Citation
Genetic Analysis of the Polyhedral Organelles Formed during B12-Dependent Growth on 1,2-Propanediol in Salmonella enterica Serovar Typhimurium LT2

Material Information

Title:
Genetic Analysis of the Polyhedral Organelles Formed during B12-Dependent Growth on 1,2-Propanediol in Salmonella enterica Serovar Typhimurium LT2
Creator:
SAMPSON, EDITH MARION ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Broths ( jstor )
Cell growth ( jstor )
Dehydrogenases ( jstor )
Enzymes ( jstor )
Microbial growth ( jstor )
Operon ( jstor )
Organelles ( jstor )
Polyhedrons ( jstor )
Propionates ( jstor )
Toxicity ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Edith Marion Sampson. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/18/2004
Resource Identifier:
57731745 ( OCLC )

Downloads

This item has the following downloads:

sampson_e ( .pdf )

sampson_e_Page_30.txt

sampson_e_Page_21.txt

sampson_e_Page_35.txt

sampson_e_Page_06.txt

sampson_e_Page_40.txt

sampson_e_Page_45.txt

sampson_e_Page_23.txt

sampson_e_Page_03.txt

sampson_e_Page_55.txt

sampson_e_Page_48.txt

sampson_e_Page_33.txt

sampson_e_Page_36.txt

sampson_e_Page_11.txt

sampson_e_Page_51.txt

sampson_e_Page_54.txt

sampson_e_Page_61.txt

sampson_e_Page_14.txt

sampson_e_Page_68.txt

sampson_e_Page_18.txt

sampson_e_Page_01.txt

sampson_e_Page_15.txt

sampson_e_Page_41.txt

sampson_e_Page_59.txt

sampson_e_Page_26.txt

sampson_e_Page_22.txt

sampson_e_Page_31.txt

sampson_e_Page_07.txt

sampson_e_Page_08.txt

sampson_e_Page_24.txt

sampson_e_pdf.txt

sampson_e_Page_67.txt

sampson_e_Page_58.txt

sampson_e_Page_66.txt

sampson_e_Page_09.txt

sampson_e_Page_05.txt

sampson_e_Page_60.txt

sampson_e_Page_19.txt

sampson_e_Page_42.txt

sampson_e_Page_02.txt

sampson_e_Page_53.txt

sampson_e_Page_32.txt

sampson_e_Page_37.txt

sampson_e_Page_52.txt

sampson_e_Page_10.txt

sampson_e_Page_12.txt

sampson_e_Page_29.txt

sampson_e_Page_39.txt

sampson_e_Page_62.txt

sampson_e_Page_25.txt

sampson_e_Page_34.txt

sampson_e_Page_04.txt

sampson_e_Page_57.txt

sampson_e_Page_16.txt

sampson_e_Page_50.txt

sampson_e_Page_17.txt

sampson_e_Page_47.txt

sampson_e_Page_20.txt

sampson_e_Page_63.txt

sampson_e_Page_38.txt

sampson_e_Page_64.txt

sampson_e_Page_49.txt

sampson_e_Page_43.txt

sampson_e_Page_65.txt

sampson_e_Page_13.txt

sampson_e_Page_46.txt

sampson_e_Page_27.txt

sampson_e_Page_28.txt

sampson_e_Page_56.txt

sampson_e_Page_44.txt


Full Text












GENETIC ANALYSIS OF THE POLYHEDRAL ORGANELLES FORMED DURING
B12-DEPENDENT GROWTH ON 1,2-PROPANEDIOL IN
Salmonella enterica SEROVAR TYPHIMURIUM LT2















By

EDITH MARION SAMPSON


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2004

































Copyright 2004

by

Edith Marion Sampson




























This thesis is dedicated to my husband, my son, my parents, and the incredible
women in my life.















ACKNOWLEDGMENTS

I thank my mentor, Dr. Thomas Bobik. His optimism, dedication, patience,

guidance, and theology will serve as example throughout my career and life. I thank Dr.

Henry Aldrich for his guidance and mentorship throughout my undergraduate and

graduate career. His passion for science and photography inspired this heart. I thank

Nemet Keyhani for his guidance and optimism, and Brahms for her cheerful disposition.

I appreciate all that Donna Williams and Lorraine McDowell have done to make my

experience in the EM laboratory pleasant. They have always greeted me as a friend and

treated me with kindness.

I thank my lab mates (Greg Havemann, Celeste Johnson-Causey, Nicole Leal, and

Patrick Joyner) for their humor, friendship, and assistance in all facets of my life. I am

grateful to the faculty in the Microbiology and Cell Science Department for use of

equipment, advice on experiments, and mentorship. Finally, I would like to thank my

parents, husband and son for their love, support and dedication during this arduous

journey.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ................................................................................................. iv

L IS T O F T A B L E S ................... ...................................................... ............ ................. ... v ii

L IST O F FIG U R E S ................................................................ ...... .... .... ............. viii

A B ST R A C T ................. .......................................................................................... x

CHAPTER

1 IN TR OD U CTION ............................................... .. ......................... ..

T h e p d u L o cu s .............................................................................................................. 1
R e g u la tio n .................................................................................1
1,2-P d D egradation ........ ............................................................ ................ .3
B 12 A denosylation ................... .... ........ ..................... ... ...... .......... .. ....
Polyhedral O rganelles ......................... ...... ........ .......... .... .. 5
pdu Genes of Unknown Function........................................................8
Sum m ary .......................... ...................................... .. .. .......... ........ 8

2 GENETIC ANALYSIS OF POLYHEDRAL BODY FORMATION AND
1,2-PROPANEDIOL DEGRADATION BY Salmonella enterica .........................10

M materials and M methods ....................................................................... .................. 12
Chem icals and R eagents........................ .. ............................................... 12
Bacterial Strains, Media, and Growth Conditions.................... ............... 13
General M olecular M ethods ........................... ..... .................................. 13
P22 Transduction ......................... .... ........................ ............ ............. 15
Construction of In-Frame pdu Gene Deletions ............................................16
G row th C urves................................................................... ........ ............ ........ 17
Aldehyde Indicator Media and MacConkey Media Tests............................. 17
E lectron M icroscopy ..................... .. .... ................... .... .. ........... 18
R results ............................ .. ......... .. ..... .. ...... .. .... .....................19
1,2-Pd Metabolism in Strains with Precise Nonpolar Deletion in Selectedpdu
G enes ........................................ 19
G row th Curves................................................... 19




v









Systematic Electron Microscopy Study of Organelle Formation by Selected
p du D election M utants............................................................ .....................26
D iscu ssio n .......................... .. ......... ... .. ................................................ 2 7

3 POLYHEDRAL ORGANELLES INVOLVED IN 1,2-PROPANEDIOL
DEGRADATION PROTECT AGAINST PROPIONALDEHYDE TOXICITY
DURING AEROBIC GROWTH OF Salmonella enterica .......................................30

M materials and M methods ................ ........................... .................................... 32
Bacterial Strains, Chemicals, and Reagents ................................................32
G row th Curves................................................... 33
HPLC Analysis...................... ............... 33
Dose Response Growth Curves........................................... .......................... 34
R results ......................................... .... ....................... .................34
Effect of CNCbl Concentration on the Growth of Wild-type S. enterica and
Selectedpdu Mutants on 1,2-Pd Minimal Medium .......................................34
Propionaldehyde Form ation ....................................... ..... .. ............... 35
Effect of Selectedpdu Deletion Mutations on 1,2-Pd Consumption ..................39
P ropionate Secretion ............................................................ .. ....... .. ..... 40
1-Propanol Secretion ........... .. .. ............. ..... .. ..... ..... ............ .....43
Effect of Propionaldehyde, Propionate, and 1-Propanol Supplementation on
the G row th of S. enterica. ................ ......... ............ .... ..... .. ........ 44
D iscu ssion ................ .......... .... .. .......... ... ....................................... 4 6

L IST O F R EFE R EN C E S ................................ ................................... ..........................50

BIO GRAPH ICAL SK ETCH .................................................. ............................... 57
















LIST OF TABLES


Table pge

2-1 Bacterial strains ................................ ................... ........ ............. ..... 14

2-2 Primers forpdu deletions completed using the Miller and Mekalanos deletion
method, restriction enzymes, and predicted insert size.......................................15

2-3 Phenotypes ofpdu deletion mutants on MacConkey and AIM media.....................20

2-4 Polyhedral phenotypes ofpdu deletion mutants ............... ................... ...........27

3-1 Strain L ist ................................. .......................... ........ .......... 32















LIST OF FIGURES


Figure pge

1-1 Thep du locus ................................................................. 2

1-2 Proposed 1,2-Pd degradation pathway .............. ........................ ............... 3

2-1 Aerobic growth of the wild-type strain and 1,2-Pd pathway mutants on
1,2-Pd/CN Cbl m inim al m edia............................................................. ............... 22

2-2 Aerobic growth of the wild-type strain and the diol dehydratase reactivating factor
m utants on 1,2-Pd/CN Cbl m inim al m edia.................................... .........................23

2-3 Effects of deletions ofpdu genes of unknown function on growth of
S. enterica on 1,2-Pd/CNCbl minimal media...................................... ...............24

2-4 Aerobic growth of the wild-type strain and 4 carboxysome homologue mutants
with interrupted growth on 1,2-Pd/CNCbl minimal media..................................25

2-5 Aerobic growth of the wild-type strain and 3 carboxysome homologue mutants
without interrupted growth on 1,2-Pd/CNCbl minimal media.............................25

2-6 Electron micrographs of S. enterica wild-type-LT2 and select carboxysome
hom ologue m utants .......................................... .............. ........... 26

3-1 Aerobic growth curves of wild-type-LT2 and polyhedral organelle
mutants in 1,2-Pd minimal broth with various concentrations of CNCbl ...............36

3-2 HPLC analysis of propionaldehyde levels in wild-type and polyhedral organelle
deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth.............. 37

3-3 HPLC analysis of 1,2-Pd consumption in wildtype-LT2 and
polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl
minimal broth .................................... ................................ .........38

3-4 HPLC analysis of propionate levels in wild-type-LT2 and polyhedral organelle
deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth..............41

3-5 HPLC analysis of 1-propanol levels in wild-type-LT2 and the
polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl
minimal broth .................................... ........................... ..... .........42









3-6 Dose response growth curves of wild-type-LT2 in minimal succinate, 1
,2-Pd broth dosed with 0 20 mM: A) propionaldehyde, B) propionate,
C ) 1-propanol. ........................................................................44

3-7 HPLC analysis of maximum production levels of propionate, propionaldehyde
and 1-propanol in wild-type-LT2 and polyhedral organelle deletion strains
during aerobic growth on 1,2-Pd/CNCbl minimal broth............... ...................47















Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

GENETIC ANALYSIS OF THE POLYHEDRAL ORGANELLES FORMED DURING
B12-DEPENDENT GROWTH ON 1,2-PROPANEDIOL IN Salmonella enterica
SEROVAR TYPHIMURIUM LT2

By

Edith Marion Sampson

December 2004

Chair: Thomas A. Bobik
Major Department: Microbiology and Cell Science

Salmonella enterica forms polyhedral organelles involved in AdoB12-dependent

1,2-propanediol (1,2-Pd) degradation. We constructed nonpolar mutations in all of the

pdu genes and examined the effects of the mutations on polyhedral organelle formation

and growth on 1,2-Pd/Vitamin B12 minimal media. Electron microscopy studies

established thatpduBB' nonpolar mutant failed to form polyhedra; thatpduH, pduJ,

pduK, and pduM mutants formed aberrant polyhedra; and that all other deletion mutants

produced normal-appearing polyhedra. Aerobic growth rates were reported for each of

the deletion mutants.

During aerobic growth on 1,2-Pd, pduBB ', pduJ, and pduK deletion strains

exhibited a period of "interrupted" growth, which was relieved when B12 concentrations

were decreased. Growth tests demonstrated that mutants containing nonpolar deletions in

pduBB ', pduJ, and pduK grew at a faster rate than wildtype at low B12 concentrations.

Additionally, high pressure liquid chromatography (HPLC) was used to measure the









products of 1,2-Pd degradation. The HPLC studies showed that the arrested growth

period corresponded to a spike in propionaldehyde levels. Moreover, wildtype cells

cultured in LB, minimal succinate media +/- Pd, and minimal Pd/B12 media (and

subjected to various propionaldehyde dosages) demonstrated a period of arrested growth.

These data indicated that propionaldehyde (the product of the diol dehydratase reaction)

was eliciting the interrupted growth response. These results support a previously

proposed model in which the polyhedral organelles serve to reduce aldehyde toxicity by

limiting the rate of aldehyde production.














CHAPTER 1
INTRODUCTION

Salmonella enterica uses 1,2-propanediol (1,2-Pd) as a carbon and energy source

via a pathway that requires coenzyme B12 (adenosylcobalamin, AdoCbl) (38). The major

product of the fermentation of two common methylpentoses (rhamnose and fucose) is

1,2-Pd. Rhamnose and fucose are found in the glycoconjugates of intestinal epithelial

cells and plant cell walls (12, 43, 51). Hence, the ability to degrade 1,2-Pd may confer a

selective advantage in anaerobic niches such as the intestinal tracts of host animals and

the interior of macrophages (43, 51). Evidence also suggests that 1,2-Pd degradation has

a role in Salmonella pathogenesis. In vivo expression technology (IVET) indicated that

1,2-Pd degradation was important for the growth of Salmonella in host tissues, and

competitive index studies in mice indicated thatpdu mutations confer a virulence defect

(17, 32). Furthermore, 1,2-Pd degradation provides an important model system for

studies of AdoCbl-dependent processes.

The pdu Locus

Regulation

The genes required for 1,2-Pd degradation are found at centisome 44 of the

Salmonella genome; and consist of the pduF and pocR genes, which encode a 1,2-Pd

diffusion facilitator protein and a transcriptional regulator, and the divergently

transcribed 21-genepdu operon (Figure 1-1) (15, 38). Thepdu locus is located adjacent

to the cob operon, which encodes twenty proteins required for de novo B12 synthesis (15).

Globally, both operons are controlled by the ArcA/ArcB system during anaerobic growth









pdu operon

pocR pduF A B C D E G H J K L MN O P Q S T U VWX


Carboxysome
homologs
Pathway
enzymes

Ado-B 1
reactivation

Figure 1-1. The pdu locus

and the Crp/cyclic AMP system under carbon and energy deficits, aerobically and

anaerobically (2, 14, 23, 36, 37). Both operons are induced by 1,2-Pd, and this control is

mediated by PocR, a member of the AraC family of regulatory proteins (9, 16, 56).

Because the cob andpdu operons are co-induced by 1,2-Pd, it has been suggested that

1,2-Pd metabolism is the main reason for de novo B12 synthesis by S. enterica (9, 16, 56).

Recent microarray analysis established that expression of two genes found in the

pdu operon (pduA andpduC) was decreased 2.5 fold in a csrA mutant (41). The protein

CsrA is a post-transcriptional regulator that has been found to control expression of

Salmonella pathogenicity island 1 (SPI-1), SPI-1 type III secretion apparatus, and

flagellar synthesis operons (6, 41, 44, 54, 55, 58, 73). Altering expression of csrA

negatively affects SPI-1 gene expression and decreases the mutant bacteria's ability to

invade cultured epithelial cells (probably because of poor expression of the flagellar

synthesis operons) (41).

A pdu operon lacZ fusion was tested for B-galactosidase production, and a 10-fold

decrease was observed in the csrA mutant when compared to the wild-type (41).










Propanol
Ado-B 12dependent dehydrogenase
diol dehydratase (pduQ)
(pd1aCDE) NADH NAD
1,2-Propanediol -- Propionaldehyde 2 1-Propanol
CoA-dependent
NAD Propionaldehyde dehydrogenase
(pduP)
NADH Propionyl-CoA

Phospho-
transacylase ?



Propionyl-phosphate

Propionate I ADP
kinase
(p ) ATP

Propionate

Figure 1-2. Proposed 1,2-Pd degradation pathway

Complementation of the csrA mutant completely restored pdu expression (41). Gene

expression of cob and cbi (de novo B12 synthetic genes) and the B12-associated

ethanolamine utilization operon (eut) were also negatively affected in the csrA mutant, as

shown with microarray analysis and B-galatosidase activity assays (41). Overall, CsrA

regulation in Salmonella seems to have been tailored to control bacterial functions

specific for life in the intestinal environment, especially those involved in virulence (41).

1,2-Pd Degradation

Based on biochemical and genetic studies, a pathway for 1,2-Pd degradation has

been proposed. 1,2-Pd degradation is dependent on the pduCDE genes, which encode the

three subunits of AdoCbl-dependent diol dehydratases (11). Diol dehydratase initiates

1,2-Pd degradation by mediating the conversion of 1,2-Pd to propionaldehyde which is

further metabolized to propionate and 1-propanol; presumably by CoA-dependent

aldehyde dehydrogenase (pduP), phosphotransacylase, propionate kinase (pduW), and









alcohol dehydrogenase (pduQ) (Fig. 1-2) (10, 42, 51, 52, 65). This metabolic process

provides one ATP by substrate-level phosphorylation, an intermediate (propionyl-CoA)

that can enter to central metabolism through the 2-methyl-citrate pathway, and an

electron sink (1-propanol) that can be used to balance cellular redox reactions (33, 57).

AdoCbl-dependent diol dehydratase catalyzes the first step of 1,2-Pd degradation

(the conversion of 1,2-Pd to propionaldehyde) using a mechanism that relies on radical

chemistry (4, 29, 64). High-energy radical intermediates generated during the catalytic

cycle can undergo side reactions resulting in the modification of AdoCbl and consequent

enzyme inactivation (1, 5, 66, 68). AdoCbl undergoes irreversible cleavage of its

cobalt/carbon bond, forming a modified cofactor that remains tightly bound at the active

site, preventing further catalysis (35, 66, 74). Reactivating factors restore enzymatic

activity by facilitating the release of bound modified cofactor, permitting another AdoCbl

molecule to enter the active site (67). In Klebsiella oxytoca, reactivation of inactive

holoenzyme is mediated by the DdrA and DdrB proteins (50) Homology searches

identified the PduGH proteins as putative reactivating factors for the AdoCbl dependent

diol dehydratase involved in 1,2-Pd degradation (10). Since pduG and pduH share

significant sequence homology to ddrA and ddrB, the reactivation process used by

Salmonella and Klebsiella may be mechanistically similar (11, 49).

B12 Adenosylation

Under anaerobic conditions, S. enterica can synthesize the AdoCbl needed for

1,2-Pd degradation de novo; however, in the presence of oxygen exogenous complex

precursors are required (39). Processing enzymes convert complex precursors such as

vitamin B12 cyanocobalaminn, CNCbl) to AdoCbl via the adenosylation pathway

(28, 34, 40). In the proposed scheme, CNCbl is decyanated to hydroxycobalamin,









reduced to cob(II)alamin, further reduced to cob(I)alamin, and finally adenosylated to

AdoCbl (28, 34, 40). To date, the genes encoding the decyanase and reductase enzymes

have not been identified (10). However, an adenosyltransferase encoded in thepdu

operon (PduO), has been characterized genetically and biochemically (40). The PduO

enzyme adenosylates cob(I)alamin using ATP as the adenosyl-group donor (40).

Polyhedral Organelles

DNA sequence analysis of the pdu operon identified seven pdu genes

(pduABJKNTU) having significant sequence homology to proteins needed for the

formation of carboxysomes; a polyhedral organelle involved in CO2 fixation by

cyanobacteria and some chemoautotrophs (10, 27). Recent electron microscopy (EM)

studies showed that Salmonella forms polyhedral organelles during aerobic and anaerobic

growth on 1,2-Pd minimal medium (10). These organelles are about 100 to 150 nm in

diameter and have a proteinaceous center surrounded by a protein shell that is about 3 to

4 nm in width (30). Carboxysomes share the same basic dimensions, but are more

regularly shaped. The shell of the carboxysome consists of about six proteins, and the

pdu operon has seven genes related in sequence to carboxysome shell genes

(pduABB'JKTU) suggesting that the shells of these organelles are related; however, their

functions appear to be quite different (10, 62).

Carboxysomes are involved in autotrophic CO2 fixation, and mutants unable to

form carboxysomes require high levels of CO2 for autotrophic growth (25, 45, 63). In

contrast, the polyhedral organelles of S. enterica are involved in the AdoCbl-dependent

degradation of 1,2-Pd (a process that has not been shown to require CO2) (10). The

function of the S. enterica polyhedral organelles has not yet been established, but a role









in moderating propionaldehyde production to minimize aldehyde toxicity through control

ofB12 availability has been proposed (30).

In recent studies, the polyhedral organelles involved in 1,2-Pd degradation by

S. enterica were purified and shown to be composed of at least 15 different proteins, 14

of which are encoded by the pdu operon (PduABB'CDEGHJKOPTU and one

unidentified protein) making these structures one of the most elaborate multi-protein

complexes found in the prokaryotic world (30). The PduB' protein was identified by N-

terminal sequencing as a shorter version PduB that was lacking 37 N-terminal amino acid

residues (30). DNA sequence analysis of the Salmonella genome identified potential

Shine-Dalgarno sequences and start sites for both PduB and PduB', indicating that they

may be encoded by overlapping genes (30).

Of the 15 polypeptides shown to be components of the S. enterica polyhedral

organelles, the functions of 5 have been investigated (11, 30, 31, 40, 42). PduA was

previously shown to be an organelle shell protein (31). PduCDE (AdoCbl-dependent diol

dehydratase) and PduP (CoA-dependent propionaldehyde dehydrogenase) are essential to

the 1,2-Pd catabolic pathway (11, 42). The PduGH enzymes are a putative diol

dehydratase reactivating factor and the PduO enzyme is an ATP:cob(I)alamin

adenosyltransferase that catalyzes the terminal step of vitamin B12 assimilation (10, 40).

The functions of the PduBB'JKTU proteins are unknown but these polypeptides all share

sequence similarity with carboxysome shell proteins (10).

As a group, the four enzymes shown to be associated with the S. enterica

polyhedral organelles are sufficient to mediate the conversion of 1,2-Pd to

propionyl-CoA (30). AdoCbl-dependent diol dehydratase catalyzes the conversion of









1,2-Pd to propionaldehyde, which is then converted to propionyl-CoA by the

CoA-dependent propionaldehyde dehydrogenase (42, 51, 65). Adenosyltransferase and

the presumptive PduGH reactivating factor are needed to maintain diol dehydratase in an

active form (5, 40, 68, 74). To date, the polyhedra have been shown to have high levels

of diol dehydratase and propionaldehyde dehydrogenase activity (30, 42), but enzymatic

assays of the other enzyme components have not been conducted. Nonetheless, the

enzyme content of the pdu polyhedra indicates that their primary catalytic role is the

conversion of 1,2-Pd to propionyl-CoA (30).

The identification of the S. enterica polyhedral organelles provided the second

example of a prokaryotic organelle, which raised questions as to the distribution and the

functional diversity of related structures. Based on recent electron microscopy and

bioinformatics studies, prokaryotic polyhedral organelles appear to be more widespread

than previously thought (30). A number of photo- and chemoautotrophic bacteria have

been shown by electron microscopy to form carboxysomes (13, 49, 63). Polyhedral

organelles have been observed in Salmonella, Klebsiella, and Citrobacter during growth

on 1,2-Pd (10, 31, 45). Bioinformatic analyses indicate that 1,2-Pd degradation by

Listeria, Lactobacillus, and Clostridium also involves organelles (30). A combination of

electron microscopy and bioinformatic analyses indicates that polyhedral organelles are

needed for AdoCbl-dependent ethanolamine utilization by Salmonella, Escherichia,

Klebsiella, Fusobacterium, Listeria and Clostridium, (3, 62). Moreover, bioinformatic

studies indicate that Desulfitobacterium hafniense and Desulfovibrio desulfuricans

produce a polyhedral organelle involved in pyruvate degradation (30). Thus,

investigations indicate that at least 4 different metabolic processes occur within









polyhedral organelles; and 30/209 organisms (for which partial or complete sequence

data are available) have the potential to express such organelles (30). Furthermore, a

much larger number of metabolic processes could potentially occur within protein-bound

organelles, since the observation of such structures would likely require electron

microcopy of cells grown under specialized conditions and bioinformatic analyses would

fail to identify protein-bound organelles that lack homologues of known organelle

proteins (30).

pdu Genes of Unknown Function

There are five genes found in the pdu operon (,,lhlf 1. fVX) that are of unknown

function and lack substantial similarity to genes of known function found in GenBank

(10). The PduL enzyme is distantly related to CpcE (phycocyanobilin lyase), an enzyme

that catalyzes a thioester linkage between phycocyanobilin (a linear tetrapyrrole) and

phycocyanin (10). It was postulated that PduL might contain a pyrrole binding site, since

cobalamins are tetrapyrroles (10, 24). The PduS protein is distantly related to several

oxidoreductases (60). ExPASy analysis indicates that PduS contains an iron sulfur

binding region and one significant transmembrane domain. ExPasy analysis ofPduV

predicted a possible ATP/GTP binding motif, and sequence homology indicates PduV

may be related to the EutP protein, which has not yet been characterized (10). The PduX

protein has sequence homology to a putative kinase (10). PduM was found to lack

homology to any characterized protein found in GenBank (10).

Summary

Nearly 50 genes are devoted to the anaerobic catabolism of 1,2-Pd and de novo

synthesis of its cofactor (AdoCbl) indicating its importance to the natural lifestyle of

Salmonella (57, 71). The ability of Salmonella to degrade 1,2-Pd has been shown to be






9


important for growth in host tissues and may confer some selective advantages in

anaerobic environments. Though the process of 1,2-Pd degradation seems to be rather

straightforward, the details tell a different story. In fact, many questions about 1,2-Pd

degradation and the unusual polyhedral organelles involved in this process remain

unanswered. The focus of this thesis is to genetically characterize thepdu operon to gain

a better understanding of the role of each pdu gene in 1,2-Pd degradation and polyhedral

formation.














CHAPTER 2
GENETIC ANALYSIS OF POLYHEDRAL BODY FORMATION AND
1,2-PROPANEDIOL DEGRADATION BY Salmonella enterica

Salmonella enterica degrades 1,2-Propanediol (1,2-Pd) in an adenosyl-cobalamin

(AdoCbl) dependent fashion (38) Propanediol is a major product of the fermentation of

the common plant sugars rhamnose and fucose and is likely to be prevalent in anaerobic

environments (12, 43, 51). Accordingly, the degradation of this small molecule is

thought to be important for the growth of S. enterica in its natural environments and for

its interactions with host organisms (57, 71).

Based on biochemical and genetic studies a pathway for 1,2-Pd degradation has

been proposed. Propanediol is first converted to propionaldehyde by AdoCbl-dependent

diol dehydratase. Propionaldehyde is further metabolized to propanol and propionate,

presumably by alcohol dehydrogenase (pduQ), CoA-dependent aldehyde dehydrogenase

(pduP), phosphotransacylase, and propionate kinase (pduW) (10, 42, 51, 52, 65).

A very unusual aspect of 1,2-Pd degradation is that it involves a polyhedral

organelle (10, 30, 31). These organelles are one of the most elaborate multi-protein

complexes found in prokaryotic organisms (30). Their cross-section is 100-200 nm

(about one-tenth the length of the cell) (10, 30). They have a protein-based shell thought

to surround four different enzymes, and are composed of at least 15 different

polypeptides, (PduABB'CDEGHJKOPTU and one unidentified protein) (30). Electron

microscopy experiments have shown that the PduA protein is a component of the

organelle's shell and is essential for proper organelle formation (31). The PduCDE









dioll dehydratase) and PduP aldehydee dehydrogenase) have also been shown to be

organelle components, but these enzymes are not essential for formation of normal

appearing structures (10, 42). The roles of the remaining organelle polypeptides, as well

as, other Pdu proteins in organelle formation have not been investigated. Eight of the

organelle proteins (PduABB'JKNTU) are related in amino acid sequence to proteins

needed for the formation of carboxysomes, and hence may play structural roles in the

organelles involved in 1,2-Pd degradation (10, 30).

To further investigate the roles ofpdu genes in organelle formation and 1,2-Pd

degradation, we constructed precise nonpolar deletions of each gene in thepdu operon.

In the case of PduB and PduB' (which have overlapping coding sequences), the deletion

that was constructed eliminated the entire the coding sequences of both proteins and this

mutation is referred to aspduBB'.

The use of growth tests and indicator media showed that strains with deletions of

the pduCDE, pduG, andpduP genes were severely impaired for growth on 1,2-Pd while

pduN, pduO, pduQ, and pduW mutants showed a moderate growth defect. Interestingly,

strains with deletion of the pduA, pduBB', pduJ, genes pduK showed an extended period

of growth arrest followed by the resumption of growth. Surprisingly, strains with

deletions in the pduM, pduL, pduM, pduS, pduT, pduU, pduV, and pduX genes grew

similarly to wild-type S. enterica on 1,2-PD minimal medium under the conditions used.

A systematic electron microscopy study was conducted to determine the effects that

selected pdu deletion mutants had on polyhedral organelle formation. Results showed

that apduBB' deletion prevented the formation of polyhedra organelles, while deletions

in the pduH, pduJ, pduK, and pduM genes resulted in the formation of aberrantly shaped









organelles and proteinaceous plate-like structures that at times prevented the separation

of dividing cells. The findings that PduH and PduM deletion mutants had defects in

organelle formation were somewhat unexpected since pduH encodes the small subunit of

the putative diol dehydratase reactivation factor andpduM encodes a protein that lacks

sequence homology to proteins of known function present in GenBank.

Deletions of the pduCDE, pduG, pduL, pduN, pduO, pduP, pduQ, pduS, pduT,

pduU, pduV, pduW, pduX, gene had no apparent effect on polyhedral organelle

formation. It was surprising to us that the pduN, pduT and pduU mutants form normal

appearing organelles since the PduT, PduU, and PduN proteins have sequence similarity

to proteins needed for carboxysome formation and the PduT and PduU protein have been

shown to be organelle-associated.

Materials and Methods

Chemicals and Reagents

Formaldehyde (r, s), 1,2-propanediol, vitamin B12 (CNCbl), and antibiotics were

from Sigma Chemical Company (St. Louis, MO). Bacto-agar, MacConkey agar base,

tryptone, and yeast extract were from Difco Laboratories (Detroit, MI). Restriction

enzymes were from New England Biolabs (Beverly, MA) or Promega (Madison, WI).

T4 DNA ligase was from New England Biolabs. Glutaraldehyde was from Tousimis

(Rockville, MD). We received 2-dimethylaminoethanol from Polysciences, Inc.

(Warrington, PA). Nonenyl succinate anhydride, uranyl acetate, and vinyl cyclohexane

dioxide were from EM Sciences (Washington, PA). Propylene glycol diglycidyl ether

and osmium tetroxide were from Ted Pella Inc. (Redding, CA). Agarose, EDTA, and

ethidium bromide were from Bio-Rad (Hercules, CA). Other chemicals were from Fisher

Scientific (Pittsburgh, PA).









Bacterial Strains, Media, and Growth Conditions

The bacterial strains used in this study are listed in Table 2-1. The rich medium

used was Luria-Bertani (LB) medium (47), Lennox (Difco, Detroit, MI). The minimal

media used was the No-carbon-E (NCE) medium (8, 46, 70). Amino acids were provided

at the following concentrations: valine, isoleucine, leucine, and threonine, 0.3 mM.

Antibiotics were provided in liquid or solid rich medium at the following concentrations

unless otherwise stated: ampicillin, 100 [tg/mL; kanamycin, 25 [tg/mL; and

choramphenicol, 20 tlg/mL. MacConkey/1,2-propanediol (1,2-Pd)/CNCbl indicator

plates were composed ofMacConkey agar base supplemented with 1% 1,2-Pd and

200 ng/mL CNCbl (38). Aldehyde indicator plates were prepared according to Conway

with the following modifications: pararosaniline was added to sterile medium as a fine

powder, 200 ng/mL CNCbl was included and ethanol was replaced by 1% 1,2-Pd (18).

General Molecular Methods

Agarose gel electrophoresis was performed as described previously (59). Plasmid

DNA was purified by alkaline lysis procedure (59) or by using Qiagen products (Qiagen,

Chatsworth, CA) according to manufacturer's directions. Following restriction digestion

or PCR amplification, DNA was purified using Qiagen PCR purification or gel extraction

kits. Restriction digests were carried out using standard protocols (59). For ligation of

DNA fragments, T4 DNA ligase was used according to the manufacturer's directions.

Electroporation was carried out using a Bio-Rad Gene-Pulser, 0.2 cm gap electroporation

cuvettes, and the following settings: capacitance, 25 pF; pulse controller, 200 ohm; and

voltage, 2.5 kV. Transformed cells were incubated in 1 mL SOC medium for 1 h at

37C, 275 rpm, and then plated on LB agar containing the appropriate antibiotics.









Table 2-1. Bacterial strains
Species Strain Genotype
E. coli BE11 (E. coli ER2267) el4- (MrcA-) endA1 supE44
thi-1 relAl? RfbD1? SpoT1? A(mrcC-mrr)
114::IS 10 A(argF-lac)UJ69 recAl/FproA+B+
laclP A(lacz)M15 zzf::mini-Tnl0 (Kanr)/pMGS2
S17.1 k pir RecA (RP4-2-Tc::Mu) k pir


S. enterica
serovar
Typhimurium
LT2


Wild-type


BE47 thr-480::TnIOdCam
BE103 TR6579/pKD46 (Kanr)
BE161 TR6579/pCP20 (Apr)
TR6579 MetA22 metE551 trpD2 ivl-452 hsdLT6
hsdSA29 HsdB- strA120 GalE- Leu- Pro-
BE182 ApduA652
BE213 ApduBB'675
BE87 ApduCDE
BE53 ApduG
BE161 ApduH
BE274 ApduJ654
BE185 ApduK655
AP121 ApduL
BE155 JpduM
AP153 ApduN
BE111 Apdu0651
BE191 ApduP659
AP157 ApduQ
AP151 ApduS
BE194 ApduT662
BE195 ApduU663
AP149 pdu V
AP139 pdu W


AP148


ApduX












Table 2-2. Primers forpdu deletions completed using the Miller and Mekalanos deletion
method, restriction enzymes, and predicted insert size
Target Primers (5' 3') Restriction Predicted
gene
gene Enzymes insert size
GCTCTAGATTCCGCAGCTGGTCACCGATG
d CGATTAGGCTGATTTCGGTAAAATGCCCTCGTTATTCAT XbaI/SphI 1025 bp
GAGGCCATTTTACCGAAATCAGCCTAATCG
ACATATGTGCATGCGCTTCACCTCGCTTGCCGG
GCTCTAGACGACTGCGCCAGCCTCTGGCACGAAG
pdu CCATTACGCTTCACCTCGCTTGCCCGCCATCGATTAGGC XbaI/SphI 1221 bp
GGCAAGCGAGGTGAAGCGTAATGG
ACATATGTGCATGCCAGCGGCGTTGGCTTCATCGG
GCTCTAGAGCCGAAATCAGCCTAATCGATGGCG
CGTTCATCGCGGGCCTACCAGCCGATCCATTACGCTTCACCTCGC XbaI/SacI 1025 bp
CGGCTGGTAGGCCCGCGATGAACG
CGAGCTCGCCAGATGCATGATTTACTC
GCTCTAGAGTGCAGCGCATTGTCGAGGAGA
CATAACCGCCCCTTAACACGACAGATGCATGATTTACTC XbaI/SacI 1194bp
TCGTGTTAAGGGGCGGTTATG
CGAGCTCGCTATAGCGCATCAGCACCTGAC
GCGCGCTCTAGATATTCACCGATGAGCACGGACTGC
pdu GATGAGTTCCCACGTTAATAGCCGCTCGGGTATAAATCGCCATAACCG XbaI/SphI 910 bp
GCGGCTATTAACGTGGGAACTCATC
GGAATTCAGGCTAATCAGCTTCAGAGAGACC
GCTCTAGAGCGATACCGACAAACTCCG
GCTCATAGCAGTTCCTCCAGCATCGCGACCTCAGTTAG XbaI/SacI 976 bp
pd CTGGAGGAACTGCTATGAGC
CGAGCTCGCGCACGTTATTGACGACCACGC
GCTCTAGAGAAACTGGTGTTCCAGTATCTGC
CCTGAGACATGGTTAACCTCTTACGCTCATAGCAGTTCCTCC XbaI/SacI 1023 bp
SGTAAGAGGTTAACCATGTCTCAGG
CGAGCTCGCCGTGGGATCACCGAACGG
GCTCTAGAGACGACGTGCGGGCGGTGAACTTTCATCAG
pduT CCATTACCCCTCCACCATCTGCTGAGACATGGTTAACCTCTTAC XbaI/SphI 1036bp
CAGATGGTGGAGGGGTAATGG
ACATATGTGCATGCCGCTGTACAGGCAGCGGTTCT
GCTCTAGACTTGGTGATGCCATGCTGAAAAGC
pduU CGCTTCATGACTTTACGTCCGGGTGATCGGTTGTCTTTCCATTACCCC XbaI/SphI 1120bp
ATCACCCGGACGTAAAGTCATGAAGCG
ACATATGTGCATGCAGAGCATGTCGCCCTGCGGCATCTCCA
GCTCTAGAGCGTTTCTGACGTCAATAACGC
CCATTATTTTGTAAGACATAAAGGTTCCTTGGGGCCGATAAACATCAAACG XbaI/SacI 980 bp
AAGGAACCTTTATGTCTTACAAAATAATGG
CGAGCTCGCCAGTTCAGCGTAATAATGCCAGGG


P22 Transduction


Transductional crosses were performed as described using P22 HT105/1 int-210


(22), a mutant phage that has high transducing ability (61). For the preparation of P22


transducing lysates from strains having galE mutations, overnight cultures were grown on


LB-medium supplemented with 0.2% glucose and 0.2% galactose. Transductants were


tested for phage contamination and sensitivity by streaking on green plates against P22









Construction of In-Frame pdu Gene Deletions

Nonpolar deletions ofpduA, pduBB', and pduWwere constructed as described by

Datsenko and Wanner with some modifications (21). The pduA deletion has previously

been described (31). The primers used to amplify the kanamycin resistance cassette from

plasmid pKD4 for the pduBB' gene deletion are 5'GCCATCCCTG GTCAACCCCAA

CCTATACGAGAGACGGCTTGTAGGCTGGAGCTGCTTCG3 'and 5'TCAGATGT

AGGACGGACGATCGTTTTTCGGTTCAGAATGAATATCCTCCTTAGTTC3'. The

primers used to amplify the kanamycin resistance cassette from plasmid pKD4 for the

pduWgene deletion are 5'CTGAATTCGAAGGAACCTTTATGTCTTACAAAATAA

TGTAGGCTGGAGCTGCTTCG 3' and 5'CGAATAGTGTGCGCGCATAGTGTCAT

GGTAAAAGCGATGAATATCCTCCTTAGTTC 3'. Primer 2 homologous to priming

site 2 of the template plasmid was slightly modified to replace the idealized ribosomal

binding site (rbs) incorporated into the plasmid with the natural rbs of the gene

downstream of the target gene. Strain BE103 was used as the host strain for linear

transformation. The location of the kanamycin cassette insertion was verified as

described (21). After the insertion site was verified by PCR, the kanamycin cassette was

moved into LT2 via transduction. The kanamycin cassette was then removed using Flp

recombinase as described (21).

Nonpolar deletions ofpduCDE, pduG, pduH, pduJ, pduK, pduL, pduM, pduN,

pduO, pduP, pduQ, pduS, pduT, pduU, and pduXwere constructed using the procedure of

Miller and Mekalanos (48). PCR primers were designed as described previously (40).

Table 2-2 lists the primers used to delete the following pdu genes: pduJ, pduK, pduL,

pduM, pduN, pduO, pduQ, pduS, pduT, and pduU. After the fusion product for each

deletion was obtained, it was restricted with the enzymes listed in Table 2-2 and ligated









to pCVD442. The ligation reaction was used to transform E. coli S17/1 via

electroporation. One clone containing an insert of expected size (listed in Table 2-2) was

used to introduce the deletion into the S. enterica chromosome. For the conjugation step,

BE47 was used as the recipient, and Ampr and Camr were selected. Following the

sucrose selection step, replica printing was used to identify Amps colonies. Deletion

strains were identified with PCR using chromosomal DNA or whole cells as source of

template. The thr::TnOldCam element was removed from the deletion strain by P22

transduction selecting prototrophy. Strains were tested for phage contamination and

sensitivity by streaking on green plates against P22 H5. Replica printing was used to

verify Cams and relief from threonine auxotrophy. Finally, the deletions were verified a

second time with PCR.

Growth Curves

For aerobic growth curves, cells were grown in 16 x 100 mm test tubes containing

5 mL of the appropriate media. Cultures were incubated at 370C in a New Brunswick

gyratory water bath shaker model G-76 at 250 rpm (New Brunswick Co. Inc, Edison NJ),

and culture tubes were held in place at an angle approximately 45. Cell growth was

monitored using a Spectronic 20D+ spectrophotometer by measuring optical density at

600 nm. Inocula for the growth curves were prepared as follows: bacterial strains were

grown overnight at 37C with shaking in LB medium, and 0.125 mL of washed culture

was used to inoculate 5 mL cultures.

Aldehyde Indicator Media and MacConkey Media Tests

Aldehyde indicator plates (AIM) supplemented with Pd and vitamin B12 (CNCbl)

use a mixture of pararosaniline and bisulfite to detect the propionaldehyde produced from

1,2-Pd degradation (18). Strains producing propionaldehyde impart a red/brown color,









while those that do not appear uncolored. This test specifically indicates that activity of

AdoCbl-dependent diol dehydratase, which produces propionaldehyde from 1,2-Pd.

MacConkey agar base supplemented with 1,2-Pd and CNCbl uses bile salts and the

pH indicator neutral red to differentiate between strains that are capable of degrading

1,2-Pd to propionate. When propionic acid is produced the bile salts are precipitated

followed by absorption of the neutral red imparting a red color to colonies. Those strains

that cannot degrade 1,2-Pd to acid appear uncolored and are scored as white.

Inocula for the plate tests were prepared as follows: bacterial strains were grown

overnight at 37 C with shaking in LB medium. The broth cultures were patched onto a

LB agar plate, incubated at 37 C for 16 18 h, and replica printed onto the various

media. The various media were then incubated at 37 C forl6 18 h, and the results were

recorded.

Electron Microscopy

For electron microscopy, cells were grown on minimal medium supplemented with

1% succinate and 0.4% Pd. Cultures (10 mL) were incubated in 125 mL shake flasks at

37C, with shaking at 275 rpm in a New Brunswick C24 Incubator Shaker. Each of the

deletion mutants was fixed in 2% glutaraldehyde in 0.1 M sodium cacodylate buffer

(pH 7.2) for 30 min at room temperature and then in 1% osmium tetroxide in the same

buffer for 1 h at 40C. The samples were then dehydrated through a graded ethanol series.

In this procedure, samples were held at room temperature overnight in a solution of

75% ethanol and 1% uranyl acetate solution during the graded alcohol dehydration series

followed by absolute acetone and embedded in Spurr's low-viscosity resin. Thin sections

were cut on a LKB Nova ultramicrotome and collected on Formvar-coated grids, post









stained with both uranyl acetate and lead citrate, and then observed and photographed

using Zeiss EM-10CA transmission microscope.

Results

1,2-Pd Metabolism in Strains with Precise Nonpolar Deletion in Selected pdu Genes

Aldehyde indicator plates (AIM) detect the propionaldehyde produced from 1,2-Pd

by AdoCbl-dependent diol dehydratase, the first enzyme of 1,2-Pd degradation. Strains

producing propionaldehyde form colonies that are red/brown in color while those that do

not appear uncolored. MacConkey/1,2-Pd/CNCbl indicator medium detects propionic

acid produced from the degradation of 1,2-Pd. Strains capable of converting 1,2-Pd to

propionate form red colonies and those unable to produce propionate produce uncolored

colonies.

Using the indicator media described above, strains with precise deletions of each

pdu gene were tested for the ability to degrade 1,2-Pd to propionaldehyde and propionate

(Table 2-3). Strains with deletions inpduCDE, pduG, pduO and pduP genes were white

on MacConkey media indicating a deficiency in propionate production; however, all

otherpdu mutants tested were red indicting that they were proficient for propionate

production. On aldehyde indicator medium, only strains withpduCDE andpduG

deletions showed a defect in propionaldehyde production relative to the wild-type strain.

It was very surprising that most of the genes in the pdu operon did not have apparent

effects on 1,2-Pd degradation.

Growth Curves

Growth curves were determined for each of the pdu deletion mutant and wild-type

S. enterica using minimal medium supplemented with 0.4% Pd, and 200 ng/mL CNCbl.

The effects of deletion of the pdu genes thought to encode enzymes of the 1,2-Pd










Table 2-3. Phenotypes of pdu deletion mutants on MacConkey and AIM media
MacConkey Aldehyde indicator
Deletion 1,2-PD* CNCbl medium with 1,2-PD
indicator medium** and CNCbl
pduA red red/brown
pduB red red/brown
pduCDE white white
pduG white white
pduH red red
pduJ red red/brown
pduK red red/brown
pduL red red/brown
pduM red red/brown
pduN red red/brown
pduO red red/brown
pduP white red/brown
pduQ red red/brown
pduS red red/brown
pduT red red/brown
pduU red red/brown
pdu V red red/brown
pdu W red red/brown
pduX red red/brown
*1,2-PD = 1,2-propanediol
**MacConkey 1,2-Pd CN-B12 indicator medium detects acid production from 1,2-Pd. Strains
that can degrade 1,2-Pd are red on the medium, and strains unable to degrade 1,2-Pd are white.
***Aldehyde indicator medium detects propionaldehyde production from 1,2-Pd. Strains
expressing active Ado-B12-dependent diol dehydratase activity are red/brown on this medium,
and strains deficient in diol dehydratase activity are white.

degradative pathway are shown in Figure 2-1. Aerobically, the wild-type strain had a

growth rate of about 0.090 OD600nm/hr. Strains with deletions of the genes for

AdoCbl-dependent diol dehydratase (pduCDE) failed to grow reaching a maximum

OD600nm of only 0.250; with initial growth rates one hundred times lower than that of the

wild-type strain. Deleting the propionaldehyde dehydrogenase gene (pduP) reduced the

growth rate by two thirds, and deleting the adenosyltransferase gene (pduO) reduced the

growth rate by one third. Deletions ofpduQ and pduW genes which are thought to

encode propanol dehydrogenase and propionate kinase had slightly lower growth rates









than that of wild-type strain. Thus, the PduQ propanol dehydrogenase and the PduW

propionate kinase were not essential for aerobic growth of S. enterica on 1,2-Pd. These

enzymes may not be required under aerobic conditions. The proposed role of PduQ is the

regeneration of NAD. In the presence of oxygen, this could be accomplished by the

electron transport chain. The role of propionate kinase is the conversion of propionyl-

phosphate to propionate with the formation of ATP by substrate level phosphorylation.

Aerobically, propionyl-CoA can feed into the methylcitrate pathway and provide an ATP

source. Alternatively, S. enterica might encode functions that can replace PduQ and

PduW. The AdhE alcohol/aldehyde dehydrogenase and acetate kinase activities of

S. enterica are constitutively expressed and are capable of using 3-carbon compounds as

substrates (19, 20, 26, 69).

The PduGH genes encode the large and small subunits of a putative reactivating

factor for AdoCbl-dependent diol dehydratase (10). Growth tests showed that deletion of

the pduG gene prevented growth on 1,2-Pd minimal medium, but surprisingly deletion of

the pduH gene had little effect on the growth of S. enterica on this medium (Figure 2-2).

This is the first reported evidence the PduG reactivating factor is required for diol

dehydratase activity in vivo. These results also raise the question as to the role of the

PduH enzyme in diol dehydratase reactivation since its role is not critical to maintaining

of diol dehydratase activity at a level needed for growth on 1,2-Pd.

Studies showed that S. enterica strains having deletions in the pdu genes of

unknown function had growth rates either slightly higher than (pduM) or similar to the

wild-type strain (pduL, pduS, pduV, andpduX) on 1,2-Pd minimal medium (Figure 2-3).

This was an unexpected finding. Thepdu operon is known to encode genes essential











forl,2-Pd degradation. Since operons typically contain genes of related function, it is

expected that thepduM, pduL, pduS, pduV, and pduX have a role in 1,2-Pd degradation.

This suggested to us that thepduM, pduL, pduS, pduV, and pduX genes may be required

for 1,2-Pd degradation under specialized conditions. Further studies will be needed to

explain why these mutants lack a detectable phenotype.


-- LT2 pduCDE -- pduP -- pduQ -- pduW
1.8

1.6

1.4

1.2


0.8

0.6

0.4

0.2

0
0 5 10 15 20 25 30 35 40
Time (Hours)


Figure 2-1. Aerobic growth of the wild-type strain and 1,2-Pd pathway mutants on
1,2-Pd/CNCbl minimal media

Growth curves were also determined for S. enterica strains carrying deletions of

the pdu genes proposed to be needed for polyhedral organelle formation (pduA, pduBB',

pduJ, pduK, pduT, andpduU) and the wild-type strain on 1,2-Pd minimal medium.

Strains with pduA, pduBB', pduJ and pduK deletion showed a period of growth arrest

(interrupted growth) in comparison to the wild-type strain (Figure 2-4). Studies also

showed that strains with deletions of the pduTand pduU genes had not discernable effect

on 1,2- Pd degradation and that a PduN deletion had a slightly decreased the growth rate

on 1,2-Pd (Figure 2-5).










SLT2 -A- pduG -- pduH

1.8

1.6

1.4

1.2

1

0.8

0.6

0.4

0.2

0
0 5 10 15 20 25 30 35 40
Time (Hours)


Figure 2-2. Aerobic growth of the wild-type strain and the diol dehydratase reactivating
factor mutants on 1,2-Pd/CNCbl minimal media

Prior studies showed thatpduA mutants exhibit a period of growth arrest (31). The

data presented show thatpduBB', pduJ and pduK deletions have a similar phenotype

showing that interrupted growth is a consequence of disruption of the polyhedral

organelles rather than a specific phenotype ofpduA mutants.

The pduN deletion had a one third reduction in growth rate without period of

growth arrest. SincepduN is upstream ofpduO and the growth rates were similar, it was

hypothesized thatpduO was not being expressed in the pduN mutant due to partial

polarity. To test this hypothesis, western blot analysis using anti-PduO was completed

for the pduN deletion strain and wild-type S. enterica (data not shown). The western blot









showed a band of the expected molecular weight for PduO (36.6 kDa) being expressed

polarity. To test this hypothesis, western blot analysis using anti-PduO was completed

for the pduN deletion strain and wild-type S. enterica (data not shown). The western blot

showed a band of the expected molecular weight for PduO (36.6 kDa) being expressed

mostly in the insoluble cellular extract in both the pduN deletion and wild-type strain.

Therefore, we concluded that the pduN deletion under investigation was nonpolar. PduN

has been shown with sequence analysis to be closely related to the CcmL-CchB family of

proteins, which are needed for the proper assembly and function of carboxysomes;

however, PduN was not found to co-purify with the S. enterica polyhedral organelles.


-+- L2 pduL -*- dM-- pdS --- uV --+ pduX


Figure 2-3. Effects of deletions ofpdu genes of unknown function on growth of
S. enterica on 1,2-Pd/CNCbl minimal media


18

16

14

L2

12



OL6

04



0


0 5 10 15 20
The (Hons)


25 30 35 40












-- LT2 -- pduA -A-pduB -- pduJ -X- pduK

1.4


1.2


1.0


0.8


0.6


0.4


0.2


0.0
0 5 10 15 20 25 30 35 40 45
Time (Hours)



Figure 2-4. Aerobic growth of the wild-type strain and 4 carboxysome homologue
mutants with interrupted growth on 1,2-Pd/CNCbl minimal media



-- LT2 -- pduN -- pduT -- pduU

1.4


1.2


1.0


0.8


0.6


0.4


0.2


0.0
0 5 10 15 20 25 30 35 40 45
Time (Hours)



Figure 2-5. Aerobic growth of the wild-type strain and 3 carboxysome homologue
mutants without interrupted growth on 1,2-Pd/CNCbl minimal media



































Figure 2-6. Electron micrographs of S. enterica wild-type-LT2 and select carboxysome
homologue mutants. A) normal-LT2, B) polyhedra minus-ApduBB', or
C, D) aberrant-ApduJ, ApduK. Bars, 0.5 |tm.

Systematic Electron Microscopy Study of Organelle Formation by Selected pdu
Deletion Mutants

The effect of each pdu gene deletion had on polyhedral organelle formation is

summarized in Table 2-4. A null mutation in thepduBB' gene exhibits a polyhedral

minus phenotype similar to the effect of apduA null mutation, indicating that these genes

are essential for polyhedral organelle formation (31). Like thepduA null mutation, polar

inclusion bodies were observed in the ApduBB' strain. Additionally, aberrant polyhedra

and proteinaceous plate-like structures were observed in ApduH, ApduJ, ApduK, and

ApduM strains suggesting their importance to polyhedral organelle formation. Recent

purification and densitometry analyses of the polyhedral organelles reported that PduB,










PduB', PduH, PduJ, and PduK compose 12.8%, 12.1%, 0.6%, 11% and 1.6% of the total

polyhedra protein, respectively (30). However, the PduM protein was not identified as an

organelle component.

Table 2-4. Polyhedral phenotypes of pdu deletion mutants
Deletion Polyhedral body formation
pduA Minus
pduBB' Minus
pduCDE Normal
pduG Normal
pduH Aberrant
pduJ Aberrant
pduK Aberrant
pduL Normal
pduM Aberrant
pduN Normal
pduO Normal
pduP Normal
pduQ Normal
pduS Normal
pduT Normal
pdu U Normal
pdu V Normal
pdu W Normal
pduX Normal

Deletions of the pduCDE, pduG, pduL, pduN, pduO, pduP, pduQ, pduS, pduT,

pduU, pduV, pduW, pduX, gene had no apparent effect on polyhedral organelle

formation. It was surprising to us that the pduN, pduT and pduU mutants form normal

appearing organelles since the PduT, PduU, and PduN proteins have sequence similarity

to proteins needed for carboxysome formation and the PduT and PduU protein have been

shown to be organelle-associated (10, 30).

Discussion

Previously, it was shown that defects in 1,2-Pd metabolism are detected in strains

with the following gene deletions: ApduCDE, ApduO, and ApduP (11, 40, 42). Data









provided in this report shows that the proposed pathway genes encoding the putative

propionate kinase (PduW) and propanol dehydrogenase (PduQ) are also important for

1,2-Pd degradation though not required, since growth rates were only slightly diminished

when compared to wild-type S. enterica. This suggested that there may be redundancy of

these enzymes with other enzymes expressed by S. enterica. ThepduQ result is not

surprising since aerobically redox balance can be achieved via the electron transport

chain.

Unexpectedly, the growth rate of the ApduN deletion strain was reduced compared

to wild-type S. enterica during growth on 1,2-Pd indicating that PduN affects 1,2-Pd

degradation. PduN has been shown with sequence analysis to be closely related to the

CcmL-CchB family of proteins, which are needed for the proper assembly and function

of carboxysomes (10). Therefore, it is thought that the PduN protein has a role in the

proper formation of the polyhedral organelles involved in 1,2-Pd degradation. One

interpretation of this finding is that the organelles directly affect the rate of 1,2-Pd

degradation. Studies presented in the next chapter test this inference.

Prior sequence analyses showed the PduABB'JKNTU polypeptides are related in

amino acid sequence to proteins involved in the formation of carboxysomes (10). A

systematic electron microscopy study conducted here showed pduA and pduBB' mutants

did not form organelles during growth on 1,2-Pd and thatpduJ and pduK mutants formed

grossly aberrant organelles under similar conditions. Studies also showed thatpduN,

pduU and pduT mutants formed organelles similar to those formed by wild-type

S. enterica during growth on 1,2-Pd. Clearly, the PduA. PduBB', PduJ and PduK protein

play key structural roles in organelle formation; however, the functions of the PduN,









PduU, and PduT proteins remain uncertain. They may play minor structural roles or be

essential to proper function.

Aberrant polyhedra are also observed inpduH, and pduM deletion strains. Neither

PduH nor PduM have sequence homology to proteins shown to be involved in polyhedral

body formation. Based on sequence analyses, PduH is proposed to encode the small

subunit of a diol dehydratase reactivation factor. This polypeptide was also found to

copurify with the polyhedra (about 0.6% of the total organelle protein) (30). Thus, PduH

may have a primary role in reactivation but also contribute to organelle structure. In prior

studies, PduM was not detected as a component of the purified polyhedra organelles.

Yet, here we showed that it is needed for proper organelle formation. This raises the

possibility that PduM may be a chaperone needed for polyhedral organelle formation. At

this time, however, we have no rigorous evidence for the function of PduM.














CHAPTER 3
POLYHEDRAL ORGANELLES INVOLVED IN 1,2-PROPANEDIOL
DEGRADATION PROTECT AGAINST PROPIONALDEHYDE TOXICITY DURING
AEROBIC GROWTH OF Salmonella enterica

Salmonella enterica metabolizes 1,2-Propanediol (1,2-Pd) in a B12 dependent

manner (38). The ability to catabolize 1,2-Pd may confer a selective advantage in

anaerobic environments, since 1,2-Pd is a fermentation product of the common plant

sugars rhamnose and fucose (12, 43, 51). Past competitive index studies with mice have

shown that mutations in thepdu operon resulted in a virulence defect (32).

Ado-B12 dependent diol dehydratase initiates the first step of 1,2-Pd degradation

with the conversion of 1,2-Pd to propionaldehyde. Propionaldehyde is further

metabolized to propanol and propionate, presumably by alcohol dehydrogenase (pduQ),

CoA-dependent aldehyde dehydrogenase (pduP), phosphotransacylase, and propionate

kinase (pduW) (10, 42, 51, 52, 65). This bifurcated pathway produces an electron sink,

1 ATP, and propionate, a three-carbon compound (propionyl-CoA) that can be channeled

into central metabolism via the 2-methyl-citrate pathway (33, 57).

An unusual feature of 1,2-Pd degradation is that it involves a polyhedral organelle.

These organelles are one of the most sophisticated multi-protein complexes known in

prokaryotic systems consisting of at least 15 different polypeptides

(PduABB'CDEGHJKOPTU and one unidentified protein) (30). Sequence similarity to

carboxysome proteins suggests that the PduABB'JKNTU polypeptides are needed for the

organelle formation (10). The roles of the pduA, pduBB', pduJ and pduK genes in

organelle formation has been substantiated by genetic studies. Deletions ofthepduA or









pduBB 'genes prevents organelle formation and deletions ofpduJ, orpduK genes results

in the formation of aberrantly shaped polyhedra. However, deletions in pduNTU genes

do not confer any observable defect in organelle structure, although apduN deletion

strain was partially impaired for growth on 1,2-Pd.

It has also been shown that deletions in the pduA, pduBB ', pduJ, orpduK genes

lead to a growth defect on 1,2-Pd minimal medium (Figure 2-4). These mutations result

in a period of growth arrest that lasts for about 20 h and has been termed interrupted

growth (Figure 2-4). Based on this finding, it was proposed that growth arrest resulted

from the accumulation of propionaldehyde to toxic levels, and that the function of the

polyhedral organelles is to coordinate the rate of propionaldehyde production and

consumption to minimize aldehyde toxicity. However, no direct evidence for

propionaldehyde accumulation or toxicity has been reported.

Here we show that interrupted growth is a consequence of propionaldehyde

toxicity. High-pressure liquid chromatography (HPLC) studies and growth tests show

that propionaldehyde accumulates to toxic levels in pduA, pduBB', pduJ, and pduK

deletion mutants, but not in the wild-type strain. Furthermore studies show that

propionaldehyde accumulation precisely correlates with interrupted growth. In addition,

controls showed that neither propionate nor 1-propanol (the other major products of

1,2-Pd degradation) accumulate to inhibitory levels during growth of S. enterica on

1,2-Pd.

The rate of 1,2-Pd consumption was also examined via HPLC. Results showed that

each mutant that exhibits interrupted growth also degrades 1,2-Pd at a higher rate than

does the wild-type strain. These findings suggest that diol dehydratase activity is altered









in the mutant strains, which is consistent with the hypothesis that polyhedral organelles

function to mitigate toxicity by coordinating the rate of propionaldehyde production and

consumption through control of diol dehydratase activity. However, additional studies

described in this chapter indicated that the situation is more complex and may also

involve regulation of the PduP propionaldehyde dehydrogenase.

Table 3-1. Strain List
Species Strain Genotype
S. enterica serovar Wild-type
Typhimurium LT2
BE182 ApduA652
BE213 ApduBB'675
BE274 ApduJ654
BE185 ApduK655
AP153 ApduN
BE194 ApduT662
BE195 ApduU663

Materials and Methods

Bacterial Strains, Chemicals, and Reagents

Bacterial strains used in this study are listed in Table 3-1. The following chemicals

were ordered from Sigma Chemical Company (St. Louis, MO): 1,2-Pd and vitamin B12

(CN-Cbl). Tryptone and yeast extract were from Difco Laboratories (Detroit, MI). Other

chemicals were from Fisher Scientific (Pittsburgh, PA). The rich medium used was

Luria-Bertani (LB) medium (47), Lennox (Difco, Detroit, MI). The minimal media used

was the No-carbon-E (NCE) medium (8, 46, 70). Amino acids were provided at the

following concentrations: valine, isoleucine, leucine, and threonine, 0.3 mM.









Growth Curves

For aerobic growth curves, cells were grown either in 250 mL baffled Erlenmeyer

flasks with 100 mL appropriate media or 16 x 100 mm test tubes containing 5 mL of the

appropriate media. Cultures were incubated at 370C in a New Brunswick gyratory water

bath shaker model G-76 at 250 rpm (New Brunswick Co. Inc, Edison NJ), and culture

tubes were held in place at an angle approximately 45. Cell growth was monitored using

a Beckman model DU640 or a Spectronic 20D+ spectrophotometer by measuring optical

density at 600 nm. Inocula for the growth curves were prepared as follows: bacterial

strains were grown overnight at 37C with shaking in LB medium, and either 3.0 mL or

0.100 mL of washed culture was used to inoculate 100 mL or 5 mL cultures, respectively.

HPLC Analysis

High-performance liquid chromatography (HPLC) was utilized to analyze the

growth media of all the deletion mutants thought to be involved in polyhedral body

formation and wildtype-LT2. (See Growth Curves Section of Materials and Methods for

specific growth conditions.) The procedure involved sampling 1.0 mL of growth media

every two h for 64 h from a 100 mL culture of minimal NCE (no-carbon-E) media

supplemented with 0.4% 1,2-Pd, 1.0 mM MgSO4, 0.3 mM VILT (amino acids), and

200 ng/mL CNCbl for each of the putative shell deletion strains (ApduA, ApduBB',

ApduJ, ApduK, ApduN, ApduT, and ApduU) and wildtype-LT2. Each of the 1.0 mL

samples was read spectrophotometrically with a Beckman model DU640 at wavelength

600 nm and then spun down at 12,000 rpm for two minutes at 40C. The supernatants

were stored at -200C in tubes with O-ring screw caps until HPLC analysis. Organic

fermentation products were measured by HPLC using a Waters 1500 Series









chromatograph equipped with a Bio-Rad Aminex HPX 87H ion exclusion column (room

temperature; 4 mM H2SO4; flow rate 0.4 mL min' or 0.3 mL min-; injection volume,

50 [tL) and dual detectors (refractive index monitor and UV detector at 210 nm).

Standards were prepared for 1,2-Pd, propionaldehyde, propionate, and 1-propanol (w/v)

in volumetric flasks at 40C using minimal NCE media as solvent. Waters Breeze

software was used to analyze the data. Samples were thawed in a water bath, filtered,

and stored on ice until being loaded into the autosampler. Standards were run before

samples, after every sixth sample, and at the end of each sample run.

Dose Response Growth Curves

Minimal medium supplemented with 1% succinate, 1.0 mM MgSO4, and

0.2% 1,2-Pd were used for cell growth. Cells were cultured in 16 x 100 mm test tubes

containing 5 mL of media. Cultures were incubated at 37 C in a New Brunswick model

G-76 shaker/water bath at 250 rpm (New Brunswick Co. Inc, Edison NJ).

Propionaldehyde, propionate, or 1-propanol were added to culture media at various

concentrations as indicated in the results section, and cell growth was monitored by

measuring optical density at 600 nm with a Spectronic 20D+ spectrophotometer. Inocula

for the growth curves were prepared as follows: bacterial strains were grown overnight at

37C with shaking in LB medium, and 0.125 mL of washed culture was used to inoculate

5 mL cultures.

Results

Effect of CNCbl Concentration on the Growth of Wild-type S. enterica and Selected
pdu Mutants on 1,2-Pd Minimal Medium.

Wild-type S. enterica and selectedpdu deletion mutants were grown on 1,2-Pd

minimal medium supplemented with various concentrations of CNCbl (0.00625 [tg/mL,









0.0125 tlg/mL, 0.0250 tlg/mL, 0.05 tlg/mL, 0.1 tlg/mL, or 0.2 tlg/mL). Each ofthepdu

mutants (ApduBB', ApduJ, ApduK, ApduN, ApduT, and ApduU) were capable of growth

under these conditions (Figure 3-1A-F). However, a period of growth arrest was

observed in strains carrying pduBB ', pduJ, and pduK deletions at CNCbl concentrations

>0.1 tlg/mL (Figure 3-1A-B). At CNCbl concentrations <0.05 tlg/mL the growth profile

of the pduBB ', pduJ, pduK deletion mutants was similar to that of the wild-type strain

(Figure 3-1C-F).

It was interesting that the pdu mutants examined exhibited interrupted growth at

higher concentrations of CNCbl, but not at lower CNCbl concentrations. This finding is

consistent with the idea that interrupted growth results from propionaldehyde toxicity

(30, 31). Presumably diol dehydratase would be more active at higher CNCbl levels and

produce more propionaldehyde from 1,2-Pd. These findings are similar to results

previously reported for apduA deletion strain (31). However, they extend those findings

by showing the phenomenon of interrupted growth and its dependency on CNCbl

concentration is not unique to thepduA deletion mutant, and is a general characteristic of

mutants that are unable to form organelles or that form grossly misshapen structures.

Propionaldehyde Formation

To test the hypothesis that the growth arrest ofpduA, pduBB', pduJ and pduK

deletion mutants resulted from propionaldehyde toxicity, wild-type S. enterica and these

deletion mutants were grown on 1,2-Pd minimal medium and the amount of

propionaldehyde released into the culture medium was followed over time by HPLC.

Results showed that propionaldehyde levels were at least 2.5-times higher in culture

broths ofpduA, pduBB', pduJ, and pduK deletion mutants compared to wild-type strain.









































I-'LT-AP147 AP226 AP178M AP158AP153-AP165-AP16


E









0 O
YZII))J IY


. N JN *l 0I 4


Figure 3-1. Aerobic growth curves of wild-type-LT2 and polyhedral organelle mutants in
1,2-Pd minimal broth with various concentrations of CNCbl: A) 0.2 [tg/mL,
B) 0.1 [tg/mL, C) 0.05 [tg/mL, D) 0.025 [tg/mL, E) 0.0125 [tg/mL,
F) 0.00625 [tg/mL (AP147, ApduA; AP226, ApduBB'; AP178, ApduJ; AP158,
ApduK; AP153, ApduN; AP165, ApduT; AP163, ApduU).


-LT2-APl47 AP226 AP178-AP158--AP153-AP165-AP16I


P-LT2-APl47 AP226 AP178-AP158"-AP153--AP165-AP163
Y


*-LT2AP147 AP226 AP178-AAP158-53-AP1AP165-AP


















--Propionaldehyde --pduA


A

















0 10 20 30 40 50 60
Time (Hours)


- Propionaldehyde pduBB'


0 10 20 30 40 50 60 70
Time (Hours)


-+Propionaldehyde -. pduK


0 10 20 30 40 50 60
Time (Hours)

-+ Propionaldehyde -.-pduT|


0 10 20 30 40 50 60 70
Time (hrs)


1.4 9


1.2 B

1.0




0.6 4
o3
0.4 i
2 -
0.2


70 0 10 20 30 40 50 60

Time (hrs)

Propionaldehyde -*pduJ

1.4 9


0.6 4
o3
0.4


0.2


0.0 0
0 10 20 30 40 50 60
Time (Hours)

P-Propionaldehyde pduN

1.4 9


.2 8 F
87 T
1.20

626
.8 5


0.6 4

o3
0.4
2.2
0.2 1



0 10 20 30 40 50 60
Time (Hours)

p-Propionaldehyde --pduU

1.4 9


1.2 H


1.0

0.8 5


0.6 4
o3
0.4 p


0.2


0 10 20 30 40 50 60
Time (hrs)


Figure 3-2. HPLC analysis of propionaldehyde levels in wild-type and polyhedral

organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal


broth: A) LT2, B) ApduA, C) ApduBB', D) ApduJ, E) ApduK, F) ApduN,


G) ApduT, H) ApduU.


I Propionaldehyde --LT21











-- LT2 --pduA --pduB -x-pduJ --pduK --pduN --pduT -pduU


12 15 18 21 24 27 30 33 36 39 42 45 48 51 54
Time (hrs)


Figure 3-3. HPLC analysis of 1,2-Pd consumption in wildtype-LT2 and polyhedral
organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal
broth. Rates were calculated using linear regression of the points in the linear
portion of the descending slope. Sample size ranged from 5 to 9 data points,
and R2 values were all above 0.98.

Accumulation of propionaldehyde in culture broths of the deletion mutants precisely

correlated with the period of "interrupted" growth", increasing at the beginning of growth

arrest and leveling off just before growth resumed (Figure 3-2 A-E). These results

support the hypothesis that interrupted growth results from propionaldehyde toxicity.

Strains with deletion of the pduN, pduT, and pduU genes accumulated less than half

the propionaldehyde observed for the wild-type strain (Figure 3-2 A, F-H). ThepduN,

pduT, andpduU genes have sequence similarity to genes needed for carboxysome

formation, but deletion of these genes does not result in interrupted growth. Less


70

60

50

40

30

20

10









propionaldehyde production indicates that diol dehydratase activity is reduced in strains

carrying deletions of the pduN, pduT, or pduU genes. This finding together with those

described above indicate that the polyhedral organelles have the capacity to influence diol

dehydratase activity both positively and negatively. In principle, this would provide an

effective means of coordinating the rate of propionaldehyde production and consumption

to allow maximal growth with minimal toxicity.

Effect of Selected pdu Deletion Mutations on 1,2-Pd Consumption

HPLC was used to measure the consumption of 1,2-Pd during growth of the

wild-type strain and selectedpdu mutants on 1,2-Pd minimal medium (Figure 3-3).

Deletion strains that resulted in the absence of polyhedra or the formation of aberrant

polyhedra (ApduA, ApduBB, Apdu J, and ApduK) utilized 1,2-Pd at a rate as much as

23% faster than the wild-type strain, while deletion strains that had no effect on

polyhedra formation (ApduN, ApduT, ApduU andApduT) had the same rate or utilized

1,2-Pd as much as 40% slower than wild-type-LT2.

These results correlate with the propionaldehyde production data presented above

in that strains that degrade 1,2-Pd faster produce more propionaldehyde and vice versa.

This further supports the idea that the polyhedral organelles can influence diol

dehydratase activity both positively and negatively. One manner in which this could be

brought about is through control of AdoCbl availability, and some support for the

supposition comes from findings that showed pduA, pduBB ', pduJ and pduK deletion

mutants grow similarly to wild-type at low CNCbl concentration, but display interrupted

growth at higher levels of CNCbl.









Propionate Secretion

Propionate is also a major product of 1,2-Pd degradation. Therefore, propionate

levels were evaluated and graphed versus time for selectedpdu mutants and wild-type

S. enterica (Figure 3-6 A-H). ThepduA andpduBB' deletion mutants secreted about the

same amount of propionate as the wild-type with a maximum concentration of about

12.5 mM being detected in culture broths (Figure 3-6 A-C). The pduJ and pduK deletion

mutants secreted about one third less total propionate when compared to the wild-type

with a maximum concentration of about 8 mM for both strains (Figure 3-6 A, D, E). The

pduN deletion mutant secreted the lowest amount of propionate (less than 6.5 mM)

(Figure 3-6 F). The pduT and pduU deletion mutants secreted about the same amount of

propionate as the wild-type strain (Figure 3-6 A, G, H).

Overall, pduA and pduBB' deletion mutants produced propionate similarly to

wild-type, but strains with pduJ, pduK, pduN, pduT orpduU deletion mutations showed a

slight to moderate deficiency in propionate production. These findings do not correlate in

any simple way with the measured rates of 1,2-Pd consumption and propionaldehyde

production. However, the observed phenotypes ofpduJ and pduK deletion mutations

could be explained by effects on both diol dehydratase and propionaldehyde

dehydrogenase activity. Strains with deletion ofthepduJ and pduK genes had increased

diol dehydratase activity (as observed by an increased rate of 1,2-Pd consumption), but

reduced propionate production. This could have resulted from an impairment of the

propionaldehyde dehydrogenase (PduP), since this enzyme converts propionaldehyde to

propionyl-CoA (an essential step in propionate formation).

















--Propionate(mM) -LT2


10 20 30 40 50 60
Time (Hours)


c
0 ,

I
Q _2
at


|+Propionate(mM) -pduBB'


Propionate (mM) pduA
16 1.4

4 B 1.2



10
0.8 0

0.6
6
0.4

0.2

0 0
0 10 20 30 40 50 60 70
Time (Hours)


*-Propionate(mM) --pduJ


1.4 16


0 10 20 30 40 50 60 70 0 10 20 30 40 50 60
Time (Hours) Time(Hours)

*-Propionate (mM) -pduK -Propionate (mM) --pduN


1.2 14

12

S10
0.8 2 2

0.6 .

0.4
4

0.2 2


0 10 20 30 40 50 60 70
Time (Hours)


--Propionate (mM) -pduT


0 10 20 30 40 50 60
Time (Hours)


0 10 20 30 40 50 60 70
Time (Hours)


*-Propionate(mM) --pduU


12

10
0.8

0.6 ."

0.4

0.2 2

0 0
70 0


H


1.2

1

0.8 2

0.6

0.4

0.2


10 20 30 40 50 60
Time (Hours)


Figure 3-4. HPLC analysis of propionate levels in wild-type-LT2 and polyhedral

organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal

broth: A) LT2, B) ApduA, C) ApduBB', D) ApduJ, E) ApduK, F) ApduN,

G) ApduT, H) ApduU.


16

14 A

12

10



6I
S


16

14 C

12

10



~6


1.4


E


F


-
















S1-Propanol -LT2


0 10 20 30 40 50 60
Tme (Hours)

-i Propanol pduBB'
35

30 @


0 10 20 30 40 50 60
Time (Hours)

-l1Propunol-.-pduK


E






,


0 10 20 30 40 50 60 70
Time (Hours)

-- 1Propanol --pduT

1.4 35

SG i .2 30

1 25

So0.8 9 20

S0.6 15


10 20 30 40 50 60
Time (Hors)


S1 Propanol --pduA
1.4 35 1

12 30 1








0.4 0





0 0 10 20 30 40 50 60 70

Time (Hours)

| 1-Propanol ppduJ|
1.4 35 1

,2 D / ,


0 0 10 20 30 40 50 60 70
Time (Hours)

--1 Propanol --pduN
1.4 35 1

1.2 30 F

1 25 1

0.8! 220




0.4 10 C I
0.2 5
&


0 10 20 30 40 50 60 70
Time (Hours)

1-Propanol --pduU


0 10 20 30 40 50 60 70
Time (Hours)


Figure 3-5. HPLC analysis of 1-propanol levels in wild-type-LT2 and the polyhedral

organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal

broth: A) LT2, B) ApduA, C) ApduBB', D) ApduJ, E) ApduK, F) ApduN,

G) ApduT, H) ApduU.


35

30

25

1 20


0









1-Propanol Secretion

1-Propanol accumulation in culture broths of the wild-type strain and selected pdu

mutants during growth on 1,2-Pd minimal medium was also measured. Levels of

1-propanol detected oscillated for unknown reason; hence the reliability of these data are

in question. However, the overall data trends for 1-propanol production by each of the

deletion mutant were consistent.

In general, all of the polyhedral organelle deletion mutants secreted less 1-propanol

than the wild-type strain independent of propionaldehyde levels. Levels of 1-propanol

tended to increase to a maximum and then decrease for all the strains tested. Also, all of

the deletion mutants reached a maximum 1-propanol concentration 2 10 h after the

wild-type maximum was met.

The mutant strains that are unable to produce polyhedral organelles (pduA and

pduBB') secreted about 40% less 1-propanol than the wild-type (Figure 3-5 B, C). The

deletion mutants that form aberrant polyhedra (ApduJand ApduK) secreted 10% and 30%

less 1-propanol than the wild-type, respectively (Figure 3-5 A, D, E). Finally the deletion

mutants that form seemingly normal polyhedra (ApduN, ApduT, and ApduU) secreted

35%, 26%, and 25% less 1-propanol than the wild-type.

The deficiency of 1-propanol production in the deletion mutants suggests that the

alcohol dehydrogenase (PduQ) might be associated with the polyhedral organelles. If so,

it is not an integral component since it was not present in the purified structures (30).

Nonetheless, PduQ might be peripherally associated with the organelles and could have

been removed by the detergent treatment used for organelle purification. It would make








44


--LT2-0 -LT2-4(mM)-LT2-8mM LT2-12 mM LT2-16 mM--LT2-20 mM -LT2-0 -LT2-4mM LT2-8 mM LT2-12mM LT2-16mM -LT2-20mM
1.8 12
.6 A B

12 08

H 06
08 8
006-1 i 06
0604

02
02

0 5 10 15 20 25 30 0 2 4 6 8 10 12
Time (hours) Time (hours)

[-LT2-0 -LT2-4mM LT2-8mM LT2-12mM- LT2-16 mM -LT2-20 mM




08
E
12





06



02

0
0 2 4 6 8 10 12
Time (hours)


Figure 3-6. Dose response growth curves ofwild-type-LT2 in minimal succinate, 1,2-Pd
broth dosed with 0 -20 mM: A) propionaldehyde, B) propionate,
C) 1-propanol.


some sense for PduQ to be in such a location since it could trap propionaldehyde as it


exits from the organelle and convert it to the less toxic 1-propanol.


Effect of Propionaldehyde, Propionate, and 1-Propanol Supplementation on the
Growth of S. enterica.


If propionaldehyde toxicity does indeed account for growth arrest of mutants


defective in polyhedral organelle formation, this compound should accumulate to toxic


levels in culture broths. Above we showed that propionaldehyde levels reach 4 8 mM


in organelle-defective mutants, but rises to only 1 2 mM in wild-type S. enterica during


growth on 1,2-Pd. To access potential toxicity of propionaldehyde, wild-type S. enterica


was cultured on NCE minimal medium (containing 1 % succinate as the carbon and


energy source) supplemented with various concentrations of this compound. Growth









arrest was observed in cultures of wild-type S. enterica supplemented with 8, 12, 16, and

20 mM propionaldehyde, but only very slight inhibition was observed with 4 mM

proionaldehyde (Figure 3-6 A). The period of growth arrest was dependent on the

propionaldehyde concentration in the cultures; higher amounts of propionaldehyde

resulted in longer the periods of interrupted growth. These experiments showed that

propionaldehyde is inhibitory to the growth of S. enterica at levels observed to occur

during interrupted growth ofpduA, pduBB ', pduJ and pduK mutants (8 mM)

(Figure 3-2 B-E). It was observed that toxicity was somewhat greater when

propionaldehyde was generated by growing cells compared to addition of

propionaldehyde to culture medium. This could be accounted for if propionaldehyde

reaches higher intracellular concentration when generated as a metabolic intermediate

(compared to entering from the growth medium), which seems likely.

The finding that propionaldehyde is toxic to S. enterica when it reaches levels near

8 mM together with the finding that levels near this value accumulate in culture broths of

pdu deletion mutants unable to form organelles provides direct evidence that interrupted

growth results from propionaldehyde toxicity.

As a control, culture broths were supplemented with 1-propanol and propionic

acid at levels near those reached during 1,2-Pd degradation. In contrast to the results

obtained with propionaldehyde, neither propionate nor 1-propanol were inhibitory to the

growth of S. enterica at the levels used (Figure 3-6 B, C). Prior studies indicated that

interrupted growth resulted from the accumulation of a toxic metabolite derived from

1,2-Pd. Thus, the results presented above provide further support for the hypothesis that









the polyhedral organelles under investigation here function to mitigate propionaldehyde

toxicity.

Discussion

Previous studies showed a pduA, pduBB ', pduJ and pduK deletion mutants are

impaired for polyhedral body formation and undergo an extended period of growth arrest

during the degradation of 1,2-Pd that is not observed in the wild-type. It was proposed

that growth arrest (interrupted growth) resulted from the accumulation of

propionaldehyde to toxic levels, but no direct evidence of propionaldehyde toxicity was

reported. Here we showed that propionaldehyde accumulates to toxic levels inpduA,

pduBB ', pduJ and pduK deletion mutants during growth on 1,2-Pd, but not in the

wild-type strain. Results also showed that propionaldehyde levels begin to rise at the

onset of growth arrest and fall off just before growth resumes. This finding provides

compelling direct evidence that the interrupted growth observed inpduA, pduBB ', pduJ

and pduK deletion mutants during 1,2-Pd degradation results from propionaldehyde

toxicity. Since pduA, pduBB ', pduJ and pduK deletion mutants are also impaired for

organelle formation, these data support the hypothesis that the polyhedral organelles

formed by S. enterica during growth on 1,2-Pd function to mitigate propionaldehyde

toxicity.

A previous proteomic analysis of Klebsiellae pneumonia during glycerol

fermentation to 1,3-Pd found an increased number of stress proteins were formed during

this metabolic process, and the authors speculated that the increased formation of these

proteins "might provide a means to protect against stress or toxic conditions caused by a

possible accumulation of 3-hydroxypropionaldehyde" (72). Additionally,

3-hydroxypropionaldehyde has been shown to induce growth inhibition in Enterobacter











(a,p,,l,'i'i, ti., K. pneumoniae, and Citrobacterfreundii (7). These findings suggest that

aldehyde toxicity may be a problem of general importance during catabolic processes.


35


30


25


20


15


10


5


0~~ ---
LT2 pduA pduB pduJ pduK pduN pduT pduU
OPropioniate Proplonaldehyde 1 -Propanol


Figure 3-7. HPLC analysis of maximum production levels of propionate,
propionaldehyde and 1-propanol in wild-type-LT2 and polyhedral organelle
deletion strains during aerobic growth on 1,2-Pd/CNCbl minimal broth

In addition, a DNA microarray analysis on the long-term adaptive responses of

E. coli found increased expression of a number of genes involved in the RpoS-dependent

general stress response when propionate was added to the growth medium (53).

Therefore, it seemed likely that a variety of fermentation products could affect cell

growth. Accordingly, the effects of each major fermentation product derived from 1,2-Pd

(propionaldehyde, propionate, and 1-propanol) were tested for potential toxic effects on

cell growth. Results showed that of the three compounds only propionaldehyde induced

growth arrest at levels observed to accumulate in culture broths during 1,2-Pd









degradation (Figure 3-6). Furthermore, the maximum levels of propionaldehyde,

propionate and 1-propanol for wild-type-LT2, ApduA, ApduBB', ApduJ, ApduK, ApduN,

ApduT, and ApduU show that only propionaldehyde levels are consistently greater in

organelle-deficient mutants compared to the wild-type strain (Figure 3-7).

Prior studies also showed that apduA deletion mutant showed interrupted growth at

higher CNCbl concentrations, but not at lower concentrations. These findings were

interpreted to suggest that the polyhedral organelles mitigate propionaldehyde toxicity

through control of diol dehydratase activity via regulation of cofactor availability. The

HPLC studies reported here suggest a more complex situation. ThepduA andpduBB'

mutants which do not form polyhedral organelles utilize 1,2-Pd about 20% faster than the

wild-type suggesting that the organelles can have an inhibitory effect on diol dehydratase

(Figure 3-3). In the mutants that formed aberrant organelles (ApduJ and ApduK), 1,2-Pd

utilization rates were only marginally faster than the wild-type. However,

propionaldehyde accumulated to elevated levels, and propionate production was impaired

suggesting these mutants might affect propionaldehyde dehydrogenase activity. In the

mutants that formed normal appearing polyhedra, the rates of 1,2-Pd consumption were

either about 25% slower (ApduN and ApduU), or similar to the wild-type (ApduT)

(Figure 3-3). These data suggest that proteins of the polyhedral organelles can also have

a negative effect on 1,2-Pd consumption. Thus from the work presented here, we

conclude that the polyhedral organelles can have both positive and negative effects on

diol dehydratase activity and can also influence the activity of the propionaldehyde

dehydrogenase (PduP). This suggests a somewhat intricate mechanism for optimizing






49


growth while minimizing propionaldehyde toxicity that operates by coordinating the rates

of propionaldehyde production and consumption.
















LIST OF REFERENCES


1. Abeles, R. H. 1983. Suicide enzyme inactivators. Basic Life Sci. 25:287-305.

2. Ailion, M., T. A. Bobik, and J. R. Roth. 1993. Two global regulatory systems
(Crp and Arc) control the cobalamin/propanediol regulon of Salmonella
typhimurium. J. Bacteriol. 175:7200-7208.

3. Aldrich, H. C., Bobik, T. A., Williams, D. S., and R. J. Busch.. 1998. Polyhedral
inclusion bodies in enteric bacteria. J2 Abstract 98th Gen. Meet. Am. Soc.
Microbiol. 1998. Am. Soc. Microbiol., Atlanta, GA.

4. Babior, B. M., T. H. Moss, and D. C. Gould. 1972. The mechanism of action of
ethanolamine ammonia lyase, a B 12 -dependent enzyme. X. A study of the
reaction by electron spin resonance spectrometry. J. Biol. Chem. 247:4389-4392.

5. Bachovchin, W. W., R. G. Eagar, Jr., K. W. Moore, and J. H. Richards. 1977.
Mechanism of action of adenosylcobalamin: glycerol and other substrate analogues
as substrates and inactivators for propanediol dehydratase--kinetics,
stereospecificity, and mechanism. Biochemistry 16:1082-1092.

6. Baker, C. S., I. Morozov, K. Suzuki, T. Romeo, and P. Babitzke. 2002. CsrA
regulates glycogen biosynthesis by preventing translation of glgC in Escherichia
coli. Mol. Microbiol. 44:1599-1610.

7. Barbirato, F., J. P. Grivet, P. Soucaille, and A. Bories. 1996.
3-Hydroxypropionaldehyde, an inhibitory metabolite of glycerol fermentation to
1,3-propanediol by enterobacterial species. Appl. Environ. Microbiol. 62:1448-
1451.

8. Berkowitz, D., J. M. Hushon, H. J. Whitfield, Jr., J. Roth, and B. N. Ames.
1968. Procedure for identifying nonsense mutations. J. Bacteriol. 96:215-220.

9. Bobik, T. A., M. Ailion, and J. R. Roth. 1992. A single regulatory gene integrates
control of vitamin B12 synthesis and propanediol degradation. J. Bacteriol.
174:2253-2266.

10. Bobik, T. A., G. D. Havemann, R. J. Busch, D. S. Williams, and H. C. Aldrich.
1999. The propanediol utilization (pdu) operon of Salmonella enterica serovar
Typhimurium LT2 includes genes necessary for formation of polyhedral organelles
involved in coenzyme B(12)-dependent 1, 2-propanediol degradation. J. Bacteriol.
181:5967-5975.









11. Bobik, T. A., Y. Xu, R. M. Jeter, K. E. Otto, and J. R. Roth. 1997. Propanediol
utilization genes (pdu) of Salmonella typhimurium: three genes for the propanediol
dehydratase. J. Bacteriol. 179:6633-6639.

12. Bry, L., P. G. Falk, T. Midtvedt, and J. I. Gordon. 1996. A model of host-
microbial interactions in an open mammalian ecosystem. Science 273:1380-1383.

13. Cannon, G. C., S. H. Baker, F. Soyer, D. R. Johnson, C. E. Bradburne, J. L.
Mehlman, P. S. Davies, Q. L. Jiang, S. Heinhorst, and J. M. Shively. 2003.
Organization of carboxysome genes in the thiobacilli. Curr. Microbiol. 46:115-119.

14. Chen, P., M. Ailion, T. Bobik, G. Stormo, and J. Roth. 1995. Five promoters
integrate control of the cob/pdu regulon in Salmonella typhimurium. J. Bacteriol.
177:5401-5410.

15. Chen, P., M. Ailion, N. Weyand, and J. Roth. 1995. The end of the cob operon:
evidence that the last gene (cobT) catalyzes synthesis of the lower ligand of vitamin
B12, dimethylbenzimidazole. J. Bacteriol. 177:1461-1469.

16. Chen, P., D. I. Andersson, and J. R. Roth. 1994. The control region of the
pdu/cob regulon in Salmonella typhimurium. J. Bacteriol. 176:5474-5482.

17. Conner, C. P., D. M. Heithoff, S. M. Julio, R. L. Sinsheimer, and M. J. Mahan.
1998. Differential patterns of acquired virulence genes distinguish Salmonella
strains. Proc. Natl. Acad. Sci. U. S. A. 95:4641-4645.

18. Conway, T., G. W. Sewell, Y. A. Osman, and L. O. Ingram. 1987. Cloning and
sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis. J.
Bacteriol. 169:2591-2597.

19. Dailly, Y., F. Mat-Jan, and D. P. Clark. 2001. Novel alcohol dehydrogenase
activity in a mutant of Salmonella able to use ethanol as sole carbon source. FEMS
Microbiol. Lett. 201:41-45.

20. Dailly, Y. P., P. Bunch, and D. P. Clark. 2000. Comparison of the fermentative
alcohol dehydrogenases of Salmonella typhimurium and Escherichia coli.
Microbios 103:179-196.

21. Datsenko, K. A. and B. L. Wanner. 2000. One-step inactivation of chromosomal
genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A.
97:6640-6645.

22. Davis, R. W., D. Botstein, and Roth J.R. 1980. Advanced bacterial genetics: a
manual for genetic engineering. Cold Spring Harbor Laboratory, Cold Spring
Harbor, N. Y.

23. Escalante-Semerena, J. C. and J. R. Roth. 1987. Regulation of cobalamin
biosynthetic operons in Salmonella typhimurium. J. Bacteriol. 169:2251-2258.









24. Fairchild, C. D., J. Zhao, J. Zhou, S. E. Colson, D. A. Bryant, and A. N.
Glazer. 1992. Phycocyanin alpha-subunit phycocyanobilin lyase. Proc. Natl. Acad.
Sci. U. S. A. 89:7017-7021.

25. Ford, J. E., E. S. Holdsworth, and S. K. Kon. 1955. The biosynthesis of vitamin
B12-like compounds. Biochem. J. 59:86-93.

26. Fox, D. K. and S. Roseman. 1986. Isolation and characterization of homogeneous
acetate kinase from Salmonella typhimurium and Escherichia coli. J. Biol. Chem.
261:13487-13497.

27. Friedberg, D., A. Kaplan, R. Ariel, M. Kessel, and J. Seijffers. 1989. The 5'-
flanking region of the gene encoding the large subunit of ribulose-1,5-bisphosphate
carboxylase/oxygenase is crucial for growth of the cyanobacterium Synechococcus
sp. strain PCC 7942 at the level of CO2 in air. J. Bacteriol. 171:6069-6076.

28. Friedmann, H. C. 1975. Biosynthesis of corrinoids, p. 75-103. In B. M. Babior
(ed.), Cobalamin. John Wiley and Sons, N. Y.

29. Hamilton, J. A., Y. Tamao, R. L. Blakley, and R. E. Coffman. 1972. Electron
paramagnetic resonance studies on cobalamin-dependent ribonucleotide reduction.
Biochemistry 11:4696-4705.

30. Havemann, G. D. and T. A. Bobik. 2003. Protein content of polyhedral organelles
involved in coenzyme B 12-dependent degradation of 1,2-propanediol in
Salmonella enterica serovar Typhimurium LT2. J. Bacteriol. 185:5086-5095.

31 Havemann, G. D., E. M. Sampson, and T. A. Bobik. 2002. PduA is a shell
protein of polyhedral organelles involved in coenzyme B(12)-dependent
degradation of 1,2-propanediol in Salmonella enterica serovar typhimurium LT2. J.
Bacteriol. 184:1253-1261.

32. Heithoff, D. M., C. P. Conner, U. Hentschel, F. Govantes, P. C. Hanna, and M.
J. Mahan. 1999. Coordinate intracellular expression of Salmonella genes induced
during infection. J. Bacteriol. 181:799-807.

33. Horswill, A. R. and J. C. Escalante-Semerena. 1997. Propionate catabolism in
Salmonella typhimurium LT2: two divergently transcribed units comprise theprp
locus at 8.5 centisomes, prpR encodes a member of the sigma-54 family of
activators, and the prpBCDE genes constitute an operon. J. Bacteriol. 179:928-940.

34. Huennekens, F. M., K. S. Viktols, K. Fujii, and D. W. Jacobsen. 1982.
Biosynthesis of the cobalamin coenzymes, In D. Dolphin (ed.), B12. John Wiley and
Sons, N. Y.

35. Ishida, A. and T. Toraya. 1993. Adenosylcobinamide methyl phosphate as a
pseudocoenzyme for diol dehydrase. Biochemistry 32:1535-1540.









36. luchi, S., D. C. Cameron, and E. C. Lin. 1989. A second global regulator gene
(arcB) mediating repression of enzymes in aerobic pathways of Escherichia coli. J.
Bacteriol. 171:868-873.

37. luchi, S. and E. C. Lin. 1988. arcA (dye), a global regulatory gene in Escherichia
coli mediating repression of enzymes in aerobic pathways. Proc. Natl. Acad. Sci.
U. S. A. 85:1888-1892.

38. Jeter, R. M. 1990. Cobalamin-dependent 1,2-propanediol utilization by Salmonella
typhimurium. J. Gen. Microbiol. 136 (Pt 5):887-896.

39. Jeter, R. M., B. M. Olivera, and J. R. Roth. 1984. Salmonella typhimurium
synthesizes cobalamin (vitamin B12) de novo under anaerobic growth conditions. J.
Bacteriol. 159:206-213.

40. Johnson, C. L., E. Pechonick, S. D. Park, G. D. Havemann, N. A. Leal, and T.
A. Bobik. 2001. Functional genomic, biochemical, and genetic characterization of
the SalmonellapduO gene, an ATP:cob(I)alamin adenosyltransferase gene.
J. Bacteriol. 183:1577-1584.

41. Lawhon, S. D., J. G. Frye, M. Suyemoto, S. Porwollik, M. McClelland, and C.
Altier. 2003. Global regulation by CsrA in Salmonella typhimurium. Mol.
Microbiol. 48:1633-1645.

42. Leal, N. A., G. D. Havemann, and T. A. Bobik. 2003. PduP is a coenzyme-a-
acylating propionaldehyde dehydrogenase associated with the polyhedral bodies
involved in Bi2-dependent 1,2-propanediol degradation by Salmonella enterica
serovar Typhimurium LT2. Arch. Microbiol. 180:353-361.

43. Lin, E. C. 1987. Dissimilatory pathways for sugars, polyols, and carboxylates, p.
244-284. In F. D. Niedhardt, K. B. Ingraham, K. B. Low, et al. (eds.), Escherichia
coli and Salmonella typhimurium: Cell. Mol. Biol. Am. Soc. Microbiol.,
Washington D. C.

44. Liu, M. Y., H. Yang, and T. Romeo. 1995. The product of the pleiotropic
Escherichia coli gene csrA modulates glycogen biosynthesis via effects on mRNA
stability. J. Bacteriol. 177:2663-2672.

45. Marco, E., I. Martinez, M. Ronentarazi, M. I. Orus, and A. Kaplan. 1994.
Inactivation of Ccmo in Synechococcus Sp Strain Pcc-7942 Results in A Mutant
Requiring High-Levels of CO2. Appl. Environ. Microbiol. 60:1018-1020.

46. Marco, E. and M. I. Orus. 1993. Trichlorfon-Induced Inhibition of Nitrate and
Ammonium Uptake in Cyanobacteria. J. Exper. Bot. 44:501-508.

47. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Habor
Laboratory, Cold Spring Harbor, N. Y.









48. Miller, V. L. and J. J. Mekalanos. 1988. A novel suicide vector and its use in
construction of insertion mutations: osmoregulation of outer membrane proteins
and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol.
170:2575-2583.

49. Mori, K., T. Tobimatsu, T. Hara, and T. Toraya. 1997. Characterization,
sequencing, and expression of the genes encoding a reactivating factor for glycerol-
inactivated adenosylcobalamin-dependent diol dehydratase. J. Biol. Chem.
272:32034-32041.

50. Mori, K. and T. Toraya. 1999. Mechanism of reactivation of coenzyme B12-
dependent diol dehydratase by a molecular chaperone-like reactivating factor.
Biochemistry 38:13170-13178.

51. Obradors, N., J. Badia, L. Baldoma, and J. Aguilar. 1988. Anaerobic
metabolism of the L-rhamnose fermentation product 1,2-propanediol in Salmonella
typhimurium. J. Bacteriol. 170:2159-2162.

52. Palacios, S., V. J. Starai, and J. C. Escalante-Semerena. 2003. Propionyl
coenzyme A is a common intermediate in the 1,2-propanediol and propionate
catabolic pathways needed for expression of theprpBCDE operon during growth of
Salmonella enterica on 1,2-propanediol. J. Bacteriol. 185:2802-2810.

53. Polen, T., D. Rittmann, V. F. Wendisch, and H. Sahm. 2003. DNA microarray
analyses of the long-term adaptive response of Escherichia coli to acetate and
propionate. Appl. Environ. Microbiol. 69:1759-1774.

54. Romeo, T. 1996. Post-transcriptional regulation of bacterial carbohydrate
metabolism: evidence that the gene product CsrA is a global mRNA decay factor.
Res. Microbiol. 147:505-512.

55. Romeo, T., M. Gong, M. Y. Liu, and A. M. Brun-Zinkernagel. 1993.
Identification and molecular characterization of csrA, a pleiotropic gene from
Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and
surface properties. J. Bacteriol. 175:4744-4755.

56. Rondon, M. R. and J. C. Escalante-Semerena. 1992. Thepoc locus is required
for 1,2-propanediol-dependent transcription of the cobalamin biosynthetic (cob)
and propanediol utilization (pdu) genes of Salmonella typhimurium. J. Bacteriol.
174:2267-2272.

57. Roth, J. R., J. G. Lawrence, and T. A. Bobik. 1996. Cobalamin (coenzyme B12):
synthesis and biological significance. Annu. Rev. Microbiol. 50:137-181.

58. Sabnis, N. A., H. Yang, and T. Romeo. 1995. Pleiotropic regulation of central
carbohydrate metabolism in Escherichia coli via the gene csrA. J. Biol. Chem.
270:29096-29104.









59. Sambrook, J. E., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y.

60. Schmehl, M., A. Jahn, z. Meyer, V, S. Hennecke, B. Masepohl, M. Schuppler,
M. Marxer, J. Oelze, and W. Klipp. 1993. Identification of a new class of
nitrogen fixation genes in Rhodobacter capsulatus: a putative membrane complex
involved in electron transport to nitrogenase. Mol. Gen. Genet. 241:602-615.

61. Schmieger, H. 1971. A method for detection of phage mutants with altered
transducing ability. Mol. Gen. Genet. 110:378-381.

62. Shively, J. M., C. E. Bradburne, H. C. Aldrich, T. A. Bobik, J. L. Mehlman, S.
Jin, and S. H. Baker. 1998. Sequence homologs of the carboxysomal polypeptide
CsoS of the thiobacilli are present in cyanobacteria and enteric bacteria that form
carboxysomes polyhedral bodies. Can. J. Bot. 76:906-916.

63. Shively, J. M., G. van Keulen, and W. G. Meijer. 1998. Something from almost
nothing: carbon dioxide fixation in chemoautotrophs. Annu. Rev. Microbiol.
52:191-230.

64. Toraya, T. 2000. Radical catalysis of B12 enzymes: structure, mechanism,
inactivation, and reactivation of diol and glycerol dehydratases. Cell Mol. Life Sci.
57:106-127.

65. Toraya, T., S. Honda, and S. Fukui. 1979. Fermentation of 1,2-propanediol with
1,2-ethanediol by some genera of Enterobacteriaceae, involving coenzyme
B12-dependent diol dehydratase. J. Bacteriol. 139:39-47.

66. Toraya, T. and A. Ishida. 1991. Roles of the D-ribose and
5,6-dimethylbenzimidazole moieties of the nucleotide loop of adenosylcobalamin
in manifestation of coenzymic function in the diol dehydrase reaction. J. Biol.
Chem. 266:5430-5437.

67. Toraya, T. and K. Mori. 1999. A reactivating factor for coenzyme B12-dependent
diol dehydratase. J. Biol. Chem. 274:3372-3377.

68. Toraya, T., M. Yamanishi, H. Muguruma, K. Ushio, J. Yamauchi, and T.
Kawamura. 1997. An electron paramagnetic resonance study on the
mechanism-based inactivation of adenosylcobalamin-dependent diol dehydrase by
glycerol and other substrates. Biochim. Biophys. Acta 1337:11-16.

69. Van Dyk, T. K. and R. A. LaRossa. 1987. Involvement of ack-pta operon
products in alpha-ketobutyrate metabolism by Salmonella typhimurium. Mol. Gen.
Genet. 207:435-440.

70. Vogel, H. J. and D. M. Bonner. 1956. Acetylornithinase of Escherichia coli:
partial purification and some properties. J. Biol. Chem. 218:97-106.









71. Walter, D., M. Ailion, and J. Roth. 1997. Genetic characterization ofthepdu
operon: use of 1,2-propanediol in Salmonella typhimurium. J. Bacteriol. 179:1013-
1022.

72. Wang, W., J. Sun, M. Hartlep, W. D. Deckwer, and A. P. Zeng. 2003.
Combined use of proteomic analysis and enzyme activity assays for metabolic
pathway analysis of glycerol fermentation by Klebsiellapneumoniae. Biotechnol.
Bioeng. 83:525-536.

73 Wei, B., S. Shin, D. LaPorte, A. J. Wolfe, and T. Romeo. 2000. Global
regulatory mutations in csrA and rpoS cause severe central carbon stress in
Escherichia coli in the presence of acetate. J. Bacteriol. 182:1632-1640.

74. Yamanishi, M., S. Yamada, A. Ishida, J. Yamauchi, and T. Toraya. 1998. EPR
spectroscopic evidence for the mechanism-based inactivation of
adenosylcobalamin-dependent diol dehydratase by coenzyme analogs. J.
Biochem.(Tokyo) 124:598-601.















BIOGRAPHICAL SKETCH

Edith M. Sampson was born in Deland, FL. She is the proud daughter of Harold

and Peggy McIntyre; sister to Sean McIntyre and Christa Candler; wife to Douglas

Sampson; and mother to Ryan Sampson. She attended five different elementary schools,

one junior high school, and two different high schools in six different states. She

graduated from Princeton H. S. in Princeton, WV. At 15, she took her first job and

continued to work throughout her high school years. After high school, she served in the

U. S. Army for 2 years, working as a telecommunications operator. With the Army

College Fund, she obtained an A. S. degree in Data Electronics from Phillips Junior

College located in Augusta, Georgia. After graduating, she worked for Augusta

Newsprint as a computer operator. She then moved to Florida and attended and

graduated with honors from Daytona Beach Community College with an A. A. degree.

Afterward, she attended and graduated with honors from the University of Florida (UF)

with a B. S. degree in Microbiology and a minor in Chemistry. Next, she took a position

as a senior laboratory technician with Dr. Thomas Bobik in the Microbiology and Cell

Science Department at UF. Eighteen months later, she began part-time graduate studies

in the same department with Dr. Bobik as her mentor. Her research project was a genetic

characterization of the organelles involved in B12-dependent 1,2-propanediol metabolism.

She was reassigned to the DNA sequencing laboratory for several months in the

Microbiology Department before accepting a Biological Scientist position with

Dr. Gregory Schultz in the OB/GYN Department at UF.




Full Text

PAGE 1

GENETIC ANALYSIS OF THE POLYHE DRAL ORGANELLES FORMED DURING B 12 -DEPENDENT GROWTH ON 1,2-PROPANEDIOL IN Salmonella enterica SEROVAR TYPHIMURIUM LT2 By EDITH MARION SAMPSON A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Edith Marion Sampson

PAGE 3

This thesis is dedicated to my husband, my son, my parents, and the incredible women in my life.

PAGE 4

ACKNOWLEDGMENTS I thank my mentor, Dr. Thomas Bobik. His optimism, dedication, patience, guidance, and theology will serve as example throughout my career and life. I thank Dr. Henry Aldrich for his guidance and mentorship throughout my undergraduate and graduate career. His passion for science and photography inspired this heart. I thank Nemet Keyhani for his guidance and optimism, and Brahms for her cheerful disposition. I appreciate all that Donna Williams and Lorraine McDowell have done to make my experience in the EM laboratory pleasant. They have always greeted me as a friend and treated me with kindness. I thank my lab mates (Greg Havemann, Celeste Johnson-Causey, Nicole Leal, and Patrick Joyner) for their humor, friendship, and assistance in all facets of my life. I am grateful to the faculty in the Microbiology and Cell Science Department for use of equipment, advice on experiments, and mentorship. Finally, I would like to thank my parents, husband and son for their love, support and dedication during this arduous journey. iv

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES.........................................................................................................viii ABSTRACT.........................................................................................................................x CHAPTER 1 INTRODUCTION........................................................................................................1 The pdu Locus..............................................................................................................1 Regulation..............................................................................................................1 1,2-Pd Degradation................................................................................................3 B 12 Adenosylation.................................................................................................4 Polyhedral Organelles...........................................................................................5 pdu Genes of Unknown Function..........................................................................8 Summary.......................................................................................................................8 2 GENETIC ANALYSIS OF POLYHEDRAL BODY FORMATION AND 1,2-PROPANEDIOL DEGRADATION BY Salmonella enterica............................10 Materials and Methods...............................................................................................12 Chemicals and Reagents......................................................................................12 Bacterial Strains, Media, and Growth Conditions...............................................13 General Molecular Methods................................................................................13 P22 Transduction.................................................................................................15 Construction of In-Frame pdu Gene Deletions...................................................16 Growth Curves.....................................................................................................17 Aldehyde Indicator Media and MacConkey Media Tests...................................17 Electron Microscopy...........................................................................................18 Results.........................................................................................................................19 1,2-Pd Metabolism in Strains with Precise Nonpolar Deletion in Selected pdu Genes................................................................................................................19 Growth Curves.....................................................................................................19 v

PAGE 6

Systematic Electron Microscopy Study of Organelle Formation by Selected pdu Deletion Mutants.......................................................................................26 Discussion...................................................................................................................27 3 POLYHEDRAL ORGANELLES INVOLVED IN 1,2-PROPANEDIOL DEGRADATION PROTECT AGAINST PROPIONALDEHYDE TOXICITY DURING AEROBIC GROWTH OF Salmonella enterica........................................30 Materials and Methods...............................................................................................32 Bacterial Strains, Chemicals, and Reagents........................................................32 Growth Curves.....................................................................................................33 HPLC Analysis....................................................................................................33 Dose Response Growth Curves...........................................................................34 Results.........................................................................................................................34 Effect of CNCbl Concentration on the Growth of Wild-type S. enterica and Selected pdu Mutants on 1,2-Pd Minimal Medium.........................................34 Propionaldehyde Formation................................................................................35 Effect of Selected pdu Deletion Mutations on 1,2-Pd Consumption..................39 Propionate Secretion............................................................................................40 1-Propanol Secretion...........................................................................................43 Effect of Propionaldehyde, Propionate, and 1-Propanol Supplementation on the Growth of S. enterica.................................................................................44 Discussion...................................................................................................................46 LIST OF REFERENCES...................................................................................................50 BIOGRAPHICAL SKETCH.............................................................................................57 vi

PAGE 7

LIST OF TABLES Table page 2-1 Bacterial strains........................................................................................................14 2-2 Primers for pdu deletions completed using the Miller and Mekalanos deletion method, restriction enzymes, and predicted insert size............................................15 2-3 Phenotypes of pdu deletion mutants on MacConkey and AIM media.....................20 2-4 Polyhedral phenotypes of pdu deletion mutants......................................................27 3-1 Strain List.................................................................................................................32 vii

PAGE 8

LIST OF FIGURES Figure page 1-1 The pdu locus.............................................................................................................2 1-2 Proposed 1,2-Pd degradation pathway.......................................................................3 2-1 Aerobic growth of the wild-type strain and 1,2-Pd pathway mutants on 1,2-Pd/CNCbl minimal media..................................................................................22 2-2 Aerobic growth of the wild-type strain and the diol dehydratase reactivating factor mutants on 1,2-Pd/CNCbl minimal media...............................................................23 2-3 Effects of deletions of pdu genes of unknown function on growth of S. enterica on 1,2-Pd/CNCbl minimal media...........................................................24 2-4 Aerobic growth of the wild-type strain and 4 carboxysome homologue mutants with interrupted growth on 1,2-Pd/CNCbl minimal media......................................25 2-5 Aerobic growth of the wild-type strain and 3 carboxysome homologue mutants without interrupted growth on 1,2-Pd/CNCbl minimal media.................................25 2-6 Electron micrographs of S. enterica wild-type-LT2 and select carboxysome homologue mutants..................................................................................................26 3-1 Aerobic growth curves of wild-type-LT2 and polyhedral organelle mutants in 1,2-Pd minimal broth with various concentrations of CNCbl................36 3-2 HPLC analysis of propionaldehyde levels in wild-type and polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth..............37 3-3 HPLC analysis of 1,2-Pd consumption in wildtype-LT2 and polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth...........................................................................................................38 3-4 HPLC analysis of propionate levels in wild-type-LT2 and polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth..............41 3-5 HPLC analysis of 1-propanol levels in wild-type-LT2 and the polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth...........................................................................................................42 viii

PAGE 9

3-6 Dose response growth curves of wild-type-LT2 in minimal succinate, 1 ,2-Pd broth dosed with 0 20 mM: A) propionaldehyde, B) propionate, C) 1-propanol...........................................................................................................44 3-7 HPLC analysis of maximum production levels of propionate, propionaldehyde and 1-propanol in wild-type-LT2 and polyhedral organelle deletion strains during aerobic growth on 1,2-Pd/CNCbl minimal broth..........................................47 ix

PAGE 10

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science GENETIC ANALYSIS OF THE POLYHEDRAL ORGANELLES FORMED DURING B 12 -DEPENDENT GROWTH ON 1,2-PROPANEDIOL IN Salmonella enterica SEROVAR TYPHIMURIUM LT2 By Edith Marion Sampson December 2004 Chair: Thomas A. Bobik Major Department: Microbiology and Cell Science Salmonella enterica forms polyhedral organelles involved in AdoB 12 -dependent 1,2-propanediol (1,2-Pd) degradation. We constructed nonpolar mutations in all of the pdu genes and examined the effects of the mutations on polyhedral organelle formation and growth on 1,2-Pd/Vitamin B 12 minimal media. Electron microscopy studies established that pduBB nonpolar mutant failed to form polyhedra; that pduH, pduJ, pduK, and pduM mutants formed aberrant polyhedra; and that all other deletion mutants produced normal-appearing polyhedra. Aerobic growth rates were reported for each of the deletion mutants. During aerobic growth on 1,2-Pd, pduBB, pduJ, and pduK deletion strains exhibited a period of interrupted growth, which was relieved when B 12 concentrations were decreased. Growth tests demonstrated that mutants containing nonpolar deletions in pduBB, pduJ, and pduK grew at a faster rate than wildtype at low B 12 concentrations. Additionally, high pressure liquid chromatography (HPLC) was used to measure the x

PAGE 11

products of 1,2-Pd degradation. The HPLC studies showed that the arrested growth period corresponded to a spike in propionaldehyde levels. Moreover, wildtype cells cultured in LB, minimal succinate media +/Pd, and minimal Pd/B 12 media (and subjected to various propionaldehyde dosages) demonstrated a period of arrested growth. These data indicated that propionaldehyde (the product of the diol dehydratase reaction) was eliciting the interrupted growth response. These results support a previously proposed model in which the polyhedral organelles serve to reduce aldehyde toxicity by limiting the rate of aldehyde production. xi

PAGE 12

CHAPTER 1 INTRODUCTION Salmonella enterica uses 1,2-propanediol (1,2-Pd) as a carbon and energy source via a pathway that requires coenzyme B 12 (adenosylcobalamin, AdoCbl) (38). The major product of the fermentation of two common methylpentoses (rhamnose and fucose) is 1,2-Pd. Rhamnose and fucose are found in the glycoconjugates of intestinal epithelial cells and plant cell walls (12, 43, 51). Hence, the ability to degrade 1,2-Pd may confer a selective advantage in anaerobic niches such as the intestinal tracts of host animals and the interior of macrophages (43, 51). Evidence also suggests that 1,2-Pd degradation has a role in Salmonella pathogenesis. In vivo expression technology (IVET) indicated that 1,2-Pd degradation was important for the growth of Salmonella in host tissues, and competitive index studies in mice indicated that pdu mutations confer a virulence defect (17, 32). Furthermore, 1,2-Pd degradation provides an important model system for studies of AdoCbl-dependent processes. The pdu Locus Regulation The genes required for 1,2-Pd degradation are found at centisome 44 of the Salmonella genome; and consist of the pduF and pocR genes, which encode a 1,2-Pd diffusion facilitator protein and a transcriptional regulator, and the divergently transcribed 21-gene pdu operon (Figure 1-1) (15, 38). The pdu locus is located adjacent to the cob operon, which encodes twenty proteins required for de novo B 12 synthesis (15). Globally, both operons are controlled by the ArcA/ArcB system during anaerobic growth 1

PAGE 13

2 pdu operonCarboxysome homologsPathway enzymes pocRpduF A B C D H G K J L MN E P O SQ T U VW X ????? Ado-B12reactivation pdu operonCarboxysome homologsPathway enzymes pocRpduF A B C D H G K J L MN E P O SQ T U VW X ????? Ado-B12reactivation Figure 1-1. The pdu locus and the Crp/cyclic AMP system under carbon and energy deficits, aerobically and anaerobically (2, 14, 23, 36, 37). Both operons are induced by 1,2-Pd, and this control is mediated by PocR, a member of the AraC family of regulatory proteins (9, 16, 56). Because the cob and pdu operons are co-induced by 1,2-Pd, it has been suggested that 1,2-Pd metabolism is the main reason for de novo B 12 synthesis by S. enterica (9, 16, 56). Recent microarray analysis established that expression of two genes found in the pdu operon (pduA and pduC) was decreased 2.5 fold in a csrA mutant (41). The protein CsrA is a post-transcriptional regulator that has been found to control expression of Salmonella pathogenicity island 1 (SPI-1), SPI-1 type III secretion apparatus, and flagellar synthesis operons (6, 41, 44, 54, 55, 58, 73). Altering expression of csrA negatively affects SPI-1 gene expression and decreases the mutant bacterias ability to invade cultured epithelial cells (probably because of poor expression of the flagellar synthesis operons) (41). A pdu operon lacZ fusion was tested for -galactosidase production, and a 10-fold decrease was observed in the csrA mutant when compared to the wild-type (41).

PAGE 14

3 1,2-Propanediol Propionaldehyde1-PropanolPropionyl-CoAAdo-B12dependent diol dehydratase (pduCDE) Propionyl-phosphate Propionate Propanol dehydrogenase (pduQ) NADH NAD NAD NADH ADPATPCoA-dependent Propionaldehydedehydrogenase(pduP)Phospho-transacylase ?Propionate kinase(pduW)1,2-Propanediol Propionaldehyde1-PropanolPropionyl-CoAAdo-B12dependent diol dehydratase (pduCDE) Propionyl-phosphate Propionate Propanol dehydrogenase (pduQ) NADH NAD NAD NADH ADPATPADPATPCoA-dependent Propionaldehydedehydrogenase(pduP)Phospho-transacylase ?Propionate kinase(pduW) Figure 1-2. Proposed 1,2-Pd degradation pathway Complementation of the csrA mutant completely restored pdu expression (41). Gene expression of cob and cbi (de novo B 12 synthetic genes) and the B 12 -associated ethanolamine utilization operon (eut) were also negatively affected in the csrA mutant, as shown with microarray analysis and B-galatosidase activity assays (41). Overall, CsrA regulation in Salmonella seems to have been tailored to control bacterial functions specific for life in the intestinal environment, especially those involved in virulence (41). 1,2-Pd Degradation Based on biochemical and genetic studies, a pathway for 1,2-Pd degradation has been proposed. 1,2-Pd degradation is dependent on the pduCDE genes, which encode the three subunits of AdoCbl-dependent diol dehydratases (11). Diol dehydratase initiates 1,2-Pd degradation by mediating the conversion of 1,2-Pd to propionaldehyde which is further metabolized to propionate and 1-propanol; presumably by CoA-dependent aldehyde dehydrogenase (pduP), phosphotransacylase, propionate kinase (pduW), and

PAGE 15

4 alcohol dehydrogenase (pduQ) (Fig. 1-2) (10, 42, 51, 52, 65). This metabolic process provides one ATP by substrate-level phosphorylation, an intermediate (propionyl-CoA) that can enter to central metabolism through the 2-methyl-citrate pathway, and an electron sink (1-propanol) that can be used to balance cellular redox reactions (33, 57). AdoCbl-dependent diol dehydratase catalyzes the first step of 1,2-Pd degradation (the conversion of 1,2-Pd to propionaldehyde) using a mechanism that relies on radical chemistry (4, 29, 64). High-energy radical intermediates generated during the catalytic cycle can undergo side reactions resulting in the modification of AdoCbl and consequent enzyme inactivation (1, 5, 66, 68). AdoCbl undergoes irreversible cleavage of its cobalt/carbon bond, forming a modified cofactor that remains tightly bound at the active site, preventing further catalysis (35, 66, 74). Reactivating factors restore enzymatic activity by facilitating the release of bound modified cofactor, permitting another AdoCbl molecule to enter the active site (67). In Klebsiella oxytoca, reactivation of inactive holoenzyme is mediated by the DdrA and DdrB proteins (50) Homology searches identified the PduGH proteins as putative reactivating factors for the AdoCbl dependent diol dehydratase involved in 1,2-Pd degradation (10). Since pduG and pduH share significant sequence homology to ddrA and ddrB, the reactivation process used by Salmonella and Klebsiella may be mechanistically similar (11, 49). B 12 Adenosylation Under anaerobic conditions, S. enterica can synthesize the AdoCbl needed for 1,2-Pd degradation de novo; however, in the presence of oxygen exogenous complex precursors are required (39). Processing enzymes convert complex precursors such as vitamin B 12 (cyanocobalamin, CNCbl) to AdoCbl via the adenosylation pathway (28, 34, 40). In the proposed scheme, CNCbl is decyanated to hydroxycobalamin,

PAGE 16

5 reduced to cob(II)alamin, further reduced to cob(I)alamin, and finally adenosylated to AdoCbl (28, 34, 40). To date, the genes encoding the decyanase and reductase enzymes have not been identified (10). However, an adenosyltransferase encoded in the pdu operon (PduO), has been characterized genetically and biochemically (40). The PduO enzyme adenosylates cob(I)alamin using ATP as the adenosyl-group donor (40). Polyhedral Organelles DNA sequence analysis of the pdu operon identified seven pdu genes (pduABJKNTU) having significant sequence homology to proteins needed for the formation of carboxysomes; a polyhedral organelle involved in CO 2 fixation by cyanobacteria and some chemoautotrophs (10, 27). Recent electron microscopy (EM) studies showed that Salmonella forms polyhedral organelles during aerobic and anaerobic growth on 1,2-Pd minimal medium (10). These organelles are about 100 to 150 nm in diameter and have a proteinaceous center surrounded by a protein shell that is about 3 to 4 nm in width (30). Carboxysomes share the same basic dimensions, but are more regularly shaped. The shell of the carboxysome consists of about six proteins, and the pdu operon has seven genes related in sequence to carboxysome shell genes (pduABBJKTU) suggesting that the shells of these organelles are related; however, their functions appear to be quite different (10, 62). Carboxysomes are involved in autotrophic CO 2 fixation, and mutants unable to form carboxysomes require high levels of CO 2 for autotrophic growth (25, 45, 63). In contrast, the polyhedral organelles of S. enterica are involved in the AdoCbl-dependent degradation of 1,2-Pd (a process that has not been shown to require CO 2 ) (10). The function of the S. enterica polyhedral organelles has not yet been established, but a role

PAGE 17

6 in moderating propionaldehyde production to minimize aldehyde toxicity through control of B 12 availability has been proposed (30). In recent studies, the polyhedral organelles involved in 1,2-Pd degradation by S. enterica were purified and shown to be composed of at least 15 different proteins, 14 of which are encoded by the pdu operon (PduABBCDEGHJKOPTU and one unidentified protein) making these structures one of the most elaborate multi-protein complexes found in the prokaryotic world (30). The PduB protein was identified by N-terminal sequencing as a shorter version PduB that was lacking 37 N-terminal amino acid residues (30). DNA sequence analysis of the Salmonella genome identified potential Shine-Dalgarno sequences and start sites for both PduB and PduB, indicating that they may be encoded by overlapping genes (30). Of the 15 polypeptides shown to be components of the S. enterica polyhedral organelles, the functions of 5 have been investigated (11, 30, 31, 40, 42). PduA was previously shown to be an organelle shell protein (31). PduCDE (AdoCbl-dependent diol dehydratase) and PduP (CoA-dependent propionaldehyde dehydrogenase) are essential to the 1,2-Pd catabolic pathway (11, 42). The PduGH enzymes are a putative diol dehydratase reactivating factor and the PduO enzyme is an ATP:cob(I)alamin adenosyltransferase that catalyzes the terminal step of vitamin B 12 assimilation (10, 40). The functions of the PduBBJKTU proteins are unknown but these polypeptides all share sequence similarity with carboxysome shell proteins (10). As a group, the four enzymes shown to be associated with the S. enterica polyhedral organelles are sufficient to mediate the conversion of 1,2-Pd to propionyl-CoA (30). AdoCbl-dependent diol dehydratase catalyzes the conversion of

PAGE 18

7 1,2-Pd to propionaldehyde, which is then converted to propionyl-CoA by the CoA-dependent propionaldehyde dehydrogenase (42, 51, 65). Adenosyltransferase and the presumptive PduGH reactivating factor are needed to maintain diol dehydratase in an active form (5, 40, 68, 74). To date, the polyhedra have been shown to have high levels of diol dehydratase and propionaldehyde dehydrogenase activity (30, 42), but enzymatic assays of the other enzyme components have not been conducted. Nonetheless, the enzyme content of the pdu polyhedra indicates that their primary catalytic role is the conversion of 1,2-Pd to propionyl-CoA (30). The identification of the S. enterica polyhedral organelles provided the second example of a prokaryotic organelle, which raised questions as to the distribution and the functional diversity of related structures. Based on recent electron microscopy and bioinformatics studies, prokaryotic polyhedral organelles appear to be more widespread than previously thought (30). A number of photoand chemoautotrophic bacteria have been shown by electron microscopy to form carboxysomes (13, 49, 63). Polyhedral organelles have been observed in Salmonella, Klebsiella, and Citrobacter during growth on 1,2-Pd (10, 31, 45). Bioinformatic analyses indicate that 1,2-Pd degradation by Listeria, Lactobacillus, and Clostridium also involves organelles (30). A combination of electron microscopy and bioinformatic analyses indicates that polyhedral organelles are needed for AdoCbl-dependent ethanolamine utilization by Salmonella, Escherichia, Klebsiella, Fusobacterium, Listeria and Clostridium, (3, 62). Moreover, bioinformatic studies indicate that Desulfitobacterium hafniense and Desulfovibrio desulfuricans produce a polyhedral organelle involved in pyruvate degradation (30). Thus, investigations indicate that at least 4 different metabolic processes occur within

PAGE 19

8 polyhedral organelles; and 30/209 organisms (for which partial or complete sequence data are available) have the potential to express such organelles (30). Furthermore, a much larger number of metabolic processes could potentially occur within protein-bound organelles, since the observation of such structures would likely require electron microcopy of cells grown under specialized conditions and bioinformatic analyses would fail to identify protein-bound organelles that lack homologues of known organelle proteins (30). pdu Genes of Unknown Function There are five genes found in the pdu operon (pduLMSVX) that are of unknown function and lack substantial similarity to genes of known function found in GenBank (10). The PduL enzyme is distantly related to CpcE (phycocyanobilin lyase), an enzyme that catalyzes a thioester linkage between phycocyanobilin (a linear tetrapyrrole) and phycocyanin (10). It was postulated that PduL might contain a pyrrole binding site, since cobalamins are tetrapyrroles (10, 24). The PduS protein is distantly related to several oxidoreductases (60). ExPASy analysis indicates that PduS contains an iron sulfur binding region and one significant transmembrane domain. ExPasy analysis of PduV predicted a possible ATP/GTP binding motif, and sequence homology indicates PduV may be related to the EutP protein, which has not yet been characterized (10). The PduX protein has sequence homology to a putative kinase (10). PduM was found to lack homology to any characterized protein found in GenBank (10). Summary Nearly 50 genes are devoted to the anaerobic catabolism of 1,2-Pd and de novo synthesis of its cofactor (AdoCbl) indicating its importance to the natural lifestyle of Salmonella (57, 71). The ability of Salmonella to degrade 1,2-Pd has been shown to be

PAGE 20

9 important for growth in host tissues and may confer some selective advantages in anaerobic environments. Though the process of 1,2-Pd degradation seems to be rather straightforward, the details tell a different story. In fact, many questions about 1,2-Pd degradation and the unusual polyhedral organelles involved in this process remain unanswered. The focus of this thesis is to genetically characterize the pdu operon to gain a better understanding of the role of each pdu gene in 1,2-Pd degradation and polyhedral formation.

PAGE 21

CHAPTER 2 GENETIC ANALYSIS OF POLYHEDRAL BODY FORMATION AND 1,2-PROPANEDIOL DEGRADATION BY Salmonella enterica Salmonella enterica degrades 1,2-Propanediol (1,2-Pd) in an adenosyl-cobalamin (AdoCbl) dependent fashion (38) Propanediol is a major product of the fermentation of the common plant sugars rhamnose and fucose and is likely to be prevalent in anaerobic environments (12, 43, 51). Accordingly, the degradation of this small molecule is thought to be important for the growth of S. enterica in its natural environments and for its interactions with host organisms (57, 71). Based on biochemical and genetic studies a pathway for 1,2-Pd degradation has been proposed. Propanediol is first converted to propionaldehyde by AdoCbl-dependent diol dehydratase. Propionaldehyde is further metabolized to propanol and propionate, presumably by alcohol dehydrogenase (pduQ), CoA-dependent aldehyde dehydrogenase (pduP), phosphotransacylase, and propionate kinase (pduW) (10, 42, 51, 52, 65). A very unusual aspect of 1,2-Pd degradation is that it involves a polyhedral organelle (10, 30, 31). These organelles are one of the most elaborate multi-protein complexes found in prokaryotic organisms (30). Their cross-section is 100-200 nm (about one-tenth the length of the cell) (10, 30). They have a protein-based shell thought to surround four different enzymes, and are composed of at least 15 different polypeptides, (PduABBCDEGHJKOPTU and one unidentified protein) (30). Electron microscopy experiments have shown that the PduA protein is a component of the organelles shell and is essential for proper organelle formation (31). The PduCDE 10

PAGE 22

11 (diol dehydratase) and PduP (aldehyde dehydrogenase) have also been shown to be organelle components, but these enzymes are not essential for formation of normal appearing structures (10, 42). The roles of the remaining organelle polypeptides, as well as, other Pdu proteins in organelle formation have not been investigated. Eight of the organelle proteins (PduABBJKNTU) are related in amino acid sequence to proteins needed for the formation of carboxysomes, and hence may play structural roles in the organelles involved in 1,2-Pd degradation (10, 30). To further investigate the roles of pdu genes in organelle formation and 1,2-Pd degradation, we constructed precise nonpolar deletions of each gene in the pdu operon. In the case of PduB and PduB (which have overlapping coding sequences), the deletion that was constructed eliminated the entire the coding sequences of both proteins and this mutation is referred to as pduBB. The use of growth tests and indicator media showed that strains with deletions of the pduCDE, pduG, and pduP genes were severely impaired for growth on 1,2-Pd while pduN, pduO, pduQ, and pduW mutants showed a moderate growth defect. Interestingly, strains with deletion of the pduA, pduBB, pduJ, genes pduK showed an extended period of growth arrest followed by the resumption of growth. Surprisingly, strains with deletions in the pduM, pduL, pduM, pduS, pduT, pduU, pduV, and pduX genes grew similarly to wild-type S. enterica on 1,2-PD minimal medium under the conditions used. A systematic electron microscopy study was conducted to determine the effects that selected pdu deletion mutants had on polyhedral organelle formation. Results showed that a pduBB deletion prevented the formation of polyhedra organelles, while deletions in the pduH, pduJ, pduK, and pduM genes resulted in the formation of aberrantly shaped

PAGE 23

12 organelles and proteinaceous plate-like structures that at times prevented the separation of dividing cells. The findings that PduH and PduM deletion mutants had defects in organelle formation were somewhat unexpected since pduH encodes the small subunit of the putative diol dehydratase reactivation factor and pduM encodes a protein that lacks sequence homology to proteins of known function present in GenBank. Deletions of the pduCDE, pduG, pduL, pduN pduO, pduP, pduQ, pduS, pduT, pduU, pduV, pduW, pduX, gene had no apparent effect on polyhedral organelle formation. It was surprising to us that the pduN, pduT and pduU mutants form normal appearing organelles since the PduT, PduU, and PduN proteins have sequence similarity to proteins needed for carboxysome formation and the PduT and PduU protein have been shown to be organelle-associated. Materials and Methods Chemicals and Reagents Formaldehyde (r, s), 1,2-propanediol, vitamin B 12 (CNCbl), and antibiotics were from Sigma Chemical Company (St. Louis, MO). Bacto-agar, MacConkey agar base, tryptone, and yeast extract were from Difco Laboratories (Detroit, MI). Restriction enzymes were from New England Biolabs (Beverly, MA) or Promega (Madison, WI). T4 DNA ligase was from New England Biolabs. Glutaraldehyde was from Tousimis (Rockville, MD). We received 2-dimethylaminoethanol from Polysciences, Inc. (Warrington, PA). Nonenyl succinate anhydride, uranyl acetate, and vinyl cyclohexane dioxide were from EM Sciences (Washington, PA). Propylene glycol diglycidyl ether and osmium tetroxide were from Ted Pella Inc. (Redding, CA). Agarose, EDTA, and ethidium bromide were from Bio-Rad (Hercules, CA). Other chemicals were from Fisher Scientific (Pittsburgh, PA).

PAGE 24

13 Bacterial Strains, Media, and Growth Conditions The bacterial strains used in this study are listed in Table 2-1. The rich medium used was Luria-Bertani (LB) medium (47), Lennox (Difco, Detroit, MI). The minimal media used was the No-carbon-E (NCE) medium (8, 46, 70). Amino acids were provided at the following concentrations: valine, isoleucine, leucine, and threonine, 0.3 mM. Antibiotics were provided in liquid or solid rich medium at the following concentrations unless otherwise stated: ampicillin, 100 g/mL; kanamycin, 25 g/mL; and choramphenicol, 20 g/mL. MacConkey/1,2-propanediol (1,2-Pd)/CNCbl indicator plates were composed of MacConkey agar base supplemented with 1% 1,2-Pd and 200 ng/mL CNCbl (38). Aldehyde indicator plates were prepared according to Conway with the following modifications: pararosaniline was added to sterile medium as a fine powder, 200 ng/mL CNCbl was included and ethanol was replaced by 1% 1,2-Pd (18). General Molecular Methods Agarose gel electrophoresis was performed as described previously (59). Plasmid DNA was purified by alkaline lysis procedure (59) or by using Qiagen products (Qiagen, Chatsworth, CA) according to manufacturer's directions. Following restriction digestion or PCR amplification, DNA was purified using Qiagen PCR purification or gel extraction kits. Restriction digests were carried out using standard protocols (59). For ligation of DNA fragments, T4 DNA ligase was used according to the manufacturer's directions. Electroporation was carried out using a Bio-Rad Gene-Pulser, 0.2 cm gap electroporation cuvettes, and the following settings: capacitance, 25 F; pulse controller, 200 ohm; and voltage, 2.5 kV. Transformed cells were incubated in 1 mL SOC medium for 1 h at 37 o C, 275 rpm, and then plated on LB agar containing the appropriate antibiotics.

PAGE 25

14 Table 2-1. Bacterial strains Species Strain Genotype E. coli BE11 (E. coli ER2267) e14 (MrcA ) endA1 supE44 thi-1 relA1? RfbD1? SpoT1? (mrcC-mrr) 114::IS10 (argF-lac)U169 recA1/F proA + B + lacI q (lacz)M15 zzf::mini-Tn10 (Kan r )/pMGS2 S17.1 pir RecA (RP4-2-Tc::Mu) pir S. enterica serovar Typhimurium LT2 Wild-type BE47 thr-480::Tn10dCam BE103 TR6579/pKD46 (Kan r ) BE161 TR6579/pCP20 (Ap r ) TR6579 MetA22 metE551 trpD2 ivl-452 hsdLT6 hsdSA29 HsdB strA120 GalE Leu Pro BE182 pduA652 BE213 pduBB BE87 pduCDE BE53 pduG BE161 pduH BE274 pduJ654 BE185 pduK655 AP121 pduL BE155 pduM AP153 pduN BE111 pduO651 BE191 pduP659 AP157 pduQ AP151 pduS BE194 pduT662 BE195 pduU663 AP149 pduV AP139 pduW AP148 pduX

PAGE 26

15 Table 2-2. Primers for pdu deletions completed using the Miller and Mekalanos deletion method, restriction enzymes, and predicted insert size Target gene Primers (5 3) Restriction Enzymes Predicted insert size pduJ GCTCTAGATTCCGCAGCTGGTCACCGATG CGATTAGGCTGATTTCGGTAAAATGCCCTCGTTATTCAT GAGGCCATTTTACCGAAATCAGCCTAATCG ACATATGTGCATGCGCTTCACCTCGCTTGCCGG XbaI/SphI 1025 bp pduK GCTCTAGACGACTGCGCCAGCCTCTGGCACGAAG CCATTACGCTTCACCTCGCTTGCCCGCCATCGATTAGGC GGCAAGCGAGGTGAAGCGTAATGG ACATATGTGCATGCCAGCGGCGTTGGCTTCATCGG XbaI/SphI 1221 bp pduL GCTCTAGAGCCGAAATCAGCCTAATCGATGGCG CGTTCATCGCGGGCCTACCAGCCGATCCATTACGCTTCACCTCGC CGGCTGGTAGGCCCGCGATGAACG CGAGCTCGCCAGATGCATGATTTACTC XbaI/SacI 1025 bp pduN GCTCTAGAGTGCAGCGCATTGTCGAGGAGA CATAACCGCCCCTTAACACGACAGATGCATGATTTACTC TCGTGTTAAGGGGCGGTTATG CGAGCTCGCTATAGCGCATCAGCACCTGAC XbaI/SacI 1194 bp pduO GCGCGCTCTAGATATTCACCGATGAGCACGGACTGC GATGAGTTCCCACGTTAATAGCCGCTCGGGTATAAATCGCCATAACCG GCGGCTATTAACGTGGGAACTCATC GGAATTCAGGCTAATCAGCTTCAGAGAGACC XbaI/SphI 910 bp pduQ GCTCTAGAGCGATACCGACAAACTCCG GCTCATAGCAGTTCCTCCAGCATCGCGACCTCAGTTAG CTGGAGGAACTGCTATGAGC CGAGCTCGCGCACGTTATTGACGACCACGC XbaI/SacI 976 bp pduS GCTCTAGAGAAACTGGTGTTCCAGTATCTGC CCTGAGACATGGTTAACCTCTTACGCTCATAGCAGTTCCTCC GTAAGAGGTTAACCATGTCTCAGG CGAGCTCGCCGTGGGATCACCGAACGG XbaI/SacI 1023 bp pduT GCTCTAGAGACGACGTGCGGGCGGTGAACTTTCATCAG CCATTACCCCTCCACCATCTGCTGAGACATGGTTAACCTCTTAC CAGATGGTGGAGGGGTAATGG ACATATGTGCATGCCGCTGTACAGGCAGCGGTTCT XbaI/SphI 1036bp pduU GCTCTAGACTTGGTGATGCCATGCTGAAAAGC CGCTTCATGACTTTACGTCCGGGTGATCGGTTGTCTTTCCATTACCCC ATCACCCGGACGTAAAGTCATGAAGCG ACATATGTGCATGCAGAGCATGTCGCCCTGCGGCATCTCCA XbaI/SphI 1120bp pduV GCTCTAGAGCGTTTCTGACGTCAATAACGC CCATTATTTTGTAAGACATAAAGGTTCCTTGGGGCCGATAAACATCAAACG AAGGAACCTTTATGTCTTACAAAATAATGG CGAGCTCGCCAGTTCAGCGTAATAATGCCAGGG XbaI/SacI 980 bp P22 Transduction Transductional crosses were performed as described using P22 HT105/1 int-210 (22), a mutant phage that has high transducing ability (61). For the preparation of P22 transducing lysates from strains having galE mutations, overnight cultures were grown on LB-medium supplemented with 0.2% glucose and 0.2% galactose. Transductants were tested for phage contamination and sensitivity by streaking on green plates against P22 H5.

PAGE 27

16 Construction of In-Frame pdu Gene Deletions Nonpolar deletions of pduA, pduBB, and pduW were constructed as described by Datsenko and Wanner with some modifications (21). The pduA deletion has previously been described (31). The primers used to amplify the kanamycin resistance cassette from plasmid pKD4 for the pduBB gene deletion are 5GCCATCCCTG GTCAACCCCAA CCTATACGAGAGACGGCTTGTAGGCTGGAGCTGCTTCG3and 5TCAGATGT AGGACGGACGATCGTTTTTCGGTTCAGAATGAATATCCTCCTTAGTTC3. The primers used to amplify the kanamycin resistance cassette from plasmid pKD4 for the pduW gene deletion are 5CTGAATTCGAAGGAACCTTTATGTCTTACAAAATAA TGTAGGCTGGAGCTGCTTCG 3 and 5CGAATAGTGTGCGCGCATAGTGTCAT GGTAAAAGCGATGAATATCCTCCTTAGTTC 3. Primer 2 homologous to priming site 2 of the template plasmid was slightly modified to replace the idealized ribosomal binding site (rbs) incorporated into the plasmid with the natural rbs of the gene downstream of the target gene. Strain BE103 was used as the host strain for linear transformation. The location of the kanamycin cassette insertion was verified as described (21). After the insertion site was verified by PCR, the kanamycin cassette was moved into LT2 via transduction. The kanamycin cassette was then removed using Flp recombinase as described (21). Nonpolar deletions of pduCDE, pduG, pduH, pduJ, pduK, pduL, pduM, pduN, pduO, pduP, pduQ, pduS, pduT, pduU, and pduX were constructed using the procedure of Miller and Mekalanos (48). PCR primers were designed as described previously (40). Table 2-2 lists the primers used to delete the following pdu genes: pduJ, pduK, pduL, pduM, pduN, pduO, pduQ, pduS, pduT, and pduU. After the fusion product for each deletion was obtained, it was restricted with the enzymes listed in Table 2-2 and ligated

PAGE 28

17 to pCVD442. The ligation reaction was used to transform E. coli S17/1 via electroporation. One clone containing an insert of expected size (listed in Table 2-2) was used to introduce the deletion into the S. enterica chromosome. For the conjugation step, BE47 was used as the recipient, and Amp r and Cam r were selected. Following the sucrose selection step, replica printing was used to identify Amp s colonies. Deletion strains were identified with PCR using chromosomal DNA or whole cells as source of template. The thr::Tn10dCam element was removed from the deletion strain by P22 transduction selecting prototrophy. Strains were tested for phage contamination and sensitivity by streaking on green plates against P22 H5. Replica printing was used to verify Cam S and relief from threonine auxotrophy. Finally, the deletions were verified a second time with PCR. Growth Curves For aerobic growth curves, cells were grown in 16 x 100 mm test tubes containing 5 mL of the appropriate media. Cultures were incubated at 37 o C in a New Brunswick gyratory water bath shaker model G-76 at 250 rpm (New Brunswick Co. Inc, Edison NJ), and culture tubes were held in place at an angle approximately 45 o Cell growth was monitored using a Spectronic 20D + spectrophotometer by measuring optical density at 600 nm. Inocula for the growth curves were prepared as follows: bacterial strains were grown overnight at 37 o C with shaking in LB medium, and 0.125 mL of washed culture was used to inoculate 5 mL cultures. Aldehyde Indicator Media and MacConkey Media Tests Aldehyde indicator plates (AIM) supplemented with Pd and vitamin B 12 (CNCbl) use a mixture of pararosaniline and bisulfite to detect the propionaldehyde produced from 1,2-Pd degradation (18). Strains producing propionaldehyde impart a red/brown color,

PAGE 29

18 while those that do not appear uncolored. This test specifically indicates that activity of AdoCbl-dependent diol dehydratase, which produces propionaldehyde from 1,2-Pd. MacConkey agar base supplemented with 1,2-Pd and CNCbl uses bile salts and the pH indicator neutral red to differentiate between strains that are capable of degrading 1,2-Pd to propionate. When propionic acid is produced the bile salts are precipitated followed by absorption of the neutral red imparting a red color to colonies. Those strains that cannot degrade 1,2-Pd to acid appear uncolored and are scored as white. Inocula for the plate tests were prepared as follows: bacterial strains were grown overnight at 37 o C with shaking in LB medium. The broth cultures were patched onto a LB agar plate, incubated at 37 o C for 16 18 h, and replica printed onto the various media. The various media were then incubated at 37 o C for16 18 h, and the results were recorded. Electron Microscopy For electron microscopy, cells were grown on minimal medium supplemented with 1% succinate and 0.4% Pd. Cultures (10 mL) were incubated in 125 mL shake flasks at 37 o C, with shaking at 275 rpm in a New Brunswick C24 Incubator Shaker. Each of the deletion mutants was fixed in 2% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.2) for 30 min at room temperature and then in 1% osmium tetroxide in the same buffer for 1 h at 4 o C. The samples were then dehydrated through a graded ethanol series. In this procedure, samples were held at room temperature overnight in a solution of 75% ethanol and 1% uranyl acetate solution during the graded alcohol dehydration series followed by absolute acetone and embedded in Spurr's low-viscosity resin. Thin sections were cut on a LKB Nova ultramicrotome and collected on Formvar-coated grids, post

PAGE 30

19 stained with both uranyl acetate and lead citrate, and then observed and photographed using Zeiss EM-10CA transmission microscope. Results 1,2-Pd Metabolism in Strains with Precise Nonpolar Deletion in Selected pdu Genes Aldehyde indicator plates (AIM) detect the propionaldehyde produced from 1,2-Pd by AdoCbl-dependent diol dehydratase, the first enzyme of 1,2-Pd degradation. Strains producing propionaldehyde form colonies that are red/brown in color while those that do not appear uncolored. MacConkey/1,2-Pd/CNCbl indicator medium detects propionic acid produced from the degradation of 1,2-Pd. Strains capable of converting 1,2-Pd to propionate form red colonies and those unable to produce propionate produce uncolored colonies. Using the indicator media described above, strains with precise deletions of each pdu gene were tested for the ability to degrade 1,2-Pd to propionaldehyde and propionate (Table 2-3). Strains with deletions in pduCDE, pduG, pduO and pduP genes were white on MacConkey media indicating a deficiency in propionate production; however, all other pdu mutants tested were red indicting that they were proficient for propionate production. On aldehyde indicator medium, only strains with pduCDE and pduG deletions showed a defect in propionaldehyde production relative to the wild-type strain. It was very surprising that most of the genes in the pdu operon did not have apparent effects on 1,2-Pd degradation. Growth Curves Growth curves were determined for each of the pdu deletion mutant and wild-type S. enterica using minimal medium supplemented with 0.4% Pd, and 200 ng/mL CNCbl. The effects of deletion of the pdu genes thought to encode enzymes of the 1,2-Pd

PAGE 31

20 Table 2-3. Phenotypes of pdu deletion mutants on MacConkey and AIM media MacConkey Aldehyde indicator Deletion 1,2-PD* CNCbl medium with 1,2-PD indicator medium** and CNCbl pduA red red/brown pduB red red/brown pduCDE white white pduG white white pduH red red pduJ red red/brown pduK red red/brown pduL red red/brown pduM red red/brown pduN red red/brown pduO red red/brown pduP white red/brown pduQ red red/brown pduS red red/brown pduT red red/brown pduU red red/brown pduV red red/brown pduW red red/brown pduX red red/brown *1,2-PD = 1,2-propanediol **MacConkey 1,2-Pd CN-B12 indicator medium detects acid production from 1,2-Pd. Strains that can degrade 1,2-Pd are red on the medium, and strains unable to degrade 1,2-Pd are white. ***Aldehyde indicator medium detects propionaldehyde production from 1,2-Pd. Strains expressing active Ado-B12-dependent diol dehydratase activity are red/brown on this medium, and strains deficient in diol dehydratase activity are white. degradative pathway are shown in Figure 2-1. Aerobically, the wild-type strain had a growth rate of about 0.090 OD 600nm /hr. Strains with deletions of the genes for AdoCbl-dependent diol dehydratase (pduCDE) failed to grow reaching a maximum OD 600nm of only 0.250; with initial growth rates one hundred times lower than that of the wild-type strain. Deleting the propionaldehyde dehydrogenase gene (pduP) reduced the growth rate by two thirds, and deleting the adenosyltransferase gene (pduO) reduced the growth rate by one third. Deletions of pduQ and pduW genes which are thought to encode propanol dehydrogenase and propionate kinase had slightly lower growth rates

PAGE 32

21 than that of wild-type strain. Thus, the PduQ propanol dehydrogenase and the PduW propionate kinase were not essential for aerobic growth of S. enterica on 1,2-Pd. These enzymes may not be required under aerobic conditions. The proposed role of PduQ is the regeneration of NAD. In the presence of oxygen, this could be accomplished by the electron transport chain. The role of propionate kinase is the conversion of propionyl-phosphate to propionate with the formation of ATP by substrate level phosphorylation. Aerobically, propionyl-CoA can feed into the methylcitrate pathway and provide an ATP source. Alternatively, S. enterica might encode functions that can replace PduQ and PduW. The AdhE alcohol/aldehyde dehydrogenase and acetate kinase activities of S. enterica are constitutively expressed and are capable of using 3-carbon compounds as substrates (19, 20, 26, 69). The PduGH genes encode the large and small subunits of a putative reactivating factor for AdoCbl-dependent diol dehydratase (10). Growth tests showed that deletion of the pduG gene prevented growth on 1,2-Pd minimal medium, but surprisingly deletion of the pduH gene had little effect on the growth of S. enterica on this medium (Figure 2-2). This is the first reported evidence the PduG reactivating factor is required for diol dehydratase activity in vivo. These results also raise the question as to the role of the PduH enzyme in diol dehydratase reactivation since its role is not critical to maintaining of diol dehydratase activity at a level needed for growth on 1,2-Pd. Studies showed that S. enterica strains having deletions in the pdu genes of unknown function had growth rates either slightly higher than (pduM) or similar to the wild-type strain (pduL, pduS, pduV, and pduX) on 1,2-Pd minimal medium (Figure 2-3). This was an unexpected finding. The pdu operon is known to encode genes essential

PAGE 33

22 for1,2-Pd degradation. Since operons typically contain genes of related function, it is expected that the pduM, pduL, pduS, pduV, and pduX have a role in 1,2-Pd degradation. This suggested to us that the pduM, pduL, pduS, pduV, and pduX genes may be required for 1,2-Pd degradation under specialized conditions. Further studies will be needed to explain why these mutants lack a detectable phenotype. 00.20.40.60.811.21.41.61.80510152025303540Time (Hours)OD (600nm) LT2 pduCDE pduP pduQ pduW Figure 2-1. Aerobic growth of the wild-type strain and 1,2-Pd pathway mutants on 1,2-Pd/CNCbl minimal media Growth curves were also determined for S. enterica strains carrying deletions of the pdu genes proposed to be needed for polyhedral organelle formation (pduA, pduBB, pduJ, pduK, pduT, and pduU) and the wild-type strain on 1,2-Pd minimal medium. Strains with pduA, pduBB, pduJ and pduK deletion showed a period of growth arrest (interrupted growth) in comparison to the wild-type strain (Figure 2-4). Studies also showed that strains with deletions of the pduT and pduU genes had not discernable effect on 1,2Pd degradation and that a PduN deletion had a slightly decreased the growth rate on 1,2-Pd (Figure 2-5).

PAGE 34

23 00.20.40.60.811.21.41.61.80510152025303540Time (Hours)OD600nm LT2 pduG pduH Figure 2-2. Aerobic growth of the wild-type strain and the diol dehydratase reactivating factor mutants on 1,2-Pd/CNCbl minimal media Prior studies showed that pduA mutants exhibit a period of growth arrest (31). The data presented show that pduBB, pduJ and pduK deletions have a similar phenotype showing that interrupted growth is a consequence of disruption of the polyhedral organelles rather than a specific phenotype of pduA mutants. The pduN deletion had a one third reduction in growth rate without period of growth arrest. Since pduN is upstream of pduO and the growth rates were similar, it was hypothesized that pduO was not being expressed in the pduN mutant due to partial polarity. To test this hypothesis, western blot analysis using anti-PduO was completed for the pduN deletion strain and wild-type S. enterica (data not shown). The western blot

PAGE 35

24 showed a band of the expected molecular weight for PduO (36.6 kDa) being expressed polarity. To test this hypothesis, western blot analysis using anti-PduO was completed for the pduN deletion strain and wild-type S. enterica (data not shown). The western blot showed a band of the expected molecular weight for PduO (36.6 kDa) being expressed mostly in the insoluble cellular extract in both the pduN deletion and wild-type strain. Therefore, we concluded that the pduN deletion under investigation was nonpolar. PduN has been shown with sequence analysis to be closely related to the CcmL-CchB family of proteins, which are needed for the proper assembly and function of carboxysomes; however, PduN was not found to co-purify with the S. enterica polyhedral organelles. 00.20.40.60.811.21.41.61.80510152025303540Time (Hours)OD600nm LT2 pduL pduM pduS pduV pduX Figure 2-3. Effects of deletions of pdu genes of unknown function on growth of S. enterica on 1,2-Pd/CNCbl minimal media

PAGE 36

25 0.00.20.40.60.81.01.21.4051015202530354045Time (Hours)OD600nm LT2 pduA pduB pduJ pduK Figure 2-4. Aerobic growth of the wild-type strain and 4 carboxysome homologue mutants with interrupted growth on 1,2-Pd/CNCbl minimal media 0.00.20.40.60.81.01.21.4051015202530354045Time (Hours)OD600nm LT2 pduN pduT pduU Figure 2-5. Aerobic growth of the wild-type strain and 3 carboxysome homologue mutants without interrupted growth on 1,2-Pd/CNCbl minimal media

PAGE 37

26 A B A A B B D C D D C C Figure 2-6. Electron micrographs of S. enterica wild-type-LT2 and select carboxysome homologue mutants. A) normal-LT2, B) polyhedra minus-pduBB, or C, D) aberrant-pduJ, pduK. Bars, 0.5 m. Systematic Electron Microscopy Study of Organelle Formation by Selected pdu Deletion Mutants The effect of each pdu gene deletion had on polyhedral organelle formation is summarized in Table 2-4. A null mutation in the pduBB gene exhibits a polyhedral minus phenotype similar to the effect of a pduA null mutation, indicating that these genes are essential for polyhedral organelle formation (31). Like the pduA null mutation, polar inclusion bodies were observed in the pduBB strain. Additionally, aberrant polyhedra and proteinaceous plate-like structures were observed in pduH, pduJ, pduK, and pduM strains suggesting their importance to polyhedral organelle formation. Recent purification and densitometry analyses of the polyhedral organelles reported that PduB,

PAGE 38

27 PduB, PduH, PduJ, and PduK compose 12.8%, 12.1%, 0.6%, 11% and 1.6% of the total polyhedra protein, respectively (30). However, the PduM protein was not identified as an organelle component. Table 2-4. Polyhedral phenotypes of pdu deletion mutants Deletion Polyhedral body formation pduA Minus pduBB' Minus pduCDE Normal pduG Normal pduH Aberrant pduJ Aberrant pduK Aberrant pduL Normal pduM Aberrant pduN Normal pduO Normal pduP Normal pduQ Normal pduS Normal pduT Normal pduU Normal pduV Normal pduW Normal pduX Normal Deletions of the pduCDE, pduG, pduL, pduN pduO, pduP, pduQ, pduS, pduT, pduU, pduV, pduW, pduX, gene had no apparent effect on polyhedral organelle formation. It was surprising to us that the pduN, pduT and pduU mutants form normal appearing organelles since the PduT, PduU, and PduN proteins have sequence similarity to proteins needed for carboxysome formation and the PduT and PduU protein have been shown to be organelle-associated (10, 30). Discussion Previously, it was shown that defects in 1,2-Pd metabolism are detected in strains with the following gene deletions: pduCDE, pduO, and pduP (11, 40, 42). Data

PAGE 39

28 provided in this report shows that the proposed pathway genes encoding the putative propionate kinase (PduW) and propanol dehydrogenase (PduQ) are also important for 1,2-Pd degradation though not required, since growth rates were only slightly diminished when compared to wild-type S. enterica. This suggested that there may be redundancy of these enzymes with other enzymes expressed by S. enterica. The pduQ result is not surprising since aerobically redox balance can be achieved via the electron transport chain. Unexpectedly, the growth rate of the pduN deletion strain was reduced compared to wild-type S. enterica during growth on 1,2-Pd indicating that PduN affects 1,2-Pd degradation. PduN has been shown with sequence analysis to be closely related to the CcmL-CchB family of proteins, which are needed for the proper assembly and function of carboxysomes (10). Therefore, it is thought that the PduN protein has a role in the proper formation of the polyhedral organelles involved in 1,2-Pd degradation. One interpretation of this finding is that the organelles directly affect the rate of 1,2-Pd degradation. Studies presented in the next chapter test this inference. Prior sequence analyses showed the PduABBJKNTU polypeptides are related in amino acid sequence to proteins involved in the formation of carboxysomes (10). A systematic electron microscopy study conducted here showed pduA and pduBB mutants did not form organelles during growth on 1,2-Pd and that pduJ and pduK mutants formed grossly aberrant organelles under similar conditions. Studies also showed that pduN, pduU and pduT mutants formed organelles similar to those formed by wild-type S. enterica during growth on 1,2-Pd. Clearly, the PduA. PduBB, PduJ and PduK protein play key structural roles in organelle formation; however, the functions of the PduN,

PAGE 40

29 PduU, and PduT proteins remain uncertain. They may play minor structural roles or be essential to proper function. Aberrant polyhedra are also observed in pduH, and pduM deletion strains. Neither PduH nor PduM have sequence homology to proteins shown to be involved in polyhedral body formation. Based on sequence analyses, PduH is proposed to encode the small subunit of a diol dehydratase reactivation factor. This polypeptide was also found to copurify with the polyhedra (about 0.6% of the total organelle protein) (30). Thus, PduH may have a primary role in reactivation but also contribute to organelle structure. In prior studies, PduM was not detected as a component of the purified polyhedra organelles. Yet, here we showed that it is needed for proper organelle formation. This raises the possibility that PduM may be a chaperone needed for polyhedral organelle formation. At this time, however, we have no rigorous evidence for the function of PduM.

PAGE 41

CHAPTER 3 POLYHEDRAL ORGANELLES INVOLVED IN 1,2-PROPANEDIOL DEGRADATION PROTECT AGAINST PROPIONALDEHYDE TOXICITY DURING AEROBIC GROWTH OF Salmonella enterica Salmonella enterica metabolizes 1,2-Propanediol (1,2-Pd) in a B 12 dependent manner (38). The ability to catabolize 1,2-Pd may confer a selective advantage in anaerobic environments, since 1,2-Pd is a fermentation product of the common plant sugars rhamnose and fucose (12, 43, 51). Past competitive index studies with mice have shown that mutations in the pdu operon resulted in a virulence defect (32). Ado-B 12 dependent diol dehydratase initiates the first step of 1,2-Pd degradation with the conversion of 1,2-Pd to propionaldehyde. Propionaldehyde is further metabolized to propanol and propionate, presumably by alcohol dehydrogenase (pduQ), CoA-dependent aldehyde dehydrogenase (pduP), phosphotransacylase, and propionate kinase (pduW) (10, 42, 51, 52, 65). This bifurcated pathway produces an electron sink, 1 ATP, and propionate, a three-carbon compound (propionyl-CoA) that can be channeled into central metabolism via the 2-methyl-citrate pathway (33, 57). An unusual feature of 1,2-Pd degradation is that it involves a polyhedral organelle. These organelles are one of the most sophisticated multi-protein complexes known in prokaryotic systems consisting of at least 15 different polypeptides (PduABBCDEGHJKOPTU and one unidentified protein) (30). Sequence similarity to carboxysome proteins suggests that the PduABBJKNTU polypeptides are needed for the organelle formation (10). The roles of the pduA, pduBB, pduJ and pduK genes in organelle formation has been substantiated by genetic studies. Deletions of the pduA or 30

PAGE 42

31 pduBBgenes prevents organelle formation and deletions of pduJ, or pduK genes results in the formation of aberrantly shaped polyhedra. However, deletions in pduNTU genes do not confer any observable defect in organelle structure, although a pduN deletion strain was partially impaired for growth on 1,2-Pd. It has also been shown that deletions in the pduA, pduBB, pduJ, or pduK genes lead to a growth defect on 1,2-Pd minimal medium (Figure 2-4). These mutations result in a period of growth arrest that lasts for about 20 h and has been termed interrupted growth (Figure 2-4). Based on this finding, it was proposed that growth arrest resulted from the accumulation of propionaldehyde to toxic levels, and that the function of the polyhedral organelles is to coordinate the rate of propionaldehyde production and consumption to minimize aldehyde toxicity. However, no direct evidence for propionaldehyde accumulation or toxicity has been reported. Here we show that interrupted growth is a consequence of propionaldehyde toxicity. High-pressure liquid chromatography (HPLC) studies and growth tests show that propionaldehyde accumulates to toxic levels in pduA, pduBB, pduJ, and pduK deletion mutants, but not in the wild-type strain. Furthermore studies show that propionaldehyde accumulation precisely correlates with interrupted growth. In addition, controls showed that neither propionate nor 1-propanol (the other major products of 1,2-Pd degradation) accumulate to inhibitory levels during growth of S. enterica on 1,2-Pd. The rate of 1,2-Pd consumption was also examined via HPLC. Results showed that each mutant that exhibits interrupted growth also degrades 1,2-Pd at a higher rate than does the wild-type strain. These findings suggest that diol dehydratase activity is altered

PAGE 43

32 in the mutant strains, which is consistent with the hypothesis that polyhedral organelles function to mitigate toxicity by coordinating the rate of propionaldehyde production and consumption through control of diol dehydratase activity. However, additional studies described in this chapter indicated that the situation is more complex and may also involve regulation of the PduP propionaldehyde dehydrogenase. Table 3-1. Strain List Species Strain Genotype S. enterica serovar Typhimurium LT2 Wild-type BE182 pduA652 BE213 pduBB BE274 pduJ654 BE185 pduK655 AP153 pduN BE194 pduT662 BE195 pduU663 Materials and Methods Bacterial Strains, Chemicals, and Reagents Bacterial strains used in this study are listed in Table 3-1. The following chemicals were ordered from Sigma Chemical Company (St. Louis, MO): 1,2-Pd and vitamin B 12 (CN-Cbl). Tryptone and yeast extract were from Difco Laboratories (Detroit, MI). Other chemicals were from Fisher Scientific (Pittsburgh, PA). The rich medium used was Luria-Bertani (LB) medium (47), Lennox (Difco, Detroit, MI). The minimal media used was the No-carbon-E (NCE) medium (8, 46, 70). Amino acids were provided at the following concentrations: valine, isoleucine, leucine, and threonine, 0.3 mM.

PAGE 44

33 Growth Curves For aerobic growth curves, cells were grown either in 250 mL baffled Erlenmeyer flasks with 100 mL appropriate media or 16 x 100 mm test tubes containing 5 mL of the appropriate media. Cultures were incubated at 37 o C in a New Brunswick gyratory water bath shaker model G-76 at 250 rpm (New Brunswick Co. Inc, Edison NJ), and culture tubes were held in place at an angle approximately 45 o Cell growth was monitored using a Beckman model DU640 or a Spectronic 20D + spectrophotometer by measuring optical density at 600 nm. Inocula for the growth curves were prepared as follows: bacterial strains were grown overnight at 37 o C with shaking in LB medium, and either 3.0 mL or 0.100 mL of washed culture was used to inoculate 100 mL or 5 mL cultures, respectively. HPLC Analysis High-performance liquid chromatography (HPLC) was utilized to analyze the growth media of all the deletion mutants thought to be involved in polyhedral body formation and wildtype-LT2. (See Growth Curves Section of Materials and Methods for specific growth conditions.) The procedure involved sampling 1.0 mL of growth media every two h for 64 h from a 100 mL culture of minimal NCE (no-carbon-E) media supplemented with 0.4% 1,2-Pd, 1.0 mM MgSO4, 0.3 mM VILT (amino acids), and 200 ng/mL CNCbl for each of the putative shell deletion strains (pduA, pduBB, pduJ, pduK, pduN, pduT, and pduU) and wildtype-LT2. Each of the 1.0 mL samples was read spectrophotometrically with a Beckman model DU640 at wavelength 600 nm and then spun down at 12,000 rpm for two minutes at 4 o C. The supernatants were stored at -20 o C in tubes with O-ring screw caps until HPLC analysis. Organic fermentation products were measured by HPLC using a Waters 1500 Series

PAGE 45

34 chromatograph equipped with a Bio-Rad Aminex HPX 87H ion exclusion column (room temperature; 4 mM H 2 SO 4 ; flow rate 0.4 mL min -1 or 0.3 mL min -1 ; injection volume, 50 L) and dual detectors (refractive index monitor and UV detector at 210 nm). Standards were prepared for 1,2-Pd, propionaldehyde, propionate, and 1-propanol (w/v) in volumetric flasks at 4 o C using minimal NCE media as solvent. Waters Breeze software was used to analyze the data. Samples were thawed in a water bath, filtered, and stored on ice until being loaded into the autosampler. Standards were run before samples, after every sixth sample, and at the end of each sample run. Dose Response Growth Curves Minimal medium supplemented with 1% succinate, 1.0 mM MgSO 4 and 0.2% 1,2-Pd were used for cell growth. Cells were cultured in 16 x 100 mm test tubes containing 5 mL of media. Cultures were incubated at 37 o C in a New Brunswick model G-76 shaker/water bath at 250 rpm (New Brunswick Co. Inc, Edison NJ). Propionaldehyde, propionate, or 1-propanol were added to culture media at various concentrations as indicated in the results section, and cell growth was monitored by measuring optical density at 600 nm with a Spectronic 20D + spectrophotometer. Inocula for the growth curves were prepared as follows: bacterial strains were grown overnight at 37 o C with shaking in LB medium, and 0.125 mL of washed culture was used to inoculate 5 mL cultures. Results Effect of CNCbl Concentration on the Growth of Wild-type S. enterica and Selected pdu Mutants on 1,2-Pd Minimal Medium. Wild-type S. enterica and selected pdu deletion mutants were grown on 1,2-Pd minimal medium supplemented with various concentrations of CNCbl (0.00625 g/mL,

PAGE 46

35 0.0125 g/mL, 0.0250 g/mL, 0.05 g/mL, 0.1 g/mL, or 0.2 g/mL). Each of the pdu mutants (pduBB, pduJ, pduK, pduN, pduT, and pduU) were capable of growth under these conditions (Figure 3-1A-F). However, a period of growth arrest was observed in strains carrying pduBB, pduJ, and pduK deletions at CNCbl concentrations 0.1 g/mL (Figure 3-1A-B). At CNCbl concentrations 0.05 g/mL the growth profile of the pduBB, pduJ, pduK deletion mutants was similar to that of the wild-type strain (Figure 3-1C-F). It was interesting that the pdu mutants examined exhibited interrupted growth at higher concentrations of CNCbl, but not at lower CNCbl concentrations. This finding is consistent with the idea that interrupted growth results from propionaldehyde toxicity (30, 31). Presumably diol dehydratase would be more active at higher CNCbl levels and produce more propionaldehyde from 1,2-Pd. These findings are similar to results previously reported for a pduA deletion strain (31). However, they extend those findings by showing the phenomenon of interrupted growth and its dependency on CNCbl concentration is not unique to the pduA deletion mutant, and is a general characteristic of mutants that are unable to form organelles or that form grossly misshapen structures. Propionaldehyde Formation To test the hypothesis that the growth arrest of pduA, pduBB, pduJ and pduK deletion mutants resulted from propionaldehyde toxicity, wild-type S. enterica and these deletion mutants were grown on 1,2-Pd minimal medium and the amount of propionaldehyde released into the culture medium was followed over time by HPLC. Results showed that propionaldehyde levels were at least 2.5-times higher in culture broths of pduA, pduBB, pduJ, and pduK deletion mutants compared to wild-type strain.

PAGE 47

36 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 AFEDCB 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.11100102030405060Time (Hours)OD 600nm 70 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.1110010203040506070Time (Hours)OD 600nm LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 0.111001020304050607Time (Hours)OD 600nm 0 LT2 AP147 AP226 AP178 AP158 AP153 AP165 AP163 AFEDCB Figure 3-1. Aerobic growth curves of wild-type-LT2 and polyhedral organelle mutants in 1,2-Pd minimal broth with various concentrations of CNCbl: A) 0.2 g/mL, B) 0.1 g/mL, C) 0.05 g/mL, D) 0.025 g/mL, E) 0.0125 g/mL, F) 0.00625 g/mL (AP147, pduA; AP226, pduBB; AP178, pduJ; AP158, pduK; AP153, pduN; AP165, pduT; AP163, pduU).

PAGE 48

37 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde LT2 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduA 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduBB' 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduJACDB 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde LT2 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduA 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduBB' 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduJ 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde LT2 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduA 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduBB' 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduJACDB 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduK 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduN 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduT 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduUEGHF 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduK 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduN 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduT 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduU 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduK 0123456789010203040506070Time (Hours)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduN 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduT 0123456789010203040506070Time (hrs)Propionaldehyde (mM)0.00.20.40.60.81.01.21.4OD600nm Propionaldehyde pduUEGHF Figure 3-2. HPLC analysis of propionaldehyde levels in wild-type and polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth: A) LT2, B) pduA, C) pduBB, D) pduJ, E) pduK, F) pduN, G) pduT, H) pduU.

PAGE 49

38 Strain Rate: 1,2-Pd mM/ hour R2 n LT2 3.674 0.9970 5 pduA 4.531 0.9977 6 pduB 4.392 0.9988 6 pduJ 3.773 0.9986 7 pduK 3.860 0.9972 7 pduN 2.239 0.9828 9 pduT 3.629 0.9971 7 p duU2.783 0.99639 010203040506070121518212427303336394245485154Time (hrs)1,2-PD (mM) LT2 pduA pduB pduJ pduK pduN pduT pduU Figure 3-3. HPLC analysis of 1,2-Pd consumption in wildtype-LT2 and polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth. Rates were calculated using linear regression of the points in the linear portion of the descending slope. Sample size ranged from 5 to 9 data points, and R 2 values were all above 0.98. Accumulation of propionaldehyde in culture broths of the deletion mutants precisely correlated with the period of interrupted growth, increasing at the beginning of growth arrest and leveling off just before growth resumed (Figure 3-2 A-E). These results support the hypothesis that interrupted growth results from propionaldehyde toxicity. Strains with deletion of the pduN, pduT, and pduU genes accumulated less than half the propionaldehyde observed for the wild-type strain (Figure 3-2 A, F-H). The pduN, pduT, and pduU genes have sequence similarity to genes needed for carboxysome formation, but deletion of these genes does not result in interrupted growth. Less

PAGE 50

39 propionaldehyde production indicates that diol dehydratase activity is reduced in strains carrying deletions of the pduN, pduT, or pduU genes. This finding together with those described above indicate that the polyhedral organelles have the capacity to influence diol dehydratase activity both positively and negatively. In principle, this would provide an effective means of coordinating the rate of propionaldehyde production and consumption to allow maximal growth with minimal toxicity. Effect of Selected pdu Deletion Mutations on 1,2-Pd Consumption HPLC was used to measure the consumption of 1,2-Pd during growth of the wild-type strain and selected pdu mutants on 1,2-Pd minimal medium (Figure 3-3). Deletion strains that resulted in the absence of polyhedra or the formation of aberrant polyhedra (pduA, pduBB, pdu J, and pduK) utilized 1,2-Pd at a rate as much as 23% faster than the wild-type strain, while deletion strains that had no effect on polyhedra formation (pduN, pduT, pduU andpduT) had the same rate or utilized 1,2-Pd as much as 40% slower than wild-type-LT2. These results correlate with the propionaldehyde production data presented above in that strains that degrade 1,2-Pd faster produce more propionaldehyde and vice versa. This further supports the idea that the polyhedral organelles can influence diol dehydratase activity both positively and negatively. One manner in which this could be brought about is through control of AdoCbl availability, and some support for the supposition comes from findings that showed pduA, pduBB, pduJ and pduK deletion mutants grow similarly to wild-type at low CNCbl concentration, but display interrupted growth at higher levels of CNCbl.

PAGE 51

40 Propionate Secretion Propionate is also a major product of 1,2-Pd degradation. Therefore, propionate levels were evaluated and graphed versus time for selected pdu mutants and wild-type S. enterica (Figure 3-6 A-H). The pduA and pduBB deletion mutants secreted about the same amount of propionate as the wild-type with a maximum concentration of about 12.5 mM being detected in culture broths (Figure 3-6 A-C). The pduJ and pduK deletion mutants secreted about one third less total propionate when compared to the wild-type with a maximum concentration of about 8 mM for both strains (Figure 3-6 A, D, E). The pduN deletion mutant secreted the lowest amount of propionate (less than 6.5 mM) (Figure 3-6 F). The pduT and pduU deletion mutants secreted about the same amount of propionate as the wild-type strain (Figure 3-6 A, G, H). Overall, pduA and pduBB deletion mutants produced propionate similarly to wild-type, but strains with pduJ, pduK, pduN, pduT or pduU deletion mutations showed a slight to moderate deficiency in propionate production. These findings do not correlate in any simple way with the measured rates of 1,2-Pd consumption and propionaldehyde production. However, the observed phenotypes of pduJ and pduK deletion mutations could be explained by effects on both diol dehydratase and propionaldehyde dehydrogenase activity. Strains with deletion of the pduJ and pduK genes had increased diol dehydratase activity (as observed by an increased rate of 1,2-Pd consumption), but reduced propionate production. This could have resulted from an impairment of the propionaldehyde dehydrogenase (PduP), since this enzyme converts propionaldehyde to propionyl-CoA (an essential step in propionate formation).

PAGE 52

41 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) LT2 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduA 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduBB' 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduJABCD 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) LT2 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduA 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduBB' 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduJ 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) LT2 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduA 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduBB' 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduJABCD CD 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduK 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduN 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduU 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4 Propionate (mM) pduTEFGH 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduK 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduN 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduU 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4 Propionate (mM) pduT 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduK 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduN 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4OD600nm Propionate (mM) pduU 0246810121416010203040506070Time (Hours)Propionate (mM)00.20.40.60.811.21.4 Propionate (mM) pduTEFGH GH Figure 3-4. HPLC analysis of propionate levels in wild-type-LT2 and polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth: A) LT2, B) pduA, C) pduBB, D) pduJ, E) pduK, F) pduN, G) pduT, H) pduU.

PAGE 53

42 ACBD 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduBB' 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduJ 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduA 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol LT2ACBD 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduBB' 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduJ 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduA 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol LT2 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduK 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduN 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduUEGFH 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduT 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduK 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduN 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduUEGFH 05101520253035010203040506070Time (Hours)1-Propanol (mM)00.20.40.60.811.21.4OD600nm 1-Propanol pduT Figure 3-5. HPLC analysis of 1-propanol levels in wild-type-LT2 and the polyhedral organelle deletion mutants during aerobic growth on 1,2-Pd/CNCbl minimal broth: A) LT2, B) pduA, C) pduBB, D) pduJ, E) pduK, F) pduN, G) pduT, H) pduU.

PAGE 54

43 1-Propanol Secretion 1-Propanol accumulation in culture broths of the wild-type strain and selected pdu mutants during growth on 1,2-Pd minimal medium was also measured. Levels of 1-propanol detected oscillated for unknown reason; hence the reliability of these data are in question. However, the overall data trends for 1-propanol production by each of the deletion mutant were consistent. In general, all of the polyhedral organelle deletion mutants secreted less 1-propanol than the wild-type strain independent of propionaldehyde levels. Levels of 1-propanol tended to increase to a maximum and then decrease for all the strains tested. Also, all of the deletion mutants reached a maximum 1-propanol concentration 2 10 h after the wild-type maximum was met. The mutant strains that are unable to produce polyhedral organelles (pduA and pduBB) secreted about 40% less 1-propanol than the wild-type (Figure 3-5 B, C). The deletion mutants that form aberrant polyhedra (pduJ and pduK) secreted 10% and 30% less 1-propanol than the wild-type, respectively (Figure 3-5 A, D, E). Finally the deletion mutants that form seemingly normal polyhedra (pduN, pduT, and pduU) secreted 35%, 26%, and 25% less 1-propanol than the wild-type. The deficiency of 1-propanol production in the deletion mutants suggests that the alcohol dehydrogenase (PduQ) might be associated with the polyhedral organelles. If so, it is not an integral component since it was not present in the purified structures (30). Nonetheless, PduQ might be peripherally associated with the organelles and could have been removed by the detergent treatment used for organelle purification. It would make

PAGE 55

44 00.20.40.60.811.21.41.61.8051015202530Time (hours)OD600nm LT2-0 LT2-4 (mM) LT2-8 mM LT2-12 mM LT2-16 mM LT2-20 mMA 00.20.40.60.811.20246810Time (hours)OD 600nm 12 LT2-0 LT2-4 mM LT2-8 mM LT2-12 mM LT2-16 mM LT2-20 mMB 00.20.40.60.811.2024681012Time (hours)OD 600nm LT2-0 LT2-4 mM LT2-8 mM LT2-12 mM LT2-16 mM LT2-20 mMC 00.20.40.60.811.21.41.61.8051015202530Time (hours)OD600nm LT2-0 LT2-4 (mM) LT2-8 mM LT2-12 mM LT2-16 mM LT2-20 mMA 00.20.40.60.811.20246810Time (hours)OD 600nm 12 LT2-0 LT2-4 mM LT2-8 mM LT2-12 mM LT2-16 mM LT2-20 mMB 00.20.40.60.811.2024681012Time (hours)OD 600nm LT2-0 LT2-4 mM LT2-8 mM LT2-12 mM LT2-16 mM LT2-20 mMC Figure 3-6. Dose response growth curves of wild-type-LT2 in minimal succinate, 1,2-Pd broth dosed with 0 20 mM: A) propionaldehyde, B) propionate, C) 1-propanol. some sense for PduQ to be in such a location since it could trap propionaldehyde as it exits from the organelle and convert it to the less toxic 1-propanol. Effect of Propionaldehyde, Propionate, and 1-Propanol Supplementation on the Growth of S. enterica. If propionaldehyde toxicity does indeed account for growth arrest of mutants defective in polyhedral organelle formation, this compound should accumulate to toxic levels in culture broths. Above we showed that propionaldehyde levels reach 4 8 mM in organelle-defective mutants, but rises to only 1 2 mM in wild-type S. enterica during growth on 1,2-Pd. To access potential toxicity of propionaldehyde, wild-type S. enterica was cultured on NCE minimal medium (containing 1 % succinate as the carbon and energy source) supplemented with various concentrations of this compound. Growth

PAGE 56

45 arrest was observed in cultures of wild-type S. enterica supplemented with 8, 12, 16, and 20 mM propionaldehyde, but only very slight inhibition was observed with 4 mM proionaldehyde (Figure 3-6 A). The period of growth arrest was dependent on the propionaldehyde concentration in the cultures; higher amounts of propionaldehyde resulted in longer the periods of interrupted growth. These experiments showed that propionaldehyde is inhibitory to the growth of S. enterica at levels observed to occur during interrupted growth of pduA, pduBB, pduJ and pduK mutants (8 mM) (Figure 3-2 B-E). It was observed that toxicity was somewhat greater when propionaldehyde was generated by growing cells compared to addition of propionaldehyde to culture medium. This could be accounted for if propionaldehyde reaches higher intracellular concentration when generated as a metabolic intermediate (compared to entering from the growth medium), which seems likely. The finding that propionaldehyde is toxic to S. enterica when it reaches levels near 8 mM together with the finding that levels near this value accumulate in culture broths of pdu deletion mutants unable to form organelles provides direct evidence that interrupted growth results from propionaldehyde toxicity. As a control, culture broths were supplemented with 1-propanol and propionic acid at levels near those reached during 1,2-Pd degradation. In contrast to the results obtained with propionaldehyde, neither propionate nor 1-propanol were inhibitory to the growth of S. enterica at the levels used (Figure 3-6 B, C). Prior studies indicated that interrupted growth resulted from the accumulation of a toxic metabolite derived from 1,2-Pd. Thus, the results presented above provide further support for the hypothesis that

PAGE 57

46 the polyhedral organelles under investigation here function to mitigate propionaldehyde toxicity. Discussion Previous studies showed a pduA, pduBB, pduJ and pduK deletion mutants are impaired for polyhedral body formation and undergo an extended period of growth arrest during the degradation of 1,2-Pd that is not observed in the wild-type. It was proposed that growth arrest (interrupted growth) resulted from the accumulation of propionaldehyde to toxic levels, but no direct evidence of propionaldehyde toxicity was reported. Here we showed that propionaldehyde accumulates to toxic levels in pduA, pduBB, pduJ and pduK deletion mutants during growth on 1,2-Pd, but not in the wild-type strain. Results also showed that propionaldehyde levels begin to rise at the onset of growth arrest and fall off just before growth resumes. This finding provides compelling direct evidence that the interrupted growth observed in pduA, pduBB, pduJ and pduK deletion mutants during 1,2-Pd degradation results from propionaldehyde toxicity. Since pduA, pduBB, pduJ and pduK deletion mutants are also impaired for organelle formation, these data support the hypothesis that the polyhedral organelles formed by S. enterica during growth on 1,2-Pd function to mitigate propionaldehyde toxicity. A previous proteomic analysis of Klebsiellae pneumonia during glycerol fermentation to 1,3-Pd found an increased number of stress proteins were formed during this metabolic process, and the authors speculated that the increased formation of these proteins might provide a means to protect against stress or toxic conditions caused by a possible accumulation of 3-hydroxypropionaldehyde (72). Additionally, 3-hydroxypropionaldehyde has been shown to induce growth inhibition in Enterobacter

PAGE 58

47 agglomerans, K. pneumoniae, and Citrobacter freundii (7). These findings suggest that aldehyde toxicity may be a problem of general importance during catabolic processes. 05101520253035LT2pduApduBpduJpduKpduNpduTpduU(mM) Propioniate Propionaldehyde 1-Propanol Figure 3-7. HPLC analysis of maximum production levels of propionate, propionaldehyde and 1-propanol in wild-type-LT2 and polyhedral organelle deletion strains during aerobic growth on 1,2-Pd/CNCbl minimal broth In addition, a DNA microarray analysis on the long-term adaptive responses of E. coli found increased expression of a number of genes involved in the RpoS-dependent general stress response when propionate was added to the growth medium (53). Therefore, it seemed likely that a variety of fermentation products could affect cell growth. Accordingly, the effects of each major fermentation product derived from 1,2-Pd (propionaldehyde, propionate, and 1-propanol) were tested for potential toxic effects on cell growth. Results showed that of the three compounds only propionaldehyde induced growth arrest at levels observed to accumulate in culture broths during 1,2-Pd

PAGE 59

48 degradation (Figure 3-6). Furthermore, the maximum levels of propionaldehyde, propionate and 1-propanol for wild-type-LT2, pduA, pduBB, pduJ, pduK, pduN, pduT, and pduU show that only propionaldehyde levels are consistently greater in organelle-deficient mutants compared to the wild-type strain (Figure 3-7). Prior studies also showed that a pduA deletion mutant showed interrupted growth at higher CNCbl concentrations, but not at lower concentrations. These findings were interpreted to suggest that the polyhedral organelles mitigate propionaldehyde toxicity through control of diol dehydratase activity via regulation of cofactor availability. The HPLC studies reported here suggest a more complex situation. The pduA and pduBB mutants which do not form polyhedral organelles utilize 1,2-Pd about 20% faster than the wild-type suggesting that the organelles can have an inhibitory effect on diol dehydratase (Figure 3-3). In the mutants that formed aberrant organelles (pduJ and pduK), 1,2-Pd utilization rates were only marginally faster than the wild-type. However, propionaldehyde accumulated to elevated levels, and propionate production was impaired suggesting these mutants might affect propionaldehyde dehydrogenase activity. In the mutants that formed normal appearing polyhedra, the rates of 1,2-Pd consumption were either about 25% slower (pduN and pduU), or similar to the wild-type (pduT) (Figure 3-3). These data suggest that proteins of the polyhedral organelles can also have a negative effect on 1,2-Pd consumption. Thus from the work presented here, we conclude that the polyhedral organelles can have both positive and negative effects on diol dehydratase activity and can also influence the activity of the propionaldehyde dehydrogenase (PduP). This suggests a somewhat intricate mechanism for optimizing

PAGE 60

49 growth while minimizing propionaldehyde toxicity that operates by coordinating the rates of propionaldehyde production and consumption.

PAGE 61

LIST OF REFERENCES 1. Abeles, R. H. 1983. Suicide enzyme inactivators. Basic Life Sci. 25:287-305. 2. Ailion, M., T. A. Bobik, and J. R. Roth. 1993. Two global regulatory systems (Crp and Arc) control the cobalamin/propanediol regulon of Salmonella typhimurium. J. Bacteriol. 175:7200-7208. 3. Aldrich, H. C., Bobik, T. A., Williams, D. S., and R. J. Busch.. 1998. Polyhedral inclusion bodies in enteric bacteria. J2 Abstract 98th Gen. Meet. Am. Soc. Microbiol. 1998. Am. Soc. Microbiol., Atlanta, GA. 4. Babior, B. M., T. H. Moss, and D. C. Gould. 1972. The mechanism of action of ethanolamine ammonia lyase, a B 12 -dependent enzyme. X. A study of the reaction by electron spin resonance spectrometry. J. Biol. Chem. 247:4389-4392. 5. Bachovchin, W. W., R. G. Eagar, Jr., K. W. Moore, and J. H. Richards. 1977. Mechanism of action of adenosylcobalamin: glycerol and other substrate analogues as substrates and inactivators for propanediol dehydratase--kinetics, stereospecificity, and mechanism. Biochemistry 16:1082-1092. 6. Baker, C. S., I. Morozov, K. Suzuki, T. Romeo, and P. Babitzke. 2002. CsrA regulates glycogen biosynthesis by preventing translation of glgC in Escherichia coli. Mol. Microbiol. 44:1599-1610. 7. Barbirato, F., J. P. Grivet, P. Soucaille, and A. Bories. 1996. 3-Hydroxypropionaldehyde, an inhibitory metabolite of glycerol fermentation to 1,3-propanediol by enterobacterial species. Appl. Environ. Microbiol. 62:1448-1451. 8. Berkowitz, D., J. M. Hushon, H. J. Whitfield, Jr., J. Roth, and B. N. Ames. 1968. Procedure for identifying nonsense mutations. J. Bacteriol. 96:215-220. 9. Bobik, T. A., M. Ailion, and J. R. Roth. 1992. A single regulatory gene integrates control of vitamin B 12 synthesis and propanediol degradation. J. Bacteriol. 174:2253-2266. 10. Bobik, T. A., G. D. Havemann, R. J. Busch, D. S. Williams, and H. C. Aldrich. 1999. The propanediol utilization (pdu) operon of Salmonella enterica serovar Typhimurium LT2 includes genes necessary for formation of polyhedral organelles involved in coenzyme B(12)-dependent 1, 2-propanediol degradation. J. Bacteriol. 181:5967-5975. 50

PAGE 62

51 11. Bobik, T. A., Y. Xu, R. M. Jeter, K. E. Otto, and J. R. Roth. 1997. Propanediol utilization genes (pdu) of Salmonella typhimurium: three genes for the propanediol dehydratase. J. Bacteriol. 179:6633-6639. 12. Bry, L., P. G. Falk, T. Midtvedt, and J. I. Gordon. 1996. A model of host-microbial interactions in an open mammalian ecosystem. Science 273:1380-1383. 13. Cannon, G. C., S. H. Baker, F. Soyer, D. R. Johnson, C. E. Bradburne, J. L. Mehlman, P. S. Davies, Q. L. Jiang, S. Heinhorst, and J. M. Shively. 2003. Organization of carboxysome genes in the thiobacilli. Curr. Microbiol. 46:115-119. 14. Chen, P., M. Ailion, T. Bobik, G. Stormo, and J. Roth. 1995. Five promoters integrate control of the cob/pdu regulon in Salmonella typhimurium. J. Bacteriol. 177:5401-5410. 15. Chen, P., M. Ailion, N. Weyand, and J. Roth. 1995. The end of the cob operon: evidence that the last gene (cobT) catalyzes synthesis of the lower ligand of vitamin B 12 dimethylbenzimidazole. J. Bacteriol. 177:1461-1469. 16. Chen, P., D. I. Andersson, and J. R. Roth. 1994. The control region of the pdu/cob regulon in Salmonella typhimurium. J. Bacteriol. 176:5474-5482. 17. Conner, C. P., D. M. Heithoff, S. M. Julio, R. L. Sinsheimer, and M. J. Mahan. 1998. Differential patterns of acquired virulence genes distinguish Salmonella strains. Proc. Natl. Acad. Sci. U. S. A. 95:4641-4645. 18. Conway, T., G. W. Sewell, Y. A. Osman, and L. O. Ingram. 1987. Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis. J. Bacteriol. 169:2591-2597. 19. Dailly, Y., F. Mat-Jan, and D. P. Clark. 2001. Novel alcohol dehydrogenase activity in a mutant of Salmonella able to use ethanol as sole carbon source. FEMS Microbiol. Lett. 201:41-45. 20. Dailly, Y. P., P. Bunch, and D. P. Clark. 2000. Comparison of the fermentative alcohol dehydrogenases of Salmonella typhimurium and Escherichia coli. Microbios 103:179-196. 21. Datsenko, K. A. and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97:6640-6645. 22. Davis, R. W., D. Botstein, and Roth J.R. 1980. Advanced bacterial genetics: a manual for genetic engineering. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. 23. Escalante-Semerena, J. C. and J. R. Roth. 1987. Regulation of cobalamin biosynthetic operons in Salmonella typhimurium. J. Bacteriol. 169:2251-2258.

PAGE 63

52 24. Fairchild, C. D., J. Zhao, J. Zhou, S. E. Colson, D. A. Bryant, and A. N. Glazer. 1992. Phycocyanin alpha-subunit phycocyanobilin lyase. Proc. Natl. Acad. Sci. U. S. A. 89:7017-7021. 25. Ford, J. E., E. S. Holdsworth, and S. K. Kon. 1955. The biosynthesis of vitamin B 12 -like compounds. Biochem. J. 59:86-93. 26. Fox, D. K. and S. Roseman. 1986. Isolation and characterization of homogeneous acetate kinase from Salmonella typhimurium and Escherichia coli. J. Biol. Chem. 261:13487-13497. 27. Friedberg, D., A. Kaplan, R. Ariel, M. Kessel, and J. Seijffers. 1989. The 5'-flanking region of the gene encoding the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase is crucial for growth of the cyanobacterium Synechococcus sp. strain PCC 7942 at the level of CO 2 in air. J. Bacteriol. 171:6069-6076. 28. Friedmann, H. C. 1975. Biosynthesis of corrinoids, p. 75-103. In B. M. Babior (ed.), Cobalamin. John Wiley and Sons, N. Y. 29. Hamilton, J. A., Y. Tamao, R. L. Blakley, and R. E. Coffman. 1972. Electron paramagnetic resonance studies on cobalamin-dependent ribonucleotide reduction. Biochemistry 11:4696-4705. 30. Havemann, G. D. and T. A. Bobik. 2003. Protein content of polyhedral organelles involved in coenzyme B12-dependent degradation of 1,2-propanediol in Salmonella enterica serovar Typhimurium LT2. J. Bacteriol. 185:5086-5095. 31. Havemann, G. D., E. M. Sampson, and T. A. Bobik. 2002. PduA is a shell protein of polyhedral organelles involved in coenzyme B(12)-dependent degradation of 1,2-propanediol in Salmonella enterica serovar typhimurium LT2. J. Bacteriol. 184:1253-1261. 32. Heithoff, D. M., C. P. Conner, U. Hentschel, F. Govantes, P. C. Hanna, and M. J. Mahan. 1999. Coordinate intracellular expression of Salmonella genes induced during infection. J. Bacteriol. 181:799-807. 33. Horswill, A. R. and J. C. Escalante-Semerena. 1997. Propionate catabolism in Salmonella typhimurium LT2: two divergently transcribed units comprise the prp locus at 8.5 centisomes, prpR encodes a member of the sigma-54 family of activators, and the prpBCDE genes constitute an operon. J. Bacteriol. 179:928-940. 34. Huennekens, F. M., K. S. Viktols, K. Fujii, and D. W. Jacobsen. 1982. Biosynthesis of the cobalamin coenzymes, In D. Dolphin (ed.), B 12 John Wiley and Sons, N. Y. 35. Ishida, A. and T. Toraya. 1993. Adenosylcobinamide methyl phosphate as a pseudocoenzyme for diol dehydrase. Biochemistry 32:1535-1540.

PAGE 64

53 36. Iuchi, S., D. C. Cameron, and E. C. Lin. 1989. A second global regulator gene (arcB) mediating repression of enzymes in aerobic pathways of Escherichia coli. J. Bacteriol. 171:868-873. 37. Iuchi, S. and E. C. Lin. 1988. arcA (dye), a global regulatory gene in Escherichia coli mediating repression of enzymes in aerobic pathways. Proc. Natl. Acad. Sci. U. S. A. 85:1888-1892. 38. Jeter, R. M. 1990. Cobalamin-dependent 1,2-propanediol utilization by Salmonella typhimurium. J. Gen. Microbiol. 136 ( Pt 5):887-896. 39. Jeter, R. M., B. M. Olivera, and J. R. Roth. 1984. Salmonella typhimurium synthesizes cobalamin (vitamin B 12 ) de novo under anaerobic growth conditions. J. Bacteriol. 159:206-213. 40. Johnson, C. L., E. Pechonick, S. D. Park, G. D. Havemann, N. A. Leal, and T. A. Bobik. 2001. Functional genomic, biochemical, and genetic characterization of the Salmonella pduO gene, an ATP:cob(I)alamin adenosyltransferase gene. J. Bacteriol. 183:1577-1584. 41. Lawhon, S. D., J. G. Frye, M. Suyemoto, S. Porwollik, M. McClelland, and C. Altier. 2003. Global regulation by CsrA in Salmonella typhimurium. Mol. Microbiol. 48:1633-1645. 42. Leal, N. A., G. D. Havemann, and T. A. Bobik. 2003. PduP is a coenzyme-a-acylating propionaldehyde dehydrogenase associated with the polyhedral bodies involved in B 12 -dependent 1,2-propanediol degradation by Salmonella enterica serovar Typhimurium LT2. Arch. Microbiol. 180:353-361. 43. Lin, E. C. 1987. Dissimilatory pathways for sugars, polyols, and carboxylates, p. 244-284. In F. D. Niedhardt, K. B. Ingraham, K. B. Low, et al. (eds.), Escherichia coli and Salmonella typhimurium: Cell. Mol. Biol. Am. Soc. Microbiol., Washington D. C. 44. Liu, M. Y., H. Yang, and T. Romeo. 1995. The product of the pleiotropic Escherichia coli gene csrA modulates glycogen biosynthesis via effects on mRNA stability. J. Bacteriol. 177:2663-2672. 45. Marco, E., I. Martinez, M. Ronentarazi, M. I. Orus, and A. Kaplan. 1994. Inactivation of Ccmo in Synechococcus Sp Strain Pcc-7942 Results in A Mutant Requiring High-Levels of CO 2 Appl. Environ. Microbiol. 60:1018-1020. 46. Marco, E. and M. I. Orus. 1993. Trichlorfon-Induced Inhibition of Nitrate and Ammonium Uptake in Cyanobacteria. J. Exper. Bot. 44:501-508. 47. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Habor Laboratory, Cold Spring Harbor, N. Y.

PAGE 65

54 48. Miller, V. L. and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575-2583. 49. Mori, K., T. Tobimatsu, T. Hara, and T. Toraya. 1997. Characterization, sequencing, and expression of the genes encoding a reactivating factor for glycerol-inactivated adenosylcobalamin-dependent diol dehydratase. J. Biol. Chem. 272:32034-32041. 50. Mori, K. and T. Toraya. 1999. Mechanism of reactivation of coenzyme B 12 -dependent diol dehydratase by a molecular chaperone-like reactivating factor. Biochemistry 38:13170-13178. 51. Obradors, N., J. Badia, L. Baldoma, and J. Aguilar. 1988. Anaerobic metabolism of the L-rhamnose fermentation product 1,2-propanediol in Salmonella typhimurium. J. Bacteriol. 170:2159-2162. 52. Palacios, S., V. J. Starai, and J. C. Escalante-Semerena. 2003. Propionyl coenzyme A is a common intermediate in the 1,2-propanediol and propionate catabolic pathways needed for expression of the prpBCDE operon during growth of Salmonella enterica on 1,2-propanediol. J. Bacteriol. 185:2802-2810. 53. Polen, T., D. Rittmann, V. F. Wendisch, and H. Sahm. 2003. DNA microarray analyses of the long-term adaptive response of Escherichia coli to acetate and propionate. Appl. Environ. Microbiol. 69:1759-1774. 54. Romeo, T. 1996. Post-transcriptional regulation of bacterial carbohydrate metabolism: evidence that the gene product CsrA is a global mRNA decay factor. Res. Microbiol. 147:505-512. 55. Romeo, T., M. Gong, M. Y. Liu, and A. M. Brun-Zinkernagel. 1993. Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J. Bacteriol. 175:4744-4755. 56. Rondon, M. R. and J. C. Escalante-Semerena. 1992. The poc locus is required for 1,2-propanediol-dependent transcription of the cobalamin biosynthetic (cob) and propanediol utilization (pdu) genes of Salmonella typhimurium. J. Bacteriol. 174:2267-2272. 57. Roth, J. R., J. G. Lawrence, and T. A. Bobik. 1996. Cobalamin (coenzyme B12): synthesis and biological significance. Annu. Rev. Microbiol. 50:137-181. 58. Sabnis, N. A., H. Yang, and T. Romeo. 1995. Pleiotropic regulation of central carbohydrate metabolism in Escherichia coli via the gene csrA. J. Biol. Chem. 270:29096-29104.

PAGE 66

55 59. Sambrook, J. E., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. 60. Schmehl, M., A. Jahn, z. Meyer, V, S. Hennecke, B. Masepohl, M. Schuppler, M. Marxer, J. Oelze, and W. Klipp. 1993. Identification of a new class of nitrogen fixation genes in Rhodobacter capsulatus: a putative membrane complex involved in electron transport to nitrogenase. Mol. Gen. Genet. 241:602-615. 61. Schmieger, H. 1971. A method for detection of phage mutants with altered transducing ability. Mol. Gen. Genet. 110:378-381. 62. Shively, J. M., C. E. Bradburne, H. C. Aldrich, T. A. Bobik, J. L. Mehlman, S. Jin, and S. H. Baker. 1998. Sequence homologs of the carboxysomal polypeptide CsoS1 of the thiobacilli are present in cyanobacteria and enteric bacteria that form carboxysomes polyhedral bodies. Can. J. Bot. 76:906-916. 63. Shively, J. M., G. van Keulen, and W. G. Meijer. 1998. Something from almost nothing: carbon dioxide fixation in chemoautotrophs. Annu. Rev. Microbiol. 52:191-230. 64. Toraya, T. 2000. Radical catalysis of B 12 enzymes: structure, mechanism, inactivation, and reactivation of diol and glycerol dehydratases. Cell Mol. Life Sci. 57:106-127. 65. Toraya, T., S. Honda, and S. Fukui. 1979. Fermentation of 1,2-propanediol with 1,2-ethanediol by some genera of Enterobacteriaceae, involving coenzyme B 12 -dependent diol dehydratase. J. Bacteriol. 139:39-47. 66. Toraya, T. and A. Ishida. 1991. Roles of the D-ribose and 5,6-dimethylbenzimidazole moieties of the nucleotide loop of adenosylcobalamin in manifestation of coenzymic function in the diol dehydrase reaction. J. Biol. Chem. 266:5430-5437. 67. Toraya, T. and K. Mori. 1999. A reactivating factor for coenzyme B 12 -dependent diol dehydratase. J. Biol. Chem. 274:3372-3377. 68. Toraya, T., M. Yamanishi, H. Muguruma, K. Ushio, J. Yamauchi, and T. Kawamura. 1997. An electron paramagnetic resonance study on the mechanism-based inactivation of adenosylcobalamin-dependent diol dehydrase by glycerol and other substrates. Biochim. Biophys. Acta 1337:11-16. 69. Van Dyk, T. K. and R. A. LaRossa. 1987. Involvement of ack-pta operon products in alpha-ketobutyrate metabolism by Salmonella typhimurium. Mol. Gen. Genet. 207:435-440. 70. Vogel, H. J. and D. M. Bonner. 1956. Acetylornithinase of Escherichia coli: partial purification and some properties. J. Biol. Chem. 218:97-106.

PAGE 67

56 71. Walter, D., M. Ailion, and J. Roth. 1997. Genetic characterization of the pdu operon: use of 1,2-propanediol in Salmonella typhimurium. J. Bacteriol. 179:1013-1022. 72. Wang, W., J. Sun, M. Hartlep, W. D. Deckwer, and A. P. Zeng. 2003. Combined use of proteomic analysis and enzyme activity assays for metabolic pathway analysis of glycerol fermentation by Klebsiella pneumoniae. Biotechnol. Bioeng. 83:525-536. 73. Wei, B., S. Shin, D. LaPorte, A. J. Wolfe, and T. Romeo. 2000. Global regulatory mutations in csrA and rpoS cause severe central carbon stress in Escherichia coli in the presence of acetate. J. Bacteriol. 182:1632-1640. 74. Yamanishi, M., S. Yamada, A. Ishida, J. Yamauchi, and T. Toraya. 1998. EPR spectroscopic evidence for the mechanism-based inactivation of adenosylcobalamin-dependent diol dehydratase by coenzyme analogs. J. Biochem.(Tokyo) 124:598-601.

PAGE 68

BIOGRAPHICAL SKETCH Edith M. Sampson was born in Deland, FL. She is the proud daughter of Harold and Peggy McIntyre; sister to Sean McIntyre and Christa Candler; wife to Douglas Sampson; and mother to Ryan Sampson. She attended five different elementary schools, one junior high school, and two different high schools in six different states. She graduated from Princeton H. S. in Princeton, WV. At 15, she took her first job and continued to work throughout her high school years. After high school, she served in the U. S. Army for 2 years, working as a telecommunications operator. With the Army College Fund, she obtained an A. S. degree in Data Electronics from Phillips Junior College located in Augusta, Georgia. After graduating, she worked for Augusta Newsprint as a computer operator. She then moved to Florida and attended and graduated with honors from Daytona Beach Community College with an A. A. degree. Afterward, she attended and graduated with honors from the University of Florida (UF) with a B. S. degree in Microbiology and a minor in Chemistry. Next, she took a position as a senior laboratory technician with Dr. Thomas Bobik in the Microbiology and Cell Science Department at UF. Eighteen months later, she began part-time graduate studies in the same department with Dr. Bobik as her mentor. Her research project was a genetic characterization of the organelles involved in B 12 -dependent 1,2-propanediol metabolism. She was reassigned to the DNA sequencing laboratory for several months in the Microbiology Department before accepting a Biological Scientist position with Dr. Gregory Schultz in the OB/GYN Department at UF. 57