Citation
Molecular Investigations, Cryopreservation and Genetic Transformation Studies in Papaya (Carica papaya L.) for Cold Hardiness

Material Information

Title:
Molecular Investigations, Cryopreservation and Genetic Transformation Studies in Papaya (Carica papaya L.) for Cold Hardiness
Creator:
KHEKNEY, SADANAND A. ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Cells ( jstor )
Cryopreservation ( jstor )
Embryos ( jstor )
Freezing ( jstor )
Gels ( jstor )
Papayas ( jstor )
Plant cells ( jstor )
Somatic embryos ( jstor )
Species ( jstor )
Sulfates ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Sadanand A. Khekney. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
8/31/2005
Resource Identifier:
436097584 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

MOLECULAR INVESTIGATIONS, CRY OPRESERVATION AND GENETIC TRANSFORMATION STUDIES IN PAPAYA ( Carica papaya L.) FOR COLD HARDINESS By SADANAND A. DHEKNEY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Sadanand Dhekney

PAGE 3

This document is dedicated to my parents

PAGE 4

iv ACKNOWLEDGMENTS I would like to express my deep apprecia tion and gratitude to Dr. Richard Litz, chair of my academic supervisory committee for his guidance, encouragement, advice, patience and moral support duri ng the period of course and re search work of the Ph.D. program. I would like to thank the members of my advisory committee, Dr. Dennis Gray, Dr. Anand Yadav, Dr. David Moraga and Dr. Kenneth Quesenberry for their guidance, technical support and expertise during the course of research work. I would also like to thank Dr. James M. White for attending my fina l defense exam at such a short notice. I wish to thank Dr. Anand K. Yadav, Princi pal Investigator/Proje ct Director of the below mentioned USDA/CSREES research pr oject on papaya biotechnology at Fort Valley State University, Geor gia, especially for providing financial support for the Research Assistantship at the University of Florida and the laborat ory facilities at the Research Station in Georgia. I wish to express my gratitude to Ms Pamela Moon for her assistance with laboratory work, statistical anal ysis and computer graphics. My very special thanks are extended to Dr. Simon Raharjo for his constant guidance and technical expertise in tissue culture and molecular biology work. I would al so like to thank Dr. Nirmal Joshee and Dr. Bipul Biswas of Fort Valley State Universit y, and Dr. Zhijian Li of MREC, University of Florida for their help and guidance during my period in their laborator ies. I would like to express a deep sense of gratitude to Ms. Sharon Norton of the Education Core, ICBR for her help and support for the molecular biol ogy work. I thank Dr. Bruce Shaffer, Dr.

PAGE 5

v Jonathan Crane, Dr. Thomas Davenport, Dr . Jorge Pea, Dr. Wagner Vendrame, Marie Thorpe, Monica Herrera, Rita Duncan, Deir elis Mesa, Callie Sullivan, Wendy Meyer, Holly Glen, Manny Soto, Mike Rossner and othe rs for their help and assistance during my stay at TREC. I would like to thank the st aff at the Horticultural Science Department in Gainesville for their help and assistance. I express my gratitude to my fellow labor atory mates and students at TREC, Darda Efendi, Isidro Suarez, Rashid Al Yahyai, Lu is Pablo, Stuart Muller and Ivan Gasca for their help and suggestions. A special word of thanks to Renuka and Sanjit Mathur, Vandana and Arvind Gudi, Neneng Nursahanah, Divina Amalin, Angel Colls and family, and visiting scientists Dr. Lai Keng Chan, Dr. Rajani Nadgauda and Dr. Kazimitsu Matsumato for making life in Homestead enjoyable and colorful. I shall always be indebted to Dr. Jayasankar Subramanian and his wife Sivagamsundhari Sikamani fo r their constant encouragement, guidance and moral support during the entire period of my gradua te studies. I would also like to thank my friends in Gainesville, Dr. Chandramohan, Anurag Agrawal, Krishnan, Manjul Dutt, Sreeram, Brajesh Dubey, Pradeep Jain, Ramkrishnan and Milind Chavan for their hospitability during my visits to Gainesville. I express my gratitude to the Miami Da de Agri-Council, Inc, the J.N. Tata Education Trust and the B. D. Bangar Edu cation Trust for the financial assistance provided during the PhD program. I would like to thank Dr. Mi chael Thomashow and Dr. Sa rah Gilmour of Michigan State University for providing the CBF c onstructs, primer sequences and technical expertise from time to time.

PAGE 6

vi Finally, I would like to thank my parent s Arun and Shubhada Dhekney, sister and brother in law Aparna and Ajit Joshi and my dog Smash for their love, patience and constant support which made me compet ent to achieve my goals in life. Acknowledgement of support and disclaimer: This material is based upon work s upported by the Cooperative State Research, Education, and Extension Service, U. S. Department of Agriculture, under Agreement No. 98-38814-6202, for the resear ch project entitled “Developing Biotechnological Approaches to Improve Cold Hardiness in Papaya” at Fort Valley State University . Any opinions, findings, conc lusions or recommendations expressed in this publications are those of the author and do not necessarily reflect the view of the U.S. Department of Agriculture.

PAGE 7

vii TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES.............................................................................................................xi LIST OF FIGURES..........................................................................................................xii ABSTRACT.....................................................................................................................xi v CHAPTER 1 INTRODUCTION........................................................................................................1 2 LITERATURE REVIEW.............................................................................................7 Papaya Carica papaya L..............................................................................................7 Uses and Importance.............................................................................................7 Taxonomy..............................................................................................................9 Breeding advances...............................................................................................11 Somatic Cell Genetics and Ge netic Transformation Studies..............................17 Somatic Embryogenesis...............................................................................17 1. Induction..........................................................................................................18 Direct somatic embryogenesis.....................................................................19 Indirect Somatic Embryogenesis..................................................................20 Cell and Tissue Culture Studies with Papaya......................................................24 Micropropagation.........................................................................................24 Protoplast culture..........................................................................................26 Somatic Embryogenesis...............................................................................27 Induction.......................................................................................................27 Maintenance.................................................................................................28 Somatic embryo development......................................................................28 Germination and plantlet recovery...............................................................28 Genetic Transformation studies...........................................................................29 Use of GFP as a reporter gene.............................................................................29 Genetic Transformation studies in Papaya..........................................................31 Genetics of cold tole rance in crop species..........................................................34 Cryopreservation Studies.....................................................................................41 Importance and use of cryopreservation......................................................41

PAGE 8

viii Cryopreservation methods...................................................................................43 Thawing........................................................................................................47 Post-thaw treatments....................................................................................49 Viability and regrowth in cryopreserved cultures........................................50 3 MOLECULAR PROBING OF CARICA PAPAYA AND VASCONCELLA SPP. FOR COLD-INDUCIBLE SEQUENCES..................................................................51 Introduction.................................................................................................................51 Materials and Methods...............................................................................................54 Plant Material......................................................................................................54 DNA Extraction...................................................................................................55 RNAse Treatment and DNA Purification............................................................56 PCR (Polymerase chain reaction) Primers and Reaction Conditions..................57 Optimization of Magnesium (Mg) Concentration...............................................57 Electrophoretic Analysis of PCR Products..........................................................58 Purification of DNA Fragme nts from Agarose Gel............................................59 Sequencing of Amplified PCR Products.............................................................60 Database Search for Homology of Sequences.....................................................60 Results........................................................................................................................ .60 PCR amplification products................................................................................60 Optimization of Mg Concentrati on for Maximum Amplification.......................62 Sequencing of PCR Products...............................................................................63 Database Search for Homology of Sequences.....................................................64 Discussion...................................................................................................................65 Conclusion..................................................................................................................68 4 SOMATIC EMBRYOGENESIS AND CRYOPRESERVATION STUDIES IN PAPAYA....................................................................................................................70 Introduction.................................................................................................................70 Materials and Methods...............................................................................................74 Somatic Embryogenesis Studies..........................................................................74 Plant material................................................................................................74 Induction of embryogenic cultures...............................................................74 Maintenance of embryogenic cultures.........................................................75 Somatic embryo development......................................................................76 Somatic embryo germination and plantlet development..............................76 Cryopreservation Studies.....................................................................................76 Embryogenic cultures...................................................................................76 Cryoprotectant treatments............................................................................76 Freezing procedures.....................................................................................77 Thawing procedure.......................................................................................78 Regrowth......................................................................................................78 Results........................................................................................................................ .79 Somatic Embryogenesis Studies..........................................................................79 Induction and maintenance of embryogenic cultures...................................79

PAGE 9

ix Somatic embryo development......................................................................79 Somatic embryo germination and plantlet development..............................81 Cryopreservation Studies.....................................................................................82 Regrowth of embryogenic cell masses following cryopreservation............82 Recovery of proembryonic masses following cryopreservation..................83 Somatic embryo development following cryopreservation.........................84 Somatic embryo germination and plantlet development..............................87 Germination of somatic embryos following cryopreservation using encapsulation-dehydration procedure.....................................................88 Discussion...................................................................................................................89 Somatic Embryogenesis Studies..........................................................................89 Cryopreservation Studies.....................................................................................93 Conclusions.................................................................................................................97 5 TRANSFORMATION OF EMBRYOGE NIC PAPAYA CULTURES WITH CBF CONSTRUCTS AND RECO VERY OF PLANTS....................................................99 Introduction.................................................................................................................99 Materials and Methods.............................................................................................101 Preparation of E coli. Cultures and Plasmid Isolation.......................................101 Evaluation of Plasmid DNA usi ng Agarose Gel Electrophoresis.....................104 Electroporation of Purified Plasmid DNA into Agrobacterium ........................104 Preparation of Agrobacterium Stocks...............................................................105 Confirmation of Bina ry Construct in Agrobacterium by Agarose Gel Electrophoresis...............................................................................................105 Induction of Embryogenic Cultures..................................................................106 Maintenance of Embryogenic Cultures.............................................................106 Co-cultivation of Embr yogenic cultures with Agrobacterium tumefaciens ......106 Growth and Development of Tran sformed Embryogenic Cultures..................107 Germination and Plantlet Development............................................................107 DNA Extraction.................................................................................................108 RNAse Treatment and DNA Purification..........................................................109 Restriction Enzyme Diges tion for Designing Probe.........................................109 Synthesizing the Probe for S outhern Blot Hybridization..................................110 Restriction Enzyme Dige stion of Genomic DNA.............................................111 Analysis of Digested Products...........................................................................113 Restriction Digestion of Geno mic DNA for Southern Blot..............................114 Depurination and Denaturation of Genomic DNA on the Agarose Gel............115 Capillary Transfer of Genomic DNA to Nylon Membrane...............................115 Cross Linking of DNA with Nylon Membrane.................................................116 Checking Transfer Efficiency of the Gel...........................................................116 Prehybridization and Hybridizat ion of the Nylon membrane:..........................116 Detection of the DIG Labeled Probe.................................................................117 Exposing and Developing the Membrane on a Film.........................................118 Results.......................................................................................................................1 18 Isolation and Evaluation of Plas mid DNA harboring the CBF 1, 2 and 3 Sequences.......................................................................................................119

PAGE 10

x Confirmation of Bina ry Construct into Agrobacterium by Agarose Gel Electrophoresis...............................................................................................120 Co-cultivation and Growth of Embryogenic Cultures.......................................121 Plantlet Development........................................................................................122 Restriction Enzyme Diges tion for ProbeSynthesis............................................123 Analysis of Labeled Probe using Agarose Gel Electrophoresis........................123 Restriction Enzyme Dige stion of Genomic DNA.............................................125 Checking Transfer Efficiency of Gel following Blotting with Nylon Membrane......................................................................................................126 Confirmation of Southern Blot..........................................................................127 Discussion.................................................................................................................128 Conclusions...............................................................................................................133 6 SUMMARY AND CONCLUSIONS.......................................................................134 Summary...................................................................................................................134 Conclusions...............................................................................................................135 APPENDIX A SEQUENCE INFORMATION................................................................................137 B RESPONSE OF EMBRYOGENIC CULTURES TO KANAMYCIN SULFATE.139 LIST OF REFERENCES.................................................................................................141 BIOGRAPHICAL SKETCH...........................................................................................168

PAGE 11

xi LIST OF TABLES Table page 2-1 Nutritional composition of papaya fruit per 100 g (Bose and Mitra, 1990)...............8 2.2 The Caricaceae family.............................................................................................10 2-3 Different Vasconcella species with their orig in, distribution and uses....................12 2-4 Cryopreservation of tropical plant sp ecies using different cryopreservation methods....................................................................................................................47 3-1 Primers used for PCR amplification and cycle conditions.......................................58 3-2 Cycle conditions for different primer sequences......................................................58 3-3 Working conditions for optimization of Mg concentration.....................................59 4-1 Different tissue types, cryoprotectant treatments and cooling methods used to determine optimum stage and treatment for cryopreservation.................................77 4-2 Number of normal, abnormal somatic embryos and percentage normal somatic embryos in different treatments................................................................................86 5-1 Restriction enzymes and digestion conditions for CBF 1, CBF 2 and CBF 3.......110 5-2 PCR components and concentrations used for probe labeling...............................112 5-3 Primer sequences for selective amp lification of CBF 1 and CBF 3.template DNA.......................................................................................................................113 5-4 Cycle conditions for selective amplif ication of CBF 1 and CBF 3 template DNA.......................................................................................................................113 5-5 Total number of shoots, plantlets and pl antlet conversion in cultures transformed with CBF 1, CBF 2 and CBF 3 constructs.............................................................122

PAGE 12

xii LIST OF FIGURES Figure page 3-1 Amplification products of genomic DNA of C.papaya and V.cundinamarcensis using different primers pairs....................................................................................61 3-2 Amplification products using degenerate nested primers........................................62 3-3 Optimum Mg concentration for maximu m amplification of PCR products using primer P1 and genomic DNA of Vasconcella cundinamarcensis ............................63 3.4 Sequencing of the different DNA frag ments obtained by PCR amplification.........64 4-1 Changes in weights of embr yogenic cultures after 12 weeks..................................80 4-2 Induction of embryogenic cultures in A . ‘Sunrise Solo’ (hypocotyl), B .‘Red Lady’ (hypocotyl) and C .‘Red Lady’ (immature zygotic embryos). Proliferating PEMs in D . ‘Sunrise Solo’ (hypocotyl) and E . ‘Red Lady’ (hypocotyl) F . Somatic embryos in ‘Red Lady’ (zygotic embryo)..............................................80 4-3 Changes in packed cell volume (PCV) of PEMs in suspension cultures after 12 weeks........................................................................................................................81 4-4 Germinating somatic embryos (A, B) and plantlet (C)............................................81 4-5 Changes in fresh weight of embr yogenic cell masses after 90 days following cryopreservation.......................................................................................................82 4-6 Actively growing PEMs in different tr eatments 60 days after cryopreservation.....83 4-7 Changes in fresh weights of PE Ms in different treatments following cryopreservation.......................................................................................................84 4.8 Proliferation of PEMs in vitrification treatment (A, B, D) and frozen control (C, E) following cryopreservation............................................................................85 4-9 Different stages of morphologically normal (A) and abnormal (B) somatic embryos....................................................................................................................85 4-10 Germinating somatic embryos (A) an d plantlet development (B) following cryopreservation.......................................................................................................87

PAGE 13

xiii 4-11 Germination percentages of somatic em bryos in different treatments following cryopreservation.......................................................................................................88 4-12 Germination of somatic embryos (B and C) following encapsulation (A)..............89 5-1 Restriction map of pGA 643 harboring CBF 1, CBF 2 and CBF 3 together with the npt II gene.........................................................................................................102 5-2 Restriction map of CBF 1 in pBluescript SK-........................................................112 5-3 A. Restriction enzyme analysis fo r CBF 1 sequence using Gene Tools B. Restriction enzyme analysis for CBF 3 sequence using Gene Tools.....................113 5-4 Agarose gel electrophoresis analysis of plasmid pGA 643 harboring the sequences CBF 1, CBF 2 and CBF 3.....................................................................119 5-5 Isolation of plasmid pGA 643 harbor ing CBF sequences as a positive control before use for co-cultivation..................................................................................120 5-6 Growth (A) and development (B) of embryogenic cultures on selection medium following co-cultivation with Agrobacterium harboring CBF 1, 2 and 3 constructs. Germination of somatic embryos (C) on germination medium containing 150mgL-1 kanamycin sulfate................................................................121 5-7 Developing shoot (A) and rooted plantle t (B) in MS basal medium containing 50 mg L-1 kanamycin sulfate..................................................................................122 5-8 Restriction enzyme digestion of pB luescript SKharboring CBF inserts.............123 5-9 Analysis of labeled probe using agarose gel electrophoresis.................................124 5-10 Analysis of digested genomic DNA from CBF 1 and CBF 3 transformed tissue using restriction enzymes Sau 3AI, Eco RI and Bam HI.......................................125 5-11 Checking transfer efficiency of DNA from gel to nylon membrane (B) following digestion of genomic DNA with re striction enzyme Sau 3AI (A).........................126 5-12 Analysis of the probed DNA on the nylon membrane after exposure to Xray film.........................................................................................................................12 7 B-1 Changes in fresh weights of embryog enic cultures at 30, 60, 90 and 120 days on varying levels of kanamycin sulfate..................................................................140

PAGE 14

xiv Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR INVESTIGATIONS, CRY OPRESERVATION AND GENETIC TRANSFORMATION STUDIES IN PAPAYA ( Carica papaya L.) FOR COLD HARDINESS By Sadanand A. Dhekney August, 2004 Chair: Richard E. Litz Major Department: Horticultural Sciences Papaya is one of the major fruit crops of the tropical regions of the world. The cold sensitivity of this crop has limited its cultivat ion to tropical and warm subtropical regions. The Caricaceae family consists of genera w ith stress tolerance traits which can be potentially transferred to papaya using a combination of biotechnology and breeding. Carica and Vasconcella genomes were probed for the presence of cold inducible sequences similar to those found in the Arabidopsis genome using the polymerase chain reaction. These studies i ndicated the presence of possible cold inducible sequences in the Vasconcella genome but which were absent in the Carica genome. A genetic transformation approach was us ed to transfer CBF transgenes into papaya. The CBF (C repeat Binding Factor) ge ne family is known to induce the cold acclimation pathway in Arabidopsis. Embryogenic cultures were transformed using the Agrobacterium tumefaciens mediated protocol. Transfor med cultures harboring CBF: NPT II were selected on maintena nce medium containing 300mg L-1 kanamycin sulfate.

PAGE 15

xv Further selection was accomplished on somatic embryo development medium containing 150 mg L-1 kanamycin sulfate. Plantlets were regenerated and the presence of the transgene was confirmed by Southern blot hybridization. To address the problems of loss of em bryogenic potential and somatic embryo development over time, a cryopreservation pr otocol was develope d. Slow and fast cooling methods in combination with differe nt cryoprotectants and tissue stages were studied to determine the optimum time, cryoprotectants and method of cooling. Proembryonic masses (PEMs) used in combin ation with vitrification and fast cooling resulted in excellent regrowth and regenera tion of plantlets following cryopreservation. These studies should be important for rese arch conducted for stress tolerance of papaya. The cryopreservation prot ocol developed for papaya s hould help in the long term storage and maintenance of germpl asm and experimental material.

PAGE 16

1 CHAPTER 1 INTRODUCTION Papaya is one of the most important tropica l fruit crops. It is consumed as a fresh fruit, while the immature fruits are commonly used in salads and as a cooked vegetable. Papaya fruits are a rich s ource of vitamins (A, B, B2 and C) and minerals, low in sodium, fat and calories, and contain no starch (Sampson, 1980; Seelig, 1970). Papaya is a wholesome fruit and ranks second to mango as a source of the precurs or of vitamin A. (Aykroyd, 1951). The yellow pigment found in th e fruit is not due to carotene but caricaxanthin. The plant is also grown for th e production of papain, a proteolytic enzyme which is present in substantial quantities in th e unripe fruit. Papain improves digestion of proteins, cures ulcers, tenderizes meat and is also used in the manuf acture of beer, and in the pharmaceutical, leather, wool and rayon industries (Seelig, 1970). Papaya is grown on an area of 0.38 milli on ha with an annual production of 6.18 million MT. The area under papaya cultivati on in USA is only 690 ha (FAOSTAT, 2003) with an annual production of 22,000 MT and valued at $15.30 million. The crop is grown in Hawaii and Florida. Papaya ranks ni nth in world production of fruits after Musa (banana and plantain), citrus, grape, appl e, mango, pear, plum and peach (FAOSTAT, 2003). Papaya is the sole member in the genus Carica in the Caricaceae family (Badillo, 1993), which also includes genera of herbaceo us tree-like species. Several genera have interesting characteristics for papaya improvement. Resistance to papaya ring spot virus

PAGE 17

2 (PRSV) has been reported in species like Vasconcella cauliflora, V. cundinamarcensis and V. stipulata and V . X helibornii nm pentagona (babaco). Babaco is a sterile parthenocarpic pistillate clone , which is vegetatively propagated. It probably originated from natural hybridization of V . stipulata and V. helibornii in Ecuador (Horovitz and Jimenez, 1967). The mountain papaya V . cundinamarcensis is native to the Andean region from Venezuela to Chile at altitudes between 1,800 to 3,000 m. It is cultivated on a small scale for its fruits in climates that are too cold for papaya (Cardenas, 1989). Vasconcella stipulata is also reported to have some degree of cold tolerance (Man shardt and Wenslaff, 1989). Papaya requires warm temperatures for its growth and development and is very sensitive to frost. Brief exposure to 0oC is damaging and prolonged cold will kill the plant. Production efficiency is also hinde red by dioecism and monoecism since plants reveal sex only at bloom. Papaya breeding in the past has been focused on development of improved cultivars for yield and resistance to bio tic stresses like PRSV. Improvement through sexual recombination in papaya is usually limite d to the variation with in the gene pool of the species. The ability of Carica and Vasconcella species to exchange genes is restricted by various reproductive barriers that prevent no rmal fertility of the hybrid or its progeny. Several Vasconcella species have useful traits, but hybr idization of thes e species with papaya is possible only by means of embryo culture since endosperm development does not occur (Jimenez and Horovitz, 1958). Hybrid s of papaya and wild species have been difficult to grow due to incompatibility, re productive sterility and low vigor. Early

PAGE 18

3 attempts to intercross papaya with other sp ecies yielded only nonviable seeds; these failures illustrate the reproductive isolation of C. papaya from the other species (Jimenez and Horovitz, 1958; Mekako and Na kasone, 1975; Sawant, 1958). Cold can limit crop productivity in the tropics and subtropics and account for significant crop losses. Different plant species have various threshold levels of stress tolerance. Some species can tolerate stress and complete their life cycle; whereas many cultivated species are highly sensitive to stress and either die or suffer from productivity losses. It has been estimated that two-thirds of the yield potential of major crops is lost due to unfavorable growing conditions. Many plants increase in freezing toleran ce in response to low temperature, a phenomenon known as cold acclimation (Sakai and Larcher, 1987). A complex array of biochemical and physiological changes o ccur with cold acclimation, ranging from alteration of lipid composition to accumulation of sugars (Steponkus et al. , 1993). Consistent with this complexity are the resu lts of genetic analysis indicating that the ability to cold acclimate is a qua ntitative genetic trait (Thomashow et al. , 1990). A central goal in cold acclimation has been to identify genes for cold tolerance. A key approach has been centered on the isola tion and characterization of genes that are induced during cold acclimation (Hughes and Dunn, 1996). Genes involved in adapting plants to growth at low temperature and t hose enhancing freezing tolerance have been cloned and characterized (Thomashow, 1999) . The products of these genes can be classified into two groups: thos e that directly protect from environmental stresses and those that regulate gene expr ession and signal transduction in the stress response pathway (Shinozaki and Yamaguchi-Shinozaki, 1997). The first group includes proteins that likely

PAGE 19

4 function by protecting cells from dehydration, namely enzymes required for the synthesis of various osmoprotectants, late embryogene sis abundant (LEA) proteins, chaperones, and detoxification enzymes (Bray, 1997). The second group of gene products involves transcription factors, protein kinases, and enzymes involved in phosphoinositide metabolism (Shinozaki and Sh inozaki-Yamaguchi, 1997). Breeding for cold hardiness has been carried out traditionally in cereals where wild relatives have been used in breeding programs for introgression of hardy tr aits into the cultivated species. However, such an approach cannot be adapted for trop ical species where the genepool may lack traits for stress tolerance and transfer of such traits across genera would not be feasible. Biotechnology offers some novel approach es for generating variability for crop improvement. It can be specifically applied to perennial fruit species where conventional breeding methods are tedious and require a l ong time to achieve the desired results. The powerful combination of biotechnology with a conventional plant breeding program permits useful traits to be introduced into commercial crops within a short time frame. In vitro techniques, namely somatic embryogenesi s and somaclonal variation, are useful tools for genetic manipulation of crop species. Genetic transformation can be used to alter existing superior cultivars for one or more specific traits. Stable transformation of crop plants has been achieved through the use of several DNA transfer technologies. These techniques have been used to impart horiz ontal gene transfer and bridge the sexual barriers between species, phyla and kingdoms. Genetic transformation offers plant breeders access to a wide array of novel genes and traits which can be inserted through a single event into high yielding and locally ad apted cultivars. Genes from bacteria, for example, the Bt gene from Bacillus thuringensis , which encodes for an endotoxin, have

PAGE 20

5 been used for transformation of cereals and vegetables for enhan ced pest resistance (Ellar, 2002). Genes from jelly fish (Sheen et al ., 1995) and reef-corals (Wenck et al ., 2003) have been used as reporter genes in genetic transformation systems in plants. Transgenic plants have been generated expressing the antige ns for HIV1 virus and rabies (Yusibov et al ., 1997). Different gene transfer ap proaches have been employed to improve stress tolerance of plants (Holmburg, 1996). Tran sferred genes include those encoding enzymes required for the biosynthesi s of various osmoprotectants (Hayashi et al ., 1997) or those encoding enzymes for modifying membrane lipids (Kodoma et al ., 1994), LEA proteins (Xu et al ., 1996), and detoxification enzymes ( Walker and McKersie, 1993).The emphasis in genetic transformation towards imparting stress tolerance has shifted from transforming plants with osmoprotectant genes to transcription factors which activate families of genes responsible for improving stress tolerance (Thomashow, 2001) The discovery of the CBF (C repeat binding factor) family of transcription factors from Arabidopsis thaliana has helped us to understand the control of the expression of low temperature regulat ed genes, which contribute to increased freezing tolerance (Thomashow, 2001). These tr anscription factors under the control of stress-inducible promoters re sult in enhanced freezing to lerance while causing minimal obvious effects on plant growth (Kasuga et al ., 1999). Similarly, plant genes of economic importan ce, for example, genes responsible for ripening, have been cloned and used to genera te transgenic plants with enhanced shelf life in crops like tomato. Genetic transforma tion of papaya has been used to enhance resistance to PRSV (Fitch et al ., 1990) and for ethylene insensitivity (Magdalita et al ., 2002).

PAGE 21

6 In vitro germplasm conservation through cryopr eservation has been applied to various crop species. Cryopreservation has been a reliable method for maintaining genetic stability and long term storage of cell lines, meristems and value added transgenic or other plant material (Kar tha, 1985; Grout, 1990). In additio n, it can be used as a tool for selection of hardy cell lines thro ugh selection pressu re applied during cryopreservation (Aguilar et al., 1993). Crop improvement in papaya for abiotic st ress like cold, has not been extensively investigated. Similarly, there have been no reports of in vitro germplasm conservation of this plant species. There have been some pre liminary studies regardi ng the differences in stress tolerance of papaya and the other genera viz. Vasconcella . These studies were undertaken to understand the mech anism of stress tolerance in Carica and Vasconcella spp. and possible approaches for genetic ma nipulation for improvement of the species. The studies undertaken for this dissertation research involved the following objectives: genetic transformation for establishing transg enic lines expressing cold tolerance genes; probing the Carica and Vasconcella genomes for any cold inducible sequences and development of a cryopreservation system for papaya.

PAGE 22

7 CHAPTER 2 LITERATURE REVIEW Papaya Carica papaya L. Uses and Importance Carica papaya L. is the most important species within the family Caricaceae and is widely cultivated for consumption as fresh fr uit and for use in drinks, jams, candies and as a dried and crystallized fr uit (Villegas, 1997). Green fru it and leaves and flowers can also be used as cooked vegetables (Wat son, 1997). Papaya is a good source of calcium and an excellent source of vitamin A (Nakas one and Paull, 1998). The vitamin A and C content of a papaya fruit approaches or exceeds the USDA minimum daily requirement for adults (OCED, 2003). The fruits of some Vasconcella spp. are used as a food source in some regions of Central and South America, but such usage is relatively limited. Direct use of highland papayas ( Vasconcella spp.) is common in the Andes, where fruits are eaten fresh, roasted, in juices, in marmal ades, or in preserves (Van den Eynden et al., 1999). Only babaco, V. X heilbornii ‘Babaco’ is commer cially developed. Papaya has several industrial uses. Biochemi cally, its leaves and fruits are complex, producing several proteins and alkaloids w ith important pharmaceutical and industrial applications (El Moussaoui et al., 2001). Of these, however, papain is a particularly important proteolytic enzyme th at is produced in the milky latex of green, unripe papaya fruits. The latex is harvested by scarifying th e green skin to induce latex flow, which is allowed to dry before collection for processing (Nakasone and Paull, 1998). In terms of evolution, papain may be associated with protection from herbivores and frugivorous

PAGE 23

8 predators (El Moussaoui et al. , 2001). Papain has various indu strial uses in the beverage, food and pharmaceutical industries, includi ng the production of chewing gum, chill proofing beer, tenderizing meat, drug preparations for various digestive aliments and the treatment of gangrenous wounds. Papain has al so been used in the textile industry for degumming silk and softening wool (Villegas, 1997) and in the cosmetic industry, in soaps and shampoo. Since the coll ection of latex is labor intensive, pa pain production is economical only in regions with low labor costs. Table 2-1. Nutritional composition of papa ya fruit per 100 g (Bose and Mitra, 1990) Component Amount(%) Water 89.60 Protein 0.50 Fat 0.10 Carbohydrate 9.50 Calcium 0.01 Phosporous 0.01 Iron 0.40 Vitamin A 2020 IU Vitamin B2 0.04 mg Vitamin C 40 mg Nicotininc Acid 0.2 mg Riboflavin 250 mg Calorific value 40

PAGE 24

9 Taxonomy Papaya, Carica papaya L. (2n=2x=18), is a member of the family Caricaceae, a small dicotyledonous family consisting of five genera of tree-like herbs (Badillo, 1993). Although opinions differ on the origin of C. papaya in tropical America (Garrett, 1995), it is likely that papaya originated in the lowlands of eastern Central America, from Mexico to Panama (Nakasone and Paull, 1998). The seeds were distributed to the Caribbean and Southeast Asia during the 16th century, and to India and Africa (Villegas, 1997). The natural hybrid ‘babaco’ was introdu ced as a crop from Central America to New Zealand in 1973 (Harman, 1983) and in th e eighties to Italy (Cossio, 1989), Spain (Merino Merino, 1989), South Africa (Wiid, 1994), Switzerland (Evequoz et al. , 1990) and Canada (Kempler et al., 1996). Until recently, the Caricaceae was thought to comprise 31 species in three genera viz . Carica , Jacartia and Jarilla from tropical America and one genus Cylicomorpha from equatorial Africa (Nakasone and Paull, 1998). However, a more recent taxonomic revision proposed that some species formerly assigned to Carica were more appropriately classified in the genus Vasconcella (Badillo et al ., 2000). Accordingly , Vasconcella , now comprising 21 species , is the largest genus of the family, followed by Jacartia with seven species. These two genera are predominantly South American in origin, wher eas domesticated papayas appear to have originated from a small fruited ancestor in Central America (Badillo, 1993). The other genera include Jarilla with three species from Mexico and Guatemala, Horovitzia , with only one species native to Mexico and Cylicomorpha with two species. The only species currently assigned to the genus Carica is Carica papaya. The different genera and species belonging to the family Caricaceae are summarized in Table 2.2.

PAGE 25

10 Table 2.2. The Caricaceae family Genus Species number Carica 1 Cylicomorpha 2 Horovizia 1 Jacartia 7 Jarilla 3 Vasconcella 21 Van Damme (2003) Highland or mountain papaya s consist of a group of unde rexploited species of the family Caricaceae originating in the Andean regi on. Compared to the commercially important C. papaya , they tend to have smaller fruit, which are less succulent, and often very pleasant in taste. Badillo (1993) grouped 20 species in the genus Vasconcella and a recently added species (Badillo et al., 2000), resulting in a total of 21 species in this genus. Fifteen of these species are distributed in Ecuador, which can be considered an important region for genetic diversity of th e genus (Badillo, 1983). Southern Ecuador has 9 Vasconcella species (Soria, 1991). The native Vasconcella species found in Southern Ecuador generally grow at an elev ation of 2,000m above m ean sea level. They include V. candicens , V. pubescens (syn V. cundinamarcensis ), V. microcarpa , V. monoica , V. parviflora , V. stipulata , V. weberbaueri , V. X heilbornii , a natural hybrid, and the more recently described endemic V. palandensis . (Badillo et al., 2000). The National Research Council (1989 ) classifies the potential of Vasconcella species at three levels: 1. Direct use of the high quality and tasty fruits.

PAGE 26

11 2. The use of genetic variability as a raw material for the creation of new Caricaceae fruits. 3. The use of these species in breeding pr ograms of papaya crop improvement in order to extend the cultiv ation range, by using gene tic endowment of cold adaptability, and improve papaya producti on by using resistance genes for ring spot virus from highland papayas. Breeding advances Broadly speaking, there are tw o distinct types of papa ya plants: dioecious and gynodioecious. Dioecious papayas have male and female flowers on separate trees. Gynodioecious papayas bear female and bisexua l flowers. Papaya flowers are borne in inflorescences, which appear in the axils of the leaves. Female flowers are held closely against the stem as single flowers in clusters of 2 to 3 (Chay-Prove et al., 2000). Male flowers are smaller in size and more numerous and are borne on 60-90 cm long pendulous inflorescences (Nakasone and Paull, 1998). Bisexual flower s are intermediate between the two unisexual forms (Nakasone and Paull, 1998). The functional gender of flowers can be reversed depe nding on environmental conditio ns, particularly temperature (OECD, 2003). Breeding methods for papaya improvement are usually the same as for perennial fruit tree species except that the re latively short juvenile period of 3 to 6 months and generation time of about 1 year make multiple generation breeding schemes feasible. All conventional breeding methods us eful in breeding self pollinating species are applicable to hermaphrodi te papaya lines. Population improvement for traits with high heritability is also practical in bo th dioecious and gynodioecious populations through recurrent selection a nd intercrossing of plants wi th desirable phenotypes.

PAGE 27

12 Table 2-3. Different Vasconcella species with their origin, distribution and uses Species Sub species Status Common Name Origin Uses V. candicans (A. Gray) A.D C. Wild Sp: chungay, toronche chicope; mito, Southern Ecuador to Northern Peru Edible fruit V. cauliflora (Jacq.) A.D C. Wild Sp: tapaculo, papayo de montaa, zonzapote Southern Mexico to northern part of SouthAmerica Edible fruit V. chilensis (Planch. ex A.D C. ) A.D C. Wild Sp: palo gordo, monte gordo Central Chile Fodder V. crassipetala ( V. Badillo) Wild Colombia Edible fruit V. cundinamarcensis (Solms-Laub.) Wild, Cultivated Sp: toronche, chamburo, papaya de tierra fria, siglalon Colombia, Venezuela to Bolivia Edible fruit V. glandulosa Wild Peru, Brazil, Bolivia, Argentina V. goudotiana Triana et Planch. Wild Cultivated Colombia Edible fruit V. horovitziana ( V. Badillo) Wild Sp: papayuela de bejuco, badea del monte Ecuador V. longiflora Wild Colombia V. microcarpa (Jacq.) A.D C. 4 subsp. subsp. baccata subsp. microcarpa subsp. pilifera subsp. Heterophylla Wild Sp: col de monte, sapiro, lechoso de monte, higuillo Po: mamao rana Panama, Venezuela, Colombia, Ecuador, Brazil, Peru, French Guyana Edible fruit

PAGE 28

13 Table 2-3. Continued Species Sub species Status Common Name Origin Uses V. monoica (Desf.) A.D C. Wild Sp: col de monte, peladera, col de montaa, yumbo papaya, brenjena, toronche, chamburo Ecuador, Peru, Bolivia Edible fruit, edible leaves V. omnilingua Wild Sp: col de monte Ecuador V. palandensis Wild Sp: papaillo Southern Ecuador Edible fruit V. parviflora A.DC. Wild Sp: papaya de monte, coral, papayillo, yuca del campo Ecuador, Peru Edible fruit V. pulchra Wild Sp: col de monte Ecuador V. quercifolia (St.Hil.) A.D C. Wild Sp: higuera del monte, sacha higuera, higuern, calasacha, gargatea, orto karalau, mamn del monte Po:mamaosinho Peru, Brazil, Argentina, Bolivia, Paraguay, Uruguay Edible fruit V. sphaerocarpa Wild Sp: papaya de monte, higuillo negro, higuillo, papayo silvestre, papayuela Colombia Edible fruit V. sprucei Wild Ecuador V. stipulata Wild Sp: toronche, siglaln silvestre Ecuador, Peru Edible fruit V. weberbaueri Wild Sp: mausha Ecuador, Peru V. heilbornii Dif. varieties var. fructifragrans var. chrysopetala ‘Babac’ Wild, Cultivated Sp: toronche, chihualcn, babaco, chamburo Ecuador Edible fruit Progeny testing is a cumbersome process ex cept in some cases where the trait can be evaluated in the seedling stage, for example resistance to some diseases.

PAGE 29

14 Frost damage is a serious problem in pa paya cultivation in both subtropical and warm temperate areas; however, cold hardines s of available papaya genetic resources has not been systematically studied. Field observations, nonetheless, suggest that temperatures below -2oC are generally injurious. Foliage sustains greater injury than stems but stem injury is more detrimental than foliar damage (Singh and Sirohi, 1977). Primary cold injury occurring near the ground causes the damaged plant bark to crack open, leading to rupture of conducting tissues through further freezing (Singh and Sirohi, 1977). Singh (1964) noted th at wild species like V. cundinamarcensis and V. quercifolia are relatively cold hardy and may survive oC and -5 oC, respectively. Efforts to incorporate desirable characte rs from the different genera of the Caricaceae family into the cultivated C. papaya have been limited. Early attempts to intercross papaya with other species yielded fruits with non-viable seeds. Endosperm failure occurs in interspecific crosses invol ving papaya, although some embryos can grow and develop (Jimenez and Horovitz, 1958). Crosses between C. papaya and V . cauliflora have been reported most frequently. In most cases the hybrid has low viability and vigor. Sterility has been observed in these cro sses (Horovitz and Jimenez, 1967). Mekako and Nakasone (1975) attempted interspecific hybr idization among six species, including the edible C. papaya . Most cross pollinations failed to set fruits. The crosses that produced fruits had underdeveloped seeds, which were non viable. There have been some reports of fertile hybrids being produced (Khuspe et al., 1980). Carica papaya X V . stipulata hybrids were produced by embryo culture but were found to have low vigor. Similarly C. papaya X V. cundinamarcensis hybrids were vigorous but reproductively sterile (Horovitz and Jimenez, 1967). Moore and Litz (1984) used biochemical markers from C.

PAGE 30

15 papaya and V. cauliflora to identify hybrids obtained by crossing C. papaya and V. cauliflora . Isozyme markers were used to determin e the nature of plants derived from somatic embryos derived from papaya ovules cultured on modified Murashige and Skoog (1962) (MS) medium 65 days after controlled pollination between the two species. They observed a unique band in the plants derive d from somatic embryos, which was not found in either parent in addition to the bands found in both parents indicating that these somatic embryos may be hybrids. In anothe r study of interspecific hybridization of C . papaya with other Vasconecella species, Manshardt and Wenslaff (1989) observed that the major barriers to interspecific gene fl ow were post zygotic and included ovule and embryo abortion, as well as a lack of e ndosperm development. Crosses between C. papaya as the male parent and V. monoica , V. parviflora , V. stipulata and V. cundinamarcensis failed except for V. cundinamarcensis, which succeeded only after young ovules were cultured 30 to 45 days afte r pollination. In all the crosses, fruits abscised prematurely because ovules failed to develop. Some fruits that persisted for 90 days contained no ovules or only empty ovules at the time fruits were harvested. The development of interspecific hybr ids was also attempted by Drew et al. (1998). Crosses were attempted between C. papaya and V . cauliflora , V. quercifolia , and V. cundinamarcensis . Immature embryos from the cro sses were rescued and germinated in vitro . Germinated embryos formed embryogeni c cultures on hormone-free semi solid medium and multiple hybrid plants were pr oduced. Hybrids genera lly lacked vigor and were sterile. The genetic relationship am ong papaya cultivars and C. papaya with its wild relatives has been studied with molecular markers. Stiles et al. (1993) used Random

PAGE 31

16 Amplified Polymorphic DNA (RAPD) to analyz e the relationship among ten cultivars of C. papaya . Out of the ten cultivars, seven were found to be of Hawaiian type while 3 were of the non Hawaiian type. Genetic simila rities among the 10 cultivars indicated that the domesticated papaya germplasm base is quite narrow. The genetic relationship between C. papaya and Vasconcella species was studied using RAPD and isozyme markers (Jobin Dcor et al., 1997). Carica papaya was demonstrated to be the only distinctly related species to Vasconcella and revealed the clos e genetic relatedness among the Central and South American species. Thes e findings were supported by an analysis of chloroplast DNA diversity in C. papaya and 11 Vasconcella species. (Aradhya et al. , 1999). The analysis showed two basic evolutionary lineages: Carica and Vasconcella , one defined by cultivated C. papaya and another consisting of the remaining wild species from South America. This evolutionary split in Carica and Vasconcella strongly suggests that papaya diverged from the other species early in the evolution of the genus and occurred in isolation, probably in Central Am erica. Molecular and cytological analysis of interspecific hybrids between C. papaya and V. cauliflora using Amplified Fragment Linked Polymorphisms (AFLP) markers (Kim and Moore , 2002), showed that genetic diversity among C. papaya cultivars was very low, indi cating smaller gene pools, while diversity among C. papaya and Vasconcella spp. was high, supporting the notion that C. papaya diverged from the other species early in the evolution of the genus. Magdalita et al, (1996) showed that there was a high le vel of polymorphism between hybrids and parents. Cytological analyses revealed th at 7-48% of the cells in many interspecific hybrids were aneupolid, suggesting that chro mosome elimination was occurring. Pollen fertility of hybrids ranged from 0.5 to 14% as compared to 88 to 99% in C. papaya and

PAGE 32

17 90 to 97% in V. cauliflora . AFLP has been used to asse ss the genetic relationship among papaya and its wild relatives from Ecuador and supports the recent rehabilitation of the Vasconcella group as a genus (Van Droogenbroeck et al., 2002); until recently, Vasconcella was considered as a s ection within the genus Carica , but was later classified as a separate genus in the family Caricaceae (Badillo et al ., 2000). Cluster analysis clearly separated the species of the Carica , Jacartia and Vasconcella genera and illustrated the large genetic distance between C. papaya and Vasconcella (Van Droogenbroeck et al., 2002). Thus, the major reproductive barriers could be attributed to the genetic diversity and least genetic similarities between C. papaya and the other genera. Somatic Cell Genetics and Genetic Transformation Studies The efficient de novo regeneration of plants from cell and tissue culture is recognized as a prerequisite for the application of many modern gene tic approaches to crop improvement. Most practical plant transf ormation protocols depend on tissue culture procedures to regenerate complete transgen ic plants from single cells that have incorporated foreign genes. The totipote ncy of plant cells underlies most plant transformation systems (Hansen and Wright , 1999). Plants are regenerated from cell culture via two methods, somatic embryogene sis and organogenesis (Christianson, 1987). Both organogenesis and somatic embryogenesi s take place through dedifferentiation and redifferentiation events. These events depend on the renewal of meristematic activity in mature differentiated cells or in an unorganized callus (Ziv, 1999). Somatic Embryogenesis Somatic embryogenesis is the process by wh ich somatic cells differentiate into somatic embryos. In contrast to zygotic em bryos that arise as a result of the fusion

PAGE 33

18 between the male and female gamete, somatic embryos can arise from cells of any tissue (Litz and Gray, 1992). Embryogene sis can involve isolated so matic or gametic cells (de Vries et al., 1988), either naturally, for example in Kalanchoe , in which somatic embryos form spontaneously on the edges of the leaves or in vitro after experimental induction. Proliferating embryogenic cultu res in liquid culture or on solid medium are suitable targets for transformation because the origin of proliferating embryogenic tissue is at or near the surface of proembryonic masses (P EMs) and thus readily accessible to DNA delivery. Embryogenic cultures are in general ve ry prolific and allow recovery of many transformants that are non chimeric because of the assumed single cell origin of somatic embryos (Maheshwari et al., 1995). Somatic embryogenesi s protocols have been standardized for a number of fruit and nut crop species (Litz and Gray, 1992). The process of somatic embryogenesis has been di vided into four stages to describe the induction and development of somatic embr yos: 1) induction; 2) maintenance; 3) development and maturation; and 4) germination and plantlet recovery. 1. Induction Somatic embryogenesis has been studie d most frequently with carrot ( Daucus carota L.) (Komamine et al., 1990) and alfalfa (Dudits et al., 1991). De Jong et al . (1993) provided a unified description of the terms em ployed to describe the process of somatic embryogenesis. Embryogenic cells have been described as cells that have achieved the transition from somatic cell to a stage where no further external stimuli are required to produce a somatic embryo (Komamine et al ., 1990). In carrot, em bryogenic cultures are induced from explants on medium with a high auxin concentration; somatic embryo development is initiated by tran sferring the cells to an auxi n-free medium. Cells able to undergo embryo development from PEMs are densely cytoplasmic, and small cells

PAGE 34

19 (Halperin, 1966). In many embryogenic cultures, the percentage of cells that are actually embryogenic is rather low, typically 1-2% (De Vries et al., 1988). Cell polarity and asymmetric cell division are involved in th e induction of somatic embryogenesis (Dudits et al., 1991). In carrot, th e asymmetric division of auxininduced cells produces small daughter cells from which soma tic embryos arise (Komamine et al., 1990). The cell tracking system developed by Toonen et al, (1994) has provided a means for identifying single cells, which develop into somatic embr yos and for following the fate of individual cells. Apart from auxins, which are known to mediate the transition from somatic to embryogenic cells, other agents including cy tokinins (Maheswaran and Williams, 1985), pH shift (Smith and Krikorian, 1990) or an application of electric field (Dijak et al ., 1986), are also thought to a ffect cell polarity. Exogenous growth regulators probably modify cell polarity by interferi ng with pH gradients or elec trical fields around the cells (Dijak et al., 1986). Controlled cell expansion and as ymmetric cell division are important mechanisms for induction of embryogenic cells (De Jong et al., 1993). Both are linked with heterogeneous partitioning of cytoplasmi c determinants subsequent to the formation of cell polarity. Heterogeneous partitioning s eems to be ubiquitous for the induction of embryogenesis (De Jong et al., 1993). Two pathways have been described with respect to somatic embryogenesis, Direct somatic embryogenesis In this pathway, embryogenic cultures arise directly from the cells of an explant without the formation of an in termediate callus or cell divisi on for example, the nucellus of monoembryonic Citrus spp. (Rangan et al., 1968), polyembryonic Mangifera indica (Litz et al., 1982) and Malus domestica (Eichholtz et al., 1980) and as secondary embryo formation from somatic embryos, for example, Carica papaya (Litz and Conover, 1983)

PAGE 35

20 and Vitis spp. (Kurl and Worley, 1977). This mode of somatic embryogenesis is generally observed where the explant tissue is a re productive related tissu e (Krikorian, 1996). The stimulus for cell division from auxin or coc onut water in the medium may be sufficient to induce somatic embryogenesis on a tissue explant, although this pattern of morphogenesis does not require the presence of a growth regulator in the medium. Sharp et al. (1980) has described direct somatic em bryogenesis as involving the presence of pre-embryogenic determined cells (PEDC) in the explant. Embryogenic competent cells may be present in the expl ant tissue but are suppressed in vivo ; explanting these tissues on suitable growth medium removes this inhibi tion and permits the cells to express their embryogenic potential (Tisse rat and Murashige, 1977) Indirect Somatic Embryogenesis In this pathway the non-embryogenic cells must undergo one or more mitotic divisions in the presence of an induction agent, generally an auxin (Ammirato 1987; Christianson, 1985; 1987). Competent, single but quiescent differentiated cells in an explant re-enter the cell division cycle a nd produce undifferentiated callus. Cells that have embryogenic potential and competence to respond to auxin arise leading to formation of PEMs (Krikorian, 1995). PEMs ar e modified globular embryos that cannot develop as somatic embryos due to the inhib itory effect of the presence of auxin. This pattern of somatic embryogenesis is strongl y dependent on the presence of a growth regulator in the medium. Indirect somatic embryogenesis indicates that a callus phase intervenes between the original explant and appearance of somatic embryos. Sharp et al. (1980) described indirect somatic embr yogenesis as following the induction of embryogenically induced determined cells (IEDC). This pattern of somatic

PAGE 36

21 embryogenesis occurs in Coffea arabica (Sondhal and Sharp, 1977), Euphoria longan (Litz, 1988) and Vitis spp. (Kurl and Worley, 1977). 2. Maintenance of embryogenic cultures Embryogenic cultures are subcultured as proembryonic masses (PEMs) on semi solid or in liquid medium in the presence of an auxin (Litz and Gray, 1992). Proliferation of PEMs has been referred to as seconda ry, repetitive or recurrent embryogenesis (Merkle et al., 1995) and involves continuous cycl es of embryogenesis from PEMs resulting from a loss of integrated cont rol (Williams and Maheshwaran, 1986). Auxin stimulates proliferation of PEMs, while i nhibiting somatic embryo development. A high auxin concentration leads to secondary soma tic embryogenesis while low levels arrest growth of somatic embryos (Merkle et al., 1995). Auxin is known to disrupt polarized cell division that is requir ed for integrated development of PEMs to somatic embyos (Kawahara and Komanine, 1995), and is often critical for maintenance of embryogenic cultures (Litz and Gray, 1992). In some cultures, PEMs can be maintained indefinitely on growth regulator-free medium after a defined period of exposure to auxin, for example, citrus (Button et al., 1974). Both pH and nitrogen concen tration are important factors in maintaining repetitive embryogenesis (Merkle et al., 1995). A low pH favors proliferation of PEMs, while a high pH favor s proliferation and development of somatic embryos (Smith and Krikorian, 1990). Chri stianson (1985) found that the change in nitrogen source from ammonium to nitrate is essential in soybean for permissive induction. Amino acid supplements, namely, glutamine in Carica spp. (Litz and Conover, 1982) and Mangifera indica (DeWald et al., 1989) can supplement existing inorganic N, thereby influencing morphogenesis.

PAGE 37

22 3. Somatic embryo development Somatic embryos develop through stages si milar to zygotic embryos, except that they do not become dormant (Dodeman et al., 1997). The somatic embryo pathway includes the globular, heart, torpedo and co tyledonary stages fo r dicotyledonous plant species and the globular, cole optyle and scutellar stages in monocotyledonous species (Gray, 1995). Each proembryo can develop into a complete somatic embryo following subculture onto auxin free medium; however multiple somatic embryos can develop from time to time (Litz and Gray, 1992). Changes in developmental patterns of somatic embryogenesis, which deviate from normal deve lopment, especially embryos originating from suspension cultures have been observed in many species (Ziv, 1999). Developmental abnormalities such as fascia tions and fusion of two or more somatic embryos can occur when cell division in merist ematic areas occurs prior to differentiation of the shoot apex and cotyledons (Ammi rato, 1987). Other malformations observed include multiple shoots on a single root system or accessory embryos (Ammirato, 1974; 1985). Unlike zygotic embryos, which enter a state of dormancy after maturation, somatic embryos continue to develop and form plantlets with elongated roots, and malformed cotyledons and l eaves (Ammirato, 1985; Nadel et al., 1989). The addition of abscisic acid (ABA) to ca rrot, caraway (Ammirato, 1985), cucumber (Ziv and Gadasi, 1985) and mango (Monsalud et al., 1995) embryogenic cultu res prevents abnormal embryo development and reduces hyperhydricity. ABA triggers a process leading to the expression of desiccation tolerance (Senaratna et al., 1990). The synthesis and deposition of storage and Late Embryogenesis Abundunt ( LEA) proteins require the application of stress or exogenous ABA (Dodeman, 1995). P hysical treatments, including cold, heat,

PAGE 38

23 osmotic or nutrient stress, can elicit a similar response, presumably because they stimulate the endogenous synthesis of ABA (McKersie et al., 1990). Somatic embryos accumulate storage protei ns, albeit at approximately 50% of the amount found in zygotic embryos and this is facilitated by an organic nitrogen source, glutamine, and an inorganic sulfur source, potassium sulfate (Lai and McKersie, 1993). The proportion of the storage reserves in the embryo that accumulates as starch or as protein is regulated by the carbon:nitrogen ratio in the medium (Lai and McKersie, 1994a). Sucrose at concentrations of 1-6% is generally used for somatic embryo development. Increasing medium osmolarity has some beneficial effects on somatic embryo maturation (Lee and Thomas, 1985). Leve ls of high osmolarity mimic changes in osmolarity that may occur in the environm ent surrounding the zygotic embryo in a seed (Merkle et al., 1995). Mature somatic embryos acquire the ability to tolerate some degree of moisture loss either by partial drying or slow drying using a series of chambers with decreasing relative humidities (Atree and Fowler, 1991). Sl ow desiccation has been demonstrated to improve maturation of Hevea brasilensis somatic embryos (Etienne,1991). Dry somatic embryos lack the vigor norm ally associated with seedlings from normal seeds. The reason for this is not obvious, although there are several possibilities. The dry somatic embryos may lack storage pr oteins or some other critical component required after germination. Storage protein leve ls can increase with some improvement in vigor (Lai and McKersie, 1993). Somatic embr yos store starch and sucrose, whereas seeds store a hemicellulose in the cell walls of the endosperm (McCleary and Matheson, 1974; 1976).

PAGE 39

24 4. Plantlet recovery Recovery of plantlets from somatic embr yos is low compared to recovery from zygotic embryos (Gray, 1995). Somatic embr yos do not undergo c ontrolled dessication like their zygotic coun terpart, which leads to precoc ious germination and abnormal development (Gray and Conger, 1985). Studies with dehydration of somatic embryos in orchard grass and grape (Gray, 1987) showed that dehydration of somatic embryos could lead to their normal post germination deve lopment. Other factors influencing the germination and recovery of plantlets incl ude optimized germination medium, use of cytokinins to counteract effects of auxi n and embryo orientation during germination process (Merkle et al., 1995). Cell and Tissue Culture Studies with Papaya Micropropagation Tissue culture studies of papaya were fi rst reported by Yie and Liaw (1977). Callus was induced from stem sections of papaya seedlings on semi solid medium containing 5.37M naphthelene acetic acid (NAA) a nd 0.46M kinetin. The callus regenerated shoots and/or somatic embryo when transfer red to a medium of lower auxin (0.0 to 0.26M indole acetic acid) and higher cytoki nin (4.65 to 9.3M ki netin). Similarly, multiple shoots were produced when the exci sed shoot tip explants were cultured on semi solid medium supplemented with 2.85M I AA and either 23.25M kinetin or 2.22 to 4.44M benzyladenine (BA). Rooting was obtained in medium containing 28.55M IAA. A number of problems have limited th e application of micropropagation to commercial production (Drew et al., 1995). These include high levels of endogenous bacterial contamination in tissue cultures (Litz an d Conover, 1978; Drew, 1988),

PAGE 40

25 difficulty in culturing mature tissue compared to juvenile tissue (Drew and Smith, 1986), loss of viability when shoot cultures are re peatedly subcultured on proliferation medium (Litz and Conover, 1982), failure to achiev e higher rooting percentages (Drew and Miller, 1984) and problems associated w ith acclimatization (Singh and Pandey, 1986). Drew (1988) developed a protocol for su ccessful production of bacterial-free shoot cultures. Tissue from sel ected trees was established in vitro by alternatel y culturing bud explants on a roller drum in solution cu lture containing BA and NAA, and on hormonefree semi solid medium. Apically dominant plantlets were produced when the shoots were rooted in vitro . Selected clones have been maintained in vitro for 10 years when multiplied on a system based on the producti on of microcuttings from axillary buds of nodal segments from apically dominant plan ts (Drew, 1992). A reliable procedure for production of high quality adventitious roots was developed by minimizing exposure to IBA (indole butyric acid) (3 da ys) either by subsequent transfer to hormone free medium or by photo oxidation of exoge nous IBA by riboflavin (Drew et al., 1991). Drew et al. (1993) studied the effects of different suga rs, namely glucose, fructose, sucrose and ribose alone and combined, on the effect of shoot growth in papaya. Fructose (10g L-1), when autoclaved together with other medium components, consistently promoted shoot growth from buds on nodal sections or buds ex cised with a wedge of stem tissue. This enhancement occurred when fructose was used alone or in combination with sucrose. Lai et al . (1998) investigated the effect of aeration on development of multiple buds to multiple shoots. Multiple buds grown in culture flasks without one week aeration followed by two weeks aeration caused a 41% in crease in the number of shoots > 0.5 cm, 42% increase in leaf expansion and a 17% in crease in leaf numbe r in comparison with

PAGE 41

26 unaereated shoots. There were differences in ethylene and oxygen c oncentrations in the flasks, with ethylene level in unaerated fl asks reaching levels of 0.11 ppm two weeks after treatment. Ethylene accumulation was not detected in aerated flasks. The multiple shoots grown for three weeks without aeration showed growth retard ation of leaves and epinasty of petioles. Yu et al. (2000) developed a protocol for e fficient rooting. Root induction in low concentrations of IBA in semi-solid medium followed by root development in vermiculite medium containing half streng th MS medium under aerated conditions resulted in efficient rooting. Rooting percen tage of shoots cultured for two weeks in aerated vermiculite was 94.5% compared to 90% in non aerated vermiculite, 71% in non aerated agar and 62.2% in non aerated agar. Fitch et al. (2003) obtained p hotoautotrophic growth and rooting of papaya shoots in vitro in an attempt to control the endogenous bacterial contamination encountered during cu lture. Papaya plants micropropagated on MS medium containing 3% sucrose, 1M BA, and 1M NAA, became contaminated by slow-growing bacteria. The growth medium wa s modified to exclude sucrose. Growth of shoots was reduced to less than 10% on the autotrophic proliferati on medium, compared to growth in sucrose-containing media. Despite a 30% smaller root mass, canopy and stem growth were normal following root formation. Protoplast culture Protoplasts from papaya leaves have b een produced in large numbers and calluses have been generated at low frequency, but regeneration did not occur (Litz and Conover, 1979). Jordan et al. (1986) attempted protoplast fusi on of two sexually incompatible species viz. V. cundinamarcensis and C. papaya . Fused protoplasts of both species as well as the occurrence of microcolonies were successfully reported. Chen and Chen

PAGE 42

27 (1992) reported regeneration of plants from protoplasts isolated from embryogenic suspension cultures of V . cundinamarcensis X C . papaya . Embryogenic cultures were digested with a mixture Cellulase R-10, Macerozyme R-10, and Driselase in 0.4M mannitol. Plants were regenera ted via somatic embryogenesis. Somatic Embryogenesis Induction Litz and Conover (1980) re ported the induction of em bryogenic cultures from callus derived from peduncles of V. stipulata Badillo. The growth medium consisted of MS medium with 30g L-1 sucrose and 2 M BA. Embryogeni c cultures were also induced from papaya ovules on White’s medium modified with the addition of 60 g L-1sucrose, 400 mg L-1 glutamine, and 20% (v/v) filter-steri lized coconut milk (Litz and Conover, 1982). Compact highly embryogenic calluses were obtained from 10-20% of the cultured ovules after several weeks and were subcu ltured either on the same medium or on medium without coconut milk. Chen et al. (1987) successfully induced embryogenic cultures using roots as explants on a medium contai ning MS inorganic salts, 160 L-1 adenine sulfate, 5.37M NAA, 2.32M kinetin and 2.89M GA3. Embryogenic cultures were induced by Fitch and Manshardt (1990) from immature zygotic embryos obtained from open pollinated and selfed fruits of C. papaya 90-114 days after anthesis. MS medium supplemented with 0.45-113M 2,4-D, 400 mg L-1 glutamine and 65 g L-1 sucrose was used to induce embryogenic culture s and the mode of induction was reported to be direct. In another study hypocotyls from ten day old seedlings were used to induce embryogenic cultures (Fitch, 1993) on medium containing modified MS vitamins, 2.3 to 11M 2-4-D, 400 mg L-1 glutamine and 6% sucrose. In other studies embryogenic

PAGE 43

28 cultures were induced from integuments of immature seeds of papaya (Monmarsen et al., 1995) and axillary buds (Jor dan and Velozo, 1997) of V . cundinamarcensis . Maintenance Litz and Conover (1983) obtained prolif eration of cultures in suspension upon transfer of ovule callu s to liquid medium containing 4.52 9.04M 2,4-D. The proembryos rapidly increased in number a nd yielded suspensions of highly globular somatic embryos. Similarly, Mahon et al . (1996) initiated suspensi on cultures in medium containing 2 M BA, 400 M adenine sulfate and 0.5 M NAA and maintained embryos in 0.5 M BA and 0.05 M NAA in suspension. Papaya embryogenic cultures maintained in liquid induction medium re sulted in significantly higher frequency of somatic embryogenesis and regeneration comp ared to those cultured on semi solid medium (Castillo et al., 1998). Somatic embryo development Litz and Conover (1983) obtained somatic embryo development when embryogenic cultures were transferred to liquid medium without 2,4-D. Somatic embryo maturation was obtained on strength MS medium wit hout 2,4-D by Fitch and Manshardt, (1990). Chen et al. (1987) obtained somatic embryo deve lopment on MS modified medium supplemented with ABA. In an improved prot ocol, slightly older hybrid embryos, 3 to 4 months old, were pre-incubated for 5 days in liquid medium containing 10 M GA3, 0.25 M BA and 0.25 M NAA prior to transfer to growth regulator-free medium (Magdalita et al ., 1996). Germination and plantlet recovery Somatic embryo germination in papaya has been obtained on basal medium containing MS major and minor salts (Fitch ,1993), as well as medium containing growth

PAGE 44

29 regulators ( Litz and Conover, 1982; Fitch and Manshardt, 1990; Ying et al., 1999). Fitch (1993) obtained rooting of s hoot cuttings derived from somatic embryos on medium containing IBA in one to four weeks. Genetic Transformation studies The essential requirements of a gene transfer system are: Availability of a target tissue including cells competent for plant regeneration; A method to introduce DNA into the targeted cells; A procedure to select and regenerate tran sformed plants at a satisfactory frequency (Birch, 1997). Genetic transformation involve s non-sexual transfer of genes and the traits they control from one organism into other. Tr ansformation vastly increases the gene pool available and allows incremental improvement of elite genotypes without necessitating generations of back crossing to recover the original phenot ype. Three main techniques used for genetic transformation are protoplast transformation, biolisti cs or microprojectile bombardment and Agrobacterium -mediated transformation (Hansen and Wright, 1999). Use of GFP as a reporter gene For each transformation method, transient expression experiments are preliminary steps used to identify cond itions that will allow efficien t DNA delivery and are usually performed using a reporter gene. Different re porter genes have been used as efficient markers to aid in the detection of transgene integration in plant tissue. Several reporter genes are used in plants, including -glucuronidase (GUS), luci ferase and genes involved in anthocyanin biosynthesis (Wilmink and Dons, 1993). The gene for green fluorescent protein (GFP) has become an important in vivo reporter in plants (Sheen et al., 1995). When expressed in cells and illuminated with blue light, GFP results in fluorescence,

PAGE 45

30 which can be easily monitore d non destructively (Haseloff et al., 1997). It can therefore be used as a means to visualize the fate of tr ansformed cells over time and rapidly test the influence of various factors through the succes sive steps of the transformation protocol. Niedz et al. (1995) first showed that wild type Aequorea GFP could be visualized in plant cells. Several variants, namely mGFP (Haseloff et al ., 1997), sGFP (Harper et al., 1999), eGFP (Yang et al., 1996), smGFP (Davis and Vierstra, 1998) have been used to improve the efficiency of expression. GFP can partiall y replace antibiotic selection and can be of great use when organogenesis or conversion segments of the transformation procedure are inefficient under antibiotic or herbicid e selection (Stewart, 2001). GFP can increase regeneration frequency. One prerequisite for such a technique is the continual fluorescence of transgenic mate rial throughout development. In soybean, fluorescence is lost for several weeks between transient expr ession and stable transformation (Larkin and Finer, 2000). The GFP selection system has great promise for transformation systems that are inefficient and for recal citrant genotypes (Ghorbel et al., 1999). In conjunction with antibiotic selection, GFP lowers the number of escapes for a number of fo rest species (Tian et al., 1999). So far, GFP has been used suc cessfully as a reporter gene in many crop species, namely, sugarcane (El Moussaoui et al., 1999), Brassica napus (Nehlin et al., 2000), soybean (Larkin and Finer, 2000), grapes (Li et al., 2001) and alfalfa (Belluci et al., 2003). GFP has also been used to improve the efficiency of plastid transformation (Khan and Maliga, 1999). High ex pression levels up to 5% have been reported in potato. Transplastomic plants were produced using G FP-antibiotic resistance marker fusion gene (Khan and Maliga, 1999). This approach enab led visualization of recovered chimeric plants and plastid segregation within plants . GFP expression in plants has been very

PAGE 46

31 useful for monitoring the presen ce and expression of transgen es in the field (Harper and Stewart, 2000). GFP exclusively allows for the monitoring of transgene movement in agronomic and ecological studies (Hudson et al., 2001) and has been valuable in genetic studies as an indica tor of zygosity (Niwa et al., 1999). In this case, non transgenic segregant leaves are red, homozygous leav es are green and hemizygous leaves are intermediate between the two. Genetic Transformation studies in Papaya Introduction of foreign genes into papaya ha s been achieved using biolistics (Fitch et al., 1990) and Agrobacterium tumefaciens -mediated transformation (Yang et al., 1996). Pang and Sanford (1988) reported succe ssful introduction of a chimeric antibiotic resistance gene into papaya using Agrobacterium -mediated transformation. Leaf discs were punched from surface-st erilized leaves a nd petioles were cut into 1 cm long segments. Tissues were inoculated with an Agrobacterium suspension for 5 min, following which they were incubated on medium for two to three da ys. The tissues were then transferred to medium containing kanamycin (300 g ml-1) to select the transformants. Fitch et al. (1990) obtained stably transf ormed papaya from embryogenic cultures via micro proj ectile bombardment. Three types of embryogenic tissues including zygotic embryos, freshly explanted hypocot yl sections and somatic embryos were bombarded with tungsten particles coated w ith a plasmid construct coding for NPTII (neomycin phosphotransferase II) and GUS. Te n putative transgenic isolates produced somatic embryos and five regenerated l eafy shoots six to nine months following bombardment. Tissues of 13 isolates were assayed for NPT II activity and 10 were positive. Three isolates were tested positive for both GUS and NPT II.

PAGE 47

32 Transgenic papaya plants were regenera ted from embryogenic cultures that were co-cultivated with a disarmed C58 strain of A. tumefaciens harboring a binary vector for the PSRV cp gene with NPT II as a marker gene and GUS as a reporter gene (Fitch et al ., 1993). Putatively transformed embryogenic cultures were ob tained by selection on 150 mg L-1 kanamycin sulfate. GUS and NPTII expr ession were detected in leaves of putatively transformed plants. The transformed status of th e plants was analyzed using both polymerase chain reaction (PCR) and sout hern blot hybridizati on of both NPTII and PSRV cp genes. Transgenic plants from Agrobacteriummediated transformation of petioles of in vitro -propagated multiple shoots was reported by Yang et al. (1996). Cross sections of papaya petioles from in vitro propagated multiple shoots were infected with A. tumefaciens LBA 4404 containing the NPTII and GUS genes and co cultured for two days. The putatively transformed cultures were identified by growth on selective medium containing kanamycin and carbenicillin a nd subsequently regenerated via somatic embryogenesis. Efficient transformation was obtained by vortexing of embryogenic suspension cultures with carborundum (Cheng et al., 1996). The embryogenic tissues were vortexed with 600 mesh carborundum in ster ile distilled water for 1 min before co culture with disarmed Agrobacterium containing the binary ve ctor pBGCP. Transformed cells were cultured on kanamycin sulfate-free medium containing carbenicillin for 2 to 3 weeks and then on kanamycin sulfate medium for three to four months. Developed somatic embryos were transferred to me dium containing NAA, BA and kanamycin sulfate and plants were regenerated. Presence of the transgene was detected by PCR and expression was detected by Western blotting. Mahon et al. (1996) reported

PAGE 48

33 transformation of papaya using micro projectile bombardment. Factors such as age of the embryos and various treatments prior to bom bardment increased transient expression by 22 fold. Highest GUS transient expression wa s obtained when somatic embryos three weeks since the last subculture on solid me dium were given a three-day treatment in liquid medium and 2h osmotic treat ment pre and post bombardment. Ying et al. (1999) described a method for effici ent genetic transformation and rapid regeneration of transgenic papaya within six months. Somatic embryos obtained from suspension culture were wounded by vortexing w ith tungsten M-15 in half strength MS medium and co cultivated for three days with A. tumefaciens LBA 4404 harboring the binary vector pBI 121. The infected somatic embryos were transferred to induction medium containing 600 mg L-1 carbenicillin for three weeks and then to selection medium with 300mg L-1 kanamycin sulfate for three week s and another selection medium with 150mg L-1 kanamycin sulfate for six weeks. Kanamycin sulfate-resistant somatic embryos were cultured on maturation medi um for one week and then on regeneration medium for 3-5 weeks. Germinated somatic em bryos were transferred to rooting medium for 2-4 weeks and thereafter acclimatized for one week in the grow th chamber and then in the greenhouse. Forty five resistant lines were produced of which 44 produced roots and 41 regenerated into plants. Transgen e integration was co nfirmed by PCR and Southern hybridization. Magdalita et al. (2002) attempted to recover tran sgenic papaya harboring the ACC synthase gene in the antisense orientati on. Somatic embryos initiated from zygotic embryos were squashed and bombarded with the antisense ACC synthase construct having GUS as a reporter gene. The bombarde d tissues were grown on half strength MS

PAGE 49

34 medium with 150 mg L-1 kanamycin sulfate, then with 300mg L-1 kanamycin sulfate. Somatic embryos surviving kanamycin sel ection were regenerated on de Fossard medium containing 0.25 M each of BA and NAA and 10 M GA3. Thirty two putative transgenic regenerants were planted in the greenhouse of which six independent lines tested positive for the kanamycin resistance gene and three lines tested positive for the antisense ACC synthase gene. McCafferty et al. (2003) developed transgenic papa ya with resistance to insect pests, Stevens leafhopper ( Empoasca spp.) and carmine spider mites ( Tetranychus cinnabarinus ). The Manduca chitinase gene, originally isolated from Manduca sexta larvae, was integrated into the pBI121 bina ry vector containing the GUS gene as a reporter and the NPTII gene as a selectable marker, all under the control of a CaMV 35S promoter. The biolistic gene gun was used to introduce the transgene vector into ‘Kapoho’ papaya. Bombarded embryogenic cu ltures were selected on tissue growth medium containing G418. Integrat ion of the transgenes in su rviving plants was confirmed by molecular analysis. The Manduca chitinase transgene improve d papaya tolerance to carmine spider mites. Genetics of cold tolerance in crop species The concept of optimal growth temperatur es is a fundamental principle in biology. Since living organisms cannot control envir onmental temperatures, they have evolved two major strategies for surviving extreme te mperatures: they either avoid the stress or tolerate it. Sub optimal temperature is one of the primary stresses limiting growth, productivity and distribution of plants (B oyer, 1982). Two types of low temperature stresses are recognized: 1. Chilling stress at temperatures above zero (0-10oC);

PAGE 50

35 2. Freezing stress at subzero temperatures. Chilling sensitivity is common in plants or iginating from tropical and subtropical regions and the injury is a result of destab ilization of cell membranes (Levitt, 1980). Plant species vary widely in their ability to surviv e freezing and it is not clear whether freezing injury of species that tolerate some freezing and species that have no tolerance to freezing occurs in the same way (Ashworth and Pearce, 2002). Plants respond to cold by freezing water extracellularly and tolerating consequent cellular dehydration and associated extrace llular ice masses. Extracellular ice grows mainly by withdrawing the water from cells , thereby dehydrating them. The amount of water withdrawn and the extent of intracellular dehydration in creases as the temperature falls (Mazur, 1969). Cells are killed when thei r tolerance of dehydration is exceeded. This is apparently due to the failure of the st ructure of membranes (Steponkus, 1984). Another strategy involves super coo ling to avoid freezing (Ashwo rth and Pearce, 2002). Factors controlling growth of ice and movement of water are important. After ice is formed extracellularly, it cannot pene trate through the cell walls (Ashworth and Abeles, 1984). On the other hand, ice can form in and rapidl y spread through the vascular system of the plant (Kitura, 1967). Studies indicate that the membranes of cells are the primary sites of freezing injury in plants (Steponkus, 1984). As temperatures drop below 0oC, ice formation is generally initiated in the intercellular spaces due, in part, to extracellular fluids having a higher freezing point than the intracellular fluid. Since the chemical potential of ice is less than that of water at a given temperature, the forma tion of extracellular ice results in a drop in water potential outside the cell. Consequently, there is movement of unfrozen water down

PAGE 51

36 the chemical potential gradient from inside the cell to the intercellular spaces. At -10oC, more than 90% of the osmotically active wate r moves out of the cell. Multiple forms of membrane damage can occur as a conse quence of freeze-induced cellular dehydration, including expansioninduced lysis, lame llar-to-hexagonalII phase transitions, and fracture jump lesions (Steponkus et al., 1993). Many plants show increase d freezing tolerance in response to low temperature, namely, cold acclimation (Sakai and Larcher, 1987). A key function of cold acclimation is to stabilize membranes against freezing injury. Cold acclimation prevents expansioninduced lysis and the formation of hexagonal II phase lipids in rye and other plants (Steponkus et al., 1993). The accumulation of sucrose and other simple sugars that typically occurs with cold acc limation also seems to contri bute to the stabilization of membranes as these molecules can protect membranes against freeze-induced damage in vitro (Strauss and Hauser, 1986). There is increasing evidence that certain novel hydrophilic and LEA polypeptides also partic ipate in the stabilization of membranes against freeze-induced injury. A fundamental goal of cold acc limation research is to iden tify genes with key roles in this response. Considerable research has been directed at determining the molecular basis of this response. These efforts have es tablished that a comple x array of biochemical and physiological changes occur during cold a cclimation, ranging from alteration in lipid composition to accumulation of sugars (Thomashow, 1999). Different approaches have been followed to identify the central components of cold acclimation. For example, isolation and characterization of genes that are induced during cold acclimation (Hughes

PAGE 52

37 and Dunn, 1996), mapping of freeze tolerance genes (Galiba et al., 1995) and identifying mutants impaired in freezing tolerance (Warren et al., 1996). Arabidopsis thaliana has been the model for studying the mechanism of cold acclimation and tolerance of phys iological stress. Most studie s have been concerned with the identification, isolation a nd characterization of cold response and tolerance genes. The identification and characterization of th ese genes have been useful for improving freezing tolerance in plants. Guy et al. (1985) established that ch anges in gene expression occur with cold acclimation. Si nce then, considerable effort has been directed at determining the nature of cold-inducible gene s and establishing whet her they have roles in freezing tolerance. This has resulted in the identification of many genes that are induced during cold acclimation (Thomasho w, 1999). As a first step toward understanding how gene expression is altere d in response to low temperatures in Arabidopsis , Hajela et al. (1990) isolated cDNA clones for COR (cold regulated) genes. RNA was prepared from cold-acclimated se edlings, a cDNA library was constructed and the library was screened for transcripts that increased in response to low temperature (24oC). This resulted in the isolation of cD NA inserts for two COR genes, COR 6.6, COR 15a, COR 47 and COR 78. These cold induced genes are either new sequences or are homologs of LEA proteins. The polypeptid es encoded by these cold regulated novel genes fall into a number of families based on amino acid composition. The COR genes encode for very hydrophilic polypeptides, remain soluble in boiling dilute aqueous buffer and have relatively simple amino acid composition. They minimize the potentially damaging effects of water stress. Constitutive expression of COR 15a in chloroplasts of transformed A. thaliana resulted in greater freezing tole rance of protoplasts isolated from

PAGE 53

38 leaves and from chloroplasts (Artus et al., 1996). Other genes which have been cloned and characterized in this group includ e the cas 15 gene from alfalfa (Monroy et al., 1993), wcs 120 from wheat (Houde et al., 1992) and hva 1 from barley (Hong et al., 1992). The Arabidopsis FAD8 gene (Gibson et al., 1994) encodes a fatty acid desaturase enzyme that may contribute to freezing tolera nce by stabilizing the protein against freeze induced-desaturation. Cold responsive genes encoding molecular chaperones, including a spinach hsp 70 gene (Anderson et al., 1994) and a Brassica napus hsp 90 gene (Krishna et al., 1995), might contribute to fr eezing tolerance by stablilzi ng proteins against freezeinduced denaturation. Cold responsive gene s encoding various si gnal transduction and regulatory proteins have been identified, including a mit ogen activated protein (MAP) kinase (Mizoguchi et al., 1993), a MAP kinase kina se kinase (Mizoguchi et al., 1996), calmodulin related proteins (Polisensky and Braam, 1996) and 14-3-3 proteins (Jarillo et al., 1994). These proteins might contribute to freezing tolerance by controlling the expression of freezing tolerance genes or by regu lating the activity of proteins involved in freezing tolerance. A major achievement in the field of co ld acclimation research has been the discovery of CBF (C repeat Binding Facto r) genes (Thomashow, 1999). Initial studies on cold-regulated gene expression established th at the promoters of certain cold-responsive genes are activated in response to low temperature and dehydration stress. Further analysis with Arabidopsis led to the identificat ion of a DNA regulatory element, the Crepeat (CRT) dehydration responsive element (DRE), which has a conserved core sequence of CCGAC that imparts responsiveness to low temperature and dehydration

PAGE 54

39 (Yamaguchi-Shinozaki and Shinozaki, 1994). Transcrip tional activators that bind to the CRT/DRE have been designated as CBF1, CBF2 and CBF3 (Stockinger et al., 1997) or DREB1b, DREB1c and DREB1a, respectively (Liu et al., 1998) and more recently CBF 4 (Haake et al., 2003).These transcriptional activ ators are cold-regulated (Gilmour et al., 1998). Within 15 min of transfer to low temperature, CBF/ DREB1 transcripts begin to accumulate followed at 1 to 2 hours by accu mulation of transcripts of CRT/DRE regulated genes. Chinnusamy et al. (2003) reported the cloning and characterization of multiple ICEr (Inducer of CBF e xpression) promoter elements of CBF genes. They were described as 125 bp regions that were known to be stimulated by different kinds of stresses including cold, drought, mechanical ag itation and the protein synthesis inhibitor cyclohexamide (Zarka et al., 2003). The sequences ICEr 1 and ICEr2 work in concert to impart robust cold regulated gene expressi on. Genetic transformation experiments have demonstrated the function of the CBF genes as transcriptional activators of freezing tolerance genes. Constitutive ex pression of CBF1 in transgenic Arabidopsis results in the expression of CRT/DRE contro lled COR genes without a te mperature stimulus. Thus, CBF1 appears to be an important regulator in the cold acclimation response, which in turns promotes freezing tolerance (J aglo-Ottosen, 1998). Similarly Kasuga et al. (1999) showed that overexpression of the cDNA en coding DREB1a in transgenic plants activated the expression of many of these stress-toleran ce genes under normal growing conditions and resulted in improved tolera nce of drought, salt loading and freezing. However, use of the constitutive CaMV 35S promoter to drive expression of DREB1a also resulted in severe grow th retardation under normal grow ing conditions. In contrast, expression of DREB1a w ith the stress inducible rd29A promoter resulted in minimal

PAGE 55

40 effects on plant growth, while providing an even greater to lerance of stress conditions than did expression of the gene fr om the CaMV 35S promoter. Hsieh et al. (2002) regenerated transgenic tomato plan ts harboring the CBF 1 gene from A. thaliana. Transgenic expression of CBF 1 in T1 and T2 generations had a grea ter degree of chilling tolerance than that of wild type tomato plan ts. Over expression of CBF 1 led to increased activity of other chilling tolerance genes, namely, the CAT 1 gene which prevents damage from photooxidation. Heterologous CBF 1 expression in tomato plants may induce several oxidative stress responsive genes to protect from chilling stress. Fowler and Thomashow (2002) used microarrays to analyze the Arabidopsis transcriptome response to changes in temperat ure. The transcript levels of ca. 8,000 genes were determined at multiple times after plan ts were transferred from warm to cold temperature and in plants which constitutive ly expressed CBF 1, CBF 2 or CBF 3. A total of 306 genes were identified as being cold responsive, with transcripts for 218 increasing and those for 88 genes showing a decreased expression. Further analysis of these upregulated and down-regulated genes revealed that in addition to gene induction, gene repression is also likely to play an integr al role in cold acclimation. Following the cloning and characterizati on of CBF genes from Arabidopsis , studies to investigate the presence of this gene family in commerci al crop species led to the cloning of these factors from Brassica napus , wheat, rye, tomato, rice (Jaglo-Ottosen et al., 2001), barley (Choi et al., 2002), strawberry and sour cherry (Owens et al., 2001). A comparative analysis of these gene sequences indicated that these sequences might be conserved across different species in the plant kingdom (Jaglo-Ottosen et al., 2001).

PAGE 56

41 Cryopreservation Studies Importance and use of cryopreservation Many economically important plant species have seeds which are termed orthodox, namely, they can be dehydrated to low water content and can be stored at low temperature for extended periods (Roberts, 1973). There are three main categories of plant species for which conservation in seed form is problematic . Some crops such as banana and plantain do not produce seeds a nd must be propagated vegetatively. Species such as potato or sugarcane include both sterile genotypes and ge notypes which produce orthodox seeds; however, these seeds are ge nerally highly heterozygous and are of limited interest for the conservation of partic ular genotypes. These species are therefore maintained as clones. Several fruit and forest tree species, especia lly those of tropical origin, produce recalcitrant seeds, namely, s eeds that cannot be drie d to sufficiently low moisture level to allow their storage at low temperature (Roberts, 1973 ). There is also a large number of species that are intermediate between orthodox and recalcitrant (Ellis et al ., 1990), for which conservation in seed form is still problematic . The traditional ex situ conservation method for these different plant sp ecies is in the form of field collections. Conservation in the field presents major drawbacks, which limits its efficacy and threatens the safety of plant genetic res ources (Withers & Engels, 1990). Biotechnology has led to the production of a new category of germplasm which includes clones obtained from elite genotypes, cell lines with speci al attributes and genetically transformed material (Engelmann, 1991). This new germplas m is often of high added value and very difficult to produce. The development of effi cient techniques to ensure its secure conservation is therefore of paramount importance.

PAGE 57

42 In vitro techniques are of great interest for collection, multiplication and storage of plant germplasm (Engelmann, 1991). Virus-free plants can be obtained through meristem culture in combination with thermotherapy, thus ensuring the produc tion of disease-free stocks and simplifying quarantine procedur es for the international exchange of germplasm. In vitro culture can be used for short and medium term storage of genotypes. There is a less demand for land and manpower and decreases exposure of axenic cultures to crop-borne diseases and pests. Embryogenic cultures are widely used in cellular and mo lecular research. Embryogenic suspension cultures are the best starting material for genetic transformation studies (Cao , 1992). They can lose morphogenic competence with time and accentuate several types of undesirable somaclonal vari ations. Loss of embryogenic competence can occur as early as four mont hs after induction wi th avocado (Witjaks ono and Litz, 1999a). Thus new cultures have to be reinduced, a process which is time consuming. In addition, costs of continued culture are often high a nd loss of material due to contamination, technical or human error is po ssible. In order to ensure a continuous supply of somatic embryos for genetic transformation, long term storage of PEMs of elite material is essential. Cryopreservation is a technique where by cells and tissues are frozen under controlled conditions and stored in liquid nitrogen, and has been a reliable method for maintaining genetic stability and long term storage of cell lines, meristems and value added transgenic or other plant material (Kartha, 1985; Grout, 1990). For long term storage of cultured material, cryopreserv ation is currently the only method. Liquid nitrogen (-196oC) is routinely used for cryogenic stor age, since it is re latively cheap and

PAGE 58

43 safe, requires little maintenance and is wide ly available. At temperatures below -120oC, the rate of chemical or biophysical reactions is too slow to cause biological deterioration (Kartha, 1985). Maintenance at these conditions effectively halts all biological growth and development. The greatest stability of in vitro plant material, with periodic storage measured in decades can be achieved by cr yogenic storage at ultra low temperature. There is a slight risk of ioni zing radiations causing genetic ch anges in materials stored at cryogenic temperatures for long periods (Grout, 1995). Cryopreservation methods The goal of cryopreservation is to maintain a high level of inte grated structure and function compatible with high viability and normal activity upon restoration to physiological temperatures (Grout, 1995). Th e maintenance of viability cannot be the sole criterion for successful cryopreserva tion, as unaltered function at a precise qualitative and quantitative level is nece ssary under many circumstances (Benson, 1990; Benson and Hamill, 1991). Broadly speaking, two methods are used for cryopreservation of plant tissues, namely, slow cooling and rapid cooli ng. The methods employed vary according to the storage period required (Enge lmann, 1991). Slow cooling techniques are based on the classical cryopreservation techniqu es that were devel oped in the 1970’s and 80’s. The function of controlled slow cooling in cryopreservation is to allow cryodehydration to progress wit hout intracellular freezing and removing water from the cells to a point where their contained solutions will not form ice crystals when taken to final cryogen temperature. (Grout, 1995). Th ey comprise a cryoprotective treatment followed by slow freezing which is carried out using a programmable freezing apparatus (Kartha, 1985). They are based on chem ical cryoprotection and freeze-induced dehydration during cooling. The most comm only employed cryoprotectants are DMSO

PAGE 59

44 (dimethylsulfoxide), mannitol, sorbitol, sucrose and PEG (polyethyleneglycol). Cryoprotective substances prin cipally have an osmotic action, but some of them, for example, DMSO, can enter cells and protect cellular integrity dur ing freezing. For most materials, optimal freezing conditions consist of a slow cooling rate (0.5 to 2C min-1) to approximately -40C, followed by rapid im mersion of samples in liquid nitrogen. Classical cryopreservation procedures are mainly used for freezing undifferentiated cultures such as cell suspensions and callu ses (Withers, 1985; Kartha and Engelmann, 1994). Until recently, the use of slow c ooling methods was restricted due to the requirement for a programmable freezer; however, this method can now be accomplished using the “Mr Frosty” container (Simione, 1998). The container provides a simple-to use system designed to achieve a rate of cooling very close to -1oC min-1. After reaching a temperature of -80oC, the tissue can be immersed in to liquid nitrogen for long term storage. After storage, rapid warming is used to prevent regrowth of ice crystals during thawing. Slow cooling has been successfully employed for a large number of cell lines of various species (Withers, 1985; Van Irene et al., 1995). For freezing of differentiated tissues and or gans such as shoot apices, zygotic and somatic embryos, other techniques can be ut ilized (Dereuddre, 1992; Engelmann, 1997). They are based on the removal of most or all freezable water by physical or osmotic dehydration of explants followed by ultra-rapid freezing which results in vitrification of intracellular solutes, namely, the formation of an amorphous glassy structure without occurrence of ice crystals, which are detrimental to cellular and structural integrity. Their main advantages in comparison to classical procedures include si mplicity, since they do not require the use of a programmable freezer, an d their applicability to a wide range of

PAGE 60

45 genotypes. They include vi trification, encapsulationdehydration, encapsulationvitrification, desiccation, a nd droplet-freezing (Engelmann, 1997). Vitrification for cryopreservation of animal cells was first reported by Rall and Fahy (1985). This procedure was based on de hydration at non freezing temperatures by direct exposure to concentrated cryoprotec tants followed by rapid freezing. The rapid cooling rates prevented nucleati on and growth of ice crystals and facilitated vitrification of the surrounding medium as we ll as the cell contents. After storage, rapid warming is used to prevent de vitrifica tion during thawing. V itrification is the phase transition of water from liquid directly into a non crys talline or amorphous phase by an extreme elevation in viscosity (Fahy et al., 1994). The protocol consists of two steps, a loading step by involving a loading so lution and dehydration step usi ng a vitrification solution. Cultures are directly immersed into liquid nitrogen, and after th awing, the cryopreserved cultures are osmoconditioned with a high concentrati on of sucrose. The key to successful vitrification is the effective increase of solutes in the cellular solution, which is achieved by loading and/or removal of water. Excise d meristems, smaller shoot tips, somatic embryos, protoplasts and cell suspensions are well suited to this t echnique (Grout, 1995). Vitrification was first applied for plant cell suspensions in 1989 (Langis et al., 1989). This technique has also been utilized for shoot apices and somatic embryos of around 20 plant species (Sakai, 1993). The advantage of vitrification is that an expensive programmable freezer is not required. Since vitr ification uses ultra rapid cooling rates, tolerance of vitrification is primarily a matter of dehydration tolerance (Reinhoud, 1996). Thus, for cryopreservation of plant cell cu ltures which are sensitive to chilling, the vitrification procedure is generally the method of preference. In gene ral, higher survival

PAGE 61

46 rates have been obtained using vitrificati on compared to the two step freezing method with respect to trop ical species (Reinhoud et.al. 1995; Van Irene et.al. 1995). The encapsulation-dehydration procedure is based on the artificial seed technology. This technique does not require the use of a programmable freezer and slow cooling. The procedure was developed for cryopreservati on of shoot tips (Dereuddre, 1992), but has also been successfully applied to cryopreser vation of plant cell suspensions (Bachiri et al., 1995). The technique has also been used in combination with slow freezing. Explants are encapsulated in alginate beads, pregrown in liquid medium enriched with sucrose for several days, partially desi ccated to a water content around 20% (FW), then frozen rapidly. Survival rates are high and growth recovery of cryopreserved samples is generally rapid and direct, w ithout callus formation. This technique has been developed for apices of various species of temperate origin, for example, a pple, pear, grape and eucalyptus, and of tropical origin, for exampl e, sugarcane and cassava (Dereuddre, 1992; Engelmann, 1997). Other modifications of the above tec hniques have also been adopted for cryopreservation of different crop species. Encapsulationvitrification involves a combination of the above techniques. Explants are encapsulated in alginate beads and treated with vitrif ication solutions before freezing. It ha s been applied to shoot apices of lily and wasabi (Matsumoto et al ., 1995; Sakai and Matsumoto, 1996). This technique is mainly used for freezing zygotic embryos or em bryonic axes extracted from seeds. It has been applied to embryos of a large number of recalcitrant and intermediate seed species (Engelmann et al ., 1995; Dumet et al ., 1997). The droplet freezing technique has been utilized for potato apices. Af ter dissection, apices are precultured with DMSO for a few

PAGE 62

47 hours and frozen rapidly in droplets of cryopr otective medium on aluminium foil. This procedure has been applied successfully to more than 150 varie ties with an average recovery rate of 40% (Schf er-Menuhr, 1996). A list of differe nt tropical plant species that have been cryopreserved successfully us ing different methods is presented in Table 2-3. Thawing Rapid thawing at 37-40oC improves the survival of cryopreserved plant tissues (Bajaj, 1995). If thawing is too slow, devitrif ication can occur and will decrease survival rates (Grout, 1995). Potentially damaging physical changes can occur with slow warming, which causes water molecules to diffu se from smaller ice crystals to larger ones. This increases the probability of strain in the biological material directly due to the presence of ice (Grout, 1995). Rapid thawi ng prevents this from happening and thereby preserves the integrity of the cells (Enge lmann, 1991); however, slow thawing may be necessary for some plant sp ecies (Withers, 1979; Marin et al., 1990). Rapid thawing of some species like Asparagus (Nishizawa et al., 1993), alfalfa and potato (Sarkar and Naik, 1998), resulted in improve d viability, survival and grow th of cryopreserved tissue. Table 2-4. Cryopreservation of tropical plant species using different cryopreservation methods. Botanical Name Cryoprotectants/ Techniques CoolingThawing References Somatic Embryos Citrus sinensis 10% DMSO Slow Slow Marin and DuranVilla (1998) Citrus sinensis 10% DMSO Slow Fast Marin et al. (1993) Duran-Villa (1995) Elaeis guineensis Preculture, Dehydration Fast Fast Dumet et al . (1993) Camellia japonica Vary vary Janeiro et al . (1996) Manihot esculenta 10% DMSO+ 10% sucrose Fast Fast Stewart et al . (2001)

PAGE 63

48 Table 2-3. Continued Botanical Name Cryoprotectants/ Techniques CoolingThawing References Embryogenic cultures Citrus sinensis PVS2, Vitrification Fast Fast Sakai et al . (1990) Citrus sinensis 5% DMSO+1.2M sucrose Slow Fast Kobayashi et al . (1990) Citrus sinensis 2M glycerol Slow Fast Sakai et al . (1991) C. sinensis, C. aurantium C. aurantifolia, C. limon C. paradisi, C. hybrid 10% DMSO Slow Fast Duran-Villa (1995) Perez et al . (1997) Mangifera indica PVS-2, Vitrification Fast Fast Wu et al . 2003 Persea americana 5% Glycerol+ 5% DMSO, PVS-2 Slow Fast Efendi (2003) Hevea brasiliensis 10% DMSO+1.M sucrose Slow Fast Engelmann and Etienne (1995) Oryza sativa 1M DMSO+ 1M glycerol+ 2M sucrose+0.09M Lproline Slow Fast Jain et al . (1996) Oryza sativa Vitrification Fast Fast Wang et al . (1998) Euphoria longan Vitrification Fast Sudarmonowati (1999) Cell cultures Doritaenopsis sp. Vitrification Fast Fast Tsukazaki et al . (2000) Oryza sativa 5% DMSO+ 10% Dglucose Slow Fast Watanabe et al . (1995;1999) Embryo axes Camellia japonica Vary vary Janeiro et al. (1996) Artocarpus heterophylus Vitrification Fast Fast Thammasiri (1999) Cryoprotectant Slow Normah and Marzalina (1999) Camellia sinensis Desiccation Fast Fast Chaudhury et al . (1991) Citrus madurensiss Vitrification Fast Fast Cho et al. (2001) Poncirus trifoliate Desiccation Fast Fast Chaudhury et al . (1999) Citrus sinensis Encapsulationdehydration; Vitrification Sudarmonowati (1999) Citrus halimii, C. mitis, C. aurantifolia, Desiccation Normah and Marzalina (1999)

PAGE 64

49 Table 2-3 Continued. Botanical Name Cryoprotectants/ Techniques Cooling Thawing References Bacaurea polyneura Desiccation Normah and Marzalina (1999) Nephelium lappaceum Desiccation Normah and Marzalina (1999) Seeds and zygotic embryos Theobroma cacao 10% DMSO+ 0.5M sucrose Slow Slow, Fast Pence (1991) Coffea arabica Desiccation Slow Fast Dussert et al . (2000) Nephelium lappaceum Two-step freezing Sudarmonowati (1999) Litchi chinensis Vitrification Fast Sudarmonowati (1999) Bacaurea polyneura Desiccation Normah and Marzalina (1999) Carica papaya Desiccation Normah and Marzalina (1999) Malnikara zapota Desiccation Normah and Marzalina (1999) Shoot tips and apices Manihot esculenta 10% DMSO+ 1M sorbitol Slow Fast Escobar et al. (1997) Colocasia esculenta Vitrification Fast Fast Takagi et al. (1997) P. trifoliate x C. sinensis Encapsulationdehydration Fast Fast Wang et al. (2002) Poncirus trifoliata Encapsulationdehydration Slow; Fast Slow Gonzales-Arnao (1998) Meristematic clumps Musa Vitrification Fast Fast Helliot et al. (2002) Post-thaw treatments After thawing, suspension cultures are ge nerally placed on filter paper. This enables easy transfer of cells to fresh medium and slow diffusion of the cryoprotectants, and appears to be beneficial for recovery of cells (Withers, 1979). The composition of the regrowth medium can affect recovery af ter cryopreservation. A reduction in auxin concentration (Dussert et al., 1992) and addition of activated charcoal (Schrijnemakers and Van Iren, 1995) in the regrowth medium improves the regrowth of tissue. Benson et al.

PAGE 65

50 (1995) showed that desferrioxamine has a positive effect on the post thaw recovery of rice cells. In pigmented cultures, the use of dim light during recovery can be beneficial for regrowth to avoid photo-oxi dation and free radical formation (Benson and NoronhaDutra, 1988). Viability and regrowth in cryopreserved cultures The fluorescein diacetate (FDA) (Perez et al., 1997) and 2,3,5-triphenyltetrazolium (TTC) vital staining tests (Ishikawa et al ., 1997) have been used to measure the viability of cultures following cryopreservation. Howeve r, the only reliable test for viability is regrowth of cryopreserved tissue on regrow th medium (Duran-Vila, 1995). Regrowth rates can differ according to the initial ti ssue used for cryopreservation and can range from three days (Sakai et al., 1991) to several weeks (Grout, 1995). A lag of several weeks is not uncommon before an obvious in crease in size can be seen in case of cryopreserved callus cult ures (Grout, 1995).

PAGE 66

51 CHAPTER 3 MOLECULAR PROBING OF CARICA PAPAYA AND VASCONCELLA SPP. FOR COLD-INDUCIBLE SEQUENCES Introduction Low temperature is one of the most importa nt environmental factors that limit crop plant growth, distribution and productivity (Sakai and Larcher, 1987). Consequently, considerable efforts have been directed at determining the nature of freezing and drought injury and the protection mechanisms that plan ts have evolved to increase tolerance of these stresses. Plant species differ greatly in their ability to develop freezing tolerance through a process known as cold acclimati on (Thomashow, 1999). Traditional breeding of many major crops has had only limited su ccess in improving freezing tolerance. As a result, considerable effort has been spent to understand the nature of cold acclimation, in order to develop novel strategies for improving crop freezing tolerance Many physiological and biochemical changes occur in plants in response to low temperature, including changes in gene e xpression (Alberdi and Corecuera, 1991). Many cold-induced genes have been identified in several crop species, namely, alfalfa ( Medicago sativa ), spinach ( Spinacia olerecea ), barley ( Hordeum vulgare ) and peach ( Prunus persica ) (Guy et al., 1985; Hong et al., 1992; Monroy et al., 1993; Wisniewski et al., 1999). In Arabidopsis thaliana , studies on the molecular ba sis of cold acclimation have identified a common cis acting regulatory element, the C repeat/Dehydration responsive element that has the conserve d core sequence CCGAC. This element is present in one to multiple copies in the pr omoters of many cold-induced genes, including

PAGE 67

52 COR 6.6, COR 15a, COR 47 and COR 78 of A. thaliana and BN 115 of Brassica napus (Baker et al., 1994; 1996; Stockinger et al., 1997; Yamaguchi-Shinozaki and Shinozaki, 1994). All of the currently characterized COR genes from A. thaliana are coordinately upregulated by CBF 1, CBF 2 or CBF 3, a family of cold and drought-inducible transcriptional activators that bind to prom oters containing a CRT/DRE element (JagloOttosen et al., 1998; Kasuga et al., 1999; Liu et al., 1998; Thomashow, 2001). Even though freezing tolerance is a complexly inheri ted trait, manipulation of a single gene (CBF1) has been shown to improve whole plant freezing tolerance of Arabidopisis (Jaglo-Ottosen et al., 1998). Since CBF genes are key regu lators of cold acclimation and over expression of CBF 1,2 or 3 can improve the freezing tolerance of Arabidopsis , there is a significant interest in determining if orthologs of CBF gene family exist in other cultivated species and functi on in a similar way in response to low temperatures. Papaya ( Carica papaya L.) is a member of the Caricaceae, a small dicotyledonous family consisting of six genera of herbace ous, shrubby or arborescent plants (Badillo, 1971; 1993). It is the only sp ecies belonging to the genus Carica (Badillo et al. , 2000). Vasconcella , comprising 21 species, is the largest genus of the family. The Vasconcella genus, also commonly known as highland or mountain papayas, is found in the subtropical Andean mountain climate at 1,5003,000m above sea level (Jordan and Velezo, 1997). The species of this genus grow well at elevations considered too cold for papaya production. Vasconcella spp . are clearly less important than papaya. However, due to the large variability in environmen ts where the species can grow, these fruit species are important in the Andes with a production of 632 MT in 1996 (Soria and Viteri, 1999). Vasconcella spp. are also important for br eeding since the genus has many

PAGE 68

53 economically important characteristics lacking in C. papaya. Some Vasconcella species have resistance to ring spot virus (Mansh ardt and Wenslaff, 1 989), enhanced cold tolerance (National Research Council, 1989) and papain co ntent up to 20 times greater than papaya (Scheldeman et al., 2002). Interspecific hybridization between C. papaya and species in other genera has been unsuccessful using conventional breeding me thods due to incomp atibility, reproductive sterility and low vigor (Mekako and Naka sone, 1975; Horovitz and Jimenez, 1967). Molecular techniques are beginning to contribute to our understanding of the relationships between the Carica and other genera. Allozyme analysis and RAPD polymorphisms have confirmed thei r distant relationships with C. papaya (Jobin Dcor et al., 1997). Chloroplast DNA analysis indicates two basic evolutionary lineages between Carica and the other genera, one defined by cultivated C. papaya and another consisting of the wild species from South America (Aradhya et al., 1999). This explains the reproductive barriers, which are evinced duri ng the interspecific hybridization between Carica and other genera in the Caricaceae. Different techniques in biotechnology ma ke it possible to transfer characters between species and genera which are impossible through conventional breeding techniques. Genetic transformation has been ap plied specifically to perennial fruit crop species where conventional methods are te dious and time consuming and yield limited results. Several genes encoding economically important traits have been cloned and transferred into different species and gene ra (Hansen and Wright, 1999). The sequencing and characterizing of the Arabidopsis genome has provided the basis for cloning and characterization of genes from other economical ly important crop species. Papaya has a

PAGE 69

54 relatively small genome (3.72 X 10-8 bp) and because of its ability to produce ripe fruit 9 to 12 months after planting, it can be a m odel for studying genes that affect fruit characters (Ma et al., 2004). Several genes of economic importance have been cloned from papaya and bear a high degree of homology with thei r counterparts from Arabidopsis (Qiu et al., 2003). Genes related to fruit ripening (Paull and Chen 2003), pathogen defense-related genes (Qiu et al., 2003), and genes related to flower development (Yu et al., 2003) have been clone d and characterized. Transfer of genes from the different gene ra of the Caricaceae to papaya would involve identification an d use of candidate genes that ar e important for different traits. Cold hardiness of the available genetic resources in the Caricaceae has not been systematically studied. Vasconcella cundinamarcensis and V. stipulata possess some mechanism for cold tolerance which is conspicuously absent in C. papaya. A systematic study of the cold acclimation a nd tolerance mechanism of th ese species can enable the comparison of these pathways with th e already elucidated pathways in Arabidopsis and other genera. It would be interesting to inve stigate whether the cultivated papaya also possesses the same genetic elements related to cold acclimation as the Vasconcella spp. The cloning and characterization of any co ld inducible or tolerant genes in Vasconcella spp . would make horizontal gene transfer from this genus to C. papaya more feasible. An attempt was made to probe the Carica and Vasconcella genomes for the presence of any cold-inducible sequences. Materials and Methods Plant Material The plant material used for this study c onsisted of two genera from the family Caricaceae viz . C. papaya and V. cundinamarcensis . Two papaya cultivars ‘Sunrise Solo’

PAGE 70

55 and ‘Maradol’ were used. The seed material was provided by the Agricultural Research Station (ARS), Hawaii of the United States Department of Agriculture (USDA). The seeds were sown in a mixture of peat soil and vermiculite in a greenhouse where the temperature maintained was 25oC. Seedling germination of ‘Sunrise Solo’ and ‘Maradol’ occurred in two weeks and after four weeks for V.cundinamarcensis . Young seedlings with the first two expanded leaves were selected for DNA extraction. DNA Extraction The leaf and stem tissues of seedlings were used for DNA extraction using the cetyltrimethylammonium brom ide (CTAB) method (Clark et al., 1989). Five hundred mg of fresh plant tissue was ground to a fine pow der in a mortar and pestle using liquid nitrogen (LN). The contents were then transf erred to a 3ml microcen trifuge tube to which 1.2 ml of CTAB buffer was added. The buffe r consisted of 3% hexadecyltrimethyl ammonium bromide (CTAB), 1.4M sodium chloride (NaCl), 0.2% mercaptoethanol, 100mM EDTA, 100mM Tris, 2% po lyvinylpyrrolidone (PVP) and 3% polyvinylpolypyrrolidone (PVPP). Th e tubes were incubated at 65oC in a water bath for 30 min with occasional inversion. Followi ng a 30 min incubation, 1.2ml of phenol: chloroform (1:1 v:v) mixture was added to the tubes and was mixed by gentle inversion of the tubes. The tubes were then centrifuged at 12,000 rpm (16,000g) at room temperature for 10 min in an Eppendorf 5417R centrifuge (Brinkmann). The aqueous phase was transferred to new 3ml microcentrif uge tubes using a wide bore pipette tip. An equal volume of chloroform:isoamyl alcohol ( 24:1 v:v) mixture was added to the tubes with gentle swirling. The tubes were th en centrifuged at 12,000 rpm for 10 min. The aqueous phase was then transferred to new microcentrifuge tubes. Two third volume of cold isopropanol was then added to the tubes and mixed gently to precipitate the nucleic

PAGE 71

56 acids. The tubes were centrifuged again at 12,000 rpm for 10 min. The supernatant was discarded and 1.0 ml wash buffer was added to the pellet. The wash buffer consisted of 7.5M ammonium acetate with 76ml of ethanol wi th the final volume made to 100 ml with sterile deionized water. The tube was then centrifuged at 16,000g for 10 min and the supernatant was removed to dry the DNA pellet. The pellet was then resuspended in 20ul water. RNAse Treatment and DNA Purification A volume of 2l DNA was taken for all the three samples and di ssolved in 13l of deionised sterile water and the sample was run on a 0.8% agarose gel at 70V for 1h to determine the purity of the DNA extracted. A ll three samples were treated with an RNAse solution to purify the samples. A volume of 3M sodium acetate equal to 10% of the total DNA volume was added to the micro centrifuge tubes containing the extracted DNA. An equal volume of 95% ethanol (Molecu lar Biology grade, Sigma Chemicals, St Louis, MO) was added to the tubes. This was followed by addition of 4L of RNAse A enzyme to the tubes. The tubes were then centrifuged at 10,000rpm for 15 min. Following centrifugation, the microcentr ifuge tubes were incubated at 4oC for 30 min. The supernatant solution was discarded and th e precipitate was washed with 70% chilled ethanol. The ethanol was carefu lly removed and the pellet wa s allowed to dry. This was followed by another wash of 95% chilled etha nol and the procedure was repeated. After complete evaporation of the ethanol the pell et was resuspended in 50L deionized sterile water. A sample of 2L was dissolved in 13L water and the sample was run on a 0.8% agarose gel at 70V for 1 h to check purity after RNAse treatment.

PAGE 72

57 PCR (Polymerase chain reaction) Primers and Reaction Conditions The different PCR primers used and cycle c onditions for the experiment are listed in Table 3-1 and Table 3-2. Based on the cons ensus sequences of the CBF genes isolated from A. thaliana (Stockinger et al., 1997), Brassica napus, Triticum aestivum , Secale cereale and Lypersicon esculentum (Jaglo-Ottosen et al., 2001), primers were designed using GeneTools Software (Biotools 2002). A se t of degenerate nested primers used to clone the CBF ortholog in Fragaria and Prunus cerasus (Owens et al., 2002) were also used for the reactions. The gene specific and degenerate primers were synthesized (Integrated DNA Technologies, Coralville, IA) and cycle conditions were worked out for each set of primers from the Tm(melting te mperature) and the GC(Guanosine Cytosine) content of the primers. A PCR core kit (Roc he Diagnostics, Germany) was used to make all the master mixes for the different co mponents and run the RCR reactions. The final volume of all reactions was made to 25L with molecular biology (MB) grade water All the reactions were run in an Eppendorf thermal cycler (Sakai et al., 1988).In case of degenerate nested primers, genomic DNA was used as a template for the first set of reactions with degenerate primers. The pr oduct obtained from this PCR amplification (1L) was used as a template for a nested PCR reaction. All the PCR products were stored at 0oC at the end of the reaction cycle. Optimization of Magnesium (Mg) Concentration The Mg concentration was optimized for the forward and reverse primers using variable levels of Mg concentrations in the master mix. The different levels of Mg used were 0.0, 1.0, 1.5, 2.0, 2.5 and 3.0mM. All other parameters in the master mix were constant and PCR reactions were carried out to determine maximum amplification of PCR products. The working conditions for PCR are shown in Table 3-3.

PAGE 73

58 Electrophoretic Analysis of PCR Products A 5L sample from all PCR reactions was made to 15L with MB grade water. The samples were then run on a 0.8% agarose gel at 55V for 1h. If any amplification of products was observed, the entire volume of the PCR product was run on a 0.8% agarose gel at 45V for 3 h to ensure complete separa tion of bands. At the end of the run period, the gel was photographed with a digital camera using a UV transilluminator. Table 3-1. Primers used for PCR amplification and cycle conditions No. Primer sequences P1 (F)5`-CCTTATCCAGTTTCTTGAAACAGAC-3` (R)5`-CGAATATTAGTAACTCCAAAGCGAC-3` P2 (F)5`-CCNAARAARCCNGCNGGNAG-3` (R)5`GGNARNARCATNCCYTCNGCC-3` P3 (F)5`CAYCCNATHTAYMGNGGNGT-3` (R)5`GGNARNARCATNCCYTCNGCC-3` P4 (F)5`GGCCGCCGGGGCGAACCAAGTTCC-3` (R)5`AGGCAGAGTCGGCGAAGTTGAGGC-3` DN* (F)5`-CCNAARAARCCNGCNGGNAG (R)5`TCNGCRAARTTYAARCA-3` Abbreviations: (F)Forward primer (R) Reverse primer DN*= degenerate nested primers Nucleotide bases: A=Adenine, C=Cytosine, G=Guanine, T=Thiamine, N= (AGTC), R= (AG) Y= (CT) K= (GT), M= (AC). Table 3-2. Cycle conditions for different primer sequences No Denaturation time and temp Denaturation Annealing Primer extension Final extension Number of cycles P1 2mins@95oC 1min@94oC 45sec@50.5oC 45 secs@72oC 5mins@72oC 30 P2 5 mins@95oC 1min@94oC 1min@50oC 1min@72oC 5mins@72oC 35 P3 1 min@95oC 45sec@94oC 45secs@50oC 45 secs@72oC 5mins@72oC 30 P4 1 min@95oC 45sec@94oC 45secs@50oC 45 secs@72oC 5mins@72oC 30 DN 5 mins@95oC 1min@94oC 1min@50oC 1min@72oC 5mins@72oC 35

PAGE 74

59 Table 3-3. Working conditions for op timization of Mg concentration. Component Stock conc. Final conc . Reaction volume PCR buffer 100mM 10mM 5uL dNTP’s 10mM 0.1mM 0.5uL Primer 1 20uM 0.5uM 1.25uL Primer 2 20uM 0.5uM 1.25uL MgCl2 25uM Variable Taq DNApolymerase 5units per uL 2 units per uL 0.5uL Genomic DNA 100ng 2uL PCR grade water Variable Total Volume 50uL Purification of DNA Fragm ents from Agarose Gel PCR products of interest were excised fr om the gel using a sharp scalpel under UV light. The excised gel bands we re transferred to a microcen trifuge tube and weighed. The DNA fragments were then purified from th e gel using a DNA purification quick kit (Roche Diagnostics, Germany). Binding buffer (500L) was added to 100 L PCR reaction and the mixture was transferred to a High Pure Filter microcentrifuge tube fitted with a filter. The tube was then centrifuged at 12,000 rpm in a microcentrifuge for 1 min. The flow through solution was discarded and 500L wash buffer was a dded to the tube a nd centrifuged at 12,000 rpm for 1 min. The flow through solution was again discarded and was followed by second wash with 200L wash buffer. The filter tube was then washed with 100L elution buffer and centrifuged at 12,000rpm for 1min. The eluate containing the purified

PAGE 75

60 DNA was collected in a 1.5 ml microcentrifuge tube. A 5L sample was removed from each reaction and the final volume was made to 15L. The samples were then run on a 0.8% agarose gel to check DNA purity and c oncentration. Following electrophoresis, the gel was photographed in a UV transilluminator. Sequencing of Amplified PCR Products The purified products were made into an aliquot of 50L. The products were then transferred to 200L PCR tubes and sent fo r sequencing (DNA sequencing core unit at University of Florida, Gainesville). Database Search for Homology of Sequences The sequences of the amplified PCR produc ts were used to perform a homology search with sequences in the NCBI database. The BLAST program (Altschule et al., 1997) was used for the homology search with the sequences in the database. BLAST-N was used to perform a nucleotide seque nce search while BLAST-X was used to determine if the putative translated am ino acid sequence had any homology in the database. Results Two cultivars of C. papaya , ‘Sunrise Solo’ and ‘Maradol’, and V. cundinamarcensis were used for studying the presence of any cold inducible homologs of the CBF transcription factors in A. thaliana . PCR amplification products The results of PCR amplification product are shown in Figure 3-1. Amplification products were obtained from primer pairs P1, P2, P3 and P4 when genomic DNA of V. cundinamarcensis was used as the template DNA. However, no amplification product

PAGE 76

61 could be obtained with any of the primer pairs when genomic DNA from C. papaya ‘Sunrise Solo’ and ‘Maradol’ was used as a template. Figure 3-1. Amplification pr oducts of genomic DNA of C.papaya and V.cundinamarcensis using different primers pairs M0.5 kb DNA marker 7. 200 bp DNA marker 1. C papaya (Sunrise Solo) Primer P1 8. C papaya (Sunrise Solo) Primer P3 2. V. cundinamarcensis Primer P1 9. V. cundinamarcensis Primer P3 3. V. cundinamarcensis Primer P1 10. C papaya (Sunrise Solo) Primer P 4 4. C papaya (Sunrise Solo) Primer P2 11. V. cundinamarcensis Primer P4 5. V. cundinamarcensis Primer P2 12. 15. C. papaya Cv Maradol Primers P1 to P4 6. C papaya (Sunrise Solo) Primer P2 16. Negative control A similar result was obtained when the pair s of degenerate nested primers were obtained (Figure 3-2.) Two rounds of amplif ication were conducted in which the PCR product obtained from the first set of reactions with degenerate primers was used as a template DNA with the degenerate nested pr imers used in the second round of reactions. While amplification products were obtained when genomic DNA of V. cundinamarcensis was used, no product was obtained with the C. papaya cultivars.

PAGE 77

62 Figure 3-2. Amplification products us ing degenerate nested primers 1. Lane 1-0.5kb DNA marker 2. Lane 2 V. cundinamarcensis PCR product 3. Lane 3 V. cundinamarcensis PCR product replicate 4. Lane 4 negative control 5. Lane 5 C. papaya Cv. Sunrise Solo 6. Lane 6 C. papaya Cv. Maradol Optimization of Mg Concentration for Maximum Amplification Different Mg levels were used to determine the optimum concentration for maximum amplification of products. The resu lts of different Mg concentrations on amplification products are shown in Figur e 3-3. The optimum Mg concentration was 3.0mM for maximum amplification as compared to the standard concentration of 1.25 to 2.0mM generally used for PCR reactions.

PAGE 78

63 Figure 3-3. Optimum Mg concentration for maximum amplification of PCR products using primer P1 and genomic DNA of Vasconcella cundinamarcensis 1. M 0.5kb DNA marker 4. Lane 42.0 mM MgCl2 2. Lane 10.0mM MgCl2 5. Lane 52.5mM MgCl2 3. Lane 21.0mM MgCl2 6. Lane 63.0mM MgCl2 4. Lane 31.5mM MgCl Sequencing of PCR Products The amplified products, which were excised and purified from the agarose gel were sequenced following the automated sequenci ng method. The products obtained with the different primers are shown in Fig. 3.4. Partial sequence information was available from the amplified fragments with sizes greater than 300bp. The primer P1 yielded a 214 bp sequence with the forward primer and a 218 bp with the reverse primer (Lane 1) . The sequence information for the primer P2 and P3 could not be obtained due to low DNA concentration as indicated in the sequencing results. The degenerate primer s yielded a sequence of 214 bp with the forward primer and 226bp with the reverse pr imer(Lane 3). Primer P4 yielded a sequence

PAGE 79

64 of 201 bp with the forward primer and a seque nce of 299bp with the reverse primer (Lane 6). Figure 3-4. Sequencing of th e different DNA fragments obtained by PCR amplification M0.5 kb DNA marker Lane 4100 bp DNA marker Lane 1Primer P 1 PCR product Lane 5Primer P3 PCR product Lane 2Primer P2 PCR product Lane 6Primer P4 PCR product Lane 3Degenerate nested primer s PCR product Lane 70.5kb DNA marker Database Search for Homology of Sequences A search was made in the database to es tablish homology of sequences cloned with those present in the database using BLAST program (Altschul et al., 1997). The sequences obtained by amplification of ge nomic DNA using primer pairs P1 and the degenerate nested primers showed significant alignment with A. thaliana CRT/DRE binding factors, CBF 1, CBF 2 and CBF 3 (Accession No: AFO 76155). They yielded a bit score of 50 with an E value of 10-3. The sequence also showed a high significant alignment with a portion of the Arabi dopsis chromosomal DNA (E value of 10-21) The sequence information for the primer pair P4 showed a significant alignment with a Carica papaya 18S ribosomal RNA gene (accession No V42514). They yielded a bit score of 398 with an E value of e-108 indicating that homology was significant. A significant alignment of these sequences was also recorded with the 18S ribosomal RNA

PAGE 80

65 genes from different cultivars of Prunus persica and Pyrus pyrifolia . The sequence information has been presented in Appendix A. BLAST-X program was used to translate the cloned sequence and a putative amino acid sequence was obtained. This putative amino acid sequence was used to perform a search using the BLAST-X program. The amino acid sequence was found to show homology with an unknown Arabidopsis protein but could not show homology with any of the currently cloned and named proteins in the database. Discussion Plants vary widely in their responses to temperature. Most species of tropical or subtropical origin are more sensitive to chilling and are damaged by exposure to low temperatures. Papaya requires warm temperature for growth and development and is sensitive to frost. On the other hand the mountain or highland papaya, V. cundinamarcensis , has some degree of cold toleran ce (Cardenas, 1989). Plants of the temperate region have some degree of cold tolerance, which is attributed to two mechanisms, supercooling or freeze tolerance. Differential mechanisms of adaptation to cold tolerance can be attributed to the evolution of a plant sp ecies in a particular region. Molecular investigations of the cold acclimation and tolerance mechanisms of Arabidopsis have resulted in the characterizati on of cold-inducible genes. A major breakthrough in understanding th e mechanisms of cold tole rance was achieved with the isolation of CBF genes in A. thaliana (Stockinger et al., 1997; Gilmour et al., 1998). The overexpression of CBF 1 under th e control of a constitutive pr omoter induced COR gene expression without low temperatur e stimulation (Jaglo-Ottosen et al., 1998). An attempt was made to investigate the mechanism of cold acclimation in V. cundinamarcensis and to study whether papaya, a trop ical species, possesses genomic

PAGE 81

66 elements similar to Arabidopsis . Gene-specific primers as we ll as degenerate and nested primers were synthesized based on homlogous re gions of previously cloned CBF genes. The target DNA was amplified by PCR (Sakai et al., 1988) and amplified products were purified and sequenced. These sequences were tested for homology with other sequences in the database using th e BLAST program (Altschule et al., 1997). The cloned sequences in V. cundinamarcensis showed a significant alignment with the CBF sequences in Arabidopsis . However, these sequences were significantly absent in C. papaya ‘Sunrise Solo’ and ‘Maradol’. The putat ive translated amino acid sequence did not show homology with any of th e currently functiona l proteins in the Arabidopsis database. This analysis information raises the question as to whether the functional protein could have a similar function as the CBF genes in Arabidopsis . This sequence was significantly absent in C. papaya and it is possible that the sequence may have a role in cold acclimation of V. cundinamarcensis . These differences could be attributed to the origin and growing regions of these two genera. While C. papaya is generally considered to have originated and evolved in the lowl ands of Central America from Mexico to Panama (Nakasone and Paull, 1998), the center of origin and diversity for Vasconcella genera is considered to be in the Andean highlands from Colombia to Peru (Badillo et al., 2000). Carica papaya is the only genus within the Cari caceae family originating entirely outside South America (Aradhya et al., 1999). Analysis of nuclear and chloroplastic DNA (cpDNA) of C. payaya and other genera, namely, Vasconcella , also demonstrated that Carica genus is genetically distant from the other genera (Kim et al., 2002; Aradhya et al., 1999). cpDNA analysis showed two basic evolutionary lineages : one defined by the cultivated C. papaya and the other consisting of Vasconcella spp . . This evolutionary

PAGE 82

67 split strongly suggests that C. papaya diverged from the other genera early in evolution and evolved in isolation in Central America. In South America, ecological isolation and adaptive radiation into ecologically extreme ha bitats at the time of Andean uplift appears to have led to diversificati on and differentiation (Aradhya et al., 1999). Plant species found in temperate and subtropi cal regions increase in freez ing tolerance when initially exposed to low non freezing temperatures , a phenomenon known as cold acclimation. This phenomenon is distinctly absent in tr opical plant species (Thomashow, 1999). Thus the cold acclimation mechanism in Vasconcella genus but lacking in C. papaya may be attributed to the evolutio n of the genera in different ecological zones. Cold acclimation of Arabidopsis involves action of the CBF cold response pathway (Thomashow, 2001). The characteristics of this pathway are ra pid induction of CBF genes in response to low temperature fo llowed by expression of CBF regulon which include genes that increase pl ant freezing tolerance. The or thologs of these genes have been cloned in other plan t species, namely, wheat, Brassica napus , rice, rye and tomato (Jaglo-Ottosen et al., 2001). However, an interesting f eature is that the genes activated downstream by these transcription factors are different from those activated in Arabidopsis . For instance, the genes ac tivated by the CBF regulon in Brassica napus are Bn 115 and Bn 28 (Jaglo-Ottosen et al., 2001), while in tomato heterologous expression of the CBF genes activates the CAT 1 gene (Hsieh et al., 2002). Thus, although cold acclimation mechanisms are controlled by differe nt genes in different plant species, the activators are CBF genes in al l species. The mechanism of cold acclimation occurring in Vasconcella spp . , which grows at high altitude loca tions, may be controlled by different genes but activation may occur by CBF orthol ogs. The CBF genes are unique low copy

PAGE 83

68 genes in Arabidopsis . The CBF 1 protein contains a 60 amino acid motif called the AP2 domain which is evolutionarily conserved across the plant kingdo m (Weigel, 1995). The domain appears to have a novel DNA binding mo tif that to date ha s been found only in plant proteins. Conservation of these sequences in diverse plan t species suggests that they have an important functional role. Therefore it is not surprising that the sequences cloned from V. cundinamarcensis bear homology to the sequences cloned from Arabidopsis . The cloning of an 18S ribosomal RNA us ing degenerate primers for CBF genes raises the question of the role of this gene in any cold-related pro cess. The 18S ribosomal RNA genes are part of the ribosomal RNA complex and are involved in processing pre rRNA molecules during transcription. Their role in cold acclimation has never been discussed so far and their role in the cold acclimation mechanism is uncertain. Further studies can be conducted on sequencing the gene completely and determining its expression in E. coli . This will help to determine whether or not the sequence is translated and if the protei n sequence can be compared to that of Arabidopsis . Construction of an expression vector ha rboring this gene and its expression in Arabidopsis or tobacco will help to determine whether or not the gene has functional properties and if downstream ge nes are activated by it. In this way the cold acclimation pathway of this species can be compared with the already eluc idated pathways in Arabidopsis . This would be helpful in explaining sim ilarities and differences that exist in cold acclimation mechanisms of temperate and tropical/ subtropical plant species. Conclusion When the genomes of C. papaya and V. cundinamarcensis were probed for presence of any cold inducible sequences, sequences bearing homo logy to those present in Arabidopsis were found in V. cundinamarcensis whereas they were absent in both

PAGE 84

69 commercial cultivars of C. papaya . Thus, a clear conclusion can be drawn from the above studies. The genome of C. papaya does not possess any tran scriptional activators responsible for cold acclimation process. The cold acclimation mechanism seems to be absent in papaya. The genome of V. cundinamarcensis possesses elements that show some homology with Arabidopsis CBF sequences and further sequencing of the cloned fragment would be necessary before a definitive conclusion could be drawn about the function of the sequence.

PAGE 85

70 CHAPTER 4 SOMATIC EMBRYOGENESIS AND CRYOPRESERVATION STUDIES IN PAPAYA Introduction The efficient regeneration of plants from cell cultures is a prerequisite for the application of most modern genetic a pproaches to crop improvement. Somatic embryogenesis is an efficient regeneration pathway for producing transgenic plants because regeneration occurs either from individual cells or proembryonic masses (PEMs). Similarly, other techniques, including somatic hybridization and in vitro mutation and selection, also can involve embryogenic pathways Somatic embryogenesis in papaya was re ported as early as 1974 (DeBruijne et al., 1974). Different explants, namely, petiole sections (DeBruijne et al., 1974), stem sections (Yie and Liaw, 1977), peduncles (Litz and Conover, 1980), ovules (Litz and Conover, 1982), roots (Chen et al., 1987) and hypocotyls (Fitch, 1993) have been used for induction of embryogenic cultures. In all case s, the indirect embr yogenesis pathway has been observed, namely, the induction of i nduced embryogenically determined cells (IEDC) (Sharp et al., 1980). The optimum protocol has involved induction of embryogenic cultures from zygotic embryos (Fitch & Manshardt, 1990). Immature zygotic embryos from open pollinated and se lfed fruits of papaya 90-114 days after anthesis produced embryogenic cultures when placed on induction medium containing 9.5M 2,4-D. Accordingly, each zygotic embryo can produce hundreds of embryos within five months of culture on media. Somatic embryogenesis was reported to be

PAGE 86

71 genotype-dependant (Fitch, 1994), with some genotypes exhibiting greater proliferation than others with respect to production of somatic embryos. Maintenance of embryogenic cultures in suspension for papaya has been reported by Litz and Conover (1983) and Mahon et al. (1996). Suspension cultures resulted in a greater production of somatic embryos and improved regeneration (Castillo et al., 1998). Suspension cultures of papaya were used by Ying et al. (1999) and Lines et al. (2002) for regeneration of transgenic plants with resistance to papaya ring spot virus. Another area emphasizing the useful ness of somatic embryogenesis is in vitro germplasm conservation. Embryogenic cultures of many species can be cryopreserved at -196oC in liquid nitrogen (LN). The genetic divers ity of most crop species is traditionally maintained as field plantings. This method of conservation has several drawbacks, for example losses due to biotic and abiotic factors and high maintenance costs. In vitro germplasm conservation is reliable for shor t and medium storage of genetic stocks; however embryogenic cultures lose their mor phogenic potential with time and this is genotype dependent (Witjaksono and Litz, 1999). In order to ensure a continuous supply of embryogenic cultures for research requiring in vitro cultures, long te rm storage of embryogenic cultures is critical. Cryopreserva tion involves freezing of cells and tissues under controlled cond itions to -196oC. Storage in liquid nitrogen is a reliable method for maintaining genetic stability and long term storage of cell lines, meristems and value added transgenic or other plant materi al (Kartha, 1985; Grout, 1995). Different cryopreservation protocols have been devel oped, which involve the use of several cryoprotectants and cooling methods in differe nt combinations. The standardization of a cryopreservation protocol for pa paya could enable the longterm storage of embryogenic

PAGE 87

72 cultures. This would be essential in orde r to address the loss of embryogenic potential that occurs over time with subculture and permit embryogenic lines to be used for longterm research. Different compounds like glycerol, dimet hyl sulfoxide (DMSO), ethylene glycol, polyethylene glycol (PEG) and hydroxymethyl starch (H MS) have been used as cryoprotectants solely and in combination with each other to ensure survival and recovery of tissue through cryopreservati on. Compounds like glycerol a nd DMSO are significantly permeable to cell and tissues and their colligative role depends on an effective reduction in water content of the cell, which in turn re duces the effective ion/solute concentrations that can occur as a result of cryodehydration (Grout, 1995). In addition they also provide an element of protection against free radical effects produced during freezing by acting as free radical scavengers (Benson, 1990). Com pounds like ethylene glycol, PEG and HMS are non permeating polymeric protective comp ounds and have proved to be effective cryoprotectants for a limited range of materi al. Their mode of action may be, in part colligative, as they become increasingly con centrated in residual solutions as freezing progresses, and have an effect on freezing point depression and the reduction of ion concentrations (Kartha, 1985). In addition to these compounds, others like sucrose, sorbitol, glycene betaine, proline and other so luble sugars have been used as conditioning agents to acclimatize and cold hard en the tissue to be frozen (Koster et al., 1989). Slow and rapid cooling have been used for successful cryopre servation of plant cells and tissues depending on the kind of tissu e and plant species. Th e function of slow cooling in cryopreservation is to allow cryode hydration to progress without intracellular freezing and removal of water from cells to a point where their contained solutions will

PAGE 88

73 not form ice crystals when taken to the fina l cryogen temperature. Instead, they will undergo a transition to a non-crystalline amorphous phase by a process known as vitrification. Rapid cooling on the other hand involves a prior dehydration of the tissue by treatment with a solution with high os moticum followed by a rapid lowering of temperature which causes vitrification (Fahy et al., 1994). The plant vitrification solution (PVS) has been the choice of cryoprotectan t employed for cryopreservation using fast cooling. PVS-2 is generally utilized and i nvolves a combination of glycerol (30%), ethylene glycol (15%) and DMSO (15%). The pr inciple involves the dehydration of plant tissue by exposure to a loading solution containing a high osmoticum followed by exposure to a vitrification solution (Sakai et al., 1991). Rapid cooling is generally achieved by directly immersing the tissu e in liquid nitrogen. The choice of cryoprotectants and cooling method to be used is purely dependent on the plant species to be cryopreserved and the stage of the tissu e at which it will be subjected to low temperature. Cryopreservation techniques have been appl ied to tropical and sub tropical fruit crop species. Cryopreservation of embryogenic avocado cultures has been achieved using both slow and fast cooling method (Efendi , 2003). Embryogenic cultures have been successfully cryopreserved by vitrification in mango (Wu et al., 2003) and longan (Matsumoto et al., 2003). Citrus spp . has been cryopreserved by both slow and fast cooling methods (Sakai et al., 1991; Sakai et al., 1993; Perez et al., 1997). Cryopreservation of embryogenic cultures has al so been successful with other tropical trees, for example, Hevea brasilinensis (Engelmann and Etienne, 1995).

PAGE 89

74 Studies have been undertaken for storage of papaya seeds (Althoff & Carmona, 1999), shoot tips (Ashmore et al., 2001) and somatic embryo s (Lu and Takagi, 2000) in liquid nitrogen. Ashmore et al., (2001) obtained a 65% recovery of in vitro papaya shoot tips following cryopreservation. Cryopreser vation using vitrification allowed regeneration of plantlets fr om shoot tips but a reduced growth was observed in field plantings. Lu and Takagi (2000) cryopreserved somatic embr yos of ‘Sunrise’ papaya by vitrification. More than 70% recovery of somatic embryos was obtained and normal germination was observed. Studies were undertaken with an object ive to determine cultivar and explant responses to induction, maintenance, soma tic embryo development and recovery of plantlets. Likewise, studies were undertaken in order to standardi ze a cryopreservation protocol for papaya embryogenic cultures in order to maximize survival and regrowth of cultures. Materials and Methods Somatic Embryogenesis Studies Plant material Two papaya cultivars, ‘Sunrise Solo’ and ‘Red Lady,’ were used to study relative rates of induction, maintenance and developm ent of embryogenic cultures. Seeds were obtained from the University of Hawaii Seed program. To study the response of immature zygotic embryos to induction a nd maintenance of embryogenic cultures, papaya fruits at 75-80 days after pollin ation were collected from the field. Induction of embryogenic cultures Two types of explants from the two cult ivars were used to induce embryogenic cultures. Seeds of ‘Sunrise So lo’ and ‘Red Lady’ were surf ace-sterilized in 20% (v/v)

PAGE 90

75 Clorox for 30 min. Excess sterilant was removed by 3 washes of sterile deionized water. The seeds were then placed in Petri plates containing semi solid water agar medium and incubated in the dark at 25oC. Germination occurred after 10-15 days. The hypocotyls of the seedlings were excised and used as explan ts. Explants were cultured in the dark on semi solid induction medium in sterile plas tic disposable Petri dishes (100mmX15mm) and sealed with Parafilm. Induction medium consisted of MS medium with strength major salts (Murashige and Skoog, 1962), 400mg L1 glutamine, 50 mg L-1 myoinositol, 0.5mg L -1 nicotinic acid, 0.5 mg L -1 pyridoxine, 0.1mg L1 thiamine HCl, 60g L1 sucrose, 9.5M 2,4-D and 3 g L-1gellan gum. The pH was adjusted to 5.8 with KOH and sterilized at 121oC at 1.1 kg cm-1 for 20 min. To study the induction response of immature zygotic embryos, fruits 75-80 days after pollination were surface ster ilized with 30% (v/v) Clorox for 1h. The fruits were then dried in a laminar flow hood and excise d to remove the underdeveloped seeds. The seed was bisected and the immature embryo w ith two cotyledons and an embryo axis was removed. It was then placed on induc tion medium and cultured as above. Maintenance of embryogenic cultures Cultures were transferred to fresh medium at 3 week intervals and were maintained on semi solid induction medium for 12 week s. Following induction of proembryonic masses (PEMs), they were transferred to 40 ml liquid medium of the same composition in 125ml Erlenmeyer flasks. Flasks were sealed with aluminum foil and Parafilm. Cultures were maintained for 12 weeks at 125 rpm. Ch anges in fresh weight of cultures on semi solid medium as well as packed cell volum e (PCV) of embryogeni c suspension cultures were recorded after each subculture.

PAGE 91

76 Somatic embryo development Embryogenic suspension cultures were sieved through ster ile 0.8mm nylon filtration fiber and the larger fraction of PEMs was transferred to semi solid maturation medium. Maturation medium consisted of induction medium (see above) without any growth regulators. PEMs were maintained on the maturation medium for 4-6 weeks for development of somatic embryos. Somatic embryo germination and plantlet development Well developed cotyledonary stage somatic embryos were transferred to semi solid germination medium. The medium consisted of MS major and minor salts, MS organics 100mg L-1 myoinositol, 30g L-1 sucrose, 4.41M BA and 28.9m GA3. The cultures were maintained in a 14h photoperiod regime for ge rmination. After germ ination, they were transferred to test tubes c ontaining MS basal medium w ithout growth regulators for further development. Cryopreservation Studies Embryogenic cultures Embryogenic cultures were induced from hypocotyls as described above. Cultures at different stages of development were used to determine the right stage for cryopreservation. Three stages of devel opment, namely, embryogenic cell masses, (compact masses containing water content of 80%), PEMs (< 0.8mm) and early stage cotyledonary embryos were select ed for cryopreservation studies. Cryoprotectant treatments Different combinations of the cryoprotect ants glycerol and dimethyl sulfoxide (DMSO) were used as treatments and are summarized in Table 4-1. Three

PAGE 92

77 cryopreservation procedures were followed depending on the type of tissue used for cryopreservation. Table 4-1. Different tissue types, cryoprotecta nt treatments and cooling methods used to determine optimum stage and treatment for cryopreservation No Stage of Tissue Cryoprotective treatments Cooling Methods 1 Embryogenic cell masses Glycerol+ DMSO (0:5, 0:10, 5:0,10:0,5:5, 10:10 %),PGD, PVS-2 Slow and Fast 2 Proembryonic masses Glycerol+ DMSO (5:5, 10:10%), PGD, PVS-2 Slow and Fast 3 Somatic embryos (cotyledonary stage) S.A.(2.5%)-no freezing(positive control) S.A. (2.5%) S.A. (2.5%) +Glycerol (10%) S.A.(2.5%)+Glycerol+ DMSO (10% each) EncapsulationDehydration PGD[polyethylene glycol + glucose + DMSO (10% each)] PVS2-plant vitrification solution -2 (glycer ol-30% + ethylene glycol-15%+ DMSO-15%) S.A. sodium alginate Freezing procedures Embryogenic cultures one week after culture into fresh me dium were selected for cryopreservation. Cryoprotectant solution and 1. 5ml cryo-vials were placed on ice in a laminar flow hood 30 min before experiments were initiated. Embryogenic cultures (200 mg) were mixed with cryoprotectants in the cryo-vials. The cryo-vial s were cooled at 1oC min-1 from room temperature to -80oC using a Mr. Frosty and then plunged into liquid nitrogen for 48h. In the case of PVS2 vitrification treatment, the tissue was incubated in a loading solu tion consisting of 2.0M glycer ol and 0.4M sucrose (Sakai et al., 1990) for 20 min. Following the incuba tion period, the loading solution was discarded and replaced with the cryoprotectant solution. The vials were incubated on ice for 30 min and then plunged into liquid nitr ogen. A similar procedure was followed when PEMs (<0.8mm) were used for cryopreservati on. Ten cryo-vials were used for each treatment and each cryo vial was considered to be a replication. For somatic embryos, a

PAGE 93

78 different procedure was followed. A solution of 2.5% sodium algina te was prepared by dissolving it in MS basal medium without cal cium chloride. The mixture was sterilized by autoclaving. The cryoprotectants were f ilter-sterilized and added to the solution. Cotyledonary stage somatic embryos on maturation medium were selected for cryopreservation. The somatic embryos were imme rsed in the solution and then dipped in a solution containing 60mM calcium chloride for 20 min to allow bead formation. The beads were then pretreated by transfer to culture medium for 24h be fore being air dried for 4h. The beads were then transferred to cryo vials and plunged into liquid nitrogen. Thawing procedure After 48h the cryo-vials were removed from liquid nitrogen and thawed in a water bath at 37oC for 2 min. Regrowth Excess cryoprotectant solution was remove d from the cryo-vials using a sterile Pasteur pipette. The embryogenic cultures we re plated on semi so lid induction medium for recovery. Cultures that s howed regrowth were maintain ed on the same medium for 12 weeks and then transferred to maturati on medium (induction medium without 2,4-D). Regrowth of cultures was record ed at 3 week intervals. The numbers of somatic embryos produced from each treatment were counted following development on maturation medium. Fifty cotyledonary st age somatic embryos were tr ansferred to germination medium and germination percentage was calculated for each treatment. For the encapsulation-dehydration treatm ents, the beads were placed on germination medium and the germination percentage was recorded. Data were analyzed with SAS using ANOVA at 5% and 1% confidence levels. In some cas es the data recorded did not follow a normal

PAGE 94

79 distribution and in such cases the appropriate data transf ormation was carried out to normalize the results. Results Somatic Embryogenesis Studies Induction and maintenance of embryogenic cultures Embryogenic cultures induced from immatu re zygotic embryos of ‘Red Lady’ (0.80g) recorded the maximum increase in weight after 12 weeks compared to ‘Sunrise Solo’ (0.50g) and ‘Red Lady’ (0.36g) in which hypocotyls were used as explants (Figure 4-1). Embryogenic cultures i nduced from hypocotyls were wet and loose. In contrast, friable embryogenic cultures were obtained fr om immature zygotic embryos (Figure 4-2). Induction of PEMs was observed earlier in cultu res from immature zygotic embryos (4-6 weeks) than from hypocotyls (9-12 weeks). A similar pattern was observed in liquid cu lture, where proliferation of PEMs was more rapid in cultures derived from immatu re zygotic embryos compared to hypocotyls. The cultures of ‘Red Lady’ derived from zygo tic embryos recorded a packed cell volume of 8.57 ml compared to ‘Sunrise Solo’ (7.95m l) and ‘Red Lady’ (6.02ml) that were derived from hypocotyls (Figure 4-3). Somatic embryo development Somatic embryo development occurred when cultures were transferred to maturation medium, which did not contain any growth regulators. Development was asynchronous and somatic embryos at different stages of development occurred in a single culture. They ranged from early stage globular embryo to la te stage cotyledonary embryos. This pattern of development was obs erved with both cultivars regardless of

PAGE 95

80 explant source. Somatic embryos reached the cotyledonary stage in three weeks on maturation medium and were ready to be transferred to germination medium. weeks 4681012 weight (g) 0.0 0.2 0.4 0.6 0.8 1.0 Red Lady (hypocotyl) Red Lady (zygotic embryo) Sunrise Solo (hypocotyl) Plot 1 Regr Figure 4-1. Changes in weights of embryogenic culture s after 12 weeks Figure 4-2.Induction of embryogenic cultures in A . ‘Sunrise Solo’ (hypocotyl), B .‘Red Lady’ (hypocotyl) and C .‘Red Lady’ (immature zygotic embryos). Proliferating PEMs in D . ‘Sunrise Solo’ (hypocotyl) and E . ‘Red Lady’ (hypocotyl) F . Somatic embryos in ‘Red Lady’ (zygotic embryo).

PAGE 96

81 Weeks 02468101214 Packed cell volume 0 2 4 6 8 10 Red Lady hypocotyls Red Lady Zygotic embryos Sunrise Solo hypocotyls Figure 4-3. Changes in packed cell volume (P CV) of PEMs in suspension cultures after 12 weeks. Somatic embryo germination and plantlet development Somatic embryo germination occurred 10 to 21 days after transf er to germination medium (Figure 4-4). Germination percentage ranged from 68-75% regardless of explant source. A large number of germinating embryos were callused at the radical end. Transfer of germinating embryos to basal medium resu lted in normal plantlet development (Figure 4-4). Prolonged culture of plantlets on germination medium caused hyperhydricelongated shoots. Figure 4-4. Germinating somatic embr yos (A, B) and plantlet (C).

PAGE 97

82 Cryopreservation Studies Regrowth of embryogenic cell masses following cryopreservation No differences in weights were observed in the different treatments 60 days after cryopreservation. The maximum weight of cu ltures was recorded in the non frozen control (0.40g) followed by PGD treatment (0.25g) and glycerol + DMSO (10% each) treatment (0.25g). A similar trend was observe d in weights of cultures 90 days after cryopreservation where the wei ghts recorded were 0.54g for th e non frozen control, 0.31g for the PGD treatment and 0.30g for the glycer ol + DMSO (10% each) treatment (Figure 4-5). Days 020406080 Weight(mg) 100 200 300 400 500 600 CU 0:5 0:10 5:0 10:0 5:5 10:10 PGD PVS-2 Figure 4-5. Changes in fresh weight of embryogenic cell ma sses after 90 days following cryopreservation CUControl Non Frozen 5:5Glycerol (5%) + DMSO (5%) 0:5Glycerol (0%) + DMSO (5%) 10:10Glycerol (10%) + DMSO (10%) 0:10Glycerol (0%) + DMSO (5 %) PGDPolyethlylene glyc ol +Glycerol+ DMSO (10% each) PVS-2Plant Vitrif ication Solution-2 5:0Glycerol (5%) + DMSO (0%) (Glycerol30% + Ethylene glycol15% + DMSO15%) 10:0Glycerol (10%) + DMSO (0%)

PAGE 98

83 Development of PEMs was affected by cryopr eservation treatment a nd no proliferation was observed compared to the non frozen contro l. None of the cryoprotectant treatments seemed to have a positive effect on recovery and regrowth of cultures. Recovery of proembryonic masses following cryopreservation A significant difference was observed among th e different treatments after 60 days following cryopreservation (Figure 4-6, 4-7) . The non frozen control recorded the maximum number of proliferating PEMs (58.12), which were followed by cultures treated with PVS-2 solution (47.12) and cultu res treated with PGD solution (33.62). The frozen control recorded the lowest numb er of PEMs (30.12). A similar pattern was observed in the increase in fresh weight of PEMs over a 90 day period. (Figure 4-7, Figure 4-8). Treatments 0123456 PEM 0 10 20 30 40 50 60 70 Figure 4-6. Actively growing PE Ms in different treatments 60 days after cryopreservation 1.Control non frozen; 2.Control frozen; 3.Glycerol (5%) + DMSO (5%); 4.Glycerol (10%) + DMSO (10%); 5.Polyethylene glycol + Glycerol + DMSO (10% each); 6Plant Vitrification Solution2 (Glycerol -30% + Ethylene glycol15% + DMS,O15%)

PAGE 99

84 The maximum increase of embryogenic cultures was recorded in the non frozen control after 30 (0.26g), 60 (0.40g) and 90 days ( 0.54g) of culture. This was followed by the vitrification treatmen t where the fresh weights were 0.24g (30 days), 0.38g (60 days) and 0.50g (90 days). There were no significant differences in fresh weight between vitrification treatmen t and the non frozen control after 90 days of regrowth following cryopreservation. Other treatments using the slow cooling method showed significantly lower fresh weights over the same period of time. Somatic embryo development following cryopreservation Somatic embryos began to develop on induction medium. Following transfer to maturation medium without any growth regulat ors, proliferation of somatic embryos was observed. Days 0306090 Fresh weight (g) 0.0 0.2 0.4 0.6 NC FC 5:5 10:10 PGD PVS2 Figure 4-7. Changes in fresh weights of PEMs in different treatments following cryopreservation NCNon frozen control; FCFrozen control; 5:5Glycerol (5%) + DMSO (5%); 10:10Glycerol (10%) + DMSO (10%); PGDPolyethylene glycol + Glycerol + DMSO (10% each); PVS 2Plant Vitrification Solution 2 (Glycerol30 % + Ethylene glycol15% + DMSO-15%)

PAGE 100

85 Primary somatic embryos produced s econdary embryos, namely, repetitive embryogenesis. Different stages of somatic embryos were observed developing at the same time. Since the data showed a wide variability and did not follow a normal distribution they were subjected to arcsine transformation (Table 4-2). Figure 4-8. Proliferation of PE Ms in vitrification treatment (A, B, D) and frozen control (C, E) following cryopreservation. Both morphologically normal and abnorma l somatic embryos were observed on the maturation medium. Morphologically normal so matic embryos included embryos which were in one of the following stages on cu lture medium: globular, heart, torpedo or cotyledonary stage (Figure 4-9). Figure 4-9. Different stages of morphologically normal (A ) and abnormal (B) somatic embryos

PAGE 101

86 Abnormal somatic embryos included those embryos which showed deviation from the normal stages of development and showed abnormal morphology including fused radical end, multiple cotyledons and misshap ed embryos (Figure 4-9). The maximum number of morphologically normal somatic embryos per Petri plate (Figure 4-9) was recorded in the non frozen control (2 56.00 .37), followed by the vitrification treatment (225.20 .93) and polyethylene glycol +glycerol + DMSO10% each (103.00 .43), while the numbers of somatic embryos recorded in the frozen control were 50.80 (.64). Morphologically abnormal so matic embryos were also observed on maturation medium in all treatments. The ma ximum number were recorded with the non frozen control (63.20 .06) while the mi nimum number were observed with the vitrification treatment (36.40 .30) followe d by the PGD treatment (21.20 .02). Thus, the maximum percentage of normal somatic em bryos was recorded in the vitrification treatment (86.18%) followed by PGD (82.42%), compared to the non frozen control (79.86%). Table 4-2. Number of normal, abnormal soma tic embryos and percentage normal somatic embryos in different treatments. CUNon frozen control; CF Control Frozen; 5:5Glycerol (5%) + DMSO (5%); 10:10-Glycerol (10%) + DMSO (10%); PGDPolyethylene glyc ol + Glycerol + DMSO (10% each); PVS 2Plant Vitrifi cation Solution 2 (Glycerol30% + Ethylene glycol15% + DMSO-15%) No Treatments Normal somatic embryos per Petri plate Abnormal somatic embryos per Petri plate Total somatic embryos per Petri plate % normal somatic embryos(SE) 1 CU 256.00 (.37) 63.20 (.06) 319.20 (.15) 79.86 (.02) 2 CF 50.80 (.63) 23.00 (.59) 73.80 (.46) 67.72 (.04) 3 (5:5) 72.60 (.18) 31.00 (.9 0) 103.60 (.29) 68.88 (.04) 4 (10:10) 59.80 (.55) 18.40 (.5 4) 78.20 (.70) 78.20 (.01) 5 PGD 103.00 (.43) 21.20 (.059) 124.20 (.39) 82.42 (.01) 6 PVS-2 225.20 (.93) 36.40 (.3 0) 261.60 (.30) 86.18 (.01)

PAGE 102

87 Somatic embryo germination and plantlet development No differences in germination were observed among the different treatments (Figure 4-11). The maximum germination perc entage was recorded in the PGD treatment (74.66%) followed by the non frozen control (72.66%) and the vitr ification treatment (71.32%). Callusing was observed at the radica l end of the germinating embryos (Figure 4-10) but was not attributed to cryopreserva tion as this phenomenon was also observed in the non frozen control. Germinating embryos developed into normal plantlets when transferred to Magenta boxes containing basal medium. Figure 4-10. Germinating somatic embryos (A ) and plantlet development (B) following cryopreservation

PAGE 103

88 Figure 4-11. Germination percentages of so matic embryos in different treatments following cryopreservation 1 Non frozen control; 2 Control frozen; 3 Glycerol (5%) + DMSO (5%); 4 Glycerol (5%) + DMSO (5%); 5 Polyethylene glycol + Glycerol + DMSO (10% each); 6 Plant Vitrification Solution 2 (Glycerol30% + Ethylene glycol15% + DMSO-15%) Germination of somatic embryos followi ng cryopreservation using encapsulationdehydration procedure Four treatments including tw o cryoprotectants, glycerol and DMSO, were used to study whether the encapsulation–dehydration pr ocedure could be applied to papaya somatic embryos. Among the different treatment s, no treatments resu lted in germination of a single somatic embryo following cryopreservation. In contrast, the positive control which included encapsulation-dehydration but no cryopreservation resulted in 78% germination of somatic embryos (Figure 4-12) within 3 weeks of treatment, indicating that encapsulation dehydration did not inhibit germination.

PAGE 104

89 Figure 4-12. Germination of somatic embryos (B and C) following encapsulation (A). Discussion Somatic Embryogenesis Studies Two papaya cultivars ‘Sunrise Solo’ a nd ‘Red Lady’ were used to study the response of different explant types to induction and maintenance of embryogenic cultures, and somatic embryo development a nd plantlet conversion. Hypocotyls from germinated seedlings and immature zygotic embryos from fruits developed 75-80 days after pollination were studied for the embryogenesis response. The time required for induction of embryoge nic cultures differed for the two kinds of explants and was earlier in cultures induced from immature zygotic embryos than from hypocotyls. A difference in the pattern of induc tion was also observed with respect to the two explant types. Cultures initiated from zygotic embryos showed proliferation of somatic embryos from the embryo axis as early as 3 weeks following explanting. This pattern was not observed with cultures de rived from hypocotyls. Cu lture of hypocotyls on induction medium gave rise to PEMs afte r 9-12 weeks. Thus the induction pathway appeared to be indirect in hypocotyls. The term Induced Embryogenic Determined Cells (IEDC) was coined by Sharp et al. (1980) and Evans et al. (1983) to describe the induction of embryogenic cells. The induction pro cess in this case involved termination of an existing gene expression program a nd its replacement with an embryogenic gene

PAGE 105

90 expression program in those cells of the e xplant tissues which produced somatic embryos (Merkle et al., 1995). These changes are usually tri ggered by an auxin and 2,4-D, which caused the alteration of gene expression in hypocotyls. Simi lar results were obtained by Fitch (1993) when hypocotyls were used as explants for induction of embryogenic cultures. Embryogenic cultures were obtaine d in 6-8 weeks following induction as compared to 9-12 weeks in the current st udy. This difference can be attributed to genotype as a differential response to embr yogenesis among cultivars was also observed by Fitch (1993). In contrast, the induction pathway in cultures derived from zygotic embryos appeared to be direct where already existing embryogenic cells produced somatic embryos with appropriate manipula tions in culture medium. These cell types were described as Pre-embryogenic Determined Cells (PEDC) to indicate that the origin of somatic embryos was directly from ce lls that already possessed an embryo gene expression program (Sharp et al., 1980). Similar results we re obtained by Fitch and Manshardt (1990) when immature zygotic em bryos were cultured on induction medium and somatic embryos were observed as early as 20 days following explanting. Induction of embryogenic cultures has also been reported from other maternal tissue like integuments of immature seeds (Monmarsen et al., 1995), ovaries and ovules (Litz and Conover, 1981b; 1982; 1983; Moore and Litz, 1984). Proliferation of embryogenic cultures occurr ed as PEMs, which were maintained as suspension cultures in liquid induction medi um. Proliferation was higher in cultures induced from immature zygotic embryos co mpared to those induced from hypocotyls. PEMs were successfully maintained in suspension cultures which proliferated by repetitive budding of PEMs. In liquid medium, rapidly di viding proembryonic cells are

PAGE 106

91 constantly shed from larger PEMs, which can then repeat the process. When globular embryogenic masses are maintained on medi um containing auxin, differentiation of embryogenic organs is inhibited and globul ar embryos enlarge, producing secondary embryos from the epidermal layer (Button et al., 1974). A loss of integrated control, thus results in secondary somatic embryogenesi s (Williams and Maheswaran, 1986). A degree of synchrony can be obtained by sieving of cu ltures and retaining the smallest proembryo fraction which retains the poten tial to produce somatic embryos after subculture to auxin free medium (Ammirato, 1987). The proliferatio n rate of PEMs is higher in suspension cultures and the cultures become more synchronized (Von Arnold et al., 2002). Castillo et al. (1998) obtained a greater pr oliferation rate of embryoge nic cultures of papaya maintained in suspension. Similarly in other tropical and subtropica l fruit crops species, for example, mango (Litz et al., 1993) and avocado (Witjaksono and Litz, 1999), embryogenic cultures can be maintained in suspension for prolonged periods. Greater proliferation and synchrony of culture s was observed with these species. Embryogenic cultures were transferred to semi solid maturation medium for somatic embryo development. Maturation medium was composed of induction medium without any growth regulators . After transfer to somatic embryo development medium, repetitive embryogenesis was observed, which was of the direct type with secondary embryos developing directly from primary embryos. This kind of embryogenesis has been described by Sharp et al., (1980) as being perm issive or direct. Asynchrony in development was observed and ca n be attributed to polarity of cells within the culture. Embryogenic cells when grow n in the induction me dium in absence of auxin can develop into somatic embryos (Ammirato, 1987). When embryogenic cultures

PAGE 107

92 are maintained on semi-solid medium cont aining 2,4-D, maturation of somatic embryos occurs, usually from the PEMs distal to the medium surface. It can be attributed to a gradient in the availability of auxin within the tissue cultur e. Another factor leading to asynchrony has been the difference in init iation period and fluctuating regimes of nutrition during periods of subculture (Conger et al., 1989). Abnormal embryo development, namely, embryos with fused cotyledons, multiple cotyledons, misshaped embryos and embryos with fused basal ends were observed in the culture medium. Developmental abnormalities such as fasciation and fusion of two or more somatic embryos can occur when cell divisions in meri stematic areas occur prior to differentiation of the shoot apex and cotyledons (Litz and Gray, 1992). Abnormalities are frequently associated with somatic embryogenesis (G ray 1995; Gray and Purohit 1991). Such abnormalities have been observed in severa l embryogenic systems including alfalfa (Xu and Bowley, 1992), mango (Litz et al., 1993) and grape (Gray and Compton, 1993). The presence of plant growth regulators in the cu lture medium is often considered to be a major factor contributing to abnormal embryo development (Ammirato, 1987). Other factors that contribute to abnormalities are ab sence of the seed coat in somatic embryos which has an effect on embryo respirat ion and gas exchange (Norstog, 1965). Somatic embryos germinated when they we re transferred to germination medium. Germination percentage was relatively hi gh ranging from 68-75%. Callusing at the radical end was frequently observed in ge rminating somatic embryos. Somatic embryos have the ability to conjugate auxins which are subsequently excreted into the medium during histodifferentiation (Michalczuk et al., 1992), and this may explain the cause of the phenomenon. Hence, treatments, including inclusion of activated charcoal in the

PAGE 108

93 medium, may lead to recovery of somatic embryos with more normal morphology and increased germinati on ability (Buchheim et al., 1989), presumably because charcoal adsorbs auxins released from developing tissue (Ebert and Taylor, 1990). Somatic embryogenesis has been demonstrat ed from both types of papaya tissues, namely, hypocotyls and immature zygotic em bryos (Fitch and Manshardt, 1990; Fitch, 1993). Somatic embryos were produced earlier fr om zygotic embryos than from somatic tissue. The shorter period of time that cult ures are exposed to 2,4D may help reduce the abnormalities that arise from the use of 2,4-D (Larkin and Scowcroft, 1981). Although somatic embryogenesis from immature zygotic embryos may be more prolific, they are more tedious to isolate and may be more difficu lt to obtain than seedlings outside the area of production. Cryopreservation Studies In an effort to standardize a cryopreserv ation protocol, differe nt cryoprotectants were treated in combination with different stages of embryogeni c cultures. Embryogenic cell masses, PEMs and somatic embryos were used for cryopreservat ion using different cryoprotectants and cooling methods. Treatment of embryogenic cell masses with cryoprotectants did not result in significant recovery and regrow th of cultures following cryop reservation. The growth of cultures following cryopreserv ation was extremely slow co mpared to the non frozen control, which recorded an increase in we ight over time. Sim ilarly, treated cultures showed no development of PEMs which occu rred in non frozen controls. Early stage embryogenic cell masses consist of a group of heterogeneous cells. Anatomical and histological studies with papa ya embryogenic cultures (Fernando et al., 2001) showed the presence of two distinct sectors in early stage embryogenic cultures, one with elongated

PAGE 109

94 and highly vacuolated cells and the other wi th compactly arranged small meristematic cells having a dense cytoplasm. Thus, differences in the rate of cooling and transfer of temperature among the cells can cause cooling gradients leading to low survival during freezing. High water content among early stage embryogenic cell masses also accounts for low survival and lack of prolif eration of PEMs following cryopreservation. Maximum survival of PEMs was recorded following treatment with cryoprotectants and cryopreservation, in comparison with other materials. Among the different combinations, the PVS-2 solution followed by the fast cooling method (vitrification) resulted in the best recovery and regrowth of cultures. Regrowth was slower than the non frozen control, but was significantly hi gher than other tissues and treatment combinations. This result could be attrib uted to the morphology of PEMs. PEMs contain small dense cytoplasmic cells with starch grai ns and are devoid of vacuoles, whereas non embryogenic cells are large and highly v acuolated (Yeung, 1995). Proembryonic cells have the smallest volume in culture and contain relatively less water, which is advantageous for survival during freez ing and thawing (Engelmann, 1991). Thus, complete dehydration in the pr esence of cryoprotectants and relatively low ice crystal formation during the freezing and thawing process could le ad to better recovery following cryopreservation. Efendi (2003) re ported that among the two types of embryogenic cultures in a vocado, the PEM-type cultu res responded better to cryopreservation than the somatic embryo (SE) -type cultures. PEM-type cultures mainly proliferate as PEMs while SE-types develop as heart and globular stage somatic embryos in maturation medium. Lu and Takagi (2000) obtained greater than 70% recovery of somatic embryos in papaya following cryopr eservation with PVS-2 solution. In mango,

PAGE 110

95 Wu et al. (2003) obtained 91 to 94.3% recovery of cryopreserved PEMs using PVS-3 as a cryoprotectant. Jain et al. (1996) reported successful cryopreservation of rice embryogenic cultures using DMSO and glycer ol by following the slow cooling method. In asparagus, embryogenic suspensions were cryopreserved usi ng the vitrification solution with modified concentra tions of cryoprotect ants (Nishizawa et al., 1993) with a survival rate of 80%. Among the different cooling methods, fast c ooling resulted in better recovery of cultures compared to slow c ooling. For cryopreservation of plant cell cultures that are sensitive to chilling, vi trification has been the preferred method and higher survival rates have been obtained compared to the slow cooling method (Reinhoud et al., 1995; Van Iren et al., 1995). Cell cultures of a tropical sp ecies like papaya may therefore be susceptible to the two step freezing procedure; rapid cooling on the other hand may have minimized the damage, resulting in be tter regrowth and development following cryopreservation. The maximum number of somatic embryos was recorded in the non-frozen control; however, the quality of somatic embryos was en hanced with vitrificat ion. The percentage of morphologically normal somatic embr yos was higher in the cryopreservation treatments compared to the non-frozen control. This can be attributed to the selection pressure imposed on the material during cryopreservation. During cryopreservation, the freeze-thawing cycle can result in selection being imposed on cells. A cell suspension culture generally consists of heterogeneous cell population. Highly cytoplasmic cells may be more tolerant of cryopreservation than other types of cells. By freezing and thawing a cell culture, the more tolerant types of cells may be selected above other cells and result

PAGE 111

96 in a higher proportion of good quali ty somatic embryos (Aguilar et al., 1993). Thus, although basic properties of a cell line may not change, there is a chance of selection as a result of cryopreservation. Similar results were obtained by Gnanapragasam and Vasil (1992), where the protoplast yi eld and plating efficiencies from cryopreserved cells were higher than the non-frozen ones. Furthermore, several freeze thaw cycles can result in the isolation of a culture with e nhanced cryotolerance (Kendall et al., 1990; Watanabe et al., 1992). Thus, cryopreservation can serve as a tool for germplasm conservation and can improve the quality and recovery of embryoge nic cultures. No signi ficant difference in germination percentages was observed between the non frozen contro l and cryoprotectant treatments. Thus, cryopreservati on clearly does not seem to have any deleterious effects on development of cultures. When somatic embryos at the cotyledona ry stage were used for cryopreservation using the encapsulation-dehydrat ion procedure, no germination and plant recovery was obtained following cryopreservation. Germina tion and recovery was normal in somatic embryos that were encapsulated but not cryopreserved, indicating that there were no inhibitory substances in the encapsulation mixt ure. The lack of regrowth was solely due to damage caused to encapsulated embr yos during cryopreservation. A study of the somatic embryo ultrastructure shows that the cells in the somatic embryos usually have a full complement of organelles. The ground meristem of the oblong embryo begins to vacoulate and the process continues th roughout embryo maturation (Schiavone and Cooke, 1985). Storage proteins and lipids accumulate during the maturation phase of somatic embryos. Storage lipid accumulation often coincides with storage protein deposition (Aung et al., 1982). During cryopreservation, proteins and lipids undergo

PAGE 112

97 phase transition from liquid crystalline to th e gel phase (Engelman, 1991). Coexistence of liquid-crystalline and gel phases in a membrane can cause leakage and therefore cell damage (Hammoudah et al. , 1981). Since not every lipid ha s the same phase transition temperature, phase separation may occur, resu lting in the formation of gel phase rich domains. With warming these domains may result in the formation of non-lamellar structures which will cause leak age and cell damage (Quinn, 1985). In Papaver somniferum , Gazeau et al. (1998) reported negative resu lts with the encapsulationdehydration method for cryopreservation and at tributed it to insufficient dehydration which did not endow cells with liquid nitrog en resistance. Therefore, papaya somatic embryos may not be an appropriate tissue st age for cryopreservation. Cryopreservation of somatic embryos using encapsulation-dehydra tion may be species-dependent. Although cryopreservation of somatic embryos has not been possible with citrus (Marin et al., 1993) and Papaver (Gazeau et al., 1998), cryopreservation of somatic embryos has been achieved in gymnosperm species like Picea glauca (Kartha et al., 1988) and P. abies (Gupta et al., 1987). Differences in storage proteins and lipids of temperate and tropical plant species may be decisive factors for th e successful cryopres ervation of somatic embryos. Exposure to low temperature may cau se inactivation of proteins that are sensitive to cold apart from lipid damage (Usami et al., 1995) and this may result in unsuccessful cryopreservation. Conclusions Embryogenic cultures were induced from papaya hypocotyls as well as immature zygotic embryos. Immature zygotic embryos ha ve better embryogenic potential compared to hypocotyls, with earlier a nd greater proliferation of PE Ms. Cryopreservation studies to optimize the stage and method of cryopreserva tion demonstrated that PEMs represent the

PAGE 113

98 best stage for cryopreservation using vitr ification and fast cooling method. This combination resulted in maximum recove ry and regrowth of cultures and normal development and recovery of plantlets.

PAGE 114

99 CHAPTER 5 TRANSFORMATION OF EMBRYOGENIC PAPAYA CULTURES WITH CBF CONSTRUCTS AND RECOVERY OF PLANTS Introduction Cold can limit crop productivity in the tropics and subtropics and accounts for significant crop losses. Different plant species have various threshold levels of stress tolerance. Some species can tolerate stress and complete their life cycle; however, many cultivated species are highly sensitive to stre ss and either die or suffer from loss of yield. It has been estimated that twothirds of the yield potential of major crops is lost due to unfavorable growing conditions. Chilling sensitivity is common in plants that originated in tropical and subtropical regions and the in jury is a result of destabilization of cell membranes (Levitt, 1980). Freezing temperat ures are a major factor determining the geographical locations suitable for growing hor ticultural plant species and periodically account for a decrease in pr oduction (Thomashow, 1999). Many environmental stresses, namely, h eat, salinity, low temperature and drought, and developmental processes, namely, seed maturation, cause water deficit in plants (Ingram and Bartels, 1996). Many plants show increased freezing tolerance in response to low temperature, a phenomenon known as cold acclimation (Sakai and Larcher, 1987). The genes associated with freezing tolerance can be classified accordingly: 1) groups that actually confer cold toleran ce through the synthesis of cr yoprotective proteins and 2) groups that are induced in response to cold whic h in turn activate the other class of genes. A major achievement in the field of cold acc limation research has been the discovery of CBF (C repeat Binding Factor) genes (Thomas how, 1999).These genes are transcriptional

PAGE 115

100 activators that bind to the promoter regions of the cold tolerance genes (Gilmour et al., 1998). These transcriptional activat ors are cold regulated (Gilmour et al., 1998). Within 15 min of transfer to low temperature, CBF/DREB1 transcripts begin to accumulate followed 1 to 2 hours later by accumulation of CRT/DRE regulated genes in A. thaliana . Overexpression of CBF genes in Arabidopsis (Jaglo-Ottosen et al. , 1998; Kasuga et al., 1999) results in the expression of CRT /DRE-controlled COR genes without a temperature stimulus . Heterologous expression of the CBF 1 gene in tomato (Heish et al., 2002) resulted in improved chil ling tolerance in transformed plants compared to wild type plants. Thus, genetic transformation w ith CBF genes seems to be promising for improving stress tolerance in plant species with limited freezing tolerance. The area under papaya production is currently limited to tropical and subtropical regions. The crop requires a warm climate for growth and development and the species is extremely sensitive to frost. Ogden et al. (1981) ranked papaya as having poor cold tolerance. A temperature of -0.6oC for a brief period can cause freezing damage (Maxwell et al., 1984). The fruit flavor tends to be insipid if fruit maturation occurs during periods when temperatures are above freezing but below optimum (Wolfe and Lynch, 1940). Chilling temperatures cause phot oinhibitory damage and the level of damage is dependent on the degree of exposure to temperature and sunlight (Smillie et al., 1979; 1988). Genetic transformation has been used in papaya for improvement of traits which are difficult to incorpor ate through conventional breed ing. Genetic transformation protocols have been standardized for papa ya using both particle bombardment (Fitch et al., 1990) and Agrobacterium mediated transformation (Fitch et al., 1993). Somatic

PAGE 116

101 embryogenesis has been the principle pa thway for obtaining regenerants following transformation (Fitch et al., 1990, 1993; Yang et al., 1996; Ying et al., 1999). Papaya is susceptible to several virus di seases (Litz, 1986), and papaya ring spot virus (PRSV) is the major viru s affecting cultivation. Fitch et al. (1993) obtained resistance to PRSV by transforming embryogeni c cultures with a coat protein (cp) gene from the virus conferring resistance to the vi rus. Plants were successfully regenerated and field trials confirmed the resistance under field conditions (Gonsalves, 1998). Similar studies have been conducted with different strains of the viru s in Taiwan (Yeh et al., 1998) and Florida (Ying et al., 1999). Genetic transformation has been used to develop transgenic papaya with antisense ACC syntha se genes to confer ethylene insensitivity (Magdalita et al., 2002) and for insect re sistance (McCafferty et al., 2003). Genetic transformation of papaya with CBF genes seems to be an interesting prospect to study changes in response of the transgenic plants to chilling temperatures. Transgenic plants encoding the CBF genes would demonstrate whether any pathway for cold acclimation exists in tr opical crop species and whethe r heterologous expression of these activators would improve chilling or fr eezing tolerance. Gene tic transformation of embryogenic papaya cultures was carried out with the above objectives in mind. Materials and Methods Preparation of E coli. Cultures and Plasmid Isolation The binary vector pGA 643 harboring the gene constructs for CBF 1, CBF 2 and CBF 3 were isolated from transformed E. coli strain DH5 . The binary vector consists of the CBF gene sequence along with the neom ycin phosphotransferase II (nptII) gene which confers resistance to the antibiotic kana mycin sulfate. The gene of interest (CBF genes) and the npt II genes were cloned within the restriction sites in the polylinker. The

PAGE 117

102 whole gene cassette is driven by the Caulif lower Mosaic Virus (CaMV) 35S promoter, a constitutive promoter. The restriction map of the binary vector is shown in Figure 5-1. Figure 5-1. Restriction map of pGA 643 har boring CBF 1, CBF 2 and CBF 3 together with the npt II gene The bacteria were streaked on Petri plates containing semi soli d LB (Luria Broth) medium containing 50 mg L-1 kanamycin sulfate. The Petri plates were incubated at 370C for 12 h. A single colony was used to inocul ate 5ml liquid LB medium with the same concentration of kanamycin sulfat e. The culture was grown at 370C on an orbital shaker at 225 rpm for 12 h. One ml of this culture was used to inoculate 35 ml liquid LB medium containing 50 mg L-1 kanamycin sulfate. After 12 h the bacterial cultures were used for isolation of plasmid DNA. The Wizzard Plus SV Minipreps DNA purification

PAGE 118

103 system (Promega) kit was used to isolate the plasmid from E. coli . One ml of the bacterial culture was centrifuged in a microcentrifuge at 10,000 rpm for 5 min. The supernatant was discarded and the tube was inverted on a paper towel to remove excess medium. A volume of 250l of cell resuspension solution was added to the microcentrifuge tube and the pellet was resuspended by vortexing. This was followed by addition of 250 L of cell lysis solution and the mixture was inverted th ree to four times to mix the solutions. The cells were then incubated in the solution at room temperature for 5 min. A volume of 350 L of neutralization solution was added and thoroughly mixed by inverting the tube for three to four times. The bacterial lysate was then centrifuged in a table top centrifuge at 14,000 rpm for 10 min. A spin column was attach ed to the port of a Vacuum Manifold (Vac Man Laboratory Vacuum Manifold, Promega) into the vacuum adapter and fitted snugly. The lysate was transferred to the spin column carefully, taking care not to transfer the white precipitate. A vacuum of 15 inches of mercury (Hg) was applied to pull the liquid through the spin column. When all th e liquid had passed through the column the vacuum was released. 750 L of column wa sh solution which was previously diluted with 95% ethanol was added to the spin colu mn and a vacuum was applied again to pull the liquid through the column. The vacuum wa s released when all the liquid passed through the spin column. The procedure was repeated using 250L of column wash solution. The column was then dried by appl ying a vacuum for 10 min. The spin column was then transferred to a 2 ml collection tube and was spun in a table top centrifuge at 14,000 rpm for 2 min to remove the residual co lumn wash solution. The spin column was then transferred to a new 1.5 ml microcentr ifuge tube. The plasmid was eluted by adding 100L of nuclease-free water to the spin column and centr ifuging it at 14,000 rpm for 2 min. The plasmid was stored at -20oC for further use.

PAGE 119

104 Evaluation of Plasmid DNA usin g Agarose Gel Electrophoresis Three L of plasmid DNA was mixed with 2 L of 6X loading dye and 10 L of distilled water. The mixture was spun at 2,000 rpm for 30 sec and loaded on a 0.8% agarose gel along with a 1kb marker. The gel wa s run at 70V for 1 h, and then stained in 50 ml TAE buffer containing 3L ethidi um bromide for 10 min. The gel was photographed using a transilluminator and the quality of the plasmid DNA was confirmed. Electroporation of Purified Plasmid DNA into Agrobacterium The purified plasmid was used for transforming A. tumeficiens competent cells GV 3101. The competent cells were removed from a -80oC freezer and thawed on ice. One g of the isolated plasmids (binary vectors) harboring the CBF 1, CBF 2 and CBF 3 inserts were mixed with the competent cells and in cubated on ice for 3 min. The contents were then transferred to a cold electroporation cuvette with a 0.2 cm electrode gap (BioRad). The Agrobacterium cells and the plasmid DNA were mixed thoroughly. The Gene Pulser (BioRad) was set at a 25mF and the volta ge was set at 2.54 kV. The pulse resistance controller was set at 200.50 fo r electroporation. After the cu vette was removed from the chamber, 1ml of YM medium was added to the chamber. The entire volume of the cuvette was transferred to 15 ml Falcon tube s containing 3 ml YM medium and the tubes were rotated in a drum roller at 225 rpm for 3h. Fifty l of the medium was then transferred to plates containing se mi solid YM medium with 50mg L-1 kanamycin sulfate and 50 mg L-1 gentamycin. The plates were incubated in the dark at 28oC for three days. Single isolated colonies growi ng on the plates were transferre d with a sterile disposable inoculating loop and used to inoculate 5 ml liquid YM medium with the same antibiotic concentrations. The medium was shaken at 225 rpm for 12 h at 28oC. One ml of this

PAGE 120

105 culture was used to initiate 35 ml liquid YM medium in 125 ml Erlenmeyer flasks with the same concentration of antibiotics. The fl asks were placed on a shaker at 225 rpm for 12 h. at 28oC. After 12 h., 700 L of the bacteria l culture was transferred to a 1.5ml microcentrifuge tube and was mixed with 200uL of filter-sterilized glycerol. The contents of the tube were mixed thoroughly. The entire 35 ml of culture was thus transferred to microcentrifuge tubes with gl ycerol and stored at -80oC for future use. Preparation of Agrobacterium Stocks A single transformed colony of Agrobacterium harboring the constructs was used to inoculate 5 ml liquid YM medium containing 50 mg L-1 kanamycin sulfate and 50mg L-1 gentamycin. The culture was gr own on a rotary shaker at 27oC and 225rpm for 15 h. One ml of this culture was used to inoculat e 35 ml YM medium in 125 ml flasks having the same composition of antibiotics. The flasks were placed on a rotary shaker at 225 rpm and 27oC for 15h. After 15 h, 100L of 100M acetosyringone was added to the flasks and were shaken on a rotary shaker for anot her 4h. Three ml of the liquid medium was centrifuged at 14,000 rpm for 2 min using a table top centrifuge. The pellet was resuspended in 2 ml MS basal medium c ontaining 100M acetosyringone and was used for co cultivation. Confirmation of Binary Construct in Agrobacterium by Agarose Gel Electrophoresis The plasmid was isolated from a 2ml Agrobacterium culture as described earlier to confirm the presence of the binary vector in the Agrobacterium. The plasmid isolated from E. coli was used as a positive control. The is olated plasmid and the control were run on a 0.8% agarose gel at 70V for 1h. The gel wa s then stained with ethidium bromide and photographed.

PAGE 121

106 Induction of Embryogenic Cultures Seeds of ‘Sunrise Solo’ were surface sterilized in 20% (v/v) Clorox for 30 min. Excess sterilant was removed by 3 washes of st erile deionized water. The seeds were then placed in Petri plates containing semi solid wa ter agar medium and incubated in the dark at 25oC. Germination occurred after 10-15 days . The hypocotyls of the seedlings were excised and used as explants. Explants were cultured in the dark on semi solid induction medium in sterile plastic disposable Pe tri dishes (100mmX15mm) and sealed with Parafilm. The induction medium consisted of MS medium with half strength major and minor salts (Murashige and Skoog, 1962), 400mg L-1 glutamine, 50 mg L-1 myoinositol, 0.5mg L-1 nicotinic acid, 0.5 mg L -1 pyridoxine, 0.1mg L-1 thiamine HCl, 60g L-1 sucrose, 9.5M 2,4-D and 7 g L-1 of agar. The pH was adjusted to 5.8 with KOH and sterilized at 121oC at 1.1 kg cm-1 for 20 min. Maintenance of Embryogenic Cultures Cultures were transferred to fresh medium every 3 weeks and were maintained on semi solid induction medium for 12 weeks. Following the induction of PEMs they were transferred to 40 ml liquid medium of the sa me composition in 125ml Erlenmeyer flasks. Flasks were sealed with aluminum foil and Parafilm. Cultures were maintained for 8 weeks at 125 rpm. Co-cultivation of Embryogenic cultures with Agrobacterium tumefaciens Embryogenic cultures maintained as suspen sion in liquid induction medium were used for co cultivation. Fifteen mg of au toclaved carborundum was added to each flask and the flasks were vortexed for 30 sec to w ound the tissue. Two ml of the concentrated Agrobacterium culture was added to the flasks and was co-cultivated with the embryogenic cultures in the dark for three days at 25oC.

PAGE 122

107 Growth and Development of Transformed Embryogenic Cultures Following three days of cocultivation, the embryogenic cultures were washed with liquid MS basal medium containing 600mg L-1 carbenicillin and 100 mg L-1 cefotaxime to remove the bacteria. Embryogenic cultures were then transferred to a glass Petri plate containing autoclaved Kimwipes for 30 min and then transferred to 125 ml Erlenmeyer flasks containing 35 ml liquid induction medium with 600mg L-1 carbenicillin and 100 mg L-1 cefotaxime for two weeks. Embryogenic cultures were periodically tested for the presence of the bacteria by removing 1ml of the liquid culture medium and plating it on nutrient agar medium . The plates were obser ved for regrowth of bacteria after 24 h. The medium was replaced at weekly intervals. Following two weeks, the cultures were transferred to semi so lid induction medium containing 600 mg L-1 carbenicillin, 100 mg L-1 cefotaxime and 300mg L-1 kanamycin sulfate. The cultures were grown on the medium for four weeks and then transferred to semi solid induction media containing the same concentration of antibio tics. After four week s the cultures were transferred to somatic embryo development medium. The development medium consisted of induction medium without growth regulators and containing 600 mg L-1 carbenicillin, 100 mg L-1 cefotaxime and 150mg L-1 kanamycin sulfate. Germination and Plantlet Development After three weeks well developed cotyledona ry stage embryos were transferred to germination medium. The germination medium consisted of MS major and minor salts, MS organics 30g L-1 sucrose, 100mg L-1 myoinositol, 28.9 M giberellic acid (GA3) and 4.41M benzyladenine (BA). Germinating somatic embryos were transferred to baby food jars containing germination medium without growth regulators and 50mgL-1 kanamycin sulfate for plantlet development. E ach plantlet showing normal rooting in the

PAGE 123

108 selection medium was considered as an individual line. The plan tlets that failed to root in the selection medium were disc arded. The plantlets were then transferred to Magenta G-7 boxes containing MS basal medium with 200mg L-1 activated charcoal for further development. DNA Extraction The germinated seedlings from putativel y transformed cultures for CBF 1 and CBF 3 were used for extraction of genomic DNA using the cetyltrimethylammonium bromide (CTAB) method (Clark et al., 1989). Five g of plant tissu e was ground to a fine powder in a mortar and pestle using liquid nitrogen (L N). The contents were then transferred to 50 ml falcon tubes to which 12 ml of CTAB buffer was added. The buffer consisted of 3% CTAB, 1.4 M NaCl, 0.2% -mercaptoethanol, 100mM EDTA, 100mM Tris HCl, 2% polyvinylpyrrolidone (PVP) and 3% polyvinylpo lypyrrolidone (PVPP). The tubes were incubated at 65oC in a water bath for 30 min with occasional inversion. The contents of the Falcon tubes were then di stributed equally to micro centrifuge tubes. Following 30 min incubation, 1.2ml of phenol: chloroform (1:1 v/v) mixture was added to the tubes and was mixed by gentle inversion of the tubes. The tubes were then centrifuged at 12,000 rpm (16,000g) at room temperature for 10 min in an Eppendorf 5417R centrifuge (Brinkmann). The aqueous phase was transferre d to new 3ml microcentrifuge tubes using a wide bore pipette tip. An equal volume of chloroform:isoamyl alcohol (24:1 v:v) mixture was added to the tubes with gentle swirling. The tubes were then centrifuged at 12,000 rpm for 10 min. The aqueous phase was th en transferred to new microcentrifuge tubes. Two-third volume of cold isopropanol was then added to the tubes and mixed gently to precipitate the nucleic acids. Th e tubes were centrifuged again at 12,000 rpm for 10 min. The supernatant was discarded and th e pellet was suspended in 1.0 ml wash

PAGE 124

109 buffer. The wash buffer consisted of 7.5M a mmonium acetate with 76ml of ethanol with the final volume made to 100 ml with ster ile deionized water. The tube was then centrifuged at 12,000rpm for 10 min and the su pernatant was removed to dry the DNA pellet. The pellets for all th e tubes were pooled and were resuspended in 100L water. The same procedure was followe d for extraction of DNA from A. thaliana which was used as a positive control. RNAse Treatment and DNA Purification A volume of 2L DNA was taken for all th ree samples and dissolved in 13L of deionized sterile water, and the sample wa s run on a 0.8% agarose gel at 70V for 1h to determine the purity of the DNA extracted. A vol ume of 3M sodium acetate equal to 10% of the total DNA volume was added to micro centrifuge tubes containing the extracted DNA. An equal volume of 95% ethanol (Molecu lar Biology grade, Sigma Chemicals, St Louis, MO) was added to the tubes. This was followed by addition of 4L of RNAse A enzyme to the tubes. The tubes were then centrifuged at 10,000rpm for 15 min. Following centrifugation, the microcentr ifuge tubes were incubated at 4oC for 30 min. The supernatant solution was discarded and th e precipitate was washed with 70% chilled ethanol. The ethanol was carefu lly removed and the pellet wa s allowed to dry. This was followed by another wash of 95% chilled etha nol and the procedure was repeated. After complete evaporation of the ethanol the pell et was resuspended in 50L deionized sterile water. A sample of 2L was dissolved in 13 L water and the sample was run on a 0.8% agarose gel at 70V for 1 h to ve rify purity after RNAse treatment. Restriction Enzyme Digest ion for Designing Probe The pBluescript SKharboring the CBF 1, CBF 2 and CBF 3 (Figure 5-2) was isolated from E. coli and treated with restriction enzymes (Fisher Scientific) to confirm

PAGE 125

110 the presence of the gene inserts. The enzy mes used for restriction digestion depended on the restriction sites in which the inserts were cloned and have been described in Table 5-1 Table 5-1. Restriction enzymes and digesti on conditions for CBF 1, CBF 2 and CBF 3 No Insert Restriction sites Buffer used Digestion conditions 1 CBF 1 Xba I and Xho I Buffer D 37oC for 3h 2 CBF 2 ECoR I Buffer H 37oC for 1h 3 CBF 3 Eco R I Buffer H 37oC for 1h Five L of plasmid DNA was mixed with 1L of the respective restriction enzymes and buffer, 1L of bovine serum albumin (BSA ), 3L of 6X loading dye and the final volume was made to 15L with nuclease-fr ee water in a microcentrifuge tube. The contents were briefly spun in a table top centrifuge at 2,000 rpm for 30 sec and incubated in a water bath at the appropr iate temperature and time for digestion. The contents were then loaded on a 0.8% agarose gel. The gel was run at 70V for 1h and then photographed. The quality of the plasmids and the cutting e fficiency of the restriction enzymes were analyzed from the gel picture. Synthesizing the Probe for Southern Blot Hybridization The digested products from the above reacti on were used as templates to synthesize a probe. The digoxigenin (DIG) labeling kit (R oche Diagnostics) was used to label the probe. The labeling procedure was carried out using PCR. An alkalilabile digoxygenin molecule was incorporated into the dUTP (ur acil triphosphate) molecule of the nucleotide triphosphates (dNTP) mixture and was supplie d with the kit. The labeled dNTPs were mixed with the unlabeled dNTPs in a proporti on of 1:3. This mixture was used to label the probe while the unlabeled dNTPs were used to amplify the template DNA as a negative control. The template DNA was diluted to a concentration of 20pg L-1 and used

PAGE 126

111 in the PCR reactions. The final volume used fo r the reactions was 50 L. All the reactions were run in an Eppendorf thermal cycler (Sakai et al ., 1988). The PCR components and reaction conditions for the reactions have b een described in Table 5-2. The primers for the CBF 1 and CBF 3 template DNA were synthesized (Integrated DNA Technologies, Coralville IA) and cycle condi tions were determined for eac h set of primers from the Tm(melting temperature) and the GC(Guanosin e Cytosine) content of the primers. The cycle conditions have been desc ribed in Table 5-3 and Table 5-4. Restriction Enzyme Di gestion of Genomic DNA The genomic DNA from the putatively tr ansformed tissue was digested with restriction enzymes for the purpose of Southe rn blot analysis. The restriction enzymes were selected after studying a simulation rest riction enzyme analysis using Gene Tools software. All commercial restriction enzyme s were selected to run the simulation gel analysis and restriction maps of the sequences were obtained. The enzymes which did not digest the sequences anywhere along the leng th of the sequence were selected to allow binding of the probe to an undigested target. The restriction maps for the CBF 1 and CBF 3 sequences are presented in Figure 5-3. Th ree restriction enzymes EcoRI, Sau3AI and BamHI (Promega) did not cut the sequence an ywhere along its length and were further tested to determine the cutting efficiency of the enzymes on the genomic DNA. TwoL of genomic DNA was mixed with 1L of enzyme, 1L of buffer and 1L of BSA and the final volume was made to 15 L with nucleas e free water in a microcentrifuge tube. The contents of the tube were briefly spun at 2,000 rpm for 30 sec in a table top centrifuge and then incubated for 4h in a water bath at 37oC.

PAGE 127

112 Figure 5-2. Restriction map of CBF 1 in pBluescript SKTable 5-2. PCR components and concen trations used for probe labeling. No Reagent Volume(L) Labeled product Volume(L) unlabeled product Final concentration 1 PCR buffer 5 5 2 dNTP+DIGdNTP 5 200uM 3 dNTP 5 200uM 4 Forward primer 5 5 1uM 5 Reverse primer 5 5 1uM 6 Taq enzyme 0.75 0.75 0.04units L-1 7 Template DNA 2L 2L 20 pg L-1 8 Water 27.25 27.25 Total 50 50

PAGE 128

113 Table 5-3. Primer sequences for selective amplification of CBF 1 and CBF 3.template DNA No Template DNA Primer sequence 1. CBF 1 (F)5`-CCTTATCCAGTTTCTTGAAACAGAC-3` (R)5`-CGAATATTAGTAACTCCAAAGCGAC-3 2 CBF 3 (F)5`-CCTTATCCAGTTTCTTGAAACAGAC-3 (R) 5’GACCATGAGCATCCGTCGTCATATGAC-3’ Table 5-4. Cycle conditions for selective am plification of CBF 1 and CBF 3 template DNA No Denaturation time and temp Denaturation Annealig Primer exte nsion Final extension Number of cycles CBF 1 2mins@95oC 1min@94oC 45sec@ 50.5oC 45 secs@72oC 5mins@72oC 50 CBF 3 5 mins@95oC 1min@94oC 1min@50oC 1min@72oC 5mins@72oC 50 Analysis of Digested Products The digestion products were analyzed on a 0.8% agarose gel. 5L of the digested sample was mixed with 3L of 6X loading dye and the final volume was made to 15L in a microcentrifuge tube. The contents were briefly spun and loaded on the gel. The gel was run at 55V for 2h to ensure total separa tion of digested DNA fragments. The gel was then photographed. The digestion reac tions were analyzed visually. A Figure 5-3. A. Restriction enzyme analysis for CBF 1 sequence using Gene Tools B. Restriction enzyme analysis for CBF 3 sequence using Gene Tools (Biotools, 2003)

PAGE 129

114 B Figure 5-3. Continued Restriction Digestion of Ge nomic DNA for Southern Blot Based on the above reaction, Sau3AI show ed uniform cutting of genomic DNA and was used for the Southern blot reaction. The concentration of genomic DNA was estimated from the gel picture (after ex traction of genomic DNA) by comparing the bands of genomic DNA with the standard markers. An amount of DNA equivalent to 1g was mixed with 1L of the restricti on enzyme, 2L buffer and 2L BSA and the final volume was made to 19L with nucleasefree water. The conten ts were briefly spun at 2,000 rpm for 30 sec and then incubated at 37oC for 4h. After 4h an additional 1L of enzyme was added and the contents were incubated overnight at 37oC. After the digestion period, 2L of the sample of digested produc ts was mixed with 3L of 6X loading dye. The final volume was made to 15L with nuc lease-free water and the samples were run on a 0.8% agarose gel at 60 V for 2 h. The gel was photographed in a gel documenting unit and the efficiency of the enzyme was determined by visual observation. The entire remaining volumes of digested products were run on a 0.8% agarose gel at 35V for 4h to ensure uniform separation of digested fragments.

PAGE 130

115 Depurination and Denaturation of Genomic DNA on the Agarose Gel The gel was transferred to a plastic contai ner and soaked in 100ml of 0.1N HCl for 10 min. The gel was transferre d to another container and 100 ml 0.5N NaOH/ 1.5M NaCl was added to the container. The gel was then gently shaken in the solution for 10 min at room temperature. The solution was discar ded and the procedure was repeated for 10 min. The gel was washed with 100ml distilled water for 30 sec. The water was discarded and the gel was washed two times for 10 mi n with 100 ml of 1M Tris (pH 7.4) 1.5M NaCl mixture. The gel was shaken gently during the whole process. Capillary Transfer of Genomic DNA to Nylon Membrane A set of eight blotting pads and two wick ing pads were used for the capillary transfer process. A blotting pad was placed at the bottom of a plastic box and was saturated with 20 mL of 20X SSC buffer. A ny air bubbles trapped between the base of the box and the pad were removed by gen tly massaging the pad. A piece of wicking paper was placed squarely over the saturate d blotting pad and air bubbles were removed. The gel was placed on the wicking paper, w ith the DNA side up. Any air bubbles trapped between the wicking paper and the gel were removed. A positively charged nylon membrane was selected for transfer of DNA and the upper end of the membrane was marked with a ball point pen to indicate th e orientation of the membrane. The membrane was handled using forceps to avoid devel opment of background noise. The membrane was placed on the gel carefully and all the ai r bubbles trapped between the membrane and the gel were carefully removed to ensure complete contact of the gel with the membrane. A piece of wicking paper was placed on th e nylon membrane and seven blotting pads were placed on the wicking paper. The lid of the plastic box was inverted and was placed on the blotting pads. Approximately 200 g (60 ml water in a 100 ml bottle) was placed in

PAGE 131

116 the middle of the lid and transfer of DNA fr om the gel to the membrane was allowed overnight. Cross Linking of DNA with Nylon Membrane The blotting pads and wicking paper was carefully removed and the nylon membrane was transferred to a clean plasti c container. 100 ml of 5X SSC buffer was added to the container and the container was sh aken gently on a rotatory shaker for 5 min at room temperature. The membrane wa s removed and placed on clean Whatman 3MM paper. The membrane was left on the paper to allow the excess SSC to be absorbed. The paper was placed in a Biorad UV cross linker. The membrane was then subjected to ultraviolet light for 150 sec to allow covale nt bond formation between the membrane and the DNA. Checking Transfer Efficiency of the Gel The blotted gel was stained with ethi dium bromide for 10 min. The gel was photographed in a gel documentation unit and th e picture was used for checking transfer efficiency of DNA from the gel to the nylon membrane. Prehybridization and Hybridization of the Nylon membrane: The labeled probe was added to the hybridi zation solution at a concentration of 2L per ml of hybridization solution. The temp erature for the hybridization reaction was calculated from the properties of the probe. Th e properties of the probe were determined by importing the sequence of the probe from PubMed website (Accession number AF074603). The sequence was analyzed with Ge ne Tools software (Biotools, 2003) for its chemical properties. The sequence had a leng th of 902 base pairs ( bp), a GC density of 43.9% and an AT density of 56.1%. The temp erature for the hybrid ization reaction was calculated from the following equation:

PAGE 132

117 Tm= 49.82+ 0.41 (% G+ C) (600/L) = 49.82 + 041 (43.9) – (600/902) Where Tm= Melting temperature of the sequence L= length of the sequence The hybridization temperature was calculated using the equation: Topt = Tm20 to -25oC. Where Topt= optimum temperature. The hybridization temperature for the probe was calculated as 41oC from the above equation. The nylon membrane was carefully ro lled and transferred to a 50 ml Falcon tube. Ten ml of hybridization solution (Roche Diagnostics) was added to the Falcon tube. The tube was placed in a hybridization oven and was rotated at 30 rpm for 15 min at a temperature of 41oC. Twenty l of the probe was adde d to the tube and hybridization was carried out overnight at 41oC. Detection of the DIG Labeled Probe The hybridization solution was discarded from the Falcon tube and the nylon membrane was washed using a DIG Wash a nd Block Buffer Set (Roche Diagnostics). Fifteen ml Wash A solution was added to th e tube and was rotate d in a hybridization oven at 30 rpm for 5 min at room temperature. The procedure was repeated with a second wash for 5 min. The Wash A solution was then discarded and 15 ml Wash B was added to the tube. The tube was then rotate d in a hybridization oven at 30 rpm at 55oC for 15 min. The solution was discarded and the proc edure was repeated 2X. The membrane was then removed from the Falcon tube with a pair of forceps and was tr ansferred to a clean plastic container. Twenty ml Buffer I was added to the container and was incubated at room temperature for 1 min. The Buffer I solution was then discarded and 20 ml Blocking solution was added. The container was shaken for 30 min at room temperature.

PAGE 133

118 An antibody solution was prepared by mixing 1.5L of the DIG antibody in 15 ml Blocking solution. The Blocking solution wa s discarded and the antibody solution was added to the container. The container was sh aken for 30 min at room temperature. The antibody solution was discarded and the membra ne was washed three times with 20 ml Buffer 1 at room temperature for 15 min each time with gentle agitation. After three washes the Buffer I soluti on was removed and the membrane was washed with 20 ml Detection Buffer for 2 min. The chemillumines cent substrate (CDP Star) provided with the kit was diluted to a ratio of 1:3 (v/v) with distilled wa ter and transferred to a spray bottle. The membrane was then transferred to a clean Whatman Filter Paper (3MM) and was sprayed with the diluted subs trate at the rate of 0.25 ml/ 100 cm2. Exposing and Developing the Membrane on a Film The membrane was then transferred to a pl astic wrap and sealed on all four sides. The membrane was transferred to an auto radiography cassette and taken to the dark room. An Xray film was placed on top of the membrane and the cassette was sealed tight to allow for development of the film. The film was allowed to develop for 20 min and then processed in a Kodak film processor. The processed film was analyzed by visual observation. Results Embryogenic cultures of papaya cultivar ‘Sunrise Solo’ were co-cultivated with Agrobacterium cultures harboring the binary vector pGA 643. The binary vector had the CBF 1, CBF 2 and CBF 3 inserts cloned into it along with the npt II gene as a selectable marker for kanamycin sulfate resistance. The embryogenic cultures were grown on induction medium containing kanamycin sulf ate for selection of transformed cells. Somatic embryo development occurred on maturation medium which consisted of

PAGE 134

119 induction medium without growth regulators. Cotyledonary stage somatic embryos were transferred to germination media for germina tion of somatic embryos and plantlets were obtained. The plantlets were rooted in MS basal medium containing 50mg L-1 kanamycin sulfate. Tissue from the putatively transf ormed seedlings was used for DNA extraction and further molecular analysis of transfor mants was done by Southern blot hybridization. Isolation and Evaluation of Plasmid DN A harboring the CBF 1, 2 and 3 Sequences A very high yield of pure pl asmid DNA was obtained (Figure 5-4). The size of the plasmid DNA and the insert was confirmed and it was greater than the 10kb molecular maker used in the run along with the cons tructs. The purity of the DNA made it suitable for use in the electroporation protocol. Figure 5-4. Agarose gel electrophoresis anal ysis of plasmid pGA 643 harboring the sequences CBF 1, CBF 2 and CBF 3. Lane 11kb molecular marker Lane 2pGA 643 harboring CBF 1 sequence Lane 3 pGA 643 harboring CBF 2 sequence Lane 4pGA 643 harboring CBF 3 sequence

PAGE 135

120 Confirmation of Binary Construct into Agrobacterium by Agarose Gel Electrophoresis The pGA 643 binary vector harboring th e CBF sequences was transferred into Agrobacterium and the success of the electropora tion procedure was confirmed by reisolating the plasmid from Agrobacterium and analyzing it on a gel. Agarose gel electrophoresis analysis indicated that the electroporation protocol was successful and that the plasmid was integrated into Agrobacterium cells without any plasmid rearrangements or deletions. This was conf irmed by the size of the plasmid DNA which corresponded to a size beyond the 10kb marker (Figure 5-5). Thus the transformed Agrobacterium cells were found to be suitable for use in co-cultivation experiment. Figure 5-5. Isolation of plasmid pGA 643 har boring CBF sequences as a positive control before use for co-cultivation Lane 1pGA 643 harboring CBF 1 sequence Lane 2pGA 643 harboring CBF 2 sequence Lane 3pGA 643 harboring CBF 3 sequence Lane 41kb marker (The smear in front of each lane indicates the RNA from Agrobacterium )

PAGE 136

121 Co-cultivation and Growth of Embryogenic Cultures Embryogenic cultures were co-cul tivated in suspension with Agrobacterium for three days and then transfe rred to liquid selection medium containing antibiotics. The growth of cultures in the induction medium wa s extremely slow compared to the control cultures and bleaching of PEMs was observed which was followed by browning of dead cells. Growth of the bacteria wa s however, inhibited at 600 mg L-1 carbenicillin and 100mgL-1 cefotaxime and clean cultures could be obtained in the presence of these antibiotics (Figure 5-6). Em bryogenic cultures resistant to kanamycin sulfate in the selection medium were observed in cultures co-cultivated with CBF 1 and CBF 3. No growth of cultures was observed in those co-cultivated with CBF 2 and browning of cultures was observed which was similar to the control non transformed embryogenic cultures grown on selection medium. The growth of embryogenic cultures appeared to be faster when they were transferre d from medium containing 300 mg L-1 kanamycin sulfate to 150 mg L-1 kanamycin sulfate. Asynchronous de velopment was observed when the PEMs were transferred to ma turation medium. Somatic embryos germinated normally when transferred to semi solid germination medium. Figure 5-6. Growth (A) and development (B ) of embryogenic cultu res on selection medium following co-cultivation with Agrobacterium harboring CBF 1, 2 and 3 constructs. Germination of somatic embryos (C) on germination medium containing 150mgL-1 kanamycin sulfate

PAGE 137

122 Plantlet Development The putatively transformed shoots were tr ansferred to test tubes containing MS basal medium containing MS major and minor salts, MS organics, 100mg L-1 myoinositol, 30g L-1 sucrose with 50 mg L-1 kanamycin sulfate for rooting and later transferred to glass bottles containing the sa me media. A low percentage of rooting was observed among the shoots transferred to the se lection medium for rooting (Table 5-5). A total of 43 shoots were obtained from cultu res transformed with CBF 1 while 51 shoots were obtained from cultures transformed with CBF 3. Each plantlet was considered to be an individual transgenic line (Figure 5-7). Table 5-5. Total number of shoots, plantlets and plantlet conversion in cultures transformed with CBF 1, CBF 2 and CBF 3 constructs. No Construct Total number of shoots Total number of plantlets Conversion percentage 1 CBF 1 43 9 20.00 2 CBF 2 0 0 00.00 3 CBF 3 51 11 21.56 Figure 5-7. Developing shoot (A) and rooted plantlet (B) in MS basal medium containing 50 mg L-1 kanamycin sulfate

PAGE 138

123 Restriction Enzyme Digestion for ProbeSynthesis The quality of the plasmid DNA harbor ing the CBF inserts and the cutting efficiency of the restriction enzymes was an alyzed visually. The size of the plasmid was confirmed by the size of the corresponding mol ecular marker (Figure 5-8). The restriction enzymes gave a clean cut of the inserts and were suitable for use in synthesizing the probe. The plasmid concentration of th e CBF 2 construct and the subsequent concentration of the insert was found to be ex tremely low and could not be used for probe synthesis. Figure 5-8. Restriction enzyme digestion of pBluescript SKharboring CBF inserts Lane 11 kb marker Lane 2CBF 1 digested with restriction enzymes Xba I and Xho I Lane 3CBF 2 digested with restriction enzyme EcoR I Lane 4CBF 3 digested with restriction enzyme Eco R I Analysis of Labeled Probe us ing Agarose Gel Electrophoresis The CBF 1 and CBF 3 inserts obtained by restri ction enzyme digestion were used in the PCR reaction for obtaining a labeled pr obe. To confirm the incorporation of the DIG-UTP label into the amplified sequence, the amplification products were run on a

PAGE 139

124 0.8% agarose gel at 70V for 1h and the ge l was photographed (Figure 5-9). No PCR amplification product was obtained when the CBF 1 sequence was used as a template DNA in the labeling reaction as well as in the negative control wh ere unlabeled dNTPs were used for the reaction. T hus, the purity of the template DNA was not high enough to allow amplification of the sequence. In the reaction where CBF 3 was used as a template for PCR reaction, amplification products were observed in both th e labeling reaction and the control reaction. The labeled and unlabeled products migrated as separate bands on the electrophoresis gel. A slight difference in size of the bands was observed between the labeled and unlabeled products. This shift in th e size of the labeled pr oduct was attributed to the incorporation of the DIG-dUTP into the amplified product. The DIG molecule is reported to be a non-polar molecule with a high molecular weight (Roche Diagnostics, 2002) and incorporation of this molecule in to the amplified product led to change in molecular weight and a subsequent shift in the size of the labeled product. An additional confirmation of the success of the labeling reaction was noted by observing a change in yield of the amplified products. The labeled pr obe had a slightly lower yield compared to the control amplification product and was attri buted to the incorporation of the labeled dUTP into the amplified sequence. Figure 5-9. Analysis of labeled prob e using agarose gel electrophoresis

PAGE 140

125 Lane 11 kb molecular marker Lane 2CBF 1 sequence amplification using labeled dNTP’s Lane 3CBF 1 sequence amplificati on using non labeled (control) dNTP’s Labe 4CBF 3 sequence amplification using labeled dNTP’s Lane 4CBF 3 amplification us ing non labeled (control) dNTP’s Restriction Enzyme Di gestion of Genomic DNA Based on the simulated restriction enzyme an alysis of the probes using Gene Tools, three enzymes were used for preliminar y analysis of genomic DNA digestion. The enzymes Sau3AI, Eco RI and BamHI did not cu t the probe anywhere along its length and hence were selected for digestion of ge nomic DNA of the transformed shoots. The digestion products were analyzed on a 0.8% agarose gel. (Figure 5-10). Among the different enzymes, the most uniform cutting was obtained when Sau 3AI was used as the enzyme for digestion and a uniform smear of DNA was obtained following digestion. Figure 5-10. Analysis of digested geno mic DNA from CBF 1 and CBF 3 transformed tissue using restriction enzymes Sau 3AI, Eco RI and Bam HI. Lane 1CBF 1 transformed genomic DNA digested with Sau 3AI Lane 2CBF 3 transformed genomic DNA digested with Sau 3AI Lane 3CBF 1 transformed genomic DNA digested with Eco RI Lane 4CBF 3 transformed genomic DNA digested with Eco RI Lane 5CBF 1 transformed genomic DNA digested with Bam HI Lane 6CBF 3 transformed genomic DNA digested with Bam HI

PAGE 141

126 In the case of the other two enzymes, clean cutting was not obtained and high molecular weight DNA was still observed at the base of the wells where the samples were initially loaded. In contrast, no hi gh molecular weight DNA was observed in the lanes in which Sau 3AI was used and this enzyme was chosen for digestion during the Southern blot reaction. Checking Transfer Efficiency of Gel fo llowing Blotting with Nylon Membrane Following the digestion of genomic DNA from putatively transformed tissue, the gel was blotted with a nylon membrane overnig ht for capillary transfer of the digested DNA to the nylon membrane. The gel was then photographed to check the transfer efficiency (Figure 5-11). A comparison of th e gel pictures before and after capillary transfer indicated that the DNA was comple ted transferred to the nylon membrane. No DNA fragments were observed on the gel follo wing capillary transfer except for very high molecular weight DNA, thus confirming successful transfer. Figure 5-11. Checking transfer efficiency of DNA from gel to nylon membrane (B) following digestion of genomic DNA w ith restriction enzyme Sau 3AI (A)

PAGE 142

127 Confirmation of Southern Blot The nylon membrane was exposed to Xra y film and developed in a Kodak film processor. The different washes were found to be efficient as evinced by the lack of any background signal following film developing (Figure 5-12). Figure 5-12. Analysis of the probed DNA on the nylon membrane after exposure to Xray film Lane 1Genomic DNA from tissue transformed with CBF 3 Lane 2Genomic DNA from tissue transformed with CBF 1 Lane 3Genomic DNA from Arabidopsis thaliana as a positive control Among the genomic DNAs used from the putat ively transformed tissue, a single band was observed in the A. thaliana genomic DNA which was used as a positive control. Similarly, a single band of approximately 900 bp corresponding to the positive control was observed in the tissue obtained from seed lings transformed with CBF 1. With tissues transformed with CBF 3, three bands were observed with sizes varying from 500 bp to 900 bp, thus indicating that multiple copies of the gene were present in this tissue. The amount of template DNA loaded was extremel y high as very dense bands were observed in the film. The picture confirmed the integr ation of the CBF 1 and the CBF 3 transgene

PAGE 143

128 into the genome of the papaya tissue. A dditional bands were observed in the positive control. These bands were presumed to be the probe binding to the endogenous CBF 1 and CBF 2 sequences which may be present at some other pos ition on a different chromosome in Arabidopsis . The CBF 3 probe was used to detect the presence of CBF 1 transgene in genomic DNA obtained from CBF 1 transformed seedlings and it successfully detected the presence of the CBF 1 transgene. Discussion Embryogenic cultures induced from hypocotyl s sections of papaya ‘Sunrise Solo were transformed with CBF 1, CBF 2 and CBF 3 gene constructs using Agrobacterium tumeficiens . The embryogenic cultures were gr own on induction medium containing kanamycin sulfate for selection of transfor med cells. Somatic embryos developed from the cultures and plants were regenerated. The molecular analysis of plantlets by Southern blot hybridization confirmed th e presence of the transgene. Embryogenic cultures were resistant to 300 mg L-1 kanamycin sulfate and proliferation of PEMs occurred at this level of antibiotic. However, compared to the proliferation of tissue, the final number of s hoots that were resistant to kanamycin sulfate was extremely low. The differential exposure of the tissue to sele ction agent may have caused proliferation of non transformed cells. Mathews et al. (1992) indicated that the initial presence of few transformed sectors in mango PEM appeared to alter the overall tolerance of cultures to kana mycin sulfate, resulting in the continued growth of non transformed cells in selection medium containi ng inhibitory levels of kanamycin sulfate. As a result, a mixture of transformed a nd non-transformed, and chimeral proembryos were formed at 200mg L-1 kanamycin sulfate sulfate on semi solid medium. Similar results were observed in Vitis (Mullins et al., 1990), where non tr ansformed buds were

PAGE 144

129 found to grow on high levels of kanamycin su lfate sulfate. In a vocado, Cruz-Hernandez et al, (1998) reported transformed, non transforme d and partially transformed (chimeral) avocado proembryonal masses in the presence of 50mg L-1 kanamycin sulfate sulfate. In citrus, a high number of escapes was obt ained when kanamycin sulfate sulfate at 100mgL-1 was used as a sele ction agent (Moore et al., 1992) and it was suggested that kanamycin sulfate sulfate was not a reliabl e selective agent for transformation. Pena et al. (1995) reported 91.2 % escapes in cultures maintained on 100 mg L-1 kanamycin sulfate in citrus transformation st udies. It was suggested that such escapes arise from non transformed cells that are protected from the selective agent by transformed cells in the culture (Dandekar et al., 1988). Another factor that could lead to more escapes is the inherent capacity of the tissues to resist ka namycin sulfate. This has been reported in walnut (Dandekar et al., 1988) and walnut in c ontrast to other crops which show extreme sensitivity (Yepes and Aldwinckle, 1994) where embryo tissues were resistant to kanamycin sulfate, possibly due to the pr esence of endogenous non-specific neomycin phosphotransferase activity. A solution to this problem could be to expose the tissue to higher levels of kanamycin sulfate imme diately following co -cultivation with Agrobacterium . However, such a step might drastic ally reduce the numbe r of transformed events recovered since only those with a high proportion of transformed cells would withstand selection pressure (Mathews et al., 1998). In earlier ge netic transformation studies with papaya, Fitch et al. (1990) obtained transgenic plantlets after culturing embryogenic cultures on induc tion media containing 150mg L-1 kanamycin sulfate for one year; however abnormal plantlets were obt ained due to long exposure of the cultures to 2,4-D. The inclusion of kanamycin sulfate sulfate in the rooti ng medium appears to effectively eliminate escapes and can thus be considered quite reliable. Another

PAGE 145

130 alternative would be to use antibiotics lik e parmomycin and genticin which are more effective and have the same mode of action as kanamycin sulfate (Seabra and Pais, 1999). There were few transgenic lines (9 in case of CBF 1 and 11 in case of CBF 3) compared to the amount of embryogenic tissu e that was cocultivated. This could be attributed to low transformation efficiency and loss in embryogenic pot ential of the tissue due to prolonged exposure to 2,4-D in the induction/select ion medium. Fitch et al. (1993) obtained only two putatively transgenic li nes from 13 g fresh weight of embryogenic cultures. In other transf ormation studies, Cheng et al. (1996) obtained 15 transgenic lines following Agrobacterium -mediated transformation; however Cai et al (1999) obtained 83 transgenic lines using Agrobacterium -mediated transformation. These differences might also be attributed to a cultivar-specific embryogenesis response. No transformed cultures were obtained with constructs harboring the CBF 2 insert. A change in sequence of the gene or arrangement during plasmid isolation or electroporation could have caused non func tionality of the construct following cocultivation. The deletion of a single base pair from the se quence at any time during the construct manipulation might have caused a ch ange in sequence, thereby leading to non functionality of the construct. Thus, it is always desirable to sequence the insert after each manipulation during the isolati on and transformation process. The CBF 3 sequence was used as a probe to detect the presence of the CBF 1 and CBF 3 transgene. The CBF 2 and CBF 3 se quences are known to share a homology of 88% and 90% with the CBF 1 sequence (Gilmour, personal communication) and hence a single probe was recommended for use. The prob e detected a single copy of the transgene in tissues obtained from cultures transformed with the CBF 1 construct while three copies of the transgene were detect ed in tissues obtained from cultures transformed with the

PAGE 146

131 CBF 3 construct. The number of copies of the transgene in the genome could have an effect on the subsequent synthesis of tran script and protein by the transgene. The presence of multiple copies of transgenes is known to cause transcriptional and post transcriptional gene silencing (Matzke et al., 1994). Genetic transformation events have been known to involve the integration of multiple copies (Jorgensen et al., 1996). It has long been known that T-DNA does not always integrate into the plant genome as a simple unique copy event (Jorgensen et al., 1996). In Citrus , Cervera et al. (2000) analyzed transgenic plants for transg ene copy number and reported 35% of the transformants had more than one copy of th e transgene and the number varied from one to six copies. They also reported that copy number of the transgene was negatively correlated with the amount of transgenic protein produced by the plants. Miguel and Oliveira (1999) observed the in tegration of two copies of transgenes in transformation studies with almond; however, the transgenic plants were consistent in the production of the GUS protein. Similarly Fitch et al. (1993) obtained transgenic papaya plants with two copies of the transgene which showed a weak npt II activity. In grap efruit transformation studies, Luth and Moore (1999) detected one to three copies of the GUS transgene and attributed the loss of staining ability in some transformants to gene silencing. This type of gene silencing has been termed as cis-inac tivation silencing (Mat zke and Matzke, 1994). The presence of multiple copies of transgenes is widely believed to trigger gene silencing (Matzke et al., 1994) and in some cases a transgene homologous to an endogenous gene may suppress expression of both genes through co-suppression (Napoli et al., 1990). It would thus be interesting to see whether th e primary papaya transformants with multiple copy insertions produce a transcript or are silenced due to multiple copies of the transgene.

PAGE 147

132 Southern blot hybridization demonstrated the incorporation of the CBF 1 and CBF 3 transgene into the papaya genome. An importa nt factor to be considered is whether the transgenic plants produce any CBF proteins or not. The CBF proteins are synthesized in response to low temperatures (Jaglo-Ottosen et al., 1998). CBF polypeptides bind to the C repeat/ DRE DNA regulatory element in th e promoter region of the COR genes and activate these genes. (Stockinger et al., 1997). CBF1 overexpression induced COR gene expression without a low temper ature stimulus. Thus, the actual increase in freezing tolerance is brought about by expressing the battery of COR genes and the CBF genes simply activate the transcri ption of these COR genes. The CBF3 gene is known to activate multiple components of the cold acclimation process in response to low temperatures (Gilmour et al., 2000). Thus, for the CBF genes to be functional in papaya there must be a cold acclimation signaling mechanism and the down stream genes in the signaling pathway which are activated in re sponse to the CBF protein. We know from earlier studies that papaya does not possess any CBF ort hologs and so it would be interesting to study which genes if at all would be activated in response to the transgenic protein. Fowler and Thomashow (2002) showed in microarray st udies that a total of 306 genes were regulated in response to low temp eratures along with the CBF genes. It is possible that the CBF protein might regulate other genes that are present in papaya. A similar response was obtained by Heish et al. (2002) who observed that the CBF 1 transgene activated the transc ription of the CAT 1 gene en coding for catalase synthesis. Kasuga et al. (1999) in over expression studies with CBF 1 in Arabidopsis , reported that transgenic plants showed severe retardati on in growth and a reduction in the number of seeds produced. Such results were not observed by JagloOttosen et al., (1998) who described similar studies with Arabidopsis or by Heish et al, (2002) who over expressed

PAGE 148

133 CBF 1 in tomato. The transgenic papaya plan tlets do not show any retarded or abnormal growth patterns at the time of writing. A cl ear idea regarding the growth habit of the plants would be obtained when further mol ecular analysis like Northern and Western blotting are performed to check for transcript and protein levels. If regenerants are found to be positive for production of the transcripts and proteins they coul d be tested for their response to low temperatures unde r laboratory and field conditions. Conclusions Transgenic papaya plantlets were regenerated by the embryogenic pathway following transformation of embryogenic culture s with gene constructs harboring a CBF 1, and CBF 3 gene sequence together with th e npt II gene as a selectable marker. The primary transformants were confirmed for th e presence of the transgene in the genome by Southern blot hybridization.

PAGE 149

134 CHAPTER 6 SUMMARY AND CONCLUSIONS Summary In this study, presence and mechan ism of cold acclimation pathway in Carica and Vasconcella genomes was studied. Studies were also conducted with genetic transformation and cryopreservation of embryogenic papaya cultures. Carica and Vasconcella genomic DNA was probed for the presence of any cold inducible sequences sim ilar to those found in Arabidopsis thaliana . Gene specific and degenerate primers were designed based on the sequences of the CBF genes cloned from Arabidopsis . The CBF gene family is known to i nduce the cold acclimation pathway in Arabidopsis and they function as tran scriptional factors for activ ation of cold tolerance genes . PCR was used to amplify DNA sequences. The amplification results indicated the possibility of some cold-inducible sequences in genomic DNA of Vasconcella but not in Carica genomic DNA. Sequence analysis result s with BLAST showed a homology of the amplified sequences with genomic DNA of Arabidopsis and with the CBF genes; however, the translated protein sequen ce did not show homology indicating the possibility of a different functional pathway in Vasconcella . Papaya embryogenic cultures were transf ormed with CBF constructs. The plasmid pGA 643 harbored the CBF 1, 2 and 3 sequences along with a npt II gene for kanamycin resistance under the control of the Ca MV 35S promoter. Transformed embryogenic cultures were maintained and selected in liquid and on semi solid medium supplemented

PAGE 150

135 with 300mg L-1 kanamycin sulfate. Plantlets were regenerated from embryogenic cultures and the integration of the transgene was confirmed by S outhern blot hybridization. Cryopreservation of embryogenic cultures at different stages, i.e., embryogenic cell masses, proembryonic masses (PEMs) and soma tic embryos was studied using slow and fast cooling methods along with different cryoprotectant combinations. Glycerol, DMSO and polyethylene glycol were used in differe nt combinations. In the slow cooling method, cryoprotectants were mixed with 200mg embr yogenic cultures in 1.2 ml cryo vials. The vials were then inserted in a Nalgene Mr. Frosty containing 250 ml isopropanaol and placed in a-80oC freezer for 2 h. for slow cooling, where the temperature decreased to 1oC min-1. The vials were then removed a nd plunged into liquid nitrogen (-196oC). The fast cooling method involves the use of loading and vitrification solutions, and direct immersion into liquid nitrogen. 200 mg embryogenic cu ltures were transferred to a 1.2 ml cryo vial and 1.0 ml st erile loading solution was a dded. Following an incubation period of 20 min, the loading solution was discarded and replaced with the PVS 2 solution. The vials were incubated on i ce and then plunged into liquid nitrogen. The vials were removed from liquid nitrogen after 48 h and thawed in a water bath for 2 min at 37oC. Following thawing, the cultur es were plated on semi solid induction medium. Growth of embryogenic cultures, somatic embryo development and plantlet regeneration were studied. PEMs used in comb ination with vitrifica tion and fast cooling resulted in excellent regrowth and regeneration of plantlets. Conclusions PCR was used to detect the presence of cold-inducible sequences in Carica and Vasconcella genomic DNA using gene specific and degenerate primers. Amplification

PAGE 151

136 results indicated the possibility of the presences of such sequences in Vasconcella but not in Carica . Embryogenic papaya cultures were used fo r genetic transformation with CBF gene constructs using Agrobacterium . Kanamycin sulfate resistant embryogenic cultures were obtained and plantlets were regenerated following somatic embryo development. Presence of the transgene was demonstrat ed using Southern blot hybridization. Different cryoprotectants and tissue stages we re used in combination with slow and fast cooling to determine the optimum tim e, cryoprotectants and method of cooling. PEMs in combination with vitrification and fast cooling produced maximum regrowth and recovery of plantlets following cryopr eservation. No differences were observed between non frozen control and vitrificati on treatment with respect to somatic embryo development and plantlet recovery.

PAGE 152

137 APPENDIX A SEQUENCE INFORMATION Sequence information for PCR amplificat ion products using primer pair P1 A. Forward primer: TGCTATTCCATCACAAGCACAGCGCCATATATTGGCAGGATTGGCCTCGGCTGTGGGTGGATT GAGTGCACCATATGAAAAGGTTTCTCATGTGC ATGAGAGGCCTGTTATGAATTGGCTCTGGGC AACAGGTTGTCATCCGTTTGGACCATTTTCTAAT GCTTCTCTGATCAGTCAAATGCTTCAGGAT GTCNCTTTGGAGTTACTAATATTC. B. Reverse primer: CATGCTATTCCATCACAAGCACAGCGCCATATATTGGCAGGATTGGCCTCGGCTGTGGGTGGA TTGAGTGCACCATATGAAAAGGTTTCTCATGTGCATGAGAGGCCTGTTATGAATTGGCTCTGG GCAACAGGTTGTCATCCGTTTGGACCATTTTCT AATGCTTCTCTGATCAGTCAAATGCTTCAGG ATGTCGCTTTGGAGTTACTAATATTCGA Sequence information for PCR amplification products using degenerate A. Forward primer: CATTTGACTGATCAGAGAAG CATTAGAAAATGGTCCAAACG GATGACAACCTGTTGCCCAGA GCCAATTCATAACAGGCCTCTCATGCACATGA GAAACCTTTTCATATGGTGCACTCAATCCAC CCACAGCCGAGGCCAATCCTGCCAATATATGGCGCTGTGCTTGTGATGGAATAGCATGCCTTC TCTCTGTTTCAAGAAACTGGATAAGG B. Reverse primer TTTGACTGATCAGAGAAG CATTAGAAAA TGGTCCAAACGGATGAC AACCTGTTGCCCAGAGC CAATTCATAACAGGCCTCTCATGCACATGAG AAACCTTTTCATATGGTGCACTCAATCCACCC ACAGCCGAGGCCAATCCTGCCAATATATGGCGCTGTGCTTGTGATGGAATAGCATGCCTTCTC TC TGTTTCAAGAAACTGGATAA GGATGTGGCTCTTTGG Sequence information obtained for PCR am plification products with primer P4 A Forward primer: TATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGG GTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCG CAAATTACCCAATCCTGACACGGGGAGGTAGCGACAATAAATAACAATACCGGGCTCTTCGA GTCTGGTAATTGGAA

PAGE 153

138 B. Reverse Primer: GCGCATCGCCGACAGTAGGGACGAACCGACCG GTGCACACCATAGGCGGACCGGCCGACCCA ACCCAAGGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGA ATTACCGCGGCTGCTGGCACCA GACTTGCCCTCCAATGGATGC TCGTTAAGGGATTTAGATTG TACTCATTCCAATTACCAGACTCGAAGAGCCC GGTATTGTTATTTATTGTCGCTACCTCCCCGT GTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGT

PAGE 154

139 APPENDIX B RESPONSE OF EMBRYOGENIC CULTURES TO KANAMYCIN SULFATE Induction and Maintenance of embryogenic cultures: Embryogenic cultures of papaya cultivar ‘Sunrise Solo’ were induced from hypocotyls and maintained as suspension cultures as described earlier. Testing embryogenic cultures for kanamycin sulfate sensitivity: Early stage embryogenic cultures 60 days after induction from hypocotyls were selected for the studies. Five different levels of kanamycin sulfate, 100, 200, 300, 400 and 500mg L -1, were used along with a positive cont rol with no kanamycin sulfate in the media. The stock solutions we re prepared by dissolving kanamycin sulfate in deionized water followed by filter sterili zation through a 0.2m Multipore filter. The induction medium was autoclaved and the kanamycin sulfate solution was added to the medium after cooling to 55oC. The medium (300mg plate-1) was then poured into 60 X 15 mm Petri plates. Each Petri plate was consider ed a replication and each treatment had ten replications. Embryogenic cultures were transferred to fresh medium containing kanamycin sulfate every two weeks. Changes in fresh weights of cultures were recorded at two week interval. The number of cultu res showing PEMs for each treatment was also recorded. The data was analyzed at 5% confidence levels using SAS. Testing of PEM Sensitivity to Different levels of Kanamycin Sulfate: The concentration at which the embryogeni c culture prolifera tion was completely inhibited was used as the highe st treatment level in suspensi on cultures. Liquid induction medium was autoclaved at 121oC and 1.1kg cm-2 and poured into sterile autoclaved 50 ml

PAGE 155

140 conical flasks. 300 mg of PEMs were added to the 15 ml medium and the antibiotic solution was mixed with the medium. The culture s were transferred to fresh medium after every two weeks and changes in fresh weight s of cultures were r ecorded. The level at which growth of embryogenic cultures wa s inhibited was standardized from the observations. Results Growth of embryogenic Cultures on Kana mycin Sulfate 60 days after induction Days 020406080100120 Fresh weight 0.0 0.2 0.4 0.6 0.8 1.0 1 2 3 4 5 6 Figure B-1. Changes in fresh weights of embryogenic cultu res at 30, 60, 90 and 120 days on varying levels of kanamycin sulfate 1 Positive control with no kanamycin; 2 100 mg L-1; 3 200 mg L-1; 4 -. 300 mg L-1; 5 400 mg L-1; 6 500mg L-1 Proliferation of PEMs The maximum proliferation in PEMs was observed in the posi tive control (100%) followed by 70% at 100mg L-1 and 20% at 200mgL-1 of kanamycin sulfate. No proliferation was observed in cultures contai ning kanamycin sulfate at concentrations of

PAGE 156

141 300 mg L-1 and higher. Kanamycin sulfate at 300mg L-1 was the level that inhibited the growth and proliferation of PEMs.

PAGE 157

142 LIST OF REFERENCES Ammirato, P. 1974. The effect of abscisic ac id on the development of somatic embryos from cells of caraway ( Carum carvi L.). Bot. Gaz., 135:328-337. Ammirato, P. 1985. Patterns of development in culture. In: Henke R.R., Hughes K.W., Constantine M.J. and Hollaender A. (e ds). Tissue Culture in Forestry and Agriculture. Plenum Press, New York, pp.9-29. Ammirato, P. 1987. Organizational event duri ng somatic embryogenesis. In: Green CE, Somers D.A., Hacket W.P. and Biesboer D.D. (eds). Plant Tissue and Cell Culture. A.R. Liss, New York, pp 57-81. Aguilar, A.E., Engelmann, F., MichaudFerrire, N. 1993. Cryopreservation of cell suspensions of Citrus deliciosa Tan. and histological study. Cryo-Letters, 14:217228. Alberdi, M., Corcuera, L.J. 1991. Cold Acclim ation in Plants. A review., Phytochemistry, 30: 3177-3184. Althoff, M.A., Carmona, R. 1999. Storage of papaya ( Carica papaya L.) seedsCaricaceae. Rev. Brasil Semen., 21: 151-156. Altschul, S.F., Madden, T.L., Schffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nuclei c Acids Res., 25: 3389-3402. Anderson, J.V., Li, Q.B., Haskell, D.W., G uy, C.L. 1994. Structural organization of the spinach endoplasmic reticulum-luminal 70kilodalton heat-shock cognate gene and expression of 70-kilodalton heat-shock genes during cold acclimation. Plant Physiol., 104:1359-70. Aradhya, M.K., Manshardt, R.M., Zee. F., Morden, C.W. 1999. A phylogenetic analysis of the genus Carica L. (Caricaceae) based on restri ction fragment length variation in a cpDNA intergenic spacer region. Genet. Res. Crop Evol., 46: 579-586. Artus, N.N., Uemura, M., Steponkus P.L., G ilmour, S.J., Lin, C.T., Thomashow, M.F. 1996. Constitutive expression of the cold-regulated Arabidopsis thaliana COR15a gene affects both chloroplast and protoplas t freezing tolerance. Proc. Natl. Acad. Sci. USA, 93:13404.

PAGE 158

143 Ashmore, S., Azimi, M., Drew, R.A. 2001. Cryopreservation trials in Carica papaya . Acta Hort., 560:117-120. Ashworth, E.N., Pearce, R.S. 2002. Extracellu lar freezing in leaves of frost-sensitive species. Planta, 214:798-805. Ashworth, E.N., Abeles, F.A. 1984. Freezing be havior of water in small pores and the possible role in the freezing of pl ant tissues. Plant Physiol., 76:201-204. Atree, S., Fowler, L.C. 1991. Micropropa gation through somatic embryogenesis in conifers. In Bajaj, Y.P.S. (ed.) Biotechnology in Agricu lture and Forestry, Vol 17, Springer, pp 53-70. Aung, L.H., Buss, G.R., Crosby, K.E., Brow n, S.S. 1982. Changes in hormonal levels soybean fruit during ontogeny. Phyton, 45: 182-185. Aykroyd, W.R. 1951. The Nutritive Value of Indian foods and the Planning of Satisfactory Diets, Govt. Of India Res., New Delhi Bachiri, Y.C., Gazeau, J., Hansz, C., Mo risset, P., Dereuddre, J. 1995. Successful cryopreservation of suspensi ons cell by encapsulation-dehydration. Plant Cell Tiss. Org. Cult., 43: 241-248. Badillo, V.M. 1971. Monografia de la Familie Caricaceae. Associacion de Profesores, Universidad Central de Venezuela, Maracay, Venezuela. Badillo, V.M. 1983. Caricaceae. In: Harling G. and Sparre B. (eds.). Flora of Ecuador No. 20. Gteborg University, Gteborg, Sweden. pp 48. Badillo, V.M. 1993. Caricaceae. Segundo Esquema. Revista de la Facultad de Agronoma de la Universidad Central, Alcan ce 43. Maracay, Venezuela. pp 111. Badillo, V.M., Van den Eynden, V., Van Damme, P. 2000. Carica palandesis (Caricaceae), a New Species from Ecuador. Novon, 10: 4-6. Bajaj, Y.P.S. 1995. Cryopreservation of plan t cell, tissue, and organ culture for the conservation of germplasm and biodiversit y,. In: Bajaj, Y.P.S. (ed.). Biotechnology in Agriculture and Forestry 32: Cryopres ervation of Plant Germplasm-1, Springer Verlag, pp. 7-27. Baker, S.S., Wilhelm, K.S., Thomashow, M.F. 1994. The 5'-region of Arabidopsis thaliana cor15a has cis-acting elements that confer cold-, droughtand ABAregulated gene expression. Plant Mol. Biol., 24: 701-713. Bellucii, M., Marchis, F., De Mannucci, R., Arcioni, S. 2003. Jellyfish green fluorescent protein as a useful reporter for transient expression and stable transformation in Medicago sativa . Plant Cell Rep., 22: 328-337.

PAGE 159

144 Benson, E.E. 1990. Free Radical Damage in St ored Plant Germplasm. IBPGR, Rome. Benson, E.E., Hamil, J.D. 1991.Cryopreservation and post freeze molecular and biosynthetic stability in transformed roots of Beta vulgaris and Nicotiana rustica . Plant Cell Tiss. Org. Cult., 24: 163-171. Benson, E.E., Lynch, P.T., Jones, J. 1995. The use of the iron chelating agent desferrioxamine in rice cell cryopreser vation: a novel approach for improving recovery. Plant Sc., 110: 249-258. Benson, E.E., Noronha-Dutra, A.A. 1988. Chemiluminescence in cryopreserved plant tissue cultures: the possibl e involvement of singlet oxygen in cryoinjury. CryoLetters, 9: 120-137. Biotools Inc. 2003. Gene Tools and Pep Tools, 114th St. Edmenton, Alberta, Canada, T6G2E1. Birch, R.A. 1997. Plant Transformation: Pr oblems and Strategies for Practical application. Annu. Rev. Plant Phsiol . Plant Mol. Biol., 48: 297-326. Bose, T.K., Mitra, S. K. 1990. Papaya. In Bo se T.K. and Mitra S.K. (eds.) Fruits: Tropical and SubTropical, Noya Prakash, pp. 304-335. Boyer, S. 1982. Plant productivity and environment. Science, 218: 443-448. Bray, E.A. 1997. Plant responses to water deficit. Trends Plant Sci, . 2: 48-54. Buchheim, J.A., Colburn, S.M., Ranch J. P. 1989. Maturation of soybean somatic embryos and the transition of plantle t growth. Plant Physiol., 89: 761-768. Button, J., Kochba, J., Bornman, C.H. 1974. Fi ne structure and embryoid development from embryogenic ovular callus of ‘Shamouti’ orange ( Citrus sinensis Osb.). J Exp. Bot., 25: 446-457. Cai, W., Gonsalves, C., Tenna nt, P., Fermin, G., Sounz, M. Jr., Sarinadu, N., Jan, F.Y., Zhu, H.Y. 1999. A protocol for efficien t transformation and regeneration of Carica papaya L. In Vitro Cell Dev. Biol., 35: 61-69. Cao, J. 1992: Regeneration of herbicide resi stant transgenic rice plants following microprojectile-mediated transformation of suspension culture cells. Plant Cell Rep., 11:586-591. Cardenas, 1989. National Research Council. Manual de Plantas Economicas de Bolivia Ed. Los Amigos del Libro, La Paz: pp. 333. Castillo, B., Smith, M.A.L., Yadava, U.L. 1998. Plant regeneration from encapsulated somatic embryos of Carica papaya L. Plant Cell Rep., 17:172-176.

PAGE 160

145 Cervera, M., Pina, J.A., Juarez, J., Navarr o, L., Pena, L. 2000. A broad exploration of a transgenic population of ci trus: stability of gene e xpression and phenotype. Theor. Appl. Genet., 100:670-677. Chaudhury, E., J. Radhamani, and K.P.S. Chandel. 1991. Preliminary observations on the cryopreservation of desiccated embryogenic axes tea [ Camellia sinensis (L.) O. Kuntze]. Cryo-Letters, 12:31-36. Cheng, Y.H., Yang, J.S., Yeh, S.D. 1996. Effi cient transformation of papaya by coat protein gene of papaya ri ngspot virus mediated by Agrobacterium following liquidphase wounding of embryogenic tissues with carborundum. Plant Cell Rep., 16:127-132. Chay-Prove, P., Ross, P., O'Hare, P., Macle od, N., Kernot, I., Evans, D., Grice, K., Vawdrey, L., Richards, N., Blair, A., Astridge, D. 2000. Agri link Series: Your Growing Guide to Better Farming. Papaw Information Kit. Queensland Horticulture Institute and Department of Primary Industries, Qld, Australia Chen, M.H., Chen, C.C. 1992. Plant regeneration from Carica protoplasts. Plant Cell Rep., 11:404-407. Chen, M.H., Chen, C.C., Wang, D.N., Ch en, F.C. 1991. Somatic embryogenesis and plant regeneration from immature embryos of Carica papaya X Carica cauliflora cultured in vitro. Can. J. Bot., 69:1913-1918. Chen, M.H., Wang, P.J., Maeda, E. 1987 .Som atic embryogenesis and plant regeneration in Carica papaya L. tissue cultured derived root explants. Plant Cell Rep., 6:348351. Chinnusamy, V., Ohta, M., Kanrar, S., Lee, B.H., Hong, X., Agarwal, M., Zhu, J.K. 2003. ICE1: a regulator of cold-induced tr anscriptome and freezing tolerance in Arabidopsis . Genes Dev., 17:1043. Cho, E.G., Horr, Y.L., Kim, H.H., Rao, V. R., Engelmann, F. 2001. Cryopreservation of Citrus madurensis zygotic embryonic axes by v itrification: importance of pregrowth and preculture conditi ons. Cryo-Letters, 22:391-396. Choi, D.W., Rodriguez, E.M., Close, T.J. 2002. Barley CBF 3 gene identification, expression pattern, and map location . Plant Physiol., 129:1781-1787. Christianson, M.L. 1985. An embryogenic culture of soybean: toward a general theory of somatic embryogenesis. In: Henke, R.R., Hughes, K.W., Constantine. M.J. and Hollaender, A. (eds). Tissue Culture in Forestry and Agriculture. Plenum Press, New York. pp. 83-103. Christianson, M.L. 1987. Causal events in mo rphogenesis. In: Green, C.E., Somers, D.A., Hackett, W.P. and Biesboer, D.D. (eds). Plant Tissue and Cell Culture. A.R. Liss, New York. pp.44-45.

PAGE 161

146 Clark, M.S., Gu, H.Y., Qu, L.J.1989. Plant Mo lecular BiologyA Laboratory Manual (Chinese translation) in DNA Purifica tion from Polysaccharide Rich Cells. Protocols in Protozoology, D-31. Conger, B.V., Hovanesian, J.C., Trigia no, R.N., Gray, D.J. 1989. Somatic embryo ontogeny in suspension cultures of or chard grass. Crop Sci., 29: 448-452. Cossio, F. 1989. Babaco. Edizioni Calder ini Edagricole, Bologna, Italy, pp. 60. Cruz-Hernandez, A., Witjaksono, Li tz R.E., Gomez-Lim, M. 1998. Agrobacterium tumefaciens -mediated transformation of embryogenic avocado cultures and regeneration of somatic embr yos. Plant Cell Rep., 17: 497-503. Dandekar, A.M., Martin, L.A., McGranah an, G.H. 1988. Genetic transformation and foreign gene expression in walnut tissue . J. Amer. Soc. Hort. Sci., 113: 945-949. Davis, S.J., Vierstra, R.D. 1998. Soluble, high ly fluorescent variants of green fluorescent protein (GFP) for use in higher pl ants. Plant Mol. Biol., 36:521-528. De Jong, A.J., Schmidt, E.D.L., De Vries, S.C. 1993. Early events in higher-plant embryogenesis. Plant Mol. Biol., 22: 367-77. De Vries, S.C., Booij, H., Meyerink, P., Huisman, G., Wilde, D., Thomas, T.L., Van Kammen, A. 1988. Acquisition of embryogeni c potential in carrot cell-suspension cultures. Planta,176: 196-204. DeBruijne, E., De Langhe, E., van Rijck, R. 1974. Actions of hormones and embryoid formation in callus cultures of Carica papaya . In: International Symposium on Crop Protection. Fytopharmacie en Fytiatrie Rijkslandsbouwhoogeschool Medelelingen, 39:637-645. Dereuddre, J. 1992. Cryopreservation of in vitro cultures of plant cells. 1992. Cryopreservation of in vitro cultures of plant cells and organs by vitrification and dehydration. In , Datte, Y., Dumas, C. and Gallais, A. (eds.). Reproductive Biology and Plant Breeding, Springe r Verlag, Berlin, pp. 291-300. DeWald, S.G., Litz, R.E., Moore, G.A. 1989. Maturation and germination of mango somatic embryos. J. Amer. Soc. Hort. Sci., 114:837-84. Dijak, M., Smith, D.L., Wilson, T.J., Brow n, D.C.W. 1986. Stimul ation of direct embryogenesis from mesophyll protoplasts of Medicago sativa . Plant Cell Rep., 5: 468. Dodeman, V.L. 1995. Comparison des Embryogene sses Zygotique et Somatique Chez la carotte ( Daucus carota .L.). Identification et Inducti on de Proteins de Maturation. Thesse de Doctorat de l’Un iversite de Paris-XI, Orsay.

PAGE 162

147 Dodeman,V.L., Ducreux, G., Kreis, M. 1997. Zygotic embryogenesis versus somatic embryogenesis. J. Expt. Bot., 313: 1493-1509. Drew, R.A. 1988. Rapid clonal propagation of papaya in vitro from mature field grown trees. HortSci., 23:609-611. Drew, R.A. 1992. Improved techniques for in vitro propagation and germplasm storage of papaya. HortSci., 27:1122-1124. Drew, R.A., Smith, N.G. 1986. Growth of ap ical and lateral buds of paw paw ( Carica papaya L.) as affected by nutritional and hor monal factors. J. Hort. Sci., 61:535543. Drew, R.A., McComb, J.A., Considine, J. A. 1993. Rhigogenesis and root growth of Carica papaya in vitro in relation to auxin sens itive phases and use of riboflavin. Plant Cell Tiss. Org. Cult., 33:1-7. Drew, R.A., Miller, R.M. 1984. Nutritional and cultural fact ors affecting rooting of papaya ( Carica papaya L.) in vitro. J. Hort.Sci., 64:767-773. Drew, R.A., O’Brien, C.M., Magdalita, P.M. 199 8. Development of interspecific hybrids. Acta. Hort., 461:285-290. Drew, R.A., Simpson, B.W., Osborne, W.J. 1991. Degradation of exogenous indole 3butyric acid and riboflavin a nd their influence on rooti ng response of papaya in vitro. Plant Cell Tiss. Org. Cult., 26:29-34. Drew, R.A., Vogler, J.N., Magdalita, P.M., Mahon, R.E., Persley, D.M. 1995. Application of biotechnology to Carica papaya and related species. Current issues in Plant Molecular a nd Cellular Biology, 321-326. Dudits, D, Bogre, L., Gyorgyey, J. 1991. Mo lecular and cellular approaches to the analysis of plant embryo development from somatic cells in vitro. J. Cell Sci., 99: 475. Dumet, D., Berjak, P., Engelmann, F. 1997. Cryopreservation of zygotic and somatic embryos of tropical species producing reca lcitrant or intermediate seeds. In Conservation of Plant Genetic Resources In Vitro Vol. 1, Razdan M.K. and Cocking E.C. eds., M/S Science, USA, pp. 153-174. Dumet, D., Engelmann, F., Chabrillange, N., Duval, Y. 1993. Cryopreservation of oil palm ( Elaeis guineensis Jacq.) somatic embryos invol ving a desiccation step. Plant Cell Rep., 12: 352-355. Duran-Villa, N. 1995. Cryopreservation of germ plasm of citrus. In: Y.P.S. Bajai (ed.). 1995. Biotechnology in agriculture and fore stry 32: Cryopreservation of plant germplasm 1, Springer Verlag, pp. 70-86.

PAGE 163

148 Dussert, S., Mauro, M.C., Engelmann, F. 1992. Cryopreservation of grape embryogenic cells suspensions. 2: Influence of post-th aw culture conditions and application to different strains. Cryo-Letters, 13: 15-22. Dussert, S., Chabrillange, N., Vasquez, N., Engelmann, F., Anthony, F., Guyot, A. Harmon, S. 2000. Beneficial effect of post-thawing osmoconditioning on the recovery of cryopreserved coffee ( Coffea arabica L.) seeds. Cryo-Letters, 21: 4752. Ebert, A., Taylor, H.F. 1990. Assessment in the changes of 2,4-dichlorophenoxy acetic acid concentration in tissue culture media in the presence of activated charcoal. Plant Cell Tiss.Org. Cult., 20: 165168. Efendi, D. 2003. Cryopreservation and Tr ansformation of Embryogenic Avocado Cultures. Ph.D. Dissertation, Univer sity of Florida, Gainesville. Eichholtz, D.A., Robitaille, H.A., Hasega wa, P.M. 1980. Adventive embryony in apple. HortSci., 14: 699-700. El Moussaoui, A., Nijs, M., Paul, C., Wintje ns, R., Vincentelli, J., Azarkan, M., Looze Elliot, A.R., Campbell, J.A., Dugdale, B., Brettell, R.I.S., Grof, C.P.L. 1999 Greenfluorescent protein facilitate s rapid in vivo detection of genetically transformed plant cells. Plant Cell Rep., 18: 707-714. El Moussaoui, A., Nijs, M., Paul, C., Wintje ns, R., Vincentelli, J., Azarkan, M., Looze, Y. 2001. Revisiting the enzymes st ored in the laticifers of Carica papaya in the context of their possible pa rticipation in the plant defense mechanism. Cell Mol. Life Sci., 58: 556-570. Ellis R.E., Hong, T., Roberts, E.H .1990. An intermediate category of seed storage behavior in. coffee. J. Exp. Bot., 41:1167-74. Engelmann, F. 1991. In vitro conservation of tropical plant germplasm A Review. Euphytica, 57: 227-243. Engelmann, F. 1994. Cryopreservation for the lo ng-term conservation of tropical crops of commercial importance. In: Proceedings of the International Symposium on the Application of Plant In Vitro Technology, 16th18th Nov., Univ. Pertanian Malaysia, Selangor, pp. 64-77. Engelmann, F. 1997. In vitro Conservation Methods. In Ford–Lloyd, B.V., Newbury, J.H., and Callow, J.A. (eds.). Biot echnology and Plant Genetic Resources: Conservation and Use, CABI, Wellingford, pp. 119. Engelmann, F. Etienne, H. 1995. Cryopres ervation of embyogenic calli of Hevea brasiliensis . In: Jain, S. M., Gupta, P. K. and Newton, R. J. (eds.). Somatic Embryogenesis in Woody Plants, Vol. 6, Kluwer Acad. Publ. Dordrecht, pp. 729746.

PAGE 164

149 Engelmann, F., Dumet, D., Chabrillange, N ., Abdelnour-Esquivel, A., Assy-Bah, B., Dereuddre, J., Duval, Y. 1995. Cryopreserva tion of zygotic and somatic embryos from recalcitrant and intermediate-seed species. Plant Genet. Res. Newsl., 103:2731. Escobar, R.H., Mafla, G. Roca, W.M. 1997. A methodology for recovering cassava plants from shoot tips maintained in liquid nitrogen. Plant Cell Rep., 8: 474-478. Etienne, H. 1991. Water status of callus from Hevea brasiliensis during induction of somatic embryogenesis. Physiol. Plant., 82:213-218. Evans, D.A., Bravo, J.E. 1983. Plant protoplasts isolation and culture . In: Giles KL (ed) International Review of Cytology Suppl 16: Plant Protoplasts. Academic Press, New York. pp. 33. Evquoz N., 1990. Premiers Rsultats d’un Essa i de Culture de Babaco. Revue Suisse Vitic. Arboric. Hortic., 22: 137-141. Fahy, G.M., McFarlene, D.R., Angell, G.A., Meryman, H.T. 1994. Vitrification as an approach to cryopreserva tion. Cryobiol., 21: 407-442. FAO Statistics. 2003. http:www: fa ostat. Accessed March, 2004. Fernando, J.A., Melo, M., Marli, K.M.S., Appezzato-da-Gloria, B. 2001. Anatomy of somatic embryogenesis in Carica papaya L. Brazilian Archives of Biology and Technology, 44: 247-255. Fitch, M.M., Manshardt, R.M.1990. Somatic embryogenesis and plant regeneration from immature zygotic embryos of papaya ( Carica papaya ). Plant Cell Rep., 9: 320-324. Fitch, M. M., Manshardt, R. M., Gonsalves, D., Slinghtom, J. L., Sanford, J. C. 1990. Stable transformation of papaya via mi croprojectile bombardment. Plant Cell Rep., 9: 189-194 Fitch, M.M. 1993. High frequency somatic embr yogenesis and plant regeneration from papaya hypocotyl callus. Plant Cell Tiss. Org. Cult., 32:205-212. Fitch, M.M., Manshardt, R. M., Gonsalves, D., Slinghtom, J. L. 1993. Transgenic papaya plants from Agrobacterium -mediated transformation of somatic embryos. Plant Cell Rep., 12: 245-249. Fitch, M.M., Terry, L., Saito, N., Yamamoto, G. Dela Cruz, A., Ye h, Aileen, W., White, S., Maeda, S.H., Ferreira, S., Moore, P. 2003. Photoautotrophic rooting and growth of papayas in vitro Abs # 572. Annual Me eting of American Society of Plant Biologists Plant Biology, Ju ly, 25-30, Honolulu, Hawaii.

PAGE 165

150 Fowler, S., Thomashow, M.F. 2002. Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell, 14: 1675-1690. Galiba, G., Quarrie, S.A., Sutka, J., Mo rounov, A., Snape, J.W. 1995. RFLP mapping of the vernalization (Vrn1) a nd frost resistance (Fr1) ge nes on chromosome 5A of wheat. Theor. Appl. Genet., 90:1174-79. Garrett, A. 1995. The Pollination of Papaw ( Carica papaya ) in Central Queensland. PhD Thesis, Central Queensland Universit Garrettn , Rockhampton. Gazeau, C., Bellny, M., Elleuch, H., David, A., Morisset C. 1998. Cryopreservation of transformed Papaver somniferum cells. Cryo-Letters, 19: 147-159. Ghorbel, R., Juarez, J., Navarro, L., Pe a, L. 1999. Green fluorescent protein as a screenable marker to increase the efficien cy of generating transgenic woody fruit plants. Theor. Appl. Genet., 99:350-358. Gibson, S., Arondel, V., Iba, K., Somerville, C. 1994. Cloning of a temperature-regulated gene encoding a chloroplast omega-3 desaturase from Arabidopsis thaliana . Plant Physiol., 106:1615-21. Gilmour, S.J., Hajela, R.K, Thomashow, M.F. 1988. Cold acclimation in Arabidopsis thaliana . Plant Physiol., 87:745-750. Gilmour S.J., Seblot, A.M., Salazar, M.P., Everard, J.D., Thomashow M.F. 2000. Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with co ld acclimation. Plant Physiol., 124: 18541865. Gilmour, S.J., Zarka, D.G., Stockinger, E. J., Salazar, M.P., Houghton, J.M., Thomashow, M.F. 1998. Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J., 16:433-42. Gnanapragasam, S., Vasil, I.K. 1992. Cryopreservation of immature embryos, embryogenic callus and cell suspension cu ltures of gramineous species. Plant Sci., 83:205-215. Gonsalves, D. 1998. Control of papaya ri ngspot virus in papaya: A case study. Annu. Rev. Phytopathol., 36:415-437. Gonzales-Arnao, M.T., Engelmann, F., Urra, F.C., Morenza, M., Rios. A. 1998. Cryopreservation of citrus apices using the encapsulation-dehydration technique. Cryo-Letters, 19:177-182. Gray, D.J. 1987. Quiescence in monocotyle donous and dicotyledonous somatic embryos induced by dehydration. HortSci., 22: 810-814.

PAGE 166

151 Gray, D. J. 1995 Somatic embryogenesis and th e technology of synthetic seed. In Bajaj Y.P.S. (ed). Biotechnology in Agricultu re and Forestry Vol. 30, Somatic Embryogenesis and Synthetic Seed I. Springer-Verlag, Berlin, pp. 126-151. Gray, D.J., Compton, M.E. 1993. Grape somatic embryo dormancy and quiescence: potential of dehydrated synthetic se eds for germplasm conservation. In: Redenbaugh, K. (ed). Synseeds: Applic ation of Synthetic Seeds to Crop Improvement. CRC Press, Boca Raton, pp 367-379. Gray, D.J., Purohit, A. 1991. Somatic embryoge nesis and development of synthetic seed technology. Crit. Rev. Plant Sci., 10: 33-61. Gray, D.J., Conger, B.V. 1985. Influence of dicamba and casein hydrolysate on somatic embryo number and quality in cell suspensions of Dactylis glomerata (Graminae). Plant Cell Tiss. Org. Cult., 4:123-133. Gray, D.J., Conger, B.V. Songstad, D.D. 1987. Desiccated quiescent somatic embryos of orchardgrass for use as synthetic se eds. In Vitro Cell Dev. Biol., 23:29. Grout, B.W.W. 1990. In: Nijkamp, H.J., van der Plas L.H.W., van Aatrijek, J. (eds). Progress in Plant Cellular and Molecula r Biology , Kluwer Academics Publisher Dordrecht, The Netherlands, pp 13-22. Grout, B.W.W. 1995. Introduction to the in vitr o preservation of plant cells, tissues and organs. In: Grout, B. (ed.). Gene tic Preservation of Plant Cells in vitro . SpringerVerlag. Heidelberg, pp. 1-20. Gupta, P.K., Durzan, D.J., Finkle, B.J. 1987. Somatic embryogenesi s in embryogenic cell masses of Picea alba (Norway spruce) and Picea taeda (loblolly pine) after thawing from liquid nitrogen. Can. J. For. Res., 17: 1130-1134. Guy, C.L., Niemi, K.L., Brambl, R. 1985. Altered gene expression during cold acclimation of spinach, Proc. Natl. Acad. Sci. USA, 82:3673-3677. Haake, V., Cook, D., Riechmann, J. L., Pineda, O., Thomashow, M F.,Zhang, J . Z . 2003. Transcription Factor CBF4 Is a Re gulator of Drought Adaptation in Arabidopsis . Plant Physiol., 130: 639-648. Hajela R.K., Horvath, D.P., Gilmour, S.J., Thomashow, M.F. 1990. Molecular cloning and expression of COR (c old-regulated) genes in Arabidopsis thaliana . Plant Physiol., 93:1246-1252. Halperin, W. 1966. Alternative morphogenesis ev ents in cell suspensions. Amer. J. Bot., 53: 443-453.

PAGE 167

152 Hammoudah, M.M., Nir, S., Bentz, J., Mayhew, E., Stewart, T.P., Hui, S.W., R.J. Kurland.1981. Interactions of La3+ with phosphatidylse rine vesicles, binding, phase transition,leakage, 31P-NMR and fusion. Biochimical Biophysical Acta, 645:102-114. Hansen, G., Wright, M.S. 1999. Recent advances in the transformation of plants. Trends in Plant Sci., 4:226-231. Harman, J.E., 1983. Preliminary Studies on th e Postharvest Physiology and Storage of Babaco Fruit ( C. heilbornii Badillo nm. pentagona (H eilborn) Badillo). New Zealand J. Agric. Res., 26: 237-243. Harper, B.K., Stewart, C.N. Jr. 2000. Patterns of green fluorescent protein in transgenic plants. Plant Mol. Biol. Rep., 18: 141a i. Harper, B.K., Mabon, S.A., Leffel, S.M., Halfhill, M.D., Richards, H.A., Moyer, K.A., Stewart, C.N. Jr. 1999. Green fluorescent pr otein as a marker for expression of a second gene in transgenic plants. Nat. Biotechnol., 17:1125-1129. Haseloff, J., Siemering, K.R., Prasher, D.C ., Hodge, S. 1997. Removal of a cryptic intron and subcellular localizati on of green fluorescent prot ein are required to mark transgenic Arabidopsis plants brightly. Proc. Natl . Acad. Sci. USA, 94:2122-2127. Hayashi, H., Mustardy, L., Deshnium, P., Id a, M., Murata, N. 1998. Transformation of Arabidopsis thaliana with the cod a gene for choline oxidase accumulation of glycinebetaine and enhanced tolerance to salt and cold stress . Plant J., 12:133-142. Helliot, B., Panis, B., Poumay, Y., Sw ennen, R., Lepoivre, P., Frison, E. 2002. Cryopreservation for the elimination of cucu mber mosaic and banana streak viruses from banana ( Musa spp.). Plant Cell Rep., 20: 1117-1122. Holmburg, N. 1996. Metabolic Engineering: ApproachesTowards Improved Stress tolerance in microorganisms and plants. PhD thesis, University of Lund, Lund. Hong, B., Barg, R., Ho, T.H.D. 1992. Developmen tal and organ-specific expression of an ABAand stress-induced protein in barley. Plant Mol. Biol., 18: 663-674. Horovitz, S., Jimenez,H. 1967. Cruzameintos inte rspecificos intergenericos en Caricaceas ysus implcaciones fitotecnicas. Agron. Trop. (Maracay) 17:323-343. Houde, M., Dhindsa, R.S., Sarhan, F. 1992. A molecular marker to select for freezing tolerance in Gramineae. Mol. Gen. Genet., 234: 43-48. Hsieh, T.H., Lee, J.T., Yang, P.T., Chiu, L.H., Charng, Y.Y., Wang, Y.C., and Chan, M.T. 2002. Heterology expression of the Arabidopsis C-repeat/dehydration response element binding factor 1 gene conf ers elevated tolerance to chilling and oxidative stresses in transgen ic tomato. Plant Physiol., 129 : 1086-1094.

PAGE 168

153 Hudson, L.C., Chamberlain, D., Stewart, C.N. Jr. 2001. GFP-tagged pollen to monitor gene flow of transgenic plants. Mol Ecol Notes, 1:321-324. Hughes, M.A., Dunn, M.A. 1996. The molecula r biology of plant acclimation to low temperature. J. Exp. Bot., 47:291-305. Ingram, J., Bartels, P. 1996. The molecular ba sis of dehydration tolerance in plants. Ann. Rev. Pl. Phy. Pl. Mol. Biol., 47:377-403. Ishikawa, K., Harata, K., Mii, M., Sakai, A., Yoshimatsu, K., Shimomura, K. 1997. Cryopreservation of zygotic embryos of a Japanese terrestrial orchid ( Bletilla striata ) by vitrification. Pl ant Cell Rep., 16:754-757. Jaglo-Ottosen, K.R., Gilmour, S.J., Zarka, D.G., Schabenberger, O., Thomashow, M.F. 1998. Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science, 280:104-106. Jaglo-Ottosen, K.R., Kleff, S., Amundsen, K. L., Zhang, X., Haake, V., Zang, J.Z., Deits, T., Thomashow, M.F. 2001. Components of the Arabidopsis C-repeat/Dehydrationresponsive element binding factor cold -response pathway are conserved in Brassica napus and other plant species. Plant Physiol., 127 : 910-917. Jain, S., Jain, R.K., Wu, R. 1996. A simple and efficient procedure for cryopreservation of embryogenic cells of aromatic Indica rice varieties. Plant Cell Rep., 15:712-717. Janeiro, L.V., Vieitez, A.M., Ballester, A. 1996. Cryopreservation of somatic embryos and embryonic axes of Camellia japonica L. Plant Cell Rep., 15:699-703. Jarillo, J.A., Capel, J., Leyva, A., Martnez -Zapater, J.M., Salinas, J. 1994. Two related low-temperature-inducible genes of Arab idopsis encode proteins showing high homology to 14-3-3 proteins, a family of putative kinase regulators. Plant Mol. Biol., 25:693-704. Jimenez,H., Horovitz, S. 1958.Cruzabiladid en tre especies de Carica. . Agron. Trop. (Maracay), 7:207-215. Jobin-Decor M.P., Graham, G.C., Henry, R. J., Drew, R.A. 1997. RAPD and isozyme analysis of genetic relationships between Carica papaya and wild relatives. Genet. Res. Crop Evol., 44:471-477. Jordan, M., Ciudad, G., Rojas, M.L. Valver de, F.1986. Isolation, culture, and fusion of Carica candamarcensis and Carica papaya protoplasts. Gartenbauwiss., 51:175178. Jordan, M., Velozo, J. 1997. In Vitr o propagation of highland papayas ( C. pubescens and C. pentagona ). Acta Hort., 417:103-106.

PAGE 169

154 Jorgensen, R.A., Cluster, P.D., English, J., Que, Q., Napoli, C.A. 1996. Chalcone synthase cosuppression phenotypes in pet unia flowers: comparison of sense vs. antisense constructs and single-copy vs . complex T-DNA sequences. Plant Mol. Biol., 31: 957-973. Kartha, K.K. 1985. Cryopreservation of plan t cells and organs, CRC Press, Boca Raton, Florida. Kartha, K.K. Engelmann, F. 1994. Cryopreservation and germplasm storage. In: Vasil, I.K., Thorpe, T.A. (eds.). Plant Cell and Tissue Culture, Kluwer, Dordrecht, pp. 195-230. Kartha, K.K., Fowke, L., Leung, N., Caswell, K., Hakman, I. 1988. Induction of somatic embryos and plantlets from cryopreserve d cell cultures of white spruce ( Picea glauca ). J. Plant Physiol., 132: 529-539. Kasuga, M., Liu, Q., Miura, S., Yamaguc hi-Shinozaki, K., Shinozaki, K. 1999. Improving plant drought, salt, and freezing to lerance by gene transfer of a single stress-inducible transcripti on factor. Nat. Biotechnol., 17 : 287-291. Kawahara, R., Komamaine, A. 1995. Molecula r basis of somatic embryogenesis. In: Bajaj Y.P.S. (ed). Biotechnology in Agri culture and Forestry Vol. 30, Somatic embryogenesis and synthetic seed I. Springer-Verlag, Berlin, pp. 30-40. Kempler, C., Kabaluk, T., 1996. Babaco ( Carica pentagona Heilb.): A Possible Crop for the greenhouse. HortSci., 31: 785-788. Kendall, E.J., Qureshi, J.A., Kartha, K.K., Chevrier, N., Leung, N., Caswell, K. 1990. Regeneration of freezing tolerant spring wheat ( Triticum aestivum L.) plants from cryoselected callus. Plant Physiol., 94:1756-1762. Khan, M.S., Maliga, P. 1999. Fluor escent antibiotic resistance marker for tracking plastid transformation in higher plants . Nat. Biotechnol., 17:910-915. Khuspe, S., Hendre, R., Mascarenhas, A., Jagannathan, V., Thombre, M., Joshi, A. 1980. Utilization of tissue culture to isolate interspecific hybrids in Carica . In: Rao, P.S., Heble, M.R., and Chadha, M.S. (eds.). Pl ant Tissue Culture, genetic manipulation and somatic hybridization of plant cells. Proc Plant Tissue Culture, Genetic Manipulation, & Somatic Hybr idization of Plant Cells. Bhabha Atomic Research Center, Bombay, India, pp. 178-205. Kim, M. S., Moore, P. H. 2002. Genetic divers ity of Carica papaya as revealed by AFLP markers. Genome, 45: 503-512. Kitura, K.1967. Freezing and injuries of mulberry trees by late spring frost. Bull. Sericult. Exp. (Tokyo), 22:202-323.

PAGE 170

155 Kobayashi, S., Sakai, A., Oyama, I. 1990. Cryopreservation of cultured navel orange ( Citrus sinensis Obs) nucellar cells and subseque nt plant regeneration. Plant Cell Tiss. Org. Cult., 23: 15-20. Komamine, A., Matsumoto, M., Tsukahara, M., Fujiwara, A., Kawahara, R., Ito, M., Smith, J., Nomura, K., Fujimura, T. 1990. Mechanisms of somatic embryogenesis in cell cultures: physiology, biochemistry and molecular biology, In: Nijkamp Medford, J.I., Behringer, F.J., Callos, J. D., Feldmann, K.A.F. Progress in Plant Cellular and Molecular Biology , Kluwer Acad. Pub., Dordrecht, The Netherlands, pp. 307-313. Koster, K.L., Steponkus, P.L., Lynch, V. 1989. Solute accumulation during cold acclimation of rye. Plant Physiol., 89: S-26. Krikorian, A.D. 1995. Historical insights into some contempo rary problems in somatic embryogenesis. In: Jain, S.M., Gupta, P.K., Newton, R.J. (eds.). Somatic Embryogenesis in Woody Plants, Kluwer Acad. Pub., Dordrecht; Boston, pp. 1957. Krikorian, A.D. 1996. Strategies for "minimal growth maintenance" of cell cultures: a perspective on management for extende d duration experimentation in the microgravity environment of a space station. Bot Rev, 62,:41-108. Krishna, P., Sacco, M., Cherutti, J.F., Hill, S. 1995. Cold-induced accumulation of hsp90 transcripts in Brassica napus . Plant Physiol., 107:915-923. Kurl, W.R., Worley, J.F. 1977. Formation of ad ventitious embryos in callus cultures of ‘Seyal’, a French hybrid grape. J. Amer. Soc. Hort. Sci., 102:360-363. Lai, F.M., McKersie, B.D. 1993. Effect of nutrition on maturation of alfalfa ( Medicago sativa L.) somatic embryos. Plant Sci., 91: 87-95. Lai, F.M, McKersie, B.D. 1994a. Regulation of starch and protein accumulation in alfalfa ( Medicago sativa L.) somatic embryos. Pl ant Sci., 100: 211-219. Lai, C.C., Yu, T.A., Yeh, S.D., Yang, J.S. 1998. Enhancement of in vitro growth of papaya multishoots by aeration. Plan t Cell Tiss. Org. Cult., 53: 221-225. Langis, R., Schnabel, B., Earle, E.D. , Steponkus, P.L. 1989. Cryopreservation of Brassica campestris L. cell suspensions by vitrif ication. Cryo-Letters, 10:421-428. Larkin, K.M., Finer, J. J. 2000. Sonicated-assisted Agrobacterium -mediated transformation of embryogenic soybean tissu e and subsequent monitoring of gene expression with GFP (abstract). In Vitro Cell Dev. Biol. Anim., 36:64A Larkin, P.J., Scowcroft, W.R. 1981. Somaclona l variation: A novel source of variability from cell cultures for plant improvement. Theor. Appl. Genet., 60:197-214.

PAGE 171

156 Lee, C.W., Thomas, J.C. 1985. Jojoba embr yo culture and oil production. HortSci., 20:762-764. Levitt, J.1980. Responses to Environmen tal Stresses: Chilling, Freezing, and High Temperature stress. Ed. Vol. 1. A cademic Press, New York, USA. Li, Z., Jayasankar, S., Gray, D.J. 2001. Expr ession of a bifunctional green fluorescent protein (GFP) fusion marker under the cont rol of three constit utive promoters and enhanced derivatives in transgenic grape ( Vitis vinifera ). Plant Sci., 160:877-887. Lines, R.E., Persley, D., Dale, J.L., Drew, R., Bateson, M.F. 2002. Genetically engineered immunity to papaya ringspot virus potyvirus in Australian papaya cultivars. Molec. Breed., 10:119-129. Litz, R.E. 1986. Papaya ( Carica papaya L.). In: Bajaj, Y.P.S. (ed). Biotechnology in Agriculture and Forestry, Vol. 1: Tree s I. Springer-Verlag,. Berlin, pp. 220-232. Litz, R.E. 1988. Somatic embryogenesis from cultu red leaf explants of the tropical tree Euphoria longan Stend. J. Plant Physiol., 132:190-193. Litz, R.E., Conover, R.A. 1978. Tissue culture propagation of papaya. Proc. Fla. State Hort. Soc., 90:245-246. Litz, R.E. Conover, R.A.1979. Development of systems for obtaining parasexual hybrids of Carica hybrids. Proc. Fla. State Hort. Soc., 92:281-283. Litz, R.E. Conover, R.A. 1980. Somatic embryogenesis in cell cultures in Carica stipulata . HortSci., 15:733-735. Litz, R.E. Conover, R.A.1982. In vitro soma tic embryogenesis and plant regeneration from Carica papaya ovular callus. Plant Sci. Let., 26:153-158. Litz, R.E. Conover, R.A. 1983. High fr equency somatic embryogenesis from Carica suspension cultures. Ann. Bot., 51:683-686. Litz, R.E., Knight, R.J.Jr., Gazit, S. 1 982. Somatic embryos from cultured ovules of Mangifera indica L. Plant Cell Rep., 1:264-266. Litz, R.E. Gray, D.J. 1992. Organogene sis and somatic embryogenesis. In: Hammerschlag, F.A. and Litz, R.E. (eds ). Biotechnology of Perennial Fruit Crops. CAB International, Wallingford, pp. 3-35. Litz, R.E., Mathews, H., Moon, P.A., Pliego, Alfaro, F., Yurgalevitch, C., DeWald, S.G. 1993. Somatic embryos of mango. In: Redenbuagh, K. (ed.). Synseeds: Applications of Synthetic Seeds to Crop Improvement. Boca Raton, Florida: CRC Press, pp. 409-425.

PAGE 172

157 Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S. 1998. Two transcription factors, DREB1 and DREB2, with an EREBP/ AP2 DNA binding domain separate two cellular signal transducti on pathways in droughtand low-temperature-responsive gene expression, respectively, in Arabidopsis . Plant Cell., 10:1391-406. Lu, T.G., Takagi, H. 2000. Cryopreservation of somatic embryos of papaya ( Carica papaya L.) by vitrification. Abst.A50. In Vitro Cell Dev. Biol., 36:73-A. Luth, D., Moore, G.A. 1999. Transgenic grapefruit plants obtained by Agrobacterium mediated transformation. Plant Cell Tiss. Org. Cult., 57: 219-222. Ma, H., Moore, P.H., Liu, Z., Kim, M.S., Yu, Q., Fitch, M.M., Sekioka, T., Paterson, A.H., Ming, R. 2004. High-density linkage mapping revealed suppression of recombination at the sex determination locus in papaya. Genetics, 166: 419436. Magdalita, P.M., Drew, R. A., Adkins, S.W., Godwin, I.D. 1996. Morphological, molecular and cytological analyses of Carica papaya X C . c auliflora interspecific hybrids. Theor. Appl. Genet., 95:224-229. Magdalita, P.M., Yabut-Perez, E.M., Mendoza, V.N., Villegas, V.N. , Botella, J.R. 2002. Towards transformation, regeneration and screening of papaya containing Antisense ACC synthase Synthase gene. Abst S42. 10th International Association of Plant Tissue Culture and Biotechnology Congress, Plant Biotechnology 2002 and Beyond: A showcase, Orlando, FL, June 23-June 28. Maheshwari, N., Rajyalakshmi, K., Ba weja, K., Dhir, S.K., Chowdhry, C.N., Maheshwari, S.C. 1995. In vitro culture of wheat and genetic transformation: retrospect and prospect. Crit. Rev. Plant Sci., 14:149. Maheswaran, G., Williams, E.G. 1985. Origin and Origin and development of somatic embryos formed directly on immature embryos of repens in vitro. Ann. of Bot., 56: 619-630. Mahon, R.E., Bateson, M.F., Chamberlain, D.A ., Higgins, C.A., Drew, R.A. and Dale, J.L.1996 An efficient method for the transf ormation of an Australian variety of Carica papaya using microprojectile bombardmen t. Aust. J. Plant Physiol., 23: 679-685. Manshardt, R. M. Wenslaff, T.F. 1989. Inters pecific hybridization of papaya with other Carica species. J. Amer. Soc. Hort. Sci.,114: 689-694. Marin, M.L., Duran-Villa, L. 1988. Survival of somatic embryos and recovery of plants of sweet orange ( Citrus sinensis L. OSb) ) after immersion in liquid nitrogen. Plant Cell Tiss. Org. Cult., 14: 51-57. Marn, M.L., Mafla, G., Roca, W.M., With ers, L.A. 1990. Cryopreservation of cassava zygotic embryos and whole seeds in liquid nitrog en. Cryo-Letters, 11:257.

PAGE 173

158 Marin, M.L., Gogorcena, Y., Ortiz, J., Duran-Vi la, N. 1993. Recovery of whole plants of sweet orange from somatic embryos subjec ted to freezing/thawing treatments. Plant Cell Tiss. Org. Cult., 34: 27-33. Marn, M.L, Mafla, G. Roca, W.M., With ers, L.A. 1990. Cryopreservation of cassava zygotic embryos and whole seeds in li quid nitrogen. CryoLetters, 11:257. Mathews, H., Dewey, V., Wagoner, W., Best wick, R.K. 1998. Molecular and cellular evidence of chimeric tissues in primary transgenics and elimination of chimaerism through improved selection protocol s. Transgenic Res., 7: 123-129. Mathews, H., Litz, R.E, Wilde, H.D., Me rkle, S.A., Wetzstein, H.Y. 1992. Stable integration and expression of -glucoronidase and NPTII genes in mango somatic embryos. In Vitro Cell . Dev. Biol., 28: 172-178. Matsumoto, T., Sakai, A., Takahashi, C. & K. Yamada, 1995. Cryopreservation of in vitro-grown apical meristems of wasabi ( Wasabia japonica ) by encapsulationvitrification method. Cr yo-Letters, 16:189-196. Matsumoto, K., Raharjo, S., Dhekney, S.A., Moon, P.A, Litz, R.E. 2003. Cryopreservation studies in longan ( Dimocarpus longan ). Abst. 1st Brazilian Congress for Plant Tissue Culture, Brazil. Matzke, M.A., Matzke, A.J.M. 1994. How a nd Why Do Plants inactivate homolgous (Trans) genes. Plant Physol., 107: 679-685. Matzke, M.A., Matzke, A.J.M., Mittelsten, M.S. 1994. Inactivation of repeated genesDNA-DNA interactions? In Paszkowski, J. (ed.). Homologous Recombination and Gene Silencing in Plants. Kluwer Aca d. Pub. Dordrecht, The Netherlands, pp. 271307. Maxwell, L.S., Krezdorn, A.H., Will, A.A., Golby, E.V. 1984. Florida Fruit. Maxwell, Tampa. Mazur, P. 1969.Cryobiology: the freezing of biological systems. Science, 168:939-949. McCafferty, H.R.K., Moore, P.H.,Zhu,Y.J. 2003. Towards improved Insect Resistance in Papaya. American Society of Plant Biologists. McCleary, B.V., Matheson, N.K. 1974. Galact osidase activity and galactomannan and galactosylsucrose oligosaccharide deplet ion in germinating legume seeds. Phytochem., 13: 1747-1757. McCleary, B.V., Matheson, N.K. 1976. Galactom annan utilization in germinating legume seeds. Phytochem., 15: 43-47.

PAGE 174

159 McKersie, B.D., Senaratna, T., Bowley, S.R. 1990. Drying somatic embryos for use as artificial seeds. In: Proceedings of the Plant Growth Regulator Society of America 17th Annual Meeting, pp. 199-207. Mekako, H.U., Nakasone, H.Y. 1975. Inte rspecific hybridization among six Carica species. J. Amer. Soc. Hort. Sci., 100:237-242. Merino Merino, D. 1989. El Cultivo del Bab aco. Ediciones Mundi-Prensa, Madrid, Spain, pp. 87. Merkle,S.A., Parrot, W.A., Flinn, B. A. 1995. Morphogenic aspects of somatic embryogenesis. In: Thorope T.A. (ed.)In Vitro Embryogenesis in Plants. Kluwer Acad. Pub. Dordrecht ,Boston, pp. 220-244. Michalczuk, L., Cooke, T. J., Cohen J.D. 1992. A uxin levels at different stages of carrot somatic embryogenesis. Phytochem., 31:1097. Miguel, C.M., Oliveira, M.M. 1999. Transgenic almond ( Prunus dulcis Mill.) plants obtained by Agrobacterium -mediated transformation of leaf explants. Plant Cell Rep., 18: 387-393. Mizoguchi, T., Hayashida, N., Yamaguchi-Shi nozaki, K., Kamada, H., Shinozaki, K. 1993. ATMPKs: a gene family of plant MAP kinases in Arabidopsis thaliana . FEBS Lett. 336:440-44. Mizoguchi, T., Irie, K., Hira yama, T., Hayashida, N., Yamaguchi-Shinozaki, K. 1996. A gene encoding a mitogen-activated protei n kinase kinase kinase is induced simultaneously with genes for a mitogenactivated protein kinase and an S6 ribosomal protein kinase by t ouch, cold, and water stress in Arabidopsis thaliana . Proc. Natl. Acad. Sci. USA, 93:765-69 Manmorsen, S. Ferriere, N.M. Teisso n, C. 1995. Production of high frequency embryogenic calli from the integum ents of immature seeds of Carica papaya . J.Hort Sci., 70: 57-64. Monroy, A.F., Castonguay, Y., Laberge, S., Sarhan, F., Vezina, L.P., Dhindsa, R.S. 1993. A new cold-induced alfalfa gene is associat ed with enhanced hardening at subzero temperature. Plant Physiol., 102:873-79 Monsalud, M.J., Mathews, H., Litz, R.E.,Gra y, D.J. 1995. Control of hyperhydricity of mango embryos. Plant Cell Tiss. Org. Cult., 42:195-206. Moore, G. A., Litz, R.E. 1984. Biochemical ma rkers for Carica papaya, Carica cauliflora and plants from somatic embryos of their hybrids. J. Amer. Soc. Hort. Sci., 109: 203-218.

PAGE 175

160 Moore, G.A., Jacono, C.C., Neidigh, J.L., Lawrence, S.D., Cline, K. 1992. Agrobacterium -mediated transformation of citrus stem segments and regeneration of transgenic plants. Plant Cell Rep., 11: 238-242. Mullins, M.G., Tang, F.C.A., Facciotti, A. 1990. Agrobacterium -mediated genetic transformation: tran sgenic plants of Vitis rupestris Scheele and buds of Vitis vinifera L. Bio/Technology, 8: 1041-1045. Murashige, T., Skoog, F. 1962. A revised medium for rapid growth of and bioassays with tobacco tissue cultures. Physiol Plant., 15:473-497. Nadel, B.L., Atlamn, A., Ziv, M. 1989. Regul ation of somatic em bryogenesis in celery cell suspension: 1. Promoting the e ffect of mannitol on somatic embryo development. Plant Cell Ti ss. Organ Cult., 18:181-199. Nakasone, H.Y., Paull, R.E. 1998. Tropical fruits. CAB International, Wallingford. Napoli C, Lemieux C, and Jorgensen R. 1990. Introduction of a chalcone synthase gene into Petunia results in reversible co-suppression of homol ogous genes in trans. Plant Cell, 2: 279-289. National Research Council, 1989. Lost Crops of the Incas. Little-Known Plants of the Andes with Promise for Worldwide Cultivation. National Academy Press. Washington D.C., USA, pp. 415. Nehlin, L., Mllers, C., Bergman, P., Glimer lius, K. 2000. Transient GUS and GFP gene expression and viability analysis of microprojectile bombarded microspores of Brassica napus L. J. Plant Physiol., 156:175-183. Niedz, R.P., Sussman, M.R., Satterlee, J.S. 1995. Green fluorescent protein: an in vivo reporter of plant gene expression. Plant Cell Rep., 14:403-406. Nishizawa, S., Sakai, A., Amano, Y., Matsuzawa, T. 1993. Cryopreservation of asparagus ( Asparagus officinalis L.) embryogenic suspension cells and subsequent plant regeneration by vitrific ation. Plant Sci., 91: 67-73. Niwa, Y., Hirano, T., Yoshimoto, K., Shimizum M., Kobayashim H. 1999. Non-invasive quantitative detection and a pplications of non-toxic, S 65T-type green fluorescent protein in living plants. Plant J., 18:455-463. Normah, M.N., Marzalina, M., 1999. Achievements and prospect of in vitro conservation for tree germplasm. In: Normah, M.N., Narimah, M.K. and Clyde, M.M. (eds.). In vitro conservation of plant genetic res ources. Plant Biotechnology Laboratory, UKM. Malaysia, pp. 253-161. Norstog, K. 1965. Development of cultured barley embryos. I. Growth of 0.10.4mm embryos. Amer. J. Bot., 52: 538-546.

PAGE 176

161 Organisation for Economic Co-operati on and Development (OECD). 2003. Draft Consensus Document on the biology of Carica papaya (L.) (Papaya). Report No. 5 February 2003, France. Ogden, M.A.H., Jackson, L.K., Campbell, C. W. 1981. Florida tropi cal fruit culture via master gardener. Proc. Fla. Hort. Soc., 94: 222. Owens, C.L., Thomashow, M. F., Hancock, J ., Iezzoni, A. 2002. CBF1 orthologs in sour cherry and strawberry and the heterologous expression of CBF1 in strawberry. J. Amer. Soc. Hort. Sci., 127: 489-494. Pang, S.Z., Sanford, J.C. 1988. Agrobacterium mediated gene transfer in papaya. J. Amer. Soc. Hort. Sci., 113: 287-291. Paull,R.E., Chen,N.J. 2003. Endoxylanase Expressed during Papaya Fruit Ripening: Purification, Cloning and Characterization. American Society of Plant Biologists, Honolulu, Hawaii USA, July 25 -30. Pena, L., M. Cervera, J. Jurez, C. Ortega, J.A. Pina, N. Durn-Vila, and L. Navarro. 1995. High efficiency Agrobacteriummediated transformation and regeneration of citrus. Plant Sci., 104: 183-191. Pence, V.C. 1991. Cryopreservation of immature embryos of Theobroma cacao . Plant Cell Rep., 10: 144-147. Perez, R.M., Navarro, N., Duran Vila, N. 1997. Crypreservation and storage of embryogenic cell cultures of several Citrus species and cultiv ars. Plant Cell Rep., 17:44-49. Polisensky, D.H., Braam, J. 1996. Cold-shock regulation of the Arabidopsis TCH genes and the effects of modulating intracellula r calcium levels. Pl ant Physiol., 111:127179. Qiu, X., Zhu, Y.J., Wang, M.L., Ming, R., M oore, P.H., Gonsalves, D., Albert, H.H. 2003. Isolation and characterization of genes involved in papaya ( Carica papaya L.) systemic acquired resistance. (Abst), ICPP, 2: 122-169. Quinn, P.J. 1985. A lipid-phase separation model of low-temperature damage to biological membranes. Cryobiology, 22:128-146. Rall, W.F. Fahy, G.M. 1985. Ice-free cryopres ervation of mouse embryos at C by vitrification. Nature, 313:573-575. Rangan, T.S., Murashige, T., Bitters, W.P. 1968. In vitro initiation of nucellar embryos in monoembryonic citrus. HortSci., 3:226-227.

PAGE 177

162 Reinhoud, P.J. 1996. Cryopreservation of Tobacco Suspension cells by Vitrification. Doctoral Thesis, Institute of Molecular Pl ant Sciences Leiden University, Leiden, The Netherlands. Reinhoud, P.J., Schrijnemakers, W.M., Van Iren, F., Kijne, J.W. 1995. Vitrification and a heat shock treatment improve cryoprese rvation of tobacco cell suspensions compared to two-step freezing. Plant Cell Tiss. Org. Cult., 42:261-267. Roberts, H.F., 1973. Predicting the viability of seeds. Seed Sci. Technol., 1:499-514. Sakai, A., 1993. Cryogenic strategies for surviv al of plant cultured cells and meristems cooled to -196oC. In Cryopreservation of Plan t Genetic Resources: Technical Assistance Activities for Geneti c Resources Projects, JICA,pp. 5-30. Sakai, A., Larcher, W. 1987. In: Frost Surviv al of Plants: Responses and Adaptation to Freezing Stress. Springer-Verlag, Berlin. Sakai, A., S. Kobayashi and I. Oiyama. 1990. Cryopreservation of nucellar cells of navel orange ( Citrus sinensis Osb.) by vitrification. Plant Cell Rep., 9:30-33. Sakai, A., Matsumoto, T. 1996. A novel cryogen ic procedure for cryopreservation of in vitro grown meristems of temperate crops encapsulation-vitr ification. In Proc. Intl. Workshop on In Vitro Conservation of Plant Genetic Resources, Kuala Lumpur, Malaysia, 4-6 July, 1995 pp.78. Sakai, A., Kobayashi, S., Oiyama. I. 1991. Cryopreservation of nuce llar cells of navel orange ( Citrus sinensis Osb.) by a simple freezing method. Plant Sci., 74:243-248. Sakai, R.K., Gelfand, D.H., Stoffel, H., Sc hraf, S.J., Higuchi, R., Horn, G.T., Mulles, K.B., Elrich, H.A. 1988. Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239: 487-491. Sampson, J.A. 1986. Tropical Fruits. Second Ed . Longman Scientific and Technical, Longman Inc., New York, NY. Sarkar, D., Naik, P.S. 1998. Cryopreservation of Shoot Tips of Tetraploid Potato ( Solanum tuberosum L.) Clones by Vitrificati on. Ann. Bot., 82: 455-461. Sawant, A. 1958. Crossing relationships in the genus Carica . Evolution, 12:263-266. Schfer-Menuhr, A. 1996. Storage of old potat o varieties in liqui d nitrogen. IPGRI Newsl. for Europe 7:8 Scheldeman, X., Romero, J., Van Damme, P. 2002. Highland papayas in Southern Ecuador. Need for conservation actions. Acta Hort., 575, 199-205. Schiavone, F.M., Cooke, T.J. 1985. A geometric analysis of somatic embryo formation in carrot cell cultures. Can J. Bot., 63: 15731575.

PAGE 178

163 Schrijnemakers, E.W.M., Van Irene, F. 1995. A two-step or equilibrium freezing procedure for the cryopreservation of pl ant cell suspensions. In: Day, J.G. and McLellan, M.R. (ed.). Methods in Mo lecular Biology, Vol 38: Cryopreservation and freeze-drying protocols Humana Press Inc. Totowa, N.J., pp. 103-111. Seabra, R.C., Pais, M.S. 1999. Genetic tr ansformation of European chestnut ( Castania sativa Mill) with genes of inte rest. Acta Hort., 494: 407-416. Seelig, R.A. 1970. Papaya . Fruit and Vegetable Facts and Pointers, United Fresh Fruit and Vegetable Association, Washington, DC. Senaratna, T., McKersie, B.D., Bowley, S.R. 1990. Artificial seeds of alfalfa ( Medicago sativa L.). Induction of desicc ation tolerance in somatic embryos. In Vitro Cell Dev. Biol., 16: 85-90. Sharp, W.R., Sondahl, M.R., Caldas, L.S., Ma raffa, S.B. 1980. The physiology of in vitro asexual embryogenesis. Hort. Rev., 2:268-310. Sheen, J., Hwang, S.B., Niwa, Y., Kobaya shi, H., Galbraith, D.W. 1995. Green fluorescent protein as a new vital mark er in plant cells. Plant J., 8:777-784. Simione, F. 1998. Cryopreservation Manua l. Nalge Nunc International http://nalgenelab.nalgenunc.com/techda ta/Technical/manual.asp. Accessed March, 2004 Singh, H. 1964. In Fruit Culture in India. In dian Council of Agricultural Research. Singh, I.D. Sirohi, S.C. 1977. Papaya. In: Nijjar, G.S. (ed.). Fruit Breeding in India, pp. 187-192. Singh, S.P. ,Pandey, R.M. 1986. Note on new device to hardenoff in vitro multiplied papaya plants. Indian J. Hort., 45: 271-273. Smillie, R.M. 1979. The new chloroplast: a new a pproach for investigating chilling stress in plants. In: Lyons, J.M., Graham, D. and Raison, J.K. (ed.). Low Temperature Stresses in Plants. Adacemic Press Inc., New York, pp.187. Smillie, R.M., Hetherington, S.E., He, J., No tt, R. 1988. Photoinhibition at chilling temperatures. Aust. J. Plant Physiol., 15:207. Smith, C.E.Jr., Krikorian, A.D. 1990. pH c ontrol of carrot somatic embryogenesis. In: Nijkamp HJ, van der Plas LH and Van Asrt rijk J (eds). Progress in Plant Cellular and Molecular Biology. Kluwer Academ ic Publisher, Dordrecht, pp. 449-453 Sondhal, M.R., Sharp, W.R. 1977. High freque ncy induction of somatic embryos in cultured leaf explants of Coffea arabica Zeitschrift fur Pflanzenphysiologie, 81:395-408.

PAGE 179

164 Soria J., 1991. Estrategias de Conservacin In Situ de Recursos Fitogenticos en Ecuador. In: Tcnicas para el Manejo y Us o de los Recursos Fitogenticos. Castillo R., Estrella J. and Tapia C. (Eds.) . INIAP, Quito, Ecuador. pp. 104-115. Soria, N., Viteri, P. 1999. Guia para el cu ltivo de babaco en el Ecuador. INIAP, COSUDE. Quito, Ecuador, pp. 48. Steponkus, P.L. 1984. Role of the plasma me mbrane in freezing injury and cold acclimation, Ann. Rev. Plant Physiol., 35:543-584. Steponkus, P.L., Uemura, M., Webb. M.S. 1993. A contrast of the cryostability of the plasma membrane of winter rye and spring oat-two species that widely differ in their freezing tolerance and plasma me mbrane lipid composition. In: Steponkus, P.L. (ed.). Advances in Low-Temperature Biology, Vol. 2. JAI Press, London, pp. 211-312. Stewart Jr, C.N. 2001. The utility of green fluor escent protein in transgenic plants. Plant Cell Rep., 20:375-385. Stewart, P., Taylor, M., Mycock, D. 2001. Th e sequence of the preperative procedures affects the success of cryostorage of ca ssava somatic embryos. Cryo-Letters, 22: 35-42. Stiles, J.I., Lemme, C., Sondur, S., Mors hidi, M.B., Manshardt, R.M. 1993. Using randomly amplified polymorphic DNA for ev aluating genetic relationships among papaya cultivars. Theor. Appl. Genet., 85:697-701. Stockinger, E.J., Gilmour, S.J., Thomashow, M.F. 1997. Arabidopsis thaliana CBF1 encodes an AP2 domain-contai ning transcriptional activat or that binds to the Crepeat/DRE, a cis-acting DNA regulatory elem ent that stimulates transcription in response to low temperature and water de ficit. Proc. Natl. Acad. Sci. USA, 94:1035-40. Strauss, G., Hauser, H. 1986. Stabilization of lipid bilayer vesicles by sucrose during freezing. Proc. Natl. Acad. Sci. USA, 83:2422-26. Sudarmonowati, E. 1999. Cryopreservation of tropi cal plants: current research status in Indonesia. Cryopreservation of tropical plant germpl asm, Current status of cryopreservation research. http:// www.ipgri.cgiar.org/publications/ jircas/Session4.pdf. [Acce ssed November 26, 2003]. Takagi, H., Thinh, N.T., Islam, O.M., Senboku, T., Sakai, T. 1997. Cryopreservation of in vitro -grown shoot tips of taro ( Colocasia esculenta (L.) Schott) by vitrification. 1. Investigation of basic conditions of the vitrification procedur e. Plant Cell Rep. 16: 594-599. Thammasiri, K. 1999. Cryopreservati on of embryonic axes of j ackfruit. Cryo-Letters, 20: 21-28.

PAGE 180

165 Thomashow, M.F. 1999. Plant Cold Acclimati on: freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physio l. Plant Mol. Biol., 50: 571-599. Thomashow, M.F. 2001. So what's new in the field of plant cold acclimation? Lots! Plant Physiol., 125: 89-93. Thomashow, M.F., S.J. Gilmour, R. Haje la, D. Horvath, C. Lin, and W. Guo. 1990. Studies on cold acclimation in Arabidopsis thaliana . In: Bennett, A.B. and O'Neill, S.D. (eds.). Horticultural Biotechnol ogy. Plant Biology Volume 11, Wiley-Liss, Inc. New York, pp 305-331. Tian, L., Levee, V., Mentag, R., Charest, P.J., Seguin, A. 1999. Green fluorescent protein as a tool for monitoring transgene expression in forest tree species. Tree Physiol., 19:541-546. Tisserat, B., Murashige, T. 1977. Re pression of asexual embryogenesis in vitro by some plant growth regulators. In Vitro Cell Dev. Biol., 13:700-805. Toonen, M.A.J., Hendriks, T., Schmidt, E. D.L., Verhoeven, H.A., van Kammen, A, de Vries, S.C. 1994. Description of somatic embryo-forming single cells in carrot suspension cultures employing vide o cell tracking. Planta, 194: 565. Tsukazagi, H., Mii, M., Tokuhara, M., Ishikawa, K. 2000. Cryopreservation of Doritaenopsis suspension culture by vitrificat ion. Plant Cell Rep., 19: 1160-1164. Usami, S., S. Ohta, T. Komari and J.N. Burnell. 1995. Cold stability of pyruvate, orthophosphate di-kinase of Flaveria brownii . Plant Mol. Biol., 27: 969-980. Van Damme, P. 2003.Highland papayas. http:/ /allserv.rug.ac.be/~tdirckx/caricaceae.htm. Accessed March, 2004 Van den Eynden, V., Cueva, E,. Cabrera, O ,. 1999. Plantas Silvestres Comestibles del Sur del Ecuador – Wild Edible Plants of Southern Ecuador. Ediciones Abya-Yala, Quito, Ecuador, pp. 221. Van Droogenbroeck, B., Breyne, P. Goetghebe ur, P., Romeijn-Peeters, E., Kyndt, T., Gheysen, G. 2002. AFLP analysis of the genetic relationships among papaya and its wild relatives (Caric aceae) from Ecuador. Theor., App. Genet., 105: 289-297. Van Irene, F., Schrijnemakers, E.W.M ., Reinhoud, P.J, Kinje, J. W. 1995. Cryopreservation of plant cell cult ures. Biotechnologia, 1:60-68. Villegas, V.N. 1997. Carica papaya L. In Verheij, E.W.M. and Coronel, R.E. (eds.). Edible fruits and nuts-Vol. 2, Wageningen University, The Netherlands. Von Arnold, S., Sabal, I., Bozhkov, P., Dyachock, J., Filonova, L. 2002. Developmental pathways of somatic embryogenesis. Plant Cell Tiss. Org. Cult., 2:217-226.

PAGE 181

166 Walker, M.A., McKersie, B.D. 1993. Role of as corbate-glutathione antioxidant system in chilling resistance of tomat o. J. Plant Physiol., 141: 234 239 Wang, J. H., Liu, J.G., Huang, C.N. 1998. Ultrastructural changes during cryopreservation of rice ( Oryza sativa L.) embryogenic suspension cells by vitrification. Cr yo-Letters, 19:49-54. Wang, Q.C., . Batuman, P., Li, M. Bar-Jose ph, R., Gafny. 2002. Cryopreservation of in vitro-grown shoot tips of ‘Troyer’ citrange [ Poncirus trifoliata (L.) Raf. x Citrus sinensis (L.) Osbeck.] by encapsulation-dehydration. Plant Cell Rep., 20:901-906. Warren, G., McKown, R., Marin, A., Teutonico, R. 1996. Isolation of mutations affecting the development of freezing tolerance in Arabidopsis thaliana (L.) Heynh. Plant Physiol., 111:1011-1019. Watanabe, K., Kuriyama, A., Kawai, F., Ka namori, M. 1999. Effect of cryoprotectant treatment and post-thaw washing on the survival of cultured rice ( Oryza sativa L.) cells after cryopreservation. Cryo-Letters, 20:377-382. Watanabe, K., Sato, F., Yamada, Y., Kawa i, F., Kanamori, M., Mitsuda, H.. 1995. Characteristics of polypeptides in cultur ed rice cells differing in cryoprotectibility. J. Plant Physiol., 136:443-447. Watson, B. 1997. Agronomy/Agroclimatology Notes for the Production of Papaya. MAFFA, Australia. Weigel, D. 1995. The APETALLA 2 domain is related to a novel type of DNA binding domain. Plant Cell, 7:388-399. Wenck, A., Pugieux, C., Turner, M., Dunn, M., Stacy, C., Tiozzo, A., Dunder, E., VanGrinsven, E., Khan, R., Sigareva, M ., Wang, W.C., Reed, J., Drayton, P., Oliver, D., Trafford, H., Legris, G., Ru shton, H., Tayab, S., Launis, K., Chang, Y.F., Chen, D., Melchers, L. 2003. Reef-cor al proteins as visual, non-destructive reporters for plant transforma tion. Plant Cell Rep., 22:244-251. Wiid M., 1994. Aanpasbaarheid van Babako in Subtropiese Gebiede. Instituut vir Tropiese en Subtropiese Gewasse Inligtingbulletin 15: 17-19. Williams E.G., Maheshwaran, G. 1986. Somatic embryogenesis: factor influencing coordinated behavior of cells as an embryogenic group. Ann. Bot., 57:443-462. Wilmink, A., Dons, J.J.M. 1993. Selective agents and marker genes used in transformation of monocotyledonous plan ts. Plant Molecula r Biology Reporter, 11:165-185. Wisniewski, M., Webb, R., Balsamo, R., Clos e, T.J., Xiao-Ming, Yu, Griffith, M. 1999. Purification, immunolocaliza tion, cryoprotective, and antif reeze activity of PCA60: A dehydrin from peach. Physiol. Plant., 105:600-608.

PAGE 182

167 Withers, L.A. 1979. Freeze preservation of soma tic embryos and clonal plantlets of carrot ( Daucus carota L.) Plant Physiol., 63:460-467. Withers, L.A., 1985. Cryopreservation of cultured plant cells and protoplasts. In Kartha, K.K. (ed.). Cryopreservation of Plant Ce lls and Organs, CRC Pr ess, Boca Raton, pp. 243-267. Withers L.A., Engels, J.M.M. 1990. The test tu be genebank a safe alternative to field conservation. IBPGR Newsl. for Asia and the Pacific 3: 1-2. Witjaksono, Litz, R. E. 1999a.Induction and growth characteristics of embryogenic avocado ( Persea americana Mill.) cultures. Plant Cell Tiss. Org. Cult., 58:19-29. Wolfe, H.S., Lynch, S.J. 1940. Papaya culture in Florida, Univ. of Fla. Agric. Exp. Stn. Bull., 350. Wu, Y.J., Huang, X.L., Xiao, J.N., Zhou, M. D., Engelmann, F. 2003. Cryopreservation of mango ( Mangifera indica ) embryogenic cultures. Cryo-Letters, 24:303-314. Xu, N., Bowley, J.D. 1992. Contrasting pa ttern of somatic and zygotic embryo development in alfalfa ( Medicago sativa L.) as revealed by scanning electron microscopy. Plant Cell Rep., 11: 279-282. Xu, D., Duan, X., Wang, B., Hong, B., Ho, T. D., Wu, R. 1996. Expre ssion of the late embryogenesis abundant protein gene, HVA1 , from barley confers tolerance to water deficit and salt stress in transg enic rice. Plant Physiol., 110: 249 – 257. Yamaguchi-Shinozaki, K., Shinozaki, K. 1994. A novel cis-acting element in an Arabidopsis gene is involved in respon siveness to drought, low-temperature, or high-salt stress. Plant Cell, 6:251-264. Yang, T.T., Cheng, L., Kain, S.R. 1996. Optimized codon usage and chromophore mutations provide enhanced sensitivity w ith the green fluorescent protein. Nucleic Acids Res., 24:4592-4593. Yang, J., Yu, T., Cheng, Y., Yeh, S. 1996. Transgenic papaya plants from Agrobacterium -mediated transformation of petiole s of in vitro propagated shoots. Plant Cell Rep., 15:459-464. Yeh, S. D., Bau, H. J., Cheng, Y. H., Y u, T. A., and Yang, J. S. 1998. Greenhouse and field evaluations of coat-protein transgen ic papaya resistant to papaya ringspot virus. Acta Hort., 461:321-328. Yepes, L. M., Aldwinckle, H. S. 1994. Factors th at affect leaf regene ration efficiency in apple, and effect of antibiotics in mor phogenesis. Plant, Cell, Tiss. Org. Cult., 37: 257-269.

PAGE 183

168 Yeung, E.C. 1995. Structural and developmenta l patterns in somatic embryogenesis. In: Thorpe, T.A. (Ed.) In Vitro Embryoge nesis in plants. Kluwer Acad. Pub., Dordrecht, pp. 205-247. Yie, S.T., Liaw, S.I. 1977. Plant regeneration from shoots tips and callus of papaya. In Vitro, 13:564-568. Ying. Z., Xia, Y. Davis ,M.J. 1999.A new met hod for obtaining transgenic papaya plants by Agrobacterium -mediated transformation of somatic embryos. Proc. Fla. Sate Hort. Soc., 112:201-205. Yu Q, Moore PH, Ming R. 2003. Cloning and ch aracterization of flower development genes in papaya. 15th Ann CTAHR Student Research Symp. p. 30. Abstract Yu, T.A., Yeh, S.D., Cheng, Y.H., Yang, J.S. 2000. Efficient rooting for eatablishment of papaya plantlets by micropropagation. Plant Cell Tiss. Org. Cult., 61: 29-35. Yusibov, V., Modelska, A., Steplewski, K., Agadjanyan, M., Weiner, D., Hooper, D.C., and Koprowski, H. 1997. Antigens produced in plants by infection with chimeric plant viruses immunize against rabies viru s and HIV-1. Proc. Natl. Acad. Sci. USA, 94: 5784-5788. Zarka, D. G., Vogel, J. T. Cook, D. Thomashow, M F. 2003. Cold induction of Arabidopsis CBF genes involves Multiple IC E (Inducer of CBF Expression) promoter plements and a Cold-Regulator y Circuit that is desensitized by low temperature. Plant Physiol., 133: 910-918. Ziv, M. 1999. Developmental and Structural Patte rns of In Vitro Plants. In. Soh W.Y. and Bhojwani S.S. (eds). Morphogenesis in Plant Tissue Cultures. Kluwer Acad. Publishers, The Netherlands, pp. 235-249. Ziv, M. Gadasi, D. 1985. Enhanced embryoge nesis and plant regeneration from cucumber callus by activated charcoal in solid/liquid double layer culture. Plant Sci., 47:115-122.

PAGE 184

169 BIOGRAPHICAL SKETCH Sadanand Dhekney was born on February 21st, 1976, in Pune, India. He is the son of Arun Dhekney (father) and Shubhada Dh ekney (mother). After graduating from Loyola High School and Jr. College in 1993, he pursued his studies at the College of Agriculture, Pune of Mahatma Phule Agricultur al University, Rahuri, India. He received the Bachelor of Science in Agriculture degree in 1997. He was awarded a Junior Research Fellowship from the Indian Council of Agriculture Research (ICAR) in 1997 to pursue the Master of Science degree at the Tamil Nadu Agricultural University, Coimbatore, India. He was awarded a Master of Science degree in Horticulture in 1999. In April 2000, he was selected as a gradua te student in the Horticultural Sciences department at the University of Florida under the supervision of Dr. Richard Litz. Sadanand was awarded a Graduate Research Assistantship towards a PhD degree in Tropical Fruit Biotechnology. He was also awar ded the J. N. Tata Memorial Fellowship, the B.D. Bangar Memorial Fellowship, a nd the Harrold E. Kendall Fellowship and William. H. Krome Memorial Fellowship by the Miami-Dade Agri Council for graduate studies. Sadanand satisfied course work requi rement in Gainesville before he moved down to Homestead to pursue research in genetic transformation, cryopreservation and molecular investigations in cold tolerance of papaya. He received the Student Travel Award from the Society for In Vitro Biology for a research pres entation during the year 2003.