Citation
Studies of Three Major Peanut Allergens

Material Information

Title:
Studies of Three Major Peanut Allergens
Creator:
KANG, IL-HO
Copyright Date:
2008

Subjects

Subjects / Keywords:
Allergens ( jstor )
Allergies ( jstor )
Amino acids ( jstor )
Cotyledons ( jstor )
Epitopes ( jstor )
Globulins ( jstor )
Peanuts ( jstor )
Proteins ( jstor )
Seed storage ( jstor )
Soybeans ( jstor )
City of Madison ( local )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Il-Ho Kang. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
4/30/2006
Resource Identifier:
436097555 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

STUDIES OF THREE MAJOR PEANUT ALLERGENS By IL-HO KANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Il-Ho Kang

PAGE 3

I dedicate this dissertation to my parents.

PAGE 4

iv ACKNOWLEDGMENTS I would like to express my sincere appreciation to Dr. Maria Gallo-Meagher, the chairperson of my graduate supervisory committee, for her scientific guidance, encouragement during my graduate study, and financial support. I would also like to extend my appreciation to Dr. R.L. Smith, Dr. K.J. Boote, Dr. D.S. Wofford, and Dr. L.C. Hannah for their academic support and criticism as members of my advisory committee. I wish to acknowledge my laboratory memb ers, Ned Stevens, Jeff Seib, Dr. A. Abouzid, Dr. M. Murakami (Match), Dr. C. Kudithipudi (Chengal), Dr. M. Jain (Mukesh), S.V. Tirumalaraju (Shiva), Shanon May, and Andrea S. Anderson, for their daily support and friendship. A special thanks to Dr. Jean Thomas for editing my dissertation and her endless help. I especially thank my cousin, Dr. Kyung Woon Jung and his family. My words are not enough to express my thankfulness to my parents, my wife, Seunghee, and our two children, Kichang and Sunyu. I am deeply grateful to my family for their love, patience, and support.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...........................................................................................................viii LIST OF FIGURES...........................................................................................................ix ABSTRACT....................................................................................................................... xi CHAPTERS 1 INTRODUCTION........................................................................................................1 2 LITERATURE REVIEW.............................................................................................4 Food Allergies..............................................................................................................4 Plant Allergens..............................................................................................................7 PR-Proteins............................................................................................................7 Seed Storage Proteins............................................................................................8 Cereal allergens and the prolamin superfamily............................................11 Legume allergens and the cupin superfamily...............................................13 Peanut ( Arachis hypogaea L.)....................................................................................15 Peanut Allergy............................................................................................................17 Ara h 1.................................................................................................................18 Ara h 2.................................................................................................................20 Ara h 3.................................................................................................................22 Treatment Strategies to Re duce Allergic Responses..................................................23 3 EXPRESSION OF THREE MAJOR PEANUT ( ARACHIS HYPHOGAEA L.) ALLERGEN GENES DURING SEED DEVELOPMENT, GERMINATION, AND SEEDLING GROWTH..............................................................................................34 Introduction.................................................................................................................34 Materials and Methods...............................................................................................38 Plant Materials.....................................................................................................38 Germination.........................................................................................................38 Total RNA Extraction..........................................................................................39 Northern Hybridization.......................................................................................40 Preparation of gels and blots........................................................................40

PAGE 6

vi Northern hybridization.................................................................................40 Peanut Protein Extraction....................................................................................41 SDS-PAGE..........................................................................................................41 N-Terminal Sequencing and Analysis.................................................................42 Preparation of Polyclonal Antibodies Against Ara h 1 and Ara h 2...................43 Subcloning of cDNAs into a pGEM-T vector..............................................43 Construction of expression plasmids............................................................43 Expression and purification of recombinant proteins..................................44 Peanut positive Human Patient Plasma...............................................................45 Western Blots Analysis.......................................................................................45 Quantitative RT-PCR..........................................................................................46 cDNA synthesis and optimization of RT-PCR............................................46 RT-PCR........................................................................................................47 Tissue Print RNA Hybridization.........................................................................48 Membrane preparation.................................................................................48 In vitro transcription for RNA probe preparation........................................48 Hybridization................................................................................................49 Tissue Print Immunoblots....................................................................................49 Protein Body Isolation.........................................................................................51 Results........................................................................................................................ .51 Expression of Peanut Allergen Genes During Seed Development.....................51 Tissue-specific Expression..................................................................................52 Identification of Peanut Seed Pr oteins by N-Terminal Sequencing....................54 Ig E Binding Tests for Peanut Seed Proteins.......................................................54 Gene Expression During Seed Ge rmination and Seedling Growth.....................55 Discussion...................................................................................................................58 4 SCREENING THE PEANUT GERM PLASM FOR ALLERGEN LEVELS............82 Introduction.................................................................................................................82 Materials and Methods...............................................................................................84 Peanut Samples....................................................................................................84 Protein Extraction................................................................................................84 SDS-PAGE..........................................................................................................85 Analysis of Quantitative Data for Screening of Peanut Germplasms.................85 Results........................................................................................................................ .86 Screening of Peanut Germplasm.........................................................................86 Discussion...................................................................................................................87 5 CHARACTERIZATION OF A NOVEL PEANUT ALLERGEN GENE, ARA H 3.92 Introduction.................................................................................................................92 Materials and Methods...............................................................................................94 Southern Blot Hybridization................................................................................94 cDNA Library Screening.....................................................................................95 Sequence and Structural Analyses.......................................................................97 Results........................................................................................................................ .98

PAGE 7

vii Genomic Southern Analysis................................................................................98 Cloning and Characterization of A Novel Ara h 3..............................................98 Comparison of 11S Globulin Proteins...............................................................100 Three-Dimensional Molecular Modeling..........................................................101 Discussion.................................................................................................................101 APPENDIX A HUMANIZED ANTIBODIES AGAINST IGE.......................................................116 B SUBCLONING OF CDNAS INTO A PGEM-T VECTOR.....................................117 C IN VITRO TRANSCRIPTION FOR RNA PROBES PREPARATION...................118 D PREPARATION OF POLYCLONAL ANTIDODIES AGAINST ARA H1 AND ARA H 2...................................................................................................................120 E CONTROL EXPERIMENT OF RT-PCR FOR ARA H 3........................................121 F SDS-PAGE AND WESTERN BLOT S OF WILD-TYPE SPECIES.......................122 G PERCENT (%) OF PEANUT ALLERGENS IN THE CORE OF THE CORE COLLECTION.........................................................................................................123 H PERCENT (%) OF PEANUT ALLERG ENS IN FLORIDA BREEDING LINES.125 I CTAB DNA EXTRACTION FOR PEANUT..........................................................128 J GENOMIC SOUTHERN BLOT HYBRIDIZATION.............................................129 LIST OF REFERENCES.................................................................................................130 BIOGRAPHICAL SKETCH...........................................................................................147

PAGE 8

viii LIST OF TABLES Table page 2-1. Allergens relate d to PR-proteins.................................................................................26 2-2. Seed storage proteins based on their solubility..........................................................27 2-3. Classification of seed storage proteins.......................................................................28 2-4. Types and characteritics of wheat grain prolamins (gluten proteins).........................29 2-5. Common names of legume globulins.........................................................................30 2-6. Properties of peanut allergens.....................................................................................31 3-1. Characterization of peanut seeds................................................................................65 4-1. Seed protein content within different peanut germplasm...........................................91 5-1. Nucleotide similarities (%) of ara h 3 and related genes.........................................113 5-2. Amino acid similarities (%) of Ara h 3 and related proteins....................................113 5-3. Critical amino acids with in the IgE binding epitopes...............................................114 5-4. Amino acid sequence identity among 11S globulin subunits...................................115

PAGE 9

ix LIST OF FIGURES Figure page 3-1. Peanut seeds at four developmental stages.................................................................65 3-2. Northern analysis for three major peanut allergen genes in 12 genotypes during seed maturation.................................................................................................................66 3-3. Expression levels of the three major peanut allergen genes during seed maturation.................................................................................................................67 3-4. Expression of Ara h 1 and Ara h 2 at tran scriptional and translational levels during seed maturation........................................................................................................68 3-5. Tissue specific expression of the th ree major peanut allergen genes.........................69 3-6. Localization of ara h 1, ara h 2, and ara h 3 transcripts in seed by tissue print hybridization.............................................................................................................70 3-7. Tissue print immunoblotting fo r Ara h 1and Ara h 2 in seed.....................................71 3-8. Expression of the three major peanut allergen genes in embryonic axes and cotyledons.................................................................................................................72 3-9. N-terminal sequence analysis of peanut seed proteins...............................................73 3-10. Seed protein profiles and immunoblot s with peanut-allergic patient serum............74 3-11. Protein profiles and immunoblots of prot eins from embryo axes and cotyledons...75 3-12. Peanut seed germination and seedling growth.........................................................76 3-13. Expression of the three major allergen genes during peanut seed germination and seedling growth........................................................................................................77 3-14. Analysis of seed weight and protei n content during germination and seedling growth.......................................................................................................................78 3-15. SDS-PAGE and western blots of embryonic axes and cotyledons during germination and seedling growth.............................................................................79 3-16. Immunoblots of Ara h 1 during seedling growth.....................................................80

PAGE 10

x 3-17. Immunoblots of Ara h 1 for protein bodies during germination and seedling growth.......................................................................................................................81 4-1. Seed protein profiles of screened germplasm.............................................................90 5-1. Copy number determination for ara h 3...................................................................107 5-2. Sequence of a novel ara h 3.....................................................................................108 5-3. Amino acid sequence alignment am ong Ara h 3 and related proteins.....................109 5-4. Amino acid sequence alignment among 11S globulins............................................110 5-5. Schematic protein structures based on amino acid sequence analysis.....................111 5-6. Molecular models of Ara h 3 and related proteins...................................................112

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy STUDIES OF THREE MAJOR PEANUT ALLERGENS By Il-Ho Kang May, 2004 Chair: Maria Gallo-Meagher Major Department: Agronomy Peanut ( Arachis hypogaea L.) is one of the most popular foods due to its low cost and high nutrition. However, peanut causes one of the most severe food allergies. Peanuts induce an allergic reaction in 1.5 million Americans and cause between 50 to 100 deaths each year in the U.S. Peanut seed storage proteins, which are recognized by more than 50% of peanut allergic patients, appear to be the main source of peanut allergens. Ara h 1, Ara h 2 and Ara h 3 are considered to be the major peanut allergens. To begin addressing the possibility of producing hypoallergenic peanut, three studies were conducted to characterize the three major peanut allergen genes and their corresponding proteins, to screen the peanut germplasm for levels of these proteins, and to clone a gene encoding Ara h 3. The expression patterns of three major peanut allergens genes, ara h 1, ara h 2 and ara h 3, were examined. The transcript levels were higher in mature seeds than in immature seeds and mRNAs were also observed only in seeds. The accumulation of their corresponding proteins, Ara h 1, Ara h 2 and Ara h 3, followed the same pattern. These

PAGE 12

proteins disappeared during seedling germina tion. Polypeptide patterns were different in embryonic axes compared with cotyledons during seedling growth. Fourteen major polypeptide bands were identified from peanut seed on SDS-PAGE by N-terminal sequencing. Most of these bands can be recognized by patients that are allergic to peanuts. Two different sources of peanut germplasm, Florida breeding lines and the core of the peanut core collection, were screened to find plants containing low levels of the major allergens. From this screening, it was observed that some plants are low in Ara h 1 content. Therefore, these plants can be used in traditional breeding and genetic modification experiments to produce hypoallergenic peanuts. Gene copy number studies revealed that Ara h 1 and Ara h 2 are encoded by one or two genes, whereas Ara h 3 is encoded by multiple genes. A new ara h 3 clone was isolated and sequence alignment showed that the new clone and protein have less than 75% homology with previously isolated ara h 3 genes and proteins. Although overall structure of the new protein was similar to other Ara h 3 proteins, this new protein had novel characteristics.

PAGE 13

1 CHAPTER 1 INTRODUCTION A food allergy is defined as an adverse reaction to foods that is mediated immunologically and involves either specific immunoglobulin E (IgE) or non-IgE mechanisms. Approximately 6-8% of children less than three years of age, and up to 2.5% of adults have some type of food allergy with peanut, milk, eggs, wheat and soybean accounting for the majority of allergic reactions (Bock, 1987; Sampson, 1999a). Plants are the most important sources of food allergic reactions, resulting in the most frequent cases of systemic reactions and of fatal anaphylaxis, and peanut tends to have one of the most severe reactions (Taylor, 1987). Over 600,000 American children have a peanut allergy and the number affected appears to be growing, having doubled in the last 10 years. As little as half a peanut can cause a fatal reaction for severely allergic individuals. Additionally, many more people have severe but non-life threatening allergic reactions to peanut, and for the rest of their lives they must avoid consumption of all products containing peanut (Hoffman and Haddad, 1974). However, avoiding peanut in food products is difficult. It is used in many processed food products and is often part of r ecipes that one would not suspect to contain this ingredient. Those allergic to peanut are advised to avoid all peanut products, many baked goods (pastries, cookies, etc.), chili, chocolate candy, egg rolls, hydrolyzed protein, marzipan, nougat and many African, Chinese, and Thai ethnic dishes. While most children outgrow other allergies, an allergy to peanuts is considered life-long; there is no cure for peanut allergies.

PAGE 14

2 Yet peanut is a low cost, highly nutriti ous and popular food worldwide. Peanuts and peanut butter are among America's most popular foods. America's per capita consumption of peanuts and peanut products is greater than six pounds per year. Peanut products have many health benefits. Peanuts contain mostly unsaturated fat, which has been shown to lower LDL-cholesterol levels in blood and reduce the risk of heart attack. Peanuts are a good source of folic acid, helping prevent neural tube defects. Peanuts contain fiber, reducing the risk of some types of cancer, and control blood sugar levels. Peanuts also contain nearly half of the 13 essential vitamins and 35% of the essential minerals. Therefore, it is important that a way is found to reduce the food allergy risk associated with peanut. Three major peanut allergen genes, ara h 1, ara h 2, and ara h 3, have been cloned as cDNAs. Their corresponding proteins are Ara h 1 (65-kD vicilin; Burks et al ., 1991), Ara h 2 (17kD conglutin; Stanley et al ., 1997), and Ara h 3 (60-kD glycinin; Burks et al ., 1998; Rabjohn et al ., 1999; Kleber-Janke et al ., 1999), respectively. These seed storage proteins have been analyzed for their antigenic determinants (Burks et al. , 1991, 1995a; Stanley et al ., 1997; Rabjohn et al ., 1999). To date, examples of plants genetically engineered to reduce production of an allergen are rice (Nakamura and Matsuda 1996; Tada et al ., 1996), ryegrass (Bhalla et al ., 1999), and soybean (Herman, 2003). These studies may provide models for producing hypoallergenic peanuts. However, initially it is important to characterize the major peanut allergen genes and their corresponding proteins by biochemical and molecular methods in order to apply appropriate genetic modifications. Consequently, one objective of this research was to characterize the expression patterns of ara h 1, ara h 2 and ara h 3 and

PAGE 15

3 their corresponding proteins in various genotypes, as well as in developing seeds, upon germination, and in flowers, leaves, roots and seedlings. Additionally, more information was sought with regard to members of the gene family encoding Ara h 3. To this end, a cloning study was conducted which resulted in the isolation and characterization of a novel ara h 3. Because there may be peanuts that have a natural variation in levels of these allergens, it may be possible to reduce the allergenicity of peanut through traditional breeding rather than genetic engin eering. Therefore, two different sources of peanut germplasm, Florida breeding lines (from Dr. D.W. Gorbet, University of Florida) and the core of the core collection (from Dr. C.C. Holbrook, USDA), were screened to find peanut plants containing low levels of the major peanut allergens.

PAGE 16

4 CHAPTER 2 LITERATURE REVIEW Food Allergies A food allergy is defined as an adverse immunological (hypersensitive) reaction to food antigens. Food allergies place a significant health, emotional, and economic burden on the people affected and their families. Individuals with a food allergy can display a range of reactions from mild symptoms such as a skin rash to life-threatening anaphylactic shock. Even minute quantities of a food have been known to trigger allergic reactions in sensitized individuals. Children are at a higher risk of death from a food allergy than adults (Sampson et al. , 1992). A food allergy is acquired usually in the first one to two years of life (Kagan, 2003). Approximately 6-8% of children less than three years of age and up to 2.5% of adults have some type of food allergy (Bock, 1987; Sampson, 1999a). It is the leading cause of life-threatening anaphylactic episodes, accounting for 150 deaths per year in the U.S. (Sampson et al. , 1992; Bock et al. , 2001). In the U.K., anaphylaxis in general has doubled during the last decade, with a major increase in the subcategory of food-induced anaphylaxis (Sheikh and Alves, 2000). Some estimates suggest that as many as three million people are allergic to peanuts (groundnuts) or tree nuts (Sicherer et al. , 1999), but the total number suffering from food allergies is unknown. Due to the serious public health concern presented by food allergies, U.S. federal regulators require labeling of foods that contain known food allergens.

PAGE 17

5 The allergens in foods are mostly naturally occurring proteins. The Food Allergy Research Resource Program (Farrp) Allergen Database (http://www.allergenonline.com) contains 98 unique proteins with known sequences that are classified as food allergens. Theoretically, any food containing a protein c ould cause an allergic reaction. However, only eight common foods, cow's milk, egg, fish, crustacea (shrimp, crab, lobster), peanuts, soybean, tree nuts (almonds, walnuts, cashews, etc.) and wheat, are responsible for more than 90% of all food allergies. Eggs, cow's milk, fish, soybeans, tree nuts and wheat are dominant allergens for infants and young children, whereas hypersensitive reactions to crustacea are common in older children and adults; some foods, such as peanut, can affect both groups. Most children (about 85%) lose their sensitivity to allergenic foods within the first three-five years of life (Sampson and McCaskill, 1985). It has been observed that food-specific IgE concentrations fall with tolerance and even children with multiple and severe allergies can achieve tolerance (Sicherer et al. , 1999). Unfortunately, some food allergies can have long-lived sensitivity. Sensitivity to peanut, tree nuts, and seafood is rarely lost; however, it has been shown that about 20% of peanut-allergic children younger than two years achieve tolerance by school age (Hourihane et al. , 1998; Sicherer et al. , 1999; Skolnick et al. , 2001). Food allergic reactions can be broadly divided into IgE-mediated hypersensitivity reactions that account for the majority of food allergies, or non-IgE-mediated immune mechanisms that cause some hypersensitivity disorders (Burks, 2003). IgE antibodies play an immediate and major role in initiating and maintaining the allergic cascade. When exposed to an allergen, B cells are stimulated to produce IgE antibodies and allergenic molecules bind to cell-bound IgE molecules. In turn, IgE antibodies bind to

PAGE 18

6 receptors on mast cells and basophiles and the complexes induce sensitization (Schulman, 2001). IgE-dependent food-allergic reactions affect one or more target organs like the skin, respiratory tract, gastrointestinal tr act, and cardiovascular system (Burks, 2002). Allergic reactions can be caused by direct exposure of the involved organ system to the food or by systemic distribution of proteins af ter ingestion. The skin and respiratory tract are most often affected by IgE-mediated foodinduced allergic reactions, whereas isolated gastrointestinal disorders are most often caused by non-IgE-mediated reactions (Sampson, 1999b). Non-IgE-mediated food allergy involves T cells and macrophages instead of food-specific IgE antibodies. Symptoms due to these non IgE mediated immunologic responses to food affect the same organ systems as the IgE mediated forms (Sicherer, 1999). For example, gastrointestinal symptoms, such as diarrhea and vomiting, are the most common in infants or toddlers. Approximately half of the milk allergies are non-IgE-mediated. Generally, the major food allergens that have been identified are water-soluble glycoproteins that have molecular masses ranging from 10 to 70 kD and are stable following treatment with heat, acid and proteases. The only exception is a transfer RNA, a minor allergen, in shrimp. A given food may contain 10–30 glycoproteins, of which a few may be important in triggering allergic reactions, regardless of their proportion in that particular food. Many casual food proteins bind to the IgE molecules specific for them and trigger the release of mediators, such as histamine, that cause symptoms. The epitope regions on those proteins to which IgE binds could affect the allergic reaction (Chatchatee et al. , 2001). With egg and milk, for example, IgE binding to epitopes that are comprised of

PAGE 19

7 sequential amino acids, compared with epitopes that are dependent on folding conformations, is associated with persistence of allergy (Vila et al. , 2001). Plant Allergens Foods of plant origin are the most important sources of food allergic reactions, resulting in the most frequent cases of systemic allergic reactions and of fatal anaphylaxis. Many plant foods contain stru cturally homologous proteins which show over 70% identity in primary sequence, but are not all equally allergenic (Pastorello et al. , 2002). Plant-derived proteins that are responsible for allergies can be classified into several groups depending on various properties like structure, function, and biochemical and immunological properties. They include several that belong to various families of pathogenesis-related proteins (PR-protei ns), seed storage proteins, proteases, -amylase inhibitors, peroxidases, profilins, thiol proteases and lectins (Breiteneder and Ebner, 2000). In the two major plant-derived allergen source groups, cereals and legumes, most of the allergens are either PR-proteins, or seed storage proteins (HoffmannSommergruber, 2002). In addition, the storage proteins can be further divided into two large superfamily groups, namely the prolamins in cereals and the cupins in legumes. PR-Proteins PR-proteins account for approximately 25% of plant allergens listed on Allergen Nomenclature (http://www.allergen.org), the homepage of the International Union of Immunological Societies (IUIS). In general, PR-proteins are induced by various types of pathogens (viruses, bacteria and fungi), by chemicals that mimic the effects of pathogen infection, such as ethylene and salicylic acid, by stress, by wounding, and by various abiotic stimuli (Brederode et al. , 1991; Yalpani et al. , 1991; Stinzi et al. , 1993; Breiteneder and Ebner, 2000). However, there are PR-proteins that can be constitutively

PAGE 20

8 expressed in some organs such as pollen or fruit that contain tissues that are more likely to be attacked by insects and fungi, or exposed to certain atmospheric conditions such as UV irradiation (Ebner et al. , 2001). PR-proteins have been classified into 14 families and the identified allergens have sequence similarities to proteins belonging to PR-protein families 2, 3, 4, 5, 8, 10, and 14 (Table 2-1, Hoffmann-Sommergruber, 2002). These PR-proteins share some of the characteristics that are relevant for plantderived allergens. They are usually small proteins that are stable at low pH and resistant to proteolysis (Hoffmann-Sommergruber, 2002). These allergenic PR-proteins are chitinases, glucanases, endoproteinases and peroxidases, as well as defensins, thionins, and lipid transfer proteins (LTPs). Recently, a major allergen of maize was identified as a 9 kD protein belonging to the LTP family (Pastorello et al. , 2000, 2001a). Interestingly, this maize LTP shares higher homology with a peach and rice LTP (79%) than with the LTPs of other cereals like wheat (59%) and barley (57%). This fact shows that sensitization to PRproteins of plants can cause cross-reactions between botanically unrelated foods (Blanco et al. , 1999; Sanchez-Monge et al. , 2000). Seed Storage Proteins In general, seed proteins can be broadly classified into either housekeeping or storage proteins (Mandal and Mandal, 2000). The housekeeping proteins are responsible for maintaining normal cell metabolism and can be divided into structural proteins such as histone proteins or biologically active prot eins such as lectins, hormones, enzymes and enzyme inhibitors. Compositionally, these are minor proteins within seeds although they may have nutritionally more balanced amino acid composition than storage proteins. On the other hand, storage proteins are non-enzymatic and their sole purpose is to provide nitrogen, sulphur and carbon during seed germination and plant establishment (Müntz,

PAGE 21

9 1998). According to their solubility, seed storage proteins are classified as either albumins, globulins, prolamins or glutelins (Table 2-2, Osborne, 1924). Albumins and globulins are the major seed storage proteins found in dicots, whereas prolamins and glutelins are the dominant seed storage proteins in monocots. Based on more recent and extensive molecular and biochemical analysis of storage protein genes and their encoded products, most storage proteins are albumins, globulins and prolamins (Table 2-3, Shewry et al. , 1995). Storage proteins are synthesized as premature proteins with a signal peptide on the cytoplasmic side of the rough ER (rER). When storage proteins are transported via the Golgi apparatus, they are converted into their mature forms and accumulated in protein bodies (PBs), which are specialized membrane-bounded storage organelles (Müntz, 1989, 1998; Shewry et al. , 1995; Shimada et al. , 2003). Recently, it was demonstrated that receptor-mediated transport may be one of the major mechanisms for sorting storage proteins to PBs in higher plants (Shimada et al. , 2003). After transfer into the PBs, seed storage proteins are further processed, resulting in conformational changes that allow effective deposition (Müntz, 1998). Seed storage proteins are protected against breakdown until their amino acids are needed for germination. The PBs can be derived from either vacuoles or the ER. Globulins are deposited in PBs derived from vacuoles (Herman et al ., 1994; Nielsen et al. , 1996; Muench and Okita, 1997; Robinson et al. , 1998; Herman and Larkins, 1999). Many newly synthesized globulins are transported to the protein storag e vacuoles (PSVs) via vesicles originating from the Golgi apparatus. Recently, it was revealed that the specific C-terminal sequence of the ' subunit of -conglycinin (7S globulin) called the vacuolar sorting determinant

PAGE 22

10 (VSD) plays an important role in tr ansport of this protein (Nishizawa et al. , 2003). However, it was demonstrated that vacuolar transport of proteins can proceed by several different routes (Okita and Rogers, 1996; Robinson et al. , 1998). Cereal storage proteins such as prolamins are also produced by the secretory pathway and deposited in PBs originating from the ER (Shewry and Halford, 2002). The mechanisms of prolamin transport and deposition are less understood than those of globulins; however, it has been demonstrated that two possible mechanisms may occur. In maize, sorghum, millet, and rice, prolamins appear to accumulate directly within the lumen of the ER, leading to the formation of discrete PBs surrounded by a membrane of an ER origin (Coleman and Larkins, 1999; Muench et al ., 1999). In the second mechanism, prolamins are synthesized in a subdomain of the ER from mRNAs for prolamins targeted to the rER associated with the developing prolamin-containing PBs (Li et al ., 1993; Choi et al ., 2000). During germination and seedling growth, storage proteins in PBs are degraded into small peptides that are subsequently mobilized in the growing seedling (Wilson et al. , 1986; Shutov and Vaintraub, 1987; Shutov et al. , 2003). Storage proteins are first cleaved by specific endoproteinases and the resulting peptides are then hydrolyzed to free amino acids by multiple reactions of exoand/or endopeptidases, which are less specific (Callis, 1995). Cysteine proteinases (CPRs) are some of the main enzymes responsible for initiating and mediating degradation and mobilization of storage proteins in cereals and dicotyledonous plants (Wilson et al. , 1986; Shutov and Vaintraub, 1987; Becker et al. , 1994, 1995; Müntz, 1996; Schlereth et al. , 2000; Müntz et al. , 2001).

PAGE 23

11 Cereal allergens and the prolamin superfamily Cereals are the most important food crops in the world, but they can elicit both respiratory allergic reactions and food allergic reactions. The three major cereals, maize, rice and wheat, account for over 70% of total world production with the remaining production being in barley, sorghum, millet, oats, rye and some dicots. In mature cereal grains, storage proteins account for approximate ly 50% of total protein, but cereal grains contain relatively little protein (10-12%) compared to legume seeds (20-40%). Prolamins are the major storage proteins of cereals (Shewry and Tatham, 1990). They represent 30 to70% of the total among different cereals and protein groups (Shewry and Halford, 2002). Prolamins are insoluble in water, but soluble in alcohol/water mixtures. They are generally rich in proline and amide nitrogen derived from glutamine (Shewry and Tatham, 1990). Prolamins vary in size (10 ~100 kD) and structure. Nevertheless, the characteristics of typical prolamins were examined from triticeae (wheat, barley, and rye) and classified into three groups: sulphur-rich (S-rich), sulphurpoor (S-poor) and high molecular weight (HMW) prolamins, with several subgroups (Table 2-4, Shewry and Halford, 2002). Based on sequence similarity and repeated sequences such as proline-rich and glutamine-rich motifs, it appears that the S-rich, Spoor, and HMW prolamins have a common evolutionary origin. Evolutionary and structural studies have shown a strong relati onship among the prolamins of maize (zeins), the prolamins of oats and rice, 2S albumin proteins of dicotyledonous seeds, -amylase and trypsin inhibitors of cereal seed, and a range of cysteine-rich plant proteins like LTPs in cereal (Kreis et al ., 1985; Shewry and Halford, 2002). The prolamin superfamily includes several major plant allergens such as the trypsin/ -amylase inhibitor family of proteins and the 2S albumin storage proteins (Urisu

PAGE 24

12 et al. , 1991; James et al. , 1997; Shewry et al. , 1995, 2002). Buckwheat ( Fagopyrum esculentum ) has been recognized as a common food allergen in Korea, Japan, and other countries, and is a good example of a cereal containing prolamin allergens (Park et al. , 1997). Among several identified allergens ranging from 9 to 67 kD, three allergens which are 9, 16, and 19 kD, have been identified as a trypsin inhibitor, an -amylase/trypsin inhibitor of millet homologue, and an -globulin homologue of rice belonging to the 2S albumins, respectively (Park et al. , 2000). The 2S albumins, initially defined as a group on the basis of their sedimentation coefficient of ~2, also are widely distributed in dicotyledonous seeds (Shewry et al. , 1995). The 2S albumins fall into several differe nt groups of unrelated proteins, including one group which shows homology to the 2S albumins from rape, sunflower and Brazil nut, but also has limited sequence homology to several amylase and proteinase inhibitors (Shewry and Tatham, 1990). The 2S albumins are heterodimers with conserved cysteine residues. Many plant proteins in the 2S albumin family have been identified as major allergens in sesame ( Sesamum indicum ) (Pastorello et al. , 2001b; Beyer et al. , 2002), English walnut ( Juglans regia ) (Teuber et al. , 1998), Brazil nut ( Bertholletia excelsa ) (Pastorello et al. , 1998), sunflower ( Helianthus annus ) (Kelly et al. , 2000) and castor bean ( Ricinus communis) (Thorpe et al. , 1988). For example, Ses I 1, a major allergen in sesame, is a 10 kD 2S albumin and is highly homologous to other allergenic proteins like the 2S albumins of Brazil nuts (similarity 87%, identity 47%), castor beans (similarity 65%, identity 41%), and sunflowers (similarity 93%, identity 43%) (Pastorello et al. , 2001a).

PAGE 25

13 Gliadins, which are wheat prolamins, have been identified as the major allergenic proteins responsible for wheat allergy in at opic dermatitis and wheat-dependent, exerciseinduced anaphylaxis (Palosuo et al. , 1999; Varjonen et al. ,1995, 1997, 2000). These proteins also show cross-reactivity with other cereal antigens (Palosuo et al. , 2001). Legume allergens and the cupin superfamily Globulins are the most widely distributed major storage proteins of legume seeds (Shewry et al. , 1995). Most seed legumes contain two major globulin fractions, legumin and vicilin, which have sedimentation coe fficients of approximately 7S and 11S, respectively, and share sequence homology (Shewry et al. , 1995; Freitas et al. , 2000). These 7S and 11S globulins are also referred to by common names (Table 2-5) and are composed of polymorphic subunits encoded by small multigene families that are coordinately expressed during cotyledon development (Goldberg et al. , 1989; Thomas, 1993). The 7S and 11S globulins belong to the cupin superfamily of proteins. Cupins contain both enzymatic and non-enzymatic members (Dunwell et al. , 2001). The cupin storage proteins, which include both the 11 S and 7 S globulins, have two cupin domains called bicupins and are very stable proteins. This double-stranded -helix structure contributes to their stability against both thermal denaturation and proteolysis (Mills et al. , 2002). Such stability may contribute to their potent allergenicity along with their abundance in the diet. The 7S globulins or vicilins are usually composed of a large number of polypeptides ranging from 10 to 70 kD in size. The 7S globulins are typically trimeric proteins that lack cysteine residues and have variable glycosylation (Table 2-5, Shewry et

PAGE 26

14 al. , 1995). Disulfide bonds are generally not necessary for the folding and assembly of these storage proteins. Their detailed subunit compositions are considerably variable, due to differences in the extent of posttranslational processing such as proteolysis and glycosylation. The 11S globulins or legumins are the major storage proteins in most legumes and also in many other dicots and some cereals. The mature proteins consist of hexamers and each subunit pair of hexamers consists of an acidic subunit and a basic subunit that are linked by a single disulfide bond (Shewry et al. , 1995). Each subunit is synthesized as a precursor that will be proteolytically cleaved after disulfide bond formation and they are generally not glycosylated. The legumins of soybean, which are also known as glycinins, arise from the expression of a family of approximately five genes. Each gene encodes a precursor of a monomer unit that undergoes a complex series of posttranslational modifications until deposition in PBs, where each polypeptide is assembled to produce the final hexameric form (Dickinson et al. , 1989; Nielsen et al. , 1989). The monomers consist of two disulfide-linked polypeptide chains which are designated as A (acidic) and B (basic). The hexamers contain random combinations of the monomers (Thanh and Shibasaki, 1978). However, the assembly of the legumins is highly regulated (Dickinson et al. , 1989). The 7S and 11S globulin subunits are related in structure and have similar evolutionary roots (Gibbs et al. , 1989; Lawrence et al. , 1994; Shutov and Bäumlein, 1999). The multiple sequence elements are conserved or exchanged among members of both families (Lawrence et al. , 1994). For example, A and B of the 11S legumins are related to the N-terminal and C-terminal regions of the 7S vicilins, respectively (Gibbs et

PAGE 27

15 al. , 1989; Ko et al. , 1993; Shewry et al. , 1995; Oliveira et al. , 2002). In addition, the 7S and 11S globulins come from an ancestral gene duplication (Harada et al. , 1989; Shewry et al. , 1995; Shutov et al. , 1995). Peanut ( Arachis hypogaea L.) Peanut (Arachis hypogaea L.) is a self-pollinating, tetraploid, tropical plant that originated in South America (Simpson et al ., 2001). Under optimum conditions, the peanut plant will begin emerging through the soil surface five to ten days after planting (DAP) and then grow to about 60 cm tall. Growth is slow until about 40 DAP, and becomes more rapid until 100 DAP. Peanut has small, yellow flowers (about 1~2cm long) that are produced 25 to 60 DAP. Peanuts show an unusual pattern of fruit development. After fertilization, a new organ called the “gynophore or peg” differentiates from the ovary. When the flower becomes fertilized, the peg from the fertilized ovary begins to elongate and bends toward the soil surface. The tip of the peg is pointed, allowing it to penetrate the soil easily. The developing peanut fruit is in the tip of the peg and begins to enlarge about 10 to 12 days after fertilization. Little mitotic division occurs in the embryo or endosperm during the active geotropic peg growth. When the peg penetrates the soil, rapid embryonic cell division begins. The peanut fruit then matures over the next 9 to 10 weeks. Peanut seeds contain large amounts of oil and protein. The oil content of peanut seed ranges from 36 to 54%. Because peanut has such a high oil content, the composition of the oil plays a major role in defining peanut quality. Peanut seed protein content ranges from 24 to 29%, with most genotypes averaging about 25% (Koppelman et al. , 2001). Peanut seed extracts show variation in protein quantity depending on the type and amount of extraction medium used. It has been

PAGE 28

16 classically demonstrated that peanut seeds contain globulins (85%), which are composed of two major globulin proteins, arachin (legumin, 11S), conarachin (vicilin, 7S), and albumin (15%) (Krishnan et al., 1986). Arachin is composed of two species, a monomer (arachin I) and a dimer (arachin II), both having a monomer molecular weight of 180 kD and the same subunit structure. Conarachin has also been separated into two species, conarachin I and conarachin II, with differing subunit structures (Yamada et al ., 1979). Conarachin II has a molecular weight of 180 kD, consisting of three subunits with molecular weights of 65 kD (Yamada et al. , 1981). Cultivated peanut is an allotetraploid ( 2n = 4x = 40) composed of A and B genomes (Husted, 1933; Strebbins, 1957), and is believed to have originated recently from a single hybridization event (Kochert et al., 1996). Archaeological evidence from excavations in Peru place the origin of A. hypogaea at least 3500 years ago (Singh and Simpson, 1994). Cytological studies of A. hypogaea observed 20 chromosome bivalents at meiosis in 88% to 98% of cells; the exceptions were rare univalents, trivalents, and quadrivalents, which suggested limited homologous pairing between the A and B genomes that comprise the tetraploid (Singh and Moss, 1982; Wynne and Halward, 1989). Its recent origin is thought to account for the paucity of genetic diversity among cultivated genotypes in comparison to their wild relatives. Only one other species in section Arachis , A. monticola Krapov. and Rigoni, is tetraploid and readily crossable with A. hypogaea ; they are virtually indistinguishable from one another based on DNA markers (Halward et al. , 1991; Kochert et al. , 1991). Consequently, A. monticola was considered to be the most likely candidate for a direct ancestor of A. hypogaea . However, some scientists believe A. monticola is simply a weedy subspecies of A. hypogaea instead

PAGE 29

17 of its progenitor (Kochert et al. , 1991). Numerous cytological and molecular investigations strongly suggest that two wild diploid species, A. duranensis and A. ipaensis , are the most likely progenitors of A. hypogaea , representing the A and B genomes, respectively (Fernandez and Krapovickas 1994; Kochert et al. , 1996; Jung et al. , 2003). Peanut Allergy Of all plant-based food allergies, peanuts cause the most serious cases of fatal foodinduced anaphylaxis (Yocum and Khan, 1994). Peanuts along with milk and eggs account for about 80% of adverse reactions to foods in patients with atopic dermatitis. It has been demonstrated that 1.3% of adults are allergic to peanuts or tree nuts (Sicherer et al. , 1999), and allergic reactions to peanuts in children have nearly doubled during the last decade in the U.S. (Sampson, 1996, Burks, 2003). Seed storage proteins, which are recognized by more than 50% of peanut-allergic patients, appear to be the major peanut allergens. Presently, 20 peanut allergens have been reported, but proteins designated as Ara h 1 (vicilin, 7S or conarachin), Ara h 2 (conglutin), Ara h 3 (glycinin or 11S) are considered to be the major peanut allergens (Burks et al. , 1991, 1992a, b, 1994,1995a, b, c, 1998; Eigenmann et al. , 1996; Rabjohn et al. , 1999). Ara h 1, Ara h 2 and Ara h 3 have been recognized by 65%, 85% and 50% of peanut allergic patients, respectively. Protei n studies of the four peanut market types (Runner, Spanish, Virginia, and Valencia) showed that they contained 12-16% Ara h 1 and 6-9% Ara h 2. No significant differences in the amount of protein in seeds were identified based on the type of peanut or the location where the peanut was grown (Koppelman et al. , 2001). However, there is no report for Ara h 3.

PAGE 30

18 Using phage display technology, other peanut allergens, Ara h 4 (glycinin), Ara h 5 (profilin), Ara h 6 (conglutin), and Ara h 7 (conglutin) have been identified (KleberJanke et al. , 1999). Ara h 4 appears to be an isoform of Ara h 3, sharing 91% identity with Ara h 3 at the nucleotide level (Kleber-Janke et al. , 1999). Also, there are two more identified Ara h 3 homologous peanut seed stor age proteins designated as Gly1 and Ara h 3/Ara h 4. The proteins Ara h 5, Ara h 6, and Ara h 7 are considered to be minor allergens, since they are recognized by only 13%, 38%, and 43% of peanut allergic patients, respectively (Becker and Reese, 2001). The characteristics of peanut allergens are summarized in Table 2-6. Peanuts roasted at 170°C, the most common cooking method in the U.S., bind 90% more serum IgE from allergic individuals than raw, boiled (100°C), or fried (120°C) peanuts (Maleki et al. , 2000a; Beyer et al. , 2001). Also, roasted peanuts may contain proteins that are more resistant to degr adation by endogenous proteases during gastric digestion. These facts suggest that cooking peanuts at high temperature lead to irreversible changes in protein structure and increase the allergenicity of peanut. Ara h 1 Ara h 1 (63.5 kD) was isolated and identified as a peanut allergen by Enzyme Linked Immunosorbent Assay (ELISA) and Ig E-specific immunoblotting with sera from peanut sensitive patients (Burks et al. , 1991). The allergenicity of Ara h 1 may be variable according to populations (Koppleman et al. , 2001). Although Ara h 1 was recognized by >90% of peanut-sensitive indi viduals from a North American population (Burks et al. , 1991,1995c), it was recognized by only 35% (de Jong et al. , 1998), 65% (Kleber-Janke et al. , 1999), and 70% (Clarke et al. , 1998) of patients from three European populations. From epitope analys is of Ara h 1, 23 independent IgE-binding

PAGE 31

19 sites have been identified and they are evenly distributed along the linear sequence of the molecule (Burks et al. , 1997). The critical amino acids that are important for IgE binding were determined within each epitope and hydrophobic residues were recognized as the most critical for IgE binding. Also, the substitution of a single amino acid within each epitope led to loss of IgE binding ability. It was also observed that IgE binding to Ara h 1 could be inhibited by pea vicilin. This observa tion suggests the cross-reactivity of Ara h 1 with other vicilin homologues (Wesing et al. , 2003). Ara h 1 is a homo-trimer with IgE binding epitopes located in the area of monomeric interactions mediated mainly by hydrophobic interactions (Shin et al. , 1998). The allergenicity of Ara h 1 is heat-stable, although native Ara h 1 is significantly denatured by heat (Koppelman et al. , 1999). This heat-stable allergenicity of Ara h 1 is a result of structural modifications following the thermal process. During the Maillard reactions, heated proteins undergo structural changes in the presence of sugars that result in protein cross-linking and loss or modifica tion of certain amino acids. When Ara h 1 was incubated with several proteinases, various protease-resistant fragments containing IgE-binding sites were still obtained. Therefore, the structure of Ara h 1 may be critical for its allergenicity by protecting the epitopes from proteinase digestion (Maleki et al. , 2000b). A 65 kD peanut allergen, Con (Concanavalin) A-reactive glycoprotein (CARG), was identified as a major allergen in the 1980s (Barnett et al. , 1983; Barnett and Howden, 1986). CARG is 2.4% carbohydrate and is stable against heat and pH changes. CARG is now considered identical to Ara h 1.

PAGE 32

20 Two ara h 1 cDNAs encoding Ara h 1 have been cloned (Burks et al. , 1991, 1995a). These two cDNAs are 97% homologous at the nucleotide level. The ara h 1 transcript is 2.3 kb and is abundant in mature peanut seed. At the protein level, ara h 1 showed homology with soybean and pea vicilins (40%), and at the nucleotide level, with broad bean and pea vicilins (64%) (Burks et al. , 1991, 1995c). Recently, a full-length ara h 1 genomic clone (4447 bp) was isolated from a peanut library (Viquez et al. , 2003). Sequence analysis of this genomic clone revealed that there are four exons of 721, 176, 81 and 903 bp and three introns of 71, 249 and 74 bp. The deduced amino acid encodes a protein of 626 residues that is identical to the Ara h 1 cDNA clone P41b. Several characterized cis -elements were found in the promoter region such as two TATA-boxes (TATATAAATA at -89and TTATATATAT at -348), a CAAT-box (CAAT at -133), a GC-box (CGGGACCGGGCCGG GCCTTCGGGCCGGGCCGGGT at -475), two Gboxes (TAACACGTACAC at -264 and ATGGACGTGAAA at -1808), and two RY elements (CATGCAC at -235 and CATGCAT at -278) (Viquez et al. , 2003). Ara h 2 Ara h 2 is a conglutin, which is a sulfur-rich protein. Also, Ara h 2 shares sequence homology with 2S albumins, mabinlins, and -amylase inhibitors (Stanley et al. , 1997). Ara h 2 is composed of two similar sized gl ycoproteins containing eight cysteine residues (Burks et al. , 1992b; Sen et al. , 2002). It migrates as a doublet of 17 to 20 kD (Burks et al. , 1995b,c) and these sizes were recently corrected to 16,670 and 18,050 Daltons following mass spectroscopy (Chatel et al. , 2003a). Ara h 2 is recognized by serum IgE from 90% of tested allergic individuals regardless of the population origin (Koppleman et al. , 2001). Ten IgE binding epitopes have been identified through peptide analysis. Three of the epitopes have been

PAGE 33

21 characterized as immunodominant epitopes. Two regions of these three epitopes contain the amino acid sequence, DPYSPS, which is considered to be necessary for IgE binding (Stanley et al. , 1997). In addition, the additional 12 amino acids of Ara h 2.02 contain a third repeat of the major linear IgE epitope motif DPYSPS (Chatel et al. , 2003a). Like Ara h 1, the protein structure of Ara h 2 plays an important role in its ability to maintain allergenicity following heat treatment and digestion (Maleki et al. , 2000a, b, 2003). Disulfide bonds appear to contribute significantly to the overall structure and stability of Ara h 2 (Sen et al. , 2002). Recently, it has been determined that Ara h 2 has functional homology with a trypsin inhibitor (Maleki et al. , 2003). In the early 1980s, peanut-1 was isolated as a peanut allergen and partially purified from raw peanuts (Sachs et al ., 1981). It contained two bands of ~20 and ~30 kD on SDS-PAGE and was a major acidic glycoprotein. Peanut-1 is now considered to be identical to Ara h 2. An ara h 2 cDNA clone of 741 bp was identified using oligonucletide primers deduced from the amino acid sequence of purified Ara h 2 (Stanley et al. , 1997). The calculated size of the protein it encoded was ~17.5 kD and the deduced protein sequence was identical to purified Ara h 2 (Stanley et al. , 1997). This clone hybridized to a ~0.7 kb mRNA on northern blots. Also, when northern analysis was performed with another ara h 2 clone (Psc32), a 0.7 kb mRNA was also observed and shown to accumulate in maturing seeds (Paik-Ro et al. , 2002). Recently, two additional ara h 2 cDNAs were isolated and named ara h 2.01 and ara h 2.02. The ara h 2.01 was 98% identical to the previously isolated partial cDNA (Stanely et al. , 1997) and the two clones are 98.1% identical in amino acid sequence (Chatel et al. , 2003a). The only difference between ara

PAGE 34

22 h 2.01 and ara h 2.02 is that ara h 2.02 has an insertion of 36 nucleotides. These two clones encode the corresponding protein doublets described above (Chatel et al. , 2003a). The first genomic clone of ara h 2 has been isolated and characterized (Viquez et al. , 2001). Sequence analysis showed that it contains an open reading frame of 622 bp with no introns and the deduced amino acid sequence contains 207 residues with a putative signal peptide. Ara h 3 Originally, a 14 kD protein was sequenced and identified as Ara h 3 from an experiment with soybean-adsorbed IgE serum from peanut-hypersensitive patients (Eigenmann et al. , 1996). Since the calculated size of the encoded protein from an ara h 3 cDNA was ~57 kD (Rabjohn et al. , 1999), this 14 kD protein is now considered to be a breakdown product of the larger protein after processing. As expected, the isolated Ara h 3 is a legumin-like seed storage protein that has homology with glycinin (Rabjohn et al. , 1999). A recombinant Ara h 3 was expressed in a bacterial system and was recognized by serum IgE from ~44% of 18 peanut hypersensitive patients tested (Rabjohn et al. , 1999). Using linear IgE-binding epitope analysis, four epitopes were identified as dominant for IgE binding. One region was recognized by all tested peanut allergic patients. Even a single amino acid change resulted in a reduction or loss of IgE binding properties in these dominant epitopes (Rabjohn et al. , 1999). The epitopes of Ara h 3 are similar to those within the soybean glycinin 1 (G1) acidic chain (Beardslee et al. , 2000). Ara h 3 subunits are very abundant preproglobulins that accumulate in PBs. Each subunit is synthesized as a precursor protein and is composed of an N-terminal acidic and a C-terminal basic chain that are linked by a disulfide bond. After proteolytic cleavage of

PAGE 35

23 the disulfide bond, mature hexamers are formed by noncovalent connections among six similar subunits. Ara h 3 proteins range in size from 14 to 45 kD on SDS-PAGE (Koppelman et al. , 2003). These serial, multiple bands are a result of posttranslational processing of Ara h 3 subunits. Also, these posttranslational changes can affect the IgEbinding properties of these Ara h 3 proteins (Koppelman et al. , 2003). The first published ara h 3 clone was a cDNA fragment of 1,530 nucleotides (Rabjohn et al. , 1999). The calculated size of the protein encoded by this open reading frame was ~57 kD. This cDNA lacked the extreme 5' end that encodes the signal peptide with the initiator methionine. This ara h 3 has homology with glycinin which is the major 11S globulin seed storage protein in soybean and pea (Rabjohn et al. , 1999). Other cDNAs encoding a peanut glycinin are ara h 4 (Kleber-Janke et al. , 1999) and gly 1 (ACCESSION: AF125192). These three cDNAs share more than 85% sequence similarity at the nucleotide level (see, Table 3-1). Also, the first genomic clone of ara h 3 has been isolated and named ara h 3/ ara h 4 (ACCESSION: AF510854). Treatment Strategies to Reduce Allergic Responses In order to treat food allergies, it is necessary to test food allergies for each patient. Also, food allergies must be determined for each food separately. Skin tests and radioallergosorbent tests (RASTs) are usef ul methods for detecting food specific IgEmediated hypersensitivity, although they are not always useful in predicting allergic symptoms in diagnosis, because of IgE-independent allergic reactions (Chatchatee et al. , 2001; Palosuo et al. 2001; Vila et al. , 2001; Sicherer, 2002). After identification of the foods that cause allergies, numerous treatment strategies can then be used. The best method is to avoid the allergen, by eliminating it from the diet; however, total avoidance is difficult for most people, since eggs, peanuts, tree nuts and

PAGE 36

24 milk are common ingredients in many foods. Also, there are humanized antibodies against IgE (Appendix A), which are designed to reduce allergic responses (Burks et al. , 2001; Casale et al. , 2001). Immunotherapy, or an allergy shot, is another approach to treatment but it can be impractical, because the injection of food protein usually results in anaphylaxis (Nelson et al. , 1997). Engineered proteins, with altered stru ctures that no longer contain IgE binding epitopes, have been designed to solve this problem (Bannon et al. , 2001; Burks et al. , 1999, 2001; Rabjohn et al. , 2002). These genetically engineered and synthetic allergens can be candidates for vaccination (Valenta et al. , 1999). In fact, an Ara h 3 modified at critical IgE binding sites had reduced binding capacity for IgE from peanuthypersensitive patients and stimulated T-cell proliferation and activation which resulted in hypoallergenicity (Rabjohn et al. , 2002). Another approach to induce tolerance to a specific food allergen is vaccination with DNA sequences that code for food allergens (Li et al. , 1999; Adel-Patient et al. , 2001; Roy et al. , 1999). Additionally, the use of immune modulators like cytokines and specific DNA sequences can direct the immune response away from an allergy. The advent of molecular cloning and the ability to genetically transform plants have led to the production of hypoallergenic plants by eliminating allergen production (Bhalla and Singh, 2004). It has been demonstrated that gene silencing strategies operating at the post-transcriptional level are highly suitable for blocking allergen production in rice (Tada et al ., 1996) and rye (Bhalla et al ., 1999). In rice, an antisense strategy resulted in suppression of expression of the 14-16 kD allergen gene in maturing rice seeds (Tada et al ., 1996). It was also demonstrated that Lol p 5, the major allergenic

PAGE 37

25 protein of ryegrass pollen allergen was suppressed by introducing antisense constructs into ryegrass without affecting normal pollen development (Bhalla et al ., 1999). Transgene-induced gene silencing was used to prevent the accumulation of Gly m Bd 30 K protein in soybean seeds (Herman et al ., 2003). The Gly m Bd 30 K-silenced plants and their seeds lacked any compositional, developmental, structural, or ultrastructural phenotypic differences when compared with control plants. It has been possible to reduce or remove some allergens by the development of soybean mutant lines; however, to date, mutagenesis and breeding have not been successful for the dominant soybean allergen (Ogawa et al. , 2000; Herman, 2003). However, biotechnology has been used to remove a major allergen in soybean demonstrating that genetic modification can be used to reduce allergenicity of food and feed (Herman, 2003). Therefore, biotechnology can be used to characterize and eliminate allergens naturally present in crops.

PAGE 38

26 Table 2-1. Allergens related to PR-proteins1 Family Designation Source Allergen name PR-2 -1,3Glucanases Hevea brasiliensis latex, banana Hev b 2 PR-3 Class I chitinases Avocado, H. brasiliensis latex, chestnut, banana Pers a 1, Hev b 11, Cas s 5 PR-4 Chitinases H. brasiliensis latex, turnip Hev b 6 PR-5 TLPs Cherry, apple, bell pepper, mountain cedar Pru av 2, Mal d 2, Cap a 1, Jun a 3 PR-8 Class III chitinases H. brasiliensis latex Hevamine PR-10 Unknown; Bet v 1 homologues Birch, hazel, alder, hornbeam, chestnut, apple, celery, cherry, peach, apricot, pear, carrot, potato, parsley Bet v 1, Cor a 1, Aln g 1, Car b 1, Cas s 1, Mal d 1, Api g 1, Pru av 1, Pru p 1, Pru ar 1, Pyr c 1, Dau c 1, STH-2, PcPR-1 PR-14 LTPs Peach, apple, soybean, apricot, plum, cherry, barley, H. brasiliensis latex, chestnut, hazelnut, walnut, mugwort, ragweed, asparagus, grape, maize, olive Pru p 3, Mal d 3, Gly m 1, Pru av 3, Art v 3, Amb a 6, Par j 1,2, Cas s 8, Cor a 8, Jug r 1, Aspa o 1, Vit v 1, Hev b 12, Zea m 14, Ole e 7 1Hoffmann-Sommergruber, 2002.

PAGE 39

27 Table 2-2. Seed storage proteins based on their solubility1 Seed storage protein Solubility (sedimentation coefficient) Albumins water (1.6~2 S) Globulins low salt solution (7~13 S) Prolamins aqueous alcohol Gluteins2 weakly acidic or alkaline solution or dilute SDS solution 1Osborne, 1924. 2Most difficult to solubilize.

PAGE 40

28 Table 2-3. Classification of seed storage proteins Class Name (plant) Characteristics 2S albumins Napin (Cruciferase), Conglutin (Lupin), SFA8, albumin (sunflower), Albumins (caster bean) heterodimeric proteins; allergenic in some plants and -gliadins (wheat) S-rich C hordein (barley), -secalins (rye), -gliadins (wheat) S-poor Low molecular weight HMW prolamin (wheat) High molecular weight Prolamins avenin (oats), 10kD of S-rich prolamin (rice) zein (maize) Prolamins in other species; No functional N motif in zein gene promoters 7S, vicilin-like proteins vicilin box as cis -element Globulins 11S, legumin-like proteins legumin box as cis -element

PAGE 41

29 Table 2-4. Types and characteritics of wheat grain prolamins (gluten proteins)1 Components Molecular mass (% total) Polymers or Monomers Properties HMW prolamins HMW subunits of glutenin 65-90000 (6-10%) Polymer Prolamin box2 (position:-185); No N motif3 Similar E motif4 S-rich prolamins -gliadins -gliadins B-and C-type LMW subunits of glutenin 30-45000 (70-80%) Monomer Monomer Polymer Prolamin box (position:-300); N motif E motif S-poor prolamins -gliadins D-type LMW subunits of glutenin 30-75000 (10-20%) Monomer Polymer Prolamin Box position:-300); N motif (reverse orientation) E motif 1Shewry and Halford, 2002 2The prolamin box is the conserved regulatory sequence in prolamin genes. 3N motif is a motif involved in the response to nitrogen within the prolamin box and has the consensus sequence, G(A/G)TGAGTCAT. 4E motif is a second highly conserved motif (TGTAAAGT) in the prolamin box.

PAGE 42

30 Table 2-5. Common names of legume globulins 7S1 Glycosylation3 11S2 Glycosylation3 Pea ( Pea sativum L . ) vicilin + legumin broad bean ( Vicia faba L.) vicilin legumin Lupinus albus -conglutin + -conglutin + Soybean ( Glycine max L. Merr.) -conglycinin glycinin + Peanut ( Arachis hypogaea L.) conarachin arachin Jack bean ( Canavalia ensiformis L . ) canavalin unknown unknown unknown Common bean ( Phasealus vulgaris L.) phaseolin + unknown unknown Lentil ( Lens culinaris Med.) vicilin legumin Chickpea ( Cier arietinum L.) vicilin + legumin + 17S is -conglutin related proteins 211S is -conglutin related proteins 3Glycosylation was determined by the presence of carbohydrate residues

PAGE 43

31 Table 2-6. Properties of peanut allergens Ara h 1 Ara h 2 Biological Function Vicilin-like (7S) seed storage protein Conglutin-like (2S) seed storage protein Molecular Mass 63.5, 65, and 68 kD in SDS-PAGE 17 and 20 kD in SDS-PAGE Isoelectric Point pI 4.55 pI 5.2 Gene Product Size About 1.9~2.3 kb of mRNA About 620 amino acid residues About 0.7kb bp of mRNA About 157 amino acid residues Formation of Oligomers Stable trimeric structure Monomeric structure Glycosylation 2.4 % of carbohydrate content 20 % of carbohydrate content Sequence Homology Vicilins from broad beans and pea ( 60~65% DNA) Concanavalin A (ConA) binding peanut allergen; maybe identical Conglutinfrom lupin (39% aa) 2S albumins from sunflower (34% aa) and castor bean (30% aa) Mabinlin I from caper (32~35% aa) Sensitization IgE binding from 65~100% of patients IgE binding from 71~100% of patients B-Cell Epitopes Total 23 IgE-binding epitopes have been identified. 6 epitopes show more than 80% of binding affinity. Total 10 IgE-binding epitopes have been identified. 3 epitopes show more than 100% of binding affinity out of 4 major epitopes. Special Property Known as conarachin Disulfide bonds

PAGE 44

32 Table 2-6 Continued Ara h 3 and related proteins including Ara h 4 Ara h 5 Biological Function Glycinin-like (11S) seed storage protein Profilin-like seed storage protein Molecular Mass 14, 16, 25, 28, 42, and 45 kD 14kD Isoelectric Point pI 5.5 pI 4.6 Gene Product Size About 1.5~1.8 kb of mRNA About 510 amino acid residues 743 bp of mRNA 131 amino acid residues Formation of Oligomers Hexameric structures unknown Glycosylation unknown unknown Sequence Homology Glycinins from soybean and pea with Ara h 3 (62~ 72% aa) and Ara h 4 (56% aa) Profilin from soybean (Gly m 3) (83% aa) Sensitization IgE binding from 44% (Ara h 3) to 53% (Ara h 4) of patients IgE binding from 13% of patients B-Cell Epitopes Total 4 IgE-binding epitopes have been identified. 3 epitopes show less than 40% of binding affinity. unknown Special Property Known as arachin Disulfide bonds unknown

PAGE 45

33 Table 2-6 Continued Ara h 6 Ara h 7 Biological Function Conglutin-like (2S) seed storage protein Conglutin-like (2S) seed storage protein Molecular Mass 14.5 kD 15.8 kD Isoelectric Point pI 5.2 pI 5.6 Gene Products Size 627 bp of mRNA 124 amino acid residues 712 bp of mRNA 135 amino acid residues Formation of Oligomers unknown unknown Glycosylation unknown unknown Sequence Homology Peanut allergens; Ara h 2 (59% aa), Ara h 7 (35% aa) Conglutin from lupine (39% aa) Peanut allergens; Ara h 2 (35% aa), Ara h 6 (35% aa) Conglutin from lupine (39% aa) Sensitization IgE binding from 38% of patients IgE binding from 43% of patients B-Cell Epitopes unknown unknown Special Property unknown unknown

PAGE 46

34 CHAPTER 3 EXPRESSION OF THREE MAJOR PEANUT ( ARACHIS HYPHOGAEA L.) ALLERGEN GENES DURING SEED DEVELOPMENT, GERMINATION, AND SEEDLING GROWTH Introduction The seed is the most economically important part of the peanut plant. However, peanut seeds are a major source of allergens. In fact, peanut allergy is one of the most serious causes of fatal food-induced anaphylaxis (Yocum and Khan, 1994). Peanut allergens are seed storage proteins and peanut contains 24-29% protein in seed dry weight (Koppelman et al. , 2001). Peanut seed storage proteins that are recognized by more than 50% of peanut allergic patients are considered to be major allergens. Although about 20 peanut allergens have been reported, Ara h 1, Ara h 2 and Ara h 3 are the major allergens. Ara h 1 is a 63.5 kD glycoprotein that ha s significant homology with vicilin seed storage proteins (Burks et al. , 1991, 1995b). Ara h 1 has 40% homology with soybean and pea vicilins at the protein level (Lycett et al. , 1983) and 64% homology with broad bean and pea vicilins at the DNA level (Burks et al. , 1995a). Ara h 1 is recognized by > 90% of peanut-sensitive individuals (Burks et al. , 1995a). The linear IgE-binding epitopes of Ara h 1 have been mapped and shown to contain 23 independent binding sites, which are evenly distributed along the linear sequence of the molecule (Burks et al. , 1997). Based on a molecular model of the tertiary structure of Ara h 1, it is a homo-trimer with IgE binding epitopes located in the area of monomer-monomer contact mediated primarily through hydrophobic interactions (Shin et al. , 1998). Northern analysis showed

PAGE 47

35 that the ara h 1 transcript is 2.3 kb and is abundant in mature peanut cotyledons (Burks et al. , 1995a). Ara h 2 is a member of the conglutin family (Stanley et al. , 1997). Ara h 2 is composed of two glycoproteins containing eight cysteine resides that migrate closely on SDS-PAGE (Burks et al. , 1992a; Sen et al. , 2002). An ara h 2 clone of 741 bp was identified from a peanut cDNA library and this clone hybridizes to a ~0.7 kb mRNA (Stanley et al. , 1997). Recently, a genomic clone, and two complete isoform cDNAs of ara h 2, named ara h 2.01 and ara h 2.02, were isolated and characterized (Viquez et al. , 2001; Chatel et al. , 2003a). The difference between these isoforms is that Ara h 2.02 contains a 12 amino acid insertion. These additional 12 amino acids in Ara h 2.02 corresponded to the difference in molecular weights of the two Ara h 2 bands found on SDS-PAGE (Chatel et al. , 2003a). Ara h 2 is recognized by serum IgE from 90% of tested allergic individuals (Koppleman et al. , 2001). Ten IgE binding epitopes have been identified by peptide analysis. Three of these epitopes are considered immunodominant epitopes and two regions within these three epitopes contain the amino acid sequence, DPYSPS, which is considered to be necessary for IgE binding. The additional 12 amino acids of Ara h 2.02 contain a third repeat of the major linear IgE epitope motif DPYSPS (Stanley et al. , 1997; Chatel et al. , 2003a). The allergenicities of Ara h 1 and Ara h 2 are resistant to heat and several proteinases due to protein structure a nd modifications to these proteins that occur following these treatments (Koppelman et al. , 1999; Maleki et al. , 2000a, b, 2003). In particular, disulfide bonds contribute significantly to the overall structure and stability of Ara h 2 (Sen et al. , 2002).

PAGE 48

36 Sequencing of an ara h 3 cDNA (1.5 kb) identified this clone as a legumin-like seed storage protein that has significant homology to glycinin, which is the major 11S globulin seed storage protein in soybean (Rabjohn et al. , 1999). Also, several peanut allergens such as Ara h 4 and Gly1, which are highly homologous to Ara h 3, have been identified (Kleber-Janke et al. , 1999). The sequence of ara h 3 encodes 507 amino acid residues and the calculated size of the deduced amino acid is ~57 kD. However, a 14 kD protein was originally identified as Ara h 3 (Eigenmann et al. , 1996). Therefore, this suggests that the 14 kD protein may be a processed form of Ara h 3 following translation of the expected whole protein. In fact, it was reported that there are several posttranslational processing sites such as As n-Gln, Asn-Gly and cysteine residues which can form disulfide bonds in Ara h 3 (Rabjohn et al. , 1999). For example, Asn-Gly peptide bonds can be cleaved resulting in the separation of the acidic and basic chains. Also, the Asn-Gln peptide bond can be a target for Asn-specific endopeptidases, resulting in a smaller acidic chain. Correctly formed and assembled mature storage proteins are stably accumulated in developing seeds. Seed storage proteins synt hesized during seed maturation are degraded during germination and seedling growth to small peptides or amino acids that are subsequently transported to the growing seedling (Goldberg et al. , 1989; Shewry et al. , 1995). Degradation occurs only after a long period of rest and imbibition of water, when seeds germinate and seedlings start to grow (Shutov et al. , 2003). Synthesis and degradation, the antagonistic processes of protein turnover, occur during different developmental stages.

PAGE 49

37 The growth of legume seeds begins with a phase of cell division, where there is little increase in absolute mass, followed by a phase of cell expansion (Pate and Flinn, 1971). During the phase of cell expansion, storage protein production occurs, which closely follows an increase in fresh we ight (Dure, 1975; Higgins, 1984). Genetic variation accounts for the timing of the transition from the cell division to the cell expansion phase and for the duration of the phases (Hedley and Smith, 1985). Towards the end of embryo development, storage protein synthesis ceases and the rate of fresh weight increase declines. During germination and seedling growth, the complete degradation of storage proteins takes place inside the storage organelle (Shutov et al. , 2003). Although the major peanut allergens have been studied by many research groups, information on their expression during seed development and upon germination and seedling growth is not available. Understanding expression mechanisms for peanut allergens will allow later manipulation of control points that regulate their synthesis and degradation. Therefore, in the work reported here, the expression patterns of three major peanut allergens during seed maturation and germination are characterized using northern and western blot analysis. In addition, spatial relationships between peanut allergen mRNAs and their corresponding proteins in seeds were examined using tissue print hybridization. The study of the expression of pea nut allergen genes and their proteins will provide basic information that can be used in the future to produce hypoallergenic peanuts.

PAGE 50

38 Materials and Methods Plant Material Twelve peanut cultivars (African Giant, Early Bunch, Georgia Green, Georgia Red, Jenkins Jumbo, NCV11, Pronto, SE Runner, Spancross, Tifton 8, and Virginia Runner G26, and Florunner) at four stages of seed de velopment were generously provided by Dr. Peggy Ozias-Akins (University of Georgia, Tifton, GA). Seeds were frozen in liquid N 2 and stored at -70°C until total RNA extraction. Seeds from the same 12 peanut cultivars grown at the UF Plant Science Research and Education Unit (Citra, FL) in 2001 were used for replication. Other peanut plant tissue samples ( cv. Georgia Green) including leaf, flower, stem, and root, were grown and harv ested after flowering at the Plant Science Research and Education Unit (Citra, FL) in 2001. Seed stage determination and harvesting were conducted according to Pattee et al. (1974) (Table 3-1 and Fig. 3-1). Seed coats were left intact for the immature stages 1 and 2, but were removed prior to RNA extraction for the more mature stage 3 and the mature stage 4 seed. Peanut seeds (Georgia Green, stage 3) from the Plant Science Research and Education Unit were used for the SDS-PAGE profiling study. Germination One hundred-eighty dried seed of Georgia Green were surface sterilized in 10% commercial bleach for 30 min, subsequently rinsed three times with distilled water, and imbibed in sterilized distilled water for 2 h. The imbibed seeds were spread onto two layers of moistened Whatman # 1 filter paper (Whatman Inc., Clifton, NJ) on a mesh tray and germinated under aseptic conditions at 25°C in the dark. After 48 h, seeds were transferred to Petri dishes (100×15mm) containing Whatman # 1 filter paper moistened with three ml of sterilized water. Samples (20 seeds from each time point) were taken at

PAGE 51

39 24, 48, 72, 96 and 144 h following imbibition. Non-imbibed, dry seeds were used as a control. For further study, 25 seeds were sampled at 0, 1, 4, 12, 24, 48, 72, 96 and 144 h after imbibition. Fresh weight and soluble protein content were measured for all 25 seeds from each time point. Total RNA Extraction Total RNA was isolated using the modified method of De Vries et al . (1988). Seeds, flowers, leaves and roots were harvested and ground in liquid N2. An RNA extraction buffer (0.1M LiCl, 0.1M Tris-HCl, 1% SDS, 10mM EDTA) mixed with an equal volume of acidic (pH 4.3) phenol (Fisher Scientific, Pittsburgh, PA) was prepared and heated to 90 C. Approximately, 0.2g of the homogeneous liquid N2-powdered samples were added to six ml of the well-mixed phenol/extraction buffer and swirled vigorously. The mixtures were shaken at 300 rp m for five min at room temperature (RT). Then three ml of chloroform was added to each sample and samples were shaken for 1530 min at RT. Samples were centrifuged (20,000 g) for 30 min at 4 C and the supernatants were transferred to fresh tubes. An equal volume of chloroform was added to each, and samples were then shaken for 15 min at 300 rpm followed by centrifugation (12,000 g) for 15 min at 4 C. The upper phase was removed and placed in tubes containing 1/3 volume of 8M LiCl. The solution was mixed well by inverting and incubated for 16-18 h at 4 C. Following centrifugation (12,000 g), resulting pellets were washed once with 2M LiCl and then twice with 70% ethanol. Washed pellets were dried and resuspended with DEPC-treated water at 55 C and stored at -80 C until use. The amount and purity of total RNA was determined by spectrophotometry (Model U-2000 Double-Beam UV spectrophotometry, Hitachi Instruments, Inc., Danbury, CT).

PAGE 52

40 Northern Hybridization Preparation of gels and blots Gel electrophoresis and northern blot membrane transfer of total RNA were performed according to Sambrook et al . (1989) with slight modification. Total RNA (5µg) was electrophoresed on a 1.0% formaldehyde denaturing gel for 3 h 30 min at 90 V in 1×MOPS running buffer (0.2M MOPS, 20mM sodium acetate, 10mM EDTA). After electrophoresis, the gel was stained in a 0.5mg/ml ethidium bromide (Sigma, St Louis, MO) solution for five min at RT and destained in DEPC-treated distilled water. Stained gel images were taken with the Gel Doc 1000/2000 gel documentation system using Quantity One software (BioRad, Hercules, CA). The gel and Hybond-N membrane (Amersham-Pharmacia Biotech, Inc., Piscataway, NJ) were soaked in 6 SSC solution for 15 min at RT followed by capillary transfer overnight. The membrane was removed from the transfer plate and UV crosslinked at 120J/cm2 for 5 min (SpectroLinker XL-10000, Spectronics Co., Westbury, NY). Northern hybridization 32P-labeled probes were synthesized using the Prime-a Gene Labeling System (Promega, Madison WI), as suggested by the manufacturer. Probes for ara h 1 and ara h 2, were made from their corresponding 1.7 kb and 0.5 kb cDNAs, respectively (Dr. G. Bannon, University of Arkansas, AR). A partial ara h 3 cDNA fragment (576 nucleotides) was produced from a peanut cDNA library constructed from developing seeds (Dr. A. Abbot, Clemson University, SC) by PCR amplification with gene-specific primers (Forward: 5’GTGCAAAACCTAAGAGG CGAG3’, Reverse: 5’CCTTGAGT CTGTGTTGAAT GC3’).

PAGE 53

41 Northern blots were prehybridized for 2 h at 65 C in hybridization buffer (0.5 M sodium phosphate, pH 7.2). Hybridization was in the same buffer for 16-18 h at 65 C. The membranes were then washed two times for 15 min at 65 C in 20mM sodium phosphate (pH 7.2) with 5% SDS and 1% SDS, separately. Radioactive bands from the gel blots were directly quantified using an IMAGEQUANT PhosPhor Imager (Version 3.0, Molecular Dynamics World Headquarters, Sunnyvale, CA). For internal control experiments, blots were stripped for 2 h at 65 C in 50% formamide. After detecting no signal, the stripped blots were rehybridized with randomly -32P dCTP-labeled 25S radish ribosomal RNA gene fragments to confirm loading amounts. All signals were normalized to the 25S rRNA signals obtained fr om each blot. Northern blot analysis was repeated three times for each experiment. Peanut Protein Extraction Peanut proteins were extracted from seeds by a modification of the method by Koppelman et al. (2001). Peanut protein extracts were made by mixing 100mg of ground seed with 1ml of 20mM Tris-HCl (pH 8.2). After 2 h of stirring at RT, the aqueous fraction was collected by centrifugation (3,000 g) for 5 min at RT. The aqueous phase was subsequently centrifuged (10,000 g) for 15 min at RT to remove residual traces of oil and insoluble particles; extracts were st ored at -20°C until use. Soluble protein concentration was determined using the Dc Protein Assay kit according to manufacturer’s instructions (BioRad, Hercules, CA). SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed essentially according to Laemmli (1970) with a Mini Protein II System

PAGE 54

42 (BioRad, Hercules, CA). Peanut protein extract (10 g) was mixed with an equal volume of 2 SDS-PAGE sample buffer (0.09M Tris-H Cl, pH 6.8; 20% glycerol; 2% SDS; 0.02% bromophenol blue; 0.1M DTT). The mixture was boiled 10 min for denaturation and then spun for 5-10 sec. Electrophoresis was performed on 12% SDS-PAGE gels in running buffer (glycine 14.4g/L; Tris-base 3.03g/L; 20% SDS 5ml/L) for 1 h 10 min at 150V. Gels not used for immunoblotting were stained with 0.1% Coomassie brilliant blue R-250 and then destained. Blue Plus2 Pre-Stained Standard (Invitrogen, Carlsbad, CA) with molecular weights of 4, 6, 16, 22, 36, 50, 64, 98, 148, and 250 kD, and Perfect Protein Markers (Novagen, Madison, WI) with molecular weights of 10, 15, 25, 35, 50, 75, 100, 150, and 225 kD were used as references. N-Terminal Sequencing and Analysis In order to identify the individual polypeptides on SDS-PAGE, N-terminal sequencing was performed. The separate d protein bands on SDS-PAGE were electroblotted to a PVDF membrane (BioRad, Hercules, CA) and the membrane was placed into staining buffer containing Cooma ssie blue. After destaining, membranes were rinsed in distilled water, dried and stored at –20ºC until use. The protein bands were cut from a PVDF-blot membrane and their N-termini were sequenced through twelve cycles of protein sequencing. Protein sequence analys is was performed by the Protein Chemistry Core Facility (Interdisciplinary Center for Biotechnology Research, University of Florida, Gainesville, FL). Using the results from sequencing of the bands, protein databases were searched through standard protein-protein BLAST (blastp) found on the NCBI web site (http://www.ncbi.nlm.nih.gov) in order to find identical or homologous proteins.

PAGE 55

43 Preparation of Polyclonal Antibodies Against Ara h 1 and Ara h 2 Subcloning of cDNAs into a pGEM-T vector cDNAs corresponding to each allergen were amplified with gene specific primer sets (see APPENDIX B) by PCR. All primers were synthesized by GenoMechanix (http://www.geno-mechanix.com/, Alachua, FL) and were designed to produce an Nhe I site at the 5’ end and a Sal I site at the 3’ end of the amplified cDNA. The cloned cDNA plasmids were used as templates in a 30 l PCR reaction. PCR products were purified from 1% agarose gels by the QIAEX II Gel Extraction kit (Qiagen, Valencia, CA) and then ligated with the pGEM-T cloning vector (Promega, Madison, WI) at 16 C with T4 ligase (Promega, Madison, WI). After overnight ligation, the DNA was transformed into Escherichia coli strain DH5 competent cells (Invitrogen, Carlsbad, CA) and incubated overnight at 37 C on LB plates supplemented with ampicillin (50µg/ml) to select the positive clones. Approximately 20 white colonies were taken and screened by PCR using the same gene specific primers (see APPENDIX B). To confirm that the positive clones had the desired inserts, DNA sequencing was performed (DNA Sequencing Core Lab, Inte rdisciplinary Center for Biotechnology Research, University of Florida, Gainesville, FL) using T7 and SP6 sequencing primers. The cloned inserts were confirmed and named pGEM-T/ ara h 1/N+S, pGEM-T/ ara h 2/N+S and pGEM-T/ ara h 3/N+S for ara h 1, ara h 2 and ara h 3 genes, respectively (see APPENDIX C). Construction of expression plasmids Sequence-verified inserts were subseque ntly isolated by double digestion using Nhe I and Sal I and were ligated into pET-21b(+) vector (Novagen, Madison, WI). The ligated

PAGE 56

44 DNA was transformed into DH5 cells and the positive colonies were screened by PCR using T7 promoter and T7 terminator primers. To verify the inserts, the selected candidate clones were sequenced (ICBR Sequenc ing Core Lab, University of Florida) with the same primers. The pET-21b(+) vector uses the T7 RNA polymerase responsive promoter to produce (His)6-tagged fusion proteins. This vector carries an N-terminal T7 Tag sequence plus His6 Tag sequence produced at the C-terminus of the recombinant protein and a gene encoding ampicillin resistance. Expression and purification of recombinant proteins The pET-21b(+) plasmids containing sequenc e-verified inserts were transformed into E. coli BL21-Codon PLUSTM (DE3)-RIL cells (Stratagene, La Jolla, CA). Cells containing each construct were grown in 5ml LB medium containing ampicillin (100 g/ml) at 37°C overnight and were used to inoculate 250ml LB medium containing ampicillin (100 g/ml). Cultures were grown at 37°C with shaking at 200 rpm until the A600 reached approximately 0.6. At that time, cells were induced with 0.4 mM isopropylB-D-thiogalactopyranoside (IPTG). Cells were grown for an additional 3 h at 37°C. Then, 1 ml of cells was removed to check for proper expression in the non-induced and induced samples. Cells were harvested by centrifugation (5000 g) for 5 min at 4°C and stored at -20°C until purification. Purification of the recombinant proteins was performed using Ni-NTA Agarose (Qiagen, Valencia, CA) as suggested by the manufacturer. The purified proteins were electrophoresed on SDS-PAGE (see APPENDIX D) and concentrations were analyzed by the Dc Protein Assay kit (BioRad, Hercules, CA). Purified proteins were stored in aliquots at –20°C until use.

PAGE 57

45 The purified proteins were sent to Lampire Biological Laboratories (http://www.lampire.com/, Pipersville, PA) and injected into rabbits (two rabbits/each antigen) for production of polyclonal antibodies. Their protocols were used for bleeds and screening to obtain reliable antibodies, and the sera containing specific polyclonal antibodies against Ara h 1 and Ara h 2 were used for our studies without purification. Peanut-positive Human Patient Plasma Sera (#18500-DB and #9735-RE) from two patient s with a history of peanut allergy were purchased from Plasma-Lab International (http://allergicdonorinfo.com/ Everett, WA). The IgE level of these sera were 192 IU/ml (#18500-DB) and more than 5000 IU/ml (#9735-RE), respectively. One patient serum (#18140-KT) with a high IgE level (approximately 1000 IU/ml), but no reported soybeanor peanut-allergic reactions was used as a negative control. Western Blots Analysis After separation of peanut protein extr acts by SDS-PAGE, the separated proteins were electrophoretically transferred to polyvinylidene-difluoride (PVDF) membranes (BioRad, Hercules, CA) generally as described by Towbin et al. (1979). Blotting was performed in transfer buffer (10mM Tris-HCl, 100mM glycine, 10% methanol) for 1 h 30 min at 300mA using a Mini-Trans Blot Syst em (BioRad, Hercules, CA). A modified method of Xiang et al. (2002) was used for immunoblotting. Membranes were blocked overnight with TBST (25mM Tris-H Cl, pH 7.5, 150mM NaCl, 0.05% Tween-20) containing nonfat 5% dry milk and subsequently incubated overnight at 4 C with the specific polyclonal antibodies for Ara h 1 a nd Ara h 2 diluted 1:100 and 1:10 in TBST, respectively. After three washes of 10 min each with TBST, membranes were incubated with the secondary antibody (Goat Anti-Rabbit IgG-whole molecule peroxidase

PAGE 58

46 conjugate, Sigma, St Louis, MO) that was diluted 1:10,000 in TBST. Membranes were washed as above with TBST, and antigen-antibody complexes were detected by chemiluminescence using the ECL plus reagent (Amersham-Pharmacia Biotech, Inc., Piscataway, NJ) and then imaged using Biomax ML film (Eastman Kodak Co., Rochester, NY). Because anti-Ara h 3 antibodies were not available, western blots were accomplished only for Ara h 1 and Ara h 2. To study the immuno-reactivity of the proteins with human sera, transferred membranes were blocked in TBST (25 mM Tris-HCl, pH 7.5, 150mM NaCl, 0.05% Tween-20) containing nonfat 5% dry milk for 1 h at RT and subsequently incubated overnight (16-18 h) at RT with patient serum diluted 1:10 in TBST. After three 10 min washes with TBST, membranes were incubated with horseradish peroxidase conjugated to goat anti-human IgE (Bethyl–Labs, Montgomery, TX) diluted 1:1,000 in TBST. Membranes were washed as above with TBST and bound IgE was detected by staining for peroxidase activity using the ECL plus reagent (Amersham-Pharmacia Biotech, Inc., Piscataway, NJ) and imaged using Biomax ML film (Eastman Kodak Co., Rochester, NY). Quantitative RT-PCR cDNA synthesis and optimization of RT-PCR cDNA was synthesized using total RNA from mature seed (stage 4), flowers, leaves and roots of Georgia Green. Total RNA (1 g) was treated with one unit of RQ1 DNase (Promega, Madison, WI) for 15 min at RT prior to RT-PCR to remove residual DNA contamination. Aliquots of total RNA were reverse transcribed into cDNA with 50mM of a random hexamer (Promega, Madison, WI). A gene specific primer set (P1: TGCCCAGTT CCAGCGCCTC, P2: TGTCGTGGTCGTTGTAGA) was designed to

PAGE 59

47 produce different length PCR products (400 bp) from the standard control products (315 bp). The conditions for RT-PCR were optimized to produce unsaturated PCR product accumulation that retained a linear relationship w ith the original transcript levels. A range of 2 to 256ng of total RNA was tested and 64ng of total RNA was found to generate unsaturated RT-PCR product accumulation through 28 cycles of PCR (see APPENDIX E). Two RT-PCR signals were generated for each sample; one for ara h 3 genes and the other for 18S rRNA, as an internal control. RT-PCR cDNAs were prepared from mature seed (s tage 4), flowers, leaves and roots of Georgia Green using the same methods as described above. The cDNAs produced by reverse transcription were amplified with a pair of gene-specific primers for ara h 3 genes in the same tube. For each RT-PCR reaction, a plant 18S rRNA internal standard (Ambion Inc., Austin, TX) was included as a load ing control. With this standard, a pair of 18S rRNA specific primers and a pair of competitive primers were mixed at a ratio of 2:8 (18S rRNA primers: competitive primers) in order to generate unsaturated RT-PCR signals over the concentration range of total RNA used in this study. For the analysis of organ specific expression of ara h 3 genes, RT-PCR was conducted twice with two independently isolated total RNA samples. Twenty l from each PCR reaction was fractionated on a 1.5% agarose gel in 1 TBE buffer and stained with ethidium bromide (0.5µg/ml). After destaining, the gels were digitally photographed and quantified with the Gel Doc 1000/2000 gel documentation system using the Quantity One software (BioRad, Hercules, CA).

PAGE 60

48 Tissue Print RNA Hybridization Membrane preparation After harvest from the field, seeds, stems, and roots of Georgia Green were cut into 1 cm cross-sections and 2 cm longitudinal-sections with a new razor blade, and the cut surfaces were pressed onto a positively charged Nylon membrane (Roche Molecular Chemicals, Indianapolis, IN) for approximately 10 to 15 sec. Duplicate membranes were cross-linked using UV light at 120J/cm2 for 5 min (SpectroLinker XL-10000, Spectronics Co., Westbury, NY) and stored at 4 C until use. In vitro transcription for RNA probe preparation Plasmids containing cDNAs (pGEM-T/ ara h 1/N+S, pGEM-T/ ara h 2/N+S, pGEM-T/ ara h 3) were linearized with Nhe I, Sal I and Sph I and used to synthesize DIG-labeled sense and antisense RNA probes by in vitro transcription using T7 or SP6 RNA polymerase, depending on the pl asmid (APPENDIX C). For digestion, approximately 20 g of plasmid DNA was used which included RNase (5 g/ml) to eliminate RNA molecules before in vitro transcription. Once digestions were completed, the linearized plasmids were extracted with 1 vol. of phenol, and then precipitated with 0.1 vol. of sodium acetate (pH 7.0) and 2 vol. of 100% ethanol. After drying, pellets were resuspended in 10 l of DEPC-treated water and 2 l of DNA was electrophoresed on the agarose gel (1%) to determine DNA concentration. The linearized DNAs were used as templates for antisense and sense Digoxigen (DIG)-labeled riboprobe synthesis (Roche Molecular Chemicals, Indianapolis, IN). Transcription mixtures (25 l) were prepared as described in APPENDIX C. After 2 h incubation, the reactions were adjusted with 75 l of nuclease-free water and 4 l aliquot were electrophoresed on agarose gels. The

PAGE 61

49 remaining template cDNAs were digested with 5 units RQ1 RNase -free DNase (1unit/ l, Promega, Madison, WI) for 10 min at 37 C, and the reactions were stopped by heating to 99 C for 5 min. Hybridization Prehybridization was performed at 50º C in DIG Easy Hyb solution (Roche Molecular Chemicals, Indianapolis, IN) for 30 min. Hybridization was started with adding denatured DIG-labeled DNA probes to pre-heated Easy Hyb solution. After hybridization, washing and detection of DIG-la beled probes were performed with a serial solutions (Washing buffer, Blocking solu tion, Antibody solution, Detection buffer and TE-buffer) provided along with DIG DNA Labeli ng and Detection Kit (Roche Molecular Chemicals, Indianapolis, IN). Tissue Print Immunoblots Tissue print immunoblotting was performed as described by Cassab and Varner (1987). Nitrocellulose membrane (BioRad, Hercules, CA) were soaked in 0.2M CaCl2 for 30 min, and dried on Whatman 3MM paper (Whatman Inc., Clifton, NJ). Once dried, three layers of Whatman 3MM paper (Whatman Inc., Clifton, NJ) were put on a plastic plate and nitrocellulose membrane was laid on top of them. Seeds were cut into 1 cm cross-sections and 2 cm longitudinal-sections with a new razor blade. Each section was washed in distilled water for 3 sec, and dried on Kimwipes® (Kimberly-Clark Co., Roswell, GA). Then each section was taken with forceps and placed carefully on the membrane. The cut tissue was pressed onto the membrane for 15-30 sec, using a gloved fingertip. Finally, the tissue section was carefully removed with the aid of forceps, and the tissue print was immediately air dried.

PAGE 62

50 Membranes were blocked with TBST solution (25 mM Tris-HCl, pH 7.5, 150mM NaCl, 0.05% Tween-20) containing 5% nonfat dry milk overnight at 4 C. The primary and secondary antibodies for Ara h 1 and Ara h 2 were prepared according to the same protocol used for western blotting. Two di fferent peanut-allergic sera (#18500-DB and #18140-KT) were purchased from Plasma-Lab International (Everett, WA) to detect the allergenic proteins in peanut seeds. The IgE level of one serum (#18500-DB) was 192 IU /ml. The other serum (#18140-KT) was approximately 1000 IU/ml, but was used as a negative control due to it having no reported soybeanor peanut-allergic reactivity. Both patient sera (diluted 1:10 in TBST) containing IgE were used as the primary antibodies; horseradish peroxidase conjugated to goat anti-human IgE (Bethyl–Labs, Montgomery, TX) was diluted 1:1,000 in TBST and used as the secondary antibody. After antibody preparation, the primary antibodies were incubated with the nitrocellulose membranes for 2 h at room temperature. The membranes were then washed three times (30 min, each) in TBST with agitation and incubated with the corresponding secondary antibodies. After the TBST membrane wash, antigen-antibody complexes were detected by ImmunoPure Metal enhanced DAB substrate Kit (PIERCE, Rockford, IL), a colorimetric detection system in the presence of horseradish peroxidase. Metal Enhanced DAB Substrate working solution was added to the membranes and incubated until signals appeared on the tissue print and the incubation was stopped by washing the membranes quickly in distilled water. The membranes were dried on Whatman 3MM (Whatman Inc., Clifton, NJ) paper and photographs of tissue prints were taken under the dissecting microscope.

PAGE 63

51 Protein Body Isolation Protein bodies were isolated according to the method of Sclereth et al. (2000) with slight modifications. Peanut seeds were homogenized in a buffer containing 100mM MES (pH 5.5), 1mM EDTA, and 600mM mannitol. After filtration using Miracloth (Calbiochem, La Jolla, CA), the extract was centrifuged (100 g) for four min at RT. The supernatant was removed and placed onto a solution of 5% Ficoll (Sigma, St Louis, MO) in the same buffer and centrifuged (100 g) for 20 min at RT. The resulting pellet was washed twice and resuspended in 100mM Tris-HCl (pH 8.0) containing 150mM NaCl. Protein bodies and supernatants containing protein from the cytosol and other cellular compartments were used for immunoblotting analysis. Results Expression of Peanut Allergen Genes During Seed Development Northern analysis revealed that ara h 1, ara h 2, and ara h 3 are differentially regulated during seed development within and between cultivars (Fig. 3-2). For several cultivars, transcripts of all three genes were either not detected or at low levels in stage 1, the earliest stage of seed development tested, and their levels peaked at the more mature stages, 3 or 4. This pattern of gene expression is evident in Florunner, Georgia Green, Jenkins Jumbo and Tifton 8. However, there were exceptions to this general observation. In African Giant, ara h 2 and ara h 3 transcript levels were dramatically lower at stage 4, compared to ara h 1 transcript levels, which were highest at stage 4. Interestingly, all three genes were highly expressed at all four seed stages of Georgia Red. For NCV11 and SE Runner, transcripts of ara h 1 and ara h 2 reached maximum levels in stage 3 seed, whereas ara h 3 transcript levels peaked earlier (stage 2). In Spancross, transcript levels of the three genes were highest at stage 2 and decreased as the seed matured. The

PAGE 64

52 transcripts of ara h 1 and ara h 3 similarly accumulated after stage 2 in Pronto, whereas the expression of ara h 2 resembled that of Spancross. Genotypes showing these various patterns of gene expression were quantitatively analyzed and the results are summarized in Figure 3-3. In particular, the transcripts of ara h 3 were much higher than those of ara h 1 and ara h 2 in Spancross and Pronto, whereas ara h 1 and ara h 2 transcripts were higher than that of ara h 3 in Virginia Runner G-26. Western blot analyses were carried out to examine expression patterns of the major peanut allergens at the protein level during seed maturation, and the results were compared with the corresponding transcript patterns (Fig. 3-4). For this study, two specific polyclonal antibodies against Ara h 1 and Ara h 2 were prepared, and hybridized with seed proteins of Georgia Green, which is one of the most popular cultivars in the southern U.S. The results show that these proteins accumulate to higher levels in mature seeds than in immature seeds. The accumulation of protein was similar to the transcriptional gene expression patterns. Ara h 1 could be detected easily, although at low levels at stages 1 and 2, whereas Ara h 2 was not observed at stage 1 and at very low levels at stage 2. Therefore, it appears that Ara h 1 accumulated sooner in developing peanut seed than Ara h 2. The two bands present for Ara h 2 represent the expression of two different ara h 2 genes that are inherited from the two diploid progenitor species (see APPENDIX F). Tissue-specific Expression To determine tissue specificity of gene expression, total RNA was isolated from flowers, leaves, roots and developing seed s of Georgia Green. Transcripts were not detected for any of the allergens in flowers, leaves and roots (Fig. 3-5A). However, because there are several ara h 3 genes that cannot be distinguished with the probe used,

PAGE 65

53 it was necessary to confirm tissue-specificity using quantitative RT-PCR with ara h 3 gene-specific primers (Figs. 3-5B). Based on RT-PCR specific for ara h 3, there were no amplified PCR products from flower, root and leaf, whereas an ara h 3 band was amplified from the synthesized seed cDNAs. Localization of allergen expression within the seed was examined to determine whether there were differences observed between embryonic axes and cotyledons (Fig. 36). In cross and longitudinal sections of seeds (Figs. 3-6A and B), more transcript was detected in cotyledons than in embryonic axes for all three allergen genes. Stem (Fig. 36C) and root (Fig. 3-6D) sections were included as negative controls, confirming that the expression of these genes is seed-specific. No signals were detected with sense RNA probes. However, it was found that the allergen gene products are localized differently in peanut seed after translation (Fig. 3-7). When membranes containing the printed peanut seed were hybridized with peanut patient se rum containing peanut specific IgE, signals were detected in the entire seed including em bryonic axes and cotyledons (Figs. 3-7A and B). Also, when tissue print blots were studied with anti-Ara h 1 and Ara h 2, the results were similar to the immunoblots obtained with human serum (Fig. 3-7C). In order to confirm the results from tissue print hybridization, northern blots and western blots were performed (Fig. 3-8). Transcripts of ara h 1 and ara h 3 were higher in the cotyledons, but mRNA of ara h 2 accumulated to similar levels in both the embryonic axes and cotyledons (Fig. 3-8A). Protein levels of Ara h 1 and Ara h 2 were the same or slightly higher in the embryonic ax es compared to the cotyledons (Fig. 3-8B).

PAGE 66

54 This observation may result from the fact that the tested seeds were almost fully mature (stage 3). Identification of Peanut Seed Pr oteins by N-Terminal Sequencing Figure 3-9 shows the peanut seed protein profile displaying thirteen polypeptide bands. The molecular weights (MW) of these 13 bands are 63, 44, 40, 36, 30, 26, 25, 22, 20, 17, 16, 14, and 12 kD. N-terminal sequencing was performed on nine of the bands to determine their identity. In the case of the 30, 26, 25 and 12 kD polypeptides, the amount of protein recovered was inadequate for sequencing. The 63 kD band has the corresponding amino acid sequence of the N-terminus of Ara h 1. The 20 and 17 kD bands have identical amino acid sequences and are Ara h 2 proteins. The 44, 40, 22 and 14 kD bands contain amino acids that correspond to those deduced from DNA sequences previously reported for Ara h 3 (Kleber-Janke et al. , 1999; Eigenmann et al. , 1996; Rabjohn et al. , 1999). The two larger polypeptides (44 and 40 kD), as well as the 14 kD polypeptide, have identical N-termini to the acidic chain of Ara h 3. The band at 22 kD is identical in sequence to the basic chain of Ara h 3. The 36 kD band contained sequences which had no homology to any protein sequence in the database. However, the newly cloned Ara h 3 (see Chapter 5) contains these sequences in the N-terminus of the acidic chain. The 16 kD polypeptide was sequenced, but it was not able to be identified due to vague sequencing results. Ig E Binding Tests for Peanut Seed Proteins In order to characterize the IgE-binding properties of the individual peanut seed polypeptides, immunoblotting was performed with two different peanut-specific patient sera (Figs. 3-10 and 3-11). The IgE reactivity of these two human sera was dominantly directed toward Ara h 1 and Ara h 2, with Ara h 1 being more reactive than Ara h 2 (Figs.

PAGE 67

55 3-10 and 3-11). However, the patients show a so mewhat different specificity for the other individual protein bands. Serum #18500-DB reacted with a total of 10 polypeptide bands including unknown bands (30, 26, 24 and 16 kD) and those corresponding to Ara h 3 (44 and 40 kD) (Fig. 3-10). However, these bands were only detected weakly by serum #9735-RE (Fig. 3-11). The 36 and 14 kD Ara h 3 bands were not recognized by either tested human sera (Figs. 3-10 and 3-11). Also, embryonic axes and cotyledons showed different polypeptide patterns (Fig 311). In particular, the 24 kD polypeptide, which was not present on SDS-PAGE for the entire peanut seed was recognized by serum #18500-DB (Fig. 3-10). However, it was present on SDS-PAGE from the embryonic axes but was not from the cotyledons (Fig. 311). The 24 kD band was recognized only in the embryonic axes by serum #9735-RE. Interestingly, the signals for Ara h 1 and Ara h 2 were more intense in the embryonic axes than in the cotyledons (Fig. 3-11). These results may indicate that there are different concentrations of allergens in these two portions of the peanut seed. Gene Expression During Seed Germination and Seedli n g Growth The expression of the allergen genes was examined during seed germination and seedling growth to determine how their corresponding seed storage proteins were degraded to supply nutrients for seedling growth. Twenty seeds were harvested at each time point and in particular, the length of the seedling was measured after radicle emergence. More than 75% of the imbibed seeds showed radicle emergence after 24 h (Fig. 3-12). Therefore, germination is complete within 24 h of imbibition. After 24 h, growth continues producing a seedling that is more than 7cm in length with primary leaves at 96 h after imbibition (Fig. 3-12).

PAGE 68

56 No allergen transcripts were detected at any stage of germination or seedling growth (Fig. 3-13A). However, SDS-PAGE indicated that there were large changes in protein composition during germination (Fig. 3-13B). Ara h 1 and Ara h 2 levels were dramatically reduced during germination and seedling growth. In the case of Ara h 1, protein degradation was easily observed at 48 h, with degradation products clearly detectable at the 96 h and 144 h time points. Ara h 2 levels began to decline at 48 h, and were undetectable at 72 h. SDS-PAGE showed that many of the Ara h 3 polypeptides such as the 44, 40, 36, and 16 kD bands degraded during the time course beginning at 48 h. However, interesting results were observed for two Ara h 3 polypeptides (Fig. 3-13B). Levels of the Ara h 3 22 kD basic chain were unchanged over the time course, remaining high even 144 h after imbibition. The Ara h 3 14 kD polypeptide increased along with seedling growth.Western blot analysis provided more detailed results (Fig. 3-13C). Ara h 1 and Ara h 2 degradation began between 24 h and 48 h. Ara h 1 degradation products were dominant at 96 h, and each resulting band of Ara h 2 degraded at similar rates over the time points. In order to examine the germination process in greater detail, germinated seeds were collected at 1, 4, 12, 24, 48, 72, 96, and 144 h after imbibition (Fig. 3-14). The fresh weight of the cotyledons and embryonic axes were unchanged before radicle protrusion at the 24 h time point. However, the fresh weight of embryonic axes increased dramatically, while that of the cotyledons increased slowly after 24 h. Because seedling growth begins after 24 h (Fig. 3-12), fresh weight changes in embryonic axes were more profound (Fig. 3-14A). The percent of soluble protein in th e fresh weight of embryonic axes decreased sharply up until 96 h, while it decreased slowly in cotyledons during all periods (Fig. 3-

PAGE 69

57 14B). Although embryonic axes fresh weight dramatically increased after radicle emergence (24 h) (Fig 3-14A), soluble protein content remained unchanged (Fig. 3-14B). Therefore, it is expected that the growing seedling contained little soluble protein. However, the degradation of soluble proteins was delayed in cotyledons. Consequently, these results reveal that the degradation of soluble proteins can occur earlier in embryonic axes than in cotyledons. SDS-PAGE showed similar results (Fig. 3-15). Ara h 1, Ara h 2, and Ara h 3 could be detected within 24 h only in embryonic axes (Fig. 3-15A). However, they were detected over the entire time course in cotyledons, even though their levels decreased slowly after 24 h (Fig. 3-15B). Immunoblotting results were similar to the results from SDS-PAGE, with the degradation of Ara h 1 and Ara h 2 being more pronounced in embryonic axes than in cotyledons (Figs. 3-15C and D). Ara h 2 was nearly completely degraded in embryonic axes after 48 h (Fig. 3-15C). In order to examine the expression of the allergen genes in growing seedlings, immunoblotting was performed in seedling sec tions at 48 h and 96 h, respectively (Fig. 316). For each time point, the harvested seedlings were cut into 1-cm sections and proteins were extracted. When immunoblotting was performed with Ara h 1, a signal was detected in sections proximal to the embryonic axes (Figs. 3-16A and B). It was clear that Ara h 1 gradually disappeared as the seedling grew (Fig. 3-16B). It has been shown that seed storage proteins accumulate in protein bodies (PBs) after synthesis, and that they can be broken down in the PBs subsequently. Therefore, Ara h 1 degradation in PBs from embryonic axes and cotyledons was analyzed at different times during germination and seedli ng growth (Fig. 3-17). It was observed that

PAGE 70

58 PBs containing Ara h 1 from embryonic axes rapidly disappeared (Fig. 3-17A), but cotyledon PBs containing Ara h 1 remained stable until 48 h (Fig. 3-17B). Discussion The expression of major peanut allergen genes showed the same results as that of other legume seed storage proteins, they accumulate during seed maturation. However, their expression patterns can be variable depending on the specific allergen gene and on the properties of the cultivars tested. In particular, ara h 3 expression patterns among the cultivars were more variable than ara h 1 and ara h 2 (Figs. 3-2 and 3-3). These variations may be due to the existence of similar, multiple ara h 3 genes that are differentially regulated. The expression patterns of the allergen genes appear to correlate with the maturity index of each cultivar. Based on the reported peanut maturity index, Georgia Green and Florunner are medium-maturity genotypes and peanut allergen gene expression reached maximum levels in stage 4 mature seeds. In Spancross and Pronto, which are early-maturing genotypes, the highest transcript levels were found earlier in seed development, in stage 2. The peanut allergens, Ara h 1, Ara h 2 and Ara h 3 were found only in seeds (Fig. 3-5). Based on their function as major seed storage proteins, these results are not surprising. Thus, their corresponding genes are expressed in a seed-specific manner. However, peanut allergens have been reported to possess functions other than storage. For example, it was reported that ara h 2 and ara h 3 have functional and sequence homologies with trypsin inhibitor (Maleki et al. , 2003, Dodo et al. , 2004). From the results of tissue-specificity tests in seeds (Figs 3-6, 3-7 and 3-8), it is clear that these genes are transcribed predominantly in the cotyledons; however, the protein products are contained throughout the peanut seed.

PAGE 71

59 Previous studies reported differential patterns of transcriptional activity of seed protein genes in two legume seeds (Hauxwell et al. , 1990). The onset of vicilin and legumin gene expression was synchronous throughout the cotyledons; mRNAs were localized in regions of reduced mitotic activity, such as the abaxial (outer) region in the cotyledons, and expanded in a wave-like manner in pea (Harris et al. , 1989; Hauxwell et al. , 1990). A wave of transcriptional activity of storage protein genes was detected from the outer surface to the inner surface of th e cotyledons in soybean (Perez-Grau and Goldberg, 1989). Moreover, soybean storage protein genes are expressed at a later stage in development than in pea (Meinke et al. , 1981; Gatehouse et al. , 1982). This difference in transcriptional activity is likely to be due to differences in plant ontogeny. During legume seed maturation, protein reserves are not only deposited in classic storage tissues, like cotyledons, but also in the embryonic axis (Müntz, 1998). Also, it was shown in our study that Ara h 1and Ara h 2 are found in the entire seed (Figs 3-7 and 3-8). It is clear that the expression of these peanut seed storage proteins follows the general patterns observed in other legume plants. In Figure 3-9, two major peanut allergens, Ara h 1 (63 kD) and Ara h 2 (17 and 20 kD) are found at the identical sizes described previously (Burks et al. , 1991; Buschmann et al. , 1996; de Jong et al. , 1998; Burks et al. , 1992). Additional bands are visible on SDS-PAGE, mainly between 12 and 44 kD. The 44, 40, and 14 kD, and the band at 22 kD have an N-terminus identical to the acidic and basic chains of Ara h 3, respectively. One band at 36 kD is identical to the new Ara h 3 (see Chapter 5). The remaining bands, 30, 26, 25, 16, and 12 kD could not be identified here. However, Koppelman et al. (2003) recently identified a number of 14-45 kD peptides belonging to Ara h 3, and

PAGE 72

60 demonstrated that those bands (45, 42, 28, 25, 16, and 14 kD) may result from the proteolytic cleavage of Ara h 3. In fact, we could find possible proteolytic cleavage sites in the amino acid sequence of all Ara h 3-related proteins (see Chapter 5), and the predicted MW of the ara h 3 gene products and recombinant forms of Ara h 3 in E.coli is around 60 kD (Kleber-Janke et al. , 1999; Rabjohn et al. , 1999). The IgE reactivity of two human sera was dominantly directed towards Ara h 1 and Ara h 2, with Ara h 1 bing more abundant than Ara h 2 (Figs. 3-10 and 3-11). Although Ara h 1 and Ara h 2 have been considered major peanut allergens, and we can speculate that the allergenicity of peanut depends on the amount of these two allergens, Ara h 3 proteins have been identified as other major allergens and their IgE binding properties have been observed (Figs. 3-10 and 3-11). Although IgE binding does not directly indicate that those proteins are necessarily involved in initiating the clinical signs of allergy, their contribution to allergenicity must also be taken into account. The main IgE reactivity was observed for the 45 and 42 kD band (acidic subunits) with both of the human sera tested, whereas the reactivity towards the 22 kD band (basic subunit) was weakly observed from only one serum. It was revealed that the major IgE binding epitopes are located in the acidic chain, whereas the basic subunits of Ara h 3 do not contain IgE binding sites from the epitope mapping of recombinant Ara h 3 (Rabjohn et al. , 1999). A recent paper demonstrated that Ara h 3 shares IgE binding epitopes with the soybean glycinin G1 acidic chain (Beardslee et al ., 2000), but another report on the IgEbinding of soy glycinin showed that the major IgE epitope is located in the basic subunit (Helm et al. , 2000). Therefore, it is possible that IgE epitopes can be found in both the acidic and basic Ara h 3 subunits, even if the acidic subunits are more often recognized

PAGE 73

61 by IgE. Also, the individual serum shows a diffe rent specificity for the individual protein bands. Therefore, although the 36 and 14 kD Ar a h 3 were not detected by both sera, we can not conclude that they have less or no allergenic properties. It is not clear why the IgE reactivity is stronger in embryonic axes than cotyledons (Fig. 3-11). However, we expect that this observation may be related to a certain mechanism that the soluble proteins can be present and degraded differentially in embryonic axes and cotyledons of peanut seeds. Ara h 1, Ara h 2 and Ara h 3 were present in germinating seeds and in seedlings, but transcripts encoding these proteins could not be detected (Fig. 3-13). Therefore, it may be concluded that the transcripts of ara h 1, ara h 2 and ara h 3 are completely degraded before germination and no transcription occurs at this stage of development. The intracellular level of seed storage proteins is determined by both synthesis and degradation rates. During seed germination, small amounts of storage proteins are broken down in limited regions. This degradation might be mediated by stored proteinases. Hydrolysis of seed storage proteins provi des amino acids for protein synthesis in the growing seedling. Germination is regarded as finished when the radicle breaks through the seed coat, approximately 24 h after imbibition in legumes (Bewley and Black, 1994). Based on these facts, our study also s howed that seed storage proteins are degraded after 24 h (Fig. 3-13). Levels of Ara h 1 and Ara h 2 gradually declined and eventually were undetectable during the course of seedling development. Most Ara h 3 isoforms, such as the 44, 40 and 36 kD polypeptides, followed the same degradation pattern as Ara h 1 and Ara h 2; however, the 22 kD band, corresponding to the basic chain of Ara h 3, was present throughout seedling

PAGE 74

62 development. Furthermore, levels of the 14 kD polypeptide of Ara h 3 increased as the other seed storage protein levels decreased (Fig. 3-13). It is tempting to speculate that the 14 kD protein is involved in the degradation of other storage proteins. Interestingly, the 14 kD polypeptide was reported to be an isoform of Ara h 3 (Rabjohn et al. , 1999), and a recent paper demonstrated that Ara h 3 may also function as a trypsin inhibitor (Dodo et al. , 2004). Figure 3-15 shows that both the 22 and 14 kD Ara h 3 bands appear predominantly in cotyledons during seedling growth, especially after 72 h. Recently, there has been serious consideration given to the role of proteolysis in controlling protein levels. In legumes, cysteine proteinases (CPRs) have been thought to be the major proteinases responsible for storage globulin breakdown (Wilson et al. , 1986; Shutov and Vaintraub, 1987; Müntz, 1996). Although it has been reported that several proteinases are co-localized with their substrates in PBs when synthesized during seed maturation, premature proteolysis of the substrates may be prevented by an inhibitor of the proteinase; this activity is highest in the dry seed (Hara-Nishimura et al. , 1982; Elpidina et al. , 1991). Thus, multiple mechanisms modulate proteinase activity during seed germination. Interestingly, the decline in most seed storage proteins in cotyledons and embryonic axes is not synchronous. In this work, the level of seed storage proteins remained relatively high in cotyledons for 48 h, yet was already reduced in embryonic axes at that time (Fig. 3-15). This phenomenon may be a consequence of a slower turnover of this protein in cotyledons than in embryonic axes. Therefore, degradation of soluble proteins can occur much earlier in embryonic axes than in cotyledons. It follows

PAGE 75

63 that seeds first utilize the degraded soluble proteins of the embryonic axes to provide the nutritients for early seedling growth. Storage proteins are not only accumulated and mobilized in specific storage tissues, but also in the radicle and the embryonic shoot (Tiedemann et al ., 2000). In legume cotyledons, significant mobilization of storage proteins starts after the radicle has broken through the seed coat, when germination switches to seedling growth (Bewley and Black, 1994). In our study, it was observed that Ara h 1 gradually disappeared as the seedling grew. (Fig. 3-16). Therefore, these results indicate that storage proteins migrate as seedlings grow and are degraded to provide the nutrients for seedlings. Protein bodies (PBs) with storage proteins have been found in the embryonic axes of taxonomically distant plants and protein mobilization in the axes precedes storage protein breakdown in cotyledons (Schlereth et al. , 2000; Tiedemann et al ., 2000). Schlereth et al. (2000) have observed that globulin proteins including vicilin and legumin are practically restricted to PBs in dry vetch seed and PBs from the embryonic axes are more fragile than cotyledon PBs which are stable until at least 72 h after imbibition. In this study, we observed similar results that degradation of PBs in peanut embryonic axes occurs prior to that in the peanut cotyledons (Fig. 3-17). Therefore, the results indicate that the degradation of globulin proteins including Ara h 1 occurs inside PBs. This work shows that the major peanut allergens accumulate in the mature, dry seed and are broken down inside PBs during seed germination and seedling growth. For future studies, it is essential to identify the regulatory sequences located in promoters and cis -regulatory elements, as well as to identify transcriptional factors. Also, it would be important to identify specific proteinases responsible for the degradation of each peanut

PAGE 76

64 allergen and characterize them. Based on the specific relationships between allergens and proteinases, we may be able to use that information to produce hypoallergenic peanuts.

PAGE 77

65 Table 3-1. Characterization of peanut seeds1. 1Pattee et al. (1974) Figure 3-1. Peanut seeds ( cv . Georgia Green) at four developmental stages. Stage 1 is the most immature; Stage 4 is a mature seed. Stage Pod Character Kernel Size (fresh weight) Seed Coat Color 1 watery, soft <150 mg white 2 soft 300 mg pink at the end 3 dry, papery inside 600 mg light pink 4 dry, indent inside 600 mg pink Stage 1 Stage 2 Stage 3 Stage 4

PAGE 78

66 Figure 3-2. Northern analysis for three major peanut allergen genes in 12 genotypes during seed maturation. *: ara h 1, ara h 2, or ara h 3 transcripts. **: 25S rRNA transcript as an internal control. 1, 2, 3 and 4 represent the seed developmental stages. * ** * ** * ** * ** * ** * ** * ** * ** * ** * ** * ** Virginia Runner G-26 African Giant Jenkins Jumbo SE Runner Spancross Tifton 8 N CV11 Pronto Florunner Georgia Green Georgia Red ara h 1 ara h 2 ara h 3 12 34 1234 1234 Early Bunch * **

PAGE 79

67 Figure 3-3. Expression levels of the three major peanut allergen genes during seed maturation. Statistical analysis of northern blots for 6 representative peanut genotypes (A~F). *: ara h 1, ara h 2, or ara h 3 transcripts. **: 25S rRNA as an internal control. 1, 2, 3 and 4 represent the seed developmental stages, respectively. Signal values obtained from each gene were normalized with 25S rRNA signal value and analyzed under the same unit. Units on the Y-axis: allergen transcripts /25S r RNA transcript. Each bar represents standard deviation. 1 2 3 4 1 2 3 4 1 2 3 4 ara h 1 ara h 2 ara h 3 Virginia Runner G-26 African Giant Georgia Green Spancross Pronto Georgia Red * ** * ** * ** * ** * ** * **

PAGE 80

68 Figure 3-4. Expression of Ara h 1 and Ara h 2 at transcriptional and translational levels during seed maturation ( cv . Georgia Green). *: ara h 1, or ara h 2 transcripts. **: Ara h 1, or Ara h 2 translational signals. 1, 2, 3 and 4 represent the seed developmental stages. Arah1 Arah2 1234 1234

PAGE 81

69 A B Figure 3-5. Tissue specific expression of the three major peanut allergen genes. Northern blots (A) for tissues including flowers (F), leaves (L), roots (R) and four seed developmental stages of Georgia Green. RT-PCR for ara h 3 (B). ara h 1, ara h 2, and ara h 3 represent transcriptional signals, respectively. 25S indicates 25S rRNA transcript signal as an internal control. *: ara h 3 specifically amplified PCR band (400bp). **: 18S internal control PCR band (315 bp). M: 1 kb DNA Marker (Promega, Madison, WI). GA4: seed of stage 4 (Georgia Green). 500 bp 250 bp 750 bp 1000 bp * ** GA4 F R L M F L R 1 2 3 4 arah 1 arah 2 arah 3 25S 25S 25S

PAGE 82

70 A B C D Figure 3-6. Localization of ara h 1, ara h 2, and ara h 3 transcripts in seed by tissue print hybridization ( cv . Georgia Green). Cross-section of seed (A). Longitudinalsection of seed (B). Stem (C). Root (D). Em: Embryonic Axes. Co: Cotyledon. ara h 1, ara h 2, and ara h 3 represent the transcriptional signals. ara h 1 ara h 2 ara h 3 ara h 2 ara h 3 ara h 1 Co Em Co Em Co Em Toluidineblue antisense sense Toluidineblue antisense sense Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em

PAGE 83

71 A B C Figure 3-7. Tissue print immunoblotting for Ara h 1and Ara h 2 in seed ( cv . Georgia Green). Cross-section (A) and longitudinal-section of seed (B) with human serum containing peanut-specific IgE. Logitudinal-section of seed (C) with anti-Ara h 1 and 2 antibodies. Negative control was performed with human serum containing non-specific IgE to peanut. Em: Embryonic Axes. Co: Cotyledon. Toluidine-blue IgE Negative Control Toluidine-blue IgE Negative Control Ara h 1 Toluidine-blue Ara h 2 Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em Co Em

PAGE 84

72 A B C Figure 3-8. Expression of the three major peanut allergen genes in embryonic axes and cotyledons ( cv . Georgia Green). Northern blots (A) of ara h 1, ara h 2 and ara h 3 for embryonic axes and cotyledons. SDS-PAGE (B) of proteins from embryonic axes, cotyledons, and the whole seed of stage 3. Western blots (C) of Ara h 1 and Ara h 2. *: ara h 1, ara h 2, or ara h 3 transcripts. **: 25S rRNA transcript as an internal control. 1, 2, 3 and 4 represent the seed developmental stages. GA: seed of stage 3 (Georgia Green). Em: Embryonic Axes. Co: Cotyledons. Signal values obtained from each gene were normalized with 25S rRNA signal value and analyzed under the same unit. Units on the Y-axis: allergen transcripts /25S r RNA transcript. Each bar represents standard deviation. M: Protein size marker (Novagen, Madison, WI). Em Co Em Co Em Co (kD) M Em Co GA ara h 1 ara h 3 75 35 25 15 50 100 Em CoGA Ara h 1 EmCoGA ara h 2 Ara h 2

PAGE 85

73 Figure 3-9. N-terminal sequence analysis of peanut seed proteins. Protein molecular weights are estimated based on SDS-PAGE. Seed proteins were isolated from Georgia Green. M: Protein size marker (Novagen, Madison, WI). 12 kD 26 kD 25 kD 30 kD 22 kD 36 kD 44 kD 40 kD 20 kD 63 kD 17 kD 14 kD RHPPGERTRGRQ (12 aa) Ara h 1 ISFRQQPEENAC (12 aa) acidic chain of Ara h 3 and related proteins ISFRQQPEENAC : Ara h 3 ISFRQQPEENAC : Ara h 4 ISFRQQPEENAC : Gly1 GIEETICSASVK (12 aa) basic chain of Ara h 3 and related proteins GIEETICTASAK : Ara h 3 GIEETICTACVK : Ara h 4 GIEETICTASVK : Gly1 GIEETICSASVK : New Ara h 3 (see Chapter 5) VTFRQGGEENEC New Ara h 3 ISFRQQPEENAC (12 aa) Ara h 3 an d r e lat ed p r o t e in s 16 kD Sequenced, but unidentified RQQGELQGDDRN (12 aa) Ara h 2

PAGE 86

74 (Serum # 18500-DB) Figure 3-10. Seed protein profiles and immunoblots with peanut-allergic patient serum. Protein molecular weights of immunoblots were estimated based on SDSPAGE. M: Protein size marker (Novage n, Madison, WI). GA3: Georgia Green seed stage 3. Ig E source: 18500-DB (Plasma Lab International, Everett, WA). 100 150 50 35 25 15 75 ( kD ) M GA3 I g E Ara h 1 (63kD) Ara h 2 (20 & 17 kD) Ara h 3 (44 & 40 kD) Unknown (30, 26, and 24 kD) Unknown (16 kD)

PAGE 87

75 (with Serum # 9735-RE) A B Figure 3-11. Protein profiles and immunoblots of proteins from embryonic axes and cotyledons ( cv . Georgia Green). Protein molecular weights of immunoblots (B) were estimated based on SDS-PAGE (A). M: Protein size marker (Novagen, Madison, WI). E: Embryonic axes. C: Cotyledon. Ig E source: 9735-RE (Plasma Lab International, Everett, WA). (kD)ME 100 75 50 35 25 15 Ara h 1 ( 63 kD ) Ara h 3 ( 22kD ) A r a h 2 ( 17 , 20 kD ) Ara h 3 ( 44 , 40 , and 36 kD ) Unknown (30 kD) Unknown ( 16 kD ) Unknown ( 96 kD ) Unknown ( 24 kD )

PAGE 88

76 Figure 3-12. Peanut seed germination and seedling growth. After imbibition, seeds were collected at each time point. Growing seedlings were measured after 24 h for each time point. For 0 h, seeds were harvested after 20 minutes of imbibition. 72 h Radicle length 2 ~ 4cm 96 h Radicle length 4 ~ 6.5 cm 144 h Radicle length > 7 cm 0 h 24 h Radicle length < 0.3 cm 48 h Radicle length 1 ~ 1.5 cm

PAGE 89

77 Arah3 (22kD) Ara h 2 (20, 17 kD) A B C Figure 3-13. Expression of the three major allergen genes during peanut seed germination and seedling growth. Northern blots (A) of ara h 1, ara h 2 and ara h 3. SDSPAGE (B) of peanut seed proteins. Western blots (C) of Ara h 1 and Ara h 2. ara h 1, ara h 2, and ara h 3 represent transcriptional signals, respectively. 25S indicates 25S rRNA transcript signal as an internal control. 0, 24, 48, 72, 96, and 144 represent harvesting times after imbibition (hours). M: Protein Size Marker (Novagen, Madison, WI). Ara h 3 (16, 14 kD) Ara h 3 (44, 40, 36 kD) 0 24 48 72 96 144 (h) 0 24 48 72 96 144 Ara h 1 ( 63 kD ) (kD) M 0 24 48 72 96 144 50 75 15 35 25 10 arah 1 arah 2 arah 3 25S 25S 25S Arah1 Arah2

PAGE 90

78 A B Figure 3-14. Analysis of seed weight and pr otein content during germination and seedling growth. Fresh seed weight (A) of embryonic axes and cotyledons. Ratio of soluble protein (B) of embryonic axes and cotyledons in fresh seeds. 0 5 10 15 20 25 30 0 1 4 12 24 48 72 96 144 hours after imbibition Fresh weight (Cotyledons; g/25 seeds) 0 5 10 15 20 25 Fresh weight (Embryonic Axes; g/25 seeds) Cotyledon Embryonic Axes 0.00 0.50 1.00 1.50 2.00 2.50 0 1 4 12 24 48 72 96 144 hours after imbibition soluble protein/Fresh weigh t in Cotyledon(%) 0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 soluble protein/Fresh weigh t in Embryonic Axes (%) Cotyledon Embryonic Axes

PAGE 91

79 Arah3 (22kD) Arah2 (20,17kD) Arah3 (22kD) Arah2 (20,17kD) A C B D Figure 3-15. SDS-PAGE and western blots of embryonic axes and cotyledons during germination and seedling growth. Peanut seed proteins were isolated and SDS-PAGE shows the polypeptide patterns from embryonic axes (A) and cotyledons (B). Also, western blots were performed for embryonic axes (C) and cotyledons (D) using anti-Ara h 1 and Ara h 2 polyclonal antibodies. 0, 1,4, 12, 24, 48, 72, 96, and 144 represent harvesting times after imbibition (hours). M: Protein Size Marker (Novagen, Madison, WI). Arah3( 14kD) 0 1 4 12 24 48 72 96 144 Ara h 2 Arah1 Ara h 2 Arah1 0 1 4 12 24 48 72 96 144 ( kD ) 0 1 4 12 24 48 72 96 144 Ara h 3 (14 kD) Ara h 3 (44, 40, 36 kD) 36 50 64 22 16 Ara h 1 ( 63 kD ) Ara h 3 (44, 40, 36 kD) 36 50 64 22 16 ( kD ) 0 1 4 12 24 48 72 96 144 Ara h 1 ( 63kD )

PAGE 92

80 A B Figure 3-16. Immunoblots of Ara h 1 during s eedling growth. Western blots for growing seedling at 48 h (A) and 96 h (B) with anti-Ara h 1 antibody. Cotyledon, embryonic axis, and growing seedling are indicated by arrows. Cotyledon Growing seedling Growing seedling

PAGE 93

81 A Embryonic axes B Cotyledons Figure 3-17. Immunoblots of Ara h 1 for prot ein bodies during germination and seedling growth. Western blots of Ara h 1 we re performed for protein bodies in embryonic axes (A) and cotyledons (B). 0, 4, 12, 24, 48, 72, and 96 represent harvesting times after imbibition (hours). 041224 487296 041224487296 PB-fraction p ellet Supernatant PB-fraction p ellet Supernatant

PAGE 94

82 CHAPTER 4 SCREENING THE PEANUT GERMPLASM FOR ALLERGEN LEVELS Introduction In the U.S., peanut ( Arachis hypogaea L.) is used primarily for food, as well as an oilseed crop. Although peanut has high nutritional value and popularity due to its health benefits, it is one of the most allergenic food affecting both children and adults and is responsible for acute, severe, and life threatening allergic reactions. The prevalence of peanut allergy in western society has been estimated at 1/10,000-1/200 and has increased during the last decade. In recent years, several peanut allergens have been identified and characterized extensively. Ara h 1, Ara h 2, and Ara h 3 have been reported as peanut allergens that can be recognized by more than 50 % of peanut allergic patients. In particular, Ara h 1 and Ara h 2 are considered to be major allergens, because they are recognized by more than 90% of peanut-allergic patients in the U.S. (Burks et al. , 1991, 1992b). Interestingly, Ara h 1 is considered only a minor allergen for European patients (de Jong et al. , 1998; Kleber-Janke et al. , 1999; Clarke et al. , 1998). Peanut proteins have been studied main ly from the nutritional point of view. However, seed protein patterns obtained by SDS-PAGE in the genus Arachis have been used to study the general characteristics of peanut proteins, identify cultivars, examine seed development, determine the relationship of proteins to other genetic traits, detect seed protein polymorphism, and compare species (Bianchi-Hall et al. , 1993, 1994). Although the total number of protein bands observed among peanut accessions fluctuates between 11 and 18 (Bianchi-Hall et al. , 1993), most of the peanut seed proteins are

PAGE 95

83 composed of two major globulins (85%), namely Ara h 1 (conarachin, 7S) and Ara h 3 (arachin, 11S) (Krishnan et al. , 1986; Burks et al. , 1991; Rabjohn et al. , 1999). Therefore, peanut cultivars may be differentiated by means of seed storage protein profiles using major differences in Ara h 1 and Ara h 3 content (Bianchi-Hall et al. , 1993, 1994). The U.S. germplasm collection for peanut contains 7432 accessions and a large amount of genetic diversity. A peanut core collection has been selected out of the U.S. germplasm collection that is designed to minimize repetitiveness yet maintain the genetic diversity of peanut (Holbrook et al. , 1993). The peanut core collection was evaluated for 16 morphological traits and resistance to four diseases. These data were used to produce a "core of the core collection" containing 111 accessions. This subset of the core collection still contains the genetic diversity of the entire U.S. peanut germplasm collection but its reduced size allows researchers to more efficiently locate valuable genes and traits. A core collection of soybean accessions has been examined to determine the levels of P34, the major human allergen found in soybean seeds (Yaklich et al. , 1999). Results showed that high protein lines did not contain more P34 than the low protein lines in the soybean core collection. Recently, quantitative studies using SDS-PAGE showed that no significant differences were identified in the amounts of Ara h 1 (12-16%) and Ara h 2 (5.9-9.3%) in seeds based on the type of peanut tested or the location where the peanut was grown (Koppelman et al. , 2001). However, only 13 peanut genotypes from the four market types (Valencia, Virginia, Spanish, R unner) were selected from different parts of the world. Therefore, it is necessary to extend this study to a more diverse and representative gene pool provided by the peanut core of the core collection to find peanut

PAGE 96

84 plants that have reduced allergen levels. Because peanut is a regional crop with relatively few individuals involved in breeding and genetic research in the U.S., we also examined breeding lines, developed by the University of Florida peanut breeding program, to investigate the abundance of major allergens in this material. Thus, this study investigated possible differences in allergen composition of two different peanut germplasm sources using seed protein profiles. Materials and Methods Peanut Samples For the analysis of peanut allergenicity by SDS-PAGE, two different germplasm sources were used. Of the 111 accessions in the core of the core collection, 99 were obtained from Dr. C.C. Holbrook (ARS, US DA, Tifton, GA) and 100 breeding lines from the Florida breeding program were obtained from Dr. D.W. Gorbet (University of Florida, Mariana, FL). Following protein extraction, 61 of the 99 core accessions and 89 of the 100 breeding lines were used in this study, because other accessions and lines did not provide consistent protein profiles. Protein Extraction Peanut proteins were extracted from 20 seeds by the modified method of Koppelman et al. (2001). Protein extracts were made by mixing 100 mg of ground seed with 1 ml of 20 mM Tris-HCl (pH 8.2). After 2 h of stirring at room temperature (RT), the aqueous fraction was collected by centrifugation (3,000 g) for 5 min at RT. The aqueous phase was subsequently centrifuged (10,000 g) for 15 min at RT to remove residual traces of oil and insoluble particles, and then extracts were stored at -20°C until use. Soluble protein content was determined using the Dc Protein Assay kit with BSA as a standard (BioRad, Hercules, CA).

PAGE 97

85 SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed essentially according to Laemmli (1970) with a Mini Protein II System (BioRad), Hercules, CA). Protein extract (10 g) was mixed with an equal volume of 2 SDS-PAGE sample buffer (0.09 M Tris-HCl , pH 6.8; 20% glycerol; 2% SDS; 0.02% bromophenol blue; 0.1 M DTT). The mixture was boiled 5 min for denaturation and then centrifuged for 5~10 sec. Electrophoresis was performed on 12% acrylamide gels (15×10 cm) in gel running buffer (glycine 14.4g/L; Tris-Base 3.03 g/L; 20% SDS 5ml/L) for 1h 10 min at 150 V. Gels were stained with 0.1% Coomassie brilliant blue R-250 and then destained. Perfect Protein Markers (Novagen, Madison, WI) with molecular weights (MWs) of 10, 15, 25, 35, 50, 75, 100, 150, and 225 kD were used as references. After destaining, gels were scanned with a Gel Doc 1000/2000 gel documentation system (BioRad, Hercules, CA). Analysis of Quantitative Data for Screening of Peanut Germplasms Data were transformed into protein banding patterns using Quantity One software (Version 4.1, BioRad, Hercules, CA). The peak area was calculated after background subtraction to estimate the percentage of proteins per band in each sample. The approximate MWs of the bands were calculated based on the positions of the molecular markers using standard MW curves. Ara h 1, Ara h 2, and Ara h 3 protein amounts were determind and expressed as the percentage of total detectable proteins on SDS-PAGE. Two independent experiments were performed to test the analytic precision of this method.

PAGE 98

86 Results Screening of Peanut Germplasm Protein electrophoresis was used to screen two sources of peanut germplasm for the abundance of allergenic proteins. In general, the amount and number of seed storage proteins showed great consistency within the core of the core collection and the Florida breeding lines. Band patterns were similar and thirteen polypeptides were commonly observed from all tested seed (see APPENDIX G and H). However, the 36 kD Ara h 3 polypeptide was very low in 20 of the 89 Florida breeding lines and in two of the 61 core of the core collection accessions. Figure 4-1 illustrates the protein profiles of the Florida breeding lines with an example of one line (F24) that is missing the 36 kD band. Table 4-1 depicts the relative content of seven of the 13 polypeptide bands from each plant. The Ara h 1 and Ara h 2 content varied between 7.0-18.5% and 3.1-8.0%, respectively. Previous studies indicated that Ara h 1 content was between 12% and 16%, and Ara h 2 content was between 5.9% and 9.3% (Koppelman et al. , 2001). Our results show that the germplasm used in this study may be more diverse than those studied in the past, and that lower allergen levels were detected. Generally, wider ranges in content were found in the core of the core collection than in the Florida breeding lines. For example, the 63 kD Ara h 1 content was 9.2-16.2% and 7.0-18.5% in the Florida breeding lines and the core of the core collection, respectively. However, the 36 kD band of the new Ara h 3 showed lower percentage in Florida breeding lines (3.6-12.7%) than in the core of the core collection (5.6-16.1%), because there were more plants lacking this band in Florida breeding lines (20 plants) than in the core of the core collection (2 plants). In the case of other Ara h 3 mutiple polypeptides, the 44 and 40 kD polypeptides ranged from 5.7-14.6%, and the 22 kD

PAGE 99

87 polypeptide of the Ara h 3 basic chain was between 8.7-19% in two sources of germplasm. Interestingly, it was observed that one plant from the core of the core collection contained very low Ara h 1 levels (7%). There was no significant difference in the allergen content from accessions derived from various countries of origin (APPENDIX G). Discussion In the last decade, peanut allergy has been considered one of the most significant health problems for a number of people, and se veral peanut allergens have been identified and studied. Numerous treatment strategies have been suggested and used for peanut allergies. Although the best strategy is to avoid the allergens by eliminating them from the diet, this can be difficult. Therefore, it is worthwhile to discover peanut plants without allergens or that contain naturally lower levels, and then crossbreed them to develop hypoallergenic peanut plants. There are peanut plants with variable allergenic properties depending on the human populations examined (Burks et al. , 1991, 1992; Clarke et al. , 1998; de Jong et al. , 1998; Kleber-Janke et al. , 1999). It was suggested that these variations are a result of genetic varia tion, different cooking methods, and different dietary regimes among human populations. Also, it was hypothesized that variation in peanut allergenicity may be a result of where geographically the peanut is grown. To answer these questions, Koppelman et al (2001) analyzed four different peanut market types, originated from various parts of the world and concluded that peanut market type is not an important factor for allergen content. In this study, we analyzed more genetically and geographically diverse peanut samples, the core of the core collection of peanut accessions and more closely related peanut samples, the Florida breeding lines. Thirteen peanut seed polypeptides were found and their N-terminal sequences were

PAGE 100

88 determined by Edmann degradation after separation by SDS-PAGE (see Chapter 3). Comparing the results of SDS-PAGE with previous studies (Bianchi-Hall et al. , 1993,1994), the protein patterns were similar, but we observed fewer polypeptide bands. It may result from the different protein extraction method used in this study. In soybean, it was demonstrated that high protein lines did not contain more allergens (Yaklich et al. , 1999). According to Koppelman et al. (2001), there was no correlation between the total protein concentration (24-29%) and allergen content in peanuts. Also, allergen content was not related to the origin of these plants. The high protein soybean plants contain more glycinin (about 50% of total proteins) than normal plants. Also, we found that a peanut plant with low Ara h 1 (6.96%) had higher Ara h 3 content (45.7%), whereas a plant with the highest Ara h 1 content (18.49%) had lower Ara h 3 (35.2%) than the average (APPENDIX G). Therefore, these major peanut allergens compensate for each other to balance the total amino acid composition in peanut seed. Because Florida breeding lines have been developed from a low number of superior genotypes such as Florunner which is missing the 36 kD band, many of the Florida lines contain low levels of 36 kD Ara h 3 (Fig. 4-1 and APPENDIX H). However, it is not clear why these peanut plants lack the 36 kD Ara h 3 band. The ultimate goal of our research is to produce hypoallergenic peanuts. Consequently, screening the peanut germplasm for plants with low allergen levels may be an effective approach to identify parents useful in a breeding program. However, there are several questions that we have to answer to produce a hypoallergenic peanut. First of all, we need to determine whether low levels of allergens still can elicit a response in peanut sensitive individuals. We have to determine if any of the lines or accessions

PAGE 101

89 tested, such as an accession showing low Ara h 1 content are acceptable to use in developing hypoallergenic peanuts or if more peanut lines must be screened. Also, if any lines or accessions are not useful to produce a hypoallergenic peanut, we must consider alternative ways. Experiments with soybean seed are currently in progress to suppress its major allergen using biotechnological approaches (Yaklich et al. , 1999; Herman et al. , 2003). Such an approach offers the prospect of directly introducing suppression of allergen synthesis into selected peanut plants using transformation. All the major peanut allergen can be the targets for elimination through either induced mutation or co-suppression. In summary, we analyzed two different peanut germplasm sources to find peanut plants with lower levels of allergens. In general, we found that there was no significant variation of major peanut allergen content in the tested peanut plants. However, we did find peanut plants with low levels of Ara h 1. However, because we used SDS-PAGE for the primary screening, it will be necessary to confirm our results by more accurate methods such as ELISA and immunoblotting. The plants with naturally lower levels of allergens may then be crossbred to produce a hypoallergenic peanut plant.

PAGE 102

90 Figure 4-1. Seed protein profiles of screened germplasm. Examples of the Florida breeding lines tested (F22-F27, 6 lines). Red arrow indicates missing 36 kD band (F24). Each band (#1-13) is indicated along with their identities. F22 F23 F24 F25 F26 F27 #5-7 . Un known (30, 26 & 25 kD) #1 . Ara h 1 ( 63 kD ) #2-4 . Ara h 3 ( 44 , 40 & 36 kD ) #9-10 . Ara h 2 ( 20 & 17 kD ) #8 . Ara h 3 ( 22 kD ) #11 . Un known (16 kD) #13 . Un known (12 kD) #12. Ara h 3 ( 14 kD )

PAGE 103

91 Table 4-1. Seed protein content within different peanut germplasm1. Polypeptides Florida breeding lines (%)2 The core of the core collection (%) Ara h 1 (63 kD) 9.2 16.2 7.0 18.5 Ara h 2 (20 kD) 3.9 8.0 3.1 6.6 Ara h 2 (17 kD) 4.7 7.8 3.2 6.9 Ara h 3 (44 kD) 6.6 12.1 5.7 11.5 Ara h 3 (40 kD) 7.7 12.3 6.5 14.6 Ara h 3 (36 kD) 3.6 12.7 5.6 16.1 Ara h 3 (22 kD) 8.7 12 8.9 19 1Two peanut germplasm; Florida peanut breeding line (89 samples) and the core of the U.S. germplasm core collection (61 samples). 2Percent of each polypeptide out of 13 major peanut seed polypeptides on SDS-PAGE.

PAGE 104

92 CHAPTER 5 CHARACTERIZATION OF A NOVEL PEANUT ALLERGEN GENE, ARA H 3 Introduction Peanut ( Arachis hypogaea L.) is the most serious food allergen, eliciting a reaction through immunoglobulin E (IgE). Approximately, 1.5 million Americans are allergic to peanuts and peanut allergy in the U.S. causes between 50 to 100 deaths each year. Allergies to peanut can persist throughout the lifetime of an individual (Yocum and Khan, 1994; Sicherer et al. , 1999). Additionally, the number of children having an allergic reaction to peanut has nearly doubled during the last decade in the U.S. (Sampson, 1996; Burks, 2003). Seed storage proteins are peanut allergens, and they are generally recognized by more than 50% of peanut allergic patients (Koppelman et al ., 2001). Three major allergenic peanut proteins have been identified: Ara h 1 and Ara h 2, recognized by 7090% of patients with peanut allergy (Clarke et al. , 1998; Burks et al. , 1998), and Ara h 3, recognized by serum IgE from approximately 44% (Rabjohn et al. , 1999) and 53% (Kleber-Janke et al., 1999) of different pa tient population with a history of peanut sensitivity. There are other peanut allergens that have been identified, however, these allergens appear to be isoforms of either Ara h 2 or Ara h 3. Ara h 3 was originally identified as a 14 kD glycinin whose N-terminal sequence was determined by Edmann degradation after separation by SDS-PAGE (Eigenmann et al. , 1996; Burks et al. , 1998). Recently, an ara h 3 gene was cloned, using degenerate cDNA probes based on the N-terminal sequence. This gene was expressed as a 60 kD

PAGE 105

93 IgE-binding protein containing both acidic and basic chains (Rabjohn et al. , 1999). Independently, Kleber-Janke et al. (1999) described an additional peanut allergen, Ara h 4. Sequence comparisons between ara h 3 and ara h 4 cDNAs revealed high sequence homology; ara h 3 and ara h 4 are considered to be the same gene. It is remarkable that the molecular weights of a recombinant form of Ara h 3 was 60 kD (Rabjohn et al. , 1999), whereas Ara h 3, as originally identified on immunoblots, appeared to be a 14 kD polypeptide (Eigenmann et al. , 1996; Burks et al. , 1998). Recently, fresh extracts of peanut seeds revealed a series of polypeptides of Ara h 3 ranging in size from 14-45 kD on SDS-PAGE and Ara h 3 has been purified and it is a hetero-hexameric protein with an apparent MW of 400 kD (Koppelman et al. , 2003). Based on their N-terminal sequences, all peptides originated from one or at least highly homologous isoforms of an ara h 3 gene (Kleber-Janke et al. , 1999; Rabjohn et al. , 1999; Koppelman et al. , 2003). Following posttranslational modifications, hexameric mature proteins are formed by noncovalent bonds among six similar subunits. Therefore, the fact that a series of polypeptides ranging from approximately 14 to 45 kD belong to Ara h 3, whereas the predicted molecular size of the gene product is around 60 kD, illustrates that the observed set of polypeptides is the result of post-translational proteolysis (Burks et al. , 1998; Koppelman et al. , 1999, 2003). Linear IgE-binding epitope analysis of recombinant Ara h 3 revealed that four IgEbinding epitopes are present in the protein. Mutational analysis of these epitopes revealed that single changes at particular amino acid residues resulted in a significant decrease in IgE binding. An interesting finding was that a ll four critical IgE-binding epitopes reside within the 40 kD acidic subunit (Rabjohn et al. , 1999). A recent study also demonstrated

PAGE 106

94 that the main IgE reactivity is directed toward the 45 and 42 kD bands (acidic subunits), whereas the 25 and 28 kD bands (basic subunits) contain only a minority of IgE epitopes (Koppelman et al. , 2003). Database searches for sequence similarity revealed that there are several ara h 3related genes including ara h 4, ara h 3/ ara h 4, and gly1. The amino acid sequence of Ara h 3 has between 62 and 72% sequence identity to glycinins from soybean ( Glycine max ) and pea ( Pisum satvium ) (Nielsen et al. , 1989). These are common storage proteins in legumes that function as a source of nitrogen for the developing plant and are initially synthesized as 60 kD premature globulins. In this study, we report the cloning of a novel ara h 3 cDNA encoding a new Ara h 3. The deduced amino acid sequence of the new Ara h 3 has been characterized and identified as a member of Ara h 3 belonging to 11S seed storage proteins. However, the characterization suggests novel features of th e new Ara h 3 that have been not observed in previously identified Ara h 3 proteins. Materials and Methods Southern Blot Hybridization Genomic DNA was extracted from peanut leaf tissue ( Arachis hypogaea L. cv. Georgia Green) by a modification of the CTAB method (Appendix I, Rogers and Bendich, 1985). Twenty g of genomic DNA was digested with EcoR I, Hind III, Dra I and BamH I (Promega, Madison, WI). After staining with ethidium bromide (0.5µg/ml) and destaining, gels were transferred onto Hybond-N membranes (Amersham-Pharmacia Biotech, Inc., Piscataway, NJ) by capillary transfer with 6 X SSC after depurination (0.2N HCl), denaturation (1.5M NaCl, 0.5N NaOH), and neutralization (1M Tris-HCl (pH 7.4), 1.5M NaCl) for 15 min, 30 min, and 45 min, respectively. After overnight

PAGE 107

95 transfer, the membranes were UV cross-linked at 120J/cm2 for 5 min (SpectroLinker XL10000, Spectronics Co., Westbury, NY). 32P-labeled probes for ara h 3 were synthesized using the Prime-a Gene Labeling System (Promega, Madison, WI) as suggested by the manufacturer. A partial cDNA fragment (576 nucleotides) of ara h 3 was prepared from a peanut cDNA library constructed from developing seeds (Dr. A. Abbot, Clemson University) by PCR amplification with gene-specific primers (Forward: 5’GTGCAAAACCTAAGAGG CGAG3’, Reverse: 5’CCTTGAGTCTGTGTTGAAT GC3’) and used as a probe. Blots were prehybridized for 1 h at 65°C in sodium phosphate buffer (Na2HPO4 and NaH2PO4, pH 7.2) containing 7% SDS and denatured salmon sperm DNA (100µg/ml). Hybridization was in the same buffer for 16-18 h at 65 C. Blots were washed once for 15 min at 65°C in 20mM sodium phosphate buffer (pH 7.2) containing 5% SDS, and then twice for 15 min at 65°C with 20mM sodium phosphate buffer (pH 7.2) plus 1% SDS. Autoradiographic images were obtained after exposure to X-ray film, X-OmatTM XFS-1 (Eastman Kodak Co., Rochester, NY) using intensifying screens for three to 10 d at 70°C. cDNA Library Screening A gt11 cDNA library constructed with RNA from developing seeds of F78-1339 ( Arachis hypogae L. , Dr. A. Abbot, Clemson University, Clemson, SC, USA) had a titer of 1×108 pfu/ml. Aliquots of the library suspension containing 5 x 104 pfu of bacteriophage were prepared with SM buffer (NaCl, MgSO4, 1M Tris-HCl (pH 7.5), 2% gelatin) and added to 600µl of Escherichia coli strain Y1088, which was previously grown until OD600=0.5 and resuspended in 10mM MgSO4. After 15 min at 37°C, 7ml of

PAGE 108

96 NZY top agarose (NaCl, MgSO4, Yeast Extract, NZ amine, 0.7% agarose) was added and the mixtures were plated on 150mm NZY agar plates (NaCl, MgSO4, Yeast Extract, NZ amine, 0.7% agar). After an overnight incubation at 37°C, the plates were stored at 4ºC for 1 h before placement of two discs of Hybond-N membranes (AmershamPharmacia Biotech, Inc., Piscataway, NJ) onto each plate for 2 min and 5 min, to transfer the phage particles to the membranes, separately. A needle was used to prick through the membrane and agar for orientation. The membranes were denatured in solution ingredients (1.5M NaCl, 0.5N NaOH) for 2 min, and then neutralized by solution ingredients (1M Tris-HCl (pH 7.4), 1.5M NaCl ) for 5 min. Membranes were rinsed for 30 sec in a solution containing 0.2M Tris-HCl (pH 7.5) and 2 SSC, and then cross-linked for at 120J/ cm2 for 5 min (SpectroLinker XL-10000, Spectronics Co., Westbury, NY) and air dried. The cDNA library was screened by plaque hybridization using a 32P-labeled 576 bp ara h 3 partial clone described earlier under the same conditions used for Southern blot hybridization. After hybridization, the positive signals from the duplicated membranes were compared to the original plates. Once the signals were confirmed, the positive plaques were removed from the plate and diffused in 1ml SM buffer with 1 drop of chloroform and stored for 1-2 h at 4ºC. The selected positive plaques were screened two additional times as described for the first screening step. After the third screening, 30 cDNA clones were selected and screened by PCR amplification with the same genespecific primers used to make the ara h 3 probe DNA. Fifteen positive clones were selected following this screen, and PCR amplified with gt11 forward and reverse primers (New England BioLabs, Beverly, MA). The PCR products were cloned into

PAGE 109

97 pCR2.1 (Invitrogen, Carlsbad, CA). Positive colonies were chosen by blue-white selection. Sequence and Structural Analyses The putative ara h 3 cDNAs were sequenced in both directions (Interdisciplinary Center for Biotechnology Research, DNA Sequenc ing Core Lab, University of Florida, Gainesville, FL). The DNA sequences were analyzed to find homologous sequences using standard nucleotide-nucleotide BLAST (blastn) (Basic Local Alignment Search Tool on NCBI web site, http://www.ncbi.nlm.nih.gov/) search. Translate (http://au.expasy.org /tools/dna.html) on an ExPASy Molecular Biology server (http://au.expasy.org/tools/) at the Swiss Institute of Bioinformatics was used to translate the nucleotide sequences to protein sequences. Nucleotide and amino acid sequence alignments were carried out using T-COFFEE (http://www.ch. embnet.org /software/TCoffee.html) (Notredame et al. , 2000) and Pairwise Sequence Alignment Programs (http://genome.cs.mtu.edu/sas.html) with the gap program (Huang, 1994). The prediction of putative posttranslational modification sites was performed by prediction tools such as NetNGlyc (http://www.cb s.dtu.dk/services/NetNGlyc/) found on the ExPASy Molecular Biology server. The amino acid sequences for Ara h 3 and related proteins were submitted for modeling of monomeric structures to SWISS-MODEL (http://www.expasy.org/swissmod /SWISS-MODEL.html ) (Guex and Peitsch, 1997) using the soybean glycinin G1 structure (PDB ID:1FXZ) (Adachi et al. , 2001) as a template. The sequence alignment generated by SWISS-MODEL was used to highlight residues corresponding to IgE binding epitopes of Ara h 3 in the basic chain.

PAGE 110

98 Results Genomic Southern Analysis Southern blot analysis was used to determine gene copy number of the ara h 3. As shown in Figure 5-1, the labeled ara h 3 probe detected multiple fragments digested by four different restriction enzymes ( EcoR I, Hind III, Dra I and BamH I). Six hybridization bands raging from 2 to 6.5 kb were observed in EcoR I restriction and the hybridization intensity about 5 kb was considerably stronger than others. When hybridization was done with genomic DNA digested with Hind III and Dra I, five (1.7~6 kb) and seven (1.2~6 kb) fagments were de tected, respectively. By contrast, only two major bands, 6 and 7 kb, were present in the BamH I digest. The results of this present study show that ara h 3 is much more complicated than ara h 1 and ara h 2 (APPENDIX J) and it may be suggested that there are more than two copies of ara h 3 in peanut. Cloning and Characterization of a Novel Ara h 3 Since genomic Southern blots indicated the existence of several ara h 3 genes in peanut, a cDNA library was screened and a previously unknown ara h 3 was cloned. The nucleotide and the deduced amino acid sequences of this new ara h 3 cDNA are shown in Figure 5-2. This cDNA has an open-reading frame of 1,533 nucleotides, coding for 510 amino acids. However, this cDNA appears to be lacking the initiator methionine at the 5' end, just like the first cloned ara h 3 (Rabjohn et al. , 1999). The reading frame starts with an AAG (Lys; K) codon and ends with a UAA stop codon. The calculated size of the protein encoded by this open reading frame is ~58 kD, and it is composed of both an acidic (36 kD) and a basic (20 kD) chain. An Asn324-Gly325 peptide bond is present, which is critical for acidic and basic chain separation. There are six cysteine residues

PAGE 111

99 (Cys8, Cys10, Cys30, Cys63, Cys106, and Cys331) and one dominant posttranslational cleavage site, Asn187-Gln188, present. Sequence similarity studies revealed that the new cDNA encodes an 11S seedstorage protein. Sequence homology at the nucleotide level between ara h 3, ara h 4 and gly1 is 85% or greater, but the percent identity between the new ara h 3 clone and these other three genes is 75% for gly1 , 73% for ara h 3, and 71% for ara h 4 (Table 5-1). Because ara h 3/ ara h 4 is a genomic clone, it was not used for nucleotide sequence comparison. Similar results were obtained from comparisons of the deduced amino acid sequences (Table 5-2). The percent identity among the four deduced amino acid sequences except the new Ara h 3 is more than 87%. However, sequence homology between the new Ara h 3 and the other four pr oteins is 73% for Ara h 3/Ara h 4, 71% for Ara h 4, 70% for Gly1, and 67% for Ara h 3. Amino acid sequence alignments of the five proteins are shown in Figure 5-3. All five proteins are composed of two polypeptide domains, an acidic and a basic chain, which can be separated through the cleavage of the Asn-Gly (N-G) peptide bond. An Asn-Gln (N-Q) peptide bond and four conserved cysteine residues, which can form interand intra-disulfide bonds, are also present in five proteins. Although the two potential Nglycosylation sites, found in each acidic (NES) and basic (NRS) chain are present in Ara h 3, Ara h 4, Gly1 and Ara h 3/Ara h 4, they are missing in the new protein. A previous study, based on the recombinant Ara h 3, discovered four IgE epitopes with critical amino acid residues (Rabjohn et al. , 1999). These four epitopes, designated E1-E4, are also found in Ara h 4, Gly1, and Ara h 3/Ara h 4. However, the new Ara h 3 contains E1-E3, but is missing most of am ino acid residues in E4 and contains only

PAGE 112

100 'DED' amino acid residues (Table 5-3 and Fig. 5-3). According to the identified E4 by Rabjohn et al. (1999), the E4 is composed of 15 amino acid residues (DEDEYE YDE EDRG), recognized by serum IgE from 38% of peanut patients tested and the underlined 6th amino acid residue, glutamic acid (E) is the critical residue for IgE binding of E4. These IgE binding epitopes are represented by amino acid residues 51-65, 236-249, 274288, and 303-305 in the new Ara h 3 (Table 5-3). Comparison of 11S Globulin Proteins Comparison of these proteins was extended to 11S globulin proteins in order to further study the relationship among various legumin-like proteins; the results are summarized in Table 5-4. At the amino acid level, the new protein and Ara h 3 show greater similarity (more than 50%) with soybean G1 glycinin, pea legumin A, field bean legumin A2, and vetch legumin A subunits, than with soybean G4 glycinin subunit and other 11S globulin-like proteins (less than 50%). Although differences between 11S globulin proteins were found based on percent sequence homology, common structures could be observed following sequence alignment among the 11 S globulins (Fig. 5-4). The linear structures of Ara h 3 and the new protein are illustrated schematically along with the common structure for 11S globulins (Fig. 5-5). These proteins are composed of two domains, an acidic and a basic chain, which can be characterized by the conserved cleavage site (N-G). The N-Q peptide bond is common in 11S globulin proteins and is one of the dominant posttranslational processing sites in the acidic chains of all these proteins. There are four conserved cysteine residues and each chain has the highly conserved cupin domains defined as bicupin.

PAGE 113

101 Three-Dimensional Molecular Modeling Computer-assisted, three-dimensional models of Ara h 3-related proteins were generated using the crystal structure for soybean glycinin G1 (PDB ID:1FXZ) (Adachi et al. , 2001) as a template. The amino acid residues of these proteins were aligned with those of the corresponding subunits of soybean glycinin G1. Figure 5-6 shows the tertiary structure of five Ara h 3-related proteins (A ~E) obtained, indicating the clear similarity in overall structure of all five proteins, even though the new Ara h 3 is missing E4 in the whole molecule (Fig 5-6E). All epitopes and the critical amino acid residues found in each epitope were displayed based on their corresponding positions in the primary structures (Fig. 5-6). In particular, the E3, which shows a high recognition rate in Ara h 3 (Rabjohn et al. , 1999), is structurally conserved in all five proteins. Four conserved cysteine residues among all five proteins were indicated based on their corresponding positions (30, 63, 106 and 331) in the new prot ein. Also, two domains, an acidic chain (green) and a basic chain (brown), were separately displayed in the new protein (Fig. 56E). Discussion The new ara h 3 clone (1533 bp) is approximately the same size as the original ara h 3 (Rabjohn et al. , 1999). Based on the alignment with Ara h 4, Gly1 and Ara 3/Ara h 4 (Fig. 5-3), the new ara h 3 clone lacks two or three amino acid residues of the N-terminal region including the start codon, like the original ara h 3. The full size of ara h 4, gly1 and ara h 3/ ara h 4 clones have been cloned by different ways. The ara h 4 cDNA and ara h 3/ ara h 4 clones have been isolated from phage display library (Kleber-Janke et al. , 1999) and genomic library, respectively. The gly1 was cloned by screening different

PAGE 114

102 cDNA library from that used for the new ara h 3. Thus, this observation may result from the incompletely synthesized cDNA library used in this study. Based on the peanut genomic Southern blots, it is clear that ara h 3 hybridizes to multiple bands indicating there are several genes with high homology (Fig. 5-1), whereas there are likely to be only two copies of ara h 1 and ara h 2 in the peanut tetraploid genome (see APPENDIX J). This is not a surprise based on the fact that there are several ara h 3-related genes such as ara h 4, gly 1, ara h 3/ ara h 4 with more than 85% sequence homology (Table 5-1). Recently, two additional cDNA clones encoding Ara h 412 (Chatel et al. , 2003b) and a peanut putative BBTI (Dodo et al. , 2004) were reported as Ara h 3 isoforms with more than 90% homology at the amino acid level to Ara h 3. However, the new ara h 3 showed much less sequence similarity (less than 75%) with other ara h 3 clones at both the nucleotide and deduced amino acid levels (Tables 5-1 and 5-2). Additionally, the new Ara h 3 has two si gnificantly different regions from the other Ara h 3-related proteins, N-terminal seque nces of the acidic chain (VTFRQGGEENE) and IgE binding epitope 4. From SDS-PAGE of peanut seed proteins, the new Ara h 3 is present as a distinct polypeptide band separate from other Ara h 3 proteins (see Fig. 3-9, Chapter 3). Therefore, our study is the first report of a novel ara h 3 cDNA. From the comparison of five Ara h 3-related proteins (Fig. 5-3), two potential Nglycosylation sites are found in Ara h 4, Gly1 and Ara h3/Ara h 4. However, Ara h 3 contains only one of the sites, and the new protein is missing both sites. Actually, it has been demonstrated that Ara h 3 is a glycoprotein and consists of a series of polypeptides ranging from 14-45 kD, similar to the subunit organization of soybean glycinin

PAGE 115

103 (Koppleman et al. , 2003). Therefore, these potential glycosylation sites can result in different polypeptide bands on SDS-PAGE with several proteolytic cleavage sites. It has been shown that legumin-like proteins show higher sequence homology than other seed storage proteins; glycinin subunits of soybean have been well characterized in this regard (Neilsen et al. , 1989; Jung et al. , 1998). There are several glycinin and glycinin-like genes in the soybean genome (Nielsen et al. , 1989), and it has been reported that other plants such as pea (Domoney and Casey, 1985), field bean (Baumlein et al. , 1986), and cotton (Chlan et al. , 1986) have several legumin-like globulin proteins. Ara h 3 and the new protein show higher sequence homology with soybean G1 and other legume LegA proteins than with soybean G4 and other 11S globulin proteins (Table 5-4). In fact, a study reported that Ara h 3 exhibits 62-72% sequence identity with soybean and pea (Rabjohn et al. , 1999). In our study, Ara h 3 and the new protein show no more than 50% sequence identity (Table 5-4). Also, the percentages of sequence homology between Ara h 3 and Ara h 4 in Tables 5-1 (85%) and 3-2 (87%) are lower than the previous report at the nucleotide (93.3%) and amino acids levels (91.3 %) (Dodo et al. , 2004). The difference in percentages between our study and the previous studies may result from use of different tools for sequence alignment, but it is not a critical factor for the interpretation of the results. There are three common features in 11S st orage proteins including the five Ara h 3related proteins (Figs. 5-3 and 5-4). The first one is that they contain the acidic and basic chains separated by the conserved Asn-Gly (N-G) peptide bond. Secondly, the formation of intraand inter-disulfide bonds can be expected from the observed four conserved cysteine residues. The last is the Asn-Gln (N-Q) peptide bond, which is a potential

PAGE 116

104 proteolytic cleavage site. Recently, it was demonstrated that the vacuolar processing enzymes (VPE) mediate Asn-specific proteolytic processing in legumin-type globulin proteins and that seed-type proteolytic enzymes including VPEs for processing seed storage protein can process storage proteins into chains capable of stable accumulation in mature seeds (Yamada et al. , 1999; Gruis et al. , 2002, 2004). It has been shown that the assembly of soybean glycinin is regulated in part by the activity of an asparaginyl endopeptidase that cleaves asparagine (Asn; N) and glycine (Gly; G) peptide bonds (Dickson et al. , 1989; Scott et al. , 1992). Also, it has been demonstrated that posttranslational cleavage of soybean glycinin precursors into acidic and basic polypeptides can regulate the aggregation of subunits in trimers into hexamers (Gruis et al. , 2002; 2004). Therefore, these potential proteolytic processing sites should be essential for legume-type 11S globulin proteins including Ara h 3 in peanut plants. The soybean glycinin subunits can be separated into at least two distinct subfamilies. One subfamily includes the G1, G2 and G3 subunits, and the other subfamily contains G4 and G5 (Neilsen et al. , 1989). Homologies within the same family range from 80 to 90%, but sequence identities between the two families are less than 50%. Two subunits of legumin-like proteins are also present in pea (Domoney and Casey, 1985). Interestingly, the homology between the LegA subunit of pea and the soybean G1 subunit is higher than the similarity between two soybean glycinin subunit families (Neilsen et al. , 1989). Our data show that the new protein and Ara h 3 are more related to the soybean G1 subunits than to the soybean G4 subunits. Therefore, based on the fact that the existence of two distinct subfamilies is common in legumin-like proteins, it can be said that all tested Ara h 3-related proteins belong to one subfamily of peanut legumin-

PAGE 117

105 like proteins. Therefore, it can be suggested that another protein group homologous with soybean G4 subunits is present in peanut. The major IgE binding epitopes are located in the acidic chain; the basic subunits of Ara h 3 do not contain complete IgE bindi ng sites and only two amino acid residues in epitope 4 reside in the basic chain (Rabjohn et al. , 1999). Another study reported the same results from soybean glycinin G1, which shares similar IgE binding epitopes with Ara h 3 (Beardslee et al ., 2000). Based on the structures of soybean glycinin G1, G2 and Ara h 3, it was shown that an IgE epitope is accessible in the trimeric and hexameric state, because trimers stack upon one another with their large surface areas at the interface (Xiang et al. , 2002). Therefore, the acidic subunits are dominantly recognized by IgE and important in formation of the multimeric structures at least in peanut and soybean. The critical amino acid residues in IgE binding epitopes and all of epitope 3, which showed a high recognition rate (Rabjohn et al. , 1999), are conserved among all five proteins analyzed. Also, the overall three-dimensional structures are similar among these proteins (Fig. 5-6). However, the new Ara h 3 lacks most of epitope 4, including the critical amino acid residues for IgE binding. Mu tations of any critical amino acid in an epitope leads to a significant decrease in IgE binding (Rabjohn et al. , 1999). Therefore, we may conclude that the new Ara h 3 has altered allergenicity which may be lower than other Ara h 3-related proteins. In summary, a new ara h 3 cDNA was cloned that has less sequence homology to previously published ara h 3-related genes. The Ara h 3 protein encoded by the new clone has the common structure of 11S gl obulin proteins including peanut Ara h 3

PAGE 118

106 proteins. However, it may have lower allergenicity compared to other Ara h 3-related proteins due the absence of one out of f our possible epitopes. Further studies using peanut patient serum IgE are necessary in order to examine whether the new Ara h 3 has a lower allergenicity or not. Also, the study of the complexity of peanut ara h 3 genes and proteins would be an additional important issue to characterize the allergenicity of Ara h 3-related proteins. If the new Ara h 3 show lower allergenic properties, this study provides the information necessary to produce a hypoallergenic peanut.

PAGE 119

107 Figure 5-1. Copy number determination for ara h 3. A Southern blot was probed with a cDNA of ara h 3. E: EcoR I, H: Hind III, D: Dra I, B: BamH I. Numbers on the left of each panel refer in kb to the 1 kb ladder size marker (Promega, WI, USA). 9.4 6.5 2.3 2.0 1.5 EHDB

PAGE 120

108 Figure 5-2. Sequence of a novel ara h 3. Top line is the nucleotide sequence, and the lower line is the corresponding amino acid sequence. Sequences (R1-R4) highlighted in green show the IgE-binding regions determined from an Ara h 3 epitope study (Rabjohn et al ., 1999). IgE-binding epitopes are indicated with a red line ( E1-E3 ), and the critical amino acids for IgE-binding are shown by the bold, red-colored letters. Sequences in yellow indicate the N-terminal sequences of the acidic chain. An asterick (*) indicates the stop codon.

PAGE 121

109 Figure 5-3. Amino acid sequence alignment among Ara h 3 and related proteins. The position of amino acids is indicated in the right column. Four epitopes are indicated with four different color boxes (Epitope #1 , Epitope #2 , Epitope #3 , Epitope #4 ). indicates different sequences of a new clone at epitope # 4. shows th e critical amino acids in each epitope region. P1& P2 indicate 5Â’ and 3Â’ primer regions for RT-PCR, respectively (see Chapter 3). shows cleavage sites for acidic (I/V) and basic (G) chains, respectively. The sequences inside of the blue lines ( ) used as probe DNA fragment( 580 bp). All have 6 conserved cysteine residues ( ) except Ara h 4, which has an additional Cys residue instead of Ser residue at 355 position. Two regions ( NES & NRS ) are indicated as the potential N-glycosylation sites.

PAGE 122

110 Figure 5-4. Amino acid sequence alignment among 11S globulins. All aligned protein sequences are composed of two regions, acidic and basic chains. Each chain has the conserved cupin domains ( ). Yellow-colored ( ) residues are cleavage sites for acidic (V/F/I/Q) and basic (G) chains, respectively. The conserved NG (Asn-Gly) peptide bond is underlined with blue line ( ). Four cysteine residues ( ) are conserved in all proteins. The positions of four epitopes from Ara h 3 are indicated with red line ( ) and the critical amino acids in each epitope exist in the red box ( ). The residues in the green-colored box ( ) are involved in HVR (hypervariable region) and especially, epitope #4 belongs to HVR. In acidic chain, NQ (Asn-Gln) represent one dominant posttranslation processing site in seed proteins ( ).

PAGE 123

111 A 11S Globulins B Ara h 3 C New Clone Figure 5-5. Schematic protein structures ba sed on amino acid sequence analysis. A. 11S Globulins. From sequence alignment (Fig. 5-4), the common structure of 11S globulins is illustrated. Generally, 11S globulin contains two main domains, acidic and basic, which are separated by the cleavage between Asn-Gly peptide bond. Also, they have an Asn-Gln peptide bond, which is a potential posttranslational cleavage site. There are 4 cysteine residues involved in the formation of disulfide bonds (an intraand an inter-chain linkage). B. Ara h 3. Because Ara h 3 missed some of N-terminal sequences, it does not show signal peptides. C. New Ara h 3. New Ara h 3 has 6 cysteine residues; however, four Cys residues of the six are expected to be involved in disulfide bond formation. Ara h 3 related proteins, including the new protein, also show the common structures of 11S globulin proteins.

PAGE 124

112 A B C D E Figure 5-6. Molecular models of Ara h 3 and related proteins. The structures were modeling by using soybean glycinin G1 as template by SWISS-MODEL. Each structure shows 4 epitopes (E1-E4) containing four critical residues (black lines). In structure of the new protein (E), the arrows indicate four conserved Cys residues and the region of basic chain is also shown ( ). A. Ara h 3, B. Ara h 4, C. Gly1, D. Ara h 3/Ara h 4, E. New Ara h 3. E1, E2, E3 and E4 indicate the epitopes.

PAGE 125

113 Table 5-1. Nucleotide similarities (%) of ara h 3 and related genes. Gene1 ara h 4 gly 1 Novel ara h 3 clone ara h 3 85 90 73 ara h 4 — 87 71 gly1 — — 75 1 ara h 3/ ara h 4 was not used for comparison, because it contains genomic DNA sequences. Homologies > 85% are in purple, while homologies < 75% are in green. Table 5-2. Amino acid similarities (%) of Ara h 3 and related proteins. Homologies > 87% are in purple, while homologies < 73% are in green. Protein Ara h 4 Gly1 Ara h 3/ 4 New Ara h 3 Protein Ara h 3 87 88 87 67 Ara h 4 — 89 87 71 Gly1 — — 90 70 Ara h 3/ 4 — — — 73

PAGE 126

114 Epitope AA Sequence Positions Recognition(%) 1 IETWN P NNQEFECAG Ara h 3 (33-47) 25 IETWN P NNQEFECAG Ara h 4 (53-67) IETWN P NNQEFECAG Gly1 (53-67) IETWN P NNQEFECAG Ara h 3/4 (54-68) IETWN P NNQEFQCAG New (51-65) 2 GNIFSGFTPE F LEQA Ara h 3 (240-254) 38 GNIFSGFTPE F LEQA Ara h 4 (260-274) GNIFSGFTPE F LAQA Gly1 (256-271) GNIFSGFTPE F LAQA Ara h 3/4 (257-272) SNIFSGFAQE F LQHA New (236-249) 3 VTVRGGLRI L SPDRK Ara h 3 (279-293) 100 VTVRGGLRI L SPDGT Ara h 4 (299-313) VTVKGGLRI L SPDRK Gly1 (295-309) VTVRGGLRI L SPDRK Ara h 3/4 (296-310) VTVKGGLRI L SPDEE New (274-288) 4 DEDEY E YDEE DRRRG Ara h 3 (303-317) 38 DEDQY E YHEQ DGRRG Ara h 4 (323-337) DEDEY E YDEE DRRRG Gly1 (319-333) DEDEY E YDEEERQQDRRRG Ara h 3/4 (325-343) DED New (303-305) The critical amino acids are shown as the red, bold, underlined residues. Table 5-3. Critical amino acids within the IgE binding epitopes.

PAGE 127

115 Table 5-4. Amino acid sequence identity among 11S globulin subunits. A3 Ara h 3 from peanut ( A. hypogaea L.) (Rabjohn et al. , 1999). AN New Ara h 3 protein from peanut ( A. hypogaea L.). (this chapter) G1 Glycinin subunit G1 from soybean ( Glycine max L.) (Sims and Goldberg, 1989). G4 Glycinin subunit G4 from soybean ( Glycine max L.) (Nielsen et al. , 1989). LA Legumin A subunit from pea ( Pisum sativum L.) (Lycett et al. , 1984). L2 Legumin A2 subunit from field bean ( Vicia faba L.) (Schlesier et al. , 1990). LV Legumin A subunit from vetch ( Vicia sativa L.) (Accesion # S44294). Ha 11S globulin-like protein from Hazelnut ( Corylus avellana L.) (Beyer et al. , 2002). Ca Allergen Ana 02 from cashew ( Anacardium occidentale L.) (Accesion #AAN76862). Se 11S globulin from sesame ( Sesamum indicum L.) (Tai et al. , 1999). Ri Glutelin from rice ( Oryza sativa L.) (Okita et al. , 1989). Oa 11S globulin from oat ( Avena sativa L.) (Tanchak et al. , 1995). Homologies > 80% are shaded purple, 50 to 70% in green, and< 50% in yellow. Protein AN G1 G4 LA L2 LV Ha Ca Se Ri Oa A3 67 54 37 49 50 53 42 39 32 31 30 An — 56 36 52 53 55 42 40 33 34 30 G1 — — 44 60 62 61 44 44 36 34 30 G4 — — — 45 43 44 40 35 32 31 31 LA — — — — 86 86 44 41 35 32 31 L2 — — — — — 93 47 42 37 34 30 LV — — — — — — 48 42 36 34 30 Ha — — — — — — — 49 47 45 40 Ca — — — — — — — — 43 41 33 Se — — — — — — — — — 41 36 Ri — — — — — — — — — — 58

PAGE 128

116 APPENDIX A HUMANIZED ANTIBODIES AGAINST IGE A recombinant humanized monoclonal antibody (mAb), which can form complexes with free IgE and blocks its interaction with mast cells and basophils, has been developed for the treatment of asthma, allergic rhinitis, and other allergic disorders. An mAb against IgE can be developed through hybridoma techniques (Schulman, 2001). After mice are immunized with human IgE, their B lymphocytes are harvested and fused with myeloma cells, producing immortalized "hybridoma" cells that secrete the antibody of interest. A single hybridoma cell line is then used to generate large quantities of the antibody, which is the reason for its designation as "monoclonal." The resulting monoclonal anti-IgE antibody was then "humanized" by removing murine elements that could trigger an immune response upon administration of the mAb to humans.

PAGE 129

117 APPENDIX B SUBCLONING OF CDNAS INTO A PGEM-T VECTOR Gene-specific primers Gene Forward primer Reverse primer ara h 1 TATGGCTAAAGCAGAGGGAGGGTTTCTCCA CCGTCGACGTTAAAAGCCTTCAAAAT ara h 2 TATGGCTAGCCTCACCATACTAGTAGCCCTC CCGTCGACGTATCTGTCTCTCTGCCGCC ara h 3 TATGGCTAGCTTCCGGCAGCAACC GGAGGAG CCGTCGACAGCCACAGCCCTCGGAGA

PAGE 130

118 APPENDIX C IN VITRO TRANSCRIPTION FOR RNA PROBES PREPARATION Digestion of template DNAs Gene Template Plasmid Enzymes for Antisense strand Enzymes for Sense strand Size of the product ara h 1 pGEM-T/ ara h 1/N+S Nhe I SP6 RNAPolymerase Sal I T7 RNAPolymerase 1.7 kb ara h 2 pGEM-T/ ara h 2/N+S Nhe I T7 RNA Polymerase Sph I* SP6 RNA Polymerase 470 bp ara h 3 pGEM-T/ ara h 3/N+S Sph I* SP6 RNAPolymerase Sal I T7 RNAPolymerase 1.5 kb * After Sph I-digestion, the templates were needed to make blunt ends due to 3Â’overhang. Purification of digested DNA templates After digestion, the template DNAs were extracted with 1 vol of phenol (pH 7.0) and precipitated with 0.1 vol of 3M Sodium A cetate (NaOAc, pH 7.0) and 2 vol of 100% Ethanol. The pellets were washed 2 times by 70% Ethanol, dried and resuspended in 10 l of DEPC-treated water. Transcription Reaction 5 Transcription Buffer (Promega) 5 l 100 mM DTT (Promega) 2.5 l RNAsin (40units/ l, Promega) 25 units (0.625 l) 10 DIG RNA labeling mix (BM) 2.5 l Linearized DNA template x l T7 or SP6 RNA Polymerase (Promega) 25 units Nuclease-free water up to 25 l Conversion of A 3Â’ Overhang to A Blunt End In case of digestion with Sph I, the produced 3Â’ overhang should be converted to a blunt end using the 3Â’ 5Â’ exonuclease activity of DNA polymerase I large (Klenow) fragment (Promega) as described below:

PAGE 131

119 1. Set up a standard in vitro transcription reaction (the above) minus the nucleotides and RNA polymerase. 2. Add DNA polymerase I large (Klenow) fragment at a concentration of 5u/ l and incubate the reaction for 15 min at 22 C. 3. Proceed with the transcription reaction by adding the nucleotide mixture and RNA polymerase.

PAGE 132

120 APPENDIX D PREPARATION OF POLYCLONAL ANTIDODIES AGAINST ARA H1 AND ARA H 2 A B SDS-PAGE show the expression of recombinan t proteins of Ara h 1(A) and Ara h 2(B) after IPTG-induction using in vitro E.coli expression system. 1: No IPTG induction, 2: 1 mM IPTG Induc tion, 3: Purified recombinant proteins, M : Protein size marker. Red arrows indicate the expressed recombinant protein band.

PAGE 133

121 APPENDIX E CONTROL EXPERIMENT OF RT-PCR FOR ARA H 3 For ara h 3, control experiments of RT-PCR was performed. *: ara h 3 specific band (400bp). **: 18S internal control band (315 bp). M: 1 kb DNA Marker (Promega, WI, USA). Units on the Y-axis: gene specific signal/18S internal control. M 2ng 16ng 64ng 256ng 0.50 0.70 0.90 1.10 1.30 1.50 * **

PAGE 134

122 APPENDIX F SDS-PAGE AND WESTERN BLOTS OF WILD-TYPE SPECIES A B SDS-PAGE (A) of peanut seed proteins fr om 3 wild-types (two A and B genome donors) and Georgia Green. Western blots (B) with of wild-type and cultivated genotypes with anti-Ara h 1 and 2, respectively. The numbers in left of SDS-PAGE show the size of molecular marker (SeeBlue Plus2 Pre-Stained Standard, Invitrogen). Sample 1: A. duranensis (1003811) as A genome donor, Sample 2: A. duranensis (30067) as A genome donor, Sample 3: Georgia Green ( A. hypogaea ) stage 3, Sample 4: A. ipaensis (30076), B genome donor. 1 2 3 4 (kD) M 1 2 3 4 98 64 50 36 22 16 6 250 Ara h 1 Ara h 2 1 2 3 4

PAGE 135

123 APPENDIX G PERCENT (%) OF PEANUT ALLERGENS IN THE CORE OF THE CORE COLLECTION Ara h 1 (63 kD) Ara h 2 (20 kD) A ra h 2 (17 kD) Ara h 3 (44 kD) Ara h 3 (40 kD) Ara h 3 (36 kD) A ra h 3 (22 kD) Total Arah 3Origin C12 10.49 5.96 6.85 7.40 10. 65 10.42 10.10 38.6 Argentina C16 10.73 6.20 6.75 9.39 11. 82 11.12 10.23 42.6 Argentina C33 10.14 6.32 6.70 8.80 11. 79 11.12 11.32 43.0 Argentina C38 10.86 6.48 6.56 9.27 11. 25 10.60 11.12 42.2 Argentina C41 11.19 5.96 6.28 8.01 11. 20 10.90 11.41 41.5 Argentina C50 11.49 5.30 6.02 8.17 10. 98 11.13 11.02 41.3 Argentina C53 13.02 6.01 6.42 8.12 9. 81 9.74 10.09 37.8 Argentina C68 11.31 5.97 6.66 8.27 10. 21 10.55 10.46 39.5 Argentina C82 10.06 6.03 6.54 8.16 10. 71 10.25 10.88 40.0 Argentina C187 10.96 5.87 6.38 7.32 10. 26 9.94 11.25 38.8 Argentina C202 12.29 5.84 6.13 7.60 9. 82 10.55 11.23 39.2 Argentina C588 10.10 5.55 5.80 8.96 12. 94 12.12 13.53 47.5 Argentina C87 10.47 4.93 6.67 8.17 11. 19 11.01 11.19 41.6 Bolivia C92 12.58 5.91 6.56 5.69 8. 11 8.18 9.29 31.3 Bolivia C97 10.23 5.99 6.46 8.20 9. 99 9.39 10.71 38.3 Bolivia C208 13.55 5.61 5.77 6.38 7. 82 8.42 11.25 33.9 Bolivia C605 11.71 6.02 5.64 8.63 12. 47 13.18 13.06 47.3 Bolivia C112 10.49 5.96 6.85 7.40 10. 65 10.42 10.10 38.6 Brazil C408 11.07 5.40 5.67 9.36 11. 78 11.33 12.14 44.6 Brazil C119 13.99 6.19 6.61 6.31 7.58 7.61 8.94 30.4 Burkina Faso C553 11.78 4.42 5.26 7.52 10. 37 10.65 14.69 43.2 China C559 10.03 5.59 5.69 9.27 12. 35 11.15 13.43 46.2 China C125 11.53 5.53 5.91 6.52 8.45 8.52 10.09 33.6 Colombia C506 14.49 5.61 5.25 6.64 9.18 10.18 13.23 39.2 Cuba C132 12.59 5.36 5.83 6.91 8. 41 9.41 10.24 35.0 Ecuador C221 10.38 5.81 6.67 8.42 11. 38 11.17 10.99 42.0 India C223 8.77 5.73 6.29 8.62 10.85 9. 52 11.82 40.8 India C227 10.92 5.49 5.52 8.36 10. 46 10.09 11.48 40.4 India C230 11.88 5.56 5.83 7.26 9. 82 9.75 11.27 38.1 India C233 13.18 5.24 5.54 6.61 9. 63 9.64 10.83 36.7 India C516 10.18 4.92 5.41 9.21 12. 35 12.36 13.37 47.3 India C526 6.96 4.87 6.10 8.65 11.85 11. 75 13.46 45.7 India C650 11.41 4.49 4.61 9.30 14. 57 13.63 14.40 51.9 India

PAGE 136

124 Ara h 1 (63 kD) Ara h 2 (20 kD) Ara h 2 (17 kD) Ara h 3 (44 kD) A ra h 3 (40 kD) A ra h 3 (36 kD) A ra h 3 (22 kD) Total Arah 3Origin C246 10.39 5.75 6.24 7.60 9. 75 9.24 10.65 37.2 Israel C249 11.04 6.18 6.61 9.37 11. 735.64 11.05 37.8 Israel C255 10.92 5.89 6.35 7.42 10. 539.89 11.45 39.3 Israel C529 9.77 5.03 5.60 9.67 12. 3612.1013.44 47.6 Israel C540 11.87 3.96 4.15 8.28 12. 0011.7113.66 45.7 Israel C541 11.37 4.38 4.89 7.37 9. 40 10.6013.99 41.4 Israel C542 8.54 4.46 4.48 9.01 12.5514.7114.58 50.9 Israel C800 17.39 3.42 4.14 7.74 8. 87 10.1515.77 42.5 Israel C802 16.78 3.25 3.96 7.72 11.69 11.8415.53 46.8 Ivory Coast C266 9.82 5.66 6.32 9.40 10.8411.0012.40 43.7 Japan C270 9.32 5.77 6.22 8.89 11. 4310.3712.08 42.8 Madagascar C277 11.26 5.74 6.40 7.33 10. 229.73 11.88 39.2 Malawi C546 13.60 3.34 3.19 9.70 13. 4013.4915.00 51.6 Malawi C805 12.56 3.82 4.38 8.97 13. 5913.1914.19 49.9 Mexico C808 10.08 4.98 5.36 10.69 14. 0315.0613.84 53.6 Morocco C673 14.90 3.64 3.86 8.29 10.5511.84 18.99 49.7 Mozambique C294 11.31 5.49 5.61 8.86 11. 2210.2011.45 41.7 Nigeria C683 12.25 3.35 3.62 7.51 11.86 16.0617.10 52.5 Nigeria C698 18.49 3.07 3.21 5.82 6.64 7.80 14.90 35.2 Nigeria C310 11.48 5.09 5.42 11.47 12. 9812.2012.66 49.3 Paraguay C149 14.08 5.37 6.62 6.50 7. 61 8.84 10.24 33.2 Peru C155 12.73 5.59 5.90 6.71 8. 01 9.92 11.55 36.2 Peru C725 12.84 3.79 3.68 7.69 8.47 11.7914.65 42.6 South Africa C747 9.95 4.80 4.39 9.52 12.2613.2913.47 48.5 Uganda C166 13.15 6.27 6.94 5.77 6. 46 7.30 9.53 29.1 Zambia C781 10.25 5.23 5.08 8.75 13. 3813.5214.35 50.0 Zimbabwe C787 9.50 5.87 6.71 7.78 13. 4612.6514.05 47.9 Zimbabwe

PAGE 137

125 APPENDIX H PERCENT (%) OF PEANUT ALLERGENS IN FLORIDA BREEDING LINES Ara h 1 (63 kD) Ara h 2 (20 kD) Ara h 2 (17 kD) Ara h 3 (44 kD) Ara h 3 (40 kD) Ara h 3 (36 kD) Ara h 3 (22 kD) Total Arah 3 F2 10.76 7.93 7.76 10.19 11.74 4.54 10.01 36.48 F3 12.46 5.77 6.02 7.93 10.20 7.88 10.02 36.02 F4 12.81 4.95 5.18 8.71 10.40 9.92 10.79 39.82 F5 13.19 5.97 6.31 9.71 11.45 4.51 9.89 35.56 F6 12.76 5.21 6.18 8.25 10.04 9.27 9.90 37.46 F7 10.55 5.22 5.82 8.97 10.55 9.94 10.46 39.91 F8 11.44 5.11 5.88 8.77 10.27 10.01 10.07 39.12 F9 11.90 4.83 5.73 8.80 10.95 9.89 10.54 40.18 F10 12.01 5.56 5.63 8.92 10.11 9.66 9.92 38.62 F12 11.02 6.10 5.92 7.85 10.43 6.21 10.48 34.97 F13 10.09 5.45 6.06 8.50 10.12 10.31 10.92 39.85 F14 11.25 4.83 5.32 7.91 10.09 10.70 11.66 40.37 F15 11.39 6.56 7.21 8.83 10.58 4.88 10.30 34.58 F16 11.70 5.02 5.51 7.65 10.51 9.71 10.22 38.09 F17 11.62 5.28 6.08 7.50 9.75 9.45 10.46 37.16 F18 11.97 5.40 6.29 9.15 11.48 4.91 10.97 36.51 F19 11.71 5.01 5.65 7.84 10.22 9.69 10.89 38.65 F20 11.85 5.17 5.48 7.13 8.93 8.90 10.44 35.41 F21 15.04 5.13 5.13 7.67 9.53 9.54 9.82 36.55 F22 12.42 5.05 5.60 7.56 9.92 10.21 11.01 38.71 F23 13.76 4.94 5.38 7.86 10.09 9.40 10.92 38.27 F24 16.19 5.12 5.61 8.11 10.54 5.37 9.72 33.73 F25 15.21 4.20 5.00 7.98 9.88 9.39 11.01 38.26 F26 14.96 4.40 5.32 7.78 9.58 8.95 9.18 35.48 F27 13.93 3.87 4.71 7.27 10.42 10.39 10.44 38.52 F28 15.43 4.83 5.06 9.30 11.53 5.55 8.66 35.04 F29 11.56 4.76 5.23 8.88 10.82 10.06 10.69 40.45 F30 11.33 4.75 5.20 8.97 10.65 10.11 10.39 40.12 F31 9.50 5.77 6.38 6.55 10.36 10.98 12.04 39.92 F32 9.23 5.70 6.20 6.91 10.63 10.76 11.90 40.21 F33 11.82 5.15 5.76 8.13 11.22 10.61 11.58 41.54 F34 11.52 5.45 6.04 7.34 10.75 10.78 11.18 40.05 F35 13.80 5.22 5.65 9.01 11.69 5.27 10.05 36.02 F36 11.96 4.50 5.56 8.33 10.80 11.00 10.54 40.67

PAGE 138

126 Ara h 1 (63 kD) Ara h 2 (20 kD) Ara h 2 (17 kD) Ara h 3 (44 kD) Ara h 3 (40 kD) Ara h 3 (36 kD) Ara h 3 (22 kD) Total Arah 3 F37 11.09 4.58 5.06 8.33 11.05 11.67 11.11 42.15 F38 12.86 5.14 5.90 9.58 12.33 5.05 10.84 37.80 F39 12.89 5.14 6.02 9.04 12.27 5.20 9.74 36.26 F42 11.62 6.37 6.39 8.96 11.55 4.91 10.83 36.25 F43 11.88 4.81 5.57 8.34 11.06 10.25 10.91 40.55 F44 10.37 5.75 6.17 9.21 10.32 9.63 9.83 38.99 F45 11.25 5.00 5.72 9.42 10.81 10.07 10.36 40.66 F46 12.18 5.76 6.67 9.43 11.03 4.68 9.58 34.71 F47 12.03 6.21 6.74 10.30 11.15 3.97 10.01 35.43 F48 11.51 4.76 5.25 8.50 10.63 9.95 10.71 39.77 F49 11.69 5.32 6.37 9.63 11.74 4.67 10.28 36.31 F50 12.31 5.66 5.82 9.82 11.05 4.93 10.43 36.23 F52 11.47 5.35 6.12 7.67 10.80 10.00 11.90 40.37 F53 15.01 5.42 6.60 7.62 8.65 5.24 10.05 31.56 F54 11.08 6.16 6.51 8.68 11.11 11.36 11.54 42.69 F55 11.55 5.62 5.84 9.54 11.26 9.22 11.51 41.53 F56 11.95 6.02 7.06 9.05 11.56 4.70 10.88 36.19 F57 14.00 5.54 5.89 7.17 9.22 4.68 10.93 32.00 F58 12.19 5.88 7.15 8.37 11.77 4.71 10.85 35.70 F61 12.52 6.02 6.66 8.57 10.75 4.71 10.21 34.23 F62 13.42 4.94 5.60 7.00 8.77 8.64 10.38 34.80 F63 13.66 5.27 5.90 7.05 10.34 8.88 9.47 35.74 F64 11.85 5.65 5.87 8.35 10.76 8.78 10.95 38.86 F65 11.96 4.37 5.08 7.44 10.21 9.37 12.13 39.15 F66 11.35 5.57 5.96 8.61 11.29 9.90 10.78 40.57 F67 11.66 4.92 5.32 6.99 11.22 12.66 11.97 42.85 F68 12.27 5.88 6.33 8.37 10.96 6.26 10.80 36.40 F69 12.14 5.65 5.61 8.89 10.25 9.15 10.75 39.04 F70 13.98 5.73 5.65 7.61 9.59 8.46 10.17 35.84 F72 11.39 5.63 6.49 8.46 10.80 9.19 10.41 38.87 F73 11.28 5.59 5.64 8.43 10.92 9.62 11.15 40.12 F74 11.10 5.60 5.60 8.85 10.95 9.42 10.72 39.95 F75 10.64 5.53 5.91 8.46 10.55 9.34 11.12 39.48 F76 12.46 5.27 5.58 7.67 10.26 8.96 10.56 37.46

PAGE 139

127 Ara h 1 (63 kD) Ara h 2 (20 kD) Ara h 2 (17 kD) Ara h 3 (44 kD) Ara h 3 (40 kD) Ara h 3 (36 kD) Ara h 3 (22 kD) Total Arah 3 F77 11.59 5.18 5.66 8.07 10.61 9.52 11.25 39.45 F78 12.88 5.51 5.80 8.18 10.47 9.29 10.30 38.24 F79 11.05 5.64 5.89 7.92 11.25 10.74 11.47 41.38 F80 12.63 5.90 6.47 9.17 11.68 5.91 9.96 36.72 F81 10.86 5.19 5.52 8.34 10.35 10.04 11.97 40.71 F82 10.19 6.00 5.94 7.54 11.26 9.92 11.37 40.08 F83 12.14 4.80 5.74 8.64 11.02 10.14 11.94 41.73 F84 12.58 6.54 7.14 9.60 10.89 3.59 11.64 35.73 F85 12.76 5.81 6.56 10.20 12.33 3.87 11.60 38.00 F86 10.49 5.89 6.07 9.56 11.67 10.36 11.06 42.64 F87 11.12 5.96 6.27 8.21 10.65 9.71 11.65 40.22 F88 10.26 5.69 5.74 8.55 11.53 9.96 11.57 41.61 F89 10.76 5.51 6.08 9.05 10.95 10.21 10.89 41.10 F90 11.66 5.45 5.94 8.13 11.94 11.24 11.87 43.17 F93 12.28 6.61 6.94 11.92 9.22 4.69 11.07 36.90 F94 11.84 4.80 5.21 11.75 9.21 12.28 11.93 45.18 F95 11.56 5.28 5.63 11.32 8.94 10.25 11.01 41.53 F96 12.09 5.78 6.43 12.13 8.36 4.76 11.13 36.37 F97 12.75 5.66 6.27 10.73 7.66 9.50 10.34 38.23 F98 11.16 5.11 5.70 11.22 9.02 9.57 12.22 42.03

PAGE 140

128 APPENDIX I CTAB DNA EXTRACTION FOR PEANUT (Original Paper : Rogers, S. O. and A. J. Bendich, 1985. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissue. Plant Molecular Biology 5: 69-76.) Solutions and Reagents 1. 2* CTAB extraction buffer (store @RT) 2 % (w/v) CTAB 100 mM Tris-Cl, pH 8.0 20 mM EDTA, pH 8.0 1.4 M NaCl 1 % PVP (MW 40,000) 2 % (v/v) ß-Mercaptoethonol (add just before use) 2. 10 % CTAB (store @RT) 10 % (w/v) CTAB 0.7 M NaCl 3. CTAB precipitation buffer (add just before use) 1 % (w/v) CTAB 50 mM Tris-Cl, pH 8.0 10 mM EDTA, pH 8.0 4. high salt TE buffer (add just before use) 10 mM Tris-Cl, pH 8.0 1 mM EDTA, pH 8.0 1 M NaCl Procedure 1. 0.1 g peanut leaf tissue 2. add 400 µl of pre-warmed (65 ºC) 2* CTAB extraction buffer 3. incubate in a 65 ºC water ba th for 60 min and occasionally mix 4. add an equal volume of chloroform : isoamyl alcohol (24:1), mix gently but thoroughly 5. centrifuge @ 10,000 rpm for 5 min at 4 ºC 6. transfer supernatant to new tube and add 1/10 volume of 65 ºC 10 % CTAB 7. repeat step 4 & 5 8. transfer the supernatant to new tube and a dd an equal volume of CTAB precipitation buffer and mix well by inversion 9. centrifuge @ 10,000 rpm for 5 min at 4 ºC ## If you can’t see a pellet, add 1/10 volume of CTAB precipitation buffer and incubate 30 min at 65 ºC. And then, centrifuge @ 10,000 rpm for 5 min at 4 ºC 10 remove the supernatant and rehydrat e pellet in 50~100 µl high salt TE buffer by heating to 65 ºC for 10 min 11 re-precipitate the DNA with 0.6 volumes of isopropanol 12 centrifuge for 15 min @ 10,000 rpm at 4 ºC 13 wash the pellet with 80 % ethanol and dry 14 resuspend in a small volume (10~50 µl) of DDW using cut tips

PAGE 141

129 APPENDIX J GENOMIC SOUTHERN BLOT HYBRIDIZATION A B Southern blots were probed with cDNA of ara h 1 (A) and ara h 2 (B). E: EcoR I, H: Hind III, D: Dra I, B: BamH I. Numbers on the left of each panel refer in kb to the 1 kb ladder size marker (Promega, WI, USA).

PAGE 142

130 LIST OF REFERENCES Adachi M, Takenaka Y, Gidamis AB, Mikami B, and Utsumi S. 2001. Crystal structure of soybean proglycinin A1aB1b homotrimer. J Mol Biol. 305:291-305. Adel-Patient K, Creminon C, Boquet D, Wal JM, and Chatel JM. 2001. Genetic immunisation with bovine beta-lactoglobulin cDNA induces a preventive and persistent inhibition of specific anti-BLG IgE response in mice. Int Arch Allergy Immunol. 126:59-67. Allergen Nomenclature. http://www.allergen.org/ . 2003-11-21. Bannon GA, Cockrell G, Connaughton C, West CM, Helm R, Stanley JS, King N, Rabjohn P, Sampson HA, and Burks AW. 2001. Engineering, characterization and in vitro efficacy of the major peanut allergens for use in immunotherapy. Int Arch Allergy Immunol. 124:70-72. Barnett D, Baldo BA, and Howden ME. 1983. Multiplicity of allergens in peanuts. J Allergy Clin Immunol. 72:61-68. Barnett D, and Howden MEH. 1986. Partial char acterization of an allergenic glycoprotein from peanut ( Arachis hypogaea L.). Biochim Biophys Acta. 882:97-105. Baumlein H, Wobus U, Pustell J, and Kafatos FC. 1986. The legumin gene family: structure of a B type gene of Vicia fa ba and a possible legumin gene specific regulatory element. Nucleic Acids Res. 14:2707-2720. Beardslee TA, Zeece MG, Sarath G, and Markwell JP. 2000. Soybean glycinin G1 acidic chain shares IgE epitopes with peanut allergen Ara h 3. Int Arch Allergy Immunol. 123:299-307. Becker C, Fischer J, Nong VH, and Müntz K. 1994. PCR cloning and expression analysis of cDNAs encoding cysteine proteinases from germinating seeds of Vicia sativa L. Plant Mol Biol. 26:1207-1212. Becker C, Shutov AD, Nong VH, Senyuk VI, Jung R, Horstmann C, Fischer J, Nielsen NC, and Müntz K. 1995. Purification, c DNA cloning and characterization of proteinase B, an asparagine-specific endopeptidase from vetch ( Vicia sativa L.) seeds. Eur J Biochem. 228: 456-462. Becker WM, and Reese G. 2001. Immunological identification and characterization of individual food allergens. J Chromatogr B Biomed Sci Appl. 756:131-140.

PAGE 143

131 Bewley JD, and Black M. 1994. Seeds: Physiology of Development and Germination. 2nd edn. New York: Plenum Press. Beyer K, Morrow E, Li XM, Bardina L, Bannon GA, Burks AW, and Sampson HA. 2001. Effects of cooking methods on peanut allergenicity. J Allergy Clin Immunol. 107:1077-1081. Beyer K, Bardina L, Grishina G, and Sampson HA. 2002. Identification of sesame seed allergens by 2-dimensional proteomics and Edman sequencing: seed storage proteins as common food allergens. J Allergy Clin Immunol. 110:154-159. Bhalla PL, Swoboda I, and Singh MB. 1999. Antisense-mediated silencing of a gene encoding a major ryegrass pollen allergen. Proc Natl Acad Sci USA. 96:1167611680. Bhalla PL, and Singh MB. 2004. Knocking out expression of plant allergen genes. Methods. 32:340-345. Bianchi-Hall CM, Keys RD, Stalker HT, and Murphy JP. 1993. Diversity of seed storage protein patterns in wild peanut ( Arachis , Fabaceae ) species. Plant Syst Evol. 186:1-15. Bianchi-Hall CM, Keys RD, and Stalker HT. 1994. Use of seed protein profiles to characterize peanut cultivars. Peanut Sci. 21:152-159. Blanco C, Diaz-Perales A, Collada C, Sanchez-Monge R, Aragoncillo C, Castillo R, Ortega N, Alvarez M, Carrillo T, and Salcedo G. 1999. Class I chitinases as potential panallergens involved in the latex-frit syndrome. J Allergy Clin Immunol. 103:507-513. Bock SA. 1987. Prospective appraisal of complaints of adverse reactions to foods in children during the first 3 years of life. Pediatrics. 79:683-688. Bock SA., Munoz-Furlong A. and Sampson HA. 2001. Fatalities due to anaphylactic reactions to foods. J Allergy Clin Immunol. 107:191-193. Brederode FT, Linthorst HJ, and Bol JF . 1991. Differential induction of acquired resistance and PR gene expression in tobacco by virus infection, ethephon treatment, UV light and wounding. Plant Mol Biol. 17:1117-1125. Breiteneder H, and Ebner C. 2000. Molecular and biochemical classification of plantderived food allergens. J Allergy Clin Immunol. 106:27-36. Burks AW. 2002. Current understanding of food allergy. Ann NY Acad Sci. 964:1-12. Burks AW. 2003. Peanut allergy: a grow ing phenomenon. J Clin Invest. 111:950-952.

PAGE 144

132 Burks AW, Williams LW, Helm RM, Connaughton C, Cockrell G, and O'Brien TJ. 1991. Identification of a major peanut allergen, Ara h I, in patients with atopic dermatitis and positive peanut challenges. J Allergy Clin Immunol. 88:172-179. Burks AW, Williams LW, Thresher W, Connaughton C, Cockrell G, and Helm RM. 1992a. Allergenicity of peanut and soybean extracts altered by chemical or thermal denaturation in patients with atopic dermatitis and positive food challenges. J Allergy Clin Immunol. 90:889-897. Burks AW, Williams LW, Connaughton C, Cockrell G, O'Brien TJ, and Helm RM. 1992b. Identification and characterization of a second major peanut allergen, Ara h II, with use of the sera of patients with atopic dermatitis and positive peanut challenge. J Allergy Clin Immunol. 90:962-969. Burks AW, Cockrell G, Connaughton C, and Helm RM. 1994. Epitope specificity and immunoaffinity purification of the major peanut allergen, Ara h I. J Allergy Clin Immunol. 93:743-750. Burks AW, Cockrell G, Stanley JS, Helm RM, and Bannon GA. 1995a. Recombinant peanut allergen Ara h I expression and IgE binding in patients with peanut hypersensitivity. J Clin Invest. 96:1715-1721. Burks AW, Cockrell G, Connaughton C, Karpas A, and Helm RM. 1995b. Epitope specificity of the major peanut allergen, Ara h II. J Allergy Clin Immunol. 95:607611. Burks AW, Cockrell G, Stanley JS, Helm RM, and Bannon GA. 1995c. Isolation, identification, and characterization of clones encoding antigens responsible for peanut hypersensitivity. Int Arch Allergy Immunol. 107:248-250. Burks, AW, Shin D, Cockrell G, Stanley JS, Helm RM, and Bannon GA. 1997. Mapping and mutational analysis of the IgE binding epitopes on Ara h I, a legume storage protein and a major peanut allergen. Eur J Biochem. 245:334-339. Burks AW, Sampson HA, and Bannon GA. 1998. Review Article Series II. Peanut allergens. Allergy. 53:725-730. Burks AW, King N, and Bannon GA. 1999. Modification of a major peanut allergen leads to loss of IgE binding. Int Arch Allergy Immunol. 118:313-314. Burks W, Bannon G, and Lehrer SB. 2001. Classic specific immunotherapy and new perspectives in specific immunotherapy for food allergy. Allergy. 56:121-124. Callis J. 1995. Regulation of protein degradation. Plant cell. 7:845-857.

PAGE 145

133 Casale TB, Condemi J, LaForce C, Nayak A, Rowe M, Watrous M, McAlary M, FowlerTaylor A, Racine A, Gupta N, Fick R, and Della Cioppa G; Omalizumab Seasonal Allergic Rhinitis Trail Group. 2001. Effect of Omalizumab on Symptoms of Seasonal Allergic Rhinitis. J Am Med Assoc. 286:2956-2967. Chatchatee P, Jarvinen KM, Bardina L, Vila L, Beyer K, and Sampson HA. 2001. Identification of IgE and IgG binding epitopes on betaand kappa-casein in cow's milk allergic patients. Clin Exp Allergy. 31:1256-1262. Chatel JM, Bernard H, and Orson FM. 2003a . Isolation and characterization of two complete Ara h 2 isoforms cDNA. Int Arch Allergy Immunol. 131:14-18. Chatel JM, Song L, Bhogal B and, and Orson FM. 2003b. Various factors (allergen nature, mouse strain, CpG/recombinant protein expressed) influence the immune response elicited by genetic immunization. Allergy. 58:641-647. Chlan CA, Pyle J, Legocki A, and Dure L III. 1986. Developmental biochemistry of cottonseed embryogenesis and germination. XVIII. cDNA and amino acid sequences of the members of the storage protein families. Plant Mol Biol. 7:475489. Choi SB, Wang C, Muench DG, Ozawa K, Franceschi VR, Wu Y, and Okita TW. 2000. Messenger RNA targeting of rice seed storage proteins to specific ER subdomains. Nature. 407:765-767. Clarke MC, Kilburn SA, Hourihane JO, Dean KR, Warner JO, and Dean TP. 1998. Serological characteristics of peanut allergy. Clin Exp Allergy. 28:1251-1257. Coleman CE, and Larkins BA. 1999. The prolamins of maize. In: Shewry PR, Casey R, eds. Seed proteins. Dordrecht: Kluwer Academic Publishers. 109-139. de Jong EC, van Zijverden M, Spanhaak S, Koppelman SJ, Pellegrom H, and Penninks AH. 1998. Identification and partial characterization of multiple major allergens in peanut proteins. Clin Exp Allergy. 28:743-751. De Vris S, Hoge H, and Bisseling T. 1988. Plant Mol Biol Manual. Vol. II B6:1. Dickinson CD, Hussein EHA, and Nielsen NC. 1989. Role of posttranslational cleavage in glycinin assembly. Plant cell. 1:459-469. Dodo HW, Viquez OM, Maleki SJ, and Konan KN. 2004. cDNA clone of a putative peanut ( Arachis hypogaea L.) trypsin inhibitor has homology with peanut allergens Ara h 3 and Ara h 4. J Agric Food Chem. 52:1404-1409. Domoney C, and Casey R. 1985. Measurement of gene number for seed storage proteins in Pisum. Nucleic Acids Res. 13:687-699.

PAGE 146

134 Dunwell JM, Culham A, Carter CE, Sosa-Aguirre CR, and Goodenough PW. 2001. Evolution of functional diversity in the cupin superfamily. Trends Biochem Sci. 26:740-746. Dure LS. 1975. Seed formation. A Rev Pl Physiol. 26:259-278. Ebner C, Hoffmann-Sommergruber K, and Breiteneder H. 2001. Plant food allergens homologous to pathogenesis-related proteins. Allergy. 56 Suppl. 67:43-44. Eigenmann PA, Burks AW, Bannon GA, and Sampson HA. 1996. Identification of unique peanut and soy allergens in sera adsorbed with cross-reacting antibodies. J Allergy Clin Immunol. 98:969-978. Elpidina EN, Voskobyonikova NE, Belozersky MA, and Dunaevsky YE. 1991. Localization of a metalloproteinase and its inhibitor in the protein bodies of buckwheat seeds. Planta. 185:46-52. ExPASy Molecular Biology server. http://au.expasy.org/tools . 2003-09-30 Farrp Allergen Database. http://www.allergenonline.com/ . 2003-11-21. Fernández A, and Krapovickas A. 1994. Cromosomas y evolución en Arachis ( Leguminosae ). Bonplandia. 8:187-220. Freitas RL, Ferreira RB, and Teixeira AR. 2000. Use of a single method in the extraction of the seed storage globulins from several legume species. Application to analyse structural comparisons within the major classes of globulins. Int J Food Sci Nutr. 51:341-352. Gatehouse JA, Evans IM, Croy RRD, and Boulter D. 1982. Differential expression of genes during legume seed development. Phil Trans R Soc Lond B. 314:367-384. GenoMechanix. http://www.geno-mechnix.com/ . 2001-07-25. Gibbs PE, Strongin KB, and McPherson A. 1989. Evolution of legume seed storage proteins-a domain common to legumins and vicilins is duplicated in vicilins. Mol Biol Evol. 6:614-623. Goldberg RB, Barker SJ, and Perez-Grau L. 1989. Regulation of gene expression during plant embryogenesis. Cell. 56:149-160. Gruis DF, Selinger DA, Curran JM, and Jung R. 2002. Redundant proteolytic mechanisms process seed storage proteins in the absence of seed-type members of the vacuolar processing enzyme family of cysteine proteases. Plant Cell. 14:28632882. Gruis D, Schulze J, and Jung R. 2004. Storage protein accumulation in the absence of the vacuolar processing enzyme family of cysteine proteases. Plant cell. 16:270-290.

PAGE 147

135 Guex N, and Peitsch MC. 1997. SWISS-MODEL and the Swiss-PdbViewer: An environment for comparative protein modeling. Electrophoresis. 18:2714-2723. Halward TM, Stalker HT, LaRue E, and Koch ert G. 1991. Genetic variation detectable with molecular markers among unadapted germplasm resources of cultivated peanut and related wild species. Genome. 34:10131020. Harada JJ, Barker SJ, and Goldberg RB. 1989. Soybean beta-conglycinin genes are clustered in several DNA regions and are regulated by transcriptional and posttranscriptional processes. Plant cell. 1:415-425. Hara-Nishimura I, Nishimura M, Matsubara H, and Akazawa T. 1982. Suborganeller localization of proteinase catalyzing the limited hydrolysis of pumpkin globulin. Plant Physiol. 70:699-703. Harris N, Grindley H, Mulchrone J, and Croy RRD. 1989. Correlated in situ hybridization and immunocytochemical studies of legumin storage protein deposition in pea ( Pisum sativum L.). Cell Biol Int Reps. 13:23-35. Hauxwell AJ, Corke FMK, Hedley CL, and Wang TL. 1990. Storage protein gene expression is localized to regions lacking mitotic activity in developing pea embryos. An analysis o seed development in Pisum sativum XIV. Development. 110:283-289. Hedley CL, and Smith CM. 1985. Genetic variation for pea seed development. In: Hebbletwaite PD, Heath MC, Dawkins TCK, editors. The pea. London: Butterworths. 329-338. Helm RM, Cockrell G, Connaughton C, Sampson HA, Bannon GA, Beilinson V, Livingstone D, Nielsen NC, and Burks AW . 2000. A soybean G2 glycinin allergen. 1. Identification and characterizati on. Int Arch Allergy Immunol. 123:205-212. Herman EM. 2003. Genetically modified soybeans and food allergies. J Exp Bot. 54:1317-1319. Herman EM, Li X, Su RT, Larsen P, Hsu H, and Sze H. 1994. Vacuolar-type H+ ATPases are associated with the endoplasmic reticulum and provacuoles of root yip cells. Plant Physiol. 106:1313-1324. Herman EM, and Larkins BA. 1999. Protein storage bodies and vacuoles. Plant cell. 11:601-614. Herman EM, Helm RM, Jung R, and Kinney AJ. 2003. Genetic modification removes an immunodominant allergen from soybean. Plant Physiol. 132:36-43. Higgins TJV. 1984. Synthesis and regulation of major proteins in seeds. A Rev Pl Physiol. 35:191-221.

PAGE 148

136 Hoffman DR, and Haddad ZH. 1974. Diagnosis of IgE-mediated reaction to food antigens by radioimmunoassay. Allergy Clin Immunol. 54:165. Hoffmann-Sommergruber K. 2002. Pathogenesis-related (PR)-proteins identified as allergens. Biochem Soc Trans. 30:930-935. Holbrook CC, Anderson WF, and Pittman RN. 1993. Selection of a core collection from the U.S. germplasm collection of peanuts. Crop Sci . 33:859-861. Hourihane JO, Roberts SA, and Warner JO. 1998. Resolution of peanut allergy: casecontrol study. Br Med J. 316:1271-1275. Huang X. 1994. On global sequence alignment. Comput Appl Biosci. 10:227-235. Husted L. 1933. Cytological studies of the peanut Arachis . I. Chromosome number and morphology. Cytologia. 5:109-117. James JM, Sixbey JP, Helm RM, Bannon GA, and Burks AW. 1997. Wheat alphaamylase inhibitor: a second route of allergic sensitization. J Allergy Clin Immunol. 99:239-244. Jung R, Scott MP, Nam YW, Beaman TW, Bassuner R, Saalbach I, Muntz K, and Nielsen NC. 1998. The role of proteolysis in the processing and assembly of 11S seed globulins. Plant cell. 10:343-357. Jung S, Tate PL, Horn R, Kochert G, Moore K, and Abbott AG. 2003. The phylogenetic relationship of possible progenitors of the cultivated peanut. J Hered. 94:334-340. Kagan RS. 2003. Food allergy: an overview. Environ Health Perspect. 111:223-225. Kelly JD, Hlywka JJ, and Hefle SL. 2000. Identification of sunflower seed IgE-binding proteins. Int Arch Allergy Immunol. 121:19-24. Kleber-Janke T, Crameri R, Appenzeller U, Schlaak M, and Becker WM. 1999. Selective cloning of peanut allergens, including profilin and 2S albumins, by phage display technology. Int Arch Allergy Immunol. 119:265-274. Ko TP, Ng JD, and McPherson A. 1993. The three-dimensional structure of canavalin from jack bean ( Canavalia ensiformis ). Plant Physiol. 101:729-744. Kochert GD, Halward TM, Branch WD, and Simpson CE. 1991. RFLP variability in peanut cultivars and wild species. Theor Appl Genet. 81:565-570. Kochert GD, Stalker HT, Gimenes M, Galgaro L, Lopes CR, and Moore K. 1996. RFLP and cytogenetic evidence on the origin and evolution of allotetraploid domesticated peanut Arachis hypogaea (Leguminosae). Amer J Bot. 83:1282-1291.

PAGE 149

137 Koppelman SJ, Bruijnzeel-Koomen CA, Hessing M, and de Jong HH. 1999. Heatinduced conformational changes of Ara h 1, a major peanut allergen, do not affect its allergenic properties. J Biol Chem. 274:4770-4777. Koppelman SJ, Vlooswijk RA, Knippels LM, Hessing M, Knol EF, van Reijsen FC, and Bruijnzeel-Koomen CA. 2001. Quantification of major peanut allergens Ara h 1 and Ara h 2 in the peanut varieties Runner, Spanish, Virginia, and Valencia, bred in different parts of the world. Allergy. 56:132-137. Koppelman SJ, Knol EF, Vlooswijk RAA, Wensing M, Knulst AC, Hefle SL, Gruppen H, and Piersma S. 2003. Peanut allergen Ara h 3: Isolation from peanuts and biochemical characterization. Allergy. 58:1144-1151. Kreis M, Forde BG, Rahman S, Miflin BJ, and Shewry PR. 1985. Molecular evolution of the seed storage proteins of barley, rye and wheat. J Mol Biol. 183:499–502. Krishnan HB, Franceschi VR, and Okita TW. 1986. Immunochemical studies on the role of the Golgi complex in protein-body formation in rice seeds. Planta. 169:471-480. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227:680-685. Lampire Biological Laboratories. http://www.lampire.com/ . 2002-11-25. Lawrence MC, Izard T, Beuchat M, Blagrove RJ, and Colman PM. 1994. Structure of phaseolin at 2.2 A resolution. Implications for a common vicilin/legumin structure and the genetic engineering of seed storage proteins. J Mol Biol. 238:748-776. Li X, Franceschi V, and Okita TW. 1993. Segregation of storage protein mRNAs on the rough endoplasmic reticulum membranes of rice endosperm membrane. Cell. 72:869-879. Li X, Huang CK, Schofield BH, Burks AW, Bannon GA, Kim KH, Huang SK, and Sampson HA. 1999. Strain-dependent induction of allergic sensitization caused by peanut allergen DNA immunization in mice. J Immunol. 162:3045-3052. Lycett GW, Delauney AJ, Gatehouse JA, Gilroy J, Croy RR, and Boulter D. 1983. The vicilin gene family of pea ( Pisum sativum L.): a complete cDNA coding sequence for preprovicilin. Nucleic Acids Res. 11:2367-2380. Lycett GW, Croy RR, Shirsat AH, and Boulter D. 1984. The complete nucleotide sequence of a legumin gene from pea ( Pisum sativum L.). Nucleic Acids Res. 12:4493-4506. Maleki SJ, Chung SY, Champagne ET, and Raufman JP. 2000a. The effects of roasting on the allergenic properties of peanut proteins. J Allergy Clin Immunol. 106:763768.

PAGE 150

138 Maleki SJ, Kopper RA, Shin DS, Park CW, Compadre CM, Sampson H, Burks AW, and Bannon GA. 2000b. Structure of the major peanut allergen Ara h 1 may protect IgE-binding epitopes from degradation. J Immunol. 164:5844-5849. Maleki SJ, Viquez O, Jacks T, Dodo H, Champagne ET, Chung SY, and Landry SJ. 2003. The major peanut allergen, Ara h 2, functions as a trypsin inhibitor, and roasting enhances this function. J Allergy Clin Immunol. 112:190-195. Mandal S, and Mandal RK. 2000. Seed storage proteins and approaches for improvement of their nutritional quality by genetic engineering. Curr Sci. 79:576-589. Meinke DW, Chen J, and Beachy RN. 1981. E xpression of storage protein genes during soybean seed development. Planta. 153:130-139. Mills EN, Jenkins J, Marigheto N, Belton PS, Gunning AP, and Morris VJ. 2002. Allergens of the cupin superfamily. Biochem. Soc. Trans. 30:925-929. Muench DG, Ogawa M, and Okita TW. 1999. The prolamins of rice. In: Shewry PR, Casey R, editors. Seed proteins. Dordrecht: Kluwer Academic Publishers. 93-108. Müntz K. 1989. Intracellular protein sorting and the formation of protein reserves in storage tissue cells of plant seeds. Biochem Physiol Pflanzen. 185:315-335. Müntz K. 1996. Proteases and proteolytic cleavag e of storage proteins in developing and germinating dicotyledonous seeds. J Exp Bot. 47:605-622. Müntz K. 1998. Deposition of storage proteins. Plant Mol Biol. 38:77-99. Nakamura R, and Matsuda T. 1996. Rice allergenic protein and molecular genetic approach for hypoallergenic rice. Bios Biot Biochem. 60:1215-1221. Nelson HS, Lahr J, Rule R, Bock A, and Leung D. 1997. Treatment of anaphylactic sensitivity to peanuts by immunotherapy with injections of aqueous peanut extract. J Allergy Clin Immunol. 99:744-751. NetNGlyc. http://www.cbs.dtu.dk/services/NetNGlyc . 2003-09-30. Nielsen NC, Dickinson CD, Cho TJ, Thanh VH, Scallon BJ, Fischer RL, Sims TL, Drews GN, and Goldberg RB. 1989. Characterization of the glycinin gene family in soybean. Plant cell. 1:313-328. Nielsen NC, Bassuner R, and Beaman T. 1996. The biochemistry and cell biology of embryo storage proteins. In: Larkins BA, Vasil IK, editors. Cellular and Molecular Biology of Plant Seed Development. Dordrecht .Kluwer Academic Publishers. 151220.

PAGE 151

139 Nishizawa K, Maruyama N, Satoh R, Fuchikami Y, Higasa T, and Utsumi S. 2003. A Cterminal sequence of soybean -conglycinin Â’ subunit acts as a vacuolar sorting determinant in seed cells. Plant J. 34:647-659. Notredame C, Higgins D, and Heringa J. 2000. T-Coffee: A novel method for multiple sequence alignments. J Mol Biol. 302:205-217. Ogawa A, Samoto M, and Takahashi K. 2000. Soybean allergens and hypoallergenic soybean products. J Nutr Sci Vitaminol. 46:271-279. Oliveira LO, Nam YW, Jung R, and Nielsen NC. 2002. Processing and assembly in vitro of engineered soybean beta-conglycinin subunits with the asparagine-glycine proteolytic cleavage site of 11S globulins. Mol Cells. 13:43-51. Okita TW, Hwang YS, Hnilo J, Kim WT, Aryan AP, Larson R, and Krishnan HB. 1989. Structure and expression of the rice glutelin multigene family. J Biol Chem. 264:12573-12581. Okita TW, and Rogers JC. 1996. Compartmentation of proteins in the endomembrane system of plant cells. Ann Rev Plant Physiol Plant Mol Biol. 47:327-349. Osborne TB. 1924. The Vegetable Proteins. London. Longmans Green. Paik-Ro OG, Seib JC, and Smith RL. 2002. Seed-specific, developmentally regulated genes of peanut. Theor Appl Genet. 104:236-240. Pairwise Sequence Alignment Programs. http://genome.cs.mtu.edu/sas.html . 2003-09-30. Palosuo K, Alenius H, Varjonen E, Koivuluht a M, Mikkola J, Keskinen H, Kalkkinen N, and Reunala T. 1999. A novel wheat gliadin as a cause of exercise-induced anaphylaxis. J Allergy Clin Immunol. 103:912-917. Palosuo K, Alenius H, Varjonen E, Kalkkinen N, and Reunala T . 2001. Rye gamma-70 and gamma-35 secalins and barley gamma-3 hordein cross-react with omega-5 gliadin, a major allergen in wheat-dependent, exercise-induced anaphylaxis. Clin Exp Allergy. 31:466-473. Park JW, Kang DB, Kim CW, Ko SH, Yum HY, Kim KE, Hong CS, and Lee KY. 2000. Identification and characterization of th e major allergens of buckwheat. Allergy. 55:1035-1041. Park SS, Abe K, Kimura M, Urisu A, and Yamasaki N. 1997. Primary structure and allergenic activity of trypsin inhibitors from the seeds of buckwheat ( Fagopyrum esculentum Moench). FEBS Lett. 400:103-107.

PAGE 152

140 Pastorello EA, Farioli L, Pravettoni V, Ispano M, Conti A, Ansaloni R, Rotondo F, Incorvaia C, Bengtsson A, Rivolta F, Trambaioli C, Previdi M, and Ortolani C. 1998. Sensitization to the major allergen of Brazil nut is correlated with the clinical expression of allergy. J Allergy Clin Immunol. 102:1021-1027. Pastorello EA, Farioli L, Pravettoni V, Is pano M, Scibola E, Trambaioli C, Giuffrida MG, Ansaloni R, Godovac-Zimmermann J, Conti A, Fortunato D, and Ortolani C. 2000. The maize major allergen, which is responsible for food-induced allergic reactions, is a lipid transfer protein. J Allergy Clin Immunol.106:744-751. Pastorello EA, Pompei C, Pravettoni V, Brenna O, Farioli L, Trambaioli C, and Conti A. 2001a. Lipid transfer proteins and 2S albumins as allergens. Allergy. 56:45-47. Pastorello EA, Varin E, Farioli L, Pravettoni V, Ortolani C, Trambaioli C, Fortunato D, Giuffrida MG, Rivolta F, Robino A, Calamari AM, Lacava L, and Conti A. 2001b. The major allergen of sesame seeds ( Sesamum indicum ) is a 2S albumin. J Chromatogr B Biomed Sci Appl. 756:85-93. Pastorello EA, Vieths S, Pravettoni V, Fari oli L, Trambaioli C, Fortunato D, Luttkopf D, Calamari M, Ansaloni R, Scibilia J, Ballmer-Weber BK, Poulsen LK, Wutrich B, Hansen KS, Robino AM, Ortolani C, and Conti A. 2002. Identification of hazelnut major allergens in sensitive patients with positive double-blind, placebo-controlled food challenge results. J Allergy Clin Immunol. 109:563-570. Pate JS, and Flinn AM. 1971. Fruit and seed development. In: Sutcliffe JF, and Pate JS. editors. The Physiology of the Garden Pea. London: Academic Press. 431-468. Pattee HE, Johns EB, Singleton JA, and Sanders TH. 1974. Composition of peanut fruit parts during maturation. Peanut Sci. 1:57-62. Perez-Grau L, and Goldberg RB. 1989. Soyb ean seed protein genes are regulated spatially during embryogenesis. Plant Cell. 1:1095-1109. Plasma-Lab International. http://allergicdonorinfo.com . 2003-07-30. Rabjohn P, Helm EM, Stanley JS, West CM, Sampson HA, Burks AW, and Bannon GA. 1999. Molecular cloning and epitope analysis of the peanut allergen Ara h 3. J Clin Invest. 103:535-542. Rabjohn P, West CM, Connaughton C, Sampson HA, Helm RM, Burks AW, and Bannon GA. 2002. Modification of peanut allergen Ara h 3: effects on IgE binding and T cell stimulation. Int Arch Allergy Immunol. 128:15-23. Robinson DG, Hinz G, and Holstein SHE. 1998. The molecular characterization of transport vesicles. Plant Mol Biol. 38:49-76. Rogers SO, and Bendich AJ. 1985. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissue. Plant Mol Biol.5:69-76.

PAGE 153

141 Roy K, Mao HQ, Huang SK, and Leong KW. 1999. Oral gene delivery with chitosan-DNA nanoparticles generates immunologic protection in a murine model of peanut allergy. Nat Med. 5:387-391. Sachs MI, Jones RT, and Yunginger JW. 1981. Isolation and partial characterization of a major peanut allergen. J Allergy Clin Immunol. 67:27-34. Sambrook J, Fritsch EF, and Maniatis T. 1989. Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sampson HA. 1996. Managing peanut allergy. Br Med J. 312:1050-1051. Sampson HA. 1999a. Food allergy. Part 1: imm unopathogenesis and clinical disorders. J Allergy Clin Immunol. 103:717-728. Sampson HA. 1999b. Food allergy. Part 2: diagnosis and management. J Allergy Clin Immunol. 103:981-989. Sampson HA, and McCaskill CC. 1985. Food hypersensitivity and atopic dermatitis: evaluation of 113 patients. J Peds. 107:669-675. Sampson HA, Mendelson L, and Rosen JP. 1992. Fatal and near-fatal anaphylactic reactions to food in children and adolescents. N Engl J Med. 327:380-384. Sanchez-Monge R, Blanco C, Perales AD, Collada C, Carrillo T, Aragoncillo C, and Salcedo G . 2000. Class I chitinases, the panallergens responsible for the latex-fruit syndrome, are induced by ethylene treatment and inactivated by heating. J Allergy Clin Immunol. 106:190-195. Schlereth A, Becker C, Horstmann C, Tiedemann J, and Müntz K. 2000. Comparison of globulin mobilization and cysteine proteinases in embryonic axes and cotyledons during germination and seedling growth of vetch ( Vicia sativa L.). J Exp Bot 51:1423-1433. Schlesier B, Bassuner R, Van Hai N, and Müntz K. 1990. The cDNA derived primary structure of two distinct legumin A subunit precursors from field bean ( Vicia faba L.). Nucleic Acids Res. 18:7146. Schulman ES. 2001. Development of a monoclonal anti-immunoglobulin E antibody (omalizumab) for the treatment of allergic respiratory disorders. Am J Respir Crit Care Med. 164:S6-11. Scott MP, Jung R, Muntz K, and Nielsen NC. 1992. A protease responsible for posttranslational cleavage of a conserved Asn-Gly linkage in glycinin, the major seed storage protein of soybean. Proc Natl Acad Sci USA. 89:658-662.

PAGE 154

142 Sen M, Kopper R, Pons L, Abraham EC, Burks AW, and Bannon GA. 2002. Protein structure plays a critical role in peanut allergen stability and may determine immunodominant IgE-binding epitopes. J Immunol. 169:882-887. Sheikh A, and Alves B. 2000. Hospital admissions for acute anaphylaxis: time trend study. Br Med J. 320:1441. Shewry PR, and Tatham AS. 1990. The prolamin storage proteins of cereal seeds: structure and evolution. Biochem J. 267:1–12. Shewry PR, Napier JA, and Tatham AS. 1995. Seed storage proteins: structures and biosynthesis. Plant cell. 7:945-956. Shewry PR, and Halford NG. 2002. Cereal seed storage proteins: structures, properties and role in grain utilization. J Exp Bot. 53:947-958. Shewry PR, Beaudoin F, Jenkins J, Griffith s-Jones S, and Mills EN. 2002. Plant protein families and their relationships to food allergy. Biochem Soc Trans. 30:906-910. Shimada T, Fuji K, Tamura K, Kondo M, Nishimura M, and Hara-Nishimura I. 2003. Vacuolar sorting receptor for seed storage proteins in Arabidopsis thaliana. Proc Natl Acad Sci USA. 100:16095-16100. Shin DS, Compadre CM, Maleki SJ, Kopper RA, Sampson H, Huang SK, Burks AW, and Bannon GA. 1998. Biochemical and structur al analysis of the IgE binding sites on ara h1, an abundant and highly allergenic peanut protein. J Biol Chem. 273:13753-13759. Shutov AD, and Vaintraub IA. 1987. Degradati on of storage proteins in germinating seeds. Phytochemistry. 26:1557-1566. Shutov AD, Kakhovskaya IA, Braun H, Baumlein H, and Müntz K. 1995. Legumin-like and vicilin-like seed storage proteins: evidence for a common single-domain ancestral gene. J Mol Evol. 41:1057-1069. Shutov AD, and Bäumlein H. 1999. Origin and evolution of seed storage globulins. In: Shewry PR, Casey R, editors. Seed proteins. Dordrecht: Kluwer Academic Publishers. 543-561. Shutov AD, Bäumlein H, Blattner FR, and Müntz K. 2003. Storage and mobilization as antagonistic functional constraints on seed storage globulin evolution. J Exp Bot. 54:1645-1654. Sicherer SH. 1999. Food allergy: When and how to perform oral food challenges. Pediatr Allergy Immunol. 10:226-234. Sicherer SH. 2002. Clinical update on peanut allergy. Ann Allergy Asthma Immunol. 88:350-361. quiz 361-2, 394.

PAGE 155

143 Sicherer SH, Munoz-Furlong A, Burks AW, and Sampson HA. 1999. Prevalence of peanut and tree nut allergy in the U.S. determined by a random digit dial telephone survey. J Allergy Clin Immunol. 103:559-562. Sims TL, and Goldberg RB. 1989. The glycinin Gy1 gene from soybean. Nucleic Acids Res. 17:4386. Simpson CE, Krapovickas A, and Valls JFM. 2001. History of Arachis including evidence of A. hypogaea L. progenitors. Peanut Sci. 28:78-79. Singh AK, and Moss JP. 1982. Utilization of wild relatives in genetic improvement of Arachis hypogaea L. 2. Chromosome complement of species of section Arachis . Theor Appl Genet. 61:305-314. Singh AK, and Simpson CE. 1994. Biosystematics and genetic resources. In: Smartt J. editor. The Groundnut Crop: A Scientific Basis for Improvement (London. Chapman and Hall. 96-137. Skolnick HS, Conover-Walker MK, Koerner CB, Sampson HA, Burks W, and Wood RA. 2001. The natural history of peanut allergy. J Allergy Clin Immunol. 107:367374. Stanley JS, King N, Burks AW, Huang SK, Sampson H, Cockrell G, Helm RM, West CM, and Bannon GA. 1997. Identification and mutational analysis of the immunodominant IgE binding epitopes of the major peanut allergen Ara h 2. Arch Biochem Biophys. 342:244-253. Stinzi A, Heitz T, Prasad V, Wiedemann-Merdinoglu S, Kaufmann S, Geoffroy P, and Fritig B. 1993. Plant pathogenesis-related proteins and their role in defense against pathogens. Biochimie. 75:687-706. Strebbins GL. 1957. Genetics, evolution, and pl ant breeding. Indian J Genet Plant Breed. 17:129-141. SWISS-MODEL. http://www.expasy.org/swissmod/SWISS-MODEL.html . 2003-01-22. Tada Y, Nakase M, Adachi T, Nakamura R, Shimada H, Takahashi M, Fujimura T, and Matsuda T. 1996. Reduction of 14-16 kDa allergenic proteins in transgenic rice plants by antisense gene. FEBS Letters. 391:341. Tai SS, Wu LS, Chen EC, and Tzen JT. 1999. Molecular cloning of 11S globulin and 2S albumin, the two major seed storage proteins in sesame. J Agric Food Chem. 47:4932-4938. Tanchak MA, Giband M, Potier B, Schernthaner JP, Dukiandjiev S, and Altosaar I. 1995. Genomic clones encoding 11S globulins in oats ( Avena sativa L.). Genome. 38:627-634.

PAGE 156

144 Taylor SL. 1987. Allergic and sensitivity reactions to food components. In: Hatchcock JN, editor. Nutritional Toxicology. Orlando: Academic Press. Vol. II. pp 173-198. T-COFFEE. http://www.ch. embnet.org /software/TCoffee.html . 2002-09-30. Teuber SS, Dandekar AM, Peterson WR, and Sellers CL. 1998. Cloning and sequencing of a gene encoding a 2S albumin seed storage protein precursor from English walnut (Juglans regia), a major food allergen. Clin Immunol. 6:807-814. Thanh VH, and Shibasaki K. 1978. Major proteins of soybean seeds: reconstitution of conglycinin from its subunits. J Agric Food Chem. 26:695-698. The National Center for Biotechnology Information. http://www.ncbi.nlm.nih.gov/ . 200209-30. Thomas TL. 1993. Gene expression during plant embryogenesis and germination: an overview. Plant Cell. 5:1401-1410. Thorpe SC, Kemeny DM, Panzani RC, McGurl B, and Lord M. 1988. Allergy to castor bean. II. Identification of the major allergens in castor bean seeds. J Allergy Clin Immunol. 82:67-72. Tiedemann J, Neubohn B, and Müntz K. 2000. Diffe rent functions of vicilin and legumin are reflected in the histopattern of globulin mobilization during germination of vetch ( Vicia sativa L.). Planta. 211:1-12. Towbin HK, Staehelin TH, and Gordon J. 1979. El ectrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Proc Natl Acad Sci USA. 76:43504354. Translate. http://au.expasy.org/tools/dna.html . 2002-09-30. Urisu A, Yamada K, Masuda S, Komada H, Wada E, Kondo Y, Horiba F, Tsuruta M, Yasaki T, and Yamada M. 1991. 16-kilodalton rice protein is one of the major allergens in rice grain extract and responsible for cross-allergenicity between cereal grains in the Poaceae family. Int Arch Allergy Appl Immunol. 96:244-252. Valenta R, Vrtala S, Focke-Tejkl M, Bugajska-Schretter, Ball T, Twardosz A, Spitzauer S, Gronlund H, and Kraft D. 1999. Genetically engineered and synthetic allergen derivatives: candidates for vaccination against type I allergy. Biol Chem. 380:815824. Varjonen E, Vainio E, Kalimo K, Juntunen-Backman K, and Savolainen J. 1995. Skinprick test and RAST responses to cereals in children with atopic dermatitis. Characterization of IgE-binding components in wheat and oats by an immunoblotting method. Clin Exp Allergy. 25:1100-1107.

PAGE 157

145 Varjonen E, Vainio E, and Kalimo K. 1997. Life-threatening, recurrent anaphylaxis caused by allergy to gliadin and exercise. Clin Exp Allergy. 27:162-166. Varjonen E, Vainio E, and Kalimo K. 2000. Antigliadin IgE--indicator of wheat allergy in atopic dermatitis. Allergy. 55:386-391. Vila L, Beyer K, Jarvinen KM, Chatchatee P, Bardina L, and Sampson HA. 2001. Role of conformational and linear epitopes in the achievement of tolerance in cow's milk allergy. Clin Exp Allergy. 31:1599-1606. Viquez OM, Summer CG, and Dodo HW. 2001. Isolation and molecular characterization of the first genomic clone of a major peanut allergen, Ara h 2. J Allergy Clin Immunol. 107:713-717. Viquez OM, Konan KN, and Dodo HW. 2003. Structure and organization of the genomic clone of a major peanut allergen gene, Ara h 1. Mol Immunol. 40:565-571. Wensing M, Knulst AC, Piersma S, O’kane F, Knol EF, and Koppelman SJ. 2003. Patients with anaphylaxis to pea can have peanut allergy caused by cross-reactive IgE to vicilin (Ara h 1). J Allergy Clin Immunol. 111:420-424. Wilson KA, Rightmire BR, Chen JC, and Tan-Wilson A. 1986. Differential proteolysis of glycinin and ß-conglycinin polypeptides during soybean germination and seedling growth. Plant Physiol. 82:71-76. Wynne JC, and Halward T. 1989. Cytogenetics and genetics of Arachis . Crit Rev Plant Sci. 8:189-220. Xiang P, Beardslee TA, Zeece MG, Markwell J, and Sarath G. 2002. Identification and analysis of a conserved immunoglobulin E-binding epitope in soybean G1a and G2a and peanut Ara h 3 glycinins. Arch Biochem Biophys. 408:51-57. Yaklich RW, Helm RM, Cockrell G, and Herman EM. 1999. Analysis of the distribution of the major soybean seed allergens in a core collection of glycine max accessions. Crop Sci. 39:1444-1447. Yalpani N, Silverman P, Wilson TMA, Kleier DA, and Raskin I. 1991. Salicylic acid is a systemic signal and an inducer of pathogenesis-related proteins in virus-infected tobacco. Plant cell. 3:809-818. Yamada K, Shimada T, Kondo M, Nishimura M, and Hara-Nishimura I. 1999. Multiple functional proteins are produced by cleav ing Asn-Gln bonds of a single precursor by vacuolar processing enzyme. J Biol Chem. 274:2563-2570. Yamada T, Aibara S, and Morita Y. 1979. Isolation and some properties of arachin subunits. Agric Biol Chem. 43:2563.

PAGE 158

146 Yamada T. Aibara S, and Morita Y. 1981. Reconstitution of arachin from isolated subunits. Agric Biol Chem. 45:1243-1250. Yocum MW, and Khan DA. 1994. Assessment of patients who have experienced anaphylaxis: a 3-year survey. Mayo Clin Proc. 69:16-23.

PAGE 159

147 BIOGRAPHICAL SKETCH Il-Ho Kang was born in Cheju, Korea, on December 4, 1969. He graduated from Korea University with his Bachelor of Science degree majoring in biology in 1996. In 1998, he completed his M.S. degree in biology (plant molecular genetics) at Korea University. The title of his M.S. disserta tion was “Light Regulation of Chloroplast Translational Elongation Factor EF-Tu Gene in Rice ( Oryza sativa L.).” After his M.S. degree, he joined the Department of Legal Medicine in Korea University as research assistant until May of 1999. In the fall of 1999, he enrolled in the Agronomy Department, University of Florida, for the Doctor of Philosophy degree. He is the first son of Bok Min Kang and Ae Ok Oh. Since he married Seung-Hee Kim in 1997, he is living with his wife and two children, Kichang Philip and Sunyu.