Citation
Effects of Environmental Contaminants on Development, Sexual Differentiation, and Steroidogenesis in Alligator mississippiensis

Material Information

Title:
Effects of Environmental Contaminants on Development, Sexual Differentiation, and Steroidogenesis in Alligator mississippiensis
Creator:
MILNES, MATTHEW R.
Copyright Date:
2008

Subjects

Subjects / Keywords:
Alligators ( jstor )
Contaminants ( jstor )
Eggs ( jstor )
Enzymes ( jstor )
Female animals ( jstor )
Gonads ( jstor )
Incubation ( jstor )
Juveniles ( jstor )
Plasmas ( jstor )
Sex determination ( jstor )
Lake Apopka ( local )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Matthew R. Milnes. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
8/31/2006
Resource Identifier:
436098790 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

EFFECTS OF ENVIRONMENTAL CO NTAMINANTS ON DEVELOPMENT, SEXUAL DIFFERENTIATION, AND STEROIDOGENESIS IN Alligator mississippiensis By MATTHEW R. MILNES A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Matthew R. Milnes

PAGE 3

to Buddie

PAGE 4

iv ACKNOWLEDGMENTS The completion of this dissertation repres ents the support, cooperation and efforts of numerous individuals. First and foremo st, I owe a special thank you to my parents Jack and Nancy Milnes for providing guida nce, freedom, and everything else I ever needed to succeed. I will always be grateful to Andy Rooney and Allan “Woody” Woodward for their friendship and mentoring as they introduced me to the world of research. I would like to recognize Dr. Louis Guillette for his enduring support, mentoring, and friendship. I am truly indebt ed for the opportunities he has provided. For making the countless days in the lab and late nights in the fi eld a true labor of love, I would like to thank my lab mates: Tam Barbeau, Dieldrich Bermudez, Gerry Binzcik, Teresa Bryan, Thea Edwards, Mark Gunderson, Satomi Kohno, Iske Larkin, Brandon Moore, and Ed Orlando. For their support and accommoda tion of my last minute deadlines, I recognize my committee memb ers: Drs. Karen Bjorndal, Dave Evans, Michael Fields, and Steve Phelps. I would al so like to thank Dr. Taisen Iguchi for providing an amazing opportunity to work in his laboratory in Okazaki, Japan. Finally, I would like to acknowledge th e multitude of undergraduate research assistants who enabled me to complete this work despite my efforts.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...........................................................................................................viii LIST OF FIGURES...........................................................................................................ix CHAPTER 1 INTRODUCTION........................................................................................................1 Background...................................................................................................................1 Endocrine Disrupting Contaminants.....................................................................1 Examples from Wildlife........................................................................................3 Alligators and Lake Apopka..................................................................................5 Objectives.....................................................................................................................6 Rationale...................................................................................................................... .7 Approach.....................................................................................................................10 Overview.............................................................................................................10 Neonatal Development and Sexual Differentiation.............................................11 Experimental Exposures......................................................................................11 Persistence of Endocrine Dysfunction and Conclusions.....................................12 Expected Benefits.......................................................................................................12 2 ALTERED NEONATAL DEVELOPMENT AND ENDOCRINE FUNCTION IN Alligator mississippienesis ASSOCIATED WITH A CONTAMINATED ENVIRONMENT.......................................................................................................15 Introduction.................................................................................................................15 Materials and Methods...............................................................................................17 Egg Collection and Incubation............................................................................17 Dissections and Tissue Cultures..........................................................................18 Radioimmunoassays............................................................................................18 Histology.............................................................................................................19 Phallus Measurements.........................................................................................20 Statistics...............................................................................................................20 Results........................................................................................................................ .21 Hatch Rates and Sex Determination....................................................................21 Egg, Hatchling, and Tissue Morphometrics........................................................22

PAGE 6

vi Plasma Testosterone an d Aromatase Activity.....................................................26 Discussion...................................................................................................................28 3 EFFECTS OF INCUBATION TEMPERA TURE AND ESTROGEN EXPOSURE ON AROMATASE ACTIVITY IN THE BRAIN AND GONADS OF EMBRYONIC ALLIGATORS..................................................................................32 Introduction.................................................................................................................32 Materials and Methods...............................................................................................36 Animals and Tissue Collection............................................................................36 Aromatase Activity Assay...................................................................................37 Statistics...............................................................................................................38 Results........................................................................................................................ .38 GAM Aromatase Activity...................................................................................38 Brain Aromatase Activity....................................................................................39 Discussion...................................................................................................................40 4 DEVELOPMENTAL ALTERATIONS AS A RESULT OF IN OVO EXPOSURE TO THE PESTICIDE META BOLITE P,P’-DDE IN Alligator mississippiensis ......46 Introduction.................................................................................................................46 Materials and Methods...............................................................................................49 Egg Incubation and Treatments...........................................................................49 Dissections and Tissue Cultures..........................................................................50 Radioimmunoassays............................................................................................50 Histology.............................................................................................................51 Phallus Measurements.........................................................................................51 Statistics...............................................................................................................52 Results........................................................................................................................ .52 Sex Determination...............................................................................................52 Plasma Testosterone an d Aromatase Activity.....................................................53 Oviduct and Phallus Morphology........................................................................56 Discussion...................................................................................................................56 5 DEVELOPMENTAL EFFECTS OF EMBRYONIC EXPOSURE TO TOXAPHENE IN THE AM ERICAN ALLIGATOR ( Alligator mississippiensis )...60 Introduction.................................................................................................................60 Materials and Methods...............................................................................................62 Egg Incubation and Treatments...........................................................................62 Dissections and Tissue Cultures..........................................................................63 Radioimmunoassays............................................................................................64 Histology.............................................................................................................65 Statistics...............................................................................................................66 Results........................................................................................................................ .66 Ethanol Treatement and Sex Determination........................................................66 Morphology.........................................................................................................67 Endocrinology.....................................................................................................67

PAGE 7

vii Discussion...................................................................................................................68 6 PERSISTENT ALTERATIONS IN STEROIDOGENIC ENZYMES AND INCREASED POST HATCHING MO RTALITY ASSOCIATED WITH ALLIGATORS FROM A CONTAM INATED ENVIRONMENT...........................74 Introduction.................................................................................................................74 Materials and Methods...............................................................................................79 Egg Incubation and Tissue Collection.................................................................79 RNA Isolation and Primer Design.......................................................................80 Quantitative Real-Time PCR...............................................................................81 Statistical Analysis..............................................................................................82 Results........................................................................................................................ .83 Mortality and Sex Determination........................................................................83 Body Size and Somatic Indices...........................................................................84 Steroidogenic Gene Expression...........................................................................85 Discussion...................................................................................................................85 7 SUMMARY AND CONCLUSIONS.........................................................................93 Objectives and Results................................................................................................93 Significance and Perspective......................................................................................98 LIST OF REFERENCES.................................................................................................101 BIOGRAPHICAL SKETCH...........................................................................................114

PAGE 8

viii LIST OF TABLES Table page 5-1 Morphological traits of male and female neonatal alligators incubated at 32o and 33.5oC.......................................................................................................................68 5-2 Paired gonad-adrenal-mesonephros (GAM) mass, seminiferous tubule (ST) diameter, thyroid epithelial cell height (ECH), colloid area (CA), and in vitro thyroxin (T4) production in male and female ne onatal alligators incubated at 32o and 33.5oC................................................................................................................68 6-1 Forward and reverse degenerative primers used to amplify fragments of cholesterol side chain cleavage (SCC), 3 -hydroxysteroid dehydrogenase (3 HSD), and 17 -hydroxylase / 17,20 lyase (17 ) in alligator gonad RNA..............82 6-2 Forward and reverse primers used for quantitative real-time PCR..........................82

PAGE 9

ix LIST OF FIGURES Figure page 1-1 Schematic illustration of the expe rimental approach to investigating the organizational disruption of developmen t in contaminant-exposed alligators.........13 1-2 Expected developmental alterati ons resulting from embryonic exposure to estrogenic and anti-androgenic environmental contamiants....................................14 2-1 Alligator egg viability ( a ) and primary sex determination at 32oC ( b ) for Lake Apopka (AP) and Lake Woodruff NWR (WO).......................................................23 2-2 Snout-vent length ( a ) and body mass ( b ) of neonatal alliga tors from Lake Apopka and Lake Woodruff.....................................................................................24 2-3 Thyroid ( a ), liver ( b ), and spleen ( c ) mass of neonatal alligators from Lake Apopka and Lake Woodruff.....................................................................................25 2-4 Phallus cuff diameter and tip lengt h of neonatal alligators from Lake Apopka and Lake Woodruff..................................................................................................26 2-5 ( a ) Plasma testosterone (T ) concentrations and ( b ) aromatase activity determined via in vitro estradiol (E2) production from androstenedi one in neonatal alligators from Lake Apopka and Lake Woodruff...................................................................27 3-1 Gonad-adrenal-mesonephros (GAM) complex aromatase activity (fmol / GAM / hr) in female (30oC), male (33.5oC) and sex-reversed female (33.5oC+E2) alligator embryos during the early (stage 20), middle (stage 22), and late (stage 24) stages of the temperature sensitive period.........................................................39 3-2 Brain aromatase activity (f mol / brain / hr) in female (30oC), male (33.5oC) and sex-reversed female (33.5oC+E2) alligator embryos duri ng the early (stage 20), middle (stage 22), and late (stage 24) stag es of the temperature sensitive period...40 4-1 Sex ratios of alligators incubated at 32oC (A) or 33.5oC (B) and exposed in ovo to p,p’-DDE or estradiol-17 (E2)............................................................................54 4-2 Plasma testosterone (T) concentrations (mean + 1 SE) in neonatal male alligators incubated at 32oC and 33.5oC and exposed in ovo to p,p’-DDE or estradiol-17 (E2)...........................................................................................................................55

PAGE 10

x 4-3 Plasma testosterone (T) concentr ations (mean + 1 SE) in neonatal female alligators incubated at 32oC and 33.5oC and exposed in ovo to p,p’-DDE or estradiol-17 (E2).....................................................................................................55 4-4 Gonad-adrenal-mesonephros (GAM ) aromatase activity in neonatal female alligators determined via estradiol (E2) production from androstenedione..............56 5-1 (A) Plasma estradiol-17 (E2) concentrations and (B) in vitro E2 production (means + S.E.) in female neonatal alligators following in ovo toxaphene exposure. Sample size is shown for each treatment group......................................69 5-2 (A) Plasma testoster one (T) concentrations and (B) in vitro T production (means + S.E.) in male neonatal alligators following in ovo toxaphene exposure. Sample size is shown for each treatment group.......................................................70 6-1 The steroidogenic pathway asso ciated with sex steroid production.........................76 6-2 Embryonic and post hatching mortality up to 13 months of age..............................84 6-3 Mean (+ SE) snout-vent length (SVL) and body mass (BM) in 13-month old alligators...................................................................................................................84 6-4 Mean (+ SE) expre ssion of (A) SF-1 and (B) StAR in 13-month old alligators......86 6-5 Mean (+ SE) expr ession of (A) SCC and (B) 3 -HSD in 13-month old alligators..87 6-6 Mean (+ SE ) expression of (A) 17 -hydroxylase and (B) Aromatase in 13month old alligators..................................................................................................88 7-1 Observed developmental alterations resulting from embryonic exposure to estrogenic and anti-androgenic environmental contamiants....................................95

PAGE 11

xi Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECTS OF ENVIRONMENTAL CO NTAMINANTS ON DEVELOPMENT, SEXUAL DIFFERENTIATION, AND STEROIDOGENESIS IN Alligator mississippiensis By Matthew R. Milnes August, 2005 Chair: Louis J. Guillette, Jr. Major Department: Zoology Xenobiotics that interfere w ith normal endocrine function have been designated as endocrine-disrupting contaminants (EDCs). Environmental exposure to EDCs and adverse effects on development and reproduc tive physiology have been documented in numerous wildlife populations. In this dissertation, alligato rs from Lake Apopka, FL, are examined as a case study of a population chronically exposed to EDCs that has experienced poor reproductive success and comp ared to alligators from Lake Woodruff National Wildlife Refuge, a reference populatio n of minimal anthropogenic influence that has exhibited consistently high reproductive su ccess. In comparing parameters relevant to development and endocrine function between these two populations and with alligators experimentally exposed to various EDCs, two specific questions are addressed: (1) what endpoints, with regard to sexual differentia tion and gonadal function, are affected during embryonic development by EDCs in the alligator, and (2) do these alterations persist beyond neonatal development?

PAGE 12

xii Snout-vent length, body mass, and phallus si ze were significantly smaller in Lake Apopka neonates, which also exhibited higher plasma testosterone (T) concentrations compared to Lake Woodruff neonates. Em bryonic exposure to estradiol at an egg incubation temperature that normally produces males resulted in females that exhibited intermediate gonadal aromatase activity rela tive to control males and females, and masculinized brain aromatase activity. A female biased sex ratio was observed among hatchlings exposed to p,p’-DDE at 100 part s per billion (ppb) wet egg mass, whereas no effect on sex determination was observed for toxaphene. Male neonates treated with 10 and 0.01 ppb toxaphene had higher plasma T concentration than control males. Significant post hatching mortality and lowe r mRNA concentrations for SF-1 and StAR, two genes coding for factors i nvolved in the regulation of de novo steroidogenesis, were observed in 13-month old alligato rs from Lake Apopka compared to alligators from Lake Woodruff. In addition, juveniles from Lake Apopka exhibited a loss of sexual dimorphism in four of the six genes examined. These data establish endpoints susceptib le to perturbation by embryonic exposure to EDCs and provide evidence of persistent alterations in allig ators relevant to reproduction. Future research is needed to determine the ability of individuals exposed to EDCs as embryos to reproduce successfully as adults.

PAGE 13

1 CHAPTER 1 INTRODUCTION Background Endocrine Disrupting Contaminants In recent years, the field of toxicolo gy has expanded from being primarily concerned with lethality and carcinogenicity to including adverse effects on reproduction and development resulting from low-dose exposure to environmental contaminants. Although reproductive impairment in wildlife ex posed to pesticides was made public as early as 1962 in Rachel Carson’s Silent Spring (Carson, 1962), the multi-disciplinary approach to reproductive and developmental t oxicology did not become widespread until the past 10-15 years. During this time, a host of man-made chemicals ranging from organochlorine (OC) pesticides to alky lphenol polyethoxylate surfactants to the polychlorinated biphenyls (PCBs) used fo r various industrial purposes has been implicated in developmental and reproduc tive abnormalities (Colborn et al., 1993). Many xenobiotics that have adverse effects on embryonic development and functioning of the reproductive system ar e thought to act by interferi ng with the normal functioning of the endocrine system and therefore have been designated as endocrine-disrupting contaminants (EDCs) (Guillette and Crain, 2000). EDCs can affect internal chemical signali ng pathways in an organism in a variety of ways. For instance, some contaminants ha ve been shown to interact directly with receptors (Vonier et al., 1996; Rooney and Guillette, 2000; Guillette et al., 2002). In such cases, the compound can either inhibit (Kel ce et al., 1995) or st imulate (Parks et al.,

PAGE 14

2 2001) expression of target genes for that r eceptor. Alternatively, some environmental contaminants have been shown to inhibit sp ecific enzymes involved in hormone synthesis or degradation, such as the steroidogenic acute regulatory (StAR) prot ein (Walsh et al., 2000a) or members of the cytochrome P450 (CYP) enzyme family (Wilson and LeBlanc, 2000; Gunderson et al., 2001). Finally, some man-made compounds have been shown to interact with plasma proteins that function as transporters of specific hormones to protect them from hepatic degradation and excreti on (Crain et al., 1998b; Cheek et al., 1999). Hormonally active compounds are comm only grouped based on the signaling pathway they are shown to disrupt. Ma ny studies of EDCs have focused on the estrogenicity of pesticides such as DDT (1,1,1-trichloro-2,2-bis ( p -chlorophenyl) ethane) (Fry and Toone, 1981; vom Saal et al., 1995; V onier et al., 1996) or sewage effluent (Purdon et al., 1994; Harries et al., 1997), whereas others implicate environmental contaminants such as DDE (1,1-dichloro-2,2bis ( p -chlorophenyl) ethylen e) (Kelce et al., 1995) and the fungicide vinclozolin (Gray et al., 1994) as anti-androgens. Additionally, PCBs and OCs have been implicated in the disruption of thyroid activity (Goldey et al., 1995; Cheek et al., 1999; Desaulniers et al ., 1999). The exact mechanism(s) through which each of these chemicals work remains unc lear, but it appears that the effects are species and dose dependent. Because th e endocrine system regulates so many physiological processes, any perturbations in that system can have profound impacts on reproductive and/or developmental processes. Much of the initial data concerning e ndocrine altering substances come from infants exposed to the synthetic estrogen diethylstilbestrol (DES) given to ~7 million pregnant women in the USA between 1947 and 1971 in an attempt to prevent pregnancy problems. A high incidence of endocrine -related abnormalities, including reproductive

PAGE 15

3 tract cancers, cryptorchidism, hypospadias, a nd infertility, have been observed in DESexposed children and adults (Newbold, 1995). Laboratory studies on pregnant mice fed DES have resulted in many of the same symp toms appearing in the offspring following in utero exposure (Bern, 1992). More recent labo ratory studies have shown that some pesticides induce effects sim ilar to those seen in DES-exposed embryos. DDT and its analog methoxychlor (bisp -methyoxy DDT) both show an affinity for binding to estrogen receptors in MCF-7 ce lls and induce similar behavi oral abnormalities in the offspring from pregnant mice fe d DES (vom Saal et al., 1995). Examples from Wildlife Of the vertebrate wildlife populations studied to date, perhaps the most well defined examples of EDC exposure come from 1) fish-eating birds of the Laurentian Great Lakes and southern California, 2) fish below sewage outfalls and paper pulp mills, and 3) alligators from contaminated lakes in south and central Florida. That many of these case studies involve l ong-lived predators feeding in aquatic environments is evidence of the bioaccumulating nature of many xenobiotics. In the Great Lakes region DDT, DDE, PCBs and polychlorinated dibenzod ioxins (PCDDs) have been implicated in population declines and/or reproductive impairment of Forster’s terns ( Sterna forsteri ), double-crested cormorants ( Phalacrocorax auritus ), herring gulls ( Larus argentatus ), and bald eagles ( Haliaeetus leucocephalus ) among others (for reviews see Grasman et al., 1998; National Research Council [NRC], 1999). Some of the symptoms associated with these populations include eggshe ll thinning, skewed sex ratios, behavioral deficits, and teratogenicity. The herring gulls of Lake Onta rio were hit particularly hard in the 1960s and s when OC and PCB contamination peaked. A high incidence of embryonic and chick mortality, abnormal gonad development, female-female pairings, and supernormal

PAGE 16

4 clutches in which multiple females lay eggs in a single nest was reported during this time (Fox, 1992). As contaminant levels have d eclined, reproductive su ccess has increased among these colonies. In Clear Lake, Califor nia, application of DDT to control Dutch elm disease and DDD (1,1-dichloro-2,2bis ( p -chlorophenyl) ethane ) to control gnats resulted in a well-documented case of ecologi cal magnification in inve rtebrates, fish, and birds. Reproductive failure was reported among western grebes ( Aechmophorus occidentalis ) following the first year of pesiticide application, ultimately resulting in significant adult mortality fi ve years later (Fry, 1995). Examples of EDC exposure in fish co me from many geographic locations and involve a diverse range of species. N onetheless, there are commonalities in the chemicals they are exposed to and the affect ed indices that are obs erved. For instance, lake whitefish ( Coregonus clupeaformis ) exposed to bleached kraft mill effluent and white sucker ( Catostomus commersonii ) exposed to pulp mill effluent have depressed circulating testosterone (T) concentrations (Munkittrick et al., 1992; 1994). Furthermore, delayed sexual maturation and reduced gonado-somatic index has been observed in perch ( Perca fluviatilis ) exposed to bleached kraft mill effl uent in the Baltic Sea (Sandstrom, 1994) and wild roach ( Rutilus rutilus ) collected from UK rivers contaminated with large volumes of treated sewage effluent (J obling et al., 2002a; 2002b). Unidentified androgenic substances, as confirmed through androgen receptor binding assays (Parks et al., 2001) in water samples downstream from a pulp mill on the Fenholloway River in Florida, have led to masculinized anal fins of female mosquitofish (Toft et al., 2004). When compared to the nearby Econfina River, which does not receive paper mill effluent, females from the Fenholloway River we re smaller, exhibited greater variation in estradiol-17 (E2), and were less likely to be pre gnant. Males from both rivers had

PAGE 17

5 similar sperm counts, but the testes were larg er and greater variati on in T concentration was observed in male fish from the Fenhollowa y compared to the Econfina River (Toft et al., 2004). Alligators and Lake Apopka Like the birds of the Great Lakes regi on and southern California, the initial indication of reproductive impairment in allig ators from Lake Apopka, FL, was the lack of recruitment of juveniles into the population. Following nearly 40 years of pesticide and nutrient runoff from adjacen t agricultural operations, Lake Apopka was subject to a large pesticide spill in 1980 from the form er Tower Chemical Company. The spill consisted primarily of dicofol (contaminated with DDT and its metabolites, DDD and DDE) and sulfuric acid (U.S. Environmenta l Protection Agency, 1994). In the years following the spill, alligator egg viabili ty rates (1983-1986) a nd juvenile population density (1981-1987) declined si gnificantly (Woodward et al ., 1993). Yolk samples taken from Lake Apopka alligator eggs duri ng this time (1984 and 1985) had significant concentrations of several OC pesticides a nd metabolites including toxaphene, dieldrin, DDE, DDD, DDT, trans and cis -chlordane, and trans -nonachlor (Heinz et al., 1991). In more recent years, egg viability rates have in creased but still remain below those of two reference sites, Lake Woodruff National Wildlife Refuge (NWR) and Orange Lake (Masson, 1995; Rice et al., 1996). Also, little decline has occurred in the concentrations of various OC pesticide residues in tissues obtained from alligators from Lake Apopka over the last two decades (Guillette et al., 1999a). Although recruitment has improved since the 1980’s, many abnormalities related to development, endocrine function, and reproducti on continue to be reported in hatchling and juvenile alligators from La ke Apopka. For the purposes of this dissertation, neonates

PAGE 18

6 are defined as alligators < 1 month of age; hatchlings are defined as alligators < 1 year of age, whereas juveniles are considered any an imal > 1 year but < 90 cm snout-vent length (SVL), the approximate minimum size at sexua l maturity. When compared to juveniles from Lake Woodruff NWR, Lake Apopka males have lower concentrat ions of circulating T (Guillette et al., 1997a; Crain et al., 1998a; Gu illette et al., 1999a). In addition to Lake Apopka, several other Florida lakes that have experienced significan t agricultural and/or municipal influences also show depressed pl asma T concentrations in juvenile males including Lake Okeechobee (Crain et al ., 1998a; Gunderson et al., 2004) and lakes Griffin and Jessup (Guillette et al., 1999b). Both males and females from Lake Apopka have also exhibited elevated estradiol-17 (E2) compared to Lake Woodruff NWR juveniles (Guillette et al., 1999b; Miln es et al., 2002). Other developmental abnormalities reported in Lake Apopka alliga tors include reduced phallus size in juveniles (Guillette et al., 1999a; 1999b; Pickford et al., 2000), polyovular and polynuclear ovarian follicles and poorly organized seminife rous tubules in 6-month hatchlings (Guillette et al., 1994), and altered cranial morphology in neonates (Milnes et al., 2001) relative to Lake Woodruff NW R and/or Orange Lake alligators. Objectives Understanding the mechanisms through which EDCs affect an organism and identifying common alterations are important in detecting exposure in both humans and wildlife. Ultimately, evalua ting the reproductive potential of exposed individuals is crucial to ensuring the conti nued success of those populations . Due to the lipophilic and bioaccumulating nature of many suspected ED Cs, such as OCs and PCBs, individuals living in a contaminated environment expe rience two major stag es of contaminant exposure. First, the embryo is likely exposed to whatever contaminants the mother is

PAGE 19

7 capable of transferring to th e embryonic environment via oocyte maturation or gestation, depending on the mode of reproduction. Embryonic exposure to hormonally active compounds may have unique consequences due to the profusion of cell proliferation and differentiation in the developing embr yo (Bern, 1992). Secondly, offspring will experience environmental exposure throughout growth and reproductive maturation. To fully recognize the p hysiological consequences of EDCs on a population, organizational disruptions must be separated from activational effects. That is, persistent developmental abnormalities resulting from embryonic exposure (organizational) must be recognized separately from transient a bnormalities caused by environmental exposure (activational) (Guillette et al., 1995a). It has been suggested that the abnormalities reported in Lake Apopka alligators are orga nizational disruptions resulting from some component of the embryonic environment precluding normal embryogenesis and leading to persistent endocrine dysfunction (Guillette et al., 1995a). To examine this idea in detail, I developed three major hypotheses to be tested in this dissertation. 1. Developmental differences related to se xual differentiation and endocrine function exist in neonatal alligators from Lake Apopka relative to a re ference site, Lake Woodruff NWR. 2. Experimental in ovo exposure to selected EDCs will induce developmental alterations in neonatal alligators from a reference population similar to those described in neonates from Lake Apopka. 3. Differences in endocrine function induced by the embryonic environment persist in juvenile alligators. Rationale Sub-lethal exposure to EDCs can have far reaching consequences for both wildlife and human populations if reproductive su ccess is compromised. Although direct extrapolation of the effects of EDCs on wildlife species to humans cannot be made, many of the molecular, cellular, and physiological processes regulated by the endocrine system

PAGE 20

8 are conserved throughout vertebra te evolution and a weight of evidence approach can be used in guiding future policy decisions (NRC, 1999). In addition to their own intrinsic value, each wildlife pop ulation is a critical part of an ecosystem that depends upon interspecies relationships to maintain the pro cesses that provide hu mans with necessary commodities such as clean air, water, soil, and food. Exposure to EDCs that reduces reproductive success within a population can upset the balance of processes that maintain a healthy ecosystem. As a long-lived top predator and a species of aesthetic and commercial importance in Florida, the alligator serves as an ideal sentinel of wetland ecosystem health. The alligator is an oviparous species that produces a singl e clutch of eggs during a synchronous reproductive cycle (G uillette et al., 1997b). This allows for the coordinated collection of a large number of eggs enabling adequate sample sizes for ecotoxicological experimental designs. The alligator al so exhibits temperature-dependent sex determination (TSD), where the egg incubation temperature during a thermosensitive period of embryonic development determines the sex of the offspring (Lang and Andrews, 1994). Females are typicall y produced at temperatures below 31oC and males produced at or above 33oC, and a mixed ratio of males and females are produced at intermediate temperatures (Lance and Boga rt, 1994; Lang and Andrews, 1994). While molecular mechanisms of sex determination have not been worked out in TSD species, experimental exposure to natural and syntheti c steroids have been shown to override the effects of temperature on sex determination (Crews et al., 1994). Thus, alligators are susceptible to experimental manipulations of incubation temperature and hormonal milieu to facilitate the investigation of temperature and sex-specific developmental patterns and indices. Although the time to sexual maturity (10+ years) makes trans-

PAGE 21

9 generational studies of alligat ors impractical, Lake Apopka provides an opportunity to investigate the effects of chronic exposure to xenobiotic chemicals on a long-lived species and determine how this expo sure affects embryonic development. That the abnormalities reported in Lake Apopka alligators could be caused by exposure to OC pesticides as opposed to indus trial chemicals or metals is supported by analyses of contaminant concentrations in various alligator tissues. Whereas elevated yolk and serum OC concentrations were repor ted (Heinz et al., 1991; Guillette et al., 1999a) in samples from Lake Apopka when compared to Lake Woodruff NWR and Orange Lake, no differences in PCB con centrations were found among these lakes (Guillette et al., 1999a). Me tal and metalloid concentratio ns in all 3 lakes were well below suggested toxic levels and levels pr eviously reported in alligators from the Everglades and Georgi a (Burger et al., 2000). Other proposed hypotheses to explain the abnormalities reported in Lake Apopka alligators include nutritional and genetic diffe rences. Nutritional differences resulting from several decades of nutrient and cont aminant loading impacting prey species composition is a plausible explanation that has not been studied to date. Previous research has shown dietary differences a nd altered egg yolk lipid composition to be associated with reduced egg viability in captive alligators (Noble et al., 1993). If the prey species composition has been drastically a ltered on Lake Apopka, it is possible that essential nutrients are lacking in the diet, thus leading to deficiencies in specific fatty acids or nutrients incorporated into th e egg yolk during vitellogenesis. Genetic differences seem an unlikely cause based on the lack of genetic diversity found among alligator populations in the southeastern U.S. (Adams et al., 1980). More recently, no genetic marker could be found to disti nguish populations (i ncluding Lake Apopka,

PAGE 22

10 Orange Lake, and Lake Woodr uff NWR) across Florida usin g microsatellite DNA (Davis et al., 2002). Approach Overview The overall approach to investigating th e organizational disruption of development and sexual differentiation in contaminant-exposed alligators is schematic ally illustrated in Figure 1-1. Figure 1-2 lists some of the alterations relevant to future reproductive fitness that are expected following embryonic expos ure to estrogenic and anti-androgenic contaminants. Because each natural system contains numerous biotic and abiotic characters that can potentiall y influence development, true replication of the scenario present in Lake Apopka cannot be obtained. Rather, Lake Apopka is used as a case study of a chronically exposed population that ha s experienced poor reproductive success, and Lake Woodruff NWR is used as a refe rence population of minimal anthropogenic influence that has exhibited consistently high reproductive success. Invoking the principle of parsimony or Occam’s razor, simplified experimental exposures to contaminants relevant to Lake Apopka ar e conducted to reveal mechanisms of contaminant-induced developmental abnorma lities. Finally, we will investigate the persistence of developmenta l abnormalities present in Lake Apopka hatchlings. By raising a subset of animals from both study sites in a controlled environment, we can limit differences in contaminant exposure to embryonic origins. All work described in this dissertation involving the use of e xperimental animals was performed under the guidelines specified by the Institutional Animal Care and Use Committee at the University of Florida.

PAGE 23

11 Neonatal Development and Sexual Differentiation Chapter 2 examines developmental and endocrine-related indices in neonatal alligators from Lake Apopka in comparison to those of Lake Woodruff NWR, thereby limiting contaminant exposure to that derived via maternal contribu tion. We compared several reproductive and devel opmental parameters, including hatch rates, primary sex determination, and somatic indices. Furthermor e, we examined plasma T concentrations and aromatase activity, the conversion of androgens to estrogens, in an effort to establish relative gonad endocrine functi on shortly after hatching. Fi nally, we compared phallus size among males and oviducal epithelial ce ll height (ECH) among females—androgen and estrogen dependent tissues , respectively. This is the first extensive comparison of neonatal alligators from Lake Apopka and La ke Woodruff NWR. It will be used to delineate developmental differences pr esent in both sexes upon hatching. Experimental Exposures Chapter 3 examines the effects of te mperature and estrogen exposure on sexual differentiation of the brain and gonad with re gard to aromatase activity. Estradiol-17 was used as a surrogate for a number of environmental contaminants known to induce female development at male-producing temper atures in the alligat or (Guillette et al., 2000) and interact with the alligator estrogen receptor (aER) (Vonier et al., 1996; Guillette et al., 2002). Chapters 4 and 5 examine two of the OC contaminants found in the highest concentration in either serum or egg yolk samples from Lake Apopka, p,p’-DDE and toxaphene. Although p,p’-DDE has been shown to have a weak affinity for the aER (Vonier et al., 1996), previous studies on mammals indicate DDE acts as an antiandrogen (Gray et al., 2001). Very little is known about the sub-lethal effects of

PAGE 24

12 toxaphene, and it has been found in relatively high concentrations in alligator egg yolks from Lake Apopka when compared to egg yolks from several other central Florida lakes (Heinz et al., 1991). We evaluated primary sex ratios at intermediate and male-producing temperatures, along with plasma T and gona d steroidogenic activity in the resulting neonates. We also examined thyroid morphology and function, oviducal ECH, and phallus size in selected treatment groups. Persistence of Endocrine Dysfunction and Conclusions Chapter 6 examines the persistence of di fferences between Lake Apopka and Lake Woodruff NWR in steroidogenesis at the molecula r level. Alligators hatched from eggs obtained from both study sites were mainta ined in captivity for 13 months prior to collecting gonad tissues for real-time, quantitative PCR (Q-PCR). Relative mRNA expression of transcription factors, trans port proteins, and catalytic enzymes involved with gonadal steroid production are co mpared among sexes and study sites. Finally, Chapter 7 will provide a summary of conclusions, place them in the context of the field of reproductive and deve lopmental toxicology, and offer direction for future research. Expected Benefits The results of these studies are expected to reveal targets of organizational disruption in light of the a bnormalities reported in juvenile alligators living in Lake Apopka. Two questions specifically addressed are (1) what endpoints, with regard to sexual differentiation and gonadal function, ar e affected during embryonic development by EDCs in the alligator, and (2) do these alterations persist beyond neonatal development. In a broader sense, this dissertation will provide insight into the different

PAGE 25

13 modes of action that EDCs have on developmen tal processes that can potentially lead to reduced reproductive success. Figure 1-1. Schematic illustration of the expe rimental approach to investigating the organizational disruption of developmen t in contaminant-exposed alligators.

PAGE 26

14 Figure 1-2. Expected developmental alterati ons resulting from embryonic exposure to estrogenic and anti-androgenic environmental contamiants.

PAGE 27

15 CHAPTER 2 ALTERED NEONATAL DEVELOPMEN T AND ENDOCRINE FUNCTION IN Alligator mississippienesis ASSOCIATED WITH A CONTAMINATED ENVIRONMENT1 Introduction The ability of environmental contamin ants to influence reproduction and development in vertebrates via disruption of the endocrine system is widespread. While the mechanisms through which xenobiotics act can be complex and vary greatly among species, determining the reproductive potential of exposed individuals is crucial to the continued success of affected populations. Due to the lipophilic and bioaccumulating nature of many suspected EDCs, such as organochlorines, individuals living in a contaminated environment experience two major stages of contaminant exposure with regard to reproductive potentia l. Initially, the embryo is likely exposed to whatever contaminants the mother is capable of transferring to the embryonic environment via oocyte maturation or gestation, depending on the mode of reproduction. Secondly, offspring will experience environmental exposure throughout growth and reproductive maturation. These effects could be furthe r complicated throu gh altered maternal epigenetic contribution to th e embryonic environment. It has been hypothesized that a number of abnormalities, including depressed egg viability, reported in alligators from Lake Apopka, FL, USA, are th e result of organizational disruption (Guillette et al., 1995a). That is, some component of the embryonic environment (e.g., contaminants, yolk hormones, nutrients, etc.) is precluding no rmal embryogenesis leading to persistent 1 This chapter has been accepted for publication in Biology of Reproduction (Milnes et al., In press)

PAGE 28

16 endocrine and reproductive dysfunction. In order to assess the persistence of organizational disruptions and differentiate them from the effects of environmental exposure (i.e., activational), we have atte mpted to establish the initial state of developmental and physiological indices of a contaminant-exposed population of alligators (Lake Apopka) rela tive to a reference site. Numerous comparative studies of Lake A popka alligators have found alterations in plasma hormone concentrations, reproductive tract morphology, steroidogenesis, hepatic steroid degradation, and greater serum contaminant concentra tions in juveniles compared to Lake Woodruff (for review see Guillette et al., 2000). While most of these studies focused on juvenile alligators (> 1 year, but < 90 cm snout -vent length) living in their respective lakes, only Guillette et al. ( 1994; 1995b) and Crain et al. (1997) examined hatchlings (< 1 year) obtained as eggs fr om Lake Apopka and Lake Woodruff. When compared to Lake Woodruff hatchlings, 6-month old Apopka ha tchlings exhibited depressed plasma testosterone (T) concentr ations in males and elevated estradiol-17 (E2) concentrations in females (Guillet te et al., 1994). Interestingly, in vitro gonad cultures from those same animals showed a different pattern of steroidoge nesis in that Apopka females had depressed E2 and males had elevated E2 production (Guillette et al., 1995b). Crain et al. (1997) found depre ssed plasma T concentrations in captive-reared 9-month old Apopka females, but did not dete ct any differences in plasma E2 concentrations. However ovarian aromatase activity, or the conversion of androgens to estrogens, was significantly lower in Lake A popka hatchlings than in Woodr uff hatchlings. While some of the results from the hatchling alligators ha ve been consistent w ith the juvenile field studies, there is sufficient data to suggest that disruptions of embryonic and hatchling development are further modified by environm ental exposure to contaminants during the

PAGE 29

17 period of growth and sexual maturation. Fo r example, in a comparison of juvenile alligators from seven Florida lakes, Guillette et al. (1999b) found no difference in plasma T among small (30 to 79 cm total length) ma les from lakes Apopka and Woodruff. In contrast, circulating T was significantly lo wer in large (80 to 130 cm total length) Apopka males when compared to Woodruff. In the same study, small Apopka females exhibited elevated plasma E2, but no differences were found between large females from the two lakes. The purpose of this study is to documen t relevant developmental endpoints in neonatal alligators (< 1 month old) from Lake Apopka in co mparison to a reference site, Lake Woodruff NWR. We then evaluate any differences in light of those reported in older hatchlings and juveniles from the sa me populations. In this study, we compare several reproductive and developm ental parameters to include hatch rates, primary sex determination, egg mass, hatchling mass, and sn out-vent length. Somatic indices of liver, thyroid, and spleen mass relative to body ma ss are also evaluated. Furthermore, we examine circulating testosterone levels and aromatase activity via in vitro E2 production in an effort to establish relative gonad endoc rine function shortly af ter hatching. Finally, we compare phallus size among males and oviduct epithelial cell height among females—androgen and estrogen de pendent tissues, respectively. Materials and Methods Egg Collection and Incubation Alligator eggs were collected from Lake Apopka and Lake Woodruff NWR, Florida, USA in June 1999 in collaborat ion with the Florida Fish and Wildlife Conservation Commission. Follo wing transport to the University of Florida, Gainesville eggs were candled to determine fertility and viability by presence of a vascularized,

PAGE 30

18 opaque band indicative of development of extraembryonic membranes associated with the embryo. Six clutches from each lake were selected for the study with the requirement of having at least 20 banded (presumably vi able) eggs. One egg from each clutch was opened to determine embryonic stage based on criteria described by Ferguson (1985), to ensure each clutch was with in the first two weeks post-ov iposition. Three eggs from each clutch were incubated at 30 and 33.5oC, temperatures known to produce all females and all males, respectively. Ten eggs per clutch were incubated at 32oC, an intermediate temperature that produces both sexes. Eggs were incubated in damp sphagnum moss in 30 x 40 cm pans. Eggs were randomly assi gned to incubation pans, and pans were rotated daily within each incubator to avoi d regional temperature effects within the incubators. Dissections and Tissue Cultures Between 10 and 20 days post-hatching, snout-vent length (SVL), and body mass (BM) were determined prior to drawing a bl ood sample and administering a lethal dose (0.5 mg/g body mass) of sodium pentobarb itol. Paired gonad-adrenal-mosonephros (GAM) complexes were removed immediately and placed in 1.0 ml of media 199 (Gibco BRI, Gaithersburg, MD) supplemented with 100 ng/ml androstenedione to determine aromatase activity, or the convers ion of androstenedione to E2. Following 5 hours of incubation at 32oC, culture media was removed and stored at oC until assayed for E2. Both GAMs were fixed in Bouins fixative for histological determination of sex. Thyroid, spleen, and liver were also remove d and weighed to the nearest mg. Radioimmunoassays Plasma T and culture media E2 concentrations were measured by radioimmunoassay previously validated for alligators (Guillette et al., 1994; 1995b).

PAGE 31

19 Samples were prepared in duplicate, extracted twice in 5 ml of diethyl ether, dried under a constant stream of filtered air, and then reconstituted in borate buffer (100 l; 0.05 M; pH 8.0). Extraction efficiencies for E2 and T were 97% and 96% respectively. Bovine serum albumin was added at a fi nal concentration of 0.19% for E2 and 0.15% for T to reduce nonspecific binding. Antibody (Endocri ne Sciences, Tarzana, CA) was then added in 200 l of borate buffer at a final concentration of 1:55,000 for E2 and 1:25,000 for T. Finally, radiolabeled steroid ([2,4,6,7,16,17-3H] Estradiol at 1 mCi/ml; [1,2,6,7,3H] Testosterone at 1 mCi/ml; both from Am ersham Biosciences, Piscataway, NJ) was added at 12,000 cpm per 100 l to bring the final volume to 500 l. Inter-assay variance tubes were similarly prepared from 3 pools of juvenile alligator plasma. Standards for both E2 and T were prepared in dup licate at 0, 1.56, 3.13, 6.25, 12.5, 25, 50, 100, 200, 400, and 800 pg/ml. Assay tubes were then vo rtexed for 1 min and incubated overnight at 4oC. Bound-free separation was performed by adding 500 l 5% charcoal / 0.5% dextran, pulse vortexing, and centrifugi ng the tubes at 2000x g for 30 min. 500 l of the supernatant was then drawn off and diluted with 5 ml of scintillation cocktail, and counted on a Beckman LS 5801 scintillation coun ter. Minimal detect able concentrations of E2 and T were 3 and 6 pg/ml, respectively. Intra-assay variance averaged 3.0% for E2 and T. Inter-assay variance for E2 and T was 8.8 and 14.9%, respectively. Hormone concentrations were determined using commercially available software (Microplate Manager 4.0, Biorad, Hercules, CA). Histology One GAM from each animal was embedded in paraffin; serial sectioned at 6 m, and stained using a modified Massons tric hrome (Presnell and Schreibman, 1997). Two

PAGE 32

20 independent observers examined each GAM for pr esence of testicular or ovarian tissue. Histological determination of sex was esta blished using criteria described by Forbes (1940) and more recently Smith and Joss (1993) . Medullar sex cord proliferation and a reduced cortex characterized testes, whereas ovaries were identified by the presence of lacunae in the medulla and germ cells in the hypertrophied cortex. The majority of ovaries observed also included a continuous por tion of the oviduct (94 of 97). Five cross sections of oviduct, evenly distributed throughout the length of the ti ssue were selected for measurement of epithelial ce ll height (ECH). In each cr oss section, four epithelial cells distributed ~90o from one another were measured at 200X magnification using an ocular micrometer. The measurements were then converted to the nearest 0.1 m with the use of a stage micrometer. Phallus Measurements. Immediately after dissecti ons, whole carcasses were fi xed in neutral buffered formalin. Following fixation and histologi cal determination of sex, the phallus was removed from each male and measured under a stereoscope at 40X magnification with the aid of a calibrated ocular micromet er to the nearest 0.025 mm. The two measurements taken, tip length and cuff diameter, were base d on previously established criteria (Guillette et al., 1996b; Pickford et al., 2000). Th e tip length was measured from the front edge of the cuff to the most di stal point along the posterior surface of the phallus, and the cuff diameter was measured at the widest poin t along the anteriorposterior axis. Statistics All analyses were performed using Th e SAS System for Windows version 9.0 (SAS Institute Inc., Cary, NC). Hatch ra tes across all three temperatures and sex

PAGE 33

21 determination at 32oC were compared between lakes usi ng chi-square tests. Continuous variables were log transformed prior to an alyses to reduce heterogeneity of variance (Sokal and Rohlf, 1995). One-way analysis of variance (ANOVA) was used to compare egg mass between lakes. An initial set of ANOVAs was conducted at 32oC to determine if sexual dimorphism was presen t in any of the morphometric indices prior to comparing means between lakes. No sexual dimorphism was detected for BM, SVL, liver, thyroid, or spleen mass (all P s > 0.05); so males and females were combined at 32oC for those variables. All further ANOVAs and analyses of covariance (ANCOVA) were performed with PROC GLM as two-way factorials usi ng lake and incubation temperature as the independent variables. When the main effect of lake or the interaction of lake and temp were significant ( P < 0.05), least square means were analyzed using Tukey-Kramer posthoc comparisons. Body mass and SVL were adjusted for egg mass and compared by ANCOVA. Organ weights (liver , thyroid, and spleen) and phallus measurements (tip and cuff) were compared using BM and SVL, respectively, as covariates. Results Hatch Rates and Sex Determination No difference in hatch rate (Figur e 2-1a) was observed between lakes ( X2 = 2.4, df = 1, P = 0.12). Lake Apopka (AP) produced 76 vi able hatchlings (79.2%) from 96 eggs, whereas Lake Woodruff (WO) pr oduced 84 viable hatchlings ( 87.5%). It is important to note that these rates are based on eggs culled from all eggs for their apparent viability. That is, these figures do not re present clutch viability of a ll eggs and clutches obtained from the respective lakes. All hatchlings incubated at 30oC developed as females (AP, N = 16; WO, N = 12), whereas all but one hatchling from each lake incubated at 33.5oC were male (AP, N = 12; WO, N = 16). There was no detectable difference in sex ratios at

PAGE 34

22 32oC ( X2 = 3.19, df = 1, P = 0.07). Of the 47 Apopka hatchlings, 36 (76.6%) were female, whereas 33 of 55 (60%) Woodruff hatchlings from the intermediate temperature developed as females (Figure 2-1b). Egg, Hatchling, and Tissue Morphometrics Mean egg mass was greater for eggs from Lake Woodruff (86.9 + 0.68g) when compared to Lake Apopka (77.7 + 0.72g) ( F = 80.05; df = 1, 156; P < 0.0001). When adjusted for egg mass, hatchling BM ( F = 8.97; df = 6, 151; P = 0.003) and SVL ( F = 5.13; df = 6, 151; P = 0.02) varied between lakes, with Woodruff hatchlings have greater BM at 32 and 33.5oC and greater SVL at 32oC (Figure 2-2). No differences were detected in liver mass ( F = 2.84; df = 6, 150; P = 0.09) or thyroid mass ( F = 1.06; df = 6, 147; P = 0.30) between lakes (Figures 2-3a and 2-3b). Differences in spleen mass (Figure 2-3c) were detected between lakes ( F = 7.36 df = 6, 150; P = 0.003), with Woodruff hatchlings having larger spleens than Lake Apopka at 32oC. Oviduct ECH did not vary between lakes ( F = 0.18; df = 3, 90; P = 0.67). After adjusting for SVL, phallus tip length ( F = 12.37; df = 4, 49; P = 0.001) and cuff diameter ( F = 19.31; df = 4, 49; P < 0.0001) were greater in Lake Woodruff male s than Lake Apopka males at 32 and 33.5oC (Figure 2-4).

PAGE 35

23 Figure 2-1. Alligator egg viability ( a ) and primary sex determination at 32oC ( b ) for Lake Apopka (AP) and Lake Woodruff NWR (WO).

PAGE 36

24 Figure 2-2. Snout-vent length ( a ) and body mass ( b ) of neonatal alligators from Lake Apopka and Lake Woodruff. Bars represent least-square means adjusted for egg mass + 1 S.E., and asterisks denote si gnificant difference between lakes within an incubation temperature. * P < 0.05; ** P < 0.01;*** P < 0.001.

PAGE 37

25 Figure 2-3. Thyroid ( a ), liver ( b ), and spleen ( c ) mass of neonatal alligators from Lake Apopka and Lake Woodruff. Bars represent least-square means adjusted for body mass + 1 S.E., and asterisk denotes si gnificant differenc e between lakes within an incubation temperature. * P < 0.01.

PAGE 38

26 Figure 2-4. Phallus cuff diameter and tip le ngth of neonatal alliga tors from Lake Apopka and Lake Woodruff. Bars represent l east-square means adjusted for snoutvent length + 1 S.E., and asterisks denote si gnificant difference between lakes within an incubation temperature. * P < 0.05; ** P < 0.005. Plasma Testosterone and Aromatase Activity All animals had detectable concentrations of plasma T (Figure 2-5a). Plasma T concentration did not vary between sexes at 32oC within either lake ( P > 0.05); however we chose to analyze males and females separately a priori due to the physiological role of plasma steroids on sexual differentiati on. Among females, Lake Apopka hatchlings had higher circulating T concentrations ( F = 19.11; df = 3, 93; P < 0.0001) at both 30 and 32oC when compared to hatchl ings from Lake Woodruff. Similarly, Lake Apopka males had higher plasma T ( F = 16.4; df = 3, 56; P = 0.0002) at 32 and 33.5oC. Aromatase activity varied greatly between males and fe males, with females producing nearly an order of magnitude more E2 per paired-GAM than male s (Figure 2-5b). Male E2 production was above detection limits in most samples, but did not vary between lakes ( F

PAGE 39

27 = 1.15; df = 3, 56; P = 0.29). Among females no difference in E2 production could be detected ( F = 2.31; df = 3, 89; P = 0.13) between lakes. Figure 2-5. ( a ) Plasma testosterone (T ) concentrations and ( b ) aromatase activity determined via in vitro estradiol (E2) production from androstenedione in neonatal alligators from Lake Apopka and Lake Woodruff. Bars represent means + 1 S.E., and asterisks denote si gnificant difference between lakes within a sex and incubation temperature. * P < 0.05; ** P < 0.01.

PAGE 40

28 Discussion Although not statistical ly significant, the low p-va lues from the inter-lake comparisons of hatch rates and sex determination at 32oC suggest these endpoints should still be considered for future studies. The selection criteria for clutches required a high number of what appeared to be viable e ggs approximately 2 weeks into the incubation period. Previous reports of low egg viability on Lake Apopka indicate that the majority of embryonic mortality took place during the first 10 days post-oviposition (Masson, 1995). Our data indicate that considerable embryonic mortality cont inues to take place after the first two w eeks following oviposition in Lake Apopka eggs when compared to Lake Woodruff. Egg treatment studies, in which developing embryos were exposed to environmental contaminants in similar con centrations measured in Lake Apopka egg yolk, have shown that some of the contam inants are capable of inducing female development at intermediate and male pr oducing temperatures. These contaminants include p,p’-DDE, p,p’-DDD, and trans -Nonachlor (Crain, 1997; Matter et al., 1998; Rooney, 1998). That Lake Apopka eggs produced 76.6% females whereas Lake Woodruff produced 60% females at 32oC warrants further investigation into a possible bias in sex determination for Lake Apopka hatchlings incubate d at intermediate temperatures. Mean egg mass from Lake Apopka was nearly 10% less than Lake Woodruff. This difference between studies in relative egg mass could be partially explained by our preferential selection of clutch es with a high number of presumably viable eggs for this study. At this time it is unclear if any rela tionship exists between mean egg mass and egg viability. In a previous st udy (Milnes et al., 2001), we observed that mean egg mass on Lake Apopka was greater than that of La ke Woodruff and there was no difference in

PAGE 41

29 hatchling mass; meaning a smaller percentage of the total egg ma ss was converted to hatchling mass during development. Likewise , in the current study we found that Lake Woodruff hatchlings incubated at 32oC were larger than Lake Apopka hatchlings after adjusting for egg mass. Currently, there are no published data regarding egg or egg yolk hydration, nutrient, or energy c ontent from these two populati ons. Future efforts should include determining water and energy content of eggs from these la kes, in addition to examining nutritional profiles such as vitamins, proteins, and fatty acids. Of the somatic indices of liver, thyroid, and spleen mass, only spleen mass showed any differences between lakes after correcti ng for body mass. Previous work indicates that like the mammalian spleen, the crocodilian sp leen is involved with initiation of the cellular immune response (Tan aka and Elsey, 1997), and is susceptible to alterations following exposure to environmental contam inants (Rooney et al., 2003). Exposure to estrogenic compounds, such as the synthetic estrogen DES, is known to induce immune depression in mice (Kalland et al., 1979). Sma ller spleen size in Lake Apopka hatchlings could be an indicator of immunosuppression following in ovo exposure to a number of contaminants that have been shown to bi nd to the alligator estrogen receptor (aER) (Vonier et al., 1996). Unlike previous studies using slightly ol der hatchlings or juveniles from Lake Apopka where plasma T was depressed, these data show elevated plasma T in Apopka neonates compared to Woodruff animals of th e same age. This supports the hypothesis that contaminant-induced alterations of the endocrine system can be further modified during the period of post-embryonic and early juvenile development. The mechanisms by which circulating T concentrations are increa sed in neonatal male alligators from Lake Apopka are unknown. Two potential e xplanations that have yet to be tested in neonates

PAGE 42

30 from Lake Apopka include a decrease in he patic metabolism or an increase in gonadal synthesis. The interaction of endogenous E2, localized production of insulin-like growth factor I (IGF-I), and thei r respective receptors are known to influence oviduct morphology in the alligator and other reptile s (Cox and Guillette, 1993; Guillette et al., 1996a). Due to the presence of chemicals in alligator eggs known to competitively bind the aER (Vonier et al., 1996; Guillette et al., 2002), and previous research indicating hypertrophy of the oviduct epithelial cell layer follo wing embryonic exposure to E2 (Crain et al., 1999), we predicted ECH would be greater in the Apopka hatchlings. Our data indicate that the chemical milieu of Lake Apopka eggs did not induce hypertrophy of the oviduct epithelium when compared to Lake Woodruff. One possi ble explanation is that the contaminant mixture’s binding affinity and ability to activate aER in an agonistic manner was insufficient to elic it a response in neonatal anim als. Although a wide array of chemicals can bind the aER, these could ac t as agonists or antagoni sts. Crain et al. (1999) found a significant increase in ECH only at the highest dose of E2 applied, 14 parts per million (wet egg mass), suggesting th e neonatal oviduct is not as sensitive to estrogenic stimulation as other indices of estrogenic exposure such as gonadal differentiation. Furthermore, our in vitro data suggest no difference in endogenous stimulation of epithelial cell hypertr ophy through ovarian aromatase activity. Previous work from our laboratory has shown a positive relationship between circulating androgens, body size and phallus size in juvenile alligators (Guillette et al., 1996b; 1999b). Our data are consistent with th ose studies in that animals from Lake Apopka exhibit smaller phallus size than an imals from Lake Woodruff. Although in contrast to previous studies, we also found higher plasma T concentration in Apopka

PAGE 43

31 neonates. As is the case in mamma ls, the non-aromatizable androgen, 5 dihydrotestosterone (DHT), appears to have a stronger influence than T on phallus development in alligators (Pickford et al., 2000). Whether or not animals from Lake Apopka have reduced 5 -reductase activity is currently unknown. Of the organochlorine contaminants detected in Apopka alligator egg yolks, p,p’-DDE (1,1-dichloro-2,2-bis(pchlorophenyl)ethylene) is found in the greatest concentration (Heinz et al., 1991), and has been shown to bind the androgen receptor in an antagonistic manner (Kelce et al., 1995). Current investigations are underw ay to examine the effects of in ovo exposure to p,p’DDE and phallus development in alligators. We have observed developmental and endocri ne-related differences consistent with the hypothesis that some component of the embryonic environment is responsible for inducing organizational changes prior to hatc hing in alligators from Lake Apopka when compared to Lake Woodruff. In such a longlived species it is difficult to determine the consequences of these developmental abnormaliti es relative to reproductive fitness. That the comparisons between neonates from thes e two populations were not uniform with previous research using older hatchling and juvenile alligators from the same study sites leads us to propose that further modificati ons associated with ontogenetic changes in endocrine function and post-hatching exposure to contaminants are si gnificant. Future studies in which parallel comparisons of captive-raised and wild-caught animals from these two populations should he lp delineate organizational from activational disruptions in Lake Apopka’s alligators.

PAGE 44

32 CHAPTER 3 EFFECTS OF INCUBATION TEMPERATURE AND ESTROGEN EXPOSURE ON AROMATASE ACTIVITY IN THE BRA IN AND GONADS OF EMBRYONIC ALLIGATORS2 Introduction During embryonic development in reptiles, steroids influence sexual differentiation of the gonad and the brain. In many vertebrate s, the presence or ab sence of sex-specific chromosomes ultimately determines sexual di fferentiation. In others, environmental influences such as temperature can be the pivotal factor in determining ovarian or testicular development. Temperature-depende nt sex determination (TSD), in which egg incubation temperature determines the sex of the developing embryo, exists in many reptiles including all crocodilians, most turtle s, and some lizards (Pieau, 1996). In the American alligator ( Alligator mississippiensis ), incubation temperatures near the low (30oC) and high (34.5oC) end of the viable range produce all females, whereas temperatures near 33oC produce all males (Lang and A ndrews, 1994). Incubating eggs collected from a Louisiana population, La ng and Andrews (Lang and Andrews, 1994) produced 100% males at 32.5oC and 33oC, and 84% males at 33.5oC. Unpublished data from our lab incubating alligator eggs from north central Florida over a six-year period has resulted in ~80% males at 33oC, and 100% males at 33.5oC, suggesting the existence of geographic variation in response to incubati on temperature. The temperature sensitive period (TSP) in alligators has been shown to occur during the third quarter of 2 This chapter is published in Environmental Health Perspectives (Milnes et al., 2002b)

PAGE 45

33 development where the bipoten tial gonad commits to either ovarian or testicular development (Smith and Joss, 1993; Lang and Andrews, 1994). Unlike mammals, where female differentiation appears to be the default in absence of androgens (Norris, 1997), estrogens a ppear to play a key role in the sexual differentiation of non-mammalian vertebrates including birds (Andrew s et al., 1997) and reptiles (Pieau, 1996). The ad ministration of exogenous estr ogens prior to the TSP can override the effects of male incubation temperatures on se xual differentiation in the freshwater turtle Trachemys scripta (Sheehan et al., 1999) an d alligators (Lance and Bogart, 1994; Crain et al., 1997). This indicat es that the undiffere ntiated gonad responds either directly to estrogen or indirectly by way of some estrogen-se nsitive, extragonadal tissue. The aromatase enzyme complex (aromatase cytochrome P450 and the flavoprotein NADPH-cytochrome P450 reductase) is responsib le for the conversion of androgens to estrogens. Aromatase activity has been dete cted in the gonad, brain, liver and adipose tissue of many vertebrate species. The role of this steroidogenic enzyme is sex and tissue dependent, and varies accordi ng to the developmental stage of the organism. Most research on aromatase and TSD in reptiles has focused on gonadal aromatase activity. Treatment of eggs with aromatase inhib itors causes male development at female producing temperatures in T. scripta (Crews et al., 1994) and prevents normal ovarian development in the alligator (Lance and Bogart, 1992). However, gonadal aromatase, which exhibits increased mRNA expression a nd estrogen synthesis on ly near the end of the TSP in crocodilians (Smith and Joss, 1994; Smith, 1995; Gabriel et al., 2001) and turtles (Desvages and Pieau, 1992; Willingham et al., 2000a) does not appear to be the primary signal for ovarian development. Two questions remain, what is the normal

PAGE 46

34 signaling mechanism that causes ovarian deve lopment and how is this signal duplicated at male producing temperatures in the presence of exogenous estrogens? Recent research suggests that the brain play s a role in sexual differentiation in TSD species. Sexually dimorphic transcription of the aromatase gene has been detected in diamondback terrapin embryos ( Malaclemys terrapin ) during the early stages of sex determination, with a greater abundance of aromatase transc ripts in the female brain (Jeyasuria and Place, 1998). During the s econd half of the TSP, aromatase activity increases in the male brain to levels greater than the female brain (Jeyasuria and Place, 1998). Willingham et al . (2000a) measured aromatase activity in the brains of male and female T. scripta embryos and found increasing activity le vels in female brains that were higher than males at the beginning of the TSP. Aromatase activity of both sexes decreased following the end of the TSP, and dropped below detection levels in females prior to hatching (Willingham et al., 2000a). In contrast to the sexually dimorphic brain aromatase expression reported in turtles, no significant differences were found in brain mRNA of alligator embryos incubated at male and female producing temperatures (Gabriel et al., 2001). Although substantial ev idence implicating the brain in directing gonadal differentiation is lacking, temperature appears to influence sexual differentiation of the brain during embryonic deve lopment in some TSD species. Like several TSD species of turtles in which low doses of estrogenic compounds cause the development of female offspring at male-producing temperatures, the alligator has become a model for screening environmenta l contaminants for estrogenicity. Several pesticides and pesticide metabolites that i nduce ovarian development at environmentally relevant concentrations include o,p’-DDE , p,p’-DDE (Matter et al., 1998), p,p’-DDD (Crain, 1997), and trans -nonachlor (Rooney, 1998). Although the mechanism by which

PAGE 47

35 these compounds influence sexual differentia tion is poorly understood, all show some affinity for the alligator es trogen receptor (aER) (Vonier et al., 1996). The modern-use herbicide atrazine shows a weak affinity for the aER (Vonier et al., 1996) and causes testicular aromatase activity uncharacteristic of males or females, but does not cause sexreversal (Crain et al., 1997). While the feminizing action of estrogenic compounds has been well documented in terms of gonadal morphology in alligator s, little is known about the functional consequences of chemically induced sex revers al. Field studies of several contaminated lakes in Florida have shown a number of f unctional abnormalities in female alligators including elevated ovarian synt hesis of testosterone (T), el evated hepatic degradation of T, and reduced ovarian synthesis of estradiol-17 (E2) (for review see Guillette et al., 2000). Because nothing is known concerning th e incubation conditions of the animals obtained for these studies it is unknown if any were sex-reversed as a result of embryonic contaminant exposure. The possibility exists that the differences observed in the exposed populations are due in part to altered endocrine function in sex-reversed females. Given the uncertainty of the mechanisms and consequences of chemically induced sex-reversal, we conducted an initial study to examine the timing and levels of aromatase activity in the brain and gona ds of putative female, male, and sex-reversed female alligator embryos. The purpose of this study was to determine if sexual dimorphism in whole brain aromatase activity could provide a means of di recting gonadal differentiation and to compare aromatase activity in the brain and gonads of E2 sex-reversed females to control males and females.

PAGE 48

36 Materials and Methods Animals and Tissue Collection Six clutches of alligator eggs were coll ected from Lake Woodruff National Wildlife Refuge, Florida, within the first two weeks post-oviposition. Eggs were transported to the University of Florida, Gainesville, a nd incubated in damp sphagnum moss at an intermediate temperature of 32oC until reaching embryonic stage 19. Fifteen eggs from each clutch were systematically assigned to three treatment groups and three dissection stages within each treatment group to avoid clutch effects within the experiment. Treatment groups consisted of control females incubated at 30oC, control males incubated at 33.5oC, and sex-reversed females incubated at 33.5oC and treated topically with 90 g E2 dissolved in 50 l of 95% ethanol at stage 19. Previ ous studies showed that alligator eggs incubated at male producing temperat ures treated with similar doses of E2 result in 100% female hatchlings (Lance and Bogart, 1994; Lang and Andrews, 1994; Crain et al., 1997). Additional eggs (3-4 per clutch) were incubated at each temperature to verify the appropriate stages for dissection of each clutch. Ten embryos from each treatment group were selected for dissection at stages 20 (early TSP), 22 (middle TSP) and 24 (late T SP). Upon reaching the appropriate stage, embryos were decapitated immediately upon rem oval from the egg. Brains and paired gonad-adrenal-mesonephros complexes (GAMs) were removed, flash frozen in liquid nitrogen, and stored at oC until assayed. Entire GAMs were used due to the difficulty in separating the three tissues and publishe d research showing th at the majority of aromatase activity takes place in the gona d portion of the complex (Smith, 1995).

PAGE 49

37 Aromatase Activity Assay The tritiated water assay used to measur e aromatase activity was a modification of methods described by Lephart and Simpson (1991) and Willingham et al . (2000a). All buffers and reagents were purchased from Sigma Chemical Co., St. Louis, MO, unless otherwise specified. Whole brains or pair ed GAMs were homogeni zed over ice in 100 l of homogenate buffer (RPMI-1640 culture me dium supplemented with 25 mM Hepes and 1 mM dithiothrietol) in microcentrifuge tu bes using a handheld pe llet pestle (Kontes, Vineland, NJ). Tissue homogenates were tran sferred to glass culture tubes along with 400 l of substrate buffer. Substrate buffer consisted of homogenate buffer supplemented with1 mM NADPH, 10 mM -D-glucose-6-dehydrogenase, 1 unit/ml glucose-6-dehydrogenase, and 0.8 M [1 -3H] androstenedione (DuPont NEN Research Products, Boston, MA). Culture tubes were covered with parafilm and incubated on a shaker at 32oC. Following 9 hours of incubation for brai ns and 6 hours for GAMs, 1.5 ml of chloroform was added to halt the reaction. The volume of the aqueous phase was brought up to 900 l with the addition of 400 l of deionized water. Culture tubes were then pulse vortexed and centrifuged at 2000x g for 15 min. A 600l aliquot of the aqueous phase was transferred to a new tube, and 600 l of 5% charcoal/0.5% dextran was added before the tube was vortexed and centrif uged at 2000x g for 15 min. Five ml of scintillation fluid (Scintilla tion BD, Fisher Scientific, Pittsburgh, PA) was added to 300 l supernatant and the tube was counted on a Beckman scintillation counter (Beckman Instruments, Schaumburg, IL).

PAGE 50

38 Aromatase activity is proportional to the amount of tritiated water produced by the cleavage of hydrogen from androstenedione at the 1 -position. Activity was calculated by multiplying the sample decays per minut e (dpm) by 3, subtracting the background (blank tube), and dividing by the dpm of substr ate originally added. This percentage was then multiplied by the mass of substrate added and expressed as fmol / tissue / hr. Sensitivity of the assay was defined as tw ice the mean dpm of blank tubes, which corresponded to ~ 8 fmols/tube/hr. Statistics Statistical analyses were performed w ith StatView for Windows (SAS Institute Inc., Cary, NC). Single-classi fication analysis of variance (A NOVA) was used to test for differences across stages within a treatment group and among treatment groups within a stage. A two-way ANOVA was not performe d as part of the analysis because a comparison of all possible combinations of st age and treatment was not consistent with the purpose of this study. Fisher’s PLSD wa s used to make pair-wise comparisons with the level of statistica l significance set at p < 0.05. Results GAM Aromatase Activity No difference in GAM aromatase activity (Figure 3-1) was detectable among treatment groups at stage 20 (p = 0.302), a nd no differences were detectable between stages 20 and 22 within any treatment group. However, enzyme activity at stage 22 in control females was lower than control male s (p = 0.012) and sex-reversed females (p = 0.014). Stage 24 was marked by a dramatic in crease in enzyme activity in control females (p < 0.0001), whereas control males e xhibited a slight decrease in aromatase activity (p = 0.022) from stage 22. A mode rate increase in aromatase activity was

PAGE 51

39 detected in E2-treated females (p = 0.0009) that wa s higher than control males (p = 0.0001) and lower than control fe males (p < 0.0001) at stage 24. Figure 3-1. Gonad-adrenal-mesonephros (GAM ) complex aromatase activity (fmol / GAM / hr) in female (30oC), male (33.5oC) and sex-reversed female (33.5oC+E2) alligator embryos during the earl y (stage 20), middle (stage 22), and late (stage 24) stages of the temperature sensitive period. Brain Aromatase Activity Brain aromatase activity (Figure 3-2) incr eased from stage 20 to 22 in all treatment groups, and no differences among treatment groups were detectable at these two stages (p = 0.359 and 0.806, respectively). From stage 22 to stage 24, aromatase activity level increased in control males (p = 0.011) and females (p = 0.001), and no difference was detected between these two groups at stag e 24 (p = 0.084). No change in aromatase activity occurred in sex-reversed females fr om stage 22 to 24 (p = 0.631), and stage 24

PAGE 52

40 sex-reversed females were lower than contro l females (p = 0.013) a nd were not different from control males (p = 0.363). Figure 3-2. Brain aromatase activity (fmol / brain / hr) in female (30oC), male (33.5oC) and sex-reversed female (33.5oC+E2) alligator embryos during the early (stage 20), middle (stage 22), and late (stage 24) stages of the temperature sensitive period. Discussion Similar to previous studies (Desvage s and Pieau, 1992; Smith and Joss, 1994; Smith, 1995; Willingham et al., 2000a), aromatas e activity in the GAM did not increase until the end of the temperature sensitive pe riod (TSP). It is likely that gonadal aromatase activity is associated with ovarian development, as it increased significantly between stages 22 and 24 in both control and se x-reversed females. The proliferation of cortically located germ cells and regression of medullary sex cords occurs during these

PAGE 53

41 stages in alligators incubated at female-pr oducing temperatures (Smith and Joss, 1993). However, temperature shift experiment s by Lang and Andrews (1994) show sex determination to occur between stages 20 and 22 when shifting from 30 to 33oC. Aromatase activity alone does not appear to initiate ovarian differentiation as evidenced by the low activity levels in both males and fe males during the early stages of the TSP. The data presented in this study indicate that the GAM of sex -reversed females is neither malenor female-like with regard to aromatase activity at stage 24. This is especially interesting since E2 exposure at male producing temp eratures results in ovarian differentiation, as opposed to an inter-sexed gonad (Lance and Bogart, 1994; Crain et al., 1997). That aromatase in the sex-reversed fe males was significantly lower than control females and higher than control ma les suggests embryonic exposure to E2 and incubation temperature affects steroidogeni c enzyme levels and/or activ ity. Apart from directing ovarian differentiation of the gonad, exogenous estrogen could disr upt a number of feedback mechanisms along the hypothalmopituitary-gonad axis, such as gonadotropin release, causing suppression of aromatase synt hesis relative to cont rol females (Norris, 1997). Incubation temperature, regardless of sex, has been shown to influence plasma steroid concentrations. In th e red-eared slider, plasma E2 in females from intermediate incubation temperatures was si gnificantly lower than juveniles from the all femaleproducing temperature and no di fferent than that of male s from the intermediate temperature (Rhen et al., 1999). This effect could be mediated by the presence of antiMllerian hormone (AMH), which has been shown to decrease aromatase synthesis in fetal ovaries of several mammal species (Vigier et al ., 1989). Western et al . (1999) detected expression of AMH in alligato r embryos incubated at male-producing temperatures beginning at st age 22, but not at female-pr oducing temperatures at any

PAGE 54

42 stage. AMH expression was limited to the medullary cells of the developing testes (Western et al., 1999), demonstrating a need to examine ovarian differentiation of sexreversed females on a morphological level (e .g., in situ hybridiz ation for AMH mRNA) relative to untreated embryos as well as measuring multiple hormones. Results of recent studies on aromatase in the brain of TSD species have differed according to species and endpoint measured. In the diamondback terrapin, transcripts of the aromatase gene were in gr eater abundance in females duri ng the first half of the TSP and then higher in males during the second half (Jeyasuria and Place, 1998). When aromatase enzyme activity was measured in the brain of red-eared slider embryos, females exhibited an increas e early in the TSP whereas males showed no significant increase throughout the same period (Willingham et al., 2000a). In the alligator, transcripts of the aromatase gene did not di ffer between sexes and showed no significant increase for any stage of development (Gabriel et al., 2001). In contra st, our data indicate an increase in enzymatic activ ity throughout the TSP in both se xes with slightly higher activity levels in put ative females at stage 24, indicati ng that gene expression does not necessarily reflect enzyme activity levels. Furthermore, E2-induced sex reversal resulted in brain activity levels similar to control ma les, suggesting that sex-reversed females do not function as normal females in all tissues. Because an increase in aromatase activity occurred early in the TSP, but did not differ between sexes, it is difficult to determ ine the role of brain aromatase activity with regard to sex determination. If the increase in brain aromat ase activity is sufficient to increase circulating E2 concentrations, temperature-depe ndent expression of the estrogen receptor (ER) could be the key to gonadal di fferentiation. That is, a slight increase in circulating E2 resulting from aromatase activity in the brain early in the TSP, coinciding

PAGE 55

43 with an increase in ER expr ession in the gonad could lead to ovarian differentiation. Bergeron et al . (1998) measured ER transcripts in th e gonads of red-eared slider embryos and found higher concentrations in the gonads of embryos incubated at female-producing temperatures at the beginning of the TSP. However, it is unknown if the estrogen produced locally in the brain is capable of crossing the blood-b rain barrier to an extent great enough to affect circula ting steroid concentrations. Fu rthermore, translation of ER transcripts to functional receptor proteins s hould be confirmed before strong inferences are made regarding the interplay of arom atase activity and ER expression in sex determination. Contrary to the results from the gonads, leve ls of aromatase activity in the brain of sex-reversed females is not different fr om that of control males, indicating E2 exposure did not override the effects of incubation te mperature on enzyme activity in the brain. Studies on eutherian mammals have shown the presence of -fetoprotein, which binds to circulating E2, prevents maternal E2 from crossing the blood-brain barrier of embryos developing in utero (Milligan et al., 1998). While -fetoprotein has not been reported in any reptile, cytosolic binding proteins have been described in the alligator that show an affinity for E2 and to a lesser extent s ynthetic steroids and cont aminants (Crain et al., 1998b). Conley et al . (1997) reported high concen trations of steroids (E2, testosterone, and androstenedione) in alliga tor egg yolks that decline si gnificantly during the TSP. The presence of steroid bi nding proteins in developing embryos could function as a means to protect the embryo from high concentr ations of maternal steroids deposited in the yolk during vitellogenesis and prevent fe minization of the brain following embryonic exposure to exogenous E2.

PAGE 56

44 Estradiol-exposure studies serv e as a valuable model, but cannot always predict the effects of estrogenic contaminants because the pathways through which these compounds work vary widely. Although many of the e nvironmental estrogenic compounds shown to cause sex reversal are capabl e of binding to the aER (Voni er et al., 1996), many differ from natural estrogens in hepatic degradation rates, binding affinity for plasma proteins, and binding affinity for other nuclear and membrane-bound recep tors. As the results of E2 exposure differed between the brain and gona d in this study, special considerations should be given to which endpoints are mon itored in organisms exposed to estrogenic compounds. Estrogens and aromatizable andr ogens have been shown to override the effect of incubation temperature on sex dete rmination (Crews et al., 1994; Lance and Bogart, 1994; Crain et al., 1997), but few studies have looked beyond gross morphology of the gonad. In the present study, E2 exposure at male-producing temp eratures resulted in intersexed gonadal and male-like brain aromatase activity in female embryos. Although our study did not examine specific brain regions, this study demonstrates that the gonad and brain respond to differing degrees following exogenous estrogen treatment. This is extraordinary given the fact that the respons e in any given region of the brain would be tempered by the fact the entire brain was ho mogenized. Future studies should examine aromatase activity in distinct regions of the brain associated with sexual differentiation such as the pre-optic area and the hypothala mus. Further research is warranted to determine if alterations in enzyme activ ity occur following cont aminant-induced sex reversal and whether or not they persist in light of the endocrine alterations reported in field studies of exposed alligator populati ons. These data clearly demonstrate that environmental contaminants could alter th e differentiation of the gonad morphologically

PAGE 57

45 while having only partial influence on the differentiation of gonadal physiology. Moreover, gonadal differentiation could be aff ected differently from the response seen in the brain. Such differences could be associ ated with the timing of exposure or exposure dosage as modified by physiological phenomena such as the transfer of chemicals across the blood-brain barrier. Given the perv asive influence of th e hypothalamo-pituitarygonadal axis in numerous endocrine activ ities including reproduction, growth and metabolism, understanding the effects of envi ronmental estrogens and antiestrogens is essential if we are to determine the imp act these compounds have on development and reproduction of many wildlife species. Only a thorough assessment at the tissue, cellular, and molecular levels can determine the full impact of a chemical ly altered embryonic environment.

PAGE 58

46 CHAPTER 4 DEVELOPMENTAL ALTERATIONS AS A RESULT OF IN OVO EXPOSURE TO THE PESTICIDE METABOLITE P,P’-DDE IN Alligator mississippiensis3 Introduction Although use of the pesticide DDT (1,1,1-trichloro-2,2-bis ( p -chlorophenyl) ethane) has been severely restricted in many industrialized nations, its widespread use in tropical regions along with the pe rsistence of its metabolites has maintained its status as an environmental contaminant of concern. Earl y investigations into its toxicity in nontarget organisms include the suppressive e ffects of DDT and its metabolites on male secondary sex characteristics in the roos ter (Burlington and Li ndeman, 1950). After several decades of use and subsequent ban in the U.S., many studies began to focus on the metabolites of DDT; DDD (1,1-dichloro-2,2bis ( p -chlorophenyl) ethane) and DDE (1,1-dichloro-2,2bis ( p -chlorophenyl) ethylene). Most notable was the association between DDE exposure and eggshe ll thinning in a variety of bi rd species (Peakall et al., 1973; Ratcliffe, 1973). The primary metabolit e formed under aerobic conditions is p,p’DDE. This metabolite is extremely persiste nt in soil and sediments, lipophilic, and readily bioaccumulates in the adipose tissue of animals at the top of the food chain (Kleinow et al., 1999). This poses a unique set of problems for oviparous vertebrates in which maternal transfer and concentration of nutrients in the lipid-rich yolk ensures offspring will be subject to contaminant e xposure at the earliest life history stages. 3 This chapter is in review for publication in General and Comparative Endocrinology .

PAGE 59

47 The potential for environmental contamin ants to disrupt development and sexual differentiation has been well documented in a ll vertebrate classes. Many of these contaminants interact with the endocrine system and can be classified as hormone agonists or antagonists. The classification depends on a numbe r of factors including, but not limited to, receptor binding affinity, prolif eration or inhibition of specific hormone mediated processes, and the development of se xually dimorphic traits. The reptilian egg bioassay has become a useful tool in asse ssing the hormone-like effects of embryonic contaminant exposure on sex determination in certain wildlife speci es (Crews et al., 1994). Many species of turtles and all cr ocodilians experience environmental sex determination where the incubation temperatur e is the primary sex-determining factor (Lang and Andrews, 1994). Experimental studies have shown that exposure to steroidogenic or steroid inhibi ting substances can alter the effect of temperature on sex determination. Current research suggests that chemical induced sex-reversal is mediated through interaction with steroid receptors or alterations in steroidogenic enzymes. Both natural and synthetic estroge ns can induce female development at male-producing temperatures in the red-eared slider, Trachemys scripta (Bergeron et al., 1999; Sheehan et al., 1999), and alligators (Lance and Bogart, 1992; Crain et al ., 1997). It has also been shown in alligators that inhibition of ar omatase activity, the enzyme that converts androgens to estrogens, can induce male de velopment at temperatures that normally produce males and females (Lance and Bogart , 1992). In addition to screening for alterations in sex determination, the egg bioa ssay is a useful tool for determining more subtle effects on hormone-related endpoints. For instance, alligators exposed in ovo to estradiol-17 (E2) exhibited greater oviducal epithelial cell height (ECH) than controls (Crain et al., 1999). In T. scripta , exposure to chlordane a nd/or Aroclor 1242 during

PAGE 60

48 embryonic development resulted in altered steroid concentrations (Willingham et al., 2000b). The classification of p,p’-DDE as an estr ogen or androgen agonist or antagonist can vary depending on the taxa and assay used for screening (Guillette and Iguchi, 2003). For example, p,p’-DDE acts as an estrogen agonist in T. scripta in that in ovo exposure at typically male-producing temperatures results in ovarian development in the majority of hatchlings (Willingham and Crews, 1999; W illingham, 2004). In contrast, p,p’-DDE failed to influence sex determination in the green sea turtle ( Chelonia mydas ) (Podreka et al., 1998) and the common snapping turtle ( Chelydra serpentina ) (Portelli et al., 1999). Matter et al. (1998) were able to influence sex determinati on in alligators with p,p’-DDE at an intermediate temperature, but not at a typically male-producing temperature. Vonier et al. (1996) found that p,p’-DDE is capable of binding to the alligator estrogen receptor (ER), but has a very low affinity relative to the endogenous ligand, E2. When put through a series of short term estrogeni city tests, p,p’-DDE exhibited low binding affinity for human and rabbit ER, was una ble to induce vitellogenin production in juvenile rainbow trout, and showed a great ly reduced ability to induce MCF-7 cell proliferation relative to E2 and its parent compound o,p’-DDT (Andersen et al., 1999). In the rat, p,p’-DDE acts as an androgen an tagonist by inhibiting androgen dependent growth and sexual differentiation (Gray et al., 2001). DDE can inhibit the binding of androgens to the human androgen receptor (hAR ) (Kelce et al., 1995) and alter androgendependent gene expression in the rat (Kelce and Wilson, 1997). In the current study, alligators were treated in ovo with low, but environmentally relevant, concentrations of p,p’-DDE. This cont aminant is of particular interest due to its predominance among organochlorines detected in various alligator tissues from Lake

PAGE 61

49 Apopka, Florida (Heinz et al., 1991; Guille tte et al., 1999a), a population with well documented developmental and reproductive ab normalities (for review see Guillette et al., 2000). The purpose was to compare the effects of p,p’-DDE exposure to similar concentrations of E2, a positive estrogenic control, and untreated controls to determine if this ubiquitous contaminant is hormonally active in the alligator—an established wildlife model for endocrine disrupting contaminants . We evaluated primary sex ratios at intermediate and male-producing temperatures , along with plasma testosterone (T) and gonad aromatase activity in the resulting neonate s. We also examined oviducal ECH and phallus size—estrogen and androgen responsive tissues, respectively. Materials and Methods Egg Incubation and Treatments All field and laboratory work was conducte d under permits from the Florida Fish and Wildlife Conservation Comm ission and US Fish and Wildlif e Service. Six clutches of alligator eggs were collected from La ke Woodruff National Wildlife Refuge, Florida in June 1999 within the first two weeks post-oviposition. One egg from each clutch was opened to determine embryonic stage based on criteria described by Ferguson (1985). Incubation temperature and treatment groups were assigned systematically to avoid clutch effects within a treatment or te mperature group. Temp erature assignments consisted of a temperature that produces males and females, 32o C, and a male-producing temperature, 33.5o C. Eleven eggs were assigned to each temperature-treatment combination. Treatment groups consisted of 100, 0.1, and 0.0001 parts per billion (ppb) p,p’-DDE (ChemServ, West Chester, PA) or E2 (Sigma Chemical Co., St. Louis, MO) based on a mean egg mass of 90 g. Treatments were delivered topica lly, dissolved in 50 l of 95% ethanol as previously described (Crain et al., 1997; M ilnes et al., 2004).

PAGE 62

50 Untreated and vehicle control groups were also assigned to each incubation temperature. Additional eggs from each clutch were incu bated at each temperature to verify the appropriate stage (19) for treatment—just prior to the thermo-sensitive period of sex determination. Eggs were maintained in 40 x 50 cm nesting boxes filled with damp sphagnum moss placed inside commercial incu bators. Nesting boxes were rotated daily within each incubator, and certified ther mometers placed in each nesting box were checked daily until hatching. Dissections and Tissue Cultures Between 14 and 21 days post-hatching, a 2 ml blood sample was drawn from the post-cranial sinus, placed in heparinized V acutainer tubes, and centrifuged at 1,500g for 20 min. Plasma was drawn off and stored at -72oC until assayed for testosterone (T). Immediately following the blood sample, neonate s were euthanized with a lethal dose (0.5 mg/g BM) of sodium pentobarbital (Sigma Chemical Co., St. Louis, MO). Paired gonad-adrenal-mosonephros (GAM) complexes we re removed immediately and placed in 1.0 ml of media 199 (Gibco BRI, Gaithersburg, MD, USA) prepared as described by Milnes et al. (2004). Cult ure media was supplemented with 100 ng/ml androstenedione to determine aromatase activit y, or the conversion of androge ns to estrogens. Following 5 hours of incubation at 32o C, culture media was removed and stored at oC until assayed for E2. Both GAMs and the oviduct, where applicable, were fixed in Bouin’s fixative for histological analyses. Radioimmunoassays Plasma T and culture media E2 concentrations were measured by radioimmunoassay previously described and va lidated for alligators (Guillette et al., 1994; Guillette et al., 1995b). Minima l detectable concentrations of E2 and T were 3 and

PAGE 63

51 6 pg/ml, respectively. Intra-assay variance averaged 2.4% for E2 and 2.7% for T; and inter-assay variance for E2 and T was 8.8 and 14.9%, respectively. Hormone concentrations were determined using commercially available software (Microplate Manager 4.0, Biorad, Hercules, CA, USA). Histology The sex of each individual was determined following histological preparation of the GAM. Briefly, one GAM from each animal was embedded in paraffin, serial sectioned at 6 m, and stained using a modified Masson’s trichrome (Presnell and Schreibman, 1997). Identification of the gonad as either testis or ovary was based on criteria described by Forbes (1940) and more recently Smith and Joss (1993). Ovaries were identified by the presence of lacunae in the medulla and germ cells in the hypertrophied cortex, whereas medullar sex cord proliferation and a reduced cortex characterized testes. Five cross sections of oviduc t, evenly distribu ted throughout the le ngth of the tissue were selected for measurement of epithelial cell height (ECH). In each cross section, four epithelial cells distributed ~90o from one another were measured at 400X magnification using an ocular micrometer. Th e measurements were then converted to the nearest 1.0 m with the use of a stage micrometer. Phallus Measurements Whole carcasses were fixed in neutral buffered formalin immediately after dissections. Following histological determin ation of sex, the phallus was removed from each male and measured under a stereoscope at 40X magnification with the aid of a calibrated ocular micrometer to the nearest 0.025 mm. The tip length was measured from the front edge of the cuff to the most di stal point along the posterior surface of the phallus, and the cuff diameter was measured at the widest poin t along the anterior-

PAGE 64

52 posterior axis. The two measurements take n have clearly defined landmarks and were based on previously established criteria (Gui llette et al., 1996b; Pickford et al., 2000). Statistics Chi squared contingency tabl es were used to compare sex ratios among treatment groups, and to the appropriate controls. Onetailed tests of signifi cance were used to compare treatment groups to controls as we expected a female biased sex ratio in E2 and DDE treated animals based on previously published studies (Matter et al., 1998; Willingham and Crews, 1999; Willingham, 2004). Morphological data and plasma T values were analyzed by two-way analysis of variance (ANOVA) using treatment and dose as the independent variables. These data were log transformed in order to normalize the distributions prior to stat istical analyses. Reported values represent non-transformed means + 1 standard error. The dist ribution of the culture media E2 concentrations could not be normalized using standard transforma tions, therefore these data were analyzed using the nonparametric Kruskal-Wallis test. We also conducted an F-test for equality of variance, as changes in variance have been shown to be associated with chemical exposure (Orlando and Guillette, 2001). All di fferences were considered significant at P < 0.05. Results Sex Determination The sex ratio for each treatment group is shown in Figure 4-1. No difference between the control and vehicle group was detected at either temperature, so subsequent comparisons with treatments were made agai nst combined control + vehicle. At 32oC, 50% of the controls were female compared to 100% for the positive control, E2, at the middle (0.1 ppb) and high (100 ppb) doses. Th e percentage of females produced at 32oC

PAGE 65

53 increased relative to controls follo wing treatment with 100 ppb p,p’-DDE ( P = 0.03). No effect on sex determination was observe d at the lower doses of DDE at 32oC, or among any of the DDE treatments at th e male-producing temperature, 33.5oC. Only the highest dose of E2 elicited significan t sex-reversal at 33.5oC ( P = 0.009). Plasma Testosterone and Aromatase Activity Plasma T concentrations for males and fe males are summarized in Figures 4-2 and 4-3, respectively. Two-way ANOVA (treatme nt x dose) for plasma T revealed no difference among groups for males ( P = 0.59) or females ( P = 0.84). GAM aromatase activity, reported as pg of E2 produced per paired GAM, was nearly 7-fold higher in females when compared to males. Aromatase activity was detectable in all males, but did not vary among treatment groups ( P = 0.49). Similarly, no differences were detected among females ( P = 0.24) from any treatment gr oup (Figure 4-4). Interestingly, aromatase activity in the high dose E2 treated females from 33.5oC was not significantly different from control or et hanol treated females at 32oC, but the variance was greater in the E2 treatment group when compared to the vehicle controls ( P = 0.03). In contrast, the variance from the high dose E2 females incubated at 32oC is reduced when compared to controls ( P = 0.04).

PAGE 66

54 Figure 4-1. Sex ratios of alligators incubated at 32oC (A) or 33.5oC (B) and exposed in ovo to p,p’-DDE or estradiol-17 (E2). Treatment values represent g/kg wet egg mass. Bars with asterisks denote a significant difference ( P < 0.05) between that treatment and the co mbined control and vehicle groups.

PAGE 67

55 Figure 4-2. Plasma testosterone (T) concentrations (mean + 1 SE) in neonatal male alligators incubated at 32oC and 33.5oC and exposed in ovo to p,p’-DDE or estradiol-17 (E2). Treatment values represent g/kg wet egg mass. Superscript a denotes treatment group that resulted in 1 male, b denotes treatment groups that resulted in all females. Figure 4-3. Plasma testosterone (T) concentrations (mean + 1 SE) in neonatal female alligators incubated at 32oC and 33.5oC and exposed in ovo to p,p’-DDE or estradiol-17 (E2). Treatment values represent g/kg wet egg mass.

PAGE 68

56 Figure 4-4. Gonad-adrenal-me sonephros (GAM) aromatase activity in neonatal female alligators determined via estradiol (E2) production from androstenedione. Bars represent means + 1 SD. The superscript a denotes variance is less than controls, whereas b denotes variance greater than vehicle (ethanol) treatment group. Oviduct and Phallus Morphology Oviducts appeared structurally homogene ous through the length of the tissue and exhibited a clearly defined epithelial cell la yer. No differences were observed in oviductal ECH among females ( P = 0.77), and averaged 11.1 + 0.55 m among controls. Phallus tip length ( P = 0.97) and cuff diameter ( P = 0.75) were not significantly different among males from any of the treatment groups. Tip length and cuff diameter averaged 1.59 + 0.06 and 1.39 + 0.04 mm, respectively, for controls. Discussion The response to E2 at the intermediate and male -producing temperatures underlies the significance of the interaction of dose and temperatur e on sex determination. At the intermediate temperature (32oC), 0.0001 mg/kg E2 produced all females; whereas 0.1 mg/kg at the male-producing temperature (33.5oC) resulted in 37.5% females. Previous

PAGE 69

57 work from our lab has produced 100% females at 33.0oC using 0.014 mg/kg E2 (Crain et al., 1997), indicating a greater than 10-fol d increase in sensitivity following a 0.5oC decrease in temperature. A similar intera ction between dose and temperature has been described for the red-eared slider at interm ediate temperatures (Wibbels et al., 1991; Wibbels and Crews, 1995), where a Michaelis -Menton fit showed no threshold dose for E2 at a male-biased temperat ure (Sheehan et al., 1999). Our results indicate that p,p’-DDE is capab le of influencing sex determination at intermediate temperatures when applied t opically at 100 ppb or 0.1 mg/kg wet egg mass. This dose is at least an order of magnitude lo wer than what has previously been shown in the alligator (Matter et al., 1998). Like the study by Matter et al. (1998), we were unable to show significant sex reversal with p,p ’-DDE at the male-producing temperature, reaffirming the gonad’s response to a combina tion of temperature and chemical milieu. At doses as low as 0.0007 mg/kg, p,p’-DDE was shown to cause male to female sex reversal in the red-eared s lider at a temperature that produced a mixed sex ratio (Willingham, 2004). In contrast, doses as high as 0.543 mg/kg in the green sea turtle and 6.25 mg/kg in the common snapping turtle fa iled to produce more females than the controls (Podreka et al., 1998; Portelli et al., 1999). Both of these studies used strongly male-biased incubation temperatures. Furthe rmore, background concentrations of DDE were measured in representative sample s from those studies, and ranged from 0.001 to 0.005 mg/kg—an order of magnitude above the effective dose shown by Willingham (2004). That the controls resulted in larg ely male-biased sex ratios indicates that the temperature was capable of overriding at least the background DDE contamination— possibly explaining the in congruity across studies.

PAGE 70

58 Embryonic exposure to p,p’-DDE or E2 did not affect plasma T, and concentrations in sex reversed females were no different th an control females. While the nonparametric analysis of ranked means failed to detect a difference in aromatase activity among females, the highest dose of E2 did affect the variance about the mean at both temperatures. At 32oC, where all the individuals exposed to 0.1 mg/kg E2 developed as females, the variance was reduced relativ e to controls. At the male producing temperature, the same dose of E2 resulted in a mixed ratio and increased variance in aromatase activity in the E2 sex reversed females. Aromat ase activity in two individuals from that treatment group, one male and one female, was nearly 4 times greater than the average female. It is important to note th at these two individual s were from different clutches, and that the gonad from the male a ppeared histologically similar to other testes examined. While the mechanisms by which variance is affected are poorly understood, we feel changes in phenotypic variance are important indicato rs of chemical perturbation. In addition to examining sex determ ination and gonad function at low concentrations, our goal was to determine if p,p’-DDE would act in an estrogenic or antiandrogenic fashion, as sugge sted by previous research. Specifically, we examined oviductal ECH, an estrogen responsive tissue, and phallus size, an androgen responsive tissue. Results from this portion of the study are inconclusive in describing the hormonal activity of DDE. Currently there are no de tailed studies addressing the ontogenetic expression of steroid recept ors in reproductive tissues of embryonic or neonatal alligators. However, previous work from our lab has shown an increase in oviduct ECH following in ovo treatment with 14 ppm E2 (Crain et al., 1999), and a significant relationship between the andr ogen, dihydrotestosterone, and ph allus size in hatchling alligators (Pickford et al., 2000). While we were able to override the effects of

PAGE 71

59 incubation temperature on sex determination, neither DDE nor E2 treatment elicited a response in the oviduct or phallus. These resu lts suggest gonadal differentiation is more sensitive to chemical perturba tion than primary sex characteri stics in neonatal alligators. In this study we attempted to determine the effects of in ovo exposure to p,p’-DDE on 1) differentiation of the gonad, 2) endocrine function, and 3) hormone sensitive tissue morphology. The alligator was chosen as an appropriate model species based on past studies that show each of these endpoints ar e labile and changes in these endpoints have been associated with chemical perturbation of the endocrine system. Our data show that p,p’-DDE is capable of influencing differen tiation of the gonad but failed to influence gonadal function and primary sex characteristics at the concentrations examined. Perhaps most significant in this study was the sensitiv ity of the gonad to low doses and changes in temperature. Future studies concerning the ability of environmental contaminants to alter sex determination must take into account th e sensitivity of the reptilian gonad to the interaction of dose and temperature.

PAGE 72

60 CHAPTER 5 DEVELOPMENTAL EFFECTS OF EMBRYON IC EXPOSURE TO TOXAPHENE IN THE AMERICAN ALLIGATOR ( Alligator mississippiensis )4 Introduction Our laboratory, in collaboration with other researchers, has performed a number of experimental studies exposing developing embryos to various persistent and nonpersistent pesticides. Usi ng the American alligator ( Alligator mississippiensis ), egg dosing studies with total egg pesticide exposures of 10 parts per million (ppm) or lower of several DDT metabolites, trans-Nonachlo r, or 2,3,7,8-tetrachl orodibenzo-p-dioxin (TCDD), and atrazine have produced alterati ons in sex determination, endocrine function, secondary sex characteristics an d/or gonadal anatomy that are similar to those reported in wild populations exposed to these compounds (Crain et al., 1997; Matter et al., 1998; Rooney, 1998; Crain et al., 1999; Guillette et al., 2000). Sim ilar studies have documented contaminant-induced sex reversal and alteration of ster oid hormone profiles in the freshwater turtle, Trachemys scripta elegans (Willingham and Crews, 1999; Willingham et al., 2000b). These experimental studies have begun to provide the causal relationships between embryonic pesticide e xposure and reproductive abnormalities that have been lacking in descriptive field studi es of wild populations. An understanding of the developmental consequences of endocrine disruption in wildlife can lead to new indicators of exposure and a better understand ing of the most sensit ive life-history stages and the consequences of e xposure during these periods. 4 This chapter is published in Comparative Biochemistry and Physiology, Part C (Milnes et al., 2004)

PAGE 73

61 In contrast to the organochlorines that have served as traditional environmental concerns, such as DDT and its metabolites, little is known of the endocrine disruptive effects or even developmental effects of em bryonic exposure to toxaphene. Toxaphene is a complex mixture of at least 1010 polychl orinated monoterpenes derived from the chlorination of camphene (Korytr et al., 2003) . It is a broad-spectrum insecticide and miticide that persists in soil for long periods of time (1 to 14 years) (Keith, 1997). Use of toxaphene was banned in the United States in 1982 (Briggs, 1992) ; however recent studies show high concentrati ons (0.1 – 2.5 ppm) of toxaphene in various biota and tissue types in the Southeastern U.S. (Maruya and Lee, 1998). In the present study, our goal was to exam ine the possible effects of toxaphene on embryonic development and endocrinology in the Am erican alligator. The focus of this study stems in part from the relatively hi gh concentration of toxaphene detected in alligator egg yolks collected from Lake Apopka compared to other Florida lakes. Heinz et al. (1991) reported toxaphe ne concentrations of 0.05 to 13.0 ppm in Lake Apopka alligator eggs. Recently unpublished egg yolk an alyses indicate concentrations in eggs collected from Lake Apopka range from 0.29 – 40.5 ppm with a mean concentration of 9.4 ppm (L. Richey, College of Veterinary Medicine, University of Georgia, pers. comm.). Adult alligators are capable of bioaccumulating large amounts of lipophilic contaminants in tissues due to their long life spans and status as a top predator. This poses potential problems for developing embryos , which must utilize the lipid rich yolk deposited by females in the oocyte as their major source of energy for development. The endpoints examined include basic morphologi cal measurements such as body size and organ weights as well as indices of e ndocrine function includi ng endocrine tissue morphology, plasma steroid concentrations, and in vitro hormone production. These

PAGE 74

62 endpoints were chosen based upon their use as classic markers of t oxicology (liver) or more recent use as biomarkers of disrup tion of the endocrine system (thyroid and gonads). Materials and Methods Egg Incubation and Treatments Ten clutches of eggs were collected fr om Lake Woodruff National Wildlife Refuge, Florida, USA, in June 2000 under permit from the Florida Fish and Wildlife Conservation Commission within the firs t two weeks post-oviposition. Following transport to the University of Florida, Gainesville, eggs were candled to determine fertility by presence of an opaque band i ndicative of development of extraembryonic membranes associated with the embryo. One egg from each clutch was opened to determine the exact embryonic stage based on criteria described by Ferguson (1985). Incubation temperature and treatment groups were assigned systematically to avoid clutch effects within a treatment or temp erature group. Eggs were incubated at 32oC, a temperature that produces both males and females, or 33.5oC, an all male-producing temperature (Ferguson and Joanen, 1983). Additional eggs from each clutch were incu bated at each temperature to verify the appropriate stage (19) for treatment—just prior to the thermo-sensitive period of sex determination (Lang and Andrews, 1994). Treatment groups (n = 13 / treatment / temperature) consisted of 10 parts per milli on (10 ppm), 10 parts per billion (10 ppb), and 10 parts per trillion (10 ppt) technical grade toxaphene (Fisher Scientific, Pittsburg, PA, USA) based on a mean egg mass of 90 g. Treatments were delivered topically, in 50 l of 95% ethanol (EtOH), to each clutch upon reaching stage 19 of development. Treatments were administered with a pipette over the highly vascular ized, topside of the

PAGE 75

63 opaque band. Half of the controls (n = 14 / temperature) from each temperature were treated topically with 50 l of EtOH alone. Upon hatchi ng, neonates were web-tagged for identification and maintained in 40 x 30 cm plastic enclosures in ~ 5 cm water. Dissections and Tissue Cultures Culture medium 199 (Sigma Chemical Co., St. Louis, MO, USA) was prepared according to manufacturer’s instructions and st erilized with a bottle top filter. Aliquots of media were supplemented aseptically under a laminar flow hood each day for gonad and thyroid cultures. Fifteen ml of cu lture media was supplemented with 0.3 mg progesterone in 5 l methanol for a final concentration of 100 ng progesterone/ml media for gonad cultures. Ten ml of thyroid cultu re media was supplemented with 500 mI.U. bovine TSH in 10 l of H2O for a final concentration of 0.5 mI.U. bTSH/ml media. Between 3 and 4 weeks post-hatching, snout-vent length (SVL), and body mass (BM) were determined prior to drawing a 3 ml blood sample and administering a lethal dose (0.5 mg/g body mass) of sodium pentobarb ital (Sigma Chemical Co., St. Louis, MO, USA). Blood samples were centrif uged in heparinized Vacutainers at 1500 g for 20 min; after which plasma was drawn off and stored at oC until assayed. Paired gonadadrenal-mesonephros (GAM) complexes were removed immediately, weighed and placed in autoclaved borosilicate culture tubes with 1.0 ml of media 199 supplemented with progesterone to determine in vitro testosterone (T) and estradiol-17 (E2) production. Similarly, thyroids were removed, weighe d, and cultured in 0 .5 ml of media 199 supplemented with bTSH. Following 5 hours of incubation at 32oC, culture media was removed and stored at oC until assayed and both GAMs and thyroids were fixed and processed in Bouin’s fixative for histopathology and identification of sex. The liver was also removed, weighed, fixed and proce ssed for histopathological analysis.

PAGE 76

64 Radioimmunoassays Plasma and in vitro steroid concentrations were analyzed by radioimmunoassay previously validated for alligators (Guillette et al., 1994; 1995b). Ma le plasma and gonad culture media samples were assayed for T, whereas E2 was measured in plasma and gonad culture media from females. Samples were extracted twice in 5 ml of diethyl ether, dried under a constant stream of filtere d air, and then reconstituted in borate buffer (100 l; 0.05 M; pH 8.0). Extraction efficiencies for E2 and T were 97% and 96%, respectively. Bovine serum albumin (BSA, Fi sher Scientific, Pittsburg, PA, USA) in 100 l of borate buffer was added at a final concentration of 0.19% for E2 and 0.15% for T to reduce nonspecific binding. Antibody (Endocri ne Sciences, Tarzana, CA, USA) was then added in 200 l of borate buffer at a final concentration of 1:55,000 for E2 and 1:25,000 for T. Finally, ra diolabeled steroid ([2,4,6,7,16,17-3H] Estradiol at 1 mCi/ml; [1,2,6,7,-3H] Testosterone at 1 mCi/ml; both from Amersham Int., Arlington Heights, IL, USA) was added at 12,000 cpm per 100 l to bring the final volume to 500 l. Interassay variance tubes were similarly prepared from 3 pools of juvenile alligator plasma. Standards for both E2 and T were prepared in duplicate at 0, 1.56, 3.13, 6.25, 12.5, 25, 50, 100, 200, 400, and 800 pg/tube. Assay tubes were then vortexed for 1 min and incubated overnight at 4oC. Bound-free separation was performed by adding 500 l 5% charcoal / 0.5% dextran, pulse vortexing, and centrifuging the tubes at 2000 g for 30 min. 500 l of the supernatant was then drawn off and dilute d with 5 ml of scintillation cocktail, and counted on a Beckman LS 5801 scintillation c ounter. Hormone concentrations were determined using commercially available software (Microplat e Manager 4.0, Biorad, Hercules, CA, USA). Because we were primarily concerned with total steroid

PAGE 77

65 production, and the entire gonad is in cluded in the GAM, values for in vitro steroidogenesis were reported on a per paired GAM basis as opposed to per mg of tissue. Thyroid culture media was assayed for thyroxin (T4) as previously validated for alligators (Crain et al., 1998a). Briefly, 100 l of culture media was combined with 300 l borate buffer containing BSA and -globulin for a final con centration of 1 and 0.4%, respectively. Then 100 l antibody (Endocrine Sciences, Ta rzana, CA, USA) in borate buffer was added at a 1:400 diluti on. Finally, 50,000 cpm of L-[125I]-thyroxin (NEN Life Science Products, Inc., Boston, MA, USA) was added in 100 l borate buffer for a final volume of 600 l. Standards in fresh culture me dia were similarly prepared at concentrations of 50, 100, 200, 400, 800, 1600, 3200, 6400, and 12800 pg / 100 l. Assay tubes were incubated at 37oC for 2 hours and 25oC for 1.5 hours. Separation of bound vs. free hormone was performed by adding 1.5 ml of 60% ammonium sulfate (aq), centrifuging at 1500 g for 30 minutes, then pourin g off the supernatant. This process was repeated using 2.0 ml of 9:11 saturated amm onium sulfate:0.5% BSA in borate buffer. Remaining radioactivity was counted on a Beckman Gamma counter and unknown concentrations were determined using Mi croplate Manager 4.0 software (Biorad, Hercules, CA, USA). Histology One GAM and the thyroid from each animal was embedded in paraffin, serial sectioned at 6 m, and stained using a modified Masson’s trichrome (Presnell and Schreibman, 1997). Two independent observers examined each GAM for presence of testicular or ovarian tissue. Histological determination of sex was established using criteria described by Forbes (1940) and mo re recently Smith and Joss (1993).

PAGE 78

66 Morphological analyses of seminiferous t ubules (ST) and thyroids were performed using Scion Image Beta 4.0.2 (Scion Corporati on, Frederick, MD, USA). Digital images (200x) of cross-sections were taken of twel ve STs per male and six thyroid follicles per animal evenly distributed throughou t the serial sections of the entire tissue. For example, every fourteenth cross-section would be analyzed from a thyroid consisting of 85 serial sections. The diameter of the STs was measured as an indicator of testicular development. For each thyroid follicle, four epithelial cell heights (ECH) and the colloid area (CA) of the follicle were recorded as an indicator of thyroid activity. Statistics All statistical analyses were perfor med using StatView for Windows (SAS Institute, Inc, Cary, NC). Initial comparis ons were made to determine if EtOH treated animals differed from untreated controls for a ll analyses. Chi squared tests were used to determine if toxaphene exposure affected sex determination at either incubation temperature. Analyses of variance (ANO VA) of morphological traits and hormone concentrations were used to compare toxaphene -treated neonates with controls within an incubation temperature. Due to the signifi cance of negative results in toxicological studies, p-values are reported for all statis tical tests. Whenever significant variation existed among treatment groups, Fisher’s prot ected least-significant difference was used to compare treatment groups to controls. Results Ethanol Treatement and Sex Determination EtOH treatments had no effect when compared to untreated controls for any of the endpoints examined, therefore EtOH-treated a nd untreated controls were combined for pair-wise comparisons to toxaphe ne-treated alligators. No di fference in sex ratios could

PAGE 79

67 be detected among treatment groups and controls at 32oC (p = 0.853). At 32oC, 83% of the controls were females whereas female s made up 83, 76, and 70% of the high, medium and low-dose toxaphene-treated an imals, respectively. At 33.5o C, all animals developed as males regardless of treatment group. Due to the small number of males at 32oC and to eliminate the potential effects of incubation temperature and/or sex, further statistical comparisons were conducted among either 32oC females or 33.5oC males. Morphology No differences in morphological indices of body or organ size could be detected among treatment groups for BM, SVL, liver mass, and thyroid mass. Means and p-values are reported for females and males in Tabl e 5-1. Paired GAM mass did not differ among male or female treatment groups (Table 52), and presented no obvious pathologies. Ovaries were identified by the presence of lacunae in the medulla and germ cells in the hypertrophied cortex, whereas ST proliferation and a reduced cortex characterized testes. No difference in ST diameter could be de tected among males. Thyroids primarily consisted of colloid filled follicles surrounded by a single, distinct layer of epithelial cells. ECH and CA of the thyroid did not differ among treatment groups for females or males. Means and p-values for ST diameter , thyroid ECH, and CA are also reported in Table 5-2 for males and females. Endocrinology In vitro T4 production did not differ among treatment groups for females or males. No differences could be detected in plasma E2 (p = 0.68) or in vitro E2 production (p = 0.573) among females (Figure 5-1). In males, plasma T concentrations were significantly different (p = 0.028,) among treat ment groups with the middle (p = 0.006) and low (p = 0.017) dose treatment groups having greater circulating concentr ations than the controls

PAGE 80

68 (Figure 5-2A). Interestingly in vitro T (Figure 5-2B) did not di ffer among male treatment groups (p = 0.519) and mean T production did not reflect th e differences observed in plasma concentrations. Table 5-1. Morphological traits of male and female neonatal alligators incubated at 32o and 33.5oC. 32oC Females 33.5oC Males Trait Mean + S.E. P-value Mean + S.E. P-value Body Mass (g) 52.38 + 0.51 0.957 53.18 + 0.52 0.874 SVL (cm) 13.39 + 0.05 0.594 13.31 + 0.04 0.168 Liver (mg) 1038.9 + 14.5 0.868 1081.6 + 12.6 0.733 Thyroid (mg) 6.2 + 0.3 0.978 5.8 + 0.2 0.646 No differences were detected among treatment groups so means were combined for toxaphene-treated and control an imals. P-values are reporte d for analysis of variance among treatment groups within each incubation temperature. Table 5-2. Paired gonad-adrenal-mesonephros (GAM) mass, seminiferous tubule (ST) diameter, thyroid epithelial cell height (ECH), colloid area (CA), and in vitro thyroxin (T4) production in male and female neonatal alligators incubated at 32o and 33.5oC. 32oC Females 33.5oC Males Trait Mean + S.E. P-value Mean+ S.E. P-value Paired GAM (mg) 39.7 + 0.6 0.871 31.6 + 0.5 0.405 ST diameter ( m) NA NA 43.2 + 0.587 Thyroid ECH ( m) 7.6 + 0.2 0.078 7.9 + 0.1 0.809 Thyroid CA ( m2) 1595.9 + 81.4 0.941 1735.4 + 82.0 0.555 In vitro T4 (pg/ml) 66474.7 + 5784.00.212 63732.6 + 4379.0 0.663 No differences were detected among treatment groups so means were combined for toxaphene-treated and control an imals. P-values are reporte d for analysis of variance among treatment groups within each incubation temperature. Discussion These results suggest that toxaphene does not have a profound impact on morphological development of the gonad or t hyroid in alligators at the concentrations used. Gross morphological measurements do not examine specific mechanisms of action, but rather serve as final endpoints fo r numerous physiological processes (e.g., metabolism, mitosis, differentiation, etc.). Of the morphological endpoints examined,

PAGE 81

69 Figure 5-1. (A) Plasma estradiol-17 (E2) concentrations and (B) in vitro E2 production (means + S.E.) in female neonatal alligators following in ovo toxaphene exposure. Sample size is shown for each treatment group.

PAGE 82

70 Figure 5-2. (A) Plasma testoster one (T) concentrations and (B) in vitro T production (means + S.E.) in male neonatal alligators following in ovo toxaphene exposure. Sample size is shown for each treatment group. *, significantly different from control group (p < 0.05).

PAGE 83

71 perhaps it is most surprising that liver mass was not affected following toxaphene exposure. Hedli et al. (1998) reported an increase in liver mass, and total hepatic cytochrome P450 (CYP) in CD1 mice following or al administration of toxaphene. In the yellowtail flounder ( Pleuronectes ferrugineus ) toxaphene has been shown to alter lipid composition in the liver (Scott et al., 2002) and increase storage of to tal and neutral lipids in isolated hepatocytes (Fhrus-Van R ee and Spurrell, 2000). Because exposure occurred as a single episode during early de velopment, it is possible that the liver recovered from any effects on morphology; sub-ce llular responses, if an y, may have been induced and could help explai n the differences in plasma T concentrations observed. Possible mechanisms of altered plasma ster oid concentrations include alterations of hypothalamic-pituitary stimulation, steroi dogenic enzyme expression, and hepatic biotransformation (metabolism and clearanc e). That we did not see a monotonic dose response is not an uncommon phenomenon wh en measuring physiological response to environmental contaminants. One general explanation of nonmonotonic dose response involves the stimulation of feedback response systems that are antagoni stic to the initial response (NRC, 1999). For example, if the ini tial response to toxaphene at low doses is an increase in plasma T, the antagonistic feedback response could be decreased hypothalamic-pituitary stimulation or increased hepatic metabolism once plasma T reaches a critical concentration. The in vitro gonad culture was used as an indication of steroidogenic enzyme activity in the gonad at the time of dissection. Previous research has shown that the gonads of hatchling and juvenile alligators respond to gonadotropin stimulation (Guillette et al., 1995b; Edward s et al., 2004). Because no gonadotropic stimulant was used during the tissue culture, enzyme activity is assumed to be representative of recent in vivo hypothalamic-pituitary stimulation, or lack thereof.

PAGE 84

72 While toxaphene exposure at the middle and low doses increased circulating T concentration in males, the in vitro data suggest gonadal synt hesis was not directly affected. However, the tissue culture, which used progesterone as a precursor substrate, did not account for several of the rate determining steps of steroidogenesis including the intramitochondrial transfer of cholesterol to the P450scc enzyme, the side-chain hydrolysis of cholesterol, or action of 3 -hydroxysteroid dehydrogenase (HSD) on pregnenolone. Future work should focus on the steroidogenic pathway prior to progesterone synthesis, steps that are known to be rate limiting a nd affected by environmental contaminants (Walsh et al., 2000b; Walsh and Stocco, 2000). On the other hand, it is entirely possible that the discord between plasma T and in vitro T production could be explained by altered hepatic metabolism of T in exposed animals. Gunderson et al. (2001) has shown differences in hepatic metabolism of andr ogens among alligator populations from sites with varying levels of contamination. Studies of toxaphene’s binding affinity for st eroid receptors indicate that it is not as hormonally active as other organochlorine compounds tested. In rainbow trout, toxaphene did not bind to the tr out estrogen receptor and had no affinity for testosterone or cortisol receptors (Knudsen and Pottinger, 1999). Vonier et al . (1996) demonstrated that toxaphene was unable to displace native steroid from either the progesterone or estrogen receptor in alligators. Furthermore, toxaphene doe s not induce vitellogenesis, a common indicator of estrogenic activity, in carp hepatocytes (S meets et al., 1999). A few studies have found limited toxaphene binding affi nity for steroid receptor in some cell lines; however, the overwhel ming evidence seems to support the case for limited hormonal activity at the level of the receptor.

PAGE 85

73 An important consideration of this study is that technical grade toxaphene was used, whereas environmental exposure in wild life is more likely to involve toxaphene metabolites that differ in structure and compositi on from the chemical used in this study. In addition, the topical applic ation most likely results in a conservative estimate of effective dose. Meaning that the amount of toxaphene eac h embryo was actually exposed to is likely lower than the amount applied to the surface of the eggs hell. Podreka et al. (1998) found that 34% of the 1,1-dichloro-2,2-bis( p -chlorophenyl)ethylene (DDE) applied to turtle eggs was absorbed into th e egg, and only 8 % was incorporated into the embryo. An alternative to topica l application is to inject the contaminant directly into the egg. At this point it is not known if this approach will result in an unacceptable occurrence of embryonic mortality in this sp ecies, and warrants further investigation. The significance of this study is that technical grade toxaphene was unable to induce developmental abnormalities similar to th ose reported in alligators living in a lake contaminated with a variety of organochlorine contaminants. In fact, the increase in plasma testosterone in toxaphene-treated ma les is opposite of what has been documented in juvenile alligators from Lake Apopka when compared to males from a reference population (Guillette et al., 1994). Since toxaphe ne is found in very high concentrations relative to other organochlori ne concentrations in Lake Apopka alligator eggs, it was important to characterize any effects toxaphene alone might have on embryonic development. At this time, it is unclear how embryonic and environmental exposure to a mixture of compounds including toxaphene me tabolites will affect development in alligators, but should be the subj ect of future investigations.

PAGE 86

74 CHAPTER 6 PERSISTENT ALTERATIONS IN STER OIDOGENIC ENZYMES AND INCREASED POST HATCHING MORTALITY ASSOCI ATED WITH ALLIGATORS FROM A CONTAMINATED ENVIRONMENT Introduction Alterations in circulating steroid concentrations are commonly associated with aquatic vertebrates exposed to endocrine-disrupting contaminants (EDCs). Depressed plasma androgens and / or elevated estradiol-17 (E2) are often characteristic of males exposed to antiandrogenic or estrogenic xe nobiotics. For example, summer flounder ( Paralichthys dentatus ) experimentally exposed to E2, o,p’-DDT and octylphenol all exhibited reduced plasma testosterone (T) (M ills et al., 2001). The octylphenol-exposed males also had elevated plasma E2 concentrations (Mills et al., 2001). In white sturgeon ( Acipenser transmontanus ) from the Columbia River, WA, plasma T and 11ketotestosterone (11-KT) concentrations were negatively correlated with p,p’-DDE levels found in the liver (Foster et al., 2001). Largemouth bass ( Micropterus salmonoides ) living downstream from a coal-f ired electric plant and a chemical manufacturing plant in the Escambia River, FL, had lower plasma T concentrations than fish from a nearby reference site (Orlando et al ., 1999). In mosquitofish ( Gambusia holbrooki ), whole body T concentrations were lower in males from highly contaminated Lake Apopka compared to Lake Orange (a reference site) during the month of January, when T and E2 concentrations normally peak (Toft et al., 2003). Similar alterations in circul ating steroid concentrations have been reported in aquatic vertebrates other than fish. When e xposed to 25 ppb atrazine , the African clawed

PAGE 87

75 frog ( Xenopus laevis ) exhibited a 10-fold decrease in T concentrations (Hayes et al., 2002). Several studies that compared steroi d concentrations in American alligators ( Alligator mississippiensis ) from multiple Florida lakes have shown that plasma T is depressed in alligators from lakes contaminated with orga nochlorine pesticides and organic nutrients (Guillette et al., 1994; Crain et al., 1998a; Guillette et al., 1999b; Gunderson et al., 2004). Furthermore, ma le and female alligators from highly contaminated Lake Apopka exhibited elevated plasma E2 when compared to alligators from a reference population, Lake Woodruff Na tional Wildlife Refuge (NWR) (Crain et al., 1998a; Guillette et al., 1999b; Milnes et al., 2002). As discussed in Chapter 1, there are nume rous potential mechanisms for altering circulating steroid concentrati ons including changes in synthesi s, availability of transport binding proteins, and hepatic degradation. The focus of this study is on gonadal steroidogenesis. The numerous cases docum enting alterations in circulating steroid concentrations has led resear chers to examine steroidogene sis in contaminant-exposed vertebrates. Steroidogenes is (Figure 6-1) is the biochemical pathway by which cholesterol is initially co nverted to the 21-carbon (C21) steroid pregnenolone by the cytochrome P450 (CYP) enzyme designated side chain cleavage (CYP11A1 or SCC). Pregnenolone is then converted by a seri es of hydroxysteroid dehydrogenases and CYP enzymes to mineralocorticoids and glucocortico ids in the adrenal glan ds (not shown) or sex steroids such as C19 androgens and C 18 estrogens in the gonads (Miller, 1988; Norris, 1997). The majority of research on steroidogenesis has focused on enzymes downstream from the conversion of chol esterol to pregnenolone such as 3 hydroxysteroid dehydrogenase (3 -HSD) and various CYP enzymes such as 17 hydoxylase / 17,20 lyase (CYP17 or 17 -hydroxylase) and aromatase (CYP19). These

PAGE 88

76 studies generally rely upon whole tissue or steroidogenic tissue homogenates incubated in culture medium supplemented with a ster oid substrate such as progesterone or androstenedione. Following incubation, ster oids downstream from the substrate are measured in the culture medium as an indica tor of relative activ ity of the corresponding enzyme(s). Figure 6-1. The steroidogenic pathway associated with sex steroid production. Adapted from Norris (1997).

PAGE 89

77 The steroidogenic pathway appears to be affected by numerous compounds, including herbal supplements, pharmaceuticals, pesticides, and industrial contaminants. For example, exposure to the phytoestrogen ge nistein resulted in d ecreased testicular T production in medaka with a comparable reduc tion in plasma T concentration (Zhang et al., 2002). Similarly, goldfish exposed to bl eached sulfite mill effluent showed a reduction in testicular T and 11KT synthesis when compared to control males (Parrot et al., 1999). In alligators obtained from eggs collected from Lake Apopka, Guillette et al. (1995b) found elevated testicular E2 production in males and lower ovarian E2 production in females compared to animals from a reference population, Lake Woodruff NWR. Some studies have shown alterations in activ ity of specific enzymes. For instance, the enzyme responsible for the conversion of andr ogens to estrogens, aromatase, is usually expressed in a sexually dimorphic manner in various tissues incl uding the gonads, liver, and brain. The herbicide atrazine was show n to increase gonadal aromatase activity in male alligators to levels similar to control females following embryonic exposure (Crain et al., 1997). Noticeably absent from previous studies relating contaminant exposure to altered steroid concentrations in non-ma mmalian systems, are studies of the transcription factors and proteins involved in regul ating steroidogenesis prior to the conversion of cholesterol to pregnenolone. Steroidogenic factor-1 (SF-1) is a member of the nuclear receptor superfamily. It is directly involved in regulating transcrip tion of the 3-hydroxy-3methylglutaryl-CoA (HMG-CoA) synthase gene , which is necessary for the synthesis of cholesterol (Mascaro et al., 2000). Furtherm ore, it has been shown to bind to the promoter region of the cholesterol SCC gene in association with hormonally regulated steroidogenesis (Hu et al., 2004). Although cholesterol SCC is the first chronically

PAGE 90

78 regulated step in the steroidogenic pathway, it s activity is limited by the availability of intramitochondrial cholesterol. The steroi dogenic acute regulatory protein (StAR) is responsible for mediating the transfer of cholesterol fr om the outer to the inner mitochondria membrane (Stocco and Clark, 1996). In mammalian systems, environmental contaminants have been shown to alter expression of the StAR gene and protein. Post-transcriptional disruption of StAR was observed following treatment of MA-10 (mouse Leydig tumor) cells with the antifungal drugs econazo le and miconazole (Walsh et al., 2000a), whereas the insecticid es, Lindane (organochlorine) and Dimethoate (organophosphate) inhibit steroidogenesis by disrupting transcription of StAR mRNA transcription (Walsh and Stocco, 2000; Walsh et al., 2000c). Possibly related to effects on sex ster oid signaling, certain environmental contaminants have been shown capable of alte ring primary sex determination – especially in species with temperature-dependent sex determination (TSD). The egg incubation temperature during a particularly thermo-sensi tive period of development is the primary factor influencing the sex of reptiles with TSD. However, numerous studies have shown that natural and synthe tic steroids are capable of overriding the effects of temperature that typically produce both sexes or all males (Crews et al., 1994; Lance and Bogart, 1994; Wibbels and Crews, 1995). Two, well-characte rized model species fo r investigating the effects of EDCs on sex determina tion are the freshwater turtle, Trachemys scripta , and the American alligator. In both species, a number of organochlorine contaminants that have been detected in Lake Apopka alligator tissues have been shown to induce male to female sex reversal, including p,p’-DDE, p,p’-DDD, and trans -Nonachlor and chlordane (Crain, 1997; Matter et al., 1998; Ro oney, 1998; Willingham and Crews, 1999). Furthermore, a previous study comparing neona tal alligators incubated at a temperature

PAGE 91

79 that produces both sexes resulted in 76% fe males from Lake Apopka compared to 60% from Lake Woodruff NWR (Chapter 2). While a host of studies provide evidence that environmental contaminants are associated with alterations of the endocrine system, few have looked at the persistence of contaminant-induced effects on the endocrine system of non-mammalian vertebrates. In particular, we know little about how embryoni c exposure to environmental contaminants manifests itself beyond neonatal development in long-lived species. The goal of this study is to examine the persis tence of contaminant-induced alterations in endocrine function and determine the mechanisms through which embryonic exposure to EDCs alter steroidogenesis in alligators at the mo lecular level. This will be accomplished by comparing mRNA expression of transcription factors (SF-1), regulat ory proteins (StAR), and enzymes (SCC, 3 -HSD, 17 -hydroxylase, and aromatase) involved in steroidogenesis in the gonads of juvenile alligators obtained as eggs from a highly contaminated site, Lake Apopka, to animals fr om a reference site, Lake Woodruff. In addition, we will examine endpoints previously examined in neonates from these two study sites (Chapter 2) or that are significant to embryonic exposure to EDCs, to include embryonic mortality, somatic indices, sex de termination, and post hatching mortality. Materials and Methods Egg Incubation and Tissue Collection Alligator eggs were collected from Lake Apopka and Lake Woodruff NWR under permits from the Florida Fish and Wildlif e Conservation Commission and US Fish and Wildlife Service in June 2001. At embryonic st age 19, the stage just prior to the thermosensitive period of sex determination, ten viable eggs from each of six clutches from both study sites were selected. Eggs were incuba ted as previously described (Milnes et al.,

PAGE 92

80 2004) at 32oC, a temperature known to produce males and females. Upon hatching, neonates were web-tagged with a unique identification number and maintained in greenhouse enclosures under natu ral light conditions for 13 mont hs at the University of Florida. Animals were fed commercial al ligator chow (Burris Mill and Feed, Inc., Franklinton, LA) ad libitum and water changes were performed every other day. Animals were checked each day for general health, and dead animals were immediately removed and placed in Bouin’s fixativ e for future determination of sex. Thirteen months post hatching body mass (B M) and snout-vent length (SVL) were determined to the nearest 1.0 g and 1.0 mm, resp ectively. Juveniles were euthanized with a lethal dose (0.5 mg/g BM) of sodium pent obarbital (Sigma, St. Louis, MO), and sex was determined under 10X magnification. Females were identified based upon the presence of an oviduct and the comparativ ely larger, textured, and light pink ovary, whereas the testis of males has a smooth, da rk red appearance. Gonads were removed, weighed to the nearest 1.0 mg, flash frozen in liquid nitrogen, and stored at -72oC. The thyroid, liver, and spleen were also removed and weighed to the nearest 1.0 mg as somatic indices of development. RNA Isolation and Primer Design The right gonad of each animal was hom ogenized in TRIzol reagent (Invitrogen, Carlsbad, CA) using 1 ml TRIzol for every 100 mg of tissue, and total RNA was isolated using a chloroform/phenol extraction. Th e aqueous phase was collected and RNA was precipitated in isoprop anol, washed in 80% ethanol, and dissolved in DEPC treated water. All samples were then purified usi ng the RNeasy kit (QIAGEN, Chatsworth, CA). Total RNA concentration was determined w ith a spectrophotometer and the quality of each sample was verified on an agarose gel. First strand cDNA synt hesis was carried out

PAGE 93

81 on 1.2 g total RNA in the presence of SuperScript II RNase HReverse Transcriptase and Oligo (dT) 12-18 Primer (Invitrogen). Nucleotide sequences for alligator SF-1 (Accession No. AY029233) and aromatase (Accession No. AF180296) have been reported elsewhere (Western et al., 2000; Gabriel et al., 2001). A partial sequence fo r StAR (Accession No. AB186356) was kindly provided by S. Kohno (University of Florida, Dept. of Zoology). Gene sequences of three key enzymes in the steroidogenic pathway were not available prior to this work. We generated partial sequences using dege nerative oligonucleotides derived from conserved regions of these genes from other species as PCR primers to amplify fragments of the alligator SCC, 3 -HSD, and 17 -hydroxylase genes (Table 6-1). Amplified fragments were sequenced using the ABI PRISM 3100 and BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Foster Ci ty, CA), and checked for nucleotide and amino acid homology using BLAST (http:// www.ncbi.nlm.nih.gov/BLAST/). Real-time PCR primers were designed using Primer Expr ess (Applied Biosystems), and are reported in Table 6-2. Quantitative Real-Time PCR Quantitative real-time PCR (Q-PCR) was performed using SYBR Green PCR Master Mix in the ABI Prism 5700 (Applie d Biosystems) following manufacturer’s protocol in a reaction volume of 15 l as previously described by our lab (Katsu et al., 2004). Conditions for Q-PCR were 2 min at 50C, 10 min at 95C, and 40 cycles of 95C for 15 sec, 60C for 1 min. The relative expression of mRNA in each sample was calculated from a standard curve obtained from a serially diluted, pooled sample. Each sample was run in triplicate and normalized fo r the expression of ribosomal L8 (Katsu et al., 2004).

PAGE 94

82 Table 6-1. Forward and reverse degenerativ e primers used to amplify fragments of cholesterol side chain cleavage (SCC), 3 -hydroxysteroid dehydrogenase (3 HSD), and 17 -hydroxylase / 17,20 lyase (17 ) in alligator gonad RNA. Gene Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’) Product Size (bp) (Accession No.) SCC TWTGGBCCCATYTACAGGGAGAA AKCATCTCGGTRACRYTGGCCT 586 (DQ007995) 3 -HSD CTBGTCATCCACACDGCTTC TGWGCCTTTYTGTAGGAGAA 596 (DQ712232) 17 CCCNTGGCTNMAGATHTTCCCCA CCAGGAAGAGGAAGAGCTCC 624 (DQ007997) Table 6-2. Forward and reverse primer s used for quantitative real-time PCR. Gene Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’) Product Size (bp) SF-1 CAGTCTCGATGTGAAATACCTGGA CGCGTTGGCCTTCTCCT 67 StAR GTTGGACCGCGAGATTTTGT TGTTGAGCCGCGTCTCTTAGT 54 SCC TCTGGAGTCAGTGTGCCATGTC TCATGCTCACCGCATCGAT 101 3 -HSD GTGATCCCATCTGCAATGGTG CCATCTGCCTTCAGGACATGTT 109 17 CCAGAAAAAGTTCACCGAGCAC CGGCTGTTGTTGTTCTCCATG 108 Aromatase CAGCCAGTTGTGGACTTGATCA TTGTCCCCTTTTTCA CAGGATAG 79 Statistical Analysis The SAS System for Windows version 9.0 (SAS Institute Inc., Cary, NC) was used for all analyses. Hatching success, sex ratios , and post hatching mortality were compared between lakes using chi-square tests. Meas urements of body size and organ weights were log transformed to reduce heterogeneity of va riance (Sokal and Rohlf, 1995). An initial one-way analysis of variance (ANOVA) was used to determine if sexual dimorphism was present in any of the somatic indices within each lake prior to comparing means between

PAGE 95

83 lakes. No sexual dimorphism was detected for BM, SVL, liver, thyroid, or spleen mass (all P s > 0.05); so males and females were combin ed for those variables. Both SVL and BM varied between lakes, therefore thyroi d, liver, and spleen mass were compared between lakes using BM as a covariate. Relative expression of each steroidogenic gene, expressed as a ratio with L8, was arcsin transformed prior to two-way ANOVA (lake x sex). When overall variation was significant ( P < 0.05), least square means were analyzed using Tukey-Kramer post-hoc comparisons. Results Mortality and Sex Determination Embryonic and post-hatching mortality are summarized in Figure 6-2. Eggs from Lake Apopka produced 48 viable hatchlings out of 60 eggs, whereas Lake Woodruff NWR produced 54. This difference wa s not statistically significant ( P = 0.125). However, following 13 months under standard ized conditions, the percentage of posthatching mortality was significantly higher among Lake Apopka animals compared to those from Lake Woodruff NWR ( P < 0.0001). An overall differe nce in sex ratios was detected between study sites ( P = 0.049). The female biased sex ratio from Lake Woodruff NWR (33:21 female:male) and a male biased sex ratio from Lake Apopka at hatching (20:28, female:male) was exacerbated by female biased post-hatching deaths. As a result, Lake Apopka was represented by 8 females and 19 males at the time of necropsy, and Lake Woodruff NWR was re presented by 33 females and 19 males.

PAGE 96

84 Figure 6-2. Embryonic and post hatching mortal ity up to 13 months of age. Asterisk denotes significant difference between lakes ( P < 0.05). Body Size and Somatic Indices Snout-vent length and BM (Figure 6-3) we re greater in Lake Apopka juveniles compared to Lake Woodruff NWR ( P = 0.0003 for SVL and BM). No differences were detectable in thyroid ( P = 0.716), liver ( P = 0.593), and spleen ( P = 0.947) mass. Figure 6-3. Mean (+ SE) snout-vent length (SVL) a nd body mass (BM) in 13-month old alligators. Asterisk denotes sign ificant difference between lakes ( P < 0.05).

PAGE 97

85 Steroidogenic Gene Expression Lake Woodruff males exhibited higher levels of gene expression for SF-1 ( P = 0.039) and StAR ( P = 0.027) than Lake Apopka males, whereas no differences were detected between females (Figure 6-4). J uveniles from Lake Woodruff NWR exhibited sexual dimorphic expression of all genes ex amined (Figures 6-4 through 6-6), whereas only 17 -hydroxylase and aromatase (Figure 66) were expressed in a sexually dimorphic pattern in juveniles from Lake Apopka. Expression of SF-1 and StAR in Apopka males appeared slightly feminized in that male expression wa s not different than females from either lake. In contrast, no di fferences could be dete cted in expression of SCC and 3 -HSD in females from Lake Apopka when compared to males from either lake (Figure 6-5). Males typi cally displayed 0.5 – 3 times higher expression levels of all genes with the exception of aromatase, which was nearly 40-fold grea ter in females than males from both lakes. Discussion Although there was no statistical difference in embryonic mortality, the percentage of eggs that gave rise to viable hatchlings from each study site was remarkably similar to previous results (Chapter 2). As previously mentioned, thes e represent eggs that appear viable at the end of the firs t third of development (stage 19), as indicated by a highly vascularized, opaque band where the extraemb ryonic membranes have attached to the inner egg shell membrane. The slightly hi gher incidence of embryonic mortality in Apopka alligators combined with a greater in cidence of post hatching mortality resulted in the loss of 55% of the individuals from Lake Apopka compared to 13% in alligators from Lake Woodruff NWR at 13 months of age. There was no obvious cause or commonly observed symptoms related to post hatching deaths, which occurred

PAGE 98

86 sporadically throughout the 13 months, And although slightly skewed towards females, there was no detectable difference in the percentage of each sex that died from Lake Apopka. Figure 6-4. Mean (+ SE) expression of (A) SF-1 a nd (B) StAR in 13-month old alligators. Bars with di fferent superscripts are si gnificantly different at P < 0.05.

PAGE 99

87 Figure 6-5. Mean (+ SE) expression of (A) SCC and (B) 3 -HSD in 13-month old alligators. Bars with di fferent superscripts are si gnificantly different at P < 0.05.

PAGE 100

88 Figure 6-6. Mean (+ SE) expression of (A) 17 -hydroxylase and (B) Aromatase in 13month old alligators. Bars with diffe rent superscripts are significantly different at P < 0.05. Based on previous work with contamin ants found in Lake Apopka eggs, we expected a greater percentage of females from Lake Apopka when compared to Lake Woodruff NWR. Similar to previously descri bed sex ratios (Chapt er 2), Lake Woodruff clutches resulted in 61% fema les. In contrast, Lake Apopka clutches produced 41% females compared to 76% females reporte d in Chapter 2. Th ese ratios include individuals that died after hatc hing but prior to 13 months of age, but not individuals that

PAGE 101

89 died prior to hatching. The possibility ex ists that eggs highest in contaminant concentrations, hence more likely to result in female hatchlings, are also most likely to fail to produce a viable hatchling. Furthermore, there appears to be a strong clutch effect on sex ratios following incubation at intermedia te temperatures (Bull et al., 1982), and an association between maternally derived yolk st eroids and sex determination in some TSD species (Janzen et al., 1998; Bowden et al ., 2000). Conely et al. (1997) described significant annual and inter-clutch variation in alligator egg yolk steroid concentrations from Louisiana, with a significant decrease in concentrations coinciding with the thermosensitive period of sex determination. Theref ore, an examination of egg yolk steroids in association with inter-clutch variation in sex ratios is warranted for future studies. That SVL and BM were greater in Lake Apopka hatchlings compared to Lake Woodruff NWR was not expected as the anim als were raised under identical conditions and previous work has shown Lake Apopka neonates were the same size or smaller than those from Lake Woodruff (Milnes et al., 2001 ; Chapter 2). One po ssible explanation is that only the most robust i ndividuals from Lake Apopka we re represented at 13 months of age, thus biasing the estimate of mean si ze. Another possibility is that endocrine function related to metabolism and growth su ch as thyroid function or growth hormones are differentially affected in animals from Lake Apopka. Alterations in the relationship between size and thyroxine (T4) concentrations have been s hown in juveniles from Lake Apopka compared to Lake Woodruff NWR (Cra in et al., 1998a), and variation in T4 concentration was reported in juvenile alliga tors from several sites in central Florida (Bermudez et al., In press) and the Everglades drainage basin (Gunderson et al., 2002) varying in pesticide and nutrient contamina tion. Thyroid morphology and relevant gene expression in these animals is currently be ing examined for publication elsewhere.

PAGE 102

90 Expression of SF-1 is typically positively correlated with st eroidogenic activity (Giguere, 1999), and StAR and SCC are regard ed as the acute and chronically regulated rate limiting steps in steroidogenesis, respec tively (Miller, 2002). We observed lower relative expression of mRNA for SF-1 and StAR in male alligators from Lake Apopka relative to Lake Woodruff NWR. Lower e xpression of SF-1 could reduce the synthesis of cholesterol or the activity of steroidoge nic enzymes such as cholesterol SCC, and lower expression of StAR could reduce the av ailability of choles terol to steroidogenic enzymes (see Figure 6-1). These results pr ovide a potential mechanism for previous studies that found lower plasma T concentratio ns in hatchling and juvenile males from Lake Apopka compared to Lake Woodruff NW R (Guillette et al., 1994; Crain et al., 1998a; Guillette et al., 1 999b; Gunderson et al., 2004). The generally higher expression of ster oidogenic genes in males compared to females, and the lack of sexual dimorphism in juveniles from Lake Apopka is consistent with reported circulating concentrations of sex steroids in juvenile alligators from these study sites (Guillette et al., 1999b). Our resu lts regarding expression of the aromatase gene are consistent with expected differences between sexes, but are contrary to previous studies showing elevated plasma E2 in males and females from Lake Apopka relative to Lake Woodruff NWR (Guillette et al., 1999b; Milnes et al ., 2002). Previous studies examining in vitro estradiol production or aromatase ac tivity in alligators from these two sites also show varying results. No differe nces in aromatase activity were reported in neonates from Lake Apopka a nd Lake Woodruff NWR (Chapter 2), whereas Guillette et al. (1995b) found lower E2 production in 6-month old fe male alligators from Lake Apopka relative to females from Lake Woodru ff. Similarly, Crain et al. (1997) observed depressed aromatase activity in 9-month ol d alligators from Lake Apopka compared to

PAGE 103

91 Lake Woodruff NWR. The apparent lack of reconciliation be tween circulating E2 and gonad aromatase activity could be indicat ive of the major regulatory sites of steroidogenesis occurring upstream in the ster oidogenic pathway. In other words, the availability of substrate to the aromatase enzyme, which is modulated by multiple genes, could be the limiting factor as opposed to tr anscription or translation of aromatase. It is important to emphasize that th ese results do not represent an acute, toxicological response to chem ical exposure, but rather a functional divergence at the organismal level to diverse embryonic environments. The specific mechanism of how embryonic exposure to environmental contaminants could permanently alter gene expression is not known. We offer three potenti al explanations for permanent changes in mRNA expression of steroidogenic genes. Firs t, a shift in homeosta tic regulation at the level of the pituitary or hypothalamus could le ad to differential stimulation of the gonads by gonadotropic hormones. Second, changes in the constitutive expression of receptors for gonadotropic hormones in steroidogenic tissues could alter secondary messenger stimulated induction of steroidogenesis. A nd lastly, differences in mRNA expression patterns could be explained by morphological alterations in steroi dogenic tissues. For instance, a reduction in the density of Leydig or granulosa cells would be perceived as a decrease in mRNA expression deri ved from whole gonad homogenates. The results of this study document pers istent differences in development and endocrine function between juvenile alli gators from a highly contaminated and a reference population. This is the first study to show alterations in mRNA expression patterns for steroidogenic genes in alligat ors associated with a contaminated environment. While highly sensitive and ge nerally predictive, qua ntification of mRNA expression is further modulated by post tr anscriptional and tran slational regulatory

PAGE 104

92 processes. Because this study focused on mRNA expression, caution must be observed in the interpretation of the data without reconciling them to enzyme activity and circulating steroid concentrations. Current studies are underway examining steroidogenic enzyme activity and plasma steroid concentrations in these animals. That these animals were raised under identical conditions in a controlled environment supports the hypothesis that embryonic exposure to environm ental contaminants results in permanent organizational alterations in endocrine functi on. That the differences between lakes did not necessarily parallel a similar study examining neonates from the same study sites suggest contaminant induced alterations can vary in phenotypic expression with ontogenetic development.

PAGE 105

93 CHAPTER 7 SUMMARY AND CONCLUSIONS Objectives and Results Over the last four decades increasing sc ientific evidence has demonstrated that many species have experienced severe declin es, local or global extinctions. Other populations have shown no obvious decline but individuals of those populations exhibit symptoms of stress resulting in reduced f ecundity, offspring survival and increased susceptibility to disease. Many exampl es have become common knowledge to the general public, such as worldwide declines in amphibian and shark populations and extensive loss of cora l reefs. The mechanisms underl ying these and other changes are poorly understood, yet these declines are cl early the result of complex phenomena involving human influences, including wi de scale environmental pollution. A small group of scientists, from numer ous disciplines, met in 1991, and generated a consensus statement which included the following: “We are certain of the following: A large number of man-made chem icals that have been released into the environment, as well as a few natural ones, have the potential to disrupt the endocrine system of animals, including humans” (Colborn and Clement, 1992). Since that declaration, a wide array of chemical contaminants has been document ed to disrupt normal endocrine function, termed endocrine disrupting contaminants or EDCs. EDCs disrupt the normal cell-to-cell signaling required for development, growt h, and reproduction among other activities in vertebrates and invertebrates alike (Guillette and Crain, 2000). Chemicals, with the potential to disrupt the e ndocrine system, function thr ough a variety of mechanisms.

PAGE 106

94 This dissertation briefly in troduced the concept of EDCs in Chapter 1 and went on to test a number of hypotheses. Specifica lly, I provided a brief review of documented associations between exposure to anthr opogenic contaminants and alterations in endocrine function, sexual differentiation, and reproductive success in a variety of taxa, including the alligators of Lake Apopka. Fi gure 1-1 offered the conceptual approach to investigating ‘organizational’ disruption in the alligator relevant to morphological and physiological differences reported in juvenile alligators living in La ke Apopka relative to Lake Woodruff National Wildlife Refuge (NWR ). The overall objectives were (1) to determine what endpoints related to sexual differentiation and gonadal endocrine function are susceptible to perturbation by endocrine -disrupting contaminants (EDCs) during embryonic development, and (2) to characte rize the persistence of these alterations beyond neonatal development. The following th ree hypotheses were tested to achieve the objectives. 1. Developmental differences related to se xual differentiation and endocrine function exist in neonatal alligators from Lake Apopka relative to a re ference site, Lake Woodruff NWR. 2. Experimental in ovo exposure to selected EDCs will induce developmental alterations in neonatal alligators from a reference population similar to those described in neonates from Lake Apopka. 3. Differences in endocrine function induced by the embryonic environment persist in juvenile alligators. Figure 7-1 summarizes some of the effect s observed in neonatal alligators exposed naturally or experimentally in ovo to various environmental contaminants. The initial study (Chapter 2) established basic indices of developmen tal differences present in neonatal alligators from Lake Apopka prior to environmenta l exposure to contaminants. Snout-vent length (SVL) and body mass (BM) were significantly sma ller in Lake Apopka

PAGE 107

95 alligators, and neonates from Lake Apopka exhibited higher plasma testosterone (T) concentration compared to Lake Woodruff. Phallus tip length and cuff diameter was smaller in males from Lake Apopka, wher eas no differences were noted in oviduct epithelial cell height (ECH). Previous studies have examined alligators 6 mo after hatching or as juveniles two to three years of age. These studies observed similar results for penis size but males displayed signifi cantly lower plasma concentrations of testosterone (Guillette et al., 1994; 1999a; 1999b). These data suggest that a relatively complex ontogenic response is occurring (see below). Figure 7-1. Observed developmental alterati ons resulting from embryonic exposure to estrogenic and anti-androgenic environmental contamiants.

PAGE 108

96 A number of environmental contaminants are known to induce female development at male-producing egg incubation temperatures in alligator embryos (Guillette et al., 2000), and interact with the alligator estr ogen receptor (aER) (Vonier et al., 1996; Guillette et al., 2002). In chapte r 3, the effects of estradiol (E2) induced sex reversal on aromatase activity in the brains and gonads of embryonic alligators were described. Exposure to E2 at normally male-producing temper atures resulted in females that exhibited gonadal aromatase activity intermediate to control males and females. Interestingly, brain aromatase activity exhibited the masculin ized pattern, suggesting that temperature remained a dominant force in c ontrolling the expression of this enzyme in the brain. These data suggest that regulati on of the activity of various enzymes in the steroidogenic pathway, in this case, aromatase, is apparently unde r complex regulation by hormones and abiotic factors, such as temperature. Chapters 4 and 5 examined the two or ganochlorine (OC) pesticide derived contaminants found in the highest concentrati on in either serum or egg yolk samples from Lake Apopka, p,p’-DDE and toxaphene. The positive estrogenic control, E2, elicited an increase in the percentage of females pr oduced at a dose of 100 and 0.1 parts per billion (ppb) at the intermediate temperature (32oC) and 100 ppb at the all male producing temperature (33.5oC). A female biased sex ratio wa s observed among hatchlings exposed to p,p’-DDE at 100 ppb, whereas no effect on sex determination was observed for p,p’DDE at the all male producing temperatur e or any dose/temperature combination of toxaphene. Both p,p’-DDE and E2 failed to influence plasma T concentration, however plasma T concentration was higher in anim als treated with 10 and 0.01 ppb toxaphene than control males. These data demons trate that gonadal diffe rentiation is highly sensitive to chemical perturbation relative to the other endpoints examined, and that the

PAGE 109

97 interaction of dose and temperat ure should be taken into acco unt in future studies. The toxaphene-induced increase in plasma T is cons istent with differences observed between neonates from the two study sites, but most of the results from the treatment studies show that the application of singl e compounds will not induce the same suite of developmental abnormalities described in alligators from La ke Apopka. That is, alligator eggs from Lake Apopka have tens, if not hundreds, of xe nobiotic chemicals in the yolk as well as endogenous hormones, such as E2, deposited in the oocyte during oogenesis. The interaction of these compounds will lead to various phenotypes, although many of the morphological and physiological abnormalities re ported previously and in these chapters, such as alterations in steroi dogenesis, appear consistently over the last 15 years of study. Chapter 6 revisited various morphological and life history endpoints previously examined in neonates (Chapter 2) but related these endpoint s to markers of steroidogenesis at the molecula r level in juvenile alligato rs from Lake Apopka and Lake Woodruff NWR. The animals used in this st udy were raised in captiv ity under controlled conditions for 13 months, thus limiting po ssible confounding factors other than the embryonic environment. A male biased sex ratio and significant post hatching mortality was observed in alligators from Lake Apopka. Males from Lake Apopka exhibited lower mRNA concentrations for SF-1 and StAR—two genes coding for factors involved in the regulation of de novo steroidogenesis. In addition, juveniles from Lake Woodruff showed a sexual dimorphic pattern of expre ssion for all genes examined, whereas Lake Apopka exhibited no sexual dimor phism for SF-1, StAR, SCC, or 3 -HSD. These data establish persistent a lterations in development and endoc rine function between juvenile alligators from a highly contam inated and a reference population. That the differences

PAGE 110

98 between lakes were not parallel between neonates and juveniles suggest contaminantinduced alterations can vary in phenotypi c expression with ontogenic development. Significance and Perspective The direct results of this di ssertation provide further subs tantiation of alterations in development, survivorship, sexual differe ntiation, and endocrine function induced through embryonic exposure to environmental contaminants. Perhap s most significant are the data that establish evidence of persis tent changes in gene expression, presumably of maternal origin (e.g., genetics and cont aminant load), that could contribute to compromised reproductive success in the adul t. The organizational hypothesis, as it relates to EDCs and decreased reproductive success, states that the disruption of developmental processes results in perm anent alterations in morphology and/or physiology that ultimately compromise reproduct ive success. The alterations in gene expression related to steroidoge nesis shown in juvenile al ligators from Lake Apopka could potentially lead to a ltered reproductive physiology in adults. For example, a permanent decrease in the e xpression of transcription f actors or enzymes involved in androgen synthesis could result in abnorma l or decreased sperm production, territorial and courtship behavior —androge n driven processes in vertebrates. Likewise, permanent changes in ovarian steroid synthesis could be disruptive to the female reproductive cycle, which relies on seasonal fluctuations in estrogens for the timing of oogenesis among other processes. The success of any population, human or wildlife ultimately depends upon survival and successful reproduction as opposed to surv ival alone (Stearns, 1992). Alligators have adapted their reproductive strate gy to a type III survivorship curve, meaning they produce a large number of offspring with a low probability of surviv al. As individuals attain

PAGE 111

99 sexual maturity, the mortality rate decreases. Alligator populations in central Florida can withstand a loss of up to 50% of the estimated annual recruitment without a detectable decrease in population density, as evident by the monitored harvesting of eggs and hatchlings for commercial pur poses on selected lakes (Ric e et al., 1999). However, maintaining these populations over multiple generations is dependent on successful reproduction; that is, the production of sexua lly mature adults capable of producing viable offspring that can also attain sexual maturity. The Tower Chemical Company spill on Lake Apopka occurred in 1980. From 1983 to 1986 egg viability was at an all-tim e low (~20%) and the juvenile population declined from 1981-1987 (Woodward et al., 1993). This period of time could be indicative of the toxicological effects of contaminant exposur e in juveniles and adults. Since the initial decline, egg vi ability and the number of juve nile alligators has gradually increased (Masson, 1995; Rice et al., 1996). The current level of embryonic and post hatching mortality on Lake Apopka does not appear immediately detrimental to the population, however nothing is known concer ning the fecundity of newly recruited individuals. Continued monitoring of e gg viability and post hatching mortality are necessary to evaluate the reproductive su ccess of the current juvenile cohort. From an evolutionary perspective the co st of altered reproductive success in a species that takes 10 to 15 years to attain sexual maturity (Wilkinson and Rhodes, 1997) is difficult to predict. If the currently surv iving offspring are sele cted for traits that confer a resistance to contaminants, how do these traits contribute or detract from reproductive success? Although speculative, we could be observing the gradual recovery of Lake Apopka’s alligators in terms of population size, but simultaneously be reducing the heritable variation and ability to cope with future challe nges in a changing

PAGE 112

100 environment (see Fox, 1995). As more chemical s are identified that disrupt development, the charge for the current and future genera tions is to evaluate the consequences of altered embryogenesis in terms of future reproductive fitne ss. This undoubtedly will be particularly challenging in long-lived sp ecies such as humans or alligators.

PAGE 113

101 LIST OF REFERENCES Adams, S.E., Smith, M.H., Baccus, R., 1980. Biochemical variation in the American alligator. Herpetologica 36, 289-296. Andersen, H.R., Andersson, A.M., Arnold, S.F., Autrup, H., Barfoed, M., Beresford, N.A., Bjerregaard, P., Christiansen, L.B., Gissel, B., Hummel, R., Jorgensen, E.B., Korsgaard, B., Le Guevel, R., Leffers, H., McLachlan, J., Moller, A., Nielsen, J.B., Olea, N., Oles-Karasko, A., Pakdel, F., Pedersen, K.L., Perez, P., Skakkeboek, N.E., Sonnenschein, C., Soto, A.M., 1999. Co mparison of short-term estrogenicity tests for identification of hormone-disrupt ing chemicals. Environ. Health Perspec. 107 Suppl 1, 89-108. Andrews, J.E., Smith, C.A., Sinclair, A. H., 1997. Sites of estrogen receptor and aromatase expression in the chicken embryo. Gen. Comp. Endocrinol. 108, 182190. Bergeron, J.M., Gahr, M., Horan, K., Wi bbels, T., Crews, D., 1998. Cloning and in situ hybridization analysis of es trogen receptor in the deve loping gonad of the red-eared slider turtle, a species with temperat ure-dependent sex determination. Develop. Growth Diff. 40, 243-254. Bergeron, J.M., Willingham, E., Osborn, C.T., III, Rhen, T., Crews, D., 1999. Developmental synergism of steroidal es trogens in sex determination. Environ. Health Perspec. 107, 93-97. Bermudez, D.S., Milnes, M.R., Bryan, T. A., Gunderson, M.P., Tubbs, C., Woodward, A.R., Guillette, L.J., Jr., In press. Seasonal variation in plasma thyroxine concentrations in juvenile alligators ( Alligator mississippiensis ) from three Florida lakes. Comp. Biochem. Phys. A. Bern, H., 1992. The fragile fetus. In: Colbor n, T., Clement, C. (Eds.), ChemicallyInduced Alterations in Sexual and Functional Development: The Wildlife/ Human Connection, vol. 21. Princeton Scientific Publishing Co., Inc., Princeton, New Jersey, pp. 9-15 Bowden, R.M., Ewert, M.A., Nelson, C.E., 200 0. Environmental sex determination in a reptile varies seasonally and with yol k hormones.P. Roy. Soc. Lond. B Bio. 267, 1745-1749. Briggs, S.A., 1992. Basic Guide to Pesticides: Their Characteristics and Hazards. Taylor & Francis, Washington DC.

PAGE 114

102 Bull, J.J., Vogt, R.T., Bulmer, M.G., 1982. Heri tability of sex rati o in turtles with environmental sex determination. Evolution 36, 333-341. Burger, J., Gochfeld, M., Rooney, A.A., Woodward, A.R., Guillette, L.J., Jr., 2000. Metals and metalloids in tissues of American alligators in three Florida lakes. Arch. Environ. Contam. Toxicol. 38, 501-508. Burlington, H., Lindeman, V.F., 1950. Effect of DDT on testes and secondary sex characters of white leghorn cockerel s. Proc Soc Exp Biol Med 74, 48-51. Carson, R., 1962. Silent Spring. The Riverside Press, Cambridge. Cheek, A.O., Kow, K., Chen, J., McLachlan, J.A., 1999. Potential mechanisms of thyroid disruption: interaction of organochlorin e compounds with human thyroid receptor 1, thryroid hormone binding globulin, and tr ansthyretin. Environ. Health Perspec. 107, 273-278. Colborn, T., Clement, C., 1992. Chemically-indu ced Alterations in Sexual and Functional Development--The Wildife/Human Connecti on. In: Princeton Scientific Publishing Co., Princeton, NJ, p. 403 Colborn, T., vom Saal, F.S., Soto, A.M., 1993. Developmental effects of endocrinedisrupting chemicals in wildlife and hu mans. Environ. Health Perspec. 101, 378384. Conley, A.J., Elf, P., Corbin, C.J., Dubow sky, S., Fivizzani, A., Lang, J.W., 1997. Yolk steroids decline during sexual differen tiation in the alligator. Gen. Comp. Endocrinol. 107, 191-200. Cox, C., Guillette, L.J., Jr., 1993. Localizati on of insulin-like gr owth factor-I-like immunoreactivity in the reproductive tract of the vitellogenic female American alligator, Alligator mississippiensis . Anat. Rec. 236, 635-640. Crain, D.A., 1997. Effects of Endocrine-Disr upting Contaminants on Reproduction in the American Alligator, Alligator mississippiensis . Ph.D. Diss., University of Florida, Gainesville. Crain, D.A., Guillette, L.J., Jr., Pickford, D. B., Percival, H.F., Woodward, A.R., 1998a. Sex-steroid and thyroid hor mone concentrations in juvenile alligators ( Alligator mississippiensis ) from contaminated and reference lakes in Florida, USA. Environ. Toxicol. Chem. 17, 446-452. Crain, D.A., Guillette, L.J., Jr., Rooney, A. A., Pickford, D.B., 1997. Alterations in steroidogenesis in alligators ( Alligator mississippiensis ) exposed naturally and experimentally to environmental contam inants. Environ. Health Perspec. 105, 528533.

PAGE 115

103 Crain, D.A., Noriega, N., Vonier, P.M., Arnol d, S.F., McLachlan, J.A., Guillette, L.J., Jr., 1998b. Cellular bioavailability of natural hormones and environmental contaminants as a function of serum and cy tosolic binding factors. Toxicol. Indust. Health 14, 261-273. Crain, D.A., Spiteri, I.D., Guillette, L.J., Jr., 1999. The functional and structural observations of the neonatal reproductive system of alligators exposed in ovo to atrazine, 2,4-D, or estradiol. Toxicol. Indust. Health 15, 180-185. Crews, D., Bergeron, J.M., Bull, J.J., Flores, D., Tousignant, A., Skipper, J.K., Wibbels, T., 1994. Temperature-dependent sex dete rmination in reptiles: proximate mechanisms, ultimate outcomes, and practical applications. Dev. Genet. 15, 297312. Davis, L.M., Glenn, T.C., Strickland, D.C ., Guillette, L.J., Jr., Elsey, R.M., Rhodes, W.E., Dessauer, H.C., Sawyer, R.H., 2002. Microsatellite DNA analyses support an east-west phylogeographic split of Ameri can alligator populations. J. Exp. Zool. 294, 352-372. Desaulniers, D., Leingartner, K., Wade, M ., Fintelman, E., Yagminas, A., Foster, W.G., 1999. Effects of acute exposure to PCBs 126 and 153 on anterior pituitary and thyroid hormones and FSH isoforms in adul t Sprague Dawley male rats. Toxicol. Sci. 47, 158-169. Desvages, G., Pieau, C., 1992. Aromatase activ ity in gonads of turtle embryos as a function of the incubation te mperature of eggs. Steroid Biochem. Molec. Biol. 41, 851-853. Edwards, T.M., Gunderson, M.P., Milnes, M.R., Guillette, L.J., Jr, 2004. Gonadotropininduced testosterone response in peri pubertal male alligators. Gen. Comp. Endocrinol. 135, 372-380. Fhrus-Van Ree, G.E., Spurrell, D.R., 2000. Effect of toxaphene on isolated hepatocytes of the yellowtail flounder, Pleuronectes ferrugineus Storer. Ecotoxicol. Environ. Safety 46, 289-297. Ferguson, M.W.J., 1985. Reproductive biology an d embryology of the crocodilians. In: Gans, C., Maderson, P., Billet, F. (Eds.), Bi ology of the Reptilia, vol. 14. J. Wiley and Sons, New York, pp. 329-491 Ferguson, M.W.J., Joanen, T., 1983. Temperat ure-dependent sex determination in Alligator mississippiensis . J. Zool., Lond. 200, 143-177. Forbes, T.R., 1940. Observations on the deve lopment of the gonad, the adrenal cortex, and the Mullerian duct. Contrib. Embryol. 174, 131-163.

PAGE 116

104 Foster, E.P., Fitzpatrick, M.S ., Feist, G.W., Schreck, C.B., Yates, J., Spitsbergen, J.M., Heidel, J.R., 2001. Plasma androgen co rrelation, EROD induction, reduced condition factor, and the occurrence of or ganochlorine pollutants in reproductively immature white sturgeon ( Acipenser transmontanus ) from the Columbia River, USA. Arch. Environ. Contam. Toxicol. 41, 182-191. Fox, G.A., 1992. Epidemiological and pathobiol ogical evidence of contaminant-induced alterations in sexual development in freeliving wildlife. In: Co lborn, T., Clement, C. (Eds.), Chemically-induced Alterati ons in Sexual and Fu nctional Development: The Wildlife/ Human Connection, Princet on Sci. Publ. Co., Inc., Princeton, pp. 147-158 Fox, G.A., 1995. Tinkering with the tinkerer: Pollution verses evolution. Environ. Health Perspec. 103, 93-100. Fry, D.M., 1995. Reproductive effects in birds exposed to pesticid es and industrial chemicals. Environ. Health Perspec. 103, 165-171. Fry, D.M., Toone, C.K., 1981. DDT-induced femi nization of gull embryos. Science 213, 922-924. Gabriel, W.N., Blumberg, B., Sutton, S., Place, A.R., Lance, V.A., 2001. Alligator aromatase cDNA sequence and its expressi on in embryos at male and female incubation temperatures. J. Exp. Zool. 290, 439-448. Giguere, V., 1999. Orphan nuclear receptors: from gene to function. Endocr. Rev. 20, 689-725. Goldey, E.S., Kehn, L.S., Lau, C., Rehnber g, G.L., Crofton, K.M., 1995. Developmental exposure to polychlorinated biphenyls (Aro clor 1254) reduces circulating thyroid hormone concentrations and causes hearing de ficits in rats. Toxicol. Appl. Pharm. 135, 77-88. Grasman, K.A., Scanlon, P.F., Fox, G.A., 1998. Reproductive and physiological effects of environmental contaminants in fish-eati ng birds of the Great Lakes: a review of historical trends. Environ. Monit. Assess. 53, 117-145. Gray, L.E., Jr., Ostby, J., Furr, J., Wolf, C.J ., Lambright, C., Parks, L., Veeramachaneni, D.N., Wilson, V., Price, M., Hotchkiss, A ., Orlando, E., Guillette, L., 2001. Effects of environmental antiandrogens on repr oductive development in experimental animals. Hum. Reprod. Update 7, 248-264. Gray, L.E., Jr., Ostby, J.S., Kelce, W. R., 1994. Developmental effects of an environmental antiandrogen: the fungicide vinclozolin alters sex differentiation of the male rat. Toxicol. Appl. Pharm. 129, 46-52.

PAGE 117

105 Guillette, L.J., Jr., Brock, J.W., Roon ey, A.A., Woodward, A.R., 1999a. Serum concentrations of various environmental co ntaminants and their relationship to sex steroid concentrations in the American al ligator. Arch. Environ. Contam. Toxicol. 36, 447-455. Guillette, L.J., Jr, Crain, A.D., 2000. Envi ronmental Endocrine Disrupters: An Evolutionary Perspective. In: Taylor and Francis, New York, p. 355 Guillette, L.J., Jr., Crain, D.A., Gunderson, M.P., Kools, S.A., Milnes, M.R., Orlando, E.F., Rooney, A.A., Woodward, A.R., 2000. Alligators and endocrine disrupting contaminants: a current pers pective. Amer. Zool. 40, 438-452. Guillette, L.J., Crain, D.A., Rooney, A.A., Pi ckford, D.B., 1995a. Organization versus activation the role of endocrinedisrupting contaminants (EDCs) during embryonic-development in wildlife. Environ. Health Perspec. 103, 157-164. Guillette, L.J., Jr., Crain, D.A., Rooney, A. A., Woodward, A.R., 1997a. Effect of acute stress on plasma concentrations of sex a nd stress hormones in juvenile alligators living in control and contaminated lakes. J. Herpetol. 31, 347-353. Guillette, L.J., Jr., Cox, M.C., Crain, D.A., 1996 a. Plasma insulin-like growth factor-I concentration during the reproductive cy cle of the American alligator ( Alligator mississippiensis ). Gen. Comp. E ndocrinol. 104, 116-122. Guillette, L.J., Jr., Gross, T.S., Gross, D.A., Rooney, A.A., Percival, H.F., 1995b. Gonadal steroidogenesis in vitro from juvenile alligators obtained from contaminated or control lakes. Environ. Health Perspec. 103, 31-36. Guillette, L.J., Jr., Gross, T.S., Masson, G.R ., Matter, J.M., Percival, H.F., Woodward, A.R., 1994. Developmental abnormalities of the gonad and abnormal sex hormone concentrations in juvenile alligators from contaminated and control lakes in Florida. Environ. Health Perspec. 102, 680-688. Guillette, L.J., Jr, Iguchi, T., 2003. Interspecies variation in the estrogenicity of p,p'DDE. Organohalogen Compounds 65, 71-73. Guillette, L.J., Jr, Pickford, D.B., Crai n, A.D., Rooney, A.A., Percival, H.F., 1996b. Reduction in penis size and plasma testos terone concentrations in juvenile alligators living in a contaminated environment. Gen. Comp. Endocrinol. 101, 3242. Guillette, L.J., Jr, Vonier, P.M., McLachlan, J.A., 2002. Affinity of the alligator estrogen receptor for serum pesticide contaminants. Toxicology 181-182, 151-154. Guillette, L.J., Jr., Woodward, A.R., Crain, A.D ., Pickford, D.B., Rooney, A.A., Percival, F.H., 1999b. Plasma steroid concentrati ons and male phallus size in juvenile alligators from seven Florida la kes. Gen. Comp. Endocrinol. 116, 356-372.

PAGE 118

106 Guillette, L.J., Jr., Woodward, A.R., Crai n, D.A., Masson, G.R., Palmer, B.D., Cox, M.C., You-Xiang, Q., Orlando, E.F., 1997b. The reproductive cycle of the female American alligator ( Alligator mississippiensis ). Gen. Comp. Endocrinol. 108, 87101. Gunderson, M.P., Bermudez, D.S., Bryan, T.A., Crain, D.A., Degala, S., Edwards, T.M., Kools, S., Milnes, M.R., Guillette, L.J., Jr ., 2002. Temporal and spatial variation in plasma thyroxine (T4) concentration in juvenile alligators collected from Lake Okeechobee and the northern Everglades, Fl orida, USA. Environ. Toxicol. Chem. 21, 914-921. Gunderson, M.P., Bermudez, D.S., Bryan, T.A., Degala, S., Edwards, T.M., Kools, S.A.E., Milnes, M.R., Woodward, A.R., Guillette, L.J., Jr, 2004. Variation in sex steroids and phallus size in j uvenile American alligators ( Alligator mississippiensis ) collected from 3 sites within the Kissimmee-Everglades drainage in Florida (USA). Chemosphere 56, 335-345. Gunderson, M.P., LeBlanc, G.A., Guillette , L.J., Jr., 2001. Alterations in sexually dimorphic biotransformation of testoste rone in juvenile American alligators ( Alligator mississippiensis ) from contaminated lakes. Environ. Health Perspec. 109, 1257-1264. Harries, J.E., Sheahan, D.A., Job ling, S., Matthiessen, P., Neall, P., Sumpter, J.P., Tylor, T., Zaman, N., 1997. Estrogenic activity in five United Kingdom rivers detected by measurement of vitellogenesis in caged male trout. Environ. Toxicol. Chem. 16, 534-542. Hayes, T.B., Collins, A., Lee, M., Mendoza, M., Noriega, N., Stuart, A.A., Vonk, A., 2002. Hermaphroditic, demasculinized frogs after exposure to the herbicide atrazine at low ecologically relevant doses. Proc. Natl. Acad. Sci. U. S. A. 99, 5476-5480. Hedli, C.C., Snyder, R., Kinoshita, F.K., Steinberg, M., 1998. Investigation of hepatic cytochrome P-450 enzyme induction and DNA adduct formation in male CD/1 mice following oral administraion of t oxaphene. J. Appl. Toxicol. 18, 173-178. Heinz, G.H., Percival, H.F., Jennings, M.L., 1991. Contaminants in American alligator eggs from Lake Apopka, Lake Griffin, and Lake Okeechobee, Florida. Environ. Monit. Assess. 16, 277-285. Hu, M.C., Hsu, H.J., Guo, I.C., Chung, B.C ., 2004. Function of Cyp11a1 in animal models. Mol. Cell Endocrinol. 215, 95-100. Janzen, F.J., Wilson, M.E., Tucker, J.K ., Ford, S.P., 1998. Endogenous yolk steroid hormones in turtles with different se x-determining mechanisms. Gen. Comp. Endocrinol. 111, 306-317.

PAGE 119

107 Jeyasuria, P., Place, A.R., 1998. Embryonic brai n-gonadal axis in temperature-dependent sex determination of reptil es: a role for P450 aromatase (CYP19). J. Exp. Zool. 281, 428-449. Jobling, S., Beresford, N., Nolan, M., Rodgers -Gray, T., Brighty, G.C., Sumpter, J.P., Tyler, C.R., 2002a. Altered sexual maturati on and gamete production in wild roach (Rutilus rutilus) living in rivers that recei ve treated sewage effluents. Biol. Repro. 66, 272-281. Jobling, S., Coey, S., Whitmore, J.G., Kime , D.E., Van Look, K.J.W., McAllister, B.G., Beresford, N., Henshaw, A.C., Brighty, G ., Tyler, C.R., Sumpter, J.P., 2002b. Wild intersex roach (Rutilus rutilus) have reduced fertility. Biol. Repro. 67, 515-524. Kalland, T., Strand, ., J-G., F., 1979. Long-term effects of neonatal estrogen treatment on mitogen responsiveness of mouse spleen lymphocytes. J. Natl. Cancer Inst. 63, 413-421. Katsu, Y., Bermudez, D.S., Braun, E.L., He lbing, C., Miyagawa, S., Gunderson, M.P., Kohno, S., Bryan, T.A., Guillette, L.J., Jr , Iguchi, T., 2004. Molecular cloning of the estrogen and progesterone receptors of the Americ an alligator. Gen. Comp. Endocrinol. 136, 122-133. Keith, L.H., 1997. Environmental Endocrine Disruptors: A Handbook of Property Data. John Wiley & Sons, Inc., New York. Kelce, W.R., Stone, C.R., Laws, S.C., Gr ay, L.E., Kemppalnen, J.A., Wilson, E.M., 1995. Persistent DDT metabolite p,p'-DDE is a potent androgen receptor antagonist. Nature 375, 581-585. Kelce, W.R., Wilson, E.M., 1997. Environmental antiandrogens: developmental effects, molecular mechanisms, and clinical implications. J. Mol. Med. 75, 198-207. Kleinow, K., Baker, J., Nichols, J., Gobas, F., Parkerton, T., Muir, D., Monteverdi, G., Mastrodone, P., 1999. Exposure, uptake, and disposition of chemicals in reproductive and developmental stages of se lected oviparous vertebrates. In: Di Giulio, R.T., Tillitt, D.E. (Eds.), Re productive and Developmental Effects of Contaminants in Oviparous Vertebrates, Society of Environmental Toxicology and Chemistry, Pensacola, FL, pp. 9-111 Knudsen, F.R., Pottinger, T.G., 1999. Interact ion of endocrine disrupting chemicals, singly and in combination, with estrogen, androgen-, and corticosteroid-binding sites in rainbow trout ( Oncorhynchus mykiss ). Aquat. Toxicol. 44, 159-170. Korytr, P., van Stee, L.L.P., Leonards, P.E.G., de Boer, J., Brinkman, U.A.T., 2003. Attempt to unravel the composition of toxaphene by comprehensive twodimensional gas chromatography with se lective detection. J. Chromatogr. A 994, 179-189.

PAGE 120

108 Lance, V.A., Bogart, M.H., 1992. Disruption of ovarian development in alligator embryos treated with an aromatase inhi bitor. Gen. Comp. Endocrinol. 86, 59-71. Lance, V.A., Bogart, M.H., 1994. Studies on sex determination in the American alligator Alligator mississippiensis . J. Exp. Zool. 270, 79-85. Lang, J.W., Andrews, H.V., 1994. Temperat ure-dependent sex determination in crocodilians. J. Exp. Zool. 270, 28-44. Lephart, E.D., Simpson, E.R., 1991. Assay of aromatase activity. Meth. Enzymol. 206, 477-483. Maruya, K.A., Lee, R.F., 1998. Aroclor 1268 and toxaphene in fish from a Southeastern U.S. estuary. Environ. Sci. Technol. 32, 1069-1075. Mascaro, C., Nadal, A., Hegardt, F.G., Ma rrero, P.F., Haro, D., 2000. Contribution of steroidogenic factor 1 to the regulation of cholesterol synthesis. Biochem. J. 350 Pt 3, 785-790. Masson, G.R., 1995. Environmental Influences on Reproductive Potential, Clutch Viability and Embryonic Mortality of the American Alligator in Florida. Ph.D. Diss., University of Florida, Gainesville. Matter, J.M., Crain, D.A., Sills-McMurry, C., Pickford, D.B., Rainwater, T.R., Reynolds, K.D., Rooney, A.A., Dickerson, R.L., Guillette, L.J., Jr., 1998. Effects of endocrine-disrupting contaminants in re ptiles: alligators. In: Kendall, R.J., Dickerson, R.L., Giesy, J.P., Suk, W.A. (Eds.), Principles and Processes for Evaluating Endocrine Disruption, S ETAC Press, Pensacola, FL, pp. 267-289 Miller, W.L., 1988. Molecular biology of st eroid hormone synthe sis. Endocr. Rev. 9, 295-318. Miller, W.L., 2002. Androgen biosynthesis from cholesterol to DHEA. Mol. Cell Endocrinol. 198, 7-14. Milligan, S.R., Khan, O., Nash, M., 1998. Comp etitive binding of xenobiotic oestrogens to rat alpha-fetoprotein and to sex steroi d binding proteins in human and rainbow trout ( Oncorhynchus mykiss ) plasma. Gen. Comp. Endocrinol. 112, 89-95. Mills, L.J., Gutjahr-Gobell, R. E., Haebler, R.A., Horowitz, D.J.B., Jayaraman, S., Pruell, R.J., McKinney, R.A., Gardner, G.R., Za roogian, G.E., 2001. Effects of estrogenic (o,p'-DDT; octylphenol) and antiandrogeni c (p,p'-DDE) chemicals on indicators of endocrine status in juvenile male summer flounder ( Paralichtys dentatus ). Aquat. Toxicol. 52, 157-176. Milnes, M.R., Allen, D., Bryan, T.A., Sedacca, C.D., Guillette, L.J., Jr, 2004. Developmental effects of embryonic expos ure to toxaphene in the American alligator ( Alligator mississippiensis ). Comp. Biochem. Phys. C 138, 81-87.

PAGE 121

109 Milnes, M.R., Bermudez, D.S, Bryan, T.A., G underson, M.P., Guillette, L.J., Jr., In press. Altered neonatal development and endocrine function in Alligator mississippiensis associated with a contaminated environment. Biol. Repro. Milnes, M.R., Woodward, A.R., Guillette, L.J., Jr., 2001. Morphological variation in hatchling American alligator ( Alligator mississippiensis ) from three Florida lakes. J. Herpetol. 35, 264-271. Milnes, M.R., Woodward, A.R., Rooney, A.A ., Guillette, L.J., Jr., 2002. Plasma steroid concentrations in relation to size and age in juvenile alligators from two Florida lakes. Comp. Biochem. Phys. A 131, 923-930. Munkittrick, K.R., McMaster, M.E., Portt, C.B., Van Der Kraak, G.J., Smith, I.R., Dixon, D.G., 1992. Changes in maturity, plasma se x steroid levels, hepatic mixed function oxygenase activity, and presence of exte rnal lesions in lake whitefish ( Coregonus clupeaformis ) exposed to bleached kraft mill effluent. Can. J. Fish. Aquat. Sci. 49, 1560-1569. Munkittrick, K.R., Van Der Kraak, G.J., McMa ster, M.E., Portt, C.B., van den Heuval, M.R., Servos, M.R., 1994. Survey of receiving-water environmental impacts associated with discharges from pulp mills: 2. Gonad size, liver size, hepatic EROD activity and plasma sex steroid levels in white sucker. Environ. Toxicol. Chem. 13, 1089-1101. National Research Council (NRC), 1999. Hormona lly Active Agents in the Environment. National Academy Press, Washington D.C. Newbold, R., 1995. Cellular and molecular effects of developmental exposure to diethylstilbestrol: implications for other environmental estrogens. Environ Health Perspect 103 Suppl 7, 83-87. Noble, R.C., McCartney, R., Ferguson, M.W. J., 1993. Lipid and fatty acid compositional differences between eggs of wild and captive-breeding alligators ( Alligator mississippiensis ): an association with reduced hatchability? J. Zool., Lond. 230, 639-649. Norris, D.O., 1997. Vertebrate Endocrinology. Academic Press, San Diego. Orlando, E.F., Denslow, N.D., Folmar, L.C., Guillette, L.J., Jr., 1999. A comparison of the reproductive physiology of largemouth bass, Micropterus salmoides , collected from the Escambia and Blackwater Rivers in Florida. Environ. Health Perspec. 107, 199-204. Orlando, E.F., Guillette, L.J., Jr., 2001. A re-e xamination of variati on associated with environmentally stressed organism s. Hum. Reprod. Update 7, 265-272.

PAGE 122

110 Parks, L.G., Lambright, C.S., Orlando, E.F., Guillette, L.J., Jr., Ankley, G.T., Gray, L.E., Jr., 2001. Masculinization of femal mos quitofish in kraft mill effluentcontaminated fenholloway river water is a ssociated with androgen receptor agonist activity. Toxicol. Sci. 62, 257-267. Parrot, J.L., Jardine, J.J., Blunt, B.R., McCarthy, L.H., McMaster, M.E., Wood, C.S., Roberts, J., Carey, J.H., 1999. Comparing biological responses to mill process changes: a study of steroid concentrations in goldfish exposed to effluent and waste streams from a Canadian bleached sulphi te mill. Water Sci. Technol. 40, 115-121. Peakall, D.E., Lincer, J.L., Risebrough, R. W., Pritchard, J.B., Kinter, W.B., 1973. DDEinduced egg-shell thinning: structural a nd physiological effect s in three species. Comp. Gen. Pharmacol. 4, 305-313. Pickford, D.B., Guillette, L.J., Jr., Crai n, D.A., Rooney, A.A., Woodward, A.R., 2000. Phallus size and plasma dihydrotestosterone concentrations in juvenile American alligators ( A. mississippiensis ) from contaminated and reference populations. J. Herpetol. 34, 233-239. Pieau, C., 1996. Temperatur variation and sex determination in rep tiles. BioEssays 18, 19-26. Podreka, S., Georges, A., Maher, B., Lim pus, C.J., 1998. The environmental contaminant DDE fails to influence the outcome of se xual differentiation in the marine turtle Chelonia mydas . Environ. Health Perspec. 106, 185-188. Portelli, M.J., de Solla, S.R., Brooks , R.J., Bishop, C.A., 1999. Effect of dichlorodiphenyltrichloroethane on sex determination of the common snapping turtle (Chelydra serpentin a serpentina). Ecotoxicol . Environ. Saf. 43, 284-291. Presnell, J.K., Schreibman, M.P., 1997. Humason's Animal Tissue Techniques. The Johns Hopkins University Press, Baltimore, MD. Purdon, C.E., Hardiman, P.A., Bye, V.J., Eno, N.C., Tyler, C.R., Sumpter, J.P., 1994. Estrogenic effects of effluents from se wage treatment works. Chem. Ecol. 8, 275285. Ratcliffe, D.A., 1973. Studies of the recent breeding success of the peregrine, Falco peregrinus. J. Reprod. Fertil. Suppl 19, 377-389. Rhen, T., Willingham, E., Sakata, J.T ., Crews, D., 1999. Incubation temperature influences sex-steroid levels in j uvenile red-eared slider turtles, Trachemys scripta , a species with temperature dependent sex determination. Biol. Repro. 61, 12751280. Rice, K.G., Percival, F.H., Woodward, A. R., Jennings, M.L., 1999. Effects of egg and hatchling harvest on American alligators in Florida. J. Wildl. Mngmt. 63, 11931200.

PAGE 123

111 Rice, K.G., Percival, H.F., Woodward, A.R ., Abercrombie, C.L., Wilkinson, P.M., 1996. Clutch viability, population trends, and ne sting female demographics. In: Rice, K.G., Percival, H.F. (Eds.), Effects of Environmental Contaminants on the Demographics and Reproduction of Lake Apopka's Alligators and Other Taxa, vol. Technical Report #53. Florida Cooperative Fish and Wildlife Research Unit, US Biological Services, Gainesville, pp. 7-33 Rooney, A.A., 1998. Variation in the Endocri ne and Immune System of Juvenile Alligators: Environmental Influence on Physiology. Ph.D. Diss, University of Florida, Gainesville. Rooney, A.A., Bermudez, D.S., Guillette, L.J ., Jr, 2003. Altered histology of the thymus and spleen in contaminant-exposed juven ile American alligat ors. J. Morphol. 256, 349-359. Rooney, A.A., Guillette, L.J., Jr., 2000. Contamin ant interactions with steroid receptors: Evidence for receptor binding. In: Guillette, L.J., Jr, Crain, A.D. (Eds.), Environmental Endocrine Di srupters: An Evolutionary Perspective, Taylor & Francis, New York, pp. 82-125 Sandstrom, O., 1994. Incomplete recovery in a coastal fish community exposed to effluent from a modernized Swedish bleached kraft mill. Can. J. Fish. Aquat. Sci. 51, 2195-2202. Scott, K.D., FahreausVan Ree, G.E., Parrish, C.C., 2002. Sex differences in hepatic lipids of toxaphene-exposed j uvenille yellowtail flounder ( Pleuronectes ferrugineus Storor). Ecotoxicol. Environ. Safety 51, 168-176. Sheehan, D.M., Willingham, E., Gaylor, D., Bergeron, J.M., Crews, D., 1999. No threshold dose for estradiol-i nduced sex reversal of turtle embryos: how little is too much? Environ. Health Perspec. 107, 155-159. Smeets, J.M., van Holsteijn, I., Giesy, J.P., Seinen, W., van den Berg, M., 1999. Estrogenic potencies of several environmental pollutants, as determined by vitellogenin induction in a carp hepatocyte assay. Toxicol. Sci. 50, 206-213. Smith, C.A., 1995. Aromatase enzyme activity during gonadal sex differentiation in alligator embryos. Differentiation 58, 281-290. Smith, C.A., Joss, J.M.P., 1993. Gonadal sex differentiation in Alligator mississippiensis , a species with temperature-dependent se x determination. Cell Tiss. Res. 273, 149162. Smith, C.A., Joss, J.M.P., 1994. Steroi dogenic enzyme activity and ovarian differentiation in the saltwater crocodile, Crocodylus porosus . Gen. Comp. Endocrinol. 93, 232-245. Sokal, R.R., Rohlf, F.J., 1995. Biometry: the principles and practi ce of statistics in biological research. W. H. Fr eeman and Company, New York.

PAGE 124

112 Stearns, S.C., 1992. The Evolution of Life Histor ies. Oxford University Press, New York. Stocco, D.M., Clark, B.J., 1996. Regulation of the acute production of steroids in steroidogenic cells. Endocr. Rev. 17, 221-244. Tanaka, Y., Elsey, R.M., 1997. Light mi croscopic study of the alligator ( Alligator mississippiensis ) spleen with special re ference to vascular ar chitecture. J. Morphol. 233, 43-52. Toft, G., Baatrup, E., Guillette, L.J., Jr ., 2004. Altered social behavior and sexual characteristics in mosquitofish (Gambusia holbrooki) living downstream of a paper mill. Aquat. Toxicol. 70, 213-222. Toft, G., Edwards, T.M., Baatrup, E., Guillette, L.J., Jr, 2003. Disturbed sexual characteristics in male mosquitofish ( Gambusia holbrooki ) from a lake contaminated with endocrine disruptors . Environ. Health Perspec. 111, 695-701. U.S. Environmental Protection Agency (USEPA), 1994. Tower Chemical Company Superfund Site Biological Assessment. U.S. EPA Region IV, Athens, GA. Vigier, B., Forest, M.G., Eychenne, B., B ezard, J., Garrigou, O., Robel, P., Josso, N., 1989. Anti-Mullerian hormone produces endoc rine sex reversal of fetal ovaries. Proc. Nat. Acad. Sci. 86, 3684-3688. vom Saal, F.S., Nagel, S.C., Palanza, P., Boechler, M., Parmigiani, S., Welshons, W.V., 1995. Estrogenic pesticides: bind ing relative to estradiol in MCF-7 cells and effects of exposure during fetal life on subsequent territorial behaviour in male mice. Toxicol. Lett. 77, 343-350. Vonier, P.M., Crain, D.A., McLachlan, J.A., Guillette, L.J., Jr, Arnold, S.F., 1996. Interaction of environmental chemical s with the estrogen and progesterone receptors from the oviduct of the American alligator. Environ. Health Perspec. 104, 1318-1322. Walsh, L.P., Kuratko, C.N., Stocco, D.M., 2000a. Econazole and miconazole inhibit steroidogenesis and disrupt steroidogen ic acute regulatory (StAR) protein expression post-transcriptionally. J. Biochem. Mol. Biol. 75, 229-236. Walsh, L.P., McCormick, C., Martin, C., Stocco, D.M., 2000b. Roundup inhibits steroidogenesis by disrupti ng steroidogenic acute re gulatory (StAR) protein expression. Environ. Health Perspec. 108, 769-776. Walsh, L.P., Stocco, D.M., 2000. Effects of Li ndane on steroidogenesis and steroidogenic acute regulatory protein expr ession. Biol. Repro. 63, 1024-1033. Walsh, L.P., Webster, D.R., Stocco, D.M., 2000c. Dimethoate inhib its steroidogenesis by disrupting transcription of the steroidogenic acute re gulatory (StAR) gene. J. Endocrinol. 167, 253-263.

PAGE 125

113 Western, P.S., Harry, J.L., Graves, J.A.M., Sinclair, A.H., 1999. Temperature-dependent sex determination in the American a lligator: AMH precedes SOX9 expression. Develop. Dynam. 216, 411-419. Western, P.S., Harry, J.L., Graves, J.A.M., Sinclair, A.H., 2000. Temperature-dependent sex determination in the American a lligator: expression of SF1, WT1 and DAX1 during gonadogenesis. Gene 241, 223-232. Wibbels, T., Bull, J.J., Crews, D., 1991. Syne rgism between temperat ure and estradiol: a common pathway in turtle sex determination? J. Exp. Zool. 260, 130-134. Wibbels, T., Crews, D., 1995. Steroid-indu ced sex determination at incubation temperatures producing mixed sex ratios in a turtle with TSD. Gen. Comp. Endocrinol. 100, 53-60. Wilkinson, P.M., Rhodes, W.E., 1997. Growth rates of American al ligators in coastal South Carolina. J. Wildl. Mngmt. 61, 397-402. Willingham, E., 2004. Endocrine-disrupting compounds and mixtures: unexpected doseresponse. Arch. Environ. Contam. Toxicol. 46, 265-269. Willingham, E., Baldwin, R., Skipper, J.K., Crews, D., 2000a. Aromatase activity during embryogenesis in the brain and adrenal-kidne y-gonad of the red-ear ed slider turtle, a species with temperature-dependent se x determination. Gen. Comp. Endocrinol. 119, 202-207. Willingham, E., Crews, D., 1999. Sex reversal effects of environmentally relevant xenobiotic concentrations on the red-eared s lider turtle, a specie s with temperaturedependent sex determination. Gen. Comp. Endo crinol. 113, 429-435. Willingham, E., Rhen, T., Sakata, J.T., Crews, D., 2000b. Embryonic treatment with xenobiotics disrupts steroid hormone profiles in hatchling red-eared slider turtles ( Trachemys scripta elegans ). Environ. Health Perspec. 108, 329-332. Wilson, V.S., LeBlanc, G.A., 2000. The cont ribution of hepatic inactivation of testosterone to the lowering of serum testosterone leve ls by ketoconazole. Toxicol Sci 54, 128-137. Woodward, A.R., Percival, H.F., Jennings, M.L. , Moore, C.T., 1993. Low clutch viability of American alligators on Lake Apopka. Fl. Sci. 56, 52-63. Zhang, L.L., Khan, I.A., Foran, C.M., 2002. Char acterization of the estrogenic response to genistein in Japanese medaka ( Oryzias latipes ). Comp. Biochem. Physiol. CPharmacol. Toxicol. Endocrinol. 132, 203-211.

PAGE 126

114 BIOGRAPHICAL SKETCH Matthew Robert Milnes wa s born June 21, 1973, in Meadville, PA. His family moved to Clearwater, FL, in 1976, where he graduated from Clearwater High School in 1991 and received a Florida Academic Scholars award. He attended the University of Florida, where he studied wildlife ecology and conservation. In 1993 Matthew enlisted in the U.S. Army Reserves, and in 1995 he began working in Dr. Louis J. Guillette’s lab as an undergraduate research assistant unde r the guidance of Andy Rooney. In 1996 he received his Bachelor of Scie nce and was commissioned as a 2nd Lieutenant and continued to serve in the Army Reserves until 2004. Following graduation, Matthew worked for the Florida Fish and Wildlife Conservation Commission in alligator resear ch and management for two years. In August, 1998, he began graduate school in th e laboratory of Dr. L ouis J. Guillette, Jr. While attending graduate school , he received Grants-in-Aid of Research from Sigma Xi and the Society for Integrative and Comp arative Biology, a National Science Foundation East Asia South Pacific Summer Institutes Fellowship, and the College of Liberal Arts and Sciences O’Neil Dissertation Fellowship. He also volunteered as a guest speaker for the Alachua County Public School Board. Af ter graduating with his Ph.D., Matthew will join Dr. Bruce Blumberg’s lab at the Univer sity of California, Irv ine as a post doctoral research fellow.