Citation
Estrogen Action on the Ovine Fetal Hypothalamic-Pituitary-Adrenal (HPA) Axis

Material Information

Title:
Estrogen Action on the Ovine Fetal Hypothalamic-Pituitary-Adrenal (HPA) Axis
Creator:
SCHAUB, CHRISTINE ELAINE ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Estrogen receptors ( jstor )
Estrogens ( jstor )
Fetus ( jstor )
Messenger RNA ( jstor )
Parturition ( jstor )
Plasmas ( jstor )
Pregnancy ( jstor )
Receptors ( jstor )
Sheep ( jstor )
Sulfates ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Christine Elaine Schaub. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/31/2008

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

ESTROGEN ACTION ON THE OVINE FETAL HYPOTHALAMIC-PITUITARY-ADRENAL (HPA) AXIS By CHRISTINE ELAINE SCHAUB A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Christine Elaine Schaub

PAGE 3

To my parents, Louis and Patricia Scha ub. With your love, faith, generosity, and selflessness you made it possibl e for many of my dreams to come true. Thank you for encouraging me to reach for the stars.

PAGE 4

iv ACKNOWLEDGMENTS I would like to thank my committee chair, Dr. Charles E. Wood, for teaching me physiology and the painstaking process of writing, and for teaching me many valuable life lessons. He has been an exceptional ment or and dedicated advisor. I am extremely grateful for the opportunity to complete my di ssertation in his lab and for his faith in my ability to succeed in this profession. I would also like to thank my other s upervisory members (Drs. Maureen KellerWood, Pushpa Kalra, Kathleen Shiverick, and William Millard) for their suggestions and guidance in shaping my dissertation. Dr . Keller-Wood was so much a part of my experience at the University of Florida that I consider her a co-mentor. I greatly respect her as a role model for women in science. Thanks also go to every member of the Wood and Keller-Wood labs (including past members Drs. Kelly Gridley and Da mian Giroux) for helping me troubleshoot, design experiments, and grow as a scientis t. Xiaoyang (Lisa) Fang deserves special thanks for helping me patiently with many as pects of my project. Thanks also go to Marcela VonReitzenstein and Melanie Powe rs for sharing one of the worst lab responsibilities with me: weekend sheep duty when the season was chaotic! In addition, I would like to thank the friends who made the last 4 years in Gainesville so enjoyable: Kimberly Aike n, Sarah Koch, Melanie Powers, and Nilanjana Sengupta started as study-buddies and have b ecome wonderful friends and supporters of

PAGE 5

v my success. I do not think I would have fi nished on time without Sarah and I forcing ourselves to work on our dissert ations together every week. Finally, I thank my family and life-long frie nds for believing in me. I would not be where I am today without their love, support, and encouragement through every step of my educational pursuits. Their sacrifi ces allowed me to realize my dreams.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES.............................................................................................................ix LIST OF FIGURES.............................................................................................................x ABSTRACT......................................................................................................................x ii CHAPTER 1 INTRODUCTION........................................................................................................1 Background and Significance.......................................................................................1 Control of Parturition....................................................................................................2 Timing of Parturition is Altered after Disruption or Stimulation of the Hypothalamic-Pituitary-Adrenal (HPA) Axis...................................................2 Development of the HPA Axis..............................................................................3 The HPA Axis and Placental Ster oidogenesis: Human vs. Sheep.......................5 Estrogen and the HPA Axis..........................................................................................6 Influence of Estrogen and Androgen on Timing of Parturition............................8 Estrogen Increases PGHS-2 in the Ovine Fetal Brain...........................................8 Sulfoconjugation of Plasma Estrogen...................................................................9 Neurosteroids in the Brain...................................................................................10 Estrogen Receptor (ER) Function...............................................................................12 Estrogen Receptor Knock-Out Studies................................................................12 Differential Regulation of Transcription.............................................................13 Classical ER Action.............................................................................................14 Ligand-Independent ER Action...........................................................................15 ERE-Independent ER Action..............................................................................16 Non-Genomic (Membrane-Associated) ER Action............................................16 ER Turnover........................................................................................................19 Antiestrogens..............................................................................................................19 Summary.....................................................................................................................21 Specific Aims..............................................................................................................22

PAGE 7

vii 2 ERAND ERmRNA AND PROTEIN EXPRESSION IN THE DEVELOPING OVINE BRAIN................................................................................26 Abstract....................................................................................................................... 26 Introduction.................................................................................................................26 Materials and Methods...............................................................................................27 Tissue Collection.................................................................................................27 RNA Isolation and Real Time RT-PCR..............................................................28 Protein Isolation a nd Western Blotting...............................................................29 Statistical Analysis..............................................................................................30 Results........................................................................................................................ .31 RT-PCR...............................................................................................................31 Western Blotting..................................................................................................31 Discussion...................................................................................................................32 3 FETAL HPA RESPONSES TO ES TRADIOL SULFATE OR ICI 182,780.............44 Abstract....................................................................................................................... 44 Introduction.................................................................................................................45 Materials and Methods...............................................................................................46 Surgical Preparation............................................................................................46 Surgery................................................................................................................47 Post-Operative Care.............................................................................................48 Blood Collection..................................................................................................48 Plasma Hormone Assays.....................................................................................48 Estradiol.......................................................................................................48 Estradiol sulfate............................................................................................49 Cortisol.........................................................................................................49 Dehydroepiandrosterone sulfate (DHEAS)..................................................50 Progesterone.................................................................................................50 Adrenocorticotropin hormone (ACTH).......................................................50 ACTH1-39......................................................................................................51 Pro-opiomelanocortin (POMC)....................................................................51 Statistical Analysis..............................................................................................51 Results........................................................................................................................ .52 Blood Gases.........................................................................................................52 Fetal Plasma ACTH, POMC, and Cortisol..........................................................52 Fetal Plasma Estradiol and Estradiol Sulfate.......................................................53 Plasma Progesterone............................................................................................54 Plasma DHEAS...................................................................................................54 Effect of Treatment on Day of Spontaneous Parturition.....................................54 Discussion...................................................................................................................55

PAGE 8

viii 4 EXPRESSION OF HPA AXIS RELATED GENES IN RESPONSE TO ESTRADIOL SULFATE OR ICI 18 2,780 IN TWIN OVINE FETUSES.................66 Abstract....................................................................................................................... 66 Introduction.................................................................................................................67 Materials and Methods...............................................................................................68 Surgical Preparation............................................................................................68 Surgery................................................................................................................69 Blood Collection..................................................................................................69 Tissue Collection.................................................................................................70 Plasma Hormone Assays.....................................................................................70 RNA Isolation and Real Time RT-PCR..............................................................70 Protein Isolation a nd Western Blotting...............................................................71 Statistical Analysis..............................................................................................71 Results........................................................................................................................ .71 Plasma Hormones................................................................................................71 Real Time RT-PCR.............................................................................................72 Western Blots......................................................................................................73 Discussion...................................................................................................................73 5 SUMMARY................................................................................................................94 BIOGRAPHICAL SKETCH...........................................................................................120

PAGE 9

ix LIST OF TABLES Table page 2-1 Distribution of sample size for each tissue type and age group studied..................37 2-2 Estrogen receptor primer and probe sequences used in real-time RT-PCR.............37 3-1 Average fetal blood gases and pH during blood sampling.......................................60 4-1 Primer and probe sequences used in real time RT-PCR..........................................79

PAGE 10

x LIST OF FIGURES Figure page 1-1 Ovine HPA axis........................................................................................................23 1-3 Genomic and non-genomic mechanis ms of estrogen receptor signaling.................25 2-1 Ontogeny of ERand ERmRNA expression in ovine brain..............................38 2-2 Ontogeny of ERand ERmRNA expression in ovine pituitary and hypothalamus...........................................................................................................39 2-3 Ontogeny of brainstem ER protein...........................................................................40 2-4 Ontogeny of hippocampal ER protein......................................................................41 2-5 Ontogeny of frontal cortex ER protein.....................................................................42 2-6 Ontogeny of cerebellar ER protein...........................................................................43 3-1 Plasma ACTH in singleton ovine fetuses.................................................................61 3-2 Plasma ACTH1-39 in singleton ovine fetuses............................................................61 3-3 Plasma POMC in singleton ovine fetuses................................................................62 3-4 Plasma cortisol in singleton ovine fetuses................................................................62 3-5 Plasma estradiol in singleton ovine fetuses..............................................................63 3-6 Plasma estradiol sulfate in singleton ovine fetuses..................................................63 3-7 Plasma progesterone in singleton ovine fetuses.......................................................64 3-8 Plasma DHEAS in singleton ovine fetuses..............................................................64 3-9 Effect of treatment on day of spontaneous parturition.............................................65 4-1 Plasma ACTH in twin fetuses..................................................................................80 4-2 Plasma ACTH1-39 in twin fetuses..............................................................................80

PAGE 11

xi 4-3 Plasma POMC in twin fetuses..................................................................................81 4-4 Plasma cortisol in twin fetuses.................................................................................81 4-5 Plasma estradiol in twin fetuses...............................................................................82 4-6 Plasma estradiol sulfate in twin fetuses....................................................................82 4-7 Plasma DHEAS in twin fetuses................................................................................83 4-8 Plasma progesterone in twin fetuses........................................................................83 4-9 AVP mRNA expression in hypothalamus................................................................84 4-10 CRH mRNA expression in hypothalamus...............................................................84 4-11 POMC mRNA expression in pituitary.....................................................................85 4-12 PC1 mRNA expression in pituitary..........................................................................85 4-13 ERmRNA expression in ovine brain....................................................................86 4-14 ERmRNA expression in ovine brain....................................................................86 4-15 PGHS-1 mRNA expre ssion in ovine brain..............................................................87 4-16 PGHS-2 mRNA expre ssion in ovine brain..............................................................87 4-17 SGK mRNA in hippocampus...................................................................................88 4-18 SGK mRNA in pituitary...........................................................................................88 4-19 STS mRNA expression in hypothalamus.................................................................89 4-20 STS mRNA expression in cerebellum.....................................................................89 4-21 ERprotein expression in estradiol sulf ate (E2SO4) treated sheep relative to control.......................................................................................................................9 0 4-22 ERprotein expression in estradiol sulf ate (E2SO4) treated sheep relative to control.......................................................................................................................9 1 4-23 ERprotein expression in ICI 182,780 (ICI) treated sheep relative to control......92 4-24 ERprotein expression in ICI 182,780 (ICI) treated sheep relative to control......93

PAGE 12

xii Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ESTROGEN ACTION ON THE OVINE FETAL HYPOTHALAMIC-PITUITARY-ADRENAL (HPA) AXIS By Christine Elaine Schaub December 2005 Chair: Charles E. Wood Major Department: Physiol ogy and Functional Genomics Endogenous plasma estradiol concentrations rise near term as a result of P450C17 induction in the ovine placenta by cortisol. This causes augmented HPA axis activity, which is important in maturing the fetus for survival outside the womb, and may communicate placental maturation and readines s for birth. These experiments were designed to test the hypotheses that 1) expres sion of estrogen receptors is ontogenetically regulated in the ovine brain, 2) estrogen acts at the fetal brain to influence the timing of parturition, and 3) estrogen m odulates expression of genes im portant in regulation of the HPA axis. We found that estrogen receptors (E Rs) are present in the ovine brain and that expression is developmentally regulated a nd region specific. We speculate that differences in ontogenetic expression of the two ER isoforms, ERand ER, result from a counterbalance between fetal matu ration and increased responsiveness to estradiol.

PAGE 13

xiii In in vivo experiments, chronically catheterized singleton fetuses were treated with estradiol sulfate icv (1 mg/day, n=5); estradiol sulfate iv (1 mg/day, n=6); ICI 182,780 icv (25 g/day, n=5); or saline control (n=5). Plasma hormone assays show that all treatments attenuate plasma adrenocorticotropin hormone (ACTH) without affecting plasma cortisol. Estradiol sulfate icv significantly increased plasma estradiol, estradiol sulfate, and progesterone while ICI 182,780 icv increased plasma dehydroepiandrosterone sulfate (DHEAS). Neith er drug altered the timing of parturition. Twin fetuses were treated with es tradiol sulfate (n=4) or ICI 182,780 icv (n=6), with one twin from each ewe serving as an in ternal control, and were sacrificed between days 130 and 134 for tissue analysis. Estrad iol sulfate signifi cantly down-regulated mRNA expression of pro-opiom elanocortin (POMC) and ERin pituitary; prostaglandin endoperoxide synthase 1 (PGHS-1) and ERin hippocampus; and corticotrophinreleasing hormone (CRH) in hypothalamus. ICI 182,780 significantly upregulated ERprotein expression in th e frontal cortex. Results suggest that estradiol sulfate affects the HPA axis in a manner inconsistent with the known effects of unconjugated estradio l and that there are differences in short versus long term infusion. We speculate that estradiol sulfate may attenuate HPA activity through interaction with gamma am ino butyric acid type A (GABAA) receptors or by acting as an estrogenreceptor antagonist.

PAGE 14

1 CHAPTER 1 INTRODUCTION Background and Significance The timing of parturition in mammals is cri tical. The initiation of birth must occur when the fetus has sufficiently matured and deve loped, in order to ensure survival outside of the womb. Fetal maturity depends on ad equate perfusion of the placenta by the maternal circulation, and the ability of th e fetus to maintain proper cardiovascular homeostasis. Disruption of utero-placental bl ood flow, altered fetal blood gases, changes in maternal or fetal blood volume and homeostasis, and infection can all lead to premature birth. Premature birth forces an underdeveloped fetus to subsist in an environment it is not yet prepared to f ace. Survival is often challenged by underdeveloped lungs that fail to produce pulmona ry surfactant, and failure of the fetus to transition smoothly from fetal to neonatal circulation. Preterm birth occurs in approximately 5 to 10% of all pregnancies, but accounts for 70 to 75% of neonatal mortality and morbidity (1). Unfortunately, clinicians do not yet have the tools necessary to diagnose women at risk for preterm delivery, resulting in billions of dollars spent annua lly on the care of premature ba bies. It is common practice for physicians to treat women with repeated do ses of glucocorticoids to hasten fetal lung maturation when preterm delivery is suspecte d, but this has the deleterious effect of producing low-birthweight and growth-retarded babies (2;3). To effectively treat and prevent preterm labor it is neces sary to elucidate the biochemical mechanisms involved in parturition.

PAGE 15

2 Control of Parturition It was first postulated in the 1930s, after observation of postmaturity in anencephalic babies, that parturi tion is a neuroendocrine event initiated by the fetus (4). Prolonged gestation was also noted in pre gnant sheep after inge stion of the plant Veratrum californicum , which caused teratologic deformities of the lamb, including cyclopsia and absence or misplacement of th e pituitary (5;6). The connection between these natural phenomena and the role of the fetal hypothala mic-pituitary-adrenal (HPA) axis in initiation of parturition was scient ifically established by Liggins (7). Timing of Parturition is Altered af ter Disruption or Stimulation of the Hypothalamic-Pituitary -Adrenal (HPA) Axis Disruption of the HPA axis at any level can induce alterations in gestation length. Liggins found that pituitary ablation in fetal sheep indefinitely delays parturition, thus artificially inducing pert urbations as seen in the fetuses with teratogenic deformities (8). Antolovich and colleagues (9) confirmed Liggins’ observation by finding that fetal hypothalamo-pituitary disconnection between 108 and 112 days gestation prolonged gestation by at least 8 days. Others demons trated the need to maintain the hypothalamopituitary connection until 135 days gestation for spontaneous pa rturition to occur (10;11). Further studies showed that particular hypotha lamic nuclei are important in initiation of birth. Specifically, bilateral destruction of the paraventricu lar nucleus (PVN) of the fetal hypothalamus results in lengthened gestation (12). Disruption of the axis at the level of the adrenal via adrenalectomy will also delay parturition in the ewe (13). Stimulation of the HPA axis is also know n to affect spontaneous parturition. Liggins (14;15) showed that infusion of AC TH or cortisol peripherally into fetal sheep induces premature parturition. Infusion of eith er of these hormones into the pregnant ewe

PAGE 16

3 fails to yield the same result. Further suppor t for the importance of the role of the HPA axis was gained after parturition was achieved with adrenocorticotropin hormone (ACTH) or glucocorticoid replacement in hypophysectomized fetal sheep (16). Those studies confirmed that parturiti on is in fact a neuroendocrine event, initiated by the fetus, and requires an intact HPA axis. Development of the HPA Axis The HPA axis is a neuroendocrine pathwa y involved in maintaining homeostasis, recovery after stress (such as hemorrhag e, hypoxia, hypotension, and hypercapnia), acceleration of organ maturation ( 17), and initiation of parturition in species such as the sheep (7). All of these f unctions depend on sequential stim ulation and maturation of the axis, as development proceeds. The PVN of the hypothalamus is re sponsible for synthesis of the corticotrophin-releasing factors, arginine vasopressin (AVP), and corticotripin-releasing hormone (CRH) that control s ecretion of ACTH. There are three major efferent systems in the PVN: magnocellular neurons that pr oject directly to the posterior pituitary, parvocellular neurons that pr oject to the median eminence and release hormones into the hypophysial portal system affecting anteri or pituitary func tion, and descending autonomic neurons that projec t to the brainstem and spinal cord (18). In general, magnocellular neurons synthesize and store AVP, while parvocellular neurons contain CRH; however, the hormones are co-localized in half of CRH positive neurons and can be found in the same neurosecretory vesi cles of the median eminence (19;20). Immunoreactive AVP and CRH can be detect ed in the sheep hypothalamus as early as 70 days gestation, with significant incr eases in both occurring between 100 and 130 days (21). Others have repor ted CRH present in neurons and nerve fibers of the PVN as

PAGE 17

4 early as 49 days (22). Argini ne vasopressin and CRH have a synergistic effect on ACTH release from the anterior p ituitary (23;24); however, after 130 days, the ratio of AVP to CRH decreases, making CRH the predominant corticotrophin-relea sing factor in the hypothalamus later in gestation (21). H ypothalamic CRH mRNA doubles in 140 to 142 day ovine fetuses compared to younger fetuses, while CRH peptide increases by 2.5 fold in 140 to 142 day fetuses (25). Patent vessels can be identified in th e median eminence, pituitary stalk, and pituitary of fetal sheep by 45 days gestat ion, indicating that the pituitary may be responsive to endocrine input from the hypotha lamus relatively early in gestation (26). The ovine anterior pituitary is immunor eactive for pro-opiomelanocortin (POMC) derived hormones, including ACTH, by 38 days (27), and becomes progressively more responsive to CRH stimulation after 100 days (28). Pituitary ACTH secretion can be regulated by decreasing CRH receptors in the pituitary or by d ecreasing POMC mRNA abundance. Lu and colleagues (29) demonstrat ed the ability of AVP, CRH, and cortisol to downregulate CRH receptors, while cortisol is also able to attenuate POMC mRNA abundance. The hypothalamus and pituitary are functiona lly active much earlier than the fetal adrenal. Until approximately 120 days gestati on, the adrenal is relatively immature and unresponsive to ACTH stimulus (30). From 100 to 121 days gestation, fetal plasma cortisol can be accounted for by trans-placental passage from mother to fetus; however, as the fetal adrenal matures, a significantly larger proportion of cortisol is of fetal origin (31). By 122 to 135 days maternal cortisol only accounts for 37% of total fetal cortisol; and the percentage drops to 12% or less in fetuses greater than 136 days (31).

PAGE 18

5 Throughout much of gestation, fetal plasma ACTH and cortisol are kept at low concentrations by relative inactivity of the fetal adrenal gland and negative feedback inhibition of ACTH secretion (32;33). Ho wever, near term there is a spontaneous increase in fetal HPA activity that leads to a se milogarithmic rise in fetal plasma cortisol. Fetal plasma ACTH increases in the same fashi on, either in parallel or after the increase in cortisol (34). The concomitant increase in ACTH and cortisol in the fetus is the result of increased adrenal sensitivity to ACTH near term (35) and decreased negative feedback on ACTH secretion (36). Increased cortisol secretion at the en d of gestation induces placental CYP450C17, which has 17 -hydroxylase and 17,20 lyase activities (3 7;38). During most of gestation, the ovine placenta expresses l ittle to no CYP17, leading the placenta to secrete primarily progesterone; however, the inductio n of this enzyme by cortisol near term results in an increase in estrogen synthesis at the expense of progester one (Figure 1-1). The HPA Axis and Placental Stero idogenesis: Human vs. Sheep In humans and other primates, there is no inducible CYP17 expressed in the placenta; therefore, steroidogenic precursors n ecessary for estrogen biosynthesis originate elsewhere (39). The human feta l adrenal (like the sheep adrenal) is under the control of ACTH, which is able to act on two distinct re gions of the cortex: the “adult zone” and the “fetal zone”. The adult z one responds to ACTH similarly to the ovine adrenal by secreting cortisol. The fetal zone lacks 3hydroxysteroid dehydrogenase (3 -HSD) activity and therefore cannot produce cortisol; however, it does contain the enzymes necessary to make the st eroid precursors dehydroepia ndrosterone (DHEA) and dehydroepiandrosterone sulfate (DHEAS). Dehydroepiandroste rone and DHEAS are then used as substrate by the placenta for estrogen biosynthesis (40). The major

PAGE 19

6 difference, therefore, between the human a nd sheep fetus is that , in the human, ACTH and not glucocorticoids are responsible fo r induction of steroidogenesis. Estradiol concentrations still rise near term in the hum an, but this is a result of ACTH and adrenal steroidogenesis coupled with pl acental steroidogenesis (the so-called “feto-placental unit”). Ultimately, estrogen biosynthesis in the human (41) and sheep (8) is controlled by the activity of the HPA axis, and is critic al in the final common pathway leading to parturition. Concomitant progesterone withdr awal and estrogen production in both the human and sheep causes a loss of myometrial quiescence and an increase in uterine activity. Augmented plasma estrogen near parturition also results in an increased sensitivity of the myometrium to oxytocin (42;43), increased force of contraction by production of PGF2 , and stimulation of gap junction formation in the uterus, thus allowing the myometrium to develop sync hronous contractions (44). Once the myometrium is activated, labor is a pr ocess that will continue to completion. Estrogen and the HPA Axis Studies using adult rats show that the activity of the HPA axis is increased in response to estrogen. Sex differences between male and female rats have been shown in activity of the axis, as females have higher basal and stimulated plasma corticosterone than males (45). Fluctuations in activity also occur as a function of ovarian cycle stage. In female rats, greater responses to st ress (as measured by CRH transcription, Fos responses, plasma ACTH, and plasma cortic osterone) occur during proestrous, when plasma estrogen is high (46-50). Similarly, in women, plasma ACTH and cortisol rise toward the end of the follicul ar phase (51). After ovari ectomy, pre-menopausal women have a significant decrease in ACTH and ad renal steroid producti on (52). In vitro,

PAGE 20

7 corticosterone production in adrenal ho mogenates from oophorectomized rats is significantly lowered after a 20 to 60 minute incubation (53). This effect is reversed in vitro after estradiol replacement (54). Like wise, several studies show decreased HPA responses to stress in rats in vivo after ovariectomy with ame lioration of activity after estradiol replacement (55;56). Data from the Wood lab also support a role of estrogen in stimulating the fetal HPA axis. Fetal sheep were chronically catheter ized and received a subcutaneous pellet containing either estradiol or androstenedi one (0.25 mg/day). Estradiol implantation resulted in an increased plasma estr adiol concentration from 26.01.1 to 51.6.5 pg/mL. At 5 to 7 days after pellet impla nts, fetuses were subjected to a 10-minute infusion of sodium nitroprusside (50 g/min IV, a stimulator of hypotension) preceded by a 2-hour infusion of either cortisol (0.5 g /min) or saline. Androstenedione did not appear to affect ACTH secretion, even after pretreatment with cortisol; however estradiol treatment for 5 to 7 days potently incr eased HPA activity, as measured by ACTH secretion, in basal and stimulated conditions (57). Further experiments were performed to eluc idate the sites of estrogen action in the central nervous system (58). Fetal sheep were treated with estradiol pellet (0.25 mg/day) or placebo (control). Brachiocephalic occl usion (BCO) was used in place of sodium nitroprusside to induce hypotensi on. Fos, the protein product of the early response gene c-fos, was used as a marker of cellular ac tivity in this study. Br achiocephalic occlusion increased Fos abundance in areas of the br ain involved in cardiovascular reflex responsiveness (NTS, PVN, CVLM, and RV LM); while carotid sinus denervation (removal of carotid sinus baroand chemorecepto rs) attenuated this response. Estrogen

PAGE 21

8 augmented the response to BCO in the same br ain regions. Those studies indicate that estrogen is able to modulate HPA activity thr ough increased secretion of ACTH, and that estrogen increases neuronal activity in brai n regions important in baroreceptor and chemoreceptor signaling. Influence of Estrogen and Androgen on Timing of Parturition Wood and colleagues tested the hypothesi s that increases in fetal plasma 17 estradiol and androstendione m odulate the activity of the feta l HPA axis (59). Seventeen time-dated pregnant ewes were treated with subcutaneous pellets of either cholesterol (control), androstenedione, 17 -estradiol, or andr ostenedione plus 17 -estradiol. All pellets released steroid at a rate of 0.25 mg/d ay. Estradiol signifi cantly increased ACTH and cortisol secretion, while treatment with androstenedione and estradiol significantly advanced the day of parturition by approxima tely four days. Estradiol alone did not advance parturition; however, it was suggest ed that local production of estrogen could have resulted from aromatiza tion of androstenedione in ew es treated with both estrogen and androstenedione. Estrogen Increases PGHS-2 in the Ovine Fetal Brain Prostaglandins and prostagl andin synthases are critically important in reproductive processes. Prostaglandin endoperoxide s ynthase 2 (PGHS-2) deficient mice have deficiencies in ovulation, fertilization, implantation, and decidualization (60). Prostaglandins are produced in a biochemi cal reaction involvi ng the liberation of arachidonic acid, the substrate for PGHS-1 a nd -2, from the plasma membrane after cleavage of phospholipids by Phospholipase A2 (61). Prostaglandin G/H Synthases catalyze a cyclooxygenase reaction that converts arachidonic acid to PGG2, and a peroxidase reaction that reduces PGG2 to PGH2. Secondary synthases then form

PAGE 22

9 biologically active e nd products from PGH2, such as prostaglandins (PGD2, PGE2, and, PGF2 ), prostacyclin (PGI2) , and thromboxane A2. Studies have shown that estrogen acts to increase expression of PGHS-2 in the brain in addition to augmenting HPA activity. Five day treatment of fetal sheep with estradiol (0.25 mg/day) increased expre ssion of PGHS-2, but not PGHS-1 in the brainstem and cerebellum and increased PGHS-2 protein in the hippocampus (62). Those studies have led to the hypot hesis that estrogen may stimul ate increased HPA expression in late gestation through incr eased prostanoid production. Sulfoconjugation of Plasma Estrogen Sulfoconjugated estrogens, such as estrone-3-sulfate and 17 -estradiol-3-sulfate, are abundant in fetal plasma (63;64). The enzyme sulfotransferase (STF) synthesizes sulfoconjugated hormones by adding a sulfate group to unconjugated st eroids (65;66). Sulfated hormones cannot bind to estrogen r eceptors (67;68), but can be converted to biologically active steroids by th e enzyme steroid sulfatase (S TS) (65;66). Conferring a sulfate group to a steroid has the benefit of increasing the ha lf-life in the blood (67) and prevents the hormone from binding to receptors in target tissues. STS and STF have been shown to be important in normal developmen t and pregnancy. Mutations of the STS gene in the fetus lead to a condition called ichthyosis, which causes scaling of the skin (69;70). Sulfatase deficiency in the placenta causes low placental production of estrogen from DHEAS, prolonged gestation, and failure of labor induction (71;72), while STF deficiency in the placenta leads to hi gh free estrogen, placental thrombosis, and spontaneous fetal death (73). Tissue distribution of the enzymes ST S and STF reveals some overlap in expression. STS can be found in classic ster oidogenic tissues (e.g., testes, ovary, adrenal

PAGE 23

10 gland, placenta, brain, and endometrium), but al so in peripheral tissues (e.g., liver, lung, viscera, aorta, kidney, and bone) (65). STF can be found in classic targ et tissues such as placenta, adrenal gland, pregnant uterus, a nd mammary epithelial cells (68). Estrogen sulfatase has been found in both adult (74-77) and fetal brain (78). Immunohistochemical staining indicates the presence of both STS and STF within neurons in fetal brain regions known to be important in modulating HPA ac tivity. Specifically, STS and STF are both found within the PVN, RVLM, NTS, and hippocampus (78;79). Expression of STS and STF in the same neuronal populations, as well as abolished receptor binding with sulfation, lead investig ators to speculate that these enzymes may control availability of biol ogically active estrogens in target tissues (39;79). Additionally, sulfoconjugated estrogens circulate in plasma in much higher concentrations than free estr ogens, indicating that the pool of inactive steroid may serve as a reservoir for local deconj ugation and activation at target sites (39). For example, 17 -estradiol-3-sulfate is measured at concen trations of 1 to 2 ng/mL in fetal plasma compared to 20 to 50 pg/mL for unconjugated estradiol (64). The abundance of enzyme activity in the fetal brain compared to periphe ral tissue (78), coupled with the ability of sulfated estrogens to be taken up by brain ti ssue (64), suggests that conjugated estrogens may be targeted to the brain to serve a neur oendocrine role, perhap s in the control of parturition (39). Neurosteroids in the Brain Even more intriguing is the possibility that , instead of being targeted to the brain, steroids can be produced locally. The first evidence for de novo steroidogenesis in the brain came from the observation that, in the brains of rats that were castrated and adrenalectomized, pregnenolone and DHEA and their conjugated forms were able to

PAGE 24

11 accumulate (80). Neurosteroidogenesis is possible due to the presence of enzymes in the brain that are traditionally f ound in classic steroidogenic ti ssues (81-85). Not all cell types in the brain are equippe d with every enzyme, thus st eroidogenic machinery dictates what products are made. For example, astroc ytes, oligodendrocytes, and neurons are all capable of steroidogenesis, but neurons pre dominantly produce estrogen while astrocytes are the major producers of DHEA (82). The estrogens that are produced locally within the brain have trophic actions that prom ote neuronal differentiation and dendritic branching in regions such as the cerebellum (86;87). Exogenous estrogen can affect neurostero idogenesis in the brain. Estrogen treatment increases progesterone levels in me dia of neonatal cortical astrocytes (88) and increases 3 -hydroxysteroid dehydrogenase (3 -HSD) mRNA and activity in the hypothalamus of ovariectomized and adrena lectomized rats (89). Increased 3 -HSD activity in the hypot halamus induces de novo synthesis of progesterone from cholesterol and initiates the lutenizing hormone (LH) surge. The LH surge is effectively abolished in rats with an inhibitor of 3 -HSD, indicating de novo synthesis of progest erone is required (89). On the other hand, estrogen wit hdrawal augments DHEAS accumulation and simultaneously attenuates sulf atase expression in ovariectomized rats, suggesting that estrogen is able to modulate th e ratio of conjugated to unconjug ated steroids in the brain through control of the sulfatase enzyme (90). Altering the ratio of conjugated to unconj ugated steroids in th e brain could have significant consequences. Both types of steroids are able to modulate GABAA receptors, but can be inhibitory or excitatory de pending on conjugation. DHEA is a known GABAA agonist (91;92) while sulf ated steroids are known antagonists (93-96). The GABAA

PAGE 25

12 receptor is a transmitter-gated ion channel co mposed of 5 subunits, some of which have multiple isoforms (97). There are approximately 30 isoforms of GABAA heterogeneously expressed throughout the ce ntral nervous system, each having unique physiological properties depending on the co mbination of subunits present (98). Immunocytochemical studies demonstrated co localization of estr ogen receptors with glutamic acid decarboxylase (GAD, the enzyme necessary to synthesize GABA) within a population of hypothalamic neurons, raising the possibility that GABAergic neurons may transmit estrogen input (99). Estrogen Receptor (ER) Function The diverse biological effects of estrogen can be attributed to two estrogen receptor subtypes, ERand ER. ERand – are two distinct genes with very similar binding affinities for their ligand, 17 -estradiol (100;101). The cl assic estrogen receptor, ER, was cloned in 1986 (102), while ERwas not discovered and cloned until 1996 (103). Both receptors contain eight exons that en code six functional domains (A-F) (104). There are four distinct areas within the genes that are critical for modulating gene transcription: two activa tion function regions (AF-1 and AF-2), a DNA binding domain (DBD), and a ligand binding domain (LBD). The DNA binding domain is highly homologous between ERand ER, at 97%, while the ligand binding domain exhibits 60% homology (Figure 1-2) (105;106). Despite homologous structures and pharmacology, many studies revealed fundamental differences between the receptors in biological processes and in their abilities to initiate transcription. Estrogen Receptor Knock-Out Studies Knock-out studies of either or both receptors ( ERKO, ERKO, and ERKO respectively) enabled investigators to delineate between functional responses attributable

PAGE 26

13 to each subtype. Phenotypes from ERKO and ERKO are more severe than ERKO, as the former result in complete infertility of both sexes, while ERKO males exhibit normal fertility and females have decreased fertility resulting from reduced ovarian efficiency (107-109). Lutenizing hormone mRNA and protein are increased in ERKO and ERKO mice, indicating that ERis the receptor responsible for negative feedback regulation of LH in the pituitary (110). Knock-out studies also indicate that ER, not ER, is responsible for mammary gland develo pment and lactation. Interestingly, loss of both receptors leads to an ovarian phenotype that differs from either ERKO or ERKO mice (111). Specifically, adult females exhibit follicular tr ansdifferentiation to structures that resemble test icular seminiferous tubules, indicating both receptors are critical in maintaining differences in germ and somatic cells in the ovary (111). Jakacka and colleagues (112) introduced a knock-in mutation that abolished classical ER signaling through estrogen response elements (EREs) while preservi ng non-classical ER functions. The phenotype of thes e mice differed from classic ER KO mice, suggesting that both non-classical and classical ER si gnaling are important in normal reproductive development and function (112). Differential Regulation of Transcription There are two activation function domains located on ERs that enable the receptors to stimulate transcription of estrogen-responsive genes within target cells (113). AF-1 is located in the N-terminus and is considered to be constitutively active, while AF-2 is a hormone dependent domain in the C terminus (114). Studies comparing the two functional domains indicate that both recepto rs contain a potent AF-2 domain; however, ERhas minimal activity in the N-terminal AF -1 (113;115). Differences in potency of the AF domains result in differential transcription activity. For example, ERis a poor

PAGE 27

14 activator of transcription, compared to ER, when interacting with the transcription factor Sp1. This difference is attributed sp ecifically to the AF-1 region because domain “swapping” is able to reverse this phenotype (116). In addition, several grou ps showed that ERacts as a dominant negative regulator of estrogen signaling, thus attenuating ERmediated transcription when the receptors are co-expressed within a targ et cell (117-119). It was s uggested that the dominant negative activity of ERwas also attributed to differences in AF-1 (120). Differential activity of AF-1 also contribu tes to the ability of the receptors to initiate transcription on chromatin. A study by Cheung and colleagues (121) demonstrated that ERand ERexert similar transcrip tional activity on naked DNA; however, ERwas better at initiating transcripti on on a chromatin template. They were able to confirm the contribution of AF-1 to this difference by domain swapping. The above mentioned studies indicate that the AF-1 region of ER has dist inct properties that are important for chromatin interaction, recruitment of cofactors, and initiation of transcription. Classical ER Action Estrogen receptors are among a family of nuclear hormone receptors that function as transcription factors when activated by lig and and can enhance or repress transcription of target genes. ERs are found in tissues su ch as the reproductive tract, mammary glands, skeleton, cardiovascular system, and brain. Classically, the ER is in an inhibitory complex with heat shock proteins inside the nu cleus or cytoplasm of target tissues. When estrogen diffuses into the cell binds to the ER on the LBD causing a conformational change that releases the heat shock proteins and promotes dimerization of the receptor. The homo or heterodimers are then able to interact via the DBD with an estrogen

PAGE 28

15 response element (ERE) located within the promot er region of the target gene to initiate transcription (105;106;122;123). The ER tr anscription complex can exert positive or negative effects on estrogen-re sponsive genes depending upon cell and promoter type. Among the genes regulated by estrogen that contain an ERE ar e angiotensin (124), oxytocin receptor (125), vasc ular endothelial growth fact or (VEGF) (126), prolactin (127), and progesterone receptor (128). Ther e is growing evidence that, in addition to classical signaling, ERs can function in a variety of non-classical mechanisms that include ligand-independent, ERE-independent , and non-genomic mode s of action (Figure 1-3) (105). Ligand-Independent ER Action It is possible for transcription to be initiat ed in estrogen target tissues in the absence of ligand. It is known that growth factors such as epidermal growth factor (EGF) and insulin-like growth factor 1 (IGF-1) are mediators of liga nd-independent actions of ER because of their ability to activate ERs and increase expression of estrogen regulated genes (129). In mice, treatment with anti-E GF antibodies decreases uterine response to estradiol. Likewise, treati ng with the ER anta gonist ICI 164,384 is cap able of decreasing the response to EGF, indicating that the gr owth factor and ligandindependent pathways may depend on each other (130). Phosphorylation of the receptors by cellula r kinases may be a means through which ligand-independent actions of ER are regulate d. Treatment with EGF or IGF results in phosphorylation of human ERat serine residue 118, enablin g the receptor to interact with coactivators importa nt in ER-mediated gene transcription (131).

PAGE 29

16 ERE-Independent ER Action Classical and ligand-independent actions of ER require interaction with an ERE within the promoter region of target genes. There is another mechanism of action, which is ERE-independent, that allows agonist bound ER to initiate transcri ption without direct DNA binding (105). Instead, ligand-bound ER is te thered to other transcription factors that are in direct contact with DNA. It is estimated that one third of human ERresponsive genes associate indirectly with ER in this manner (132). Examples of EREindependent activation include ER interaction with Fos and Jun at AP-1 binding sites and interaction of ER with SP1 w ithin GC rich promoter sequences (105). Genes regulated in an ERE-independent fashion include EGF receptor (133), LDL receptor (134), c-fos (135), and IGF-1 (136). Non-Genomic (Membrane-Associated) ER Action While the classic view of estrogen re ceptor action involves cellular responses dependent on initiation of mRNA and protein synthesis, there are other effects of estrogen that are so rapid th at induction of genomic pathwa ys can not be responsible. These rapid effects are attributed to a plas ma membrane associat ed ER; however, our complete understanding of non-genomic ER acti ons is hindered without a cloned receptor (137). The first evidence of a plasma membrane associated ER was in 1977, when Pietras and colleagues discovered that there was an increase in cAMP in response to estradiol (138). Since then, many groups contributed to our understanding of nongenomic actions of ER by showing their invol vement in release of intracellular calcium (139), activation of MAPK (140-142) and PI 3 kinase (143;144), and stimulation of adenylate cyclase and cAMP production (145).

PAGE 30

17 Classification of the receptor has been diffi cult as there is evidence in support of three different types of membrane receptors: 1.) a receptor targeted to the membrane that is identical to nuclear ER, 2.) a membrane rece ptor that shares some characteristics with nuclear ER, such as the ligand binding domai n, and 3.) a membrane ER that is distinct from nuclear ER (146). For an ER identical to the nuclear ER to be found at the plasma membrane there must be a transmembrane domain found in nuclear ER, yet none has been identified. It is more likely that ERs translocate to the me mbrane and interact with other membrane proteins. Razandi and colleagues found th at cell membrane and nuclear ERs in transfected CHO cells originate from a singl e transcript and have nearly identical dissociation constants (147). In their study, the receptors found in the membrane accounted for less than 5% of the total ER found in the cell s and they were able to stimulate inositol phosphate pr oduction through inter action with G proteins (147). Others confirmed the interaction of ER with G protein coupled receptors (148;149). Antibodies directed against nuclear ERare capable of detecting ERs of differing molecular weights from the classic 66 kDa ER, suggesting that the membrane and nuclear ER are similar, but not identical. Using an antibody direct ed against the ligand binding domain of ER, a 29 kDa ER was discovered on the surface of sperm (150). Other investigators found 5 membrane ERs in the uterus with molecular weights ranging from 11-57 kDa (151). The antibodies used in their study did not detect any other ERs except the classical 66 kDa ER. Alternative splicing c ould account for different transcript lengths, as a biologically active and truncated form of ER, termed ER46, was discovered in the plasma membrane, nucleus , and cytosol of human endothelial cells

PAGE 31

18 (152). Truncation of ERto ER46 results in a receptor that is able to act as a dominant negative repressor of ER66 function in vitro (153). This recept or is involved in production of eNOS in calveolar domains of the membrane by activ ation of MAPK and PI3 kinase (154;155). Studies involving the estrogen receptor antagonist ICI 182,780 provided evidence for a novel membrane ER. The ICI compound, which inhibits genomic effects of ERand ER, is unable to block PKC activation afte r estradiol treatment in chondrocytes (156) or MAPK stimulation in rat hippo campus (157). Knock-out studies involving ERalso identify novel mechanisms of ER action th at are insensitive to the effects of ICI (158). Others found that ERKO mice respond to 17 -estradiol, the transcriptionally inactive stereoisomer of 17 -estradiol, by increasing MAPK, an effect that is not blocked by ICI (159). Recently, a putative ER, termed ER-X, was discovered in caveolar-like microdomains in the cortex and uterus of wild type and ERKO mice (160). Certain structural determinants were found to be necessary to target ERs to the plasma membrane and initiat e non-genomic effects. Ta rgeting of the ligand binding domain of ERto the membrane is sufficient to induce membrane-associated ER actions (161). Recent evidence suggest s that a specific amino acid residue, Serine 522, located within the E domain (containing LBD and AF-2) of ERis required for function and localization to the plasma membrane (162;163). Mutation of this residue results in a 62% decrease in membrane localization compared to wild type receptor. Furthermore, membrane-related signaling is a ttenuated while nuclear transcri ption is unaffected (162). It is possible that estrogen receptors ca n finely regulate cellular responses through convergence of genomic and non-genomic actions . For example, transcriptional activity

PAGE 32

19 of AP-1, which is involved in ERE-independent genomic action, is regulated by MAPK phosphorylation, while MAPK is regulated by estradiol through memb rane ER (164;165). The convergence of multiple modes of ER action is likely to vary according to cell type, thus genomic responses to estrad iol can differ tremendously (166). ER Turnover The concentration of estradiol circula ting in plasma can vary depending on the physiological state of the animal. As a means of regulating bioavailab ility of ER within a cell, it is possible for the ligand, estradiol, to regulate its r eceptor. The half-life of an estrogen receptor, in the absence of estradio l, is approximately 5 days; however, the presence of estrogen results in a hormone -dependent degradation of the receptor, resulting in a half-life shor tened to 3 to 4 hours (167;168). ER mRNA has a half-life of only 5 hours in the absence of ligand (169). The proteasome inhibitor, MG132 is able to block ER turnover, implicating the ubiquiti n-proteasome pathway in the degradation of ER (170;171). Others showed that 17 -estradiol is capable of downregulating both ERand ERafter one hour of treatment. This e ffect can be blocked by tamoxifen and lactacystin, a protease inhibitor (172). The ability of estradiol to autoregulate receptor availability serves to control the respons iveness of the target tissue and limit the expression of estrogen responsive genes (170). Antiestrogens There are two classes of antiest rogens: Type I, having mixed estrogenic/antiestrogenic effect s, and Type II, the pure antie strogens that do not have selective estrogen-like activities (173;174). Type I antiestrogens include tamoxifen and tamoxifen analogs. These drugs are classified as selectiv e estrogen receptor modulators (SERMs) because they e xhibit antiestrogenic effects in tis sues such as the breast while

PAGE 33

20 exhibiting estrogenic effects in the uterus. Depending on species a nd tissue, the activity of SERMs can be described as full antagonist, pa rtial agonist, or full agonist (175). The conformational change that occurs afte r receptor dimerization differs depending on whether the ligand is endogenous estradiol or an antiestrogen (176). Type I antiestrogens are competitive inhibitors of estrogen bindi ng to the ER; however, the change in the receptor shape is not converted completely to an inactive form, thus explaining the ability of the ER to retain some activity with SERMs (173). The pure antiestrogen ICI 182,780 (ICI) does not display estrogenic activity in any tissue (177;178) and is an antagonist of both ERand ER(115;179). The ability of the estrogen receptor to function as a modulat or of transcription in target tissue is completely attenuated by the antagonism of ICI (180). ICI, like tamoxifen, is a competitor of endogenous estrogen for bindi ng to the ER; however , unlike SERMs, the transcriptional unit is inactiv e after ligand binding (181;182). In addition to impaired receptor dimerization, ICI also impairs ER f unction by disrupting nuclear localization and increasing turnover of the receptors (183; 184). A study by Dauvois (183) using COS-1 cells transfected with mouse ER indicates that treatment of cells with ICI causes increased accumulation of the receptors in the cytoplasm. The study found that the antiestrogen binds to newly synthesized ER in the cytoplasm and prevents receptor shuttling to the nucleus, thus rendering the ER available for rapid degradation (183). While ICI downregulates ER protein, it does not appear to affect ER mRNA abundance (173;185-187) ICI has been evaluated for clinical potent ial in the treatment of estrogen-dependent breast cancer because it does not display estr ogenic activity in any tissue (177;178) and

PAGE 34

21 has an affinity for ER that is 100 times gr eater than tamoxifen ( 188). In addition, ICI inhibits not only ER action, but also aromatase activity (189 ). Inhibition of aromatase would benefit clinical treatm ent of estrogen-dependent tumo rs because it would prevent local production of estrogen from androge ns. In breast tumors, ICI treatment downregulates ER (190) and the mitogenic activ ity of estrogens on the breast cancer cells is attenuated (191). Recent evidence sugge sts that chronic administration of ICI is required in order to maintain biological activ ity due to a high plasma clearance rate (9.314.3 mL/min/kg) and a half life of 13.5-18.5 hours (192). Summary The role of estrogen in parturition a nd activation of the HPA axis has been established; however, the functional role be tween estrogen receptors and their ligand, 17 -estradiol, during fetal development and part urition remains to be elucidated. The objectives of this dissertation were to dete rmine developmental changes in the expression of the estrogen receptors ERand – within the ovine fetal brain and to evaluate the influence of estrogen on fetal HPA axis activ ity. HPA axis activity is augmented near term as endogenous plasma estradiol levels in crease, which is important in maturing the fetus for survival outside the womb, and may communicate placental maturation and readiness for birth. This research addressed the functional relations hip between estrogen and HPA axis activity throughout ovine gestat ion and the influence of estrogen on the timing of parturition. I used in vivo chronic catheterization of fetal sheep, real time reverse transcriptase polymerase chain re action (RT-PCR), west ern blot analysis, immunohistochemistry, enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA) to answer the speci fic aims outlined in this dissertation.

PAGE 35

22 Specific Aims Specific Aim 1 : To establish the ontogeny of ER -alpha and ER-beta expression in the ovine fetal brain. ERand – mRNA and protein expressi on were studied at various gestational ages in brain regi ons relevant to the HPA axis. Specific Aim 2: To determine if estrogen acts at the ovine fetal brain to influence the timing of parturition in singleton fetuses. Infusion of 17 -estradiol-3-sulfate (1 mg/day ) directly into the lateral ventricle (intra-cerebral ventricle, icv ) of a singleton fetus via an osmotic mini pump was used to determine the effects of estrogen on parturition date. Infusion of the estrogen recepto r antagonist, ICI 182, 780 (25 g/day) icv was used to determine the effects of estrogen on parturition date. Timing of parturition was compared using icv administration of 17 -estradiol or ICI 182, 780 at the same dose ad ministered intravenously (iv). Activation of the fetal HPA axis was documented by measuring plasma hormones relevant to HPA control. Specific Aim 3: To utilize twin pregnancies in order to evaluate the effect of estrogen on expression of genes important in regulation of HPA activity in the fetal sheep brain. Infusion of 17 -estradiol sulfate icv in one fetus, using the other fetus as an age-matched control, was used to eval uate differences in mRNA and protein expression of ER, ER, PGHS-1, and PGHS-2. Infusion of ICI 182,780 icv in one fetus, using the other fetus as an agematched control, was used to evalua te differences in mRNA and protein expression of ER, ER, PGHS-1, and PGHS-2. Activation of the HPA axis was documented by measuring plasma hormones relevant to HPA control in both fetuses. Activation of the HPA axis was doc umented by measurement of POMC mRNA in the pituitary and CRH and AVP mRNA in the hypothalamus in both fetuses.

PAGE 36

23 Hypothalamus Pituitary Adrenal Cortex CRH ACTH Cortisol Placenta ESTROGEN _ +AVP Stress CYP450C17:Progesterone Hypothalamus Pituitary Adrenal Cortex CRH ACTH Cortisol Placenta ESTROGEN _ +AVP Stress CYP450C17:Progesterone Figure 1-1. Ovine HPA axis. Cortisol normally exerts negative feedback at the levels of the the pituitary and hypothalamu s; however, this inhibition is decreased late in gestation. Near term, cortisol induces the expressi on of CYP450C17 in the placenta causing an increase in estrogen synthesis at the expense of progesterone. Estrogen exerts a positive feedback effect on the ovine fetal HPA axis.

PAGE 37

24 ERERN N C C A/B CD EF A/BCDEF AF-1AF-2 DNA Binding Dimerization LigandBinding Dimerization Homology (mouse):18%97%60% ERERN N C C A/B CD EF A/BCDEF AF-1AF-2 DNA Binding Dimerization LigandBinding Dimerization Homology (mouse):18%97%60% Figure 1-2. Domain structures for ERand ER. ERs are separate gene products, but have six functional domains in common. The six domains, A-F, have properties that contribute to DNA binding (region C), ligand binding (region E), dimerization (regions C and E) and transcriptional activation (AF-1 and AF-2 in the A/B region and E region respectively). Homology between mouse ERand ERis indicated below the figure. Printed with kind permission from Springer Sc ience and Business Media. Modified from Figure 1, p 194, in Hewitt and Korach, Revi ews in Endocrine & Metabolic Disorders, 2002; 3: 193-200 .

PAGE 38

25 Figure 1-3. Genomic and non-ge nomic mechanisms of estroge n receptor signaling. 1) Classical ligand-dependent ER signaling. Ligand binds to th e ER which then interacts with estrogen response elements (EREs) within promoter regions of target cells. 2) Ligand-independent ER signaling. Estrogen receptors initiate transcription after activation via a signaling cascade involving a me mbrane receptor, such as growth factor (GF) receptors. 3) ERE-independent signaling. Transcription is initiated by interaction of the ER-Estradiol complex with DNA-bound transcription factors such as AP1 at nonERE promoter sites. 4) Non-genomic, membrane-associated ER signaling. Nongenomic signaling via an ER located at the plasma membrane is responsible for rapid actions of estrogen within target cells. Printed with permission. Originally published in Hall, Journal of Biological Chemistry, 2001; 276 (40): 36869-36872 (figure 1, p 36870).

PAGE 39

26 CHAPTER 2 ERAND ERmRNA AND PROTEIN EXPRE SSION IN THE DEVELOPING OVINE BRAIN Abstract Increased fetal hypothalamus-pituitary-adr enal (HPA) axis activity initiates parturition in sheep. Data from our lab s upports a positive feedback interaction between placental estrogen and the fetal HPA axis; howev er, little is known about the expression of estrogen receptors within the ovine feta l brain and pituitary. The present study was designed to test the hypothesis th at the expression patterns of the two major isoforms of estrogen receptor, ERand ER, are ontogenetically regulated within the ovine brain. We used real time RT-PCR and western blo tting to examine expression of ERs in the hippocampus, brainstem, cerebellum, pituitar y, hypothalamus and frontal cortex of the fetal, post-natal, and adult sheep. Our results demonstrate that ERs are expressed in the ovine brain as early as midgestation, and that the expres sion of both receptors is developmentally regulated. The ontogenetic ex pression patterns sugge st active regulation of the receptors that is region-spec ific and that the regulation of ERis distinct from that of ER. We speculate that the de velopmental patterns of ERand ERresult from a counterbalance between maturity of the fetus and increased responsiveness to circulating plasma estradiol. Introduction Parturition is initiated in sheep by increased activity of the fetal hypothalamicpituitary-adrenal (HPA) axis (7 ;28). Near term, there is a concomitant increase in fetal

PAGE 40

27 plasma adrenocorticotropic hormone (ACTH) and cortisol (34), which is caused by increased adrenal sensitivity (35) and decr eased negative feedback inhibition on ACTH secretion (36). Augmented co rtisol secretion induces the placental enzyme cytochrome P450c17, leading to an increase in estrogen bios ynthesis at the expense of progesterone production (37;38;193). An increased plasma es trogen:progesterone ra tio causes a loss of myometrial quiescence and an incr ease in uterine contractilit y, which ultimately leads to expulsion of the fetus (7). In addition to its direct action on the myometrium, estrogen has a neuroendocrine role in regulation of the HPA axis. Our la b previously reported that estrogen, within physiological limits, augments HPA activity through increased basal and stimulated ACTH secretion (57), and that estrogen in creases neuronal activity in brain regions important in baroreceptor and chemoreceptor signaling (58). Based on those data we proposed that estrogen acts in a positive feedback mechanism to enhance fetal HPA activity at the end of gest ation (39). It is likely that the effects of circulating estradiol on the HPA axis are mediated by estrogen receptors within the fetal brain; however, little data exists describing the regulation of es trogen receptors during fetal development and parturition in sheep. The present study was designed to test the hypotheses that the two main isoforms of the estrogen receptor, ERand ER, are abundant in the fetal brain and that they are deve lopmentally regulated. Materials and Methods Tissue Collection Fetal sheep of known gestational age (80 to 145 days, n=3 to 5/group, Table 2-1), lambs, and adult ewes (post-partum females, n=3 to 5/group) were euthanized with an overdose of sodium pentobarbital. Brains we re rapidly removed, disse cted into distinct

PAGE 41

28 regions, and snap frozen in liquid nitrogen. The following tissues were collected: 1) brainstem, 2) hippocampus, 3) frontal cort ex, 4) cerebellum, 5) pituitary and 6) hypothalamus. Tissues were stored at -80C until processed for mRNA or protein. RNA Isolation and Real Time RT-PCR Tissues were individually pulverized usi ng Bio-Pulverizer (Bio-Spec Products, Bartlesville, OK), a trigger-style mortar and pestle device. Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA) accord ing to the manufacturer’s instructions. A high speed polytron homogeni zer (Tekmar, Janke and Kunkel, West Germany) was used for homogenization. RNA pellets were resuspended in 200l RNAsecure (Ambion, Austin, TX) pre-heated to 60C. The pellet s were incubated in a 60C water bath for 10 minutes in order to inactivate RNAses. E ach RNA sample concentration was quantified by spectrophotometry. RNA samples were converted into 4 g st able cDNA by reverse transcription using a High-Capacity cDNA Archive Kit (Applied Bi osystems, Foster City, CA) according to the manufacturer’s instructions. Reverse tr anscription reactions were performed in RNase/DNase free microcentrifuge tubes on a thermocycler (Biometra, Ltd., Kent, ME) using a thermal profile that ran for 10 minut es at 25C followed by 120 minutes at 37C. The resulting cDNA samples were stored at -20C until real-time RT-PCR was performed. ER, ER, and 18S rRNA gene expression was analyzed using real-time RTPCR. ERand ERprimer and probe sets were designed on Primer Express version 2.0 (Applied Biosystems) using known ovine sequences. Primers and probe for 18S rRNA were purchased from Applied Biosystems. ERand ERreactions contained 100 ng cDNA, 300 nM forward primer, 900 nM reverse primer, and 200 nM TAMRA

PAGE 42

29 probe. The primer and probe sequences for ERand ERcan be found in Table 2-2. The sequence amplified by ERprimers is located within the 5’ UTR. The location of the amplified ERsequence is within the protein coding region; however, the location within the nucleotide sequence is unknown. Control reactions run at the same time indicate the primers were specific for our amplified product and did not amplify genomic DNA. The locations of our products in relati on to splice variants for either gene are unknown. Ribosomal RNA reactions contained 0.1 ng cDNA, 100 nM forward and reverse primer, and 50 nM probe. Total reaction volume was 25 l, and included pre-mixed reagents (universal master mix, Applied Bios ystems). Samples were run in triplicate along with no-template controls for each gene in optical grade 96 well plates on an ABI Prism 7000 Thermal cycler (Applied Biosystems ). The thermal cycler was programmed using the following thermal settings: 1 cycle at 50C for 2 minutes, 1 cycle at 95C for 10 minutes, and 40 cycles at 95C for 15 seconds followed by 60C for 1 minute. Expression levels of the ERor – genes within the brain re gions of interest were calculated using the 2Ct method (194) using 18S rRNA as an internal reference. Protein Isolation and Western Blotting Tissues were homogenized in boiling ly sis buffer containing 1% SDS, 1 mM sodium orthovanadate, and 10 mM Tris pH 7.4 (Sigma Chemical Co., St. Louis, MO). Homogenates were boiled for 5 minutes then centrifuged at 7,500 x g for 10 minutes at 4C to remove particulate matter. The re sulting supernatant was assayed for protein content using the BioRad DC Protein Assa y (BioRad Laboratories, Hercules, CA) and stored at -80C.

PAGE 43

30 Samples were diluted 1:1 with a denaturing loading buffer (4% SDS, 20% glycerol, 125 mM Tris pH 6.8, and 10% -mercaptoethanol) and boiled for 5 minutes. Pre-cast 18well 7.5% Criterion Tris-HCl gels (BioRad) we re loaded with 40 g protein per lane (25 g for hippocampus) for SDS-PAGE. Gels were run for ~2.5 h at 100V. Following electrophoresis, proteins were transferre d onto nitrocellulose membrane at 22V overnight, blocked for 1 h, and then probed for ERor ERfor 1 h. ERantibody (MC-20 antibody, cat. no. sc-542, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was diluted 1:200 in antibody diluent (PBS with 0.05% Tween 20) and ERantibody (cat. no. PA1-311, Affinity BioReagents, Golden, CO) was diluted 1:1000 in antibody diluent (5% non-fat dry milk in PBS with 0.05% Tween 20). Membranes were visualized using goat-peroxidase conjugated anti-rabbit IgG (Sigma Chemical Co.; 1:5,000 for ERand 1:10,000 for ER) and ECL reagent (Amersham, Arli ngton Heights, IL). Quantity One densitometry software (BioRad) was utilized fo r blot analysis. Stai ning specificity was confirmed by preabsorption of the primary antibody using 25 g ERsynthetic peptide (Santa Cruz, cat. no. sc-542 P) or 25 g ERsynthetic peptide (Affinity BioReagents, cat. no. PA1-311). Statistical Analysis One-way analysis of variance (ANOVA) was used to analyze mRNA data. A pairwise multiple comparison was performed using the Student-Newman-Keuls Method. Western data were analyzed using 2-way ANOVA. Samples were divided between two gels; therefore, age and gel were a factor in analysis. A pairwise multiple comparison was performed using Duncan’s Method. Sigm aStat 3.1 (Jandel Scientific, San Rafael, CA) was used for all analyses. A significan ce level of P<0.05 was used to reject the null hypothesis. Values are re ported as mean SEM.

PAGE 44

31 Results ERand ERwere expressed at the protein an d mRNA level in fetal, neonatal and adult ovine brainstem, hippo campus, cortex, and cerebellum. RT-PCR Results for RT-PCR analysis of ERand ERcan be found in Figures 2-1 and 22. ERand ERmRNA expression was low and unchanging in brainstem, hippocampus, and cortex during fetal life; however, the abunda nce of both estrogen receptors increased in brainstem and hippo campus in adult sheep relative to fetal expression levels (Figure 2-1A-B, E-F). In cortex, expression of ER, but not ERincreased in adult sheep relative to the fetus (Figure 2-1C and G). Expression of both genes was significantly upregulated in mid to late gestation (120 to 145 days) in ce rebellum, but decreased following parturition (Figure 2-1D and H). ERand ERexpression in pituitary was incr eased starting at 100 days and remained elevated relative to 80 da y fetuses (Figure 2-2A and C). ERexpression in pituitary significantly decreas ed at 145 days’ gestation relative to 120 days. In hypothalamus, the increase in ERexpression began at 120 days and remained elevated relative to 80 day fetuse s (Figure 2-2B). ERexpression in hypothalamus showed two increases: one at 120 days’ gestation and another at 1-week (Figure 2-2D). Western Blotting ERprotein abundance was increased in pos tnatal and adult br ainstem (Figure 22A). The pattern of ERprotein expression was similar, except there was a significant decrease in expression from 100 to 130 days’ gestation relative to 80 days’ gestation.

PAGE 45

32 The rise in ERin the brainstem began prenatally at 145 days’ gestation and persisted in the postnatal lamb and adult (Figure 2-2B). In hippocampus, ERexpression was significantly decreased from 100 days’ gestation through 1-day postnatal and then began to rise in the 7-day postnatal lamb and adult (Figure 2-3A). Expression of ERprotein was variab le with no increase postnatally (Figure 2-3B). There was an immunoreactive doublet (72,70 kDa) detectable for ERin the cortex (Figure 2-4A-B). Both bands signi ficantly increased in the adult relative to younger animals. The 72 kDa band increased si gnificantly relative to 80 days beginning on day 120 and remained elevated in the postnatal and adult animals. ERabundance in cortex was increased postnatally compared to fetuses (Figure 2-4C). We measured an immunoreactiv e triplet (72,70,68 kDa) for ERin cerebellum (Figure 2-5A-C). Two bands (72 and 68 kDa) showed similar patterns of expression with significantly decreased abunda nce with advancing fetal maturity and significantly increased abundance in the adult ewe. The 72 kDa band was transien tly increased at 145 days. The 70 kDa band was variable with no significant changes in expression. ERexpression was highest in 1-week lambs and adults compared to fetuses (Figure 2-4D). Discussion In this report, developmental expres sion of the estrogen receptors, ERand ER, was described in the ovine brain. This is the first study in sheep to quantify the expression of ERand ERontogenetically at the mRNA a nd protein level. There have been studies to investigate estrogen recep tor immunoreactivity in the sheep (195;196), but these were either comple ted before the cloning of ERin 1996 or focused solely on

PAGE 46

33 expression in the cerebral cortex. Others reported estrogen recep tor expression in the brain of rodent species such as rat (197;198), mouse (199), and guinea pig (200). We utilized brain tissue from fetuses rangi ng in age from 80 to 145 days’ gestation (term ~148), postnatal lambs, and adults in th is study. Our results i ndicate that estrogen receptor mRNA and protein can be detected in the ovine fetus at the earliest time point we used (80 days gestation) and that recepto r expression differs in the fetus and adult. We found that in brainstem, hippocampus , and cerebral cortex abundance of ERmRNA was low and unchanging until adulthood. The adult tissues in those regions showed a significant increase in expression rela tive to fetuses. Similarly, in brainstem and hippocampus, ERmRNA increased in adults rela tive to fetuses. There was no change found in ERmRNA expression in cortex. In contrast, ERand ERin hypothalamus and pituitary showed a patter n of increased expr ession around 100 or 120 days followed by a decrease at 145 days and increase post-natally. There was no dramatic increase in ER expression in the adul t hypothalamus or pituita ry as seen in other tissues. These differences could reflect fundame ntal differences in sensitivity of specific brain tissues to estr adiol during gestation. ERprotein in brainstem, hippocampus, cort ex, and cerebellum was also relatively constant during gestation. It was only in th e postnatal and/or adu lt tissues that we saw increased expression of ER. ERprotein was more variable. There was no change in ERprotein in hippocampus, but in cortex and cerebellum protein expression was highest in postnatal and adult animals. Brainstem was the only tissue that showed a prenatal increase in ERprotein, beginning on day 145 and continuing in the lamb and adult tissue.

PAGE 47

34 We were surprised that ERand ERexpression was relatively constant in the fetus despite the changing endoc rine environment that occurs during gestation. Placental estrogen production increases while progesteron e decreases dramatically near term in species such as sheep (7;201). These horm ones have known effects on estrogen receptors (ER) in reproductive tissues, and we thought it was likely, given evidence that estrogen can stimulate the HPA axis (59;202), that th e effects of estrogen on the brain would be mediated through ERs as well. Steroid hormone receptors, such as the es trogen receptor, are regulated by their respective ligands, but can also be regulat ed by other hormones. In endometrium, estrogen has been shown to upregulate ER and progesterone receptor (PR) while progesterone downregulates ER and PR ( 203;204). During the preovulatory estrogen surge, ER mRNA increases in the endometriu m, followed by upregulation of ER protein (205). Ing et al. reported th at the mechanism of upregula tion of ER mRNA in sheep endometrium is through augmented mRNA stab ility (206). Given this, one might predict that at mid-gestation, when fetal estradiol is low and progesterone is high, ER expression would be low as well. The abundance of th e mRNA would be augmented with advanced fetal maturity as circulating estradiol incr eases and progesterone decreases near term, followed by a downregulation of ERs after parturition. While we did find low expre ssion at mid-gestation, we did not see a significant increase in mRNA abundance as parturition ap proached, or a downregulation after birth. This suggests that the mechanisms control ling ER expression in fetal sheep brain are different than those in endometrium. In MCF-7 breast cancer cells, estradiol downregulates ER (207;208), w ith methylation of the ERgene as a possible

PAGE 48

35 mechanism (209). If estradiol does attenua te ER expression in the brain one would expect ER to be augmented at mid-gestation when estradiol is low, downregulated as the fetus matures in an increasingly estrogen-ri ch/progesterone-poor environment, followed by upregulation following parturition. This is, in fact, close to what we observed in this study, with the exception of the predicted augmented expression at mid-gestation. However, one could imagine a scenario in wh ich the fetal brain becomes more responsive to estrogen action as it grows and develops. It is also likely that at mid-gestation it is progesterone that keeps ER downregulated. In brainstem, we observed increases in ERprotein before birth. This may provide a mechanism for an increase in es tradiol action on the car diovascular centers within the brain. Nuclei that relay inputs to the brain from chemoand baroreceptors may be stimulated before spontaneous partur ition as it is necessary for the fetus to maintain cardiovascular homeostasis when it is separated from the maternal placenta at birth. Previous reports indicate that estrad iol increases the fetal response to hypoxia by increasing neuronal activity in brain nuclei impo rtant in cardiovascular homeostasis, such as nucleus tractus solitarius (NTS) and rostral and caudal ventrolateral medulla (RVLM and CVLM) (58). The increased neuronal activit y in these nuclei also occurs independent of chemoreceptor or baroreceptor input (58). These brain nuclei have been shown to contain estrogen receptors (195;198). While this study indicates upregulation of ERin brainstem, we are unable to sp ecify which nuclei reflect this change in expression as we did not examine specific neuronal popul ations in the tissues collected. Expression of ER mRNA in the cerebellum differed from brainstem, hippocampus, and cortex. Specifically, ERand ERmRNA were upregulated from 120-145 days’

PAGE 49

36 gestation in this tissue without seeing a c oncomitant change in receptor protein. This suggests increased turnover of the receptor or perhaps increased estrogen action in cerebellum. Based on personal observation during collection of these tissues, the cerebellum increases in size and develops dram atically in the last 40% of gestation in sheep. This could indicate estrogen dependent growth and maturation. There is a wealth of literature indicating that neuronal steroi dogenesis occurs in the brain (81;210;211) and that the Purkinje cell of the cerebellum is a site for synthesis of steroids such as estradiol (86;87;212). Aromatase, which is the enzyme responsible fo r conversion of testosterone to estrogen, is expressed in the Purkinje ce lls of neonatal rats (86). Furthermore, estradiol concentrations are higher in th e prenatal rat cerebellum than in both the prepubertal and adult rat (86). Moreover, estradiol in the cerebellum has been shown to promote dendritic growth, spinogenesis, and s ynaptogenesis of the Purkinje cell (86;87). It has been suggested by Tsut sui and colleages that the act ions of estrogen on ER may promote growth and development of th e cerebellum by enhancing secretion of neurotrophic factors (87). In summary, we examined expression of ERand ERas a function of developmental age. While we found both rece ptors in brainstem, cerebellum, cortex, hippocampus, hypothalamus, and pituitary, regula tion appears to be region specific. We suggest that the increasing expr ession in adult animals relativ e to fetuses may result from regulation of the receptors by the hormonal milieu that exists during gestation. It is also possible that the use of post-pa rtum adult ewes influenced th e expression of ERs in this study. Regulation of ER mRNA in the cerebellu m is substantially diffe rent than in other brain regions and might reflect a role of es tradiol in growth an d development of the

PAGE 50

37 neurons in this tissue. We conclude th at, despite the increases in circulating concentrations of estrogens in fetal plasma in the later stages of fetal life, there is no pattern of downre gulation of ERand ERexpression. We speculate, therefore, that increasing plasma concentrations of estrogen at the end of gestation, combined with a lack of downregulation of the estrogen r eceptors, allows increased estrogen action in various brain regions at the end of gestation. Table 2-1. Distribution of sample size for each tissue type and age group studied Age Hippocampus Hypothalamus Cortex Cerebellum Brainstem Pituitary 80 days GA 4 5 5 4 5 5 100 days GA 3 4 4 4 4 4 120 days GA 4 4 4 4 4 4 130 days GA 4 4 4 4 4 4 145 days GA 5 5 5 5 5 4 1 day lamb 4 4 4 4 4 4 1 week lamb 5 5 5 5 5 5 adult 4 4 4 4 4 4 Table 2-2. Estrogen receptor primer and probe sequences used in real-time RT-PCR Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) TaqMan Probe ERAGGCACACGGGAGCACAT TTCCATGGGCTTGTAGAAGTCACTTCCCTTCCTTCTCACTGTCTCAGCCC ERGCTCTGGTCTGGGTGATTGCGTTAGCCAGGCGCATGGA AAGAGCGGCATGTCCTCCCAGCA

PAGE 51

38 ERmRNA Expression in Brainstem 0.1 1 10 100 1000 * ERmRNA Expression in Brainstem 0.1 1 10 100 1000 *A E ERmRNA Expression in Hippocampus 0.1 1 10 100 1000 *B ERmRNA Expression in Hippocampus 0.1 1 10 100 1000 *F ERmRNA Expression in Cortex 0.1 1 10 100 1000 Ga,bC ERmRNA Expression in Cortex 0.1 1 10 100 1000 ERmRNA Expression in Cerebellum 8 0 d g a 1 0 0 d g a 1 2 0 d g a 1 3 0 d g a 1 4 5 d g a 1 d a y l a m b 1 w e e k l a m b a d u l t 0.1 1 10 100 1000 10000 aD ERmRNA Expression in Cerebellum 8 0 d g a 1 0 0 d g a 1 2 0 d g a 1 3 0 d g a 1 4 5 d g a 1 d a y l a m b 1 w e e k l a m b a d u l t 0.1 1 10 100 1000 10000 aHDevelopmental AgeFold Change (2 Ct ) Relative to 80 Days' Gestation Figure 2-1. Ontogeny of ERand ERmRNA expression in ovine brain. ERand ERare shown for various developmental ages in brainstem (A,E), hippocampus (B,F), cortex (C,G), and cerebellum (D,H). Values are represented as mean SEM. * represents significant increase relative to al l ages, “a” represents significant increase relative to 80 day fetuses, “b” represents si gnificant increase relative to 100 day fetuses.

PAGE 52

39 ERmRNA Expression in Pituitary Fold Change (2 Ct ) Relative to 80 Days' Gestation 0.1 1 10 100 1000 a e a a,b,d,e,f a-f A C BD ERmRNA Expression in Pituitary 0.1 1 10 100 1000 a ERmRNA Expression in HypothalamusDevelopmental Age 8 0 d g a 1 0 0 d g a 1 2 0 d g a 1 3 0 d g a 1 4 5 d g a 1 d a y l a m b 1 w e e k l a m b a d u l t 0.1 1 10 100 1000 a b ERmRNA Expression in Hypothalamus 8 0 d g a 1 0 0 d g a 1 2 0 d g a 1 3 0 d g a 1 4 5 d g a 1 d a y l a m b 1 w e e k l a m b a d u l t 0.1 1 10 100 1000 a,e a,e a Figure 2-2. Ontogeny of ERand ERmRNA expression in ovine pituitary and hypothalamus. ERand ERare shown for various develo pmental ages in pituitary (A,C) and hypothalamus (B,D). Values are re presented as mean SEM. “a” represents significant increase relative to 80 day fetuses, “b” represents significant increase relative to 100 day fetuses, “e” indicates significan t increase relative to 145 day fetuses, “a-f” indicates significant increase co mpared to 80 to 1-day lambs.

PAGE 53

40 B ER70kDa in Brainstem Mean Intensity 0 500 1000 1500 2000 2500 c a-fADevelopmental Age ER55kDa in Brainstem 8 0 d g a 1 0 0 d g a 1 2 0 d g a 1 3 0 d g a 1 4 5 d g a 1 d a y l a m b 1 w e e k l a m b a d u l t 0 500 1000 1500 2000 2500 a b-d a-e a-f* * Figure 2-3. Ontogeny of brains tem ER protein. A) ERprotein at 70 kDa. B) ERprotein at 55 kDa. Values are represente d as mean SEM. * represents significant increase relative to all ages, “a” represents significant difference relative to 80 day fetuses, “c” represents significant increase re lative to 120 day fetuses, “b-d” indicates significant increase compared to 100-130 day fetuses, “a-e” represents an increase relative to 80-145 day fetuses, “a-f” indicates an in crease relative to 80 to 1-day lambs.

PAGE 54

41 ER55kDa in Hippocampus 8 0 d g a 1 0 0 d g a 1 2 0 d g a 1 3 0 d g a 1 4 5 d g a 1 d a y l a m b 1 w e e k l a m b a d u l t 0 500 1000 1500 2000 2500 a b b bDevelopmental AgeB ER70kDa in Hippocampus Mean Intensity 0 500 1000 1500 2000 2500 a b-f*A Figure 2-4. Ontogeny of hippo campal ER protein. A) ERprotein at 70 kDa. B) ERprotein at 55 kDa. Values are represented as mean SEM. * represents significant increase relative to all ages, “a” represents a significant decrease compared to 80 day fetuses, “b” represents a significant increase co mpared to 100 day fetuses, “b-f” indicates a significant increase compar ed to 100 to 1-day lambs.

PAGE 55

42 ER70kDa in Cortex Mean Intensity 0 500 1000 1500 2000 2500 *A CDevelopmental AgeB ER55kDa in Cortex 8 0 d g a 1 0 0 d g a 1 2 0 d g a 1 3 0 d g a 1 4 5 d g a 1 d a y l a m b 1 w e e k l a m b a d u l t 0 500 1000 1500 2000 2500 a-c a-d a-f ER72kDa in Cortex 0 500 1000 1500 2000 2500 a a,b Figure 2-5. Ontogeny of frontal cortex ER protein. A) ERat 70 kDa. B) ERat 72 kDa. C) ERat 55 kDa. Values are represented as mean SEM. * represents significant increase relative to all ages, “a” re presents a significant increase compared to 80 day fetuses, “b” represents a significant in crease compared to 100 day fetuses, “a-c” indicates a significant increase compared to 80-120 day fetuses, “a-d” is significant from 80-130 day fetuses, “a-f” is signif icant from 80 to 1-day lambs.

PAGE 56

43 ER70kDa in Cerebellum 0 500 1000 1500 2000 2500 B ER55kDa in Cerebellum 8 0 d g a 1 0 0 d g a 1 2 0 d g a 1 3 0 d g a 1 4 5 d g a 1 d a y l a m b 1 w e e k l a m b a d u l t Mean Intensity 0 500 1000 1500 2000 2500 a,b a-fD ER68kDa in Cerebellum 0 500 1000 1500 2000 2500 a c-gA ER72kDa in Cerebellum 0 500 1000 1500 2000 2500 a a b-d,f b-d,fCDevelopmental Age Figure 2-6. Ontogeny of cereb ellar ER protein. A) ERat 68 kDa. B) ERat 70 kDa. C) ERat 72 kDa. D) ERat 55 kDa. Values are represented as mean SEM. “a” is significantly different from 80 day fetuses, “b” is significantly di fferent from 100 day fetuses, “b-d” is significantly different fr om 100-130 day fetuses, “c-g” is significantly different from 120 to 1-week lambs, “f” is significantly different from 1-day lambs and “a-f” is significantly differen t from 80 to 1-day lambs.

PAGE 57

44 CHAPTER 3 FETAL HPA RESPONSES TO ES TRADIOL SULFATE OR ICI 182,780 Abstract Preparturient increases in plasma estrogen are important in the final common pathway leading to parturition in sheep. Th ese experiments were designed to test the hypotheses that estrogen modulates hypothalami c-pituitary-adrenal (HPA) activity near term through interaction with estrogen recepto rs in the central nervous system and that infusion of 17 -estradiol-3-sulfate (estradiol sulfat e) or ICI 182,780 (ICI) may advance or delay day of spontaneous parturition respectiv ely. Chronically catheterized fetal sheep were treated with estradiol sulfate icv (n=5), estradiol sulfate iv (n=6), ICI icv (n=5) or saline (n=5). Fetuses were subjected to arterial blood draw every other day until spontaneous birth for plasma hormone analysis. Plasma estradiol, es tradiol sulfate, and cortisol and POMC were measured by ELISA. Plasma DHEAS, progesterone, and ACTH were measured by RIA. Plasma ACTH1-39 was measured by immunoradiometric assay (IRMA). Treatment with estradiol sulfate and ICI attenuated ACTH secretion near term without affecting plasma cortisol . Infusion of es tradiol sulfate icv significantly increased plasma estradiol, plasma estradiol sulfate, and plasma progesterone compared to all other groups. ICI significantly incr eased plasma DHEAS compared to control and estradiol sulfate icv groups. Neither drug altered the timing of parturition. We conclude that estradiol sulfate affects the HPA axis in a ma nner inconsistent with the known effects of unconjugated estradiol. We speculate that tr eatment with estradiol sulfate may attenuate

PAGE 58

45 HPA activity, possibly thr ough interaction with GABAA receptors or by acting as a partial antagonist of ER, a nd that this may be an important mechanism through which HPA activity is modulated during gestation. Introduction Gestation in sheep is approximately 148 da ys in an uninstrumented animal. Near term, activity of the fetal HPA axis increases (7;28) due to maturation of the axis as well as decreased sensitivity to th e negative feedback effects of cortisol (36). Decreased inhibition of the axis results in increased pl asma ACTH and cortisol in the fetus (34). Cortisol induces the enzyme P450C17 in the placenta, causing an increase in estrogen production at the expense of progesterone (37;38 ;193). Estrogen synthesis at the end of gestation is important in initia ting a chain of events that cu lminates in the birth of the fetus. Estrogen has been shown to augment HPA activ ity in adult rats. Female rats have higher basal and stimulated co rticosterone than males (45) and exert maximum responses to stress during proestrous, when plasma es trogen is elevated (46-50). Ovariectomy attenuates adrenal steroid produc tion in response to stress; ho wever, activity of the HPA axis is ameliorated following hormone repl acement with estradiol (55;56). In this laboratory, we previously reporte d that estrogen given peripher ally augments fetal plasma ACTH secretion in response to stress in sheep (57). We also showed previously that peripheral administration of es trogen and the androgen, androste ndione, together are able to significantly shorten the lengt h of gestation in sheep by appr oximately four days (59). In the same study, estradiol alone did not adva nce the day of parturition; however, it was suggested that aromatization of adrostenedio ne to estrogen could have occurred in lambs receiving both hormones, thus allowing more estrogen to modulate HPA axis activity.

PAGE 59

46 These experiments were designed to examine the effects of exogenous administration of 17 -estradiol-3-sulfate, the sulfoconjugated form of 17 -estradiol, on the fetal HPA axis and the timing of parturit ion in sheep. Sulfoconjugated steroids are abundant in fetal plasma (63;64) and are able to bind estrogen receptors within target tissues after deconjugation by th e enzyme steroid sulfatase (S TS) (65;66). We infused 17 -estradiol-3-sulfate centrally ( icv ) or peripherally ( iv ) to test the hypothesis that estrogen acts within the fetal brain to augmen t HPA activity and to advance the date of parturition. Furthermore, we utilized th e non-selective estrogen receptor blocker ICI 182,780 to test the hypothesis that the effects of estrogen on the HPA axis are mediated by estrogen receptors. Materials and Methods Twenty one pregnant ewes with time -dated singleton fetuses (120-125 days gestation) were used in this study. They we re divided into four experimental groups: saline control (n=5), estradiol sulfate icv (1 mg/day, n=5), estradiol sulfate iv (1 mg/day ,n= 6), and ICI 182780 icv (25 g/day, n=5). Treatments were infused using an osmotic mini-pump implanted in the fetus. Animals we re housed in individual pens located in the Animal Resources Department at the Univer sity of Florida. The rooms maintained controlled lighting and temperature a nd sheep were given food and water ad libitum . Surgical Preparation Food was withheld from the pregnant ewes for 24 hours before surgery. Ewes were intubated and anaesthetized with halothane (0.5 to 2%) in oxygen during surgical preparation. Following intubation, the abdomen and left flank were shorn and scrubbed with alternating solutions of be tadine and alcohol. Ewes were transported to the surgical suite where they were attached to a ventilator and given iv saline. Before the start of

PAGE 60

47 surgery, 750 mg ampicillin (Polyflex, Fort Dodge Laboratories, Fort Dodge, IA) was administered im . Surgery Surgery was performed using aseptic techni que in a surgery suite located in the animal facility at the Universi ty of Florida. Animals were anaesthetized with halothane (0.5-2%) in oxygen and vital signs were m onitored during surgery. The uterus was exposed through a midline incision and the fe tal hindlimbs were located by palpation. The hindlimbs were delivered through a small in cision in the uterus a nd each tibial artery was instrumented with a polyvinylchloride catheter (outside diameter 0.05 in; inside diameter, 0.03 in.) that was advanced to the de scending aorta. The catheters were filled with heparin to prevent clotting and closed at the end using a sterile brass nail. An additional catheter (outside diameter 0.09 in; inside diameter, 0.05 in.) was sewn to the skin of one fetal hindlimb for access to amnio tic fluid. Fetuses that received estradiol sulfate iv were also instrumented vi a the saphenous vien with a small catheter (outside diameter, 0.05 in.; inside diam eter, 0.03 in.) that was attach ed to an osmotic mini-pump (size 2mL4, Alza Corp., Palo Alto, CA). Fetuses receiving icv infusions were instrumented with arterial catheters and an extra catheter placed in the lateral cerebral ventricle. The fetal head was located and de livered through a separate uterine incision. The scalp was retracted and a small catheter ( outside diameter, 0.05 i n.; inside diameter, 0.03 in.) attached to an osmotic mini-pum p (Alzet size 2mL4) was inserted through a hole made in the skull into the lateral cerebral ventricle. This catheter was held in place using Vet Bond. The exposed catheter and osmotic mini-pump were placed subcutaneously before closing the incision on the head. The fetus was returned to the uterus and the second uterine incision was cl osed. Antibiotics (750mg ampicillin) were

PAGE 61

48 administered into the amniotic cavity via dire ct injection. Finally, the hindlimb catheters were exteriorized through the flank of th e ewe using a trochar, where they were maintained in a cloth pocket. The maternal midline incision was closed in three layers. The abdomen of the ewe was then wrapped in spandage (Medi-T ech International, Brooklyn, NY, USA) in order to hold the pocket securely. Post-Operative Care Ewes were given 1 mg/kg flunixin meglum ine (Webster Veterinary, Sterling, MA) for analgesia and returned to their pens wher e they were monitored until they could stand on their own. Twice daily during a 5-day re covery period ewes were given antibiotic (ampicillin, 750 mg, im ) and rectal temperatures were monitored for indication of postoperative infection. Blood Collection Following the recovery period, fetal blood sa mples were drawn from the arterial catheter every other morning (between 0800 and 1000 hours) for use in hormone assays. Samples were kept on ice until centrifuged at 3,000 x g for 15 minutes at 4C to separate red blood cells and plasma. Plasma was stored at -20C until analys is. Blood gases were measured at the time of blood sampling using an ABL 77 Radiometer (Radiometer America Inc., Cleveland, OH) blood gas analyzer. Plasma Hormone Assays Estradiol Plasma estradiol was measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit (Oxford Biomedical Research, cat.no. EA70). Estradiol was extracted from 200 L plas ma in 12x75 mm glass tubes using 2 mL hexane/ethyl acetate (3:2 vol/vol). Tubes we re vortexed for 30 seconds and phases were

PAGE 62

49 allowed to separate. The orga nic phase was transferred to a clean tube and evaporated under a stream of N2 and the aqueous phase (contain ing sulfoconjugated steroids, proteins, salts, etc.) was dis carded. The evaporated samples were re-extracted using the same volume of hexane/ethyl acetate, vor texed for 15 seconds, a nd evaporated under N2. Samples were reconstituted in 120 L of d iluted extraction buffer (provided in kit). Reconstituted samples were analyzed in 50 L duplicates and calibrated using standards provided with the kit. Absorbances were read at 450 nm after being stopped with 100 L 1N HCl. Cross reactivity with 17 -estradiol, estriol, and estrone in this kit is 100%, 0.41%, and 0.10% respectively, as reported by the manufacturer. Estradiol sulfate Plasma estradiol sulfate was measured us ing the estradiol ELISA kit from Oxford Biomedical Research (cat.no. EA70) as previ ously reported (64). Estradiol sulfate was extracted from 10 L plasma using 1 mL et hanol. Tubes were vortexed for 30 seconds and centrifuged at 3000 x g for 10 minutes at 4C. Supernatan t was transferred to a new glass tube and evaporated under vacuum (Savant Instruments, Farmingdale, NY) for 1 hour. Dried samples were reconstituted in 120 L diluted extraction buffer (provided in kit). Reconstituted samples were analyzed in 50 L duplicates and calibrated using standards provided with the kit. Absorbances were read at 450 nm after being stopped with 100 L 1N HCl. Cortisol Plasma cortisol was measured using a cort isol ELISA kit from Oxford Biomedical Research (cat.no. EA65). Cortis ol was extracted using ethanol , as described previously (213). Cross reactivity with cortisol, cortisone, 11-deoxycortis ol, and corticosterone in this kit is 100%, 15.77%, 15%, and 4.81% resp ectively, as reported by the manufacturer.

PAGE 63

50 Dehydroepiandrosterone sulfate (DHEAS) DHEAS was measured with an 125I-DHEA-SO4 Coat-A-Count kit from Diagnostic Products Corporation (Los Angeles, CA ; cat. no. TKDS5). The manufacturer’s instructions were observed with the following exceptions: 100 L plasma was assayed in duplicate (instead of 50 L) with 750 L 125I-DHEA-SO4 (instead of 1.0 mL) and an additional standard of 0.025 ug/mL was adde d. The purpose of these changes was to increase the sensitivity of the assay since sa mple concentrations were expected to fall on the low end of the standard curve. Per cent cross reactivity with DHEAS, DHEA, and Estrone-3-SO4 was 100, 0.57 and 0.25 respectively, as reported by the manufacturer. Progesterone Progesterone was measured with an 125I-Progesterone Coat-A-Count kit from Diagnostic Products Corporation (Los Ange les, CA; cat. no. TKPG5) according to the manufacturer’s instruct ions. Samples were analyzed in 100 L duplicates and calibrated using a standard curve provided with the kit. Percent cross reactivity with progesterone, 17 -hydroxyprogesterone, medr oxyprogesterone, and pr egnenolone was 100, 3.4, 0.3, and 0.1 respectively, as reporte d by the manufacturer. Adrenocorticotropin hormone (ACTH) Plasma ACTH was measured using RIA as described previously (214). ACTH was extracted from 0.5 mL plasma using powdere d glass (35 mg/tube, Corning Glassworks, Corning, NY) in 0.5 mL 0.5 M phosphate buffer (pH 7.4). ACTH was eluted with 1 mL acid:acetone (1 volume 0.25 N HCl: 1 volume acet one) and evaporated to dryness under vacuum (Savant Instruments, Farmingdale, NY) . Extracts were re constituted overnight in 0.5 mL assay buffer (0.5 M phosphate buffer, pH 7.4, extracted BSA solution, and 0.5% v/v -mercaptoethanol). Rabbit anti-ACTH antiserum and radioactive iodinated

PAGE 64

51 ACTH (125I-ACTH) were used to measure extracted plasma ACTH. Samples were analyzed in duplicate and compared to a st andard curve generated using a standard extracted with the sample set. ACTH1-39 ACTH1-39 was measured using a 2-site imm unoradiometric assay kit purchased from DiaSorin (Stillwater, MN, cat.no. 27130). The assay utilizes a radioactive tracer containing goat anti-ACTH26-39 and 125I mouse anti-ACTH1-17 as well as a polystyrene bead coated with mouse anti-goat. When 200 L plasma is incubated with the tracer and the bead, only ACTH1-39 present in the sample will form an antibody complex. Samples were measured in duplicate and calibrated using a standard curve provide d with the kit. Pro-opiomelanocortin (POMC) Pro-opiomelanocortin was measured usi ng an ELISA kit from Immunodiagnostic Systems Ltd. (cat. no. AC-71F1) according to the manufacturer’s instructions. Samples were assayed in 100 L duplicates and calibra ted using a standard curve provided with the kit. Cross reactivity with POMC and Pro-ACTH is 100%, as reported by the manufacturer. Statistical Analysis Two-way analysis of variance (ANOVA) was used to analyze differences among treatment groups in this study. One-way ANOVA was used to test effect of time within each treatment group. Pairwise multiple comp arisons were performed using Duncan’s Method, the Holm-Sidak method, or Stude nt-Newman-Keuls method. Effect of treatment on day of parturition was an alyzed by 1-way ANOVA. Sigma Stat 3.1 software (Jandel Scientific, San Rafael, CA) was utilized for analyses. A significance

PAGE 65

52 level of P<0.05 was used to reject the null hypothesis. Va lues are reported as mean SEM. Results Blood Gases Fetal arterial blood gases and pH were measured on every sampling day and averaged over time. Data are presented in Table 3-1. There were no significant differences in average PaO2 or pH among groups, but there was a significant difference found in average group PaCO2 ( P< 0.001, 2-way ANOVA). Fetal Plasma ACTH, POMC, and Cortisol Plasma ACTH was relatively constant in a ll groups between days -20 and -4 before parturition (Figure 3-1). Th ere was no significant increas e in plasma ACTH observed near term in treated fetuses; however, ther e was an increase in plasma ACTH in the control group in the last sampling day be fore parturition. While this value was significantly elevated compared to earlier days within the cont rol group (384.2 339.4 pg/mL, P< 0.05, 1-way ANOVA), it was not signifi cantly different from day -1 for estradiol sulfate icv (161.8 136.8 pg/mL), estradiol sulfate iv (126.25 98.8 pg/mL), or ICI icv (122.75 84.1pg/mL). Data for plasma ACTH1-39 are shown in Figure 3-2. ACTH1-39 was not significantly different among groups by 2-way ANOVA, but there was a trend for increases near term in the control and ICI group. Pro-opiomelanocortin (POMC) was significantly different ( P< 0.01, 2-way ANOVA) in control fetuses compared with treated fetuses (Figure 3-3) . The near term increase in POMC was attenuated after treatment with estradiol sulfat e or ICI. Plasma c oncentrations of POMC were 193.9 148.1 pM in control fetuses on day -1 before parturition compared to 38.1 1.3 pM in estr adiol sulfate icv , 46.7 20.6 pM in estradiol sulfate iv , and 61.7 36.7 pM

PAGE 66

53 in ICI icv treated fetuses. The ACTH1-39:POMC ratio was not significant among groups. Despite an attenuated secretion of the pituita ry peptides ACTH and POMC near term, the pattern of cortisol secretion remained norma l in all groups (Figure 3-4). Fetal plasma cortisol was constant until day -7 when it bega n to increase until the end of gestation in all experimental groups. Ther e were no significant differenc es in plasma cortisol among groups. The trend for increased cortisol ove r time was statistically significant by 2-way ANOVA ( P< 0.001). Fetal Plasma Estradiol and Estradiol Sulfate Treatment of singleton fetuses with es tradiol sulfate, via both routes of administration, resulted in plasma estradiol th at was elevated compared to control and ICI treated fetuses ( P< 0.001, 2-way ANOVA; Figure 3-5). Plasma estradiol was significantly higher in the icv compared to iv group. Administration of estradiol sulfate centrally caused an approximate 2-fold mean increase in plasma estradiol compared to fetuses treated with the same dose of estrad iol sulfate periphera lly (197.0 9.9 pg/mL vs. 82.3 10.5 pg/mL) and a 6-fold increase over co ntrol and ICI treated fetuses (197.0 9.9 pg/mL vs. 32.3 8.5 pg/mL and 29.9 11.6 pg/mL respectively). Estradiol sulfate treatment also resulted in a significant differe nce in circulating plasma estradiol sulfate among groups ( P< 0.001, 2-way ANOVA; Figure 3-6). In addition, estradiol sulfate was approximately 10 times more abundant in fetal plasma than unconjugated estradiol. Estradiol sulfate was elevated in plasma after treatment with estradiol sulfate both peripherally and centrally, w ith the increase following icv administration greater than that via iv infusion between days -12 and -4. The plasma E2SO4:E2 ratio was also significantly altered following treatment ( P< 0.001, 2-way ANOVA). Estradiol sulfate

PAGE 67

54 treatment significantly decreased E2SO4:E2 ratio (9.9 1.2 iv and 5.4 1.1 icv ) relative to control and ICI treated fetuses (12.0 1.0 and 12.2 1.3 respectively). Plasma Progesterone Plasma progesterone concentrations we re significantly different among groups (main effect of group, P< 0.001; Figure 3-7). In estradiol sulfate icv treated fetuses plasma progesterone began to rise on signifi cantly on day -15, peaking at day -9 (10.4 1.9 ng/mL), and remained elevated relative to other experimental groups until term. Plasma E2:P ratio was significantly different among groups ( P< 0.001, 2-way ANOVA). The E2:P ratio increased following estradiol sulfate treatment iv (0.018 0.003) and icv (0.029 0.0025) relative to control (0.007 0.002) and ICI treated fetuses (0.008 0.003). Plasma DHEAS Plasma DHEAS was also significantly a ffected by experimental treatment ( P< 0.001, 2-way ANOVA; Figure 3-8). C ontrol and estradiol sulfate icv treated fetuses showed no differences in plasma DHEA S over time, while estradiol sulfate iv and ICI treated fetuses showed significant increases in plasma DHEAS that began around day -12. Increases in plasma DHEAS were greatest in ICI icv treated fetuses, with the peak plasma value reaching 0.16 0.03 g/mL before spontaneous parturition. Effect of Treatment on Day of Spontaneous Parturition Despite alterations in plasma hormone concentrations, there was no effect of treatment on day of spontaneous parturition in this study (Figure 3-9). Lambs delivered on day 144 1 (control), 141 2 (estradiol sulfate icv ), 142 2 (estradiol sulfate iv ), and 141 3 (ICI icv ) with no significant differe nce among groups by 1-way ANOVA.

PAGE 68

55 Discussion The results of this study de monstrate that 1) estradiol sulfate does not stimulate the HPA axis in the manner we would expect of es tradiol alone, 2) administration of estradiol sulfate centrally and periphera lly produces differential eff ects on the HPA axis, and 3) neither estradiol sulfate nor ICI 182,780 alters the timing of parturition in chronically catheterized fetal sheep. We propose that the physiological effects of sulfoconjugated estradiol on the fetal endocrine environment observed in this study are distinct from estradiol and may be important for our unde rstanding of the mechanisms involved in HPA activity during gestation in sheep. We measured fetal plasma ACTH and cort isol as a means of investigating HPA activity in this study. Many i nvestigators have shown that ACTH and cortisol increase near term in this species (34;36;215;216), an observation we confirmed in our control fetuses. Treatment with either estradiol sulfate or ICI attenuated the normal preparturient rise in ACTH we observed in cont rol fetuses. Surprised by this result, we investigated the possibility that ACTH1-39 or POMC secretion were increased in the treated animals. Our results indicate that , while POMC was significantly increased near term in control animals, there was no significant change in plasma ACTH1-39 among groups. Furthermore, the ratio of ACTH1-39:POMC was not significantly different among groups, indicating that processing of PO MC to ACTH does not account for the differences we observed. Interestingly, de spite attenuated ACTH secretion in treated fetuses, cortisol output near term increased as seen in control animal s. Considering that ACTH, ACTH1-39 , and POMC are not increased in treated fetuses, we speculate that there must be some other factor stimulating the adrenal gland, or there is increased adrenal sensitivity to ACTH, thus allowing for increase d cortisol near term in these animals.

PAGE 69

56 These results are inconsiste nt with known actions of estradiol on the HPA axis. Female rats have greater adrenal responsivene ss to ACTH than male rats (55) and have increased responses to stress (as measured by ACTH and corticosterone) during proestrus, when plasma estradiol is high (46-50). Ovariectom y decreases basal and stimulated ACTH secretion, with amelioration of pituitary responsiv eness after estradiol replacement (55;56). We showed previousl y, in the ovine fetus, that estradiol can augment HPA responses to stress (57). We sp eculate that estradiol sulfate and estradiol may have differential effects on HPA activity (discussed below), which may account for the differences in plasma horm ones we observed in this study. Estradiol sulfate treatment either iv or icv resulted in significantly higher plasma estradiol than in ICI treated or control fetuse s. Administering estradiol sulfate into the brain caused an approximate 2-fold mean increase in plasma estradiol when compared to fetuses treated with the same dose peripherally. We showed previously that the brain is a rich source of steroid sulfat ase (78), thus local deconjuga tion of estradiol sulfate to biologically active estradiol w ithin the brain could account for the differences observed between the icv and iv groups. Furthermore, we did not show a preparturient rise in plasma estradiol in the control animals. Estr adiol has been shown to rise before birth in the fetus and mother, although it appears that the dramatic increase in the fetus occurs approximately two days before parturition ( 217). It is possible that, since we were drawing blood every other day, we missed this increase. It is also possible that the limited data showing increased estradiol in th e fetus near term ar e simply outdated and incorrect.

PAGE 70

57 Estradiol sulfate was approximately 10 times more abundant than estradiol in plasma of control animals. The differen ces in concentration between circulating conjugated and unconjugated ster oids was noted previously for estradiol (64) and estrone (63). As expected, infusion of estradiol sulfate either iv or icv caused significantly higher plasma estradiol sulfate than control anim als; however, plasma estradiol sulfate was higher in fetuses receiving cen tral infusion of estradiol sulfate than those treated peripherally between days -12 and -4 before parturition. We were surprised by this result, considering that the icv and iv treated animals received the same dose and plasma was measured in the same compartment. This suggests that either the clearance of estradiol sulfate is decreased following icv infusion or treatment results in estradiol sulfate production in these animals. Furthe rmore, estradiol sulfate treatment, either icv or iv , significantly lowered E2SO4:E2 ratio compared to control or ICI treated fetuses, suggesting that infusion of es tradiol sulfate may upregulate steroid sulfatase activity. This would have the effect of lowering E2SO4:E2 ratio by increasing plasma estradiol, which is what we see in the estradiol sulfate treatment group. It is well established that in sheep there is a decrease in plasma progesterone and increase in plasma estrogen at the end of gestation due to induction of the enzyme P450C17 in the placenta by cortisol (37;38;193). We measured plasma progesterone and calculated E2:P ratio to get some idea of 17 -hydroxylase activity in this study. Following treatment with estradiol sulfate, E2:P ratio was significantly increased in the icv and iv groups compared to the ICI and control groups, indicating the possibility that P450C17 is more active following estradiol sulfate infusion; however, it is intriguing that estradiol sulfate infusion icv also causes increased progest erone production over time.

PAGE 71

58 The fact that plasma estradio l is also significantly increased in the estradiol sulfate icv group could help explain how the E2:P ratio could still be increased. DHEAS is an androgenic precursor for es tradiol production. The results of this study indicate that ICI treatment iv causes increased DHEAS production in fetal sheep over time. ICI 182,780 is a known inhibitor of aromatase (189). It is possible that treatment with ICI is inhibiting anot her steroidogenic enzyme, possibly 3 hydroxysteroid dehydrogenase, thus causi ng accumulation of DHEAS. Another intriguing possibility is that ICI may increa se DHEAS as a result of estrogen receptor blockade. We do not see an increase in DHEAS in the E2SO4 treated fetuses, indicating the differences we observed may reflect involvement of the estrogen receptor. Several groups showed that manipulation of the ovine fetal HPA axis by infusion of ACTH or cortisol can induce premature parturition (14-16). We showed previously that co-administration of estradiol and androstene dione (each at a rate of 250 g/day) to the fetus can advance the day of parturition by a pproximately 4 days (59). In the present study, we treated fetal sheep with 1 mg/day 17 -estradiol-3-sulfate, an amount 4 times greater than the dosage we used previously. We used this dose for several reasons. Firstly, in the previous study, es tradiol alone did not advance pa rturition; therefore, it was suggested that androstenedione could have been converted locally to estr ogen in those fetuses treated with both hormones, indicating th at a larger dose may be needed to induce labor. Secondly, we used the sulfoconjugate d form of estradiol. Sulfoconjugated hormones must be deconjugated by the enzyme sulfatase (STS) in or der to bind to their target receptors (65;66); ther efore, since we could not know for sure how much of our drug would become biologically active, we administered a larger dose.

PAGE 72

59 Despite this change in dosage , we did not affect timing of parturition in this study. It is possible that in our pr evious experiments the use of androstenedione coupled with estradiol was critical for initiation of parturition. In a separate set of experiments we showed that estradiol augmen ted fetal ACTH secrection in response to stress, whereas androstenedione decreased ne gative feedback inhibition of ACTH secretion (57), indicating that the combined effects of estrogen and androgen on the HPA axis may be important. Based on the present study, we do not believe estradiol alone is able to initiate parturition; however, use of a larger sample population in these experiments may have yielded differences among groups that we were not able to show with a low n. In addition, we can not rule out the possibility that it was our use of es tradiol sulfate instead of unconjugated estradiol that produced the endocrine changes observed in this study. We speculate that estradiol sulfate may be i nhibitory to the HPA axis through interaction with GABAA receptors or by acting as an antagonist of ER. GABAA receptors are responsible for me diating neuronal responses to the inhibitory neurotransmitter GABA. The PVN (which is the major integration site for control of input to the HPA axis) is known to have GABAergic innervation, with nearly half of all synapses in the medial parvocellular P VN (mpPVN) containing GABA receptors (218) Specific GABAA receptor subunits can be found within hypophysiotrophic CRH neurons (219), and pharmacological studies both in vitro and in vivo have shown GABAergic mechanisms to be involved in the inhibition of CRH secretion (220-222). Activity of the HPA axis is reduced (as measured by ACTH secretion) after icv injection of GABAA agonists (223). Interestingly, neurosteroids (steroids produced de novo within the brain) ar e also known to be GABAA agonists

PAGE 73

60 (91;92;224). If estradiol sulfate were modulating GABAA in these experiments by acting as a neurosteroid it could explain how both estradiol sulfate and ICI (by blocking the effects of endogenous estradiol) were able to attenuate ACTH secretion from the pituitary. It may also explain why we were seeing differential effects of icv and iv infusion. Our use of ICI 182,780 in this study was to te st the hypothesis that if the effects of estradiol on the HPA axis are modulated through estrogen receptors, then blocking endogenous estradiol could delay ge station in this species. We were not able to increase gestation length by use of ICI in these experi ments; however, it is po ssible that our dose was simply too low (25 g/day) or that the clearance of this drug is high. In summary, we have examined the effects of 17 -estradiol-3-sulfate and the estrogen receptor antagoni st ICI 182,780 on HPA axis ac tivity and on the timing of parturition in sheep. While neither drug wa s able to alter day of gestation, we did observe unique and distinct effects on hormone secretion in the fetus. We believe that estradiol sulfate is acting as an inhibi tor of HPA axis ac tivity, possibly through interaction with GABAA receptors or by acting as an ER antagonist within the brain. We conclude that estradiol sulfate has effects on th e HPA axis that are distinct from estradiol and that this may be an important mechanis m for modulating activity of the axis during gestation. Table 3-1. Average fetal blood gases and pH during blood sampling Treatment Group PaO2 (mmHg) SEM PaCO2 (mmHg) SEM* pH (mmHg) SEM E2SO4 icv (n=5) 18.5 0.81 57.9 0.71 7.32 0.01 E2SO4 iv (n=6) 18.4 0.81 55.4 0.71# 7.33 0.01 ICI icv (n=5) 16.6 0.92 56.5 0.80 7.32 0.01 Control (n=5) 19.0 0.67 59.6 0.59** 7.32 0.01 *Groups are significantly different ( P <0.001) by 2-way ANOVA. **Controls are significantly different from E2SO4 iv and ICI icv ( P <0.05) by pairwise multiple comparison. # E2SO4 iv are significantly different from E2SO4 icv ( P <0.05) by pairwise multiple comparison.

PAGE 74

61 Days Before Parturition -20-18-16-14-12-10-8-6-4-20 ACTH (pg/mL) 0 100 200 300 400 500 600 E2SO4 icv E2SO4 iv ICI icv control Figure 3-1. Plasma ACTH in singleton ovine fetuses. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM. Days Before Parturition -20-18-16-14-12-10-8-6-4-20 ACTH 1-39 (pg/mL) 0 10 20 30 40 50 60 70 E2SO4 icv E2SO4 iv ICI icv control Figure 3-2. Plasma ACTH1-39 in singleton ovine fetuses. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM.

PAGE 75

62 Days Before Parturition -20-18-16-14-12-10-8-6-4-20 POMC (pM) 0 50 100 150 200 250 300 E2SO4 icv E2SO4 iv ICI icv Control Figure 3-3. Plasma POMC in singleton ovine fetuses. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM. Groups are significantly different by 2-way ANOVA ( P =0.004). Control fetuses ar e significantly different from all treatment groups by pairwise multiple comparison (Duncan’s method, P <0.05). Days Before Parturition -20-18-16-14-12-10-8-6-4-20 Cortisol (ng/mL) 0 20 40 60 80 100 120 E2SO4 icv E2SO4 iv ICI icv Control Figure 3-4. Plasma cortisol in singleton ovine fetuses. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM.

PAGE 76

63 Days Before Parturition -20-18-16-14-12-10-8-6-4-20 Estradiol (pg/mL) 0 50 100 150 200 250 300 E2SO4 icv E2SO4 iv ICI icv Control Figure 3-5. Plasma estradiol in singleton ovine fetuses. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM. Groups are significantly different by 2-way ANOVA ( P <0.001). Estradiol sulf ate fetuses treated icv and iv are significantly different from control and ICI icv fetuses and are significantly different from each other by pairwise multiple comparison (Duncan’s method, P <0.05). Days Before Parturition -20-18-16-14-12-10-8-6-4-20 Estradiol Sulfate (ng/mL) 0.0 0.5 1.0 1.5 2.0 2.5 3.0 E2SO4 icv E2SO4 iv ICI icv Control Figure 3-6. Plasma estradiol su lfate in singleton ovine fetuses. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM. Groups are significantly different by 2-way ANOVA ( P <0.001). Estradiol sulf ate fetuses treated icv and iv are significantly different from control and ICI icv fetuses and are significantly different from each other by pairwise multiple comparison (Duncan’s method, P <0.05).

PAGE 77

64 Days Before Parturition -20-18-16-14-12-10-8-6-4-20 Progesterone (ng/mL) 2 4 6 8 10 12 E2SO4 icv E2SO4 iv ICI icv Control Figure 3-7. Plasma progesteron e in singleton ovine fetuses. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM. Groups are significantly different by 2-way ANOVA ( P <0.001). Estradiol sulfate icv treated fetuses are signi ficantly different from all groups by pairwise multiple comparison (Holm-Sidak method, P <0.05). Days Before Parturition -20-18-16-14-12-10-8-6-4-20 DHEAS (mg/mL) 0.00 0.05 0.10 0.15 0.20 E2SO4 icv E2SO4 iv ICI icv Control Figure 3-8. Plasma DHEAS in singleton ovine fetuses. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM. Groups are significantly different by 2-way ANOVA ( P <0.001). ICI icv fetuses are significantly di fferent from all groups and estradiol sulfate iv fetuses are significantly different from estradiol sulfate icv and control fetuses by pairwise multiple comparison (Holm-Sidak method, P <0.05).

PAGE 78

65 Days Gestational Age 125130135140145150155 Probability of non-delivery (%) 0 20 40 60 80 100 E2SO4 icv E2SO4 iv ICI icv Control Figure 3-9. Effect of treatment on day of spontaneous parturition. Fetal sheep were treated with estradiol sulfate icv ( ), estradiol sulfate iv ( ), ICI 182780 icv ( ), or control ( ). Values are represented as mean SEM.

PAGE 79

66 CHAPTER 4 EXPRESSION OF HPA AXIS RELATED GENES IN RESPONSE TO ESTRADIOL SULFATE OR ICI 182,780 IN TWIN OVINE FETUSES Abstract Increased hypothalamic-pituitary-adrenal (HPA) axis activity near term is responsible for initiation of spontaneous parturition in sheep. We previously reported that estradiol administration causes increased plasma ACTH and cortisol in the fetus. The present study was designed to in vestigate genomic responses to 17 -estradiol-3sulfate administration within the fetal brain. Ten time-dated pregnant ewes with twin fetuses were used in this study. One fetus was treated icv with either 17 -estradiol-3sulfate (1 mg/day; n=4) or the estrogen receptor antagonist ICI 182,780 (25 ug/day; n=6) while the other fetus served as an age-matched control. Estradiol sulfate infusion caused increases in plasma ACTH1-39, cortisol, estradiol, and estradiol sulfate compared to age-matched controls. ICI infusion caused significantly decreased plasma concentrations of DHEAS and progesterone relativ e to controls. ICI did not produce any significan t changes in gene expression; however, estradiol sulfate infusion downregulated mRNA expression of POMC and ERin pituitary, ERand PGHS-1 in hippocampus, and CRH in hypothalamus. ICI increased ERprotein in cortex. We believe acute versus chronic effects of estradiol sulfate treatment are important in determining effects on the HPA axis. We speculate that estradiol sulfate may be acting as an estrogen receptor an tagonist or through interaction with GABAA

PAGE 80

67 receptors as a neurosteroid to produce decrea sed HPA responses and that this may be an important mechanism of action wi thin the brain during gestation. Introduction In many species such as sheep, changes in the fetal and maternal endocrine environments are important in the maintenan ce and termination of pregnancy (7). Near term, estrogen biosynthesis is affected by HPA axis activity in the ovine fetus. Cortisol from the fetal adrenal is responsible fo r induction of the pl acental enzyme P450C17, which has 17 -hydroxylase and 17,20 lyase activity, thus enabling estrogen production at the expense of progesterone (37;38; 193). Increasing the estrogen to progesterone ratio leads to a loss of myometrial quiescence and augmen ted uterine tone, culminating in the birth of the fetus. We demonstrated previously that estradiol stimulates the fetal HPA axis (57;59;202). Exogenous estradio l treatment augments basal and stimulated fetal plasma ACTH secretion and elevates plasma cortisol (57). Estrone given to adult sheep increases hypothalamic AVP content (202). The stimulat ory effect of estrogen on the HPA axis has been documented in adult rats as well. Ovariectomized female rats have attenuated adrenal steroid production whic h is reversed upon estradio l replacement (55;56). We proposed that a positive feedback loop exists between placental estrogen production and HPA activity in sheep (57). Recently, we reported (see chapter 3) that infusion of 17 -estradiol-3-sulfate into the cerebral ventricles of the fetus produ ces hormonal responses that differ from responses elicited by intravenous infusi on and from what we would expect of unconjugated estradiol. We hypothesized that the effects of estrogen on the HPA axis near term may be mediated through estrogen receptors within the brain; however, the

PAGE 81

68 design of the previous study di d not allow us to investigat e changes in mRNA or protein in response to treatment. The present study was performed to elucidate genomic responses to 17 -estradiol-3-sulfate and ICI 182,780 within the ovine fetal brain and pituitary. Our study focused on genes that are re levant to the HPA axis or its activity. Specifically, we examined expression of ER, ER, PGHS-1, PGHS-2, AVP, CRH, POMC, STS, SGK-1, and PC1. Materials and Methods Ten time-dated ewes with twin pregnancies were used in this study (20 fetuses, 120 to 127 days gestation). One fetus served as the experimental fetus while its twin served as an internal age-matched control. Ther e were four experimental groups: estradiol sulfate icv (1 mg/day, n=4) with an age-ma tched control (n=4), and ICI 182780 icv (25 g/day, n=6) with an age-matched control (n =6). Animals were housed in individual pens located in the Animal Resources Depart ment at the University of Florida. The rooms maintained controlled lighting and te mperature and sheep were given food and water ad libitum . Surgical Preparation Food was withheld from the pregnant ewes for 24 hours before surgery. Ewes were intubated and anaesthetized with halothane (0.5 to 2%) in oxygen during surgical preparation. Following intubation, the abdomen and left flank were shorn and scrubbed with alternating solutions of be tadine and alcohol. Ewes were transported to the surgical suite where they were attached to a ventilator and given iv saline. Before the start of surgery, 750 mg ampicillin (Polyflex, Fort Dodge Laboratories, Fort Dodge, IA) was administered im .

PAGE 82

69 Surgery Surgery and arterial catheter placement wa s performed using aseptic technique as previously described (see Chapter 3). For placement of the catheter into the lateral cerebral ventricle, the scalp wa s retracted and a small cathete r (outside diameter, 0.05 in.; inside diameter, 0.03 in.) attached to an os motic mini-pump (size 2mL4Alza Corp., Palo Alto, CA) was inserted through a hole made in th e skull. This catheter was held in place using Vet Bond. The exposed catheter and osmotic mini-pump were placed subcutaneously before closing the incision on the head. Antibiotics (750 mg ampicillin) were administered into the amniotic cavity via direct injection. Finally, the hindlimb catheters were exteriorized through the flank of the ewe using a trochar, where they were maintained in a cloth pocket. Ewes were given 1 mg/kg flunixin meglumine (Webster Veterinary, Sterling, MA) for an algesia and returned to th eir pens where they were monitored until they could stand on their ow n. Twice daily during a 5-day recovery period ewes were given antib iotic (ampicillin, 750 mg im ) and rectal temperatures were monitored for indication of post-operative infection. Blood Collection Following the recovery period, fetal blood sa mples were drawn from the arterial catheter every other morning (between 0800 and 1000) for use in hormone assays. Samples were kept on ice until centrifuge d at 3,000 x g for 15 minutes at 4C to separated red blood cells and plasma. Plasma was stored at -20C until analysis. Blood gases were measured at the time of blood sampling using an ABL 77 Radiometer (Radiometer America Inc., Cleveland, OH) blood gas analyzer.

PAGE 83

70 Tissue Collection Twin fetuses of known gestational age (130 to 134 days) were euthanized with an overdose of sodium pentobarbital. Brains we re rapidly removed, disse cted into distinct regions, and snap frozen in liquid nitrogen. The following tissues were collected: 1) brainstem, 2) hippocampus, 3) frontal cort ex, 4) cerebellum, 5) hypothalamus, 6) pituitary. Tissues were stored at -80C until processed for mRNA or protein. Plasma Hormone Assays Assays for estradiol, estradiol sulfate, cortisol, DHEAS, progesterone, ACTH, ACTH1-39, and POMC were measured using ELISA or RIA as described in chapter 3. RNA Isolation and Real Time RT-PCR Tissues were individually pulverized and to tal RNA was extracted as described in chapter 2. RNA samples were converted into 10 g stable cDNA by reverse transcription using a High-Capacity cDNA Ar chive Kit (Applied Biosyste ms, Foster City, CA) as previously described. cDNA samples were st ored at -20C until re al-time RT-PCR was performed. ER, ER, PGHS-1, PGHS-2, AVP, CRH, PO MC, STS, SGK-1, PC1 and 18S rRNA gene expression was analyzed us ing real-time RT-PCR with 100 ng cDNA template. Primer and probe sets were de signed on Primer Express version 2.0 (Applied Biosystems) using known ovine sequences. Primers and probe for 18S rRNA were purchased from Applied Biosystems. Reaction mixtures and primer and probe sequences can be found in Table 4-1. Ribosomal R NA reactions contained 0.1 ng cDNA, 100 nM forward and reverse primer, and 50 nM pr obe. Total reaction volume was 25 l, and included pre-mixed reagents (universal master mix, Applied Biosystems). Samples were

PAGE 84

71 run in triplicate on an ABI Prism 7000 PCR ma chine (Applied Biosystems) as previously described. Protein Isolation and Western Blotting Tissues were homogenized in boiling ly sis buffer containing 1% SDS, 1 mM sodium orthovanadate, and 10 mM Tris pH 7.4 (Sigma Chemical Co., St. Louis, MO) as previously described. Supernatant was assaye d for protein content using the BioRad DC Protein Assay (BioRad Laborator ies, Hercules, CA) and stored at -80C. Commercially available antibodies were used for ERand ERwestern blots as described in chapter 2. Quantity One densitometry software (BioRad) was utilized for blot analysis. Staining specificity was confirmed by preabsorption of the primary antibody using 25 g ERsynthetic peptide (Santa Cruz, cat. no. sc-542 P) or 25 g ERsynthetic peptide (Affinity BioReagents, cat. no. PA1-311). Statistical Analysis Protein and mRNA were analyzed by paired t-test. Two-way an alysis of variance (ANOVA) was used to analyze hormone data . Sigma Stat 3.1 (Jandel Scientific, San Rafael, CA) was used for data analysis. A si gnificance level of P<0.05 was used to reject the null hypothesis. Values ar e reported as mean SEM. Results Plasma Hormones Treatment with estradiol sulfate or ICI did not produce significant changes in plasma ACTH ( P= N.S., Figure 4-1) or POMC ( P= N.S.; Figure 4-3); however, ACTH1-39 was significantly increased in estradiol sulfat e treated fetuses compared to control fetuses ( P< 0.01; Figure 4-2). Plasma cortisol was also significantly increased in estradiol sulfate treated fetuses as measured by 2-way ANOVA (log cortisol P< 0.05; Figure 4-4). Plasma

PAGE 85

72 estradiol and estradiol sulfate data are presen ted in figures 4-5 and 4-6. ICI treatment did not elicit significant changes in plasma estradiol or estradiol sulfate; however, estradiol sulfate treatment resulted in significant el evations in both of these hormones (both P< 0.001). Estradiol sulfate treatment caused peak plasma estradiol a nd estradiol sulfate concentrations of 301 67 pg/mL and 1.36 0.11 ng/mL respectively. The E2SO4:E2 ratio was significantly decreased ( P= 0.01) following estradiol sulfate treatment (15.43 2.33 and 5.88 0.59 for control and estradiol sulf ate treatment respectively). Plasma DHEAS and progesterone were not significantl y different in estradiol sulfate treated animals relative to controls; however, ICI trea tment resulted in atte nuated concentrations of these hormones (Figures 4-7B, log DHEAS P= 0.002; Figure 4-8B, log progesterone P< 0.001). Estrogen to progester one ratio was significantly increased compared to controls (0.048 0.0088 vs. 0.0053 0.00047) fo llowing estradiol su lfate treatment ( P< 0.001). Real Time RT-PCR Real time data are presented in figures 4-9 through 4-20. Estradiol sulfate treatment did not significantly change mRNA compared to control fetuses ( P= N.S) when measuring abundance of the following genes: AVP, pro-hormone convertase 1 (PC1), ER, PGHS-2, serum and glucocorticoid-regula ted kinase (SGK), or steroid sulfatase (STS). ICI treatment did not al ter transcript expression of an y genes tested in this study. Estradiol sulfate treatment caused significant downregulation of CRH in hypothalamus (Figure 4-10), POMC and ERin pituitary (Figur es 4-11 and 4-13), and ERand PGHS-1 in hippocampus (Figures 4-13 and 4-15) when compared to control fetuses using a paired t-test analysis (all P< 0.05).

PAGE 86

73 Western Blots Western blot results for ERand ERare presented in figures 4-21 through 4-24. Multiple immunoreactive bands for ERwere found in hypothalamus, cortex, and brainstem of estradiol sulfate treated a nd control animals (Figure 4-21). Multiple immunoreactive bands were also found for ERin ICI and control animals (Figure 423); however, the number of bands present in each region differs when compared to figure 4-21. The hypothalamus of estradiol sulf ate and control animal s had more reactive bands than ICI treated or ICI controls while hippocampus , cortex, and cerebellum had less. There were no significant differences in ERprotein expression between treated and control animals in any br ain region by paired t-test ( P= N.S.). There was only one immunoreac tive band (~55kDa) found for ERin each brain region. ERin cortex was upregulated following treatment with ICI ( P= 0.05, Figure 424). All other brain regions lacked signifi cant differences between treated and control animals. Discussion We have proposed that a positive fee dback loop exists between placental production of estradiol and increased activity of the HPA axis near parturition. The synthesis of placental steroids near term is dependent upon cortisol secretion from the adrenal gland. Cortisol induces P450C17 in the placenta (37; 38;193) which enables estrogens and androgens to be synthesized and secreted into the fetal and maternal circulations, which further enhances HPA activ ity. A recent experiment (see chapter 3) demonstrates that infusion of 17 -estradiol-3-sulfate has diffe rential effects on circulating plasma hormones when infused peripherally or centrally and that sulfated estradiol produces hormonal responses that we feel ar e inconsistent with the known actions of

PAGE 87

74 unconjugated estradiol. The pr esent study is a follow up to ou r recent experiments that was designed to analyze genomic responses to infusion of 17 -estradiol-3-sulfate or the estrogen receptor blocker, ICI 182,780 on the fetal brain. The hormonal data from this study indicates that estradiol sulf ate infusion causes increased ACTH1-39 and cortisol secretion compared to control fetuses. These results are consistent with a previous study in our lab showing increases in fe tal plasma ACTH and cortisol after short term subcutaneous es tradiol exposure (57) and with others who showed stimulatory effects of estradiol on ACTH or corticosterone secretion in adult rats (46;55;56;225). Because we saw increases in plasma cortisol, we measured serum and glucocorticoid-regulated kinase (SGK) as a mark er of glucorticoid action in the brain, but the glucocorticoid increases we observed in plasma were too small to cause increased SGK abundance in the hippocampus or pituitary. Our results differ from our previous experi ments (chapter 3) in which there were no significant differences between control and st eroid treated fetuses in plasma ACTH or cortisol concentrations. Likewise, this st udy indicates that ICI cau ses decreased plasma concentrations of DHEAS and progester one, whereas our previous study showed increased plasma DHEAS in ICI treated fetuse s. We believe that this discrepancy may indicate a difference in short versus long term effects of exogenous steroid or ICI exposure. In our previous study, fetuses were exposed to continuous infusion as long as 25 days, whereas in this study exposure was limite d to half that length. However, we can not rule out the possibility that our data differ from those in chapter 3 due to our use of a twin model of ovine parturition in this study.

PAGE 88

75 Estradiol sulfate administration into th e lateral cerebral ventricles caused significantly elevated plasma estradiol and estr adiol sulfate relative to control fetuses. This is consistent with our previous studies in chapter 3. Sulfoc onjugated estrogens are abundant in fetal plasma (63;64). Because we were infusing sulfoconjugated estradiol into the fetal brain we measured steroid su lfatase (STS), the enzyme which cleaves the sulfate group from estradiol thus making it biologically active (65). Despite abundant estradiol sulfate in fetal plasma it does not appear to alter transcription of STS. This may indicate that STS is not regul ated by substrate availability. Estradiol sulfate significantly downre gulated CRH mRNA in the hypothalamus. Our data is consistent with a recent study show ing that estradiol is able to attenuate CRH gene expression in the placenta (226). A study by the same group showed that downregulation of placental CRH is a result of interaction between ERand a cAMP response element (CRE) located within the promoter region of the CRH gene (227). Decreased CRH synthesis after estradiol tr eatment has also been shown in the rat hypothalamus (228;229). However, the literature is not conclusive regarding the effects of estradiol on CRH expressi on. Estradiol was shown to have no effect on CRH mRNA in the PVN of ovariectomized ewes (230). Ot hers believe that estr adiol stimulates the HPA axis by upregulating expression of CRH. Ovariectomized rhesus monkeys that were estradiol replaced had CRH mRNA that was 2-fold higher than untreated controls (231). In rats, CRH increases in response to re straint stress, an effect that is augmented by treatment with estradiol benzoate (232) . Interestingly, AVP mRNA abundance did not change in this study. This was surprising b ecause AVP is readily released during fetal stress and is considered the l eading corticotropin releasing fact or in sheep (233). It is not

PAGE 89

76 clear from our results why we were unable to see changes in th e expression of this hormone. We found that POMC mRNA was significantly decreased following estradiol sulfate treatment. Our resu lts are consistent with the known effects of estradiol on POMC mRNA in rats. Several groups s howed that ovariectomy increases POMC expression while estradiol repl acement attenuates th is response (234-236). POMC and pro-ACTH are known to inhibit adrenal respon siveness to ACTH in the fetus (237), while fully processed ACTH1-39 is stimulatory. Increased pr ocessing of POMC to ACTH1-39 would explain how plasma ACTH1-39 and cortisol are increased in estradiol sulfate treated fetuses; however, prohormone convertase 1 (P C1), the enzyme which cleaves ACTH and -liptropin from POMC (238), was not affected by estradiol sulfate. It is possible that the activity of the enzyme may be regulated independent of mRNA. In pituitary and hippocampus ERmRNA was downregulated compared to control fetuses. Estradiol was shown to downr egulate ER in MCF7 breast cancer cells (207;208); however, classic effects of estradio l cause upregulation of ER in tissues such as endometrium (203;204). During the preovul atory estrogen surge, ER mRNA increases in the endometrium, followed by upregulation of ER protein (239). It is possible that ER is regulated differently in the fetal brain than in the endometrium or that estradiol sulfate is acting in a fashion that is distinct from estradiol. Estradiol sulfate treatment significantly downregulated PGHS-1 expression in hippocampus. Previous work in our la b showed that estradiol administered subcutaneously augments PGHS-2 mRNA in fetal brainstem and cerebellum with no changes in PGHS-1 mRNA abundance (62). We speculate that estrad iol sulfate may be

PAGE 90

77 interacting with the estrogen receptor as a partial antagonist; therefore, it is not unreasonable to assume that it would cause eff ects different from those seen in previous studies. ERprotein was increased following infusion of ICI 182,780. ICI is known to impair ER function by disrupting nuclear localization and incr easing ER turnover (183;240). ICI is also known to downregul ate ER protein without affecting mRNA abundance (173;185-187). Manipulation of r eceptor binding changes protein abundance, but it is not clear from our studies why ICI was able to upregulate ERprotein in the cortex. We observed multiple specific bands for ERin many of the brain regions examined. This might indicate that intracellula r processing is different in the fetus versus the adult. The cloned sequence for ERpredicts a molecular we ight of 66kDa (102), but we have found bands ranging from 66-72kDa. The appearance of these bands may be due to post-translational modifications such as phosphorylation. Th ere is evidence that MAPK phosphorylates human ERat serine reside 118 afte r exposure to EGF or IFG, thus enabling the receptor to interact with co-factors important in ER-mediated gene transcription (131) It is also possible that these bands represent splice variants for ER. Several splice variants of ER have been desc ribed at the mRNA level, but it appears that most are poorly expressed as proteins and the functional roles are incompletely understood. A review of estrogen receptors in the brain (241) i ndicates that most variants expressed at the protein level are of either higher or lowe r molecular weights than the bands which we found in our study.

PAGE 91

78 We believe that the experiments discussed here combined with those in chapter 3 indicate differences in acute ve rsus chronic administration of estradiol sulfate to the fetal brain. We speculate that during short term e xposure we are able to see stimulation of the axis (as measured by plasma ACTH and cort isol) due to deconjugation of sulfate from sulfoconjated estradiol, thus allowing unconjuga ted estradiol to stimulate the axis. After long term exposure the effects on the axis appe ar to be mostly inhibitory, as ACTH is suppressed in estradiol sulfate treated fetu ses. This could be explained by two mechanisms: 1) estradiol sulfate could be interacting with GABAA receptors as an inhibitory neurosteroid within the fetal brai n (see Chapter 3 discus sion), or 2) it is possible that estradiol sulfat e could be acting as a partial antagonist of the estrogen receptor, most likely at the plasma membra ne, thus explaining mixed stimulatory and inhibitory effects. Our results strongly indi cate estradiol sulfate actions on the HPA axis and fetal neuroendocrine system that warrant more systematic study.

PAGE 92

79 Table 4-1. Primer and probe se quences used in real time RT-PCR Gene Forward Primer (5’-3’) [For. Primer] (nM) Reverse Primer (5’-3’) [Rev. Primer] (nM) TaqMan Probe [Probe] (nM) ERAGGCACACGGGAGCACAT 300 TTCCATGGGCTTGTAGAAGTCA 900 CTTCCCTTCCTTCTCACTGTCTCAGCCC 250 ERGCTCTGGTCTGGGTGATTGC 300 GTTAGCCAGGCGCATGGA 900 AAGAGCGGCATGTCCTCCCAGCA 250 PGHS-1 GGCACCAACCTCATGTTTGC 100 TCTTGCCGAAGTTTTGAAGA 100 TTCTTTGCCCAACACTTCACCCATCA 200 PGHS-2 GCACAAATCTGATGTTTGCATTCT 100 CTGGTCCTCGTTCATATCTGCTT 100 TGCCCAGCACTTCACCCATCAATTTT 200 SGK-1 GACTTTGGACTCTGCAAGGAGAA 900 CGGGCGTGCCACAGAA 900 TTGAACACAATGGCACGACGTCCAC 250 PC1 GCGGGCATCTTCGCTCTAG 900 TCCATACAACCAAGTGCTGCAT 900 AAGCAAATCCAAATCTCACCTGGCGAG 250 POMC CCGGCAACTGCGATGAG 900 GGAAATGGCCCATGACGTACT 900 AGCCGCTGACTGAGAACCCCCG 250 STS TTCACTTAGCATGATATCCTCAAGGT 900 AATGGCCAGAGAATGAAATTCAG 900 CATCTTCATGTTTCATGGTCGTAGCGTGTG 250 CRH TCCCATTTCCCTGGATCTCA 300 GAGCTTGCTGCGCTAACTGA 300 TTCCACCTCCTCCGAGAAGTCTTGGAAAT 250 AVP TTCCAGAACTGCCCAAGGG 250 AGACACTGTCTCAGCTCCAGGTC 50 SYBR Green --

PAGE 93

80 Days Infusion 468101214ACTH (pg/mL) 0 100 200 300 400 500 E2SO4 Control Days Infusion 6810121416ACTH (pg/mL) 0 100 200 300 400 500 ICI Control AB Days Infusion 468101214ACTH (pg/mL) 0 100 200 300 400 500 E2SO4 Control Days Infusion 6810121416ACTH (pg/mL) 0 100 200 300 400 500 ICI Control AB Figure 4-1. Plasma ACTH in twin fetuses. A) Estradiol sulfate (E 2SO4) versus control. B) ICI 182,780 (ICI) versus control. Days Infusion 468101214ACTH 1-39 (pg/mL) 0 10 20 30 40 50 E2SO4 Control Days Infusion 6810121416ACTH 1-39 (pg/mL) 0 10 20 30 40 50 ICI Control AB Days Infusion 468101214ACTH 1-39 (pg/mL) 0 10 20 30 40 50 E2SO4 Control Days Infusion 6810121416ACTH 1-39 (pg/mL) 0 10 20 30 40 50 ICI Control AB Figure 4-2. Plasma ACTH1-39 in twin fetuses. A) Estradiol sulfate (E2SO4) versus control ( P< 0.01). B) ICI 182,780 (ICI) versus control.

PAGE 94

81 Days Infusion 468101214POMC (pM) 0 20 40 60 80 100 120 E2SO4 Control Days Infusion 6810121416POMC (pM) 0 20 40 60 80 100 120 ICI Control AB Days Infusion 468101214POMC (pM) 0 20 40 60 80 100 120 E2SO4 Control Days Infusion 6810121416POMC (pM) 0 20 40 60 80 100 120 ICI Control AB Figure 4-3. Plasma POMC in twin fetuses. A) Estradiol sulfate (E 2SO4) versus control. B) ICI 182,780 (ICI) versus control. Days Infusion 468101214Cortisol (ng/mL) 0 20 40 60 80 E2SO4 Control Days Infusion 6810121416Cortisol (ng/mL) 0 20 40 60 80 ICI Control AB Days Infusion 468101214Cortisol (ng/mL) 0 20 40 60 80 E2SO4 Control Days Infusion 6810121416Cortisol (ng/mL) 0 20 40 60 80 ICI Control AB Days Infusion 6810121416Cortisol (ng/mL) 0 20 40 60 80 ICI Control AB Figure 4-4. Plasma cortisol in twin fetuses. A) Estradiol sulfate (E2SO4) versus control (P<0.05). B) ICI 182,780 (ICI) versus control.

PAGE 95

82 Days Infusion 6810121416Estradiol (pg/mL) 0 100 200 300 400 ICI Control Days Infusion 468101214Estradiol (pg/mL) 0 100 200 300 400 E2SO4 Control AB Days Infusion 6810121416Estradiol (pg/mL) 0 100 200 300 400 ICI Control Days Infusion 468101214Estradiol (pg/mL) 0 100 200 300 400 E2SO4 Control AB Figure 4-5. Plasma estradiol in twin fetuses. A) Estradiol sulfate (E2SO4) versus control (P<0.001). B) ICI 182,780 (ICI) versus control. Days Infusion 6810121416Estradiol Sulfate (ng/mL) 0.0 0.5 1.0 1.5 2.0 ICI Control Days Infusion 468101214Estradiol Sulfate (ng/mL) 0.0 0.5 1.0 1.5 2.0 E2SO4 Control AB Days Infusion 6810121416Estradiol Sulfate (ng/mL) 0.0 0.5 1.0 1.5 2.0 ICI Control Days Infusion 468101214Estradiol Sulfate (ng/mL) 0.0 0.5 1.0 1.5 2.0 E2SO4 Control AB Figure 4-6. Plasma estradiol sulfate in twin fetuses. A) Estradiol sulfate (E2SO4) versus control ( P< 0.001). B) ICI 182,780 (ICI) versus control.

PAGE 96

83 Days Infusion 468101214DHEAS (ug/mL) 0.00 0.05 0.10 0.15 E2SO4 Control Days Infusion 6810121416DHEAS (ug/mL) 0.00 0.05 0.10 0.15 ICI Control AB Days Infusion 468101214DHEAS (ug/mL) 0.00 0.05 0.10 0.15 E2SO4 Control Days Infusion 6810121416DHEAS (ug/mL) 0.00 0.05 0.10 0.15 ICI Control AB Days Infusion 6810121416DHEAS (ug/mL) 0.00 0.05 0.10 0.15 ICI Control AB Figure 4-7. Plasma DHEAS in twin fetuses. A) Estradiol sulfate (E2SO4) versus control. B) ICI 182,780 (ICI) ve rsus control (log DHEAS, P< 0.01). Days Infusion 6810121416Progesterone (ng/mL) 0 5 10 15 20 ICI Control Days Infusion 468101214Progesterone (ng/mL) 0 5 10 15 20 E2SO4 Control AB Days Infusion 6810121416Progesterone (ng/mL) 0 5 10 15 20 ICI Control Days Infusion 468101214Progesterone (ng/mL) 0 5 10 15 20 E2SO4 Control AB Figure 4-8. Plasma progesterone in twin fetuses. A) Estradiol sulfate (E2SO4) versus control. B) ICI 182,780 (ICI) versus control (log progesterone, P< 0.001).

PAGE 97

84 Treatment ICIE2SO4 Fold Change (2Ct ) 0.1 1 10 Control Treated Figure 4-9. AVP mRNA expression in hypotha lamus. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals. Treatment ICIE2SO4 Fold Change (2Ct ) 0.1 1 10 Control Treated * Figure 4-10. CRH mRNA expre ssion in hypothalamus. Expr ession in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals. * indicates statistica lly significant decreas e in mRNA abundance relative to control fetuses ( P< 0.05).

PAGE 98

85 Treatment ICIE2SO4 Fold Change (2 Ct ) 0.1 1 10 Control Treated * Figure 4-11. POMC mRNA expression in pitu itary. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals. * indicates statistica lly significant decreas e in mRNA abundance relative to control fetuses ( P< 0.05). Treatment ICIE2SO4 Fold Change (2 Ct ) 0.1 1 10 Control Treated Figure 4-12. PC1 mRNA expression in p ituitary. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals.

PAGE 99

86 Tissue B r a i n s t e m H y p o t h a l a m u s P i t u i t a r y C e r e b e l l u m H i p p o c a m p u s C o r t e x Fold Change (2 Ct ) 0.1 1 10 ICI control ICI E2SO4 control E2SO4 * * Figure 4-13. ERmRNA expression in ovine brain. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals. * indicates statistica lly significant decreas e in mRNA abundance relative to control fetuses ( P< 0.05). Tissue B r a i n s t e m H y p o t h a l a m u s P i t u i t a r y C e r e b e l l u m H i p p o c a m p u s C o r t e x Fold Change (2 Ct ) 0.1 1 10 ICI control ICI E2SO4 control E2SO4 Figure 4-14. ERmRNA expression in ovine brain. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals.

PAGE 100

87 Tissue B ra i n s t e m H y p o t h a l a m u s P i t u i t a r y C e r e b e l l u m H i p p o c a m p u s C o rt e x Fold Change (2 Ct ) 0.1 1 10 ICI control ICI E2SO4 control E2SO4 * Figure 4-15. PGHS-1 mRNA expression in ovin e brain. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals. * indicates statistica lly significant decreas e in mRNA abundance relative to control fetuses ( P< 0.05). Tissue B r a i n s t e m H y p o t h a l a m u s P i t u i t a r y C e r e b e l l u m H i p p o c a m p u s C o r t e x Fold Change (2 Ct ) 0.1 1 10 ICI control ICI E2SO4 control E2SO4 Figure 4-16. PGHS-2 mRNA expression in ovin e brain. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) trea ted twin fetuses compared to in utero control animals.

PAGE 101

88 Treatment ICIE2SO4 Fold Change (2 Ct ) 0.1 1 10 Control Treated Figure 4-17. SGK mRNA in hippocampus. Expression in estrad iol sulfate (E2SO4) treated and ICI 182,780 (ICI) treated tw in fetuses is compared to in utero control animals. Treatment ICIE2SO4 Fold Change (2Ct ) 0.1 1 10 Control Treated Figure 4-18. SGK mRNA in pituitary. Expr ession in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treated twin fetuses compared to in utero control animals.

PAGE 102

89 Treatment ICIE2SO4 Fold Change (2Ct ) 0.1 1 10 Control Treated Figure 4-19. STS mRNA expression in hypotha lamus. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals. Treatment ICIE2SO4 Fold Change (2Ct ) 0.1 1 10 Control Treated Figure 4-20. STS mRNA expression in cereb ellum. Expression in estradiol sulfate (E2SO4) treated and ICI 182,780 (ICI) treate d twin fetuses is compared to in utero control animals.

PAGE 103

90 Specific Band of InterestMean IntensityA B C D E ERBrainstem 72 kDa70 kDa 0 1000 2000 3000 E2SO4 control E2SO4 ERHippocampus 72 kDa 0 1000 2000 3000 ERHypothalamus 72 kDa70 kDa68 kDa66 kDa 0 1000 2000 ERCortex 72 kDa70 kDa 0 1000 2000 3000 ERCerebellum 72 kDa 0 1000 2000 3000 Specific Band of InterestMean IntensityA B C D E ERBrainstem 72 kDa70 kDa 0 1000 2000 3000 E2SO4 control E2SO4 ERHippocampus 72 kDa 0 1000 2000 3000 ERHypothalamus 72 kDa70 kDa68 kDa66 kDa 0 1000 2000 ERCortex 72 kDa70 kDa 0 1000 2000 3000 ERCerebellum 72 kDa 0 1000 2000 3000 Figure 4-21. ERprotein expression in estradiol sulfate (E2SO4) treated sheep relative to control. A) Hypothalamus. B) Hippo campus. C) Cortex. D) Cerebellum. E) Brainstem.

PAGE 104

91 A B C D E TreatmentMean Intensity ERHypothalamus ControlE2SO4 0 500 1000 1500 ERHippocampus ControlE2SO4 0 500 1000 1500 ERCortex ControlE2SO4 0 500 1000 1500 ERCerebellum ControlE2SO4 0 1000 2000 3000 ERBrainstem ControlE2SO4 0 1000 2000 3000 A B C D E TreatmentMean Intensity ERHypothalamus ControlE2SO4 0 500 1000 1500 ERHippocampus ControlE2SO4 0 500 1000 1500 ERCortex ControlE2SO4 0 500 1000 1500 ERCerebellum ControlE2SO4 0 1000 2000 3000 ERBrainstem ControlE2SO4 0 1000 2000 3000 Figure 4-22. ERprotein expression in estradiol sulfate (E2SO4) treated sheep relative to control. A) Hypothalamus. B) Hippo campus. C) Cortex. D) Cerebellum. E) Brainstem.

PAGE 105

92 Mean IntensitySpecific Band of Interest A B C D E ER-a Hypothalamus 72 kDa70 kDa68 kDa 0 500 1000 1500 ICI control ICI ERHippocampus 72 kDa70 kDa68 kDa66 kDa 0 500 1000 1500 2000 ERCortex 72 kDa70 kDa68 kDa 0 500 1000 ERCerebellum 72 kDa70 kDa 0 500 1000 ERBrainstem 72 kDa70 kDa 0 200 400 600 800 1000 Mean IntensitySpecific Band of Interest A B C D E ER-a Hypothalamus 72 kDa70 kDa68 kDa 0 500 1000 1500 ICI control ICI ERHippocampus 72 kDa70 kDa68 kDa66 kDa 0 500 1000 1500 2000 ERCortex 72 kDa70 kDa68 kDa 0 500 1000 ERCerebellum 72 kDa70 kDa 0 500 1000 ERBrainstem 72 kDa70 kDa 0 200 400 600 800 1000 Figure 4-23. ERprotein expression in ICI 182,780 (ICI) treated sheep relative to control. A) Hypothalamus. B) Hippocam pus. C) Cortex. D) Cerebellum. E) Brainstem.

PAGE 106

93 TreatmentMean IntensityA B C D E ERHypothalamus ControlICI 0 200 400 600 ERHippocampus ControlICI 0 500 1000 1500 ERCortex ControlICI 0 500 1000 1500 * ERCerebellum ControlICI 0 500 1000 1500 ERBrainstem ControlICI 0 200 400 600 800 1000 TreatmentMean IntensityA B C D E ERHypothalamus ControlICI 0 200 400 600 ERHippocampus ControlICI 0 500 1000 1500 ERCortex ControlICI 0 500 1000 1500 * ERCerebellum ControlICI 0 500 1000 1500 ERBrainstem ControlICI 0 200 400 600 800 1000 Figure 4-24. ERprotein expression in ICI 182,780 (ICI) treated sheep relative to control. A) Hypothalamus. B) Hippocam pus. C) Cortex. D) Cerebellum. E) Brainstem. * indicates statis tically significant increase in mean intensity relative to control fetuses.

PAGE 107

94 CHAPTER 5 SUMMARY Preterm birth remains a concern of physic ians world-wide. As of 2001, 5 to 10% of all births were reported as preterm, yet this figure accounts for 70 to 75% of neonatal morbidity and mortality (1). Among the known medical causes of preterm birth are disruption of utero-placental blood flow, changes in maternal or fetal cardiovascular homeostasis, stress, and sepsis; however, maternal age, socio-economic status, poor lifestyle choices (i.e., drug or alcohol abus e or smoking), and carry ing more than one fetus may contribute to premature labor. Desp ite major efforts on the part of the research community to better understand the bioche mical mechanisms and physiology of labor, many questions remain unanswered. Most groups studying parturition use sheep as a model. While sheep are not identical to humans, one may interpret the da ta relative to primates, while keeping in mind the known differences between the tw o. Sheep are preferred over non-human primates because of the quiescence of the uter us during surgical procedures on the fetus; primates face the risk of abortion caused by cont ractions when the uterus is manipulated. Furthermore, sheep are a better research al ternative than mice or rats because of differences in size, domesticity, neuronal and HP A axis maturity at birth, and ability to manipulate the fetus. Our experiments require d chronic catheterizat ion and large volumes of blood drawn every other day. Rodents are simply too small to draw the amount of blood needed for our assays.

PAGE 108

95 The fetal HPA axis is critical in initiation of parturition in this species. Disruption or stimulation of the axis can delay or initia te parturition, respectivel y. Previous research in our laboratory showed a stimulatory effect of estradiol on the HPA axis and the ability of estrogen and androstenedione to advance the date of parturition by 4 days. Based on those data, it was hypothesized that estradiol exerts a positive feedback effect on the fetal HPA axis. Our studies sought to provide answ ers to questions raised by those studies. The aims addressed in this dissertation were designed to gain some understanding of the ontogenetic role of estrogen and estrogen receptors in the fetus and how they may be involved in parturition in sheep. The experiments outlined in chapter 2 were designed to quantify the expression of ERand ERontogenetically. Brain tissues were co llected from fetal sheep ranging in age from 80 to 145 days and from adults. We found that ER mRNA and protein were detectable in the ovine fetus in all of th e brain tissues studied and that expression appeared to be developmentally regulated, as expression differed between the fetus and adult. In general, we found that mRNA and protein expression was higher in adult animals than fetuses. Studies using endometrial tissue demonstrated the ability of estradiol to upregulate ER; therefore, we pos tulated that ER may be upregulated near term when estradiol is high. Our results suggest that, in the fetal brain, estradiol downregulates ER expression. We believe that the mechanisms contro lling ER expression in the brain may be different than those in endome trium. We speculate that in mid-gestation progesterone is able to downregulate the receptors, while in late gestation increasi ng concentrations of plasma estradiol may decrease expression. The endocrine environment imposed by

PAGE 109

96 pregnancy is removed after birth, which ma y explain why expression is augmented in adult (and sometimes post-natal) animals. An exception to our general findings was found in fetal cerebellum. In this tiss ue, ER mRNA was upregulated from 120 to 145 days gestation. We believe that this is a reflection of estrogen dependent growth and maturation, as estradiol in the cerebellum is known to promote dendritic growth and synaptogenesis. In chapters 3 and 4, we performed in vivo experiments intended to address the following questions: Does estradiol act central ly or peripherally to stimulate the fetal HPA axis?; Are estrogen receptors involve d in mediating estradiol action on the HPA axis?; If the effects of estradiol on the HP A axis are mediated through estrogen receptors will infusion of estradiol cause early parturition?; Can an estrogen receptor blocker delay parturition?; and finally, Does estradiol cause genomic responses within the brain that alter HPA axis activity? One confounding factor in our studies was our decision to use estradiol sulfate instead of estradiol. We made this choice be cause estradiol sulfate is much more soluble than estradiol and we knew that it would be deconjugated within the fetus (we showed previously that the brain is an abundant source of steroid sulfatase, bu t it is also expressed peripherally). However, we chose a highe r dose (1 mg/day) than used before (0.25 mg/day) because we could not predict how much sulfated steroid would be locally deconjugated. In chapter 3, singleton fetuses (treated with estradiol sulfate icv or iv ; ICI 182,780 icv ; or vehicle) were subjected to blood draw every other day until spontaneous parturition occurred so that we could crea te an ontogeny of plasma hormones in sheep

PAGE 110

97 and determine the effect of treatment on part urition. Our most interesting and unexpected result was that cortisol increased near term in all treatment groups, despite a blunted ACTH response. These results contrast with the known effects of estradiol that have been shown in the sheep and in the rat. In sheep, adrenal maturation, development, and secretion of cortisol depend on stimulation fr om pituitary secretion of ACTH. How is it possible for cortisol secretion to mirror control fetuses when ACTH is blunted? Is there another signal or factor that is controlling cortisol secretion from the fetal adrenal? If so, where is the signal coming from? Estradiol sulfate and ICI both blunted ACTH responses; however other plasma hormone responses were not similar between tr eatments. This sugge sts that both ICI and estradiol sulfate are able to inhibit the ACTH response, but probably through different mechanisms. We know that IC I is a non-selective ER antago nist, but we speculate that estradiol sulfate may be interacting with GABAA receptors as a neurosteroid or as a partial ER antagonist to inhibit HPA activity. We were also surprised that central admini stration of estradiol sulfate significantly increased plasma estradiol sulfate between da ys -12 and -4 before parturition, compared to peripheral treatment. This could mean th at clearance decreases following infusion into the brain, or there could be local producti on of estradiol sulfate that is somehow stimulated by estradiol sulfate itself. It is known that neur osteroidogenesis occurs in the brain; however, the mechanisms involved in increased plasma estradiol sulfate production in our experiments are unknown. Neither estradiol sulfate nor ICI altered the timing of part urition in our study. We do not believe that this indicates that ERs are not involved in pa rturition, rather, the

PAGE 111

98 process of parturition is more complex than one steroid acting through its receptors to activate the HPA axis. We also acknowledge that our sample size was low and therefore a more robust study may have yielded diffe rent results. However, we do find it interesting that we were able to “tweak” the endocrine environment so dramatically without affecting spontaneous parturition. The purpose of chapter 4 was to identify genomic responses resulting from estradiol sulfate or ICI treatment . We used twin fetuses so th at we could use one fetus as an age-matched control while comparing the effect of treatment. Estradiol sulfate downregulated mRNA for POMC and ERin pituitary; CRH and ERin hypothalamus; and PGHS-1 in hippocampus. There was no effect of ICI on genomic responses. ERand ERprotein were not affected by es tradiol sulfate treatment, but ERwas upregulated in cortex following ICI tr eatment. It is unclear from the present studies why ER protein data did not follow mRNA data. Interestingly, estradiol su lfate was stimulatory on ACTH1-39 and cortisol secretion in our twin studies. This is consistent with other studies in our lab, but conflicts with the data from chapter 3. This could reflec t a fundamental difference between use of singleton and twin fetuses. However, we sp eculate that the differences observed between chapters 3 and 4 reflect differences in s hort versus long-term exposure to estradiol sulfate. In our singleton study, fetuses were treated for as long as 25 days whereas our twins were treated for half that length of time. We speculate that in the short-term, stimulation of the HPA axis (as seen in ACTH1-39 and cortisol secretion) and genomic responses consistent with estradiol are probably due to sulfate deconjugation from estradiol, allowing estradiol to affect HPA activity. In the long-term, we see some

PAGE 112

99 combination of inhibitory and stimulatory eff ects. We speculate that estradiol sulfate could be interacting with GABAA receptors as a neurostero id or as a partial ER antagonist to elicit these responses. In the case of cortisol secr etion, it appears that chronic exposure to estradiol sulfate may be less important than other factors in controlling adrenal responsiveness. That is, in the long-term the inhibitory effect of estradiol sulfate is over-ruled by some other mechanism, thus allowing cortisol to rise despite inhibited pituit ary secretion of ACTH. Taken together, our data indicate that the e ffects of estradiol sulf ate treatment in the fetus are complex and not merely as simple as “stimulatory” or “inh ibitory”. Acutely, estradiol sulfate seems to mimic effects expe cted of unconjugated es tradiol, but chronic infusion complicates the picture. Our data stro ngly indicates that estradiol sulfate affects the HPA axis and the fetal neuroendocrine envi ronment. Further studies are necessary to elucidate the possible mediators of the inhibitory ve rsus stimulatory effects of estradiol sulfate and where the steroid may be act ing within the central nervous system.

PAGE 113

100 LIST OF REFERENCES 1. Challis JR, Smith SK 2001 Fetal endocrine signals and preterm labor. Biology of the Neonate 79:163-167 2. Kerzner LS, Stonestreet BS, Wu KY, Sadowska G, Malee MP 2002 Antenatal dexamethasone: effect on ovine place ntal 11beta-hydroxysteroid dehydrogenase type 2 expression and fetal growth. Pediatr Res 52:706-712 3. Jobe AH, Newnham JP, Moss TJ, Ikegami M 2003 Differential effects of maternal betamethasone and cortisol on lung maturation and growth in fetal sheep. American Journal of Obst etrics and Gynecology 188:22-28 4. Malpas P 1933 Postmaturity and malformations of the foetus. Journal of Obstetrics and Gynecology of th e British Commonwealth 40:1046-1053 5. Van Kampen KR, Ellis LC 1972 Prolonged gestation in ewes ingesting Veratrum californicum : morphological changes and st eroid biosynthesis in the endocrine organs of cyclopic lambs. J Endocrinol 52:549-560 6. Binns W, James LF, Shupe JL 1964 Toxicosis of Veratrum californicum in ewes and its relationship to a congenital deformity in lambs. Annals New York Academy of Sciences 111:571-576 7. Liggins GC, Fairclough RJ, Grieves SA, Kendall JZ, Knox BS 1973 The mechanism of initiation of parturition in the ewe. Recent Progress in Hormone Research 29:111-159 8. Liggins GC, Kennedy PC, Holm LW 1967 Failure of initiation of parturition after electrocoagulati on of the pituitary of the feta l lamb. American Journal of Obstetrics and Gynecology 98:1080-1086 9. Antolovich GC, Clarke I J, McMillen IC, Perry RA, Robinson PM, Silver M, Young R 1990 Hypothalamo-pituitary disconnection in the fetal sheep. Neuroendocrinology 51:1-9 10. Deayton JM, Young IR, Thorburn GD 1993 Early hypophysectomy of sheep fetuses: effects on growth, placenta l steroidogenesis and prostaglandin production. J Reprod Fertil 97:513-520

PAGE 114

101 11. Deayton JM, Young IR, Hollingworth SA, White A, Crosby SR, Thorburn GD 1994 Effect of late hypothalamo-pitu itary disconnection on the development of the HPA axis in the ovine fetus and the initiation of parturition. J Neuroendocrinol 6:25-31 12. McDonald TJ, Nathanielsz PW 1991 Bilateral destruction of the fetal paraventricular nuclei prolongs gestation in sheep. Ameri can Journal of Obstetrics and Gynecology 165:764-770 13. Drost M, Holm LM 1968 Prolonged gestation in ewes after foetal adrenalectomy. Journal of Endocrinology 40:293-296 14. Liggins GC 1968 Premature parturition after infusi on of corticotrophin or cortisol into foetal lambs. Journal of Endocrinology 42:323-329 15. Liggins GC 1969 Premature delivery of foetal lambs infused with glucocorticoids. J Endocrinol 45:515-523 16. Kendall JZ, Challis JRG, Hart IC, Jones CT, Mitchell MD, Ritchie JWK, Robinson JS, Thorburn GD 1977 Steroid and prostagla ndin concentrations in the plasma of pregnant ewes duri ng infusion of adrenocorticotropin or dexamethasone to intact or hypophysectom ized foetuses. J Endocrinol 75:59-71 17. Liggins GC 1976 Adrenocortical-related maturational events in the fetus. American Journal of Obstet rics and Gynecology 126:931 18. Kiss JZ 1988 Dynamism of chemoarchi tecture in the hypothalamic paraventricular nucleus. Brai n Research Bulletin 20:699-708 19. Whitnall MH, Mezey E, Gainer H 1985 Co-localization of corticotropinreleasing factor and vasopressin in me dian eminence neurosecretory vesicles. Nature 317:248-250 20. Whitnall MH, Smyth D, Gainer H 1987 Vasopressin coexists in half of the corticotropin-releasing factor axons present in the exte rnal zone of the median eminence in normal rats. Neuroendocrinology 45:420-424 21. Currie IS, Brooks AN 1992 Corticotrophin-releasing factors in the hypothalamus of the developing fetal sheep. Journal of Developmental Physiology 17:241-246 22. Watabe T, Levidiotis ML, Oldfield B, Wintour EM 1991 Ontogeny of corticotrophin-releasing f actor (CRF) in the ovine fetal hypothalamus: use of multiple CRF antibodies. J Endocrinol 129:335-341 23. Brooks AN, White A 1990 Activation of pituitary-adr enal function in fetal sheep by corticotrophin-releasi ng factor and arginine vasopressin. Journal of Endocrinology 124:27-35

PAGE 115

102 24. Norman LJ, Challis JRG 1987 Synergism between systemic corticotropinreleasing factor and arginine vasopressi n on adrenocorticotropin release in vivo varies as a function of gestational age in the ovine fe tus. Endocrinology 120:1052-1058 25. Keiger CJ, O'Steen WK, Brewer G, Sorci TM, Zehnder TJ, Rose JC 1994 Corticotropin releasing factor mRNA and peptide levels are differentially regulated in the developing ovine br ain. Brain Res Mol Brain Res 27:103-110 26. Levidiotis ML, Wintour EM , McKinley MJ, Oldfield BJ 1989 Hypothalamichypophyseal vascular connections in the fetal sheep. Neuroendocrinology 49:4750 27. Mulvogue HM, McMillen IC, Robinson PM, Perry RA 1986 Immunocytochemical localization of pro-gamma-MSH, gamma-MSH, ACTH, and beta-endorphin/beta-lipotropin in th e fetal sheep pituitary: an ontogenetic study. Journal of Developmental Physiology 8:355-368 28. Challis JRG, Brooks AN 1989 Maturation and activ ation of hypothalamicpituitary-adrenal function in feta l sheep. Endocrine Reviews 10:182-204 29. Lu F, Yang K, Challis JR 1994 Regulation of ovine fe tal pituitary function by corticotropin-releasing hormone, arginine vasopressin and cortisol in vitro. J Endocrinol 143:199-208 30. Wintour EM 1984 Developmental aspects of th e hypothalamic-pituitary-adrenal axis. J Dev Physiol 6:291-299 31. Hennessy DP, Coghlan JP, Hardy KJ, Scoggins BA, Wintour EM 1982 The origin of cortisol in the blood of fe tal sheep. Journal of Endocrinology 95:71-79 32. Wood CE, Rudolph AM 1983 Negative feedback regulation of adrenocorticotropin secretion by cortis ol in ovine fetuses. Endocrinology 112:1930-1936 33. Wood CE 1986 Sensitivity of cortisol-induced inhibition of ACTH and renin in fetal sheep. American Journa l of Physiology 250:R795-R802 34. Wood CE 1994 The function of the fetal pitu itary-adrenal system. In: Thorburn GD, Harding R (eds). Textbook of Fetal Physiology.Oxford University Press, Oxford:351-358 35. Rose JC, Meis PJ, Urban RB, Greiss FC 1982 In vivo evidence for increased adrenal sensitivity to adrenocorticotropin -(1-24) in the lamb fetus late in gestation. Endocrinology 111:80-85 36. Wood CE 1988 Insensitivity of near-term fetal sheep to cortisol: Possible relation to the control of part urition. Endocrinology 122:1565-1572

PAGE 116

103 37. France JT, Magness RR, Murry BA, Rosenfeld CR, Mason JI 1988 The regulation of ovine placental steroi d 17 alpha-hydroxylase and aromatase by glucocorticoid. Molecula r Endocrinology 2:193-199 38. Steele PA, Flint APF, Turnbull AC 1976 Activity of steroid C-17,20 lyase in the ovine placenta: Effect of exposure to foetal glucocorticoid. Journal of Endocrinology 69:239-246 39. Wood CE 2005 Estrogen/hypothalamus-pituitary-ad renal axis interactions in the fetus: The interplay between placenta and fetal brain. J Soc Gynecol Investig 12:67-76 40. Jaffe RB 2001 Role of the human fetal adre nal gland in the initiation of parturition. Front Horm Res 27:75-85 41. Jaffe RB, Seron-Ferre M, Crickard K, Koritnik D, Mitchell BF, Huhtaniemi IT 1981 Regulation and function of the pr imate fetal adrenal gland and gonad. Recent Progress in Hormone Research 37:41-97 42. Soloff MS 1975 Uterine receptor for oxytocin: effects of estrogen. Biochemical and Biophysical Research Communications 65:205-212 43. Roberts JS, Share L 1969 Effects of progesterone and estrogen on blood levels of oxytocin during vaginal di stension. Endocrinology 84:1076-1081 44. Sakai N, Tabb T, Garfield RE 1992 Modulation of cell-to -cell coupling between myometrial cells of the human uterus during pregnancy. American Journal of Obstetrics and Gynecology 167:472-480 45. Kitay JI 1961 Sex differences in adrenal cortical secreti on in the rat. Endocrinology 68:818-824 46. Viau V, Meaney MJ 1991 Variations in the hypot halamic-pituitary-adrenal response to stress during the estrous cycle in the rat. Endocrinology 129:25032511 47. Carey MP, Deterd CH, deKoni g J, Helmerhost F, DeKloet ER 1995 The influence of ovarian steroids on hypothala mic-pituitary-adrenal regulation in the female rat. J Endocrinol 144:311-321 48. Pollard I, White BM, Bassett JR, Cairncross KD 1975 Plasma glucocorticoid elevation and desynchronization of th e estrous cycle following unpredictable stress in the rat. Behav Biol 14:103-108 49. Nappi RE, Rivest S 1995 Ovulatory cycle influences the stimulatory effect of stress on the expression of corticotropi n-releasing factor receptor messenger ribonucleic acid in the paraventricular nuc leus of the female rat hypothalamus. Endocrinology 136:4073-4083

PAGE 117

104 50. Nappi RE, Bonneau MJ, Rivest S 1997 Influence of the estrous cycle on c-fos and CRH gene transcription in the brai n of endotoxin-challenged female rats. Neuroendocrinology 65:29-46 51. Genazzani AR, LeMarchand-Bera ud T, Aubert ML, Felber JP 1975 Pattern of plasma ACTH, hGH, and cortisol during menstrual cy cle. Journal of Clinical Endocrinology and Metabolism 41:431-437 52. De L, V, la Marca A, Talluri B, D'Antona D, Morgante G 1998 Hypothalamopituitary-adrenal axis and adrenal func tion before and after ovariectomy in premenopausal women. Eur J Endocrinol 138:430-435 53. Kitay JI 1965 Depression of adrenal corticosterone production in oophorectomized rats. Endocrinology 77:1048-1052 54. Kitay JI, Coyne MD, Swygert NH 1970 Influence of gonadectomy and replacement with estradiol or testoste rone on formation of 5 alpha-reduced metabolites of corticosterone by the ad renal gland of the rat. Endocrinology 87:1257-1265 55. Kitay JI 1963 Pituitary-adrenal function in the rat after gonadectomy and gonadal mormone replacement. Endocrinology 73:253-260 56. Coyne MD, Kitay JI 1969 Effects of ovariectomy on pituitary secretion of ACTH. Endocrinology 85:1097-1102 57. Saoud CJ, Wood CE 1997 Modulation of ovine fetal adrenocorticotropin secretion by androstenedione and 17beta -estradiol. American Journal of Physiology 272:R1128-R1134 58. Purinton SC, Wood CE 2002 Oestrogen augments the fetal ovine hypothalamuspituitary-adrenal axis in respons e to hypotension. J Physiol 544:919-929 59. Wood CE, Saoud CJ 1997 Influence of estradiol and androstenedione on ACTH and cortisol secretion in the ovine fe tus. J Soc Gynecol Investig 4:279-283 60. Lim H, Paria BC, Das SK, Dinchuk JE , Langenbach R, Trzaskos JM, Dey SK 1997 Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91:197-208 61. Smith WL, DeWitt DL, Garavito RM 2000 Cyclooxygenases: structural, cellular, and molecular bi ology. Annu Rev Biochem 69:145-182 62. Wood CE, Giroux D 2003 Central nervous system prostaglandin endoperoxide synthase-1 and -2 responses to oestra diol and cerebral hypoperfusion in lategestation fetal sheep. J Physiol 549:573-581

PAGE 118

105 63. Carnegie JA, Robertson HA 1978 Conjugated and unconjugated estrogens in fetal and maternal fluids of the pregnant ewe: A possible role for estrone sulfate during early pregnancy. Biol ogy of Reproduction 19:202-211 64. Wood CE, Gridley KE, Keller-Wood M 2003 Biological activity of 17betaestradiol-3-sulfate in ovine fetal plas ma and uptake in fetal brain. Endocrinology 144:599-604 65. Reed MJ, Purohit A, Woo LW, Newman SP, Potter BV 2005 Steroid sulfatase: molecular biology, regulation, a nd inhibition. Endocr Rev 26:171-202 66. Hobkirk R 1985 Steroid sulfotransferases a nd steroid sulfate sulfatases: characteristics and biological role s. Can J Biochem Cell Biol 63:1127-1144 67. Ruder HJ, Loriaux L, Lipsett MB 1972 Estrone sulfate: production rate and metabolism in man. J Clin Invest 51:1020-1033 68. Song WC 2001 Biochemistry and reproducti ve endocrinology of estrogen sulfotransferase. Annals New York Academy of Sciences 948:43-50 69. DiGiovanna JJ, Robinson-Bostom L 2003 Ichthyosis: etiology, diagnosis, and management. Am J Clin Dermatol 4:81-95 70. Traupe H, Happle R 1983 Clinical spectrum of steroid sulfatase deficiency: Xlinked recessive ichthyosis, birth complicat ions and cryptorchidism. Eur J Pediatr 140:19-21 71. France JT, Seddon RJ, Liggins GC 1973 A study of pregnancy with low estrogen production due to pl acental sulfatase deficien cy. Journal of Clinical Endocrinology and Metabolism 36:1-9 72. Compagnone NA, Salido E, Shapiro LJ, Mellon SH 1997 Expression of steroid sulfatase during embryogenesi s. Endocrinology 138:4768-4773 73. Tong MH, Jiang H, Liu P, Lawson JA, Brass LF, Song WC 2005 Spontaneous fetal loss caused by placental thrombosis in estrogen sulfotransferase-deficient mice. Nat Med 11:153-159 74. Kawano J, Aikawa E 1987 Regional distri bution of arylsulpha tase and estronesulfate sulfatase ac tivities in rat brain and hypophys is. Brain Research 409:391394 75. Platia MP, Fencl Md, Elkind-Hirsc h KE, Canick JA, Tulchinsky D 1984 Estrone sulfatase activity in the human br ain and estrone sulfate levels in the normal menstrual cycle. J Steroid Biochem 21:237-241

PAGE 119

106 76. Connolly PB, Resko JA 1989 Estrone sulfatase activity in rat brain and pituitary: effects of gonadectomy and the estrous cycle. J Steroid Biochemistry 33:10131018 77. Lakshmi S, Balasubramanian AS 1981 The distribution of estrone sulphatase, dehydroepiandrosterone sulphatase, and arylsulphatase C in the primate (Macaca radiata) brain and pituitary. J Neurochem 37:358-362 78. Purinton SC, Newman H, Castro MI, Wood CE 1999 Ontogeny of estrogen sulfatase activity in ovine fetal hypothala mus, hippocampus, and brain stem. Am J Physiol 276:R1647-R1652 79. Purinton SC, Wood CE 2000 Ovine fetal estrogen su lfotransferase in brain regions important for hypothalamus-p ituitary-adrenal axis control. Neuroendocrinology 71:237-242 80. Corpechot C, Robel P, Axelson M, Sjovall J, Baulieu EE 1981 Characterization and measurement of dehydr oepiandrosterone sulfate in rat brain. Proc Natl Acad Sci U S A 78:4704-4707 81. Sierra A 2004 Neurosteroids: the StAR protei n in the brain. J Neuroendocrinol 16:787-793 82. Zwain IH, Yen SS 1999 Neurosteroidogenesis in astrocytes, oligodendrocytes, and neurons of cerebral cortex of rat brain. Endoc rinology 140:3843-3852 83. Shibuya K, Takata N, Hojo Y, Furukawa A, Yasumatsu N, Kimoto T, Enami T, Suzuki K, Tanabe N, Ishii H, Muka i H, Takahashi T, Hattori TA, Kawato S 2003 Hippocampal cytochrome P450s synthesize brain neurosteroids which are paracrine neuromodulators of synaptic si gnal transduction. Biochim Biophys Acta 1619:301-316 84. Matsunaga M, Ukena K, Tsutsui K 2001 Expression and localization of cytochrome P450 17 alpha-hydroxylase/c17,20-l yase in the avian brain. Brain Res 899:112-122 85. Stromstedt M, Waterman MR 1995 Messenger RNAs encoding steroidogenic enzymes are expressed in rodent br ain. Brain Res Mol Brain Res 34:75-88 86. Sakamoto H, Mezaki Y, Shiki mi H, Ukena K, Tsutsui K 2003 Dendritic growth and spine formation in response to estrogen in the developing Purkinje cell. Endocrinology 144:4466-4477 87. Tsutsui K, Sakamoto H, Shikimi H, Ukena K 2004 Organizing actions of neurosteroids in the Purkinje neuron. Neurosci Res 49:273-279 88. Sinchak K, Mills RH, Tao L, LaPolt P, Lu JK, Micevych P 2003 Estrogen induces de novo progesterone synthesis in astrocytes. Dev Neurosci 25:343-348

PAGE 120

107 89. Soma KK, Sinchak K, Lakhter A, Schlinger BA, Micevych PE 2005 Neurosteroids and Female Reproducti on: Estrogen Increases 3{beta}-HSD mRNA and Activity in Rat Hypotha lamus. Endocrinology 146:4386-4390 90. Maayan R, Strous RD, Abou-Kaoud M, Weizman A 2005 The effect of 17beta estradiol withdrawal on th e level of brain and peripheral neurosteroids in ovarectomized rats. Neurosci Lett 384:156-161 91. Deutsch SI, Mastropaolo J, Hitri A 1992 GABA-active steroids: endogenous modulators of GABA-gated chloride ion conductance. Clin Neuropharmacol 15:352-364 92. Regelson W, Kalimi M 1994 Dehydroepiandrosterone (DHEA)--the multifunctional steroid. II. Effects on the CNS, cell proliferation, metabolic and vascular, clinical and othe r effects. Mechanism of action? Annals New York Academy of Sciences 719:564-575 93. Demirgoren S, Majewska MD, Spivak CE, London ED 1991 Receptor binding and electrophysiological eff ects of dehydroepiandrosterone sulfate, an antagonist of the GABAA receptor. Neuroscience 45:127-135 94. Majewska MD 1992 Neurosteroids: endogenous bimodal modulators of the GABAA receptor. Mechanism of action and physiological significance. Prog Neurobiol 38:379-395 95. Majewska MD, Schwartz RD 1987 Pregnenolone-sulfate: an endogenous antagonist of the gamma-aminobutyric acid receptor complex in brain? Brain Res 404:355-360 96. Spivak CE 1994 Desensitization and noncompe titive blockade of GABAA receptors in ventral midbrain neurons by a neurosteroid dehydroepiandrosterone sulfate. Synapse 16:113-122 97. Lambert JJ, Belelli D, Peden DR, Vardy AW, Peters JA 2003 Neurosteroid modulation of GABAA recepto rs. Prog Neurobiol 71:67-80 98. Sieghart W, Sperk G 2002 Subunit composition, dist ribution and function of GABA(A) receptor subtypes. Curr Top Med Chem 2:795-816 99. Herbison AE 1994 Immunocytochemical evidence for oestrogen receptors within GABA neurones located in the perinuclear zone of the supraoptic nucleus and GABAA receptor beta 2/beta 3 subunits on supraoptic oxytocin neurones. J Neuroendocrinol 6:5-11 100. Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson JA 1997 Comparison of the ligand bindi ng specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138:863870

PAGE 121

108 101. Harris HA, Bapat AR, Gonder DS, Frail DE 2002 The ligand binding profiles of estrogen receptors alpha and beta ar e species dependent. Steroids 67:379-384 102. Greene GL, Gilna P, Waterfield M, Baker A, Hort Y, Shine J 1986 Sequence and expression of human estrogen re ceptor complementary DNA. Science 231:1150-1154 103. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor e xpressed in rat prostate and ovary. Proc Natl Acad Sci U S A 93:5925-5930 104. Kumar V, Green S, Stack G, Berry M, Jin JR, Chambon P 1987 Functional domains of the human estrogen receptor. Cell 51:941-951 105. Hall JM, Couse JF, Korach KS 2001 The multifaceted mechanisms of estradiol and estrogen receptor signaling. Journal of Biological Chemistry 276:3686936872 106. Hewitt SC, Korach KS 2002 Estrogen receptors: structure, mechanisms and function. Rev Endocr Metab Disord 3:193-200 107. Lubahn DB, Moyer JS, Golding TS, Co use JF, Korach KS, Smithies O 1993 Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estroge n receptor gene. Proc Natl Acad Sci U S A 90:11162-11166 108. Krege JH, Hodgin JB, Couse JF, Enma rk E, Warner M, Mahler JF, Sar M, Korach KS, Gustafsson JA, Smithies O 1998 Generation and reproductive phenotypes of mice lacking estrogen recep tor beta. Proc Natl Acad Sci U S A 95:15677-15682 109. Couse JF, Korach KS 1999 Reproductive phenotypes in the estrogen receptoralpha knockout mouse. Ann Endocrinol (Paris) 60:143-148 110. Hewitt SC, Korach KS 2003 Oestrogen receptor knockout mice: roles for oestrogen receptors alpha and beta in reproductive tissues . Reproduction 125:143149 111. Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, Davis BJ, Korach KS 1999 Postnatal sex reversal of the ovaries in mice lacking estrogen receptors alpha and beta. Science 286:2328-2331 112. Jakacka M, Ito M, Martinson F, Ishikawa T, Lee EJ, Jameson JL 2002 An estrogen receptor (ER)alpha deoxyribonuc leic acid-binding domain knock-in mutation provides evidence for nonclassical ER pathway signaling in vivo. Molecular Endocrinology 16:2188-2201

PAGE 122

109 113. Nilsson S, Makela S, Treuter E, Tujague M, Thomsen J, Andersson G, Enmark E, Pettersson K, Warner M, Gustafsson JA 2001 Mechanisms of estrogen action. Physiol Rev 81:1535-1565 114. Tora L, White J, Brou C, Tasset D, Webster N, Scheer E, Chambon P 1989 The human estrogen receptor has two independent nonacidic transcriptional activation functions . Cell 59:477-487 115. Barkhem T, Carlsson B, Nilsson Y, Enmark E, Gustafsson J, Nilsson S 1998 Differential response of estrogen receptor alpha and estrogen receptor beta to partial estrogen agonists/antagonists. Mol Pharmacol 54:105-112 116. Saville B, Wormke M, Wang F, Nguyen T, Enmark E, Kuiper G, Gustafsson JA, Safe S 2000 Ligand-, cell-, and estrogen r eceptor subtype (alpha/beta)dependent activation at GC-rich (Sp1) pr omoter elements. Journal of Biological Chemistry 275:5379-5387 117. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of es trogen receptors ERalpha and ERbeta at AP1 sites. Science 277:1508-1510 118. Pettersson K, Delaunay F, Gustafsson JA 2000 Estrogen receptor beta acts as a dominant regulator of estroge n signaling. Oncogene 19:4970-4978 119. Lindberg MK, Moverare S, Skrtic S, G ao H, Dahlman-Wright K, Gustafsson JA, Ohlsson C 2003 Estrogen receptor (ER)-beta reduces ERalpha-regulated gene transcription, suppor ting a "ying yang" relations hip between ERalpha and ERbeta in mice. Molecular Endocrinology 17:203-208 120. Ogawa S, Inoue S, Watanabe T, Hiroi H, Orimo A, Hosoi T, Ouchi Y, Muramatsu M 1998 The complete primary structure of human estrogen receptor beta (hER beta) and its heterodimerizati on with ER alpha in vivo and in vitro. Biochem Biophys Res Commun 243:122-126 121. Cheung E, Schwabish MA, Kraus WL 2003 Chromatin exposes intrinsic differences in the transcriptional activiti es of estrogen receptors alpha and beta. EMBO J 22:600-611 122. Weihua Z, Andersson S, Cheng G, Simpson ER, Warner M, Gustafsson JA 2003 Update on estrogen signaling. FEBS Lett 546:17-24 123. Levin ER 2001 Cell localization, physio logy, and nongenomic actions of estrogen receptors. J Appl Physiol 91:1860-1867 124. Zhao YY, Zhou J, Narayanan CS, Cui Y, Kumar A 1999 Role of C/A polymorphism at -20 on the expression of human angiotensinogen gene. Hypertension 33:108-115

PAGE 123

110 125. Bale TL, Dorsa DM 1997 Cloning, novel promoter sequence, and estrogen regulation of a rat oxytocin recep tor gene. Endocri nology 138:1151-1158 126. Mueller MD, Vigne JL, Minchenko A, Lebovic DI, Leitman DC, Taylor RN 2000 Regulation of vascular e ndothelial growth factor (VEGF) ge ne transcription by estrogen receptors alpha and beta . Proc Natl Acad Sci U S A 97:10972-10977 127. Day RN, Koike S, Sakai M, Muramatsu M, Maurer RA 1990 Both Pit-1 and the estrogen receptor are required for estr ogen responsiveness of the rat prolactin gene. Molecular Endocrinology 4:1964-1971 128. Kraus WL, Montano MM, Katzenellenbogen BS 1994 Identification of multiple, widely spaced estrogen-respons ive regions in the rat progesterone receptor gene. Molecular Endocrinology 8:952-969 129. Smith CL 1998 Cross-talk between peptide grow th factor and estrogen receptor signaling pathways. Biology of Reproduction 58:627-632 130. Ignar-Trowbridge DM, Nelson KG, Bidwell MC, Curtis SW, Washburn TF, McLachlan JA, Korach KS 1992 Coupling of dual signaling pathways: epidermal growth factor ac tion involves the estrogen r eceptor. Proc Natl Acad Sci U S A 89:4658-4662 131. Kato S 2001 Estrogen receptor-mediated crosstalk with growth factor signaling pathways. Breast Cancer 8:3-9 132. O'Lone R, Frith MC, Karlsson EK, Hansen U 2004 Genomic targets of nuclear estrogen receptors. Mole cular Endocrinology 18:1859-1875 133. Salvatori L, Ravenna L, Felli MP, Cardillo MR, Russo MA, Frati L, Gulino A, Petrangeli E 2000 Identification of an estrogen-mediated deoxyribonucleic acid-binding independent transactivation pathway on the epidermal growth factor receptor gene promoter. Endocrinology 141:2266-2274 134. Li C, Briggs MR, Ahlborn TE, Kraemer FB, Liu J 2001 Requirement of Sp1 and estrogen receptor alpha interaction in 17beta-estradiol-mediated transcriptional activation of the low dens ity lipoprotein receptor gene expression. Endocrinology 142:1546-1553 135. Duan R, Porter W, Safe S 1998 Estrogen-induced c-fos protooncogene expression in MCF-7 human breast cancer cells: role of estrogen receptor Sp1 complex formation. Endocrinology 139:1981-1990 136. Umayahara Y, Kawamori R, Watada H, Imano E, Iwama N, Morishima T, Yamasaki Y, Kajimoto Y, Kamada T 1994 Estrogen regulati on of the insulinlike growth factor I gene transcription involves an AP -1 enhancer. Journal of Biological Chemistry 269:16433-16442

PAGE 124

111 137. Vasudevan N, Kow LM, Pfaff D 2005 Integration of steroid hormone initiated membrane action to genomic functio n in the brain. Steroids 70:388-396 138. Pietras RJ, Szego CM 1977 Specific binding sites fo r oestrogen at the outer surfaces of isolated endometrial cells. Nature 265:69-72 139. Morley P, Whitfield JF, Vanderh yden BC, Tsang BK, Schwartz JL 1992 A new, nongenomic estrogen action: the rapi d release of intrac ellular calcium. Endocrinology 131:1305-1312 140. Migliaccio A, Di Domenico M, Castoria G, de Falco A, Bontempo P, Nola E, Auricchio F 1996 Tyrosine kinase/p21ras/MA P-kinase pathway activation by estradiol-receptor complex in MCF-7 cells. EMBO J 15:1292-1300 141. Endoh H, Sasaki H, Maruyama K, Take yama K, Waga I, Shimizu T, Kato S, Kawashima H 1997 Rapid activation of MAP kina se by estrogen in the bone cell line. Biochem Biophys Res Commun 235:99-102 142. Watters JJ, Campbell JS, Cunni ngham MJ, Krebs EG, Dorsa DM 1997 Rapid membrane effects of steroids in neuroblastoma cells: effects of estrogen on mitogen activated protein kinase signal ling cascade and c-fos immediate early gene transcription. Endocrinology 138:4030-4033 143. Castoria G, Migliaccio A, Bilancio A, Di Domenico M, de Falco A, Lombardi M, Fiorentino R, Varricchio L, Barone MV, Auricchio F 2001 PI3-kinase in concert with Src promotes the S-phase entry of oestradiol-stimulated MCF-7 cells. EMBO J 20:6050-6059 144. Marino M, Acconcia F, Bresci ani F, Weisz A, Trentalance A 2002 Distinct nongenomic signal transducti on pathways controlled by 17beta-estradiol regulate DNA synthesis and cyclin D(1) gene transcription in HepG2 cells. Mol Biol Cell 13:3720-3729 145. Aronica SM, Kraus WL, Katzenellenbogen BS 1994 Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription. Proc Natl Acad Sci U S A 91:8517-8521 146. Nadal A, Ropero AB, Fuentes E, Soria B 2001 The plasma membrane estrogen receptor: nuclear or unclear? Tr ends Pharmacol Sci 22:597-599 147. Razandi M, Pedram A, Greene GL, Levin ER 1999 Cell membrane and nuclear estrogen receptors (ERs) originat e from a single transcript: studies of ERalpha and ERbeta expressed in Chin ese hamster ovary cells. Molecular Endocrinology 13:307-319

PAGE 125

112 148. Filardo EJ, Quinn JA, Bland KI, Frackelton AR, Jr. 2000 Estrogen-induced activation of Erk-1 and Erk-2 requires the G protein-coupled receptor homolog, GPR30, and occurs via trans-activation of the epidermal growth factor receptor through release of HB-EGF. Mo lecular Endocrinology 14:1649-1660 149. Wyckoff MH, Chambliss KL, Mineo C, Yuhanna IS, Mendelsohn ME, Mumby SM, Shaul PW 2001 Plasma membrane estrogen receptors are coupled to endothelial nitric-oxide synthase through Galpha(i). Journal of Biological Chemistry 276:27071-27076 150. Luconi M, Muratori M, Forti G, Baldi E 1999 Identification and characterization of a novel functiona l estrogen receptor on human sperm membrane that interferes with progest erone effects. J C lin Endocrinol Metab 84:1670-1678 151. Monje P, Boland R 1999 Characterization of membrane estrogen binding proteins from rabbit uterus . Mol Cell Endocrinol 147:75-84 152. Li L, Haynes MP, Bender JR 2003 Plasma membrane localization and function of the estrogen receptor alpha variant (E R46) in human endothe lial cells. Proc Natl Acad Sci U S A 100:4807-4812 153. Figtree GA, McDonald D, Watkins H, Channon KM 2003 Truncated estrogen receptor alpha 46-kDa isoform in human endothelial cells: rela tionship to acute activation of nitric oxide s ynthase. Circulation 107:120-126 154. Mendelsohn ME 2000 Nongenomic, ER-mediated ac tivation of endothelial nitric oxide synthase: how does it work? What does it mean? Circ ulation Research 87:956-960 155. Simoncini T, Hafezi-Moghadam A, Brazil DP, Ley K, Chin WW, Liao JK 2000 Interaction of oestrogen recepto r with the regulatory subunit of phosphatidylinositol-3-OH kinase. Nature 407:538-541 156. Sylvia VL, Walton J, Lopez D, Dean DD, Boyan BD, Schwartz Z 2001 17 beta-estradiol-BSA conjugates and 17 beta-estradiol regulate growth plate chondrocytes by common membrane asso ciated mechanisms involving PKC dependent and independent signal transduction. J Cell Biochem 81:413-429 157. Kuroki Y, Fukushima K, Kanda Y, Mizuno K, Watanabe Y 2000 Putative membrane-bound estrogen receptors possibl y stimulate mitogen-activated protein kinase in the rat hippocampus. Eur J Pharmacol 400:205-209 158. Das SK, Taylor JA, Korach KS, Paria BC, Dey SK, Lubahn DB 1997 Estrogenic responses in estr ogen receptor-alpha deficien t mice reveal a distinct estrogen signaling pathway. Proc Natl Acad Sci U S A 94:12786-12791

PAGE 126

113 159. Singh M, Setalo G, Jr., Guan X, Frail DE, Toran-Allerand CD 2000 Estrogeninduced activation of the mitogen-activated protein kinase cascade in the cerebral cortex of estrogen receptor-alpha kno ck-out mice. J Neurosci 20:1694-1700 160. Toran-Allerand CD, Guan X, MacLusky NJ, Horvath TL, Diano S, Singh M, Connolly ES, Jr., Nethrapalli IS, Tinnikov AA 2002 ER-X: a novel, plasma membrane-associated, putative estrogen receptor that is regulated during development and after ischemic br ain injury. J Neurosci 22:8391-8401 161. Kousteni S, Bellido T, Plotkin LI, O'B rien CA, Bodenner DL, Han L, Han K, DiGregorio GB, Katzenellenbogen JA, Katzenellenbogen BS, Roberson PK, Weinstein RS, Jilka RL, Manolagas SC 2001 Nongenotropic, sex-nonspecific signaling through the estrogen or andr ogen receptors: dissociation from transcriptional ac tivity. Cell 104:719-730 162. Razandi M, Alton G, Pedram A, Ghonshani S, Webb P, Levin ER 2003 Identification of a structural determin ant necessary for the localization and function of estrogen receptor alpha at the plasma membrane. Mol Cell Biol 23:1633-1646 163. Evinger AJ, III, Levin ER 2005 Requirements for estrogen receptor alpha membrane localization and function. Steroids 70:361-363 164. Karin M 1995 The regulation of AP-1 activ ity by mitogen-activated protein kinases. Journal of Biological Chemistry 270:16483-16486 165. Dos Santos EG, Dieudonne MN, Pecquery R, Le M, V, Giudicelli Y, Lacasa D 2002 Rapid nongenomic E2 effects on p42/ p44 MAPK, activator protein-1, and cAMP response element binding protein in rat white adipocytes. Endocrinology 143:930-940 166. Bjornstrom L, Sjoberg M 2005 Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic ac tions on target genes. Molecular Endocrinology 19:833-842 167. Nirmala PB, Thampan RV 1995 Ubiquitination of th e rat uterine estrogen receptor: dependence on estradiol. Biochem Biophys Res Commun 213:24-31 168. Pakdel F, Le Goff P, Katzenellenbogen BS 1993 An assessment of the role of domain F and PEST sequences in estroge n receptor half-life and bioactivity. J Steroid Biochem Mol Biol 46:663-672 169. Kenealy MR, Flouriot G, Sonntag-Buck V, Dandekar T, Brand H, Gannon F 2000 The 3'-untranslated region of the human estrogen receptor alpha gene mediates rapid messenger ribonucleic acid turnover. Endocrinology 141:28052813

PAGE 127

114 170. Nawaz Z, Lonard DM, Denni s AP, Smith CL, O'Malley BW 1999 Proteasome-dependent degradation of th e human estrogen receptor. Proc Natl Acad Sci U S A 96:1858-1862 171. Preisler-Mashek MT, Solodin N, Stark BL, Tyriver MK, Alarid ET 2002 Ligand-specific regulation of proteasome -mediated proteolysis of estrogen receptor-alpha. Am J Physiol Endocrinol Metab 282:E891-E898 172. Tschugguel W, Dietrich W, Zhegu Z, Stonek F, Kolbus A, Huber JC 2003 Differential regulation of proteasome-depe ndent estrogen recept or alpha and beta turnover in cultured human uterine artery endothelial cells. J Clin Endocrinol Metab 88:2281-2287 173. MacGregor JI, Jordan VC 1998 Basic guide to the mechanisms of antiestrogen action. Pharmacol Rev 50:151-196 174. Hermenegildo C, Cano A 2000 Pure anti-oestrogens. Hum Reprod Update 6:237-243 175. Furr BJ, Jordan VC 1984 The pharmacology and clinical uses of tamoxifen. Pharmacol Ther 25:127-205 176. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753-758 177. Wakeling AE, Dukes M, Bowler J 1991 A potent specific pu re antiestrogen with clinical potential. Cancer Res 51:3867-3873 178. Howell A, Osborne CK, Morris C, Wakeling AE 2000 ICI 182,780 (Faslodex): development of a novel, "pure" antiestrogen. Cancer 89:817-825 179. Tremblay A, Tremblay GB, Labrie C, Labrie F, Giguere V 1998 EM-800, a novel antiestrogen, acts as a pure antagonist of the transcrip tional functions of estrogen receptors alpha and beta. Endocrinology 139:111-118 180. Wakeling AE 1995 Use of pure antioestrogens to elucidate the mode of action of oestrogens. Biochem Pharmacol 49:1545-1549 181. Pink JJ, Jordan VC 1996 Models of estrogen receptor regulation by estrogens and antiestrogens in breast cancer cell lines. Cancer Res 56:2321-2330 182. Sabbah M, Gouilleux F, Sola B, Redeuilh G, Baulieu EE 1991 Structural differences between the hormone and antih ormone estrogen receptor complexes bound to the hormone response element. Proc Natl Acad Sci U S A 88:390-394 183. Dauvois S, White R, Parker MG 1993 The antiestrogen ICI 182780 disrupts estrogen receptor nucleocytoplasmic shu ttling. J Cell Sci 106 ( Pt 4):1377-1388

PAGE 128

115 184. Parker MG 1993 Action of "pure" antiestrogens in inhibiting estrogen receptor action. Breast Cancer Res Treat 26:131-137 185. Howell A 2000 Faslodex (ICI 182780). an oestrogen receptor downregulator. Eur J Cancer 36 Suppl 4:S87-S88 186. Dauvois S, Danielian PS, White R, Parker MG 1992 Antiestrogen ICI 164,384 reduces cellular estrogen receptor conten t by increasing its turnover. Proc Natl Acad Sci U S A 89:4037-4041 187. Gibson MK, Nemmers LA, Beckman WC, Jr., Davis VL, Curtis SW, Korach KS 1991 The mechanism of ICI 164,384 antiest rogenicity involves rapid loss of estrogen receptor in uterine tissue. Endocrinology 129:2000-2010 188. Wakeling AE, Bowler J 1988 Biology and mode of action of pure antioestrogens. J Ster oid Biochem 30:141-147 189. Long BJ, Tilghman SL, Yue W, Thiant anawat A, Grigoryev DN, Brodie AM 1998 The steroidal antiestrogen ICI 182,780 is an inhibitor of cellular aromatase activity. J Steroid Biochem Mol Biol 67:293-304 190. DeFriend DJ, Howell A, Nicholson RI, A nderson E, Dowsett M, Mansel RE, Blamey RW, Bundred NJ, Robertson JF, Saunders C, . 1994 Investigation of a new pure antiestrogen (ICI 182780) in women with primar y breast cancer. Cancer Res 54:408-414 191. Cicatiello L, Addeo R, Altucci L, Belsito P, V, Boccia V, Cancemi M, Germano D, Pacilio C, Salzano S, Bresciani F, Weisz A 2000 The antiestrogen ICI 182,780 inhibits proliferation of human breast cancer cells by interfering with multiple, sequential estrogen-regulated processes required for cell cycle completion. Mol Cell Endocrinol 165:199-209 192. Robertson JF, Harrison M 2004 Fulvestrant: pharmacokinetics and pharmacology. Br J Cancer 90 Suppl 1:S7-10 193. Anderson ABM, Flint AP, Turnbull AC 1975 Mechanism of activation of glucocorticoids in induction of ovine parturition: Effect on placental steroid metabolism. Journal of Endocrinology 66:61-70 194. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408 195. Lehman MN, Ebling FJP, Moenter SM, Karsch FJ 1993 Distribution of estrogen receptor-immunoreactive cells in the sheep brain. Endocrinology 133:876-886

PAGE 129

116 196. Deitch HR, Mershon JL, Clark KE 2001 Estrogen receptor beta is the predominant isoform expressed in the br ain of adult and fetal sheep. American Journal of Obstetrics and Gynecology 184:1077-1079 197. Shughrue PJ, Lane MV, Merchenthaler I 1997 Comparative distribution of estrogen receptor-alpha a nd -beta mRNA in the rat central nervous system. J Comp Neurol 388:507-525 198. Simerly RB, Chang C, Muramatsu M, Swanson LW 1990 Distribution of androgen and estrogen receptor mRNA-containing cells in the rat brain: an in situ hybridization study. J Comp Neurol 294:76-95 199. Mitra SW, Hoskin E, Yudkovitz J, Pear L, Wilkinson HA, Hayashi S, Pfaff DW, Ogawa S, Rohrer SP, Schaeffer JM, McEwen BS, Alves SE 2003 Immunolocalization of estrogen receptor beta in the mouse brain: comparison with estrogen receptor alpha. Endocrinology 144:2055-2067 200. Warembourg M, Leroy D 2004 Comparative distribut ion of estrogen receptor alpha and beta immunoreactivities in the fo rebrain and the midbrain of the female guinea pig. Brain Res 1002:55-66 201. Challis JRG 1971 Sharp increase in free circ ulating oestrogen immediately before parturition in sheep. Nature 229:208 202. Wood CE, Saoud CJ, Stoner TA, Keller-Wood M 2001 Estrogen and androgen influence hypothalamic AVP and CRF con centrations in fetal and adult sheep. Regul Pept 98:63-68 203. Miller BG, Wild J, Stone GM 1979 Effects of progest erone on the oestrogenstimulated uterus: a comparative study of the mouse, guinea pig, rabbit and sheep. Aust J Biol Sci 32:549-560 204. Ing NH, Tornesi MB 1997 Estradiol up -regulates estrog en receptor and progesterone receptor gene expression in specific ovine uterine cells. Biology of Reproduction 56:1205-1215 205. Ott TL, Zhou Y, Mirando MA, Stevens C, Harney JP, Ogle TF, Bazer FW 1993 Changes in progesterone and oestr ogen receptor mRNA and protein during maternal recognition of pregnancy and luteolysis in ewes. J Mol Endocrinol 10:171-183 206. Ing NH, Ott TL 1999 Estradiol up-regulates estrogen receptor-alpha messenger ribonucleic acid in sheep endometrium by increasing its stability. Biology of Reproduction 60:134-139 207. Saceda M, Lippman ME, Lindsey RK, Puente M, Martin MB 1989 Role of an estrogen receptor-dependent mechanism in the regulation of estrogen receptor mRNA in MCF-7 cells. Molecu lar Endocrinology 3:1782-1787

PAGE 130

117 208. Kaneko KJ, Furlow JD, Gorski J 1993 Involvement of the coding sequence for the estrogen receptor gene in autologous ligand-dependent down-regulation. Molecular Endocrinology 7:879-888 209. Ottaviano YL, Issa JP, Parl FF, Smith HS, Baylin SB, Davidson NE 1994 Methylation of the estrogen receptor gene CpG island marks loss of estrogen receptor expression in human breast cancer cells. Cancer Res 54:2552-2555 210. Stoffel-Wagner B 2003 Neurosteroid biosynthesis in the human brain and its clinical implications. Annals New York Academy of Sciences 1007:64-78 211. Baulieu EE, Robel P 1990 Neurosteroids: a new brain function? J Steroid Biochem Mol Biol 37:395-403 212. Tsutsui K, Sakamoto H, Ukena K 2003 A novel aspect of the cerebellum: biosynthesis of neurosteroids in th e Purkinje cell. Cerebellum 2:215-222 213. Wood CE, Cudd TA, Kane C, Engelke K 1993 Fetal ACTH and blood pressure responses to thromboxane mimetic U 46619. American Journal of Physiology 265:R858-R862 214. Wood CE, Chen H-G, Bell ME 1989 Role of vagosympathetic fibers in the control of adrenocorticotropic hormone, vasopressin, and renin responses to hemorrhage in fetal sheep. Ci rculation Research 64:515-523 215. Bassett JM, Thorburn GD 1969 Foetal plasma corticosteroids and the initiation of parturition in sheep. J Endocrinol 44:285-286 216. Wintour EM, Brown EH, Denton DA, Hardy KJ, McDougall JG, Oddie CJ, Whipp GT 1975 The ontogeny and regulation of corticosteroid secretion by the ovine foetal adrenal. Acta Endocrinologica 79:301-316 217. Challis JRG, Patrick JE 1981 Fetal and maternal estrogen concentrations throughout pregnancy in the sheep. Ca nadian Journal of Physiology and Pharmacology 59:970-978 218. Decavel C, Van den Pol AN 1990 GABA: a dominant neurotransmitter in the hypothalamus. J Comp Neurol 302:1019-1037 219. Cullinan WE 2000 GABA(A) receptor s ubunit expression within hypophysiotropic CRH neurons: a dual hybr idization histochemical study. J Comp Neurol 419:344-351 220. Plotsky PM, Otto S, Sutton S 1987 Neurotransmitter modulation of corticotropin releasing factor secretion into the hypophysial-portal circulation. Life Sci 41:1311-1317

PAGE 131

118 221. Calogero AE, Gallucci WT , Chrousos GP, Gold PW 1988 Interaction between GABAergic neurotransmission and rat hypothalamic corticot ropin-releasing hormone secretion in vitro. Brain Res 463:28-36 222. Hillhouse EW, Milton NG 1989 Effect of noradrenaline and gammaaminobutyric acid on the secretion of co rticotrophin-releas ing factor-41 and arginine vasopressin from the rat hy pothalamus in vitro. J Endocrinol 122:719723 223. Makara GB, Stark E 1974 Effects of gamma-aminobutyric acid (GABA) and GABA antagonist drugs on ACTH re lease. Neuroendocrinology 16:178-190 224. Belelli D, Lambert JJ 2005 Neurosteroids: endo genous regulators of the GABA(A) receptor. Nat Rev Neurosci 6:565-575 225. Burgess LH, Handa RJ 1992 Chronic estrogen-induced alterations in adrenocorticotropin and corticosterone s ecretion, and glucocorticoid receptormediated function in female rats. Endocrinology 131:1261-1269 226. Ni X, Nicholson RC, King BR, Chan EC, Read MA, Smith R 2002 Estrogen represses whereas the estrogen-antagoni st ICI 182780 stimulates placental CRH gene expression. J Clin E ndocrinol Metab 87:3774-3778 227. Ni X, Hou Y, King BR, Tang X, Read MA, Smith R, Nicholson RC 2004 Estrogen receptor-mediated down-regulati on of corticotropin-releasing hormone gene expression is dependent on a cyclic adenosine 3',5'-monophosphate regulatory element in human placenta l syncytiotrophoblast cells. J Clin Endocrinol Metab 89:2312-2318 228. Haas DA, George SR 1989 Estradiol or ovariectomy decreases CRF synthesis in hypothalamus. Brain Research Bulletin 23:215-218 229. Paulmyer-Lacroix O, Hery M, Pugeat M, Grino M 1996 The modulatory role of estrogens on corticotropin -releasing factor gene expression in the hypothalamic paraventricular nucleus of ovariectomized rats: role of the adrenal gland. J Neuroendocrinol 8:515-519 230. Broad KD, Keverne EB, Kendrick KM 1995 Corticotrophin releasing factor mRNA expression in the sheep brain duri ng pregnancy, parturition and lactation and following exogenous progesterone and oestrogen treatment. Brain Res Mol Brain Res 29:310-316 231. Roy BN, Reid RL, VanVugt DA 1999 The effects of estrogen and progesterone on corticotropin-releasing hormone and arginine vasopressin messenger ribonucleic acid levels in the paraventricu lar nucleus and supraoptic nucleus of the rhesus monkey. Endocrinology 140:2191-2198

PAGE 132

119 232. Lund TD, Munson DJ, Haldy ME, Handa RJ 2004 Androgen inhibits, while oestrogen enhances, restraint-induced ac tivation of neuropeptide neurones in the paraventricular nucleus of the hypot halamus. J Neuroendocrinol 16:272-278 233. Liu JP, Robinson PJ, Funder JW, Engler D 1990 The biosynthesis and secretion of adrenocorticotr opin by the ovine anterior p ituitary is predominantly regulated by arginine va sopressin (AVP). Journal of Biological Chemistry 265:14136-14142 234. Treiser SL, Wardlaw SL 1992 Estradiol regulation of proopiomelanocortin gene expression and peptide content in th e hypothalamus. Neuroendocrinology 55:167173 235. Wilcox JN, Roberts JL 1985 Estrogen decreases rat hypothalamic proopiomelanocortin messenger ribonucle ic acid levels. Endocrinology 117:23922396 236. Tong Y, Zhao HF, Labrie F, Pelletier G 1990 Regulation of proopiomelanocortin messenger ribonucleic acid content by sex steroids in the arcuate nucleus of the female rat brain. Neurosci Lett 112:104-108 237. Schwartz J, Kleftogiannis F, Jacobs R, Thorburn GD, Crosby SR, White A 1995 Biological activity of adrenocortic otropic hormone precursors on ovine adrenal cells. Am J Physiol 268:E623-E629 238. Zhou A, Bloomquist BT, Mains RE 1993 The prohormone convertases PC! and PC2 mediate distinct endoprot eolytic cleavages in a stri cy temporal order during proopiomelanocortin biosynthetic proce ssing. Journal of Biological Chemistry 268:1763-1769 239. Ballard PL, Ning Y, Polk D, Ikegami M, Jobe AH 1997 Glucocorticoid regulation of surfactant components in im mature lambs. American Journal of Physiology 273:L1048-L1057 240. Parker MG, Arbuckle N, Dauvoi s S, Danielian P, White R 1993 Structure and function of the estrogen receptor. An nals New York Academy of Sciences 684:119-126 241. Toran-Allerand CD 2004 Minireview: A plethora of estrogen receptors in the brain: where will it end? Endocrinology 145:1069-1074

PAGE 133

120 BIOGRAPHICAL SKETCH Christine Elaine Schaub was born April 11, 1978 and raised in ru ral Maryland. She developed an interest in science at a young age and, after her 1996 high school graduation, went on to pursue a bachelorÂ’s degree in biol ogy from Franklin and Marshall College in Lancaster, Pennsylvania. She gr aduated with honors in biology in May 2000, and worked as a research assistant at the Natio nal Institutes of Health for 1 year before beginning graduate school. Christine began he r graduate studies at the University of Florida College of Medicine in August 2001. Her dissertation work was completed with Dr. Charles Wood in the Department of P hysiology, where she studied the effects of estradiol on the fetal brain. Christine wa s supported in her graduate studies by a scholarship through the Health Services Co llegiate Program with the U.S. Navy. She received her Ph.D. in December 2005 and be gan post-doctoral work in March at the Naval Medical Research Cent er in Silver Spring, MD.