Citation
Gene Therapy for Phenylketonuria: Dominant-Negative Interference in a Recessive Disease

Material Information

Title:
Gene Therapy for Phenylketonuria: Dominant-Negative Interference in a Recessive Disease
Copyright Date:
2008

Subjects

Subjects / Keywords:
DNA ( jstor )
Dosage ( jstor )
Female animals ( jstor )
Gene therapy ( jstor )
Liver ( jstor )
Phenylketonuria ( jstor )
Plasmids ( jstor )
RNA ( jstor )
Small interfering RNA ( jstor )
Transfection ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.
Embargo Date:
7/30/2007

Downloads

This item has the following downloads:


Full Text












GENE THERAPY FOR PHENYLKETONURIA: DOMINANT-NEGATIVE
INTERFERENCE IN A RECESSIVE DISEASE















By

CATHERINE ELISABETH CHARRON


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005

































Copyright 2005

by

Catherine Elisabeth Charron

































I dedicate this work to my parents. If not for their sacrifice, I would not be here today
writing and working in a language that I did not learn from birth. They gave me the
opportunity to lead my life with endless possibilities in sight and see the world as an open
road to explore.















ACKNOWLEDGMENTS

The past four years would not have been so successful without the help and support

of many. First I would like to thank all of my committee members, Drs. Byrne, Laipis,

Lewin and Petersen, for their continued support, positive attitude and broad knowledge of

science. Our meetings were always a source of inspiration to work harder and increase

my general knowledge in sciences. I especially thank my mentor, Dr. Philip Laipis, for

his support, friendship, and trust: without it I would not have had the courage and the

patience to persevere during rough times. I thank him for his continued belief in my

abilities, allowing me to grow as a scientist and as a person.

Many people have come through our laboratory in the past four years, and I am

grateful to all for their friendship and help. Nenita Cortez, Heather Steele, and Wen-Tao

Deng deserve many thanks for helping me begin my work in the laboratory and teaching

me the skills that were indispensable to this project. I thank Jon-Michael Knapp and Ken

Ross for their friendship as I began my work in the lab. Andreas Zori and Dawn Young, I

thank for their eagerness to learn and their patience with me as I strive to become a better

teacher everyday. I give special thanks to Dr Jennifer Embury, without whose expert

knowledge and countless hours spent analyzing our mice, this project would not have

been complete. Her perseverance and generosity are an inspiration and an example that I

will endeavor to follow throughout my career. I am very grateful to Mandy Blackburn

and Brian O'Donnell for their essential technical assistance in the lab. I am deeply









indebted to Stacy Porvasnik for her help with surgeries. Her skills and generosity allowed

for much saved time, giving me the opportunity to finish this project in so few years.

I would like to give special thanks to Dr. Omaththage P. Perera. He is a great

example as a scientist, parent and person, and I am deeply grateful to have met him and

learned so much from him during his short time in the lab.

Appreciation is extended to the Pathology Animal Care Facility and to the Vecor

Core for the support they provide. I also acknowledge the staff in both the Genetics and

Biochemistry Departments, and in the Interdisciplinary Progam's main office.

I would like to thank my family for their love and support during all this time. I

would not be here today if not for their continuing encouragement. Finally, I would like

to thank my husband Sean Lewis for his love and patience. I could not imagine doing this

without him; he is my strength, my love and my best friend.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ...................................................................... ...................iv

LIST O F TA B LE S .......................................................................................... .... ....... ix

LIST OF FIGU RE S ................................................... x

A B STR A C T .............. ......... ... ........................................................ ...................... xii

CHAPTER

1 INTRODUCTION .............................................................. .. ... .............. 1

Phenylketonuria......................... ..............
H isto ry ........................................................... ........................................... 1
Clinical Features .................................. ............................ .. ............
Classic phenotype ....................................................................... 3
Phenotype of early-treated patients ......................................................... 5
Maternal phenylketonuria syndrome ........................................................ 6
G genetics ................................................................................................... 8
The Phenylalanine Metabolic Pathway ..................................... 10
Animal Models for PKU....................... ......... .................. 13
Alternative Therapies ............. ...... .... ........ .. ....... .. 14
Gene Therapy Vectors Based on Adeno-Associated Virus ..... ............... 16
Adeno-Associated Virus Biology................... ..... .................. 17
Current Trends and Applications of rAAV................................ ............. 18
RNA and DNA as Therapeutic Agents .............. ................................. 19
R N A Interference .................................. ........................... .............. 20
R ib ozy m es................................................... 2 1

2 MATERIALS AND METHODS ...................................... ......... .............. 27

In Vitro Ribozym e A analysis .......................... ....... ....... ................ .............. 27
Deprotection of RNA Oligos ........................ ...... ......... .......... ..... 27
Target E nd-L abelling ............. ........................... ................ .............. 28
Time Course of Cleavage Reactions ..................................................... 28
In Vitro Transcription ............ ..................... ......... 29
Full-Length Transcript Cleavage Reaction................................................. 30
M multiple Turnover K inetic A nalysis............................................. ... .............. 30









Molecular Cloning Protocols ......... ..... ......... ................ .. 32
Cloning of Ribozyme Vectors ....... ... ............. ................... .............. 32
Construction of CB-mPAH-F263S .... .................................. 33
Construction of CB-mPAH-Hd..... ..................... .................33
Construction of tRN A-RzI209 ....................... ...... ............. .............. 36
Cell Culture Protocols .......................................... 38
Transient Cell Transfection with CaPO4 ............. ............................... 38
Transient Transfections using Superfect ............. ........................................ 39
Phenylalanine Hydroxylase Activity Assay ......... .... ...... ........... ........ 39
Protein C concentration A ssay......................... ............. ................... .............. 40
W western B letting ............... ................. .................................................. ....... 40
N northern B letting .............................................................................................. 41
Recombinant Adeno Associated Virus Packaging.............................................. 41
Animal Procedures ................. .. ....... .......... ......... 42
Grow th Rate A analysis ............. ................. ......... .... ...................... 42
Blood Collection ................ ... .................. 42
Microplate Serum Phenylalanine Assay ................................. ................. 43
Food Consumption M easurement ... ............................................... 44
Portal Vein Injections ............. ........... .......................... 44
Phenylalanine Loading ......... .............. ................... 45
Sacrifice and Tissue Collection............................ ................. 45
R N ase P protection A ssay s ......................................................................... .... .... 46
Southern Blotting ................................................................... ... ......... 47
RN A Interference Protocols......................................................... ......... ..... 48
G generation of siRN A Cassettes................................................................... 48
Reverse Transcriptase Reaction and Polymerase Chain Reaction ..................... 48

3 ANIMAL M ODEL ANALYSIS........................... ......................... 50

General Sex Dimorphism in BTBR Pahenu2 Mice................................................. 50
G row th C urve A naly sis .................................................................... ....... 50
Serum Phenylalanine L evels.................................. .............. ... .. .............. 53
Food Consumption .............. .... ......... ................. 54
Lifespan Analysis ........................... .............. 55
Phenylalanine Hydroxylase in BTBR Pahenu2 Mice .................... ................. 56
Liver PAH ............... ......... ......... ............ 56
Message levels ................ .............. .............. 56
Protein levels...... ......... ................... .............. 57
Activity levels .............. .... ......... ................. 57
Kidney PAH ................................... ................ 59
D iscu ssion ......... .... .............. ................................ ........................... 59

4 DOMINANT-NEGATIVE INTERFERENCE IN PHENYLKETONURIA ............ 68

Gene Therapy for Phenylketonuria: Divergent Results by Sex in BTBR Pahenu2 .... 69
Liver PAH: Evidence of Dominant-Negative Interference ............................... 70
In vitro Cell Transfection Studies with Normal and Mutant PAH ......................... 71









D iscu ssio n ....................... ..... .................. ................. ............... 7 4

5 DESIGNING A HAMMERHEAD RIBOZYME AGAINST PHENYALANINE
HYDROXYLASE .............. .. ............ ...... ...... ................ 83

Hammerhead Ribozyme Design for mPAH ..................................... 83
In V itro R ibozym e T ests ................ ... .. .. ........... ...... .............. .................... 83
Cloning RzI209 into p21-nhp and Designing a Ribozyme-Resistant mPAH........... 85
Ribozyme 1209 Is Active In Vivo....................... ............................... 86
Ribozyme 1209 Can Overcome Dominant-Negative Interference............................ 88
D iscu ssion ...................... .. .. ......... .. .. ......... ................................... 89

6 GENE THERAPY FOR PHENYLKETONURIA .............................................. 103

Dose-Response in BTBR Pahenu2 Males to rAAV2-CB-mPAH-Hd-WPRE........... 103
Combining an Ineffective Dose of rAAV2-CB-mPAH-Hd-WPRE with Increasing
rA A V 2-CB -RzI209-(-SalI) D oses ...................................... ..... ................. 109
Gene Therapy with a Mildly Effective Dose of rAAV2-CB-mPAH-Hd-WPRE
and Increasing Amounts of rAAV2-CB-RzI209-(-SalI) .................................. 110
D discussion ............. ............................. ........................... 111

7 DEVELOPMENT OF A SINGLE VECTOR CARRYING THE MOUSE PAH
GENE AND RIBOZYME 1209 ........................... ...................123

Design and Cloning of a Dual rAAV Vector............................................. 124
Cell Transfection Experiments with CB-mPAH-Hd-tRNA-RzI209.................... 125
In Vivo Experiments with CB-mPAH-Hd-tRNA-RzI209 ........................... 126
D iscu ssio n ...................... ......1.............. ................................. .. 12 7

8 DEVELOPMENT OF SHORT INTERFERING RNAS FOR MARINE PAH...... 134

Short Interfering RN A Site Selection .............. ...... .................................... 134
siR N A C ell C culture T ests .......................................................................... ..... 135
D iscu ssion .................................................... ................... ............ .. 137

9 SUMMARY, CONCLUSION AND FUTURE DIRECTIONS ............................ 141

G general Significance ................................................................. .............. 14 1
Sum m ary and Conclusion..................................................... ....................... 141
Future D directions ............................... .... ... .... .... ........ ...... 143
Dual Gene Replacement and Antisense Technology Approaches for the Treatment
of Genetic Diseases........................................ 145

G L O S S A R Y ...................................................................................... 14 8

LIST OF REFEREN CES........................................................... .... ............. 151

BIOGRAPHICAL SKETCH .......................................................... ........... .... 165
















LIST OF TABLES

Table page

2-1 M multiple turnover kinetic analysis reaction set-up................................................ 31

2-2 PCR mutagenesis primers for mPAH-F263 S construction. ............................... 34

2-3 PCR mutagenesis primers for mPAH-Hd construction................................. 35

2-4 Oligos for tRNA-RzI209 construction. .......... .............................. ..............37

3-1 Unpaired t-test analysis of litter weights.... ........... .................................... 52

3-2 Results of ANOVA analysis of adult weights. .................................................. 53

3-3 Serum phenylalanine values in BTBR Pahen 2.................................................. 54

3-4 Lifespan analysis............... .. .......................... .. .... .. .... .......... 56

3-5 PAH activity in liver samples. ........................ ................ 58

5-1 Ribozym e 1209 kinetic properties ....... ..... ............................ .. .............. 85

6-1 rAAV2-CB-mPAH-Hd-WPRE vector titers. ............ ... .................. 104

6-2 Serum phenylalanine levels for timed bleeds in male Pahenu2 mice .................... 106

8-1 Short interfering RNAs for mouse PAH. .................................. 136
















LIST OF FIGURES

Figure page

1-1 Phenylalanine conversion to tyrosine ......... ............. ................... ............. 25

1-2 Hammerhead ribozyme structure ............... ........... ......... ....................... 26

3-1 BTBR Pahenu2 mouse model ..... .... ...... ........................... ......... 61

3-2 BTBR mice growth curves. .......... ..... ............................. 62

3-3 M ale and fem ale w eight differences. ........... ................................. .............. 63

3-4 Average daily food consumption ..... ....... .......................... ................. 64

3-5 Northern blot of mouse PAH.......... .................. ......... ........................ 65

3-6 Western blot of mouse PAH.............. ................................... 66

3-7 K idney PAH am ounts................... ...................................... .......................... 67

4-1 rA A V v sector m ap s. ............. ................. ................. ............. .............. ..... 76

4-2 Serum phenylalanine levels after gene therapy wirh rAAV2............. ..............77

4-3 PA H am ounts in m house liver ........................... .............................................. 78

4-4 Cloning strategy for construction of CB-mPAH-F263S.................................... 79

4-5 Test transfections with CB-mPAH and CB-mPAH-F263S. ............................ 80

4-6 Mixed transient transfection results...... ....................... .............. 81

4-7 Western blot of native PAGE with mixed transfection samples ......................... 82

5-1 Mouse PAH ribozyme designs. ........................... ..............91

5-2 Time Course analyses with ribozymes at 20mM MgC12.............. .............. 92

5-3 Time Course analysis of ribozyme 1209 at 5mM MgC12.......... .............. 93

5-4 Ribozyme 1209 kinetic analysis ............. ............................... .............. 94









5-5 Long target cleavage analysis. ............................................................. ... ......... 95

5-6 CB-Rz 209 ............................. ........... ..................... 96

5-7 Cloning strategy for the construction of a ribozyme-resistant mPAH clone........... 97

5-8 CB-RzI209 stably expresses RzI209 in 293 cells ........ ...............................98

5-9 CB-mPAH-Hd is resistant to the ribozyme ...................................... ............... 99

5-10 Ribozyme 1209 successfully prevents dominant-negative interference in 293
cells. .................................................................................... 10 0

5-11 N ull ribozym e designs ...................... .. ............. .. ..................... ............. 101

5-12 The null ribozymes do not prevent dominant-negative interference ................ 102

6-1 Dose response to rAAV2-CB-mPAH-Hd-WPRE. ..................................... 114

6-2 Phenylalanine loading experiment ...... ..................... ................ 115

6-3 RNase protection assay with dose-response animals .......................................... 116

6-4 Southern blot of dose response animals. ............. ........................... ............... 117

6-5 Phenylalanine hydroxylase activity in gene therapy-treated animals ................. 118

6-6 Serum phenylalanine levels after dual vector injections............................... 119

6-7 RNase protection assay for co-injected animals............................................... 120

6-8 Southern blot detection of two rAAV vectors................ ... .............................. 121

6-9 Serum phenylalanine levels after co-injection of mildly effective CB-mPAH-
Hd-WPRE dose and increasing amounts of CB-RzI209-(-Sal). ......................... 122

7-1 tRN A -R zI209 design ......................... ............. .. ....................... ............. 129

7-2 Cloning strategy for construction of tRNA-RzI209 cassette............. ............. 130

7-3 Results of transient cell transfections with CB-mPAH-Hd-tRNA-RzI209 ......... 131

7-4 tRNA-RzI209 activity and expression in HEK-293 cells. ................................ 132

7-5 In vivo results with CB-mPAH-Hd-tRNA-RzI209 ............. .... ............ 133

8-1 Cell culture siRNA working concentration determination.................................. 139

8-2 M house PAH siRNA test results. .................................................. ............ 140















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

GENE THERAPY FOR PHENYLKETONURIA: DOMINANT-NEGATIVE
INTERFERENCE IN A RECESSIVE DISEASE

By

Catherine Elisabeth Charron

August 2005

Chair: Philip J. Laipis
Major Department: Biochemistry and Molecular Biology

Phenylketonuria (PKU) is an autosomal recessive disease where phenylalanine

accumulates in the blood; high brain levels of phenylalanine often lead to mental

retardation. The enzyme phenylalanine hydroxylase (PAH), which converts

phenylalanine to tyrosine, is the mutated gene for over 97% of patients. Dietary

restriction of phenylalanine is the only form of therapy for PKU and is recommended for

life. Unfortunately patients often go off diet during adolescence, and this has led to a rise

in maternal PKU syndrome, the increased incidence of birth defects in children born to

phenylketonuric women. Gene therapy for phenylketonuria would cure the

hyperphenylalaninemia (HPA) and help prevent maternal PKU syndrome.

Using recombinant adeno-associated virus serotype 2 (rAAV2), we have

successfully delivered the mouse PAH gene to male mice and cured the HPA. While

successful, the doses needed in the Pahnu2 mouse model are 5 to 10 times higher than

those used to cure hemophilia A in a mouse model. The Pahenu2 mouse model has a









missense mutation in PAH rendering the enzyme inactive, and we found that PAH is

present in the liver at 30 percent of normal levels. Since the enzyme is a homotetramer,

dominant-negative interference after gene therapy could explain the need for high rAAV

doses to cure HPA. Using transient transfections we confirmed that mutant and normal

monomer interact together and reduce total PAH activity.

To prevent the dominant-negative interference, we developed a ribozyme that

cleaves the endogenous PAH message. When both ribozyme and resistant PAH gene

were delivered in separate rAAV vectors, no improvement in the effectiveness of the

therapy was observed. Endogenous PAH message was reduced in liver samples

confirming ribozyme activity in vivo. A single vector was constructed to contain the

resistant PAH gene and the ribozyme expressed by a modified tRNA'al promoter. The

novel vector was delivered to male Pahenu2 mice and normalization of serum

phenylalanine levels was achieved with four fold lower doses than with the original CB-

mPAH vector, confirming the dominant-negative interference hypothesis. This

observation of dominant-negative interference to gene therapy in a classic recessive

disorder may prove quite common in many human genetic diseases.














CHAPTER 1
INTRODUCTION

Phenylketonuria

Phenylketonuria (PKU) is one of the most commonly inherited human genetic

diseases with an incidence in the United States (US) around 1 in 15,000 births. The gene

affected in the majority (97%) of patients is phenylalanine hydroxylase (PAH), and the

disease is inherited as an autosomal recessive disorder. Accumulation of phenylalanine

(Phe) in the blood, brain and other organs is the cause of the disease, classically

characterized by severe mental retardation. Since the 1960s, severe (>lmM) or milder

(0.36-1mM) hyperphenylalaninemia (HPA) have been detected in the neonatal period,

and treated by the dietary restriction of phenylalanine. If blood Phe levels are kept within

a nontoxic range throughout childhood, brain and cognitive development are near normal.

Unfortunately, the diet is both expensive and unpleasant, and is now recommended for

life by physicians. This chapter presents a summary of the current knowledge on

phenylketonuria including a discussion of the issues associated with maternal

phenylketonuria syndrome.

History

The classic phenylketonuria phenotype originally described by Folling in 1934 is

characterized by severe mental retardation, microcephaly, delayed speech, seizures,

eczema and behavior abnormalities.1 When Folling discovered that two of his patients

presenting with the same symptoms were related, he quickly realized that this form of

mental retardation was inherited in a recessive pattern. After chemical analysis, he









determined that the patients excreted phenylpyruvic acid in their urine: he had discovered

a new inborn error of metabolism, the first mental retardation to have a recognized

chemical feature.2 In 1937 the disease was renamed phenylketonuria to emphasize this

biochemical feature.2

Penrose, in the United Kingdom (UK), and Jervis, in the US, studied the known

patients extensively because of the interest generated by this new inborn error of

metabolism and its effect on intelligence. They very quickly observed varying degrees of

severity in terms of the quantitative trait and described patients (using the common terms

at the time) as imbeciles, idiots or simple morons. Since sex chromosome linkage was

found to be negative, the disease was known to be autosomal and suspected of having

undetermined phenotype-influencing factors either environmental or genetic. They

reported a higher number of cases in white populations and calculated the carrier

frequency to be approximately 1 in 100 for both the US and the UK. Penrose used PKU

as a medical example to challenge eugenics since for eliminating PKU from the

population eugenic proponents would have to sterilize one percent of the population:

"Only a lunatic would advocate such a procedure to prevent the occurrence of a handful

of harmless imbeciles." 2: 198 He also theorized on how altering body metabolism could

influence the psychiatric manifestation of the disease, accurately predicting the future

success of treating PKU by dietary therapy.

Hyperphenylalaninemia (HPA) was found to be the cause of the disease by Jervis

in 1947, and the defective enzyme was determined to be liver PAH in 1953 by

Udenfriend and Cooper.3 In the same year, Bickel demonstrated the possibility of

improving the mental retardation by using a Phe-restricted diet. The need to identify PKU









patients early became obvious: at the time it is estimated that one percent of the

population in mental institutions had PKU. In 1957 the ferric chloride "diaper test" was

tested in some California well-baby clinics, but the test proved to be unreliable during the

first month of life. Four years later a reliable assay was developed to screen blood-spots

from newborns for hyperphenylalaninemia.4 This made neonatal screening possible and

allowed for the Phe-restricted diet to be started before one month of life. During the next

two decades neonatal screening was instituted throughout the Western World and

thousands of PKU patients have been placed on diets shortly after birth and given the

opportunity to develop normally.

Clinical Features

Classic phenotype

Although mental retardation is the main feature of the untreated patient, the

mechanism by which phenylalanine causes the disease is still not known. Recent studies

display the potential risks associated with high Phe concentration in cerebrospinal fluid

(CSF). Patch-clamp experiments show that by competing for binding sites on NMDA and

non-NMDA receptors, Phe depresses glutamate receptor function in hippocampal and

cerebrocortical cultured neurons.5 The glutamate receptor is associated with formation of

synapses during early development and in dendritic spine changes in adult tissue, and

thus it is involved in memory performance and learning. In vivo the glutamate receptor is

not saturated by its substrate and thus could effectively be inhibited by higher CSF Phe

levels, most likely leading to memory and learning dysfunctions. The BTBR Pahenu2

mouse model brain (see later section) shows an up-regulation of the density of NMDA

receptors as determined by radioactive ligand binding and western blotting for specific

subunits of NMDA receptors.6 AMPA receptor subunits (a non-NMDA glutamate









receptor) are also found to be elevated as compared to the heterozygote forebrain

samples.

A study measuring Na+, K+-ATPase activity in erythrocyte membranes from treated

PKU patients has shown that there is a negative correlation between ATPase activity and

the serum Phe concentration in the patients. The patients who had serum Phe levels

above 0.30mM had decreased Na K+-ATPase activity; this correlates with the

observation that ATPase activity is reduced in the cortex of rats subjected to experimental

PKU. The same isozyme of the ATPase is present in the brain, and loss of its activity

occurs in neurodegenerative disorders. Direct inhibition of the Na+, K+-ATPase is

associated with glutamate release. However, it is unknown at this point if the decreased

activity in erythrocytes is similar in the brain, and if this is somehow related to the

increase in NMDA receptors observed in the brains of Pahenu2 mice. Creatine kinase

activity, important in maintaining energy homeostasis in the brain, and dopamine

synthesis have been found to be reduced in hyperphenylalaninemic mouse or rat brains,

adding to the complexity of the phenotype.8,9

An earlier study in a mouse model with inducible hyperphenylalaninemia by

administration of Phe in the drinking water examined adult mice brains. Statistically

significant decreases in the muscarinic acetylcholine receptors in the hippocampus and

cerebral cortex were observed.10 Phe has been shown to inhibit ATP-sulfurylase

decreasing the synthesis of sulfatides which are myelin-associated lipids. The decrease in

sulfatides results in lower protection levels of myelin and higher myelin turnover not

compensated by higher myelin synthesis. Low myelination was observed in the brain

autopsy of severe untreated PKU patients and in the Pahnu2 brains.8'11 The brains in the









induced HPA study showed loss of the acetylcholine receptor in a [Phe]- and time of

exposure-dependent manner in a region of the brain associated with acquisition and long-

term storage of information. The association of specific neuronal receptors and possible

permanent brain damage with HPA supports the need for lifelong therapy.

Phenotype of early-treated patients

Once neonatal detection of hyperphenylalaninemia was possible, patients were

placed, within one month after birth, on a phenylalanine-free diet. This diet prevents the

elevation of serum Phe levels and the neuropsychological phenotype is averted. The diet

consists of a mixture of free amino acids or modified protein hydrolysates and is ingested

as a drink after dilution in water. The commercial products currently available have

improved since the early 1960s in terms of overall nutritional qualities and vitamin

balance, and have been shown to lead to normal physical growth in children.12 However,

the taste and smell of the products are poor, and make compliance to the diet difficult.

Phenylketonuric children must be closely followed throughout their childhood by a clinic

to monitor serum Phe levels, growth parameters and diet intake.

In the 1960s, a few reports came out suggesting that termination of diet in early

childhood would not lead to any side effects. Unfortunately, the conclusion was

premature. In 1978, and in a follow up study in 1991, Smith et al. showed that

termination or relaxation of the diet can lead to loss of intelligence quotient (IQ)

points.13,14 Poor dietary control in early and continuously-treated PKU patients (10.8

years-old) affects short-term memory, selective attention, behavioral inhibition and rule-

based behavior as compared to well-controlled PKU patients with Phe levels below

400tmol/l and age- and IQ-matched normal control subjects.15 In the same study, the

better controlled patients had significant, but mild, impairments in planning and sustained









attention as compared to the normal subjects. Again, this emphasizes the need to find a

better cure for PKU.

Maternal phenylketonuria syndrome

Maternal PKU syndrome refers to the increased range of birth defects seen in

children born of hyperphenylalaninemic mothers on a poorly controlled diet. Growth

retardation, psychomotor handicaps and other birth defects have been reported.16 High

phenylalanine in the mother was first noted to be teratogenic to the fetus by Dent in 1956

and Mabry in 1963.17 The first reports noted mental retardation in the non-PKU offspring

of PKU mothers, but before the end of the decade reports on microcephaly, intrauterine

growth retardation, and high frequency of congenital heart defects were published.17

Since diet was not recommended for life after its early institution in the 1960s and the

1970s, the rise in maternal PKU syndrome came about as the first early-treated patients

reached childbearing age. The extent of the syndrome was not fully understood until the

report from Lenke and Levy, compiling data from a wide range of metabolic centers

across the world, was published in the New England Journal of Medicine in 1980.18

Mental retardation in the children born to women with Phe at 20mg/dL (untreated classic

PKU) was found to occur in 92% of cases, microcephaly in 73%, congenital heart defects

in 12% and low birth weight, below 2.5kg, in 40% of births. These risks were shown to

increase as the mother's Phe levels increased. In the US, two thirds of phenylketonuric

women are not on diet when they become pregnant.19 The benefits of treating PKU

patients from infancy could be erased if this increase in birth defects, an unforeseen side-

effect of the prior success with PKU, is not addressed.20

The Maternal PKU Collaborative Study was started in 1984 to examine the effects

of phenylalanine-control during gestation on pregnancy outcomes. The international









study enrolled 382 women with 574 pregnancies.21 The women were monitored during

pregnancy, and the children followed until 6-7 years of age to measure cognitive

development.22 The frequency of abnormalities in the children was found to be directly

related to maternal phenylalanine levels during pregnancy.16

The range of birth defects attributable to maternal PKU syndrome includes prenatal

growth retardation, microcephaly, congenital heart disease and facial dysmorphias.23

While fetal loss for PKU women is comparable to the normal averages, increases in these

birth defects are always related to phenylalanine levels and length of exposure during

gestation.23 Control prior to conception and control below 360tmol/L achieved by 10

weeks of gestation will lead to a normal or near normal outcome both at birth and in IQ at

follow up. Congenital heart disease is not strictly related to Phe concentration, but its

frequency is increased when poor control with inadequate protein and vitamin intake

occurs during the first trimester.22 Postnatal growth retardation is inversely correlated to

phenylalanine control during the gestation period; IQ goes down significantly in the same

manner. Women with IQ less than 85 need special support since their adherence to the

diet is not as easily achieved: currently in the US the status of care and support is not

adequate to allow for proper control and better pregnancy outcomes in these women.

Other factors besides phenylalanine levels are thought to affect pregnancy outcome

and the child's IQ at 6 to 7 years of age. These include age of the mother, socioeconomic

status, parental IQ, and home characteristics.24 Home characteristics and parental IQ can

explain most of the lower than expected IQ scores in the children; more than three of the

known risk factors for one pregnancy also can lead to poorer than expected outcome.

Nonetheless, nine women with classic PKU observing late diet control had children who









demonstrated higher than expected IQs at 6 years.24 A common feature between maternal

PKU syndrome, fetal alcohol syndrome and pyruvate dehydrogenase deficiency is a

potent inhibition of pyruvate dehydrogenase: since modifier genes are known to prevent

toxicity in fetal alcohol syndrome, the possibility of modifier genes for PKU is an

attractive explanation for the variance in the results observed in the late-treated group.24

Genetics

The incidence of the disease in the US varies from 1 in 13,500 to 1 in 19,000 births.

For non-PKU hyperphenylalaninemia, the estimate is 1 in 48,000 births.25 The prevalence

of PKU is higher in white and Native American than in black, hispanic and asian

populations. Much allelic diversity has been reported at the locus (>450 known

mutations); an extensive database containing all of the known mutations is located at

http://www.pahdb.mcgil.ca.26 This diversity leads to much phenotypic variability even

amongst patients with the same PAH genotype. Other genetic and environmental factors

probably influence the clinical phenotype but have yet to be elucidated.

PAH is located on the human chromosome 12 at position q22-q24.1.27 The first

human cDNA clone was isolated in 1985. The protein is 451 amino acids or 51,672

Daltons.28 The protein was isolated from the rat as a dimer, and thought to be made up of

two identical subunits.29 PAH contains 13 exons over 90kb of DNA.30 The average exon

length is 114 bases, ranging from 57 to 892 bases. Phenylalanine hydroxylase is strongly

homologous to tyrosine hydroxylase, and this homology is greatest in the C-terminal two-

thirds of the protein. Interestingly, for PAH this corresponds to the last 1698 bases of the

mRNA which is coded in 16kb of DNA, while the most divergent parts of the protein

correspond to 567 bases of mRNA coded in 72kb of DNA. The largest intron, between

exons 3 and 4, is 23kb and falls between amino acids 117 and 118 where the homology to









tyrosine hydroxylase begins. This suggests that functional and tissue-specific regulators

could be contained within that intron or at least within the 72kb of divergent DNA.30 Rat

and human PAH share 96% homology at the amino acid level, and 89% at the nucleotide

level, with 82% of the differing nucleotides as silent codon changes.28

Transcription of PAH has been shown to be regulated by a 9kb fragment situated

upstream of the human gene. As other housekeeping genes, it does not have a TATA box,

and uses multiple transcription initiation start sites both in humans and in rodents.31 The

5' region of human PAH contains two half sites of the glucocorticoid response element

(GRE), two consensus sites for activator protein 2 (AP2) and one partial site for cAMP

response element (CRE).32 A 1.7kb region situated from position -3.5kb to -5.2kb

contains 2 hepatocyte nuclear factor 1 (HNF1) binding sites.33 HNF1 was shown to

activate the 9kb promoter region in a dose-dependent manner, and can be enhanced by its

dimerization cofactor DCoH. Interestingly DCoH is also the enzyme pterin-4-a-

carbinolamine dehydratase (PCD), responsible for converting 4-a-carbinolamine-

tetrahydrobiopterin to 7,8-dihydrobiopterin quinoid form in the recycling pathway of BH4

(see Figure 1-1 and later section). Both DCoH and PAH can be found on the same operon

in Pseudomonas aeruginosa, suggesting an evolutionary role in the regulation of PAH by

DCoH: it can transactivate transcription of the gene and recycle the necessary cofactor.

In the mouse, the activity of the promoter is completely dependent on its enhancer,

situated 3.5kb upstream of the start site. The enhancer has binding sites with weak

homology to HNF 1 and C/EBP consensus sequences. Addition of cAMP and

dexamethasone increases the activity of the promoter in the presence of the enhancer in

an additive fashion.31 The enzyme activity in rat cell lines is increased in the presence of









hydrocortisone due to an increase in PAH transcripts, suggesting that the rat and mouse

promoters have similar characteristics.34 Transgenic mice containing the human

regulatory region express the PAH transgene like the murine PAH, both in a time and

tissue-specific manner.35 The murine enhancer region is 77.5% homologous to the human

segment containing the HNF1 binding sites.33 It is still unknown if the human PAH gene

is hormonally regulated, but unlike the murine promoter, it does not require cAMP or

dexamethasone for in vitro activity.

In humans, the PAH transcript can be detected during the first trimester in the fetal

liver. In rodents, PAH is activated at day 18 of gestation, but strongly induced during the

first post-natal week in the liver.35 PAH is present in rodent kidney, and was found in

human kidney cortex at 20% of levels observed in human liver.36'37 In rats the kidney has

20% of liver mRNA amounts, and both the liver and kidney mRNAs are the same size.34

Conditions which activate the rat-purified enzyme do not activate the kidney enzyme: it

is in a constant activated state.38 Because the mRNAs are identical, the difference in

activities may be from different post-translational modifications and regulation. Rao

postulated that the kidney enzyme could make up 50% of rats' total PAH activity due to

its higher 5,6,7,8-tetrahydrobiopterin (BH4)-dependent activity. Moller et al.

demonstrated that the human kidney contributes a large amount of tyrosine to the

systemic circulation, while the liver is a net remover of both phenylalanine and tyrosine

from the circulation.39

The Phenylalanine Metabolic Pathway

Phenylalanine metabolism is very complex due to its function as a precursor to

dopamine, epinephrine and norepinephrine and its dual glucogenic and ketogenic role.

Phenylalanine is an essential amino acid; its input is dietary and its clearance includes









inclusion into polypeptides (5-10%), and oxidation to tyrosine (75%). Minor pathways of

transamination and decarboxylation do not contribute significantly to its catabolism. All

cells use phenylalanine for protein synthesis, but hepatocytes and kidney cells are the

main contributors to phenylalanine clearance.39'40 The first enzyme in the clearance

pathway is phenylalanine hydroxylase or L-phenylalanine-4-monooxygenase by its

formal name. Phenylalanine hydroxylase is a tetrameric enzyme made up of four

identical subunits. PAH is a substrate for cAMP-dependent protein kinase. It is a

metalloprotein requiring Imol of iron per mol of subunit and has a necessary cofactor,

BH4.41 The conversion of phenylalanine to tyrosine is postulated to occur via the NIH

shift since the hydrogen on carbon 4 of phenylalanine is moved to carbon 3 on tyrosine

(Figure 1-1). BH4 is synthesized de novo from GTP in a four step pathway involving GTP

cyclohydrolase I (GTPCH), 6-pyruvoyl tetrahydropterin synthase (PTPS), and sepiapterin

reductase (SR). HPA can also be caused by defects in GTPCH and PTPS, and this occurs

in 1 to 2% of cases. In the PAH system, two enzymes are responsible for recycling BH4:

PCD and dihydropteridine reductase (DHPR).

Regulation of PAH is three-fold based on studies done with the rat enzyme: PAH is

activated by phenylalanine and by phosphorylation by cAMP-dependent protein kinase.

The phosphorylation seems to be stimulated by phenylalanine, while once

phosphorylated less phenylalanine is needed for activation.42 Since phosphorylation of

PAH is performed by cAMP-dependent protein kinase, blood glucagon levels indirectly

affect the rate at which Phe is cleared: after a meal, levels of cAMP increase thus

activating PAH. In low blood glucose conditions, Phe turnover can increase in order to

obtain fumarate. BH4 inhibits PAH activity keeping the enzyme in a (postulated) less









active conformation; the effect is reversed by Phe. The structure of a PAH dimer has been

elucidated.43 The 452 amino acid monomer is composed of three regions: a regulatory, a

catalytic and a tetramerization domain. The catalytic domain, amino acids 118-427,

contains 13 helices and 9 (3 strands. The regulatory domain is in the N-terminus while the

tetramerization domain is contained in the C-terminus. The active site is buried in a deep

basket-shaped cleft where the iron atom is bound by H290, H285, Q330 and a water

molecule. Kobe et al. postulated that movement of the N-terminal regulatory domain

about a hinge region, making access to the catalytic site easier, could explain the

regulation by phosphorylation and Phe.43

As of May 2005, 498 disease-causing mutations were recorded in the PAH

database. Sixty-two percent of these mutations are missense mutations.. In vitro analyses

have been performed to analyze a wide range of these mutations in order to obtain insight

on the genotype-phenotype relationship of PKU and the biochemical mechanism of

disease.44-48 The analyses in mammalian cells have shown that mutations often have a

decrease of immunoreactive protein but no real difference in mRNA amounts. These

conformationall" mutations predispose the protein monomer to incorrect folding or

misassembly of the enzyme, as determined in E. coli expression systems and two-hybrid

analyses, thus leading to increased turnover of the protein.44 In vitro manipulations such

as temperature decreases and increased chaperonin levels can rescue protein amounts,

oligomerization pattern and, for some mutations, activity as well.46 Similar modulating

effects in vivo could explain the discrepancies in phenotypes between patients of identical

genotype.49









Animal Models for PKU

A mouse model, named BTBR Pahenu2, was created by N-ethyl-N-nitrosourea

treatment of male BTBR Pas mice by Shedlovsky et al. in 1993.50 The specific

phenotype, hyperphenylalaninenemia, was screened for in over 300 offspring of

mutagenized males crossed to BTBR Pahenul mice. The Pahen"u line was created a few

years earlier and displayed a mild PKU phenotype, so the mutagenesis was repeated in

order to find a more severely affected phenotype.5 Once a potential carrier of a mutation

unable to rescue the Pahenul phenotype was found, it was bred to wild type BTBR Pas

female mice and two congenic mutant lines were eventually established, BTBR Pahenu2

and Pahenu3. The Pahenul and Pahenu3 mice have different PKU phenotypes, and will not

be discussed in this work. The Pahenu2 mice exhibit many of the characteristics associated

with classic PKU: hypopigmentation, cognitive disabilities, and maternal PKU

syndrome.52'53 The single base mutation in the mouse PAH gene, located on chromosome

10, is in exon 7, the same exon where most human mutations are located, changing

phenylalanine residue 263 to a serine and rendering the enzyme catalytically inactive.54

Shedlovsky et al. reported reduced immunoreactive protein as compared to wild type

BTBR Pas mice along with one percent of normal PAH mRNA in liver extracts. The

mutation also created a new Alw26I restriction site allowing for quick genotyping from

PCR amplification followed by restriction digest.54

The female mice do not regularly carry litters to term; if pups are born they will not

survive beyond a few hours. This maternal PKU syndrome in the mouse is caused by the

high serum Phe levels in the dams.55 Specific cardiovascular defects were noted in

embryos from 14.5 days postcoitum.53 Cognitive deficits in the mice were assessed by

odor discrimination tests and latent learning. The Pahenu2 mice have statistically









significant deficits in these learning and memory tasks; however these deficits are not

incapacitating. This evidence combined with the high serum Phe levels and the

hypopigmentation confirms that the mouse is a very good model of human

phenylketonuria.

Alternative Therapies

The lack of adherence to the Phe-restricted synthetic diet and the resulting increase

in maternal PKU syndrome highlights the need for an alternative form of therapy for

PKU. Tetrahydrobiopterin supplementation has been used with success in PKU patients

who have mutations that are known to be responsive to the cofactor. These patients

typically do not have "classic" PKU, since mutations in the catalytic domain do not

respond to BH4 supplementation. The mechanism for BH4 responsiveness is not fully

understood. The mutations that have been studied in vitro show reduced activation by

phenylalanine and reduced affinity for phenylalanine.56 Few of these mutations have a

decreased affinity to tetrahydrobiopterin. However, BH4 seems to prevent misfolding and

inactivation of these mutant proteins.7 Other hypotheses include mRNA stabilization,

induction of PAH expression by BH4, and changes in the regulation of BH4 synthesis

after oral administration. The response to tetrahydrobiopterin is obviously multifactorial

and depends on the alleles present in each individual patient.58

In the tetrahydrobiopterin patient trials, a normal diet or a relaxed diet is

supplemented with BH4 to achieve lower and controlled Phe levels. In two separate

studies, normal development in all of the patients was observed, and lowering of serum

Phe levels was achieved in the patients treated for an extended period of time.59'60 Side

effects noted are psychoneurotic, urological and gastrointestinal in nature.61 However no

full long-term or large-scale study has been conducted to assess the safety of repeat









administration of BH4. While BH4 supplementation can be three to four times more

expensive than the Phe-restricted diet, it could help prevent the effects of maternal PKU

syndrome by stabilizing Phe levels and preventing concentrations from peaking during

the day. Phenylalanine variation during pregnancy was found to have a negative effect on

head circumference at birth by the Collaborative Study.22

Enzyme replacement therapy could be an attractive alternative to treat all PKU

patients. Most of the work with enzyme replacement therapy has been done with the

enzyme Phenylalanine Ammonia-Lyase (PAL) since it does not require a cofactor for

activity.62 Oral delivery of enteric gelatin-coated PAL capsules was shown to be

successful and reduced Phe levels by 22% in PKU patients. While promising it may not

be enough for classic phenotypes and more work is being done to protect the activity of

the protein from the acidic environment of the stomach and optimize it for the intestinal

environment. PEGylation of PAL was also tested in mice: the enzyme has a longer half-

life, but after multiple injections it is quickly cleared from circulation. Enzyme

replacement therapy with PAH has also been explored, but the requirement for co-

injection of BH4 does not make it as attractive a therapy as PAL.

Gene therapy for PKU would be an ideal form of treatment to improve the quality

of life of PKU and HPA patients and to prevent maternal PKU syndrome. Skin, muscle

and bone marrow have been explored as possible targets for gene therapy, but the

availability of the cofactor has limited success in these approaches.63-66 With recombinant

adenovirus, two groups achieved lowering of serum Phe in the BTBR Pahenu2 mice using

the Rous Sarcoma virus LTR and CAG promoters respectively.67'68 However, both

groups reported antibodies raised against adenovirus and complete reversal of treatment









after two weeks. All of these experiments were introducing functional human PAH, as

opposed to mouse PAH.

Adeno-associated virus (AAV) has also been successfully used to treat HPA in the

mouse model. Using recombinant AAV (rAAV) serotype 5 carrying the mouse PAH

gene, long-term correction of mice, 40 weeks, was achieved in males, but not in

females.69 One third less vector was needed in the males than in the females to achieve a

similar Phe clearance during the first 6 weeks, at which point the female's serum Phe

levels returned to their hyperphenylalaninemic state. The minimum effective dose in

males in this study was 3x1013 vector genomes of rAAV5. With rAAV2, the human PAH

gene was delivered to mice with a WPRE element included in the cassette.70 Again,

female mice did not respond to the same dose that was found effective in males, 2x1012

vector genomes. This dose was effective up to 25 weeks, at which point an increase in

serum Phe levels was noted. According to the authors, this was due to a loss in vector

DNA amounts as determined by semiquantitative PCR. All of these studies have shown

that it is possible to treat hyperphenylalaninemia in the mice by gene therapy, but more

work is required to achieve true long-term correction in the males, and the same response

in female mice.

Gene Therapy Vectors Based on Adeno-Associated Virus

Somatic gene therapy for the correction of inherited genetic disorders is the desired

hallmark of future individualized medicine. Viral vectors for such delivery have been

studied for many years.71 Genome size, immunogenicity, length of gene expression and

integration capabilities are factors that can affect the choice of a viral vector. Adeno-

associated virus has many attractive qualities for human use: it is nonpathogenic, it can

infect dividing and non-dividing cells, it does not have to contain any viral coding









sequences, and it can mediate long-term gene expression in animal models.7274 There are

over 50 AAV serotypes known; each one may have slightly different cell tropism

offering the possibility of enhanced transduction for different targeted organs.75

Unfortunately the genome size of AAV is its main limitation since many genes are longer

than the 4.68kb packaging limit. Reports on a small percentage of integration into active

chromatin regions and the possibility of increased tumorigenesis have darkened the

prospects of this gene therapy vector.76 Nonetheless, rAAV serotype 2 is currently in use

in clinical trials, and still remains a vector of choice for the development of gene therapy

for inherited disorders.

Adeno-Associated Virus Biology

Adeno-associated virus is part of the family Parvoviridae and is classified as a

dependovirus in the Parvovirinae subfamily. Dependoviruses require the presence of

helper viruses, such as Adeno virus or Herpes virus, to establish a productive infection. In

the absence of such a helper virus, a latent infection can be maintained by integration of

the virus DNA into the genome. In humans, the main AAV integration site is 19ql3.3

where the genome usually integrates in tandem repeats.7 This can be rescued by

subsequent infection with the helper virus. The virus has not been associated with disease

in humans.

The AAV genome is single-stranded DNA and is 4679 bases in length for AAV

serotype 2.71 It is flanked on both sides by 145-nucleotide inverted terminal repeats (ITR)

composed of three palindromic sequences with only seven bases remaining unpaired

when folded. The ITRs are the only elements required in cis for encapsidation. The

genome encodes nonstructural proteins (Rep78, Rep 68, Rep 52 and Rep 40) and capsid

proteins (VP1, VP2, and VP3). These proteins are expressed from three polymerase II









promoters, p5, p19 and p40, from alternatively spliced mRNA. The Rep proteins are

required for DNA replication, establishment of latent infections, site-specific integration

into chromosome 19, and encapsidation of the genome. The Cap proteins combine 60

subunits into T=1 icosahedral symmetry with VP2 as the major structural component of

the small virion.

AAV serotype 2 binds to the ubiquitously expressed cell surface heparin sulfate

proteoglycan (HSPG). It requires fibroblast growth factor receptor type 1 and the integrin

avP35 for entry into the cell.78'79 Uptake occurs through standard endocytosis from

clathrin-coated pits, and the capsid is removed in the nucleus.80 The virus genome can be

found in the nucleus two hours after infection. Receptors used by the other AAV

serotypes include sialic acid and PDGFR, giving each one a different preferred cell type.

Current Trends and Applications of rAAV

Recombinant AAV virus can be made in the lab without the use of helper viruses.

Recombinant virus production is accomplished by providing only the necessary proteins

required for DNA replication and encapsidation on a plasmid that is independent of the

recombinant AAV plasmid. Both plasmids are co-transfected into cells, and rAAV virus

can be purified free of helper virus. This method is efficient and produces low particle-to-

infectivity ratios. The ITRs are the only wild type virus sequence left on the recombinant

virus. Thus it is incapable of replicating once it has entered the cell. The viral genome is

slowly converted from single stranded DNA to double stranded DNA, delaying the onset

of expression in the cell. The genome is maintained in the nucleus as a linear or circular

high molecular weight concatemer.81

Many animal models have been treated with rAAV vectors to correct a variety of

inherited disorders in a variety of tissues. Tissues successfully targeted by direct in vivo









methods include liver, muscle, heart, brain, lung, eye and kidney.74'82-87 Hemophilia B has

been treated by liver-directed gene therapy both in a mouse model and in a canine model

demonstrating the safety and the long-term expression mediated by rAAV2.73'88 These

studies also showed a dose response correlating increased factor IX circulating levels

with higher rAAV doses.

Clinical trials with AAV serotype 2 are underway for a number of diseases across

the US. Two trials, one for Cystic Fibrosis and one for Hemophilia B, have published a

number of updates. Delivery of rAAV2 to the lungs has not resulted in any adverse

effects to date, but it does not seem that the virus is transducing the lung epithelial cells

very efficiently.7 Results in the Hemophilia B trials have been a little more encouraging.

While delivery of rAAV2 containing the Factor IX gene to the muscle was well tolerated,

only a mild effect on Factor IX concentrations, 1% of normal, has so far been achieved.

When the liver was the target in a partner study, 5 to 12% of normal Factor IX levels

have been observed in the circulation of one patient for 5 weeks, but then dropped to

2.7%. AAV was detected in the semen of one patient and this seems to have been cleared

after 3 months.75 The results of these trials have not yet led to the cures hoped for, but

they have shown that rAAV2 delivery to humans is relatively well-tolerated and can

achieve modest therapeutic effects.

RNA and DNA as Therapeutic Agents

Antisense oligonucleotides can be used to target specific messenger RNAs to

inhibit translation or to induce cleavage and degradation. Antisense RNA

oligonucleotides, ribozymes and short interfering RNAs have been studied over the years

for their potential uses as therapeutic compounds in cancers and dominant diseases.









While these different molecules have distinct advantages, we will focus on ribozymes

because this methodology seems best suited for the particular problems seen in PKU.

RNA Interference

The process of RNA interference was discovered in the worm Caenorhabditis

elegans.89 When double stranded RNA (dsRNA) is introduced, sequence-specific post-

transcriptional gene silencing occurs. The enzyme DICER, an RNase III, processes long

dsRNA molecules by cleaving the dsRNA into 22-nucleotide short interfering RNAs

(siRNAs). This duplex is unwound and binds to its target RNA via RISC, RNA-induced

silencing complex. If the siRNA sequence perfectly matches its target, cleavage occurs

approximately at 10 nucleotides from the 5' end of the target sequence. It is now known

that the general mechanism of dsRNA response is conserved in most eukaryotes, thus the

recent developments in siRNA technology for use in mammalian cells.

The currently most popular approach for expression of siRNA uses a PolIII

promoter to express a hairpin that encodes for both the sense and the antisense RNA

sequence. This is then delivered directly to the cells by transfection or cloned into a viral

vector for easy delivery into animal models. Much work has been done on determining

markers for functional siRNA design. One of the requirements for good siRNAs is the

need for 2 nucleotide 3' overhangs.90 Internal general requirements include low GC

content, three or more A/U base pairs at the 3' end of the sense strand, and lack of

internal repeats.91'92 The presence of A/U base pairs at that end confirms previous results

obtained by Schwarz which suggested that the strand that is included into RISC has the

least tightly bound 5' end, thus preferentially selecting the antisense strand.93

RNA interference has been used extensively for functional gene studies in cell

cultures, and is being studied for targeting cancer genes, viral infections, and genetic









disorders.94-96 Safety of siRNA use in humans is currently being assessed in a clinical

trial where an siRNA targeting VEGF is being tested to help prevent age-related macular

degeneration.97 However, more study is necessary since siRNAs have been implicated in

chromatin architecture in several organisms, and the role and mechanism of siRNAs has

not yet been fully elucidated in mammalian cells.98 MicroRNAs (miRNAs) are made

from precursor miRNAs in mammalian cells and have been associated with

developmental gene regulation.99 MicroRNAs are also 21 to 23 nucleotides when

processed from their longer precursors. They often function as translational repressors

and do not contain an exact match to their targets raising concerns about possible side

effects of introduced siRNAs. The inexact match of miRNAs to their targets also implies

that to create a cDNA that is resistant to a designed siRNA will require extensive

modifications. This requirement is the main reason why we focused on hammerhead

ribozymes for our study. Nonetheless, the large amount of research being done with

siRNAs should soon uncover the best and safest way to use them in gene-function studies

and as therapeutic agents.

Ribozymes

Ribozymes are RNA molecules capable of catalyzing chemical reactions without

protein assistance. Hairpin ribozymes, RNaseP, Group I and II introns can catalyze such

reactions as ribonucleotide transesterification and hydrolysis.100 Hammerhead ribozymes

were discovered in plant satellite virus RNAs and mediate rolling circle replication. They

self-cleave the RNA in an in-line transesterification reaction.101 Since the sequence

requirements of the reaction have been discovered, they have been engineered to catalyze

the same reaction in trans for a specific chosen target.102 The target sequence of a

ribozyme contains "NUX', N is any nucleotide and X is any nucleotide but G. The









ribozyme will cleave the mRNA after X. The actual rate of cleavage is significantly

affected by the sequence of NUX with GUC and AUC having higher activities.103 The

typical lab hammerhead ribozyme is 33 to 35 nucleotides long, depending on the length

of the hybridizing arms, and its core structure includes stems I and III (the hybridizing

arms) and stem II, a hairpin structure used for maintaining stability of the required

folding for catalysis (Figure 1-2). Once bound to its target, the cleavage reaction takes

place and the RNA products are subsequently degraded.

Since they do not require proteins for catalysis, the main issue with ribozyme-use

in therapeutics is choosing the right delivery method. If used as stabilized RNA

molecules direct or general injections must be tested to ascertain co-localization with its

target RNA while keeping in mind the half-life of the ribozyme. Delivery with a viral

vector can obviate the previous issue as long as the virus will infect the correct cell type.

The proper promoter must be chosen so that the ribozyme can exit the nucleus to reach

the mRNA target without being processed or degraded itself. Ribozymes only need 12

nucleotides for target recognition, and the cleavage target rules are not as restricted as

initially thought.104 Nonetheless, specificity of the cleavage reaction has been

demonstrated.105 Many groups have successfully used ribozymes as anti-viral treatments,

anti-cancer treatments, and disease treatments for disorders such as Alzheimer's and

retinis pigmentosa.106,107

A hammerhead ribozyme, Angiozyme, is currently in Phase II clinical trials for

treatment of advanced colorectal cancers in combination with chemotherapy.108 The

ribozyme targets VEGFR-1 and is a chemically modified molecule injected

subcutaneously on a daily basis. Patients who had detectable VEGFR-1 levels prior to









therapy which declined post therapy have been found to have better clinical outcomes

than patients whose levels did not change. Another stabilized hammerhead ribozyme is in

a clinical trial for Hepatitis C Virus.109 Clinical trials are also underway to target HIV

infection with lentivirus-introduced hammerhead and hairpin ribozymes.110 Ribozymes

are a useful tool for specific mRNA degradation and offer many advantages in their

simplicity.

The research presented in this thesis includes careful analysis of the BTBRPahenu2

mouse model, in vitro experiments defining mutant and normal PAH protein interactions,

and various rAAV-derived gene therapy experimental results for the treatment of

phenylketonuria. General physiological observations of the BTBRPahenu2 mouse model

along with careful molecular analysis of PAH in the mice are reported in order to provide

further insight into the disease status in the model. From the observations made in mouse

livers, the interaction between normal and mutant protein subunits of PAH was further

evaluated in cell culture and determined to lead to dominant-negative interference. The

development of a hammerhead ribozyme directed against mouse PAH, to prevent the

dominant-negative interference, is detailed along with its evaluation in cell culture and in

vivo. Finally, the construction of a novel vector carrying both the mouse PAH gene and

the ribozyme, expressed from a modified tRNAv' promoter, is described along with

initial in vivo results in male mice. The findings reported in this research clearly show

that gene therapy for PKU is possible, but when treating patients with missense

mutations, the prevention of an interaction between normal and mutant protein subunits

may be necessary in order for the gene therapy to be successful at lower doses of rAAV.

Moreover, the data show the need for careful evaluation of mouse models, of both






24


missense and null mutants, when evaluating the possible treatment of genetic diseases by

gene therapy and the clinical relevance to human patients.












02


PAH


O H
BH4 H N


H2N N N H
I I
H H


SDHPR
NAD+ DHFR
NADP+ 0
H N H


NADH + H+
NADPH + H+


OH




GOO"
NH3




4a-carbinolamine
o H
I I OH I


HN N N
H


non-enzymatic in vitro
PCD in vivo


R = COH COH CH3


7,8-BH2 (quinoid form)
Figure 1-1 Phenylalanine conversion to tyrosine. The enzyme PAH converts Phe to Tyr
using BH4 and oxygen. BH4 is recycled via a two-step pathway which utilizes
NADH.









Stem II
G U
G-C
C-G
G-C
C-G
GAG
A U
A
Stem III I G Stem I
A CU
3'--GUCGUA UAGUU--5'
5' CAGCNUXAUCAA 3'
Figure 1-2 Hammerhead ribozyme structure. The ribozyme is aligned to its 12-nucleotide
target. The cleavage reaction takes place after the X. Stems 1 and III represent
the hybridizing arms when bound to the target RNA; stem II is a hairpin
structure which stabilizes the ribozyme structure.














CHAPTER 2
MATERIALS AND METHODS

The research presented in this dissertation required the use of many experimental

methods. They are described in this chapter in detail to allow other researchers to use the

experiments presented. Any specific modifications to the methods are explained where

relevant in the following chapters.

In Vitro Ribozyme Analysis

For these experiments, all enzymes were from Promega (Madison, WI) unless

otherwise indicated. Radioactive nucleotides were ordered from Amersham Biosciences

(Piscataway, NJ). The water used in all of the experiments was deionized, distilled,

purified through ion-exchange chromatography and autoclaved. All gels for ribozyme

analysis were 8 M urea, acrylamide sequencing gels run in 1 X TBE buffer and

prewarmed to approximately 450C prior to loading the samples, which were heat

denatured at 850C for 3 minutes followed by chilling on ice for 3 minutes. The gels were

fixed in 40% methanol, 10% acetic acid and 3% glycerol for 30 to 45 minutes and

subsequently dried at 800C under vacuum. All of these protocols were described by Fritz

et al.111

Deprotection of RNA Oligos

The chosen ribozyme sequences and 12-nucleotide targets were ordered from

Dharmacon, Inc (Lafayette, CO). The oligos were resuspended in 100 tl of water. Using

the provided deprotection TEMED buffer, 20 tl of each oligo was diluted to 100 tl with

the buffer and incubated at 600C for 30 minutes. The reaction was stopped by drying in a









SpeedVac (Savant) for 30 minutes. Assuming 99% efficiency in synthesis, the oligos

were resuspended at 200 pmole/tl for the ribozymes, and at 300 pmole/tl for the targets.

Working dilutions were prepared: 2 pmole/tl of ribozyme, and 10 pmole/tl of targets.

Samples were stored at -700C until further use.

Target End-Labelling

The targets were end-labeled with y-[32P]-ATP to allow for detection of the intact

and cleaved targets on a polyacrylamide sequencing-grade gel. Twenty picomoles of the

target were added to 10 tl of 1 X polynucleotide kinase buffer containing 1 1t of RNasin

Ribonuclease Inhibitor, 1 tl of 0.1 M DTT, 1 tl of polynucleotide kinase (5 to 10 units),

and 4 [Ci ofy-[32P]-ATP. After incubation at 370C for 30 minutes, sixty-five microliters

of water were added, and the labeled target was extracted with

phenol:chloroform:isoamyl alcohol. This was purified on a Sephadex G-50 column (USA

Scientific, Ocala, FL). The labeled target can be stored at -200C.

Time Course of Cleavage Reactions

The purpose of the time course experiment is to test the efficiency of the ribozymes

against the short 12-nucleotide target. Excess target is mixed 10:1 with the ribozyme in a

single large reaction from which timed samples are taken and subsequently run on an 8%

gel. First, two picomoles of the ribozyme working dilution was mixed with 88 tl of water

and 13 tl of 400 mM Tris-HC1. This was incubated at 650C for 2 minutes and left at

room temperature for 10 minutes to allow for proper folding of the ribozyme. Thirteen

microliters of a 1:10 dilution of RNasin in 0.1 M DTT was added with 13 tl of 200 mM

MgC12 for a 20 mM MgC12 final concentration. This concentration is used for all first

time course experiments with new ribozymes. The reaction was then incubated at 370C









for 10 minutes. Prepared tubes each with 20 tl of RNA formamide buffer (90%

formamide, super pure grade, 50 mM EDTA pH 8.0, 0.05% bromophenol blue, 0.05%

xylene cyanol) were placed on ice at this time and were labeled for the desired time

points, typically 0, 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 minutes. Two microliters of

unlabeled target from the working dilution or 20 pmoles, and 2 tl of end-labeled target

were added in that order to the reaction. Immediately after adding the hot target, 10 tl of

the reaction was removed and added to the prepared tube labeled 0. This was repeated for

each time point. The samples can be stored at -200C.

Six microliters of each timed sample was electrophoresed on an 8% gel at 40 mV

until the bromophenol blue was approximately 2/3 down. Once fixed and dried, it was

exposed to a phosphorescent screen overnight, and scanned with a PhoshorImager

(Molecular Dynamics, Sunnyvale CA) for analysis. The percent of cleaved target at each

time point was calculated from the intensity of the product band over the total intensity of

the product and the intact target.

In Vitro Transcription

A linearized and purified pGEM-T-mPAH plasmid was used to create full-length

mPAH transcripts with T7 RNA Polymerase. The reaction was set up in 20 tl as follows:

4 tl of 5 X polymerase buffer, 2 tl 100 mM DTT, 1 tl RNasin (40 units), 1 tl of a

solution of 20 mM each ATP, CTP, and GTP, 1 tl 4 mM UTP, 2 tl linearized pGEM-T-

mPAH (100 ng), 2 tl or 20 [tCi of [a-32P]-UTP, and 6 tl of water. One microliter of T7

RNA polymerase or 20 units was added last. The reaction was incubated at 370C for 2

hours. Forty microliters of water was added to the reaction and was extracted with 100 [tl

of phenol:chloroform:isoamyl alcohol. The aqueous layer was then purified on a G-50









column, and 1 tl of the eluate was checked in a scintillation counter to calculate the

concentration of the labeled transcript.

Full-Length Transcript Cleavage Reaction

The full-length transcript was incubated with the ribozyme at 37C to determine if

the cleavage site is accessible when the entire mRNA sequence is present. The reaction

was set up with the desired ratio of ribozyme to target and magnesium concentration. For

ribozyme 1209, the experiment was set up in 30 tl as follows: 3 tl 400 mM Tris, 2 tl or

6 picomoles of ribozyme, 10 tl or 1.5 picomoles of labeled transcript, 3 tl of 200 mM

MgC12, 3 tl of a 1:10 dilution of RNasin in 0.1 M DTT and 9 tl of water. Samples were

taken at time 0, 1 and 2 hours. A 5% acrylamide gel was needed to separate the

anticipated cleavage products of 862 and 660 bases. The gel was not fixed but dried and

exposed to a phosphorescent screen overnight.

Multiple Turnover Kinetic Analysis

The kinetic properties of the ribozyme are calculated with the Michaelis-Menten

equation from a series of duplicate cleavage reactions set up with increasing ratios of

target to ribozyme. By increasing the ratio from 1:40 to 1:1000, saturation of the

ribozyme is achieved thus the cleavage reaction becomes the rate-limiting step in the

experiment. The series of duplicate reaction is shown in Table 2-1. Each reaction was set

up as in the time course of cleavage reaction by adding the items in order and incubating

at 65C for 2 minutes and 10 minutes at room temperature after the ribozyme addition.

The RNasin" and the magnesium chloride were then added and the tubes were placed at

37C for a minimum of 10 minutes. The 30pmole/tl target mixture contained 15 tl of

end-labeled target, 15 tl of 300 pmole/tl target stock and 120 tl of water. A 3 pmole/tl









dilution was needed to set up the lower molar ratios of Rz to target. The necessary

amount of target mixture was added to each tube in a staggered fashion by waiting 15 to

30 seconds between each addition. The time selected to stop each reaction was pre-

determined in a time course experiment and allowed the reaction to go to 10 to 20% of

maximum cleavage. The reactions were stopped by the addition of 20 [tl of RNA stop

buffer and placed on ice.

Table 2-1 Multiple turnover kinetic analysis reaction set-up.
Tubes H20 400 mM Ribozyme 1:10 RNasin 50 mM Target Target solution used
Tris-HCl (0.3 pmol/tl) MgCl2 Molar ratio Rz:target
1,11 14 2 0 1 2 1 3pm/tl
2, 12 10 2 1 1 2 4 3 pm/tl 1:40
3, 13 8 2 1 1 2 6 3 pm/tl 1:60
4, 14 6 2 1 1 2 8 3 pm/tl 1:80
5, 15 13 2 1 1 2 1 30 pm/tl 1:100
6, 16 12 2 1 1 2 2 30 pm/tl 1:200
7, 17 10 2 1 1 2 4 30 pm/tl 1:400
8, 18 8 2 1 1 2 6 30 pm/tl 1:600
9, 19 6 2 1 1 2 8 30 pm/tl 1:800
10,20 4 2 1 1 2 10 30 pm/tl 1:1000

Each sample was electrophoresed on an 8% gel and exposed to a phosphorescent

screen for analysis. In order to analyze the results, a calibration curve was also generated

from a series of target samples hybridized to HybondTM-N+ (Amersham Biosciences)

membrane using a slot blot apparatus. Each sample contained a known amount of end-

labeled target, from 0 to 100 picomoles of target, allowing for the intensity of each band

to be correlated to the concentration of target through a simple linear regression. The

equation of this line was used to calculate the concentration of cleaved target in each of

the duplicate reactions. A saturation curve was generated from plotting the cleaved target

concentration divided by the time of the reaction versus the inputted total target. If

saturation is not obtained, higher concentrations of target should be set up in a new









experiment. A Lineweaver-Burk plot was created by graphing 1/v versus 1/S: v is the

velocity or cleaved target (nM/minute), and S is the total input substrate concentration

(nM). The equation of the line was used to determine Vmax, Km and kcat. Vmax is the

absolute value of 1/Y when X is 0; Km is the absolute value of 1/X when Y is 0; kcat is

Vmax divided by the concentration of ribozyme used in the experiment, 15 nM.

Molecular Cloning Protocols

Molecular cloning protocols used in this study followed manufacturer's

recommendations for each enzyme or component used. Enzymes were from New

England BioLabs (Beverly, MA) unless otherwise indicated. Other general protocols

were adapted from Molecular Cloning: A Laboratory Manual.112

Cloning of Ribozyme Vectors

Ribozyme 1209 and its two null derivatives were cloned into the vector p21-newhp

which is based on pTR-UF 12. The restriction sites at the cloning site are Hind III and Spe

I and the ribozymes were ordered as DNA oligos including the correct restriction site

bases from Sigma Genosys (The Woodlands, TX). The oligos were gel purified, annealed

and ligated into the digested p21-newhp vector. Sure" Cells (Stratagene, La Jolla, CA)

were used for transformations to ensure ITR retention. Clones of each ribozyme were

sequenced and selected based on ITR retention by Sma I digests. The RzI209 plasmid

was renamed CB-RzI209 (Figure 5-6).

The ribozyme 1209 vector used for packaging for animal experiments was modified

from the original CB-RzI209 vector. The PYF 441 enhancer, the HSV thymidine kinase

promoter and the neomycin cassette were removed from the vector by Sal I digestion and

religation because the neomycin cassette contains cryptic splice sites which could









interference with gene expression if integrated into the genome.113 This plasmid was

named CB-RzI209-(-Neo).

Construction of CB-mPAH-F263S

The plasmid vector CB-mPAH was created from p43-hAAT developed by Loiler

and Flotte at the University of Florida. Directed mutagenesis of mPAH was achieved

using synthetic DNA oligonucleotides as PCR primers. The 5' primer contained the

desired base changes to change phenylalanine 263 to a serine and started at a unique

restriction site, Xho I, to allow quick cloning of the mutagenized cassette (Table 2-2).

The PCR reaction was set up using EasyStartTM PCR Mix-in-a-tube (Molecular

BioProducts, San Diego, CA). The 132 base pair PCR product was gel purified and

ligated into pGEM-T (Promega). After bacterial transformations into XL 1-Blue MRF'

cells (Stratagene) and sequencing of the obtained clones, the fragment was cut from

pGEM-T with Xho I and Hind III, gel purified and ligated into pGEM-T-mPAH. The

mutated gene, mPAH-F263S, was moved from pGEM-T to the CB backbone released

from an EcoR I and Not I digest. Bacterial transformations into Sure cells was followed

by sequencing of clones obtained. Large DNA preparations were performed with

Qiagen's Plasmid Giga Kit.

Construction of CB-mPAH-Hd

The same strategy used for the construction of CB-mPAH-F263 S was used to

change the CB-mPAH plasmid to a resistant sequence to the RzI209. PCR mutagenesis

was utilized to introduce silent base changes around the sequence for Isoleucine 209. The

5' primer again contained the necessary base changes, and started at a unique restriction

site, Stu I (Table 2-3). After gel purification of the 322 base pair product, it was ligated













Table 2-2 PCR mutagenesis primers for mPAH-F263S construction.
Sequence 5' Restriction Site 3' Restriction Site
Normal Protein S S R D F L G G L A F R V F H C Xho I
cDNA 5' GTCGTCTCGAGATTTCTTGGGTGGCCTGGCCTTCCGAGTCTTCCACTGC 3' (C TCGAG)
5' Primer 5' GTCGTCTCGAGATTTCCTGGGTGGCCTGGCCTTCCGAGTCTCCCACTGC 3'
F263S Protein S S R D F L G G L A F R V S H C
3' Primer 5' TGGGCAAAGCTTCTATCTGAAAAC 3' Hind III
S___(A AGCTT)
aSequence of the oligos are indicated with designated base and amino acid changes in bold. Only the 5' primer contained changes.













Table 2-3 PCR mutagenesis primers for mPAH-Hd construction.
Sequence 5' Restriction 3' Restriction
Site Site
mPAHcDNA 5' TGAAGGCCTTGTATAAAACACATGCCTGCTACGAGCACAACCACATCTTCCCTCTTC 3' Stu I
5' Primer 5' TGAAGGCCTTGTATAAAACACATGCCTGCTACGAGCACAACCATATTTTTCCTCTTC 3' (AGG CCT)
3' Primer 5' TGGGCAAAGCTTCTATCTGAAAAC 3' Hind III
S___(A AGCTT)
aSequences of the oligos are indicated with designated base changes in bold, and cleavage site underlined. Only the 5' primer contained changes.









into pGEM"-T, moved to pGEM-T-mPAH and the entire mutagenized gene, mPAH-Hd,

cloned into the CB backbone to create CB-mPAH-Hd. The mPAH-Hd cassette was also

cloned into the CB-WPRE backbone released from an EcoR I and Not I digest.

Sequencing of pGEM-T with the PCR insert and the final vector constructs was done,

and the CB-mPAH-Hd and CB-mPAH-Hd-WPRE plasmids were selected based on ITR

retention. XLI Blue MRF' cells were used for all pGEM-T transformations, and Sure"

cells were used for all plasmids containing ITR sequences.

Construction of tRNA-RzI209

The tRNA-RzI209 cassettewas designed in order to conserve necessary folding

properties for the tRNA sequence and to allow the ribozyme's hybridizing arms to reach

their target sequence. From the necessary sequence a multi-step strategy was devised to

construct the 200 base pair cassette. Two restriction sites each about one-third from the

ends of the cassette were selected for cloning the cassette in three sets of oligos. The

plasmid pGEM-3Zf(+) (Promega) was modified with a new elongated multiple cloning

site to allow for the sequential cloning of the tRNA cassette (Table 2-4). The modified

pGEM-3Zf(+) was renamed pGEM-3Zf(+)-MCS2. Each oligo set for the tRNA cassette

was ordered from Sigma Genosys and gel purified prior to annealing and ligation into

pGEM-3Zf(+)-MCS2 (Table 2-5). LyoComp GT116 cells (InvivoGen, San Diego, CA)

were used for each cloning step, and blue white screening was utilized to help select

properly ligated clones. A positive digest screen was used if possible at each cloning step.

Once the full cassette was cloned into pGEM-3Zf(+), it was sequenced prior to cloning

into the CB-mPAH-Hd plasmid. The cassette was introduced after the













Table 2-4 Oligos for tRNA-RzI209 construction.
pGEM-3Zf(+)- Sequencea
MCS2
Restriction Sites KpnI BamHI SalI
EcoRI Aval PstI HindIII
Multiple Cloning GAATTCGAGC TCGGTACCCG GGGATCCTCT AGAGTCGACC TGCAGGCATG CAAGCTT
Site CTTAAGCTCG AGCCATGGGC CCCTAGGAGA TCTCAGCTGG ACGTCCGTAC GTTCGAA
Modified Csp45I BamHI SalI
Restriction Sites EcoRI KpnI Aval EcoRV PstI HindIII
Modified Multiple GAATTCGAGC TCGGTACCTT CGAACCCGGG GATCCTCTAG AGATATCGTC GACCTGCAGG CATGCAAGCT T
Cloning Site CTTAAGCTCG AGCCATGGAA GCTTGGGCCC CTAGGAGATC TCTATAGCAG CTGGACGTCC GTACGTTCGA A
MCS2 sense oligo 5' CTTCGAACCCGGGGATCCTCTAGATATCG3'
MCS2 antisense 5' TCGACGTTATCTAGAGGATCCCCGGGTTCGAAGGTAC3'
oligo
tRNA-RzI209 Sequencea
cassette
Restriction Sites EcoRI Clal Sau96I Csp45I
Sequence 5' GAATTCATCGATACAGTTGGTTTAAGTAGTGTAGTGGTTATCACGTTCGCCTGACACGCGAAAGGTCCCCCGGTTCGAA
FokI EcoRV
ACCGGGCACTACAAAAACCAACAGGGAACTGATGAGCGCTTCGGCGCGGAAATGTGGATGGGATAT
Clal HindIII
CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT T T T TATCGATAAGC T T 3'
Oligo Set 1 Sense 5 'AATTCATCGATACAGTTGGTTTAAGTAGTGTAGTGGTTATCACGTTCGCCTGACACGCGAAAGGTCCCCGGTT3'
Oligo Set 1 5' CGAACCGGGGACCTTTCGCGTGTCAGGCGAACGTGATAACCACTACACTACTTAAACCAACTGTATCGATG3'
Antisense
Oligo Set 2 Sense 5 'CGAAACCGGGCACTACAAAAACCAACAGGGAACTGATGAGCGCTTCGGCGCGAAATGTGGATGGGAT3 '
Oligo Set 2 5'ATCCCATCCACATTTCGCGCCGAAGCGCTCATCAGTTCCCTGTTGGTTTTTGTAGTGCCCGGTTT3'
Antisense
Oligo Set 3 Sense 5'ATCAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTATCGATA3'
Oligo Set 3 5 'AGCTTATCGATAAAAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAT
Antisense 3'
aModifications to MCS2 and check digests are indicated in bold.
bThe tRNA sequence was added in three oligo sets: set 1 is from EcoRI to Csp45I, set 2, Csp45I to EcoRV, and set 3, EcoRV to HindIII.









SV40 polyA sequence at the Cla I site and screened for proper orientation by restriction

digest. This clone was also sequenced.

Cell Culture Protocols

HEK-293 and all 293T cells were cultured in Dubelco's Modified Eagle Media

containing 25 mM glucose, 4 mM L-glutamine, and 0.04 mM phenol red. These were

passage on a weekly basis with 0.25% trypsin and used for transient cell transfections of

various plasmid DNA.

Transient Cell Transfection with CaP04

Transient cell transfections of HEK-293 cells were done in 6-well plates (9.6 cm2

per well) with 80% confluent cells passage 24 hours earlier. The desired DNA amounts

were mixed in water and 300 tl of 2.5 M CaC12 was added to a final volume of 3.0 ml.

This solution was added dropwise to 3.0 ml of 2 X HBSS (Hank's buffered salt solution)

while vortexing lightly. After a 15-minute incubation, it was separated into four wells of

the 6-well plate and added directly to the complete media. Four hours later the media was

changed to fresh complete media. Cells were harvested after 48 to 72 hours by removing

the media, washing with PBS and scraping in 1.0 ml of PBS per well. Of four wells, 3

were collected together in PBS, and one was collected using 1.0 ml of TRIzol Reagent

instead of PBS. The 3.0 ml of cells were centrifuged at 1000 rpm and resuspended in 0.5

ml of homogenization buffer: 1.5 ml 1 M KC1, 8.5 ml H20, and 0.5 tl of 3-

mercaptoethanol. The cells were homogenized in a glass homogenizer and this was rinsed

with 0.5 ml of buffer and added to the homogenate saved into a fresh tube. The lysate

was obtained by centrifugation at 14,000 rpm at 40C.









Transient Transfections using Superfect

293T cells were obtained from Dr Chang's laboratory. His lab constructed a stably

integrated 293T cell line via a lentivirus system containing pTYF-mPAH and named

293T-TYF-mPAH. The lentivirus plasmid was constructed using our lab's mPAH

cassette from CB-mPAH. These cells were used for siRNA transfections using SuperFect

(Qiagen). Cells were passed into a 6-well plate 24 hours prior to transcription at a

concentration 4x105 cells per well. Seventy-five microliters of DMEM was mixed with

3.5 [tg of DNA at a minimum 1 tgg/tl concentration. After vortexing, 7 tl of SuperFect

was added to the center of the DMEM/DNA solution, mixed up and down five times, and

incubated at room temperature for 7 to 12 minutes. The mixture was then added dropwise

to one well of cells containing 0.6 ml fresh complete media. After 6 hours the media was

changed to 2 ml of complete media. Cells were harvested 48 hours after transfection with

1.0 ml TRIzol Reagent and stored at -200C until RNA extractions.

Phenylalanine Hydroxylase Activity Assay

The PAH activity assay is based on the reduction of NADH to NAD in the

recycling pathway of BH4 (Figure 1-1). Cell transfection or tissue samples are set up

twice: one reaction without phenylalanine and one with phenylalanine thus the assay

measures the phenylalanine-linked reduction of NADH at 340 nm. Four samples are run

in one assay with the 8-sample holder of the Genesys 5 UV-Vis spectrophotometer

(Thermo Electron Corporation, Cambridge, UK). The reactions were set up in lml total

volume with 100 tl of cell lysate or 20 tl of tissue homogenate. Each sample included

the following: 0.10 M potassium phosphate buffer, pH 6.8, 0.25 U catalase, 0.10 mU

DHPR, 0.04 mM 6-Methyl-5,6,7,8-tetrahydropterine (6-MPH4), 0.2 mM NADH, and 1

mM Phe if included. Both NADH and 6-MPH4 were added last and the reactions'









decrease in absorbance at 340 nm were recorded every five minutes for 30 minutes. After

calculating the protein concentration of the samples, the Phe-linked reduction of NADH

was calculated as specific activity in units/mg of total protein.

Protein Concentration Assay

The protein concentration assay is a modified short-protocol Lowry assay.

Standards were set up with 10 X BSA (New England BioLabs) ranging from 0 mg to 100

mg of protein. Typically 10 tl of tissue homogenate and 20 tl of cell lysate were diluted

to 100 tl with water for analysis. Six hundred microliters of copper reagent (0.6 mM

Na2CuEDTA, 0.2 M Na2CO3, 0.1 M NaOH) were added to the protein and incubated at

room temperature for 10 minutes. Sixty microliters of a 1:1 dilution of Folin &

Ciocalteu's phenol reagent (Sigma) in water were added and allowed to incubate for 30 to

45 minutes at room temperature. Each reaction and standard is set up in duplicate, and the

entire 760 tl was read at 500 nm. From the average of the duplicate standards, a linear

regression was calculated to get an equation of the line used to determine the protein

concentration of the experimental samples.

Western Blotting

The mouse PAH antibody was raised against a 142 amino acid N-terminal peptide

in rabbit. The antisera was used at a 1:1000 dilution in TBS-T with 5% milk. Tissue

homogenate or cell lysate were electrophoresed on 12% acrylamide Tris-HCl gels with a

discontinuous buffer system containing SDS. The protein was transferred to

nitrocellulose membranes, blocked overnight, and incubated with two primary antibodies:

the mouse PAH antisera and a rabbit polyclonal antibody to GAPDH (Abcam,

Cambridge, UK) as a loading control. The secondary antibody was horseradish

peroxidase-linked and developed against rabbit IgG in donkey (Amersham). Detection of









samples was done with ECLTM Western Blotting Detection Reagents (Amersham), and

the blots were exposed to Kodak XAR film for 0.5 to 4 minutes. Laser densitometry was

used to quantify the intensity of the bands.

Northern Blotting

Tissue samples saved in RNAI/i/,/ (Ambion) were processed with TRIzol"

Reagent. The tissues, approximately 100 mg, were homogenized with an electric tissue

homogenizer in 1.5 ml of TRIzol, and the manufacturer's protocol was followed for RNA

extraction. Samples were resuspended in an appropriate volume of nuclease-free water

and stored at -700C. Levels of ribosomal RNA were adjusted, and electrophoresed on 2.2

M formaldehyde, 1 X Mops electrophoresis buffer and 1% agarose gels. The RNA was

transferred overnight in 10 X SSC by upward capillary transfer to a neutral nylon

membrane, HybondTM-N (Amersham). After UV irradiation, the membrane was stained

briefly with ethidium bromide for RNA visualization. Probe labeling was accomplished

with the RediprimeTM II system (Amersham). Hybridization to the mPAH and human

copper zinc Super Oxide Dismutase (CuZnSOD) cDNA probes was done in Church

buffer overnight at 65C. After washing three times in 0.2 X SSC, the membranes were

exposed to Kodak XAR film at -700C, and using various timed exposures, the levels of

PAH mRNA in the different tissues were compared using laser densitometry.

Recombinant Adeno-Associated Virus Packaging

All packaging of vector DNA was done by the University of Florida Vector Core

Laboratory. The only serotype used for these experiments was rAAV type 2, matching

the type 2 ITR sequences present in our vector plasmids. Large preparations of plasmid

DNA was done in our laboratory using Qiagen's Plasmid Giga Kit. After testing the









DNA preparation by restriction digest and cell transfection for the PAH activity assay,

the entire yield was given to the Vector Core Laboratory. Our vector DNA was then co-

transfected into HEK-293 cells with the pDG plasmid which contains AAV's rep and cap

genes along with the required adenovirus genes.114 After 48 hours a cell pellet was

obtained, freeze-thawed, and the lysate was separated on an iodixonal step-gradient. The

virus was purified on a heparin affinity column, and after concentration the virus was

titered by quantitative competitive PCR and infectious center assay.

Animal Procedures

Growth Rate Analysis

Selected litters were closely followed from birth for 56 days. Pups from the

heterozygote dam to Pahenu2 male matings were tattooed on their paws within the first 6

days after birth in order to specifically follow each pup's growth rate and later sort

according to genotype. India ink was injected with a 36-gauge needle into the paws of the

pups after chilling them briefly on ice. A sequential pattern for each pup was used: no

tattoo, left front, right front, left rear, right rear, left front and left rear, etc. until all

double combinations were exhausted if necessary. Pups were weighed every 3 to 4 days

for 36 days, then every week until day 56. The data was sorted by genotype and then by

sex within each genotype. Weights were averaged, standard deviations were calculated

and all data sets were analyzed by student's t-tests and ANOVA.

Blood Collection

Animals were bled without anesthesia in a rotating tail injector (Braintree

Scientific, Braintree, MA). Blood samples, approximately 90 to 110 tl, were collected

into heparinized capillary tubes: the tails of the mice were cut with veterinary scissors

and the tail was massaged towards the cut to collect the blood. The entire procedure,









including weighing the mouse if necessary takes approximately five to six minutes per

mouse. The content of the capillary tube was transferred into a 200 [tL tube. This was

spun down at 10,000 g and the serum was collected into a second tube. Both blood and

serum samples were stored at -200C until further use. Mice were usually bled in late

afternoon on a weekly basis, but can be bled more often if necessary.

Microplate Serum Phenylalanine Assay

The phenylalanine assay is a modification of the assay developed in 1962 by

McCaman.115 Only 7.5 tl of serum is needed for triplicate readings. Each sample was

TCA precipitated, with 11.2 tl of 0.3 N TCA and chilled on ice for 10 minutes or stored

at -200C until the assay was set up. Using a PCR plate for 96 samples, 64 [tl of cocktail

was dispensed into each well. The cocktail contains 4.40 ml 0.3 M succinate, pH 5.8,

1.76 ml of 30 mM ninhydrin, and 0.880 ml 5 mM L-leucyl-L-alanine. Standards were

prepared from 10 mM phenylalanine in 0.3 N TCA: 0 mM, 0.05 mM, 0.10 mM, 0.25

mM, 0.50 mM, 0.75 mM, 1.0 mM and 1.25 mM. Each standard and sample was run in

triplicate. Four microliters of each standard was added to the appropriate wells. The

precipitated serum samples were spun down at 13,000 rpm or 16,000 g for 10 minutes in

a microcentrifuge. Four microliters of each sample is added to the wells, and the plate

was capped prior to placing in a thermocycler to incubate the samples at 600C for 2

hours.

Two hundred microliters of copper reagent is added to each well of a 96-well 0.5

ml black fluorimeter plate (Nunc, Denmark). The copper reagent is composed of 1.6 g

Na2CO3, 0.065 g potassium sodium tartrate, 0.060 g CuSO4-5H20 each dissolved in about

300 ml H20 and added together to bring up to 1 liter. One hundred microliters was added









to the incubated samples in the PCR plate and then the entire volume was moved into the

fluorimeter plate. The PCR plate was washed with another 100 tl of copper reagent and

added to the fluorimeter plate as well. The plate was read twice on an FLx800

Multidetection Microplate Reader (BioTek, Winooski VT). Both readings were averaged

to calculate the phenylalanine concentration in each sample.

Food Consumption Measurement

Food consumption was calculated as an average per day per gram of mouse. Mice

were kept in standard housing, two, three or four to a cage separated by sex and

genotype. The mice and the food were weighed once a week when the mice were

changed to new cages. The first week, only the food in the new cage was weighed by

moving it to a weigh boat. At the second and subsequent time points, the leftover food

was weighed to calculate the food consumption, and the new food placed with the mice

was weighed as well. This was repeated for two to four weeks, and performed at

consistent times to allow correct per day calculations.

Portal Vein Injections

All mice selected for gene therapy experiments were bled 2 to 3 times prior to the

portal vein injections in order to obtain a baseline serum phenylalanine concentration. At

the time of surgery, all mice were typically between 10 to 14 weeks old. All instruments

and solutions were sterilized by autoclaving prior to surgery. The mice were weighed and

injected subcutaneously with Baytril and Buprenex diluted 1 to 10 separately with

injection-saline solution. General anesthesia was accomplished with isoflurane. After

cleaning the ventral surface, a midline abdominal cut was made and the portal vein was

exposed for injection with or without moving intestines outside of the body cavity. Using

a 29-gauge needle, the injection was made into the portal vein in an approximate volume









of 0.3 cc. After bleeding was stopped with cotton tipped applicators, 0.5 cc to 1 cc of pre-

warmed LRS solution was added into the body cavity to prevent adhesions. The

abdominal muscle wall was sewn with 4.0 silk and the outer skin was stapled closed.

Mice were placed in clean warm cages and monitored for 15 to 30 minutes before being

taken back into the colony. Sterile peanut butter was given to the mice on a piece of

normal chow to monitor their recovery on the next day. Cottage cheese or phenylalanine-

free chocolate can also be given to increase their appetite if necessary. Once a day for the

following week the mice were checked to make sure the wounds were clean and no

staples were lost. The staples were removed a week after surgery at which time the mice

are bled for the first time point.

Phenylalanine Loading

A phenylalanine solution was prepared in 0.9% saline and filtered sterilized

through a sterile syringe and a 0.22 [m filter. The pH of the solution was 7.4. The

concentration of 26.4 mg/ml was determined by spectrophotometric analysis. On the day

of the study, each animal was bled (0 hour), weighed and then injected subcutaneously

with 0.8 mg L-Phe per gram of body weight. The volumes injected thus ranged from 1.0

to 1.5 ml per mouse. Each blood sample taken was approximately 30 [1. Timed blood

samples were obtained at 1.5, 3, 6, 12, and 24 hours. Serum was separated by

centrifugation and the Phe concentrations determined with the normal fluorimetric assay

and repeated three times.

Sacrifice and Tissue Collection

Gene therapy-treated animals were sacrificed with an overdose of sodium

pentobarbital followed by cervical dislocation or brain perfusion with 4%

paraformaldehyde. The following tissues were collected (prior to perfusion): muscle,









kidney, spleen, lung, liver and testes, and quick frozen on dry ice and stored at -700C.

Instruments used for dissection were cleaned between each tissue with Decon* Eliminase*

Decontaminant (East Sussex, UK) to prevent DNA cross-contamination. Approximately

100 mg of liver was saved in 2 ml of RNAl/i,/ (Ambion, Austin, TX) and placed on ice

then moved to -200C. All other tissues were fixed in 10% formalin for general

pathological examination. Liver sections saved in tissue cassettes were sent to the

Pathology Core for paraffin embedding and sectioning. These were processed by

dehydration with graded ethanol solutions, cleared with xylene and embedded in paraffin.

Five-micron sections mounted on glass slides were hydrated in graded alcohol solutions,

stained with hematoxylin and counterstained with eosin. These were dehydrated once

again to place a coverslip on the slide using Permount.

Normal animals were sacrificed by CO2 asphyxiation followed by cervical

dislocation. Necessary tissue samples were removed and saved by quick freezing, in

RNAlater or as tissue homogenates. Approximately 100 mg of tissue was homogenized

in 2 ml homogenization buffer in a glass homogenizer. This was centrifuged at 16,000 g

for 10 minutes at 40C. The supernatant was saved at -700C or used immediately for PAH

activity assays.

RNase Protection Assays

RNA samples were extracted with TRIzol Reagent (Invitrogen) and protocol.

Probes for the RNase Protection Assay (RPA) were designed, PCR amplified from CB-

mPAH and cloned into pGEM-T. The clones selected for transcription reactions were

checked to be in the correct orientation for T7 RNA polymerase transcription, digested

with NotI, and purified by phenol:chloroform extraction. Transcription of the probes was









done using Ambion's MaxiScript In vitro Transcription Kit. Probes were gel purified

and eluted overnight. Fifteen micrograms of RNA from the experimental samples were

set up with CB-mPAH sense probes, antisense probes as negative controls, and Actin

probes as loading controls. Yeast RNA, 2.5 [tg, was included with all probes with or

without RNAse addition as RNase efficiency controls. The assay was done using

Ambion's RPA IIITM Kit and protocol. The samples were run on 5% acrylamide, 8 M

urea, 1 X TBE gels and exposed to film at -700C for various times to detect protected

RNA fragments. Laser densitometry was done to calculate relative levels of protected

RNA.

Southern Blotting

DNA was extracted from tissue samples in tail buffer: 50 mM NaC1, 25 mM

EDTA, 50 mM Tris pH 8.0, with 50 [tl of 10% SDS, and 50 [tl of 10 mg/ml proteinase K.

One hundred milligrams of tissue was incubated in 500 [tl of buffer overnight at 550C, 2

[tl of 10 mg/ml RNase A solution was added in the morning for 1 hour incubation at

550C. Aqueous layers were subsequently extracted with the following: 500 tl phenol for

1 hour at room temperature, 500 [tl phenol:chloroform for 30 minutes at room

temperature, and 500 [tl chloroform for 2 minutes at room temperature. The last aqueous

layer was ethanol precipitated and resuspended in an appropriate volume of TE pH 8.0.

DNA sample quality was checked by incubating at 370C for 1 hour in 1 X NEB

restriction buffer 3 and 1 X BSA, then electrophoresed on 1% agarose gels against

unincubated samples.

Twenty micrograms of DNA was digested overnight. The digested samples were

run on 0.8% agarose 1 X TAE gels at 5 V/cm for 5 hours. DNA was transferred by









downward capillary transfer in 10 X SSPE onto BioRad Zeta-Probe GT membrane. The

membrane was UV crosslinked and baked for 30 minutes at 800C. Church buffer with

added sheared salmon sperm DNA was used for hybridization at 650C. Pre-hybridization

was done for 4 hours. Fifty nanograms of gel purified digested DNA fragments were

labeled with Rediprime II at room temperature. The probes were purified on G-50

columns and half of the probes were used in 10ml of hybridization buffer for a 12x 14cm

membrane. Washes were done at 65C for a total of 3 hours. Membranes were exposed

for 48 hours to Kodak BioMax-MS film in a TransScreen HE cassette at -700C.

Subsequent exposures were done as necessary. Laser densitometry was used to measure

band intensities.

RNA Interference Protocols

Generation of siRNA Cassettes

DNA oligos for the three designed siRNAs were ordered from Sigma-Genosys. The

oligos were gel purified and diluted to 10 [tM based on concentrations obtained from

optical density readings. Ambion's SilencerTM Express siRNA Expression Cassette Kit

was used for generating each cassette containing the human U6 promoter. The provided

GAPDH and negative cassette controls were also made. The PCR reactions were done in

a Mastercycler (Eppendorf) using Platinum" Taq (Invitrogen) according to provided

protocols with 500C for the annealing temperature. Concentrations of the final product

were determined by optical density.

Reverse Transcriptase Reaction and Polymerase Chain Reaction

RNA samples were extracted using TRIzol Reagent and protocol. Five hundred

nanograms of RNA were used for the reverse transcription reaction followed by









polymerase chain reaction (RT-PCR). All reactions were set up in 200 Etl tubes and all

incubation steps were done in the Mastercycler to ensure even incubations. The lid

temperature of the Mastercycler was kept at 1050C throughout the experiment. All RNA

samples were from cell transfections, thus were first treated with RQ1 RNase-Free

DNase (Promega) for 30 minutes at 370C. EDTA was added to the samples and incubated

at 65C for 10 minutes for inactiviation of the DNase. The reverse transcription reaction

was then set up using Promega's AccessQuickTM RT-PCR System. This includes a mix

that contains the necessary components for reverse transcription and PCR reactions. The

reverse transcriptase was added last. A one hour incubation at 480C for reverse

transcription was done followed by 35 cycles of 940C 0.5 minute, 550C 1 minute, 720C 5

minutes, and one last 5 minute incubation at 720C. Half of the reactions were then run on

15% polyacrylamide 1 X TBE gels with an appropriate ladder. The gels were stained

with ethidium bromide for visualization on an Eagle EyeTM Imaging System (Stratagene).

Relative intensites of the bands was calculated using the software UN-SCAN-IT gel

Automated Digitizing System Version 5.1 (Silk Scientific Corporation, Orem, UT).














CHAPTER 3
ANIMAL MODEL ANALYSIS

The most useful animal model for phenylketonuria is the BTBR Pahenu2 mouse. A

single nucleotide mutation in the PAH locus created the missense mutation F263 S.54 This

mutation renders phenylalanine hydroxylase completely inactive. The mice have

"classic" PKU: hyperphenylalaninemia, cognitive deficits, maternal PKU syndrome, and

hypopigmentation (Figure 3-1). Various studies of the mouse model have been done (see

the Animal model section of Chapter 1), but some physiological parameters that we have

observed with our colony have not been previously described. This chapter describes

some general observations about the mouse model, and experiments performed to further

understand this model of classic phenylketonuria.

General Sex Dimorphism in BTBR Pahenu2 Mice

Growth Curve Analysis

A number of papers have been published about the BTBR Pahenu2 model, but none

mentions any differences between the Pahenu2 male and female mice. Early on in our

colony it was observed that the female mice were smaller and more fragile than their

male counterparts. We decided to quantitate this observed difference from birth to

adulthood. Three litters from male -/- to female +/- matings were followed from birth

until post-natal day 72. All pups were tattooed with India Ink in different patterns on

their paws between day 3 and day 6 to follow each pup's weight specifically, since

genotype of the pups cannot be ascertained visually immediately after birth. Coat color

identification between days 15-20 was used to assess genotype in these crosses which









was later confirmed by serum Phe levels obtained at weaning. Five heterozygous males,

seven heterozygous females, five Pahenu2 males and four Pahenu2 females were thus

followed from birth. Weights pre-determined in our inventory were added to the averages

of these mice for the adult average values to obtain more accurate numbers. Three wild

type litters were also followed from birth, but without tattooing of the pups. Eleven wild

type males and seventeen wild type females were thus included in these calculations.

Again values obtained from our inventory were also added into the adult weight averages.

The results in Figure 3-2 show that Pahenu2 mice are smaller than both heterozygote

and wild type mice. Using unpaired t-test analysis (Table 3-1) from day 0 to day 56, wild

type and heterozygous mice do not show any significant trends in the differences in their

growth. While some points show significant differences, they can be explained by litter

sizes: the wild type litters had each three to four more pups than the followed

heterozygous litters thus being somewhat smaller at some of the early time points.

Comparing males and females separately explains the significant p values towards the

end of the 56 days. While males are not significantly different in their growth rates, the

wild type females remain somewhat smaller than the heterozygous females, a lasting

effect of the litter size differences that does not continue once the animals reach

adulthood. Adult females, both wild type and heterozygote, are generally smaller than

their male counterparts as expected.

The Pahenu2 mice compared to heterozygous mice are significantly smaller starting

at day 6 with a p value below 0.05. The p value comes below 0.001 at day 12 until day 49

when it comes back to just below 0.05. Again looking at the males alone, the difference

in growth rates is only significant until day 49 when the PKU males reach weights that













Table 3-1 Un paired t-test analysis of litter weights
Days: 3 6 9 12 15 18 23 28 35 42 49 56
+/+ to +/-a 0.0663 0.0088b 0.0041 0.0001 0.0001 0.0001 0.0000 0.0000 0.0000 0.0004 0.0454 0.0123
M+/+tom+/- 0.1051 0.0361 0.0169 0.0026 0.0035 0.0045 0.0002 0.0000 0.0001 0.0001 0.0214 0.1898
F+/+to f+/- 0.3945 0.0647 0.0651 0.0218 0.0138 0.0080 0.0016 0.0005 0.0000 0.0012 0.0002 0.0000
+/+to -/- 0.0008 0.0000 0.0001 0.3472 0.0002 0.3190 0.0000 0.0002 0.0514 0.0485 0.0429 0.1927
M+/+tom-/- 0.0471 0.0089 0.0038 0.9054 0.0085 0.1963 0.0023 0.0001 0.0184 0.0069 0.0443 0.5190
F+/+to -/- 0.0035 0.0000 0.0247 0.3020 0.0166 0.9470 0.0015 0.0517 0.0019 0.0053 0.0000 0.0017
+/- to -/- 0.5257 0.8105 0.3585 0.0000 0.0001 0.0000 0.0000 0.0000 0.0000 0.0028 0.3896 0.0761
M+/-tom-/- 0.5555 0.3175 0.6245 0.0007 0.0105 0.0000 0.0000 0.0000 0.0000 0.0078 0.3432 0.2649
F+/- to f-/- 0.0902 0.0407 0.3600 0.0051 0.0058 0.0000 0.0001 0.0000 0.0000 0.0001 0.0001 0.0001
Intra +/+ 0.0042 0.0081 0.5667 0.5861 0.6491 0.8837 0.1544 0.0042 0.0000 0.0000 0.0000 0.0000
Intra+/- 0.2821 0.1806 0.1547 0.8212 0.3868 0.3618 0.5781 0.0121 0.0020 0.0013 0.0006 0.0067
Intra -/- 0.4163 0.0348 0.1433 0.2402 0.6082 0.9275 0.7959 0.2092 0.0059 0.0013 0.0003 0.0000
aResult of paired analysis is shown for each set of data.
bBlue text indicates p value less than 0.05.
cPink text denotes p value less than 0.001.









cannot be distinguished from heterozygous males, see Figure 3-3 and Table 3-1. This is

different than the growth curves observed between the wild type and heterozygous males

that did not show this delay in weight gain.

The female Pahenu2 are significantly smaller than all the other mice in the model.

When compared to heterozygote females, the p values are below 0.05 from day 12 until

day 28 when the p value goes below 0.001 and remains there throughout their lifetime.

This fragility is further demonstrated by ANOVA analysis of adult weights in Table 3-2

that shows that the p value only remains significant between the three populations when

the Pahenu2 females are included in the calculations.

Table 3-2 Results of ANOVA analysis of adult weights.
Groups DFa Fb PC
+/+, +/-, -/-194 16.61 2.23x10-7
+/+, +/-, male -/-, female -/- 194 52.61 7.82x10-25
+/+, +/-, male -/- 124 0.31 0.73
+/+, +/-, female -/- 144 55.26 1.78x10'18
a Degrees of freedom
b F-value: distance between individual distributions
c P-value

Serum Phenylalanine Levels

In humans, the classic PKU phenotype is normally defined as having serum

phenylalanine levels of 1200 [tmol/L (1.2 mM) or more.27 The mouse model, BTBR

Pahenu2, has similarly elevated Phe levels that classify it as the "classic" phenotype. Table

3-3 shows normal, non-hyperphenylalaninemic, heterozygote Phe values, and male and

female Pahenu2 serum Phe values. Female mice have higher Phe levels than the male

mice, and our lab has observed this phenomenon since the beginning of our colony. Only

one recent report indicated similar findings where male mice had 1.80 mM serum Phe

levels while female mice had 2.89 mM serum Phe levels.70 Shedlovsky had reported an

average of 23.1 mg/dL (1.39 mM) serum Phe in the Pahen2 mice with no mention of









male and female differences.50 The model's Phe values have also been reported as 1.70

mM116, 1.54 mM64, 1.57 mM66, 2.0 mM in males and 2.06 mM in females (deemed not

significant)69, and 1.23 mM68. The varied values can be explained by differences in assay

methods and sensitivity, and perhaps also explain the one report where male and female

mice where not found to have significantly different values.

Table 3-3. Serum phenylalanine values in BTBR Paheu2.
6 weeks 8 weeks Adult average
Heterozygote 0.07 +/- 0.02 0.07 +/- 0.01 0.09
Male -/- 1.50 +/- 0.14 1.36 +/- 0.08 1.13 +/- 0.08
Female -/- 1.82 +/- 0.12 1.58 +/- 0.05 1.54 +/- 0.03
a Values expressed in mM.

The phenylalanine values in the Pahenu2 mice prior to 6 weeks are not significantly

different and are around 2.0 mM. As the mice begin their sexual development, the values

decrease as shown, with the males lowering by half their early levels by adulthood. The

6-week time point or 42 days corresponds to the time when male mice begin to catch up

to heterozygote mice in terms of weight. Perhaps the gain in muscle weight can explain

the 0.4 mM (or 6.7 mg/dL) difference by adulthood in the serum Phe values.

Food Consumption

The food consumption on a per week basis was measured in the mice in order to

find an explanation for the difference in serum Phe values between the male and female

PKU mice. The mice were housed in standard housing in groups of 2 to 4 separated by

sex and genotype. Each mouse was weighed once a week for a total of 2 to 4 weeks.

Average food consumption was calculated on a per-gram of mouse basis as protein intake

is usually reported in the literature. Figure 3-4 shows that for adult mice, 10 weeks or

older, the Pahenu2 (-/-) females eat more than any of the other mice. Heat loss in these

smaller mice may explain the difference in food intake since more energy expenditure









should be required to maintain body temperature. To verify this hypothesis, one cage of

heterozygote females had their food consumption measured starting at 6-weeks of age for

3 consecutive weeks. Their average weight over the 3 weeks was 23.3 g, similar to the

adult Pahenu2 females. These mice also consumed more chow than their adult

counterparts, with an average of 0.25+/-0.03 g of food consumed per day per gram of

mouse.

Lifespan Analysis

Using our entire mouse inventory, a natural lifespan analysis was performed. Only

mice that died of natural causes were included in the calculations. Average lifespan,

incidence of premature death defined as prior to 12 weeks of age, average adult lifespan

(excluding mice that died prior to 12 weeks of age) and median adult lifespan were

calculated from the data. Wild type and heterozygote data were combined by sexes since

the pool samples were smaller than for the PKU mice. The results are displayed in Table

3-4. As an indication of overall relevance, the number of data points for each group is

indicated along with the fraction of total mice of that category in the inventory that it

represents. The data are most likely skewed toward a lower than expected lifespan:

animals that die young will be recorded into the inventory whilst older animals may be

sacrificed prior to the end of their natural lifespan. However, the sample size for the PKU

mice seems large enough to infer that the female mice have a higher incidence of

premature death, 0.15 versus 0.08, and a shorter adult lifespan than the males. 7.1 months

versus 10.5 months. Normal males live longer than normal females, and the data for PKU

males are similar to that of the normal males. Even though the sample size for

heterozygote and wild type mice is much smaller, it seems likely that given a larger

sample size the data would remain the same. This assumption is based on our









observations, general appearance of the mice, their size, Phe levels, and food

consumption presented in the earlier parts of this chapter.

Table 3-4 Lifespan analysis.
Malesa Females -/- Males -/- Females
(+/+ and +/-) (+/+ and +/-)
N 22 46 65 81
(fraction of total (9%) (15%) (40%) (40%)
inventory)
Average lifespan 9.3 7.2 9.8 6.3
(months)
Incidence of 0.09 0.15 0.08 0.15
premature death
Average adult 10.0 8.1 10.5 7.1
lifespan (months)
Median adult 9.5 7.3 10.7 6.6
lifespan (months)
aData is presented as the average in months based on the indicated sample size.

Phenylalanine Hydroxylase in BTBR Paheu2 Mice

It is clear that based on lifespan, serum Phe values, and growth curves that female

Pahenu2 mice are more severely affected by the disease than the male mice. To further

evaluate the mouse model and attempt to understand the male and female dimorphism,

PAH was measured in its various forms in both liver and kidney.

Liver PAH

Message levels

The mouse model contains a missense mutation causing a phenylalanine change to

a serine. It was reported that the Pahenu2 mice have 12% of wild type PAH mRNA

levels.50 Given that the mutation is a single base change buried in the middle of the PAH

transcript, it seemed unlikely that it would cause such a reduction in transcription or

render the mRNA unstable in any way. Mouse liver samples were extracted for RNA and

these were analyzed by Northern blotting for mPAH. While Northern blotting is not the

most sensitive method for RNA quantification, a severe reduction in RNA levels would









be easy to detect and confirm. Figure 3-5 shows a representative blot and the overall

results. A total of eight adult animal samples were analyzed for +/+ and -/- mice, and 7

samples were analyzed for +/- mice. No statistically significant changes were observed

between the three genotypes or between sexes. The message is very abundant and easily

detectable using the full-length cDNA probe as shown in Figure 3-5A.

Protein levels

Message levels were not expected to be different in the PKU mice, and the

Northern blots showed that PAH in the liver was not reduced. We were uncertain what

effects the inactivity of the F263S protein would have on overall PAH protein levels in

the liver. Shedlovsky had showed Pahenu2 levels to be approximately 33% of wild type.50

That evidence combined with normal levels of PAH mRNA indicates that perhaps

mPAH-F263S is less stable than the normal monomer and is directly selected for

degradation after translation, or that the mutant protein does not easily form a tetramer

and is also selectively degraded, or that the mutant inactive tetramers are turned over

quickly due to inactivity. Liver PAH protein amounts were determined by Western

blotting. PAH amounts were found to decrease by approximately 40% between +/+ and

+/- mice, and by approximately 60% between +/+ and -/- mice, as shown in Figure 3-6,

and in agreement with the original published results on Pahenu2 mice.

Activity levels

Phenylalanine hydroxylase activity was measured from freshly extracted liver

protein to further define the liver environment. Since mPAH-F263 S has no catalytic

activity, the Pahenu2 samples do not have any activity as measured by the

spectrophotometric assay. In the heterozygote samples, Kaufman predicted based on a

mathematical model developed with the properties of purified PAH, that a heterozygote









patient might be expected to have 40% of normal activity based on reported ratios of

serum Phe values in obligate heterozygote versus normal patients. Sample biopsies from

these patients have been reported to be around 30% of normal activity.117 We have

calculated an average of 42% activity in heterozygote mice, agreeing with Kaufman's

prediction. Table 3-5 contains the result of the PAH assays with the liver samples.

Table 3-5 PAH activity in liver samples.
+/+ +/- -/-
Activity average" 1.00 0.42 0.02
Standard deviation 0.15 0.10 0.07
N 9 8 13
aResults are given as averages +/- standard deviation relative to wild type activity levels.

Protein levels in heterozygote mice were approximately 62% of wild type, while

activity has been found to be only 42% of wild type. The Pahenu2 mice have 41% of

normal protein amounts with, as expected, 0% normal activity. This suggests that the

mPAH-F263 S monomers are turned over quickly in the liver possibly due to instability or

improper folding. In heterozygotes, with one copy of the mutated gene, the mice show

16% of protein above the assumed 50% normal protein. If the 16% 'extra' protein is

assumed to be the mPAH-F263S protein amount, one could assume that Pahenu2 mice

should only have 32% protein. However, 41% was actually observed. Moreover, the 42%

of normal activity levels consistently observed in the +/- mice suggests that an interaction

between normal and mutant monomer is taking place thus reducing the total potential

activity levels and perhaps the amounts of normal monomers. The antibody is incapable

of distinguishing between normal and mutant monomer, thus we are unable to determine

what relative amounts of each protein is present in the heterozygote mice.









Kidney PAH

Similar experiments were conducted with kidney samples. Results are shown in

Figure 3-7. Unlike liver PAH, protein amounts are equal between each genotype. Activity

levels decrease by 50% from wild type mice to heterozygote mice. The regulation of

turnover and /or the stability of the protein seem to be different between the two organs,

which is consistent with the state of activation observed with purified kidney rat PAH.38

The rat kidney enzyme was not responsive to pre-incubation with phenylalanine unlike

liver PAH, and it was found to have higher in vitro activity with BH4. Since the

promoters are the same, it is presumed that post-translational modifications are different

in each organ leading to the differences observed in stability of the protein.

It is interesting that the liver and the kidney do not seem to regulate PAH in the

same manner, and perhaps the kidney could be a good target for gene therapy.

Colocalization of the cofactor BH4 and the AAV vector would have to be achieved, thus

requiring that the cell types where PAH and BH4 are present in the kidney be susceptible

to rAAV infection. Studies are currently underway to determine the localization of PAH

in the mouse kidney.

Discussion

The mouse model for phenylketonuria, BTBR Pahenu2, was examined in detail for

this study. BTBR Pahenu2 mice have a single base mutation in the PAH gene leading to

the missense mutation F263S in exon 7.54 The mutated enzyme is catalytically inactive,

and the mice have classic PKU: hyperphenylalaninemia, hypopigmentation, cognitive

deficits and maternal PKU syndrome. We found that female BTBR Pahenu2 mice are

significantly smaller than the male Pahenu2 mice and have a shorter lifespan and a higher

incidence of premature death than any of the other mice. Serum phenylalanine levels in









adult female Pahenu2 mice are on average 0.5 mM higher than the males, and the females

were found to eat more on a per gram basis than either Pahenu2 males, heterozygote, or

wild type mice. While the increased food intake might be due to higher energy

expenditure for body temperature stabilization in the smaller female mice, thus leading to

the higher serum Phe levels, the reason for the persistent smaller size in the females is

still unknown.

The sexual dimorphism observed in the animal model is not explained by the

molecular status of PAH in the mice: no differences were observed between males and

females in terms of PAH transcript, protein or activity. This is consistent with the fact

that PAH is a housekeeping gene even though in the mouse, the enhancer has been shown

to be regulated by hormones such as dexamethosone.31 The PAH transcript was not found

to be significantly reduced in all three genotypes of the mouse model as expected for a

missense mutation. Protein levels in the liver were 62% of normal in the heterozygote

mice, and 41% of normal in the Pahenu2 mice. Activity measurements showed that

heterozygote mice have 42% of normal PAH activity in the liver. This amount of activity

as compared to the calculated protein amounts in the heterozygote livers is suggestive of

a dominant-negative interference effect in the mice, since the enzyme is a homotetramer.

The presence of PAH mutant protein in the Pah e2 mice could lead to dominant-negative

interference after gene therapy, and explain the need for high rAAV doses to cure

hyperphenylalaninemia. Our gene therapy results, and the implication of dominant-

negative interaction are discussed in detail in chapters 4, 5 and 7. Since some 60% of

known human PAH mutations are missense mutations expressed in the patients, further

study of this mechanism is needed to develop clinically applicable therapy for humans.






61

+/+ -/- +/-






4






Figure 3-1 BTBR Pah "' mouse model. The PKU mice (-/-) are hypopigmented as
compared to the wild type (+/+) and heterozygote (+/-) mice.







62



50
+ +/+ +/- A-/-
45

40

35

30 -

.. 25--- A ---
-c- 25

20 2

15 A

10 l---




0 20 40 60 80 100 Adult average
Time (days)

Figure 3-2 BTBR mice growth curves. The Pahenu2 (-/-) mice are significantly smaller
than the heterozygote (+/-) and wild type (+/+) mice.







63




* +/- Males N +/- Females A -/- Males -/- Females










I- A
A i

A
1 *-
------


p----------------------------


80 100


Adult average


Time (days)


Figure 3-3 Male and female weight differences. While female Pahenu2 (-/- Females)
remain significantly smaller than all the other mice, the male Pahen2 (-/-
Males) catch up to the heterozygote (+/-) mice around day 40.


50

45

40

35

S30
4-J
-C 25

: 20

15

10

5

0




















* Male +/- U Female +/- Male -/- S Female -/-


0.30


0


E
0
0.25
o

E


o 0.20




L

0
(U




L 0.15




0
S 0.10
0.
E


C
o 0.05

0o
0
0
Ll


0.00 J


Figure 3-4 Average daily food consumption. Female -/- mice eat significantly more on a

per gram basis than the heterozygote or male -/- mice, p<0.05.


*






- - - -- -


I


.. .......................


::.:: ::: ::::::::::::::::::::::
::::::.::::::::.:::::::::::::::::::::: i
... ... ...... .... ,..... ....,
............. ... .........
. .... . . . . ,

.,.............. ..........,
. . .... .. ... .... .. ....,
.......... ... ..-. .... ..

.. . .... . . . .
. ... . . . . .
. .
.. . .

. . .
.. .. .. .
. . . . .
. . . .










x\,x x\' X ,
\e \


Iy -l <- e.


mPAH



CuZnSOD


B



ci)
(U


E

D..
ciL
ci


C'1


+/+ +/- -/-

Figure 3-5 Northern blot of mouse PAH. A. Representative northern blot showing mPAH
signal and loading control CuZnSOD. B. Quantitated results combined by
genotype as calculated by laser densitometry and reported as relative PAH
amounts normalized to CuZnSOD.













X\
mPAH M1


V v


GAPDH 0"


1.2

C
0 1
E
c
C
(D 0.8
0.

0.6

S0.4


0.2


0


+1+ +1- I


Figure 3-6 Western blot of mouse PAH. A. Representative western blot film from male
liver samples. Fifteen micrograms of total protein was run for each sample
and mPAH and loading control GAPDH signals are both indicated. B.
Quantitated results of western blots grouped by genotype. Results are
expressed as relative mPAH amounts normalized to GAPDH as measured by
laser densitometry. Wild type levels were set to one and +/- and -/- levels are
shown as fraction of wild type.







67



1.6
mRNA Protein Activity
1.4


S1.2 -


o 1
0

= 0.8
0

0.6

a) 0.4


0.2


0
+I+ +/-
-0.2

Figure 3-7 Kidney PAH amounts. All results are presented relative to wild type levels set
to 1. mRNA amounts are averages +/- average deviation, N=5, N=6 and N=6
respectively. Protein amounts are averages +/- standard deviation, N=14,
N=12, and N=8 respectively. Activity levels are graphed as averages +/-
standard deviation, N=12, N=10 and N=10 respectively.














CHAPTER 4
DOMINANT-NEGATIVE INTERFERENCE IN PHENYLKETONURIA

Dominant-negative interference is defined as an interaction between two proteins

that leads to negative regulation or inactivation of the normal protein's function.118 This

may occur when one protein is mutated in a way that prevents its normal activity; the

mutated protein combines with a normal protein and leads to impaired function,

inactivation, or degradation. Systems that require dimerization or oligomerization can be

affected by dominant-negative interference by an expressed and relatively stable mutant

subunit. The best-known example of dominant-negative interference in a human disease

is Osteogenesis Imperfecta (OI) where one mutant collagen molecule destabilizes the

extra cellular matrix (ECM) of the bone leading to bone fragility and frequent fractures,

the main clinical features of OI. Dominant-negative effects due to specific mutations in

receptors or hormones can cause many endocrine diseases. For example Fabry disease,

congenital adrenal hypoplasia, Crigler-Najjar syndrome, and pituitary dwarfism have

been found to be dominant-negative disease in some patients. 11

After early results of gene therapy trials in the BTBR Pahenu2 mice, our laboratory

hypothesized that dominant-negative interference could be the reason for the high rAAV

doses needed to cure HPA in male mice. Phenylalanine hydroxylase is a tetrameric

enzyme, and a functional monomer introduced by gene therapy could interact with the

endogenous mutant monomers, reducing total potential activity in the hepatocytes, thus

the need for high doses to correct the hyperphenylalaninemia. This chapter presents the









gathered evidence that dominant-negative interference occurs in this mouse model for

phenylketonuria after gene therapy.

Gene Therapy for Phenylketonuria: Divergent Results by Sex in BTBR Pahenu2

A recombinant Adeno-associated virus vector was constructed in the lab and

contains the mouse PAH cDNA. The gene is expressed from the hCMV enhancer and

Chicken-Pj-Actin hybrid promoter (CB). An SV40 polyA signal follows the mPAH

cDNA, and the plasmid is 6823 bases in total (Figure 4-1 panel A). An alternate vector

contains the Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE)

followed by the Bovine Growth Hormone polyA. This plasmid is 7519 bases (Figure 4-1

panel B). Either vector can be packaged in trans to produce rAAV type 2 virions (Figure

4-1 panels C and D). All virus packaging was done by the University of Florida Vector

Core. Briefly, our vector DNA is co-transfected into HEK-293 cells with the pDG

plasmid which contains AAV's rep and cap genes along with the required Adeno virus

genes.114 After 48 hours a cell pellet is obtained, freeze-thawed, and separated on an

iodixonal step-gradient. The virus is purified on a heparin affinity column, and after

concentration the virus is titered by quantitative competitive PCR and infectious center

assay.

The first gene therapy trial was done with rAAV2-CB-mPAH virus. Both male and

female mice were injected via portal vein. Male mice responded to 1.5x1011 infectious

unit (IU) dose by lowering their serum phenylalanine levels from 1.10 mM to an average

of 0.3 mM for 24 weeks, the end of the experiment (data not shown). Normal

phenylalanine levels would be around 0.10 mM. The dose of CB-mPAH vector was

therapeutic, but not fully effective. Female mice failed to respond to the same virus dose

as the males. The females' lack of response to the gene therapy at such a high doses









prompted the construction of the second vector that includes the WPRE in order to

enhance the effect of the gene therapy. The WPRE has been shown to enhance the

activity of transcripts both in cells and in animals from a variety of virus vectors.119120 In

cell culture transfections, CB-mPAH-WPRE has 2 to 2.5 fold higher activity than CB-

mPAH (data not shown). We repeated our initial study using both newly packaged

rAAV2-CB-mPAH-WPRE and rAAV2-CB-mPAH. We note that continuous

improvements by the University of Florida Vector Core have improved both the yields

and quantitation accuracy of vector preparations.

In this second trial, 3X1010 infectious units of rAAV2-CB-mPAH fully corrected

male BTBR Pahenu2 mice (Figure 4-2). With the CB-mPAH-WPRE vector, males were

fully corrected at about half the CB-mPAH dose, 1.3x1010 infectious units. Female mice

responded to 3x1011 infectious units of rAAV2-CB-mPAH-WPRE by lowering their

serum Phe levels to approximately 0.6 mM. This dose is at least 20 times more than the

dose used in the male mice and still failed to fully correct the females. These results are

comparable to those obtained by Mochizuki et al. in 2004, although different serotypes of

AAV were used.69

Liver PAH: Evidence of Dominant-Negative Interference

No difference between the sexes was observed at the molecular level for PAH.

Nonetheless, the data do point to an interaction between mutant and normal PAH

monomer. While RNA transcription is constant for the housekeeping gene in all three

groups of mice, protein PAH levels vary in the liver (Figure 4-3). In addition, activity

levels are reduced from wild type to heterozygote mice due the presence of the mutant

F263 S monomer. While the overall PAH amount is approximately 62% in heterozygote

mice, the PAH activity detected in these samples is only 42% of wild type. If only the









mutant monomers were degraded in the heterozygotes, one would expect to see 50% of

wild type protein amounts and 50% of wild type activity. Neither the western blots nor

the activity assays can differentiate between normal and mutant monomers, but based on

the less than ideal percentages observed, one can infer that both monomers interact in a

dominant-negative fashion leading to increased turnover and reduced PAH activity. The

heterozygote mice at 42% normal PAH activity have normal serum Phe levels and are

indistinguishable from wild type mice.

In vitro Cell Transfection Studies with Normal and Mutant PAH

To further investigate the possible interaction between normal mPAH and mouse

mutant mPAH-F263S, a new vector was created to express mPAH-F263S. PCR primers,

containing nucleotide changes to create the F263S mutation, were used to amplify a 132

base pair segment of the PAH cDNA (Table 2-2). The amplified region was subcloned

into a pGEM-T plasmid, sequenced, cloned into pGEM-T-mPAH and the full-length

mPAH-F263 S gene was moved back into the rAAV-CB-mPAH plasmid (Figure 4-4).

The extra cloning steps were done to avoid subcloning a small PCR product into the large

rAAV plasmid that must be transformed into Sure cells. The larger pieces used in the last

ligation allow for better ligation efficiency and are easier to transform into the low-

efficiency Sure cells.

HEK-293 cells are routinely used to test activity of DNA vector preparations, and

were chosen to study the possible interactions between normal and mutant monomers of

PAH. Calcium phosphate transient transfections were performed with various ratios of

vector DNA, a cell lysate obtained after 48 to 72 hours post-transfection, and used in the

spectrophotometric PAH assay. All co-transfection experiments performed together were

normalized in terms of total DNA transfected with the p21-newhp plasmid which









contains the same CB promoter as the mPAH plasmids. pTR-UF 11 was also transfected

to visually monitor transfection efficiency by examining GFP expression in the cells prior

to harvest.

Both CB-mPAH and CB-mPAH-F263 S were tested for activity or protein

production with increased DNA transfected in the cells, without normalization between

transfections. This was done in part to determine what amount of CB-mPAH DNA

transfected would result in activity levels that could increase and decrease in a detectable

range between each transfection. Both activity and protein expression increased in an

almost linear fashion when increased amounts of DNA were transfected into the HEK-

293 cells (Figure 4-5). The series of mPAH-F263S transfections was analyzed by western

blotting (Figure 4-5 panel A). The protein amounts increased from 5 to 15 [tg and show

that the F263S monomer is stable in this transient expression system. The mPAH

transfections were analyzed by activity assay (Figure 4-5 panel B). The amount of

activity from 5 [tg per well to 10 [tg per well almost tripled while the 15 [tg transfections

were approximately 1.5 times more active than the 10 [tg transfections as expected. The

3-fold increase in activity from 5 [tg to 10 [tg is not completely unexpected since at 10 [tg

more cells could have been transfected with multiple copies of CB-mPAH thus producing

a larger number of stable tetramers and increasing the activity by more than 2-fold. From

10 [tg to 15 [tg, the cells are more evenly transfected and the increase in activity follows

the increase in DNA.

Mixed CB-mPAH and CB-mPAH-F263 S transfections were then performed to

analyze the extent of the interaction between the two proteins in this system. For one half

of the transfections, mPAH was held constant and mPAH-F263 S was increased relative









to the normal vector. For the second half, mPAH-F263 S was held constant and increased

amounts of mPAH were co-transfected in the cells. The results are presented relative to

an mPAH only transfection (with total DNA normalized with p21-newhp to the highest

amount of DNA transfected in the experiment) (Figure 4-6). Averages of a minimum of 3

transfections with standard deviations are shown for all data sets. The results indicate that

when both mutant and wild type monomers are present in the same cell PAH activity is

reduced. At a one to one ratio, the PAH activity is reduced by half and this remains so

even with increased amounts of null mPAH-F263 S. Increased mPAH-F263 S was

expected to have a stronger effect on PAH activity; the lack of further decrease in activity

may be explained by both the transient assay and details of subunit association. Turnover

of the protein may not be as efficient in the saturated cells, and accumulation of

functional tetramers would prevent further decrease in activity. Increased mPAH versus a

constant DNA amount of mPAH-F263 S led to less than a linear increase in activity and

further shows that the mutant and normal mPAH monomers interact in a dominant-

negative fashion.

One set of samples from the mixed transfections was analyzed by native

polyacrylamide gel electrophoresis and western blotting (Figure 4-7). In native gel

electrophoresis no SDS is included in running buffers or in the sample buffers. The cell

lysate samples shown in the figure, mPAH:mPAH-F263S and 2mPAH:mPAH-F263 S

were run next to a cell lysate from a transfection with CB-mPAH-WPRE, and a lysate

from CB-mPAH-A-exl3-WPRE. The later construct has exon 13 deleted from the cDNA,

the region coding for the tetramerization loop, thus preventing the protein from forming

tetramers. None of the mixed transfections showed a change in oligomerization pattern as









compared to the mPAH-WPRE transfection, and all three have a different pattern than the

mPAH-A-exl3-WPRE sample which indicates the position of dimers, and presumably

monomers, on the gel. The decreases in activity from the mixed transfections are due to

the interaction of the different monomers while forming dimers and tetramers, and not to

increased turnover or severe changes in oligomerization patterns.

Discussion

Male Pahenu2 mice were cured of hyperphenylalaninemia with 3x1010 IU (3x1012

vg) of rAAV2-CB-mPAH. While this is consistent with recently published PKU studies,

the minimum effective dose is high when compared to other rAAV uses.69'70 Portal vein

delivery of 4x109 IU of CB-hAAT to female C57 B1/J6 mice resulted in sustained

therapeutic levels of human al-antitrypsin and in a hemophilia B mouse model, an

rAAV2 vector carrying human Factor IX was therapeutic at 6.3x1010 vector

genomes.121,122 Four to eight-fold more rAAV2 was needed to cure HPA in male mice as

compared to both of these studies even though CB-hAAT is the source of vector

sequences used to construct CB-mPAH. We hypothesized that for the tetrameric PAH

enzyme, dominant-negative interference between endogenous and rAAV-derived protein

was diminishing the effectiveness of the gene therapy, and this possibility was confirmed

when we found that Pahenu2 mice have 42% of normal liver PAH amounts. The difference

between PAH protein levels and PAH activity in the heterozygote mice further suggests

that an interaction between the two monomers affects PAH activity.

To confirm the hypothesis, we performed mixed vector cell transfection

experiments. If one models the possible interactions of the monomers based on the

assumption that the effect between the monomers occurs at the dimer level, the results of









the mixed transfection experiments agree with the statistical predictions. For example, at

a 1:1 ratio of CB-mPAH and CB-mPAH-F263 S /4 of dimers would be fully wild type, /2

would be mixed, and /4 would be mutant. If the assumption is made that a mixed dimer

might have between zero and full activity, the observation of 62% of normal activity

suggests that mixed dimers are active at about 75% of wild type dimer activity. At the 1:2

transfection ratio, only 11% of dimers are wild type, and 44% are mixed. This predicts

PAH activity should be about 45% of full activity, close to the observed 52%. At the

higher ratio of 1:3, the results fell outside of the predicted PAH activity range (probably

due to saturation of the cell culture system or turnover of missense protein), but

importantly, were still lower than normal. The cell culture model data confirmed our

hypothesis that interaction between normal and mutated monomers leads to reduced PAH

activity thus increasing the rAAV doses needed to reduce HPA in male mice.

Female mice have serum Phe levels 1.5 times higher than males. Other studies have

suggested rAAV2 DNA is retained at about 7-fold higher levels in males than in females,

although this may depend on vector dose.123 Based on these numbers, ten to fourteen-fold

more vector may be needed to cure Pahenu2 females. However, the females were not

corrected at a dose 20-fold higher than in the males, suggesting that additional

mechanisms may cause the observed difference in the therapy response. Multiple studies

are in progress to attempt to elucidate the male and female dimorphism in the response to

gene therapy. While this will be key towards curing maternal PKU syndrome in the mice,

and potentially humans, this study concentrated on reducing overall needed vector doses

to cure HPA by targeting the dominant-negative interference.


















STR hCMV ie enhancer



Chicken beta actin promoter

CB-mPAH
6823 bp
Rabbit beta globbin
/ EcoRI
2000

l' ", ot mPAH
IN\ Xho mPAH
HimdIII HI


ITR
0 TR hCMV ie enhancer



Ampialcn resistance Chicken beta actin promoter


CB-mPAH-WPRE
SCB-mPAH'WPRE Rabbit beta globbin exon
75190 a




ITR mPAH
Bovine growth hormone poly A n4000 Oai Not


Chicken beta Actin promoter
hCMV ie enhancer
ITR
i i.


Chicken beta actin promoter
Rabbit beta globbin


ScoRI
gcne


'AH WPRE


Bovine growth hormone polyA


:o ITR
,:- -: :- -:


rAAV-CB-mPAH-WPRE
4665 bp


Figure 4-1 rAAV vector maps. A and B show the full plasmid maps, C and D show the

packaged DNA. A and C: CB-mPAH. B and D: CB-mPAH-WPRE.


Ampicllin resistance


Rabbit beta Globbin
mPAH


SV40pA
Not l


rAAV-CB-mPAH
3969 bp


hCMV ie enhancer
ITR

1 1- .







77



2.10

1.80

-15 0 Male -/- control
S1.50

E o 3.00E10 mPAH
1.20
Qo o A 1.30E10 mPAH-WPRE
E 0.90
SS Female 3.00E11 mPAH-
V)0.60 -WPRE
0.60
Female -/- control

0.30

0.00-
0 5 10 15 20 25
Time (weeks)

Figure 4-2 Serum phenylalanine levels after gene therapy wirh rAAV2. Male mice
treated with 3.00x1010 IU CB-mPAH had normal phenylalanine levels 2
weeks after treatment. Similar results were obtained with 1.30xl100 IU CB-
mPAH-WPRE. Female mice responded mildly to a 3.00x101 IU CB-mPAH-
WPRE.











*mRNA U Protein


2

1.75

1.5

1.25

1

0.75

0.5

0.25

0

-0.25


Figure 4-3 PAH amounts in mouse liver. All results are shown relative to wild type
amounts. mRNA averages +/- standard error, N=8, N=7, N=8. Protein
averages +/- standard deviation, N=13, N=12, N=12 respectively. Activity
averages +/- standard deviation, N=9, N=8, and N=13.


Activity








79




mPAH

.: (788)
StuI (622) HindIII (927)
I I- I


PCR amplification
Gel purification
Ligation to pGEM-T


pGEM-T-F263S PCR

Digest with XhoI and HindIII
Gel purification
Ligation into pGEM-T-mPAH


Amptillin resistance


F263S PCR HindII (2) NotI (630)








T7 promoter
lac operon mulaple doing rega


Stu (4240)
EcoR (3620) i Xhol(4406)
Eco* 362~i:..:..:...


MF263S
'.


Ampdtchn resistance
















Ampicillin resistance


ac oeron


Digest with EcoRI and NotI
Gel purification
Ligation into CB-mPAH


CB-mPAH-F263S
6823 bp


Chicken beta action promoter



S Rabbit beta globbin
EcoRI
2000


n Xhol H-
indlil mPAH-F2635


Figure 4-4 Cloning strategy for construction of CB-mPAH-F263S. PCR mutagenesis was
used to create the necessary base changes to make mPAH-F263S. The PCR
product after gel purification was subcloned into pGEM-T-mPAH. The full
gene mPAH-F263S was cloned into the CB vector after a correct sequence
was obtained.


EcoRI (2)


NotI (1544)
I


mPAH


SV40 pA












5ug lOug 15ug


mPAH-F263S


5


4


I3
I







1


0


mPAH 2 mPAH 3 mPAH


Figure 4-5 Test transfections with CB-mPAH and CB-mPAH-F263S. A. CB-mPAH-
F263 S serial transfections analyzed by Western blotting show increased PAH
signal when total DNA transfected is increased. B. CB-mPAH serial
transfections analyzed by activity assay, relative increases of transfected DNA
amounts are indicated. Although not quite linear, the activity does increase as
more mPAH was transfected.







81



4.00

3.50

3.00

2.50

2.00

au 1.50






0.00



PAH activity 2.45 1.75 1.00 0.62 0.52 0.60 -0.01
Standard deviation 0.95 0.19 0.21 0.12 0.15 0.09

Figure 4-6 Mixed transient transfection results. Cotransfections of CB-mPAH and CB-
mPAH-F263 S were performed and the activity assay results are shown. Ratios
in the first line of the data table are molar ratios of CB-mPAH:CB-mPAH-
F263S.

















1 2 3 4


* '
"*c,


.1: C~


..Oligomer

.qTetramer


Dimer...

Monomer.j,


Figure 4-7 Western blot of native PAGE with mixed transfection samples. Lane 1: CB-
mPAH-delta-exl3-WPRE. Lane 2: CB-mPAH-WPRE. Lane 3: CB-mPAH:
CB-mPAH-F263S. Lane 4: 2CB-mPAH: CB-mPAH-F263S.













CHAPTER 5
DESIGNING A HAMMERHEAD RIBOZYME AGAINST PHENYALANINE
HYDROXYLASE

In order to prevent the dominant-negative interference between normal and mutated

PAH subunits, as described in Chapter 4, two hammerhead ribozymes were designed to

target endogenous mPAH. This chapter presents the in vitro tests performed with these

ribozymes, the cloning of a recombinant AAV vector for the expression of the selected

ribozyme in vivo, and cell culture experiments using the ribozyme to demonstrate

dominant-negative interference.

Hammerhead Ribozyme Design for mPAH

The mouse PAH cDNA was searched for suitable 'NUX' sites (N is any nucleotide,

and X is anything but guanosine). Since GUC and AUC have been found to be more

active cleavage sites, only those two combinations were looked for in the cDNA.103 For

each possible cleavage site, the surrounding 12-nucleotide target and the necessary

ribozyme were checked for optimal folding using MFOLD.124,125 Only target sites

without self-binding and ribozymes with free hybridizing arms in their best

conformations were further checked with 100 or so bases of the target region for folding.

Two sites with cleavage site AUC, the codon for isoleucine, were selected corresponding

to positions 194 and 1209 (Figure 5-1). Both sequences for the 12-nucleotide targets and

full-length ribozymes, 33 nucleotides, were ordered as RNA oligos from Dharmacon.

In Vitro Ribozyme Tests

The first test for ribozyme activity is a time course analysis to measure the cleavage

rate of the ribozyme against its target. This is done with excess target and with a high









concentration of magnesium, 20mM, to allow for maximal ribozyme folding and

stability. Based on protocols developed by Fritz et al. (2002), each target was end-labeled

with y-[32P]-ATP.111 Ribozyme and target were mixed in a 10:1 target to ribozyme ratio

for time course analyses and samples were taken at various time points. The samples

were electrophoresed on 8 M urea, 8% acrylamide, 1 X TBE sequencing gels and

analyzed with a PhosphorImager (Molecular Dynamics, Sunnyvale CA). One of the two

ribozymes, RzI209, was found to be very active, with 70% of the target cleaved by 4

minutes (Figure 5-2). Further experiments were done with that particular ribozyme only,

since ribozyme 194 was not as active. A second time course of cleavage reactions was

performed with RzI209 at 5 mM MgCl2 in order to simulate a more physiological

magnesium concentration and with the same 10:1 ratio of target to ribozyme. The

ribozyme was still very active: fifty percent of the target was cleaved by 4 minutes

(Figure 5-3).

Kinetic properties of the ribozyme were determined in vitro at 5 mM MgCl2. Ten

duplicate reactions were set up with increasing target to ribozyme ratios from 0:1 to

1000:1. Each reaction was allowed to go for 1 minute, where on the previous time course

it was found that 10 to 20% of the target was cleaved. A saturation curve was generated

after running the samples on a gel and analyzing with the PhosphorImager (Figure 5-4A).

The kinetic parameters of the ribozyme were determined from the equation of the line on

the Lineweaver-Burke plot (Figure 5-4 B). The ribozyme could catalyze about 41

reactions per minute (Table 5-1).

A last in vitro experiment was meant to test RzI209's ability to cleave the full-

length target as opposed to the short target that had been ordered from Dharmacon. Using









the pGEM-T-mPAH construct, an RNA, corresponding to the full-length mRNA, was

transcribed with T7 polymerase. The transcribed product was incubated at 20 mM MgC12

with excess ribozyme at 37C. Samples taken at one and two hours were run on a 5%

PAGE 8 M Urea gel, and both cleavage products, 842 and 660 bases, were detected on

the gel (Figure 5-5). Ribozyme 1209 is capable of cleaving full-length PAH mRNA in an

in vitro reaction.

Table 5-1 Ribozyme 1209 kinetic properties.
Vmax 625.00 nM/min
K, 12104.38 nM
kcat 41.67 min'1

Cloning RzI209 into p21-nhp and Designing a Ribozyme-Resistant mPAH

The chosen rAAV vector for expressing the ribozyme, p21-newhp is based on pTR-

UF 12. It contains the hybrid CMV enhancer and chicken (3-actin promoter that is closely

related to the hybrid promoter contained in the CB-mPAH plasmids. The hCMV

enhancer in p21-newhp is 381 nucleotides long of which 361 nucleotides from the 3' end

are identical to the 3' end of the hCMV enhancer on CB-mPAH which is 535 nucleotides

in total. The p21-newhp plasmid is designed to express the ribozyme from the CB

promoter and follows the hammerhead ribozyme with a hybrid hairpin ribozyme to

evenly cleave the 3' ends of the transcripts to allow the ribozyme maximum ability to

reach its target mRNA.125 The ribozyme is followed by an SV40 polyA, 187 nucleotides

that is identical to the 5' end of the SV40 polyA in CB-mPAH which is 222 nucleotides

long. The ribozyme vector also includes a neomycin cassette driven by the PYF 441

enhancer and an HSV thymidine kinase promoter followed by a bovine growth hormone

polyA (BGHpA) signal that is identical to the BGHpA on the CB-mPAH-WPRE

plasmid, both 208 nucleotides long.









DNA oligonucleotides corresponding to ribozyme 1209 sense and antisense

sequences with added restriction sites Spe I and Hind III were ordered from Sigma

Genosys. The oligos were purified on a polyacrylamide gel, and subsequently annealed

and ligated into the p21-newhp rAAV vector, renamed CB-RzI209 (Figure 5-6). Sure

Cells (Stratagene) were used for bacterial transformations. All clones were sequenced at

the Sequencing Core and screened for ITR retention.

Since the vector-derived mRNA would also be cleaved by the ribozyme, a

ribozyme-resistant construct of mouse PAH was designed by changing the cleaving and

hybridization sequences targeted by the ribozyme. Directed mutagenesis of mPAH was

achieved using synthetic DNA oligonucleotides as PCR primers (Table 2-3). The 5'

primer contained the desired base changes, which were silent mutations (Figure 5-7). A

322 base pair PCR product was gel purified and ligated into pGEM-T (Promega). After

bacterial transformations into XL 1-Blue MRF' cells (Stratagene) and sequencing of the

obtained clones, the fragment was cut from pGEM-T, moved to pGEM-T-mPAH

plasmid. The resistant mPAH gene was named mPAH-Hd. The new cDNA was cloned

into the CB backbone and CB-WPRE backbone. Bacterial transformations into Sure cells

was followed by sequencing of clones obtained. Large DNA preparations were performed

with Qiagen's Plasmid Giga Kit.

Ribozyme 1209 Is Active In Vivo

The mouse PAH and the ribozyme constructs utilize the CMV immediate early

enhancer, the chicken-p-actin promoter (with the first intron) and the rabbit P3-globin

exon as the splice site acceptor. HEK-293 cells were transiently transfected with the

purified vector DNA constructs using calcium phosphate. The promoter strengths being









equal, the plasmids are thus transfected in relative amounts using micrograms of DNA as

a measure. This can be translated into molar ratios since the plasmids are less than one

hundred eighty base pair different in size. Various combinations of the vectors were used

while keeping the total DNA amount in each assay constant. After 48-72 hours

approximately 3 X 106 cells were harvested, homogenized and a clear extract was

obtained by centrifugation. The extracts are used immediately in the spectrophotometric

PAH activity assay and a Lowry protein concentration assay.

Ribozyme 1209 was first checked for expression in HEK 293 cells. Ten micrograms

of CB-RzI209 was transfected into the cells and harvested with TRIzol for RNA

extraction. Using the 5' sequencing primer for p21-newhp at position 1856 and the

antisense oligonucleotide of RzI209, a reverse transcription reaction was performed

followed by PCR amplification with Promega's AccessQuickTM RT-PCR kit. The

ribozyme was easily detected in the sample (Figure 5-8), thus it is expressed and

relatively stable in the cells. The samples were electrophoresed on a 2% agarose 1 X TAE

gel, and the ribozyme product, while clearly visible, was not well separated from primer

to primer amplification products so subsequent RT-PCR reaction samples were thus

electrophorsed on 15% polyacrylamide 1X TBE gels.

The ribozyme was then tested for its ability to cleave mPAH and reduce the total

potential activity in the transfections. Combinations of CB-mPAH and CB-RzI209 were

transfected into cells and assayed for activity as compared to a no ribozyme transfection

(normalized for the maximum amount of DNA transfected in the experimental set with

p21-newhp). Ratios of 1 to 4, 1 to 5 and 1 to 10 were tested. Phenylalanine hydroxylase

activity was reduced to 70% at 1:4, 40% at 1:5 and 20% at 1:10 (Figure 5-9). These ratios




Full Text

PAGE 1

G E N E T H E R A P Y F O R P H E N Y L K E T O N U R I A : D O M I N A N T N E G A T I V E I N T E R F E R E N C E I N A R E C E S S I V E D I S E A S E B y C A T H E R I N E E L I S A B E T H C H A R R O N A D I S S E R T A T I O N P R E S E N T E D T O T H E G R A D U A T E S C H O O L O F T H E U N I V E R S I T Y O F F L O R I D A I N P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y U N I V E R S I T Y O F F L O R I D A 2005

PAGE 2

C opyr i ght 2005 by C a t he r i ne E l i s a be t h C ha r r on

PAGE 3

I de di c a t e t hi s w or k t o m y pa r e nt s I f not f or t he i r s a c r i f i c e I w oul d not be he r e t oda y w r i t i ng a nd w o r ki ng i n a l a ngua ge t ha t I di d not l e a r n f r om bi r t h. T he y ga ve m e t he oppor t uni t y t o l e a d m y l i f e w i t h e ndl e s s pos s i bi l i t i e s i n s i ght a nd s e e t he w or l d a s a n ope n r oa d t o e xpl o r e

PAGE 4

i v A C K N O W L E D G M E N T S T he pa s t f our ye a r s w oul d no t ha ve be e n s o s uc c e s s f ul w i t hout t he he l p a nd s uppor t of m a ny. F i r s t I w oul d l i ke t o t ha nk a l l of m y c om m i t t e e m e m be r s D r s B yr ne L a i pi s L e w i n a nd P e t e r s e n, f or t he i r c ont i nue d s uppor t p os i t i ve a t t i t ude a nd br oa d know l e dge of s c i e nc e O ur m e e t i ngs w e r e a l w a ys a s our c e of i ns pi r a t i on t o w or k ha r de r a nd i nc r e a s e m y ge ne r a l know l e dge i n s c i e nc e s I e s pe c i a l l y t ha nk m y m e nt o r D r P hi l i p L a i pi s f o r hi s s uppor t f r i e nds hi p, a nd t r us t : w i t hout i t I w oul d not ha ve ha d t he c our a ge a nd t he pa t i e nc e t o pe r s e ve r e dur i ng r ough t i m e s I t ha nk h i m f or hi s c ont i nue d be l i e f i n m y a bi l i t i e s a l l ow i ng m e t o g r ow a s a s c i e nt i s t a nd a s a pe r s on. M a ny pe opl e ha ve c om e t hr ough ou r l a bo r a t or y i n t he pa s t f our ye a r s a nd I a m gr a t e f ul t o a l l f or t he i r f r i e nds hi p a nd he l p N e ni t a C or t e z H e a t he r S t e e l e a nd W e n T a o D e ng de s e r ve m a ny t ha nks f or he l pi ng m e be gi n m y w or k i n t he l a bo r a t or y a nd t e a c hi ng m e t he s ki l l s t ha t w e r e i ndi s pe ns a bl e t o t hi s pr oj e c t I t ha nk J on M i c ha e l K na pp a nd K e n R os s f or t he i r f r i e nds hi p a s I be ga n m y w or k i n t he l a b. A nd r e a s Z or i a nd D a w n Y oung I t ha nk f or t he i r e a ge r ne s s t o l e a r n a nd t he i r pa t i e nc e w i t h m e a s I s t r i ve t o be c om e a be t t e r t e a c he r e ve r yda y. I gi ve s pe c i a l t ha nks t o D r J e nni f e r E m bur y, w i t hout w hos e e xpe r t know l e dge a nd c ount l e s s hour s s pe nt a na l yz i ng our m i c e t hi s pr oj e c t w oul d not ha ve be e n c om pl e t e H e r pe r s e ve r a nc e a nd ge ne r os i t y a r e a n i ns pi r a t i on a nd a n e xa m pl e t ha t I w i l l e nde a vor t o f ol l ow t hr oughout m y c a r e e r I a m ve r y g r a t e f ul t o M a n dy B l a c kbur n a nd B r i a n O D onne l l f or t he i r e s s e nt i a l t e c hni c a l a s s i s t a n c e i n t he l a b. I a m de e pl y

PAGE 5

v i nde bt e d t o S t a c y P or va s ni k f o r he r he l p w i t h s ur g e r i e s H e r s ki l l s a nd ge ne r os i t y a l l ow e d f or m uc h s a ve d t i m e g i vi ng m e t he oppor t uni t y t o f i ni s h t hi s pr oj e c t i n s o f e w ye a r s I w oul d l i ke t o gi ve s pe c i a l t ha nks t o D r O m a t ht h a ge P P e r e r a H e i s a g r e a t e xa m pl e a s a s c i e nt i s t pa r e nt a nd pe r s on, a nd I a m de e pl y gr a t e f ul t o ha ve m e t hi m a nd l e a r ne d s o m uc h f r om hi m dur i ng hi s s hor t t i m e i n t he l a b. A ppr e c i a t i on i s e xt e nde d t o t he P a t hol ogy A ni m a l C a r e F a c i l i t y a nd t o t he V e c or C or e f or t he s uppor t t he y pr ovi de I a l s o a c know l e dge t he s t a f f i n bot h t he G e ne t i c s a nd B i oc he m i s t r y D e pa r t m e nt s a nd i n t he I n t e r di s c i pl i na r y P r oga m s m a i n of f i c e I w oul d l i ke t o t ha nk m y f a m i l y f or t he i r l ove a nd s uppor t dur i ng a l l t hi s t i m e I w oul d not be he r e t oda y i f not f o r t he i r c ont i nui ng e nc our a ge m e nt F i na l l y I w oul d l i ke t o t ha nk m y hus ba nd S e a n L e w i s f or h i s l ove a nd pa t i e nc e I c oul d not i m a gi ne doi ng t hi s w i t hout hi m ; he i s m y s t r e ngt h, m y l ove a nd m y be s t f r i e nd.

PAGE 6

vi T A B L E O F C O N T E N T S pa ge A C K N O W L E D G M E N T S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . i v L I S T O F T A B L E S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . i x L I S T O F F I G U R E S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . x A B S T R A C T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi i C H A P T E R 1 I N T R O D U C T I O N . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 P he nyl ke t onur i a . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 H i s t or y . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 C l i ni c a l F e a t ur e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 C l a s s i c phe not ype . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 P he not ype of e a r l y t r e a t e d pa t i e nt s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 M a t e r na l phe nyl ke t onur i a s yndr om e . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 G e ne t i c s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 T he P he nyl a l a ni ne M e t a bol i c P a t hw a y . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 A ni m a l M ode l s f or P K U . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 A l t e r na t i ve T he r a p i e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 G e ne T he r a py V e c t or s B a s e d on A de no A s s oc i a t e d V i r us . . . . . . . . . . . . . . . . . . . 16 A de no A s s oc i a t e d V i r us B i ol ogy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 C ur r e nt T r e nds a nd A ppl i c a t i ons of r A A V . . . . . . . . . . . . . . . . . . . . . . . . . . . 18 R N A a nd D N A a s T he r a pe ut i c A ge nt s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 R N A I nt e r f e r e nc e . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20 R i boz ym e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21 2 M A T E R I A L S A N D M E T H O D S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27 I n V i t r o R i boz ym e A na l ys i s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27 D e pr ot e c t i on of R N A O l i gos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27 T a r ge t E nd L a be l l i ng . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 T i m e C our s e of C l e a va ge R e a c t i ons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 I n V i t r o T r a ns c r i pt i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29 F ul l L e ngt h T r a ns c r i pt C l e a va ge R e a c t i on . . . . . . . . . . . . . . . . . . . . . . . . . . . 30 M ul t i pl e T ur nove r K i ne t i c A na l ys i s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30

PAGE 7

vi i M ol e c ul a r C l oni ng P r ot oc ol s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32 C l oni ng of R i boz ym e V e c t or s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32 C ons t r uc t i on of C B m P A H F 263 S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33 C ons t r uc t i on of C B m P A H H d . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33 C ons t r uc t i on of t R N A R z I 209 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36 C e l l C ul t ur e P r ot oc ol s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38 T r a ns i e nt C e l l T r a ns f e c t i on w i t h C a P O 4 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38 T r a ns i e nt T r a ns f e c t i ons us i ng S upe r f e c t . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39 P he nyl a l a ni ne H ydr oxyl a s e A c t i vi t y A s s a y . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39 P r ot e i n C onc e nt r a t i on A s s a y . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40 W e s t e r n B l ot t i ng . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40 N or t he r n B l ot t i ng . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41 R e c om bi na nt A de no A s s oc i a t e d V i r us P a c ka gi ng . . . . . . . . . . . . . . . . . . . . . . . . . 41 A ni m a l P r oc e dur e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42 G r ow t h R a t e A na l ys i s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42 B l ood C ol l e c t i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42 M i c r opl a t e S e r um P he nyl a l a ni ne A s s a y . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43 F ood C ons um pt i on M e a s ur e m e nt . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44 P or t a l V e i n I nj e c t i ons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44 P he nyl a l a ni ne L oa di ng . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45 S a c r i f i c e a nd T i s s ue C ol l e c t i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45 R N a s e P r ot e c t i on A s s a ys . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46 S out he r n B l ot t i ng . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47 R N A I nt e r f e r e nc e P r ot oc ol s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48 G e ne r a t i on of s i R N A C a s s e t t e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48 R e ve r s e T r a ns c r i pt a s e R e a c t i on a nd P ol ym e r a s e C ha i n R e a c t i on . . . . . . . . . . 48 3 A N I M A L M O D E L A N A L Y S I S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50 G e ne r a l S e x D i m or phi s m i n B T B R P ah e n u 2 M i c e . . . . . . . . . . . . . . . . . . . . . . . . . . 50 G r ow t h C ur ve A na l ys i s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50 S e r um P he nyl a l a ni ne L e ve l s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53 F ood C ons um pt i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54 L i f e s pa n A na l ys i s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55 P he nyl a l a ni ne H ydr oxyl a s e i n B T B R P ah e n u 2 M i c e . . . . . . . . . . . . . . . . . . . . . . . . 56 L i ve r P A H . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 M e s s a ge l e ve l s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 P r ot e i n l e ve l s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57 A c t i vi t y l e ve l s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57 K i dne y P A H . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59 D i s c us s i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59 4 D O M I N A N T N E G A T I V E I N T E R F E R E N C E I N P H E N Y L K E T O N U R I A . . . . . . 68 G e ne T he r a py f o r P he nyl ke t onu r i a : D i ve r ge nt R e s ul t s by S e x i n B T B R P ah e n u 2 . . 69 L i ve r P A H : E vi de nc e of D om i na nt N e ga t i ve I nt e r f e r e nc e . . . . . . . . . . . . . . . . . . 70 I n v i t r o C e l l T r a ns f e c t i on S t udi e s w i t h N or m a l a nd M ut a nt P A H . . . . . . . . . . . . . . 71

PAGE 8

vi i i D i s c us s i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74 5 D E S I G N I N G A H A M M E R H E A D R I B O Z Y M E A G A I N S T P H E N Y L A L A N I N E H Y D R O X Y L A S E . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83 H a m m e r he a d R i boz ym e D e s i gn f or m P A H . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83 I n V i t r o R i boz ym e T e s t s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83 C l oni ng R z I 209 i nt o p21 nhp a nd D e s i gni ng a R i b oz ym e R e s i s t a nt m P A H . . . . . . 85 R i boz ym e I 209 I s A c t i ve I n V i v o . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86 R i boz ym e I 209 C a n O ve r c om e D om i na nt N e ga t i ve I nt e r f e r e nc e . . . . . . . . . . . . . . 88 D i s c us s i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89 6 G E N E T H E R A P Y F O R P H E N Y L K E T O N U R I A . . . . . . . . . . . . . . . . . . . . . . . . 103 D os e R e s pon s e i n B T B R P ah e n u 2 M a l e s t o r A A V 2 C B m P A H H d W P R E . . . . . 103 C om bi ni n g a n I ne f f e c t i ve D os e of r A A V 2 C B m P A H H d W P R E w i t h I nc r e a s i ng r A A V 2 C B R z I 209 ( S a l I ) D os e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109 G e ne T he r a py w i t h a M i l dl y E f f e c t i ve D os e of r A A V 2 C B m P A H H d W P R E a nd I nc r e a s i ng A m ount s of r A A V 2 C B R z I 209 ( S a l I ) . . . . . . . . . . . . . . . . . . 110 D i s c us s i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111 7 D E V E L O P M E N T O F A S I N G L E V E C T O R C A R R Y I N G T H E M O U S E P A H G E N E A N D R I B O Z Y M E I 209 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123 D e s i gn a nd C l oni ng of a D ua l r A A V V e c t or . . . . . . . . . . . . . . . . . . . . . . . . . . . . 124 C e l l T r a ns f e c t i on E xpe r i m e nt s w i t h C B m P A H H d t R N A R z I 209 . . . . . . . . . . . 125 I n V i v o E xpe r i m e nt s w i t h C B m P A H H d t R N A R z I 209 . . . . . . . . . . . . . . . . . . . 126 D i s c us s i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127 8 D E V E L O P M E N T O F S H O R T I N T E R F E R I N G R N A S F O R M U R I N E P A H . . . 134 S hor t I nt e r f e r i ng R N A S i t e S e l e c t i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134 s i R N A C e l l C ul t ur e T e s t s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135 D i s c us s i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 9 S U M M A R Y C O N C L U S I O N A N D F U T U R E D I R E C T I O N S . . . . . . . . . . . . . . 141 G e ne r a l S i gni f i c a nc e . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141 S um m a r y a nd C onc l us i on . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141 F ut ur e D i r e c t i ons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143 D ua l G e ne R e pl a c e m e nt a nd A nt i s e ns e T e c hnol o gy A ppr oa c he s f or t he T r e a t m e nt of G e ne t i c D i s e a s e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 145 G L O S S A R Y . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 148 L I S T O F R E F E R E N C E S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 151 B I O G R A P H I C A L S K E T C H . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165

PAGE 9

i x L I S T O F T A B L E S T a bl e pa ge 2 1 M ul t i pl e t ur nove r k i ne t i c a na l ys i s r e a c t i on s e t up. . . . . . . . . . . . . . . . . . . . . . . . . 31 2 2 P C R m ut a ge ne s i s pr i m e r s f or m P A H F 263S c ons t r uc t i on. . . . . . . . . . . . . . . . . . 34 2 3 P C R m ut a ge ne s i s pr i m e r s f or m P A H H d c ons t r uc t i on. . . . . . . . . . . . . . . . . . . . . 35 2 4 O l i gos f or t R N A R z I 209 c ons t r uc t i on. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37 3 1 U npa i r e d t t e s t a na l ys i s of l i t t e r w e i ght s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52 3 2 R e s ul t s of A N O V A a na l ys i s of a dul t w e i ght s . . . . . . . . . . . . . . . . . . . . . . . . . . . 53 3 3 S e r um phe nyl a l a ni ne va l ue s i n B T B R P ah e n u 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . 54 3 4 L i f e s pa n a na l ys i s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 3 5 P A H a c t i vi t y i n l i ve r s a m pl e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58 5 1 R i boz ym e I 209 ki ne t i c p r ope r t i e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85 6 1 r A A V 2 C B m P A H H d W P R E ve c t or t i t e r s . . . . . . . . . . . . . . . . . . . . . . . . . . . 104 6 2 S e r um phe nyl a l a ni ne l e ve l s f o r t i m e d bl e e ds i n m a l e P ah e n u 2 m i c e . . . . . . . . . . 106 8 1 S hor t i nt e r f e r i ng R N A s f or m ous e P A H . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 136

PAGE 10

x L I S T O F F I G U R E S F i gur e pa ge 1 1 P he nyl a l a ni ne c onve r s i on t o t y r os i ne . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25 1 2 H a m m e r he a d r i boz ym e s t r uc t ur e . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26 3 1 B T B R P ah e n u 2 m ous e m ode l . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61 3 2 B T B R m i c e gr ow t h c ur ve s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62 3 3 M a l e a nd f e m a l e w e i ght di f f e r e nc e s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 3 4 A ve r a ge da i l y f ood c ons um pt i on. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64 3 5 N or t he r n bl ot of m ous e P A H . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65 3 6 W e s t e r n bl ot of m ous e P A H . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66 3 7 K i dne y P A H a m ount s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67 4 1 r A A V ve c t or m a ps . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76 4 2 S e r um phe nyl a l a ni ne l e ve l s a f t e r ge ne t he r a py w i r h r A A V 2. . . . . . . . . . . . . . . . . 77 4 3 P A H a m ount s i n m ous e l i ve r . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78 4 4 C l oni ng s t r a t e gy f or c ons t r uc t i on o f C B m P A H F 2 63S . . . . . . . . . . . . . . . . . . . . 79 4 5 T e s t t r a ns f e c t i ons w i t h C B m P A H a nd C B m P A H F 263S . . . . . . . . . . . . . . . . . 80 4 6 M i xe d t r a ns i e nt t r a ns f e c t i on r e s ul t s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 4 7 W e s t e r n bl ot of na t i ve P A G E w i t h m i xe d t r a ns f e c t i on s a m pl e s . . . . . . . . . . . . . . 82 5 1 M ous e P A H r i boz ym e de s i gns . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91 5 2 T i m e C our s e a na l ys e s w i t h r i boz ym e s a t 20m M M gC l 2 . . . . . . . . . . . . . . . . . . . . 92 5 3 T i m e C our s e a na l ys i s of r i boz ym e I 209 a t 5 m M M gC l 2 . . . . . . . . . . . . . . . . . . . . 93 5 4 R i boz ym e I 209 ki ne t i c a na l ys i s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94

PAGE 11

xi 5 5 L ong t a r ge t c l e a va ge a na l ys i s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 5 6 C B R z I 209. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96 5 7 C l oni ng s t r a t e gy f or t he c ons t r uc t i on of a r i boz ym e r e s i s t a nt m P A H c l one . . . . . 97 5 8 C B R z I 209 s t a bl y e xpr e s s e s R z I 209 i n 293 c e l l s . . . . . . . . . . . . . . . . . . . . . . . . . 98 5 9 C B m P A H H d i s r e s i s t a nt t o t he r i boz ym e . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 5 10 R i boz ym e I 209 s uc c e s s f ul l y pr e ve nt s dom i na nt ne ga t i ve i nt e r f e r e nc e i n 293 c e l l s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100 5 11 N ul l r i boz ym e de s i gns . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101 5 12 T he nul l r i boz ym e s do not pr e ve nt dom i na nt ne ga t i ve i nt e r f e r e nc e . . . . . . . . . . 102 6 1 D os e r e s pons e t o r A A V 2 C B m P A H H d W P R E . . . . . . . . . . . . . . . . . . . . . . . 114 6 2 P h e nyl a l a ni ne l oa di ng e xpe r i m e nt . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115 6 3 R N a s e pr ot e c t i on a s s a y w i t h dos e r e s pons e a ni m a l s . . . . . . . . . . . . . . . . . . . . . 116 6 4 S out he r n bl ot of dos e r e s pons e a ni m a l s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117 6 5 P he nyl a l a ni ne hydr o xyl a s e a c t i vi t y i n ge ne t he r a py t r e a t e d a ni m a l s . . . . . . . . . 118 6 6 S e r um phe nyl a l a ni ne l e ve l s a f t e r dua l ve c t or i nj e c t i ons . . . . . . . . . . . . . . . . . . . 119 6 7 R N a s e pr ot e c t i on a s s a y f or c o i nj e c t e d a ni m a l s . . . . . . . . . . . . . . . . . . . . . . . . . 120 6 8 S out he r n bl ot de t e c t i on of t w o r A A V ve c t or s . . . . . . . . . . . . . . . . . . . . . . . . . . 121 6 9 S e r um phe nyl a l a ni ne l e ve l s a f t e r c o i nj e c t i on of m i l dl y e f f e c t i ve C B m P A H H d W P R E dos e a nd i nc r e a s i ng a m ount s o f C B R z I 209 ( S a l I ) . . . . . . . . . . . . . 122 7 1 t R N A R z I 209 de s i gn. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129 7 2 C l oni ng s t r a t e gy f or c ons t r uc t i on o f t R N A R z I 209 c a s s e t t e . . . . . . . . . . . . . . . . 130 7 3 R e s ul t s of t r a ns i e nt c e l l t r a ns f e c t i ons w i t h C B m P A H H d t R N A R z I 209. . . . . . 131 7 4 t R N A R z I 209 a c t i vi t y a nd e xpr e s s i on i n H E K 293 c e l l s . . . . . . . . . . . . . . . . . . 132 7 5 I n v i v o r e s ul t s w i t h C B m P A H H d t R N A R z I 209. . . . . . . . . . . . . . . . . . . . . . . 1 33 8 1 C e l l c ul t ur e s i R N A w or ki ng c onc e nt r a t i on de t e r m i na t i on. . . . . . . . . . . . . . . . . . 139 8 2 M ous e P A H s i R N A t e s t r e s ul t s . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140

PAGE 12

xi i A bs t r a c t of D i s s e r t a t i on P r e s e nt e d t o t he G r a dua t e S c hool of t he U ni ve r s i t y of F l or i da i n P a r t i a l F u l f i l l m e nt o f t he R e qui r e m e nt s f or t he D e g r e e of D oc t o r of P hi l os o phy G E N E T H E R A P Y F O R P H E N Y L K E T O N U R I A : D O M I N A N T N E G A T I V E I N T E R F E R E N C E I N A R E C E S S I V E D I S E A S E B y C a t he r i ne E l i s a be t h C ha r r on A ugus t 2005 C ha i r : P hi l i p J L a i pi s M a j or D e pa r t m e nt : B i oc he m i s t r y a nd M ol e c ul a r B i ol ogy P he nyl ke t onur i a ( P K U ) i s a n a ut os om a l r e c e s s i ve di s e a s e w he r e phe nyl a l a ni ne a c c um ul a t e s i n t he bl ood; hi gh br a i n l e ve l s of phe n yl a l a ni ne of t e n l e a d t o m e nt a l r e t a r da t i on. T he e nz ym e phe nyl a l a ni ne hyd r oxyl a s e ( P A H ) w hi c h c onve r t s phe nyl a l a ni ne t o t yr os i ne i s t he m ut a t e d ge ne f o r ove r 97% of pa t i e nt s D i e t a r y r e s t r i c t i on of phe nyl a l a ni ne i s t he onl y f o r m o f t he r a py f or P K U a nd i s r e c om m e nde d f or l i f e U n f or t una t e l y pa t i e nt s o f t e n go of f di e t du r i ng a dol e s c e nc e a nd t hi s ha s l e d t o a r i s e i n m a t e r na l P K U s yndr om e t he i nc r e a s e d i nc i de nc e of bi r t h de f e c t s i n c hi l dr e n bo r n t o phe nyl ke t onur i c w om e n. G e ne t he r a py f o r phe n yl k e t onur i a w oul d c ur e t he hype r phe nyl a l a ni ne m i a ( H P A ) a nd he l p p r e ve nt m a t e r na l P K U s yndr om e U s i ng r e c om bi na nt a de no a s s oc i a t e d vi r us s e r ot ype 2 ( r A A V 2) w e ha ve s uc c e s s f ul l y de l i ve r e d t he m ous e P A H ge ne t o m a l e m i c e a nd c ur e d t he H P A W hi l e s uc c e s s f ul t he dos e s ne e de d i n t he P ah e n u 2 m ous e m ode l a r e 5 t o 10 t i m e s hi ghe r t ha n t hos e us e d t o c ur e he m ophi l i a A i n a m ous e m ode l T he P ah e n u 2 m ous e m ode l ha s a

PAGE 13

xi i i m i s s e ns e m ut a t i on i n P A H r e nde r i ng t he e nz ym e i na c t i ve a nd w e f ound t ha t P A H i s pr e s e nt i n t he l i ve r a t 30 pe r c e nt o f no r m a l l e ve l s S i nc e t he e nz ym e i s a ho m ot e t r a m e r dom i na nt ne ga t i ve i nt e r f e r e nc e a f t e r ge ne t he r a py c oul d e xpl a i n t he ne e d f or hi gh r A A V dos e s t o c ur e H P A U s i ng t r a ns i e nt t r a ns f e c t i ons w e c onf i r m e d t ha t m ut a nt a nd nor m a l m onom e r i nt e r a c t t oge t he r a nd r e duc e t ot a l P A H a c t i vi t y. T o pr e ve nt t he dom i na nt ne ga t i ve i nt e r f e r e nc e w e de ve l ope d a r i boz ym e t ha t c l e a ve s t he e ndoge nous P A H m e s s a ge W he n bot h r i boz ym e a nd r e s i s t a nt P A H ge ne w e r e de l i ve r e d i n s e pa r a t e r A A V ve c t or s no i m p r ove m e nt i n t he e f f e c t i ve ne s s of t he t he r a py w a s obs e r ve d. E ndoge nous P A H m e s s a ge w a s r e duc e d i n l i ve r s a m pl e s c onf i r m i ng r i boz ym e a c t i vi t y i n v i v o A s i ngl e ve c t or w a s c ons t r uc t e d t o c ont a i n t he r e s i s t a nt P A H ge ne a nd t he r i boz ym e e xpr e s s e d by a m odi f i e d t R N A V a l pr om ot e r T he nove l ve c t or w a s de l i ve r e d t o m a l e P ah e n u 2 m i c e a nd nor m a l i z a t i on o f s e r um phe nyl a l a ni ne l e ve l s w a s a c hi e ve d w i t h f our f ol d l ow e r dos e s t ha n w i t h t he o r i gi na l C B m P A H ve c t or c onf i r m i ng t he do m i na nt ne ga t i ve i nt e r f e r e nc e hypot he s i s T hi s obs e r va t i on of dom i na nt ne ga t i ve i nt e r f e r e nc e t o g e ne t he r a py i n a c l a s s i c r e c e s s i ve di s or de r m a y pr ove qui t e c om m on i n m a ny hum a n ge ne t i c di s e a s e s

PAGE 14

1 C H A P T E R 1 I N T R O D U C T I O N P h e n yl k e t on u r i a P he nyl ke t onur i a ( P K U ) i s one of t he m os t c om m o nl y i nhe r i t e d hu m a n ge ne t i c di s e a s e s w i t h a n i nc i de nc e i n t he U ni t e d S t a t e s ( U S ) a r ound 1 i n 15, 000 bi r t hs T he ge ne a f f e c t e d i n t he m a j or i t y ( 97% ) o f pa t i e nt s i s phe nyl a l a ni ne hydr oxyl a s e ( P A H ) a nd t he di s e a s e i s i nhe r i t e d a s a n a ut os om a l r e c e s s i ve di s or de r A c c um ul a t i on o f phe nyl a l a ni ne ( P he ) i n t he bl ood b r a i n a nd ot he r o r ga ns i s t he c a us e of t he di s e a s e c l a s s i c a l l y c ha r a c t e r i z e d by s e ve r e m e nt a l r e t a r da t i on S i nc e t h e 1960s s e ve r e ( > 1m M ) o r m i l de r ( 0. 36 1m M ) hype r phe nyl a l a ni ne m i a ( H P A ) ha ve b e e n de t e c t e d i n t he ne ona t a l pe r i od, a nd t r e a t e d by t he di e t a r y r e s t r i c t i on o f phe nyl a l a ni ne I f bl ood P he l e ve l s a r e ke pt w i t hi n a nont oxi c r a nge t h r oughout c hi l dh ood, br a i n a nd c ogni t i ve de ve l opm e nt a r e ne a r nor m a l U nf or t una t e l y, t he di e t i s bot h e xpe ns i ve a nd unpl e a s a nt a nd i s now r e c om m e nde d f or l i f e by phys i c i a ns T hi s c ha pt e r p r e s e nt s a s um m a r y of t he c ur r e nt know l e dge on phe nyl ke t onur i a i nc l udi ng a di s c us s i on of t he i s s ue s a s s oc i a t e d w i t h m a t e r na l phe nyl ke t onur i a s yndr om e H i s t or y T he c l a s s i c phe nyl ke t onur i a phe not ype or i g i na l l y de s c r i be d by F ol l i ng i n 1934 i s c ha r a c t e r i z e d by s e ve r e m e nt a l r e t a r da t i on m i c r oc e pha l y, de l a ye d s pe e c h, s e i z ur e s e c z e m a a nd be ha vi or a bnor m a l i t i e s 1 W he n F ol l i n g di s c ove r e d t ha t t w o of hi s pa t i e nt s pr e s e nt i ng w i t h t he s a m e s ym pt om s w e r e r e l a t e d, he qui c kl y r e a l i z e d t ha t t hi s f o r m o f m e nt a l r e t a r da t i on w a s i nhe r i t e d i n a r e c e s s i ve pa t t e r n. A f t e r c he m i c a l a na l ys i s he

PAGE 15

2 de t e r m i ne d t ha t t he pa t i e nt s e xc r e t e d phe nyl pyr uvi c a c i d i n t he i r ur i ne : he ha d di s c ove r e d a ne w i nbor n e r r or of m e t a bol i s m t he f i r s t m e nt a l r e t a r da t i on t o ha ve a r e c ogni z e d c he m i c a l f e a t ur e 2 I n 1937 t he d i s e a s e w a s r e na m e d phe nyl ke t onur i a t o e m pha s i z e t hi s bi oc he m i c a l f e a t ur e 2 P e nr os e i n t he U ni t e d K i ngdom ( U K ) a nd J e r vi s i n t he U S s t udi e d t he know n pa t i e nt s e xt e ns i ve l y be c a us e of t he i nt e r e s t ge ne r a t e d by t hi s ne w i nbo r n e r r or of m e t a bol i s m a nd i t s e f f e c t on i nt e l l i ge nc e T he y ve r y qui c kl y obs e r ve d va r yi ng de gr e e s of s e ve r i t y i n t e r m s o f t he qua nt i t a t i ve t r a i t a nd de s c r i be d pa t i e nt s ( us i ng t he c om m on t e r m s a t t he t i m e ) a s i m be c i l e s i di ot s or s i m pl e m or ons S i nc e s e x c hr om os om e l i nka ge w a s f o und t o be ne ga t i ve t he di s e a s e w a s know n t o be a ut os om a l a nd s us pe c t e d of ha vi ng unde t e r m i ne d phe not ype i nf l ue nc i ng f a c t or s e i t he r e nvi r onm e nt a l o r ge ne t i c T he y r e por t e d a hi ghe r num be r of c a s e s i n w hi t e popul a t i ons a nd c a l c ul a t e d t he c a r r i e r f r e que nc y t o be a ppr oxi m a t e l y 1 i n 100 f o r bot h t h e U S a nd t he U K P e nr os e us e d P K U a s a m e di c a l e xa m pl e t o c ha l l e nge e uge ni c s s i nc e f or e l i m i na t i ng P K U f r om t he popul a t i on e uge ni c pr opone nt s w oul d ha ve t o s t e r i l i z e one pe r c e nt of t he popul a t i on : O nl y a l una t i c w ou l d a dvoc a t e s uc h a pr oc e dur e t o pr e ve nt t he oc c ur r e nc e of a ha ndf ul of ha r m l e s s i m be c i l e s 2 : 1 9 8 H e a l s o t he o r i z e d on how a l t e r i ng body m e t a bol i s m c oul d i nf l ue nc e t he ps yc hi a t r i c m a ni f e s t a t i on o f t he di s e a s e a c c ur a t e l y pr e di c t i ng t he f ut u r e s uc c e s s of t r e a t i ng P K U by di e t a r y t he r a py H ype r phe nyl a l a ni ne m i a ( H P A ) w a s f oun d t o be t h e c a us e of t he di s e a s e by J e r vi s i n 1947, a nd t he de f e c t i ve e nz ym e w a s de t e r m i ne d t o be l i ve r P A H i n 1953 by U de nf r i e nd a nd C oope r 3 I n t he s a m e ye a r B i c ke l de m ons t r a t e d t he pos s i bi l i t y of i m pr ovi ng t he m e nt a l r e t a r da t i on by us i ng a P he r e s t r i c t e d di e t T he ne e d t o i de nt i f y P K U

PAGE 16

3 pa t i e nt s e a r l y be c a m e obvi ous : a t t he t i m e i t i s e s t i m a t e d t ha t one pe r c e nt of t he popul a t i on i n m e nt a l i ns t i t ut i ons ha d P K U I n 195 7 t he f e r r i c c hl or i de di a pe r t e s t w a s t e s t e d i n s om e C a l i f or ni a w e l l ba by c l i ni c s bu t t he t e s t pr ove d t o be un r e l i a bl e dur i ng t he f i r s t m ont h of l i f e F our ye a r s l a t e r a r e l i a bl e a s s a y w a s de ve l ope d t o s c r e e n bl ood s pot s f r om ne w bor ns f or hype r phe nyl a l a ni n e m i a 4 T hi s m a de ne ona t a l s c r e e ni ng pos s i bl e a nd a l l ow e d f or t he P he r e s t r i c t e d di e t t o be s t a r t e d be f or e one m ont h of l i f e D ur i ng t he ne xt t w o de c a de s ne ona t a l s c r e e ni ng w a s i ns t i t ut e d t hr o ughout t he W e s t e r n W or l d a nd t hous a nds of P K U pa t i e nt s ha ve be e n pl a c e d on di e t s s hor t l y a f t e r bi r t h a nd gi ve n t he oppor t uni t y t o de ve l op nor m a l l y. C l i n i c al F e at u r e s C l as s i c p h e n ot yp e A l t hough m e nt a l r e t a r da t i on i s t he m a i n f e a t ur e of t he unt r e a t e d pa t i e nt t he m e c ha ni s m by w hi c h phe nyl a l a ni ne c a us e s t he di s e a s e i s s t i l l not know n. R e c e nt s t udi e s di s pl a y t he pot e nt i a l r i s ks a s s oc i a t e d w i t h hi gh P he c onc e nt r a t i on i n c e r e br os pi na l f l ui d ( C S F ) P a t c h c l a m p e xpe r i m e nt s s how t ha t by c om pe t i ng f or bi ndi ng s i t e s on N M D A a nd non N M D A r e c e pt or s P he de p r e s s e s gl ut a m a t e r e c e pt or f unc t i on i n hi ppoc a m pa l a nd c e r e br oc or t i c a l c ul t ur e d ne u r ons 5 T he gl u t a m a t e r e c e pt or i s a s s oc i a t e d w i t h f or m a t i on of s yna ps e s dur i ng e a r l y de ve l opm e nt a nd i n de ndr i t i c s pi ne c ha nge s i n a dul t t i s s ue a nd t hus i t i s i nvol ve d i n m e m o r y pe r f or m a nc e a nd l e a r ni ng. I n v i v o t he gl ut a m a t e r e c e pt or i s not s a t ur a t e d by i t s s ubs t r a t e a nd t hus c oul d e f f e c t i ve l y be i nhi bi t e d by hi ghe r C S F P he l e ve l s m os t l i ke l y l e a di ng t o m e m o r y a nd l e a r ni ng dys f unc t i ons T he B T B R P ah e n u 2 m ous e m ode l br a i n ( s e e l a t e r s e c t i on) s how s a n up r e gul a t i on o f t he de ns i t y of N M D A r e c e pt or s a s de t e r m i ne d by r a di oa c t i ve l i ga nd bi nd i ng a nd w e s t e r n bl ot t i ng f o r s pe c i f i c s ubuni t s of N M D A r e c e pt or s 6 A M P A r e c e pt or s u buni t s ( a non N M D A gl ut a m a t e

PAGE 17

4 r e c e pt or ) a r e a l s o f ound t o be e l e va t e d a s c om pa r e d t o t he he t e r oz ygot e f o r e br a i n s a m pl e s A s t udy m e a s ur i ng N a + K + A T P a s e a c t i vi t y i n e r y t hr oc yt e m e m br a ne s f r o m t r e a t e d P K U pa t i e nt s ha s s how n t ha t t he r e i s a ne ga t i ve c o r r e l a t i on be t w e e n A T P a s e a c t i vi t y a nd t he s e r um P he c onc e nt r a t i on i n t he pa t i e nt s 7 T he p a t i e nt s w ho ha d s e r um P he l e ve l s a bove 0. 30m M ha d de c r e a s e d N a + K + A T P a s e a c t i vi t y; t hi s c or r e l a t e s w i t h t he obs e r va t i on t ha t A T P a s e a c t i vi t y i s r e duc e d i n t he c or t e x of r a t s s ubj e c t e d t o e xpe r i m e nt a l P K U T he s a m e i s oz ym e of t he A T P a s e i s pr e s e nt i n t he br a i n a nd l os s of i t s a c t i vi t y oc c ur s i n ne ur ode ge ne r a t i ve di s or de r s D i r e c t i nh i bi t i on of t he N a + K + A T P a s e i s a s s oc i a t e d w i t h gl ut a m a t e r e l e a s e H ow e ve r i t i s u nknow n a t t hi s poi nt i f t he de c r e a s e d a c t i vi t y i n e r yt h r oc yt e s i s s i m i l a r i n t he b r a i n, a nd i f t hi s i s s om e how r e l a t e d t o t he i nc r e a s e i n N M D A r e c e pt or s obs e r ve d i n t he br a i n s of P ah e n u 2 m i c e C r e a t i ne ki na s e a c t i vi t y, i m po r t a nt i n m a i nt a i ni ng e ne r gy hom e os t a s i s i n t he br a i n, a nd dopa m i ne s ynt he s i s ha ve be e n f ound t o be r e duc e d i n hype r p he nyl a l a ni ne m i c m ous e or r a t br a i ns a ddi ng t o t he c om p l e xi t y of t he phe not ype 8 9 A n e a r l i e r s t udy i n a m ous e m ode l w i t h i nduc i bl e hype r phe nyl a l a ni ne m i a by a dm i ni s t r a t i on of P he i n t he dr i nki ng w a t e r e xa m i n e d a dul t m i c e b r a i ns S t a t i s t i c a l l y s i gni f i c a nt de c r e a s e s i n t he m us c a r i ni c a c e t yl c hol i ne r e c e pt or s i n t he hi ppoc a m pus a nd c e r e br a l c or t e x w e r e obs e r ve d. 1 0 P he ha s be e n s ho w n t o i nhi bi t A T P s ul f ur yl a s e de c r e a s i ng t he s ynt he s i s of s ul f a t i de s w hi c h a r e m ye l i n a s s oc i a t e d l i pi ds T he de c r e a s e i n s ul f a t i de s r e s ul t s i n l ow e r p r ot e c t i on l e ve l s of m ye l i n a nd hi ghe r m ye l i n t u r nove r not c om pe ns a t e d by hi ghe r m ye l i n s ynt he s i s L ow m y e l i na t i on w a s obs e r ve d i n t he b r a i n a ut ops y of s e ve r e unt r e a t e d P K U pa t i e nt s a nd i n t h e P ah e n u 2 br a i ns 8 1 1 T he br a i ns i n t he

PAGE 18

5 i nduc e d H P A s t udy s how e d l os s of t he a c e t yl c hol i ne r e c e pt or i n a [ P he ] a nd t i m e of e xpos ur e de pe nde nt m a nne r i n a r e gi on o f t he br a i n a s s oc i a t e d w i t h a c qui s i t i on a nd l ong t e r m s t or a ge of i nf o r m a t i on. T he a s s oc i a t i on of s pe c i f i c ne ur ona l r e c e pt or s a nd pos s i bl e pe r m a ne nt br a i n da m a ge w i t h H P A s uppor t s t he ne e d f or l i f e l ong t he r a py. P h e n ot yp e of e ar l y t r e at e d p at i e n t s O nc e ne ona t a l de t e c t i on of hype r phe nyl a l a ni ne m i a w a s pos s i bl e pa t i e nt s w e r e pl a c e d, w i t hi n one m ont h a f t e r bi r t h, on a phe nyl a l a ni ne f r e e di e t T h i s di e t pr e ve nt s t he e l e va t i on of s e r um P he l e ve l s a nd t he ne ur ops yc hol ogi c a l phe not ype i s a ve r t e d. T he di e t c ons i s t s of a m i xt ur e o f f r e e a m i no a c i ds or m odi f i e d pr ot e i n hyd r ol ys a t e s a nd i s i nge s t e d a s a dr i nk a f t e r di l ut i on i n w a t e r T he c om m e r c i a l pr oduc t s c ur r e nt l y a va i l a bl e ha ve i m pr ove d s i nc e t he e a r l y 1960s i n t e r m s of ove r a l l nut r i t i ona l qua l i t i e s a nd vi t a m i n ba l a nc e a nd ha ve be e n s how n t o l e a d t o no r m a l ph ys i c a l gr ow t h i n c hi l d r e n. 1 2 H ow e ve r t he t a s t e a nd s m e l l of t he pr oduc t s a r e poor a nd m a ke c om pl i a nc e t o t he di e t di f f i c ul t P he nyl ke t onur i c c hi l dr e n m us t be c l os e l y f ol l ow e d t hr oughout t he i r c hi l dhood by a c l i ni c t o m oni t or s e r um P he l e ve l s gr ow t h pa r a m e t e r s a n d di e t i nt a k e I n t he 1960s a f e w r e por t s c a m e ou t s ugge s t i ng t h a t t e r m i na t i on o f di e t i n e a r l y c hi l dhood w oul d not l e a d t o a ny s i de e f f e c t s U nf or t una t e l y, t he c onc l us i on w a s pr e m a t ur e I n 1978 a nd i n a f ol l ow up s t udy i n 19 91, S m i t h e t a l s how e d t ha t t e r m i na t i on or r e l a xa t i on of t he di e t c a n l e a d t o l os s of i nt e l l i ge nc e quot i e nt ( I Q ) poi nt s 1 3 1 4 P oor di e t a r y c ont r ol i n e a r l y a nd c ont i n uous l y t r e a t e d P K U pa t i e nt s ( 10 8 ye a r s ol d) a f f e c t s s hor t t e r m m e m o r y, s e l e c t i ve a t t e nt i on, be ha vi or a l i nhi bi t i on a nd r ul e ba s e d be ha vi or a s c om pa r e d t o w e l l c ont r ol l e d P K U pa t i e nt s w i t h P he l e ve l s be l ow 400 m ol / l a nd a ge a nd I Q m a t c he d nor m a l c ont r o l s ubj e c t s 1 5 I n t he s a m e s t udy, t he be t t e r c ont r ol l e d p a t i e nt s ha d s i gni f i c a nt but m i l d, i m pa i r m e nt s i n pl a nni ng a nd s us t a i ne d

PAGE 19

6 a t t e nt i on a s c om pa r e d t o t he nor m a l s ubj e c t s A ga i n, t hi s e m pha s i z e s t he ne e d t o f i nd a be t t e r c ur e f or P K U M at e r n al p h e n yl k e t o n u r i a s yn d r om e M a t e r na l P K U s yndr om e r e f e r s t o t he i nc r e a s e d r a nge of bi r t h de f e c t s s e e n i n c hi l dr e n bor n of hype r phe nyl a l a ni ne m i c m ot he r s o n a poor l y c ont r ol l e d di e t G r ow t h r e t a r da t i on, ps yc hom ot or ha ndi c a ps a nd ot he r bi r t h de f e c t s ha ve be e n r e por t e d 1 6 H i gh phe nyl a l a ni ne i n t he m ot he r w a s f i r s t not e d t o be t e r a t oge ni c t o t he f e t us by D e nt i n 1956 a nd M a br y i n 1963 1 7 T he f i r s t r e por t s not e d m e nt a l r e t a r da t i on i n t he non P K U of f s pr i ng of P K U m o t he r s but be f or e t he e nd o f t he de c a de r e por t s on m i c r oc e pha l y, i nt r a ut e r i ne gr ow t h r e t a r da t i on a nd hi gh f r e que nc y of c onge ni t a l he a r t de f e c t s w e r e publ i s he d. 1 7 S i nc e di e t w a s not r e c om m e nde d f or l i f e a f t e r i t s e a r l y i ns t i t ut i on i n t he 1960s a nd t he 1970s t he r i s e i n m a t e r na l P K U s yndr om e c a m e a bout a s t he f i r s t e a r l y t r e a t e d pa t i e nt s r e a c he d c hi l dbe a r i ng a ge T he e xt e nt of t he s yndr o m e w a s not f ul l y unde r s t ood unt i l t he r e por t f r om L e nke a nd L e vy, c om pi l i ng da t a f r om a w i de r a nge of m e t a bol i c c e nt e r s a c r os s t he w or l d, w a s publ i s he d i n t he N e w E ngl an d J our nal of M e di c i ne i n 1980 1 8 M e nt a l r e t a r da t i on i n t he c hi l dr e n bor n t o w om e n w i t h P he a t 20m g/ dL ( unt r e a t e d c l a s s i c P K U ) w a s f ound t o oc c ur i n 92 % of c a s e s m i c r oc e pha l y i n 73% c onge ni t a l he a r t de f e c t s i n 12% a nd l ow bi r t h w e i ght be l ow 2. 5kg i n 40% of bi r t hs T he s e r i s ks w e r e s how n t o i nc r e a s e a s t he m ot he r s P he l e ve l s i nc r e a s e d. I n t h e U S t w o t hi r ds of phe nyl ke t onu r i c w om e n a r e not on di e t w he n t he y be c om e p r e gna nt 1 9 T he be ne f i t s of t r e a t i ng P K U pa t i e nt s f r om i n f a nc y c oul d be e r a s e d i f t hi s i nc r e a s e i n bi r t h de f e c t s a n un f or e s e e n s i de e f f e c t of t he pr i o r s uc c e s s w i t h P K U i s not a ddr e s s e d. 2 0 T he M a t e r na l P K U C ol l a bor a t i ve S t udy w a s s t a r t e d i n 1984 t o e xa m i ne t he e f f e c t s of phe nyl a l a ni ne c ont r ol dur i ng ge s t a t i on on p r e gna nc y out c om e s T he i n t e r na t i ona l

PAGE 20

7 s t udy e nr ol l e d 382 w om e n w i t h 574 pr e gna nc i e s 2 1 T he w om e n w e r e m oni t o r e d dur i ng pr e gna nc y, a nd t he c hi l dr e n f ol l ow e d unt i l 6 7 ye a r s of a ge t o m e a s ur e c ogni t i ve de ve l opm e nt 2 2 T he f r e que nc y of a bnor m a l i t i e s i n t he c hi l dr e n w a s f ound t o be di r e c t l y r e l a t e d t o m a t e r na l phe nyl a l a ni ne l e ve l s dur i ng pr e gna nc y. 1 6 T he r a nge o f bi r t h de f e c t s a t t r i but a bl e t o m a t e r na l P K U s yndr om e i nc l ude s pr e na t a l gr ow t h r e t a r da t i on m i c r oc e pha l y, c onge ni t a l he a r t di s e a s e a nd f a c i a l dys m or phi a s 2 3 W hi l e f e t a l l os s f or P K U w om e n i s c om pa r a bl e t o t he nor m a l a ve r a ge s i nc r e a s e s i n t he s e bi r t h de f e c t s a r e a l w a ys r e l a t e d t o phe nyl a l a ni ne l e ve l s a nd l e ngt h of e xpos ur e dur i ng ge s t a t i on. 2 3 C ont r ol pr i o r t o c onc e pt i on a nd c ont r ol be l ow 360 m ol / L a c hi e ve d by 10 w e e ks of ge s t a t i on w i l l l e a d t o a no r m a l o r ne a r no r m a l out c om e bot h a t bi r t h a nd i n I Q a t f ol l ow up. C onge ni t a l he a r t di s e a s e i s not s t r i c t l y r e l a t e d t o P he c onc e nt r a t i on but i t s f r e que nc y i s i nc r e a s e d w he n poor c ont r ol w i t h i na de qua t e pr ot e i n a nd vi t a m i n i nt a ke oc c ur s dur i ng t he f i r s t t r i m e s t e r 2 2 P os t na t a l gr ow t h r e t a r da t i on i s i nve r s e l y c or r e l a t e d t o phe nyl a l a ni ne c ont r ol dur i ng t he ge s t a t i on pe r i od; I Q goe s dow n s i gni f i c a nt l y i n t he s a m e m a nne r W om e n w i t h I Q l e s s t ha n 85 ne e d s pe c i a l s uppor t s i nc e t he i r a dhe r e nc e t o t he di e t i s not a s e a s i l y a c hi e ve d: c ur r e nt l y i n t he U S t he s t a t us of c a r e a n d s uppor t i s not a de qua t e t o a l l ow f o r pr ope r c ont r o l a nd be t t e r pr e gna nc y out c om e s i n t he s e w om e n. O t he r f a c t or s be s i de s phe nyl a l a ni ne l e ve l s a r e t hou ght t o a f f e c t pr e gna nc y out c om e a nd t he c hi l d s I Q a t 6 t o 7 ye a r s of a ge T he s e i nc l ude a ge of t he m ot h e r s oc i oe c onom i c s t a t us pa r e nt a l I Q a nd hom e c ha r a c t e r i s t i c s 2 4 H o m e c ha r a c t e r i s t i c s a nd pa r e nt a l I Q c a n e xpl a i n m os t of t he l ow e r t ha n e xpe c t e d I Q s c or e s i n t he c hi l dr e n; m or e t ha n t h r e e of t he know n r i s k f a c t or s f or one pr e gna nc y a l s o c a n l e a d t o poor e r t ha n e xpe c t e d out c om e N one t he l e s s ni ne w om e n w i t h c l a s s i c P K U obs e r v i ng l a t e di e t c ont r ol ha d c hi l dr e n w ho

PAGE 21

8 de m ons t r a t e d hi ghe r t ha n e xpe c t e d I Q s a t 6 ye a r s 2 4 A c om m on f e a t ur e be t w e e n m a t e r na l P K U s yndr om e f e t a l a l c ohol s yndr om e a nd pyr uv a t e de hydr oge na s e de f i c i e nc y i s a pot e nt i nhi bi t i on of py r uva t e de hydr oge na s e : s i nc e m odi f i e r ge ne s a r e know n t o pr e ve nt t oxi c i t y i n f e t a l a l c ohol s yndr om e t he pos s i bi l i t y o f m odi f i e r ge ne s f o r P K U i s a n a t t r a c t i ve e xpl a na t i on f o r t he va r i a nc e i n t he r e s ul t s obs e r ve d i n t he l a t e t r e a t e d gr oup 2 4 G e n e t i c s T he i nc i de nc e of t he di s e a s e i n t he U S va r i e s f r om 1 i n 13 500 t o 1 i n 19 000 bi r t hs F or non P K U hype r phe nyl a l a ni ne m i a t he e s t i m a t e i s 1 i n 48, 000 bi r t hs 2 5 T he p r e va l e nc e of P K U i s h i ghe r i n w hi t e a nd N a t i ve A m e r i c a n t h a n i n bl a c k, hi s pa ni c a nd a s i a n popul a t i ons M uc h a l l e l i c di ve r s i t y ha s be e n r e por t e d a t t he l oc us ( > 450 know n m ut a t i ons ) ; a n e xt e ns i ve da t a ba s e c ont a i ni ng a l l o f t he kn ow n m u t a t i ons i s l oc a t e d a t ht t p: / / w w w pa hdb. m c gi l c a 2 6 T hi s di ve r s i t y l e a ds t o m uc h phe not ypi c v a r i a bi l i t y e ve n a m ongs t pa t i e nt s w i t h t he s a m e P A H ge not ype O t he r ge ne t i c a nd e nvi r on m e nt a l f a c t or s pr oba bl y i nf l ue nc e t he c l i ni c a l phe not ype but ha ve ye t t o be e l uc i da t e d. P A H i s l oc a t e d on t he hum a n c hr om os om e 12 a t p os i t i on q22 q24. 1 2 7 T he f i r s t hum a n c D N A c l one w a s i s ol a t e d i n 1985 T he pr ot e i n i s 451 a m i no a c i ds or 51 672 D a l t ons 2 8 T he pr ot e i n w a s i s ol a t e d f r om t he r a t a s a di m e r a nd t hought t o be m a de up o f t w o i de nt i c a l s ubuni t s 2 9 P A H c ont a i ns 13 e xons o ve r 90kb o f D N A 3 0 T he a ve r a ge e xon l e ngt h i s 114 ba s e s r a ngi ng f r o m 57 t o 892 ba s e s P he nyl a l a ni ne hydr oxyl a s e i s s t r ongl y hom ol o gous t o t yr os i ne hyd r oxyl a s e a nd t h i s hom ol ogy i s gr e a t e s t i n t he C t e r m i na l t w o t hi r ds of t he pr ot e i n I nt e r e s t i ngl y, f or P A H t h i s c or r e s ponds t o t he l a s t 1698 ba s e s of t he m R N A w hi c h i s c ode d i n 16kb of D N A w hi l e t he m os t di ve r ge nt pa r t s o f t he pr ot e i n c or r e s pond t o 567 ba s e s of m R N A c ode d i n 72kb of D N A T he l a r ge s t i nt r on be t w e e n e xons 3 a nd 4, i s 23kb a nd f a l l s be t w e e n a m i no a c i ds 117 a nd 118 w he r e t he hom ol ogy t o

PAGE 22

9 tyrosine hydroxylase begins. This suggests that functional and tissue specific regulat ors could be contained within that intron or at least within the 72kb of divergent DNA. 30 Rat and human PAH share 96% homology at the amino acid level, and 89% a t the nucleotide level, with 82% of the differing nucleotides as silent codon changes. 28 Transcription of PAH has been shown to be regulated by a 9kb fragment situated upstream of the human gene. As other housekeeping genes, it does not have a TATA box, and uses multiple transcription initiati on start sites both in humans and in rodents. 31 The 5 region of human PAH contai ns two half sites of the glucocorticoid response element (GRE), two consensus sites for activator protein 2 (AP2) and one partial site for cAMP response element (CRE). 32 A 1.7kb region situated from position 3.5kb to 5.2kb contains 2 hepatocyte nuclear factor 1 (HNF1) binding sites. 33 HNF1 was shown to activate the 9kb promoter region in a dose dependent manner, and can be enhanced by its dimerization cofactor DCoH. Interestingly DCoH is also the enzyme pterin 4 carbinolamine dehydratase (PCD), responsible for converting 4 carbinolamine tetrahydrobiopterin to 7,8 dihydrobiopterin quinoid form in the recycling pathway of BH 4 (see Figure 1 1 and later section). Both DCoH and PAH can be found on the sam e operon in Pseudomonas aeruginosa suggesting an evolutionary role in the regulation of PAH by DCoH: it can transactivate transcription of the gene and recycle the necessary cofactor. In the mouse, the activity of the promoter is completely dependent on its enhancer, situated 3.5kb upstream of the start site. The enhancer has binding sites with weak homology to HNF1 and C/EBP concensus sequences. Addition of cAMP and dexamethasone increases the activity of the promoter in the presence of the enhancer in an additive fashion. 31 The enzyme activity in rat cell lines is increased in the presence of

PAGE 23

10 hydr oc or t i s one due t o a n i nc r e a s e i n P A H t r a ns c r i p t s s ugge s t i ng t ha t t he r a t a nd m ous e pr om ot e r s ha ve s i m i l a r c ha r a c t e r i s t i c s 3 4 T r a ns ge ni c m i c e c ont a i ni ng t he hum a n r e gul a t or y r e gi on e xpr e s s t he P A H t r a ns ge ne l i ke t he m ur i ne P A H bot h i n a t i m e a nd t i s s ue s pe c i f i c m a nne r 3 5 T he m u r i ne e nha nc e r r e gi on i s 77. 5 % hom ol ogous t o t he hu m a n s e gm e nt c ont a i ni ng t he H N F 1 bi nd i ng s i t e s 3 3 I t i s s t i l l unknow n i f t he hum a n P A H ge ne i s hor m ona l l y r e gul a t e d, but unl i ke t he m ur i ne pr o m ot e r i t doe s not r e qui r e c A M P or de xa m e t ha s one f or i n v i t r o a c t i vi t y I n hum a ns t he P A H t r a ns c r i pt c a n be de t e c t e d du r i ng t he f i r s t t r i m e s t e r i n t he f e t a l l i ve r I n r ode nt s P A H i s a c t i va t e d a t da y 18 of ge s t a t i on, but s t r ongl y i nduc e d dur i ng t he f i r s t pos t na t a l w e e k i n t he l i ve r 3 5 P A H i s pr e s e nt i n r ode nt k i dne y, a nd w a s f ound i n hum a n ki dne y c or t e x a t 20% of l e ve l s obs e r v e d i n hum a n l i ve r 3 6 3 7 I n r a t s t he k i dne y ha s 20% of l i ve r m R N A a m ount s a nd bot h t he l i ve r a nd ki dne y m R N A s a r e t he s a m e s i z e 3 4 C ondi t i ons w hi c h a c t i va t e t he r a t pur i f i e d e nz ym e do not a c t i va t e t he ki dne y e nz ym e : i t i s i n a c o ns t a nt a c t i va t e d s t a t e 3 8 B e c a us e t he m R N A s a r e i de nt i c a l t he di f f e r e nc e i n a c t i vi t i e s m a y be f r o m di f f e r e nt pos t t r a ns l a t i ona l m odi f i c a t i ons a nd r e gul a t i on R a o pos t ul a t e d t ha t t he ki dne y e nz ym e c oul d m a ke up 50% of r a t s t o t a l P A H a c t i vi t y due t o i t s hi ghe r 5 6, 7 8 t e t r a hydr ob i opt e r i n ( B H 4 ) de pe n de nt a c t i vi t y. M ol l e r e t al de m ons t r a t e d t ha t t he hum a n ki dne y c ont r i bu t e s a l a r ge a m ount of t yr os i ne t o t he s ys t e m i c c i r c ul a t i on, w hi l e t he l i ve r i s a ne t r e m ov e r of bot h phe nyl a l a ni ne a nd t yr os i ne f r om t he c i r c ul a t i on. 3 9 T h e P h e n yl al an i n e M e t ab ol i c P at h w ay P he nyl a l a ni ne m e t a bol i s m i s ve r y c om pl e x due t o i t s f unc t i on a s a p r e c ur s or t o dopa m i ne e pi ne phr i ne a nd nor e pi ne phr i ne a nd i t s dua l gl uc oge ni c a nd ke t oge ni c r o l e P he nyl a l a ni ne i s a n e s s e nt i a l a m i no a c i d; i t s i npu t i s di e t a r y a nd i t s c l e a r a nc e i nc l ude s

PAGE 24

11 i nc l us i on i nt o pol ype pt i de s ( 5 10% ) a nd oxi da t i on t o t y r os i ne ( 75% ) M i nor pa t hw a ys of t r a ns a m i na t i on a nd de c a r boxyl a t i on do not c ont r i b ut e s i gn i f i c a nt l y t o i t s c a t a bol i s m A l l c e l l s us e phe nyl a l a ni ne f or pr o t e i n s ynt he s i s but h e pa t oc yt e s a nd ki dne y c e l l s a r e t he m a i n c ont r i but or s t o phe nyl a l a ni ne c l e a r a nc e 3 9 4 0 T he f i r s t e nz ym e i n t he c l e a r a nc e pa t hw a y i s phe nyl a l a ni ne hydr oxyl a s e or L phe nyl a l a ni ne 4 m onooxyge na s e by i t s f or m a l na m e P he nyl a l a ni ne hyd r oxyl a s e i s a t e t r a m e r i c e nz ym e m a de up of f our i de nt i c a l s ubuni t s P A H i s a s ubs t r a t e f or c A M P de pe nde nt pr ot e i n ki na s e I t i s a m e t a l l opr ot e i n r e qui r i ng 1m ol of i r on pe r m ol of s ubuni t a nd ha s a ne c e s s a r y c of a c t or B H 4 4 1 T he c onve r s i on o f phe nyl a l a ni ne t o t y r os i ne i s pos t ul a t e d t o oc c ur vi a t he N I H s hi f t s i nc e t he hydr oge n on c a r bon 4 of phe nyl a l a n i ne i s m ove d t o c a r bon 3 on t y r os i ne ( F i gur e 1 1) B H 4 i s s ynt he s i z e d de nov o f r om G T P i n a f our s t e p pa t hw a y i nvol vi ng G T P c yc l ohydr ol a s e I ( G T P C H ) 6 pyr uvoyl t e t r a hydr o pt e r i n s ynt ha s e ( P T P S ) a nd s e pi a pt e r i n r e duc t a s e ( S R ) H P A c a n a l s o be c a us e d by de f e c t s i n G T P C H a nd P T P S a nd t hi s oc c ur s i n 1 t o 2% of c a s e s I n t he P A H s ys t e m t w o e nz y m e s a r e r e s pons i bl e f or r e c yc l i n g B H 4 : P C D a nd di hydr opt e r i d i ne r e duc t a s e ( D H P R ) R e gul a t i on of P A H i s t hr e e f ol d ba s e d on s t udi e s d one w i t h t he r a t e nz ym e : P A H i s a c t i va t e d by phe nyl a l a ni ne a nd by phos phor yl a t i on by c A M P de pe nde nt pr ot e i n ki na s e T he phos phor yl a t i on s e e m s t o be s t i m ul a t e d by ph e nyl a l a ni ne w hi l e onc e phos phor yl a t e d l e s s phe nyl a l a ni ne i s ne e de d f or a c t i va t i on. 4 2 S i nc e phos phor yl a t i on of P A H i s pe r f o r m e d by c A M P de pe nde nt p r ot e i n ki na s e bl ood gl uc a gon l e ve l s i ndi r e c t l y a f f e c t t he r a t e a t w hi c h P he i s c l e a r e d: a f t e r a m e a l l e ve l s of c A M P i nc r e a s e t hus a c t i va t i ng P A H I n l ow bl ood gl uc os e c ondi t i ons P he t ur nove r c a n i nc r e a s e i n o r de r t o obt a i n f um a r a t e B H 4 i nh i bi t s P A H a c t i vi t y ke e pi n g t he e nz ym e i n a ( pos t ul a t e d) l e s s

PAGE 25

12 a c t i ve c onf or m a t i on; t he e f f e c t i s r e ve r s e d by P he T he s t r uc t ur e o f a P A H di m e r ha s be e n e l uc i da t e d. 4 3 T he 452 a m i no a c i d m ono m e r i s c om pos e d of t hr e e r e gi ons : a r e gul a t o r y, a c a t a l yt i c a nd a t e t r a m e r i z a t i on dom a i n. T he c a t a l yt i c dom a i n, a m i no a c i ds 118 427 c ont a i ns 13 he l i c e s a nd 9 s t r a nds T he r e gul a t or y dom a i n i s i n t he N t e r m i nus w hi l e t he t e t r a m e r i z a t i on dom a i n i s c o nt a i ne d i n t he C t e r m i nus T he a c t i ve s i t e i s bur i e d i n a de e p ba s ke t s ha pe d c l e f t w he r e t he i r on a t om i s bound b y H 290, H 285 Q 330 a nd a w a t e r m ol e c ul e K obe e t a l pos t ul a t e d t ha t m ove m e nt of t he N t e r m i na l r e gul a t o r y dom a i n a bout a hi nge r e gi on, m a ki ng a c c e s s t o t he c a t a l yt i c s i t e e a s i e r c oul d e xpl a i n t he r e gul a t i on by phos phor yl a t i on a nd P he 4 3 A s of M a y 2005, 498 di s e a s e c a us i ng m ut a t i ons w e r e r e c or de d i n t he P A H da t a ba s e S i xt y t w o pe r c e nt of t he s e m ut a t i ons a r e m i s s e ns e m ut a t i ons 2 7 I n v i t r o a na l ys e s ha ve be e n pe r f or m e d t o a na l yz e a w i de r a nge of t h e s e m ut a t i ons i n or de r t o obt a i n i ns i ght on t he ge not ype phe not ype r e l a t i ons hi p of P K U a n d t he bi oc he m i c a l m e c ha ni s m of di s e a s e 4 4 4 8 T he a na l ys e s i n m a m m a l i a n c e l l s ha ve s how n t ha t m ut a t i ons o f t e n ha ve a de c r e a s e of i m m unor e a c t i ve pr ot e i n but no r e a l di f f e r e nc e i n m R N A a m ount s T he s e c onf or m a t i ona l m ut a t i ons pr e di s pos e t he pr o t e i n m onom e r t o i nc or r e c t f ol di ng or m i s a s s e m bl y of t he e nz ym e a s de t e r m i ne d i n E c ol i e xpr e s s i on s ys t e m s a nd t w o hybr i d a na l ys e s t hus l e a di ng t o i nc r e a s e d t ur nove r of t he pr ot e i n. 4 4 I n v i t r o m a ni pul a t i ons s uc h a s t e m pe r a t ur e de c r e a s e s a nd i nc r e a s e d c ha pe r oni n l e ve l s c a n r e s c ue pr ot e i n a m ount s ol i gom e r i z a t i on pa t t e r n a nd, f or s om e m ut a t i ons a c t i vi t y a s w e l l 4 6 S i m i l a r m odul a t i ng e f f e c t s i n v i v o c oul d e xpl a i n t he di s c r e pa nc i e s i n p he not ype s be t w e e n pa t i e nt s of i de nt i c a l ge not ype 4 9

PAGE 26

13 A n i m al M od e l s f or P K U A m ous e m ode l na m e d B T B R P ah e n u 2 w a s c r e a t e d by N e t hyl N ni t r os our e a t r e a t m e nt of m a l e B T B R P as m i c e by S he dl ovs ky e t al i n 1993 5 0 T he s pe c i f i c phe not ype hype r phe nyl a l a ni ne ne m i a w a s s c r e e ne d f or i n ove r 300 o f f s pr i ng of m ut a ge ni z e d m a l e s c r os s e d t o B T B R P ah e n u 1 m i c e T he P ah e n u 1 l i ne w a s c r e a t e d a f e w ye a r s e a r l i e r a nd di s pl a ye d a m i l d P K U phe not ype s o t he m ut a ge ne s i s w a s r e pe a t e d i n or de r t o f i nd a m or e s e ve r e l y a f f e c t e d phe not ype 5 1 O nc e a pot e nt i a l c a r r i e r of a m ut a t i on una bl e t o r e s c ue t he P ah e n u 1 phe not ype w a s f ou nd, i t w a s br e d t o w i l d t ype B T B R P as f e m a l e m i c e a nd t w o c onge ni c m ut a nt l i ne s w e r e e ve nt ua l l y e s t a bl i s he d, B T B R P ah e n u 2 a nd P ah e n u 3 T he P ah e n u 1 a nd P ah e n u 3 m i c e ha ve di f f e r e nt P K U phe not ype s a nd w i l l not be di s c us s e d i n t hi s w or k. T he P ah e n u 2 m i c e e xhi bi t m a ny of t he c ha r a c t e r i s t i c s a s s oc i a t e d w i t h c l a s s i c P K U : hypopi gm e nt a t i on c ogni t i ve di s a bi l i t i e s a nd m a t e r na l P K U s yndr om e 5 2 5 3 T he s i ngl e ba s e m ut a t i on i n t he m o us e P A H ge ne l oc a t e d on c hr om os om e 10, i s i n e xon 7 t he s a m e e xon w he r e m os t hum a n m ut a t i ons a r e l oc a t e d, c ha ngi ng phe nyl a l a ni ne r e s i due 263 t o a s e r i ne a nd r e nde r i n g t he e nz ym e c a t a l yt i c a l l y i na c t i ve 5 4 S he dl ovs ky e t al r e por t e d r e duc e d i m m uno r e a c t i ve pr ot e i n a s c om pa r e d t o w i l d t ype B T B R P as m i c e a l ong w i t h one pe r c e nt of no r m a l P A H m R N A i n l i ve r e xt r a c t s T he m ut a t i on a l s o c r e a t e d a ne w A l w 26 I r e s t r i c t i on s i t e a l l ow i ng f o r qui c k ge not ypi ng f r om P C R a m pl i f i c a t i on f ol l ow e d by r e s t r i c t i on di ge s t 5 4 T he f e m a l e m i c e do not r e gul a r l y c a r r y l i t t e r s t o t e r m ; i f pups a r e bor n t he y w i l l not s ur vi ve be yond a f e w hour s T hi s m a t e r na l P K U s y ndr om e i n t he m ous e i s c a us e d by t he hi gh s e r um P he l e ve l s i n t he da m s 5 5 S pe c i f i c c a r di ova s c ul a r de f e c t s w e r e not e d i n e m br yos f r om 14. 5 da ys pos t c oi t um 5 3 C ogni t i ve d e f i c i t s i n t he m i c e w e r e a s s e s s e d by odor di s c r i m i na t i on t e s t s a nd l a t e nt l e a r ni ng T he P ah e n u 2 m i c e ha ve s t a t i s t i c a l l y

PAGE 27

14 s i gni f i c a nt de f i c i t s i n t he s e l e a r ni ng a nd m e m o r y t a s ks ; how e ve r t he s e de f i c i t s a r e not i nc a pa c i t a t i ng. T hi s e vi de nc e c om bi ne d w i t h t he hi gh s e r um P he l e ve l s a nd t he hypopi gm e nt a t i on c onf i r m s t ha t t he m ous e i s a ve r y good m ode l of hu m a n ph e nyl ke t onur i a A l t e r n at i ve T h e r ap i e s T he l a c k of a dhe r e nc e t o t he P he r e s t r i c t e d s ynt he t i c di e t a nd t he r e s ul t i ng i nc r e a s e i n m a t e r na l P K U s yndr om e hi ghl i gh t s t he ne e d f o r a n a l t e r na t i ve f or m of t he r a py f o r P K U T e t r a hydr obi opt e r i n s uppl e m e nt a t i on ha s be e n us e d w i t h s uc c e s s i n P K U pa t i e nt s w ho ha ve m ut a t i ons t ha t a r e know n t o be r e s pons i ve t o t he c o f a c t or T he s e pa t i e nt s t ypi c a l l y do not ha ve c l a s s i c P K U s i nc e m ut a t i o ns i n t he c a t a l yt i c dom a i n do not r e s pond t o B H 4 s uppl e m e nt a t i on. T he m e c ha ni s m f or B H 4 r e s pons i ve ne s s i s not f ul l y unde r s t ood. T he m ut a t i ons t ha t ha ve be e n s t udi e d i n v i t r o s how r e duc e d a c t i va t i on by phe nyl a l a ni ne a nd r e duc e d a f f i ni t y f o r phe nyl a l a ni ne 5 6 F e w of t he s e m ut a t i ons ha ve a de c r e a s e d a f f i ni t y t o t e t r a hydr obi opt e r i n H ow e ve r B H 4 s e e m s t o p r e ve nt m i s f ol di ng a nd i na c t i va t i on of t he s e m ut a nt pr ot e i ns 5 7 O t he r hypo t he s e s i nc l ude m R N A s t a bi l i z a t i on, i nduc t i on of P A H e xpr e s s i on by B H 4 a nd c ha nge s i n t he r e gul a t i on o f B H 4 s ynt he s i s a f t e r or a l a dm i ni s t r a t i on. T he r e s pons e t o t e t r a hydr obi opt e r i n i s obvi ous l y m ul t i f a c t or i a l a nd de pe nds on t he a l l e l e s pr e s e nt i n e a c h i ndi vi du a l pa t i e nt 5 8 I n t he t e t r a hydr obi opt e r i n pa t i e nt t r i a l s a nor m a l d i e t or a r e l a xe d di e t i s s uppl e m e nt e d w i t h B H 4 t o a c hi e ve l ow e r a nd c ont r ol l e d P he l e ve l s I n t w o s e pa r a t e s t udi e s nor m a l de ve l opm e nt i n a l l o f t he pa t i e nt s w a s obs e r ve d, a nd l ow e r i ng o f s e r um P he l e ve l s w a s a c hi e ve d i n t he pa t i e nt s t r e a t e d f or a n e xt e nde d pe r i od of t i m e 5 9 6 0 S i de e f f e c t s not e d a r e ps yc hone ur ot i c ur ol ogi c a l a nd ga s t r oi nt e s t i na l i n na t ur e 6 1 H ow e ve r no f ul l l ong t e r m o r l a r ge s c a l e s t udy ha s be e n c onduc t e d t o a s s e s s t he s a f e t y of r e pe a t

PAGE 28

15 a dm i ni s t r a t i on of B H 4 W hi l e B H 4 s uppl e m e nt a t i o n c a n be t hr e e t o f ou r t i m e s m or e e xpe ns i ve t ha n t he P he r e s t r i c t e d di e t i t c oul d he l p pr e ve nt t he e f f e c t s of m a t e r na l P K U s yndr om e by s t a bi l i z i ng P he l e ve l s a nd pr e ve nt i ng c onc e nt r a t i ons f r om pe a ki ng dur i ng t he da y. P he nyl a l a ni ne va r i a t i on du r i ng p r e gna nc y w a s f ound t o ha ve a ne ga t i ve e f f e c t on he a d c i r c um f e r e nc e a t bi r t h by t he C ol l a bor a t i ve S t udy. 2 2 E nz ym e r e pl a c e m e nt t he r a py c oul d be a n a t t r a c t i v e a l t e r na t i ve t o t r e a t a l l P K U pa t i e nt s M os t of t he w o r k w i t h e nz ym e r e pl a c e m e nt t he r a py ha s be e n done w i t h t he e nz ym e P he nyl a l a ni ne A m m oni a L ya s e ( P A L ) s i nc e i t doe s not r e qui r e a c of a c t or f or a c t i vi t y. 6 2 O r a l de l i ve r y of e nt e r i c ge l a t i n c oa t e d P A L c a ps ul e s w a s s how n t o be s uc c e s s f ul a nd r e duc e d P he l e ve l s by 22% i n P K U pa t i e nt s W hi l e pr om i s i ng i t m a y not be e nough f or c l a s s i c phe not ype s a nd m or e w or k i s be i ng done t o p r ot e c t t he a c t i vi t y of t he pr ot e i n f r om t he a c i di c e nvi r o nm e nt of t he s t o m a c h a nd opt i m i z e i t f o r t he i nt e s t i na l e nvi r onm e nt P E G yl a t i on of P A L w a s a l s o t e s t e d i n m i c e : t he e nz ym e ha s a l onge r ha l f l i f e but a f t e r m ul t i pl e i nj e c t i ons i t i s qui c kl y c l e a r e d f r om c i r c ul a t i on. E nz ym e r e pl a c e m e nt t he r a py w i t h P A H ha s a l s o be e n e xpl o r e d, but t he r e qui r e m e nt f or c o i nj e c t i on of B H 4 doe s not m a ke i t a s a t t r a c t i ve a t h e r a py a s P A L G e ne t he r a py f or P K U w oul d be a n i de a l f or m of t r e a t m e nt t o i m p r ove t he qua l i t y of l i f e of P K U a nd H P A pa t i e nt s a nd t o pr e ve nt m a t e r na l P K U s yndr om e S ki n m us c l e a nd bone m a r r ow ha ve be e n e xpl or e d a s pos s i bl e t a r ge t s f or ge ne t he r a py, but t he a va i l a bi l i t y of t he c of a c t or ha s l i m i t e d s uc c e s s i n t he s e a ppr oa c he s 6 3 6 6 W i t h r e c om bi na nt a de novi r us t w o g r oups a c hi e ve d l ow e r i ng o f s e r u m P he i n t he B T B R P ah e n u 2 m i c e us i ng t he R ous S a r c om a vi r us L T R a nd C A G p r om ot e r s r e s pe c t i ve l y. 6 7 6 8 H ow e ve r bot h gr oups r e por t e d a nt i bod i e s r a i s e d a ga i ns t a de novi r us a nd c om pl e t e r e ve r s a l of t r e a t m e nt

PAGE 29

16 a f t e r t w o w e e ks A l l of t he s e e xpe r i m e nt s w e r e i n t r oduc i ng f unc t i on a l hum a n P A H a s oppos e d t o m ous e P A H A de no a s s oc i a t e d vi r us ( A A V ) ha s a l s o be e n s uc c e s s f ul l y us e d t o t r e a t H P A i n t he m ous e m ode l U s i ng r e c om bi na nt A A V ( r A A V ) s e r ot ype 5 c a r r yi ng t he m ous e P A H ge ne l ong t e r m c or r e c t i on of m i c e 40 w e e ks w a s a c hi e ve d i n m a l e s but not i n f e m a l e s 6 9 O n e t hi r d l e s s ve c t or w a s ne e de d i n t he m a l e s t ha n i n t he f e m a l e s t o a c hi e ve a s i m i l a r P he c l e a r a nc e dur i ng t he f i r s t 6 w e e ks a t w hi c h poi nt t he f e m a l e s s e r um P he l e ve l s r e t ur ne d t o t he i r hype r phe nyl a l a ni ne m i c s t a t e T he m i ni m um e f f e c t i ve dos e i n m a l e s i n t hi s s t udy w a s 3x10 1 3 ve c t or ge nom e s o f r A A V 5. W i t h r A A V 2, t he hum a n P A H ge ne w a s de l i ve r e d t o m i c e w i t h a W P R E e l e m e nt i nc l ude d i n t he c a s s e t t e 7 0 A ga i n, f e m a l e m i c e di d no t r e s pond t o t he s a m e dos e t ha t w a s f ound e f f e c t i ve i n m a l e s 2x10 1 2 ve c t or ge nom e s T hi s dos e w a s e f f e c t i ve up t o 25 w e e ks a t w hi c h poi nt a n i nc r e a s e i n s e r um P he l e ve l s w a s not e d. A c c or di ng t o t he a ut h or s t hi s w a s due t o a l os s i n ve c t or D N A a m ount s a s de t e r m i ne d by s e m i qua nt i t a t i ve P C R A l l of t he s e s t udi e s ha ve s how n t ha t i t i s pos s i bl e t o t r e a t hype r phe nyl a l a ni n e m i a i n t he m i c e by ge ne t he r a py but m or e w or k i s r e qui r e d t o a c hi e ve t r ue l ong t e r m c o r r e c t i on i n t he m a l e s a nd t he s a m e r e s pons e i n f e m a l e m i c e G e n e T h e r ap y V e c t or s B as e d on A d e n o A s s oc i at e d V i r u s S om a t i c ge ne t he r a py f or t he c or r e c t i on of i nhe r i t e d ge ne t i c di s or de r s i s t he de s i r e d ha l l m a r k of f ut ur e i ndi vi dua l i z e d m e di c i ne V i r a l v e c t or s f or s uc h de l i ve r y ha ve be e n s t udi e d f or m a ny ye a r s 7 1 G e nom e s i z e i m m unoge ni c i t y, l e ngt h of ge ne e xpr e s s i on a nd i nt e gr a t i on c a pa bi l i t i e s a r e f a c t or s t ha t c a n a f f e c t t he c hoi c e of a vi r a l ve c t o r A de no a s s oc i a t e d vi r us ha s m a ny a t t r a c t i ve qua l i t i e s f or h um a n us e : i t i s nonpa t hoge ni c i t c a n i nf e c t di vi di ng a nd non di vi d i ng c e l l s i t doe s not h a ve t o c ont a i n a ny v i r a l c odi ng

PAGE 30

17 s e que nc e s a nd i t c a n m e di a t e l ong t e r m ge ne e xpr e s s i on i n a ni m a l m ode l s 7 2 7 4 T he r e a r e ove r 50 A A V s e r ot ype s know n; e a c h one m a y ha v e s l i ght l y di f f e r e nt c e l l t r opi s m of f e r i ng t he pos s i bi l i t y of e nha nc e d t r a ns duc t i on f or di f f e r e nt t a r ge t e d or ga ns 7 5 U nf or t una t e l y t he ge nom e s i z e of A A V i s i t s m a i n l i m i t a t i on s i nc e m a ny ge ne s a r e l onge r t ha n t he 4. 68kb pa c ka gi ng l i m i t R e por t s on a s m a l l pe r c e nt a ge of i nt e gr a t i on i nt o a c t i ve c hr om a t i n r e gi ons a nd t he pos s i bi l i t y of i nc r e a s e d t um or i ge ne s i s ha ve da r ke ne d t he pr os pe c t s of t hi s ge ne t he r a py ve c t or 7 6 N one t he l e s s r A A V s e r ot ype 2 i s c ur r e nt l y i n us e i n c l i ni c a l t r i a l s a nd s t i l l r e m a i ns a ve c t o r of c hoi c e f or t he de ve l opm e nt o f ge ne t he r a py f or i nhe r i t e d di s or de r s A d e n o A s s oc i at e d V i r u s B i ol ogy A de no a s s oc i a t e d vi r us i s pa r t of t he f a m i l y P ar v o v i r i dae a nd i s c l a s s i f i e d a s a de pe ndovi r us i n t he P ar v ov i r i nae s ubf a m i l y. D e pe ndovi r us e s r e qui r e t he p r e s e nc e of he l pe r vi r us e s s uc h a s A de no vi r us o r H e r pe s vi r u s t o e s t a bl i s h a pr oduc t i ve i nf e c t i on I n t he a bs e nc e of s uc h a he l pe r vi r us a l a t e nt i n f e c t i on c a n be m a i nt a i ne d by i nt e gr a t i on of t he vi r us D N A i nt o t he ge nom e I n hum a ns t he m a i n A A V i nt e gr a t i on s i t e i s 19q13 3 w he r e t he ge nom e us ua l l y i nt e g r a t e s i n t a nde m r e pe a t s 7 7 T h i s c a n be r e s c ue d by s ubs e que nt i nf e c t i on w i t h t he he l pe r vi r us T he vi r us ha s not be e n a s s oc i a t e d w i t h di s e a s e i n hum a ns T he A A V ge nom e i s s i ngl e s t r a nde d D N A a nd i s 4 679 ba s e s i n l e ngt h f o r A A V s e r ot ype 2. 7 1 I t i s f l a nke d on bot h s i de s by 145 nuc l e ot i de i nve r t e d t e r m i na l r e pe a t s ( I T R ) c om pos e d of t hr e e pa l i nd r om i c s e que nc e s w i t h onl y s e ve n ba s e s r e m a i ni ng unpa i r e d w he n f ol de d. T he I T R s a r e t he onl y e l e m e nt s r e qui r e d i n c i s f or e nc a ps i da t i on. T he ge nom e e nc ode s nons t r uc t ur a l pr ot e i ns ( R e p78, R e p 68, R e p 52 a nd R e p 40 ) a nd c a ps i d pr ot e i ns ( V P 1, V P 2, a nd V P 3 ) T he s e pr ot e i ns a r e e xpr e s s e d f r om t hr e e pol y m e r a s e I I

PAGE 31

18 pr o m ot e r s p5 p19 a nd p40 f r om a l t e r na t i ve l y s pl i c e d m R N A T he R e p p r ot e i ns a r e r e qui r e d f o r D N A r e pl i c a t i on, e s t a bl i s hm e nt of l a t e nt i nf e c t i ons s i t e s pe c i f i c i nt e gr a t i on i nt o c hr om os om e 19 a nd e nc a ps i da t i on of t he ge n om e T he C a p pr ot e i ns c om bi ne 60 s ubu ni t s i nt o T = 1 i c os a he dr a l s ym m e t r y w i t h V P 2 a s t he m a j or s t r uc t ur a l c om pone nt o f t he s m a l l vi r i on A A V s e r ot ype 2 bi nds t o t he ubi qui t ous l y e xpr e s s e d c e l l s ur f a c e he pa r i n s ul f a t e pr ot e ogl yc a n ( H S P G ) I t r e qui r e s f i b r obl a s t gr ow t h f a c t or r e c e pt or t ype 1 a n d t he i nt e gr i n V 5 f or e nt r y i nt o t he c e l l 7 8 7 9 U pt a ke oc c ur s t hr o ugh s t a nda r d e ndoc yt os i s f r om c l a t hr i n c oa t e d pi t s a nd t he c a ps i d i s r e m ove d i n t he nuc l e us 8 0 T he vi r us ge no m e c a n be f ound i n t he nuc l e us t w o hou r s a f t e r i nf e c t i on. R e c e pt or s us e d by t he ot he r A A V s e r ot ype s i nc l ude s i a l i c a c i d a nd P D G F R g i vi ng e a c h one a di f f e r e nt pr e f e r r e d c e l l t ype C u r r e n t T r e n d s an d A p p l i c at i on s o f r A A V R e c om bi na nt A A V vi r us c a n be m a de i n t he l a b w i t hout t he us e of he l pe r v i r us e s R e c om bi na nt vi r us pr oduc t i on i s a c c om pl i s he d by pr ovi di ng onl y t he ne c e s s a r y pr ot e i ns r e qui r e d f o r D N A r e pl i c a t i on a nd e nc a ps i da t i on on a pl a s m i d t ha t i s i nde pe nde nt of t he r e c om bi na nt A A V pl a s m i d. B ot h pl a s m i ds a r e c o t r a ns f e c t e d i nt o c e l l s a nd r A A V vi r us c a n be pur i f i e d f r e e o f he l pe r vi r us T h i s m e t hod i s e f f i c i e nt a nd pr oduc e s l ow pa r t i c l e t o i nf e c t i vi t y r a t i os T he I T R s a r e t he onl y w i l d t ype vi r us s e que nc e l e f t on t he r e c om bi na nt vi r us T hus i t i s i nc a pa bl e of r e pl i c a t i ng onc e i t ha s e nt e r e d t he c e l l T he vi r a l ge nom e i s s l ow l y c onve r t e d f r om s i ngl e s t r a nde d D N A t o do ubl e s t r a nde d D N A de l a yi ng t he ons e t of e xpr e s s i on i n t he c e l l T he ge nom e i s m a i nt a i ne d i n t he nuc l e us a s a l i ne a r o r c i r c ul a r hi gh m ol e c ul a r w e i ght c onc a t e m e r 8 1 M a ny a ni m a l m ode l s ha ve be e n t r e a t e d w i t h r A A V ve c t or s t o c or r e c t a v a r i e t y of i nhe r i t e d di s or de r s i n a va r i e t y of t i s s ue s T i s s ue s s uc c e s s f ul l y t a r ge t e d by di r e c t i n v i v o

PAGE 32

19 m e t hods i nc l ude l i ve r m us c l e he a r t b r a i n, l ung, e ye a nd ki dne y. 7 4 8 2 8 7 H e m ophi l i a B ha s be e n t r e a t e d by l i ve r di r e c t e d ge ne t he r a py bot h i n a m ous e m ode l a nd i n a c a ni ne m ode l de m ons t r a t i ng t he s a f e t y a nd t he l ong t e r m e xpr e s s i on m e di a t e d by r A A V 2. 7 3 8 8 T he s e s t udi e s a l s o s how e d a dos e r e s pons e c or r e l a t i ng i nc r e a s e d f a c t or I X c i r c ul a t i ng l e ve l s w i t h hi ghe r r A A V dos e s C l i ni c a l t r i a l s w i t h A A V s e r ot ype 2 a r e unde r w a y f or a num be r o f di s e a s e s a c r os s t he U S T w o t r i a l s one f or C ys t i c F i br os i s a nd one f or H e m ophi l i a B ha ve publ i s he d a num be r of upda t e s D e l i ve r y of r A A V 2 t o t he l ung s ha s not r e s ul t e d i n a ny a dve r s e e f f e c t s t o da t e but i t doe s not s e e m t ha t t he vi r us i s t r a ns duc i ng t he l ung e pi t he l i a l c e l l s ve r y e f f i c i e nt l y 7 5 R e s ul t s i n t he H e m ophi l i a B t r i a l s ha ve be e n a l i t t l e m or e e nc our a gi ng W hi l e de l i ve r y of r A A V 2 c ont a i ni ng t he F a c t or I X ge ne t o t he m us c l e w a s w e l l t ol e r a t e d, onl y a m i l d e f f e c t on F a c t or I X c onc e nt r a t i ons 1% of no r m a l ha s s o f a r be e n a c hi e ve d. W he n t he l i ve r w a s t he t a r ge t i n a pa r t ne r s t udy, 5 t o 12% o f no r m a l F a c t or I X l e ve l s ha ve be e n obs e r ve d i n t he c i r c ul a t i on of one pa t i e n t f or 5 w e e ks but t he n d r oppe d t o 2. 7% A A V w a s de t e c t e d i n t he s e m e n of one pa t i e nt a nd t hi s s e e m s t o ha ve be e n c l e a r e d a f t e r 3 m ont hs 7 5 T he r e s ul t s of t he s e t r i a l s ha ve no t ye t l e d t o t he c ur e s hope d f o r but t he y ha ve s how n t ha t r A A V 2 de l i ve r y t o hum a ns i s r e l a t i ve l y w e l l t ol e r a t e d a n d c a n a c hi e ve m ode s t t he r a pe ut i c e f f e c t s R N A an d D N A as T h e r ap e u t i c A ge n t s A nt i s e ns e ol i gonuc l e ot i de s c a n be us e d t o t a r ge t s p e c i f i c m e s s e nge r R N A s t o i nhi bi t t r a ns l a t i on o r t o i nduc e c l e a va ge a nd de gr a da t i on. A nt i s e ns e R N A ol i gonuc l e ot i de s r i boz ym e s a n d s hor t i nt e r f e r i ng R N A s ha ve be e n s t udi e d ove r t he ye a r s f or t he i r pot e nt i a l us e s a s t he r a pe ut i c c om pounds i n c a nc e r s a nd dom i na nt di s e a s e s

PAGE 33

20 W hi l e t he s e di f f e r e nt m ol e c ul e s ha ve di s t i nc t a dva nt a ge s w e w i l l f oc us on r i boz ym e s be c a us e t hi s m e t hodol ogy s e e m s be s t s ui t e d f or t he pa r t i c ul a r p r obl e m s s e e n i n P K U R N A I n t e r f e r e n c e T he pr oc e s s of R N A i nt e r f e r e nc e w a s di s c ove r e d i n t he w or m C ae nor habdi t i s e l e gans 8 9 W he n doubl e s t r a nde d R N A ( ds R N A ) i s i nt r oduc e d, s e que nc e s pe c i f i c pos t t r a ns c r i pt i ona l ge ne s i l e nc i ng oc c ur s T he e nz ym e D I C E R a n R N a s e I I I pr oc e s s e s l ong ds R N A m ol e c ul e s by c l e a vi ng t he ds R N A i nt o 22 nuc l e ot i de s hor t i nt e r f e r i ng R N A s ( s i R N A s ) T hi s dupl e x i s unw ound a nd bi nds t o i t s t a r ge t R N A vi a R I S C R N A i nduc e d s i l e nc i ng c om pl e x. I f t he s i R N A s e que nc e pe r f e c t l y m a t c he s i t s t a r ge t c l e a va ge oc c ur s a ppr oxi m a t e l y a t 10 nuc l e ot i de s f r om t he 5 e nd o f t he t a r ge t s e que nc e I t i s now know n t ha t t he ge ne r a l m e c ha ni s m o f ds R N A r e s pons e i s c ons e r ve d i n m os t e uka r yot e s t hus t he r e c e nt de ve l opm e nt s i n s i R N A t e c hnol ogy f o r us e i n m a m m a l i a n c e l l s T he c ur r e nt l y m os t popul a r a ppr oa c h f or e xp r e s s i on of s i R N A us e s a P ol I I I pr om ot e r t o e xpr e s s a ha i r pi n t ha t e nc ode s f or bot h t he s e ns e a nd t he a nt i s e ns e R N A s e que nc e T hi s i s t he n de l i ve r e d di r e c t l y t o t he c e l l s by t r a ns f e c t i on or c l one d i nt o a vi r a l ve c t or f or e a s y de l i ve r y i nt o a ni m a l m ode l s M uc h w or k ha s be e n done on de t e r m i ni ng m a r ke r s f or f unc t i ona l s i R N A de s i gn. O ne of t he r e qui r e m e nt s f or good s i R N A s i s t he ne e d f or 2 nuc l e ot i de 3 ove r ha ngs 9 0 I nt e r na l ge ne r a l r e qui r e m e nt s i nc l ude l ow G C c ont e nt t hr e e o r m o r e A / U ba s e pa i r s a t t he 3 e nd of t he s e ns e s t r a nd, a nd l a c k o f i nt e r na l r e pe a t s 9 1 9 2 T he pr e s e nc e of A / U ba s e pa i r s a t t ha t e nd c onf i r m s pr e vi ous r e s ul t s obt a i ne d by S c hw a r z w hi c h s ugge s t e d t ha t t he s t r a nd t ha t i s i nc l ude d i nt o R I S C ha s t he l e a s t t i ght l y bound 5 e nd t hus p r e f e r e nt i a l l y s e l e c t i ng t he a nt i s e ns e s t r a nd. 9 3 R N A i nt e r f e r e nc e ha s be e n us e d e xt e ns i ve l y f or f u nc t i o na l ge ne s t udi e s i n c e l l c ul t ur e s a nd i s be i ng s t udi e d f or t a r ge t i ng c a nc e r g e ne s vi r a l i n f e c t i ons a nd ge ne t i c

PAGE 34

21 di s or de r s 9 4 9 6 S a f e t y of s i R N A us e i n hum a ns i s c u r r e nt l y be i ng a s s e s s e d i n a c l i ni c a l t r i a l w he r e a n s i R N A t a r ge t i ng V E G F i s be i ng t e s t e d t o he l p p r e ve nt a ge r e l a t e d m a c ul a r de ge ne r a t i on. 9 7 H ow e ve r m o r e s t udy i s ne c e s s a r y s i nc e s i R N A s ha ve be e n i m pl i c a t e d i n c hr om a t i n a r c hi t e c t ur e i n s e ve r a l or ga ni s m s a nd t h e r ol e a nd m e c ha ni s m of s i R N A s ha s not ye t be e n f ul l y e l uc i da t e d i n m a m m a l i a n c e l l s 9 8 M i c r oR N A s ( m i R N A s ) a r e m a de f r om p r e c ur s or m i R N A s i n m a m m a l i a n c e l l s a nd h a ve be e n a s s oc i a t e d w i t h de ve l opm e nt a l ge ne r e gul a t i on. 9 9 M i c r oR N A s a r e a l s o 21 t o 23 nuc l e ot i de s w he n pr oc e s s e d f r om t he i r l onge r p r e c ur s or s T he y of t e n f unc t i on a s t r a ns l a t i ona l r e pr e s s or s a nd do not c ont a i n a n e xa c t m a t c h t o t he i r t a r ge t s r a i s i ng c onc e r ns a bout pos s i bl e s i de e f f e c t s of i nt r oduc e d s i R N A s T he i ne xa c t m a t c h o f m i R N A s t o t he i r t a r ge t s a l s o i m pl i e s t ha t t o c r e a t e a c D N A t ha t i s r e s i s t a nt t o a de s i gne d s i R N A w i l l r e qui r e e xt e ns i ve m odi f i c a t i ons T hi s r e qui r e m e nt i s t he m a i n r e a s on w hy w e f oc us e d on ha m m e r he a d r i boz ym e s f or ou r s t udy. N one t he l e s s t he l a r ge a m ount of r e s e a r c h be i ng done w i t h s i R N A s s houl d s oon unc ove r t he be s t a nd s a f e s t w a y t o us e t he m i n ge ne f unc t i on s t udi e s a nd a s t he r a pe ut i c a ge nt s R i b oz ym e s R i boz ym e s a r e R N A m ol e c ul e s c a pa bl e of c a t a l yz i ng c he m i c a l r e a c t i ons w i t hout pr ot e i n a s s i s t a nc e H a i r pi n r i boz ym e s R N a s e P G r oup I a nd I I i nt r ons c a n c a t a l yz e s uc h r e a c t i ons a s r i bonuc l e ot i de t r a ns e s t e r i f i c a t i on a nd hydr ol ys i s 1 0 0 H a m m e r he a d r i boz ym e s w e r e di s c ove r e d i n pl a nt s a t e l l i t e vi r us R N A s a nd m e di a t e r ol l i ng c i r c l e r e pl i c a t i on T he y s e l f c l e a ve t he R N A i n a n i n l i ne t r a ns e s t e r i f i c a t i on r e a c t i on. 1 0 1 S i nc e t he s e que nc e r e qui r e m e nt s of t he r e a c t i on ha ve be e n di s c ove r e d t he y ha ve be e n e ngi ne e r e d t o c a t a l yz e t he s a m e r e a c t i on i n t r ans f o r a s pe c i f i c c hos e n t a r ge t 1 0 2 T he t a r ge t s e que nc e of a r i boz ym e c ont a i ns N U X N i s a ny nuc l e ot i de a nd X i s a ny nuc l e ot i de but G T he

PAGE 35

22 r i boz ym e w i l l c l e a ve t he m R N A a f t e r X T he a c t ua l r a t e o f c l e a va ge i s s i gni f i c a nt l y a f f e c t e d by t he s e que nc e of N U X w i t h G U C a nd A U C ha vi ng hi ghe r a c t i vi t i e s 1 0 3 T he t ypi c a l l a b ha m m e r he a d r i boz ym e i s 33 t o 35 nuc l e ot i de s l ong, de pe ndi ng on t he l e ngt h of t he hyb r i di z i ng a r m s a nd i t s c or e s t r uc t ur e i nc l u de s s t e m s I a nd I I I ( t he hybr i d i z i ng a r m s ) a nd s t e m I I a ha i r pi n s t r uc t ur e us e d f or m a i nt a i ni ng s t a bi l i t y of t he r e qui r e d f ol di ng f o r c a t a l ys i s ( F i gu r e 1 2 ) O nc e bound t o i t s t a r ge t t he c l e a va ge r e a c t i on t a ke s pl a c e a nd t h e R N A pr oduc t s a r e s ubs e que nt l y de gr a de d. S i nc e t he y do not r e qui r e pr ot e i ns f or c a t a l ys i s t he m a i n i s s ue w i t h r i boz ym e us e i n t he r a pe ut i c s i s c hoos i ng t he r i ght de l i ve r y m e t h od. I f us e d a s s t a bi l i z e d R N A m ol e c ul e s di r e c t or ge ne r a l i nj e c t i ons m us t be t e s t e d t o a s c e r t a i n c o l oc a l i z a t i on w i t h i t s t a r ge t R N A w hi l e ke e pi ng i n m i nd t he ha l f l i f e of t he r i boz ym e D e l i ve r y w i t h a vi r a l ve c t or c a n obvi a t e t he pr e vi ous i s s ue a s l ong a s t he vi r us w i l l i nf e c t t he c or r e c t c e l l t ype T he pr ope r pr om ot e r m us t be c hos e n s o t ha t t he r i b oz ym e c a n e xi t t he nuc l e us t o r e a c h t he m R N A t a r ge t w i t hout be i ng p r oc e s s e d or de gr a de d i t s e l f R i boz ym e s onl y ne e d 12 nuc l e ot i de s f or t a r ge t r e c ogni t i on a nd t he c l e a va ge t a r ge t r ul e s a r e not a s r e s t r i c t e d a s i ni t i a l l y t hought 1 0 4 N one t he l e s s s pe c i f i c i t y of t he c l e a va ge r e a c t i on ha s be e n de m ons t r a t e d. 1 0 5 M a ny gr oups ha ve s uc c e s s f ul l y us e d r i boz ym e s a s a nt i vi r a l t r e a t m e nt s a nt i c a nc e r t r e a t m e nt s a nd di s e a s e t r e a t m e nt s f or di s or de r s s uc h a s A l z he i m e r s a nd r e t i ni s pi gm e nt os a 1 0 6 1 0 7 A ha m m e r he a d r i boz ym e A ngi oz ym e i s c ur r e nt l y i n P ha s e I I c l i ni c a l t r i a l s f o r t r e a t m e nt of a dva nc e d c ol or e c t a l c a nc e r s i n c om bi na t i on w i t h c he m ot he r a py 1 0 8 T he r i boz ym e t a r ge t s V E G F R 1 a nd i s a c he m i c a l l y m odi f i e d m ol e c ul e i nj e c t e d s ubc ut a ne ous l y on a da i l y ba s i s P a t i e nt s w ho ha d de t e c t a bl e V E G F R 1 l e ve l s pr i o r t o

PAGE 36

23 t he r a py w hi c h de c l i ne d pos t t he r a py ha ve be e n f ou nd t o ha ve be t t e r c l i ni c a l out c om e s t ha n pa t i e nt s w hos e l e ve l s di d not c ha nge A not he r s t a bi l i z e d ha m m e r he a d r i boz ym e i s i n a c l i ni c a l t r i a l f or H e pa t i t i s C V i r us 1 0 9 C l i ni c a l t r i a l s a r e a l s o unde r w a y t o t a r ge t H I V i nf e c t i on w i t h l e nt i vi r us i nt r oduc e d ha m m e r he a d a nd ha i r pi n r i boz ym e s 1 1 0 R i boz ym e s a r e a us e f ul t ool f o r s pe c i f i c m R N A de gr a da t i on a nd of f e r m a ny a dva nt a ge s i n t he i r s i m pl i c i t y. T he r e s e a r c h pr e s e nt e d i n t h i s t he s i s i nc l ude s c a r e f ul a na l ys i s of t he B T B R P ah e n u 2 m ous e m ode l i n v i t r o e xpe r i m e nt s de f i ni ng m ut a n t a nd nor m a l P A H p r ot e i n i nt e r a c t i ons a nd va r i ous r A A V de r i ve d ge ne t he r a py e xpe r i m e nt a l r e s ul t s f or t he t r e a t m e nt of phe nyl ke t onur i a G e ne r a l phys i ol ogi c a l obs e r va t i ons of t he B T B R P ah e n u 2 m ous e m ode l a l ong w i t h c a r e f ul m ol e c ul a r a na l ys i s of P A H i n t h e m i c e a r e r e po r t e d i n or de r t o p r ovi de f ur t he r i ns i ght i nt o t he di s e a s e s t a t us i n t he m ode l F r om t he obs e r va t i ons m a de i n m ous e l i ve r s t he i n t e r a c t i on be t w e e n nor m a l a nd m u t a nt pr ot e i n s ubuni t s of P A H w a s f ur t he r e va l ua t e d i n c e l l c ul t ur e a nd de t e r m i ne d t o l e a d t o dom i na nt ne ga t i ve i nt e r f e r e nc e T he de ve l opm e nt of a ha m m e r he a d r i boz ym e d i r e c t e d a ga i ns t m ous e P A H t o p r e ve nt t he dom i na nt ne ga t i ve i nt e r f e r e nc e i s de t a i l e d a l ong w i t h i t s e va l ua t i on i n c e l l c ul t u r e a nd i n v i v o F i na l l y t he c ons t r uc t i on of a nove l ve c t o r c a r r yi ng bot h t he m ous e P A H ge ne a nd t he r i boz ym e e xpr e s s e d f r om a m odi f i e d t R N A V a l pr om ot e r i s de s c r i be d a l ong w i t h i ni t i a l i n v i v o r e s ul t s i n m a l e m i c e T he f i ndi ngs r e por t e d i n t hi s r e s e a r c h c l e a r l y s how t ha t ge ne t he r a py f or P K U i s pos s i bl e but w he n t r e a t i ng pa t i e nt s w i t h m i s s e ns e m ut a t i ons t he p r e ve nt i on of a n i nt e r a c t i on be t w e e n nor m a l a nd m ut a nt p r ot e i n s ubuni t s m a y be ne c e s s a r y i n or de r f or t he ge ne t he r a py t o be s uc c e s s f ul a t l ow e r dos e s of r A A V M or e ove r t he da t a s how t he ne e d f o r c a r e f ul e va l u a t i on of m ous e m ode l s of bot h

PAGE 37

24 m i s s e ns e a nd nul l m ut a nt s w he n e va l ua t i ng t he po s s i bl e t r e a t m e nt of ge ne t i c di s e a s e s by ge ne t he r a py a nd t he c l i ni c a l r e l e va nc e t o hum a n p a t i e nt s

PAGE 38

25 F i gur e 1 1 P he nyl a l a ni ne c onve r s i on t o t y r os i ne T he e nz ym e P A H c onve r t s P he t o T y r us i ng B H 4 a nd oxyge n. B H 4 i s r e c yc l e d vi a a t w o s t e p pa t hw a y w hi c h ut i l i z e s N A D H

PAGE 39

26 F i gur e 1 2 H a m m e r he a d r i boz ym e s t r uc t ur e T he r i boz ym e i s a l i gne d t o i t s 12 nuc l e ot i de t a r ge t T he c l e a va ge r e a c t i on t a ke s pl a c e a f t e r t he X S t e m s 1 a nd I I I r e pr e s e nt t he hybr i di z i ng a r m s w he n bound t o t he t a r ge t R N A ; s t e m I I i s a ha i r pi n s t r uc t ur e w hi c h s t a bi l i z e s t he r i boz ym e s t r uc t ur e

PAGE 40

27 C H A P T E R 2 M A T E R I A L S A N D M E T H O D S T he r e s e a r c h pr e s e nt e d i n t h i s di s s e r t a t i on r e qui r e d t he us e of m a ny e xpe r i m e nt a l m e t hods T he y a r e de s c r i be d i n t hi s c ha pt e r i n de t a i l t o a l l ow ot he r r e s e a r c he r s t o us e t he e xpe r i m e nt s pr e s e nt e d. A ny s pe c i f i c m odi f i c a t i ons t o t he m e t hods a r e e xpl a i ne d w he r e r e l e va nt i n t he f ol l ow i ng c ha pt e r s I n V i t r o R i b oz ym e A n al ys i s F or t he s e e xpe r i m e nt s a l l e nz ym e s w e r e f r om P r o m e ga ( M a di s on, W I ) unl e s s ot he r w i s e i ndi c a t e d. R a di oa c t i ve nuc l e ot i de s w e r e or de r e d f r om A m e r s ha m B i os c i e nc e s ( P i s c a t a w a y, N J ) T he w a t e r us e d i n a l l of t he e xpe r i m e nt s w a s de i oni z e d, di s t i l l e d, pur i f i e d t h r ough i on e xc ha nge c hr om a t ogr a phy a n d a ut oc l a ve d. A l l ge l s f or r i boz ym e a na l ys i s w e r e 8 M ur e a a c r yl a m i de s e que nc i ng ge l s r un i n 1 X T B E buf f e r a nd pr e w a r m e d t o a ppr ox i m a t e l y 45 C p r i or t o l oa di ng t he s a m pl e s w hi c h w e r e he a t de na t ur e d a t 85 C f o r 3 m i nut e s f ol l ow e d by c hi l l i ng on i c e f or 3 m i nut e s T he ge l s w e r e f i xe d i n 40 % m e t ha nol 10 % a c e t i c a c i d a nd 3% g l yc e r ol f or 30 t o 45 m i nut e s a nd s ubs e que nt l y dr i e d a t 80 C unde r va c uum A l l of t he s e pr ot oc ol s w e r e de s c r i be d by F r i t z e t al 1 1 1 D e p r ot e c t i on of R N A O l i gos T he c hos e n r i boz ym e s e que nc e s a nd 12 nuc l e ot i de t a r ge t s w e r e or de r e d f r om D ha r m a c on, I nc ( L a f a ye t t e C O ) T he ol i gos w e r e r e s us pe nde d i n 100 l o f w a t e r U s i ng t he pr ovi de d de pr o t e c t i on T E M E D bu f f e r 20 l o f e a c h ol i go w a s di l ut e d t o 100 l w i t h t he buf f e r a nd i nc uba t e d a t 60 C f o r 30 m i nut e s T he r e a c t i on w a s s t oppe d by dr y i ng i n a

PAGE 41

28 S pe e dV a c ( S a va nt ) f o r 30 m i nut e s A s s um i ng 99% e f f i c i e nc y i n s ynt he s i s t he ol i gos w e r e r e s us pe nde d a t 200 pm ol e / l f or t he r i boz ym e s a nd a t 300 pm ol e / l f or t he t a r ge t s W or ki ng di l ut i ons w e r e pr e pa r e d: 2 pm ol e / l of r i boz ym e a nd 10 pm ol e / l of t a r ge t s S a m pl e s w e r e s t or e d a t 70 C unt i l f ur t he r us e T ar ge t E n d L ab e l l i n g T he t a r ge t s w e r e e nd l a be l e d w i t h # [ 3 2 P ] A T P t o a l l ow f or de t e c t i on of t he i n t a c t a nd c l e a ve d t a r ge t s on a pol ya c r yl a m i de s e que nc i ng gr a de ge l T w e nt y pi c om ol e s of t he t a r ge t w e r e a dde d t o 10 l of 1 X pol ynuc l e ot i de k i na s e buf f e r c ont a i ni ng 1 l o f R N a s i n $ R i bonuc l e a s e I nhi bi t or 1 l of 0 1 M D T T 1 l of pol ynuc l e ot i de ki na s e ( 5 t o 10 uni t s ) a nd 4 C i o f # [ 3 2 P ] A T P A f t e r i nc uba t i on a t 37 C f or 30 m i nut e s s i xt y f i ve m i c r ol i t e r s of w a t e r w e r e a dde d, a nd t he l a be l e d t a r ge t w a s e x t r a c t e d w i t h phe nol : c hl or of or m : i s oa m yl a l c ohol T hi s w a s pur i f i e d on a S e pha de x G 50 c ol um n ( U S A S c i e nt i f i c O c a l a F L ) T he l a be l e d t a r ge t c a n be s t or e d a t 20 C T i m e C ou r s e of C l e avage R e ac t i on s T he pur pos e of t he t i m e c our s e e xpe r i m e nt i s t o t e s t t he e f f i c i e nc y of t he r i boz ym e s a ga i ns t t he s hor t 12 nuc l e ot i de t a r ge t E xc e s s t a r ge t i s m i xe d 10: 1 w i t h t he r i boz ym e i n a s i ngl e l a r ge r e a c t i on f r om w h i c h t i m e d s a m pl e s a r e t a ke n a nd s ubs e que nt l y r un on a n 8 % ge l F i r s t t w o pi c om ol e s of t he r i boz ym e w or ki ng di l ut i on w a s m i xe d w i t h 88 l o f w a t e r a nd 13 l of 400 m M T r i s H C l T hi s w a s i nc uba t e d a t 65 C f o r 2 m i nut e s a nd l e f t a t r oom t e m pe r a t ur e f or 10 m i nut e s t o a l l ow f or pr op e r f ol di ng of t he r i boz ym e T hi r t e e n m i c r ol i t e r s of a 1: 10 di l ut i on of R N a s i n $ i n 0. 1 M D T T w a s a dde d w i t h 13 l of 200 m M M gC l 2 f or a 20 m M M gC l 2 f i na l c onc e nt r a t i on T h i s c onc e nt r a t i on i s us e d f or a l l f i r s t t i m e c our s e e xpe r i m e nt s w i t h ne w r i boz ym e s T he r e a c t i on w a s t he n i nc uba t e d a t 37 C

PAGE 42

29 f or 10 m i nut e s P r e pa r e d t ube s e a c h w i t h 20 l of R N A f or m a m i de buf f e r ( 90% f or m a m i de s upe r pur e gr a de 50 m M E D T A pH 8. 0, 0 05% b r om ophe nol bl ue 0 05% xyl e ne c ya nol ) w e r e pl a c e d on i c e a t t hi s t i m e a nd w e r e l a be l e d f or t he de s i r e d t i m e poi nt s t ypi c a l l y 0 0 5, 1, 2, 4, 8, 16, 32, 64, a nd 1 28 m i nut e s T w o m i c r o l i t e r s of unl a be l e d t a r ge t f r om t he w or ki ng d i l ut i on o r 20 p m ol e s a nd 2 l o f e nd l a be l e d t a r ge t w e r e a dde d i n t ha t or de r t o t he r e a c t i on. I m m e di a t e l y a f t e r a ddi ng t he ho t t a r ge t 10 l of t he r e a c t i on w a s r e m ove d a nd a dde d t o t he pr e pa r e d t ube l a be l e d 0 T hi s w a s r e pe a t e d f or e a c h t i m e poi nt T he s a m pl e s c a n be s t or e d a t 20 C S i x m i c r ol i t e r s of e a c h t i m e d s a m pl e w a s e l e c t r oph or e s e d on a n 8% ge l a t 40 m V unt i l t he b r om ophe nol bl ue w a s a ppr oxi m a t e l y 2/ 3 dow n. O nc e f i xe d a nd dr i e d i t w a s e xpos e d t o a phos phor e s c e nt s c r e e n ove r ni ght a nd s c a nne d w i t h a P hos hor I m a ge r ( M ol e c ul a r D yna m i c s S unnyva l e C A ) f or a na l ys i s T he pe r c e nt o f c l e a ve d t a r ge t a t e a c h t i m e poi nt w a s c a l c ul a t e d f r om t he i nt e ns i t y of t he pr oduc t ba nd ove r t he t ot a l i nt e ns i t y o f t he pr oduc t a nd t he i n t a c t t a r ge t I n V i t r o T r an s c r i p t i on A l i ne a r i z e d a nd pu r i f i e d pG E M T m P A H pl a s m i d w a s us e d t o c r e a t e f ul l l e ngt h m P A H t r a ns c r i pt s w i t h T 7 R N A P ol ym e r a s e T he r e a c t i on w a s s e t up i n 20 l a s f ol l ow s : 4 l o f 5 X pol ym e r a s e buf f e r 2 l 100 m M D T T 1 l R N a s i n $ ( 40 uni t s ) 1 l of a s ol ut i on of 20 m M e a c h A T P C T P a nd G T P 1 l 4 m M U T P 2 l l i ne a r i z e d pG E M T m P A H ( 100 ng ) 2 l o r 20 C i of [ 3 2 P ] U T P a nd 6 l of w a t e r O ne m i c r ol i t e r o f T 7 R N A pol ym e r a s e or 20 un i t s w a s a dde d l a s t T he r e a c t i on w a s i nc uba t e d a t 37 C f or 2 hour s F or t y m i c r o l i t e r s of w a t e r w a s a dde d t o t he r e a c t i on a nd w a s e xt r a c t e d w i t h 100 l of phe nol : c hl or of o r m : i s oa m yl a l c ohol T he a que ou s l a ye r w a s t he n pur i f i e d on a G 50

PAGE 43

30 column, and 1 l of the eluate was checked in a scintillation counter to calculate the concentration of the labeled transcript. Full Length Transcript Cleavage Reaction The full length transcript was incubated with the ribozyme at 37 C to determine if the cleavage site is accessible when the entire mRNA sequence is present. The reaction was set up with the desired ratio of ribozyme to target and magnesium concentration. For ribozyme I209, the experiment was set up in 30 l as follows: 3 l 400 mM Tris, 2 l or 6 picomoles of ribozyme, 10 l or 1.5 picomoles of label ed transcript, 3 l of 200 mM MgCl 2 3 l of a 1:10 dilution of RNasin $ in 0.1 M DTT and 9 l of water. Samples were taken at time 0, 1 and 2 hours. A 5% acrylamide gel was needed to separate the anticipated cleavage products of 862 and 660 bases. The gel was not fixed but dried and exposed to a phosphorescent screen overnight. Multiple Turnover Kinetic Analysis The kinetic properties of the ribozyme are calculated with the Michaelis Menten equation from a series of duplicate cleavage reactions set up with increasing ratios of target to ribozyme. By increasing the ratio from 1:40 to 1:1000, saturation of the ribozyme is achieved thus the cleavage reaction becomes the rate limiting step in the experiment. The series of duplicate reaction is shown in Table 2 1. Each reaction was set up as in the time course of cleavage reaction by adding the items in order and incubating at 65 C for 2 minutes and 10 minutes at room temperature after the ribozyme addition. The RNasin $ and the magnesium chloride were then added and the tubes were placed at 37 C for a minimum of 10 minutes. The 30pmole/ l target mixture contained 15 l of end labeled target, 15 l of 300 pmole/ l target stock and 120 l of water. A 3 pmole/ l

PAGE 44

31 di l ut i on w a s ne e de d t o s e t up t he l ow e r m ol a r r a t i o s of R z t o t a r ge t T he ne c e s s a r y a m ount of t a r ge t m i xt u r e w a s a dde d t o e a c h t ube i n a s t a gge r e d f a s hi on by w a i t i ng 15 t o 30 s e c onds be t w e e n e a c h a ddi t i on. T he t i m e s e l e c t e d t o s t op e a c h r e a c t i on w a s pr e de t e r m i ne d i n a t i m e c our s e e xpe r i m e nt a nd a l l ow e d t he r e a c t i on t o go t o 10 t o 20 % o f m a xi m um c l e a va ge T he r e a c t i ons w e r e s t oppe d b y t he a ddi t i on of 20 l of R N A s t op buf f e r a nd pl a c e d on i c e T a bl e 2 1 M ul t i pl e t ur nove r k i ne t i c a na l ys i s r e a c t i on s e t up. T u b es H 2 O 4 0 0 m M T ri s H Cl Ri b o zy me (0 3 p mo l / l ) 1 : 1 0 R N as i n 5 0 m M Mg Cl 2 T a rg et T a rg et s o l u t i o n u s ed Mo l ar rat i o R z: t arg et 1 1 1 1 4 2 0 1 2 1 3 p m/ l 2 1 2 1 0 2 1 1 2 4 3 p m/ l 1 : 4 0 3 1 3 8 2 1 1 2 6 3 p m/ l 1 : 6 0 4 1 4 6 2 1 1 2 8 3 p m/ l 1 : 8 0 5 1 5 1 3 2 1 1 2 1 3 0 p m/ l 1 : 1 0 0 6 1 6 1 2 2 1 1 2 2 3 0 p m/ l 1 : 2 0 0 7 1 7 1 0 2 1 1 2 4 3 0 p m/ l 1 : 4 0 0 8 1 8 8 2 1 1 2 6 3 0 p m/ l 1 : 6 0 0 9 1 9 6 2 1 1 2 8 3 0 p m/ l 1 : 8 0 0 1 0 2 0 4 2 1 1 2 1 0 3 0 p m/ l 1 : 1 0 0 0 E a c h s a m pl e w a s e l e c t r ophor e s e d on a n 8% ge l a n d e xp os e d t o a phos phor e s c e nt s c r e e n f or a na l ys i s I n or de r t o a na l yz e t he r e s ul t s a c a l i br a t i on c ur ve w a s a l s o ge ne r a t e d f r om a s e r i e s of t a r ge t s a m pl e s hybr i di z e d t o H ybo nd T M N + ( A m e r s ha m B i os c i e nc e s ) m e m br a ne us i ng a s l ot bl o t a ppa r a t us E a c h s a m pl e c ont a i n e d a know n a m ount of e nd l a be l e d t a r ge t f r om 0 t o 100 pi c om ol e s o f t a r ge t a l l ow i ng f or t he i n t e ns i t y of e a c h ba nd t o be c or r e l a t e d t o t he c onc e nt r a t i on of t a r ge t t hr ou gh a s i m pl e l i ne a r r e gr e s s i on. T he e qua t i on of t hi s l i ne w a s us e d t o c a l c ul a t e t he c onc e nt r a t i on of c l e a ve d t a r ge t i n e a c h of t he dupl i c a t e r e a c t i ons A s a t ur a t i on c ur ve w a s ge ne r a t e d f r om pl ot t i ng t he c l e a ve d t a r ge t c onc e nt r a t i on di vi de d by t he t i m e of t he r e a c t i on v e r s us t he i nput t e d t ot a l t a r ge t I f s a t ur a t i on i s not obt a i ne d hi ghe r c onc e nt r a t i ons of t a r ge t s houl d be s e t up i n a ne w

PAGE 45

32 e xpe r i m e nt A L i ne w e a ve r B ur k p l ot w a s c r e a t e d by gr a phi ng 1/ v ve r s us 1/ S : v i s t he ve l oc i t y or c l e a ve d t a r ge t ( nM / m i nut e ) a nd S i s t h e t ot a l i nput s ubs t r a t e c onc e nt r a t i on ( nM ) T he e qua t i on o f t he l i ne w a s u s e d t o de t e r m i ne V m a x K m a nd k c a t V m a x i s t he a bs ol ut e va l ue of 1/ Y w he n X i s 0; K m i s t he a bs ol ut e va l ue of 1/ X w he n Y i s 0; k c a t i s V m a x di vi de d by t he c onc e nt r a t i on of r i boz ym e us e d i n t he e xpe r i m e nt 15 nM M ol e c u l ar C l on i n g P r ot oc ol s M ol e c ul a r c l on i ng pr ot oc ol s us e d i n t hi s s t udy f ol l ow e d m a nuf a c t ur e r s r e c om m e nda t i ons f or e a c h e nz ym e o r c om pone nt us e d. E nz ym e s w e r e f r om N e w E ngl a nd B i oL a bs ( B e ve r l y M A ) un l e s s ot he r w i s e i ndi c a t e d. O t he r ge ne r a l pr ot oc ol s w e r e a da pt e d f r om M ol e c ul a r C l oni ng: A L a bor a t o r y M a nua l 1 1 2 C l on i n g of R i b oz ym e V e c t or s R i boz ym e I 209 a nd i t s t w o nul l de r i va t i ve s w e r e c l one d i nt o t he ve c t o r p21 ne w hp w hi c h i s ba s e d on pT R U F 12 T he r e s t r i c t i on s i t e s a t t he c l oni ng s i t e a r e H i nd I I I a nd S pe I a nd t he r i boz ym e s w e r e o r de r e d a s D N A ol i gos i nc l udi ng t he c or r e c t r e s t r i c t i on s i t e ba s e s f r om S i gm a G e nos ys ( T he W oodl a nds T X ) T he ol i gos w e r e ge l pur i f i e d, a nne a l e d a nd l i ga t e d i nt o t he di ge s t e d p21 ne w hp ve c t o r S u r e $ C e l l s ( S t r a t a ge ne L a J ol l a C A ) w e r e us e d f or t r a ns f or m a t i ons t o e ns ur e I T R r e t e nt i on. C l one s of e a c h r i boz ym e w e r e s e que nc e d a nd s e l e c t e d ba s e d on I T R r e t e nt i on by S m a I d i ge s t s T he R z I 209 pl a s m i d w a s r e na m e d C B R z I 209 ( F i gur e 5 6) T he r i boz ym e I 209 ve c t or us e d f o r pa c ka gi ng f o r a ni m a l e xpe r i m e nt s w a s m odi f i e d f r om t he or i gi na l C B R z I 209 ve c t or T he P Y F 441 e nha nc e r t he H S V t hym i di ne ki na s e pr om ot e r a nd t he ne om yc i n c a s s e t t e w e r e r e m ove d f r om t he ve c t or by S a l I di ge s t i on a nd r e l i ga t i on be c a us e t he ne om yc i n c a s s e t t e c ont a i ns c r ypt i c s pl i c e s i t e s w hi c h c oul d

PAGE 46

33 interference with gene expression if integrated into the genome. 113 This plasmid was named CB RzI209 ( Neo). Construction of CB mPAH F263S The plasmid vector CB mPAH was created from p43 hAAT developed by Loiler and Flotte at the University of Florida. Directed mutagenesis of mPAH was achieved using syntheti c DNA oligonucleotides as PCR primers. The 5 primer contained the desired base changes to change phenylalanine 263 to a serine and started at a unique restriction site, Xho I, to allow quick cloning of the mutagenized cassette ( Table 2 2). The PCR reacti on was set up using EasyStart TM PCR Mix in a tube (Molecular BioProducts, San Diego, CA). The 132 base pair PCR product was gel purified and ligated into pGEM $ T (Promega). After bacterial transformations into XL1 Blue MRF cells (Stratagene) and sequenci ng of the obtained clones, the fragment was cut from pGEM $ T with Xho I and Hind III, gel purified and ligated into pGEM T mPAH. The mutated gene, mPAH F263S, was moved from pGEM T to the CB backbone released from an EcoR I and Not I digest. Bacterial tra nsformations into Sure $ cells was followed by sequencing of clones obtained. Large DNA preparations were performed with Qiagens Plasmid Giga Kit. Construction of CB mPAH Hd The same strategy used for the construction of CB mPAH F263S was used to change t he CB mPAH plasmid to a resistant sequence to the RzI209. PCR mutagenesis was utilized to introduce silent base changes around the sequence for Isoleucine 209. The 5 primer again contained the necessary base changes, and started at a unique restriction si te, Stu I ( Table 2 3). After gel purification of the 322 base pair product, it was ligated

PAGE 47

34 T a bl e 2 2 P C R m ut a ge ne s i s pr i m e r s f or m P A H F 263S c ons t r uc t i on. Seq u en c e a 5 R es t ri ct i o n Si t e 3 R es t ri ct i o n Si t e N o r mal Pro t ei n cD N A 5 Pri mer F2 6 3 S Pro t ei n 5 G S C G S TT R G A D AT F T C L TG G G T G GG L G G A GG F T C R G A V CC F T C H AC C 5 G TC GT CT CG AG AT TT CT TG GG TG GC CT GG CC TT C CG AG TC TT C C AC TG C 3 5 G TC GT CT CG AG AT TT C C TG GG TG GC CT GG CC TT C CG AG TC T C CC AC TG C 3 5 G S C G S TT R G A D AT F T C L TG G G T G GG L G G A GG F T C R G A V CC S T C H AC C X h o I (C |T CG AG ) 3 Pri mer 5 T GG GC AA AG CT TC T A TC TG AA AA C 3 H i n d I II (A |A GC TT ) a Seq u en c e o f t h e o l i g o s ar e i n d i cat ed w i t h d es i g n at ed b as e an d a mi n o aci d ch an g es i n b o l d O n l y t h e 5 p ri mer co n t ai n ed ch an g es

PAGE 48

35 T a bl e 2 3 P C R m ut a ge ne s i s pr i m e r s f or m P A H H d c ons t r uc t i on. Seq u en c e a 5 R es t ri ct i o n Si t e 3 R es t ri ct i o n Si t e mP A H c D N A 5 Pri mer 5 T GA AG GC CT TG TA TA AA AC AC AT GC CT GC TA CG A GC AC AA CC AC AT C T TC CC TC TT C 3 5 T GA AG GC CT TG TA TA AA AC AC AT GC CT GC TA CG A GC AC AA CC A T AT T T T T CC TC TT C 3 St u I (A GG |C CT ) 3 Pri mer 5 T GG GC AA AG CT TC TA TC TG AA AA C 3 H i n d I II (A |A GC TT ) a Seq u en c es o f t h e o l i g o s are i n d i cat ed w i t h d es i g n at ed b as e ch an g es i n b o l d an d cl e av ag e s i t e u n d erl i n ed O n l y t h e 5 p ri me r co n t ai n ed ch an g es

PAGE 49

36 into pGEM T, moved to pGEM T mPAH and the entire mutagenized gene, mPAH Hd, cloned into the CB backbone to crea te CB mPAH Hd. The mPAH Hd cassette was also cloned into the CB WPRE backbone released from an EcoR I and Not I digest. Sequencing of pGEM T with the PCR insert and the final vector constructs was done, and the CB mPAH Hd and CB mPAH Hd WPRE plasmids were selected based on ITR retention. XLI Blue MRF cells were used for all pGEM T transformations, and Sure cells were used for all plasmids containing ITR sequences. Construction of tRNA RzI209 The tRNA RzI209 cassettewas designed in order to conserve nece ssary folding properties for the tRNA sequence and to allow the ribozymes hybridizing arms to reach their target sequence. From the necessary sequence a multi step strategy was devised to construct the 200 base pair cassette. Two restriction sites each ab out one third from the ends of the cassette were selected for cloning the cassette in three sets of oligos. The plasmid pGEM 3Zf(+) (Promega) was modified with a new elongated multiple cloning site to allow for the sequential cloning of the tRNA cassette ( Table 2 4). The modified pGEM 3Zf(+) was renamed pGEM 3Zf(+) MCS2. Each oligo set for the tRNA cassette was ordered from Sigma Genosys and gel purified prior to annealing and ligation into pGEM 3Zf(+) MCS2 ( Table 2 5). LyoComp GT116 cells (InvivoGen, San Diego, CA) were used for each cloning step, and blue white screening was utilized to help select properly ligated clones. A positive digest screen was used if possible at each cloning step. Once the full cassette was cloned into pGEM 3Zf(+), it was seque nced prior to cloning into the CB mPAH Hd plasmid. The cassette was introduced after the

PAGE 50

37 T a bl e 2 4 O l i gos f or t R N A R z I 209 c ons t r uc t i on. p G E M 3 Z f( + ) MC S2 Seq u en c e a Res t ri ct i o n Si t es Mu l t i p l e Cl o n i n g Si t e Kp nI B am HI Sa lI Ec oR I Av aI Ps tI H in dI II GA AT TC GA GC T CG GT AC CC G GG GA TC CT CT A GA G TC GA CC T GC AG GC AT G CA AG CT T CT TA AG CT CG A GC CA TG GG C CC CT AG GA GA T CT C AG CT GG A CG TC CG TA C GT TC GA A Mo d i fi ed Res t ri ct i o n Si t es Mo d i fi ed Mu l t i p l e Cl o n i n g Si t e C sp 45 I B am HI S al I Ec oR I Kp nI A va I Ec oR V Ps tI Hi n dI II GA AT TC GA GC T CG GT AC CT T CG AA CC CG GG G AT C CT CT AG A GA TA TC GT C GA CC TG CA GG C AT GC AA G CT T CT TA AG CT CG A GC CA TG GA A GC TT GG GC CC C TA G GA GA TC T CT AT AG CA G CT GG AC GT CC G TA CG TT C GA A MC S2 s en s e o l i g o MC S2 an t i s en s e o l i g o 5 CT TC GA AC CC GG GG AT CC TC TA GA TA TC G3 5 TC GA CG TT AT CT AG AG GA TC CC CG GG TT CG AA GG T AC 3 t RN A R zI2 0 9 cas s et t e b Seq u en c e a Res t ri ct i o n Si t es Seq u en c e E c oR I Cl aI Sa u9 6I Cs p4 5I 5 GA AT TC AT CG AT AC AG TT GG TT TA AG TA GT GT AG T GG T T AT CA CG TT CG CC TG AC AC G C GA AA GG TC CC CG G TT CG AA F ok I E co RV AC CG GG CA CT AC AA AA AC CA AC AG GG AA CT GA TG AG C GC T T CG GC GC GA AA TG TG GA TG G G AT AT C la I H i nd II I CA AA AA AA AA AA AA AA AA AA AA AA AA AA AA AA AA AA A AA A A AA AA AA AA AA AA AA AA AA A A TT TT TA TC GA TA A GC TT 3 O l i g o S et 1 Sen s e O l i g o S et 1 A n t i s en s e 5' AA TT CA TC GA TA CA GT TG GT TT AA GT AG TG TA GT G GT T A TC AC GT TC GC CT GA CA CG C G AA AG G T CC CC GG T T3 5' CG AA CC GG GG AC CT TT CG CG TG TC AG GC GA AC GT G AT A A CC AC TA CA CT AC TT AA AC C A AC TG TA TC GA TG 3 O l i g o S et 2 Sen s e O l i g o S et 2 A n t i s en s e 5' CG AA AC CG GG CA CT AC AA AA AC CA AC AG GG AA CT G AT G A GC GC TT CG GC GC GA AA TG T G GA TG GG AT 3' 5' AT CC CA TC CA CA TT TC GC GC CG AA GC GC TC AT CA G TT C C CT GT TG GT TT TT GT AG TG CC CG GT TT 3' O l i g o S et 3 Sen s e O l i g o S et 3 A n t i s en s e 5' AT CA AA AA AA AA AA AA AA AA AA AA AA AA AA AA AA A AA A A AA AA AA AA AA AA AA AA AA A A AA AA TT TT TA TC G AT A3 5' AG CT TA TC GA TA AA AA TT TT TT TT TT TT TT TT TT T TT T T TT TT TT TT TT TT TT TT TT T T TT TT TT TT TT TT T TT TT GA T 3' a Mo d i fi cat i o n s t o M CS2 an d ch eck d i g es t s are i n d i cat e d i n b o l d b T h e t R N A s eq u en ce w as ad d ed i n t h r ee o l i g o s et s : s et 1 i s fro m E co RI t o Cs p 4 5 I, s et 2 Cs p 4 5 I t o E co R V an d s et 3 E co R V t o H i n d III

PAGE 51

38 S V 40 pol yA s e que nc e a t t he C l a I s i t e a nd s c r e e ne d f or pr ope r or i e nt a t i on by r e s t r i c t i on di ge s t T hi s c l one w a s a l s o s e que nc e d. C e l l C u l t u r e P r ot oc ol s H E K 293 a nd a l l 293T c e l l s w e r e c ul t u r e d i n D ube l c o s M odi f i e d E a gl e M e di a c ont a i ni ng 25 m M gl uc os e 4 m M L gl ut a m i ne a n d 0. 04 m M phe nol r e d T he s e w e r e pa s s a ge d on a w e e kl y ba s i s w i t h 0. 25% t r y ps i n a n d us e d f or t r a ns i e nt c e l l t r a ns f e c t i ons of va r i ous pl a s m i d D N A T r an s i e n t C e l l T r an s f e c t i on w i t h C aP O 4 T r a ns i e nt c e l l t r a ns f e c t i ons of H E K 293 c e l l s w e r e done i n 6 w e l l pl a t e s ( 9 6 c m 2 pe r w e l l ) w i t h 80% c onf l ue nt c e l l s pa s s a ge d 24 hour s e a r l i e r T he de s i r e d D N A a m ount s w e r e m i xe d i n w a t e r a nd 300 l of 2. 5 M C a C l 2 w a s a dde d t o a f i na l vol um e o f 3 0 m l T hi s s ol ut i on w a s a dde d dr opw i s e t o 3. 0 m l o f 2 X H B S S ( H a nk s bu f f e r e d s a l t s ol ut i on) w hi l e vor t e xi ng l i ght l y. A f t e r a 15 m i nut e i nc uba t i on, i t w a s s e pa r a t e d i nt o f ou r w e l l s of t he 6 w e l l pl a t e a nd a dde d di r e c t l y t o t he c om pl e t e m e di a F our hou r s l a t e r t he m e di a w a s c ha nge d t o f r e s h c om pl e t e m e di a C e l l s w e r e ha r ve s t e d a f t e r 48 t o 72 hour s by r e m ovi ng t he m e di a w a s hi ng w i t h P B S a nd s c r a pi ng i n 1 0 m l of P B S pe r w e l l O f f our w e l l s 3 w e r e c ol l e c t e d t oge t he r i n P B S a nd one w a s c ol l e c t e d us i ng 1. 0 m l o f T R I z ol R e a ge nt i ns t e a d of P B S T he 3. 0 m l o f c e l l s w e r e c e nt r i f uge d a t 1000 r pm a nd r e s us pe nde d i n 0. 5 m l of hom oge ni z a t i on buf f e r : 1 5 m l 1 M K C l 8 5 m l H 2 O a nd 0 5 l of m e r c a pt oe t ha nol T he c e l l s w e r e hom oge ni z e d i n a gl a s s hom oge ni z e r a nd t hi s w a s r i ns e d w i t h 0. 5 m l o f bu f f e r a nd a dde d t o t he hom oge na t e s a ve d i nt o a f r e s h t ube T he l ys a t e w a s obt a i ne d by c e nt r i f uga t i on a t 14 000 r pm a t 4 C

PAGE 52

39 T r an s i e n t T r an s f e c t i on s u s i n g S u p e r f e c t 293T c e l l s w e r e obt a i ne d f r om D r C ha ng s l a bor a t or y. H i s l a b c ons t r uc t e d a s t a bl y i nt e gr a t e d 293T c e l l l i ne v i a a l e nt i vi r us s ys t e m c ont a i ni ng pT Y F m P A H a nd na m e d 293T T Y F m P A H T he l e nt i vi r us pl a s m i d w a s c on s t r uc t e d u s i ng our l a b s m P A H c a s s e t t e f r om C B m P A H T he s e c e l l s w e r e us e d f o r s i R N A t r a ns f e c t i ons us i ng S upe r F e c t ( Q i a ge n) C e l l s w e r e pa s s e d i nt o a 6 w e l l pl a t e 24 hour s pr i or t o t r a ns c r i pt i on a t a c onc e nt r a t i on 4x10 5 c e l l s pe r w e l l S e ve nt y f i ve m i c r ol i t e r s of D M E M w a s m i xe d w i t h 3. 5 g of D N A a t a m i ni m um 1 g/ l c onc e nt r a t i o n. A f t e r vor t e xi ng 7 l of S upe r F e c t w a s a dde d t o t he c e nt e r o f t he D M E M / D N A s ol ut i on, m i xe d up a nd dow n f i ve t i m e s a nd i nc uba t e d a t r oom t e m pe r a t ur e f or 7 t o 12 m i nu t e s T he m i xt ur e w a s t h e n a dde d dr opw i s e t o one w e l l o f c e l l s c ont a i ni ng 0. 6 m l f r e s h c om pl e t e m e di a A f t e r 6 hour s t he m e di a w a s c ha nge d t o 2 m l of c om pl e t e m e di a C e l l s w e r e ha r ve s t e d 48 hour s a f t e r t r a ns f e c t i on w i t h 1. 0 m l T R I z ol R e a ge nt a nd s t or e d a t 20 C unt i l R N A e xt r a c t i ons P h e n yl al an i n e H yd r oxyl as e A c t i vi t y A s s ay T he P A H a c t i vi t y a s s a y i s ba s e d on t he r e duc t i on o f N A D H t o N A D i n t he r e c yc l i ng pa t hw a y of B H 4 ( F i gur e 1 1) C e l l t r a ns f e c t i on or t i s s ue s a m pl e s a r e s e t up t w i c e : one r e a c t i on w i t hout phe nyl a l a ni ne a nd one w i t h phe nyl a l a ni ne t hus t he a s s a y m e a s ur e s t he phe nyl a l a ni ne l i nke d r e duc t i on of N A D H a t 340 nm F ou r s a m pl e s a r e r un i n one a s s a y w i t h t he 8 s a m pl e hol de r o f t he G e ne s ys 5 U V V i s s pe c t r ophot om e t e r ( T he r m o E l e c t r on C or por a t i on C a m br i dge U K ) T he r e a c t i on s w e r e s e t up i n 1m l t ot a l vol um e w i t h 100 l of c e l l l ys a t e or 20 l of t i s s ue hom oge na t e E a c h s a m pl e i nc l ude d t he f ol l ow i ng: 0. 10 M pot a s s i um phos pha t e buf f e r pH 6. 8 0 25 U c a t a l a s e 0. 10 m U D H P R 0. 04 m M 6 M e t hyl 5 6, 7 8 t e t r a hyd r opt e r i ne ( 6 M P H 4 ) 0 2 m M N A D H a nd 1 m M P he i f i nc l ude d. B ot h N A D H a nd 6 M P H 4 w e r e a dde d l a s t a nd t he r e a c t i ons

PAGE 53

40 de c r e a s e i n a bs or ba nc e a t 340 nm w e r e r e c or de d e ve r y f i ve m i nut e s f or 30 m i nut e s A f t e r c a l c ul a t i ng t he pr ot e i n c onc e nt r a t i on of t he s a m pl e s t he P he l i nke d r e duc t i on of N A D H w a s c a l c ul a t e d a s s pe c i f i c a c t i vi t y i n uni t s / m g o f t o t a l pr ot e i n. P r ot e i n C on c e n t r at i on A s s ay T he pr ot e i n c onc e nt r a t i on a s s a y i s a m odi f i e d s hor t pr ot oc ol L ow r y a s s a y. S t a nda r ds w e r e s e t up w i t h 10 X B S A ( N e w E ngl a nd B i oL a bs ) r a ngi ng f r o m 0 m g t o 100 m g of p r ot e i n. T ypi c a l l y 10 l of t i s s ue hom oge na t e a nd 20 l of c e l l l ys a t e w e r e d i l ut e d t o 100 l w i t h w a t e r f o r a na l ys i s S i x hundr e d m i c r ol i t e r s of c oppe r r e a ge nt ( 0. 6 m M N a 2 C uE D T A 0 2 M N a 2 C O 3 0 1 M N a O H ) w e r e a dde d t o t he p r ot e i n a nd i nc ub a t e d a t r oom t e m pe r a t ur e f or 10 m i nut e s S i x t y m i c r o l i t e r s of a 1: 1 di l u t i on o f F ol i n & C i oc a l t e u s phe nol r e a ge nt ( S i gm a ) i n w a t e r w e r e a dde d a nd a l l ow e d t o i nc uba t e f or 30 t o 45 m i nut e s a t r oo m t e m pe r a t u r e E a c h r e a c t i on a nd s t a nda r d i s s e t up i n dupl i c a t e a nd t he e nt i r e 760 l w a s r e a d a t 500 nm F r om t he a ve r a g e of t he dupl i c a t e s t a nda r ds a l i ne a r r e gr e s s i on w a s c a l c ul a t e d t o ge t a n e qua t i on o f t he l i ne us e d t o de t e r m i ne t he pr o t e i n c onc e nt r a t i on of t he e xpe r i m e nt a l s a m pl e s We s t e r n B l ot t i n g T he m ous e P A H a nt i body w a s r a i s e d a ga i ns t a 142 a m i no a c i d N t e r m i na l pe pt i de i n r a bbi t T he a nt i s e r a w a s us e d a t a 1: 1000 di l ut i o n i n T B S T w i t h 5 % m i l k. T i s s ue hom oge na t e or c e l l l ys a t e w e r e e l e c t r ophor e s e d on 12% a c r yl a m i de T r i s H C l ge l s w i t h a di s c ont i nuous bu f f e r s ys t e m c ont a i ni ng S D S T he pr ot e i n w a s t r a ns f e r r e d t o ni t r oc e l l ul os e m e m br a ne s bl oc ke d ove r n i ght a nd i nc uba t e d w i t h t w o p r i m a r y a nt i bodi e s : t he m ous e P A H a nt i s e r a a nd a r a bbi t po l yc l ona l a n t i body t o G A P D H ( A bc a m C a m br i dge U K ) a s a l oa di ng c ont r ol T he s e c onda r y a nt i body w a s ho r s e r a di s h pe r oxi da s e l i nke d a nd de ve l ope d a ga i ns t r a bbi t I g G i n donke y ( A m e r s ha m ) D e t e c t i on of

PAGE 54

41 s a m pl e s w a s done w i t h E C L T M W e s t e r n B l ot t i ng D e t e c t i on R e a ge nt s ( A m e r s ha m ) a nd t he bl ot s w e r e e xpos e d t o K oda k X A R f i l m f or 0. 5 t o 4 m i nut e s L a s e r de ns i t om e t r y w a s us e d t o qua nt i f y t he i nt e ns i t y of t he ba nds N or t h e r n B l ot t i n g T i s s ue s a m pl e s s a ve d i n R N A l at e r ( A m bi on) w e r e pr oc e s s e d w i t h T R I z ol R e a ge nt T he t i s s ue s a ppr oxi m a t e l y 100 m g w e r e hom oge ni z e d w i t h a n e l e c t r i c t i s s ue hom oge ni z e r i n 1 5 m l of T R I z ol a nd t he m a nuf a c t ur e r s pr ot oc ol w a s f ol l ow e d f or R N A e xt r a c t i on. S a m pl e s w e r e r e s us pe nde d i n a n a ppr o pr i a t e vol um e o f nuc l e a s e f r e e w a t e r a nd s t or e d a t 70 C L e ve l s of r i bos om a l R N A w e r e a dj us t e d, a nd e l e c t r ophor e s e d on 2. 2 M f or m a l de hyde 1 X M ops e l e c t r ophor e s i s buf f e r a nd 1% a ga r os e ge l s T he R N A w a s t r a ns f e r r e d ove r ni ght i n 10 X S S C by upw a r d c a pi l l a r y t r a ns f e r t o a ne ut r a l nyl on m e m br a ne H ybond T M N ( A m e r s ha m ) A f t e r U V i r r a di a t i on, t he m e m br a ne w a s s t a i ne d br i e f l y w i t h e t hi di um br om i de f or R N A vi s ua l i z a t i on. P r obe l a be l i ng w a s a c c om pl i s he d w i t h t he R e di pr i m e T M I I s ys t e m ( A m e r s ha m ) H yb r i di z a t i on t o t he m P A H a nd hum a n c oppe r z i nc S upe r O xi de D i s m ut a s e ( C uZ nS O D ) c D N A pr obe s w a s done i n C hur c h buf f e r ove r ni ght a t 65 C A f t e r w a s hi ng t h r e e t i m e s i n 0. 2 X S S C t he m e m br a ne s w e r e e xpos e d t o K oda k X A R f i l m a t 70 C a nd us i ng v a r i ous t i m e d e xpos ur e s t he l e ve l s of P A H m R N A i n t he di f f e r e nt t i s s ue s w e r e c om pa r e d us i ng l a s e r de ns i t om e t r y. R e c om b i n an t A d e n o A s s oc i at e d V i r u s P ac k agi n g A l l pa c ka gi ng of ve c t or D N A w a s done by t he U ni ve r s i t y of F l or i da V e c t or C or e L a bor a t or y. T he onl y s e r ot ype us e d f or t he s e e xpe r i m e nt s w a s r A A V t ype 2, m a t c hi ng t he t ype 2 I T R s e que nc e s pr e s e nt i n our ve c t or p l a s m i ds L a r ge pr e pa r a t i ons of pl a s m i d D N A w a s done i n our l a bor a t or y us i ng Q i a ge n s P l a s m i d G i ga K i t A f t e r t e s t i ng t he

PAGE 55

42 D N A pr e pa r a t i on by r e s t r i c t i on d i ge s t a nd c e l l t r a ns f e c t i on f or t he P A H a c t i vi t y a s s a y, t he e nt i r e yi e l d w a s gi ve n t o t he V e c t or C or e L a bo r a t or y. O ur ve c t or D N A w a s t he n c o t r a ns f e c t e d i nt o H E K 293 c e l l s w i t h t he pD G pl a s m i d w hi c h c ont a i ns A A V s r e p a nd c ap ge ne s a l ong w i t h t he r e qui r e d a de novi r us ge ne s 1 1 4 A f t e r 48 hour s a c e l l pe l l e t w a s obt a i ne d, f r e e z e t ha w e d, a nd t he l ys a t e w a s s e pa r a t e d on a n i odi xona l s t e p gr a di e nt T he vi r us w a s pur i f i e d on a he pa r i n a f f i ni t y c ol um n a n d a f t e r c onc e nt r a t i on t he vi r us w a s t i t e r e d by qua nt i t a t i ve c om pe t i t i ve P C R a nd i nf e c t i ous c e nt e r a s s a y. A n i m al P r oc e d u r e s G r ow t h R at e A n al ys i s S e l e c t e d l i t t e r s w e r e c l os e l y f o l l ow e d f r om bi r t h f o r 56 da ys P ups f r om t he he t e r oz ygot e da m t o P ah e n u 2 m a l e m a t i ngs w e r e t a t t ooe d on t he i r pa w s w i t hi n t he f i r s t 6 da ys a f t e r bi r t h i n o r de r t o s pe c i f i c a l l y f ol l ow e a c h pup s gr ow t h r a t e a nd l a t e r s or t a c c or di ng t o ge not ype I ndi a i nk w a s i nj e c t e d w i t h a 36 ga uge ne e dl e i nt o t he pa w s of t he pups a f t e r c hi l l i ng t he m b r i e f l y on i c e A s e que nt i a l pa t t e r n f or e a c h pup w a s us e d: no t a t t oo, l e f t f r ont r i ght f r ont l e f t r e a r r i ght r e a r l e f t f r ont a nd l e f t r e a r e t c unt i l a l l doubl e c om bi na t i ons w e r e e xha us t e d i f ne c e s s a r y. P ups w e r e w e i ghe d e ve r y 3 t o 4 da ys f or 36 da ys t he n e ve r y w e e k unt i l da y 56 T he da t a w a s s or t e d by ge not ype a nd t he n by s e x w i t hi n e a c h ge not ype W e i ght s w e r e a ve r a ge d s t a nda r d de vi a t i ons w e r e c a l c ul a t e d a nd a l l da t a s e t s w e r e a na l yz e d by s t ude nt s t t e s t s a nd A N O V A B l ood C ol l e c t i on A ni m a l s w e r e bl e d w i t hout a ne s t he s i a i n a r ot a t i ng t a i l i nj e c t or ( B r a i nt r e e S c i e nt i f i c B r a i nt r e e M A ) B l ood s a m pl e s a ppr oxi m a t e l y 90 t o 110 l w e r e c ol l e c t e d i nt o he pa r i ni z e d c a pi l l a r y t ube s : t he t a i l s o f t he m i c e w e r e c ut w i t h ve t e r i na r y s c i s s or s a nd t he t a i l w a s m a s s a ge d t ow a r ds t he c ut t o c ol l e c t t he bl ood T he e nt i r e pr oc e dur e

PAGE 56

43 i nc l udi ng w e i ghi ng t he m ous e i f ne c e s s a r y t a ke s a ppr oxi m a t e l y f i ve t o s i x m i nut e s pe r m ous e T he c ont e nt of t he c a pi l l a r y t ube w a s t r a ns f e r r e d i nt o a 200 L t ube T hi s w a s s pun dow n a t 10, 000 g a nd t he s e r um w a s c ol l e c t e d i nt o a s e c ond t ube B ot h b l ood a nd s e r um s a m pl e s w e r e s t or e d a t 20 C un t i l f ur t he r u s e M i c e w e r e us ua l l y bl e d i n l a t e a f t e r noon on a w e e kl y ba s i s but c a n be bl e d m or e of t e n i f ne c e s s a r y. M i c r op l at e S e r u m P h e n yl al an i n e A s s ay T he phe nyl a l a ni ne a s s a y i s a m odi f i c a t i on of t he a s s a y de ve l ope d i n 1962 by M c C a m a n. 1 1 5 O nl y 7 5 l of s e r um i s ne e de d f or t r i pl i c a t e r e a di ngs E a c h s a m pl e w a s T C A pr e c i pi t a t e d, w i t h 11 2 l of 0. 3 N T C A a nd c hi l l e d on i c e f or 10 m i nut e s or s t or e d a t 20 C unt i l t he a s s a y w a s s e t up. U s i ng a P C R p l a t e f or 96 s a m pl e s 64 l o f c oc kt a i l w a s di s pe ns e d i nt o e a c h w e l l T he c oc kt a i l c ont a i n s 4. 40 m l 0. 3 M s uc c i na t e pH 5 8, 1. 76 m l of 30 m M ni nhyd r i n, a nd 0 880 m l 5 m M L l e uc yl L a l a ni ne S t a nda r ds w e r e pr e pa r e d f r om 10 m M phe nyl a l a ni ne i n 0 3 N T C A : 0 m M 0. 05 m M 0 10 m M 0 25 m M 0. 50 m M 0 75 m M 1 0 m M a nd 1. 25 m M E a c h s t a nda r d a nd s a m pl e w a s r un i n t r i pl i c a t e F our m i c r ol i t e r s o f e a c h s t a nda r d w a s a d de d t o t he a pp r opr i a t e w e l l s T he pr e c i pi t a t e d s e r um s a m pl e s w e r e s pun dow n a t 13, 000 r pm o r 16 000 g f o r 10 m i nut e s i n a m i c r oc e nt r i f uge F ou r m i c r ol i t e r s of e a c h s a m pl e i s a dde d t o t he w e l l s a nd t he pl a t e w a s c a ppe d pr i or t o pl a c i ng i n a t he r m oc yc l e r t o i n c uba t e t he s a m pl e s a t 60 C f or 2 hour s T w o hundr e d m i c r ol i t e r s o f c oppe r r e a ge nt i s a dde d t o e a c h w e l l o f a 96 w e l l 0 5 m l bl a c k f l uo r i m e t e r pl a t e ( N unc D e nm a r k) T he c oppe r r e a ge nt i s c om pos e d of 1. 6 g N a 2 C O 3 0. 065 g po t a s s i um s odi um t a r t r a t e 0. 060 g C uS O 4 5H 2 O e a c h di s s ol ve d i n a bout 300 m l H 2 O a nd a dde d t oge t he r t o br i ng up t o 1 l i t e r O ne hund r e d m i c r o l i t e r s w a s a dde d

PAGE 57

44 t o t he i nc uba t e d s a m pl e s i n t he P C R pl a t e a nd t he n t he e nt i r e vol um e w a s m ove d i n t o t he f l uor i m e t e r pl a t e T he P C R pl a t e w a s w a s he d w i t h a not he r 100 l of c oppe r r e a ge nt a nd a dde d t o t he f l uor i m e t e r pl a t e a s w e l l T he pl a t e w a s r e a d t w i c e on a n F L x800 M ul t i de t e c t i on M i c r o pl a t e R e a de r ( B i oT e k, W i noo s ki V T ) B ot h r e a di ngs w e r e a ve r a ge d t o c a l c ul a t e t he phe nyl a l a ni ne c onc e nt r a t i on i n e a c h s a m pl e F ood C on s u m p t i on M e as u r e m e n t F ood c ons um pt i on w a s c a l c ul a t e d a s a n a ve r a ge pe r da y pe r gr a m of m ous e M i c e w e r e ke pt i n s t a nda r d h ous i ng, t w o t h r e e or f our t o a c a ge s e pa r a t e d by s e x a nd ge not ype T he m i c e a nd t he f ood w e r e w e i ghe d on c e a w e e k w he n t he m i c e w e r e c ha nge d t o ne w c a ge s T he f i r s t w e e k onl y t he f oo d i n t he ne w c a ge w a s w e i ghe d by m ovi ng i t t o a w e i gh boa t A t t he s e c on d a nd s ubs e que nt t i m e poi nt s t he l e f t ove r f ood w a s w e i ghe d t o c a l c ul a t e t he f ood c ons um pt i on, a n d t he ne w f ood pl a c e d w i t h t he m i c e w a s w e i ghe d a s w e l l T hi s w a s r e pe a t e d f or t w o t o f our w e e ks a nd pe r f or m e d a t c ons i s t e nt t i m e s t o a l l ow c or r e c t pe r da y c a l c ul a t i ons P or t al V e i n I n j e c t i on s A l l m i c e s e l e c t e d f or ge ne t he r a py e xpe r i m e nt s w e r e bl e d 2 t o 3 t i m e s pr i o r t o t he por t a l ve i n i n j e c t i ons i n or de r t o obt a i n a ba s e l i ne s e r um phe nyl a l a ni ne c onc e nt r a t i on. A t t he t i m e of s ur ge r y, a l l m i c e w e r e t ypi c a l l y be t w e e n 10 t o 14 w e e ks ol d. A l l i ns t r um e nt s a nd s ol ut i ons w e r e s t e r i l i z e d by a ut oc l a vi ng pr i o r t o s ur ge r y. T he m i c e w e r e w e i ghe d a nd i nj e c t e d s ubc ut a ne ous l y w i t h B a yt r i l a nd B upr e ne x di l ut e d 1 t o 10 s e pa r a t e l y w i t h i nj e c t i on s a l i ne s ol ut i on. G e ne r a l a ne s t he s i a w a s a c c om pl i s he d w i t h i s of l ur a ne A f t e r c l e a ni ng t he ve nt r a l s ur f a c e a m i dl i ne a bdom i na l c ut w a s m a de a nd t he po r t a l ve i n w a s e xpos e d f or i nj e c t i on w i t h or w i t hout m ovi ng i nt e s t i ne s out s i de of t he body c a vi t y. U s i ng a 29 ga uge ne e dl e t he i nj e c t i on w a s m a de i n t o t he por t a l ve i n i n a n a ppr oxi m a t e vo l um e

PAGE 58

45 of 0. 3 c c A f t e r b l e e di ng w a s s t oppe d w i t h c ot t on t i ppe d a ppl i c a t or s 0 5 c c t o 1 c c o f p r e w a r m e d L R S s ol ut i on w a s a dde d i nt o t he body c a v i t y t o p r e ve nt a dhe s i ons T he a bdom i na l m us c l e w a l l w a s s e w n w i t h 4. 0 s i l k a nd t he out e r s ki n w a s s t a pl e d c l os e d. M i c e w e r e pl a c e d i n c l e a n w a r m c a ge s a nd m oni t o r e d f or 15 t o 30 m i nut e s be f or e be i ng t a ke n ba c k i nt o t he c ol ony. S t e r i l e pe a nut but t e r w a s gi ve n t o t he m i c e on a pi e c e of nor m a l c how t o m oni t or t he i r r e c ove r y on t he ne xt da y. C ot t a ge c he e s e or phe nyl a l a ni ne f r e e c hoc ol a t e c a n a l s o be gi ve n t o i nc r e a s e t he i r a ppe t i t e i f ne c e s s a r y. O nc e a da y f or t he f ol l ow i ng w e e k t he m i c e w e r e c he c ke d t o m a ke s ur e t he w ounds w e r e c l e a n a nd no s t a pl e s w e r e l os t T he s t a pl e s w e r e r e m ove d a w e e k a f t e r s ur ge r y a t w hi c h t i m e t he m i c e a r e bl e d f o r t he f i r s t t i m e poi nt P h e n yl al an i n e L oad i n g A phe nyl a l a ni ne s ol ut i on w a s pr e pa r e d i n 0. 9 % s a l i ne a nd f i l t e r e d s t e r i l i z e d t hr ough a s t e r i l e s yr i nge a nd a 0. 22 m f i l t e r T he pH of t he s ol u t i on w a s 7. 4 T he c onc e nt r a t i on of 26 4 m g / m l w a s de t e r m i ne d by s p e c t r ophot om e t r i c a na l ys i s O n t he da y of t he s t udy, e a c h a ni m a l w a s bl e d ( 0 hou r ) w e i gh e d a nd t he n i nj e c t e d s ubc ut a ne ous l y w i t h 0. 8 m g L P he pe r g r a m of body w e i ght T he v ol um e s i nj e c t e d t h us r a nge d f r om 1 0 t o 1. 5 m l pe r m ous e E a c h bl ood s a m pl e t a ke n w a s a ppr oxi m a t e l y 30 l T i m e d bl ood s a m pl e s w e r e obt a i ne d a t 1. 5 3 6 12 a nd 24 hour s S e r um w a s s e pa r a t e d by c e nt r i f uga t i on a nd t he P he c onc e nt r a t i ons de t e r m i n e d w i t h t he no r m a l f l uor i m e t r i c a s s a y a nd r e pe a t e d t hr e e t i m e s S ac r i f i c e an d T i s s u e C ol l e c t i on G e ne t he r a py t r e a t e d a ni m a l s w e r e s a c r i f i c e d w i t h a n ove r dos e of s odi um pe nt oba r bi t a l f ol l ow e d by c e r vi c a l di s l oc a t i on o r b r a i n pe r f us i on w i t h 4% pa r a f or m a l de hyde T he f o l l ow i ng t i s s ue s w e r e c ol l e c t e d ( pr i or t o pe r f us i on) : m us c l e

PAGE 59

46 ki dne y, s pl e e n, l ung l i ve r a nd t e s t e s a nd qui c k f r o z e n on dr y i c e a nd s t or e d a t 70 C I ns t r um e nt s us e d f or di s s e c t i on w e r e c l e a ne d be t w e e n e a c h t i s s ue w i t h D e c on E l i m i na s e D e c ont a m i na nt ( E a s t S us s e x, U K ) t o p r e ve nt D N A c r os s c ont a m i na t i on. A ppr ox i m a t e l y 100 m g of l i ve r w a s s a ve d i n 2 m l of R N A l at e r ( A m bi on, A us t i n, T X ) a nd pl a c e d on i c e t he n m ove d t o 20 C A l l ot he r t i s s ue s w e r e f i xe d i n 10% f or m a l i n f or ge ne r a l pa t hol ogi c a l e xa m i na t i on. L i ve r s e c t i ons s a v e d i n t i s s ue c a s s e t t e s w e r e s e nt t o t he P a t hol ogy C or e f o r pa r a f f i n e m be ddi ng a nd s e c t i o ni ng. T he s e w e r e pr oc e s s e d by de hydr a t i on w i t h g r a de d e t ha nol s ol ut i ons c l e a r e d w i t h xyl e ne a nd e m be dde d i n pa r a f f i n. F i ve m i c r on s e c t i ons m ount e d on gl a s s s l i de s w e r e hydr a t e d i n gr a de d a l c ohol s ol ut i ons s t a i ne d w i t h he m a t oxyl i n a nd c ount e r s t a i ne d w i t h e os i n. T he s e w e r e de hydr a t e d onc e a ga i n t o pl a c e a c ove r s l i p on t he s l i de us i ng P e r m o unt N or m a l a ni m a l s w e r e s a c r i f i c e d by C O 2 a s phyxi a t i on f ol l ow e d by c e r vi c a l di s l oc a t i on. N e c e s s a r y t i s s ue s a m pl e s w e r e r e m ove d a nd s a ve d by qui c k f r e e z i ng, i n R N A l at e r or a s t i s s ue hom oge na t e s A ppr oxi m a t e l y 100 m g of t i s s ue w a s hom oge ni z e d i n 2 m l hom oge ni z a t i on bu f f e r i n a gl a s s hom oge ni z e r T h i s w a s c e nt r i f uge d a t 16, 000 g f or 10 m i nut e s a t 4 C T he s upe r na t a nt w a s s a ve d a t 70 C or us e d i m m e di a t e l y f or P A H a c t i vi t y a s s a ys R N as e P r ot e c t i on A s s ays R N A s a m pl e s w e r e e xt r a c t e d w i t h T R I z ol R e a ge nt ( I nvi t r oge n) a nd pr ot oc ol P r obe s f or t he R N a s e P r ot e c t i on A s s a y ( R P A ) w e r e de s i gne d, P C R a m pl i f i e d f r om C B m P A H a nd c l one d i nt o pG E M T T he c l one s s e l e c t e d f or t r a ns c r i pt i on r e a c t i ons w e r e c he c ke d t o be i n t he c or r e c t o r i e nt a t i on f or T 7 R N A pol ym e r a s e t r a ns c r i pt i on, di ge s t e d w i t h N ot I a nd pu r i f i e d by phe nol : c hl or o f or m e xt r a c t i on. T r a ns c r i pt i on o f t he p r obe s w a s

PAGE 60

47 done us i ng A m bi on s M a xi S c r i pt I n v i t r o T r a ns c r i pt i on K i t P r obe s w e r e ge l pu r i f i e d a nd e l ut e d ove r ni ght F i f t e e n m i c r og r a m s of R N A f r om t he e xpe r i m e nt a l s a m pl e s w e r e s e t up w i t h C B m P A H s e ns e pr obe s a nt i s e ns e pr o be s a s ne ga t i ve c on t r ol s a nd A c t i n pr obe s a s l oa di ng c ont r ol s Y e a s t R N A 2. 5 g, w a s i nc l ude d w i t h a l l pr obe s w i t h o r w i t hout R N A s e a ddi t i on a s R N a s e e f f i c i e nc y c ont r ol s T he a s s a y w a s done us i ng A m bi on s R P A I I I T M K i t a nd p r ot oc ol T he s a m pl e s w e r e r un on 5% a c r yl a m i de 8 M ur e a 1 X T B E ge l s a nd e xpos e d t o f i l m a t 70 C f or va r i ous t i m e s t o de t e c t p r ot e c t e d R N A f r a gm e nt s L a s e r de ns i t om e t r y w a s done t o c a l c ul a t e r e l a t i ve l e ve l s of p r ot e c t e d R N A S ou t h e r n B l ot t i n g D N A w a s e xt r a c t e d f r om t i s s ue s a m pl e s i n t a i l buf f e r : 50 m M N a C l 25 m M E D T A 50 m M T r i s pH 8. 0 w i t h 50 l o f 10% S D S a nd 50 l of 10 m g/ m l pr o t e i na s e K O ne hundr e d m i l l i g r a m s of t i s s ue w a s i nc uba t e d i n 500 l of buf f e r ove r ni ght a t 55 C 2 l of 10 m g/ m l R N a s e A s ol ut i on w a s a dde d i n t he m or ni ng f or 1 hou r i nc uba t i on a t 55 C A que ous l a ye r s w e r e s ubs e que nt l y e xt r a c t e d w i t h t he f ol l ow i ng: 500 l phe nol f or 1 hour a t r oom t e m pe r a t ur e 500 l phe nol : c hl o r of or m f o r 30 m i nut e s a t r oom t e m pe r a t ur e a nd 500 l c hl or o f or m f or 2 m i nu t e s a t r oom t e m pe r a t ur e T he l a s t a que ous l a ye r w a s e t ha nol pr e c i pi t a t e d a nd r e s us pe nde d i n a n a ppr opr i a t e vol um e of T E pH 8 0. D N A s a m pl e qua l i t y w a s c he c ke d by i nc uba t i ng a t 37 C f or 1 hou r i n 1 X N E B r e s t r i c t i on buf f e r 3 a nd 1 X B S A t he n e l e c t r ophor e s e d on 1% a ga r os e ge l s a ga i ns t uni nc u ba t e d s a m pl e s T w e nt y m i c r og r a m s of D N A w a s di ge s t e d ove r ni ght T he di ge s t e d s a m pl e s w e r e r un on 0 8% a ga r os e 1 X T A E ge l s a t 5 V / c m f o r 5 hour s D N A w a s t r a ns f e r r e d by

PAGE 61

48 dow nw a r d c a pi l l a r y t r a ns f e r i n 10 X S S P E ont o B i oR a d Z e t a P r obe G T m e m b r a ne T he m e m br a ne w a s U V c r os s l i nke d a nd ba ke d f o r 30 m i nut e s a t 80 C C hur c h buf f e r w i t h a dde d s he a r e d s a l m on s pe r m D N A w a s us e d f or h ybr i di z a t i on a t 65 C P r e hybr i di z a t i on w a s done f or 4 hour s F i f t y na nogr a m s of ge l pu r i f i e d di ge s t e d D N A f r a gm e nt s w e r e l a be l e d w i t h R e di pr i m e I I a t r oom t e m pe r a t ur e T he pr obe s w e r e pur i f i e d on G 50 c ol um ns a nd ha l f o f t he p r obe s w e r e us e d i n 10m l of hybr i di z a t i on buf f e r f o r a 12x 14c m m e m br a ne W a s he s w e r e done a t 65 C f or a t ot a l o f 3 hou r s M e m br a ne s w e r e e xpos e d f or 48 hour s t o K o da k B i oM a x M S f i l m i n a T r a ns S c r e e n H E c a s s e t t e a t 70 C S ubs e que nt e xpos ur e s w e r e done a s ne c e s s a r y. L a s e r de ns i t om e t r y w a s us e d t o m e a s ur e ba nd i nt e ns i t i e s R N A I n t e r f e r e n c e P r ot oc ol s G e n e r at i on of s i R N A C as s e t t e s D N A ol i gos f or t he t h r e e de s i gne d s i R N A s w e r e or de r e d f r om S i g m a G e nos ys T he ol i gos w e r e ge l pur i f i e d a nd di l ut e d t o 10 M ba s e d on c onc e nt r a t i ons obt a i ne d f r om opt i c a l de ns i t y r e a di ngs A m bi on s Si l e nc e r T M E xpr e s s s i R N A E xpr e s s i on C a s s e t t e K i t w a s us e d f or ge ne r a t i ng e a c h c a s s e t t e c ont a i ni ng t h e hum a n U 6 p r om ot e r T he pr ovi de d G A P D H a nd ne ga t i ve c a s s e t t e c ont r ol s w e r e a l s o m a de T he P C R r e a c t i ons w e r e done i n a M a s t e r c yc l e r ( E ppe ndor f ) us i ng P l a t i num T aq ( I nvi t r oge n) a c c or di ng t o pr ovi de d pr ot oc ol s w i t h 50 C f or t he a nne a l i ng t e m pe r a t u r e C o nc e nt r a t i ons of t he f i na l p r oduc t w e r e de t e r m i ne d by opt i c a l de ns i t y. R e ve r s e T r an s c r i p t as e R e ac t i on an d P ol ym e r as e C h ai n R e ac t i on R N A s a m pl e s w e r e e xt r a c t e d us i ng T R I z ol R e a ge nt a nd pr ot oc ol F i ve hundr e d na nogr a m s of R N A w e r e us e d f or t he r e ve r s e t r a ns c r i pt i on r e a c t i on f ol l ow e d by

PAGE 62

49 pol ym e r a s e c ha i n r e a c t i on ( R T P C R ) A l l r e a c t i on s w e r e s e t up i n 200 l t ube s a nd a l l i nc uba t i on s t e ps w e r e done i n t he M a s t e r c yc l e r t o e ns ur e e ve n i nc uba t i ons T he l i d t e m pe r a t ur e of t he M a s t e r c yc l e r w a s ke pt a t 105 C t hr ougho ut t he e xpe r i m e nt A l l R N A s a m pl e s w e r e f r om c e l l t r a ns f e c t i ons t hus w e r e f i r s t t r e a t e d w i t h R Q 1 R N a s e F r e e D N a s e ( P r om e ga ) f o r 30 m i nut e s a t 37 C E D T A w a s a dde d t o t he s a m pl e s a nd i nc uba t e d a t 65 C f or 10 m i nut e s f or i na c t i vi a t i on o f t he D N a s e T he r e ve r s e t r a ns c r i pt i on r e a c t i on w a s t he n s e t up us i ng P r o m e ga s A c c e s s Q ui c k T M R T P C R S ys t e m T hi s i nc l ude s a m i x t ha t c ont a i ns t he ne c e s s a r y c om pone nt s f or r e ve r s e t r a ns c r i pt i on a nd P C R r e a c t i ons T he r e ve r s e t r a ns c r i pt a s e w a s a dde d l a s t A one hou r i n c uba t i on a t 48 C f o r r e ve r s e t r a ns c r i pt i on w a s done f ol l ow e d by 35 c yc l e s of 94 C 0. 5 m i nu t e 55 C 1 m i nut e 72 C 5 m i nut e s a nd one l a s t 5 m i nut e i nc uba t i on a t 72 C H a l f of t he r e a c t i ons w e r e t he n r un on 15% pol ya c r yl a m i de 1 X T B E ge l s w i t h a n a pp r op r i a t e l a dde r T he ge l s w e r e s t a i ne d w i t h e t hi di um b r om i de f or v i s ua l i z a t i on on a n E a gl e E ye T M I m a gi ng S ys t e m ( S t r a t a ge ne ) R e l a t i ve i nt e ns i t e s of t he ba nds w a s c a l c ul a t e d us i ng t he s of t w a r e U N S C A N I T ge l A ut om a t e d D i gi t i z i ng S ys t e m V e r s i on 5. 1 ( S i l k S c i e nt i f i c C or por a t i on O r e m U T )

PAGE 63

50 CHAPTER 3 ANIMAL MODEL ANALYSI S The most useful animal model for phenylketonuria is the BTBR Pah enu2 mouse. A single nucleotide mutation in the PAH locus created the missense mutation F263S. 54 This mutation renders phenylalanine hydroxylase completely inactive. The mice have classic PKU: hyperphenylal aninemia, cognitive deficits, maternal PKU syndrome, and hypopigmentation ( Figure 3 1). Various studies of the mouse model have been done (see the Animal model section of Chapter 1), but some physiological parameters that we have observed with our colony h ave not been previously described. This chapter describes some general observations about the mouse model, and experiments performed to further understand this model of classic phenylketonuria. General Sex Dimorphism in BTBR Pah enu2 Mice Growth Curve Ana lysis A number of papers have been published about the BTBR Pah enu2 model, but none mentions any differences between the Pah enu2 male and female mice. Early on in our colony it was observed that the female mice were smaller and more fragile than their mal e counterparts. We decided to quantitate this observed difference from birth to adulthood. Three litters from male / to female +/ matings were followed from birth until post natal day 72. All pups were tattooed with India Ink in different patterns on their paws between day 3 and day 6 to follow each pups weight specifically, since genotype of the pups cannot be ascertained visually immediately after birth. Coat color identification between days 15 20 was used to assess genotype in these crosses which

PAGE 64

51 was later confirmed by serum Phe levels obtained at weaning. Five heterozygous males, seven heterozygous females, five Pah enu2 males and four Pah enu2 females were thus followed from birth. Weights pre determined in our inventory were added to the averages of these mice for the adult average values to obtain more accurate numbers. Three wild type litters were also followed from birth, but without tattooing of the pups. Eleven wild type males and seventeen wild type females were thus included in these calcula tions. Again values obtained from our inventory were also added into the adult weight averages. The results in Figure 3 2 show that Pah enu2 mice are smaller than both heterozygote and wild type mice. Using unpaired t test analysis (Table 3 1) from day 0 to day 56, wild type and heterozygous mice do not show any significant trends in the differences in their growth. While some points show significant differences, they can be explained by litter sizes: the wild type litters had each three to four more pups than the followed heterozygous litters thus being somewhat smaller at some of the early time points. Comparing males and females separately explains the significant p values towards the end of the 56 days. While males are not significantly different in th eir growth rates, the wild type females remain somewhat smaller than the heterozygous females, a lasting effect of the litter size differences that does not continue once the animals reach adulthood. Adult females, both wild type and heterozygote, are gene rally smaller than their male counterparts as expected. The Pah enu2 mice compared to heterozygous mice are significantly smaller starting at day 6 with a p value below 0.05. The p value comes below 0.001 at day 12 until day 49 when it comes back to just b elow 0.05. Again looking at the males alone, the difference in growth rates is only significant until day 49 when the PKU males reach weights that

PAGE 65

52 T a bl e 3 1 U npa i r e d t t e s t a na l ys i s of l i t t e r w e i ght s D ay s : 3 6 9 1 2 1 5 1 8 2 3 2 8 3 5 4 2 4 9 5 6 + / + t o + / a 0 0 6 6 3 0 0 0 8 8 b 0 0 0 4 1 0 0 0 0 1 c 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 4 5 4 0 0 1 2 3 M + / + t o m + / 0 1 0 5 1 0 0 3 6 1 0 0 1 6 9 0 0 0 2 6 0 0 0 3 5 0 0 0 4 5 0 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 2 1 4 0 1 8 9 8 F+ / + t o f + / 0 3 9 4 5 0 0 6 4 7 0 0 6 5 1 0 0 2 1 8 0 0 1 3 8 0 0 0 8 0 0 0 0 1 6 0 0 0 0 5 0 0 0 0 0 0 0 0 1 2 0 0 0 0 2 0 0 0 0 0 + / + t o / 0 0 0 0 8 0 0 0 0 0 0 0 0 0 1 0 3 4 7 2 0 0 0 0 2 0 3 1 9 0 0 0 0 0 0 0 0 0 0 2 0 0 5 1 4 0 0 4 8 5 0 0 4 2 9 0 1 9 2 7 M + / + t o m / 0 0 4 7 1 0 0 0 8 9 0 0 0 3 8 0 9 0 5 4 0 0 0 8 5 0 1 9 6 3 0 0 0 2 3 0 0 0 0 1 0 0 1 8 4 0 0 0 6 9 0 0 4 4 3 0 5 1 9 0 F+ / + t o / 0 0 0 3 5 0 0 0 0 0 0 0 2 4 7 0 3 0 2 0 0 0 1 6 6 0 9 4 7 0 0 0 0 1 5 0 0 5 1 7 0 0 0 1 9 0 0 0 5 3 0 0 0 0 0 0 0 0 1 7 + / t o / 0 5 2 5 7 0 8 1 0 5 0 3 5 8 5 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 8 0 3 8 9 6 0 0 7 6 1 M + / t o m / 0 5 5 5 5 0 3 1 7 5 0 6 2 4 5 0 0 0 0 7 0 0 1 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 8 0 3 4 3 2 0 2 6 4 9 F+ / t o f / 0 0 9 0 2 0 0 4 0 7 0 3 6 0 0 0 0 0 5 1 0 0 0 5 8 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 In t ra + / + 0 0 0 4 2 0 0 0 8 1 0 5 6 6 7 0 5 8 6 1 0 6 4 9 1 0 8 8 3 7 0 1 5 4 4 0 0 0 4 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 In t ra + / 0 2 8 2 1 0 1 8 0 6 0 1 5 4 7 0 8 2 1 2 0 3 8 6 8 0 3 6 1 8 0 5 7 8 1 0 0 1 2 1 0 0 0 2 0 0 0 0 1 3 0 0 0 0 6 0 0 0 6 7 In t ra / 0 4 1 6 3 0 0 3 4 8 0 1 4 3 3 0 2 4 0 2 0 6 0 8 2 0 9 2 7 5 0 7 9 5 9 0 2 0 9 2 0 0 0 5 9 0 0 0 1 3 0 0 0 0 3 0 0 0 0 0 a Res u l t o f p ai r ed an al y s i s i s s h o w n fo r each s et o f d at a. b Bl u e t ex t i n d i cat es p v al u e l es s t h an 0 0 5 c Pi n k t ex t d en o t es p v al u e l es s t h an 0 0 0 1

PAGE 66

53 cannot be distinguished from heterozygous males, see Figure 3 3 and Table 3 1. This is different than the growth curves observed between the wild type and heterozygous males that did not show this delay in weight gain. The female Pah en u2 are significantly smaller than all the other mice in the model. When compared to heterozygote females, the p values are below 0.05 from day 12 until day 28 when the p value goes below 0.001 and remains there throughout their lifetime. This fragility is further demonstrated by ANOVA analysis of adult weights in Table 3 2 that shows that the p value only remains significant between the three populations when the Pah enu2 females are included in the calculations. Table 3 2 Results of ANOVA analysis of adul t weights. Groups DF a F b P c +/+, +/ / 194 16.61 2.23x10 7 +/+, +/ male / female / 194 52.61 7.82x10 25 +/+, +/ male / 124 0.31 0.73 +/+, +/ female / 144 55.26 1.78x10 18 a Degrees of freedom b F value: distance between individual distributions c P value Serum Phenylalanine Levels In humans, the classic PKU phenotype is normally defined as having serum phenylalanine levels of 1200 mol/L (1.2 mM) or more. 27 The mouse model, BTBR Pah enu2 has similarly elevated Phe levels that classify it as the classic phenotype. Table 3 3 shows normal, non hyperphenylalaninemic, heterozygote Phe values, and male and female Pah enu2 serum Phe values. Femal e mice have higher Phe levels than the male mice, and our lab has observed this phenomenon since the beginning of our colony. Only one recent report indicated similar findings where male mice had 1.80 mM serum Phe levels while female mice had 2.89 mM serum Phe levels. 70 Shedlovsky had re ported an average of 23.1 mg/dL (1.39 mM) serum Phe in the Pah enu2 mice with no mention of

PAGE 67

54 male and female differences. 50 The models Phe values have also been reported as 1. 70 mM 116 1.54 mM 64 1.57 mM 66 2.0 mM in males and 2.06 mM in females (deemed not significant) 69 and 1.23 mM 68 The varied values can be explained by differences in assay methods and sensitivity, and perhaps also explain the one report where male and female mice where not found to have significantly different values. Table 3 3. Serum phenylalanine values in BTBR Pah enu2 6 weeks a 8 we eks a Adult average a Heterozygote 0.07 +/ 0.02 0.07 +/ 0.01 0.09 Male / 1.50 +/ 0.14 1.36 +/ 0.08 1.13 +/ 0.08 Female / 1.82 +/ 0.12 1.58 +/ 0.05 1.54 +/ 0.03 a Values expressed in mM. The phenylalanine values in the Pah enu2 mice prior to 6 weeks are not significantly different and are around 2.0 mM. As the mice begin their sexual development, the values decrease as shown, with the males lowering by half their early levels by adulthood. The 6 week time point or 42 days corresponds to the t ime when male mice begin to catch up to heterozygote mice in terms of weight. Perhaps the gain in muscle weight can explain the 0.4 mM (or 6.7 mg/dL) difference by adulthood in the serum Phe values. Food Consumption The food consumption on a per week basi s was measured in the mice in order to find an explanation for the difference in serum Phe values between the male and female PKU mice. The mice were housed in standard housing in groups of 2 to 4 separated by sex and genotype. Each mouse was weighed once a week for a total of 2 to 4 weeks. Average food consumption was calculated on a per gram of mouse basis as protein intake is usually reported in the literature. Figure 3 4 shows that for adult mice, 10 weeks or older, the Pah enu2 ( / ) females eat more th an any of the other mice. Heat loss in these smaller mice may explain the difference in food intake since more energy expenditure

PAGE 68

55 should be required to maintain body temperature. To verify this hypothesis, one cage of heterozygote females had their food co nsumption measured starting at 6 weeks of age for 3 consecutive weeks. Their average weight over the 3 weeks was 23.3 g, similar to the adult Pah enu2 females. These mice also consumed more chow than their adult counterparts, with an average of 0.25+/ 0.03 g of food consumed per day per gram of mouse. Lifespan Analysis Using our entire mouse inventory, a natural lifespan analysis was performed. Only mice that died of natural causes were included in the calculations. Average lifespan, incidence of premature death defined as prior to 12 weeks of age, average adult lifespan (excluding mice that died prior to 12 weeks of age) and median adult lifespan were calculated from the data. Wild type and heterozygote data were combined by sexes since the pool samples wer e smaller than for the PKU mice. The results are displayed in Table 3 4. As an indication of overall relevance, the number of data points for each group is indicated along with the fraction of total mice of that category in the inventory that it represents The data are most likely skewed toward a lower than expected lifespan: animals that die young will be recorded into the inventory whilst older animals may be sacrificed prior to the end of their natural lifespan. However, the sample size for the PKU mic e seems large enough to infer that the female mice have a higher incidence of premature death, 0.15 versus 0.08, and a shorter adult lifespan than the males. 7.1 months versus 10.5 months. Normal males live longer than normal females, and the data for PKU males are similar to that of the normal males. Even though the sample size for heterozygote and wild type mice is much smaller, it seems likely that given a larger sample size the data would remain the same. This assumption is based on our

PAGE 69

56 obs e r va t i ons ge ne r a l a ppe a r a nc e of t he m i c e t he i r s i z e P he l e ve l s a nd f ood c ons um pt i on pr e s e nt e d i n t he e a r l i e r pa r t s o f t hi s c ha pt e r T a bl e 3 4 L i f e s pa n a na l ys i s Mal es a (+ / + an d + / ) Fem al es (+ / + an d + / ) / M al es / F em al es N (fract i o n o f t o t al i n v en t o ry ) 2 2 (9 % ) 4 6 (1 5 % ) 6 5 (4 0 % ) 8 1 (4 0 % ) A v e rag e l i fes p an (mo n t h s ) 9 3 7 2 9 8 6 3 In ci d en ce o f p remat u r e d e at h 0 0 9 0 1 5 0 0 8 0 1 5 A v e rag e ad u l t l i fes p an (mo n t h s ) 1 0 0 8 1 1 0 5 7 1 Med i an ad u l t l i fes p an (mo n t h s ) 9 5 7 3 1 0 7 6 6 a D at a i s p res en t ed as t h e av erag e i n mo n t h s b as ed o n t h e i n d i cat ed s a mp l e s i z e. P h e n yl al an i n e H yd r oxyl as e i n B T B R P ah e n u 2 M i c e I t i s c l e a r t ha t ba s e d on l i f e s pa n, s e r um P he va l ue s a nd gr ow t h c ur ve s t ha t f e m a l e P ah e n u 2 m i c e a r e m or e s e ve r e l y a f f e c t e d by t he di s e a s e t ha n t he m a l e m i c e T o f ur t he r e va l ua t e t he m ous e m ode l a nd a t t e m pt t o unde r s t a nd t he m a l e a nd f e m a l e di m o r phi s m P A H w a s m e a s ur e d i n i t s va r i ous f or m s i n bot h l i v e r a nd ki dne y. L i ve r P A H M e s s age l e ve l s T he m ous e m ode l c ont a i ns a m i s s e ns e m ut a t i on c a us i ng a phe nyl a l a ni ne c ha nge t o a s e r i ne I t w a s r e por t e d t ha t t he P ah e n u 2 m i c e ha ve 12% o f w i l d t ype P A H m R N A l e ve l s 5 0 G i ve n t ha t t he m u t a t i on i s a s i ngl e ba s e c ha nge bur i e d i n t he m i ddl e of t he P A H t r a ns c r i pt i t s e e m e d unl i ke l y t ha t i t w oul d c a us e s uc h a r e duc t i on i n t r a ns c r i pt i on or r e nde r t he m R N A uns t a bl e i n a ny w a y. M ous e l i ve r s a m pl e s w e r e e xt r a c t e d f o r R N A a nd t h e s e w e r e a na l yz e d by N or t he r n bl ot t i ng f or m P A H W hi l e N o r t he r n bl o t t i ng i s no t t he m os t s e ns i t i ve m e t hod f or R N A qua nt i f i c a t i on, a s e ve r e r e duc t i on i n R N A l e ve l s w oul d

PAGE 70

57 be easy to detect and confirm. Figure 3 5 shows a representative blot and the overall r esults. A total of eight adult animal samples were analyzed for +/+ and / mice, and 7 samples were analyzed for +/ mice. No statistically significant changes were observed between the three genotypes or between sexes. The message is very abundant and ea sily detectable using the full length cDNA probe as shown in Figure 3 5A. Protein levels Message levels were not expected to be different in the PKU mice, and the Northern blots showed that PAH in the liver was not reduced. We were uncertain what effects t he inactivity of the F263S protein would have on overall PAH protein levels in the liver. Shedlovsky had showed Pah enu2 levels to be approximately 33% of wild type. 50 That ev idence combined with normal levels of PAH mRNA indicates that perhaps mPAH F263S is less stable than the normal monomer and is directly selected for degradation after translation, or that the mutant protein does not easily form a tetramer and is also selec tively degraded, or that the mutant inactive tetramers are turned over quickly due to inactivity. Liver PAH protein amounts were determined by Western blotting. PAH amounts were found to decrease by approximately 40% between +/+ and +/ mice, and by approx imately 60% between +/+ and / mice, as shown in Figure 3 6, and in agreement with the original published results on Pah enu2 mice. Activity levels Phenylalanine hydroxylase activity was measured from freshly extracted liver protein to further define the liver environment. Since mPAH F263S has no catalytic activity, the Pah enu2 samples do not have any activity as measured by the spectrophotometric assay. In the heterozygote samples, Kaufman predicted based on a mathematical model developed with the propert ies of purified PAH, that a heterozygote

PAGE 71

58 pa t i e nt m i ght be e xpe c t e d t o ha ve 40 % of nor m a l a c t i vi t y ba s e d on r e por t e d r a t i os o f s e r um P he va l ue s i n obl i ga t e he t e r oz ygot e ve r s us n or m a l pa t i e nt s S a m pl e bi ops i e s f r om t he s e pa t i e nt s ha ve be e n r e por t e d t o be a r o und 30 % of nor m a l a c t i vi t y. 1 1 7 W e ha ve c a l c ul a t e d a n a ve r a ge of 42 % a c t i vi t y i n he t e r oz yg ot e m i c e a gr e e i ng w i t h K a uf m a n s pr e di c t i on. T a bl e 3 5 c ont a i ns t he r e s ul t of t he P A H a s s a ys w i t h t he l i ve r s a m pl e s T a bl e 3 5 P A H a c t i vi t y i n l i ve r s a m pl e s + / + + / / A ct i v i t y av er ag e a 1 0 0 0 4 2 0 0 2 St an d ard d ev i at i o n 0 1 5 0 1 0 0 0 7 N 9 8 1 3 a Res u l t s are g i v en as av er ag es + / s t an d ard d ev i at i o n re l at i v e t o w i l d t y p e act i v i t y l ev el s P r ot e i n l e ve l s i n he t e r oz ygot e m i c e w e r e a ppr oxi m a t e l y 62% o f w i l d t ype w hi l e a c t i vi t y ha s be e n f ound t o be onl y 42% of w i l d t yp e T he P ah e n u 2 m i c e ha ve 41 % of nor m a l pr ot e i n a m ount s w i t h a s e xpe c t e d, 0 % nor m a l a c t i vi t y. T hi s s ugge s t s t ha t t he m P A H F 263S m ono m e r s a r e t u r ne d ove r qui c kl y i n t he l i ve r pos s i bl y due t o i ns t a bi l i t y or i m pr ope r f ol di ng. I n he t e r oz ygot e s w i t h one c opy of t he m ut a t e d ge ne t he m i c e s how 16% of pr ot e i n a bove t he a s s um e d 50% no r m a l p r ot e i n. I f t he 16% e xt r a pr ot e i n i s a s s um e d t o be t he m P A H F 263 S pr o t e i n a m ount o ne c oul d a s s um e t ha t P ah e n u 2 m i c e s houl d onl y ha ve 32% pr ot e i n H ow e ve r 41% w a s a c t ua l l y obs e r ve d. M or e ove r t he 42% of nor m a l a c t i vi t y l e ve l s c ons i s t e nt l y obs e r ve d i n t he + / m i c e s ugge s t s t ha t a n i n t e r a c t i on be t w e e n nor m a l a nd m ut a nt m onom e r i s t a ki ng p l a c e t hus r e duc i ng t he t o t a l pot e nt i a l a c t i vi t y l e ve l s a nd pe r ha ps t he a m ount s o f no r m a l m onom e r s T he a nt i body i s i nc a pa bl e of di s t i ngui s hi ng be t w e e n nor m a l a nd m ut a nt m on om e r t hu s w e a r e una bl e t o de t e r m i ne w ha t r e l a t i ve a m ount s of e a c h pr ot e i n i s pr e s e nt i n t he he t e r oz ygot e m i c e

PAGE 72

59 Kidney PAH Similar experiments were conducted with kidney samples. Results are shown in Figure 3 7. Unlike liver PAH, protein amounts are equal betwee n each genotype. Activity levels decrease by 50% from wild type mice to heterozygote mice. The regulation of turnover and /or the stability of the protein seem to be different between the two organs, which is consistent with the state of activation observe d with purified kidney rat PAH. 38 The rat kidney enzyme was not responsive to p re incubation with phenylalanine unlike liver PAH, and it was found to have higher in vitro activity with BH 4 Since the promoters are the same, it is presumed that post translational modifications are different in each organ leading to the differences obs erved in stability of the protein. It is interesting that the liver and the kidney do not seem to regulate PAH in the same manner, and perhaps the kidney could be a good target for gene therapy. Colocalization of the cofactor BH 4 and the AAV vector would have to be achieved, thus requiring that the cell types where PAH and BH 4 are present in the kidney be susceptible to rAAV infection. Studies are currently underway to determine the localization of PAH in the mouse kidney. Discussion The mouse model for phenylketonuria, BTBR Pah enu2 was examined in detail for this study. BTBR Pah enu2 mice have a single base mutation in the PAH gene leading to the missense mutation F263S in exon 7. 54 The mutated enzyme is catalytically inactive, and the mice have classic PKU: hyperphenylalaninemia, hypopigmentation, c ognitive deficits and maternal PKU syndrome. We found that female BTBR Pah enu2 mice are significantly smaller than the male Pah enu2 mice and have a shorter lifespan and a higher incidence of premature death than any of the other mice. Serum phenylalanine l evels in

PAGE 73

60 a dul t f e m a l e P a h e n u 2 m i c e a r e on a ve r a ge 0. 5 m M hi ghe r t ha n t he m a l e s a nd t he f e m a l e s w e r e f ound t o e a t m o r e on a pe r g r a m ba s i s t ha n e i t he r P ah e n u 2 m a l e s he t e r oz ygot e o r w i l d t ype m i c e W hi l e t he i nc r e a s e d f ood i n t a ke m i ght be due t o hi ghe r e n e r gy e xpe ndi t ur e f or body t e m pe r a t u r e s t a bi l i z a t i on i n t he s m a l l e r f e m a l e m i c e t hus l e a di ng t o t he hi ghe r s e r um P he l e ve l s t he r e a s on f o r t he pe r s i s t e nt s m a l l e r s i z e i n t he f e m a l e s i s s t i l l unknow n. T he s e xua l di m or phi s m obs e r ve d i n t he a ni m a l m o de l i s not e xpl a i ne d by t he m ol e c ul a r s t a t us of P A H i n t he m i c e : no di f f e r e nc e s w e r e obs e r ve d be t w e e n m a l e s a nd f e m a l e s i n t e r m s of P A H t r a ns c r i pt pr ot e i n or a c t i vi t y. T hi s i s c ons i s t e nt w i t h t he f a c t t ha t P A H i s a hous e ke e pi ng ge ne e ve n t hough i n t h e m ous e t h e e nha nc e r ha s be e n s how n t o be r e gul a t e d by hor m one s s uc h a s de xa m e t hos one 3 1 T h e P A H t r a ns c r i pt w a s not f ound t o be s i gni f i c a nt l y r e duc e d i n a l l t hr e e ge not ype s of t he m ous e m ode l a s e xpe c t e d f or a m i s s e ns e m ut a t i on. P r ot e i n l e ve l s i n t he l i ve r w e r e 62% of nor m a l i n t he he t e r oz ygot e m i c e a nd 41 % of nor m a l i n t he P ah e n u 2 m i c e A c t i vi t y m e a s ur e m e nt s s how e d t ha t he t e r oz ygot e m i c e ha ve 42% of nor m a l P A H a c t i vi t y i n t he l i ve r T hi s a m ount o f a c t i vi t y a s c om pa r e d t o t he c a l c ul a t e d p r ot e i n a m ount s i n t he he t e r oz ygot e l i ve r s i s s ugge s t i ve of a dom i na nt ne ga t i ve i nt e r f e r e nc e e f f e c t i n t he m i c e s i nc e t he e nz ym e i s a hom ot e t r a m e r T he pr e s e nc e of P A H m ut a nt p r ot e i n i n t he P ah e n u 2 m i c e c oul d l e a d t o dom i na nt ne ga t i ve i nt e r f e r e nc e a f t e r ge ne t he r a py, a nd e xpl a i n t he ne e d f or hi gh r A A V dos e s t o c ur e hype r phe nyl a l a ni ne m i a O ur ge ne t he r a py r e s ul t s a nd t he i m pl i c a t i on of do m i na nt ne ga t i ve i nt e r a c t i on a r e d i s c us s e d i n de t a i l i n c ha pt e r s 4, 5 a nd 7 S i nc e s om e 60 % o f know n hum a n P A H m u t a t i ons a r e m i s s e ns e m ut a t i ons e xpr e s s e d i n t he pa t i e nt s f u r t he r s t udy of t hi s m e c ha ni s m i s ne e de d t o de ve l op c l i ni c a l l y a ppl i c a bl e t he r a py f o r hum a ns

PAGE 74

61 F i gur e 3 1 B T B R P ah e n u 2 m ous e m ode l T he P K U m i c e ( / ) a r e hypopi gm e nt e d a s c om pa r e d t o t he w i l d t ype ( + / + ) a nd he t e r oz ygot e ( + / ) m i c e

PAGE 75

62 F i gur e 3 2 B T B R m i c e gr ow t h c ur ve s T he P ah e n u 2 ( / ) m i c e a r e s i gni f i c a nt l y s m a l l e r t ha n t he he t e r oz ygot e ( + / ) a nd w i l d t ype ( + / + ) m i c e

PAGE 76

63 F i gur e 3 3 M a l e a nd f e m a l e w e i ght di f f e r e nc e s W hi l e f e m a l e P ah e n u 2 ( / F e m a l e s ) r e m a i n s i gni f i c a nt l y s m a l l e r t ha n a l l t he ot he r m i c e t he m a l e P ah e n u 2 ( / M a l e s ) c a t c h up t o t he he t e r oz ygot e ( + / ) m i c e a r o und da y 40.

PAGE 77

64 F i gur e 3 4 A ve r a ge da i l y f ood c ons um pt i on. F e m a l e / m i c e e a t s i gni f i c a nt l y m or e on a pe r gr a m ba s i s t ha n t he he t e r oz ygot e o r m a l e / m i c e p< 0. 05.

PAGE 78

65 F i gur e 3 5 N or t he r n bl ot of m ous e P A H A R e pr e s e nt a t i ve n or t he r n bl ot s how i ng m P A H s i gna l a nd l oa di ng c ont r ol C uZ nS O D B Q ua nt i t a t e d r e s ul t s c om bi ne d by ge not ype a s c a l c ul a t e d by l a s e r de ns i t om e t r y a nd r e por t e d a s r e l a t i ve P A H a m ount s nor m a l i z e d t o C uZ n S O D

PAGE 79

66 F i gur e 3 6 W e s t e r n bl ot of m ous e P A H A R e pr e s e nt a t i ve w e s t e r n bl ot f i l m f r om m a l e l i ve r s a m pl e s F i f t e e n m i c r ogr a m s o f t ot a l pr ot e i n w a s r un f or e a c h s a m pl e a nd m P A H a nd l oa di ng c ont r ol G A P D H s i gna l s a r e bot h i ndi c a t e d. B Q ua nt i t a t e d r e s ul t s of w e s t e r n bl ot s g r oupe d by ge not ype R e s ul t s a r e e xpr e s s e d a s r e l a t i ve m P A H a m ount s nor m a l i z e d t o G A P D H a s m e a s ur e d by l a s e r de ns i t om e t r y. W i l d t ype l e ve l s w e r e s e t t o on e a nd + / a nd / l e ve l s a r e s how n a s f r a c t i on of w i l d t ype

PAGE 80

67 F i gur e 3 7 K i dne y P A H a m ount s A l l r e s ul t s a r e pr e s e nt e d r e l a t i ve t o w i l d t ype l e ve l s s e t t o 1. m R N A a m ount s a r e a ve r a ge s + / a ve r a ge de v i a t i on, N = 5, N = 6 a nd N = 6 r e s pe c t i ve l y. P r ot e i n a m ount s a r e a ve r a ge s + / s t a nda r d de vi a t i on, N = 14, N = 12, a nd N = 8 r e s pe c t i ve l y. A c t i vi t y l e ve l s a r e gr a phe d a s a ve r a ge s + / s t a nda r d de vi a t i on, N = 12, N = 10 a nd N = 1 0 r e s pe c t i ve l y.

PAGE 81

68 C H A P T E R 4 D O M I N A N T N E G A T I V E I N T E R F E R E N C E I N P H E N Y L K E T O N U R I A D om i na nt ne ga t i ve i nt e r f e r e nc e i s de f i ne d a s a n i n t e r a c t i on be t w e e n t w o pr o t e i ns t ha t l e a ds t o ne ga t i ve r e gul a t i on or i na c t i va t i on o f t he nor m a l p r ot e i n s f unc t i on 1 1 8 T hi s m a y oc c ur w he n one p r ot e i n i s m ut a t e d i n a w a y t h a t pr e ve nt s i t s nor m a l a c t i vi t y; t he m ut a t e d pr ot e i n c om bi ne s w i t h a no r m a l pr o t e i n a n d l e a ds t o i m pa i r e d f unc t i on i na c t i va t i on, or de gr a da t i on. S ys t e m s t ha t r e qui r e d i m e r i z a t i on or ol i gom e r i z a t i on c a n be a f f e c t e d by dom i na nt ne ga t i ve i nt e r f e r e nc e by a n e xpr e s s e d a nd r e l a t i ve l y s t a bl e m ut a nt s ubuni t T he be s t know n e xa m pl e of dom i na nt ne g a t i ve i nt e r f e r e nc e i n a hum a n di s e a s e i s O s t e oge ne s i s I m pe r f e c t a ( O I ) w he r e one m ut a nt c ol l a ge n m ol e c ul e de s t a bi l i z e s t he e xt r a c e l l ul a r m a t r i x ( E C M ) of t he bone l e a di ng t o bone f r a gi l i t y a nd f r e que nt f r a c t ur e s t he m a i n c l i ni c a l f e a t ur e s of O I D om i na nt ne ga t i v e e f f e c t s due t o s pe c i f i c m ut a t i ons i n r e c e pt or s or ho r m one s c a n c a us e m a ny e ndoc r i ne d i s e a s e s F or e xa m pl e F a br y di s e a s e c onge ni t a l a dr e na l hypopl a s i a C r i gl e r N a j j a r s ynd r om e a nd pi t ui t a r y dw a r f i s m ha ve be e n f ound t o be dom i na nt ne ga t i ve di s e a s e i n s om e pa t i e nt s 1 1 8 A f t e r e a r l y r e s ul t s of ge ne t he r a py t r i a l s i n t he B T B R P ah e n u 2 m i c e our l a bor a t or y hypot he s i z e d t ha t dom i na nt ne ga t i ve i nt e r f e r e nc e c oul d be t h e r e a s on f or t he hi gh r A A V dos e s ne e de d t o c ur e H P A i n m a l e m i c e P he nyl a l a ni ne hydr oxyl a s e i s a t e t r a m e r i c e nz ym e a nd a f unc t i ona l m onom e r i nt r oduc e d by ge ne t he r a py c oul d i nt e r a c t w i t h t he e ndoge nous m ut a nt m onom e r s r e duc i ng t ot a l pot e nt i a l a c t i vi t y i n t he he pa t oc yt e s t hus t he ne e d f or hi gh dos e s t o c o r r e c t t he hype r phe nyl a l a ni ne m i a T hi s c ha pt e r pr e s e nt s t he

PAGE 82

69 gathered evidence that dominant negative interference occurs in this mouse model for phenylketonuria after gene therapy. Gene Therapy for Phenyl ketonuria: Divergent Results by Sex in BTBR Pah enu2 A recombinant Adeno associated virus vector was constructed in the lab and contains the mouse PAH cDNA. The gene is expressed from the hCMV enhancer and Chicken Actin hybrid promoter (CB). An SV40 poly A signal follows the mPAH cDNA, and the plasmid is 6823 bases in total ( Figure 4 1 panel A). An alternate vector contains the Woodchuck hepatitis virus post transcriptional regulatory element (WPRE) followed by the Bovine Growth Hormone polyA. This plasmid is 7519 bases ( Figure 4 1 panel B). Either vector can be packaged in trans to produce rAAV type 2 virions ( Figure 4 1 panels C and D). All virus packaging was done by the University of Florida Vector Core. Briefly, our vector DNA is co transfected into HE K 293 cells with the pDG plasmid which contains AAVs rep and cap genes along with the required Adeno virus genes. 114 After 48 hours a cell pellet is obtained, freeze th awed, and separated on an iodixonal step gradient. The virus is purified on a heparin affinity column, and after concentration the virus is titered by quantitative competitive PCR and infectious center assay. The first gene therapy trial was done with rAA V2 CB mPAH virus. Both male and female mice were injected via portal vein. Male mice responded to 1.5x10 11 infectious unit (IU) dose by lowering their serum phenylalanine levels from 1.10 mM to an average of 0.3 mM for 24 weeks, the end of the experiment ( data not shown). Normal phenylalanine levels would be around 0.10 mM. The dose of CB mPAH vector was therapeutic, but not fully effective. Female mice failed to respond to the same virus dose as the males. The females lack of response to the gene therapy at such a high doses

PAGE 83

70 prompted the construction of the second vector that includes the WPRE in order to enhance the effect of the gene therapy. The WPRE has been shown to enhance the activity of transcripts both in cells and in animals from a variety of vir us vectors. 119,120 In cell culture transfections, CB mPAH WPRE has 2 to 2.5 fold higher activity than CB mPAH (data not shown). We repeated our initial study using both newly packaged rAAV2 CB mPAH WPRE and rAAV2 CB mPAH. We note that continuous improvements by the University of Florida Vector Core have improved both the yields and quantitation accuracy of vector preparations. In this second trial, 3X10 10 infectious units of rAAV2 CB mPAH fully co rrected male BTBR Pah enu2 mice ( Figure 4 2). With the CB mPAH WPRE vector, males were fully corrected at about half the CB mPAH dose, 1.3x10 10 infectious units. Female mice responded to 3x10 11 infectious units of rAAV2 CB mPAH WPRE by lowering their serum Phe levels to approximately 0.6 mM. This dose is at least 20 times more than the dose used in the male mice and still failed to fully correct the females. These results are comparable to those obtained by Mochizuki et al. in 2004, although different serot ypes of AAV were used. 69 Liver PA H: Evidence of Dominant Negative Interference No difference between the sexes was observed at the molecular level for PAH. Nonetheless, the data do point to an interaction between mutant and normal PAH monomer. While RNA transcription is constant for the housekeeping gene in all three groups of mice, protein PAH levels vary in the liver ( Figure 4 3). In addition, activity levels are reduced from wild type to heterozygote mice due the presence of the mutant F263S monomer. While the overall PAH amount is app roximately 62% in heterozygote mice, the PAH activity detected in these samples is only 42% of wild type. If only the

PAGE 84

71 mutant monomers were degraded in the heterozygotes, one would expect to see 50% of wild type protein amounts and 50% of wild type activity Neither the western blots nor the activity assays can differentiate between normal and mutant monomers, but based on the less than ideal percentages observed, one can infer that both monomers interact in a dominant negative fashion leading to increased t urnover and reduced PAH activity. The heterozygote mice at 42% normal PAH activity have normal serum Phe levels and are indistinguishable from wild type mice. In vitro Cell Transfection Studies with Normal and Mutant PAH To further investigate the possibl e interaction between normal mPAH and mouse mutant mPAH F263S, a new vector was created to express mPAH F263S. PCR primers, containing nucleotide changes to create the F263S mutation, were used to amplify a 132 base pair segment of the PAH cDNA (Table 2 2) The amplified region was subcloned into a pGEM T plasmid, sequenced, cloned into pGEM T mPAH and the full length mPAH F263S gene was moved back into the rAAV CB mPAH plasmid ( Figure 4 4). The extra cloning steps were done to avoid subcloning a small PCR product into the large rAAV plasmid that must be transformed into Sure cells. The larger pieces used in the last ligation allow for better ligation efficiency and are easier to transform into the low efficiency Sure cells. HEK 293 cells are routinely used to test activity of DNA vector preparations, and were chosen to study the possible interactions between normal and mutant monomers of PAH. Calcium phosphate transient transfections were performed with various ratios of vector DNA, a cell lysate obtained a fter 48 to 72 hours post transfection, and used in the spectrophotometric PAH assay. All co transfection experiments performed together were normalized in terms of total DNA transfected with the p21 newhp plasmid which

PAGE 85

72 contains the same CB promoter as the mPAH plasmids. pTR UF11 was also transfected to visually monitor transfection efficiency by examining GFP expression in the cells prior to harvest. Both CB mPAH and CB mPAH F263S were tested for activity or protein production with increased DNA transfecte d in the cells, without normalization between transfections. This was done in part to determine what amount of CB mPAH DNA transfected would result in activity levels that could increase and decrease in a detectable range between each transfection. Both ac tivity and protein expression increased in an almost linear fashion when increased amounts of DNA were transfected into the HEK 293 cells ( Figure 4 5). The series of mPAH F263S transfections was analyzed by western blotting (Figure 4 5 panel A). The protei n amounts increased from 5 to 15 g and show that the F263S monomer is stable in this transient expression system. The mPAH transfections were analyzed by activity assay ( Figure 4 5 panel B). The amount of activity from 5 g per well to 10 g per well almo st tripled while the 15 g transfections were approximately 1.5 times more active than the 10 g transfections as expected. The 3 fold increase in activity from 5 g to 10 g is not completely unexpected since at 10 g more cells could have been transfecte d with multiple copies of CB mPAH thus producing a larger number of stable tetramers and increasing the activity by more than 2 fold. From 10 g to 15 g, the cells are more evenly transfected and the increase in activity follows the increase in DNA. Mix ed CB mPAH and CB mPAH F263S transfections were then performed to analyze the extent of the interaction between the two proteins in this system. For one half of the transfections, mPAH was held constant and mPAH F263S was increased relative

PAGE 86

73 to the normal v ector. For the second half, mPAH F263S was held constant and increased amounts of mPAH were co transfected in the cells. The results are presented relative to an mPAH only transfection (with total DNA normalized with p21 newhp to the highest amount of DNA transfected in the experiment) ( Figure 4 6). Averages of a minimum of 3 transfections with standard deviations are shown for all data sets. The results indicate that when both mutant and wild type monomers are present in the same cell PAH activity is reduc ed. At a one to one ratio, the PAH activity is reduced by half and this remains so even with increased amounts of null mPAH F263S. Increased mPAH F263S was expected to have a stronger effect on PAH activity; the lack of further decrease in activity may be explained by both the transient assay and details of subunit association. Turnover of the protein may not be as efficient in the saturated cells, and accumulation of functional tetramers would prevent further decrease in activity. Increased mPAH versus a c onstant DNA amount of mPAH F263S led to less than a linear increase in activity and further shows that the mutant and normal mPAH monomers interact in a dominant negative fashion. One set of samples from the mixed transfections was analyzed by native poly acrylamide gel electrophoresis and western blotting ( Figure 4 7). In native gel electrophoresis no SDS is included in running buffers or in the sample buffers. The cell lysate samples shown in the figure, mPAH:mPAH F263S and 2mPAH:mPAH F263S were run next to a cell lysate from a transfection with CB mPAH WPRE, and a lysate from CB mPAH ex13 WPRE. The later construct has exon 13 deleted from the cDNA, the region coding for the tetramerization loop, thus preventing the protein from forming tetramers. None o f the mixed transfections showed a change in oligomerization pattern as

PAGE 87

74 c om pa r e d t o t he m P A H W P R E t r a ns f e c t i on, a nd a l l t hr e e ha ve a di f f e r e nt pa t t e r n t ha n t he m P A H e x13 W P R E s a m pl e w hi c h i ndi c a t e s t he pos i t i on of di m e r s a nd p r e s um a bl y m onom e r s on t he ge l T he de c r e a s e s i n a c t i vi t y f r om t he m i xe d t r a ns f e c t i ons a r e due t o t he i nt e r a c t i on o f t he d i f f e r e nt m onom e r s w hi l e f or m i ng di m e r s a nd t e t r a m e r s a nd not t o i nc r e a s e d t ur nove r or s e ve r e c ha nge s i n ol i gom e r i z a t i on pa t t e r ns D i s c u s s i on M a l e P ah e n u 2 m i c e w e r e c ur e d o f hype r phe nyl a l a ni ne m i a w i t h 3x10 1 0 I U ( 3x10 1 2 vg) of r A A V 2 C B m P A H W hi l e t hi s i s c ons i s t e nt w i t h r e c e nt l y publ i s he d P K U s t udi e s t he m i ni m um e f f e c t i ve dos e i s hi gh w he n c om pa r e d t o ot he r r A A V us e s 6 9 7 0 P or t a l ve i n de l i ve r y of 4x10 9 I U of C B hA A T t o f e m a l e C 57 B l / J 6 m i c e r e s ul t e d i n s us t a i ne d t he r a pe ut i c l e ve l s of hum a n # 1 a nt i t r yps i n a nd i n a he m ophi l i a B m ous e m ode l a n r A A V 2 ve c t or c a r r y i ng hum a n F a c t or I X w a s t he r a pe ut i c a t 6. 3x10 1 0 ve c t o r ge nom e s 1 2 1 1 2 2 F ou r t o e i ght f ol d m or e r A A V 2 w a s ne e de d t o c ur e H P A i n m a l e m i c e a s c om pa r e d t o bot h of t he s e s t udi e s e ve n t hough C B hA A T i s t he s our c e of ve c t or s e que nc e s us e d t o c ons t r uc t C B m P A H W e hyp ot he s i z e d t ha t f or t he t e t r a m e r i c P A H e nz ym e dom i na nt ne ga t i ve i nt e r f e r e nc e be t w e e n e ndoge nous a nd r A A V de r i ve d p r ot e i n w a s di m i ni s hi ng t he e f f e c t i ve ne s s of t h e ge ne t he r a py, a nd t h i s pos s i bi l i t y w a s c onf i r m e d w he n w e f ound t ha t P ah e n u 2 m i c e ha ve 42 % o f no r m a l l i ve r P A H a m ount s T he di f f e r e nc e be t w e e n P A H pr ot e i n l e ve l s a nd P A H a c t i vi t y i n t he he t e r oz ygot e m i c e f u r t he r s ugge s t s t ha t a n i nt e r a c t i on be t w e e n t he t w o m onom e r s a f f e c t s P A H a c t i vi t y. T o c onf i r m t he hypot he s i s w e pe r f o r m e d m i xe d v e c t or c e l l t r a ns f e c t i on e xpe r i m e nt s I f one m ode l s t he pos s i bl e i nt e r a c t i on s of t he m ono m e r s ba s e d on t he a s s um pt i on t ha t t he e f f e c t be t w e e n t he m onom e r s oc c ur s a t t he di m e r l e ve l t he r e s ul t s of

PAGE 88

75 t he m i xe d t r a ns f e c t i on e xpe r i m e nt s a gr e e w i t h t he s t a t i s t i c a l pr e di c t i ons F or e xa m pl e a t a 1: 1 r a t i o of C B m P A H a nd C B m P A H F 263S of di m e r s w oul d be f u l l y w i l d t ype w oul d be m i xe d, a nd w oul d be m ut a nt I f t he a s s um pt i on i s m a d e t ha t a m i xe d di m e r m i ght ha ve be t w e e n z e r o a nd f ul l a c t i vi t y, t he obs e r va t i on of 62% of no r m a l a c t i vi t y s ugge s t s t ha t m i xe d di m e r s a r e a c t i ve a t a bout 75 % of w i l d t ype di m e r a c t i vi t y. A t t he 1: 2 t r a ns f e c t i on r a t i o, onl y 11% o f di m e r s a r e w i l d t yp e a nd 4 4% a r e m i xe d. T hi s p r e di c t s P A H a c t i vi t y s houl d be a bout 45% of f ul l a c t i vi t y, c l os e t o t he obs e r ve d 52% A t t he hi ghe r r a t i o of 1: 3, t he r e s ul t s f e l l out s i de of t he p r e di c t e d P A H a c t i vi t y r a nge ( pr oba bl y due t o s a t ur a t i on o f t he c e l l c ul t ur e s ys t e m or t u r no ve r of m i s s e ns e pr ot e i n) but i m por t a nt l y, w e r e s t i l l l ow e r t ha n nor m a l T he c e l l c ul t ur e m ode l da t a c on f i r m e d our hypot he s i s t ha t i nt e r a c t i on be t w e e n nor m a l a nd m u t a t e d m onom e r s l e a ds t o r e duc e d P A H a c t i vi t y t hus i nc r e a s i ng t he r A A V dos e s ne e de d t o r e du c e H P A i n m a l e m i c e F e m a l e m i c e ha ve s e r um P he l e ve l s 1. 5 t i m e s hi gh e r t ha n m a l e s O t he r s t udi e s ha ve s ugge s t e d r A A V 2 D N A i s r e t a i ne d a t a bout 7 f ol d hi ghe r l e ve l s i n m a l e s t ha n i n f e m a l e s a l t hough t hi s m a y de pe nd on ve c t or dos e 1 2 3 B a s e d on t he s e num be r s t e n t o f our t e e n f ol d m or e ve c t or m a y be ne e de d t o c ur e P ah e n u 2 f e m a l e s H ow e ve r t he f e m a l e s w e r e not c or r e c t e d a t a dos e 20 f ol d h i ghe r t ha n i n t he m a l e s s ugge s t i ng t ha t a ddi t i ona l m e c ha ni s m s m a y c a us e t he obs e r ve d di f f e r e nc e i n t he t he r a py r e s pons e M ul t i pl e s t udi e s a r e i n pr og r e s s t o a t t e m pt t o e l uc i da t e t he m a l e a nd f e m a l e di m o r phi s m i n t he r e s pons e t o ge ne t he r a py. W hi l e t hi s w i l l be ke y t ow a r ds c u r i n g m a t e r na l P K U s yndr om e i n t he m i c e a nd pot e nt i a l l y hum a ns t hi s s t udy c onc e nt r a t e d on r e duc i ng ove r a l l ne e de d ve c t or dos e s t o c ur e H P A by t a r ge t i ng t he dom i na nt ne ga t i ve i n t e r f e r e nc e

PAGE 89

76 F i gur e 4 1 r A A V ve c t or m a ps A a nd B s how t he f ul l pl a s m i d m a ps C a nd D s how t he pa c ka ge d D N A A a nd C : C B m P A H B a nd D : C B m P A H W P R E

PAGE 90

77 F i gur e 4 2 S e r um phe nyl a l a ni ne l e ve l s a f t e r ge ne t he r a py w i r h r A A V 2. M a l e m i c e t r e a t e d w i t h 3 00x10 1 0 I U C B m P A H ha d no r m a l p he nyl a l a ni ne l e ve l s 2 w e e ks a f t e r t r e a t m e nt S i m i l a r r e s ul t s w e r e ob t a i ne d w i t h 1 30x10 1 0 I U C B m P A H W P R E F e m a l e m i c e r e s ponde d m i l dl y t o a 3. 00x10 1 1 I U C B m P A H W P R E

PAGE 91

78 F i gur e 4 3 P A H a m ount s i n m ous e l i ve r A l l r e s ul t s a r e s how n r e l a t i ve t o w i l d t ype a m ount s m R N A a ve r a ge s + / s t a nda r d e r r or N = 8, N = 7, N = 8. P r o t e i n a ve r a ge s + / s t a nda r d de vi a t i on, N = 13, N = 12, N = 1 2 r e s pe c t i ve l y. A c t i vi t y a ve r a ge s + / s t a nda r d de vi a t i on, N = 9, N = 8, a nd N = 13.

PAGE 92

79 F i gur e 4 4 C l oni ng s t r a t e gy f or c ons t r uc t i on o f C B m P A H F 2 63S P C R m ut a ge ne s i s w a s us e d t o c r e a t e t he ne c e s s a r y ba s e c ha nge s t o m a ke m P A H F 263S T he P C R pr oduc t a f t e r ge l pur i f i c a t i on w a s s ubc l one d i nt o p G E M T m P A H T he f ul l ge ne m P A H F 263S w a s c l one d i nt o t he C B ve c t or a f t e r a c or r e c t s e que nc e w a s obt a i ne d.

PAGE 93

80 F i gur e 4 5 T e s t t r a ns f e c t i ons w i t h C B m P A H a nd C B m P A H F 263S A C B m P A H F 263S s e r i a l t r a ns f e c t i ons a na l yz e d by W e s t e r n bl ot t i ng s how i nc r e a s e d P A H s i gna l w he n t ot a l D N A t r a ns f e c t e d i s i nc r e a s e d. B C B m P A H s e r i a l t r a ns f e c t i ons a na l yz e d by a c t i vi t y a s s a y, r e l a t i ve i n c r e a s e s of t r a ns f e c t e d D N A a m ount s a r e i ndi c a t e d. A l t hough not qui t e l i ne a r t he a c t i vi t y doe s i nc r e a s e a s m or e m P A H w a s t r a ns f e c t e d.

PAGE 94

81 F i gur e 4 6 M i xe d t r a ns i e nt t r a ns f e c t i on r e s ul t s C ot r a ns f e c t i o ns of C B m P A H a nd C B m P A H F 263S w e r e pe r f o r m e d a nd t he a c t i vi t y a s s a y r e s ul t s a r e s how n. R a t i os i n t he f i r s t l i ne of t he da t a t a bl e a r e m ol a r r a t i os o f C B m P A H : C B m P A H F 263S

PAGE 95

82 F i gur e 4 7 W e s t e r n bl ot of na t i ve P A G E w i t h m i xe d t r a ns f e c t i on s a m pl e s L a ne 1: C B m P A H de l t a e x13 W P R E L a ne 2: C B m P A H W P R E L a ne 3: C B m P A H : C B m P A H F 263S L a ne 4: 2C B m P A H : C B m P A H F 263S

PAGE 96

83 C H A P T E R 5 D E S I G N I N G A H A M M E R H E A D R I B O Z Y M E A G A I N S T P H E N Y L A L A N I N E H Y D R O X Y L A S E I n or de r t o pr e ve nt t he dom i na nt ne ga t i ve i nt e r f e r e nc e be t w e e n nor m a l a nd m u t a t e d P A H s ubuni t s a s de s c r i be d i n C ha pt e r 4, t w o ha m m e r he a d r i boz ym e s w e r e de s i gne d t o t a r ge t e ndoge no us m P A H T hi s c ha pt e r pr e s e nt s t he i n v i t r o t e s t s pe r f or m e d w i t h t he s e r i boz ym e s t he c l oni ng of a r e c om bi na nt A A V ve c t or f o r t he e xpr e s s i on of t he s e l e c t e d r i boz ym e i n v i v o a nd c e l l c ul t ur e e xpe r i m e nt s us i ng t he r i boz ym e t o de m ons t r a t e dom i na nt ne ga t i ve i nt e r f e r e nc e H am m e r h e ad R i b oz y m e D e s i gn f or m P A H T he m ous e P A H c D N A w a s s e a r c he d f or s ui t a bl e N U X s i t e s ( N i s a ny nuc l e ot i de a nd X i s a nyt hi ng bu t gua nos i ne ) S i nc e G U C a nd A U C ha ve be e n f ound t o be m or e a c t i ve c l e a va ge s i t e s onl y t hos e t w o c om bi na t i ons w e r e l ooke d f or i n t he c D N A 1 0 3 F or e a c h pos s i bl e c l e a va ge s i t e t he s ur r ound i ng 12 nu c l e ot i de t a r ge t a nd t he ne c e s s a r y r i boz ym e w e r e c he c ke d f o r opt i m a l f ol di ng us i ng M F O L D 1 2 4 1 2 5 O nl y t a r ge t s i t e s w i t hout s e l f bi ndi ng a nd r i boz ym e s w i t h f r e e hybr i di z i ng a r m s i n t he i r be s t c onf or m a t i ons w e r e f u r t he r c he c ke d w i t h 100 o r s o ba s e s of t he t a r ge t r e gi on f or f ol di ng T w o s i t e s w i t h c l e a va ge s i t e A U C t he c odon f o r i s ol e uc i ne w e r e s e l e c t e d c or r e s pondi ng t o pos i t i ons I 94 a nd I 209 ( F i gu r e 5 1 ) B ot h s e que nc e s f or t he 12 nuc l e ot i de t a r ge t s a nd f ul l l e ngt h r i boz ym e s 33 nuc l e ot i de s w e r e o r de r e d a s R N A ol i gos f r om D ha r m a c on. I n V i t r o R i b oz y m e T e s t s T he f i r s t t e s t f or r i boz ym e a c t i vi t y i s a t i m e c ou r s e a na l ys i s t o m e a s ur e t he c l e a va ge r a t e of t he r i boz ym e a ga i ns t i t s t a r ge t T h i s i s done w i t h e xc e s s t a r ge t a nd w i t h a hi gh

PAGE 97

84 concentration of magnesium, 20mM, to allow for maximal ribozyme folding and stability. Based on protocols developed by Fritz et al. (2002), each target was end labeled with $ [ 32 P] ATP. 111 Ribozyme and target were mixed in a 10:1 target to ribozyme ratio for time course analyses and samples were taken at various time points The samples were electrophoresed on 8 M urea, 8% acrylamide, 1 X TBE sequencing gels and analyzed with a PhosphorImager (Molecular Dynamics, Sunnyvale CA). One of the two ribozymes, RzI209, was found to be very active, with 70% of the target cleaved by 4 minutes ( Figure 5 2). Further experiments were done with that particular ribozyme only, since ribozyme I94 was not as active. A second time course of cleavage reactions was performed with RzI209 at 5 mM MgCl 2 in order to simulate a more physiological magn esium concentration and with the same 10:1 ratio of target to ribozyme. The ribozyme was still very active: fifty percent of the target was cleaved by 4 minutes ( Figure 5 3). Kinetic properties of the ribozyme were determined in vitro at 5 mM MgCl 2 Ten d uplicate reactions were set up with increasing target to ribozyme ratios from 0:1 to 1000:1. Each reaction was allowed to go for 1 minute, where on the previous time course it was found that 10 to 20% of the target was cleaved. A saturation curve was gener ated after running the samples on a gel and analyzing with the PhosphorImager ( Figure 5 4A). The kinetic parameters of the ribozyme were determined from the equation of the line on the Lineweaver Burke plot (Figure 5 4 B). The ribozyme could catalyze about 41 reactions per minute (Table 5 1). A last in vitro experiment was meant to test RzI209s ability to cleave the full length target as opposed to the short target that had been ordered from Dharmacon. Using

PAGE 98

85 the pGEM T mPAH construct, an RNA, correspondin g to the full length mRNA, was transcribed with T7 polymerase. The transcribed product was incubated at 20 mM MgCl 2 with excess ribozyme at 37 C. Samples taken at one and two hours were run on a 5% PAGE 8 M Urea gel, and both cleavage products, 842 and 660 bases, were detected on the gel ( Figure 5 5). Ribozyme I209 is capable of cleaving full length PAH mRNA in an in vitro reaction. Table 5 1 Ribozyme I209 kinetic properties. V max 625.00 nM/min K m 12104.38 nM k cat 41.67 min 1 Cloning RzI209 into p21 n hp and Designing a Ribozyme Resistant mPAH The chosen rAAV vector for expressing the ribozyme, p21 newhp is based on pTR UF12. It contains the hybrid CMV enhancer and chicken actin promoter that is closely related to the hybrid promoter contained in the CB mPAH plasmids. The hCMV enhancer in p21 newhp is 381 nucleotides long of which 361 nucleotides from the 3 end are identical to the 3 end of the hCMV enhancer on CB mPAH which is 535 nucleotides in total. The p21 newhp plasmid is designed to express th e ribozyme from the CB promoter and follows the hammerhead ribozyme with a hybrid hairpin ribozyme to evenly cleave the 3 ends of the transcripts to allow the ribozyme maximum ability to reach its target mRNA. 125 The ribozyme is followed by an SV40 polyA, 187 nucleotides that is identical to the 5 end of the SV40 polyA in CB mPAH which is 222 nucleotides long. The ribozyme vector also includes a neomycin cassette driven by the PYF 441 enhancer and an HSV thymidine kin ase promoter followed by a bovine growth hormone polyA (BGHpA) signal that is identical to the BGHpA on the CB mPAH WPRE plasmid, both 208 nucleotides long.

PAGE 99

86 DNA oligonucleotides corresponding to ribozyme I209 sense and antisense sequences with added restr iction sites Spe I and Hind III were ordered from Sigma Genosys. The oligos were purified on a polyacrylamide gel, and subsequently annealed and ligated into the p21 newhp rAAV vector, renamed CB RzI209 ( Figure 5 6). Sure Cells (Stratagene) were used for b acterial transformations. All clones were sequenced at the Sequencing Core and screened for ITR retention. Since the vector derived mRNA would also be cleaved by the ribozyme, a ribozyme resistant construct of mouse PAH was designed by changing the cleavi ng and hybridization sequences targeted by the ribozyme. Directed mutagenesis of mPAH was achieved using synthetic DNA oligonucleotides as PCR primers ( Table 2 3). The 5 primer contained the desired base changes, which were silent mutations ( Figure 5 7). A 322 base pair PCR product was gel purified and ligated into pGEM % T (Promega). After bacterial transformations into XL1 Blue MRF cells (Stratagene) and sequencing of the obtained clones, the fragment was cut from pGEM T, moved to pGEM T mPAH plasmid. Th e resistant mPAH gene was named mPAH Hd. The new cDNA was cloned into the CB backbone and CB WPRE backbone. Bacterial transformations into Sure cells was followed by sequencing of clones obtained. Large DNA preparations were performed with Qiagens Plasmid Giga Kit. Ribozyme I209 Is Active In Vivo The mouse PAH and the ribozyme constructs utilize the CMV immediate early enhancer, the chicken actin promoter (with the first intron) and the rabbit globin exon as the splice site acceptor. HEK 293 cells were transiently transfected with the purified vector DNA constructs using calcium phosphate. The promoter strengths being

PAGE 100

87 equal, the plasmids are thus transfected in relative amounts using micrograms of DNA as a measure. This can be translated into molar rati os since the plasmids are less than one hundred eighty base pair different in size. Various combinations of the vectors were used while keeping the total DNA amount in each assay constant. After 48 72 hours approximately 3 X 10 6 cells were harvested, homo genized and a clear extract was obtained by centrifugation. The extracts are used immediately in the spectrophotometric PAH activity assay and a Lowry protein concentration assay. Ribozyme I209 was first checked for expression in HEK 293 cells. Ten microg rams of CB RzI209 was transfected into the cells and harvested with TRIzol for RNA extraction. Using the 5 sequencing primer for p21 newhp at position 1856 and the antisense oligonucleotide of RzI209, a reverse transcription reaction was performed followe d by PCR amplification with Promegas AccessQuick TM RT PCR kit. The ribozyme was easily detected in the sample ( Figure 5 8), thus it is expressed and relatively stable in the cells. The samples were electrophoresed on a 2% agarose 1 X TAE gel, and the ribo zyme product, while clearly visible, was not well separated from primer to primer amplification products so subsequent RT PCR reaction samples were thus electrophorsed on 15% polyacrylamide 1X TBE gels. The ribozyme was then tested for its ability to clea ve mPAH and reduce the total potential activity in the transfections. Combinations of CB mPAH and CB RzI209 were transfected into cells and assayed for activity as compared to a no ribozyme transfection (normalized for the maximum amount of DNA transfected in the experimental set with p21 newhp). Ratios of 1 to 4, 1 to 5 and 1 to 10 were tested. Phenylalanine hydroxylase activity was reduced to 70% at 1:4, 40% at 1:5 and 20% at 1:10 ( Figure 5 9). These ratios

PAGE 101

88 are consistent with early ribozyme studies that had predicted a need for 10 fold excess of ribozyme to target for inactivation of gene function. 126 Moreover in the long trancript cleavage reaction at a 4 to 1 ratio of ribozyme to target, the target was still present after 2 hours consistent with the need of a 10:1 excess of ribozyme to fully reduce PAH activity in vivo When RzI209 was similarly tested against C B mPAH Hd, the ribozyme was ineffective in reducing PAH activity ( Figure 5 9). 127 Ribozyme I209 Can Overcome Dominant Negative Interference Since CB mPAH Hd encod es RNA that was shown to be resistant to the RzI209, the mixed transfection experiments presented in Chapter 4 were repeated with CB mPAH Hd instead of CB mPAH. CB RzI209 was added to the mixed transfections of CB mPAH Hd and CB mPAH F263S to test its abil ity in preventing the dominant negative effect produced by the monomers interactions by selectively cleaving mPAH F263S and reducing the amount of mutant monomer produced in the cells. Ratios of 1 to 1 and 1 to 2 CB mPAH to CB mPAH F263S were used in thes e experiments with added CB RzI209 at an equal amount to CB mPAH Hd. The results show that RzI209 can reverse the dominant negative effect produced by the interaction of normal and mutant monomer ( Figure 5 10). The effect of the ribozyme at this single dos e is greater when less CB mPAH F263S is present. While a ratio of 1:10 was needed to lower PAH activity to 20% or normal, a ratio of 1:1 was sufficient here to restore PAH activity. As hypothesized in the first transfection tests, a small accumulation of f unctional tetramers in this imperfect system is probably enough to regain much activity, so a 1:1 ratio of mPAH Hd and ribozyme is enough to allow the accumulation of functional tetramers leading to the gain in activity.

PAGE 102

89 To verify that the gain in activit y in the ribozyme transfected samples in figure 5 10 is the specific result of RzI209 activity, two null ribozymes were designed and cloned into p21 newhp. Both null ribozymes have a G to C base change at position 8, this base is required for catalysis thu s both ribozymes should be unable to catalyze a cleavage reaction (Figure 5 11). 126 The second null ribozyme, N ull 2, has two base pair changes in the hybridizing arms of the ribozyme to prevent it from properly binding the target mPAH and thus preventing any antisense effect ( Figure 5 11 panel B). The cloning procedure for the null ribozymes was done exactly as de scribed for RzI209. Both null ribozymes were tested in cell transfections. The co transfections of CB mPAH and CB mPAH F263S were repeated and each null ribozyme was added to the combination in the same DNA amount. The activity of the cell lysates when e ither null ribozyme is added is around 60% of an mPAH only sample ( Figure 5 12). While this is somewhat higher in activity than the mPAH: mPAH F263S transfection, 50%, a mild antisense effect may be possible even though Null 2 is not supposed to bind to mP AH F263S. Nonetheless, this shows that the large gain in activity seen when RzI209 is added to the double transfection is specific to the ribozymes activity. Discussion Ribozyme I209 was found to be active in mammalian cells, and capable of specifically cleaving its target. Specificity of ribozyme activity has been shown in a number of studies. 105,128 The construction of the resistant mPAH Hd was relatively simple, and 3 base changes were sufficient to ensure cleavage specificity as detected with the PAH activity assay. Creating an endogenously targeted ribozyme and a resistant cDNA for the treatment of genetic diseases can be done with simple molecular biology methods. The in vitro methods used in this chapter successfully selected an active

PAGE 103

90 r i boz ym e W hi l e R N A ol i gos a r e e xpe ns i ve t he i n v i t r o t e s t s a r e m or e s t r a i gh t f or w a r d a nd t i m e s a vi ng t ha n c l oni ng a nd c e l l c ul t ur e w o r k m a ki ng i t w or t hw hi l e t o t e s t a s e r i e s of r i boz ym e s i n v i t r o be f or e i nve s t i ng m uc h t i m e a nd e f f or t i n i n v i v o s t udi e s W he n t he r i bo z ym e ve c t or w a s a dde d t o t he m i xe d ve c t or t r a ns f e c t i ons a r e ve r s a l of t he obs e r ve d dom i na nt ne ga t i ve i nt e r f e r e nc e a n d a ga i n i n P A H a c t i vi t y oc c ur r e d U s i ng t he nul l r i boz ym e s i n t he s a m e s e t t i ng s how e d t ha t t he e f f e c t i s s pe c i f c t o R z I 209. T hus t he r i bo z ym e c a n be t e s t e d i n c om bi na t i on w i t h t he r e s i s t a nt m P A H ge ne i n t he a ni m a l m ode l t o e va l ua t e t he a ppr oa c h i n a t r ue i n v i v o s e t t i ng. N ot on l y di d t he s e e xpe r i m e nt s s how t he e f f e c t i ve ne s s of t he r i boz ym e i n c ul t ur e d c e l l s t he y de f i ni t i ve l y de m ons t r a t e t h a t dom i na nt ne ga t i ve i nt e r f e r e nc e w a s t he c a us e of t he r e duc t i on of P A H a c t i vi t y s e e n i n t he m i xe d t r a ns f e c t i ons w i t h t he F 2 63S m ut a nt p r ot e i n.

PAGE 104

91 F i gur e 5 1 M ous e P A H r i boz ym e de s i gns R i boz ym e s a r e a l i g ne d t o t he i r t a r ge t s w i t h c l e a va ge t a r ge t s i t e i n r e d ( A a nd B ) O pt i m a l f ol di ng c onf or m a t i ons o f t he r i boz ym e s a s de t e r m i ne d by M F O L D G C bonds a r e i ndi c a t e d i n r e d, A U i n bl ue ( C a nd D ) A C R i boz ym e I 94 B D R i boz ym e I 209.

PAGE 105

92 F i gur e 5 2 T i m e C our s e a na l ys e s w i t h r i boz ym e s a t 20m M M gC l 2 T i m e i s i ndi c a t e d i n m i nut e s A R i boz ym e I 94 f a i l e d t o e f f e c t i ve l y c l e a ve i t s t a r ge t B R i boz ym e I 209 c l e a ve d 43% of i t s t a r ge t by 1 m i nut e

PAGE 106

93 F i gur e 5 3 T i m e C our s e a na l ys i s of r i boz ym e I 209 a t 5m M M gC l 2 A G e l of s a m pl e s f r om t i m e c our s e t i m e i s i n m i nut e s B F r a c t i on o f t a r ge t c l e a ve d pl ot t e d ove r t i m e F i f t y pe r c e nt of t he t a r ge t w a s c l e a ve d by 4 m i nut e s

PAGE 107

94 F i gur e 5 4 R i boz ym e I 209 ki ne t i c a na l ys i s A S a t u r a t i on c ur ve B L i ne w e a ve r B ur ke P l ot ge ne r a t e d f r om A

PAGE 108

95 F i gur e 5 5 L ong t a r ge t c l e a va ge a na l ys i s T i m e i s i ndi c a t e d i n m i nut e s B ot h c l e a va ge pr oduc t s w e r e de t e c t e d a t 1 a nd 2 hou r s

PAGE 109

96 F i gur e 5 6 C B R z I 209. T he p r om ot e r i s t he s a m e a s t ha t f or C B m P A H T he r i boz ym e i s f ol l ow e d by a n i nt e r na l l y pr oc e s s i ng ha i r pi n r i boz ym e

PAGE 110

97 F i gur e 5 7 C l oni ng s t r a t e gy f or t he c ons t r uc t i on of a r i boz ym e r e s i s t a nt m P A H c l one P C R m ut a ge ne s i s w a s pe r f or m e d t o s e l e c t i ve l y c h a nge ba s e s i n or de r t o r e nde r m P A H r e s i s t a nt t o R z I 209. A f t e r ge l pu r i f i c a t i on, t he P C R pr oduc t w a s s ubc l one d i nt o pG E M T m P A H T he f ul l l e ngt h m ut a g e ni z e d c D N A m P A H H d, w a s c l one d i nt o t he C B ve c t or

PAGE 111

98 F i gur e 5 8 C B R z I 209 s t a bl y e xpr e s s e s R z I 209 i n 293 c e l l s T e n m i c r og r a m s of C B R z I 209 D N A w a s t r a ns f e c t e d i nt o 293 c e l l s a nd t h e c e l l s w e r e c ol l e c t e d us i ng T R I z ol f o r R N A e xt r a c t i ons A f t e r a n R T P C R r e a c t i on, t he r i boz ym e i s s how n t o be s t a bl y e xpr e s s e d i n t he c e l l s a s c om pa r e d t o a c t i n l e ve l s N o r e ve r s e t r a ns c r i pt a s e c ont r ol r e a c t i ons w e r e done f or bot h s e t s of pr i m e r s

PAGE 112

99 F i gur e 5 9 C B m P A H H d i s r e s i s t a nt t o t he r i boz ym e T r a ns f e c t i ons of i nc r e a s i ng r a t i os of C B R z I 209 t o C B m P A H s how de c r e a s e d P A H a c t i vi t y i n t he s pe c t r ophot om e t r i c a s s a y. S i m i l a r r a t i os of C B R z I 209 t r a ns f e c t e d w i t h C B m P A H H d do not s how a ny de c r e a s e s i n P A H a c t i vi t y.

PAGE 113

100 F i gur e 5 10 R i boz ym e I 209 s uc c e s s f ul l y pr e ve nt s dom i na nt ne ga t i ve i nt e r f e r e nc e i n 293 c e l l s W he n C B R z I 209 i s c o t r a ns f e c t e d w i t h a 1: 1 r a t i o of C B m P A H a nd C B m P A H F 263S t he P A H a c t i vi t y r e m a i ns a t ne a r nor m a l l e ve l s T he P A H a c t i vi t y i s a l s o m i l dl y hi ghe r i n t h e l ys a t e s of 1: 2 r a t i os of m P A H t o m P A H F 26 3S t r a ns f e c t i ons t ha t i nc l ude t he r i boz ym e pl a s m i d.

PAGE 114

101 F i gur e 5 11 N ul l r i boz ym e de s i gns A N ul l 1 r i boz ym e B N u l l 2 r i boz ym e I n r e d i s t he t a r ge t s i t e o f t he r i boz ym e s B ol d t e xt i ndi c a t e s t he nuc l e ot i de c ha nge s m a de t o t he s e que nc e of R z I 209 T he c a t a l yt i c G h a s be e n c ha nge d t o a C i n bot h N ul l 1 a nd 2. N ul l 2 ha s e xt r a ba s e c ha nge s i n s t e m s I a nd I I I

PAGE 115

102 F i gur e 5 12 T he nul l r i boz ym e s do not pr e ve nt dom i na nt ne ga t i ve i nt e r f e r e nc e N e i t he r nul l r i boz ym e s w e r e a bl e t o r e ve r s e t he do m i na nt ne ga t i ve i nt e r a c t i on be t w e e n m P A H a nd m P A H F 263S i n c e l l t r a ns f e c t i ons

PAGE 116

103 C H A P T E R 6 G E N E T H E R A P Y F O R P H E N Y L K E T O N U R I A R i boz ym e I 209 w a s f ound t o be a c t i ve i n v i v o a nd a bl e t o pr e ve nt do m i na nt ne ga t i ve i nt e r f e r e nc e F or t he a ni m a l e xpe r i m e nt s C B m P A H H d W P R E w a s us e d s i nc e t he W P R E e na bl e s l ow e r ve c t or dos e s t o c ur e H P A a s c om pa r e d t o t he ve c t or w i t hou t t he s t a bi l i z i ng e l e m e nt T he V e c t or C or e pa c ka ge d bot h C B m P A H H d W P R E a nd C B R z I 209 ( S a l I ) i nt o r A A V 2, t he A A V s e r ot ype t ha t w e ha ve us e d s uc c e s s f ul l y i n m a l e m i c e T he f i r s t pa r t o f t he e xpe r i m e nt c ons i s t e d of de t e r m i ni ng a dos e r e s pons e c ur ve f o r t he r A A V 2 C B m P A H H d W P R E ve c t or O nc e de t e r m i ne d, a n i ne f f e c t i ve dos e o f r A A V 2 C B m P A H H d W P R E w oul d be c om bi ne d w i t h i nc r e a s i ng dos e s of r A A V 2 C B R z I 209 ( S a l I ) t o t e s t t he a bi l i t y of t he r i boz ym e i n v i v o t o e nha nc e t he e f f e c t o f t he ge ne t he r a py ve c t or by l ow e r i ng t he e ndoge nous m R N A a m ount s t hus e ndoge nous pr ot e i n s ynt he s i s a nd t he dom i na nt ne ga t i ve i nt e r f e r e nc e D os e R e s p on s e i n B T B R P ah e n u 2 M al e s t o r A A V 2 C B m P A H H d WP R E A t ot a l of t w e l ve c e l l f a c t or i e s w e r e t r a ns f e c t e d w i t h t he ve c t or D N A c om bi ne d i nt o t w o 1m L t ube s S i nc e t he t i t e r s w e r e s i m i l a r b e t w e e n t he t w o ba t c he s of vi r us t he y w e r e m i xe d t oge t he r a nd t he t i t e r s a ve r a ge d ( T a bl e 6 1) T he vi r us s t oc k w a s br i e f l y t ha w e d be f or e us e ke pt on i c e du r i ng s ur ge r i e s a n d s t or e d a t 70 C A dul t m a l e m i c e w e r e bl e d i n t he w e e ks pr i or t o s ur ge r y t o obt a i n b a s e l i ne s e r um P he l e ve l s S ur ge r i e s w e r e pe r f or m e d a s de s c r i be d i n c ha pt e r s 2 a nd 3. T he dos e s s e l e c t e d w e r e ba s e d on pr e vi ous ge ne t he r a py r e s ul t s O ne a ni m a l i nj e c t e d w i t h a h i gh dos e 4. 00x10 1 0 i nf e c t i ous uni t s ( I U ) w a s a nt i c i pa t e d t o be c ur e d of hype r phe nyl a l a ni ne m i a T he ne xt dos e

PAGE 117

104 1.33x10 10 IU, was also expected to be fully effective and was injected into two animals. One third of that dose was injected into two more animals, 4.28x10 9 IU, and the lowest dose, 1.43x10 9 IU was injected into the two final animals. One mouse received 0.3 mL of LRS as a no vector control animal. One week after surgery, the animals were bled, and this was repeated every week for six weeks, then every two weeks for another month, at which point the mice were bled on 4 to 6 week intervals until they died, or were sacrificed at week 36 after surgery. The doses injected behaved according to our predictions ( Figure 6 1). Both 4.00x10 10 IU and 1.33x10 10 IU lowered serum Phe levels to the normal range, 4.28x10 9 IU lowered serum Phe in the two animals to between 0.60 to 0.80 mM, and 1.43x10 9 IU had no detectable effect on serum Phe levels. Based on these results, we had a dose response curve with a known minim um effective dose, a partially effective dose, and a threshold ineffective dose of rAAV2 CB mPAH Hd WPRE in male mice. Table 6 1 rAAV2 CB mPAH Hd WPRE vector titers. Reference number Particle count (vector genomes) Infectious units 1703 1708 3.44x10 13 4.00x10 11 1709 1714 3.67x10 13 5.50x10 11 Average 3.56x10 13 4.75x10 11 At week 24 after gene therapy, a phenylalanine loading experiment was designed, similar to experiments performed by Scriver et al. in 2000. 116 Each animal still alive from the dose response study was injected subcutaneously with 0.8 mg L Phe per gram of body weight, and timed b lood samples were taken for the next 24 hours to determine the rate of phenylalanine clearance. A control adult male PKU mouse and a heterozygote male mouse were also added to this experiment. The animals were kept in standard housing with normal chow and unlimited water: their baseline Phe levels were at the same levels they had been during the past 24 weeks. The blood samples taken were 25 L

PAGE 118

105 to 30 L at each time point, taken at time 0 prior to the injection, 1.5, 3, 6, 12 and 24 hours post injection. Th is came to a maximum of 180 L of blood drawn during that period of time. The animals were allowed to recuperate for 2 weeks prior to their next scheduled bleed since the normal weekly blood sample is around 80 l. The highest phenylalanine values observe d were at 1.5 hours post injection. Each animal had a different highest serum Phe value and baseline value: the data was plotted on a relative scale from the highest value at 1.5 hours, set to 1.0 on the scale, to the baseline at 0 hour set to 0. Each time point was subsequently plotted giving a relative Phe clearance rate ( Figure 6 2A). From that data, one can clearly see that a heterozygote mouse, with 42% of normal enzyme activity, can clear the phenylalanine load in 3 to 6 hours. The control mice, both LRS and adult PKU mice, cleared the excess phenylalanine between 12 to 24 hours. The unresponsive dose, 1.43x10 9 IU was no different than the control mice. The treated animals at 4x10 10 1.33x10 10 and 4.28x10 9 IUs, which on normal daily food consumption ha ve normal or 0.60 mM serum Phe levels, cleared the excess load in 12 hours. One of the animals, at 4.00x10 10 IU, was sacrificed shortly after the challenge since it did not recuperate well after the many bleeds. Upon necropsy it was determined that the an imal most likely suffered from post renal azotemia: excess accumulation of nitrogen waste products (urea) in the blood due to kidney inefficiency. A bladder infection that caused stones or blockage prior to the loading experiment had gone undetected, and t he phenylalanine load contributed to the azotemia. The animal was sacrificed shortly thereafter since it was not eating and did not look well.

PAGE 119

106 Mice are bled in the late afternoon, at the end of their 12 hour inactivity period. For this phenylalanine chall enge, we started the experiment in the morning since many bleeds were required following the load. When the samples were assayed, we noticed that in the treated animals, the time 0 bleed was higher than their normal afternoon values ( Figure 6 2B). This was not at the time further investigated since insufficient animals were left in the experiment. With a different group of gene therapy treated animals, we have performed timed bleeds: one blood sample was obtained in the morning, and one at the normal time, in late afternoon (Table 6 2). On average, all treated animals, no matter their level of response to the treatment, had higher Phe levels in the morning by approximately 0.27 mM. The LRS animal also had higher levels in the morning by 0.33 mM, equivalent t o untreated Pah enu2 males with 0.34 mM difference. Neither heterozygote nor wild type males have significant differences in their serum Phe levels between morning and afternoon bleeds. The gene therapy animals PAH activity do not clear daily phenylalanine load immediately, but require time, perhaps up to 12 hours, to do so. Heterozygote animals with 42% of normal activity have stable phenylalanine levels throughout the day. Table 6 2 Serum phenylalanine levels for timed bleeds in male Pah enu2 mice. Aver age AM Phe Average PM Phe Difference Gene therapy treated mice DD a DD a 0.27 LRS control 1.53 1.20 0.33 Pah enu2 males 1.23 0.89 0.34 +/ males 0.07 0.05 0.02 +/+ males 0.13 0.12 0.01 a Dose dependent: varies for each gene therapy dose. The followin g samples were saved from all animals at the time of sacrifice: liver, kidney, lung, testes, muscle and spleen for DNA extraction; liver for RNA; and the whole body for necropsy and histologic analysis. The liver samples saved in RNA later TM were

PAGE 120

107 extracted with TRIzol Reagent according to the manufacturers protocol and used for RNase protection assays (RPA). A probe was designed to differentiate between vector derived RNA and endogenous PAH mRNA ( Figure 6 3A). Samples from three animals that died 4 days aft er vector delivery due to surgery complications were saved and analyzed first by RPA. One animal was an LRS control, one had received 4.28x10 9 IU, and one 4.00x10 10 IU of CB mPAH Hd WPRE. Both animals that had received vector were found to express the rAAV 2 derived mPAH at this early time point ( Figure 6 3B). This is consistent with the lowering of serum Phe levels observed one week after surgery in the surviving animals at the same doses. Recombinant AAV type 2 virus DNA is expressed in the liver four days after portal vein injections. All of the animals in the dose response experiment were sacrificed at 36 weeks, one at 26 weeks after the phenylalanine loading experiment, and two died at 20 weeks from undetermined causes. The RNAse protection assay detect ed vector RNA only in the animals that were sacrificed prior to 30 weeks. These animals had received 1.33x10 10 IU and 4.00x10 10 IU respectively ( Figure 6 3C). Both of these animals had responded to the therapy, thus it is consistent that vector mRNA was det ected at those time points. By the end of the experiment, starting around week 24, two of the five remaining animals serum Phe levels began to rise back towards a hyperphenylalaninemic state even though they had previously responded to the gene therapy. N one of these animals had detectable vector RNA in the extracted liver samples (Figure 6 3C). A Southern blot was then performed after DNA was extracted from the frozen liver samples. An mPAH exon 6 probe, 197 nucleotides, was used to detect vector DNA and genomic DNA ( Figure 6 4A). Twenty micrograms of DNA were run after overnight

PAGE 121

108 digestion on a 0.8% agarose 1 X TAE gel and transferred to BioRad ZetaProbe GT membrane. After washing, the membranes were exposed to Kodak BioMax MS film for 48 hours. All anima ls had detectable genomic DNA bands; a heterozygote control DNA sample, the LRS control animal and the only available 1.43x10 9 IU had no detectable vector DNA. Both 4.28x10 9 IU had light, but detectable, vector bands and all three animals at the higher dos es had easily detectable vector quantities ( Figure 6 4B). Liver samples for the 4.00x10 10 IU, both 1.33x10 10 IU, and the LRS control animals were extracted for protein in the standard homogenization buffer with added protease inhibitor cocktail (Sigma). T hese were assayed for PAH activity in the standard assay but with a larger volume of extract (100 l) than the 20 l normally used with fresh liver extracts. Only the two animals with detectable vector RNA had detectable PAH activity ( Figure 6 5). Upon pa thological examination of the livers of these animals, variable levels of changes in the hepatocytes have been found. These changes are consistent with those seen in animals from our previous studies that are suggestive of liver damage after injection with rAAV vectors, especially those that include the WPRE. The typical changes in the livers of the dose response animals were random, diffuse, to mild anisocytosis of the hepatocytes, with intranuclear cytoplasmic invaginations, and chromatin clumping which l ed to pre neoplasty or neoplasty in a number of cases. In this experiment, 3 of the 5 remaining animals at 36 weeks, the 1.43x10 9 IU mouse and both mice at 4.28x10 9 IU, had severe changes in nuclear morphology observed in the liver. The 1.33x10 10 IU animal had fewer changes than the three other animals, but these were still very significant. The LRS mouse had milder changes, but not a completely normal

PAGE 122

109 pathology. While some changes could be due to old age, as the results with the LRS mouse suggests, the sev ere changes observed in the treated animals require more study. Combining an Ineffective Dose of rAAV2 CB mPAH Hd WPRE with Increasing rAAV2 CB RzI209 ( SalI) Doses Dual vector approaches have been used to enhance the packaging capacity of recombinant AAV vectors in the muscle and in the liver. 129 133 These experiments showed that co transduction of cells by two vectors is possible, and we sought to utilize the small percentage of cells that should be co transduced by our vectors to combat the dominant negative interference. Four weeks after the beginning of the dose response study, the lowest dose used of CB mPAH Hd WPRE, 1.43x10 9 IU, was combined with increasing amounts of CB RzI209 ( SalI). One, three, six, and twelve times more than 1.43x10 9 IU of the ribozyme vector was co injected into adult male mice. A total of three animals were injected with rAAV2 CB mPAH Hd WPRE only, one was injected with the one to one ratio of CB mPAH Hd WPRE to CB RzI209 ( SalI), two at 1:3, two at 1: 6 and two were injected at 1:12. While some decreases in serum Phe levels were observed up until week 5, every mouse returned to background serum Phe levels by week 10 until week 24, the end of the experiment for the majority of the animals ( Figure 6 6). RNAse protection assays were done with liver RNA samples from these animals. No sample had detectable amounts of vector mPAH message present, which is consistent with the lack of response to the gene therapy. The density of endogenous PAH and actin bands o n the films were measured by laser densitometry to normalize all results and compare the amounts of endogenous PAH present. The LRS control mice, and the 1:0 mice all had relative PAH amounts ranging between 1.5 to 3.0 ( Figure 6 7). The 1:1

PAGE 123

110 mouse, one 1:6, and both 1:12 mice had PAH amounts that came out below 1, indicative of ribozyme activity in vivo DNA was extracted from frozen liver samples of the animals. The same Southern blot design as described in figure 6 4A was performed with these samples. The genomic DNA band was easily detectable in all samples with the exon 6 probe, and both 1:3 and both 1:12 mice had faint vector bands (Figure 6 8B). The small probe (197 nucleotides) is either not sensitive enough to detect this low dose of injected vector DNA, or the DNA was not stabilized in the hepatocytes. The CB RzI209 ( SalI) DNA was detected in both 1:3 mice, one 1:6 mouse and both 1:12 mice using the hCMV probe (Figure 6 8A and C). The 1:6 mouse and both 1:12 mice had reduced endogenous PAH mRNA leve ls as detected by the RNase protection assay in Figure 6 7. Only one of the 1:3 mice had a piece of liver saved for RNA analysis and this mouse was kept for 32 weeks after gene therapy (the second 1:3 mouse was disovered dead in its cage and only a liver p iece for DNA was saved). Although both vector bands were detectable in the Southern blots, the endogenous PAH signal was not significantly reduced in the RPA analysis. Gene Therapy with a Mildly Effective Dose of rAAV2 CB mPAH Hd WPRE and Increasing Amoun ts of rAAV2 CB RzI209 ( SalI) As soon as the animals from the previous experiment were determined unresponsive to the dual injections of CB mPAH Hd WPRE and CB RzI209 ( SalI), it was decided to attempt combining the mildly effective dose of rAAV2 CB mPAH H d WPRE with various amounts of rAAV2 CB RzI209 ( SalI). So 4.28x10 9 IU of CB mPAH Hd WPRE was co injected with CB RzI209 ( SalI) into adult male mice: one control mouse, two at 1:0, two at 1:3, and one at 1:5 ratios of the respective vectors. All animals l owered their serum Phe levels to between 0.60 mM to 0.80 mM for 24 weeks,

PAGE 124

111 the duration of the experiment ( Figure 6 9). Unfortunately no difference between any of the animals was observed, the ribozyme vector seemingly had no effect on the gene therapy. Di scussion Prior results in our lab had led us to develop an rAAV vector containing the WPRE element. This vector is two fold more effective in vivo than the CB mPAH vector. In this study we report the results of a careful dose response study for the treatme nt of PKU in male mice with two effective doses, one mildly effective dose and one ineffective dose. Even though cured, the phenylalanine loading experiment showed that the mice are far from able to handle a phenylalanine challenge. This form of therapy is thus not ready for the challenge of pregnancy in females, since upon a greater than normal dietary intake, the Phe levels are likely to rise above acceptable concentrations for a safe pregnancy outcome. The results of the RPA with the four day samples sh ow that rAAV DNA is expressed very shortly after portal vein injections. The lowest dose available at the early time point, 4.28x10 9 IU, is equivalent to 4.28x10 11 vector genomes. This means an approximate multiplicity of infection (MOI) of 4000 was delive red to the liver, assuming 1x10 8 hepatocytes per 30 gram mouse. It is very probable that such a quick onset of expression is the result of positive and negative polarity single stranded DNA annealing to form dsDNA rAAV monomers inside the same cell, and th us allow the quick expression of the delivered gene. 134 The animals were kept for 36 weeks after gene therapy but we noticed a loss of effectiveness starting around week 24, or 6 months. No samples obtained after 26 weeks had detectable vector message or liver PAH activity. Since vector DNA presence was

PAGE 125

112 c onf i r m e d by S out he r n bl ot o f l i ve r s a m pl e s a nd b ot h 1. 33x10 1 0 I U m i c e s how e qui va l e nt ve c t or D N A a m ount s w i t h one m ous e ha vi ng be e n s a c r i f i c e d a t 20 w e e ks a nd t he s e c ond a t 36 w e e ks t he l os s of e f f e c t i ve ne s s i s not a t t r i but e d t o l os s of ve c t o r D N A T hi s s e e m s unl i ke O h s s t udy i n 2004, i n w hi c h l os s of D N A e xpl a i ne d t he l os s of e f f e c t i ve ne s s i n t he r a py. 7 0 A l l o f ou r c om bi ne d e vi de nc e s ugge s t s t ha t s om e t i m e a f t e r 26 w e e k s ve c t or t r a ns c r i pt i on i s s hut of f t he ge ne t he r a py e f f e c t i s gr a dua l l y l os t a nd no P A H a c t i vi t y nor ve c t or P A H m e s s a ge c a n be de t e c t e d a t 36 w e e ks a f t e r s ur ge r y U pon pa t hol ogi c a l e xa m i na t i on, w e ha ve obs e r ve d m i l d t o s e ve r e c ha nge s i n t he l i ve r c e l l m o r phol ogy a nd a n i nc r e a s e d i nc i de nc e o f c a nc e r i n t he m i c e W P R E ha s r e c e nt l y be e n i m pl i c a t e d a s t he pos s i bl e l i nk be t w e e n i nc r e a s e d t um or i ge ne s i s a f t e r ge ne t he r a py due t o t he pr e s e nc e of pa r t i a l H bX pr ot e i n s e que nc e s i n t he e nha nc e r e l e m e nt 1 3 5 I nc r e a s e d c a r c i nom a i n a ni m a l s t r e a t e d by r A A V h a s be e n r e por t e d i n t he l i t e r a t u r e 1 3 5 1 3 6 T he m a r ke d nuc l e a r c ha nge s c oul d e xpl a i n t he l os s of t he ge ne t he r a py e f f e c t be yond 26 w e e ks but t he e xa c t m e c ha ni s m i s s t i l l unknow n a t t hi s poi nt a s i s t he e xa c t c a us e of t he s e nuc l e a r c ha nge s D ua l ve c t or a ppr oa c he s ha ve be e n us e d t o e nha nc e t he c a pa c i t y of r A A V ve c t or s W hi l e m or e s uc c e s s f ul i n m us c l e c o t r a ns duc t i on of l i ve r c e l l s by t w o s e pa r a t e ve c t or s ha s be e n s how n t o oc c ur i n 42% of t o t a l t r a ns duc e d he pa t oc yt e s a s e va l ua t e d by F I S H 1 3 7 U nf or t una t e l y t hi s t r a ns l a t e s t o onl y a bout 1% of t ot a l l i ve r he pa t oc yt e s w he n us i ng a dos e of 1x10 1 1 ve c t or ge nom e s pe r ve c t or S i nc e o t he r gr oups ha d p r e di c t e d t ha t on l y 10% of nor m a l P A H a c t i vi t y w oul d be ne e de d t o r e ve r s e hype r phe nyl a l a ni ne m i a i n t he m i c e w e de l i ve r e d bot h o f our ve c t or s i n a s i ngl e por t a l ve i n i n j e c t i on i nt o a dul t m a l e m i c e i n t he hope s t ha t a s m a l l pe r c e nt a ge o f c o t r a ns duc e d c e l l s m i ght l e a d t o a hi gh

PAGE 126

113 e nough ga i n i n P A H a c t i vi t y t o c l e a r H P A N e i t he r a n i ne f f e c t i ve dos e of C B m P A H H d W P R E ( 1. 07 x10 1 1 vg) nor a m i l dl y t he r a pe ut i c dos e ( 3. 21x10 1 1 vg ) w a s f ound t o be m or e e f f e c t i ve w he n C B R z I 209 w a s pr e s e nt i n va r i ous r a t i os U s i ng t he da t a of M i a o e t al a nd our ow n da t a w e e s t i m a t e t ha t a t t he de l i ve r e d dos e s a bout 3 10% of t he he pa t o c yt e s m a y be t r a ns duc e d. T he s m a l l pe r c e nt a ge o f c o t r a ns duc e d c e l l s i n t he l i ve r e s t i m a t e d i n a s i m i l a r m a nne r a s be t w e e n 1 4% of he pa t oc yt e s w a s pr oba bl y not s uf f i c i e nt t o ha ve a de t e c t a bl e e f f e c t on t he H P A phe not ype s i nc e bot h ve c t or s ne e d t o be e xpr e s s e d i n t he s a m e c e l l t o pr e ve nt dom i na nt ne ga t i ve i nt e r f e r e nc e P e r ha ps a l i m i t i ng f a c t or s uc h a s phe nyl a l a ni ne t r a ns por t i nt o e a c h he pa t oc yt e a l s o c ont r i but e d t o t he l a c k of s uc c e s s i n t he dua l ve c t or a pp r oa c h. N one t he l e s s a r e duc t i on i n ove r a l l l i ve r P A H m e s s a ge w a s obs e r ve d i n t he t r e a t e d a ni m a l s c onf i r m i ng r i boz y m e a c t i vi t y i n v i v o A s i ngl e ve c t or c a r r yi ng bot h t he f unc t i ona l ge ne a nd t he r i boz ym e i s ne e de d t o s uc c e s s f ul l y c om ba t dom i na nt ne ga t i ve i nt e r f e r e nc e i n t he l i ve r

PAGE 127

114 F i gur e 6 1 D os e r e s pons e t o r A A V 2 C B m P A H H d W P R E A dul t m a l e m i c e s e r um P he l e ve l s w e r e nor m a l i z e d a t 4 00x10 1 0 I U a nd a t 1. 33 x10 1 0 I U 4 28x10 9 I U l ow e r e d s e r um P he l e ve l s be t w e e n 0 6 a nd 0. 8 m M 1 43x10 1 0 ha d no de t e c t a bl e e f f e c t on t he H P A phe not ype

PAGE 128

115 F i gur e 6 2 P he nyl a l a ni ne l oa di ng e xpe r i m e nt A R e l a t i ve r a t e of de c r e a s e i n s e r um P he l e ve l s a f t e r t he phe nyl a l a ni ne l oa d B A c t ua l s e r u m P he l e ve l s a f t e r t he l oa di ng e xpe r i m e nt

PAGE 129

116 F i gur e 6 3 R N a s e pr ot e c t i on a s s a y w i t h dos e r e s pons e a ni m a l s A P r obe de s i gn f or di f f e r e nt i a t i ng be t w e e n e ndoge nous a nd ve c t or P A H R N A B E a r l y e xpr e s s i on of C B m P A H H d W P R E i n m i c e s a c r i f i c e d a t f our da ys a f t e r ve c t or i nj e c t i on. C V e c t or R N A w a s de t e c t e d i n o nl y t w o a ni m a l s w hi c h w e r e s a c r i f i c e d pr i or t o 30 w e e ks a f t e r ge ne t he r a p y.

PAGE 130

117 F i gur e 6 4 S out he r n bl ot of dos e r e s pons e a ni m a l s A T he m P A H e xon 6 p r obe i s us e d w i t h a N ot I a nd N c o I di ge s t t o s i m ul t a ne ous l y de t e c t ve c t or D N A a m ount s a nd e ndoge nous m P A H B D os e r e s pons e a ni m a l s s how a n i nc r e a s e i n ve c t or D N A c or r e s pondi ng t o t he i nc r e a s e i n dos e s

PAGE 131

118 F i gur e 6 5 P he nyl a l a ni ne hydr oxyl a s e a c t i vi t y i n ge ne t he r a py t r e a t e d a ni m a l s T w o a ni m a l s ha d de t e c t a bl e l e ve l s of P A H a c t i vi t y i n l i ve r s a m pl e s c or r e s pondi ng t o a ni m a l s t ha t ha d de t e c t a bl e ve c t or R N A

PAGE 132

119 F i gur e 6 6 S e r um phe nyl a l a ni ne l e ve l s a f t e r dua l ve c t or i nj e c t i ons 1. 43x10 9 I U of C B m P A H H d W P R E w a s c oi nj e c t e d i nt o m a l e m i c e w i t h i nc r e a s i ng a m ount s of C B R z I 209 ( S a l I ) a s i ndi c a t e d. R a t i os a r e of i nf e c t i ous uni t dos e s : C B m P A H H d W P R E : C B R z I 209 ( S a l I ) N o l a s t i ng e f f e c t s w e r e obs e r ve d on s e r um P he l e ve l s ove r 24 w e e ks

PAGE 133

120 F i gur e 6 7 R N a s e pr ot e c t i on a s s a y f or c o i nj e c t e d a ni m a l s 1 43x10 9 I U of C B m P A H H d W P R E w a s c oi nj e c t e d i nt o m a l e m i c e w i t h i nc r e a s i ng a m ount s of C B R z I 209 ( S a l I ) a s i ndi c a t e d a bove t he s a m pl e s R a t i os of i nf e c t i ous uni t dos e s a r e C B m P A H H d W P R E : C B R z I 209 ( S a l I ) A ni m a l s t ha t r e c e i ve d t he r i boz ym e ve c t or s how e d de c r e a s e d e ndoge nous P A H m R N A a m ount s N o ve c t or R N A w a s de t e c t e d i n a ny o f t he a ni m a l s T he a c t i n pe l l e t w a s l os t dur i ng pr e c i pi t a t i on

PAGE 134

121 F i gur e 6 8 S out he r n bl ot de t e c t i on of t w o r A A V ve c t or s 1. 43 x10 9 I U of C B m P A H H d W P R E w a s c oi nj e c t e d i nt o m a l e m i c e w i t h i nc r e a s i ng i nf e c t i ous uni t s o f C B R z I 209 ( S a l I ) a s i ndi c a t e d a bove t he s a m pl e s A T he hM C V pr obe i s a l i gne d t o bot h ve c t or s a nd B gl I I N ot I di ge s t i s us e d t o d e t e c t bot h ve c t or s on one bl ot B S out he r n bl ot r e s ul t f r om N c o I a nd N ot I di ge s t w i t h e xon 6 pr obe C S out he r n bl ot r e s ul t f r om B gl I I a nd N ot I di ge s t w i t h hC M V pr obe O ne 1: 3, one 1: 6 a nd bot h 1: 12 a ni m a l s ha ve bot h ve c t o r ba nds pr e s e nt

PAGE 135

122 F i gur e 6 9 S e r um phe nyl a l a ni ne l e ve l s a f t e r c o i nj e c t i on of m i l dl y e f f e c t i ve C B m P A H H d W P R E dos e a nd i nc r e a s i ng a m ount s o f C B R z I 209 ( S a l I ) 4 28x10 9 I U o f C B m P A H H d W P R E w a s i nj e c t e d i nt o m a l e m i c e w i t h i nc r e a s i ng i nf e c t i ous uni t s of C B R z I 209 ( S a l I ) a s i ndi c a t e d. A l l a ni m a l s s how e d a s i m i l a r t he r a pe ut i c de c r e a s e i n s e r um P he l e ve l s

PAGE 136

123 C H A P T E R 7 D E V E L O P M E N T O F A S I N G L E V E C T O R C A R R Y I N G T H E M O U S E P A H G E N E A N D R I B O Z Y M E I 209 T he c ur r e nt r i boz ym e c ons t r uc t i n t he p21 ne w hp ve c t or i s de s i gne d t o p r e ve nt e a r l y de gr a da t i on a nd t o pr o m ot e e xpor t f r o m t he nuc l e us ba s e d on t he s pl i c e s i t e a c c e pt or i n t he gl obi n e xon j us t ups t r e a m of t he r i boz ym e s e que nc e T o c ons t r uc t a s i ngl e r A A V ve c t or c a r r yi ng bot h t he m P A H ge ne a nd t he r i boz ym e t he c hoi c e o f a ne w pr om ot e r f or t he r i boz ym e w a s ne c e s s a r y be c a us e of A A V ge nom e s i z e pa c ka gi ng l i m i t s T he pr om ot e r f o r t he r i boz ym e w oul d ha ve t o of f e r s t a bi l i t y t o pr e ve nt e a r l y r i boz ym e de gr a t i on a nd a l l ow f or e xpor t o f t he r i boz ym e f r o m t he nuc l e us s o t ha t i t a nd t he e ndoge nous P A H m R N A c oul d be i n t he s a m e c e l l c om pa r t m e nt E xpe r i m e nt s by K uw a ba r a e t al ha ve de m ons t r a t e d t he f e a s i bi l i t y of e xpr e s s i ng r i boz ym e s j us t dow ns t r e a m of a m od i f i e d t R N A V a l 1 3 8 1 4 1 T he y ha ve s how n by i n s i t u hybr i di z a t i on a nd nor t he r n bl ot s o f c yt opl a s m i c a nd nuc l e a r f r a c t i ons t ha t t he t R N A dr i ve n r i boz ym e s a r e e xpor t e d t o t he c yt opl a s m a f t e r di r e c t i nj e c t i on i nt o t he nuc l e i o f H e L a c e l l s a nd a f t e r e xpr e s s i on f r om t r a ns i e nt l y t r a ns f e c t e d pl a s m i d D N A 1 4 2 S i nc e t he t R N A ha s bot h t he A a nd B bo x m ot i f s i nt a c t i t s t i l l s e r ve s a s i t s ow n pr om ot e r us i ng R N A pol ym e r a s e I I I K a w a s a ki a nd T a i r a r e por t e d i n 2002 t ha t a ddi ng a s hor t pol yA t a i l 3 of a r i boz ym e c ons t r uc t c oupl e d t he a c t i vi t y of a he l i c a s e t o t he r i boz ym e t hus a l l ow i ng c l e a va ge of a ny t a r ge t s i t e r e ga r dl e s s of s e c onda r y s t r uc t u r e 1 4 3 B a s e d on t hi s e vi de nc e w e opt e d t o i nc l ude a 60 a de nos i ne t a i l 3 o f t he r i boz ym e c ons t r uc t t o e nha nc e t a r ge t a c c e s s i bi l i t y a nd ove r a l l s t a bi l i t y o f t he r i boz ym e A not he r e l e m e nt s t udi e d by t he s a m e gr oup, c ons t i t ut i ve t r a ns por t e l e m e nt ( C T E ) c a n a l s o i nt e r a c t w i t h R N A he l i c a s e s b ut ha s a

PAGE 137

124 longer sequence thus would not be optimal for our use because of the packaging limits of rAAV. Design and Cloning of a Dual rAAV Vector The CB mPAH Hd cassette is 3970 bp including the ITRs. The insertion of a small cassette of less than 210 base s will not affect packaging ability of the vector, since wild type AAV is 4679 bases. Based on Kawasakis design, the mouse tRNA Val was modified and joined to RzI209, followed by a polyA tail of 60 bases and a PolIII terminator sequence. 143 By modifying linker sequences between the tRNA, the ribozyme and the polyA tail, the bes t possible confirmation of this full length product was determined by MFOLD ( Figure 7 1). The tRNA fold has been conserved and the ribozymes hybridizing arms are still free to find their target in the best conformation. This should allow for export from t he nucleus, and target binding and cleavage by the ribozyme. The tRNA RzI209 pA cassette is 203 nucleotides long and was designed to be inserted following the polyA site in the CB mPAH Hd construct. While the tRNA RzI209 pA cassette was originally designed to be cloned into both CB mPAH Hd and CB mPAH Hd WPRE plasmids, we decided not to continue with the CB mPAH Hd WPRE after seeing the loss of effectiveness in the dose response animals described in the previous chapter. A multi step procedure was needed to build the tRNA cassette ( Figure 7 2). Three sets of oligos were designed based on restriction sites present inside the cassette and the two necessary restriction sites at each end for the multi step procedure. Briefly, the tRNA cassette would first be clo ned into a modified pGEM % 3Zf(+) plasmid, pGEM 3Zf(+) MCS2 ( Table 2 4), thus allowing for the use of cold competent GT116 cells for cloning, blue white screening, and easy sequencing reactions. The three sets of DNA oligos were

PAGE 138

125 ordered and cloned individua lly into pGEM 3Zf(+) MCS2 which included all the necessary rare restriction sites. After each cloning step, aided by blue white screening which incidently alternatively switched from white to blue at each new transformed ligation, a positive check digest c ould be done from a restriction site inside each oligo set. Once all three sections of the cassette were cloned, sequencing reactions were performed to ascertain the conservation of the desired sequence. The tRNA cassette was moved into the CB mPAH Hd vect or and was renamed CB mPAH Hd tRNA RzI209. Unfortunately the design of the tRNA Rz requires optimization of folding with each different ribozyme attached to it. Even though two unique sites are included to clone the ribozyme after the tRNA, it may become necessary to change the linker sequences for each ribozyme based on optimal folding, thus adding an extra step for the construction of this ribozyme cassette. Cell Transfection Experiments with CB mPAH Hd tRNA RzI209 Mixed transfections of mPAH, mPAH Hd a nd mPAH Hd tRNA RzI209 were carried out in HEK 293 cells. Since the new dual vector was only constructed with the active ribozyme, it was decided not to test it in cells against the inactive protein from CB mPAH F263S. Instead, either CB mPAH Hd or CB mPA H was added to CB mPAH Hd tRNA RzI209. When CB mPAH Hd was added, the PAH activity doubled as compared to CB mPAH Hd tRNA RzI209 alone. When the non ribozyme resistant CB mPAH was added, the activity only increased by about 10% (Figure 7 3). A Western blo t with the PAH antibody was performed with one set of the samples from the previous transfections. It shows that when CB mPAH Hd is transfected with CB mPAH Hd tRNA RzI209 the protein amount is higher than with the addition of CB mPAH ( Figure 7 4A). Primer s for amplification of the tRNA cassette by RT PCR were

PAGE 139

126 designed and used to amplify a 105 base pair product from a saved RNA sample from one of the transfections. While a band is visible between 100 and 125 nucleotides, the primers were not very efficient and created a high background ( Figure 7 4B). The tRNA cassette is highly structured and meant to self bind in a specific manner, hence the selection of primers was extremely limited and not ideal. Nontheless the RT PCR result show that the modified tRNA Va l does express the ribozyme in HEK 293 cells. The combined results from the cell transfection experiments satisfied us that the ribozyme was expressed by the tRNA promoter. It seemed capable of reaching its target RNA and preventing an increase in PAH act ivity in the cell culture experiments. The CB mPAH Hd tRNA RzI209 plasmid was grown in a large scale, purified using Qiagens Giga Prep kit, and sent to the Vector Core for packaging in rAAV2. In Vivo Experiments with CB mPAH Hd tRNA RzI209 A limited amou nt of virus was received from the Vector Core, only 2 cell factories of purified virus in a 1mL volume. Because of this limit, and the difficult task of choosing correct doses, the animal experiments were staggered in small groups, using adult male mice. T he lowest fully effective dose in the dose response experiment was 1.33x10 10 IU of CB mPAH Hd WPRE ( Figure 6 1), and the lowest effective known dose of CB mPAH to work in male mice was 3.00x10 10 IU (Figure 4 1). As a first dose of the combined vector, we c hose 1.5x10 10 IU and injected this amount into two male mice. By the third week after surgery, the mice reached a normalized serum Phe level which has been maintained for another 15 weeks and is still ongoing (Figure 7 5). We then proceeded to inject progr essively lower doses of the dual vector into male mice. Two mice have received 3.75x10 9 IU and have lowered to 0.60 mM serum Phe concentration

PAGE 140

127 for up to 8 weeks. One animal injected at 7.5x10 9 is now at 0.2 mM serum Phe 4 weeks after surgery ( Figure 7 5). Between week 8 and 12 for the 1.5x10 10 IU animals, and between week 2 and 6 for the 3.75x10 9 IU animals, we performed timed bleeds as described in chapter 6. As compared to the treated animals of Table 6 2, which received the CB mPAH ex13 WPRE vector, th ese animals have a difference of 0.25 and 0.24 mM serum Phe levels between morming and afternoon bleeds. This means that 27 to 30% less variation in daily serum Phe levels has been achieved as compared to Pah enu2 mice. The reduction of serum Phe daily vari ation has been achieved with lower rAAV2 doses than those used with CB mPAH ex13 WPRE which has a similar dose response to CB mPAH Hd WPRE. Discussion We assumed that delivery of a single vector containing both the PAH gene and the ribozyme was needed to effectively combat dominant negative interference. One implication of this decision would be that a small promoter was required to express the ribozyme in order to fit within the packaging limits of rAAV. A modified tRNA Val was chosen based on studies fro m Kuwabara et al. After successful testing using cell transfections, the combined vector, CB mPAH Hd tRNA RzI209, was packaged into rAAV2. In vivo results have so far shown that the combined vector is four times as effective as CB mPAH alone, and at least twice as effective as CB mPAH WPRE after portal vein injections. The lowest effective dose of 7.5x10 9 IU, or 5.2x10 11 vector genomes is the lowest dose used in our lab and in the literature with either rAAV2 or rAAV5 to achieve normalization of serum Phe l evels in male Pah enu2 mice. Since the full effect of the gene therapy took longer to stabilize than it had in the mice that had received

PAGE 141

128 t he W P R E ve c t or ( F i gu r e s 6 1 a nd 7 5) t hi s m a y t ur n out t o be a s a f e r m e t hod t ha n t he pr e vi ous ve c t or a ppr oa c h. S t udi e s of t he l i ve r pa t h ol ogy a r e pl a nne d t o c om pa r e t o t he C B m P A H H d W P R E dos e r e s pons e a ni m a l s a l o ng w i t h R N a s e pr ot e c t i on a s s a ys a nd s out he r n bl ot s T hi s i s t he f i r s t r e por t o f c om bi ni ng bot h ge ne a nd r i boz ym e i nt o a s i ngl e ve c t or T he a ppr oa c h i s a n a l t e r na t i ve a nd s i m pl e r m e t hod t ha n t r a ns s pl i c i ng r i boz ym e s : r i boz ym e s ba s e d on T e t r ahy m e na gr oup I i nt r on de s i gne d t o a m e nd de f e c t i ve t r a ns c r i pt s 1 4 4 1 4 5 I t s houl d be a ppl i c a bl e t o a l l m ut a t i ons of a ny s i ngl e ge ne di s or de r unl e s s a pa t i e nt ha s a m ut a t i on a t t he c hos e n r i boz ym e bi ndi ng s e que nc e

PAGE 142

129 F i gur e 7 1 t R N A R z I 209 de s i g n. T he t R N A f ol di ng i s c ons e r ve d w hi l e t he hyb r i di z i ng a r m s f or t he r i boz ym e a r e l e f t unbound t o a l l ow f o r t a r ge t hybr i di z a t i on. T he pol y A doe s not bi nd t o t he r e s t of t he c a s s e t t e i n t hi s opt i m a l f ol di ng c onf or m a t i on.

PAGE 143

130 F i gur e 7 2 C l oni ng s t r a t e gy f or c ons t r uc t i on o f t R N A R z I 209 c a s s e t t e T hr e e s e t s of ol i gos w e r e a nne a l e d a nd i ndi vi dua l l y l i ga t e d i nt o t he m odi f i e d c l oni ng s i t e s of pG E M 3 Z f ( + ) M C S 2. T hi s c a s s e t t e w a s s ubs e q ue nt l y m ove d i nt o t he C B m P A H H d pl a s m i d.

PAGE 144

131 F i gur e 7 3 R e s ul t s of t r a ns i e nt c e l l t r a ns f e c t i ons w i t h C B m P A H H d t R N A R z I 209. A ddi t i on of a n e qua l a m ount of C B m P A H H d t o C B m P A H H d t R N A R z I 209 doubl e s t he P A H a c t i vi t y w hi l e a ddi t i on of C B m P A H doe s not r e s ul t i n a s i gni f i c a nt i nc r e a s e i n P A H a c t i vi t y

PAGE 145

132 Figure 7 4 tRNA RzI209 activi ty and expression in HEK 293 cells. A. Western blot of cell transfection samples from figure 7 3. PAH amount is only mildly increased when CB mPAH is co transfected with the tRNA vector. Lane 1: CB mPAH Hd tRNA RzI209 only. Lane 2: CB mPAH Hd tRNA RzI209 w ith CB mPAH. Lane 3: CB mPAH Hd tRNA RzI209 with CB mPAH Hd. B. RT PCR of CB mPAH Hd tRNA RzI209 transfection. The ribozyme is clearly expressed in the cells even though background from the primer was very abundant.

PAGE 146

133 F i gur e 7 5 I n v i v o r e s ul t s w i t h C B m P A H H d t R N A R z I 209. B ot h 1. 5x10 1 0 a nd 7 5x10 9 I U s ha ve nor m a l i z e d s e r um P he l e ve l s i n m a l e P ah e n u 2 m i c e m a ki ng t hi s ve c t or f our f ol d m or e e f f e c t i ve t ha n C B m P A H a l one T he 3. 75x10 9 a ni m a l s ha ve s e r um P he l e ve l s a r ound 0. 60 m M

PAGE 147

134 C H A P T E R 8 D E V E L O P M E N T O F S H O R T I N T E R F E R I N G R N A S F O R M U R I N E P A H R N A i nt e r f e r e nc e i s t he p r oc e s s of pos t t r a ns c r i pt i ona l s i l e nc i ng i nduc e d by doubl e s t r a nde d R N A S hor t i nt e r f e r i ng R N A s a r e dupl e x e s of 20 t o 22 nuc l e ot i de s a nd a r e pr oc e s s e d by R I S C t o t a r ge t a m e s s e nge r R N A f or c l e a va ge a nd de gr a da t i on. A s a n a l t e r na t i ve a ppr oa c h t o ha m m e r he a d r i boz ym e s t o pr e ve nt dom i na nt ne ga t i ve i nt e r f e r e nc e s hor t i nt e r f e r i ng R N A s w e r e de s i gne d t o t a r ge t m P A H S i nc e s i R N A s ha ve m a ny di f f e r e nt s e l e c t i on r ul e s a nd ne e d t o be t e s t e d i n v i v o f or t r ue de t e r m i na t i on o f a c t i vi t y, A m bi on s S i l e nc e r ki t w a s c hos e n t o t e s t t hr e e s e l e c t e d s i R N A s a ga i n s t m P A H 9 1 9 2 T he ki t c r e a t e s t he s i R N A c a s s e t t e by P C R a m pl i f i c a t i on a nd i s de s i gne d t o i nc l ude a c hos e n pr om ot e r i n t he s e e xpe r i m e nt s h um a n U 6. T he m e t hod s ki ps l e ngt hy c l oni ng s t e ps w hi l e s t i l l e xpr e s s i ng t he s i R N A i n t he c e l l s a s oppos e d t o t r a ns f e c t i ng R N A ol i gos w hi c h ha ve a f i n i t e ha l f l i f e 1 4 6 S h or t I n t e r f e r i n g R N A S i t e S e l e c t i on P ot e n t i a l s i R N A s i t e s w e r e s e l e c t e d f r om t he P A H c D N A s e que nc e i n t he r A A V C B m P A H ve c t or O nl y t he f i r s t 500 nuc l e ot i de s o f t he c D N A w e r e s c r e e ne d f or t he be s t pos s i bl e t a r ge t s i t e s T he r e a r e a num be r of pa pe r s publ i s he d t ha t c a n he l p one s e l e c t pos s i bl e good R N A i nt e r f e r e nc e s i t e s but none of t he r ul e s a r e f ool pr oof a nd t hi s i s of t e n e m pha s i z e d by t he a ut ho r s T o s e l e c t s i R N A t a r ge t s i t e s t hr e e a va i l a bl e t oo l s o n t he I nt e r ne t w e r e us e d: A m bi on s w e bs i t e P r om e ga s w e bs i t e a nd a t r i a l ve r s i on of S V M R N A i ve r s i on 5 0. E a c h w e bs i t e or p r ogr a m c a m e up w i t h di f f e r e nt l i s t s of be s t s i R N A pos i t i ons ; c om pa r i ng

PAGE 148

135 all three lists, target sites that were within 20 bases of each other were further examined using BLAST searches. If the designed siRNA was found to correspo nd to another gene besides PAH in the first 100 results by BLAST search, it was rejected as a possible design. The list of possible target sites was reduced and finally three target sites were selected for testing and the PCR primers necessary for the Sile ncer kit were ordered from Sigma Genosys ( Table 8 1). siRNA Cell Culture Tests The three siRNAs were made according to Ambions specifications. To determine what concentration of siRNA cassette was needed to test in cell cultures, the siGAPDH and siNegati ve control for human cells included in Ambions kit were amplified alongside the mPAH siRNAs. Three concentrations were tested with the siGAPDH and siNegative in HEK 293 cells by standard calcium phosphate transfection: 100 ng/well, 200 ng/well, and 300 ng /well of a six well plate. After two days, the cells were harvested for RNA extraction with TRIzol, and RT PCR reactions were set up to detect the amounts of GAPDH and Actin in each transfection. Based on the normalized GAPDH results, 300 ng/well was selec ted as a reasonable concentration to use in HEK 293 cells ( Figure 8 1). The three siRNAs for mPAH were then tested versus co transfected CB mPAH plasmid, 300 ng siRNA and 2 g CB mPAH. Each transfection was done in one well of a 6 well plate with approxim ately 8x10 5 cells per well and harvested after 48 hours for RNA with T RI zol. The results were analyzed by RT PCR for mPAH amount and GAPDH was used as an internal control in these experiments. The best siRNA was si333, knocking down PAH to approximately 50 % (Figure 8 2).

PAGE 149

136 T a bl e 8 1 S hor t i nt e r f e r i ng R N A s f or m ous e P A H mP A H 5 t a rg et ed s eq u en ce Pri me rs s i 3 3 3 A A C G A C A T T G G T G C C A C T G T C Sen s e: G T CC T A C A C A A A G A C A G T G G C A C C A A T G T C G C C G G T G T T T C G T C C T T T C C A C A A G A n t i s en s e: C G G C G A A G C T T T T T CC A A A A A A C G A C A T T G G T G CC A C T G T CC T A C A C A A A G A C A s i 4 0 1 A A G G A C C A T T C A G G A G C T G G A Sen s e: G G A C T A C A C A A A T C C A G C T CC T G A A T G G T C C T T C G G T G T T T C G T C C T T T C C A C A A G A n t i s en s e: C G G C G A A G C T T T T T CC A A A A A A A A G G A C C A T T C A G G A G C T G G A C T A C A C A A A T CC A s i 4 3 2 A A T C A G A T T C T C A G C T A T G G A Sen s e: G G A C T A C A C A A A T C C A T A G C T G A G A A T C T G A C C G G T G T T T C G T C C T T T C C A C A A G A n t i s en s e: C G G C G A A G C T T T T T CC A A A A A A T C A G A T T C T C A G C T A T G G A C T A C A C A A A T CC A

PAGE 150

137 Using a different cell line, 293T, the transfections with the siRNAs and CB mPAH were repeated. The transfections into this cell line were done using Qiagens Superfect transfection rea gent as described in Chapter 2. The same amounts of DNA were used and the results were also analyzed by RT PCR in the same manner. The results were similar, but si402 led to a better reduction of mPAH than si333 in these cells ( Figure 8 2). The reductions were not quite as great as those achieved in 293 cells. One last transfection experiment was performed with a newly acquired cell line, 293T TYF mPAH created by Dr Changs laboratory from our CB mPAH vector. The cells constitutively express the mPAH gene and were transfected with 300 ng of each siRNA, and 2 g of empty carrier plasmid pGEM 3ZF(+) MCS2 using the superfect protocol. The cells were harvested for RNA after 48 hours with T RI zol. The results of the RT PCR show that si333 can reduce the express ion of mPAH by 40% while the other two siRNAs did not efficiently reduce the mPAH message ( Figure 8 2). Discussion Based on all the combined results, si333 seems to be the best choice of siRNA from all three designs tested. The siRNA that performed the wo rst in all three cell lines, si432, followed only three of the selection rules suggested in Reynolds et al. but had been chosen because of its lower GC content. 91 Both si333 and si401 followed four suggested rules: si333 has 52.4% GC content, 2 G /C at the 5 end of the sense strand, 3 A/U at the 5 end of the antisense strand and does not contain a G/C stretch; si401 has 52.4% GC content, a U at position 10, 2 G/C at the 5 end of the sense strand and does not contain a G/C stretch. It is interest ing that si333 broke some of the negative selection rules for specific bases at certain positions but yet performed the best overall, reemphasizing the need for in vivo testing after algorithm based design.

PAGE 151

138 F ur t he r t e s t s a t va r i ous c onc e nt r a t i ons c oul d be do ne t o s e e i f m or e knoc kdow n of m P A H m R N A c a n be a c hi e ve d w i t h s i 333. F o r us e i n t he m ous e m ode l i n ge ne t he r a py e xpe r i m e nt s a not he r p r om ot e r a c t i ve i n m ur i ne c e l l s w i l l ha ve t o be t e s t e d t o c onf i r m t he a c t i vi t y of t he s i R N A t R N A p r om ot e r s ha ve b e e n us e d t o e xpr e s s s hor t i nt e r f e r i ng R N A s a nd w oul d be a good c hoi c e f or t he e xpr e s s i on of s i 333 1 4 7 1 4 8 T he s i 333 c oul d be c l one d i nt o t he C s p45I a nd C l a I s i t e s t o r e pl a c e R z I 209 i n t he c ur r e nt t R N A c a s s e t t e i n t he pG E M 3Z f ( + ) pl a s m i d f or s e pa r a t e t a r ge t t o s i R N A t e s t i ng. I f a c t i ve a r e s i s t a nt m P A H ve c t or w i l l ha ve t o be c ons t r uc t e d by e xt e ns i ve P C R m ut a ge ne s i s a nd t e s t e d a s w e l l pr i or t o a ny a ni m a l e xpe r i m e nt s O ur C B m P A H ve c t or i nc l ude s a ppr oxi m a t e l y 50 nuc l e ot i de s of t he 5 U T R o f P A H a nd a bout 400 nuc l e ot i de s of t he 3 U T R A n a l t e r na t e s i R N A de s i gn c oul d be t a r ge t e d a ga i ns t e i t he r r e gi on I f t he s i R N A w a s f o und t o be a c t i ve i n c e l l c ul t ur e t e s t s r e m ovi ng t ha t r e gi on f r om our c ons t r uc t w oul d r e nde r t he ve c t or c om pl e t e l y r e s i s t a nt t o t he s i R N A a voi di ng t he m ut a ge ne s i s r e qui r e d w i t h t he c ur r e nt s i R N A s

PAGE 152

139 F i gur e 8 1 C e l l c ul t ur e s i R N A w or ki ng c onc e nt r a t i on de t e r m i na t i on. T hr e e a m ount s of s i R N A s 100 ng, 200 ng a nd 300 ng w e r e t e s t e d by C a P O 4 t r a ns f e c t i on o f 4x10 5 H E K 293 c e l l s pl a t e d i n 6 w e l l pl a t e s i n 2 m l of m e di a R N A w a s e xt r a c t e d f or R T P C R r e a c t i ons D e ns i t y of obt a i n e d G A P D H a nd A c t i n ba nds w e r e e va l ua t e d w i t h U N S C A N I T ge l a nd nor m a l i z e d G A P D H a m ount s a r e gr a phe d a bove

PAGE 153

140 F i gur e 8 2 M ous e P A H s i R N A t e s t r e s ul t s T he t hr e e c hos e n s i R N A s e que nc e s w e r e t e s t e d i n c e l l t r a ns f e c t i ons a ga i ns t c o t r a ns f e c t e d o r e ndoge nous t a r ge t R e s ul t s a r e f r om R T P C R r e a c t i ons of e a c h c e l l t r a ns f e c t i ons gr a phe d a s r e l a t i ve m P A H a m ount N = 1 f o r 293 T T Y F m P A H c e l l s N = 3 f or t he ot he r t w o c e l l l i ne s S i 333 ga ve t he m os t c ons i s t e nt r e duc t i on of m P A H m e s s a ge

PAGE 154

141 C H A P T E R 9 S U M M A R Y C O N C L U S I O N A N D F U T U R E D I R E C T I O N S G e n e r al S i gn i f i c an c e T he e a r l i e s t s t udi e s f or de ve l opi ng ge ne t he r a py f o r P K U w e r e done i n 1986 by L e dl e y e t al 1 4 9 W hi l e a f e w g r oups ha ve s uc c e s s f u l l y t r e a t e d t he m ous e m ode l B T B R P ah e n u 2 w i t h e i t he r a de novi r us or r e c om bi na nt A A V t ype 2 a nd t ype 5 ( s e e C ha pt e r 1) t he r e s ul t s ha ve be e n di s a ppoi nt i ng a t be s t H i gh r A A V dos e s a r e ne e de d t o t r e a t m a l e m i c e a nd f e m a l e m i c e r e qui r e e ve n hi ghe r ve c t or dos e s t o r e a c h t he r a pe ut i c s e r um P he l e ve l s M or e ove r l os s of e f f e c t i ve ne s s ha s be e n r e por t e d a f t e r 25 w e e ks 7 0 T h i s s t udy r e por t s t he l ow e s t t he r a pe ut i c r A A V t ype 2 dos e i n m a l e s w hi l e us i ng a nove l ve c t or t ha t c a r r i e s bot h a ha m m e r he a d r i boz ym e a nd a r e s i s t a nt ge ne t o r e pl a c e t he e ndoge nous m ut a nt m R N A T he r e s ul t s a nd t he i r i m p l i c a t i ons a r e s um m a r i z e d be l ow a l ong w i t h pl a nne d f ut ur e s t udi e s f o r t he t r e a t m e nt o f m a t e r na l P K U s yndr om e S u m m ar y a n d C on c l u s i on T he m ous e m ode l f or phe nyl ke t onu r i a B T B R P ah e n u 2 w a s e xa m i ne d i n de t a i l f or t hi s s t udy. W hi l e t he s e xua l di m or phi s m obs e r ve d i n t he m i c e a r e not e xpl a i ne d a t t he m ol e c ul a r l e ve l t he pr ot e i n a nd a c t i vi t y l e ve l s s e e n i n t he he t e r oz ygot e m i c e s uppor t t he pos s i bi l i t y of dom i na nt ne ga t i ve i nt e r f e r e nc e S ys t e m s t ha t i nvol ve ol i gom e r i z a t i on a r e know n t o be s us c e pt i bl e t o dom i na nt ne ga t i ve i nt e r f e r e nc e w he n m ut a nt pr ot e i ns a r e e xpr e s s e d a nd r e l a t i ve l y s t a bl e D om i na nt ne ga t i ve i nt e r f e r e nc e i s t he c a us e of qui t e a f e w e ndoc r i ne di s e a s e s a nd ge ne t i c di s e a s e s w hi c h a c l a s s i c e xa m pl e be i ng O s t e oge ne s i s I m pe r f e c t a T he c e l l t r a ns f e c t i on e xpe r i m e nt s w i t h C B m P A H a nd C B m P A H F 263S

PAGE 155

142 c onf i r m e d t ha t t he P A H m onom e r s i nt e r a c t l e a di ng t o r e duc e d a c t i vi t y i n c e l l l ys a t e s T he r e f or e ge ne t he r a py f or m os t phe nyl ke t onur i a pa t i e nt s w i l l r e qui r e bot h ge ne r e pl a c e m e nt a nd a m e t hod t o pr e ve nt t he dom i na nt ne ga t i ve i nt e r f e r e nc e H a m m e r he a d r i boz ym e s w e r e c hos e n a s t he m e a ns t o de gr a de e ndoge nous P A H m R N A T he i r s m a l l s i z e a nd a l l e l e s pe c i f i c i t y w e r e i de a l f or de ve l opm e nt of a dua l ge ne r e pl a c e m e nt a nd a nt i s e ns e ge ne t he r a py a ppr oa c h. B a s e d on t he r e s ul t s of t he s e pa r a t e ve c t or e xpe r i m e nt s t he r e s e e m s t o be a m i ni m um num be r of c e l l s r e qui r e d t ha t e xpr e s s f unc t i ona l P A H a c t i vi t y i n o r de r t o c l e a r a s i gni f i c a nt a m ount of s e r um phe nyl a l a ni ne W hi l e t he dos e s ha ve be e n r e duc e d f ur t he r t o 7. 5x 10 9 I U w i t h t he c om bi ne d r i boz ym e a nd ge ne ve c t or i t i s s t i l l unknow n a t t hi s poi nt i f t he num be r of c e l l s t r a ns duc e d r e pr e s e nt s t he m i ni m um a m ount of ne e de d c e l l s f o r P he c l e a r a nc e o r i f t he r i boz ym e a c t i vi t y i s not s uf f i c i e nt t o c om pl e t e l y pr e ve nt t he dom i na nt ne ga t i ve i nt e r f e r e nc e T he l os s of e f f e c t i ve ne s s obs e r ve d i n t he dos e r e s pons e e xpe r i m e nt a f t e r 24 w e e ks w a s una nt i c i pa t e d s i nc e ot he r s t udi e s ha ve s how n t he r a pe ut i c e f f e c t s f r om s i m i l a r ve c t or s f or up t o 52 w e e ks 1 2 1 T he l a c k of ve c t or m e s s a ge a nd P A H a c t i vi t y i n t he a ni m a l s t ha t ha d r e t ur ne d t o hi gh s e r um P he l e ve l s w a s e xpe c t e d. H ow e ve r t he pr e s e nc e of t he ve c t or D N A i n t hos e s a m e a ni m a l s a nd t he nuc l e a r m o r p hol ogi c a l c ha nge s ha ve ve r y s e r i ous i m pl i c a t i ons f or t he f i e l d of r A A V ge ne t he r a py. W e a r e c l os e l y m oni t or i ng t he a ni m a l s t ha t r e c e i ve d t he c om bi ne d ge ne r i boz ym e ve c t or w hi c h doe s not c ont a i n t he W P R E a nd t hi s m a y a dd e vi de nc e a bout t he s our c e f or t he m or phol ogi c a l c ha nge s : r A A V D N A pr ot e i n ove r e xpr e s s i on, p r ot e i n pr ot e i n i nt e r a c t i on or t he W P R E e l e m e nt I t i s unc l e a r a t t he hi gh dos e s ne e de d t o t r e a t H P A how m a ny he pa t oc yt e s ha ve be e n t r a ns duc e d a nd how m a ny c opi e s of t he ve c t or ge nom e a r e p r e s e nt pe r c e l l I t m a y be unhe a l t hy f o r c e l l s

PAGE 156

143 t o ha ve hi gh ve c t or c opy num be r s w i t h hi ghl y e xpr e s s e d P A H pr ot e i n t ha t i s not s e c r e t e d, unl i ke hA A T T he pr e s e nc e of a n uns t a bl e m i s s e ns e pr ot e i n c om pl i c a t e s t he s i t ua t i on T he W P R E w hi c h a l l ow s i nc r e a s e d t r a ns l a t i on by s t a bi l i z i ng t he m R N A c oul d t hus be m or e de s t r uc t i ve ove r t i m e a nd out w e i gh t he be ne f i t s i t pr ovi de s e a r l y on by a l l ow i ng l ow e r ve c t or dos e s F u r t he r m or e t he dua l ge ne r i b oz ym e ve c t or s how s t ha t s i m pl e ove r e xpr e s s i on w a s not t he m os t e f f e c t i ve a ppr oa c h i n l ow e r i ng ne e de d ve c t or dos e s W hi l e m or e s t udy i s ne e de d t o unde r s t a nd t he i nc r e a s e d t um or i ge ne s i s a nd m or phol ogi c a l c ha nge s i t i s c l e a r t ha t c a r e f ul e va l ua t i on of bot h a m ous e m ode l a nd t he hum a n di s e a s e i s ne e de d be f or e a s uc c e s s f ul s a f e ge ne t he r a py a p pr oa c h f or hum a ns c a n be de s i gne d. F u t u r e D i r e c t i on s R e duc i ng ove r a l l a m ount s of ne e de d ve c t or w i l l be ne c e s s a r y pr i or t o c l i ni c a l t r i a l s bot h f or s a f e t y i s s ue s a nd c os t of ve c t or pr oduc t i on W hi l e t he c ur r e nt r e s ul t ha ve r e duc e d ve c t or dos e s t he us e of ne w e r s e r ot ype s of r A A V na m e l y r A A V 8, w i l l pr o ba bl y l e a d t o a n e ve n f ur t he r r e duc t i on of ne e de d dos e s t o c u r e H P A bot h i n m a l e s a nd i n f e m a l e s R e c om bi n a nt A A V 8 ha s be e n r e por t e d t o be 10 t o 100 t i m e s m or e e f f e c t i ve i n l i ve r t ha n A A V 2, 5 o r 7 1 5 0 I f 10 t i m e s m or e e f f e c t i ve 5. 2x1 0 1 0 ve c t or ge nom e s c o ul d be us e d t o t r e a t m a l e m i c e ne a r t he dos e s t e s t e d t o t r e a t hu m a n pa t i e nt s i n c ur r e nt va r i ous c l i n i c a l t r i a l s 7 5 1 5 1 T he C B m P A H H d t R N A R z I 209 ve c t or i s onl y 4 172 nuc l e ot i de s l ong. A ddi ng a s e c ond r i boz ym e w i t h i t s ow n t R N A pr om ot e r a ppr oxi m a t e l y 200 ba s e s i nt o t he c ons t r uc t c oul d f ur t he r e nha nc e t he e f f e c t a ga i ns t t he dom i na nt ne ga t i ve i nt e r f e r e nc e a nd a l l ow f or f ur t he r r e duc t i on of ne e de d ve c t or dos e s M ul t i m e r i c r i boz ym e s e xpr e s s e d f r om s i ngl e pr om ot e r s ha ve be e n us e d i n va r i ous s t udi e s by r e pe a t i ng t he s a m e r i boz ym e s e que nc e i n a s e r i e s e ngi ne e r e d f or s e l f c l e a va ge i n be t w e e n e a c h r e pe a t 1 5 2 1 5 3 U s i ng t he

PAGE 157

144 s a m e r i boz ym e c l one d t w i c e c oul d be e a s i l y t e s t e d w i t hi n a s hor t t i m e a nd w oul d a voi d d e ve l opi ng a s e c ond di f f e r e nt r i boz ym e f or m P A H A s a n a l t e r na t i ve a nd a c om pa r i s on t o ha m m e r he a d r i boz ym e s t he de s i gne d s i R N A s c ou l d be c l one d w i t h a n a ppr op r i a t e pr om ot e r a nd t e s t e d t o c onf i r m t he i r a c t i vi t y A r e s i s t a nt m P A H ve c t or w oul d be c ons t r uc t e d by e xt e ns i ve P C R m ut a ge ne s i s t o pr e ve nt t r a ns l a t i on i nhi bi t i on a nd c l e a va ge by t he s i R N A A l t e r na t i ve l y a n s i R N A c oul d be de s i gne d a ga i ns t t he U T R s pr e s e nt i n t he ve c t or w hi c h c oul d be r e m ove d t o a voi d m u t a ge ne s i s of t he ve c t or c ons t r uc t T he r e s ul t s of t hi s s t udy, w hi l e e xt r e m e l y s uc c e s s f ul i n r e duc i ng r A A V 2 dos e s ne e de d t o c ur e H P A i n m a l e m i c e ha ve no t be e n r e pe a t e d i n f e m a l e m i c e T he dos e s ne e de d t o c ur e f e m a l e s a r e di f f i c ul t t o pr e di c t w i t h t hi s ne w ve c t or T w e nt y f ol d hi ghe r dos e s of t he r A A V 2 C B m P A H W P R E ve c t or ha v e pr e vi ous l y l ow e r e d f e m a l e s e r um P he l e ve l s t o a t he r a pe ut i c r a nge I f s i m i l a r a m ount s a r e r e qui r e d w i t h t hi s ve c t or 1. 5x10 1 2 I U w i l l be ne e de d t o c ur e t he f e m a l e s A dos e r e s pons e s t udy w i t h t he dua l ve c t or i s pl a nne d i n f e m a l e s t o a s s e s s t he e f f e c t of t he r i boz ym e i n v i v o t o c om ba t dom i na nt ne ga t i ve i nt e r f e r e nc e i n f e m a l e l i ve r s P r e ve nt i on of m a t e r na l P K U s yndr om e r e m a i ns t h e f oc us of ge ne t he r a py s t udi e s f or P K U U nt r e a t e d P ah e n u 2 f e m a l e s do not nor m a l l y c a r r y l i t t e r s t o t e r m F ol l ow i ng ge ne t he r a py w i t h no r m a l i z a t i on of s e r um P he l e ve l s i n f e m a l e s w e pl a n on m a t i ng t he m t o bot h P ah e n u 2 a nd he t e r oz ygot e m a l e s I f l i t t e r s a r e obt a i ne d a nd t he pups s ur vi ve be yond a f e w hour s bo t h da m s a nd pups w i l l be c l os e l y m o ni t or e d t o a s s e s s t he e xt e nt of r e ve r s a l of m a t e r na l P K U s yndr om e G e ne r a l gr ow t h pa r a m e t e r s c a n be c om pa r e d t o nor m a l P ah e n u 2 a nd he t e r oz ygot e gr ow t h c ur ve s obt a i ne d i n t hi s s t udy.

PAGE 158

145 L i ve r di r e c t e d ge ne t he r a py f or P K U ha s be e n t he f oc us of a l l publ i s he d s t udi e s t o da t e O ur d a t a obt a i ne d f r om t he m i c e s how s t ha t t he ki dne y m i ght be a n i nt e r e s t i ng t a r ge t f or ge ne t he r a py a s w e l l T he e nz ym e s e e m s t o be d i f f e r e nt l y r e gul a t e d i n t he ki dne y a s c om pa r e d t o t he l i ve r P r ot e i n a m ount s b e t w e e n a l l t hr e e ge not ype s w e r e not r e duc e d i n t he ki dne y w hi l e a c t i vi t y l e ve l s w e r e a t 50% of nor m a l i n he t e r oz ygot e s a s w oul d be pr e di c t e d f or 1 c opy o f t he nor m a l ge ne S e r ot ype s of r A A V ne e d t o be t e s t e d f or t r a ns duc t i on of k i dne y c e l l s a nd c o l oc a l i z e d t o e ndoge nous B H 4 s i nc e i t i s r e qui r e d f or P A H a c t i vi t y. I t i s unknow n a t t hi s poi nt i f r A A V de r i ve d P A H p r ot e i n w oul d c a us e dom i na nt ne ga t i ve i nt e r f e r e nc e i n t he ki dne y, bu t he t e r oz ygot e P A H a c t i vi t y l e ve l s s e e m t o i ndi c a t e ot he r w i s e N one t he l e s s t he c om bi ne d v e c t or w oul d pr e ve nt t he pos s i bi l i t y o f dom i na nt ne ga t i ve i nt e r f e r e nc e by r e duc i ng e ndoge nous P A H pr ot e i n p r oduc t i on. I f a s e r ot ype of r A A V c a n be f ound t o t r a ns duc e t he pr ope r c e l l t ype pe r ha ps t r e a t m e nt of one or bot h ki dne ys c oul d be m or e e f f e c t i ve i n c l e a r i ng s e r um P he l e ve l s t ha n t he l i ve r s i nc e t he ki dne y ha s be e n pr e di c t e d t o be a bl e t o c l e a r 50% o f s e r um P he l e ve l s D u al G e n e R e p l ac e m e n t an d A n t i s e n s e T e c h n ol ogy A p p r oac h e s f or t h e T r e at m e n t of G e n e t i c D i s e as e s T he c om bi ne d ge ne r e pl a c e m e nt a nd a nt i s e ns e m ol e c ul e a ppr oa c h us e d i n t hi s s t u dy w i l l be e s pe c i a l l y us e f ul f o r t he t r e a t m e nt of a ut os om a l dom i na nt di s e a s e s F or e xa m pl e i n O s t e oge ne s i s I m pe r f e c t a e xpr e s s e d m ut a nt c ol l a ge n t ype 1 1 a nd 1 2 pr ot e i ns l e a d t o ve r y s e ve r e c l i ni c a l phe not ype s 1 5 4 T he i nc o r por a t i on o f t he m ut a nt 1 1 or 1 2 c ol l a ge n pr ot e i n i nt o t he t r i pl e he l i x of t ype I c ol l a ge n de s t a bi l i z e s t he c ol l a ge n m ol e c ul e s a nd t he e xt r a c e l l ul a r m a t r i x l e a di ng t o b one f r a gi l i t y T a r ge t i ng t he e ndoge nous m ut a nt c ol l a ge n t r a ns c r i pt w i t h a r i bo z ym e w o ul d pr e ve nt i t s a s s oc i a t i on i n t he t r i pl e he l i x w hi l e t he ve c t or de r i ve d nor m a l ge ne w oul d be i nc l ude d i n t he he l i x a nd

PAGE 159

146 w oul d i m pr ove t he s t r e ngt h o f t he E C M U s i ng t he e ndoge nous pr om ot e r f or c ol l a ge n w i l l be ne c e s s a r y f or t r e a t m e nt of t hi s di s e a s e s i nc e dos a ge i m ba l a nc e s of C O L 1A 1 c a n a l s o c a us e di s e a s e A ut os om a l r e c e s s i ve di s e a s e s c oul d a l s o be ne f i t f r om a dua l ge ne r e pl a c e m e nt a nd a nt i s e ns e m ol e c ul e a ppr oa c h i n ge ne t he r a py. L e s c h N yha n s yndr om e a nd K e l l e y S e e gm i l l e r s yndr om e ( gout ) r e s ul t f r om t he de f i c i e nc y of t he e nz ym e hypoxa nt hi ne gua ni ne phos phor i bos yl t r a ns f e r a s e ( H P R T ) I n bo t h s yndr om e s t he r e i s a r e s i dua l a m ount of a c t i vi t y be l ow 10 % of nor m a l H P R T i s a l s o a t e t r a m e r i c e nz ym e t hus t he pos s i bi l i t y of c a us i ng dom i na nt ne ga t i ve i nt e r f e r e n c e a f t e r ge ne t he r a py c oul d be a voi de d by us i ng a r i boz ym e a ga i ns t t he e ndoge nous t r a ns c r i pt I n c ys t i c f i br os i s 40 % o f know n C F T R m ut a t i ons a r e m i s s e ns e m ut a t i ons S om e m ut a t i ons a r e de gr a de d i n t he E R due t o t he i ns t a bi l i t y or i m pr ope r f o l di ng, a nd t he w i l d t y pe pr ot e i n i s t houg ht t o be i ne f f i c i e nt l y pr oc e s s e d a s w e l l W he n t r e a t i ng pa t i e nt s by ge ne t he r a py w i t h e xpr e s s e d m ut a t i ons i t m i ght be a dva nt a ge ous t o t he ve c t or de r i ve d pr ot e i n t o pr e ve nt t r a ns l a t i on o f t he e ndoge nous C F T R m R N A by us i ng a nt i s e ns e t e c hn ol ogy. I f onl y 25% of t r a ns l a t e d C F T R i s f ul l y pr oc e s s e d pe r ha ps a gr e a t e r e f f e c t f r om t he ge ne t he r a py c oul d be obs e r ve d by onl y a l l ow i ng t r a ns l a t i on, t hus a t t e m pt e d p r oc e s s i ng, of t he nor m a l pr ot e i n T hi s s t udy s how s t ha t ge ne t he r a py f or phe nyl ke t o nur i a i s pos s i bl e a nd c a n l e a d t o hype r phe nyl a l a ni ne m i a r e ve r s a l on a no r m a l di e t B y de t e r m i ni ng t he r e a s on f or t he ne e de d hi gh ve c t or dos e s i n p r e vi ous s t udi e s w e w e r e a bl e t o de vi s e a s uc c e s s f ul a ppr oa c h t o pr e ve nt dom i na nt ne ga t i ve i nt e r f e r e nc e i n t he t r e a t e d a ni m a l s t hus r e duc i ng r A A V 2 dos e s T he m ous e m ode l f or P K U B T B R P ah e n u 2 e xpr e s s e s a m i s s e ns e pr ot e i n. M a ny a ni m a l m ode l s f or ge ne t i c di s e a s e s a r e knoc k out m i c e t ha t do not pr oduc e a ny

PAGE 160

147 m ut a nt pr ot e i n W hi l e us e f ul f or pr e l i m i na r y s t udi e s t r e a t m e nt o f t he s e m i c e c a nnot t r a ns l a t e di r e c t l y t o hum a n c l i ni c a l t r i a l s A s t he P A H da t a ba s e s how s r e l a t i ve l y f e w m ut a t i ons a c t ua l l y l e a d t o nons e ns e or a bs e nt pr ot e i ns due t o c om pl e t e de g r a da t i on or l a c k of e xpr e s s i on. C a r e f ul a s s e s s m e nt of nor m a l a nd m ut a nt p r ot e i n i nt e r a c t i ons ne e d t o be pe r f or m e d t o de ve l op a pp r opr i a t e ge ne t he r a py a ppr oa c he s i n ge ne t i c di s e a s e s

PAGE 161

148 G L O S S A R Y A A V A de no a s s oc i a t e d vi r us A N O V A A na l ys i s of va r i a nc e A P 2 A c t i va t or pr ot e i n 2 B G H pA B ovi ne gr ow t h hor m one pol y A B H 4 T e t r a hydr obi opt e r i n B T B R B l a c k a nd t a n, t u f t e d m i c e C A G H ybr i d pr om ot e r c ont a i ni ng t he hC M V e nha nc e r a nd a m odi f i e d c hi c ke n a c t i n pr om ot e r a nd f i r s t i nt r on C B S a m e hybr i d p r om ot e r a s C A G C / E B P C C A A T / e nha nc e r bi ndi ng pr o t e i n C F T R C ys t i c f i br os i s t r a ns m e m br a ne c onduc t a nc e r e gul a t or C R E c A M P r e s pons e e l e m e nt C S F C e r obr os pi na l f l ui d C O L 1A 1 C ol l a ge n t ype 1, a l pha 1 ge ne C O L 1A 2 C ol l a ge n t ype 1, a l pha 2 ge ne C uZ nS O D C oppe r z i nc s uppe r oxi de di s m ut a s e r a t pr obe D C oH D i m e r i z a t i on c of a c t or t o H N F 1 D I C E R E ndor i bonuc l e a s e D i c e r D H P R D i hydr opt e r i di ne r e duc t a s e D M E M D ube l c c o s m odi f i c a t i on of E a gl e s m e di um

PAGE 162

149 E C M E xt r a c e l l ul a r m a t r i x E R E ndopl a s m i c r e t i c ul um F I S H F l uor e s c e nt i n s i t u hyb r i di z a t i on G A P D H G l yc e r a l de hyde phos pha t e de hydr oge na s e G R E G l uc oc or t i c oi d r e s pons e e l e m e nt G T P C H G T P c yc l ohydr ol a s e I H B S S H a nk s buf f e r e d s a l t s ol ut i on hC M V H um a n c yt om e ga l ovi r us i m m e di a t e e a r l y e nha nc e r H E K 293 H um a n e m br yoni c ki dne y t r a ns f or m e d c e l l l i ne H I V H um a n i m m unode f i c i e nc y vi r us H N F 1 H e pa t oc e l l ul a r nuc l e a r f a c t or 1 H P A H ype r phe nyl a l a ni ne m i a H P R T H ypoxa nt hi ne gua ni ne phos phor i bos yl t r a ns f e r a s e H S P G H e pa r i n s ul f a t e pr ot e ogl yc a n I gG I m m unogl obul i n c l a s s G I Q I nt e l l i ge nc e quot i e nt I T R I nve r t e d t e r m i na l r e pe a t I U I nf e c t i ous uni t s L R S L a c t a t e d r i nge r s i nj e c t i on s ol ut i on L T R L ong t e r m i na l r e pe a t 6 M P H 4 6 M e t hyl 5, 6, 7 8 t e t r a hydr opt e r i ne N I H s hi f t N a t i ona l I ns t i t ut e of H e a l t h s hi f t : i nt r a m ol e c ul a r h ydr oge n m i gr a t i on N M D A N m e t hyl D a s pa r t a t e

PAGE 163

150 O I O s t e oge ne s i s i m pe r f e c t a P A G E P ol ya c r yl a m i de ge l e l e c t r opho r e s i s P A H P he nyl a l a ni ne hydr oxyl a s e pr ot e i n P ah e n u 2 M ur i ne m ut a ge ni z e d l i ne w i t h F 263S a m i no a c i d c ha nge i n bot h P ah ge ne s p21 n e w hp pT R U F 12 de r i ve d ve c t or w i t h ne w ha i r pi n P A L P he nyl a l a ni ne a m m oni a l ya s e P K U P he nyl ke t onur i a P C D P t e r i n 4 c a r bi nol a m i ne de hydr a t a s e P T P S 6 pyr uvoyl t e t r a hydr opt e r i n s ynt ha s e R I S C R N A i nduc e d s i l e nc i ng c om pl e x R P A R N a s e pr ot e c t i on a s s a y R T P C R R e ve r s e t r a ns c r i pt i on a nd pol ym e r a s e c ha i n r e a c t i o n R z R i boz ym e s i R N A S hor t i nt e r f e r i ng R N A S R S e pi a pt e r i n r e duc t a s e S V 40pA S i m i a n vi r us 40 pol yA U T R U nt r a ns l a t e d r e gi on V E G F R 1 V a s c ul a r e ndot he l i a l gr ow t h f a c t o r r e c e pt or 1 vg V e c t or ge nom e s W P R E W oodc huc k he pa t i t i s vi r us pos t t r a ns c r i pt i ona l e l e m e nt

PAGE 164

151 L I S T O F R E F E R E N C E S 1. F ol l i ng, I T he di s c ove r y of phe nyl ke t onur i a A c t a P a e di a t r S uppl 407, 4 10 ( 1994) 2. P e nr os e L S P he nyl ke t onur i a a pr obl e m i n e uge n i c s A nn H um G e ne t 62 ( P t 3 ) 193 202 ( 1998 ) 3. K oc h, R & C r uz F dl H i s t or i c a l a s pe c t s a nd ove r vi e w of r e s e a r c h on phe nyl ke t onur i a M e nt a l R e t a r da t i on a nd D e ve l opm e nt a l D i s a bi l i t i e s R e s e a r c h R e vi e w s 5, 101 103 ( 1999) 4. G ut hr i e R & S us i A A S i m pl e P he nyl a l a ni ne M e t hod F or D e t e c t i ng P he nyl ke t onur i a I n L a r ge P opul a t i ons O f N e w bo r n I nf a nt s P e di a t r i c s 32 338 43 ( 1963) 5. G l us ha kov, A V D e nni s D M S um ne r s C S e ube r t C N & M a r t ynyuk, A E L phe nyl a l a ni ne s e l e c t i ve l y de pr e s s e s c ur r e nt s a t gl ut a m a t e r gi c e xc i t a t or y s yna ps e s J N e ur os c i R e s 72, 116 24 ( 2003) 6. G l us ha kov, A V G l us ha kova O V a r s hne y, M B a j pa i L K S u m ne r s C L a i pi s P J E m bu r y, J E B a ke r S P O t e r o, D H D e nni s D M S e ube r t C N & M a r t ynyuk, A E L ong t e r m c ha nge s i n gl ut a m a t e r g i c s yna pt i c t r a ns m i s s i on i n phe nyl ke t onur i a B r a i n 128, 300 7 ( 2005) 7. B e di n, M E s t r e l l a C H P onz i D D ua r t e D V D ut r a F i l ho, C S W ys e A T W a j ne r M & W a nnm a c he r C M R e duc e d N a ( + ) K ( + ) A T P a s e a c t i vi t y i n e r yt hr oc yt e m e m br a ne s f r om pa t i e nt s w i t h phe nyl k e t onur i a P e di a t r R e s 50, 56 60 ( 2001) 8. J os e ph, B & D ye r C A R e l a t i ons hi p be t w e e n m ye l i n pr oduc t i on a nd dopa m i ne s ynt he s i s i n t he P K U m ous e br a i n. J N e ur oc he m 8 6, 615 26 ( 2003 ) 9. C os t a be be r E K e s s l e r A S e ve r o D ut r a F i l ho C de S ouz a W ys e A T W a j ne r M & W a nnm a c he r C M H ype r phe nyl a l a ni ne m i a r e duc e s c r e a t i ne ki na s e a c t i vi t y i n t h e c e r e br a l c or t e x o f r a t s I nt J D e v N e ur os c i 2 1, 111 6 ( 2003 ) 10. H om m e s F A T he e f f e c t of hype r phe nyl a l a ni na e m i a on t he m us c a r i ni c a c e t yl c hol i ne r e c e pt or i n t he H P H 5 m ous e br a i n. J I nhe r i t M e t a b D i s 16 962 74 ( 1993)

PAGE 165

152 11. K a uf m a n, S T e t r a hydr obi opt e r i n: ba s i c bi oc he m i s t r y a nd r ol e i n hum a n di s e a s e vi i i 420 ( J ohns H opki ns U ni ve r s i t y P r e s s B a l t i m o r e 1997 ) 12. A c os t a P B Y a nni c e l l i S S i ngh R M of i di S S t e i ne r R D e V i nc e nt i s E J ur e c ki E B e r ns t e i n, L G l e a s on, S C he t t y M & R ous e B N ut r i e nt i nt a ke s a nd phys i c a l gr ow t h of c hi l dr e n w i t h phe nyl ke t onur i a unde r goi ng nut r i t i on t he r a py J A m D i e t A s s oc 103, 1167 73 ( 2 003) 13. S m i t h, I B e a s l e y, M G & A de s A E E f f e c t on i nt e l l i ge nc e of r e l a xi ng t he l ow phe nyl a l a ni ne di e t i n phe nyl ke t onur i a A r c h D i s C hi l d 66, 311 6 ( 1991) 14. S m i t h, I L oba s c he r M E S t e ve ns on, J E W ol f f O H S c hm i dt H G r ube l K a i s e r S & B i c ke l H E f f e c t of s t oppi ng l ow phe nyl a l a ni ne di e t on i n t e l l e c t ua l pr ogr e s s of c hi l dr e n w i t h phe nyl ke t onur i a B r M e d J 2, 723 6 ( 1978) 15. L e uz z i V P a ns i ni M S e c hi E C hi a r ot t i F C a r d uc c i C L e vi G & A nt onoz z i I E xe c ut i ve f unc t i on i m pa i r m e nt i n e a r l y t r e a t e d P K U s ubj e c t s w i t h nor m a l m e nt a l de ve l opm e nt J I nhe r i t M e t a b D i s 27, 115 2 5 ( 2004) 16. A m e r i c a n A c a de m y of P e di a t r i c s : M a t e r na l phe nyl ke t onur i a P e di a t r i c s 107, 427 8 ( 2001) 17. L e vy, H L H i s t or i c a l ba c kgr ound f or t he m a t e r na l P K U s yndr om e P e di a t r i c s 112, 1516 8 ( 2003 ) 18. L e nke R R & L e vy, H L M a t e r na l phe nyl ke t onur i a a nd hype r phe nyl a l a ni ne m i a A n i nt e r na t i ona l s ur ve y o f t he out c om e of unt r e a t e d a nd t r e a t e d p r e gna nc i e s N E ngl J M e d 303 1202 8 ( 1980 ) 19. B l a u, N & S c r i ve r C R N e w a ppr oa c he s t o t r e a t P K U : how f a r a r e w e ? M ol G e ne t M e t a b 81, 1 2 ( 2004 ) 20. P a ul D A doub l e e dge d s w or d. N a t ur e 405 515 ( 2000) 21. K oc h, R H a nl e y W L e vy H M a t a l on, R R ous e B T r e f z F G ut t l e r F A z e n, C F r i e dm a n E P l a t t L & de l a C r uz F M a t e r na l phe nyl ke t onur i a : a n i nt e r na t i ona l s t udy. M ol G e ne t M e t a b 71, 233 9 ( 2 000) 22. K oc h, R H a nl e y W L e vy H M a t a l on, K M a t a l o n, R R ous e B T r e f z F G ut t l e r F A z e n, C P l a t t L W a i s br e n, S W i da m a n, K N i ng, J F r i e dm a n, E G & de l a C r uz F T he M a t e r na l P he nyl ke t onur i a I nt e r na t i ona l S t udy: 1984 2002. P e di a t r i c s 112, 1523 9 ( 2003) 23. R ous e B & A z e n, C E f f e c t o f hi gh m a t e r na l b l oo d phe nyl a l a ni ne on of f s pr i ng c onge ni t a l a nom a l i e s a nd de ve l opm e nt a l out c om e a t a ge s 4 a nd 6 ye a r s : t he i m por t a nc e of s t r i c t di e t a r y c ont r ol pr e c onc e pt i on a nd t hr oughout p r e gna nc y. J P e di a t r 144, 235 9 ( 2004 )

PAGE 166

153 24. H a nl e y, W B A z e n, C K oc h R M i c ha l s M a t a l on, K M a t a l on, R R ous e B T r e f z F W a i s br e n, S & de l a C r uz F M a t e r na l P h e nyl ke t onur i a C ol l a bor a t i ve S t udy ( M P K U C S ) t he 'out l i e r s '. J I nhe r i t M e t a b D i s 27, 711 23 ( 2004 ) 25. N a t i ona l I ns t i t ut e s of H e a l t h C ons e ns us D e ve l opm e nt C onf e r e nc e S t a t e m e nt : phe nyl ke t onur i a : s c r e e ni ng a nd m a na ge m e nt O c t obe r 16 18 2000 P e di a t r i c s 108, 972 82 ( 2001 ) 26. S c r i ve r C R H ur t ubi s e M K one c ki D P hom m a r i nh, M P r e vos t L E r l a nds e n, H S t e ve ns R W a t e r s P J R ya n, S M c D ona l d, D & S a r ki s s i a n, C P A H db 2003: w ha t a l oc us s pe c i f i c know l e dge ba s e c a n do. H um M ut a t 21, 333 44 ( 2003) 27. S c r i ve r C R & K a uf m a n S H ype r phe nyl a l a ni ne m i a : P he nyl a l a ni ne H ydr oxy l a s e D e f i c i e nc y. i n T he m e t a bol i c a nd m ol e c ul a r ba s e s of i nhe r i t e d di s e a s e V ol I I ( e ds C ha r l e s R S c r i ve r M D C M A r t hur L B e a ude t M D W i l l i a m S S l y, M D & D a vi d V a l l e M D ) ( M c G r a w H i l l N e w Y or k, 200 1) 28. K w ok, S C L e dl e y, F D D i L e l l a A G R obs on, K J & W oo, S L N uc l e ot i de s e que nc e of a f ul l l e ngt h c om pl e m e nt a r y D N A c l o ne a nd a m i no a c i d s e que nc e of hum a n ph e nyl a l a ni ne hydr oxyl a s e B i oc he m i s t r y 2 4, 556 61 ( 1985 ) 29. L e dl e y, F D G r e ne t t H E D i L e l l a A G K w ok, S C & W oo, S L G e ne t r a ns f e r a nd e xpr e s s i on of hum a n phe nyl a l a ni ne hydr oxy l a s e S c i e nc e 228, 77 9 ( 1985) 30. D i L e l l a A G K w ok, S C L e dl e y, F D M a r vi t J & W oo, S L M ol e c ul a r s t r uc t ur e a nd pol ym or phi c m a p of t he hum a n phe nyl a l a ni ne hydr oxyl a s e ge ne B i oc he m i s t r y 25, 743 9 ( 1986 ) 31. F a us t D M C a t he r i n, A M B a r ba ux S B e l ka di L I m a i z um i S c he r r e r T & W e i s s M C T he a c t i vi t y o f t he hi ghl y i nduc i bl e m o us e phe nyl a l a ni ne hydr oxyl a s e ge ne pr om ot e r i s de pe nde nt upon a t i s s ue s pe c i f i c hor m one i nduc i bl e e nha nc e r M ol C e l l B i ol 16, 3125 37 ( 1996) 32. K one c ki D S W a ng, Y T r e f z F K L i c ht e r K one c ki U & W oo, S L S t r uc t u r a l c ha r a c t e r i z a t i on of t he 5' r e gi ons o f t he hum a n phe nyl a l a ni ne hydr oxyl a s e ge ne B i oc he m i s t r y 31, 8363 8 ( 1992 ) 33. L e i X D & K a uf m a n S I de nt i f i c a t i on of he pa t i c n uc l e a r f a c t or 1 bi ndi ng s i t e s i n t he 5' f l a nki ng r e gi on of t he hum a n phe nyl a l a ni ne hydr oxyl a s e ge ne : i m pl i c a t i on of a dua l f un c t i on o f phe nyl a l a ni ne hyd r oxyl a s e s t i m ul a t or i n t he phe nyl a l a ni ne hydr oxyl a t i on s ys t e m P r oc N a t l A c a d S c i U S A 9 5, 1500 4 ( 1998 ) 34. D a hl H H & M e r c e r J F I s ol a t i on a nd s e que nc e of a c D N A c l one w hi c h c ont a i ns t he c om pl e t e c odi ng r e gi on of r a t phe nyl a l a ni ne hy dr oxyl a s e S t r uc t u r a l hom ol ogy w i t h t y r os i ne hydr oxyl a s e g l uc oc or t i c oi d r e gul a t i on, a nd us e of a l t e r na t e pol ya de nyl a t i on s i t e s J B i ol C he m 261 4 148 53 ( 1986 )

PAGE 167

154 35. W a ng, Y D e M a yo, J L H a hn, T M F i ne gol d, M J K one c ki D S L i c ht e r K one c ki U & W oo S L T i s s ue a nd de ve l opm e nt s pe c i f i c e xpr e s s i on of t he hum a n phe nyl a l a ni ne hydr oxyl a s e / c hl or a m phe ni c ol a c e t yl t r a ns f e r a s e f us i on ge ne i n t r a ns ge ni c m i c e J B i ol C he m 267 15105 10 ( 1992 ) 36. T our i a n, A G odda r d, J & P uc k, T T P he nyl a l a ni ne hydr oxyl a s e a c t i vi t y i n m a m m a l i a n c e l l s J C e l l P hys i ol 73, 159 70 ( 1969) 37. A yl i ng, J E P i r s on, W D a l J a na bi J M & H e l f a nd, G D K i dne y phe nyl a l a ni ne hydr oxyl a s e f r om m a n a nd r a t C om pa r i s on w i t h t he l i ve r e nz ym e B i oc he m i s t r y 13, 78 85 ( 1974 ) 38. R a o, D N & K a uf m a n, S P ur i f i c a t i on a nd s t a t e o f a c t i va t i on of r a t ki dne y phe nyl a l a ni ne hydr oxyl a s e J B i ol C he m 261 886 6 76 ( 1986 ) 39. M ol l e r N M e e k, S B i ge l ow M A nd r e w s J & N a i r K S T he ki dne y i s a n i m por t a nt s i t e f or i n vi vo phe nyl a l a ni ne t o t y r os i ne c onve r s i on i n a dul t hum a ns : A m e t a bol i c r ol e of t he ki dne y. P r oc N a t l A c a d S c i U S A 97 1242 6 ( 2000 ) 40. L i c ht e r K one c ki U H i pke C M & K one c ki D S H um a n phe nyl a l a ni ne hydr oxyl a s e ge ne e xpr e s s i on i n ki dne y a nd ot he r n onhe pa t i c t i s s ue s M ol G e ne t M e t a b 67, 308 16 ( 1999) 41. S c r i ve r C R & C l ow C L P he nyl ke t onur i a a nd ot h e r phe nyl a l a ni ne hydr oxyl a t i on m ut a nt s i n m a n. A nnu R e v G e ne t 14 179 202 ( 19 80) 42. D os ke l a nd, A P M a r t i ne z A K na pps kog, P M & F l a t m a r k, T P hos phor yl a t i on of r e c om bi na nt hum a n phe nyl a l a ni ne hyd r oxyl a s e : e f f e c t on c a t a l yt i c a c t i vi t y s ubs t r a t e a c t i va t i on a nd pr ot e c t i on a ga i ns t non s pe c i f i c c l e a va ge of t he f us i on pr ot e i n by r e s t r i c t i on p r ot e a s e B i oc he m J 313 ( P t 2) 409 14 ( 1996) 43. K obe B J e nni ngs I G H ous e C M M i c he l l B J G oodw i l l K E S a nt a r s i e r o, B D S t e ve ns R C C ot t on, R G & K e m p B E S t r uc t ur a l ba s i s of a ut or e gul a t i on of phe nyl a l a ni ne hydr oxyl a s e N a t S t r uc t B i ol 6, 442 8 ( 1999) 44. W a t e r s P J H ow P A H ge ne m ut a t i ons c a us e hype r phe nyl a l a ni ne m i a a nd w hy m e c ha ni s m m a t t e r s : i ns i ght s f r om i n vi t r o e xpr e s s i on. H um M ut a t 21, 357 69 ( 2003) 45. W a t e r s P J S c r i ve r C R & P a r ni a k, M A H om om e r i c a nd he t e r om e r i c i nt e r a c t i ons be t w e e n w i l d t ype a nd m ut a nt phe nyl a l a ni ne hydr oxyl a s e s ubuni t s : e va l ua t i on of t w o hybr i d a pp r oa c he s f or f unc t i ona l a na l y s i s of m ut a t i ons c a us i ng hype r phe nyl a l a ni ne m i a M ol G e ne t M e t a b 73, 230 8 ( 2001 ) 46. P e y, A L D e s vi a t L R G a m e z A U ga r t e M & P e r e z B P he nyl ke t onu r i a : ge not ype phe not ype c or r e l a t i ons ba s e d on e xpr e s s i on a na l ys i s of s t r uc t ur a l a nd f unc t i ona l m ut a t i ons i n P A H H um M ut a t 21 370 8 ( 2003)

PAGE 168

155 47. M i r i s ol a M G C a l i F G l or i a A S c hi noc c a P D A m a t o, M C a s s a r a G L e o G D P a l i l l o L M e l i C & R om a no, V P A H ge ne m ut a t i ons i n t he S i c i l i a n popul a t i on: a s s oc i a t i on w i t h m i ni ha pl ot ype s a nd e xpr e s s i on a na l ys i s M ol G e ne t M e t a b 74, 353 61 ( 2001) 48. G a m e z A P e r e z B U ga r t e M & D e s vi a t L R E x pr e s s i on a na l ys i s of phe nyl ke t onur i a m ut a t i ons E f f e c t on f ol di ng a nd s t a bi l i t y of t he phe nyl a l a ni ne hydr oxyl a s e pr ot e i n. J B i ol C he m 275 29737 42 ( 2000) 49. K a ya a l p E T r e a c y, E W a t e r s P J B yc k, S N ow a c ki P & S c r i ve r C R H um a n phe nyl a l a ni ne hydr oxyl a s e m ut a t i ons a nd hype r ph e nyl a l a ni ne m i a phe not ype s : a m e t a na l ys i s of ge not ype phe not ype c or r e l a t i ons A m J H um G e ne t 61 1309 17 ( 1997) 50. S he dl ovs ky, A M c D ona l d, J D S y m ul a D & D ov e W F M ous e m ode l s of hum a n phe nyl ke t onur i a G e ne t i c s 134, 1205 10 ( 1993) 51. M c D ona l d, J D B ode V C D ove W F & S he dl ovs ky, A P a hhph 5: a m ous e m ut a nt de f i c i e nt i n phe nyl a l a ni ne hydr oxyl a s e P r o c N a t l A c a d S c i U S A 87, 1965 7 ( 1990 ) 52. Z a gr e da L G oodm a n, J D r ui n D P M c D ona l d, D & D i a m ond A C ogni t i ve de f i c i t s i n a ge ne t i c m ous e m ode l of t he m os t c om m on bi oc he m i c a l c a us e of hum a n m e nt a l r e t a r da t i on J N e ur os c i 19, 6175 82 ( 1999) 53. M c D ona l d, J D D ye r C A G a i l i s L & K i r by, M L C a r di ova s c ul a r de f e c t s a m ong t he pr oge ny of m ous e phe nyl ke t onur i a f e m a l e s P e di a t r R e s 42, 103 7 ( 1997) 54. M c D ona l d, J D & C ha r l t on, C K C ha r a c t e r i z a t i on o f m ut a t i ons a t t he m ous e phe nyl a l a ni ne hydr oxyl a s e l oc us G e nom i c s 39, 40 2 5 ( 1997 ) 55. C ho, S & M c D ona l d, J D E f f e c t of m a t e r na l b l ood phe nyl a l a ni ne l e ve l on m ous e m a t e r na l phe nyl ke t onur i a o f f s pr i ng. M ol G e ne t M e t a b 74, 420 5 ( 2001 ) 56. P e y, A L P e r e z B D e s vi a t L R M a r t i ne z M A A gua do, C E r l a nds e n, H G a m e z A S t e ve ns R C T ho r ol f s s on, M U g a r t e M & M a r t i ne z A M e c ha ni s m s unde r l yi ng r e s pons i ve ne s s t o t e t r a hydr obi opt e r i n i n m i l d phe nyl ke t onu r i a m ut a t i ons H um M ut a t 24 388 99 ( 2004) 57. E r l a nds e n, H P e y A L G a m e z A P e r e z B D e s vi a t L R A gua do, C K oc h R S ur e ndr a n, S T y r i ng, S M a t a l on, R S c r i ve r C R U ga r t e M M a r t i ne z A & S t e ve ns R C C or r e c t i on of ki ne t i c a nd s t a bi l i t y de f e c t s by t e t r a hydr obi opt e r i n i n phe nyl ke t onur i a pa t i e nt s w i t h c e r t a i n phe nyl a l a ni n e hydr oxyl a s e m ut a t i ons P r oc N a t l A c a d S c i U S A 101, 16903 8 ( 2004)

PAGE 169

156 58. D e s vi a t L R P e r e z B B e l a nge r Q ui nt a na A C a s t r o, M A gua do, C S a nc he z A G a r c i a M J M a r t i ne z P a r do M & U ga r t e M T e t r a hydr obi opt e r i n r e s pons i ve ne s s : r e s ul t s of t he B H 4 l oa di ng t e s t i n 31 S pa ni s h P K U pa t i e nt s a nd c or r e l a t i on w i t h t he i r ge not ype M ol G e ne t M e t a b 83, 157 62 ( 2004 ) 59. T r e f z F K & B l a u, N P ot e nt i a l r ol e of t e t r a hydr ob i opt e r i n i n t he t r e a t m e nt of m a t e r na l phe nyl ke t onur i a P e di a t r i c s 112 1566 9 ( 2003) 60. S hi nt a ku, H K ur e S O hu r a T O ka no, Y O hw a da M S ugi ya m a N S a kur a N Y os h i da I Y os hi no, M M a t s uba r a Y S uz uki K A oki K & K i t a ga w a T L ong t e r m t r e a t m e nt a nd di a gnos i s of t e t r a hydr obi opt e r i n r e s pons i ve hype r phe nyl a l a ni ne m i a w i t h a m ut a nt phe nyl a l a ni ne hydr oxyl a s e ge ne P e di a t r R e s 55, 425 30 ( 2004) 61. B l a u, N & E r l a nds e n, H T he m e t a bol i c a nd m ol e c ul a r ba s e s of t e t r a hydr obi opt e r i n r e s pons i ve phe nyl a l a ni ne hydr oxyl a s e de f i c i e nc y. M ol G e ne t M e t a b 82, 101 11 ( 2004) 62. K i m W E r l a nds e n, H S u r e ndr a n, S S t e ve ns R C G a m e z A M i c hol s M a t a l on, K T y r i ng, S K & M a t a l on, R T r e nds i n e nz ym e t h e r a py f or phe nyl ke t onur i a M ol T he r 10 220 4 ( 2004 ) 63. C hr i s t e ns e n, R G ut t l e r F & J e ns e n, T G C om pa r i s on of e pi de r m a l ke r a t i noc yt e s a nd de r m a l f i b r obl a s t s a s pot e nt i a l t a r ge t c e l l s f or s om a t i c ge ne t he r a py o f phe nyl ke t onur i a M ol G e ne t M e t a b 76 313 8 ( 200 2) 64. H a r di ng, C O W i l d, K C ha ng, D M e s s i ng, A & W ol f f J A M e t a bol i c e ngi ne e r i ng a s t he r a py f o r i nbo r n e r r or s of m e t a bol i s m de ve l opm e nt of m i c e w i t h phe nyl a l a ni ne hydr oxyl a s e e xpr e s s i on i n m us c l e G e ne T he r 5, 677 83 ( 1998) 6 5. L i n, C M T a n Y L e e Y M C ha ng, C C & H s i a o, K J E xpr e s s i on of hum a n phe nyl a l a ni ne hydr oxyl a s e a c t i vi t y i n T l ym phoc yt e s of c l a s s i c a l phe nyl ke t onur i a c hi l dr e n by r e t r ovi r a l m e di a t e d ge ne t r a ns f e r J I nh e r i t M e t a b D i s 20, 742 54 ( 1997) 66. H a r di ng, C O N e f f M J one s K W i l d, K & W ol f f J A E xp r e s s i on of phe nyl a l a ni ne hydr oxyl a s e ( P A H ) i n e r yt h r oge ni c bone m a r r ow doe s not c or r e c t hype r phe nyl a l a ni ne m i a i n P a h( e nu2) m i c e J G e ne M e d 5, 984 93 ( 2003) 67. F a ng, B E i s e ns m i t h, R C L i X H F i ne gol d, M J S he d l ovs ky, A D ove W & W oo, S L G e ne t he r a py f o r phe nyl ke t onu r i a : phe n ot ypi c c or r e c t i on i n a ge ne t i c a l l y de f i c i e nt m ous e m ode l by a de novi r us m e di a t e d he pa t i c ge ne t r a ns f e r G e ne T he r 1 247 54 ( 1994 )

PAGE 170

157 68. N a ga s a ki Y M a t s uba r a Y T a ka no, H F uj i i K S e noo M A ka num a J T a ka ha s hi K K u r e S H a r a M K a ne ga e Y S a i t o, I & N a r i s a w a K R e ve r s a l of hypopi gm e nt a t i on i n phe nyl ke t onu r i a m i c e by a de novi r us m e di a t e d ge ne t r a ns f e r P e di a t r R e s 45, 465 73 ( 1999) 69. M oc hi z uki S M i z uka m i H O gur a T K ur e S I c hi nohe A K oj i m a K M a t s uba r a Y K oba ya hi E O ka da T H os hi ka A O z a w a K & K um e A L ong t e r m c or r e c t i on of hype r phe nyl a l a ni ne m i a by A A V m e di a t e d ge ne t r a ns f e r l e a ds t o be ha vi or a l r e c ove r y i n phe nyl ke t onu r i a m i c e G e ne T he r 11 1081 6 ( 2004) 70. O h, H J P a r k, E S K a ng S J o, I & J ung, S C L ong t e r m e nz ym a t i c a nd phe not ypi c c or r e c t i on i n t he phe nyl ke t onu r i a m ous e m ode l by a de no a s s oc i a t e d vi r us ve c t or m e di a t e d ge ne t r a ns f e r P e di a t r R e s 56, 278 84 ( 2004 ) 71. M uz yc z ka N & B e r ns K P a r vov i r i da e : T he vi r us e s a nd t he i r r e pl i c a t i on i n F unda m e nt a l vi r ol ogy ( e ds K ni pe D H ow l e y, P & G r i f f i n, D ) 1089 1121 ( L i ppi nc ot t W i l l i a m s & W i l k i ns P hi l a de l phi a 200 1) 72. S ong, S E m bur y J L a i pi s P B e r ns K C r a w f o r d, J & F l o t t e T S t a bl e t he r a pe ut i c s e r u m l e ve l s of hum a n a l pha 1 a nt i t r yp s i n ( A A T ) a f t e r por t a l ve i n i nj e c t i on of r e c om bi na nt a de no a s s oc i a t e d vi r us ( r A A V ) ve c t or s G e ne T he r 8 1299 306 ( 2001 ) 73. H e r z og, R Y a ng, E C out o, L H a gs t r om J E l w e l l D F i e l ds P B ur t on M B e l l i nge r D R e a d, M B r i nkhous K P ods a kof f G N i c hol s T K ur t z m a n, G & H i gh, K L ong t e r m c or r e c t i on of c a ni ne he m ophi l i a B by ge ne t r a ns f e r of bl ood c oa gul a t i on f a c t or I X m e di a t e d by a de no a s s oc i a t e d vi r a l ve c t or N a t M e d 5, 56 63 ( 1999) 74. K a s pa r B R ot h, D L a i N D r um m J E r i c ks on, D M c K i r na n, M & H a m m ond H M yoc a r di a l ge ne t r a ns f e r a nd l ong t e r m e xpr e s s i on f ol l ow i ng i nt r a c or ona r y de l i ve r y of a de no a s s oc i a t e d vi r us J G e ne M e d 7, 316 24 ( 2005 ) 75. H i l di nge r M & A ur i c c hi o A A dva nc e s i n A A V m e di a t e d ge ne t r a ns f e r f or t he t r e a t m e nt of i nhe r i t e d d i s or de r s E ur J H u m G e ne t 12, 263 71 ( 2004 ) 76. N a ka i H M ont i ni E F ue s s S S t or m T G r om pe M & K a y, M A A V s e r ot ype 2 ve c t or s pr e f e r e nt i a l l y i n t e gr a t e i nt o a c t i ve ge ne s i n m i c e N a t G e ne t 34, 297 302 ( 2003) 77 Y a ng, C X i a o X Z hu, X A ns a r di D E ps t e i n, N F r e y, M M a t e r a A & S a m ul s ki R C e l l ul a r r e c om bi na t i on pa t hw a ys a nd vi r a l t e r m i na l r e pe a t ha i r pi n s t r uc t ur e s a r e s uf f i c i e nt f or a de no a s s oc i a t e d vi r us i nt e gr a t i on i n vi vo a nd i n vi t r o. J V i r ol 71 9231 47 ( 1997 ) 78. Q i ng, K M a h, C H a ns e n, J Z hou S D w a r ki V & S r i va s t a va A H um a n f i br obl a s t gr ow t h f a c t or r e c e pt or 1 i s a c o r e c e pt or f or i n f e c t i on by a de no a s s oc i a t e d vi r us 2. N a t M e d 5, 71 7 ( 1999)

PAGE 171

158 79. S um m e r f or d C B a r t l e t t J & S a m ul s ki R A l pha V be t a 5 i nt e gr i n: a c o r e c e pt or f or a de no a s s oc i a t e d vi r us t ype 2 i nf e c t i on. N a t M e d 5, 78 82 ( 1999) 80. T hom a s C E S t o r m T A H ua ng, Z & K a y, M A R a pi d unc oa t i ng of ve c t or ge nom e s i s t he ke y t o e f f i c i e nt l i ve r t r a ns duc t i on w i t h ps e udot ype d a de no a s s oc i a t e d vi r us ve c t or s J V i r ol 78 3110 22 ( 20 04 ) 81. N a ka i H Y a nt S S t or m T F ue s s S M e us e L & K a y, M E xt r a c hr om os om a l r e c om bi na nt a de no a s s oc i a t e d vi r us ve c t or ge nom e s a r e pr i m a r i l y r e s pons i bl e f or s t a bl e l i ve r t r a ns duc t i on i n vi vo. J V i r ol 75, 6969 76 ( 2001) 82. O ha s hi K N a ka i H C out o, L & K a y, M M odi f i e d i nf us i on pr oc e dur e s a f f e c t r e c om bi na nt a de no a s s oc i a t e d vi r us ve c t or t ype 2 t r a ns duc t i on i n t he l i ve r H um G e ne T he r 16 299 306 ( 2005 ) 83. L i u, M Y ue Y H a r pe r S G r a nge R C ha m be r l a i n, J & D ua n, D A de no a s s oc i a t e d vi r us m e di a t e d m i c r odys t r ophi n e xpr e s s i on pr ot e c t s young m dx m us c l e f r om c ont r a c t i on i nduc e d i nj ur y M ol T he r 11, 245 56 ( 2005 ) 84. P a s s i ni M M a c a ul e y, S H uf f M T a ks i r T B u, J W u, I P i e pe nha ge n, P D odge J S h i ha bu ddi n, L O 'R i or da n, C S c huc hm a n, E & S t e w a r t G A A V ve c t or m e di a t e d c or r e c t i on of b r a i n pa t hol ogy i n a m ous e m ode l of N i e m a nn P i c k A di s e a s e M ol T he r 11 754 62 ( 2005) 85. V i r e l l a L ow e l l I Z us m a n, B F ous t K L oi l e r S C onl on, T S ong S C he s nut K F e r kol T & F l ot t e T E nha nc i ng r A A V ve c t or e xpr e s s i on i n t he l ung. J G e ne M e d ( 2005) 86. H e nni g, A O gi l vi e J O hl e m i l l e r K T i m m e r s A H a us w i r t h, W & S a nds M A A V m e di a t e d i nt r a vi t r e a l ge ne t he r a py r e duc e s l ys os om a l s t or a ge i n t he r e t i na l pi gm e n t e d e pi t he l i um a nd i m pr ove s r e t i na l f unc t i o n i n a dul t M P S V I I m i c e M ol T he r 10 106 16 ( 2004 ) 87. T a ke da S T a ka ha s hi M M i z uka m i H K oba ya s hi E T a ke uc hi K H a ka m a t a Y K a ne ko, T Y a m a m ot o, H I t o C O z a w a K I s hi ba s hi K M a t s uz a ki T T a ka t a K A s a no, Y & K us a no, E S uc c e s s f ul ge ne t r a ns f e r us i ng a de no a s s oc i a t e d vi r us ve c t or s i nt o t he ki dne y: c om pa r i s on a m ong a de no a s s oc i a t e d vi r us s e r ot ype 1 5 ve c t or s i n vi t r o a nd i n vi vo N e p hr on E xp N e phr ol 96, e 119 26 ( 2004) 88. S nyde r R M i a o, C M e us e L T ubb, J D ona hue B L i n H S t a f f or d D P a t e l S T hom ps on, A N i c hol s T R e a d, M B e l l i nge r D B r i nkhous K & K a y, M C or r e c t i on of he m ophi l i a B i n c a ni ne a nd m u r i ne m ode l s us i ng r e c om bi na nt a de no a s s oc i a t e d vi r a l ve c t or s N a t M e d 5, 64 70 ( 1999) 89. F i r e A X u S M ont gom e r y M K K os t a s S A D r i ve r S E & M e l l o, C C P ot e nt a nd s pe c i f i c ge ne t i c i nt e r f e r e nc e by doubl e s t r a nde d R N A i n C a e nor ha bdi t i s e l e ga ns N a t ur e 391, 806 11 ( 1998)

PAGE 172

159 90. M c M a nu s M T & S ha r p, P A G e ne s i l e nc i ng i n m a m m a l s by s m a l l i nt e r f e r i ng R N A s N a t R e v G e ne t 3, 737 47 ( 2002) 91. R e ynol ds A L e a ke D B oe s e Q S c a r i nge S M a r s ha l l W S & K hvor ova A R a t i ona l s i R N A de s i gn f or R N A i nt e r f e r e nc e N a t B i ot e c hnol 22, 326 30 ( 2004 ) 92. U i T e i K N a i t o, Y T a ka ha s hi F H a r a guc hi T O hki H a m a z a ki H J uni A U e da R & S a i go K G ui de l i ne s f or t he s e l e c t i on o f hi ghl y e f f e c t i ve s i R N A s e que nc e s f or m a m m a l i a n a nd c hi c k R N A i nt e r f e r e nc e N uc l e i c A c i ds R e s 32, 936 48 ( 2004 ) 93. S c hw a r z D S H ut va gne r G D u, T X u Z A r oni n N & Z a m or e P D A s ym m e t r y i n t he a s s e m bl y of t he R N A i e nz ym e c om pl e x. C e l l 115, 199 208 ( 2003) 94. S ong, R X Z ha ng Z M or G & S a nt e n, R J D ow n r e gul a t i on of B c l 2 e nha nc e s e s t r oge n a popt ot i c a c t i on i n l ong t e r m e s t r a di ol de pl e t e d E R + br e a s t c a nc e r c e l l s A popt os i s 10, 667 78 ( 2005) 95. X i a H M a o, Q E l i a s on, S L H a r pe r S Q M a r t i ns I H O r r H T P a ul s on, H L Y a ng, L K ot i n R M & D a vi ds on, B L R N A i s uppr e s s e s pol ygl ut a m i ne i nduc e d ne ur ode ge ne r a t i on i n a m ode l of s pi noc e r e be l l a r a t a xi a N a t M e d 10, 816 20 ( 2004) 96. Z ha ng, W Y a ng, H K ong, X M oha pa t r a S S a n J ua n V e r ga r a H H e l l e r m a nn G B e he r a S S i nga m R L oc ke y, R F & M oha pa t r a S S I nhi bi t i on of r e s pi r a t or y s ync yt i a l vi r us i nf e c t i on w i t h i nt r a na s a l s i R N A na nopa r t i c l e s t a r ge t i ng t he v i r a l N S 1 ge ne N a t M e d 11, 56 62 ( 2005) 97. H e de K B l oc ki ng c a nc e r w i t h R N A i n t e r f e r e nc e m ove s t ow a r d t he c l i ni c J N a t l C a nc e r I ns t 97, 626 8 ( 2005) 98. D i l l i n, A T he s pe c i f i c s of s m a l l i nt e r f e r i ng R N A s pe c i f i c i t y. P r oc N a t l A c a d S c i U S A 100, 6289 91 ( 2003) 99. T a ng G s i R N A a nd m i R N A : a n i ns i ght i nt o R I S C s T r e nds i n B i oc he m i c a l S c i e nc e s 30, 106 ( 2005 ) 100. D oudna J A & C e c h, T R T he c he m i c a l r e pe r t oi r e of na t ur a l r i boz ym e s N a t ur e 418, 222 8 ( 2002 ) 101. S c ot t W G M ur r a y J B A r no l d, J R S t odda r d B L & K l ug, A C a pt ur i ng t he s t r uc t ur e of a c a t a l yt i c R N A i nt e r m e di a t e : t he ha m m e r he a d r i boz ym e S c i e nc e 274, 2065 9 ( 1996 ) 102. R uf f ne r D E S t o r m o, G D & U hl e nbe c k, O C S e qu e nc e r e qui r e m e nt s of t he ha m m e r he a d R N A s e l f c l e a va ge r e a c t i on. B i oc he m i s t r y 29, 10695 702 ( 1990 )

PAGE 173

160 103. S hi m a ya m a T N i s hi ka w a S & T a i r a K G e ne r a l i t y of t he N U X r u l e : ki ne t i c a na l ys i s of t he r e s ul t s of s ys t e m a t i c m ut a t i ons i n t h e t r i nuc l e ot i de a t t he c l e a va ge s i t e of ha m m e r he a d r i boz ym e s B i oc he m i s t r y 34 3 649 54 ( 1995 ) 104. K or e A R V a i s h, N K K ut z ke U & E c ks t e i n, F S e que nc e s pe c i f i c i t y of t he ha m m e r he a d r i boz ym e r e vi s i t e d; t he N H H r ul e N uc l e i c A c i ds R e s 26, 4116 20 ( 1998) 105. S ha w L C S kol d A W ong F P e t t e r s R H a us w i r t h, W W & L e w i n A S A n a l l e l e s pe c i f i c ha m m e r he a d r i boz ym e ge ne t h e r a py f or a por c i ne m ode l of a ut os om a l dom i na nt r e t i ni t i s p i gm e nt os a M ol V i s 7, 6 13 ( 2001 ) 106. P ue r t a F e r na nde z E R om e r o L ope z C B a r r os o d e l J e s u s A & B e r z a l H e r r a nz A R i boz ym e s : r e c e nt a dva nc e s i n t he de ve l opm e n t of R N A t ool s F E M S M i c r obi ol R e v 27, 75 97 ( 2003) 107. C a s t a not t o, D L i J R M i c hi e nz i A L a ngl oi s M A L e e N S P uy m i r a t J & R os s i J J I nt r a c e l l ul a r r i boz ym e a ppl i c a t i ons B i oc he m S oc T r a ns 30 1140 5 ( 2002 ) 108. B e r gs l a nd, E K U pda t e on c l i ni c a l t r i a l s t a r ge t i ng va s c ul a r e ndot he l i a l gr ow t h f a c t or i n c a nc e r A m J H e a l t h S ys t P ha r m 61 S 1 2 20 ( 2004) 109. U s m a n, N & B l a t t L M N uc l e a s e r e s i s t a nt s ynt he t i c r i boz ym e s : de ve l opi ng a ne w c l a s s of t he r a pe ut i c s J C l i n I nve s t 106 1197 202 ( 2000) 110. S ul l e nge r B A & G i l boa E E m e r gi ng c l i ni c a l a ppl i c a t i ons of R N A N a t ur e 418, 252 8 ( 2002 ) 111. F r i t z J J W hi t e D A L e w i n, A S & H a us w i r t h, W W D e s i gni ng a nd c ha r a c t e r i z i ng ha m m e r he a d r i boz ym e s f or us e i n A A V ve c t o r m e di a t e d r e t i na l ge ne t he r a pi e s M e t hods E nz ym ol 346, 358 77 ( 2002) 112. S a m br ook, J R us s e l l D W & M a ni a t i s T M ol e c ul a r c l oni ng: a l a bor a t or y m a nua l 3 v ( C ol d S p r i ng H a r bo r L a bor a t or y P r e s s C ol d S pr i ng H a r bor N Y 2001) 113. M e ye r s E N L e w a ndos ki M & M a r t i n, G R A n F gf 8 m ut a nt a l l e l i c s e r i e s ge ne r a t e d by C r e a nd F l p m e di a t e d r e c om bi na t i on N a t G e ne t 18 136 41 ( 1998) 114. Z ol ot ukhi n, S B yr ne B M a s on, E Z ol o t ukhi n, I P ot t e r M C he s nut K S um m e r f or d C S a m ul s ki R & M uz yc z ka N R e c om bi na nt a de no a s s oc i a t e d vi r us pur i f i c a t i on us i ng nove l m e t hods i m pr ove s i n f e c t i ous t i t e r a nd yi e l d. G e ne T he r 6 973 85 ( 1999 ) 115. M c C a m a n, M F l uor i m e t r i c m e t hod f or t he de t e r m i na t i on of phe nyl a l a ni ne i n s e r um J our na l of L a bo r a t or y a nd C l i ni c a l M e di c i ne ( 1962)

PAGE 174

161 116. S a r ki s s i a n, C N B oul a i s D M M c D ona l d, J D & S c r i ve r C R A he t e r oa l l e l i c m ut a nt m ous e m ode l : A ne w or t hol og ue f o r hum a n hype r phe nyl a l a ni ne m i a M ol G e ne t M e t a b 69, 188 94 ( 2000 ) 117. K a uf m a n, S A m ode l of hum a n phe nyl a l a ni ne m e t a bol i s m i n nor m a l s ubj e c t s a nd i n phe nyl ke t onur i c pa t i e nt s P r oc N a t l A c a d S c i U S A 96 3 160 4 ( 1999 ) 118. P hi l l i ps J A 3r d D om i na nt ne ga t i ve di a be t e s i ns i pi dus a nd ot he r e ndoc r i nopa t hi e s J C l i n I nve s t 112 1641 3 ( 2003) 119. P a t e r na J C & B ue l e r H R e c om bi na nt a de no a s s oc i a t e d vi r us ve c t or de s i gn a nd ge ne e xpr e s s i on i n t he m a m m a l i a n b r a i n. M e t hods 28, 208 18 ( 2002 ) 120. Z uf f e r e y R D one l l o, J E T r ono, D & H ope T J W oodc huc k he pa t i t i s vi r us pos t t r a ns c r i pt i ona l r e gul a t or y e l e m e nt e nha nc e s e xpr e s s i on of t r a ns ge ne s de l i ve r e d by r e t r ovi r a l ve c t or s J V i r ol 73 2886 92 ( 1999) 121. S ong, S E m bur y J L a i pi s P J B e r ns K I C r a w f o r d, J M & F l ot t e T R S t a bl e t he r a pe ut i c s e r um l e ve l s of hum a n a l pha 1 a nt i t r yp s i n ( A A T ) a f t e r por t a l ve i n i nj e c t i on of r e c om bi na nt a de no a s s oc i a t e d vi r us ( r A A V ) ve c t or s G e ne T he r 8 1299 306 ( 2001 ) 122. S nyde r R O M i a o, C M e us e L T ubb, J D ona hue B A L i n H F S t a f f or d D W P a t e l S T hom ps on, A R N i c hol s T R e a d, M S B e l l i nge r D A B r i nkhous K M & K a y, M A C or r e c t i on of he m ophi l i a B i n c a ni ne a n d m ur i ne m ode l s us i ng r e c om bi na nt a de no a s s oc i a t e d vi r a l ve c t or s N a t M e d 5, 64 70 ( 1999) 123. D a vi dof f A N g C Z hou J S pe nc e Y & N a t hw a ni A S e x s i gni f i c a nt l y i nf l ue nc e s t r a ns duc t i on of m u r i ne l i ve r by r e c om bi na nt a de no a s s oc i a t e d vi r a l ve c t or s t hr ough a n a nd r oge n de pe nde nt pa t hw a y. B l ood 102, 480 8 ( 2003) 124 Z uke r M M f ol d w e b s e r ve r f or nuc l e i c a c i d f ol di ng a nd hybr i di z a t i on pr e di c t i on N uc l e i c A c i ds R e s 31, 3406 15 ( 2003) 125. Q i X L e w i n A S H a us w i r t h W W & G uy, J O pt i c ne ur opa t hy i nduc e d by r e duc t i ons i n m i t oc hondr i a l s upe r oxi de di s m ut a s e I nve s t O p ht ha l m ol V i s S c i 44, 1088 96 ( 2003 ) 126. L i e be r A & S t r a us s M S e l e c t i on of e f f i c i e nt c l e a va ge s i t e s i n t a r ge t R N A s by us i ng a r i boz ym e e xpr e s s i on l i br a r y. M ol C e l l B i ol 15, 540 51 ( 1995) 127. C ha r r on, C E L e w i n, A S & L a i pi s P J E xpl o r i ng t he U s e of R i boz ym e w i t h G e ne T he r a py f o r P he nyl ke t onu r i a M ol e c ul a r T he r a py 7, S 396 ( 2003) 128. T oudj a r s ka I K i l pa t r i c k, M W N i u J W e ns t r up, R J & T s i pour a s P D e l i ve r y of a ha m m e r he a d r i boz ym e s pe c i f i c a l l y dow n r e gul a t e s m ut a nt t ype I c ol l a ge n m R N A i n a m ur i ne m ode l o f os t e oge ne s i s i m pe r f e c t a A nt i s e ns e N uc l e i c A c i d D r ug D e v 11, 341 6 ( 2001 )

PAGE 175

162 129. N a ka i H S t or m T & K a y, M I nc r e a s i ng t he s i z e of r A A V m e di a t e d e xpr e s s i on c a s s e t t e s i n vi vo by i n t e r m ol e c ul a r j o i ni ng o f t w o c om pl e m e nt a r y ve c t or s N a t B i ot e c hnol 18 527 32 ( 2000 ) 130. D ua n, D Y ue Y & E nge l ha r dt J E xpa ndi ng A A V pa c ka gi ng c a pa c i t y w i t h t r a ns s pl i c i ng or ove r l a ppi ng ve c t or s : a qua nt i t a t i v e c om pa r i s on. M ol T he r 4 383 91 ( 2001) 131. D ua n, D Y ue Y Y a n, Z & E nge l ha r dt J A ne w dua l ve c t or a ppr oa c h t o e nha nc e r e c om bi na nt a de no a s s oc i a t e d vi r us m e di a t e d ge ne e xpr e s s i on t hr ough i nt e r m ol e c ul a r c i s a c t i va t i on. N a t M e d 6 595 8 ( 2 000) 132. Y a n, Z Z ha ng, Y D ua n D & E nge l ha r dt J T r a ns s pl i c i ng ve c t or s e xpa nd t he ut i l i t y of a de no a s s oc i a t e d vi r us f o r ge ne t he r a py. P r oc N a t l A c a d S c i U S A 97 6716 21 ( 2000 ) 133. M a h, C S a r ka r R Z ol ot ukhi n I S c hl e i s s i ng, M X i a o, X K a z a z i a n, H H & B yr ne B J D ua l ve c t or s e xp r e s s i ng m ur i ne f a c t o r V I I I r e s ul t i n s us t a i ne d c or r e c t i on of he m ophi l i a A m i c e H um G e ne T h e r 14, 143 52 ( 2003 ) 134. N a ka i H S t or m T & K a y, M R e c r ui t m e nt of s i ng l e s t r a nde d r e c om bi na nt a de no a s s oc i a t e d vi r us ve c t or ge nom e s a nd i nt e r m ol e c ul a r r e c om bi na t i on a r e r e s pons i bl e f or s t a bl e t r a ns duc t i on o f l i ve r i n vi vo. J V i r ol 74 9451 63 ( 2000 ) 135. K i ngs m a n, S M M i t r opha nous K & O l s e n, J C P ot e nt i a l onc oge ne a c t i vi t y of t he w oodc huc k he pa t i t i s pos t t r a ns c r i pt i ona l r e gul a t or y e l e m e nt ( W P R E ) G e ne T he r ( 2004) 136. D ons a nt e A V ogl e r C M uz yc z ka N C r a w f or d J M B a r ke r J F l ot t e T C a m pbe l l T hom ps on, M D a l y, T & S a nds M S O bs e r ve d i nc i de nc e of t um or i ge ne s i s i n l ong t e r m r ode nt s t udi e s of r A A V ve c t or s G e ne T he r 8 1343 6 ( 2001) 137. M i a o, C N a ka i H T hom ps on, A S t or m T C hi u, W S nyde r R & K a y, M N onr a ndom t r a ns duc t i on of r e c om bi na nt a de no a s s oc i a t e d vi r us ve c t or s i n m ous e he pa t oc yt e s i n vi vo: c e l l c yc l i ng doe s not i n f l ue nc e he pa t oc yt e t r a ns duc t i on. J V i r ol 74, 3793 803 ( 2000 ) 138. K uw a ba r a T W a r a s hi na M K os e ki S S a no, M O hka w a J N a ka ya m a K & T a i r a K S i gni f i c a nt l y hi ghe r a c t i vi t y of a c yt opl a s m i c ha m m e r he a d r i boz ym e t ha n a c or r e s pondi ng nuc l e a r c ount e r pa r t : e ngi ne e r e d t R N A s w i t h a n e xt e nde d 3' e nd c a n be e xpor t e d e f f i c i e nt l y a nd s pe c i f i c a l l y t o t he c yt opl a s m i n m a m m a l i a n c e l l s N uc l e i c A c i ds R e s 29, 2780 8 ( 2001) 139. K uw a ba r a T W a r a s hi na M N a ka ya m a A O hka w a J & T a i r a K t R N A V a l he t e r odi m e r i c m a xi z ym e s w i t h hi gh pot e nt i a l a s ge ne i na c t i va t i ng a ge nt s : s i m ul t a ne ous c l e a va ge a t t w o s i t e s i n H I V 1 T a t m R N A i n c ul t ur e d c e l l s P r oc N a t l A c a d S c i U S A 96, 1886 91 ( 1999)

PAGE 176

163 140. W a r a s hi na M K uw a ba r a T K a t o, Y S a no, M & T a i r a K R N A p r ot e i n hyb r i d r i boz ym e s t ha t e f f i c i e nt l y c l e a ve a ny m R N A i nde p e nde nt l y of t he s t r uc t ur e o f t he t a r ge t R N A P r oc N a t l A c a d S c i U S A 98, 5572 7 ( 2001) 141. K a t o, Y K uw a ba r a T W a r a s hi na M T oda H & T a i r a K R e l a t i ons hi ps be t w e e n t he a c t i vi t i e s i n vi t r o a nd i n vi vo of va r i ous ki nds o f r i boz ym e a nd t he i r i nt r a c e l l ul a r l oc a l i z a t i on i n m a m m a l i a n c e l l s J B i o l C he m 276, 15378 85 ( 2001) 142. K uw a ba r a T W a r a s hi na M S a no, M T a ng, H W ong S t a a l F M une ka t a E & T a i r a K R e c ogni t i on of e ngi ne e r e d t R N A s w i t h a n e xt e nde d 3' e nd by E xpo r t i n t ( X po t ) a nd t r a ns por t of t R N A a t t a c he d r i boz ym e s t o t he c yt opl a s m i n s om a t i c c e l l s B i om a c r om ol e c ul e s 2, 1229 42 ( 2001 ) 143. K a w a s a ki H & T a i r a K I de nt i f i c a t i on of ge ne s b y hybr i d r i boz ym e s t ha t c oupl e c l e a va ge a c t i vi t y w i t h t he unw i ndi ng a c t i vi t y of a n e ndoge nous R N A he l i c a s e E M B O R e p 3, 443 50 ( 2002 ) 144. B yun, J L a n, N L ong, M & S ul l e nge r B A E f f i c i e nt a nd s pe c i f i c r e pa i r of s i c kl e be t a gl obi n R N A by t r a ns s pl i c i ng r i boz ym e s R na 9, 1254 63 ( 2003) 145. S hi n, K S S ul l e nge r B A & L e e S W R i boz ym e M e di a t e d I nduc t i on of A popt os i s i n H um a n C a nc e r C e l l s by T a r ge t e d R e pa i r of M ut a nt p53 R N A M ol e c ul a r T he r a py 10 365 ( 2004) 146. C a s t a not t o, D L i H & R os s i J J F unc t i ona l s i R N A e xpr e s s i on f r om t r a ns f e c t e d P C R pr oduc t s R na 8, 1454 60 ( 2002) 147. B ode n, D P us c h, O L e e F T uc ke r L S ha nk P R & R a m r a t na m B P r om ot e r c hoi c e a f f e c t s t he pot e nc y of H I V 1 s pe c i f i c R N A i nt e r f e r e nc e N uc l e i c A c i ds R e s 31, 5033 8 ( 2003) 148. K a w a s a ki H & T a i r a K S hor t ha i r pi n t ype of ds R N A s t ha t a r e c ont r ol l e d by t R N A ( V a l ) pr om ot e r s i gni f i c a nt l y i nduc e R N A i m e di a t e d ge ne s i l e nc i ng i n t he c yt opl a s m of hum a n c e l l s N uc l e i c A c i ds R e s 31, 7 00 7 ( 2003 ) 149. L e dl e y, F D G r e ne t t H E M c G i nni s S he l nut t M & W oo, S L C R e t r ovi r a l M e di a t e d G e ne T r a ns f e r of H um a n P he nyl a l a ni ne H ydr oxyl a s e i nt o N I H 3 T 3 a nd H e pa t om a C e l l s P N A S 83 409 413 ( 1986 ) 150. S a r ka r R T e t r e a ul t R G a o G W a ng, L B e l l P C ha ndl e r R W i l s on J & K a z a z i a n, H J T ot a l c or r e c t i on o f he m ophi l i a A m i c e w i t h c a ni ne F V I I I us i ng a n A A V 8 s e r ot ype B l ood 103, 1253 60 ( 2004) 151. N a t hw a ni A C D a vi dof f A M & L i nc h, D C A r e v i e w of ge ne t he r a py f o r ha e m a t ol ogi c a l di s or de r s B r J H a e m a t ol 128, 3 17 ( 2005)

PAGE 177

164 152 S m i c un, Y K i l pa t r i c k, M W F l o r e r J T oudj a r s ka I W u, G W e ns t r up, R J & T s i pour a s P E nha nc e d i nt r a c e l l ul a r a va i l a bi l i t y a n d s ur vi va l of ha m m e r he a d r i boz ym e s i nc r e a s e s t a r ge t a bl a t i on i n a c e l l ul a r m ode l of os t e oge ne s i s i m pe r f e c t a G e ne T he r 10 2005 12 ( 2003 ) 153. B a i J R os s i J & A kki na R M ul t i va l e nt a nt i C C R r i boz ym e s f or s t e m c e l l ba s e d H I V t ype 1 ge ne t he r a py. A I D S R e s H um R e t r ovi r us e s 17, 385 99 ( 2001) 154. C ol e W G A dva nc e s i n os t e oge ne s i s i m pe r f e c t a C l i n O r t hop R e l a t R e s 6 16 ( 2002)

PAGE 178

165 B I O G R A P H I C A L S K E T C H C a t he r i ne E l i s a be t h C ha r r on w a s bor n A pr i l 30, 19 79, i n M ont r e a l C a na da E duc a t e d i n F r e nc h s c hool s dur i ng he r yout h s he a t t e nde d a f i ve m on t h E ng l i s h c our s e i n f i f t h g r a de w he r e s he w a s i m m e r s e d i n t he l a ngua g e f or t he f i r s t t i m e S he c ont i nue d he r E ngl i s h e duc a t i on t hr ough a dva nc e d c l a s s e s dur i ng 6 t h 7 t h a nd 8 t h gr a de A t t he a ge of f our t e e n, s he a nd he r f a m i l y m ove d t o F or t L a ude r da l e F l or i da w he r e s he a t t e nde d C a r di na l G i bbons H i gh S c hool W hi l e t hi s w a s he r f i r s t e xpe r i e nc e i n a n a l l E ngl i s h s c hool s he gr a dua t e d t hi r d i n he r c l a s s i n 1997 S h e e nt e r e d t he U ni ve r s i t y of F l or i da i n t he f a l l o f 1997 a nd obt a i ne d a B a c he l or of S c i e nc e de gr e e i n c he m i s t r y i n D e c e m be r 2000. D ur i ng t ha t t i m e s he j oi ne d t he l a bor a t or y of D r J on S t e w a r t i n t he C he m i s t r y D e pa r t m e nt a nd w a s a r e c i pi e nt of t he U ni ve r s i t y o f F l or i da S c hol a r s p r ogr a m a w a r d I n t he f a l l o f 2001 s he be ga n he r doc t or a l e duc a t i on a t t he U ni ve r s i t y o f F l o r i da C ol l e ge of M e di c i ne I nt e r di s c i pl i na r y P r og r a m i n B i om e di c a l S c i e nc e s S he j oi ne d t he l a bor a t or y of D r P h i l i p L a i pi s i n 2002 a nd be ga n t o w or k on de ve l opi ng ge ne t he r a py a ppr oa c he s f o r t he t r e a t m e nt of phe nyl ke t onur i a A f t e r obt a i ni ng h e r doc t or a l de g r e e i n ge ne t i c s C a t he r i ne pl a ns t o pur s ue a c a r e e r i n a c a de m i c r e s e a r c h i n t he f i e l d o f ge ne t he r a py f or i nhe r i t e d ge ne t i c di s e a s e s