|
|
| Citation |
- Permanent Link:
- https://ufdc.ufl.edu/UFE0004372/00001
Material Information
- Title:
- Building an Episomal Model of Aging in Saccharomyces cerevesiae
- Creator:
- FALCON, ALARIC ANTONIO ( Author, Primary )
- Copyright Date:
- 2008
Subjects
- Subjects / Keywords:
- Cellular senescence ( jstor )
Daughter cells ( jstor )
DNA ( jstor )
Life span ( jstor )
Magnetism ( jstor )
Monomers ( jstor )
Mother cells ( jstor )
Plasmids ( jstor )
Ribosomal DNA ( jstor )
Yeasts ( jstor )
Record Information
- Source Institution:
- University of Florida
- Holding Location:
- University of Florida
- Rights Management:
- Copyright Alaric Antonio Falcon. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
- Embargo Date:
- 4/30/2004
- Resource Identifier:
- 72844070 ( OCLC )
|
| Downloads |
This item has the following downloads:
|
| Full Text |
|
BUILDING AN EPISOMAL MODEL OF AGING IN Saccharomyces cerevisiae
By
ALARIC ANTONIO FALCON
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA INT PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2004
Copyright 2004
by
Alaric Antonio Falc6n
This document is dedicated to Peri A. Tong, Manuel A. Falc6n, and Beverly L. Metcalfe
for their unwavering support.
ACKNOWLEDGMENT S
I thank my mentor, John P. Aris, and my committee (William A. Dunn, Thomas C.
Rowe, and Brian Burke) for helping me become a scientist.
TABLE OF CONTENTS
Page
ACKNOWLEDGMENT S ........._._._..... .___ ..............iv.....
LI ST OF T ABLE S .............. ..............viii....
LI ST OF FIGURE S ........._._._..... .___ .............._ ix...
AB S TRAC T .........._.._.._ ..............xi..._.... ....
CHAPTER
1 BACKGROUND AND SIGNIFICANCE ........._..._.._ ...._._ .........._..........
Sirdp, rDNA, and Aging .............. ......._ .. .............. 1..
Extrachromosomal rDNA Circles are Discovered ......._.__ ........__ .............2
Components of the rDNA .........._.._...... .............. 3...
Foblp and its Role in ERC Production .........._.__..... .__ .. ....._._.......
ARS of the rDNA .........._..... ........_ ..............6....
Asymmetric Inheritance of ERCs .........._.._........_....._ ............
Summary .........._.__..... .__ ..............7.....
2 DEFINING THE LINK BETWEEN EPIS OMES AND AGING .............. ... ............9
Roles of Different Cis-Acting Plasmid Sequences in Reduction of Yeast Replicative
Life Span ................. .... ......... ............ .... ... ........... .......1
Plasmid Inheritance Correlates with Reduction in Yeast Life Span ................... ...... 17
Plasmids Do Not Significantly Increase ERC Levels ................. ................. ....20
Plasmid Accumulation Correlates with Reduction in Life Span .............. .... .......... 22
Terminal Cell M orphology ........._...... ........ .._.._ ..... ...._.._....... ...........2
Do Functional rDNA Transcriptional Units Play a Role in Reduction in Life Span?31
Summary ............ _...... ._ .............. 3 3...
3 TWO MICRON CIRCLE: A NATURALLY OCCURRING EPISOME' S ROLE IN
AGING ................. ................. 3......... 5.....
New Method for Removal of Two Micron Circle ................. ................ ...._ 36
Two Micron Circle Does Not Reduce Life Span ................ ... .............. ........38
Two Micron Circle Does Not Accumulate in Old Cells ................. ................. ..39
Summary ................. ................. 41.............
4 A CELL'S LIMITED RESOURCES AND PLASMID COMPETITION .................42
Smllp, Meclp, RNR, and Rad53p Pathway ................ ..............42. ...........
SML 1 Deletions Do Not Increase Life Span. ........._._........___ .........._...43
Old Cells Do Not have an Increased Sensitivity to Hydroxyurea. ........._...........45
Double Strand Breaks Do Not Increase in Old Cells .........._.... ........__........48
Phosphorylation of Rad53p Does Not Increase in Old Cells. ............. ...... ........ 49
ERC Competition with a CEN Plasmid Throughout Yeast Life Span ................... ... 50
Mitotic Stabilities in the Presence of ERCs ......___ ..... ...__ ........_..... 52
Plasmid Accumulation in sir2A and foblA Strains ................ ................ ...._ 55
Summary ................. ................. 56.............
5 CHROMATIN SILENCING AND EPISOME FORMATION ................ .............. 58
ACS2 and ACS1 is Required for Normal Life Span ................ ................ ...._ 59
ACS2A Increases ERC Production ................ ..............61. ..............
Summary ................ ..............62. ...............
6 LOOKING AT POSSIBLE MECHANISM OF CELLULAR AGING ................... ..64
YCA1 and Apoptosis in Yeast .............. ... .......... ...............64....
Shu Gene Family and Mutation Suppression in Aging ................. ................. ...65
Summary ................. ................. 67.............
7 DI SCU SSION ................. ................. 69.............
Why Do ARS Plasmids Accumulate in Mother Cells? ........... .. .. .........___......70
Why Do Budding Yeast Exhibit a Mother Cell Plasmid Segregation Bias?............. 71
Why Do ARS1~ Plasmids Bring About Cellular Senescence More Rapidly than Do
ER C s? ............ .... ........._ ........_ .. .. .............7
Do Cis-acting Sequences that Counteract Mother Cell Segregation Bias Suppress
Reduction in Life Span by ARS1~ Plasmids?.............. ................72
Do 2 Micron Circles Reduce Life Span? ......____ .... .. .__ .......__........7
Why Do 2 Micron Origin Plasmids Reduce Life Span? .............. ..............___....72
Why Do 2 Micron Origin Plasmids Have an Intermediate Effect on Life Span?......73
Why Does Transformation with pJPAll4 Lead to 2 Micron Circle Loss?...._........73
By What Mechanism(s) Do Plasmids, and by Implication ERC s, Reduce Life Span
in Y east? ........._.._.. ... ... ..._._ ..... .. .._ ..... .. .. ........7
Why Are There Less Plasmid Accumulation in Strains that Produce More ERCs?.. 75
Is There Episomal Aging in Metazoans? ....__ ......_____ .... .....__........7
8 MATERIALS AND METHODS ............_...... .__ .....___..........7
Yeast Strains and Plasmids ............ .....__ ..............77..
M itotic Stability .............. .. ........... ..............79.......
Replicative Life Span Determinations.............. .............79
Southern Blot Analysis and Quantitation ....__ ......_____ ..... .....__.........8
Magnetic Cell Sorting.............. ................ 8 1
Budscar Histograms ........._._ ......._. .............. 82...
rDNA Recombination Assay .........._._ ...._.._ .. .............. 82...
APPENDIX
A STRAIN: W303AR5+pJPAl l3 MEDIA: SD aHLW .................... .............. 84
B STRAIN: W303AR5+pJPAll6 MEDIA: SD aHLW.........._.._.. ........_.._........ 85
C STRAIN: W303AR5+pJPAl38 MEDIA: SD aHLW .........._.._.. ........_.._........ 86
D STRAIN: yAF6 MEDIA: SD aHLW .............. .................... 87
E STRAIN: W303AR5+pJPAl33 MEDIA: SD aHWu.............. .... .............. 88
F STRAIN: W303AR5+pJPAl36 MEDIA: SD aHWu.............. .................. 89
G STRAIN: W303AR5+pJPAl48 MEDIA: SD aHWu.............. ..................90
H STRAIN: yAF5 MEDIA: SD aHWu.............. ..............91...
I STRAIN: W303R5+pAF32 MEDIA: YPD.............. ...................92
J STRAIN: FOB1A+pAF32 MEDIA: YPD ....__ ......_____ ..... ......._.......93
K STRAIN: SIR2A+pAF32 MEDIA: YPD ........................... .......94
L PLASMIDS USED ............ _...... ._ ..............95....
M STRAINS USED ............ _...... ._ ..............96....
LIST OF REFERENCES.............. ...............99
BIOGRAPHICAL SKETCH ............_...... .__ ............._ 105...
LIST OF TABLES
Table pag
2-1. Plasmids used in this study. ................ ................. 13......... ..
2-2. Life span data summary.............. ................ 16
6-1. P-values of the SHU deletion life spans. .........._._...... .__ ....._._........6
L-1. The plasmids used throughout this dissertation.............. .............. 95
M-1. The strains used throughout this dissertation. ................ ......... ................ 96
LIST OF FIGURES
Finure pag
1-1. The pseudoERC strategy ............ ...... ._ ..............3...
1-2. The rDNA repeat. .........._...._ ..............4........_ .....
1-3. Fob 1 mediated expansion of the rDNA. .........._...._ .........._....5_....._.._..
1-4. ERC Formation ............ ..... ._ ..............6....
2-1. Life span analysis of plasmid-transformed yeast. ................ ................ ...._ 15
2-2. Plasmid inheritance studies ........._..... .............. 19.__.. .....
2-3. Extrachromosomal rDNA circle (ERC) formation in yeast transformants ............22
2-4. Plasmid DNA and extrachromosomal rDNA circle (ERC) levels in young and old
cell s ....... ..... ................. 24..............
2-5. Plasmid DNA and extrachromosomal rDNA circle (ERC) levels in young and old
cell s ....... ..... ................. 28..............
2-6. Terminal morphology of senescent cells.............. ................. 30
2-7. Life span analysis of yeast transformed with plasmids containing rDNA repeats.. 32
3-1. Southern blot analysis of pJPAll14 transformants ................ ................. ...._37
3-2. Life span analysis of cir+ and cir0 yeast ................ ..............39. .......... .
3-3. Two micron plasmid levels in young and old cells. ................ ... .............. .....40
4-1. Meclp, Rad53p, Smllp, and RNR pathway (94)............_._. .......___ ........._43
4-2. Life span of SM~L1 deletions ................. ......... ........ ...........4
4-3. Hydroxyurea sensitivity of young and old cells from 0 mM to 200 mM ............... 46
4-4. Hydroxyurea sensitivity of young and old cells from 0 mM to 50 mM. ................ 47
4-5. Southern of DSB in yAF6 (WT), W1488-4C (WT), smllA, meclAsml~A, and
rad53 Asml lA.. ................ ................. 49.............
4-6. Rad53p phosphorylation in young and old cells.............. ................ 50
4-7. Life span of W303R5 (WT), sir2A, and foblA during the CEN loss experiment...5 1
4-8. The age which WT, sir2A, and foblA lose plasmid.............. ................ 52
4-9. Mitotic stabilities of pAF3 1 and pAF32 ................ ................. 53...........
4-10. Mitotic stabilities of pJPAl33 and pJPAl36. ................ ......... ................ 54
4-11. Southern of showing plasmid competition phenomenon.. ................ ................. 55
4-12. Quantitation of plasmid competition Southern ....._____ .......___ ............. 56
5-1. The acetylation of histones and its affect on ERC production and life span............ 59
5-2. Life span of ACS deletions. ........._._. ....___......_. ..........6
5-3. Sorts of young and old ACS deletion strains. ....._._._ ..... ..__. .................62
6-1. Life span of ycalA. ........._._ ......._. ..............65...
6-2. SHU genes role in life span. .........._.__.....__ ......_ .........6
Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
BUILDING AN EPISOMAL MODEL OF AGING IN Saccharomyces cerevisiae
By
Alaric Antonio Falcon
May, 2004
Chair: John P. Aris
Major Department: Anatomy and Cell Biology
Aging in Saccharomyces cerevisiae is under the control of multiple pathways. The
production and accumulation of extrachromosomal rDNA circles (ERC s) is one pathway
that has been proposed to bring about aging in yeast. To test this proposal, we developed
a plasmid-based model system to study the role of DNA episomes in reduction of yeast
life span. Recombinant plasmids containing different replication origins, cis-acting
partitioning elements, and selectable marker genes were constructed and analyzed for
their effects on yeast replicative life span. Plasmids containing the ARS1 replication
origin reduce life span to the greatest extent of the plasmids analyzed. This reduction in
life span is partially suppressed by a CEN4 centromeric element on ARS1~ plasmids.
Plasmids containing a replication origin from the endogenous yeast 2 micron circle also
reduce life span, but to a lesser extent than ARS1 plasmids. Consistent with this, ARS1
and 2 micron origin plasmids accumulate in ~7-generation-old cells, but ARS1/CEN4
plasmids do not. Importantly, ARS1~ plasmids accumulate to higher levels in old cells
than 2 micron origin plasmids, suggesting a correlation between plasmid accumulation
and life span reduction. Reduction in life span is not an indirect effect of increased ERC
levels, nor the result of stochastic cessation of growth. The presence of a fully functional
9.1 kb rDNA repeat on plasmids is not required for, and does not augment, reduction in
life span. These findings support the view that accumulation of DNA episomes,
including ERC s, cause cell senescence in yeast.
The endogenous 2 micron circle is a naturally occurring episomal DNA. Loss of
the 2 micron circle can be facilitated with the transformation of an ARS containing
plasmid. Since 2 micron circles are episomes, and episomes can cause aging,
experiments were complete to show that it does not accumulate in old cells and does not
cause agmng.
In strains that contain more ERCs, ARS plasmids do not accumulate as much.
There is an episomal competition phenomenon. While it is not known what the episomes
are competing for, it can be demonstrated that as the number of different episomes
increase the rate of accumulation for each episome decreases.
CHAPTER 1
BACKGROUND AND SIGNIFICANCE
Saccharomyces cerevisiae is a single-ce Iled, budding yeast. During mitosis,
budding yeast divide asymmetrically. This is different from fission yeast where the two
cells produced by mitosis are indistinguishable. With budding yeast, the new smaller cell
(the daughter cell) emerges from the older, larger cell (the mother cell) (1-4). Because
the mother cell can be distinguished from its daughters, a mother can be followed
throughout all of its divisions. As mothers age, they become enlarged, their cell cycle
slows, and they become sterile (2,5). Daughters can be physically separated from their
mothers with a microdisection microscope. Physical separation is necessary, because it is
difficult to follow a mother cell through all of its divisions if it is obscured by daughter
cells and daughters of daughter cells. By removing the daughters from mothers, and
simultaneously tallying the number of divisions a mother completes, the cell's replicative
life span can be determined. The replicative life span is defined as the number of
divisions a mother cell completes (6). With the ability to conduct replicative life span
experiments and the ease of genetic manipulation, Saccharomyces cerevisiae is an
excellent model organism for aging studies.
Sir2p, rDNA, and Aging
Long and short lived aging mutants have been isolated in Saccharomyces
cerevisiae (7-10). One of the first such mutants identified was SIR4-42, a long lived
mutant that resulted in the localization of the SIR complex to the nucleolus (3,8). The
silent information regulator (SIR) complex is involved in the silencing of chromatin at
the telomeres, mating type loci, and rDNA (2,11,12). The rDNA serves as a nucleolar
organizing region in eukaryotic cells, and is the site of transcription of pre-rRNA (11). In
addition to the findings that implicated the rDNA in life span, the nucleolus was found to
be enlarged and fragmented in old yeast cells (2,3). This was consistent with the notion
that the rDNA played a role in life span determination. More recently, the silencing
protein Sirdp was found to be a nucleolar protein specifically involved in silencing at the
rDNA locus (3). Loss of function sir2 mutations reduce life span (3,12), whereas SIR2
overexpression extends life span (13). Sirdp is now known to function as a histone
deactylase that plays a central role in modulating chromatin structure (13,14). It has been
tied to the extension of life span in metazoan organisms (15), as well as being linked to
the caloric restriction model of aging (16).
Extrachromosomal rDNA Circles are Discovered
Based on SIR4-42 and other findings, Sinclair and Guarente in 1997 showed that
old mother cells accumulated extrachromosomal rDNA circles (ERCs). This was proven
by the use of 2D chloroquine gels and by Southern blots for rDNA. 2D chloroquine gels
are used to look for closed circular DNA molecules (17-19). Old cell undigested DNA
on 2D chloroquine gels showed rDNA episomes. The old cells had rDNA episomes and
young cells did not (20). To test the role of ERCs in yeast mother cell aging, replicative
life spans were conducted on cells that had been given pseudoERCs. PseudoERCs are
induced by using a plasmid with a partial rDNA repeat flanked by loxP sites and a
plasmid with Cre recombinase under the control of the galactose promoter. On adding
galactose, the galactose promoter allows the expression of Cre recombinase (21). Cre
recombinase then recombines the sequence between the loxP sites out of the plasmid
(22). This creates the pseudoERC, a partial rDNA repeat with a selectable marker and no
extraneous segregation or replication mechanisms (Figure 1-1). These pseudoERCs
cause an earlier onset of senescence (20). More specifically, the cell that had the
induction of pseudoERCs had a lower replicative life span (20). This suggested that
ERCs are a cause of aging, and are not produced as an effect of aging. This experiment is
the central proof of the ERC mediated aging model. The finding that ERCs could cause
aging was a completely novel aging mechanism.
producesDE Crep- rcmiaeC reomediatesrecobnto atr th lxPsie
resultingin the exision ofthe ASCNadteceaino suoR
Compoentsof th rDN
The ribosomal DNA (rDNA) is present on chromosome XII in a single linear array
of between 100 and 200 head-to-tail repeats (2,3,11,23). Each 9. 1 kb rDNA repeat is
responsible for producing the 5S and 35S pre-rRNA (Figure 1-2) (7,24) These RNAs
are later processed and packaged with proteins to form a ribosome (24,25). One half of
rDNA repeats are usually silent and not actively transcribing the rRNA (11,26). This
excess capacity is to ensure that the vital function of protein synthesis will not be
hindered by the lack of rRNA.
Figure 1-2.The rDNA repeat. 5S and 35S pre-rRNA are both transcribed in the rDNA.
The 35S is later processed into 18S, 5.8S, and 25S rRNA. Within the NTSs
are the RFB and ARS-rD (both have been shown to be essential for ERC
formation and replication, respectively).
Foblp and its Role in ERC Production
The protein Foblp is required for the replication fork block (RFB) in the
non-transcribed spacer 1 (NTS1) (23,27). It is implicated in the formation of ERCs (7).
The RFB blocks one of the replication forks within the replication bubble (23). This
makes replication unidirectional, in the direction of 35S pre-rRNA transcription (23).
The RFB has been observed in yeast, frog, mouse, human, and plant (28-32). The
ultimate function of the RFB site in yeast is to allow the cell to expand and contract the
number of repeats in the rDNA array by homologous recombination (23) (Figure 1-3).
Because recombination is initiated at a DNA double stranded break (DSB), a crossover
may occur within a sister chromatid by the formation of a Holliday structure (23).
Conversely, recombination can occur upstream, resulting in the loss of a repeat (23). An
apparently unintended consequence of RFB function is the increased production of ERCs
(Figure 1-4) (7). Holliday structures within the rDNA occur 3.6 times per cell cycle (33),
indicating rampant recombination at the locus. In FOB1 deleted strains, there is reduced
recombination at the rDNA locus, because there is no RFB at the RFB site (34). This
Figure 1-3.Fob1 mediated expansion of the rDNA. (A) FoblIp acts at each RFB site in
rDNA. (B) Replication begins at ARS-rD and two replication forks travel in
opposite directions. (C) The replication fork traveling in the opposite
direction of 35S transcription is stopped at RFB site. The other replication
fork continues. A double stranded break can occur at the RFB site. (D) A
Holliday structure forms and homologous recombination with the sister
chromatid can repair the break. (E) The closest replication bubble catches up
to the recombination site creating two separate strands of DNA, one of which
has an additional repeat.
~s-~ ~-r
I~
-I1~L
__ __ __ __ _~ _~ _
-~L ~68r
reflects foblA' s reduced formation of ERCs and longer life span (7). This further
implicates ERCs in the aging process.
----
-r-~--~
C ~._~-gL~e. rqs8, ~L ~dL~
~
J~k~
~91P
~'118
~~B
A B3
O, O
Figure 1-4.ERC Formation (A) An ERC can be formed by homologous recombination
and the looping out a circular DNA. (B) They can also be formed by
recombination of the free end of DNA, the product of FoblIp RFB (27).
ARS of the rDNA
Within every rDNA repeat, there is an autonomously replicating sequence (ARS)
or origin of replication (3 5,36). ARSs are AT rich sequences of DNA, to which the
origin recognition complex (ORC) binds (37,38). The ORC complex of proteins is
essential for the initiation of DNA replication (37,3 8). The ARS-rD's (rDNA' s ARS)
biological function is as a site for the initiation of DNA replication within the rDNA
repeat. It is necessary because the repeat locus consists of one to two hundred
head-to-tail 9.1 kb repeats (approximately 1,500 kb in length) (39). Normally, ARSs are
spaced approximately 40 kb apart throughout the yeast genome (37,39,40). By putting an
ARS in every repeat, replication of the genome through this lengthy region can occur
more efficiently than with an ARS at either end of the locus (39). The ARS will also
allow episomal rDNA, such as ERCs, to replicate (20,35). The ARS-rD is considered a
"weak" ARS. That is, any given ARS-rD fires less than once per cell cycle (35,36,39).
Because ARS-rD occurs once in every repeat, every third ARS can fire and still replicate
the locus effectively. The distance between firing ARSs is approximately 30 kb. The
activity of the ARS-rD has been linked to transcriptionally active 3 5S genes (which were
in turn linked to nonsilent euchromatic regions of the locus) (41,42).
Asymmetric Inheritance of ERCs
A phenomenon associated with ERCs is their asymmetric segregation. There is a
natural tendency for the ERCs and ARS plasmids to stay within the mother cell during
cell division (2,3,43). This was demonstrated by pedigree analysis, a technique that
follows the segregation of a non-Mendelian trait through mitosis (20). Mother cells have
a bias to retain the plasmids and not pass them on to their daughters (43). Although this
phenomenon was discovered in 1983, little is known about the mechanism that retains the
plasmids in the mother cells. With ERCs being excised from the genome, replicated by
their endogenous ARS, and segregated preferentially to the mother; there is a massive
accumulation of the episomes in older cells. This is the model of ERC mediated aging
(20). Although the amount of ERCs in very old cells is not known, the number estimated
to be in cells after 15 generations is 500 to 1000 ERCs (20). This accumulation is
thought to be behind the mechanism of ERC mediated aging (20).
Summary
A maj or tenet of the ERC mediated model for replicative aging in Saccharomyces
cerevisiae is that ERCs are nothing more than episomal DNA molecules with an ARS
(20). Evidence for this comes from the observation that a yeast shuttle vector, containing
only an ARS, reduced replicative life span (compared to a control plasmid containing an
ARS and a centromeric (CEN) element) (20). CEN plasmids are maintained at low copy
number and segregate with high fidelity to daughter cells just like chromosomes (44).
ARS plasmids attain a high copy number and show a bias toward retention in mother
cells during mitosis (similar to ERCs) (43). The fact that the ARS plasmid can shorten
yeast mother cell life span suggests that the rDNA sequence per se does not contribute to
ERC mediated aging, and that potentially any extrachromosomal DNA able to replicate
may reduce life span (20).
CHAPTER 2
DEFINING THE LINK BETWEEN EPISOMES AND AGING
The yeast Saccharomyces cerevisiae has proved to be a valuable model organism
for investigating mechanisms of cellular aging (45-47). Central to the biology of aging in
S. cerevisiae is an asymmetric cell division process that gives rise to mother and daughter
cells with different characteristics. Mother cells have a limited capacity to produce
daughter cells, and the decline in this capacity with each generation is referred to as
replicative aging. The limited replicative potential of yeast mother cells has been
recognized since the 1950s (48). Pioneering studies in the Jazwinski and Guarente
laboratories postulated the existence of a senescence factor/substance that accumulates in
mother cells and is transmissible to daughters (49,50). Work in the Guarente lab
identified a heritable "age" locus that regulates yeast life span (51). More recent studies
have made clear that allelic variation at single genetic loci can markedly affect yeast life
span, including extension of life span. This indicates that a process as complex as
cellular aging is controlled by a hierarchical regulatory system. Like in other model
organisms, such as D. melan2oga~ster and C. elegan2s, mutations that influence yeast life
span have been found to exert their effects through different physiological and genetic
pathways, including those that participate in caloric restriction, gene silencing, genomic
stability, growth regulation, mitochondrial function, and stress response (45-47,52,53).
Replicative aging is undoubtedly a complex process, even in a eukaryote as
simple as S. cerevisiae. Different hypotheses have been proposed to explain yeast
replicative aging. One hypothesis proposed by Sinclair and Guarente (54) posits that
replicative aging is caused by progressive accumulation of extrachromosomal rDNA
circles (ERC s) in yeast mother cells. According to this model, ERC s are produced
stochastically by intrachromosomal homologous recombination at the rDNA locus and
are inherited asymmetrically by mother cells, which leads to ERC accumulation and
replicative senescence. The rDNA locus in S. cerevisiae consists of a tandem array of
~150, 9.1 kb direct repeats, each of which encodes the four rRNAs (18S, 5.8S, 25S, and
5S) in precursor form. Many aspects of the ERC model have been supported
experimentally. Numerous studies support the view that ERC s are produced by
homologous recombination, are self-replicating, are inherited asymmetrically, and
accumulate in mother cells (45,54,55).
More controversial is the role ERC s play in the aging process. Are ERC s
"mediators" or "markers" of yeast aging? Certain findings link ERC production with
regulation of life span and support a "mediator" role for ERC s. One of the first life span
extending mutations characterized in yeast (SIR4-42) was found to redirect "silent
information regulator" (Sir) protein complexes to the rDNA locus and limit
recombination (5 1,56). Expression of SIR2, which encodes a nucleolar NAD-dependent
histone deacetylase, correlates with longevity. Sirdp binds to rDNA and suppresses
rDNA recombination and ERC production (57-59). Deletion of SIR2 shortens life span,
whereas overexpression of SIR2 extends life span (60). FOB1 encodes a nucleolar "fork
blocking" protein that binds to the replication fork barrier (RFB) site in rDNA and in so
doing halts DNA replication in the direction opposite of pre-3 5S rRNA transcription (61-
63). The RFB site and the overlapping HOT1 site promote rDNA recombination (63,64).
Mutations in (or deletion of) FOB1 reduce rDNA recombination, lower ERC levels, and
extend life span (65). Recombination of replication forks stalled at RFB sites is
suppressed by Sirdp (66), which partly explains the role of Sir2-dependent silencing in
extending life span. Also, introduction of a plasmid carrying a stretch of rDNA, as an
"artificial" ERC, was shown to reduce life span (54).
On the other hand, ERC s have been interpreted as a "marker" of aging that are a
consequence, not a cause, of aging. Mutations that impair DNA replication,
recombination, or repair have been observed to reduce life span without concomitant
accumulation of ERC s (67-69). However, reduction in life span may be the result of the
combined effects of age-dependent and age-independent processes at work in certain
mutants. The hrmlA mutants, which affect rDNA recombination, age prematurely due to
a combination of the normal aging process and a G2-like cell cycle arrest (69). Similarly,
sgs1 mutants exhibit a shortened life span because of the combined effects of the normal
aging process and cell cycle arrest due to defective recombination (70). Some petite
mutants have been shown to have elevated ERC levels (71), but extended life spans (72).
However, to our knowledge, both elevated ERC levels and extended life span in petite
mutants have not been demonstrated side-by-side in the same strain. A sir2 mutant with
an extended life span was reported to have normal ERC levels (73). More generally, the
effects of SIR2 on life span have been attributed to altered patterns of gene expression,
including altered transcription of rDNA, which may lead to an imbalance in ribosome
synthesis (74,75). Thus, although there is agreement that the rDNA locus plays a key
role in the yeast aging process, the precise role of extrachromosomal DNAs remains
controversial.
To shed light on this controversy, we have developed a plasmid-based model
system to investigate the role of episomal DNAs in reduction of yeast life span. Here we
present the first comprehensive test of the ERC model of yeast aging proposed by
Sinclair and Guarente (54). We constructed three types of recombinant plasmid for this
purpose: ARS plasmids, ARS/CEN plasmids, and 2 CI origin plasmids. ARS plasmids
are most like ERC s in that they are circular DNA molecules with a replication origin but
lack a cis-acting partitioning sequence. Classic pedigree analysis studies by Murray and
Szostak showed that ARS plasmids exhibit a strong bias to be retained in mother cells
during mitosis (43). Thus, ARS plasmids are predicted to accumulate in mother cells like
ERC s, but this has not yet been demonstrated. ARS/CEN plasmids contain a
centromeric DNA region that acts in cis to attach plasmid DNA to the mitotic spindle and
ensure efficient delivery to daughter cells during mitosis. ARS/CEN plasmids should not
accumulate in mother cells. 2 CI origin plasmids typically contain a DNA replication
origin, a cis-acting REP3 STB element, and one copy of an inverted repeat that regulates
plasmid copy number (~20 to 40 copies/cell) (76). The REP3 STB element actively
partitions plasmid DNA to daughter cells during mitosis in cil- yeast strains (i.e., in
strains that contain the endogenous 2 CI circle DNA plasmid that encodes proteins that
interact in transrt~t~rt~t~rt~t~rt~ with REP3 STB) (76). 2 CI origin plasmids are not predicted to
accumulate in mother cells, although the 2 CI plasmid partitioning machinery is not
predicted to exhibit the fidelity of a centromere-based partitioning machinery. We also
constructed a series of plasmids containing functional rDNA repeat units, and tested their
effects on life span. This represents a significant improvement over a previously reported
experiment (54), which employed a non-functional stretch of rDNA (i.e., rDNA
incapable of being transcribed to yield full-length 35S pre-rRNA).
Roles of Different Cis-Acting Plasmid Sequences in Reduction of Yeast Replicative
Life Span
To study the effects of plasmids on yeast replicative life span, we generated two
series of plasmids based on commonly-used integrating vectors-pRS306 and pRS305
(77). In each plasmid, we inserted ARS1, or ARS1~ and CEN4, or the 2 CI circle origin (see
Materials and Methods). ARS1~ (autonomous replicating sequence 1) is a nuclear
genomic DNA replication origin whose function and domain organization have been
studied in detail (78). Centromeric DNA from chromosome IV (CEN4) has been mapped
and functionally dissected (79). The region of the 2 CI circle plasmid extending from
Table 2-1. Plasmids used in this study.
Plasmid Origin, Insert Marker Backbone
pJPA105 2 CI, rDNA repeat (Xmal endpoints) 7RP1 pAFl15
pJPA106 2 CI, rDNA repeat (Ahdl endpoints) 7RP1 pAFl15
pJPA107 2 CI, rDNA repeat (Psil endpoints) 7RP1 pAFl15
pJPAll3 ARS1~ GRA3 pRS306 (77)
pJPAll4 rDNA ARS GRA3 pRS306
pJPAll6 ARS1~, CEN4 GRA3 pRS306
pJPAll7 rDNA ARS, CEN4 GRA3 pRS306
pJPAl38 2 CI GRA3 pRS306
pJPAl33 ARS1~ LEU2 pRS305 (77)
pJPAl36 ARS1~, CEN4 LEU2 pRS305
pJPAl48 2 CI LEU2 pRS305
REP3 through the adj acent 599 bp 2 CI repeat functions as a replication origin as well as a
cis-acting plasmid partitioning element (76,80). The plasmids used in this study are
summarized in Table 2-1.
To evaluate effects on life span, plasmids were transformed into strain W303AR5
(54). For each plasmid, six independently-isolated transformants were analyzed in
parallel, and each life span curve reflects their collective behavior. Selection for the
plasmid was maintained during life span analysis. Virgin mother cells unable to give rise
to 5 daughters were discarded to exclude contributions from mother cells without
plasmid. To identify mother cells that stopped dividing due to plasmid loss, rather than
senescence, cells that had not divided in 2 days were transferred to nonselective medium
and monitored for cell division and colony formation. A low percentage (<10%) of
mother cells were found to give rise to colonies, and were excluded from the life span
data set. Life span plates were incubated during the daytime at 300C, but placed
overnight (~12 hours) at 140C, which gave a slightly, but significantly (p<0.01) longer
life span than observed on plates stored overnight at 40C (Figure 2-1A).
Interestingly, transformants harboring pJPAll3 (ARS1) showed dramatic reductions in
both average and maximum life span compared to the Ura+ control strain yAF6 (Figure
2-1B). yAF6 differs from pJPAll13 transformants only in terms of plasmid DNA
topology (i.e., integrated in yAF6 and episomal in transformants). Transformants
containing pJPAll6 (ARS1~, CEN4) have a reduced average life span compared to yAF6,
but exhibit a maximum life span similar to yAF6 (Figure 2-1B). Thus, addition of a
CEN4 element to an ARS1~ plasmid suppresses reduction in maximum life span, but does
not completely compensate for, or protect against, effects on average life span. Plasmids
containing the 2 CI circle origin of replication were also constructed and analyzed. Yeast
cells harboring pJPAl38 (2 CI ori) show a reduction in both average and maximum life
span (Figure 2-1B). Generally speaking, the extent of reduction in average and
maximum life span in pJPAl38 (2 CI ori) transformants is intermediate between that
Figure 2-1.Life span analysis of plasmid-transformed yeast. Number of daughter cells
(generations) produced per mother cell are plotted as a function of mother cell
viability. A) Life span curves of strain W303AR5 (54) grown on SD
(synthetic dextrose) and S+D (dextrose added after autoclaving) media at
300C during the daytime and stored overnight (~12 hours) at 40C or 140C.
The number (n) of mother cells analyzed per curve is as follows: SD 40C,
n=60; SD 140C, n=59; S+D 140C, n=60. B) Life span curves of W303AR5
transformed with plasmids pJPAll3 (ARS1~), pJPAll6 (ARS1~, CEN4), or
pJPAl38 (2 CI ori), and control strain yAF6 (URA3) (n=55, 47, 57, and 58,
respectively). C) Life span curves of W303AR5 transformed with plasmids
pJPAl33 (ARS1), pJPAl36 (ARS1, CEN4), pJPAl48 (2 CI ori), and control
strain yAF5 (LEU2) (n=38, 33, 41, and 59, respectively). D) Life span curves
of W303AR5 transformed with pJPAll16 (ARS1~, CEN4) determined on SD
and YPD (n=45 and 49, respectively). Life spans of control strains yAF6 and
W303AR5 were determined on YPD (n=50 and 55, respectively). Plasmids
are described in Table 2-1.
observed in pJPAll3 (ARS1) and pJPAll6 (ARS1~, CEN4) transformants (Figure 2-1B).
The results from multiple life span experiments are summarized in Table 2-2.
Table 2-2. Life span data summary.
Plasmid/Strain Mean Life Span Maximum Life Span n*"
pJPAll3 12.4 & 1.8 21.8 & 2.2 4
pJPAll6 23 A 1.4 39 & 2.7 4
pJPAl38 16.3 A 1.8 31.3 & 0.6 3
yAF6 33.2 & 3.0 42 & 1 3
The results reported above were obtained with plasmids carrying a GRA3 selectable
marker. To eliminate the possibility that effects of plasmids on life span were due to
GRA3 or medium lacking uracil, we constructed plasmids with a LEU2 selectable marker
(Table 2-1), and conducted life span experiments on medium lacking leucine. The results
obtained with the LEU2 plasmid series were very similar to results obtained with the
GRA3 plasmid series (Figure 2-1C). pJPAl33 (ARS1~) caused dramatic reductions in
average (9.9 generations) and maximum (17 generations) life spans compared to the Leu+
control strain yAF5. yAF5 yielded an average (30.3 generations) and a maximum (44
generations) life span very similar to the average and maximum lifespan for yAF6 (Table
2-2). Transformants containing pJPAl36 (ARS1~, CEN4) yielded a maximum life span of
38 generations, but an average life span of 24 generations, similar to what was observed
for the GRA3 plasmid pJPAll6 (ARS1, CEN4). Plasmid pJPAl48 (2 CI ori) reduced the
average (15.5 generations) and maximum (31 generations) life span to an extent
intermediate between pJPAl33 (ARS1~) and pJPAl36 (ARS1, CEN4) (Figure 2-1C),
similar to what was observed with the GRA3 plasmid pJPAl38 (2 CI ori) (Figure 2-1B).
The reduction in average life span by ARS1, CEN4 plasmids pJPAll6 and
pJPAl36 was unexpected. A similar plasmid had previously been reported to have no
effect on life span when grown on YPD medium (54). One possible explanation for this
difference was that ARS1, CEN4 plasmids are occasionally lost from mother cells,
causing them to cease division on selective medium prior to senescence, which would
result in a reduction in average life span. To test this, ARS1, CEN4 plasmid
transformants were analyzed on non-selective YPD medium as done previously (54). On
YPD, transformants carrying pJPAll6 (ARS1~, CEN4) were as long-lived as control
strains yAF6 (URA3) and W303AR5 (Figure 2-1D). pJPAll6 transformants analyzed in
parallel on selective SD medium showed a reduction in average life span (Figure 2-1D),
as expected. These findings support the interpretation that ARS1~, CEN4 plasmids, which
are present at near-unit copy number in transformants (see below), are occasionally lost
from mother cells, rendering them unable to divide at a point in their life span prior to
normal senescence.
We have also examined the effects of two well-known plasmids that carry the
7RP1 selectable marker. pTV3 carries the 2 CI origin whereas pRS314 carries ARSH14
and CEN6 (77,80). Life spans of transformants containing each plasmid were analyzed
on medium lacking tryptophan. pTV3 transformants had an average life span of 18.7 and
a maximum life span of 32, both values of which are in good agreement with
corresponding values for the 2 CI origin plasmids pJPAl38 and pJPAl48 (Figure 2-1 and
Table 2-2). pRS3 14 had average and maximum life spans of 21 and 41, respectively,
which are in good agreement with values obtained with the ARS1~/CEN4 plasmids
pJPAll6 and pJPAl36 (Figure 2-1 and Table 2-2). These data allow us to exclude a
specific role for ARS1~ and CEN4 in life span reductions presented above (Figure 2-1).
Plasmid Inheritance Correlates with Reduction in Yeast Life Span
The plasmids used in this study were constructed to explore relationships between
plasmid inheritance and effects on life span. Mitotic stability and plasmid copy number
are widely-used measures of plasmid DNA inheritance. Mitotic stability is defined as the
proportion of a population of cells grown under selection that contains plasmid. We
determined the mitotic stability and plasmid copy number of the plasmids used in life
span experiments. Included in our studies were plasmids containing the rDNA ARS.
rDNA repeats contain a single, relatively weak ARS (81). pJPAll4 and pJPAll7
contain the rDNA ARS at the same position as ARS1 in pJPAll3 and pJPAll6,
respectively (see Table 2-1 and Materials and Methods).
Plasmid pJPAll3 (ARS1~) was found to have a mitotic stability of approximately
20% (Figure 2-2A), which is typical of yeast replicating plasmids containing ARS1,
which exhibit a mother cell partitioning bias (43). pJPAll6 (ARS1~, CEN4) exhibited a
much higher mitotic stability, ~90%, which is consistent with the presence of CEN4
centromeric DNA, and agrees with the mitotic stability of pRS316 (ARSH4, CEN6)
(Figure 2-2A). pJPAl38 (2 CI ori) showed a high degree of mitotic stability, ~90%
(Figure 2-2A). The 2 CI origin plasmid pRS424 had a somewhat lower mitotic stability
by comparison (Figure 2-2A). pJPAll4 (rDNA ARS) has a very low mitotic stability,
<1% (Figure 2-2A). The presence of CEN4 with the rDNA ARS in pJPAll17 improves
mitotic stability to ~3 5% (Figure 2-2A). These results with pJPAl l4 and pJPAl l7 are
consistent with the low efficiency of the rDNA ARS (81). Not surprisingly, it was
impractical for us to carry out life span analyses of transformants containing pJPAll14.
Figure 2-2.Plasmid inheritance studies. Plasmids are denoted by cis-acting elementss.
See Table 1 for plasmid descriptions. pRS316 (ARSH4, CEN6, (77)) and
pRS424 (2 CI ori, 7RPl, (82)) are included for comparison purposes. A)
Mitotic stability determinations. Mitotic stability is defined as the percentage
of colony forming units in a culture grown under selective conditions that
contains plasmid-borne selectable marker. Side-by-side bars are
determinations from separate experiments. Average and standard deviation
values are plotted. B) Plasmid copy number in toto for cell population.
Average and standard deviation values from Southern blots of genomic DNA
digested with BamHI (filled bars) and PstI (open bars) are shown. C) Plasmid
copy number on a per cell basis. Values were calculated by dividing copy
number values from panel B by mitotic stability values from panel A (average
of both experiments). The variances in copy number values were determined,
assuming a log normal distribution of values. Variances for all values were
near 1.0, with the exception of rDNA ARS plasmid copy number, which had a
variance of 3.0, which is indicative of a higher level of error in this
measurement.
Plasmid copy number was determined using Southern blot analysis. Copy number
was displayed either as the total number of plasmids compared to the total number of
genomes (copy number in the population, Figure 2-2B) or the total number of plasmid
compared to the fraction cells (genomes) that contain a copy of the plasmid (copy number
per cell, Figure 2-2C) by using a plasmids mitotic stability. Copy number determinations
using two different restriction enzymes gave comparable results (Figure 2-2B). pJPAll3
(ARS1) exhibited the highest plasmid copy number (Figure 2-2C). Plasmids pJPAll6
(ARS1, CEN4) and pJPAll7 (rDNA ARS, CEN4) exhibited near-unit copy number
values (Figure 2-2C), which is typical of centromeric plasmids (79), such as pRS316
(ARSH4, CEN6) (77). pJPAl38 (2 CI ori) exhibited a copy number of ~33 (Figure 2-2C),
which is in the range of copy number values reported for other 2 CI origin plasmid vectors
(80). The high copy number of pJPAll13 is primarily due to the asymmetric inheritance
of this plasmid and its accumulation in mother cells, rather than ARS strength per se. We
reach this conclusion because pJPAll4, which contains a weak (rDNA ARS) replication
origin, achieves a copy number almost as great as pJPAll3, which contains a strong
(ARS1) replication origin (Figure 2-2C). Thus, pJPAll3 demonstrates a correlation
between extent of reduction of transformant life span (Figure 2-1B) and tendency to be
inherited asymmetrically and attain a high copy in yeast cells (Figure 2-2C).
Plasmids Do Not Significantly Increase ERC Levels
The results presented above suggest that reduction in life span by the ARS1~ plasmid
pJPAll3 is due to asymmetric inheritance and accumulation in mother cells. An
alternative explanation is that pJPAll3 increases ERC levels in transformed cells, and
thereby reduces life span indirectly. To address this possibility, we measured
recombination at the rDNA locus using an ADE2 marker loss assay and measured ERC
levels in transformed cells by Southern blotting.
To analyze the frequency of recombination at the rDNA locus, we took advantage
of the fact that W3 03AR5 contains ADE2 integrated at the rDNA locus (54).
Recombination between flanking rDNA repeats results in loss ofADE2 and a change in
colony color. The frequency of half-red sectored colonies is a measure of rDNA
recombination rate (events per cell division). Transformation of yeast with plasmid
results in a small increase in rDNA recombination as measured by ADE2 marker loss.
For W303AR5, we find that ADE2 marker loss occurs at a frequency of ~1.3 per
thousand cell doublings (Figure 2--3A), which is in good agreement with frequencies
reported by others (60,68,69). The rate ofADE2 marker loss from yAF6 (URA3) occurs
at ~2.7 per thousand (Figure 2-3A). Transformants containing the three plasmids used in
this study, pJPAll3 (ARS1), pJPAll6 (ARS1, CEN4), and pJPAl38 (2 CI ori), exhibited
marker loss rates of 4.1i, 4.5, and 4. 1 per thousand cell doublings, respectively. The
differences between transformants and yAF6 represent increases of less than 2-fold.
Higher levels ofADE2 marker loss are typically observed in strains with reduced life
spans. For example, short-lived sir2A mutants exhibit ADE2 marker loss rates >10-fold
higher than isogenic SIR2 strains (60).
To directly compare ERC levels, yeast transformants and control strains were
analyzed by Southern blotting, and ERC monomer bands were quantitated (see Materials
and Methods). ERC monomers consist of a single 9. 1 kb rDNA repeat and were chosen
for purposes of quantitation because they are well-resolved from chromosomal rDNA and
other ERC bands on Southern blots. ERC monomer levels in transformants were not
significantly different than ERC monomer levels in control strains. Control strains
W303AR5 and yAF6 (URA3) have approximately 0.0007 and 0.0015 ERC monomers
per total chromosomal rDNA, respectively (Figure 2-3B). Transformants bearing
pJPAll3 (ARS1), pJPAll6 (ARS1, CEN4), and pJPAl38 (2 CI ori) have ERC monomers
levels of 0.0014, 0.001, and 0.001, respectively (Figure 2-3B). These values are within
the error of measurements and are not significantly different (Figure 2-3). For
comparison, we examined yAF5 (LEU2), which contains a copy of pRS305 integrated at
the leu2-113 locus, and found that the ERC monomer level was 0.001, which is
intermediate between W303AR5 and yAF6 (Figure 2-3B). Quantitation of slower-
migrating ERC multimer bands did not reveal significant differences in levels between
transformant and control strains (data not shown). We conclude that plasmids do not
have a significant effect on ERC levels.
Figure 2-3. Extrachromosomal rDNA circle (ERC) formation in yeast transformants.
Plasmids are denoted by cis-acting elementss. See Table 2-1 for plasmid
descriptions. Control strains W303AR5 (W303), yAF5 (LEU2), and yAF6
(URA3) did not contain plasmid. A) ADE2 marker loss assay. The number of
half-red sectored colonies on minimal selective medium per total colony
number defines the per (first) cell division rate of loss of the ADE2 marker
from the rDNA repeat in W303AR5. Total number (n) of colonies scored is
shown. B) ERC monomer levels. Southern blotting analyses of DNA from
transformed and control strains grown on selective media were done to
quantify chromosomal rDNA and ERC monomer band levels (see Materials
and Methods). ERC monomer band intensity was divided by chromosomal
rDNA band intensity to give a normalized ERC monomer/chromosomal
rDNA ratio. Average and standard deviation values are plotted.
Plasmid Accumulation Correlates with Reduction in Life Span
If plasmids reduce life span in a manner analogous to ERC s, then plasmid DNAs
should accumulate in old mother cells. To test this prediction, we used a biotinylation
and magnetic sorting approach to isolate ~?-generation old yeast cells (see Materials and
Methods). Plasmid DNA levels in young and old cells were measured by quantitative
Southern blotting.
The ages of old and young (unsorted) cells were determined by counting bud
scars stained with Calcofluor (83). From single sort experiments, the average ages of
yeast transformed with pJPAll3, pJPAll6, pJPAl38, and yAF6 were 6.9, 7.0, 6. 1, and
6.2 generations, respectively (Figure 2-4A). Young cells from the same cultures were an
average of 1.5, 1.4, 1.1, and 1.1 generations old, respectively (Figure 2-4A). Inspection
of the Southern blot clearly reveals increases in relative amounts of pJPAll13 (ARS1) and
pJPAl38 (2 CI ori) in old cells (Figure 2-4B). pJPAll6 (ARS1~, CEN4) did not
accumulate in old cells, and yields bands similar in their intensities to corresponding
bands from yAF6 (Figure 2-4B). In a striking illustration of the accumulation of
pJPAll3 and pJPAl38 in old cells, the linearized plasmid DNA bands can be observed
by ethidium bromide staining (Figure 2-4D). ERC levels in young and old cells were
also analyzed by Southern blotting. Hybridization to rDNA probe revealed ERC bands
and a broad band corresponding to the rDNA locus on chromosome XII (Figure 2-4C).
We note that all old cell preparations contained increased numbers of both monomeric
and slower-migrating ERC species (Figure 2-4C). The ERC and rDNA repeat bands
collapse to a single 9.1 kb band following digestion with KpnI, which cuts rDNA once
(data not shown).
Chromosomal and plasmid band intensities were quantitated using a
PhosphorImager. Consistent with our determinations in Figure 2-2, pJPAll3 (ARS1) and
pJPAl38 (2 CI ori) are present at high copy number in young cells, but pJPAll6 (ARS1,
CEN4) is not (Figure 2-4E). In ~?-generation old transformants, the plasmid copy
numbers for pJPAll3 and pJPAl3 8 are dramatically increased, reaching values of 254
and 137, respectively (Figure 2-4F). This represents a difference in copy number
between young and old cells of ~13-fold for pJPAll3 and~-6-fold for pJPAl38. By
Figure 2-4.Plasmid DNA and extrachromosomal rDNA circle (ERC) levels in young and
old cells. Panel A conveys the cis-acting elements present in each plasmid
(see also Table 2-1). Plasmids are abbreviated by numbers in panels B-H. All
plasmids carry UR3. Control strain yAF6 (UR3) did not contain plasmid.
Old cells were harvested using a biotinylation and magnetic sorting approach
(see Materials and Methods). A) Age profile histograms of young and old
cells. Number of cells is plotted as a function of number of bud scars (n>40
for each histogram). B) Southern blot of plasmid DNAs. Pstl-digested
genomic DNA yields a 3.67 kb UR3 band. Other bands are plasmid-derived.
Genomic UR3 DNA in lane "Old 113" migrated as two bands due to partial
over-digestion of this sample. C) Southern blot of ERCs. D) Ethidium
bromide stained agarose gel corresponding to the blot in panels B and C.
DNA marker sizes (in kb) are shown. E and F. Plasmid levels in young and
old cells (quantitation of data presented in panel B). G and H) ERC
monomer levels in young and old cells (quantitation of data presented in panel
C). For E-H, ratios of episome plasmidd or ERC monomer) band intensity
divided by chromosomal rDNA band intensity (X1000) are plotted (on a semi
log scale). See Fig. 2-1B for corresponding life span data. Comparable
results were obtained from similar cell sorting and Southern blotting
experiments and are discussed in the Results section.
comparison, 7-generation old pJPAll6 transformants show no significant increase in
plasmid copy number (Figure 2-4F).
In a separate experiment with pJPAll3 and pJPAll6 transformants, in which
genomic DNA was digested with BamHI instead of Pstl, quantitative analysis revealed
that young cells contained 27 and 1.5 plasmids/cell, respectively, whereas old cells
contained 283 and 1.2 plasmids/cell, respectively (data not shown). This corresponds to a
~10-fold increase in plasmid copy number for pJPAll3 in~?7-generation old cells, and no
significant increase in pJPAll6 copy number, which agrees with findings presented in
Figure 2-4E, F.
ERC monomer levels were also quantitated in young and ~?-generation old
transformants and yAF6. ERC monomer levels in young cells were equal or close to
0.001 (Figure 2-4G), which agrees with measurements presented above (Figure 2-3B). In
old cells, however, ERC monomer levels were appreciably higher, and exhibited
increases between ~20-fold to~-70-fold (Figure 2-4H). The levels of ERC s we observe
in ~?-generation old cells appears comparable to ERC levels in sorted cells of similar
age reported by others (e.g., (54,60)), although quantitative analysis of ERC levels in
young and old yeast cells is not commonly reported in the literature.
In the experiment shown in Figure 2-4, ERC monomer levels in yAF6 (URA3) are
higher than in transformants (Figure 2-4H). This raises the question: does the presence
of plasmid reduce ERC levels? In a separate experiment, ERC monomer levels in
young cells were equal or close to 0.001 (ERC monomer/chromosomal rDNA) and ERC
monomer levels in old transformants containing pJPAll3, pJPAll6, and pJPAl38 and in
old yAF6 cells were determined to be 0.083, 0.075, 0.045, and 0.081, respectively (data
not shown). The similar ERC levels in yAF6 and transformants in this experiment
suggest that plasmid vectors do not appreciably affect ERC monomer levels (Figure 2-5).
Does the extent of ERC accumulation in old cells in Fig. 4 agree with predictions
based on our estimates of rates of recombination within the rDNA locus (see above,
Figure 2-3)? If we assume that extrachromosomal rDNA repeats are generated at a rate
of 0.5 per cell per generation, and that ERC s are retained in mother cells, then 6-7
generations should yield an increase of between 32- to 64-fold, which is similar to the
observed range of increase from 20- to 70-fold (Figure 2-4G, H).
We have also quantitated the relative amount of all ERC s (i.e., monomers,
multimers, and concatemers) found in old transformants containing pJPAll3, pJPAll6,
and pJPAl38 and in old yAF6 cells. We found levels, respectively, of 0. 140, 0. 136,
0.086, and 0.238 (extrachromosomal rDNA/chromosomal rDNA; data not shown). These
values mirror levels of accumulation of ERC monomers presented in Figure 2-4H. Thus,
ERC monomers comprise approximately 1/4 to 1/3 of all extrachromosomal rDNA
repeats and are present at similar levels relative to all ERC s in old transformed and
untransformed cells.
To extend these studies, yeast sorting experiments were done with transformants
containing the LEU2 plasmids pJPAl33 (ARS1~), pJPl36 (ARS1, CEN4), and pJPAl48 (2
CI ori), and with the LEU2 strain yAF5. The average ages of sorted yeast transformed
with pJPAl33, pJPAl36, pJPAl48, and yAF5 are 7.1, 7.0, 7.6, and 7.9 generations,
respectively (Figure 2-5A). Young cells from the same cultures were an average of 1.7,
1.0, 1.6, and 1.6 generations, respectively (Figure 2-5A). pJPAl33 and pJPAl48 attain
copy number levels of 119 and 39, respectively, in ~?-generation old cells (Figure 2-5C).
This represents an increase in copy number between young and old cells of ~30- and ~8-
fold for pJPAl33 and pJPAl48, respectively. pJPAl36 did not show a significant
increase in old cells (Figure 2-5C). In comparison to pJPAll3 and pJPAl38, pJPAl33
and pJPAl48 reached lower absolute levels of plasmid in ~?-generation old cells.
However, pJPAl33 and pJPAl48 accumulated to similar extents in terms of fold-
increase. To resolve if this difference in absolute levels of plasmids in old cells was due
to experimental error, sorting experiments with transformants and the control strain were
repeated, followed by Southern analyses. The repeat experiment gave results very similar
to first experiment, both in terms of absolute level of plasmid in young and old cells as
well as fold-increase in young and old cells (Figure 2-5B, C). This indicates that
plasmids with identical ARS1~ origins and CEN4 elements, but with different backbones
and selectable markers, are maintained at different absolute copy number levels in young
and old cells. Nevertheless, similar fold-differences in plasmid levels are observed
between young and ~?-generation old cells. This indicates that ASR1 and CEN4 elements
present on plasmids functionally determine patterns of plasmid inheritance and
accumulation during yeast mother cell replication.
Next, ERC monomer levels in transformants containing pJPAl33, pJPAl36, and
pJPAl48, and in strain yAF5 were quantitated. In young cells, ERC monomers were
detected at relatively high levels (Figure 2-5C). However, ERC monomer levels in ~7
generation old cells were similar to levels observed above for pJPAll3, pJPAll6, and
pJPAl38 transformants (compare Figures 2-4H and 2-5D). Thus, ERCs in the Leu+
transformants showed accumulation over a range of ~3-fold to ~12 fold between young
and old transformants. This range of fold-increase is approximately 7-fold lower than the
~20-fold to ~70-fold increase in ERC levels between young and old Ura+ transformants.
This suggests that the rate of ERC accumulation during the aging process is regulated so
that old cells of similar ages contain similar levels of ERC s despite differences in initial
levels of ERC s in young cells.
Figure 2-5.Plasmid DNA and extrachromosomal rDNA circle (ERC) levels in young and
old cells. Plasmids are abbreviated by numbers in panels B-E. Panel A
conveys the cis-acting elements present in each plasmid (see also Table 2-1).
All plasmids carry LEU2. Control strain yAF5 (LEU2) did not contain
plasmid. Data were collected as described in Fig. 4. A. Age profile
histograms of young and old cells. B and C. Plasmid levels in young and old
cells (semi log plot). Data from two Southern blotting experiments are shown
(Exp 1 and Exp 2). D and E. ERC monomer levels in young and old cells
(semi log plot). See Fig. IC for corresponding life span data.
An important trend emerges from our studies of plasmid accumulation in old cells.
Plasmids that accumulate to the greatest degree in old cells (Figures 2-4 and 2-5) exert
the most profound effect on life span (Figure 2-1). ARS1 plasmids attain the highest copy
numbers in old cells and have the most pronounced effect on life span. ARS1 /CEN4
plasmids maintain a copy number near unity in young and old cells and have a small
effect on maximum lifespan and a moderate effect on average life span. Plasmids with 2
CI origins attain a copy number in old cells roughly half that of ARS1 plasmids and reduce
life span roughly half as much as ARS1 plasmids. This suggests the existence of an
inverse relationship between plasmid accumulation in old cells and reduction in yeast life
span.
Terminal Cell Morphology
Currently, in the field of yeast aging, there are few approaches available to directly
address the senescent phenotype in old non-dividing cells. To address this issue
indirectly, we scrutinized the "terminal" morphology of cells at the end of their life span
(Appendix A-H). The rationale for this approach is that cell morphology is a phenotypic
indicator of cell cycle stage and can serve as a basis to compare senescent cells (70). If
cell morphology in terminal transformed cells is very different from the morphology of
terminal wild type cells, this would imply that different mechanisms may bring about the
senescent phenotype in transformed and untransformed cells.
To examine terminal yeast cells, images of terminal cells were collected from
three different life span experiments. Three different cell morphologies were scored:
unbudded cells, single-budded cells with small buds, and single-budding cells with large
buds (70). Bud emergence in S. cerevisiae correlates with entrance into S phase, and
small buds are indicative of early S phase, whereas large buds are indicative of late S/G2
or mitotic arrest. Unbudded cells are in G1 phase. Between 10-15% of the terminal cells,
transformed or untransformed, had multiple buds (data not shown) and were omitted
from this comparison. For pJPAll3 (ARS1) and pJPAll6 (ARS1~, CEN4) transformants,
and W303AR5, more than 50% of terminal cells were unbudded (Figure 2-6). Typically,
Figure 2-6. Terminal morphology of senescent cells. Cells at the end of life span
experiments were classified according to budding pattern as described (70).
Small buds were defined as having a diameter less than 25% of the diameter
of the mother cell. All other buds were classified as large. Average and
standard deviation values from three independent experiments are shown (n
>40 for each transformant or control strain in each experiment).
between 50% and 60% of senescent yeast cells have been found to be unbudded (69,70).
pJPAll6 transformant cells consistently yielded the highest proportion (~65%) of
unbudded cells (Fig. 6). yAF6 (URA3) and pJPAl38 (2 CI ori) transformants ceased
dividing with a predominance, yet a lower percentage, of unbudded cells (Figure 2-6).
Thus, the maj ority of pJPAll13 transformants, like W303AR5 cells, senesced in G1, as
expected. In addition, similar proportions of small budded and large budded terminal
cells in senescent pJPAll3 transformants and W303AR5 cells (Figure 2-6) indicate that
similar proportions of these cells arrested in similar phases (S or G2 M) of the cell cycle.
Thus, this analysis supports the interpretation that pJPAll3 (ARS1) reduces life span by a
normal aging process.
Do Functional rDNA Transcriptional Units Play a Role in Reduction in Life Span?
Although plasmids without rDNA sequences reduce yeast life span, it is important
to consider a potential role for rDNA sequences in life span reduction. It is possible that
ERC s reduce life span in a manner that is mechanistically more complex than the
manner in which plasmid episomes reduce life span. There are significant differences in
coding potential between plasmids and ERC s. The 9. 1 kb rDNA repeat carries genes for
rRNA precursors as well as the gene TAR1, which lies on the strand opposite the 25S
rRNA and encodes a mitochondrial protein (84). One way to address this issue is to ask
whether or not a plasmid vector carrying an rDNA repeat unit has a more pronounced
effect on life span than plasmid vector alone. It is important to note this issue was not
completely addressed in a previous study employing the rDNA-containing plasmid
pDS163 (54). Plasmid pDS163 does not contain a functional 9.1 kb rDNA repeat unit.
The rDNA on pDS163 consists of a 12. 1 kb insert extending from an EcoRI site within
the coding sequence of 5.8S rRNA to the 5'-most EcoRI site in the 25S rRNA coding
region (data not shown). The 12.1 kb fragment does not carry a full-length 35S pre-
rRNA transcription unit and is capable of producing only a truncated 35S pre-rRNA
transcript, which if processed would be incapable of yielding mature 25 S rRNA.
To determine if an episomal rDNA repeat influences life span, we constructed
three plasmids containing 9.1 kb rDNA repeats and used them in life span experiments.
The three plasmids, pJPA105, pJPA106, and pJPA107 contain 9.1 kb repeats with
different endpoints in the plasmid pAFl5, which contains a 2 CI origin (see Materials and
Methods, and Table 2-1). Plasmid pJPA105 contains a repeat with Xmal end points,
Figure 2-7.Life span analysis of yeast transformed with plasmids containing rDNA
repeats. Number of daughter cells (generations) produced per mother cell are
plotted as a function of mother cell viability. Life span analysis was done as
described in Figure 2-1 using W303AR5 carrying plasmids pJPA105 (n=45),
pJPA106 (n=43), or pJPA107 (n=46) and control plasmid pAFl15 (n=46).
Plasmids pJPA105, pJPA106, and pJPA107 contain full length (9.1 kb),
rDNA repeats with different endpoints (see Table 2-1 and Materials and
Methods). pJPA105 contains an rDNA insert with Xmal endpoints, which has
been shown to be functional in vivo (85).
which has been shown by Nomura and colleagues to functionally complement an rDNA
deletion in vivo (85). pJPA106 and pJPA107 contain repeats with Ahdl and Psil
endpoints, respectively, which should not interfere with rDNA gene expression (Figure 1-
2). A 2 CI origin plasmid was used because plasmids constructed with rDNA inserts
whose replication relied solely on the rDNA ARS were found to integrate into the
chromosomal rDNA locus with high frequency (as determined by Southern blot analysis;
data not shown). Life span determinations of W303AR5 transformants containing
pAFl15, pJPA105, pJPA106, and pJPA107 were done as described above (see Figure 2-
1). pJPA105, pJPA106, pJPA107, and pAFl5 transformants gave very similar life span
curves, indicating that the presence of a functional rDNA repeat does not have a dramatic
effect on life span (Figure 2-7). All four plasmids affect life span to an extent similar to
the 2 CI origin plasmids pJPAl38 and pJPAl48 (Figure 2-1B, C), although the average
life spans for pJPA105, pJPA106, pJPA107, and pAFl15 (13.3, 11.8, 11.7, and 12.2
generations, respectively) are lower than the average life spans for pJPAl38 and
pJPAl48 transformants (15.5 and 16.3 generations, respectively; Figure 2-1 and Table 2-
2). Life span curves for pJPA106 and pJPA107 transformants did not show a statistically
significant difference from pAFl5 transformants based on the Wilcoxon signed pair rank
test (p>0.05) Only transformants carrying pJPA105 and pAFl5 exhibited a statistically
significant difference (p<0.05), but this represents a small increase in life span of
transformants carrying pJPA105. These findings support the conclusion that the presence
of a full-length rDNA repeat per se does is not required for, and does not necessarily
augment, reduction in yeast life span.
Summary
Our studies show that yeast plasmids accumulate in mother cells and reduce
replicative life span. The effect of plasmids on life span appears to be a direct effect, and
not an indirect effect on ERC levels in mother cells. A functional rDNA repeat unit is
not required for reduction in life span, and the presence of a functional rDNA repeat does
not augment reduction in life span by plasmids. Thus, plasmids containing ARS
elements appear to "mimic" ERC-mediated reduction in life span. These findings
provide strong evidence that replicative aging in S. cerevisiae is caused by accumulation
of episomal DNA. The fact that functional rDNA sequences are not required for
reduction in life span argues that expression of rDNA genes present on ERC s is not a
causative process in yeast aging. This indicates that accumulation of episomal DNAs,
such as ARS plasmids and ERC s, is one mechanism by which yeast life span is
regulated.
CHAPTER 3
TWO MICRON CIRCLE: A NATURALLY OCCURRING EPISOME' S ROLE IN
AGING
One of the processes that has been proposed to regulate replicative life span in the
budding yeast Saccharomyces cerevisiae is the accumulation of extrachromosomal rDNA
circles (ERCs) by yeast mother cells (54). ERCs are generated by recombination within
the rDNA repeat region on chromosome XII and are passed on to daughter cells
infrequently due to an inheritance bias exhibited by replication origin-containing DNA
episomes (43). We have shown that plasmids containing an autonomously replicating
sequence (ARS; yeast DNA replication origin) reduce life span due to their accumulation
during replicative aging (86). This suggests that DNA episomes in general regulate
replicative aging, and reduce life span due to their accumulation in yeast mother cells.
The majority of laboratory strains of S. cerevisiae contain an endogenous plasmid
known as the two micron (2CI) circle, due to the length of its circular DNA determined by
electron microscopy (76,87). Strains harboring this non-Mendelian genetic element are
denoted cir ; strains lacking it are referred to as ciro (88). Four genes and multiple cis-
acting sequences on the 2 micron plasmid have been mapped and functionally dissected
(76,87). These are responsible for maintaining copy number at approximately 20-40
copies per cell by a recombination-based mechanism and ensuring high fidelity
transmission of the 2 micron plasmid during cell division and mating (76,87,89). There
are no significant growth phenotypes generally associated with the presence of the 2
micron plasmid in cir+ strains, and conversely, negligible growth advantages conferred to
ciro strains (76,87). This has led to the view that the 2 micron plasmid is a "parasitic"
DNA that imposes only a minor selective disadvantage to host strains (76,87). However,
previous studies have not examined the possibility of an effect of the 2 micron plasmid
on replicative life span. A minor effect on replicative life span is not predicted to result
in a discernable difference in vegetative growth rate, and may have been overlooked in
the past. To address this issue we have taken advantage of a novel and simple method for
curing a cir+ yeast strain of 2 micron plasmids. Previously described methods (90,91) for
curing strains of 2 micron plasmids are more time-consuming and are less convenient
than the method described herein.
New Method for Removal of Two Micron Circle
During the course of plasmid copy number studies published elsewhere (86), we
fortuitously observed that transformants containing recombinant yeast shuttle vectors
with an rDNA ARS lost 2 micron plasmid DNA more frequently than was expected,
based on the known inheritance behavior of 2 micron plasmids. In our initial Southern
blotting studies, half of the transformants containing plasmid pJPAll14 (4/8
transformants) or plasmid pJPAll8 (2/4 transformants) lost 2 micron plasmid DNA (data
not shown). Plasmids pJPAll4 and pJPAll8 are derived from pRS306 (77) and have
been described previously (86). pJPAll4 contains a 200 bp insert with the rDNA ARS;
pJPAll8 contains a complete 9. 1 kb rDNA repeat with its ARS. The rDNA ARS has
relatively weak replication origin activity due to the presence of a non-consensus ARS
consensus sequence (ACS) (81). As a result, the maj ority of pJPAll14 and pJPAll18
transformants form colonies slowly on selective SD medium. In instances where fast-
growing pJPAll8 colonies arose on transformation plates or streaks of individual
transformants, Southern analysis revealed that pJPAll8 had integrated into the rDNA
A B
M 1 2 3 4 5 6 7 8 9g d101112 1 2 3 4L 5 6 7 8 1011 12
Figure 3-1.Southern blot analysis of pJPAll14 transformants. Panel A. DNAs from
twelve transformants were digested with Pstl, separated on a 1% agarose gel
and stained with ethidium bromide. Size markers (M) are shown (in kb).
Panel B. DNAs from the gel in panel A were transferred to a nylon
membrane, hybridized to 32P-labeled 2 micron plasmid DNA probe, and
visualized with a PhosphorImager. The 6318 bp 2 micron plasmid contains
one PstI site and yields a single 6.3 kb band (arrowhead). The faint bands
above and below the 2 micron plasmid band likely correspond to
hybridization to regions of homology in yeast chromosomes (e.g., a region of
homology in Ch III yields a PstI fragment of 7747 bp, which corresponds to
the size of the upper faint band). Longer exposures of the Southern blot
revealed no detectable bands in lanes 8 and 9 (data not shown).
locus (data not shown). Transformants containing pJPAll8 were not studied further
because of the relative frequency with which pJPAll18 integrated into the rDNA repeat
locus. Fast-growing pJPAll4 transformants arose only very infrequently and were not
analyzed for plasmid integration by Southern blotting. Transformants containing plasmid
pJPAll3 (86), which is derived from pRS306 but contains the ARS1~ origin instead of the
rDNA ARS, did not show loss of 2 micron plasmids in our Southern blotting studies (data
not shown). ARS1~ contains an ARS consensus sequence (ACS) that conforms to the
lie~iC1)3dC~~
consensus observed in most ARS elements and is considered a strong ARS, unlike the
rDNA ARS.
These preliminary results suggested that pJPAll4 may be generally useful to cure
cir+ strains of 2 micron plasmid DNA. To further test the use of pJPAll14 for this
purp ose, we tran sform ed W30O3 AR5 with pJPAll 4, streaked i ndep endently -i sol ated
transformants to single colonies, obtained isolates lacking pJPAll4, and analyzed twelve
arbitrarily-chosen isolates by Southern blot analysis (see Materials and Methods).
pJPAll4 has two technical merits in this experiment. Because pJPAll4 contains the
rDNA ARS, it is readily lost from transformants grown in the presence of uracil. Loss of
pJPAll4 can be confirmed by growth on medium containing 5-fluoroorotic acid (5-
FOA). In this experiment, 2 of 12 yeast isolates lost 2 micron plasmid DNA (Figure 3-1).
This confirms our initial findings that pJPAll4 transformants lose 2 micron plasmids
with a sufficiently high frequency to allow pJPAll14 to be useful for curing a strain of the
2 micron plasmid.
Two Micron Circle Does Not Reduce Life Span
To determine if the presence of 2 micron plasmids influenced replicative life span,
microdissection-based life span determinations were done as described (86,92). The two
ciro strains, yAF7 and yAF8, obtained from the experiment presented in Figure I were
compared to the parental strain W303AR5. No apparent difference in replicative life
spans was observed (Figure 3-2). The average replicative life spans for yAF7, yAF8, and
W303AR5 were 22.7 (16.2), 21.9 (17.3), and 23.5 (15.9) generations, respectively.
Wilcoxon two-sample paired signed rank tests revealed no statistically significant
differences between the three life span curves (p<0.05). Thus, the presence of 2 micron
plasmids in W303AR5 does reduce replicative life span compared to two independently-
isolated, otherwise isogenic strains lacking 2 micron plasmids.
~-+- yA54FT -W-- yAF8 --&-- Wct303AR$
03 10 20 30 4
Generatoe
Figure 3-.iesa nlsso i n ir es.Nme fduhe el
Figre3-.Lfor ypAF7 alyAF8,fi and W303R, reaspetivly Thm e three curelsar
indistinguishable by Wilcoxon two-sample paired signed rank tests (p<0.05).
Two Micron Circle Does Not Accumulate in Old Cells
These findings indicate that 2 micron plasmids do not confer a disadvantage insofar
as replicative life span is concerned. This suggests that 2 micron plasmids do not
accumulate during the aging process. To test this prediction, ~6-generation old yeast
cells were prepared by magnetic sorting (see Materials and Methods) and 2 micron
plasmid DNA levels were analyzed by Southern blotting. No differences in 2 micron
~ Ib
IrZu ;B
~s~ B
~Wfig 5
Figure 3-3.Two micron plasmid levels in young and old cells. Old cells were isolated by
biotinylation and magnetic sorting (see Materials and Methods). Bud scars in
young and old cells were stained with Calcofluor and counted to determine
average age. DNAs from young and old cells were analyzed by Southern
blotting as described for Figure 3-1. Size markers (M) are shown (in kb). To
normalize levels of 2 micron plasmid DNA to genomic DNA levels, the blot
was stripped and rehybridized to 32P-labeled probe to URA3. 2 micron
plasmid and URA3 band intensities were quantitated, and no significant
difference was found between the ratios of 2 micron plasmid DNA to URA3
DNA in young and old cells.
plasmid DNA levels were observed between populations of cells with average ages of 1.1
and 6.2 generations (Figure 3-2). To normalize the amounts of 2 micron DNA present in
young and old cell samples to the amounts of genomic DNA present, the relative amount
of the URA3 gene was determined by Southern blotting (Figure 3-2). Quantitative
analysis of the intensities of bands corresponding to 2 micron plasmid DNA and URA3
was done and revealed no significant difference between normalized 2 micron DNA
~ud~ga P~~
l.f 6.2 M
2 C1~ rrrr ~arirr,
levels in young and old cells (data not shown). Previous studies have shown substantial
accumulation of ERCs (5- to 50-fold) and non-centromeric recombinant plasmids (5- to
25-fold) in 7-generation old yeast cells (86). Thus, 2 micron plasmids are unlike ERCs
and non-centromeric yeast plasmid vectors, and do not accumulate in old cells.
Summary
In chapter 2, 2 micron origin plasmids were shown to accumulate. The same is
not true for naturally occurring 2 micron circles. They do not accumulate; therefore, they
do not reduce lifespan. While only confirming the model of plasmid aging, the loss of 2
micron circles in transformants of pJPAll14 is very interesting. What is pJPAll14 doing
to cause 2 micron circle loss?
CHAPTER 4
A CELL'S LIMITED RESOURCES AND PLASMID COMPETITION
The main hypothesis being developed to explain ERC mediated aging revolves
around the idea that episomes cause a replication burden in cells. As cells age, they
accumulate episomes (93). The episomes eventually reach a high copy number. It is so
high, that it is about the same amount of DNA as the yeast genome (93). This means that
an old cell is replicating two or more times the amount of DNA it normally replicates.
This enormous amount of DNA could require all of a cell's replication factors and DNA
substrates to complete replication. If one of these factors or substrates is limiting, then
the cell may encounter problems during replication. This could result in mutations,
double strand breaks, etc. In order to further explore this idea, the following experiments
were completed.
Smllp, Meclp, RNR, and Rad53p Pathway
Smllp and Meclp are involved in a well know DNA damage and repair pathway
(94). Most importantly it senses replication fork slowing and stalls. The cascade starts
by Meclp sensing DNA damage or replication fork stalling. It then signals through
Rad53p to Smllp. Sm 11p, an inhibitor, releases and thereby activates Ribonucleotide
Reductase (RNR) (Figure 4-1). RNR makes dNTPs from NTPs by removing the 2'
hydroxyl from ribose. This reaction results in an increase of cellular pools of dNTPs and
the progression of stalled replication forks (94).
Figure 4-1.Meclp, Rad53p, Smllp, and RNR pathway (94). This pathway ultimately
leads to the production of dNTPs.
SML1 Deletions Do Not Increase Life Span.
To see whether an increase in the cellular dNTPs pools would counteract the affects
of an episome's replication burden, a SM~L1 deletion was created with the insertion of
HIS3. By removing the RNR complex inhibitor, Smllp, dNTPs are continuously being
DCNA Jarrage,. rephla~tion blockE, & jstalled repli~tcano fbrks6
Trascrptina r
Rur p 1
RNR ~
gu
lation
produced no matter what the state of the cell. SM~L1 deletions are known to increase
dNTPs levels in the cell by 2-3 fold. In addition to looking at the life span ofSM~L1 and
sml1A strains, transformants of smllA were also test for an extended life span. The
plasmid used was pJPAll3. This is the ARS1 plasmid from Figure 2-1B and Table 2-1.
Transformed cells may help to amplify the affect sml1A has on a replication burden, since
they contain more episomes and have shorter life spans.
-*yAF10O+ARS
-=-smll n+ARS
yAF10
-*-sm/7AI
0 10 20 30 40
Generations
Figure 4-2.Life span ofSM~L1 deletions. yAF10 (HIS3; control) had a mean life span of
25.5 and a n=55. smllA had a mean life span of 25.9 and a n=57. yAF10 +
ARS (control) had a mean life span of 12.9 and a n=42. smllA + ARS had a
mean life span of 11.8 and a n=54. The ARS plasmid used was pJPAll3
(ARS 1).
The SM~Ll deletion had the same life span as the control (yAF 10). They were
statistically indistinguishable using the Wilcoxon two-sample paired signed rank test.
yAF 10 is the yAF5 strain with its his3 locus repaired to control for insertion of HIS3 into
snall. The transformed snlall cells also had the same life span as the transformed control
strain (Figure 4-2). Reproducing previous results, the pJPAll3 (ARS1) transformants
had a mean life span within the standard deviations of the life spans in Table 2-2.
Since replication is a doubling process, it is conceivable that an increase in dNTPs
of 2-3 fold is not enough to be seen on a life span. In other words, the life span assay
may not be sensitive enough. In old cells, episomes account for a large proportion of the
total DNA (could be more than half). Since they are retained due to mother cell bias, a
division occurring at an old age would increase the total DNA content by nearly double.
The only DNA being passed on to the daughter cell would be the chromosomes, not the
massively accumulated and newly replicated episomes. The key to this idea is that
episomes can reach a quantity larger than that of the genome. A snlall may only have
increased a cells life span by one doubling, not enough to be observed by life span.
Old Cells Do Not have an Increased Sensitivity to Hydroxyurea
Hydroxyurea (HU) is a chemical inhibitor of the RNR complex (94). It has been
widely used when studying Meclp and Smllp. Sn~all has an increased resistance to
HU. Strains that are snzllA neclA or sn~all rad53A have an increased sensitivity to
HU. Interestingly M~EC1 and RAD53 cannot be deleted without a SM~L1 deletion
suppressing their lethality (94). Smllp has a critical role in HU sensitivity because it is
the inhibitor of the RNR complex. Without SM~L1 it takes more HU to suppress the
larger pool of active RNR in the cell. IfM~EC1 or RAD53 are deleted then Smllp does
not release the RNR complex and the cell cannot make dNTPs. This is why sdl~A is
required when deleting M~EC1 and RAD53. M~eclA snal and rad53A sdl~A strains are
not less sensitive to HU because of Mec lp and Rad53p regulation of transcription factors
for the RNR proteins through Dunlp (Figure4-1). Without the activation of Dunlp, RNR
levels in the cell stay the same and cannot compensate for the inhibition by HU.
O mtM HUL 50 mMi HU 1008 mM HU 3200 mM~ HU
Young
Old
Figure 4-3.Hydroxyurea sensitivity of young and old cells from 0 mM to 200 mM. Each
plate has Hyve rows of pin stamps. Each row is a serial dilution of a strain.
The first row is a WT control yAF6. The second row is a WT control W1588-
4C. The third row is sdl~A. The fourth row is nzeclAsnlall. The fifth row is
rad53Asndl A.
A change in HU sensitivity by old cells would show that this DNA repair pathway
plays a role in the aging process. Two WT, sdl~A, nzeclA snlall, and rad53A sdl~A
strains were magnetically sorted to get young and old cells. Serial dilutions were pin
stamped onto minimal medium plates containing various levels of hydroxyurea. The first
pin stamping contained HU concentrations of 0, 50, 100, 200, 300, and 400 mM. As
expected the nzeclA snlall and rad53A sdl~A strains had an increased sensitivity to HU,
while the WT and snlall were more resistant. There were no noticeable differences in
the sensitivity of HU between the young and old cells (Figure 4-3). The 300 and 400 mM
HU concentrations are not shown because no strains were able to grow in those
conditions.
Om ML HU
10 mM HU
20 mMV HUI
Young
80Q mMr HU
4~0 mM HU
50 mM HU
Figure 4-4.Hydroxyurea sensitivity of young and old cells from 0 mM to 50 mM. Each
plate has Hyve rows of pin stamps. Each row is a serial dilution of a strain.
The first row is a WT control yAF6. The second row is a WT control W1588-
4C. The third row is sdl~A. The fourth row is nzeclAsnlall. The fifth row is
rad53Asndl A.
To further investigate HU sensitivity in old and young cells, a narrower range of
HU was examined for the second round of pin stamping. The concentrations of HU used
in this experiment were 0, 10, 20, 30, 40, and 50 mM. Again no distinction could be
drawn between the HU sensitivity of old cells to the HU sensitivity of young cells.
A closer look at concentrations between 0 to 10 mM and 100 to 300 mM may show
the differences we are looking for. The increase resistance to HU of smllA was not
shown; therefore, there needs to be a tighter range of concentrations between 100 and 300
mM. It is possible that old cells are more resistant to HU because they are up regulating
RNR.
Double Strand Breaks Do Not Increase in Old Cells
Replication slow zones are regions of DNA within the chromosomes at which
replication forks slow down. These zones were first discovered in M~EC1 mutants, where
the slow zones turned into double stranded breaks (DSB) (95). Since Meclp is the sensor
for stalled replication forks, M~EC1 mutants cannot fix stalled forks. In M~EC1 mutants,
replication forks spend more time at the slow zones. This leads to more DSBs in these
replication slow zones.
In old cells, the diminishing amounts of dNTPs caused by the episomal replication
burden could cause replication forks to stall more frequently and for longer periods of
time. This would in turn lead to more DSB. To test whether magnetically sorted old
cells have more DSB then young cells, pulse field gels were used to separate
chromosomes. After the gel was completed, it was transferred to positively charged
nylon and probed with the CHA1 probe. CHAl is located on one end chromosome III
(95). If a DSB occurred, then faint bands should appear below the chromosome III band.
These bands are shortened versions of chromosome III. No discernable difference could
be observed between young and old cells. There were no shorter bands on the blot;
therefore, there were no DSBs.
The original paper describing DSBs in nzecl mutants used a synchronized
population of cells. DNA was extracted from cells in the process of S phase. By using
cell synchronization, DSB formation in old cell might be able to be seen. Since there is
no positive control (nzeclA synchronized) in Figure 4-5, it is hard to say that the absence
of DSB detection conclusively shows that DSB do not form in old cells.
Figure~~,a 4-.oter fDBinyF W),W484C(TsdlnelsnlA n
ra53sdl. usefil gl a rn corin o atral admehos
Sothrnws raseredt psiiel cage nln ndralaln
Thgue pr5.othein tht ene DSB an sale repicaio forks in4 the) cella Mecaslpa,
phosphorylates o Rad53p (96). If t Rad53p pohryaion Olevel icess nodcelte
this pathway could be implemented in aging. After magnetically sorting old cells, protein
lysates were extracted. Several controls were also completed in parallel. HU causes a
signal cascade through this DNA repair pathway resulting in the phosphorylation of
Rad53p and the release of the RNR complex by Smllp. The phosphorylation can be seen
by a shift upward of Rad53p band on a gel (96). A rad53A smllA strain was added to
show which band is the Rad53p (the one not present in this strain). A meclA sml1A strain
was used to show a less phosphorylated Rad53p. The western blot shows that there was
no increase in the phosphrylation levels of Rad53p between young, old, and older (double
magnetic sort) cells. Even between cells that have have a variety of ERC levels (foblA,
WT, and sir2A), there was no difference in the phosphorylation of Rad53p.
Fiue -.Rd3ppophrlain ny un an ol el.Teupr ipre adi
Sinc thii a polyclona antbd, thr issm oseiicbnigt ad
CiuEN pl6.asmd53 ccanorlaio be seenan ld. Thesstanhvedfrntles ofpe ERsese band in tr
differetlie spans. 4 Sir2A prdcs the mhosthrlae ERs W rsoduc slghl less. Fh oblA
producs ver few pF3 is a stycoable pasmibd that cotins a ENelme oseicdnt. It repesnts
licens foring ofF3 ano single origin~ during the accumlatio ofEosf ERCs casea eioal
replication burden by abnormal licensing of ARSs throughout the genome, then pAF32
should fail to replicate more often in strains with more ERCs.
-* W303R5
11
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
-m sir2A
-A- fob lA
0 10 20 30 40 50
Generations
Figure 4-7.Life span of W303R5 (WT), sir2A, and foblA during the CEN loss
experiment. W303R5 had a mean life span of 22.4 and an n = 29. Sir2A had
a mean life span of 12.6 and an n = 28. FoblA had a mean life span of 30. 1
and an n = 30.
We followed the inheritance pattern of pAF32 throughout the life span of the
various transformants. Because pAF32 contains the ADE2 gene, its inheritance can be
followed by colony color (Appendix I-K). After the pedigree analysis was completed,
the life spans of the three strains (with a CEN plasmid) were consistent with the life spans
that are already published in the literature (without a CEN plasmid) (Figure 4-7). After a
close analysis of the pedigrees, they show that the sir2A stain lost the plasmid at earlier
divisions than the both WT and foblA strains. WT, which has intermediate number of
ERC, had intermediate loss of pAF32. The foblA strain had the fewest ERCs and the
latest lost of the CEN plasmid (Figure 4-8). While there was a low n, this result suggests
that ERCs inhibit CEN plasmid replication. It also says that episomes may cause aging in
old cells by sequestering needed replication factors away from the genome.
-* W303R5
-m sir2A
-A- fob lA
1
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
10 20
Generation at which CEN Plasmid was lost
Figure 4-8.The age which WT, sir2A, and foblA lose plasmid. CEN plasmids were lost
at a mean generation time of 11.4, 6.25, and 14.3 (respectively). The number
of cells analyzed in each strain were n = 8, n = 4, and n = 7 (respectively).
Mitotic Stabilities in the Presence of ERCs
To further investigate ERC's role in the cell, mitotic stabilities were examined. A
change in mitotic stability of ARS plasmids may be expected in strains with various
levels of ERCs accumulation. FoblA, WT, and sir2A strains were tested with pAF31
(ARS), pAF32 (CEN), pJPAl33 (ARS), and pJPAl36 (CEN). The two sets of plasmids
were used to control for the use of the ADE2 or LEU2 selectable markers. The sir2A
strain had an increased mitotic stability of pAF31i. Normally pAF3 1 has a mitotic
n= 7 9 11 13 13 14
100
90 -
80 -
70 -
60 -
50 -
40 -
30 -
20 -
10 -
0-
-
-
-
-
-
-
-
-
-
W303
pAF31
foblA
pAF31
sir2A W303
pAF31 pAF32
Strain/Plasmid
foblA sir2A
pAF32 pAF32
Figure 4-9.Mitotic stabilities of pAF3 1 and pAF32. The two plasmids were tested in
strains with various amounts of ERCs.
stability of 16% (W303). In the sir2A strain, pAF3 1 had a mitotic stability of 29%. The
sir2A strain had a slight increase in the mitotic stability of pJPAl33, but it was not
significant. The mitotic stability went from 17% (W303) to 21% (sir2A), but these
numbers fell within the standard deviation of each other. This could be explained by the
smaller size of pJPAl33 from that of pAF3 1. Very small plasmids are known to have
different mitotic stability characteristics. The ARS plasmid, pAF31, may have reached a
critical threshold in size for ERCs to play a role in mitotic stability. The foblA strain's
inability to further reduce the mitotic stability of pAF31 shows that there may be a
critical mass of episomes a cell can handle. If the increase in ERCs from fob lA to W303
was not enough to change mitotic stability, then the decrease in size from pAF31 to
pJPAl33 could be not enough to change mitotic stability.
W303 foblA sir2A W303 fob1 sir2
pJPA133 pJPA133 pJPA133 pJPA136 pJPA136 pJPA136
Strain/Plasmid
Figure 4-10. Mitotic stabilities of pJPAl33 and pJPAl36. The two plasmids were
tested in strains with various amounts of ERCs.
Plasmid Accumulation in sir2A and foblA Strains
Again foblA, sir2A, and wt strains were transformed with pJPAl33 and pJPAl36.
Magnetic sorts were completed to obtain young and old cells. The episomal replication
burden model predicts that accumulating plasmid will compete. In this example, ERCs
will compete with pJPAl33 for the replication machinery. The accumulation of the ARS
plasmid will decrease in the strains with increased ERC production.
Fiue-1.S uathern ofsoigpasi opttonpeoeo. ldgse
genmi DNA yild a .3 k E2 ad the ad r lsi
derived.C
mostcopes411 Softher plasmid (29 plasmids/cll) iinoldcls pJPe l33 alon Xhad different
coy umbern i eecmpee n the youngti strains Toqatfhe copy numberswr6,46an2. wit res ett
I I -
foblA, WT, and sir2A. This again mimicked the results from the old cells, but to a lesser
degree. Young and old cells of all of the strains contained relatively the same number of
pJPAl36 (CEN). This argues for a competition between ARS episomes for replication
machinery in the cell. To further extrapolate this idea, episomes may also compete with
the genome for the replication machinery and cause aging. Another explanation of this
result may be that there is a critical mass of episomes allowed in the nucleus. After that
mass is reached episomes begin to be pushed out.
350 ,
300
-250
-
1 00 -
HYoung
SOld
50t-
sir2 plPA133
wt plPA133 fob1 plPA133 sir2 plPA136
Strains
wt plPA136 fob1 plPA136
Figure 4-12. Quantitation of plasmid competition Southern. Quantitaion was
completed on the blot in Figure 4-11 by a Phosphuor imager.
Summary
The mechanism by which episomes cause aging has been very illusive. In this
chapter several experiments have been designed to tease out the mechanism. Although
some experiments gave negative answers, they did give definitive answers. While the
exact mechanism of episomal aging is still not well known, the experiments strongly
suggest in what direction subsequent experiments should go.
The maj or experiments in this chapter show a few things:
*CEN plasmids are lost at younger generation times in strains with more ERCs.
*The mitotic stability of ARS plasmids increases in strains with more ERCs.
*Old cells of strains with more ERCs accumulate fewer ARS plasmids.
Together they say that as episomes accumulate there is an increasing strain on the
cells replication machinery.
CHAPTER 5
CHROMATIN SILENCINTG AND EPISOME FORMATION
The maj or role of Sirdp in aging is its ability to deacetylate histones. By
deacetylating histones in the rDNA, it is silencing the DNA. More specifically it is
compacting the chromatin and making it less accessible. This results in fewer ERCs
produced and in turn a longer life span. Strains that over express Sirdp have fewer ERCs
and live longer. Conversely SIR2 deletions create more ERCs and have a shorter life
span because it cannot deacetylate histones.
If the histone acetylation status in the rDNA is central in ERC aging, then limiting
a cells ability to acetylate histones could be as important as Sirdp ability to deacetylate
histones. Histone acetyl transferases (HATs) are the enzymes that acetylate histones. In
addition to the enzymes responsible for the acetylation and deacetylation of histones the
pool of acetyl CoA may be important to aging. Acetyl CoA is the substrate for HATs in
the acetylation of histones. A closer look at the production of acetyl CoA may lead to
mutants that increase life span. These ideas are illustrated in Figure 5-1.
Two enzymes are responsible for the production of acetyl CoA, Acslp and Acs2p
(Acetyl CoA Synthetase). Acslp has a Km 30 times lower than Acs2p (97). This does
not mean that it does most of the conversion of acetate to acetyl CoA. The two enzymes
are regulated very differently. Acslp is completely repressed by glucose (100 mg/L), up
regulated in ethanol, and further increased in acetate medium. Where as Acs2p is
maintained at a constant level in glucose and ethanol, but acts sporadically in acetate
(97). An ACS2 deletion cannot grow on glucose as a carbon source. This is because of
At:
__ __ _~_ _
the repression of ACS1 by glucose. If ACS2 is deleted and ACS1 is repressed by glucose,
then there is insufficient ACS activity in the cell, and the cell cannot survive. The cell
needs acetyl CoA to survive.
-0,
FDNA Stab~ilit
Are~tata
Lonlgevity
Agl ng
Figure 5-1. The acetylation of histones and its affect on ERC production and life span.
ACS2 and ACS1 is Required for Normal Life Span
Deletions ofACS1 and ACS2 were obtained from the Clusius lab. It was predicted
that deletions of the ACS genes would lead to an extended life span. This is because
acetyl CoA levels in the cell would drop. Histones would be acetylated less, and the
production of ERCs would decrease causing a longer life span.
EtH
Acetakiehyde
Acetyl CoA Co
s~4bc~HiStone~
rD~NA Inssta l4ilty
Life spans were completed on both glucose and ethanol. Surprisingly T23D, the
strain background, has a much longer life span than the W303R5 derivatives that have
been used in previous studies throughout this dissertation and other strains in published
papers. Never the less, there was a reduction in life span in acslA from the controls.
Interestingly acs2A had an even shorter life span than a~sclA (Figure 5-2). These
reductions in life span are opposite of what one might conclude, from the model
described in Figure 5-1.
-H-23D E -*-21 E
-K-T23D D -%-621 D
625 E
20 40 60
Generations
Figure 5-2.Life span of ACS deletions. T23D (control) on ethanol (E) had a mean life
span of 55.2 and an n=59. 621 (acslA) on ethanol (E) had a mean life span of
47.4 and an n=59. 625 (acs2A) on ethanol (E) had a mean life span of 16.6
and an n=51. T23D (control) on glucose (G) had a mean life span of 35.0 and
an n=59. 621 (acslA) on glucose (G) had a mean life span of 24.8 and an
n=59.
A closer look at metabolism shows that acetyl CoA is used for many processes in
the cell besides acetylation of histones. Acetyl CoA is one of the entrance points into the
Citric Acid Cycle. It is also used in lipid synthesis. ACS2 is known to be coregulated
with structural genes of fatty acid biosynthesis because of an upstream ICRE
(inositol/choline-response element). These and other pathways may be more important to
a cell's health than the predicted decrease in the production of ERCs by the ACS
deletions.
In addition to looking at the affects of Acslp and Acs2p in a cell, we inadvertently
observed a difference in life span between cells grown on glucose and cells grown on
ethanol as a carbon source. When T23D was grown on ethanol it had a mean life span of
55.2 and a maximum life span of 77 Generations. This is longer than the longest life
span we have seen published in the literature. To our knowledge the longest life span
published is a mean life span of 36. 1 and a maximum life span of 74 (98).
ACS2A Increases ERC Production
To further explore ACS1 and ACS2's role in aging, ERC production and
accumulation was measure in old and young cells of the ACS deletions. According to the
model illustrated in Figure 5-1, ACS deletions should lead to a decrease in ERC
production. Cells were grown in ethanol and then age fractionated by magnetic sorting.
T23D (control) had very few to no ERCs in the old cells. This may be why it has a
longer life span than W303R5. What is the genetic difference between T23D and
W303R5. T23D is a diploid strain while W303R5 is a haploid. Previous experiments
have shown that the ploidy of a strain is not important to life span (99). Another
difference is that W303R5 is ade2, his3, leu2, trpl, and ura3; and T23D has no
62
auxotrophic markers. Some of these genes can be compared by life spans that were
completely separately, and they do not seem to influence life span.
Interestingly, the ACS2 deletion produces more ERCs. While the ACS1 deletion
does not produce ERCs. Acs2A's ERC production may attribute to its shortened life
span.
9:
..I
IaIr ~
x:: x : :
Figure 5-3.Sorts of young and old ACS deletion strains. The southern blot was probe for
rDNA. Light banding in the old acs2A sample can be observed at a high
molecular weight. These are ERCs.
Summary
ACS1, ACS2, ethanol as a carbon source, and fatty acid biosynthesis are all linked
to aging. Further exploration is needed to fully understand how acetyl CoA is involved in
aging. Another noteworthy result is that T23D lives longer than W303R5. It would be
interesting to know what genetic differences contribute to its extended life span. Many
experiments could easily be designed to determine the genes that help it live longer.
CHAPTER 6
LOOKING AT POSSIBLE MECHANISM OF CELLULAR AGING
YCA1 and Apoptosis in Yeast
Apoptosis and aging are intimately linked. Since programmed cell death,
apoptosis, contributes to the aging of metazoans, looking at a known yeast caspase, an
apoptotic regulator, seemed reasonable. Yealp is the only known caspase like protein in
yeast (100). It has been shown to be required for hydrogen peroxide induced apoptosis.
When YCA1 is deleted, it increases yeast chronological life span (100). To further
investigate the role of Yealp in the aging process we constructed a YCA1 deletion in our
W303AR5 strain. It was created by using microhomology to YCA1 and inserting HIS3
inside of the gene (See Materials and Methods). After the insertion of HIS3 into YCA1,
we confirmed by southern that the constructed W303AR5 ycal::HIS3 strain was correct.
A control strain was also created by repairing the his3 locus of the W303AR5 strain.
This was to insure that the HIS3 status of the cell would not contribute to a lifespan
change. The two strains were compared through replicative life spans (Figure 6-1).
There was no statistical difference between the ycal deletion and the control strain. The
interpretation is that while ycal is necessary for a normal chronological life span, it is not
required for replicative life span. This experiment illustrates the fundamental difference
between a chronological and replicative life span. A chronological life span
demonstrates a cells resilience and ability to replicate after being in a saturated culture
full of cells and depleted of nutrients. In a replicative life span, cells are spaced out very
far from each other, so it is unlikely that they will run out of nutrients. It is a measure of
a cell replicative potential, not its resilience over time. It is a subtle difference, but
important when trying to address different questions about cellular aging.
-m Control
ycalAn
10 20 30 40
Generations
Figure 6-1.Life span of ycalA. This life span was completed on rich media (YPD). The
control strain had a mean life span of 22. 1 (n=60). The ycal deletion had a
mean life span of 21.4 (n=57).
Shu Gene Family and Mutation Suppression in Aging
Using a CAN1 forward-mutation assay, the SHU (sensitivity to hydroxyurea) genes
were discovered. These genes are required to prevent spontaneous mutations. In the
assay, 4,847 yeast deletion mutants (from the yeast deletion proj ect) were screened for
the ability to spontaneously become canavanine resistant (canl) (101).
In collaboration with the laboratory of Rodeny Rothstein, four of the genes
discovered in this screen (SHU1, SHU2, SHU3, and CSM~2) were looked at by replicative
-= W303R5 -* shu? A
-n- shu3n -m- csm2d
shu2n
4Xn
10 20 30 40
Generations
Figure 6-2. SHU genes role in life span. The mean life span of W303R5 is 24.5 (n=60).
The mean life span of shulA is 25.3 (n=60). The mean life span of shu2A is
25.8 (n=58). The mean life span of shu3A is 23.2 (n=56). The mean life span
of csm2A is 22.5 (n=59). The mean life span of the quadruple deletion (shulA,
shu2A, shu3A, and csm2A) is 21.5 (n=59).
life span. They are believed to be involved in DNA replication. These experiments were
completed in the Rothstein lab. These gene's ability to suppress mutations and their
involvement in DNA replication make them a candidate for having an increased life span.
The Rothstein lab had preliminary data that suggested this with one or more of the
mutants. After the experiment was completed all strains had very similar life spans
(Figure 6-2). A close look at the p-values obtained from the Wilcoxon two-sample paired
signed rank test shows that there may be a small difference between the strains (Table 6-
1). The experiment needs to be repeated (one of the few that has not been) before any
maj or conclusions can be drawn.
Table 6-1. P-values of the SHU deletion life spans.
Comparison #1 Comparison #2 P-Value
W303R5 shulA 0.032
W303R5 shu2A 0.003
W303R5 shu3A 1.22 x 10-7
W303R5 csm2A 9.07 x 10-6
W303R5 Quadruple a 4.50 x 10-s
shulA shu2A 0.090
shulA shu3A 1.14 x10-4
shulA csm2A 2. 12 x10-6
shulA Quadruple a 3.30 x 10-s
shu2A shu3A 1.47 x 10-4
shu2A csm2A 1.02 x 10-5
shu2A Quadruple a 4.23 x 10-6
shu3A csm2A 0.016
shu3A Quadruple a 1.68 x10-5
csm2A Quadruple a 0.002
Summary
This chapter focuses on ideas that were not specifically linked to our episomal
aging model. Because these concepts could have played a role in the broader scope of
aging, we explored them. It is now known that YCA1 does not affect replicative life span.
68
We also know that more experiments need to be completed to show definitively the
subtle difference between the SHU strains
CHAPTER 7
DISCUSSION
Budding yeast is an excellent system in which to study cell-autonomous
mechanisms of aging. Mechanisms linked to genome stability, metabolic damage, and
metabolic regulation have been found to regulate yeast replicative life span (45-
47,52,53,102). Sinclair and Guarente have proposed that a key regulator of life span is
the cellular level of extrachromosomal rDNA circles (ERC s) (54). To study this
proposal, we have used plasmids to model ERC inheritance and accumulation, two
processes that govern ERC levels in yeast cells. Our work shows that plasmid DNAs
bring about significant reductions in yeast life span. We Eind that ARS1~ and 2 CI origin
plasmids specifically accumulate in old yeast cells, and that the level of accumulation of
ARS1~ and 2 CI origin plasmids in old cells correlates with the extent of reduction in life
span. This is the first demonstration to our knowledge of an inverse relationship between
DNA episome level in old cells and reduction in life span. We Eind that plasmids have a
direct effect on life span and do not indirectly reduce life span by increasing
recombination at the rDNA locus and increasing ERC levels in transformed cells.
Analysis of the "terminal" morphology of senescent cells indicates that plasmids do not
cause a stochastic arrest in the cell cycle, which is consistent with a normal aging
process. Reduction in life span does not require that plasmids carry rDNA repeat
sequences, and the presence of a full-length, functional 9.1 kb rDNA repeat on a plasmid
does not augment reduction in life span. These Eindings confirm the work of Sinclair and
Guarente (54), and provide significant new support for their ERC model by directly
demonstrating a relationship between plasmid inheritance, plasmid accumulation, and
reduction in life span. Our studies also highlight the value of plasmids as tools to
investigate properties of ERC s that are relevant to the aging process in yeast.
Why Do ARS Plasmids Accumulate in Mother Cells?
It has long been appreciated that ARS plasmids are inherited asymmetrically and
accumulate in mother cells (43). This accounts for the high copy number and low mitotic
stability of ARS plasmids. However, accumulation of ARS plasmids in cells that are
multiple generations old has not been directly demonstrated. Our studies are the first to
directly demonstrate that ARS1-containing plasmids accumulate to high levels in old
yeast cells. Although ARS1 plasmid partitioning bias is well known, little is understood
about its underlying mechanism. One possibility is that plasmid partitioning bias is due
to the nature of cell and nuclear division in budding yeast. During closed mitosis in
yeast, an intact nucleus elongates along the axis of the mitotic spindle and adopts an
elongated "dumb-bell" shape due to constriction of the nucleus at the bud neck.
Chromosomes pass though the constriction at the bud neck by virtue of their attachment
to the mitotic spindle, which is able to exert force on chromosomes. In the absence of
spindle attachment, passage of DNA molecules through the constriction at the bud neck
may be limited. Consistent with this notion, the relatively small (1.45 kb) TRP RI
plasmid has been shown to be inherited efficiently and to exhibit high mitotic stability
(103). The small size of the TRP RI plasmid may allow it to readily distribute between
mother and daughter cells through the bud neck constriction. Commonly used yeast
recombinant DNA vectors are typically larger than the TRP RI plasmid and require cis-
acting sequences and trans-acting factors to be stably inherited.
Why Do Budding Yeast Exhibit a Mother Cell Plasmid Segregation Bias?
One possibility is that mother cell segregation bias is a mechanism to protect
progeny cells from potential "parasitic" effects of episomal DNAs acquired from the
environment. The 2 CI circle is a commensall" episomal DNA that Futcher has depicted
as a sexually transmitted selfish DNA (89). The 2 CI circle depends on its capacity to
overcome mother cell segregation bias (see below) in order to survive in a host
population in the absence of any selective value. Another possibility is that mother cell
segregation bias is a mechanism to increase the longevity of progeny cells by limiting
transmission of ERC s.
Why Do ARS1 Plasmids Bring About Cellular Senescence More Rapidly than Do
ERCs?
One possibility is that virgin mothers contain more plasmids than ERC s at the start
of life span experiments. Virgin mothers must contain at least one ARS plasmid, but
probably contain on average ~0.5 ERC per cell. The difference in origin strength
between ARS1~ and the rDNA ARS may also be important. ARS1 is a relatively "strong"
ARS, and capable of supporting rapid plasmid accumulation in mother cells. ERC s
contain a comparatively "weak" ARS that is likely to support only relatively slow
accumulation in mother cells. The rDNA ARS contains an ACS (ARS consensus
sequence) that departs from the consensus at position 1 a change that has been shown
to reduce ARS function, primarily by limiting DNA unwinding (81). This difference in
strength could explain why ARS1 plasmids bring about senescence in mother cells more
rapidly than do ERC s. ARS1~ plasmids are replicated more efficiently than ERC s, which
increases the rate of ARS1 plasmid accumulation in mother cells compared to ERCs.
Do Cis-acting Sequences that Counteract Mother Cell Segregation Bias Suppress
Reduction in Life Span by ARS1 Plasmids?
Yes, ARS1 CEN4 plasmids reduce life span to a lesser extent than ARS1 plasmids,
which is consistent with results of Sinclair and Guarente (54). However, inclusion of
CEN4 on ARS1~ plasmids suppresses the reduction in maximum life span by ARS1~
plasmids, but does not fully suppress the reduction in average life span. Our studies also
directly show that ARS1 CEN4 plasmids do not accumulate in ~7 generation old mother
cells. The reduction in life span is not specific for the combination ofARS1 and CEN4.
The combination ofARSH4 and CEN6 (in pRS314, (77)) reduces average life span with a
minimal effect on maximum life span. The fact that centromeric DNA elements suppress
reduction in maximum life span supports the conclusion that ARS1~ plasmids exert their
effect by accumulation in mother cells, as discussed above.
Do 2 Micron Circles Reduce Life Span?
It is initially surprising that ciro cells did not have an increased life span compared
to cir~ cells, especially since 2Cl origin plasmids accumulated in old cells. Quickly we
realized that the 2Cl circles and 2Cl origin plasmids were very different. 2Cl circles did not
accumulate in old cells and 2Cl origin plasmids did. With this knowledge of 2C
accumulation, it becomes obvious that 2Cl circles would not decrease life span.
Why Do 2 Micron Origin Plasmids Reduce Life Span?
Although both 2 CI origin plasmids and 2 CI circles contain the REP3 STB cis-acting
stability element, 2 CI origin plasmids contain a single 599 bp segment, whereas 2 CI
circles contain two 599 bp segments arranged as an inverted repeat (76,80). More
efficient autoregulation of 2 CI circle copy number and inheritance is likely to prevent
accumulation in old cells. It is important to note that 2 CI circles can be toxic to cells
when present at high copy number. Constitutive expression of the 2 CI amplification
machinery results in high copy number and has deleterious effects on cell growth (76).
Similarly, mutations in NIB1 ULP result in unusually high levels of 2 CI circles,
formation of large inviable or mitotically arrested cells, and clonal lethality (104).
Studies by Dobson and coworkers indicate that an abnormal form of Rep2p, a 2 CI circle-
encoded plasmid partitioning protein, accumulates in ulpl mutants, suggesting that ULP1
is involved in partitioning of 2 CI circles during mitosis (M. Dobson, personal
communication). This suggests that high levels of 2 CI circles in nib1 ulpl mutants may
result from asymmetric inheritance. In this sense, phenotypes associated with nibl/ulpl
defects may share mechanistic underpinnings with senescent phenotypes associated with
asymmetric inheritance of plasmids and ERC s.
Why Do 2 Micron Origin Plasmids Have an Intermediate Effect on Life Span?
Although 2Cl origin plasmids accumulate in ~7 generation old mother cells, they
attain levels approximately half that observed with ARS1~ plasmids. As mentioned above,
comparison of results with 2Cl origin and ARS1~ plasmids supports an important semi-
quantitative inverse relationship: the extent of plasmid accumulation in old cells
correlates with the extent of reduction in life span.
Why Does Transformation with pJPA114 Lead to 2 Micron Circle Loss?
Recent studies of 2 micron plasmid partitioning have made great strides in
revealing roles for cis-acting elements and trans-acting factors in substantial cellular and
molecular detail (105,106). These studies and earlier studies (76,87) suggest that
inheritance of 2 micron plasmids has little mechanistic overlap with inheritance of
replicating (ARS) plasmids such as pJPAll4. Thus, it seems unlikely that pJPAll4
competes with 2 micron circle for a limiting amount of (a) specific mitotic partitioning
factorss. Another possibility is that pJPAll4 adversely affects 2 micron circle copy
number, which in turn adversely affects transmission to daughter cells. We have
observed that 2 micron circle DNA levels are reduced 30-40% in ~?-generation old cells
containing yeast replicating plasmid pJPAll3, but not in ~?-generation control cells
lacking pJPAll3. pJPAll3 accumulates to high levels in ~?-generation old cells (86),
and perhaps 2 micron circle DNA levels are reduced as a result of this accumulation.
pJPAll4 attains a high copy number in young cells (86), and is likely to accumulate in
old cells, like pJPAll3. Although these Eindings are not conclusive, they are consistent
with competition between pJPAll4 and 2 micron circles for DNA replication factors
and/or precursors, which could lead to reduced 2 micron circle copy number and
impaired transmission to daughter cells.
By What Mechanism(s) Do Plasmids, and by Implication ERCs, Reduce Life Span
in Yeast?
It is clear that asymmetric inheritance of plasmid DNAs has the potential to burden
mother cells with high DNA content. If we assume that a 5 kb plasmid is replicated once
each S phase, and uniformly inherited by the mother cell during M phase, then 12
doublings will yield a plasmid DNA content in excess of the nuclear genomic DNA
content (5 X 212 = 20.5 Mb plasmid DNA content > ~13 Mb nuclear genomic DNA
content). Of course, this example is an oversimplification and omits factors such as
origin firing frequency and segregation efficiency. However, we note that after 12
generations, 90% of pJPAll13 (5.7 kb ARS1 plasmid) transformants were senescent and
after 20 generations, 90% of pJPAl33 (4.8 kb ARS1~ plasmid) transformants were
senescent. The fact that significant percentages of senescent mother cells arise between
10 and 20 generations is consistent with the accumulation of plasmid DNA content to a
level that approaches or exceeds nuclear genomic DNA content. Similarly, Sinclair and
Guarente have estimated that the ERC content of old cells exceeds the content of the
linear genome (54).
Why Are There Less Plasmid Accumulation in Strains that Produce More ERCs?
This concept of plasmid competition brings us to believe that there is a replication
burden in old cells. Two things could cause the loss of pAF32 (CEN), when it is in the
presence of ERCs. A limiting replication factor or DNA substrate could be soaked up by
the large quantity of ERCs and not allow the single copy pAF32 to replicate. In another
scenario the ERCs could act almost like a physical barrier making it harder for the
plasmid to leave the cell. Inheritance and replication are the two mechanisms that are
central to the characteristics and behavior of plasmids.
The mitotic stability in sir2A, WT, and foblA eliminates the concept of ERCs
acting as a physical barrier for inheritance of pAF32. It also raises new questions when
looking at the ARS plasmids (pAF31 and pJPAl33). Returning to the two plasmid
processes, ERCs could be increasing plasmid inheritance or replication. While it is
unlikely that ERCs are causing an increase in replication, a look at inheritance allows us
to start constructing some models. It is possible that there is a limited amount of space in
the nucleus. The total number of episomes cannot be higher than some critical mass of
DNA. This would cause the two accumulating episomes to be pushed out of cells and
inherited better. Saturation of the plasmid bias machinery could be another mechanism
that increases mitotic stability.
Episome accumulation in old cells of strains that produce various levels of ERCs
shows us that plasmid competition is very real. The reduced level of pJPAl33 in sir2A is
about half of the copy number than in W303R5. This is dramatic. The most important
part of the plasmid competition phenomenon is whether, it is an output of how episomes
causes aging. Mechanistically these two ideas could be very similar. If this is true, we
will be able utilize the versatility of plasmids to discover how ERCs cause aging.
Is There Episomal Aging in Metazoans?
While ERCs have not been found in metazoans, it is hard to say that the absence of
evidence for them proves there is no episomal aging is higher organisms. It is possible
that another highly repetitive sequence can recombine to form episomes, but they have
been very difficult to detect. Also, DNA viruses could be interpreted as episomes that
reach high copy within a cell. An analogy can be draw between ERC replication stress
and viral commandeering of a cell's replication machinery. Both may lead to problems
during DNA replication and hence genomic instability. Genomic instability could
facilitate the mutations and recombination in various cancer causing genes and increase
the incidence of cancer.
CHAPTER 8
MATERIALS AND METHODS
This chapter contains the methods and procedure used for experiments throughout
this dissertation.
Yeast Strains and Plasmids
W3 03AR5 (M4rATa leu2-3,11~2 his3-11,1~5 ura3-1 ade2-1 trpl-1 canl-100 RAD5
ADE2::rDNA, [cil-+], (54)) was obtained from D. A. Sinclair. yAF5 and yAF6 were
constructed by integrating linearized pRS305 and pRS306 (77), respectively, into the
leu2-3,11~2 or ura3-1 loci of W303AR5, respectively, and genotypes were confirmed by
Southern blotting. Plasmids were transformed into W303AR5 using a standard lithium
acetate method (107). All experiments were done with freshly-prepared, independently-
isolated, colony-purified transformants. Unless otherwise noted, yeast were grown on
selective SD "drop in" medium (88).
Descriptions of plasmids are provided in Table 1. A 200 bp fragment containing
ARS1~ was amplified by PCR with primers 5 '-GGAAGCTTCCAAATGATTTAGCATTATC-3 and
5'-CCGAATTCTGTGGAGACAAATGGTG-3' using template YRpl7. A 200 bp fragment
containing the rDNA ARS was amplified by PCR with primers
5 '-CCAAGCTTGTGGACAGAGGAAAAGG-3 and 5 '-GGGAATTCATAACAGGAAAGTAACATCC-3 using
template pJPA102 (rDNA repeat with Ahdl endpoints in pCR4, see below). A 753 bp
fragment containing CEN4 was amplified by PCR with primers
5 '-GCGGATCCCCTAGGTTATCTATGCTG-3 and 5 '-GGGAATTCCTAGGTACCTAAATCCTC-3 using
template YCp50. A 1346 bp region of 2 CI circle DNA, containing the REP3 STB cis-
acting stability element and a single 599 bp repeat region, was amplified by PCR with
primers 5 '-CCGGATCCAACGAAGCATCTGTGCTTC-3 and
5 '-CCAAGCTTTATGATCCAATATCAAAGG-3 using pRS424 as template. rDNA repeats were
amplified by PCR using as template size-selected (8-10 kb), genomic DNA that was
digested with the appropriate enzyme (Ahdl, Psil, or Xmal). The following primer pairs
were used: Ahdl endpointS, 5'-GGGATCCATGTCGGCGGCAGTATTG-3 and
5'-CCTGCAGiCTGTCCCACATACTAAATCTC~TTC-3'; Psil endpoints,
5'-GGGATCCTAATATACGATGAGGATGATAGTG-3' and
5'-CCTGCAGTAATAGATATATACAATACATGTT~TTTACC-3'; Xmal endpoints,
5 '-CCCGGGGCACCTGTCACTTTGG-3 and 5 '-CCCGGGTAAACCCAGTTCCTCACTAT-3' PCR was
performed for 20 cycles with 15-second denaturation and annealing times using PfuTurbo
DNA polymerase (Stratagene). PCR products were purified (Qiagen), digested with
restriction enzymes and ligated directly into recipient vectors, or cloned into pCR4-
TOPO (Invitrogen), excised, gel-purified, and ligated into recipient vectors (see Table 2-
1). ARS elements were cloned between HindIII and EcoRI sites. CEN4 was cloned
between EcoRI and BamHI sites. The 2 CI origin was cloned between HindIII and
BamHI sites. rDNA inserts were cloned between PstI and BamHI sites in pAFl15, which
is derived from pRS424 and contains loxP sites that were inserted at EcoRI and Spel sites
using annealed primer pairs: 5 -AAT`TATAAC TTCGTA TAA TGTAT`GC TATACGAAGTTA T-3' and
5'-AATTATAACTTCGTATAGCATACATTATACGAAGTTAT3 (EcoRI);
5'-CTAGATAACT~TCGTATAATGTATGCTATACGAAGTTA-3 and
5'-CTAGATAACTTCGTATAGCATACATTATACGAAGTTAT3 (Spel). All cloned inserts were
sequenced in their entirety. Plasmids pJPA105, pJPA106, and pJPA107 (that contain
rDNA inserts) were propagated in E. coli DH~a grown in LB media with 25 Clg/ml
carbenicillin at 300C to avoid insert instability.
Mitotic Stability
For each plasmid, five transformants were grown in selective SD liquid medium for
2 days at 300C to saturation (OD600 = 1.1-1.5; 0.5-1X107 ofu/ml; growth to late log gave
results similar to stationary phase). Approximately 200-250 colony forming units (cfu)
of each transformant were plated on non-selective SD medium, grown for 2-3 days at
300C, replica plated onto selective and non-selective agar media, and grown for 3-4 days
at 300C. After these plates grow the total number of colonies that grew under no
selection are counted from the first plate. The number of colonies that grew under
selection are counted from the second plate. Dividing the number of colonies from the
second plate by the number of colonies on the first plate gets the percent of cells in the
population that had the plasmid. This is the mitotic stability. It is simply the number of
colonies that contained the plasmid divided by the total number of colonies.
Replicative Life Span Determinations
Replicative life span determinations were done essentially as described (92) with a
few modifications. Six transformants were streaked individually on one side of an SD
agar plate, and 10 virgin mother cells from each (n=60) were positioned in an orthogonal
grid pattern. Virgin mothers that failed to give rise to 5 daughters were not included in
the data set. Due to the low mitotic stability of ARS-plasmids, it was necessary to start
with approximately 250 virgin mother cells from ARS1~-plasmid transformants to obtain
n=50-60 for life span determinations. A Zeiss Tetrad microscope equipped with 16X
eyepieces was used for micromanipulations as described (88). SD agar plates were
weighed at the beginning of each experiment and sterile water was pipetted into four
small notches at the edge of each plate on a daily basis to compensate for evaporation and
prevent increases in osmolality, which could potentially affect results (108). During life
span experiments, plates were incubated at 300C during the daytime and stored overnight
(~12 hours) at 140C. We found that extended periods (>24 hours) at 140C reduced life
spans of transformants and control strains (data not shown). At the end of a life span
experiment, mother cells not having divided for 2 days were transferred to non-selective
SD or YPD medium, and cells that resumed mitosis were excluded from the data set.
This allowed us to exclude data from mother cells that stopped dividing due to plasmid
loss rather than due to cell senescence. Data were entered into an Excel spreadsheet
template file (available on request) that automatically calculated relevant life span data
values and performed Wilcoxon two-sample paired signed rank tests. Images of terminal
cells were collected using a Spot-2 CCD camera (Diagnostic Imaging) affixed to a Zeiss
Tetrad microscope and "terminal" cell morphology analysis was done as described (70).
Southern Blot Analysis and Quantitation
DNA was extracted from yeast cells using a glass beads/phenol method, digested
with restriction enzymes according to the supplier (New England Biolabs), separated on
0.8% agarose gels (200 V/hours), and capillary transferred to positively-charged nylon
membrane under alkaline conditions using standard methods (109). For each plasmid
copy number and ERC monomer level determination, five plasmid transformants were
analyzed in parallel. Digestion with BamHI or PstI yielded single plasmid-specific or
genome-specific bands of different sizes that hybridized tO 32P-labeled probe generated
by random-primed labeling (New England Biolabs). PstI and BamHI do not cleave
rDNA. Genomic bands were used as internal standards for measurements of plasmid
levels. Chromosomal rDNA bands were used as internal standards for measurements of
ERC monomer levels. Blots were hybridized first to GRA3 or LEU2 probe, followed by
stripping and hybridization to rDNA probe. Data from the same blots were used to
prepare Figures 2 and 3B. Southern data were acquired with a Typhoon PhosphorImager
and analyzed using ImageQuant software (Molecular Dynamics).
Pulse field gel electrophoresis was completed at 14oC with a Bio-Rad CHEF-DR II.
1% agarose gels were run in 0.5X TBE for 30 hours. The voltage used was 200V with a
switch time starting at 5 seconds and ending at 30 seconds.
Magnetic Cell Sorting
At any given time 1 in 512 cells is an eight generation old cell. This is due to the
nature of a doubling population. 1/2 of the cells are new, zero generation daughters. 1/2
of the cell remaining (1/4) are 1 generation old cells. 1/2 of the cell remaining (1/8) are 2
generation old cells. This continues until the number becomes increasingly smaller. To
extract the small number of old cells from a large population of cells, magnetic sorting is
used. 1x10" cells are grown up and labeled with biotin. They are then grown over night
in 1 liter of liquid medium. Since new cell wall synthesis occurs at the bud of the
emerging cell, no biotin is transferred to the newly divided daughters. This results in a
large population of cells that have their oldest cells labeled with biotin and the young
cells are not. The cells are then spun down and concentrated into a smaller volume.
Strep-avidin coated magnetic beads are mixed with the cells for 2 hours at 4oC. All of the
subsequent steps are done in the cold to ensure that the cell do not continue to grow. The
strong interaction between biotin and avidin allows the magnetic beads to bind to the old
cells. The old cells are then pulled out of solution with a strong magnet and the young
cells are washed away. Eight washes are used to ensure that the population acquired at
the end of the experiment is homogeneously old. The old cell final product is ready for
further use in other experiments.
Budscar Histograms
After a sort for old cells, a bud scar histogram is conducted to determine the age
distribution of the cells collected. When a cell divides a bud scar ring is formed at the
point of budding and separation. The bud scar can be stained with a fluorescent dye
calcofluor white MR2. A small fraction of old and young cells are stained with
calcofluor and the number of bud scars on 50 cells are recorded. This creates a histogram
of the number of cells vs. the number of budscars.
rDNA Recombination Assay
The rDNA recombination assay is designed to quantitate the level of recombination
at the rDNA locus. W303AR5 has an ADE2 gene within the rDNA locus. In the absence
of the ADE2 gene colonies become red in color, while wild type ADE2 are white. This
color phenotype allows the scoring of ade2 colonies to be very easy. Saturated liquid
cultures were prepared from five transformants. They were diluted and spread on 15 cm
selective SD agar plates containing 5 Clg/ml adenine hemisulfate and 5 Clg/ml histidine to
enhance red color production. They are allowed to grow at 30oC for 2-3 days. The
plates are then placed at 4oC for 1-2 days for the color to develop. The number of half
sector colonies, colonies that are half red half white, are scored in comparison to the
number of all white colonies. All other partially sectored or red colonies are ignored.
The reason only half sector colonies are scored is because half sectored colonies are
colonies that have lost the ADE2 marker on the first division in the colony formation. A
completely red colony may have become red at any time in growing in the liquid culture.
83
By looking at the first division to forming a colony, all of the data can be normalized to a
single mitotic event.
APPENDIX A
STRAIN: W303AR5+pJPAll3 MEDIA: SD aHLW
15 20 25 30 35 40 45 50 55 60
8 15 10 7 17 11 16 21 6 11
85 8 1120
20 7 6
18 10 17 14 6 15 21 16 20
8 12 16 15 9 18 10 22 24
?5 21
g ;16 8
18 21 13 19 93 8 10 24 10 6
Terminal morphology of senescent cells with its life span directly below the image.
APPENDIX B
STRAIN: W303AR5+pJPAll6 MEDIA: SD aHLW
15 20 26 30 35 40 45 50 55 60
6 21
12 28
31 24
30 21 27
7 20 33L 30
11 38
18 18
915 18 25
B 9s 5 32
22 32 25
10 34 29 29 28
32 12 29 27' 9
19 27 21 37 24
Terminal morphology of senescent cells with its life span directly below the image.
APPENDIX C
STRAIN: W303AR5+pJPAl38 MEDIA: SD aHLW
15 20 26 30 35 40 45 50 55 60
10 13 15 9
6 10 14 6
19 10
7 7 12 9 16
23 26
29 11 9
23 19
5 15 28
29 17 16; 5
31 11
12 12 24 15 23
Terminal morphology of senescent cells with its life span directly below the image.
APPENDIX D
STRAIN: yAF6 IVEDIA: SD aHLW
15 20 26 30 35 40 45 50 55 60
29
29 32 30 23 30 27 25 33 22
24 29 34 33 35 26 35 24 32 33
24 34 32 21 38 28
37 42 3r;
37 29 33 30 31 19
38 35 38 41
23 32 42
25 31 34 38 35 31 38 33 29
Terminal morphology of senescent cells with its life span directly below the image.
APPENDIX E
STRAIN: W303AR5+pJPAl33 MEDIA: SD aHWu
15 20 26 30 35 40 45 50 55 60
9 11 14 10
10i 7
12 12 5 17 10 5 10
Terminal morphology of senescent cells with its life span directly below the image.
|
| Full Text |
|
PAGE 1
BUILDING AN EPISOMAL MODEL OF AGING IN Saccharomyces cerevisiae By ALARIC ANTONIO FALCN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004
PAGE 2
Copyright 2004 by Alaric Antonio Falcn
PAGE 3
This document is dedicated to Peri A. Tong, Manuel A. Falcn, and Beverly L. Metcalfe for their unwavering support.
PAGE 4
iv ACKNOWLEDGMENTS I thank my mentor, John P. Aris, and my committee (William A. Dunn, Thomas C. Rowe, and Brian Burke) for helping me become a scientist.
PAGE 5
v TABLE OF CONTENTS Page ACKNOWLEDGMENTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iv LIST OF TABLES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viii LIST OF FIGURES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix ABSTRACT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi CHAPTER 1 BACKGROUND AND SIGNIFICANCE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Sir2p, rDNA, and Aging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Extrachromosomal rDNA Circles are Discovered . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Components of the rDNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Fob1p and its Role in ERC Production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 ARS of the rDNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Asymmetric Inheritance of ERCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 2 DEFINING THE LINK BETWEEN EPISOMES AND AGING . . . . . . . . . . . . . . . . 9 Roles of Different Cis-Acting Plasmid Sequences in Reduction of Yeast Replicative Life Span . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 Plasmid Inheritance Correlates with Reduction in Yeast Life Span . . . . . . . . . . . . 17 Plasmids Do Not Significantly Increase ERC Levels . . . . . . . . . . . . . . . . . . . . . . . 20 Plasmid Accumulation Correlates with Reduction in Life Span . . . . . . . . . . . . . . . 22 Terminal Cell Morphology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29 Do Functional rDNA Transcriptional Units Play a Role in Reduction in Life Span? 31 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33 3 TWO MICRON CIRCLE: A NATURALLY OCCURRING EPISOMES ROLE IN AGING . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35 New Method for Removal of Two Micron Circle . . . . . . . . . . . . . . . . . . . . . . . . . 36 Two Micron Circle Does Not Reduce Life Span . . . . . . . . . . . . . . . . . . . . . . . . . . 38 Two Micron Circle Does Not Accumulate in Old Cells . . . . . . . . . . . . . . . . . . . . . 39 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
PAGE 6
vi 4 A CELLS LIMITED RESOURCES AND PLASMID COMPETITION . . . . . . . . 42 Sml1p, Mec1p, RNR, and Rad53p Pathway . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42 SML1 Deletions Do Not Increase Life Span. . . . . . . . . . . . . . . . . . . . . . . . . . 43 Old Cells Do Not have an Increased Sensitivity to Hydroxyurea . . . . . . . . . . . 45 Double Strand Breaks Do Not Increase in Old Cells . . . . . . . . . . . . . . . . . . . . 48 Phosphorylation of Rad53p Does Not Increase in Old Cells . . . . . . . . . . . . . . 49 ERC Competition with a CEN Plasmid Throughout Yeast Life Span . . . . . . . . . . . 50 Mitotic Stabilities in the Presence of ERCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52 Plasmid Accumulation in sir2 and fob1 Strains . . . . . . . . . . . . . . . . . . . . . . . . . 55 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 5 CHROMATIN SILENCING AND EPISOME FORMATION . . . . . . . . . . . . . . . . 58 ACS2 and ACS1 is Required for Normal Life Span . . . . . . . . . . . . . . . . . . . . . . . . 59 ACS2 Increases ERC Production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62 6 LOOKING AT POSSIBLE MECHANISM OF CELLULAR AGING . . . . . . . . . . 64 YCA1 and Apoptosis in Yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64 Shu Gene Family and Mutation Suppression in Aging . . . . . . . . . . . . . . . . . . . . . . 65 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67 7 DISCUSSION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69 Why Do ARS Plasmids Accumulate in Mother Cells? . . . . . . . . . . . . . . . . . . . . . . 70 Why Do Budding Yeast Exhibit a Mother Cell Plasmid Segregation Bias? . . . . . . 71 Why Do ARS1 Plasmids Bring About Cellular Senescence More Rapidly than Do E R C s? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71 Do Cis -acting Sequences that Counteract Mother Cell Segregation Bias Suppress Reduction in Life Span by ARS1 Plasmids? . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72 Do 2 Micron Circles Reduce Life Span? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72 Why Do 2 Micron Origin Plasmids Reduce Life Span? . . . . . . . . . . . . . . . . . . . . . 72 Why Do 2 Micron Origin Plasmids Have an Intermediate Effect on Life Span? . . . 73 Why Does Transformation with pJPA114 Lead to 2 Micron Circle Loss? . . . . . . . 73 By What Mechanism(s) Do Plasmids, and by Implication E R C s, Reduce Life Span in Yeast? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74 Why Are There Less Plasmid Accumulation in Strains that Produce More ERCs? . 75 Is There Episomal Aging in Metazoans? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76 8 MATERIALS AND METHODS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77 Yeast Strains and Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77 Mitotic Stability . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Replicative Life Span Determinations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Southern Blot Analysis and Quantitation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
PAGE 7
vii Magnetic Cell Sorting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Budscar Histograms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82 rDNA Recombination Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82 APPENDIX A STRAIN: W303AR5+pJPA113 MEDIA: SD aHLW . . . . . . . . . . . . . . . . . . . . . . . 84 B STRAIN: W303AR5+pJPA116 MEDIA: SD aHLW . . . . . . . . . . . . . . . . . . . . . . . 85 C STRAIN: W303AR5+pJPA138 MEDIA: SD aHLW . . . . . . . . . . . . . . . . . . . . . . . 86 D STRAIN: yAF6 MEDIA: SD aHLW . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87 E STRAIN: W303AR5+pJPA133 MEDIA: SD aHWu . . . . . . . . . . . . . . . . . . . . . . . 88 F STRAIN: W303AR5+pJPA136 MEDIA: SD aHWu . . . . . . . . . . . . . . . . . . . . . . . 89 G STRAIN: W303AR5+pJPA148 MEDIA: SD aHWu . . . . . . . . . . . . . . . . . . . . . . . 90 H STRAIN: yAF5 MEDIA: SD aHWu . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91 I STRAIN: W303R5 +pAF32 MEDIA: YPD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92 J STRAIN: FOB1 +pAF32 MEDIA: YPD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93 K STRAIN: SIR2 +pAF32 MEDIA: YPD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94 L PLASMIDS USED . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 M STRAINS USED . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96 LIST OF REFERENCES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 BIOGRAPHICAL SKETCH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
PAGE 8
viii LIST OF TABLES Table page 2-1. Plasmids used in this study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 2-2. Life span data summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 6-1. P-values of the SHU deletion life spans. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67 L-1. The plasmids used throughout this dissertation. . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 M-1. The strains used throughout this dissertation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96
PAGE 9
ix LIST OF FIGURES Figure page 1-1. The pseudoERC strategy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 1-2. The rDNA repeat . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 1-3. Fob1 mediated expansion of the rDNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 1-4. ERC Formation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 2-1. Life span analysis of plasmid-transformed yeast . . . . . . . . . . . . . . . . . . . . . . . . . 15 2-2. Plasmid inheritance studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 2-3. Extrachromosomal rDNA circle ( E R C ) formation in yeast transformants . . . . . . 22 2-4. Plasmid DNA and extrachromosomal rDNA circle ( E R C ) levels in young and old cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24 2-5. Plasmid DNA and extrachromosomal rDNA circle ( E R C ) levels in young and old cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 2-6. Terminal morphology of senescent cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30 2-7. Life span analysis of yeast transformed with plasmids containing rDNA repeats. 32 3-1. Southern blot analysis of pJPA114 transformants . . . . . . . . . . . . . . . . . . . . . . . . 37 3-2. Life span analysis of cir + and cir 0 yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39 3-3. Two micron plasmid levels in young and old cells . . . . . . . . . . . . . . . . . . . . . . . . 40 4-1. Mec1p, Rad53p, Sml1p, and RNR pathway (94). . . . . . . . . . . . . . . . . . . . . . . . . 43 4-2. Life span of SML1 deletions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44 4-3. Hydroxyurea sensitivity of young and old cells from 0 mM to 200 mM . . . . . . . 46 4-4. Hydroxyurea sensitivity of young and old cells from 0 mM to 50 mM. . . . . . . . . 47
PAGE 10
x 4-5. Southern of DSB in yAF6 (WT), W1488-4C (WT), sml1 mec1 sml1 and rad53 sml1 .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49 4-6. Rad53p phosphorylation in young and old cells . . . . . . . . . . . . . . . . . . . . . . . . . . 50 4-7. Life span of W303R5 (WT), sir2 and fob1 during the CEN loss experiment. . 51 4-8. The age which WT, sir2 and fob1 lose plasmid . . . . . . . . . . . . . . . . . . . . . . . 52 4-9. Mitotic stabilities of pAF31 and pAF32 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53 4-10. Mitotic stabilities of pJPA133 and pJPA136. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54 4-11. Southern of showing plasmid competition phenomenon.. . . . . . . . . . . . . . . . . . . 55 4-12. Quantitation of plasmid competition Southern . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 5-1. The acetylation of histones and its affect on ERC production and life span. . . . . . 59 5-2. Life span of ACS deletions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60 5-3. Sorts of young and old ACS deletion strains . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62 6-1. Life span of yca1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65 6-2. SHU genes role in life span.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
PAGE 11
xi Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BUILDING AN EPISOMAL MODEL OF AGING IN Saccharomyces cerevisiae By Alaric Antonio Falcn May, 2004 Chair: John P. Aris Major Department: Anatomy and Cell Biology Aging in Saccharomyces cerevisiae is under the control of multiple pathways. The production and accumulation of extrachromosomal rDNA circles ( E R C s) is one pathway that has been proposed to bring about aging in yeast. To test this proposal, we developed a plasmid-based model system to study the role of DNA episomes in reduction of yeast life span. Recombinant plasmids containing different replication origins, cis -acting partitioning elements, and selectable marker genes were constructed and analyzed for their effects on yeast replicative life span. Plasmids containing the ARS1 replication origin reduce life span to the greatest extent of the plasmids analyzed. This reduction in life span is partially suppressed by a CEN4 centromeric element on ARS1 plasmids. Plasmids containing a replication origin from the endogenous yeast 2 micron circle also reduce life span, but to a lesser extent than ARS1 plasmids. Consistent with this, ARS1 and 2 micron origin plasmids accumulate in ~7-generation-old cells, but ARS1/CEN4 plasmids do not. Importantly, ARS1 plasmids accumulate to higher levels in old cells than 2 micron origin plasmids, suggesting a correlation between plasmid accumulation
PAGE 12
xii and life span reduction. Reduction in life span is not an indirect effect of increased E R C levels, nor the result of stochastic cessation of growth. The presence of a fully functional 9.1 kb rDNA repeat on plasmids is not required for, and does not augment, reduction in life span. These findings support the view that accumulation of DNA episomes, including E R C s, cause cell senescence in yeast. The endogenous 2 micron circle is a naturally occurring episomal DNA. Loss of the 2 micron circle can be facilitated with the transformation of an ARS containing plasmid. Since 2 micron circles are episomes, and episomes can cause aging, experiments were complete to show that it does not accumulate in old cells and does not cause aging. In strains that contain more ERCs, ARS plasmids do not accumulate as much. There is an episomal competition phenomenon. While it is not known what the episomes are competing for, it can be demonstrated that as the number of different episomes increase the rate of accumulation for each episome decreases.
PAGE 13
1 CHAPTER 1 BACKGROUND AND SIGNIFICANCE Saccharomyces cerevisiae is a single-ce lled, budding yeast. During mitosis, budding yeast divide asymmetrically. This is different from fission yeast where the two cells produced by mitosis are indistinguishable. With budding yeast, the new smaller cell (the daughter cell) emerges from the older, larger cell (the mother cell) (1-4). Because the mother cell can be distinguished from its daughters, a mother can be followed throughout all of its divisions. As mothers age, they become enlarged, their cell cycle slows, and they become sterile (2,5). Daughters can be physically separated from their mothers with a microdisection microscope. Physical separation is necessary, because it is difficult to follow a mother cell through all of its divisions if it is obscured by daughter cells and daughters of daughter cells. By removing the daughters from mothers, and simultaneously tallying the number of divisions a mother completes, the cells replicative life span can be determined. The replicative life span is defined as the number of divisions a mother cell completes (6). With the ability to conduct replicative life span experiments and the ease of genetic manipulation, Saccharomyces cerevisia e is an excellent model organism for aging studies. Sir2p, rDNA, and Aging Long and short lived aging mutants have been isolated in Saccharomyces cerevisiae (7-10). One of the first such mutants identified was SIR4-42 a long lived mutant that resulted in the localization of the SIR complex to the nucleolus (3,8). The silent information regulator (SIR) complex is involved in the silencing of chromatin at
PAGE 14
2 the telomeres, mating type loci, and rDNA (2,11,12). The rDNA serves as a nucleolar organizing region in eukaryotic cells, and is the site of transcription of pre-rRNA (11). In addition to the findings that implicated the rDNA in life span, the nucleolus was found to be enlarged and fragmented in old yeast cells (2,3). This was consistent with the notion that the rDNA played a role in life span determination. More recently, the silencing protein Sir2p was found to be a nucleolar protein specifically involved in silencing at the rDNA locus (3). Loss of function sir2 mutations reduce life span (3,12), whereas SIR2 overexpression extends life span (13). Sir2p is now known to function as a histone deactylase that plays a central role in modulating chromatin structure (13,14). It has been tied to the extension of life span in metazoan organisms (15) as well as being linked to the caloric restriction model of aging (16). Extrachromosomal rDNA Circles are Discovered Based on SIR4-42 and other findings, Sinclair and Guarente in 1997 showed that old mother cells accumulated extrachromosomal rDNA circles (ERCs). This was proven by the use of 2D chloroquine gels and by Southern blots for rDNA. 2D chloroquine gels are used to look for closed circular DNA molecules (17-19). Old cell undigested DNA on 2D chloroquine gels showed rDNA episomes. The old cells had rDNA episomes and young cells did not (20) To test the role of ERCs in yeast mother cell aging, replicative life spans were conducted on cells that had been given pseudoERCs. PseudoERCs are induced by using a plasmid with a partial rDNA repeat flanked by loxP sites and a plasmid with Cre recombinase under the control of the galactose promoter. On adding galactose, the galactose promoter allows the expression of Cre recombinase (21). Cre recombinase then recombines the sequence between the loxP sites out of the plasmid (22). This creates the pseudoERC, a partial rDNA repeat with a selectable marker and no
PAGE 15
3 extraneous segregation or replication mechanisms (Figure 1-1). These pseudoERCs cause an earlier onset of senescence (20). More specifically, the cell that had the induction of pseudoERCs had a lower replicative life span (20). This suggested that ERCs are a cause of aging, and are not produced as an effect of aging. This experiment is the central proof of the ERC mediated aging model. The finding that ERCs could cause aging was a completely novel aging mechanism. Figure 1-1. The pseudoERC strategy. Activation of the GAL1 promoter by galactose produces Cre recombinase. Cre mediates recombination at the loxP sites resulting in the excision of the ARS CEN and the creation of a pseudoERC (20). Components of the rDNA The ribosomal DNA (rDNA) is present on chromosome XII in a single linear array of between 100 and 200 head-to-tail repeats (2,3,11,23). Each 9.1 kb rDNA repeat is responsible for producing the 5S and 35S pre-rRNA (Figure 1-2) (7,24) These RNAs are later processed and packaged with proteins to form a ribosome (24,25). One half of rDNA repeats are usually silent and not actively transcribing the rRNA (11,26). This excess capacity is to ensure that the vital function of protein synthesis will not be hindered by the lack of rRNA.
PAGE 16
4 Figure 1-2. The rDNA repeat. 5S and 35S pre-rRNA are both transcribed in the rDNA. The 35S is later processed into 18S, 5.8S, and 25S rRNA. Within the NTSs are the RFB and ARS-rD (both have been shown to be essential for ERC formation and replication, respectively). Fob1p and its Role in ERC Production The protein Fob1p is required for the replication fork block (RFB) in the nontranscribed spacer 1 (NTS1) (23,27) It is implicated in the formation of ERCs (7). The RFB blocks one of the replication forks within the replication bubble (23). This makes replication unidirectional, in the direction of 35S pre-rRNA transcription (23) The RFB has been observed in yeast, frog, mouse, human, and plant (28-32). The ultimate function of the RFB site in yeast is to allow the cell to expand and contract the number of repeats in the rDNA array by homologous recombination (23) (Figure 1-3). Because recombination is initiated at a DNA double stranded break (DSB), a crossover may occur within a sister chromatid by the formation of a Holliday structure (23). Conversely, recombination can occur upstream, resulting in the loss of a repeat (23). An apparently unintended consequence of RFB function is the increased production of ERCs (Figure 1-4) (7) Holliday structures within the rDNA occur 3.6 times per cell cycle (33), indicating rampant recombination at the locus. In FOB1 deleted strains, there is reduced recombination at the rDNA locus, because there is no RFB at the RFB site (34). This
PAGE 17
5 reflects fob1 s reduced formation of ERCs and longer life span (7). This further implicates ERCs in the aging process. Figure 1-3. Fob1 mediated expansion of the rDNA. (A) Fob1p acts at each RFB site in rDNA. (B) Replication begins at ARS-rD and two replication forks travel in opposite directions. (C) The replication fork traveling in the opposite direction of 35S transcription is stopped at RFB site. The other replication fork continues. A double stranded break can occur at the RFB site. (D) A Holliday structure forms and homologous recombination with the sister chromatid can repair the break. (E) The closest replication bubble catches up to the recombination site creating two separate strands of DNA, one of which has an additional repeat.
PAGE 18
6 Figure 1-4. ERC Formation (A) An ERC can be formed by homologous recombination and the looping out a circular DNA. (B) They can also be formed by recombination of the free end of DNA, the product of Fob1p RFB (27). ARS of the rDNA Within every rDNA repeat, there is an autonomously replicating sequence (ARS) or origin of replication (35,36) ARSs are AT rich sequences of DNA, to which the origin recognition complex (ORC) binds (37,38). The ORC complex of proteins is essential for the initiation of DNA replication (37,38). The ARS-rDs (rDNAs ARS) biological function is as a site for the initiation of DNA replication within the rDNA repeat. It is necessary because the repeat locus consists of one to two hundred headtotail 9.1 kb repeats (approximately 1,500 kb in length) (39). Normally, ARSs are spaced approximately 40 kb apart throughout the yeast genome (37,39,40). By putting an ARS in every repeat, replication of the genome through this lengthy region can occur more efficiently than with an ARS at either end of the locus (39). The ARS will also allow episomal rDNA, such as ERCs, to replicate (20,35) The ARS-rD is considered a weak ARS. That is, any given ARS-rD fires less than once per cell cycle (35,36,39) Because ARS-rD occurs once in every repeat, every third ARS can fire and still replicate the locus effectively. The distance between firing ARSs is approximately 30 kb. The
PAGE 19
7 activity of the ARS-rD has been linked to transcriptionally active 35S genes (which were in turn linked to nonsilent euchromatic regions of the locus) (41,42). Asymmetric Inheritance of ERCs A phenomenon associated with ERCs is their asymmetric segregation. There is a natural tendency for the ERCs and ARS plasmids to stay within the mother cell during cell division (2,3,43) This was demonstrated by pedigree analysis, a technique that follows the segregation of a non-Mendelian trait through mitosis (20). Mother cells have a bias to retain the plasmids and not pass them on to their daughters (43) Although this phenomenon was discovered in 1983, little is known about the mechanism that retains the plasmids in the mother cells. With ERCs being excised from the genome, replicated by their endogenous ARS, and segregated preferentially to the mother; there is a massive accumulation of the episomes in older cells. This is the model of ERC mediated aging (20). Although the amount of ERCs in very old cells is not known, the number estimated to be in cells after 15 generations is 500 to 1000 ERCs (20). This accumulation is thought to be behind the mechanism of ERC mediated aging (20). Summary A major tenet of the ERC mediated model for replicative aging in Saccharomyces cerevisiae is that ERCs are nothing more than episomal DNA molecules with an ARS (20). Evidence for this comes from the observation that a yeast shuttle vector, containing only an ARS, reduced replicative life span (compared to a control plasmid containing an ARS and a centromeric (CEN) element) (20). CEN plasmids are maintained at low copy number and segregate with high fidelity to daughter cells just like chromosomes (44) ARS plasmids attain a high copy number and show a bias toward retention in mother cells during mitosis (similar to ERCs) (43) The fact that the ARS plasmid can shorten
PAGE 20
8 yeast mother cell life span suggests that the rDNA sequence per se does not contribute to ERC mediated aging, and that potentially any extrachromosomal DNA able to replicate may reduce life span (20).
PAGE 21
9 CHAPTER 2 DEFINING THE LINK BETWEEN EPISOMES AND AGING The yeast Saccharomyces cerevisiae has proved to be a valuable model organism for investigating mechanisms of cellular aging (45-47). Central to the biology of aging in S. cerevisiae is an asymmetric cell division process that gives rise to mother and daughter cells with different characteristics. Mother cells have a limited capacity to produce daughter cells, and the decline in this capacity with each generation is referred to as replicative aging. The limited replicative potential of yeast mother cells has been recognized since the 1950s (48). Pioneering studies in the Jazwinski and Guarente laboratories postulated the existence of a senescence factor/substance that accumulates in mother cells and is transmissible to daughters (49,50). Work in the Guarente lab identified a heritable "age" locus that regulates yeast life span (51). More recent studies have made clear that allelic variation at single genetic loci can markedly affect yeast life span, including extension of life span. This indicates that a process as complex as cellular aging is controlled by a hierarchical regulatory system. Like in other model organisms, such as D. melanogaster and C. elegans mutations that influence yeast life span have been found to exert their effects through different physiological and genetic pathways, including those that participate in caloric restriction, gene silencing, genomic stability, growth regulation, mitochondrial function, and stress response (45-47,52,53). Replicative aging is undoubtedly a complex process, even in a eukaryote as simple as S. cerevisiae Different hypotheses have been proposed to explain yeast replicative aging. One hypothesis proposed by Sinclair and Guarente (54) posits that
PAGE 22
10 replicative aging is caused by progressive accumulation of extrachromosomal rDNA circles ( E R C s) in yeast mother cells. According to this model, E R C s are produced stochastically by intrachromosomal homologous recombination at the rDNA locus and are inherited asymmetrically by mother cells, which leads to E R C accumulation and replicative senescence. The rDNA locus in S. cerevisiae consists of a tandem array of ~150, 9.1 kb direct repeats, each of which encodes the four rRNAs (18S, 5.8S, 25S, and 5S) in precursor form. Many aspects of the E R C model have been supported experimentally. Numerous studies support the view that E R C s are produced by homologous recombination, are self-replicating, are inherited asymmetrically, and accumulate in mother cells (45,54,55). More controversial is the role E R C s play in the aging process. Are E R C s mediators or markers of yeast aging? Certain findings link E R C production with regulation of life span and support a mediator role for E R C s. One of the first life span extending mutations characterized in yeast ( SIR4-42 ) was found to redirect silent information regulator (Sir) protein complexes to the rDNA locus and limit recombination (51,56). Expression of SIR2 which encodes a nucleolar NAD-dependent histone deacetylase, correlates with longevity. Sir2p binds to rDNA and suppresses rDNA recombination and E R C production (57-59). Deletion of SIR2 shortens life span, whereas overexpression of SIR2 extends life span (60). FOB1 encodes a nucleolar fork blocking protein that binds to the replication fork barrier (RFB) site in rDNA and in so doing halts DNA replication in the direction opposite of pre-35S rRNA transcription (6163). The RFB site and the overlapping HOT1 site promote rDNA recombination (63,64). Mutations in (or deletion of) FOB1 reduce rDNA recombination, lower E R C levels, and
PAGE 23
11 extend life span (65). Recombination of replication forks stalled at RFB sites is suppressed by Sir2p (66) which partly explains the role of Sir2-dependent silencing in extending life span. Also, introduction of a plasmid carrying a stretch of rDNA, as an artificial E R C was shown to reduce life span (54). On the other hand, E R C s have been interpreted as a marker of aging that are a consequence, not a cause, of aging. Mutations that impair DNA replication, recombination, or repair have been observed to reduce life span without concomitant accumulation of E R C s (67-69). However, reduction in life span may be the result of the combined effects of age-dependent and age-independent processes at work in certain mutants. The hrm1 mutants, which affect rDNA recombination, age prematurely due to a combination of the normal aging process and a G 2 -like cell cycle arrest (69) Similarly, sgs1 mutants exhibit a shortened life span because of the combined effects of the normal aging process and cell cycle arrest due to defective recombination (70). Some petite mutants have been shown to have elevated E R C levels (71), but extended life spans (72). However, to our knowledge, both elevated E R C levels and extended life span in petite mutants have not been demonstrated side-by-side in the same strain. A sir2 mutant with an extended life span was reported to have normal E R C levels (73). More generally, the effects of SIR2 on life span have been attributed to altered patterns of gene expression, including altered transcription of rDNA, which may lead to an imbalance in ribosome synthesis (74,75). Thus, although there is agreement that the rDNA locus plays a key role in the yeast aging process, the precise role of extrachromosomal DNAs remains controversial.
PAGE 24
12 To shed light on this controversy, we have developed a plasmid-based model system to investigate the role of episomal DNAs in reduction of yeast life span. Here we present the first comprehensive test of the E R C model of yeast aging proposed by Sinclair and Guarente (54) We constructed three types of recombinant plasmid for this purpose: ARS plasmids, ARS/CEN plasmids, and 2 origin plasmids. ARS plasmids are most like E R C s in that they are circular DNA molecules with a replication origin but lack a cis -acting partitioning sequence. Classic pedigree analysis studies by Murray and Szostak showed that ARS plasmids exhibit a strong bias to be retained in mother cells during mitosis (43). Thus, ARS plasmids are predicted to accumulate in mother cells like E R C s, but this has not yet been demonstrated. ARS/CEN plasmids contain a centromeric DNA region that acts in cis to attach plasmid DNA to the mitotic spindle and ensure efficient delivery to daughter cells during mitosis. ARS/CEN plasmids should not accumulate in mother cells. 2 origin plasmids typically contain a DNA replication origin, a cis -acting REP3/STB element, and one copy of an inverted repeat that regulates plasmid copy number (~20 to 40 copies/cell) (76). The REP3/STB element actively partitions plasmid DNA to daughter cells during mitosis in cir + yeast strains (i.e., in strains that contain the endogenous 2 circle DNA plasmid that encodes proteins that interact in trans with REP3/STB ) (76). 2 origin plasmids are not predicted to accumulate in mother cells, although the 2 plasmid partitioning machinery is not predicted to exhibit the fidelity of a centromere-based partitioning machinery. We also constructed a series of plasmids containing functional rDNA repeat units, and tested their effects on life span. This represents a significant improvement over a previously reported
PAGE 25
13 experiment (54) which employed a non-functional stretch of rDNA (i.e., rDNA incapable of being transcribed to yield full-length 35S pre-rRNA). Roles of Different Cis-Acting Plasmid Sequences in Reduction of Yeast Replicative Life Span To study the effects of plasmids on yeast replicative life span, we generated two series of plasmids based on commonly-used integrating vectorspRS306 and pRS305 (77). In each plasmid, we inserted ARS1 or ARS1 and CEN4 or the 2 circle origin (see Materials and Methods). ARS1 (autonomous replicating sequence 1) is a nuclear genomic DNA replication origin whose function and domain organization have been studied in detail (78). Centromeric DNA from chromosome IV ( CEN4 ) has been mapped and functionally dissected (79). The region of the 2 circle plasmid extending from Table 2-1. Plasmids used in this study. Plasmid Origin, Insert Marker Backbone pJPA105 2 rDNA repeat (XmaI endpoints) TRP1 pAF15 pJPA106 2 rDNA repeat (AhdI endpoints) TRP1 pAF15 pJPA107 2 rDNA repeat (PsiI endpoints) TRP1 pAF15 pJPA113 ARS1 URA3 pRS306 (77) pJPA114 rDNA ARS URA3 pRS306 pJPA116 ARS1 CEN4 URA3 pRS306 pJPA117 rDNA ARS, CEN4 URA3 pRS306 pJPA138 2 URA3 pRS306 pJPA133 ARS1 LEU2 pRS305 (77) pJPA136 ARS1 CEN4 LEU2 pRS305 pJPA148 2 LEU2 pRS305 REP3 through the adjacent 599 bp 2 repeat functions as a replication origin as well as a cis -acting plasmid partitioning element (76,80). The plasmids used in this study are summarized in Table 2-1.
PAGE 26
14 To evaluate effects on life span, plasmids were transformed into strain W303AR5 (54). For each plasmid, six independently-isolated transformants were analyzed in parallel, and each life span curve reflects their collective behavior. Selection for the plasmid was maintained during life span analysis. Virgin mother cells unable to give rise to 5 daughters were discarded to exclude contributions from mother cells without plasmid. To identify mother cells that stopped dividing due to plasmid loss, rather than senescence, cells that had not divided in 2 days were transferred to nonselective medium and monitored for cell division and colony formation. A low percentage (<10%) of mother cells were found to give rise to colonies, and were excluded from the life span data set. Life span plates were incubated during the daytime at 30C, but placed overnight (~12 hours) at 14C, which gave a slightly, but significantly (p<0.01) longer life span than observed on plates stored overnight at 4C (Figure 2-1A). Interestingly, transformants harboring pJPA113 ( ARS1 ) showed dramatic reductions in both average and maximum life span compared to the Ura + control strain yAF6 (Figure 2-1B). yAF6 differs from pJPA113 transformants only in terms of plasmid DNA topology (i.e., integrated in yAF6 and episomal in transformants). Transformants containing pJPA116 ( ARS1, CEN4 ) have a reduced average life span compared to yAF6, but exhibit a maximum life span similar to yAF6 (Figure 2-1B). Thus, addition of a CEN4 element to an ARS1 plasmid suppresses reduction in maximum life span, but does not completely compensate for, or protect against, effects on average life span. Plasmids containing the 2 circle origin of replication were also constructed and analyzed. Yeast cells harboring pJPA138 (2 ori) show a reduction in both average and maximum life
PAGE 27
15 span (Figure 2-1B). Generally speaking, the extent of reduction in average and maximum life span in pJPA138 (2 ori) transformants is intermediate between that Figure 2-1. Life span analysis of plasmid-transformed yeast. Number of daughter cells (generations) produced per mother cell are plotted as a function of mother cell viability. A) Life span curves of strain W303AR5 (54) grown on SD (synthetic dextrose) and S+D (dextrose added after autoclaving) media at 30C during the daytime and stored overnight (~12 hours) at 4C or 14C. The number (n) of mother cells analyzed per curve is as follows: SD 4C, n=60; SD 14C, n=59; S+D 14C, n=60. B) Life span curves of W303AR5 transformed with plasmids pJPA113 ( ARS1 ), pJPA116 ( ARS1, CEN4 ), or pJPA138 (2 ori), and control strain yAF6 ( URA3 ) (n=55, 47, 57, and 58, respectively). C) Life span curves of W303AR5 transformed with plasmids pJPA133 ( ARS1 ), pJPA136 ( ARS1, CEN4 ), pJPA148 (2 ori), and control strain yAF5 ( LEU2 ) (n=38, 33, 41, and 59, respectively). D) Life span curves of W303AR5 transformed with pJPA116 ( ARS1 CEN4 ) determined on SD and YPD (n=45 and 49, respectively). Life spans of control strains yAF6 and W303AR5 were determined on YPD (n=50 and 55, respectively). Plasmids are described in Table 2-1. observed in pJPA113 ( ARS1 ) and pJPA116 ( ARS1, CEN4 ) transformants (Figure 2-1B). The results from multiple life span experiments are summarized in Table 2-2.
PAGE 28
16 Table 2-2. Life span data summary. Plasmid/Strain Mean Life Span Maximum Life Span n* pJPA113 12.4 1.8 21.8 2.2 4 pJPA116 23 1.4 39 2.7 4 pJPA138 16.3 1.8 31.3 0.6 3 yAF6 33.2 3.0 42 1 3 The results reported above were obtained with plasmids carrying a URA3 selectable marker. To eliminate the possibility that effects of plasmids on life span were due to URA3 or medium lacking uracil, we constructed plasmids with a LEU2 selectable marker (Table 2-1), and conducted life span experiments on medium lacking leucine. The results obtained with the LEU2 plasmid series were very similar to results obtained with the URA3 plasmid series (Figure 2-1C). pJPA133 ( ARS1 ) caused dramatic reductions in average (9.9 generations) and maximum (17 generations) life spans compared to the Leu + control strain yAF5. yAF5 yielded an average (30.3 generations) and a maximum (44 generations) life span very similar to the average and maximum lifespan for yAF6 (Table 2-2). Transformants containing pJPA136 ( ARS1, CEN4 ) yielded a maximum life span of 38 generations, but an average life span of 24 generations, similar to what was observed for the URA3 plasmid pJPA116 ( ARS1, CEN4 ). Plasmid pJPA148 (2 ori) reduced the average (15.5 generations) and maximum (31 generations) life span to an extent intermediate between pJPA133 ( ARS1 ) and pJPA136 ( ARS1, CEN4 ) (Figure 2-1C), similar to what was observed with the URA3 plasmid pJPA138 (2 ori) (Figure 2-1B). The reduction in average life span by ARS1 CEN4 plasmids pJPA116 and pJPA136 was unexpected. A similar plasmid had previously been reported to have no effect on life span when grown on YPD medium (54) One possible explanation for this
PAGE 29
17 difference was that ARS1 CEN4 plasmids are occasionally lost from mother cells, causing them to cease division on selective medium prior to senescence, which would result in a reduction in average life span. To test this, ARS1 CEN4 plasmid transformants were analyzed on non-selective YPD medium as done previously (54). On YPD, transformants carrying pJPA116 ( ARS1 CEN4 ) were as long-lived as control strains yAF6 ( URA3 ) and W303AR5 (Figure 2-1D). pJPA116 transformants analyzed in parallel on selective SD medium showed a reduction in average life span (Figure 2-1D), as expected. These findings support the interpretation that ARS1 CEN4 plasmids, which are present at near-unit copy number in transformants (see below), are occasionally lost from mother cells, rendering them unable to divide at a point in their life span prior to normal senescence. We have also examined the effects of two well-known plasmids that carry the TRP1 selectable marker. pTV3 carries the 2 origin whereas pRS314 carries ARSH4 and CEN6 (77,80). Life spans of transformants containing each plasmid were analyzed on medium lacking tryptophan. pTV3 transformants had an average life span of 18.7 and a maximum life span of 32, both values of which are in good agreement with corresponding values for the 2 origin plasmids pJPA138 and pJPA148 (Figure 2-1 and Table 2-2). pRS314 had average and maximum life spans of 21 and 41, respectively, which are in good agreement with values obtained with the ARS1/CEN4 plasmids pJPA116 and pJPA136 (Figure 2-1 and Table 2-2). These data allow us to exclude a specific role for ARS1 and CEN4 in life span reductions presented above (Figure 2-1). Plasmid Inheritance Correlates with Reduction in Yeast Life Span The plasmids used in this study were constructed to explore relationships between plasmid inheritance and effects on life span. Mitotic stability and plasmid copy number
PAGE 30
18 are widely-used measures of plasmid DNA inheritance. Mitotic stability is defined as the proportion of a population of cells grown under selection that contains plasmid. We determined the mitotic stability and plasmid copy number of the plasmids used in life span experiments. Included in our studies were plasmids containing the rDNA ARS. rDNA repeats contain a single, relatively weak ARS (81) pJPA114 and pJPA117 contain the rDNA ARS at the same position as ARS1 in pJPA113 and pJPA116, respectively (see Table 2-1 and Materials and Methods). Plasmid pJPA113 ( ARS1 ) was found to have a mitotic stability of approximately 20% (Figure 2-2A), which is typical of yeast replicating plasmids containing ARS1 which exhibit a mother cell partitioning bias (43) pJPA116 ( ARS1, CEN4 ) exhibited a much higher mitotic stability, ~90%, which is consistent with the presence of CEN4 centromeric DNA, and agrees with the mitotic stability of pRS316 ( ARSH4, CEN6 ) (Figure 2-2A). pJPA138 (2 ori) showed a high degree of mitotic stability, ~90% (Figure 2-2A). The 2 origin plasmid pRS424 had a somewhat lower mitotic stability by comparison (Figure 2-2A). pJPA114 (rDNA ARS) has a very low mitotic stability, <1% (Figure 2-2A). The presence of CEN4 with the rDNA ARS in pJPA117 improves mitotic stability to ~35% (Figure 2-2A). These results with pJPA114 and pJPA117 are consistent with the low efficiency of the rDNA ARS (81) Not surprisingly, it was impractical for us to carry out life span analyses of transformants containing pJPA114.
PAGE 31
19 Figure 2-2. Plasmid inheritance studies. Plasmids are denoted by cis -acting element(s). See Table 1 for plasmid descriptions. pRS316 ( ARSH4, CEN6 (77)) and pRS424 (2 ori, TRP1 (82)) are included for comparison purposes. A) Mitotic stability determinations. Mitotic stability is defined as the percentage of colony forming units in a culture grown under selective conditions that contains plasmid-borne selectable marker. Side-by-side bars are determinations from separate experiments. Average and standard deviation values are plotted. B) Plasmid copy number in toto for cell population. Average and standard deviation values from Southern blots of genomic DNA digested with BamHI (filled bars) and PstI (open bars) are shown. C) Plasmid copy number on a per cell basis. Values were calculated by dividing copy number values from panel B by mitotic stability values from panel A (average of both experiments). The variances in copy number values were determined, assuming a log normal distribution of values. Variances for all values were near 1.0, with the exception of rDNA ARS plasmid copy number, which had a variance of 3.0, which is indicative of a higher level of error in this measurement. Plasmid copy number was determined using Southern blot analysis. Copy number was displayed either as the total number of plasmids compared to the total number of genomes (copy number in the population, Figure 2-2B) or the total number of plasmid compared to the fraction cells (genomes) that contain a copy of the plasmid (copy number per cell, Figure 2-2C) by using a plasmids mitotic stability. Copy number determinations using two different restriction enzymes gave comparable results (Figure 2-2B). pJPA113 ( ARS1 ) exhibited the highest plasmid copy number (Figure 2-2C). Plasmids pJPA116 ( ARS1, CEN4 ) and pJPA117 (rDNA ARS, CEN4 ) exhibited near-unit copy number
PAGE 32
20 values (Figure 2-2C), which is typical of centromeric plasmids (79) such as pRS316 ( ARSH4, CEN6 ) (77) pJPA138 (2 ori) exhibited a copy number of ~33 (Figure 2-2C), which is in the range of copy number values reported for other 2 origin plasmid vectors (80). The high copy number of pJPA113 is primarily due to the asymmetric inheritance of this plasmid and its accumulation in mother cells, rather than ARS strength per se We reach this conclusion because pJPA114, which contains a weak (rDNA ARS) replication origin, achieves a copy number almost as great as pJPA113, which contains a strong ( ARS1 ) replication origin (Figure 2-2C). Thus, pJPA113 demonstrates a correlation between extent of reduction of transformant life span (Figure 2-1B) and tendency to be inherited asymmetrically and attain a high copy in yeast cells (Figure 2-2C). Plasmids Do Not Significantly Increase ERC Levels The results presented above suggest that reduction in life span by the ARS1 plasmid pJPA113 is due to asymmetric inheritance and accumulation in mother cells. An alternative explanation is that pJPA113 increases E R C levels in transformed cells, and thereby reduces life span indirectly. To address this possibility, we measured recombination at the rDNA locus using an ADE2 marker loss assay and measured E R C levels in transformed cells by Southern blotting. To analyze the frequency of recombination at the rDNA locus, we took advantage of the fact that W303AR5 contains ADE2 integrated at the rDNA locus (54). Recombination between flanking rDNA repeats results in loss of ADE2 and a change in colony color. The frequency of half-red sectored colonies is a measure of rDNA recombination rate (events per cell division). Transformation of yeast with plasmid results in a small increase in rDNA recombination as measured by ADE2 marker loss. For W303AR5, we find that ADE2 marker loss occurs at a frequency of ~1.3 per
PAGE 33
21 thousand cell doublings (Figure 2--3A), which is in good agreement with frequencies reported by others (60,68,69) The rate of ADE2 marker loss from yAF6 ( URA3 ) occurs at ~2.7 per thousand (Figure 2-3A). Transformants containing the three plasmids used in this study, pJPA113 ( ARS1 ), pJPA116 ( ARS1, CEN4 ), and pJPA138 (2 ori), exhibited marker loss rates of 4.1, 4.5, and 4.1 per thousand cell doublings, respectively. The differences between transformants and yAF6 represent increases of less than 2-fold. Higher levels of ADE2 marker loss are typically observed in strains with reduced life spans. For example, short-lived sir2 mutants exhibit ADE2 marker loss rates >10-fold higher than isogenic SIR2 strains (60). To directly compare E R C levels, yeast transformants and control strains were analyzed by Southern blotting, and E R C monomer bands were quantitated (see Materials and Methods). E R C monomers consist of a single 9.1 kb rDNA repeat and were chosen for purposes of quantitation because they are well-resolved from chromosomal rDNA and other E R C bands on Southern blots. E R C monomer levels in transformants were not significantly different than E R C monomer levels in control strains. Control strains W303AR5 and yAF6 ( URA3 ) have approximately 0.0007 and 0.0015 E R C monomers per total chromosomal rDNA, respectively (Figure 2-3B). Transformants bearing pJPA113 ( ARS1 ), pJPA116 ( ARS1, CEN4 ), and pJPA138 (2 ori) have E R C monomers levels of 0.0014, 0.001, and 0.001, respectively (Figure 2-3B). These values are within the error of measurements and are not significantly different (Figure 2-3). For comparison, we examined yAF5 ( LEU2 ), which contains a copy of pRS305 integrated at the leu2-113 locus, and found that the E R C monomer level was 0.001, which is intermediate between W303AR5 and yAF6 (Figure 2-3B). Quantitation of slower
PAGE 34
22 migrating E R C multimer bands did not reveal significant differences in levels between transformant and control strains (data not shown). We conclude that plasmids do not have a significant effect on E R C levels. Figure 2-3. Extrachromosomal rDNA circle ( E R C ) formation in yeast transformants. Plasmids are denoted by cis -acting element(s). See Table 2-1 for plasmid descriptions. Control strains W303AR5 ( W303 ), yAF5 ( LEU2 ), and yAF6 ( URA3 ) did not contain plasmid. A) ADE2 marker loss assay. The number of half-red sectored colonies on minimal selective medium per total colony number defines the per (first) cell division rate of loss of the ADE2 marker from the rDNA repeat in W303AR5. Total number (n) of colonies scored is shown. B) E R C monomer levels. Southern blotting analyses of DNA from transformed and control strains grown on selective media were done to quantify chromosomal rDNA and E R C monomer band levels (see Materials and Methods). E R C monomer band intensity was divided by chromosomal rDNA band intensity to give a normalized E R C monomer/chromosomal rDNA ratio. Average and standard deviation values are plotted. Plasmid Accumulation Correlates with Reduction in Life Span If plasmids reduce life span in a manner analogous to E R C s, then plasmid DNAs should accumulate in old mother cells. To test this prediction, we used a biotinylation and magnetic sorting approach to isolate ~7-generation old yeast cells (see Materials and Methods). Plasmid DNA levels in young and old cells were measured by quantitative Southern blotting. The ages of old and young (unsorted) cells were determined by counting bud scars stained with Calcofluor (83) From single sort experiments, the average ages of
PAGE 35
23 yeast transformed with pJPA113, pJPA116, pJPA138, and yAF6 were 6.9, 7.0, 6.1, and 6.2 generations, respectively (Figure 2-4A). Young cells from the same cultures were an average of 1.5, 1.4, 1.1, and 1.1 generations old, respectively (Figure 2-4A). Inspection of the Southern blot clearly reveals increases in relative amounts of pJPA113 ( ARS1 ) and pJPA138 (2 ori) in old cells (Figure 2-4B). pJPA116 ( ARS1, CEN4 ) did not accumulate in old cells, and yields bands similar in their intensities to corresponding bands from yAF6 (Figure 2-4B). In a striking illustration of the accumulation of pJPA113 and pJPA138 in old cells, the linearized plasmid DNA bands can be observed by ethidium bromide staining (Figure 2-4D). E R C levels in young and old cells were also analyzed by Southern blotting. Hybridization to rDNA probe revealed E R C bands and a broad band corresponding to the rDNA locus on chromosome XII (Figure 2-4C). We note that all old cell preparations contained increased numbers of both monomeric and slower-migrating E R C species (Figure 2-4C). The E R C and rDNA repeat bands collapse to a single 9.1 kb band following digestion with KpnI, which cuts rDNA once (data not shown). Chromosomal and plasmid band intensities were quantitated using a PhosphorImager. Consistent with our determinations in Figure 2-2, pJPA113 ( ARS1 ) and pJPA138 (2 ori) are present at high copy number in young cells, but pJPA116 ( ARS1, CEN4 ) is not (Figure 2-4E). In ~7-generation old transformants, the plasmid copy numbers for pJPA113 and pJPA138 are dramatically increased, reaching values of 254 and 137, respectively (Figure 2-4F). This represents a difference in copy number between young and old cells of ~13-fold for pJPA113 and ~6-fold for pJPA138. By
PAGE 36
24 Figure 2-4. Plasmid DNA and extrachromosomal rDNA circle ( E R C ) levels in young and old cells. Panel A conveys the cis -acting elements present in each plasmid (see also Table 2-1). Plasmids are abbreviated by numbers in panels B-H. All plasmids carry URA3 Control strain yAF6 ( URA3 ) did not contain plasmid. Old cells were harvested using a biotinylation and magnetic sorting approach (see Materials and Methods). A) Age profile histograms of young and old cells. Number of cells is plotted as a function of number of bud scars (n>40 for each histogram). B) Southern blot of plasmid DNAs. PstI-digested genomic DNA yields a 3.67 kb URA3 band. Other bands are plasmid-derived. Genomic URA3 DNA in lane Old 113 migrated as two bands due to partial over-digestion of this sample. C) Southern blot of E R C s. D) Ethidium
PAGE 37
25 bromide stained agarose gel corresponding to the blot in panels B and C. DNA marker sizes (in kb) are shown. E and F. Plasmid levels in young and old cells (quantitation of data presented in panel B). G and H) E R C monomer levels in young and old cells (quantitation of data presented in panel C). For E-H, ratios of episome (plasmid or E R C monomer) band intensity divided by chromosomal rDNA band intensity (X1000) are plotted (on a semi log scale). See Fig. 2-1B for corresponding life span data. Comparable results were obtained from similar cell sorting and Southern blotting experiments and are discussed in the Results section. comparison, 7-generation old pJPA116 transformants show no significant increase in plasmid copy number (Figure 2-4F). In a separate experiment with pJPA113 and pJPA116 transformants, in which genomic DNA was digested with BamHI instead of PstI, quantitative analysis revealed that young cells contained 27 and 1.5 plasmids/cell, respectively, whereas old cells contained 283 and 1.2 plasmids/cell, respectively (data not shown). This corresponds to a ~10-fold increase in plasmid copy number for pJPA113 in ~7-generation old cells, and no significant increase in pJPA116 copy number, which agrees with findings presented in Figure 2-4E, F. E R C monomer levels were also quantitated in young and ~7-generation old transformants and yAF6. E R C monomer levels in young cells were equal or close to 0.001 (Figure 2-4G), which agrees with measurements presented above (Figure 2-3B). In old cells, however, E R C monomer levels were appreciably higher, and exhibited increases between ~20-fold to ~70-fold (Figure 2-4H). The levels of E R C s we observe in ~7-generation old cells appears comparable to E R C levels in sorted cells of similar age reported by others (e.g., (54,60)), although quantitative analysis of E R C levels in young and old yeast cells is not commonly reported in the literature. In the experiment shown in Figure 2-4, E R C monomer levels in yAF6 ( URA3 ) are higher than in transformants (Figure 2-4H). This raises the question: does the presence
PAGE 38
26 of plasmid reduce E R C levels? In a separate experiment, E R C monomer levels in young cells were equal or close to 0.001 ( E R C monomer/chromosomal rDNA) and E R C monomer levels in old transformants containing pJPA113, pJPA116, and pJPA138 and in old yAF6 cells were determined to be 0.083, 0.075, 0.045, and 0.081, respectively (data not shown). The similar E R C levels in yAF6 and transformants in this experiment suggest that plasmid vectors do not appreciably affect E R C monomer levels (Figure 2-5). Does the extent of E R C accumulation in old cells in Fig. 4 agree with predictions based on our estimates of rates of recombination within the rDNA locus (see above, Figure 2-3)? If we assume that extrachromosomal rDNA repeats are generated at a rate of 0.5 per cell per generation, and that E R C s are retained in mother cells, then 6-7 generations should yield an increase of between 32to 64-fold, which is similar to the observed range of increase from 20to 70-fold (Figure 2-4G, H). We have also quantitated the relative amount of all E R C s (i.e., monomers, multimers, and concatemers) found in old transformants containing pJPA113, pJPA116, and pJPA138 and in old yAF6 cells. We found levels, respectively, of 0.140, 0.136, 0.086, and 0.238 (extrachromosomal rDNA/chromosomal rDNA; data not shown). These values mirror levels of accumulation of E R C monomers presented in Figure 2-4H. Thus, E R C monomers comprise approximately 1/4 to 1/3 of all extrachromosomal rDNA repeats and are present at similar levels relative to all E R C s in old transformed and untransformed cells. To extend these studies, yeast sorting experiments were done with transformants containing the LEU2 plasmids pJPA133 ( ARS1 ), pJP136 ( ARS1, CEN4 ), and pJPA148 (2 ori), and with the LEU2 strain yAF5. The average ages of sorted yeast transformed
PAGE 39
27 with pJPA133, pJPA136, pJPA148, and yAF5 are 7.1, 7.0, 7.6, and 7.9 generations, respectively (Figure 2-5A). Young cells from the same cultures were an average of 1.7, 1.0, 1.6, and 1.6 generations, respectively (Figure 2-5A). pJPA133 and pJPA148 attain copy number levels of 119 and 39, respectively, in ~7-generation old cells (Figure 2-5C). This represents an increase in copy number between young and old cells of ~30and ~8fold for pJPA133 and pJPA148, respectively. pJPA136 did not show a significant increase in old cells (Figure 2-5C). In comparison to pJPA113 and pJPA138, pJPA133 and pJPA148 reached lower absolute levels of plasmid in ~7-generation old cells. However, pJPA133 and pJPA148 accumulated to similar extents in terms of foldincrease. To resolve if this difference in absolute levels of plasmids in old cells was due to experimental error, sorting experiments with transformants and the control strain were repeated, followed by Southern analyses. The repeat experiment gave results very similar to first experiment, both in terms of absolute level of plasmid in young and old cells as well as fold-increase in young and old cells (Figure 2-5B, C). This indicates that plasmids with identical ARS1 origins and CEN4 elements, but with different backbones and selectable markers, are maintained at different absolute copy number levels in young and old cells. Nevertheless, similar fold-differences in plasmid levels are observed between young and ~7-generation old cells. This indicates that ASR1 and CEN4 elements present on plasmids functionally determine patterns of plasmid inheritance and accumulation during yeast mother cell replication. Next, E R C monomer levels in transformants containing pJPA133, pJPA136, and pJPA148, and in strain yAF5 were quantitated. In young cells, E R C monomers were detected at relatively high levels (Figure 2-5C). However, E R C monomer levels in ~7
PAGE 40
28 generation old cells were similar to levels observed above for pJPA113, pJPA116, and pJPA138 transformants (compare Figures 2-4H and 2-5D). Thus, E R C s in the Leu + transformants showed accumulation over a range of ~3-fold to ~12 fold between young and old transformants. This range of fold-increase is approximately 7-fold lower than the ~20-fold to ~70-fold increase in E R C levels between young and old Ura + transformants. This suggests that the rate of E R C accumulation during the aging process is regulated so that old cells of similar ages contain similar levels of E R C s despite differences in initial levels of E R C s in young cells. Figure 2-5. Plasmid DNA and extrachromosomal rDNA circle ( E R C ) levels in young and old cells. Plasmids are abbreviated by numbers in panels B-E. Panel A conveys the cis -acting elements present in each plasmid (see also Table 2-1). All plasmids carry LEU2 Control strain yAF5 ( LEU2 ) did not contain plasmid. Data were collected as described in Fig. 4. A. Age profile histograms of young and old cells. B and C. Plasmid levels in young and old cells (semi log plot). Data from two Southern blotting experiments are shown (Exp 1 and Exp 2). D and E. E R C monomer levels in young and old cells (semi log plot). See Fig. 1C for corresponding life span data.
PAGE 41
29 An important trend emerges from our studies of plasmid accumulation in old cells. Plasmids that accumulate to the greatest degree in old cells (Figures 2-4 and 2-5) exert the most profound effect on life span (Figure 2-1). ARS1 plasmids attain the highest copy numbers in old cells and have the most pronounced effect on life span. ARS1/CEN4 plasmids maintain a copy number near unity in young and old cells and have a small effect on maximum lifespan and a moderate effect on average life span. Plasmids with 2 origins attain a copy number in old cells roughly half that of ARS1 plasmids and reduce life span roughly half as much as ARS1 plasmids. This suggests the existence of an inverse relationship between plasmid accumulation in old cells and reduction in yeast life span. Terminal Cell Morphology Currently, in the field of yeast aging, there are few approaches available to directly address the senescent phenotype in old non-dividing cells. To address this issue indirectly, we scrutinized the terminal morphology of cells at the end of their life span (Appendix A-H). The rationale for this approach is that cell morphology is a phenotypic indicator of cell cycle stage and can serve as a basis to compare senescent cells (70) If cell morphology in terminal transformed cells is very different from the morphology of terminal wild type cells, this would imply that different mechanisms may bring about the senescent phenotype in transformed and untransformed cells. To examine terminal yeast cells, images of terminal cells were collected from three different life span experiments. Three different cell morphologies were scored: unbudded cells, single-budded cells with small buds, and single-budding cells with large buds (70). Bud emergence in S. cerevisiae correlates with entrance into S phase, and
PAGE 42
30 small buds are indicative of early S phase, whereas large buds are indicative of late S/G 2 or mitotic arrest. Unbudded cells are in G 1 phase. Between 10-15% of the terminal cells, transformed or untransformed, had multiple buds (data not shown) and were omitted from this comparison. For pJPA113 ( ARS1 ) and pJPA116 ( ARS1, CEN4 ) transformants, and W303AR5, more than 50% of terminal cells were unbudded (Figure 2-6). Typically, Figure 2-6. Terminal morphology of senescent cells. Cells at the end of life span experiments were classified according to budding pattern as described (70). Small buds were defined as having a diameter less than 25% of the diameter of the mother cell. All other buds were classified as large. Average and standard deviation values from three independent experiments are shown (n >40 for each transformant or control strain in each experiment). between 50% and 60% of senescent yeast cells have been found to be unbudded (69,70). pJPA116 transformant cells consistently yielded the highest proportion (~65%) of unbudded cells (Fig. 6). yAF6 ( URA3 ) and pJPA138 (2 ori) transformants ceased dividing with a predominance, yet a lower percentage, of unbudded cells (Figure 2-6).
PAGE 43
31 Thus, the majority of pJPA113 transformants, like W303AR5 cells, senesced in G 1 as expected. In addition, similar proportions of small budded and large budded terminal cells in senescent pJPA113 transformants and W303AR5 cells (Figure 2-6) indicate that similar proportions of these cells arrested in similar phases (S or G 2 /M) of the cell cycle. Thus, this analysis supports the interpretation that pJPA113 ( ARS1 ) reduces life span by a normal aging process. Do Functional rDNA Transcriptional Units Play a Role in Reduction in Life Span? Although plasmids without rDNA sequences reduce yeast life span, it is important to consider a potential role for rDNA sequences in life span reduction. It is possible that E R C s reduce life span in a manner that is mechanistically more complex than the manner in which plasmid episomes reduce life span. There are significant differences in coding potential between plasmids and E R C s. The 9.1 kb rDNA repeat carries genes for rRNA precursors as well as the gene TAR1 which lies on the strand opposite the 25S rRNA and encodes a mitochondrial protein (84). One way to address this issue is to ask whether or not a plasmid vector carrying an rDNA repeat unit has a more pronounced effect on life span than plasmid vector alone. It is important to note this issue was not completely addressed in a previous study employing the rDNA-containing plasmid pDS163 (54) Plasmid pDS163 does not contain a functional 9.1 kb rDNA repeat unit. The rDNA on pDS163 consists of a 12.1 kb insert extending from an EcoRI site within the coding sequence of 5.8S rRNA to the 5-most EcoRI site in the 25S rRNA coding region (data not shown). The 12.1 kb fragment does not carry a full-length 35S prerRNA transcription unit and is capable of producing only a truncated 35S pre-rRNA transcript, which if processed would be incapable of yielding mature 25S rRNA.
PAGE 44
32 To determine if an episomal rDNA repeat influences life span, we constructed three plasmids containing 9.1 kb rDNA repeats and used them in life span experiments. The three plasmids, pJPA105, pJPA106, and pJPA107 contain 9.1 kb repeats with different endpoints in the plasmid pAF15, which contains a 2 origin (see Materials and Methods, and Table 2-1). Plasmid pJPA105 contains a repeat with XmaI end points, Figure 2-7. Life span analysis of yeast transformed with plasmids containing rDNA repeats. Number of daughter cells (generations) produced per mother cell are plotted as a function of mother cell viability. Life span analysis was done as described in Figure 2-1 using W303AR5 carrying plasmids pJPA105 (n=45), pJPA106 (n=43), or pJPA107 (n=46) and control plasmid pAF15 (n=46). Plasmids pJPA105, pJPA106, and pJPA107 contain full length (9.1 kb), rDNA repeats with different endpoints (see Table 2-1 and Materials and Methods). pJPA105 contains an rDNA insert with XmaI endpoints, which has been shown to be functional in vivo (85). which has been shown by Nomura and colleagues to functionally complement an rDNA deletion in vivo (85). pJPA106 and pJPA107 contain repeats with AhdI and PsiI endpoints, respectively, which should not interfere with rDNA gene expression (Figure 12). A 2 origin plasmid was used because plasmids constructed with rDNA inserts
PAGE 45
33 whose replication relied solely on the rDNA ARS were found to integrate into the chromosomal rDNA locus with high frequency (as determined by Southern blot analysis; data not shown). Life span determinations of W303AR5 transformants containing pAF15, pJPA105, pJPA106, and pJPA107 were done as described above (see Figure 21). pJPA105, pJPA106, pJPA107, and pAF15 transformants gave very similar life span curves, indicating that the presence of a functional rDNA repeat does not have a dramatic effect on life span (Figure 2-7). All four plasmids affect life span to an extent similar to the 2 origin plasmids pJPA138 and pJPA148 (Figure 2-1B, C), although the average life spans for pJPA105, pJPA106, pJPA107, and pAF15 (13.3, 11.8, 11.7, and 12.2 generations, respectively) are lower than the average life spans for pJPA138 and pJPA148 transformants (15.5 and 16.3 generations, respectively; Figure 2-1 and Table 22). Life span curves for pJPA106 and pJPA107 transformants did not show a statistically significant difference from pAF15 transformants based on the Wilcoxon signed pair rank test (p>0.05) Only transformants carrying pJPA105 and pAF15 exhibited a statistically significant difference (p<0.05), but this represents a small increase in life span of transformants carrying pJPA105. These findings support the conclusion that the presence of a full-length rDNA repeat per se does is not required for, and does not necessarily augment, reduction in yeast life span. Summary Our studies show that yeast plasmids accumulate in mother cells and reduce replicative life span. The effect of plasmids on life span appears to be a direct effect, and not an indirect effect on E R C levels in mother cells. A functional rDNA repeat unit is not required for reduction in life span, and the presence of a functional rDNA repeat does not augment reduction in life span by plasmids. Thus, plasmids containing ARS
PAGE 46
34 elements appear to mimic E R C -mediated reduction in life span. These findings provide strong evidence that replicative aging in S. cerevisiae is caused by accumulation of episomal DNA. The fact that functional rDNA sequences are not required for reduction in life span argues that expression of rDNA genes present on E R C s is not a causative process in yeast aging. This indicates that accumulation of episomal DNAs, such as ARS plasmids and E R C s, is one mechanism by which yeast life span is regulated.
PAGE 47
35 CHAPTER 3 TWO MICRON CIRCLE: A NATURALLY OCCURRING EPISOMES ROLE IN AGING One of the processes that has been proposed to regulate replicative life span in the budding yeast Saccharomyces cerevisiae is the accumulation of extrachromosomal rDNA circles (ERCs) by yeast mother cells (54) ERCs are generated by recombination within the rDNA repeat region on chromosome XII and are passed on to daughter cells infrequently due to an inheritance bias exhibited by replication origin-containing DNA episomes (43). We have shown that plasmids containing an autonomously replicating sequence (ARS; yeast DNA replication origin) reduce life span due to their accumulation during replicative aging (86). This suggests that DNA episomes in general regulate replicative aging, and reduce life span due to their accumulation in yeast mother cells. The majority of laboratory strains of S. cerevisiae contain an endogenous plasmid known as the two micron (2 ) circle, due to the length of its circular DNA determined by electron microscopy (76,87). Strains harboring this non-Mendelian genetic element are denoted cir + ; strains lacking it are referred to as cir 0 (88). Four genes and multiple cisacting sequences on the 2 micron plasmid have been mapped and functionally dissected (76,87). These are responsible for maintaining copy number at approximately 20-40 copies per cell by a recombination-based mechanism and ensuring high fidelity transmission of the 2 micron plasmid during cell division and mating (76,87,89). There are no significant growth phenotypes generally associated with the presence of the 2 micron plasmid in cir + strains, and conversely, negligible growth advantages conferred to
PAGE 48
36 cir 0 strains (76,87) This has led to the view that the 2 micron plasmid is a parasitic DNA that imposes only a minor selective disadvantage to host strains (76,87). However, previous studies have not examined the possibility of an effect of the 2 micron plasmid on replicative life span. A minor effect on replicative life span is not predicted to result in a discernable difference in vegetative growth rate, and may have been overlooked in the past. To address this issue we have taken advantage of a novel and simple method for curing a cir + yeast strain of 2 micron plasmids. Previously described methods (90,91) for curing strains of 2 micron plasmids are more time-consuming and are less convenient than the method described herein. New Method for Removal of Two Micron Circle During the course of plasmid copy number studies published elsewhere (86) we fortuitously observed that transformants containing recombinant yeast shuttle vectors with an rDNA ARS lost 2 micron plasmid DNA more frequently than was expected, based on the known inheritance behavior of 2 micron plasmids. In our initial Southern blotting studies, half of the transformants containing plasmid pJPA114 (4/8 transformants) or plasmid pJPA118 (2/4 transformants) lost 2 micron plasmid DNA (data not shown). Plasmids pJPA114 and pJPA118 are derived from pRS306 (77) and have been described previously (86). pJPA114 contains a 200 bp insert with the rDNA ARS; pJPA118 contains a complete 9.1 kb rDNA repeat with its ARS. The rDNA ARS has relatively weak replication origin activity due to the presence of a non-consensus ARS consensus sequence (ACS) (81). As a result, the majority of pJPA114 and pJPA118 transformants form colonies slowly on selective SD medium. In instances where fastgrowing pJPA118 colonies arose on transformation plates or streaks of individual transformants, Southern analysis revealed that pJPA118 had integrated into the rDNA
PAGE 49
37 Figure 3-1. Southern blot analysis of pJPA114 transformants. Panel A. DNAs from twelve transformants were digested with PstI, separated on a 1% agarose gel and stained with ethidium bromide. Size markers (M) are shown (in kb). Panel B. DNAs from the gel in panel A were transferred to a nylon membrane, hybridized to 32 P-labeled 2 micron plasmid DNA probe, and visualized with a PhosphorImager. The 6318 bp 2 micron plasmid contains one PstI site and yields a single 6.3 kb band (arrowhead). The faint bands above and below the 2 micron plasmid band likely correspond to hybridization to regions of homology in yeast chromosomes (e.g., a region of homology in Ch III yields a PstI fragment of 7747 bp, which corresponds to the size of the upper faint band). Longer exposures of the Southern blot revealed no detectable bands in lanes 8 and 9 (data not shown). locus (data not shown). Transformants containing pJPA118 were not studied further because of the relative frequency with which pJPA118 integrated into the rDNA repeat locus. Fast-growing pJPA114 transformants arose only very infrequently and were not analyzed for plasmid integration by Southern blotting. Transformants containing plasmid pJPA113 (86), which is derived from pRS306 but contains the ARS1 origin instead of the rDNA ARS, did not show loss of 2 micron plasmids in our Southern blotting studies (data not shown). ARS1 contains an ARS consensus sequence (ACS) that conforms to the
PAGE 50
38 consensus observed in most ARS elements and is considered a strong ARS, unlike the rDNA ARS. These preliminary results suggested that pJPA114 may be generally useful to cure cir + strains of 2 micron plasmid DNA. To further test the use of pJPA114 for this purpose, we transformed W303AR5 with pJPA114, streaked independently-isolated transformants to single colonies, obtained isolates lacking pJPA114, and analyzed twelve arbitrarily-chosen isolates by Southern blot analysis (see Materials and Methods). pJPA114 has two technical merits in this experiment. Because pJPA114 contains the rDNA ARS, it is readily lost from transformants grown in the presence of uracil. Loss of pJPA114 can be confirmed by growth on medium containing 5-fluoroorotic acid (5FOA). In this experiment, 2 of 12 yeast isolates lost 2 micron plasmid DNA (Figure 3-1). This confirms our initial findings that pJPA114 transformants lose 2 micron plasmids with a sufficiently high frequency to allow pJPA114 to be useful for curing a strain of the 2 micron plasmid. Two Micron Circle Does Not Reduce Life Span To determine if the presence of 2 micron plasmids influenced replicative life span, microdissection-based life span determinations were done as described (86,92). The two cir 0 strains, yAF7 and yAF8, obtained from the experiment presented in Figure 1 were compared to the parental strain W303AR5. No apparent difference in replicative life spans was observed (Figure 3-2). The average replicative life spans for yAF7, yAF8, and W303AR5 were 22.7 (.2), 21.9 (.3), and 23.5 (.9) generations, respectively. Wilcoxon two-sample paired signed rank tests revealed no statistically significant differences between the three life span curves (p<0.05). Thus, the presence of 2 micron
PAGE 51
39 plasmids in W303AR5 does reduce replicative life span compared to two independentlyisolated, otherwise isogenic strains lacking 2 micron plasmids. Figure 3-2. Life span analysis of cir + and cir 0 yeast. Number of daughter cells (generations) produced per mother cell are plotted as a function of mother cell viability. yAF7 and yAF8 are derivatives of W303AR5 (54) that lack the 2 micron plasmid, and correspond, respectively, to lanes 7 and 8 in Figure 3-1. The number of mother cells (n) analyzed for each curve equals 55, 56, and 55 for yAF7, yAF8, and W303AR5, respectively. The three curves are indistinguishable by Wilcoxon two-sample paired signed rank tests (p<0.05). Two Micron Circle Does Not Accumulate in Old Cells These findings indicate that 2 micron plasmids do not confer a disadvantage insofar as replicative life span is concerned. This suggests that 2 micron plasmids do not accumulate during the aging process. To test this prediction, ~6-generation old yeast cells were prepared by magnetic sorting (see Materials and Methods) and 2 micron plasmid DNA levels were analyzed by Southern blotting. No differences in 2 micron
PAGE 52
40 Figure 3-3. Two micron plasmid levels in young and old cells. Old cells were isolated by biotinylation and magnetic sorting (see Materials and Methods). Bud scars in young and old cells were stained with Calcofluor and counted to determine average age. DNAs from young and old cells were analyzed by Southern blotting as described for Figure 3-1. Size markers (M) are shown (in kb). To normalize levels of 2 micron plasmid DNA to genomic DNA levels, the blot was stripped and rehybridized to 32 P-labeled probe to URA3 2 micron plasmid and URA3 band intensities were quantitated, and no significant difference was found between the ratios of 2 micron plasmid DNA to URA3 DNA in young and old cells. plasmid DNA levels were observed between populations of cells with average ages of 1.1 and 6.2 generations (Figure 3-2). To normalize the amounts of 2 micron DNA present in young and old cell samples to the amounts of genomic DNA present, the relative amount of the URA3 gene was determined by Southern blotting (Figure 3-2). Quantitative analysis of the intensities of bands corresponding to 2 micron plasmid DNA and URA3 was done and revealed no significant difference between normalized 2 micron DNA
PAGE 53
41 levels in young and old cells (data not shown). Previous studies have shown substantial accumulation of ERCs (5to 50-fold) and non-centromeric recombinant plasmids (5to 25-fold) in 7-generation old yeast cells (86). Thus, 2 micron plasmids are unlike ERCs and non-centromeric yeast plasmid vectors, and do not accumulate in old cells. Summary In chapter 2, 2 micron origin plasmids were shown to accumulate. The same is not true for naturally occurring 2 micron circles. They do not accumulate; therefore, they do not reduce lifespan. While only confirming the model of plasmid aging, the loss of 2 micron circles in transformants of pJPA114 is very interesting. What is pJPA114 doing to cause 2 micron circle loss?
PAGE 54
42 CHAPTER 4 A CELLS LIMITED RESOURCES AND PLASMID COMPETITION The main hypothesis being developed to explain ERC mediated aging revolves around the idea that episomes cause a replication burden in cells. As cells age, they accumulate episomes (93). The episomes eventually reach a high copy number. It is so high, that it is about the same amount of DNA as the yeast genome (93). This means that an old cell is replicating two or more times the amount of DNA it normally replicates. This enormous amount of DNA could require all of a cells replication factors and DNA substrates to complete replication. If one of these factors or substrates is limiting, then the cell may encounter problems during replication. This could result in mutations, double strand breaks, etc. In order to further explore this idea, the following experiments were completed. Sml1p, Mec1p, RNR, and Rad53p Pathway Sml1p and Mec1p are involved in a well know DNA damage and repair pathway (94). Most importantly it senses replication fork slowing and stalls. The cascade starts by Mec1p sensing DNA damage or replication fork stalling. It then signals through Rad53p to Sml1p. Sm11p, an inhibitor, releases and thereby activates Ribonucleotide Reductase (RNR) (Figure 4-1). RNR makes dNTPs from NTPs by removing the 2 hydroxyl from ribose. This reaction results in an increase of cellular pools of dNTPs and the progression of stalled replication forks (94).
PAGE 55
43 Figure 4-1. Mec1p, Rad53p, Sml1p, and RNR pathway (94). This pathway ultimately leads to the production of dNTPs. SML1 Deletions Do Not Increase Life Span. To see whether an increase in the cellular dNTPs pools would counteract the affects of an episomes replication burden, a SML1 deletion was created with the insertion of HIS3 By removing the RNR complex inhibitor, Sml1p, dNTPs are continuously being
PAGE 56
44 produced no matter what the state of the cell. SML1 deletions are known to increase dNTPs levels in the cell by 2-3 fold. In addition to looking at the life span of SML1 and sml1 strains, transformants of sml1 were also test for an extended life span. The plasmid used was pJPA113. This is the ARS1 plasmid from Figure 2-1B and Table 2-1. Transformed cells may help to amplify the affect sml1 has on a replication burden, since they contain more episomes and have shorter life spans. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 40 Generations Fraction of Cells Viable yAF10+ARS yAF10 sml1 +ARS sml1 Figure 4-2. Life span of SML1 deletions. yAF10 ( HIS3 ; control) had a mean life span of 25.5 and a n=55. sml1 had a mean life span of 25.9 and a n=57. yAF10 + ARS (control) had a mean life span of 12.9 and a n=42. sml1 + ARS had a mean life span of 11.8 and a n=54. The ARS plasmid used was pJPA113 (ARS1). The SMLl1 deletion had the same life span as the control (yAF10). They were statistically indistinguishable using the Wilcoxon two-sample paired signed rank test.
PAGE 57
45 yAF10 is the yAF5 strain with its his3 locus repaired to control for insertion of HIS3 into sml1 The transformed sml1 cells also had the same life span as the transformed control strain (Figure 4-2). Reproducing previous results, the pJPA113 (ARS1) transformants had a mean life span within the standard deviations of the life spans in Table 2-2. Since replication is a doubling process, it is conceivable that an increase in dNTPs of 2-3 fold is not enough to be seen on a life span. In other words, the life span assay may not be sensitive enough. In old cells, episomes account for a large proportion of the total DNA (could be more than half). Since they are retained due to mother cell bias, a division occurring at an old age would increase the total DNA content by nearly double. The only DNA being passed on to the daughter cell would be the chromosomes, not the massively accumulated and newly replicated episomes. The key to this idea is that episomes can reach a quantity larger than that of the genome. A sml1 may only have increased a cells life span by one doubling, not enough to be observed by life span. Old Cells Do Not have an Increased Sensitivity to Hydroxyurea Hydroxyurea (HU) is a chemical inhibitor of the RNR complex (94) It has been widely used when studying Mec1p and Sml1p. Sm11 has an increased resistance to HU. Strains that are sm11 mec1 or sm11 rad53 have an increased sensitivity to HU. Interestingly MEC1 and RAD53 cannot be deleted without a SML1 deletion suppressing their lethality (94). Sml1p has a critical role in HU sensitivity because it is the inhibitor of the RNR complex. Without SML1 it takes more HU to suppress the larger pool of active RNR in the cell. If MEC1 or RAD53 are deleted then Sml1p does not release the RNR complex and the cell cannot make dNTPs. This is why sml1 is required when deleting MEC1 and RAD53 Mec1 sml and rad53 sml1 strains are not less sensitive to HU because of Mec1p and Rad53p regulation of transcription factors
PAGE 58
46 for the RNR proteins through Dun1p (Figure4-1). Without the activation of Dun1p, RNR levels in the cell stay the same and cannot compensate for the inhibition by HU. Figure 4-3. Hydroxyurea sensitivity of young and old cells from 0 mM to 200 mM. Each plate has five rows of pin stamps. Each row is a serial dilution of a strain. The first row is a WT control yAF6. The second row is a WT control W15884C. The third row is sml1 The fourth row is mec1 sml1 The fifth row is rad53 sml1 A change in HU sensitivity by old cells would show that this DNA repair pathway plays a role in the aging process. Two WT, sml1 mec1 sml1 and rad53 sml1 strains were magnetically sorted to get young and old cells. Serial dilutions were pin stamped onto minimal medium plates containing various levels of hydroxyurea. The first pin stamping contained HU concentrations of 0, 50, 100, 200, 300, and 400 mM. As expected the mec1 sml1 and rad53 sml1 strains had an increased sensitivity to HU, while the WT and sml1 were more resistant. There were no noticeable differences in the sensitivity of HU between the young and old cells (Figure 4-3). The 300 and 400 mM HU concentrations are not shown because no strains were able to grow in those conditions.
PAGE 59
47 Figure 4-4. Hydroxyurea sensitivity of young and old cells from 0 mM to 50 mM. Each plate has five rows of pin stamps. Each row is a serial dilution of a strain. The first row is a WT control yAF6. The second row is a WT control W15884C. The third row is sml1 The fourth row is mec1 sml1 The fifth row is rad53 sml1
PAGE 60
48 To further investigate HU sensitivity in old and young cells, a narrower range of HU was examined for the second round of pin stamping. The concentrations of HU used in this experiment were 0, 10, 20, 30, 40, and 50 mM. Again no distinction could be drawn between the HU sensitivity of old cells to the HU sensitivity of young cells. A closer look at concentrations between 0 to 10 mM and 100 to 300 mM may show the differences we are looking for. The increase resistance to HU of sml1 was not shown; therefore, there needs to be a tighter range of concentrations between 100 and 300 mM. It is possible that old cells are more resistant to HU because they are up regulating RNR. Double Strand Breaks Do Not Increase in Old Cells Replication slow zones are regions of DNA within the chromosomes at which replication forks slow down. These zones were first discovered in MEC1 mutants, where the slow zones turned into double stranded breaks (DSB) (95). Since Mec1p is the sensor for stalled replication forks, MEC1 mutants cannot fix stalled forks. In MEC1 mutants, replication forks spend more time at the slow zones. This leads to more DSBs in these replication slow zones. In old cells, the diminishing amounts of dNTPs caused by the episomal replication burden could cause replication forks to stall more frequently and for longer periods of time. This would in turn lead to more DSB. To test whether magnetically sorted old cells have more DSB then young cells, pulse field gels were used to separate chromosomes. After the gel was completed, it was transferred to positively charged nylon and probed with the CHA1 probe. CHA1 is located on one end chromosome III (95). If a DSB occurred, then faint bands should appear below the chromosome III band. These bands are shortened versions of chromosome III. No discernable difference could
PAGE 61
49 be observed between young and old cells. There were no shorter bands on the blot; therefore, there were no DSBs. The original paper describing DSBs in mec1 mutants used a synchronized population of cells. DNA was extracted from cells in the process of S phase. By using cell synchronization, DSB formation in old cell might be able to be seen. Since there is no positive control ( mec1 synchronized) in Figure 4-5, it is hard to say that the absence of DSB detection conclusively shows that DSB do not form in old cells. Figure 4-5. Southern of DSB in yAF6 (WT), W1488-4C (WT), sml1 mec1 sml1 and rad53 sml1 Pulse field gel was run according to materials and methods. Southern was transferred to positively charged nylon under alkaline conditions. The blot was probed with the CHA1 probe described in materials and methods. Phosphorylation of Rad53p Does Not Increase in Old Cells The protein that senses DSB and stalled replication forks in the cell, Mec1p, phosphorylates Rad53p (96) If Rad53p phosphorylation level increases in old cells, then this pathway could be implemented in aging. After magnetically sorting old cells, protein lysates were extracted. Several controls were also completed in parallel. HU causes a
PAGE 62
50 signal cascade through this DNA repair pathway resulting in the phosphorylation of Rad53p and the release of the RNR complex by Sml1p. The phosphorylation can be seen by a shift upward of Rad53p band on a gel (96). A rad53 sml1 strain was added to show which band is the Rad53p (the one not present in this strain). A mecl sml1 strain was used to show a less phosphorylated Rad53p. The western blot shows that there was no increase in the phosphrylation levels of Rad53p between young, old, and older (double magnetic sort) cells. Even between cells that have have a variety of ERC levels ( fob1 WT, and sir2 ), there was no difference in the phosphorylation of Rad53p. Figure 4-6. Rad53p phosphorylation in young and old cells. The upper dispersed band in the W1488-4C (+HU) is the phosphoralated version of Rad53p. The lower tight band in -HU lane of W1488-4C is the unphosphorylted state of Rad53p. Since this is a polyclonal antibody, there is some nonspecific binding to bands still present in the rad53 sml1 (lower band in the blot). ERC Competition with a CEN Plasmid Throughout Yeast Life Span By transforming pAF32 into WT, sir2 and fob1 strains the effects of ERCs on a CEN plasmid ccan be seen. These strains have different levels of ERCs and in turn different life spans. Sir2 produces the most ERCs. WT produce slightly less. Fob1 produces very few. pAF32 is a stable plasmid that contains a CEN element. It represents licensing of a single origin during the accumulation of ERCs. If ERCs cause an episomal replication burden by abnormal licensing of ARSs throughout the genome, then pAF32 should fail to replicate more often in strains with more ERCs.
PAGE 63
51 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 40 50 Generations Fraction of Cells Viable W303R5 sir2 fob1 Figure 4-7. Life span of W303R5 (WT), sir2 and fob1 during the CEN loss experiment. W303R5 had a mean life span of 22.4 and an n = 29. Sir2 had a mean life span of 12.6 and an n = 28. Fob1 had a mean life span of 30.1 and an n = 30. We followed the inheritance pattern of pAF32 throughout the life span of the various transformants. Because pAF32 contains the ADE2 gene, its inheritance can be followed by colony color (Appendix I-K). After the pedigree analysis was completed, the life spans of the three strains (with a CEN plasmid) were consistent with the life spans that are already published in the literature (without a CEN plasmid) (Figure 4-7). After a close analysis of the pedigrees, they show that the sir2 stain lost the plasmid at earlier divisions than the both WT and fob1 strains. WT, which has intermediate number of
PAGE 64
52 ERC, had intermediate loss of pAF32. The fob1 strain had the fewest ERCs and the latest lost of the CEN plasmid (Figure 4-8). While there was a low n, this result suggests that ERCs inhibit CEN plasmid replication. It also says that episomes may cause aging in old cells by sequestering needed replication factors away from the genome. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 Generation at which CEN Plasmid was lost Fraction of Cells W303R5 sir2 fob1 Figure 4-8. The age which WT, sir2 and fob1 lose plasmid. CEN plasmids were lost at a mean generation time of 11.4, 6.25, and 14.3 (respectively). The number of cells analyzed in each strain were n = 8, n = 4, and n = 7 (respectively). Mitotic Stabilities in the Presence of ERCs To further investigate ERCs role in the cell, mitotic stabilities were examined. A change in mitotic stability of ARS plasmids may be expected in strains with various
PAGE 65
53 levels of ERCs accumulation. Fob1 WT, and sir2 strains were tested with pAF31 (ARS), pAF32 (CEN), pJPA133 (ARS), and pJPA136 (CEN). The two sets of plasmids were used to control for the use of the ADE2 or LEU2 selectable markers. The sir2 strain had an increased mitotic stability of pAF31. Normally pAF31 has a mitotic 0 10 20 30 40 50 60 70 80 90 100 W303 pAF31 fob1 pAF31 sir2 pAF31 W303 pAF32 fob1 pAF32 sir2 pAF32 Strain/Plasmid Mitotic Stability n = 7 9 11 13 13 14 Figure 4-9. Mitotic stabilities of pAF31 and pAF32. The two plasmids were tested in strains with various amounts of ERCs. stability of 16% (W303). In the sir2 strain, pAF31 had a mitotic stability of 29%. The sir2 strain had a slight increase in the mitotic stability of pJPA133, but it was not significant. The mitotic stability went from 17% (W303) to 21% ( sir2 ), but these
PAGE 66
54 numbers fell within the standard deviation of each other. This could be explained by the smaller size of pJPA133 from that of pAF31. Very small plasmids are known to have different mitotic stability characteristics. The ARS plasmid, pAF31, may have reached a critical threshold in size for ERCs to play a role in mitotic stability. The fob1 strains inability to further reduce the mitotic stability of pAF31 shows that there may be a critical mass of episomes a cell can handle. If the increase in ERCs from fob1 to W303 was not enough to change mitotic stability, then the decrease in size from pAF31 to pJPA133 could be not enough to change mitotic stability. 0 10 20 30 40 50 60 70 80 90 100 W303 pJPA133 fob1 pJPA133 sir2 pJPA133 W303 pJPA136 fob1 pJPA136 sir2 pJPA136 Strain/Plasmid Mitotic Stability Figure 4-10. Mitotic stabilities of pJPA133 and pJPA136. The two plasmids were tested in strains with various amounts of ERCs.
PAGE 67
55 Plasmid Accumulation in sir2 and fob1 Strains Again fob1 sir2 and wt strains were transformed with pJPA133 and pJPA136. Magnetic sorts were completed to obtain young and old cells. The episomal replication burden model predicts that accumulating plasmid will compete. In this example, ERCs will compete with pJPA133 for the replication machinery. The accumulation of the ARS plasmid will decrease in the strains with increased ERC production. Figure 4-11. Southern of showing plasmid competition phenomenon. XhoI digested genomic DNA yields a 8.935 kb LEU2 band. Other bands are plasmid derived. Southerns were completed on the magnetic sorts to quantify the copy number of the plasmids in each strain. As predicted old sir2 cells which contains more ERCs, had fewer ARS plasmids (pJPA133) per cell (165 plasmids/cell). WT had an intermediate number (272 plasmids/cell), and fob1 with the fewest number of ERCs contains the most copies of the plasmid (293 plasmids/cell) in old cells. pJPA133 also had a different copy number in the young strains. The copy numbers were 6, 4.6, and 2.8 with respect to
PAGE 68
56 fob1 WT, and sir2 This again mimicked the results from the old cells, but to a lesser degree. Young and old cells of all of the strains contained relatively the same number of pJPA136 (CEN). This argues for a competition between ARS episomes for replication machinery in the cell. To further extrapolate this idea, episomes may also compete with the genome for the replication machinery and cause aging. Another explanation of this result may be that there is a critical mass of episomes allowed in the nucleus. After that mass is reached episomes begin to be pushed out. 0 50 100 150 200 250 300 350 sir2 pJPA133 wt pJPA133 fob1 pJPA133 sir2 pJPA136 wt pJPA136 fob1 pJPA136 Strains Plasmid Copy Number per Cell Young Old Figure 4-12. Quantitation of plasmid competition Southern. Quantitaion was completed on the blot in Figure 4-11 by a Phosphuor imager. Summary The mechanism by which episomes cause aging has been very illusive. In this chapter several experiments have been designed to tease out the mechanism. Although some experiments gave negative answers, they did give definitive answers. While the
PAGE 69
57 exact mechanism of episomal aging is still not well known, the experiments strongly suggest in what direction subsequent experiments should go. The major experiments in this chapter show a few things: CEN plasmids are lost at younger generation times in strains with more ERCs. The mitotic stability of ARS plasmids increases in strains with more ERCs. Old cells of strains with more ERCs accumulate fewer ARS plasmids. Together they say that as episomes accumulate there is an increasing strain on the cells replication machinery.
PAGE 70
58 CHAPTER 5 CHROMATIN SILENCING AND EPISOME FORMATION The major role of Sir2p in aging is its ability to deacetylate histones. By deacetylating histones in the rDNA, it is silencing the DNA. More specifically it is compacting the chromatin and making it less accessible. This results in fewer ERCs produced and in turn a longer life span. Strains that over express Sir2p have fewer ERCs and live longer. Conversely SIR2 deletions create more ERCs and have a shorter life span because it cannot deacetylate histones. If the histone acetylation status in the rDNA is central in ERC aging, then limiting a cells ability to acetylate histones could be as important as Sir2p ability to deacetylate histones. Histone acetyl transferases (HATs) are the enzymes that acetylate histones. In addition to the enzymes responsible for the acetylation and deacetylation of histones the pool of acetyl CoA may be important to aging. Acetyl CoA is the substrate for HATs in the acetylation of histones. A closer look at the production of acetyl CoA may lead to mutants that increase life span. These ideas are illustrated in Figure 5-1. Two enzymes are responsible for the production of acetyl CoA, Acs1p and Acs2p (Acetyl CoA Synthetase). Acs1p has a K m 30 times lower than Acs2p (97). This does not mean that it does most of the conversion of acetate to acetyl CoA. The two enzymes are regulated very differently. Acs1p is completely repressed by glucose (100 mg/L), up regulated in ethanol, and further increased in acetate medium. Where as Acs2p is maintained at a constant level in glucose and ethanol, but acts sporadically in acetate (97). An ACS2 deletion cannot grow on glucose as a carbon source. This is because of
PAGE 71
59 the repression of ACS1 by glucose. If ACS2 is deleted and ACS1 is repressed by glucose, then there is insufficient ACS activity in the cell, and the cell cannot survive. The cell needs acetyl CoA to survive. Figure 5-1. The acetylation of histones and its affect on ERC production and life span. ACS2 and ACS1 is Required for Normal Life Span Deletions of ACS1 and ACS2 were obtained from the Clusius lab. It was predicted that deletions of the ACS genes would lead to an extended life span. This is because acetyl CoA levels in the cell would drop. Histones would be acetylated less, and the production of ERCs would decrease causing a longer life span.
PAGE 72
60 Life spans were completed on both glucose and ethanol. Surprisingly T23D, the strain background, has a much longer life span than the W303R5 derivatives that have been used in previous studies throughout this dissertation and other strains in published papers. Never the less, there was a reduction in life span in acs1 from the controls. Interestingly acs2 had an even shorter life span than asc1 (Figure 5-2). These reductions in life span are opposite of what one might conclude, from the model described in Figure 5-1. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 20 40 60 80 Generations Fraction of Cells Viable T23D E 621 E 625 E T23D D 621 D Figure 5-2. Life span of ACS deletions. T23D (control) on ethanol (E) had a mean life span of 55.2 and an n=59. 621 ( acs1 ) on ethanol (E) had a mean life span of 47.4 and an n=59. 625 ( acs2 ) on ethanol (E) had a mean life span of 16.6 and an n=51. T23D (control) on glucose (G) had a mean life span of 35.0 and an n=59. 621 ( acs1 ) on glucose (G) had a mean life span of 24.8 and an n=59.
PAGE 73
61 A closer look at metabolism shows that acetyl CoA is used for many processes in the cell besides acetylation of histones. Acetyl CoA is one of the entrance points into the Citric Acid Cycle. It is also used in lipid synthesis. ACS2 is known to be coregulated with structural genes of fatty acid biosynthesis because of an upstream ICRE (inositol/choline-response element). These and other pathways may be more important to a cells health than the predicted decrease in the production of ERCs by the ACS deletions. In addition to looking at the affects of Acs1p and Acs2p in a cell, we inadvertently observed a difference in life span between cells grown on glucose and cells grown on ethanol as a carbon source. When T23D was grown on ethanol it had a mean life span of 55.2 and a maximum life span of 77 Generations. This is longer than the longest life span we have seen published in the literature. To our knowledge the longest life span published is a mean life span of 36.1 and a maximum life span of 74 (98) ACS2 Increases ERC Production To further explore ACS1 and ACS2 s role in aging, ERC production and accumulation was measure in old and young cells of the ACS deletions. According to the model illustrated in Figure 5-1, ACS deletions should lead to a decrease in ERC production. Cells were grown in ethanol and then age fractionated by magnetic sorting. T23D (control) had very few to no ERCs in the old cells. This may be why it has a longer life span than W303R5. What is the genetic difference between T23D and W303R5. T23D is a diploid strain while W303R5 is a haploid. Previous experiments have shown that the ploidy of a strain is not important to life span (99). Another difference is that W303R5 is ade2 his3 leu2 trp1 and ura3 ; and T23D has no
PAGE 74
62 auxotrophic markers. Some of these genes can be compared by life spans that were completely separately, and they do not seem to influence life span. Interestingly, the ACS2 deletion produces more ERCs. While the ACS1 deletion does not produce ERCs. Acs2 s ERC production may attribute to its shortened life span. Figure 5-3. Sorts of young and old ACS deletion strains. The southern blot was probe for rDNA. Light banding in the old acs2 sample can be observed at a high molecular weight. These are ERCs. Summary ACS1 ACS2 ethanol as a carbon source, and fatty acid biosynthesis are all linked to aging. Further exploration is needed to fully understand how acetyl CoA is involved in
PAGE 75
63 aging. Another noteworthy result is that T23D lives longer than W303R5. It would be interesting to know what genetic differences contribute to its extended life span. Many experiments could easily be designed to determine the genes that help it live longer.
PAGE 76
64 CHAPTER 6 LOOKING AT POSSIBLE MECHANISM OF CELLULAR AGING YCA1 and Apoptosis in Yeast Apoptosis and aging are intimately linked. Since programmed cell death, apoptosis, contributes to the aging of metazoans, looking at a known yeast caspase, an apoptotic regulator, seemed reasonable. Yca1p is the only known caspase like protein in yeast (100) It has been shown to be required for hydrogen peroxide induced apoptosis. When YCA1 is deleted, it increases yeast chronological life span (100). To further investigate the role of Yca1p in the aging process we constructed a YCA1 deletion in our W303AR5 strain. It was created by using microhomology to YCA1 and inserting HIS3 inside of the gene (See Materials and Methods). After the insertion of HIS3 into YCA1 we confirmed by southern that the constructed W303AR5 yca1 :: HIS3 strain was correct. A control strain was also created by repairing the his3 locus of the W303AR5 strain. This was to insure that the HIS3 status of the cell would not contribute to a lifespan change. The two strains were compared through replicative life spans (Figure 6-1). There was no statistical difference between the yca1 deletion and the control strain. The interpretation is that while yca1 is necessary for a normal chronological life span, it is not required for replicative life span. This experiment illustrates the fundamental difference between a chronological and replicative life span. A chronological life span demonstrates a cells resilience and ability to replicate after being in a saturated culture full of cells and depleted of nutrients. In a replicative life span, cells are spaced out very far from each other, so it is unlikely that they will run out of nutrients. It is a measure of
PAGE 77
65 a cell replicative potential, not its resilience over time. It is a subtle difference, but important when trying to address different questions about cellular aging. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 40 Generations Fraction of Cells Viable Control yca1 Figure 6-1. Life span of yca1 This life span was completed on rich media (YPD). The control strain had a mean life span of 22.1 (n=60). The yca1 deletion had a mean life span of 21.4 (n=57). Shu Gene Family and Mutation Suppression in Aging Using a CAN1 forward-mutation assay, the SHU (sensitivity to hydroxyurea) genes were discovered. These genes are required to prevent spontaneous mutations. In the assay, 4,847 yeast deletion mutants (from the yeast deletion project) were screened for the ability to spontaneously become canavanine resistant ( can1 ) (101) In collaboration with the laboratory of Rodeny Rothstein, four of the genes discovered in this screen ( SHU1 SHU2 SHU3 and CSM2 ) were looked at by replicative
PAGE 78
66 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 40 Generations Fraction of Cells Viable W303R5 shu1 shu2 shu3 csm2 4X Figure 6-2. SHU genes role in life span. The mean life span of W303R5 is 24.5 (n=60). The mean life span of shu1 is 25.3 (n=60). The mean life span of shu2 is 25.8 (n=58). The mean life span of shu3 is 23.2 (n=56). The mean life span of csm2 is 22.5 (n=59). The mean life span of the quadruple deletion ( shu1 shu2 shu3 and csm2 ) is 21.5 (n=59). life span. They are believed to be involved in DNA replication. These experiments were completed in the Rothstein lab. These genes ability to suppress mutations and their involvement in DNA replication make them a candidate for having an increased life span. The Rothstein lab had preliminary data that suggested this with one or more of the mutants. After the experiment was completed all strains had very similar life spans (Figure 6-2). A close look at the p-values obtained from the Wilcoxon two-sample paired
PAGE 79
67 signed rank test shows that there may be a small difference between the strains (Table 61). The experiment needs to be repeated (one of the few that has not been) before any major conclusions can be drawn. Table 6-1. P-values of the SHU deletion life spans. Comparison #1 Comparison #2 P-Value W303R5 shu1 0.032 W303R5 shu2 0.003 W303R5 shu3 1.22 x 10 -7 W303R5 csm2 9.07 x 10 -6 W303R5 Quadruple 4.50 x 10 -8 shu1 shu2 0.090 shu1 shu3 1.14 x 10 -4 shu1 csm2 2.12 x 10 -6 shu1 Quadruple 3.30 x 10 -8 shu2 shu3 1.47 x 10 -4 shu2 csm2 1.02 x 10 -5 shu2 Quadruple 4.23 x 10 -6 shu3 csm2 0.016 shu3 Quadruple 1.68 x10 -5 csm2 Quadruple 0.002 Summary This chapter focuses on ideas that were not specifically linked to our episomal aging model. Because these concepts could have played a role in the broader scope of aging, we explored them. It is now known that YCA1 does not affect replicative life span.
PAGE 80
68 We also know that more experiments need to be completed to show definitively the subtle difference between the SHU strains
PAGE 81
69 CHAPTER 7 DISCUSSION Budding yeast is an excellent system in which to study cell-autonomous mechanisms of aging. Mechanisms linked to genome stability, metabolic damage, and metabolic regulation have been found to regulate yeast replicative life span (4547,52,53,102). Sinclair and Guarente have proposed that a key regulator of life span is the cellular level of extrachromosomal rDNA circles ( E R C s) (54). To study this proposal, we have used plasmids to model E R C inheritance and accumulation, two processes that govern E R C levels in yeast cells. Our work shows that plasmid DNAs bring about significant reductions in yeast life span. We find that ARS1 and 2 origin plasmids specifically accumulate in old yeast cells, and that the level of accumulation of ARS1 and 2 origin plasmids in old cells correlates with the extent of reduction in life span. This is the first demonstration to our knowledge of an inverse relationship between DNA episome level in old cells and reduction in life span. We find that plasmids have a direct effect on life span and do not indirectly reduce life span by increasing recombination at the rDNA locus and increasing E R C levels in transformed cells. Analysis of the terminal morphology of senescent cells indicates that plasmids do not cause a stochastic arrest in the cell cycle, which is consistent with a normal aging process. Reduction in life span does not require that plasmids carry rDNA repeat sequences, and the presence of a full-length, functional 9.1 kb rDNA repeat on a plasmid does not augment reduction in life span. These findings confirm the work of Sinclair and Guarente (54), and provide significant new support for their E R C model by directly
PAGE 82
70 demonstrating a relationship between plasmid inheritance, plasmid accumulation, and reduction in life span. Our studies also highlight the value of plasmids as tools to investigate properties of E R C s that are relevant to the aging process in yeast. Why Do ARS Plasmids Accumulate in Mother Cells? It has long been appreciated that ARS plasmids are inherited asymmetrically and accumulate in mother cells (43). This accounts for the high copy number and low mitotic stability of ARS plasmids. However, accumulation of ARS plasmids in cells that are multiple generations old has not been directly demonstrated. Our studies are the first to directly demonstrate that ARS1 -containing plasmids accumulate to high levels in old yeast cells. Although ARS1 plasmid partitioning bias is well known, little is understood about its underlying mechanism. One possibility is that plasmid partitioning bias is due to the nature of cell and nuclear division in budding yeast. During closed mitosis in yeast, an intact nucleus elongates along the axis of the mitotic spindle and adopts an elongated dumb-bell shape due to constriction of the nucleus at the bud neck. Chromosomes pass though the constriction at the bud neck by virtue of their attachment to the mitotic spindle, which is able to exert force on chromosomes. In the absence of spindle attachment, passage of DNA molecules through the constriction at the bud neck may be limited. Consistent with this notion, the relatively small (1.45 kb) TRP RI plasmid has been shown to be inherited efficiently and to exhibit high mitotic stability (103). The small size of the TRP RI plasmid may allow it to readily distribute between mother and daughter cells through the bud neck constriction. Commonly used yeast recombinant DNA vectors are typically larger than the TRP RI plasmid and require cis acting sequences and trans -acting factors to be stably inherited.
PAGE 83
71 Why Do Budding Yeast Exhibit a Mother Cell Plasmid Segregation Bias? One possibility is that mother cell segregation bias is a mechanism to protect progeny cells from potential parasitic effects of episomal DNAs acquired from the environment. The 2 circle is a commensal episomal DNA that Futcher has depicted as a sexually transmitted selfish DNA (89) The 2 circle depends on its capacity to overcome mother cell segregation bias (see below) in order to survive in a host population in the absence of any selective value. Another possibility is that mother cell segregation bias is a mechanism to increase the longevity of progeny cells by limiting transmission of E R C s. Why Do ARS1 Plasmids Bring About Cellular Senescence More Rapidly than Do E R C s? One possibility is that virgin mothers contain more plasmids than E R C s at the start of life span experiments. Virgin mothers must contain at least one ARS plasmid, but probably contain on average ~0.5 E R C per cell. The difference in origin strength between ARS1 and the rDNA ARS may also be important. ARS1 is a relatively strong ARS, and capable of supporting rapid plasmid accumulation in mother cells. E R C s contain a comparatively weak ARS that is likely to support only relatively slow accumulation in mother cells. The rDNA ARS contains an ACS (ARS consensus sequence) that departs from the consensus at position 1 a change that has been shown to reduce ARS function, primarily by limiting DNA unwinding (81). This difference in strength could explain why ARS1 plasmids bring about senescence in mother cells more rapidly than do E R C s. ARS1 plasmids are replicated more efficiently than E R C s, which increases the rate of ARS1 plasmid accumulation in mother cells compared to E R C s
PAGE 84
72 Do Cis -acting Sequences that Counteract Mother Cell Segregation Bias Suppress Reduction in Life Span by ARS1 Plasmids? Yes, ARS1/CEN4 plasmids reduce life span to a lesser extent than ARS1 plasmids, which is consistent with results of Sinclair and Guarente (54). However, inclusion of CEN4 on ARS1 plasmids suppresses the reduction in maximum life span by ARS1 plasmids, but does not fully suppress the reduction in average life span. Our studies also directly show that ARS1/CEN4 plasmids do not accumulate in ~7 generation old mother cells. The reduction in life span is not specific for the combination of ARS1 and CEN4 The combination of ARSH4 and CEN6 (in pRS314, (77)) reduces average life span with a minimal effect on maximum life span. The fact that centromeric DNA elements suppress reduction in maximum life span supports the conclusion that ARS1 plasmids exert their effect by accumulation in mother cells, as discussed above. Do 2 Micron Circles Reduce Life Span? It is initially surprising that cir 0 cells did not have an increased life span compared to cir + cells, especially since 2 origin plasmids accumulated in old cells. Quickly we realized that the 2 circles and 2 origin plasmids were very different. 2 circles did not accumulate in old cells and 2 origin plasmids did. With this knowledge of 2 accumulation, it becomes obvious that 2 circles would not decrease life span. Why Do 2 Micron Origin Plasmids Reduce Life Span? Although both 2 origin plasmids and 2 circles contain the REP3/STB cis -acting stability element, 2 origin plasmids contain a single 599 bp segment, whereas 2 circles contain two 599 bp segments arranged as an inverted repeat (76,80). More efficient autoregulation of 2 circle copy number and inheritance is likely to prevent accumulation in old cells. It is important to note that 2 circles can be toxic to cells
PAGE 85
73 when present at high copy number. Constitutive expression of the 2 amplification machinery results in high copy number and has deleterious effects on cell growth (76). Similarly, mutations in NIB1/ULP1 result in unusually high levels of 2 circles, formation of large inviable or mitotically arrested cells, and clonal lethality (104). Studies by Dobson and coworkers indicate that an abnormal form of Rep2p, a 2 circleencoded plasmid partitioning protein, accumulates in ulp1 mutants, suggesting that ULP1 is involved in partitioning of 2 circles during mitosis (M. Dobson, personal communication). This suggests that high levels of 2 circles in nib1/ulp1 mutants may result from asymmetric inheritance. In this sense, phenotypes associated with nib1 / ulp1 defects may share mechanistic underpinnings with senescent phenotypes associated with asymmetric inheritance of plasmids and E R C s. Why Do 2 Micron Origin Plasmids Have an Intermediate Effect on Life Span? Although 2 origin plasmids accumulate in ~7 generation old mother cells, they attain levels approximately half that observed with ARS1 plasmids. As mentioned above, comparison of results with 2 origin and ARS1 plasmids supports an important semiquantitative inverse relationship: the extent of plasmid accumulation in old cells correlates with the extent of reduction in life span. Why Does Transformation with pJPA114 Lead to 2 Micron Circle Loss? Recent studies of 2 micron plasmid partitioning have made great strides in revealing roles for cis-acting elements and trans-acting factors in substantial cellular and molecular detail (105,106). These studies and earlier studies (76,87) suggest that inheritance of 2 micron plasmids has little mechanistic overlap with inheritance of replicating (ARS) plasmids such as pJPA114. Thus, it seems unlikely that pJPA114 competes with 2 micron circle for a limiting amount of (a) specific mitotic partitioning
PAGE 86
74 factor(s). Another possibility is that pJPA114 adversely affects 2 micron circle copy number, which in turn adversely affects transmission to daughter cells. We have observed that 2 micron circle DNA levels are reduced 30-40% in ~7-generation old cells containing yeast replicating plasmid pJPA113, but not in ~7-generation control cells lacking pJPA113. pJPA113 accumulates to high levels in ~7-generation old cells (86), and perhaps 2 micron circle DNA levels are reduced as a result of this accumulation. pJPA114 attains a high copy number in young cells (86), and is likely to accumulate in old cells, like pJPA113. Although these findings are not conclusive, they are consistent with competition between pJPA114 and 2 micron circles for DNA replication factors and/or precursors, which could lead to reduced 2 micron circle copy number and impaired transmission to daughter cells. By What Mechanism(s) Do Plasmids, and by Implication E R C s, Reduce Life Span in Yeast? It is clear that asymmetric inheritance of plasmid DNAs has the potential to burden mother cells with high DNA content. If we assume that a 5 kb plasmid is replicated once each S phase, and uniformly inherited by the mother cell during M phase, then 12 doublings will yield a plasmid DNA content in excess of the nuclear genomic DNA content (5 X 2 12 = 20.5 Mb plasmid DNA content > ~13 Mb nuclear genomic DNA content). Of course, this example is an oversimplification and omits factors such as origin firing frequency and segregation efficiency. However, we note that after 12 generations, 90% of pJPA113 (5.7 kb ARS1 plasmid) transformants were senescent and after 20 generations, 90% of pJPA133 (4.8 kb ARS1 plasmid) transformants were senescent. The fact that significant percentages of senescent mother cells arise between 10 and 20 generations is consistent with the accumulation of plasmid DNA content to a
PAGE 87
75 level that approaches or exceeds nuclear genomic DNA content. Similarly, Sinclair and Guarente have estimated that the E R C content of old cells exceeds the content of the linear genome (54). Why Are There Less Plasmid Accumulation in Strains that Produce More ERCs? This concept of plasmid competition brings us to believe that there is a replication burden in old cells. Two things could cause the loss of pAF32 (CEN), when it is in the presence of ERCs. A limiting replication factor or DNA substrate could be soaked up by the large quantity of ERCs and not allow the single copy pAF32 to replicate. In another scenario the ERCs could act almost like a physical barrier making it harder for the plasmid to leave the cell. Inheritance and replication are the two mechanisms that are central to the characteristics and behavior of plasmids. The mitotic stability in sir2 WT, and fob1 eliminates the concept of ERCs acting as a physical barrier for inhertance of pAF32. It also raises new questions when looking at the ARS plasmids (pAF31 and pJPA133). Returning to the two plasmid processes, ERCs could be increasing plasmid inheritance or replication. While it is unlikely that ERCs are causing an increase in replication, a look at inheritance allows us to start constructing some models. It is possible that there is a limited amount of space in the nucleus. The total number of episomes cannot be higher than some critical mass of DNA. This would cause the two accumulating episomes to be pushed out of cells and inherited better. Saturation of the plasmid bias machinery could be another mechanism that increases mitotic stability. Episome accumulation in old cells of strains that produce various levels of ERCs shows us that plasmid competition is very real. The reduced level of pJPA133 in sir2 is about half of the copy number than in W303R5. This is dramatic. The most important
PAGE 88
76 part of the plasmid competition phenomenon is whether, it is an output of how episomes causes aging. Mechanistically these two ideas could be very similar. If this is true, we will be able utilize the versatility of plasmids to discover how ERCs cause aging. Is There Episomal Aging in Metazoans? While ERCs have not been found in metazoans, it is hard to say that the absence of evidence for them proves there is no episomal aging is higher organisms. It is possible that another highly repetitive sequence can recombine to form episomes, but they have been very difficult to detect. Also, DNA viruses could be interpreted as episomes that reach high copy within a cell. An analogy can be draw between ERC replication stress and viral commandeering of a cells replication machinery. Both may lead to problems during DNA replication and hence genomic instability. Genomic instability could facilitate the mutations and recombination in various cancer causing genes and increase the incidence of cancer.
PAGE 89
77 CHAPTER 8 MATERIALS AND METHODS This chapter contains the methods and procedure used for experiments throughout this dissertation. Yeast Strains and Plasmids W303AR5 ( MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA [cir + ], (54)) was obtained from D. A. Sinclair. yAF5 and yAF6 were constructed by integrating linearized pRS305 and pRS306 (77), respectively, into the leu2-3,112 or ura3-1 loci of W303AR5, respectively, and genotypes were confirmed by Southern blotting. Plasmids were transformed into W303AR5 using a standard lithium acetate method (107). All experiments were done with freshly-prepared, independentlyisolated, colony-purified transformants. Unless otherwise noted, yeast were grown on selective SD drop in medium (88). Descriptions of plasmids are provided in Table 1. A 200 bp fragment containing ARS1 was amplified by P C R with primers 5-GGAAGCTTCCAAATGATTTAGCATTATC-3 and 5-CCGAATTCTGTGGAGACAAATGGTG3 using template YRp17. A 200 bp fragment containing the rDNA ARS was amplified by P C R with primers 5-CCAAGCTTGTGGACAGAGGAAAAGG -3 and 5-GGGAATTCATAACAGGAAAGTAACATCC -3 using template pJPA102 (rDNA repeat with AhdI endpoints in pCR4, see below). A 753 bp fragment containing CEN4 was amplified by P C R with primers 5-GCGGATCCCCTAGGTTATCTATGCTG -3 and 5-GGGAATTCCTAGGTACCTAAATCCTC-3 using template YCp50. A 1346 bp region of 2 circle DNA, containing the REP3/STB cis
PAGE 90
78 acting stability element and a single 599 bp repeat region, was amplified by P C R with primers 5-CCGGATCCAACGAAGCATCTGTGCTTC -3 and 5-CCAAGCTTTATGATCCAATATCAAAGG -3 using pRS424 as template. rDNA repeats were amplified by P C R using as template size-selected (8-10 kb), genomic DNA that was digested with the appropriate enzyme (AhdI, PsiI, or XmaI). The following primer pairs were used: AhdI endpoints, 5-GGGATCCATGTCGGCGGCAGTATTG-3 and 5-CCTGCAGCTGTCCCACATACTAAATCTCTTC-3 ; PsiI endpoints, 5-GGGATCCTAATATACGATGAGGATGATAGTG3 and 5-CCTGCAGTAATAGATATATACAATACATGTTTTTACC-3 ; XmaI endpoints, 5-CCCGGGGCACCTGTCACTTTGG-3 and 5CCCGGGTAAACCCAGTTCCTCACTAT-3 P C R was performed for 20 cycles with 15-second denaturation and annealing times using PfuTurbo DNA polymerase (Stratagene). P C R products were purified (Qiagen), digested with restriction enzymes and ligated directly into recipient vectors, or cloned into pCR4TOPO (Invitrogen), excised, gel-purified, and ligated into recipient vectors (see Table 21). ARS elements were cloned between HindIII and EcoRI sites. CEN4 was cloned between EcoRI and BamHI sites. The 2 origin was cloned between HindIII and BamHI sites. rDNA inserts were cloned between PstI and BamHI sites in pAF15, which is derived from pRS424 and contains loxP sites that were inserted at EcoRI and SpeI sites using annealed primer pairs: 5-AATTATAACTTCGTATAATGTATGCTATACGAAGTTAT3 and 5-AATTATAACTTCGTATAGCATACATTATACGAAGTTAT -3 (EcoRI); 5-CTAGATAACTTCGTATAATGTATGCTATACGAAGTTAT -3 and 5-CTAGATAACTTCGTATAGCATACATTATACGAAGTTAT-3 (SpeI). All cloned inserts were sequenced in their entirety. Plasmids pJPA105, pJPA106, and pJPA107 (that contain
PAGE 91
79 rDNA inserts) were propagated in E. coli DH5a grown in LB media with 25 g/ml carbenicillin at 30C to avoid insert instability. Mitotic Stability For each plasmid, five transformants were grown in selective SD liquid medium for 2 days at 30C to saturation (OD 600 = 1.1-1.5; 0.5-1X10 7 cfu/ml; growth to late log gave results similar to stationary phase). Approximately 200-250 colony forming units (cfu) of each transformant were plated on non-selective SD medium, grown for 2-3 days at 30C, replica plated onto selective and non-selective agar media, and grown for 3-4 days at 30C. After these plates grow the total number of colonies that grew under no selection are counted from the first plate. The number of colonies that grew under selection are counted from the second plate. Dividing the number of colonies from the second plate by the number of colonies on the first plate gets the percent of cells in the population that had the plasmid. This is the mitotic stability. It is simply the number of colonies that contained the plasmid divided by the total number of colonies. Replicative Life Span Determinations Replicative life span determinations were done essentially as described (92) with a few modifications. Six transformants were streaked individually on one side of an SD agar plate, and 10 virgin mother cells from each (n=60) were positioned in an orthogonal grid pattern. Virgin mothers that failed to give rise to 5 daughters were not included in the data set. Due to the low mitotic stability of ARS-plasmids, it was necessary to start with approximately 250 virgin mother cells from ARS1 -plasmid transformants to obtain n=50-60 for life span determinations. A Zeiss Tetrad microscope equipped with 16X eyepieces was used for micromanipulations as described (88). SD agar plates were weighed at the beginning of each experiment and sterile water was pipetted into four
PAGE 92
80 small notches at the edge of each plate on a daily basis to compensate for evaporation and prevent increases in osmolality, which could potentially affect results (108). During life span experiments, plates were incubated at 30C during the daytime and stored overnight (~12 hours) at 14C. We found that extended periods ( # 24 hours) at 14C reduced life spans of transformants and control strains (data not shown). At the end of a life span experiment, mother cells not having divided for 2 days were transferred to non-selective SD or YPD medium, and cells that resumed mitosis were excluded from the data set. This allowed us to exclude data from mother cells that stopped dividing due to plasmid loss rather than due to cell senescence. Data were entered into an Excel spreadsheet template file (available on request) that automatically calculated relevant life span data values and performed Wilcoxon two-sample paired signed rank tests. Images of terminal cells were collected using a Spot-2 CCD camera (Diagnostic Imaging) affixed to a Zeiss Tetrad microscope and terminal cell morphology analysis was done as described (70) Southern Blot Analysis and Quantitation DNA was extracted from yeast cells using a glass beads/phenol method, digested with restriction enzymes according to the supplier (New England Biolabs), separated on 0.8% agarose gels (200 V/hours), and capillary transferred to positively-charged nylon membrane under alkaline conditions using standard methods (109). For each plasmid copy number and E R C monomer level determination, five plasmid transformants were analyzed in parallel. Digestion with BamHI or PstI yielded single plasmid-specific or genome-specific bands of different sizes that hybridized to 32 P-labeled probe generated by random-primed labeling (New England Biolabs). PstI and BamHI do not cleave rDNA. Genomic bands were used as internal standards for measurements of plasmid levels. Chromosomal rDNA bands were used as internal standards for measurements of
PAGE 93
81 E R C monomer levels. Blots were hybridized first to URA3 or LEU2 probe, followed by stripping and hybridization to rDNA probe. Data from the same blots were used to prepare Figures 2 and 3B. Southern data were acquired with a Typhoon PhosphorImager and analyzed using ImageQuant software (Molecular Dynamics). Pulse field gel electrophoresis was completed at 14C with a Bio-Rad CHEF-DR II. 1% agarose gels were run in 0.5X TBE for 30 hours. The voltage used was 200V with a switch time starting at 5 seconds and ending at 30 seconds. Magnetic Cell Sorting At any given time 1 in 512 cells is an eight generation old cell. This is due to the nature of a doubling population. 1/2 of the cells are new, zero generation daughters. 1/2 of the cell remaining (1/4) are 1 generation old cells. 1/2 of the cell remaining (1/8) are 2 generation old cells. This continues until the number becomes increasingly smaller. To extract the small number of old cells from a large population of cells, magnetic sorting is used. 1x10 8 cells are grown up and labeled with biotin. They are then grown over night in 1 liter of liquid medium. Since new cell wall synthesis occurs at the bud of the emerging cell, no biotin is transferred to the newly divided daughters. This results in a large population of cells that have their oldest cells labeled with biotin and the young cells are not. The cells are then spun down and concentrated into a smaller volume. Strep-avidin coated magnetic beads are mixed with the cells for 2 hours at 4C. All of the subsequent steps are done in the cold to ensure that the cell do not continue to grow. The strong interaction between biotin and avidin allows the magnetic beads to bind to the old cells. The old cells are then pulled out of solution with a strong magnet and the young cells are washed away. Eight washes are used to ensure that the population acquired at
PAGE 94
82 the end of the experiment is homogeneously old. The old cell final product is ready for further use in other experiments. Budscar Histograms After a sort for old cells, a bud scar histogram is conducted to determine the age distribution of the cells collected. When a cell divides a bud scar ring is formed at the point of budding and separation. The bud scar can be stained with a fluorescent dye calcofluor white MR2. A small fraction of old and young cells are stained with calcofluor and the number of bud scars on 50 cells are recorded. This creates a histogram of the number of cells vs. the number of budscars. rDNA Recombination Assay The rDNA recombination assay is designed to quantitate the level of recombination at the rDNA locus. W303AR5 has an ADE2 gene within the rDNA locus. In the absence of the ADE2 gene colonies become red in color, while wild type ADE2 are white. This color phenotype allows the scoring of ade2 colonies to be very easy. Saturated liquid cultures were prepared from five transformants. They were diluted and spread on 15 cm selective SD agar plates containing 5 g/ml adenine hemisulfate and 5 g/ml histidine to enhance red color production. They are allowed to grow at 30C for 2-3 days. The plates are then placed at 4C for 1-2 days for the color to develop. The number of half sector colonies, colonies that are half red half white, are scored in comparison to the number of all white colonies. All other partially sectored or red colonies are ignored. The reason only half sector colonies are scored is because half sectored colonies are colonies that have lost the ADE2 marker on the first division in the colony formation. A completely red colony may have become red at any time in growing in the liquid culture.
PAGE 95
83 By looking at the first division to forming a colony, all of the data can be normalized to a single mitotic event.
PAGE 96
84 APPENDIX A STRAIN: W303AR5+pJPA113 MEDIA: SD aHLW Terminal morphology of senescent cells with its life span directly below the image.
PAGE 97
85 APPENDIX B STRAIN: W303AR5+pJPA116 MEDIA: SD aHLW Terminal morphology of senescent cells with its life span directly below the image.
PAGE 98
86 APPENDIX C STRAIN: W303AR5+pJPA138 MEDIA: SD aHLW Terminal morphology of senescent cells with its life span directly below the image.
PAGE 99
87 APPENDIX D STRAIN: yAF6 MEDIA: SD aHLW Terminal morphology of senescent cells with its life span directly below the image.
PAGE 100
88 APPENDIX E STRAIN: W303AR5+pJPA133 MEDIA: SD aHWu Terminal morphology of senescent cells with its life span directly below the image.
PAGE 101
89 APPENDIX F STRAIN: W303AR5+pJPA136 MEDIA: SD aHWu Terminal morphology of senescent cells with its life span directly below the image.
PAGE 102
90 APPENDIX G STRAIN: W303AR5+pJPA148 MEDIA: SD aHWu Terminal morphology of senescent cells with its life span directly below the image.
PAGE 103
91 APPENDIX H STRAIN: yAF5 MEDIA: SD aHWu Terminal morphology of senescent cells with its life span directly below the image.
PAGE 104
92 APPENDIX I STRAIN: W303R5 +pAF32 MEDIA: YPD Every two rows is the pedigree for a single cell.
PAGE 105
93 APPENDIX J STRAIN: FOB1 +pAF32 MEDIA: YPD Every two rows is the pedigree for a single cell.
PAGE 106
94 APPENDIX K STRAIN: SIR2 +pAF32 MEDIA: YPD Every two rows is the pedigree for a single cell.
PAGE 107
95 A PPENDIX L PLASMIDS USED Table L-1. The plasmids used throughout this dissertation. Plasmid Origin, Insert Marker Backbone Size pJPA105 2 rDNA repeat (XmaI endpoints) TRP1 pAF15 14,829 pJPA106 2 rDNA repeat (AhdI endpoints) TRP1 pAF15 14,746 pJPA107 2 rDNA repeat (PsiI endpoints) TRP1 pAF15 14,747 pJPA113 ARS1 URA3 pRS306 (77) 4,575 pJPA114 rDNA ARS URA3 pRS306 4,575 pJPA116 ARS1 CEN4 URA3 pRS306 5,316 pJPA117 rDNA ARS, CEN4 URA3 pRS306 5,316 pJPA118 rDNA repeat (XmaI endpoints) URA3 pRS306 13,556 pJPA133 ARS1 LEU2 pRS305 (77) 5,698 pJPA136 ARS1 CEN4 LEU2 pRS305 6,468 pJPA138 2 URA3 pRS306 5,703 pJPA148 2 LEU2 pRS305 6,826 pAF15 2 LoxP TRP1 pRS424 (77) 5,692 pAF31 ARS1 URA3,ADE2 pJPA113 6,828 pAF32 ARS1 CEN4 URA3,ADE2 pJPA116 7,568 pRS305 Integrating Vector LEU2 N/A 5,504 pRS306 Integrating Vector URA3 N/A 4,381 pRS424 2 High Copy Vector TRP1 N/A 5,616
PAGE 108
96 APPENDIX M STRAINS USED Table M-1. The strains used throughout this dissertation. Strains Summary Genotype Parent Strain W303R5 WT MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 N/A W303AR5 ADE2::rDNA MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA W303R5 yAF5 pRS305 integration MAT a leu2-3,112::pRS305(LEU2) his3-11,15 ura3-1 ade2-1 trp1-1 can1100 RAD5 ADE2::rDNA W303AR5 yAF6 pRS306 integration MAT a leu2-3,112 his3-11,15 ura31::pRS306(URA3) ade2-1 trp1-1 can1100 RAD5 ADE2::rDNA W303AR5 yAF7 cir 0 MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA cir 0 W303AR5 yAF8 cir 0 MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA cir 0 W303AR5 W1588-4C WT MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W303R5 U952-3B sml1 MAT a sml1::HIS3 leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C U953-61A mec1 MAT a mec1::TRP1 sml1::HIS3 leu23,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C
PAGE 109
97 can1-100 RAD5 U960-5C rad53 MAT a rad53::HIS3 sml1-1 leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1100 RAD5 W1588-4C yAF2 sml1 MAT a sml1::HIS3 leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA W303AR5 HKY580-10D WT MAT (alpha) leu2-3, 112 his3-11, 15 ade2-1 ura3-1 trp1-1 can1-100 RAD5+ W303R5 RMY178-1A fob1 MAT a fob1::URA3 leu2-3, 112 his3-11, 15 ade2-1 ura3-1 trp1-1 can1-100 RAD5+ HKY580-10D RMY206-5B sir2 MAT (alpha) sir2::HIS3 hmr::TRP1 leu2-3, 112 his3-11, 15 ade2-1 ura3-1 trp1-1 can1-100 RAD5+ HKY580-10D T2-3D WT Diploid (WT at all markers) N/A GG621 acs1 acs1::APT1 T2-3D GG625 acs2 acs2::Tn5BLE T2-3D yAF10 WT HIS3 MAT a leu2-3,112::pRS305(LEU2 ) ura31 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA yAF5 yAF1 yca1 MAT a yca1::HIS3 leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA W303AR5 W2889-19B shu1 MAT a shu1::HIS3 leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C U1672 shu2 MAT (alpha) shu2::K. lactis URA3 leu23,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C W4154-3D shu3 MAT a shu3::KANMX leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C
PAGE 110
98 11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W3824-21D csm2 MAT a csm2::KANMX leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C W4173-16B shu1, shu2, shu3. csm2 MAT a shu1::HIS3 shu2::K. lactis URA3 shu3::KANMX csm2::KANMX leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C
PAGE 111
99 LIST OF REFERENCES 1. Guthrie, C., and Fink, G. R. (eds) (1991) Guide to Yeast Genetics and Molecular Biology Vol. 194. Methods Enzymol. Edited by Abelson, J. N., and Simon, M. I., Academic Press, San Diego 2. Guarente, L., Ruvkun, G., and Amasino, R. (1998) Proc Natl Acad Sci U S A 95 11034-11036. 3. Johnson, F. B., Sinclair, D. A., and Guarente, L. (1999) Cell 96 291-302 4. Sherman, F. (1991) Methods Enzymol. 194 3-21 5. Smeal, T., Claus, J., Kennedy, B., Cole, F., and Guarente, L. (1996) Cell 84 633642. 6. Motrtimer, R. K., and Johnston, J. R. (1959) Nature 183 1751-1752 7. Defossez, P. A., Prusty, R., Kaeberlein, M., Lin, S. J., Ferrigno, P., Silver, P. A., Keil, R. L., and Guarente, L. (1999) Mol Cell 3 447-455. 8. Kennedy, B. K., Gotta, M., Sinclair, D. A., Mills, K., McNabb, D. S., Murthy, M., Pak, S. M., Laroche, T., Gasser, S. M., and Guarente, L. (1997) Cell 89 381-391. 9. Park, P. U., Defossez, P. A., and Guarente, L. (1999) Mol Cell Biol 19 38483856. 10. Sinclair, D. A., Mills, K., and Guarente, L. (1997) Science 277 1313-1316 11. Cockell, M. M., and Gasser, S. M. (1999) Curr Biol 12 R575-R576 12. Guarente, L. (1999) Nat Genet 23 281-285. 13. Kaeberlein, M., McVey, M., and Guarente, L. (1999) Genes Dev 13 2570-2580. 14. Fritze, C. E., Verschueren, K., Strich, R., and Easton Esposito, R. (1997) EMBO J 16 6495-6509. 15. Tissenbaum, H. A., and Guarente, L. (2001) Nature 410 227-230. 16. Lin, S. J., Defossez, P. A., and Guarente, L. (2000) Science 289 2126-2128.
PAGE 112
100 17. Shure, M., Pulleyblank, D. E., and Vinograd, J. (1977) Nucleic Acids Res 4 11831205 18. Pruss, G. J. (1985) J Mol Biol 185 51-63. 19. Brill, S. J., and Sternglanz, R. (1988) Cell 54 403-411. 20. Sinclair, D. A., and Guarente, L. (1997) Cell 91 1033-1042. 21. Lohr, D. (1997) J Biol Chem 272 26795-26798. 22. Van Duyne, G. D. (2001) Annu Rev Biophys Biomol Struct 30 87-104 23. Kobayashi, T., Heck, D. J., Nomura, M., and Horiuchi, T. (1998) Genes Dev 12 3821-3830. 24. Warner, J. R. (1989) Microbiol Rev 53 256-271. 25. Melese, T., and Xue, Z. (1995) Curr Opin Cell Biol 7 319-324. 26. Dammann, R., Lucchini, R., Koller, T., and Sogo, J. M. (1993) Nucleic Acids Res 21 2331-2338. 27. Rothstein, R., and Gangloff, S. (1999) Nat Genet 22 4-6. 28. Gerber, J. K., Gogel, E., Berger, C., Wallisch, M., Muller, F., Grummt, I., and Grummt, F. (1997) Cell 90 559-567. 29. Hernandez, P., Martin-Parras, L., Martinez-Robles, M. L., and Schvartzman, J. B. (1993) EMBO J 12 1475-1485. 30. Little, R. D., Platt, T. H., and Schildkraut, C. L. (1993) Mol Cell Biol 13 66006613. 31. Lopez-estrano, C., Schvartzman, J. B., Krimer, D. B., and Hernandez, P. (1998) J Mol Biol 277 249-256. 32. Wiesendanger, B., Lucchini, R., Koller, T., and Sogo, J. M. (1994) Nucleic Acids Res 22 5038-5046. 33. Zou, H., and Rothstein, R. (1997) Cell 90 87-96. 34. Kobayashi, T., and Horiuchi, T. (1996) Genes Cells 1 465-474. 35. Miller, C. A., Umek, R. M., and Kowalski, D. (1999) Nucleic Acids Res 27 39213930. 36. Miller, C. A., and Kowalski, D. (1993) Mol Cell Biol 13 5360-5369.
PAGE 113
101 37. Newlon, C. S. (1997) Cell 91 717-720. 38. Rao, H., and Stillman, B. (1995) Proc Natl Acad Sci U S A 92 2224-2228. 39. Reppe, S., Jemtland, R., and Oyen, T. B. (1999) Biochem Biophys Res Commun 266 190-195. 40. Clyne, R. K., and Kelly, T. J. (1997) Methods 13 221-233. 41. Linskens, M. H., and Huberman, J. A. (1988) Mol Cell Biol 8 4927-4935. 42. Brewer, B. J., and Fangman, W. L. (1988) Cell 55 637-643. 43. Murray, A. W., and Szostak, J. W. (1983) Cell 34 961-970. 44. Tschumper, G., and Carbon, J. (1983) Gene 23 221-232. 45. Sinclair, D. A. (2002) Mech. Ageing Dev 123 857-867 46. Tissenbaum, H. A., and Guarente, L. (2002) Dev Cell 2 9-19 47. Jazwinski, S. M. (2002) Annu Rev Microbiol 56 769-792 48. Mortimer, R. K., and Johnson, J. R. (1959) Nature 183 1751-1752 49. Egilmez, N. K., and Jazwinski, S. M. (1989) J Bacteriol 171 37-42 50. Kennedy, B. K., Austriaco, N. R., Jr., and Guarente, L. (1994) J Cell Biol 127 1985-1993 51. Kennedy, B. K., Austriaco, N. R., Jr., Zhang, J., and Guarente, L. (1995) Cell 80 485-496 52. Mandavilli, B. S., Santos, J. H., and Van Houten, B. (2002) Mutat. Res 509 127151 53. Costa, V., and Moradas-Ferreira, P. (2001) Mol Aspects Med 22 217-246 54. Sinclair, D. A., and Guarente, L. (1997) Cell 91 1033-1042 55. Sinclair, D., Mills, K., and Guarente, L. (1998) Annu Rev Microbiol 52 533-560 56. Kennedy, B. K., Gotta, M., Sinclair, D. A., Mills, K., McNabb, D. S., Murthy, M., Pak, S. M., Laroche, T., Gasser, S. M., and Guarente, L. (1997) Cell 89 381-391 57. Fritze, C. E., Verschueren, K., Strich, R., and Easton Esposito, R. (1997) EMBO J 16 6495-6509
PAGE 114
102 58. Gotta, M., Strahlbolsinger, S., Renauld, H., Laroche, T., Kennedy, B. K., Grunstein, M., and Gasser, S. M. (1997) EMBO J 16 3243-3255 59. Smith, J. S., Brachmann, C. B., Pillus, L., and Boeke, J. D. (1998) Genetics 149 1205-1219 60. Kaeberlein, M., McVey, M., and Guarente, L. (1999) Genes Dev 13 2570-2580 61. Brewer, B. J., Lockshon, D., and Fangman, W. L. (1992) Cell 71 267-276 62. Brewer, B. J., and Fangman, W. L. (1988) Cell 55 637-643 63. Kobayashi, T., and Horiuchi, T. (1996) Genes Cells 1 465-474 64. Ward, T. R., Hoang, M. L., Prusty, R., Lau, C. K., Keil, R. L., Fangman, W. L., and Brewer, B. J. (2000) Mol Cell Biol 20 4948-4957 65. Defossez, P. A., Prusty, R., Kaeberlein, M., Lin, S. J., Ferrigno, P., Silver, P. A., Keil, R. L., and Guarente, L. (1999) Mol Cell 3 447-455 66. Benguria, A., Hernandez, P., Krimer, D. B., and Schvartzman, J. B. (2003) Nucleic Acids Res 31 893-898 67. Park, P. U., Defossez, P. A., and Guarente, L. (1999) Mol Cell Biol 19 3848-3856 68. Mays Hoopes, L. L., Budd, M., Choe, W., Weitao, T., and Campbell, J. L. (2002) Mol Cell Biol 22 4136-4146 69. Merker, R. J., and Klein, H. L. (2002) Mol Cell Biol 22 421-429 70. McVey, M., Kaeberlein, M., Tissenbaum, H. A., and Guarente, L. (2001) Genetics 157 1531-1542 71. Conrad-Webb, H., and Butow, R. A. (1995) Mol Cell Biol 15 2420-2428 72. Kirchman, P. A., Kim, S., Lai, C. Y., and Jazwinski, S. M. (1999) Genetics 152 179-190 73. Kim, S., Benguria, A., Lai, C. Y., and Jazwinski, S. M. (1999) Mol Biol Cell 10 3125-3136 74. Jazwinski, S. M. (2000) Trends Genet 16 506-511 75. Jazwinski, S. M. (2000) Ann N Y Acad Sci 908 21-30 76. Broach, J. R., and Volkert, F. C. (1991) in The molecular and cellular biology of the yeast Saccharomyces (Pringle, J. R., ed) Vol. 1, pp. 297-331, 2 vols., Cold Spring Harbor Press
PAGE 115
103 77. Sikorski, R. S., and Hieter, P. (1989) Genetics 122 19-27 78. Bielinsky, A. K., and Gerbi, S. A. (2001) J Cell Sci 114 643-651 79. Carbon, J., and Clarke, L. (1990) New Biol 2 10-19. 80. Rose, A. B., and Broach, J. R. (1990) Methods Enzymol 185 234-279 81. Miller, C. A., Umek, R. M., and Kowalski, D. (1999) Nucleic Acids Res 27 39213930. 82. Christianson, T. W., Sikorski, R. S., Dante, M., Shero, J. H., and Hieter, P. (1992) Gene 110 119-122 83. Pringle, J. R. (1991) Methods Enzymol 194 732-735 84. Coelho, P. S., Bryan, A. C., Kumar, A., Shadel, G. S., and Snyder, M. (2002) Genes Dev 16 2755-2760 85. Oakes, M., Aris, J. P., Brockenbrough, J. S., Wai, H., Vu, L., and Nomura, M. (1998) J Cell Biol 143 23-34 86. Falcn, A. A., and Aris, J. P. (2003) J Biol Chem In Press 87. Futcher, A. B. (1988) Yeast 4 27-40 88. Sherman, F. (2002) Methods Enzymol 350 3-41 89. Futcher, B., Reid, E., and Hickey, D. A. (1988) Genetics 118 411-415 90. Rose, A. B., and Broach, J. R. (1990) Methods Enzymol 185 234-279 91. Tsalik, E. L., and Gartenberg, M. R. (1998) Yeast 14 847-852 92. Park, P. U., McVey, M., and Guarente, L. (2002) Methods Enzymol 351 468-477 93. Falcon, A. A., and Aris, J. P. (2003) J Biol Chem 278 41607-41617 94. Zhao, X., Muller, E. G., and Rothstein, R. (1998) Mol Cell 2 329-340 95. Cha, R. S., and Kleckner, N. (2002) Science 297 602-606 96. Tercero, J. A., Longhese, M. P., and Diffley, J. F. (2003) Mol Cell 11 1323-1336 97. van den Berg, M. A., de Jong-Gubbels, P., Kortland, C. J., van Dijken, J. P., Pronk, J. T., and Steensma, H. Y. (1996) J Biol Chem 271 28953-28959 98. Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., and Sinclair, D. A. (2003) Nature 423 181-185
PAGE 116
104 99. Kennedy, B. K., Austriaco, N. R., Jr., and Guarente, L. (1994) J Cell Biol 127 1985-1993 100. Madeo, F., Herker, E., Maldener, C., Wissing, S., Lachelt, S., Herlan, M., Fehr, M., Lauber, K., Sigrist, S. J., Wesselborg, S., and Frohlich, K. U. (2002) Mol Cell 9 911-917 101. Huang, M. E., Rio, A. G., Nicolas, A., and Kolodner, R. D. (2003) Proc Natl Acad Sci U S A 100 11529-11534 102. Aguilaniu, H., Gustafsson, L., Rigoulet, M., and Nystrom, T. (2003) Science 299 1751-1753 103. Zakian, V. A., and Scott, J. F. (1982) Mol Cell Biol 2 221-232. 104. Holm, C. (1982) Cell 29 585-594 105. Mehta, S., Yang, X. M., Chan, C. S., Dobson, M. J., Jayaram, M., and Velmurugan, S. (2002) J Cell Biol 158 625-637 106. Scott-Drew, S., Wong, C. M., and Murray, J. A. (2002) Cell Biol Int 26 393-405 107. Gietz, R. D., and Woods, R. A. (2002) Methods Enzymol 350 87-96 108. Kaeberlein, M., Andalis, A. A., Fink, G. R., and Guarente, L. (2002) Mol Cell Biol 22 8056-8066 109. Wu, P., Brockenbrough, J. S., Metcalfe, A. C., Chen, S., and Aris, J. P. (1998) J Biol Chem 273 16453-16463
PAGE 117
105 BIOGRAPHICAL SKETCH I was born in San Jose, CA on January 7, 1979. At the age of five I moved to Ormond Beach, FL. I went Seabreeze Senior High School (in Daytona Beach, FL) where I graduate as the valedictorian. In August 1997, I started at the University of Florida (UF). In August 1999, I received a Bachelor of Science in Biochemistry from UF. That same month I started the Interdisciplinary Program in Biomedical Sciences at UF, to work on my Ph.D.
|
|
