Citation
The Identification of Trans-Acting Factors That Mediate the Manganese Superoxide Dismutase Enhancer Function

Material Information

Title:
The Identification of Trans-Acting Factors That Mediate the Manganese Superoxide Dismutase Enhancer Function
Creator:
CHOKAS, ANN LYNN ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Antibodies ( jstor )
Chromatin ( jstor )
DNA ( jstor )
Gene expression ( jstor )
Promoter regions ( jstor )
Proteins ( jstor )
Rats ( jstor )
Superoxides ( jstor )
Tracheoesophageal fistula ( jstor )
Yeasts ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Ann Lynn Chokas. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/31/2006
Resource Identifier:
71315451 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

THE IDENTIFICATION OF TRANS-ACTING FACTORS THAT MEDIATE THE MANGANESE SUPEROXIDE DISM UTASE ENHANCER FUNCTION By ANN LYNN CHOKAS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Ann Lynn Chokas

PAGE 3

To my parents.

PAGE 4

ACKNOWLEDGMENTS There are many people to thank when doing a Ph.D. First among them is my mentor, (Dr. Harry Nick) for allowing me to “play” in the lab, and handing me such a wonderfully rich and interesting project. I have learned an incredible amount during my time here and am grateful for all the opportunities and support I was given. Second I would like to thank Joan Monnier who made my experience here a special one, a fellow horse lover and friend always. The members of the Nick Lab, past and present have each made this experience a unique one. From the past, I would like to thank Shiu “Yang” Kuo, who started out as my second mentor and ended up being a great friend and colleague. I thank Chris Davis for whole-heartedly welcoming me into the lab, and his world. I thank Rich Rogers for passing on to me a carefully studied project, and for always sharing his ideas. I would also like to thank the current graduate students (Diezer, Kimmy, Xiaolei and Jewel) and the technicians (Dawn, Molly, Brett and Justin) and the post-docs (Amy and Jiang) who have kept things interesting to say the least and gave birth to “Cholies” and an endless supply of music and cakes:>. Through this journey, I have been fortunate to have many guides, both intellectually and emotionally. Without the support of my friends, particularly those from my IDP class, this would have been a much more difficult experience. I am very appreciative of all the people I have met here along the way and am lucky to have been part of such a great class of people. I am grateful to my iii

PAGE 5

rollerblading buddies (Amy in particular), who helped me adjust through our outdoor excursions among other things. I am extremely grateful to my yaya sisters (Chin, Stela and Patricia), who helped keep me sane through laughter, tears and good food always :>. My NY friends (Pats, Jennifer, Juli, Paula, and Sophia, among others) have been incredibly supportive and deserve special thanks. The support of my family, even though they thought I was insane, (my parents in particular) has been incredible, no words can adequately express my thanks. I would also like to thank Lucia Notterpek (and Kyle from her laboratory) for taking the time to teach me immunohistochemistry. I would especially like to thank all of the members of my committee (Drs. Anderson, Bungert, Ferl, and Notterpek) for all the insightful comments and questions they asked along the way, it made me a better scientist and added to the project overall. I have learned from all of them, if not always directly, indirectly by their example. iv

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iii LIST OF FIGURES..........................................................................................................vii ABSTRACT.........................................................................................................................x CHAPTER 1 INTRODUCTION........................................................................................................1 Free Radical Theory of Oxygen Toxicity.....................................................................1 Superoxide Dismutases.................................................................................................2 Physiological Importance.............................................................................................4 Transcriptional Regulation of MnSOD........................................................................6 Identification of an Enhancer Element.........................................................................7 Enhancers......................................................................................................................9 Protein Contact Sites in the Enhancer........................................................................13 2 MATERIALS AND METHODS...............................................................................18 Materials.....................................................................................................................18 Methods......................................................................................................................20 Yeast One-Hybrid Screening...............................................................................20 Vector construction......................................................................................20 Yeast integration..........................................................................................20 Library screening..........................................................................................23 Alternative One-Hybrid Screening Protocol.......................................................25 Plasmid Construction...........................................................................................26 Tissue Culture......................................................................................................26 RNA Isolation and Northern Analysis................................................................26 Co-Immunoprecipitation Analysis......................................................................29 Total cell lysate............................................................................................29 Nuclear extract.............................................................................................30 Nuclear immunoprecipitation.......................................................................31 Immunohistochemical Analysis..........................................................................32 Chromatin Immunoprecipitation (ChIP).............................................................32 v

PAGE 7

Electrophoretic Mobility Shift Assay (EMSA)...................................................35 Glutathione-S-Transferase (GST) fusion protein preparation......................35 Electrophoretic Mobility Shift Assay (EMSA)............................................36 Real-Time PCR...................................................................................................37 3 ISOLATION OF TRANSCRIPTION FACTORS.....................................................38 Introduction.................................................................................................................38 Results.........................................................................................................................40 Discussion...................................................................................................................58 Transcription Enhancer Factor-1 (TEF-1)...........................................................61 The p65 Transcription Factor..............................................................................66 4 TRANSCRIPTION FACTOR OVER-EXPRESSION STUDIES ON ENDOGENOUS MNSOD GENE EXPRESSION.....................................................72 Introduction.................................................................................................................72 Results.........................................................................................................................74 Discussion...................................................................................................................95 5 CHARACTERIZATION OF TRANSCRIPTION FACTOR INTERACTIONS AND PROTEIN-DNA IN VIVO INTERACTIONS...............................................102 Introduction...............................................................................................................102 Results.......................................................................................................................106 Transcriptional Enhancer Factor-1 and p65 Localization in Unstimulated and Induced Rat Lung Epithelial Cells.................................................................106 Co-over-expression of both TEF and p65 results in p65 Nuclear Localization....................................................................................................106 Transcriptional Enhancer Factor-1 and p65 Interact as determined through Immunoprecipitation Studies.........................................................................110 Transcriptional Enhancer Factor-1 and p65 bind the MnSOD Enhancer Region in a Chromatin Environment..........................................................................116 Discussion.................................................................................................................120 6 CONCLUSIONS AND FUTURE DIRECTIONS...................................................128 Conclusions...............................................................................................................128 Future Directions......................................................................................................132 APPENDIX ONE HYBRID ANALYSIS OF SITE 4 WITHIN THE MNSOD ENHANCER: INVOLVEMENT OF C/EBPAND/OR C/EBP-........................136 LIST OF REFERENCES.................................................................................................143 BIOGRAPHICAL SKETCH...........................................................................................159 vi

PAGE 8

LIST OF FIGURES Figure page 1-1 Rat MnSOD genomic clone characterization.............................................................8 1-2 Alignment of Rat, Human, Chimp and Mouse MnSOD intron 2 region.................14 1-3 Comparison of nomenclature and sequence between Jones et al. (1997), Maehara et al. (1999) and our study (One-Hybrid Sequence).................................15 2-1 The pHISi and pLacZi vector maps from Clontech.................................................21 2-2 The pACT2 plasmid vector map from Clontech......................................................24 3-1 One-Hybrid assay design depicting integration of binding site into yeast genome.....................................................................................................................40 3-2 Human transcriptional enhancer factor-1 (TEF-1)...................................................42 3-3 Human transcriptional enhancer factor-3 (TEF-3)...................................................44 3-4 Human p65...............................................................................................................46 3-5 Comparison of the human p65 sequence isolated from the yeast One-Hybrid screen (Hp65) with the human p65 cDNA derived from the Sanger Institute.........48 3-6 Genomic structure of human p65 as determined by us from the One-Hybrid screen........................................................................................................................49 3-7 Proposed human TEF-1 protein structure................................................................50 3-8 Protein structure of human p65................................................................................51 3-9 Theorized transcription factor binding sites.............................................................52 3-10 Specific complex formation ....................................................................................54 3-11 Glutathione-S-transferase (GST) fusion protein preparation...................................56 3-12 Electrophoretic mobility shift assay (EMSA) analyses with p65-GST....................59 3-13 Electrophoretic mobility shift assay (EMSA) analyses with TEF-GST...................60 vii

PAGE 9

3-14 Newly theorized protein binding sites for TEF-1 and p65 on the enhancer site 2...70 4-1 Northern analysis of transcriptional enhancer factor-3 (TEF-3) over-expression...76 4-2 Northern analysis of Flag tagged-transcriptional enhancer factor -1 (TEF1) and Flag-TEF1 with TEF3 over-expression....................................................................77 4-3 Northern analysis of over-expressed p65.................................................................78 4-4 Northern analysis of transcriptional enhancer factor -1 (TEF1)-pcDNA3.1, p65-pcDNA3.1 and TEF1 + p65 over-expression...........................................................80 4-5 Densitometric analysis of effect of over-expression of TEF-1, p65, and TEF-1 and p65............................................................................................................................81 4-6 Immunoblot analysis of over-expression of transcriptional enhancer factor -1 (TEF-1),p65, TEF-1 and p65....................................................................................82 4-7 Northern analysis of transcriptional enhancer factor-1 (TEF-1) and p65 over-expression.................................................................................................................83 4-8 Densitometric analysis of endogenous MnSOD expression....................................84 4-9 Northern analysis of transcriptional enhancer factor-3 (TEF-3) and p65 over-expression.................................................................................................................85 4-10 Northern analysis of, p65-pcDNA3.1, transcriptional enhancer factor -1 (TEF1)-pcDNA3.1, Flag-TEF-1(TEF-F), p65 and TEF1-pcDNA3.1, and p65 + Flag-TEF-1 over-expression in human fetal lung fibroblast (HFL) cells................87 4-11 Real-Time PCR analysis of rat IB gene expression.............................................88 4-12 Northern analysis of over-expression of pcDNA3.1, p65-TA deletion (TA), TEF-1, p65, TA + TEF-1, and p65+TEF-1....................................................................91 4-13 Densitometry of Northern analysis depicted in Figure 4-12....................................92 4-14 Immunoblot analysis comparing TEF1 + p65-TA deletion (TA), and TEF1+ p65............................................................................................................................93 4-15 Northern analysis of over-expression of TEF-1, p65, S180P-p65...........................94 4-16 Northern analysis of over-expression of TEF1, p50, p65, p50+TEF1, p50+p65, and TEF1+ p65........................................................................................................96 4-17 Northern analysis of untransfected L2 cells treated with SN50...............................97 5-1 Immunohistochemical analysis of endogenous TEF-1 and p65 expression..........108 viii

PAGE 10

5-2 Immunohistochemical analysis of over-expressed TEF-1 and p65-pcDNA3.1.....109 5-3 Immunohistochemical analysis of over-expressed Flag-TEF-1 and myc-p65.......111 5-4 Immunohistochemical analysis demonstrating over-expression of both Flag-TEF-1 and myc-p65 as compared to myc-p65 alone.....................................113 5-5 Total cell lysate immunoprecipitation of over-expressed TEF1 and p65..............117 5-6 Nuclear fraction immunoprecipitation from untransfected L2 cells......................118 5-7 Chromatin immunoprecipitation assay description................................................123 5-8 Chromatin immunoprecipitation from untransfected lung epithelial cells ...........124 5-9 Summary of ChIP data on the rat MnSOD enhancer region located in Intron 2 .126 5-10 Theoretical model of MnSOD enhancer structure following induction.................127 A-1 Rat MnSOD enhancer Site 4 from Rogers (2000).................................................137 A-2 Northern analysis of over-expression of liver activating protein (LAP) and liver inhibiting protein (LIP)..........................................................................................139 A-3 Northern analysis of endogenous C/EBP RNA expression in untransfected L2 cells. ......................................................................................................................140 A-4 Chromatin immunoprecipitation of uninduced versus IL-1 induced L2 cells at various time points.................................................................................................141 ix

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE IDENTIFICATION OF TRANS-ACTING FACTORS THAT MEDIATE THE MANGANESE SUPEROXIDE DISMUTASE ENHANCER FUNCTION By Ann Lynn Chokas December 2004 Chair: Harry S. Nick Major Department: Neuroscience Reactive oxygen species (ROS) are produced during normal cellular respiration and in response to oxidative stress. These reactive oxygen species include superoxide anions and hydroxyl radicals, and are deleterious to the cell. Manganese superoxide dismutase (MnSOD) is the first line of defense against superoxide radicals. MnSOD converts superoxide radicals into hydrogen peroxide and oxygen. The MnSOD gene is highly regulated as seen by the increase in gene expression following cellular exposure to proinflammatory mediators such as LPS, TNF and IL-1 . Previous work in our laboratory showed that this regulated gene-expression functions through an enhancer region located within Intron 2 of the MnSOD gene. In this study, we utilized the One-Hybrid assay to identify the factors that bind Site 2 in the MnSOD enhancer. Through this work, three transcription factors were isolated: transcripitonal enhancer factor-1 (TEF-1), transcriptional enhancer factor-3 (TEF-3) and p65. p65 was originally identified as a member of the NF-B complex. EMSA analyses x

PAGE 12

demonstrated the binding site of each factor within Site 2 through mutational analysis. Over-expression studies demonstrated that each factor individually had no effect on endogenous MnSOD gene expression. However, combined over-expression of both TEF and p65 resulted in an increase in endogenous MnSOD gene expression. Immunohistochemical analyses of the localization of the proteins demonstrated that on over-expression of p65 and TEF together, p65 (which is normally localized in the cytoplasm) is found in the nucleus. Co-immunoprecipitation assays, demonstrated that these proteins are capable of interacting in the nucleus. Northern analyses demonstrated the importance of the p65 activation domain and of the serine residue at position 180 within the p65 protein for TEF/p65 mediated induction. Further studies utilizing the Chromatin Immunoprecipitation assay confirmed the binding of these factors to the enhancer region in the endogenous chromatin environment, suggestive of a looping model between the promoter and enhancer regions. xi

PAGE 13

CHAPTER 1 INTRODUCTION Free Radical Theory of Oxygen Toxicity The “Free Radical Theory of Oxygen Toxicity” suggests that oxygen radicals are easily formed as a consequence of the chemical nature of the oxygen molecule and its ability to undergo univalent reduction reactions that lead to superoxide radical (O2-) formation (Clark & Lambertson 1971; Fridovich 1989; Haugaard 1968). The term “free radical” applies to any species containing one or more unpaired electrons. The superoxide radical itself (O2-) “can act as either a univalent oxidant or reductant” (Fridovich 1989; p7761) and can lead to production of hydrogen peroxide (H2O2) through enzymatic mechanisms and hydroxyl radical (OH) formation when in the presence of iron or other divalent cations. Reactive oxygen species (ROS), include oxygen-derived free radicals (superoxide anions, O2-, and hydroxyl radicals) and also their metabolites (hydrogen peroxide, H2O2, hypochlorous acid, HOCl). These ROSs can directly damage DNA, protein, and lipids and can indirectly damage cellular structures by a superoxide radical dependent chain reaction (Fridovich 1978; Southorn & Powis 1988). The ROS are produced during normal cellular respiration in the mitochondrial electron transport chain, and also in response to injury and phagocytosis (Goldblum et al. 1987; Ward 1994; Ward et al. 1988). Phagocytic cells produce large quantities of superoxide in response to infection by bacteria. These high levels of superoxide radicals can potentially affect the viability of neighboring healthy 1

PAGE 14

2 cells. It is therefore important for cells and tissues to retain the ability to mount an effective antioxidant defense to maintain normal cellular and tissue redox levels. Superoxide Dismutases The first demonstration of oxygen free radicals being cleared by superoxide dismutases was shown in erythrocytes by McCord and Fridovich (1969a). A primary member of this defense system is manganese superoxide dismutase (MnSOD), a potent anti-oxidant enzyme that belongs to the superoxide dismutase family of proteins (whose members are distinguished by the metal found in the catalytic site of the enzyme). The cytoplasmic copper/zinc SOD (Cu,Zn-SOD) is found in eukaryotes and in chloroplasts, while the extracellular Cu,Zn-SOD has been found only in eukaryotes thus far. The FeSOD has been isolated from prokaryotes and certain plants, and the NiSOD has been associated only with specific prokaryotes. MnSOD (Fridovich 1985) has been found in prokaryotes and the mitochondria of eukaryotes. The mammalian MnSOD protein is a tetrameric enzyme that contains four identical 21 kD subunits, with one Mn atom coordinated in the center of each subunit (the bacterial MnSODs contain only two subunits). Each enzyme converts two molecules of superoxide radical to molecular oxygen and hydrogen peroxide (2H+ + 2 O2H2O2 + O2), with the latter being broken down to water and oxygen by catalase(in the perioxisomes) and glutathione peroxidase (located in the mitochondria and cytosol). The superoxide dismutases are able to carry out catalysis through the redox properties of the manganese metal. During catalysis, the active site metal in MnSOD cycles between the oxidized and reduced forms (Mn3+ Mn2+ Mn3+). In the first half reaction the active site Mn3+ reacts with superoxide (O2-), resulting in Mn2+ and O2. In the second half reaction, the enzyme

PAGE 15

3 binds with another superoxide (O2-) and with the addition of 2H+, produces H2O2 with a recycling of the enzyme back to the original Mn3+ state (Hearn et al. 2001). The key differences between the two intracellular enzymes found in mammalian cells, are their location and gene expression mechanisms; Cu,Zn-SOD is constitutively expressed and located throughout the cytosol, nucleus, and the intermembrane space of mitochondria while MnSOD expression is highly regulated and the protein is strictly localized to the mitochondrial matrix. Additionally, MnSOD is product inhibited, while neither CuZnSOD nor FeSOD are. Dismutation of superoxide radicals is imperative for maintenance of normal cellular function; particularly in the mitochondria where 1-5% of normal respiration leaks off as oxygen radicals (Turrens & Boveris 1980; Turrens et al. 1982). Mammalian cells endogenously produce reactive oxygen species during normal cellular respiration; and as a consequence of exposure to many agents in the environment that can elicit ROS production, including ultraviolet radiation, cigarette smoke, and a range of environmental pollutants (Chow 1993; Janssen et al. 1993). Increased ROS production has been associated with many conditions and diseases including aging (Ku et al. 1993; Orr & Sohal 1994), cancer (Halliwell 1993), lung disease, autoimmune disorders, such as diabetes and neurodegenerative diseases, such as amyotrophic lateral sclerosis (Ferrante et al. 1997), Alzheimer’s (Butterfield et al. 1994), and Parkinson’s disease (Fahn & Cohen 1992). In order to defend against free radical-mediated damage cells have devised elaborate defense mechanisms, which include the utilization of small molecules such as Vitamin E and C and enzymatic mechanisms, which include the superoxide dismutases,

PAGE 16

4 heme oxygenases, catalase, glutathione peroxidase and DNA damage repair enzymes (Frank & Massaro 1980; Fridovich 1985). The location of MnSOD in the mitochondria allows it to directly inhibit superoxide radicals from damaging the mitochondrial DNA directly or alternatively damaging other cellular components. Damage to mitochondrial DNA at the nucleotide level can also lead to several diseases including encephalomyopathy and maternally inherited diabetes and deafness (Dinour et al. 2004). The need to maintain healthy mitochondria therefore is critical, as they are the energy producers of the cell. This elegant free radical defense system allows the mitochondria to produce large amounts of energy for the cell without injuring normal cellular function in the process. This is accomplished through tight regulation of the MnSOD gene. Physiological Importance The first researchers to demonstrate the cytoprotective nature of MnSOD in tissue culture experiments were Wong & Goeddel (1988), who exposed multiple cell types to cytotoxic TNF levels, and analyzed the expression of the MnSOD, CuZnSOD, catalase, glutathione peroxidase, and electron transport chain genes. MnSOD gene expression increased due to exposure to TNF, and this increase in gene expression was accompanied by cellular resistance to TNF toxicity. Protective effects of low doses of TNF against radiation and heat damage were also shown to be mediated through MnSOD activation (Wong et al. 1991). The ability of MnSOD to act in a protective fashion was also shown by Crapo and Tierney (1974) who demonstrated that MnSOD activity was increased in mice exposed to a sublethal dose of 85% oxygen prior to exposure to a lethal environment of 100% oxygen; the mice that were preexposed to 85%

PAGE 17

5 oxygen survived longer than their counterparts. Additional work by Wispe et al. (1992) expanded on this, demonstrating that transgenic mice with human MnSOD targeted to the lung survived longer than normal littermates when exposed to hyperoxia. Histological analysis confirmed this protection by showing that lung tissue from the MnSOD overexpressing mice looked normal as compared with the wildtype littermates who were exposed to hyperoxia and had extensive lung damage. The lung is an excellent system to look at ROS damage via MnSOD because it is so sensitive to oxygen damage and because medical therapies for respiratory problems include treatments with elevated oxygen tension often leading to further lung injury (Frank & Massaro 1980). The most striking observation of the critical importance of MnSOD however, was demonstrated when two groups independently generated MnSOD knockout mice. Li et al. (1995) deleted exon 3 of the Sod2 gene (Sod2mlucsf), whereas Lebowitz et al. (1996) deleted exons 1 and 2 of the Sod2 gene (Sod2mlbcm). On a CD-1 background, homozygous Sod2mlucsf-mutant mice (with no detectable MnSOD activity), all died within 10 days of birth with dilated cardiomyopathy, lipid accumulation in the liver and skeletal muscle and metabolic acidosis (Li et al. 1995). Homozygous Sod2mlbcm-mutant mice of mixed genetic background (also without detectable MnSOD activity), died within 18 days; and exhibited severe anemia, degeneration of neurons in the basal ganglia and brain stem, and progressive motor disturbances characterized by weakness, and rapid fatigue. Mice exhibited extensive mitochondrial injury within the neurons and cardiac myocytes. Heterozygous mutant mice (both Sod2mlucsf and Sod2mlbcm), had reduced levels of MnSOD (50% of normal), and showed oxidative stress with increased mitochondrial

PAGE 18

6 damage and premature induction of apoptosis, while transgenic mice with mutations in the cytoplasmic CuZn,SOD had little pathological consequences (Reaume et al. 1996). Transcriptional Regulation of MnSOD The necessary and protective role of MnSOD (as characterized by the animal studies above) is due to regulation of the gene at the transcriptional level, as has been shown by multiple laboratories (Eastgate et al. 1993; Rogers et al. 2000, 2001; Tsan et al. 1990; Visner et al. 1990, 1991; White et al. 2000; Wong & Goeddel 1988; Wong et al. 1991). The rat, mouse and human MnSOD genes all contain 5 exons, separated by 4 introns (DiSilvestre et al. 1995; Wan et al. 1994), and all have a greater than 89% identity with each other at the protein level (Jones et al. 1995), with the mitochondrial leader sequence that is used for targeting to the mitochondria being the most divergent region. Our laboratory has focused on the rat MnSOD gene which gives rise to five species of mRNA, which were identified by northern analyses, and determined to be the result of alternative polyadenylation, (Hurt et al. 1992) (Figure 1-1). In eukaryotes, the MnSOD gene is upregulated by lipopolysaccharide (LPS), tumor necrosis factor alpha (TNF), interleukins 1 and and interleukin-6 (IL-1, IL-6), and interferon gamma (IFN-) (Wong & Goeddel 1998; Visner et al. 1991; Valentine & Nick 1992; Kifle et al. 1996) . Studies with actinomycin, a transcriptional inhibitor, showed that induction with the pro-inflammatory mediators LPS, TNF, and IL-1 could be blocked implicating de novo transcriptional mechanisms. Nuclear run-on assays in our laboratory confirmed that this stimulus dependent increase in MnSOD expression was due in major part to de novo transcription (Hsu et al. 1993). Chromatin structure analysis through DNase I hypersensitivity experiments on the MnSOD gene revealed 7 hypersensitive (HS) regions suggesting increased DNA

PAGE 19

7 accessibility in this region. The first HS (HS1) is located within the promoter region and was studied through deletion analysis using the human growth hormone gene (hGH) as a reporter. These results demonstrated that the promoter could be deleted from 2500bp to 500bp with no effect on either the basal or stimulated hGH mRNA and protein expression. The minimal promoter was further characterized by in vivo DMS footprinting (Kuo et al. 1999), which identified 10 basal protein binding sites, with two repeatedly inducible G nucleotides within the proximal 500bp region. Importantly, the induction seen with the promoter/growth hormone fragments was only 2-3 fold higher than basal levels as compared with the 15-20 fold induction on the endogenous gene when exposed to inflammatory mediators observed by steady state northern analysis. It was therefore hypothesized that an additional element beyond the promoter was necessary to achieve maximal induction. Identification of an Enhancer Element DNAase I hypersensitive site 1 coincides with the proximal promoter region, leaving six other sites that could possibly hold stimulus dependent regulatory elements. Dr. Rogers in our laboratory conducted a deletion analysis of the remaining hypersensitive sites by creating a hGH expression vector that contained the MnSOD promoter (2.5kb Hind/Eag I fragment) and a 6.1 Kb HindIII fragment which included all the remaining HS sites, as well as the majority of the MnSOD structural gene. These 2 fragments were placed upstream of the hGH gene and this construct as well as a construct containing only the promoter were analyzed by transient transfection and northern analysis. The 6.1kb construct showed an increase in hGH mRNA expression in either orientation when stimulated with LPS, TNF andIL-1, with a level of induction similar

PAGE 20

8 MnSODGenomic CloneMnSODMolecular Regulation = DNaseI hypersensitive site = exons = Alternative Polyadenylationsite ** enhancer10 constitutivefactors1 inducible 3'5'***** * Figure 1-1. Rat MnSOD genomic clone characterization. Five exons are depicted by black boxes, and the five rat transcripts shown in the northern insert on the right, are due to alternative polyadenylation as depicted by the black arrows. Seven DNase I hypersensitive sites (*) are depicted throughout the gene. DNase Site 1 located within the promoter was characterized through in vivo footprinting analysis to contain 10 constitutive binding sites and 1 inducible site. DNase Site 2 located within Intron 2 was characterized and determined to contain an enhancer region. Five Exons are depicted by black boxes. The five rat gene transcripts shown on the right were determined to be due to alternative polyadenylation as shown by the black arrows.

PAGE 21

9 to that observed by steady state northern analysis. The enhancer element was subsequently delineated to a minimum size of 260bp, while still maintaining position and orientation independent enhancer activity. Studies to further characterize the size and composition by both deletion and electrophoresis mobility shift assay (EMSA) analysis demonstrated that this region contains multiple interacting elements. The EMSA analysis also confirmed the existence of stimulus-dependent protein binding and demonstrated the potential complexity that is mediated through protein-protein interactions, since smaller overlapping deletions eliminated stimulus-specific protein complexes. Further work showed that a minimal enhancer fragment could be linked to the minimal thymidine kinase (TK) promoter and still be active in an orientation independent manner. Additionally, the corresponding enhancer element in the human gene was also linked to the TK promoter and displayed the same characteristics as the rat enhancer (Rogers et al. 2000). This is not surprising given the high level of identity across species in this region of Intron2 (Figure 1-2). The minimal enhancer region in the rat gene is located in the last 500bp of intron 2. Complementary work in the mouse gene was conducted using chloramphenicol acetlyltransferase (CAT) reporter assays to study the enhancer capabilities, showing that the same region was involved in pro-inflammatory mediated induction (Jones et al. 1997). Enhancers Enhancers are by definition genomic DNA sequences that have the ability to activate gene transcription at a distance, in the forward or reverse orientation and in combination with a heterologous promoter (a promoter other than its own). The first known enhancer was found in the simian virus 40 (SV40) viral genome, in the form of

PAGE 22

10 two 72bp tandem repeats which were located upstream from the early promoter transcriptional start site (Benoist & Chambon 1981). When these 72bp repeats were deleted, transcription from the SV40 early gene start sites was decreased. Later the same year, the Schaffner laboratory (Banerji et al. 1981) demonstrated that this same region of SV40 when linked to the -globin gene was able to increase transcription 200 fold over basal levels in a transient transfection reporter assay, demonstrating that enhancer activity was not specific to the viral genome. They also were the first to coin the term “Enhancer”. The SV40 viral enhancer contains multiple protein binding sites that act synergistically in a cell specific manner (Xiao et al. 1991). The Chambon laboratory identified proteins binding sites within the enhancer, and found that one of the proteins, GTIIC, was cell type specific (Xiao et al. 1987), on further isolation the protein was renamed as transcriptional enhancer factor-1 (TEF-1) (Davidson et al. 1988). The immunoglobulin kappa light chains’ enhancer was one of the first cellular enhancers identified, and from this work isolation of the NF-B complex was accomplished (Baeuerle & Baltimore 1989), which was also found to bind the SV40 enhancer (Sen & Baltimore 1986a). Since these initial observations many cellular enhancers have been found and are currently being investigated. Eukaryotic enhancer driven activity is context dependent, requiring the permission of the endogenous DNA chromatin structure as well as access to the appropriate transcription factors. Chromatin is composed of chromosomal DNA, histones and a multitude of non-histone proteins. Each chromosome is composed of one long double stranded genomic DNA that is highly compacted through the wrapping of 146 bp of DNA around 8 core histone proteins, forming a nucleosome core particle, each nucleosome is

PAGE 23

11 separated by linker regions of DNA which regulate the further compaction of genomic DNA into a 30 nm filament. Adjacent nucleosomes are connected through the interaction of histone H1 which also plays a critical role in higher order chromatin structure. Most relevant to this thesis is that the chromatin structure is functionally linked to gene regulation. The wrapping of DNA around histone core proteins is one method to regulate gene transcription, by making silent genes inaccessible to enhancing factors (heterochromatin) or by making regulatory regions accessible to potential activating factors (euchromatin). Throughout development and in response to stimuli genes are turned on and off through the reversible accessibility of transcription factors, demonstrating the dynamic nature of the chromatin structure. In order to accomplish this, the core histones themselves are modified. Histone modifications occur on the amino terminal ends of core histones and include acetylation, deacetylation, phosphorylation and methylation. The most studied enzymes that are responsible for two of these modifications are the histone acetyltransferases (HAT) and histone deacetylases (HDAC), which can function individually or as part of a multi-subunit nucleosomal remodeling complex such as the SWI/SNF complex originally isolated from yeast (Cairns et al. 1994). Gene activation requires an accessible chromatin structure for transcription factor interaction with enhancing sequences, but it is not the only requirement for gene activation. Transcription cannot occur without the basal transcriptional machinery which includes RNA Polymerase II (RNA Pol II) and its associated factors, TFIIA, TFIIB, TFIID (containing TATA Binding Protein (TBP) and TBP associated factors (TAFs)), TFIIE, TFIIF and TFIIH being present at the promoter. How the factors binding at the

PAGE 24

12 enhancer often large distances away and the factors at the promoter interact is still under debate. Multiple models have been proposed to explain enhancer action. The most popular are looping and linking, and more recently, the facilitated tracking model (Blackwood & Kadonaga 1998). The looping model, which has been the most prevalent model in recent years, suggests direct contact between promoter and enhancer bound transcription factors, with the intervening DNA looping out. Experimental evidence supporting the looping model, includes electron microscopy visualizing the bacterial repressor binding two operator sequences separated by five helical turns, if nonhelical increments are introduced looping does not occur (Ptashne 1986). The linking model suggests that protein factors progressively bind the region between enhancer and promoter, thus remodeling the chromatin structure (Ptashne 1986; Bulger & Groudine 1999). The linking and looping models have been suggested as a potential mode of action for transcription of the human -globin genes whose transcription is regulated by a locus controlling region (LCR) located upstream of the genes (Bulger & Groudine 1999). The facilitated tracking model suggests that the entire enhancer bound complex moves along the chromatin until it encounters the promoter, at which time a stable loop is formed (Blackwood & Kadonaga 1998). Recent evidence supporting this model utilizes the chromatin immunoprecipitation assay (Chapter 5) and DNase I hypersensitivity studies to follow the location of factors bound to the HNF-4 gene during cellular differentiation. These investigators found that the entire enhancer complex of proteins moves along the DNA until reaching the promoter at which time a nucleosome is remodeled at the transcriptional start site and all enhancer and promoter factors are found in the same

PAGE 25

13 location. They do not however, directly pr ove a loop structure is present (Hatzis & Talianidis 2002). The exact mechanism utilized by genes to activate transcription from large distances has clearly not been determin ed at this time, however, newer techniques are being developed that could potentially help answer this question. The assembly of protein factors at the enhancer/promoter complex regardless of how it occurs is critical for transcriptional regulation. Transcription is reliant on multiple protein interactions, specific interactions at an enhancer for example is dependent on both the sequence itself and the combination of fact ors that bind the sequence. Transcription factors often have partners, and depending on the partner the outcome can be activation or repression. The context of gene regulati on including the availabil ity of factors and the chromatin environment is extremely important as each cell type potentially will have different transcription factors avai lable for use in gene regulation. Protein Contact Sites in the Enhancer The MnSOD enhancer region has been dem onstrated to contain multiple inducible protein contact sites. This was determined through in vivo DMS footprinting analyses using cells induced by the proinflammatory mediators TNF and IL-1 as compared to uninduced cells (Rogers 2000; Jones et al. 1997). Dr. Rogers in our laboratory designated areas of multiple contact sites wi thin the enhancer region as Sites 1-4. Computer based consensus sequence analysis on Site 2 implicated C/EBP , NFB, and Oct-1 (in descending order) as the transcription factors potentially able to bind this region of DNA. However, supershift and comp etitor EMSA analyses suggested that the C/EBP-X site (Figure 1-3) is not bound by C/EBP (although the C/EBP-X nomenclature is still used) (Jones et al. 1997).

PAGE 26

14 RATCTGGGGGCATCTAGTGGAGAAGTGTGGTATTTTAGCATAG TTGTGT...AAGTGGCCCA. HUMAN CTGGAGGCATCTAGTGGAAAAATGCAGTATTTCAGCCTGA TTGTGTTTGAAGTAAATGATCHIMPCTGGAGGCATCTAGTGGAAAAATGCAGTATTTCAGCCTGA TTGTGTTTGAAGTAAATGACMOUSE CGAGGGGCATCTAGTGGAGAAGTATAGTATTTCAACATAA TTGTGT...AAGTGGCCAA. RAT ACCAAGAGAA GGAAAT..TACCACATTCTGGAAATTTTA CTTGCAATAAG CAAATCACAT HUMANTAAAAGAGGA GGAAGT..TACCACATTCTGGAAGATTTACTTG....... ..AGACAGAC CHIMPTAAAAGAGGA GGAAGT..TACCACATTCTGGAAGATTTACTTG....... ..AGACAGAC MOUSE TCCAAGAGAG GGAAATATTACCACATTCTGGAAATTTTACTTGCAATAAG CAAATCACAC RAT AA.TCGTGAAT.ACGGGAAG AGACTC..TGATTTA.GGAAATGACAGATT TGGGAAGGCTHUMANGAACCTTGAATTACGGGAAA AGGCCCCGTGATTTA.GGAAATAACAAATT TGGGAAACATCHIMP GAACCTTGAATTACGGGAAA AGGCCCCGTGATTTA.GGAAATAACAAATT TGGGAAACATMOUSEAAATCTTAAAT.ACGGGAAG AGACTG..GGATTTTTGGAAATTGCAGATC TGGGA.GGATRAT GTGGTAATAGTGA.GTAGGGGAAAAGCCCAGTTGGGAAAT CGTTTCCTCTAAGGTGACATHUMAN GTAATGGG.GAGAGACTGGGGAATACCCCAGTTGTGAAAG TACTTCCTGTAAGGCAACATCHIMPGTAATGGG.GAGAGACTGGGGAATACCCCAGTTGTGAAAG TACTTCCTGTAAGGCAACATMOUSEGTGGTAATAGTGAAGCAGGGGAATAGCCCAGTTGGGAAAG CATTTCCTTTAAGGTGACAT Figure 1-2. Alignment of Rat, Human, Chimp and Mouse MnSOD intron 2 region. Grey highlighting demonstrates identical nucleotides in all four sequences. The underlined sequence was utilized for first One-Hybrid analysis.

PAGE 27

15 C/EBPNF-kBMaeharaet al. 1999GGAAATAT TACCACATTCTGGAAATTTTAC CCTTTATA ATGGTGTAAGACCTTTAAAATG GGAAATTACCACATTCTGGAAATTTTACCCTTTAATGGTGTAAGACCTTTAAAATGOne-Hybrid SequenceC/EBP-1C/EBP-XJones et al. 1997 MouseRat Figure 1-3. Comparison of nomenclature and sequence between Jones et al. 1997, Maehara et al. 1999 and our study (One-Hybrid Sequence). The mouse sequence of Site 2 (Rogers 2000) has 2 additional nucleotides that the rat sequence does not contain (shown in bold).

PAGE 28

16 Additionally, the Isobe laboratory did over-expression studies utilizing reporter constructs containing the MnSOD promoter and/or enhancer region, and found that C/EBP was not involved in the induction seen through these regions. Conversely, however, supershift EMSA analysis on this region, demonstrated that C/EBP and C/EBP, but not C/EBP were in the mouse NIH-3T3 complex that binds the site seen in Figure 1-3 (Maehara et al. 2000), suggesting an alternative role for C/EBP in the enhancer complex. The Isobe laboratory did further EMSA and over-expression studies on the region including mutational analysis and concluded that the Jones C/EBP-X site was the binding site of the p65 subunit of the NFB complex, which will be addressed in Chapter 2. At the time this project began, there was obviously some conflict with regards to the protein factors binding this intronic enhancer element. In order to determine the actual protein factors that bound the enhancer region a One-Hybrid analysis was done utilizing Site 2 in the enhancer (Rogers 2000). Site 2 is equivalent to the C/EBP-1 and C/EBP-X named sites from Jones et al. (1997) and sites A (CEBP) and B (NF-B) from the work of Maehara et al. (1999) (Figure 1-3). The original studies to determine the factors binding the enhancer began from a computer based data analysis on known transcription factor binding sites. While this method is useful and provides good initial data, we wanted to determine what factors were binding in an in vivo situation and therefore utilized the One-Hybrid assay. The results of these analyses are discussed at length in this dissertation, but the important point here is that one of the factors isolated from the One-Hybrid assay was not originally in the transcription factor DNA binding

PAGE 29

17 database (TransFac); and therefore would have been missed had we relied solely upon the computer analysis.

PAGE 30

CHAPTER 2 MATERIALS AND METHODS Materials Items purchased from New England Biolabs included restriction endonucleases, T4 DNA Ligase, Klenow (the large fragment of E .coli. DNA Polymerase), T4 Polynucleotide Kinase (201S) and Vent Polymerase (254S). Items purchased from Sigma Chemical Company (St. Louis, MO) included Lithium Acetate (LiAc) (L-6883), Polyethylene glycol (PEG) (P-3640), X-gal, Albumin from bovine serum (A7511), Dimethyl sulfoxide (DMSO) (D8779), goat serum and Flag M2 antibody (F3165). Items purchased from Invitrogen technologies included Random Primers DNA Labeling System (18187-013) and proteinase K (25530-015). Items purchased from Qiagen included QIAquick Nucleotide Removal kit (28304), QIAquick Gel Extraction kit (12162), QIAprep Spin Miniprep kit (27106), Qiagen Plasmid Midi kit (12144), and Qiagen Plasmid Maxi kit (12162). Items purchased from Amersham Biosciences included Protein A Sepharose CL-4B (17-0780-01), Protein G Sepharose (17-0618-02), Hybond-ECL Nitrocellulose membrane (RPN68D), Hyperfilm MP (RNP 1677K, RNP30H), ECL Western Blotting Analysis System (RPN2108), E. coli. BL21 protease deficient competent cells (27-1542), pGEX-6P-1 GST fusion kit (27-4597), and G50 sephadex columns. Items purchased from New England Nuclear (NEN) Life Sciences Products, Boston, MA included [-32P] dATP, and dTTP (3,000 Ci (111TBq)/mmol) (BLU013H), [-32P]ATP (3,000 Ci (111TBq)/mmol) (BLU002A). Items purchased from Roche Technologies included Fugene6 transfection reagent (1-815-091), Interleukin 1 18

PAGE 31

19 (IL-1) and complete protease inhibitor cocktail (1-697-498). Zetabind positively charged nylon transfer membrane (NM511-01-045SP) was purchased from Cuno, Meriden, CT. Items purchased from Stratagene included the QuickChange Site-Directed Mutagenesis Kit, and XL-10 competent cells (200518). Slide-A-Lyzer Dialysis Cassette (66415) (10,000MWCO, 0.1-0.5 ml capacity) was purchased from Pierce. Yeast One-Hybrid materials included a pre-transformed human brain MATCHMAKER cDNA library (HY4004AH), rat lung MATCHMAKER cDNA library (RL4006AH), sheared, denatured herring testes carrier DNA (K1606-A), yeast strain YM4271, YPD medium (8600-1) containing Difco peptone and yeast extract, and supplemental dropout medias were purchased from Clontech. Bacterial lipopolysaccharide (LPS) E. coli serotype 055:B5 (L 2880) and Recombinant Tumor necrosis factor (TNF) were gifts from Genentech. Antibodies against TEF-1 (610923) were purchased from BD Transduction Laboratories, p65 (C-20, sc-109), p50 (D-17, sc-1192), c-myc (sc-789), C/EBP (sc-150), C/EBP (sc-151) antibodies and Protein A/G agarose (sc-2003), and BSA (sc-2323) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies to MnSOD (SOD-110) were purchased from Stressgen, Sp1 (07-124) antibodies were purchased from Upstate biotechnology. Prolong Antifade kit (P-7481), Alexa Fluor 488 goat anti-mouse IgG (H+L) (A-11029), Alexa Fluor 594 goat anti-rabbit IgG (H+L) (A-11037), Hoechst 33342 (10 mg/ml in water) (H-3570) were purchased from Molecular Probes in Eugene, OR. Paraformaldehyde (15713) was purchased from EM Sciences.

PAGE 32

20 Methods Yeast One-Hybrid Screening Vector construction Three tandem copies of the rat MnSOD intron 2, Site 2 sequence (5’GGAAATTACCACATTCTGGAAATTTTAC3’) were synthesized by Gibco BRL as top and bottom strands with either EcoRI/SalI or EcoRI/XbaI restriction sites on each end. The oligonucleotides were annealed by combining equivalent pmol amounts (53 pmol) of each strand in 250 mM Tris pH 7.7, incubating at 95C for 3 min followed by a gradual decrease in temperature to 4C, over 4 h. 400 pmol of the annealed oligonucleotides were phosphorylated at the 5’ends of the oligonucleotides by T4 polynucleotide kinase (NEB: 201S) to allow for later ligation. The kinase reaction was carried out at 37C for 1 h, and the enzyme heat inactivated at 65C for 20 min, and then samples were then cooled to room temperature. The annealed and kinased double stranded DNA was purified using the Qiagen PCR kit. The EcoRI/XbaI annealed oligos were ligated into the pHISi vector (Figure 2-1A) while the EcoRI/SalI annealed oligos were ligated into the pLacZi vector (Figure 2-1B), obtained from Clontech. Ligation reactions were transformed into XL-10 competent cells from Stratagene and spread on plates containing 75 g/ml of ampicillin; positive clones were verified by sequencing. Each clone was linearized with either Xho (pHISi) or NcoI (pLacZi) and used for transformation into the yeast YM4271 strain. Yeast integration The two vectors, pHISi and pLacZi were employed in this assay due to the unique qualities each contains. The yeast strain YM4271 obtained from Clontech contains a mutation in the endogenous HIS3 gene (which encodes an enzyme required for histidine

PAGE 33

21 biosynthesis) and therefore cannot grow on media lacking histidine (–HIS) unless a functional HIS3 gene is introduced. The pHISi vector contains a minimal HIS promoter in front of a functional HIS3 gene, allowing for low level HIS3 gene expression once the plasmid has been integrated, providing a method to select yeast containing this vector by plating on –HIS medium. This leaky HIS3 gene expression is later suppressed by including 3-aminotriazole (3-AT), a histidine biosynthesis inhibitor, to suppress background growth during the screening process. AB Figure 2-1. The pHISi and pLacZi vector maps from Clontech used to integrate enhancer sites into the yeast genome The pLacZi vector contains the minimal yeast cytochrome C1 promoter which regulates the LacZ gene. The LacZ gene allows for further verification of clones detected from library screening. This vector contains the URA gene which is used as a site of integration into the yeast genome allowing for growth on –URA plates when integrated. Integration is accomplished through linearization of each vector within either the HIS3 (pHISi) or URA (pLacZi) gene sites, allowing for homologous recombination to occur within the yeast genome at the corresponding sites. Transformation of the yeast YM4271 strain was done using the LiAc (lithium acetate) protocol. Yeast cells were grown until they were in log-phase growth (OD600

PAGE 34

22 between 0.4-0.6), at which time they were harvested for preparation of competent cells. Transformation of competent cells was accomplished by centrifugation of cells at 1000 X g for 5 min at RT, resuspending cells in a 1X TE/ LiAc solution, adding 1 g of linearized or uncut plasmid (as a control) with 100 g of herring testes carrier DNA, followed by addition of a PEG/LiAc solution (1 ml 10X TE, 1 ml 10X LiAc, 8 ml 50% polyethylene glycol (PEG)). Cells were incubated for 30 min at 30C with shaking at 200 rpm, followed by dimethyl sulfate (DMSO) treatment, and a 15 min incubation at 42C. Transformed cells were centrifuged and resuspended in 150 l of 1X TE buffer and plated on appropriate media lacking either histidine (-HIS) or uracil (-URA) to test for integration. Only yeast strains containing the integrated plasmids which have corrected the mutation within the yeast genome will be able to grow on this media. pHISi transformed cells were plated on -HIS plates, while pLacZi transformed cells were plated on -URA plates, and incubated at 30C for 4-6 days. The colonies that formed were re-plated on the same medium plates and allowed to grow for 4-6 days (these can be stored at 4C for 3-4 weeks maximum). To test for the ability of the pHISi integrated yeast strain to be used when screening a library, the ability of the yeast to grow on –HIS media must be suppressed, this is accomplished with the competitive inhibitor of the yeast HIS3 protein, 3-AT (3-amino-1,2,4-triazole) (Sigma A-8056). The optimal concentration of 3-AT was determined prior to library screening. One colony from each integrated strain was diluted, replated on –HIS plates containing a range of 3-AT concentrations including 0, 15, 30, 45 and 60mM, and incubated at 30C for 4-6 days, the optimal concentration here was determined to be 45 mM.

PAGE 35

23 The pLacZi vector allows for the expression of -galactosidase upon binding of a library protein to the integrated sequence that is being studied. To determine if any other endogenously found yeast proteins are potentially binding the sequence of interest and activating the LacZ gene expression, a test for background expression was performed. This was accomplished by assessing the ability of the transformed yeast to hydrolyze X-gal (5-bromo-4-chloro-3-indolyl--D-galactopyranoside), which produces blue colonies through -galactosidase production, in a colony lift filter assay. The assay is conducted by adhering yeast colonies to a sterile filter, freeze thawing the filter to permeabilize the cells, and placing the filter on top of an X-gal/Z buffer (Z buffer contains Na2HPO4-7H20 16.1g/L, NaH2PO4-H20 5.5 g/L, KCl 0.75 g/L, MgSO4-7H2O 0.246g/L, pH7.0 autoclaved) solution. Z-buffer/X-gal solution contains 100 ml Z buffer, 0.27 ml -mercaptoethanol, and 1.67 ml of 20 mg/ml X-gal in DMF stock) soaked filter. The time at which the first blue colony is seen is the maximum amount of time to be used when double checking positive colonies from a library screen: 2 h in this case. The LacZ plasmid is integrated into the yeast genome first at the URA site, followed by a second transformation integrating the pHISi plasmid into the HIS gene site, followed by the above tests, thus three layers of stringency are able to be used, the ability to grow on –HIS and –URA media, and the ability to hydrolyze X-gal based on production of -galactosidase. An additional stringency level is added during library screening with an introduction of another growth media requirement. Library screening Two methods were employed in this thesis for One-Hybrid screening. The first method for the majority of this thesis utilized the ability of yeast to mate. A human brain

PAGE 36

24 library maintained in the MAT yeast strain Y187 was purchased from Clontech. The cDNAs in this library were inserted into the pACT2 plasmid (Figure 2-2) which generates a fusion protein containing the GAL4 AD (activation domain) (amino acids 768-881) fused to each brain cDNA in the library protein, as well as the LEU2 (leucine) gene adding further stringency to the library screen by allowing only interactive protein-DNA partners to grow on medium lacking leucine, histidine and uracil. Figure 2-2. The pACT2 plasmid vector map from Clontech containing library cDNAs The pHISi/pLacZi integrated MATa YM4271 yeast strain was mated with the MAT pre-transformed library Y187 yeast strain through overnight incubation at 30C with gentle swirling (30-50 rpm). Cell mixtures were centrifuged at 1000 X g for 10 min at RT, the cell pellet was resuspended in YPDA media containing kanamycin and the total volume was measured for later calculation. Library mating mixtures were diluted and spread on –Leu media plates at the following dilutions: 1:10, 1:100, 1:1000, 1:10,000. Library titer was determined by dividing the number of colonies by the plating volume (mls) times the dilution factor. With this protocol 1 X 108 cfu/ml were screened from the brain cDNA library.

PAGE 37

25 Alternative One-hybrid Screening Protocol (results described in Appendix) Site 4 within the rat MnSOD intron 2 enhancer region was made in triplicate tandem repeats as described with the following Site 4 sequence: 5’ GTAGGGGAAAAGCCCAGTTGGGAAATCGTTT3’. A rat lung cDNA library was purchased from Clontech and expanded as follows: First, a library titer determination was done by taking an aliquot of the library and determining the dilution necessary for 50,000 colony forming units (cfu) to be grown per plate, cells were then allowed to grow at 30C for 2-3 days to make sure underrepresented colonies were recovered. The colonies were collected by adding 5 ml of LB media per plate, scraping the colonies off, pooling them into one sterile flask, and repeating this procedure with another 5 ml of LB. The final pooled volume was used in multiple Qiagen plasmid preparations in order to obtain the amplified library, which was used in this second screen. Transformation of the integrated yeast strains with the library plasmid was done using the LiAc procedure with 20 g of library plasmid DNA, and 2 mg of sheared herring testes carrier DNA. The transformation mixtures were plated as follows: To determine the transformation efficiency, 200 l of a 1:100 dilution was plated on 100 mm -LEU plates. The remaining mixture was spread on 150 mm –HIS-URA-LEU+[3-AT] plates, (500 l per plate) and incubated at 30C for 4-6 days. The largest colonies were replated on two new 150mm –HIS-URA-LEU+ [3-AT] plates; one plate was used for the -galactosidase colony-lift filter assay, which was described earlier as a secondary screen to verify positive clones, and one plate was stored as a master plate. 5 X 105 cfu were screened from the rat lung expanded library.

PAGE 38

26 Plasmid Construction TEF-1, TEF-3 and p65 cDNA’s obtained from the Clontech library screen were subcloned into Invitrogens pcDNA3.1 amp vectors as well as Clontech’s myc and Flag N terminally tagged vectors. Site directed mutagenesis was done using the Stratagene Quick Change Mutagenesis kit. The p65-TA and p50 plasmids were a kind gift of Dr. Mary Waltner-Law. Tissue Culture L2 rat lung epithelial cells (type 2) from ATCC (CCL 149) were grown in Hams F12K medium (Life Technologies-N-3520) supplemented with 10% fetal bovine serum, 10 g/ml penicillin G, 0.1 mg/ml streptomycin, and 0.25 g/ml amphotericin B, at 37C in humidified air with 5% CO2. Human fetal lung fibroblast cells were also grown in F12K medium. Experimentally, cells were grown to 60-65% confluency, transfected with 10 g of DNA and 30 l of Fugene in serum free media on 100 mm tissue culture plates, two plasmid transfections were done equimolar using the same DNA/Fugene ratio. 3 h after DNA/Fugene mix addition, cells were washed with PBS two times and fresh media added. RNA or protein isolation was done 12, 24 & 48 h post transfection depending on the experiment. Transfections which included stimulation with pro-inflammatory mediators were done in a batch method with a 150 mm plate being transfected with 20 g of DNA, same Fugene ratio, and the cells being split 1:4 into 100 mm plates the following day, 40 h post transfection cells were induced with LPS (0.5 g/ml), TNF (10 ng/ml), or IL-1 (2 ng/ml) versus no induction. RNA Isolation and Northern Analysis Total cellular RNA was isolated by the acid guanidinium thiocyanate extraction method described by Chomczynski and Sacchi (1987) with modifications (Visner et al.

PAGE 39

27 1990). Briefly, cells were grown to confluency, washed once with room temperature PBS, followed by 3 ml of guanidinium thiocyanate solution (GTC) (4M guanidinium thiocyanate, 25 mM sodium citrate pH 7.0, 0.5% sarcosyl, and 0.1 M 2-mercaptoethanol) per 100 mm plate. The homogenate was transferred to a 15 ml conical polypropylene tube and 0.1 volume of 2 M sodium acetate pH 4.0, an equal volume of water saturated phenol and 0.2 volumes of chloroform: isoamyl alcohol (IAA) (49:1) was added, mixed vigorously and incubated on ice for 15 min. The final mixture was centrifuged for 20 min at 4C. Following centrifugation, the upper aqueous phase was transferred to a fresh tube and mixed with an equal volume of isopropanol to precipitate the RNA. Following incubation at -20C for 1 h minimum, samples were centrifuged at 10,000 X g for 30 min at 4C. The RNA pellet was resuspended in 500 l of GTC and transferred to a 1.5 ml RNAse free eppendorf tube. The RNA was again precipitated with an equal volume of isopropanol, and incubation at -20C for 1 h minimum. Centrifugation at 10,000 X g for 15 min at 4C was followed by addition of 400 l of DEPC treated water and incubation at 50C for 15 min. The RNA was precipitated with 0.1 volume of DEPC treated 3 M sodium acetate pH 5.2, and 2.2 volumes of 100% ethanol, followed by incubation at -20C for 1 h minimum. The precipitated RNA was centrifuged, resuspended in 300 l of DEPC treated water, and ethanol precipitated again. The final pellet was dried in a Savant speed-vacuum centrifuge to remove any trace amounts of ethanol, and resuspended in DEPC treated water. RNA concentration was determined by measuring the absorbance at 260 nm in a Beckman DU-64 Spectrophotometer (Beckman Instruments, Inc.). The purity of the RNA was determined by the 260 nm/280 nm absorbancy ratio (1.5-2.0).

PAGE 40

28 15 g of total RNA was lyophilized and resuspended in 25 l of loading buffer containing 50% formamide, 6.6% formaldehyde, 6 mM sodium acetate pH 7.4, 0.5 mM EDTA pH 8.0, 20 mM 3-(N-morpholino) propane sulfonic acid (MOPS) pH 7.0. RNA was dissolved through incubation at 50C for 10 min followed by incubation at 65C for 10 min. Loading dye containing 0.4% xylene cyanol FF, 0.4% bromophenol blue, 1 mM EDTA pH 8.0, 50% glycerol, and 0.3 g/l of ethidium bromide was added prior to gel loading. The ethidium bromide allowed for visualization of ribosomal RNA under UV light, giving an estimate of the equivalence of loading. Total RNA was size-fractionated on a 1% agarose-formaldehyde gel overnight. The gel was then treated for 30 min with 50 mM NaOH, 30 min with 100 mM Tris-HCl pH 7.0, and two times for 25 min with 50 mM TBE (10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0). The RNA was electrotransferred to a charged nylon membrane (Zetabind, Cuno Laboratory Products) in 40 mM TBE for 1 h and UV covalently cross-linked for 3 min (Church & Gilbert, 1984). The membrane was hybridized with randomly primed double stranded (Random primers DNA labeling system) 32P-labeled probes over night, followed by washing with the same solution at a temperature 5 degrees higher than hybridization temperature. Blots were exposed to autoradiograph film. All autoradiographs shown are the result of a minimum of 3 independent experiments. Densitometry was done using NIH Scion Image analysis. Statistical analysis was done using a T test: Paired two sample for Means, two-tailed p values were used, with *=<0.5, and ***=<.0005.

PAGE 41

29 Co-Immunoprecipitation Analysis Total cell lysate Rat lung epithelial L2 cells were transfected at 65-70% confluency with Fugene as described and protein was isolated 10, 24 or 48 hours post transfection by washing cells with cold PBS on ice, followed by isolation of cells in 1 ml of chilled RIPA lysis buffer with protease inhibitors. Cells were incubated with RIPA lysis buffer for 30 min at 4C with rocking to ensure cellular lysis, followed by centrifugation at 14,000 X g for 15 min at 4C to remove cellular debris. The supernatant was transferred to pre-chilled 1.5 ml eppendorf tubes, and either used for western analysis or for immunoprecipitation studies. For western analysis 10 l aliquots were used to determine protein concentration with the Pierce Bicinchoninic Acid (BCA) assay kit (23227), all standards were done in triplicate. For immunoprecipitation, 100 l of total protein was transferred to a separate pre-chilled tube for later protein concentration determination; the remaining solution was used for immunoprecipitation. The remaining lysate solution was either split into two 500 l aliquots (500 l RIPA buffer was added to each for a total of 1 ml per immunoprecipitation), one half being used for beads only, while the other half was used for antibody precipitation, or total lysate was used. Immunoprecipitations were accomplished by incubation with either p65 or c-myc antibodies for 1 h at 4C followed by addition of 25 l ProteinA/G agarose beads from Santa Cruz to capture antibody-antigen complexes for 1 h at 4C. Antibody-antigen complexes were washed 4X with RIPA buffer (5-10 min each) at 4C, 25 l Laemelli buffer was added to remaining beads containing antibody-antigen complexes. Samples were the boiled for 5 min, centrifuged briefly, and the supernatant was loaded onto 10% Tris-HCl SDS-PAGE

PAGE 42

30 gels, run for 1 h at 100 V using Tris buffer. SDS PAGE gels were transferred to nitrocellulose membranes (Amersham) either overnight at 30 V at 4C or for 1 h at 100 V at 4C. Membranes were subsequently blocked with 7% BSA (Santa Cruz) in TST-T with 0.2% NaAzide for either 1 h at RT or overnight at 4C. Blots were then washed for 15 min once, then two times for 5 min each in TST-T at RT. Primary antibodies were made in 7% BSA/TST-T with 0.2% Na Azide and incubated either for 1 h at 4C or overnight at 4C. Following primary antibody incubation, blots were washed as previously stated and incubated with secondary antibodies made up in 5% BSA/TST-T (no NaAzide) for 1 h at RT, followed by washes with TST-T. The following primary antibodies were used: monoclonal anti-TEF-1 (1:50), polyclonal anti-p65 (1:200), monoclonal anti-FlagM2 (0.5 g/ml), polyclonal anti-myc (1:250), polyclonal anti-MnSOD (1:5000), polyclonal anti-p50 (1:4000), polyclonal anti-C/EBP, polyclonal anti-C/EBP, polyclonal anti-Sp1 antibody. Secondary antibodies were used at concentrations ranging from 1:10,000 to 1:20,000. Immunoblotting visualization was accomplished using Amershams ECL kit. Nuclear extract Rat lung epithelial type 2 like L2 cells were grown to confluency on four 150mm dishes per condition, IL-1 cells were induced for 1 h. Cells were washed two times with cold PBS, and collected in 1 ml of PBS per plate and transferred to a 15 ml conical tube. Cells were centrifuged at 1200 rpm for 3 min at 4C, and cellular pellets were resuspended in 2 mls of cold lysis buffer (20 mM Hepes pH7.6, 10 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, 20 mM Glycerol, 1 mM DTT, 1 mM PMSF and protease inhibitor cocktail from Boehringer), kept on ice for 5 min, centrifuged at

PAGE 43

31 2200 rpm for 5 min at 4C, and the cytoplasmic supernatant was transferred to a pre-chilled eppendorf tube, flash frozen in liquid Nitrogen (N2) and put at -80C for later protein concentration determination. The remaining cellular pellet was resuspended in 1 ml nuclear extraction buffer (20 mM Hepes pH 7.6, 400 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 20% Glycerol, 1 mM DTT, 1 mM PMSF and protease inhibitor cocktail from Boehringer) by gentle rocking at 4C for 1 h, followed by centrifugation at 11,000 rpm for 10 min at 4C. The supernatant was transferred to pre-chilled tubes kept on ice. The nuclear extract supernatant was dialyzed overnight with two changes of dialysis buffer (20 mM Hepes pH 7.8, 100 mM KCl, 10 mM MgCl2, 0.2 mM EDTA, 20% Glycerol, 1 mM DTT, 1 mM PMSF and protease inhibitors) at 4C using membranes with molecular weight cut offs of 12-14,000. Nuclear immunoprecipitation Nuclear extracts were pre-cleared with 2 g of control mouse IgG and 60 l Protein G agarose for 1 h at 4C with gentle rocking, extracts were then centrifuged at 4C. The supernatant was transferred to a fresh pre-chilled tube, and incubated with 20 g anti-TEF antibody for 1 h with rocking at 4C, followed by the addition of 30 l Protein G agarose for antibody-antigen capture for 2.5 h at 4C with rocking. Complexes were washed 4X with cold PBS containing protease inhibitors, and antibody-antigen-agarose bead complexes were resuspended in 30 l Laemelli buffer, boiled for 5 min, and run on 10% Tris-HCl SDS-PAGE gels for 1 h at 100 V. Gels were transferred as described and probed with anti-p65 antibody (1:200). Anti-rabbit secondary-HRP (horse radish peroxidase) linked antibody was used at 1:20,000.

PAGE 44

32 Immunohistochemical Analysis Rat lung epithelial type 2 like L2 cells were grown to approximately 50% confluency on glass coverslips where they were transfected with Fugene at a 1:3 ratio of DNA:Fugene. 12, 24 or 48 h post transfection cells were washed 2X with serum free media, fixed with 4% Paraformaldehyde made in serum free media for 10 min RT, washed 1X with serum free media, 3X with PBS at RT and additionally fixed with 100% Methanol for 5 min at -20C. Cells were washed 2X with PBS at RT, blocked with 10% goat serum in PBS for 1 h at RT or overnight at 4C. Primary antibodies to TEF-1 (monoclonal) and p65 (polyclonal) were used at a concentration of 1:50 in 10% blocking solution and incubated for 2 h at RT or overnight at 4C. Bound primary antibodies were detected with Alexa fluorochrome conjugated anti-mouse FITC (1:300) or anti-rabbit Texas Red (1:500) for monoclonal and polyclonal primary antibodies respectively. Secondary antibodies were incubated at RT for one hour in the dark along with Hoescht dye (1:1000) to stain nuclei. Cover slips were mounted using the Prolong Antifade kit (molecular probes) and images were acquired with a Spot camera attached to a Zeiss Axioplan 2 microscope using a 20X objective. For comparative pictures, gains were kept at the same level for primary pictures and secondary antibody only controls. For analysis of tagged proteins, fixation was done with either 100% acetone for 2 min at RT or 100% MeOH for 5 min at -20C, all remaining procedures were identical. Chromatin Immunoprecipitation (ChIP) Rat lung epithelial type 2 like L2 cells were grown to 100% confluency on 150 mm plates and crosslinked with 1% formaldehyde for 5-10 min at room temperature and quenched with 125 mM glycine for 5 min at RT. Cells were then washed two times with

PAGE 45

33 PBS containing protease inhibitors, and collected in 1 ml of PBS, centrifuged at 8,000 X g for 1 min at 4C, and resuspended in cold swelling buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40 plus protease inhibitors) and incubated on ice for 10 min. Swelled cells were centrifuged at 5,000 rpm for 5 min at 4C, and the cellular pellet was gently resuspended in 1 ml lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris pH 8.1, and protease inhibitors). The chromatin lysate was sonicated using a Branson Model 500 Dismembrator (purchased from Fisher Scientific) at 40% amplitude for six 8 sec bursts with 2 min rest on ice between each burst. Sonicated lysate was transferred to a 1.5 ml eppendorf tube and centrifuged at 13,000 rpm for 5 min at 4C. Supernatant was transferred to a pre-chilled 15 ml conical tube on ice, 50 l was saved for verification of size fractionation. Remaining supernatant was diluted 1:10 in ChIP dilution buffer (0.1% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris pH 8.1, and 167 mM NaCl), mixed and either stored at -80C in aliquots or directly used in 1 ml aliquots following preclearing of samples. Samples were pre-cleared with 60 l of either Protein A sepharose beads blocked with 3% protease free BSA or 60 l of Protein G sepharose in TE. Pre-clearing was done for 2 h at 4C with rocking, followed by centrifugation at 5,000 rpm for 5 min at 4C. Precleared supernatant was transferred to new pre-chilled 1.5 ml eppendorf tubes and antibodies were added as follows: 2 g anti-p65, 5 g anti-Sp1, 20 g anti-TEF-1, 2 g anti-C/EBP, and 2 g anti-C/EBP for overnight incubation at 4C with gentle rocking. Capture of complexes was accomplished with the addition of 60 l of Protein A or G sepharose blocked beads for polyclonal and monoclonal antibodies respectively, and incubation for 2 h at 4C (no antibody controls received the same amount of beads). Captured complexes were washed successively one

PAGE 46

34 time each with the following solutions: low salt (0.1% SDS, 1% Triton X-100 (vol/vol), 20 mM Tris pH 8.1, 2 mM EDTA, and 150 mM NaCl), high salt (0.1% SDS, 1% Triton X-100 (vol/vol), 20 mM Tris pH 8.1, 2 mM EDTA, and 500 mM NaCl), LiCl (250 mM LiCl, 1% NP-40, 1% sodium deoxycholate (DOC), 10 mM Tris pH 8.1, and 1 mM EDTA) followed by three washes with TE (10 mM Tris pH 8.0 and 1 mM EDTA pH 8.0) at 4C with rocking. After the final TE wash, samples were eluted with 500 l of elution buffer (1% SDS and 100 mM NaHCO3) per sample and incubated for 20 min at RT with rocking on nutator. Eluted samples were centrifuged at 2,000 rpm for 2 min at RT, and supernatant transferred to a fresh 1.5 ml eppendorf tube. Prior to washing of complexes above, 500 l of no antibody samples was kept aside as INPUT controls. Proteinase treatment of eluted samples and INPUT controls was accomplished by the addition of NaCl [200 mM]f, EDTA [11 mM]f, Tris pH 7.0 [44 mM]f and 2 l of proteinase K (20 mg/ml) to digest protein for 1 h at 45C, followed by cross link reversal at 65C for 4 h. Samples were either stored at -20C or chromatin DNA was directly purified using the Qiagen PCR kit. Purified DNA was subjected to PCR with primers specific to the Rat MnSOD intron 2 enhancer: (top strand: 5’-CAGGTCTGGGAAACGGGTTGAGTAATTG3’, bottom strand: 5’ GAGGAAAGTTGTCAGATGTCACCTTAGAGG3’), and the MnSOD promoter (top strand: 5’-CAAGGCGGCCCGAGAAGAGGCGGGG-3’; bottom strand: 5’-CTTGGACACA-GCTAGGCGCTGAC-3’). PCR fragments were fractionated on a 1.5% agarose gel, and electrotransferred to a nylon membrane and hybridized with a ATP-radiolabeled oligo specific to a region within the amplified region. ChIP fragments were visualized by autoradioagraphy.

PAGE 47

35 Electrophoretic Mobility Shift Assay (EMSA) Glutathione-S-Transferase (GST) fusion protein preparation GST protein constructs were made by subcloning cDNAs into the pGEX6P-1 vector from Amersham Biosciences in frame with the GST sequence. The pGEX6P-1 GST fusion protein vector contains the Lacq gene which produces a repressor protein that binds to the operator region of the tac promoter, which regulates GST fusion protein expression. The tac promoter is induced using the lactose analogue isopropyl -D-thiogalactoside (IPTG) which causes the repressor protein to be released from the operator sequence, so that the bacterial RNA Polymerase machinery can activate transcription. Plasmid DNA was isolated and sequenced for verification prior to GST fusion protein isolation. BL21 (protease deficient) E.coli competent cells were used for transformation prior to GST fusion protein preparation. GST-fusion proteins were prepared as follows. Bacteria from the original transformation were grown in two 100 ml YT media solutions with 100 g/ml of ampicillin for 12-15 h at 37C with shaking. Cultures were diluted 1:100 in two 20 ml YT containing flasks and grown for 3-5 h until an A600 reading of 0.6-0.8 was achieved. To induce fusion protein expression, 1 ml of 10mM IPTG was added for a final concentration of 0.5 mM, and incubated for an additional 3 h at 37C with shaking. Bacterial cells were transferred to 50 ml conical tubes and centrifuged at 7700 X g for 10 min at 4C. Supernatants were discarded, pellets were drained thoroughly and resuspended in 1 ml cold PBS (10 l was saved for later analysis). Cells were lysed by addition of 10 l of freshly prepared lysozyme (10 mg/ml in water) in conjunction with freeze thawing in a dry ice and isopropanol bath a minimum of 10 times. Cells were centrifuged for 10 min at 4C to get rid of cellular

PAGE 48

36 debris and insoluble material. The supernatant was transferred to fresh pre-chilled tubes on ice, and 10 l was saved from the insoluble material for later analysis. For capture of GST fusion proteins, 20 l of 50% Glutathione sepharose slurry was added per 1 ml of sample and incubated with gentle agitation for 20 min at RT. This was followed by centrifugation at 2500 rpm for 5 min at 4C. The GST-glutathione matrix was washed 3X with 100 l PBS and GST proteins eluted 3X with 10 l of Glutathione elution buffer by incubating for 10 min at RT each time. GST fusion proteins were run (10 l) on a 10% SDS-PAGE gel along with collected control fractions to detect any potential steps of protein loss. Protein concentrations were done using the Pierce BSA kit. GST-proteins were further dialyzed against 20 mM Hepes pH 7.8, 100 mM KCl, 10 mM MgCl2, 0.2 mM EDTA, 20% Glycerol, 1 mM DTT, 1 mM PMSF and protease inhibitors using the Pierce Slide-A-Lyzer Dialysis Cassette (66415). Electrophoretic Mobility Shift Assay (EMSA) Complementary oligonucleotides were annealed and overhangs filled in with the Klenow fragment using 32P dTTP for 1 h at 37C with subsequent clean up done with G50 sephadex columns from Amersham. The DNA binding reaction was performed for 20 min. at RT in 10 mM Hepes pH 7.9, 1 mM MgCl2, 50 mM KCl, 1 mM DTT, 12% glycerol, 4 g Poly dA-dT with 0.8 pmol of each annealed oligo, and either 0.4 g TEF-GST or 18 ng p65-GST. Samples were run on 0.5X TBE gels for 2 h at 200V and dried for 45 min at 80C, and subjected to autoradiography. The following pairs of oligonucleotides were used: WT-Top: 5’ AAGAGAAGGAAATTACCACATTCTGGAAAT 3’, WT-Bottom: 5’ ATTTCCAGAATGTGGTAATTTCCTTC 3’, M-p65-Top: 5’

PAGE 49

37 AAGAGAATTCCCGGCAAACATTCTGGAAAT 3’, M-p65-Bottom: 5’ ATTTCCAGAATGTTTGCCGGGAATTC 3’, M-TEF1-Top: 5’ AAGAGAAGGAAATTACCAACGGAGGGAAAT, M-TEF1-Bottom: 5’ ATTTCCCTCCGTTGGTAATTTCCTTC 3’ Real-Time PCR Previously isolated RNA was reverse transcribed to cDNA by the use of a RT kit purchased from Invitrogen. Briefly, 1 g of total RNA was mixed with oligo (dT) primers and dNTP mix and incubated at 65C for 5 min. This was followed by addition of 5 mM MgCl2, 10 mM DTT, reverse transcriptase reaction buffer [1X]f and 1 l RNaseOUT Rnase Inhibitor. Mixture was incubated at 42C for 2 min, followed by addition of 1 l (50units) of Superscript II Reverse transcriptase, and incubation at 42C for 50 min. The reaction was terminated by 15 min incubation at 70C, followed by a brief 4C incubation, and addition of 1 l Rnase H to degrade any remaining RNA for 20min at 37C. For PCR reaction, 79 l of water was added to each tube and 1 l of this cDNA was used along with 1.2 l of MgCl2, 0.5 l of each 10 M primer, and 1 l of SYBR Green. The following primers were used: 5’R-IKB: 5’ CAGCAGACTCCACTCCACTTG3’;3’R-IKB: 5’GAGCGTTGACATCAGCACC3’ and Rat Cyclophilin A: PPIA#1: 5’GGTGGCAAGTCCATCTACGG3’, PPIA#2: 5’TCACCTTCCCAAAGACCACAT3’. Real time PCR reactions were done on the Roche Light Cycler machine.

PAGE 50

CHAPTER 3 ISOLATION OF TRANSCRIPTION FACTORS Introduction Manganese superoxide dismutase is a critical anti-oxidant enzyme necessary for proper cellular function. Because of its importance the gene and protein have been studied at length by various groups (Rogers et al. 2000, Maehara et al. 2000, Jones et al. 1997). Our laboratory has focused on the transcriptional regulation of the gene, and has identified an enhancer region within intron 2 of the rat and human MnSOD gene that is inducible with the pro-inflammatory mediators LPS, TNF, and IL-1 (Rogers et al. 2000). This region of intron 2 fits the description of an enhancer as it can work in the forward or reverse orientation, with its own promoter as well as a heterologous promoter, and can induce multiple genes besides the endogenous MnSOD gene. The ability of this complex enhancer to act in this manner is dependent on the interaction of multiple proteins that bind in a constitutive as well as inducible manner (Jones et al. 1997; Rogers 2000), and their involvement with the basal transcriptional machinery. Multiple proteins have been suggested to be involved in MnSOD enhancer regulation, among them NF-B (p50/p65), C/EBP, p65 and Sp1 (Maehara et al. 1999; Maehara et al. 2000; Jones et al. 1997). The premise for the original suggestion of these proteins was based on computer analysis using Transfactor binding databases. While this is an important beginning to determine which proteins are able to bind a sequence of DNA, it does not necessarily give a complete picture, as at any one time, the database you are looking at might not contain all the factors that have been studied. Additionally, it must be taken into 38

PAGE 51

39 consideration that the binding of a protein to a sequence of DNA does not on its own explain its function in terms of gene regulation. The first step is to determine which protein(s) bind the regulatory element in an in vivo environment. In order to determine the identity of the factors that directly interact with the enhancer region in a eukaryotic system, the yeast One-Hybrid assay was employed. The yeast One-Hybrid methodology is based on the previously characterized Gal4-UAS regulatory system that functions in yeast, whereby the yeast protein Gal4 binds an upstream activating sequence (UAS) through its’ activation domain (Fields & Song 1989). As Figure 3-1 outlines, a tissue specific cDNA library is generated, cloned into a plasmid containing the Gal4 activation domain and an auxotrophic growth gene resulting in a protein library where each protein is fused to the yeast Gal 4 activation domain. Upon specific-DNA binding, the Gal 4 activation domain is able to transactivate RNA polymerase II transcription, allowing for growth on minimal media. The DNA sequence of interest, in this case, enhancer Site 2 (Rogers 2000) is cloned in tandem triplicates into a vector containing an additional auxotrophic gene (-His), and is subsequently integrated into the yeast genome, conferring chromatin structure, and allowing for verification of integration through auxotrophic growth analysis. This dual selection system helps eliminate false positive interactions. The first yeast screen discussed here, utilized the mating ability of yeast; plasmids containing our DNA of interest were integrated into the yeast MATa strain, while the human brain library was maintained in the MAT yeast strain provided by Clontech. This allowed for simple mating of the two strains through incubation. As stated previously the MnSOD enhancer region within Intron 2 has multiple protein binding sites as determined by in vivo

PAGE 52

40 footprinting analyses (Rogers 2000; Jones et al. 1997). Through an analysis of in vivo footprinting data and mutational analyses on sites within the enhancer (Rogers 2000; Maehara et al. 1999) site 2 (Rogers 2000) was used for the initial One-Hybrid assay screen (underlined in Figure 1-3). GAL4AD cDNA LEU2Library Plasmid HIS3 Bait-DNA binding sites integrated into yeast genome -HIS/-URA/LacZ+ Transformation of AD fusion libraryinto reporter strainScreening for DNA-binding activities GAL4AD cDNA LEU2Library Plasmid GAL4AD GAL4AD GAL4AD Library protein GAL4AD HIS3 GAL4AD LacZ URA LacZ URA-HIS/-URA/-LEU/LacZ+ Figure 3-1. One-Hybrid Assay design depicting integration of binding site into yeast genome with referenced auxotrophic genes, and introduction of Gal4 Activation Domain (AD) fusion protein library plasmids containing additional auxotrophic gene (Leu2) Results The transcription factors isolated from the initial yeast One-Hybrid screen included Transcriptional Enhancer Factor-1 (TEF-1), Transcriptional Enhancer Factor -3(TEF-3), and p65. One copy of human TEF-1 was isolated that is 2253bp in length (Figure 3-2) , and is 2104bp shorter in the 3’ UTR as compared to the original Genbank sequence (Accession # NM_021961) of 4357bp isolated by Davidson et al. (1988). Three copies of human TEF-3 were isolated, with the longest being 1577bp (Figure 3-3), and containing additional 3’ UTR, as compared to the 1284bp sequence in Genbank (Accession # X94438). The p65 cDNA isolated is 2515bp in length (Figure 3-4), and is 748bp longer

PAGE 53

41 (combined additional length from both the 5’ and 3’ends) than the first published human p65 sequence which was 1767bp (Ruben et al. 1991) (Accession#M62399). A comparison of the original human p65 published sequence by Ruben et al. (1991) and that derived from The Wellcome Trust Sanger Institute ( http://www.sanger.ac.uk/ ), revealed a new genomic structure for the p65 gene. Our clone contained an additional 90 bp (Figure 3-5), when compared with the predicted genomic structure of Deloukas and van Loon (1993) and that derived from the human genome ( http://www.sanger.ac.uk/ ). Our sequence contains an additional 5’ exon that encodes the ATG and denotes a new transcription start site. This creates a 620bp intron separating what was previously predicted as exon 1 (Deloukas & van Loon 1993). This finding is further supported by the studies on the murine p65 gene which defined an exon 1a that is identical to that predicted by our cDNA (Linker et al. 1996). Interestingly, the Haseltine group (Ueberla et al. 1993) cloned the human p65 promoter (Accession #L01459) and defined a start site just downstream of our predicted site in March of the same year as Deloukas and van Loon (1993) who published in November of that year, apparently having not seen the work of Ueberla et al.. These results therefore define the existence of a new exon for the human p65 gene, a new transcription start site and show that the gene is comprised of 11 rather than 10 exons as depicted in Figure 3-6. The TEF-1 protein structure is depicted in Figure 3-7. The DNA binding domain acronym TEA/ATTS stands for TEA (TE for TEF-1 and the yeast TEC1, A for the Aspergillus abaA gene product) (Burglin, 1991) and ATTS (AbaA, TEC1p, TEF-1 sequence) (Andrianopoulos & Timberlake 1991). The DNA binding domain is theorized to contain either three -helices or one -helix and two sheets, no crystal structure has

PAGE 54

42 1GGGACCGGGA GCCGGGGAGG GAGCCGGGCA CCGAGCAGAG GGCGGGGGAA GCGGCGCCGACCCTGGCCCT CGGCCCCTCC CTCGGCCCGT GGCTCGTCTC CCGCCCCCTT CGCCGCGGCT61AGTTTGCCTC GGACTCGCCG GGCGCTGCGG TGGCTCCCTG GGCCGAGGTT TATTTTCTTGTCAAACGGAG CCTGAGCGGC CCGCGACGCC ACCGAGGGAC CCGGCTCCAA ATAAAAGAACIleGluProSerSerTrpSer121AAAAGGCTCC AGGCTTCGGC TTGGAAAATC CCACCGCCAA AATTGAGCCC AGCAGCTGGATTTTCCGAGG TCCGAAGCCG AACCTTTTAG GGTGGCGGTT TTAACTCGGG TCGTCGACCTSGlySerGluSerProAlaGluAsnMetGluArgMetSerAspSerAlaAspLysProIle181GCGGCAGTGA GAGCCCTGCC GAAAACATGG AAAGGATGAG TGACTCTGCA GATAAGCCAACGCCGTCACT CTCGGGACGG CTTTTGTACC TTTCCTACTC ACTGAGACGT CTATTCGGTTIAspAsnAspAlaGluGlyValTrpSerProAspIleGluGlnSerPheGlnGluAlaLeu241TTGACAATGA TGCAGAAGGG GTCTGGAGCC CCGACATCGA GCAAAGCTTT CAGGAGGCCCAACTGTTACT ACGTCTTCCC CAGACCTCGG GGCTGTAGCT CGTTTCGAAA GTCCTCCGGGLAlaIleTyrProProCysGlyArgArgLysIleIleLeuSerAspGluGlyLysMetTyr301TGGCTATCTA TCCACCATGT GGGAGGAGGA AAATCATCTT ATCAGACGAA GGCAAAATGTACCGATAGAT AGGTGGTACA CCCTCCTCCT TTTAGTAGAA TAGTCTGCTT CCGTTTTACATGlyArgAsnGluLeuIleAlaArgTyrIleLysLeuArgThrGlyLysThrArgThrArg361ATGGTAGGAA TGAATTGATA GCCAGATACA TCAAACTCAG GACAGGCAAG ACGAGGACCATACCATCCTT ACTTAACTAT CGGTCTATGT AGTTTGAGTC CTGTCCGTTC TGCTCCTGGTALysGlnValSerSerHisIleGlnValLeuAlaArgArgLysSerArgAspPheHisSer421GAAAACAGGT GTCTAGTCAC ATTCAGGTTC TTGCCAGAAG GAAATCTCGT GATTTTCATTCTTTTGTCCA CAGATCAGTG TAAGTCCAAG AACGGTCTTC CTTTAGAGCA CTAAAAGTAASLysLeuLysAspGlnThrAlaLysAspLysAlaLeuGlnHisMetAlaAlaMetSerSer481CCAAGCTAAA GGATCAGACT GCAAAGGATA AGGCCCTGCA GCACATGGCG GCCATGTCCTGGTTCGATTT CCTAGTCTGA CGTTTCCTAT TCCGGGACGT CGTGTACCGC CGGTACAGGASAlaGlnIleValSerAlaThrAlaIleHisAsnLysLeuGlyLeuProGlyIleProArg541CAGCCCAGAT CGTCTCGGCC ACTGCCATTC ATAACAAGCT GGGGCTGCCT GGGATTCCACGTCGGGTCTA GCAGAGCCGG TGACGGTAAG TATTGTTCGA CCCCGACGGA CCCTAAGGTGAProThrPheProGlyAlaProGlyPheTrpProGlyMetIleGlnThrGlyGlnProGly601GCCCGACCTT CCCAGGGGCG CCGGGGTTCT GGCCGGGAAT GATTCAAACA GGGCAGCCAGCGGGCTGGAA GGGTCCCCGC GGCCCCAAGA CCGGCCCTTA CTAAGTTTGT CCCGTCGGTCGSerSerGlnAspValLysProPheValGlnGlnAlaTyrProIleGlnProAlaValThr661GATCCTCACA AGACGTCAAG CCTTTTGTGC AGCAGGCCTA CCCCATCCAG CCAGCGGTCACTAGGAGTGT TCTGCAGTTC GGAAAACACG TCGTCCGGAT GGGGTAGGTC GGTCGCCAGTTAlaProIleProGlyPheGluProAlaSerAlaProAlaProSerValProAlaTrpGln721CAGCCCCCAT TCCAGGGTTT GAGCCTGCAT CGGCCCCAGC TCCCTCAGTC CCTGCCTGGCGTCGGGGGTA AGGTCCCAAA CTCGGACGTA GCCGGGGTCG AGGGAGTCAG GGACGGACCGGGlyArgSerIleGlyThrThrLysLeuArgLeuValGluPheSerAlaPheLeuGluGln781AAGGTCGCTC CATTGGCACA ACCAAGCTTC GCCTGGTGGA ATTTTCAGCT TTTCTCGAGCTTCCAGCGAG GTAACCGTGT TGGTTCGAAG CGGACCACCT TAAAAGTCGA AAAGAGCTCGGGlnArgAspProAspSerTyrAsnLysHisLeuPheValHisIleGlyHisAlaAsnHis841AGCAGCGAGA CCCAGACTCG TACAACAAAC ACCTCTTCGT GCACATTGGG CATGCCAACCTCGTCGCTCT GGGTCTGAGC ATGTTGTTTG TGGAGAAGCA CGTGTAACCC GTACGGTTGGHSerTyrSerAspProLeuLeuGluSerValAspIleArgGlnIleTyrAspLysPhePro901ATTCTTACAG TGACCCATTG CTTGAATCAG TGGACATTCG TCAGATTTAT GACAAATTTCTAAGAATGTC ACTGGGTAAC GAACTTAGTC ACCTGTAAGC AGTCTAAATA CTGTTTAAAGPGluLysLysGlyGlyLeuLysGluLeuPheGlyLysGlyProGlnAsnAlaPhePheLeu961CTGAAAAGAA AGGTGGCTTA AAGGAACTGT TTGGAAAGGG CCCTCAAAAT GCCTTCTTCCGACTTTTCTT TCCACCGAAT TTCCTTGACA AACCTTTCCC GGGAGTTTTA CGGAAGAAGGLValLysPheTrpAlaAspLeuAsnCysAsnIleGlnAspAspAlaGlyAlaPheTyrGly1021TCGTAAAATT CTGGGCTGAT TTAAACTGCA ATATTCAAGA TGATGCTGGG GCTTTTTATGAGCATTTTAA GACCCGACTA AATTTGACGT TATAAGTTCT ACTACGACCC CGAAAAATACGValThrSerGlnTyrGluSerSerGluAsnMetThrValThrCysSerThrLysValCys1081GTGTAACCAG TCAGTACGAG AGTTCTGAAA ATATGACAGT CACCTGTTCC ACCAAAGTTTCACATTGGTC AGTCATGCTC TCAAGACTTT TATACTGTCA GTGGACAAGG TGGTTTCAAA Figure 3-2. Human transcriptional enhancer factor-1 (TEF-1)

PAGE 55

43 CSerPheGlyLysGlnValValGluLysValGluThrGluTyrAlaArgPheGluAsnGly1141GCTCCTTTGG GAAGCAAGTA GTAGAAAAAG TAGAGACGGA GTATGCAAGG TTTGAGAATGCGAGGAAACC CTTCGTTCAT CATCTTTTTC ATCTCTGCCT CATACGTTCC AAACTCTTACGArgPheValTyrArgIleAsnArgSerProMetCysGluTyrMetIleAsnPheIleHis1201GCCGATTTGT ATACCGAATA AACCGCTCCC CAATGTGTGA ATATATGATC AACTTCATCCCGGCTAAACA TATGGCTTAT TTGGCGAGGG GTTACACACT TATATACTAG TTGAAGTAGGHLysLeuLysHisLeuProGluLysTyrMetMetAsnSerValLeuGluAsnPheThrIle1261ACAAGCTCAA ACACTTACCA GAGAAATATA TGATGAACAG TGTTTTGGAA AACTTCACAATGTTCGAGTT TGTGAATGGT CTCTTTATAT ACTACTTGTC ACAAAACCTT TTGAAGTGTTILeuLeuValValThrAsnArgAspThrGlnGluThrLeuLeuCysMetAlaCysValPhe1321TTTTATTGGT GGTAACAAAC AGGGATACAC AAGAAACTCT ACTCTGCATG GCCTGTGTGTAAAATAACCA CCATTGTTTG TCCCTATGTG TTCTTTGAGA TGAGACGTAC CGGACACACAPGluValSerAsnSerGluHisGlyAlaGlnHisHisIleTyrArgLeuValLysAsp1381TTGAAGTTTC AAATAGTGAA CACGGAGCAC AACATCATAT TTACAGGCTT GTAAAGGACTAACTTCAAAG TTTATCACTT GTGCCTCGTG TTGTAGTATA AATGTCCGAA CATTTCCTGA1441GAACATGGTT ATTTATATAT ATAGATATCT GTATATACAC ACACACATAT GTGCACACACCTTGTACCAA TAAATATATA TATCTATAGA CATATATGTG TGTGTGTATA CACGTGTGTG1501ACACTCTCTC TCCATTATCG AACGACTGAC TGTAAACCTC ACCACACAGG GTGGTGCCCTTGTGAGAGAG AGGTAATAGC TTGCTGACTG ACATTTGGAG TGGTGTGTCC CACCACGGGA1561GGCCCCGAGG TCACCCCGAC TTTTCTAAAT CTTGTTTGAG TGAAGTCATT TTTTCATGTGCCGGGGCTCC AGTGGGGCTG AAAAGATTTA GAACAAACTC ACTTCAGTAA AAAAGTACAC1621TTCATACTAT CATTGTAGCT GTGAAGTTCT GGTACAGTTG TAAAAAGAGA AATTGAGTTGAAGTATGATA GTAACATCGA CACTTCAAGA CCATGTCAAC ATTTTTCTCT TTAACTCAAC1681TTTCTCTATG TTCTTCAGAT GTGCAGCCCA CAATTCCTCG GGAAAGGTGA ACCTGAACAAAAAGAGATAC AAGAAGTCTA CACGTCGGGT GTTAAGGAGC CCTTTCCACT TGGACTTGTT1741CCCAAGTCTC TCTCTGCAGA GCCCTGTTTC TAATTGTGGT AGAAAATATT GAGACAGAGCGGGTTCAGAG AGAGACGTCT CGGGACAAAG ATTAACACCA TCTTTTATAA CTCTGTCTCG1801ATTTGCCATG GGACATTTAC AGCCTTTATA CAAATGTATT TAGTTCTCTT TTTTCCAACATAAACGGTAC CCTGTAAATG TCGGAAATAT GTTTACATAA ATCAAGAGAA AAAAGGTTGT1861TAAAATTCTT GTTTTAAGAT ACAAGTAAAA TTAATCTTTA AATATAAATG TAAATTAGTAATTTTAAGAA CAAAATTCTA TGTTCATTTT AATTAGAAAT TTATATTTAC ATTTAATCAT1921CACAAAACTA AGAATCTTTA GACTTATCTT TGTAACTAAT TAGGGTGGAA GTTATGAAAGGTGTTTTGAT TCTTAGAAAT CTGAATAGAA ACATTGATTA ATCCCACCTT CAATACTTTC1981AATGTAATTC ACTAAATTAT TTTTTAAATG AAACCTTTTT TTTTCTTTTT GAAACCAAATTTACATTAAG TGATTTAATA AAAAATTTAC TTTGGAAAAA AAAAGAAAAA CTTTGGTTTA2041GTTAAACTAT AGCCTTAAGA AATGCTTGGT AGAAGTGTCC TAATGAGACA AATTTGTACTCAATTTGATA TCGGAATTCT TTACGAACCA TCTTCACAGG ATTACTCTGT TTAAACATGA2101TTTATCCTCA AGGTTAACAC TAATCTCCTA ATCCATTAAA CTCTTGAACA GGTATTACAAAAATAGGAGT TCCAATTGTG ATTAGAGGAT TAGGTAATTT GAGAACTTGT CCATAATGTT2161AGGAAGAAAA CTTCACCCCT TATCCTTAAC ATATATAGTA TATTTAAAAA ATATAAAATTTCCTTCTTTT GAAGTGGGGA ATAGGAATTG TATATATCAT ATAAATTTTT TATATTTTAA2221GTATTGTACT AATGTGATGA TGGATTATTT AATCATAACATGA TTACACTACT ACCTAATAAA TTA Figure 3-2. Continued.

PAGE 56

44 1TTGGAACTGG CTTAGCGCAC CCATCCCACC TTCCCGCACC CTGGGACCGG TCCAACGAGCAACCTTGACC GAATCGCGTG GGTAGGGTGG AAGGGCGTGG GACCCTGGCC AGGTTGCTCGIleThrSerAsnGluTrpSer61GCTCCTCCAA GCGGAGCCTT GGAGGGCACG GCCGGCACCA TTACCTCCAA CGAGTGGAGCCGAGGAGGTT CGCCTCGGAA CCTCCCGTGC CGGCCGTGGT AATGGAGGTT GCTCACCTCGSerProThrSerProGluGlySerThrAlaSerGlyGlySerGlnAlaLeuAspLysPro121TCTCCCACCT CCCCTGAGGG GAGCACCGCC TCTGGGGGCA GTCAGGCACT GGACAAGCCCAGAGGGTGGA GGGGACTCCC CTCGTGGCGG AGACCCCCGT CAGTCCGTGA CCTGTTCGGGIleAspAsnAspAlaGluGlyValTrpSerProAspIleGluGlnSerPheGlnGluAla181ATCGACAATG ACGCAGAGGG CGTGTGGAGC CCGGATATTG AGCAGAGTTT CCAGGAGGCCTAGCTGTTAC TGCGTCTCCC GCACACCTCG GGCCTATAAC TCGTCTCAAA GGTCCTCCGGLeuAlaIleTyrProProCysGlyArgArgLysIleIleLeuSerAspGluGlyLysMet241CTCGCCATCT ACCCGCCCTG TGGCAGGCGC AAAATCATCC TGTCGGACGA GGGCAAGATGGAGCGGTAGA TGGGCGGGAC ACCGTCCGCG TTTTAGTAGG ACAGCCTGCT CCCGTTCTACTyrGlyArgAsnGluLeuIleAlaArgTyrIleLysLeuArgThrGlyLysThrArgThr301TATGGTCGGA ACGAGCTGAT TGCCCGCTAC ATCAAGCTCC GGACAGGGAA GACCCGCACCATACCAGCCT TGCTCGACTA ACGGGCGATG TAGTTCGAGG CCTGTCCCTT CTGGGCGTGGArgLysGlnValSerSerHisIleGlnValLeuAlaArgArgLysAlaArgGluIleGln361AGGAAGCAGG TCTCCAGCCA CATCCAGGTG CTGGCTCGTC GCAAAGCTCG CGAGATCCAGTCCTTCGTCC AGAGGTCGGT GTAGGTCCAC GACCGAGCAG CGTTTCGAGC GCTCTAGGTCAlaLysLeuLysAspGlnAlaAlaLysAspLysAlaLeuGlnSerMetAlaAlaMetSer421GCCAAGCTAA AGGACCAGGC AGCTAAGGAC AAGGCCCTGC AGAGCATGGC TGCCATGTCGCGGTTCGATT TCCTGGTCCG TCGATTCCTG TTCCGGGACG TCTCGTACCG ACGGTACAGCSerAlaGlnIleIleSerAlaThrAlaPheHisSerSerMetAlaLeuAlaArgGlyPro481TCTGCACAGA TCATCTCCGC CACGGCCTTC CACAGTAGCA TGGCCCTCGC CCGGGGCCCCAGACGTGTCT AGTAGAGGCG GTGCCGGAAG GTGTCATCGT ACCGGGAGCG GGCCCCGGGGGlyArgProAlaValSerGlyPheTrpGlnGlyAlaLeuProGlyGlnAlaGlyThrSer541GGCCGCCCAG CAGTCTCAGG GTTTTGGCAA GGAGCTTTGC CAGGCCAAGC CGGAACGTCCCCGGCGGGTC GTCAGAGTCC CAAAACCGTT CCTCGAAACG GTCCGGTTCG GCCTTGCAGGHisAspValLysProPheSerGlnGlnThrTyrAlaValGlnProProLeuProLeuPro601CATGATGTGA AGCCTTTCTC TCAGCAAACC TATGCTGTCC AGCCTCCGCT GCCTCTGCCAGTACTACACT TCGGAAAGAG AGTCGTTTGG ATACGACAGG TCGGAGGCGA CGGAGACGGTGlyPheGluSerProAlaGlyProAlaProSerProSerAlaProProAlaProProTrp661GGGTTTGAGT CTCCTGCAGG GCCCGCCCCA TCGCCCTCTG CGCCCCCGGC ACCCCCATGGCCCAAACTCA GAGGACGTCC CGGGCGGGGT AGCGGGAGAC GCGGGGGCCG TGGGGGTACCGlnGlyArgSerValAlaSerSerLysLeuTrpMetLeuGluPheSerAlaPheLeuGlu721CAGGGCCGCA GCGTGGCCAG CTCCAAGCTC TGGATGTTGG AGTTCTCTGC CTTCCTGGAGGTCCCGGCGT CGCACCGGTC GAGGTTCGAG ACCTACAACC TCAAGAGACG GAAGGACCTCGlnGlnGlnAspProAspThrTyrAsnLysHisLeuPheValHisIleGlyGlnSerSer781CAGCAGCAGG ACCCGGACAC GTACAACAAG CACCTGTTCG TGCACATTGG CCAGTCCAGCGTCGTCGTCC TGGGCCTGTG CATGTTGTTC GTGGACAAGC ACGTGTAACC GGTCAGGTCGProSerTyrSerAspProTyrLeuGluAlaValAspIleArgGlnIleTyrAspLysPhe841CCAAGCTACA GCGACCCCTA CCTCGAAGCC GTGGACATCC GCCAAATCTA TGACAAATTCGGTTCGATGT CGCTGGGGAT GGAGCTTCGG CACCTGTAGG CGGTTTAGAT ACTGTTTAAGProGluLysLysGlyGlyLeuLysAspLeuPheGluArgGlyProSerAsnAlaPhePhe901CCGGAGAAAA AGGGTGGACT CAAGGATCTC TTCGAACGGG GACCCTCCAA TGCCTTTTTTGGCCTCTTTT TCCCACCTGA GTTCCTAGAG AAGCTTGCCC CTGGGAGGTT ACGGAAAAAALeuValLysPheTrpAlaAspLeuAsnThrAsnIleGluAspGluGlySerSerPheTyr961CTTGTGAAGT TCTGGGCAGA CCTCAACACC AACATCGAGG ATGAAGGCAG CTCCTTCTATGAACACTTCA AGACCCGTCT GGAGTTGTGG TTGTAGCTCC TACTTCCGTC GAGGAAGATAGlyValSerSerGlnTyrGluSerProGluAsnMetIleIleThrCysSerThrLysVal1021GGGGTCTCCA GCCAGTATGA GAGCCCCGAG AACATGATCA TCACCTGCTC CACGAAGGTCCCCCAGAGGT CGGTCATACT CTCGGGGCTC TTGTACTAGT AGTGGACGAG GTGCTTCCAGCysSerPheGlyLysGlnValValGluLysValGluThrGluTyrAlaArgTyrGluAsn1081TGCTCTTTCG GCAAGCAGGT GGTGGAGAAA GTTGAGACAG AGTATGCTCG CTATGAGAATACGAGAAAGC CGTTCGTCCA CCACCTCTTT CAACTCTGTC TCATACGAGC GATACTCTTA Figure 3-3. Human transcriptional enhancer factor-3 (TEF-3)

PAGE 57

45 GlyHisTyrSerTyrArgIleHisArgSerProLeuCysGluTyrMetIleAsnPheIle1141GGACACTACT CTTACCGCAT CCACCGGTCC CCGCTCTGTG AGTACATGAT CAACTTCATCCCTGTGATGA GAATGGCGTA GGTGGCCAGG GGCGAGACAC TCATGTACTA GTTGAAGTAGHisLysLeuLysHisLeuProGluLysTyrMetMetAsnSerValLeuGluAsnPheThr1201CACAAGCTCA AGCACCTCCC TGAGAAGTAC ATGATGAACA GCGTGCTGGA GAACTTCACCGTGTTCGAGT TCGTGGAGGG ACTCTTCATG TACTACTTGT CGCACGACCT CTTGAAGTGGIleLeuGlnValValThrAsnArgAspThrGlnGluThrLeuLeuCysIleAlaTyrVal1261ATCCTGCAGG TGGTCACCAA CAGAGACACA CAGGAGACCT TGCTGTGCAT TGCCTATGTCTAGGACGTCC ACCAGTGGTT GTCTCTGTGT GTCCTCTGGA ACGACACGTA ACGGATACAGPheGluValSerAlaSerGluHisGlyAlaGlnHisHisIleTyrArgLeuValLysGlu1321TTTGAGGTGT CAGCCAGTGA GCACGGGGCT CAGCACCACA TCTACAGGCT GGTGAAAGAAAAACTCCACA GTCGGTCACT CGTGCCCCGA GTCGTGGTGT AGATGTCCGA CCACTTTCTT1381TGAGAGACTC GGGGAGCAGG GAGGGGGGAA GAGACGTGTG TGCAGGAAAC GGGGACGTGGACTCTCTGAG CCCCTCGTCC CTCCCCCCTT CTCTGCACAC ACGTCCTTTG CCCCTGCACC1441GGAGGGGACC TGCAGGGGCA GCCCCCTGAA GTGCCAAGAG AGCTGAGAGG AGCAGTTGTGCCTCCCCTGG ACGTCCCCGT CGGGGGACTT CACGGTTCTC TCGACTCTCC TCGTCAACAC1501ACTCTACCCA GGAACAAACT GTGCCTGAAC CTGAGGTGCC CAACCCCAAA TAAACCCAAGTGAGATGGGT CCTTGTTTGA CACGGACTTG GACTCCACGG GTTGGGGTTT ATTTGGGTTC1561ATGCTGTGTA TTTTCAGATACGACACAT AAAAGTCT Figure 3-3. Continued

PAGE 58

46 1TTTCCGCCTC TGGCGAATGG CTCGTCTGTA GTGCACGCCG CGGGCCCAGC TGCGACCCCGAAAGGCGGAG ACCGCTTACC GAGCAGACAT CACGTGCGGC GCCCGGGTCG ACGCTGGGGCMetAspGluLeuPheProLeuIlePheProAlaGluPro61GCCCCGCCCC CGGGACCCCG GCCATGGACG AACTGTTCCC CCTCATCTTC CCGGCAGAGCCGGGGCGGGG GCCCTGGGGC CGGTACCTGC TTGACAAGGG GGAGTAGAAG GGCCGTCTCGPAlaGlnAlaSerGlyProTyrValGluIleIleGluGlnProLysGlnArgGlyMetArg121CAGCCCAGGC CTCTGGCCCC TATGTGGAGA TCATTGAGCA GCCCAAGCAG CGGGGCATGCGTCGGGTCCG GAGACCGGGG ATACACCTCT AGTAACTCGT CGGGTTCGTC GCCCCGTACGAPheArgTyrLysCysGluGlyArgSerAlaGlySerIleProGlyGluArgSerThrAsp181GCTTCCGCTA CAAGTGCGAG GGGCGCTCCG CGGGCAGCAT CCCAGGCGAG AGGAGCACAGCGAAGGCGAT GTTCACGCTC CCCGCGAGGC GCCCGTCGTA GGGTCCGCTC TCCTCGTGTCAThrThrLysThrHisProThrIleLysIleAsnGlyTyrThrGlyProGlyThrValArg241ATACCACCAA GACCCACCCC ACCATCAAGA TCAATGGCTA CACAGGACCA GGGACAGTGCTATGGTGGTT CTGGGTGGGG TGGTAGTTCT AGTTACCGAT GTGTCCTGGT CCCTGTCACGAIleSerLeuValThrLysAspProProHisArgProHisProHisGluLeuValGlyLys301GCATCTCCCT GGTCACCAAG GACCCTCCTC ACCGGCCTCA CCCCCACGAG CTTGTAGGAACGTAGAGGGA CCAGTGGTTC CTGGGAGGAG TGGCCGGAGT GGGGGTGCTC GAACATCCTTLAspCysArgAspGlyPheTyrGluAlaGluLeuCysProAspArgCysIleHisSerPhe361AGGACTGCCG GGATGGCTTC TATGAGGCTG AGCTCTGCCC GGACCGCTGC ATCCACAGTTTCCTGACGGC CCTACCGAAG ATACTCCGAC TCGAGACGGG CCTGGCGACG TAGGTGTCAAPGlnAsnLeuGlyIleGlnCysValLysLysArgAspLeuGluGlnAlaIleSerGlnArg421TCCAGAACCT GGGAATCCAG TGTGTGAAGA AGCGGGACCT GGAGCAGGCT ATCAGTCAGCAGGTCTTGGA CCCTTAGGTC ACACACTTCT TCGCCCTGGA CCTCGTCCGA TAGTCAGTCGAIleGlnThrAsnAsnAsnProPheGlnValProIleGluGluGlnArgGlyAspTyrAsp481GCATCCAGAC CAACAACAAC CCCTTCCAAG TTCCTATAGA AGAGCAGCGT GGGGACTACGCGTAGGTCTG GTTGTTGTTG GGGAAGGTTC AAGGATATCT TCTCGTCGCA CCCCTGATGCALeuAsnAlaValArgLeuCysPheGlnValThrValArgAspProSerGlyArgProLeu541ACCTGAATGC TGTGCGGCTC TGCTTCCAGG TGACAGTGCG GGACCCATCA GGCAGGCCCCTGGACTTACG ACACGCCGAG ACGAAGGTCC ACTGTCACGC CCTGGGTAGT CCGTCCGGGGLArgLeuProProValLeuSerHisProIlePheAspAsnArgAlaProAsnThrAlaGlu601TCCGCCTGCC GCCTGTCCTT TCTCATCCCA TCTTTGACAA TCGTGCCCCC AACACTGCCGAGGCGGACGG CGGACAGGAA AGAGTAGGGT AGAAACTGTT AGCACGGGGG TTGTGACGGCGLeuLysIleCysArgValAsnArgAsnSerGlySerCysLeuGlyGlyAspGluIlePhe661AGCTCAAGAT CTGCCGAGTG AACCGAAACT CTGGCAGCTG CCTCGGTGGG GATGAGATCTTCGAGTTCTA GACGGCTCAC TTGGCTTTGA GACCGTCGAC GGAGCCACCC CTACTCTAGAPLeuLeuCysAspLysValGlnLysGluAspIleGluValTyrPheThrGlyProGlyTrp721TCCTACTGTG TGACAAGGTG CAGAAAGAGG ACATTGAGGT GTATTTCACG GGACCAGGCTAGGATGACAC ACTGTTCCAC GTCTTTCTCC TGTAACTCCA CATAAAGTGC CCTGGTCCGATGluAlaArgGlySerPheSerGlnAlaAspValHisArgGlnValAlaIleValPheArg781GGGAGGCCCG AGGCTCCTTT TCGCAAGCTG ATGTGCACCG ACAAGTGGCC ATTGTGTTCCCCCTCCGGGC TCCGAGGAAA AGCGTTCGAC TACACGTGGC TGTTCACCGG TAACACAAGGAThrProProTyrAlaAspProSerLeuGlnAlaProValArgValSerMetGlnLeuArg841GGACCCCTCC CTACGCAGAC CCCAGCCTGC AGGCTCCTGT GCGTGTCTCC ATGCAGCTGCCCTGGGGAGG GATGCGTCTG GGGTCGGACG TCCGAGGACA CGCACAGAGG TACGTCGACGAArgProSerAspArgGluLeuSerGluProMetGluPheGlnTyrLeuProAspThrAsp901GGCGGCCTTC CGACCGGGAG CTCAGTGAGC CCATGGAATT CCAGTACCTG CCAGATACAGCCGCCGGAAG GCTGGCCCTC GAGTCACTCG GGTACCTTAA GGTCATGGAC GGTCTATGTCAAspArgHisArgIleGluGluLysArgLysArgThrTyrGluThrPheLysSerIleMet961ACGATCGTCA CCGGATTGAG GAGAAACGTA AAAGGACATA TGAGACCTTC AAGAGCATCATGCTAGCAGT GGCCTAACTC CTCTTTGCAT TTTCCTGTAT ACTCTGGAAG TTCTCGTAGTMLysLysSerProPheSerGlyProThrAspProArgProProProArgArgIleAlaVal1021TGAAGAAGAG TCCTTTCAGC GGACCCACCG ACCCCCGGCC TCCACCTCGA CGCATTGCTGACTTCTTCTC AGGAAAGTCG CCTGGGTGGC TGGGGGCCGG AGGTGGAGCT GCGTAACGACVProSerArgSerSerAlaSerValProLysProAlaProGlnProTyrProPheThrSer1081TGCCTTCCCG CAGCTCAGCT TCTGTCCCCA AGCCAGCACC CCAGCCCTAT CCCTTTACGTACGGAAGGGC GTCGAGTCGA AGACAGGGGT TCGGTCGTGG GGTCGGGATA GGGAAATGC A Figure 3-4. Human p65

PAGE 59

47 SSerLeuSerThrIleAsnTyrAspGluPheProThrMetValPheProSerGlyGlnIle1141CATCCCTGAG CACCATCAAC TATGATGAGT TTCCCACCAT GGTGTTTCCT TCTGGGCAGAGTAGGGACTC GTGGTAGTTG ATACTACTCA AAGGGTGGTA CCACAAAGGA AGACCCGTCTISerGlnAlaSerAlaLeuAlaProAlaProProGlnValLeuProGlnAlaProAlaPro1201TCAGCCAGGC CTCGGCCTTG GCCCCGGCCC CTCCCCAAGT CCTGCCCCAG GCTCCAGCCCAGTCGGTCCG GAGCCGGAAC CGGGGCCGGG GAGGGGTTCA GGACGGGGTC CGAGGTCGGG PAlaProAlaProAlaMetValSerAlaLeuAlaGlnAlaProAlaProValProValLeu1261CTGCCCCTGC TCCAGCCATG GTATCAGCTC TGGCCCAGGC CCCAGCCCCT GTCCCAGTCCGACGGGGACG AGGTCGGTAC CATAGTCGAG ACCGGGTCCG GGGTCGGGGA CAGGGTCAGGLAlaProGlyProProGlnAlaValAlaProProAlaProLysProThrGlnAlaGlyGlu1321TAGCCCCAGG CCCTCCTCAG GCTGTGGCCC CACCTGCCCC CAAGCCCACC CAGGCTGGGGATCGGGGTCC GGGAGGAGTC CGACACCGGG GTGGACGGGG GTTCGGGTGG GTCCGACCCCGGlyThrLeuSerGluAlaLeuLeuGlnLeuGlnPheAspAspGluAspLeuGlyAlaLeu1381AAGGAACGCT GTCAGAGGCC CTGCTGCAGC TGCAGTTTGA TGATGAAGAC CTGGGGGCCTTTCCTTGCGA CAGTCTCCGG GACGACGTCG ACGTCAAACT ACTACTTCTG GACCCCCGGALLeuGlyAsnSerThrAspProAlaValPheThrAspLeuAlaSerValAspAsnSerGlu1441TGCTTGGCAA CAGCACAGAC CCAGCTGTGT TCACAGACCT GGCATCCGTC GACAACTCCGACGAACCGTT GTCGTGTCTG GGTCGACACA AGTGTCTGGA CCGTAGGCAG CTGTTGAGGCGPheGlnGlnLeuLeuAsnGlnGlyIleProValAlaProHisThrThrGluProMetLeu1501AGTTTCAGCA GCTGCTGAAC CAGGGCATAC CTGTGGCCCC CCACACAACT GAGCCCATGCTCAAAGTCGT CGACGACTTG GTCCCGTATG GACACCGGGG GGTGTGTTGA CTCGGGTACGLMetGluTyrProGluAlaIleThrArgLeuValThrGlyAlaGlnArgProProAspPro1561TGATGGAGTA CCCTGAGGCT ATAACTCGCC TAGTGACAGG GGCCCAGAGG CCCCCCGACCACTACCTCAT GGGACTCCGA TATTGAGCGG ATCACTGTCC CCGGGTCTCC GGGGGGCTGGPAlaProAlaProLeuGlyAlaProGlyLeuProAsnGlyLeuLeuSerGlyAspGluAsp1621CAGCTCCTGC TCCACTGGGG GCCCCGGGGC TCCCCAATGG CCTCCTTTCA GGAGATGAAGGTCGAGGACG AGGTGACCCC CGGGGCCCCG AGGGGTTACC GGAGGAAAGT CCTCTACTTCAPheSerSerIleAlaAspMetAspPheSerAlaLeuLeuSerGlnIleSerSer1681ACTTCTCCTC CATTGCGGAC ATGGACTTCT CAGCCCTGCT GAGTCAGATC AGCTCCTAAGTGAAGAGGAG GTAACGCCTG TACCTGAAGA GTCGGGACGA CTCAGTCTAG TCGAGGATTC1741GGGGTGACGC CTGCCCTCCC CAGAGCACTG GGTTGCAGGG GATTGAAGCC CTCCAAAAGCCCCCACTGCG GACGGGAGGG GTCTCGTGAC CCAACGTCCC CTAACTTCGG GAGGTTTTCG1801ACTTACGGAT TCTGGTGGGG TGTGTTCCAA CTGCCCCCAA CTTTGTGGAT GTCTTCCTTGTGAATGCCTA AGACCACCCC ACACAAGGTT GACGGGGGTT GAAACACCTA CAGAAGGAAC1861GAGGGGGGAG CCATATTTTA TTCTTTTATT GTCAGTATCT GTATCTCTCT CTCTTTTTGGCTCCCCCCTC GGTATAAAAT AAGAAAATAA CAGTCATAGA CATAGAGAGA GAGAAAAACC1921AGGTGCTTAA GCAGAAGCAT TAACTTCTCT GGAAAGGGGG GAGCTGGGGA AACTCAAACTTCCACGAATT CGTCTTCGTA ATTGAAGAGA CCTTTCCCCC CTCGACCCCT TTGAGTTTGA1981TTTCCCCTGT CCTGATGGTC AGCTCCCTTC TCTGTAGGGA AATCTGGGGT CCCCCATCCCAAAGGGGACA GGACTACCAG TCGAGGGAAG AGACATCCCT TTAGACCCCA GGGGGTAGGG2041CATCCTCCAG CTTCTGGTAC TCTCCTAGAG ACAGAAGCAG GCTGGAGGTA AGGCCTTTGAGTAGGAGGTC GAAGACCATG AGAGGATCTC TGTCTTCGTC CGACCTCCAT TCCGGAAACT2101GCCCACAAAG CCTTATCAAG TGTCTTCCAT CATGGATTCA TTACAGCTTA ATCAAAATAACGGGTGTTTC GGAATAGTTC ACAGAAGGTA GTACCTAAGT AATGTCGAAT TAGTTTTATT2161CGCCCCAGAT ACCAGCCCCT GTATGGCACT GGCATTGTCC CTGTGCCTAA CACCAGCGTTGCGGGGTCTA TGGTCGGGGA CATACCGTGA CCGTAACAGG GACACGGATT GTGGTCGCAA2221TGAGGGGCTG GCCTTCCTGC CCTACAGAGG TCTCTGCCGG CTCTTTCCTT GCTCAACCATACTCCCCGAC CGGAAGGACG GGATGTCTCC AGAGACGGCC GAGAAAGGAA CGAGTTGGTA2281GGCTGAAGGA AACCAGTGCA ACAGCACTGG CTCTCTCCAG GATCCAGAAG GGGTTTGGTCCCGACTTCCT TTGGTCACGT TGTCGTGACC GAGAGAGGTC CTAGGTCTTC CCCAAACCAG2341TGGGACTTCC TTGCTCTCCC TCTTCTCAAG TGCCTTAATA GTAGGGTAAG TTGTTAAGAGACCCTGAAGG AACGAGAGGG AGAAGAGTTC ACGGAATTAT CATCCCATTC AACAATTCTC2401TGGGGGAGAG CAGGCTGGCA GCTCTCCAGT CAGGAGGCAT AGTTTTTACT GAACAATCAAACCCCCTCTC GTCCGACCGT CGAGAGGTCA GTCCTCCGTA TCAAAAATGA CTTGTTAGTT2461AGCACTTGGA CTCTTGCTCT TTCTACTCTG AACTAATAAA TCTGTTGCCA AGCTGTCGTGAACCT GAGAACGAGA AAGATGAGAC TTGATTATTT AGACAACGGT TCGAC Figure 3-4. Continued

PAGE 60

48 TTTCCGCCTC TGGCGAATGG CTCGTCTGTA GTGCACGCCG CGGGCCCAGC .......... .......... .......... .......... ..........TGCGACCCCG GCCCCGCCCC CGGGACCCCG GCCATGGACG AACTGTTCCC.......... .......... .......... .........G AACTGTTCCCCCTCATCTTC CCGGCAGAGC CAGCCCAGGC CTCTGGCCCC TATGTGGAGACCTCATCTTC CCGGCAGAGC CAGCCCAGGC CTCTGGCCCC TATGTGGAGATCATTGAGCA GCCCAAGCAG CGGGGCATGC GCTTCCGCTA CAAGTGCGAGTCATTGAGCA GCCCAAGCAG CGGGGCATGC GCTTCCGCTA CAAGTGCGAG Hp65Hp65 (15,000) Figure 3-5. Comparison of the Human p65 sequence isolated from the yeast One-Hybrid screen (Hp65) with the Human p65 cDNA derived from the Sanger Institute (Hp65 -15,000). Bold underlined nucleotides depict our predicted Exon 1 sequence containing 5’UTR and the ATG (boxed). Thick underlined sequence corresponds to our predicted Exon 2 sequence.

PAGE 61

49 Figure 3-6. Genomic structure of human p65 as determined by us from the One-Hybrid screen cDNA isolated in comparison with the published human genomic structures shown by Deloukas & van Loon (1993) and the Haseltine group (1993) Human p65 gene structuren1 (620 bp) Intro Exon1 (90bp) Exon2 (27bp) Exon3 (152bp)12345687910Exons11

PAGE 62

TEF-1 Protein Structure ProlineRich (25%)aa143-204 STY Rich (48%)Serine,Threonine,Tyrosineaa306-328 Zn FingerCX2CX8HX3Haa402-426 NH2--COOHAcidic E26% S=20% aa4-54DNA Binding DomainTEA/ATTSaa39-121 39-51aaaHelix-1 70-81aa-sheetaHelix-2 90-99aa-sheet aHelix-3 50 Figure 3-7. Proposed Human TEF-1 Protein Structure, including putative DNA binding domain based on sequence analysis

PAGE 63

51 p65 protein structureNH2--COOH RelHomology Domainaa1-273MLZActivation Domain Dimerization IkBBindingDNA Binding201291312151212911551TA (transactivationdomain)aa350-551 S180ProLeuArgLeuPro ProVal LeuSer His Pro172182 Figure 3-8. Protein Structure of human p65 including rel homology domain found in all family members protein-dimerization, DNA binding domain, mini leucine zipper region (MLZ) and the transactivation domain (TA)

PAGE 64

52 been determined for this protein. Regions were determined based on the amino acid composition in the area as depicted. The potential Zn finger region at the carboxyl terminus has no functional significance as of yet. The p65 protein structure is depicted in Figure 3-8, the rel homology domain is conserved among all rel family members, and includes dimerization and DNA binding domains. The location of amino acid residue 180 and the transactivation domain is highlighted as these will be discussed in Chapter 4. TEF1 and p65 Bind Specific Sites in Enhancer TEF and p65 were isolated from the yeast One-Hybrid screen based on their ability to bind the rat MnSOD enhancer Site 2 in a eukaryotic yeast environment. Based on the MnSOD enhancer sequence and a review of the relevant DNA binding data for each protein, we hypothesized that TEF-1 binds the bottom strand 5’AGAATG3’, while p65 binds the top strand 5’GGAAATTACC3’ (Figure 3-9). To confirm this theory electrophoretic mobility shift assays (EMSA) were done utilizing a 30 bp double stranded annealed fragment containing enhancer Site 2. The EMSA technique allows for in vitro visualization of protein-DNA binding through incubation of a radioactively labeled probe with either nuclear extract or pure protein in a binding buffer containing non-specific competitor DNA (polydI-dC). After incubation, reactions are run on a non denaturing polyacrylamide gel, which separates protein-DNA complexes from unbound dsDNA. GGAAATTACCACATTCTGGAAATTTTACCCTTTAATGGTGTAAGACCTTTAAAATG TEF-1 p65 Figure 3-9. Theorized Transcription Factor Binding Sites. One-Hybrid Site2 of the MnSOD Enhancer is depicted, with potential TEF1 and p65 binding sites

PAGE 65

53 Initially to determine if any complexes were indeed forming on this DNA fragment containing Site 2, nuclear extracts from uninduced (control), LPS, TNF and IL-1 induced L2 cells were incubated with a radioactively labeled Klenow filled in Site 2 fragment. As can be seen in Figure 3-10, the lanes marked DNA + N.E. contained two highly migrating protein-DNA complexes. To determine if these complexes were specific for the Site 2 fragment, 200X of non-radioactive (cold) Site 2 fragment was used as a competitor, and as can be seen in the lanes marked DNA + N.E + Cold WT DNA in Figure 3-10, the non-radioactive fragment competed away the upper two complexes. To further demonstrate specificity another region from the MnSOD gene in Exon 4 was used as a non-specific competitor, and 200X of this was used for competition as well (DNA + N.E + Cold Exon4 DNA), this fragment however was not able to compete away the complexes forming on the Site 2 fragment, demonstrating that the two upper complexes formed on Site 2 were specific. No difference in complex formation was seen between induced and non-induced samples. Due to this being a complex enhancer with multiple protein binding sites, it is possible that this small 30bp fragment will not contain the additional DNA sequences necessary to recruit additional proteins found in the induced state. To determine if TEF-1 and p65 were specifically able to bind Site 2, fusion proteins were made utilizing the Glutathione-S-Transferase (GST) gene fusion system from Amersham. Glutathione-S-transferase is a naturally occurring 26kD (kiloDalton) protein, that can be expressed at high levels in E.coli through the use of an inducible tac promoter. The tac promoter is a variant of the lac promoter, and with the use of a lactose analogue, IPTG, one is able to induce high level protein expression in E. coli.. An

PAGE 66

54 WT DNADNA+ N.E.DNA+N.E.+ColdWT DNADNA+N.E.+ColdExon4 DNADNA+ N.E.IL-1LPSTNFaDNA+ N.E.DNA+N.E.+ColdWT DNADNA+N.E.+ColdExon4 DNADNA+ N.E.DNA+N.E.+ColdWT DNADNA+N.E.+ColdExon4 DNADNA+N.E.+ColdWT DNADNA+N.E.+ColdExon4 DNAControl Figure 3-10. Specific Complex formation. Electromobility Shift Assay utilizing One-Hybrid Site (WT) or non-specific DNA (Exon 4 DNA) with uninduced or induced L2 cell nuclear extracts. WT DNA=radioactively labeled DNA with no extract

PAGE 67

55 additional feature that allows for ease of purification of GST fusion proteins is the ability of GST to bind Glutathione which for these purposes is bound to a sepharose matrix, allowing for binding of the GST fusion protein to a solid support matrix, followed by washing steps to remove any non-specifically bound proteins and final elution using reduced glutathione. TEF-1 and p65 GST fusion proteins were made (Figure 3-11). Figure 3-11A is an immunoblot analysis of the TEF-GST proteins as compared with previously over-expressed TEF-1-pcDNA3.1 and Flag-TEF-1, GST-protein sizes are as expected with a shift in 26kD from the original over-expressed proteins. Supernatant (Supt) and insoluble fractions were run to determine where any potential loss of protein might be occurring during the isolation process. Figure 3-11B is an immunoblot analysis of the p65-GST proteins made as compared to previously over-expressed p65-pcDNA3.1, with supernatant and insoluble fractions visualized as well. Upon verification of GST fusion protein over-expression, EMSA analyses were conducted to determine if these proteins were able to bind Site 2, and at what concentration of protein this binding was optimal. Figures 3-12 and 3-13 demonstrate these studies. Figure 3-12, Panel A demonstrates the ability of p65-GST to bind Site 2 with increasing concentrations of p65-GST, the two complexes seen are believed to be the result of p65 homodimerization on two potential p65 binding sites within Site 2 as will be elaborated on in the discussion. Briefly, p65 is able to homodimerize on binding sites that contain a 5’GGAA3’ half site, and Site 2 contains two of these sites (Figure 3-9). Panel B demonstrates the robust p65-GST binding when incubated with nuclear extract as well as the much higher migration as compared to the nuclear extract alone complexes. To determine if the hypothesized binding sites seen in Figure 3-7 were accurate,

PAGE 68

56 28.992.052.235.7TEF-pcDNA3.1TEF-FlagTEF-GST FinalTEF-GST-SuptTEF-GST-InsolubleXkDA p65-pcDNA3.1 28.992.052.235.7kDp65-GST Finalp65-GST Suptp65-GST InsolubleBWB: a-TEFWB: a-p65 Figure 3-11. GST Protein Preparation. Immunoblot analysis of purified TEF-GST and p65-GST proteins. A: TEF-1 immunoblot demonstrating over-expression of TEF-1-pcDNA3.1 and Flag-TEF-1 proteins as compared to the eluted TEF-GST (GST Final). B: p65 immunoblot demonstrating over-expression of p65-pcDNA3.1 as compared to eluted p65-GST (GST Final). Supernatant (supt) and insoluble fractions from the purification procedure are shown. GST tag MW= 26kD

PAGE 69

57 mutational analyses of each site were done by exchanging purines (A/G) for pyrimidines (T/C). Panel C shows a comparision of wildtype (WT) Site 2, and mutated TEF-1 (M-TEF-1) and p65 (M-p65) sites when incubated with p65-GST and nuclear extract. As demonstrated when the hypothesized p65 site within Site 2 is mutated there is a loss of the lower band and an increased intensity of the upper band, most likely resulting from a switch of p65 homodimers from one p65 subsite to the other p65 subsite located 3’ from the originally hypothesized p65 subsite. The mutation of the TEF-1 site does not have any major effects on ability of p65 to bind Site 2. Panel D is the corresponding DNA only controls for Panel C. To determine the binding ability of TEF-GST, a concentration gradient was done as visualized in Figure 3-13, Panel A. Panel A demonstrates TEF-GST binding as a single band at 100 ng of protein, when only TEF-GST and DNA are incubated together. The right side of Panel A shows TEF-GST binding in a concentration gradient with a constant amount of L2 nuclear extract. The upper two complexes that were shown to be specific through competition assays are seen, with the lower looking complexes migrating at about the same location as the bands seen in the DNA alone lanes of Panel D. At 100 ng of TEF-GST where it was shown to be bound to Site 2 without nuclear extract, upon addition of nuclear extract, the originally determined TEF-GST seems to have predominantly moved higher in the gel, above the nuclear extract complexes, potentially have interacted with one or more factors from the nuclear extract, thus forming a complex of larger size or a change in structure. This is seen again in Panel B when studying mutational analyses. The same Site 2 sequence mutation fragments used above for p65 were utilized here but with TEF-GST and nuclear extract. As can be visualized

PAGE 70

58 by a comparison with Panel A, the binding pattern for TEF-GST and nuclear extract is the same as in the wildtype (WT) lane, however when the TEF-1 site is mutated (M-TEF) all specific complex bands are lost except for the normally seen nuclear extract Site 2 lower complex. Neither the TEF-GST monomer band nor the uppermost TEF-GST-N.E. band is seen, demonstrating that TEF-GST is unable to bind Site 2 without the wildtype TEF-1 binding site. The disappearance of the upper nuclear extract band suggests that this complex normally is bound with endogenous TEF, and the mutation of this site impedes the ability of a complex to be formed, suggestive of TEF being the initial factor or only factor binding Site 2. The loss of the endogenous binding TEF as well as the exogenously produced TEF-GST corroborates the hypothesis of the TEF binding site as well as its involvement in the enhancer complex. The mutated p65 site (M-p65) shows the same pattern as the wildtype (WT) sequence, however in a more robust manner. Panel C is the corresponding DNA only controls for this experiment. Discussion The yeast One-Hybrid assay was utilized to identify regulatory factors that specifically interact with the MnSOD enhancer Site 2 region in the context of a eukaryotic cellular milieu. Yeast cells offer a number of unique advantages in a screen for relevant transcription factors: 1) the cells have many characteristics unique to eukaryotes, 2) as single cell organisms they are suitable to rapid screening/plating techniques, 3) metabolic mutants can be employed for selection under auxotrophic growth conditions, and 4) the cells are able to efficiently undergo homologous recombination, allowing for integration of the binding site of interest into a chromatin environment.

PAGE 71

59 DNA Alonep65-GST5 ng10 ng20 ng40 ng100 ng180 ngp65-GST+N.E.N.E. AloneDNA onlyA B M-TEFM-p65WT DNAC M-TEFM-p65WT DNADp65-GST +N.E. Figure 3-12. EMSA Analyses with p65-GST. Panel A: Demonstration of p65-GST binding enhancer Site 2 with increasing p65-GST concentrations. Panel B: p65-GST incubated with L2 nuclear extract as compared to nuclear extract alone (N.E. Alone). Panel C: Mutational analysis of Site 2 using p65-GST and nuclear extract. Wildtype (WT) Site 2 with p65-GST, mutated hypothesized p65 subsite (M-p65) and mutated theorized TEF-1 (M-TEF) binding site. Panel D: DNA only controls for Panel C, same nomenclature

PAGE 72

60 TEF-GSTDNA AloneTEF-GST0.1 ng1 ng2 ng10 ng20 ng100 ngN.E. Alone0.1 ng1 ng2 ng10 ng20 ng100 ngTEF-GST + N.E. TEF-GST + N.E.DNA onlyAM-p65M-TEFWT DNA B M-p65M-TEFWT DNAC Figure 3-13. EMSA analyses with TEF-GST. Panel A: Demonstration of TEF-GST binding enhancer Site 2. Arrow depicts TEF-GST binding as monomer. Right side of Panel A: TEF-GST binding enhancer Site 2 with the aid of L2 nuclear extracts, increasing concentrations of TEF-GST are shown with constant nuclear extract (3 g). Panel B: Mutational analysis of Site 2 with TEF-GST and nuclear extract. WT DNA= wildtype Site 2 fragment, M-TEF= Theorized TEF-1 binding site mutation, M-p65= Hypothesized p65 binding site mutation. Panel C: DNA only controls for experiments in Panel B

PAGE 73

61 The results of this One-Hybrid assay utilizing Site 2 included two family members (TEF-1 and TEF-3) as well as p65, a factor previously implicated in MnSOD gene regulation (Maehara et al. 2000). Transcription Enhancer Factor-1 (TEF-1) Transcription enhancer factor-1 (TEF 1) is the prototypic member of the TEA/ATTS family of transcription factors, that is evolutionarily conserved (Campbell et al. 1992; Blatt & DePamphilis 1993) and was first discovered in Hela cells by its ability to bind 3 regions (GTIIC, SphI and SphII) within the simian virus (SV40) enhancer region (Xiao et al. 1987). It has since been shown to belong to a family of proteins that all contain four evolutionarily conserved regions, a DNA binding region, called the TEA/ATTS region (TE for TEF-1 and TEC-1 (yeast homologue), and A for the Aspergillus aba A gene product), a proline rich region, an STY region and a zinc finger region (Figure 3-7). Interestingly, there are three potential translational start sites within this gene, with the first start codon being an ATT (Isoleucine) at position 541, followed by two ATG (Methionine) start codons at 586 and 595. The resultant proteins migrate on a denaturing polyacrylamide gel as a 53 kD and 51kD doublet resulting from the ATT, and the two ATGs respectively (Figure 3-11). Detailed studies by the laboratory of Dr. Pierre Chambon, most notably mutation of the first start codon resulting in disappearance of the 53kD protein and mutation of the second start codon, with little decrease in the 51kD protein confirm visually the above assertions (Xiao et al. 1991). The functional differences between these two protein products has not been elucidated as of yet, but it is interesting to note that in Hela cells where TEF was first identified, only the 53kD protein is present, while in rat lung epithelial L2 cells, all three species are seen endogenously.

PAGE 74

62 In human and mouse (Jacquemin et al. 1996) four main members have been identified: TEF-1, TEF-3, TEF-4, and TEF-5. Additionally, the following alternative splice variants have been identified: in human, TEF-1 and (Jiang et al. 2000), in rat: , , , , , and (Zuzarte et al. 2000), and in chicken TEF-1A, TEF-1B, TEF-1C, and TEF-1D (Stewart et al. 1994). TEF family members have distinct developmental expression patterns as seen in mice, most notably TEF-1 is strongly expressed in the developing skeletal muscle and myocardium beginning at 10.5 dpc (days post coitum) and from 15.5 dpc onward in the developing lungs and heart among other organs. It has been shown in embryonic stem cells that TEF-1 DNA binding sites can specifically enhance gene expression, suggesting that TEF-1 plays an important role in the early stages of development (Melin et al. 1993). TEF-1, like MnSOD is critical for proper development, as was demonstrated in mice experiments where TEF-1 gene had been retrovirally disrupted leading to death at embryonic days 11 and 12 (E11/E12) due to an abnormally thin ventricular wall in the heart (Chen et al. 1994). Interestingly, MnSOD knock out mice die of similar cardiac problems (Li et al. 1995). Its importance in regulating transcription within cardiac muscle has been explored by multiple investigators. Farrance & Ordahl were the first to show that a TEF-1 related factor was involved in regulation of cardiac and skeletal muscle gene expression through the common M-CAT binding site (5’ GGTATG 3’) found in many cardiac promoters (Farrance & Ordahl 1992; 1996). Multiple groups followed this original work looking at various genes within cardiac cells, all finding that TEF-1 was integrally involved in cardiac gene regulation (Kariya et al. 1993; Shimizu et

PAGE 75

63 al. 1993; Maclellan et al. 1994; Gupta et al. 1997; Swartz et al. 1998). TEFs’ regulatory role in cardiac muscle specific gene expression is well established. The expression of TEF is cell type specific as is its role in gene regulation. TEF-1 has been shown to act in an inhibitory as well as an activating manner in regards to gene regulation (Hwang et al. 1993; Jiang & Eberhardt 1995; Jiang & Eberhardt 1996, Vassilev et al. 2001). Cell type specificity directly correlates with the availability of potential partners and/or modifying factors. TEF-1s activating or inhibiting properties have been shown to be reliant on the partners it interacts with (Ishiji et al. 1992; Chaudhary et al. 1994; Chaudhary et al. 1995; Jiang & Eberhardt 1997). TEF-1 has been shown to interact with multiple proteins including Max (Gupta et al. 1997), poly(ADP-ribose) polymerase(PARP) (Butler and Ordahl 1999), SRF (Serum Response Factor)(Gupta et al. 2001), YAP65 (Vassilev et al. 2001), MEF2 (myocyte enhancer factor-2) (Maeda et al. 2002), TBP (TATA binding protein)(Jiang & Eberhardt 1996), and TFIID associated TAFs (Brou et al. 1993). TEF-1 has multiple protein domains as can be seen in Figure 3-7, which were determined through mutational analyses, as well as protein-protein interaction assays, no crystal structure of TEF-1 has been done at this point. Regulation of TEF activity has been focused on phosphorylation sites and activating partners. Multiple phosphorylation sites have been suggested within TEF-1 (Jiang et al. 2001; Gupta et al. 2000; Kariya et al. 1993). The Eberhardt laboratory has investigated the inhibitory properties of TEF-1 in human choriocarcinoma BeWo cells, and demonstrated that TEF-1 can be phosphorylated by protein kinase C and that this phosphorylation occurs at serine and threonine residues within the third helix of the DNA binding domain. This

PAGE 76

64 modification results in reduced TEF-1 DNA binding activity based on DNA binding assays and functional data (Jiang et al. 2001), and may explain the inhibitory action of TEF-1 in these cells. The ability of TEF to activate gene transcription has been demonstrated to be dependent on the availability of relevant protein partners. One such partner is YAP65, a cytoplasmic protein that has been shown to interact through its amino terminus with the carboxyl terminus of all TEF family members (Vassilev et al. 2001). Although YAP65 is visualized in the cytoplasm, TEF-YAP complexes have been purified from mouse cells, suggesting that TEF/YAP dimers do exist in vivo. The authors conclude that the carboxyl terminal acidic activation domain of YAP is in actuality the functional activation domain of TEF, as without this interaction TEF is unable to activate transcription. Additionally, they propose that YAP65 regulates TEF activity by its localization in the cytoplasm, only being stimulated to translocate when needed. TEF-1 was first isolated based on its ability to bind three sites within the SV40 enhancer/early promoter region, GTIIC (5’GTGGAATGT3’), Sph-II (5’AAGTATGCA3’) and Sph-I (5’AAGCATGCA3’) (Davidson et al. 1988). There are multiple binding sites within this enhancer region, in descending order towards the TATA box of the early promoter they are GTIIC, GT-I, TC-II, TC-I, SphII, Sph I, and P. The spacing of the TEF-1 binding sites within this sequence gives an indication of the binding capabilities of TEF. TEF-1 is capable of binding as a monomer (GTIIC site) as well as in a cooperative manner (SphII/SphI sites). This cooperativity has certain requirements. In the case of SphI, SphII must be bound first for binding to occur on the SphI site, these sites are located tandomly (Davidson et al. 1988). The Eberhardt

PAGE 77

65 laboratory expanded on the analysis of cooperativity analysis using double stranded synthetic oligos containing 12bp random sequences. They radioactively labeled these sequences and through multiple rounds of selection incubated them with TEF-GST bound to agarose, this was followed by cleavage of the GST-agarose, and release of TEF-1-DNA complexes which were then utilized in an EMSA analysis. Shifted complexes were isolated from the gel, and the DNA sequence determined. Of 31 selected sites, 67% were GTIIC (GGAATG), 12% were M-CAT (GGTATG), and 2% contained our hypothesized TEF-1 Site 2 sequence (AGAATG). The majority of the clones (18/31) contained two GTIIC half sites. The cooperativity between these two half sites was dependent on the number of bp between each site. Further EMSA analyses determined that 1 bp resulted in a single band, 2-3 bp between each site resulted in two migrating bands, and when the space was increased to 4 or 5 bp a single migrating band was seen (Jiang et al. 2000), similar results with 5 and 10 bp were seen by the Chambon group (Davidson et al. 1988). The requirement for protein-protein interactions in this cooperativity was demonstrated by the use of increasing amounts of deoxycholate (DOC) in the EMSA binding reaction. DOC had been previously demonstrated to selectively interrupt protein-protein interactions while having no affect on protein-DNA interactions. Increasing amounts of DOC [0.16%]f resulted in a loss of the dimer band, while the monomer band remained (Jiang et al. 2000). Within Site 2 of the rat enhancer, only one potential TEF-1 site is seen, the spacing between our hypothesized p65 site and TEF-1 is 1 bp. The EMSA analysis shown in Figure 3-13 utilizing GST-TEF-1 showed one migrating band, suggesting monomeric binding, however upon addition of nuclear

PAGE 78

66 extract, this TEF-1 bound DNA is visualized migrating higher than the two regularly seen nuclear complexes. Potential explanations for this include modifications of the TEF-1 protein leading to altered DNA binding or leading to interactions with a protein found within the nuclear extract. Interaction with a factor directly from the extract could cause an increase in size and/or change in conformation of the protein complex of binding Site 2. The binding of TEF-GST alone also could potentially result in a higher migrating band, if this were the case the higher migrating band would only be the result of the 26kD GST protein. It is difficult to measure protein sizes on a non-denaturing gel due to protein structure playing a role as opposed to a denaturing gel where all proteins are comparable due to equalization of charge and loss of secondary structure. An interesting note to add is that in the SV40 enhancer/early promoter region, site TC-II (5’GGAAAGTCCC3’), which is located 18 and 19bp respectively from the GTIIC and Sph-II motifs, is known to be bound by NF-B, a complex containing p50 and p65, and in the first characterization of NF-B binding the immunoglobulin light chain intronic enhancer region, it was also shown to bind the SV40 enhancer region (Sen &Baltimore 1986b). The p65 Transcription Factor The transcription factor p65 is a member of the evolutionarily and structurally conserved Rel homology domain family of proteins, whose members include p50, RelA (p65), c-Rel, RelB, and p52. Most importantly, all of these proteins are believed to have the ability to homo and hetero-dimerize with each other. All family members contain an approximately 300 amino acid residue N-terminal domain that is responsible for DNA binding, dimerization and nuclear localization (Figure 3-8).

PAGE 79

67 The prototypical heterodimer consists of p50 and p65 and was first isolated as a member of a complex of proteins bound to the Immunoglobin light kappa chain enhancer region and was given the name NF-B (nuclear factor kappa B) (Sen &Baltimore 1986a). Since its isolation the NF-B complex has been shown to positively regulate a multitude of genes involved in the inflammatory response as well as growth and development. Its ability to quickly activate transcription in response to outside stimuli is due to the pre-existence of the complex in the cytoplasm where it is held by IB (inhibitory kappa B) family members, either or until cell stimulation. Following cellular stimulation IB is phosphorylated leading to ubiquitination and subsequent proteosome mediated degradation. Once modified IB is no longer able to sequester NF-B (p50/p65 complex) and as a consequence NF-B translocates to the nucleus where it activates transcription. This classical view has been expanded upon in recent years as more laboratories have studied NF-B activation, with various inducers and multiple cell lines. Ghosh & Karin propose a new model based on a review of the current data thus far. They propose that the p50/p65/IB complex is able to shuttle between the cytoplasm and the nucleus without stimulation, with IB being phosphorylated in the cytoplasm, and IB ubiquitination taking place in the nucleus (proteasomal degradation occurring in the nucleus or cytoplasm still to be determined). This theory is based on the fact that IB contains a nuclear export sequence (NES) which allows it to shuttle back and forth between the cytoplasm and nucleus, and only masks the p65 nuclear localization sequence (NLS), while IB another member of the IB family also able to bind NF-B masks both NLSs on p65 and p50 and does not contain an NES and is localized to the cytoplasm (Ghosh & Karin 2002).

PAGE 80

68 Since the discovery of the p65 and p50 subunits of the NF-B complex, each member has been shown to interact with other proteins. Specifically, p65, which contains a transactivation domain is the most studied of the two has been shown to interact with proteins from transcription factor families other than the Rel family such as C/EBP, which is a member of the leucine transcription factor family (Stein & Baldwin 1993; Kiningham et al. 2001), and the AP-1 complex which contains the c-fos and c-jun transcription factors (Stein et al. 1993), as well as members of the transcription initiation complex such as TBP (Schmitz et al. 1995), and TFIIB (Xia et al. 2004), and most recently replication factor C (RFC)(Anderson & Perkins 2003). The p50 subunit while not having any activation domain is an interesting protein in its own right. The p50 subunit like its relative p52 is processed from a precursor protein, p105 and p100 respectively. The p105 protein has been the most studied, protein cleavage occurs in a glycine rich region within the protein, releasing the N terminal portion (p50) (Lin & Ghosh 1996). In mice, alternative splicing of the p105 transcript leads to a protein identical to the C terminal half of p105/p50 called IB, which acts in an inhibitory fashion (Grumont & Gerondakis 1994; Liou et al. 1992). The p105 gene has been shown to be autoregulated in reporter assays where both p50 and p65 separately and together can activate p105 transcription (Ten et al. 1992). p50, like p65 is able to homodimerize, unlike p65 however, this homodimerization often leads to repression of transcription (Franzoso et al. 1993). Suggestions for this repression include competition for NF-B sites, and recruitment of co-repressor complexes containing histone deacetylation complexes.

PAGE 81

69 Multiple phosphorylation and acetylation sites have been identified within the p65 transcription factor. How these modification sites interact to coordinately activate transcription is currently in dispute. One laboratory studying the IL-8 promoter believe that once p65 is bound to B sequences, p300 and PCAF (p300/CBP-associated factor) are recruited to the promoter to remodel the chromatin and subsequently acetylate p65 at lysines 122 and 123, lowering its affinity for B DNA, and eventually p65 is exported via IB (which is also upregulated by NF-B) (Kiernan et al. 2003). A second laboratory suggests that de acetylation of p65 promotes NF-B binding with IB, mediating its export to the cytoplasm (Chen et al. 2003). The first laboratory did detailed studies showing that acetylated p65 is directly able to interact with IB, and that acetylated p65 accumulates in the cytoplasm, lending more credence to their theory. Crystal structures of the NF-B (p50/p65) complex demonstrate that it binds DNA with a B consensus sequence of 5’GGGRNYYYCC3’, with R, N, and Y representing purines, any bases, and pyrimidines, respectively (Chen et al. 1998). Each member has a preference for binding, with p65 preferring a 4 bp half site, while p50 prefers a 5 bp half site with 1 bp spacer between the two. p65, however is able to bind the length of an NF-B site as a homodimer by making base specific contacts to its optimal site, and only phosphate backbone contacts with the remainder of the sequence (Chen & Ghosh 1999). Additionally, it was shown that p65 prefers half sites with the following sequence 5’GGAA3’, such as the B-33 sequence, which is similar to the IFN enhancer and the P element of the IL-2 promoters. The B-33 sequence is 5’GGAA A TTT C 3’ (Chen et al. 2000), which has one A/T change with our hypothesized Site 2 p65 sequence 5’GGAA A TTA C 3’.

PAGE 82

70 From a review of the multiple crystal structures completed by the Ghosh laboratory, it appears that p65 is able to bind as a homodimer to sequences ranging from 4 bp to 10 bp in length, with different conformations depending on the sequence (Chen et al. 2000). The sequence that the Isobe group suggests is an NF-B binding site within our Site 2 is 5’TCTGGAA A3’ (Maehara et al. 2000), however based on the above review this site is more in line with a potential p65 homodimerization site rather than a NF-B binding site. Since both of these sequences are in Site 2, the results in Figure 3-12 regarding the loss of one of the two complexes due to mutagenesis of our hypothesized site can be explained by the transfer of potential p65 homodimers on the one subsite to the second subsite. The differences seen in migration on the gel of these two complexes is most likely due to the differences in binding of p65 to each p65 subsite within Site 2. It has been demonstrated that p65 binds to two different half sites with different conformations, but similar affinities which can be the result of just one bp change (Chen et al. 2000). Which of the two potential p65 binding sites is the functionally relevant one in vivo is unclear. Both sites contain inducible protection sites through in vivo footprinting as does the TEF-1 site which is located between the two potential p65 binding sites as seen in Figure 3-14 (Rogers 2000; Jones et al. 1997). GGAAATTACCACATTCTGGAAATTTTACCCTTTAATGGTGTAAGACCTTTAAAATG TEF-1 p65 p65 Figure 3-14. Newly theorized protein binding sites for TEF-1 and p65 on the enhancer site 2 sequence

PAGE 83

71 In summary, a yeast One-Hybrid screen utilizing Site 2 of the MnSOD enhancer region resulted in the isolation of the transcription factors, TEF-1, TEF-3 and p65. p65 had previously been implicated in MnSOD gene regulation, while TEF family members had not. Specific binding within Site2 for these factors was confirmed through mutation of theorized sites for each factor and EMSA analysis utilizing GST fusion proteins. To determine the functional relevance of this binding, over-expression studies utilizing these factors were completed and the results demonstrated in Chapter 4.

PAGE 84

CHAPTER 4 TRANSCRIPTION FACTOR OVER-EXPRESSION STUDIES ON ENDOGENOUS MNSOD GENE EXPRESSION Introduction One-Hybrid Analysis of the MnSOD intronic enhancer Site 2 revealed the binding of the transcription factors p65 and transcriptional enhancer factor-1 (TEF1). EMSA analysis confirmed specific binding sites for these proteins within Site 2. Transcription factor binding alone however, does not determine functional relevance. Gene regulation is a coordinated process that requires the interaction of multiple factors and complexes, some of which act in an inhibitory fashion while others have activating potential. Key to successfully initiating transcription is the interaction between proteins bound at the promoter and those bound at the enhancer. The enhanceosome first described by Dr. Tom Maniatis suggests that multiple proteins are organized at the enhancer in a specific arrangement unique to each enhancer element, and that this protein-protein-DNA complex presents a complementary surface for the protein factors acting at the promoter (Thanos & Maniatis 1995). This specificity is determined by the DNA sequence itself and the availability of factors within a particular cell. Higher eukaryotic organisms are able to develop and respond to ever changing external stimuli because of this intricately coordinated specificity. An enhanceosome can include factors that bend DNA so that it can interact with activating factors necessary for transcriptional activation. The protein members of this complex act cooperatively, such that each member has a role in the transcription process. A One-Hybrid analysis allows for detection and isolation of 72

PAGE 85

73 specific proteins binding a sequence of DNA, however as discussed multiple factors are usually involved in transcriptional initiation. Therefore, isolating the factors is only the first step towards determining the functional role of these factors. To functionally determine the involvement of protein factors with the sequence of interest, and ultimately with the regulation of the gene, one of the most common methods employed has been the transient transfection assay utilizing reporter constructs to determine activation. This method involves the over-expression of the factor(s) of interest along with a circular non-replicating plasmid containing the regulatory sequence of interest attached to a gene that is readily detected such as the human growth hormone gene or the luciferase cDNA. Transient transfection assays utilizing reporter constructs have resulted in a wealth of knowledge regarding gene regulation. However, analysis of promoter-enhancer reporter constructs provides only information about what a transcription factor is capable of doing, such as stimulation or inhibition, not necessarily what it actually does in vivo at the gene in its natural chromatin environment. Chromatin is composed of DNA and nucleosomes. To determine if non-replicating plasmids are capable of mimicking the chromatin environment experiments were conducted to determine if plasmid DNA was capable of forming a nucleosomal pattern similar to that found endogenously. Multiple groups have looked at this patterning through the use of micrococcal nuclease, an enzyme which cleaves the linker region between nucleosomes, creating a representative pattern of digestion. The results suggest that nucleosomes are deposited on non-replicating plasmid DNA, however there is no consistent pattern as is found in cellular chromatin (Smith & Hager 1997; Archer et al. 1992). These experiments are a reminder, that while useful in a broad sense, plasmid

PAGE 86

74 based analyses do not recapitulate what is happening in vivo, and experiments conducted in the context of the natural chromatin environment are more relevant towards an understanding of gene regulation. To determine the functional significance of the factors isolated through One-Hybrid screening, each factor was transiently over-expressed either alone or in combination, and the endogenous MnSOD gene expression levels were analyzed by steady state northern analysis. If the factor(s) act in a positive manner, induction of gene transcription should be visualized. The factor(s) isolated could also potentially have a negative role in regulation, acting as a dominant negative, and therefore experiments were conducted with the known pro-inflammatory mediators of MnSOD (LPS, TNF, and IL-1), to determine if a negative acting factor would be able to block MnSOD induction. Any factor(s) that are capable of inducing endogenous MnSOD expression must be directly involved in the natural induction of the gene because these factors would have to navigate the natural chromatin environment. Results As described in Chapter 3, the transcription factors isolated from the One-Hybrid screen included three copies of transcriptional enhancer factor-3 (TEF-3), 1 copy of TEF-1, and 1 copy of p65. The cDNA library used for the One-Hybrid screen was a human brain cDNA library, it is possible that TEF-3 is more enriched in the adult brain and this is why three copies of this cDNA were isolated. The literature has shown that TEF family members have the ability to bind similar DNA sequences due to their sharing a common DNA binding domain (Jacquemin et al. 1996; Stewart et al. 1994). It is, therefore, possible for these two factors to bind the same sequence. To determine what involvement if any the TEF-3 transcription factor had on MnSOD gene expression,

PAGE 87

75 TEF-3 was over-expressed in L2 cells with and without the inducers LPS (0.5 g/ml), TNF (10 ng/ml), and IL-1 (2 ng/ml) for 8 h. Figure 4-1 demonstrates that TEF-3 did not induce endogenous MnSOD gene expression in the unstimulated cells, nor did it inhibit the induced expression caused by LPS, TNF and IL-1. Re-probing of the original blot with the TEF-3 cDNA confirms over-expression in the transfected lanes, while showing that TEF-3 is not found endogenously by northern analysis in our pulmonary epithelial cells. To determine if TEF-1 was involved in MnSOD expression, TEF-1 was over-expressed in L2 cells with and without the inducers LPS, TNF, and IL-1 for 8 h. Figure 4-2 demonstrates that TEF-1 was also unable to induce MnSOD gene expression on its own or in combination with TEF-3 nor inhibit the pro-inflammatory induced MnSOD expression as compared to the untransfected samples. Figure 4-2 additionally demonstrates the endogenous expression of TEF-1 in these cells. TEF-1 gene expression is cell type specific, when expressed three potential transcript sizes are seen depending on the cell type, a major TEF-1 transcript ~12 Kb, and minor transcripts of 2.4 and 3.5 Kb. Analysis of the 3’UTR revealed multiple putative polyadenylation sites as well as several potential mRNA destabilization signals (AUUUA) (Xiao et al. 1991). The next transcription factor tested was p65 which has been implicated in MnSOD gene expression by other laboratories, (Maehara et al. 2000; Jones et al. 1997), although these laboratories did not study endogenous MnSOD expression. Over-expression of p65 (Figure 4-3) caused minimal induction in our cells, and although the induction seen varies, the fold inductions seen do not compare with that of the LPS, TNF and IL-1 induction of the endogenous MnSOD gene normally seen in L2 cells.

PAGE 88

76 MnSODTEF3Cathepsin BUntransfectedTEF3 3.82.72.21.31.0Kb CLTICLTI Figure 4-1. Northern analysis of transcriptional enhancer factor-3 (TEF-3) over-expression in L2 cells as compared to untransfected cells with either no induction (C), LPS (L), TNF (T) or IL-1 (I). Endogenous MnSOD, TEF-3 over-expression and Cathepsin B for loading control were analyzed

PAGE 89

77 UntransfectedTEF1-FTEF1-F+TEF3CTEF1-FlagMnSODEndogenous TEF112.0 3.82.72.21.31.0Cathepsin B 1.3Kb TEF3LTICLTICLTI Figure 4-2. Northern analysis of Flag tagged-transcriptional enhancer factor -1 (TEF1) and Flag-TEF1 with TEF3 over-expression as compared to untransfected with either no induction (C), LPS (L), TNF (T) or IL-1 (I). Endogenous MnSOD, Endogenous TEF-1, over-expressed Flag-TEF1, over-expressed TEF-3 and Cathepsin B as a loading control are visualized

PAGE 90

78 MnSOD p65 Cathepsin B Untransfectedp65 CLTICLTI Figure 4-3. Northern analysis of over-expressed p65 compared to untransfected with either no induction (C), LPS (L), TNF (T) or IL-1 (I). Endogenous MnSOD, over-expressed p65 and Cathepsin B as a loading control is visualized.

PAGE 91

79 It is well established that complex enhancer functions often require the involvement of multiple proteins for activation of transcription, with this in mind, we next over-expressed both TEF-1 and p65 transcription factors together and evaluated endogenous MnSOD gene expression. As seen in Figure 4-4, there was a significant increase in endogenous MnSOD expression as compared to vector alone, TEF-1 alone and p65 alone transfected cells. Densitometry and statistical analysis (Figure 4-5) of seven experiments however reveals that this induction is approximately 5 fold. This level of induction does not reproduce the steady state increases seen by northern analyses; however Site 2 is only one of multiple elements within the enhancer that contribute to the endogenous MnSOD induction seen by pro-inflammatory mediators. We also demonstrated by immunoblot analysis that the increases seen by co-over-expression of the TEF-1 and p65 yielded an increase in MnSOD protein levels as compared to uninduced basal expression (Figure 4-6). Figure 4-7 demonstrated co-over-expression of TEF-1 and p65 as compared with the pro-inflammatory inducers LPS, TNF and IL-1. Figure 4-8 is the densitometry and statistical analysis of TEF-1 and p65 over-expression with the endogenous MnSOD inducers LPS and IL-1. As visualized over-expression of TEF and p65 followed by IL-1 stimulation resulted in a significant induction of endogenous MnSOD as compared to untransfected stimulated IL-1 samples. The effect was also significant in TNF and LPS treated samples however to a lesser extent. As previously discussed, all TEF family members have a conserved DNA binding domain, and although TEF-3 did not appear to be expressed in our cells through northern analysis, we over-expressed TEF-3 with p65, to determine if it could similarly to TEF-1.

PAGE 92

80 pcDNA3.1 TEF1+p65TEF1p65 Cathepsin BMnSOD Figure 4-4. Northern analysis of transcriptional enhancer factor -1 (TEF1)-pcDNA3.1, p65-pcDNA3.1 and TEF1 + p65 over-expression as compared to vector alone (pcDNA3.1) Endogenous MnSOD, and Cathepsin B as loading control are visualized.

PAGE 93

81 Endogenous MnSOD Induction0123456UntransfectedTEF Alonep65 AloneTEF+p65Fold Induction n=7**** Figure 4-5. Densitometric analysis of effect of over-expression of TEF-1, p65, and TEF-1 and p65 as compared to untransfected on endogenous MnSOD gene expression. Densitometry was done using Scion Image from NIH and Statistics done using t-test of Paired Two samples of the Mean, two tailed P value, where *= <.05, ***=<.0005 significance.

PAGE 94

82 IL-1TNF-LPSUn-stimulatedp65TEF1 +p65Recombinant MnSOD 36 29 20TEF1 Figure 4-6. Immunoblot analysis of over-expression of transcriptional enhancer factor -1 (TEF-1),p65, TEF-1 and p65 as compared to untransfected with either no induction (C), LPS (L), TNF (T) or IL-1 (I). MnSOD protein size is visualized with recombinant MnSOD as a size control marker.

PAGE 95

83 p65 Cathepsin BTEF1 MnSODpcDNA3.1TEF1 + p65 Endogenous TEF1CLTICLTI Figure 4-7. Northern analysis of transcriptional enhancer factor-1 (TEF-1) and p65 over-expression as compared to empty pcDNA3.1 transfected L2 cells with either no induction (C), LPS (L), TNF (T) or IL-1 (I). Endogenous MnSOD, Endogenous TEF-1, TEF-1, p65 over-expression and Cathepsin B as loading control are analyzed visualized

PAGE 96

84 ***** Endogenous MnSOD Induction with TEF+p65 &Mediators012345678ControlTEF+p65LPSTEF+p65-LPSTNFTEF+p65-TNFIL-1bTEF+p65-IL-1bFold Induction ****** Figure 4-8. Densitometric analysis of endogenous MnSOD expression. A comparison of untransfected versus transfected cells with TEF and p65. Each set was either uninduced or induced with LPS, TNF or IL-1. Densitometry was done using NIH Scion Image and statistics were done comparing untransfected to transfected samples using the t-test for paired two samples of the mean, one-tailed p value, where*= <.05, **=<.005 significance

PAGE 97

85 Cathepsin BTEF3MnSODpcDNA3.1TEF3 + p65 CLTICLTI Figure 4-9. Northern analysis of transcriptional enhancer factor-3 (TEF-3) and p65 over-expression as compared to empty pcDNA3.1 transfected L2 cells with either no induction (C), LPS (L), TNF (T) or IL-1 (I). Endogenous MnSOD, TEF-3 over-expression and Cathepsin B for loading control are visualized

PAGE 98

86 As seen in Figure 4-9, over-expression of TEF-3 with p65 also induced the endogenous MnSOD mRNA at levels comparable to TEF-1 and p65 co-over-expression. The originally isolated transcription factor cDNAs were of human origin, to verify the function of these factors on endogenous human MnSOD mRNA, TEF-1 and p65 were transfected either alone or together into human fetal lung fibroblast cells (HFLs). Figure 4-10 demonstrates that TEF-1 and p65 are also able to induce the endogenous human MnSOD gene. The activating function of p65 as previously discussed was first determined through its interaction with p50 in the NF-B complex. NF-B is held in an inactive state through its interaction with IB family members. IB shuttles NF-B between the cytoplasm and the nucleus, upon activation, IB releases p65 in the nucleus where it induces multiple genes including IB. To determine if TEF-1 and p65 over-expression had an effect on IB gene expression, RNA was reverse transcribed to generate first strand cDNA and Real-Time PCR analysis was done utilizing primers for the rat IB gene. Figure 4-11 demonstrates that IB mRNA is induced after co-over-expression of both TEF-1 and p65 as compared to untransfected and TEF-1 and p65 over-expression. These results are suggestive of the fact that TEF/p65 mediated induction could potentially regulate additional genes besides the endogenous MnSOD and IB genes. As previously discussed and visualized in Figure 3-6, p65 has known functional domains, including a trans-activation (TA) domain located in the carboxyl terminus of the protein. In an attempt to elucidate whether the p65 transactivation domain was important to p65 and TEF dependent induction of MnSOD, a mutant form of p65 lacking the trans-activation domain was utilized.

PAGE 99

87 MnSODL7ATEF1-FTEF1p65p65+TEF1p65+TEF1-FKb 41 Figure 4-10. Northern analysis of, p65-pcDNA3.1, transcriptional enhancer factor -1 (TEF1)-pcDNA3.1, Flag-TEF-1(TEF-F), p65 and TEF1-pcDNA3.1, and p65 + Flag-TEF-1 over-expression in Human Fetal Lung Fibroblast (HFL) cells. Human endogenous MnSOD expression is visualized (Normal 1 &4 Kb MnSOD transcripts, and L7A is used as a loading control

PAGE 100

88 Real Time PCR-IkBalpha024681012141618pcDNA3.1TEFp65TEF+p65Fold Induction Figure 4-11. Real-Time PCR analysis of rat IB gene expression. The Roche Light Cycler was used. mRNA was isolated from L2 cells transfected with pcDNA3.1, TEF-1, p65 as well as TEF-1 + p65. Data was analyzed by the CT method, using cyclophilin A as the control gene

PAGE 101

89 TEF-1 was co-over-expressed with a mutant form of p65 lacking the trans-activation domain (TA), and compared to wildtype p65 alone, TA alone, and the wildtype p65 alone and in combination with TEF-1. As can be seen in Figure 4-12, when compared to wildtype p65 and TEF-1 over-expression, TA and TEF-1 over-expression resulted in minimal induction of the endogenous MnSOD mRNA. The left side of the figure demonstrates protein over-expression of the TA plasmid as compared to wildtype p65 over-expression. The densitometry and statistical analysis is seen in Figure 4-13 for mRNA levels by northern analysis. Figure 4-14 demonstrates a time course (12, 24, & 48 h) of MnSOD protein expression following co-over-expression of TA and TEF-1 as compared to wildtype p65 and TEF-1 co-over-expression. The implication of these results is that the transactivation domain of p65 may have an important role in either interacting with TEF or through its importance in transcriptional activation. Further studies outlined in Chapter 6 to further characterize the relevant domains in both TEF and p65 will be discussed. As previously discussed p65 has known single amino acid modification sites within the protein which affect gene transcription. On initial comparison of the p65 clone isolated from the One-Hybrid screen with the published human p65 nucleotide sequence, a single nucleotide difference (nucleotide 538 from start of translation) was observed which resulted in a serine at position 180 in our sequence, while the original published sequence contained a proline at this position (C CT=Proline, T CT=Serine). Our immediate response was to correct this apparent error in our sequence, we therefore performed site-directed mutagenesis and converted nucleotide 538 from a T to a C, and over-expressed this new p65 mutant, S180P with TEF-1. As can be seen in Figure 4-15,

PAGE 102

90 this single point mutation resulted in the inability of combined p65 and TEF-1 over-expression to induce endogenous MnSOD. On further analysis of p65 sequences found in the database, and through an EST (established sequence tags) database search we realized that in fact the serine in our sequence was the correct one and that the originally published proline was incorrect; a mistake that worked to our advantage in this case. The amino acid at position 180 is located within a region containing multiple prolines (172:Pro-Leu-Arg-Leu-Pro-,Pro-Val-Leu-Ser -His-Pro:182), suggestive of an area containing turns, if this were the case introducing a serine at position 180 might not be as disruptive as would be expected. The two mutant p65 analyses, TA and S180P are suggestive of interactions between the proteins as will be discussed in the next chapter. The NF-B complex containing p50 and p65 is one of the most well characterized inducible transcription complexes and has been suggested to be involved in MnSOD gene regulation (Jones et al. 1997; Maehara et al. 1999; Kiningham et al. 2001). In order to determine if p50 was involved in the induction seen with p65 and TEF-1 over-expression, p50 was over-expressed alone and in combination with either p65 or TEF-1. As can be seen in Figure 4-16, p50 alone, or in combination with TEF-1 and p65 had no effect on endogenous MnSOD expression when compared with untransfected samples. Confirmation of the activity of the over-expressed p50 is seen on re-probing of the blot with p50. The p50 transcription factor is processed from a precursor p105 protein, whose mRNA has been shown to be induced by over-expression of p50 and to a lesser extent p50 and p65 (Cogswell et al. 1993; Paya et al. 1992). Over-expression of p50 (O-p50)

PAGE 103

91 ControlVectorTATEFp65TA +TEF 1 TEF1+p65 ControlVectorp65TA MnSODCathepsinBp65TA Figure 4-12. Northern analysis of over-expression of pcDNA3.1, p65-TA deletion (TA), TEF-1, p65, TA + TEF-1, and p65+TEF-1 as compared to untransfected L2 cells. Endogenous MnSOD, and Cathepsin B as the loading control are visualized. Left panel: Immunoblot analysis of over-expression of p65 and the p65 TA plasmids as compared to vector and untransfected

PAGE 104

92 Endogenous MnSOD Induction00.511.522.533.544.55untransfectedpcDNA3.1TA AloneTEF Alonep65 AloneTA +TEFp65 +TEFFold Induction * Figure 4-13. Densitometry of Northern analysis depicted in Figure 4-12. Densitometry was done using NIH Scion Image and statistics were done comparing to untransfected samples using the t-test for paired two samples of the mean, two-tailed p value, where *= <.05 significance

PAGE 105

93 TEF1 +TA DeletionTEF1 +p65124824124824MnSOD Hrs Figure 4-14. Immunoblot analysis comparing TEF1 + p65-TA deletion (TA), and TEF1+ p65 (wildtype) Over-expression in L2 cells. A time course of 12, 24, and 48h was done. 10g of total protein from each sample was run on an 12%SDS-PAGE gel. Recombinant MnSOD is used as the size control

PAGE 106

94 MnSOD TEF1TEF1p65p65S180P-p65S180P-p65TEF1 + p65TEF1 + p65TEF1 + S180PTEF1 + S180P CathepsinB p65 Untrans.WT-p65S180P 1189221452 Figure 4-15. Northern analysis of over-expression of TEF-1, p65, S180P-p65 (serine to a proline substitution at position 180 within the p65 protein), TEF-1+ p65, TEF-1 + S180P-p65. Endogenous MnSOD, p65, S180P-p65 over-expression, and Cathepsin B as the loading control are visualized. Left panel: Immunoblot analysis of over-expression of p65 and the p65 S180P plasmids as compared to untransfected

PAGE 107

95 resulted in an increase in the p105 mRNA transcript (E-p105) thus confirming previous autoregulatory studies and the activity of the over-expressed p50 plasmid. The left panel demonstrates over-expression of the p50 protein as compared to untransfected cells. Interestingly, there may also be a slight increase in p105 mRNA levels after co-transfection with TEF-1 and p65. To try and further determine the involvement of p50 in the induction of MnSOD, a cell permeable inhibitor (SN-50), which masks the nuclear localization sequence of p50 was used (Lin et al. 1995; Uzzo et al. 2001; Kolenko et al. 1999). Pre-incubation of the inhibitor at a concentration of 50 g/ml for one hour, followed by an 8 h induction with the pro-inflammatory inducers LPS, TNF and IL-1 and subsequent northern analysis is depicted in Figure 4-17. SN-50 does not appear to block the pro-inflammatory induction of endogenous MnSOD gene expression at the concentration used. Although this study was not done exhaustively in terms of inhibitor concentrations, it also suggests that p50 is not involved in MnSOD gene induction. Discussion These experiments demonstrate that the combined over-expression of TEF and p65 results in an increase in endogenous MnSOD gene expression in both rat and human lung cells. This induction can be accomplished with either TEF-1 or TEF-3 which is not surprising given that they belong to the same family of factors whose members have conserved DNA binding domains, and are capable of binding similar and identical DNA sequences (Jacquemin et al. 1996; Stewart et al. 1994). TEF family members might have similar DNA binding capabilities but they are differentially expressed both temporally and spatially (Jacquemin et al. 1996). A review of the literature demonstrates

PAGE 108

96 O-p50p65MnSODE-TEF1UntransfectedUntransfectedpcDNA3.1pcDNA3.1TEFTEFp50p50p65p65p50+TEFp50+TEFp50+p65p50+p65TEF+p65TEF+p65 O-TEF1 CathepsinBE-p105p50 kDUntrans. 28203120905234 Figure 4-16. Northern analysis of over-expression of TEF1, p50, p65, p50+TEF1, p50+p65, and TEF1+ p65 as compared to untransfected and empty pcDNA3.1. Endogenous MnSOD, over-expressed p65, Endogenous TEF-1 (E-TEF1), over-expressed TEF-1 (O-TEF1), Endogenous p105 (E-p105), over-expressed p50 (O-p50) and Cathepsin B as the loading control are visualized. Left panel: Immunoblot analysis of over-expressed p50-pcDNA3.1 versus untransfected L2 rat lung epithelial cells. Antibody is specific to human p50

PAGE 109

97 ControlSN50C L T IC L T IMnSOD CathepsinB Figure 4-17. Northern analysis of untransfected L2 cells treated with SN50. Control cells were either uninduced (C) or treated with LPS (L), TNF (T), or IL-1 (I) for 8 h. SN50 cells were treated with 50g/ml of the p50 cell permeable inhibitor SN50 for 1h prior to induction with LPS (L), TNF (T), or IL-1 (I) for 8h as compared to uninduced SN50 treated cells. MnSOD expression and Cathepsin B as the loading control are visualized

PAGE 110

98 that both TEF and p65 are capable of partnering with various transcription factors (Jiang & Eberhardt 1996; Gupta et al. 1997; Gupta et al. 2001; Vassilev et al. 2001; Stein et al. 1993; Stein et al. 1993b; Schmitz et al. 1995). p65, in particular has been most closely associated with its first partner, p50, and the two are thought to mediate a large array of genes. Often this is based on an analysis of p65 function directly yet NF-B is sited as the culprit (Zhong et al. 1998; Kiernan et al. 2003). The potential for p65 to interact functionally with partners besides p50, has been demonstrated through the use of reporter assays (Stein et al. 1993; Schmitz et al. 1995). This is among the first experiments as far as we are aware that demonstrates a partner for p65 with the result of endogenous induction of gene expression. TEF-1 activity is dependent on the availability of specific partners, which is cell type dependent. TEF has been demonstrated to be sensitive to the partner it associates with, as different partners produce different results (Xiao et al. 1991; Chaudhary et al. 1994; Jiang & Eberhardt 1996). The TEF/p65 mediated induction of endogenous MnSOD gene expression is shown to be specific to these two partners as co-over-expression of TEF and p50 does not result in an increase in endogenous MnSOD gene expression. Additionally, co-over-expression of p50 and p65 did not result in a marked increase in endogenous MnSOD gene expression, and the p50 translocation inhibitor, SN50 did not alter the MnSOD induction seen with pro-inflammatory mediators. Work outside our laboratory over-expressed p50 in NIH-3T3 cells, and saw no effect on reporter constructs containing either the MnSOD promoter alone or in combination with the enhancer region (Maehara et al. 2000). Additionally, supershift studies with antibodies to p50 showed minimal disruption of the complexes formed in

PAGE 111

99 these cells (Jones et al. 1997; Maehara et al. 1999). Taken together, this data suggests that p50/p65 is not involved in the endogenous MnSOD induction. Additionally, TEF-1 and p65 co-over-expression was able to induce endogenous IB gene expression, whose protein product is known to interact with the NF-B complex in an inhibitory fashion. These results suggest that TEF/p65 mediated gene induction could potentially be relevant for a variety of genes, some of which were previously considered NF-B dependent. IB has been shown to interact with p50/p65 directly through their NLSs (Malek et al. 1998), an inhibitor often used to inhibit “NF-B” dependent induction is BAY11-7082, used in this laboratory as well to inhibit IL-1 induction of MnSOD in pulmonary artery endothelial cells (Rogers et al. 2001). This inhibitor acts by inhibiting the inducible phosphorylation of IB. Upon phosphorylation of IB the NLS of the p50/p65 complex is exposed allowing translocation of the heterodimer to the nucleus. This inhibition of translocation however does not necessarily mean that the NF-B partners themselves are inhibited from acting as once p65 has translocated to the nucleus, it might interact with another partner that is already present such as TEF-1 for example, and its exit from the nucleus could still be maintained by IB, whose gene is induced by p65 prior to export. Most importantly to the current research, it is also possible that IB may regulate the formation and function of a possible TEF-1/p65 complex. Evidence for the formation of a TEF/p65 complex involved in induction of endogenous MnSOD is at this point circumstantial and mostly inferred, however in the following chapter evidence will be presented for direct protein-protein interactions. Presently, over-expression of two mutant versions of p65, TA and S180P with TEF-1,

PAGE 112

100 showed either diminished or no activation of the endogenous MnSOD gene expression following co-transfection of the plasmids. p65 contains an activation domain at its carboxyl terminus, which is thought to be the activating potential for its interaction with p50 in the NF-B complex. TEF-1 has been shown to interact with another partner, YAP65, which also contains a carboxyl terminus activation domain which the authors suggest is the activating potential for TEF-1 (Vassilev et al. 2001). It is possible therefore that p65 contains the activating potential for TEF/p65 mediated induction, and the variable inductions seen with p65 alone are due to interactions with the endogenous TEF-1. The inability for TEF-1 and p65 to induced endogenous MnSOD gene expression when the amino acid position 180 in p65 is mutated is dramatic. The S180P mutation is due to a one nucleotide change resulting in a one amino acid change. The replacement of the serine residue with a proline residue at first glance would be of concern since introduction of a proline residue could potentially cause disruption of the native protein structure. However, on further analysis of this region in p65, it is immediately apparent that multiple prolines exist in very close proximity, suggestive that incorporation of an additional proline might cause minimal changes in protein structure. Preliminary data by our laboratory on a S180A mutant (serine to alanine change) demonstrates that it also is unable to induce TEF/p65 mediated induction of endogenous MnSOD. This suggests that the potential proline induced bends at position 180 were not a factor in the inability of the TEF/S180P induction to occur. Multiple phosphorylation and acetylation sites have been found on p65, often at serine residues (Vermeulen et al. 2002). If conformational changes were occurring with the S180P mutant they could interfere with

PAGE 113

101 the ability of TEF and p65 to interact directly or alternatively could alter the activating potential of p65 once it has interacted with TEF, thereby resulting in no apparent induction. In summary, combined over-expression of TEF and p65 leads to induction of endogenous MnSOD gene expression. Most importantly, the results of these experiments demonstrate the ability of TEF and p65 to cooperate in a natural chromatin environment. Additionally, the ability to see an induction at the endogenous level with transfection of only two factors suggests that one or both of these factors is a direct activator of endogenous MnSOD induction. Multiple inducible binding sites have been found within the enhancer, which may be critical to the induction of gene expression, which will be discussed in the Appendix. In addition, the importance of specific domains in p65 such as the transactivation domain, lend further credence to the importance of p65 and may infer the importance of the heterodimeric complex. The identification of position 180 as an important residue has also opened another avenue of investigation namely the importance of post-translational modification as another level of regulation. In the next chapter, we will provide proof of direct interactions between these proteins, and their ability to bind the endogenous MnSOD gene in the natural chromatin environment through ChIP analyses.

PAGE 114

CHAPTER 5 CHARACTERIZATION OF TRANSCRIPTION FACTOR INTERACTIONS AND PROTEIN-DNA IN VIVO INTERACTIONS Introduction Throughout development and in response to external stimuli, eukaryotes utilize a complex yet highly coordinated system of gene regulation. This system is reliant on proteins which relay messages from the cell surface to the nucleus. These signaling pathways include modifying proteins, as well as those responsible for protein sequestration in the cytoplasm. Transcription factors are proteins that recognize specific DNA sequences and activate or repress gene expression either on their own or in combination with other transcription factors. Transcription factors, particularly ones with activating potential often comprise at least two functional domains, the DNA binding domain (DBD) and the transcriptional activation domain (AD). These domains can often be modular, in that they can be separated from the rest of the protein and still have activating potential both in vitro and in vivo when fused to a heterologous DBD, such as the Gal4 AD used in the yeast One-Hybrid assay, and the herpes simplex virus protein,VP16 activation domain (Chasman et al. 1989). Transcription factors are categorized by their DNA binding domain. The most well characterized classifications include the leucine zipper, Zn finger, helix-turn-helix, and rel homology motifs. The leucine zipper domain found in C/EBP, and AP-1 family members is characterized by stretches of leucine residues that create a basic hydrophobic region along an -helix (Vinson et al. 1989). DNA binding occurs 102

PAGE 115

103 through dimerization of two helices arranged parallel to each other with the leucine residues facing each other. This dimerization allows for the carboxyl clusters of basic amino acids to interact with the negative charged DNA backbone. The zinc finger domain found in the developmentally regulated Gli proteins is characterized by its ability to coordinate Zn between cysteine and histidine residues (Cys-Cys-His-His or Cys4) (Pavletich & Pabo 1993). The helix turn-helix motif found in homeobox genes contains an elongated recognition helix with two helices connected by a turn (Otting et al. 1990). The rel family members, such as NF-B bind DNA as hetero or homodimers in a butterfly fashion. Each subunit contains two sets of sheet folds, which form the N’ and C’ terminal domains. The N’ terminal domain contacts DNA both base specifically and backbone non-specifically, while the C’ terminal domain mediates dimerization and non-specific DNA contacts (Chen & Ghosh 1999). The resulting structure looks like a butterfly with DNA found in the center. No crystallization structures have been made of TEF and DNA, however structural predictions have suggested three helices containing hydrophobic patches or one helix and two sheets. Previously it was believed that only factors within the same transcription factor family could interact. Currently, evidence has accumulated demonstrating heterodimerization between families, such as the leucine zipper family member C/EBP which is able to interact with the rel family members p65 for example (Stein et al. 1993; Stein et al. 1993b, Perkins et al. 1993; Schmitz et al. 1995). The actual domains that are required for dimerization can vary between partners, for example, TEF interacts with SRF through aas 27113, while TEF interacts with YAP through aas 115-445 (Vassilev

PAGE 116

104 et al. 2001; Gupta et al. 2001). Transcription factors also heterodimerize for functional reasons. As discussed some factors contain transactivation domains, however not all factors necessarily contain these domains. Heterodimerization could be a requirement for function, as one of the factors could contain the required activation or inhibitory domain. The activity of transcription factors can also be affected by non-DNA binding accessory factors which can act as a bridge between the basal transcriptional machinery, stabilizing the transcription factor DNA binding complex or alternatively changing the specificity of the target sequence by altering the transcription factors conformation in regards to binding. The recent work by the Baltimore laboratory (Leung et al. 2004) demonstrating the ability of a one nucleotide change in sequence to change the partners binding that sequence is a reminder of the coordinated effort required for proper gene activation. This process also includes the availability of protein factors and their modifiers, bridging proteins, partners potentially for activation, chromatin remodeling machinery, RNA polymerase and of course the actual sequence itself. One marvels that we are here at all. How transcription factors recognize and bind specific regions of DNA exactly is still under debate however, the basic principles of the interactions have held true. In 1984, Pabo & Seur suggested the existence of a “recognition code” similar to the genetic code for amino acid determination, however the “recognition code” was based on potential amino acid side chain interactions with DNA bases. Amino acid side chains within a protein bind DNA based on the exposed moieties of each nucleotide, such as a hydrogen atom, a methyl group, or hydrogen bond donor/acceptors (Suzuki & Yagi 1994; Pabo & Seur 1984). The nature of the DNA double helix allows for the exposure of base

PAGE 117

105 pairs in the major grooves allowing for specific protein-DNA interaction. The specificity of the interactions are also dictated by van der waals forces, and hydrogen bonds, where two thirds are non-specific contacts made with the phosphate backbone, leaving the remaining one third of the interactions for sequence specific contacts. Each amino acid can interact with more than one base simultaneously. Regardless of the details to gene activation, what is clear is that there is interdependence on both protein-protein and protein-DNA interactions, one cannot occur without the other. To decipher the mechanisms leading to gene regulation, evaluating both interactions in as close to an endogenous environment as possible can result in useful information. As already demonstrated in this thesis, the functional relevance of TEF and p65 has been demonstrated through co-over-expression studies which resulted in increased endogenous MnSOD gene transcription. Minimally, this induction requires the trans-activation domain of p65, as well as a serine at position 180, suggestive of potential protein-protein mediated interactions leading to the induction of endogenous MnSOD gene expression. In order to determine if protein-protein interactions were occurring, co-immunoprecipitation studies were conducted. As determination of protein-protein interactions alone does not tell us if these proteins are found endogenously at the rat MnSOD enhancer region, chromatin immunoprecipitation studies to determine if these factors were bound to the endogenous enhancer in unstimulated and IL-1 stimulated cells was conducted.

PAGE 118

106 Results Transcriptional Enhancer Factor-1 and p65 Localization in Unstimulated and Induced Rat Lung Epithelial Cells To visualize the localization of the TEF-1 and p65 transcription factors, an immunohistochemical immunoflourescent analysis was performed using antibodies specific to each protein. Rat lung epithelial cells were plated on glass coverslips and allowed to grow to confluency. Stimulated cells were treated with either LPS (0.5 g/ml), TNF (10 ng/ml), or IL-1 (2 ng/ml). Primary antibodies to TEF-1 (monoclonal) and p65 (polyclonal) were both used at a dilution of 1:50, anti-mouse FITC and anti-rabbit Texas red secondary antibodies were used at a dilution of 1:300 and 1:500 respectively, Hoescht dye was used to detect nuclear DNA at a dilution of 1:1000. As seen in Figure 5-1a, TEF-1 is a nuclear localized protein, while p65 is primarily cytoplasmic in unstimulated resting cells (b). As has been well documented in the literature (Ghosh & Karin 2002), upon stimulation with LPS, TNF and IL-1 p65 becomes a nuclear localized protein (panels c-e). Inset boxes in each panel represent secondary antibody controls. Panels f-j are the corresponding nuclear stained cells from panels a-e. Co-over-expression of both TEF and p65 results in p65 Nuclear Localization To determine if these two proteins could affect the respective localization of each putative partner, TEF1 and p65 were over-expressed and their localization visualized as compared to untransfected cells. As seen in Figure 5-2, untransfected endogenous TEF-1 is localized to the nucleus, over-expressed TEF-1-pcDNA3.1 is also found in the nucleus, at higher levels than the untransfected cells within the same panel. Untransfected endogenous p65 is localized to the cytoplasm as is over-expressed p65-pcDNA3.1, but at

PAGE 119

107 higher levels. Inset boxes with in each panel reflect seconda ry antibody only controls for each sample set. However, on transfection of both plasmids, TEF-1-pcDNA3.1 and p65-pcDNA3.1, p65 was localized in the nucle us, suggestive of cytosol to nucleus translocation (bottom three panels). To verify the effect of co-over-expre ssion of TEF-1and p65 seen in Figure 5-2, constructs containing amino terminal epitopes which are not found endogenously were used resulting in an N terminal tag for each protein, Flag for TEF-1 and myc for p65. Antibodies specific to these short peptides allowed for detection of only those cells transfected with our plasmids versus endogenous TEF-1 and p65. Figure 5-3 panel a demonstrates Flag-TEF-1 localization, as co mpared to cells that do not contain this protein, reaffirming that endogenous TEF-1 is not being detected w ith these antibodies. Panel b is a merged image with Hoescht staining in blue labeling the nucleus with Flag-TEF-1 normally green becomming light blue as compared to cells devoid of Flag-TEF-1. Panel c demonstrates myc-p65 localiza tion in the cytoplasm, panel d is a merged image with Hoescht staining in blue labeling the nucleus and myc-p65 in red. On co-over-expression of both Flag-TEF-1 and myc-p65, panel e demonstrates Flag-TEF-1 nuclear localization, panel f demonstrates myc-p65 nuclear and cytoplasmic localization, panel g is a merged image of both Flag-TEF-1 and myc-p65, and panel h is a merged image of panel g and Hoescht staining of the same samples, further demonstrating nuclear localization. All insets are sec ondary antibody alone controls. For further visualization of this phenomenon, Figure 5-4 panels a –d demonstrates an example of two cells within the same field. The upper cell has been transfected with both Flag-TEF-1 and myc-p65, while the lower cell has only been transfec ted with myc-p65.

PAGE 120

108 Figure 5-1. Immunohistochemical analysis of endogenous TEF-1 and p65 expression in lung epithelial cells. Panels a and b represent unstimulated control cells, Panel a was immunostained with anti-TEF-1 antibody, Panels b-e were immunostained with anti-p65 antibody. Panel c was stimulated with LPS (0.5 g/ml), Panel d was stimulated with TNF (10 ng/ml), and Panel e was stimulated with IL-1 (2 ng/ml). Panels f-j demonstrate nuclei staining for the corresponding upper panels

PAGE 121

109 Figure 5-2. Immunohistochemical analysis of over-expressed TEF-1 and p65-pcDNA3.1 in lung epithelial cells. Untransfected cells are visualized demonstrating TEF-1 expression as compared with cells transfected with TEF-1-pcDNA3.1 in the adjacent panel. Untransfected cells immunostained with anti-p65 antibody are compared to the right panel containing cells transfected with p65-pcDNA3.1. Bottom three panels demonstrate over-expression of TEF-1-pcDNA3.1 and p65-pcDNA3.1. Left panel is immunostained with anti-TEF-1 antibody, middle panel is immunostained with anti-p65 antibody, and the Right panel is immunostained with both anti-TEF-1 and anti-p65 antibodies, and is shown as a merged image.

PAGE 122

110 Panel a demonstrates Flag-TEF-1 nuclear loca lization only in th e upper cell, Panel b verifies this through a merged image with Ho escht staining of the same field. Panel c demonstrates myc-p65 localization in bot h cells, however as seen in Panel d in a merged image with Hoescht staining, only the upper cell has myc-p65 localized in the nucleus, while the lower cell is devoid of nuclear myc-p65. Panels e-h are further examples of the same phenomenon. All insets are secondary antibody alone controls for each panel. TEF and p65 Interact as determined through Immunoprecipitation Studies The results obtained thr ough immunohistochemical an alysis suggested an interaction between TEF and p65, to dete rmine if this interaction was direct, immunoprecipitation experiment s were conducted to approach and test the hypothesis from three different angles. The first being the use of total cell lysates, first on cells transfected with both plasmids utilizing antibodies to p65, second, on cells transfected with tagged versions of the proteins utilizi ng antibodies to myc, and third, nuclear and cytoplasmic cell fractions were isolated from untransfected cells, and nuclear immunoprecipitation was carried out u tilizing antibodies to TEF1. First, TEF-1-pcDNA3.1 and p65-pcDNA3.1 we re co-over-expresse d, and total cell lysate was isolated, split in two equal volumes, one half received no antibody, and one half received the anti-p65 antibody for immunoprecipitation. Immunoprecipitated complexes were washed repeatedly and th e isolated p65-Ab complexes were run on a denaturing polyacrylamide gel, transferred to a nitrocellulose memb rane, and probed with the anti-TEF-1 antibody. Figure 5-5A demonstr ates the results, with total referring to total TEF-1 protein isolated from cells tran sfected with TEF-1-pcDNA3.1. As previously

PAGE 123

Figure 5-3. Immunohistochemical analysis of over-expressed Flag-TEF-1 and myc-p65 in rat lung epithelial cells. Panel a demonstrates Flag-TEF-1 over-expression using anti-Flag antibody, Panel b is the same field stained with Hoescht dye to visualize nuclei. Panel c demonstrates over-expression of myc-p65 using anti-myc antibody, Panel d is the same field stained with Hoescht dye to visualize nuclei. Panels e-h have demonstrate over-expression of both Flag-TEF-1 and myc-p65 within the same cell. Panel e is immunostained with anti-Flag antibody, Panel f is immunostained with anti-myc antibody. Panel g is a merged image of Panels e and f. Panel h is a merged image of Panel g and Hoescht staining to demonstrate nuclear localization. Inset boxes represent secondary antibody alone controls for panels a and c. Inset boxes for Panels e and f represent untransfected anti-Flag and anti-myc immunostaining controls

PAGE 124

112

PAGE 125

Figure 5-4. Immunohistochemical analysis demonstrating overexpression of both Flag-TEF-1 and myc-p65 as compared to myc-p65 alone in the same field of view. Panel a demonstrates a single upper cell transfected with Flag-TEF-1 as seen by immunostaining with anti-Flag antibody, Panel b is a merged image of a and Hoescht staining of the same cells. Panel b demonstrates the over-expression of myc-p65 in both the upper cell and a lower cell. Panel d is a merged image of Panel c and Hoescht staining, showing nuclear localization of myc-p65 only in the cell transfected with Flag-TEF-1. Panels e-h are additional examples of the same phenomenon seen in Panels a-d. Inset boxes are secondary antibodies only controls

PAGE 126

114

PAGE 127

115 discussed the TEF-1 protein is unique in that it not only has two start codons resulting in two mature proteins (51 &53kD), but the first start codon is an ATT (Isoleucine). The functional difference between these two proteins has not been determined as of yet. As the heavy chain of most antibodies runs in this region (~55kD), another approach was taken utilizing the tagged proteins described earlier. Total cell lysate immunoprecipitations were carried out on L2 cells co-over-expressed with Flag-TEF-1 and myc-p65. Total cell lysate was isolated and either split in two equal volumes, with one half receiving no antibody, while the other half received the anti-myc antibody for immunoprecipitation (Figure 5-5B), or the entire cellular lysate was used with anti-myc antibody for immunoprecipitation (Figure 5-5C). Immunoprecipitated complexes were washed repeatedly and the isolated myc-Ab complexes were run on a denaturing polyacrylamide gel, transferred to a nitrocellulose membrane, and probed with the anti-Flag antibody. Figure 5-5B demonstrates a Flag protein band of the expected size range in the immunoprecipitated lane (IP -myc), while no band is seen in the beads only lane containing no Ab. Figure 5-5C demonstrates a Flag protein band in the immunoprecipitated lane (IP -myc) which runs at the same size as total Flag-TEF-1 protein isolated from the same sample prior to immunoprecipitation (Total). To further evaluate the interaction between TEF-1 and p65, cytoplasmic and nuclear fractions were isolated from untransfected L2 cells that were either unstimulated or stimulated with IL-1 (2 ng/ml). Immunoprecipitation was carried out utilizing the TEF-1 antibody on the nuclear fractions, which were split in two, one half being utilized for beads only, no antibody, and the other half for immunoprecipitation.

PAGE 128

116 Immunoprecipitates were run on a denaturing polyacrylamide gel, transferred to a nitrocellulose membrane and immunoblotted with the p65 antibody. As seen in Figure 5-6A, no interaction was seen in unstimulated cells (Control) in either the beads only or in the immunoprecipitated lane (IP -TEF), however in the stimulated cells (IL-1), interaction with p65 was seen in the immunoprecipitated (IP -TEF) lane as compared to the beads only lane (total p65 protein isolated from a separate experiment was utilized as a size marker). Total protein was isolated from the cytoplasmic and nuclear fractions (prior to immunoprecipitation) to verify the presence of endogenous TEF and p65, as well as their localization. A representative experiment is seen in Figure 5-6B where p65 is found both in the cytoplasm and the nucleus in unstimulated cells, while upon stimulation the majority of p65 relocalizes to the nucleus. TEF-1 however was only present in the nuclear fractions, this confirms at the total protein level what was visualized in the previous immunohistochemistry experiments. This last approach allowed us to determine where the interaction between the two proteins occurred, when it occurred (stimulus driven) and allowed us to do the reverse immunoprecipitation. TEF and p65 bind the MnSOD Enhancer Region in a Chromatin Environment. We have demonstrated that TEF and p65 have the ability to interact through co-immunoprecipitation assays, and that this interaction can occur in the nucleus where TEF1 is found following stimulation. To determine if this interaction occurs on DNA in a chromatin environment, chromatin immunoprecipitation assays (ChIP) were carried out. Figure 5-7 outlines the procedure, briefly, cells are fixed with formaldehyde to cross link any proteins to DNA and RNA, cells are then lysed and sonicated to break up the chromatin into relatively uniform chromatin domains. Immunoprecipitation is carried out with antibodies to the protein of interest in conjunction with protein sepharose as the

PAGE 129

117 WB: a-TEFWB: a-FlagTEF-1+p65-pcDNA3.1Flag-TEF-1+myc-p65Flag-TEF-1+myc-p65kDkDABCTotalIP a-p65Beads only 9012051.734.1 9012051.734.1IP a-mycBeads onlyWB: a-FlagkDTotalIP a-myc124503580 Figure 5-5. Total cell lysate immunoprecipitation of over-expressed TEF1 and p65. A: Immunoprecipitation of over-expressed TEF-1 and p65-pcDNA3.1 in lung epithelial cells using anti-p65 antibody, followed by immunoblotting with anti-TEF1 antibody. B: Immunoprecipitation of over-expressed Flag-TEF-1 and myc-p65 using anti-myc antibody, followed by immunoblotting with anti-Flag antibody. C: Immunoprecipitation of over-expressed Flag-TEF-1 and myc-p65 using anti-myc antibody, followed by immunoblotting with anti-Flag antibody. Totals refer to total protein isolated prior to immunoprecipitation

PAGE 130

118 Figure 5-6. Nuclear fraction immunoprecipitation from untransfected L2 cells. Nuclear fractions were isolated from unstimulated and IL-1 stimulated lung epithelial cells. Anti-TEF1 antibody was used for pull down and immunoblot analysis was done with anti-p65 antibody. Total p65-pcDNA3.1 over-expressed protein from a separate experiment was used for a size control. Cytoplasmic and nuclear fraction total proteins were tested for endogenous expression of p65 and TEF-1 in uninduced and IL-1 stimulated cells

PAGE 131

119 solid support for precipitation of the Ab-protein-DNA complex. The complex is isolated, treated with Proteinase K to degrade the proteins and the DNA is isolated from the samples and subjected to PCR using primers to the area of interest. Amplified PCR products are fractionated on an agarose gel, and treated for Southern analysis, transferred to a nylon membrane and probed with a radioactively labeled oligo complementary to an area within the PCR amplified region for the final evaluation. To determine if TEF and p65 bind the rat MnSOD enhancer region in intron 2, the ChIP assay was conducted on uninduced and IL-1 induced L2 cells with antibodies to TEF, p65, and Sp1. Protein A sepharose was used for the polyclonal antibodies p65 and Sp1, Protein G sepharose was used for the monoclonal TEF-1 antibody as it worked more efficiently. No antibody controls were done for both protein A and G sepharose for a valid comparison of background reactivity compared to immunoprecipitated samples. INPUT samples were obtained from no antibody controls prior to washing of sepharose beads. INPUT controls give an indication of the amount of chromatin in the lysate, and its ability to be PCR amplified. Figure 5-8 demonstrates TEF binding to the enhancer region in unstimulated (Control) cells and IL-1 stimulated cells (IL-1). Binding of p65 to the enhancer, however is inducible as p65 is found bound only after stimulation. Sp1 is bound minimally at the enhancer after induction. Sp1 has previously been shown to bind the promoter region in a constitutive manner (Kuo et al. 2003), and was used as a control in this assay to demonstrate specificity for different regions within the rat MnSOD genomic sequence. PCR controls included H2O as a control for cross contamination during the PCR setup process. INPUT controls were previously described, and genomic DNA

PAGE 132

120 (unsonicated or treated) was used as a positive control for the PCR using the primer pairs indicated. The inset demonstrates the sonciated DNA size fragments isolated from this experiment, C=control, and I=IL-1. Discussion Transcription factors often act in concert with other proteins to regulate gene transcription. Enhancer regions in particular are often found bound to multiple proteins in a constitutive as well as induced manner, as is the case for the MnSOD enhancer region within intron2 (Jones et al. 1997; Rogers 2000). An enhancer element’s ability to induce gene transcription from a distance in the forward or reverse orientation, as well as in front of a heterologous promoter is dependent on the ability of transcription factors to not only bind it directly but also to interact with other factors that are required for transcription including members of the RNA polymerase machinery. Multiple protein interactions therefore must occur for initiation of transcription to take place. Two transcription factors, TEF and p65 were identified based on their ability to bind the MnSOD enhancer Site 2 in a One-Hybrid analysis. The ability of both factors on over-expression to induce endogenous MnSOD transcription at the northern level suggested that some interaction between the two proteins might be occurring. However, these results alone, do not guarantee the direct interaction of these two proteins. In order to visualize the localization of the proteins prior to and after stimulation with the pro-inflammatory inducers used in northern analysis, LPS, TNF and IL-1, immunohistochemical analyses were done, revealing the translocation of p65 to the nucleus after stimulation, while TEF remained in the nucleus regardless of induction. These results confirmed visually what has been previously presumed in the literature regarding p65 nuclear translocation following stimulation in rat lung epithelial cells.

PAGE 133

121 This translocation however does not directly implicate its involvement in the MnSOD gene as p65 is involved in the regulation of a multitude of genes. It did, however, give us a means to visualize any potential interaction with TEF-1 and to uncover an interesting phenomenon namely translocation dependent in part on protein/protein interaction. On over-expression of both TEF-1 and p65 in tagged and untagged constructs, p65 is visualized in the nucleus in the majority of cells receiving both plasmids. A possible explanation for these results, resides in the fact that if both plasmids are taken up by a cell, their transcribed mRNA will most likely be simultaneously translated to protein by ribosomes in the cytoplasm thus producing large quantities of each protein as compared to endogenous levels. TEF1 is a normally a nuclear transcription factor, while p65 is predominantly cytoplasmic, most notably due to IB masking its nuclear localization sequence, thus sequestering it in the cytoplasm. If TEF and p65 are able to interact, and both proteins are being produced at extremely high levels p65 could potentially bind with TEF and be dragged into the nucleus with TEF as it translocates to the nucleus. This visualization of potential interactions between the proteins led to experiments to determine if direct interactions were occurring. Co-immunoprecipitation assays allow for confirmation of direct protein-protein interactions, through the use of antibodies specific to each protein or antibodies to tagged versions of a protein. Antibodies function on their ability to recognize an epitope within the antigen/protein of interest, however not all assays contain favorable conditions for this interaction to take place, and this is why multiple methods are often used to confirm these interactions. Direct interaction of TEF-1 and p65 was demonstrated through co-immunoprecipitation assays utilizing both total and fractionated cell lysates in

PAGE 134

122 transfected as well as untransfected cells, utilizing over-expressed, tagged, and endogenous proteins through immunoprecipitation. Nuclear immunoprecipitation of untransfected cells demonstrated the ability of TEF-1 and p65 to interact and co-localize in the nucleus. Additionally, this interaction is dependent on IL-1 induction, and most likely other inflammatory mediators as well. Co-immunoprecipitation assays determine that proteins have the ability to interact with each other, but not if these proteins can also bind endogenously the gene of interest. Chromatin immunoprecipitation assays are based on the same principle of antibody-antigen recognition. However this method immunoprecipitates not only the protein of interest but also the region of DNA the factor is binding in the natural chromatin environment with endogenous factors and nucleosomal positions. Working in the endogenous chromatin environment of a gene is the ideal method to determine which proteins are binding a region of DNA. The size determination of the region of DNA being bound by a protein is dependent on the sonication fragments that were produced, which are often anywhere from 200-1000 bp. More recent advances and extrapolations of this assay have led to the visualization of the specific protein contact sites at the nucleotide level within a region of sonicated DNA through the combined use of ChIP and in vivo footprinting (Kang et al. 2002). Our ChIP data has shown that TEF is found constitutively on the MnSOD enhancer, that p65 is induced by IL-1 to bind the enhancer, and that low levels of Sp1 binding is seen in the enhancer region. Sp1 is known to be constitutively bound to the promoter region and these binding sites are necessary for transcription to occur (a summary of the ChIP data is seen in Figure 5-9).

PAGE 135

123 Figure 5-7. Chromatin Immunoprecipitation Assay Description. Depiction demonstrates chromatin (beads on a string) DNA, followed by formaldehyde cross linking of proteins and DNA. Sonication of chromatin results in smaller fragments, which are then precipitated with antibodies. Separation and degradation of protein from DNA, followed by PCR analysis utilizing gene specific primers

PAGE 136

124 Figure 5-8. Chromatin Immunoprecipitation from untransfected lung epithelial cells. Unstimulated (Control) and stimulated (IL-1) samples were used for immunoprecipitation. No Ab controls for Protein A and G sepharose were used as background controls for antibodies. Anti-TEF-1, anti-p65, and anti-SP1 antibodies were used for immunoprecipitation as shown. Controls for PCR included H20, INPUT DNAs which are a fraction of chromatin isolated from No Ab controls prior to washing steps, and genomic unsoncicated DNA as a positive PCR control. PCR primers were used corresponding to the region within Intron 2 of the rat MnSOD gene where the minimal enhancer resides. PCR primers for the rat MnSOD promoter region were used as a control. Inset demonstrates sonication of fragments used for this experiment

PAGE 137

125 The finding of Sp1 in the enhancer at low leve ls is suggestive of a potential interaction between Sp1 at both sites as demonstrated in Figure 5-10. Sp1 levels are low as compared to binding seen at the promoter; th e Sp1 visualized here is most likely not bound directly to DNA, but is indirectly bound via another protein. The actual Sp1 that is binding could either be a new Sp1 factor, or on e of the Sp1 factors normally seen at the promoter. This is suggestive of a bridge between the enhancer and promoter Sp1 factors, either by a new or current molecule, suggestive of a looping model with Sp1 being the common binding factor. This hypothesis is obviously dealing only with the known proteins involved in transcriptional regul ation of the MnSOD gene; however additional factors are most likely involved as it is a complex enhancer with multiple protein binding sites, which will be discussed further in the Appendix. In summary, the results presented, sugge sts protein-protein in teractions between TEF-1 and p65 in an IL-1 inducible manner. This interaction most likely takes place at the MnSOD enhancer region in an IL-1 inducible manner, as ChIP studies have demonstrated the presence of TEF-1 and p65 on the MnSOD enhancer region. In addition, the results also pr ovide evidence for a potential cross over partner between the promoter and enhancer, namely a new or prom oter bound molecule of Sp1. Therefore, as depicted in Figure 5-10, we have summarized the results of our data by suggesting that a looping mechanism of interac tion is potentially occurri ng between the enhancer and promoter.

PAGE 138

126 Figure 5-9. Summary of ChIP data on the rat MnSOD enhancer region located in Intron 2. Control unstimulated cells demonstrate TEF-1 binding in the enhancer region only and Sp1 binding in the previously identified Promoter sites V and IX. IL-1 stimulated cells demonstrate p65 and TEF binding the enhancer region, with low levels of Sp1 protein. The promoter region was bound by Sp1 in induced IL-1 cells

PAGE 139

127 Figure 5-10. Theoretical model of MnSOD enhancer structure following induction. The promoter and enhancer region are shown in a looping model with either one or more new molecules of Sp1 being one of the potential bridging factors

PAGE 140

CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS Conclusions At the beginning of this thesis the transcription factors responsible for the functional activity of the MnSOD enhancer at Site 2 had not been definitively elucidated. Previous work had demonstrated the involvement of p65 in regards to activation through intronic elements in reporter assays. The involvement of C/EBP was still undetermined (Maehara et al. 1999; Maehara et al. 2000; Jones et al. 1997). These studies utilized in vitro binding assays and transient transfection of reporter plasmids to make their conclusions. These assays can be very useful for a general view of the capability of factors, but they do not necessarily recapitulate what occurs in the endogenous chromatin environment. From the beginning of this study I have tried to stay as close to the endogenous situation as possible, beginning with the assay to isolate the factors binding this site in vivo. I had the opportunity to learn and utilize multiple assays in the laboratory, with the One-Hybrid being the first. The One-Hybrid assay helps to recapitulate an endogenous eukaryotic environment, particularly due to the ability to integrate the site of interest into the yeast genome, which itself has chromatin structure. Although the yeast grow at a different temperature, and prefer a more acidic environment, they are a eukaryotic organism with chromatin. Importantly, due to the auxotrophic nature of yeast, it allowed for tight regulation of the screening process. It was interesting and very exciting to isolate these two proteins because both had demonstrated previous enhancer binding capabilities. TEF-1 was isolated based on its 128

PAGE 141

129 ability to bind 3 sites within the SV40 viral enhancer, the first identified enhancer (Benoist &Chambon 1981; Banerji et al. 1981). Additionally, the NF-B (p50/p65) complex was isolated from one of the first cellular enhancers identified, the immunoglobulin B light chain enhancer (Sen &Baltimore 1986a; Baeuerle & Baltimore 1989). The fact that both of these proteins are among the first enhancer binding proteins identified, and that they were both capable of binding the same critical enhancer region, demonstrated their importance in mediating both viral and cellular genes. Isolation of the TEF and p65 transcription factors by One Hybrid analysis determined that they were able to bind Site 2, however the exact binding sites needed to be determined. Confirmation of our theorized binding sites was determined through the EMSA technique. The ability to confirm that our hypothesized binding sites were accurate through the use of GST proteins was very rewarding. Determination of factor binding however did not tell us the functional relevance if any. My intentions were to stay as close as possible to the chromatin environment and I was thus fortunate that over-expression of my regulatory factors, TEF and p65, caused a significant and reproducible induction of the endogenous MnSOD gene. A review of the literature indicates that the majority of transient transcription factor over-expression studies evaluate effects based on co-transfection of promoter/enhancer reporter constructs rather than assessment of the endogenous gene expression. This is in fact the norm for MnSOD in particular, since studies with regulatory factors have only utilized the reporter constructs as the output for functional effects. In addition, this was the first time the laboratory had tried over-expressing transcription factors and examining the endogenous mRNA levels through steady state northern analysis. Luckily it worked

PAGE 142

130 to our benefit and as has been demonstrated repeatedly by multiple hands in the laboratory. Thus the most important outcome is that TEF and p65 play a critical role in the regulation of the endogenous gene as all our data places these factors functionally in the normal chromatin environment. Multiple factors are required for transcription to occur, but obviously certain factors are more important than others. As p65, a member of the NF-B complex was isolated from the yeast One-Hybrid screen and previous reports had suggested NF-B involvement, we felt it necessary to determine the involvement of p50 if any in this process. Over-expression of a functional p50 protein was determined through northern analysis. In our hands, p50 and p65 do not induce endogenous MnSOD gene expression in rat lung epithelial cells. Additionally, and importantly TEF and p50 over-expression did not induce endogenous MnSOD gene expression in these cells. This determined for us that this was a phenomenon specific to TEF/p65 mediated MnSOD gene induction. Additional work with the p50 translocation inhibitor, SN-50, often used for blocking NF-B mediated gene induction, had no effect on the endogenous MnSOD at the concentration used. Combined, these results demonstrate that p50 is not involved in MnSOD induction in L2 cells. The ability of the p50 protein to induce its own promoter (which has been previously sited as a function of p50) is a strong indication that the p50 protein we obtained is functional, yet over-expression of the two components of NF-B, p50/p65 did not have the ability to induce endogenous MnSOD gene expression in rat lung epithelial cells. This data has also served to establish the requirement of the transactivation domain and the serine residue located at position 180 within the p65 protein. p65 has been

PAGE 143

131 extensively studied because of its strong activating potential (Schmitz & Baeuerle 1991; Schmitz et al. 1995). It is extremely possible that p65 contains the activating potential in TEF/p65 mediated induction, while TEF serves as the stronger DNA domain. Preliminary results not shown demonstrate that the DNA binding domain of TEF is also required for TEF/p65 mediated gene induction. Both these experiments were done through domain deletions. Alternatively, my research has also uncovered the importance of a point mutation in p65, namely, S180P that is clearly critical for this TEF/p65 mediated gene induction. Important serine phosphorylation sites in p65 have been identified by a number of investigators (Buss et al. 2004a; Buss et al. 2004b). Although we cannot convincingly argue that S180 is a critical site for phosphorylation we do have preliminary evidence that a serine to alanine change at this position was also able to block TEF/p65 mediated induction. The formation of a heterodimeric complex of TEF/p65 was demonstrated via multiple methods including: 1) immunohistochemical localization of the factors following over-expression, 2). Total lysate immunoprecipitation studies utilizing antibodies specific to p65, 3) Total lysate immunoprecipitation studies utilizing antibodies specific for tagged versions of the protein, and finally and most importantly, 4) nuclear extract immunoprecipitation on untransfected cells with the TEF-1 antibody that were either stimulated with IL-1 or unstimulated. Finally and possibly most importantly, ChIP analysis directly places these factors on the MnSOD enhancer region in the natural chromatin environment. TEF is bound prior to and following induction with IL-1 while p65 is only bound following induction.

PAGE 144

132 The low level binding seen with Sp1 following induction is suggestive of it acting as a potential bridge between the promoter and enhancer. As the field of enhancer driven transcription has expanded, so has the original concept of one protein complex regulating one gene. NF-B for example, has been shown to regulate a multitude of genes since it was first isolated. It is possible that TEF and p65 might one day be found to regulate multiple genes outside of those presented in this thesis. Future Directions The results demonstrated in this thesis and the techniques I’ve introduced should be very useful to take this project to the next step. First and foremost the interaction between the two proteins needs to be analyzed further. Preliminary data deleting the TEF-1 DNA binding domain suggests that it is critical for TEF/p65 mediated induction of endogenous MnSOD through northern analysis. A detailed analysis of previously isolated residues of importance for TEF will help guide this research, hopefully allowing for a critical interaction location to be determined. However, given the fact that TEF interacts with each protein partner determined thus far through a different domain, these studies will most likely be empirical. The S180P mutation of p65 has been currently replaced with alanine and threonine, and its ability to induce in combination with TEF will be evaluated further through northern analysis. The ability to make GST tagged proteins will be further utilized to study the interactions between the two proteins through GST pull down assays. The NF-kB complex has been implicated in the regulation of many genes involving multiple pathways besides the original inflammatory pathway analyzed. It would be interesting to determine what other potential genes the TEF/p65 interaction could

PAGE 145

133 regulate besides MnSOD and IB. This can be accomplished through real-time PCR analysis utilizing a vast array of primers or more quickly through microarray technology. RNA isolated from cells transfected with TEF/p65 could be isolated and hybridized with an array containing hundreds of genes, to get a global view of the other genes potentially regulated by these transcription factors. Additionally, as most enhanceosome complexes comprise multiple proteins it would be interesting to determine what other proteins are involved in the complex. The interaction of both TEF and p65 with members of the basal transcriptional machinery, makes a case for studying the proteins TBP, TFIIB etc through ChIP analysis, as well as potentially looking at histone modifications utilizing the antibodies to HAT and HDAC enzymes and of course the further involvement of Sp1. A time course similar to what is seen in Appendix A can be done to see how the enhancer protein complex is forming and interacting with the RNA Pol II machinery. The results in Appendix A demonstrate the unknown function of C/EBP and C/EBP in MnSOD mediated induction. The late arrival of C/EBP on the enhancer could potentially correspond with the amount of time necessary for the induced production of the protein to be at saturating amounts. We have visualized that LPS and IL-1 induce C/EBP gene expression at the RNA level, potentially at 3 h post induction. Analogously, the protein levels of C/EBP may have also increased enough so that they may now bind the enhancer potentially acting in concert with C/EBP to inhibit MnSOD gene transcription. Additionally this might explain previous EMSA analyses showing C/EBP and C/EBP, but not C/EBP in induced complexes, and the over-expression studies on enhancer based reporter assays showing that C/EBP was unable to induce

PAGE 146

134 through the promoter/enhancer regions of MnSOD (Maehara et al. 2000). These proteins could be involved in the regulatory mechanism needed and required for the MnSOD gene. To determine if this is the regulation mechanism, stable cell lines containing C/EBP and C/EBP separately and together could be utilized to determine if these stably integrated cells are still capable of inducing endogenous MnSOD with pro-inflammatory mediators. Ultimately, determining if the looping model in Figure 5-10 is correct would be ideal. A recently developed methodology to determine this is the Capturing Chromosome Conformation (3C) developed by Dekker and associates in yeast (Dekker et al. 2002), and modified slightly in mammalian cells on examination of the -globin locus (Tolhuis et al. 2002). This technique is based on the ability to cross link protein-protein and protein-DNA interactions through the use of formaldehyde, thus capturing the chromosome conformation at a particular time. Cells are treated with formaldehyde and chromatin is digested with restriction enzymes, these protein-DNA linked fragments are ligated using low DNA concentration. Under these conditions, intra-molecular associations are more favored to occur versus random inter-molecular interactions. Thus there is a higher probability of ligating fragments that are in close proximity, such as those crosslinked in a loop conformation for example, than there is to ligate random fragments not directly linked by proteins. Following ligation, the crosslinks are reversed and ligation products are detected and quantified by PCR. The crosslinking frequency of two specific restriction fragments is measured by comparing control and crosslinked templates in quantitative PCR reactions. A control template needs to be prepared which contains all the possible ligation products. The crosslinking frequency between two

PAGE 147

135 specific loci is expressed as the ratio of the amount of product obtained using the cross-linked template as compared to the control template. Therefore there is a direct correlation between the frequency with which two templates interact. This is potentially one of the first techniques to allow for true in vivo endogenous detection of the spatial organization of chromosomal regions.

PAGE 148

APPENDIX ONE HYBRID ANALYSIS OF SITE 4 WITHIN THE MNSOD ENHANCER: INVOLVEMENT OF C/EBPAND/OR C/EBPIntroduction The function of most enhancers requires the complex interaction between multiple DNA binding sites and their respective protein regulatory factors. We have identified two protein factors that are involved in this regulation, TEF1 and p65. To determine what additional factors were involved in enhancer regulation, a second One-Hybrid analysis was done on Site 4 (underlined in Figure A-1) utilizing a rat lung cDNA library. Computer based analysis of this site identified binding sites for the putative factors, NF1 and NF-B. Mutagenesis studies demonstrated that this site was involved in LPS, TNF, and IL-1 mediated induction through the uses of a growth hormone reporter assay (Rogers 2000). Figure A-1 shows the sequence of Site 4 along with the in vivo DMS footprinting contact sites previously seen as well as potential transcription factor binding sites which we are suggesting. Previous studies have demonstrated that C/EBP binds either the enhancer directly or proteins contacting the enhancer (Maehara et al. 1999; Jones et al. 1997; Guo et al. 2003). However, these studies were unable to demonstrate that this binding leads to any functional response through either transcriptional activation or repression. Multiple methods can be used to turn off gene activation, such as through the use of modifying factors which can work on any proteins in the complex or through histone modifications that effect chromatin remodeling and thus the binding of trans-acting regulatory factors. 136

PAGE 149

137 Based on the wealth of data implicating C/EBP family members, it is possible that some subset of this family could be part of MnSOD regulation. Over-expression studies utilizing C/EBP and reporter constructs containing either the MnSOD promoter alone or MnSOD promoter/enhancer combination demonstrated that C/EBP was unable to induce transcription in a mouse fibroblast cell line (Maehara et al. 2000). C/EBP is known to be phosphorylated, so there is the potential that it needs this phosphorylation to be active. Therefore, we cannot exclude the possibility of protein modifications being necessary. As a reminder, these data and other in vitro studies formed the basis for our One-Hybrid analysis to identify proteins that are truly involved in MnSOD expression. Figure A-1. Rat MnSOD enhancer Site 4 from Rogers (2000) depicting DMS in vivo footprinting induced protection and induced hypersensitivity as well as suggested transcription factor binding sites Results As previously discussed, C/EBP and the NF-B complex have been implicated in MnSOD enhancer regulation. Given the potential importance of C/EBP provided by other investigators and prior to our One-Hybrid analysis C/EBP involvement was

PAGE 150

138 studied on the endogenous MnSOD gene expression as shown in Figure A-2. There are a number of alternative names that have been given to C/EBP, including NF-IL6 and LAP (liver activating protein). For the purposes of this discussion the names C/EBP and LAP will be used interchangeably. Our laboratory had previously obtained rat cDNA expression constructs for both LAP and LIP (liver inhibiting protein) a naturally occurring dominant negative of LAP from the laboratory of Dr. Schiebler at Rockefellar University. As seen in Figure A-2, no effect was observed when LAP or LIP were transfected into L2 cells. Protein over-expression of LAP utilizing anti-C/EBP antibodies is visualized in the left panel of Figure A-2. One problem with these studies was the lack of over-expression for the LAP construct at the mRNA level even though the Immunoblot analysis demonstrated induction at the protein level. As with the rational for the use of the One-Hybrid analysis on Site 2, we used an identical approach using sequences specific to Site 4. The results of One-Hybrid analysis at this site yielded the identification of 1 C/EBP clone, 2 encoding C/EBPs, and 1 rat p65 clone. The C/EBP clone was unfortunately not full length, lacking a region of the N terminus, therefore no start codon was available. Currently, the full length C/EBP clone is being reverse transcribed and amplified from L2 cells by our laboratory. The C/EBP clone is 1130 bp and provides a full length coding sequence, and the p65 clone is 2629bp in length. C/EBP and C/EBP, are members of the same transcription factor family and are known to bind to very similar DNA sequences, and are capable of dimerizing with each other. This part of the project is being continued by another graduate student, and will hopefully be more revealing. We are working in collaboration,

PAGE 151

139 and I will show some of the preliminary data of the over-expression work here and the ChIP analysis which I have completed at this point. Figure A-2. Northern analysis of over-expression of liver activating protein (LAP) and liver inhibiting protein (LIP). Endogenous MnSOD, over-expressed LIP/LAP utilizing probe that recognizes both species, and Cathepsin B as the loading control is visualized. Immunoblot analysis of over-expression of LAP using anti-C/EBP antibodies (left panel) Figure A-3 first demonstrates that C/EBP gene expression is up regulated in L2 cells in response to LPS and IL-1. Additionally, it is shown to bind the enhancer region in a time dependent manner as seen in Figure A-4 through ChIP analysis. A time course analysis of L2 cells induced with IL-1 over a period from 15 min to 3.5 h (210 min) is shown, with the 0 time point being equivalent to uninduced cells. The top panel demonstrates enhancer binding factors, while the bottom panel demonstrates factgors binding at the promoter. In uninduced cells, C/EBP is found at the enhancer, however

PAGE 152

140 15 min after induction through 3.5 h (210 min), it appears to bind the DNA in a stronger fashion, potentially due to a conformational shift following induction. C/EBP however, is not bound at the enhancer in uninduced cells, following IL-1 induction there is an increase in binding, with the strongest intensity at 3.5 h (210 min), which could potentially correlate with the amount of time necessary to transcribe and translate the induced C/EBP mRNA to protein. p65 is not bound in the uninduced cells, and binds following IL-1 induction at 15 min through 3.5 h (210 min). The promoter studies demonstrate potential minimal C/EBP in uninduced cells, although this could be background. C/EBP is however definitely bound following induction at the promoter from 15 min through 3.5 h (210 min). C/EBP is not bound at the promoter until 30 min convincingly and if found bound strongest at 3.5 h (210 min). p65 is not bound at the promoter in uninduced cells, however following IL-1 stimulation from low level binding is seen. This observation needs to be further studied. Figure A-3. Northern analysis of endogenous C/EBP RNA expression in untransfected L2 cells. Uninduced (C), LPS (L), TNF (T) and IL-1 (I) samples are shown Discussion C/EBP has been previously implicated as being involved in MnSOD gene transcription, originally through database analyses as previously discussed. Recent

PAGE 153

141 research findings have led to conflicting reports. The Boss laboratory demonstrated its ability to bind the endogenous gene (Guo et al. 2003), while the Isobe laboratory rules Figure A-4. Chromatin immunoprecipitation of uninduced versus IL-1 induced L2 cells at various time points as indicated above using antibodies to p65, C/EBP, and C/EBP. Both the enhancer and promoter regions of the rat MnSOD gene were analyzed out C/EBP in terms of functional activation of the gene, but still demonstrates that it binds to a complex located on the enhancer (Maehara et al. 1999). To determine if there was any C/EBP involvement in our L2 cells, over-expression studies were conducted. Over-expression of the LAP had no effect on endogenous MnSOD gene induction, however, as is illustrated, C/EBP transcript levels are naturally highly expressed and equivalent to “over-expressed” levels (Figure A-2). The ability of this plasmid to express C/EBP has been demonstrated by the Kilberg laboratory in a different cell type (Chen et al. 2004), therefore we are unsure of the reasons why the full length protein levels cannot be over-expressed in our cells, while the truncated repressor form (LIP) can be over-expressed as seen in Figure A-2. The higher protein levels can be seen through immunoblot analyses comparing untransfected control cells to over-expressed LAP

PAGE 154

142 forms, telling us the protein is being made which may be explained by the fact that the transgene mRNA has a short half life. It should be noted that logically speaking MnSOD needs to be up-regulated quickly in response to dangerously toxic superoxide radicals. Its regulation is, in fact, rapid as can be seen with p65 for example which arrives on the MnSOD enhancer region within 15 minutes, therefore it is plausible that multiple protein factors with both inhibitory and excitatory potential would be involved in this rapid activation of the MnSOD gene. C/EBP and C/EBP will most likely play a role possibly in an inhibitory pathway to turn off gene activation mediated by the enhancer.

PAGE 155

LIST OF REFERENCES Agalioti, T., Lomvardas, S., Parekh, B., Yie, J., Maniatis, T., and Thanos, D. (2000). Ordered recruitment of chromatin modifying and general transcription factors to the IFN-beta promoter. Cell 103, 667-678. Anderson, L. A., and Perkins, N. D. (2003). Regulation of RelA (p65) function by the large subunit of replication factor C. Mol Cell Biol 23, 721-732. Andrianopoulos, A., and Timberlake, W. E. (1991). ATTS, a new and conserved DNA binding domain. Plant Cell 3, 747-748. Archer, T. K., Lefebvre, P., Wolford, R. G., and Hager, G. L. (1992). Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation. Science 255, 1573-1576. Arndt, K. T., Styles, C., and Fink, G. R. (1987). Multiple global regulators control HIS4 transcription in yeast. Science 237, 874-880. Baeuerle, P. A., and Baltimore, D. (1989). A 65-kappaD subunit of active NF-kappaB is required for inhibition of NF-kappaB by I kappaB. Genes Dev 3, 1689-1698. Banerji, J., Olson, L., and Schaffner, W. (1983). A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell 33, 729-740. Banerji, J., Rusconi, S., and Schaffner, W. (1981). Expression of a beta-globin gene is enhanced by remote SV40 DNA sequences. Cell 27, 299-308. Benoist, C., and Chambon, P. (1981). In vivo sequence requirements of the SV40 early promotor region. Nature 290, 304-310. Blackwood, E. M., and Kadonaga, J. T. (1998). Going the distance: a current view of enhancer action. Science 281, 61-63. Blatt, C., and DePamphilis, M. L. (1993). Striking homology between mouse and human transcription enhancer factor-1 (TEF-1). Nucleic Acids Res 21, 747-748. Borgstahl, G. E., Parge, H. E., Hickey, M. J., Beyer, W. F., Jr., Hallewell, R. A., and Tainer, J. A. (1992). The structure of human mitochondrial manganese superoxide dismutase reveals a novel tetrameric interface of two 4-helix bundles. Cell 71, 107-118. 143

PAGE 156

144 Bowler, R. P., Arcaroli, J., Crapo, J. D., Ross, A., Slot, J. W., and Abraham, E. (2001). Extracellular superoxide dismutase attenuates lung injury after hemorrhage. Am J Respir Crit Care Med 164, 290-294. Bringold, U., Ghafourifar, P., and Richter, C. (2000). Peroxynitrite formed by mitochondrial NO synthase promotes mitochondrial Ca2+ release. Free Radic Biol Med 29, 343-348. Brou, C., Chaudhary, S., Davidson, I., Lutz, Y., Wu, J., Egly, J. M., Tora, L., and Chambon, P. (1993). Distinct TFIID complexes mediate the effect of different transcriptional activators. Embo J 12, 489-499. Bruhat, A., Jousse, C., Carraro, V., Reimold, A. M., Ferrara, M., and Fafournoux, P. (2000). Amino acids control mammalian gene transcription: activating transcription factor 2 is essential for the amino acid responsiveness of the CHOP promoter. Mol Cell Biol 20, 7192-7204. Bulger, M., and Groudine, M. (1999). Looping versus linking: toward a model for long-distance gene activation. Genes Dev 13, 2465-2477. Burglin, T. R. (1991). The TEA domain: a novel, highly conserved DNA-binding motif. Cell 66, 11-12. Buss, H., Dorrie, A., Schmitz, M. L., Frank, R., Livingstone, M., Resch, K., and Kracht, M. (2004a). Phosphorylation of serine 468 by GSK-3b negatively regulates basal p65 NF-kB activity. J Biol Chem. Epub, Oct. Buss, H., Dorrie, A., Schmitz, M. L., Hoffmann, E., Resch, K., and Kracht, M. (2004b). Constitutive and IL-1-inducible phosphorylation of p65 NF-kB at serine 536 is mediated by multiple protein kinases including IKKalpha , IKKbbeta , IKKepsilon , TBK1 and an unknown kinase and couples p65 to TAFII31-mediated IL-8 transcription. J Biol Chem. Epub, Oct. Butler, A. J., and Ordahl, C. P. (1999). Poly(ADP-ribose) polymerase binds with transcription enhancer factor 1 to MCAT1 elements to regulate muscle-specific transcription. Mol Cell Biol 19, 296-306. Butterfield, D. A., Hensley, K., Harris, M., Mattson, M., and Carney, J. (1994). beta-Amyloid peptide free radical fragments initiate synaptosomal lipoperoxidation in a sequence-specific fashion: implications to Alzheimer's disease. Biochem Biophys Res Commun 200, 710-715. Cairns, B. R., Kim, Y. J., Sayre, M. H., Laurent, B. C., and Kornberg, R. D. (1994). A multisubunit complex containing the SWI1/ADR6, SWI2/SNF2, SWI3, SNF5, and SNF6 gene products isolated from yeast. Proc Natl Acad Sci U S A 91, 1950-1954.

PAGE 157

145 Campbell, S., Inamdar, M., Rodrigues, V., Raghavan, V., Palazzolo, M., and Chovnick, A. (1992). The scalloped gene encodes a novel, evolutionarily conserved transcription factor required for sensory organ differentiation in Drosophila. Genes Dev 6, 367-379. Carey, M. (1998). The enhanceosome and transcriptional synergy. Cell 92, 5-8. Cereghini, S., and Yaniv, M. (1984). Assembly of transfected DNA into chromatin: structural changes in the origin-promoter-enhancer region upon replication. Embo J 3, 1243-1253. Chang, L. Y., Kang, B. H., Slot, J. W., Vincent, R., and Crapo, J. D. (1995). Immunocytochemical localization of the sites of superoxide dismutase induction by hyperoxia in rat lungs. Lab Invest 73, 29-39. Chasman, D. I., Leatherwood, J., Carey, M., Ptashne, M., and Kornberg, R. D. (1989). Activation of yeast polymerase II transcription by herpesvirus VP16 and GAL4 derivatives in vitro. Mol Cell Biol 9, 4746-4749. Chaudhary, S., Brou, C., Valentin, M. E., Burton, N., Tora, L., Chambon, P., and Davidson, I. (1994). A cell-specific factor represses stimulation of transcription in vitro by transcriptional enhancer factor 1. Mol Cell Biol 14, 5290-5299. Chaudhary, S., Tora, L., and Davidson, I. (1995). Characterization of a HeLa cell factor which negatively regulates transcriptional activation in vitro by transcriptional enhancer factor-1 (TEF-1). J Biol Chem 270, 3631-3637. Chen, C., Dudenhausen, E. E., Pan, Y. X., Zhong, C., and Kilberg, M. S. (2004). Human CCAAT/enhancer-binding protein beta gene expression is activated by endoplasmic reticulum stress through an unfolded protein response element downstream of the protein coding sequence. J Biol Chem 279, 27948-27956. Chen, L., Fischle, W., Verdin, E., and Greene, W. C. (2001). Duration of nuclear NF-kappaB action regulated by reversible acetylation. Science 293, 1653-1657. Chen, Z., Friedrich, G. A., and Soriano, P. (1994). Transcriptional enhancer factor 1 disruption by a retroviral gene trap leads to heart defects and embryonic lethality in mice. Genes Dev 8, 2293-2301. Chen, F. E., and Ghosh, G. (1999). Regulation of DNA binding by Rel/NF-kappaB transcription factors: structural views. Oncogene 18, 6845-6852. Chen, Y. Q., Ghosh, S., and Ghosh, G. (1998). A novel DNA recognition mode by the NF-kappa B p65 homodimer. Nat Struct Biol 5, 67-73. Chen, F. E., Huang, D. B., Chen, Y. Q., and Ghosh, G. (1998). Crystal structure of p50/p65 heterodimer of transcription factor NF-kappaB bound to DNA. Nature 391, 410-413.

PAGE 158

146 Chen, Y. Q., Sengchanthalangsy, L. L., Hackett, A., and Ghosh, G. (2000). NF-kappaB p65 (RelA) homodimer uses distinct mechanisms to recognize DNA targets. Structure Fold Des 8, 419-428. Chien, C. T., Bartel, P. L., Sternglanz, R., and Fields, S. (1991). The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc Natl Acad Sci U S A 88, 9578-9582. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162, 156-159. Chow, C. K. (1993). Cigarette smoking and oxidative damage in the lung. Ann N Y Acad Sci 686, 289-298. Church, G. M., and Gilbert, W. (1984). Genomic sequencing. Proc Natl Acad Sci U S A 81, 1991-1995. Clark, J. M., and Lambertsen, C. J. (1971). Pulmonary oxygen toxicity: a review. Pharmacol Rev 23, 37-133. Cogswell, P. C., Scheinman, R. I., and Baldwin, A. S., Jr. (1993). Promoter of the human NF-kappa B p50/p105 gene. Regulation by NF-kappa B subunits and by c-REL. J Immunol 150, 2794-2804. Crapo, J. D., and Tierney, D. F. (1974). Superoxide dismutase and pulmonary oxygen toxicity. Am J Physiol 226, 1401-1407. Cross, C. E., Halliwell, B., Borish, E. T., Pryor, W. A., Ames, B. N., Saul, R. L., McCord, J. M., and Harman, D. (1987). Oxygen radicals and human disease. Ann Intern Med 107, 526-545. Davidson, I., Xiao, J. H., Rosales, R., Staub, A., and Chambon, P. (1988). The HeLa cell protein TEF-1 binds specifically and cooperatively to two SV40 enhancer motifs of unrelated sequence. Cell 54, 931-942. Dekker, J., Rippe, K., Dekker, M., and Kleckner, N. (2002). Capturing chromosome conformation. Science 295, 1306-1311. Deloukas, P., and van Loon, A. P. (1993). Genomic organization of the gene encoding the p65 subunit of NF-kappa B: multiple variants of the p65 protein may be generated by alternative splicing. Hum Mol Genet 2, 1895-1900. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., and Schibler, U. (1990). LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev 4, 1541-1551.

PAGE 159

147 Descombes, P., and Schibler, U. (1991). A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67, 569-579. DiGuiseppi, J., and Fridovich, I. (1984). The toxicology of molecular oxygen. Crit Rev Toxicol 12, 315-342. Dinour, D., Mini, S., Polak-Charcon, S., Lotan, D., and Holtzman, E. J. (2004). Progressive nephropathy associated with mitochondrial tRNA gene mutation. Clin Nephrol 62, 149-154. DiSilvestre, D., Kleeberger, S. R., Johns, J., and Levitt, R. C. (1995). Structure and DNA sequence of the mouse MnSOD gene. Mamm Genome 6, 281-284. Doelman, C. J., and Bast, A. (1990). Oxygen radicals in lung pathology. Free Radic Biol Med 9, 381-400. Dougall, W. C., and Nick, H. S. (1991). Manganese superoxide dismutase: a hepatic acute phase protein regulated by interleukin-6 and glucocorticoids. Endocrinology 129, 2376-2384. Eastgate, J., Moreb, J., Nick, H. S., Suzuki, K., Taniguchi, N., and Zucali, J. R. (1993). A role for manganese superoxide dismutase in radioprotection of hematopoietic stem cells by interleukin-1. Blood 81, 639-646. Fahn, S., and Cohen, G. (1992). The oxidant stress hypothesis in Parkinson's disease: evidence supporting it. Ann Neurol 32, 804-812. Farrance, I. K., Mar, J. H., and Ordahl, C. P. (1992). M-CAT binding factor is related to the SV40 enhancer binding factor, TEF-1. J Biol Chem 267, 17234-17240. Farrance, I. K., and Ordahl, C. P. (1996). The role of transcription enhancer factor-1 (TEF-1) related proteins in the formation of M-CAT binding complexes in muscle and non-muscle tissues. J Biol Chem 271, 8266-8274. Ferrante, R. J., Browne, S. E., Shinobu, L. A., Bowling, A. C., Baik, M. J., MacGarvey, U., Kowall, N. W., Brown, R. H., Jr., and Beal, M. F. (1997). Evidence of increased oxidative damage in both sporadic and familial amyotrophic lateral sclerosis. J Neurochem 69, 2064-2074. Fields, S., and Song, O. (1989). A novel genetic system to detect protein-protein interactions. Nature 340, 245-246. Frank, L., and Massaro, D. (1980). Oxygen toxicity. Am J Med 69, 117-126.

PAGE 160

148 Franzoso, G., Bours, V., Azarenko, V., Park, S., Tomita-Yamaguchi, M., Kanno, T., Brown, K., and Siebenlist, U. (1993). The oncoprotein Bcl-3 can facilitate NF-kappa B-mediated transactivation by removing inhibiting p50 homodimers from select kappa B sites. Embo J 12, 3893-3901. Freeman, B. A., and Crapo, J. D. (1981). Hyperoxia increases oxygen radical production in rat lungs and lung mitochondria. J Biol Chem 256, 10986-10992. Fridovich, I. (1976). Oxygen radicals, hydrogen peroxide, and oxygen Toxicity. In Free Radicals in Biology. (N.Y., Academic Press). Fridovich, I. (1978). The biology of oxygen radicals. Science 201, 875-880. Fridovich, I. (1985). The Harvey lectures, Series. In (N.Y., Academic Press), pp. 51. Fridovich, I. (1989). Superoxide dismutases. An adaptation to a paramagnetic gas. J Biol Chem 264, 7761-7764. Ghosh, S., and Karin, M. (2002). Missing pieces in the NF-kappaB puzzle. Cell 109 Suppl, S81-96. Gillies, S. D., Morrison, S. L., Oi, V. T., and Tonegawa, S. (1983). A tissue-specific transcription enhancer element is located in the major intron of a rearranged immunoglobulin heavy chain gene. Cell 33, 717-728. Goldblum, S. E., Jay, M., Yoneda, K., Cohen, D. A., McClain, C. J., and Gillespie, M. N. (1987). Monokine-induced acute lung injury in rabbits. J Appl Physiol 63, 2093-2100. Golemis, E. A., Serebriiskii, I., and Law, S. F. (1999). The yeast two-hybrid system: criteria for detecting physiologically significant protein-protein interactions. Curr Issues Mol Biol 1, 31-45. Gregory, E. M., and Fridovich, I. (1973). Induction of superoxide dismutase by molecular oxygen. J Bacteriol 114, 543-548. Grumont, R. J., and Gerondakis, S. (1994). Alternative splicing of RNA transcripts encoded by the murine p105 NF-kappa B gene generates I kappa B gamma isoforms with different inhibitory activities. Proc Natl Acad Sci U S A 91, 4367-4371. Guo, Z., Boekhoudt, G. H., and Boss, J. M. (2003). Role of the intronic enhancer in tumor necrosis factor-mediated induction of manganous superoxide dismutase. J Biol Chem 278, 23570-23578. Gupta, M., Amin CS, Gupta M, Hay N, & Zak R (1997). Transcription Enhancer Factor 1 interacts with a basic helix-loop-helix zipper protein, Max, for positive regulation of cardiac alpha-myosin heavy chain gene expression. MCB 17, 3924-3936.

PAGE 161

149 Gupta, M., Kogut, P., Davis, F. J., Belaguli, N. S., Schwartz, R. J., and Gupta, M. P. (2001). Physical interaction between the MADS box of serum response factor and the TEA/ATTS DNA-binding domain of transcription enhancer factor-1. J Biol Chem 276, 10413-10422. Gupta, M. P., Kogut, P., and Gupta, M. (2000). Protein kinase-A dependent phosphorylation of transcription enhancer factor-1 represses its DNA-binding activity but enhances its gene activation ability. Nucleic Acids Res 28, 3168-3177. Halliwell, B. (1993). The role of oxygen radicals in human disease, with particular reference to the vascular system. Haemostasis 23 Suppl 1, 118-126. Hatzis, P., and Talianidis, I. (2002). Dynamics of enhancer-promoter communication during differentiation-induced gene activation. Mol Cell 10, 1467-1477. Haugaard, N. (1968). Cellular mechanisms of oxygen toxicity. Physiol Rev 48, 311-373. Hsu, J. L., Visner, G. A., Burr, I. A., and Nick, H. S. (1992). Rat copper/zinc superoxide dismutase gene: isolation, characterization, and species comparison. Biochem Biophys Res Commun 186, 936-943. Hurt, J., Hsu, J. L., Dougall, W. C., Visner, G. A., Burr, I. M., and Nick, H. S. (1992). Multiple mRNA species generated by alternate polyadenylation from the rat manganese superoxide dismutase gene. Nucleic Acids Res 20, 2985-2990. Hwang, J. J., Chambon, P., and Davidson, I. (1993). Characterization of the transcription activation function and the DNA binding domain of transcriptional enhancer factor-1. Embo J 12, 2337-2348. Ishiji, T., Lace, M. J., Parkkinen, S., Anderson, R. D., Haugen, T. H., Cripe, T. P., Xiao, J. H., Davidson, I., Chambon, P., and Turek, L. P. (1992). Transcriptional enhancer factor (TEF)-1 and its cell-specific co-activator activate human papillomavirus-16 E6 and E7 oncogene transcription in keratinocytes and cervical carcinoma cells. Embo J 11, 2271-2281. Jacquemin, P., Hwang, J. J., Martial, J. A., Dolle, P., and Davidson, I. (1996). A novel family of developmentally regulated mammalian transcription factors containing the TEA/ATTS DNA binding domain. J Biol Chem 271, 21775-21785. Janssen, Y. M., Van Houten, B., Borm, P. J., and Mossman, B. T. (1993). Cell and tissue responses to oxidative damage. Lab Invest 69, 261-274. Jeong, S., and Stein, A. (1994). Micrococcal nuclease digestion of nuclei reveals extended nucleosome ladders having anomalous DNA lengths for chromatin assembled on non-replicating plasmids in transfected cells. Nucleic Acids Res 22, 370-375.

PAGE 162

150 Jiang, S. W., Desai, D., Khan, S., and Eberhardt, N. L. (2000). Cooperative binding of TEF-1 to repeated GGAATG-related consensus elements with restricted spatial separation and orientation. DNA Cell Biol 19, 507-514. Jiang, S. W., Dong, M., Trujillo, M. A., Miller, L. J., and Eberhardt, N. L. (2001). DNA binding of TEA/ATTS domain factors is regulated by protein kinase C phosphorylation in human choriocarcinoma cells. J Biol Chem 276, 23464-23470. Jiang, S. W., and Eberhardt, N. L. (1995). Involvement of a protein distinct from transcription enhancer factor-1 (TEF-1) in mediating human chorionic somatomammotropin gene enhancer function through the GT-IIC enhanson in choriocarcinoma and COS cells. J Biol Chem 270, 13906-13915. Jiang, S. W., and Eberhardt, N. L. (1996). TEF-1 transrepression in BeWo cells is mediated through interactions with the TATA-binding protein, TBP. J Biol Chem 271, 9510-9518. Jiang, S. W., Trujillo, M. A., and Eberhardt, N. L. (1997). Human chorionic somatomammotropin enhancer function is mediated by cooperative binding of TEF-1 and CSEF-1 to multiple, low-affinity binding sites. Mol Endocrinol 11, 1223-1232. Jiang, S. W., Trujillo, M. A., Sakagashira, M., Wilke, R. A., and Eberhardt, N. L. (2000). Novel human TEF-1 isoforms exhibit altered DNA binding and functional properties. Biochemistry 39, 3505-3513. Jones, P. L., Kucera, G., Gordon, H., and Boss, J. M. (1995). Cloning and characterization of the murine manganous superoxide dismutase-encoding gene. Gene 153, 155-161. Jones, P. L., Ping, D., and Boss, J. M. (1997). Tumor necrosis factor alpha and interleukin-1beta regulate the murine manganese superoxide dismutase gene through a complex intronic enhancer involving C/EBP-beta and NF-kappaB. Mol Cell Biol 17, 6970-6981. Kang, S. H., Vieira, K., and Bungert, J. (2002). Combining chromatin immunoprecipitation and DNA footprinting: a novel method to analyze protein-DNA interactions in vivo. Nucleic Acids Res 30, e44. Kariya, K., Farrance, I. K., and Simpson, P. C. (1993). Transcriptional enhancer factor-1 in cardiac myocytes interacts with an alpha 1-adrenergicand beta-protein kinase C-inducible element in the rat beta-myosin heavy chain promoter. J Biol Chem 268, 26658-26662. Kiernan, R., Bres, V., Ng, R. W., Coudart, M. P., El Messaoudi, S., Sardet, C., Jin, D. Y., Emiliani, S., and Benkirane, M. (2003). Post-activation turn-off of NF-kappa B-dependent transcription is regulated by acetylation of p65. J Biol Chem 278, 2758-2766.

PAGE 163

151 Kifle, Y., Monnier, J., Chesrown, S. E., Raizada, M. K., and Nick, H. S. (1996). Regulation of the manganese superoxide dismutase and inducible nitric oxide synthase gene in rat neuronal and glial cells. J Neurochem 66, 2128-2135. Kiningham, K. K., Xu, Y., Daosukho, C., Popova, B., and St Clair, D. K. (2001). Nuclear factor kappaB-dependent mechanisms coordinate the synergistic effect of PMA and cytokines on the induction of superoxide dismutase 2. Biochem J 353, 147-156. Kokoszka, J. E., Coskun, P., Esposito, L. A., and Wallace, D. C. (2001). Increased mitochondrial oxidative stress in the Sod2 (+/-) mouse results in the age-related decline of mitochondrial function culminating in increased apoptosis. Proc Natl Acad Sci U S A 98, 2278-2283. Kolenko, V., Bloom, T., Rayman, P., Bukowski, R., Hsi, E., and Finke, J. (1999). Inhibition of NF-kappa B activity in human T lymphocytes induces caspase-dependent apoptosis without detectable activation of caspase-1 and -3. J Immunol 163, 590-598. Ku, H. H., Brunk, U. T., and Sohal, R. S. (1993). Relationship between mitochondrial superoxide and hydrogen peroxide production and longevity of mammalian species. Free Radic Biol Med 15, 621-627. Kuo, S., Chesrown, S. E., Mellott, J. K., Rogers, R. J., Hsu, J. L., and Nick, H. S. (1999). In vivo architecture of the manganese superoxide dismutase promoter. J Biol Chem 274, 3345-3354. Kuo, S., Chokas, A. L., Rogers, R. J., and Nick, H. S. (2003). PIN*POINT analysis on the endogenous MnSOD promoter: specific demonstration of Sp1 binding in vivo. Am J Physiol Cell Physiol 284, C528-534. Lebovitz, R. M., Zhang, H., Vogel, H., Cartwright, J., Jr., Dionne, L., Lu, N., Huang, S., and Matzuk, M. M. (1996). Neurodegeneration, myocardial injury, and perinatal death in mitochondrial superoxide dismutase-deficient mice. Proc Natl Acad Sci U S A 93, 9782-9787. Lemmer, E. R., Welch, J. L., Tsai, T., Keck-Waggoner, C. L., Huh, C., Zimonjic, D. B., Popescu, N. C., and Thorgeirsson, S. S. (2000). Genomic structure and chromosome location of the mouse RelA p65 gene (Rela). Cytogenet Cell Genet 89, 129-132. Lenardo, M. J., and Baltimore, D. (1989). NF-kappa B: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 58, 227-229. Leung, T. H., Hoffmann, A., and Baltimore, D. (2004). One nucleotide in a kappaB site can determine cofactor specificity for NF-kappaB dimers. Cell 118, 453-464.

PAGE 164

152 Li, Y., Huang, T. T., Carlson, E. J., Melov, S., Ursell, P. C., Olson, J. L., Noble, L. J., Yoshimura, M. P., Berger, C., Chan, P. H., and et al. (1995). Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat Genet 11, 376-381. Lin, L., and Ghosh, S. (1996). A glycine-rich region in NF-kappaB p105 functions as a processing signal for the generation of the p50 subunit. Mol Cell Biol 16, 2248-2254. Lin, Y. Z., Yao, S. Y., Veach, R. A., Torgerson, T. R., and Hawiger, J. (1995). Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J Biol Chem 270, 14255-14258. Linker, R. A., Baeuerle, P. A., and Kaltschmidt, C. (1996). Cloning of the murine relA (p65 NF-kappa B) gene and comparison to the human gene reveals a distinct first intron. Gene 176, 119-124. Liou, H. C., Nolan, G. P., Ghosh, S., Fujita, T., and Baltimore, D. (1992). The NF-kappa B p50 precursor, p105, contains an internal I kappa B-like inhibitor that preferentially inhibits p50. Embo J 11, 3003-3009. MacLellan, W. R., Lee, T. C., Schwartz, R. J., and Schneider, M. D. (1994). Transforming growth factor-beta response elements of the skeletal alpha-actin gene. Combinatorial action of serum response factor, YY1, and the SV40 enhancer-binding protein, TEF-1. J Biol Chem 269, 16754-16760. Maeda, T., Gupta, M. P., and Stewart, A. F. (2002). TEF-1 and MEF2 transcription factors interact to regulate muscle-specific promoters. Biochem Biophys Res Commun 294, 791-797. Maehara, K., Hasegawa, T., and Isobe, K. I. (2000). A NF-kappaB p65 subunit is indispensable for activating manganese superoxide: dismutase gene transcription mediated by tumor necrosis factor-alpha. J Cell Biochem 77, 474-486. Maehara, K., Hasegawa, T., Xiao, H., Takeuchi, A., Abe, R., and Isobe, K. (1999). Cooperative interaction of NF-kappaB and C/EBP binding sites is necessary for manganese superoxide dismutase gene transcription mediated by lipopolysaccharide and interferon-gamma. FEBS Lett 449, 115-119. Maehara, K., Oh-Hashi, K., and Isobe, K. I. (2001). Early growth-responsive-1-dependent manganese superoxide dismutase gene transcription mediated by platelet-derived growth factor. Faseb J 15, 2025-2026. Malek, S., Huxford, T., and Ghosh, G. (1998). Ikappa Balpha functions through direct contacts with the nuclear localization signals and the DNA binding sequences of NF-kappaB. J Biol Chem 273, 25427-25435.

PAGE 165

153 Marcil, R., and Higgins, D. R. (1992). Direct transfer of plasmid DNA from yeast to E.coli by electroporation. Nucleic Acids Res 20, 917. McCord, J. M., and Fridovich, I. (1969a). Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J Biol Chem 244, 6049-6055. McCord, J. M., and Fridovich, I. (1969b). The utility of superoxide dismutase in studying free radical reactions. I. Radicals generated by the interaction of sulfite, dimethyl sulfoxide, and oxygen. J Biol Chem 244, 6056-6063. McCord, J. M., and Fridovich, I. (1970). The utility of superoxide dismutase in studying free radical reactions. II. The mechanism of the mediation of cytochrome c reduction by a variety of electron carriers. J Biol Chem 245, 1374-1377. Melin, F., Miranda, M., Montreau, N., DePamphilis, M. L., and Blangy, D. (1993). Transcription enhancer factor-1 (TEF-1) DNA binding sites can specifically enhance gene expression at the beginning of mouse development. Embo J 12, 4657-4666. Merika, M., and Thanos, D. (2001). Enhanceosomes. Curr Opin Genet Dev 11, 205-208. Nolan, G. P., Ghosh, S., Liou, H. C., Tempst, P., and Baltimore, D. (1991). DNA binding and I kappa B inhibition of the cloned p65 subunit of NF-kappa B, a rel-related polypeptide. Cell 64, 961-969. Orlando, V. (2000). Mapping chromosomal proteins in vivo by formaldehyde-crosslinked-chromatin immunoprecipitation. Trends Biochem Sci 25, 99-104. Orr, W. C., and Sohal, R. S. (1994). Extension of life-span by overexpression of superoxide dismutase and catalase in Drosophila melanogaster. Science 263, 1128-1130. Otting, G., Qian, Y. Q., Billeter, M., Muller, M., Affolter, M., Gehring, W. J., and Wuthrich, K. (1990). Protein--DNA contacts in the structure of a homeodomain-NA complex determined by nuclear magnetic resonance spectroscopy in solution. Embo J 9, 3085-3092. Pabo, C. O., and Sauer, R. T. (1984). Protein-DNA recognition. Annu Rev Biochem 53, 293-321. Pavletich, N. P., and Pabo, C. O. (1993). Crystal structure of a five-finger GLI-DNA complex: new perspectives on zinc fingers. Science 261, 1701-1707. Paya, C. V., Ten, R. M., Bessia, C., Alcami, J., Hay, R. T., and Virelizier, J. L. (1992). NF-kappa B-dependent induction of the NF-kappa B p50 subunit gene promoter underlies self-perpetuation of human immunodeficiency virus transcription in monocytic cells. Proc Natl Acad Sci U S A 89, 7826-7830.

PAGE 166

154 Perkins, N. D., Edwards, N. L., Duckett, C. S., Agranoff, A. B., Schmid, R. M., and Nabel, G. J. (1993). A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation. Embo J 12, 3551-3558. Ptashne, M. (1986). Gene regulation by proteins acting nearby and at a distance. Nature 322, 697-701. Rahman, I., and MacNee, W. (1996). Role of oxidants/antioxidants in smoking-induced lung diseases. Free Radic Biol Med 21, 669-681. Reaume, A. G., Elliott, J. L., Hoffman, E. K., Kowall, N. W., Ferrante, R. J., Siwek, D. F., Wilcox, H. M., Flood, D. G., Beal, M. F., Brown, R. H., Jr., et al. (1996). Motor neurons in Cu/Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nat Genet 13, 43-47. Reeves, R., Gorman, C. M., and Howard, B. (1985). Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells. Nucleic Acids Res 13, 3599-3615. Rogers, R. J., Chesrown, S. E., Kuo, S., Monnier, J. M., and Nick, H. S. (2000). Cytokine-inducible enhancer with promoter activity in both the rat and human manganese-superoxide dismutase genes. Biochem J 347 Pt 1, 233-242. Rogers, R. J., Monnier, J. M., and Nick, H. S. (2001). Tumor necrosis factor-alpha selectively induces MnSOD expression via mitochondria-to-nucleus signaling, whereas interleukin-1beta utilizes an alternative pathway. J Biol Chem 276, 20419-20427. Ruben, S. M., Dillon, P. J., Schreck, R., Henkel, T., Chen, C. H., Maher, M., Baeuerle, P. A., and Rosen, C. A. (1991). Isolation of a rel-related human cDNA that potentially encodes the 65-kD subunit of NF-kappa B. Science 251, 1490-1493. Schmitz, M. L., and Baeuerle, P. A. (1991). The p65 subunit is responsible for the strong transcription activating potential of NF-kappa B. Embo J 10, 3805-3817. Schmitz, M. L., Stelzer, G., Altmann, H., Meisterernst, M., and Baeuerle, P. A. (1995). Interaction of the COOH-terminal transactivation domain of p65 NF-kappa B with TATA-binding protein, transcription factor IIB, and coactivators. J Biol Chem 270, 7219-7226. Sen, R., and Baltimore, D. (1986a). Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46, 705-716. Sen, R., and Baltimore, D. (1986b). Inducibility of kappa immunoglobulin enhancer-binding protein Nf-kappa B by a posttranslational mechanism. Cell 47, 921-928.

PAGE 167

155 Serebriiskii, I. G., Khazak, V., and Golemis, E. A. (2001). Redefinition of the yeast two-hybrid system in dialogue with changing priorities in biological research. Biotechniques 30, 634-636. Shimizu, N., Smith, G., and Izumo, S. (1993). Both a ubiquitous factor mTEF-1 and a distinct muscle-specific factor bind to the M-CAT motif of the myosin heavy chain beta gene. Nucleic Acids Res 21, 4103-4110. Smith, C. L., and Hager, G. L. (1997). Transcriptional regulation of mammalian genes in vivo. A tale of two templates. J Biol Chem 272, 27493-27496. Southorn, P. A., and Powis, G. (1988). Free radicals in medicine. I. Chemical nature and biologic reactions. Mayo Clin Proc 63, 381-389. Stein, B., and Baldwin, A. S., Jr. (1993). Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-kappa B. Mol Cell Biol 13, 7191-7198. Stein, B., Baldwin, A. S., Jr., Ballard, D. W., Greene, W. C., Angel, P., and Herrlich, P. (1993). Cross-coupling of the NF-kappa B p65 and Fos/Jun transcription factors produces potentiated biological function. Embo J 12, 3879-3891. Stein, B., Cogswell, P. C., and Baldwin, A. S., Jr. (1993). Functional and physical associations between NF-kappa B and C/EBP family members: a Rel domain-bZIP interaction. Mol Cell Biol 13, 3964-3974. Stewart, A. F., Larkin, S. B., Farrance, I. K., Mar, J. H., Hall, D. E., and Ordahl, C. P. (1994). Muscle-enriched TEF-1 isoforms bind M-CAT elements from muscle-specific promoters and differentially activate transcription. J Biol Chem 269, 3147-3150. Swartz, E. A., Johnson, A. D., and Owens, G. K. (1998). Two MCAT elements of the SM alpha-actin promoter function differentially in SM vs. non-SM cells. Am J Physiol 275, C608-618. Ten, R. M., Paya, C. V., Israel, N., Le Bail, O., Mattei, M. G., Virelizier, J. L., Kourilsky, P., and Israel, A. (1992). The characterization of the promoter of the gene encoding the p50 subunit of NF-kappa B indicates that it participates in its own regulation. Embo J 11, 195-203. Thanos, D., and Maniatis, T. (1995). Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell 83, 1091-1100. Tjian, R. (1996). The biochemistry of transcription in eukaryotes: a paradigm for multisubunit regulatory complexes. Philos Trans R Soc Lond B Biol Sci 351, 491-499.

PAGE 168

156 Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F., and de Laat, W. (2002). Looping and interaction between hypersensitive sites in the active beta-globin locus. Mol Cell 10, 1453-1465. Tsan, M. F., White, J. E., Santana, T. A., and Lee, C. Y. (1990). Tracheal insufflation of tumor necrosis factor protects rats against oxygen toxicity. J Appl Physiol 68, 1211-1219. Turrens, J. F. (1997). Superoxide production by the mitochondrial respiratory chain. Biosci Rep 17, 3-8. Turrens, J. F., and Boveris, A. (1980). Generation of superoxide anion by the NADH dehydrogenase of bovine heart mitochondria. Biochem J 191, 421-427. Turrens, J. F., Freeman, B. A., and Crapo, J. D. (1982). Hyperoxia increases H2O2 release by lung mitochondria and microsomes. Arch Biochem Biophys 217, 411-421. Ueberla, K., Lu, Y., Chung, E., and Haseltine, W. A. (1993). The NF-kappa B p65 promoter. J Acquir Immune Defic Syndr 6, 227-230. Uzzo, R. G., Dulin, N., Bloom, T., Bukowski, R., Finke, J. H., and Kolenko, V. (2001). Inhibition of NFkappaB induces caspase-independent cell death in human T lymphocytes. Biochem Biophys Res Commun 287, 895-899. Valentine, J. F., and Nick, H. S. (1992). Acute-phase induction of manganese superoxide dismutase in intestinal epithelial cell lines. Gastroenterology 103, 905-912. Vassilev, A., Kaneko, K. J., Shu, H., Zhao, Y., and DePamphilis, M. L. (2001). TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm. Genes Dev 15, 1229-1241. Vermeulen, L., De Wilde, G., Notebaert, S., Vanden Berghe, W., and Haegeman, G. (2002). Regulation of the transcriptional activity of the nuclear factor-kappaB p65 subunit. Biochem Pharmacol 64, 963-970. Vinson, C. R., Sigler, P. B., and McKnight, S. L. (1989). Scissors-grip model for DNA recognition by a family of leucine zipper proteins. Science 246, 911-916. Visner, G. A., Block, E. R., Burr, I. M., and Nick, H. S. (1991). Regulation of manganese superoxide dismutase in porcine pulmonary artery endothelial cells. Am J Physiol 260, L444-449. Visner, G. A., Dougall, W. C., Wilson, J. M., Burr, I. A., and Nick, H. S. (1990). Regulation of manganese superoxide dismutase by lipopolysaccharide, interleukin-1, and tumor necrosis factor. Role in the acute inflammatory response. J Biol Chem 265, 2856-2864.

PAGE 169

157 Wan, X. S., Devalaraja, M. N., and St Clair, D. K. (1994). Molecular structure and organization of the human manganese superoxide dismutase gene. DNA Cell Biol 13, 1127-1136. Ward, P. A. (1994). Oxygen radicals, cytokines, adhesion molecules, and lung injury. Environ Health Perspect 102 Suppl 10, 13-16. Ward, P. A., Warren, J. S., and Johnson, K. J. (1988). Oxygen radicals, inflammation, and tissue injury. Free Radic Biol Med 5, 403-408. White, J. E., Lin, H. Y., Davis, F. B., Davis, P. J., and Tsan, M. F. (2000). Differential induction of tumor necrosis factor alpha and manganese superoxide dismutase by endotoxin in human monocytes: role of protein tyrosine kinase, mitogen-activated protein kinase, and nuclear factor kappaB. J Cell Physiol 182, 381-389. Wispe, J. R., Warner, B. B., Clark, J. C., Dey, C. R., Neuman, J., Glasser, S. W., Crapo, J. D., Chang, L. Y., and Whitsett, J. A. (1992). Human Mn-superoxide dismutase in pulmonary epithelial cells of transgenic mice confers protection from oxygen injury. J Biol Chem 267, 23937-23941. Wong, G. H., Elwell, J. H., Oberley, L. W., Goeddel, D. V., Lewis, M., Tartaglia, L. A., Lee, A., Bennett, G. L., Rice, G. C., and Chen, E. Y. (1989). Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity of tumor necrosis factor. Cloning and expression of cDNAs for two distinct murine tumor necrosis factor receptors demonstrate one receptor is species specific. Cell 58, 923-931. Wong, G. H., and Goeddel, D. V. (1988). Induction of manganous superoxide dismutase by tumor necrosis factor: possible protective mechanism. Science 242, 941-944. Wong, G. H., McHugh, T., Weber, R., and Goeddel, D. V. (1991). Tumor necrosis factor alpha selectively sensitizes human immunodeficiency virus-infected cells to heat and radiation. Proc Natl Acad Sci U S A 88, 4372-4376. Xia, C., Watton, S., Nagl, S., Samuel, J., Lovegrove, J., Cheshire, J., and Woo, P. (2004). Novel sites in the p65 subunit of NF-kappaB interact with TFIIB to facilitate NF-kappaB induced transcription. FEBS Lett 561, 217-222. Xiao, J. H., Davidson, I., Ferrandon, D., Rosales, R., Vigneron, M., Macchi, M., Ruffenach, F., and Chambon, P. (1987). One cell-specific and three ubiquitous nuclear proteins bind in vitro to overlapping motifs in the domain B1 of the SV40 enhancer. Embo J 6, 3005-3013. Xiao, J. H., Davidson, I., Matthes, H., Garnier, J. M., and Chambon, P. (1991). Cloning, expression, and transcriptional properties of the human enhancer factor TEF-1. Cell 65, 551-568.

PAGE 170

158 Zhong, H., Voll, R. E., and Ghosh, S. (1998). Phosphorylation of NF-kappa B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol Cell 1, 661-671. Zuzarte, P. C., Farrance, I. K., Simpson, P. C., and Wildeman, A. G. (2000). Tumor cell splice variants of the transcription factor TEF-1 induced by SV40 T-antigen transformation. Biochim Biophys Acta 1517, 82-90.

PAGE 171

BIOGRAPHICAL SKETCH Ann Lynn Chokas was born at Flower Fifth Avenue Hospital in Queens, New York, to Mary and William Chokas. She attended Great Neck South High School, in Great Neck, New York graduating in May 1985. She continued her education at Adelphi University, Garden City, NY, where she was a member of the Equestrian Club. She transferred to the State University of New York at Stony Brook where she was treasurer of the Parachuting Club. She graduated in August 1989 with a Bachelor of Arts degree in anthropology and an interest in neurobiology. Next, she worked full time at Olympus Corporation while attending Queens College at night, eventually earning a Bachelor of Science degree in biology, with a minor in Chemistry. She continued her education at New York University in Manhattan. She worked simultaneously in a NASA-funded laboratory, studying the effects of weightlessness on motor function in newborn rat pups; and was directly involved in the first mission sending new born pups up with their mothers. She earned a Master of Science degree in biology with a major of Neuroscience. She then worked as a lab technician and manager, until deciding to continue her education in pursuit of a Ph.D. at the University of Florida, where she enrolled in the Fall of 1999. She graduated in Fall 2004. 159