Citation
Novel Method for Detecting Human Polyomaviruses in Environmental Waters as an Indicator of Human Sewage Pollution

Material Information

Title:
Novel Method for Detecting Human Polyomaviruses in Environmental Waters as an Indicator of Human Sewage Pollution
Creator:
MCQUAIG, SHANNON M.
Copyright Date:
2008

Subjects

Subjects / Keywords:
Bacteroides ( jstor )
BK virus ( jstor )
DNA ( jstor )
Fecal coliforms ( jstor )
Humans ( jstor )
Polymerase chain reaction ( jstor )
Sewage ( jstor )
Viruses ( jstor )
Water pollution ( jstor )
Water samples ( jstor )
City of Gainesville ( local )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Shannon M. McQuaig. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/31/2006
Resource Identifier:
495636986 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

NOVEL METHOD FOR DETECTING HUMAN POLYOMAVIRUSES IN ENVIRONMENTAL WATERS AS AN INDICATOR OF HUMAN SEWAGE POLLUTION By SHANNON M. MCQUAIG A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Shannon M. McQuaig

PAGE 3

To my mom, my dad, and my uncle Jimmy.

PAGE 4

ACKNOWLEDGMENTS I acknowledge my advisor Dr. Farrah for his guidance throughout my undergraduate and graduate studies. He was always supportive and encouraging. I also acknowledge my supervisory committee members, Dr. Keyhani and Dr. Kima. In addition, I would like to thank the entire Department of Microbiology and Cell Science. I thank Gainesville Regional Utilities (GRU) and CH2M Hill for allowing me to incorporate my work into their project and also for funding a part of this study. I specially thank Dr. Troy Scott. He is a great teacher, colleague, and (most of all) friend. Without his help and support this would not been possible. I thank Dr. George Lukasik for his supervision and expertise. I also extend my appreciation to Joel Caren for his help with the GRU samples. I would like to acknowledge my fellow graduate student, Johnny Davis, and our dishwasher and my best friend, Rene Nortman. They both made every day in the lab fun and entertaining. I also acknowledge my friend Kindra Kelly, who was always willing to lend an ear. I thank Adam Mayer for his support, understanding, and comic relief; and for being a much-needed distraction during the most stressful time of my graduate study: the end. Lastly, I thank my parents, Kathy and Gary McQuaig; and my uncle, James McQuaig. They gave me the love and foundation needed to accomplish everything that I have, and for that I will always be grateful. iv

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...........................................................................................................viii LIST OF FIGURES.............................................................................................................x ABSTRACT.......................................................................................................................xi CHAPTER 1 INTRODUCTION........................................................................................................1 Human Pathogenic Bacteria Spread via Fecal-Oral Route...........................................1 Escherichia coli.....................................................................................................1 Shigella..................................................................................................................2 Salmonella.............................................................................................................3 Vibrio.....................................................................................................................3 Campylobacter......................................................................................................4 Human Pathogenic Viruses Spread via Fecal-Oral Route............................................4 Adenovirus............................................................................................................4 Enterovirus............................................................................................................5 Hepatitis A.............................................................................................................5 Rotavirus................................................................................................................6 Norovirus...............................................................................................................6 Human Pathogenic Protozoan Spread via Fecal-Oral Route........................................7 Entamoeba histolytica...........................................................................................7 Giardia lambia......................................................................................................7 Cryptosporidium parvum.......................................................................................8 Water Regulations........................................................................................................8 Water Quality Indicators...............................................................................................9 Chemical Indicators of Fecal Pollution.................................................................9 Coprostanol....................................................................................................9 Caffeine........................................................................................................10 Whitening agents..........................................................................................10 Microbial Indicators of Fecal Pollution...............................................................10 Traditional microbial water quality indicators.............................................10 Microbial source tracking.............................................................................12 v

PAGE 6

Viruses Shed in Urine..........................................................................................21 Polyomaviruses............................................................................................21 Human polyomaviruses................................................................................21 Purpose of Study..................................................................................................23 Experimental Rationale.......................................................................................23 2 DETECTION OF HUMAN POLYOMAVIRUSES IN BOTH SEWAGE AND SEPTIC TANK SAMPLES AND THE ABSENCE OF HUMAN POLYOMAVIRUSES IN DAIRY WASTE..............................................................24 Materials and Methods...............................................................................................24 Collection of Samples..........................................................................................24 DNA Extraction..........................................................................................................25 PCR Detection of HPyVs....................................................................................25 Gel Electrophoresis of PCR Products..................................................................26 Excision of PCR Products from Agarose Gels....................................................26 Cloning of PCR Product......................................................................................26 Plasmid Isolation.................................................................................................27 Restriction Enzyme Analysis of Plasmids and DNA Sequencing.......................27 Sequence Analysis of PCR Product....................................................................27 Limit of Detection of PCR for HPyVs in Sewage...............................................27 Results.........................................................................................................................28 Discussion...................................................................................................................28 3 DEVELOPMENT OF A METHOD TO CONCENTRATE AND DETECT HUMAN POLYOMAVIRUSES FROM WATER SAMPLES.................................34 Materials and Methods...............................................................................................35 Sample Collection...............................................................................................35 Sample Preparation..............................................................................................36 Virus Concentration on Micropourous Filters.....................................................36 QIAamp DNA Stool Kit (Qiagen, Inc., Valencia, CA).......................................36 QIAamp Viral RNA Kit (Qiagen, Inc., Valencia, CA).......................................36 QIAamp MinElute Kit (Qiagen, Inc., Valencia, CA)..........................................37 QIAamp Blood DNA Midi Kit (Qiagen, Inc., Valencia, CA).............................37 HPyV Enzymatic Conditions:.............................................................................37 Agarose Gel Electrophoresis...............................................................................38 SYBR-Gold Viral Direct Counts.........................................................................38 Range of Detection..............................................................................................39 Results.........................................................................................................................39 Discussion...................................................................................................................40 vi

PAGE 7

4 HUMAN POLYOMAVIRUSES AS INDICATORS OF HUMAN-DERIVED FECAL POLLUTION IN ENVIRONMENTAL WATER SAMPLES: THREE DIFFERENT INDICATORS OF HUMAN FECAL POLLUTION IN JACKSONVILLE AREA CANALS AND CREEKS................................................44 Materials and Methods...............................................................................................44 Sample Collection...............................................................................................44 Processing of Samples for Bacteroides Marker..................................................45 Preparation of Bacteroidetes template DNA for PCR reactions..................45 PCR primers and reaction conditions for Human Bacteroides marker detection..................................................................................................45 Processing of Samples for esp Detection............................................................46 Isolation of enterococci................................................................................46 PCR primers and reaction conditions...........................................................46 Processing of Samples for HPyV Detection........................................................47 Prefiltration of samples................................................................................47 Virus concentration on micropourous filters................................................47 DNA extraction............................................................................................47 HPyV enzymatic conditions.........................................................................47 Results.........................................................................................................................48 Discussion...................................................................................................................53 5 HUMAN POLYOMAVIRUSES AS INDICATORs OF HUMAN-DERIVED FECAL POLLUTION IN ENVIRONMENTAL WATER SAMPLES: FECAL INDICATORS IN GAINESVILLE'S URBAN CREEKS.........................................55 Materials and Methods...............................................................................................56 Sample Collection...............................................................................................56 Processing of Samples for Total Coliforms.........................................................56 Processing of Samples for Fecal Coliforms........................................................56 Processing of Samples for Enterococci...............................................................57 Processing of Samples for esp Detection............................................................57 Processing of Samples for HPyV Detection........................................................57 Results.........................................................................................................................57 Discussion...................................................................................................................58 6 SUMMARY AND CONCLUSIONS.........................................................................64 LIST OF REFERENCES...................................................................................................68 BIOGRAPHICAL SKETCH.............................................................................................83 vii

PAGE 8

LIST OF TABLES Table page 2-1 Primers used to amplify the homologous t-antigen of BKV and JCV.*..................29 2-2 HPyV detection in septic tank, raw sewage and dairy waste throughout a nine month period.*.........................................................................................................29 2-3 Detection of HPyVs in raw sewage from the University of Florida Water Reclamation Facility.*.............................................................................................30 3-1 Concentration and detection of HPyVs in water inoculated with sewage.*............42 3-2 Direct counts of BKV using SYBR-Gold staining epifluorescence microscopy.....42 4-1 Sampling sites for Jacksonville area study...............................................................49 4-2 Results of 11/15/04 analysis for markers of human fecal pollution.........................49 4-3 Results of 12/13/04 analysis for markers of human fecal pollution.........................50 4-4 Results of 1/10/05 analysis for markers of human fecal pollution...........................50 4-5 Results of 2/8/05 analysis for markers of human fecal pollution.............................51 4-6 Results of 3/14/05 analysis for markers of human fecal pollution...........................51 4-7 Results of 4/18/05 analysis for markers of human fecal pollution...........................52 4-8 Results of 6/7/05 analysis for markers of human fecal pollution.............................52 4-9 Percent positive correlation of the three indicators used to identify human fecal pollution...................................................................................................................53 5-1 Results of October 2004 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs.......................................................60 5-2 Results of November 2004 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs...................................61 5-3 Results of January 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs.......................................................62 viii

PAGE 9

5-4 Results of February 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs...................................62 5-5 Results of June 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs.......................................................63 5-6 Guidelines for total coliforms, fecal coliforms, E . coli, and enterococci in surface waters.*........................................................................................................63 ix

PAGE 10

LIST OF FIGURES Figure page 2-1 Gel electrophoresis of human and dairy cow waste samples: a) 100 bp molecular ladder , b) Negative control, c) and e) Raw sewage samples, d) Dairy cow waste sample, f) BK virus positive control........................................................................31 2-2 Sequencee of plasmid SA.........................................................................................31 2-3 Sequence of plasmid SC...........................................................................................32 2-4 Sequence alignments of plasmid SA and published BK polyomavirus strain As (GENBANK) . Similarities are highlighted in yellow.............................................33 2-5 Sequence alignments of plasmid SC and published BK polyomavirus isolate BKV HC-u9 (GENBANK) . Similarities are highlighted in yellow........................33 3-1 Approximately 3 x 108 BKV virus stained with SYBR-Gold and viewed using 1000X magnification on an epifluorescence microscope with blue excitation........43 x

PAGE 11

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science NOVEL METHOD FOR DETECTING HUMAN POLYOMAVIRUSES IN ENVIRONMENTAL WATERS AS AN INDICATOR OF HUMAN SEWAGE POLLUTION By Shannon M. McQuaig December 2005 Chair: Samuel R. Farrah Major Department: Microbiology and Cell Science Federal and state regulatory agencies mandate the use of fecal coliforms, E. coli and/or Enterococci as microbial indicators of water quality. However, these traditional indicators of fecal pollution do not adequately assess the specific sources of pollution or the associated health risks. Many methods have been developed to identify sources of fecal contamination. This field of study has been collectively termed Microbial Source Tracking (MST). My study proposes the use of human-specific polyomaviruses (HPyVs), JCV and BKV, as indicators of human fecal pollution. The HPyVs are ubiquitous throughout the human population and serological studies speculate that 60 to 80% of adults harbor antibodies against HPyVs. They are secreted in the urine in high titers and mostly cause asymptomatic infections. Infected individuals shed viruses throughout their life span. xi

PAGE 12

A rapid and sensitive method was developed and optimized to concentrate and extract DNA of HPyVs from environmental water samples. Primers specific for the conserved t-antigen of both JCV and BKV were used in a nested PCR reaction to detect HPyVs. The method was able to detect viruses in as little as one microliter of raw sewage. Environmental samples were assayed for the presence of HPyVs as indicators of human fecal pollution. Samples were also screened for the presence of two additional molecular markers of human fecal pollution; the Enterococcus faecium esp gene described by Scott et al (2004), and a human-specific target in Bacteroides-Prevotella developed by Bernhard and Field (2000). In addition, a part of this study compared the presence of human-specific indicators of fecal pollution to total and fecal coliform counts and enterococci counts. All three markers were consistently detected in raw sewage. In environmental samples, one or more of the markers were detected in all of the samples suspected of containing human fecal impact. Specifically, HPyVs were detected in 100% of samples in which the Enterococcus faecium esp gene and Bacteroides-Prevotella human markers were found. No correlation was observed between the presence of human-specific indicators and high bacteriological counts. Data indicate the developed method for HPyVs detection has the sensitivity required to be a reliable predicator of human fecal pollution in environmental waters. xii

PAGE 13

CHAPTER 1 INTRODUCTION Identifying human fecal pollution in waters used for human recreation, fish breeding, or shellfish harvesting is necessary to reduce the potential of human contact with enteric pathogens. Waters contaminated with human fecal matter have the capability to pose serious health risks for shellfish consumers and swimmers, and tremendous economic losses for shellfish harvesters and businesses near beaches (Scott et al. 2002b). A large number of human pathogens may be spread by the fecal-oral route. Infections with these pathogens can produce mild to serious consequences and may even be fatal. The clinical symptoms associated with infections with enteric pathogens can be intestinal symptoms (ranging from abdominal cramps to acute gastroenteritis to bloody diarrhea) or extraintestinal symptoms (that can include fever, headache, and jaundice following liver infections). The following is a brief overview of some common bacterial, viral and protozoan pathogens spread by the fecal-oral route. Human Pathogenic Bacteria Spread via Fecal-Oral Route Escherichia coli Escherichia coli (E. coli) are part of the Enterobacteriaceae family. This gram-negative bacilli is a part of the intestinal flora of both humans and other warm-blooded animals (Brenner 1984). E. coli can range from nonpathogenic to virulent strains, depending on their virulence factors, such as the production of toxins and adhesion molecules. There are several strains that have virulence factors and cause diarrhea including enterotoxigenic (ETEC), enteropathogenic (EPEC), enterohemorrhagic 1

PAGE 14

2 (EHEC), enteroinvasive (EIEC), and enteroaggregative (EAggEC) (Thielman and Guerrant, 2004). The most serious strain of E. coli is the virulent enterohemorrhagic (EHEC) strain 0157:H7. Ingestion of less than 100 bacillli can cause infection with severe bloody diarrhea and abdominal cramps (Murray et al. 2002; Nicholls et al. 2000). Children under 5 years old and the elderly who become infected with 0157:H7 are particularly susceptible to kidney failure (hemolytic uremic syndrome). For the most part E. coli, is harmless, and the presence of E. coli in water samples has been used as an indication of fecal pollution. Traditional methods for detecting E. coli rely on its ability to ferment lactose with the production of acid and gas. Detection of E. coli can also be accomplished by polymerase chain reaction (PCR), or probe hybridization; or biochemically, by the inability to metabolize methyllumbelliferyl--D-glucuronide (MUG) (Lior and Borczyk 1987) or to ferment sorbitol (March and Ratnam 1986). Shigella Shigella spp. are also a part of the Enterobacteriaceae family. These organisms are gram-negative, non-motile bacilli. Four species of Shigella have been isolated and described; S. dysenteriae, S. flexneri, S. boydii, and S. sonnei (Murray et al. 2002). S. sonnei are responsible for most the infections in developed countries, S. flexneri are responsible for most the infections in developing countries, S. dysenteriae are responsible for the most severe infections, and S. boydii are rarely isolated (Murray et al. 2002). Approximately 70% of all Shigella infections occur in children younger than 15 years old, and infection can establish from as few as 200 bacilli (Murray et al. 2002). Shigella produce 3 characteristic toxins including the Shigella enterotoxin 1 and 2; and a

PAGE 15

3 phage-born Shiga toxin (Murray et al. 2002). Shigella has the ability to invade M cells and colonize the intestinal epithelium of the intestinal tract. Toxins adhere to receptors in the small intestines, and block absorption of electrolytes, glucose, and amino acids causing watery diarrhea (Niyogi 2005). Shigella can be detected using various methods including immunocapture PCR (Peng et al. 2002), immunomagentic isolation and PCR (Islam and Lindberg 1992). Salmonella Salmonella spp. (like E. coli and Shigella spp.) are in the family Enterobacteriaceae and are gram-negative bacilli. These organisms can colonize humans, domestic animals, birds, reptiles, livestock, and rodents (Murray et al. 2002). After ingestion by humans, Salmonella invade the M cells and can cause chronic colonization, enteritis, or enteric fever (typhoid fever). Salmonella enterica can cause fever, abdominal cramps, vomiting, and nonbloody diarrhea (Murray et al. 2002). Although many Salmonella spp. infections are limited to the gastrointestinal tract, S. typhi produces a generalized infection (typhoid fever). Traditional methods used to detect Salmonella spp. in clinical and environmental samples are tedious and labor-intensive. Detection methods usually include the use of pre-enrichment, enrichment, plating on selective and differential media, and finally, confirmation of isolates as Salmonella spp. using biochemical and immunological tests. Different molecular methods have been used to detect Salmonella, including immunomagnetic isolation (Yu et al. 1996) and PCR-based assays (Nam et al. 2005). Vibrio All Vibrio species are curved bacilli that have the ability to grow naturally in estuarine and marine environments. Vibrio cholerae is the most well-known of the

PAGE 16

4 Vibrio species and is the causative agent of cholera (Murray et al. 2002). Infection with V. cholerae can cause severe watery diarrhea, electrolyte imbalance and can lead to death from dehydration. Standard methods exist for the concentration and detection of Vibrio species from water samples (Section 9260H). Vibrio spp. can also be enriched from clinical, water and food samples using Alkaline Peptone Water a high pH. The media contains 2% (w/v) sodium chloride, which promotes the growth of Vibrio and the high pH inhibits growth of most unwanted background flora (Cruickshank 1968). Campylobacter The genus of Campylobacter consists of motile, small, curved gram-negative bacilli, that have a polar flagellum (Murray et al. 2002). C. jejuni is the most common Campylobacter species found in the United States. C. jejuni can infect poultry, livestock, domestic animals and humans. In humans, clinical symptoms are normally gastroenteritis. Campylobacter can be detected in water using concentration of samples followed by selection on specific media or by molecular assays including PCR (Waage et al. 1999). Human Pathogenic Viruses Spread via Fecal-Oral Route Adenovirus Adenoviruses are approximately 90-100 nm in diameter and have a double-stranded DNA genome (Murray et al. 2002). Adenoviruses can cause a range of effects including respiratory illness to gastroenteritis. Adenoviruses year-round and are frequently found in raw sewage (He and Jiang 2005). Two types of Adenoviruses (types 40 and 41) are the most frequently detected enteric adenoviruses. Various methods have

PAGE 17

5 been developed to detect Adenoviruses in water, including integrated cell culture and PCR-based methods (He and Jiang 2005). Enterovirus Enteroviruses have single-stranded RNA genomes surrounded by an icosahedral capsid (Murray et al. 2002). The enterovirus capsids are approximately 30 nm in diameter, and have the ability to resist a pH as low as 3, enabling them to withstand the conditions of the gastrointestinal tract (Murray et al. 2002). Polioviruses, coxsackieviruses, and echoviruses are all serotypes of enteroviruses. Enteroviruses have a seasonal occurrence, and are most prevalent during summer and fall (Skraber et al. 2004). These viruses are primarily transmitted by the fecal-oral route; however infections with enteroviruses are unapparent and usually do not lead to intestinal symptoms. However, extra-intestinal infection may be established in organs such as the nervous system, heart, and skin (Murray et al. 2002). These viruses can replicate in the alimentary canal and be shed asymptomically for up to a month after infection (Murray et al. 2002). Enteroviruses can be detected using absorption-elution techniques combined with cell culture (Clesceri et al. 1998;Kittigul et al. 2000), Reverse Transcriptase PCR (RT-PCR), or integrated cell culture/PCR methods (Reynolds et al. 2001). Hepatitis A Hepatitis A virus has a single-stranded RNA genome surrounded by a naked icosahedral capsid. The capsid is approximately 27 nm in diameter. Hepatitis A is stable at a pH of 1.0. Hepatitis A is classified as an Enterovirus but differs from the other enteroviruses in some ways. It is more heat-resistant than most other enteroviruses and causes weak or no cytopathic effects (CPE) in cell culture. The Hepatitis A virus is usually acquired by ingestion, and enters the bloodstream, and establishes infection in the

PAGE 18

6 liver. Viruses produced in the liver are released in bile and thus can be isolated from stool in high titers (Murray et al. 2002). People infected with Hepatitis A may experience fever, fatigue, nausea, abdominal pain, and jaundice. Complete recovery is observed in 99% of patients. Detection of Hepatitis A is similar to detection methods used for enteroviruses. However RT-PCR is the current preferred method of detection (Kingsley and Richards 2001; Kittigul et al. 2000). Rotavirus Rotaviruses have double-stranded RNA genomes comprised of 11 segments. These viruses have a non-enveloped double-layered protein capsid that is approximately 60 to 80 nm in diameter (Murray et al. 2002). The virus is stable at a pH ranging from 3.5 to 10, which allows the virus to survive the acidic environment of the stomach. Once inside the small intestines, Rotaviruses absorb to the columnar cells and begin replication, and as much as 1010 viral particles per gram of stool can be shed at the height of disease (Murray et al. 2002). Rotaviruses are the leading cause of severe gastroenteritis in children worldwide (Widdowson et al. 2005). Rotaviruses are most commonly detected in water by concentration using filtration then Reverse Transcriptase PCR assay (Kittigul et al. 2005). Norovirus Noroviruses have single-stranded RNA genomes surrounded by a non-enveloped capsid. Formerly known as Norwalk-like Viruses, Noroviruses have 4 genogroups including GI, GII, GIII, and GIV (Skraber et al. 2004). Noroviruses have a seasonal distribution, with most infections occurring during the winter months (Skraber et al. 2004). Norovirus infection usually presents as vomiting, watery non-bloody diarrhea

PAGE 19

7 with abdominal cramps, and nausea. Infections in young children and the elderly can lead to complications such as severe dehydration. As few as 10 viral particles can cause disease (Murray et al. 2002). Noroviruses can be detected in water using filtration and RT-PCR (Borchardt et al. 2004). Human Pathogenic Protozoan Spread via Fecal-Oral Route Entamoeba histolytica The life cycle of Entamoeba histolytica includes the formation of a single nucleus cyst that has a diameter of 12 m. The cysts can withstand the acidic environment of the stomach, which allows them to pass through the stomach wall to the ileum where excystation occurs (Bogitsh and Cheng 1998). Infections with E. histolytica can vary in severity with some individuals showing no symptoms while others may have amoebic dysentry or chronic amoebiasis. E. histolytica can be detected by microscopic examination, ELISA, or PCR (Evangelopoulos et al. 2001; Schunk et al. 2001; Zindrou et al. 2001). Giardia lambia Giardia spp. can be found in a variety of mammals including humans, beavers and domestic livestock. Infection with Giardia lambia occurs by the ingestion of a cyst. An infection can be established with as few as 100 cysts (Bogitsh and Cheng 1998). After ingestion, the cysts form trophozoites that attach to the intestinal walls, and can cause diarrhea and symptoms related to malabsorption of nutrients. Infected individuals can shed as many as a billion trophozoites in a single stool sample (Bogitsh and Cheng, 1998). Standard Methods exist for detecting G. lambia in water samples (EPA Method 1623).

PAGE 20

8 Cryptosporidium parvum The 4-5 m oocysts of Cryptosporidium parvum are infectious. Once ingested, sporozoites are formed and then attach to the epithelial cells of the colon (Bogitsh and Cheng 1998). Several metamorphic events occur in which the sporozoites become trophozoites. C. parvum can infect a range of hosts including humans, cattle, sheep, rodents, and birds. Symptoms range from none to severe diarrhea. Death can occur in immunocompromised patients. Cryptosporidium can be detected in the environment using fluorescent antibodies viewed with epiflourescence microscopy. In addition, standard methods have been developed to detect Cryptosporidium (EPA Method 1623). Water Regulations Bacterial, viral, and protozoan pathogens can be introduced into waters in various ways including sewer overflows, leaking septic tanks, sewer malfunction, contaminated storm drains, runoff from animal feedlots, human fecal discharge from boats and poorly operating septic tanks, and other sources (Aslan-Yilmaz et al. 2004; Dietz et al. 2004; O’Shea and Field 1992; Wakida and Lerner 2005). In addition, there is a strong correlation between storm-water runoff and increased microbial load in retention waters (Fujioka 2001; Kistemann et al. 2002; Marsalek and Rochfort 2004). All surface waters in the state of Florida are classified according to their intended use. Potable water is categorized as Class I. Waters used to harvest and propagate shellfish are Class II. Class III is defined as any waters used for recreation and the propagation and harvesting of fish. Surface waters used for utilities, navigation or industrial purposes are Class IV. Minimum criteria for all water classes restricts any substance or combination of substances that may produce a foul odor, be acutely toxic, or

PAGE 21

9 render a serious threat to the general public or wildlife (FL Surface Water Quality Standards, Ch. 62-302.500). In 1972, the Environmental Protection Agency (EPA) released The Clean Water Act. The report specified acceptable levels of biological and chemical contaminates; and suggested the use of total and fecal coliforms counts as an indicator of fecal pollution (Quality Criteria for Water. EPA-440976023). In 1986, The Clean Water Act was modified. The resulting report (titled Ambient Water Quality Criteria for Bacteria) recommended the use of Escherichia coli (E. coli) and enterococci, in place of total and fecal coliforms, as the leading indicators. However, water quality standards are governed at a state level and many U.S. states have implemented the use of total and fecal coliform counts as water-quality indicators (EPA’s BEACH Watch Program: 2000 Update. EPA-823-F-00-012). Water Quality Indicators Various methods have been proposed to identify human impact of surface waters. These methods include chemical indicators, traditional microbial indicators, and microbial source tracking methods. Chemical Indicators of Fecal Pollution Coprostanol Coprostanol is a sterol formed from the reduction of cholesterol by bacteria in the intestines (Scott et al. 2002). Coprostanol comprises about 60% of the total sterols in human feces (Bull et al. 2002). Venkatesan and Kaplan (1990) suggested using coprostanol as an indicator of human fecal pollution. However Coprostanol is also produced in cats and pigs (although 10% less concentrated than in humans) (Puglisi et al. 2003).

PAGE 22

10 Caffeine Caffeine is a substance found in soda, tea and coffee. It has been proposed as an indicator of human fecal pollution (Burkhardt 1990). Caffeine is broken down in the liver and excreted in urine. Only 0.5 to 3% of caffeine is excreted chemically unchanged (Curaldo and Robertson 1993). While high concentrations of caffeine have been documented in sewage, little is known in regards to the survival, transport and dilution of caffeine once it is introduced in the environment (Scott et al. 2002b). Whitening agents Whitening agents are found in detergents and washing powder. Whitening agents can be detected by HPLC with fluorescence detection (Kramer et al. 1996; Poinger et al. 1996). Whitening agents have been proposed as an indicator of human pollution; however they are not consistently found in human sewage (Scott et al. 2002b). Microbial Indicators of Fecal Pollution An ideal indicator is defined as a microorganism that is well characterized, has validated temporal and geographical consistency, is stable in fresh and marine water environments, is shed by a majority of the indicate species, and has a well-defined persistence (Scott et al. 2002b). The indicator must also be detected in the presence of human pathogens. Points to consider when developing a method to detect the indicator organism are reliability, reproducibility, cost effectiveness, and standardizable protocols. Traditional microbial water quality indicators Enumeration of total and fecal coliforms, E. coli and Enterococci has generally been used to assess microbial water quality. The coliform group consists of all aerobic and facultative anaerobic, gram-negative, nonspore-forming, rod-shaped bacteria that

PAGE 23

11 ferment lactose with gas formation within 48 hours of inoculation at 35C. Fecal coliforms are distinguished from total coliforms by growth at a slightly higher temperature (44.5 0.2C) (Clesceri et al. 1998). E. coli is a member of the fecal coliform group. Enterococci are a subgroup of fecal streptococci and are distinguished by their ability to grow in 6.5% sodium chloride, at 10C and 45C, and at a pH of 9.5 (Scott et al. 2005). Fecal coliforms, E. coli, and enterococci share a common feature; they all can inhabit the intestines of warm-blooded animals, including wildlife, livestock, and humans, and therefore can be excreted in the feces of these animals. Although there have been some associations between high levels of indicator bacteria and disease outbreaks (Chao et al. 2003; Chou et al. 2004; Strauss et al. 1995), there is little or no prediction of specific sources of contamination, nor correlation with human pathogens (Scott et al. 2002; Simpson et al. 2002; Skraber et al. 2004). For example, Sunen and Sobsey (1999) found hepatitis A viruses and enteroviruses in waters deemed safe based on acceptable levels of fecal coliform and enterococci. Total coliforms have the ability to survive and potentially proliferate in tropical environments (Bordalo et al. 2002; Colwell 1993; Mark 1977). Fecal coliforms, E. coli, and enterococci have been shown to multiply in warm waters (Desmarais et al. 2002; Hardina et al. 1991; Roll et al. 1997; Solo-Gabriele et al. 2000; Wright 1989), and have been found in waters with no history of anthropogenic impact (Carillo et al. 1985; Rivera et al. 1988; Wright 1986). The reliability of traditional indicators is uncertain because of the possibility of survival and regrowth in tropical climates (Chao et al. 2003), particularly since EPA’s

PAGE 24

12 guidelines were based on studies performed in nontropical areas of the United States including Boston, New York and New Orleans (Shibata et al. 2004). Therefore, high indicator counts cannot be attributed to excrement with complete certainty. Microbial source tracking The inability of traditional indicators to distinguish human fecal pollution from wild and domestic animal fecal pollution is a major shortcoming. This shortcoming has given rise to Microbial Source Tracking (MST), a collective term for methodologies employed to detect and differentiate sources of fecal pollution in waters (using microorganisms as indicators). The concept of MST is based on differences in the intestinal flora of different hosts because of distinct habitats including temperature, food supply, and host digestive systems. Some methods exploit differences arising from natural selection including competition among microorganisms for space and nutrients, or exposure to antibiotics. The process of developing an MST method includes choosing a target microorganism found in the feces of a specific host group, and then identifying a characteristic phenotypic and/or genotypic reference feature unique to the chosen microorganism. Water is tested for fecal contamination based on the association of fecal contamination with the presence or absence of the targeted reference feature. MST is an ever-growing field of study, and various methods have been developed. Methodologies developed can be categorized into either phenotypic or genotypic, library independent or dependent methods. Phenotypic library dependent methods. Phenotypic library dependent methods categorize microorganisms based on differences and similarities of results in biochemical

PAGE 25

13 based tests. Multiple antibiotic resistance patterns and E. coli serotyping are both phenotypic library dependent methods. Multiple antibiotic resistance (MAR). In the 1940s penicillin was introduced into the clinical field as an antibiotic. Since then, many other antibiotics have been introduced (e.g. cephalosporin, isoniazid, bacitracin, tetracycline, rifampin). The effectiveness of antibiotics led to their increasing use. In addition, farm animals, such as beef cattle, are frequently given antibiotics to elicit fast weigh gain for quicker slaughter (Rogers et al. 2004; Rumsey et al. 2000). Consequently, exposure of human and domestic animals to antibiotics has become frequent. This has led to intestinal flora that exhibit specific antibiotic resistance patterns. In contrast, bacteria from wildlife species tend to be susceptible to certain antibiotics. Escherichia coli and Enterococcus spp. are the primary organisms used in Multiple Antibiotic Resistance analyses (MAR). Isolates from known sources are plated on agar containing different antibiotic disks at various concentrations. Growth patterns are observed, and a resistance pattern emerges that can be used in source differentiation (Cooke 1976; Harwood et al. 2000; Kelch and Lee 1978; Parveen et al. 1997; Wiggins 1996, 1999). Large libraries of isolates are constructed for a watershed. Representative libraries are defined as having greater than 6,000 isolates (Wiggins et al. 2003). Unknown isolates are then compared to the known source profiles using statistical analyses. Drawbacks of the method include costs associated with the initial construction of the known library, reproducibility of results, and indeterminate results (Harwood et al. 2003; Samadpour et al. 2005).

PAGE 26

14 E. coli serotyping. The immune systems of both humans and animals respond to foreign carbohydrate and protein molecules by producing antibodies. These antibodies circulate through the blood and can be isolated in serum. E. coli serotyping involves exposing various serums of either animal or human origin with the somatic antigens of E. coli isolates. The origin of the isolate can be pin-pointed based on reactions with specific antisera. Several studies have associated specific E. coli serotypes with either human or non-human sources (Crichton and Old 1979; Gonzalez and Blanco 1989; Parveen et al. 2001). A serious limiting factor of E. coli serotyping is that it requires a large antisera bank to get a complete and representative analysis and documented cross-reactivity of human types with isolates of nonhuman origin (Orskov and Orskov 1981). Phenotypic library independent methods. Phenotypic library independent methods are based either on ratios of organisms or on the direct presence of certain organisms. Fecal coliforms to fecal streptococci ratios, presence of sorbital fermenting Bifidobacteria, Rhodococcus coprophilus or Clostridium perfringens are all different phenotypic library independent methods. Fecal coliforms to fecal streptococci ratios. The use of fecal coliforms (FC) to fecal streptococci (FS) ratios as fecal pollution indicators was first described by Geldreich and Kenner (1969). The basis of this approach rests on the fact that human feces contains relatively higher fecal coliform counts when compared to animal feces, and fecal streptococci counts are proportionally higher in animal feces relative to human feces. Approximate ratios were determined with an FC:FS of >4 indicative of human

PAGE 27

15 fecal contamination and an FC:FS of <0.7 indicative of animal fecal contamination (Feachem 1975; Geldreich and Kenner 1969; Mara 1974; Sinton 1998). FC:FS ratios were used in several studies to discriminate between human and nonhuman fecal pollution of environmental waters (Coyne et al. 1994; Edwards et al.1997; Feachem 1974). Coyne and Howell (1994) concluded that FC:FS ratios had little analytical use because environmental factors (temperature and especially pH) can skew counts, leading to inaccurate results. Bifidobacteria: the third-most-prevalent bacteria in human intestines (Charteris et al. 1997; Nebra and Blanch 1999). These gram-positive bacteria are non-spore-forming obligate anaerobes (Sneath et al. 1986). Isolates from human feces have the ability to ferment sorbitol (Cabelli 1979; Nebra and Blanch 1999; Resnick and Levin 1981). The presence of Bifidobacteria spp. that ferment sorbitol may indicate human fecal pollution. Mara and Oragui (1983) developed human bifid sorbitol agar (HBSA), which is used to isolate sorbitol-fermenting Bifidobacteria. Bacteria are removed from water samples using membrane filtration. The membranes are placed on HBSA plates and incubated anaerobically at 37C for 4 to 6 days. Raised, yellow colonies are presumed to be sorbitol-fermenting Bifidobacteria. Xavier et al. (2005) compared the ratio of sorbitol-fermenting Bifidobacteria to total Bifidobacteria. They consistently found ratios greater then 0.2 in human-derived wastes, and ratios less than 0.05 in animal-derived slaughterhouse effluents. Development of this method is hindered by the lack of data on the persistence of Bifidobacteria in environmental water systems (Carillo et al. 1985). Rhodococcus coprophilus: an actinomycete associated with herbivore dung. It has been proposed as an indicator of animal-derived fecal pollution (Jagals et al. 1995; Mara

PAGE 28

16 and Oragui 1981). R. coprophilus are isolated by direct plating on MM3 agar (Mara and Oragui 1981). Various drawbacks associated with this method include the survival of R. coprophilus for up to 17 weeks in non filtered freshwater at temperatures ranging from 5 to 30C (Mara and Oragui 1983), the time required for incubation (21 days), and problems with overgrowth of R. coprophilus by other bacterial species (Rangdale 2003). Clostridium perfringens: gram-positive, anaerobic, spore-forming rods. These organisms are isolated from water samples using membrane filtration. Both spore and vegetative cells are enumerated by counting all dark-pink colonies after the filter has been incubated on mCP agar at 44.5C for 24 h and then exposed to ammonium hydroxide fumes (USEPA 1995). While C. perfringens are primarily found in human feces (Bisson et al. 1980; Hill et al. 1996), isolation from the feces of domestic and feral animals has been documented (Rangdale 2003). C. perfringens resemble enteric viruses in regards to resistance of environmental factors (Fujioka and Shizumura 1985; Fujioka, et al. 1997), however the use of C. perfringens is an inconclusive determinant for human versus animal wastes because it can isolated from both sources. Genotypic library dependent methods. Methodologies based on genotypic patterns compared to a known library constructed from representative isolates are defined as genotypic library dependent methods. Examples of genotypic library dependent methods include: pulsed gel electrophoresis, repetitive element PCR and ribotyping. Pulsed field gel electrophoresis (PFGE). Pulsed field gel electrophoresis (PFGE) is a DNA fingerprinting method. DNA is extracted from bacterial isolates, and then

PAGE 29

17 treated with restriction endonucleases. The resulting high molecular weight restriction fragments are separated using a pulsed-field electrophoresis. Herbein et al. (1996) found an association between E. coli PFGE profiles and isolate source. Using PFGE, Simmons et al. (2001) was able to identify the source of 224 of 439 isolates from an urban watershed. Stoeckel et al. (2004) correctly classified 24 isolates from environmental samples based on PFGE profiles. However, Parveen et al. (2001) analyzed 32 E. coli isolates from environmental samples and found no significant association of PFGE profiles and isolate source. While PFGE has the ability to discriminate small genetic differences, it may be too sensitive to broadly discriminate bacteria for source tracking (Scott et al. 2002b). Repetitive element PCR (rep-PCR). The genome of E. coli has 35 nucleotide long repetitive extragenic palindromic elements (Rangdale 2003). Repetitive element PCR (rep-PCR) utilizes degenerated primers specific to the repetitive elements. The amplified genetic fragments are analyzed using gel electrophoresis and banding patterns are compared with statistical analysis. Databases are constructed and used to identify sources of bacterial isolates. Johnson et al. (2004) used rep-PCR to identify the source of E. coli isolates and found a 60.5% average rate of correct classification. Stoeckel et al. (2004) was able to correct identify the source of approximately 48% of E. coli isolates using rep-PCR. This method has a high discriminatory potential; however reproducibility of results and broad geographical application of rep-PCR is questionable (Scott et al. 2002b). Ribotyping. Ribotyping is a labor-intensive method that yields DNA fingerprints of ribosomal RNA. The method involves the isolation of E. coli, DNA extraction,

PAGE 30

18 digestion of genomic DNA with restriction enzymes, separation of digestion products by gel electrophoresis, Southern blotting and hybridization using probes specific to a fragment of the rRNA gene. Ribotyping has been employed in many studies with the average rate of correct classification of human and animal isolates ranging from 13-99% (Myoda et al. 2003; Carson et al. 2001; Hartel et al. 2002; Parveen et al. 1999; Samadpour et al. 1995; Stoeckel et al. 2004). This method has met with some success, however several glaring disadvantages such as required labor and costs make this method unfavorable. Genotypic Library Independent Methods. Genotypic library independent methods identify unique molecular makers in microorganisms that are used in presence/absence detections of the indicator. Examples of genotypic library independent methods include: Bacteroides genotyping, F-specific coliphage genotyping, presence of enterococcal surface protein, or presence of human enteric viruses. Bacteroides genotyping. Bacteroides-Provetella are gram-negative, anaerobic non-spore forming bacilli. Members of this group out-number coliforms in both human and animal feces (Holdeman et al. 1976). Bernhard and Field (2000a) developed primers based on 16S rRNA sequencing data that amplify human and ruminant specific Bacteroides. The use of these primers to identify sources of fecal pollution has been limited but successful in preliminary studies (Bernhard and Field 2000b). This method has the potential to be sensitive and discriminatory; however Tang et al. (2005) have reported a significant number of false positives for non-human samples. F-specific coliphage genotyping. F-specific (F+) coliphage are viruses that primarily infect Escherichia, Pseudomonas, Caulobacter, Salmonella, and Vibrio spp.,

PAGE 31

19 which possess a plasmid coding for a sex pilus (Crawford and Gesteland, 1964). The virus families, Inoviridae and Leviviridae, are DNA and RNA coliphages respectively. The F+ RNA coliphages have been more fully characterized, and therefore they have received more attention in regards to MST methods. The F+ RNA coliphages are divided into four main subgroups: group I, group II, group III and group IV (Hsu et al. 1995; Murphy et al. 1995). Groups II and III are primarily associated with human wastes, whereas group IV has been associated with fecal wastes of animal origin (Schaper et al. 2002; Scott et al. 2002b). Group I coliphages have been isolated from both human and animal fecal wastes. The presence of a certain group of coliphage is used to indicate the source of fecal contamination of water. F+ coliphages are plated on a bacterial host, incubated and the resulting plaques are transferred to a nylon membrane. The capsids are denatured, after which the nucleic acid of the phage is cross-linked on the membrane. Detection and differentiation of the F+ coliphages is accomplished using group-specific 32Por digoxigenin-labeled oligonucleotide probes. Several issues have arisen in regards to the use of F+ coliphages as indicators. Group II and III F+ coliphages are isolated from only a small percentage of human fecal samples, however these are the predominate bacteriophage in sewage; this leads to the suspicion of proliferation when these bacteriophage are introduced to sewage (Gerba 1987; Havelaar et al. 1990; Scott et al. 2002b). Scott et al. (2002b) suggests further investigation into survival characteristics is necessary before this method is used as an indicator of fecal pollution.

PAGE 32

20 Enterococcal surface protein. Enterococcal surface protein (esp) is a virulence factor associated with clinical isolates of Enterococcus faecium (Oancea et al. 2004). A method to detect the esp gene in water samples was developed by Scott et al. (2005). Enterococci are isolated from water by membrane filtration. The membranes are placed on mE agar and incubated at 41C for 24 hours (USEPA Method 1600). The filters containing Enterococci are lifted and placed in tryptic soy broth for 3 hours at 41C. DNA extractions are performed on the resulting culture and the presence of the esp gene is determined using PCR and gel electrophoresis. To date, there are no reported studies using the esp gene as an indicator of fecal pollution in water; however Scott et al. (2005) found the esp gene in 63 of 65 sewage and septic tank samples. Human enteric viruses. Over 100 different enteric viruses exist (Scott et al. 2002b). The most prevalent enteric viruses in human derived sewage include enteroviruses, adenoviruses and rotaviruses. Direct monitoring of these viruses has been performed using integrated cell culture methods and PCR detection. Approximately 80% of the viral particles shed in feces are adenoviruses (Hurst et al. 1988), and the presence of enteric adenovirus type 40 and 41 (Ad 40 and Ad 41) has been implemented as an indication of human fecal pollution (Chapron et al. 2000; Jiang et al. 2000; Pina et al. 1998). Ad 40 and Ad 41 have been found in fecally contaminated surface waters (Castignolles et al. 1998; Dohi et al. 1995; Formiga-Cruz et al. 2003; Jiang et al. 2000; Jiang 2002; Pina et al. 1998). Weaknesses of this method include cross-reactivity of primers with porcine adenovirus type 5, and inability to distinguish nonviable versus viable virus particles with PCR (Rangdale 2003).

PAGE 33

21 Viruses Shed in Urine Polyomaviruses Polyomaviruses are of the Papovavirus family. Papovaviruses are very host specific and can establish both chronic and persistent infections in their natural hosts. These viruses are non-enveloped with an icosahedral capsid. The genome is composed of circular double stranded DNA. Polyomaviruses have a 5-kbp genome that encodes for a large T antigen, small t antigen, and 3 viral proteins (VP1, VP2, and VP3) (Saenz-Robles et al. 2001). The International Committee on Taxonomy of Viruses currently recognizes 13 polyomaviruses. The list includes BK virus (BKV), JC virus (JCV), simian vacuolating virus 40 (SV40), murine polyomavirus (PyV), hamster polyomavirus (HaPV), lymphotrophic papovavirus (LPV), budgerigar fledgling disease virus (BFDV), bovine polyomavirus (BPyV), kilham virus (KV), baboon polyomavirus-2 (PPV-2), rabbit kidney vacuolating virus (RKV), simian virus agent 12 (SA12), and rat polyomavirus (RPV). Human polyomaviruses The human polyomaviruses (HPyVs), JCV and BKV, have similarly structured genomes that show 75% homology (Hirsch and Steiger, 2003). The prevalence of these viruses in the human population is worldwide (Del Valle et al. 2004, Pavesi, 2005, Stolt et al. 2003). Serological studies have shown 60-90% of adults harbor antibodies against human polyomaviruses (HPyVs) (Hirsch and Steiger, 2003, Polo et al. 2004). A symptomless primary infection occurs during childhood (Bofill-Mas et al. 2000; Dorries 1998); following which, the viruses establish latent infections in the renal tissue and can persist indefinitely (Del Valle et al. 2004; Shah 1996). Asymptomatic viruria can

PAGE 34

22 occur occasionally or continuously in infected individuals (Arthur et al. 1989; Hogan et al. 1980; Markowitz et al. 1993; Polo et al. 2004; Vanchiere et al. 2005). Disease is normally associated when the host’s immune system becomes suppressed by conditions such as AIDS (White et al. 2005). In general, polyomaviruses have a low morbidity, latency, and symptomless reactivation (Hirsch and Steiger 2003). Clinically these viruses are known for life long asymptomatic viruria in immunocompetent individuals (Polo et al. 2004). Approximately one million viral particles can be shed in one milliliter of urine from a healthy individual (Bofill-Mas et al. 2000). JC virus. The JC virus was first isolated in 1971 from a patient suffering from progressive multifocal leukoencephalopathy (PML) (Padgett et al. 1971); and is now recognized as the pathogenic agent associated with PML (Venter et al. 2004). Disease caused by the JC virus is limited to individuals with comprised immune (Padgett et al. 1971). More than 10% of AIDS patients are afflicted with PML (Dolei et al. 2000; Berger et al. 1998). JCV excretion is not contingent on a suppressed immune system and JCV DNA is often found in the urine of healthy individuals (Bofill-Mas et al. 2000; Markowitz et al. 1993). BK virus. The BK virus was also initially isolated in 1971. The virus was found in the urine of a male that had undergone a renal transplant (Gardner et al. 1971). It is now documented that BKV reactivation can lead to interstitial nephritis and urteral stenosis in kidney transplant patients (Hirsch and Steiger 2003; Polo et al. 2004). BKV is more readily excreted in immunocompromised patients, including organ transplant patients,

PAGE 35

23 HIV patients and pregnant women (Knowles 2001); however excretion in immunocompetent individuals has been documented (Behzadbehbahani et al. 2004). Purpose of Study The purpose of this study was to develop a novel method to detect human fecal pollution in environmental waters. Human polyomaviruses (JC virus and BK virus) were chosen as a novel indicator of human fecal pollution because they are unique to humans, exist in a majority of the population and are present in high numbers in sewage. Experimental Rationale As stated previously, the JC virus and BK virus are excreted in urine. An average adult produces approximately 1200-1500 ml of urine a day. The first part of this study was designed to confirm the presence of HPyVs in domestic sewage and septic tank wastes. In addition, investigations were made to determine whether or not the excretion of HPyVs underwent a seasonal occurrence. After preliminary studies, a method was developed to concentrate and detect HPyVs in water samples. The method developed to detect HPyVs in water samples was then applied to environmental samples suspected of human fecal contamination. The latter part of this study compared results obtained from the detection of HPyVs in environmental water samples to results of the detection of the human specific esp gene and Bacteroides marker.

PAGE 36

CHAPTER 2 DETECTION OF HUMAN POLYOMAVIRUSES IN BOTH SEWAGE AND SEPTIC TANK SAMPLES AND THE ABSENCE OF HUMAN POLYOMAVIRUSES IN DAIRY WASTE Human polyomaviruses (HPyVs) should be prevalent in wastes containing human urine because a high percentage (50-90%) of the world’s population is seropositive for JC virus and/or BK virus (Hirsch et al. 2003, Stoner et al. 2000, Taguchi et al. 1982). HPyVs are excreted in high amounts in immunocompromised as well as immunocompetent individuals (Agostini et al. 1996, Polo et al. 2004, Vanchiere et al. 2005). As much as 8.7 x 105 polyomavirus-like particles per milliliter of urine has been observed (Bofill-Mas et al. 2000). Limited studies have been done regarding the excretion pattern of HPyVs. Polo et al. (2004) presented a study in which 62.7% of adult participants and 13.2% of children excreted either JC virus or BK virus. JC virus excretion was largely continuous and BK virus was mostly occasional. However, there is no information regarding the seasonal occurrence of HPyVs. This study was designed to examine the presence of HPyVs in sewage and septic tank samples over a nine-month period. Dairy cow manure samples were also screened to ensure validity of human specificity. Materials and Methods Collection of Samples Raw sewage samples were collected from the University of Florida Water Reclamation Facility (Gainesville, FL). Representative septic tank samples were 24

PAGE 37

25 collected from Beltz Liquid Waste Management (Gainesville, FL) trucks less than 3 hours after septic tank collection. Dairy cow manure samples were collected from the University of Florida Dairy Research Unit. All samples were collected in sterile bottles, transported to the laboratory on ice then stored at 4C until processed. All samples were processed within 24 hours of collection. DNA Extraction Samples used to determine the presence of HPyVs in human waste were subject to direct DNA extractions using QIAamp DNA mini kit (Qiagen, Inc., Valencia, CA). One hundred microliters of sample was added to 100 L of 0.9% NaCl and then processed as per manufacturer’s instructions. DNA was resuspended in 50 L of nuclease free water and stored at -20C. PCR Detection of HPyVs The primers previously developed by Askamit (1993) specific for the homologous t-antigen of both JC virus and BK virus were used in this study (Table 2-1). PCR was performed using a modified version of reaction conditions described by Wiley et al. (2004). Briefly, 45 L of Platinum Blue PCR SuperMix (Invitrogen, Inc., Carlsbad, CA), 200-nM of each primer (P5 and P6), and 1 L of DNA template were combined and the final reaction volume was adjusted to 50 L using reagent grade water. The PCR reaction conditions were as follows: initial denaturing at 94C for 2 min, followed by 45 cycles of: 94C for 20 sec, 55C for 20 sec, and 72C for 20 sec, then a final elongation at 72C for 2 min. The nested PCR was run using the same reaction

PAGE 38

26 conditions with 1 L of the first reaction used as the template. All amplification steps were carried out using an Eppendorf Mastercycler Thermocycler. Gel Electrophoresis of PCR Products PCR products were analyzed using 1.5% agarose gel electrophoresis. DNA was viewed using GelStar nucleic acid stain (Biowhittaker, Inc., Walkersville, MD) under UV light. Bands were identified by visual analysis and comparison to a pGEM HindIII digest (Promega, Inc., San Luis Obispo, CA) or 100 bp Molecular Ruler (BioRad) and a positive control. BK virus (ATCC #VR-837) was used as a positive control. Positive results were recorded when bands appeared at 172 bp which corresponded to the PCR product of the BK virus positive control. Excision of PCR Products from Agarose Gels Select bands from raw sewage samples that corresponded with the positive control and visually appeared to be 172 bp were excised from the agarose gel using QIAquick Gel Extraction kit (Qiagen, Inc., Valencia, CA). Purified DNA was resuspended in 50 L of nuclease free reagent grade water, and stored at -20C until used in cloning. Cloning of PCR Product The TOPO TA Cloning kit (Invitrogen, Carlsbad, CA) was used to clone PCR products into competent cells. PCR products were ligated into the pCR 2.1 vector. E. coli TOP 10F’ cells were transformed with the pCR 2.1 vector. The cells were then plated on Luria-Bertani agar containing 100 g/ml ampicillin, isopropyl--D-thiogalactopyranoside (IPTG), and 5-bromo-4-chloro-3-indolyl--D-galactoside (X-gal). The pCR 2.1 TOPO TA cloning vector is a lacZ-based system and therefore positive clones were visualized by blue/white screening.

PAGE 39

27 Plasmid Isolation White clones were selected and inoculated into Luria-Bertani broth containing 100 g/ml ampicillin, the broths were then incubated at 37C for 24 hours. Plasmids were extracted from the cultures using QIAprep Spin Miniprep kit (Qiagen, Inc., Valencia, CA) according to manufacturer’s instructions. Extracted plasmids were resuspended in 50 L nuclease free reagent grade water. Restriction Enzyme Analysis of Plasmids and DNA Sequencing A volume of 16 L of the extracted plasmids was used in EcoRI restriction enzyme digestion according to manufacturer’s instructions (New England BioLabs, Inc., Beverly, Mass.). Digestion products were analyzed using 1.5% agarose gel electrophoresis. DNA was viewed using GelStar nucleic acid stain (Biowhittaker, Inc., Walkersville, MD) under UV light. Bands were identified by visual analysis and comparison to a 100 bp Molecular Ruler (BioRad). Plasmid samples that exhibited the proper length insert were sent to Michigan State University DNA Sequencing Facility (East Lansing, MI) for DNA sequencing. Sequence Analysis of PCR Product The sequences obtained from the raw sewage sample were combined with data from previously published sequences of human polyomavirus t-antigen. The sequences were aligned and compared using Bioware Jellyfish Software. Limit of Detection of PCR for HPyVs in Sewage Aliquots of raw sewage were heated at 99C for 5 minutes for to ensure viral capsid lysis. Volumes ranging from 0.1-4 L were used as a template in PCR reactions as previously described.

PAGE 40

28 Results A total of 14 septic tank samples, 36 sewage samples and 18 dairy cow waste samples were collected from August 2004, to April 2005. All human derived waste samples were positive for HPyVs, and HPyVs were not detected in any dairy cow waste samples (Table 2-2). Amplicons from select sewage samples were extracted from the agarose gel (Figure 2-1) and sequenced. Results obtained from Michigan tate University DNA Sequencing Facility are found in Figure 2-2 and Figure 2-3. The sequence from plasmid SA aligned with BK polyomavirus strain As (GENBANK) with 100% similarity (Figure 2-4). The sequence from plasmid SC aligned with BK polyomavirus isolate BKV HC-u9 (GENBANK) with 92% similarity (Figure 2-5). The lowest volume of sewage in which HPyVs are detectable by PCR is 1 L (Table 2-3). Discussion The results of this study indicate that HPyVs are detectable in both raw sewage and septic tank samples throughout the year. The absence of the HPyV marker in dairy cow manure samples indicates the potential of this test to be a human specific indicator of fecal pollution. DNA sequencing of PCR products ascertained HPyV identification using primers P5 and P6. Sequence alignment results were highly similar to human polyomavirus sequences previously published (GENBANK). The capability of this test to detect HPyVs in as little as 1L of sewage suggests that it has the potential to be a sensitive indicator of human fecal contamination.

PAGE 41

29 Table 2-1. Primers used to amplify the homologous t-antigen of BKV and JCV.* Primer Designation Sequence Product Size P5 5’-AGT CTT TAG GGT CTT CTA CC-3’ P6 5’GGT GCC AAC CTA TGG AAC AG-3’ 172 bp Table 2-2. HPyV detection in septic tank, raw sewage and dairy waste throughout a nine month period.* Septic Tank Raw Sewage Dairy Waste August + +, +, +, + -, 2004 (n=1) (n=4) (n=2) September + +, +, +, + -, 2004 (n=1) (n=4) (n=2) October +, + +, +, +, + -, 2004 (n=2) (n=4) (n=2) November + +, +, +, + -, 2004 (n=1) (n=4) (n=2) December +, + +, +, +, + -, 2004 (n=2) (n=4) (n=2) January +, + +, +, +, + -, 2005 (n=2) (n=4) (n=2) February + +, +, +, + -, 2005 (n=1) (n=4) (n=2) March +, + +, +, +, + -, 2005 (n=2) (n=4) (n=2) April +, + +, +, +, + -, 2005 (n=2) (n=4) (n=2) Total Number of Samples Positive for HPyVs 14 36 0 Percent of Samples Positive for HPyVs 100 100 0 *DNA extractions were performed on 100 l aliquots samples. Four microliters of DNA was used as template in the PCR reaction. A 172 bp band was recorded as a positive result.

PAGE 42

30 Table 2-3. Detection of HPyVs in raw sewage from the University of Florida Water Reclamation Facility.* 4 L 2 L 1 L 0.1 L +, + +, + -, -, Detection of HPyVs (n=2) (n=2) +, +, +, +, + (n=5) (n=3) *Samples were collected on April 28th, 2004 and treated as described in the text.

PAGE 43

31 A B C D E 172 bp Figure 2-1. Gel electrophoresis of human and dairy cow waste samples: a) 100 bp molecular ladder , b) Negative control, c) and e) Raw sewage samples, d) Dairy cow waste sample, f) BK virus positive control. SA (cycled with reverse primer) Sequence >JBR90_D04_3722_08.ab1 CHROMAT_ID=411769 aatccc agcttggtccgagctcggatccttcgtaacggaggaaagtgtgctggaatttcc c cttggtgcgaacctatggaacagaagagtgggagtcctggtggagctcctttaatgaaa aatgggatgaagatttattctgccatgaggatatgtttgccagtgatgaagaagcaacag cagattcccaacactcaacaccacccaaagaaaaaagaaaggtagaagaccctaaagact aagggcgaattctgcagatatccatcacactggcggccgctcgagcatgcatctagaggg cccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgt gactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgcc agctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctg aatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgc gcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttccctt cctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttag ggttccgatttagtgctttacggcacctcgaccccaaaaacttgattagggtgatggttc acgtagtgggccatcgccctgatagacggttttcgccttttgacgttggagtcacgttct taatagtggactcttggtccaaatggaacaacactcaaccctattcggtcttatcttttg attataagggaattngcganttcgcctattg tttaaaaatgactgattaacaaatttaac cgatattaacaaattcagg cgg 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 acgt trimmed region(s) acgt vector region(s) Figure 2-2. Sequencee of plasmid SA

PAGE 44

32 SC (cycled with forward primer) Sequence >JBR89_C04_3722_06.ab1 CHROMAT_ID=411770 ggttttttgacccgatntnaannggnnacttcntnatgagaggagcnaaatttt cccttg gtgccacctatggaacagaacatttgccgtcctggtggagctcctttaatgaaaaatggg atgaagattttttttgccctgaagatatgtttgccaatgatgaagaagcgaccgccgatt ctcaacactccacacctcccaagaaaaagagaaaggtataagaccctaaagactaagggc gaattccagcacactggtggccgtctctagtggatcccagctcggtttttttttggcgta atcatggtcatagctgtttcctgtgtgaaattggtattcgctcacgattccacacaacat acgagccggaagcataaagtgtaaagcccggggtgcctattgagtgagctaactcattta aattgggttgcgctcaa tgcccgctatccagtccggaaacctgtcatgcccactgcatta aagaatcggcctatcgcgcaggaagaggtgagtttgcgttatgggtgctatttcgcgtcc tcagttactgactgcgcgcgatcggtctgttcggttgctgaagagcggttacagtctgac tcaataggtggtgataacggtatccactaaaatacggggtataaccccgggaaaaagaca ggggagaaaaaggcccaggaaatggccag gaaccgctaaaagccgcgttg tcggatcaat atccaaggggtcccccccttatggagatgaagaaatttaagcttattcaacagtgggcga agcacgacagacatgatattccacccgttttccttggatcacttctgcaatccatgattc catatgctaatcagaatatggtatcttttcccttcggattcagaatttttgaggattatg t 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 acgt trimmed region(s) acgt vector region(s) Figure 2-3. Sequence of plasmid SC

PAGE 45

33 Figure 2-4. Sequence alignments of plasmid SA and published BK polyomavirus strain As (GENBANK). Similarities are highlighted in yellow. Figure 2-5. Sequence alignments of plasmid SC and published BK polyomavirus isolate BKV HC-u9 (GENBANK). Similarities are highlighted in yellow.

PAGE 46

CHAPTER 3 DEVELOPMENT OF A METHOD TO CONCENTRATE AND DETECT HUMAN POLYOMAVIRUSES FROM WATER SAMPLES When dealing with detection of viruses in water several issues must be addressed. These include the concentration procedure to be used, the assay procedure to detect viruses and removal of inhibitors of the assay procedure. Human and animal viruses are generally present in low numbers in environmental waters, therefore the viruses must usually be concentrated before detection assays are performed. Several methods to concentrate viruses are available, these include: ultracentrifugation, cartridge filters (electropositive or electronegative), glass wool filters, vortex and tangible flow filtration, acid flocculation, organic flocculation (Fong and Lipp 2005). Enteric viruses can be concentrated from water at a low pH using microporous filters. Research has shown MS2, X174, and Poliovirus-1 absorption to Millipore HA filters is >99% at pH 3.5 (Gerba 1984; Lukasik et al. 2000). While some viruses can be inactivated at a pH of 3.5 (Scott et al. 2002a); human polyomaviruses (HPyVs) have been shown to withstand exposure to low pHs (Bofill-Mas et al. 2001). After absorption to microporous filters, viruses must be eluted from the filter in a smaller volume of eluting solution for DNA extraction. The microporous filters not only concentrate viruses but also PCR inhibitors. These inhibitors must be removed from the sample. Most commercially available DNA extraction kits are designed to isolate DNA and remove PCR inhibitors from clinical samples such as blood, tissue and forensic 34

PAGE 47

35 samples. However samples containing feces and urine harbor relatively high concentrations of inhibitors and are problematical substrates for PCR (Behzadbehbahani et al. 1997). It is imperative that the chosen DNA extraction method eliminates all inhibition of PCR. Research has been performed addressing the efficiency of different commercially available DNA extraction kits. McOrist et al. (2002) found QIAamp DNA Stool Mini Kit the most effective extraction method for fecal samples when compared to FastDNA kit (Bio 101, Carlsbad, CA, USA), Nucleospin C+T kit (Macherey-Nagal, Germany), and Quantum Prep Aquapure Genomic DNA isolation kit (Bio-Rad, Hercules, CA, USA). QIAamp Viral RNA Kit co-precipitates RNA and DNA and had been used with success in extracting Enterovirus RNA from nitrocellulose filters (Scott, unpublished data). Moreover, Whiley et al. (2004) effectively used QIAamp DNA Blood Mini Kit (Qiagen, Inc., Valencia, CA) to perform nucleic acid extractions on urine samples. One objective of this study was to design a protocol to concentrate and detect HPyVs from water samples. Four different DNA extraction kits were tested for efficiency of inhibitor removal, DNA recovery and reproducibility of results. Materials and Methods Sample Collection Sewage samples were collected from the University of Florida’s Water Reclamation Facility (Gainesville, FL). All samples were collected in sterile bottles, transported to the laboratory on ice then stored at 4C until processed. All samples were processed within 24 hours of collection.

PAGE 48

36 Sample Preparation One hundred milliliters of tap water was dechlorinated with sodium thiosulfate. One hundred microliters of raw sewage was inoculated into the dechlorinated water. The pH of the water was then adjusted to 3.5 using hydrochloric acid (HCl). Virus Concentration on Micropourous Filters Water was vacuum filtered through a 0.45 micron, 47-mm diameter nitrocellulose filter. The filter was lifted and placed into a 30 ml polypropylene tube, and stored at -20 C. All filters were processed within 24 hours. QIAamp DNA Stool Kit (Qiagen, Inc., Valencia, CA) DNA extractions were performed with some modifications to the manufacturer’s protocol. Two hundred microliters of 0.1% Tween in phosphate buffered solution (PBS) and 1.4 ml Buffer ASL were added to the tube containing the filter and was then placed on a Dynal Rotator and rotated for 10 minutes at 70C. Tubes were centrifuged briefly to collect the lysate. The lysate was then added to the Qiagen spin column and viral DNA was isolated according to manufacturer’s instructions. DNA was resuspended in 200 L nuclease free reagent grade water and stored at -20C. QIAamp Viral RNA Kit (Qiagen, Inc., Valencia, CA) DNA extractions were performed according to manufacturer’s instructions with some modification. Briefly, 700 L of viral lysis buffer was added to the tube containing the filter and then rotated on a Dynal Rotator for 10 minutes until the filters were saturated. Tubes were centrifuged briefly to collect lysate. The lysate was added to the Qiagen spin column and viral RNA and DNA were isolated according to manufacturer’s instructions. Nucleic acids were resuspended in 50 L nuclease free reagent grade water and stored at -20C.

PAGE 49

37 QIAamp MinElute Kit (Qiagen, Inc., Valencia, CA) DNA extractions were performed according to manufacturer’s instructions with some modification. A combination of QIAGEN Protease, 800 L of phosphate buffered solution and 800 L of viral lysis buffer were added to the tube containing the filter. The tube containing the lysis solution and filter was incubated at 56C. After 15 minutes tubes were centrifuged briefly to collect lysate. The lysate was then added to the Qiagen spin column and viral DNA was isolated according to manufacturer’s instructions. DNA was resuspended in 50 L nuclease free reagent grade water and stored at -20C. QIAamp Blood DNA Midi Kit (Qiagen, Inc., Valencia, CA) Two-milliliters of Beef Extract (pH 9.3) was added to the tube along with 200 L of QIAGEN Proteinase and 2.4 ml of Buffer AL. The tubes were rotated on a Dynal Rotator for 10 minutes at 70C, after which the lysate was then added to the Qiagen spin column. The viral DNA was isolated according to manufacturer’s instructions. DNA was resuspended in 90 L nuclease free reagent grade water and stored at -20C. HPyV Enzymatic Conditions: The assay was carried out using 45 L Platinum Blue PCR SuperMix (Invitrogen, Inc., Carlsbad, CA), 200-nM of primers P5 and P6, template volume of 4 l, the final volume was adjusted to 50 l with reagent grade water. The PCR reaction conditions were as follows: initial denaturing at 94C for 2 minutes, followed by 45 cycles of: 94C for 20 seconds, 55C for 20 seconds, and 72C for 20 seconds, then a final elongation at 72C for 2 minutes. The nested PCR was run using the same reaction conditions with 1 l of the first reaction used as the template.

PAGE 50

38 Agarose Gel Electrophoresis The PCR products were analyzed using 1.5% agarose gel electrophoresis. DNA was viewed using GelStar nucleic acid stain (Biowhittaker, Inc., Walkersville, MD) under UV light. Bands were identified by visual analysis and comparison to a pGEM HindIII digest (Promega, Inc., San Luis Obispo, CA) or 100 bp Molecular Ruler (BioRad) and a positive control. BK virus (ATCC #VR-837) was used as a positive control. Positive results were recorded when bands appeared at 172 bp which corresponded to the PCR product of the BK virus positive control. SYBR-Gold Viral Direct Counts BK virus stock (ATCC #VR-837) was obtained from the American Tissue Culture Collection. The stock was serially diluted in reagent grade nuclease free water. Samples were fixed with 0.02 m-filtered formalin to a final concentration of 1% in the sample. Prior to filtration an antifade mounting solution was prepared by combining 990 L of 50/50 PBS: Glycerin and 10 L of 10% p-phenylenediamine. The formalin fixed samples were vacuumed filtered through a 25 mm, 0.02 m pore size Whatman Anodisc filter backed by a 25 mm, 0.8 m pore size AA Millipore mixed-ester membrane filter. The Whatman filters were then lifted and placed in a petri dish containing staining solution. The staining solution was comprised of 97.5 L of 0.02 m filtered deionized water and 2.5 L of 1:10 diluted SYBR-Gold Nucleic Acid Dye (Invitrogen, Inc., Carlsbad, CA). Filters were stained for approximately 12 minutes. After the staining period, the filters were placed on a slide and covered with 28 L of antifade mounting solution and cover slip. BK virus was observed using 1000X magnification on an epifluorescence microscope with blue excitation.

PAGE 51

39 Range of Detection One hundred milliliters of tap water was dechlorinated with sodium thiosulfate. The dechlorinated tap water was inoculated with a known titer of BK virus. The pH of the water was lowered to 3.5 using HCl. Water samples were filtered through a 0.45 micron porosity, 47-mm diameter nitrocellulose filter. The filter was lifted and placed into a 30 ml polypropylene tube, and stored at C. All filters were processed within 24 hours. QIAamp Blood DNA Midi kit was used for DNA extractions. PCR and gel electrophoresis was used to detect BK virus (protocols previously described). Results A total of 4 samples of were extracted using the QIAamp DNA Stool Mini Kit. All samples were negative for the presence of HPyVs. Two of the twelve DNA samples (16.7%) extracted using the QIAamp Viral RNA Kit were positive for HPyVs. Fourty-eight (30%) samples out of 160 extracted using the QIAamp MinElute Virus Spin Kit were positive for HPyVs. A total of 30 samples were extracted using QIAamp DNA Blood Midi Kit. HPyVs were detected in all thirty of the samples (100%) (Table 3-1). QIAamp DNA Blood Midi Kit was selected as the best method for DNA extraction and inhibitor removal. Direct viral counts were made using SYBR-Gold and epifluorescence microscopy (Figure 3-1). A total of 292, 140 and 237 BK virus particles were counted at the 10-10 dilutions, and a total of 14, 12 and 22 BK virus particles were counted at the 10-11 dilutions (Table 3-2). The titer of the BK virus stock was approximated to be 1.915 0.7 x 1012. One hundred milliliter water samples were inoculated with 223 77, 160 43, or 16 4 BK virus particles. The method developed was able to detect BK virus DNA

PAGE 52

40 represented by a PCR product after extraction of filter by QIAamp DNA Blood Kit in the samples inoculated with 160 43 and 223 77 viral particles; but not in the water sample inoculated with 16 4 BK virus particles. Discussion The QIAamp DNA Stool Kit was the least efficient of all the kits used to extract DNA from filters. At one point in the manufacturer’s protocol only half of the sample was applied for further processing. Therefore, at that step the sensitivity of HPyV detection was decreased by one-half, which could be a large contribution to the inefficiency of this kit. When using both the QIAamp Viral RNA Kit and QIAamp MinElute Kit the volume of lysis buffer was insufficient to saturate the entire surface of a membrane filter, and therefore limited the exposure of the viruses to the lysis buffer, which may have contributed to the ineffectiveness of these two kits. Results were variable when using the QIAamp Viral RNA Kit and inadequate for the purpose of this study. The QIAamp MinElute Kit was more efficient than the Viral RNA Kit; however it showed limited reproducibility. The best-suited commercially available DNA extraction kit was the QIAamp DNA Blood Midi Kit. It allowed a larger volume (2 ml) to be used to elute the membrane filter. The higher volume of elution buffer allowed for sufficient coverage of the filter. In addition, the high pH (9.3) Beef Extract used to elute the filter appeared to more readily release virus particles from the filter perhaps by interfering with the electrostatic interactions and competing for protein binding on the surface of the filter. The DNA Blood Midi Kit gave consistent results, making it the obvious choice to use in subsequent DNA extractions.

PAGE 53

41 Approximately 150 BK viral particles diluted in 100 ml of water could be detected using this method. This coupled with previous studies showing the detection of HPyVs in as little as 1 L of sewage imply that this method is sensitive. The sensitivity of detection further enforces the potential of this method to be successfully used for detecting human fecal pollution in environmental waters. Preliminary data suggest that environmental water samples suspected of human fecal pollution (broken sewage lines, sewer overflows, etc.) will be positive for HPyVs.

PAGE 54

42 Table 3-1. Concentration and detection of HPyVs in water inoculated with sewage.* Results of HPyVs detection # of positives # of negatives Percent Positive QIAamp DNA Stool Mini Kit 0 4 00%% QIAamp Viral RNA Mini Kit 2 10 1166..7700%% QIAamp MinElute Virus Spin Kit 48 112 3300%% QIAamp DNA Blood Midi Kit 30 0 110000%% Note: HPyVs were concentrated on microporous filters. DNA extractions were performed directly on the filter. DNA extraction kits were tested for efficiency of inhibitor removal and consistency of results. Table 3-2. Direct counts of BKV using SYBR-Gold staining epifluorescence microscopy. Dilutions Number of BK Viral Particles Counted Average Std. Dev. 10-10 292 140 237 223 77 10-11 14 12 22 16 4

PAGE 55

43 Figure 3-1. Approximately 3 x 108 BKV virus stained with SYBR-Gold and viewed using 1000X magnification on an epifluorescence microscope with blue excitation.

PAGE 56

CHAPTER 4 HUMAN POLYOMAVIRUSES AS INDICATORS OF HUMAN-DERIVED FECAL POLLUTION IN ENVIRONMENTAL WATER SAMPLES: THREE DIFFERENT INDICATORS OF HUMAN FECAL POLLUTION IN JACKSONVILLE AREA CANALS AND CREEKS The fecal anaerobe genus Bacteroides has been used as an indicator of human fecal pollution (Bernhard and Field, 2000). Primer sets for human-specific organisms were developed based on 16S rRNA sequences, and have been used successfully in field studies on the west coast (Bernhard, et. al 2003), although they have not been used in other geographical areas. Enterococcus faecium is one of the dominant enterococci found in human feces, and the enterococcal surface protein gene (esp) found in this species is associated with human, but not animal-derived, fecal matter (Scott et al. 2004). Scott et al. (2004) developed a PCR based method to detect the esp gene in waters suspected of human fecal pollution. Our objective was to compare and contrast the presence of human specific Bacteroides marker, the esp marker and the presence of HPyVs, and to identify any correlations between the three indicators. Materials and Methods Sample Collection Samples were collected from creeks and canals in the Jacksonville area (Nassau and Duval Counties) (Table 4-1). All samples were collected in sterile bottles, transported to the laboratory on ice then stored at 4C until processed. All samples were processed 44

PAGE 57

45 within 24 hours of collection. Samples were collected from November 2004, through June 2005. Processing of Samples for Bacteroides Marker We filtered 100 ml of water from each sample through a 0.45 micron filter to collect bacterial cells for molecular analysis. In case of a clogged filter, an additional filter was utilized until a total of 100 ml was filtered. Each filter was then processed according to methodology outlined below. Preparation of Bacteroidetes template DNA for PCR reactions Filters were suspended in Qiagen Stool Lysis Buffer and vortexed vigorously. The resulting lysate was processed using QIAamp DNA Stool Kit (Qiagen, Inc., Valencia, CA) PCR reactions were performed on composite DNA samples extracted from membrane filters. PCR primers and reaction conditions for Human Bacteroides marker detection Primers specific for Bacteroides derived from human sources (Fwd: 5’AACGCTAGCTACAGGCTT-3’ and Rev: 5’CAATCGGAGTTCTTCGTG-3’) were developed by Bernhard and Field (2000). PCR reactions were performed in a 50 L reaction mixture containing 1X PCR buffer, 1.5 mM MgCl2, 200 M of each of the four deoxyribonucleotides, 0.3 M of each primer, 2.5 U of HotStarTaq DNA polymerase (Qiagen), and 5 L of template DNA. Amplification consisted of 25 cycles at 94C for 30 sec, an annealing temperature of 53C for 30 sec, and 72C for 1 min followed by a final 6-min extension at 72C. To increase the sensitivity of detection, 1 L of each PCR product was reamplified using the same conditions. PCR products were visualized in a 1% agarose gel stained with GelStar.

PAGE 58

46 Processing of Samples for esp Detection Isolation of enterococci Enterococci were isolated by membrane filtration. Filters were incubated for 18 to 24 hours on mE agar supplemented with indoxyl substrate (mEI, Sigma, Inc.) according to methodology outlined in USEPA Method 1600. Growth of enterococci Filters containing enterococci were lifted, suspended in Tryptic Soy Broth, vortexed vigorously, and incubated for 3 h at 41oC. DNA extractions were performed on the culture using a QIAamp DNA extraction kit according to manufacturer’s instructions (Qiagen, Inc.). PCR primers and reaction conditions The forward primer used it this study was previously designed by Scott, et. al (2004), and is specific for the E. faecium esp gene (5’-TAT GAA AGC AAC AGC ACA AGT T-3’). A conserved reverse primer (5’-ACG TCG AAA GTT CGA TTT CC-3’), developed previously by Hammerum and Jensen (2002), was used for all reactions. PCR reactions were performed in a 50 L reaction mixture containing 1X PCR buffer, 1.5 mM MgCl2, 200 M of each of the four deoxyribonucleotides, 0.3 M of each primer, 2.5 U of HotStarTaq DNA polymerase (Qiagen), and 5 L of template DNA. Amplification was performed with an initial step at 95 oC for 15 min (to activate Taq polymerase), followed by 35 cycles of 94oC for 1 min, 58oC for 1 min, and 72oC for 1 min. PCR products were separated on a 1.5% agarose gel stained with GelStar nucleic acid stain (BioWhittaker, Inc., Walkersville, MD ) and viewed under UV light. The PCR product is 680 or 681 base pairs in length, representing both variants of the E. faecium esp gene.

PAGE 59

47 Processing of Samples for HPyV Detection Prefiltration of samples Samples were prefiltered to remove large particles, before prefiltration the pH of samples was raised to 10.0 to reduce virus absorption to the filter. The samples were vacuum filtered through 47 mm prefilter and effluent was collected in a sterile side arm flask. Virus concentration on micropourous filters After prefiltration the pH of the water sample was dropped to 3.5 using concentrated acetic acid. Six hundred milliliters of the water sample was vacuum filtered through a 0.45 micron, 47-mm diameter nitrocellulose filter. The filter was lifted and placed into a 30 ml polypropylene tube, and stored at -20 C. All filters were processed within 24 hours. DNA extraction Two-milliliters of Beef Extract (pH 9.3) was added to the tube along with 200 L of QIAGEN Proteinase and 2.4 ml of Buffer AL. The tubes were rotated on a Dynal Rotator for 10 minutes at 70C, after which the lysate was added to the Qiagen spin column. The viral DNA was then isolated according to manufacturer’s instructions. DNA was resuspended in 100 L nuclease free reagent grade water and stored at -20C. HPyV enzymatic conditions The assay was carried out using 45 l Platinum Blue PCR SuperMix (Invitrogen, Inc., Carlsbad, CA), 200-nM of primers P5 and P6, template volume of 4 L, the final volume was adjusted to 50 L with reagent grade water . The PCR reaction conditions were as follows: initial denaturing at 94C for 2 minutes, followed by 45 cycles of: 94C for 20 sec, 55C for 20 sec, and 72C for 20 sec, then a final elongation

PAGE 60

48 at 72C for 2 min . The nested PCR was run using the same reaction conditions with 1 L of the first reaction used as the template . The PCR products were analyzed using 1.5% agarose gel electrophoresis . DNA was viewed using GelStar nucleic acid stain (Biowhittaker, Inc.) under UV light . Bands were identified by visual analysis and comparison to a pGEM HindIII digest (Promega, Inc.) or 100 bp Molecular Ruler (BioRad) and a positive control . BK virus was used as a positive control . Positive results were recorded when bands appeared at 172 bp which corresponded to the PCR product of the BKV positive control. Results Ten sites were sampled in the months of November of 2004, December of 2004, January of 2005, February of 2005, March of 2005, April of 2005, and June of 2005. Each site was analyzed for the presence of the esp marker, the Bacteroides marker, and human polyomaviruses. In November of 2004, all three markers of human fecal pollution were found in one sample D1 (Table 4-2). In December of 2004, both the esp marker and Bacteroides marker were not found in any samples, however human polyomaviruses were detected in samples D3 and D4 (Table 4-3). None of the indicators of human fecal pollution were found in the January of 2005 samples (Table 4-4). In February of 2005, all three markers were found in samples D1, D2, D3, N2 and N5. Both the esp marker and HPyVs were detected in sample N1, only the esp marker was found in D5, and only HPyVs were detected in sample N4 (Table 4-5). In March of 2005, all three markers were detected in samples D1 and N5, both the Bacteroides marker and HPyVs were detected in samples D2, N2, only the Bacteroides marker was detected in N1, and only HPyVs were detected

PAGE 61

49 in D3, D4, D5, N3 and N4 (Table 4-6). In April of 2005, all three markers were detected in D2, only the esp marker was detected in D1, both the Bacteroides marker and HPyVs were detected in N1 and N2, and only HPyVs were detected in N3 (Table 4-7). In June of 2005, none of the markers were detected in any of the samples (Table 4-8). Table 4-1. Sampling sites for Jacksonville area study. Site Designation Sampling Location D1 Graceland Bridge D2 Lenox Ave. Bridge D3 San Juan Blvd Boat Ramp D4 Blanding Ave. Cedar Shore Apt.Bldg. D5 Ortega Canal N1 CR-125/St. Mary’s Middle Prong Bridge N2 CR-127/ St. Mary’s Middle Prong Bridge N3 CR-250/St. Mary’s Middle Prong Bridge N4 Hwy 90/ Deep Creek Bridge N5 CR-121/Brandy Branch Bridge Table 4-2. Results of 11/15/04 analysis for markers of human fecal pollution. Date Collected Site Number esp Markera (+/-) Human Bacteroides Markera (+/-) HPyV Detectionb (+/-) 11/15/04 D 1 + + + 11/15/04 D 2 11/15/04 D 3 11/15/04 D 4 11/15/04 D 5 11/15/04 N 1 11/15/04 N 2 11/15/04 N3 11/15/04 N 4 11/15/04 N 5 a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml.

PAGE 62

50 Table 4-3. Results of 12/13/04 analysis for markers of human fecal pollution. Date Collected Site Number esp Markera (+/-) Human Bacteroides Markera (+/-) HPyV Detectionb (+/-) 12/13/04 D 1 12/13/04 D 2 12/13/04 D 3 + 12/13/04 D 4 + 12/13/04 D 5 12/13/04 N 1 12/13/04 N 2 12/13/04 N 3 12/13/04 N 4 12/13/04 N 5 a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml. Table 4-4. Results of 1/10/05 analysis for markers of human fecal pollution. Date Collected Site Number esp Markera (+/-) Human Bacteroides Markera (+/-) HPyV Detectionb (+/-) 1/10/05 D 1 1/10/05 D 2 1/10/05 D 3 1/10/05 D 4 1/10/05 D 5 1/10/05 N 1 1/10/05 N 2 1/10/05 N 3 1/10/05 N 4 1/10/05 N 5 a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml.

PAGE 63

51 Table 4-5. Results of 2/8/05 analysis for markers of human fecal pollution. Date Collected Site Number esp Markera (+/-) Human Bacteroides Markera (+/-) HPyV Detectionb (+/-) 2/8/05 D 1 + + + 2/8/05 D 2 + + + 2/8/05 D 3 + + + 2/8/05 D 4 2/8/05 D 5 + 2/8/05 N 1 + + 2/8/05 N 2 + + + 2/8/05 N 3 2/8/05 N 4 + 2/8/05 N 5 + + + a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml. Table 4-6. Results of 3/14/05 analysis for markers of human fecal pollution. Date Collected Site Number esp Markera (+/-) Human Bacteroides Markera (+/-) HPyV Detectionb (+/-) 3/14/05 D 1 + + + 3/14/05 D 2 + + 3/14/05 D 3 + 3/14/05 D 4 + 3/14/05 D 5 + 3/14/05 N 1 + 3/14/05 N 2 + + 3/14/05 N 3 + 3/14/05 N 4 + 3/14/05 N 5 + + + a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml.

PAGE 64

52 Table 4-7. Results of 4/18/05 analysis for markers of human fecal pollution. Date Collected Site Number esp Markera (+/-) Human Bacteroides Markera (+/-) HPyV Detectionb (+/-) 4/18/05 D 1 + 4/18/05 D 2 + + + 4/18/05 D 3 4/18/05 D 4 4/18/05 D 5 4/18/05 N 1 + + 4/18/05 N 2 + + 4/18/05 N 3 + 4/18/05 N 4 4/18/05 N 5 a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml. Table 4-8. Results of 6/7/05 analysis for markers of human fecal pollution. Date Collected Site Number esp Markera (+/-) Human Bacteroides Markera (+/-) HPyV Detectionb (+/-) 6/7/05 D 1 6/7/05 D 2 6/7/05 D 3 6/7/05 D 4 6/7/05 D 5 6/7/05 N 1 6/7/05 N 2 6/7/05 N 3 6/7/05 N 4 6/7/05 N 5 a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml.

PAGE 65

53 Discussion The Jacksonville area utilizes both sewer and septic systems to dispose of waste. Breaks in sewer lines, overflows of lift stations and faulty septic tanks have led to sewage contamination of canals and creeks. Three different types of human fecal indicators were used to assess the quality of canals and creeks. Seventy samples were screened for all three markers. One or more of the markers was found in 23 (33%) of the samples. HPyVs were detected in 9 out of 9 (100%) of the samples that contained both the esp marker and Bacteroides marker. A total of 14 samples were positive for Bacteroides marker, of these 13 (93%) were also positive for HPyVs. A total of 12 samples were positive for the esp marker, of these 10 (83%) were also positive for HPyVs. (Table 4-14). A higher number of samples were positive for the presence of HPyVs (n=23) than both the esp marker (n=12) and the Bacteroides (n=14), this could be attributed a larger volume of water used in the HPyVs analysis. Also, viruses tend to be slightly more stable in environmental conditions. Table 4-9. Percent positive correlation of the three indicators used to identify human fecal pollution. Percent Positive Correlation + esp + Bacteroides +esp + Bacteroides + HPyVs 83% 93% 100% + Bacteroides 75% 100% 100% + esp 100% 75% 100% Instances occurred in which only the esp marker or only the Bacteroides marker was found in a sample. While this study was not designed to address and explain these scenarios, one reason for our observations may be due to disturbance of sediment of the canals. Numerous studies have shown microorganisms have the ability to persist for long

PAGE 66

54 periods of time in the sediment of lakes and rivers (Anderson et al. 2005; Lisle et al. 2004; Stenstrom and Carlander 2001). Recreational activities are frequent in the canals and creeks that were sampled. These activities could have led to a disturbance in the sediment and subsequently the release of microorganisms to the water. Further studies could be done to analyze the microbial quality of the sediment in areas where water sampling occurs. Overall, HPyVs were consistently present in samples which both the human specific esp marker and the Bacteroides marker were detected. This is further evidence that the presence of HPyVs is a valuable addition to the Microbial Source Tracking ‘toolbox’.

PAGE 67

CHAPTER 5 HUMAN POLYOMAVIRUSES AS INDICATORS OF HUMAN-DERIVED FECAL POLLUTION IN ENVIRONMENTAL WATER SAMPLES: FECAL INDICATORS IN GAINESVILLE'S URBAN CREEKS There are 31 wastewater facilities in Alachua County. From January 1st to December 31st, 2004, there were 11 sewage spills reported in Alachua County with a total of 24,500 gallons of sewage being released into the environment (Clean Water Fund). Sewage spills occur due to various reasons including clogged sewer lines (e.g. grease clogs), aged pipes and storm events that led to an overload of system capacity. Creeks of Gainesville can become riddled with sewage during sewer line malfunctions. Gainesville Regional Utilities uses total and fecal coliforms as a measure of water quality; however total and fecal coliforms counts along with Enterococci counts are a conservative measure of fecal contamination in water and little information is construed from enumerating these indicator organisms. The presence of these microorganisms can be attributed to an assortment of possible animal and/or human sources. Enterococcus faecium is one of the dominant enterococci found in human feces, and the enterococcal surface protein gene (esp) found in this species is associated with human, but not animal-derived, fecal matter (Scott et al. 2004). Scott et al. (2004) developed a PCR based method to detect the esp gene in waters suspected of human fecal pollution. Determining sources of fecal pollution allows for cost-effective remediation of contaminated waters and more accurate risk assessment for consumers and swimmers. 55

PAGE 68

56 The objective of this study was to use the method developed to detect HPyVs in environmental water samples suspected of containing human fecal pollution, and to then compare those results with bacteriological counts and the presence of the esp marker. Materials and Methods Sample Collection Samples were collected from urban creeks of Gainesville, Florida (Hogtown Creek, Tumblin Creek, and the Sweetwater Branch). All samples were collected in sterile bottles, transported to the laboratory on ice then stored at 4C until processed. All samples were processed within 24 hours of collection. Samples were collected from October, 2004 through June, 2005. Processing of Samples for Total Coliforms Total coliforms were isolated by membrane filtration according to standard methods (Section 9222). Volumes of 0.1 ml, 1.0 ml and 100 ml of each sample were filtered. Filters were lifted, placed on mEndo agar (Difco) and incubated at 35 0.5C for 24 hours. Total coliforms were enumerated by counting colonies with a pink to dark-red color having a metallic sheen. Processing of Samples for Fecal Coliforms The Most Probable Number (MPN) of fecal coliforms in each sample was determined using multiple-tube fermentation technique. For each sample three tubes containing A-1 Broth (Fisher) were inoculated with 0.1 ml, 1.0 ml, and 10 ml. Tubes were incubated at 35 0.5C for 3 hours then transferred to a water bath at 44 0.5C for 21 hours. Gas production in any tube within 24 hours indicated a positive reaction and thus the presence fecal coliforms. MPN was calculated from the number of positive tubes as described in Standard Methods (Section 9221C).

PAGE 69

57 Processing of Samples for Enterococci Enterococci were isolated by membrane filtration. Volumes of 0.1 ml, 1.0 ml and 100 ml of each sample were filtered. Filters were lifted, placed on mE agar (Difco) and incubated at 41 0.5C for 48 hours. All colonies having a light or dark red color were counted as enterococci (Standard Methods Section 9230C). Processing of Samples for esp Detection Samples were processed as previously described in Materials and Methods of Chapter 4. Processing of Samples for HPyV Detection Samples were processed as previously described in Materials and Methods of Chapter 4. Results Samples were collected in the months of October (Table 5-1), November (Table 5-2), January (Table 5-3), February (Table 5-4) and June (Table 5-5), and processed for total and fecal coliforms, Enterococci and the presence of the esp maker and HPyVs. A total of 22 sites were sampled in October 2004. Sites S3, S7, S11 and S38 were positive for the esp marker. HPyVs were detected in sites S3, S7 and S38. Based on EPA water guidelines (Table 5-6), all sites did not meet total coliform or enterococci standards and only sites S13P, S13R, S39, S41P, S42, S45P and S46 were considered uncontaminated by fecal pollution based on fecal coliform counts. A total of 13 sites were sampled in November 2004. Sites S7, S9, S11, S23 and S38 were positive for both the esp marker and HPyVs. All enterococci counts were above EPA standards. Sites S7, S9, S11, S20 and S23 were considered ‘safe’ based on

PAGE 70

58 fecal coliform counts. All the sites except for S17M were above acceptable total coliform levels. A total of 11 samples were collected in January 2005. The esp marker and HPyVs were detected in sites S7, S11, S38, SWD and SWU. Enterococci counts were above acceptable levels for all the sites. Only S42 and SWU had total coliform counts below EPA standards. Fecal coliforms counts were above standard levels in sites S7, S23, S37, S38, S42 and S45P. Six samples were collected in February 2005. The esp marker and HPyVs were detected in sites S7, S38 and SWU. All sites were above acceptable enterococci counts and all but SWU were above acceptable total coliform counts. Only two sites, S37 and SWU, were below EPA guidelines for fecal coliform counts. A total of 10 samples were collected in June 2005. The esp marker and HPyVs were detected in sites S3, S8, S9, S13P, S37 and S38. Only HPyVs were present in sample S7. All samples were above acceptable levels for both total coliforms and enterococci. Only S8 and S13P did not met EPA standards for fecal coliforms. Discussion Based on EPA guidelines, a majority of samples collected were considered unsafe for human consumption and recreation. The creeks and streams that the samples were taken from are frequented by wildlife. High enterococci and coliform counts could be credited to either the presence of wildlife or human fecal contamination. Using indicators of human fecal pollution, the esp marker and the detection of HPyVs, a total of 24 samples were deemed unsafe for human interactions. Sources of human fecal pollution may include bypassed and failing septic tanks, stormwater runoff, sanitary sewer overflows and leaking sewer pipes.

PAGE 71

59 In one instance the esp marker was found when the presence of HPyVs was not detected, and in one instance HPyVs were detected when the esp marker was not detected. The absence of the HPyVs in the presence of the esp marker may be due to experimental error when extracting DNA. Experimental error may also be the reason for the absence of the esp marker in the presence of HPyVs. However, the problem could possibly be attributed to the differences in volume assayed; a total of 600 ml was used in the HPyVs assay whereas only 100 ml was used in the esp assay. Overall, the results of the esp marker and the HPyVs concurred for 60 of the 62 (97%) samples.

PAGE 72

60 Table 5-1. Results of October 2004 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Site Total Coliformsa Fecal Coliformsb Enterococcusa Espc HPyVsc S3 7000 > 2400 2780 + + S7 12000 1600 2980 + + S11 6000 920 3500 + S12 3000 1600 3940 S13P 5000 540 700 S13R 13000 540 2160 S16 4000 920 6210 S17M 4000 920 1060 S18 9000 350 1200 S20 5000 540 4480 S22 3000 920 1820 S23 5000 920 5380 S31 10000 > 2400 4100 S37 5000 > 2400 1980 S38 23000 920 2660 + + S39 13000 350 2100 S41P 8000 540 1120 S42 4000 170 2840 S45M 6000 920 2280 S45P 5000 350 760 S46 7000 350 2160 SSE 12000 > 2400 4280 a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product.

PAGE 73

61 Table 5-2. Results of November 2004 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Site Total Coliformsa Fecal Coliformsb Enterococcusa Espc HPyVsc S7 11000 350 5640 + + S9 5000 540 2680 + + S11 9000 280 2900 + + S12 5000 1600 4200 S17M 1000 920 3140 S18 27000 920 1200 S20 7000 540 3140 S23 7000 540 7960 + + S31 6000 >2400 2240 S38 16000 >2400 5800 + + S43 5000 1600 3700 S46 4000 1600 2680 SSE 10000 920 2460 a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product.

PAGE 74

62 Table 5-3. Results of January 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Site Total Coliformsa Fecal Coliformsb Enterococcusa Espc HPyVsc S3 8000 540 1020 S7 5000 920 1400 + + S11 3000 540 4000 + + S23 5000 920 2940 S37 6000 920 2640 S38 5000 1600 4960 + + S42 1000 > 2400 3200 S45M 5000 540 1520 S45P 4000 > 2400 4620 SWD 3000 540 1080 + + SWU 1000 540 880 + + a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product. Table 5-4. Results of February 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Site Total Coliformsa Fecal Coliformsb Enterococcusa Espc HPyVsc S3 18000 920 1540 S7 10000 920 2000 + + S11 8000 920 1360 S37 4000 540 2200 S38 18000 920 2080 + + SWU 1000 540 880 + + a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product.

PAGE 75

63 Table 5-5. Results of June 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Site Total Coliformsa Fecal Coliformsb Enterococcusa Espc HPyVsc S3 11000 540 3800 + + S4 10000 350 7400 S7 5000 540 1200 + S8 32000 1600 2200 + + S9 10000 240 3200 + + S12 4000 220 4800 S13P 4000 920 1600 + + S23 4000 130 2000 S37 4000 170 2000 + + S38 6000 170 3800 + + a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product. Table 5-6. Guidelines for total coliforms, fecal coliforms, E. coli, and enterococci in surface waters.* INDICATOR GUIDELINES Total Coliforms Monthly average of < 1000/100 ml, < 1000/100 ml in 20% of the samples, and < 2400/100 ml on a single day Fecal Coliforms Monthly average of 200/100ml, < 400/100 ml in 10% of samples, and < 800/100 ml on a single day E. coli Monthly average of < 126/100 ml and < 235/100 ml on a single day Enterococci Monthly average of < 35/100 ml and < 104/100 ml on a single day

PAGE 76

CHAPTER 6 SUMMARY AND CONCLUSIONS It is imperative that waters used for recreation, shellfish harvesting, and fishing not be contaminated with human fecal pollution. Human fecal matter has the potential to contain various pathogens including E. coli, Shigella spp., Salmonella spp., Campylobacter spp., Vibrio spp., Adenovirus, Rotavirus, Norovirus, Enterovirus, Giardi lambia, Crytosporidium parvum, and Entamoeba histolytica. The introduction of human fecal pollution into surface waters can occur through various ways include bypassed and failing septic tanks, stormwater runoff, sanitary sewer overflows, leaking sewer pipes and failing wastewater treatment plants. Microbial Source Tracking is the term used to describe methodologies use to determine sources of fecal pollution in environmental waters. Human specific indicators allows for a more stringent analysis of water quality in regards to human health. This is the first documented study using a virus found in urine as an indicator of fecal pollution. The first part of this study was designed to examine any seasonal trends in the distribution of HPyVs, because some enteric viruses have been documented as having a seasonal distribution. For example, Rotavirus detection is significantly higher in winter (p<0.05) (Ono et al. 2001; Brittencourt et al. 2000; Mehnert et al. 1993), and enteroviruses detection is higher in the summer months (Tani et al. 1995). Samples of raw sewage were analyzed for HPyVs over a representative nine month period, and HPyVs were consistently found. This suggests that there is not a seasonal distribution of HPyVs excretion. 64

PAGE 77

65 Coupled with the study of seasonal distribution, the human specificity of the primers used in this study was validated. The International Committee on Taxonomy of Viruses recognizes 13 different polyomaviruses, two of which are human specific. Of the 13 recognized, Bovine Polyomavirus is the only virus specific to livestock. To ensure that the primers chosen to use in this study did not amplify the polyomavirus found in bovines, diary waste was tested for the presence of HPyVs. Out of 18 samples analyzed, HPyVs were not detected in any of the samples. In areas where human waste or diary waste is suspected of contaminating surface water, the method developed in this study could be vital in identifying human fecal pollution which would allow for immediate remedial actions. During the latter half of this study, a method to concentrate HPyVs from water samples was developed. The developed method was then used to identify human fecal pollution in environmental waters in two individual studies. Enteric viruses can be concentrated from water by decreasing the pH of the water to 3.5 and filtering the sample through a nitrocellulose filter (Lukasik et al. 2000). Using this same method HPyVs were concentrated from water samples, and one microliter of DNA extract, which corresponded to one microliter of raw sewage, gave a positive PCR product. Water was also inoculated with a known titer of BK virus (ATCC #VR-837), and the method developed was able to detect approximately 150 BK viral particles; this combined with the observation that individuals experiencing asymptomatic viruria can shed up to 1.5 x 109 virus particles in a day (Bofill-Mas et al. 2000), make this a relatively sensitive method.

PAGE 78

66 The first study used to assess the potential use of HPyVs as an indication of human fecal pollution in environmental water sample was done in the Jacksonville area. Water samples were taken canals and creeks in the Jacksonville area and tested for three different human specific markers of human fecal pollution. The presence of all three markers did not coincide in every sample suspect of human fecal pollution. This could possibly be accredited to the differences of the actual indicator organisms. The esp marker is found in Enterococcus faecium, and aerotolerant bacteria, the Bacteroides marker is anaerobic bacteria and HPyVs are double stranded DNA viruses. It is well known that aerotolerant bacteria, anaerobic bacteria, and viruses have different survival rates in environmental conditions. In addition, the anaerobic Bacteroides and HPyVs have the potential to persist more readily in the sediment of canals and creeks. Recreational activities that lead to the disturbance of sediment might account for the presence of these markers in the absence of the esp marker. Overall, samples that were positive for the esp marker and the Bacteroides marker were also positive for HPyVs. The second study used to assess the potential use of HPyVs as an indication of human fecal pollution in environmental water sample was done in the Gainesville area. The presence of HPyVs was compared to the presence of the esp marker and bacteriological counts. The results of the esp marker and the results for HPyVs were the same for 60 of 62 samples (97%). The EPA specifics that fecal pollution can be assumed when total coliform are > 2400 cfu per 100ml, when fecal coliforms are > 800 cfu per 100 ml, or Enterococci are > 104 cfu per 100 ml (EPA’s BEACH Watch Program: 2000 Update. EPA-823-F-00-012). The presence of HPyVs and the esp marker always occurred when total coliforms and Enterococci were above EPA standards; however

PAGE 79

67 100% (n=62) of the samples taken were above EPA standards in regards to total coliforms and Enterococci. A total of 29 samples were deemed “safe” for human interaction based on fecal coliform counts. Of the 29, 41% (n=12) were positive for one of the markers of human fecal pollution (esp marker or HPyVs). Twenty-three samples were positive for either the esp marker or HPyVs, of these only 48% (n=11) were above EPA standards for fecal coliforms. Based on the results of the Gainesville area study, the presence of human fecal pollution can not be predicted using bacteriological counts. Overall, this study suggests that the presence of HPyVs in environmental samples is a good indication of human fecal pollution. The work presented shows the test for HPyVs is a rapid and effective method to detect human derived fecal pollution. Further studies correlating the presence of human pathogens would further valid this method.

PAGE 80

LIST OF REFERENCES Agostini, H.T., C.F. Ryschkewitsch and G.L. Stoner (1996) Genotype profile of human polyomavirus JC excreted in urine of immunocompetent individuals. J Clin Microbiol. Jan;34(1):159-64. Akasmit, A. (1993) In: Persing DH, Smith TF, White TJ, editors. Diagnostic molecular microbiology principles and applications. Rochester: Mayo Foundation. p. 364 Anderson, K., J. Whitlock, V. Harwood. (2005) Persistence and differential survival of fecal indicator bacteria in subtropical waters and sediments. Appl Environ Microbiol. 71(6):3041-8. Arthur, R.R., S. Dagostin and K.V. Shah (1989) Detection of BK virus and JC virus in urine and brain tissue by the polymerase chain reaction. J Clin Microbiol. Jun;27(6):1174-9. Aslan-Yilmaz, A., E. Okus and S. Ovez. (2004) Bacteriological indicators of anthropogenic impact prior to and during the recovery of water quality in an extremely polluted estuary, Golden Horn, Turkey. Mar Pollut Bull. Dec;49(11-12):951-8. Behzadbehbahani, A., P.E. Klapper, P.J. Vallely and G.M. Cleator (1997) Detection of BK virus in urine by polymerase chain reaction: a comparison of DNA extraction methods. J Virol Methods. Sep;67(2):161-6. Behzadbehbahani, A., P.E. Klapper, P.J. Vallely, G.M. Cleator and S.H. Khoo (2004) Detection of BK virus and JC virus DNA in urine samples from immunocompromised (HIV-infected) and immunocompetent (HIV-non-infected) patients using polymerase chain reaction and microplate hybridisation. J Clin Virol. Apr;29(4):224-9. Berger, J.R., L. Pall, D. Lanska and M. Whiteman. (1998) Progressive multifocal leukoencephalopathy in patients with HIV infection. J Neurovirol. 1998 Feb;4(1):59-68. Bernhard, A.E. and K.G. Field. (2000a) A PCR assay to discriminate human and ruminant feces on the basis of host differences in Bacteroides-Prevotella genes encoding 16S rRNA. Appl Environ Microbiol. Oct;66(10):4571-4. 68

PAGE 81

69 Bernhard, A.E. and K.G. Field. (2000b) Identification of nonpoint sources of fecal pollution in coastal waters by using host-specific 16S ribosomal DNA genetic markers from fecal anaerobes. Applied Environ Microbiol 66; 1587-1594. Bernhard, A.E., T. Goyard, M.T. Simonich and K.G. Field. (2003) Application of a rapid method for identifying fecal pollution sources in a multi-use estuary. Water Res 37; 909-913. Bisson, J., and V. Cabelli. (1980). Clostridium perfringens as a water pollution indicator. J. Water Pollut. Control Fed. 52:241-248. Bittencourt, J.A., E. Arbo, A.S. Malysz, R. Oravecand C. Dias (2000) Seasonal and age distribution of rotavirus infection in Porto Alegre--Brazil. Braz J Infect Dis. Dec;4(6):279-83. Bofill-Mas, S., M. Formiga-Cruz, P. Clemente-Casares, F. Calafell and R. Girones (2001) Potential transmission of human polyomaviruses through the gastrointestinal tract after exposure to virions or viral DNA. J Virol. Nov;75(21):10290-9. Bofill-Mas, S., S. Pina and R. Girones (2000) Documenting the epidemiologic patterns of polyomaviruses in human populations by studying their presence in urban sewage. Appl Environ Microbiol. Jan;66(1):238-45. Bogitsh, B. and T. Cheng (1998) Human Parasitology. 2nd Edition, San Diego, CA Bonjoch, X., E. Balleste, A.R. Balnch (2005) Enumeration of bifidobacterial populations with selective media to determine the source of waterborne fecal pollution. Water Research 39; 1621 Borchardt, M., N. Haas and R. Hunt (2004) Vulnerability of drinking-water wells in La Crosse, Wisconsin, to enteric-virus contamination from surface water contributions. Appl Environ Microbiol. 70(10):5937-46. Bordalo, A.A., R. Onrassami and C. Dechsakulwatana. (2002) Survival of faecal indicator bacteria in tropical estuarine waters (Bangpakong River, Thailand). J Appl Microbiol. 93(5):864-71. Brenner, D. (1984) In: Bergey’s Manual of Systematic Bacteriology. Vol (1) 5; 410-422 Bull, I.D., M.J. Lockheart, M.M. Elhmmali, D.J. Roberts, and R.P. Evershed. (2002) The origin of faeces by means of biomarker detection. Environ. Int. 27:647. Burkhardt, M. R. (1999) Determination of submicrogram-per liter concentrations of caffeine in surface water and groundwater samples by solid-phase extraction and liquid chromatography. J. AOAC Int. 82:161. Cabelli, V. J., (1979) Am J Pub Health 69; 690.

PAGE 82

70 Carillo, J., E. Estrada and T.C. Hazen (1985) Survival and enumeration of the fecal indicators Bifidbacterium adolescents and Escherichia coli in a tropical rainforest watershed. Applied Environmental Microbiology 50:468-76 Carson, A. C., B. L. Shear, M. R. Ellersieck, and A. Asfaw. (2001) Identification of fecal Escherichia coli from humans and animals by ribotyping. Appl. Environ. Microbiol. 67:1503. Castingnolles, N., F. Petit, I. Mendel, L. Simon, L. Cattolico, and C. Buffet-Janvresse. (1998). Detection of adenovirus in the waters of the Seine river estuary by nested-PCR. Mol. Cell. Probes 12:175-180. Chao, K., C. Chao and W. Chao (2003) Suitability of the traditional microbial indicators and their enumerating methods in the assessment of fecal pollution of subtropical freshwater environments. J Microbiol Immunol Infect. Dec;36(4):288-93. Chapron, C. D., N. A. Ballester, J. H. Fontaine, C.N. Frades, and A.B. Margolin. (2000) Detection of astroviruses, enteroviruses and adenovirus types 40 and 41 in surface waters collected and evaluated by the information collection rule and an integrated cell culture-nested pcr procedure. Applied and Environmental Microbiology 66[6], 2520-2525. Charteris, W. P., P. M. Kelly, L. Morelli, and Collins J. K. (1997) Selective detection, enumeration and identification of potentially probiotic Lactobacillus and Bifidobacterium species in mixed bacterial populations. Int. J. Food Microbiol. 35:1-27. Chou, C., Y. Lin and J. Su (2004) Microbial indicators for differentiation of humanand pig-sourced fecal pollution. J Environ Sci Health A Tox Hazard Subst Environ Eng. Jun;39(6):1415-21. Clesceri, L., A. Greenberg, and A. Eaton (1998) Standard Methods for the Examination of Water and Wastewater 20th ed. American Public Health Association, Maryland. Colwell, R.R. (1993) Non-culturable but still viable and potentially pathogenic bacteria. Zentralblat Bakteriologie 279, 154. Cooke, M.D. (1976) Antibiotic resistance among coliform and fecal coliform bacteria isolated from sewage, seawater, and marine shellfish. Antimicrobial Agents of Chemotherapy 9:879-884. Coyne, M.S. and J.M. Howell. (1994) The fecal coliform/fecal streptococci ratio (FC/FS) and water quality in the bluegrass region of Kentucky. Soil and Science News and Views. 15.9 Internet access: http://hermes.ecn.purdue.edu Crawford, E. M., and R. F. Gesteland. (1964) The adsorption of bacteriophage R17. Virology 22:165.

PAGE 83

71 Crichton P. B. and D.C. Old. (1979) Biotyping of E. coli. The Journal of Mediacal microbiology 12 4 473-486. Cruickshank, R. (1968) Medical Microbiology. 11th ed. Livingstone Ltd, London, UK. Curaldo, P., and D. Robertson (1983) The health consequences of caffeine. Ann Intern Med. 98:641 Del Valle, L., S. Enam, C. Lara, J. Miklossy, K. Khalili and J. Gordon (2004) Primary Central Nervous System Lymphoma Expressing the Human Neurotropic Polyomavirus, JC Virus, Genome Journal of Virology, April Desmarais, T.R., H.M Solo-Gabriele and C.J. Palmer (2002) Influence of soil on fecal indicator organisms in a tidally influenced subtropical environmental. Applied Environmental Microbiology. March, 1165-1172. Dietz, M.E., J.C. Clausen and K.K. Filchak. (2004) Education and changes in residential nonpoint source pollution. Environ Manage. Nov;34(5):684-90. Dohi, Y., N. Tani, N. Kurumatani, and K. Yonemasu. (1995). Seasonal distribution of adenoviruses, enteroviruses and reoviruses in urban river water. Microbiol. Immunol. 39:577-580. Dolei, A., V. Pietropaolo, E. Gomes, C. Di Taranto, M. Ziccheddu, M. A. Spanu, C. Lavorino, M. Manca and A. M. Degener. (2000) Polyomavirus persistence in lymphocytes: prevalence in lymphocytes from blood donors and healthy personnel of a blood transfusion center Journal of General Virology 81, 1967-1973. Dorries, K. (1998). Molecular biology and pathogenesis of human polyomavirus infections. Dev Biol Stand 94, 71. Edwards, E., T.Coyne, P. Daniel, J. Vendrell, J. Murdoch and P. Moore. (1997) Indicator bacteria concentrations of two northwest Arkansas streams in relation to flow and season. American Society of Agricultural Engineers. (40) 1; 103-109. Evangelopoulos, A., N. Legakis, N. Vakalis (2001) Microscopy, PCR, and ELISA applied to the epidemiology of amoebiasis in Greece. Parasitol Int 50(3): 185-9 Feachem, R. (1974) An improved role for faecal coliform to faecal streptococci ratios in the differentiation between human and non-human pollution sources. Water Research 9; 689-690. Feachem, R.G. (1975) An improved role for faecal coliform to faecal streptococci ratios in the differentiation between human and non-human pollution sources (Note) Water Research 9: 689-690. Florida Administrative Code, FL Surface Water Quality Standards, Ch. 62-302.500

PAGE 84

72 Fong, T. and E. Lipp. (2005) Enteric Viruses of Humans and Animals in Aquatic Environments: Health Risks, Detection and Potential Water Quality Assessment Tools. Microbiol and Molecular Biology Reviews 69 (2) 357-371. Formiga-Cruz, M., A. K. Allard, A.C. Condin-Hansson, K. Henshilwood, B. E. Hernoth, J. Jofr, D. N. Lees, F. Lucena, Papapetropoulou, R. E. Rangdale, A. Tsibouxi, A. Vantarakis and R. Girones. (2003) Evaluation of potential viral contamination in shellfish with applicability to diverse geographical areas. Applied and Environmental Microbiology 69 (3) 1556-1563. Fujioka, R. S. (1997) Indicators of marine recreational water quality. In. Hurst C. J. Knusden G.R. McInerney M.J. Stetenbach L.D. and Walter M. V. Ed Manual of environmental microbiology ASM press Washington DC 176-183. Fujioka, R.S. (2001) Monitoring coastal marine waters for spore-forming bacteria of fecal and soil origin to determine point from non-point source pollution. Water Sci Technol. 44(7):181-8 Fujioka, R. S and L.K. Shizumura (1985) Clostridrium perfringens a reliable indicator of stream water quality. Journal of water pollution Control Federation 57; 986-992. Gardner, S.D., A.M. Field, D.V. Coleman and B. Hulme. (1971) New human papovavirus (B.K.) isolated from urine after renal transplantation. Lanet I: 1253-1257. Geldreich, M.H. and B. A. Kenner. (1969) Concepts of fecal streptococci in stream pollution. Journal of the WaterPollution Control Federation 41: 8 Part 2 R336-R352. Gerba, C.P. (1984) Applied and theoretical aspects of virus adsorption to surfaces. Adv Appl Microbiol. 30:133-68. Gerba, C. P. (1987) Phage as indicators of fecal pollution, p. 197. In S. M. Goyal, C. P. Gerba, and G. Bitton (ed.), Phage ecology. Wiley-Interscience, New York, N.Y. Gonzalez, E. A. and J. Blanco. (1989) Serotypes and antibiotic resistance of verotoxigenic (VTEC) necrotizing (NTEC) E. coli strains isolated from calves with diarrhoea. FEMS Microbiology Letters 51(1) 31-36. Hammerum, A.M., and L.B. Jensen (2002) Prevalence of esp, encoding the enterococcal surface protein, in Enterococcus faecalis and Enterococcus faecium isolates from hospital patients, poultry, and pigs in Denmark. J Clin Microbiol 40: 4396. Hardina, C.M. and R.S. Fujioka (1991) Soil: the environmental source of Escherichia coli and enterococci in Hawaii’s stream. Environmental Toxicology Water Quality. 6: 185-95.

PAGE 85

73 Hartel, P. G., J. D. Summer, J. L. Hill, J. V. Collins, J. A. Entry, and W. I. Segars. (2002) Geographic variability of Escherichia coli ribotypes from animals in Idaho and Georgia. J. Environ. Qual. 31:1273. Harwood, V.J., J. Whitlock and V.H. Withington (2000) Classification of the antibiotic resistance patterns of indicator bacteria by discriminant analysis use in predicting the source of fecal contamination in subtropical Florida waters. Appl Environ Microbiol 66:3698-3704. Harwood, V.J., B. Wiggins, C. Hagedon, R.D. Ellender, J. Gooch, J. Kern, M. Samadpour, A.C. Chapman, B.J. Robinson and B.C. Thompson. (2003) Phenotypic library-based microbial source tracking methods: efficacy in the California collaborative study. J Water Health. Dec;1(4):153-66. Havelaar, A. H., W. M. Pot-Hogeboom, K. Furuse, R. Pot, and M. P. Hormann. (1990) F-specific RNA bacteriophages and sensitive host strains in faeces and wastewater of human and animal origin. J App. Bacterio. 69:30. He, J. and S. Jiang (2005) Quantification of Enterococci and Human Adenoviruses in Environmental Samples by Real-Time PCR Applied Environ Microbiol 71 (5); 2250. Herbein S. A., G. M. Simmons, Jr. and S. L. Myers. (1996). Use of Pulsed-Field Gel Electrophoresis (PFGE) to investigate nonpoint fecal coliform sources to tidal inlets on the Eastern shore of the Chesapeake Bay. 96th General Meeting of the American Society for Microbiology, p. 467, May 19-23. New Orleans, LA. Hill, R., W. Straube, A. Palmisano, S. Gibson, and R. Colwell. (1996). Distribution of sewage indicated by Clostridium perfringens at a deep-water disposal site after cessation of sewage disposal. Appl Environ Microbiol. 62:1741-1746. Hirsch, H. and J. Steiger (2003) Polyomavirus BK. Infectious Disease 3: 611-623. Hogan, T.F., B.L. Padgett, D.L. Walker, E.C. Borden and J.A. McBain (1980) Rapid detection and identification of JC virus and BK virus in human urine by using immunofluorescence microscopy. J Clin Microbiol. Feb;11(2):178-83. Holdeman, L. V., I. J. Good, and W. E. C. Moore. (1976) Human fecal flora: variation in bacterial composition within individual and a possible effect of emotional stress Appl. Environ. Microbiol. 31, pp. 359-375. Hsu, F. C., Y.-S. Shieh, J. van Duin, M. J. Beekwilder and M. D. Sobsey. (1995) Genotyping male-specific RNA coliphages by hybridization with oligonucleotide probes. Appl. Environ. Microbiol. 61:3960. Hurst, C., K. A. McClellan and W. H. Benton (1988) Comparasion of cytopathogenicity, immunofluorescence and "in situ" DNA hybridisation as methods for the detection of adenoviruses. Water Res 22; 1547-1552.

PAGE 86

74 Islam, D. and A A Lindberg (1992) Detection of Shigella dysenteriae type 1 and Shigella flexneri in feces by immunomagnetic isolation and polymerase chain reaction. J Clin Microbiol. 30(11): 2801. Jagals, P., W. O. K.Grabow and J. C. de Villers (1995) Evaluation of indicators for assessment of human and animal fecal pollution of surface run-off. Water Science and Technology. 31. 235-241. Jiang, S. (2002) Detection of human adenovirus in coastal waters of Southern California. http://wwwcsgc.ucsd.edu/RESEARCH/PROJPROF_PDF/RC46PD.pdf Jiang, S., R. Noble, and W. Chu (2000) Human adenoviruses and coliphages in urban runoff impacted coastal waters of Southern California Applied and Environmental Microbiology 67; 179-184. Johnson, L.K., M.B. Brown, E.A. Carruthers, J.A. Ferguson, P.E. Dombek and M.J. Sadowsky. (2004) Sample size, library composition, and genotypic diversity among natural populations of Escherichia coli from different animals influence accuracy of determining sources of fecal pollution. Appl Environ Microbiol. Aug;70(8):4478-85 Kelch, W.J. and J.S. Lee. (1978) Antibiotic resistance patterns of gram negative bacteria isolated from environmental sources. Applied Environmental Microbiology 36, 450. Kingsley, D. and G. Richards (2001) Rapid and efficient extraction method for reverse transcription-PCR detection of hepatitis A and norwalk-like viruses in shellfish. Appl Environ Microbiol 67(9):4152-4157 Kistemann, T., T. Classen, C. Koch, F. Dangendorf, R. Fischeder, J. Gebel, V. Vacata, and M. Exner (2002) Microbial load of drinking water reservoir tributaries during extreme rainfall and runoff. Appl Environ Microbiol. 68 (5):2188-97. Kittigul, L., B. Raengsakulrach, S. Siritantikorn, R. Kanyok, et al. (2000) Detection of Poliovirus, hepatitis A virus and rotavirus from sewage and water samples. Southeast Asian J Trop Med Public Health 31(1):41-6 Kittigul, L., S. Ekchaloemkiet, F. Utrarachkij, K. Siripanicgon, D. Sujirarat, S. Pungchitton and A. Boonthum. (2005) An efficient virus concentration method and RT-nested PCR for detection of rotaviruses in environmental water samples. J Virol Methods. 124(1-2):117-22. Kramer, J.B., S. Canonica, J. Hoige and J. Kaschig. (1996) Degradation of fluorescent whitening agents in sunlit natural waters. Environ. Sci. Technol. 30: 2227-2234. Lior, H., A. A. Borczyk, (1987) False positive identifications of Escherichia coli O157. Lancet (I) 333.

PAGE 87

75 Lisle, J., J. Smith, D. Edwards, G. McFeters (2004) Occurrence of microbial indicators and Clostridium perfringens in wastewater, water column samples, sediments, drinking water, and Weddell seal feces collected at McMurdo Station, Antarctica. Appl Environ Microbiol. 70(12):7269-76. Lukasik, J., T.M. Scott, D. Andryshak and S.R. Farrah (2000) Influence of salts on virus adsorption to microporous filters. Appl Environ Microbiol. Jul;66(7):2914-20. Mara, D.D. (1974) Bacteriology for sanitary engineers. Edinburgh and London, Churchill Livingstone p. 209. Mara, D.D. and J.I. Oragui (1981) Occurrence of Rhodococcus coprophilus and associated actinomycetes in feces, sewage, and freshwater. Appl Environ Microbiol. Dec;42(6):1037-42. Mara, D.D. and J.I. Oragui (1983a) Investigation of the survival characteristics of Rhodococcus coprophilus and certain fecal indicator bacteria. Appl Environ Microbiol. Aug;46(2):356-60. Mara, D. D. and J. I. Oragui. (1983b) Sorbitol-fermenting bifidobacteria as specific indicators of human faecal pollution. J. Appl. Bacteriol. 55:349. March, S.B. and S. Ratnam (1986) Sorbitol-MacConkey medium for detection of Escherichia coli O157:H7 associated with hemorrhagic colitis. J Clin Microbiol 23:869-872. Mark, T.M. Total coliform bacteria. American Society for Testing and Materials, 1977: 59-64. Markowitz, R.B., H.C. Thompson, J.F. Mueller, J.A. Cohen and W.S. Dynan (1993) Incidence of BK virus and JC virus viruria in human immunodeficiency virus-infected and -uninfected subjects. J Infect Dis. 1993 Jan;167(1):13-20. Marsalek, J., and Q. Rochfort (2004) Urban wet-weather flows: sources of fecal contamination impacting on recreational waters and threatening drinking-water sources. J Toxicol Environ Health A. Oct 22-Nov 26;67(20-22):1765-77. McOrist, A.L., M. Jackson and A.R. Bird (2002) A comparison of five methods for extraction of bacterial DNA from human faecal samples. J Microbiol Methods. Jul;50(2):131-9. Mehnert, D.U. and K.E.Stewien (1993) Detection and distribution of rotavirus in raw sewage and creeks in Sao Paulo, Brazil. Appl Environ Microbiol. Jan;59(1):140-3. Murphy, F. A., C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo and M. D. Summers. (1995) Virus taxonomy: the classification and nomenclature of viruses. Sixth report of the International Committee on Taxonomy of Viruses. Arch Virol. 10:268.

PAGE 88

76 Murray, P., K. Rosenthal, G. Kobayashi, M. Pfaller (2002) Medical Microbiology. Mosby-Year Book, Inc. St. Louis. Myoda, S.P., C.A. Carson, J.J. Fuhrmann, B.K. Hahm, P.G. Hartel, H. Yampara-Lguise, L. Johnson, R.L. Kuntz, C.H. Nakatsu, M.J. Sadowsky, and M. Samadpour. (2003) Comparison of genotypic-based microbial source tracking methods requiring a host origin database. J Water Health. Dec;1(4):167-80. Nam, H., V. Srinivasan, B. Gillespie, S. Murinda and S. Oliver. (2005) Application of SYBR green real-time PCR assay for specific detection of Salmonella spp. in dairy farm environmental samples. Int J Food Microbiol. 102(2):161-71. Nebra, A.R. and A. Blanch (1999) New Selective Medium for Bifidobacterium spp. Appl Envi. Microbiol, 1; 65(11): 5173 5176. Nicholls, L., T. Grant, R. Brown (2000) Identification of a novel genetic locus that is required for the vitro adhension of a clinical isolate of enterohaemorrhagic E. coli to epithelial cells. Mol Microbiology 35(2): 275-88 Niyogi, S. (2005) Shigellosis. Journal of Microbiology (43) 2; 133-143Oancea, C., I. Klare, W. Witte and G. Werner. (2004) Conjugative transfer of the virulence gene, esp, among isolates of Enterococcus faecium and Enterococcus faecalis. J Antimicrob Chemother. Jul;54(1):232-5. Ono, K., S.K. Rai, M. Chikahira, T. Fujimoto, H. Shibata, Y. Wada, H. Tsuji, Y. Oda, G. Rai, C.D. Shrestha, K. Masuda, H.G. Shrestha, T. Matsumura, H. Hotta, T. Kawamura and S. Uga (2001) Seasonal distribution of enteropathogens detected from diarrheal stool and water samples collected in Kathmandu, Nepal. Southeast Asian J Trop Med Public Health. Sep;32(3):520-6. Orskov, F. and I. Orskov. (1981). Enterobacteriaceae, p. 340-352. In A. I. Broude (ed.), Medical microbiology and infectious diseases. W. B. Saunders Co., Philadelphia, Pa. O’Shea, M.L. and R. Field. (1992) Detection and disinfection of pathogens in storm-generated flows. Can J Microbiol. Apr;38(4):267-76. Padgett, B. and D. Walker (1976) New Human Papovaviruses. Prog. Med. Virol., 22:1-35. Pagdett, B., D. Walker, G.M. ZuRhein, R.J. Eckroade and B.H. Dessel. (1971) Cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy. Lanet I: 1257-1260. Parveen, S., N.C. Hodge, R.E. Stall, S.R. Farrah and M.L. Tamplin (2001) Phenotypic and genotypic characterization of human and nonhuman Escherichia coli. Water Res. Feb;35(2):379-86.

PAGE 89

77 Parveen, S., R.L. Murphree, L. Edminston, C.W. Kaspar, K.M. Portier and M.L. Tamplin (1997) Association of multiple-antibiotic-resistance profiles with point and nonpoint sources of Escherichia coli in Apalachicola Bay. Applied Environmental Microbiology. 63:2607-2612. Parveen S., K.M. Portier, K. Robinson, L. Edminston and M.L. Tamplin (1999) Discriminant analysis of ribiotype profiles of Ecsherichia coli for differentiating human and nonhuman sources of fecal pollution. Applied and Environmental Microbiology 65; 3142-3147. Pavesi, A. (2005) Utility of JC polyomavirus in tracing the pattern of human migrations dating to prehistoric times. J Gen Virol. May;86(Pt 5):1315-26. Peng, X., W. Luo, J. Zhang, S. Wang, and S. Lin (2002) Rapid Detection of Shigella Species in Environmental Sewage by an Immunocapture PCR with Universal Primers. Appl Environ Microbiol 68(5);2580 Pina, S., M. Puig, F. Lucena, J. Jofre, and R. Girones. (1998) Viral pollution in the environment and in shellfish: human adenovirus detection by pcr as an index of human viruses. Appl Environ Microbiol 64:3376-3382. Poinger,T., J.A. Field, T.M. Field, and W. Giger. (1996) Occurrence offluorescent whitening agents in sewage and river determined by solid-phase extraction and high-performance liquid chromatography. Environ Sci & Technol. 30(7): 2220–2226. Polo, C., J.L. Perez, A. Mielnichuck, C.G. Fedele, J. Niubo and A. Tenorio (2004) Prevalence and patterns of polyomavirus urinary excretion in immunocompetent adults and children. Clin Microbiol Infect. Jul;10(7):640-4. Puglisi, E., M. Nicelli, E. Capri, M. Trevisan, A. Del Re (2003) Cholesterol, beta-sitosterol, ergosterol, and coprostanol in agricultural soils. J Environ Qual. 32(2):466-71. Rangdale, R.E. (2003) Development of Methods for Pollution Source Tracking-Stage 3 Consolidated Literature Review. In: Environment Agency North West Region INTERREG IIIB Atlantic Area Programme Resnick, I. G. and M. A. Levin. (1981) Assessment of bifidobacteria as indicators of human fecal pollution. Applied and environmental microbiology 42: 433-438. Reynolds, K., C. Gerba, M. Abbaszadegan, L. Pepper (2001) ICC/PCR detection of enteroviruses and hepatitis A virus in environmental samples. Can J Microbiol 47(2):153-7 Rhodes, M. W. and H. Kator. (1994) Seasonal occurrence of mesophilic Aeromonas spp. as a function of biotype and water quality in temperate freshwater lakes. Water Research 28; 2241-2251.

PAGE 90

78 Rhodes, M. W. and H. Kator (1999) Sorbitol-fermenting bifidobacteria as indicators of diffuse human fecal pollution in estuarine watersheds. Journal of Applied Microbiolology 87; 528-535. Rivera, S.C., T.C. Hazen, and G.A. Toranzos (1988) Isolation of fecal coliforms from pristine sites in a tropical rain forest. Applied Environmental Microbiology 54:513-7. Rogers, C., A. Fitzgerald, M. Carr, B. Covey, J. Thomas and M. Looper. (2004) On-farm management decisions to improve beef quality of market dairy cows. J Dairy Sci. 87(5):1558-64. Roll, B.M. and R.S. Fujioka (1997) Source of fecal indicator bacteria in a brackish tropical stream and their impact on recreational water quality. Water Science Technology 35 (11-12): 179-86. Rumsey, T., K. McLeod, T. Elsasser, S. Kahl and R. Baldwin (2000) Performance and carcass merit of growing beef steers with chlortetracycline-modified sensitivity to pituitary releasing hormones and fed two dietary protein levels. J Anim Sci. 78(11):2765-70. Saenz-Robles, M.T., C.S. Sullivan and J.M. Pipas (2001) Transforming functions of Simian Virus 40. Oncogene Nov 26;20(54):7899-907. Samadpour, M., and N. Chechowitz. (1995) Little Soos Creek microbial source tracking: a survey. University of Washington Department of Health, Seattle. Samadpour, M., M.C. Roberts, C. Kitts, W. Mulugeta and D. Alfi. (2005) The use of ribotyping and antibiotic resistance patterns for identification of host sources of Escherichia coli strains. Lett Appl Microbiol. 40(1):63-8. Schaper, M., J. Jofre, M. Uys, M., and W. O. K. Grabow. (2002) Distribution of genotypes of F-specific RNA bacteriophages in human and non-human sources of faecal pollution in South Africa and Spain. J. Appl. Microbiol. 92:657. 35. Schunk, M., T. Jelinek, K. Wetzel, H. Nothdurft. (2001) Detection of Giardia lamblia and Entamoeba histolytica in stool samples by two enzyme immunoassays. Eur J Clin Microbiol Infect Dis 20 (6):389-91 Scott, T.M., T.M. Jenkins, J. Lukasik and J.B. Rose (2005) Potential use of a host associated molecular marker in Enterococcus faecium as an index of human fecal pollution. Environ Sci Technol. Jan 1;39(1):283-7. Scott, T.M., J. Lukasik and S.R. Farrah (2002a) Improved method for recovery of bacteriophage from large volumes of water using negatively charged microporous filters. Can J Microbiol. Apr;48(4):305-10.

PAGE 91

79 Scott, T.M., J. B. Rose, T. M. Jenkins, S. R. Farrah and J. Lukasik (2002b) Microbial source tracking: current methodology and future directions. Applied and Environmental Microbiology. 68 (12): 5796. Shah, K. V. (1996). Polyomaviruses. Philadelphia: Lippincott–Raven. Shibata, T., H.M. Solo-Gabriele, L.E. Fleming and S. Elmir (2004) Monitoring marine recreational water quality using multiple microbial indicators in an urban tropical environment. Water Research 38: 3119-31. Simmons, G. M., D. F. Waye, S. Herbein, S. Myers, and E. Walker. (2000) Estimating nonpoint fecal coliform sources in Northern Virginia’s Four Mile Run watershed, p. 248. In T. Younos and J. Poff (ed.), Proceedings of the Virginia Water Research Symposium 2000, VWRRC Special ReportSR-19, Blacksburg Simpson, J., J. Santo Domingo and D. Reasoner (2002) Microbial source tracking: state of the science. Environ Sci Technol. Dec 15;36(24):5279-88. Sinton, L. W., A.M. Donnison and C.M. Hastie. (1993) Faecal streptococci as faecal pollution indicators a review. New Zealand Journal of Marine and Freshwater Research 27. 101-137. Sinton, L. W., R.K. Finlay and D.J. Hannah. (1998) Distinguishing human from animal faecal contamination in water: a review. New Zealand Journal of marine and Freshwater Research. Vol 32; 323-348. Skraber, S., B. Gassilloud, C. Gantzer (2004) Comparison of coliforms and coliphages as tools for assessment of viral contamination in river water. Appl Environ Microbiol. Jun;70(6):3644-9. Sneath, P.H.A., N. S. Mair, M. E. Sharp and J. G. Holt. (1986) Bergey's manual of systematic bacteriology. Vol 2. Baltimore, Williams and Wilkins pp. 965-1599. Solo-Gabriele, H.M., M.A. Wolfert, T.R. Desmarasis and C.J. Palmer (2000) Sources of Escherichia coli in a coastal subtropical environment. Applied Environmental Microbiology 66 (1): 230-7. Stoeckel, D.M., M.V. Mathes, K.E. Hver, C. Hagedorn, H. Kator, J. Lukasik, T.L. O’Brien, T.W. Fenger, M. Samadpour, K.M Strickler and B.A. Wiggins. (2004) Comparison of seven protocols to identify fecal contamination sources using Escherichia coli. Environ Sci Technol. Nov 15;38(22):6109-17. Stolt, A., K. Sasnauskas, P. Koskela, M. Lehtinen and J. Dillner. (2003) Seroepidemiology of the human polyomaviruses J Gen Virol 84; 1499-1504 Stoner, G.L., D.V. Jobes, M. Fernandez Cobo, H.T. Agostini, S.C. Chima and C.F. Ryschkewitsch (2000) JC virus as a marker of human migration to the Americas. Microbes Infect. Dec;2(15):1905-11.

PAGE 92

80 Strauss, N., Y. Von Schirnding, B. Genthe, E. Jordaan and H. Truter (1995) The health effects of exposure through swimming in South African marine waters: an overview. Urban Health Newsl. 1995 Sep;(26):37-42. Strenstrom, T. and A. Carlander (2001) Occurrence and die-off of indicator organisms in the sediment in two constructed wetlands. Water Sci Technol. 44(11-12):223-30. Sunen, E. and M. Sobsey (1999) Recovery and detection of enterovirus, hepatitis A virus and Norwalk virus in hardshell clams (Mercenaria mercenaria) by RT-PCR methods. J Virol Methods. 1999 Feb;77(2):179-87. Tang, R.J., J.W. Santo Domingo, O.C. Shanks, M.C. Waldron, P.K. Weiskel, R.F. Breault and O.C. Pancorbo. (2005) Specificity and Sensitivity of Fecal Bacteroidetes Human-Specific Primers with Fecal and Wastewater Samples from the U.S. Midwest and Northeast Regions. In Abstracts of the 105th General Meeting of the American Society for Microbiology. June 5th-9th, 2005. Tani, N., Y. Dohi, N. Kurumatani and K. Yonemasu (1995) Seasonal distribution of adenoviruses, enteroviruses and reoviruses in urban river water. Microbiol Immunol. 39(8):577-80. Thielman, N. and R. Guerrant (2004) Clinical practice. Acute infectious diarrhea. N Engl J Med. 350(15):1576-7 Thompson, J., D. Hodge, A. Borczyk. (1990) Rapid biochemical test to identify verocytotoxin-positive strains of Escherichia coli serotype O 157. J Clin Microbiol 28 (2); 165-168. U.S. Environmental Protection Agency. Quality Criteria for Water. EPA-440976023. Washington, DC: U.S. Environmental Protection Agency, 1976. U.S. Environmental Protection Agency. Ambient water quality criteria for bacteria. EPA-A440/5-84-002. Washington, DC: U.S. Environmental Protection Agency, 1986. U.S. Environmental Protection Agency. EPA’s BEACH Watch Program: 2000 Update. EPA-823-F-00-012. Washington, DC: U.S. Environmental Protection Agency, 2000. Vanchiere, J.A., Z.S. White and J.S. Butel (2005) Detection of BK virus and simian virus 40 in the urine of healthy children. J Med Virol. Mar;75(3):447-54. Venkatesan, I. M., and I. R. Kaplan. (1990) Sedimentary coprostanol as an index of sewage addition to Santa Monica Basin, Southern California. Environ. Sci. Technol. 24:208.

PAGE 93

81 Venter, M., S.B Smit, P. Leman and R. Swanepoel (2004) Phylogenetic evidence of widespread distribution of genotype 3 JC virus in Africa and identification of a type 7 isolate in an African AIDS patient. J Gen Virol Aug;85(Pt 8):2215-9. Waage, A., T. Vardundet, V. Lund and G. Kapperud. (1999) Detection of a small number of Campylobacter jenuni and Campylobacter coli in environmental water, sewage, and food samples by semi-nested PCR assay. Applied Envirn Microbiol 65 (4): 1636-43 Wakida, F.T., and D.N. Lerner (2005) Non-agricultural sources of groundwater nitrate: a review and case study. Water Res. Jan;39(1):3-16. Whiley, D.M., K.E. Arden, I.M. Mackay, M.W. Syrmis and T.P. Sloots (2004) Simultaneous detection and differentiation of human polyomaviruses JC and BK by a rapid and sensitive PCR-ELAHA assay and a survey of the JCV subtypes within an Australian population. J Med Virol. Mar;72(3):467-72. White, M.K., J. Gordon, K. Reiss, L. Del Valle, S. Croul, A. Giordano, A. Darbinyan and K. Khablili. (2005) Human polyomaviruses and brain tumors. Brain Res Rev. Jun 24 Widdowson, M., J. Bresee, J. Gentsch and R. Glass (2005) Rotavirus disease and its prevention. Curr Opin Gastroenterol. 21(1):26-31. Wiggins, B.A. (1996) Discriminant analysis of antibiotic resistance patterns in fecal streptococci, a method to differentiate human and animal sources of fecal pollution in natural waters. Applied Environmental Microbiology. 62:3997-4002. Wiggins, B.A., R.W. Andrews, R.A. Conway, C.L. Corr, E.J. Dobratz, D.P. Dougherty, J.R. Eppard, S.R Knupp, M.C. Limjoco, J.M. Mettenburg, J.M. Rinehardt, J. Sonsino, R.L. Torrijos and M.E. Zimmerman (1999) Use of antibiotic resistance analysis to identify nonpoint sources of fecal pollution. Applied Environmental Microbiology 65:3484-3486. Wiggins, B. A., P. W. Cash, W. S. Creamer, W. S. Dart, S. E. Garcia, T. M. Gerecke, J. Han, B.L. Henry, K. B. Hoover, E. L. Johnson, K. C. Jones, J. G. McCarthy, J. McDonough, S. A. Mercer, M. J. Noto, H. Park, M. S. Phillips, S. M. Purner, B. M. Smith, E. N. Stevens and A. K. Varner. (2003) Use of antibiotic resistance analysis for representativeness testing of multiwatershed libraries. Applied and Environmental Microbiology (6) 9; 3399-3405. Wright, R.C. (1986) The seasonality of bacterial quality of water in a tropical developing country. Journal of Hygiene (96):75-82. Wright, R.C. (1989) The survival patterns of selected fecal bacteria in tropical fresh waters. Epdiem Inf 103:606-11.

PAGE 94

82 Yu, H. and J. Bruno (1996) Immunomagnetic-electrochemiluminescent detection of E. coli 0157:H7 and Salmonella typhimurium in foods and environmental water samples. Appl Environ Microbiol 65:3484-6 Zindrou, S., E. Orozco, E. Linder, A. Tellez and A. Bjorkman (2001) Specific detection of Entamoeba histolytica DNA by hemolysin gene targeted PCR. Acta Trop 78 (2): 117-25

PAGE 95

BIOGRAPHICAL SKETCH Shannon Marie McQuaig was born in Rockledge, Florida on April 28, 1982. In 2000, she graduated from Cocoa High School in the top ten of her class. After high school she attended the University of Florida (UF) in Gainesville, FL. In August 2003 she received her Bachelor of Science degree in microbiology and cell science. After receiving her degree she began a Master of Science graduate program in the Microbiology Department at UF. After graduating, Shannon plans to attend the University of South Florida, Tampa, FL were she hopes to earn a Doctor of Philosophy degree under the supervision of Dr. Valerie Harwood. 83