Citation
Beta-Amylase Induction and the Protective Role of Maltose during Temperature Shock

Material Information

Title:
Beta-Amylase Induction and the Protective Role of Maltose during Temperature Shock
Creator:
KAPLAN, FATMA ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Chlorophylls ( jstor )
Chloroplasts ( jstor )
Enzymes ( jstor )
Freezing ( jstor )
Peas ( jstor )
Polymerase chain reaction ( jstor )
Reverse transcriptase polymerase chain reaction ( jstor )
Shock heating ( jstor )
Starches ( jstor )
Sugars ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Fatma Kaplan. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/31/2005
Resource Identifier:
436098624 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

BETA-AMYLASE INDUCTION AND THE PROTECTIVE ROLE OF MALTOSE DURING TEMPERATURE SHOCK By FATMA KAPLAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Fatma Kaplan

PAGE 3

To my mother Dilber Demir and my husband Cameron Schiller

PAGE 4

ACKNOWLEDGMENTS I would like to thank my advisor, Charles L. Guy, for his continuing support during my doctoral studies. I thank my committee members (Dr. Andrew D. Hanson, Dr. Alice C. Harmon, Dr. Kenneth Cline, and Dr. Michael Kane) for their support and constructive comments during my study. I would like to thank Dr. Ken Cline, for making his lab available for isolating chloroplast; Dr. Carole Dabney-Smith, for providing isolated pea chloroplast for the subsequent thylakoid isolation; Dr. Denise Tieman, Scott McMillen, and Dr. Bradley Hayes for soluble sugar analysis of Arabidopsis and pea chloroplasts; Dr. Lanfang Levine at Kennedy Space Center for making her lab available and for helping with the soluble sugar analysis of Arabidopsis transgenic lines; Jeff Rollins, for access to the ELISA plate reader; Dr. Kevin Folta for his help screening T-DNA insertional lines; and Dale Haskell, Cameron Schiller, and Maria Amaya for their help during the freezing stress experiments. We thank the Salk Institute Genomic Analysis Laboratory for providing the sequence-indexed Arabidopsis T-DNA insertion mutants; CSIRO Plant Industry for permitting the use of the pHellsgate 8 plasmid for the production of the BMY8 hairpin construct; and USDA for funding this research. I would like to thank my mother, my husband, and my relatives for their continuing support. iv

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES.........................................................................................................viii ABSTRACT.......................................................................................................................ix CHAPTER 1 INTRODUCTION........................................................................................................1 2 LITERATURE REVIEW.............................................................................................3 Role of Beta-Amylases in Starch Degradation.............................................................3 Reaction Mechanism....................................................................................................4 Beta-Amylase Structure................................................................................................6 Subcellular Localization of Beta-Amylases.................................................................8 Regulation of Beta-amylase..........................................................................................9 Light......................................................................................................................9 Sugars..................................................................................................................11 Phytohormones....................................................................................................11 Proteolytic Cleavage............................................................................................12 Abiotic Stress.......................................................................................................12 Compatible Solute......................................................................................................13 3 MATERIAL AND METHODS..................................................................................16 Plant Growth, and Heat and Cold Shock Treatment...................................................16 RNA Extraction..........................................................................................................17 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR).................................17 Beta-Amylase Enzyme Assay.....................................................................................19 Western Blot Analysis................................................................................................20 Chlorophyll Extraction...............................................................................................21 Carbohydrate Analysis................................................................................................22 Compatible Solute Assay for Maltose........................................................................23 Pea Chloroplast Isolation............................................................................................25 Thylakoid Isolation.....................................................................................................25 v

PAGE 6

In Vitro Heat Shock and Freezing Stress of Electron Transport Chain......................26 Quick DNA Extraction for Knockout PCR Screening and RNAi Lines....................27 PCR Screening of Knockouts.....................................................................................27 Sequencing T-DNA Flanking Fragments...................................................................27 BMY8 RNAi Construct..............................................................................................28 Agrobacterium-mediated Transformation..................................................................29 PCR Screening BMY8 RNAi Lines...........................................................................29 Starch Screening for BMY8 RNAi Lines...................................................................30 Freezing Stress............................................................................................................30 Chlorophyll Fluorescence...........................................................................................31 Electrolyte Leakage Measurements............................................................................31 4 RESULTS...................................................................................................................32 Heat and Cold Shock Elicit Specific Beta-Amylase Gene Induction.........................32 Beta-amylase Transcript Accumulation is Correlated with Maltose Accumulation..35 Maltose Has Compatible Solute Properties................................................................41 Maltose Can Function as a Chloroplast Stromal Compatible Solute In Vitro............44 Initial Characterization of Betaand Alpha-Amylase T-DNA Insertional Lines.......46 Carbohydrate Profiles of T-DNA Insertional Lines...................................................48 Isolation and Initial Screening of BMY8 RNAi Lines...............................................49 Carbohydrate Profile of BMY8 RNAi Lines..............................................................52 Less Chlorophyll Fluorescence in BMY8 RNAi Lines after Freezing Stress............54 5 DISCUSSION.............................................................................................................58 6 CONCLUSIONS........................................................................................................64 REFERENCES..................................................................................................................65 BIOGRAPHICAL SKETCH.............................................................................................72 vi

PAGE 7

LIST OF TABLES Table page 2-1. Arabidopsis beta-amylase gene family.........................................................................9 3-1. Primers used in RT-PCR reactions.............................................................................18 3-2. Primers used in RT-PCR reaction for knockout lines................................................19 3-3. Primers for PCR screening of knockout lines............................................................28 4-1. Soluble sugar content of the isolated pea chloroplast.................................................40 4-2. Knockout lines for beta-amylases and alpha-amylase verified by PCR.....................47 vii

PAGE 8

LIST OF FIGURES Figure page 2-1. Hydrolytic starch degradation.....................................................................................4 2-2. Beta-amylase hydrolysis of alpha-1,4 glycosidic linkage of a polyglucan chain........5 2-3. Crystal structure of soybean beta-amylase (1BYB)....................................................7 4-1. RT-PCR analysis of selected genes following heat and cold shock..........................34 4-2. Expression profiles of beta-amylases........................................................................36 4-3. Specificity of BMY7 and BMY9 monoclonal antibodies.........................................37 4-4. Carbohydrate profiles of heat and cold shock time course........................................39 4-5. In vitro compatible solute assay for three enzymes...................................................42 4-6. In vitro time course compatible solute assay for three enzymes...............................43 4-7. Electron transport chain activity of isolated thylakoids in the absence and presence of soluble sugars during heat shock at 40C for 4 min.............................................45 4-8. Electron transport chain activity of isolated thylakoids in the absence and presence of soluble sugars following freezing stress at -15C for 20 h..................................45 4-9. Characterization of beta-and alpha-amylase T-DNA insertional lines. A) PCR screening for the T-DNA insertion...........................................................................47 4-10. Carbohydrate profiles of 18-day-old alphaand beta-amylase knockout plants.....50 4-11. Characterization of BMY8 RNAi lines...................................................................51 4-12. Carbohydrate profiles of 28-day-old BMY8 RNAi lines (C5 and C14).................53 4-13. Freezing tolerance of non-acclimated BMY8 RNAi lines......................................55 4-14. Freezing tolerance of cold acclimated BMY8 RNAi lines......................................56 viii

PAGE 9

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BETA-AMYLASE INDUCTION AND THE PROTECTIVE ROLE OF MALTOSE DURING TEMPERATURE SHOCK By Fatma Kaplan December 2004 Chair: Charles L. Guy Major Department: Plant Molecular and Cellular Biology A number of studies have demonstrated beta-amylase induction in response to abiotic stress. In my study, a temperature response profile in 5C increments from 45C to 0C showed that increases in transcript accumulation at temperature extremes was specific for two members of the gene family (BMY7 and 8). Both members encode proteins that possess apparent transit peptides for chloroplast stromal localization. Induction was not observed for other key starch-degrading enzymes demonstrating a rather specific response to temperature stress for BMY7 and 8. Time course experiments for heat shock at 40C and cold shock at 5C showed that beta-amylase induction correlated with maltose accumulation. Maltose has the ability, as demonstrated by in vitro assays, to protect proteins, membranes, and the photosynthetic electron transport chain at physiologically relevant concentrations. A role for BMY8 during cold shock was also shown in vivo using BMY8 RNAi lines. Reduced in BMY8 transcript levels resulted in a decrease in maltose, glucose, fructose, and sucrose content. BMY8 RNAi ix

PAGE 10

lines with reduced soluble sugar content exhibited less chlorophyll fluorescence as Fv/Fm ratio compared with WT suggesting that the photosynthetic electron transport chain was more sensitive to freezing stress. Carbohydrate analysis and freezing stress assay results of BMY8 RNAi lines indicate that maltose, by itself or together with glucose and fructose, contribute to the protection of the photosynthetic electron transport chain in the chloroplast during freezing stress. x

PAGE 11

CHAPTER 1 INTRODUCTION Beta-amylase is an exoamylase that hydrolyses 1,4 glycosidic linkages of polyglucan chains at the nonreducing end to produce maltose (4-O--D-Glucopyranosyl--D-glucose) during starch degradation. Maltose is exported to the cytosol by a maltose translocator found in the chloroplast membrane (Neuhaus and Schulte 1996; Servaites and Geiger 2002; Lu and Sharkey, 2004; Niittyla et al., 2004; Sharkey et al., 2004; Weise et al., 2004) to be further metabolized by cytosolic glucosyltransferases. Studies showed that beta-amylase expression and/or activity was induced during temperature stress; and the levels of its product (maltose) also increased during temperature stress (Dreier et al., 1995; Nielsen et al., 1997; Datta et al., 1999; Seki et al., 2001; Sung, 2001; Kreps et al., 2002; Fowler and Thomashow 2002; Seki et al., 2002; Jung et al., 2003; Kaplan et al., 2004). For example, when Arabidopsis was cold-stressed at 4C for 12 h, beta-amylase (AJ25034; ct-Bmy or BMY8) transcript increased about 14-fold (Sung, 2001) and induction was found to occur as early as 2 h of exposure to cold stress (Seki et al., 2001). The BMY7 expression increased about 5-fold when Arabidopsis plants grown at 20C were exposed for 1 h to 40C (Sung, 2001). Studies with potato tubers also showed that an increase in beta-amylase activity was accompanied by maltose production during cold shock (Nielsen et al., 1997). The role of beta-amylase induction during temperature shock is unknown. My study showed that beta-amylase induction precedes the appearance of maltose, which has compatible solute-like protective abilities as demonstrated by in vitro assays. The BMY8 1

PAGE 12

2 RNAi lines with reduced beta-amylase transcript levels had less maltose accumulation in response to cold shock, compared with WT. Freezing stress assays showed that BMY8 RNAi lines had reduced chlorophyll fluorescence parameters. Therefore, stress-induced beta-amylase results in maltose accumulation, which can contribute to the protection of the photosynthetic electron transport chain, proteins, and membranes inside the chloroplast during temperature shock.

PAGE 13

CHAPTER 2 LITERATURE REVIEW Role of Beta-Amylases in Starch Degradation The primary function of beta-amylase in plants is in starch breakdown (Figure 2-1) (Scheidig et al., 2002). Down-regulation of a chloroplast-localized beta-amylase by antisense mRNA resulted in a starch-excess phenotype in potato leaves compared to wild type plants (Scheidig et al., 2002). Plants with reduced chloroplastic beta-amylase activity could degrade only 8-30% of their total starch in the dark, while wild type could degrade 50%; indicating that hydrolytic rather than phosphorolytic cleavage is the predominant during starch degradation (Scheidig et al., 2002; Lu and Sharkey, 2004; Sharkey et al., 2004; Weise et al., 2004). Furthermore, it produces maltose by hydrolyzing long unbranched polyglucan chains that are breakdown products of native starch grains by other amylolytic enzymes like alpha-amylase based on in vitro studies (Beck and Ziegler, 1989). It has been suggested that glucose and maltose are exported to the cytosol during hydrolytic cleavage (Figure 2-1). Several studies show that export of glucose and maltose occurs from isolated chloroplasts (Neuhaus and Schulte 1996; Servaites and Gieger 2002; Weise et al., 2004). This is further supported by the recent discovery of a maltose translocator (MEX) in the chloroplast membrane (Niittyla et al., 2004). Mutations in the maltose translocator, a single copy gene, resulted in a starch excess phenotype and elevated maltose content (Niittyla et al., 2004). Once maltose is exported to the cytosol, it is further metabolized to glucose and/or sucrose, and maltodextrins by 3

PAGE 14

4 cytosolic glucosyltransferases during transitory starch degradation (Chia et al., 2004; Lu and Sharkey, 2004). For example, when cytosolic amylomaltase (disproportioning enzyme II, dpe2), transferring a glucosyl unit from maltose to glycogen in vitro (Chia et al., 2004), was knocked out by a T-DNA insertion, the knockout plants (dpe2) contained high maltose (Chia et al., 2004; Lu and Sharkey, 2004) maltodextrins and starch content (Lu and Sharkey, 2004). Long branched glucansStarchPhoshorylyticcleavageGlucoseMaltotrioseSucroseGlucosePolyglucanChloroplastMaltoseMaltose CytosolLong unbranchedglucans R1 and/or AMYDBEDPE1DPE1BMYPHSDPE2DPE2MEX GLUTLong branched glucansStarchPhoshorylyticcleavageGlucoseMaltotrioseSucroseGlucosePolyglucanChloroplastMaltoseMaltose CytosolLong unbranchedglucans R1 and/or AMYDBEDPE1DPE1BMYPHSDPE2DPE2MEX GLUT Figure 2-1. Hydrolytic starch degradation. R1: a glucan, water dikinase; AMY: alpha-amylase; DBE: debranching enzyme; PHS: phosphorylase, BMY: beta-amylase; DPE1: plastidic disproportioning enzyme; DPE2: cytosolic disproportioning enzyme; MEX: maltose exporter; GLUT: glucose transporter This diagram is drawn based on the model by Sharkey et al., 2004. Reaction Mechanism Beta-amylase is an exoamylase that hydrolyses 1,4 glycosidic linkages of polyglucan chains at the nonreducing end to produce maltose (4-O-alpha-D-Glucopyranosyl-beta-D-glucose) (Figure 2-2). Hydrolysis of the glycosidic bond is

PAGE 15

5 achieved by two conserved Glu residues using a general acid-base catalysis mechanism. (Mikami et al., 1994). In the soybean enzyme, Glu 186 plays a role as a general acid and Glu 380 plays a role as a general base (Figure 2-3B) (Mikami et al., 1994; Kang et al., 2004). The carboxyl group of Glu 186 is located on the hydrophilic surface of the glucose, and donates a proton to the glycosidic oxygen. The carboxyl group of Glu 380 lies on the hydrophobic face of the glucose residue at the subsite -1 and activates an attacking water molecule. The deprotonated Glu 186 is stabilized by Thr 342 after cleavage of the glycosidic bond (Mikami et al., 1994; Kang et al., 2004). The reducing glucose of the maltose product is in the beta-form, hence, the name beta-amylase. + H2Obeta amylaseOH2OH O H2OH O H2OH H2OH OH2OH O +OH2OH O H2OH OCHHHOHOHHH OCHHOHHOHOHHH OCHHHOHOHHH H2OH O MaltoseOCHHOHHOHOHHH H2OH OCHHHOHOHHOH H2OH O HOCHHHOHOHHH OCHHHOHOHHH OCHHHOHOHHH OCHHOHHOHOHHH OCHHHOHOHHH nn 2 1232543154+ H2Obeta amylaseOH2OH O H2OH O H2OH H2OH OH2OH O +OH2OH O H2OH OCHHHOHOHHH OCHHOHHOHOHHH OCHHHOHOHHH H2OH O MaltoseOCHHOHHOHOHHH H2OH OCHHHOHOHHOH H2OH O HOCHHHOHOHHH OCHHHOHOHHH OCHHHOHOHHH OCHHOHHOHOHHH OCHHHOHOHHH nn 2 1232543154 Figure 2-2. Beta-amylase hydrolysis of alpha-1,4 glycosidic linkage of a polyglucan chain Current models of beta-amylase function explain its mode of action on polyglucan chains. Beta-amylase appears to degrade amylose chain substrates by a random encounter binding mechanism, but can also sequentially catalyze maltose production after an initial substrate binding. This combined hydrolytic process is referred to as “multiple attack” (Adachi et al., 1998). The estimated K cat for the major soybean enzyme is

PAGE 16

6 between 1260 and 1280 (s 1 ), and the optimum pH is 5.4 6.0 (Adachi et al., 1998; Hirata et al., 2004). Beta-Amylase Structure Structures derived from X-ray crystallography of plant beta-amylases are known for sweet potato (Cheong et al., 1995), soybean (Adachi et al., 1998; Mikami et al., 1993; Mikami et al., 1994), and barley (Mikami et al., 1999). The sweet potato beta-amylase is composed of four identical subunits of 498 amino acids having 222 molecular symmetry. Each subunit has a large (/beta) 8 core, three long loops associated with a subdomain, and an extended C-terminal loop. A conserved Glu, located on L4 near the base of a cleft between the core domain and the smaller subdomain containing three long loops, is thought to function in catalysis. A conserved Cys at position 96 seems to be involved in the inactivation of enzymatic activity by sulfhydryl reagents. Overall, the structure of sweet potato beta-amylase is very similar to the structure reported for soybean and barley beta-amylases. Additionally, the soybean, sweet potato and barley enzymes are most homologous to the major Arabidopsis extraplastidic form Atbeta-amy (BMY1) (Monroe and Preiss 1990; Laby et al., 2001) encoded at position At4g15210 of the genome. However, this particular Arabidopsis enzyme appears to function as an active monomer (Monroe and Preiss 1990). The catalytic site of the soybean enzyme (1BYB) sits in a cul-de-sac of the 18 deep cleft, which allows the endwise hydrolysis of unbranched amylose and maltosaccharide chains (Mikami et al., 1993). The comparative smallness of the cul-de-sac assembly contrasts with the long active-site cleft characteristic of endoglycanases. The nonreducing end of the chain is oriented toward the base of the cleft, and two conserved (Figure 2-3A and B) Glu 186, 380 residues occupy positions above

PAGE 17

7 AB AB Figure 2-3. Crystal structure of soybean beta-amylase (1BYB) Mikami et al. (1994). A) The structure of beta-amylase. B) Close up of the active site. Catalytic Glu 186, 380 residues are shown in red, glucose residues are white, and the carbon backbone of the protein is yellow. This figure is created by Dr. Mavis Agbandje-McKenna using O software (Jones et al.,1991).

PAGE 18

8 and below the bound polyglucan chain. Loop 3 in the closed position helps to shield the reaction center from solvent, and facilitates an ordered water molecule adjacent to Glu 380 to provide the steric outcome of the hydrolysis/hydration reaction (Mikami et al., 1994). This overall structural arrangement explains why alpha-cyclodextrin and maltose are competitive inhibitors of beta-amylase (Adachi et al., 1998; Mikami et al., 1993; Mikami et al., 1994). Subcellular Localization of Beta-Amylases Beta-amylases are localized (Table 2-1) to the stroma of mesophyll cell chloroplasts (Scheidig et al., 2002; Lao et al., 1999), the vacuole (Ziegler and Beck, 1986; Datta et al., 1999), and the cytoplasm. One Arabidopsis beta-amylase, designated ct-Bmy (accession # AJ250341; BMY8), has been biochemically localized to the chloroplast stroma (Lao et al., 1999) based on import studies with isolated pea chloroplasts; and confirmed by accumulation of a beta-amylase-GFP fusion protein in Arabidopsis chloroplasts (Lao et al., 1999). A chloroplast localization of beta-amylase is also known in potato (Scheidig et al., 2002). Arabidopsis contains two additional highly homologous beta-amylase genes that, based on sequence analyses (Table 2-1), are predicted to be plastid localized. Subcellular fractionation studies with pea also demonstrate a vacuolar localization of beta-amylase (Ziegler and Beck, 1986). Isolated vacuoles from pea and wheat leaf protoplasts contain detectable amylolytic activity, which is identified as beta-amylase activity (Ziegler and Beck, 1986). The majority of beta-amylase activity in leaves of maize and pearl millet is localized in the vacuole; 94% and 80%, respectively (Datta et al., 1999). Further support for multiple subcellular localizations of beta-amylase in plant cells comes from bioinformatic analysis of the Arabidopsis genome, where 6 of the 9 (currently released sequences from GenBank)

PAGE 19

9 probable beta-amylase genes encode proteins predicted to localize to extraplastidic compartments (Table 2-1). Table 2-1. Arabidopsis beta-amylase gene family Suggested Nomenclature MIPS Given Name Tissue Location Subcellular Location BMY1 AT4G15210 AT-Amy 1 , Ram1 2 , BMY1 3 , BAM5 4 Pholem 7 Vacuole 8 MY2 AT5G45300 BAM8 4 Cytosol* MY3 AT5G18670 BMY3 5 , BAM9 3 Flowers 5 Cytosol* BMY4 AT2G45880 BAM7 4 Cytosol* MY5 AT2G32290 BAM6 4 Cytosol* MY6 AT5G55700 BAM4 4 Mitochondria* MY7 AT3G23920 BMY7 3 , BAM1 4 Chloroplast* MY8 AT4G17090 ct-Bmy 6 , BMY8 3 , BAM3 4 , Chloroplast 6 MY9 AT4G00490 BMY9 3 , BAM2 4 Chloroplast* Red color in the MIPS (Munich information center for protein sequences) number indicates chromosomal location. *Predicted subcellular location based on Target P prediction. 1 Mita et al., (1997), 2 Laby et al., (2001), 4 Smith et al., (2004), 7 Wand et al., 1995; 5 Chandler et al., 2001; 8 Monroe and Priess 1990; 6 Lao et al., 1999 Regulation of Beta-amylase Beta-amylase expression and activity are regulated by light (Sharma and Schopfer, 1982; Harmer et al., 2000; Chandler et al., 2001; Tepperman et al., 2001; Smith et al., 2004); sugars (Nakamura et al., 1991; Mita et al., 1995; Maeo et al., 2001); phytohormones (Wang et al., 1996; Ohto et al., 1992); abiotic stresses (Drier et al., 1995; Datta et al., 1999; Nielsen et al., 1997; Seki et al., 2001; Sung, 2001); and proteolytic cleavage (Hara-Nishimura et al., 1986; Sopanen and Lauriere, 1989). However, information about which isoforms are regulated by the above conditions remains scarce. Light Induction of beta-amylase in mustard is controlled by phytochrome (Sharma and Schopfer, 1982) during cotyledon photomorphogenesis. Its induction is photoreversible

PAGE 20

10 by far-red light during the first 36 h after sowing, but mRNA synthesis does not increase until about 46 h after sowing. This timing difference of phytochrome-mediated induction of beta-amylase activity is suggested to involve a stable regulatory element (Sharma and Schopfer, 1982) in the signal-transduction pathway. Microarray studies show that at least one member of the beta-amylase family is under the control of phytochrome and the circadian clock. Using wild-type and phyA null Arabidopsis seedlings (Tepperman et al., 2001), a chloroplast localized beta-amylase (BMY8) is classified as a phyA early induced gene exhibiting an expression profile similar to CAB, PSII OEC protein1, chlorophyll and carotenoid biosynthesis genes. The same beta-amylase gene in older seedlings entrained to 12 h light/dark cycles also appears to be controlled by the circadian clock (Harmer et al., 2000). Other similarly regulated genes include starch branching enzyme, sucrose-phosphate synthase, and UDP rhamnose-anthocyanidin-3-glucoside rhamnosyltransferase-like protein. Such an expression profile is consistent with the recently demonstrated role of a plastid-localized beta-amylase in transitory starch degradation (Scheidig et al., 2002) for hexose export to the cytoplasm. Besides the chloroplastic form, one other beta-amylase (accession # AC005700; BMY3) is circadian-clock regulated, and shows an expression profile similar to the chloroplastic form (Chandler et al., 2001). Recent study has also shown that 4 Arabidopsis beta-amylases, 3 of which are predicted to be chloroplast localized, are diurnally regulated. Expression of BMY6, BMY3, BMY7, and BMY8 showed a steady increase until dawn, and their expression started decreasing after sunrise (Smith et al., 2004).

PAGE 21

11 Sugars Sugars function as metabolites and as regulators of gene expression. Regulatory activity is thought to be accomplished through hexokinase, hexose, and sucrose dependent pathways (Smeekens, 2000). Three and 6% fructose, glucose and sucrose induce beta-amylase transcript, protein accumulation, and activity in sweet potato leaf petiole cuttings (Nakamura et al., 1991) and Arabidopsis plants (Mita et al., 1995). In Arabidopsis, it is the vacualor form (Mita et al., 1995). This is also supported by studies with transgenic tobacco plants harboring a construct for beta-amy:GUS, where GUS expression is driven by a sweet potato beta-amylase promoter (Maeo et al., 2001). The GUS activity shows induction in leaf tissues treated with glucose, fructose, mannose, and sucrose; but not the nonmetabolizable 2-deoxyglucose (2d-Glc) that can be phosphorylated by hexokinase. This is further supported by the use of glucosamine, an inhibitor of hexokinase, which inhibits sucrose-induced GUS activity (Maeo et al., 2001). Thus, sugar regulation for beta-amylase appears to be accomplished through hexose and sucrose-dependent pathways (Nakamura et al., 1991; Mita et al., 1995; Maeo et al., 2001) requiring hexokinase activity (Maeo et al., 2001). Phytohormones Beta-amylase is regulated by phytohormones at the levels of transcript and activity (Wang et al., 1996; Ohto et al., 1992). Beta-amylase activity, in germinating rice seeds, is inhibited by exogenous supply of 10 M ABA. This inhibition is fully reversible by adding 1-10 M GA 3 . The ABA inhibition of beta-amylase activity is exerted at the mRNA level, either by inhibiting transcription or by destabilizing the beta-amylase mRNA (Wang et al., 1996). On the other hand, treatment of sweet potato leaf petioles with 100 M ABA leads to induction of beta-amylase mRNA, but this induction is

PAGE 22

12 repressed by 50 M GA 3 supply (Ohto et al., 1992). These opposite responses to ABA and GA 3 could result from species-specific processes, differences between petioles and seeds, or different phytohormone treatment levels. Proteolytic Cleavage The seeds of some species contain stored beta-amylase that is bound to starchy endosperm possibly through S-S bridges (Hara-Nishimura et al., 1986). During germination, this enzyme is not synthesized de novo; but instead, is released from a bound form by proteolytic cleavage, to produce a smaller-sized free form (Sopanen and Lauriere, 1989). Western blot analysis showed that free (59 kDa) and bound (64 kDa) forms of beta-amylase, isolated from germinated and ungerminated seeds, respectively (Sopanen and Lauriere, 1989). The uncleaved form has lower activity compared to the free form; thus, proteolytic cleavage is thought to relieve steric hindrances that prevent substrates from reaching the active site (Sopanen and Lauriere, 1989). Abiotic Stress Regulation of beta-amylase expression and activity by abiotic stress includes osmotic (Datta et al., 1999; Dreier et al., 1995), drought (Yang et al., 2001), salt (Datta et al., 1999; Dreier et al., 1995), cold (Sung, 2001; Seki et al., 2001; Nielsen et al., 1997), and heat stress (Dreier et al., 1995). More specifically, regulation of beta-amylase activity by osmotic stress appears to be a general response for several plant species (Datta et al., 1999; Dreier et al., 1995). Exposure of barley (Dreier et al., 1995), pearl millet, and maize (Datta et al., 1999) to osmotic stress with 300 mM sorbitol for 4 days also results in the increase of beta-amylase activity, which is correlated with an increase in beta-amylase protein. Similarly, when cucumber cotyledons are treated with 30 or 50% PEG for 0.5 and 1 day, beta-amylase activity increases, followed by increases in the free

PAGE 23

13 sugars sucrose and maltose (Todaka et al. 2000). Not surprisingly, salt stress also stimulates induction of beta-amylase protein accumulation and activity (Datta et al., 1999; Dreier et al., 1995) in maize, pearl millet (Datta et al., 1999), and barley (Dreier et al., 1995). Beta-amylase expression (Sung, 2001; Seki et al., 2001) or activity (Nielsen et al., 1997) is similarly induced by cold and heat stress. When Arabidopsis plants are cold stressed at 4C for 12 h, chloroplast localized beta-amylase (accession number AJ25034; BMY8) transcript increases about 14-fold (Sung, 2001). This response can occur as early as 2 h after exposure to cold stress (Seki et al., 2001). In addition, when potato tuber storage temperature was reduced from 20C to 5C or 3C, beta-amylase activity increased 4to 5-fold over a 10-day period, and was followed by maltose accumulation; whereas the activities of -glycosidase and endoamylase remained unchanged (Nielsen et al., 1997). Heat stress also induces beta-amylase transcript (BMY7) (Sung, 2001) and activity (Dreier et al., 1995), such that raising barley growth temperature from 25C to 35C results in induction of beta-amylase activity. Compatible Solute Compatible solutes (osmoprotectants) are low-molecular-weight organic molecules that accumulate under stress conditions. High concentrations of such solutes are not toxic to the cells (Sakamoto et al., 1998; Yancey et al., 1982). Those with charged functional groups do not normally have a net charge at physiological pH. Compatible solutes are thought to stabilize proteins and membranes, and contribute to cell osmotic pressure under stress conditions. There are three general types of osmoprotectants: methylamines, polyols, and amino acids (Yancey et al., 1982).

PAGE 24

14 Sucrose, a compatible solute thought to stabilize membranes and proteins during temperature stress and water stress (Santarius, 1973), is known to accumulate during temperature stress (Guy et al., 1992; Krapp and Stitt, 1995; Strand et al., 1997; Strand et al., 1999; Wanner and Junttilla, 1999). The activity and transcripts of the sucrose biosynthetic enzyme, sucrose phosphate synthase (SPS), are known to accumulate under temperature stress (Guy et al., 1992; Strand et al., 1997). Similarly, when warm grown Arabidopsis plants were exposed to low temperature (5C), sugar accumulated within a few h consisting primarily of sucrose, glucose, and fructose (Wanner and Junttilla, 1999; Kaplan et al., 2004). Again similarly, a shift from 23C to 5C in Arabidopsis growth temperature resulted in accumulation of phosphorylated hexose intermediates and soluble sugars like sucrose, glucose and fructose (Guy et al., 1992; Krapp and Stitt, 1995; Strand et al., 1997; Strand et al., 1999). The increase in free sugars was correlated with an increase in mRNA accumulation (Strand et al., 1997) and activity of SPS (Guy et al., 1992) that catalyzes sucrose synthesis from glucose and fructose. Additionally, based on RT-PCR data, expression of SPS is induced under temperature stress (4C for 12 h and 40C for 1 h). Proline, an amino acid compatible solute, accumulates under stress conditions such as salt, dehydration, and cold stress (Verbruggen et al., 1993; Yoshiba et al., 1995; Xin and Brows, 1998; Wanner and Junttila, 1999; Gilmour et al., 2000). 1 pyrroline-5-carboxylate synthetase (P5CS) catalyzes the first two steps in proline biosynthesis in plants (Hu et al., 1992). It is suggested that P5CS plays a key role in proline biosynthesis under osmotic stress, and catalyzes the regulating step (Yoshiba et al., 1995; Strizhov et al., 1997). Based on time course experiments, Arabidopsis plants showed proline

PAGE 25

15 accumulation 5 h after dehydration initiation; and proline steadily accumulated for a further 19 h. The P5CS expression increased within 2 h before proline accumulation and continued to increase up to 10 h based on dehyration time course studies (Yoshiba et al., 1995; Srizhov et al., 1997). Similar to the effects of dehydration stress, Arabidopsis plants accumulated proline 4 h after NaCl treatment (Verbruggen et al., 1993). The P5CS transcripts accumulated within 1 h after NaCl treatment and continued to accumulate for 24 h, according to time course studies (Yoshiba et al., 1995; Strizhov et al., 1997). Proline accumulation was also detectable 24 h after exposure of warm-grown Arabidopsis plants to low temperature (1C) (Wanner and Junttila, 1999). Morover, when Arabidopsis plants were cold-acclimated at 4C for 2 days, the free proline content increased 10-fold, and the proline accumulation was accompanied by increased expression of P5CS (Xin and Browse, 1998). These studies were also supported by time course experiments, where warm-grown Arabidopsis plants were exposed to cold temperature (4C), P5CS expression increased slightly 24 h after initiating treatment (Yoshiba et al., 1995). However, P5CS expression showed no induction under heat treatment (40C), in the time course studies (Yoshiba et al., 1995).

PAGE 26

CHAPTER 3 MATERIAL AND METHODS Plant Growth, and Heat and Cold Shock Treatment Arabidopsis thaliana (var. Columbia) seeds were stratified at 4C for 3 days and sown in Fafard 2 mix soil (Canadian sphagnum peat, perlite, and vermiculite). Plants were grown in a controlled environment with a 15/9 h light/dark cycle at 20C + 2C for 16-18 days. The irradiance was 25-40 mol m -2 s -1 photosynthetically active radiation (PAR). Six days before the experiment, irradiance was increased to 90-140 mol m -2 s -1 PAR. Plants were exposed to the same irradiance 90-140 mol m -2 s -1 PAR during heatand cold-shock treatments. In the step-up and step-down experiments, 16-day-old Arabidopsis plants were exposed to 25, 30, 35, 40 and 45C for 1 h heat shock; and 15, 10, 5, and 0C for 12 h cold shock. In both experiments, plants grown at 20C were used as a control. The temperature treatment was begun and the initial leaf samples (0 time control) were taken at 8 AM (2 h after the lights were on at 6 AM). Heat-shock leaf samples were taken at 9 AM, and cold-shock leaf samples were taken at 8 PM (1 h before the end of the photoperiod). Three independent experiments were conducted. Leaf samples were collected, flash frozen in liquid nitrogen, and stored at C for subsequent RNA extraction and RT-PCR analyses. In the time course experiment, 18-day-old Arabidopsis plants were exposed to 40C for 0, 30, 60, 120 and 240 min for heat shock; and to 5C for 0, 6, 24, 48, 96 and 16

PAGE 27

17 192 h for cold shock. Three independent experiments were conducted. Leaf samples were taken 2 h after the lights were on, for RT-PCR analysis, carbohydrate analysis, immunoblot, enzyme assay, and chlorophyll analysis. RNA Extraction Heatand cold-shocked Arabidopsis leaves were flash-frozen in liquid nitrogen and stored at -80C. The leaf tissues were ground to a fine powder in liquid nitrogen using a mortar and pestle, then RNA was extracted using QIAGEN RNeasy Plant Mini Kits (QIAGEN) according to the manufacturer’s protocol. RNA was quantified absorbance at 260 nm using an UV spectrophotometer and stored at -80C. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) “Ready To Go” RT-PCR Beads (Amersham Pharmacia Biotech) were used for RT-PCR. Each 25 L RT-PCR included 1 Unit Taq DNA polymerase, 10 mM pH 9 Tris-HCl, 60 mM KCl, 1.5 mM MgCl 2 , 200 M each dNTP, Moloney Murine Leukemia virus reverse transcriptase, RNAguard RNase inhibitor (porcine), stabilizers, DNase and RNase-free BSA, 1 g primer deoxy nucleotide (pd(N) 6 ) for the first strand synthesis, 0.4 M each gene specific forward and reverse primers (Table 3-1), 0.1 M each 18 S rRNA forward and reverse primer (internal loading control), 0.3 M each 3’ terminal dideoxy 18S rRNA forward and reverse primers, and 16 ng total RNA. Various PCR cycles (25, 30, 35, and 40) were tested and adjusted to each gene to make sure DNA amplification was still in a linear phase at the termination of the reaction. Additionally, the total RNA for RT-PCR came from plants that were treated on three different occasions. After addition of total RNA and pd(N) 6 , the reaction was incubated at 42C for 30 min for the first strand cDNA synthesis. Gene specific and 18S rRNA primers (as a loading control)

PAGE 28

18 were added and PCR amplification was carried out with a Stratagene Robocycler (Stratagene). The first PCR cycle was 95C for 5 min, 95C for 30 sec, 52C for 1 min, 72C for 1 min and the second cycle was 95C for 30 sec, 52C for 1 min, 72C for 1 min. The second cycle was repeated 25 times for BMY8, Cor78, Hsp70; 30 times for BMY1, BMY9, AMY1, P5CS (8 ng total RNA), Phos b; and 35 times for BMY7, IMY, SPS. The final cycle was 72C for 7 min. Afterwards, PCR products were kept at 5C. PCR products were fractionated in a 1% agarose gel in 1X TAE buffer for 1 h at 90 V. Gels were stained with ethidium bromide and digitally photographed with an IS-1000 Digital Imaging System (Alpha Innotech Corporation). Table 3-1. Primers used in RT-PCR reactions. Gene of Interest MIPS Primer Sequence 5’ to 3’ CG363 ACGCCGGAGAATACAATG F BMY1 At4g15210 CG364 CAACGGCACAATCTCATG R CG305 GACACCCAGTTCAAAA F BMY7 At3g23920 CG306 CTCAACTTCTTCCCGACA R CG307 GGAACAAGCGGACCTCAT F BMY8 At4g17090 CG308 TCTCAGCGATCTTGCCTT R CG382 GCTGGCAGGCGTAACACT F BMY9 At4g00490 CG383 CGGTTTGAGGAGTTGTAGAAG R CG351 CGTCTTGAACCACACAGC F IMY At2g39930 CG352 GCAAAGTCTCCCTCCTCT R CG345 CCAGGGTAGAGGAAACAA F AMY At1g69830 CG346 TCGAAGAAGACCGCTGGT R CG315 AAGATGAAGGAAATGAGTG F Phos b At3g29320 CG316 CATCTTTTCTGGTCTCGG R CG353 GGACCAAGGGCAAGTAAG F P5CS At2g39795 CG354 AGCCCATCCTCCTCTGTG R CG321 AATGACAATATCTGAGACTC F SPS At5g11110 CG322 ACCACATTCTTTAGCCTC R CG309 CTTTGACTCTGTTCTCGGT F RD29A or Cor78 At5g52310 CG310 GTTGTCAGTTTCTCCGCC R CG258 TCAAGCGGATAAGAGTCACT F Hsp70 At3g12580 CG259 CTCGTCCGGGTTAATGCT R CG359 GGAGCGATTTGTCTGGTT F 18S rRNA At3g41768 CG360 TGATGACTCGCGCTTACT R CG361 GGAGCGATTTGTCTGGTT-3' F 18S rRNA 3’ dideoxy At3g41768 CG362 TGATGACTCGCGCTTACT-3' R

PAGE 29

19 For BMY8 RNAi lines, quantitative RT-PCR was done as described above using gene specific primers as listed in Table 3-1 to determine the degree of transcript decrease and specificity of the RNAi construct. For beta-amylase and alpha-amylase knockout lines, gene specific primers were designed from either side of the insertion if the insertion was positioned in an exon. If the insertion was positioned in an intron, gene specific primers were selected from exonic regions on either side of the intron. If the insertion event was in the promoter region, gene specific primers were designed (Table 3-2). RT-PCR was done as described above except that 45 PCR cycles were used in order to detect any transcript. Table 3-2. Primers used in RT-PCR reaction for knockout lines. MIPS Mutant Salk Primer Sequence 5’ to 3’ CG535 ACCCGCAACTTCTATACCT BMY1-1R SALK_004755 CG536 AACATGGCGGATTTGATAG CG541 CCGTTTACGTTATGCTTCC At4g15210 BMY1-2K SALK_032057 CG542 CGGCTTGTCATTGTATTCTC GC537 TAGCATTGCACAGGTGTTC At3g23920 BMY7-1L SALK_039895 CG538 ATCGAAACTACAAGGCTCAC CG307 GGAACAAGCGGACCTCAT At4g17090 BMY8-1G SALK_041214 CG308 TCTCAGCGATCTTGCCTT CG539 TTGGCGTGGTGTTTCTAC At4g00490 BMY9-1H SALK_086084 CG540 TTCCCCAAGTAAGGCATT CG345 CCAGGGTAGAGGAAACAA AMY1-1O SALK_058213 CG346 TCGAAGAAGACCGCTGGT CG543 CGGAGAAATGGACTACAATCAA At1g69830 AMY1-2B SALK_005044 CG481 AGCATTGAAAAAAGTGGGACA Beta-Amylase Enzyme Assay Heat and cold shocked Arabidopsis leaves from 3 independent experiments were flash frozen in liquid nitrogen and ground to a fine powder using mortar and pestle. Crude extracts were prepared in an extraction buffer (50 mM Tris and 1 mM EDTA pH 6.2), thoroughly mixed, and centrifuged for 10 min at 10,000 g in a JA-18.1 rotor using a

PAGE 30

20 Beckman J2-21 centrifuge at 4C. The supernatant was used for enzyme activity assay using a beta-amylase assay kit (Megazyme) according to the manufacturer’s protocol. The beta-amylase substrate solution (100 L) was preincubated at 40C for approximately 5 min, then 100 L crude enzyme extract was added to the substrate solution, mixed, and incubated at 40C for exactly 10 min. The control included a substrate solution and extraction buffer instead of plant extract. After 10 min, 1500 L of stop buffer (1% (w/v) Trizma base) was added to stop the reaction. Production of p-nitrophenol was measured at A 410 spectrophotometrically. In this assay, the specific artificial substrate p-nitrophenyl maltopentaoside (PNPG5) was used, which is resistant to cleavage by alpha-amylases for p-nitrophenol production. Total protein content was quantified using the Bradford assay at (Bradford, 1976). Western Blot Analysis Monoclonal antibodies were prepared using synthetic peptides that were unique (C-terminal) for each of the three putative plastid-localized beta-amylases, namely BMY7, 8 and 9. Peptide sequences were as follows: BMY7 (At3g23920) EGRDSHCREEVEREAEHFVHC, BMY8 (At4g17090) KNMKEGGHGRRLSKEDTTGSDLC, and BMY9 (At4g00490) ESQNFKEFERFLKRMGEAVC. The peptides were cross-linked individually to the carrier protein, keyhole limpet hemocyanin (KLH), through the C-terminal cysteine sulfhydryl. DNA sequences for cDNAs of all three beta-amylases were cloned into pGEX-4T-2 or pGEX-2T vectors (Pharmacia Biotec). The expressed recombinant proteins were used for screening hybridoma cell lines and cross-reactivity tests. A monoclonal antibody for BMY7 did not cross-react with the other recombinant beta

PAGE 31

21 amylases BMY8 and 9, and similarly a monoclonal antibody for BMY9 did not cross-react with the other recombinant beta-amylases BMY7 and 8. Monoclonal antibodies were obtained for BMY9 and BMY7, 3H10-3D6 and 4F5-5G10, respectively. A monoclonal antibody for BMY8 was not obtained. However, a mouse serum that recognizes all 3 beta-amylases was obtained. Heat and cold shocked Arabidospis leaves were flash frozen in liquid nitrogen and stored at -80C. Leaves from 3 independent experiments were ground to a fine powder in liquid nitrogen using mortar and pestle. Total protein from leaf tissue was prepared in an extraction buffer containing 50 mM Tris-HCl pH 7.0, 0.1 mM EDTA, 5 mM dithiothreitol, 1 mM PMSF, 1 g/mL leupeptin, and 1g/mL pepstatin A. Protein content was quantified by the Bradford assay. Fifteen g total protein was loaded on to a 10% polyacrylamide gel and run at 100V for 15 min and then 200V for 45 min. Proteins were transferred to PVDF membrane by semidry-blotter (BIORAD), according to the manufacturer’s protocol. Because the abundance of beta-amylase protein was too low for the conventional western blot staining detection system, we used the more sensitive ABC staining kit from Pierce. ABC Western staining was done according to the manufacturer’s protocol (Pierce). Control gels for equal loading were stained with Coomassie blue. Chlorophyll Extraction Chlorophyll content was determined by the method of Bruinsma (1963). Chlorophyll was extracted from 10 mg freeze-dried leaves prepared from 3 independent experiments using 1 mL of 80% acetone at 4C overnight in a 2 mL screw cap micro tube in the dark. Chlorophyll content was quantified spectrophotometrically at A 645 and A 663 .

PAGE 32

22 Carbohydrate Analysis Eighteen day-old cold and heat shocked Arabidopsis plants from 3 independent experiments were harvested, flash frozen in liquid nitrogen and freeze-dried. Lactose at 200 M was added to samples as an internal standard at the beginning of extraction to normalize the data due to losses during the extraction procedure, and due to changes in the HPLC detection system. Soluble sugars were extracted five times using hot 80% aqueous ethanol from 30 mg (dry-weight) of leaves and stems. Ethanol insoluble materials were saved for starch analysis. Ethanol was evaporated at 80C and the remaining aqueous solution was lyophilized and resuspended in distilled water. To collect soluble neutral sugars, extracts were passed though an Amberlite ion exchange column with 1 meq/exchange capacity at room temperature. The flow-through was freeze-dried. Monosaccharides and disaccharides were separated using an HPLC with Dionex system using a CarboPac PA10 column. Samples injected on the PA 10 column were separated at a flow rate of 1.0 mL/min with a step gradient of NaOH from 10-200 mM over 50 min. The step gradient was in the following order: 10 mM NaOH for 15 min, 80 mM NaOH for 5 min, 140 mM NaOH for 10 min, 200 mM NaOH for 10 min for column regeneration, and 10 mM NaOH for 10 min for column re-equilibration. Monosaccharides (fructose and glucose), disaccharides (sucrose, trehalose, maltose) and the sugar alcohol form of maltose (maltitol) were quantified. Starch content was determined by the method of Li et al. (1965). After soluble sugar extraction, the ethanol insoluble residue was vacuum-dried. Starch was solubilized in boiling water for 15 min. The supernatant was reacted with iodine-potassium iodide

PAGE 33

23 (0.1%) and color density was measured at A 620 using a spectrophotometer. Potato starch was used as the standard to estimate starch quantity. Compatible Solute Assay for Maltose Compatible solute assays for SspI, G6PDH, and ADH were repeated 3 times with the exception of the G6PDH time course experiment that was repeated twice. SspI (New England Biolabs) is a bacterial restriction enzyme that cleaves double stranded DNA. In this assay it cuts the pGEX-4T-2 circular plasmid twice, and generates 3.77 kb and 1.19 kb fragments in the reaction buffer (50 mM NaCl, 100 mM Tris-HCl, 10 mM MgCl 2 , 0.025% Triton X-100 pH 7.5 at 25C). Five units of SspI in the reaction buffer in the absence of maltose were incubated at 50C for 15 min where 50% of the enzyme activity was lost. Aliquots were incubated at 50C in the presence of 14, 100, 200 and 400 mM maltose. A substrate, 0.5 g of pGEX-4T-2 circular plasmid, was added to the reaction mixture and incubated at 37 C for 1 h. The control reaction did not include maltose and was not exposed to heat treatment to show the full enzyme activity. Twenty-two L of a 50 L reaction was loaded on a 1% agarose gel. The gel was run at 100 V for 30 min and stained with ethidium bromide to visualize the product. A 5 kb band representing a single cut plasmid was quantified to assess the degree of protection by maltose. Scion Image for Windows (Scion Corporation-http://www.scioncorp.com) was used to quantify the intensity of the ethidium bromide stained DNA bands from the inverse images of the gels (Reidler, 2000). The same assay was performed using sucrose, trehalose and glucose to compare the ability of maltose as a compatible solute. A time-course experiment was conducted

PAGE 34

24 where SspI was treated in the absence and in the presence of 400 mM maltose, glucose, sucrose and trehalose at 50C for 0, 5, 10, 15, 20 and 25 min. Lyophilized G6PDH from Leuconostoc mesenteroides was purchased from Worthington Biochemical Company. G6PDH in 50 mM Tris-HCl pH 7.8 was incubated at 48C for 15 min, which reduced activity by 50%. G6PDH in 50 mM Tris-HCl pH 7.8 was heated in the absence and presence of 14, 100, 200, and 400 mM maltose, trehalose, glucose and sucrose. The control did not include any sugar and was not given a heat treatment. The reaction (1.5 mL) included 2.97 mM MgCl 2 , 50 mM Tris-HCl pH 7.8, 0.6 mM beta-NADP + (freshly prepared), 10 mM Glc-6-P, and 595 ng heat shocked G6PDH. Production of NADPH was followed for 3 min at A 340 using a Lambda 3A UV/VIS spectrophotometer (PERKIN-ELMER). A time-course experiment was conducted where G6PDH was treated in the absence and in the presence of 400 mM maltose, glucose, sucrose and trehalose at 48C for 0, 5, 10, 15, 20 and 25 min. Lyophilized ADH from yeast 300 U/mg was purchased from Calbiochem. ADH in 50 mM potassium phosphate buffer pH 7.6 was exposed to 53.5C for 15 min with a loss of 50% activity. ADH in 50 mM potassium phosphate buffer pH 7.6 was heated in the absence and presence of 14, 100, 200, and 400 mM maltose, trehalose, glucose and sucrose. The control did not include any sugar and was not given a heat treatment. Reaction volume 1.5 mL included 333 mM EtOH, 50 mM potassium phosphate pH 7.6, 4.15 mM beta-NAD + (freshly prepared), and 500 ng heated ADH. Production of NADH was followed for 20 s at A 340 using a Lambda 3A UV/VIS spectrophotometer (PERKIN-ELMER). A time course experiment was conducted where ADH was treated in the

PAGE 35

25 absence and in the presence of 400 mM maltose, glucose, sucrose and trehalose at 53.5C for 0, 5, 10, 15, 20 and 25 min. Pea Chloroplast Isolation Pea seeds variety Progress #9 (J. W. Jung Seed Company) were soaked in flowing water for about 8 h before planting. The next day, seeds were planted in vermiculite and placed in a controlled environment at 18C + 2C, 150 mol m -2 s -1 PAR with a 12/12 light/dark cycle for 9-10 days. After 10 days, pea plants were subjected to cold shock 5C for 24 h and 40C for 30 min. Aerial portions of the plants were collected from 2 independent experiments and chloroplasts were immediately isolated. Pea chloroplasts were isolated according to Cline et al. (1993). Fifty g of aerial portions of 10 day-old pea seedlings were chopped into small pieces and placed into 200 mL of ice cold GR-buffer (50 mM Hepes/KOH pH 7.5, 0.33 M sorbitol, 1 mM MgCl 2, 1 mM MnCl 2, 2 mM EDTA, 5 mM Na-ascorbate, 1% BSA), and homogenized using a Polytron. The homogenate was filtered though one layer of miracloth and centrifuged at 2000 x g for 3 min in a swing-out rotor. The plastid containing pellet was resuspended in GR buffer, overlayed on a Percoll gradient and centrifuged at 2000 g for 15 min in a swing-out rotor. Intact plastids were collected, diluted three times with buffer (50 mM Hepes/KOH pH 8, 0.33 M sorbitol), and pelleted at 1500 x g for 5 min. The pellet was resuspended in 25 mL of buffer (50 mM HEPES/KOH pH 8, 0.33 M sorbitol) and chlorophyll content was quantified. Thylakoid Isolation Thylakoids were isolated according to Santarius (1996). The isolated chloroplasts were ruptured by resuspending them at 1 mg/mL in 10 mM Hepes/KOH, pH 8, 5 mM

PAGE 36

26 MgCl 2 , and incubating for 2 min on ice. Wash buffer 1:1 (70 mM KCl, 30 mM NaNO 3 , 20 mM K 2 SO 4 , 5 mM MgCl 2 , and 5 mM Hepes/KOH pH 7.5) was added and the mixture was centrifuged 3300 x g for 8 min in a swing-out rotor to collect thylakoid membranes. The pellet was washed at 1 mg/mL in wash buffer and centrifuged at 3300 x g for 8 min. Thylakoids were resuspended in wash buffer corresponding to 1 mg/mL chlorophyll. In Vitro Heat Shock and Freezing Stress of Electron Transport Chain Aliquots of 0.2 mL thylakoids in wash buffer (70 mM KCl, 30 mM NaNO 3 , 20 mM K 2 SO 4 , 5 mM MgCl 2 , and 5 mM Hepes/KOH pH 7.5) corresponding to 0.5 mg/mL chlorophyll were exposed to heat shock at 40C for 4 min and to freezing stress at -15C for 20 h in the absence and presence of 2.5, 14, 28, 56, and 112 mM maltose, glucose and trehalose. Full activity of the whole electron transport chain was measured after isolation of thylakoid membranes. Five independent experiments with 3 replications each were conducted for heat shock and 4 independent experiments with 3 replications each were done for freezing stress. The electron transport of thylakoids was followed by DCPIP reduction. Thylakoid reaction medium for electron transport measurements was prepared according to Allen and Holmes (1986). The assay buffer included 0.1 M sorbitol, 50 mM Hepes/KOH pH 7.6, 5 mM NaCl, 5 mM MgCl 2 , 0.1 mM DCPIP. The reaction was mixed after addition of thylakoid membranes corresponding to 25 g mL -1 chlorophyll and illuminated for 10 sec at 200 mol photons m -2 sec -1 light intensity to determine activity of the electron transport chain by following the reduction of the redox dye DCPIP at A 595 .

PAGE 37

27 Quick DNA Extraction for Knockout PCR Screening and RNAi Lines A small amount of a cotyledon (1 x 1 mm) from Arabidopsis seedlings was removed with forceps and placed into 50 L of DNA extraction buffer (100 mM Tris-HCl pH 9.5, 10 mM EDTA pH 8.0, and 1 M KCl), heated at 95C for 10 min and then cooled to room temperature. One L of this DNA extract was used as a template in a 25 L PCR reaction. PCR Screening of Knockouts Beta-amylase and alpha-amylase T-DNA insertion lines obtained from the Arabidopsis Biological Resource Center (Ohio) were screened by PCR using LBa1 (http://signal.salk.edu/tdnaprimers.html) primer and gene specific primers (Table 3-3). “Ready To Go” PCR Beads (Amersham Pharmacia Biotech) were used for screening. Each 25 L PCR included ~2.5 Unit Taq DNA polymerase, 10 mM Tris-HCl pH 9, 50 mM KCl, 1.5 mM MgCl 2 , 200 M each dNTP, stabilizers, BSA, and 0.4 M each gene specific forward and reverse primers. PCR amplification was carried out with a Stratagene Robocycler (Stratagene). The first PCR cycle was 95C for 5 min, 95C for 30 sec, 52C for 1 min, 72C for 1 min and the second cycle was 95C for 30 sec, 52C for 1 min, 72C for 1 min. The second cycle was repeated 45 times. The final cycle was 72C for 7 min. Afterwards, PCR products were kept at 5C. PCR products were fractionated in a 1% agarose gel. Gels were stained with ethidium bromide and digitally photographed with an Kodak Gel Logic 100 Imaging System (Kodak). Sequencing T-DNA Flanking Fragments T-DNA flanking fragments were gel purified using Wizard PCR Preps DNA Purification System (Promega), according to the manufacturer’ s protocol. Ten L big

PAGE 38

28 dye (ICBR Sequencing Core Lab) sequencing reaction was carried out, according to the manufacturers’ protocol using 3-10 ng PCR product, 5 pmol LBb1 sequencing primer (5’ GCGTGGACCGCTTGCTGCAACT 3’ obtained from SALK website http://signal.salk.edu/tdnaprimers.html) and 4 L big dye. PCR amplification was done using a Stratagene robocycler (Stratagene). The first cycle was 95C for 30 sec, 50C for 15 sec, 60C for 4 min. The first cycle was repeated 25 times. Resulting PCR product was ethanol precipitated, air dried and submitted for sequencing to ICBR sequencing core lab at the University of Florida. Table 3-3. Primers for PCR screening of knockout lines. MIPS Mutant Salk Primer Sequence 5' to 3' CG466 AAACCTACCACATTCACATACTCAA BMY1-1 SALK_004755 CG467 CTCGGAGAAGGGGAAGTTTT CG468 TTTTTTGGTTTTTTGTTCTTTCTC At4g15210 BMY1-2 SALK_032057 CG469 CATGATTGCTTGGATTTTGAGT CG472 TGGTCATAATCTCAAATCCTACTTC At3g23920 BMY7-1 SALK_039895 CG473 AAAGGCGATGAAAGCGAGT CG498 CCATGTGTTCAAAGCCAAAG At4g17090 BMY8-1 SALK_041214 CG499 TTTTAACCTTTTCACTTGTCACAC CG476 GGTTTAGTGATGGCGATTAGG At4g00490 BMY9-1 SALK_086084 CG477 CAGCCAAATCAACCAAACAC CG478 ACCAAAAGTTATCATATCTCTCTGC AMY1-1 SALK_058213 CG479 CCGACACTTTTTCCAATTGAG CG480 GGTGAATATAGACAAGAGTGAGAGAG At1g69830 AMY1-2 SALK_005044 CG481 AGCATTGAAAAAAGTGGGACA LBa1* T-DNA left border primer CG448 TGGTTCACGTAGTGGGCCATCG *This primer sequence was obtained from SALK website BMY8 RNAi Construct A unique 338 bp BMY8 sequence at the 3’end had been amplified by PCR using pfu polymerase (Stratagene) and gene specific primers (forward 5' CACCTGAGCACGCGAATTG 3’ and reverse 5' TCAGCGATCTTGCCTTTGAC 3'). The 338 bp DNA fragment was gel purified using Wizard PCR Preps DNA Purification

PAGE 39

29 System (Promega), then the fragment was directionally cloned into pENTR directional TOPO vector (Invitrogen), according to the manufacturer’s manual. The cloning reaction was used to transform electro-competent Escherichia. coli DH5 strain. E. coli strains were selected for kanamycin resistance and desired colonies were tested for the presence of BMY8 fragment using PCR amplification with the BMY8 gene-specific primers above. The hpRNA construct was done as described by Wesley et al. (2001). The pENTR directional TOPO vector with BMY8 fragment was mixed with pHellsgate 8 plasmid in the presence of Gateway LR clonase enzyme mix (Invitrogen) which promotes in vitro recombination between entry clone and destination clone resulting in a hairpin construct, according to manufacturer’s protocol. Then the mixture was transferred to DH5 E. coli strain by electroporation (BIO RAD), according to manufacturer’s protocol. The pHellsgate plasmid was extracted from spectinomycin resistant lines and digested with Xho1 and Xba1 for the presence of BMY8 fragment in the forward and reverse orientation to form hairpin structure. The desired plasmids were further confirmed by PCR using BMY8 specific primers for the presence of the BMY8 fragment. Afterwards, it was transformed to Agrobacterium (ABI strain) by electroporation, according to the manufacturer’s manual (BIORAD). Agrobacterium-mediated Transformation The floral dip method for Agrobacterium-mediated transformation was done as described by Clough and Bent (1998). PCR Screening BMY8 RNAi Lines Seeds were harvested from plants that were subjected to floral dip method and grown on an MS medium with 50 mg/L kanamycin and 100 mg/L carbenicillin. The kanamycin resistant plants were screened by PCR using pHellsgate specific primers

PAGE 40

30 which are designed either side of the BMY8 fragment (forward 5' GTTCCAACCACGTCTTCAAAG 3’ and reverse 5' TTCTTCGTCTTACACATCACTTG 3') in order to determine that plants have the BMY8 RNAi fragment. “Ready To Go” PCR Beads (Amersham Pharmacia Biotech) were used for PCR described in “PCR screening of knockouts.” Seeds were collected for further analysis from plants that were resistant to kanamycin and contained BMY8 the fragment. Starch Screening for BMY8 RNAi Lines Leaf staining for starch was used to quickly screen BMY8 RNAi lines. Leaf samples were taken 2 h after the lights were turned on from 9 lines of BMY8 RNAi lines with 8 plants each. Mature fully-expanded leaves were decolorized with 80% ethanol at 80C for about 10-15 min. The leaves were then gently washed with water, stained with .2 % iodine-potassium iodide” for 30 sec, gently washed to remove excess iodine, and placed on a plastic petri dish for visual inspection and photography. Freezing Stress WT, knockout and BMY8 RNAi lines were grown on sucrose free MS medium (for BMY8 RNAi lines this medium was supplemented with 50 mg/L kanamycin and 100 mg/L carbenicillin), stratified 3 days at 4C, and placed in a controlled environment. Seven days later seedlings were transferred to soil and grown for another 20 days. Plants with cold shock (at 4C for 6 h) or without a cold shock were rapidly harvested 2 h after the onset of light period, wrapped in water saturated tissue paper, placed in a test tube, then placed in a controlled temperature bath (Forma Scientific model 2425) and equilibrated for 30 min at 0C. Then a chip of ice was placed in contact with the tissue paper and the temperature was lowered at a rate of 2C h -1 . Tubes were removed at 30

PAGE 41

31 min intervals, placed on ice and allowed to thaw overnight at 4C. The next day, chlorophyll fluorescence and electrolyte leakage measurements were done. Three independent experiments for 20C grown plants and one experiment for cold shocked plants were done. Each experiment contained 6 replications, each from a different plant. Chlorophyll Fluorescence Chlorophyll fluorescence parameters were measured with the Plant Efficiency Analyzer (Hansatech Instruments) after a 10 min dark adaptation period. Readings were taken over a 5 sec interval after exposure at 100 % illumination level (approx. 3000 mols m -2 s -1 peak wavelength 650 nm) by high intensity light emitting diodes and 4 mm in diameter leaf area was illuminated. Six replicates, each from a different plant, were averaged for each time point. Variable fluorescence, Fv, was determined as the difference between the maximal fluorescence signal, Fm, and the initial darkness fluorescence level, Fo. Electrolyte Leakage Measurements Electrolyte leakage of the aerial portions of the plants was measured according to Sung and Guy (2003). After freezing stress treatment, aerial portions of plants were placed in scintillation vials containing 10 mL distilled water and shaken for 1 hr. After the first reading the tissue were exposed to a 2 min microwaving at high setting to destroy all living cells. After cooling to room temperature, the second readings were taken and the LT 50 determined.

PAGE 42

CHAPTER 4 RESULTS Heat and Cold Shock Elicit Specific Beta-Amylase Gene Induction A step-up and step-down experiment was performed to determine how temperature influences beta-amylase expression. Plants were exposed to temperatures in a single step from 20C to 45C for 1 h in 5C increments in the step-up experiment (Figure 4-1) . For the step-down experiment, plants were exposed to temperatures in a single step from 20C to 0C for 12 h in 5C decrements (Figure 4-1). The different exposure times for the step-up and step-down treatments were approximated in part to equalize the influence of the temperature differential on kinetics based on the Arrhenius equation relationship for respiratory processes (Yelenosky and Guy, 1977) for the temperature extremes of 40 and 5C. Gene-specific transcript levels were evaluated by RT-PCR. Hsp70 (At3g12580) was used as a control for the heat treatment, and its transcript gradually increased as temperature increased (Figure 4-1). Likewise, Cor78/rd29A (At5g52310) was used as a control for the cold shock treatment and its transcript level showed slight induction at 10C and strong induction at 5C and 0C (Figure 4-1). The chloroplast-targeted beta-amylase (ct-bmy, BMY8) (Figure 4-1) showed the greatest transcript accumulation at 5C and 0C increasing by 15and 13-fold, respectively. Transcript level was more modestly increased at 10C; approximately 7-fold. During heat shock, transcript level was unchanged. Conversely, the mRNA levels of another putative chloroplast-targeted beta-amylase (BMY7) was increased at 40C and 45C; 11and 8-fold, respectively. BMY7 transcript level did not change in response to cold shock temperatures down to 0C. A 32

PAGE 43

33 third predicted chloroplast-localized beta-amylase (BMY9) did not exhibit temperature-regulated modulation of expression, but instead was expressed at all temperatures from 45C to 0C. The vacuolar form accounts for the major beta-amylase activity in Arabidopsis tissues. Steady state mRNA level of the vacuolar form (BMY1) was largely unchanged during heat stress, except at 45C where its mRNA became undetectable. Transcript level of BMY1 during cold shock decreased 5-fold at 10C and 5C, and became undetectable at 0C. To determine whether modulation of BMY7 and 8 transcript levels is a general stress response of genes for starch degrading enzymes, transcript profiles for key enzymes in starch degradation pathways were examined in the step-up and step-down RT-PCR experiments (Figure 4-1). Alpha-amylase (AMY1) was repressed 3-fold at 40C and 5-fold at 45C; however, its transcript level was only increased 2-fold at 10C and 5C. Phosphorylase b (Phos b) transcript level was unchanged under heat shock and decreased 5-fold at 5C and 0C. Debranching enzyme, or isoamylase (IMY), mRNA levels were decreased 4-fold at 45C, but unchanged at all other heat shock temperatures. During cold shock, IMY mRNA level was unchanged except at 0C where it was decreased 3-fold. Therefore, the expression patterns of BMY7 and 8 under a variety of heat (from 20C to 45C) and cold (from 20C to 0C) shock temperatures appear to involve specific responses relative to other genes of starch degradation pathways. Sucrose phosphate synthase (SPS) and delta-1-pyroline 5-carboxylase synthetase (P5CS) transcript profiles were also compared with beta-amylase transcript patterns because their transcripts were known to accumulate during exposure to cold shock

PAGE 44

34 BMY8BMY7BMY9BMY1AMYPhosbIMYSPSP5CSHsp70Cor78 Heat Shock (1 h) 45 40 35 30 25 20 Temperature (C) Cold Shock (12 h) 20 15 10 5 0 Temperature (C) BMY8BMY7BMY9BMY1AMYPhosbIMYSPSP5CSHsp70Cor78 Heat Shock (1 h) 45 40 35 30 25 20 Temperature (C) Cold Shock (12 h) 20 15 10 5 0 Temperature (C) Figure 4-1. RT-PCR analysis of selected genes following heat and cold shock. Sixteen day-old Arabidopsis plants were grown at 20C and exposed to heat shock at 25, 30, 35, 40 and 45C for 1 h and cold shock at 15, 10, 5, and 0C for 12 h. Control plants were kept at 20C. The arrow heads indicate the 18S rRNA internal control. Representative images are shown from one of the 3 experiments. BMY1 beta-amylase 1 (At4g15210); BMY7, beta-amylase 7 (At3g23920); BMY8, beta-amylase 8 (At4g17090); BMY9, beta-amylase 9 (At4g00490); AMY, alpha-amylase (At1g69830); IMY, isoamylase (At2g39930); Phos b, phosphorylase b (At3g29320); P5CS, delta-1-pyrroline 5-carboxylase synthetase (At2g39795); SPS, sucrose-phosphate synthase (AL391222); Hsp70, heat shock protein 70 (At3g12580); Cor78, low-temperature-induced protein 78 (At5g52310); 18S rRNA (At3g41768).

PAGE 45

35 temperatures. When the temperature was lowered, SPS transcript level increased (Figure 4-1); 3-, 7-, and 10-fold at 10C, 5C, and 0C, respectively. During heat shock, SPS transcript level was slightly increased. P5CS transcript level was decreased 2.5-fold during cold shock, but its transcript level was unchanged during heat shock, except for a slight decrease at 40C and 45C (Figure 4-1). Beta-amylase Transcript Accumulation is Correlated with Maltose Accumulation Based on step-up and step-down experiments, increase in beta-amylase transcripts was found to be greatest at 40C and 5C. A time course RT-PCR (Figure 4-2A) study was done to determine the induction kinetics for the beta-amylases upon exposure to heat and cold stress. Confirming the previous RT-PCR analysis, under cold shock at 5C, BMY8 transcript level was increased dramatically as early as 6 h and peaked at 24 h, then gradually decreased, but remained higher than control levels at 192 h. BMY8 transcript level during heat shock at 40C was reduced after 30 min. In contrast, BMY7 transcript level peaked at 60 min of exposure to 40C and then decreased. It did not show any significant change in transcript levels in response to cold shock. At 5C, BMY7 transcript level seemed to be increased at 6 h; however, this response was seen only in one replication out of the three (Figure 4-2A). In agreement with the step-up and step-down experiment, BMY9 failed to show significant changes in transcript levels during heat shock, but BMY1 transcript level was increased 7-fold at 2 and 4 hr of heat shock. Transcript level of BMY9 and BMY1 was unaffected by cold shock (Figure 4-2A). Hsp70 was used as a control for the heat treatment and its transcript level peaked at 30-60 min upon exposure to 40C. Under cold shock conditions, Hsp70 also exhibited a slight induction until 24 h, when its transcript became undetectable. Cor 78/rd29A was used as

PAGE 46

36 Heat Shock at 40C240 120 90 60 30 0Cold Shock at 5C Time Course (min)Time Course (h) 0 6 12 24 48 96 192 BMY8BMY9BMY1Hsp70Cor78BMY7 A BMY9BMY7 BCTime Course (min)Time Course (h) 0.00.40.81.20612244896192 0.00.40.81.22401209060300Fold Change in Total -amylase ActivityHeat Shock at 40C240 120 90 60 30 0Cold Shock at 5C Time Course (min)Time Course (h) 0 6 12 24 48 96 192 BMY8BMY9BMY1Hsp70Cor78BMY7 A BMY9BMY7 BMY9BMY7 BCTime Course (min)Time Course (h) 0.00.40.81.20612244896192 0.00.40.81.22401209060300Fold Change in Total -amylase ActivityTime Course (min)Time Course (h) 0.00.40.81.20612244896192 0.00.40.81.22401209060300Fold Change in Total -amylase Activity Figure 4-2. Expression profiles of beta-amylases. A) Time course study of RT-PCR analysis of selected beta-amylase genes under heat and cold shock. The arrow heads indicate the 18S rRNA internal control. B) Immuno blot of BMY7 and 9. C) Total beta-amylase activity. Error bars represents standard deviation of mean of three experiments. Eighteen-day old Arabidopsis plants grown at 20C were exposed to 40C for 0, 30, 60, 120 and 240 min for heat shock and to 5C for 0, 6, 24, 48, 96 and 192 h. Controls were kept at 20C. Representative images are shown from one of the three experiments.

PAGE 47

37 a cold shock treatment control. It showed a very similar transcript profile to BMY8 during cold shock, but no significant changes in response to heat shock conditions. Beta-amylase protein levels were analyzed to determine whether a correlation between protein abundance and gene expression profiles existed. Monoclonal antibodies (Mab) specific for unique beta-amylase C-terminal sequences of BMY7 and BMY9 were prepared using synthetic peptides. Selected monoclonal antibodies were tested for their specificity against recombinant GST beta-amylase proteins (Figure 4-3). Monoclonal antibodies specific for BMY7 and 9 and a polyclonal mouse serum that recognized all three BMY7, 8 and 9 proteins were used for western analysis. Protein levels were found to be very low for BMY7, 8 and 9. BMY7 protein levels gradually decreased in response to heat shock, and remained constant under cold shock paralleling its expression profile (Figure 4-2B). BMY9 protein levels remained unchanged in response to heat and cold E.coliBMY9BMY7BMY8E.coliBMY9BMY7BMY8 BMY7 (4F5-5G10)BMY9 (3H10-3D6)AB E.coliBMY9BMY7BMY8E.coliBMY9BMY7BMY8 BMY7 (4F5-5G10)BMY9 (3H10-3D6)AB Figure 4-3. Specificity of BMY7 and BMY9 monoclonal antibodies (Mab). A) BMY7 Mab tested for cross reactivity against E. coli (negative control) proteins, BMY8 and BMY9 GST fusion proteins. BMY7 Mab did not cross react with BMY8 and BMY9. B) BMY9 Mab tested for cross reactivity against E. coli (negative control) proteins, BMY8 and BMY7 GST fusion proteins. BMY9 Mab did not cross react with BMY8 and 7. The signal in BMY8 line in A and B is water drop artifact.

PAGE 48

38 shock also mirroring expression patterns (Figure 4-2B). Unfortunately, informative western blots were not obtained for BMY8 proteins levels using the polyclonal mouse serum. Total leaf beta-amylase enzyme activity was measured to distinguish whether activity is correlated with changes in beta-amylase gene expression. Total leaf beta-amylase enzyme activity remained constant during heat and cold shock conditions (Figure 4-2C). To rule out the possibility that changes in chloroplastic beta-amylase activity, which is considered to be about 10% of the total, may have been obscured in total beta-amylase activity measurements, pea chloroplasts were isolated to determine the influence of temperature on chloroplastic beta-amylase activity. Pea plants were heat shocked at 40C for 30 min and cold shocked at 5C for 24 h and chloroplasts isolated in 3 h. Total pea chloroplastic beta-amylase activity did not show any striking change in response to heat or cold shock (two replications done for each treatment and data not shown). Leaf tissue maltose content (Figure 4-4) was measured to determine whether maltose accumulation paralleled changes in beta-amylase expression. Soluble sugar analysis revealed that maltose content doubled from 0.06 to 0.14 mol mg -1 Chl within 30 min exposure to 40C, remained constant until 60 min, and then decreased back to control levels at 4 h. During cold shock, the maltose content showed a dramatic increase from 0.04 (control) to 0.60 mol mg -1 Chl in the first 6 h then continued to accumulate to 0.80 mol mg -1 Chl by 48 h. Afterward maltose decreased to 0.11 mol mg -1 Chl by 192 h. The maltose accumulation profile (Figure 4-4) was similar to that of sucrose, glucose and fructose. Given that the concentrations of a number of soluble sugars were altered in

PAGE 49

39 0.000.020.040.060.080.100.120.14 Time Course(min) 05101520253035 0481216 0.000.100.200.300.400.500.600.70 0.00.40.81.21.6 Time Course(h) 0.000.050.100.150.200.250.300.350.402401209060300 0.000.501.001.502.002.503.003.504.000612244896192 Heat Shock at 40CCold Shock at 5C 0.000.050.100.150.20 0.00.30.60.91.21.5 0510152025 Starch mg mg-1ChlTrehalosemol mg-1ChlFructose mol mg-1ChlSucrose mol mg-1ChlGlucose mol mg-1ChlMaltose mol mg-1Chl 01234567 0.000.150.300.450.60 0.000.020.040.060.080.100.120.14 Time Course(min) 05101520253035 0481216 0.000.100.200.300.400.500.600.70 0.00.40.81.21.6 Time Course(h) 0.000.050.100.150.200.250.300.350.402401209060300 0.000.501.001.502.002.503.003.504.000612244896192 Heat Shock at 40CCold Shock at 5C 0.000.050.100.150.20 0.00.30.60.91.21.5 0510152025 Starch mg mg-1ChlTrehalosemol mg-1ChlFructose mol mg-1ChlSucrose mol mg-1ChlGlucose mol mg-1ChlMaltose mol mg-1Chl 01234567 0.000.150.300.450.60 Figure 4-4. Carbohydrate profiles of heat and cold shock time course. Eighteen-day old Arabidopsis plants were grown at 20C then exposed to 40C for 0, 30, 60, 120 and 240 min for heat shock and to 5C for 0, 6, 24, 48, 96 and 192 h. Control plants were kept at 20C. Error bars indicate standard deviation ( + SD) of the mean for three experiments.

PAGE 50

40 response to temperature shock, the proportion of maltose at 30 min of heat shock and at 6 h of cold shock was increased relative to the total soluble sugar content. Interestingly, when total soluble sugar content began decreasing, trehalose content began increasing about 96 h after cold shock. In contrast, trehalose content slightly decreased after 90 min of exposure to heat shock. To determine whether maltose accumulates within chloroplasts during temperature stress, intact chloroplasts needed to be isolated. Most species, including Arabidopsis, are not well suited for isolation of intact chloroplasts. Currently, pea and spinach are widely used for intact chloroplast isolation. Therefore, as a proxy for Arabidopsis, we chose to study isolated pea chloroplast. Intact chloroplasts were isolated from 10 day-old pea leaves exposed to 40C for 30 min or to 5C for 24 h, and glucose, trehalose, fructose, and maltose contents were determined (Table 4-1). After 24 h at 5C, maltose content in pea chloroplasts was about 2.5-fold greater than chloroplasts from 20C grown seedlings, but under heat shock, a change in maltose content was not detected. Table 4-1. Soluble sugar content of the isolated pea chloroplast Treatment Maltose Glucose Fructose Trehalose nmol mg -1 Chl nmol mg -1 Chl nmol mg -1 Chl nmol mg -1 Chl Control 18C 2 + 1 17 + 5 5 + 3 1 + 1 Cold Shock 5C 24 h 5 + 1 46 + 11 15 + 2 2 + 1 Heat Shock 40C 30 min 1 + 0 28 + 4 11 + 5 2 + 1 Starch content (Figure 4-4) was determined to better understand its relationship with maltose accumulation. Starch content increased with time and was correlated with accumulation of maltose at about 48 h of cold shock. Conversely, during heat shock, starch content decreased over time from 0.15 to 0.04 mg mg -1 Chl. The decrease in starch content could be related to accelerated metabolism due to elevated temperature.

PAGE 51

41 Maltose Has Compatible Solute Properties Compatible solutes stabilize proteins and membranes, and contribute to cell osmotic potential during stress. The compatible solute properties of maltose were tested for three different enzymes; SspI, glucose 6 phosphate dehydrogenase (G6PDH) and alcohol dehydrogenase (ADH). The restriction enzyme, SspI (Figure4-5A, lane C), cleaves the substrate plasmid (pGEX-4T-2; 4.97 kb, Pharmacia Biotech.) twice leading to 1 and 4 kb plasmid fragments when the enzyme is fully functional. If the enzyme is compromised by high temperature, it does not completely digest the plasmid, but produces a singly cleaved plasmid fragment of 5 kb (top band), and double cut fragments of 1 and 4 kb (Figure 4-5A, lane 0 mM sugars). As a result, 3 bands are produced instead of 2. We considered that when the intensity of the 5 kb band (singly cleaved) and the 4 kb band was equal, the enzyme had lost 50% activity. Ssp1 was exposed to 50C for 15 min (Figure4-5A) in the absence of maltose (0 mM as a control) and in the presence of (14, 100, 200, and 400 mM) maltose. The 5 kb band, which represented the loss of activity, was quantified to determine relative protection. When the enzyme was fully active, the 5 kb band was not visible (Figure 4-5A lane C), but its intensity increased with loss of enzyme activity (lane 2; 0 mM sugars). At an estimated physiological concentration (14 mM), maltose was able to partially protect SspI function. Not surprisingly, this protection increased with increasing maltose concentration (Figure 4-5A). At 200 and 400 mM, the intensity of the top band was much reduced compared to 0 mM maltose. Besides maltose, identical concentrations of sucrose, trehalose and glucose were also tested to compare the performance of maltose as a compatible solute (Figure 4-5A).

PAGE 52

42 Maltose performed as well as trehalose at physiological concentration. At 200 mM, trehalose provided 100% protection, while maltose gave 80-90% protection. At 400 mM glucose, trehalose, and sucrose showed 100% protection, while maltose showed 85-90% protection. In addition, protection of SspI activity (Figure 4-6A) in the presence of soluble sugars; maltose, trehalose, glucose and sucrose (400 mM), can be maintained for at least 25 min at 50C, while in the absence of sugars the enzyme lost almost 90% of its activity over this time. Again trehalose, glucose and sucrose show 100% protection, while maltose shows approximately 90% protection. % Protection 0102030405060014100200400 Maltose Glucose Sucrose Trehalose G6PDH at 48C for 15 min 0102030405060014100200400 Maltose Glucose Sucrose Trehalose ADH at 53.5C for 15 min% ProtectionSugar Concentration (mM)MaltoseC014100200Glucose 4CSspIat 50C for 15 min Trehalose Sucrose 400 mMC014100200 4CSspIat 50C for 15 min 400 mMABC% Protection 0102030405060014100200400 Maltose Glucose Sucrose Trehalose G6PDH at 48C for 15 min% Protection 0102030405060014100200400 Maltose Glucose Sucrose Trehalose G6PDH at 48C for 15 min 0102030405060014100200400 Maltose Glucose Sucrose Trehalose ADH at 53.5C for 15 min% ProtectionSugar Concentration (mM)MaltoseC014100200Glucose 4CSspIat 50C for 15 min Trehalose Sucrose 400 mMC014100200 4CSspIat 50C for 15 min 400 mMAMaltoseC014100200Glucose 4CSspIat 50C for 15 min Trehalose Sucrose 400 mMC014100200 4CSspIat 50C for 15 min 400 mMABC Figure 4-5. In vitro compatible solute assay for three enzymes. SspI, G6PDH, and ADH were exposed to heat shock for 15 min in the absence and presence of a variety of concentrations of maltose, glucose, sucrose and trehalose. A) SspI. SspI cleaves double stranded DNA. In this assay, functional SspI cuts the pGEX-4T-2 plasmid twice to produce two bands 3.77 kb and 1.19 kb. Heat damaged SspI cuts the plasmid only once to yield a 5 kb open circle (top band). Protection of the enzyme by soluble sugars is indicated by a reduction in the intensity of the 5 kb band. B) G6PDH. C) ADH.

PAGE 53

43 % ProtectionRate of A340increase min-1 0102030405060708090510152025 0.0000.0500.1000.1500.2000.2500.3000.3500510152025 Control Maltose Glucose Sucrose Trehalose G6PDH at 48C Time Course (min) 0102030405060708090510152025 0.0000.0500.1000.1500.2000.2500510152025 Control Maltose Glucose Sucrose Trehalose Time Course (min)ADH at 53.5C% ProtectionRate of A340increase min-1 Control0510152025 min Time Course at 50C Maltose TrehaloseGlucose Sucrose Control0510152025 min Time Course at 50C Maltose TrehaloseGlucose Sucrose ABC% ProtectionRate of A340increase min-1 0102030405060708090510152025 0.0000.0500.1000.1500.2000.2500.3000.3500510152025 Control Maltose Glucose Sucrose Trehalose G6PDH at 48C Time Course (min) 0102030405060708090510152025 0.0000.0500.1000.1500.2000.2500510152025 Control Maltose Glucose Sucrose Trehalose Time Course (min)ADH at 53.5C% ProtectionRate of A340increase min-1 Control0510152025 min Time Course at 50C Maltose TrehaloseGlucose Sucrose Control0510152025 min Time Course at 50C Maltose TrehaloseGlucose Sucrose ABC Figure 4-6. In vitro time course compatible solute assay for three enzymes. SspI, G6PDH, and ADH were exposed to heat shock for 25 min in the absence and presence of 400 mM maltose, glucose, sucrose and trehalose. A) SspI, arrowheads show the 1, 4 and 5 kb bands. B) G6PDH. C) ADH. To test whether this protection was general, compatible solute assays were done using G6PDH, which uses D-Glc-6-P and NAD(P) + as substrates to produce D-glucono--lactone-P and NAD(P)H. Maltose performed as well as the other compatible solute

PAGE 54

44 sugars even at estimated physiological concentration (Figure 4-5B). The same performance was seen (Figure 4-6B), when the time was extended to 25 min in the presence of 400 mM of the above sugars. ADH utilizes RCH 2 OH and NAD + as substrates to produce RCHO, NADH and H + in a reversible reaction. ADH was heat stressed (Figure 4-5C) in the absence and presence of 14, 100, 200, and 400 mM maltose, glucose, trehalose, and sucrose. As in the SspI and G6PDH compatible solute assays, maltose showed an equal level of protection for ADH. The same was true when the time was extended to 25 min at 53.5C (Figure 4-6C). Maltose Can Function as a Chloroplast Stromal Compatible Solute In Vitro Maltose was tested in vitro for compatible solute properties using thylakoid membranes for the functionality of the electron transport chain against heat denaturation (Figure 4-7) and freezing stress (Figure 4-8). Maltose was compared with trehalose and glucose. Pea thylakoids were exposed to 40C for 4 min (Figure 4-7), where 30% of electron transport chain activity remained in the absence of compatible solute sugars. Electron transport chain activity was followed by reduction of the redox dye 2,6-dichlorophenolindophenol (DCPIP), which accepts electrons from Q B of PSII and FeS A of PSI (Hder and Tevini, 1987). Photosynthetic electron transport chain activity was protected 3% and 5% at physiological concentrations of 2.5 and 14 mM maltose, respectively, during heat shock. When the concentration of maltose increased further, electron transport activity was preserved up to 45% at 112 mM. This level of protection was very comparable to trehalose at the same concentration. Glucose showed 30% protection at 112 mM.

PAGE 55

45 010203040506002.5142856112 Maltose Glucose Trehalose Sugar Concentration (mM)% Protection 010203040506002.5142856112 Maltose Glucose Trehalose Sugar Concentration (mM)% Protection Figure 4-7. Electron transport chain activity of isolated thylakoids in the absence and presence of soluble sugars during heat shock at 40C for 4 min. Electron transport was evaluated by DCPIP reduction. 02040608010012002.5142856112 Maltose Glucose Trehalose Sugar Concentration (mM)% Protection 02040608010012002.5142856112 Maltose Glucose Trehalose Sugar Concentration (mM)% Protection Figure 4-8. Electron transport chain activity of isolated thylakoids in the absence and presence of soluble sugars following freezing stress at -15C for 20 h. Electron transport was evaluated by DCPIP reduction. Pea thylakoids were frozen (Figure 4-8) at -15C for 20 h, which caused a 60% reduction of electron transport chain activity. Similar to heat shock, protection by maltose was seen at physiologically relevant maltose concentrations 2.5 and 14 mM

PAGE 56

46 preserving 2 and 24% activity, respectively. This protection increased gradually to 93% with the increasing concentration of maltose and was very similar to that of trehalose. Glucose concentration at 112 mM gave 47% protection, which was much less than that of maltose or trehalose. Initial Characterization of Betaand Alpha-Amylase T-DNA Insertional Lines A very good correlation was observed between increased beta-amylase transcript and increased maltose content during cold and heat shock. In vitro assay showed that maltose can protect proteins and. In order to determine whether maltose has a contribution in the protection of the photosynthetic electron transport in vivo, seeds of T-DNA insertion lines of beta-amylases (BMY1, BMY7, BMY8, BMY9) and alpha-amylase (AMY1) were obtained (Table 4-1) from the Arabidopsis biological resource center (ABRC). Beta-amylase and alpha-amylase T-DNA insertion lines were screened by PCR using a T-DNA specific primer (LBa1) (http://signal.salk.edu/tdnaprimers.html), and gene specific primers for the presence of the T-DNA insertion (Figure 4-9A) to identify homozygous or hemizygous plants. Amplified T-DNA flanking sequences were sequenced using a T-DNA specific primer (LBb1) (http://signal.salk.edu/tdnaprimers.html) to verify the insertion site. T-DNA insertion sites were either at the same location as reported or 30 to 40 bp upstream of the reported region on the SALK website, except for BMY1-1 and AMY 1-1. The T-DNA insertion for BMY1-1 was located in the intron instead of the exon and for AMY 1-1 in the promoter instead of exon (Table 4-2).

PAGE 57

47 Table 4-2. Knockout lines for beta-amylases and alpha-amylase verified by PCR MIPS Mutant Salk ID T-DNA location and orientation Expression BMY1-1R SALK_004755 Intron Reverse Expressed At4g15210 BMY1-2K SALK_032057 Exon Forward No expression At3g23920 BMY7-1L SALK_039895 Exon Reverse No expression At4g17090 BMY8-1G SALK_041214 Promoter Forward Expressed At4g00490 BMY9-1H SALK_086084 Exon Forward No expression AMY1-1O SALK_058213 Promoter 2 T-DNA insertions Forward and Reverse Expressed At1g69830 AMY1-2B SALK_005044 Exon Forward No expression BMY7-1LBMY1-1RBMY1-2KAMY1-1OAMY1-2BWTWT WT WT WT WT BMY9-1HBMY8-1GWT 18S rRNA BMY7-1BMY8-1BMY9-1BMY1-1BMY1-2AMY1-1AMY1-2 T-DNA InsertionWT ABBMY7-1LBMY1-1RBMY1-2KAMY1-1OAMY1-2BWTWT WT WT WT WT BMY9-1HBMY8-1GWT 18S rRNA BMY7-1BMY8-1BMY9-1BMY1-1BMY1-2AMY1-1AMY1-2 T-DNA InsertionWT AB Figure 4-9. Characterization of beta-and alpha-amylase T-DNA insertional lines. A) PCR screening for the T-DNA insertion. Upper band is T-DNA insertion fragment and lower band is WT fragment. Representative images are shown from one of the 17 plants for each knockout line. B) RT-PCR for the presence and absence of the gene expression. Arrow head show 18S rRNA for the equal loading and also to show that the RT-PCR reaction worked. The absence of the target gene amplicon is due to lack of gene expression. RT-PCR analysis was done using gene specific primers to verify that T-DNA insertion had disrupted gene expression. In this RT-PCR analysis (Figure 4-9B), amplification was saturated at 45 PCR cycles to detect transcripts, even if they were

PAGE 58

48 present in low abundance. Based on RT-PCR results (Figure 4-9B), BMY7-1L, BMY9-1H, BMY1-2K, and AMY1-2B gene expression were abolished. However, BMY8-1G, BMY1-1R and AMY1-1O transcripts were still present. To determine whether transcript levels were reduced in BMY8-1G and AMY1-1O T-DNA insertion lines, a quantitative RT-PCR analysis was performed. Based on quantitative RT-PCR results, AMY1-1O and BMY8-1G expression levels were the same as WT levels (data not shown). Therefore the BMY8 insertion line was not considered for further analysis. Because there were no other knock-out lines available for BMY8, an RNAi approach was chosen to knock-out or lower BMY8 expression. Carbohydrate Profiles of T-DNA Insertional Lines Maltose content was measured (Figure 4-10) by HPLC to determine whether abolishing gene expression for beta-and alpha-amylases had any influence on maltose accumulation during cold shock. As expected, maltose content was not significantly different in T-DNA insertional lines when plants were grown at 20C, based on ttest (p < 0.05). When plants were cold shocked for 6 h, overall maltose content was slightly lower in alpha-and beta-amylase T-DNA insertional lines than that of in WT, except for BMY7-1L which had similar maltose levels to WT; however, the change did not reach a statistically significant level (t-test p < 0.05). Maltose is involved in the production of glucose and sucrose (Lu and Sharkey, 2004; Sharkey et al., 2004, Weise et al., 2004) during starch degradation. In order to determine whether changes in maltose accumulation influenced the other sugars, glucose, fructose and sucrose levels were determined 20C grown and cold shocked for 6 h at 4C plants. Consistent with maltose levels, sucrose, glucose, fructose contents of T-DNA insertional lines (Figure 4-10) were comparible to WT levels at 20C; however, their

PAGE 59

49 levels were slightly lower when cold shocked. The reduction in glucose and fructose levels were statistically significant in BMY1-2 K and AMY1-1O (t-test p < 0.05), but not in sucrose. The slight reduction in glucose, fructose and sucrose levels did not reach statistically significant levels (t-test p < 0.05) in BM7-1, BMY9-1 and AMY1-1O. Because alphaand beta-amylases are involved in starch degradation, starch content was quantified to determine whether lack of expression of the alphaand beta-amylases influenced starch content. Based on t-test (p < 0.05), BMY7-1L and BMY9-1H did not show significant differences in their starch content compared with WT (Figure 4-9). However, BMY1-2K and AMY1-2B showed about twice as much starch as WT plants (Figure 4-10) and AMY1-1O was almost significant with a p < 0.06. When plants were cold shocked for 6 h, WT and knock-out plants increased starch content and the BMY1-2K and AMY1-2B plants maintained high starch content compared with WT. Isolation and Initial Screening of BMY8 RNAi Lines Seeds obtained from Agrobacterium-mediated transformed plants were selected on MS medium containing 50 mg/L kanamycin. The 17 kanamycin resistant lines were screened for the presence of the transgene using plasmid specific primers by PCR. Only 9 transgenic lines produced the expected 652 bp fragment (338 bp unique BMY8 sequence at the 3’end and 314 bp plasmid-specific) (Figure 4-11A). The signal intensity in Figure 4-11A should not be interpreted as more insertions because the amount of DNA in each PCR reaction is not equal.

PAGE 60

50 02468WTBMY7-1LBMY9-1HBMY1-2KAMY1-2BAMY1-1OStarchugmg-1DW Control at 20C Cold Shock at 4C for 6 h 01020304050Glucose nmolmg-1DW 02468Fructosenmolmg-1DW 07142128Sucrosenmolmg-1DW 0.00.40.81.21.6Maltosenmolmg-1DW 02468WTBMY7-1LBMY9-1HBMY1-2KAMY1-2BAMY1-1OStarchugmg-1DW Control at 20C Cold Shock at 4C for 6 h Control at 20C Cold Shock at 4C for 6 h 01020304050Glucose nmolmg-1DW 02468Fructosenmolmg-1DW 07142128Sucrosenmolmg-1DW 0.00.40.81.21.6Maltosenmolmg-1DW Figure 4-10. Carbohydrate profiles of 18-day-old alphaand beta-amylase knockout plants. Soluble sugar concentrations in samples were calculated as lactose equivalent using lactose as an internal reference accounting for sample loss and drift of detector responses. Error bars indicate standard deviation ( + SD) of the mean for three experiments. BMY1-2K, AMY1-2B (p < 0.05), and AMY1-1O (p < 0.065) have significantly higher starch content based on t-test.

PAGE 61

51 Because beta-amylase is involved in starch degradation, knocking out beta-amylase gene expression should cause starch accumulation. To screen transgenic lines that have impaired beta-amylase activity, leaf starch was visualized in the 9 transgenic lines. Various degrees of starch accumulation were observed (Figure 4-11B). We also looked at the T1 segregation profile for kanamycin resistance in 3 of the high starch ~3:1166606772C133:133810061344C143:138812201608C5RatioWTRNAiTotalLinesSegregation of T1 generation ~3:1166606772C133:133810061344C143:138812201608C5RatioWTRNAiTotalLinesSegregation of T1 generation BMY8BMY7BMY9WTC5C 14 WTC2C5C9C12C13C14C16C15C17BMY8 RNAilines ABCDBMY8BMY7BMY9WTC5C 14 WTC2C5C9C12C13C14C16C15C17BMY8 RNAilines AB WTC2C5C9C12C13C14C16C15C17BMY8 RNAilines ABCD Figure 4-11. Characterization of BMY8 RNAi lines. A) PCR screening of kanamycin resistant transgenic lines for the presence of transgene using plasmid pHELLSGATE 8 specific primers. B) Leaf starch staining. Representative images are shown from one of 8 leaves each from different plants for each transgenic line. C) Plants were grown on sucrose free MS medium supplemented with 50 mg/L kanamycin. Transgenic lines were kanamycin resistant and WT segregating lines were kanamycin sensitive. D) Quantitative RT-PCR for C5 and C14 transgenic lines. Arrow head shows the 18S rRNA for loading control.

PAGE 62

52 accumulating lines (C5, C13 and C14) to determine whether the phenotype resulted from a single insertion. The C5, C13 and C14 lines each showed a 3:1 segregation (Figure 4-11C) suggesting that each contained a single insertion. Quantitative RT-PCR analysis was done to confirm that BMY expression was reduced in the starch accumulation lines C5 and C14. Based on RT-PCR results, BMY8 expression was decreased in the RNAi lines C5 and C14 (Figure 4-11D). To rule out the possibility that the increased starch content was due to decreased expression of the other beta-amylases, we looked at the expression of BMY7 and BMY9, two beta-amylases that possess putative transit peptide sequences for chloroplast targeting. Based on the RT-PCR results (Figure 4-11D), BMY9 transcript was not affected by the BMY8 RNAi construct, and BMY7 transcript appeared to be only reduced in C14 suggesting that the increased starch content was primarily due to decreased BMY8 transcript. The reduced BMY7 transcript level in line C14 could be due to RNA interference. Carbohydrate Profile of BMY8 RNAi Lines Maltose content of BMY8 RNAi lines was measured to determine cold shock induced maltose accumulation was abolished due to reduced BMY8 expression (Figure 4-12). Based on HPLC carbohydrate analysis, maltose content did not increase in BMY8 RNAi lines (C5 and C14) during cold shock (4C for 6 h). This indicates that lack of maltose accumulation during cold shock is primarily due to reduced BMY8 expression. This result is also consistent with the previous time course study where increase in BMY8 transcript was correlated with maltose accumulation during cold shock. Glucose, fructose, and sucrose contents were also measured to determine whether lack of maltose accumulation has an influence on the carbohydrate metabolism. During cold shock, glucose, fructose and sucrose levels (Figure 4-12) were significantly lower

PAGE 63

53 WTC5C14BMY8 RNAiLines Control at 20C Cold Shock at 4C for 6 h010203040 Starchg mg-1DW 024681012Maltosenmolmg-1DW 05101520Fructosenmolmg-1DW 04812Sucrosenmolmg-1DW 020406080Glucosenmolmg-1DW WTC5C14BMY8 RNAiLines Control at 20C Cold Shock at 4C for 6 h Control at 20C Cold Shock at 4C for 6 h010203040 Starchg mg-1DW 024681012Maltosenmolmg-1DW 05101520Fructosenmolmg-1DW 04812Sucrosenmolmg-1DW 020406080Glucosenmolmg-1DW Figure 4-12. Carbohydrate profiles of 28-day-old BMY8 RNAi lines (C5 and C14). Soluble sugar concentrations in samples were calculated as lactose equivalent using lactose as an internal reference accounting for sample loss and drift of detector responses. Error bars indicate standard deviation ( + SD) of the mean for three experiments. Based on t-test (p < 0.05), C5 and C14 have significantly low maltose and high starch content. Glucose, fructose, and sucrose levels were significantly lower during cold shock in C5. Only fructose levels were significantly lower during cold shock in C14.

PAGE 64

54 (t-test p < 0.05) in BMY8 RNAi lines except for glucose and sucrose levels in C14. Surprisingly, 20C BMY8 RNAi plants had significantly higher glucose, fructose and sucrose levels, except for C14 that had normal sucrose levels based on t-test (p < 0.05). Consistent with the leaf starch staining results, BMY8 RNAi lines had higher starch content than wild type (Figure 4-12) at 20C grown and cold shocked plants. When BMY8 RNAi lines were cold shocked for 6 h, their starch content did not increase any further. The scale for starch in Figure 4-9 and Figure 4-11 is different; however, the starch levels for WT were very comparable at 20C and at 4C 6 h cold shock Less Chlorophyll Fluorescence in BMY8 RNAi Lines after Freezing Stress Chlorophyll fluorescence of BMY8 RNAi lines was measured following an overnight recovery from freezing stress to test the hypothesis that BMY8 RNAi lines with reduced maltose accumulation would exhibit a more sensitive phenotype for photosynthetic apparatus functionality. Initially, BMY1-2, the vacuolar form, was considered as negative control because a known point mutation in this gene resulted in reduced beta-amylase activity due to inefficient mRNA splicing, but did not affect carbohydrate metabolism (Laby et al., 2001). However, knocking out BMY1-2 expression resulted in a 1.6 fold higher starch content compare to WT (Figure 4-10), and slightly lower maltose, glucose, fructose and sucrose content. Therefore it was not further considered as a negative control. The BMY9 knockout was thus chosen as a negative control because BMY9 is not temperature regulated. The AMY1-2B knockout was initially considered as a positive control because beta-amylase was considered to be unable to attack intact starch granules prior digestion by alpha-amylase (Beck and Ziegler 1989) and the AMY1-2B knock out should result in reduction or no maltose accumulation during cold shock. Therefore, AMY knockout plants would be expected to

PAGE 65

55 behave similarly to the BMY8 RNAi lines during freezing stress. However, based on carbohydrate analysis (Figure 4-10), AMY1-2B had a reduced maltose content that was very similar to that of BMY9. Thus, AMY1-2B was expected to behave similarly to the BMY9 knockout for chlorophyll fluorescence. Based on chlorophyll fluorescence as 0.30.50.70.90-3-4-5-6-7 WT C5 C14 C13 BMY9-1H AMY1-2B 0204060800-3-4-5-6-7 WT C5 C14 C13 BMY9-1H AMY1-2BIon Leakage %Fv/FmTemperature (C)BA 0.30.50.70.90-3-4-5-6-7 WT C5 C14 C13 BMY9-1H AMY1-2B 0204060800-3-4-5-6-7 WT C5 C14 C13 BMY9-1H AMY1-2BIon Leakage %Fv/FmTemperature (C)BA Figure 4-13. Freezing tolerance of non-acclimated BMY8 RNAi lines. A) Fv/Fm ratio. B) Ion leakage. Twenty-seven day old plants grown at 20C were freeze-stressed. At -5, -6, -7C BMY8 RNAi lines (C5, C14 and C13) and AMY1-2B had significantly less chlorophyll fluorescence as Fv/Fm ratio compared with the control, according to ANOVA (p < 0.05). Error bars indicates 95% confidence interval of mean of 3 independent experiments each having 6 replications.

PAGE 66

56 0.60.70.80.90-3-4-5 WT C5 C14 C13Fv/Fm 0510152025300-3-4-5 WT C5 C14 C13Ion Leakage %Temperature (C)BA 0.60.70.80.90-3-4-5 WT C5 C14 C13Fv/Fm 0510152025300-3-4-5 WT C5 C14 C13Ion Leakage %Temperature (C)BA Figure 4-14. Freezing tolerance of cold acclimated BMY8 RNAi lines. A) Fv/Fm ratio. B) Ion leakage. Twenty-seven day old plants grown at 20C were cold shocked for 6 h at 4C and then freeze-stressed. Error bars indicates + SD of 6 replications. At -5C BMY8 RNAi lines (C5, C14 and C13) had significantly lower Fv/Fm ratio compared with controls (t-test p < 0.05). Fv/Fm ratio, BMY8 RNAi lines began showing photoinhibiton at -4C (Figure 4-13A) following freezing stress, whereas WT started showing photoinhibition at -5C. With the persistence and increased severity of freezing stress, photoinhibition increased and this was more pronounced in the BMY8 RNAi lines (Figure 4-13A). If maltose is accumulating in the chloroplast stroma and contribute to the protection of the photosynthetic electron transport chain, it would not be expected to contribute to

PAGE 67

57 reduction in the damage to the plasma membrane. Therefore, BMY8 RNAi lines and WT should show a similar phenotype for ion leakage. Interestingly, 20C grown plants WT and BMY8 RNAi lines showed significantly less ion leakages (Figure 4-13B) after freezing stress based on ANOVA (p < 0.05). The difference in ion leakage assay is probably due to increased glucose, fructose and sucrose content because 20C grown plants BMY8 RNAi lines contained significantly higher glucose, fructose, and sucrose content (Figure 4-12), but similar maltose content compared with WT. Maltose content begins increasing very early during cold acclimation and peaks at 6 h. Based on maltose accumulation kinetics, plants were cold acclimated for 6 h and then freeze stressed to determine whether cold-acclimated plants behave differently with respect to chlorophyll fluorescence. Supporting the results with the non-acclimated plants, cold acclimated BMY8 RNAi lines (C5, C13, and C14) showed greater photoinhibition compared to WT (Figure 4-14A) after freezing stress. Consistent with our hypothesis, 6 h cold acclimated BMY8 RNAi lines and WT plants had very similar ion leakages following freezing stress (Figure 4-14B) meaning that maltose is not contributing to plasma membrane protection in the cytosol. These results suggest that cold induced maltose accumulation during early cold shock occurs largely in the chloroplast stroma and contribute to the protection of the photosynthetic electron transport chain.

PAGE 68

CHAPTER 5 DISCUSSION The RT-PCR analyses presented here are in good agreement with several published microarray studies (Seki et al., 2001; Sung, 2001; Seki et al., 2002; Fowler and Thomashow, 2002; Kreps et al., 2002) where a chloroplastic beta amylase (ct-bmy, BMY8 At4g17090) was shown to be induced during cold shock. In response to heat shock, BMY7 (At3g23920) transcript encoding a protein with a putative chloroplast transit peptide was accumulated, and this is consistent with a previous microarray study from our laboratory (Sung, 2001). Temperature stress induction apparently is specific to these two beta-amylases, but not for all other members of the beta-amylase gene family. The expression of other genes of the starch degradation pathway was either unchanged or repressed during heat and cold shock, except for the cold shock induction of alpha-amylase. Beta-amylase activity is known to increase in response to heat stress (Drier et al., 1995), and cold stress (Nielsen et al., 1997). In contrast, Arabidopsis total beta-amylase activity of leaf tissue was constant during heat shock at 40C for a period of 4 h, and during cold shock at 5C for a period of 8 days. Yet, total leaf beta-amylase activity may not represent actual changes in chloroplastic beta-amylase activity because 90% of the total beta-amylase activity is extra-chloroplastic in Arabidopsis (Monroe and Preiss, 1990). Beta-amylase activity slightly increased in response to heat shock, but remained unchanged during cold shock, when beta-amylase activity was measured using isolated chloroplasts from heat shocked or cold shocked pea seedlings (data not shown). It is 58

PAGE 69

59 conceivable that the increase in beta-amylase enzyme activity in pea chloroplast could be species specific under stress conditions. Nevertheless, in Arabidopsis and pea, temperature stress resulted in an increase in maltose content, similar to that observed for cold stressed potato tubers (Nielsen at al. 1997). Two possibilities could explain maltose accumulation without an increase in beta-amylase activity. Under non-stressed conditions, substrate starch may be a limiting factor in maltose accumulation. The Michaelis constant (K m ) of plant beta-amylases for soluble starch for the non-reducing end ranges from 1.67 to 6.8 mg mL -1 (Lizotte et al., 1990; Doehlert et al., 1982). Beta-amylase is also competitively inhibited by its product maltose, and the K i for maltose is estimated at 11.5 mM (Lizotte et al., 1990). If Arabidopsis chloroplast-localized beta-amylases were constrained by a high K m , increasing starch content under cold stress (Figure 4-3) could increase maltose content without any increase in overall beta-amylase activity until catalysis approached substrate saturation or was inhibited by its end product maltose. In Arabidopsis, the estimated starch level approximates the K m (1.5-2.3 mg mL -1 ). The starch levels increase gradually under cold shock to 7.9 mg mL -1 by 48 h, 34 mg mL -1 at 96 h and then decrease to 22.9 mg mL -1 at 192 h. It would be plausible that the increase in starch content at 5C would result in the increased maltose content until 48 h. Then, competitive inhibition by maltose could limit further maltose accumulation after 48 h, even though starch content continues to increase. Another possibility for maltose accumulation may be to repress maltase expression leading to decreased maltase protein and activity in the chloroplast. One study reports that chloroplast-localized maltase activity (Sun et al., 1995) exists in pea plants; nevertheless, no sequence information is available, and current database

PAGE 70

60 searches have not yet revealed a candidate alpha-glucosidase or maltase with a predicted chloroplast target signal from Arabidopsis. It seems to be widely suspected that maltase activity is absent in the chloroplast stroma. In contrast, a mutation in a single-copy maltose translocator gene (Niittyla et al., 2004) leads to maltose accumulation in the chloroplast. It appears that maltose is broken down to its glucose units by cytosolic glucosyltransferases (Niittyla et al., 2004; Lu and Sharkey et al., 2004; Chia et al., 2004), not by a chloroplastic maltase. A parallel study of microarray (unpublished) and metabolic profiling (Kaplan et al., 2004) analysis data indicate that the expression of the maltose translocator gene does not significantly change when maltose accumulation occurs under heat and cold shock. The likely place for maltose to accumulate during acute stress is the chloroplast stroma. There it could act as a compatible solute to protect stromal proteins and the functionality of the thylakoid membrane for the photosynthetic electron transport chain. Compatible solutes (osmoprotectants) are low molecular weight organic molecules that at high concentrations are not toxic to cells (Yancey et al., 1982; Sakamoto and Murata, 1998). Estimates of maltose concentrations from this work, if localized exclusively within the stroma, could reach as high as 15 mM, a concentration that would be sufficient to provide significant compatible solute benefit. Therefore, maltose as well as the other sugars that accumulate would have positive effects on the functionality of proteins, membranes, and membrane-associated processes , such as the photosynthetic electron transport chain (Figure 4-6 and Figure 4-7). Consistent with the proposed function of maltose as a protectant in the chloroplast, BMY8 RNAi lines (C5, C14, C13), which had reduced maltose accumulation, exhibited lower chlorophyll fluorescence as indicated by

PAGE 71

61 Fv/Fm ratio (Figure12 and 13) compared with WT, BMY9 and AMY1 T-DNA insertional lines following freezing stress. AMY1 knockout line had lower chlorophyll fluorescence compared with WT and BMY9. Additionally, BMY9 knockout line had slightly lower chlorophyll fluorescence compared with WT after freezing stress. The decrease in BMY8 transcript level results in a decrease in maltose, glucose, fructose, and sucrose content. Together gene expression, carbohydrate analysis and freezing stress assay results suggest that maltose, by itself or together with glucose and fructose, contribute to the protection of the photosynthetic electron transport chain in the chloroplast during freezing stress. It has been recently demonstrated that hydrolytic cleavage is the predominant route over that of phosphorolytic cleavage during transitory starch degradation (Scheidig et al., 2002; Lu and Sharkey, 2004; Weise et al., 2004; Sharkey et al., 2004; Smith et al., 2004). Beta-amylases and maltose play a major role during transitory starch breakdown, and maltose is the major product of this process. Lu and Sharkey (2004) hypothesized that a maltose/maltodextrin system is an important component of starch-to-sucrose conversion at night. T-DNA insertional lines for betaand alphaamylases (BMY9, BMY1, AMY1) and BMY8 RNAi lines were impaired in the accumulation of maltose compared with WT during cold shock (Figure 4-9 and 11). This reduction in maltose content was more severe in BMY8 RNAi lines, which is the cold inducible form. In agreement with Lu and Sharkey’s hypothesis, BMY8 RNAi lines (C5 and C14) with reduced maltose content during cold shock also had reduced glucose, fructose, and sucrose with the exception of normal sucrose levels in C14. The coordinate reduction in soluble sugar content was also observed in the other betaand alpha-amylase knockout lines with the exception of

PAGE 72

62 BMY7. Even the slightest change in maltose content was translated to changes in glucose, fructose and sucrose content during cold shock. This suggests that BMY9, BMY1, BMY8, and AMY1 are involved in starch metabolism, especially at low temperature. It is expected that reduced maltose production would be inversely correlated with starch excess phenotype either during starch breakdown or during cold shock. BMY8 RNAi lines (Figure 4-11) showed starch excess phenotype and this phenotype was in good agreement with the study by Scheidig et al. (2002), where reduction in expression of the potato ortholog of BMY8 with the antisense method resulted in starch excess phenotype. When we determined starch content of the other two putative chloroplast localized beta-amylase T-DNA insertional lines (BMY7-1L and BMY9-1H), they did not show a starch-excess phenotype. One explanation for this result could be that the absence of BMY7 or BMY9 might be compensated for by BMY8, and thus BMY8 would play the major role during starch degradation. Interestingly, BMY1 (ram1) the extraplastidic form showed 1.6 fold higher starch content than the WT plants and the starch phenotype persisted during cold shock (Figure 4-9), suggesting that BMY1 is involved in starch metabolism. In contrast to previous reports (Laby et al. 2001), BMY1 (ram1) did not influence starch content. One reason why our results contrast is because we are looking at different aspects of starch degradation. Laby et al. (2001) were looking for starch mobilization over a 24 h period and our study was looking at cumulative starch content. BMY1 might have a very small effect on starch mobilization which cannot reach statistically significant levels during a 24 h measurement interval. However, in the present work impairment in BMY1 activity can reach statistically

PAGE 73

63 significant levels because cumulative starch content is measured. Knock out line of alpha-amylase (AMY1-2B, At1g69830), consistent its function, showed 2.1 fold more starch than WT under normal conditions and cold shock conditions. In contrast, a recent study based on unpublished results reported that a knock out line for the same alpha-amylase (At1g69830) did not impair starch degradation (Smith et al., 2004). This could be due to differences in growth conditions and sampling time.

PAGE 74

CHAPTER 6 CONCLUSIONS Accumulation of BMY7 and 8 transcripts appears to be heat and cold shock specific, respectively, and this response is not a general stress response for the genes involved in starch degradation, based on RT-PCR analysis. Induction of BMY7 and 8 expression was accompanied by accumulation of their product, maltose, possibly within the chloroplast. Furthermore, maltose protected the photosynthetic electron transport chain in vitro. Role of BMY8 during cold shock was also shown in vivo using BMY8 RNAi lines. Decrease in BMY8 transcript level resulted in a decrease in maltose, glucose, fructose, and sucrose content. BMY8 RNAi lines with reduced soluble sugar content had less chlorophyll fluorescence as Fv/Fm ratio compared with WT suggesting that the photosynthetic electron transport chain was more sensitive to freezing stress. The findings presented here indicate that induction of BMY8 leading to maltose accumulation could be an important factor to help plants cope with acute temperature stress and perhaps long-term temperature stress. Because maltose production is a single step reaction, plants could produce significant quantities of maltose in the stroma in a very short time to contribute to the protection of chloroplast membranes and proteins. The short-term protective benefit would give plants additional time to produce their complement of long-term stress related proteins and metabolites, which requires significant modification of metabolism and physiology. 64

PAGE 75

REFERENCES Adachi M, Mikami B, Katsube T, Utsumi S (1998) Crystal structure of recombinant soybean -amylase complexed with -cyclodextrin. J. Biol. Chem. 273: 19859-19865 Allen JF, Holmes NG (1986) Electron transport and redox titration. In MF Hipkins, NR Baker, eds, Practical approach series; photosynthesis energy transduction, IRL Press, Oxford England. Pp. 103-141. Beck E, Ziegler P (1989) Biosynthesis and degradation of starch in higher plants. Annu. Rev. Plant. Physiol. Plant Mol. Biol. 40: 95-117 Bradford MM (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254 Bruinsma J (1963) The quantitative analysis of chlorophylls a and b in plant extracts. Photochem. Photobiol. (Chlor Metabol Sym) 2: 241-249 Chandler JW, Apel K, Melzer S (2001) A novel putative beta-amylase gene and Atb-Amy from Arabidopsis thaliana are circadian regulated. Plant Sci. 161: 1019-1024 Chia T, Thorneycroft D, Chapple A, Messerli G, Chen J, Zeeman SC, Smith SM, Smith AM (2004) A cytosolic glucosyltransferase is required for conversion of starch to sucrose in Arabidopsis leaves at night. Plant J. 37: 853-863 Cline K, Henry R, Li CJ, Yuan J (1993) Multiple pathways for protein transport into or across the thylakoid membrane. EMBO J. 12: 4105-4114 Datta R, Selvi MT, Seetharama N, Sharma R (1999) Stress-mediated enhancement of beta-amylase activity in pearl millet and maize leaves is dependent on light. J. Plant Physiol. 154: 657-664 Doehlert DC, Duke SH, Anderson L (1982) Beta-amylases from alfalfa (Medicago sativa L.) roots. Plant Physiol. 69: 1096-1102 Dreier W, Schnarrenberger C, Brner T (1995) Lightand stress-dependent enhancement of amylolytic activities in white and green barley leaves: beta-amylases are stress-induced proteins. J. Plant Physiol. 145: 342-348 65

PAGE 76

66 Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14: 1675-1690 Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol. 124: 1854-1865 Guy CL, Huber JLA, Huber SC (1992) Sucrose phosphate synthase and sucrose accumulation at low temperature. Plant Physiol. 100: 502-508 Hder D-P, Tevini M (1987) General Photobiology, Pergamon Press, New York. Hara-Nishimura I, Nishimura M, Daussant J (1986) Conversion of free beta-amylase to bound beta-amylase on starch granules in the barley endosperm during desiccation phase of seed development. Protoplasma 134: 149-153 Harmer SL, Hogenesch JB, Straume M, Chang HS, Han B, Zhu T, Wang X, Kreps JA, Kay SA (2000) Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. Science 290: 2110-2113 Hildebrand DF, Hymowitz T (1981) Role of -amylase in starch metabolism during soybean seed development and germination. Physiol. Plant. 53: 429-434 Hirata A, Adachi M, Sekine A, Kang Y-N, Utsumi S, Mikami B (2004) Structural and enzymatic analysis of soybean beta-amylase mutants with increased pH optimum. J. Biol. Chem. 279: 7287-7295 Jones TA, Zou JY, Cowan SW, Kjeldgaard (1991) Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr. A. 47: 110-119 Jung S-H, Lee J-Y, Lee D-H (2003) Use of SAGE technology to reveal changes in gene expression in Arabidopsis leaves undergoing cold stress. Plant Mol. Biol. 52: 553-567 Kang Y-N, Adachi M, Utsumi S, Mikami B (2004) The roles of Glu186 and Glu380 in the catalytic reaction of soybean beta-amylase. J. Mol. Biol. 339: 1129-1140 Kaplan F, Kopka J, Haskell D, Zhao W, Schiller KC, Gatzke N, Sung DY, Guy CL (2004) Exploring the temperature stress metabolome of Arabidopsis thaliana. Plant Physiol. 136: (in press) Kossmann J, Lloyd J (2000) Understanding and influencing starch biochemistry. Crit. Rev. Biochem. Mol. Biol. 35: 141-196

PAGE 77

67 Krapp A, Stitt M (1995) An evaluation of direct and indirect mechanisms for the “sink-regulation” of photosynthesis in spinach: changes in gas exchange, carbohydrates, metabolites, enzyme activities and steady-state transcript levels after cold-girdling source leaves. Planta 195: 313-323 Kreps JA, Wu Y, Chang SH, Zhu T, Wang X, Harper JF (2002) Transcriptome changes for Arabidopsis in response to salt osmotic and cold stress. Plant Physiol 130: 2129-2141 Laby RJ, Kim D, Gibson SI (2001) The ram1 mutant of Arabidopsis exhibits severely decreased -amylase activity. Plant Physiol. 127: 1798-1807 Lao NT, Schoneveld O, Mould RM, Hibberd JM, Gray JC, Kavanagh TA (1999) An Arabidopsis gene encoding a chloroplast-targeted beta-amylase. Plant J. 20: 519-527 Li PH, Weiser CJ, Van Huystee R (1965) Changes in metabolites of red-osier dogwood during cold acclimation. J. Amer. Soc. Hort. Sci. 86: 723-730 Lizotte PA, Henson CA, Duke SH (1990) Purification and characterization of pea epicotyl beta-amylase. Plant Physiol. 92: 615-621 Lu Y, Sharkey TD (2004) The role of amylomaltase in maltose metabolism in the cytosol of photosynthetic cells. Planta 218: 466-473 Maeo K, Tomiya T, Hayashi K, Akaike M, Morikami A, Ishiguro S, Nakamura K (2001) Sugar-responsible elements in the promoter of a gene for beta-amylase of sweet potato. Plant Mol. Biol. 46: 627-637 Mikami B, Degano M, Hehre EJ, Sacchettini JC (1994) Crystal structure of soybean -amylase reacted with -maltose and maltal: Active site components and their apparent roles in catalysis. Biochemistry 33: 7779-7787 Mikami B, Hehre EJ, Sato M, Katsube Y, Hirose M, Morita Y, Sacchettini JC (1993) The 2.0 resolution structure of soybean -amylase complexed with -cyclodextrin. Biochemistry 32: 6836-6845 Mikami B, Yoon HJ, Yoshigi N (1999) The crystal structure of the sevenfold mutant of barley -amylase with increased thermostability at 2.5 resolution. J. Mol. Biol. 285: 1235-1243 Mita S, Suzuki-Fujii K, Nakamura K (1995) Sugar-inducible expression of a gene for beta-amylase in Arabidopsis thaliana. Plant Physiol. 107: 895-904 Mita S, Hirano H, Nakamura K (1997) Negative regulation in the expression of a sugar-inducible gene in Arabidopsis thaliana. A recessive mutation causing enhanced expression of gene for beta-amylase. Plant Physiol. 114: 575-582

PAGE 78

68 Mita S, Murano N, Akaike M, Nakamura K (1997) Mutants of Arabidopsis thaliana with pleiotropic effects on the expression of the gene for beta-amylase and on the accumulation of anthocyanin that are inducible by sugars. Plant J. 11: 841-851 Monroe JD, Preiss J (1990). Purification of a -amylase that accumulates in Arabidopsis thaliana mutants defective in starch metabolism. Plant Physiol. 94: 1033-1039 Nakamura K, Ohto M, Yoshida N, Nakamura K (1991) Sucrose-induced accumulation of beta-amylase occurs concomitant with the accumulation of starch and sporamin in leaf-petiole cuttings of sweet potato. Plant Physiol. 96: 902-909 Neuhaus HE, Schulte N (1996) Starch degradation in chloroplasts isolated from C 3 or CAM (crassulacean acid metabolism)-induced Mesembryanthemum crystallinum L. Biochem. J. 318: 945-953 Nielsen TM, Deiting U, Stitt M (1997) A beta-amylase in potato tubers is induced by storage at low temperature. Plant Physiol. 113: 503-510 Niittyla T, Messerli G, Trevisan M, Chen J, Smith A.M, Zeeman SC (2004) A previously unknown maltose transporter essential for starch degradation in leaves. Science 303: 87-89 Ohto M-A, Nakamura-Kito K, Nakamura K (1992) Induction of expression of genes coding for sporamin and beta-amylase by polygalacturonic acid in leaf-petiole cuttings of sweet potato. Plant Physiol. 99: 422-427 Reidler JA (2000) Low cost gel analysis. Methods Mol. Biol. 132: 277-288 Sakamoto A, Murata A, Murata N (1998) Metabolic engineering of rice leading to biosynthesis of glycine betaine and salt and cold. Plant Mol Biol 38: 1011-1019 Santarius KA (1973) The protective effects of sugars on chloroplast membranes during temperature and water stress and its relationship to frost, desiccation and heat resistance. Planta 113: 105-114 Santarius KA (1996) Freezing of isolated thylakoid membranes in complex media. X. Interactions among various low molecular weight cryoprotectants. Cryobiology 33: 118-126 Scheidig A, Frhlich A, Schulze S, Lloyd JR, Kossmann J (2002) Downregulation of a chloroplast-targeted beta-amylase leads to starch-excess phenotype in leaves. Plant J. 30: 581-591

PAGE 79

69 Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carninci P, Hayashizaki Y, Shinozaki K (2001) Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray. Plant Cell 13: 61-72 Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K (2002) Monitoring the expression profiles of 7000 Arabidopsis genes under drought cold and high-salinity stresses using a full-length cDNA microarray. Plant J. 31: 279-292 Servaites JC, Geiger DR (2002) Kinetic characteristics of chloroplast glucose transport. J. Exp. Bot. 53:1581-1591 Sharkey TD, Laporte M, Lu Y, Weise S, Weber AP (2004) Engineering plants for elevated CO 2 : a relationship between starch degradation and sugar sensing. Plant Biol. 6: 280-288 Sharma R, Schopfer P (1982) Sequential control of phytochome-mediated synthesis de novo of beta-amylase in cotyledons of mustard (Sinapis alba L.) seedlings. Planta 155: 183-189 Smeekens S (2000) Sugar-induced signal transduction in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 51: 49-81 Smith SM, Fulton DC, Chia T, Thorneycroft D, Chapple A, Dunstan H, Hylton C, Zeeman SC, Smith AM (2004) Diurnal changes in the transcriptome encoding enzymes of starch metabolism provide evidence for both transcriptional and posttranscriptional regulation of starch metabolism in Arabidopsis leaves. Plant Physiol. 136: 2687-2699 Sopanen T, Lauriere C (1989) Release and activity of bound beta-amylase in germinating barley grain. Plant Physiol. 89: 244-249 Strand A, Hurry V, Guftafsson P, Gardenstrom P (1997) Development of Arabidopsis thaliana leaves at low temperatures releases the suppression of photosynthesis and photosynthetic gene expression despite the accumulation of soluble carbohydrates. Plant J. 12: 605-614 Strand A, Hurry V, Henkes S, Huner N, Guftafsson P, Gardenstrom P, Stitt M (1999) Acclimation of Arabidopsis leaves developing at low temperatures. Increasing cytoplasmic volume accompanies increased activities of enzymes in the Calvin cycle and in the sucrose-biosynthesis pathway. Plant Physiol. 119: 1387-1397. Strizhov N, brahm E, krsz L, Blickling S, Zilberstein A, Schell J, Koncz C, Szabados L (1997) Differential expression of two P5CS genes controlling proline accumulation during salt-stress requires ABA and is regulated by ABA1, ABI1, and AXR2 in Arabidopsis. Plant J. 12: 557-569

PAGE 80

70 Sun Z, Duke SH, Henson CA (1995) The role of pea chloroplast (alpha) glucosidase in transitory starch degradation. Plant Physiol. 108: 211-217 Sung DY (2001) Characterization of Arabidopsis heat shock protein 70 (Hsp70) gene family and microarray analysis of gene expression in response to temperature extremes. Ph.D. dissertation. University of Florida, Gainesville. Sung DY, Guy CL (2003) Physiological and molecular assessment of altered expression of Hsc70-1 in Arabidopsis. Evidence for pleiotropic consequences. Plant Physiol. 132: 979-987 Tepperman JM, Zhu T, Chang HS, Wang X, Quail PH (2001) Multiple transcription-factor genes are early targets of phytochome A signaling. Proc. Natl. Acad. Sci. USA 98: 9437-9442 Todaka D, Matusshima H, Morohashi Y (2000) Water stress enhances -amylase activity in cucumber cotyledons. J. Exp. Bot. 51: 739-745 Verbruggen N, Villarroel R, Van Montagu M (1993) Osmoregulation of pyrroline-5-carboxylate reductase gene in Arabidopsis thaliana. Plant Physiol. 103: 771-781 Wang Q, Monroe JD, Sjolund RD (1995) Identification and characterization of a phloem specific -amylase. Plant Physiol. 109: 743-750 Wang S-M, Lue W-L, Eimert K, Chen J (1996) Phytohormone-regulated beta-amylase gene expression in rice. Plant Mol. Biol. 31: 975-982 Wanner LA, Junttila O (1999) Cold-induced freezing tolerance in Arabidopsis. Plant Physiol. 120: 391-399 Weise SE, Weber APM, Sharkey TD (2004) Maltose is the major form of carbon exported from the chloroplast at night. Planta 218: 474-482 Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, Waterhouse PM (2001) Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 27: 581-590 Xin Z, Browse J (1998) Eskimo1 mutants of Arabidopsis are constitutively freezing-tolerant. Proc. Natl. Acad. Sci. USA 95: 7799-7804 Yancey PH, Clark ME, Hand SC, Bowlus RD, Somero GN (1982) Living with water stress: evolution of osmolyte systems. Science 217: 1214-1222

PAGE 81

71 Yang J, Zhang J, Wang Z, Zhu Q (2001) Activities of starch hydrolytic enzymes and sucrose-phosphate synthase in the stems of rice subjected to water stress during grain filling. J. Exp. Bot. 52: 2169-2179 Yelenosky G, Guy CL (1977) Carbohydrate accumulation in leaves and stems of “Valencia” orange at progressively colder temperatures. Bot. Gaz. 138: 13-17 Yoshiba Y, Kiyosue T, Katagiri T, Ueda H, Mizoguchi T, Yamaguchi-Shinozaki K, Wada K, Harada Y, Shinozaki K (1995) Correlation between the induction of a gene for 1 -pyrroline-5-carboxylate synthetase and accumulation of proline in Arabidopsis thailana under osmotic stress. Plant J. 7: 751-760 Ziegler P, Beck E (1986) Exoamylase activity in vacuoles isolated from pea and wheat leaf protoplast. Plant Physiol. 82: 1119-1121

PAGE 82

BIOGRAPHICAL SKETCH Fatma Kaplan was born in Duzce, Turkey. Fatma attended Cumhuriyet University in the College of Agriculture in Tokat, Turkey. When she was a third year undergraduate student, she received a scholarship for practical training abroad. She did her practical training for 3 months at Hohenheim University in Stuttgart, Germany. After returning to Turkey, she earned her Bachelor’s degree in 1992, from the Department of Horticulture. She began her master’s degree program in natural and applied sciences, at Ankara University in Ankara. At the same time, she attended German language courses at the Goethe Institute in Ankara, Turkey. In 1995, during her master’s studies, she received a full government scholarship from the Ministry of National Education of Turkey to pursue an M.S. and Ph.D. degree in the USA. She attended 7 months of an advanced-level English language course in Turkey in 1996, and then for another 6 months she attended an English language course in the USA. In 1997, Fatma began studying for her master’s degree at the University of Florida (UF), in Gainesville. In 1998, Fatma was recognized by the office of International Studies and Programs, at UF, for earning a 4.0 cumulative grade point average (GPA) in her first year of graduate school. She completed her master’s degree in May 3, 1999, at UF. Upon completion of her master’s degree, she started her Ph.D. in the Plant Molecular and Cellular Biology Program (PMCB) at UF. Her first year in PMCB program (1999-2000), she did a rotation in the labs of Dr. Andrew D. Hanson and Dr. Charles Guy. She was awarded a research assistantship from Charles Guy’s lab in 2000, 72

PAGE 83

73 and stopped taking scholarship from the Turkish Government, during her doctoral studies. She produced refereed publications and her dissertation project was considered worthy of patent. She also established a collaboration for metabolite profiling with Dr. Joachim Kopka, at the Max Planck Institute of Molecular Plant Physiology, Golm, Germany, in 2003. Additionally, she was given the “Outstanding International Student Award” in April 22, 2004 from Institute of Food and Agricultural Sciences (IFAS) at UF. After completing her Ph.D. degree, she will look for a job and repay the Ministry of National Education of Turkey for the scholarship, she took during her master’s studies and her first-year rotation in the PMCB program.