Citation
Evolutionary Patterns in the Dilatata Group (Paspalum, POACEAE): A Polyploid/Agamic Complex

Material Information

Title:
Evolutionary Patterns in the Dilatata Group (Paspalum, POACEAE): A Polyploid/Agamic Complex
Creator:
SPERANZA, PABLO R. ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Alleles ( jstor )
Chloroplasts ( jstor )
Genetic loci ( jstor )
Genomes ( jstor )
Genomics ( jstor )
Genotypes ( jstor )
Microsatellites ( jstor )
Population genetics ( jstor )
Species ( jstor )
Tetraploidy ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Pablo R. Speranza. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
7/30/2007
Resource Identifier:
71638317 ( OCLC )

Downloads

This item has the following downloads:

speranza_p ( .pdf )

speranza_p_Page_054.txt

speranza_p_Page_045.txt

speranza_p_Page_043.txt

speranza_p_Page_014.txt

speranza_p_Page_037.txt

speranza_p_Page_041.txt

speranza_p_Page_083.txt

speranza_p_Page_012.txt

speranza_p_Page_118.txt

speranza_p_Page_033.txt

speranza_p_Page_081.txt

speranza_p_Page_078.txt

speranza_p_Page_025.txt

speranza_p_Page_051.txt

speranza_p_Page_116.txt

speranza_p_Page_074.txt

speranza_p_Page_027.txt

speranza_p_Page_001.txt

speranza_p_pdf.txt

speranza_p_Page_057.txt

speranza_p_Page_003.txt

speranza_p_Page_111.txt

speranza_p_Page_061.txt

speranza_p_Page_060.txt

speranza_p_Page_102.txt

speranza_p_Page_064.txt

speranza_p_Page_026.txt

speranza_p_Page_107.txt

speranza_p_Page_063.txt

speranza_p_Page_065.txt

speranza_p_Page_038.txt

speranza_p_Page_087.txt

speranza_p_Page_098.txt

speranza_p_Page_085.txt

speranza_p_Page_056.txt

speranza_p_Page_119.txt

speranza_p_Page_021.txt

speranza_p_Page_106.txt

speranza_p_Page_115.txt

speranza_p_Page_091.txt

speranza_p_Page_113.txt

speranza_p_Page_055.txt

speranza_p_Page_097.txt

speranza_p_Page_020.txt

speranza_p_Page_009.txt

speranza_p_Page_103.txt

speranza_p_Page_086.txt

speranza_p_Page_096.txt

speranza_p_Page_099.txt

speranza_p_Page_095.txt

speranza_p_Page_110.txt

speranza_p_Page_112.txt

speranza_p_Page_036.txt

speranza_p_Page_039.txt

speranza_p_Page_024.txt

speranza_p_Page_035.txt

speranza_p_Page_101.txt

speranza_p_Page_059.txt

speranza_p_Page_089.txt

speranza_p_Page_104.txt

speranza_p_Page_109.txt

speranza_p_Page_016.txt

speranza_p_Page_046.txt

speranza_p_Page_114.txt

speranza_p_Page_058.txt

speranza_p_Page_019.txt

speranza_p_Page_049.txt

speranza_p_Page_092.txt

speranza_p_Page_010.txt

speranza_p_Page_070.txt

speranza_p_Page_082.txt

speranza_p_Page_100.txt

speranza_p_Page_079.txt

speranza_p_Page_006.txt

speranza_p_Page_040.txt

speranza_p_Page_094.txt

speranza_p_Page_075.txt

speranza_p_Page_042.txt

speranza_p_Page_105.txt

speranza_p_Page_077.txt

speranza_p_Page_011.txt

speranza_p_Page_044.txt

speranza_p_Page_093.txt

speranza_p_Page_071.txt

speranza_p_Page_050.txt

speranza_p_Page_084.txt

speranza_p_Page_117.txt

speranza_p_Page_029.txt

speranza_p_Page_068.txt

speranza_p_Page_022.txt

speranza_p_Page_052.txt

speranza_p_Page_007.txt

speranza_p_Page_067.txt

speranza_p_Page_017.txt

speranza_p_Page_018.txt

speranza_p_Page_028.txt

speranza_p_Page_062.txt

speranza_p_Page_090.txt

speranza_p_Page_080.txt

speranza_p_Page_108.txt

speranza_p_Page_013.txt

speranza_p_Page_066.txt

speranza_p_Page_076.txt

speranza_p_Page_031.txt

speranza_p_Page_072.txt

speranza_p_Page_032.txt

speranza_p_Page_030.txt

speranza_p_Page_023.txt

speranza_p_Page_048.txt

speranza_p_Page_034.txt

speranza_p_Page_047.txt

speranza_p_Page_008.txt

speranza_p_Page_004.txt

speranza_p_Page_073.txt

speranza_p_Page_088.txt

speranza_p_Page_005.txt

speranza_p_Page_053.txt

speranza_p_Page_069.txt

speranza_p_Page_002.txt

speranza_p_Page_015.txt


Full Text












EVOLUTIONARY PATTERNS IN THE DILATATA GROUP
(Paspalum, POACEAE): A POLYPLOID/AGAMIC COMPLEX















By

PABLO R. SPERANZA


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005

































Copyright 2005

by

Pablo R. Speranza


































This dissertation is dedicated to my son Mauricio who never forgot to give me a hug
when I left home for work at night.















ACKNOWLEDGMENTS

I want to thank my advisor, Pamela Soltis, for having always been available and

willing to help and provide support during my whole program. I also wish to thank my

committee members (Pamela Soltis, Douglas Soltis, Kenneth Quesenberry, and Gloria

Moore) for having made of each meeting a constructive and worthy experience, each

providing a different point of view on my work. I am indebted to Enrique Estramil and

Marcos Malosetti for their help with data analysis, and to my laboratory mates,

particularly Joshua Clayton, Vaughan Symonds, and Jennifer Tate for their invaluable

help in writing this dissertation. I also want to thank Gabriel Rua, Rodrigo Vergara,

Jennifer Tate, Michelle McMahon, and Kevin Smith for providing fundamental plant

material for this study.

I wish to thank my colleagues of the Universidad de la Republica, Uruguay,

particularly Magdalena Vaio, Cristina Mazzella, and Ivan Grela for facilitating plant

material and staying constantly in contact with me. This work would not have been

possible without the training and inspiration that I received from Juan Carlos Millot

during my undergraduate education.

Finally, this dissertation was possible due to the support I received from my wife,

Alicia Lusiardo.

This work was supported in part by a credit-scholarship from the Programa de

Desarrollo Tecnol6gico, Ministerio de Educaci6n y Cultura, Uruguay.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TA BLE S ......... ................... ... .......................... viii

LIST OF FIGURES ......... ......................... ...... ........ ............ ix

ABSTRACT ........ .............. ............. ...... ...................... xi

CHAPTER

1 AN INTRODUCTION TO THE STUDY OF THE DILATATA GROUP OF
P a sp a lu m ............................................................ ................ 1

A Historical Perspective ................. ... ...... ......... ................
The Contributions of This Dissertation ............................................. ............... 7
Chapter 2: The Technique .............................................................................. 7
Chapter 3: The Germ plasm ............................................................................8
Chapter 4: The Complex ....................................................... 8
Chapter 5: The All-Important Pentaploid(s)........................................................9

2 NUCLEAR AND CYTOPLASMIC MICROSATELLITE MARKERS FOR THE
SPECIES OF THE DILATATA GROUP OF Paspalum (POACEAE).....................10

In tro d u ctio n ............................................. ........................ ................ 1 0
M materials and M methods ....................................................................... .................. 13
M icrosatellite C apture ......................................... ........ .... ........ .. ........ .... 13
Chloroplast M arkers .................. ...................... .... .. .. .. ................. 14
P lan t M material ...............................................................15
A m plification and Scoring ............................................................................ 17
R results .................. ..... ....... ................................ ......18
Capture and A m plification Success.......................................... ..................... 18
V ariab ility ...................................................................................... ............. 2 4
C hloroplast V ariability ............................................... ............................. 25
D isc u ssio n ............................................................................................................. 2 6
Capture Efficiency ............................................... .. .. .... ................. 26
Amplification Profile............... ............................. ............... ............... 26
N on-F local L oci .................................................................................. 27
N u clear L oci .......................................................................2 8









C hloroplast M icrosatellites............................................................. .... ........... 30
C o n c lu sio n s........................................................................................................... 3 0

3 BREEDING SYSTEM AND POPULATION GENETIC STRUCTURE OF
Paspalum dilatatum ssp.flavescens (POACEAE). .................................................32

In tro d u ctio n ........................................................................................................... 3 2
M materials and M methods. ..................................................................... ...................34
C collection Strategy ......................................... ................. ........ 34
M icrosatellite A m plification ........................................ .......................... 35
D ata A n a ly sis ................................................................................................. 3 6
R e su lts ................................................................................................................... 3 7
D iscu ssion .............................................................................................................. 43
M eating System ............................. .... .......................... ........ 43
Genetic Differentiation and Geographical Structure ................... ....... 44

4 EVOLUTIONARY RELATIONSHIPS AND MECHANISMS IN THE
DILATATA GROUP (Paspalum, POACEAE) ........................................ ...49

In tro d u ctio n ........................................................................................................... 4 9
M materials an d M eth od s ......................................................................................... 53
P lant M material ................................................................................................ 53
DNA Extraction and Microsatellite Analysis.............................................54
D ata A n aly sis................................................ ....................... .... 5 5
R esu lts ................................................. ..................... ......56
V ariability in the Tetraploids............................................ 56
V ariability in the A pom icts ....................................................... 60
Relationships among Apomicts .................................................................... 61
H eterozygosity of the A pom icts .................................................................. 63
D iscu ssion .................. .. ................... ....... ....................... ......64
Evolutionary relationships among the sexual tetraploid biotypes .....................64
G genetic structure of the sexual tetraploids .............. .......................... .............. 66
V ariability w within the apom icts ........................................... ...................... 67
The addition of the X genome, apomixis, and the origin of pentaploid P.
dilatatum ............................... ................................................ 67
Paspalum dilatatum Uruguaiana and 59B................... ............ ............ 68
Paspalum dilatatum clone 2........................................ ..... ............... 70
Paspalum dilatatum Chiru ................................................70
P aspalum pauciciliatum ................................................... ............................ 71
Paspalum dilatatum Torres ................ .................. ...... ...............72
C on clu sion s......................................................................................... .72

5 PENTAPLOID X TETRAPLOID HYBRIDIZATION CYCLES IN Paspalum
dilatatum (POACEAE): EXPLAINING THE CURRENT AND FUTURE
EVOLUTIONARY SUCCESS OF AN IMBALANCED POLYPLOID ...................74

In tro d u ctio n ............................ ....................................... ................ 7 4









M materials and M methods ....................................................................... ..................76
P lant M material .......................... ..................................................7 6
DNA Extraction and Microsatellite Analysis..............................................77
D ata A n a ly sis ................................................................................................. 8 0
R e su lts ......................................................................................................................... 8 1
D isc u ssio n ............................................................................................................. 8 7
The "Typical" Clone.................. .............. ......... 87
Distribution of Clonal Diversity in the Native Range ................... ...................89
Hybridization and its Genetic Consequences...................................................90
T h e M ech anism .............................. .......................... .... ........ .... ..... ...... 9 1
H ow M any T im es? ............................ ........................ ......... ........... 92

6 CONCLUDING REMARKS ....................................................................... 94

REFERENCES ................... ......... .. ...... ... ..................97

B IO G R A PH ICA L SK ETCH ......... ................. ...................................... .....................106
















LIST OF TABLES


Table pge

1-1 Paspalum species known to share genomes with P. dilatatum Poir ........................

2-1 Accession numbers and collection locations of the plant material used to test
microsatellite transferability among biotypes .................................. ............... 16

2-2 Primer sequences and structure for all the microsatellite loci reported in this
stu d y ............................................................................. 1 9

2-3 Estimated recombination frequency between pairs of loci amplified by the same
primer combination and LOD score for the test of independent segregation
b etw een th em ........... .......... ................ ................. ................................ 2 3

2-4 Test of the segregation ratios per microsatellite locus. ............................................23

3-1 Genetic diversity and heterozygosity for individual populations ofP. dilatatum
ssp.flavescens for 6 microsatellite loci. ................................................ ......... 38

3-2 AMOVA of a six-microsatellite-locus data matrix for 21 populations of P.
dilatatum ssp. flavescens. .................................. ........................................40

4-1 Genomic formulae and reproductive systems of the members of the Dilatata
group ....................... .................................... ........... ...... .. 50

4-2 Accession numbers of the materials retrieved from germplasm banks used to
analyze the relationships among the different biotypes .......................................55

4-3 Summary of the microsatellite data for the sexual tetraploid biotypes of
Paspalum group Dilatata and genotypes for the apomictic biotypes.....................58

5-1 Accession numbers, genotypes, and population of origin of the pentaploid P.
dilatatum material retrieved from germplasm banks. ............................................78

5-2 Allele frequency distributions in the tetraploid biotypes of P. dilatatum used to
estimate possible contributions to the recombinant pentaploid clones ..................79

5-3 Proportion of shared allele distances (Dps) of the recombinant pentaploids of P.
dilatatum to the tetraploid biotypes of the Dilatata group. ................ ..............85















LIST OF FIGURES


Figure page

1-1 Strict consensus of 15264 most parsimonious trees based on four cpDNA non-
coding squ en ces.............................................................................. ............... .. 4

2-1 A graphical representation of all the microsatellite alleles amplified for a sample
of each biotype. .......................................................................20

2-2 Alignment of nucleotide sequences of representative alleles for the non-focal
loci compared to the originally cloned sequences........................................21

3-1 A spikelet of P. dilatatum ssp.flavescens and P. dilatatum ssp. dilatatum ...........34

3-2 Allele size distribution for six microsatellite loci in P. dilatatum ssp.flavescens...37

3-3 Genetic distances among 21 populations of P. dilatatum ssp.flavescens and their
g geographical distribution ............................................................... .....................4 1

3-4 Genetic distances among individual genotypes of P. dilatatum ssp.flavescens
and their geographical distribution............. ................... ......... ..................... 42

4-1 Geographical distribution of the accessions ....... ..................................... ....54

4-2 Population structure of a sample of the members of the Dilatata group estimated
by Structure under the admixture model based on microsatellite data for 13 loci ...59

4-3 UPGMA phenograms of the distances among the sexual tetraploid biotypes of
the Dilatata group based on 13 microsatellite loci obtained with different
distance m measures ........................................... .......... .......... ........ .... 60

4-4 Multilocus genotypes of the apomictic components of the Dilatata group..............62

5-1 Number of microsatellite allele differences between all genotypes of pentaploid
P. dilatatum and the nearest of the two most widespread genotypes (A and P). .....82

5-2 Genotypic relationships and geographical distribution of the clonal variants of
pentaploid P. dilatatum ................................. .........................................84









5-3 Estimated tetraploid biotype contributions to the pentaploid recombinant P.
dilatatum genotypes ........................................ .. ... .. ...... 85

5-4 Multilocus microsatellite genotypes for the recombinant genotypes of pentaploid
P dilatatum .. ...................................................................... .... 86















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

EVOLUTIONARY PATTERNS IN THE DILATATA GROUP
(Paspalum, POACEAE): A POLYPLOID/AGAMIC COMPLEX


By

Pablo R. Speranza

August 2005

Chair: Pamela S. Soltis
Major Department: Botany

Paspalum dilatatum Poir. and its related species are warm-season grasses native to

temperate South America. The members of the Dilatata group include polyploid sexual

and apomictic components, some of which have reached worldwide distributions. The

common biotype of P. dilatatum is a complex apomictic pentaploid hybrid, and efforts to

identify its putative ancestors have led to the accumulation of a significant amount of

cytogenetic information about the relationships among biotypes within the Dilatata

group. In general, past work in this complex has suffered from the lack of representative

collections, and the low power of the techniques. In this study, I developed microsatellite

markers, analyzed their transferability within the Dilatata group, and applied them to

representative samples to analyze the evolutionary relationships within the group at

different levels. The markers developed here show great power to detect recent

hybridization and analyze genetic structure. The genetic structure of the sexual biotypes

was described for a collection of P. dilatatum ssp.flavescens. This biotype is highly









autogamous, and its genetic variability does not show significant geographical structure

probably due to continuous disturbance of the roadside environment it inhabits. The

relationships among the sexual and the apomictic components are analyzed, and the

origin of the apomictic biotypes is discussed. Genetic recombination was not detected in

the apomictic hexaploids and tetraploids. Among the pentaploids, a single clone and its

somatic variants were found on all the continents and in almost all the collection sites in

its native area. All the other apomicts in the group, including the recombinant pentaploids

are hypothesized to be derived from the pentaploid form. The probable mechanisms

involve either the production of unreduced female gametes or eu-triploid pollen grains by

the pentaploids. This is probably the most extensive study ever attempted in this group,

and it will undoubtedly change the direction of all future research in these species. The

new recombinant forms will have to be analyzed and their productive potential assessed,

while existing collections should be re-structured to reflect the unexpected distribution of

the genetic variability they contain.














CHAPTER 1
AN INTRODUCTION TO THE STUDY OF THE DILATATA GROUP OF Paspalum

A Historical Perspective

The genus Paspalum contains ca. 350 species, most of them native to the tropical

and warm temperate New World (Chase 1929). Chase (1929) recognized about 20

informal taxomomic groups within the genus based on vegetative and reproductive

morphological characters, a classification that is still widely used.

The Dilatata group of Paspalum contains several species with great forage

potential, and several of them have been used as forage crops (Skerman and Riveros

1992). Paspalum dilatatum Poir. and its related species are warm-season grasses native to

the grasslands of temperate South America. Some members of the group, particularly P.

dilatatum ssp. dilatatum and P. urvillei Steud., have reached worldwide distributions

wherever a warm temperate climate combined with sufficient rainfall exists.

The members of the Dilatata group have been classified into several formal and

informal taxonomic categories which will be referred to as biotypes in this dissertation.

The common biotype of P. dilatatum (P. dilatatum ssp. dilatatum) is a complex

apomictic pentaploid hybrid, and efforts to identify its putative ancestors have led, over

several decades, to the accumulation of a significant body of cytogenetic information

about the relationships among all the species and biotypes within the Dilatata group and

between this group and the related Virgata group (Table 1-1). The fist comprehensive

treatment of the Dilatata species was done by Moraes Fernandes et al. (1968) based

solely on the meiotic behavior of the biotypes. Burson (1983) summarized the results of











the advancements achieved during the 1970s by several interspecific hybridizations and


assigned the genomes in the group to putative diploid donors. Several new tetraploid


members of the group have been identified since then, but no significant advances have


been made about the relationships among them and the apomictic components.


Table 1-1. Paspalum species known to share genomes with P. dilatatum Poir
Species or biotype 2n Genomic Formula Authority
Paniculata Group
P. panmculatum 20 JJ Burson (1979)
P. jurgensu 20 JJ Burson (1978)
Dilatata Group
P. dilatatum ssp. dilatatum 50 IIJJX Burson (1983)
P. dilatatum ssp. flavescens 40 IIJJ Burson et al. (1973)
P. dasypleurum 40 IIJJ Quarin and Capponio (1995)
P. urvillet 40 IIJJ Burson (1979)
P. dilatatum Virasoro 40 IIJJ Caponio and Quarin (1990)
P. dilatatum Vacaria 40 IIJJ Quarin unpub. res.
P. dilatatum "Chiri" 60 IIJJXX Burson (1991)a
P. dilatatum Uruguaiana 60 IIJJX1X2 Burson (1995)
Virgata Group
P. conspersum 40 1212JJ Burson (1978)
P. virgatum 40 IIJ2J2 Burson and Quarin (1982)
P. rufum 20 II Quarin and Norrmann (1990)
Quadrifaria Group
P. haumann 20 II Quarin and Norrmann (1990)
P. brunneum 20 II Quarin and Norrmann (1990)
P. quadrifarum 20 II Quarin and Norrmann (1990)
P. intermedium 20 II Burson (1978)
P. densum 20 II Caponio and Quarin (1993)
P. durifolum 60 IIJ2J2X*X* Burson (1985)
unknown genome not related to other X genomes


Several possible donors have been suggested for the I genome of the Dilatata


group, most of which constitute species commonly included in the Quadrifaria group as

defined by Barreto (1966). This group has been seen as including several species


typically based on self-incompatible sexual diploids and their apomictic autopolyploid


cytotypes. Recently, an analysis of the relationships among the proposed sources of the I


genome was prepared in collaboration with M. Vaio. This study addresses the


relationships among the several proposed donors of the I genome to the Dilatata group


using two main approaches: the distribution of rDNA sites in the genomes and


phylogenetic analysis of the chloroplast sequences.









Our results suggest that the relationships among the species of the group are

complex, with several polyploids of interspecific origin. Remarkably, the pairing ability

of the chromosomes among the I genome species (Quarin and Norrmann, 1990) bears a

correlation with the phylogenetic distances among them inferred from chloroplast

sequences.

The analysis published in Vaio et al. (2005) is part of a phylogenetic analysis of the

genus as a whole that has been undertaken by G. H. Rua and myself to provide a

framework in which the origin of polyploid species complexes of Paspalum can be

analyzed. This study is not yet completed as we still lack cytogenetic information on

most of the samples included in the study. A summary of the current progress of this

phylogenetic effort is shown in Fig. 1-1, and an outline of the methodology is provided in

Fig. 1-2. Concerning the origin of the Dilatata group, the relationships obtained so far

suggest that the definitive identification of the genomic sources for the group is far from

being achieved: the currently proposed sources of I genomes form a paraphyletic

assemblage within which the proposed J genome donor (P. juergensiilP. paniculatum) is

also found. Moreover, P. rufum, whose chromosomes also show a moderate degree of

pairing to the I genome, is located in a different clade which includes, among others,

most members of the Notata and Plicatula groups. If these relationships are confirmed in

the future, the J genome would represent a derived genome nested in a group in which the

plesiomorphic condition is the ability to pair with the I genome. The current

identifications of the I and J genomes are the result of the knowledge that was available

to the researchers when findings were made. Without a general understanding of the




















P malacophyllum
Pusten
P simplex
94 P95 ---- bicdum
SPf-lct-m P polyphyllum
P falcaum
P humboldtanum
P pauclfolum
65 82 P commune
P ruergens( (JJ) Paniculata
P parculatum (JJ) Paniculata
-61 P quarnn (II) Quadrifara
Dilatata group (IIJJ)
P remotum
P quadrnfanum (II) Quadrifaria
65 conspersm (IIJJ) Vlrgata
9 P mtermedum (II) Quadrifana
SP aundmnellum
S 89 P denticulatum
Sl-- P lIvdum
99 89 P virgatum (IIJJ) Virgata
93 P exaltatum (II) Quadnfana
P haumanr (II) Quadrfana
-- P ovale
P fascculatum
SP indecorum
P amndmaceum
P chacoense
P tnrchostomum
P durlfoum


3 P cromyorrhizon
57 P onanthum
P stellatum
P equitans
62 P lepton
8 P lhmbatum
P compressifohum
53 Pmodestum
0 P pa hstre
P wnghtn
a P alcahmn m
97 P rum (II) Vlrgata
99 I P bertonn
P 11ilo,
P chasea-m
P guenoarum
P coryphaeum
P scrobiculatum
P atratum
P ellpticum
P erranthum
P hneare


P maculosum


-- P mtinus
P notatum
P plcatulum
P acummnatum
53 -------- P glabrinode
96 P distchum
P vagmatum
100 P mconstans
P mandiocanum
P almum
P ceresia
P piosum
P setaceum
Thrasyapetrosa
P unmspicatum
P conjugatum
P b57 P repens
P orbiculatum


P racemosum


-Axonopusfurcatum
IoAxonopus rosengurtin


Fig. 1-1. Strict consensus of 15264 most parsimonious trees based on four cpDNA non-

coding sequences (see Box 1). Numbers above branches represent boostrap

support values, and numbers below the branches represent percent posterior

probabilities for the same branches in a Bayesian (see Box 1) tree of similar

topology when they were not 100%.


57


93




100




99


_______ Anthaenantiopsis rojasiana
P maequivalve


5 changes












The phylogeny shown in Fig. 1-1 represents the current status of an ongoing project
aimed at establishing a framework for the study of the relationships among species
and polyploid complexes within the genus Paspalum. This project is being carried out
in collaboration with G. H. Rua. The genus itself has not been analyzed using
molecular tools, but some partial analyses show that the genus is not monophyletic if
the species of Thrasya are excluded, and its nearest relatives are A4iih, lcini,1 \i\,
Thrasyopsis, and some species currently assigned to Panicum (G6mez-Martinez and
Culham 2000, Giussani et al. 2001, Duvall et al. 2001, Aliscioni et al. 2003).
The inclusion of multiple polyploids and hybrids in a phylogenetic analysis would
confound the phylogenetic signal if we analyzed nuclear markers (including
morphology). As a consequence we were faced with the practical impossibility of
assembling a collection of only diploids or performing broad scale nuclear sequence
isolation and cloning of a big portion of the genus, while the ploidy levels of most of
our materials would be unknown. We decided to use a mostly living collection at the
Universidad de Buenos Aires, for which cytogenetic information could be obtained
and voucher specimens had been deposited. We undertook the phylogenetic effort
using chloroplast sequences. With this kind of marker, a congruent set of sequences
could be obtained, and our phylogenetic tree would represent the organismal history
of our diploid samples and the maternal progenitors of our polyploids. This approach
would circumvent the risk of insufficient taxon sampling by filling the gaps created by
unrepresented diploids with the chloroplast sequences of their derived polyploids.
Valuable information can also be obtained on the maternal origins of the polyploids.
Four non-coding chloroplast regions were amplified: the trnL(UAA) intron, the atpf,-
rbcL spacer, the trnG(UCC) intron and the trnL(UAA)-trnF(GAA) spacer (technical
details on amplification and sequencing are given in Vaio et al. 2005). A single
matrix was made of all the alignments for 72 species of Paspalum, one species of both
Thrasya and Aii/ihi,,iin,,ipi, and two species of Axonopus as outgroups. The
matrix was analyzed with parsimony using PAUP* (fully heuristic search with 20000
SAR) and Bayesian approaches using MrBayes (a model was selected with Modeltest
and the MCMC was run for 2,000,000 generations on MrBayes). The trees obtained
with both approaches, were fully congruent, and the tree obtained with MrBayes was
nearly identical to the majority-rule consensus obtained with parsimony. A slightly
more conservative parsimony strict consensus is shown in Fig. 1-1 which does not
show nine nodes that appeared in the Bayesian tree with posterior probabilities mostly
below 0.70.


Fig 1-2. Main conclusions of a preliminary phylogeny of the genus Paspalum












In spite of the data being preliminary, a few well-supported hypotheses can be derived
from this tree concerning the placement and origin of the Dilatata group:

1. Paspalum is not monophyletic unless Thrasya is included in it and a)
Aiiihie iiuiniip \i\ is included or b) P. inaequivalve is excluded.

2. Paspalum racemosum, P. orbiculatum, P. repens, and P. conjugatum form a
basal grade to an otherwise poorly supported clade containing the rest of the
species of Paspalum and Thrasya.

3. Two major clades with high posterior probabilities but no parsimony bootstrap
support include most of the species analyzed.

4. The species of the Dilatata, Virgata, Paniculata, and Quadrifaria groups are
included in the same clade but in different subclades. The species of the
Quadrifaria group are found in both subclades.

5. The second major clade includes species of the Plicatula, Notata and Bertoniana
groups among others. This clade shows very little internal resolution. P. rufum
is included in this clade.

6. The chloroplast genome of the Dilatata group is included in a clade that includes
species that have been assigned both the I and J genomes.

7. The chloroplast genomes of the Virgata group are scattered within the clade that
contains most of the Quadrifaria species.






Fig. 1-2 (continued)


relationships among the main clades within the genus, the quest for the direct genome

donors of the polyploid groups (including the Dilatata group) is deemed to continue at


random, with occasional successes and many false positives.









The Contributions of This Dissertation

In general, past work in this complex has suffered from two main limitations: the

lack of representative collections, and the low power of the techniques. An effort was

made in this case to represent with more than one individual each component of the

complex. The main source of materials was a collection deposited by myself between

1992 and 1999 in the Germplasm Bank at the Facultad de Agronomia, Montevideo,

Uruguay, which was complemented with the USDA collection.

The main body of this dissertation is divided into four chapters dealing with

different levels of analysis of the Dilatata complex.

Chapter 2: The Technique

Two recent works (Speranza et al. 2003, Vaio et al. 2005) represent the first

examples of the use of cytogenetic information in this group beyond the sheer number of

chromosomes or their meitotic behavior; however, cytogenetics alone cannot answer

many of the questions that must be addressed in this group. It has been hypothesized

that, for example, the pentaploid biotype may be the direct derivative of Chiru and a

sexual tetraploid. Microsatellites, due to their co-dominant nature and high degree of

variability, appear as the ideal kind of markers to test such hypotheses. Furthermore,

other issues that need to be addressed, such as the breeding systems and genetic structure

of several biotypes, could also be effectively resolved using variable co-dominant

markers.

In Chapter 2, I will design and characterize several microsatellite loci for P.

dilatatum ssp.flavescens and test their transferability to all the other members of the

Dilatata group. I will also attempt to predict their potential to test different types of









hypotheses. These markers will be used as the main source of information in the

following three chapters.

Chapter 3: The Germplasm

In the context of the traditional hypothesis, P. dilatatum is the product of a

tetraploid (IIJJ) x hexaploid (IIJJXX) hybridization. The use of a variable, well-

characterized collection of tetraploids seems to be the most direct resynthesis route for

variable pentaploids. This collection could be hybridized to either of the two apomictic

and invariable hexaploids to produce new pentaploids. In spite of this, representative

collections oftetraploids have not been available. The collection of P. dilatatum ssp.

flavescens that I used here was the first one made with such an objective in mind, and a

molecular characterization of it will greatly increase its value. A comprehensive

populational-level study of the genetic variability and its structure will be presented in

Chapter 3.

Chapter 4: The Complex

Two previous attempts have been made to represent the Dilatata group in its

entirety. These attempts (Moraes Fernandes et al. 1968) and Burson (1983) were based

on the knowledge available at the time. In spite of the identification of new components

and new relationships mainly during the 1990s, the paucity of information, the lack of

comprehensive collections, or the limited interpretability of the markers used (see Casa et

al. 2002), no great advances have been made in the past two decades. With the power of

suitable techniques and a sufficient collection, Chapter 4 will surely become a landmark

in the understanding of the complex.






9


Chapter 5: The All-Important Pentaploid(s)

It was the interest in this biotype that initiated a long series of studies in the

Dilatata group. Since the establishment of its complex hybrid origin (Bashaw and Forbes

1958), the biotype has mostly been seen as a static, invariable entity. Chapter 5 is

probably the most extensive and intensive study of genetic variability ever attempted in

this biotype, and will undoubtedly change the direction of all future research on it














CHAPTER 2
NUCLEAR AND CYTOPLASMIC MICROSATELLITE MARKERS FOR THE
SPECIES OF THE DILATATA GROUP OF Paspalum (POACEAE)

Introduction

The Dilatata group of Paspalum is a polyploid complex native to the grasslands of

temperate South America. The complex contains several informal taxonomic entities that

will be generally referred to as biotypes in this paper. Paspalum dilatatum Poir. ssp.

dilatatum, a trihybrid pentaploid apomict (Bashaw and Forbes 1958, Bashaw and Holt

1958), is a widely recognized forage crop. This biotype has been assigned the IIJJX

genomic formula (Burson 1983). The Dilatata group also includes several sexual selfing

allotetraploids and several tetra- and hexaploid apomictic entities. The sexual

allotetraploids (P. urvillei Steud., P. dasypleurum Kunze ex Desv., P. dilatatum ssp.

flavescens Roseng. Arr. et Izag., and biotypes Virasoro and Vacaria of P. dilatatum) have

been shown either directly or indirectly to share the IIJJ genomic formula (Burson et al.

1973, Quarin and Caponio 1995, Burson 1979, Caponio and Quarin 1990), and their

interfertility has been either directly assessed by hybridization (Caponio and Quarin

1990, Quarin and Caponio 1995) or inferred from the occurrence of natural hybrids

(Valls and Pozzobon 1987). The group also includes two apomictic hexaploids (P.

dilatatum biotypes Uruguaiana and Chiru ) which have been assigned the IIJJXX2 and

IIJJXX genomic formulae, respectively (Burson 1991, 1992). Paspalum dilatatum

Torres, an asynaptic apomictic hexaploid (Moraes-Fernandes et al. 1968), and P.

pauciciliatum, an apomictic tetraploid (Bashaw and Forbes 1958) of unknown genomic









constitution, are also included in the group. Recently, Machado et al. (2005) have shown

that there may be several pentaploid apomictic entities in the group which have not yet

been described or named.

Interest in breeding the common pentaploid biotype has been the main motivation

for extensive interspecific hybridization and cytogenetic analyses in this group.

Pentaploid (IIJJX) resynthesis by hexaploid (IIJJXX) x tetraploid (IIJJ) hybridization has

been suggested as a possible breeding strategy for the group (Burson 1983). Vigorous

synthetic pentaploids have been successfully obtained by this kind of cross (Burson

1991b, 1992, Speranza 1994, unpubl. res.); however, the evaluation of available genetic

variability, particularly in the selfing tetraploids, has not been undertaken.

Sufficient knowledge has been accumulated not only to initiate the first breeding

attempts, but also to make this species complex an interesting model for the study of

apomixis and polyploidy. In spite of this, the study of the relationships among the

different entities that comprise this group has not advanced much in the last decade, most

probably due to the limitations of the tools available and the biological characteristics of

the organisms themselves. Only recently has it been possible to obtain further cytological

information on these biotypes through the modification of cytological techniques that

allow chromosome identification and karyotyping (Speranza et al. 2003, Vaio et al.

2005); however, cytogenetics alone cannot answer many of the questions that must be

addressed in this group.

As most of the apomicts in the complex have been hypothesized to be inter-

biotypic combinations, the markers required to address questions about their genetic

structure and origin must be transferable among all of the putative parents involved and









preferably co-dominant. On the other hand, assessment of parentage would be best

achieved with markers that are stable within biotypes, while the study of the genetic

structure of the sexual components of the complex requires high levels of variability.

Attempts have been made to use molecular markers for the study of these species,

but even when some degree of genetic differentiation between the biotypes and intra-

biotypic variability were confirmed (isozymes: Pereira et al. 2000, Chies unpublished

data, Hickenbick et al. 1992, AFLP: Speranza unpublished data, Casa et al. 2002), the

levels of variability have not been high enough or their interpretability has been very

limited. Allopolyploidy adds an additional level of complexity to the genetic

interpretation of molecular markers: the assessment of homology vs. homeology among

markers may not be straightforward, particularly in complex interbiotypic combinations.

Microsatellite markers, despite the greater technological investment required for their

development, provide the best tools for the study of the issues that have to be addressed:

genetic structure, relatedness among the entities of the complex, and parentage of the

apomictic components which are expected to be fixed hybrids. The generalized use of

simple sequence repeat (SSR) enrichment and PCR-based protocols has greatly facilitated

the development of new microsatellite loci (Fischer and Bachmann 1998, Kijas et al.

1994, Kandpal et al. 1994, JakSe and Javornik, 2001). Microsatellites not only provide

more powerful genetic data due to their co-dominant nature, they usually tend to be

extremely variable. Mutation rates of nearly 1x10-3 have been directly observed in maize

(Vigouroux et al. 2002). In well-studied selfing grass amphiploid systems like wheat,

microsatellites are capable of revealing great genetic variability (Roder et al. 1995) where









isozyme, RFLP, and AFLP markers show a high degree of marker conservation (Hazen et

al. 2002, Kim and Ward 2000).

Finally, determining the directionality of hybridizations within the species complex

may be crucial to understanding the mechanisms by which new genetic combinations are

being generated. Chloroplast microsatellites, typically (T/A)n, have been successfully

used to elucidate directional formation of allopolyploids in grasses (Ishii and McCouch

2000). Ishii and McCouch (2000) reported that despite successful cross-amplification, the

presence of variable (T/A)n tracts was not conserved among distantly related grass

genera; however, putatively universal primers for grass chloroplast microsatellites have

been reported in the literature (Provan et al. 2004).

Sixteen variable nuclear and one variable chloroplast microsatellite loci for P.

dilatatum ssp.flavescens were developed and characterized in this study. Their

transferability among all the taxonomic entities of the Dilatata group was assessed, and

their utility for addressing populational and phylogenetic studies at different levels is

discussed.

Materials and Methods

Microsatellite Capture

A genomic DNA library consisting of Sau3AI fragments of P. dilatatum ssp.

flavescens was enriched for putative microsatellite-containing sequences following the

procedures of Ernst et al. (2004) with minor modifications. Briefly, genomic DNA was

extracted with Sigma GeneluteTM kit (Sigma-Aldrich, St. Louis, MO) and digested with

Sau3AI. Fragments smaller than approximately 400bp were removed by fractioning using

Chroma Spin columns (Clontech Laboratories). Sau3AI linkers were ligated to the

remaining fragments which were then amplified by PCR. The amplified fragment library









was enriched for (GT)n-containing sequences by binding to a Vectrex Avidin D matrix

(Vector Laboratories, Burlingame, CA) to which a biotinylated (CA)n oligonucleotide

probe had been previously bound. The eluted fragments were reamplified by PCR using

primers for the Sau3AI linkers, ligated into pCR II-TOPO plasmids (Invitrogen, Inc)

and transformed into ONE shot E. coli competent cells. Colonies were screened by

binding them to Magnacharge nylon transfer membranes (Osmonics, Inc.). The

membranes were probed with labeled (CA)n and positive colonies detected with Lumi-

Phos 480 (Lifecodes, Inc.). All probe labeling, hybridization, and detection was carried

out with Quick-Light TM system (Lifecodes, Stamford, CT). Positive colonies were

grown overnight in a liquid medium and plasmids purified with QIAprep Spin Miniprep

Kit (Qiagen, Inc.). Plasmid isolates were screened a second time by dot-blotting serial

dilutions on nylon membranes and hybridizing to a (CA)n probe. Isolates showing

consistent hybridization signal through the dilutions were sequenced and used for primer

development.

Plasmid isolates were sequenced on a CEQ 8000 capillary sequencer (Beckman-

Coulter, Fullerton, CA) using /4 reaction volumes with the addition of 80mM Tris and 2

mM MgC12 (pH 9) to complete the volume of a full reaction. The sequences were edited

manually using SequencherTM (V4.1.4, Genecodes, Ann Arbor, MI).

Primers were designed for sequences containing repeats longer than (GT)io with

Primer 3 (Rozen and Skaletsky, 2000). Low-complexity regions were excluded for

primer design when possible.

Chloroplast Markers

Sequences for 6 chloroplast non-coding regions were obtained for all the

recognized entities in the Dilatata group (Table 2-1). Six regions were analyzed: the









trnT(UGU)-trnL(UAA) spacer, the trnL(UAA) intron, the PsbA-trnH spacer, the atpB-

rbcL spacer, the trnG(UCC) intron, and the trnL(UAA)-trnF(GAA) spacer. PCR and

sequencing conditions and primers were reported in Vaio et al. (2005) except for the

trnT(UGU)-trnL(UAA) spacer which was amplified and sequenced using primers A and

B (Taberlet 1991). Primers were designed flanking two poly-A repeats located in the

trnT(UGU)-trnL(UAA) spacer. All primers reported by Provan et al. (2004) were also

tested. A second poly A-tract not reported by Provan et al. (2004) was detected near the

trnL(UAA)3' exon but no length variability was observed among the available sequences,

and no further analysis was performed on it. Primer design, labeling, amplification, and

detection procedures were performed as for the nuclear SSR described above.

Plant Material

Potential variability of microsatellites was assessed by analyzing a total of 28

accessions representing different species of the Dilatata group. To assess intraspecific

variability, we analyzed ten accessions each of P. dilatatum ssp.flavescens and P.

urvillei. Accessions were chosen to represent as much of the native range of the species

as possible. To assess transferability, two accessions each of P. dasypleurum, P.

dilatatum ssp. dilatatum, and biotypes Virasoro and Vacaria of P. dilatatum were also

analyzed. Seed samples were obtained from the Southern Regional Plant Introduction

station, Griffin, GA, USA and the Germplasm Bank at the Facultad de Agronomia,

Montevideo, Uruguay. Collection localities and accession number information for all

materials are shown in Table 2-1.

DNA was also extracted from 43 F2 individuals derived from a hybrid between P.

dilatatum ssp. flavescens and P. dilatatum Virasoro to analyze segregation patterns of

loci and possible linkage relationships. Deviation from expected segregation ratios and









16




linkage between loci were assessed using Joinmap 3.0 (Van Ooijen and Voorrips, 2001).



When there were indications that more than one locus had been amplified by a primer



pair (see below), the loci were considered as putative homeologs and the absence of



linkage between them regarded as a test for their homeology.



Table 2-1. Accession numbers and collection locations of the plant material used to test

microsatellite transferability among biotypes
Species or blotype Individual Accession Location


P dilatatum ssp

2n=4x=40 (IIJJ) 2
3
4
5
6
7
8
9
10


P urvillet 1
2n=4x=40 (IIJJ) 2
3
4
5
6
7
8
9
10


P dilatatum
Vrnorn
2n=4x=40 (IIJJ)


P dilatatum

2n=4x=40 (IIJJ)


P dasypleurum** 1
2n=4x=40 (IIJJ) 2


P dilatatum ssp
2n=550 (IIJJX) 2
2n= 5x50 (IIJJX) 2


PI 508720
PI 508722
N A 7355
N A 7363
N A 7434
N A 7439
N A 7468
N A 7470
N A 7476
N A 7492


PI 509008
PI 509010
PI 509012
PI 509013
PI 164065
N A 2957
N A 7392
N A 7389
N A 7390
NA 7199


Pila, Buenos Aires, Argentina
Route 41, 1 0 km W of General Belgrano, Buenos Aires, Argentina
Route 3 near Tnnidad, Flonda, Uruguay
Route 8 km 34 3, Canelones, Uruguay
Riachuelo, Coloma, Uruguay
Route 12, 600 m N of Route 9, Maldonado, Uruguay
Route 56 km 51 500, Honda, Uruguay
Route 11 km 65 600, San Jose, Uruguay
Route 9 km 227, Rocha, Uruguay
Route 6 km 189 600, Honda, Uruguay


Ivoti, Cascata de Sao Miguel, about 45 km N of Porto Alegre, Rio Grande do Sul, Brazil
Route BR 116, 6 kmn N of Pelotas River, Santa Catarma, Brazil
Route 8, 162 km W of Buenos Aires, Buenos Aires, Argentina
Villa Nueva, 3 km S of Villa Mana, Cordoba, Argentina
Floranopois, Santa Catarma, Brazil
Route 26, km 25, Paysandu, Uruguay
Road to Las Cumbres de La Ballena, Maldonado, Uruguay
Route 7, km 103, Florida, Uruguay
Route 29 near Mmas de Corrales, Rivera, Uruguay
Balneario Solis, Maldonado, Uruguay


N A 7207 Gobemador Virasoro, Comentes, Argentina
Garruchos, Comentes, Argentina Voucher BAA24352


PI 404370 Near Vacaria, 192 km on Route BR 116, N of Porto Alegre, Rio Grande do Sul, Brazil
PI 404382 On Route BR 285 10 km west of Vacaria Rio Grande do Sul Brazil


Botancal Garden, Valdivia, Chile
General Lagos, Valdivia, Chile


N A 7542 Quebrada de los Cuervos, Treinta y Tres, Uruguay
N A 7673 Masoller, Rivera, Uruguay


*Accession numbers preceded by PI correspond to the Southern Plant Introduction Station, Griffin, GA, USA. Numbers preceded by
N.A. correspond to the Germplasm Bank at the Facultad de Agronomia, Montevideo, Uruguay.
** Seeds ofP. dasypleurum were kindly provided by Ing. For. Rodrigo Vergara from the Universidad Austral de Chile and the
University of Florida.


FI hybrids were obtained by manually emasculating a plant of P. dilatatum ssp.



flavescens and pollinating it with pollen from an individual of P. dilatatum Virasoro.









Emasculation and pollination were carried out about one hour after sunrise. The plants to

be emasculated were placed at approximately 20C and 100% RH to delay anther

dehiscense after anthesis was initiated each morning. Mature full seeds were counted and

germinated in Petri dishes on filter paper in an incubator with alternating temperatures

(16 h at 30C light, 8 h at 20C dark). Germinators were placed at 40C for 4 days prior to

incubation to break dormancy and homogenize germination. The resulting progeny were

grown and the hybrids were identified by the high number of nerves in glume II and

lemma I which characterize the pollen donor. Selfed seed of one F1 hybrid was collected

and treated as described above to establish the segregating F2 progeny used in this study.

Amplification and Scoring

For all plant materials DNA was extracted from fresh leaves or silica-gel-dried

leaves using Sigma GeneluteTM kit (Sigma-Aldrich, St. Louis, MO) according to the

manufacturer's instructions.

Amplification, labeling, and separation conditions were adjusted for all primer

pairs following Boutin-Garnache (2001). Forward primers were extended by adding an

M13 tail (5'-CACGACGTTGTAAAAC-3'), and M13 primers were labeled with D4

(Beckman Coulter, Fullerton, CA). All PCR amplifications were carried out in 10 [tL

reactions containing 0.2 units of NEB Taq polymerase (New England Biolabs, Beverly,

MA), 1.5 mM MgCl2, 0.15 [tM of the reverse primer and labeled M13 primer, 0.01 [tM of

the extended forward primer, and 0.1 mM of each dNTP in the manufacturer's buffer.

Amplification was carried out in a Biometra T3 Thermoblock with the same two-step

program for all primer pairs. The PCR profile consisted of an initial denaturing step of 5

min at 940C, followed by 40 cycles of 15 sec at 940C and 3 min at 530C, and a final

extension step of 5 min at 720C. Labeled microsatellite products were separated in a









CEQ 8000 capillary sequencer (Beckman-Coulter, Fullerton, CA) by loading 0.75 pL of

the PCR product and 0.35 pL of CEQTM DNA Size Standard Kit-400 (Beckman

Coulter, Fullerton, CA) in 25[tL of formamide per well. Chromatograms were visualized

on CEQ TM Genetic Analysis system software (Beckman Coulter, Fullerton, CA) and

scored manually.

Alleles in different size ranges from different biotypes or subspecies were

sequenced to assess homology. For primer pairs amplifying a single locus, alleles were

amplified and sequenced directly from the PCR products of homozygous individuals.

For primer pairs amplifying more than one putative locus, PCR products were separated

in 2% agarose, and the bands were cut, purified with Wizard SV Gel and PCR Clean-up

System (Promega, Maddison, WI), and sequenced directly. When multiple bands could

not be separated in the gel, gel slices containing several bands were cut and combined

products cloned with a TOPO TA Cloning kit.

Results

Capture and Amplification Success

A total of 24 clones containing (GT)n repeats were captured and sequenced. Four

clones were redundant. Primer pairs were designed for all clones, and all loci were

amplified with the same two-step PCR profile detailed above. Fifteen of these primer

pairs successfully amplified interpretable band patterns, and twelve of them were selected

for further analysis based on a preliminary assessment of amplification success under the

given conditions. Primer pairs for loci Pdfll, Pdfl2, and Pdfl26 are reported but not

further characterized (Table 2-2). Primer sequences, flanking sequence lengths, and

repeat units for all successfully amplified loci are shown in Table 2-2.








19



Table 2-2. Primer sequences and structure for all the microsatellite loci reported in this
study. When sequence information is available for more than one allele, the
variable repeat motif is reported. GenBank accession numbers for the
originally cloned sequence used to design each primer pair are given in
parentheses.


Primer pair
or locus
Focal loci
Pdfll (DQ110403)

Pdfl2 (DQ110403)

Pdfl4 (DQ110403)

Pdfl6a (DQ110403)

Pdfl7 (DQ110403)

Pdfl8 (DQ110403)

Pdfll0 (DQ110403)

Pdfll (DQ110403)

Pdfl112a (DQ110403)

Pdfl15a (DQ110403)

Pdfll8 (DQ110403)

Pdfl20a (DQ110403)

Pdfl22a (DQ110403)

Pdfl26 (DQ110403)

Pdfl28a (DQ110403)

Non-focal loci
Pdfl6b
Pdfll2b
Pdfll5b
Pdfl20b
Pdfl20-3
Pdfl22b
Pdfl28b
Chloroplast locus
cpDilB (DQ104323)


Primer sequences (5'-3')


F-GGGCGTGACAAGATTGAGAG
R-GATCCAACTCCTGGGATCAA
F-GTCTTCTACGCGACAATGTA
R-AAATGGTGGACGACACCTCT
F-TGGCTCATGTCAACCATGTC
R-CTGGAGACCAAGCAAACAGG
F-GGTCCATCCTGCTGATGAAG
R-AGCAGCACAACCTGCTGAG
F-TAGGCTGCGGAATCAACTTT
R-ACAAGGACAAACCGACTGCT
F-AGGCTGCAGAAGACTCCAAA
R-GCCACCTACTCCCCTCTGTA
F-GCTCATCAAATATGACTGAACCA
R-TCTTACGTCCCACCCAAATC
F-AAGAAGCCATTGGGTCTGG
R-CATGCATGCCTACACACAGA
F-TTCCTTTGTCAGTTCACTTCCAT
R-ACAAACTGTGCGACAAGTGC
F-AACCACTGTGTGAAGCTTGCTA
R-TGTGCACACTCATCGAAAGA
F-GGAAGGTTCAGCAACGGATA
R-GATAAGGCGGAGGGCTACTT
F-CTGGCCACTTCTTTGGACAT
R-CGGCACTAGTTGCCTGAAA
F-GCATGCTGTTGTCTTTTGCT
R-TTCCCTCGCCTCTGCTAGT
F-ATCGGCATGCTACAAGTTCC
R-TCTCATGTTCATTGCTGAAGTG
F-AAAATACCCGTGCGTTGCTA
R-CCACGCCATGTCGTCTACTA


flanking sequence
length (bp)

157


Repeat unit


(TG)26C(GT)5

(AT)5(GT)31

(TG)16

(GT)37

(GT)21

(GT)1

(TG)sCG(TG)21

(TG)12

(TA)2 (GT)26

(GT)2GC(GT)43

(GT)12

(TA)8(TG)20

(CT)2(GT)30

(CT)2oGC(GT)32

(TG)32


(TG)2
(TA)2 AT (GT)6(GA)s
(TA)4 (GT)6
(T)io
(TA)6
(CT)4 (GT)11
(TG)2


F-GGGAATCCGTAAAATGTCAGA
R-GAAAAATTGATTTGCGAATTAGAGA


Primer pairs Pdfl6, Pdfll2, Pdfl 15, Pdfl20, and Pdfl22 amplified more than one


band in all tetraploid individuals, most of which appeared homozygous for all the other


loci (Fig lb, g, h, j, and k). In these cases, representative bands from both size ranges


were cloned, sequenced, and compared with the originally captured sequences (Fig. 2-2).


Two of the extra bands, a Pdfll2 190-bp band in P. dilatatum ssp.flavescens and a 140-














g) Pdfl12a Pdfl12b
* 2(6bp)- -- 4(12bpr- --




2 --(9bp


2(2bp)


b) Pdfl6a Pdfl6b


h) Pdfl15a Pdfl15b -


* 3(40bp)


6(26bp)


* 10(110bp)


4(8bp)


* 2(10bp)


c) Pdfl7


i) Pdf118 -

2(16bp) 6(50bp)


j) Pdfl20a Pdfl20b Pdfl20c


3(4bp)
- -- 245


e) PdfllO


2
S E

2:


* 4(60bp)


-------------------- --, 1
2(lbp)


Sk) Pdf122a Pdfl22b
4(12bp) 10(120bp)


I) Pdf128a Pdf128b


3(6bp)


6(30bp)


3(6bp)


1 2 345 6 78 9 10 1 2 34 5 6 7 8 9 10 1 2 1 2 1 212 1 2 1 2 3 4 5 6 7 8 9 101 2 34 5 6 7 8 9 10 1 2 12 1 2 1 2
P dilatatum ssp flaM ecens P urwvle, P dlatatum p flasen P urwlle

Biotype Blotype



Fig. 2-1. A graphical representation of all the microsatellite alleles amplified for a sample

of each biotype. Fragment lengths are plotted as scored including the M13

primer extension (19bp). Number of alleles within biotype are given for P.

dilatatum ssp. dilatatum and P. urvillei for those loci that showed variability

within biotypes. The corresponding maximum fragment size difference is

shown in parenthesis


a) Pdfl4


2(12bp)


d) Pdfl8


2(2bp)


5(40bp)


2(2bp)


f) Pdfl11


- --_--I:


235























GGT-TTGATACTAATTGTATATAAGTCGATTGCTTA-TTTTGCGTTA-ACTATTGCTGTGTCATTTTGGCGCGCTGTTTCTTTCCCTTCTTCATTTCGAGGTAGCT (GT) G
... ............ A ...G ..T ..T ........ ......... G .... C ...... ... .... A ............ T ...................... (G T )
............. A...G..T..T......... ........ G ..... .. ... .. A ......... T ........... ..... GT)
... ......... ..... ..G..T..T ........ .... .... ... ... ...... .. ..... ... ........ T .................T. GT
. ............A...G..T..T......... T ..........C.G.......... CAG.. ..----- -----..... CT GTGCG


b) Pdfll2


S. ......... G .................... ... .... A ...
] ............. G ............................. A ...
S.. ............. ............. A...
1 . ..... ......... .................... A ...


c) Pdfll5


d) Pdfl20


AAGG (TA) (TG) 20--ATTCTTTTGATATGCTCCCTTGTAT
(TA G....... T ......... C .....
TA ....... T ......... C ..... (
.... TA ) T G ................... C ....


e) Pdfl22
Pdfl22a Clone
Pdfl22a Vir 1
Pdfl22b Vir 1

f) Pdf128


CAAGCCT (CT) 2 (GT) 3CGCGCGTGCACATGCATGGCGGCATGGCGCGCTTTGGCCGTTGGCCGATGCTTGCTGACTGAATCACTGAATGCTGGAGCTGAGCATGCA
.......( T) (GT .................................................... ...C ........ .. .
....... I(T)4 (GT) ............ .... ................................... A ............ T.C .........


CAGGAACAATCTAGCCACGGTGTGGTGCGTATATTTCGCATTGGGCGGTGTATAGA
. . .. . . . . . .. . . . . . .

...... ... ................. ........................T... I
S.... ................. .......... ... ........I..
... .. .. ... .. .. ...T-....A..A..... T.. =


Fig. 2-2. Alignment of nucleotide sequences of representative alleles for the non-focal loci compared to the originally cloned

sequences. Primer sequences are not included. All putatively homologous variable and non-variable repetitive sequences

near or around the main microsatellite are highlighted for comparison


a) Pdfl 6


I . .. .


. ..... .. ....... .
. ...... .C. ......... I
...... .c. ....... 7
.GT .............. 2P


.................. .C ............ T ....... ... A ..AC .
.................. .C ............ T ....... ... A ..A .
.................. .C ............ T ....... ... A ..A .
. .. .. .. .. .. .. .. T ... ... ... .. .


- (GT) 2GC (GT) 43
C (TA) 4 (GT)
c (TA) 4 (GT),5 C


-AGTTGCCACCT (TC) 6 (T) 3 GCTAAATGTATACTTTCCTTAA-CGCTGCTGAATATTTGTTAAGAACTAAACAATCTGCCGATATTATG
rT ........... [(TC )2 C T ) G (T ) G (T ) .... .. .. .. .. ..................... .... .. ...... T .... .....
r ........... (TC )2 C (T )2G (T )i .... G .... C ..G ......... -GT ................... .A ............ T .........
...... T... (TC)4 (T)3 ........ GC ............ A.T ........ ---- --- --- A ....... .............


G. ........ .......... ...CG.T... .G.. ........ ..... ...... .. ....
3G ......... T ............. CG.T .... G.T ....... G.CT --- --- .G .... C ....









bp band in P. urvillei did not contain the forward primer sequence. These bands were in

fact reproduced by using just the labeled M13 primer and the reverse primer for each

locus. These bands were not further scored and are not shown in Fig. 2-2. In all the other

cases, the extra bands showed extensive sequence similarity to the captured alleles (Fig.

2-2). The loci for which the primers were originally designed will be referred to as the

focal loci. When two different loci were detected, the focal locus was identified by

adding "a" to the primer pair name. For most non-focal loci, fragment sizes were smaller

than the captured bands, and the microsatellite repeat was either absent or showed a

lower number of repeats. The only exception was the Pdfll2a 140-bp allele in Vacaria

which was smaller than the non-focal locus Pdfll2b. Representative allele sequences are

shown in Fig. 2-2. For Pdfl20 and Pdfl28, an extra band was present in the apomictic

pentaploid relative to tetraploids (Fig. 2-2j and 1). These bands were sequenced, and they

showed again extensive similarity to the captured loci (Fig. 2-2).

When more than one locus was amplified by a primer pair, alleles were assigned to

either putative homeologous locus based on the sequences shown in Fig. 2-2.

Homeologous loci are expected to be completely unlinked because they necessarily lie on

different chromosomes. Linkage analysis based on the segregating F2 population showed

no evidence of linkage between loci amplified by the same primer pair with

recombination frequencies ranging from 0.3664 to 0.4371 and LOD scores from 0.03 to

1.09 (significance threshold LOD equal to 3) (Table 2-3).

In addition, no significant linkage was observed when considering the full set of 16

loci (including non-focal loci), even at a low LOD score threshold level of 2. Although

the test for independence between loci as implemented in Joinmap is robust against











segregation distortions, it is reassuring that all but one locus (PDfl 15a) showed


segregation ratios in agreement with the expectations (Table 2-4).


Most loci were amplified in all materials tested with a few exceptions (Fig. 2-1).


Paspalum urvillei could not be scored for Pdfl7 and Pdfll0. Pdfl7 was not amplified at all


in most P. urvillei samples, whereas for Pdfll0, weak peaks were observed but could not


be reliably scored probably due to interference during PCR from the M13-primed


fragment mentioned above. Paspalum dilatatum Virasoro showed null alleles for Pdfl 18


and Pdfll2a, and P. dasypleurum did not produce fragments for Pdfl 15. Locus Pdfl22b


amplified consistently only in P. dilatatum Virasoro and P. dilatatum ssp. dilatatum.


Table 2-3. Estimated recombination frequency between pairs of loci amplified by the
same primer combination, and LOD score for the test of independent
segregation between them. Significant threshold LOD=3
Locus pair Recombination LOD
frequency
Pdfll2a vs Pdfll2b 0.4326 1.09
Pdfll5a vs Pdfll5b 0.3664 0.38
Pdfl20a vs Pdfl20b 0.3665 0.21
Pdfl22a vs Pdfl22b 0.4371 0.03


Table 2-4. Test of the segregation ratios per microsatellite locus. Genotypes coded as: 'a'
homozygousflavescens allele, 'b' homozygous Virasoro allele, 'h'
heterozygous, 'c' dominant allele from Virasoro, and 'd' dominant from ssp.
flavescens
.Locus a h b c d ratio chi-square df p
Pdfl4 13 22 8 0 0 1:2:1 1.2 2 0.549
Pdfl6 14 18 11 0 0 1:2:1 1.6 2 0.449
Pdfl7 16 17 10 0 0 1:2:1 3.6 2 0.165
Pdfl8 9 22 12 0 0 1:2:1 0.4 2 0.819
PdfllO 17 20 6 0 0 1:2:1 5.8 2 0.055
Pdflll 6 21 16 0 0 1:2:1 4.7 2 0.095
Pdfll2a 0 0 15 0 28 3:1 2.2 1 0.138
Pdfll2b 7 28 8 0 0 1:2:1 4.0 2 0.135
Pdfll5a 5 21 17 0 0 1:2:1 6.7 2 0.035
Pdfll5b 10 20 13 0 0 1:2:1 0.6 2 0.741
Pdfll8 0 0 10 0 33 3:1 0.1 1 0.752
Pdfl20a 8 25 10 0 0 1:2:1 1.3 2 0.522
Pdfl20b 14 20 9 0 0 1:2:1 1.4 2 0.497
Pdfl22a 7 25 11 0 0 1:2:1 1.9 2 0.387
Pdfl22b 8 0 0 35 0 3:1 0.9 1 0.343
Pcfl28 12 19 12 0 0 1:2:1 0.6 2 0.741









Variability

All biotypes showed polymorphisms for at least two loci. On the other hand,

several alleles were mostly fixed within biotypes but variable among biotypes. Notably

Pdfl7 provided excellent biotype-specific markers for this sample (Fig. 2-1c). Pdfl6b was

the only invariable locus scored in this sample.

At least two different alleles were cloned and partially sequenced from the focal

biotype for Pdfl4, Pdfl6a, Pdfll 1, Pdfll2a, Pdfl22a, Pdfll5a, and Pdfl28a. Despite the

effect of the long repetitive tract on the quality of the sequence, it can be clearly seen that

variation in the focal loci is due to expansion/contraction of the (GT/CA)n repeat (data

not shown).

Despite being the source biotype, P. dilatatum ssp.flavescens does not display the

greatest variability nor allele sizes in this sample (Fig 2-1). The average number of

alleles for P. dilatatum ssp.flavescens is 2.5 with an average size range per locus of 9.9

bp. Paspalum urvillei showed a higher number of alleles per locus (3.9) and a higher size

range (28.9 bp); furthermore, P. urvillei showed polymorphisms for all the scored loci,

and all the individuals except 3, 7, and 8 were heterozygous for at least one locus whereas

in P. dilatatum ssp.flavescens only individual 7 appeared heterozygous for locus Pdfl6a.

The two individuals sampled from Virasoro and Vacaria were completely homozygous,

whereas heterozygosity was observed in both individuals of P. dasypleurum (Fig. 2-le, j,

h). The two individuals ofP. dilatatum ssp. dilatatum were heterozygous for all loci

except individual 2 at locus Pdfl22b (Fig. 2-1k).

In summary, 19 variable nuclear microsatellite loci were investigated, with one

locus monomorphic in all the accessions (Pdfl6b). Among the 18 variable loci, 11 were

successfully amplified and interpreted in all the biotypes in this sample. Of the original









12 focal loci, 4 could not be scored in one of the biotypes: Pdfl7 and PdfllO in P. urvillei,

Pdfll8 in Virasoro, and Pdfll5a in P. dasypleurum. Three of the non-focal variable loci

(Pdfll2b, Pdfll5b, and Pdfl20b) were successfully amplified and scored for all

individuals, while Pdfl22b was only amplified in Virasoro, the pentaploids, and one

individual ofP. urvillei, and finally, two loci (Pdfl20-3 and Pdfl28b) were only amplified

in the pentaploids.

Chloroplast Variability

All regions were successfully amplified and sequenced except for the trnT(UGU)-

trnL(UAA) spacer for which low-quality sequences were obtained due to the presence of

poly-A tracts near both ends (GenBank accession nos. DQ104273-DQ104323). No

further efforts were made to improve the quality of the sequences of the (UGU)-

trnL(UAA) spacer because they were considered appropriate for the purposes of this

study. Overall, no sequence variability was found among the biotypes of the Dilatata

group except for the length of the poly-A tract in the trnT(UGU)-trnL(UAA) spacer, and

a G-T transversion in the trnL(UAA) intron in the Vacaria individual. No repetitive

sequences were found except for poly-A/T tracts. Fragment sizes were not variable for

any of the loci reported by Provan et al. (2004) or the poly-A repeat located near the

trnL(UAA)5' exon in the trnT(UGU)-trnL(UAA) spacer. Only the poly-A repeat located

near trnT(UGU) (cpDilB) was variable as observed in the original sequences. Fragment

lengths (after subtracting the M13 tail) were 198 bp for P. dilatatum ssp.flavescens, ssp.

dilatatum, Virasoro, and Vacaria, 199 bp for P. urvillei and 197 bp for P. dasypleurum.

No intrabiotypic variability was observed except for individual 2 in P. urvillei, which

contained the 198-bp allele.









Discussion

Capture Efficiency

Among the loci reported here, Pdfl2, Pdfll2a, Pdfll5b, and Pdfl20a were found to

be compound (CA/GT)n (AT/TA)n repeats (Table 2-2). In a genome-wide survey in rice,

Temnykh et al. (2000, 2001) found that (CA)n repeats were frequently associated with

(TA)n repeats.

In genome-wide surveys of grasses, (CA)n repeats have been reported to be

relatively short compared to other dinucleotides (Temnykh et al. 2000). During the

enrichment phase of the capture protocol, this may have led to the retention of a limited

number of longer repeats, which may explain the high level of redundancy (4/24) of the

captured clones. A strong bias towards long repeats may be advantageous because the

length of the perfect repeats is expected to be associated with higher degrees of

variability (Symonds et al. 2003). Here, loci with more than 30 perfect repeats (Pdfl6,

Pdfl 5a, Pdfl22, and Pdfl28) revealed the highest number of alleles per locus in both P.

dilatatum ssp. flavescens and P. urvillei.

Amplification Profile

Low temperatures during the PCR extension step have been suggested to reduce the

generation of frameshift products (commonly known as "stutter"), particularly for

fragments containing (CA)n repeats (Hite et al. 1996). Under standard PCR conditions

like those used here, though, extension temperature cannot be reduced below the desired

annealing temperature. In preliminary amplifications a noticeable reduction in the

number of stutter peaks was observed, particularly for long alleles, when extension was

carried out at 530C rather than at 720C, while even lower temperatures resulted in the

production of locus-nonspecific products. However, the use of a single, robust









amplification profile does not require the adjustment of annealing and extension

temperatures for each primer pair individually, and greatly increases logistic efficiency

when simultaneously working with multiple primer pairs.

Non-Focal Loci

Most studies focus on primer pairs that amplify highly variable single loci. In this

study, all bands were taken into account because stable, biotype-specific, co-dominant

markers could be extremely useful for hybrid analyses within the complex. Sourdille et

al. (2001) analyzed a set of wheat microsatellite primer pairs including primers that

amplified more than one locus taking into account their known chromosomal locations

and transferability. In that study, 54% of the primer pairs amplified more than one locus,

including cases in which the extra bands were monomorphic, independently segregating

variable loci or co-segregating linked markers. These results are very similar to the ones

obtained in this study, in which 50% of the primer pairs amplified more than one putative

locus. In this study, however, extra bands were either monomorphic or independently

segregating, but no putative tandem duplications were found. Definitive assessment of

homeology would require a genetic map showing that the loci are located in syntenic

homeologous chromosome segments.

The number of products amplified was always equal to or less than the number of

loci expected for a tetraploid amphiploid, always consistent with the interpretation that

primer pairs were amplifying products from either one or the two genomes. Remarkably,

primer pair Pdfl20 amplified a number of bands exactly corresponding to the ploidy level

in heterozygous individuals.









Nuclear Loci

At least two variable loci were identified for each of the biotypes including the

three sexual tetraploids represented by only two individuals. It is likely then that if more

individuals were analyzed, this set of loci could contain useful markers for population

structure and breeding system assessment of all the biotypes in the group. Overall, the

focal species showed less variation than P. urvillei. Only in 25% of the loci (Pdfl4,

Pdfl6a, Pdfl20a, and Pdfl28) did P. dilatatum ssp.flavescens show consistently longer

repeats than P. urvillei. It is typically expected that due to selection for long repeats

during library enrichment, longer repeats and higher variability are more likely to be

found in the focal biotype (Ellegren et al. 1995), an artifact known as ascertainment bias.

However, P. urvillei consistently showed more variability and a much higher level of

heterozygosity for most loci. A higher number of alleles was captured in P. urvillei, even

at loci for which the average fragment length was clearly lower than in P. dilatatum ssp.

flavescens (Fig 2-2 g, j) which contradicts the accepted consensus that repeat number and

variability are associated regardless of the causes of this correlation (Schloterer 2000). A

statistical comparison of variability within different biotypes is beyond of the scope of

this paper; however, the clear differences in variability and heterozygosity between P.

dilatatum ssp.flavescens and P. urvillei are likely to be real despite the small sample size

presented here. Amos et al. (1996) claim that heterozygosity may lead to an increase in

mutation rates at microsatellite loci. This may seem to be the case when comparing P.

dilatatum ssp. flavescens and P. urvillei; however, the stochastic effects of the restricted

distribution of P. dilatatum ssp.flavescens and its apparently extreme selfing rate may

deserve further investigation as putative explanations for the observed "reverse

ascertainment bias". The relative distance between the species analyzed should also be









taken into account to interpret meaningfully cross-amplification and ascertainment bias.

The I, J, and X genomes within the Dilatata polyploids can be considered to represent

different species because they are implicitly assumed to have diverged independently as

different diploid species between their coalescence time and the polyploidization event

that brought them back together. When the putative homeologous sequences shown in

Fig.2-2 are compared, a strong ascertainment bias is evident in all of them. Similar

flanking sequences combined with shorter and imperfect repeats like those found in the

non-focal loci in this study were found by Chen et al. (2002) when they amplified

microsatellites developed for Oryza sativa in congeners containing different genomes.

Variation was also found between the two individuals of P. dilatatum ssp.

dilatatum. These two individuals share 13 heterozygous allele combinations, making it

very unlikely that the three differences found (Pdfll5a and Pdfl22b, Fig. 2-1 h and k,

respectively) are due to a sexual recombination event or independent origins. However,

enough mutations seem to have accumulated in this clonal biotype to observe variability

with this set of microsatellite loci.

Alleles found in P. dilatatum ssp. dilatatum in eight loci are also present in

Virasoro, suggesting that this tetraploid could have been involved in the origin of the

pentaploid biotype. The pentaploids could not have arisen directly from a cross involving

the Virasoro genotypes analyzed here because the pentaploids are heterozygous for loci

for which Virasoro shows null alleles (Pdfll2a and Pdfll8). More intra-biotypic

variability must be analyzed, but the markers developed in this study seem to have great

potential for assessing the relationships among the sexual and apomictic components of

the Dilatata group.









Clustering and uneven genomic distribution of (CA)n motifs has been reported in

several genomes (Elsik and Williams 2001, Schmidt and Heslop-Harrison 1996);

however, no close linkage was detected among the loci analyzed in this study. Any

subset of these loci can then be chosen for a specific application based on amplification

consistency and variability to provide independent characters.

Chloroplast Microsatellites

Even though cpDilB was the only variable chloroplast microsatellite identified, it

could potentially be very informative for assessing hybridization among biotypes because

the chloroplast genome is inherited as a single cohesive group and different alleles are

fixed within biotypes. Paspalum urvillei is the most widespread of the sexual members

of the Dilatata group, and its current range overlaps with those of the rest of its members.

Putative hybrids can be confirmed or P. urvillei can be ruled out from being the female

progenitor by using this marker. In this sample, individual 2 of P. urvillei was the only

one that showed a chloroplast allele that is not typical of its biotype. This accession was

indeed collected near the area of co-occurrence with biotype Vacaria with which P.

urvillei has been reported to hybridize (Valls and Pozzobon 1987). Our ability to identify

this putative hybrid confirms the utility of this marker.

Conclusions

Nuclear and chloroplast markers are reported with potential applications in

population genetics and phylogenetic studies within the Dilatata group. Highly variable

nuclear markers can be used to address population structure and breeding system issues

for all the biotypes in the group. On the other hand, more stable biotype-specific loci

may be used as co-dominant markers to assess the relationships among biotypes and

particularly the origin of the apomictic components of the complex. The variable






31


chloroplast microsatellite locus reported may in turn provide valuable information about

the relationship between the most widespread sexual member of the complex (P. urvillei)

and the rest of the biotypes.














CHAPTER 3
BREEDING SYSTEM AND POPULATION GENETIC STRUCTURE OF Paspalum
dilatatum ssp. flavescens (POACEAE).

Introduction

Paspalum dilatatum Poir. is a warm-season grass native to the grasslands of

temperate and subtropical South America. The species includes several tetraploid,

pentaploid and hexaploid forms. The common pentaploid form (P. dilatatum ssp.

dilatatum) was one of the first warm-season grasses to be cultivated for pasture (Skerman

and Riveros 1992), however, its commercial use has been limited by poor seed

production and susceptibility to ergot (Clavicepspapali). The pentaploid biotype

reproduces by apomixis (Bashaw and Holt 1958) and it has been assigned the IIJJX

genomic formula (Burson 1983). Because no sexuality has been reported in this

subspecies and collections have not provided much variability for the characters of

interest, efforts were soon undertaken to elucidate its relationships with other Paspalum

species in the hope that a breeding strategy could be devised. As a consequence of

extensive collections and cytogenetic investigations in P. dilatatum and related species,

three sexual tetraploid biotypes with the IIJJ genomic formula have been identified and

are usually included in the species (P. dilatatum ssp.flavescens Roseng. Arr. et Izag., and

biotypes Virasoro and Vacaria). Burson (1983) proposed that recombinant IIJJX

pentaploids could be synthesized by crossing one of the sexual biotypes and an apomictic

hexaploid with the IIJJXX genomic formula. This genomic formula was later assigned to

the hexaploid biotypes Chiru and Uruguaiana (Burson 1991, 1995), and synthetic









pentaploids have been readily produced (Burson 1991b, 1995, Speranza 1994 unpubl.

res.) and show excellent forage potential. As only one population is known for Chiri, and

probably both Chiri and Uruguaiana are very likely a single clone, genetic variability for

the breeding scheme mentioned above must come from the tetraploid parent. Among the

tetraploids, P. dilatatum ssp.flavescens is morphologically the most similar to the

common pentaploid biotype. The forage potential of P. dilatatum ssp. flavescens itself

has been assessed and compared with that of other biotypes. Besides a lower production

potential, this biotype's production is more concentrated in the spring (Millot 1969).

Paspalum dilatatum ssp.flavescens produces more seed than the pentaploids and it is

thought to be more resistant to Claviceps. Paspalum dilatatum ssp. flavescens is

currently distributed in southern Uruguay and the eastern province of Buenos Aires,

Argentina (Rosengurtt et al. 1970). Paspalum dilatatum ssp. dilatatum is also found

throughout the range of P. dilatatum ssp.flavescens. The tetraploid subspecies can be

distinguished from the pentaploids by its more erect and usually taller culms, larger, more

rounded spikelets, and yellow rather than purple anthers (Fig. 3-1). Recently,

microsatellite data for a small sample of this biotype suggested a high level of

homozygosity (Chapter 2)

A collection of P. dilatatum ssp.flavescens was deposited at the Germplasm Bank

of the Facultad de Agronomia in Montevideo, Uruguay during the 1990s. An efficient

use of this collection will depend on knowledge about its genetic structure, the breeding

system of the species, and its geographical structure (Epperson 1990, Rao and Hodgkin

2002). No morphological qualitative markers have been identified in the biotype, and

there is no evaluation of the degree of genetic variability it contains or its structure. In









this study, a sample of this collection is analyzed using six microsatellite loci, and the

breeding system, genetic structure, and geographical structure of the genetic variability

are discussed.













a b

Fig. 3-1. A spikelet of P. dilatatum ssp.flavescens (a) and P. dilatatum ssp. dilatatum (b).
Note the relatively shorter, less hairy stigmata in P. dilatatum ssp.flavescens
and trapped anthers (arrow). The bar represents 1 mm.

Materials and Methods.

Collection Strategy

Because tetraploid and pentaploid plants are practically indistinguishable in grazed

pastures, most collections were made on major roads in southern Uruguay. Based on

field and greenhouse observations that suggested autogamy, an emphasis was made on

collecting seed from a single panicle from each individual while sampling as many

individuals as possible. Paspalum dilatatum ssp.flavescens grows in dense patches on

roadsides and in hilly areas, and patches are typically restricted to lower slopes excluding

the bottom. Each population consisted of up to four patches including both sides of the

road and both sides of a waterway when one was present. Seeds were deposited in the

Germplasm Bank at the Facultad de Agronomia in Montevideo, Uruguay. For most









accessions, a voucher specimen was also deposited at the herbarium of the Facultad de

Agronomia (MVFA).

Seed samples of 21 accessions were later retrieved from the Germplasm Bank for

this study. Accession numbers are given in Table 3-1, and collection localities can be

seen in Figs. 3-3 and 4. Eight individuals per accession were grown in greenhouse

conditions. All individuals were observed during the reproductive stage to ensure that no

pentaploids were present.

Microsatellite Amplification

DNA was extracted from fresh leaves using Sigma GeneluteTM kit (Sigma-Aldrich,

St. Louis, MO). PCR and separation were carried out as described in (Chapter 2) using

extended forward primers with an M13 tail (Boutin-Garnache et al. 2001). Briefly, 0.5-3

[tL of DNA were added to a PCR mix consisting of 2 units of NEB Taq polymerase (New

England Biolabs, Beverly, MA), 1.5 mM MgCl2, 0.15 pM of the reverse primer and

labeled M13 primer, 0.01 [tM of the extended forward primer, and 0.1 mM of each dNTP

in the manufacturer's buffer. Amplification was carried out with the same two-step

program for all primer pairs consisting of a denaturation step of 15 s at 940C and an

annealing/extension step of 3 m at 530C (Chapter 2). Primer pairs Pdfl4, Pdfl6, Pdfl 12,

Pdfl 15 and Pdfl20 (Chapter 2) were selected for this study. Three different fluorochrome

labels were used (D2, D3 and D4, Beckman Coulter, Fullerton, CA) for the M13 primers.

PCR products labeled with D2, D3 and D4 were combined 5:3:2, and 1 [tL of the

combined products was loaded on a CEQ 8000 capillary sequencer (Beckman-Coulter,

Fullerton, CA). Chromatograms were visualized on CEQTM Genetic Analysis system

software (Beckman Coulter, Fullerton, CA) and scored manually.









Data Analysis

AMOVA (Excoffier et al. 1992) was implemented with Arlequin (Schneider,

Roessli, and Excoffier 2000) using both the number of different alleles (FST) and the sum

of squared size difference (RST) as a distance measure (Slatkin 1995). Average squared

distances (D1) (Goldstein et al. 1995, Slatkin 1995) and the proportion of shared alleles

(Dps) (Bowcock 1994) as implemented in MSAanalyzer (Dieringer and Shloterer 2002)

were used to measure population differentiation. D1 was chosen because it takes into

account the mutation history reflected by allele size similarities caused by the stepwise

mutation mechanism typical of microsatellite loci. Furthermore, D1 is expected to reflect

linearly the divergence time between populations even when averaged across loci with

different mutation rates (Goldstein et al. 1995). The calculation of D1 makes use of

intrapopulational allele size variance; when calculation is based only on average allele

size as is commonly implemented for (6S)2 (Goldstein et al. 1995), the distance between

populations including a combination of long and short alleles and populations with only

intermediate alleles is severely underestimated, and this situation was often approached in

the current data set.

Population parameters of inbreeding (Fis) and gene diversity (He) were calculated

with Genepop (http://wbiomed.curtin.edu.au/genepop/).

A Mantel test (Mantel 1967) was implemented using Passage (Rosenberg 2001)

between matrices of D1 and Dps genetic distances and geodesic distances between

populations to detect isolation by distance (Heywood 1991, Slatkin and Arter 1991).

Geodesic distances between populations were generated by Passage from the original

population geographical coordinate list. Cluster and principal component analyses were

performed with MVSP (KCS, Anglesey, Wales).











Results

All primers amplified the expected products in all individuals. Lack of

amplification in a first attempt was overcome by varying the amount of DNA used in the

PCR reaction in all cases. Although all DNAs had been extracted with the same protocol,

ten-fold variations in the amount of DNA were sometimes necessary to achieve

satisfactory amplification. No homozygotes for null alleles were thus detected, and given

the levels of homozygosity found, it is not likely that they are present as heterozygous

combinations in this sample.

290


280


270 r


260















210
250 -





230








200 ---i
Pdfl4 Pdfl6 Pdfl12 Pdfl15 Pdfl20 Pdfl22

Locus

Fig. 3-2. Allele size distribution for six microsatellite loci in P. dilatatum ssp.flavescens.
Shaded areas represent relative allele frequencies.



















Table 3-1. Genetic diversity and heterozygosity for individual populations ofP. dilatatum ssp.flavescens for 6 microsatellite loci.


Pdfl20
Pop." Acc.b Gen' Hetd F,se He Ag Het
101 7494 2 0 1.00 0.04 1
102 7495 7 3 0.67 0.57 2 2
50 7363 4 1 0.92 0.30 2 1
57 7364 4 0 1.00 0.47 2 0
62 7429 7 0 1.00 0.52 2 0
64 7432 6 1 0.93 0.30 2 0
65 7435 7 2 0.87 0.32 2 0
66 7433 4 1 0.78 0.19 2 0
68 7434 5 1 0.96 0.53 2 0
7 7355 6 3 0.79 0.31 1
72 7438 7 0 1.00 0.40 1
76 7467 5 0 1.00 0.30 2 0
78 7469 4 0 1.00 0.19 2 0
79 7470 3 0 1.00 0.35 2 0
82 7473 3 0 1.00 0.23 2 0
87 7478 4 0 1.00 0.33 2 0
91 7481 7 3 0.73 0.39 2 1
92 7482 2 1 0.80 0.10 1
95 7485 3 0 1.00 0.21 1
98 7491 4 0 1.00 0.16 2 0
99 7492 1 0.00 1
Ave. He
Totals 80 16 0.92 0.59 1.7 0.49


Pdfl4
Reph A Het
39 1
(37-39) 4 2
(37-39) 1
(37-39) 2 0
(37-39) 2 0
(37-39) 2 0
(37-39) 1
(37-39) 2 0
(37-39) 2 1
37 2 2
39 2 0
(37-39) 2 0
(37-38) 1
(37-39) 2 0
(37-39) 3 0
(37-39) 3 0
(37-39) 1
37 1


Pdfll2
Rep A Het
30 1
(21-36) 2 2
30 2 0
(21-36) 2 0
(21-30) 2 0
(30-36) 1
30 2 1
(30-36) 2 1
(21-30) 2 0
(30-36) 2 1
(30-36) 3 0
(30-31) 1
30 2 0
(30-36) 2 0
(21-36) 2 0
(21-36) 2 0
30 3 2
30 1


Pdfll5
Rep A Het
43 1
(40-43) 2 1
(43-44) 2 0
(40-43) 2 0
(40-43) 3 0
43 4 0
(43-44) 3 1
(40-42) 1
(40-43) 3 0
(40-43) 2 0
(40-43) 2 0
40 2 0
(40-42) 1
(40-43) 3 0
(38-43) 2 0
(38-43) 2 0
(40-44) 2 0
40 2 0


Rep A
65 1
(43-44) 4
(42-43) 2
(43-47) 2
(42-62) 3
(42-62) 2
(59-66) 1
32 1
(42-62) 2
(43-62) 1
(43-62) 2
(42-62) 2
42 1
(32-62) 2
(32-62) 1
(32-62) 1
(42-62) 2
(42-62) 2


Pdfl22
Het

1
0
0
0
1



0

0
0

0



1
0


37 1 30 2 0 (43-45) 2 0 (62-65) 2 0
(37-39) 2 0 (21-32) 1 45 1 42 1 -
37 1 30 1 40 1 42 1 -
Ave He He Ave He Ave He
(37-39) 1.8 0.39 (21-36) 1.8 0.62 (38-45) 2.0 0.75 (32-66) 1.7 0.62


Pdfl6
Rep A Het
46 2 0
(34-43) 5 1
(43-45) 2 0
(43-45) 2 0
(37-45) 2 0
(39-43) 1
43 3 0
43 2 1
(43-45) 3 0
43 2 0
(39-43) 3 0
(43-45) 3 0
45 2 0
(39-43) 1
43 1
43 1
(43-45) 3 1
(43-45) 2 1


Rep
(42-45)
(45-54)
(50-52)
(45-52)
(45-52)
52
(51-54)
(45-52)
(45-52)
(51-52)
(40-52)
(45-52)
(44-45)
52
52
52
(45-53)
(45-47)


(34-43) 2 0 (45-47)
45 2 0 (52-53)
45 1 45
Ave He
(34-46) 2.1 0.66 (40-54)


Population label. b Accession number. c Number of genotypes per population. dNumber of heterozygous individuals. multilocus
fixation index. f Expected heterozygosity. g Number of alleles. number of repeat units in the microsatellite inferred from allele

length.









All loci were variable, providing high expected heterozygosities (Table 3-1). Pdfl4

was the least variable locus (He= 0.39) and the only one to show a clearly unimodal allele

size distribution with one allele showing a frequency of 0.77 (Fig. 3-2).

Allele size ranges and their frequencies for the whole sample are shown in Fig. 3-1.

Allele size distributions are clearly bimodal for Pdfl6, Pdfll2, Pdfl 15, and Pdfl20.

Consequently, in spite of the high proportion of alleles with very low frequencies, He

values for all loci across populations are rather high (Table 3-1). Besides showing

bimodal distributions, not all possible allele sizes are represented. Three considerable

gaps were found: a 20-bp gap in Pdfl4 and two gaps of 20 and 24 bp, respectively, in

Pdfll5.

The sample contained a high level of overall homozygosity; only 16 individuals

(9.5%) showed any heterozygosity. However, only 4 populations contained more than a

single heterozygote, and notably only 4 individuals were heterozygous at more than one

locus, three of them from population 102. In turn, those three individuals share all the

segregating alleles, making it possible that they may belong to a single segregating

progeny (data not shown). Eleven populations (52%) contained no heterozygotes, and

fixation indices within individuals (Fis) for the rest of the populations are high, including

those for population 102 (0.673). The average Fis value is 0.916. In spite of the low

number of heterozygotes, intrapopulational variability is considerable, with about half of

the populations reaching He values above 0.35. Although one population (99) contained

a single genotype, the average number of genotypes is 3.8 per populational sample of

only 8 individuals. The average number of alleles per locus within populations is 1.8,








40



ranging between 1.7 and 2.1 (Table 3-1). Then, despite differences in variability, all loci


contributed allele size differences which would detect outcrossing if it were taking place.


Allele size distribution between populations varied among loci; however, for some


loci, particularly Pdfl6 and Pdfl 15, several variable populations showed non-overlapping


ranges (Table 3-1). This observation suggests that there may be structure in the allele


size range within populations, which could shown by using a distance method that takes


allele size into account.


Table 3-2. AMOVA of a six-microsatellite-locus data matrix for 21 populations of P.
dilatatum ssp. flavescens.
Distance measure RST
Source of Sum of Variance Percentage
variation d.f. squares components of variation

Among
populations 20 28961.05 86.62 Va 58.27

Within
populations 315 19537.88 62.03 Vb 41.73

Total 335 48498.93 148.65

Fixation Index FST : 0.583
Significance test P(rand. value >= obs. value) 0.00000+-0.00000
(1023 permutations)

Distance measure FST
Source of Sum of Variance Percentage
variation d.f. squares components of variation

Among
populations 20 330.14 0.98Va 54.04

Within
populations 315 262.44 0.83 Vb 45.96

Total 335 592.58 1.813

Fixation Index FST : 0.54
Significance test P(rand. value = obs. value) = 0.00000+-0.00000
(1023 permutations)



Significance test P(rand. value = obs. value) = 0.00000+-0.00000
(1023 permutations)

Va and FST : P(rand. value >= obs. value) =- 0.00000+-0.00000








41


79
68
a *



95 A
87
66
102
57
50
98 E
62
91
76
92
99
78
240 D1 200 160 120 80 40 0

Longitude
b -580 -570 -560 -550 -540


S \ 99A
S /
82 1 78 9 7 r 8 -4 u




68 61-I 62 92, 57 /

--- < 79' 91 1 \ 02 ; '/




Montevideo -. roads -35-


C02

01 *

0 0 00
0 1 S *
0O

0 0
-0 2
0 10 20 30 40 50

Fig. 3-3. Genetic distances among 21 populations ofP. dilatatum ssp.flavescens and

their geographical distribution, a. Complete linkage phenogram of D1
distances, b. Geographical distribution of the clusters shown in a (see
symbols). Only roads on which the samples were collected are shown, c. a
Mantel correlogram of D1 genetic distances and geographical distance
between populations. Open circles show significant correlations.







42






















b 58 55







87360 300 240 180 13420 60 0
Di






S 76 87 -340 u
780 e
68 66 62 92 57
S91 95 102
65 72
S72 Atlantic Ocean
Rio de la Plata 64 50
Montevideo -350

Fig. 3-4. Genetic distances among individual genotypes of P. dilatatum ssp.flavescens
and their geographical distribution, a. Average linkage (UPGMA) phenogram
of D1 distances. b. Geographical distribution of the clusters shown in a (see
symbols in a).

Population subdivision as analyzed by AMOVA produced FST values of 0.58275

when using the average allele size difference as a distance measure, and 0.54041 when

using the number of shared alleles. Both estimates were highly significant (Table 3-2).

D1 genetic distances between populations were calculated and the distance matrices

used for cluster analysis. Several linkage methods were used and all resulted in similar









clusters (results not shown). One of the best resolved phenograms is shown in Fig. 3-3a.

The resulting cluster memberships were plotted on a map (Fig. 3-3b) to visualize any

possible geographical structure. Mantel tests were also performed comparing the D1 and

Dps distance matrices to the geographical distance matrix. None of these tests was

significant. Mantel correlograms were also produced which showed no association

between geographical and genetic distance with either distance measure. One of those

correlograms is shown in Fig. 3-3c.

A similar approach was followed to analyze possible geographical structure in the

distribution of individual genotypes. A UPGMA phenogram of D1 genetic distance

between pairs of individual genotypes is shown in Fig. 3-4a, and the geographical

distribution of the two main clusters is shown in Fig. 3-4b. Dps produced similar results

(data not shown). The two main clusters plotted in Fig. 3-4b not only show a complete

lack of geographical segregation, but they also show extensive overlap.

Discussion

Mating System

The observed inbreeding rate as reflected by the fixation index (Fis) depends not

only on autogamy but also on pollinations between flowers from the same inflorescence

(geitonogamy), flowers on different ramets of the same genet (tillers), and, finally, the

genetic substructuring of the populations which increases biparental inbreeding (Ritland

1984, Brown 1989). While all these effects are confounded in populational data, as in

our case, there are indications that the selfing rate itself is very high.

The high intrapopulational genotypic differentiation observed in P. dilatatum ssp.

flavescens, coupled with extremely high fixation indices (Fis=0.97), suggests a lower

contribution of biparental inbreeding to the observed homozygosity in relation to the









actual selfing rate. Extensive observation of florets of this species during manual

hybridization suggests two mechanisms for such a high selfing rate. First, P. dilatatum

ssp.flavescens shows several characteristics that are typical of cleistogamous grasses

(Cambpell et al. 1983): stigmata and stamen filaments are relatively short in reference to

floret dimensions when compared to other biotypes of the species, and anther dehiscence

occurs immediately after or during anthesis. Furthermore, one, two or all three anthers

have been often observed to remain within the floret during and after anthesis, while

stigmata barely protrude outside the spikelet. Frankel and Galun (1977) classified this

mechanism as functional autogamy, and it has frequently been observed in grasses. The

second mechanism involves anthesis prior to emergence of the panicle from the sheath;

this has been more frequently observed for the first one or two racemes of the panicle.

Campbell et al. (1983) listed this mechanism as Type Ia and considers that cleistogamy in

these cases may be mostly an environmental response. In agreement with field and

greenhouse observations in P. dilatatum, factors such as light, temperature and moisture

have been reported to affect anthesis and panicle emergence (Campbell et al. 1983). For

a warm-season grass with an extended reproductive phase like P. dilatatum,

environmental responses could cause wide seasonal variations in selfing rates. Delayed

anthesis and faster culm elongation in the early spring under cool temperatures and no

moisture restrictions may increase the probability of outcrossing.

Genetic Differentiation and Geographical Structure

Genetic differentiation overall is very high in P. dilatatum ssp. flavescens. FST

estimates for continuous populations in which autogamy is thought to be the main factor

contributing to structuring have been reported to vary between 0.29 and 0.78 (Heywood

1981). The current sample of P. dilatatum ssp. flavescens was mostly collected in









disturbed environments such as roadsides, and seed morphology suggests dispersion by

gravity. These two factors, together with the observed selfing rates, contribute to a high

expectation for population subdivision (Loveless and Hamrick 1984). Hamrick and Godt

(1990) estimated a proportion of total genetic diversity among populations of 0.51 for 78

selfing species analyzed with isozymes, whereas their estimates for outcrossing species

vary between 0.1 and 0.2 depending on the mode of seed dispersion. Our FST estimate of

0.54 is therefore high and reflects the biological characteristics of the species. In our data

set, non-overlapping allele size distributions in variable populations suggest the presence

of informative non-random distribution of allele sizes. Regardless of the exact

evolutionary model each microsatellite locus follows, the process seems to retain some

mutational memory that can be captured by RST much more efficiently than FST with the

resulting underestimation of overall genetic differentiation by the latter (Slatkin 1995). In

this case, however, the use of RST instead than FST as a distance measure in the AMOVA

did not significantly increase the estimate as expected. There are several possible reasons

for this. FST and RST estimates of genetic subdivision would converge in situations where

mutation plays a minor role in population differentiation in relation to drift (Slatkin

1995). Population and mating system dynamics leading to high levels of genetic drift and

recent long-distance dispersal of individuals or population expansion will then improve

the performance of FST relative to RST (Slatkin 1995, Estoup et al. 1998).

Under a strict stepwise mutation model, gaps in the allele-length distributions are

expected after severe drift, like that caused by small local effective population sizes or

founder effects followed by a rapid expansion of the population. With time, mutation is

expected to fill the gaps between the sampled alleles (Cornuet and Luikart 1996). Not









only were some large gaps detected in this sample, but also, in ranges in which allele

sizes are rather continuous, the distributions were multimodal, with very low frequencies

for the intervening length categories. It could be argued that microsatellites have not

been observed to follow a strict stepwise mutation model. It seems reasonable to assume

that a mixed model (Di Rienzo 1994) is most realistic. Direct observation of

microsatellite mutations in maize has shown a majority of single-step length increase

events and fewer greater downward mutations (Vigouroux 2002). Observed allele-size

frequency distributions in self-pollinated Arabidopsis thaliana show continuous, mostly

unimodal distributions, especially for loci with a high number of perfect repeats

(Symonds and Lloyd 2003). In P. dilatatum ssp.flavescens, loci with very long perfect

repeat tracts like Pdfll5 and Pdfl6 (Chapter 2) show clearly discontinuous multimodal

distributions. It follows then that observed mutation patterns alone would not fully

explain the allele-size distributions observed in this sample.

The lack of correlation between geographical and genetic distance also supports a

scenario in which drift or long-range dispersal dominates the genetic dynamics of the

population. No correlation or clear geographical pattern was observed with population or

individual genotype data. Furthermore, the geographical distribution of identical

genotypes shared by several populations did not show geographical clustering (data not

shown).

It has been shown, particularly in selfing grasses, that molecular marker diversity,

either allozymes or microsatellites, could reflect the effects of selection (Allard 1972,

Nevo 1998, Li 2000). Rare hybridization events or long-distance dispersal can trigger

rapid genotype turnover at a particular site or microsite. Seemingly continuous









populations may then harbor widely divergent locally adapted genotypes whose

relatedness would not be reflected by neutral molecular markers. Green et al. (2001),

working at a more detailed spatial scale than in this study, found admixtures of highly

divergent microsatellite genotypes in Anisantha sterilis, a selfing weedy grass. Selection,

migration and temporal variation in the mating system were invoked as possible causes

for the lack of spatial genetic structure and persistence of divergent genotypes within

populations.

The great majority of our accessions were collected on roadsides; for two main

reasons: first, no dense stands of this subspecies are commonly found in other

environments, and second, P. dilatatum ssp. dilatatum is found almost continuously in

nearly all areas in Uruguay and almost always where P. dilatatum ssp.flavescens is

found. Distinguishing between subspecies in the field is not easy unless panicles are

present. Except for vacant lots in urban areas, most of the country is under grazing by

cattle, and panicles of P. dilatatum ssp.flavescens are seldom observed under grazing. In

fact, P. dilatatum ssp.flavescens may be largely excluded by grazing. Road construction,

shoulder leveling and periodical mowing of the roadsides are three types of events that

can strongly affect population dynamics. Construction may provide an opportunity for

long-distance dispersal or severe local bottlenecks. The plant cover of a road

construction site is completely cleared, creating open environments for colonization. The

seeds of the future colonizers may be brought from variable distances depending on the

origin of the gravel that is used or the application of turf patches to the barren slopes that

are created. Particularly in secondary roads, many stands of this subspecies extend into

the gravel shoulders and even into minor cracks in the asphalt itself. Shoulder leveling in









these areas necessarily involves uprooting and dragging whole or big portions of P.

dilatatum ssp.flavescens stands over variable distances. On main roads, the roadsides

also are periodically mowed with inevitable movement of panicles and seeds. From a

long-term perspective, species composition in Uruguayan grasslands has been greatly

influenced by the introduction of cattle in the 17th century. Rodriguez et al. (2003) have

shown that during a ten-year grazing exclusion, dominant grass types in a Uruguayan

grassland rapidly shifted from prostrate warm-season species to cool-season erect types

with narrow leaves and bigger seeds. Grazing patterns must have been changing

continuously due to the gradual replacement of Pampas deer by cattle. Pampas deer

(Ozotoceros bezoarticus) were still abundant at the beginning of the 19th century (Darwin

1839), while they are currently restricted to only two small populations in the whole

country (Gonzalez et al. 1998). Altesor et al. (1998) have in turn reported dramatic

floristic change for the same site during 55 years under continuous grazing. It is clear

that the impact of grazing in Uruguay during the last four centuries must have been and

still is strong, particularly on erect grasses like P. dilatatum ssp.flavescens. It can be

hypothesized that the subspecies may have suffered a strong bottleneck after the

introduction of cattle followed by relatively recent recolonization of the fenced roadsides.

This event, coupled with the present short-term effects of roadside habitats on population

dynamics and dispersal, sufficiently accounts for the lack of geographical structuring,

lack of mutational memory evidenced by the low RST values, and discontinuous allele

size distributions.














CHAPTER 4
EVOLUTIONARY RELATIONSHIPS AND MECHANISMS IN THE DILATATA
GROUP (PASPALUM, POACEAE)

Introduction

The genus Paspalum contains approximately 350 to 400 species (Clayton and

Reinvoize 1986) and has traditionally been divided into informal groups (Chase 1929).

The Dilatata group of Paspalum contains several species with great forage potential, and

several of them have been used as forage crops (Skerman and Riveros 1992). Paspalum

dilatatum Poir. and its related species are warm-season grasses native to the grasslands of

temperate South America and they are well adapted to resist frequent frosts during the

winter (Burson et al. 1991, da Costa and Scheffer-Basso 2003). This environmental

adaptability has allowed some members of the group, particularly P. dilatatum ssp.

dilatatum and P. urvillei Steud., to reach worldwide distributions wherever a warm-

temperate climate combined with sufficient rainfall exist.

The members of the Dilatata group have been classified into several formal and

informal taxonomic categories that will be referred to as biotypes in this study. The

common biotype of P. dilatatum (P. dilatatum ssp. dilatatum) is a complex apomictic

pentaploid hybrid, and efforts to identify its putative ancestors have led, over several

decades, to the accumulation of abundant cytogenetic information about the relationships

among all the species and biotypes within the Dilatata group. The conclusions of a whole

era of cytogenetic analysis based on meiotic studies in interspecific hybrids are

summarized in Table 4-1.











Table 4-1. Genomic formulae and reproductive systems of the members of the Dilatata
group
2n Genomic
Species or biotype 2n Genomic Author* Reproductive system**
(x 10) Formula
dilatatum ssp. 50 IIJJX Burson (1983) Apomictic (Bashaw and Holt 1958)
dilatatum
P. dlatatumssp. 40 IIJJ Burson et al. (1973) Sexual
flavescens
P. dasypleurum 40 IIJJ Quarin et al. (1995) Sexual

P. urvillet 40 IIJJ Burson (1979) Sexual
P. dilatatum 40 IIJJ Caponio et al. (1990) Sexual
Virasoro
P. dlatatum
P. dilatat40 IIJJ Quarin et al. (1993 unpub). Sexual
Vacaria
P. dilatatum 60 I X Burson (1991) Facultative apomict (Burson et al. 1991,
"Chirui" 60 IIJJXX Burson (1991) Millot 1977)
"Chinru" Millot 1977)
P. dilatatum 60 IIJJXX2 Burson (1992) Apomictic (Burson et al. 1991)
Uruguaiana
P. dilatatum Torres 60 ? Apomictic (Burson et al. 1991)

P. paucicilatum 40 AA1BC Moraes Fernandes et al. (1968) Apomictic

* Authorities are given for the publication of the genomic formula.
**Authorities are given for works that specifically addressed the reproductive system. All
sexual biotypes have been crossed, and sexuality is well established.


At least two attempts have been made previously to present the Dilatata complex in


a comprehensive way, including hypotheses on the relationships among its members.


Moraes Fernandes et al. (1968) did not provide genomic formulae but deduced genomic


architectures from meiotic behavior. They represented the genomic architectures in terms


of the number of copies of entire genomes which were assigned letters that do not


necessarily signify homology across biotypes. A number of biotypes were described in


this work, including the pentaploid apomictic common form (P. dilatatum ssp.


dilatatum), the Uruguaiana and Torres hexaploid biotypes, P. pauciciliatum and the


sexual tetraploid biotype of P. dilatatum now known as Vacaria. The latter was not


differentiated from the "yellow anthered" form (P. dilatatum ssp. flavescens) which had


previously been described by Bashaw and Forbes (1958). The common pentaploid


biotype (AABBC) was hypothesized to have arisen as a 2n+n hybrid involving a









tetraploid form and a diploid genome donor, or alternatively, as the product of an

allotetraploid and an allohexaploid sharing the A and B genomes. The hexaploid

Uruguaiana (AAAiA1BB) was proposed to be a 2n+n hybrid between two tetraploids,

and P. pauciciliatum (AAiBC) was hypothesized to be a hybrid between two tetraploids

with one partially homologous genome. Finally, the completely asynaptic Torres

(2n=6x=60) was hypothesized to be a putative hybrid between a tetraploid P. dilatatum

and an octoploid cytotype of P. virgatum with which it is sympatric and may share

morphological similarities. This hypothesis, however, does not explain the lack of

chromosome pairing in Torres given that variations of the IIJJ genomic formula have

later been assigned to tetraploid P. dilatatum sexual biotypes and tetraploid P. virgatum

(Burson et al. 1982).

An extensive program of interspecific hybridizations undertaken during the 1970s

provided the foundations for the current assignment of genomic homologies within the

group. Burson (1983) summarized this information including genomic formulae and

putative diploid donors for the component genomes. The sexual tetraploids were

assigned the IIJJ genomic formula, and they were hypothesized to have originated

independently from the diploid sources for these genomes. The diploid genome donors

were thought to be P. intermedium and P. juergensii, respectively (Burson 1978, 1979).

Several other putative I genome donors have been identified since then (Quarin and

Normann 1990, Caponio and Quarin 1993). The phylogenetic relationships among these

putative genome donors have recently been shown to be complex, spanning a

polyphyletic array of species (Vaio et al. 2005), and the identity of the direct donor of the









I genome has not been clarified yet. It is likely that new additional sources of the I

genome will be identified in the future.

In the arrangement presented by Burson (1983), the pentaploid biotype was thought

to be derived from a cross between P. dilatatum ssp.flavescens (IIJJ) and an unknown

hexaploid with the IIJJXX genomic formula. A hexaploid with the appropriate meiotic

behavior was described in Uruguay (Albicette 1980), and later, this hexaploid was found

to possess the predicted IIJJXX genomic formula (Burson 1991). Because Paspalum

species in general have very small genomes (Jarret et al. 1995), chromosomes are

generally small and relatively featureless; as a consequence, all of the cytogenetic work

relied solely on chromosome numbers and pairing in interspecific hybrids. Only recently

have prometaphase karyotypes been used as a source of phylogenetic information in the

genus (Speranza et al. 2003, Vaio et al. 2005). However, assessing relationships between

specific fixed apomicts requires techniques that can identify individual clones as putative

parents. For this approach multiple accessions of each biotype must be used to account

for variability. Complete collections of all the biotypes are not currently available.

Despite the lack of a comprehensive sample of all biotypes, an effort was made to

assemble a collection representing, at least partly, some of the variability within all of the

biotypes. A set of microsatellite markers developed for P. dilatatum ssp. flavescens

(Chapter 2) was used to describe the relationships among the apomictic biotypes of the

Dilatata group, find evidence of multiple origins or variability within them, and assess

their putative relationships with the sexual tetraploids. The variability and putative

evolutionary patterns within the common pentaploid biotype P. dilatatum ssp. dilatatum









will be discussed in depth elsewhere; here this biotype will be represented by a few

common genotypes.

Materials and Methods

Plant Material

Seeds were retrieved from the USDA Plant Introduction Station (Griffin, Georgia,

USA) and the Germplasm Bank at the Facultad de Agronomia, University of the

Republic, Uruguay (Table 2). Seeds of P. dasypleurum were kindly provided by Ing.

For. R. Vergara from the Universidad Austral de Chile, and leaf material of an additional

accession of P. dilatatum Virasoro was provided by Dr. G. H. Rua from the Universidad

de Buenos Aires, Argentina. All four accessions ofP. dilatatum Chiru come from the

location indicated in Figure 4-1 and represent 4 different clusters of plants up to 2 km

apart. The heptaploid clone 59B ofPaspalum dilatatum was collected near Villa Serrana

(Lavalleja, Uruguay) in 1997. The site was revisited in 2000, and the same individual

was identified and recollected. Samples of both P. dilatatum ssp. dilatatum and P.

dilatatum ssp.flavescens from the same site were included in this study. Silica-gel dried

leaves of two triploid clones (N.A. 7663 and 7608) and a diploid individual (N.A. 7623)

were used to represent P. quadrifarium.

Accessions were classified by biotype at the Facultad de Agronomia, Uruguay, but

a preliminary biotype assignment for the USDA material was made based on field notes

except for previously described accessions (mostly Burson et al. 1991). Plants were

grown to the reproductive stage, and biotype assignments were corrected or confirmed by

chromosome counting whenever morphology did not agree with field notes.

Chromosome counts were made as described in Speranza et al. (2003). Briefly, root tips

were treated with 2mM 8-hydroxyquinoline for 4 h, fixed in 3:1 (ethanol: acetic acid) for











at least 24 h and stored in 70% ethanol at 40C. After fixation root tips were digested in


4% (w/v) cellulase (Calbiochem) and 4% (v/v) pectinase (Sigma), squashed and stained


with lacto-propionic (1:1) orcein.


-75o -65 -545o



o

o -300
S + Atlantic Ocean
M \ A A


0 / P dilatatum Vacana
0 P dasypleurum -350
Sbo O P Dilatatum Virasoro
o /e p 0 P dilatatum ssp flavescens
SP dilatatum ssp dilatatum
SP dilatatum clone 2
X P urville/
+ P pauciciliatum
A P dilatatum Urugualana
A P dilatatum Chin -40o
S dilatatum Torres
P dilatatum 59B


Fig. 4-1. Geographical distribution of the accessions

DNA Extraction and Microsatellite Analysis

Fresh leaves were collected and DNA extracted with Sigma GeneluteTM kit (Sigma-


Aldrich, St. Louis, MO). Microsatellite amplification and separation were carried out as


described in Chapter 2. Eleven primer pairs designed for nuclear microsatellites (Table


4-3) and chloroplast microsatellite primer pair cpDilB were chosen from those reported in


Chapter 2. Microsatellite amplification, separation, and detection were performed as


described in Chapter 3. Extended forward primers with an M13 tail were used in


combination with labeled M13 forward primers. Three different fluorochrome labels


were used (D2, D3, and D4, Beckman Coulter, Fullerton, CA). Chromatograms were


visualized on CEQ TM Genetic Analysis system software (Beckman Coulter, Fullerton,


CA) and scored manually.











Data Analysis

Alleles in complex patterns were assigned to loci based on the approach given in


Chapter 2 for all biotypes that are known to contain a basic IIJJ genome assemblage. For


P. pauciciliatum, assignment was preliminarily made the same way. In the case of P.


dilatatum Torres, homology assessment was not attempted, and the data are presented


only graphically by primer pair. For P. dilatatum Uruguaiana and P. dilatatum 59B,


assignment was made a posteriori.


Table 4-2. Accession numbers of the materials retrieved from germplasm banks used to
analyze the relationships among the different biotypes
P. dilatatum Chini P. dilatatum ssp.flavescens P. urvillel
N.A.7537* N.A.7493 PI 462305
N.A.7662* N.A.7494 PI 462306
N.A.7672* N.A.7495 PI 509008
N.A.7359* N.A.7363 PI 509009
P. dilatatum ssp. dilatatum N.A.7364 PI 509010
N.A.7673* N.A.7433 PI 509012
N.A.7542* N.A.7434 PI 509013
N.A.7365* N.A.7355 PI 164065
P. dilatatum clone 2 N.A.7438 N.A.2957
PI310044* N.A.7441 N.A.7392
P. dilatatum clone 59B N.A.7468 NA 7390
N.A.7686* N.A.7470 N.A.7389
P. dilatatum Torres N.A.7474 PI 203752
N.A.7196* N.A.7475 N.A.7199
PI 404439** N.A.7476 P. dilatatum Vacaria
P. pauciciliatum N.A.7486 PI 404398
NA 7533* N.A.7492 PI404388*
PI310222* PI508723 PI404370
N.A.2500* PI 508720 PI 404382
PI310214* PI 508716 PI404372
P. dilatatum Uruguaiana PI 508722* PI 404434
N.A.7527* P. dilatatum Virasoro PI 508689*
PI404444** N.A.7207 PI404436*


Microsatellite data were summarized using MSAnalyzer (Dieringer and Shloterer


2002). Multilocus fixation indices (Fis), genetic diversity (He), and population


differentiation tests (Goudet et al. 1996) for the tetraploid biotypes were performed with


Genepop (http://wbiomed.curtin.edu.au/genepop/).









The distribution of microsatellite variance between and within sexual biotypes was

assessed with AMOVA (Excoffier et al. 1992) as performed by Arlequin (Schneider,

Roessli, and Excoffier 2000). The same program was used to compute Slatkin's

linearized distances (Slatkin 1995) to analyze the similarities among the tetraploids. For

Vacaria and P. urvillei, Mantel tests (Mantel 1967) were performed to test isolation by

distance between the geographical distance matrices and both average squared distance

(6[t)2 (Goldstein et al. 1995) and proportion of shared alleles (Dps) (Bowcock 1994).

Distance matrices were produced by MSAnalyzer. Both the Mantel tests and the

geographical distance matrices were obtained with Passage (Rosenberg 2001) from the

geographical coordinates of accessions.

The ancestry and possible admixture of apomicts and their contributions to hybrids

were analyzed using Structure (Pritchard et al. 2000). The ancestry model was set to

admixture, and population information was only used as a starting point. All further

simulations were performed based solely on the genotype of each individual. The

number of clusters (K) was set to 5 to represent the five known tetraploids in the group.

Otherwise all the default options were left in effect. Simulations were carried out for

50000 burn-in runs followed by 100,000 MCMC generations.

Results

Variability in the Tetraploids

Among the three biotypes that were best represented in this data set, P. urvillei was

the most variable for all loci except Pdfl4 and Pdfl7, and Vacaria had the lowest Fis in

spite of having the lowest gene diversity (Table 4-3). These two biotypes show rather

high fixation indices (0.793 and 0.734, respectively). To analyze whether at least part of

the Fis values found for P. urvillei and Vacaria can be attributed to isolation by distance,









Mantel tests were performed between genetic and geographical distance matrices for both

biotypes, but no significant correlations were found (data not shown). The lowest Fis

over all the tetraploids was estimated for P. dasypleurum, although this value could be

highly biased because two individuals were available. The two individuals of Virasoro

were also completely homozygous. The breeding system and population structure of P.

dilatatum ssp.flavescens was studied in detail elsewhere (Chapter 3) and will not be

discussed here.

Samples of P. dilatatum ssp.flavescens from both Argentina and Uruguay were

included in this study; however, all the alleles found in the Argentinean accessions were

also present in the Uruguayan populations, and all individuals within the biotype were

assigned to the same population cluster by Structure (Fig. 4-2). The five tetraploid

biotypes were well differentiated based on the AMOVA, with a highly significant 89% of

the variability found among biotypes (Table 4-4). The exact test of population

differentiation also showed highly significant differentiation for all population pairs (not

shown).

The results obtained with Structure generally assigned all individuals within each

biotype to the same population cluster, showing very clear differentiation among the five

tetraploid biotypes and significant admixture only for one individual in Vacaria and some

components of Vacaria within P. urvillei (Fig. 4-2). Some admixture of P. dasypleurum

within P. urvillei in one individual was also estimated. Finally, no variability for the

chloroplast marker cpDilB was found within biotypes except for one individual of P.

urvillei that showed the chloroplast haplotype found in P. dilatatum (Table 4-3).










58





Table 4-3. Summary of the microsatellite data for the sexual tetraploid biotypes of

Paspalum group Dilatata and genotypes for the apomictic biotypes.


Biotype or
Species

2n (x-10)
Na
Locus Hb
Pdflll H,'
Ad
Range
Ho
Pdfl4 H,
A
Range
Ho
Pdfl8 H,
A
Range
Ho
Pdfl28 H,
A
Range
Ho
Pdfll5b H,
A
Range
Ho
Pdfll5 H,
A
Range
Ho
Pdfl22 H,
A
Range
Ho
Pdfl7 H,
A
Range
Ho
PdfllO H,
A
Range
Ho
Pdfl20b H,
A
Range
Ho
Pdfl20 H,
A
Range
Ho
Pdfll2 H,
A
Range
Ho
Pdfll2b H,
A
Range
Ho
Pdfll8 H,
A
Range
cpDilB


Pd Pd ssp
cilhatum Chi ddatatum
6x 5x
4 3


172 174
172 176 180


ePd
Umguaiana
6x
2



180


P
quadrifarium
3x
2


172 172
176 176


P
dasypleurum
4x
2
0
0
1
174
0
0
1
212
0
0
1
230
0
0
1
200
0500
0500
2
210-212
nd
nd
nd
nd
0500
0500
2
214-220
0
0
1
241
0
0667
2
227-237
05
05
2
199-200
0
0
1
215
0
0
1
212
0
0
1
201
0
0667
2
264-266
216


P d ssp
flavescens
4x
21
0
0070
2
176-180
0036
0492
4
202-232
0
0314
3
236-240
0
0857
10
244-274
0
0
1
212
0036
0776
8
216-282
0
0 701
5
214-228
0
0
1
257
0
0512
4
225-229
0
0590
3
197-199
0
0543
3
235-239
0
0486
2
235-241
0
0
1
201
0
0491
3
236-254
217


urviller
4x
14
0071
0690
4
172-180
0
0349
2
202-204
0 143
0 746
6
198-244
0357
0 722
5
194-202
0
0 148
2
202-212
0 154
0942
12
244-353
0286
0876
11
184-260
0
0
1
251
0091
0835
8
181-229
0
0561
3
196-203
0077
0594
5
208-263
0
0571
4
221-233
0286
0254
2
201-210
0214
0807
7
252-304
218/217


Pd
Vacana

4x
8
0
0
1
176
0 125
0 125
2
204-210
0250
0 700
5
218-236
0
04
2
194-200
0
0
1
212
0 125
0775
5
243-250
0 125
0 125
2
196-240
0 125
0325
2
249-251
0 125
0692
4
195-227
0
0
1
199
0 125
0758
4
211-273
0
0
1
174
0
0
1
201
0 125
0 125
2
254-260
217


Pd P
Virasoro pauc
4x 4x
2 4
0
0
1
172 172
0
0
1
198 206
0
0
1
230 247
0
0
1
188 188
0
0
1
214 214
0
0667
2
228-242 -
0
0667
2
194-196 196
0
0
1 219
233 231
0
0
1
181 179
0
0
1 190
201 201
0
0
1
221 225/2


187 199
201 201


219 217
27 223 233


222
224 221 235


201 201 201
210 210 210


258
308
217 213


208
206
187
187 204 204


219
207 241


224 224
230 226


230 230
217 217


FIs 0 571
He 0269
a Sample size.


0988 0 793 0 734 1 000
0424 0641 0302 0167


b Observed number of heterozygotes.

c Gene diversity.
d Number of alleles.

e Only the alleles not present in common


P. dilatatum ssp. dilatatum are shown here. The


alleles shared with P. dilatatum ssp. dilatatum are shown in Fig. 4-2.


P
quadrifartum
2x
I


196 202
206 204


230 230
234 238


188 198
198 200


212
214 214


234 222/224
264 226/242/250


184 186
196 196


233 235
237 257


241 225


181
181 203/20;













90%
80%
70%
60%
50%
40%
30%
20%
10%
no%


"0
F m ssp flavescens P urvillel Vacarla 2






Fig. 4-2. Population structure of a sample of the members of the Dilatata group estimated
by Structure under the admixture model based on microsatellite data for 13
loci. Each color represents the contribution to each genotype of each one of
the five clusters generated

If the five tetraploid biotypes were derived from a single ancestral population, and


given that a strong ascertainment bias could not be detected within this group (Chapter


3), Slatkin's linearized RST would represent relative divergence times between pairs of


biotypes. RST distances are expected to be linearly related to evolutionary divergence


time and could be used to estimate phylogenetic relationships among the biotypes. A


UPGMA tree based on linearized RST is shown in Fig. 4-3a. Under this hypothesis,


biotypes Vacaria and Virasoro are very similar, while P. dasypleurum and P. urvillei


form a tight cluster to which P. dilatatum ssp.flavescens attaches. In this result, P.


dilatatum as currently delimited can still be considered monophyletic with P. dilatatum


ssp. flavescens very close to a sister clade formed by P. urvillei and P. dasypleurum.


To circumvent the reliance of the RST-based measures on a stepwise mutational


model of microsatellites, the proportion of shared alleles (Dps) was also used as a distance


measure. The UPGMA phenogram based on Dps shows high distance estimates for all


population pairs with the nearest pair (P. dasypleurum-Vacaria) joined at a distance of


--










0.77 (Fig. 4-3b). The arrangement of the biotypes is completely different from that

obtained with RST. In this case all the possible rooting options would nest either P.

dasypleurum or P. urvillei within P. dilatatum.


30 24 18 12

Linearized RST


Virasoro

Vacaria

dasypleurum

urvillei

flavescens

6 0


Virasoro


urvillei


dasypleurum


Vacaria


flavescens


0.96 0.8 0.64 0.48

Dps


0.32 0.16 0


Fig. 4-3. UPGMA phenograms of the distances among the sexual tetraploid biotypes of
the Dilatata group based on 13 microsatellite loci obtained with different
distance measures a. Linearized RST b. Proportion of shared alleles

Variability in the Apomicts

P. pauciciliatum and P. dilatatum Chiru, Uruguaiana (Table 4-3), and Torres (not

shown) appeared as single clones; individuals within each biotype share a number of









heterozygous allele combinations ranging from a minimum of 4 in P. pauciciliatum to 13

among the different accessions ofP. dilatatum ssp. dilatatum. Within Torres and Chiri,

no differences were detected among accessions, and the single genotypes found are

shown in Fig. 4-3. In the case of pentaploid P. dilatatum, two clearly different clones

were identified among the individuals reported here, a typical, widespread clone and a

second clone referred to here as P. dilatatum clone 2 (Fig. 4-4). On the other hand,

mostly in typical P. dilatatum ssp. dilatatum (Table 4-3) and Uruguaiana (Fig. 4-4),

individuals differ by a small number of allele length differences attributable to mutation.

Most of this variability is restricted to the longer alleles of loci PdfllO and Pdfll5 (Table

4-3 and Fig. 4-3). The highly variable longer allele in locus Pdfll5 showed a different

length in each of the 3 individuals of typical pentaploid P. dilatatum presented here

(Table 4-3). Due to its extreme instability, this locus was not used in any of the

comparisons among biotypes.

Relationships among Apomicts

Paspalum. dilatatum clone 59B and Uruguaiana share 11 or 12 heterozygote allele

combinations with the typical clone of P. dilatatum ssp. dilatatum, and differences are

again restricted to the longer alleles of loci PdfllO (Fig. 4-3) and Pdfll5 (not shown). If

these shared bands are interpreted to be homologous, the "extra" bands (Table 4-3) can

be assumed to be located on the extra 10 chromosomes (Burson's (1995) X2 genome).

All these bands were also found in the two triploid P. quadrifarium clones (Table 4-3)

except for the 180-bp band in locus Pdfll 1 shared by both Uruguaiana and 59B.








62



315


305


295

Pdfll 1
285 Pdfl4 (+100bp)
Pdfl8
275 Pdfl28-1
Pdfl15-2
Pdf122-1
265 1 1 Pdfl7
SPdfl20-2
255 -Pdfll2-1
1 Pdfl12-2
1 Pdfl20-1 (5Obp)
245 Pdfll0
1 m Pdfll8
S235


225


215


205


195


185


175
-6 -----------------

165









Fig. 4-4. Multilocus genotypes of the apomictic components of the Dilatata group


Chiri, P. pauciciliatum, and P. dilatatum clone 2 clearly share a significant


proportion of bands with Virasoro; however, Chiri contains alleles that cannot be directly


attributed to its putative Virasoro ancestry. The typical P. dilatatum ssp. dilatatum, on


the other hand, appears to contain alleles that can be assigned to P. dilatatum ssp.


flavescens (Fig. 4-2). The putative contributions of Virasoro, Chiri, and P. dilatatum


clone 2 to other biotypes are confounded because they all share a significant proportion


of alleles themselves (Fig. 4-2). Chiri and P. dilatatum clone 2 share 6 out of 8









heterozygous allele combinations making the likelihood of a sexual event linking the two

very low.

All the apomicts except Torres shared a 170-bp allele in locus Pdfl28b and a 177-

bp allele in locus Pdfl20c which are thought to be located on the X genome (Chapter 2).

Torres does not show the 177-bp band in locus Pdfl20c and it shows a 218-bp allele in

the chloroplast locus cpDilB instead of the 217-bp allele found in the other biotypes of P.

dilatatum. Torres frequently showed more alleles in the nuclear loci than the biotypes

known to be built on the basic IIJJ combination of the group. Alleles were scored to

maximize its similarity to other biotypes in the data set. This approach makes sense if the

asynaptic behavior of Torres is due to lack of chromosome homology and is not under

genetic control. In this case, if Torres is part of the Dilatata group, it can only contain

one copy of each of the I and J genomes. Even following this strategy, it is not possible

to derive all of its alleles from any other apomict in the group. In spite of this, at least

one allele from each of nine loci can be traced to one of the two clones of pentaploid P.

dilatatum (Fig. 4-3).

Heterozygosity of the Apomicts

The degree of heterozygosity in the apomicts is variable. Typical P. dilatatum ssp.

dilatatum is heterozygous for every locus, while Chirf and P. dilatatum clone 2 show

lower levels of heterozygosity (Fig. 4-3). In the case of P. pauciciliatum, half of the loci

located on an I or J genome are expected to be hemizygous because its genomic

architecture does not allow for two copies of both genomes, so the observed presence of

only one band at several loci cannot be reported as homozygosity as was done for Chirf

and P. dilatatum clone 2. A similar situation is found in Torres in which only PdfllO

amplified a single band (Fig. 4-3). In fact, based solely on its asynaptic meiotic behavior,









all the bands amplified by a single primer pair should be reported as homeologous and

the genotype as completely hemizygous.

Discussion

Evolutionary relationships among the sexual tetraploid biotypes

The use of microsatellite data to assess phylogenetic relationships is questionable

(Garza et al. 1995, Doyle et al. 1998). Size homoplasy, stochastic effects of past

bottlenecks, allele size asymmetry, and the possibility that at least some of the biotypes

had independent origins (making a hierarchical hypothesis of relatedness meaningless)

are some of the concerns.

The effect of size homoplasy on population parameter estimates has been

frequently discussed, and its consequences have been modeled and predicted at the

populational level (Estoup 2002). Size homoplasy at the interspecific level has also long

been a concern (Doyle et al. 1998). On the other hand, the use of microsatellite data for

phylogeny reconstruction within species and between species has been tested against

other sources of information with relative success (Alvarez et al. 2001, Richard and

Thorpe 2001). In the present data set, however, it is rather the strong asymmetry in allele

sizes observed among the biotypes that raises the major concerns. This problem is in

some way related to the artifact known as ascertainment bias (Ellegren et al. 1995) where

the non-focal species appear as less variable due to the original selection of loci to show

long allele sizes in the focal species. It has been well established that the length of a

microsatellite allele is related to its variability and mutation rate (Symonds and Lloyd

2000). Once a microsatellite increases its length, it also increases its upward mutation

rate. One peculiarity of this microsatellite set as applied to the current group of species is

that different loci seem to have been amplified in different biotypes reaching higher allele









sizes associated with higher mutation rates (Pdfl 28 in P. dilatatum ssp. flavescens,

Pdfl22 in P. urvillei, and Pdfl20 in Vacaria) (Table 4-3). As a consequence, when

applying distance measures based on allele length, the biotypes not showing long allele

sizes at a particular locus necessarily appear as more similar to one another. However,

this artifactual similarity is in reality a symplesiomorphy in a phylogenetic context.

When applying a distance measure based only on the presence of identical alleles (Dps),

the larger alleles are not matched with those of other biotypes; these biotypes appear

similar to one another again based shared ancestral character states. This problem is

further evidenced by the high distance values among pair of biotypes obtained with Dps.

Alvarez et al. (2001) circumvented similar problems in Lycopersicon by using only loci

showing very low diversity indices (<0.25). If such a criterion were applied to this data

set, most information would be eliminated because the only loci showing diversity

indices near 0.25 are Pdfll5b, Pdfl7 and Pdfll2b, of which Pdfl7 is null in most P.

urvillei accessions.

The tetraploid components of the group have been previously proposed to have

originated independently (Burson 1983), a possibility that is somewhat supported by the

presence of fixed, non-shared chloroplast haplotypes among the three named species:

Paspalum urvillei, P. dasypleurum and P. dilatatum. This scenario is further supported

by the clear genetic differentiation in their nuclear microsatellite loci. With abundant

evidence accumulating for the recurrent formation of polyploids in the last years (D.

Soltis and P. Soltis 1993, P. Soltis and D. Soltis 2000), the independent formation of at

least some of these biotypes remains a likely possibility. Regardless of mode of origin of









the five sexual tetraploids, the hypotheses of relatedness presented in Figure 4-2 should

be interpreted with extreme caution.

On the other hand, evidence for ongoing gene flow was only found between

Vacaria and P. urvillei. Valls and Pozzobon (1987) reported, based on field observations,

that Vacaria formed natural hybrids with P. urvillei where their areas of distribution

overlapped, while natural hybrids have not been recorded between Virasoro or P.

dilatatum ssp.flavescens and P. urvillei. This gene flow apparently has not had strong

effects on the genetic identity of the involved biotypes which remain morphologically

and genetically distinct. Although more data are required to quantify any degree of gene

flow among the tetraploid biotypes ofP. dilatatum and analyze their morphological

differentiation in a systematic way, it seems clear that they form distinct units and should

all deserve at least formal subspecific status.

Genetic structure of the sexual tetraploids

The genetic structure of P. dilatatum ssp.flavescens has been discussed in detail

elsewhere (Chapter 3). For the other biotypes, the topic has been specifically addressed

only in Virasoro (Hickenbick et al. 1992). Hickenbick et al. (1992) concluded that both

selfing and cross-pollination must occur in this biotype based on segregating progenies

detected using isozyme markers. They also observed developing embryos in Virasoro

spikelets dissected prior to anthesis. In this study, the two individuals analyzed were

fully homozygous for the 13 loci, indicating a high level of homozygosity; however, very

few differences were detected between the two accessions scored, making it difficult to

detect the occurrence of allogamy. Paspalum dilatatum ssp.flavescens (Chapter 3) and

Virasoro show relatively shorter anthers and stigmata than the other biotypes,

characteristics that are usually considered morphological evidence of functional









autogamy (Frankel and Galun 1977, Campbell 1999). Paspalum urvillei, P. dasypleurum

and Vacaria showed lower levels of inbreeding. Even though isolation by distance could

not be demonstrated in this data set, it is likely that at least part of the observed

homozygosity may be due to crossing between individuals carrying the same alleles.

Variability within the apomicts

Paspalum dilatatum ssp. dilatatum was the only apomictic biotype that showed

evidence of containing more than a single clonal genotype. In spite of this, some

microsatellite variability was found within typical P. dilatatum ssp. dilatatum,

Uruguaiana and P. pauciciliatum. Such variability could be useful in assessing genetic

diversity and phylogeographic patterns in these rather widespread clones, especially in P.

dilatatum ssp. dilatatum.

The addition of the X genome, apomixis, and the origin of pentaploid P. dilatatum

Two different pathways have been suggested for the origin of the pentaploid IIJJX

biotype. The X genome could have been added to the group by means of a hexaploid

(IIJJXX) and then transferred to the pentaploids when this hexaploid crossed to a

tetraploid (IIJJ) (Burson 1983, Moraes Fernandes et al. 1968) or it could have been

directly added to form a pentaploid by a 2n+n hybridization between a tetraploid (IIJJ)

and an unrelated diploid (XX) (Moraes Fernandes et al. 1968). The data discussed above

show that the two hexaploid candidates identified so far are more likely explained as

derivatives than progenitors of the pentaploids. The second pathway invokes the

production of unreduced gametes by P. dilatatum tetraploids. Chloroplast sequence data

support the derivation of the maternal genome from within P. dilatatum rather than from

the donor of the X genome (Chapter 2). Production of unreduced gametes by tetraploids

has been observed (Speranza unpub. res.). One P. dilatatum ssp.flavescens individual,









when pollinated by Chiri produced several 2n+n (2n=7x=70) hybrids. The hybrids of the

same P. dilatatum ssp.flavescens individual by Virasoro (Chapter 2), when crossed with

Chiri also produced several 2n+n hybrids with 2n=7x=70. This time, the maternal plant

was expected to be highly heterozygous and its genotype can be inferred from the

segregation data shown in Chapter 2 for its progeny. Analysis of its 2n+n hybrids with

Chirn, however, did not show the transmission of any heterozygosity from its maternal

parent for several microsatellite loci (data not shown). This indicates that the unreduced

gametes were produced by some second division restitution (SDR)-like mechanism.

Even if the possibility cannot be rejected, no mechanism has been observed that can

explain the formation of a primary pentaploid by the contribution of a heterozygous

unreduced gamete by a heterozygous tetraploid. There are, however, in the present data

set, relatively homozygous pentaploids, namely P. dilatatum Clone 2. The level of

heterozygosity in the pentaploids is then variable. How did a heterozygous pentaploid

form if hexaploids are excluded as intermediaries? Existing pentaploid individuals have

the ability to transmit euploid IJX gametes and produce new IIJJX pentaploids when

crossed to an IIJJ tetraploid (Mazzella and Speranza 1997). The observed extreme

heterozygosity could have been gained by existing pentaploids by successive cycles of

crossing to other tetraploid members of the group. An extensive survey of the

intrabiotypic variability within P. dilatatum could provide further evidence of this

mechanism.

Paspalum dilatatum Uruguaiana and 59B

Both Uruguaiana and 59B share almost all of the heterozygous allele combinations

found in the widespread typical P. dilatatum ssp. dilatatum. As a consequence, their

mutual relationship and the relationship of both clones to the pentaploid biotype cannot









be explained by sexual events. Early pollination of pentaploid florets has been shown

lead to the fertilization of aposporic embryo sacs and the production of 2n+n hybrids

(Bennett et al. 1969, Espinoza and Quarin 2000, Burson 1992). Furthermore, a putative

donor of the alleles not present in the pentaploid parent has been identified here as P.

quadrifarium. This suggests that these two clones are 2n+n hybrids of pentaploid P.

dilatatum and a diploid or tetraploid individual of P. quadrifarium. The close

morphological and physiological similarity between Uruguaiana and pentaploid P.

dilatatum has been previously noted (Burson 1991). Furthermore, the spikelets of

Uruguaiana (and clone 59B) differ from those of the pentaploid biotype in that their

maximum width is located near the middle of the spikelet like those found in species of

the Quadrifaria group (Barreto 1966) rather than near the base as seen in P. dilatatum.

The two accessions of Uruguaiana analyzed here were collected more than 220 km apart,

and they differ at some microsatellite loci. These differences were interpreted as

mutations given that the alleles hypothesized to represent the X2 genome were identical

for the two locations. Its geographical range and the presence of mutations suggest that

Uruguaiana is not a recent derivative of pentaploid P. dilatatum and that several more

such hybrids could have been formed in a similar way. The finding of 59B, a single

hybrid of the same kind shows that the complex is active and still generating new

combinations at higher ploidy levels. Clone 59B is a single, highly sterile individual

found near Villa Serrana, Uruguay and it is likely to be the product of a contemporary

hybridization event. This plant was collected at the edge of a water stream that crosses a

secondary road. Clone 59B was growing among plants of P. dilatatum ssp.flavescens and

pentaploid P. dilatatum. Immediately next to 59B were several plants of P. exaltatum









which shares genomes with P. quadrifarium (Vaio et al. 2005) and several dispersed

individuals of P. quadrifarium. Spikelet morphology and the presence of P.

quadrifarium-specific bands in 59B strongly suggest that a species from the Quadrifaria

group could have contributed the extra genomes in 59B.

Paspalum dilatatum clone 2

This accession of P. dilatatum can be partially explained by a cross between

Virasoro and Chiru. Morphologically this accession seems to correspond to the putative

Virasoro x Uruguaiana hybrids reported by Machado et al. (2005). Even though

Uruguaiana is presently known to occur near the collection site of P. dilatatum clone 2,

its genotype does not support such parentage. On the other hand, Chiru is only known

from a relict population in Paysandu, Uruguay and Clone 2 was found in Brazil,

approximately 240 km NE of this location. A greater distribution range of Chiru in the

past or the still undetected occurrence of genotypes closely related to it in southern Brazil

must be invoked to explain this hybrid as the product of a tetraploid x hexaploid hybrid.

The reverse hypothesis where Chiru is a derivative of P. dilatatum clone 2 is considered

below.

Paspalum dilatatum Chiru

Chiru is closely related to Virasoro and less heterozygous than P. dilatatum ssp.

dilatatum and Uruguaiana. The involvement of Virasoro as the donor of the basic IIJJ

genomes seems evident; however, Chiru also shows alleles that cannot be explained by

the genotypes found in Virasoro, and given that Virasoro has been found to be highly

homozygous, it is not likely that the relationship between the two biotypes is direct. The

reverse pathway, i.e., the addition of an extra copy of the X genome to a P. dilatatum

clone 2 type individual in a fashion similar to that described for Uruguaiana, cannot be









excluded as the origin of Chirn. In fact, only the shorter allele in Pdfl 18 and the absence

of a second allele in locus Pdfll2 could not be explained this way. Under this scenario, P.

dilatatum clone 2 would be more widespread than detected here and Chiri would not be a

relict population of a formerly widespread biotype but a possibly recent 2n+n hybrid of

P. dilatatum clone 2. The only extra putative X genome allele found in Chiri is a 187 bp

allele at locus Pdfl20. This allele was also found in clone 59B, and it was attributed to its

P. quadrifarium parent. In the case of Chiri, this constitutes very weak evidence of the

origin of the X genome from within the Quadrifaria group.

Paspalum pauciciliatum

P. pauciciliatum appears to be very closely related to and is sympatric with both

Chiri and P. dilatatum clone 2. The contribution of a reduced IJX gamete from either P.

dilatatum biotype as a pollen donor could explain most of the alleles found in P.

pauciciliatum and even more so if one-step mutations are allowed. Its chloroplast

haplotype, however, is different from that of the other members of the Dilatata group.

This difference was detected only at the cpDilB locus whereas the chloroplast haplotype

of P. pauciciliatum is identical to that of the rest of the Dilatata group five non-coding

regions (Chapter 2). Its cytogenetic architecture (Moraes Fernandes et al.1968) implies

that one of its genomes is present in two copies. If the difference found in the chloroplast

genome is taken as evidence of an independent origin of its chloroplast genome, then its

maternal progenitor must be closely related to the diploid donor of either the I or J

genome to the Dilatata group but not the same individual or population. The maternal

progenitor should be responsible for the contribution of extra bands at loci Pdfl 18,

Pdfll2b and Pdfl7. Under this scenario, its genomic formula should be either IIJX or

IJJX.









Paspalum dilatatum Torres

Chloroplast DNA data strongly support the contribution of the maternal genome of

Torres from within the Dilatata group (Chapter 2). However, its chloroplast haplotype

corresponds to P. urvillei instead of that shared by all the other biotypes of P. dilatatum.

For 7 out of 13 loci analyzed Torres shows alleles also found within either the P.

dilatatum ssp. dilatatum-Uruguaiana complex or the Chiru-P. dilatatum clone 2 complex;

however, it lacks one of the markers of the X genome that is shared by all the other

apomicts including P. pauciciliatum. Its link to the rest of the group may be some

genotype of the highly variable P. urvillei. If Torres contains a copy of the I and the J

genomes, as suggested by its similarities to P. urvillei, then its other genomes must not

come from another member of the group based on the lack of pairing of its chromosomes.

The relationship of this biotype to the rest of the group cannot be completely clarified

based on this data set and the task would probably require analyzing species belonging to

other taxonomic groups.

Conclusions

This study has established a series of evolutionary hypotheses within the Dilatata

group which will dramatically change the future direction of both basic and applied

research within this group.

1. Both nuclear and chloroplast markers show that the five sexual tetraploids studied
here are well differentiated and do not show significant gene flow except for P.
urvillei and Vacaria.

2. The Uruguayan and Argentinean accessions of P. dilatatum ssp.flavescens form a
single coherent unit.

3. P. dilatatum ssp.flavescens and Virasoro appear highly homozygous, in agreement
with floret morphology and previous reports. P. urvillei, Vacaria and P.
dasypleurum probably show higher degrees of allogamy.






73


4. No clear evidence was found to support the monophyly of the group.

5. The relationships among the sexual tetraploid biotypes could not be reliably
explained by the current data set.

6. Chloroplast haplotype differentiation is in agreement with current species
delimitations.

7. Uruguaiana, Chiru, Torres and P. pauciciliatum each appears to comprise a single
clone.

8. Pentaploid P. dilatatum comprises an assemblage of more than one clone.

9. Variability attributed to somatic mutations was found within Uruguaiana, P.
pauciciliatum and the typical clone of P. dilatatum for at least two loci, which can
be used for analyzing genetic structure within these clonal biotypes.

10. All of the apomicts in the group show the same alleles in the loci thought to reside
on the X genome, suggesting a single origin for this genome in the group.

11. All of the apomicts seem to contain at least one copy of each of the I, J and X
genomes.

12. The hexaploids and heptaploids are better explained as derivatives of the pentaploid
P. dilatatum rather than its ancestors.

13. Virasoro is the sexual tetraploid that shows the greatest degree of similarity to all of
the apomicts.

14. A genotype of pentaploid P. dilatatum derived from Virasoro might have been the
primary apomict in the group. Further pentaploid-tetraploid crosses may have
created the variability and the heterozygosity found in the apomicts.

15. The suggested mechanisms for the formation of new apomicts involve either an
unreduced female gamete or a euploid IJX pollen grain of pentaploid P. dilatatum.














CHAPTER 5
PENTAPLOID X TETRAPLOID HYBRIDIZATION CYCLES IN Paspalum dilatatum
(POACEAE): EXPLAINING THE CURRENT AND FUTURE EVOLUTIONARY
SUCCESS OF AN IMBALANCED POLYPLOID

Introduction

Paspalum dilatatum Poir. is a warm-season grass native to the grasslands of

temperate South America. This species is part of an informal taxonomic group within the

genus known as the Dilatata group (Chase 1929). Included in this group are several

sexual and apomictic biotypes and species whose evolutionary relationships have recently

been discussed in detail based on data from 13 microsatellite loci (Chapter 4). The sexual

members of the group (P. urvillei Steud., P. dasypleurum Kunze ex Desv., P. dilatatum

ssp.flavescens Roseng. Arr. et Izag., and biotypes Virasoro and Vacaria of P. dilatatum)

are all tetraploid and share the same genomic formula (IIJJ). The relationships among the

sexual tetraploids and between them and the apomicts have not been completely clarified;

however, microsatellite data suggest that Virasoro has greatly contributed to the genetic

makeup of the apomictic components (Chapter 4). Except for pentaploid P. dilatatum, the

rest of the apomicts in the group (P. dilatatum biotypes Uruguaiana, Chinr and Torres

(6x) and P. pauciciliatum (Parodi) Herter (4x)) seem to each comprise a single clone and

its mutational derivatives, and all of them have been hypothesized to be derivatives of the

pentaploid form (Chapter 4). In this context, the apomicts would all include at least one

copy of the I and J genomes and at least one copy of the third unassigned genome (X).

The pentaploid form (IIJJX) had previously been proposed to be the product of a cross

between a hexaploid (IIJJXX) and a tetraploid (IIJJ) (Burson 1983); however, the









transmission of an unaltered heterozygous multilocus genotype between pentaploids and

the hexaploids Chiru and Uruguaiana suggests that the latter may be more likely

derivatives of the pentaploid form by means of a 2n+n hybridization in which the

pentaploid contributed an unreduced gamete and the second X genome was contributed

by a diploid. Chloroplast sequence data suggest that the pentaploid probably acted as the

maternal progenitor in such crosses (Chapter 2, Chapter 4), a mechanism that had already

been reported experimentally (Bennett et al. 1969, Burson 1997). Genotypic information

for thirteen microsatellite loci suggests yet another mechanism by which the pentaploid

may be involved in the origin of the remaining apomicts, i.e., P. pauciciliatum, and at

least one recombinant pentaploid clone. The pentaploids are able to produce euploid IJX

pollen grains (Mazzella and Speranza 1995) which can fertilize a sexual tetraploid to

yield a recombinant pentaploid. Pentaploid P. dilatatum is not only the most widespread

biotype, but it also seems to have been the basis of the entire apomictic complex in the

group. It may have been involved in the origin of the other apomicts either by means of

unreduced female gametes or euploid IJX pollen grains, and it could be the original

carrier of the X genome. If the transmission of euploid IJX gametes is a frequent event,

then several more recombinant pentaploids like the one reported in Chapter 4 should be

found in the wild. Variability has been detected among pentaploid P. dilatatum

accessions with dominant markers (Casa et al. 2002); however, with this kind of markers,

and particularly for a small sample, clonal variants cannot be distinguished from

recombinants. Microsatellites have proven efficient in detecting recent hybridization

events and if recombinants are found it should be possible to infer their mode of origin

from their genotypes.









Regardless of its mode of origin or evolutionary role, pentaploid P. dilatatum is

currently distributed worldwide in warm-temperate regions of the north and south

hemispheres where it has become an important forage grass (Burson 1983, Skerman and

Riveros 1992). Because of this, there is great applied potential for the detection of genetic

variability in the available germplasm collections. Microsatellite markers can reveal

mutational variation that could be useful for assessing the extent and distribution of

mutational genetic variability within the typical form of this biotype (Chapter 2, Chapter

4).

In this study, an extensive collection of pentaploid P. dilatatum representing its

worldwide distribution has been retrieved from existing germplasm banks and analyzed

using microsatellite markers developed for P. dilatatum ssp. flavescens (Chapter 2) to

assess the level of variability.

Materials and Methods

Plant Material

Seeds of pentaploid P. dilatatum were retrieved from the USDA Plant Introduction

Station (Griffin, Georgia) and the Germplasm Bank at the Facultad de Agronomia,

University of the Republic, Uruguay. Accession numbers are given in Table 5-1.

Additional dry leaves from California, Texas, and Australia were kindly provided by M.

McMahon, J. Tate, and K. Smith, respectively.

Material retrieved from Georgia mostly contained populational samples. The

Uruguayan collection used in this study was mostly developed by myself between 1992

and 1999. This collection is composed primarily of single-plant progenies produced in

the greenhouse from off-type individuals collected in the field. Populations 1 and 3 had

been previously reported by Prof J.C. Millot (1997 pers. comm.) as variable based on









morphological evidence. These populations were collected as single individuals, and each

apomictic progeny kept under a different accession number (Table 5-1). Chromosome

numbers were determined for all the Uruguayan single-plant accessions by P. Speranza,

M. Vaio and C. Mazzella following the technique described in Speranza et al. (2003).

For the current study, full seeds were germinated in Petri dishes on filter paper.

Germinators were placed at 40C for 4 days prior to incubation to break dormancy and

homogenize germination and were then transferred to an incubator with alternating

temperatures (16 h at 300C light, 8 h at 200C dark). For eight populational samples with

good seed quality, eight individuals were grown per accession, otherwise only one

individual was kept in each case (Table 5-1). Plants were cultivated in greenhouse

conditions for at least one complete growth season and screened for contaminants or

biotype assignment errors at the reproductive stage. Chromosome numbers were

determined when the originally reported biotype assignment and morphological

appearance of a plant were in disagreement. Chromosome numbers were also determined

aposteriori for all putatively recombinant individuals (Table 5-1).

DNA Extraction and Microsatellite Analysis

Fresh leaves were collected in the greenhouse and DNA extracted with Sigma

GeneluteTM kit (Sigma-Aldrich, St. Louis, MO). Microsatellite amplification and

separation were carried out as described in Chapter 2. Eight primer pairs reported in

Chapter 2 were used in this study (Pdfl4, Pdfl7, Pdfl8, Pdfll0, Pdfll 1, Pdfll2, Pdfll5,

and Pdfl20). Fragment amplification was obtained for all individuals by varying the

amount of DNA added to the PCR mix between 0.5-3 tL. Extended forward primers with

an M13 tail were used in combination with labeled M13 forward primers. Three different

fluorochrome labels were used (D2, D3 and D4, Beckman Coulter, Fullerton, CA). PCR








78



products labeled with different dyes were combined, and 1 aL of the combined products


was loaded on a CEQ 8000 capillary sequencer (Beckman-Coulter, Fullerton, CA).


Chromatograms were visualized on CEQ TM Genetic Analysis system software (Beckman


Coulter, Fullerton, CA) and scored manually.


Table 5-1. Accession numbers, genotypes, and population of origin of the pentaploid P.
dilatatum material retrieved from germplasm banks. The number of
individuals analyzed per accession is indicated in parenthesis if it is more than
one. The genotypes/individuals for which the chromosome number was
confirmed or is first reported in this study are marked by an asterisk. A
population number is given in those cases in which more than one individual
from the same location was analyzed.
Accession Genotypes Population Accession Genotypes Accession Genotypes Population
N.A.7346 (8) A/RecC2*/RecC7* 7 PI 173004 M1 PI 410284 P1
N.A.7368 (8) P/V 2 PI 202298 G PI 410286 A
N.A.7404 A* PI 202300 A PI 410287 A
N.A.7416 L* PI 217623 A PI 462248 P
N.A.7430 Recbl* PI 222812 Al PI 462254 (8) A/Q 9
N.A.7440 (8) J/P/RecB4* 6 PI 235068 A PI462256 (8) P/T 4
N.A.7465 (4) I/P/RecB3* 1 PI 271592 A PI 462258 A
N.A.7471 O* PI 273255 A PI 462261 (8) RecC2* 10
N.A.7524 A* PI 274081 A PI 462262 P
N.A.7525 W* PI 283015 RecA2* PI 462264 A
N.A.7528 D* PI 285302 A PI 508671 U
N.A.7529 Y* 3 PI 300076 A PI 508676 P
N.A.7540 G* PI 300077 A PI 508682 P
N.A.7541 P* PI 304015 E* PI 508692 F
N.A.7542 A* 7 PI 310044 RecAl* PI 508694 D
N.A.7543 RecB2* PI 310076 RecC4* PI 508701 A
N.A.7544 A* PI 310077 N PI 508703 D
N.A.7545 P* PI 310078 P PI 508705 A
N.A.7562 (8) H* 8 PI 310083 D PI 508706 A
N.A.7563 (8) C/RecC1* 5 PI 310088 A PI508707 M
N.A.7588 I* PI 310091 M PI 508708 A
N.A.7606 P* PI 331112 A PI 508712 B
N.A.7609 RecC3* 3 PI 338660 A PI 508715 A*
N.A.7613 A* PI 404394 P PI 508719 G
N.A.7618 RecC6* PI 404410 T PI 508725 P
N.A.7619 H* PI 404412 P PI 508857 T*
N.A.7657 X* 1 PI 404415 RecC5* PI 576135 M
N.A.7658 P* 1 PI 404431 I
N.A.7661 A* 1 PI 404432 P
N.A.7665 P* 3 PI 404823 P
N.A.7673 H* PI 409854 A
N.A.7674 RecA3* PI 410281 A
N.A.7688 S* 1 PI 410283 A
N.A.7690 A* NSL 28721 D1




















Table 5-2. Allele frequency distributions in the tetraploid biotypes of P. dilatatum used to estimate possible contributions to the

recombinant pentaploid clones.
P P dilatatum ssp P P dilatatum P dilatatum P P dilatatum ssp P P dlatatum P dlatatum P P dilatatum ssp P P dilatatum P dilatatum
dasypleurum flavescens urville, Vacara Virasoro dasypleurum flavescens urville, Vacaria Virasoro dasypleurum flavescens urville/ Vacaria Virasoro
Pdfll Pdfl15 Pdfl20
172 018 100 216 004 207 008
174 1 00 218 209 062
176 004 018 100 222 211 027 013
178 050 224 008 215 1 00
180 096 014 226 217
Pdfl4 228 050 221 100
196 1 00 232 223
200 236 018 233
202 013 021 238 034 235 050
204 079 006 240 237 004
206 242 002 013 050 239 046
208 244 056 263 004 031
210 094 246 004 019 271 019
212 1 00 250 013 273 038
220 077 252 Pdf12
226 254 012 174 100
232 011 264 212 1 00
238 276 029 221 064
240 278 0 07 223
242 282 004 225 009
Pdfl8 286 004 229 009
198 004 292 008 233 018
218 011 044 294 008 235 039
220 006 296 012 239
224 038 298 015 241 061
226 007 006 302 008 245
230 1 00 1 00 312 008 251
232 326 008 253
234 332 008 Pdfl12b
236 011 0 32 0 06 354 0 04 200 1 00 1 00 0 86 1 00
238 082 039 PdfllO 210 014 100
240 007 175 Pdfl7
244 007 179 233 100
266 181 018 100 235
272 187 005 241 100
274 191 045 249 081
276 195 009 006 251 100 019
Pdfl15b 207 253
202 092 209 005 257 100
210 025 211 025 259
212 075 100 008 100 213 050 Pdfl20b
214 1 00 221 009 196 036
225 004 197 025 057
227 050 068 019 198 057
229 029 009 199 075 018 100
237 050 200 025
245 201 100
203 007









Data Analysis

Alleles in complex patterns were assigned to loci based on Chapter 2. MSAnalyzer

(Dieringer and Shloterer 2002) was used to summarize microsatellite data and calculate

distance matrices based on the proportion of shared alleles (Dps) (Bowcock 1994).

The number of mutational steps of each genotype from the most common

genotypes was estimated based on a Dps matrix and used to decide which genotypes

should be further analyzed as recombinants.

For the genotypes identified as mutational variants of the major clone, a genotype

network was created using Network (www.fluxus-engineering.com ) by the Median

Joining method (Bandelt et al. 1999). Alleles of loci interpreted to be located on the I or J

genome according to Chapter 2 were assigned to either homologous locus in each

individual based on size and/or conservation of the other allele, i.e. the shorter band could

be considered a mutant of the "long" allele if the common "short" allele was conserved.

The entire genotype was further treated as a single haplotype because it was assumed that

recombination did not take place.

Information about allele frequencies in the tetraploid biotypes of the Dilatata group

was obtained from Chapter 4 and is here summarized and shown in Table 5-2 for

comparison. Two exploratory approaches were followed to identify the putative donor of

alleles to each recombinant pentaploid. First, a matrix of Dps was generated with

MSAnalyzer and the distance of each recombinant to each tetraploid biotype was taken as

an indication of putative ancestry. Second, allele admixture proportions were explored

using Structure (Pritchard et al. 2000). To circumvent the confounding effect of the high

number of alleles shared by the typical pentaploid genotype and Virasoro, a population of

a hypothetical ancestor of the typical clone was simulated by removing the alleles clearly









attributable to a Virasoro-like parent. The ancestry model was based on prior population

assignments for the tetraploids and admixture for the recombinant genotypes. The

simulation was re-run with the number of clusters set to represent the actual number of

putative ancestral populations present in the matrix. Otherwise, all of the default options

were left in effect. The final simulations were carried out for 50000 bum in runs

followed by 100000 MCMC replicates.

Results

A total of 29 multilocus genotypes for 12 loci were identified using the eight

microsatellite primer pairs. Primer pairs Pdfll5 and Pdfll2 amplify two and Pdfl20 three

independent loci (Chapter 2). The 177-bp band which is thought to reside on the putative

X genome locus Pdfl20c was present in all the individuals and is not shown in the

figures. The data were first displayed graphically (as in Fig. 5-4) and visually analyzed.

A single most common genotype with a few mutations was evident while a few

individuals were clearly recombinants. For exploratory purposes the most frequent

genotypes (A and P) were treated as ancestral and mutational steps counted from them.

To assess the extent of the major clone, the number of allele size differences of each

genotype to the closest of either of the two versions of the major clone was calculated

(Fig. 5-1). All genotypes with 5 or fewer allele differences to the common genotype

were tentatively considered its mutational variants. A highly contrasting pattern was

observed between those genotypes with 7 or more allele differences with the common

genotypes and those with 5 or fewer. A progression in the number of allele-size changes

from 0 to 5 was clearly interpretable as somatic mutations because alleles accumulate in

the most unstable loci (Pdfll5 and Pdfll10) and the rest of the loci typically remain

unchanged or show single-step mutations in the longer alleles. These genotypes maintain







82


at least 6 original heterozygous combinations of the common genotype. This pattern is

not observed in genotypes showing 7 or more allele differences from the common

genotype; changes affect either allele and their size ranges are drastically different.


18
S16
14


0 K--- ----


0
A P P1Q S T U W X B D I A1 CL YE H J FD1 G V M1M N C6B3B2B4B1C5C1C4A2C3A1A3C
recombinants
Genotype


Fig. 5-1. Number of microsatellite allele differences between all genotypes of pentaploid
P. dilatatum and the nearest of the two most widespread genotypes (A and P).
The total number of alleles considered is 22.

A genotype network was built for the major clone and its inferred somatic variants

(Fig. 5-2a). The network represents a completely hierarchical arrangement with a total of

44 changes in 12 variable alleles of which 13 changes in the same 4 alleles are

homoplasious (long alleles in Pdfll0, Pdfll5 and Pdfl8 and the short allele in Pdfl7) (Fig.

5-2a). Two frequent genotypes (A and P) include most of the individuals. Several

genotypes are connected to these two common ones by one or a few mutations. Of the

total 44 changes required to build the network, six were allele losses where the actual size

of the resulting allele cannot be observed. For the remaining 38 changes, 20 or 21

represent size increases and 18 or 17 size decreases depending on whether genotype A or

P is considered ancestral. These changes are not distributed evenly along the network or

across loci. A single branch connecting genotypes G, H, and J to A accounts for 11 size

increases. The ratio of increases to decreases for the rest of the tree is 9:16. Of the 44









total changes scored for 22 alleles, 10 are accounted for by the longer allele of Pdfl 15

alone and 7 by the longer allele of Pdfll. A significant size difference of 7 steps

separates a completely inactive Pdfl 15 long allele of approximately 28 GT repeats

(branches departing from P) from a hypermutable Pdfl 15 whose size increased

independently twice: once leading to genotypes M and Ml and a second time on the

branch ending in H where it reaches a maximum length of approximately 40 repeats.

The geographical locations of the genotypes shown in Fig. 5-2a are displayed in

Fig. 5-2b. The genotypes show a high degree of admixture in the native range of the

species. A meaningful statistical treatment of the geographical structure is not possible

because the sampling strategy was deliberately biased in Uruguay where most of the

samples and genotypes were found. Despite this, the most remarkable geographical

patterns are the absence of genotype P towards the southwest and the high degree of

admixture east of the Uruguay River. This extreme admixture of genotypes is best

exemplified by the presence of highly divergent genotypes within a single population (see

legend of Fig. 5-2b and Table 5-1).

In contrast to the high diversity and admixture found within the native range, the

samples retrieved from the rest of the world all show the A genotype except for one

accession from South Africa which shows the P genotype, and the samples from Florida,

Greece, and Turkey, which show the M or a related genotype (Fig. 5-2c).

As a first approach to analyze the origin of the recombinant genotypes, their allelic

constitutions were compared to those of the known sexual biotypes in the group. The

estimation of the putative contributions of Virasoro, Vacaria, and P. dilatatum ssp.

flavescens to the recombinants suggests the same pattern when estimated by Structure
















































Fig. 5-2. Genotypic relationships and geographical distribution of the clonal variants of
pentaploid P. dilatatum A. A haplotype network of the multilocus
microsatellite genotypes. Allele losses are indicated by crosses and size
variations as boxes on the branches assuming either genotype A or P is
ancestral. Box sizes are proportional to allele-size increase (black boxes) or
decrease (white boxes) in dinucleotide repeats. B and C.. Distribution of
clonal variants of typical P. dilatatum B. within its native range and C. outside
its native range. Letters refer to the genotypes shown in Figure. 2A. Circled
numbers in Fig. 2B correspond to locations for which more than one
individual was analyzed. The genotypes found in each population are
indicated in the legend.

















m Vlrasoro
0.5 V dilatatum-Vmrasoro
O Vacana
0 flavescens


>> > > ; ; U ;U ;U ;U ;O ;O ;O ;O ;O ;O
Genotype C-O -I oI oC


Fig. 5-3. Estimated tetraploid biotype contributions to the pentaploid recombinant P.
dilatatum genotypes. The clusters were generated by Structure based on prior
population assignments and the number of clusters (K) set to 4 to represent
each of the indicated putative tetraploid sources: Virasoro, Vacaria, ssp.
flavescens, and a fourth sample inferred from the alleles present in the most
common genotypes of typical P. dilatatum not shared with Virasoro. The
simulation resulted in no admixture estimated for the tetraploid biotypes each
of which was completely assigned to its own cluster (not shown).

Table 5-3. Proportion of shared allele distances (Dps) of the recombinant pentaploids of P.
dilatatum to the tetraploid biotypes of the Dilatata group. The distance of each
recombinant to the nearest biotype is indicated in bold italics.
Ge e Pm P. dilatatum ssp. P. P. dilatatum P. dilatatum
fGenotype P .da flavescens urvillel Vacaria Virasoro
RecAl 0.90 0.94 0.85 0.95 0.35
RecA2 0.95 0.89 0.82 0.95 0.50
RecA3 0.90 0.92 0.86 0.95 0.35
RecB1 0.78 0.51 0.79 0.80 0.80
RecB2 0.83 0.48 0.79 0.86 0.75
RecB3 0.85 0.55 0.78 0.86 0.80
RecB4 0.78 0.55 0.78 0.80 0.85
RecC1 0.85 0.86 0.78 0.85 0.65
RecC3 0.85 0.86 0.77 0.80 0.65
RecC4 0.80 0.89 0.83 0.80 0.60
RecC5 0.85 0.86 0.78 0.86 0.65
RecC6 0.80 0.84 0.71 0.78 0.55
RecC7 0.64 0.78 0.80 0.69 0.83



(Fig. 5-3) or represented by Dps (Table 5-3). Three putative groups of recombinants are


apparent in both analyses. Recombinant group A shows greater similarity to Virasoro


than the typical clone, recombinant group B shows a clear contribution from P. dilatatum








86



ssp.flavescens, and recombinant group C is more heterogeneous and appears to share


more alleles with Virasoro than the typical clone. The multilocus genotypes shown in


Fig. 5-4 are in complete agreement with this. In agreement with the estimated allele


admixture proportions shown in Fig. 5-3, the genotypes in groups A and B can be almost


fully accounted for by a cross between typical clones A or P and the individuals of


Virasoro and P. dilatatum ssp.flavescens included in Fig. 5-4.


Pdfl4(-15bp)
Pdfl7

mPdfl8

~PdfllO

Pdfll1

Pdfl12

S Pdfl12b

mPdfl15b
M Pdfl20

.-- m Pdfl20b







0---
mm C m
mmmm 11


-


228




208-
208-
i--i


188 -


18--------- ------


168
0 0 ;; ;30<< 0 ;0 ;0 ;0 ; ;; ; ; 0 ; ;0 0




Fig. 5-4. Multilocus microsatellite genotypes for the recombinant genotypes of pentaploid
P. dilatatum. The nearest genotype from the typical clone (A or P) is shown
next to each recombinant group. Two individuals of P. dilatatum ssp.
flavescens and Virasoro are shown next to each of the clusters they appear to
be related to for comparison. The highly variable locus Pdfll5 is not shown.


i- 1 1 i 1 1i -
- i-



I m

O O
mmm









Furthermore, recombinants of group B are found in the area of co-occurrence of

pentaploids and P. dilatatum ssp. flavescens, and the recombinants of group A are found

either in the area of distribution of Virasoro or near it (Fig. 5-5).

The putative recombinants of group C present a different situation. First, a clear

contribution of an existing tetraploid to their genotypes was not found. Second, their

geographical distribution does not overlap with that of any currently known tetraploid,

except for genotype C5, and third, they show allele sizes that are beyond the range so far

detected in the tetraploids analyzed (longer allele of Pdfll5 in Cl, 2 and 7; longer allele

of Pdfl8 in C1-5; shorter allele ofPdfllO in Cl, 2 and 5) (Table 5-2). Genotype C5, in

spite of its geographical location, does not show a clear contribution of Vacaria (see Fig.

5-4 and Table 5-2).

Discussion

The "Typical" Clone

One of the difficulties encountered in this data set was the discrimination of the

extent of the variability caused by mutation from that due to hybridization. Although it

was evident from the data that a single common genotype comprises the majority of the

accessions analyzed, hybridization to a homozygous source could be confounded with a

high degree of mutagenic activity. The genotypic matrix contained 22 different alleles

because the common genotype is heterozygous at all the loci assigned to the I or J

genomes. If this clone crossed to any unrelated genotype, a maximum of 11 allele-size

differences would be expected. However, the two tetraploids with which hybridization

was hypothesized (Virasoro and P. dilatatum ssp.flavescens) share a number of alleles

with pentaploid P. dilatatum; hybridization to either of them would then produce fewer

than the maximum of 11 differences. With a low number of hybrids as detected here,









sexual events would not necessarily cause conflict in the data matrix and could maintain a

hierarchical structure in spite of recombination. More systematic character compatibility

approaches to detecting recombination in apomicts rely on the generation of this conflict

(Mes 1998) and only provide an approximation to the quantification of sexual

reproduction (Mes et al. 2002). In spite of the above, our case by case analysis has

probably resulted in a very realistic distinction of clonal variants and recombinants.

In well-studied apomictic plant systems like Taraxacum, apomicts tend to behave

as good overseas colonizers (van Dijk 2003); however, unlike P. dilatatum, native ranges

usually contain an assemblage of independently generated clones regardless of how

widespread they may be (van der Hulst et al. 2000). Regardless of the detection of a

certain number of recombinants, most of pentaploid P. dilatatum comprises a single clone

with its somatic variants; moreover, most of the individuals collected outside the native

range of the species have shown the same genotype when analyzed for this set of loci.

The actual extension of this clone around the globe is not known but it has been shown

here to be present on every continent. The current collection is not suitable for estimating

the proportion of typical genotypes within the native range because most of the samples

were collected as individual off-types or as different types within a morphologically

variable population. It is likely then, that recombinants are less frequent than detected

here. It is remarkable that the typical clone was present in all populational samples

containing recombinants except population 10. This population, however, was collected

and annotated as P. pauciciliatum, so it is likely that if typical individuals were present at

the site, they may have been avoided.




Full Text

PAGE 1

EVOLUTIONARY PATTERNS IN THE DILATATA GROUP ( Paspalum POACEAE): A POLYPLOID/AGAMIC COMPLEX By PABLO R. SPERANZA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Pablo R. Speranza

PAGE 3

This dissertation is dedicated to my son Ma uricio who never for got to give me a hug when I left home for work at night.

PAGE 4

iv ACKNOWLEDGMENTS I want to thank my advisor, Pamela Soltis, for having always been available and willing to help and provide support during my whole program. I also wish to thank my committee members (Pamela Soltis, Douglas Soltis, Kenneth Quesenberry, and Gloria Moore) for having made of each meeting a constructive and worthy experience, each providing a different point of view on my work. I am inde bted to Enrique Estramil and Marcos Malosetti for their help with data analysis, and to my laboratory mates, particularly Joshua Clayt on, Vaughan Symonds, and Jennifer Tate for their invaluable help in writing this dissertati on. I also want to thank Ga briel Rua, Rodrigo Vergara, Jennifer Tate, Michelle McMahon, and Kevi n Smith for providing fundamental plant material for this study. I wish to thank my colle agues of the Universidad de la Repblica, Uruguay, particularly Magdalena Vaio, Cristina Mazze lla, and Ivn Grela for facilitating plant material and staying constantly in contact with me. This work would not have been possible without the training and inspiration that I received from Juan Carlos Millot during my undergraduate education. Finally, this dissertation wa s possible due to the support I received from my wife, Alicia Lusiardo. This work was supported in part by a cr edit-scholarship from the Programa de Desarrollo Tecnolgico, Ministerio de Educacin y Cultura, Uruguay.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...........................................................................................................viii LIST OF FIGURES...........................................................................................................ix ABSTRACT....................................................................................................................... xi CHAPTER 1 AN INTRODUCTION TO THE STUDY OF THE DILATATA GROUP OF Paspalum ......................................................................................................................1 A Historical Perspective...............................................................................................1 The Contributions of This Dissertation........................................................................7 Chapter 2: The Technique.....................................................................................7 Chapter 3: The Germplasm...................................................................................8 Chapter 4: The Complex.......................................................................................8 Chapter 5: The All-Important Pentaploid(s)..........................................................9 2 NUCLEAR AND CYTOPLASMIC MICROSATELLITE MARKERS FOR THE SPECIES OF THE DILATATA GROUP OF Paspalum (POACEAE).....................10 Introduction.................................................................................................................10 Materials and Methods...............................................................................................13 Microsatellite Capture.........................................................................................13 Chloroplast Markers............................................................................................14 Plant Material......................................................................................................15 Amplification and Scoring..................................................................................17 Results........................................................................................................................ .18 Capture and Amplif ication Success.....................................................................18 Variability............................................................................................................24 Chloroplast Variability........................................................................................25 Discussion...................................................................................................................26 Capture Efficiency...............................................................................................26 Amplification Profile...........................................................................................26 Non-Focal Loci....................................................................................................27 Nuclear Loci........................................................................................................28

PAGE 6

vi Chloroplast Microsatellites..................................................................................30 Conclusions.................................................................................................................30 3 BREEDING SYSTEM AND POPULATION GENETIC STRUCTURE OF Paspalum dilatatum ssp. flavescens (POACEAE).....................................................32 Introduction.................................................................................................................32 Materials and Methods...............................................................................................34 Collection Strategy..............................................................................................34 Microsatellite Amplification...............................................................................35 Data Analysis.......................................................................................................36 Results........................................................................................................................ .37 Discussion...................................................................................................................43 Mating System.....................................................................................................43 Genetic Differentiation and Geographical Structure...........................................44 4 EVOLUTIONARY RELATIONSHIPS AND MECHANISMS IN THE DILATATA GROUP ( Paspalum POACEAE).........................................................49 Introduction.................................................................................................................49 Materials and Methods...............................................................................................53 Plant Material......................................................................................................53 DNA Extraction and Microsatellite Analysis......................................................54 Data Analysis.......................................................................................................55 Results........................................................................................................................ .56 Variability in the Tetraploids...............................................................................56 Variability in the Apomicts.................................................................................60 Relationships among Apomicts...........................................................................61 Heterozygosity of the Apomicts..........................................................................63 Discussion...................................................................................................................64 Evolutionary relationships among the sexual tetraploid biotypes.......................64 Genetic structure of th e sexual tetraploids..........................................................66 Variability within the apomicts...........................................................................67 The addition of the X genome, apomix is, and the origin of pentaploid P. dilatatum ..........................................................................................................67 Paspalum dilatatum Uruguaiana and 59B...........................................................68 Paspalum dilatatum clone 2................................................................................70 Paspalum dilatatum Chir...................................................................................70 Paspalum pauciciliatum ......................................................................................71 Paspalum dilatatum Torres.................................................................................72 Conclusions.................................................................................................................72 5 PENTAPLOID X TETRAPLOID HYBRIDIZATION CYCLES IN Paspalum dilatatum (POACEAE): EXPLAINING THE CURRENT AND FUTURE EVOLUTIONARY SUCCESS OF AN IMBALANCED POLYPLOID...................74 Introduction.................................................................................................................74

PAGE 7

vii Materials and Methods...............................................................................................76 Plant Material......................................................................................................76 DNA Extraction and Microsatellite Analysis......................................................77 Data Analysis.......................................................................................................80 Results........................................................................................................................ .81 Discussion...................................................................................................................87 The “Typical” Clone............................................................................................87 Distribution of Clonal Dive rsity in the Native Range.........................................89 Hybridization and its Genetic Consequences......................................................90 The Mechanism...................................................................................................91 How Many Times?..............................................................................................92 6 CONCLUDING REMARKS......................................................................................94 REFERENCES..................................................................................................................97 BIOGRAPHICAL SKETCH...........................................................................................106

PAGE 8

viii LIST OF TABLES Table page 1-1 Paspalum species known to share genomes with P. dilatatum Poir..........................2 2-1 Accession numbers and collection locations of the plant material used to test microsatellite transfer ability among biotypes..........................................................16 2-2 Primer sequences and structure for all the microsatellite loci reported in this study.........................................................................................................................1 9 2-3 Estimated recombination frequency betw een pairs of loci amplified by the same primer combination and LOD score for the test of independent segregation between them............................................................................................................23 2-4 Test of the segregation ratios per microsatellite locus.............................................23 3-1 Genetic diversity and heterozygos ity for individual populations of P. dilatatum ssp. flavescens for 6 microsatellite loci....................................................................38 3-2 AMOVA of a six-microsatellite-loc us data matrix for 21 populations of P. dilatatum ssp. flavescens ..........................................................................................40 4-1 Genomic formulae and reproductive syst ems of the members of the Dilatata group.........................................................................................................................5 0 4-2 Accession numbers of the materials re trieved from germplasm banks used to analyze the relationships am ong the different biotypes...........................................55 4-3 Summary of the microsatellite data for the sexual tetraploid biotypes of Paspalum group Dilatata and genotypes for the apomictic biotypes.......................58 5-1 Accession numbers, genotypes, and popul ation of origin of the pentaploid P. dilatatum material retrieved from germplasm banks...............................................78 5-2 Allele frequency distributions in the tetraploid biotypes of P. dilatatum used to estimate possible contributions to th e recombinant pentaploid clones....................79 5-3 Proportion of shared allele distances (Dps) of the recombinant pentaploids of P. dilatatum to the tetraploid biotype s of the Dilatata group.......................................85

PAGE 9

ix LIST OF FIGURES Figure page 1-1 Strict consensus of 15264 most pars imonious trees based on four cpDNA noncoding squences..........................................................................................................4 2-1 A graphical representation of all the microsatellite al leles amplified for a sample of each biotype.........................................................................................................20 2-2 Alignment of nucleotide sequences of representative alleles for the non-focal loci compared to the originally cloned sequences....................................................21 3-1 A spikelet of P. dilatatum ssp. flavescens and P. dilatatum ssp. dilatatum ............34 3-2 Allele size distribution for six microsatellite loci in P. dilatatum ssp. flavescens ...37 3-3 Genetic distances among 21 populations of P. dilatatum ssp. flavescens and their geographical distribution..........................................................................................41 3-4 Genetic distances among individual genotypes of P. dilatatum ssp. flavescens and their geographical distribution...........................................................................42 4-1 Geographical distribution of the accessions.............................................................54 4-2 Population structure of a sample of th e members of the Dilatata group estimated by Structure under the admixture model base d on microsatellite data for 13 loci...59 4-3 UPGMA phenograms of the distances among the sexual tetraploid biotypes of the Dilatata group based on 13 microsate llite loci obtained with different distance measures.....................................................................................................60 4-4 Multilocus genotypes of the apomictic components of the Dilatata group..............62 5-1 Number of microsatellite allele differences between all genotypes of pentaploid P. dilatatum and the nearest of the two most widespread genotypes (A and P)......82 5-2 Genotypic relationships a nd geographical distribution of the clonal variants of pentaploid P. dilatatum ............................................................................................84

PAGE 10

x 5-3 Estimated tetraploid biotype contri butions to the pentaploid recombinant P. dilatatum genotypes.................................................................................................85 5-4 Multilocus microsatellite genotypes for the recombinant genotypes of pentaploid P. dilatatum ..............................................................................................................86

PAGE 11

xi Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EVOLUTIONARY PATTERNS IN THE DILATATA GROUP ( Paspalum POACEAE): A POLYPLOID/AGAMIC COMPLEX By Pablo R. Speranza August 2005 Chair: Pamela S. Soltis Major Department: Botany Paspalum dilatatum Poir. and its related species are warm-season grasses native to temperate South America. The members of th e Dilatata group include polyploid sexual and apomictic components, some of whic h have reached worldwide distributions. The common biotype of P. dilatatum is a complex apomictic pent aploid hybrid, and efforts to identify its putative ancestors have led to the accumulation of a significant amount of cytogenetic information about the relations hips among biotypes within the Dilatata group. In general, past work in this complex has suffered from the lack of representative collections, and the low power of the techniques. In this st udy, I developed microsatellite markers, analyzed their transf erability within th e Dilatata group, and applied them to representative samples to an alyze the evolutionary relati onships within the group at different levels. The markers developed he re show great power to detect recent hybridization and analyze genetic structure. Th e genetic structure of the sexual biotypes was described for a collection of P. dilatatum ssp. flavescens This biotype is highly

PAGE 12

xii autogamous, and its genetic variability does not show significant geographical structure probably due to continuous disturbance of the roadside environment it inhabits. The relationships among the sexual and the apom ictic components are analyzed, and the origin of the apomictic biotypes is discusse d. Genetic recombination was not detected in the apomictic hexaploids and tetraploids. Am ong the pentaploids, a single clone and its somatic variants were found on a ll the continents and in almost all the collection sites in its native area. All the other apomicts in th e group, including the re combinant pentaploids are hypothesized to be derived from the pe ntaploid form. The probable mechanisms involve either the production of unreduced female gametes or eu-triploid pollen grains by the pentaploids. This is probably the most extensive study ever attempted in this group, and it will undoubtedly change th e direction of all future re search in these species. The new recombinant forms will have to be anal yzed and their productive potential assessed, while existing collections should be re-structured to reflect the unexpect ed distribution of the genetic variability they contain.

PAGE 13

1 CHAPTER 1 AN INTRODUCTION TO THE STUDY OF THE DILATATA GROUP OF Paspalum A Historical Perspective The genus Paspalum contains ca. 350 species, most of them native to the tropical and warm temperate New World (Chase 1929). Chase (1929) recognized about 20 informal taxomomic groups within the genus based on vegetative and reproductive morphological characters, a classifica tion that is still widely used. The Dilatata group of Paspalum contains several speci es with great forage potential, and several of them have been us ed as forage crops (Skerman and Riveros 1992). Paspalum dilatatum Poir. and its related species are warm-season grasses native to the grasslands of temperate South America. Some members of the group, particularly P. dilatatum ssp. dilatatum and P. urvillei Steud., have reached worldwide distributions wherever a warm temperate climate combin ed with sufficient rainfall exists. The members of the Dilatata group have b een classified into several formal and informal taxonomic categories which will be refe rred to as biotypes in this dissertation. The common biotype of P. dilatatum ( P. dilatatum ssp. dilatatum ) is a complex apomictic pentaploid hybrid, and efforts to id entify its putative ances tors have led, over several decades, to the accu mulation of a significant body of cytogenetic information about the relationships among all the species and biotypes within the Dilatata group and between this group and the related Virgata gr oup (Table 1-1). The fist comprehensive treatment of the Dila tata species was done by Moraes Fernandes et al. (1968) based solely on the meiotic behavior of the biotype s. Burson (1983) summar ized the results of

PAGE 14

2 the advancements achieved during the 1970s by several interspecifi c hybridizations and assigned the genomes in the group to putativ e diploid donors. Several new tetraploid members of the group have been identified si nce then, but no significant advances have been made about the relationships among them and the apomictic components. Table 1-1. Paspalum species known to share genomes with P. dilatatum Poir Species or biotype 2n Genomic Formula Authority Paniculata Group P. paniculatum 20 JJ Burson (1979) P. jurgensii 20 JJ Burson (1978) Dilatata Group P. dilatatum ssp. dilatatum 50 IIJJX Burson (1983) P. dilatatum ssp. flavescens 40 IIJJ Burson et al (1973) P. dasypleurum 40 IIJJ Quarn and Capponio (1995) P. urvillei 40 IIJJ Burson (1979) P. dilatatum Virasoro 40 IIJJ Caponio and Quarn (1990) P. dilatatum Vacara 40 IIJJ Quarn unpub. res. P. dilatatum "Chir" 60 IIJJXX Burson (1991)a P. dilatatum Uruguaiana 60 IIJJX1X2 Burson (1995) Virgata Group P. conspersum 40 I2I2JJ Burson (1978) P. virgatum 40 IIJ2J2 Burson and Quarn (1982) P. rufum 20 II Quarn and Norrmann (1990) Quadrifaria Group P. haumanii 20 II Quarn and Norrmann (1990) P. brunneum 20 II Quarn and Norrmann (1990) P. quadrifarium 20 II Quarn and Norrmann (1990) P. intermedium 20 II Burson (1978) P. densum 20 II Caponio and Quarn (1993) P. durifolium 60 IIJ2J2X*X* Burson (1985) unknown genome not related to other X genomes Several possible donors have been suggest ed for the I genome of the Dilatata group, most of which constitute species comm only included in the Quadrifaria group as defined by Barreto (1966). This group has been seen as including several species typically based on self-incompatible sexual diploids and their a pomictic autopolyploid cytotypes. Recently, an analys is of the relationships among the proposed sources of the I genome was prepared in collaboration w ith M. Vaio. This study addresses the relationships among the several proposed donors of the I genome to the Dilatata group using two main approaches: the distribu tion of rDNA sites in the genomes and phylogenetic analysis of the chloroplast sequences.

PAGE 15

3 Our results suggest that the relations hips among the species of the group are complex, with several polyploids of interspeci fic origin. Remarkabl y, the pairing ability of the chromosomes among the I genome sp ecies (Quarn and No rrmann, 1990) bears a correlation with the phylogenetic distances among them inferred from chloroplast sequences. The analysis published in Vaio et al. (2005) is part of a phylogenetic analysis of the genus as a whole that has been undertaken by G. H. Rua and myself to provide a framework in which the origin of polyploid species complexes of Paspalum can be analyzed. This study is not yet completed as we still lack cytogenetic information on most of the samples included in the study. A summary of the current progress of this phylogenetic effort is shown in Fig. 1-1, and an outline of the methodology is provided in Fig.1-2. Concerning the origin of the Dilata ta group, the relationships obtained so far suggest that the definitive iden tification of the genomic sources for the group is far from being achieved: the currently proposed s ources of I genomes form a paraphyletic assemblage within which the proposed J genome donor ( P. juergensii / P. paniculatum ) is also found. Moreover, P. rufum whose chromosomes also show a moderate degree of pairing to the I genome, is located in a different clade which includes, among others, most members of the Notata and Plicatula group s. If these relationships are confirmed in the future, the J genome would represent a deri ved genome nested in a group in which the plesiomorphic condition is th e ability to pair with th e I genome. The current identifications of the I and J genomes are th e result of the knowledge that was available to the researchers when findings were made Without a general understanding of the

PAGE 16

4 P. malacophyllumP.usteriP.simplexP.bicilliumP.polyphyllumP.falcatumP.humboldtianumP.paucifoliumP.communeP.juergensii (JJ) PaniculataP.paniculatum (JJ) PaniculataP.quarinii (II) Quadrifaria Dilatata group (IIJJ)P.remotumP.quadrifarium (II) QuadrifariaP.conspersum (I2I2JJ) VirgataP.intermedium (II) QuadrifariaP.arundinellumP.denticulatumP.lividumP.virgatum (IIJ2J2) VirgataP.exaltatum (II) QuadrifariaP.haumanii (II) QuadrifariaP.ovaleP.fasciculatumP.indecorumP.arundinaceumP.chacoenseP.trichostomumP.durifoliumP.cromyorrhizonP.ionanthumP.stellatumP.equitansP.leptonP.limbatumP.compressifoliumP.modestumP.palustreP.wrightiiP.alcalinumP.rufum (II) VirgataP.bertoniiP.lilloiP.chaseanumP.guenoarumP.coryphaeumP.scrobiculatumP.atratumP.ellipticumP.erianthumP.lineareP.maculosumP.minusP.notatumP.plicatulumP.acuminatumP.glabrinodeP.distichumP.vaginatumP.inconstansP.mandiocanumP.almumP.ceresiaP.pilosumP.setaceum ThrasyapetrosaP.unispicatumP.conjugatumP.repensP.orbiculatumP.racemosum AnthaenantiopsisrojasianaP.inaequivalve Axonopusfurcatum Axonopusrosengurttii 5 changes98 57 95 94 82 65 61 65 99 50 89 93 91 89 93 99 73 57 97 83 62 83 53 80 99 100 96 57 57 53 93 99 100 P. malacophyllumP.usteriP.simplexP.bicilliumP.polyphyllumP.falcatumP.humboldtianumP.paucifoliumP.communeP.juergensii (JJ) PaniculataP.paniculatum (JJ) PaniculataP.quarinii (II) Quadrifaria Dilatata group (IIJJ)P.remotumP.quadrifarium (II) QuadrifariaP.conspersum (I2I2JJ) VirgataP.intermedium (II) QuadrifariaP.arundinellumP.denticulatumP.lividumP.virgatum (IIJ2J2) VirgataP.exaltatum (II) QuadrifariaP.haumanii (II) QuadrifariaP.ovaleP.fasciculatumP.indecorumP.arundinaceumP.chacoenseP.trichostomumP.durifoliumP.cromyorrhizonP.ionanthumP.stellatumP.equitansP.leptonP.limbatumP.compressifoliumP.modestumP.palustreP.wrightiiP.alcalinumP.rufum (II) VirgataP.bertoniiP.lilloiP.chaseanumP.guenoarumP.coryphaeumP.scrobiculatumP.atratumP.ellipticumP.erianthumP.lineareP.maculosumP.minusP.notatumP.plicatulumP.acuminatumP.glabrinodeP.distichumP.vaginatumP.inconstansP.mandiocanumP.almumP.ceresiaP.pilosumP.setaceum ThrasyapetrosaP.unispicatumP.conjugatumP.repensP.orbiculatumP.racemosum AnthaenantiopsisrojasianaP.inaequivalve Axonopusfurcatum Axonopusrosengurttii 5 changes98 57 95 94 82 65 61 65 99 50 89 93 91 89 93 99 73 57 97 83 62 83 53 80 99 100 96 57 57 53 93 99 100 Fig. 1-1. Strict consensus of 15264 most pa rsimonious trees based on four cpDNA noncoding sequences (see Box 1). Number s above branches represent boostrap support values, and numbers below the br anches represent percent posterior probabilities for the same branches in a Bayesian (see Box 1) tree of similar topology when they were not 100%.

PAGE 17

5 Fig 1-2. Main conclusions of a preliminary phylogeny of the genus Paspalum The phylogeny shown in Fig. 1-1 represents the current status of an ongoing project aimed at establishing a framework for the study of the relationships among species and polyploid complexes within the genus Paspalum This project is being carried out in collaboration with G. H. Rua. The genus itself has not been analyzed using molecular tools, but some partial analyses show that the genus is not monophyletic if the species of Thrasya are excluded, and its nearest relatives are Anthaenantiopsis Thrasyopsis and some species currently assigned to Panicum (Gmez-Martnez and Culham 2000, Giussani et al. 2001, Duvall et al. 2001, Aliscioni et al. 2003). The inclusion of multiple polyploids and hybrids in a phylogenetic analysis would confound the phylogenetic signal if we an alyzed nuclear markers (including morphology). As a consequence we were f aced with the practical impossibility of assembling a collection of only diploids or performing broad s cale nuclear sequence isolation and cloning of a big portion of the genus, while the ploidy levels of most of our materials would be unknown. We decided to use a mostly living collection at the Universidad de Buenos Aires, for which cytogenetic information could be obtained and voucher specimens had been deposite d. We undertook the phylogenetic effort using chloroplast sequences. With this ki nd of marker, a congruent set of sequences could be obtained, and our phylogenetic tree would represent the organismal history of our diploid samples and the maternal proge nitors of our polyploids. This approach would circumvent the risk of insufficient taxon sampling by filling the gaps created by unrepresented diploids with the chloroplast sequences of their derived polyploids. Valuable information can also be obtained on the maternal origins of the polyploids. Four non-coding chloroplast re gions were amplified: the trn L(UAA) intron, the atp rbcL spacer, the trn G(UCC) intron and the trn L(UAA)trn F(GAA) spacer (technical details on amplification and sequencing are given in Vaio et al. 2005). A single matrix was made of all the alignments for 72 species of Paspalum one species of both Thrasya and Anthaenantiopsis and two species of Axonopus as outgroups. The matrix was analyzed with parsimony using PAUP* (fully heuristic search with 20000 SAR) and Bayesian approaches using MrBaye s (a model was selected with Modeltest and the MCMC was run for 2,000,000 generations on MrBayes). The trees obtained with both approaches, were fully congruent, and the tree obtained with MrBayes was nearly identical to the majority-rule cons ensus obtained with parsimony. A slightly more conservative parsimony strict consen sus is shown in Fig. 1-1 which does not show nine nodes that appeared in the Bayesi an tree with posterior probabilities mostly below 0.70.

PAGE 18

6 Fig. 1-2 (continued) relationships among the main clades within the genus, the quest for the direct genome donors of the polyploid groups (including the Dila tata group) is deemed to continue at random, with occasional successes and many false positives. In spite of the data being preliminary, a few well-supporte d hypotheses can be derived from this tree concerning the placemen t and origin of the Dilatata group: 1. Paspalum is not monophyletic unless Thrasya is included in it and a) Anthaenantiopsis is included or b) P. inaequivalve is excluded. 2. Paspalum racemosum P. orbiculatum P. repens, and P. conjugatum form a basal grade to an otherwise poorly suppor ted clade containing the rest of the species of Paspalum and Thrasya 3. Two major clades with high posterior probabilities but no parsimony bootstrap support include most of the species analyzed. 4. The species of the Dilatata, Virgata, Paniculata, and Quadrifaria groups are included in the same clade but in diffe rent subclades. The species of the Quadrifaria group are found in both subclades. 5. The second major clade includes species of the Plicatula, Notata and Bertoniana groups among others. This clade show s very little internal resolution. P. rufum is included in this clade. 6. The chloroplast genome of the Dilatata gr oup is included in a clade that includes species that have been assi gned both the I and J genomes. 7. The chloroplast genomes of the Virgata gr oup are scattered with in the clade that contains most of the Quadrifaria species.

PAGE 19

7 The Contributions of This Dissertation In general, past work in this complex has suffered from two main limitations: the lack of representative collections, and the lo w power of the techniques. An effort was made in this case to represent with more than one individual each component of the complex. The main source of materials wa s a collection deposited by myself between 1992 and 1999 in the Germplasm Bank at the Facultad de Agronoma, Montevideo, Uruguay, which was complemented with the USDA collection. The main body of this dissertation is di vided into four chapters dealing with different levels of analysis of the Dilatata complex. Chapter 2: The Technique Two recent works (Speranza et al. 2003, Vaio et al. 2005) represent the first examples of the use of cytogenetic inform ation in this group beyond the sheer number of chromosomes or their meitotic behavior; however, cytogenetics alone cannot answer many of the questions that must be addresse d in this group. It has been hypothesized that, for example, the pentaploid biotype ma y be the direct deri vative of Chir and a sexual tetraploid. Microsatellites, due to th eir co-dominant nature and high degree of variability, appear as the ideal kind of markers to test such hypotheses. Furthermore, other issues that need to be addressed, such as the breedi ng systems and genetic structure of several biotypes, could also be effec tively resolved using variable co-dominant markers. In Chapter 2, I will design and characterize several microsatellite loci for P. dilatatum ssp. flavescens and test their transferability to all the other members of the Dilatata group. I will also atte mpt to predict their potential to test different types of

PAGE 20

8 hypotheses. These markers will be used as the main source of information in the following three chapters. Chapter 3: The Germplasm In the context of the traditional hypothesis, P. dilatatum is the product of a tetraploid (IIJJ) x hexaploid (IIJJXX) hybridization. The use of a variable, wellcharacterized collection of tetraploids seems to be the most direct resynthesis route for variable pentaploids. This co llection could be hybridized to either of the two apomictic and invariable hexaploids to produce new pentaploids. In spite of this, representative collections of tetraploids have not been available. The collection of P. dilatatum ssp. flavescens that I used here was the first one made with such an objective in mind, and a molecular characterization of it will greatly increase its value. A comprehensive populational-level study of the ge netic variability and its stru cture will be presented in Chapter 3. Chapter 4: The Complex Two previous attempts have been made to represent the Dilatata group in its entirety. These attempts (M oraes Fernandes et al. 1968) a nd Burson (1983) were based on the knowledge available at the time. In sp ite of the identification of new components and new relationships mainly during the 1990s, the paucity of information, the lack of comprehensive collections, or the limited interp retability of the markers used (see Casa et al. 2002), no great advances have been made in the past two decades. With the power of suitable techniques and a sufficient collection, Chapter 4 will surely become a landmark in the understanding of the complex.

PAGE 21

9 Chapter 5: The All-Important Pentaploid(s) It was the interest in this biotype that initiated a l ong series of studies in the Dilatata group. Since the esta blishment of its complex hybrid origin (Bashaw and Forbes 1958), the biotype has mostly been seen as a static, invariable entity. Chapter 5 is probably the most extensive a nd intensive study of genetic va riability ever attempted in this biotype, and will undoubtedly change the direction of all future research on it

PAGE 22

10 CHAPTER 2 NUCLEAR AND CYTOPLASMIC MICROSATELLITE MARKERS FOR THE SPECIES OF THE DILATATA GROUP OF Paspalum (POACEAE) Introduction The Dilatata group of Paspalum is a polyploid complex nativ e to the grasslands of temperate South America. The complex contai ns several informal taxonomic entities that will be generally referred to as biotypes in this paper. Paspalum dilatatum Poir. ssp. dilatatum a trihybrid pentaploid apomict (B ashaw and Forbes 1958, Bashaw and Holt 1958), is a widely recognized forage crop This biotype has b een assigned the IIJJX genomic formula (Burson 1983). The Dilatata group also includes several sexual selfing allotetraploids and several tetraand he xaploid apomictic en tities. The sexual allotetraploids ( P. urvillei Steud., P. dasypleurum Kunze ex Desv., P. dilatatum ssp. flavescens Roseng. Arr. et Izag., and biot ypes Virasoro and Vacaria of P. dilatatum ) have been shown either directly or indirectly to share the IIJJ genomic formula (Burson et al. 1973, Quarn and Caponio 1995, Burson 1979, Ca ponio and Quarn 1990), and their interfertility has been eith er directly assessed by hybrid ization (Caponio and Quarn 1990, Quarn and Caponio 1995) or inferred fr om the occurrence of natural hybrids (Valls and Pozzobon 1987). The group also includes two apomictic hexaploids ( P. dilatatum biotypes Uruguaiana and Chir ) wh ich have been assigned the IIJJXX2 and IIJJXX genomic formulae, respectively (Burson 1991, 1992) Paspalum dilatatum Torres, an asynaptic apomictic hexaploi d (Moraes-Fernandes et al. 1968), and P. pauciciliatum an apomictic tetraploid (Bashaw and Forbes 1958) of unknown genomic

PAGE 23

11 constitution, are also included in the group Recently, Machado et al. (2005) have shown that there may be several pe ntaploid apomictic entities in the group which have not yet been described or named. Interest in breeding the common pentaploid biotype has been the main motivation for extensive interspecific hybridization and cytogenetic anal yses in this group. Pentaploid (IIJJX) resynthesis by hexaploid (IIJJXX) x tetraplo id (IIJJ) hybridization has been suggested as a possible breeding st rategy for the group (Burson 1983). Vigorous synthetic pentaploids have b een successfully obtained by this kind of cross (Burson 1991b, 1992, Speranza 1994, unpubl. res.); however, the evaluation of available genetic variability, particularly in the selfing tetraploids, has not been undertaken. Sufficient knowledge has been accumulated not only to initiate the first breeding attempts, but also to make this species co mplex an interesting model for the study of apomixis and polyploidy. In spite of this the study of the relationships among the different entities that comprise this group has not advanced much in the last decade, most probably due to the limitations of the tools av ailable and the biological characteristics of the organisms themselves. Only recently has it been possible to obtai n further cytological information on these biotypes through the m odification of cytological techniques that allow chromosome identification and karyot yping (Speranza et al. 2003, Vaio et al. 2005); however, cytogenetics alone cannot answer many of the questions that must be addressed in this group. As most of the apomicts in the comp lex have been hypothesized to be interbiotypic combinations, the markers required to address questions about their genetic structure and origin must be transferable among all of the putative parents involved and

PAGE 24

12 preferably co-dominant. On the other ha nd, assessment of parentage would be best achieved with markers that ar e stable within biotypes, wh ile the study of the genetic structure of the sexual compone nts of the complex requires high levels of variability. Attempts have been made to use molecula r markers for the study of these species, but even when some degree of genetic diffe rentiation between the biotypes and intrabiotypic variability were confirmed (isozy mes: Pereira et al. 2000, Chies unpublished data, Hickenbick et al. 1992, AFLP: Speran za unpublished data, Casa et al. 2002), the levels of variability have not been high e nough or their interpretability has been very limited. Allopolyploidy adds an additional level of complexity to the genetic interpretation of molecular markers: th e assessment of homology vs. homeology among markers may not be straightforw ard, particularly in complex interbiotypic combinations. Microsatellite markers, despite the greater technological investment required for their development, provide the best tools for the study of the issues that have to be addressed: genetic structure, relatedness among the enti ties of the complex, and parentage of the apomictic components which are expected to be fixed hybrids. The generalized use of simple sequence repeat (SSR) enrichment and PCR-based protocols ha s greatly facilitated the development of new microsatellite loci (Fischer and Bachmann 1998, Kijas et al. 1994, Kandpal et al. 1994, Jakše and Javornik, 2001). Microsatellites not only provide more powerful genetic data due to their co -dominant nature, they usually tend to be extremely variable. Muta tion rates of nearly 1x10-3 have been directly observed in maize (Vigouroux et al. 2002). In we ll-studied selfing grass amphi ploid systems like wheat, microsatellites are capable of revealing great genetic variability (R der et al. 1995) where

PAGE 25

13 isozyme, RFLP, and AFLP markers show a hi gh degree of marker conservation (Hazen et al. 2002, Kim and Ward 2000). Finally, determining the directionality of hybridizations within the species complex may be crucial to understanding the mechanis ms by which new genetic combinations are being generated. Chloroplast mi crosatellites, typically (T/A)n, have been successfully used to elucidate directional formation of allopolyploids in grasses (Ishii and McCouch 2000). Ishii and McCouch (2000) re ported that despite successful cross-amplification, the presence of variable (T/A)n tracts was not conserved among distantly related grass genera; however, putatively universal primers for grass chloroplast microsatellites have been reported in the liter ature (Provan et al. 2004). Sixteen variable nuclear and one variable chloroplast microsatellite loci for P dilatatum ssp. flavescens were developed and character ized in this study. Their transferability among all the taxonomic entiti es of the Dilatata group was assessed, and their utility for addressing populational and phyl ogenetic studies at different levels is discussed. Materials and Methods Microsatellite Capture A genomic DNA library consisting of Sau3AI fragments of P. dilatatum ssp. flavescens was enriched for putative microsatel lite-containing sequences following the procedures of Ernst et al. (2004) with minor modificati ons. Briefly, genomic DNA was extracted with Sigma GeneluteTM kit (Sigma-Aldrich, St. Loui s, MO) and digested with Sau3AI. Fragments smaller than approxima tely 400bp were removed by fractioning using Chroma Spin columns (Clontech Laboratorie s). Sau3AI linkers were ligated to the remaining fragments which were then amplif ied by PCR. The amplified fragment library

PAGE 26

14 was enriched for (GT)n-containing sequences by binding to a Vectrex Avidin D matrix (Vector Laboratories, Burlingame, CA) to which a biotinylated (CA)n oligonucleotide probe had been previously bound. The eluted fragments were reamplified by PCR using primers for the Sau3AI linkers, ligated into pCR II-TOPO plasmids (Invitrogen, Inc) and transformed into ONE shot E. coli competent cells. Coloni es were screened by binding them to Magnacharge nylon transfer membranes (Osmonics, Inc.). The membranes were probed with labeled (CA)n and positive colonies detected with LumiPhos 480 (Lifecodes, Inc.). All probe labeli ng, hybridization, and detection was carried out with Quick-Light TM system (Lifecodes, Stamford, CT). Positive colonies were grown overnight in a liquid medium and plas mids purified with QIAprep Spin Miniprep Kit (Qiagen, Inc.). Plasmid isolates were screened a second time by dot-blotting serial dilutions on nylon membranes and hybridizing to a (CA)n probe. Isolates showing consistent hybridization signal through the dilutions were sequenced and used for primer development. Plasmid isolates were sequenced on a CEQ 8000 capillary sequencer (BeckmanCoulter, Fullerton, CA) using reaction volumes with the addition of 80mM Tris and 2 mM MgCl2 (pH 9) to complete the volume of a full reaction. The sequences were edited manually using SequencherTM (V4.1.4, Genecodes, Ann Arbor, MI). Primers were designed for sequences containing repeats longer than (GT)10 with Primer 3 (Rozen and Skaletsky, 2000). Lo w-complexity regions were excluded for primer design when possible. Chloroplast Markers Sequences for 6 chloroplast non-codi ng regions were obtained for all the recognized entities in the D ilatata group (Table 2-1) Six regions were analyzed: the

PAGE 27

15 trnT (UGU)trnL (UAA) spacer, the trnL (UAA) intron, the PsbA trnH spacer, the atpB rbcL spacer, the trnG (UCC) intron, and the trnL (UAA)trnF (GAA) spacer. PCR and sequencing conditions and primers were repor ted in Vaio et al. (2005) except for the trnT (UGU)trnL (UAA) spacer which was amplified and sequenced using primers A and B (Taberlet 1991). Primers were designed fl anking two poly-A rep eats located in the trnT (UGU)trnL (UAA) spacer. All primers reported by Provan et al. (2004) were also tested. A second poly A-tract not reported by Pr ovan et al. (2004) was detected near the trnL (UAA)3Â’ exon but no length variability wa s observed among the available sequences, and no further analysis was performed on it. Primer design, labeling, amplification, and detection procedures were performed as for the nuclear SSR described above. Plant Material Potential variability of microsatellites was assessed by analyzing a total of 28 accessions representing different species of th e Dilatata group. To assess intraspecific variability, we analyzed ten accessions each of P. dilatatum ssp. flavescens and P. urvillei Accessions were chosen to represent as much of the native range of the species as possible. To assess transf erability, two accessions each of P. dasypleurum P. dilatatum ssp. dilatatum and biotypes Virasoro and Vacaria of P. dilatatum were also analyzed. Seed samples were obtained fr om the Southern Regional Plant Introduction station, Griffin, GA, USA and the Germplasm Bank at the Facultad de Agronoma, Montevideo, Uruguay. Collection localities and accession number information for all materials are shown in Table 2-1. DNA was also extracted from 43 F2 individuals derived from a hybrid between P. dilatatum ssp. flavescens and P. dilatatum Virasoro to analyze segregation patterns of loci and possible linkage rela tionships. Deviation from exp ected segregation ratios and

PAGE 28

16 linkage between loci were assessed using Jo inmap 3.0 (Van Ooijen and Voorrips, 2001). When there were indications that more than one locus had been amplified by a primer pair (see below), the loci were considered as putative homeologs and the absence of linkage between them regarded as a test for their homeology. Table 2-1. Accession numbers and collection locati ons of the plant material used to test microsatellite transferability among biotypes Species or biotype Individual Accession number Location P. dilatatum ssp. flavescens 1 PI 508720 Pila, Buenos Aires, Argentina 2n=4x=40 (IIJJ) 2 PI 508722 Route 41, 1.0 km W of General Belgrano, Buenos Aires, Argentina 3 N.A.7355 Route 3 near Trinidad, Florida, Uruguay 4 N.A.7363 Route 8 km 34.3, Canelones, Uruguay 5 N.A.7434 Riachuelo, Colonia, Uruguay 6 N.A.7439 Route 12, 600 m N of Route 9, Maldonado, Uruguay 7 N.A.7468 Route 56 km 51.500, Florida, Uruguay 8 N.A.7470 Route 11 km 65.600, San Jos, Uruguay 9 N.A.7476 Route 9 km 227, Rocha, Uruguay 10 N.A.7492 Route 6 km 189.600, Florida, Uruguay P. urvillei 1 PI 509008 Ivoti, Cascata de So Miguel, about 45 km N of Porto Alegre, Rio Grande do Sul, Brazil 2n=4x=40 (IIJJ) 2 PI 509010 Route BR 116, 6 km N of Pelotas River, Santa Catarina, Brazil 3 PI 509012 Route 8, 162 km W of Buenos Aires, Buenos Aires, Argentina 4 PI 509013 Villa Nueva, 3 km S of Villa Maria, Crdoba, Argentina 5 PI 164065 Florianopolis, Santa Catarina, Brazil 6 N.A.2957 Route 26, km 25, Paysand, Uruguay 7 N.A.7392 Road to Las Cumbres de La Ballena, Maldonado, Uruguay 8 N.A.7389 Route 7, km 103, Florida, Uruguay 9 N.A.7390 Route 29 near Minas de Corrales, Rivera, Uruguay 10 N.A.7199 Balneario Sols, Maldonado, Uruguay P. dilatatum Virasoro 1 N.A.7207 Gobernador Virasoro, Corrientes, Argentina 2n=4x=40 (IIJJ) 2 Garruchos, Corrientes, Argentina. Voucher: BAA24352 P. dilatatum Vacaria 1 PI 404370 Near Vacaria, 192 km on Route BR 116, N of Porto Alegre, Rio Grande do Sul, Brazil 2n=4x=40 (IIJJ) 2 PI 404382 On Route BR 285, 10 km west of Vacaria, Rio Grande do Sul, Brazil P. dasypleurum** 1 Botanical Garden, Valdivia, Chile 2n=4x=40 (IIJJ) 2 Genera l Lagos, Valdivia, Chile P. dilatatum ssp. dilatatum 1 N.A.7542 Quebrada de los Cuervos, Treinta y Tres, Uruguay 2n=5x=50 (IIJJX) 2 N.A.7673 Ma soller, Rivera, Uruguay *Accession numbers preceded by PI correspond to the Southern Plant Introduction Station, Griffin, GA, USA. Numbers preceded by N.A. correspond to the Germplasm Bank at the F acultad de Agronoma, Montevideo, Uruguay. ** Seeds of P. dasypleurum were kindly provided by Ing. For. Rodrigo Verg ara from the Universidad Austral de Chile and the University of Florida. F1 hybrids were obtained by manually emasculating a plant of P. dilatatum ssp. flavescens and pollinating it with pollen from an individual of P. dilatatum Virasoro.

PAGE 29

17 Emasculation and pollination were carried out ab out one hour after sunrise. The plants to be emasculated were placed at approxim ately 20C and 100% RH to delay anther dehiscense after anthesis was initiated each morning. Mature full seeds were counted and germinated in Petri dishes on filter paper in an incubator with alternating temperatures (16 h at 30C light, 8 h at 20C dark). Germinators were placed at 4C for 4 days prior to incubation to break dormancy and homogenize ge rmination. The resulting progeny were grown and the hybrids were identified by the high number of nerves in glume II and lemma I which characterize the pollen donor. Selfed seed of one F1 hybrid was collected and treated as described above to establish the segregating F2 progeny used in this study. Amplification and Scoring For all plant materials DNA was extracted from fresh leaves or silica-gel-dried leaves using Sigma GeneluteTM kit (Sigma-Aldrich, St. Louis, MO) according to the manufacturerÂ’s instructions. Amplification, labeling, and separation condi tions were adjusted for all primer pairs following Boutin-Garn ache (2001). Forward primer s were extended by adding an M13 tail (5Â’-CACGACGTTGTAAAAC-3Â’), a nd M13 primers were labeled with D4 (Beckman Coulter, Fullerton, CA). All PCR am plifications were carried out in 10 L reactions containing 0.2 units of NEB Taq pol ymerase (New England Biolabs, Beverly, MA), 1.5 mM MgCl2, 0.15 M of the reverse primer and labeled M13 primer, 0.01 M of the extended forward primer, and 0.1 mM of each dNTP in the manufacturerÂ’s buffer. Amplification was carried out in a Biometra T3 Thermoblock with the same two-step program for all primer pairs. The PCR profile consisted of an initia l denaturing step of 5 min at 94C, followed by 40 cycles of 15 sec at 94C and 3 min at 53C, and a final extension step of 5 min at 72 C. Labeled microsatellite products were separated in a

PAGE 30

18 CEQ 8000 capillary sequencer (Beckman-Coulte r, Fullerton, CA) by loading 0.75 L of the PCR product and 0.35 L of CEQTM DNA Size Standard Kit-400 (Beckman Coulter, Fullerton, CA) in 25L of formamide per well. Chromatograms were visualized on CEQ TM Genetic Analysis system soft ware (Beckman Coulte r, Fullerton, CA) and scored manually. Alleles in different size ranges from di fferent biotypes or subspecies were sequenced to assess homology. For primer pa irs amplifying a single locus, alleles were amplified and sequenced directly from the PCR products of homoz ygous individuals. For primer pairs amplifying more than one putative locus, PCR products were separated in 2% agarose, and the bands were cut, purified with Wizard SV Gel and PCR Clean-up System (Promega, Maddison, WI), and sequenc ed directly. When multiple bands could not be separated in the gel, gel slices c ontaining several bands were cut and combined products cloned with a TOPO TA Cloning kit. Results Capture and Amplification Success A total of 24 clones containing (GT)n repeats were captured and sequenced. Four clones were redundant. Primer pairs were designed for all clones, and all loci were amplified with the same two-step PCR profile detailed above. Fifteen of these primer pairs successfully amplified interpretable band pa tterns, and twelve of them were selected for further analysis based on a preliminary assessment of amplification success under the given conditions. Primer pairs for loci Pdfl1, Pdfl2, and Pdfl26 are reported but not further characterized (Table 2-2). Primer sequences, flanking sequence lengths, and repeat units for all successfully amplified loci are shown in Table 2-2.

PAGE 31

19 Table 2-2. Primer sequences and structure for al l the microsatellite loci reported in this study. When sequence information is avai lable for more than one allele, the variable repeat motif is reported. GenBank accession numbers for the originally cloned sequence used to de sign each primer pair are given in parentheses. Primer pairs Pdfl6, Pdfl12, Pdfl15, Pdfl 20, and Pdfl22 amplified more than one band in all tetraploid individuals, most of which appeared homozygous for all the other loci (Fig 1b, g, h, j, and k). In these cas es, representative bands from both size ranges were cloned, sequenced, and compared with the originally captured se quences (Fig. 2-2). Two of the extra bands, a Pdfl12 190-bp band in P. dilatatum ssp. flavescens and a 140Primer pair or locus Primer sequences (5Â’-3Â’) flanking sequence length (bp) Repeat unit Focal loci Pdfl1 (DQ110403) F-GGGCGTGACAAGATTGAGAG R-GATCCAACTCCTGGGATCAA 157 (TG)26C(GT)5 Pdfl2 (DQ110403) F-GTCTTCTACGCGACAATGTA R-AAATGGTGGACGACACCTCT 170 (AT)5(GT)31 Pdfl4 (DQ110403) F-TGGCTCATGTCAACCATGTC R-CTGGAGACCAAGCAAACAGG 161 (TG)16 Pdfl6a (DQ110403) F-GGTCCATCCTGCTGATGAAG R-AGCAGCACAACCTGCTGAG 167 (GT)37 Pdfl7 (DQ110403) FTAGGCTGCGGAATCAACTTT R-ACAAGGACAAACCGACTGCT 189 (GT)21 Pdfl8 (DQ110403) F-AGGCTGCAGAAGACTCCAAA R-GCCACCTAC TCCCCTCTGTA 182 (GT)17 Pdfl10 (DQ110403) F-GCTCATCAAATATGACTGAACCA R-TCTTACGTCCCACCCAAATC 142 (TG)8CG(TG)21 Pdfl11 (DQ110403) F-AAGAAGCCATTGGGTCTGG R-CATGCATGCCTACACACAGA 142 (TG)12 Pdfl12a (DQ110403) F-TTCCTTTGTCAGTTCACTTCCAT R-ACAAACTGTGCGACAAGTGC 155 (TA)2 (GT)26 Pdfl15a (DQ110403) F-AACCACTGTGTGAAGCTTGCTA R-TGTGCACACTCATCGAAAGA 152 (GT)2GC(GT)43 Pdfl18 (DQ110403) F-GGAAGGTTCAGCAACGGATA R-GATAAGGCGGAGGGCTACTT 196 (GT)12 Pdfl20a (DQ110403) F-CTGGCCACTTCTTTGGACAT R-CGGCACTAGTTGCCTGAAA 162 (TA)8(TG)20 Pdfl22a (DQ110403) F-GCATGCTGTTGTCTTTTGCT R-TTCCCTCGCCTCTGCTAGT 137 (CT)2(GT)30 Pdfl26 (DQ110403) F-ATCGGCATGCTACAAGTTCC R-TCTCATGTTCATTGCTGAAGTG 99 (CT)20GC(GT)32 Pdfl28a (DQ110403) F-AAAATACCCGTGCGTTGCTA R-CCACGCCATGTCGTCTACTA 159 (TG)32 Non-focal loci Pdfl6b 148 (TG)2 Pdfl12b 158 (TA)2 AT (GT)6(GA)8 Pdfl15b 176 (TA)4 (GT)6 Pdfl20b 173 (T)10 Pdfl20-3 151 (TA)6 Pdfl22b 136 (CT)4 (GT)11 Pdfl28b 147 (TG)2 Chloroplast locus cpDilB (DQ104323) F-GGGAATCCGTAAAATGTCAGA R-GAAAAATTGATTTGCGAATTAGAGA 191 (T)11

PAGE 32

20 165 175 185 195 205 215 225 235 245 255 265 275 285 l)Pdfl28a Pdfl7 210 220 230 240 250 260 270 280 k)Pdfl22a 180 190 200 210 220 230 240 250 260 270 175 185 195 205 215 225 235 245 255 265 275j)Pdfl20a i)Pdfl18 235 245 255 265 275 285 295 305 195 205 215 225 235 245 255 265 275 285 295 305 315 325 335 345 355 f)Pdfl11 120 130 140 150 160 170 180 190 200 210 220 230 240 e)Pdfl10 160 170 180 190 200 210 220 230 240 250 d) Pdfl8 170 180 190 200 210 220 230 240 250 260 270 h)Pdfl15a Pdfl6a 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 Pdfl4 170 180 190 200 210 220 230 240 250 g)Pdfl12a P. dilatatum ssp. flavescensP. urvilleiVirasoro Vacaria P. dasypleurum ssp. dilatatum123456789101234567891012 121212 P. dilatatum ssp. flavescensP. urvilleiVirasoro Vacaria P. dasypleurum ssp. dilatatum123456789101234567891012 1212122(12bp) 2(2bp) 6(26bp) 4(8bp) 2(2bp) 5(40bp) 2(2bp) 3(6bp) 2(6bp) 4(12bp) 2(9bp) 3(40bp) 2(10bp) 10(110bp) 2(16bp) 6(50bp) 3(4bp) 4(60bp) 2(1bp) 4(12bp)10(120bp) 6(30bp) 3(6bp) 165 175 185 195 205 215 225 235 245 Fragmentlength(bp) Fragmentlength(bp)Biotype Biotype 165 175 185 195 205 215 225 235 245 255 265 275 285 165 175 185 195 205 215 225 235 245 255 265 275 285 165 175 185 195 205 215 225 235 245 255 265 275 285 165 175 185 195 205 215 225 235 245 255 265 275 285 l)Pdfl28a Pdfl7 210 220 230 240 250 260 270 280 210 220 230 240 250 260 270 280 210 220 230 240 250 260 270 280 k)Pdfl22a 180 190 200 210 220 230 240 250 260 270 180 190 200 210 220 230 240 250 260 270 180 190 200 210 220 230 240 250 260 270 175 185 195 205 215 225 235 245 255 265 275 175 185 195 205 215 225 235 245 255 265 275 175 185 195 205 215 225 235 245 255 265 275j)Pdfl20a i)Pdfl18 235 245 255 265 275 285 295 305 235 245 255 265 275 285 295 305 235 245 255 265 275 285 295 305 235 245 255 265 275 285 295 305 195 205 215 225 235 245 255 265 275 285 295 305 315 325 335 345 355 195 205 215 225 235 245 255 265 275 285 295 305 315 325 335 345 355 195 205 215 225 235 245 255 265 275 285 295 305 315 325 335 345 355 f)Pdfl11 120 130 140 150 160 170 180 190 200 210 220 230 240 120 130 140 150 160 170 180 190 200 210 220 230 240 120 130 140 150 160 170 180 190 200 210 220 230 240 e)Pdfl10 160 170 180 190 200 210 220 230 240 250 160 170 180 190 200 210 220 230 240 250 160 170 180 190 200 210 220 230 240 250 d) Pdfl8 170 180 190 200 210 220 230 240 250 260 270 170 180 190 200 210 220 230 240 250 260 270 170 180 190 200 210 220 230 240 250 260 270 h)Pdfl15a Pdfl6a h)Pdfl15a Pdfl6a 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 Pdfl4 170 180 190 200 210 220 230 240 250 170 180 190 200 210 220 230 240 250 170 180 190 200 210 220 230 240 250 g)Pdfl12a P. dilatatum ssp. flavescensP. urvilleiVirasoro Vacaria P. dasypleurum ssp. dilatatumP. dilatatum ssp. flavescensP. urvilleiVirasoro Vacaria P. dasypleurum ssp. dilatatum123456789101234567891012 121212 12345678910 1234567891012345678910 1234567891012 12 12 1212 1212 12 P. dilatatum ssp. flavescensP. urvilleiVirasoro Vacaria P. dasypleurum ssp. dilatatumP. dilatatum ssp. flavescensP. urvilleiVirasoro Vacaria P. dasypleurum ssp. dilatatum123456789101234567891012 121212 12345678910 1234567891012345678910 1234567891012 12 12 1212 1212 122(12bp) 2(2bp) 6(26bp) 4(8bp) 2(2bp) 5(40bp) 2(2bp) 3(6bp) 2(6bp) 4(12bp) 2(9bp) 3(40bp) 2(10bp) 10(110bp) 2(16bp) 6(50bp) 3(4bp) 4(60bp) 2(1bp) 4(12bp)10(120bp) 6(30bp) 3(6bp) 165 175 185 195 205 215 225 235 245 165 175 185 195 205 215 225 235 245 165 175 185 195 205 215 225 235 245 Fragmentlength(bp) Fragmentlength(bp)Biotype Biotype Fig. 2-1. A graphical representation of all the microsatellite alleles amplified for a sample of each biotype. Fragment lengths are plotted as scored including the M13 primer extension (19bp). Number of alleles within biotype are given for P. dilatatum ssp. dilatatum and P urvillei for those loci that showed variability within biotypes. The corresponding maximum fragment size difference is shown in parenthesis

PAGE 33

Fig. 2-2. Alignment of nucleotide sequences of representative alle les for the non-focal loci compar ed to the originally cloned sequences. Primer sequences are not in cluded. All putatively homologous variable and non-variable repetitive sequences near or around the main microsatellite are highlighted for comparison 21 a) Pdfl6 Pdfl6a Clone C-AACTCCAGCAGCTGCTTT---GGT-TTGATACTAATTGTATATAAGTCGATTGCTTA-TTTTGCGTTA-ACTATTGCTGTGTCATTTTGGCGCGCTGTTTCTTTCCCTTCTT CATTTCGAGGTAGCT (GT)36 G Pdfl6a Dil 1 .-......C.........AA---...-............A...G..T..T.........-..........-G....C......-.C.......A............T....... ............... (GT)6 T Pdfl6a Vir 1 .-......C.........AA---...-............A...G..T..T.........-..........-G...........-.C.......A............T....... ............... (GT)8 G Pdfl6a Dil 1 .-......C.........AA---...-............A...G..T..T.........-..........-............-.C.......A............T....... ............... (GT)7 G Pdfl6b Flav7 .GT...............AATTT...A............A...G..T..T.........T..........C.G..........-.CAG..----..------------------..-----.....-T CTGTGCGTG b) Pdfl12 Pdfl12a Clone AATATCACACCTGCATATTGTAAGATTAGTACATGTATGAACCGACTTAA(TA)2 (GT)26 GCATG CG T (CT)2ACTAAAGGCAAGTTACCTAGTGAAAGTTATTTCACATGTACTGTTTAGA Pdfl12b Urv 1 ..................C............T...........A..AC..(TA)2 AT (GT)6(GA)8GTGCA (CG)3 T (CT)2.............G...............................A... Pdfl12b Vir 1 ..................C............T...........A..A...(TA)2 AT (GT)6(GA)8GTGCA (CG)3 T (CT)2.............G...............................A... Pdfl12b Flav1 ..................C............T...........A..A...(TA)2(AT)2(GT)4(GA)5GTGCA (CG)3 T (CT)2........-......................-.............A... Pdfl12a Vac 1 ...............................T.................. TA GA GT (CT)2-............-...............................A... c) Pdfl15 Pdfl15a Clone CACAGTCAATGTCACATTTGGCACAAAGTGAGTGA---(GT)2GC(GT)43 -------------------------Pdfl15b Vir 1 ...........G......G.A.......G.-----TGCC(TA)4 (GT)6 GATACTAAATACTAACAATGCTTTAT Pdfl15b Flav1 ...........G......G.A.......G.-----TGCC(TA)4 (GT)5 GATACTAAATACTAACAATGCTTTAT Pdfl15a Clone AAGGTTATGGATATAGGAAGACAAGGCATATGTAGATAGAAGAGAAACCCAAACTGGGACTAGAATTCGGATACTCTTTCGATGAG Pdfl15b Vir 1 ..............G...........T..................................T........................ Pdfl15b Flav1 ..............G...........T..................................T........................ d) Pdfl20 Pdfl20a Flav1 AAGG (TA)8(TG)20--ATTCTTTTGATATGCTCCCTTGTAT----AGTTGCCACCT(TC)6 (T)3 GCTAAATGTATACTTTCCTTAA-CGCTGCTGAATATTTGTTAAGAACTAAACAATCTGCCGATATTATG Pdfl20b Flav1 .... (TA)4 CG........T..........C.....GTAT...........(TC)2 C(T)2G(T)4G(T)8 ....G....C..G.........-.T.....................A............T......... Pdfl20b Vir 1 .... (TA)4 CG........T..........C.....GTAT...........(TC)2 C(T)2G (T)10....G....C..G.........-GT.....................A............T......... Pdfl20-3 Dil 1 .... (TA)6 TG --...................C.....----......T...-(TC)4 (T)3 ........GC............A.T........-------------A........A............. e) Pdfl22 Pdfl22a Clone CAAGCCT(CT)2 (GT)30CCGCGCGTGCACATGCATGGCGGCATGGCGCGCTTTGGCCGTTGGCCGATGCTTGCTGACTGAATCACTGAATGCTGGAGCTGAGCATGCAG Pdfl22a Vir 1 .......(CT)10 (GT)11....................................................................C............C........GA Pdfl22b Vir 1 .......(CT)4 (GT)11........................................................A.............G........T.C.........A f) Pdfl28 Pdfl28a Clone CAGGAACAATCTAGCCACGGTGTGGTGCGTATATTTCGCATTGGGCGGTGTATAGA(TG)32-------------------AATTTTGAAGAACAATGACAACCAT-AGTTTG-TCATAGTGTTTTCAAACTTCAAAGATAAGTCA Pdfl28a Urv 1 ........................................................(TG)11-------------------.........................-......-................................ Pdfl28a Dil 1 ........................................................(TG)11-------------------.........................-......-................................ Pdfl28a Dil 1 ......T...G.................T...........................(TG)10-------------------....................G....-......-................................ Pdfl28b Dil 1 ----------------------...A---....A...T-....A..A......T..(TG)2.TTTCCCAGCATGTTTTTTGG.........T.............CG.T....G.T.......G.CT-------..G....C....

PAGE 34

22 bp band in P. urvillei did not contain the forward primer sequence. These bands were in fact reproduced by using just the labeled M13 primer and the reverse primer for each locus. These bands were not further scored a nd are not shown in Fig. 2-2. In all the other cases, the extra bands showed extensive sequenc e similarity to the captured alleles (Fig. 2-2). The loci for which the primers were or iginally designed will be referred to as the focal loci. When two differe nt loci were detected, the focal locus was identified by adding “a” to the primer pair name. For most non-focal loci, fragment sizes were smaller than the captured bands, and the microsatellite repeat was either absent or showed a lower number of repeats. The only exception was the Pdfl12a 140-bp allele in Vacaria which was smaller than the non-focal locus Pd fl12b. Representative allele sequences are shown in Fig. 2-2. For Pdfl20 and Pdfl28, an extra band was present in the apomictic pentaploid relative to tetraplo ids (Fig. 2-2j and l). These bands were sequenced, and they showed again extensive similarity to the captured loci (Fig. 2-2). When more than one locus was amplified by a primer pair, alleles were assigned to either putative homeologous locus based on the sequences shown in Fig. 2-2. Homeologous loci are expected to be complete ly unlinked because they necessarily lie on different chromosomes. Linkage analysis based on the segregating F2 population showed no evidence of linkage between loci amp lified by the same primer pair with recombination frequencies ranging from 0.3664 to 0.4371 and LOD scores from 0.03 to 1.09 (significance threshold LOD equal to 3) (Table 2-3). In addition, no significant linkage was obser ved when considering the full set of 16 loci (including non-focal loci), even at a low LOD score threshold level of 2. Although the test for independence between loci as implemented in Joinmap is robust against

PAGE 35

23 segregation distortions, it is reassuring that all but one locus (PDfl15a) showed segregation ratios in agreement w ith the expectations (Table 2-4). Most loci were amplified in all materials tested with a few exceptions (Fig. 2-1). Paspalum urvillei could not be scored for Pdfl7 and Pdfl10. Pdfl7 was not amplified at all in most P. urvillei samples, whereas for Pdfl10, weak peaks were observed but could not be reliably scored probably due to in terference during PCR from the M13-primed fragment mentioned above. Paspalum dilatatum Virasoro showed null alleles for Pdfl18 and Pdfl12a, and P. dasypleurum did not produce fragments for Pdfl15. Locus Pdfl22b amplified consistently only in P. dilatatum Virasoro and P. dilatatum ssp. dilatatum Table 2-3. Estimated recombination frequenc y between pairs of loci amplified by the same primer combination, and LOD sc ore for the test of independent segregation between them. Significant threshold LOD=3 Locus pair Recombination frequency LOD Pdfl12a vs Pdfl12b 0.4326 1.09 Pdfl15a vs Pdfl15b 0.3664 0.38 Pdfl20a vs Pdfl20b 0.3665 0.21 Pdfl22a vs Pdfl22b 0.4371 0.03 Table 2-4. Test of the segregation ratios per microsatellite locus. Genotypes coded as: ‘a’ homozygous flavescens allele, ‘b’ homozygous Virasoro allele, ‘h’ heterozygous, ‘c’ dominant allele from Virasoro, and ‘d’ dominant from ssp. flavescens .Locus a h b c d ratio chi-square df p Pdfl4 13 22 8 0 0 1:2:1 1.2 2 0.549 Pdfl6 14 18 11 0 0 1:2:1 1.6 2 0.449 Pdfl7 16 17 10 0 0 1:2:1 3.6 2 0.165 Pdfl8 9 22 12 0 0 1:2:1 0.4 2 0.819 Pdfl10 17 20 6 0 0 1:2:1 5.8 2 0.055 Pdfl11 6 21 16 0 0 1:2:1 4.7 2 0.095 Pdfl12a 0 0 15 0 28 3:1 2.2 1 0.138 Pdfl12b 7 28 8 0 0 1:2:1 4.0 2 0.135 Pdfl15a 5 21 17 0 0 1:2:1 6.7 2 0.035 Pdfl15b 10 20 13 0 0 1:2:1 0.6 2 0.741 Pdfl18 0 0 10 0 33 3:1 0.1 1 0.752 Pdfl20a 8 25 10 0 0 1:2:1 1.3 2 0.522 Pdfl20b 14 20 9 0 0 1:2:1 1.4 2 0.497 Pdfl22a 7 25 11 0 0 1:2:1 1.9 2 0.387 Pdfl22b 8 0 0 35 0 3:1 0.9 1 0.343 Pcfl28 12 19 12 0 0 1:2:1 0.6 2 0.741

PAGE 36

24 Variability All biotypes showed polymorphisms for at least two loci. On the other hand, several alleles were mostly fixed within bi otypes but variable among biotypes. Notably Pdfl7 provided excellent biotype-s pecific markers for this sample (Fig. 2-1c). Pdfl6b was the only invariable locus scored in this sample. At least two different alle les were cloned and partially sequenced from the focal biotype for Pdfl4, Pdfl6a, Pdfl11, Pdfl12a, Pd fl22a, Pdfl15a, and Pdfl28a. Despite the effect of the long repetitive tr act on the quality of the sequence, it can be clearly seen that variation in the focal loci is due to expansion/contract ion of the (GT/CA)n repeat (data not shown). Despite being the source biotype, P. dilatatum ssp. flavescens does not display the greatest variability nor allele sizes in this sample (Fig 21). The average number of alleles for P. dilatatum ssp. flavescens is 2.5 with an average si ze range per locus of 9.9 bp Paspalum urvillei showed a higher number of allele s per locus (3.9) and a higher size range (28.9 bp); furthermore, P. urvillei showed polymorphisms fo r all the scored loci, and all the individuals except 3, 7, and 8 were heterozygous for at least one locus whereas in P. dilatatum ssp. flavescens only individual 7 appeared heterozygous for locus Pdfl6a. The two individuals sampled from Virasoro and Vacaria were completely homozygous, whereas heterozygosity was obser ved in both individuals of P. dasypleurum (Fig. 2-1e, j, h). The two individuals of P. dilatatum ssp. dilatatum were heterozygous for all loci except individual 2 at locus Pdfl22b (Fig. 2-1k). In summary, 19 variable nucle ar microsatellite loci were investigated, with one locus monomorphic in all the accessions (Pdf l6b). Among the 18 variable loci, 11 were successfully amplified and interpreted in all the biotypes in this sample. Of the original

PAGE 37

25 12 focal loci, 4 could not be scored in one of the biotypes: Pdfl7 and Pdfl10 in P. urvillei Pdfl18 in Virasoro, and Pdfl15a in P. dasypleurum Three of the non-focal variable loci (Pdfl12b, Pdfl15b, and Pdfl20b) were successfully amplified and scored for all individuals, while Pdfl22b was only amplifie d in Virasoro, the pe ntaploids, and one individual of P. urvillei, and finally, two loci (Pdfl20-3 and Pdfl28b) were only amplified in the pentaploids. Chloroplast Variability All regions were successfully amplif ied and sequenced except for the trnT (UGU)trnL (UAA) spacer for which low-quality sequences were obtained due to the presence of poly-A tracts near both ends (Gen Bank accession nos. DQ104273-DQ104323). No further efforts were made to improve the quality of the sequences of the (UGU)trnL (UAA) spacer because they were considered appropriate for the purposes of this study. Overall, no sequence variability wa s found among the biotypes of the Dilatata group except for the length of the poly-A tract in the trnT (UGU)trnL (UAA) spacer, and a G-T transversion in the trnL (UAA) intron in the Vacaria in dividual. No repetitive sequences were found except for poly-A/T tracts Fragment sizes we re not variable for any of the loci reported by Provan et al. (2004) or the poly-A repeat located near the trnL (UAA)5Â’ exon in the trnT (UGU)trnL (UAA) spacer. Only the poly-A repeat located near trnT (UGU) (cpDilB) was variable as observed in the original sequences. Fragment lengths (after subtracting the M13 tail) were 198 bp for P. dilatatum ssp. flavescens ssp. dilatatum Virasoro, and Vacaria, 199 bp for P. urvillei and 197 bp for P. dasypleurum No intrabiotypic variability was obs erved except for individual 2 in P. urvillei which contained the 198-bp allele.

PAGE 38

26 Discussion Capture Efficiency Among the loci reported here, Pdfl2, Pd fl12a, Pdfl15b, and Pdfl20a were found to be compound (CA/GT)n (AT/TA)n repeats (Table 2-2). In a genome-wide survey in rice, Temnykh et al. (2000, 2001) found that (CA)n repeats were frequently associated with (TA)n repeats. In genome-wide surveys of grasses, (CA)n repeats have been reported to be relatively short compared to other dinucle otides (Temnykh et al. 2000). During the enrichment phase of the capture protocol, this may have led to the retention of a limited number of longer repeats, which may explai n the high level of re dundancy (4/24) of the captured clones. A strong bias towards l ong repeats may be advantageous because the length of the perfect repeats is expected to be associated with higher degrees of variability (Symonds et al. 2003). Here, loci with more than 30 perfect repeats (Pdfl6, Pdfl15a, Pdfl22, and Pdfl28) revealed the highe st number of alleles per locus in both P. dilatatum ssp. flavescens and P. urvillei. Amplification Profile Low temperatures during the PCR extension step have been suggested to reduce the generation of frameshift pr oducts (commonly known as “s tutter”), particularly for fragments containing (CA)n repeats (Hite et al. 1996). Under standard PCR conditions like those used here, though, ex tension temperature cannot be reduced below the desired annealing temperature. In preliminary am plifications a noticeable reduction in the number of stutter peaks was observed, particularly for long alleles, when extension was carried out at 53C rather than at 72C, while even lower temperatures resulted in the production of locus-nonspecific products. However, the use of a single, robust

PAGE 39

27 amplification profile does not require the adjustment of annealing and extension temperatures for each primer pair individuall y, and greatly increases logistic efficiency when simultaneously working with multiple primer pairs. Non-Focal Loci Most studies focus on primer pairs that am plify highly variable single loci. In this study, all bands were taken into account becau se stable, biotype-specific, co-dominant markers could be extremely useful for hybrid analyses within the complex. Sourdille et al. (2001) analyzed a set of wheat microsat ellite primer pairs in cluding primers that amplified more than one locus taking into account their known chromosomal locations and transferability. In that study, 54% of the primer pairs amplified more than one locus, including cases in which the extra bands we re monomorphic, independently segregating variable loci or co-s egregating linked markers. These re sults are very similar to the ones obtained in this study, in which 50% of the primer pairs amp lified more than one putative locus. In this study, however, extra bands were either monomor phic or independently segregating, but no putative tandem duplicati ons were found. Definitive assessment of homeology would require a genetic map showing that the loci are lo cated in syntenic homeologous chromosome segments. The number of products amplified was always equal to or less than the number of loci expected for a tetraploid amphiploid, alwa ys consistent with the interpretation that primer pairs were amplifying products from e ither one or the two genomes. Remarkably, primer pair Pdfl20 amplified a number of ba nds exactly corresponding to the ploidy level in heterozygous individuals.

PAGE 40

28 Nuclear Loci At least two variable loci were identif ied for each of the biotypes including the three sexual tetraploids represented by only two i ndividuals. It is likel y then that if more individuals were analyzed, this set of loci could contain useful markers for population structure and breeding system assessm ent of all the biotypes in the group Overall, the focal species showed less variation than P. urvillei Only in 25% of the loci (Pdfl4, Pdfl6a, Pdfl20a, and Pdfl28) did P. dilatatum ssp. flavescens show consistently longer repeats than P. urvillei It is typically expected that due to selection for long repeats during library enrichment, longer repeats and hi gher variability are more likely to be found in the focal biotype (Ellegren et al. 1995), an artifact known as ascertainment bias. However, P. urvillei consistently showed more variability and a much higher level of heterozygosity for most loci. A higher number of alleles was captured in P. urvillei even at loci for which the average fragment length was clearly lower than in P. dilatatum ssp. flavescens (Fig 2-2 g, j) which cont radicts the accepted consensus that repeat number and variability are associated rega rdless of the causes of this correlation (Schlterer 2000). A statistical comparison of variab ility within different biotypes is beyond of the scope of this paper; however, the clear differences in variability and heterozygosity between P. dilatatum ssp. flavescens and P. urvillei are likely to be real despite the small sample size presented here. Amos et al. (1996) claim that heterozygosity may lead to an increase in mutation rates at microsatellite loci. This may seem to be the case when comparing P. dilatatum ssp. flavescens and P. urvillei ; however, the stochastic effects of the restricted distribution of P. dilatatum ssp. flavescens and its apparently extreme selfing rate may deserve further investigation as putative explanations for the observed “reverse ascertainment bias”. The relative distance be tween the species analyzed should also be

PAGE 41

29 taken into account to interpre t meaningfully cross-amplifi cation and ascertainment bias. The I, J, and X genomes within the Dilatata polyploids can be considered to represent different species because they are implicitly assumed to have diverged independently as different diploid species between their co alescence time and the polyploidization event that brought them back together. When the putative homeologous sequences shown in Fig.2-2 are compared, a strong as certainment bias is evident in all of them. Similar flanking sequences combined with shorter a nd imperfect repeats like those found in the non-focal loci in this study were found by Chen et al. (2002) when they amplified microsatellites developed for Oryza sativa in congeners contai ning different genomes. Variation was also found betw een the two individuals of P. dilatatum ssp. dilatatum These two individuals share 13 heterozygous allele combinations, making it very unlikely that the thr ee differences found (Pdfl15a and Pdfl22b, Fig. 2-1 h and k, respectively) are due to a sexual recombinati on event or independent origins. However, enough mutations seem to have accumulated in this clonal biotype to observe variability with this set of microsatellite loci. Alleles found in P. dilatatum ssp. dilatatum in eight loci are also present in Virasoro, suggesting that this tetraploid coul d have been involved in the origin of the pentaploid biotype. The pentap loids could not have arisen di rectly from a cross involving the Virasoro genotypes analyzed here because the pentaploids are heterozygous for loci for which Virasoro shows null alleles (Pdf l12a and Pdfl18). More intra-biotypic variability must be analyzed, but the markers developed in this study seem to have great potential for assessing the relationships among the sexual and apomictic components of the Dilatata group

PAGE 42

30 Clustering and uneven genomic distribution of (CA)n motifs has been reported in several genomes (Elsik and Williams 2001, Schmidt and Heslop-Harrison 1996); however, no close linkage was detected among the loci analyzed in this study. Any subset of these loci can then be chosen fo r a specific applicati on based on amplification consistency and variability to provide independent characters. Chloroplast Microsatellites Even though cpDilB was the only variable chloroplast microsatel lite identified, it could potentially be very informative for assessing hybridization among biotypes because the chloroplast genome is inherited as a singl e cohesive group and different alleles are fixed within biotypes Paspalum urvillei is the most widespread of the sexual members of the Dilatata group, and its current range overlaps with thos e of the rest of its members. Putative hybrids can be confirmed or P. urvillei can be ruled out from being the female progenitor by using this marker. In this sample, individual 2 of P. urvillei was the only one that showed a chloroplast allele that is not typical of its biot ype. This accession was indeed collected near the area of co-occu rrence with biotype Vacaria with which P. urvillei has been reported to hybr idize (Valls and Pozzobon 1987). Our ability to identify this putative hybrid confirms the utility of this marker. Conclusions Nuclear and chloroplast markers are repor ted with potential applications in population genetics and phylogene tic studies within the Dila tata group. Highly variable nuclear markers can be used to address popul ation structure and breeding system issues for all the biotypes in the group. On the othe r hand, more stable biotype-specific loci may be used as co-dominant markers to assess the relationships among biotypes and particularly the origin of the apomictic components of the complex. The variable

PAGE 43

31 chloroplast microsatellite locus reported may in turn provide valuable information about the relationship between the most widesp read sexual member of the complex ( P. urvillei ) and the rest of the biotypes.

PAGE 44

32 CHAPTER 3 BREEDING SYSTEM AND POPULATION GENETIC STRUCTURE OF Paspalum dilatatum ssp. flavescens (POACEAE). Introduction Paspalum dilatatum Poir. is a warm-season grass native to the grasslands of temperate and subtropical South America. The species includes several tetraploid, pentaploid and hexaploid forms. The common pentaploid form ( P. dilatatum ssp. dilatatum ) was one of the first warm-season grasses to be cultivated for pasture (Skerman and Riveros 1992), however, its commercial use has been limited by poor seed production and susceptibility to ergot ( Claviceps paspali ). The pentaploid biotype reproduces by apomixis (Bashaw and Holt 1958) and it has been a ssigned the IIJJX genomic formula (Burson 1983). Because no sexuality has been reported in this subspecies and collections have not provide d much variability for the characters of interest, efforts were soon undertaken to elucidate its relationships with other Paspalum species in the hope that a breeding strategy could be devised. As a consequence of extensive collections and cytogenetic investigations in P. dilatatum and related species, three sexual tetraploid biotypes with the II JJ genomic formula have been identified and are usually included in the species ( P. dilatatum ssp. flavescens Roseng. Arr. et Izag., and biotypes Virasoro and Vacaria). Burson (1983) proposed that recombinant IIJJX pentaploids could be synthesized by crossing on e of the sexual biotypes and an apomictic hexaploid with the IIJJXX genomic formula. This genomic formula was later assigned to the hexaploid biotypes Chir and Urugua iana (Burson 1991, 1995), and synthetic

PAGE 45

33 pentaploids have been readily produc ed (Burson 1991b, 1995, Speranza 1994 unpubl. res.) and show excellent forage potential. As only one population is known for Chir, and probably both Chir and Uruguaia na are very likely a single clone, genetic variability for the breeding scheme mentioned above must co me from the tetraplo id parent. Among the tetraploids, P dilatatum ssp. flavescens is morphologically the most similar to the common pentaploid biotype. The forage potential of P. dilatatum ssp. flavescens itself has been assessed and compared with that of other biotypes. Be sides a lower production potential, this biotypeÂ’s pr oduction is more concentrated in the spring (Millot 1969) Paspalum dilatatum ssp. flavescens produces more seed than the pentaploids and it is thought to be more resistant to Claviceps. Paspalum dilatatum ssp. flavescens is currently distributed in sout hern Uruguay and the eastern province of Buenos Aires, Argentina (Rosengurtt et al. 1970) Paspalum dilatatum ssp. dilatatum is also found throughout the range of P. dilatatum ssp. flavescens The tetraploid subspecies can be distinguished from the pentaploids by its more erect and usually taller culms, larger, more rounded spikelets, and yellow rather than purple anthers (Fig. 3-1). Recently, microsatellite data for a small sample of this biotype suggested a high level of homozygosity (Chapter 2) A collection of P. dilatatum ssp. flavescens was deposited at the Germplasm Bank of the Facultad de Agronoma in Montev ideo, Uruguay during the 1990s. An efficient use of this collection will depend on knowledge about its genetic structure, the breeding system of the species, an d its geographical structur e (Epperson 1990, Rao and Hodgkin 2002). No morphological qualitative markers ha ve been identified in the biotype, and there is no evaluation of the degree of genetic va riability it contains or its structure. In

PAGE 46

34 this study, a sample of this collection is an alyzed using six microsatellite loci, and the breeding system, genetic struct ure, and geographical structur e of the genetic variability are discussed. Fig. 3-1. A spikelet of P. dilatatum ssp. flavescens (a) and P. dilatatum ssp. dilatatum (b). Note the relatively shorter, less hairy stigmata in P. dilatatum ssp. flavescens and trapped anthers (arrow). The bar represents 1 mm. Materials and Methods. Collection Strategy Because tetraploid and pentaploid plants ar e practically indisti nguishable in grazed pastures, most collections were made on ma jor roads in southern Uruguay. Based on field and greenhouse observations that sugge sted autogamy, an emphasis was made on collecting seed from a singl e panicle from each individual while sampling as many individuals as possible Paspalum dilatatum ssp. flavescens grows in dense patches on roadsides and in hilly areas, and patches are typically restricted to lower slopes excluding the bottom. Each population c onsisted of up to four patche s including both sides of the road and both sides of a waterway when one was present. Seeds were deposited in the Germplasm Bank at the Facultad de Agrono ma in Montevideo, Uruguay. For most a b

PAGE 47

35 accessions, a voucher specimen was also deposited at the herbarium of the Facultad de Agronoma (MVFA). Seed samples of 21 accessions were later retrieved from the Germplasm Bank for this study. Accession numbers are given in Table 3-1, and collection localities can be seen in Figs. 3-3 and 4. Eight individua ls per accession were grown in greenhouse conditions. All individuals we re observed during the reproduc tive stage to ensure that no pentaploids were present. Microsatellite Amplification DNA was extracted from fresh leaves using Sigma GeneluteTM kit (Sigma-Aldrich, St. Louis, MO). PCR and separation were carri ed out as described in (Chapter 2) using extended forward primers with an M13 tail (B outin-Garnache et al. 2001). Briefly, 0.5-3 L of DNA were added to a PCR mix consisting of 2 units of NEB Taq polymerase (New England Biolabs, Beverly, MA), 1.5 mM MgCl2, 0.15 M of the reverse primer and labeled M13 primer, 0.01 M of the extended forward primer, and 0.1 mM of each dNTP in the manufacturerÂ’s buffer. Amplificati on was carried out with the same two-step program for all primer pairs consisting of a denaturation step of 15 s at 94C and an annealing/extension step of 3 m at 53C (Chapter 2). Prim er pairs Pdfl4, Pdfl6, Pdfl12, Pdfl15 and Pdfl20 (Chapter 2) were selected for this study. Three different fluorochrome labels were used (D2, D3 and D4, Beckman Co ulter, Fullerton, CA) for the M13 primers. PCR products labeled with D2, D3 and D4 were combined 5:3:2, and 1 L of the combined products was loaded on a CEQ 8000 capillary sequencer (Beckman-Coulter, Fullerton, CA). Chromatogram s were visualized on CEQTM Genetic Analysis system software (Beckman Coulter, Fulle rton, CA) and scored manually.

PAGE 48

36 Data Analysis AMOVA (Excoffier et al. 1992) was impl emented with Arlequin (Schneider, Roessli, and Excoffier 2000) using both the number of different alleles (FST) and the sum of squared size difference (RST) as a distance measure (Sla tkin 1995). Average squared distances (D1) (Goldstein et al. 1995, Slatkin 1995) and the proportion of shared alleles (Dps) (Bowcock 1994) as implemented in MS Aanalyzer (Dieringer and Shlterer 2002) were used to measure po pulation differentiation. D1 was chosen because it takes into account the mutation history reflected by allele size similarities caused by the stepwise mutation mechanism typical of microsatellite loci. Furthermore, D1 is expected to reflect linearly the divergence time be tween populations even when averaged across loci with different mutation rates (Goldstein et al. 1995). The calculation of D1 makes use of intrapopulational allele size va riance; when calculation is based only on average allele size as is commonly implemented for ( )2 (Goldstein et al. 1995), the distance between populations including a combination of long and short alleles and populations with only intermediate alleles is severely underestimated, and this situation was often approached in the current data set. Population parameters of inbreeding (FIS) and gene diversity (He) were calculated with Genepop (http://wbiomed.curtin.edu.au/genepop/). A Mantel test (Mantel 1 967) was implemented using Passage (Rosenberg 2001) between matrices of D1 and Dps genetic distances and geodesic distances between populations to detect isolation by dist ance (Heywood 1991, Slatkin and Arter 1991). Geodesic distances between populations were generated by Passage from the original population geographical coordinate list. Cluster and principal component analyses were performed with MVSP (KCS, Anglesey, Wales).

PAGE 49

37 Results All primers amplified the expected pr oducts in all individuals. Lack of amplification in a first attempt was overcom e by varying the amount of DNA used in the PCR reaction in all cases. Although all DNAs ha d been extracted with the same protocol, ten-fold variations in the amount of DNA were sometimes necessary to achieve satisfactory amplification. No homozygotes fo r null alleles were thus detected, and given the levels of homozygosity found, it is not like ly that they are present as heterozygous combinations in this sample. Fig. 3-2. Allele size distribution fo r six microsatellite loci in P. dilatatum ssp. flavescens Shaded areas represent rela tive allele frequencies. Locus A llele size ( b p) Pdfl4 Pdfl6 Pdfl12 Pdfl15 Pdfl20 Pdfl22 200 210 220 230 240 250 260 270 280 290

PAGE 50

Table 3-1. Genetic diversity and hetero zygosity for individual populations of P. dilatatum ssp. flavescens for 6 microsatellite loci. Pdfl20 Pdfl4 Pdfl12 Pdfl15 Pdfl22 Pdfl6 Pop.a Acc.b Genc Hetd Fis e He f Ag Het Reph A Het Rep A Het Rep A Het Rep A Het Rep A Het Rep 101 7494 2 0 1.00 0.04 1 39 1 30 1 43 1 65 1 46 2 0 (42-45) 102 7495 7 3 0.67 0.57 2 2 (37-39)4 2 (21-36)2 2 (40-43) 2 1 (43-44)4 1 (34-43)5 1 (45-54) 50 7363 4 1 0.92 0.30 2 1 (37-39)1 30 2 0 (43-44) 2 0 (42-43)2 0 (43-45)2 0 (50-52) 57 7364 4 0 1.00 0.47 2 0 (37-39)2 0 (21-36)2 0 (40-43) 2 0 (43-47)2 0 (43-45)2 0 (45-52) 62 7429 7 0 1.00 0.52 2 0 (37-39)2 0 (21-30)2 0 (40-43) 3 0 (42-62)3 0 (37-45)2 0 (45-52) 64 7432 6 1 0.93 0.30 2 0 (37-39)2 0 (30-36)1 43 4 0 (42-62)2 1 (39-43)1 52 65 7435 7 2 0.87 0.32 2 0 (37-39)1 30 2 1 (43-44) 3 1 (59-66)1 43 3 0 (51-54) 66 7433 4 1 0.78 0.19 2 0 (37-39)2 0 (30-36)2 1 (40-42) 1 32 1 43 2 1 (45-52) 68 7434 5 1 0.96 0.53 2 0 (37-39)2 1 (21-30)2 0 (40-43) 3 0 (42-62)2 0 (43-45)3 0 (45-52) 7 7355 6 3 0.79 0.31 1 37 2 2 (30-36)2 1 (40-43) 2 0 (43-62)1 43 2 0 (51-52) 72 7438 7 0 1.00 0.40 1 39 2 0 (30-36)3 0 (40-43) 2 0 (43-62)2 0 (39-43)3 0 (40-52) 76 7467 5 0 1.00 0.30 2 0 (37-39)2 0 (30-31)1 40 2 0 (42-62)2 0 (43-45)3 0 (45-52) 78 7469 4 0 1.00 0.19 2 0 (37-38)1 30 2 0 (40-42) 1 42 1 45 2 0 (44-45) 79 7470 3 0 1.00 0.35 2 0 (37-39)2 0 (30-36)2 0 (40-43) 3 0 (32-62)2 0 (39-43)1 52 82 7473 3 0 1.00 0.23 2 0 (37-39)3 0 (21-36)2 0 (38-43) 2 0 (32-62)1 43 1 52 87 7478 4 0 1.00 0.33 2 0 (37-39)3 0 (21-36)2 0 (38-43) 2 0 (32-62)1 43 1 52 91 7481 7 3 0.73 0.39 2 1 (37-39)1 30 3 2 (40-44) 2 0 (42-62)2 1 (43-45)3 1 (45-53) 92 7482 2 1 0.80 0.10 1 37 1 30 1 40 2 0 (42-62)2 0 (43-45)2 1 (45-47) 95 7485 3 0 1.00 0.21 1 37 1 30 2 0 (43-45) 2 0 (62-65)2 0 (34-43)2 0 (45-47) 98 7491 4 0 1.00 0.16 2 0 (37-39)2 0 (21-32)1 45 1 42 1 45 2 0 (52-53) 99 7492 1 0.00 1 37 1 30 1 40 1 42 1 45 1 45 Ave. He Ave He He Ave He Ave He Ave He Totals 80 16 0.92 0.59 1.7 0.49 (37-39)1.8 0.39 (21-36)1.8 0.62 (38-45) 2.0 0.75 (32-66)1.7 0.62 (34-46)2.1 0.66 (40-54) a Population label. b Accession number. c Number of genotypes per population. d Number of heterozygous individuals. e multilocus fixation index. f Expected heterozygosity. g Number of alleles. h number of repeat units in the mi crosatellite inferred from allele length. 38

PAGE 51

39 All loci were variable, providing high exp ected heterozygosities (Table 3-1). Pdfl4 was the least variable locus (He= 0.39) and the only one to show a clearly unimodal allele size distribution with one allele sh owing a frequency of 0.77 (Fig. 3-2). Allele size ranges and their frequencies for the whole sample are shown in Fig. 3-1. Allele size distributions ar e clearly bimodal for Pdfl6, Pdfl12, Pdfl15, and Pdfl20. Consequently, in spite of the high proportion of alleles with very low frequencies, He values for all loci across populations are ra ther high (Table 3-1). Besides showing bimodal distributions, not all possible allele sizes are represented. Three considerable gaps were found: a 20-bp gap in Pdfl4 a nd two gaps of 20 and 24 bp, respectively, in Pdfl15. The sample contained a high level of overall homozygosity; only 16 individuals (9.5%) showed any heterozygosity. However, only 4 populations contained more than a single heterozygote, and notably only 4 indivi duals were heterozygous at more than one locus, three of them from population 102. In turn, those thre e individuals share all the segregating alleles, making it possible that they may belong to a single segregating progeny (data not shown). Eleven populati ons (52%) contained no heterozygotes, and fixation indices with in individuals (FIS) for the rest of the populations are high, including those for population 102 (0.673). The average FIS value is 0.916. In spite of the low number of heterozygotes, intra populational variability is consid erable, with about half of the populations reaching He values above 0.35. Although one population (99) contained a single genotype, the average number of genotypes is 3.8 per populational sample of only 8 individuals. The average number of a lleles per locu s within populations is 1.8,

PAGE 52

40 ranging between 1.7 and 2.1 (Table 3-1). Then, de spite differences in variability, all loci contributed allele size differen ces which would detect outcrossi ng if it were taking place. Allele size distribution be tween populations varied among loci; however, for some loci, particularly Pdfl6 and Pdfl15, severa l variable populations showed non-overlapping ranges (Table 3-1). This observation suggests that there may be structure in the allele size range within populations, which could s hown by using a distance method that takes allele size into account. Table 3-2. AMOVA of a six-microsatellite-l ocus data matrix for 21 populations of P. dilatatum ssp. flavescens Distance measure RST Source of Sum of Variance Percentage variation d.f. squa res components of variation Among populations 20 28961.05 86.62 Va 58.27 Within populations 315 19537.88 62.03 Vb 41.73 Total 335 48498.93 148.65 Fixation Index FST : 0.583 Significance test (1023 permutations) P(rand. value >= obs. value) = 0.00000+-0.00000 Distance measure FST Source of Sum of Variance Percentage variation d.f. squa res components of variation Among populations 20 330.14 0.98Va 54.04 Within populations 315 262.44 0.83 Vb 45.96 Total 335 592.58 1.813 Fixation Index FST : 0.54 Significance test (1023 permutations) P(rand. value >= obs. value) = 0.00000+-0.00000 Significance test (1023 permutations) P(rand. value >= obs. value) = 0.00000+-0.00000 Va and FST : P(rand. value >= obs. value) = 0.00000+-0.00000

PAGE 53

41 Fig. 3-3. Genetic distances among 21 populations of P. dilatatum ssp. flavescens and their geographical distribution. a. Complete linkage phenogram of D1 distances. b. Geographical distributio n of the clusters shown in a (see symbols). Only roads on which the samp les were collected are shown. c. a Mantel correlogram of D1 genetic distances a nd geographical distance between populations. Open circles show significant correlations. L a t i t u d e Longitude Montevideo -35 -34 -58 -57 -56 -55 -54 D1 78 99 92 76 91 62 98 50 57 102 66 87 82 95 101 65 7 64 72 68 79 240 200 160 12080400 a b Atlantic Ocean Ro de la Plata roads 68 7 82 65 64 66 79 78 62 98 99 101 76 92 57 87 72 95 91 50 102 -0.2 -0.1 0 0.1 0.2 0 10 20 30 40 50 c

PAGE 54

42 Fig. 3-4. Genetic distances among individual genotypes of P. dilatatum ssp. flavescens and their geographical distribution. a. Average linkage (UPGMA) phenogram of D1 distances. b. Geographical distributi on of the clusters shown in a (see symbols in a). Population subdivision as an alyzed by AMOVA produced FST values of 0.58275 when using the average allele size differ ence as a distance measure, and 0.54041 when using the number of shared alleles. Both es timates were highly signi ficant (Table 3-2). D1 genetic distances between populations were calculated and the distance matrices used for cluster analysis. Se veral linkage methods were used and all resulted in similar 360 300 240 180 120 60 0 L a t i t u d e Longitud Montevideo -35 -34 -58 -57 -56 -55 -54 b Atlantic Ocean Ro de la Plata 68 7 82 65 64 66 79 78 62 98 99 101 76 92 57 87 72 95 91 50 102 a D1

PAGE 55

43 clusters (results not shown). One of the best resolved phenograms is shown in Fig. 3-3a. The resulting cluster memberships were plo tted on a map (Fig. 3-3b) to visualize any possible geographical structure. Mantel tests were also performed comparing the D1 and Dps distance matrices to the geographical di stance matrix. None of these tests was significant. Mantel correl ograms were also produced which showed no association between geographical and genetic distance with either distance measure. One of those correlograms is shown in Fig. 3-3c. A similar approach was followed to analy ze possible geographical structure in the distribution of individual genot ypes. A UPGMA phenogram of D1 genetic distance between pairs of individual genotypes is shown in Fig. 3-4a, and the geographical distribution of the two main clus ters is shown in Fig. 3-4b. Dps produced similar results (data not shown). The two main clusters pl otted in Fig. 3-4b not only show a complete lack of geographical segregation, but they also show extensive overlap. Discussion Mating System The observed inbreeding rate as reflected by the fixation index (FIS) depends not only on autogamy but also on pollinations between flowers from the same inflorescence (geitonogamy), flowers on different ramets of the same genet (tillers), and, finally, the genetic substructuring of the populations whic h increases biparental inbreeding (Ritland 1984, Brown 1989). While all these effects ar e confounded in populational data, as in our case, there are indica tions that the selfing ra te itself is very high. The high intrapopulational genotyp ic differentiation observed in P. dilatatum ssp. flavescens coupled with extremely high fixation indices (FIS 0.97), suggests a lower contribution of biparental inbreeding to th e observed homozygosity in relation to the

PAGE 56

44 actual selfing rate. Extens ive observation of florets of this species during manual hybridization suggests two mechanisms fo r such a high selfing rate. First, P. dilatatum ssp. flavescens shows several characteristics that are typical of cleistogamous grasses (Cambpell et al. 1983): stigmata and stamen fila ments are relatively short in reference to floret dimensions when compared to other bi otypes of the species, and anther dehiscence occurs immediately after or during anthesis. Furthermore, one, two or all three anthers have been often observed to remain within the floret during and after anthesis, while stigmata barely protrude outsi de the spikelet. Frankel and Galun (1977) classified this mechanism as functional autogamy, and it has fr equently been observed in grasses. The second mechanism involves anthesis prior to emergence of the panicle from the sheath; this has been more frequently observed for th e first one or two racemes of the panicle. Campbell et al. (1983) listed this mechanism as Type Ia and considers that cleistogamy in these cases may be mostly an environmenta l response. In agreement with field and greenhouse observations in P dilatatum factors such as light, temperature and moisture have been reported to affect anthesis and panicle emergence (Campbell et al. 1983). For a warm-season grass with an extended reproductive phase like P. dilatatum environmental responses could cause wide season al variations in self ing rates. Delayed anthesis and faster culm elongation in the early spring under cool temperatures and no moisture restrictions may increase the probability of outcrossing. Genetic Differentiation and Geographical Structure Genetic differentiation overall is very high in P. dilatatum ssp. flavescens FST estimates for continuous populations in which au togamy is thought to be the main factor contributing to structuring have been re ported to vary between 0.29 and 0.78 (Heywood 1981). The current sample of P. dilatatum ssp. flavescens was mostly collected in

PAGE 57

45 disturbed environments such as roadsides, and seed morphology suggests dispersion by gravity. These two factors, together with th e observed selfing rate s, contribute to a high expectation for population subdivision (Lovele ss and Hamrick 1984). Hamrick and Godt (1990) estimated a proportion of total gene tic diversity among populat ions of 0.51 for 78 selfing species analyzed with isozymes, wh ereas their estimates for outcrossing species vary between 0.1 and 0.2 depending on th e mode of seed dispersion. Our FST estimate of 0.54 is therefore high and reflects th e biological characteristics of the species. In our data set, non-overlapping allele size distributions in variable populations suggest the presence of informative non-random distribution of allele sizes. Regardless of the exact evolutionary model each microsatellite locus follows, the process seems to retain some mutational memory that can be captured by RST much more efficiently than FST with the resulting underestimation of overall genetic differentiation by the latter (Slatkin 1995). In this case, however, the use of RST instead than FST as a distance measure in the AMOVA did not significantly increase the estimate as e xpected. There are several possible reasons for this. FST and RST estimates of genetic subdivision w ould converge in situations where mutation plays a minor role in population diffe rentiation in relation to drift (Slatkin 1995). Population and mating system dynamics l eading to high levels of genetic drift and recent long-distance dispersal of individuals or population expansion will then improve the performance of FST relative to RST (Slatkin 1995, Estoup et al. 1998). Under a strict stepwise mutation model, ga ps in the allele-len gth distributions are expected after severe drift, like that caused by small local effective population sizes or founder effects followed by a rapid expansion of the population. With time, mutation is expected to fill the gaps be tween the sampled alleles (C ornuet and Luikart 1996). Not

PAGE 58

46 only were some large gaps detected in this sample, but also, in ranges in which allele sizes are rather continuous, th e distributions were multimodal, with very low frequencies for the intervening length categories. It co uld be argued that micr osatellites have not been observed to follow a strict stepwise muta tion model. It seems reasonable to assume that a mixed model (Di Rienzo 1994) is mo st realistic. Direct observation of microsatellite mutations in maize has shown a majority of single-step length increase events and fewer greater downward mutati ons (Vigouroux 2002). Observed allele-size frequency distributions in self-pollinated Arabidopsis thaliana show continuous, mostly unimodal distributions, especially for loci with a high number of perfect repeats (Symonds and Lloyd 2003). In P. dilatatum ssp. flavescens loci with very long perfect repeat tracts like Pdfl15 and Pdfl6 (Chapter 2) show clearly discontinuous multimodal distributions. It follows then that obser ved mutation patterns alone would not fully explain the allele-size distributi ons observed in this sample. The lack of correlation between geographica l and genetic distance also supports a scenario in which drift or long-range dispersal dominates the genetic dynamics of the population. No correlation or clear geographi cal pattern was observe d with population or individual genotype data. Furthermore, the geographical distribution of identical genotypes shared by several populations did not show geographical clustering (data not shown). It has been shown, particular ly in selfing grasses, that molecular marker diversity, either allozymes or microsat ellites, could reflect the e ffects of selec tion (Allard 1972, Nevo 1998, Li 2000). Rare hybridization events or long-distance di spersal can trigger rapid genotype turnover at a particular site or micros ite. Seemingly continuous

PAGE 59

47 populations may then harbor widely di vergent locally adap ted genotypes whose relatedness would not be reflected by neutra l molecular markers. Green et al. (2001), working at a more detailed spatial scale th an in this study, found admixtures of highly divergent microsat ellite genotypes in Anisantha sterilis a selfing weedy grass. Selection, migration and temporal varia tion in the mating system we re invoked as possible causes for the lack of spatial genetic structure a nd persistence of divergent genotypes within populations. The great majority of our accessions were collected on roadsides; for two main reasons: first, no dense stands of this subspecies are commonly found in other environments, and second, P. dilatatum ssp. dilatatum is found almost continuously in nearly all areas in Uruguay and almost always where P. dilatatum ssp. flavescens is found. Distinguishing between subspecies in the field is not easy unless panicles are present. Except for vacant lots in urban area s, most of the country is under grazing by cattle, and panicles of P. dilatatum ssp. flavescens are seldom observed under grazing. In fact, P. dilatatum ssp. flavescens may be largely excluded by grazing. Road construction, shoulder leveling and periodical mowing of the roadsides are three types of events that can strongly affect population dynamics. C onstruction may provide an opportunity for long-distance dispersal or severe local bottlenecks. The plant cover of a road construction site is completely cleared, creating open enviro nments for colonization. The seeds of the future colonizers may be brought from variable distances depending on the origin of the gravel that is us ed or the application of turf pa tches to the barren slopes that are created. Particularly in secondary roads, many stands of this subspecies extend into the gravel shoulders and even into minor cracks in the asphalt itself. Shoulder leveling in

PAGE 60

48 these areas necessarily involves uprooti ng and dragging whole or big portions of P. dilatatum ssp. flavescens stands over variable distances. On main roads, the roadsides also are periodically mowed with inevitable mo vement of panicles and seeds. From a long-term perspective, species composition in Uruguayan grasslands has been greatly influenced by the introdu ction of cattle in the 17th century. Rodrguez et al. (2003) have shown that during a ten-year grazing exclus ion, dominant grass types in a Uruguayan grassland rapidly shifted from prostrate wa rm-season species to cool-season erect types with narrow leaves and bigger seeds. Gr azing patterns must have been changing continuously due to the gradual replacement of Pampas deer by cattle. Pampas deer ( Ozotoceros bezoarticus ) were still abundant at the beginning of the 19th century (Darwin 1839), while they are currently restricted to only two small populations in the whole country (Gonzlez et al. 1998). Altesor et al (1998) have in turn reported dramatic floristic change for the same site during 55 years under continuous grazing. It is clear that the impact of grazing in Uruguay during the last four ce nturies must have been and still is strong, particul arly on erect grasses like P. dilatatum ssp. flavescens It can be hypothesized that the subspecies may have suffered a strong bottleneck after the introduction of cattle followed by relatively recent recolonization of the fenced roadsides. This event, coupled with the present short-te rm effects of roadside habitats on population dynamics and dispersal, sufficiently accounts fo r the lack of geographical structuring, lack of mutational memory evidenced by the low RST values, and discontinuous allele size distributions.

PAGE 61

49 CHAPTER 4 EVOLUTIONARY RELATIONSHIPS AND MECHANISMS IN THE DILATATA GROUP ( PASPALUM POACEAE) Introduction The genus Paspalum contains approximately 350 to 400 species (Clayton and Reinvoize 1986) and has traditionally been divided into informal groups (Chase 1929). The Dilatata group of Paspalum contains several species with great forage potential, and several of them have been used as fo rage crops (Skerman and Riveros 1992). Paspalum dilatatum Poir. and its related species are warm-seas on grasses native to the grasslands of temperate South America and they are well adap ted to resist freque nt frosts during the winter (Burson et al. 1991, da Costa and Scheffer-Basso 2003). This environmental adaptability has allowed some me mbers of the group, particularly P. dilatatum ssp. dilatatum and P. urvillei Steud., to reach worldwide di stributions wherever a warmtemperate climate combined with sufficient rainfall exist. The members of the Dilatata group have b een classified into several formal and informal taxonomic categories that will be re ferred to as biotypes in this study. The common biotype of P. dilatatum ( P. dilatatum ssp. dilatatum ) is a complex apomictic pentaploid hybrid, and efforts to identify its putative ancestors ha ve led, over several decades, to the accumulation of abundant cyto genetic information about the relationships among all the species and biotypes within the Dilatata group The conclusions of a whole era of cytogenetic analysis based on meio tic studies in inte rspecific hybrids are summarized in Table 4-1.

PAGE 62

50 Table 4-1. Genomic formulae and reproductive systems of the members of the Dilatata group Species or biotype 2n (x=10) Genomic Formula Author* Reproductive system** P. dilatatum ssp dilatatum 50 IIJJX Burson (1983) Apomictic (Bashaw and Holt 1958) P dilatatum ssp. flavescens 40 IIJJ Burson et al. (1973) Sexual P. dasypleurum 40 IIJJ Quarn et al. (1995) Sexual P. urvillei 40 IIJJ Burson (1979) Sexual P. dilatatum Virasoro 40 IIJJ Caponio et al. (1990) Sexual P. dilatatum Vacara 40 IIJJ Quarn et al. (1993 unpub). Sexual P. dilatatum "Chir" 60 IIJJXX Burson (1991) Facultative apomict (Burson et al. 1991, Millot 1977) P. dilatatum Uruguaiana 60 IIJJXX2 Burson (1992) Apomictic (Burson et al. 1991) P. dilatatum Torres 60 ? Apomictic (Burson et al. 1991) P. pauciciliatum 40 AA1BC Moraes Fernandes et al. (1968) Apomictic Authorities are given for the public ation of the genomic formula. **Authorities are given for works that specif ically addressed the reproductive system. All sexual biotypes have been crossed, and sexuality is well established. At least two attempts have been made prev iously to present the Dilatata complex in a comprehensive way, including hypotheses on the relationships among its members. Moraes Fernandes et al. ( 1968) did not provide genomic formulae but deduced genomic architectures from meiotic behavior. They re presented the genomic ar chitectures in terms of the number of copies of entire genomes which were assigned letters that do not necessarily signify homology across biotypes. A number of biotypes were described in this work, including the pentap loid apomictic common form ( P. dilatatum ssp. dilatatum ), the Uruguaiana and Torres hexaploid biotypes, P. pauciciliatum and the sexual tetraploid biotype of P. dilatatum now known as Vacaria. The latter was not differentiated from the “yellow anthered” form ( P. dilatatum ssp. flavescens ) which had previously been described by Bashaw a nd Forbes (1958). The common pentaploid biotype (AABBC) was hypothe sized to have arisen as a 2n+n hybrid involving a

PAGE 63

51 tetraploid form and a diploid genome donor, or alternatively, as the product of an allotetraploid and an allohexaploid shar ing the A and B genomes. The hexaploid Uruguaiana (AAA1A1BB) was proposed to be a 2n+n hybr id between two tetraploids, and P. pauciciliatum (AA1BC) was hypothesized to be a hy brid between two tetraploids with one partially homologous genome. Finally, the completely asynaptic Torres (2n=6x=60) was hypothesized to be a putative hybrid between a tetraploid P. dilatatum and an octoploid cytotype of P. virgatum with which it is sympatric and may share morphological similarities. This hypothesi s, however, does not explain the lack of chromosome pairing in Torres given that va riations of the IIJJ genomic formula have later been assigned to tetraploid P. dilatatum sexual biotypes and tetraploid P. virgatum (Burson et al. 1982). An extensive program of interspecific hybridizations undertaken during the 1970s provided the foundations for the current assi gnment of genomic homologies within the group. Burson (1983) summarized this inform ation including genomic formulae and putative diploid donors for the component ge nomes. The sexual tetraploids were assigned the IIJJ genomic formula, and they were hypothesized to have originated independently from the diploid sources fo r these genomes. The diploid genome donors were thought to be P. intermedium and P. juergensii respectively (Burson 1978, 1979). Several other putative I genome donors have been identified since then (Quarn and Normann 1990, Caponio and Quarn 1993). Th e phylogenetic relationships among these putative genome donors have recently been shown to be complex, spanning a polyphyletic array of species (Vaio et al. 2005), and the identity of th e direct donor of the

PAGE 64

52 I genome has not been clarified yet. It is likely that new additional sources of the I genome will be identified in the future. In the arrangement presented by Burson ( 1983), the pentaploid biotype was thought to be derived from a cross between P. dilatatum ssp. flavescens (IIJJ) and an unknown hexaploid with the IIJJXX genomic formula. A hexaploid with the appropriate meiotic behavior was described in Uruguay (Albicette 1980), and later, this hexaploid was found to possess the predicted IIJJXX genomic formula (Burson 1991). Because Paspalum species in general have very small geno mes (Jarret et al. 1995), chromosomes are generally small and relatively featureless; as a consequence, all of the cytogenetic work relied solely on chromosome numbers and pairin g in interspecific hybrids. Only recently have prometaphase karyotypes been used as a source of phylogenetic information in the genus (Speranza et al. 2003, Vaio et al. 2005) However, assessing relationships between specific fixed apomicts requires techniques that can identify individual clones as putative parents. For this approach multiple accessi ons of each biotype must be used to account for variability. Complete coll ections of all the biotypes ar e not currently available. Despite the lack of a comprehensive sample of all biotypes, an effort was made to assemble a collection representing, at least partly, some of the variability with in all of the biotypes. A set of microsat ellite markers developed for P. dilatatum ssp. flavescens (Chapter 2) was used to de scribe the relationships among the apomictic biotypes of the Dilatata group, find evidence of multiple origins or variabi lity within them, and assess their putative relationships with the sexual tetraploids. The variability and putative evolutionary patterns within the common pentaploid biotype P. dilatatum ssp. dilatatum

PAGE 65

53 will be discussed in depth elsewhere; here this biotype will be represented by a few common genotypes. Materials and Methods Plant Material Seeds were retrieved from the USDA Pl ant Introduction Station (Griffin, Georgia, USA) and the Germplasm Bank at the Facu ltad de Agronoma, University of the Republic, Uruguay (Table 2). Seeds of P. dasypleurum were kindly provided by Ing. For. R. Vergara from the Universidad Austral de Chile, and leaf material of an additional accession of P. dilatatum Virasoro was provided by Dr. G. H. Rua from the Universidad de Buenos Aires, Argentina. All four accessions of P. dilatatum Chir come from the location indicated in Figure 4-1 and represent 4 different clusters of plants up to 2 km apart. The heptaploid clone 59B of Paspalum dilatatum was collected near Villa Serrana (Lavalleja, Uruguay) in 1997. The site was revisited in 2000, and the same individual was identified and recollected. Samples of both P. dilatatum ssp. dilatatum and P. dilatatum ssp. flavescens from the same site were include d in this study. Silica-gel dried leaves of two triploid clones (N.A. 7663 a nd 7608) and a diploid individual (N.A. 7623) were used to represent P. quadrifarium Accessions were classified by biotype at the Facultad de Agronoma, Uruguay, but a preliminary biotype assignment for the US DA material was made based on field notes except for previously described accessions (m ostly Burson et al. 1991). Plants were grown to the reproductive stage, and biotype assignments were corrected or confirmed by chromosome counting whenever morphol ogy did not agree with field notes. Chromosome counts were made as described in Speranza et al. (2003) Briefly, root tips were treated with 2mM 8-hydroxyquinoline for 4 h, fixed in 3:1 (ethanol: acetic acid) for

PAGE 66

54 at least 24 h and stored in 70% ethanol at 4C. After fixation root tips were digested in 4% (w/v) cellulase (Calbiochem) and 4% (v/v ) pectinase (Sigma), squashed and stained with lacto-propionic (1:1) orcein. -40 -35 -30 -75-65-55-45 R o d e l a P l a t aAtlanticOceanPacificOceanP a r a n U r u g u a yP a r a g u a yP. dilatatum ssp. flavescens P dilatatum Vacaria P dasypleurum P Dilatatum Virasoro P. dilatatum ssp. dilatatum P. dilatatum clone 2 P urvillei P pauciciliatum P dilatatum Uruguaiana P dilatatum Chir P dilatatum Torres P dilatatum 59B -40 -35 -30 -75-65-55-45 R o d e l a P l a t aAtlanticOceanPacificOceanP a r a n U r u g u a yP a r a g u a yP. dilatatum ssp. flavescens P dilatatum Vacaria P dasypleurum P Dilatatum Virasoro P. dilatatum ssp. dilatatum P. dilatatum clone 2 P urvillei P pauciciliatum P dilatatum Uruguaiana P dilatatum Chir P dilatatum Torres P dilatatum 59B Fig. 4-1. Geographical distribution of the accessions DNA Extraction and Micro satellite Analysis Fresh leaves were collected and DNA extracted with Sigma GeneluteTM kit (SigmaAldrich, St. Louis, MO). Micr osatellite amplification and se paration were carried out as described in Chapter 2. Eleven primer pair s designed for nuclear microsatellites (Table 4-3) and chloroplast microsatellite primer pair cpDilB were chosen from those reported in Chapter 2. Microsatellite amplification, se paration, and detection were performed as described in Chapter 3. Extended forward pr imers with an M13 tail were used in combination with labeled M13 forward primer s. Three different fluorochrome labels were used (D2, D3, and D4, Beckman Coulte r, Fullerton, CA). Chromatograms were visualized on CEQ TM Genetic Analysis sy stem software (Beckman Coulter, Fullerton, CA) and scored manually.

PAGE 67

55 Data Analysis Alleles in complex patterns were assigned to loci based on the approach given in Chapter 2 for all biotypes that are known to contain a basic IIJJ genome assemblage. For P. pauciciliatum assignment was preliminarily made the same way. In the case of P. dilatatum Torres, homology assessment was not attempted, and the data are presented only graphically by primer pair. For P. dilatatum Uruguaiana and P. dilatatum 59B, assignment was made a posteriori. Table 4-2. Accession numbers of the materials retrieved from germplasm banks used to analyze the relationships among the different biotypes P. dilatatum Chir P. dilatatum ssp. flavescens P. urvillei N.A.7537* N.A.7493 PI 462305 N.A.7662* N.A.7494 PI 462306 N.A.7672* N.A.7495 PI 509008 N.A.7359* N.A.7363 PI 509009 P. dilatatum ssp. dilatatum N.A.7364 PI 509010 N.A.7673* N.A.7433 PI 509012 N.A.7542* N.A.7434 PI 509013 N.A.7365* N.A.7355 PI 164065 P. dilatatum clone 2 N.A.7438 N.A.2957 PI 310044* N.A.7441 N.A.7392 P. dilatatum clone 59B N.A.7468 NA 7390 N.A.7686* N.A.7470 N.A.7389 P. dilatatum Torres N.A.7474 PI 203752 N.A.7196* N.A.7475 N.A.7199 PI 404439** N.A.7476 P. dilatatum Vacaria P. pauciciliatum N.A.7486 PI 404398 NA 7533* N.A.7492 PI 404388* PI 310222* PI 508723 PI 404370 N.A.2500* PI 508720 PI 404382 PI 310214* PI 508716 PI 404372 P. dilatatum Uruguaiana PI 508722* PI 404434 N.A.7527* P. dilatatum Virasoro PI 508689* PI 404444** N.A.7207 PI 404436* Microsatellite data were summarized using MSAnalyzer (Dieringer and Shlterer 2002). Multilocus fixation indices ( FIS), genetic diversity (He), and population differentiation tests (Goudet et al. 1996) for the tetraploid biotypes were performed with Genepop ( http://wbiomed.curtin.edu.au/genepop/ ).

PAGE 68

56 The distribution of microsat ellite variance between and within sexual biotypes was assessed with AMOVA (Excoffi er et al. 1992) as perfom ed by Arlequin (Schneider, Roessli, and Excoffier 2000). The same program was used to compute SlatkinÂ’s linearized distances (Slatkin 1995) to analyze the similarities among the tetraploids. For Vacaria and P. urvillei Mantel tests (Mantel 1967) were performed to test isolation by distance between the geographical distance matr ices and both average squared distance ( )2 (Goldstein et al. 1995) and proportion of shared alleles (Dps) (Bowcock 1994). Distance matrices were produced by MSAnal yzer. Both the Mantel tests and the geographical distance matrices were obtained with Passage (Rosenberg 2001) from the geographical coordinates of accessions. The ancestry and possible admixture of apom icts and their contributions to hybrids were analyzed using Structure (Pritchard et al. 2000). The ancestry model was set to admixture, and population information was onl y used as a starting point. All further simulations were performed based solely on the genotype of each individual. The number of clusters (K) was se t to 5 to represen t the five known tetraploids in the group Otherwise all the default options were left in effect. Simulations were carried out for 50000 burn-in runs followed by 100,000 MCMC generations. Results Variability in the Tetraploids Among the three biotypes that were best represented in this data set, P. urvillei was the most variable for all loci except Pdfl 4 and Pdfl7, and Vacaria had the lowest FIS in spite of having the lowest gene diversity (T able 4-3). These two biotypes show rather high fixation indices (0.793 and 0.734, respectively). To analyze whether at least part of the FIS values found for P. urvillei and Vacaria can be attribut ed to isolation by distance,

PAGE 69

57 Mantel tests were performed between genetic and geographical distance matrices for both biotypes, but no significant correlations we re found (data not shown). The lowest FIS over all the tetraploids was estimated for P. dasypleurum although this value could be highly biased because two individuals were av ailable. The two individuals of Virasoro were also completely homozygous. The br eeding system and population structure of P. dilatatum ssp. flavescens was studied in detail elsewhere (Chapter 3) and will not be discussed here. Samples of P. dilatatum ssp. flavescens from both Argentina and Uruguay were included in this study; however, all the alleles found in th e Argentinean accessions were also present in the Uruguayan populations, a nd all individuals within the biotype were assigned to the same population cluster by St ructure (Fig. 4-2). The five tetraploid biotypes were well differentiated based on th e AMOVA, with a highly significant 89% of the variability found among biotypes (Table 4-4). The exact test of population differentiation also showed highly significant differentiation for all population pairs (not shown). The results obtained with Structure genera lly assigned all indivi duals within each biotype to the same population cluster, show ing very clear differentiation among the five tetraploid biotypes and significant admixture only for one individual in Vacaria and some components of Vacaria within P. urvillei (Fig. 4-2). Some admixture of P. dasypleurum within P. urvillei in one individual was also estima ted. Finally, no variability for the chloroplast marker cpDilB was found with in biotypes except for one individual of P. urvillei that showed the chloroplast haplotype found in P. dilatatum (Table 4-3).

PAGE 70

58 Table 4-3. Summary of the microsatellite da ta for the sexual tetraploid biotypes of Paspalum group Dilatata and genotypes for the apomictic biotypes. Biotype or Species P. dasypleurum P. d. ssp. flavescens P urvillei P. d. Vacaria P.d. Virasoro P. pauciciliatum P. d. Chir P. d. ssp. dilatatum eP. d. 59B eP.d. Uruguaiana P. quadrifarium P. quadrifarium 2n (x=10) 4x 4x 4x 4x 4x 4x 6x 5x 7x 6x 3x 2x Na 2 21 14 8 2 4 4 3 1 2 2 1 Locus Ho b 0 0 0.07100 Pdfl11 He c 0 0.070 0.690 0 0 Ad 1 2 4 1 1 172 174 172 172 Range 174 176-180 172-180 176 172 172 172 176 180 180 176 176 Ho 0 0.036 0 0.1250 Pdfl4 He 0 0.492 0.349 0.125 0 A 1 4 2 2 1 196 202 Range 212 202-232 202-204 204-210 198 206 206 204 Ho 0 0 0.1430.2500 Pdfl8 He 0 0.314 0.746 0.700 0 A 1 3 6 5 1 230 230 Range 230 236-240 198-244 218-236 230 247 234 238 Ho 0 0 0.35700 Pdfl28 He 0 0.857 0.722 0.4 0 A 1 10 5 2 1 188 198 Range 200 244-274 194-202 194-200 188 188 198 200 Ho 0.500 0 0 00 Pdfl15b He 0.500 0 0.148 0 0 A 2 1 2 1 1 212 Range 210-212 212 202-212 212 214 214 214 214 Ho n.d. 0.036 0.1540.1250 Pdfl15 He n.d. 0.776 0.942 0.775 0.667 A n.d. 8 12 5 2 234 222/224 Range n.d. 216-282 244-353 243-250 228-242 264 226/242/250 Ho 0.500 0 0.2860.1250 Pdfl22 He 0.500 0.701 0.876 0.125 0.667 A 2 5 11 2 2 184 186 Range 214-220 214-228 184-260 196-240 194-196 196 196 196 Ho 0 0 0 0.1250 Pdfl7 He 0 0 0 0.325 0 A 1 1 1 2 1 219 233 235 Range 241 257 251 249-251 233 231 237 257 241 241 225 Ho 0 0 0.0910.1250 Pdfl10 He 0.667 0.512 0.835 0.692 0 A 2 4 8 4 1 181 Range 227-237 225-229 181-229 195-227 181 179 181 203/207 Ho 0.5 0 0 00 Pdfl20b He 0.5 0.590 0.561 0 0 A 2 3 3 1 1 190 187 199 Range 199-200 197-199 196-203 199 201 201 201 201 Ho 0 0 0.0770.1250 208 Pdfl20 He 0 0.543 0.594 0.758 0 206 A 1 3 5 4 1 219 217 187 195 Range 215 235-239 208-263 211-273 221 225/227 223 233 187 204 204 208 Ho 0 0 0 0Pdfl12 He 0 0.486 0.571 0 A 1 2 4 1 222 219 Range 212 235-241 221-233 174 224 221 235 207 207 241 Ho 0 0 0.28600 Pdfl12b He 0 0 0.254 0 0 A 1 1 2 1 1 201 201 201 Range 201 201 201-210 201 210 210 210 210 Ho 0 0 0.2140.125Pdfl18 He 0.667 0.491 0.807 0.125 A 2 3 7 2 258 258 238 224 224 Range 264-266 236-254 252-304 254-260 308 274 258 230 230 230 226 cpDilB 216 217 218/217217217213217217217217 FIS 0.571 0.988 0.793 0.734 1.000 He 0.269 0.424 0.641 0.302 0.167 a Sample size. b Observed number of heterozygotes. c Gene diversity. d Number of alleles. e Only the alleles not present in common P. dilatatum ssp. dilatatum are shown here. The alleles shared with P. dilatatum ssp. dilatatum are shown in Fig. 4-2.

PAGE 71

59 Fig. 4-2. Population structure of a sample of the members of the Dilatata group estimated by Structure under the admixture model based on microsatellite data for 13 loci. Each color represents the contri bution to each genotype of each one of the five clusters generated If the five tetraploid biotypes were de rived from a single ancestral population, and given that a strong ascertainment bias could not be detected within this group (Chapter 3), SlatkinÂ’s linearized RST would represent relative dive rgence times between pairs of biotypes. RST distances are expected to be linearl y related to evolutionary divergence time and could be used to estimate phyloge netic relationships among the biotypes. A UPGMA tree based on linearized RST is shown in Fig. 4-3a. Under this hypothesis, biotypes Vacaria and Virasoro are very similar, while P. dasypleurum and P. urvillei form a tight cluster to which P. dilatatum ssp. flavescens attaches. In this result, P. dilatatum as currently delimited can still be considered monophyletic with P. dilatatum ssp. flavescens very close to a sister clade formed by P. urvillei and P. dasypleurum To circumvent the reliance of the RST-based measures on a stepwise mutational model of microsatellites, the proportion of shared alleles (Dps) was also used as a distance measure. The UPGMA phenogram based on Dps shows high distance estimates for all population pairs with the nearest pair ( P. dasypleurum -Vacaria) joined at a distance of 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% pauciciliatum Chir dilatatum clone 2 ssp .dilatatumssp flavescensP. urvillei VacariaP. dasypleurum Virasoro 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% pauciciliatum Chir dilatatum clone 2 ssp .dilatatumssp flavescensP. urvillei VacariaP. dasypleurum Virasoro

PAGE 72

60 0.77 (Fig. 4-3b). The arrangement of the biot ypes is completely different from that obtained with RST. In this case all the possible ro oting options would nest either P. dasypleurum or P. urvillei within P. dilatatum Fig. 4-3. UPGMA phenograms of the distances among the sexual tetrap loid biotypes of the Dilatata group based on 13 microsate llite loci obtained with different distance measures a. Linearized RST b. Proportion of shared alleles Variability in the Apomicts P. pauciciliatum and P. dilatatum Chir, Uruguaiana (Table 4-3), and Torres (not shown) appeared as single clones; individua ls within each biotype share a number of flavescens urvillei dasypleurum Vacaria Virasoro 363024181260LinearizedRST 0.960.80.640.480.320.160flavescens urvillei dasypleurum Vacaria Virasoro Dpsa bflavescens urvillei dasypleurum Vacaria Virasoro 363024181260LinearizedRSTflavescens urvillei dasypleurum Vacaria Virasoro 363024181260LinearizedRST 0.960.80.640.480.320.160flavescens urvillei dasypleurum Vacaria Virasoro Dps 0.960.80.640.480.320.160flavescens urvillei dasypleurum Vacaria Virasoro Dpsa b

PAGE 73

61 heterozygous allele combinations ranging from a minimum of 4 in P. pauciciliatum to 13 among the different accessions of P. dilatatum ssp. dilatatum Within Torres and Chir, no differences were detected among acces sions, and the single genotypes found are shown in Fig. 4-3. In th e case of pentaploid P. dilatatum two clearly different clones were identified among the individuals reported here, a typical, wide spread clone and a second clone referred to here as P. dilatatum clone 2 (Fig. 4-4). On the other hand, mostly in typical P. dilatatum ssp. dilatatum (Table 4-3) and Ur uguaiana (Fig. 4-4), individuals differ by a small number of allele length differences attributable to mutation. Most of this variability is re stricted to the longe r alleles of loci Pdfl10 and Pdfl15 (Table 4-3 and Fig. 4-3). The highly variable longer allele in locus Pdfl15 showed a different length in each of the 3 indivi duals of typical pentaploid P. dilatatum presented here (Table 4-3). Due to its extreme instabilit y, this locus was not used in any of the comparisons among biotypes. Relationships among Apomicts Paspalum. dilatatum clone 59B and Uruguaiana shar e 11 or 12 heterozygote allele combinations with the typical clone of P. dilatatum ssp. dilatatum, and differences are again restricted to the longer al leles of loci Pdfl10 (Fig. 4-3) and Pdfl15 (not shown). If these shared bands are interpreted to be homologous, the “extra” bands (Table 4-3) can be assumed to be located on the extra 10 chromosomes (Burson’s (1995) X2 genome). All these bands were also found in the two triploid P. quadrifarium clones (Table 4-3) except for the 180-bp band in locus Pdfl 11 shared by both Uruguaiana and 59B.

PAGE 74

62 Pdfl11 Pdfl4 (+100bp) Pdfl8 Pdfl28-1 Pdfl15-2 Pdfl22-1 Pdfl7 Pdfl20-2 Pdfl12-1 Pdfl12-2 Pdfl20-1 (+50bp) Pdfl10 Pdfl18 165 175 185 195 205 215 225 235 245 255 265 275 285 295 305 315Allele length (bp) pauciciliatum Virasoro Virasoro ssp. dil clone 2 Chir ssp. dilatatum Uruguaiana Brazil dilatatum 59B Torres Uruguaiana Urug. Pdfl11 Pdfl4 (+100bp) Pdfl8 Pdfl28-1 Pdfl15-2 Pdfl22-1 Pdfl7 Pdfl20-2 Pdfl12-1 Pdfl12-2 Pdfl20-1 (+50bp) Pdfl10 Pdfl18 165 175 185 195 205 215 225 235 245 255 265 275 285 295 305 315Allele length (bp) pauciciliatum Virasoro Virasoro ssp. dil clone 2 Chir ssp. dilatatum Uruguaiana Brazil dilatatum 59B Torres Uruguaiana Urug. Fig. 4-4. Multilocus genotypes of the apomictic components of the Dilatata group Chir, P. pauciciliatum and P. dilatatum clone 2 clearly share a significant proportion of bands with Virasoro; however, Chir contains alleles that cannot be directly attributed to its putative Vi rasoro ancestry. The typical P. dilatatum ssp. dilatatum on the other hand, appears to contain alleles that can be assigned to P. dilatatum ssp. flavescens (Fig. 4-2). The putative contri butions of Virasoro, Chir, and P. dilatatum clone 2 to other biotypes are confounded becau se they all share a significant proportion of alleles themselves (Fig. 4-2). Chir and P. dilatatum clone 2 share 6 out of 8

PAGE 75

63 heterozygous allele combinations making th e likelihood of a sexual event linking the two very low. All the apomicts except Torres shared a 170-bp allele in locus Pdfl28b and a 177bp allele in locus Pdfl20c which are thought to be located on the X genome (Chapter 2). Torres does not show the 177-bp band in locu s Pdfl20c and it shows a 218-bp allele in the chloroplast locus cpDilB instead of the 217-bp allele found in the other biotypes of P. dilatatum Torres frequently showed more alleles in the nuclear loci than the biotypes known to be built on the basic IIJJ combinati on of the group. Alleles were scored to maximize its similarity to other biotypes in the data set. This appro ach makes sense if the asynaptic behavior of Torres is due to l ack of chromosome homology and is not under genetic control. In this ca se, if Torres is part of the Dilatata group, it can only contain one copy of each of the I and J genomes. Ev en following this strategy, it is not possible to derive all of its alleles fr om any other apomict in the group. In spite of this, at least one allele from each of nine loci can be tra ced to one of the two clones of pentaploid P. dilatatum (Fig. 4-3). Heterozygosity of the Apomicts The degree of heterozygosity in th e apomicts is variable. Typical P. dilatatum ssp. dilatatum is heterozygous for every locus, while Chir and P. dilatatum clone 2 show lower levels of heterozygosity (Fig. 4-3). In the case of P. pauciciliatum half of the loci located on an I or J genome are expected to be hemizygous because its genomic architecture does not allow for two copies of both genomes, so the observed presence of only one band at several loci cannot be repor ted as homozygosity as was done for Chir and P. dilatatum clone 2. A similar situation is found in Torres in which only Pdfl10 amplified a single band (Fig. 4-3) In fact, based solely on its asynaptic meiotic behavior,

PAGE 76

64 all the bands amplified by a si ngle primer pair should be reported as homeologous and the genotype as completely hemizygous. Discussion Evolutionary relationships among th e sexual tetraploid biotypes The use of microsatellite data to asse ss phylogenetic relationships is questionable (Garza et al. 1995, Doyle et al. 1998). Si ze homoplasy, stochastic effects of past bottlenecks, allele size asymmetry, and the possi bility that at least some of the biotypes had independent origins (making a hierarchic al hypothesis of rela tedness meaningless) are some of the concerns. The effect of size homoplasy on popul ation parameter estimates has been frequently discussed, and its consequences have been modeled and predicted at the populational level (Estoup 2002). Size homoplasy at the intersp ecific level has also long been a concern (Doyle et al. 1998). On the other hand, the use of microsatellite data for phylogeny reconstruction within species and between species has been tested against other sources of information with relativ e success (Alvarez et al. 2001, Richard and Thorpe 2001). In the present data set, however, it is rather the strong asymmetry in allele sizes observed among the biotypes that raises the major concerns. This problem is in some way related to the artifact known as as certainment bias (Ellegren et al. 1995) where the non-focal species appear as le ss variable due to the original selection of loci to show long allele sizes in the focal species. It has been well establishe d that the length of a microsatellite allele is re lated to its variability and mutation rate (Symonds and Lloyd 2000). Once a microsatellite in creases its length, it also increases its upward mutation rate. One peculiarity of this microsatellite se t as applied to the current group of species is that different loci seem to have been amplif ied in different biotypes reaching higher allele

PAGE 77

65 sizes associated with higher mutation rates (Pdfl 28 in P. dilatatum ssp. flavescens Pdfl22 in P. urvillei and Pdfl20 in Vacaria) (Table 43). As a consequence, when applying distance measures based on allele length, the biotypes not showing long allele sizes at a particular locus necessarily appear as more similar to one another. However, this artifactual similarity is in reality a symplesiomorphy in a phylogenetic context. When applying a distance measure based only on the presence of identical alleles (Dps), the larger alleles are not matched with thos e of other biotypes; these biotypes appear similar to one another again ba sed shared ancestral character states. This problem is further evidenced by the high distance values among pair of biotypes obtained with Dps. Alvarez et al. (2001) circumvented similar problems in Lycopersicon by using only loci showing very low diversity indices (<0.25). If su ch a criterion were applied to this data set, most information would be eliminated because the only loci showing diversity indices near 0.25 are Pdfl15b, Pdfl7 and Pd fl12b, of which Pdfl7 is null in most P. urvillei accessions. The tetraploid components of the group ha ve been previously proposed to have originated independent ly (Burson 1983), a po ssibility that is so mewhat supported by the presence of fixed, non-shared chloroplas t haplotypes among the three named species: Paspalum urvillei P. dasypleurum and P. dilatatum This scenario is further supported by the clear genetic differentiation in their nuclear microsatellite loci. With abundant evidence accumulating for the recurrent forma tion of polyploids in the last years (D. Soltis and P. Soltis 1993, P. Soltis and D. Soltis 2000), the independent formation of at least some of these biotypes remains a likely pos sibility. Regardless of mode of origin of

PAGE 78

66 the five sexual tetrap loids, the hypotheses of relatedness presented in Figure 4-2 should be interpreted with extreme caution. On the other hand, evidence for ongoing gene flow was only found between Vacaria and P. urvillei Valls and Pozzobon (1987) repor ted, based on field observations, that Vacaria formed natural hybrids with P. urvillei where their areas of distribution overlapped, while natural hybrids have not been recorded between Virasoro or P. dilatatum ssp. flavescens and P. urvillei. This gene flow apparently has not had strong effects on the genetic identity of the invol ved biotypes which remain morphologically and genetically distinct. Although more data are required to quantify any degree of gene flow among the tetraploid biotypes of P. dilatatum and analyze their morphological differentiation in a systematic way, it seems clea r that they form distinct units and should all deserve at least formal subspecific status. Genetic structure of the sexual tetraploids The genetic structure of P. dilatatum ssp. flavescens has been discussed in detail elsewhere (Chapter 3). For the other biotypes the topic has been specifically addressed only in Virasoro (Hickenbick et al. 1992). Hickenbick et al (1992) concluded that both selfing and cross-pollination must occur in this biotype based on segregating progenies detected using isozyme markers. They al so observed developing embryos in Virasoro spikelets dissected prior to anthesis. In th is study, the two individuals analyzed were fully homozygous for the 13 loci, indicating a high level of homozygosity; however, very few differences were detected between the two accessions scored, making it difficult to detect the occurrence of allogamy. Paspalum dilatatum ssp. flavescens (Chapter 3) and Virasoro show relatively shorter anther s and stigmata than the other biotypes, characteristics that are usually consid ered morphological evidence of functional

PAGE 79

67 autogamy (Frankel and Galun 1977, Campbell 1999). Paspalum urvillei P. dasypleurum and Vacaria showed lower levels of inbreedi ng. Even though isolation by distance could not be demonstrated in this data set, it is likely that at least part of the observed homozygosity may be due to crossing between individuals carrying the same alleles. Variability within the apomicts Paspalum dilatatum ssp. dilatatum was the only apomictic biotype that showed evidence of containing more than a single clonal genotype. In spite of this, some microsatellite variability was found within typical P. dilatatum ssp. dilatatum Uruguaiana and P. pauciciliatum Such variability could be useful in assessing genetic diversity and phylogeographic patt erns in these rather widesp read clones, especially in P. dilatatum ssp. dilatatum The addition of the X genome, apomixis, and the origin of pentaploid P. dilatatum Two different pathways have been suggested for the origin of the pentaploid IIJJX biotype. The X genome could have been a dded to the group by means of a hexaploid (IIJJXX) and then transferred to the pentap loids when this hexaploid crossed to a tetraploid (IIJJ) (Burson 1983, Moraes Fern andes et al. 1968) or it could have been directly added to form a pentaploid by a 2n+n hybridization between a tetraploid (IIJJ) and an unrelated diploid (XX) (Moraes Fernandes et al. 1968). The data discussed above show that the two hexaploid candidates identif ied so far are more likely explained as derivatives than progenitors of the pent aploids. The second pathway invokes the production of unreduced gametes by P. dilatatum tetraploids. Chloroplast sequence data support the derivation of the ma ternal genome from within P. dilatatum rather than from the donor of the X genome (Chapter 2). Production of unreduced gametes by tetraploids has been observed (Speranza unpub. res.). One P. dilatatum ssp. flavescens individual,

PAGE 80

68 when pollinated by Chir produced several 2n+ n (2n=7x=70) hybrids. The hybrids of the same P. dilatatum ssp. flavescens individual by Virasoro (Chapt er 2), when crossed with Chir also produced several 2n+n hybrids with 2n=7x=70. This time, the maternal plant was expected to be highly heterozygous and its genotype can be inferred from the segregation data shown in Chapter 2 for its progeny. Analysis of its 2n+n hybrids with Chir, however, did not show the transmission of any heterozygosity from its maternal parent for several microsatellite loci (data not shown). This indicates that the unreduced gametes were produced by some second divi sion restitution (SDR )-like mechanism. Even if the possibility cannot be rejecte d, no mechanism has been observed that can explain the formation of a primary pentap loid by the contribution of a heterozygous unreduced gamete by a heterozygous tetraploid. There are, however, in the present data set, relatively homozygous pentaploids, namely P. dilatatum Clone 2. The level of heterozygosity in the pentaplo ids is then variable. How did a heterozygous pentaploid form if hexaploids are excluded as intermedia ries? Existing pentaplo id individuals have the ability to transmit euploid IJX gamete s and produce new IIJJX pentaploids when crossed to an IIJJ tetraploid (Mazzella and Speranza 1997). The observed extreme heterozygosity could have been gained by exis ting pentaploids by successive cycles of crossing to other tetraplo id members of the group An extensive survey of the intrabiotypic variability within P. dilatatum could provide further evidence of this mechanism. Paspalum dilatatum Uruguaiana and 59B Both Uruguaiana and 59B share almost all of the heterozygous allele combinations found in the widespread typical P. dilatatum ssp. dilatatum As a consequence, their mutual relationship and the relationship of bot h clones to the pentap loid biotype cannot

PAGE 81

69 be explained by sexual events. Early pollination of pentaploid florets has been shown lead to the fertilization of aposporic embr yo sacs and the production of 2n+n hybrids (Bennett et al. 1969, Espinoza and Quarn 2000, Burson 1992). Furthermore, a putative donor of the alleles not presen t in the pentaploid parent has been identified here as P. quadrifarium This suggests that these two cl ones are 2n+n hybrid s of pentaploid P. dilatatum and a diploid or tetr aploid individual of P. quadrifarium The close morphological and physiological similarity between Uruguaiana and pentaploid P. dilatatum has been previously noted (Burson 199 1). Furthermore, the spikelets of Uruguaiana (and clone 59B) differ from those of the pentaploid bi otype in that their maximum width is located near the middle of the spikelet li ke those found in species of the Quadrifaria group (Barreto 1966) rather than near the base as seen in P. dilatatum The two accessions of Uruguaiana analyzed here were collected more than 220 km apart, and they differ at some microsatellite loci These differences were interpreted as mutations given that the alleles hypothesized to represent the X2 genome were identical for the two locations. Its geographical range and the presence of mu tations suggest that Uruguaiana is not a recent derivative of pentaploid P. dilatatum and that several more such hybrids could have been formed in a similar way. The finding of 59B, a single hybrid of the same kind shows that the co mplex is active and still generating new combinations at higher ploidy levels. Clone 59B is a single, highl y sterile individual found near Villa Serrana, Uruguay and it is li kely to be the product of a contemporary hybridization event. This plant was collected at the edge of a water stream that crosses a secondary road. Clone 59B wa s growing among plants of P. dilatatum ssp. flavescens and pentaploid P. dilatatum Immediately next to 59B were several plants of P. exaltatum

PAGE 82

70 which shares genomes with P. quadrifarium (Vaio et al. 2005) and several dispersed individuals of P. quadrifarium Spikelet morphology and the presence of P. quadrifarium -specific bands in 59B strongly suggest that a species from the Quadrifaria group could have contributed the extra genomes in 59B. Paspalum dilatatum clone 2 This accession of P. dilatatum can be partially expl ained by a cross between Virasoro and Chir. Morphologically this acce ssion seems to correspond to the putative Virasoro x Uruguaiana hybrids reported by Machado et al. (2005). Even though Uruguaiana is presently known to o ccur near the collection site of P. dilatatum clone 2, its genotype does not support such parentag e. On the other hand, Chir is only known from a relict population in Paysand, Uruguay and Clone 2 was found in Brazil, approximately 240 km NE of this location. A greater distribution range of Chir in the past or the still undetected occurrence of genot ypes closely related to it in southern Brazil must be invoked to explain this hybrid as th e product of a tetraploid x hexaploid hybrid. The reverse hypothesis where Ch ir is a derivative of P. dilatatum clone 2 is considered below. Paspalum dilatatum Chir Chir is closely related to Virasoro and less heterozygous than P. dilatatum ssp. dilatatum and Uruguaiana. The involvement of Vi rasoro as the donor of the basic IIJJ genomes seems evident; however, Chir also sh ows alleles that cannot be explained by the genotypes found in Virasoro, and given th at Virasoro has been found to be highly homozygous, it is not likely that the relations hip between the two bi otypes is direct. The reverse pathway, i.e., the addition of an extra copy of the X genome to a P. dilatatum clone 2 type individual in a fashion simila r to that described for Uruguaiana, cannot be

PAGE 83

71 excluded as the origin of Chir. In fact, only the shorter allele in Pdfl18 and the absence of a second allele in locus Pdfl12 could not be explained this way. Under this scenario, P. dilatatum clone 2 would be more widespread than detected here and Chir would not be a relict population of a formerly widespread bi otype but a possibly re cent 2n+n hybrid of P. dilatatum clone 2. The only extra putative X ge nome allele found in Chir is a 187 bp allele at locus Pdfl20. This allele was also found in clone 59B, and it was attributed to its P. quadrifarium parent. In the case of Chir, this c onstitutes very weak evidence of the origin of the X genome from within the Quadrifaria group. Paspalum pauciciliatum P. pauciciliatum appears to be very closely rela ted to and is sympatric with both Chir and P. dilatatum clone 2. The contribution of a re duced IJX gamete from either P. dilatatum biotype as a pollen donor could expl ain most of the alleles found in P. pauciciliatum and even more so if one-step mutations are allowed. Its chloroplast haplotype, however, is different from that of the other members of the Dilatata group. This difference was detected only at the cpD ilB locus whereas the chloroplast haplotype of P. pauciciliatum is identical to that of the rest of the Dilatata group five non-coding regions (Chapter 2). Its cyt ogenetic architecture (Moraes Fernandes et al.1968) implies that one of its genomes is present in two c opies. If the difference found in the chloroplast genome is taken as evidence of an independent origin of its chloroplast genome, then its maternal progenitor must be closely related to the diploid donor of either the I or J genome to the Dilatata group but not the sa me individual or population. The maternal progenitor should be responsible for the c ontribution of extra ba nds at loci Pdfl18, Pdfl12b and Pdfl7. Under this scenario, its ge nomic formula should be either IIJX or IJJX.

PAGE 84

72 Paspalum dilatatum Torres Chloroplast DNA data strongly support the contribution of the maternal genome of Torres from within the Dilatata group (Chapt er 2). However, its chloroplast haplotype corresponds to P. urvillei instead of that shared by all the other biotypes of P. dilatatum For 7 out of 13 loci analy zed Torres shows alleles also found within either the P. dilatatum ssp. dilatatum -Uruguaiana complex or the ChirP. dilatatum clone 2 complex; however, it lacks one of the markers of the X genome that is shared by all the other apomicts including P. pauciciliatum Its link to the rest of the group may be some genotype of the highly variable P. urvillei If Torres contains a copy of the I and the J genomes, as suggested by its similarities to P. urvillei then its other genomes must not come from another member of the group based on the lack of pairing of its chromosomes. The relationship of this biotype to the rest of the group cannot be co mpletely clarified based on this data set and the task would probably require an alyzing species belonging to other taxonomic groups. Conclusions This study has established a series of e volutionary hypotheses w ithin the Dilatata group which will dramatically change the futu re direction of both basic and applied research within this group 1. Both nuclear and chloroplast markers show that the five sexual tetraploids studied here are well differentiated and do not show significant gene flow except for P. urvillei and Vacaria. 2. The Uruguayan and Argentinean accessions of P. dilatatum ssp. flavescens form a single coherent unit. 3. P. dilatatum ssp. flavescens and Virasoro appear highly homozygous, in agreement with floret morphology and previous reports. P. urvillei Vacaria and P. dasypleurum probably show higher degrees of allogamy.

PAGE 85

73 4. No clear evidence was found to su pport the monophyly of the group. 5. The relationships among the sexual tetr aploid biotypes could not be reliably explained by the current data set. 6. Chloroplast haplotype differentiation is in agreement with current species delimitations. 7. Uruguaiana, Chir, Torres and P. pauciciliatum each appears to comprise a single clone. 8. Pentaploid P. dilatatum comprises an assemblage of more than one clone. 9. Variability attributed to somatic mutations was found within Uruguaiana, P. pauciciliatum and the typical clone of P. dilatatum for at least two loci, which can be used for analyzing genetic stru cture within these clonal biotypes. 10. All of the apomicts in the group show the same alleles in the loci thought to reside on the X genome, suggesting a single origin for this genome in the group. 11. All of the apomicts seem to contain at least one copy of each of the I, J and X genomes. 12. The hexaploids and heptaploids are better e xplained as derivatives of the pentaploid P. dilatatum rather than its ancestors. 13. Virasoro is the sexual tetraploid that shows the greatest degree of similarity to all of the apomicts. 14. A genotype of pentaploid P. dilatatum derived from Virasoro might have been the primary apomict in the group Further pentaploid-tetraploid crosses may have created the variability and the hete rozygosity found in the apomicts. 15. The suggested mechanisms for the formati on of new apomicts involve either an unreduced female gamete or a euploid IJX pollen grain of pentaploid P. dilatatum

PAGE 86

74 CHAPTER 5 PENTAPLOID X TETRAPLOID HYBRIDIZATION CYCLES IN Paspalum dilatatum (POACEAE): EXPLAINING THE CURR ENT AND FUTURE EVOLUTIONARY SUCCESS OF AN IMBALANCED POLYPLOID Introduction Paspalum dilatatum Poir. is a warm-season grass native to the grasslands of temperate South America. This species is pa rt of an informal taxonomic group within the genus known as the Dilatata group (Chase 1929). Included in this group are several sexual and apomictic biotypes and species whos e evolutionary relati onships have recently been discussed in detail based on data from 13 microsatellite loci (C hapter 4). The sexual members of the group ( P. urvillei Steud., P. dasypleurum Kunze ex Desv., P. dilatatum ssp. flavescens Roseng. Arr. et Izag., and bi otypes Virasoro and Vacaria of P. dilatatum ) are all tetraploid and share the same genomic formula (IIJJ). The relationships among the sexual tetraploids and between them and the apom icts have not been completely clarified; however, microsatellite data sugge st that Virasoro has greatly contributed to the genetic makeup of the apomictic components (C hapter 4). Except for pentaploid P. dilatatum the rest of the apomicts in the group ( P. dilatatum biotypes Uruguaiana, Chir and Torres (6x) and P. pauciciliatum (Parodi) Herter (4x)) seem to each comprise a single clone and its mutational derivatives, and all of them ha ve been hypothesized to be derivatives of the pentaploid form (Chapter 4). In this context, the apomicts would all include at least one copy of the I and J genomes and at least one copy of the third unassigned genome (X). The pentaploid form (IIJJX) had previously be en proposed to be th e product of a cross between a hexaploid (IIJJXX) and a tetr aploid (IIJJ) (Burs on 1983); however, the

PAGE 87

75 transmission of an unaltered heterozygous multilocus genotype between pentaploids and the hexaploids Chir and Uruguaiana suggest s that the latter may be more likely derivatives of the pentaploid form by means of a 2n+n hybridization in which the pentaploid contributed an unr educed gamete and the second X genome was contributed by a diploid. Chloroplast sequence data suggest that the pentaploid probably acted as the maternal progenitor in such crosses (Chapter 2, Chapter 4), a mechanism that had already been reported experimentally (Bennett et al. 1969, Burson 1997). Genotypic information for thirteen microsatellite loci suggests yet another mech anism by which the pentaploid may be involved in the origin of the remaining apomicts, i.e., P. pauciciliatum and at least one recombinant pentaploid clone. The pentaploids are able to produce euploid IJX pollen grains (Mazzella and Speranza 1995) which can fertilize a se xual tetraploid to yield a recombinant pentaploid. Pentaploid P. dilatatum is not only the most widespread biotype, but it also seems to have been the ba sis of the entire apomictic complex in the group. It may have been involved in the origin of the other apomicts either by means of unreduced female gametes or euploid IJX po llen grains, and it could be the original carrier of the X genome. If the transmission of euploid IJX gametes is a frequent event, then several more recombinant pentaploids li ke the one reported in Chapter 4 should be found in the wild. Variability has been detected among pentaploid P. dilatatum accessions with dominant markers (Casa et al. 2002); however, with th is kind of markers, and particularly for a small sample, clona l variants cannot be distinguished from recombinants. Microsatellites have proven e fficient in detecting recent hybridization events and if recombinants are found it should be possible to infer their mode of origin from their genotypes.

PAGE 88

76 Regardless of its mode of origin or evolutionary role, pentaploid P. dilatatum is currently distributed worldwide in warm-t emperate regions of the north and south hemispheres where it has become an importa nt forage grass (B urson 1983, Skerman and Riveros 1992). Because of this, there is great applied potential for th e detection of genetic variability in the available germplasm coll ections. Microsatellite markers can reveal mutational variation that coul d be useful for assessing th e extent and distribution of mutational genetic variability within the typical form of this biotype (Chapter 2, Chapter 4). In this study, an extensiv e collection of pentaploid P. dilatatum representing its worldwide distribution has been retrieved fr om existing germplasm banks and analyzed using microsatellite markers developed for P. dilatatum ssp. flavescens (Chapter 2) to assess the level of variability. Materials and Methods Plant Material Seeds of pentaploid P. dilatatum were retrieved from the USDA Plant Introduction Station (Griffin, Georgia) and the Germ plasm Bank at the Facultad de Agronoma, University of the Republic, Uruguay. Accession numbers are given in Table 5-1. Additional dry leaves from California, Texas, and Australia were kindly provided by M. McMahon, J. Tate, and K. Smith, respectively. Material retrieved from Georgia mos tly contained populational samples. The Uruguayan collection used in this study wa s mostly developed by myself between 1992 and 1999. This collection is composed primar ily of single-plant progenies produced in the greenhouse from off-type individuals colle cted in the field. Populations 1 and 3 had been previously reported by Prof. J.C. Millot (1997 pers. comm.) as variable based on

PAGE 89

77 morphological evidence. These populations were collected as single individuals, and each apomictic progeny kept under a different a ccession number (Table 5-1). Chromosome numbers were determined for all the Uruguaya n single-plant accessions by P. Speranza, M. Vaio and C. Mazzella following the techni que described in Speranza et al. (2003). For the current study, full seeds were germin ated in Petri dishes on filter paper. Germinators were placed at 4C for 4 days prior to incubation to break dormancy and homogenize germination and were then tran sferred to an incubator with alternating temperatures (16 h at 30C light, 8 h at 20 C dark). For eight popul ational samples with good seed quality, eight indi viduals were grown per acc ession, otherwise only one individual was kept in each case (Table 5-1). Plants we re cultivated in greenhouse conditions for at least one complete growth season and screened for contaminants or biotype assignment errors at the repr oductive stage. Chromosome numbers were determined when the originally report ed biotype assignment and morphological appearance of a plant were in disagreement. Chromosome numbers were also determined a posteriori for all putatively recombinan t individuals (Table 5-1). DNA Extraction and Micro satellite Analysis Fresh leaves were collected in the greenhouse and DNA extracted with Sigma GeneluteTM kit (Sigma-Aldrich, St. Louis, MO ). Microsatellite amplification and separation were carried out as described in Chapter 2. Eight primer pairs reported in Chapter 2 were used in this study (Pdfl 4, Pdfl7, Pdfl8, Pdfl10, Pdfl11, Pdfl12, Pdfl15, and Pdfl20). Fragment amplification was obt ained for all individuals by varying the amount of DNA added to the PCR mix between 0.5-3 L. Extended forward primers with an M13 tail were used in combination with labeled M13 forward primers. Three different fluorochrome labels were used (D2, D3 a nd D4, Beckman Coulter, Fullerton, CA). PCR

PAGE 90

78 products labeled with different dyes were combined, and 1 L of the combined products was loaded on a CEQ 8000 capillary seque ncer (Beckman-Coulter, Fullerton, CA). Chromatograms were visualized on CEQ TM Genetic Analysis system software (Beckman Coulter, Fullerton, CA) and scored manually. Table 5-1. Accession numbers, genotypes, and population of origin of the pentaploid P. dilatatum material retrieved from germplasm banks. The number of individuals analyzed per accession is indica ted in parenthesis if it is more than one. The genotypes/individuals for which the chromosome number was confirmed or is first reported in th is study are marked by an asterisk. A population number is given in those case s in which more than one individual from the same location was analyzed. Accession Genotypes Population Accession Ge notypes Accession Genotypes Population N.A.7346 (8) A/RecC2*/RecC7* 7 PI 173004 M1 PI 410284 P1 N.A.7368 (8) P/V 2 PI 202298 G PI 410286 A N.A.7404 A* PI 202300 A PI 410287 A N.A.7416 L* PI 217623 A PI 462248 P N.A.7430 Recb1* PI 222812 A1 PI 462254 (8) A/Q 9 N.A.7440 (8) J/P/RecB4* 6 PI 235068 A PI 462256 (8) P/T 4 N.A.7465 (4) I/P/RecB3* 1 PI 271592 A PI 462258 A N.A.7471 O* PI 273255 A PI 462261 (8) RecC2* 10 N.A.7524 A* PI 274081 A PI 462262 P N.A.7525 W* PI 283015 RecA2* PI 462264 A N.A.7528 D* PI 285302 A PI 508671 U N.A.7529 Y* 3 PI 300076 A PI 508676 P N.A.7540 G* PI 300077 A PI 508682 P N.A.7541 P* PI 304015 E* PI 508692 F N.A.7542 A* 7 PI 310044 RecA1* PI 508694 D N.A.7543 RecB2* PI 310076 RecC4* PI 508701 A N.A.7544 A* PI 310077 N PI 508703 D N.A.7545 P* PI 310078 P PI 508705 A N.A.7562 (8) H* 8 PI 310083 D PI 508706 A N.A.7563 (8) C/RecC1* 5 PI 310088 A PI 508707 M N.A.7588 I* PI 310091 M PI 508708 A N.A.7606 P* PI 331112 A PI 508712 B N.A.7609 RecC3* 3 PI 338660 A PI 508715 A* N.A.7613 A* PI 404394 P PI 508719 G N.A.7618 RecC6* PI 404410 T PI 508725 P N.A.7619 H* PI 404412 P PI 508857 T* N.A.7657 X* 1 PI 404415 RecC5* PI 576135 M N.A.7658 P* 1 PI 404431 I N.A.7661 A* 1 PI 404432 P N.A.7665 P* 3 PI 404823 P N.A.7673 H* PI 409854 A N.A.7674 RecA3* PI 410281 A N.A.7688 S* 1 PI 410283 A N.A.7690 A* NSL 28721 D1

PAGE 91

Table 5-2. Allele frequency distributi ons in the tetrap loid biotypes of P. dilatatum used to estimate possi ble contributions to the recombinant pentaploid clones. P. dasypleurum P. dilatatum ssp. flavescens P. urvillei P. dilatatum Vacaria P. dilatatum Virasoro P. dasypleurum P. dilatatum ssp. flavescens P. urvillei P. dilatatum Vacaria P. dilatatum Virasoro P. dasypleurum P. dilatatum ssp. flavescens P. urvillei P. dilatatum Vacaria P. dilatatum Virasoro Pdfl11 Pdfl15 Pdfl20 172 0.181.002160.04 207 0.08 174 1.00 218 209 0.62 176 0.04 0.18 1.00 222 211 0.27 0.13 178 0.50 224 0.08 215 1.00 180 0.96 0.14 226 217 Pdfl4 228 0.50 221 1.00 196 1.00232 223 200 236 0.18 233 202 0.13 0.21 238 0.34 235 0.50 204 0.79 0.06 240 237 0.04 206 242 0.02 0.13 0.50 239 0.46 208 244 0.56 263 0.04 0.31 210 0.94 246 0.04 0.19 271 0.19 212 1.00 250 0.13 273 0.38 220 0.77 252 Pdfl1 2 226 2540.12 174 1.00 232 0.11 264 212 1.00 238 276 0.29 221 0.64 240 278 0.07 223 242 282 0.04 225 0.09 Pdfl 8 286 0.04 229 0.09 198 0.042920.08 233 0.18 218 0.11 0.44 294 0.08 235 0.39 220 0.06 296 0.12 239 224 0.38 298 0.15 241 0.61 226 0.07 0.06 302 0.08 245 230 1.00 1.00 312 0.08 251 232 326 0.08 253 234 332 0.08 Pdfl12b 236 0.11 0.320.063540.04 200 1.001.000.861.00 238 0.82 0.39 Pdfl10 210 0.14 1.00 240 0.07 175 Pdfl7 244 0.07179 233 1.00 266 181 0.18 1.00 235 272 187 0.05 241 1.00 274 191 0.45 249 0.81 276 195 0.09 0.06 251 1.00 0.19 Pdfl15b 207 253 202 0.922090.05 257 1.00 210 0.25 211 0.25 259 212 0.75 1.00 0.08 1.00 213 0.50 Pdfl20b 214 1.002210.09 196 0.36 225 0.04 197 0.25 0.57 2270.50 0.68 0.19 198 0.57 229 0.29 0.09 199 0.75 0.18 1.00 2370.50 200 0.25 245 201 1.00 203 0.07 79

PAGE 92

80 Data Analysis Alleles in complex patterns were assigned to loci based on Chapter 2. MSAnalyzer (Dieringer and Shlterer 2002) was used to su mmarize microsatellite data and calculate distance matrices based on the pr oportion of shared alleles (Dps) (Bowcock 1994). The number of mutational steps of ea ch genotype from the most common genotypes was estimated based on a Dps matrix and used to decide which genotypes should be further analyzed as recombinants. For the genotypes identified as mutational variants of the major clone, a genotype network was created using Network ( www.fluxus-engineering.com ) by the Median Joining method (Bandelt et al. 1999). Alleles of loci interpreted to be located on the I or J genome according to Chapter 2 were assigne d to either homologous locus in each individual based on size and/or conservation of the other allele, i.e. the shorter band could be considered a mutant of the “long” allele if the common “short” allele was conserved. The entire genotype was further treated as a single haplotype because it was assumed that recombination did not take place. Information about allele frequencies in the tetraploid biotypes of the Dilatata group was obtained from Chapter 4 and is here summarized and shown in Table 5-2 for comparison. Two exploratory approaches were followed to identify th e putative donor of alleles to each recombinant pentaploid. First, a matrix of Dps was generated with MSAnalyzer and the distance of each recombinan t to each tetraploid biotype was taken as an indication of putative ancestry. Second, al lele admixture proporti ons were explored using Structure (Pritchard et al. 2000). To circumvent the confounding effect of the high number of alleles shared by the typical pent aploid genotype and Virasoro, a population of a hypothetical ancestor of the typical clone was simulated by removing the alleles clearly

PAGE 93

81 attributable to a Virasorolike parent. The ancestry mode l was based on prior population assignments for the tetraploids and admi xture for the recombinant genotypes. The simulation was re-run with the nu mber of clusters set to re present the actual number of putative ancestral populations present in the ma trix. Otherwise, all of the default options were left in effect. The final simulati ons were carried out for 50000 burn in runs followed by 100000 MCMC replicates. Results A total of 29 multilocus genotypes for 12 loci were identified using the eight microsatellite primer pairs. Primer pair s Pdfl15 and Pdfl12 amplify two and Pdfl20 three independent loci (Chapter 2). The 177-bp ba nd which is thought to reside on the putative X genome locus Pdfl20c was present in all the individuals and is not shown in the figures. The data were first di splayed graphically (as in Fig. 5-4) and visually analyzed. A single most common genotype with a fe w mutations was evident while a few individuals were clearly reco mbinants. For exploratory purposes the most frequent genotypes (A and P) were treated as ancestral and mutational steps counted from them. To assess the extent of the major clone, the number of allele size differences of each genotype to the closest of either of the tw o versions of the major clone was calculated (Fig. 5-1). All genotypes w ith 5 or fewer allele differe nces to the common genotype were tentatively considered its mutational variants. A highly c ontrasting pattern was observed between those genotypes with 7 or more allele differences with the common genotypes and those with 5 or fewer. A progr ession in the number of allele-size changes from 0 to 5 was clearly interpretable as so matic mutations because alleles accumulate in the most unstable loci (Pdfl15 and Pdfl10) a nd the rest of the loci typically remain unchanged or show single-step mutations in th e longer alleles. These genotypes maintain

PAGE 94

82 at least 6 original heterozygous combinations of the common genotype This pattern is not observed in genotypes showing 7 or mo re allele differences from the common genotype; changes affect either allele and their size ranges are dr astically different. 0 2 4 6 8 10 12 14 16 18C6B3B2B4B1C5C1C4A2 C3 A1A3C7 APOP1QSTUWXBDIA1CLYEHJFD1GVM1N MNumberofalleledifferencesGenotype recombinants 0 2 4 6 8 10 12 14 16 18C6B3B2B4B1C5C1C4A2 C3 A1A3C7 APOP1QSTUWXBDIA1CLYEHJFD1GVM1N MNumberofalleledifferencesGenotype 0 2 4 6 8 10 12 14 16 18C6B3B2B4B1C5C1C4A2 C3 A1A3C7 APOP1QSTUWXBDIA1CLYEHJFD1GVM1N MNumberofalleledifferencesGenotype recombinants Fig. 5-1. Number of microsatell ite allele differences between all genotypes of pentaploid P. dilatatum and the nearest of the two most widespread genotypes (A and P). The total number of alleles considered is 22. A genotype network was built for the major cl one and its inferred somatic variants (Fig. 5-2a). The network repres ents a completely hierarchical arrangement with a total of 44 changes in 12 variable alleles of whic h 13 changes in the same 4 alleles are homoplasious (long alleles in Pdfl10, Pdfl15 and Pdfl8 and the short allele in Pdfl7) (Fig. 5-2a). Two frequent genotypes (A and P) include most of the individuals. Several genotypes are connected to th ese two common ones by one or a few mutations. Of the total 44 changes required to build the network, six were allele losses where the actual size of the resulting allele cannot be observed. For the remaining 38 changes, 20 or 21 represent size increases and 18 or 17 size de creases depending on wh ether genotype A or P is considered ancestral. These changes ar e not distributed evenly along the network or across loci. A single branch c onnecting genotypes G, H, and J to A accounts for 11 size increases. The ratio of increases to decrease s for the rest of the tree is 9:16. Of the 44

PAGE 95

83 total changes scored for 22 alleles, 10 are accounted for by the l onger allele of Pdfl15 alone and 7 by the longer allele of Pdfl10. A significant size difference of 7 steps separates a completely inac tive Pdfl15 long allele of a pproximately 28 GT repeats (branches departing from P) from a hypermutable Pdfl15 whose size increased independently twice: once leading to ge notypes M and M1 and a second time on the branch ending in H where it reaches a maxi mum length of approximately 40 repeats. The geographical locations of the genotypes shown in Fig. 5-2a are displayed in Fig. 5-2b. The genotypes show a high degree of admixture in the native range of the species. A meaningful statisti cal treatment of the geographical structure is not possible because the sampling strategy was deliberatel y biased in Uruguay where most of the samples and genotypes were found. Despite this, the most remarkable geographical patterns are the absence of genotype P towards the southw est and the high degree of admixture east of the Uruguay River. This extreme admixture of genotypes is best exemplified by the presence of highly diverg ent genotypes within a single population (see legend of Fig. 5-2b and Table 5-1). In contrast to the high diversity and ad mixture found within the native range, the samples retrieved from the rest of the wo rld all show the A genotype except for one accession from South Africa which shows the P genotype, and the samples from Florida, Greece, and Turkey, which show the M or a related genotype (Fig. 5-2c). As a first approach to analyze the origin of the recombinant genotypes, their allelic constitutions were compared to those of the known sexual biotypes in the group. The estimation of the putative contribut ions of Virasoro, Vacaria, and P. dilatatum ssp. flavescens to the recombinants suggests the same pattern when estimated by Structure

PAGE 96

84 M M A A A A A A A A A A A A A A P1 M1 A1 D1 Fig. 2bC -35 -30-75-65 -55R o d e l a P l a t aAtlanticOceanPacificOceanP a r a n U r u g u a yP a r a g u a yP P P P P P P P P P P P P 1 P 2 2 P, V T U O W 3 4 4 Q, R M M N K A A A A A A A A A A A A A A L B 5 5 C, RecC1 6 6 P, J, RecB4 7 7 A, RecC2, RecC7 F E D D D G G G G 1 S, X, P, I A RecB3 I I H H 8 8 H 3 Y, S, RecC3 B P1 5 S S1 0 L U2 0 L R1 5 L T 7 S 1 0 S 4 S V2 0 L Q 10L P1 10L W 1 0 L X1 5 L O1 5 L 1 1 S Y 7S L 15L M 12L 8L 10L M1 7S 15L10L K 15L 10L A 8 S A1 1 0 S B 2 0 L C 1 5 L D1 1 L E 8 L N 4 L 12L F2 0 b S D1 15 L 1 0 L 4 S 1 2 L 7 L G 1 5 L I 1 5 L 1 5 S H 8 S 1 0 L 7 S J A 9 9 A M M A A A A A A A A A A A A A A P1 M1 A1 D1 Fig. 2bC M M A A A A A A A A A A A A A A P1 M1 A1 D1 M M A A A A A A A A A A A A A A P1 M1 A1 D1 Fig. 2bC -35 -30-75-65 -55R o d e l a P l a t aAtlanticOceanPacificOceanP a r a n U r u g u a yP a r a g u a yP P P P P P P P P P P P P 1 P 2 2 P, V 2 P, V T U O W 3 4 4 Q, R 4 Q, R M M N K A A A A A A A A A A A A A A L B 5 5 C, RecC1 5 C, RecC1 6 6 P, J, RecB4 6 P, J, RecB4 7 7 A, RecC2, RecC7 7 A, RecC2, RecC7 F E D D D G G G G 1 S, X, P, I A RecB3 1 S, X, P, I A RecB3 I I H H 8 8 H 8 H 3 Y, S, RecC3 3 Y, S, RecC3 B P1 5 S S1 0 L U2 0 L R1 5 L T 7 S 1 0 S 4 S V2 0 L Q 10L P1 10L W 1 0 L X1 5 L O1 5 L 1 1 S Y 7S L 15L M 12L 8L 10L M1 7S 15L10L K 15L 10L A 8 S A1 1 0 S B 2 0 L C 1 5 L D1 1 L E 8 L N 4 L 12L F2 0 b S D1 15 L 1 0 L 4 S 1 2 L 7 L G 1 5 L I 1 5 L 1 5 S H 8 S 1 0 L 7 S J A P1 5 S S1 0 L U2 0 L R1 5 L T 7 S 1 0 S 4 S V2 0 L Q 10L P1 10L W 1 0 L X1 5 L O1 5 L 1 1 S Y 7S L 15L M 12L 8L 10L M1 7S 15L10L K 15L 10L A 8 S A1 1 0 S B 2 0 L C 1 5 L D1 1 L E 8 L N 4 L 12L F2 0 b S D1 15 L 1 0 L 4 S 1 2 L 7 L G 1 5 L I 1 5 L 1 5 S H 8 S 1 0 L 7 S J P1 5 S 1 5 S S1 0 L 1 0 L U2 0 L 2 0 L R1 5 L 1 5 L T 7 S 1 0 S 4 S 7 S 1 0 S 4 S V2 0 L Q 10L 10L P1 10L 10L W 1 0 L X1 5 L O1 5 L 1 1 S 1 1 S Y 7S L 7S L L 15L M 12L 8L 10L M1 7S 15L 7S 15L10L K 15L 10L A 8 S 8 S A1 1 0 S 1 0 S B 2 0 L 2 0 L C 1 5 L 1 5 L D1 1 L 1 1 L E 8 L N 4 L 12L 12L F2 0 b S 2 0 b S D1 15 L 15 L 1 0 L 4 S 1 2 L 7 L G 1 5 L 1 5 L I 1 5 L 1 5 L 1 5 S 1 5 S H 8 S 1 0 L 7 S J A 9 9 A 9 A Fig. 5-2. Genotypic relationships and geographical distribution of the clonal variants of pentaploid P. dilatatum A. A haplotype network of the multilocus microsatellite genotypes. Allele lo sses are indicated by crosses and size variations as boxes on the bran ches assuming either genotype A or P is ancestral. Box sizes are proportional to allele-size increase (black boxes) or decrease (white boxes) in dinucleotide repeats. B and C.. Distribution of clonal variants of typical P. dilatatum B. within its native range and C. outside its native range. Letters refer to the genotypes shown in Figure. 2A. Circled numbers in Fig. 2B correspond to locations for which more than one individual was analyzed. The genotypes found in each population are indicated in the legend.

PAGE 97

85 0 0.5 1A P RecA1 RecA2 RecA3 RecB1 RecB2 RecB3 RecB4 RecC1 RecC3 RecC4 RecC5 RecC6 RecC7 Virasoro dilatatum -Virasoro Vacaria flavescensCluster contributiontogenotypeGenotype 0 0.5 1A P RecA1 RecA2 RecA3 RecB1 RecB2 RecB3 RecB4 RecC1 RecC3 RecC4 RecC5 RecC6 RecC7 Virasoro dilatatum -Virasoro Vacaria flavescens 0 0.5 1A P RecA1 RecA2 RecA3 RecB1 RecB2 RecB3 RecB4 RecC1 RecC3 RecC4 RecC5 RecC6 RecC7 0 0.5 1A P RecA1 RecA2 RecA3 RecB1 RecB2 RecB3 RecB4 RecC1 RecC3 RecC4 RecC5 RecC6 RecC7 Virasoro dilatatum -Virasoro Vacaria flavescens Virasoro dilatatum -Virasoro Vacaria flavescensCluster contributiontogenotypeGenotype Fig. 5-3. Estimated tetraploid biotype cont ributions to the pentaploid recombinant P. dilatatum genotypes. The clusters were ge nerated by Structure based on prior population assignments and the number of clusters (K) set to 4 to represent each of the indicated putative tetraplo id sources: Virasoro, Vacaria, ssp. flavescens and a fourth sample inferred from the alleles present in the most common genotypes of typical P. dilatatum not shared with Virasoro. The simulation resulted in no admixture estim ated for the tetraploid biotypes each of which was completely assigned to its own cluster (not shown). Table 5-3. Proportion of shar ed allele distances (Dps) of the recombinant pentaploids of P. dilatatum to the tetraploid biotypes of the Dilatata group. The distance of each recombinant to the nearest biotyp e is indicated in bold italics. Genotype P .dasypleurum P. dilatatum ssp. flavescens P. urvillei P. dilatatum Vacaria P. dilatatum Virasoro RecA1 0.90 0.94 0.85 0.95 0.35 RecA2 0.95 0.89 0.82 0.95 0.50 RecA3 0.90 0.92 0.86 0.95 0.35 RecB1 0.78 0.51 0.79 0.80 0.80 RecB2 0.83 0.48 0.79 0.86 0.75 RecB3 0.85 0.55 0.78 0.86 0.80 RecB4 0.78 0.55 0.78 0.80 0.85 RecC1 0.85 0.86 0.78 0.85 0.65 RecC3 0.85 0.86 0.77 0.80 0.65 RecC4 0.80 0.89 0.83 0.80 0.60 RecC5 0.85 0.86 0.78 0.86 0.65 RecC6 0.80 0.84 0.71 0.78 0.55 RecC7 0.64 0.78 0.80 0.69 0.83 (Fig. 5-3) or represented by Dps (Table 5-3). Three putative groups of recombinants are apparent in both analyses. Recombinant gr oup A shows greater similarity to Virasoro than the typical clone, recombinant gr oup B shows a clear contribution from P. dilatatum

PAGE 98

86 ssp. flavescens and recombinant group C is more heterogeneous and appears to share more alleles with Virasoro than the typi cal clone. The multilocus genotypes shown in Fig. 5-4 are in complete agreement with this In agreement with the estimated allele admixture proportions shown in Fig. 5-3, the ge notypes in groups A and B can be almost fully accounted for by a cross between typica l clones A or P and the individuals of Virasoro and P. dilatatum ssp. flavescens included in Fig. 5-4. 168 188 208 228 248 268Dil-A RecA1 RecA2 REcA3 Vir1 Vir2 Dil-P RecB1 RecB2 RecB3 RecB4 Flav1 Flav2 Dil-A RecC1 RecC2 RecC3 RecC4 RecC5 RecC6 RecC7 Pdfl11 Pdfl20 Pdfl20b Pdfl4(-15bp) Pdfl15b Pdfl7 Pdfl12 Pdfl12b Pdfl8 Pdfl10 168 188 208 228 248 268 168 188 208 228 248 268Dil-A RecA1 RecA2 REcA3 Vir1 Vir2 Dil-P RecB1 RecB2 RecB3 RecB4 Flav1 Flav2 Dil-A RecC1 RecC2 RecC3 RecC4 RecC5 RecC6 RecC7 Pdfl11 Pdfl11 Pdfl20 Pdfl20 Pdfl20b Pdfl20b Pdfl4(-15bp) Pdfl4(-15bp) Pdfl15b Pdfl15b Pdfl7 Pdfl7 Pdfl12 Pdfl12 Pdfl12b Pdfl12b Pdfl8 Pdfl8 Pdfl10 Pdfl10 Fig. 5-4. Multilocus microsatelli te genotypes for the recombinant genotypes of pentaploid P. dilatatum The nearest genotype from the typical clone ( A or P) is shown next to each recombinan t group. Two individuals of P. dilatatum ssp. flavescens and Virasoro are shown next to each of the clusters they appear to be related to for comparison. The highly variable locus Pdfl15 is not shown.

PAGE 99

87 Furthermore, recombinants of group B are found in the area of co-occurrence of pentaploids and P. dilatatum ssp. flavescens and the recombinants of group A are found either in the area of distribution of Virasoro or near it (Fig. 5-5). The putative recombinants of group C presen t a different situation. First, a clear contribution of an existing tetraploid to their genotypes was not found. Second, their geographical distribution does not overlap with that of any currently known tetraploid, except for genotype C5, and third, they show a llele sizes that are beyond the range so far detected in the tetraploids an alyzed (longer allele of Pdfl15 in C1, 2 and 7; longer allele of Pdfl8 in C1-5; shorter allele of Pdfl10 in C1, 2 and 5) (Table 5-2). Genotype C5, in spite of its geographical location, does not s how a clear contribution of Vacaria (see Fig. 5-4 and Table 5-2). Discussion The “Typical” Clone One of the difficulties encountered in this data set was the discrimination of the extent of the variability caused by mutation fr om that due to hybrid ization. Although it was evident from the data that a single co mmon genotype comprises the majority of the accessions analyzed, hybridization to a homoz ygous source could be confounded with a high degree of mutagenic activity. The genot ypic matrix contained 22 different alleles because the common genotype is heterozygous at all the loci assigned to the I or J genomes. If this clone crossed to any unrel ated genotype, a maximum of 11 allele-size differences would be expected. However, the two tetraploids w ith which hybridization was hypothesized (Virasoro and P dilatatum ssp. flavescens ) share a number of alleles with pentaploid P. dilatatum ; hybridization to either of them would then produce fewer than the maximum of 11 differences. With a low number of hybrids as detected here,

PAGE 100

88 sexual events would not necessari ly cause conflict in the data matrix and could maintain a hierarchical structure in spite of recombination. More syst ematic character compatibility approaches to detecting recombination in apom icts rely on the genera tion of this conflict (Mes 1998) and only provide an approxima tion to the quantification of sexual reproduction (Mes et al. 2002). In spite of the above, our case by case analysis has probably resulted in a very re alistic distinction of clonal variants and recombinants. In well-studied apomictic plant systems like Taraxacum apomicts tend to behave as good overseas colonizers (van Dijk 2003); however, unlike P. dilatatum native ranges usually contain an assemblage of indepe ndently generated clone s regardless of how widespread they may be (van der Hulst et al 2000). Regardless of the detection of a certain number of recombinants, most of pentaploid P. dilatatum comprises a single clone with its somatic variants; moreover, most of the individuals collected outside the native range of the species have shown the same genot ype when analyzed for this set of loci. The actual extension of this clone around th e globe is not known but it has been shown here to be present on every continent. The cu rrent collection is not suitable for estimating the proportion of typical genotype s within the native range b ecause most of the samples were collected as individual off-types or as different types within a morphologically variable population. It is likely then, that recombinants are less frequent than detected here. It is remarkable that the typical clone was present in all populational samples containing recombinants except population 10. This population, however, was collected and annotated as P. pauciciliatum so it is likely that if typical individuals were present at the site, they may ha ve been avoided.

PAGE 101

89 It follows from the above that the dominan ce of this clone is not currently being challenged, not even at the local scale. Whether this clone is a one-of-a-kind highly successful interspecific combination or the result of selection among numerous related clonal lineages (Parker et al. 1977), typical pentaploids may represent a General Purpose Genotype (GPG) (Lynch 1984). The GPG hypothes is is even more appealing for a longlived perennial grass with low seed production than for the insect populations with rapid turn-over for which it was advanced. On the other hand, clones are not necessarily evolutionarily inactive (Loxdale and Lushai 2003 ) or devoid of marker diversity (Mes et al. 2002). The mutational diversific ation of the typical clone of P. dilatatum detected with microsatellites is significant, and it is likely that the biot ype contains a great unexplored wealth of genetic variability. Distribution of Clonal Div ersity in the Native Range It is well established that the plant communities of the Uruguayan grasslands have been dramatically altered by th e introduction of domestic cat tle, with current conditions favoring semiprostrate warm-season grasses (Rodrguez 2003). Among the biotypes of P. dilatatum it is particularly the pentaploids that match such ecological requirements. It has long been thought (J.C. Millot pers. comm. 1990) that pentaploid P. dilatatum originally had a much more restricted di stribution and has rapi dly spread since the introduction of domestic cattle in the 17th century. Ravines and waterways in the hilly landscape of eastern Uruguay currently provide refugium conditions for subtropical flora (Grela 2003). Independent lines of ongoing research (Speranza and Sols-Neffa, Vaio and Speranza unpub. res.) indicate that the herbac eous components in this region are also genetically differentiated from surroundings populations, suggesting that the area may have acted as a refugium during drier and c ooler climatic phases fo r herbaceous species

PAGE 102

90 that are currently more widespread. In this scenario, the typical clone may have originated and spent most of its history in the suggested (or any other) restricted geographical range, and generate d most of its somatic varian ts before spreading during the past three centuries. Such rapid expans ion can account for the lack of geographical structure in the distribution of genotypes and th e multiplicity of clonal variants in eastern Uruguay. Hybridization and its Genetic Consequences In areas of sympatry with compatible sexua l species, the typical clone seems to be developing a reservoir of altern ative forms which may play an important role in securing the survival of the biotype if the climatic or eco logical conditions in the area changed. This pattern has been reported for several agamic complexes (Hrandl 2004) and recently for P. notatum (Daurelio et al. 2004). The current contact between pentaploids and some tetraploids, on the other hand, may be secondary and relatively recent, as reflected by the geographical location of hybrid s with Virasoro and ssp. flavescens The presence of hybrids in these areas represents indeed the ongoing transfer of genetic variability from a locally adapted selfer like P. dilatatum ssp. flavesencens to a genetically aggressive advancing species, much in the fashion of the compilospecies concept proposed by Harlan (1963). The fact s that Virasoro and ssp. flavescens are selfers, highly homozygous (Chapter 3, Chapter 4, Hickenbick et al. 1992) and c onsequently probably carry a low genetic load has further implications in the same direction: the incorporation of an IJ gamete from either of them is equivalent to the incorporation of the whole genotype of a locally adapted counterpart a nd a significant simultaneous reduction of the genetic load of the resulting apomict.

PAGE 103

91 The Mechanism The formation of euploid apomictic pentaploids by hybrid ization between tetraploids and pentaploids has been achie ved experimentally w ith a relatively high frequency (Speranza 1994 unpub. res.). Benne tt et al. (1969) re ported a very low crossability for the tetraploid x pentaplo id cross (0.04%) but we obtained almost 1% crossability (4 hybrids out of 455 emasculations ), nearly ten times as high as the average of our crosses to hexaploids (Chir) over three seasons (17 hybrids out of 11,100 emasculations). Of the 4 hybrids we obtained, 2 were pentaploid and apomictic and were almost indistinguishable from their pentap loid parent, one was aneuploid (2n=45) and sexual, and the fourth one was heptaploid (2n=70). When analyzed with the same markers used in this study, the genotypes of the pentaploids were as expected for an F1 hybrid. Euploid hybrids can be generated if pentaploids can produce normally reduced gametes for their I and J genomes that carry a full complement of X chromosomes. When the meiotic fate of the X chromoso mes was observed in the pentaploid pollen donor, they were seen to lag during anaphase I, stay condensed and end up in one of the dyad members at the end of telophase I. Most lagging chromosomes were observed to form a single micronucleus with a much hi gher frequency than expected by chance. Unexpectedly, this chromatin cl uster organized itself into a secondary metaphasic plate, and sister chromatids segregated synchroni cally with the main group of chromosomes (Mazzella and Speranza 1997, M. Klastornick, unpub. res.) Hybrids receiving less than the 10 X chromo somes in this kind of cross apparently do not inherit apomixis. The 45-chromosome plant we recovered from a cross between the tetraploid P. dilatatum ssp. flavescens and pentaploid P. dilatatum was weak and sexual and the F3 individuals reverted to a phenotype very similar to that of P. dilatatum

PAGE 104

92 ssp. flavescens Bennett et al. (1969) and Burson (1995) also reported plants with incomplete X genomes that reproduced sexually, indeed it was this la st hybrid that was later used to assess the homology be tween the X genomes of pentaploid P. dilatatum and Chir (Burson 1991). It can be safely concl uded that the apomixis genes are located on the X chromosomes but, are all ten X chromosomes necessary for apomixis? This cannot be answered for sure yet, but most of the artificia l and natural hybrids reported have a full complement of X chromosomes. Once this t ype of euploid IJX gamete can be produced, their frequency need not be too high to expl ain the formation of ap omictic pentaploids by tetraploid x pentaploid crosses. Events in which apomixis has not been successfully passed on will not be observed in nature, and the establishment of apomixis seems to require at least most of the chromosomes of the X genome. How Many Times? The origin of the typical pentaploids ha s not been established yet; however, the completely heterozygous genotype of the pe ntaploids suggests at least one round of hybridization after apomixis wa s established (Chapter 4). The microsatellite genotype of P. pauciciliatum is congruent with a pentaploid x diploid cross, and evidence for the derivation of Uuruguaiana, Chir, and a heptap loid hybrid from the pentaploid form is even more compelling. Here, at least four independent events of crosses to ssp. flavescens three to Virasoro and an undetermin ed number to at least one more unidentified tetraploid are we ll supported by the data. Furt hermore, the hybrids reported by Machado et al. (2005) may well fit the same pa ttern. In all these cr osses, the same set of ten chromosomes of the X genome has been transmitted without changes or recombination. Our results do not show any evidence that the process will come to an end in the near future; the X genome needs onl y maintain its ability to code for apomixis

PAGE 105

93 to secure its survival regardless of how ma ny times it may be transferred onto different IIJJ backgrounds Pentaploid P. dilatatum far from being the fortunate single product of a random encounter between a dwindling he xaploid and a geographically restricted tetraploid seems to be an aggressive compilo species with an unpredictable evolutionary future.

PAGE 106

94 CHAPTER 6 CONCLUDING REMARKS The work presented in this dissertation has provided answers to several questions about the evolutionary mechanisms ope rating within the Dilatata group of Paspalum The apomictic complex within the group ha s been shown to be evolutionarily active and still generating new variants. The focus has shifted from the hexaploids, which were thought to have play ed a central role in the form ation of new apomicts, to the pentaploids, whose evolutiona ry potential has been clearly demonstrated. At the same time, a mechanism was proposed by means of which an imbalanced polyploid can be involved in several sexual ev ents and reproduce itself while enhancing its evolutionary potential in the process. This phenomenon, even though it does not seem to have been too frequent, is reminiscent of the compilospecies model, in which a genetically aggressive entity is able to engulf the local adaptation generated by related species and advance over their areas of dist ribution. The behavior of th e X genome of the Dilatata group is somewhat unprecedented. Even if some of the transmission events that were hypothesized in Chapters 4 and 5 could be give n an alternative explanation, it seems that the same set of ten chromosomes has been transmitted unchanged and unrecombined several times since the origin of the group. This mechanism is a powerful explanatory tool which can account for the multiplicity of forms currently known in the group and predicts that several more will be found. Before this work, the apomicts in the D ilatata group comprised one tetraploid, one pentaploid and two hexaploids, each one thought to be a unique event. Only recently had

PAGE 107

95 the possibility that the group contained more forms been suggested by Machado et al. (2005). My analysis shows that the group contains multiple hybrids, all of which are similarly divergent and deserve the same rank as the four biotypes that had been identified based on chromosome numbers. Each one of the four previously known hybrids had been treated by applied research ers as a different entity and analyzed accordingly. It can easily be predicted that within the next few years the number of new “biotypes” will have increased at least by one order of magnitude, and the task of evaluating them may have also increased accordingly. The collection and management of the accessions should also accompany the new perspective. The recombinant individuals ha ve most often been found intermixed with representatives of the typical pentaploid clone. A collec tion of highly divergent apomicts is not a valid management unit in a clonal br eeding program. To be able to manage or use these new “biotypes,” individual pr ogeny accessions should be stored and characterized. This strategy proved successf ul in reflecting the variability in the populations that had been identified as variab le by J.C. Millot as was shown here. The current collections should be restructured and the component clones of each accession identified and separated if they are ever to be used for the purpose they were intended. No attempt to make taxonomic decisions was made in any of the parts of this dissertation. However, the issue seems unavoidable. The relationships among the tetraploid components of the group have not been clarified; however, the fact that they share an identical sequence for all the chloropl ast regions that were analyzed (except for the addition or deletion of a few adenines in a poly A-tract) clearly stresses their relatedness.

PAGE 108

96 Two of them P. dasypleurum and P. urvillei have been acknowledged as different species. The remaining three entities, curren tly considered biotype s (or subspecies) of P. dilatatum are genetically distinct, an d no gene flow has been reco rded except in artificial crosses. A comprehensive mo rphological study including an e xhaustive determination of their distribution ranges is still lacking, but it is likely that no biological connections other than their relatedness will be found among them. Perhaps, from the point of view of convenience, they should first become name d subspecies as was suggested in Chapter 4. The apomicts, on the other hand, may all be connected by a few sexual events, and it is possible that their ancest ries trace back to a single population or even a single individual, and they can be considered to be the product of several attempts by the same entity to secure its evolutionary future. Ev en if the informal biotype designations in use are still appropriate for the hexaploids, the expression “common” to designate the pentaploids has lost all meaning. The pred icted multiplicity of hybrids will make the naming of all of them impr actical and meaningless. The origin of the Dilatata group as a whole remains as obscure as it was. In fact, the arrangement of the speci es with known genomic form ulae in the preliminary phylogeny that was shown in the Chapter 1 suggests that we may be a long way from identifying the direct donors of the tw o basic genomes on which the complex is constructed. The complex relationships among the members of the Quadrifaria group that were outlined in Vaio et al. (2005) cautions about the current interpretation of cytogenetic affinities. In spite of this, the first necessary step has been taken. The construction of a phylogeny of the genus is under way.

PAGE 109

97 REFERENCES Albicette Bastreri, MM (1980) Estudi o citogentico en biotipos de Paspalum dilatatum tipo Chir e hbridos interespecficos con Paspalum proliferum Ing. Agr. Thesis. Ministerio de Educacin y Cultura, Montevideo, Uruguay. Aliscioni, SS Guissiani, LM Zuloaga, FO Kellogg, EA (2003) A molecular phylogeny of Panicum (Poaceae:Paniceae): test s of monophyly and phylogenetic placement within the Panicoideae 1. Am J Bot 90:5 796-821 Allard RW, Babbel GR, Clegg MT, Kahler AL (1972) Evidence for coadaptation in Avena barbata Proc Natl Acad Sci 69:3043-3048 Altesor A, Di Landro E, May H, Ezcurra E (1998) Long term species change in a Uruguayan grassland. J Veg Sci 9:173-180 Alvarez AE, van de Wiel CCM, Smulders MJM, Vosman B (2001) Use of microsatellites to evaluate genetic diversity and species relationships in the genus Lycopersicon Theor Appl Genet 103:1283-1292 Amos W, Sawcer FJ, Feakes RW (1996) Mi crosatellites show mutational bias and heterozygote instability. Nature Genet 13:390-391 Bandelt HJ, Forster P, Rhl A (1999) Me dian-Joining Networks for Inferring Intraspecific Phylogenies Mol Biol Evol 16:37-48 Barreto IL (1966) Las especies afines a Paspalum quadrifarium (Gramineae) en la Amrica del Sur de clima sub-tropical y templado. Darwiniana 14:130-155 Bashaw EC, Forbes Jr I (1958) Chromo some numbers and microsporogenesis in Dallisgrass Paspalum dilatatum Poir. Agron J 50:441-445 Bashaw EC, Holt EC (1958) Megasporoge nesis, embryo sac development and embryogenesis in Dallisgrass, Paspalum dilatatum Poir. Agron J 50:753-756 Bennett HW, Burson BL, Bashaw EC (1969) Intr aspecific Hybridization in Dallisgrass, Paspalum dilatatum Poir. Crop Sci 9:807-809 Boutin-Garnache I, Raposo M, Raymond M, Deschepper CF (2001) M13-tailed primers improve the readability and usability of mi crosatellite analyses performed with two different allele-sizing me thods. Biotechniques 31:24-26

PAGE 110

98 Bowcock AM, Ruiz-Linares A, Tomfohrde J, Minch E, J.R. Kidd, Cavalli-Sforza LL (1994). High resolution human evolutionary trees with pol ymorphic microsatellites. Nature 368:455-457 Brown AHD (1990) Genetic char acterization of plant mating systems. In; Brown AHD, Clegg MT, Kahler A, Weir B (eds) Plan t population genetics, breeding and genetic resources. Sinauer,Sunderland, Mass, pp 145–162 Burson BL (1978) Genome relations between Paspalum conspersum and two diploid Paspalum species. Can J Gen Cytol 20:365-372 Burson BL (1979) Cytogenetics of Paspalum urvillei x P. intermedium and P. dilatatum x P. paniculatum hybrids. Crop Sci 19:534-538 Burson BL (1983) Phylogenetic investigations of Paspalum dilatatum and related species. Proc XIV Int Grassl Cong:170-173 Burson BL (1991)a Homology of chromoso mes of the X genomes in common and Uruguayan dallisgrass, Paspalum dilatatum Genome 34:950-953 Burson BL (1991)b Genome relationships betwee n tetraploid and hexa ploid biotypes of dallisgrass, Paspalum dilatatum Bot Gazz 159:219-223 Burson BL (1992) Cytology and reproduc tive behavior of hybrids between Paspalum urvillei and two hexaploid P. dilatatum biotypes. Genome 35:1002-1006 Burson BL (1995) Genome relationship and reproductive behavior of intraspecific Paspalum dilatatum hybrids: Yellow-anthered x Uruguaiana. Int J Plant Sci 156:326-331 Burson BL, Quarn CL (1982) Cytology of Paspalum virgatum and its relationship with P. intermedium and P. jurgensii Can J Gen Cytol 24:219-226 Burson BL, H Lee, Bennett EC (1973) Genome relations between tetraploid Paspalum dilatatum and four diploid Paspalum species. Crop Sci 13:139-143 Burson BL, Quarn CL (1991) Cy tological relationship between Paspalum dilatatum and diploid cytotypes of P. brunneum and P. rufum Genome 35:332-336 Burson BL, Voigt PW, Evers GW (1991) Cyto logy, reproductive behavior, and forage potential of hexaploid dallisgr ass biotypes. Crop Sci 31:636-641 Campbell CS, Quinn JA, Cheplick GP, Bell TJ (1983) Cleistogamy in grasses. Annu Rev Ecol Syst 14:411-441 Caponio I, Quarn CL (1990) Intraand Inte rspecific hybridization between dallisgrass and vaseygrass. Crop Sci 30:362-364

PAGE 111

99 Caponio I, Quarin CL (1993) Cytology and reproduction of Paspalum densum and its genomic relationship with P. intermedium and P. urvillei J Hered 84:220-222 Casa AM, Mitchel SE, Lopes CR, Valls JF M (2002) RAPD analysis reveals genetic variability among sexual and apomictic Paspalum dilatatum Poiret biotypes. J Hered 93:300-302 Chase A (1929) North American species of Paspalum Contributions from the US National Herbarium. vol 28 Part 1 Chen X, Cho YG, McCouch SR (2002) Sequenc e divergence of rice microsatellites in Oryza and other plant species. Mol Genet Genomics 268:331-343 Clayton WD, Renvoize SA (1986) Genera Graminum grasses of the world. Kew Bulletin, additional series 13 Cornuet JM, Luikart G (1996) Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144:2001-2014 Darwin C.(1839). Journal of researches in to the geology and natural history of the various countries visited by H.M.S. Beagle. London da Costa DI, Scheffer-Basso SM (2003) Ca racterizao Morfofisiolgica e Agronmica de Paspalum dilatatum Poir. Bitipo Virasoro e Festuca arundinacea Schreb. 1. Desenvolvimento Morfolgico. R Bras Zootec 32:1054-1060 Daurelio LD, Espinoza F, Quarn CL, Pessi no SC (2004) Genetic diversity in sexual diploid and apomictic tetr aploid populations of Paspalum notatum situated in sympatry or allopatry. Pl Syst Evol 244:189-199 Di Rienzo A, Peterson AC, Garza JC, Va ldes AM, Slatkin M, Freimer NB (1994) Mutational processes of simple-sequence repeat loci in human populations. Proc Natl Acad Sci 91:3166-3170 Dieringer D, Schlterer C ( 2003) Microsatellite Analyser (M SA): a platform independent analysis tool for large microsatellit e data sets. Mol Ecol Notes 3:167-169 Doyle JJ, Morgante M, Tingey SV, Powell W (1998) Size Homoplasy in Chloroplast Microsatellites of Wild Pere nnial Relatives of Soybean ( Glycine Subgenus Glycine ). Mol Biol Evol 15:215-218 Duvall, MR Noll, JD Ninn, AH (2001) Phyl ogenetics of the Paniceae Am J Bot 88:11 1988-1992 Ellegren H, Primmer CR, Sheldon BC (1995) Micr osatellite “evolution”: directionality or bias? Nature Genet 11:360-362

PAGE 112

100 Elsik CG, Williams CG (2001) Families of clus tered microsatellites in a conifer genome. Mol Genet Genomics 265:535-542 Epperson BK (2000) Spatial genetic structur e and non-equilibrium demographics within plant populations. Plant Species Biol 15:269-279 Ernst JA, Branch C, Clarck AM, Hokit DG (2004) Polymorphic microsatellite markers for the Florida scrub lizard (Sceloporu s woodi ). Mol Ecol Notes 4:364-365 Espinoza F, Quarn CL (2000) 2n+n hybridization of apomictic Paspalum dilatatum with diploid Paspalum species. Int J Plant Sci 161:221-225 Estoup A, Jarne P, Cornuet JM (2002) Homopl asy and mutation model at microsatellite loci and their consequences for populat ion genetics analysis. Mol Ecol 11:15911604 Estoup A, Rousset F, Michalakis JM, Cor nuet M, AdriamangaM, Guyomard R (1998) Comparative analysis of microsatellit e and allozyme amrkers: a case study investigating microgeographic di fferentiation in brown trout ( Salmo trutta ). Mol Ecol 7:339-353 Excoffier L, Smouse PE, Quattro JM (1992) An alysis of molecular variance inferred from metric distances among dna haplotype s: application to human mitochondrial DNA restriction data. Genetics 131:479-791 Fischer D, Bachmann K (1998) Microsatellite enrichment in organisms with large genomes ( Allium cepa L.). Biotechniques 24:796-802 Frankel R, Galun E (1977) Pollination mech anisms, reproduction and plant breeding Springer-Verlag, Berlin, pp 52-78 Garza JC, Slatkin M, Freimer NB (1995) Micr osatellite allele frequencies in humans and chimpanzees with implications on constr aints on allelel size. Mol Biol Evol 12:954-603 Giussani, LM Cota-Sanchez, JH Zuloaga, FO Kellog, EA (2001). A molecular phylogeny of the grass subfamily Panicoideae (P oaceae) shows multiple origins of C4 photosynthesis. Am J Bot 88:11 1993-2012 Goldstein DB, Linares AR, Cafalli-Sforza LL, Feldman MW (1995) An evaluation of genetic distances for use with micr osatellite loci. Genetics 139:463-471 Gmez Martnez R, Culham A ( 2000) Phylogeny of the subfamily Panicoideae with emphasis on the tribe Paniceae : evidence from the trnL-F cpDNA region. In Jacobs WL and Everett J (eds.) Grass systematics and evolution-Vol. 2 of Proceedings of the Second International C onference on the Comparative Biology of the Monocots, Melbourne, CSIRO, Australia.

PAGE 113

101 Gonzlez S, Maldonado JE, Leonard JA, Vil C, Barbanti Duarte JM, Merino N Brum Zorrilla N Wayne RK (1998) Conservation ge netics of the endangered Pampas deer ( Ozotoceros bezoarticus ). Mol Ecol 7:47-56 Goudet J, Raymond M, de Mees T, Rousset F (1996) Testing differentiation in diploid populations. Genetics 144:1933-1940 Green JM, Barker JHA, Marshall EJP, Fr oud-Williams RJ, Peters NCB, Arnold GM Dawson K Karp A (2001) Microsatellite an alysis of the inbreeding grass weed Barren Brome ( Anisantha sterilis ) reveals genetic diversity at the withinand between-farm scales. Mol Ecol 10:1035-1045 Grela I (2003) Geografa flors tica de las especies arbreas de Uruguay: propuesta para la delimitacin de dendrofloras. Masters Thesis. Programa de Desarrollo de las Ciencias Basicas, Ministerio de Educacion y Cultura, Universidad de la Republica, Montevideo, Uruguay. Hamrick JL, Godt MJW (1990) Allozyme di versity in plant species. In; Brown AHD, Clegg MT, Kahler A, Weir B (eds) Plan t population genetics, breeding and genetic resources. Sinauer,Sunderland, Mass, pp 43-63 Hamrick JL, Godt MJW (1997) Allozyme dive rsity in cultivated crops. (Germplasm regeneration: Develpments in population gene tics and their implications). Crop Sci 31:26-30 Harlan JR, de Wet JMJ (1963) The compilo species concept. Evolution 17:497-501 Hazen SP, Leroy P, Ward RW (2002) AFLP in Triticum aestivum L.: patterns of genetic diversity and genome dist ribution. Euphytica 125:89-102 Heywood JS (1991) Spatial anal ysis of genetic variation in plant populations. Annu Rev Ecol Syst 22:335-355 Hickenbick MCM, Flores AI P Cavalli-Molina S, Weber LH, Kersting ACO, Costa LS, de Souza-Chies TT, Albarus MH (1992) Mode of reproduction and seed production in Paspalum dilatatum Poir. Virasoro biotype-Dil atata group (Gramineae). Rev Brasil Genet 15:85-102 Hite JM, Eckert KA, Cheng KC (1996) Fact ors affecting fidelity of DNA synthesis during PCR amplification of d(C-A)n. D(GT)n microsatellite repeats. Nucleic Acids Res 24:2429-2434 Hrandl E (2004) Comparative analysis of ge netic divergence among sexual ancestors of apomictic complexes using isozym e data. Int J Plant Sci 165:615-622 Ishii T, McCouch SR (2000) Microstellites and microsynteny in th e chloroplast genomes of Oryza and eight other Gramineae species. Theor Appl Genet 100:1257-1266

PAGE 114

102 Jakse J, Javornik B (2001) High Throughput Isolation of Microsatellites in Hop ( Humulus lupulus L.). Plant Mol Biol Rep 19:217-226 Jarret RL, Ozias-Atkins P, Phatak S, Na dimpalli R, Duncan R, Hiliard S (1995) DNA contents in Paspalum spp. determined by flow cytometry. Genet Resour Crop Ev 42:237-242 Kandpal RP, Kandpal G, Weissman SM (1994) Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for regionspecific markers. Proc Natl Acad Sci 91:88-92 Kijas JMH, Fowler JCS, Garbett CA, Thomas MR. (1994) Enrichment of microsatellites from the citrus genome using biotinylat ed oligonucleotide sequences bound to streptavidin-coated magnetic pa rticles. Biotechniques 16:657-660 Kim HS, Ward RW (2000) Patterns of RFLP-b ased genetic diversity in germplasm pools of common wheat with diffe rent geographical or breeding program origins. Euphytica 115:197-208 Li YC, Rder MS, Fahima T, Kirzhner VM, Beiles A, Korol AB Nevo E (2000) Natural selection causing microsatellite divergence in wild emmer wheat at the ecologically variable microsite at Ammiad, Israel. Theor Appl Genet 100:985-999 Loveless MD, Hamrick JL (1984) Ecological dete rminants of genetic structure in plant populations. Annu Rev Ec ol Syst 15:65-95 Loxdale HD, Lushai G (2003) Rapid changes in clonal lines: the deat h of a ‘sacred cow’. Biol J Linnean Soc 79:3-16 Lynch M (1984) Destabilizing selection, general-purpose genotypes and geographic parthenogenesis. Q Rev Biol 59:257-290 Machado ACC, Valls JFM, Pealoza APS, dos Santos S (2005) Novos bitipos pentaplides do grupo Dilatata de Paspalum L. (Gramineae) no Sul do Brasil 1. Cincia Rural 35:56-61 Mantel N (1967) The detection of diseas e clustering and a generalized regression approach. Cancer Res 27:209-220 Mazzella C, Speranza P (1997) Meio tic behavior of univalents in Paspalum dilatatum Rev Brasil Genet 20:79 Mes TH (1998) Caracter compatibility of mo lecular markers to di stinguish asexual and sexual reproduction. Mol Ecol 9:1719-1727 Mes TH, KuperusP, Kirschner J, Stepnek J, Storchov H, Oosterveld P and den Nijs CM (2002) Detection of genetically divergent clone mates in apomictic dandelions. Mol Ecol 11:253-265

PAGE 115

103 Millot J.C (1969) Mejoramiento de gramneas forrajeras. In: Reunin tcnica. La Estanzuela, Colonia. Produccin y conserva cin de forraje. Plan Agropecuario,. La Estanzuela, Uruguay, pp 101-110. Millot JC (1977) Sexuality in Paspalum dilatatum Poir. ssp. dilatatum Roseng. In: Drets et al. (eds) Aspects of chromosome or ganization and function. III Latin Am Congr of Genet, Montevideo, Uruguay. 2-12 Feb. 1977. NSF, UNESCO, OAS, and Ministerio de Educacin y Cultura, Uruguay. p. 252 Moraes Fernandes MIB, Barreto IL, Sal zano FM (1968) Cytogenetic, ecologic and morphologic studies in Brazilian forms of Paspalum dilatatum Can J Gen Cytol 10:131-138 Nevo E (1998) Genetic diversity in wild cere als: regional and local studies and their bearing on conservation ex situ and in situ. Genet Resour Crop Ev 45:355-370 Parker ED, Selander RK, Hudson RO, Lester LJ (1977) Genetic diversity in colonizing parthenogenetic cockroac hes. Evolution 31:836-842 Pereira J, Sabbia V, Fajardo A, Speranza PR (2000) Anlisis genticos en gramneas nativas del gnero Paspalum a partir de datos isoenzim ticos y RAPD. Agrociencia 4: 1-11 Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945-959 Provan J, Biss PM, McMeel D, Mathews S (2004) Universal primers for the amplification of chloroplast microsatellites in grasses (Poaceae). Mol Ecol Notes 4:262-264 Quarn CL, Caponio I (1995) Cytogenetics and reproduction on P. dasypleurum and its hybrids with P. urvillei and P. dilatatum ssp. flavescens Int J Plant Sci 156:232235 Rao RV, Hodgkin T (2002) Genetic diversity and conservation and ut ilization of plant genetic resources. Plan t Cell Tiss Org 68:1-19 Ritland K (1984) The effective proportion of self-fertilizations with consanguineous matings in inbred popula tions. Genetics 106:139-152 Rder MS, Plaschke J, Knig S, Brner A, Sorrells ME, Tanksley SD and Ganal MW (1995) Abundance, variability and chromo somal location of microsatellites in wheat. Mol Gen Genet 246:327-333 Rodrguez C, Leoni E, Lezama F, Altesor A (2003) Temporal trends in species composition and plant traits in natura l grasslands of Uruguay. J Veg Sci 14:433440

PAGE 116

104 Rosenberg, M S (2001) PASSAGE. Pattern Analysis, Spatial Statistics, and Geographic Exegesis. Version 1.1. Department of Bi ology, Arizona State University, Tempe, AZ Rosengurtt B, Arrillaga de Maffei BR, I zaguirre de Artucio P (1970) Gramneas Uruguayas. Universidad de la Repb lica, Montevideo, Uruguay, pp 347-383 Rozen S, Skaletsky HJ (2000) Primer3 on th e WWW for general users and for biologist programmers. In: Krawetz S, Misener S, eds. Bioinformatics Methods and Protocols: Methods in Molecular Biol ogy. Totowa, NJ: Humana Press. pp 365-386 Schlterer C (2000) Evolutionary dynam ics of microsatellite DNA. Chromosoma 109:365-371 Schmidt T, Heslop-Harrison JS (1996) Th e physical and genomic organization of microsatellites in sugar beet Proc Natl Acad Sci 93:8761-8765 Schneider S, Roessli D, Excoffier L (2000) Arlequin v. 2.0: a software for population genetic data analysis. Genetics and Biom etry Laboratory, University of Geneva, Switzerland. Skerman PJ, Riveros F (1992) Gramneas Tropicales. Coleccin FAO: Produccin y proteccin vegetal. No. 23. FAO, Rome, Italy, 849 p Slatkin M (1995) A measure of population subdivision based on microsatellite allele frequencies. Genetics 139:457-462 Slatkin M, Arter HE (1991) Sp atial autocorrelation methods in population genetics. Am Nat 138:499-517 Soltis DE, Soltis PS (1999) Polyploidy: r ecurrent formation and genome evolution. Trends Ecol Evol 14:348-352 Soltis PS, Soltis DE (2000) The role of genetic and genomic attributes in the success of polyploids. Proc Natl Acad Sci 97:7051-7057 Sourdille P, Tavaud M, Charmet G, Bern ard M (2001) Transferability of wheat microsatellites to diploid Triticeae species carrying the A, B and D genomes. Theor Appl Genet 103:346-352 Speranza P, Vaio M, Mazzella C (2003) Karyotypes of two cytotypes of Paspalum quadrifarium Lam. (Poaceae). An alternative te chnique for small chromosomes in plants. Genet Mol Biol 26:499-503 Symonds VV, Lloyd AM (2003) An anal ysis of microsatellite loci in Arabidopsis thaliana : mutational dynamics and a pplication. Genetics 165:1475-1488

PAGE 117

105 Temnykh S, DeClerck G, Lukashova A, Lipovi ch L, Cartinhour S, McCouch S (2001) Computational and experimental anal ysis of microsat ellites in rice ( Oryza sativa L.): frequency,lengthvar iation,transposon associations,and genetic marker potential. Genome Res 11:1441-1452 Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lopovich L Cho YG Ishii T McCouch SR (2000) Mapping and genome organization of microsatellite sequences in rice ( Oryza sativa L.). Theor Appl Genet 100:697-712 Vaio M, Speranza P, Valls JFM, Guerra M, Mazzella C (2005) Locali zation of the 5S and 45S rDNA sites and cpDNA sequence analysis in species of the Quadrifaria Group of Paspalum (Poaceae, Paniceae). Ann Bot in press Valls JFM, Pozzobon M. (1987) Variaco apresentada pelos principais grupos taxonmicos de Paspalum com interesse forrageiro no Brasil. In Encontro Internacional sobre Melhoramiento Gentico de Paspalum. Anais. Nova Odessa, SP Brasil, Instituto de Zootecnia. pp 15-21 Van der Hulst RGM, Mes THM, den Nijs JC M, Bachmann K (2000) Amplified fragment length polymorphism (AFLP) markers reveal that populatio n structure of triploid dandelions ( Taraxacum officinale ) exhibits both clonality and recombination. Mol Ecol 9:1-8 van Dijk PJ (2003) Ecological and evolutio nary opportunities of apomixis: insights from Taraxacum and Chondrilla Phil Trans R Soc Lond 358:1113-1121 Van Ooijen JW, Voorrips RE (2001) JoinMap version 3.0: software for the calculation of genetic linkage maps. Wageninge n: Plant Research International Vigouroux Y, Jaqueth JS, Matsuoka Y, Smith OS, Beavis WD, Smith JSC and Doebley J (2002) Rate and Pattern of Mu tation at Microsatellite Loci in Maize. Mol Biol Evol 19:1251-1260

PAGE 118

106 BIOGRAPHICAL SKETCH Pablo Speranza was born in Montevideo, Uruguay, in 1967. Since his very early childhood he showed great interest in biology. Unsure of what the future may hold he registered at the University of the Repub lic in Uruguay both to receive a license in biology and a degree in agronomy. In 1989 while taking a required course in plant breeding he met Prof. J.C. Millot who was very influential in his career and later served as the chair of his Agronomy thesis. In 1990, after having passed the exam to the Plant Breeding course he started working as a teachin g assistant for the course. He received his degree of Ingeniero Agrnomo in 1995 after co mpleting a thesis on the cytogenetics and agronomic characterizati on of an interspecific Paspalum hybrid produced by Prof. Millot. He has been working in the Department of Pl ant Biology at the Facultad de Agronoma in Montevideo, Uruguay, since then under the supe rvision of C. Mazzella who later served as the chair of his masterÂ’s dissertation committee. His MasterÂ’s dissertation included research in molecular cytogenetics in Paspalum dilatatum and related species which was carried out at the John Innes Research Center in Norwich, England, under the supervision of Prof. J.S. (Pat) Heslop-Ha rrison. Pablo obtained his master Â’s degree in biology in 1999 from the Programa de Desarrollo en Ciencias Bsicas of the University of the Republic. In 1991 Pablo obtained a faculty position at the Department of Plant Biology and taught plant breeding until 1999. In order to pu rsue his academic career he decided to obtain a PhD degree abroad. In 2000 he was aw arded a Fulbright scholarship and started a PhD program at Washington St ate University under the supervision of Pamela Soltis. In

PAGE 119

107 2001 Pamela and Douglas Soltis moved to the Un iversity of Florida and Pablo completed his PhD program here in August 2005. In August 2005, he will be moving back to Uruguay and will resume his academic career at the University of the Republic, where he already has several colla borative projects under way.