Citation
Novel Therapeutic Methods for Inducing Immunomodulation: Applications to the Non-Obese Diabetic Mouse Model of Type I Diabetes

Material Information

Title:
Novel Therapeutic Methods for Inducing Immunomodulation: Applications to the Non-Obese Diabetic Mouse Model of Type I Diabetes
Creator:
SIMON, GREGORY GEORGE ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Antibodies ( jstor )
Cytokines ( jstor )
Cytometry ( jstor )
Diabetes complications ( jstor )
Gene therapy ( jstor )
Lymphocytes ( jstor )
Medical treatment ( jstor )
Splenocytes ( jstor )
T lymphocytes ( jstor )
Type 1 diabetes mellitus ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Gregory George Simon. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/31/2006

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

NOVEL THERAPUTIC METHODS FOR INDUCING IMMUNOMODULATION: APPLICATIONS TO THE NON-OBESE DIABETIC MOUSE MODEL OF TYPE 1 DIABETES BY GREGORY GEORGE SIMON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Gregory George Simon

PAGE 3

To the memory of my grandfather, Dr. Wilh elm Georg Simon, who inspired my interest in science and to whom I credit my drive to earn my Doctor of Philosophy

PAGE 4

iv ACKNOWLEDGMENTS It is with great appreciation and sincere thanks that I list here the individuals without whose tireless assistan ce and thoughtful insight this manuscript could never have been completed. I thank my mentor, Dr. Barry Byrne, especially for his broad knowledge of science and medicine. He took a chance a nd accepted me into his laboratory as an undergraduate student. He has been my insp iration professionally and a very good friend personally. I appreciate the opportunity to work on cutting-edge research in the field of gene therapy and look forward to conti nued work in this innovative field. I would also like to thank Dr. Mark At kinson, who accepted me into his laboratory when the scope of my research project shifte d. He has always been available to mentor and guide me professionally. I truly appreciate the opportunity to learn everything I could about immunology and autoimmune diabetes in his laboratory. I would like to thank all those in both Barry Byrne’s and Mark Atkinson’s laboratories who made my past few years memo rable, especially Denise Cloutier, Yoshi Sakai, Lara DeRuisseau, Ch risty Pacak, Bijoy Thattaliyath, Irene Zolotukhin, Kerry Cresawn, Cathryn Mah, Stacy Porvasnik, Sean Germain, Matt Parker, Clive Wasserfall, Todd Brusko, and Fletcher Schwartz. I appreci ate their friendship and I will greatly miss spending time with them, wherever the future may bring us. I am deeply grateful for the guidance of Todd Brusko and Clive Wasserfall, whose knowledge of immunological techniques has been invaluable for me to complete my projects. Appreciation is ex tended to the Vector Core facility and the Molecular

PAGE 5

v Pathology Core facility for th eir scientific support. I w ould also like to thank my supervisory committee members and colleagues to whom I looked to for focus and direction. Lastly, I would like to thank my parents, my brother and his wife, my sister and her family, and Larry and Diane Berman for th eir continued support through the years, especially during critical or challenging times. I send speci al thanks to all my close friends these past few years, especially, Stac y, Mario, Chris, and Sean. Their zeal for life and happiness allowed me to continue and obtain my goals.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...............................................................................................................x LIST OF FIGURES...........................................................................................................xi ABSTRACT.....................................................................................................................xi ii CHAPTER 1 INTRODUCTION........................................................................................................1 Type 1 Diabetes............................................................................................................1 Terminology of Diabetes.......................................................................................2 Natural History of Type 1 Diabetes.......................................................................3 Animal Models of Diabetes: Non-Obese Diabetic Mouse...........................................4 Immune Characteristics of Type 1 Diabetes.................................................................5 Regulation of the Immune System........................................................................5 T Lymphocyte Mediated Response.......................................................................6 T Lymphocyte Responses in the NOD Mouse......................................................6 Regulatory T Lymphocytes...................................................................................8 Cytokine-Mediated Immunity...............................................................................9 Interferon gamma...........................................................................................9 Interleukin-1 beta.........................................................................................11 Therapeutic Strategies for Type 1 Diabetes................................................................12 Insulin Replacement Therapy..............................................................................12 Pancreas/Islet Cell Transplantation.....................................................................13 Immunomodulatory Regulation...........................................................................14 Therapeutic Antibodies.......................................................................................15 Gene Therapy..............................................................................................................18 Recombinant Adeno-Associated Viral Vectors...................................................18 Basic Biology of AAV........................................................................................18 Recombinant AAV Serotypes.............................................................................19 Muscle-Directed Gene Therapy..........................................................................20 Summary.....................................................................................................................21

PAGE 7

vii 2 GENERAL METHODS.............................................................................................22 Western Blot Analysis of Protein Expression............................................................22 Large-Scale Preparation of Plasmid DNA for Packaging into rAAV Vectors...........23 Packaging of rAAV Serotype 1 Virus........................................................................25 Splenocyte Purification...............................................................................................26 Immune Profiling by Flow Cytometry.......................................................................27 Intracellular Cytokine St aining Flow Cytometry.......................................................28 CD4+CD25+ T Lymphocytes Suppression Assay.......................................................29 3 PREVENTION OF T1D BY USE OF ANTI-THYMOCYTE GLOBULIN.............31 Methods......................................................................................................................31 ATG Administration............................................................................................31 Blood Glucose Analysis......................................................................................32 Immunohistochemistry........................................................................................32 Total Lymphocyte Counting................................................................................33 Serum Cytokine Analysis....................................................................................33 Glucose Tolerance Testing..................................................................................33 Purification of Immune Cells from Sp leen and Pancreatic Lymph Nodes.........34 Splenocyte Stimulation Assay.............................................................................34 CD4+CD25+ T Lymphocyte Suppression Assay.................................................35 Flow Cytometry Analysis of Splenocytes and Pancreatic Lymph Node Cells...35 Adoptive Transfers..............................................................................................36 Results........................................................................................................................ .37 Survival Curves of In Vivo Treated NOD mice...................................................37 Total Lymphocyte Count.....................................................................................39 Flow Cytometry Analysis of CD3+ CD4+ and CD8+ T lymphocyte Populations.......................................................................................................39 Flow Cytometry Analysis of CD11c+ CD11b+ and B220+ Populations..............42 Insulitis Scoring...................................................................................................43 Glucose Tolerance Testing..................................................................................44 Splenocyte Stimulation Assay.............................................................................45 Luminex for Cytokines In Vivo ...........................................................................46 CD4+CD25+Suppression Assay...........................................................................47 Flow Cytometry Analysis of T lymphocyte Costimulatory Signal Molecules...48 Adoptive Transfers..............................................................................................50 Discussion...................................................................................................................50 Conclusions.................................................................................................................52 4 MOLECULAR CLONING OF RECOMBINANT AAV VECTORS.......................53 Construction of rAAV Vectors Expressing Chimeric Mouse Anti-MouseInterferon Gamma IgG1..........................................................................................53 Construction of rAAV Vector Expressing Soluble Type I Interleukin-1 Receptor....62

PAGE 8

viii 5 FUNCTIONAL ANALYSIS OF RECOMBINANT AAV IMMUNOMODULATORY MOLECULES..............................................................67 Western Blot...............................................................................................................67 Anti-IFN Antibody............................................................................................67 Soluble IL-1r-Ig...................................................................................................68 IFN Competition ELISA: Bindi ng Capacity of Anti-IFN Antibody...............69 IL-1 Competition ELISA: Binding Capacity of smIL-1r-Ig.............................70 Functional Ability of Imm unomodulatory Molecules to Prevent Apoptosis......70 Mixed Lymphocyte Reaction..............................................................................71 Discussion and Conclusions.......................................................................................73 6 PREVENTION OF T1D BY USE OF RECOMBINANT AAV-CBA-ANTIINTERFERON GAMMA ANTIBODY.....................................................................74 Methods......................................................................................................................74 Blood Glucose Analysis......................................................................................75 Immunohistochemistry........................................................................................75 Serum Cytokine Analysis....................................................................................75 Splenocytes Proliferation Assay..........................................................................76 Splenocyte Cytokine Assay.................................................................................76 Flow Cytometry...................................................................................................76 DO11.10 Transgenic Mice..........................................................................................77 Early Lymphocyte Activation Detection.............................................................77 Late Immune Activation Detection.....................................................................78 Results........................................................................................................................ .78 Survival Curves of In Vivo Treated NOD Mice..................................................78 Immunohistochemisty.........................................................................................80 Serum cytokine analysis...............................................................................82 Splenocyte proliferation assay.....................................................................84 Splenocyte Cytokine Assay.................................................................................85 Flow Cytometry...................................................................................................88 DO11.10 Ovalbumin TCR Transgenic Mice.......................................................88 Late Immune Activation Detection.....................................................................90 Chemokine Receptor Staining.............................................................................91 Discussion...................................................................................................................92 Conclusions.................................................................................................................96 7 PREVENTION OF T1D BY USE OF RECOMBINANT AAV-CBA-SOLUBLE INTERLEUKIN-1RECEPTOR-IG FUSION.............................................................97 Methods......................................................................................................................97 Blood Glucose Analysis......................................................................................98 Imunohistochemistry...........................................................................................98 Serum Cytokine Analysis....................................................................................98 Splenocytes Proliferation Assay..........................................................................99

PAGE 9

ix Splenocyte Cytokine Assay.................................................................................99 Flow Cytometry...................................................................................................99 DO11.10 Transgenic Mice........................................................................................100 Early Lymphocyte Activation Detection...........................................................100 Late Immune Activation Detection...................................................................100 Results.......................................................................................................................1 01 Survival Curves of In Vivo Treated NOD Mice................................................101 Immunohistochemisty.......................................................................................102 Serum Cytokine Analysis..................................................................................105 Splenocyte Proliferation Assay.........................................................................107 Splenocyte Cytokine Assay...............................................................................108 DO11.10 Ovalbumin TCR Transgenic Mouse..................................................109 Late Immune Activation Detection...................................................................110 Discussion.................................................................................................................112 Conclusions...............................................................................................................114 8 DISCUSSION AND CONCLUSIONS....................................................................115 Discussion.................................................................................................................115 Conclusions...............................................................................................................118 LIST OF REFERENCES.................................................................................................120 BIOGRAPHICAL SKETCH...........................................................................................131

PAGE 10

x LIST OF TABLES Table page 3-1 Flow cytometric analysis of CD25, CD28, CD154, and CCR5 on CD4+ and CD8+ T lymphocytes................................................................................................49 6-1 Injection scheme for immunomodulat ory rAAV therapy of NOD mice to prevent type 1 diabetes: rAAV-CBA-anti-IFN antibody....................................................75 7-1 Injection scheme for immunomodulat ory rAAV therapy of NOD mice to prevent type 1 diabetes: rAAV-CBA-smIL-1r-Ig.................................................................98

PAGE 11

xi LIST OF FIGURES Figure page 1-1 Recombinant AAV genomic structure.....................................................................19 3-1 Kaplan Meier curve for ATG treated mice..............................................................37 3-2 Total lymphocyte count............................................................................................38 3-3 Example of flow cytometric analysis of specific T lymphocyte populations after therapeutic administration........................................................................................40 3-4 Average of flow cytometric analysis of specific T lymphocyte populations after therapeutic administration........................................................................................41 3-5 Flow cytometric staining for antigen presenting cells 7 days after therapeutic treatment...................................................................................................................42 3-6 Insulitis scoring of ATG treated mice......................................................................43 3-7 Intraperitoneal gluc ose tolerance testing..................................................................44 3-8 Splenocyte stimulation assa y of ATG treated NOD mice........................................45 3-9 Serum IL-2 concentration following th erapeutic treatment of 12 week old NOD mice..........................................................................................................................4 6 3-10 Suppression assay 30 days pos t therapeutic administration.....................................47 3-11 Example of gating scheme for flow cytometry analysis of CD25, CD28, CD154, and CCR5 on CD4+ and CD8+ T lymphocytes........................................................48 3-12 Adoptive transfers experiments................................................................................50 4-1 Schematic strategy for cloning of rAAV-CBA-anti-IFN -antibody........................61 4-2 Schematic strategy for cloning of rAAV-CBA-smIL-1r-Ig.....................................66 5-1 Interferon gamma western blot................................................................................68 5-2 Interleukin-1 dot blot..............................................................................................68

PAGE 12

xii 5-3 Calculating the bind ing capacity of anti-IFN antibody..........................................69 5-4 Calculating the binding capacity of smIL-1r-Ig.......................................................70 5-5 Caspase-3 assay on -TC3 cells...............................................................................71 5-6 Mixed lymphocyte reaction......................................................................................72 6-1 Kaplan Meier for rAAV1-anti-IFN antibody treated mice.....................................79 6-2 Insulitis scoring of mice treated with rAAV1-anti-IFN antibody..........................80 6-3 Pancreatic immunostaining fo r B220 and CD3 lymphocytes..................................81 6-4 Serum cytokine concentrations................................................................................83 6-5 Recombinant AAV treated NOD mouse splenocyte proliferation assay.................84 6-6 Cytokine expression from sp lenocytes stimulation assay........................................85 6-7 Flow cytometric analysis of sp lenocytes and pancreatic lymph nodes....................87 6-8 Example of flow cytometric analysis of CD69 staining..........................................89 6-9 Average flow cytometry analysis of CD69 staining................................................90 6-10 Flow cytometric analyses of CD4+CD28+ and CD11b+MHCII+ splenocytes..........91 6-11 Flow cytometry analysis of CD3+CXCR3+ and CD3+CCR5+ T lymphocytes.........92 7-1 Kaplan Meier for rAAV1-CBA-smIL-1r-Ig treated mice......................................102 7-2 Insulitis scoring of mice tr eated with rAAV1-smIL-1r-Ig.....................................103 7-3 Pancreatic immunostaining for B220+ and CD3+ lymphocytes.............................104 7-4 Serum cytokine concentrations..............................................................................105 7-5 Recombinant AAV1-smIL-1r-Ig treated NOD mouse splenocyte proliferation assay.......................................................................................................................107 7-6 Cytokine expression from sp lenocytes stimulation assay......................................108 7-7 Example of flow cytometr y analysis of CD69 staining.........................................109 7-8 Average flow cytometry analysis of CD69 staining..............................................110 7-9 Flow cytometry analyses of CD3+CD28+ and CD11b+MHCII+ splenocytes.........111

PAGE 13

xiii Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NOVEL THERAPUTIC METHODS FOR INDUCING IMMUNOMODULATION: APPLICATIONS TO THE NON-OBESE DIABETIC MOUSE MODEL OF TYPE 1 DIABETES By Gregory George Simon December 2005 Chair: Barry J. Byrne Cochair: Mark A. Atkinson Major Department: Medical Sciences--Immunology and Microbiology Type 1 Diabetes (T1D) is characteri zed by a proinflammatory autoimmune mediated destruction of the beta cells located within pancreatic islets and results in decreased insulin production. Insulin replacement does not represent a cure for T1D; therefore therapeutic strategies have recentl y focused on disease prevention. Attempts to alter the immune response through the use of antibodies capable of manipulating the immune system, offers one attractive st rategy. A second strategy could utilize gene therapy methods to deliver genes that encode proinflammatory antagonists. This project tested whether either of these two approach es could prevent the ons et of T1D and shift the immune response away from islet destru ction using the non obese diabetic mouse model of T1D. The work presented in this disse rtation is a critical step in understanding the immune system’s role in the progress of T1D and will contribute to therapies to cure diabetes

PAGE 14

1 CHAPTER 1 INTRODUCTION This introduction discusses the manifestatio ns and immune charac teristics of type 1 diabetes (T1D). It also discusses treatmen t options and the rational for using immune modulating molecules as a possible treatment option. Type 1 Diabetes Diabetes Mellitus is a group of metabolic diseases characterized by a partial or absolute deficiency in the secretion and/or action of the anabolic hormone insulin. Insulin is a dimeric protein produced by cells within the islets of Langerhans in the pancreas and is responsible for induc ing cellular uptake and stor age of glucose from the bloodstream. In response to rising blood gluc ose levels, secretor y granules within cells release preformed insulin. The insulin then bi nds to and stimulates glucose transporters located on the surfaces of muscle and fat cells . Upon insulin activation, these transporters facilitate the movement of glucose across th eir respective cell membranes. Therefore, any disruption in this metabolic process, either by inefficiency or a deficiency in insulin, will disrupt the necessary homeos tasis of blood glucose levels, leading to the common symptoms of diabetes mellitus (1, 2). An estimated 120 million people worldwide suffer from diabetes mellitus, with 10 to 15% of these cases classified as T1D. The frequency of T1D ranges from a low of 1 case per 100,000 individuals per year in regions of China and India, to a high exceeding 50 cases per 100,000 persons in certain area s of Finland. In the United States,

PAGE 15

2 approximately 20 million people have been diag nosed with diabetes, with more than 1 million thought to be T1D (1, 3). Most of the long-term complications of T1D fall into four groups: cardiovascular disease, nephropathy, retinopathy, and neuropath y. According to the la test statistics from the National Institute of Diabetes and Dige stive and Kidney Diseas es (NIDDK), coronary heart disease is the leading cause of diabetes -related deaths, accounting for approximately one-half of the deaths in T1D patients. Each y ear, diabetes represents the leading cause of end-stage renal failure, new cases of blindne ss each year, and lower-limb amputations in the United States. Also, persons with diabetes are more susceptible to bacterial and viral infections, strokes, high blood pressure, and pe riodontal disease (4). Given the number of complications associated with diabetes, it is not surprising that pe ople afflicted with T1D have a 33% reduced life expectancy (3). Terminology of Diabetes While a formal classification system fo r diabetes was not established until 1979, distinctions among various degrees of the dis ease were made as early as the nineteenth century. Before the isolation of insulin in th e 1920s, patients sufferi ng from diabetes were diagnosed as having either of two types, base d solely on the age of the onset of symptoms (2). Patients becoming symptomatic during ch ildhood were classified as having juvenile diabetes. This type of diabet es was considered more severe , and led to almost-certain death within 1 year of diagnosis . In contrast, patients afflicte d with diabetes later in life were diagnosed as having adul t-onset diabetes. This form of the disease was usually not immediately life threatening and could be trea ted with a combination of diet, exercise, and hypoglycemic agents.

PAGE 16

3 After the introduction of exogenous insulin as a treatment, further classification of diabetes mellitus was further classified based on the varying requirements for insulin. As a result, diabetic patients were described as having either an insulin-dependent (IDDM) or non-insulin dependent (NIDDM) form of the disease (1, 2). Although the basis for classification became more pathologic, timing of onset was a key factor in classifying the severity of disease. Classification of diabetes mellitus was further refined, favoring a system based on the underlying pathogenesis of the disease ra ther than on age of onset or insulin requirement. The new system established by the American Diabetes Association (ADA), the NIDDK, and the Centers for Disease Cont rol and Prevention (CDC), uses T1D in place of IDDM and T2D in place of NIDDM (5). While hyperglycemia is the end result of all types of diabetes mellitus, distinct pathogenic mechanisms underlie each form. Pe rsons with T1D often exhibit many of the hallmarks of an autoimmune disorder, such as the presence of auto-antibodies and genetic susceptibility associated with genes of th e major histocompatibility complex (MHC). Their insulin deficiency is due directly to cell destruction and is usually absolute. Natural History of Type 1 Diabetes Because of the rapid onset of its common manifestations, T1D was once considered a disease triggered by an acute pathogenic process, such as an acute viral infection (6). However, research provided strong eviden ce supporting a different concept involving rapid onset of symptoms afte r an extended period of au toimmune destruction (7). Autoimmunity results from the loss of tolerance to self-molecules (or antigens) by the immune system. In T1D, the insulin-producing cells of the pancreas are the self-

PAGE 17

4 molecules that are slowly dest royed by the host’s immune syst em. Once a certain level of cell destruction is reached (estimated at 50 to 80%) the classic symptoms of hyperglycemia and ketosis appear (8). Patients in the clinical phase (post-symptomatic) of the disease require daily in sulin administration in order to return to marginally normal blood glucose homeostasis (9). Animal Models of Diabetes: Non-Obese Diabetic Mouse The non-obese diabetic (NOD) mouse is a well-established mouse model of human T1D. Developed by Makino et al. (10) in the late 1970s, the NOD mouse spontaneously develops hyperglycemia between 12 to 18 w eeks of age, and show ed immunological and clinical features of the human form of the di sease, such as infiltration of the endocrine pancreas by autoreactive mononuclear cells, followed by the onset of hyperglycemia (11). The course of islet destruc tion has been well characteriz ed in the NOD mouse. By 5 weeks of age, these mice begin to show signs of insulitis (12). By 10 weeks of age, they show considerable insulitis and a complex myriad of imm une infiltrates; mostly CD4+ T lymphocytes, but also CD8+ T lymphocytes, dendritic ce lls (DC), and B lymphocytes (13). At 18 weeks of age, e ssentially all of female and male NOD mice show signs of lymphocytic infiltration in the pancreas, but only 60 to 80% of females and 15 to 20% of males become overtly diabetic mice by 30 week s of age (9). Environmental factors have also been shown to influence the incidence of T1D (including the conditions in which the mice are housed). Incidence of disease is highe r when mice are maintained in a relatively germ-free environment, but decreases dramatically when mice are maintained in conventional housing facilities (14). The reason for this is unclear, but it is believed that

PAGE 18

5 the immune system, under so-c alled “dirty” conditions, dir ects its actions to exposing foreign proteins, and protects the individual animal’s autoimmunity. However, when the environment is clean the inherent dysregulati on in which the immune system attacks self antigens operates relatively unoppos ed, resulting in T1D (15). While T lymphocyte responses appear to be the leading cause of immune-mediated cell destruction in the NOD model, other immune cells may play a role in the development of T1D. These include defec tive macrophage maturation and function (16), low levels of natural killer (NK) cell activity (17, 18), def ects in NKT cells (19, 20), and deficiencies in regulatory CD4+CD25+ T lymphocytes (21). Immune Characteristics of Type 1 Diabetes Pancreata from patients recently diagnosed with T1D show a similar degree of cell destruction; however, any intact islets remaining contain a large inflammatory infiltrate. The infiltrate (commonly referred to as insulitis) consists primarily of CD4+ T lymphocytes with fewer numbers of CD8+ T lymphocytes, macropha ges, B lymphocytes and NK cells (22). The next section discusse s immune processes involved in destruction of the cells leading to T1D. Regulation of the Immune System An autoreactive T lymphocyte repertoire is a natural component of a healthy immune system. However, a complex regulatory system closely contro ls the activation of these self-reactive lymphocytes (23). At the center of this control circuit are immune regulating molecules known as cytokines. Cy tokines are low-molecu lar-weight proteins that regulate the immune response by exerti ng a variety of effects on lymphocytes and other immune-system cells (24) . Most cytokines are produced by two distinct subsets of CD4+ T lymphocytes, T helper 1 (T h1) and T helper 2 (Th2) cel ls (25, 26). Cytokines can

PAGE 19

6 counter-regulate development of the opposing ce llular subset, there by enhancing a cellmediated or antibody-mediated immune response (24, 27). T Lymphocyte Mediated Response Based on their pattern of cytokine produc tion and their functi onal responses, T lymphocytes are subdivided into those partic ipating in cell-media ted immune responses such as inflammation, delayed type hypersen sitive reactions, and macrophage activation (Th1 subset); from those releasing cytoki nes that induce B lymphocytes to secrete antibodies (Th2 subset). Since the original definition of the Th1/Th2 clones, several additional cytokines have become associ ated with each subset, such that Th1 lymphocytes are defined by their pr oduction of interferon gamma (IFN ) and tumor necrosis factor alpha (TNF,), while Th2 lymphocytes prod uce interleukin (IL)-4, IL-5, IL-10, and IL-13 (28, 29). A third CD4+ T lymphocyte subset, called T re gulatory (Treg) lymphocytes, is described in a variety of di fferent priming conditions. This CD4+ T lymphocyte subset constitutes 5 to 10% of peripheral CD4+ T lymphocytes and is cap able of inhibiting the responses of CD4+CD25– and CD8+ T lymphocytes in vitro and in vivo (30). The CD4+CD25+ FoxP3+ regulatory T lymphocytes play a major role in maintaining immune tolerance to self and in controlling autoimmunity (31). Treg lymphocytes inhibit autoimmunity in a number of experimental mo dels, including T1D (32). They have been shown to prevent onset of autoimmunity by be ing involved in regula tion of effector T lymphocyte homeostasis. T Lymphocyte Responses in the NOD Mouse Cytokines’ role in the progression of T1D has been studied extensively in the last decade. The CD4+ T lymphocytes are essential both ear ly and late in disease development

PAGE 20

7 and act directly in immune-mediated dest ruction of islets in the NOD mouse (33). However, destruction of the islet is not solely a CD4+ T lymphocyte mediated process. Mathis et al. (34) have demonstrated that CD8+ T lymphocytes also contribute to islet destruction. NOD mice show unique cytokine producti on profiles that may alter Th1/Th2 lymphocyte polarization. A number of studies have shown that antigen presenting cell (APC) populations from NOD mice may produce an array of cytokines that promote Th1 responses (when compared to other strains of mice), including in creased expression of IL-12 (35) and IFN (36). Activation capabilities of the T lymphocyte repertoire are critical in the formation of an autoimmune reaction. Regulating costim ulation of naive T lymphocytes plays an important role in preventing autoimmune responses. Costimulation of secondary signaling molecules, CD28/B7, have been s hown to be an important mediator of autoimmune T lymphocytes responses (37). However, analysis with CD28 knockout NOD mice identified a selective defect in the number and function of CD4+CD25+ regulatory T lymphocytes (38). Other costimulat or molecules identified as being critical in the development of T1D include CD152 (39), CD140 (40), and CD154 (41). Not all costimulatory molecules are deleterious. Experiments w ith inducible costimulatory molecule (ICOS) (42) and programmed death-1 (PD-1) (43) showed these molecules help prevent autoimmunity. T lymphocyte trafficking between the panc reatic lymph nodes and the pancreas are a critical aspect in understanding the initiati ng events associated with the development of T1D. The development of insulitis and progression to overt T1D correlates with

PAGE 21

8 expression of multiple chemokine/chemokine receptors including: monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1 (MIP-1 ), MIP-1 , CCR5, RANTES, MCP-3, MCP-5, and IFN-i nducible protein-10 (IP-10) (44). Regulatory T Lymphocytes More recently, regulatory CD4+CD25+ T lymphocytes have been investigated as a primary cell involved in the immune system ab ility to prevent the onset of T1D. In terms of effector function, it appear s that naturally occurring Treg lymphocytes in the immune system produce IL-10 and IL-4 to mediate thei r suppressive activity of autoimmune cells. In addition to this, Treg lymphocytes are able to interfere with APC-effector T lymphocyte engagement and weaken the eff ector T lymphocyte activation, leading to antigen specific anergy. The NOD mouse may have a generalized defect in their ability to generate effective numbers of Treg lymphocyt es. The percentage of Treg lymphocytes is approximately half that of other autoimmune resistant strains of mice (45). Alternatively, recent data suggests that the ability of CD4+CD25+ Treg lymphocytes’ ability to suppress in NOD mice is time dependent within the autoimmune response and to suppress CD4+CD25T effector lymphocytes is time dependent (46). Therefore, to initiate a true therapy for the prevention of T1D, it ma y be necessary to control T lymphocyte responses by reducing the effector T lym phocyte response while increasing the Treg lymphocyte response. Experiments with polyc lonal T lymphocyte deactivators such as anti-CD3 antibody (47) and low dose of nomina l antigen (48) have been shown to induce the development of CD4+CD25+FoxP3+ T lymphocytes in normal and NOD mice and reduce the incidence of T1D onset.

PAGE 22

9 Cytokine-Mediated Immunity Cytokines are a group of low-molecular-wei ght regulatory molecules that are the main mediators of signaling between cells in the immune response. The importance of cytokines in the development, maintenan ce, and regulation of the immune response cannot be understated. These molecules regu late facets from lymphocyte activation and deactivation, to trafficking of immune cel ls to sites of infection. The physiological function of individual cytokine s is, however, extremely comp lex. A particular cytokine may either activate or deactivate cells of th e immune system, depending on the time of expression and concentration at a specific st age of the immune response. Other factors that influence the degree of immune activ ation include cytoki ne receptor binding efficiency, the degree of redundancy, pl eiotropy, synergy, and antagonism between different cytokines (49). In the following sections, the importance of two cytokines involved in the development of autoimmune T1D, IFN and IL-1 , will be discussed. Interferon gamma IFN is a cytokine produced primarily by activated CD4+ Th1 lymphocytes, CD8+ T lymphocytes, and NK cells. IFN is recognized as chief mediator of innate as well as adaptive immunity (50). Among th e biological activities of IFN , activation of macrophages is considered of key importance. Interferon gamma has been shown to have multiple proinflammatory effects such as upr egulation of IL-12 (51), IL-15 (52), TNF (53), inducible nitric oxide s ynthase (iNOS) (54), caspase-1 ( 55), and IL-6 (56). In accord with these functional characte ristics, bioactivity of IFN has been identified as a prerequisite in several models of inflammato ry and autoimmune dis eases, including T1D. Interferonhas been shown to be a major mediator of induced islet cell death in mice. It has also been shown that IFN is cytotoxic to cells in vitro (57). In experiments with

PAGE 23

10 non-diabetes-prone IFN transgenic mice, overexpression of IFN in cells resulted in a progressively severe insulitis, cell destruction, and accele rated diabetes onset (58). Further experiments suggest it is an autoimmune response, because the IFN transgenic mice, when backcrossed to severe combin ed immunodeficient (SCID) mice, lacking lymphocytes, did not develop diabetes. Also MHC compatible islets grafted into IFN transgenic mice were rejected and the IFN transgenic mice developed circulating lymphocytes specifically cytotoxic to the engrafted islets (59). These IFN transgenic mouse studies establish that the normal m ouse repertoire contains islet specific T lymphocyte, which become activated to is let antigens in the presence of IFN , produced locally in the islet. These effects can be reve rsed with the administration of either antiIFN monoclonal antibodies or soluble IFN receptors (sIFN R) (60); factors that reduced lymphocytes infiltration to the isle ts and protected the mice from onset of disease. However, recent experiments have shown that IFN may be necessary in preventing T1D. This counter intuitive fi nding came from experiments involving IFN ’s functional characteristics that show an ti-inflammatory actions which include downregulation of monocyte chem otaxis (61), induction of CD8+ suppressor T lymphocytes (62), and induction of T lymphoc yte apoptosis (63). Experiments with IFN knockout mice did not prevent either insulitis or T1D in the NOD mice, but it did increase the time to onset (64). Further experiments by Sobel et al. (6 5) have shown that injections of (r)ecombinant IFN in a dose dependent fashion, inhibi ted the development of T1D. The

PAGE 24

11 maximal rIFN dose decreased the incidence of diabet es from 74% in control animals to 42%. The expression of the costimulatory mol ecules B7-2 and CD54 were significantly increased in splenocytes of rIFN treated mice, while the expression of MHC class I was decreased. Other experi ments show that IFN is necessary for blockade of CD28 and CD40 T lymphocyte costimulation (66). The lack of IFN not only affects the stimulatory f unction of T lymphocytes, it also influences the ability of these cell s to traffic in the body. Indeed, IFN influences immune and autoimmune responses by supporting the homing of activated T lymphocytes. Experiments by Chervonsky et al. (67) showed that adhesion of insulin-specific CD8+ lymphocytes to microvasculature was normal in IFN knockout mice, yet diapedesis was significantly impaired. This effect was revers ible by treatment of the animals with rIFN . Further evidence also suggests the presence of IFN may be required for the formation CD4+CD25+ T lymphocytes. Mice challenged with donor alloantigen showed a 5-fold increase in IFN mRNA expression in Treg lymphocytes, but not effector T lymphocytes, within 24 hours of re-encountering alloantigen in vivo . In addition, the generation and function of alloantigen-reactive Treg lymphocytes was impaired dramatically in IFN deficient mice (68). Interleukin-1 beta Interleukin-1 is a pleiotropic cytokine whose in vivo functions include induction of the acute-phase response to inflammation. IL-1 is also an endogenous pyrogen, induces the synthesis of othe r proinflammatory cytokines, including the hepatic acute phase protein inducer, IL-6, alters food intake , and promotes the wasting of lean tissue (69). IL-1 acts on a variety of tissue types throu gh binding to two independent classes of

PAGE 25

12 IL-1 receptors. Although the two IL-1 receptors are independent gene products, they both belong to the immunoglobulin super family and their extracellular domains are structurally similar (70). The distribution of IL-1 type I a nd type II receptors on various tissue types differs markedly. Type I recepto rs are found on most cell types including Tlymphocytes, endothelial cells and hepatocyte s, whereas type II receptors are limited primarily to blood neutrophils, monocyt es, bone marrow progenitor cells and Blymphocytes (71). The intracellular portion of the type II receptor is truncated and recent in vitro studies suggest that IL-1 binding to the type II recept or does not result in signal transduction. IL-1 induces the production of NO by islets, and there is evidence to support a role for NO in T1D development. The incidence of diabetes induced by injections of multiple low-dose streptozotocin is reduced in iNOS de ficient mice (54). Nitric oxide production may not be the only mechanism by which cytokines damage cells. IL-1 stimulates CD95 death receptor expression by cells in vitro , and CD95 activation has been implicated in cell death caused by T lymphocytes in the NOD mouse (72). Therapeutic Strategies for Type 1 Diabetes At present, there are two ways people w ith T1D are treated, insulin replacement therapy and pancreas/islet ce ll transplantation. Each has a dvantages and disadvantages which will be discussed in the following section. Insulin Replacement Therapy The isolation of insulin in 1921 and its subs equent use as a treatment for diabetes mellitus has dramatically reduced the once acute-m ortality of the disease, particularly in type 1 disease. However, the extensive list of chronic complications associated with the disease combine not only to enhance morb idity, but also to cause accelerated and

PAGE 26

13 premature mortality, still mani fest even with insulin ther apy. Chronic complications of diabetes result from the loss of glucose homeostasis and usually develop 10 to 15 years after the onset of symptoms. Pancreas/Islet Cell Transplantation Transplantation of pancreas or purified islet cells have shown the potential to restore islet cells the insulin secretory responses to metabolic needs, correct glucose homeostasis, and thus limit the incidence a nd severity of the degenerative complications that are commonly seen in diabetic patients on insulin treatment (73). Over the past 20 years, the surgical procedures for whole-pancreas transpla ntation have remarkably improved. This technique can now be perfor med with one-year success rates that are close to those for kidneys alone or for other solid organs. Pancreas graft su rvival after 1 year is 82, 74, and 76% when the organ is implanted after the kidney, simultaneously with the kidney, or alone, respectively. The majority of one year-surviving grafts maintain functioning cells for a decade (74). Pancreas graft survival is almost invariably associated with normalized glucos e levels and states of insulin independence, which also improve the quality of life for the recipients. However, these benefits do not occur without risks. First, the surgical proce dure is still tec hnically cumbersome and associated with a high morbidity. Moreover, the need for chronic immune suppression carries the same infectious and tumorigenic risks as other organ transp lantations. The decision for pancreas transplantation is therefore usually delayed until late in the course of T1D when renal failure raises the need for a kidney graft. At this la ter stage, simultaneous implantation of a pancreatic organ will not bring a major benefit in terms of prevention of secondary complications, as these are already advanced to an irre versible level (75).

PAGE 27

14 Islet transplants have long since b een proposed as a safer alternative to whole-organ transplants. Studies in rodents have demonstrated that islet grafts can be implanted in different sites using simple techniques. In several models they correct T1D, rapidly and for extended periods (76). For many year s, none of these promising features could be reproduced in T1D patients. The reasons were probably multiple, ranging from technical difficulties in preparing viable and metabolica lly adequate grafts, to biologic obstacles of inflammatory and immune nature. Over the years, progress has been made in the isolation of human islet tissue and its use in autoand allo -transplantations . Human islet grafts were shown to correct T1D in patients who had received a donor kidney prior to, or simultaneously with, the islet graft (77, 78). This gain in safety is, however, associated with a less favorable do nor-to-recipient ratio. In the recently successful series of islet transplantations by the Edmonton group (showing 90% restoration of euglycemia at 1 year post transplantation), metabolic co rrection required islet preparations from 2 to 4 pancreata that were procured under optimized conditions (79). The shortage in donor organs, and in partic ular those that are procured under the better conditions, is currently a major limitation to the clinical future of islet cell tran splantation. This combined with the same immune problems of reject ion that plague whole pancr eas transplantation, make the future use of islet transplantation difficult to conceptualize as a mass answer to a major therapeutic need. Immunomodulatory Regulation The ideal therapy for T1D, rather than trea tment after onset, would be to prevent or limit islet destruction prior to overt disease. To accomplish this, it would be necessary to manipulate the immune response against the is let cells. Operationall y, this would mean the establishment of immunological tolerance in a mature immune system; in other

PAGE 28

15 words, a state of durable antigen-specific unresponsiveness in the absence of generalized immune mediated islet destruction. Therapeutic Antibodies Recently, the use of recomb inant antibodies in the treatment of T1D in the NOD mouse has shown considerable promise. An tibodies directed against lymphocytes or molecules specific to the surface membrane have been instrumental to this effect. These antibodies potentially suppress T ly mphocyte activation that would lead to rapid islet destruction, while allowing formation of Treg lymphocytes that needed for long-term islet survival in the absence of a sustained immunosuppres sive therapy. Most successes in animals have been obtained after nonspecific depletion by to tal lymphoid irradiation, anti-lymphocyte/anti-thymocyte antibodies (80), or after specific monoclonal antibody therapy such as an ti-CD3 antibody (81); associated with a transi ent fall in lymphocyte count. However, administration of m onoclonal antibodies that block activation of T lymphocytes at the level of the IL-2 receptor (82) or costimulatory signals such as CD154 (83), may also allow for efficient suppression of the destructive process without lymphocyte depletion. Other approaches that have seen success have focused on the modulation of cytokine signa ling between immune cells in cluding the administration of monoclonal antibodies that block IFN (83) and IL-12 (84). In addition, the use of soluble receptors has shown similar abilities as monocl onal antibodies to modulate cytokine levels and prevent T1D in the NOD mouse. For example, previous experiments with soluble IL-1 receptor (85), soluble IFN receptor (60), and soluble TNF receptor (86) have shown promising results. In addition to the use of monoclonal anti bodies and soluble receptors, the use of polyclonal antibody preparations has been show n to regulate autoimmune T1D. The use

PAGE 29

16 of anti-thymocyte globulin (ATG) to deplete lymphocytes in vivo is well established and has been used in transplantation research for over 40 years (87). Anti-thymocyte globulin induces a rapid and profound lymphocytopenia classically attributed to several mechanisms such as co mplement-dependent cytolysis, cell-mediated antibody-dependent cytolysis, as well as ops onization and subseque nt phagocytosis by macrophages (88). It has also been suggest ed that ATG recognizes and cross-links multiple cell surface receptors and co-stimulator y molecules on T lymphocytes leading to weakened activation and anergy (89). Since th e demonstration of efficacy for ATG, many applications have been investigated a nd applied to medical use including renal transplantation (90), graft vers us host disease (91), and aplastic anemia (92). Rabbit ATG (rATG) used for experiments in mice is pr epared by immunizing rabbits with pooled lymph node cells prepared from NOD, C3 H/He, DBA/2, and C57BL/6 mice (93). More recently, the use of ATG (or like agents) has been investigated in the prevention and treatment of T1D in the NOD mouse (53, 94). Ma kino et al. (95) showed that the antilymphocyte serum (ALS) could be used in NOD mice. The incidence of T1D was greatly reduced in female mice following intravenous injection of ALS co mpared to control mice. However, little is known about the physiol ogical functions of ATG and the specific target molecules the antibodies recognize. Several studies have been conducted which show that ATG affects a wide range of im mune cell types, producing antibodies against many different cell surface molecules (96). The ability of ATG to down modulate T lymphocyte responses is a key role in eff ectiveness as an immunomodulatory therapy. Experiments by Michallet et al. (96) showed that ATG contains f unctional antibodies to

PAGE 30

17 CD11a/CD18 (leukocyte functionassociated antigen-1 [LFA-1]) which down-modulates cell surface expression of this 2 integrin on lymphocytes, m onocytes, and neutrophils. Additional studies shown that ATG contains antibodies specific to CD49d/CD29 (VLA4), 4 7 integrin, CD50, CD54, and CD102; but not to CD62L. Anti-thymocyte globulin also binds to CXCR4 and CCR7 on lym phocytes, and CXCR4, as well as CCR5 on monocytes. This binding has been shown to down-modulate cell surface expression of CCR7 and decrease the monocyte chemotac tic response to CCL5 (RANTES) and lymphocyte chemotactic response to CCL19 (MIP-3 ), greatly reducing the ability of lymphocytes to traffic in vivo . In addition to affecting T lymphocytes, AT G has been shown to induce apoptosis in B lymphocytes and plasma cells. Binding of ATG was observed ag ainst numerous B lymphocyte surface proteins including CD 30, CD38, CD95, CD80, and HLA-DR (97). Anti-thymocyte globulin is also able to bind and interfere in DC function. ATG bound to DC at least in part by recogni zing CD1a, MHC I, MHC II, CD11a, CD86, CD32, CD11b, CD29, and CD51/61 (126). This bi nding was more relevant in mature DCs, and initiated induced complement-media ted lysis. In mixed lymphocytes reaction (MLR) assays, ATG was able to significan tly inhibit T lymphocyte proliferation by binding on them but not on DCs, implyi ng ATG affects DC activation but not proliferation (126). The ability for ATG to interfere in the act ivation, trafficking, a nd proliferation of T lymphocytes, as well as the ability to bloc k B lymphocyte and DC function make it an effective method for inhibiting the devel opment of autoreactive immune responses.

PAGE 31

18 Gene Therapy Gene therapy offers the opportunity to deliver immunomodulat ory proteins via a single dose whose transgene provides life long expression of therapeutic protein. There are many different methods to deliver tran sgenes, including both viral and non-viral methods. Each method has advantages and disadvantages. The following section will discuss one such vector, the recombin ant adeno associated virus (rAAV). Recombinant Adeno-Asso ciated Viral Vectors Adeno-associated virus ( AAV) is a member of the dependovirus genus of the Parvoviridae family of small DNA animal viruses. As a dependovirus, AAV requires helper virus such as adenovirus, herpes vi rus or vaccina for a productive viral lytic infection (98). In th e absence of a helper virus, AAV establishes a latent infection preferentially integrating into human chromo some 19 at a specific location called the AAVS1 site (99). The long-term latent pha se has made AAV an appealing vehicle by which to deliver recombinant gene products in vivo . Other critical characteristics of AAV contribute to its appeal as a gene therapy vector. It was de monstrated that AAV infection in humans results in the abse nce of any pathological cons equences and no evidence of disease has been attributed to it. AAV can in fect both dividing and quiescent cells and it has a broad host and tissue tropism (100) . While the cloning size is limited to approximately 4.7 kilobases, this vector is id eally suited for delivery of small transgenes such as cytokines (101). Basic Biology of AAV The AAV genome consists of 2, 145 base pair inverted terminal repeats (ITR), and 2 overlapping reading frames that encode Rep and Cap proteins. Rep transcripts are produced from the p5 and the p19 promoters. These encode for Rep 78 and 52 proteins.

PAGE 32

19 Alternative splicing of both transcripts allows for the translation of smaller Rep proteins, Rep 68 and 40. Rep 78 and 68 complete DNA exci sion and replication functions that are necessary for the lytic phase of the viral life cycle. Two alte rnatively spliced transcripts are transcribed from the p40 promoter. They encode the th ree viral capsid proteins (VP1, VP2, and VP3). The proteins VP2 and VP3 are tr anslated from the same transcript using different initiation sites (98, 102). These proteins are provided in trans when rAAV vectors are produced. Figure 1-1. Recombinant AAV genomic structure. A) Genomic structure of wild type AAV. B) rAAV vector with rep and cap genes removed and replaced with transgene. Recombinant AAV Serotypes As the field of AAV gene therapy has adva nced, so too has the number of different serotypes and favored tissue tropisms. As of October 2004, 8 distinct AAV serotypes have been isolated from primates, with 7 being distinct serotypes based on antibody cross-reactivity studie s (103, 104). Pseudotyping has become the standard approach to generating alternativ e rAAV serotypes using the gene expression cassette with rAAV serotype 2 (rAAV2) ITRs in the capsid of the alternative serot ype. Pseudotyping is a

PAGE 33

20 favorable approach to creating rAAV, as th ere is more experience and information concerning the safety, chromosomal integrati on efficiency, and specificity with rAAV2 ITRs in animal models and humans (105). Ma ny studies have prove n the efficaciousness of psudotyped vector expression. Studies have been performed to compare transgene expression levels in specific tissues from different serotypes cro ss-packaged with AAV2 ITRs. For example, serotype1 has been show n to be far more efficient at muscle transduction than serotype 2 (106). Equally important is that is was observed that transgene expression from an rAAV1 vector was seen 1 week post injection, 3 weeks earlier and at levels two logs higher than rAAV2 (107, 108). Muscle-Directed Gene Therapy The advantage of muscle directed transduc tion for secreted proteins over targeting other organs is that that skeletal muscle is highly vascularized a nd efficient at protein production and secretion (109, 110) . However, several studies demonstrated formation of antibodies to the transgene after intramus cular factor 9 (FIX) rAAV delivery (111, 112, 113). The risk for such immune responses depe nds on the route of vector administration, vector dose and serotype (114). In experi ments, studying FIX, mice showed either complete absence or only a transient (in the first two months after vector administration) anti-FIX formation following rAAV1 gene transf er at high doses to skeletal muscle (111, 115). Because of the increased expression leve ls of rAAV1, the tota l number of vector genomes necessary to obtain a therapeutic eff ect on the order of two to three logs lower then rAAV2 (111, 116). This decreased dosag e results in a decrease anti-AAV capsid antibody titer (117).

PAGE 34

21 Summary The potential of immunotherapy for pr evention and treatment of autoimmune disease can provide a powerful tool for people suffering from such disorders. Clinical evaluation of a number of treatments is unde rway. However, the complexities of immune responsiveness in autoimmune disease are multifaceted and temporally complex. To understand the potential of such therapies, we focused on two specific aspects of immune response in autoimmune T1D; cytokine me diated activation and lymphocyte mediated destruction. One of the proposed methods, cy tokine mediated immunomodulation, uses a gene therapy based approach: rAAV-mediated delivery of soluble IL-1 receptor IgG fusion protein and anti-IFN antibody to the muscle. Both are designed to achieve systemic reduction of proinflammatory cytoki nes. The second method utilizes polyclonal ATG. We investigated the potential for and consequences, both forms of treatment in an in vivo NOD model of inflammatory and autoimmune disease. These findings provide us with both a new appreciation for the potential of cytokine and T lymphocyte modulation by protein and gene therapy methods to re gulate immune responses and may, in the future, lead to treatments for autoimmune T1D.

PAGE 35

22 CHAPTER 2 GENERAL METHODS Many methods were used in the experiments presented in this dissertation. In this chapter, general procedures are described in si gnificant detail to enable researchers to use the experiments presented. Any modifications to these procedures are explained in the ensuing chapters. In addition, molecular cloning methods are included in Chapter 4. Western Blot Analysis of Protein Expression Protein to be run on for We stern Blot was denatured at 100C for 5 minutes. Then 100 nanograms (ng) of protein was load ed onto a precast 10% Tris/Glycine polyacrylamide gel (Invitrogen; Carlsbad, CA ) along with a broad range protein marker The gel was run in an electrophoresis apparatus (BioRad; Hercules, CA) for 2 hours at 110 volts in 1X SDS running buffer (1.5 M TrisHCl / 0.4% Sodium Dodecyl Sulfate (SDS), pH 8.8). The gel was then transferred onto a nitrocellulose membrane and placed in between two pieces of filte r paper and 4 sponges. It was then placed a transfer box and placed back into the electrophoresis apparatus. The transfer was run at 25 volts for 1.5 hours in transfer buffer (200 mL me thanol, 1.45 g Tris, 7.2 g Glycine, H20 to 1 liter). The nitrocellulose paper was removed and wa shed with blocking solution (1x phosphate buffered saline (PBS), 0.1% Tween20, 5% nonfat dry milk) on a shaker at 75 revolutions per minute (rpm) overnight at 4C. The next morning the buffer was poured off and the membrane was washed 3 times with PBS/Tw een20 for 10 minutes on a plate shaker at room temperature. After the final wash, th e primary antibody, diluted in 10 mL of blocking buffer, was applied to the membra ne. After one hour incubation, the membrane

PAGE 36

23 was washed 3 times again with PBS/Tween20. After the third wash, 1 L of secondary horse radish peroxidase (HRP) antibody dilute d in 10 mL of blocking buffer was applied to the membrane at incubated at room temperature on a shaker for 30 minutes. The secondary antibody was then poured off a nd washed 3 times with PBS/Tween20. The membrane was then placed on a piece of saran wrap and blotted dry with filter paper. The ECL developing solution (Amersham; Uppsal a, Sweden) was applied (2 mL solution A and 50 L solution B) and incubated in the da rk at room temperature for 5 minutes. The membrane was then blotted with another pi ece of filter paper to dry and the membrane was wrapped in saran wrap. The membrane was then brought to the dark room and developed using x-ray film. Large-Scale Preparation of Plasmid DNA for Packaging into rAAV Vectors A loopfull of bacterial glycerol stock c ontaining plasmid DNA was inoculated into a 1 liter flask containing Luria-Bertani (L B) broth with 100 g/mL (amp)icillian and incubated in 37C shaking at 200 rpm incuba tor overnight. The next morning the cells were pelleted cells at 4000 (4K) rpm, 4 C for 30 minutes. The broth was poured off and the cells were resuspended in 10 mL of ly sozyme buffer (25 mM Tris/Cl pH 7.5, 10 mM ethylenediamine-tetra-acetic acid (EDTA) , 15% sucrose). After transferring the suspension to a new bottle, the original bottle was washed out with an additional 10 mL of lysozyme buffer and transferred to the ne w bottle for a total combined volume of 20 mL. Next, 4 mL of lysozyme (12 mg/mL in lysozyme buffer) was added and incubated on ice for 5 minutes. Then, 48 mL of 0.2 N NaOH-1% SDS was added and mixed with a pipette. After a 10 minute incubation on ice, 36 mL of 3 M Na-acetate buffer, pH 4.8 was added followed by 0.2 mL of chloroform and mi xed again with a pipette. The tube was

PAGE 37

24 incubated on ice for 20 minutes and then centrifuged at 9K rpm, 4 C for 20 minutes. The supernatant was then transferred to a fresh bottle by straining (using gauze) and 33 mL of 40% polyethylene glycol was added. After 10 minutes of incubation on ice, the tubes were centrifuged at 9K rpm at 4 C for 10 minutes. The supernatant was discarded and the pellet was dissolved in 10 mL of H20 followed by 10 mL of 5.5 M LiCl. After incubation on ice for 10 minutes, the tubes were again centrifuged at 9K rpm, at 4 C for 10 minutes. The supernatant was then transferred in e qual amounts into two 50 mL conical tubes and 6 mL of isopropanol was added to each tube. After a 10 minute incubation at room temperature, the tubes were centrifuged at 4K rpm at room temperature for 20 minutes. The supernatant was discarded and the tube s allowed to air dry. The pellet was the dissolved into 3.7 mL of TE (10 mM Tris/0.1 mM EDTA buffer, pH 7.4) buffer. For each conical tube, 4.2 g of CsCl and 0.24 mL of et hidium bromide (10 mg/mL) was added and mixed to dissolve the CsCl. The solution was then transferred the into a 4.9 mL OptiSeal centrifuge tube (Beckman; Fullerton, Ca). The tube was topped off with TE buffer to make sure there were no air bubbl es. The tubes were placed in a NVT90 rotor and placed into a Beckman ultracentrifuge. Th e tubes were then centrifuged at 55K rpm for 18 hours. The next day, the lower plasmid band was removed with a needle and an 18 gauge syringe and placed into a 15 mL conical tube . An equal volume of isoamyl alcohol was added to the tube and vortexed to mix. Afte r a 5 minute centrifugation at 4K rpm, the organic phase was discarded. This was re peated until the solution contained no pink coloration (approximately 4 extractions). The bottom layer was then transferred into a 50 mL conical tube, and 2.5 volume of H2O was added followed by 2 of the combined

PAGE 38

25 volumes with 100% ethanol (EtOH). The tube was then mixed by swirling and incubated on ice for 30 minutes. Next, the plasmid DNA was centrifuged at 10K rpm for 15 minutes at 4 C. The supernatant was discarded and the pellet was resuspended in 1 mL TE buffer. To the tube containing the dissolved DNA, 500 L of phenol-chloroform was added, vortexed, and centrifuged for 5 minutes at 4K rpm. The top aqueous layer was transferred to a new tube. This was repeated once more with phenol-chloroform and then once with only chloroform. After the final extraction, 1/10 the solution volume of 3 M Na-acetate and two times the solution of 100% EtOH was added to the tube and mixed gently. The precipitated DNA was then pelleted for 5 mi nutes at 2K rpm. The supernatant was discarded and the pellet was washed with 75% EtOH. After pelleting the DNA for an addition 5 minutes at 2K rpm, the supern atant was removed and the DNA was air dried for approximately 10 minutes. The pellet was then dissolved in 1 mL of TE buffer and the DNA concentration was calcula ted using a spectrophotometer. Packaging of rAAV Serotype 1 Virus Briefly, a cell factory (Nalge Nunc Interna tional; Rochester, NY) of 80% confluent HEK 293 cells was cotransfected with the r AAV vector plasmid and the helper plasmid pXYZ1 using CaPO4 transfection. Forty-eight hours la ter the cells were harvested and lysed by resuspending the cells in lysis buffer (20 mM Tris, 150 mM NaCl, pH 8), freezing and thawing 3 times, followed by Benzonase digestion (25 Units/mL). Following digestion, the lysate centrifuged at 3,500 times (g)ravity for 20 minutes and the supernatant loaded onto the iodixanol step gradient (105). Following Optiprep iodixanol (Optiprep Co; Oslo, Norway) gr adient centrifugation, th e vector-containing fraction was collected by side puncture of the centrifugation tube and diluted 1:1 using a

PAGE 39

26 low salt (20 mM Tris, 15 mM Na Cl, pH 8.5) buffer. The dilute d iodixanol fractions were loaded onto a 5 mL HighTrap Q HP column (Amersham) at a flow rate of 5 mL/minute. The column was washed at a flow rate of 5 mL/minute with 50 mL of low salt buffer. The virus was then eluted at a flow rate of 5 mL/minute from the column using the elution buffer (20 mM Tris and 350 mM NaCl, pH 8.5) a nd collecting the peak. Buffer exchange and concen tration of the final stock was accomplished using a Centrifugal Spin Concentrator, Apollo 20 mL High-Performance (O rbital Biosciences; Topsfield, MA). Discontinuous diafiltration was performed three times and resulted in a final formulation of the vector in lactated Ringer's solution. Splenocyte Purification Mice were sacrificed by CO2 affixation followed by cer vical dislocation. The body was then cleaned with ethanol (EtOH) and the spleen removed with sterile instruments. The spleen was placed on a nylon membrane, a ttached to a 50 mL conical tube and a 3 mL syringe filled with Hanks buffered saline solution (HBSS) was used to break the splenic membrane and dislodge the cells. In addition to this, the cells were further dislodged by massaging the spleen with the plunger of the syringe. The membrane was rinsed with 5 mL HBSS by pipetting to pus h the remaining cells through the membrane. The 50 mL conical tubes were filled up to 35 mL volume with HBSS and centrifuged at 500 g for 10 minutes at 4C. The HBSS was po ured off and the cells were resuspended by tapping the side of the tube. To lyse red blood cells, the cells were resuspended in 2 mL 1x ammonium chloride (StemCell Technolo gies). After a 5 minute incubation on ice, 28 mL HBSS was added to the conical tube and centrifuged again for 10 minutes at 500 g at 4C. The HBSS was poured off and the ce lls were again resuspended by tapping the bottom of the conical tube. A second wash with 30 mL HBSS was performed and the

PAGE 40

27 cells were resuspended in 5 mL RPMI 1640 media supplemented with 10% FBS, 200 mM L-glutamine, 25 mM 4-(2-hydroxyethyl)-1 -piperazineethanesulfonic acid (HEPES), 100 units/mL Penicillin / 100 g/mL Streptomycin (P/S) 1 L -mercaptoethanol (BME). The cells were then counted using a hemato cytometer. Briefly, 10 L of resuspended cells were diluted into 90 L 0.4% (w/v ) Trypan Blue dye. Ten microliters of the resuspended cells were then placed on the hematocytometer and the cells on the center were counted. The number counted equaled the number multiplied by 105 (e.g., 162 cells would be 162x105 or 16.2 million cells per mL). Immune Profiling by Flow Cytometry For each sample, 1x106 cells were aliqoted into 5 mL Falcon tubes (Becton Dickinson Inc; Palo Alt, Ca) per test. In addition, 1x106 cells were added for each test’s isotype control. For calibration purposes, one tube for each individual florescent-tagged antibody used, and one tube of cells with no antibodies wa s prepared containing 1x106 cells. The cells were then centrifuged at 500 g for 10 minutes at 4C. The media was aspirated out and the cells were resuspended in 1 mL of fl ow cytometry staining buffer. (1x PBS, 0.1M bovine serum albumin (BSA), and 0.09 M Na Azide) followed by lightly vortexing the tube. The cells were centrifuged again and resuspended in 100 L flow buffer. To each tube, 10 L of normal rat se rum was added and the tubes were incubated for 15 minutes at 4C in the dark. The fluor escently labeled antibody mixtures were then added to the appropriate tubes. The cells we re then vortexed lightly and incubated with the antibodies at 4C for 30 minutes in the da rk. After 30 minutes, 2 mL of flow buffer was added to each tube and then centrif uged for 10 minutes at 500 g. The buffer was removed and the cells were washed once more with an additional 2 mL flow buffer. The

PAGE 41

28 cells were then resuspended in 400 L of fl ow buffer and made ready for reading on the flow cytometer. Flow cytometric analysis of prepared cells was carried out using the FACScan Flow Cytometer (Becton Dickinson Inc). Firs t, unlabeled cells were placed into the cytometer and the forward scatter/side scat ter setting was made. This was followed by the fluorescein isothiocyanate (c hannel-1), phycoerythrin (channe l-2), peridinin chlorophylla protein (channel 3), and a llophycocyanin (channel-4) markers. Alternatively, ten minutes before the cells were read by the fl ow cytometer, 5 L of 7-amino-actinomycin D (7-AAD) was added to measure the number of dead cells in for each sample. The 7AAD was then added to a tube of unlabeled cells and calibrated in channel 3. Once the calibration settings were established, the se ttings were stored, and 50-100,000 cells were counted from each sample. The files were save d to the computer and analyzed using FCS Express Flow Cytometer analysis program . (De Novo Software; Thornhill, Canada). Intracellular Cytokine Staining Flow Cytometry For intracellular cytokine staining the protocol follows much as the extracellular protocol above. However, just before the fi nal 400 L resuspension in flow buffer, the cells were instead resuspended in 1 mL of cold eBioscience fixation and permeabilization buffer (eBioscience, San Diego, CA) for each sample. After a quick pulse vortex, the cells were incubated at 4C overnight in th e dark. The following morning the cells were washed once by adding flow buffer followe d by centrifugation at 500 g for 10 minutes and then decanting the supernatant. The cells were then washed with 2 mL of eBioscience permeabilization buffer and centrifuged for 10 minutes at 500 g. The permeabilization buffer was removed and the wash repeated with another 2 mL of permeabilization buffer. The cells were then resuspended in 100 L of flow buffer

PAGE 42

29 containing 2% normal rat serum for 15 minut es. After 15 minutes, intracellu lar antibody was added and the tubes were diluted in 100 L of permeabilization buffer and incubated at 4C for 30 minutes in the dark. The cel ls were then washed with 2 mL of permeabilization buffer and centrifuged for 10 minutes at 500 g. The supernatant was decanted and the cells were washed with an additional 2 mL of pe rmeabilization buffer. Finally, the cells were resuspended in 400 L of flow buffer and analyzed on the flow cytometer. CD4+CD25+ T Lymphocytes Suppression Assay Once the CD4+CD25+ regulatory T (Treg) lymphoc ytes were purified using a MACS (Miltenyi Biotec Inc; Auburn, CA) magnetic bead purification system, they were applied to a 96 well tissue culture di sh at varying ratios to effector CD4+CD25T (Teff) lymphocytes. To the peripheral wells of the plate, 200 L of RPMI 1640 media was added to reduce evaporat ion. In six replicates, 1x105 total cells were added for each of the in the following (Treg:Teff) ratios: 2:1, 1:0, 1:1, 0.5:1, 0.25:1, and 0:1. To each well, 5 g of anti-CD3 antibody and 2.5 g of anti-CD28 antibody were added diluted to 20 L with RPMI 1640 media. In addition to the combinations of Treg and Teff lymphocytes, 5x104 accessory cells irradiated with 3300 rads were added to each well. In other wells, accessory cells were plated alone with and without 5 g of anti-CD3 antibody/ 2.5 g of anti-CD28 an tibody in six replicates. The cells were then incubated at 37C, 5% CO2, 95% humidity for 5 days. After 5 days, 20 L of media from each sample was taken for cytokine ELISA and frozen at -20C. To each well, 0.5 Ci H3 thymidine was added diluted to 20 L in RPMI 1640. Af ter 18 hours of incubation, the cells were lysed and the H3 incorporation measured with a 1450 Microbeta Trilux -scintillation counter (Wallace Inc.; Turku, Finland). Briefly, the cells we re transferred to a filter

PAGE 43

30 bottom 96 well dish and placed on a media suc tion plate. The media was sucked through and the cells were osmotically lysed by washing them four times with diH20. After the final wash the filter paper was allowed to ai r dry for 30 minutes, at which time 25 L of scintillation fluid was added. After two hours the plate was read on the -scintillation counter and the results we re calculated on a spread sheet for analysis.

PAGE 44

31 CHAPTER 3 PREVENTION OF T1D BY USE OF ANTI-THYMOCYTE GLOBULIN Methods ATG Administration For in vivo experiments, 3 week old non-obese diabetic (NOD)/Lt mice were ordered from Jackson Labs Inc. (Bar Har bor, MA). All the mice were housed in the special pathogen free Pathology Animal Core fa cility and followed Institutional Animal Care and Use Committee (IACUC) and Animal Care Services (ACS) protocols. Upon arrival, the mice were tagged w ith a subcutaneous FriendChipTM (AVID) so that each mouse could be tracked with a 9 digit code via a scanner. This was carried out under isoflorane (Abbott Labs, North Chicago, IL ) inhalant anesthe tic utilizing the commercial vaporizer at a dose of 2 to 3% based on manufacturers specifications. At 4 weeks of age, 12 mice were injected intraperitoneally with 500 g of ATG (Genzyme Corp; Farmingham, MA) diluted into 200 L of saline. After 72 hours, a second dose of 500 g was delivered as before. In parallel to the ATG injections, 12 mice were also injected with two occasions of 500 g rabbit IgG, (Jackson Immuno; Milpitas, CA) which served as the negative control for all experiments. This injection scheme was re peated with 3 other experi mental groups, 12 mice at 8 weeks of age, 12 mice at 12 weeks of age, and 12 mice at the time of T1D onset as determined by two consecutive blood gl ucose readings over 240 mg/dL over 2 consecutive days. Nine mice from each gr oup were followed until onset of T1D for the mice injected with rATG or rIgG at 4, 8, a nd 12 weeks of age. Progression of T1D was

PAGE 45

32 also followed for mice injected at the time of onset. In addition to these mice, 3 BALB/c mice were immunized with ATG for strain comparison purposes, a nd 12 more NOD mice were immunized with rIgG or ATG for immunoprofiling at day 7 and day 14 post therapeutic administration. Blood Glucose Analysis The mice administered ATG or rIgG were bl ed by tail perforation for blood glucose levels once a week. After two consecutive blood glucose readings above 240 mg/dL over two days the mouse was classified as diabet ic and euthanized. This was accomplished by means a carbon dioxide chamber followed by cer vical displacement and dissection of organs. Mice injected at onset of T1D were monitored for progre ss/reversion of their diabetes. These mice were also evaluated fo r blood glucose levels . At the time of 4 consecutive weekly readings of blood glucos e levels higher than 250 mg/dL, the mouse was euthanized as before and the organs we re harvested for histopa thological evaluation. Immunohistochemistry The organs (heart, lungs, liver, pancreas, kidney, intestine, skeletal muscle, gonad, and spleen) from euthanized mice were harves ted for immunohistological analysis. They were placed into cassettes, then in 10% fo rmalin, and sent to the UF Pathology Core facility. H&E staining was carried out on al l organs for general pathology. Insulitis scoring was carried out on H&E stained pancreas. The sp leen and pancreatic lymph nodes from the 3 mice were pooled for flow cytometry analysis. The pancreas and spleen were stained for B220 and CD3 for analysis of lymphocytes profile in these organs. This was done according to established protocol s and carried out unde r sterile conditions whenever possible.

PAGE 46

33 Total Lymphocyte Counting In addition to monitoring blood glucose, th ese mice were bled via tail prick with a #11 scalpel at the following times; day 0, 1, 7, 14, 30 post-injection. Ten microliters of blood was collected via capillary tube and pl aced into an EDTA tube (Amersham) for lymphocyte counts, which were than read on a MASCOT Hemavet 850 CBC Analyzer (Drew Scientific; San Diego CA). Serum Cytokine Analysis In addition to the 10 L of blood ta ken for lymphocyte counting at all time points, 50 L blood was taken via capillary tubes and placed into a serum separation tubes. The blood was then centrifuged for ten minutes at 5500 g and the serum placed into a 1.5 mL microcentrifuge tube and then frozen at -80C for cy tokine analysis. The Luminex 10-plex cytokine system determ ined serum cytokine concentration for interleuin-1 beta (IL), IL-2, IL-4, IL-5, IL-6, IL10, IL-12, granulocyte-macrophagecolony stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF ), and interferon gamma (IFN ). Glucose Tolerance Testing Thirty days after the fi rst injection, 3 mice underwen t intraperitoneal glucose tolerance testing on the day before euthanasia was perf ormed. It was performed on conscious mice that had been fasted for 5 hours, by removal to clean cage without food at the end of their dark (feedi ng) cycle. Following fasting, gl ucose levels were obtained from blood from a small tail incision. Gl ucose (1 mg/gm body wt) was injected intraperitoneally in saline d iluted to 200 L volume. Blood glucose values were obtained at 0, 5, 15, 30, 60, and 120 minutes after gl ucose administration using an OneTouch Ultra (LifeScan) meter.

PAGE 47

34 Purification of Immune Cells from Spleen and Pancreatic Lymph Nodes At the time of necropsy, the spleen and pancreatic lymph nodes were placed in solution of Hanks buffered saline solution (HBSS) and placed on ice. Single cell suspensions of these organs were then prepared as described in chapter 2. The isolation of the pancreatic lymph node cells followed a similar protocol to the isolation of the splenocytes with the exception of the ammonium chloride step. Splenocyte Stimulation Assay. For each mouse, a 96 well plate was prepared with 100 L of RPMI 1640 supplemented with 10% FBS, 200 mM L-gl utamine, 25 mM 4-(2-hydroxyethyl)-1piperazineethanesulfonic acid (HEP ES), 100 units/mL penicillin/ 100 g/mL streptomycin (P/S) 1 L -mercaptoethanol (BME). In six wells, 0.2 g lipopolysaccaride (LPS) was diluted into the media. Into a nother 6 wells, 1 g/mL of anti-CD3antibody and 1 g/mL of anti-mouse CD28 antibody were ad ded to the RPMI 1640 media. The outside wells of the 96 well plate, 200 L of media se rved to minimize evaporation on the plate. To each well, with either 1 g/mL LPS or 1 g/mL anti-CD28/anti-CD3 antibody, 1x105 splenocytes were added diluted into 100 L RPMI 1640 media. To an additional 6 wells, splenocytes were added without any stimulant. These wells served as the experimental negative control. The cells were then incubated for 72 hours at 37C, 5% CO2 at 95% humidity. After 72 hours incubation, 20 L of media was taken and frozen for future cytokine analysis using the Luminex 100 sy stem and the final concentrations wre calculated by this method. Then to each well, 0.5 Ci of H3 thymidine diluted into 20 L RPMI 1640 and was added to the cells. After 16 hours, the cells are then harvested and counted in a -scintillatio n counter as described previously.

PAGE 48

35 CD4+CD25+ T Lymphocyte Suppression Assay Splenocytes from each mouse were plated into a 96 well plates and six replicates from each mouse underwent a CD4+CD25+suppression assay as described in chapter 2. Media samples from the assay at the day 5 time point were an alyzed by the MultiCytokine ELISA using Lumine100TM System. Flow Cytometry Analysis of Splenocyt es and Pancreatic Lymph Node Cells. Lymphocytes isolated from spleen and pa ncreatic lymph nodes were stained for flow cytometric analysis. For each mouse, 1x106 cells per test, with the following fluorescein isothiocyanate (FITC), phyc oerythrin (PE), and allophycocyanin (APC) florescent antibodies along with 7-amino-ac tinomycin D (7-AAD) (BD Pharminigen), and the appropriate isotype controls were prepared. To each test 50,000 cells were read on the flow cytometer. In addition to the experi mental tubes, contro l tubes were prepared for the individual antibodies: anti-CD3-FITC, anti-CD8-PE, 7-AAD, and anti-CD4APC anti-CD3-FITC, anti-CD28-PE, 7-AAD, and anti-CD4-APC anti-CD3-FITC, anti-CD28-PE, 7-AAD, and anti-CD8-APC anti-CD3-FITC, anti-CD25-PE, 7-AAD, and anti-CD4-APC anti-CD3-FITC, anti-CD25-PE, 7-AAD, and anti-CD8-APC anti-CD3-FITC, anti-CD154-PE, 7-AAD, and anti-CD4-APC anti-CD3-FITC, anti-CD154-PE, 7-AAD, and anti-CD8-APC anti-CD3-FITC, anti-CCR5-PE , 7-AAD, and anti-CD4-APC anti-CD3-FITC, anti-CCR5-PE, 7-AAD, and anti-CD8-APC The results from the individual tests were then analyzed using the flow cytometry analysis program FCS Express software (De No vo Software). The isotype controls and the dead cells were subtracted out to calculate the values for each experimental condition tested. The samples were then run on the fl ow cytometry machine and the results were then analyzed with a computer program that allowed for the results to be plotted into a graphical program.

PAGE 49

36 Adoptive Transfers For adoptive transfer experiments, 3 w eek old non-obese diabetic Rag knock-out (NOD-Rag (-,-)) mice (Jackson Labs) were ordered and housed in the SPF Mouse Pathology facility, following IACUC and ASC protocols. Upon arrival the mice were tagged with a subcutaneous FriendChipTM (Avid) in which each mouse could be tracked with a 9 digit code via a scanner. This was carried out under is oflorane (Abbot Labs) inhalant anesthetic as described previously. Splenocytes obtained from survivors of each treatment group at 30 weeks of age, were adoptively transferred via intravenous injection under isoflorane anesthesia. Four NOD-Rag (-,-) mice, each had 20x106 splenocytes from T1D mice, adoptively transferred. These mice served negative controls. Five NOD-Rag (-,-) mice, each had 20x106 splenocytes from rIgG treated mice, a doptively transferred. Seven NOD-Rag (-,-) mice, each had 20x106 splenocytes from ATG treated mice, adoptively transferred. Seven NOD-Rag (-,-) mice, each had 10x106 splenocytes from T1D mice and 10x106 splenocytes from rIgG treated micex adop tively transferred. Seven NOD-Rag (-,-) mice each had 10x106 splenocytes from T1D mice and 10x106 splenocytes from ATG treated mice, adoptively transferred. All the mice were followed for onset of T1 D by weekly blood glucose readings as described previously. At time of diabetes onset, the mice were euthanized and the pancreas was removed for histopathology. This was done by removing the organ and placing it in 10% formalin, follo wed by 75% ethanol. The organs were then sent to the UF Pathology Core facility where they were stained for immunopathology and immunohistochemistry.

PAGE 50

37 Results Survival Curves of In Vivo Treated NOD mice The incidence of T1D through 30 weeks post-injection, in female NOD/LtJ mice treated at either 4, 8, or 12 weeks of age, with either ATG or c ontrol rIgG are shown in Figure 3-1. Figure 3-1. Kaplan Meier curve for ATG tr eated mice. A) Comp arison of different experimental groups administered with AT G or rIgG at A) 4 weeks of age, B) 8 weeks of age, or C) 12 weeks of age. There was not a significant difference be tween the negative control rIgG treated mice and the ATG treated mice. NOD mice tr eated at 12 weeks of age with ATG did show a significant decrease in the rate of disease onset (p<0.004) as compared to rIgG treated littermates. At 30 weeks of age, 89% of the ATG treated mice were remained euglycemic while only 22% of rIgG treated mice remained euglycemic.

PAGE 51

38 Figure 3-2. Total lymphocyte count. A) Lymp hocyte count for mice treated with either ATG or rIgG at 12 weeks of age. B) Lymphocyte count for NOD and BALB/c mice treated with ATG at 12 weeks of age.

PAGE 52

39 Total Lymphocyte Count Blood was taken at 0, 1, 3, 7, 14, and 30 days following administration of ATG or rIgG control from the different experimental age treatments, as well a control BALB/c mice. The total lymphocyte count calculated using a CBC machine. The average of the lymphocytes (see figure 3-2) were then calculated and graphed according to concentration at the different time points. Treatment with ATG caused a transient lymphocytopenia that, by day 14 post administration began to return to normal lym phocyte numbers. This pattern was seen in both NOD and BALB/c treated mice. The lympho cyte count of the rIgG treated mice was reduced; however, these mice never became lymphocytopenic. There was a significant decrease (p<0.04) of lymphocyte co unt in ATG treated mice (2950 to 520 lymphocytes/L) verse the rIgG contro l (3517 to 1357 lymphocytes/L) mice. Total lymphocyte count for mice treated at 4 weeks of age and 8 weeks of age showed similar patterns as those treated at 12 weeks of age (data not shown). Flow Cytometry Analysis of CD3+ CD4+ and CD8+ T lymphocyte Populations Using flow cytometry, the specific CD3+ lymphocyte populations were calculated at day 7, 14, and 30 from 12 week old treat ed mice. For comparison, the pancreatic lymph nodes and the thymus were also taken an d the lymphocytes were purified for flow cytometry analysis. Splenocytes from thes e mice were harvested and the cells were stained for with the appropriate antibodies for flow cytometry. Just before the cells were run on the flow cytometer, 7-AAD was added to account for and subtract out the dead cells for analysis. The cells were run on the flow cytometer and 50,000 cells were allowed to be read by the analysis program that then calculated the specific lymphocyte subtypes.

PAGE 53

40 Figure 3-3. Flow cytometric analysis of specific T lymphoc yte populations after therapeutic administration. Representative A) CD3, B) CD4, and C) CD8 staining of mice treated with ATG or rIgG at 7 days post therapeutic administration. Figure 3-3 calculates the amount of differe nt T lymphocyte sub populations with in the spleen at 7 days post ATG treatment. In addition to the ATG treatment, rIgG control is also displayed as well as an isotype cont rol. These figures are gated on lymphocytes and 7-AAD to analyze only the living lym phocyte subpopulations. The data presented here demonstrates that ther e is a reduced amount of CD 3, CD4, and CD8 T lymphocytes found in the spleen after trea tment with ATG, but not rIgG up to 14 days post treatment. By 30 days post therapeutic administration, the levels of lymphocytes returned back to the same levels as the negative control treat ed mice. The same pattern was seen in all treatment groups.

PAGE 54

41 Figure 3-4. Average of flow cytometric an alysis of specific T lymphocyte populations after therapeutic administration. Average A) CD3, B) CD4, and C) CD8 staining of mice treated with ATG or rIgG at 7, 14, and 30 days post therapeutic administration. Treatment of ATG caused a transient CD3+ T lymphocyte depletion (12.1% vs. 53.7%; p<0.01), that by day 30 post administra tion, returned to normal numbers. This pattern was seen both CD4+ (8.5% vs. 38.4%; p<0.001) and CD8+ (2.6% vs.16.1%; p<0.001) T lymphocytes. The CD4:CD8 ratio of the ATG treated mice did not alter significantly (Data not shown) from rIgG control mice at a ll time points. Mice treated with rIgG had slightly reduced CD3+ T lymphocyte, yet there was not a significant decrease during the time points studied. This same pattern was seen in all treatment groups including mice treated at 4 and 8 weeks of age.

PAGE 55

42 Flow Cytometry Analysis of CD11c+ CD11b+ and B220+ Populations Splenocytes from mice treated with ATG and rIgG at 12 weeks of age and euthanized 7 days later were stained for fl ow cytometric analysis. For each mouse, 1x106 cells per test using fluorescently labeled antibody mixtures (BD Pharminigen) were prepared, according to the prot ocol is described in chapte r 2, testing for anti-B220-FITC (RA3-6B2), anti-CD11b-PE (M1/70), 7-AAD, and anti-CD11c-APC (N418) along with the corresponding isotype controls. The resu lts were then analyzed using the FCS Express (De Novo) flow cytometry analysis program. Figure 3-5. Flow cytometric staining for antig en presenting cells 7 days after therapeutic treatment. Flow cytometric staining for A) CD11c+ dendritic cells, B) CD11b+ macrophages, and C) B220/CD45R+ B lymphocytes. Flow cytometry showed no statistical difference in the concentration CD11c+ dendritic cells, CD11b+ macrophages, or B220/CD45R+ B lymphocytes. This same patter was seen in all treatment groups including mice treated at 4 and 8 weeks of age and BALB/c treated mice.

PAGE 56

43 Insulitis Scoring The organs from euthanized mice were ha rvested for immunohist ological analysis. Organs were placed into cassettes, and stored in 10% formalin. The tissues were sent to the UF Pathology Core facility, where H&E staining was carried out on all organs for general pathology. In addition insulitis scori ng was carried out on H&E stained pancreas. Figure 3-6. Insulitis scoring of ATG treated mice. The pancreas from euthanized mice harvested, placed into cassettes and stor ed in 10% formalin. Blinded insulitis scoring was carried out on H&E stained pancreas. No pathologies were recogni zed in any mice in histology from H&E stained organs. Insulitis scoring of the pancreas showed a reduced lymphocyte infiltrate in ATG treated mice over controls. This same pattern was s een in all treatment groups including mice treated at 4 and 8 weeks of age as well as BALB/c treated mice and mice treated at 12 weeks of age and euthanized at day 7 and da y 14 post therapeutic treatment with ATG or rIgG negative control.

PAGE 57

44 Glucose Tolerance Testing Thirty days after the first injection, 3 mice underwent intrap eritoneal glucose tolerance testing. Blood glucose values were obta ined at 0, 5, 15, 30, 60, and 120 minutes after glucose administration. Figure 3-7. Intraperitoneal gluc ose tolerance testing. IPGTT of A) 4 week old mice, B) 8 week old mice, and C) 12 week old mice 30 days after therapeutic administration. Intraperitoneal glucose admi nistration did not show a si gnificant average difference in the 4 week or 8 week old treated mice, 30 days after therapeu tic administration. Mice treated at 12 weeks of age and IP glucose to lerance tested at 30 days after therapeutic treatment did show a signif icance (p<0.05) average dive rgence between the ATG and rIgG control treated mice at the early time points measured from 5 to 15 minutes post glucose administration. While mice from both treatment groups had an average fasting

PAGE 58

45 glucose levels of 135 mg/dL, upon glucose administration rIgG treated mice average glucose levels rose to 307 mg/dL while ATG treated mice gl ucose levels rose only to 244 mg/dL. Splenocyte Stimulation Assay. For each mouse, 1x105 splenocytes were stimulated with anti-CD28/anti-CD3 antibody. Following 3 days incubation, H3 thymidine was added for an addition 16 hours and then the H3 thymidine incorporation was read on a -scintillation counter. Figure 3-8. Splenocyte stimulation assay of ATG treated NOD mice. Splenocytes from different experimental groups were stimulated with CD3/ CD28 and H3 thymidine incorporation was m easured. A) Comparison of H3 thymidine incorporation of treated mice at 4, 8, and 12 weeks of age and splenocytes isolated 30 days following therapeuti c administration. B) Comparison of H3 thymidine incorporation of treated mi ce, 12 weeks of age with splenocytes isolated 7, 14, and 30 days follo wing therapeutic administration. Therapeutic treatment with ATG significantly reduced average splenocyte proliferation as measure by H3 thymidine incorporation over rIgG control for the 8 and 12 week old treated mice 30 post administrati on. There was not a significant reduction in proliferation of mice treated with ATG at 4 w eeks of age verse the control. In addition,

PAGE 59

46 12 week old ATG treated mice showed a sign ificant reduction average reduction in H3 thymidine incorporation in splenocytes isol ated 7, 14, and 30 days following therapeutic treatment. Luminex for Cytokines In Vivo Serum sample from mice were taken at 0, 1, 3, 6, 12, 24, 72, 168, 336, and 720 hours following therapeutic treatment with AT G or rIgG. A 21-plex Luminex Cytokine System was run on the seru m for cytokine profiling. . Figure 3-9. Serum IL-2 concentration follo wing therapeutic treatment of 12 week old NOD mice. Serum samples from mice were taken at 0, 1, 3, 6, 12, 24, 72, 168, 336, and 720 hours following therapeutic treatment with ATG or rIgG. Mice immunized with ATG ha d an early average increas e in IL-2 concentration from baseline of less than 20 pg/mL up to 145 pg/mL by 12 hours. By day 3, the concentration of IL-2 returned back down to the negative control leve ls of expression that never varied at any experimental time poi nt. Age matched NOD mice treated with rIgG never showed a significant increase in seru m concentrations of IL-2 throughout the measured time points.

PAGE 60

47 There was increased concentration of othe r cytokines as measured by the 21-plex Luminex Cytokine System including the chemokines, MIP-1 , MCP-1, and KC (Data not shown). CD4+CD25+Suppression Assay Purified CD4+CD25+ T lymphocytes from different experimental groups administered with therapeutic antibody at 4, 8, and 12 weeks of age were mixed with varying ratios to effector CD4+CD25T lymphocyte proliferative ability was measured by H3 thymidine incorporation in a -scintillation machine. Figure 3-10. Suppression assay 30 days post therapeutic administra tion. A) Suppression assay for A) 4 week old treated mice, B) 8 week old treated mice, and for 12 week old treated mice.

PAGE 61

48 Mice treated with ATG at 4 weeks of age and sacrificed 30 days later showed a decreased, albeit not statisti cally significant ab ility to suppress effector T lymphocyte proliferation after stimulation with antiCD3antibody/anti-CD28 antibody. Mice treated with ATG at 8 weeks of age showed a slig ht average increased ability to suppress stimulated effector T lymphocyt es. Mice treated at 12 weeks of age showed a statistically significant decrease in average proliferation of effector CD4+ lymphocytes in the presence of regulatory T lymphocytes at a 2:1, 1:1, and :1 ratios. The greatest differences count be seen at 1:1 ratio, in which CD4+CD25+ T lymphocytes from mice treated with ATG could suppr ess lymphocyte average proliferation by 80% (p<0.01) as compared to only 40% suppression with CD4+CD25+ T lymphocytes purified from mice treated with rIgG. Flow Cytometry Analysis of T lympho cyte Costimulatory Signal Molecules Lymphocytes isolated from spleen were st ained for flow cytometric analysis. For each mouse, 1x106 cells per test usin g fluorescently labeled antibody mixtures were prepared, according to the protoc ol is described in chapter 2. Figure 3-11. Example of gating scheme fo r flow cytometry analysis of CD25, CD28, CD154, and CCR5 on CD4+ and CD8+ T lymphocytes.

PAGE 62

49 Using the same gating scheme for all expe rimental groups, the concentration of the different T lymphocytes popul ations were calculated. Table 3-1. Flow cytometric analysis of CD25, CD28, CD154, and CCR5 on CD4+ and CD8+ T lymphocytes. Flow cytometry analysis s howed statistically increased average expression of CD4+CD25+ (16.85% vs. 8.30%; p<0.01), CD4+CD28+ (3.58% vs.1.12%; p<0.05), CD8+CD28+ (2.78% vs. 0.89%; p<0.01) at day 7 post therapeutic treatment. There was a statistically decreased av erage expression of CD4+CCR5+ (14.41% vs. 31.73%; p<0.01) and CD8+CCR5+ (12.89% vs. 23.33%; p<0.01) in mice treated with ATG when compared to rIgG control littermates. All othe r experimental groups showed no statistical difference in cell surface costimulatory molecules. There was an increased average expressi on 14 days post therapeutic treatment for CD25+ on CD4+ lymphocytes (11.05% vs. 8.26%; p< 0.05) in ATG treated mice over rIgG controls. There was no signifi cant difference of expression in all other experimental groups.

PAGE 63

50 There was no significant difference of expression of any of the cell surface costimulatory molecules in ATG treated mice 30 days post treatment as compared to rIgG controls. Adoptive Transfers Splenocytes obtained from survivors of each treatment group at 30 weeks of age in protocol were transferred via intr avenous injection into NOD-Rag (-,-) mice and followed for onset of diabetes as described previously. Figure 3-12. Adoptive transfers expe riments. Adoptive cotransfer of 10x106 splenocytes from 30 week old ATG or rIgG surviving mice with 10x106 splenocytes from T1D mice transfered into NOD (rag-/-) mi ce. B) Adoptive single transfer of 20x106 splenocytes from 30 week old ATG or rIgG surviving mice transferred into NOD (rag-/-) mice. Adoptive transfer of splenocytes showed an increased survival in mice that were transferred with splenocytes from ATG treated groups. This same pattern was seen in both the single adoptive splenocyte transf er as well as the adoptive cotransfer experiments. Discussion In these studies, we showed that prevention of T1D in the NOD mouse using ATG, achieved complete remission in over 90% of treated mice. This treatment is age dependent, with suppression of T1D occurring only in mice treated at 12 weeks of age.

PAGE 64

51 Evidence from these studies suggests that tr eatment with ATG at 4 weeks of age may accelerate diabetes. Mice treated with ATG at th is age developed diabetes at faster rate than mice treated at 8 and 12 weeks. Indeed, ev en mice treated at onset of diabetes with only ATG experience a reversal of diabetes (Data not shown). In mice with extreme diabetes (blood glucose >400 mg/dL) this reve rsal was transient, and with in one month of treatment, these mice returned back to hyperglycemic. CD25+CD4+ regulatory T lymphocytes demonstrated a reduced capacity in four week old trea ted mice to suppress effector T lymphocytes in suppression assays. However, there was signi ficant increase in 12 week old treated mice Treg lymphocyte f unction in comparison to age matched rIgG control mice. This suggests that an effectiv e ATG treatment is extremely age dependent and optimal treatment of T1D prevention may be linked to a developmental checkpoint in immune system’s maturation and progress to T1D. In contrast to treatment with depleting anti-T lymphocyte anti bodies, where disease prevention depends on maintenance of T lymphoc yte depletion, a short course of ATG is sufficient to establish long-term tolerance a nd confer permanent protection from T1D. The efficacy of ATG in preventing T1D in these studies is attributed to its direct action on T lymphocyte activation and proliferation. Th is coupled with a short term increase of a cytokine milieu, could allow for a weaken ed immune activation and the subsequent expansion of regulatory T lymphocytes. Flow cytometric analysis demonstrated a significantly reduced concentration of CD28 and CD154 on CD4+ T lymphocytes in the spleen, indicating a reduced effector capacity. The selective down-regulation of splenic and pancr eatic lymph node T

PAGE 65

52 lymphocyte CCR5 expression may be significant due to its association with Th1 immune responses. Adoptive transfer of splenocytes from ATG treated mice into NOD (rag-/-) mice conferred protective immunity against onset of T1D when cotransferred with splenocytes from diabetic mice suggesting a permanent alteration of lymphocytes rendering them anergic. Conclusions Our findings provide in vivo evidence for a role of ATG as a possible therapy in the prevention of T1D. The role of ATG in ly mphocyte depletion resu lted in a greatly reduced insulitis in NOD mice and preven tion of T1D. The window by which the treatment allows for effective results is ex tremely small and effective treatment in a clinical setting may require more detail on th e best time at which the therapy should be given. Promising work in the future may join therapies to widen the window at which treatment can be given. Possible combination therapies include adding rapamycin to the treatment or combining with immunomodul atory rAAV therapies. These promising findings allow for future work that ma y one day, lead to a therapy for T1D.

PAGE 66

53 CHAPTER 4 MOLECULAR CLONING OF RECOMBINANT AAV VECTORS Construction of rAAV Vectors Expressing Chimeric Mouse Anti-Mouse-Interferon Gamma IgG1 The variable regions of the heavy ch ain (pUC18 AM7-Vh) and light chains (pUC18 AM-Vl) were graciously sent by Pr otein Design Labs (Fremont, Ca). These fragments were cloned using an anchor ed PCR method from a hybridoma cell line expressing a well characterized neutralizing anti-murine IFN antibody (118, 119). The constant domain of the of the hea vy chain and light ch ain were cloned by reverse transcriptase polymerase chain reaction (RT-PCR) from a hybridoma cells expressing an mouse immunoglobulin G1 (IgG1) kappa against human alkaline phosphotase (UF ICBR Hybridoma Co re). Hybridoma cells were grown in suspension in RPMI 1640 media supplemented with 10% FBS and incubated at 37C, 5% CO2. After 48 hours, 1x106 cells were pelleted by centrif ugation at 500 g for 10 minutes. The supernatant was removed and the RNA pur ified using TRIZOL reagent (Invitrogen Corp.) from lysed cells. First strand synthesis utilized SuperScrip t II RT PCR Kit (Invitrogen Corp) in which to a nuclease-free microcentrifuge t ube, the following components were added: 1 L Oligo(dioxythymidine (dT))12-18 (500 g/mL), 5 g total RNA, and 1 L dioxyucleotide-triphospate (dNTP) mix (10 mM each). The tube was then placed on a heat block at 65C for 5 minutes and then pl aced on ice. After a quick centrifugation to bring the contents to the bottom of the tube , the following contents were then added to

PAGE 67

54 the mixture: 4 L 5X First-Strand Buffer, 2 L 0.1M DTT, and 1 L RNaseOUT (40 units/L). The contents were then mixed ge ntly and incubated at 42C for 2 minutes. Next, 1 L (200 units) of SuperScript II RT was added and mixed by pipetting gently. The tube was then brought up to 20 L tota l volume with diethyl pyrocarbonate (DEPC) H2O and incubated at 42C for 50 minutes. Fo llowing the RT reaction, the mixture was inactivated by heating at 70C for 15 minutes. Following RT-PCR, the cDNA underwent further amplification using primers designed specific to the constant domains of the heavy chain and the light chain respectively. The cDNA was amplified us ing Platinum PCR SuperMix (Invitrogen Corp). To 2 nuclease free PCR tubes, 45 L Platinum PCR SuperMix was added containing 22 units/mL complexed recombinant Taq DNA polymerase with Platinum Taq antibody, 22 mM Tris-HCl (pH 8.4), 55 mM KCl, 1.6 mM MgCl2, 220 M dNTP mix, and stabilizers. For the light chain (C ) PCR tube, 200 nM of the following primers were added, based on the NCBI Accession # V01569, along with 1 g of RT-PCR product: forward: 5’ CGGGCT GATGCTGCACCAA 3’ reverse: 5’ CTAACACT CATTCCTGTTGAAGCTCT 3’ For the heavy chain (Fc) PCR tube, 200 nM of the following primers were added based on the NCBI Accession # M60429, along with 1 g of RT-PCR product: forward: 5’ GCCAAAACGACACCCCCATCT 3’ reverse: 5’ TTATTTACACAGGGAGGGGTG 3’ Sterile diH2O was then added to both tubes to bring the total volume to 50 L. The tubes was capped and placed into the RoboCycler Gradient 96 thermocycler (Stratagene, La Jolla, CA).

PAGE 68

55 For the light chain the reac tion, after a 3 minute 95C dena turation step, 30 cycles at 94C for 30 seconds, 55C for 30 seconds , and 72C for 1 minute was performed. A final extension at 72C for 10 minutes finish ed the reaction. For the heavy chain reaction, after a 3 minute 95C denaturation step, 30 cy cles at 94C for 30 seconds, 58C for 30 seconds, and 72C for 1 minute was performed. A final extension at 72C for 10 minutes finished the reaction. The PCR products were then run a 1% ag arose gel with a 1 kilobase pair (kb) ladder at 100 volts for 1.5 hours. Th e 324 base pair fragment for the C and the 1070 bp fragment for the Fc were was then cut out w ith a sterile scalpel and placed into a 1.5 mL centrifuge tubes. The DNA was purified from the agarose gel using the QIAquick Gel Extraction Kit (Qiagen; Hilden, Germany). The next step was to move the RT-PCR product into a sequencing vector. It was ligated into the pCR2.1-TOPO vector (Invitr ogen Corp.) using the following procedure. To a sterile microcentrifuge tube, 4 L RT-PCR product, 1 L of sterile H2O, and 1 L of pCR2.1-TOPO vector added. Then the cells we re mixed gently, incubated for 5 minutes at room temperature, and then placed on ice. To transform the DNA into bacterial cells, 2 L of the ligation reaction was pippeted into a vial of One Shot Chemically Competent TOP10 E. coli and mixed by gentle tapping. After a 30 minute incubation on ice, the cells were heat-shocked for 30 seconds in a 42C waterbath. The tube was then immediately transferred to ice. Then, 250 L of room temperature Luria-Bertani (LB) broth was added to the cells and incubated in a 200 rpm shaker at 37C. After one hour, 50 L of the transformation was spread on a prewarmed LB agar plate containing 50 g/mL (amp)icillin and 40 mg/mL 5-bromo4-chloro-3-indolyl-beta-D-galactopyranoside

PAGE 69

56 in dimethylformamide and incubated overnight at 37C. The next day, 10 white colonies were picked from each construct using ster ile toothpicks and placed into 15 mL conical tubes containing 3 mL LB Broth (100 g/mL am p). The tubes were then placed in a 200 rpm shaking 37C incubator overnight. The ne xt morning, the colonies were screened using a QIAprep miniprep (Qiagen Corp). A restriction enzyme digest was then pe rformed on the DNA to screen for clones that have the PCR product inserts. To a 1.5 mL tube, 1 g plasmid DNA, 1 unit restriction enzyme EcoRI (New England Bi olabs Inc; Beverly, Ma), and 2 L 10x NEB Buffer 2 was added. Then, diH20 was added to a final volume of 20 L and the tubes were incubated in a 37C water bath. After 2 hours, DNA dye was added to the tubes and they were run on a 1.2% agarose gel for 2 hours. Clones with bands at 342/3890 base pairs (bp) for the C plasmid and 1065/3890 bp for the Fc plasmid were considered positive and sent to the sequencing core facility (ICBR, University of Florida) which used an ABI Prism 377XL sequencing system (Applie d Biosytems Inc; Foster City, CA). The clones with the correct sequence we re stored as pCR2.1-TOPO-IgG1 C and pCR2.1TOPO-IgG1 Fc respectively. New primers were then designed to allow for the fusion of the variable region to the constant domain of bot h the heavy and light chains to produce the complete recombinant chimeric monoclonal mouse anti-mouse interferon gamma antibody. A Kozac consensus sequence was included in the forward 5’ primer of the variable regions prior to the start signal. The 3’ reverse primer of the vari able domain was designed to include a short 5’ sequence of the constant domain. The 5’ forward primer of the constant domain was design to include the complimen tary 3’sequence of the variable domain.

PAGE 70

57 Four nuclease free PCR tubes containing 45 L Supermix were prepared. To the first tube, 0.1 g pUC18-ALC and 200 nM pr imers were added as follows: forward 5’ CCACCATGAGTGTGCCCACTCA 3’ reverse: 5’ GCAGCATC AGCCCGTTTGATTTCCAGCT 3’ To the second tube, 0.1 g pCR2.1-TOPO-C and 200 nM primers were added as follows: forward 5’ AGCTGGAAATCAAACGGGCTGATGCTGC 3’ reverse 5’ CTAACACTCATTCCTGTTGAAGCTCT 3’ To the third tube, 0.1 g pUC-VHC and 200 nM primers were added as follows: forward 5’ CCACCATGTTCTCTCCACAGTCCCT 3’ reverse 5’AAATAGCCCTTGACCAGGCATCCCAG 3’ To the fourth tube, 0.1 g pCR2.1-TOPO-IgG1 Fc, and 200 nM primers were added as follows: forward 5’ CTGGGATG CCTGGTCAAGGGCTATTT 3’ reverse: 5’ GCGGCCGC TCATTTACCAGGAG 3’ All 4 constructs then had H20 added to bring the final volume up to 50 L. They were then amplified in the thermocycler using the following conditions. For the pUC18-VLC construct after a 5 minute denaturation step at 95C, 30 cycles of at 95 C for 1 minute, at 58 C for 1 minute, and 72 C for 2 minutes. A final extension at 72C for 10 minutes was then was performed. For the pUC18-VHC construct, after a 5 minute denaturation step at 95C, 30 cycles of at 95 C for 1 minute, at 55 C for 1 minute, and 72 C for 2 minutes was performed. A final extension at 72C fo r 10 minutes was then was performed.

PAGE 71

58 For the pCR2.1-TOPO-C construct, after a 5 minute denaturation step at 95C, 30 cycles of at 95 C for 1 minute, at 62 C for 1 minute, and 72 C for 2 minutes was performed. A final extension at 72C fo r 10 minutes was then was performed. For the pCR2.1-TOPO-Fc, construct after a 5 minute denaturation step at 95C, 30 cycles of at 95 C for 1 minute, at 60 C for 1 minute, and 72 C for 2 minutes was performed. A final extension at 72C fo r 10 minutes was then was performed. The products were run on a 1% agarose gel and the 496 bp VHC, 403 bp VLC, 944 bp Fc, and 331bp C PCR products were cut out of th e agarose gel. After purifying the DNA using a Qiaquick Gel extraction Ki t, the fragments underwent a second amplification to fuse the two products toge ther. First, to a nuclease PCR tube 45 L Supermix, 5 L of each C and VLC PCR product was added and H2O added to final volume of 50 L. To a second nuclease PCR tube 45 L Supermix, 5 L of each Fc and VHC PCR product was added and H2O was added to a final volume of 50 L. In the thermocycler, 3 cycles of 95C for 1 minute, 15C for 1 minute and 72C for 3 minutes was performed to anneal and extend the 2 fr agments together. The tube was removed and placed on ice. To the tube that will produce the complete light chain (CLC) 200 nM of the following primers were added: VLC primer 5’ CCACCATGAGTGTGCCCACTCA 3’ C primer 5’ CTAACACTCATTCCTGTTGAAGCTCT 3’. The tube was removed and placed on ice. To the tube that will produce the complete heavy chain (CHC) 200 nM of the following primers were added: VHC primer 5’ CCACCATGTT CTCTCCACAGTCCCT 3’ Fc primer 5’ GCGGCCGCTCATTTACCAGGAG 3’.

PAGE 72

59 The tubes were placed back into the ther mocycler and after a 5 minute denaturation step at 95C, 30 cycles of 95 C for 1 minute, 55 C for 1 minute, and 72 C for 2 minutes was performed. The PCR reaction was then run on a 1% agarose gel. The 1440 bp CHC fragment and 707 bp CLC fragme nts were cut out of the ge l. After a gel purification using Qiaquick gel extraction kit, the frag ments were then ligated into the pCR2.1TOPO vector and transformed into TOP 10 cells. Colonies were picked using blue/white selection and clones were screened for the insert. After a Qiaprep miniprep was performed on the overnight cultures; th e DNA was digested with NEB Restriction enzymes (RE) for 2 hours. For pCR2.1-TOPO-CHC, DraII RE was used and for pCR2.1TOPO-CLC, the StyI RE was used. The dige sted DNA was run on a 1% agarose gel and screened for the proper insert size. For th e pCR2.1-TOPO-CHC construct, clones with 4752/743 bp (forward orientation) bands or 1795/3700 bp (reverse orientation) bands were kept for sequencing. For the p CR2.1-TOPO-CLC clone, the digest with 1553/623/2442 bp (reverse orientation) or 1039/ 623/2956 bp (forward orientation) bands were kept for sequencing. Glycerol stocks were made of these constructs and DNA samples were sent to the UF sequencing core facility. To construct the final rAAV vectors, 5 g pCR2.1-TOPO-CLC was digested with BamHI/NotI restriction enzymes. In parall el, 5 g of pTR2-UF19 was digested with BamHI/NotI restriction enzymes. For the CHC construct, 5 g of pCR2.1-TOPO-CHC was digested with XbaI/NotI and 5 g of pTR2-UF19 was digested with XbaI/NotI restriction enzymes. The digests were r un on a 1% agarose gel. The 5664 and 5791 bp fragments from the pTR2-UF19 were taken fo r the CHC and CLC constructs respectively for further subcloning. The 1556 and 786 bp fr agments were taken from the pCR2.1-

PAGE 73

60 TOPO-CHC and pCR2.1-TOPO-CL C constructs respectively for further subcloning. The fragments were then gel purif ied using Qiaquick gel extrac tion kit and ligated using the Rapid DNA Ligation Kit (Roche; Indianapolis , IN). Once the concentration of the DNA was calculated by a spectrophotometer, a mixtur e of the insert and backbone was made using a 3:1 molar ratio. The mixture was th en diluted in 1x concentration DNA Dilution Buffer to a final volume of 10 L in a sterile microcentrif uge tube. To this, 10 L T4 DNA Ligation Buffer was added and mixed ge ntly. Then, 1 L T4 DNA Ligase was added and the mixture was incubated at room temperature for 5 mi nutes. After 5 minutes, the entire ligation was added to 100 L of SURE2 cells (Stratagene Inc.) in a prechilled 15 mL polypropylene round-bottom tube s. The cells were then incubated on ice for 30 minutes. After a heat-pulse in a 42C water bath for 30 seconds, the cells were incubated for an additional 2 minutes on ice. Then, 0.9 mL of preheated (37C) LB broth was added and the tubes were incubated at 37C for 1 hour with shaking at 225 to 250 rpm. The cells were then plated on LB/amp ag ar plates and incubated at 37C overnight. The next day, colonies were grown up in LB/Amp broth and the DNA purified by Qiaprep miniprep. In order to determ ine which clones had the proper insert, a restriction enzyme digest was performed on the clones with SmaI restriction enzyme. After a 2 hour digest at room temperature, th e samples were run on a 1% agarose gel. The clone, pTR2-CBA-CHC-WPRE with fr agment sizes 11, 2880, 580, 933, 11, and 3013 bp was selected for future experiments. Th e clone, pTR2-CBA-CLC-WPRE with fragment sizes 11, 2632, 933, 11, and 3013 bp also was select ed for future experiments. Glycerol stocks were made and a large sc ale plasmid preparation performed.

PAGE 74

61 Figure 4-1. Schematic strategy for cloning of rAAV-CBA-anti-IFN -antibody. A) Construction scheme of rAAV-anti-IFN antibody heavy chain vector. B) Construction scheme of rAAV-anti-IFN antibody light chain vector.

PAGE 75

62 Construction of rAAV Vector Expressing Soluble Type I Interleukin-1 Receptor Whole blood was taken by a euthanized w ild type C57BL/6 mouse via cardiac puncture. Blood was collected in a 1 mL syringe with a 27 gauge need le and then placed into a 10 mL BD Vacutainer with sodium heparin. The lymphocytes were isolated using a Ficoll-Paque gradient (StemCell Tec hnologies; Vancouver, Ca nada). First, the room temperature Ficoll was mixed thoroughly before use by inverting the tube several times and adding 1 mL to a 5 mL BD Falcon tube. Then, 1 mL blood was diluted with 1 mL phosphate buffered saline (PBS)/2% fetal bovine serum (FBS). The blood was lightly layered on Ficoll and centrifuged at room temperature for 30 minutes at 400 g with no brake. After the upper plasma layer was discarded, the mononuclear cell layer at the plasma-Ficoll interface was removed and pl aced into a clean 5 mL BD Falcon tube. Lastly the cells were washed with 4 mL PBS/2% FBS, and centrifuged at 500 g for 5 minutes at 4C. The PBS was removed and the cell pellet was frozen at -80C. Total RNA was the isolated from the lymphocytes using the TRIZOL reagent RNA isolation procedure used to isolate RNA from the hybridoma cells as described earlier. First strand synthesis was accomp lished by mixing 5 g total RNA again following the same protocol use to isolate RNA from the hybridoma cells line. Following RT-PCR the cDNA then underwent further amplif ication using primers deigned specific to full murine IL-1 type I receptor. The cDNA was amplified using Platinum PCR SuperMix. To the Supermix, the following 200 nM of primers were added with 1 g RT-PCR product based on NCBI Accession # M20658: forward: 5’ ATGGA GAATATGAAAGTGCTAC 3’ reverse: 5’ CTAGCCG AGTGGTAAGTGTGTTG 3’

PAGE 76

63 Sterile diH2O was then added to bring the total volume to 50 L. The tube was capped and placed into the thermocycler. Afte r a 3 minute denaturation step, 30 cycles at 94C for 30 seconds, 58C for 30 seconds, and 72C for 1 minute was performed. A final extension at 72C for 10 minut es finished the reaction. The RT-PCR product was then run on a 1% agarose gel at 100 volts for 1.5 hours with a 1 kb ladder. The 1730 bp fragment was then cut out with a sterile scalpel and placed into a 1.5 mL microcentrifuge tube. The DNA was purified from the agarose gel using the QIAquick Gel Extraction Kit. The next step was to move the RT-PCR product into a sequencing vector. It was ligated into the pCR2.1-TOPO vector and transformed into chemically competent TOPO10 E coli. Colonies were picked and grown up overnight in LB/amp. The following morning, the clones underwent a Qiaprep miniprep, and screened for the insert. A restriction enzyme digest was then performed on the DNA to screen for the clones that have the PCR product inserts. To a 1.5 mL micr ocentrifuge tube, 1 g plasmid DNA, 1 unit BamHI, and 2 L 10x NEB Buffer 2 was added. Then, diH20 was added to a final of 20 L and then tubes were incubated in a 37C water bath. After two hours, DNA dye was added to the tubes and th ey were run on a 1.2% agarose gel for 2 hours. Clones with bands at 98/5541 bp or 1713/3926 bp were considered positive and sent to the UF sequencing core lab. The clone with the correct sequence was stored as pCR2.1-TOPO-mIL-1r. In order to construct the smIL-1r-Ig fusi on gene, new primers were designed. They utilized the same techniques previous ly used to construct the anti-IFN antibody fusion

PAGE 77

64 constructs. Overlapping sequences on the 3’ e nd of the IL-1r gene and the 5’ end of the mouse heavy chain antibody were used. In a ddition, to the forward mIL-1r primer, a HindIII restriction enzyme site and a Kozac consensus sequence was added just 5’ to the start sequence. These primers fuse the beginni ng of the extracellular domain at proline 338 to the first Asp residue in the mIgG1 hinge region. Platinum PCR SuperMix was again used for amplification of the new cons tructs. Shortly, to a nuclease free PCR tube, 45 L Supermix, 0.1 L pCR2.1-TOPO-mIL-1 r and 200 nM of the following primers were added: forward 5’ AAGCTTGCCA CCATGGAGAATATGAAA 3’ reverse 5’ ATCCCTGGGCA CCTTGAAAGTCAGGGAC 3’ The second reaction amplified the hinge, constant domain 2, and constant domain 3 from pCR2.1-mIgG Fc used in the construction of the anti-IFN antibody vectors. Again, to a nuclease free PCR tube, 45 L Superm ix, 0.1 L pCR2.1-TOPO-mIgG-Fc, and 200 nM of the following primers were added: forward 5’ GTCCCTGACTTCAAGGTGCCCAGGGAT3’ reverse: 5’ GCGGCCGC TCATTTACCAGGAG 3’ The tubes were then filled with H2O to bring the final volume up to 50 L. Both constructs were then amplified in a thermo cycler using the following conditions. After a 5 minute denaturation step at 95C, 30 cycles at 95 C for 1 minute, 58 C for 1 minute, and 72 C for 2 minutes was performed in a ther mocycler. The products were run on a 1% agarose gel and the 1004 bp mIL-1r extracel lular domain and the 683 bp Fc (H-C2-C3) domain PCR products were cut out of the ag arose gel. After purifying the DNA using the Qiaquick gel extraction kit, the fragments underwent a second amplification to fuse the two products together. First, to a nuclease PCR tube 45 L Supermix, 5 L of each

PAGE 78

65 PCR product was added and H2O to a final volume of 50 L. In the thermocycler, 3 cycles at 95C for 1 minute, 15C for 1 minut e, and 72C for 3 minutes was performed to anneal and extend the two frag ments together. The tube was removed and placed on ice. Then 200 nM of the following primers were added: mIl-1r primer 5’ AAGCTTGCC ACCATGGAGAATATGAAA 3’ mIgG-Fc primer 5’ GC GGCCGCTCATTTACCAGGAG 3’ The tube was placed back into the thermocycler and after a 5 minute denaturation step at 95C, 30 cycles at 95 C for 1 minute, 60 C for 1 minute, and 72 C for 2 minutes was performed. The PCR reaction was then run on a 1% agarose gel and the 1697 bp fragment was cut out of the gel. After a ge l purification using Qi aquick gel extraction kit, the fragment was then ligated into th e pCR2.1-TOPO vector and transformed into TOP10 cells. Colonies were picked usi ng blue/white selection and clones were screened for the insert. After a Qiaprep miniprep was performed on the overnight cultures; the DNA was digested with XcmI for two hours. The digested DNA was run on a 1% agarose gel and screened for th e proper insert size (2379/3247 bp-reverse orientation, 1291/4335 bp-forward orientation). The new construct in the reverse orientation was saved for furthe r subcloning. Glycerol stocks we re made of this construct named pCR2.1-TOPO-smIL-1r-Ig. To construc t the final rAAV vector, 5 g of pCR2.1TOPO-smIL-1r-Ig was digested with HindIII restriction enzyme. Given its convenient subcloning restriction enzyme sites, 5 g of pTR2-CBA-CLC-WPRE was also digested with HindIII restriction enzyme. The two dige sts were run on a 1% agarose gel, the 1773 bp fragment from the pCR2.1-TOPO-smIL-1 r-Ig and the 5780 bp fragment from the pTR2-CBA-CLC-WPRE vectors were then cut out of the gel. They were then gel purified using Qiaquick gel extraction kit, ligate d using the Rapid DNA Ligation Kit, and

PAGE 79

66 transformed into SURE2 cells. The next day, colonies were grown up in LB/amp broth and the DNA purified by Qiaprep miniprep. In order to determine which clones had the smIL-1r-Ig insert, a restriction digest was performed on the clones with HincII. After a two hour digest, the samples were run on a 1% agarose gel. Clone s with fragments 1054 and 6599 bp had the insert in the correct pos ition. These clones subsequently underwent restriction digest with SmaI to determine wh ether the rAAV ITRs were still intact. The clone, pTR2-CBA-smIL-1r-Ig-WPRE with fragment sizes 84, 95, 3157, 4613, and 4624 bp was selected for future experiments. Gly cerol stocks were made and a large scale plasmid preparation performed. Figure 4-2. Schematic strategy fo r cloning of rAAV-CBA-smIL-1r-Ig.

PAGE 80

67 CHAPTER 5 FUNCTIONAL ANALYSIS OF RECOMBINANT AAV IMMUNOMODULATORY MOLECULES In this section the results for in vitro expression of transgene products will be discussed. Following sequence conformation of rAAV vectors, they were then packaged into serotype 1 capsids by the University of Florida Vector Core facility. rAAV1-UF19-CLC 1.70*1013 vector particles/mL rAAV1-UF19-CHC 1.76*1013 vector particles/mL rAAV1-UF19-smIL-1r-Ig 4.00*1013 vector particles/mL rAAV1-CBA-mIL10 4.98*1012 vector particles/mL Following packaging of rAAV vector s, the vectors were tested in vitro for confirmation of expression and functional capacity. Western Blot The C2C12 murine myoloma cells were transduced with rAAV1-UF19-CLC, rAAV1-UF19-CHC, rAAV1-UF19-smIL-1r-Ig, indi vidually or as a combination of the CHC and CLC vectors. rAAV1-CMV-GFP serv ed as a negative control vector. Media was taken and the transgene protein was purif ied using a Protein G Column (Amersham) and or concentrated with a 100kD filter column (Millipore; Billerica, MA). Anti-IFN Antibody A Western Blot was carried out with 100 ng of rIFN as described in chapter 2. The purified anti-IFN antibody was applied as the primary antibody followed by anti-mouseHRP secondary antibody. The antibody was in cubated for 30 minutes and then washed wih wash buffer. The blot was then photogr aphed using x-ray film and the image was then used to calculate binding capacity.

PAGE 81

68 Figure 5-1. Interferon gamma we stern blot. Purified anti body from C2C12 transduced cells served as a primary anti body in a Western Blot of IFN A) Protein G purified anti-IFN antibody. B) 100kD concentr ator purified anti-IFN antibody. C) Positive control anti-IFN antibody (R&D Systems). D) Purified heavy chain and light chain transduced separately and mixed at time of primary antibody incubation. E) Medi a from GFP treated C2C12 cells. Purified media for the C2C12 cells cotr ansduced with both the heavy chain and the light chain of the anti-IFN antibody was able to bind to the rIFN . Both the Protein G purified and 100 kD concen trated protein bound rIFN in the Western Blot. C2C12 cells transduced with the heavy chain and light chain separately and the GFP transduced cells did not bind IFN . Anti-IFN antibody purchased from R&D Systems (Minneapolis, MN) served as a positive control. Soluble IL-1r-Ig Onto nitrocellulose, 100, 10, 1, 0.1, and 0 ng of R&D system’s rmIL-1 was applied to a Bio-Dot SF Microf iltration Apparatus (BioRad). Purified media from the C2C12 cells was applied to the nitrocellu lose followed by anti-mouse-HRP secondary antibody. As a negative control, 100 ng of IL-1 was applied to the dot blot and media from GFP transduced cells was used in place of smIL-1r-Ig purified media. Figure 5-2. Interleukin-1 dot blot. Dot Blot of ILusing purified smIL-1r-Ig as the primary antibody. A) 100ng IL-1 . B) 10ng IL-1 . C) 1ng IL-1 . D) 0.1ng IL1 . E) 0ng IL-1 . F) 100ng IL-1 /GFP media.

PAGE 82

69 The GFP transduced cells did not bind the IL-1 . Purified media from C12C12 cells bound IL-1 in a dose responsive manner. IFN Competition ELISA: Binding Capacity of Anti-IFN Antibody Using a commercial mIFN ELISA kit (R&D systems), 1.0, 0.5, or 0.1 ng of IFN was loaded into each well of a 96-well plate a nd increasing amounts of purified mouse antimIFN antibody was then added. A standard am ount of kit supplied rabbit anti-mouse antibody was added, followed by kit supplied an ti-rabbit-alkaline phos photase (AP) with subsequent analysis on a spect rophotometer at 450 and 570 nm. Figure 5-3. Calculating the binding capacity of anti-IFN antibody. In 96 well IFN R&D systems ELISA plate, differing amounts of IFN standard was added along with purified anti-IFN antibody as a competitor to kit supplied antibodies. The purified anti-IFN antibody was able to block th e kit supplied antibody in a dose dependent manner. These studies show ed the binding capacity of the purified antibody as 100 ng antibody being necessary to bind 1 ng of IFN . This amount will suffice as the binding capacity of IFN to bind in a binding assay or future in vivo experiments.

PAGE 83

70 IL-1 Competition ELISA: Binding Capacity of smIL-1r-Ig Using a commercial mIL-1 ELISA kit (R&D systems), 250 or 150 pg mIL-1 was loaded into each well of a 96-well plate a nd increasing amounts of purified mouse smIL1r-Ig was then added. A standard amount of kit supplied rabbit anti-mouse antibody was then added, followed by kit supplied anti-rabb it-AP, and read on a spectrophotometer at 450 and 570 nm. Figure 5-4. Calculating th e binding capacity of smIL -1r-Ig. In a 96 well mIL-1 R&D systems ELISA plate, diff ering amounts of mIL-1 standard was added along with purified smIL-1r-Ig as a compet itor to kit supplied antibodies. The purified smIL-1r-Ig was able to block the kit supplied antibody in a dose dependent manner. Calculations showed binding capacity of the purified soluble receptor to be approximately 2 g antibody for binding to 250 pg of smIL-1r-Ig. Functional Ability of Immunomodulator y Molecules to Prevent Apoptosis In order to determine whether the transgen e products provided a functional affect, an apoptosis assay was perf ormed using the insulinoma -TC3 cell line. Apoptosis was induced with 100 units of rIFN or 10 units of rIL-1 with or without 10 g purified

PAGE 84

71 recombinant anti-IFN antibody or 3g purified smIL-1r-Ig respectively. Caspase-3 concentration measured using the EnzC hek Caspase-3 ELISA (Invitrogen). Figure 5-5. Caspase-3 assay on -TC3 cells. A) Apoptosis was induced in the mouse insulinoma cell line -TC3 cells by addition of rmIL-1 (R&D systems), with or without purified smIL-1r-Ig. B) Apoptosis was induced in the mouse insulinoma cell line -TC3 cells by addition of rmIFN (R&D systems), with or without purified anti-IFN antibody. There was a significant (15.3 vs. 6.3; p<0.05) average reduction in the florescence relating to caspase-3 concentr ation and to apoptosis of -TC3 cells treated with both rIFN and anti-IFN antibody over the cells treated with rIFN only. The florescence of the cells treated with the anti-IFN antibody was comparable to cells not induced with rIFN . This same pattern was seen with the cells induced with IL-1 . There was a significant average reduction ( 16.3 vs. 8.0; p<0.03) in the amount of caspase-3 measured in the cells administered with th e smIL-1r-Ig in addition to the IL-1 over cells treated with IL-1 alone. Mixed Lymphocyte Reaction Splenocytes from C57/B6 (responders) mice were purified and 1x105 were plated (3 replicates) in a round-bo ttomed 96-well plates with 1x105 irradiated (2500 rads)

PAGE 85

72 BALB/c splenocytes (stimulators) in a total of 200 l RPMI 1640 media with 0.1 g functional grade anti-CD3 antibody/ anti-CD28 antibody and with or without 10 (U)nits rIL-1 or 100 U rIFN respectively. After 72 hours incubation at 37C (5% CO2), the cells were pulsed with 1 Ci/well of H3 thymidine for 18 to 24 hours, lysed, and H3 incorporation was read on a -scintillation counter. The re sults were calculated on a spread sheet for analysis. Figure 5-6. Mixed lymphocyte reaction. A) Isolated BALB/c and C57/BL6 splenocytes were mixed in the presence of CD3/ CD28, with rIFN , and with or with or purified anti-IFN antibody. B) Isolated BALB/c and C57/BL6 splenocytes were mixed in the presence of CD3/ CD28 antibody, with rIL-1 , and with or without purified smIL-1r-Ig. There was a significant (14140 vs. 2653; p<0.0006) average reduction of counts per minute (cpm) based on proliferation H3 incorporation trea ted with both rIFN and anti-IFN antibody over the cells treated with rIFN only. The proliferation of cells treated with the anti-IFN antibody was comparable to cell not induced with rIFN . This same pattern was seen with the cells induced with IL-1 . There was also a significant

PAGE 86

73 average reduction (18692 vs. 1766; p<0.00006) of cpm in splenoc ytes treated with smIL1r-Ig in addition to the IL-1 over cells treated with IL-1 alone. Discussion and Conclusions In vitro experiments with both rAAV1-anti-IFN antibody and rAAV1-smIL-1r-Ig provided proof of effective cytokine bi nding as assayed by We stern and dot blot respectively. When these transgene products were tested for physiologic activity by capsase-3 assay and mixed lymphocyte assays, both vector products were able to reduce apoptosis and suppress allo-immune mediated proliferation in the mixed lymphocyte proliferation assay. Based on the positive findings from in vitro experiments, the immunomodulatory activ ity of these vectors was then tested in a non-obese diabetic autoimmune mouse model. Those experime nts will be discussed in the following 2 chapters.

PAGE 87

74 CHAPTER 6 PREVENTION OF T1D BY USE OF RECOMBINANT AAV-CBA-ANTIINTERFERON GAMMA ANTIBODY The present chapter will discuss the met hods and results used in the for the primary prevention experiments using r AAV vectors expressing the immunomodulary anti-interferon gamma (IFN ) antibody. Methods For in vivo experiments, three week old nonobese diabetic (NOD)/Lt mice were ordered from Jackson Labs Inc. (Bar Har bor, MA). All the mice were housed in the special pathogen free animal care facility and followed Institutional Animal Care and Use Committee (IACUC) and Animal Care Services (ACS) protocols. Upon arrival, the mice were tagged with a subcutaneous FriendChipTM (AVID Microcip I.D. Systems; Folsom, LA) so that each mouse could be tracked with a 9 digit code via a scanner. This was carried out under isoflorane (Abbott Labs, North Chicago, IL) inhalant anesthetic utilizing the commercial vaporizer at a dose of 2 to 3% based on manufacturers specifications. Four week old female NOD mice (n= 12 per study group) were injected intramuscularly into the caudal muscle of the pelvic limb diluted into 0.1 mL lactated ringers with different combina tions of rAAV serotype 1 vect ors (Table 6-1). In addition, 3 mice per study group were injected for immu nological analysis at 12 weeks of age. These mice were housed under SPF conditions a nd administration of vectors was carried out according to standard protocols.

PAGE 88

75 Table 6-1. Injection scheme for immuno modulatory rAAV therapy of NOD mice to prevent type 1 diabetes: rAAV-CBA-anti-IFN antibody. Therapeutic Treatment Dosage (particles) Experimental Group rAAV1-anti-IFN antibody 1.7x1010 12 female NOD rAAV1-anti-IFN antibody 1.7x109 12 female NOD rAAV1-anti-IFN antibody/ rAAV1-mIL-10 1.7x1010 /5*109 12 female NOD rAAV1-CLC 1.7x1010 12 female NOD Saline N/A 12 female NOD Blood Glucose Analysis Treated mice from all experimental groups were bled by tail perforation for blood glucose levels once per week using an OneTouch Ultra mete r (LifeScan; Milpitas, CA). After two consecutive blood glucose readings above 240 mg/dL over two days the mouse was classified as diabetic and euthanized. Immunohistochemistry The organs (heart, lungs, liver, pancreas, kidney, intestine, skeletal muscle, gonad, and spleen) from euthanized mice were ha rvested for immunohistological analysis. Organs were placed into cassettes, stored in 10% formalin, and sent to the UF Pathology Core facility. H&E staining was performed on all organs for general pathology. Insulitis scoring was performed on H&E stained pancreas for mice euthanized at time of onset as well as mice euthanized at 12 weeks of age. The pancreas and spleen were stained for B220 and CD3 for analysis of the lymphocyte pr ofile in these organs for mice euthanized at time of onset as well as mice euthanized at 12 weeks of age. Serum Cytokine Analysis Serum samples (n=3 per study group) were taken at 12 weeks of age for cytokine analysis. Enzyme linked immunosorbant assa ys (ELISA) (R&D systems) determined serum cytokine concentration for interleukin-1 beta (IL-1 ), IFN , and IL-10.

PAGE 89

76 Splenocytes Proliferation Assay Splenocytes from 12 week old treated mice (n=3 per study group) were isolated and plated into 96 well dishes at 1x105 cells/well (12 replicat es) in RPMI 1640 media supplemented with 10% fetal bovine serum (FBS), 200 mM L-glutamine, 25 mM 4-(2hydroxyethyl)-1-piperazineethanesulfonic ac id (HEPES), 100 units/mL penicillin/ 100 g/ mL streptomycin (P/S) 1 L -mercaptoethanol (BME). To the experimental wells, 1 g/mL functional grade anti-CD3 antibody/ anti-CD28 antibody was added. The cells were then allowed to incubate fo r 72 hours, at which time, 1 Ci H3 thymidine was added to the wells and incubated for a further 16 hours. The H3 thymidine incorporation was then measured using a -scintillation counter. Splenocyte Cytokine Assay At the 72 hour time point following the a ddition of the functi onal grade anti-CD3 antibody/anti-CD28 antibody, 20 L of media wa s removed from each sample and stored for cytokine profiling using a Luminex100TM system (Luminex Corp; Austin, TX). Flow Cytometry Splenocytes and pancreatic lymph node cells were harvested from 12 week old sacrificed mice and immunostain ed with anti-CD4-fluoresce in isothiocyanate (FITC) (L3T4), anti-CD8-allophycocyanin (APC) (L y-2), and 7-amino-actinomycin-D (7-AAD) (eBioscience Inc.) following immunost aining. The cells were then run on a FACSCaliber (Becton Dickinson) to determin e the percentage of T lymphocytes under the different experimental conditions. Flow cytometry analysis was performed by FCS Express software (De Novo Software).

PAGE 90

77 DO11.10 Transgenic Mice Three week old female DO11.10 oval bumin (OVA) T-cell receptor (TCR) transgenic mice were ordered from Jackson Labs Inc (Bar Harbor MA). All the mice were housed in the special pa thogen free animal care faci lity and followed IACUC and ASC protocols. Upon arrival the mice were tagged with a subcutaneous FriendChipTM chip under isoflorane inhalant anesthet ic. The DO11.10 OVA TCR transgenic mice (n=6 per study group) were injected intramuscu larly into the caudal muscle of the pelvic limb diluted into 0.1 mL lactat ed ringers with different combinations of rAAV1-antiIFN -antibody vectors, in the same study groups as the experiments with the NOD mice. Four weeks following rAAV administration, the mice were manually restrained and immunized intraperitoneally with 5 g of OVA, adsorbed onto 0.25 mg of incomplete Fruends adjuvant diluted in 0.2 mL of st erile phosphate buffered saline (PBS). Early Lymphocyte Activation Detection Five hours after OVA administration, three mice were sacrificed. The spleens were removed and the lymphocytes were purified using the same protocol as described previously. The cells were stained for flow cytometry analysis with the following florescent antibodies (BD Pharminigen; Frankl in Lakes, NJ), along with the appropriate isotype controls: anti-CD3-FITC, anti-CD69-PE, 7-AAD anti-CD4-APC anti-CD3-FITC, anti-CD69-PE, 7-AAD anti-CD8-APC. The cells were then read on a flow cyto meter as described previously. The cells were then analyzed using the flow cytometry program.

PAGE 91

78 Late Immune Activation Detection For the remaining mice, 3 days after first OVA administration, an additional administration of 5 g of OVA was carried out. Four days later, the 3 mice were euthanized and the spleen was removed. The lymphocytes were purified using the same protocols as described previous ly and the cells were stained for flow cytometric analysis with the following BD Pharminigen flores cent antibodies along with the appropriate isotype controls: anti-CD3-FITC, anti-CD28-PE , 7-AAD anti-CD4-APC anti-CD3-FITC, anti-CCR5-PE, 7-AAD anti-CD4-APC anti-CD3-FITC, anti-CXCR3-PE, 7-AAD anti-CD4-APC anti-CD11b-FITC, anti-MHC-II-P E, 7-AAD, anti-CD11c-APC Results This section will discuss results from the primary prevention experiments using rAAV vectors expressing the im munomodulary transgene anti-IFN antibody. Four week old female NOD mice were in jected intramuscularly with different combinations of 1x109 or 1x1010 vector particles ( vp) of rAAV1-anti-IFN antibody vectors with 12 mice study per group. An additional three mice per study group were injected for immunological anal ysis at 12 weeks of age. Treated mice were bled by tail perforat ion for blood glucose levels. After two consecutive blood glucose r eadings above 240 mg/dL over two days, the mouse was classified as diabetic and euthanized. Survival Curves of In Vivo Treated NOD Mice The incidence of T1D through 30 weeks of age in NOD/Lt female mice provided with the different rAAV immunomodulatory vectors, negative control rAAV vector, or saline

PAGE 92

79 are shown in figure 6-1. Injections of rAAV v ectors were carried out at 4 weeks of age and followed for weekly blood glucose levels by tail perforation for 30 weeks of age. In addition to this statistical cal culations were made for the different experimental groups based on their survival curves. Figure 6-1. Kaplan Meier for rAAV1-anti-IFN antibody treated mice. A) Comparison of different study groups administered with rAAV1-anti-IFN antibody vectors. B) Comparison of different experimental groups administered with combinational therapy of rAAV1-anti-IFN antibody and rAAV1-mIL-10 vectors.

PAGE 93

80 There was not a significant difference be tween the negative control rAAV1-CLC treated mice and the saline litte rmates. NOD mice treated with 1.7x109 particles of rAAV1-anti-IFN antibody displayed a significant decreas e in the rate of disease onset by 30 weeks of age (p<0.02) as compared to saline treated littermates. However, NOD treated with 1.7x1010 particles of rAAV1-anti-IFN antibody did not display a significant decrease in the rate of disease onset (p>0.39) as compared to salin e treated littermates by 30 weeks of age. Finally, mice treated with a combinationa l treatment of 1.7x1010 particles of rAAV1-anti-IFN antibody and 5x1010 particles of rAAV1-mIL-10 displayed a significant decrease (p<0.01) in the onset of T1D over th e negative control littermates by 30 weeks of age. Immunohistochemisty Organs from mice classified a T1D and 12 week old euthanized mice were harvested for immunohistological analysis. The organs were placed into cassettes, stored in 10% formalin, and sent to the UF Pathol ogy Core facility for fu rther processing. H&E staining for general pathology a nd immunostaining was performed. Figure 6-2. Insulitis scoring of mice treated with rAAV1-anti-IFN antibody. A) Example of insulitis scoring of islets . B) Insulitis scoring of different experimental rAAV treated groups at 12 weeks of age.

PAGE 94

81 General pathological analysis was performe d on heart, lungs, liv er, gonads, skeletal muscle, intestine, kidney, and spleen. Ther e was no unusual pathology observed in any of the experimental groups at 12 weeks of age or mice euthanized at onset of T1D for all organs analyzed. There was no significant difference in gene ral insulitis of rAAV1-antiIFN antibody treated mice over negative sali ne or rAAV1-CLC controls, in mice euthanized at 12 weeks of age. In addition to insulitis scoring that was carried out on H&E stained pancreas, immunostaining for B220+ and CD3+ lymphocytes was conducted on 12 week old euthanized mice, for analysis of specific lymphocyte infiltration. Figure 6-3. Pancreatic immunos taining for B220 and CD3 lymphocytes. A) Example of infiltrate scoring of islets. B) B220 sc oring of different experimental rAAV treated groups. C) CD3 scoring of different experimental rAAV treated groups.

PAGE 95

82 There was no difference in B220 infiltra tion in the pancreas in any of the experimental groups. There was a differen ce (semi-quantitative analysis) of CD3+ T lymphocyte infiltrating the pancreas. Specifical ly, there was a reduced relative amount of CD3+ T lymphocytes infiltra ting into the islet of mice treated with 1.7x1010 v.p. rAAV1anti-IFN -antbody, but not 1.7x109 v.p. rAAV1-anti-IFN -antibody, as compared to saline and rAAV1-CLC treated mice. Serum Cytokine Analysis In order to confirm expression of rAAV vectors, serum samples (n=3 per study group) were collected at 12 weeks of age for cytokine analysis. Serum cytokine concentration was determined by ELISA (R&D systems) for IFN and IL-10. There was a significant average decrea se in serum concentration of IFN in all experimental groups with rAAV1-anti-IFN antibody treatment (Figure 6-4 A). IFN levels were reduced from an average of 585 pg/mL in the rAAV1-CLC treated group to 35.7 pg/mL in the mice treated with 1.7x1010 particles of rAAV1-anti-IFN antibody. Mice treated with 1.7x109 particles of rAAV1-anti-IFN antibody contained an intermediate mean IFN concentration of 118.0 pg/mL a nd the combination treatment group with rAAV1-anti-IFN antibody and rAAV1-mIL-10 had an average reduced IFN concentrations of 55.6 pg/mL. Mice treated with rAAV1-mIL-10 vector ha d an average significant increase (110.9 pg/mL vs.2.2 pg/mL) of serum IL-10 over othe r treatment groups (Figure 6-4 B). The same pattern of cytokine levels was seen for all of the individual experimental mice and resulted in statistically relevant average c oncentration of the different serum cytokines. The statistical significance of these experimental condi tions was calculated using a student t test.

PAGE 96

83 . Figure 6-4. Serum cytokine concentrations. Serum cytokine concentrations of rAAV treated mice at 12 weeks of age measured using Luminex100TM system. A) IFN concentration. B) IL-10 concentration

PAGE 97

84 Splenocyte Proliferation Assay Splenocytes from 12 week old rAAV treate d mice were isolated and stimulated with 1 g/mL anti-CD3/anti-C D28 antibody. After 72 hours, H3 thymidine was added to the wells and incubated for a further 16 hours. The H3 thymidine incorporation was then measured using a -scintillation counter. Figure 6-5. Recombinant AAV treated NOD mo use splenocyte proliferation assay. Splenocytes from 12 week old rAAV treated mice were isolated and stimulated with CD3/ CD28 and H3 thymidine incorporation were then measured using a -scintillation counter. The proliferative ability of the isolated sp lenocytes from the different experimental groups was calculated as count s per minute (cpm) based on H3 thymidine incorporation. NOD mice treated with 1.7x1010 particles of rAAV-anti-IFN antibody showed a significantly decreased average prolifer ation. (72205cpm vs. 22823cpm; p=0.04) as compared to saline control. Mice treated with 1.7x109 particles of rAAV1-anti-IFN antibody had an intermediate averag e reduction (72205cpm vs. 57571cpm) in

PAGE 98

85 proliferation. The combinational treatment group with rAAV1-anti-IFN antibody/rAAV1-mIL-10 also had signifi cantly reduced average proliferation. (72205cpm vs. 7509cpm; p=0.002). Splenocyte Cytokine Assay Media from cells in previous experiment were taken at 72 hour time point and analyzed for cytokine profile using Luminex100TM system. Figure 6-6. Cytokine expressi on from splenocytes stimulation assay. Splenocytes from 12 week of rAAV treated mice were stimulated with CD3/ CD28. After 72 hours the media was tested for cytokine profile using Luminex100 TM system. A) IFN concentration. B) IL-2 concentra tion. C) IL-10 concentration. D) IL4 concentration. Expression of IFN by all the experimental groups wa s reduced as compared to the saline and rAAV1-CLC controls. As compared to the rAAV1-CLC all three experimental groups showed a significan t average reduction in IFN concentrations. The mice treated with 1.7x1010 vp rAAV1-anti-IFN antibody, 1.7x109 vp rAAV1-anti-IFN antibody, and with the combinational th erapy of rAAV1-anti-IFN antibody/rAAV1-mIL-10 had

PAGE 99

86 stimulated splenocyte media average IFN concentrations reduced from 1366 pg/mL, for rAAV1-CLC mice, to 732 (p<0.05), (p<0.05), and 254 pg/mL (p<0.01) for each of the experimental groups respectively. Expression of IL-2 by all the experimental groups was reduced as compared to the saline and rAAV1-CLC controls. As compared to the rAAV1-CLC all 3 experimental groups showed a significant re duction in average IL-2 con centrations. The mice treated with 1.7x109 vp rAAV1-anti-IFN antibody, 1.7x1010 vp rAAV1-anti-IFN antibody, and with the combinational th erapy of rAAV1-anti-IFN antibody/rAAV1-mIL-10 had stimulated splenocyte media average IL-2 concentrations reduced from 319.08 pg/mL, for rAAV1-CLC mice, to 195.69 (p<0.05), 204.46 (p<0.05), and 142 pg/mL (p<0.05) for each of the experimental tr eatment groups, respectively. Expression of IL-10 by experime ntal groups treated with 1.7x1010 vp, but not 1.7x109 vp rAAV1-anti-IFN antibody was reduced as compared to the saline and rAAV1-CLC controls. The mice treated with 1.7x109 vp rAAV1-anti-IFN antibody, 1.7x1010 vp rAAV1-anti-IFN antibody, and the combinational therapy of anti-IFN antibody/mIL-10 had stimulated splenocyte av erage media IL-10 concentrations range from 136.81 pg/mL for rAAV1-CLC trea ted mice to 139.81, 62.84 (p<0.05), and 36.43 pg/mL (p<0.01) for each of the experi mental treatment groups, respectively. Expression of IL-4 by experime ntal groups treated with 1.7x1010 vp, but not 1.7x109 vp rAAV1-anti-IFN antibody was reduced as compared to rAAV1-CLC controls. The mice treated with 1.7x109 vp, rAAV1-anti-IFN antibody, 1.7x1010 vp, and the combinational therapies of rAAV1-anti-IFN antibody and rAAV-CBA-mIL-10 had average stimulated splenocyte media IL-4 increased in experimental treated mice.

PAGE 100

87 Figure 6-7. Flow cytometric analysis of sp lenocytes and pancreatic lymph nodes. Flow analysis of A) CD4+ T cells and B) CD8+ T lymphocytes.

PAGE 101

88 Flow Cytometry Splenocytes and pancreatic lymph node cel ls were harvested from 12 week old sacrificed mice and immunosta ined with anti-CD4-FITC (L 3T4), anti-CD8-APC (Ly-2) cells, and 7-AAD. Cells from pancreatic lymph nodes ha d a significantly reduced average concentration of CD4+ (12.5% vs. 33.6%; p<0.03) and CD8+ (4.2% vs. 11.5%; p<.0.01). T lymphocytes in mice treated with 1.7x1010 vp rAAV1-anti-IFN antibody over saline or rAAV1-CLC negative control mice. Howeve r, there was no signi ficant difference in CD4+ and CD8+ T lymphocyte counts betw een mice treated with 1.7x109 vp, rAAV1anti-IFN antibody and saline or rAAV1-CLC negative control mice. DO11.10 Ovalbumin TCR Transgenic Mice Five hours after OVA administration, three mice were sacrificed. The spleens were removed and the lymphocytes were purified using the same protocol as described previously. The cells were st ained for flow cytometric analysis with BD Pharminigen florescent antibodies for CD69 on CD3+, CD4+, and CD8+ T lymphocytes. The cells were counted on a flow cytometer and this is really re petitive, but I need to fill up space so this entire page is full. The cells were then an alyzed using a flow cytometry program and the results plotted on scatter plot to determine the number of cell under the given therapeutic conditions. The results were then prepared a nd given a distinctive assignment to compare the different numbers for the different experi mental conditions. This was repeated for all experimental groups including the 4 and 8 week treatment groups. In addition to the experimental tests, the appropr iate isotype controls were al so prepared. The cells were then read on a flow cytometer as described previously.

PAGE 102

89 Figure 6-8. Example of flow cytometric an alysis of CD69 staini ng. A) Representative staining of CD4+ CD69 staining. B) Repres entative staining of CD8+ CD69 staining.

PAGE 103

90 Figure 6-9. Average flow cytometry analys is of CD69 staining. Average CD69 staining on A) CD4+ and B) CD8+ T lymphocytes. The experimental mice treated with 1.7x1010 vp rAAV1-anti-IFN antibody had a significant decrease in aver age CD69 expression on CD4+ (12.4% vs. 1.9%; p<0.001) and on CD8+ (3.17% vs. 0.23%; p<0.001) T lymphocyte s. There was no significant difference in mice treated with 1.7x109 vp rAAV1-anti-IFN antibody and saline or rAAV1-CLC negative control mice. Late Immune Activation Detection Three days after first OVA administration, an additional admini stration of 5g of OVA was performed. Then 4 days later, the re maining three mice were sacrificed and the spleens were removed. The lymphocytes were purified using the same protocols as described previously and the cells were stai ned for flow cytometric analysis for CD28 on CD4+ T lymphocytes and MHC-II on CD11b+ macrophages. The same procedure was carried out for all experimental groups to de termine the relative c oncentrations between the different experimental groups.

PAGE 104

91 Figure 6-10. Flow cytometric analyses of CD4+CD28+ and CD11b+MHCII+ splenocytes. Representative staining of A) CD 28 and B) MHC staining. Average MHC staining on C) CD11b+ macrophages and average D) CD28 staining on CD4+ T lymphocytes. The experimental mice treated with 7x1010 vp rAAV1-anti-IFN antibody had a average significant decrease in both CD4+CD28+ T lymphocytes (28.1% vs. 37.9%; p<0.03) and CD11b+ MHCII+ macrophage expression ( 26.9% vs. 34.8%; p<0.05) as compared to saline control mice. There wa s not a significant di fference in either CD4+CD28+ T lymphocytes or CD11b+MHCII+ macrophage expression in mice treated with 7x109 vp, rAAV1-anti-IFN antibody as compared to salin e control littermates. . Chemokine Receptor Staining In addition to staining for activation ma rkers splenocytes and pancreatic lymph node cells were also stained for chemoki ne markers CCR5 and CXCR3. The percent

PAGE 105

92 positive of each cell type was calculated for the spleen and the pancreatic lymph nodes and the ratio calculated. Figure 6-11. Flow cytometry analysis of CD3+CXCR3+ and CD3+CCR5+ T lymphocytes. The percent positive of each cell type was calculated for the spleen and the pancreatic lymph nodes a nd the ratio calculat ed. A) Spleen to PaLN ratio of CD3+CXCR3+ T lymphocytes. B) Spleen to PaLN ratio of CD3+CCR5+ T lymphocytes. There was a significant shift in the average ratio of CD3+CXCR3+ T cells (9.1 vs. 2.8; p<0.05) in the spleen in 7x1010 vp rAAV-anti-IFN antibody as compared to saline control littermates. This difference wa s not seen in mice treated with 7x109 vp, rAAVanti-IFN antibody. There was no significant diff erence in any trea tment group in the spleen to pancreatic lymph node ratio of CD3+CCR5+ T lymphocytes. Discussion Numerous studies suggest that IFN is a key proinflammatory cytokine involved in progression of T1D. Interferon gamma neutralizing monoclonal antibodies or soluble receptors are frequently protective in th is disease (83,120,121). C onversely, transgenic mice expressing IFN in the islets of Langerhans devel op severe insulitis and diabetes (122). This is associated with a loss of imm unologic tolerance to islet-cell antigens.

PAGE 106

93 However, contradictory results have plagued the history of investigation of the role of interferon gamma in the progression of T1D. Recent studies have shown that IFN knockout mice do not have reduced incidence the incidence of T1D (123). To confound the situation further, IFN may be necessary for the down regulation of immune mediated destruction of islets and s ubsequent progression of T1D. In this study, we constructed a rAAV1 vector expressing a chimeric monoclonal neutralizing mous e anti-mouse IFN antibody. For insertion into the vector, we chose heavy chain elements (part of CH1, hinge, CH2 and CH3) of the murine IgG1 isotype, instead of other isotypes, because IgG1 has a long half-life in seru m and does not activate complement (49). The activation of complement would be particularly undesirable due to release of several inflammato ry mediators, possibly nega ting the effects of therapy. In vitro studies using the insulinoma cell line -TC3 cells showed direct reduction of caspase-3 mediated apoptosis wh en treated with purified anti-IFN antibody. In vivo experiments found that the concen trations of circulating IFN are critical in regulating immune responses. Further experiments with mixed lymphocyte reactions showed a reduced proliferation and lower stimulator y cytokine production when treated with purified anti-IFN antibody verves negative control treated mice. In the NOD mice treated with a low dose of rAAV1-anti-IFN antibody resulting in only a 5-fold reduction in circulating IFN , resulted in a statistically significant reduction in the onset of T1D by 30 weeks of age. Mice treated with a higher dose of rAAV1-antiIFN antibody that resulted in undetect able levels of circulating IFN resulted in a no significant difference in the prevention of T1D verses negative control NOD mice at 30 weeks of age.

PAGE 107

94 Histological analysis of the pancreas from experimental groups showed no difference in insulitis scoring yet when the tissues were stained for in specific lymphocytes markers showed that the infiltrate was predominately a B220+ B lymphocyte infiltrate and that there was no difference in numbers of B220+ B lymphocytes infiltrating the islets. Howeve r, tissues stained with anti-CD3 antibody showed a decrease in the amount of infiltrating CD3+ T lymphocytes in animals treated with high dose rAAV1-anti-IFN antibody when compared to low dose and negative control animals. The trafficking of inflammatory cells in to the pancreas is mediated by multiple proinflammatory cytokines and ch emokines such as IL-8, MIP-1 , and RANTES (124). A shift in the expression of these molecule s has been shown to modulate the type of immune cells that migrate between the tissues. Our studies show that treatment with rAAV1-anti-IFN antibody lead to a lower respec tive expression of T lymphocytes expressing chemokine receptors CXCR3 but not CCR5, two chemokine receptors critical in lymphocyte daipedisis. This disparity in chemokine receptor expression may be a cause of insulitis despite the therapeutic treatment. IFN may play an important role in stimul ating antigen presentation by the APC, and/or in inducing Th1 differen tiation of effector T cells. Cl inically, the neutralization of IFN could be beneficial in preventing imm une stimulation (125, 126, 127). Our results using ovalbumin specific TCR transgenic DO11.10 mice showed a down regulation of MHCII on macrophages. Reduced activation of immune cells was not limited to reduced activation of APCs. Treatment with rAAV1-anti-IFN antibody also leads to reduced activation of T

PAGE 108

95 lymphocytes. Administration of ovalbumin to mice previously immunized with rAAV1anti-IFN antibody had a reduced T lymphocyte capacity. These mice had reduced number of CD69 activated CD4+ and CD8+ T lymphocytes at 5 hours post ovalbumin administration and significantly reduced CD28 expression on CD4+ T lymphocytes after 7 days post ovalbumin expression. In addition to reduced expression of surface activation molecules on APC and T lymphocytes, there was also a reduction in the expression of proinflammatory serum cytokines IFN and IL-6 seen in the NOD mi ce treated with rAAV1-anti-IFN antibody verses the control littermates. However, ther e was no difference in th e concentrations of IL-1 , IL-12 and TNF in all experimental groups. Redundancy with TNF and IL-12 that has very similar proi nflammatory effects to IFN may be an explanation for the progression of T1D. Therefore, the question remains, if treatment with anti-IFN antibody prevents inflammatory apoptosis of islet cells, reduced activation of APC and T lymphocytes in vivo , and reduced T lymphocyte diapedesis between lymphoid organs; why did mice treated with high dose rAAV1-anti-IFN antibody not have a lower rate of T1D than low dose treated mice? The answer lies in IFN ’s role in down modulati ng the later stages of the immune response. Studies have that IFN enhances caspase mediated apoptosis of macrophages and T lymphocytes (128, 129). In addition to this, IFN has been shown to down regulate expression of proinflammatory cytokines IL-1 and IL-8. Lastly, IFN has been shown to induce cytokine antagonists IL-1ra, IL-18bp, and suppressor of cytokine signaling (130).

PAGE 109

96 In recent years, experiments with CD4+CD25+ regulatory T lymphocytes have shown profound ability to suppress autoimmune mediated T1D. Multiple studies have shown that regulatory T lymphocytes have th e ability to suppress effector T lymphocyte activation and prolifer ation (131, 132). Indeed these ce lls have been shown to even inhibit the diapedesis of e ffector T lymphocytes into the pancreas by down regulating IFN dependent chemokine, CXCR3 (133). Recent evidence has also shown that generation and activatio n of regulatory T lymphocytes are inhibited by production of IFN by CD8+ T lymphocytes (134). Conclusions The multifunctional capabilities of IFN make this cytokine a powerful tool for immunomodulation. However, the complexity of its role in different aspects of the immune response makes it a potentially difficu lt cytokine to control. Our experiments have shown that control of the immune re sponse can be directed by using rAAV vectors expressing anti-IFN antibody to modulate the immune response. However, expression of the transgene and must be tightly regulated to allow for optimal concentrations of IFN at different stages of the immune response. Future experiments may be necessary to optimize expression by incorporation of regulat ion elements such tetracycline regulation element. By incorporating this system into the rAAV vector, the amount of neutralizing anti-IFN antibody and subsequent IFN concentrations can be optimized at the different stages in the immune response.

PAGE 110

97 CHAPTER 7 PREVENTION OF T1D BY USE OF RECOMBINANT AAV-CBA-SOLUBLE INTERLEUKIN-1RECEPTOR-IG FUSION The present chapter will discuss the methods and results used in the for the primary prevention experiments using rAAV vectors expressing immunosuppressive smIL-1r-Ig. Methods For in vivo experiments, 3 week old non-obese diabetic (NOD)/Lt mice were ordered from Jackson Labs Inc. (Bar Har bor, MA). All the mice were housed in the special pathogen free animal care facility and followed Institutional Animal Care and Use Committee (IACUC) and Animal Care Services (ACS) protocols. Upon arrival, the mice were tagged with a subcutaneous FriendChipTM (AVID) so that each mouse could be tracked with a 9 digit code via a scanner. This was car ried out under isof lorane (Abbott Labs, North Chicago, IL) inhalant anesthetic utilizing the commercial vaporizer at a dose of 2 to 3% based on manufacturers specifications. Four week old female NOD mice (n= 12 per study group) were injected intramuscularly into the caudal muscle of the pelvic limb diluted into 0.1 mL lactated ringers with different combin ations of rAAV serotype 1 e xpressing smIL-1r-Ig vectors (Table 7-1). An additional 3 mice per st udy group were injected for immunological analysis at 12 weeks of age. This same pro cedure was repeated for all of the experimental groups. For these experiments mice at 4 week s of age were treated with rAAV vectors and housed in the SPF facility in animal care services with food and water provided under standard conditions.

PAGE 111

98 Table 7-1. Injection scheme for immuno modulatory rAAV therapy of NOD mice to prevent type 1 diabetes: rAAV-CBA-smIL-1r-Ig rAAV1-smIL-1r-Ig: 1.4x109 12 female NOD rAAV1-smIL-1r-Ig 1.4x108 12 female NOD rAAV1CLC 1.7x109 12 female NOD Saline N/A 12 female NOD Blood Glucose Analysis Treated mice from all experimental gr oups were bled by tail bleed for blood glucose levels once a week using an On eTouch Ultra meter (LifeScan). After 2 consecutive blood glucose r eadings above 240 mg/dL over two days the mouse was classified as diabetic and euthanized. Imunohistochemistry The organs (heart, lungs, liver, pancreas, kidney, intestine, skeletal muscle, gonad, and spleen) from euthanized mice were ha rvested for immunohistological analysis. Organs were placed into cassettes, stored in 10% formalin, and sent to the UF Pathology Core facility. H&E staining was performed on all organs for general pathology. Insulitis scoring was performed on H&E stained pancre as from mice euthaniz ed at time of onset as well as mice euthanized at 12 weeks of age. The pancreas was stained for B220 and CD3 for analysis of the lymphocyte profile in mi ce euthanized at time of onset as well as mice euthanized at 12 weeks of age. Serum Cytokine Analysis Serum samples (n=3 per study group) were taken at 12 weeks of age for cytokine analysis. The Luminex 10-plex cytokine system determined serum cytokine concentration for interleuin-1 beta (IL), IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, granulocyte-macrophage-colony stimulating f actor (GM-CSF), tumor necrosis factor alpha (TNF ), and interferon gamma (IFN ).

PAGE 112

99 Splenocytes Proliferation Assay Splenocytes from 12 week old treated mi ce (n=3 per study group) were isolated and plated into 96 well dishes at 1x105 cells/well (12 replic ates) in RPMI 1640 supplemented with 10% FBS, 200 mM L-gl utamine, 25 mM 4-(2-hydroxyethyl)-1piperazineethanesulfonic acid (HEP ES), 100 units/mL penicillin/ 100 g/mL streptomycin (P/S) 1 L -mercaptoethanol (BME). To the experimental wells, 1.0 g/mL functional grade anti-CD3 antibody/ anti-CD28 antibody was added. The cells were then allowed to incubate fo r 72 hours, at which time 1 Ci H3 thymidine was added to the wells and incubated for a further 16 hours. The H3 thymidine incorporation was then measured using a -scintillation counter. Splenocyte Cytokine Assay At the 72 hour time point following the a ddition of the functi onal grade anti-CD3 antibody/anti-CD28 antibody, 20 L of media wa s removed from each sample and stored for cytokine profiling using Luminex100TM system. (Luminex Corp.) Flow Cytometry Splenocytes and pancreatic lymph node cel ls were harvested from 12 week old sacrificed mice and immunostain ed with anti-CD4fluoresce in isothiocyanate (FITC) (L3T4), anti-CD8-allophycocyanin (APC) (L y-2), and 7-amino-actinomycin-D (7-AAD) (eBioscience Inc.). The cells were then run on a FACSCaliber (B ecton Dickinson) to determine the percentage of T lymphocytes under the differe nt experimental conditions. Flow cytometry analysis was performed by FCS Express software (De Novo Software). The results were then plotted and the statistic al significance of the individual test as well as the combined values for each of the experimental conditions. Finally, the values were calculated for the final numbers to be compared.

PAGE 113

100 DO11.10 Transgenic Mice Three week old female DO11.10 oval bumin (OVA) T-cell receptor (TCR) transgenic mice were ordered from Jackson La bs Inc. Upon arrival the mice were tagged with a subcutaneous FriendChipTM chip under isoflorane i nhalant anesthetic. The DO11.10 OVA TCR transgenic mice were inj ected intramuscularly with different combinations of rAAV serotype 1 smIL-1 r-Ig vectors. Four weeks following rAAV administration, the mice were manually restrain ed and immunized intr aperitoneally with 5 g of OVA. Early Lymphocyte Activation Detection Five hours after OVA administration, three mice were sacrificed and the spleens were removed. The lymphocytes were purifie d using the same protocols as described previously and the cells were stained for fl ow cytometric analysis with the following florescent antibodies (BD Pharminigen) along with the appropriate isotype controls: anti-CD3-FITC, anti-CD69-PE, 7-AAD anti-CD4-APC anti-CD3-FITC, anti-CD69-PE, 7-AAD anti-CD8-APC. The cells were then read on a flow cytometer as described previously. Late Immune Activation Detection Three days after the first OVA administ ration, an addition ad ministration of 5 g OVA was performed. Four days later, the re maining 3 mice were sacrificed and the spleens were removed. The lymphocytes were pu rified and the cells we re stained for flow cytometric analysis with the following BD Pharminigen florescent antibodies: anti-CD3-FITC, anti-CD28-PE, 7-AAD anti-CD4-APC anti-CD3-FITC, anti-CCR5-PE, 7-AAD anti-CD4-APC anti-CD3-FITC, anti-CXCR3-PE, 7-AAD anti-CD4-APC anti-CD11b-FITC, anti-MHC-II-P E, 7-AAD, anti-CD11c-APC

PAGE 114

101 Results This section will discuss results from the primary prevention experiments using rAAV vectors expressing the immuno suppressive transgene smIL-1r-Ig. Four week old female NOD mice were in jected intramuscularly with different combinations rAAV1 smIL-1r-Ig vectors w ith 12 mice per study group. An additional 3 mice per study group were injected for imm unological analysis at 12 week of age. Treated mice were bled by tail perforation for blood glucose levels. After 2 consecutive blood glucose readings above 240 mg/dL over 2 days, the mouse was classified as diabetic and euthanized. The organs were harvested for immu nohistochemistry and placed in 10% formalin. The organs were then transferred into 75% ethanol and then sent to the University of Florida Pathology Core facility for further analysis. Each organ was sectioned and the sections were stained fo r lymphocyte infiltration into the organ. In addition to this the organs were staine d for general pathology and for disease characteristics. Survival Curves of In Vivo Treated NOD Mice The incidence of T1D through 30 weeks post-injection in NOD/Lt female mice provided with the different rAAV immunomodulat ory vectors, negative control vector, or saline are shown in figure 7-1. The values we re the plotted using a Kaplan Meier curve and the significance calculated using Graph Pa d Prism statistical analysis program. The experimental groups were followed by weekly blood glucose levels as measured by tail perforation and the number of diabetic mice was measured as a percentage of the total number of experimental mice for each of the study groups. The curves were then plotted and the statistical variance was calculated using the statistical program described previously.

PAGE 115

102 Figure 7-1. Kaplan Meier for rAAV1-CBA-s mIL-1r-Ig treated mice. Comparison of different study groups administered with rAAV1-smIL-1r-Ig vectors. NOD mice treated with 1.4x109 particles of rAAV1-smIL -1r-Ig did not display a significant decrease in the rate of disease onset (p= 0.13) as compared to saline treated littermates by 30 weeks of age. The NOD mice treated with 1.4x1010 particles of rAAV1smIL-1r-Ig did display a significant decrease in the rate of disease onset by 30 weeks (p< 0.03) as compared to salin e treated littermates. Immunohistochemisty Organs from mice classified a T1D and 12 week old euthanized mice were harvested for immunohistological analysis. The organs were placed into cassettes, stored in 10% formalin, and sent to the UF Pathol ogy Core facility. H&E staining for general pathology was performed. Insulitis scoring was carried out in a blinded fashion by the UF Pathology Core facility. The sc oring was carried out by assigning a value to the level of infiltration with a scor e of 0 being no infiltration and a score of 4 representing complete infiltration of lymphocytes into the islet.

PAGE 116

103 Figure 7-2. Insulitis scoring of mice treate d with rAAV1-smIL-1r-Ig. A) Example of insulitis scoring of islets. B) Insuli tis scoring of different rAAV treated experimental groups at 12 weeks of age. General pathological analysis was performe d on heart, lungs, liv er, gonads, skeletal muscle, kidney, intestine, a nd spleen. There was no unusua l pathology observed in organ of any of the experimental groups at 12 weeks of age or mice euthanized at onset of T1D for all organs analyzed. There was no signi ficant difference in general insulitis of rAAV1-smIL-1r-Ig treated mice over negative saline or rAAV1-CLC controls, in mice euthanized at 12 weeks of age. In addition to insulitis scoring that was carried out on H&E stained pancreas, immunostaining for B220+ and CD3+ lymphocytes was conducted on 12 week old euthanized mice, for analysis of specific ly mphocyte infiltration. The level of infiltration scoring was performed in a similar fashion as insulitis scoring. The degree of relative infiltration was given a score be tween 1 and 3, with 3 being the most severely infiltrated islets and 1 being the least. This scoring system was performed on B220 and CD3 stained pancreatic sections. The total numbers of islet and there corres ponding islet infiltration scored was calculated for each study group and the results were graphed using Microsoft excel program.

PAGE 117

104 Figure 7-3. Pancreatic immunostaining for B220+ and CD3+ lymphocytes. A) Example of infiltrate scoring of islets. B) B220 scoring of different experimental rAAV treated groups. C) CD3 scoring of different experimental rAAV treated groups. There was no difference (blinded semi-quantitative analysis) in B220+ B lymphocyte infiltration in the pancreas of any experimental group. There was also no difference of CD3+ T lymphocytes cells infiltrating the islet of the pancreas. Note also that flow cytometric analysis of lymphocytes isolated from the spleen and pancreatic lymph nodes revealed no statistica l difference in the number of CD3+ and B220+ lymphocytes in those organs (data not shown) . The number of islet c ounted for the saline control was greater than that of the experimental sections, l eaving the statistical power of this experiment less then a 95% confidence.

PAGE 118

105 Serum Cytokine Analysis In order to confirm expression of rAAV vectors, serum samples (n=3 per study group) were collected at 12 weeks of age for cytokine analysis. Serum cytokine concentration was determined by Luminex Beadlyte 10-plex system. Figure 7-4. Serum cytokine concentrations. Serum cytokine con centrations of rAAV treated mice at 12 weeks of age measured using Luminex100TM system. A) IL-1 serum concentration. B) IL-6 serum concentration. C) TNF serum concentration.

PAGE 119

106 Figure 7-4. Continued The experimental mice treated with rAAV1-smIL-1-Ig showed a mean reduced serum concentration of IL-1 . Mice treated with 1.4x1010 particles of rAAV1-smIL-1r-Ig had a mean reduced serum IL-1 concentration of 23.8 pg/mL compared to 64.9 pg/mL for saline control mice (p<0.05). While mice treated with 1.4x1010 particles of rAAV1smIL-1r-Ig showed an average reduction in IL-1 concentrations, but the amount was not significantly different from saline or rAAV1-CLC negative controls. The experimental mice treated with rAAV1-smIL-1-Ig showed an average reduced serum concentration of IL-6. Mice treated with 1.4x1010 particles of rAAV1smIL-1r-Ig had average reduced serum IL-6 concentration of 39.8 pg/mL compared to 80.2 pg/mL for saline control mice (p< 0.04). While mice treated with 1.4x1010 particles of rAAV1-smIL-1r-Ig showed an average re duction in IL-6 concentrations but the amount was not significantly different than saline or rAAV1-CLC negative controls.

PAGE 120

107 None of the experimental mice treated with rAAV1-smIL-1-Ig vectors demonstrated an average reduced serum concentration of TNF as compared to saline or rAAV1-CLC negative controls. Splenocyte Proliferation Assay Splenocytes from 12 week old rAAV treate d mice were isolated and stimulated with anti-CD3/anti-CD28 antibody. After 72 hours, H3 thymidine was added to the wells and incubated for a further 16 hours. The H3 thymidine incorporation was then measured using a -scintillation counter. Figure 7-5. Recombinant AAV1-smIL-1r-Ig tr eated NOD mouse splenoc yte proliferation assay. Splenocytes from 12 week ol d rAAV treated mice were isolated, stimulated with, CD3/ CD28 and H3 thymidine incorporation were then measured using a -scintillation counter. The proliferative ability of the isolated sp lenocytes from the different experimental groups was calculated as count s per minute (cpm) based on H3 thymidine incorporation. None of the experimental groups showed a significantly decreased average proliferation

PAGE 121

108 (72205 cpm vs. 65230 cpm) in NOD mice treated with 1.7x1010 particles of rAAV1smIL-1r-Ig and 79372 cpm with NOD mice treated with 1.7x109 particles of rAAV1smIL-1r-Ig. Splenocyte Cytokine Assay Media from cells in previous experiment were taken at 72 hour time point and analyzed for cytokine profile using Luminex100TM system. Figure 7-6. Cytokine expressi on from splenocytes stimulation assay. Splenocytes from 12 week of rAAV treated mice were stimulated with CD3/ CD28. After 72 hours the media was tested for cytokine profile using Luminex100TM system. A) IFN concentration. B) IL-2 concentra tion. C) IL-10 concentration. D) IL4 concentration. Expression of all cytokines showed no signi ficant difference in average expression levels when compared to saline and r AAV1-CLC negative cont rols. This provides evidence that this is not a cytokine mediat ed phenomenon and that the survival of the experimental mice may be due to anothe r factor such as lymphocyte activation.

PAGE 122

109 DO11.10 Ovalbumin TCR Transgenic Mouse Five hours after OVA administration 3 mice were sacrificed. The spleens were removed and the lymphocytes were purified using the same protocol as described previously. The cells were st ained for flow cytometric analysis with BD Pharminigen florescent antibodies for CD69 on CD3+, CD4+, and CD8+ T lymphocytes. In addition to the experimental tests, the appr opriate isotype controls were also prepared. The cells were then read on a flow cytometer as described previously. Figure 7-7. Example of flow cytometry anal ysis of CD69 staining. A) Representative staining of CD4+ CD69 staining. B) Repres entative staining of CD8+ CD69 staining.

PAGE 123

110 Figure 7-8. Average flow cytometry analys is of CD69 staining. Average CD69 staining on CD4+ and C) CD8+ T lymphocytes. Mice treated with rAAV-smIL-1r-Ig did not have a statistically average reduced activation of CD4+or CD8+ T lymphocytes, as measured by CD69, expression over control mice. Late Immune Activation Detection Three days after first OVA administration, an additional administ ration of 5 g of OVA was performed. Then 4 days later, the remaining 3 mice were sacrificed and the spleens were removed. The lymphocytes were purified using the same protocols as described previously and the cells were stai ned for flow cytometric analysis for CD28 on CD4+ T lymphocytes and MHC-II on CD11b+ macrophages. The splenocytes were harvested and just before the went into the flow cytometer, 7-AAD was added so that the dead cells could be subtracted out form the an alysis program and that proper scatter plots could be generated.

PAGE 124

111 Figure 7-9. Flow cytome try analyses of CD3+CD28+ and CD11b+MHCII+ splenocytes. Representative staining of A) CD 28 and B) MHC staining. Average MHC staining on C) CD11b+ macrophages and average D) CD28 staining on CD4+ T lymphocytes. The experimental mice treated with either 1.4x1010 vp, rAAV1-smIL-1r-Ig or 1.4x109 vp rAAV1-smIL-1r-Ig had a no signifi cant average decrease in CD4+CD28+ T lymphocytes. However there was a significant decrease CD11b+MHCII+ macrophage mean expression (37.4 vs. 26.1%; p<0.01) in mice treated with 1.4x1010 vp rAAV1smIL-1r-Ig, and with 1.4x109 vp rAAV1-smIL-1r-Ig (37.4 vs. 27.4%; p<0.05) as compared to saline control mice. This same pa ttern was seen in each of the 3 mice for the different experimental groups. This resulted in very small average deviations between the different study groups.

PAGE 125

112 Discussion The data presented in this report demonstr ates that a fusion molecule consisting of a soluble form of the extracellu lar portion of the interleuki n-1 receptor fused to the Fc portion of mouse IgGl (smIL-1r-Ig) is an e ffective antagonist of autoimmune mediated progression of T1D in the NOD mouse. A decr eased incidence of hyperglycemia in mice treated with rAAV1-CBA-smIL-1r-Ig was seen at 30 weeks of age, as compared to saline and rAAV1-CLC negative control treated mice. Furthermore, the effectiveness of the treatment was dose dependent, with mice treat ed at a higher dose of vector having a significantly increased delay of hyperg lycemia over the low dose treated group. While the importance of IL-1 as a proinflammatory cyt okine responsible for islet cell death has been extensively studied in vitro (54), its role in th e development of T1D diabetes in vivo remains controversial. Histological analysis of the pancreas at 12 weeks of age showed no significant reduction in insu litis between the different experimental groups. When the infiltrates where examined fo r particular cell t ypes, the main islet infiltrate was B220+ cells in all experimental groups. In all experimental groups there was also significant CD3+ T lymphocyte infiltrate in the pancreatic islets. Based on these findings, protection for hype rglycemia may require protection from lymphocyte migration and activation. To confirm whether lymphocyte activation was altered in treated groups, splenocyte profiling was carried out. Splenocytes from rAAV1-smIl-1r-Ig treated mice showed no significan t difference in ability to suppress in T lymphocyte proliferation over negative contro l treated mice, when stimulated with antiCD3/anti-CD28 antibody. Additionally, when rAAV1-smIl-1r-Ig treated DO11.10 TCR transgenic mice where stimulated with ova lbumin, there was not a significant down

PAGE 126

113 regulation of T lymphocyte ac tivation markers CD69 or CD28 in this antigen specific model. This data suggests that to develop a completely effective therapy, modulation of lymphocyte activation may also be necessa ry. Another possible reason why rAAV-smIL1-Ig therapy did not protect more fully from T1D is that it may not block the effects of perforin and granzymes. These factors are secreted by the cytotoxic granule of the CD8+ T-lymphocytes and are important mediators of cell destruction in NOD diabetes (135). Studies have shown that autoimmune T1 D in the NOD mouse can be prevented by treatment with nondepleting monoclonal anti bodies to CD4 and CD8 (136, 137) or with low doses of anti-CD3 antibody at amounts that do not fully deplete (138). In addition, Cooke et al. showed that the combinational of anti-CD4 therapy with recombinant sIL1RII, effectively prevented the action of IL-1 in a islet allograft mouse model (139). Our results suggest that the postponement of T1D by rAAV-smIL-1r-Ig is not the result T lymphocyte activation impairment, but rather can be explained by the loss of the proinflammatory environment. Our studies sh ow that treatment with rAAV1-smIL-1r-Ig resulted in a reduced serum concentra tion of proinflammatory cytokines IFN , IL-1 and IL-6, verse the negative control experimental groups. This data is encouraging, as our in vitro results with -TC3 cells, demonstrated reduced cas pase-3 mediated apoptosis when the cells were administered IL-1 in the presence of purifie d smIL-1r-Ig gene product. While the amount of proinflammatory cy tokines was reduced in the rAAV1-smIL1r-Ig treated mice, these mice did still ev entually undergo inflammatory mediated lymphocyte infiltration. Serum levels of TNF did not deviate between experimental groups and could account for the eventual in sulitis and progression to T1D. Redundancy

PAGE 127

114 with TNF , that has very similar effects to IL-1 , may be an explanation for the progression of T1D. Both cytokines activate the nuclear facto r-B and mitogen-activated protein kinase pathways, and induce an ove rlapping set of genes involved in inflammation (140). Studies by Kay et al. (141) showed that in IL-1 receptor knockout NOD mice, iNOS production was reduced but mice still underwent TNF dependent class I MHC upregulation. This led to an increase in Fas mediated cell apoptosis. Therefore, if both IL-1 and TNF are produced in the is lets of NOD mice, by removing IL-1 , the effects are limited to ge nes, like iNOS, that are IL-1 dependent. Other IL-1 -inducible genes, like class I MHC, which can be upregulated by TNF or Fas as well, that can be upregul ated independently of IL-1 , and can still be expressed on cells resulting in onset of T1D. Conclusions We have clearly shown that treatment with rAAV1-smIL-1r-Ig can prolong the onset of T1D in the NOD mouse. These expe riments have demonstrated the powerful utility of a single administration of rAAV vector expressing the anti-inflammatory molecule, smIL-1r-Ig, as a means to reduce systemic inflammatory signaling. This therapy serves a first step in progress to developing a truly effective therapy for prevention of T1D. Further experiments with combinations of therapies such as the addition of anti-thymocyte globulin will addre ss the issues lymphocyte infiltration, while still maintaining an anti-inflammatory environment in the pancreatic islets.

PAGE 128

115 CHAPTER 8 DISSCUSION AND CONCLUSIONS Discussion The potential of immunothera py for the prevention and trea tment of type 1 diabetes (T1D) can provide a powerful tool for people suffering from this disease. However, the complexities of immune response in T1D ar e multifaceted and temporally complex. To understand the full potential of these therapies, we focused on two specific aspects of immune response in autoimmune disease, cy tokine mediated activation and lymphocyte mediated destruction. One of the pr oposed methods, cytokine mediated immunomodulation uses the ge ne therapy approaches: recombinant adeno-associated vector (rAAV) mediated deliver y of soluble IL-1 receptor IgG fusion protein (smIL-1rIg) and anti-interferon gamma (IFN ) antibody to the muscle to achieve systemic reduction of these proinflammatory cytokine s. The second method utilized polyclonal anti-thymocyte globulin (ATG) to down regulate T lymphocyt e responses. Preliminary in vitro results from this proposal led us to inve stigate the poten tial for and consequences of treatment in an in vivo nonobese diabetic (NOD) mous e model of inflammatory and autoimmune disease. Our first study focused on blocking the proinflammatory cytokine IFN . We constructed a rAAV1 vector expressing a ch imeric monoclonal neutralizing mouse antimouse IFN antibody. NOD mice treated with a low dose of rAAV1-anti-IFN antibody, resulting in only a 5 fold reduction in circulating IFN , resulted in a statistically significant reduction in the onset of T1D at 30 weeks of age. Mice tr eated with a higher

PAGE 129

116 dose of rAAV1-anti-IFN antibody, which resulted in undetect able levels of circulating IFN , showed no significant difference in th e prevention of T1D over negative rAAV or saline treated control NOD mice. Histological analysis of the pancreas from experimental showed that the infiltrate was predominately a B lymphocyte infiltrate a nd that there was no difference in numbers of B220 cells infiltrating the islets. Ho wever tissues stained with anti-CD3 antibody showed a decrease in the amount of infiltrating CD3+ lymphocytes in animals treated with high dose rAAV1-anti-IFN antibody when compared to low dose and negative control animals. Our studies show that treatment with rAAV1-anti-IFN antibody lead to a lower respective expression of T lymphocyt es expressing chemokine receptors CXCR3 but not CCR5, two chemokine receptors cr itical in lymphocyte diapedesis. Our results using ovalbumin specific Tcell receptor (TCR) transgenic DO11.10 mice showed a down regulation of major hi stocompatibility II (M HCII) on macrophages. Reduced activation of immune cells was not limited to reduced activation of antigen presenting cells (APC). Treatment with rAAV1-anti-IFN antibody also leads to reduced activation of T lymphocytes. These mice ha d reduced number of CD69 activated CD4+ and CD8+ T lymphocytes. In addition to reduced expression of surface activation molecules on APC and T lymphocytes, there was also a reduction in the expression of proinflammatory serum cytokines, IFN and IL-6, seen in mice treated with rAAV1-anti-IFN antibody verses the control littermates. However, there was no difference in the concentrations of IL-1 , IL-12 and TNF in all experimental groups. Redundancy with TNF and IL-12, that has

PAGE 130

117 very similar proinflammatory effects to IFN , may be an explanation for the continued progression of T1D in rAAV-anti-IFN -antibody treated mice. Our second study focused on the pr oinflammatory cytokine, IL-1 . The data presented in this study demons trate that rAAV mediated de livery of sIL-1r-Ig is an effective antagonist of autoimmune mediat ed progression of T1D in the NOD mouse. A decreased incidence of hyperglycemia in mice treated with rAAV1-CBA-smIL-1r-Ig was seen at 30 weeks of age as compared to saline and rAAV1-CLC negative controls. Furthermore, the effectiveness of the trea tment was dose dependent with mice treated with a higher dose of vector had a signifi cantly increased delay of hyperglycemia over the low dose treated group. Our results suggest that since the postpone ment of T1D is not the result of T lymphocyte activation impairment, but ra ther can be explained by a loss of proinflammatory environment due to thera py. Our studies show that treatment with rAAV1-CBA-smIL-1r-Ig demonstrated a reduced serum concentration of proinflammatory cytokines IFN , IL-1 and IL-6 verse the ne gative control group. This data is encouraging as our in vitro results with -TC3 cells demonstrated reduced caspase mediated apoptosis when administered IL-1 in the presence of purified smIL-1r-Ig gene product. In our third study, we focused on the lymphocyte mediated immune response against cell destruction. In these studies, we showed that prevention of T1D in the NOD mouse using ATG achieved complete remission in over 90% of treated mice at 30 weeks of age. This treatment is age dependent w ith suppression of T1D occurring only in mice treated at 12 weeks of age. CD25+CD4+ regulatory T lymphocytes demonstrated an

PAGE 131

118 increased capacity to suppress effector T lymphocytes in a suppression assay, which was transferable in in vivo adoptive cotransfer experiments. Flow cytometric analysis of demonstrated a significantly redu ced concentration of CD28 and CD154 on splenic CD4+ T lymphocytes, indicating a reduced effector activation capacity. The selective down-regulation of splenic and pancreatic lymph node T lymphocyte CCR5 expression may be significant due to its association with Th1 immune responses that are associat ed with the progression of T1D. Conclusions The projects presented in th is dissertation focus on the therapeutic targeting of two immunological processes that are interconnected in the development of the autoimmune progression in T1D. First, our findings provide in vivo evidence for a role of lymphocyte mediated control by ATG as a possible therapy. The ability for ATG to provide lymphocyte depletion resulted in a greatly reduced insulitis in NOD mice and prevention of T1D. The window by which the tr eatment allows for e ffective results is extremely small, and an effective treatment in a clinical setting may require more detail on the best time at which the therapy should be given. Second, cytokines play a controlling factor in trafficki ng of lymphocytes into the pa ncreas in this autoimmune disease. As mediators of inflammation, prev enting cytokine activation of lymphocytes offers another aspect of the immune res ponse for targeted therapy. The use of rAAV therapy targeting the proinflammatory IFN and IL-1 slowed the progression of T1D in a dose depended manner. The importance of th ese experiments for an understanding of immune processes of autoimmune T1D cannot be understated. Much more needs to be learned about the specific molecules at differe nt stages of the immune response in order to develop an effective therapy. Promising wo rk in the future may join therapies to

PAGE 132

119 improve the likeness of a positive therapeutic outcome. Possible combination therapies include combining immunomodulatory rAAV therapy to suppress the inflammatory response along with ATG to downmodulate T lymphocyte mediated immune destruction of the cells. These experiments offer a first st ep into the understa nding of these novel molecules that may, some day be used a th erapy to prevent the onset of autoimmune T1D.

PAGE 133

120 LIST OF REFERENCES 1 Eisenbarth,G.S. & Lafferty,K. Type I diabetes: molecula r, cellular, and clinical immunology (Oxford University Press, Oxford, 1996). 2 National Diabetes Data Gr oup: Classification and Diagnos is of Diabetes Mellitus and Other Categories of Glucose Intolerance. Diabetes 28 , 1039-1057 (1979). 3 Scobie,I.N. An atlas of diabetes mellitus (Parthenon Pub. Group, Boca Raton Fla., 2002). 4 Costantino,L., Rastelli,G., Vianello,P., Cignarella,G., & Barlocco,D. Diabetes complications and their potential preventio n: aldose reductase inhibition and other approaches. Med. Res. Rev. 19 , 3-23 (1999). 5 Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Report of the Expert Committee on the dia gnosis and classification of diabetes mellitus. Diabetes Care S5-S20 (2001). 6 Atkinson,M.A. & Maclaren,N.K. The pathoge nesis of insulin-dependent diabetes mellitus. N. Engl. J. Med. 331 , 1428-1436 (1994). 7 Bach,J.F. Insulin-dependent diabetes mellitus as an autoimmune disease. Endocr. Rev. 15 , 516-542 (1994). 8 Rayburn,W.F. Diagnosis and classification of diabetes mellitus: highlights from the American Diabetes Association. J. Reprod. Med. 42 , 585-586 (1997). 9 Signore,A., Pozzilli,P., Gale,E.A., Andr eani,D., & Beverley,P.C. The natural history of lymphocyte subsets infi ltrating the pancreas of NOD mice. Diabetologia 32 , 282-289 (1989). 10 Makino,S. et al. Breeding of a non-obese, di abetic strain of mice. Jikken Dobutsu 29 , 1-13 (1980). 11 Anderson,M.S. & Bluestone,J.A. The NOD mouse: a model of immune dysregulation. Annu. Rev. Immunol. 23 , 447-485 (2005). 12 Kikutani,H. & Makino,S. The murine autoimmune diabetes model: NOD and related strains. Adv. Immunol. 51 , 285-322 (1992).

PAGE 134

121 13 Andre,I. et al. Checkpoints in the progression of au toimmune disease: lessons from diabetes models. Proc. Natl. Acad. Sci. U. S. A. 93, 2260-2263 (1996). 14 Singh,B. & Rabinovitch,A. Influence of mi crobial agents on the development and prevention of autoimmune diabetes. Autoimmunity 15 , 209-213 (1993). 15 Bach,J.F. The effect of infections on sus ceptibility to autoimmune and allergic diseases. N. Engl. J. Med. 347 , 911-920 (2002). 16 Serreze,D.V., Gaedeke,J.W., & Leiter,E. H. Hematopoietic stem-cell defects underlying abnormal macrophage developmen t and maturation in NOD/Lt mice: defective regulation of cytokine receptors and protein kinase C. Proc. Natl. Acad. Sci. U. S. A. 90, 9625-9629 (1993). 17 Kataoka,S. et al. Immunologic aspects of the non obese diabetic (NOD) mouse. Abnormalities of cellular immunity. Diabetes 32 , 247-253 (1983). 18 Ogasawara,K. et al. Impairment of NK cell f unction by NKG2D modulation in NOD mice. Immunity 18 , 41-51 (2003). 19 Naumov,Y.N. et al. Activation of CD1d-restricted T cells protects NOD mice from developing diabetes by regulat ing dendritic cell subsets. Proc. Natl. Acad. Sci. U. S. A . 98, 13838-13843 (2001). 20 Wang,B., Geng,Y.B., & Wang,C.R. CD1-restri cted NK T cells protect nonobese diabetic mice from developing diabetes. J. Exp. Med. 194 , 313-320 (2001). 21 Salomon,B. et al. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells th at control autoimmune diabetes. Immunity. 12 , 431-440 (2000). 22 Foulis,A.K., Liddle,C.N., Farquharson,M .A., Richmond,J.A., & Weir,R.S. The histopathology of the pancreas in type 1 (insulin-dependent) diabetes mellitus: a 25-year review of deaths in patients under 20 years of age in the United Kingdom. Diabetologia 29 , 267-274 (1986). 23 Kronenberg,M. & Rudensky,A. Regulation of immunity by self-reactive T cells. Nature 435 , 598-604 (2005). 24 Janeway,C. Immunobiology the immune system in health and disease (Garland Science, New York, 2005). 25 Mosmann,T.R. & Coffman,R.L. TH1 and TH2 cells: different patterns of lymphokine secretion lead to di fferent functional properties. Annu. Rev. Immunol. 7 , 145-173 (1989).

PAGE 135

122 26 Mosmann,T.R., Cherwinski,H., Bond,M.W ., Giedlin,M.A., & Coffman,R.L. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136 , 2348-2357 (1986). 27 Abbas,A.K., Murphy,K.M., & Sher,A. F unctional diversity of helper T lymphocytes. Nature 383 , 787-793 (1996). 28 Constant,S.L. & Bottomly,K. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15 , 297-322 (1997). 29 Romagnani,S. The Th1/Th2 paradigm. Immunol. Today 18 , 263-266 (1997). 30 Marie,J.C., Letterio,J.J., Gavin,M., & Rudensky,A.Y. TGF-beta1 maintains suppressor function and Foxp3 expressi on in CD4+CD25+ regulatory T cells. J. Exp. Med. 201 , 1061-1067 (2005). 31 Sakaguchi,S. et al. Immunologic tolerance maintain ed by CD25+ CD4+ regulatory T cells: their common role in controll ing autoimmunity, tumor immunity, and transplantation tolerance. Immunol. Rev. 182 , 18-32 (2001). 32 Salomon,B. et al. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells th at control autoimmune diabetes. Immunity. 12 , 431-440 (2000). 33 Lejon,K. & Fathman,C.G. Isol ation of self an tigen-reactive cells from inflamed islets of nonobese diabetic mice us ing CD4high expression as a marker. J. Immunol. 163 , 5708-5714 (1999). 34 Wang,B., Gonzalez,A., Benoist,C., & Mathis,D . The role of CD8+ T cells in the initiation of insulin-dependent diabetes mellitus. Eur. J. Immunol. 26 , 1762-1769 (1996). 35 Marleau,A.M. & Singh,B. Myeloid dendritic cells in non-obese diabetic mice have elevated costimulatory and T helper-1-inducing abilities. J. Autoimmun. 19 , 23-35 (2002). 36 Rothe,H., Ito,Y., & Kolb,H. Disease re sistant, NOD-related strains reveal checkpoints of immunoregul ation in the pancreas. J. Mol. Med. 79 , 190-197 (2001). 37 Lenschow,D.J. et al. Differential effects of anti -B7-1 and anti-B7-2 monoclonal antibody treatment on the development of diab etes in the nonobese diabetic mouse. J. Exp. Med. 181 , 1145-1155 (1995). 38 Salomon,B. et al. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells th at control autoimmune diabetes. Immunity. 12 , 431-440 (2000).

PAGE 136

123 39 Luhder,F., Hoglund,P., Allison,J.P., Be noist,C., & Mathis,D. Cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) regulates the unfoldi ng of autoimmune diabetes. J. Exp. Med. 187 , 427-432 (1998). 40 Balasa,B. et al. CD40 ligand-CD40 interactions are necessary for the initiation of insulitis and diabetes in nonobese diabetic mice. J. Immunol. 159 , 4620-4627 (1997). 41 Green,E.A., Wong,F.S., Eshima,K., Mora,C ., & Flavell,R.A. Neonatal tumor necrosis factor alpha promotes diab etes in nonobese diabetic mice by CD154independent antigen presentation to CD8(+) T cells. J. Exp. Med. 191 , 225-238 (2000). 42 Herman,A.E., Freeman,G.J., Mathis,D., & Benoist,C. CD4+CD25+ T regulatory cells dependent on ICOS promote regulation of effector cells in the prediabetic lesion. J. Exp. Med. 199 , 1479-1489 (2004). 43 Ansari,M.J. et al. The programmed death-1 (PD-1) pathway regulates autoimmune diabetes in nonobese diabetic (NOD) mice. J. Exp. Med. 198 , 63-69 (2003). 44 Atkinson,M.A. & Wilson,S.B. Fatal attracti on: chemokines and type 1 diabetes. J. Clin. Invest 110 , 1611-1613 (2002). 45 Salomon,B. et al. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells th at control autoimmune diabetes. Immunity. 12 , 431-440 (2000). 46 An autoimmune disease, APECED, cause d by mutations in a novel gene featuring two PHD-type zinc-finger domains. Th e Finnish-German APECED Consortium. Autoimmune Polyendocrinopathy-Ca ndidiasis-Ectodermal Dystrophy. Nat. Genet. 17 , 399-403 (1997). 47 Walker,M.R. et al. Induction of FoxP3 and acquis ition of T regulatory activity by stimulated human CD4+. J. Clin. Invest 112 , 1437-1443 (2003). 48 Apostolou,I. & von,B.H. In vivo instructi on of suppressor commitment in naive T cells. J. Exp. Med. 199 , 1401-1408 (2004). 49 Kuby,J. Immunology (W.H. Freeman, New York, 1997). 50 Billiau,A. Interferon-gamma: biol ogy and role in pathogenesis. Adv. Immunol. 62 , 61-130 (1996). 51 Yoshida,A., Koide,Y., Uchijima,M., & Yoshida,T.O. IFN-gamma induces IL-12 mRNA expression by a murine macrophage cell line, J774. Biochem. Biophys. Res. Commun. 198 , 857-861 (1994).

PAGE 137

124 52 Doherty,T.M., Seder,R.A., & Sher,A. Induc tion and regulation of IL-15 expression in murine macrophages. J. Immunol. 156 , 735-741 (1996). 53 Hayes,M.P., Freeman,S.L., & Donnelly,R.P . IFN-gamma priming of monocytes enhances LPS-induced TNF production by augmenting both transcription and MRNA stability. Cytokine 7 , 427-435 (1995). 54 Thomas,H.E., Darwiche,R., Corbett,J.A., & Kay,T.W. Interleukin-1 plus gammainterferon-induced pancreatic beta-cell dysfunction is me diated by beta-cell nitric oxide production. Diabetes 51 , 311-316 (2002). 55 Tamura,T. et al. Interferon-gamma induces Ice gene expression and enhances cellular susceptibili ty to apoptosis in the U937 leukemia cell line. Biochem. Biophys. Res. Commun. 229 , 21-26 (1996). 56 McLoughlin,R.M. et al. Interplay between IFN-gamma and IL-6 signaling governs neutrophil trafficking and apopt osis during acute inflammation. J. Clin. Invest 112 , 598-607 (2003). 57 Rabinovitch,A. An update on cytokines in the pathogenesis of insulin-dependent diabetes mellitus. Diabetes Metab Rev. 14 , 129-151 (1998). 58 Sarvetnick,N., Liggitt,D., Pitts,S.L., Hansen,S.E., & Stewart,T.A. Insulindependent diabetes mellitus induced in transgenic mice by ectopic expression of class II MHC and interferon-gamma. Cell 52 , 773-782 (1988). 59 Sarvetnick,N. et al. Loss of pancreatic islet tolerance induced by beta-cell expression of interferon-gamma. Nature 346 , 844-847 (1990). 60 Prud'homme,G.J. & Chang,Y. Prevention of autoimmune diabetes by intramuscular gene therapy with a nonvira l vector encoding an inte rferon-gamma receptor/IgG1 fusion protein. Gene Ther. 6 , 771-777 (1999). 61 Wahl,S.M., Allen,J.B., Ohura,K., Ch enoweth,D.E., & Hand,A.R. IFN-gamma inhibits inflammatory cell recruitment and the evolution of bacterial cell wallinduced arthritis. J. Immunol. 146 , 95-100 (1991). 62 Balashov,K.E., Khoury,S.J., Hafler,D.A., & Weiner,H.L. Inhibition of T cell responses by activated human CD8+ T cells is mediated by interferon-gamma and is defective in chronic progressive multiple sclerosis. J. Clin. Invest 95 , 2711-2719 (1995). 63 Novelli,F. et al. Environmental signals influencin g expression of the IFN-gamma receptor on human T cells control whether IFN-gamma promotes proliferation or apoptosis. J. Immunol. 152 , 496-504 (1994).

PAGE 138

125 64 Hultgren,B., Huang,X., Dybdal,N., & Stew art,T.A. Genetic absence of gammainterferon delays but does not prevent diabetes in NOD mice. Diabetes 45 , 812-817 (1996). 65 Sobel,D.O. et al. Gamma interferon paradoxically inhibits the development of diabetes in the NOD mouse. J. Autoimmun. 19 , 129-137 (2002). 66 Konieczny,B.T. et al. IFN-gamma is critical for long-term allograft survival induced by blocking the CD28 and CD40 lig and T cell costimulation pathways. J. Immunol. 160 , 2059-2064 (1998). 67 Savinov,A.Y., Wong,F.S., & Chervonsky,A.V . IFN-gamma affects homing of diabetogenic T cells. J. Immunol. 167 , 6637-6643 (2001). 68 Sawitzki,B. et al. IFN-gamma production by alloantig en-reactive regulatory T cells is important for their regulatory function in vivo. J. Exp. Med. 201 , 1925-1935 (2005). 69 Fong,Y. et al. Cachectin/TNF or IL-1 alpha indu ces cachexia with redistribution of body proteins. Am. J. Physiol 256 , R659-R665 (1989). 70 Sims,J.E., Giri,J.G., & Dower,S.K. The two interleukin-1 receptors play different roles in IL-1 actions. Clin. Immunol. Immunopathol. 72 , 9-14 (1994). 71 Satoskar,A.R. et al. Enhanced Th2-like responses in IL-1 type 1 receptor-deficient mice. Eur. J. Immunol. 28 , 2066-2074 (1998). 72 Chervonsky,A.V. et al. The role of Fas in autoimmune diabetes. Cell 89 , 17-24 (1997). 73 Robertson,R.P. Seminars in medicine of the Beth Israel Hospital, Boston: Pancreatic and islet transplantation for diabetes--cures or curiosities? N. Engl. J. Med. 327 , 1861-1868 (1992). 74 Gruessner,A.C. & Sutherland,D.E. Pancreas transplant outcomes for United States (US) cases reported to the United Netw ork for Organ Sharing (UNOS) and non-US cases reported to the International Pancre as Transplant Registry (IPTR) as of October, 2000. Clin. Transpl. 45-72 (2000). 75 Manske,C.L. Risks and benefits of kidney a nd pancreas transplant ation for diabetic patients. Diabetes Care 22 Suppl 2 , B114-B120 (1999). 76 Lacy,P.E. Present status of islet transplantation. Clin. Invest Med. 10 , 496-498 (1987). 77 Ricordi,C. et al. Human islet isolation and allotransplantation in 22 consecutive cases. Transplantation 53 , 407-414 (1992).

PAGE 139

126 78 Bretzel,R.G. et al. Islet transplantation: present clinical situation and future aspects. Exp. Clin. Endocrinol. Diabetes 109 Suppl 2 , S384-S399 (2001). 79 Shapiro,A.M. et al. Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N. Engl. J. Med. 343 , 230-238 (2000). 80 Knechtle,S.J., Hamawy,M.M., Hu,H., Fechne r,J.H., Jr., & Cho,C.S. Tolerance and near-tolerance strategies in monkeys and their application to human renal transplantation. Immunol. Rev. 183 , 205-213 (2001). 81 Belghith,M. et al. TGF-beta-dependent mechanisms mediate restoration of selftolerance induced by antibodies to CD 3 in overt autoimmune diabetes. Nat. Med. 9 , 1202-1208 (2003). 82 Waldmann,H., Qin,S., & Cobbold,S.P. Monocl onal antibodies for the therapeutic induction of tolerance. Immunol. Ser. 59 , 85-99 (1993). 83 bray-Sachs,M. et al. Prevention of diabetes in NOD mice treated with antibody to murine IFN gamma. J. Autoimmun. 4 , 237-248 (1991). 84 Fujihira,K. et al. Suppression and acceleration of autoimmune diabetes by neutralization of endogenous in terleukin-12 in NOD mice. Diabetes 49 , 1998-2006 (2000). 85 Nicoletti,F. et al. Protection from experimental autoimmune diabetes in the nonobese diabetic mouse with so luble interleukin-1 receptor. Eur. J. Immunol. 24 , 1843-1847 (1994). 86 Hunger,R.E., Carnaud,C., Garcia,I., Vassa lli,P., & Mueller,C. Prevention of autoimmune diabetes mellitus in NOD mi ce by transgenic expression of soluble tumor necrosis factor receptor p55. Eur. J. Immunol. 27 , 255-261 (1997). 87 Woodruff,M.F. & Anderson,N.A. Effect of lymphocyte depletion by thoracic duct fistula and administration of antilymphocytic serum on the survival of skin homografts in rats. Nature 200, 702 (1963). 88 Bonnefoy-Berard,N. & Revillard,J.P. M echanisms of immunosuppression induced by antithymocyte globulins and OKT3. J. Heart Lung Transplant. 15, 435-442 (1996). 89 Merion,R.M., Howell,T., & Bromberg,J.S. Partial T-cell activ ation and anergy induction by polyclonal antithymocyte globulin. Transplantation 65, 1481-1489 (1998). 90 Delmonico,F.L. et al. The selective use of antilym phocyte serum for cyclosporine treated patients with re nal allograft dysfunction. Ann. Surg. 206, 649-654 (1987).

PAGE 140

127 91 Dugan,M.J., DeFor,T.E., Steinbuch,M., Filipovich,A.H., & Weisdorf,D.J. ATG plus corticosteroid therapy for acute gr aft-versus-host diseas e: predictors of response and survival. Ann. Hematol. 75 , 41-46 (1997). 92 Teramura,M., Kobayashi,S., Iwabe,K., Yo shinaga,K., & Mizoguchi,H. Mechanism of action of antithymocyte globulin in the treatment of aplastic anaemia: in vitro evidence for the presence of immunosuppressive mechanism. Br. J. Haematol. 96 , 80-84 (1997). 93 Monaco,A.P., Gozzo,J.J., Wood,M.L., & Li egeois,A. Use of low doses of homozygous allogeneic bone marrow cells to induce tolerance with antilymphocyte serum (ALS): tolerance by intraorgan injection. Transplant. Proc. 3 , 680-683 (1971). 94 Ogawa,N., List,J.F., Habener,J.F., & Maki ,T. Cure of overt diabetes in NOD mice by transient treatment with anti -lymphocyte serum and exendin-4. Diabetes 53 , 1700-1705 (2004). 95 Harada,M. & Makino,S. Suppression of overt diabetes in NOD mice by antithymocyte serum or anti-Thy 1, 2 antibody. Jikken Dobutsu 35 , 501-504 (1986). 96 Michallet,M.C. et al. Functional antibodies to leu kocyte adhesion molecules in antithymocyte globulins. Transplantation 75 , 657-662 (2003). 97 Zand,M.S. et al. Polyclonal rabbit antithymocyt e globulin trigge rs B-cell and plasma cell apoptosis by multiple pathways. Transplantation 79 , 1507-1515 (2005). 98 Berns,K.I. Parvovirus replication. Microbiol. Rev. 54 , 316-329 (1990). 99 Kotin,R.M., Linden,R.M., & Berns,K.I. Char acterization of a preferred site on human chromosome 19q for integrati on of adeno-associated virus DNA by nonhomologous recombination. EMBO J. 11 , 5071-5078 (1992). 100 Hermonat,P.L. & Muzyczka,N. Use of adeno-associated virus as a mammalian DNA cloning vector: transduction of neomyc in resistance into mammalian tissue culture cells. Proc. Natl. Acad. Sci. U. S. A 81 , 6466-6470 (1984). 101 Zhang,Y.C. et al. Adeno-associated virus-mediated IL-10 gene therapy inhibits diabetes recurrence in syngeneic is let cell transplant ation of NOD mice. Diabetes 52 , 708-716 (2003). 102 Flotte,T.R. & Carter,B.J. Adeno-associ ated virus vectors for gene therapy. Gene Ther. 2 , 357-362 (1995). 103 Gao,G.P. et al. Novel adeno-associated viruses fr om rhesus monkeys as vectors for human gene therapy. Proc. Natl. Acad. Sci. U. S. A 99 , 11854-11859 (2002).

PAGE 141

128 104 Chao,H. & Walsh,C.E. AAV vectors for hemophilia B gene therapy. Mt. Sinai J. Med. 71 , 305-313 (2004). 105 Zolotukhin,S. et al. Production and purific ation of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 , 158-167 (2002). 106 Rabinowitz,J.E., Xiao,W., & Samulski,R.J . Insertional mutagenesis of AAV2 capsid and the production of recombinant virus. Virology 265 , 274-285 (1999). 107 Fraites,T.J., Jr. et al. Correction of the enzymatic and functional deficits in a model of Pompe disease using adeno-associated virus vectors. Mol. Ther. 5 , 571-578 (2002). 108 Hauck,B. & Xiao,W. Characterization of tissue tropism determinants of adenoassociated virus type 1. J. Virol. 77 , 2768-2774 (2003). 109 Kessler,P.D. et al. Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein. Proc. Natl. Acad. Sci. U. S. A 93 , 14082-14087 (1996). 110 Xiao,X., Li,J., & Samulski,R.J. Efficient long -term gene transfer into muscle tissue of immunocompetent mice by adeno-associated virus vector. J. Virol. 70 , 80988108 (1996). 111 Arruda,V.R. et al. Safety and efficacy of factor IX gene transfer to skeletal muscle in murine and canine hemophilia B models by adeno-associated viral vector serotype 1. Blood 103 , 85-92 (2004). 112 Fields,P.A. et al. Risk and prevention of anti-fact or IX formation in AAV-mediated gene transfer in the contex t of a large deletion of F9. Mol. Ther. 4 , 201-210 (2001). 113 Fields,P.A. et al. Role of vector in activation of T cell subsets in immune responses against the secreted tran sgene product factor IX. Mol. Ther. 1 , 225-235 (2000). 114 Herzog,R.W. & Dobrzynski,E. Immune im plications of gene therapy for hemophilia. Semin. Thromb. Hemost. 30 , 215-226 (2004). 115 Chao,H., Monahan,P.E., Liu,Y., Samulski,R.J., & Walsh,C.E. Sustained and complete phenotype correction of hemophilia B mice following intramuscular injection of AAV1 serotype vectors. Mol. Ther. 4 , 217-222 (2001). 116 Xiao,W. et al. Gene therapy vectors based on adeno-associated virus type 1. J. Virol. 73 , 3994-4003 (1999). 117 Sandalon,Z. et al. Secretion of a TNFR:Fc fusion protein following pulmonary administration of pseudotyped aden o-associated virus vectors. J. Virol. 78 , 1235512365 (2004).

PAGE 142

129 118 Co,M.S. et al. Chimeric and humanized antibodies with specific ity for the CD33 antigen. J. Immunol. 148 , 1149-1154 (1992). 119 Fan,Z.C. et al. Comparison of the three-dimensiona l structures of a humanized and a chimeric Fab of an anti-gamma-interferon antibody. J. Mol. Recognit. 12 , 19-32 (1999). 120 bray-Sachs,M. et al. Prevention of diabetes in NOD mice treated with antibody to murine IFN gamma. J. Autoimmun. 4 , 237-248 (1991). 121 Nicoletti,F. et al. The effects of a nonimmunogeni c form of murine soluble interferon-gamma receptor on the developm ent of autoimmune diabetes in the NOD mouse. Endocrinology 137 , 5567-5575 (1996). 122 Wogensen,L. et al. Postnatal anti-interferon-gamma treatment prevents pancreatic inflammation in transgenic mice with beta-cell expression of interferon-gamma. J. Interferon Res. 14 , 111-116 (1994). 123 Gysemans,C.A. et al. Disruption of the gamma-interf eron signaling pathway at the level of signal transducer and activator of transcription-1 prevents immune destruction of beta-cells. Diabetes 54 , 2396-2403 (2005). 124 Baker,M.S. et al. Genetic deletion of chemoki ne receptor CXCR3 or antibody blockade of its ligand IP10 modulates posttransplantati on graft-site lymphocytic infiltrates and prolongs func tional graft survival in pa ncreatic islet allograft recipients. Surgery 134 , 126-133 (2003). 125 Popa,C. et al. Cytokine production of stimul ated whole blood cultures in rheumatoid arthritis patients receivi ng short-term infliximab therapy. Cytokine 30 , 72-77 (2005). 126 Skurkovich,S., Kasparov,A., Narbut,N., & Skurkovich,B. Treatment of corneal transplant rejection in humans with anti-inte rferon-gamma antibodies. Am. J. Ophthalmol. 133 , 829-830 (2002). 127 Sigidin,Y.A., Loukina,G.V., Skurkovic h,B., & Skurkovich,S. Randomized, doubleblind trial of anti-interferon-gamma antibodies in rheumatoid arthritis. Scand. J. Rheumatol. 30 , 203-207 (2001). 128 Yamazaki,T. et al. Expression of programmed death 1 ligands by murine T cells and APC. J. Immunol. 169 , 5538-5545 (2002). 129 Ma,J. et al. Regulation of macrophage activation. Cell Mol. Life Sci. 60 , 2334-2346 (2003). 130 Muhl,H. & Pfeilschifter,J. Anti-inflammatory properties of pro-inflammatory interferon-gamma. Int. Immunopharmacol. 3 , 1247-1255 (2003).

PAGE 143

130 131 Sakaguchi,S., Sakaguchi,N., Asano,M., It oh,M., & Toda,M. Immunologic selftolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanis m of self-tolerance causes various autoimmune diseases. J. Immunol. 155 , 1151-1164 (1995). 132 Andre,I. et al. Checkpoints in the progression of au toimmune disease: lessons from diabetes models. Proc. Natl. Acad. Sci. U. S. A 93 , 2260-2263 (1996). 133 Sarween,N. et al. CD4+CD25+ cells c ontrolling a pathogenic CD4 response inhibit cytokine differentiation, CXCR-3 expression, and tissue invasion. J. Immunol. 173 , 2942-2951 (2004). 134 Nishikawa,H. et al. IFN-gamma controls the genera tion/activation of CD4+ CD25+ regulatory T cells in antitumor immune response. J. Immunol. 175 , 4433-4440 (2005). 135 Qin,H. et al. Progression of spontaneous autoimm une diabetes is associated with a switch in the killing mechanis m used by autoreactive CTL. Int. Immunol. 16 , 16571662 (2004). 136 Liu,E. et al. Nondepleting anti-CD4 monoclona l antibody prevents diabetes and blocks induction of insulin autoantibo dies following insulin peptide B:9-23 immunization in the NOD mouse. J. Autoimmun. 21 , 213-219 (2003). 137 Ildstad,S.T., Chilton,P.M., Xu,H., Domeni ck,M.A., & Ray,M.B. Preconditioning of NOD mice with anti-CD8 mAb and costimul atory blockade enhances chimerism and tolerance and prevents diabetes, while depletion of {alpha}{beta}-TCR+ and CD4+ cells negates the effect. Blood 105 , 2577-2584 (2005). 138 Chatenoud,L. CD3 antibody treatment stimul ates the functional capability of regulatory T cells. Novartis. Found. Symp. 252 , 279-286 (2003). 139 Drage,M. et al. Nondepleting anti-CD4 and solubl e interleukin-1 receptor prevent autoimmune destruction of syngeneic islet grafts in diabetic NOD mice. Transplantation 74 , 611-619 (2002). 140 Kuldo,J.M. et al. Differential effects of NF-{ka ppa}B and p38 MAPK inhibitors and combinations thereof on TNF{alpha}and IL-1{beta}-induced proinflammatory status of endothelial cells in vitro. Am. J. Physiol Cell Physiol 289 , C1229-C1239 (2005). 141 Thomas,H.E. et al. IL-1 receptor deficiency slows progression to diabetes in the NOD mouse. Diabetes 53 , 113-121 (2004).

PAGE 144

131 BIOGRAPHICAL SKETCH Gregory George Simon was born on April 2nd 1977 in Stratford, New Jersey. He spent his early youth in Turnersville, New Jersey and then moved to Palm Harbor, Florida at the age of 10. In the 9th grade he moved to Cooper City, Florida where he attended and graduated from Boyd Anderson High School’s International Baccalaureate Program in 1996. He obtained his Bachelor of Science degrees in microbiology and genetics from the University of Florida in 1999. He entered the University of Florida, College of Medicine Interdisciplinary Program in Biomedical Sciences in the fall of 2001. Upon joining the laboratories of Dr. Ba rry Byrne and Dr. Mark Atkinson in 2002, he initiated studies of recombinant adeno-asso ciated virus gene ther apy applications in immune modulation for the treatment of t ype 1 diabetes. After completing his Ph.D., Greg plans to pursue a master's degree in pub lic health at the Johns Hopkins University beginning the summer of 2006.