Citation
Genetic Association of Catalase and Antigen Processing Genes with Vitiligo Susceptibility

Material Information

Title:
Genetic Association of Catalase and Antigen Processing Genes with Vitiligo Susceptibility
Creator:
CASP, COURTNEY BRADLEY ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Alleles ( jstor )
Enzymes ( jstor )
Exons ( jstor )
Genotypes ( jstor )
Melanocytes ( jstor )
Oxidative stress ( jstor )
P values ( jstor )
Pathogenesis ( jstor )
Skin ( jstor )
Vitiligo ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Courtney Bradley Casp. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/20/2003
Resource Identifier:
80611064 ( OCLC )

Downloads

This item has the following downloads:

casp_c ( .pdf )

casp_c_Page_010.txt

casp_c_Page_067.txt

casp_c_Page_074.txt

casp_c_Page_137.txt

casp_c_Page_002.txt

casp_c_Page_128.txt

casp_c_Page_025.txt

casp_c_Page_101.txt

casp_c_Page_095.txt

casp_c_Page_078.txt

casp_c_Page_100.txt

casp_c_Page_111.txt

casp_c_Page_141.txt

casp_c_Page_104.txt

casp_c_Page_120.txt

casp_c_Page_028.txt

casp_c_Page_052.txt

casp_c_Page_047.txt

casp_c_Page_009.txt

casp_c_Page_118.txt

casp_c_Page_014.txt

casp_c_Page_106.txt

casp_c_Page_092.txt

casp_c_Page_083.txt

casp_c_Page_059.txt

casp_c_Page_113.txt

casp_c_Page_077.txt

casp_c_Page_057.txt

casp_c_Page_064.txt

casp_c_Page_105.txt

casp_c_Page_140.txt

casp_c_Page_114.txt

casp_c_Page_032.txt

casp_c_Page_122.txt

casp_c_Page_119.txt

casp_c_Page_079.txt

casp_c_Page_088.txt

casp_c_Page_103.txt

casp_c_Page_069.txt

casp_c_Page_090.txt

casp_c_Page_061.txt

casp_c_Page_063.txt

casp_c_Page_087.txt

casp_c_Page_003.txt

casp_c_Page_115.txt

casp_c_Page_015.txt

casp_c_Page_007.txt

casp_c_Page_026.txt

casp_c_Page_093.txt

casp_c_Page_131.txt

casp_c_Page_138.txt

casp_c_Page_126.txt

casp_c_Page_019.txt

casp_c_Page_001.txt

casp_c_Page_051.txt

casp_c_Page_021.txt

casp_c_Page_027.txt

casp_c_Page_073.txt

casp_c_Page_108.txt

casp_c_Page_066.txt

casp_c_Page_097.txt

casp_c_Page_135.txt

casp_c_Page_123.txt

casp_c_Page_082.txt

casp_c_Page_065.txt

casp_c_Page_011.txt

casp_c_Page_075.txt

casp_c_Page_036.txt

casp_c_Page_037.txt

casp_c_Page_050.txt

casp_c_Page_038.txt

casp_c_Page_133.txt

casp_c_Page_121.txt

casp_c_Page_054.txt

casp_c_Page_127.txt

casp_c_Page_033.txt

casp_c_Page_134.txt

casp_c_Page_005.txt

casp_c_Page_132.txt

casp_c_Page_044.txt

casp_c_Page_102.txt

casp_c_Page_048.txt

casp_c_Page_035.txt

casp_c_Page_041.txt

casp_c_Page_030.txt

casp_c_Page_139.txt

casp_c_Page_013.txt

casp_c_Page_043.txt

casp_c_Page_056.txt

casp_c_Page_107.txt

casp_c_pdf.txt

casp_c_Page_084.txt

casp_c_Page_086.txt

casp_c_Page_076.txt

casp_c_Page_029.txt

casp_c_Page_109.txt

casp_c_Page_085.txt

casp_c_Page_094.txt

casp_c_Page_112.txt

casp_c_Page_116.txt

casp_c_Page_042.txt

casp_c_Page_071.txt

casp_c_Page_072.txt

casp_c_Page_125.txt

casp_c_Page_031.txt

casp_c_Page_099.txt

casp_c_Page_004.txt

casp_c_Page_091.txt

casp_c_Page_049.txt

casp_c_Page_045.txt

casp_c_Page_098.txt

casp_c_Page_089.txt

casp_c_Page_068.txt

casp_c_Page_136.txt

casp_c_Page_053.txt

casp_c_Page_008.txt

casp_c_Page_124.txt

casp_c_Page_016.txt

casp_c_Page_080.txt

casp_c_Page_055.txt

casp_c_Page_023.txt

casp_c_Page_017.txt

casp_c_Page_070.txt

casp_c_Page_024.txt

casp_c_Page_117.txt

casp_c_Page_096.txt

casp_c_Page_018.txt

casp_c_Page_130.txt

casp_c_Page_022.txt

casp_c_Page_129.txt

casp_c_Page_039.txt

casp_c_Page_040.txt

casp_c_Page_081.txt

casp_c_Page_058.txt

casp_c_Page_006.txt

casp_c_Page_110.txt

casp_c_Page_020.txt

casp_c_Page_012.txt

casp_c_Page_062.txt

casp_c_Page_046.txt

casp_c_Page_034.txt

casp_c_Page_060.txt


Full Text











GENETIC ASSOCIATION OF CATALASE AND ANTIGEN PROCESSING GENES
WITH VITILIGO SUSCEPTIBILITY














By

COURTNEY BRADLEY CASP


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2003































Copyright 2003

by

Courtney Bradley Casp






































This dissertation is dedicated to my husband Justin, who encouraged me every step of the
way.
















ACKNOWLEDGMENTS

I first would like to thank my mentor, Dr. Wayne McCormack, for his guidance and

encouragement in the completion of my studies. I thank him for patiently and

knowledgeably answering the hundreds of questions I have asked him over the course of

my dissertation work. He is an inspiring educator, both in the classroom and in the lab.

Next, I would like to thank the members of my dissertation committee, Dr. Mike

Clare-Salzler, Dr. Sally Litherland, and Dr. Peggy Wallace, for their time, energy and

guidance. I would like to extend special thanks to Dr. Litherland, who patiently taught

me monocyte culture techniques, and whose lab and onfce were always open to me.

I am indebted to many members of the McCormack lab, past and present, most

notably Deb Fisher and Bryan Riggeal, who were always around to lend both an ear and a

hand. Special thanks also go out to the Clare-Sazler and Litherland lab members who

have shared both their expertise and their lab space with me. I also wish to thank Kim

Blenman, Linda Archer and Dr. Rita Hurst, who have provided me with scientific as well

as much needed personal support. I am forever indebted to these friends and co-workers

who have helped me to accomplish my goals.

On a personal note, I would like to thank my entire family for their unwavering

encouragement. Specifically, I thank my parents, my mother Connie Bradley, my father

Tim Bradley, and my stepmother June Bradley, who have fostered dedication and

encouraged me to always "do the right thing." I also thank my father-in-law and mother-

in-law, Mark and Marcy Casp, who have given me encouragement and support as well as










a laptop for which to write this document. I thank my husband who has stood behind me

and cheered every step of the way. I thank him for his optimism and love, which have

kept me going even on my darkest days. Finally, I thank my beautiful daughter Ashlyn,

who, when I look at her innocent face, reminds me to keep everything in life in

perspective.




















TABLE OF CONTENTS

Page

ACKNOWLEDGMENT S .............. .................... iv


LIST OF TABLES ................. ..............ix..___ ......


LI ST OF FIGURE S .............. .................... xi


AB STRAC T ................ .............. xii


CHAPTER


1 INTRODUCTION ................. ...............1.......... ......


Skin Structure and Physiology............... ...............
Vitiligo Pathogenesis ................. ...............4.................
Autoimmune Hypothesis ................. ...............5.................
Cytotoxic hypothesis .............. ...............8.....
Treatm ent ................. ................. 10..............
Genetics of Vitiligo ................. ...............12........... ....
Vitiligo Candidate Genes............... ...............15.
Immune System Genes.............. ...... .. .............. ................15.....
Low-molecular-weight polypeptide 2 (LMP2), low-molecular-weight
polypeptide 7 (LMP7) and multicatalytic-endopepidase-complex-like 1
(M EC L i) ................ ... ......... .... ....... ..............1
Transporter associated with antigen processing 1 and 2 (TAPI and TAP2)16
CD28 and CTLA4 (CD152) ................. ...............17...............
C D 4 .............. ...............17....
IL-12p40 ........._... .. ...............18...__........

IL-1P ........._.... .. .... ... ... ... ... .. .. ....... .......1
Autoimmune polyendocrinopathy syndrome type-1 (APS-1)/autoimmune
regulator (AIRE) ................... .......... ...............19.......
Melanocyte Biochemistry and Oxidative Stress............... ...............19.
Catalase (CAT)..................... .. .............1
GTP cyclohydrolase 1 (GCH1) ................. ...............20...............


2 CASE/CONTROL AND FAMILY-BASED AS SOCIATION STUDIES .................21


Introducti on ................. ...............21.................
Materials and Methods .............. ...............22....













Subj ects ................. ...............22.................
BI ood Processing ................. ...............22.......... ......
DNA Extraction............... ...............2
Prim ers ................... ...............24.......... ......
Microsatellite Markers............... ...............25
RFLP and AFLP Markers............... ...............25

Statistical Analysis .............. ...............28....
Re sults........._....... ...... ...............3 0....

Immune Sy stem Genes .........._.... ...............3 0....___. ....
Melanocyte-specific Genes .............. ...............36....
Discussion ................. ...............40.................


3 ANTIGEN PROCESS SING AND PRESENTATION GENES ................. ................46


Introducti on ................. ...............46.................
Materials and Methods .............. ...............47...

Blood Collection and Processing............... ...............4
LMP7 Sequencing .................... ........... ..........4
DNA preparation and PCR amplification .............. ..... ............... 4
Direct sequencing of PCR products ............. ..... .................48
R e sults.........._..... .... .._._. ........ ...............50.
Case/Control Association Studies .............. ...............50....
Allele and genotype frequencies .............. ...............50....
Family-based association .............. ...............56....
LMP7 Sequencing .............. ...............58....
Discussion ............. ...... ._ ...............58...


4 CATALASE .............. ...............66....


Introducti on ................. ...............66.................
Materials and Methods .............. ...............67...

Blood Collection and Processing............... ...............6
Catalase Sequencing .................. ............ .... ...............67.....
DNA preparation and PCR amplification .............. ..... ............... 6
Direct sequencing of PCR products ................. ..............................69
Re sults ................ ............. ... ...............70.....

Catalase Gene Polymorphisms ................... ... ............. .... ........... .............7
Association of the T/C Exon 9 (BstX I) CAT Marker with Vitiligo ................... 72
Family-Based Association............... ..............7
Catalase Sequencing ........._..... ...._... ...............74.....
Discussion ........._..... ...._... ...............74.....


5 CANDIDATE VITILIGO SUSCEPTIBLITY GENE EXPRESSION STUDIES....79


Introducti on ................. ...............79.................
Materials and Methods ............... ...............80....

Monocyte Isolation and Culture .............. ...............80....












S emi-Quantitative RT-PCR............... ...............8 1
Flow Cytometry of P2-microglobulin .............. ...............83....
Catalase Enzyme Assay ................. ...............83........... ....
H202 Treatment of Monocytes ....._.. ............_. .........._ ...._.._.. ...84
Re sults................. ...............84........_ .....
Catalase Assay ................. .......... ...............84......

P2-Microglobulin Expression............... ...............8
H202 Treatment .............. ...............89....
RNA Expression Studies ................ ...._.._ ...............89......
Discussion ................ ...............91........ ......


6 DISCUSSION: OXIDATIVE STRESS AND THE IMMUNE SYSTEM IN
VITILIGO PATHOGENE SIS ............ .....__ ...............101..


Oxidative Stress ............... ... ....... ..__. ............ ............10
Reactive Oxygen Species and Autoimmunity .............. ...............103....
Antioxidant Levels in Autoimmune Disease .....___ ..........._... ...............103
Transfection of Antioxidant Genes ........._...... ...... ..___ ......._ ..............105
Antioxidants and Reactive Oxygen Species in Autoimmunity ........._..............106
Antigen Processing, Oxidative Stress and Vitiligo............... ...............10
Vitili go and Oxi dative Stre s s................. ....___ ...............108 .
Vitiligo and Catalase .............. ...............108....
Vitiligo and MHC class II genes ............__......___....._ ..........10
Future Directions ............ _...... ._ ............... 111...


LIST OF REFERENCES ............_ ..... ..__ ...............113..


BIOGRAPHICAL SKETCH ............_...... ._ ...............128...

















LIST OF TABLES


Table pg

2-1. Vitiligo patient and unaffected relative samples collected for case/control and
family-based analyses. ............. ...............23.....

2-2. Primer sequences ................. ...............26......___ ....

2-3. Microsatellite primer conditions. ............. ...............27.....

2-4. RFLP/S SCP PCR conditions............... ...............2

2-5. Case/control association analysis for CD28 by microsatellite (CAA 3' UTR) ........34

2-6. Case/control association analysis for CTLA4 by microsatellite (AT 3' UTR) ........34

2-7. Case/control association analysis of CTLA4 by RFLP (Bst E II +49 A/G)............35

2-8. Case/control association analysis of CTLA4 by RFLP (Hae III intron 1 C/T).......35

2-9. Case/control association analysis s of AP S- 1 by S SCP (C/T exon 5) ................... .....3 7

2-10. Case/control association analysis of APS-1 by RFLP (Hae III exon 10 T/C).........37

2-11. Case/control association analysis of IL-1P by RFLP (Ava I -511 C/T) ..................3 8

2-12. Case/control association analysis of CD4 by Microsatellite (TTTTC repeat 5' UTR)3 8

2-13. Case/control association analysis of IL-12p40 by RFLP (Taq 1 C/A 3' UTR)........39

2-14. Case/control association analysis of GCH1 by RFLP (Bsa Al C/T exon 6) ...........39

3-1. LMP7 primers for sequencing across the gene .............. ...............49....

3-2. Primers used for LM~P TAP and M~ECL 1 genotyping ................. ......................51

3-3. Linkage disequilibrium analysis of Caucasian vitiligo patients (age of onset 0-29
years) and control subjects. ............. ...............53.....

3-4. Allele frequencies of LM~PTAP and M~ECL1 candidate genes in Caucasian vitiligo
patients (age of onset 0-29 years) and control subj ects..........._.._.._ ......_.._.. .....54










3-5. Genotype frequencies of LM~PTAP and M~ECL1 candidate genes in Caucasian
vitiligo patients and (age of onset 0-29 years) control subj ects. ........._...._ .............55

3-6. Family based association (transmission disequilibrium test) results for LM~P TAP
and M~ECL candidate genes and vitiligo susceptibility .............. ....................5

4-1. Catalase primers for sequencing across the gene ........................... ...............68

4-2. Sequences of primers used for CAT genotyping .......... ................ ...............71

4-3. Distribution of alleles and genotypes for the T/C SNP in CA T exon 9 in vitiligo
patient and control populations .............. ...............73....

4-4. Carriage rates and heterozygosity of the T/C SNP in CA T exon 9 in vitiligo patients
compared to control s .............. ...............73....

4-5. Catalase gene single nucleotide polymorphisms (SNPs). ............. ....................75

5-1. RT-PCR primer pairs and PCR conditions for LMP2, LMP7, TAP1, TAP2 and
catalase .............. ...............82....

5-2. Genotypes of patients treated with 500 U IFN-y, and used in mRNA, catalase and,
P2-microglobulin expression studies with corresponding catalase enzyme activity
and mean P2-microglobulin fluorescence. ............. ...............90.....

















LIST OF FIGURES


Figure pg

1-1. Melanin biosynthesis pathway .............. ...............3.....

2-1. CD28 allele frequency............... ...............3

2-2. CTLA4 allele frequency ................. ...............33................

5-1. Monocyte catalase levels in patients and controls .............. .....................8

5-2. Erythrocyte catalase levels in vitiligo patients and normal controls. .......................87

5-3. P2-microglobulin expression on patient and control monocytes.. ..........._...............88

5-4. Messenger RNA expression of LMP2, LMP7, TAPI1 and TAP2 in patient and
control monocytes after overnight treatment with 1000 U IFN-y. ................... ........92

5-5. Messenger RNA expression of LMP2, LMP7, TAPI1 and TAP2 in patient and
control monocytes after overnight treatment with 500 U IFN-y. .............................93

5-6. Catalase/18S RNA ratios with and without overnight treatment with 500U IFN-y. 94
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

GENETIC ASSOCIATION OF CATALASE AND ANTIGEN PROCESSING GENES
WITH VITILIGO SUSCEPTIBILITY




By

Courtney Bradley Casp

December 2003

Chair: Wayne T. McCormack
Maj or Department: Pathology, Immunology, and Laboratory Medicine

Vitiligo is a common dermatological disorder of the epidermis and hair follicles,

manifested clinically as expanding hypopigmented lesions of the skin. Vitiligo

pathogenesis is believed to be due to autoimmune destruction of the melanocyte, or

autotoxicity in the melanocyte. Vitiligo often appears in multiple family members,

suggesting a genetic component to vitiligo pathogenesis. The goal of this study was to

test the hypothesis that vitiligo pathogenesis is caused in part by genetic susceptibility to

both autoimmune and autotoxic events in the epidermis due to genetic differences in

genes involved in the regulation of the immune response, melanin production and

oxidative stress.

Through the use of case/control and family based association studies, two

susceptibility genes for vitiligo were identified. Susceptibility to vitiligo was

demonstrated for a gene(s) in or near the LMP/TAP region of the MHC class II genomic










region. The LMP/TAP gene products are responsible for processing and transport of

antigenic peptides for presentation to the immune system via MHC class I molecules.

Messenger RNA expression studies of LMP2, LMP7, TAPI1 and TAP2 genes did not

show alterations in expression of mRNA for any of these genes in monocytes derived

from vitiligo patients and normal controls. However, expression studies of MHC class I

revealed decreased expression of MHC class I on monocytes from vitiligo patients,

suggesting some alterations in the MCH class I presentation pathway. The second

vitiligo susceptibility gene, catalase, is an important antioxidant, responsible for breaking

down hydrogen peroxide. Messenger RNA expression studies of catalase found no

alteration in catalase mRNA expression between patients and controls. Enzyme

expression studies of catalase, however, revealed decreased expression of catalase in the

monocytes of vitiligo patients, a result not seen in erythrocytes from these same patients.

These results demonstrate a possible role for genes involved in immune system

regulation, as well as for genes involved in regulating oxidative stress in vitiligo

susceptibility. Thus, the etiology of vitiligo may rely on both autotoxic events in the

melanocyte, allowing for increased oxidative stress in the epidermis and inappropriate

autoimmune presentation of self-peptides to the immune system.















CHAPTER 1
INTTRODUCTION

Vitiligo is a common dermatological disorder of the epidermis and hair follicles,

affecting both genders and ~1% of the population in all ethnic groups worldwide.

(Nordlund and Ortonne, 1998). Vitiligo is defined clinically by expanding areas of

hypopigmentation on the skin surface due to the destruction or inactivation of epidermal

melanocytes (Badri et al., 1993; Majumder et al., 1993; Tobin et al., 2000). Vitiligo

pathology is limited to the depigmentation of the epidermis, but it is often associated with

other autoimmune disorders such as alopecia areata and Hashimoto's thyroiditis (Badri et

al., 1993; Kemp et al., 1999). Depigmentation can occur anywhere on the body including

the face. The striking appearance of depigmented areas flanked by normal tissue can

cause social stigmatism and physiological distress in affected individuals. Treatment for

vitiligo is often both expensive and time and labor intensive for the patient, with

insurance companies often denying coverage because it is often considered to be purely a

cosmetic disorder. This study's goal was to determine potential genetic susceptibility of

a variety of candidate genes to vitiligo, and further characterize the expression of these

genes in vitiligo patients.

Skin Structure and Physiology

Human skin is made up of two main layers, the epidermis, which is described as a

stratified squamous epithelium mainly consisting of keratinocytes, and the dermis, an

underlying layer of vascularized connective tissue (Nordlund and Ortonne, 1998).

Melanocytes reside at the junction of the dermis and the epidermis and produce the










protein melanin that provides pigmentation for the skin and hair. The production of

melanin begins with the amino acid tyrosine, and ends with the production of the red-

yellow pheomelanin, and the more common brown-black eumelanin. The production of

these two pigments occurs through two different pathways, both of which require the

rate-limiting enzyme tyrosinase (Figure 1-1). Melanin is produced in melanosomes,

specialized organelles that are translocated from the center of the melanocyte cytoplasm

to the tip of its dendrites. The dendrites are then involved in the transfer of the

melanosomes to the keratinocytes.

Keratinocytes also develop at this dermal epidermal junction, where they are in a

constant state of mitosis. As new keratinocytes are made, the older ones are forced

toward the surface of the epithelium carrying their cargo of melanin. On the way to the

epidermal surface, melanosomes are degraded in the keratinocyte's lysosomes, and the

melanin becomes finely dispersed. It is thought that the degree of dispersion of the

melanosome helps to dictate skin tone, with darker-skinned individuals seeming to have

less degradation of the melanosomes. Darker-skinned individuals also produce more

melanin, as well as melanin of a darker color than fair-skinned individuals. When the

keratinocytes reach the epithelial surface they compact and form a protective layer of

keratin before they are shed off (Nordlund and Ortonne, 1998). This keratin layer

protects the skin from injury, and the melanin cargo it carries helps to protect the skin

from the damage of ultraviolet rays. Melanin production is stimulated with excessive

exposure to ultraviolet rays, which is commonly known as tanning.

The hypopigmented lesions in vitiligo patients are a result of the destruction and/or

inactivation of the melanin-producing melanocytes. Keratinocytes still make their


















IL TRP-Z TRP-1

dopaquinane eumelanins
pyrovinasee Pm- (rownfblack)


phenylalanine < tyrosine
phenylarlanine hydmroyase .


P35


6-BH4


I


pheumelanius
(yellow/red)


7-BH4


L-dops


dopamine


GTP-cyclohyvdmine I


HNF1/4


norepinephrine

PNMT *
epinephrine


GTP


Figure 1-1. Melanin biosynthesis pathway










migration to the surface of the epithelium, albeit without their cargo of pigment. This

results in patches of skin that look milky-white because they are devoid of pigment.

There are two main types of vitiligo, segmental and non-segmental, and classification

relies on the distribution of hypopigmented lesions. In segmental vitiligo the areas of

depigmentation are random and often occur on just one location on the body. Segmental

vitiligo is also sometimes marked with the loss of melanocytes from the hair follicles and

a loss of hair pigment. Segmental vitiligo is less likely to repigment than non-segmental

vitiligo; however it is also less likely to spread to other areas of the body. Non-segmental

vitiligo usually manifests in a strikingly symmetrical pattern and often does not affect the

hair follicles in the areas of depigmentation. Non-segmental vitiligo often gets

progressively worse, spreading to more areas of the body over time. Some patients with

non-segmental vitiligo almost completely depigment over the years. With non-segmental

vitiligo there is sometimes spontaneous repigmentation, or partial repigmentation with

treatment; however, the patient rarely fully returns to pre-disease pigmentation.

Segmental and non-segmental vitiligo present very differently clinically and may have

different etiologies (Bos, 1997; Nordlund and Ortonne, 1998).

Vitiligo Pathogenesis

The average age of onset in vitiligo is 20-23 years of age (Nordlund and Ortonne,

1998). Because patients are not usually born with the disease, it is thought that an

initiating event, such as illness, stress, UV exposure or injury, may trigger

depigmentation. It has been shown that the numbers of melanocytes in depigmented

lesions are vastly reduced or absent; however, the mechanisms of this apparent

destruction have been widely debated. The two theories with the most evidence are that

1) the destruction of the melanocyte is due to the buildup of toxic by-products in the









melanin biosynthesis pathway, and 2) the destruction is autoimmune in origin. These

theories are not mutually exclusive, and in fact, the actual onset of disease might involve

a combination of autotoxic as well as autoimmune events.

Autoimmune Hypothesis

The autoimmune theory of vitiligo etiology is the most popular as well as the most

substantiated. First serum anti-melanocytic antibodies are found in many, but not all,

vitiligo patients, and are not found in healthy pigmented individuals. These antibodies

are directed against tyrosinase, tyrosinase-related protein 1 (TRPl), tyrosinase-related

protein 2 (TRP2), and melanin-concentrating hormone receptor 1 (MCHR1) (Cui et al.,

1993; Song et al., 1994; Kemp et al., 1999; Kemp et al., 2002). However, in vitro work

with these autoantibodies has suggested that the presence of the anti-melanocytic

autoantibodies may just be a marker of active vitiligo and may have little or no active role

in initiating or maintaining the disease (Bos, 1997).

The first evidence of cell-mediated immunity playing a role in the pathogenesis of

vitiligo came from the observation of invading lymphocytes in studies of "inflammatory

vitiligo," a disease characterized by a raised red rim surrounding the depigmented lesion

(van den Wijngaard et al., 2001). Lesional skin of non-inflammatory vitiligo patients has

more recently been shown to contain significantly higher levels of CD3 CD4 and

CD8+ T cells than found in control skin and in skin outside lesions in the same patients

(Badri et al., 1993; Le Poole et al., 1996). Melanocytes also have been found in rare

circumstances to both take up antigen through phagocytosis, as well as to present antigen

via MHC class II molecules (Le Poole et al., 1993a, 1993b). It has been shown that 2/3

of perilesional melanocytes in vitiligious skin express antigen on MHC class II (al Badri

et al., 1993).









Most immunohistochemical studies suggest that melanocytes are almost completely

destroyed, as opposed to being inactive or dormant, and this loss is accompanied by

dermal and epidermal infiltrates in the active lesion, which include an increase in CD4+

and CD8' T cells (Hann et al., 1992; Le Poole et al., 1993a; Badri et al., 1993; Le Poole

et al., 1996). More recent work suggests that not all melanocytes are destroyed in the

lesion; however, those remaining have been rendered dysfunctional (Tobin et al., 2000).

Further evidence of an abnormal immune response is a reversal of the CD4 /CD8+ ratios

as well as a decrease in CD45RA cells in vitiligo patient peripheral blood (Mozzanica et

al., 1990; Abdel-Naser et al., 1992). Disruptions in Langerhans cells in vitiligo have also

been reported, with decreased numbers seen in active vitiligo with a return of normal

numbers in stable vitiligo (Kao and Yu, 1990). It is important to note that variation in

published data on peripheral cell imbalances may be due to a variety of factors such as

differences in study populations, differences in vitiligo disease presentation and/or

progression, and prior immune-suppressive therapy (Ongenae et al., 2003).

A subclass of lymphocytes contains an inducible carbohydrate moiety known as

cutaneous lymphocyte antigen (CLA) on their surface (Fuhlbrigge et al., 1997). This

carbohydrate moiety targets these lymphocytes to the dermis by an interaction with its

ligands E and P selections and through the dispersion of a chemokine known as CTACK

(Picker et al., 1993; Robert and Kupper, 1999; Campbell et al., 1999; Morales et al.,

1999). Both E and P selections, as well as CTACK, are upregulated upon local skin

inflammation, injury and UV exposure. In certain skin disorders, such as atopic

dermatitis and psoriasis, an increased percentage of CLA' lymphocytes is observed in

peripheral blood and skin as compared to controls. Our own studies have shown









encouraging, but not definitive signs that this increase in CLA+ T cells (especially CD4 )

is seen in vitiligo patients' peripheral blood (unpublished data). Cytotoxic T

lymphocytes that are specific for Mel-A, a melanocyte surface marker, and have a CLA

carbohydrate moiety have been shown to be at far higher levels in vitiligo patients than in

controls. While Mel-A+ CTLs were also found in control subjects, these cells were not

CLA This absence of CLA prevents these from migrating to the skin to attack the

melanocytes, thus preventing the induction of vitiligo (Ogg et al., 1998).

Further evidence of immune events mediating vitiligo is seen in the altered

expression of several cytokines in patients. The expression of ICAM-1 in vitiligo

patients has been shown to be six-fold higher than in controls (al Badri et al., 1993).

Soluble IL-2 receptor levels are expressed at high concentrations in vitiligo patients.

(Honda et al., 1997; Yeo et al., 1999; Caixia et al., 1999, Tu et al., 1999). Peripheral

blood of patients also has increased concentrations of pro-inflammatory cytokines IL-6

and IL-8 as well as a decreased production of GM-CSF, TNF-ot, and INF-y (Yu et al.,

1997).

The association of vitiligo with other known autoimmune disorders such as

Addison's disease, Hashimoto's thyroiditis, pernicious anemia and alopecia areata also

supports the autoimmune theory of disease. In addition, it has been observed that

successful treatment for melanoma sometimes results in spontaneous vitiligo, suggesting

that a successful anti-melanoma immune response might attack normal healthy

melanocytes, due to the sharing of many of the same surface antigens (Overwijk et al.,

1999; Bronte et al., 2000). These findings suggest that a T cell mediated attack on the









melanocyte can produce areas of sustained depigmentation, a scenario that has also been

suggested in the etiology of vitiligo.

The most useful animal model of vitiligo pathogenesis is the Smyth-line chicken.

The Smyth-line chicken expresses many of the maj or features of human vitiligo including

cutaneous depigmentation that is variable in appearance and most often occurs during

adolescence. These chickens also suffer with alopecia and autoimmune thyroiditis and

blindness. Pathogenesis in these animals also supports an autoimmune etiology as

lymphocytic infiltration is seen in the depigmented areas, melanocyte specific

autoantibodies are present, and steroid treatment can halt and sometimes improve

pigmentation (Lamoreaux and Boissy, 2000).

Cytotoxic hypothesis

The cytotoxic hypothesis is based on the premise that the loss of melanocytes in

vitiligo patients is a direct result of an inherent defect in the melanocyte, most probably

resulting in the buildup of toxic intermediates or metabolites from the melanin

biosynthesis pathway. There has been increasing evidence for a role for oxidative stress

in the involvement of vitiligo pathogenesis, based primarily on reported defects in several

key enzymes in the melanin biosynthesis pathway. Vitiligo patients show an increased

epidermal de novo synthesis and recycling of 6(R)-L-erythro-5,6,7,8-tetrahydrobiopteri

(6BH4). It is the accumulation of these oxidized pterins (6- and 7-biopterin) that results

in the fluorescence of vitiligo skin under a Woods UV lamp, which is used for the

definitive diagnosis of vitiligo in a patient (Schallreuter et al., 2001).

Vitiligo patients also show very low levels of 4a-OH-tetrahydrobiopterin

dehydratase (DH) activity which is involved in the recycling pathway of 6BH4. Due to

decreased DH activity, there is an increased buildup of the 7-isomer form of 6BH4,










(7BH4), which functions as an effective competitor of 6BH4. A buildup of 7BH4 wl

affect phenylalanine hydroxylase (PAH) activity. PAH activity is often decreased in

vitiligo patients, which causes a buildup of epidermal L-phenylalanine levels.

All of these abnormal biochemical events in the vitiligo epidermis may contribute

to increased levels of hydrogen peroxide (H202). High concentrations of H202 can

deactivate catalase, an enzyme normally involved in breaking down H202 and other free

oxygen radicals. Low catalase activities have previously been reported in the epidermis

of vitiligo patients, whether this defect is due to an increase in H202 fTOm the defective

6BH4 pathway or due to a separate problem in the catalase enzyme is unknown. What

has been shown is that treatment with pseudocatalase, a bis-manganese III-EDTA-

(HCO3)2 Synthetic catalase substitute, has promoted repigmentation in vitiligo patients,

along with restoring DH enzyme activity and a return to normal 7BH4 leVOIS in the

epidermis (Schallreuter et al., 2001).

Abnormal antioxidant activity in peripheral blood mononuclear cells (PBMCs) of

vitiligo patients has also been observed, with increased superoxide dismutase activity,

and reduced catalase, glutathione and vitamin E levels. This variability in antioxidant

levels was seen exclusively in subjects with active disease. These changes in

antioxidants could be responsible for the generation of intracellular reactive oxygen

species (ROS) in vitiligo patients, and may be due in part to an observed mitochondrial

impairment (Dell'Anna et al., 2001).

Vitiligo melanocytes are also found to have an abnormal dilation of the rough

endoplasmic reticulum (RER), seen on transmission electron microscope examination

(Boissy et al., 1991; Im et al., 1994). Further observation of this phenomenon is seen in









PIG3V cells, an immortalized vitiligo cell line. In the PIG3V cells, this abnormal

dilation is thought to be caused by a retention of a variety of proteins in the RER (Le

Poole et al., 2000).

Treatment

There is no known "cure" for vitiligo, and current treatment methods function

mainly by stopping current progression of the disease and aiding in the repigmentation of

hypopigmented lesions. Current treatments do not prevent the reappearance of future

depigmented lesions. Treatment options are often expensive and labor-intensive on the

part of the patient, and are most often not covered by patients' insurance, as vitiligo is

considered a mainly a cosmetic disorder. Up until the late 1990's, the options for

treatment of vitiligo were limited mainly to psoralens with UVA radiation (PUVA)

therapy and the use of topical corticosteroids on the skin. Current treatment options have

expanded recently and now include a variety of choices such as epidermal melanocyte

autografts, topical treatment with pseudocatalase, and narrow-band UVB irradiation

(Nj oo and Westerhof, 2001)

PUVA is considered by many to be the "standard" treatment for vitiligo. Psoralens

are compounds found in many plants used to treat a variety of dermatological disorders,

such as psoriasis, dermatitis, and vitiligo. Psoralens, in conjunction with sun exposure,

have been used to treat skin disorders for centuries, and can be traced back to the ancient

Egyptians (McClelland et al., 1997). Upon exposure to UVA radiation, psoralens can

bind directly to macromolecules such as proteins, lipids, and DNA (Taylor and Gasparro,

1992). Once excited by UVA radiation, psoralens can interact with pyrimidines in DNA

through covalent bonding, forming interchain crosslinks (Song and Tapley, 1979). The

relative frequency of the DNA crosslinking depends on the wavelength of UVA exposure









(Taylor and Gasparro, 1992). It is still unclear how this biochemical interaction of

psoralen with DNA functions to alleviate symptoms in the dermatological disorders it is

used to treat. One theory is that the DNA adducts formed function to hamper DNA

synthesis and cell replication, processes which may be upregulated in hypoproliferative

disorders such as psoriasis (McNeely and Goa, 1998).

PUVA-induced repigmentation in vitiligo patients is thought to be due to the

recognition of the DNA adducts as damage, which might trigger activation of genes

involved in pigmentation or melanocyte biochemistry, since DNA repair is closely

associated with transcription. A second theory hypothesizes that PUVA treatment creates

reactive oxygen species that then stimulate melanogenesis by activating melanocyte

migration from the hair follicle to the epidermis (McNeely and Goa, 1998). PUVA

therapy often requires 100-300 exposures, and treatment does not guarantee

repigmentation. One study showed 56% of vitiligo patients achieved 75%

repigmentation, with a lack of response occurring in 22% of patients (Morrison, 2000;

McNeely and Goa, 1998).

The most promising new treatment for vitiligo is the topical application of UVB-

activated pseudocatalase, a bis-manganese EDTA bicarbonate complex. Pseudocatalase

functions to mimic the human enzyme catalase, which removes H202 and other free

radicals from the epidermis. It has been shown that vitiligo patients have decreased

catalase expression, along with a subsequent increased expression of H202 COncentrations

in their epidermis. Treatment of vitiligo patients with topical applications of the

pseudocatalase cream, along with frequent exposure to UVB radiation, given at a much

lower exposure than normal therapeutic doses, has allowed for the halt of depigmentation









in 95% of patients, and repigmentation of 60-65% of individuals. Treatment with

pseudocatalase also restores epidermal DH activities and decreases the accumulation of

7BH4 (Schallreuter et al., 1999a, 1999b, 2002).

Genetics of Vitiligo

About 20% of vitiligo patients have at least one first-degree relative also affected,

and the relative risk of vitiligo for first-degree relatives of vitiligo patients is increased by

at least 7- to 10-fold (Bhatia et al., 1992; Nath et al., 1994). Vitiligo susceptibility does

not follow a simple Mendelian inheritance pattern, and much of the available data suggest

that vitiligo is a complex hereditary disease influenced by a set of recessive alleles

occurring at several unlinked autosomal loci that collectively confer the vitiligo

phenotype (Majumder et al., 1993; Nath et al., 1994; Alkhateeb et al., 2002). This type

of inheritance is common among other autoimmune diseases. For example, in type 1

diabetes, the risk of an individual developing diabetes with a first degree relative affected

is only between 1-9% (Redondo et al., 2001), where it is likely that a combination of

genetics and environmental factors result in disease pathogenesis. Vitiligo may therefore

be considered a polygenic disease, with alleles at multiple loci possibly contributing to

increased susceptibility to and/or direct pathogenesis of vitiligo. HLA associations have

been reported between specific alleles of complement, class I and class II MHC genes

with vitiligo in various ethnic and racial subpopulations, but no common HLA association

has been observed. Studies have reported HLA associations in early onset vs. late onset

vitiligo cases, and it is possible that there are different etiologies, and different genetic

factors in early vs. late onset vitiligo, as well as in segmental vs. non-segmental vitiligo

(Finco et al., 1991; Orecchia et al., 1992; Arcos-Burgos et al., 2002). Further

complicating matters, it is probable that genetics alone do not dictate disease onset, as









most vitiligo patients are not born with this disorder, but develop it later in life. As with

other autoimmune diseases, environmental factors such as toxins, pollutants, viruses, UV

exposure, and stress could play a maj or role in the onset of vitiligo in those that are

genetically predisposed.

In order to determine potential genes involved in an inheritable disorder there are

several techniques that can be employed. Functional cloning relies on first identifying

the abnormal protein involved in the disease process, and then using its sequence to

determine the cDNA sequence, and Einally the gene involved in the disease. A large

limitation to functional cloning is that the protein(s) involved in the disease process is

(are) not often known. In contrast, positional cloning allows for determination of the

gene' s location without prior knowledge of the protein involved in the disease

pathogenesis. The two main positional cloning techniques employed in disease gene

screening in recent years are linkage mapping and the candidate gene approach.

Linkage mapping scans the entire genomes of family members and individuals

afflicted with the disorder of interest, using regularly spaced genetic markers in the DNA

whose positions have already been determined. Regions where affected individuals

shared alleles more frequently than expected by chance alone are then identified, and

nearby genes are subj ected to further analysis. This type of screening is extremely labor

intensive and requires large families with both affected and non-affected members.

However, it does allow for the unbiased screening of diseases where investigators have

no prior knowledge of the pathobiology of the disorder.

The candidate gene approach allows for researchers to investigate susceptibility of

a gene to a disorder by focusing on a limited number of genes selected for their potential









involvement in the biology or pathophysiology of the disorder. Candidate gene studies

do not rely on large multi-generation families, but can be performed using unrelated

groups of patients (cases) and controls, or through small families. Candidate gene studies

also have the advantage of being better suited for determining susceptibility genes in

more complex disorders where the relative risk associated with any one gene is relatively

small (Kwon and Goate, 2000).

Once a candidate gene is chosen based on its potential involvement of the disease

of interest, a polymorphism that will allow for suitable genotyping must be identified. It

is important to note that these polymorphisms within the gene might cause a mutation

that results in a functional change in the protein or more likely, may have no functional

relevance to protein function or stability at all. In candidate gene analyses,

polymorphisms function solely as genetic markers within the gene. If a polymorphism

within a gene is inherited at a rate that exceeds the levels determined by random chance,

this gene can then be called a potential susceptibility gene. In this case, the

polymorphism genotyped can either be the actual mutation conferring the susceptibility

or it could merely be linked to the mutation of interest due to its close physical proximity.

There are a variety of polymorphic markers within the genome that are useful for

genotyping. Single nucleotide polymorphisms, or SNPs, are heritable individual single

nucleic acid changes in the genomic sequence. Sometimes SNPs allow for the creation or

deletion of a sequence that is recognizable by a particular restriction endonuclease. This

type of polymorphism is known as a restriction fragment length polymorphism, or RFLP,

and can be genotyped using the two variable sized fragments produced through the

endonuclease activities of the restriction enzyme. Amplified fragment length










polymorphisms, or AFLPs, are variants of RFLPs. AFLPs are created through designing

polymerase chain reaction (PCR) primers that change one nucleotide forcing the

amplification of a sequence that creates a restriction site involving a known SNP. Repeat

regions in genomic DNA are also very useful in genotyping. The human genome

contains a large number of these normal inheritable variances in small sequence repeats.

These repeat regions can be a long sequence repeated many times (14 to 100 base pairs),

known as a variable number of tandem repeats (VNTR), or minisatellites, or a region of

multiple repeats of just a few nucleotides (2-5 base pairs), called short tandem repeats

(STR) or microsatellites (Griffiths et al., 1999).

Vitiligo Candidate Genes

Determining genes that confer genetic susceptibility to vitiligo using the candidate

gene approach requires pre-knowledge about the disease process and pathogenesis.

Because it has been hypothesized that vitiligo pathogenesis could be a direct result of

autoimmunity and/or autotoxicity due to biochemical defects in the melanocytes, genes

that regulate the immune system, melanocyte biochemistry and development and

oxidative stress are suitable choices for candidate genes.

Immune System Genes

Low-molecular-weight polypeptide 2 (LMP2), low-molecular-weight polypeptide 7
(LMP7) and multicatalytic-endopepidase-complex-like 1 (MECL1)

The proteasome is a large protease composed of several subunits, which plays a

crucial role in protein degradation in the cell. Three subunits crucial for protein

proteolysis known as X, Y, and Z are constitutively expressed, but can be replaced by the

three IFN-y inducible subunits low -molecular-weight polypeptide 2 (LMP2), low-

molecular-weight polypeptide 7 (LMP7) and multicatalytic-endopepidase-complex like 1









(MECL 1). The induction of these three subunits allows for the creation of the

"(immunoproteasome.") Whereas these induced subunits are very similar in sequence to

the constitutive subunits, functionally they cleave proteins into different peptides. The

IFN-y inducible subunits generate peptides that are more compatible with the binding

groove of the MHC class I molecule (Driscoll et al., 1993; Tanaka et al., 1998; Pamer et

al., 1998).

The immunoproteasome genes were selected as candidate genes because several

autoimmune diseases have been shown to have significant association to genes in this

region. LMP2 and LMP7 also make good candidate genes since they are located within

the MHC class II region of the genome, a region that historically has been linked with

susceptibility to many other autoimmune diseases (Wong and Wen, 2003).

Transporter associated with antigen processing 1 and 2 (TAP1 and TAP2)

Along with the immunoproteasome genes, TAPI and TAP2 are involved in the

MHC class I antigen-processing and presentation pathway. To reach the MHC class I

molecule for binding, the proteasome-cleaved peptide must cross into the endoplasmic

reticulum from the cytoplasm. The TAP complex allows for this transfer of peptides into

the ER. TAP is an IFN-y inducible heterodimer made up of two subunits, TAPI and

TAP2, which both must be present for peptide binding and translocation. The TAP

complex preferentially binds peptides of certain lengths and of certain amino acid

composition, favoring acidic, aromatic, hydrophobic and charged residues (Harding et al.,

1997). These TAP/MHC class I-preferred peptides are produced at a higher rate with the

IFN-y induction of LMP2, LMP7, and MECL1 (Harding et al., 1997; Rechsteiner et al.,

2000).









TAPI and TAP2 were also chosen as candidate genes due to their reported

associations with other autoimmune diseases such as, celiac disease (Djilali-Saiah et al.,

1994), Sjogren's syndrome (Kumagai et al., 1997), and multiple sclerosis (Moins-

Teisserenc et al., 1995), as well as due to their location within the MHC class II genomic

region.

CD28 and CTLA4 (CD152)

In order for a naive T cell to become activated, two separate signals are required.

The first signal is the interaction of the T cell receptor on the surface of the T cell with

the peptide/MHC complex located on the surface of an antigen presenting cell (APC).

Secondly, CD28, a surface molecule on the T cell, must come into contact with its ligand,

CD80/CD86, on the surface of an APC. A T cell receiving stimulation with both signals

will be driven to activation and proliferation. Once activated, CTLA4 functions to

regulate this process by shutting down T cell activation and proliferation. CTLA4 is also

found on the surface of T cells, and is upregulated after activation. CTLA4 out-competes

CD28 for the binding of its ligand, CD80/86 as CTLA4 binds CD80/86 with an affinity

about 100 x greater than CD28. CTLA4 binding to the ligand delivers a negative signal

to the T cell, limiting its activation and proliferative response. CTLA4 polymorphisms

have been linked to various autoimmune diseases such as insulin-dependant diabetes

mellitus (IDDM), Hashimoto's thyroiditis, multiple sclerosis, and celiac disease

(Einarsdottir et al., 2003; Udea et al., 2003; Kantarci et al., 2003).

CD4

CD4 is a single chain molecule composed of four immunoglobulin-like domains,

whose cytoplasmic domain interacts with a tyrosine kinase known as Lyk, allowing for

CD4 to participate in signal transduction. CD4 functions as a co-receptor on T cells,









interacting with the peptide:1VHC class II complex on APCs and acting synergistically

with the T cell receptor (TCR) in signaling and activation of the T cell. CD4 was chosen

as a candidate gene because improper binding of CD4 to the peptide:1VHC complex or

the TCR, or improper signaling through the CD4 receptor might allow for inappropriate

activation of T cells. Studies have also shown epidermi s-infiltrating T cells exhibit an

increased CD8/CD4 ratio within perilesional skin in vitiligo patients (Le Poole et al.,

1996).

IL-12p40

IL-12 is a very important cytokine that is important in the induction of the Thl

subset that produces inflammatory cytokines. The potent pro-inflammatory activity of

IL-12 requires tight control, which is exerted at various levels. Primary control is exerted

on IL-12 production by APCs, a maj or factor driving the response towards the Thl or

Th2 phenotype. A disturbed Thl/Th2 balance, and/or aberrant control of Thl cytokines,

such as IL-12, has been hypothesized as playing a role in induction of T cell mediated

autoimmunity. IL-12p40 has also been shown to be associated with type 1 diabetes

(Davoodi-Semiromi et al., 2002).

IL-1P

IL-1 is a proinflammatory cytokine secreted mainly by macrophages. IL-1 from

activated macrophages stimulates cytokine and cytokine receptor production by T-cells as

well as stimulating B-cell proliferation. Two forms of IL-1, 1L1-a and IL-1P, have the

same activities but different structures. IL-la is primarily membrane-associated whereas

IL-1P is secreted. Excess IL-1 may induce inflammatory and autoimmune diseases in

such organs as the joints, lungs, gastrointestinal track, central nervous system, and blood









vessels. Treatment with IL-1 receptor antagonist has been used in animal models of

rheumatoid arthritis (Schwab et al., 1991), Inflammatory bowel disease (Cominelli et al.,

1992), and allergic asthma (Selig et al., 1992), with much success. IL-1 may be a

mediator of damage to the pancreatic islets in insulin-dependent diabetes mellitus

(IDDM), and IL-1Ra has been shown to block the IL-1-induced decrease in insulin

secretion by pancreatic beta cells in vitro (Sandler et al., 1991; Eizirik et al., 1991).

Because IL-1P has been linked to these autoimmune diseases, and due to its potent pro-

inflammatory nature, it makes a good candidate gene for vitiligo.

Autoimmune polyendocrinopathy syndrome type-1 (APS-1)/autoimmune regulator
(AIRE)

The AIRE gene is responsible for autoimmune polyendocrinopathy-candidiasis-

ectodermal dystrophy syndrome (APECED). The most common features of APECED

are parathyroid gland failure, chronic susceptibility to candida yeast infection, and

Addison's disease. Other manifestations, and when the symptoms emerge, are variable.

Other autoimmune diseases associated with APECED may include alopecia, vitiligo,

ovarian failure, testicular atrophy, hypothyroidism, gastric parietal cell atrophy, hepatitis,

intestinal malabsorption, and insulin-dependent diabetes mellitus. Because vitiligo is one

of the autoimmune diseases associated with APECED, it was chosen as a candidate gene.

Melanocyte Biochemistry and Oxidative Stress

Catalase (CAT)

Catalase is a homotetrameric, heme-containing, peroxisomal enzyme that catalyzes

the conversion of hydrogen peroxide (H202) to water and oxygen. Catalase plays an

important role in the prevention of cell damage from highly reactive oxygen-derived free

radicals. Catalase was chosen as a candidate gene because of reports of low epidermal









catalase activity in both lesional and non-lesional skin of vitiligo patients. This decrease

of catalase expression is not observed in patient erythrocytes, and is also observed with a

concomitant increase in epidermal H202 (Schallreuter et al., 1991,1999a 1999b).

GTP cyclohydrolase 1 (GCH1)

GCH1 is the first and rate-limiting step in the synthesis of 6-tetrahydrobiopterin,

which serves as a cofactor for the hydroxylation of the amino acid L-phenylalanine to L-

tyrosine. L-tyrosine is needed as a substrate for tyrosinase to initiate melanogenesis in

the melanocyte.















CHAPTER 2
CASE/CONTROL AND FAMILY-BASED ASSOCIATION STUDIES

Introduction

The importance of genetic factors in vitiligo susceptibility has been suggested by

reports of significant familial aggregation (Bhatia et al., 1992; Nath et al., 1994). Vitiligo

susceptibility does not follow a simple Mendelian inheritance pattern, and is considered a

complex hereditary disease influenced by a set of recessive alleles occurring at several

unlinked autosomal loci. Therefore vitiligo is considered a polygenic disease, with

alleles at multiple loci possibly contributing to increased susceptibility to and/or direct

pathogenesis of vitiligo. As previously described, two principal hypotheses concerning

the etiology of vitiligo include (1) the self-destruct model, which suggests that

biochemical and/or structural defects inherent to patient melanocytes contribute to the

initiation and/or progression of melanocyte cytolysis, and (2) the autoimmune model,

which suggests that melanocyte death occurs through inappropriate immune system

destruction of pigment cells. To evaluate genetic factors that may play a role in vitiligo

pathogenesis, a candidate gene approach was designed. Genes involved in both immune

system regulation and melanocyte regulation and biochemistry were chosen based on

their potential involvement in vitiligo etiology. Case/control and family-based analyses

were performed on genotypic data garnered from vitiligo patients, their family members,

and non-affected controls.









Materials and Methods

Subj ects

An intemet website was set up at both the University of Florida and at the National

Vitiligo Foundation. Interested patients contacted the research group via email to request

further information, or to participate in the research study. Kits were mailed out to

interested patients and family members containing three 10 mL EDTA blood collection

tubes, IRB consent forms (project numbers 130-1998 and 416-1998), personal

information surveys requesting information such as race, age of onset, family history

and/or personal presence of other autoimmune diseases, and pattern of depigmentation.

Patients and family members were collected and genotyped regardless of race and/or

ethnicity, however, due to insufficient numbers of subj ects in other racial groups the

case/control and family-based analyses were performed on Caucasian subj ects only

(Table 2-1). Patients requested a blood draw from their local family physician and

returned the blood kits via priority mail.

Blood Processing

Whole blood was centrifuged at 3000 rpm (2000 x g) for ten minutes in vacutainer

tubes in a clinical centrifuge. The buffy coat, the layer between the red blood cells and

plasma layer that contains white blood cells, was removed and transferred with a sterile

transfer pipette into a 50 mL conical tube. Red blood cells were then lysed to isolate

white blood cells with 6-8 volumes of red blood cell lysis solution (RBC) (139 mM

ammonium chloride, 17 mM Tris-HC1, pH 7.65), followed by a ten-minute incubation at

370C. Samples were then centrifuged at 2000 rpm (900 x g) for seven minutes, the

supernatant discarded and the pellet washed with PBS (38 mM KCl; 21 mM KH2PO4,

1.96 M NaCl; 137 mM Na2HPO4). The pellet was then resuspended in 5 mL of high TE












Table 2-1. Vitiligo patient and unaffected relative samples collected for case/control and
family-based analyses.


Vitiligo Patients

Race

255 Caucasian

152 Hispanic
African
American

Indian (Asian)

Other Asian

Mixed

407 Not Reported


Unaffected Relatives

Gender Race

Female 223 Caucasian

Male 183 Hispanic
African
American

Indian (Asian)

Other Asian

Mixed

Total 406 Not Reported


Gender

Female

Male











Total


323

32

8

11

6

14

12









(100 mM Tris-HC1, pH 8.0; 40 mM EDTA, pH 8.0) and 5 mL of DNA lysis solution (100

mM Tris-HC1, pH 8.0; 40 mM EDTA, pH 8.0; 400 mL dH20; 0.22% SDS).

DNA Extraction

Lysed genomic DNA samples were mixed with 10 mL TE-saturated phenol at pH

6.6 (Fisher Scientific) and centrifuged at 2000 rpm (900 x g) for 5 minutes. The aqueous

layer which contains the DNA was transferred via sterile transfer pipette to a 50 mL

conical tube, to which 5 mL phenol (Amersham) and 5 mL chloroform (Fisher Scientific)

were added. The samples were then mixed gently, and centrifuged at 2000 rpm (900 x g)

for 5 minutes, and the aqueous layer was once again removed and transferred to a clean

50 mL conical tube. A Einal extraction was conducted using 5 mL chloroform. The DNA

was precipitated with the addition of '/ the volume of 7.5 M ammonium acetate and an

equal volume of isopropanol. The precipitated DNA was rinsed with 70-100% ethanol,

using a Pasture pipette hook, and transferred into a 1.5 mL tube containing 400 CLL TE

and placed on a rotator for one to two days. The DNA was quantitated using a

spectrophotometer at 260 nm, diluted to 20 ng/CLL, and aliquoted 2 CLL/well into a 96-well

PCR plate (DOT scientific). Control samples were prepared from Caucasian subjects

with no history of autoimmunity, and were generously provided by Dr. Jin Xiong She

(formerly at the University of Florida, now at Medical College of Georgia, Center for

Biotechnology and Genomic Medicine).

Primers

PCR primer sequences were designed using OLIGO software, or were obtained

from the literature (Table 2-2). Primers (Gibco-Life Technologies) were reconstituted

with 100 CIL of 10 mM Tris-HCI and diluted to a working concentration of 20 pmol/CIL









with 10 mM Tris-HC1. PCR conditions for each primer pair were determined

empirically, and candidate genes were genotyped using RFLP, AFLP and microsatellite

markers.

Microsatellite Markers

Forward PCR primers were labeled with 10 CLCi y-32P-ATP (6000 CLCi/mol) with 1

CIL T4 polynucleotide kinase (New England Biolabs), 3 CL 10X kinase buffer (New

England Biolabs), 5 CIL ddH20, with a one hour incubation at 370C and ten minutes at

650C. Each genomic DNA sample was amplified using 10 CIL of a PCR master mix

containing 710 CIL ddH20, 120 CIL of 10X dNTP, 12 CIL unlabeled forward primer, 10 CIL

labeled forward primer, 12 CIL reverse primer, and 7.2 CIL Taq polymerase to each well of

the 96-well PCR plate. After thirty PCR cycles, 20 CIL of stop buffer (92% formamide; 2

CLM EDTA, 0.03% xylene cyanol, 0.03% bromophenol blue) was added to each of the 96

wells. Samples were then heat denatured at 970C for 15 minutes and separated by

electrophoresis on a denaturing 6% acrylamide gel, using 0.5% TBE buffer. The gels

were vacuum dried, and exposed to Fuji X-ray film for 2-4 days at -800C. PCR

conditions, product size and number of alleles for each marker can be found in Table 2-3.

RFLP and AFLP Markers

PCR amplification of RFLP and AFLP markers was completed using 10 CIL of a

master mix containing 710 CIL ddH20, 120 CIL of 10X dNTP (2 CIL each dNTP, 92 CIL 10

mM Tris-HC1, pH 7.5), 12 CIL forward primer, 12 CIL reverse primer, and 7.2 CIL Taq

polymerase to each well of the 96-well PCR plate. Cycle lengths were determined

empirically. Following amplification, samples were then digested overnight with the
























CTLA4 CTLA4-1 GCC AGT GAT GCT AAA GGT TG CTLA4-2 ACA CAA AAA CAT ACG TGG CTC Marron et al
1997
CTLA4 CTLA4-4 CTG CTG AAA CAA ATG AAA CCC CTLA4-5 AAG GCT CAG CTG AAC CTG GT Marron et a]
1997
CTLA4 CTLA4-22 CCCTGGCATTGTTGTAGAGTG CTLA4-24 CACTATTTTTGAGTTGATGCAG Marron et al
2000
IL-12p40 IL-12-1 ATTTGGAGGAAAAGTGGAAGA IL-12-2 AATTTCATGTCCTTAGCCATA Davoodi-Semiron
al., 2002
IL-1P IL-1P-1 CAT CTG GCA TTG ATC TGG TT IL-1P-2 TTT AGG AAT CTT CCC ACT TAC di Giovine et
1992
APS-1 APS-1-1 TATGTGCTTGGGAACAGTCTT APS-1-2 ATCAGCCCCATCTCCCCG Genbank
rs878081
APS-1 APS-1-3 GCGGGAGAGGAGGTAAGAG APS-1-4 AGGACCCACACACAGTAGG Genbank
rsl800521
GCH1 GCH1-1 GGG TTG AGC CCT CTA CTT TC GCH1-2 TCG GCA CTA CAC CAC TTT TAT T Genbank rs8

SNP ID reference numbers are from the National Center for Biotechnology Information Single Nucleotide Polymorphism database
(http://www. ncbi. nlm. nih. gov/SNP).


Table 2-2. Primer sequences


Gene Forward
primer
CD28 CD28-10


Sequence


Reverse
Primer
CD28-15


Sequence


Reference


GAG AAT CGC TTG AAC CTG GC


TAG ACA AAT AAT CCT TCA CAG TA


Marron et ~
2000


al.,

l.,

l.,


mi et

al.,





41










Table 2-3. Microsatellite primer conditions.


Gene

CD28

CTLA4

CD4


Primer
Pair
10/15

1/2

1/2


Marker

CAA 3' UTR

AT 3'UTR

TTTTC5' UTR


Size

166

110

170


Anneal
oC
58

58

58


Marker
Type
tri repeat

di repeat

Penta-repeat


Number
of alleles
7

33+

6


Table 2-4. RFLP/SSCP PCR conditions.


Gene Primer
Pair
CTLA4 4/5

CTLA4 22/24

IL- 1/2
12p40
IL-1P 1/2

APS-1 1/2

APS-1 3/4

GCH1 1/2


Marker

BstE II +49 A/G

Hae III C/T
intron 1
Taq I C/A 3'
UTR
Ava I C/T
promoter -511
C/T 715 exon 5

Hae III 1324
exon 10 T/C
Bsa Al SNP841
exon 6


Size

152

257

1046

308

203

150

250


Anneal oC

58

58

58

58

60

62

54


Marker
type
RFLP

RFLP

RFLP

RFLP

SSCP

RFLP

RFLP


RFLP
enzyme
BstE II

Hae III

Taq I

Ava I



Hae III

Bsa Al









restriction enzyme appropriate for each RFLP/AFLP, according to the protocol of the

supplier (New England Biolabs). Restriction enzyme concentrations for complete

digestion were determined empirically for each marker. Digestion products were then

separated by agarose gel electrophoresis and visualized using ethidium bromide staining

and a 312 nm UV-transilluminator. Samples were genotyped as homozygous for the

restriction site (cut), homozygous for no restriction site (uncut) or heterozygous. PCR

conditions, and product size for each marker can be found in Table 2-4.

Statistical Analysis

Blood samples were collected from vitiligo patients and their family members

from all ethnic groups, however only the Caucasian ethnic group was large enough to

run a valid case/control analysis on the genotypic data. Patients were also divided into

two groups, segmental or non-segmental, based on the appearance/diagnosis of their

lesion types. Only patients with non-segmental lesions were included in the

case/control and TDT analysis. Allele and genotype frequencies were calculated for

each genetic marker for the patient and control data sets. These allele and genotype

frequencies were then compared between the affected and non-affected populations. If

the particular gene or allele had no association with a particular disease, the frequency

of that allele or genotype in the patient population should be very similar to the

frequency of that allele or genotype in the control population. An allele or gene that

confers susceptibility or resistance to a particular disease would hypothetically differ in

frequency between the affected and non-affected populations. To compare the

frequency of an allele or genotype between the case and control populations, a chi-










square (X2) analysis is performed. Chi-square analysis is represented by the following

equation:

X2 = C[(Expected Value Obtained Value)2]/Expected Value

To further validate statistical significance determined by the case/control analysis,

the transmission disequilibrium test (TDT), a family-based association test, was

performed. The TDT examines whether alleles of the marker of interest are transmitted

at a frequency greater than 50% from an informative parent to an affected child. In the

TDT, an informative parent is defined as a parent who is heterozygous for the allele of

interest. Chi-square analysis is then performed to determine the statistical significance

of the TDT. The equation for the TDT in a 2 allele situation (i.e. RFLP, AFLP) is as

follows:

TDT = (b-c)2 / (b+c)

Where b = the number of times allele 1 is transmitted from a heterozygous parent to an

affected child and c = the number of times allele 2 is transmitted from a heterozygous

parent to an affected child (Haines and Pericak-Vance, 1998)

For a microsatellite marker where many possible alleles can be transmitted, the

TDT is then represented by the following equation:

Tkhet = [(k-1)/k] CI (nl,.- n,)2/ E.1 +. -1 2n,,

Where k = the number of marker alleles

n,. = the total number of times allele i is transmitted to affected offspring

n., = the total number of times allele i is not transmitted to affected offspring

n,, = n,. n., (Haines and Pericak-Vance, 1998; Spelman and Ewens, 1996)










Bonferroni's correction is a statistical method of adjusting and correcting for

multiple numbers of chi-square tests. Bonferroni's correction is represented by dividing

the test-wise significance level by the number of tests, and is represented by the

following equation:



Where a = the testwise significance level (0.05)

K = the total number of tests performed (Shaffer, 1995).

Bonferroni's correction was used on both RFLP/AFLP and microsatellite data.

It has been suggested that there may be a difference between the etiologies of early

onset and late onset vitiligo (Arcos-Burgos et al., 2002). To investigate this

phenomenon, case/control analyses were also conducted separately on individuals

whose age of diagnosis was less than 30 years of age.

Results

Immune System Genes

Genetic association of CD28 with vitiligo was tested using a trinucleotide repeat.

Allele and genotype frequencies for the patient and control groups are seen in Figure 2-

1. Case/control analysis of this data revealed significance for allele 6, with ap value of

0.0036, and a corrected p value of 0.01 1 (Table 2-5). This allele is seen about 2 times

as frequently in the control population, hence it can be said to have a protective nature.

Family-based TDT analysis does not support association for this marker (Tkhet = 12.0,

p=0.101).

To determine potential susceptibility of the gene CTLA4, three polymorphisms were

used, two RFLP markers and one microsatellite marker. The microsatellite marker is an

AT dinucleotide repeat located in the 3' untranslated region. This marker has a huge









population variance, with at least 33 identified alleles. Figure 2-2 shows the allele and

genotype distribution for CTLA4. We found suggestion of association of single allele 8

(p=0.0140, corrected p=n.s.), which was seen more often in controls than in the patient

population and the grouped alleles 24-33, which were seen more often in patients than

in controls (p=0.0337, corrected p=n.s.) (Table 2-6) These alleles were grouped

together due to the high level of polymorphism associated with this marker. Alleles

with larger number of repeats were difficult to accurately identify, and thus alleles with

more than 24 repeats were grouped into one large group for analysis purposes. One

genotype 18/19 was also found to be possibly associated with vitiligo (p= 0.0362,

corrected p= n.s.), with this genotype seen more often in the control population than the

patient population. Neither the putative significant alleles nor the significant genotype

p values hold up after Bonferroni's correction, which corrects for multiple chi-square

tests. The TDT also does not support association for this marker (Tkhet= 12.3, p=0. 197)

(Table 2-5). The two RFLP markers CTLA 4/5 (Bst EII position +49 A/G) and CTLA4

22/24 (Hae III intron 1 C/T) were also genotyped and used in analysis. Neither marker

showed significant association with vitiligo through case/control analysis using all

patients as well as in patients with early onset vitiligo, however TDT analysis shows

significant association of both of these markers with vitiligo with p values of 0.006 and

0.043 respectively (Table 2-7 and 2-8).

Two markers were used to analyze the candidate gene APS-1, including one

RFLP and one SSCP. Analysis of the SSCP marker, APS-1 1/2, revealed no association

of this marker with vitiligo using case/control or TDT analyses. The RFLP marker,

APS-1 3/4, also showed no association with vitiligo through case/control for the total






32







CD28



80

70







30*

20*

10


1P 1C 2P 2C 3P 3C 4P 4C 5P 5C 6P 6C 7P 7C
Patient and Control Alleles


Figure 2-1. CD28 allele frequency. P=vitiligo patient alleles, C=control alleles.
Asterisks represent significant differences in allele frequency between
patient and controls.







33








CTLA4
55



45


40
35i





301 11 21 3111451 6671 11 91 02 12 22 32
25in ndCnrl lee








frqunc btwenpai Ptatin t aondContolAlee


















Patient Control N p value

398 366 Allele 6 5.0 10.7 0.0036 0.011 0.47 43 n.s.


Table 2-6. Case/control association analysis for CTLA4 by microsatellite (AT 3' UTR)

Number of Alleles Genotype or % % p value Corrected p Relative TDT
Genotyped Allele Patient Control value Risk (RR)


Table 2-5. Case/control association analysis for CD28 by microsatellite (CAA 3' UTR)

Number of Alleles Genotype or % Patient % Control p value Corrected p
Genotyped Allele value


Relative
Risk (RR)


TDT


Patient Control

438 302 Allele 8 43.2 52.3 0.0140 n.s.


p value

n.s.


Alleles 24-33

Genotype
18/19


20.3

0


14.2

2


0.0337

.0362


0.82

1.42

0














Table 2-7. Case/control association analysis of CTLA4 by RFLP (Bst E II +49 A/G)


Patient
Group


Number of Alleles
Genotyped


Genotype or
allele


% % p value Corrected p
Patient Control value


Relative Risk
(RR)


TDT


Patient


Control

368


N p value

59 0.006


Total


42.1

57.9


39.4

60.6


n.s.


n.s.


Age of onset
less than 30


Table 2-8. Case/control association analysis of CTLA4 by RFLP (Hae III intron 1 C/T)


Patient
Group


Number of Alleles
Genotyped


Genotype or
allele


% % p value Corrected p
Patient Control value


Relative
Risk (RR)


TDT


Patient


Control

334


N p value

48 0.043


Total


43.3
56.7


41.6


Age of onset
less than 30









vitiligo patient population, however, TDT analysis suggests association between this

marker and vitiligo (p=0.035). Grouping the patients with early onset (before 30 years

reveals allele 1 and genotype 1,l to be possibly associated with vitiligo with p values of

0.0171 and 0.0174, respectively. Using Bonferroni's correction, these p values remain

barely significant (p=0.05) (Tables 2-9 and 2-10).

A RFLP marker in the promoter region of IL-1P was genotyped. There was no

association with vitiligo suggested by either case/control or TDT analysis (Table 2-11).

The CD4 gene was genotyped using a pentanucleotide repeat (TTTTC) in the 5' UTR of

the gene. Case/control analysis found a significant p value for this microsatellite

marker (Table 2-7). Case/Control association analysis of CTLA4 by RFLP (Bst E II

+49 A/G) genotype 02,02 (p=0.0107). Bonferroni's correction allowed the p value to

remain just within the limits of significance (Table 2-12). Family-based analysis does

not support association of this gene with vitiligo. IL-12p40 was genotyped using a C/A

SNP in the 3' UTR. Case/control analysis revealed no association of vitiligo with any

allele or genotype for the total patient population, however segregating the population

into early onset vitiligo patients found that genotype 2,2 had a significant p value

(p=0.0291, corrected p=n.s.). TDT analysis revealed a potential association of IL-12

with vitiligo with ap value of 0.0396, however the number of informative families in

this analysis was very low (n=34) (Table 2-13).

Melanocyte-specific Genes

A RFLP maker for GCH1 in exon 6 was evaluated by case/control and TDT

analysis for potential association with vitiligo. No association was found in either the

case/control or family-based association analyses (Table 2-14).
















Table 2-9. Case/control association analysis of APS-1 by SSCP (C/T exon 5)


Patient
Group


Number of Alleles
Genotyped


Genotype or
allele


% %
Patient Control


p value Corrected p
value


Relative
Risk (RR)


TDT


Patient


Control
344


N p value
15 n.s.


Total


19.4

80.6


22.1

77.9


Age of onset
less than 30


Table 2-10. Case/control association analysis of APS-1 by RFLP (Hae III exon 10 T/C)


Patient Group


Number of Alleles
Genotyped

Patient Control


Genotype or
allele


% % p value Corrected p
Patient Control value


Relative
Risk (RR)


TDT


N p value
44 0.035


Total

Age of onset
less than 30
Age of onset
less than 30


Allele 1


71.8

50.6


61.3 0.0171

35.4 0.0174


0.05

0.05


1.17

1.87


Genotype 11
















Table 2-11. Case/control association analysis of IL-1P by RFLP (Ava I -511 C/T)


Patient
Group


Number of Alleles
Genotyped


Genotype or
allele


% % p value Corrected p
Patient Control value


Relative
Risk (RR)


TDT


Patient


Control

294


N p value

42 n.s.


Total


34.7

65.3


34.0

66.0


n.s.


n.s.


Age of onset
less than 30


Table 2-12. Case/control association analysis of CD4 by Microsatellite (TTTTC repeat 5' UTR)


Number of Alleles
Genotyped


Genotype or
Allele


% Patient % Control


p value Corrected p
value


Relative
Risk (RR)


TDT


p value

n.s.


Patient

446


Control


Genotype
02,02


0.0107


0.47













Table 2-13. Case/control association analysis of IL-12p40 by RFLP (Taq 1 C/A 3' UTR)


Patient
Group


Number of Alleles
Genotyped


Genotype or
allele


% %
Patient Control


p value Corrected p
value


Relative
Risk (RR)


TDT


Patient


Control


N p value

34 0.0396


Total


Age of onset
less than 30


Genotype 2,2


1.7 0.0291


0.087


3.63


Table 2-14. Case/control association analysis of GCH1 by RFLP (Bsa Al C/T exon 6)


Patient
Group


Number of Alleles
Genotyped


Genotype or
allele


% % p value Corrected p
Patient Control value


Relative
Risk (RR)


TDT


Patient


Control


N p, value

46 n.s.


Total


Age of onset
less than 30









Discussion

The candidate genes CTLA4/CD28, APS-1, IL1P, CD4 and IL-12 were analyzed

based on their roles in modulating the immune response. GCH1 was analyzed due to its

role in melanocyte biochemistry. The genetic markers chosen for both I110 and GCH1

showed no association with vitiligo. All the other immune related genes reported here

showed at least one marker with a significant (p<:0.05) genotype or allele in either the

case/control or the TDT association studies. Although the p values for several

individual allele(s) and/or genotype(s) appeared to be significant, after application of

Bonferroni's correction for multiple Chi square analyses, many of there p values were

not significant. These data suggest that there may be a weak or spurious association of

several of these immune response genes and the human autoimmune disease vitiligo.

Analysis of a microsatellite marker within the CD28 gene showed possible

association of a protective allele with vitiligo using case/control analysis. However,

family-based studies did not confirm this association. Three CTLA4 markers were

analyzed, including one microsatellite and two RFLP polymorphisms. The three

CTLA4 polymorphisms revealed no significant alleles or genotypes, however both

RFLP markers showed possible association with vitiligo using family-based association

studies.

Because of the important regulatory role of CTLA4 in T cell activation, it has

been considered a likely candidate for involvement in autoimmune diseases. A likely

insulin-dependent diabetes mellitus (IDDM) susceptibility locus, IDDM12, was

discovered in the CTLA4/CD28 genomic region. Using the same CTLA4 and CD28

polymorphic markers employed in this study, researchers discovered highly significant









association of all three CTLA4 markers with IDDM, while the CD28 marker suggested

no association (Marron et al., 1997). Association of the CTLA4 gene has also been

suggested with other autoimmune disorders, such as Graves' disease, autoimmune

hypothyroidism (Einarsdottir et al., 2003; Udea et al., 2003), multiple sclerosis

(Kantarci et al., 2003), and rheumatoid arthritis (Rodriguez et al., 2002).

A study of 74 British vitiligo patients revealed no primary association of the

CTLA4 dinucleotide repeat with vitiligo. However, this same study demonstrated an

association of the AT dinucleotide polymorphism with vitiligo patients who also

suffered from one or more other autoimmune disorders (Kemp et al., 1999). Similar

data stratification of our patients into those who suffer from vitiligo alone, or those who

suffer from multiple autoimmune disorders does not replicate the enhanced significance

of the CTLA4 polymorphism as seen by Kemp et al. (Kristensen, 2000). While the

report by Kemp and coworkers does not support our findings of CTLA4 association

with vitiligo, it does lend evidence to an association of vitiligo with a general immune

system dysfunction. It is also important to keep in mind that there may well be several

divergent etiologies, and CTLA4 may be associated with vitiligo that is primarily

autoimmune in origin. A functional explanation for autoimmune association of the

dinucleotide repeat has been suggested. The CTLA4 AT dinucleotide repeat varies in

number from 1 repeat to greater than 33 repeats. Increased numbers of dinucleotide

repeats have been shown to affect RNA stability, and in particular AT rich regions in

UTRs have been documented to decrease stability (Kemp et al., 1999).

APS-1 or AIRE is the gene responsible for autoimmune polyendocrinopathy-

candidiasis-ectodermal dystrophy syndrome (APECED), otherwise known as









autoimmune polyglandular syndrome (APS). It is an autosomal recessive autoimmune

disease, caused by mutations in the AIRE (autoimmune regulator) gene. The most

common features of APECED are parathyroid gland failure, chronic susceptibility to

candida yeast infection, and Addison's disease. Other autoimmune diseases associated

with APECED include alopecia, vitiligo, ovarian failure, testicular atrophy,

hypothyroidism, gastric parietal cell atrophy, hepatitis, intestinal malabsorption, and

insulin-dependent diabetes mellitus. The AIRE protein is predominantly expressed in

thymic epithelial cells (TECs) but also in some monocyte-derived cells of the thymus,

in a subset of cells in lymph nodes, and in the spleen and in fetal liver. Due to this

expression pattern, it is thought that the AIRE protein may be involved in the

maintenance of thymic tolerance, and perhaps mutations in this gene may be

responsible for incomplete negative selection of self-antigens, resulting in the eventual

development of multiple autoimmune disorders (Pitkanen et al., 2003).

A weak association of APS-1 with vitiligo was shown in the case/control study

with the RFLP marker in exon 10 in patients with early-onset vitiligo (Table 2-10). The

family-based TDT reaffirms these results with a weakly significant p value of 0.035.

Since the APS-1 RFLP p values are not strong, and because the other SSCP APS-1

marker showed no association with vitiligo, it is not likely that a defect in the AIRE

gene is responsible for vitiligo susceptibility. It is possible that some of the vitiligo

patients used in this study are also APS patients who at the time of blood donation had

not yet been diagnosed, or who had not yet developed other autoimmune problems.

This explanation could be a reason for the significant p values found in the population

of vitiligo patients who developed the disorder before age 30.









CD4 is a co-receptor molecule found on CD4+ T cells, which functions by binding

the peptide:1VHC class II complex on the APC and through associating with the TCR on

the T cell. CD4 is a single chained molecule composed of four immunoglobulin-like

domains. Signaling through CD4 occurs when its cytoplasmic domain interacts with a

tyrosine kinase known as Lyk. CD4 and the TCR signaling cascades function

synergistically to allow for T cell activation after interaction of the TCR and its specific

peptide located in the binding grove of the MHC class II molecule on an APC.

Theoretically any malfunction of the CD4 receptor could potentially allow for improper

activation and proliferation of CD4+ T cells. We found a weak association of the

microsatellite TTTTC repeat, located in the 5' UTR of the CD4 gene, with vitiligo.

Since this result was not supported by family-based data, thus it is unlikely that CD4 is

a true susceptibility gene for vitiligo.

Interleukin-12 is a pro-inflammatory cytokine secreted from macrophages or

dendritic cells, which plays an important role in the protection against intracellular

pathogens as well as the developmental commitment of T helper 1 cells. IL-12 is

comprised of two disulfide-linked subunits IL-12p40 and IL-12p3 5, which together

make up the active form of the molecule designated IL-12p70. IL-12 exerts its

biological effects through binding to specific IL-12 receptors (IL-12Rs). IL-12

receptors also play a critical role in determining Thl/Th2 balance. The IL-12RP2

subunit is not expressed on resting T cells, but is upregulated when the TCR comes into

contact with antigen (Chang et al., 2000). Because of its pro-inflammatory role, genes

of the IL-12 pathway are therefore good candidates for mediating susceptibility or

resistance to a range of immune disorders.









IL-12 polymorphisms have been associated with several autoimmune disorders

such as diabetes (Davoodi-Semiromi et al., 2002), atopic dermatitis, and psoriasis

vulgaris (Tsunemi et al., 2002). In this study the 3' UTR SNP in the IL-12 p40 gene

showed weak association with vitiligo in patients whose age of onset was less than 30

years (p= 0.0291). This association was lost when Bonferroni's correction was applied

(p=0.087). The family-based TDT study also showed weak association of this

polymorphism with vitiligo with ap value of 0.0396. A physiological effect of this 3'

UTR polymorphism has recently been described. Seegers et al. (2002) observed an

increasing IL-12p70 secretion by monocytes in vitro in those without this

polymorphism, heterozygotes, and homozygotes with the 3' UTR polymorphism

respectively. This increase in IL-12 could contribute to autoimmunity, as it has been

hypothesized that disturbed Thl/Th2 balance, and or aberrant control of Thl cytokines,

such as IL-12, may play an important role in induction of T cell mediated

autoimmumity .

While many of these immune system candidate genes show statistically

significant p values (p<:0.05) in the case/control and/or family-based analysis, which

would hypothetically identify them as vitiligo susceptibility genes, most of these

associations are statistically weak. It is important to note that vitiligo is most likely a

disease with a multifactorial etiology. Therefore susceptibility genes that are

uncommon in a population, or genes which are only one of many such genes

responsible for the vitiligo phenotype may not show strong associations in case/control

analyses. It is with this in mind that we dismiss these genes possessing weak genetic

association with vitiligo, CTLA4/CD28, APS-1, CD4, and IL-12p40, as being










improbable susceptibility genes for vitiligo. In the next chapter, we describe analyses

of a different set of candidate genes, involved in antigen processing and presentation,

using a similar approach.















CHAPTER 3
ANTIGEN PROCESSING AND PRESENTATION GENES

Introduction

Many human autoimmune diseases have been associated with polymorphisms in

genes located in the MHC class II genomic region of the human HLA locus. This highly

polymorphic region includes several genes involved in the processing and presentation of

antigen to the immune system, including low molecular weight polypeptides -2 and -7

(LMP2 and LMP7) and transporter-associated with antigen processing proteins -1 and -2

(TAPI and TAP2). These four genes are associated with several autoimmune diseases,

such as type 1 diabetes, juvenile rheumatoid arthritis, ankylosing spondylitis, celiac

disease, Sjoigren's syndrome, and multiple sclerosis (Deng et al., 1995; Prahalad et al.,

2001; Fraile et al., 1998; Djilali-Saiah et al., 1994; Kumagai et al., 1997; Moins-

Teisserance et al., 1995). LMP2 and LMP7 encode IFN-y inducible subunits of the

immunoproteasome, which replace constitutively expressed subunits of the cytoplasmic

proteasome upon immune system upregulation. The immunoproteasome functions by

degrading ubiquitin-tagged cytoplasmic proteins into peptides that are especially suited

for presentation by MHC class I molecules (Tanaka et al., 1998; Pamer et al., 1998). An

additional IFN-y inducible subunit, multicatalytic endopeptidase complex-like-1

(MECL1i), is part of the immunoproteasome complex, but is encoded on chromosome 16

outside the MHC region. TAPI and TAP2 encode subunits of an IFN-y inducible

transporter heterodimer. TAPI and TAP2 function by binding peptides in the cytoplasm









and transporting them into the endoplasmic reticulum where they can be loaded into

nascent MHC class I molecules (Pamer et al., 1998).

As reported for other autoimmune diseases, genes in the HLA region may play a

role in vitiligo pathogenesis. Many HLA associations have been reported between

specific alleles of complement, class I and class II MHC genes with vitiligo, however,

many of these associations are solely found in isolated population groups (Friedman et

al., 1999). A recent segregation and linkage disequilibrium analyses of microsatellite

markers spanning the entire HLA region suggested a maj or HLA genetic factor

segregating as a dominant factor in patients with early onset of vitiligo (Arcos-Burgos et

al., 2002).

Because of the reported associations of these genes with other autoimmune

diseases, and due to the location of these genes inside the MHC class II genomic region,

we chose to genotype polymorphisms in LMP2, LMP7, TAP1, TAP2 and MECL1.

Because family based association for the SNP in intron 6 of LMP7 was so significant, we

also chose to sequence across LMP7 to search for mutations in this gene. We report here

case-control and family-based genetic association studies for the TAP1, TAP2, LMP7,

LMP2 and MECL1 genes in human vitiligo patients. The LMP/TAP gene region was

found to be significantly associated with vitiligo in Caucasian patients, suggesting a

possible role for MHC class I antigen processing and/or presentation in the anti-

melanocyte autoimmune response involved in vitiligo pathogenesis (Casp et al., 2003).

Materials and Methods

Blood Collection and Processing

Blood collection and processing, DNA extraction and genotyping were performed

as described in chapter 2.









LMP7 Sequencing

DNA preparation and PCR amplification

Six sets of PCR primers were designed within flanking introns to amplify all 6

exons (Table 3-1). Two DNA pooled sample sets were created, one containing mixed

DNA from 50 selected vitiligo patients, the other containing a mixture of DNA from 50

unaffected controls. PCR was carried out in a 50-C1L volume containing 50 mM KC1, 10

mM Tris-HC1, pH 8.3, 1.5 mM MgCl2; 60 CIM of each dNTP, pooled patient and control

genomic DNA, 2 pmol of each primer and 1.5 U Taq DNA polymerase. Samples were

subj ected to 3 5 cycles of 30 s at 940C for denaturing, 30 s at optimum annealing

temperature, and 30 s at 720C for extension.

Direct sequencing of PCR products

After PCR amplification, products (50 CIL) were electrophoresed on a 2.0% agarose gel.

The DNA fragments were excised from the gel and transferred into 1.5-mL Eppendorf

tubes. The tubes were frozen at -200C for 5-10 min. The gel slices were smashed while

frozen and then incubated in a 500-600C water bath for 10-15 min. The tubes were

briefly vortexed and the PCR products eluted out of the gels by a short centrifugation.

The supernatant was centrifuged once more to remove any remaining agarose. An

aliquot of products (30CLL) was then used directly for cycle sequencing using the ABI

Prism BigDye terminator (Applied Biosystems) according to the manufacturer' s

instructions. The sequencing reactions were precipitated in 3 vol. 100% ethanol and 0.1

vol. 3 M sodium acetate, pH 5.2. Pellets were washed with 250 C1L of 70% ethanol, dried

in a vacuum dryer and then dissolved in 20 CLL of template suppression buffer (Perkin












Table 3-1. LMP7 primers for sequencing across the gene


LMP7 marker/Exon amplified

LMP7 A/exon 1

LMP7 B/exon2

LMP7 C/exon3

LMP7 D/exon4

LMP7 E/exon5

LMP7 F/exon6


Forward Primer

TTACCTCCTTTCCAAGCT
CCTCG
TTAGGAGACCGTTGAAC
CTGGAG
AGACCCAAAGAAGAGGC
CACATG
TATACGCTCCAGCAGGC
AGAATC
CTATGGGCAGTATGATC
TGTGGC


Reverse Primer

AGAATATACCCGCCGCGT
GTAG
AACTTGCACTTCCTCCTCT
CAGG
TCCACTTTGTTGCAGAGT
TGGC
GGGGAACATGAAGAATG
GAGAGC
CACCTCCCAGGTTCAAGT
GATTC


TACAAAAATTAGCCGGA AGCAATGAGCAGCCTTCC
CGTGG TGAG









Elmer). DNA sequencing was carried out using an ABI 310 automated sequencer

(Applied Biosystems).

Results

Case/Control Association Studies

Allele and genotype frequencies

The single nucleotide polymorphisms (SNPs) used in this study as genetic markers

for the LMP/TAP genes and MECL1 are listed in Table 3-2. Case/control analyses of a

patient population consisting of 230 unrelated Caucasian vitiligo patients and 188

unrelated Caucasian controls revealed significant differences in allele and/or genotype

frequencies suggesting association with the candidate genes TAPI and TAP2 (data not

shown). However, when population heterogeneity between the case and control sets was

tested by using Wright' s F statistic according to the unbiased methods (6 value) of Weir

& Cockerham, a significant difference between the case and control populations was

indicated (Weir and Cockerham, 1984). As suggested by Arcos-Burgos et al. (2003), we

then stratified the vitiligo patient population by age of onset, as their segregation and

linkage disequilibrium analyses of the HLA region revealed a dominant genetic factor

segregating in vitiligo patients developing this disorder before age 30.

Using these new guidelines there was no significant difference in population

structure between a case population consisting of 100 Caucasian patients with an age of

vitiligo onset of 0-29 years and the control set as defined by subdivision analysis. Using

age of onset as a distinguishing factor, the 6 value was not significantly different than

zero (6 = 0.0050, 95% confidence interval -0.0010 0.0116). Exact tests for Hardy-
















Table 3-2. Primers used for LM~P TAP and M~ECL1 genotyping.


PCR Primers

Sequences (5' to 3')


Annealing Restriction


Fragment sizes (bp)
Cut Uncut

252 212,40

183 161,22


Gene


Polymorphism


Name


Temp.
58 C


Enzyme
Hha I


SNP ID

rsl7587

rs735883


LMP2 G/A exon 3 (R60H)


TMP2-2 GTGAACCGAGTGTTTGACAAGC


LMP2-1
TAPl-15
TAPl-16
TAPl-10
TAPl-11
LMP7-Z
LMP7-BR
LMP7-7
LMP7-4
TAP2-3
TAP2-4
TAP2-5
TAP2-6
MECL1-1
MECT,1-2


GCCAGCAAGAGCCGAAACAAG
GTGCTCTCACGTTCCAAGGA
AGGAGTAGAGATAGAAGAACCb
CTCATCTTGGCCCTTTGCTC
CACCTGTAACTGGCTGTTTG
TCGCTTTACCCCGGGGACTGa
AACTTGCACTTCCTCCTCTCAGG
TTGATTGGCTTCCCGGTACTG
TCTACTACGTGGATGAACATGG
GAACGTGCCTTGTACCTGCGCc
ACCCCCAAGTGCAGCAC
GGTGATTGCTCACAGGCTGCCGd
CACAGCTCTAGGGAAACTC
TCGACTTGGGTTGCAGGCTTAC
ATCTGAAGTAACCGCTGCGAC


TAPI


C/T intron 7


M~sp I

.4cc I

Pst I


TAPI G/A exon 10 (D637G)

LMP7 A/C exon 2 (Q49K)


165 136,29 rsl800453

212 194,18 rs2071543


LMP7


G/T intron 6


Hha I 583,180 428,180,155 ref. 1


TAP2 G/A exon 5 (V379I)

TAP2 A/G exon 11 (T665A)

MECL1 T/C exon 4 (L107L)


BstU I

nlsp I


212 192,20 rsl800454


225 205,20


rs241447


MAI 973,131 535,438,131 rs20549


"Underlined nucleotide in primer LMP7-Z was changed from the germline A to a C to create the Pst I RFLP.
bUnderlined nucleotide in primer TAP1-16 was changed from the germline G to a C to create the Msp I RFLP.
"Underlined nucleotide in primer TAP2-3 was changed from the germline T to a G to create the Bst UI RFLP.
dUnderlined nucleotide in primer TAP2-5 was changed from the germline T to a C to create the Msp I RFLP


Underlined nucleotides were altered from germline sequence to create restriction sites at the single nucleotide polymorphism (SNP).
SNP ID reference numbers are from the National Center for Biotechnology Information Single Nucleotide Polymorphism database
(http://www. ncbi. nlm. nih. gov/SNP









Weinberg equilibrium and linkage disequilibrium are shown in Table 3-3. Deviation

from Hardy-Weinberg equilibrium was observed for the TAP2 A/G exon 5 genetic

marker in both the patient and control populations. After Bonferroni's correction for

multiple comparisons, significant linkage disequilibrium was observed between LMP2-

TAP1, LMP2-LMP7 and TAPl-LMP7 genetic markers in patients, and between LMP2-

TAP1, LMP2-LMP7, LMP2-TAP2, TAPl-LMP7, LMP7-LMP7, and LMP7-TAP2

genetic markers in controls (Table 3-3).

The allele and genotype frequencies for the seven LMP/TAP and one MECL1

genetic markers genotyped for 100 Caucasian vitiligo patients with early age of onset (0-

29 years) and 188 unrelated Caucasian control subj ects are shown in Table 3-4 and 3-5.

No significant differences were observed for the allele counts and frequencies of six of

the eight markers examined (Table 3-4). The G/T SNP in intron 6 of the LMP7 gene

displayed an excess of the G allele in the patient vs. control groups (p=0.040). The G/A

SNP in exon 10 of the TAPI gene (D637G) exhibited a significant excess of the G allele

in the patient vs. control groups (p=0.0034).

Table 3-5 lists genotype counts and percentages for 100 Caucasian vitiligo patients

with early age of onset and 188 unrelated controls, as well as the p values determined by

X2 analysis of 3x2 contingency tables. No significant differences were observed for

seven of the eight markers genotyped. The G/A SNP in exon 10 of the TAPI gene

(D637G) exhibited a significant excess (p=0.0094) of the GG genotype allele in vitiligo

patients (71.4%) compared to controls (53.4%). Furthermore, comparison of the

individual allele carriage rates for this marker confirmed that the A allele carriage rate is

significantly lower in patients than in controls (28.6% vs. 46.6%, pc=0.0073), and that

















Table 3-3. Linkage disequilibrium analysis of Caucasian vitiligo patients (age of onset 0-29 years) and control subj ects.


LMP2 TAPI
G/A exon 3 C/T intron 7


TAPI
G/A exon 10


LMP7
A/C exon 2


LMP7
G/T intron 6


TAP2 TAP2
A/G exon 5 A/G exon 11


MECL1
T/C exon 4


Cases
LMP2 G/A exon 3
TAPI C/T intron 7
TAPI G/A exon 10
LMP7 A/C exon 2
LMP7 G/T intron 6
TAP2 A/G exon 5
TAP2 A/G exon 11
MECL1 T/C exon 4
Controls
LMP2 G/A exon 3
TAPI C/T intron 7
TAPI G/A exon 10
LMP7 A/C exon 2
LMP7 G/T intron 6
TAP2 A/G exon 5
TAP2 A/G exon 11
MECL1 T/C exon 4


0.067
<10-5 a
0.068
0.347
<10-5 a
0.091
0.812
0.603

1.000
<10-5 a
0.044
0.248
<10-5 a
0.001 a
0.856
0.615


0.220
0.183
0.509
<10-5 a
0.260
0.863
0.622


0.237
0.027
<10-5 a
<10-5 a
0.002
0.590
0.621


0.458
0.369
0.330
0.168
0.335
0.647




0.154
0.271
0.268
0.837
0.170
0.279


1.000
1.000
0.295
1.000
0.330





0.709
0.0003 a
0.229
0.836
0.300


0.670
0.618
0.811
0.160






0.537
0.0003 a
0.343
0.867


0.011
0.185
0.640







0.010
0.204
0.029


0.625
0.503









1.000
0.881


0.521










0.298


a p<0.05 after Bonferroni's correction for multiple tests.
P values for exact tests of Hardy-Weinberg equilibrium are shown in the diagonal (bold).
disequilibrium pairwise tests


Below are p values for the linkage
















Table 3-4. Allele frequencies of LM~P/TAP and M~ECL1 candidate genes in Caucasian vitiligo patients (age of onset 0-29 years) and
control subjects.


Vitiligo Patients
Count Percentage Count


Controls
Percentage


Gene


Polymorphism


Allele


a value


LMP2 G/A exon 3 (R60H) G


TAP1 C/T intron 7 C


TAP1 G/A exon 10 (D637G) A


LMP7 A/C exon 2 (Q49K) A


LMP7 G/T intron 6 G


TAP2 A/G exon 5 (V379I) A


TAP2 A/G exon 11 (T665A) A


MECL 1 T/C exon 4 (L107L) T


26.2
73.8

38.8
61.2

25.6
74.4

88.1
11.9

42.8
57.2

21.0
79.0

69.8
30.2


0.22


0.0034


0.91


0.040


0.85


0.65


146 80.2 259
36 19.8 61




















Table 3-5. Genotype frequencies of LMP
years) control subjects.



Gene Polymorphism

LDIP2 G/A exon 3 (R60H)



T4P1 C/T intron 7



T4P1 G/A exon 10 (D637G)



DIP7 A/C exon 2 (Q49K)



LDIP7 G/T intron 6



T4P2 A/G exon 5 (V379I)



T4P2 A/G exon 11 (T665A)



MLECL1 T/C exon 4 (L107L)


/TAP and MECL1 candidate genes in Caucasian vitiligo patients and (age of onset 0-29



Vitiligo Patients Controls
Genotype Count Percentage Count Percentage p value

GG 6 6.3 12 6.6 0.095
GA 50 52.6 71 39.2
AA 39 41.1 98 54.1

CC 21 23.3 27 17.3 0.47
CT 38 42.2 67 43.0
TT 31 34.5 62 39.7

AA 1 1.0 8 4.6 0.0094
AG 27 27.6 73 42.0
GG 70 71.4 93 53.4

AA 73 77.7 131 78.0 0.98
CA 19 20.2 34 20.2
CC 2 2.1 3 1.8

GG 26 28.6 28 16.9 0.077
GT 43 47.3 86 51.8
TT 22 24.2 52 31.3

AA 9 9.8 14 8.0 0.84
AG 22 23.9 46 26.1
GG 61 66.3 116 65.9

AA 51 52.6 90 48.9 0.83
AG 37 38.1 77 41.9
GG 9 9.3 17 9.2

TT 60 65.9 107 66.9 0.98
TC 26 28.6 45 28.1
CC 5 5.5 8 5.0









the overall G carriage rate is higher in patients than in controls, although not statistically

significant (99.0% vs. 95.4%, pc=0.22). Taken together, these results suggest a possible

association between the TAPI gene in the LMP/TAP gene cluster and vitiligo

susceptibility.

Family-based association

Further evidence for genetic association between LMP/TAP genes and vitiligo

susceptibility was sought using the transmission disequilibrium test (TDT), a family-

based (intrafamilial) study design that considers heterozygous (informative) parents and

evaluates the frequency with which alleles are transmitted to affected offspring (Speilman

et al., 1996). A X2 test was used to evaluate the deviation of the rates of transmission and

non-transmission from the random expectation (Table 3-6). For the TAPI G/A exon 10

(D637G) marker, only 35 informative heterozygouss) parents could be identified.

Although the number of informative parents is relatively low, analysis of this marker

suggests unequal transmission of alleles to affected children, with the G allele being

transmitted more frequently (69%) than expected due to random chance (p=0.028), which

is consistent with the allele and genotype frequencies described above.

TDT analysis of the other genes in the LMP/TAP cluster revealed additional

evidence for biased transmission of LMP/TAP alleles in vitiligo patients, with significant

differences detected (p<:0.05) for LMP2, TAPI and LMP7 genetic markers. Similar to

the results for the TAPI G/A exon 10 marker, the LMP2 G/A exon 3 (R60H) and TAPI

C/T intron 7 markers displayed allele transmission frequencies of 68%, and TDT p values

of 0.023 and 0.011i, respectively. The most highly significant TDT result (p<0.00006)

was observed for the LMP7 G/T intron 6 marker, for which there were 45 informative









Table 3-6. Family based association (transmission disequilibrium test) results for LM~P/TAP and M~ECL1 candidate genes and vitiligo
susceptibility


Number of Not %
Gene Marker Informative Parents Transmitted Transmitted Transmitted p value
LMP2 G/A exon 3 (R60H) 38 26 12 68 0.023
TAPI C/T intron 7 50 34 16 68 0.011
TAPI G/A exon 10 (D637G) 35 24 11 69 0.028
LM~P7 A/C exon 2 (Q49K) 26 16 10 62 0.24
LM~P7 G/T intron 6 45 36 9 80 0.000057
TAP2 A/G exon 5 (V379I) 22 12 10 55 0.67
TAP2 A/G exon 11 (T665A) 56 31 25 55 0.42
M~ECL1 T/C exon 4 (L107L) 47 24 23 51 0.88









parents available. The G allele was transmitted from unaffected parents to affected

children much more often (80%) than expected due to random chance

LMP7 Sequencing

50 Caucasian patients and 50 Caucasian controls were pooled from the overall

patient and control groups without regard to LMP7 genotype. Pooled groups were

sequenced with the hope of discovering new polymorphisms and/or mutations in the

LMP7 gene based on preliminary results from case/control and TDT analysis, which

initially revealed highly significant p values for both the case/control and family-based

studies. As the number of patients and controls used in the analyses increased, and as

Bonferroni's correction was applied, significant p values for LMP7 remained only in the

family based analyses. While LMP7 was sequenced completely across all 6 exons, there

was too much background from the 50 pooled samples to discern individual

polymorphisms (especially those with low patient numbers) with confidence. Even

known SNPs used as RFLP markers in the case/control and family based analyses were

not apparent within the sequenced data due to background variation (data not shown).

Discussion

Through the use of a candidate gene approach we have found evidence for genetic

association between vitiligo and the LMP/TAP region. Case/control analyses reveal

association of vitiligo and the gene encoding transporter associated with antigen

processing-1 (TAPl), whereas a family-based association method (TDT) revealed biased

transmission of specific alleles from heterozygous parents to affected offspring for the

TAPI gene, as well as for the LMP2 and LMP7 genes. No association with vitiligo was

found for the MECL1 gene, which encodes a third immunoproteasome subunit not

located in the MHC class II region (Casp et al., 2003).









The LMP/TAP genes play important roles in the regulation of class I antigen

processing and presentation, as their proteins form IFN-y inducible subunits of the

immunoproteasome and TAP transporter respectively. The proteasome is a large

protease made up of several subunits, which plays a crucial role in protein degradation in

the cell. Proteasomes. reside in the cytosol in both free-floating forms and bound to

ribosomes on the endoplasmic reticulum, and in the nucleus. In most cases the

proteasomes degrade intracellular proteins that have been marked for degradation by the

attachment of an ubiquitin moiety. The complete 26S proteasome is made up of two

major components, the 20S core protease subunit, and the 19S ATP-dependant cap

(Bochtler et al., 1999). The structural prototype of the proteasome is of four stacked

heptameric rings in an a7P7P7a7 cylindrical structure. The catalytic sites of the

proteases are located in the P subunits on the interior of the cylindrical structure, and

involve an N-terminal threonine. Other conserved resides in the vicinity of the

proteasome active site include Aspl7, Serl29 and Serl69 (Bochtler et al., 1999). The

20S proteasome is made up of at least 14 different subunits (Brooks et al., 2000). Three

of these subunits, known as X, Y, and Z, are constitutively expressed, but can be replaced

by the three IFN-y inducible subunits LMP2, LMP7, and MECL 1. When these inducible

subunits are present, the proteasome is known as the immunoproteasome. It was due to

their inducibility by IFN-y that these subunits were first believed to play a role in antigen

processing. These inducible subunits have many amino acid similarities to the

constitutive subunits, however they cleave proteins into peptides differently. The IFN-y

inducible subunits generate peptides with basic carboxyl termini, and hydrophobic

residues, while inhibiting cleavage after acidic residues. These residues are those that are









the most compatible with the binding groove of the MHC class I molecule (Tanaka et al.,

1998; Pamer et al., 1998; Driscoll et al., 1993).

Another subunit that is inducible by IFN-y is known as proteasome activator 28

(PA28) or 11 S REG. PA28 has three subunits, a, P, and y, which form a ring-shaped

heptameter (Rechsteiner et al., 2000). Evolutionarily, subunits a and P seem to have

been derived from gene duplication of the Ki antigen which is found in lower eukaryotes

(Fruh et al., 1999). Interestingly, anti-Ki antibodies are often found in conjunction with

systemic lupus erythematosus, another known autoimmune disease (Tanaka et al., 1998).

PA28 functions as an activator of the 20S proteasome, by associating with one or both

ends of the proteasome to create a football shaped structure as seen by electron

microscopy (Tanaka et al., 1998). The association of PA28 with the 20S proteasome

greatly enhances the proteasome's peptidase activities (Rechsteiner et al., 2000).

The proteasome plays an integral role in antigen processing and presentation

through the MHC class I pathway. The MHC class I pathway is mainly responsible for

processing and presenting intracellular pathogens such as viruses and intracellular

bacteria. Processing by either the constitutive or the IFN-y induced proteasome subunits

influence which peptides are generated and presented by MHC class I molecules

(Schwarz et al., 2000; Sijts et al., 2000; Morel et al., 2000; Maksymowych et al., 1998).

To reach the MHC class I molecule for binding, the proteasome-cleaved peptide must

cross into the endoplasmic reticulum from the cytoplasm. To do this, the peptide must

associate with a molecule known as transporter associated with antigen processing (TAP)

which will transport the peptide across the endoplasmic reticulum. TAP is an IFN-y

inducible heterodimer that consists of two subunits, TAPI1 and TAP2, both of which must









be present for peptide binding and translocation. Peptide binding is ATP independent,

but translocation across the ER does require ATP (Pamer et al., 1998). The TAP complex

preferentially binds peptides of certain lengths and of certain amino acid composition,

favoring basic, aromatic, hydrophobic and charged residues (Harding et al., 1997). As

mentioned before, these TAP/MHC class I-preferred peptides are produced at a higher

rate with the IFN-y induction of the immunoproteasome (Rechsteiner et al., 2000;

Harding et al., 1997).

Without antigen in its binding groove, MHC class I molecules are sequestered in

the ER. Newly synthesized MHC class I OC chain associates with a chaperone protein

known as calnexin. Association with calnexin retains the MHC in a partially folded state.

With the addition of the P-2 microglobulin chain, calnexin is released, and the MHC now

binds calreticulin, another chaperone protein, and tapasin, a protein that serves as a bridge

between the TAP complex and the MHC. The MHC will remain in this state until a

peptide that fits its specificity comes into the ER by way of the TAP transporter (Pamer et

al., 1998). MHC class I molecules are each capable of binding a repertoire of peptides

with lengths of 8-10 amino acids, characteristic anchor residues, and basic or

hydrophobic C-termini (Reichsteiner et al., 2000; Rock and Goldberg 1999).

With the maj ority of the proteins degraded by the proteasome being self-proteins,

the generation of altered forms of antigen by the immunoproteasome and the preferential

transport of MHC class I-compatible antigens across the ER membrane by TAP are

extremely important in influencing the expression of foreign peptide over self peptide.

Changes in function and/or expression patterns of TAP or LMP proteins could potentially

influence the peptide repertoire expressed to circulating lymphocytes, and allow for the









induction of inappropriate immune events to cryptic epitopes of self-peptides for which

the immune system has not been made tolerant. TAPI amino acid polymorphisms,

including D637G (in this report) and I333V, have been reported to influence the

permissiveness of transport of specific peptides across the endoplasmic reticulum in some

models(Quadri and Singal, 1998), and the TAP2 polymorphism T665A (in this report)

has been suggested to influence the antibody response to measles virus vaccine (Hayney

et al., 1997). Two functional studies of human TAP polymorphisms, however, revealed

no significant influence of human TAPI1 or TAP2 alleles on peptide binding and

translocation. (Obst et al., 1995; Daniel et al., 1997). Fewer functional studies have been

performed on LM~P polymorphisms, however, it has been reported that the LMP2 R60H

and LMP7 Q49K polymorphisms (in this report) affect age-dependent TNF-oc apoptosis

and response to interferon in patients with chronic hepatitis C, respectively (Mishto et al.,

2002; Sugimoto et al., 2002).

Immunoproteasomes might also play an integral role in maintaining peripheral

tolerance. Immunoproteasomes are normally expressed by cells in the thymus and by

mature dendritic cells under conditions in which most T cell activation occurs, whereas

elsewhere in the periphery constitutive proteasomes are expressed in the absence of

inflammation. Because non-professional antigen presenting cells in non-inflamed tissue

should only present antigens processed by the constitutive proteasome in their MHC class

I molecules, T cells specific for these peptides may become anergized upon presentation,

due to the lack of costimulation. T cells that become inadvertently activated by self-

peptide at a site of inflammation may "avoid" antigen from the same self-peptide in non-

inflamed sites due to differing epitopes produced by the constitutive proteasome









(Groettrup et al., 2001). In vitiligo patients, biochemical defects in the melanin pathway

that promote oxidative damage could be a trigger for excessive inflammation in the skin.

Inappropriate expression or function of either the constitutive proteasome or

immunoproteasome might influence antigen processing and presentation, leading to a

break in peripheral tolerance to melanocyte self-antigens.

Two other recent reports have also implicated the MHC class II region in vitiligo

susceptibility. Using a whole genome scan of a large family cluster with both vitiligo and

Hashimoto thyroiditis, a general autoimmune susceptibility locus (AIS1) was mapped to

human chromosome 1. Evidence was also reported for a Hashimoto disease

susceptibility locus within a chromosome 6 region spanning both the MHC and AIDT1, a

non-MHC locus associated with susceptibility to both Hashimoto thyroiditis and Graves'

disease (Alkhateeb et al., 2002). A linkage disequilibrium analysis of 56 multi-

generation Columbian families with vitiligo using microsatellite markers spanning the

entire human MHC region revealed a maj or genetic factor within the MHC at 6p21.3-

21.4 with a dominant mode of inheritance in vitiligo patients with an early age of onset

and a recessive mode of inheritance influenced by environmental effects in vitiligo

patients with an age of onset after 30 years of age. Comparisons of a variety of

inheritance models suggested that the most parsimonious genetic model was that of a

maj or dominant gene plus environmental effects, although multifactorial models could

not be rej ected (Arcos-Burgos et al., 2002).

In recent years there have been many reports of association of LMP and TAP genes

with human autoimmune diseases. LMP2 and LMP7 have been reported to be associated

with insulin-dependent diabetes mellitus (Deng et al., 1995); LMP7 is associated with









ankylosing spondylitis (Fraile et al., 1998) and with juvenile rheumatoid arthritis

(Prahalad et al. 2001); TAP2 is associated with Sjoigren's syndrome (Kumagai et al.,

1997); and with multiple sclerosis (Moins-Teisserenc et al., 1995). Other HLA

associations have been sporadically reported for vitiligo patients of various ethnic groups,

e.g. DR4 in Caucasian Americans (Foley et al., 1983), A2 in German and Slovak patients

and Dw7 in Slovak patients (Buc et al.; 1996, Schallreuter et al., 1993), Cw6 and DR6 in

Dutch patients (Venneker et al., 1993), and B21, Cw6 and DR53 in Kuwaiti patients (al-

Fouzan et al., 1995). Unlike most autoimmune diseases, there seems to be no common

HLA association with vitiligo. Insufficient numbers of vitiligo patients from other ethnic

and racial populations were available for comparison to Caucasians in this study. Several

studies have reported HLA associations in early onset vs. late onset vitiligo cases (Arcos-

Burgos et al., 2002; Orecchia et al., 1992; Finco et al., 1991). Classification ofyitiligo

patients by age of onset was therefore important to detect valid genetic association with

the LMP/TAP gene cluster. We detected no association between the LMP/TAP or

MECL 1 genes and late-onset vitiligo (data not shown).

We interpret this association study in the LMP/TAP region with caution, given the

complications caused by a high occurrence of linkage disequilibrium in the region, for

which there are variable and inconsistent reports for markers spanning the entire region

from DM and DPB, through the LMP/TAP cluster, and extending to the DRB 1, DQAl

and DQB 1 genes (Djilali-Saiah et al., 1996; Van Endert et al., 1992 Carrington et al.,

1994). Similarly, after Bonferroni's correction, significant disequilibrium values were

observed among some but not all possible pairwise LMP/TAP comparisons within the

vitiligo patient and control populations (Table 3-3). The LMP/TAP gene cluster also









features a well-characterized recombination hotspot within intron 2 of the TAP2 gene,

and additional recombination hotspots are located throughout the human IVHC locus

(Cullen et al., 1997, 2002; Jefferys et al., 2000). Until functional data are found to

confirm associations with autoimmune disease suggested by genetic studies, definitive

conclusions about genetic association in this region will remain controversial, as

associations with autoimmune disease may be due to linkage disequilibrium with other

genes in the MHC class II region. Although most autoimmune diseases have been linked

to various genes within IVHC class II region, it is important to note that to our

knowledge, causative mutations in IVHC class II regions have yet to be found to explain

potential associations to disease pathology. It has been suggested that multiple IVHC

genes may be contributing to disease pathogenesis, and that statistical analyses may be

averaging the effects of several genes to a centralized gene (Fu et al., 1998).

Nevertheless, our data are consistent with genetic association of the L1VP/TAP region

with vitiligo susceptibility















CHAPTER 4
CATALASE

Introduction

Catalase is a homotetrameric, heme-containing, peroxisomal enzyme that catalyses

the conversion of hydrogen peroxide (H202) to water and oxygen. Catalase is one of

several redundant enzymes whose main function is to prevent cell damage from highly

reactive oxygen-derived free radicals. A reduction of catalase enzyme activity (EC

1.1 1.1.6) has been reported in the entire epidermis of vitiligo patients (Schallreuter et al.,

1991, 1999). Defects in several enzymes involved in melanin synthesis have also been

observed in vitiligo patients, lending evidence for the autotoxic theory of vitiligo

pathogenesis. The sum of these enzymatic defects result in the buildup and accumulation

of H202 in the epidermis of vitiligo patients. High concentrations of H202 Can TOSult in

the deactivation of catalase. It is therefore unknown if the decreased concentration of

catalase found in vitiligenous epidermis is a direct result of the accumulation of H202 due

to previously reported biochemical defects, or whether there is a separate problem with

the catalase enzyme. Topical treatment of vitiligo patents with pseudocatalase, which

mimics the activity catalase, promotes repigmentation due to the apparent correction of

some of the biochemical defects that caused the accumulation of hydrogen peroxide in

the epidermis (Schallreuter et al., 2001).

The observed catalase deficiency in vitiligo patient skin is the basis for treatment of

vitiligo with pseudocatalase, a bis-manganese III-EDTA-(HCO3 )2 COmplex that can

degrade H202 to 02 and H20 after UVB photoactivation, thus mimicking the action of










endogenous catalase (Schallreuter et al., 1995, 1999a, 1999b). Pseudocatalase is applied

topically to the entire epidermis twice daily accompanied by total body low dose narrow-

band UVB exposure 2-3 times per week. Clinical results are very promising, with a halt

in the progression of active vitiligo in 95% of the patients treated, and repigmentation in

60-65% of treated patients independent of disease duration. The biochemical effects of

pseudocatalase also include a dramatic decrease in epidermal H202 leVOIS and restoration

of the normal 6BH4 TOCyCling prOcess (Schallreuter et al., 1995, 1999b, 2001).

In these experiments, case/control and family based association studies, and gene

sequencing were used to determine if the cause of decreased patient epidermal catalase

levels is due to a defect in the catalase gene itself. Results from these association studies

revealed preliminary evidence for genetic association between the catalase gene and

vitiligo susceptibility, which further supports a role for deregulation of the skin's ability

to handle oxidative stress in the pathogenesis of vitiligo (Casp et al., 2002).

Materials and Methods

Blood Collection and Processing

Blood collection and processing, DNA extraction and genotyping were performed

as described in chapter 2.

Catalase Sequencing

DNA preparation and PCR amplification

Thirteen sets of PCR primers were designed within flanking catalase (CAT) gene

introns to amplify individual exons (Table 4-1).

In order to determine the maximum DNA pool size that would allow detection of

rare mutations, DNA sample pools from vitiligo patents were created with each pool

having an incrementally increasing number of patients who had been genotyped for a












Table 4-1. Catalase primers for sequencing across the gene


CAT
marker/Exon
amplified
CATx1/exon 1

CATx2/exon 2

CATx3/exon 3

CATx4/ exon 4

CATx5/exon 5

CATx6/exon 6

CATx7/exon 7

CATx8/exon 8

CATx9/exon 9

CATx10/exon 10

CATx11/exon 11

CATx12/exon 12

CATx13/ exon 13


Forward Primer


TGAAGGATGCTGATAACCG

AAGTATTGACCAGCACAGC

CAGAAGGCTGGTGCTAAC

AGTTCTTGGAAGTGGATTAG

GCTAGTT GT CTAT GCT GAG

TCATTAAGGGACTTTCTGG

GCAGTGTTACTCATAATCCT

ATTGAGTATGTGTATGTGGC

GAAGTTTACAGCC CATTCC

TAGCAGATGGCAGCGTTC

AAAGTGAAGGACACAACCC

ACTCTGAGGCTGGCATTG

TTCACTGGCAAAACACATAC


Reverse Primer


CCATGAGCCCTCAATCTG

AACCTGAGGAAATAACCATC

AACTTCCTATGTGTCTCC

TTTGCCATGTTGCCCAGG

CTTTACCTTACACTACAGAC

ATAATGAGATTGGGATACGC

GTAAGCACTCATTCACAGC

GTGAATCCCACAAGGTAAC

CAAGTAACATCTGAGGTGG

GATACATCAGACAGTTGGG

CAAACAGCTAAGGACGATG

ACAGTGGCAGGTAATGGC

AAGAGTCTGGTAGCAGTTTA









known catalase polymorphism. This strategy allowed for the visualization of an

increased amplitude of the polymorphic SNP peak on the sequence chromatograph. This

experiment proved that in a small pool (ten patients) it would be possible to observe a

SNP or mutation present in only one of the ten patients sequenced in that pool.

Thirteen pools were then created with ten patients each, regardless of past catalase

genotype. PCR was carried out in a 10-CIL volume containing 10x PCR buffer (50 mM

KC1, 10 mM Tris-HC1, pH 8.3, 1.5 mM MgCl2); 60 CIM of each dNTP, pooled patent and

control genomic DNA, 2 pmol of each primer and 1.5 U Taq DNA polymerase. Samples

were subj ected to 3 5 cycles of 30 s at 940C for denaturing, 30 s at optimum annealing

temperature, and 30 s at 720C for extension.

Direct sequencing of PCR products

After PCR amplification, products (10 CIL) were electrophoresed on a 2.0% agarose

gel. Bands were excised from the gel and transferred into 1.5-mL Eppendorf tubes. DNA

was eluted from the agarose gel using Quantum Prep Freeze and Squeeze DNA gel

extraction spin columns (Bio-Rad). An aliquot of products (30CLL) was then used directly

for cycle sequencing using the ABI Prism BigDye terminator (Applied Biosystems)

according to the manufacturer' s instructions. The sequencing reactions were then

precipitated in 3 vol. 100% ethanol and 0.1 vol. 3 M sodium acetate, pH 5.2. The pellets

were washed with 250 CIL of 70% ethanol, and spun down in a dye-terminator removal

column (Qiagen), dried in a vacuum dryer and then dissolved in 20 CIL of template

suppression buffer (Perkin Elmer). DNA sequencing was carried out using an ABI 310

automated sequencer (Applied Biosystems).









Results

Catalase Gene Polymorphisms

Three catalase gene single nucleotide polymorphisms (SNP) were genotyped in this

study, two of which were found to be uninformative (Table 4-2). A T/C substitution in

the CAT 5'-untranslated region, previously characterized in Hungarian acatalasemic and

hypocatalasemic subjects was genotyped by AFLP analysis (Goth et al., 1998). A Pst I

(CTGCAG) RFLP was created by changing one nucleotide in the reverse PCR primer

(Table 4-2). This polymorphism was found to be uninformative for our Caucasian patient

and control populations, as nearly all subj ects were homozygous for the T allele (data not

shown). A T/C silent substitution in exon 10 (Leu-419), genotyped by RFLP analysis

using the restriction endonuclease BstN I (CCWGG) was also shown to be

uninformative. In this polymorphism, the T allele is cleaved by BstN I; whereas, the C

allele remains uncut. Nearly all subjects genotyped were homozygous for the T allele,

which differs from the allele frequencies of 0.78 T and 0.22 C reported in the NCBI SNP

database (data not shown).

The informative CAT genetic marker was a T/C silent substitution in CAT exon 9 (Asp-

389), which was genotyped using RFLP analysis of amplified genomic fragments with

the restriction endonuclease BstX I (CCANNNNNNTGG) Forsberg et al., 1999 With

this polymorphism, the T allele is cleaved by BstX I, whereas the C allele remains uncut.

We observed allele frequencies of 0.82 C and 0. 18 T in our control population (Table 4-

3), which were similar to those reported by Forsberg et al.(1999) for only 58 Caucasians

(0.87 C and 0.13 T).
















Table 4-2. Sequences of primers used for CAT genotyping


PCR Primer Sequences (5' to 3')


Restriction
Enzyme
Pst I
BstX I
BstN I


Anneal
Temp.
600C
640C
680C


NCBI
SNP IDb
rsl049982
rs769217
rs704724


Polymorphism
T/C 5'UTR
T/C exon 9
T/C exon 10


Forward Primer
GCCAATCAGAAGGCAGjTCC
GCCGCCTTTTTGCCTATCCT
CCTAAGTGCATCTGGGTGGT


Reverse Primer
GCGTGCGGTTTGCTCTGCa
TCCCGCCCATCTGjCTCCAC
TACATCAGACAGTTGGGGCA


CAT-1
CAT-5
CAT-7


CAT-2
CAT-6
CAT-8


aUnderlined nucleotide in primer CAT-2 was changed from the germline G to a C to create the Pst I RFLP.
bNational Center for Biotechnology Information Single Nucleotide Polymorphism database: hilll-. -- -- -- !ic l--s! nil! !mis e v/SNP









Association of the T/C Exon 9 (BstX I) CAT Marker with Vitiligo

The observed allele and genotype frequencies for the T/C SNP in exon 9 in control

and patient populations are shown in Table 4-3. The allele frequencies for this CAT

genetic marker did not differ significantly between the control and patient populations

(p=0.54). When the observed control and patient genotype frequencies were compared

with expected values using a 3x2 contingency table in a standard X2-test (Table 4-3), they

were found to be significantly different (p=0.0024), suggesting possible association of the

T/C exon 9 (BstX I) CAT marker with vitiligo. The observed genotype frequencies of the

control population did not significantly differ from those predicted by the Hardy-

Weinberg equation (p=0.26). However, the genotype frequencies observed in the vitiligo

patient group did not appear to be in Hardy-Weinberg equilibrium (p=0.016), with an

apparent excess of heterozygotes and deficiency of each homozygote class in the patient

population. Comparison of individual allele carriage rates and the percentage of

heterozygotes vs. homozygotes (Table 4-4) revealed that the overall C allele carriage rate

and the frequency of heterozygotes were significantly higher in patients than in control

subj ects.

Family-Based Association

Further suggestive evidence for genetic association between the CAT gene and

vitiligo susceptibility was obtained using TDT, a family-based study design that

considers heterozygous parents and evaluates the frequency with which alleles are

transmitted to affected offspring. A X2-test was used to evaluate the deviation of the rates

of transmission and non-transmission of the C and T alleles of the T/C exon 9 (BstX I)

CAT marker from the random expectation of 50:50. Forty-three informative


















N C T C/C C/T T/T C/C C/T T/T p value
Controls 177 0.82 0.18 122 (68.9) 46 (26.0) 9 (5.1) 119 52 6 0.26
Patients 235 0.80 0.20 144 (61.3) 89 (37.9) 2 (0.8) 151 75 9 0.016
p value 0.0024a
controls vs. patients using the X2 test with 3x2 contingency table
b Observed vs. expected according to Hardy-Weinberg equilibrium


Controls 94.9 31.1 26.0 74.0
Patients 99.1 38.7 37.9 62.1
p value 0.0083 n.s.a 0.011
Corrected pb 0.025 0.033
a n.s., not significant
b USing Bonferroni's correction


Table 4-3. Distribution of alleles and genotypes for the T/C SNP in CA T exon 9 in vitiligo patient and control populations


Expected genotype countsb


Observed allele
frequencies


Observed genotype counts (%)


Table 4-4. Carriage rates and heterozygosity of the T/C SNP in CAT exon 9 in vitiligo patients compared to controls


Heterozygotes vs. homozygotes
C/T (%) C/C + T/T (%)


C carriage rate
(%)


T carriage rate
(%)










heterozygouss) parents were identified among all of the patients and family members

genotyped. The C allele was transmitted more frequently to affected offspring than

expected as a result of random chance (X2=3 .93, p=0.047).

Catalase Sequencing

The catalase gene was sequenced across 13 exons using 12 pools of five patients

each. Using this method, we were able to observe polymorphisms used in our genotyping

study. Although several new single nucleotide polymorphisms were identified none

resulted in amino acid changes that could affect enzyme activity or exert an obvious

effect on gene expression. No new interesting SNPs were found in exon 9, where the T/C

SNP was genotyped (Table 4-5).

Discussion

Both family based and case/control association studies suggest a role for catalase,

an enzyme responsible for the degradation of hydrogen peroxide to water and oxygen, in

vitiligo pathogenesis. Because catalase is one of many redundant antioxidant enzymes,

the absence of catalase enzyme activity in blood and tissues predisposes patients to oral

infections by peroxide-generating bacteria such as streptococci and pneumococci, but

most forms of hypocatalasemia and acatalasemia are asymptomatic (Eaton et al., 1995).

Vitiligo-like depigmentation is not a reported phenotypic feature of acatalasemia or

hypocatalasemia. However, a possible role for catalase in vitiligo susceptibility was

suggested by reports of low epidermal catalase activity in both lesional and non-lesional

skin of vitiligo patients, with concomitant increases in epidermal H202 (Schallreuter et

al., 1991, 1999a, 1999b). Whereas epidermal levels of catalase were decreased in vitiligo

patients, erythrocyte levels of catalase were reported to be comparable in 10 vitiligo












Table 4-5. Catalase gene single nucleotide polymorphisms (SNPs).

SNP Position Location

A/T 36535 15 base pairs 5' of mRNA
start site
G/A 36466 5' UTR

G/A 36303 Intron 1

C/T 36296 Intron 1

T/C 36238 Intron 1

C/T 26328 Intron 1

T/C 18934 Intron 7

G/T 6919 Intron 11

T/G 6915 Intron 11










patients and 20 control subj ects suggesting that the catalase deficiency in vitiligo patients

may be limited to the skin and otherwise asymptomatic (Maresca et al., 1997).

The elevated levels of H202 Observed in the epidermis of vitiligo patients, can

depress catalase activity by irreversibly inactivating the heme active site of catalase

(Aronoff et al., 1965). As discussed in detail by Schallreuter et al. (1999) several

biochemical defects have been reported for vitiligo patients can contribute to the

accumulation of epidermal H202, including defects in the de novo biosynthesis and/or

recycling of the essential cofactor (6R)-L-erythro-5,6,7,8-tetrahydrobiopteri (6BH4)

(Schallreuter et al., 1994), increases in epidermal monoamine oxidase A (EC 1.4.3.4)

activity (Schallreuter et al., 1996), and reduced glutathione peroxidase (EC 1.11.1.9)

activity (Beasley et al., 1999). The oxidative burst associated with NADPH oxidase

activities of inflammatory cells observed to infiltrate the peri-lesional skin of some

patients with active vitiligo is another potential source of H202 in patient skin (Ortonne et

al., 1993).

Other possible mechanisms of catalase deficiency in the skin of vitiligo patients

include tissue-specific differences in gene expression or enzyme structure/function in

patient melanocytes and/or keratinocytes. Qualitative comparison of catalase mRNA

levels in cultured melanocytes from lesional or non-lesional epidermis of vitiligo patients

or healthy controls showed no differences in expression between these groups

(Schallreuter et al., 1999b). Genetic association of the catalase gene with vitiligo

susceptibility is suggested by both by case-control and family based association studies,

suggesting that low catalase enzyme activity may be due to mutations within the catalase

gene that influence catalase activity in skin cells. Our association data suggest it is the









heterozygote genotype for T/C SNP in CAT exon 9 that confers susceptibility to vitiligo

pathogenesis. A possible explanation for this observation might be a dominant negative

effect of another mutation(s) linked to the C allele, resulting in a quantitative deficiency

of catalase enzyme activity. As observed for other multimeric proteins, mutations that

interfere with subunit assembly, interaction and/or function can lead to assembly of

mutant multimers that interfere with the function of the normal allele (Nussbaum et al.,

2001). According to this model, such a CAT mutation in the heterozygous state would

result in the expression of catalase enzyme tetramers with varying numbers of normal and

mutant subunits. Assuming equal levels of protein expression from both alleles and

depending on the nature of the CAT mutation(s), mixed molecules with possible reduced

enzyme activity could represent up to 80% of the tetramers. Interestingly, a quantitative

deficiency in catalase has also recently been suggested to play a role in diabetes

pathogenesis, as Hungarian patients with a demonstrated catalase deficiency exhibited a

higher frequency of diabetes than unaffected first-degree relatives and the general

Hungarian population (Goth et al., 2000). No CAT genetic analyses or gene expression

studies have been reported for diabetes thus far.

Sequence analysis of the entire catalase coding region was completed to screen for

the presence of any potential SNPs that may serve as functional mutations in the catalase

gene. SNPs in exon 9 were of particular interest, however no functional SNPs/potential

mutations were observed in the region. These results can be explained in several

different ways. Firstly, the mutation may not be in the sequenced exonic regions,

mutations in introns can affect splice sites, allowing for variation in translated proteins.

SNPs we have found "uninteresting" could still cause variations in the translated proteins,










amino acid substitutions anywhere in the coding region, even those that are conserved

could impact protein secondary structure, which could potentially affect the binding of

the two catalase subunits.

Given the lack of association between acatalasemia and vitiligo, and the localized

decrease in enzyme activity, it is possible that the effects of CAT mutations contributing

to vitiligo susceptibility may be tissue-specific, resulting in changes in gene expression or

enzyme structure/function in patient melanocytes and/or keratinocytes. Such mutations

might lead to a quantitative deficiency of catalase activity in the epidermis that is a

contributing causative factor for the accumulation of H202, rather than simply a

consequence of H202 accumulation from other sources. Overall, these results suggest

that the catalase gene may be a susceptibility gene in some vitiligo patients, and further

support the epidermal oxidative stress model for vitiligo pathogenesis. Further gene

expression studies could help to define a causative role of this enzyme in the etiology of

vitiligo, and chapter 5 discusses our approach and results.















CHAPTER 5
CANDIDATE VITILIGO SUSCEPTIBILITY GENE EXPRESSION STUDIES

Introduction

Genetic association evidence points towards a possible involvement of catalase and

genes in the LMP/TAP region of the MHC class II region with vitiligo pathogenesis.

Gene expression and/or function studies are needed to provide further evidence for a role

of any of these genes in vitiligo pathogenesis. As our genetic studies have revealed,

vitiligo pathogenesis may include involvement of both biochemical defects in

melanogenesis as well as an inappropriate immune involvement. As a result of this

finding, we have chosen to look at gene expression in antigen presenting cells, which

serve as a bridge between intracellular events and the immune system. Because vitiligo

is a dermatological disorder, the most appropriate cell for this study should be the dermal

Langerhans cell. However, because this cell type is extremely difficult to isolate in

numbers needed for expression study analysis, we have chosen to look at gene expression

in monocytes isolated from peripheral blood. We are hypothesizing that any defect seen

in dermal APCs maybe seen in all other APCs as well.

Changes in expression of mRNA from catalase or any of the antigen processing

genes would bolster evidence of that gene's involvement in vitiligo pathogenesis. Thus,

gene expression studies were performed on catalase, as well as on genes involved in

antigen processing and presentation, including MHC class I and the IFN-y inducible

genes of the MHC class II region, TAP1, TAP2, LMP2 and LMP7. RNA expression

studies of the LMP and TAP genes should reflect an IFN-y inducible upregulation of the









message. MHC class I expression is also IFN-y inducible, and is easily observable by

surface P2-microglobulin (P2m) expression using flow cytometry. Catalase can be

quantitated by measuring enzyme activity as well as through semiquantitative RT-PCR of

catalase RNA. It is unknown if catalase expression is IFN-y inducible, however, we

observed mRNA and catalase enzyme expression with and without the addition of IFN-y.

Variability in expression of mRNA or the enzyme activity of any of these genes might

implicate that gene further in the pathogenesis of vitiligo.

Materials and Methods

Monocyte Isolation and Culture

PBMCs were obtained from whole blood from vitiligo patients who had contacted

the research group after reading about the study through a website set up at both the

University of Florida and at the National Vitiligo Foundation. Vitiligo patients and

controls donated 3 5 mL of blood on their first visit and 50 mL of blood on any

subsequent visit. PBMCs used for isolating monocytes used in RNA assays were isolated

by centrifugation (50 x g for 30 min at 250C) on Ficoll gradients, washed with lx PBS,

and resuspended in RPMI-1640 plus endotoxin-free 10% FCS. PBMCs were counted,

and their viability was assessed by trypan blue exclusion. Cells were plated at lx107 cells

per well in a 6-well plate. Cells were allowed to adhere to the plate for 2 hours, and then

washed vigorously with 1xPBS to remove non-adherent cells. Cells for flow cytometry

and catalase enzyme activity assays were subj ected to a negative selection resetting

protocol to isolate purified monocytes using RosetteSep monocyte enrichment antibody

cocktail (StemCell Technologies). After antibody treatment to whole blood, monocytes

were isolated by centrifugation (500 x g for 20 minutes at 250C), washed with









lxPBS+2% FB S, and RBCs were subj ected to lysis using RBC lysis solution (139 mM

ammonium chloride; 17 mM Tris-HC1, pH 7.65). Purified monocytes were then cultured

in 5 mL polypropylene tubes (Falcon) at 2x106 CellS per tube. All cells, both adherence-

purified and rosetted, were plated in duplicate, +/- the addition of either 1000 U or 500 U

human IFN-y and incubated 24 hours at 370C in 5% CO2.

Semi-Quantitative RT-PCR

RNA was extracted from 6-well plates using RNAqueous-4PCR Kit protocol

(Ambion), and purity of the RNA was assessed spectrophotometrically at 260 and 280

nm. LMP2, LMP7, TAPI TAP2 and CAT RNA expression in monocytes cultured

overnight was monitored using semi-quantitative RT-PCR using the Retro SCRIPT kit

(Ambion). 250 ng of RNA from each sample were used to synthesize the first-stand

complementary DNA (cDNA), using random decamer primers and M-MLV (Ambion).

The primer sequences used to amplify cDNAs are shown in Table 5-1. Gene specific and

18S alternate primers/competimers (Ambion) were used in this experiment.

Competimers for 18S amplification chemically modify 18S primers, compete with the

18S primers and reduce the efficiency of the 18S amplification so that the 18S primers do

not become limited. Five CLL aliquots of the RT reaction were used to amplify gene

specific and 18S fragments, respectively, with 10X dNTP (2 C1L each dNTP, 92 CLL 10

mM Tris-HC1, pH 7.5), 10X PCR buffer (50 mM KC1, 10 mM Tris-HC1, pH 8.3, 1.5 mM

MgCl2), 2.5 CLM gene-specific primers (forward and reverse) or 18S primers/competimers

(8:2; 2 CIL) and 1.25 U Taq polymerase. Amplification of gene specific and 18S cDNAs

was performed for 35 cycles, each cycle consisting of 1 min denaturation at 950C, 30 s

annealing at 580C, and 30 s extension at 720C. cDNA was electrophoresed on a 2.0%







82




Table 5-1. RT-PCR primer pairs and PCR conditions for LMP2, LMP7, TAP1, TAP2
and catalase



Gene PCR Forward Primer Reverse Primer
Temperature
oC
CAT 58 AGTGGCCAACTACCAGCGTGA TCCAGTGATGAGCGGGTTACA

LMP2 58 TTGTGATGGGTTCTGATTCCCG CAGAGCAATAGCGTCTGTGC
LMP7 58 TCGCCTTCAAGTTCCAGCATGG CCAACCATCTTCCTTCATGTGG
TAP1 58 CAGAATCTGTACCAGCCC CTGGCTGATGCATCCAGG
TAP2 58 TACCTGCTCATAAGGAGGGTGC ATTGGGATATGCAAAGGAGACG









agarose gel, and visualized using ethidium bromide staining and a 312 nm UV-

transilluminator

Flow Cytometry of P2-microglobulin

Monocytes purified by resetting were incubated in FACS buffer (1% RIA grade

BSA, 0. 1% sodium azide in lx PBS, pH 7.4) with endotoxin-free lyophilized mouse

serum (Sigma Chemical Co.) for 20 minutes. Anti-CD 14 PE monocytess), FITC labeled

isotype control, and FITC labeled anti-P2-microglobulin (MHC class I) antibodies were

added to aliquots of cells and incubated for an additional 20 minutes. Cells were then

fixed with 4% formaldehyde for 20 minutes. Fixed cells were washed twice in FACS

buffer, and then resuspended in 200 CLL FACS buffer. Flow cytometric analysis was

performed using a FACSscan or FACSCalibur flow cytometer (Becton Dickinson

Immunocytometry Systems), collecting between 5,000 to 10,000 ungated events.

Catalase Enzyme Assay

One mL of whole blood was taken from each patient and control and immediately

frozen at -700C, to use as an erythrocyte control in the catalase enzyme activity assay.

Monocytes purified by resetting were pelleted and washed twice in lx PBS. The cells

were resuspended in 40 C1L of sample diluent (surfactant in phosphate buffer) provided in

the Catalase-520 kit (OxisResearch) and frozen at -700C. Samples of whole blood and

monocytes were thawed and the whole blood samples were diluted 1000-fold in sample

diluent. 30 CLL of each sample were placed in a clean 1.5 mL tube, and 500 CLL substrate

(10 mM H202) WAS added and incubated for exactly one minute. After 1 minute, 500 CLL

of stop reagent (sodium azide) was added, and each tube was capped and inverted. 20 CLL

of each reaction was added to cuvettes, and 2 mL of HRP/Chromogen reagent was added,









and incubated for 10 minutes. In this assay, the rate of dismutation of hydrogen peroxide

to water and molecular oxygen is proportional to catalase concentration. The sample is

treated with a known quantity of H202, and then quenched with sodium azide. The

amount of H202 remaining in the reaction mixture is determined through the oxidative

coupling of 4-aminophenazone and 3,5-dichl oro-2-hydroxybenzenesulfonic acid in the

presence of H202 and catalyzed by horseradish peroxidase. Absorbance is then read at

520 nm, and catalase concentration of each unknown was determined by fitting diluted

standards to a second order polynomial regression.

H202 Treatment of Monocytes

Monocytes isolated by resetting were exposed to 100 CLM H202 for 24 hours to

simulate oxidative stress, and to determine catalase and P2-microglobulin expression in

both vitiligo patients and controls. After 24 hours, cells were pelleted and washed twice

with lx PBS before the catalase assay, or flow cytometry for P2-microglobulin

expression was performed.

Results

Catalase Assay

Catalase enzyme concentrations were determined in whole blood and purified

monocytes from 10 patients and 10 controls. Whole blood samples were frozen

immediately after the blood draw, and purified monocytes were cultured for 24 hours +/-

500 U IFN-y. Catalase levels were determined using a colorimetric assay, which detects

the degradation of H202 by endogenous catalase present in the sample, measured as

absorbance at 520nm. Unknown sample concentrations were determined by applying the

absorbance to a standard curve of known catalase sample concentrations. Catalase









concentrations were found to be significantly lower in vitiligo patient monocytes (p=

0.0252), as determined by Student's t test (Figure 5-1). Concentrations did not seem to

vary with or without the addition of 500 U IFN-y to the monocyte cultures. As seen in

previous studies (Maresca et al., 1997), catalase concentrations did not vary significantly

in erythrocytes of the same vitiligo patients and controls (Figure 5-2). These results show

a decreased catalase enzyme level in vitiligo patients in monocytes, which is not seen in

patient whole blood.

P2-Microglobulin Expression

Flow cytometry was employed to determine expression of MHC class I on the

surface of monocytes using P2-microglobulin as a marker. PE-labeled anti-CD14

antibodies were used to label monocytes. Purified monocytes were treated +/- 500 U IFN-

y overnight. Because the percentage of cells expressing P2-microglobulin was not

significantly different throughout patient and control populations, mean fluorescence

(MF), or the amount of P2-microglobulin on the cell surface of each monocyte, was

compared between patient and control populations. As expected, MHC class I

expression, as measured by P2-microglobulin expression, was upregulated in response to

IFN-y in both patient and control purified monocytes. P2-microglobulin expression was

also shown to be significantly higher on control monocytes after IFN-y treatment than in

vitiligo patients (p=0.0496 using a Student' s t test) (Figure 5-3). Expression of P2-

microglobulin on untreated monocytes also approached significance between the patient

and control populations (p=0.0512). This data suggest that vitiligo patients have a lower

expression of MHC class I on their monocytes than normal controls. It is important to

note that there is one control individual whose P2-microglobulin expression is much

















Monocyte Catalase Levels


I


Control IFNl gamma+ Patient IFN~ gamma+ Control IFN gamma Patient IFN gamma-


Figure 5-1. Monocyte catalase levels in patients and controls. Patient monocytes have
significantly less catalase activity than controls after treatment with 500 U
IFN-y (p= 0.0252 by Student's t test). Asterisks represent significant
differences in allele frequency between patient and controls.




























O


87






Eryth rocyte Catalase Levels


25000-

20000-

15000-

100001

50001


5
m


A


Controls


Patients


Figure 5-2. Erythrocyte catalase levels in vitiligo patients and normal controls.




Full Text

PAGE 1

GENETIC ASSOCIATION OF CATALASE AND ANTIGEN PROCESSING GENES WITH VITILIGO SUSCEPTIBILITY By COURTNEY BRADLEY CASP A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2003

PAGE 2

Copyright 2003 by Courtney Bradley Casp

PAGE 3

This dissertation is dedicated to my husband Ju stin, who encouraged me every step of the way.

PAGE 4

iv ACKNOWLEDGMENTS I first would like to thank my mentor, Dr. Wayne McCormack, for his guidance and encouragement in the completion of my studies. I thank him for patiently and knowledgeably answering the hundr eds of questions I have asked him over the course of my dissertation work. He is an inspiring e ducator, both in the classroom and in the lab. Next, I would like to thank the member s of my dissertation committee, Dr. Mike Clare-Salzler, Dr. Sally Litherland, and Dr. Peggy Wallace, for their time, energy and guidance. I would like to ex tend special thanks to Dr. Litherland, who patiently taught me monocyte culture technique s, and whose lab and office were always open to me. I am indebted to many members of the McCormack lab, past and present, most notably Deb Fisher and Bryan Riggeal, who we re always around to le nd both an ear and a hand. Special thanks also go out to the Cl are-Sazler and Litherland lab members who have shared both their expertis e and their lab space with me. I also wish to thank Kim Blenman, Linda Archer and Dr. Rita Hurst, who have provided me with scientific as well as much needed personal support. I am fore ver indebted to these friends and co-workers who have helped me to accomplish my goals. On a personal note, I would like to thank my entire family for their unwavering encouragement. Specifically, I thank my pa rents, my mother Connie Bradley, my father Tim Bradley, and my stepmother June Br adley, who have fostered dedication and encouraged me to always “do the right thing.” I also thank my father-in-law and motherin-law, Mark and Marcy Casp, who have gi ven me encouragement and support as well as

PAGE 5

v a laptop for which to write this document. I thank my husband who has stood behind me and cheered every step of the way. I tha nk him for his optimism and love, which have kept me going even on my darkest days. Fi nally, I thank my beautiful daughter Ashlyn, who, when I look at her innocent face, re minds me to keep everything in life in perspective.

PAGE 6

vi TABLE OF CONTENTS Page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES.............................................................................................................ix LIST OF FIGURES...........................................................................................................xi ABSTRACT......................................................................................................................x ii CHAPTER 1INTRODUCTION........................................................................................................1 Skin Structure and Physiology......................................................................................1 Vitiligo Pathogenesis....................................................................................................4 Autoimmune Hypothesis.......................................................................................5 Cytotoxic hypothesis.............................................................................................8 Treatment....................................................................................................................10 Genetics of Vitiligo.....................................................................................................12 Vitiligo Candidate Genes............................................................................................15 Immune System Genes........................................................................................15 Low-molecular-weight polypeptid e 2 (LMP2), low-molecular-weight polypeptide 7 (LMP7) and multicatal ytic-endopepidase-complex-like 1 (MECL1).................................................................................................15 Transporter associated with antigen processing 1 and 2 (TAP1 and TAP2)16 CD28 and CTLA4 (CD152).........................................................................17 CD4..............................................................................................................17 IL-12p40.......................................................................................................18 IL-1 .............................................................................................................18 Autoimmune polyendocrinopathy syndro me type-1 (APS-1)/autoimmune regulator (AIRE).....................................................................................19 Melanocyte Biochemistry and Oxidative Stress..................................................19 Catalase (CAT).............................................................................................19 GTP cyclohydrolase 1 (GCH1)....................................................................20 2CASE/CONTROL AND FAMILY-BAS ED ASSOCIATION STUDIES.................21 Introduction.................................................................................................................21 Materials and Methods...............................................................................................22

PAGE 7

vii Subjects................................................................................................................22 Blood Processing.................................................................................................22 DNA Extraction...................................................................................................24 Primers.................................................................................................................24 Microsatellite Markers.........................................................................................25 RFLP and AFLP Markers....................................................................................25 Statistical Analysis..............................................................................................28 Results........................................................................................................................ .30 Immune System Genes........................................................................................30 Melanocyte-specific Genes.................................................................................36 Discussion...................................................................................................................40 3ANTIGEN PROCESSING AND PRESENTATION GENES...................................46 Introduction.................................................................................................................46 Materials and Methods...............................................................................................47 Blood Collection and Processing.........................................................................47 LMP7 Sequencing...............................................................................................48 DNA preparation and PCR amplification....................................................48 Direct sequencing of PCR products.............................................................48 Results........................................................................................................................ .50 Case/Control Association Studies.......................................................................50 Allele and genotype frequencies..................................................................50 Family-based association.............................................................................56 LMP7 Sequencing...............................................................................................58 Discussion...................................................................................................................58 4CATALASE...............................................................................................................66 Introduction.................................................................................................................66 Materials and Methods...............................................................................................67 Blood Collection and Processing.........................................................................67 Catalase Sequencing............................................................................................67 DNA preparation and PCR amplification....................................................67 Direct sequencing of PCR products.............................................................69 Results........................................................................................................................ .70 Catalase Gene Polymorphisms............................................................................70 Association of the T/C Exon 9 ( Bst X I) CAT Marker with Vitiligo...................72 Family-Based Association...................................................................................72 Catalase Sequencing............................................................................................74 Discussion...................................................................................................................74 5CANDIDATE VITILIGO SUSCEPTIBILI TY GENE EXPRESSION STUDIES....79 Introduction.................................................................................................................79 Materials and Methods...............................................................................................80 Monocyte Isolation and Culture..........................................................................80

PAGE 8

viii Semi-Quantitative RT-PCR.................................................................................81 Flow Cytometry of 2-microglobulin.................................................................83 Catalase Enzyme Assay.......................................................................................83 H2O2 Treatment of Monocytes............................................................................84 Results........................................................................................................................ .84 Catalase Assay.....................................................................................................84 2-Microglobulin Expression..............................................................................85 H2O2 Treatment...................................................................................................89 RNA Expression Studies.....................................................................................89 Discussion...................................................................................................................91 6DISCUSSION: OXIDATIVE STRESS AND THE IMMUNE SYSTEM IN VITILIGO PATHOGENESIS..................................................................................101 Oxidative Stress........................................................................................................101 Reactive Oxygen Species and Autoimmunity..........................................................103 Antioxidant Levels in Autoimmune Disease.....................................................103 Transfection of Antioxidant Genes...................................................................105 Antioxidants and Reactive Oxyge n Species in Autoimmunity.........................106 Antigen Processing, Oxidative Stress and Vitiligo...................................................108 Vitiligo and Oxidative Stress.............................................................................108 Vitiligo and Catalase.........................................................................................108 Vitiligo and MHC class II genes.......................................................................110 Future Directions......................................................................................................111 LIST OF REFERENCES.................................................................................................113 BIOGRAPHICAL SKETCH...........................................................................................128

PAGE 9

ix LIST OF TABLES Table page 2-1.Vitiligo patient and unaffected relative samples collected for case/control and family-based analyses..............................................................................................23 2-2.Primer sequences......................................................................................................26 2-3.Microsatellite primer conditions..............................................................................27 2-4.RFLP/SSCP PCR conditions....................................................................................27 2-5.Case/control association analysis fo r CD28 by microsatellite (CAA 3' UTR)........34 2-6.Case/control association analysis fo r CTLA4 by microsatellite (AT 3' UTR)........34 2-7.Case/control association an alysis of CTLA4 by RFLP ( Bst E II +49 A/G)............35 2-8.Case/control association an alysis of CTLA4 by RFLP ( Hae III intron 1 C/T)........35 2-9.Case/control association analys is of APS-1 by SSCP (C/T exon 5)........................37 2-10.Case/control association analysis of APS-1 by RFLP ( Hae III exon 10 T/C).........37 2-11.Case/control association analysis of IL-1 by RFLP ( Ava I –511 C/T)..................38 2-12.Case/control association analysis of CD 4 by Microsatellite ( TTTTC repeat 5' UTR)38 2-13.Case/control association analysis of IL-12p40 by RFLP ( Taq 1 C/A 3' UTR)........39 2-14.Case/control association analysis of GCH1 by RFLP ( Bsa A1 C/T exon 6)...........39 3-1.LMP7 primers for sequencing across the gene........................................................49 3-2.Primers used for LMP/TAP and MECL1 genotyping...............................................51 3-3.Linkage disequilibrium analysis of Cau casian vitiligo patients (age of onset 0-29 years) and control subjects.......................................................................................53 3-4.Allele frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo patients (age of onset 0-29 years) and control subjects............................................54

PAGE 10

x 3-5.Genotype frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo patients and (age of ons et 0-29 years) control subjects...............................55 3-6.Family based association (transmi ssion disequilibrium test) results for LMP/TAP and MECL1 candidate genes and vitiligo susceptibility..........................................57 4-1.Catalase primers for sequencing across the gene.....................................................68 4-2.Sequences of primers used for CAT genotyping.....................................................71 4-3.Distribution of alleles and genotypes for the T/C SNP in CAT exon 9 in vitiligo patient and control populations................................................................................73 4-4.Carriage rates and heterozygosity of the T/C SNP in CAT exon 9 in vitiligo patients compared to controls................................................................................................73 4-5.Catalase gene single nucleotide polymorphisms (SNPs).........................................75 5-1.RT-PCR primer pairs and PCR conditions for LMP2, LMP7, TAP1, TAP2 and catalase.....................................................................................................................82 5-2.Genotypes of patients treated with 500 U IFN, and used in mRNA, catalase and, 2-microglobulin expression studies with corresponding catalase enzyme activity and mean 2-microglobulin fluorescence................................................................90

PAGE 11

xi LIST OF FIGURES Figure page 1-1.Melanin biosynthesis pathway...................................................................................3 2-1.CD28 allele frequency..............................................................................................32 2-2.CTLA4 allele frequency...........................................................................................33 5-1.Monocyte catalase levels in patients and controls...................................................86 5-2.Erythrocyte catalase levels in v itiligo patients and normal controls........................87 5-3. 2-microglobulin expression on pati ent and control monocytes.............................88 5-4.Messenger RNA expression of LMP2, LMP7, TAP1 and TAP2 in patient and control monocytes after overni ght treatment with 1000 U IFN............................92 5-5.Messenger RNA expression of LMP2, LMP7, TAP1 and TAP2 in patient and control monocytes after overni ght treatment with 500 U IFN..............................93 5-6.Catalase/18S RNA ratios with and w ithout overnight trea tment with 500U IFN.94

PAGE 12

xii Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENETIC ASSOCIATION OF CATALASE AND ANTIGEN PROCESSING GENES WITH VITILIGO SUSCEPTIBILITY By Courtney Bradley Casp December 2003 Chair: Wayne T. McCormack Major Department: Pathology, Immunology, and Laboratory Medicine Vitiligo is a common dermatological disorder of the epidermis and hair follicles, manifested clinically as expanding hypopi gmented lesions of the skin. Vitiligo pathogenesis is believed to be due to au toimmune destruction of the melanocyte, or autotoxicity in the melanocyte. Vitiligo often appears in multiple family members, suggesting a genetic component to vitiligo pa thogenesis. The goal of this study was to test the hypothesis that vitili go pathogenesis is caused in pa rt by genetic susceptibility to both autoimmune and autotoxic events in the epidermis due to genetic differences in genes involved in the regulation of th e immune response, melanin production and oxidative stress. Through the use of case/control and fam ily based association studies, two susceptibility genes for vitiligo were id entified. Susceptibility to vitiligo was demonstrated for a gene(s) in or near th e LMP/TAP region of the MHC class II genomic

PAGE 13

xiii region. The LMP/TAP gene products are re sponsible for processing and transport of antigenic peptides for presentation to the immune system via MHC class I molecules. Messenger RNA expression studies of LMP 2, LMP7, TAP1 and TAP2 genes did not show alterations in expression of mRNA for any of these genes in monocytes derived from vitiligo patients and normal controls. However, expression studies of MHC class I revealed decreased expression of MHC cla ss I on monocytes from vitiligo patients, suggesting some alterations in the MCH class I presentation pathway. The second vitiligo susceptibility gene, ca talase, is an important antioxi dant, responsible for breaking down hydrogen peroxide. Messenger RNA expression studies of catalase found no alteration in catalase mRNA expression between patients and controls. Enzyme expression studies of catalase, however, revealed decreased expression of catalase in the monocytes of vitiligo patients, a result not seen in erythrocyt es from these same patients. These results demonstrate a possible role for genes involved in immune system regulation, as well as for genes involved in regulating oxidativ e stress in vitiligo susceptibility. Thus, the etio logy of vitiligo may rely on bo th autotoxic events in the melanocyte, allowing for increased oxidative stress in the epider mis and inappropriate autoimmune presentation of self-p eptides to the immune system.

PAGE 14

1 CHAPTER 1 INTRODUCTION Vitiligo is a common dermatological disorder of the epidermis and hair follicles, affecting both genders and ~1% of the popu lation in all ethnic groups worldwide. (Nordlund and Ortonne, 1998). Vitiligo is defined clinically by expanding areas of hypopigmentation on the skin surface due to the destruction or inactivation of epidermal melanocytes (Badri et al., 1993; Majumder et al., 1993; Tobin et al., 2000). Vitiligo pathology is limited to the depigmentation of th e epidermis, but it is often associated with other autoimmune disorders such as alopecia areata and HashimotoÂ’s thyroiditis (Badri et al., 1993; Kemp et al., 1999). Depigmentati on can occur anywhere on the body including the face. The striking appearance of depigmented areas flanked by normal tissue can cause social stigmatism and physiological distre ss in affected individuals. Treatment for vitiligo is often both expensive and time and labor intensive for the patient, with insurance companies often denying coverage because it is often considered to be purely a cosmetic disorder. This studyÂ’s goal was to determine potential genetic susceptibility of a variety of candidate genes to vitiligo, and further characterize th e expression of these genes in vitiligo patients. Skin Structure and Physiology Human skin is made up of two main layers the epidermis, which is described as a stratified squamous epithelium mainly cons isting of keratinocytes, and the dermis, an underlying layer of vascularized conne ctive tissue (Nordlund and Ortonne, 1998). Melanocytes reside at the junction of the dermis and the epidermis and produce the

PAGE 15

2 protein melanin that provides pigmentation for the skin and hair. The production of melanin begins with the amino acid tyrosine and ends with the production of the redyellow pheomelanin, and the more common brown-black eumelanin. The production of these two pigments occurs through two diffe rent pathways, both of which require the rate-limiting enzyme tyrosinase (Figure 11). Melanin is produced in melanosomes, specialized organelles that are translocated from the center of the melanocyte cytoplasm to the tip of its dendrites. The dendrites ar e then involved in the transfer of the melanosomes to the keratinocytes. Keratinocytes also develop at this dermal epidermal junction, where they are in a constant state of mitosis. As new kerati nocytes are made, the older ones are forced toward the surface of the epith elium carrying their cargo of melanin. On the way to the epidermal surface, melanosomes are degraded in the keratinocyteÂ’s lysosomes, and the melanin becomes finely dispersed. It is t hought that the degree of dispersion of the melanosome helps to dictate skin tone, with darker-skinned individuals seeming to have less degradation of the melanosomes. Dark er-skinned individuals also produce more melanin, as well as melanin of a darker colo r than fair-skinned individuals. When the keratinocytes reach the epithelial surface th ey compact and form a protective layer of keratin before they are shed off (Nordl und and Ortonne, 1998). This keratin layer protects the skin from injury, and the mela nin cargo it carries help s to protect the skin from the damage of ultraviolet rays. Mela nin production is stimulated with excessive exposure to ultraviolet rays, which is commonly known as tanning. The hypopigmented lesions in vitiligo patients are a result of the destruction and/or inactivation of the melanin-producing melanoc ytes. Keratinocytes still make their

PAGE 16

3 Figure 1-1. Melanin biosynthesis pathway

PAGE 17

4 migration to the surface of the epithelium, al beit without their cargo of pigment. This results in patches of skin that look mil ky-white because they are devoid of pigment. There are two main types of vitiligo, segm ental and non-segmental, and classification relies on the distribution of hypopigmented le sions. In segmental vitiligo the areas of depigmentation are random and often occur on just one location on the body. Segmental vitiligo is also sometimes marked with the loss of melanocytes from the hair follicles and a loss of hair pigment. Segmental vitiligo is less likely to repigment than non-segmental vitiligo; however it is also le ss likely to spread to other ar eas of the body. Non-segmental vitiligo usually manifests in a strikingly symm etrical pattern and ofte n does not affect the hair follicles in the areas of depigmen tation. Non-segmental vitiligo often gets progressively worse, spreading to more areas of the body over time. Some patients with non-segmental vitiligo almost completely depigment over the years. With non-segmental vitiligo there is sometimes spontaneous re pigmentation, or partial repigmentation with treatment; however, the patient rarely fu lly returns to pre-disease pigmentation. Segmental and non-segmental vitiligo present very differently clinically and may have different etiologies (Bos, 1997; Nordlund and Ortonne, 1998). Vitiligo Pathogenesis The average age of onset in vitiligo is 20-23 years of age (Nordlund and Ortonne, 1998). Because patients are not usually born with the disease, it is thought that an initiating event, such as illness, st ress, UV exposure or injury, may trigger depigmentation. It has been shown that th e numbers of melanocytes in depigmented lesions are vastly reduced or absent; however, the mech anisms of this apparent destruction have been widely debated. The tw o theories with the most evidence are that 1) the destruction of the melanocyte is due to the buildup of toxic by-products in the

PAGE 18

5 melanin biosynthesis pathway, and 2) the dest ruction is autoimmune in origin. These theories are not mutually exclusive, and in fact, the actual onset of disease might involve a combination of autotoxic as well as autoimmune events. Autoimmune Hypothesis The autoimmune theory of v itiligo etiology is the most popular as well as the most substantiated. First serum anti-melanocytic antibodies are found in many, but not all, vitiligo patients, and are not found in healthy pigmente d individuals. These antibodies are directed against tyrosinase, tyrosinase -related protein 1 (TRP1), tyrosinase-related protein 2 (TRP2), and melanin-concentrati ng hormone receptor 1 (MCHR1) (Cui et al., 1993; Song et al., 1994; Kemp et al., 1999; Kemp et al., 2002). However, in vitro work with these autoantibodies ha s suggested that the presen ce of the anti-melanocytic autoantibodies may just be a marker of activ e vitiligo and may have little or no active role in initiating or maintain ing the disease (Bos, 1997). The first evidence of cell-me diated immunity playing a role in the pathogenesis of vitiligo came from the observation of invadi ng lymphocytes in studies of “inflammatory vitiligo,” a disease ch aracterized by a raised red rim surrounding the depigmented lesion (van den Wijngaard et al., 2001). Lesional skin of non-inflammatory vitiligo patients has more recently been shown to contai n significantly higher levels of CD3+, CD4+, and CD8+ T cells than found in control skin and in skin outside lesions in the same patients (Badri et al., 1993; Le Poole et al., 1996). Melanocytes also have been found in rare circumstances to both take up antigen through phagocytosis, as well as to present antigen via MHC class II molecules (Le Poole et al ., 1993a, 1993b). It has been shown that 2/3 of perilesional melanocytes in vitiligious skin express antigen on MHC class II (al Badri et al., 1993).

PAGE 19

6 Most immunohistochemical studies suggest that melanocytes are almost completely destroyed, as opposed to being inactive or dormant, and this loss is accompanied by dermal and epidermal infiltrates in the acti ve lesion, which includ e an increase in CD4+and CD8+ T cells (Hann et al., 1992; Le Poole et al., 1993a; Badri et al., 1993; Le Poole et al., 1996). More recent work suggests th at not all melanocytes are destroyed in the lesion; however, those remaining have been rendered dysfunctional (Tobin et al., 2000). Further evidence of an abnormal immune response is a reversal of the CD4+/CD8+ ratios as well as a decrease in CD45RA cells in vitiligo patient periphe ral blood (Mozzanica et al., 1990; Abdel-Naser et al., 1992). Disruptions in Langerhans cells in vitiligo have also been reported, with decreased numbers seen in active vitiligo with a return of normal numbers in stable vitiligo (Kao and Yu, 1990). It is important to no te that variation in published data on peripheral cell imbalances ma y be due to a variety of factors such as differences in study populations, differences in vitiligo diseas e presentation and/or progression, and prior immune-suppressi ve therapy (Ongenae et al., 2003). A subclass of lymphocytes contains an inducible carbohydrate moiety known as cutaneous lymphocyte antigen (CLA) on thei r surface (Fuhlbrigge et al., 1997). This carbohydrate moiety targets these lymphocytes to the dermis by an interaction with its ligands E and P selectins and through the dispersion of a chemokine known as CTACK (Picker et al., 1993; Robert and Kupper, 1999; Campbell et al., 1999; Morales et al., 1999). Both E and P selectins, as well as CTACK, are upregulated upon local skin inflammation, injury and UV exposure. In certain skin disorders, such as atopic dermatitis and psoriasis, an increased percentage of CLA+ lymphocytes is observed in peripheral blood and skin as compared to controls. Our own studies have shown

PAGE 20

7 encouraging, but not definitive si gns that this increase in CLA+ T cells (especially CD4+) is seen in vitiligo patient sÂ’ peripheral blood (unpublis hed data). Cytotoxic T lymphocytes that are specific for Mel-A, a melanocyte surface marker, and have a CLA carbohydrate moiety have been shown to be at fa r higher levels in vi tiligo patients than in controls. While Mel-A+ CTLs were also found in contro l subjects, these cells were not CLA+. This absence of CLA prevents these fr om migrating to the skin to attack the melanocytes, thus preventing the i nduction of vitiligo (Ogg et al., 1998). Further evidence of immune events medi ating vitiligo is s een in the altered expression of several cytokines in patients The expression of ICAM-1 in vitiligo patients has been shown to be six-fold highe r than in controls (al Badri et al., 1993). Soluble IL-2 receptor levels are expressed at high concentrations in vitiligo patients. (Honda et al., 1997; Yeo et al., 1999; Caixia et al., 1999, Tu et al., 1999). Peripheral blood of patients also has increased concentr ations of pro-inflammatory cytokines IL-6 and IL-8 as well as a decreased production of GM-CSF, TNF, and INF(Yu et al., 1997). The association of vitiligo with othe r known autoimmune disorders such as AddisonÂ’s disease, HashimotoÂ’s thyroiditis, pernicious anemia and alopecia areata also supports the autoimmune theory of disease. In addition, it has been observed that successful treatment for melanoma sometimes results in spontaneous vitiligo, suggesting that a successful anti-melanoma immune response might attack normal healthy melanocytes, due to the sharing of many of the same surface antigens (Overwijk et al., 1999; Bronte et al., 2000). These findings sugge st that a T cell mediated attack on the

PAGE 21

8 melanocyte can produce areas of sustained depi gmentation, a scenario that has also been suggested in the etiology of vitiligo. The most useful animal model of vitili go pathogenesis is the Smyth-line chicken. The Smyth-line chicken expresses many of the major features of human vitiligo including cutaneous depigmentation that is variable in appearance and most often occurs during adolescence. These chickens also suffer w ith alopecia and autoimmune thyroiditis and blindness. Pathogenesis in these animals also supports an autoimmune etiology as lymphocytic infiltration is seen in th e depigmented areas, melanocyte specific autoantibodies are present, and steroid treatment can halt and sometimes improve pigmentation (Lamoreaux and Boissy, 2000). Cytotoxic hypothesis The cytotoxic hypothesis is based on the pr emise that the loss of melanocytes in vitiligo patients is a direct re sult of an inherent defect in the melanocyte, most probably resulting in the buildup of toxic intermediates or metabolites from the melanin biosynthesis pathway. There has been increa sing evidence for a role for oxidative stress in the involvement of vitiligo pathogenesis, based primarily on reported defects in several key enzymes in the melanin biosynthesis pa thway. Vitiligo patients show an increased epidermal de novo synthesis and recycling of 6(R )-L-erythro-5,6,7,8-tet rahydrobiopterin (6BH4). It is the accumulation of these oxidized pterins (6and 7-biopterin) that results in the fluorescence of vitiligo skin under a Woods UV lamp, which is used for the definitive diagnosis of vitiligo in a patient (Schallreuter et al., 2001). Vitiligo patients also show very lo w levels of 4a-OH-tetrahydrobiopterin dehydratase (DH) activity wh ich is involved in the recycling pathway of 6BH4. Due to decreased DH activity, there is an increase d buildup of the 7-isomer form of 6BH4,

PAGE 22

9 (7BH4), which functions as an effective competitor of 6BH4. A buildup of 7BH4 will affect phenylalanine hydroxylas e (PAH) activity. PAH activity is often decreased in vitiligo patients, which cau ses a buildup of epidermal L-phenylalanine levels. All of these abnormal biochemical events in the vitiligo epidermis may contribute to increased levels of hydrogen peroxide (H2O2). High concentrations of H2O2 can deactivate catalase, an enzyme nor mally involved in breaking down H2O2 and other free oxygen radicals. Low catalase activities have pr eviously been reported in the epidermis of vitiligo patients, whether this defect is due to an increase in H2O2 from the defective 6BH4 pathway or due to a separate problem in the catalase en zyme is unknown. What has been shown is that treatment with pseudocatalase, a bis-manganese III-EDTA(HCO3)2 synthetic catalase substitute, has prom oted repigmentation in vitiligo patients, along with restoring DH enzyme activ ity and a return to normal 7BH4 levels in the epidermis (Schallreuter et al., 2001). Abnormal antioxidant activity in peri pheral blood mononuclear cells (PBMCs) of vitiligo patients has also been observed, w ith increased superoxi de dismutase activity, and reduced catalase, glutathione and vitamin E levels. This variability in antioxidant levels was seen exclusively in subjects with active disease. These changes in antioxidants could be responsible for th e generation of intr acellular re active oxygen species (ROS) in vitiligo patients, and may be due in part to an observed mitochondrial impairment (DellÂ’Anna et al., 2001). Vitiligo melanocytes are also found to have an abnormal dilation of the rough endoplasmic reticulum (RER), seen on tran smission electron microscope examination (Boissy et al., 1991; Im et al., 1994). Furthe r observation of this phenomenon is seen in

PAGE 23

10 PIG3V cells, an immortalized vitiligo cell line. In the PIG3V cells, this abnormal dilation is thought to be caused by a retenti on of a variety of proteins in the RER (Le Poole et al., 2000). Treatment There is no known “cure” for vitiligo, a nd current treatment methods function mainly by stopping current progression of the disease and aiding in the repigmentation of hypopigmented lesions. Current treatments do not prevent the reappearance of future depigmented lesions. Treatment options are often expensive and labor-intensive on the part of the patient, and are most often not covered by patients’ insu rance, as vitiligo is considered a mainly a cosmetic disorder. Up until the late 1990’s, the options for treatment of vitiligo were limited mainly to psoralens with UVA radiation (PUVA) therapy and the use of topical corticosteroids on the skin. Current treatment options have expanded recently and now include a variety of choices such as epidermal melanocyte autografts, topical treatment with pseudoc atalase, and narrow-band UVB irradiation (Njoo and Westerhof, 2001) PUVA is considered by many to be the “standard” treatment for vitiligo. Psoralens are compounds found in many plants used to tr eat a variety of dermatological disorders, such as psoriasis, dermatitis, and vitiligo. Psoralens, in conjunction with sun exposure, have been used to treat skin disorders for cen turies, and can be traced back to the ancient Egyptians (McClelland et al., 1997). Upon exposure to UVA radiation, psoralens can bind directly to macromolecules such as pr oteins, lipids, and DNA (Taylor and Gasparro, 1992). Once excited by UVA radiation, psoralens can interact with pyrimidines in DNA through covalent bonding, forming intercha in crosslinks (Song and Tapley, 1979). The relative frequency of the DNA crosslinking depends on the wavelength of UVA exposure

PAGE 24

11 (Taylor and Gasparro, 1992). It is still un clear how this biochemical interaction of psoralen with DNA functions to alleviate symp toms in the dermatological disorders it is used to treat. One theory is that th e DNA adducts formed function to hamper DNA synthesis and cell replicati on, processes which may be upr egulated in hypoproliferative disorders such as psoriasis (McNeely and Goa, 1998). PUVA-induced repigmentation in vitiligo pa tients is thought to be due to the recognition of the DNA adducts as damage, which might trigger activation of genes involved in pigmentation or melanocyte bi ochemistry, since DNA repair is closely associated with transcription. A second theo ry hypothesizes that PUVA treatment creates reactive oxygen species that then stimulate melanogenesis by activating melanocyte migration from the hair follicle to the epidermis (McNeely and Goa, 1998). PUVA therapy often requires 100-300 exposur es, and treatment does not guarantee repigmentation. One study showed 56% of vitiligo patients achieved 75% repigmentation, with a lack of response occu rring in 22% of pati ents (Morrison, 2000; McNeely and Goa, 1998). The most promising new treatment for vitiligo is the topical application of UVBactivated pseudocatalase, a bis-manganese EDTA bicarbonate complex. Pseudocatalase functions to mimic the human enzyme catalase, which removes H2O2 and other free radicals from the epidermis. It has been shown that vitiligo patients have decreased catalase expression, along with a subs equent increased expression of H2O2 concentrations in their epidermis. Treatment of vitiligo patients with topical applications of the pseudocatalase cream, along with frequent e xposure to UVB radiation, given at a much lower exposure than normal th erapeutic doses, has allowed fo r the halt of depigmentation

PAGE 25

12 in 95% of patients, and repigmentation of 60-65% of individuals. Treatment with pseudocatalase also restores epidermal DH activities and decreases the accumulation of 7BH4 (Schallreuter et al., 1999a, 1999b, 2002). Genetics of Vitiligo About 20% of vitiligo patients have at least one first-de gree relative al so affected, and the relative risk of vitiligo for first-degree relatives of vitiligo patients is increased by at least 7to 10-fold (Bhati a et al., 1992; Nath et al., 1994) Vitiligo susceptibility does not follow a simple Mendelian inheritance patt ern, and much of the available data suggest that vitiligo is a complex hereditary disease influenced by a set of recessive alleles occurring at several unlinked autosomal lo ci that collectively confer the vitiligo phenotype (Majumder et al., 1993; Nath et al., 1994; Alkhateeb et al., 2002). This type of inheritance is common among other autoimm une diseases. For example, in type 1 diabetes, the risk of an indi vidual developing diabetes with a first degree relative affected is only between 1-9% (Redondo et al., 2001), where it is likely that a combination of genetics and environmental factors result in disease pathogenesis. Vitiligo may therefore be considered a polygenic disease, with alleles at multiple loci possibly contributing to increased susceptibility to and/or direct pat hogenesis of vitiligo. HLA associations have been reported between specific alleles of complement, class I and class II MHC genes with vitiligo in various et hnic and racial subpopulations, but no common HLA association has been observed. Studies have reported HLA associations in early onset vs. late onset vitiligo cases, and it is possible that there ar e different etiologies, and different genetic factors in early vs. late onset vitiligo, as well as in segm ental vs. non-segmental vitiligo (Finco et al., 1991; Orecchia et al., 1992; Arcos-Burgos et al., 2002). Further complicating matters, it is probable that gene tics alone do not dictate disease onset, as

PAGE 26

13 most vitiligo patients are not born with this di sorder, but develop it later in life. As with other autoimmune diseases, environmental fact ors such as toxins, pollutants, viruses, UV exposure, and stress could play a major role in the onset of vitili go in those that are genetically predisposed. In order to determine potential genes invol ved in an inheritable disorder there are several techniques that can be employed. F unctional cloning relies on first identifying the abnormal protein involved in the diseas e process, and then using its sequence to determine the cDNA sequence, and finally the gene involved in the disease. A large limitation to functional cloning is that the prot ein(s) involved in the disease process is (are) not often known. In contrast, positiona l cloning allows for determination of the geneÂ’s location without pr ior knowledge of the protei n involved in the disease pathogenesis. The two main positional cloning techniques employed in disease gene screening in recent years are linkage ma pping and the candidate gene approach. Linkage mapping scans the entire genomes of family members and individuals afflicted with the disorder of interest, using regularly spaced genetic markers in the DNA whose positions have already been determined. Regions where affected individuals shared alleles more frequently than expect ed by chance alone are then identified, and nearby genes are subjected to fu rther analysis. This type of screening is extremely labor intensive and requires large families with both affected and non-affected members. However, it does allow for the unbiased screen ing of diseases where investigators have no prior knowledge of the pathobiology of the disorder. The candidate gene approach allows for re searchers to investigate susceptibility of a gene to a disorder by focusing on a limited num ber of genes selected for their potential

PAGE 27

14 involvement in the biology or pathophysiology of the disorder. Candidate gene studies do not rely on large multi-generation families, but can be performed using unrelated groups of patients (cases) and controls, or through small families. Candidate gene studies also have the advantage of being better suited for determining susceptibility genes in more complex disorders where the relative risk associated with any one gene is relatively small (Kwon and Goate, 2000). Once a candidate gene is chosen based on its potential involvement of the disease of interest, a polymorphism that will allow fo r suitable genotyping must be identified. It is important to note that these polymorphi sms within the gene might cause a mutation that results in a functional change in the protein or more likely, may have no functional relevance to protein function or stability at all. In candidate gene analyses, polymorphisms function solely as genetic ma rkers within the gene. If a polymorphism within a gene is inherited at a rate that exceeds the leve ls determined by random chance, this gene can then be called a potential susceptibility gene. In this case, the polymorphism genotyped can either be the actual mutation conferring the susceptibility or it could merely be linked to the mutation of interest due to its close physical proximity. There are a variety of polymorphic markers within the genome that are useful for genotyping. Single nucleotide polymorphisms, or SNPs, are heritable individual single nucleic acid changes in the genomic sequence. Sometimes SNPs allow for the creation or deletion of a sequence that is recognizable by a particular restriction endonuclease. This type of polymorphism is known as a restri ction fragment length polymorphism, or RFLP, and can be genotyped using the two vari able sized fragments produced through the endonuclease activities of th e restriction enzyme. Amplified fragment length

PAGE 28

15 polymorphisms, or AFLPs, are variants of RFLPs. AFLPs are created through designing polymerase chain reaction (PCR) primers th at change one nucleotide forcing the amplification of a sequence that creates a re striction site involvi ng a known SNP. Repeat regions in genomic DNA are also very us eful in genotyping. The human genome contains a large number of these normal inhe ritable variances in small sequence repeats. These repeat regions can be a long sequence repeated many times (14 to 100 base pairs), known as a variable number of tandem repeats (VNTR), or minisatellites, or a region of multiple repeats of just a few nucleotides (2 -5 base pairs), called short tandem repeats (STR) or microsatellite s (Griffiths et al., 1999). Vitiligo Candidate Genes Determining genes that confer genetic susc eptibility to vitili go using the candidate gene approach requires pre-knowledge a bout the disease process and pathogenesis. Because it has been hypothesized that vitili go pathogenesis could be a direct result of autoimmunity and/or autotoxicity due to bi ochemical defects in the melanocytes, genes that regulate the immune system, melanoc yte biochemistry and development and oxidative stress are suitable choices for candidate genes. Immune System Genes Low-molecular-weight polypeptide 2 (LMP2), low-molecular-weight polypeptide 7 (LMP7) and multicatalytic-endope pidase-complex-like 1 (MECL1) The proteasome is a large protease com posed of several subunits, which plays a crucial role in protein degradation in th e cell. Three subunits crucial for protein proteolysis known as X, Y, and Z are constitu tively expressed, but can be replaced by the three IFNinducible subunits low –molecula r-weight polypeptid e 2 (LMP2), low– molecular-weight polypeptide 7 (LMP7) a nd multicatalytic-endopepidase-complex like 1

PAGE 29

16 (MECL1). The induction of these three s ubunits allows for the creation of the “immunoproteasome.” Whereas these induced subunits are very similar in sequence to the constitutive subunits, functionally they cleav e proteins into different peptides. The IFNinducible subunits generate peptides th at are more compatible with the binding groove of the MHC class I molecule (Driscol l et al., 1993; Tanaka et al., 1998; Pamer et al., 1998). The immunoproteasome genes were selected as candidate genes because several autoimmune diseases have been shown to ha ve significant association to genes in this region. LMP2 and LMP7 also make good candida te genes since they are located within the MHC class II region of the genome, a regi on that historically has been linked with susceptibility to many other autoimmune diseases (Wong and Wen, 2003). Transporter associated with antigen processing 1 and 2 (TAP1 and TAP2) Along with the immunoproteasome genes, TAP1 and TAP2 are involved in the MHC class I antigen-processing and presenta tion pathway. To reach the MHC class I molecule for binding, the proteasome-cleaved peptide must cross into the endoplasmic reticulum from the cytoplasm. The TAP complex allows for this transfer of peptides into the ER. TAP is an IFNinducible heterodimer made up of two subunits, TAP1 and TAP2, which both must be present for pe ptide binding and translocation. The TAP complex preferentially binds peptides of certain lengths and of certain amino acid composition, favoring acidic, aromatic, hydrophobi c and charged residues (Harding et al., 1997). These TAP/MHC class I-preferred peptides are produced at a hi gher rate with the IFNinduction of LMP2, LMP7, and MECL1 (H arding et al., 1997; Rechsteiner et al., 2000).

PAGE 30

17 TAP1 and TAP2 were also chosen as candidate genes due to their reported associations with other autoimmune diseases such as, celiac disease (Djilali-Saiah et al., 1994), SjogrenÂ’s syndrome (Kumagai et al ., 1997), and multiple sclerosis (MoinsTeisserenc et al., 1995), as well as due to their location within the MHC class II genomic region. CD28 and CTLA4 (CD152) In order for a naive T cell to become ac tivated, two separate signals are required. The first signal is the interaction of the T cell receptor on the surface of the T cell with the peptide/MHC complex located on the su rface of an antigen presenting cell (APC). Secondly, CD28, a surface molecule on the T cell, must come into contact with its ligand, CD80/CD86, on the surface of an APC. A T ce ll receiving stimulation with both signals will be driven to activati on and proliferation. Once ac tivated, CTLA4 functions to regulate this process by shutting down T cell act ivation and proliferation. CTLA4 is also found on the surface of T cells, and is upregul ated after activation. CTLA4 out-competes CD28 for the binding of its ligand, CD80/86 as CTLA4 binds CD80/86 with an affinity about 100 x greater than CD28. CTLA4 binding to the ligand delivers a negative signal to the T cell, limiting its ac tivation and prolifer ative response. CTLA4 polymorphisms have been linked to various autoimmune di seases such as insulin-dependant diabetes mellitus (IDDM), HashimotoÂ’s thyroiditis, multiple sclerosis, and celiac disease (Einarsdottir et al., 2003; Udea et al., 2003; Kantarci et al., 2003). CD4 CD4 is a single chain molecule compos ed of four immunoglobulin-like domains, whose cytoplasmic domain interacts with a tyrosine kinase known as Lyk, allowing for CD4 to participate in signal transduction. CD4 functions as a co-receptor on T cells,

PAGE 31

18 interacting with the peptide:MHC class II complex on APCs and acting synergistically with the T cell receptor (TCR) in signaling and activation of the T cell. CD4 was chosen as a candidate gene because improper bind ing of CD4 to the peptide:MHC complex or the TCR or improper signaling through the CD 4 receptor might allow for inappropriate activation of T cells. Studie s have also shown epidermis-infiltrating T cells exhibit an increased CD8/CD4 ratio within perilesional sk in in vitiligo patients (Le Poole et al., 1996). IL-12p40 IL-12 is a very important cytokine that is important in the induction of the Th1 subset that produces inflammatory cytokines. The potent pro-inflammatory activity of IL-12 requires tight control, which is exerted at various levels. Primary control is exerted on IL-12 production by APCs, a major factor driving the response towards the Th1 or Th2 phenotype. A disturbed Th1/Th2 balance, and/or aberrant control of Th1 cytokines, such as IL-12, has been hypothesized as pl aying a role in induc tion of T cell mediated autoimmunity. IL-12p40 has also been shown to be associated with type 1 diabetes (Davoodi-Semiromi et al., 2002). IL-1 IL-1 is a proinflammatory cytokine secr eted mainly by macrophages. IL-1 from activated macrophages stimulates cytokine and cytokine receptor production by T-cells as well as stimulating B-cell prolifer ation. Two forms of IL-1, IL1and IL-1 have the same activities but different structures. IL-1 is primarily membrane-associated whereas IL-1 is secreted. Excess IL-1 may induce inflammatory and autoimmune diseases in such organs as the joints, lungs, gastrointe stinal track, central nervous system, and blood

PAGE 32

19 vessels. Treatment with IL-1 receptor anta gonist has been used in animal models of rheumatoid arthritis (Schwab et al., 1991), In flammatory bowel disease (Cominelli et al., 1992), and allergic asthma (Selig et al., 1992), with much success. IL-1 may be a mediator of damage to the pancreatic isle ts in insulin-dependent diabetes mellitus (IDDM), and IL-1Ra has been shown to bl ock the IL-1-induced decrease in insulin secretion by pancreatic beta cells in vitr o (Sandler et al., 1991; Eizirik et al., 1991). Because IL-1 has been linked to these autoimmune diseases, and due to its potent proinflammatory nature, it makes a good candidate gene for vitiligo. Autoimmune polyendocrinopathy syndrome type-1 (APS-1)/autoimmune regulator (AIRE) The AIRE gene is responsible for au toimmune polyendocrinopathy-candidiasisectodermal dystrophy syndrome (APECED). The most common features of APECED are parathyroid gland failure, chronic susceptibility to candida yeast infection, and Addison's disease. Other manifestations, a nd when the symptoms emerge, are variable. Other autoimmune diseases associated w ith APECED may include alopecia, vitiligo, ovarian failure, testicular atrophy, hypothyroidism, gastric pa rietal cell atrophy, hepatitis, intestinal malabsorption, and insulin-dependent diabetes mellitus. Because vitiligo is one of the autoimmune diseases associated with APECED, it was chosen as a candidate gene. Melanocyte Biochemistry and Oxidative Stress Catalase (CAT) Catalase is a homotetrameric, heme-containing, peroxisomal enzyme that catalyzes the conversion of hydrogen peroxide (H2O2) to water and oxygen. Catalase plays an important role in the preven tion of cell damage from hi ghly reactive oxygen-derived free radicals. Catalase was chosen as a candidate gene because of reports of low epidermal

PAGE 33

20 catalase activity in both lesional and non-lesiona l skin of vitiligo patients. This decrease of catalase expression is not ob served in patient erythrocytes and is also observed with a concomitant increase in epidermal H2O2 (Schallreuter et al., 1991,1999a 1999b). GTP cyclohydrolase 1 (GCH1) GCH1 is the first and rate-limiting step in the synthesis of 6-tetrahydrobiopterin, which serves as a cofactor for the hydroxylat ion of the amino acid L-phenylalanine to Ltyrosine. L-tyrosine is needed as a substr ate for tyrosinase to initiate melanogenesis in the melanocyte.

PAGE 34

21 CHAPTER 2 CASE/CONTROL AND FAMILY-BASED ASSOCIATION STUDIES Introduction The importance of genetic factors in viti ligo susceptibility has been suggested by reports of significant familial aggregation (Bha tia et al., 1992; Nath et al., 1994). Vitiligo susceptibility does not follow a simple Mendeli an inheritance pattern, and is considered a complex hereditary disease influenced by a se t of recessive alleles occurring at several unlinked autosomal loci. Therefore vitili go is considered a polygenic disease, with alleles at multiple loci possibly contributing to increased susceptibility to and/or direct pathogenesis of vitiligo. As previously described, two principal hypotheses concerning the etiology of vitiligo incl ude (1) the self-destruct model, which suggests that biochemical and/or structural defects inherent to patient me lanocytes contribute to the initiation and/or progression of melanocyte cytolysis, and (2) the autoimmune model, which suggests that melanocyte death occu rs through inappropriate immune system destruction of pigment cells. To evaluate genetic factors that may play a role in vitiligo pathogenesis, a candidate gene approach was designed. Ge nes involved in both immune system regulation and melanocyte regulation and biochemistry were chosen based on their potential involvem ent in vitiligo etiology. Case/con trol and family-based analyses were performed on genotypic data garnered from vitiligo patients, their family members, and non-affected controls.

PAGE 35

22 Materials and Methods Subjects An internet website was set up at both the University of Florid a and at the National Vitiligo Foundation. Interested patients cont acted the research group via email to request further information, or to participate in the research study. Kits were mailed out to interested patients and family members containing three 10 mL EDTA blood collection tubes, IRB consent forms (project numbers 130-1998 and 416-1998), personal information surveys requesting information su ch as race, age of onset, family history and/or personal presence of ot her autoimmune diseases, and pattern of depigmentation. Patients and family members were collected and genotyped regardless of race and/or ethnicity, however, due to insufficient numbers of subjects in other racial groups the case/control and family-based analyses were performed on Caucasian subjects only (Table 2-1). Patients requested a blood dr aw from their local family physician and returned the blood kits via priority mail. Blood Processing Whole blood was centrifuged at 3000 rpm (2000 x g) for ten minutes in vacutainer tubes in a clinical cen trifuge. The buffy coat, the laye r between the red blood cells and plasma layer that contains white blood cells, was removed and transferred with a sterile transfer pipette into a 50 mL conical tube. Red blood cells were then lysed to isolate white blood cells with 6-8 volumes of red blood cell lysis solution (RBC) (139 mM ammonium chloride, 17 mM Tris-HCl, pH 7.65), followed by a ten-minute incubation at 37 C. Samples were then centrifuged at 2000 rpm (900 x g) for seven minutes, the supernatant discarded and the pellet washed with PBS (38 mM KCl; 21 mM KH2PO4; 1.96 M NaCl; 137 mM Na2HPO4). The pellet was then resuspended in 5 mL of high TE

PAGE 36

23 Table 2-1. Vitiligo patient and unaffected re lative samples collected for case/control and family-based analyses. Vitiligo PatientsUnaffected Relatives GenderRaceGenderRace Female255Caucasian315Female223Caucasian323 Male152Hispanic34Male183Hispanic32 African American11 African American8 Indian (Asian)12Indian (Asian)11 Other Asian9Other Asian6 Mixed16Mixed14 Total407Not Reported10Total406Not Reported12

PAGE 37

24 (100 mM Tris-HCl, pH 8.0; 40 mM EDTA, pH 8.0) and 5 mL of DNA lysis solution (100 mM Tris-HCl, pH 8.0; 40 mM EDTA, pH 8.0; 400 mL dH2O; 0.22% SDS). DNA Extraction Lysed genomic DNA samples were mixed with 10 mL TE-saturated phenol at pH 6.6 (Fisher Scientific) and cen trifuged at 2000 rpm (900 x g) for 5 minutes. The aqueous layer which contains the DNA was transferre d via sterile transfer pipette to a 50 mL conical tube, to which 5 mL phenol (Amersham) and 5 mL chloroform (Fisher Scientific) were added. The samples were then mixe d gently, and centrifuged at 2000 rpm (900 x g) for 5 minutes, and the aqueous layer was once again removed and transferred to a clean 50 mL conical tube. A final extraction wa s conducted using 5 mL chloroform. The DNA was precipitated with the addition of th e volume of 7.5 M ammonium acetate and an equal volume of isopropanol. The precipit ated DNA was rinsed with 70-100% ethanol, using a Pasture pipette hook, and transfer red into a 1.5 mL tube containing 400 L TE and placed on a rotator for one to two days. The DNA was quantitated using a spectrophotometer at 260 nm, diluted to 20 ng/ L, and aliquoted 2 L/well into a 96-well PCR plate (DOT scientific). Control samp les were prepared from Caucasian subjects with no history of autoimmunity, and were generously provided by Dr. Jin Xiong She (formerly at the University of Florida, now at Medical College of Georgia, Center for Biotechnology and Genomic Medicine). Primers PCR primer sequences were designed us ing OLIGO software, or were obtained from the literature (Table 2-2). Primers (G ibco-Life Technologies) were reconstituted with 100 L of 10 mM Tris-HCl and diluted to a working concentration of 20 pmol/L

PAGE 38

25 with 10 mM Tris-HCl. PCR conditions for each primer pair were determined empirically, and candidate genes were genot yped using RFLP, AFLP and microsatellite markers. Microsatellite Markers Forward PCR primers were labeled with 10 Ci -32P-ATP (6000 Ci/mol) with 1 L T4 polynucleotide kinase (New Engla nd Biolabs), 3L 10X kinase buffer (New England Biolabs), 5 L ddH2O, with a one hour incubation at 37 C and ten minutes at 65 C. Each genomic DNA sample was amp lified using 10 L of a PCR master mix containing 710 L ddH2O, 120 L of 10X dNTP, 12 L unlabeled forward primer, 10 L labeled forward primer, 12 L reverse primer, and 7.2 L Taq polymerase to each well of the 96-well PCR plate. After thirty PCR cy cles, 20 L of stop buffer (92% formamide; 2 M EDTA, 0.03% xylene cyanol, 0.03% bromophenol blue) was added to each of the 96 wells. Samples were then heat denatured at 97 C for 15 minutes and separated by electrophoresis on a denaturing 6% acrylamid e gel, using 0.5% TBE buffer. The gels were vacuum dried, and exposed to Fuji X-ray film for 2-4 days at -80 C. PCR conditions, product size and number of alleles for each marker can be found in Table 2-3. RFLP and AFLP Markers PCR amplification of RFLP and AFLP ma rkers was completed using 10 L of a master mix containing 710 L ddH2O, 120 L of 10X dNTP (2 L each dNTP, 92 L 10 mM Tris-HCl, pH 7.5), 12 L forward prim er, 12 L reverse primer, and 7.2 L Taq polymerase to each well of the 96-well PCR plate. Cycle lengths were determined empirically. Following amplification, samples were then digested overnight with the

PAGE 39

26Table 2-2. Primer sequences GeneForward primer SequenceReverse Primer SequenceReference CD28CD28-10GAG AAT CGC TTG AAC CTG GCCD28-15TAG ACA AAT AAT CCT TCA CAG TAMarron et al., 2000 CTLA4CTLA4-1GCC AGT GAT GCT AAA GGT TGCTLA4-2A CA CAA AAA CAT ACG TGG CTCMarron et al., 1997 CTLA4CTLA4-4CTG CTG AAA CAA ATG AAA CCCCTLA4-5AAG GCT CAG CTG AAC CTG GTMarron et al., 1997 CTLA4CTLA4-22CCCTGGCATTGTTGT AGAGTGCTLA4-24CACTATTTTTGAGT TGATGCAGMarron et al., 2000 IL-12p40IL-12-1ATTTGGAGGAAAAGTGGAAGAIL-12-2AATTTCATGTCCTTAGCCATADavoodi-Semiromi et al., 2002IL-1 IL-1 -1 CAT CTG GCA TTG ATC TGG TT IL-1 -2 TTT AGG AAT CTT CCC ACT TACdi Giovine et al., 1992 APS-1APS-1-1TATGTGCTT GGGAACAGTCTTAPS-1-2AT CAGCCCCATCTCCCCGGenbank rs878081 APS-1APS-1-3GCGGGAGAGGAGGTAAGAGAPS-1-4AGGACCCACACACAGTAGGGenbank rs1800521 GCH1GCH1-1GGG TTG AGC CCT CTA CTT TCGCH1-2TCG GCA CTA CAC CAC TTT TAT TGenbank rs841 SNP ID reference numbers are from the National Center for Biotechnology Information Single Nucleotide Polymorphism database (http://www.ncbi.nlm.nih.gov/SNP).

PAGE 40

27 Table 2-3. Microsatell ite primer conditions. GenePrimer Pair MarkerSizeAnneal C Marker Type Number of alleles CD2810/15CAA 3' UTR16658tri repeat7 CTLA41/2AT 3' UTR11058di repeat33+ CD41/2TTTTC 5' UTR17058Penta-repeat6 Table 2-4. RFLP/SSCP PCR conditions. GenePrimer Pair MarkerSize Anneal C Marker type RFLP enzyme CTLA44/5 Bst E II +49 A/G15258RFLP Bst E II CTLA422/24 Hae III C/T intron 1 25758RFLP Hae III IL12p40 1/2 Taq I C/A 3' UTR 104658RFLP Taq I IL-1 1/2 Ava I C/T promoter -511 30858RFLP Ava I APS-11/2C/T 715 exon 520360SSCP APS-13/4 Hae III 1324 exon 10 T/C 15062RFLP Hae III GCH11/2 Bsa A1 SNP841 exon 6 25054RFLP Bsa A1

PAGE 41

28 restriction enzyme appropriate for each RFLP /AFLP, according to the protocol of the supplier (New England Biolabs). Restrict ion enzyme concentrations for complete digestion were determined empirically for each marker. Digestion products were then separated by agarose gel electrophoresis and vi sualized using ethidium bromide staining and a 312 nm UV-transilluminator. Samples were genotyped as homozygous for the restriction site (cut), homozygous for no rest riction site (uncut) or heterozygous. PCR conditions, and product size for each marker can be found in Table 2-4. Statistical Analysis Blood samples were collected from vitil igo patients and their family members from all ethnic groups, however only the Caucasian ethnic group was large enough to run a valid case/control analysis on the genot ypic data. Patients we re also divided into two groups, segmental or non-segmental, ba sed on the appearance/ diagnosis of their lesion types. Only patients with nonsegmental lesions were included in the case/control and TDT analysis. Allele a nd genotype frequencies were calculated for each genetic marker for the patient and cont rol data sets. Thes e allele and genotype frequencies were then compared between th e affected and non-aff ected populations. If the particular gene or allele had no association with a par ticular disease, the frequency of that allele or genotype in the patient population shoul d be very similar to the frequency of that allele or genotype in th e control population. An allele or gene that confers susceptibility or resistance to a particular di sease would hypothetically differ in frequency between the affected and non -affected populations. To compare the frequency of an allele or genotype betw een the case and cont rol populations, a chi-

PAGE 42

29 square ( 2) analysis is performed. Chi-square analysis is represented by the following equation: 2 = [(Expected Value – Obtained Value)2]/Expected Value To further validate statistical significan ce determined by the case/control analysis, the transmission disequilibrium test (TDT ), a family-based association test, was performed. The TDT examines whether alleles of the marker of interest are transmitted at a frequency greater than 50% from an inform ative parent to an affected child. In the TDT, an informative parent is defined as a parent who is heterozygous for the allele of interest. Chi-square analysis is then perf ormed to determine the statistical significance of the TDT. The equation for the TDT in a 2 allele situation (i.e. RFLP, AFLP) is as follows: TDT = (b-c)2 / (b+c) Where b = the number of times allele 1 is transmitted from a heterozygous parent to an affected child and c = the number of times allele 2 is transmitted from a heterozygous parent to an affected child (Haines and Pericak-Vance, 1998) For a microsatellite marker where many possible alleles can be transmitted, the TDT is then represented by the following equation: Tkhet = [( k -1)/ k ] i (ni. – n.i)2/ ni. + n.i – 2niiWhere k = the number of marker alleles ni. = the total number of times allele i is transmitted to affected offspring n.i = the total number of times allele i is not transmitted to affected offspring nii = ni. n.i (Haines and Pericak-Vance, 1998; Spelman and Ewens, 1996)

PAGE 43

30 BonferroniÂ’s correction is a statistical method of adjusting and correcting for multiple numbers of chi-square tests. Bonf erroniÂ’s correction is represented by dividing the test-wise significance level by the num ber of tests, and is represented by the following equation: = / k Where = the testwise significance level (0.05) K = the total number of tests performed (Shaffer, 1995). BonferroniÂ’s correction was used on bot h RFLP/AFLP and microsatellite data. It has been suggested that there may be a difference between the etiologies of early onset and late onset vitiligo (Arcos-Bur gos et al., 2002). To investigate this phenomenon, case/control analyses were al so conducted separately on individuals whose age of diagnosis was less than 30 years of age. Results Immune System Genes Genetic association of CD28 with vitiligo was tested using a trinucleotide repeat. Allele and genotype frequencies for the pati ent and control groups are seen in Figure 21 Case/control analysis of this data revealed significance for allele 6, with a p value of 0.0036, and a corrected p value of 0.011 (Table 2-5). This allele is seen about 2 times as frequently in the control population, hence it can be said to have a protective nature. Family-based TDT analysis does not s upport association for this marker (Tkhet = 12.0, p =0.101). To determine potential susceptibility of the gene CTLA4, three polymorphisms were used, two RFLP markers and one microsatellite marker. The microsatellite marker is an AT dinucleotide repeat located in the 3' untranslated region. This marker has a huge

PAGE 44

31 population variance, with at least 33 identified alleles. Figure 2-2 shows the allele and genotype distribution for CTLA4. We found suggestion of asso ciation of single allele 8 ( p =0.0140, corrected p =n.s.), which was seen more often in controls than in the patient population and the grouped alleles 24-33, which were seen more often in patients than in controls ( p =0.0337, corrected p =n.s.) (Table 2-6) Th ese alleles were grouped together due to the high level of polymorphism associated with this marker. Alleles with larger number of repeats were difficult to accurately identify, and thus alleles with more than 24 repeats were grouped into on e large group for analysis purposes. One genotype 18/19 was also found to be pos sibly associated with vitiligo ( p = 0.0362, corrected p = n.s.), with this genotype seen more often in the contro l population than the patient population. Neither the putative signi ficant alleles nor the significant genotype p values hold up after BonferroniÂ’s corr ection, which corrects for multiple chi-square tests. The TDT also does not suppor t association for this marker (Tkhet= 12.3, p =0.197) (Table 2-5). The two RFLP markers CTLA 4/5 ( Bst EII position +49 A/G) and CTLA4 22/24 ( Hae III intron 1 C/T) were also genotyped and used in analysis. Neither marker showed significant association with vitili go through case/control analysis using all patients as well as in patients with early onset vitiligo, however TDT analysis shows significant association of both of these markers with vitiligo with p values of 0.006 and 0.043 respectively (Table 2-7 and 2-8). Two markers were used to analyze the candidate gene APS-1, including one RFLP and one SSCP. Analysis of the SSCP marker, APS-1 1/2, revealed no association of this marker with vitiligo using case/c ontrol or TDT analyses. The RFLP marker, APS-1 3/4, also showed no association with vitiligo through case/con trol for the total

PAGE 45

32 Figure 2-1. CD28 allele frequency. P=viti ligo patient alleles, C=control alleles. Asterisks represent significant diffe rences in allele frequency between patient and controls.

PAGE 46

33 Figure 2-2. CTLA4 allele frequency. The blac k bars are patient alleles, the checkered bars are control alleles Asterisks re present significant differences in allele frequency between patient and controls.

PAGE 47

34Table 2-5. Case/control association analys is for CD28 by microsatellite (CAA 3' UTR) Number of Alleles Genotyped Genotype or Allele % Patient% Control p valueCorrected p value Relative Risk (RR) TDT PatientControl N p value 398366Allele 65.010.70.00360.0110.4743n.s. Table 2-6. Case/control association analys is for CTLA4 by microsatellite (AT 3' UTR) Number of Alleles Genotyped Genotype or Allele % Patient % Control p valueCorrected p value Relative Risk (RR) TDT PatientControl N p value 438302Allele 843.252.30.0140n.s.0.8297n.s. Alleles 24-3320.314.20.0337n.s.1.42 Genotype 18/19 02.0362n.s.0

PAGE 48

35Table 2-7. Case/control associat ion analysis of CTLA4 by RFLP ( Bst E II +49 A/G)Number of Alleles Genotyped TDT Patient Group PatientControl Genotype or allele % Patient % Control p valueCorrected p value Relative Risk (RR) N p value Total4323681 2 42.1 57.9 39.4 60.6 n.s.n.s.590.006 Age of onset less than 30 176368 Table 2-8. Case/control associat ion analysis of CTLA4 by RFLP ( Hae III intron 1 C/T)Number of Alleles Genotyped TDT Patient Group PatientControl Genotype or allele % Patient % Control p valueCorrected p value Relative Risk (RR) N p value Total4043341 2 43.3 56.7 41.6 58.4 n.s.n.s.480.043 Age of onset less than 30 180334

PAGE 49

36 vitiligo patient population, how ever, TDT analysis suggest s association between this marker and vitiligo ( p =0.035). Grouping the patients with early onset (before 30 years reveals allele 1 and genotype 1,1 to be possibly associated with vitiligo with p values of 0.0171 and 0.0174, respectively. Using B onferroniÂ’s correction, these p values remain barely significant ( p =0.05) (Tables 2-9 and 2-10). A RFLP marker in the promoter region of IL-1 was genotyped. There was no association with vitiligo sugge sted by either case/control or TDT analysis (Table 2-11). The CD4 gene was genotyped using a pentanuc leotide repeat (TTTTC ) in the 5' UTR of the gene. Case/control an alysis found a significant p value for this microsatellite marker (Table 2-7). Case/Control asso ciation analysis of CTLA4 by RFLP ( Bst E II +49 A/G) genotype 02,02 ( p =0.0107). BonferroniÂ’s correction allowed the p value to remain just within the limits of significance (Table 2-12). Family-based analysis does not support association of this gene with vitiligo. IL-12p40 was genotyped using a C/A SNP in the 3' UTR Case/control analysis revealed no association of vi tiligo with any allele or genotype for the total patient population, however segr egating the population into early onset vitili go patients found that ge notype 2,2 had a significant p value ( p =0.0291, corrected p =n.s.). TDT analysis revealed a potential association of IL-12 with vitiligo with a p value of 0.0396, however the number of informative families in this analysis was very low (n=34) (Table 2-13). Melanocyte-specific Genes A RFLP maker for GCH1 in exon 6 wa s evaluated by case/control and TDT analysis for potential associa tion with vitiligo. No associ ation was found in either the case/control or family-based association analyses (Table 2-14).

PAGE 50

37Table 2-9. Case/control association analysis of APS-1 by SSCP (C/T exon 5)Number of Alleles Genotyped TDT Patient Group PatientControl Genotype or allele % Patient % Control p valueCorrected p value Relative Risk (RR) N p value Total3203441 2 19.4 80.6 22.1 77.9 n.s.n.s.15n.s. Age of onset less than 30 72344 Table 2-10. Case/control associat ion analysis of APS-1 by RFLP ( Hae III exon 10 T/C)Number of Alleles Genotyped TDT Patient Group PatientControl Genotype or allele % Patient % Control p valueCorrected p value Relative Risk (RR) N p value Total536362 440.035 Age of onset less than 30 174362Allele 171.861.30.01710.051.17 Age of onset less than 30 Genotype 1150.635.40.01740.051.87

PAGE 51

38Table 2-11. Case/control a ssociation analysis of IL-1 by RFLP ( Ava I –511 C/T)Number of Alleles Genotyped TDT Patient Group PatientControl Genotype or allele % Patient % Control p valueCorrected p value Relative Risk (RR) N p value Total3782941 2 34.7 65.3 34.0 66.0 n.s.n.s.42n.s. Age of onset less than 30 148294 Table 2-12. Case/control associ ation analysis of CD4 by Micros atellite (TTTTC repeat 5' UTR)Number of Alleles Genotyped TDT PatientControl Genotype or Allele % Patient% Control p valueCorrected p value Relative Risk (RR) N p value 446358Genotype 02,02 6.814.50.0107n.s.0.47104n.s. .

PAGE 52

39Table 2-13. Case/control associat ion analysis of IL-12p40 by RFLP ( Taq 1 C/A 3' UTR)Number of Alleles Genotyped TDT Patient Group PatientControl Genotype or allele % Patient % Control p valueCorrected p value Relative Risk (RR) N p value Total388352 340.0396 Age of onset less than 30 162352Genotype 2,26.21.70.02910.0873.63 Table 2-14. Case/control associat ion analysis of GCH1 by RFLP ( Bsa A1 C/T exon 6)Number of Alleles Genotyped TDT Patient Group PatientControl Genotype or allele % Patient % Control p valueCorrected p value Relative Risk (RR) N p value Total436284 46n.s. Age of onset less than 30 174284

PAGE 53

40 Discussion The candidate genes CTLA4/CD28, APS-1, IL1 CD4 and IL-12 were analyzed based on their roles in modula ting the immune response. GCH1 was analyzed due to its role in melanocyte biochemistry. The genetic markers chosen for both IL1 and GCH1 showed no association with vi tiligo. All the other immune related genes reported here showed at least one mark er with a significant (p 0.05) genotype or allele in either the case/control or the TDT associ ation studies. Although the p values for several individual allele(s) and/or genotype(s) appe ared to be significant, after application of BonferroniÂ’s correction for multiple Chi square analyses, many of there p values were not significant. These data suggest that ther e may be a weak or spurious association of several of these immune response genes a nd the human autoimmune disease vitiligo. Analysis of a microsatellite marker within the CD28 gene showed possible association of a protective al lele with vitiligo using case/ control analysis. However, family-based studies did not confirm this association. Three CTLA4 markers were analyzed, including one microsatellite and two RFLP polymorphisms. The three CTLA4 polymorphisms revealed no significa nt alleles or genotypes, however both RFLP markers showed possible association w ith vitiligo using family-based association studies. Because of the important regulatory role of CTLA4 in T cell activation, it has been considered a likely candidate for invo lvement in autoimmune diseases. A likely insulin-dependent diabetes mellitus (IDDM ) susceptibility locus, IDDM12, was discovered in the CTLA4/CD28 genomic re gion. Using the same CTLA4 and CD28 polymorphic markers employed in this study, re searchers discovered highly significant

PAGE 54

41 association of all three C TLA4 markers with IDDM, while the CD28 marker suggested no association (Marron et al ., 1997). Association of th e CTLA4 gene has also been suggested with other autoimmune disorder s, such as GravesÂ’ disease, autoimmune hypothyroidism (Einarsdottir et al., 2003; Udea et al., 2003), multiple sclerosis (Kantarci et al., 2003), and rheumato id arthritis (Rodr iguez et al., 2002). A study of 74 British vitiligo patients re vealed no primary association of the CTLA4 dinucleotide repeat with vitiligo. However, this same study demonstrated an association of the AT dinucleotide polymorphism with vitiligo patients who also suffered from one or more other autoimm une disorders (Kemp et al., 1999). Similar data stratification of our patients into those who suffer from vitiligo alone, or those who suffer from multiple autoimmune disorders do es not replicate the enhanced significance of the CTLA4 polymorphism as seen by Kemp et al. (Kristensen, 2000). While the report by Kemp and coworkers does not suppor t our findings of CTLA4 association with vitiligo, it does lend evidence to an a ssociation of vitiligo with a general immune system dysfunction. It is also important to keep in mind that there may well be several divergent etiologies, and CTLA4 may be a ssociated with vitiligo that is primarily autoimmune in origin. A functional explan ation for autoimmune association of the dinucleotide repeat has been suggested. Th e CTLA4 AT dinucleotide repeat varies in number from 1 repeat to greater than 33 re peats. Increased numbers of dinucleotide repeats have been shown to affect RNA stab ility, and in particular AT rich regions in UTRs have been documented to decrease stability (Kemp et al., 1999). APS-1 or AIRE is the gene respons ible for autoimmune polyendocrinopathycandidiasis-ectodermal dystrophy syndr ome (APECED), otherwise known as

PAGE 55

42 autoimmune polyglandular syndrome (APS). It is an autosomal recessive autoimmune disease, caused by mutations in the AIRE (autoimmune regulator) gene. The most common features of APECED are parathyroi d gland failure, chronic susceptibility to candida yeast infection, and Addison's diseas e. Other autoimmune diseases associated with APECED include alopecia, vitili go, ovarian failure, testicular atrophy, hypothyroidism, gastric parietal cell atrophy, he patitis, intestinal malabsorption, and insulin-dependent diabetes mellitus. The AI RE protein is predominantly expressed in thymic epithelial cells (TECs) but also in some monocytederived cells of the thymus, in a subset of cells in lymph nodes, and in the spleen and in feta l liver. Due to this expression pattern, it is t hought that the AIRE protein may be involved in the maintenance of thymic tolerance, and perhaps mutations in this gene may be responsible for incomplete negative selection of self-antigens, resu lting in the eventual development of multiple autoimmune disorders (Pitkanen et al., 2003). A weak association of APS-1 with vit iligo was shown in the case/control study with the RFLP marker in exon 10 in patients with early-onset vitiligo (Table 2-10). The family-based TDT reaffirms these re sults with a weakly significant p value of 0.035. Since the APS-1 RFLP p values are not strong, and because the other SSCP APS-1 marker showed no association with vitiligo, it is not likely that a defect in the AIRE gene is responsible for vitiligo susceptibilit y. It is possible that some of the vitiligo patients used in this study are also APS pa tients who at the time of blood donation had not yet been diagnosed, or who had not yet developed other autoimmune problems. This explanation could be a reason for the significant p values found in the population of vitiligo patients who developed the disorder before age 30.

PAGE 56

43 CD4 is a co-receptor molecule found on CD4+ T cells, which functions by binding the peptide:MHC class II complex on the AP C and through associating with the TCR on the T cell. CD4 is a single chained mol ecule composed of four immunoglobulin-like domains. Signaling through CD4 occurs when its cytoplasmic domain interacts with a tyrosine kinase known as Lyk. CD4 and the TCR signaling cascades function synergistically to allow for T cell activation after interaction of the TCR and its specific peptide located in the bi nding grove of the MHC cl ass II molecule on an APC. Theoretically any malfunction of the CD4 r eceptor could potentially allow for improper activation and pro liferation of CD4+ T cells. We found a weak association of the microsatellite TTTTC repeat, located in the 5' UTR of the CD4 gene, with vitiligo. Since this result was not supported by family-bas ed data, thus it is unlikely that CD4 is a true susceptibility gene for vitiligo. Interleukin-12 is a pro-inflammatory cytokine secreted from macrophages or dendritic cells, which plays an important role in the protection against intracellular pathogens as well as the developmental commitment of T helper 1 cells. IL-12 is comprised of two disulfide-linked s ubunits IL-12p40 and IL-12p35, which together make up the active form of the molecule designated IL-12p70. IL-12 exerts its biological effects through binding to specif ic IL-12 receptors (IL-12Rs). IL-12 receptors also play a critical role in determining Th1/Th2 balance. The IL-12R 2 subunit is not expressed on resting T cells, but is upregulated when the TCR comes into contact with antigen (Chang et al., 2000). Because of its pro-inflammatory role, genes of the IL-12 pathway are therefore good ca ndidates for mediating susceptibility or resistance to a range of immune disorders.

PAGE 57

44 IL-12 polymorphisms have been associated with several auto immune disorders such as diabetes (Davoodi-Semiromi et al., 2002), atopic dermatitis, and psoriasis vulgaris (Tsunemi et al., 2002). In this study the 3' UTR SNP in the IL-12 p40 gene showed weak association with vitiligo in pa tients whose age of onset was less than 30 years ( p = 0.0291). This association was lost when BonferroniÂ’s correction was applied (p=0.087). The family-based TDT study also showed weak association of this polymorphism with vitiligo with a p value of 0.0396. A physiological effect of this 3' UTR polymorphism has recently been descri bed. Seegers et al. (2002) observed an increasing IL-12p70 secretion by monocytes in vitro in those without this polymorphism, heterozygotes, and homozygotes with the 3' UTR polymorphism respectively. This increase in IL-12 could contribute to autoimmunity, as it has been hypothesized that disturbed Th1/Th2 balance, and or aberrant control of Th1 cytokines, such as IL-12, may play an important role in induction of T cell mediated autoimmunity. While many of these immune system candidate genes show statistically significant p values ( p 0.05) in the case/control and/or family-based analysis, which would hypothetically identify them as vitili go susceptibility genes, most of these associations are statistically weak. It is im portant to note that vitiligo is most likely a disease with a multifactorial etiology. Th erefore susceptibility genes that are uncommon in a population, or genes which are only one of many such genes responsible for the vitiligo phenotype may not show strong associations in case/control analyses. It is with this in mind that we dismiss these genes possessing weak genetic association with vitiligo, CTLA4/CD 28, APS-1, CD4, and IL-12p40, as being

PAGE 58

45 improbable susceptibility genes for vitiligo. In the next chapter, we describe analyses of a different set of candidate genes, invo lved in antigen processing and presentation, using a similar approach.

PAGE 59

46 CHAPTER 3 ANTIGEN PROCESSING AND PRESENTATION GENES Introduction Many human autoimmune diseases have been associated with polymorphisms in genes located in the MHC class II genomic re gion of the human HLA locus. This highly polymorphic region includes several genes invo lved in the processing and presentation of antigen to the immune system, including low molecular weight polypeptides -2 and -7 (LMP2 and LMP7) and transporter-associated wi th antigen processing proteins -1 and -2 (TAP1 and TAP2). These four genes are asso ciated with several autoimmune diseases, such as type 1 diabetes, j uvenile rheumatoid arthritis, ankylosing spondylitis, celiac disease, SjgrenÂ’s syndrome, and multiple sclerosis (Deng et al., 1995; Prahalad et al., 2001; Fraile et al., 1998; Djilali-Saiah et al., 1994; Kumagai et al., 1997; MoinsTeisserance et al., 1995). LMP2 and LMP7 encode IFNinducible subunits of the immunoproteasome, which replace constitutivel y expressed subunits of the cytoplasmic proteasome upon immune system upregula tion. The immunoproteasome functions by degrading ubiquitin-tagged cytoplasmic proteins into peptides that are especially suited for presentation by MHC class I molecules (T anaka et al., 1998; Pamer et al., 1998). An additional IFNinducible subunit, multicatalytic endopeptidase complex-like-1 (MECL1), is part of the immunoproteasome complex, but is encoded on chromosome 16 outside the MHC region. TAP1 and TAP2 encode subunits of an IFNinducible transporter heterodimer. TAP1 and TAP2 function by binding peptides in the cytoplasm

PAGE 60

47 and transporting them into the endoplasmic reticulum where they can be loaded into nascent MHC class I molecules (Pamer et al., 1998). As reported for other autoimmune diseas es, genes in the HLA region may play a role in vitiligo pathogenesis. Many HLA associations have been reported between specific alleles of complement, class I a nd class II MHC genes with vitiligo, however, many of these associations are solely f ound in isolated population groups (Friedman et al., 1999). A recent segregation and linkage disequilibrium analyses of microsatellite markers spanning the entire HLA region suggested a major HLA genetic factor segregating as a dominant factor in patients with early onset of vi tiligo (Arcos-Burgos et al., 2002). Because of the reported associations of these genes with other autoimmune diseases, and due to the location of these ge nes inside the MHC class II genomic region, we chose to genotype polymorphisms in LMP2, LMP7, TAP1, TAP2 and MECL1. Because family based association for the SNP in intron 6 of LMP7 was so significant, we also chose to sequence across LMP7 to search for mutations in this gene. We report here case-control and family-based genetic asso ciation studies for the TAP1, TAP2, LMP7, LMP2 and MECL1 genes in human vitiligo patients. The LMP/TAP gene region was found to be significantly associated with vi tiligo in Caucasian patients, suggesting a possible role for MHC class I antigen proc essing and/or presentation in the antimelanocyte autoimmune response involved in vitiligo pathogenesis (Casp et al., 2003). Materials and Methods Blood Collection and Processing Blood collection and processing, DNA extrac tion and genotyping were performed as described in chapter 2.

PAGE 61

48 LMP7 Sequencing DNA preparation and PCR amplification Six sets of PCR primers were designed wi thin flanking introns to amplify all 6 exons (Table 3-1). Two DNA pooled sample sets were created, one containing mixed DNA from 50 selected vitiligo patients, the other containi ng a mixture of DNA from 50 unaffected controls. PCR was carried out in a 50-L volume containing 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2; 60 M of each dNTP, pooled patient and control genomic DNA, 2 pmol of each primer and 1.5 U Taq DNA polymerase. Samples were subjected to 35 cycles of 30 s at 94C for denaturing, 30 s at optimum annealing temperature, and 30 s at 72C for extension. Direct sequencing of PCR products After PCR amplification, products (50 L) were electrophoresed on a 2.0% agarose gel. The DNA fragments were excised from the gel and transferred into 1.5-mL Eppendorf tubes. The tubes were frozen at –20C for 5–10 min. The gel slices were smashed while frozen and then incubated in a 50–60C water bath for 10–15 min. The tubes were briefly vortexed and the PCR products eluted out of the gels by a short centrifugation. The supernatant was centrifuged once more to remove any remaining agarose. An aliquot of products (30 L) was then used directly for cycle sequencing using the ABI Prism BigDye terminator (Applied Biosystems) according to the manufacturer’s instructions. The sequencing reactions were precipitated in 3 vol. 100% ethanol and 0.1 vol. 3 M sodium acetate, pH 5.2. Pellets were washed with 250 L of 70% ethanol, dried in a vacuum dryer and then dissolved in 20 L of template suppression buffer (Perkin

PAGE 62

49 Table 3-1. LMP7 primers for sequencing across the geneLMP7 marker/Exon amplifiedForward PrimerReverse Primer LMP7 A/exon 1TTACCTCCTTTCCAAGCT CCTCG AGAATATACCCGCCGCGT GTAG LMP7 B/exon2TTAGGAGACCGTTGAAC CTGGAG AACTTGCACTTCCTCCTCT CAGG LMP7 C/exon3AGACCCAAAGAAGAGGC CACATG TCCACTTTGTTGCAGAGT TGGC LMP7 D/exon4TATACGCTCCAGCAGGC AGAATC GGGGAACATGAAGAATG GAGAGC LMP7 E/exon5CTATGGGCAGTATGATC TGTGGC CACCTCCCAGGTTCAAGT GATTC LMP7 F/exon6TACAAAAATTAGCCGGA CGTGG AGCAATGAGCAGCCTTCC TGAG

PAGE 63

50 Elmer). DNA sequencing was carried out using an ABI 310 automated sequencer (Applied Biosystems). Results Case/Control Association Studies Allele and genotype frequencies The single nucleotide polymor phisms (SNPs) used in this study as genetic markers for the LMP/TAP genes and MECL1 are listed in Table 3-2. Case/control analyses of a patient population consisting of 230 unrelat ed Caucasian vitiligo patients and 188 unrelated Caucasian controls revealed signif icant differences in al lele and/or genotype frequencies suggesting association with th e candidate genes TAP1 and TAP2 (data not shown). However, when population heterogene ity between the case and control sets was tested by using WrightÂ’s F statistic according to the unbiased methods ( value) of Weir & Cockerham, a significant difference betw een the case and control populations was indicated (Weir and Cockerham, 1984). As s uggested by Arcos-Burgos et al. (2003), we then stratified the vitiligo patient populati on by age of onset, as their segregation and linkage disequilibrium analyses of the HL A region revealed a dom inant genetic factor segregating in vitiligo patients deve loping this disorder before age 30. Using these new guidelines there was no significant diffe rence in population structure between a case population consisting of 100 Caucasian patients with an age of vitiligo onset of 0-29 years and the control set as defined by subdivision analysis. Using age of onset as a distinguishing factor, the value was not signif icantly different than zero ( = 0.0050, 95% confidence interval 0.0010 0.0116). Exact tests for Hardy-

PAGE 64

51Table 3-2. Primers used for LMP/TAP and MECL1 genotyping.PCR PrimersAnnealingRestrictionFragment sizes (bp) GenePolymorphismName Sequences (5 to 3 ) Temp.EnzymeCutUncutSNP ID LMP2G/A exon 3 (R60H)LMP2-2GTGAACCGAGTGTTTGACAAGC 58 C Hha I252212,40rs17587 LMP2-1GCCAGCAAGAGCCGAAACAAG TAP1C/T intron 7TAP1-15GTGCTCTCACGTTCCAAGGA 55 C Msp I183161,22rs735883 TAP1-16AGGAGTAGAGATAGAAGAACCb TAP1G/A exon 10 (D637G)TAP1-10CTCATCTTGGCCCTTTGCTC 60 C Acc I165136,29rs1800453 TAP1-11CACCTGTAACTGGCTGTTTG LMP7A/C exon 2 (Q49K)LMP7-ZTCGCTTTACCCCGGGGACTGa 63 C Pst I212194,18rs2071543 LMP7-BRAACTTGCACTTCCTCCTCTCAGG LMP7G/T intron 6LMP7-7TTGATTGGCTTCCCGGTACTG 58 C Hha I583,180428,180,155ref. 1 LMP7-4TCTACTACGTGGATGAACATGG TAP2G/A exon 5 (V379I)TAP2-3GAACGTGCCTTGTACCTGCGCc 57 C Bst U I212192,20rs1800454 TAP2-4ACCCCCAAGTGCAGCAC TAP2A/G exon 11 (T665A)T AP2-5GGTGATTGCTCACAGGCTGCCGd 61 C Msp I225205,20rs241447 TAP2-6CACAGCTCTAGGGAAACTC MECL 1 T/C exon 4 (L107L)MECL1-1TCGACTTGGGTTGCAGGCTTAC 65 C Mlu I973,131535,438,131rs20549 MECL1-2ATCTGAAGTAACCGCTGCGAC aUnderlined nucleotide in primer LMP7-Z was ch anged from the germline A to a C to create the Pst I RFLP.bUnderlined nucleotide in primer TAP1-16 was ch anged from the germline G to a C to create the Msp I RFLP.cUnderlined nucleotide in primer TAP2-3 was changed from the germline T to a G to create the Bst UI RFLP.dUnderlined nucleotide in primer TAP2-5 was ch anged from the germline T to a C to create the Msp I RFLPUnderlined nucleotides were a ltered from germline sequence to create restricti on sites at the single nucleotide polymorphism (S NP). SNP ID reference numbers are from the National Center for Biotechnology Information Single Nucleotide Polymorphism database (http://www.ncbi.nlm.nih.gov/SNP

PAGE 65

52 Weinberg equilibrium and linkage disequilib rium are shown in Table 3-3. Deviation from Hardy-Weinberg equilibrium was observed for the TAP2 A/G exon 5 genetic marker in both the patient and control popula tions. After BonferroniÂ’s correction for multiple comparisons, significant linkage di sequilibrium was observed between LMP2TAP1, LMP2-LMP7 and TAP1-LMP7 genetic markers in patients, and between LMP2TAP1, LMP2-LMP7, LMP2-TAP2, TAP1-LMP7, LMP7-LMP7, and LMP7-TAP2 genetic markers in controls (Table 3-3). The allele and genotype frequencies for the seven LMP/TAP and one MECL1 genetic markers genotyped for 100 Caucasian viti ligo patients with early age of onset (029 years) and 188 unrelated Caucasian control subjects are shown in Table 3-4 and 3-5. No significant differences were observed for th e allele counts and frequencies of six of the eight markers examined (Table 3-4). The G/T SNP in intron 6 of the LMP7 gene displayed an excess of the G allele in the patient vs. control groups ( p =0.040). The G/A SNP in exon 10 of the TAP1 gene (D637G) exhibited a sign ificant excess of the G allele in the patient vs. control groups ( p =0.0034). Table 3-5 lists genotype counts and percen tages for 100 Caucasian vitiligo patients with early age of onset and 188 unr elated controls, as well as the p values determined by 2 analysis of 3 2 contingency tables. No signifi cant differences were observed for seven of the eight markers genotyped. The G/A SNP in exon 10 of the TAP1 gene (D637G) exhibited a significant excess ( p =0.0094) of the GG genotype allele in vitiligo patients (71.4%) compared to controls ( 53.4%). Furthermore, comparison of the individual allele carriage rates for this marker confirmed that the A allele carriage rate is significantly lower in patients than in controls (28.6% vs. 46.6%, p c=0.0073), and that

PAGE 66

53Table 3-3. Linkage disequilibrium analysis of Caucasian vitiligo patients (age of onset 0-29 years) and control subjects.LMP2TAP1TAP1LMP7LMP7TAP2TAP2MECL1 G/A exon 3C/T intron 7G/A exon 10A/C exon 2G /T intron 6A/G exon 5A/G exon 11T/C exon 4 Cases LMP2 G/A exon 3 0.067 TAP1 C/T intron 7 <10-5 a0.220 TAP1 G/A exon 10 0.0680.183 0.458 LMP7 A/C exon 2 0.3470.5090.369 1.000 LMP7 G/T intron 6 <10-5 a<10-5 a0.3301.000 0.670 TAP2 A/G exon 5 0.0910.2600.1680.2950.618 0.011 TAP2 A/G exon 11 0.8120.8630.3351.0000.8110.185 0.625 MECL1 T/C exon 40.6030.6220.6470.3300.1600.640 0.503 0.521 Controls LMP2 G/A exon 3 1.000 TAP1 C/T intron 7 <10-5 a0.237 TAP1 G/A exon 10 0.0440.027 0.154 LMP7 A/C exon 2 0.248<10-5 a0.271 0.709 LMP7 G/T intron 6 <10-5 a<10-5 a0.2680.0003 a0.537 TAP2 A/G exon 5 0.001 a0.0020.8370.2290.0003 a0.010 TAP2 A/G exon 11 0.8560.5900.1700.8360.3430.204 1.000 MECL1 T/C exon 40.6150.6210.2790.3000.8670.029 0.881 0.298 a p <0.05 after BonferroniÂ’s correction for multiple tests.P values for exact tests of Hardy-Weinberg equilib rium are shown in the diagonal (bold). Below are p values for the linkage disequilibrium pairwise tests

PAGE 67

54Table 3-4. Allele frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo pa tients (age of onset 0-29 years) and control subjects.Vitiligo PatientsControls GenePolymorphismAlleleCountPercentageCountPercentage p value LMP2G/A exon 3 (R60H)G6232.69526.20.11 A12867.426773.8 TAP1C/T intron 7C8044.412138.80.22 T10055.619161.2 TAP1G/A exon 10 (D637G)A2914.88925.60.0034 G16785.225974.4 LMP7A/C exon 2 (Q49K)A16587.829688.10.91 C2312.24011.9 LMP7G/T intron 6G9552.214242.80.040 T8747.819057.2 TAP2A/G exon 5 (V379I)A4021.77421.00.85 G14478.327879.0 TAP2A/G exon 11 (T665A)A13971.625769.80.65 G5528.411130.2 MECL1T/C exon 4 (L107L)T14680.225980.90.84 C3619.86119.1

PAGE 68

55Table 3-5. Genotype frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitili go patients and (age of onset 0-29 years) control subjects.Vitiligo PatientsControls GenePolymorphismGenotypeCountPercentageCountPercentage p value LMP2 G/A exon 3 (R60H)GG66.3126.60.095 GA5052.67139.2 AA3941.19854.1 TAP1 C/T intron 7CC2123.32717.30.47 CT3842.26743.0 TT3134.56239.7 TAP1 G/A exon 10 (D637G)AA11.084.60.0094 AG2727.67342.0 GG7071.49353.4 LMP7 A/C exon 2 (Q49K)AA7377.713178.00.98 CA1920.23420.2 CC22.131.8 LMP7 G/T intron 6GG2628.62816.90.077 GT4347.38651.8 TT2224.25231.3 TAP2 A/G exon 5 (V379I)AA99.8148.00.84 AG2223.94626.1 GG6166.311665.9 TAP2 A/G exon 11 (T665A)AA5152.69048.90.83 AG3738.17741.9 GG99.3179.2 MECL1 T/C exon 4 (L107L)TT6065.910766.90.98 TC2628.64528.1 CC55.585.0

PAGE 69

56 the overall G carriage rate is higher in patients than in c ontrols, although not statistically significant (99.0% vs. 95.4%, p c=0.22). Taken together, thes e results suggest a possible association between the TAP1 gene in the LMP/TAP gene cluster and vitiligo susceptibility. Family-based association Further evidence for genetic associa tion between LMP/TAP genes and vitiligo susceptibility was sought using the transmi ssion disequilibrium test (TDT), a familybased (intrafamilial) study design that consid ers heterozygous (informative) parents and evaluates the frequency with which alleles are transmitted to affected offspring (Speilman et al., 1996). A 2 test was used to evaluate the devi ation of the rates of transmission and non-transmission from the random expectation (Table 3-6). For the TAP1 G/A exon 10 (D637G) marker, only 35 informative (heterozygous) parents could be identified. Although the number of informative parents is relatively low, analysis of this marker suggests unequal transmission of alleles to affect ed children, with th e G allele being transmitted more frequently (69%) th an expected due to random chance ( p =0.028), which is consistent with the allele and genotype frequencies described above. TDT analysis of the other genes in th e LMP/TAP cluster revealed additional evidence for biased transmission of LMP/TAP a lleles in vitiligo pati ents, with significant differences detected ( p 0.05) for LMP2, TAP1 and LMP7 genetic markers. Similar to the results for the TAP1 G/A exon 10 marker, the LMP2 G/A exon 3 (R60H) and TAP1 C/T intron 7 markers displayed allele tr ansmission frequencies of 68%, and TDT p values of 0.023 and 0.011, respectively. The most highly signifi cant TDT result ( p <0.00006) was observed for the LMP7 G/T intron 6 marker, for which there were 45 informative

PAGE 70

57Table 3-6. Family based association (tra nsmission disequilibrium test) results for LMP/TAP and MECL1 candidate genes and vitiligo susceptibility GeneMarker Number of Informative ParentsTransmitted Not Transmitted % Transmitted p value LMP2G/A exon 3 (R60H)382612680.023 TAP1 C/T intron 7503416680.011 TAP1 G/A exon 10 (D637G)352411690.028 LMP7 A/C exon 2 (Q49K)261610620.24 LMP7 G/T intron 645369800.000057 TAP2 A/G exon 5 (V379I)221210550.67 TAP2 A/G exon 11 (T665A)563125550.42 MECL1 T/C exon 4 (L107L)472423510.88

PAGE 71

58 parents available. The G allele was tran smitted from unaffected parents to affected children much more often (80%) th an expected due to random chance LMP7 Sequencing 50 Caucasian patients and 50 Caucasian controls were pooled from the overall patient and control groups without regard to LMP7 genotype. Pooled groups were sequenced with the hope of discovering ne w polymorphisms and/or mutations in the LMP7 gene based on preliminary results fr om case/control and TDT analysis, which initially revealed highly significant p values for both the case/control and family-based studies. As the number of patients and contro ls used in the analyses increased, and as BonferroniÂ’s correction was applied, significant p values for LMP7 remained only in the family based analyses. While LMP7 was seque nced completely across all 6 exons, there was too much background from the 50 pool ed samples to discern individual polymorphisms (especially those with low patient numbers) with confidence. Even known SNPs used as RFLP markers in the cas e/control and family based analyses were not apparent within the seque nced data due to background variation (data not shown). Discussion Through the use of a candidate gene appr oach we have found evidence for genetic association between vitiligo and the LMP/ TAP region. Case/control analyses reveal association of vitiligo and the gene encoding transporte r associated with antigen processing-1 (TAP1), whereas a family-based association method (TDT) revealed biased transmission of specific alleles from heteroz ygous parents to affected offspring for the TAP1 gene, as well as for the LMP2 and LMP7 genes. No association with vitiligo was found for the MECL1 gene, which encodes a third immunoproteasome subunit not located in the MHC class II region (Casp et al., 2003).

PAGE 72

59 The LMP/TAP genes play important roles in the regulation of class I antigen processing and presentation, as their proteins form IFNinducible subunits of the immunoproteasome and TAP transporter resp ectively. The proteasome is a large protease made up of several subunits, which play s a crucial role in protein degradation in the cell. Proteasomes reside in the cyto sol in both free-floating forms and bound to ribosomes on the endoplasmic reticulum, and in the nucleus. In most cases the proteasomes degrade intracellular proteins that have been marked for degradation by the attachment of an ubiquitin moiety. The complete 26S proteasome is made up of two major components, the 20S core protease subunit, and the 19S ATP-dependant cap (Bochtler et al., 1999). The structural prot otype of the proteasome is of four stacked heptameric rings in an 7 7 7 7 cylindrical structure. The catalytic sites of the proteases are located in the subunits on the interior of the cylindrical structure, and involve an N-terminal threonine. Other c onserved resides in the vicinity of the proteasome active site include Asp17, Ser129 and Ser169 (Bochtler et al., 1999). The 20S proteasome is made up of at least 14 di fferent subunits (Brooks et al., 2000). Three of these subunits, known as X, Y, and Z, are constitutively expressed, but can be replaced by the three IFNinducible subunits LMP2, LMP7, and MECL1. When these inducible subunits are present, the proteasome is known as the immunoproteasome. It was due to their inducibility by IFNthat these subunits were first be lieved to play a role in antigen processing. These inducible subunits ha ve many amino acid similarities to the constitutive subunits, however they cleave prot eins into peptides differently. The IFNinducible subunits generate peptides wi th basic carboxyl termini, and hydrophobic residues, while inhibiting cleava ge after acidic residues. Th ese residues are those that are

PAGE 73

60 the most compatible with the binding groove of the MHC class I molecule (Tanaka et al., 1998; Pamer et al., 1998; Driscoll et al., 1993). Another subunit that is inducible by IFNis known as proteasome activator 28 (PA28) or 11 S REG. PA28 has three subunits, , and which form a ring-shaped heptameter (Rechsteiner et al., 2000). Evolutionarily, subunits and seem to have been derived from gene duplication of the Ki antigen which is found in lower eukaryotes (Fruh et al., 1999). Interestingly, anti-Ki antibodies are often found in conjunction with systemic lupus erythematosus, another know n autoimmune disease (Tanaka et al., 1998). PA28 functions as an activator of the 20S proteasome, by associating with one or both ends of the proteasome to create a foot ball shaped structure as seen by electron microscopy (Tanaka et al., 1998). The asso ciation of PA28 with the 20S proteasome greatly enhances the proteasomeÂ’s peptid ase activities (Rechsteiner et al., 2000). The proteasome plays an integral role in antigen processing and presentation through the MHC class I pathway. The MHC cl ass I pathway is mainly responsible for processing and presenting intracellular pat hogens such as viruses and intracellular bacteria. Processing by either the constitutive or the IFNinduced proteasome subunits influence which peptides are generated and presented by MHC class I molecules (Schwarz et al., 2000; Sijts et al., 2000; Mo rel et al., 2000; Maksymowych et al., 1998). To reach the MHC class I molecule for binding, the proteasome-cleaved peptide must cross into the endoplasmic reticulum from the cytoplasm. To do this, the peptide must associate with a molecule known as transporte r associated with an tigen processing (TAP) which will transport the peptide across the endoplasmic reticulum. TAP is an IFNinducible heterodimer that consists of tw o subunits, TAP1 and TAP2, both of which must

PAGE 74

61 be present for peptide binding and transloc ation. Peptide binding is ATP independent, but translocation across the ER does require ATP (Pamer et al., 1998). The TAP complex preferentially binds peptides of certain lengths and of certain amino acid composition, favoring basic, aromatic, hydrophobic and ch arged residues (Hardi ng et al., 1997). As mentioned before, these TAP/MHC class I-pre ferred peptides are produced at a higher rate with the IFNinduction of the immunoproteasome (Rechsteiner et al., 2000; Harding et al., 1997). Without antigen in its binding groove, MH C class I molecules are sequestered in the ER. Newly synthesized MHC class I chain associates with a chaperone protein known as calnexin. Association with calnexin retains the MHC in a partially folded state. With the addition of the -2 microglobulin chain, calnexin is released, and the MHC now binds calreticulin, another chap erone protein, and tapasin, a prot ein that serves as a bridge between the TAP complex and the MHC. Th e MHC will remain in this state until a peptide that fits its specificity comes into the ER by way of the TAP transporter (Pamer et al., 1998). MHC class I molecules are each cap able of binding a repertoire of peptides with lengths of 8-10 amino acids, charac teristic anchor re sidues, and basic or hydrophobic C-termini (Reichsteiner et al., 2000; Rock and Goldberg 1999). With the majority of the proteins degr aded by the proteasome being self-proteins, the generation of altered forms of antigen by the immunoproteasome and the preferential transport of MHC class I-compatible antig ens across the ER membrane by TAP are extremely important in influencing the expr ession of foreign peptide over self peptide. Changes in function and/or expression pattern s of TAP or LMP proteins could potentially influence the peptide repertoire expressed to circulating lymphocytes, and allow for the

PAGE 75

62 induction of inappropriate immune events to cryptic epitopes of self-peptides for which the immune system has not been made tolerant. TAP1 amino acid polymorphisms, including D637G (in this re port) and I333V, have been reported to influence the permissiveness of transport of specific pep tides across the endoplas mic reticulum in some models(Quadri and Singal, 1998), and the TA P2 polymorphism T665A (in this report) has been suggested to influence the antibody response to measles virus vaccine (Hayney et al., 1997). Two functiona l studies of human TAP polymorphisms, however, revealed no significant influence of human TAP1 or TAP2 alleles on peptide binding and translocation. (Obst et al., 1995; Daniel et al., 1997). Fewer functional studies have been performed on LMP polymorphisms, however, it has been reported that the LMP2 R60H and LMP7 Q49K polymorphisms (in this report) affect age-dependent TNFapoptosis and response to interferon in pa tients with chronic hepatitis C, respectively (Mishto et al., 2002; Sugimoto et al., 2002). Immunoproteasomes might also play an in tegral role in maintaining peripheral tolerance. Immunoproteasomes are normally expressed by cells in the thymus and by mature dendritic cells under conditions in which most T cell activation occurs, whereas elsewhere in the periphery constitutive pr oteasomes are expressed in the absence of inflammation. Because non-professional antig en presenting cells in non-inflamed tissue should only present antigens processed by the co nstitutive proteasome in their MHC class I molecules, T cells specific for these pe ptides may become anergized upon presentation, due to the lack of costimulation. T cells that become inadvertently activated by selfpeptide at a site of inflammation may “avoid” antigen from the same self-peptide in noninflamed sites due to differing epitopes produced by the constitutive proteasome

PAGE 76

63 (Groettrup et al., 2001). In v itiligo patients, biochemical de fects in the melanin pathway that promote oxidative damage could be a tri gger for excessive inflammation in the skin. Inappropriate expression or function of either the constitutive proteasome or immunoproteasome might influence antigen pr ocessing and presentation, leading to a break in peripheral toleran ce to melanocyte self-antigens. Two other recent reports have also imp licated the MHC class II region in vitiligo susceptibility. Using a whole genome scan of a large family cluster with both vitiligo and Hashimoto thyroiditis, a general autoimmune susceptibility locus ( AIS1 ) was mapped to human chromosome 1. Evidence was al so reported for a Hashimoto disease susceptibility locus within a chromoso me 6 region spanning both the MHC and AIDT1 a non-MHC locus associated with susceptibility to both Hashimoto thyroiditis and GravesÂ’ disease (Alkhateeb et al., 2002). A lin kage disequilibrium analysis of 56 multigeneration Columbian families with vitiligo using microsatellite markers spanning the entire human MHC region revealed a major genetic factor within the MHC at 6p21.321.4 with a dominant mode of inheritance in vi tiligo patients with an early age of onset and a recessive mode of inheritance influenced by environmental effects in vitiligo patients with an age of onset after 30 years of age. Comparisons of a variety of inheritance models suggested that the most parsimonious genetic model was that of a major dominant gene plus environmental effects, although multifactorial models could not be rejected (Arc os-Burgos et al., 2002). In recent years there have been many repor ts of association of LMP and TAP genes with human autoimmune diseases. LMP2 and LMP7 have been report ed to be associated with insulin-dependent diabetes mellitus (D eng et al., 1995); LMP7 is associated with

PAGE 77

64 ankylosing spondylitis (Fraile et al., 1998) and with juvenile rheumatoid arthritis (Prahalad et al. 2001); TAP2 is associated with SjgrenÂ’s syndrome (Kumagai et al., 1997); and with multiple sclerosis (Moins -Teisserenc et al., 1995). Other HLA associations have been sporad ically reported for vitiligo pati ents of various ethnic groups, e.g. DR4 in Caucasian Americans (Foley et al., 1983), A2 in German and Slovak patients and Dw7 in Slovak patients (Buc et al.; 1996, Schallreuter et al., 1993), Cw6 and DR6 in Dutch patients (Venneker et al., 1993), and B21, Cw6 and DR53 in Kuwaiti patients (alFouzan et al., 1995). Unlike most autoimmune diseases, there seems to be no common HLA association with vitiligo. Insufficient num bers of vitiligo patients from other ethnic and racial populations were available for comp arison to Caucasians in this study. Several studies have reported HLA a ssociations in early onset vs late onset vitiligo cases (ArcosBurgos et al., 2002; Orecchia et al., 1992; Finco et al., 1991). Classification of vitiligo patients by age of onset was therefore important to detect valid ge netic association with the LMP/TAP gene cluster. We detect ed no association be tween the LMP/TAP or MECL1 genes and late-onset vitiligo (data not shown). We interpret this association study in th e LMP/TAP region with caution, given the complications caused by a high occurrence of linkage disequilibrium in the region, for which there are variable and inconsistent re ports for markers spanning the entire region from DM and DPB, through the LMP/TAP cl uster, and extending to the DRB1, DQA1 and DQB1 genes (Djilali-Saiah et al., 1996; Va n Endert et al., 1992 Carrington et al., 1994). Similarly, after BonferroniÂ’s correc tion, significant disequilibrium values were observed among some but not all possible pa irwise LMP/TAP comparisons within the vitiligo patient and contro l populations (Table 3-3). The LMP/TAP gene cluster also

PAGE 78

65 features a well-characterized recombination hotspot within intron 2 of the TAP2 gene, and additional recombination hotspots ar e located throughout the human MHC locus (Cullen et al., 1997, 2002; Jefferys et al., 2000). Until functi onal data are found to confirm associations with autoimmune dis ease suggested by genetic studies, definitive conclusions about genetic association in th is region will remain controversial, as associations with autoimmune disease may be due to linkage disequilibrium with other genes in the MHC class II region. Although most autoimmune diseases have been linked to various genes within MHC class II regi on, it is important to note that to our knowledge, causative mutations in MHC class II regions have yet to be found to explain potential associations to disease pathology. It has been suggested that multiple MHC genes may be contributing to disease pathogene sis, and that statistical analyses may be averaging the effects of several genes to a centralized gene (Fu et al., 1998). Nevertheless, our data are c onsistent with genetic associ ation of the LMP/TAP region with vitiligo susceptibility

PAGE 79

66 CHAPTER 4 CATALASE Introduction Catalase is a homotetrameric, heme-containing, peroxisomal enzyme that catalyses the conversion of hydrogen peroxide (H2O2) to water and oxygen. Catalase is one of several redundant enzymes whos e main function is to prevent cell damage from highly reactive oxygen-derived free radicals. A re duction of catalase enzyme activity (EC 1.11.1.6) has been reported in the entire epidermis of vitiligo patients (Schallreuter et al., 1991, 1999). Defects in several enzymes involve d in melanin synthesis have also been observed in vitiligo patients, lending evid ence for the autotoxic theory of vitiligo pathogenesis. The sum of these enzymatic de fects result in the buildup and accumulation of H2O2 in the epidermis of vitiligo pati ents. High concentrations of H2O2 can result in the deactivation of catalase. It is ther efore unknown if the decreased concentration of catalase found in vitiligenous epidermis is a direct resu lt of the accumulation of H2O2 due to previously reported biochemical defects, or whether there is a separate problem with the catalase enzyme. Topical treatment of vitiligo patents with pseudocatalase, which mimics the activity catalase, promotes repi gmentation due to the apparent correction of some of the biochemical defects that cau sed the accumulation of hydrogen peroxide in the epidermis (Schallreuter et al., 2001). The observed catalase deficiency in vitiligo patient skin is the basis for treatment of vitiligo with pseudocatalase, a bis-manganese III-EDTA-(HCO3 )2 complex that can degrade H2O2 to O2 and H2O after UVB photoactivation, thus mimicking the action of

PAGE 80

67 endogenous catalase (Schallreuter et al., 1995, 1999a, 1999b). Pseudocatalase is applied topically to the entire ep idermis twice daily accompanie d by total body low dose narrowband UVB exposure 2-3 times per week. Clinic al results are very promising, with a halt in the progression of active vi tiligo in 95% of the patients treated, and repigmentation in 60-65% of treated patients i ndependent of disease duration. The biochemical effects of pseudocatalase also include a dr amatic decrease in epidermal H2O2 levels and restoration of the normal 6BH4 recycling process (Schallreuter et al., 1995, 1999b, 2001). In these experiments, case/control and fa mily based association studies, and gene sequencing were used to determine if the cau se of decreased patient epidermal catalase levels is due to a defect in the catalase gene itself. Results from these association studies revealed preliminary evidence for genetic association between the catalase gene and vitiligo susceptibility, which fu rther supports a role for dere gulation of the skin's ability to handle oxidative stress in the pat hogenesis of vitiligo (Casp et al., 2002). Materials and Methods Blood Collection and Processing Blood collection and processing, DNA extrac tion and genotyping were performed as described in chapter 2. Catalase Sequencing DNA preparation and PCR amplification Thirteen sets of PCR primers were designed within flanking catalase (CAT) gene introns to amplify individual exons (Table 4-1). In order to determine the maximum DNA pool size that would allow detection of rare mutations, DNA sample pools from vitili go patents were created with each pool having an incrementally increasing number of patients who had been genotyped for a

PAGE 81

68 Table 4-1. Catalase primers for sequencing across the geneCAT marker/Exon amplified Forward PrimerReverse Primer CATx1/exon 1TGAAGGATGCTGATAACCGCCATGAGCCCTCAATCTG CATx2/exon 2AAGTATTGACCAGCACAGCAACCTGAGGAAATAACCATC CATx3/exon 3CAGAAGGCTGGTGCTAACAACTTCCTATGTGTCTCC CATx4/ exon 4AGTTCTTGGAA GTGGATTAGTTTGCCATGTTGCCCAGG CATx5/exon 5GCTAGTTGTCTATG CTGAGCTTTACCTTACACTACAGAC CATx6/exon 6TCATTAAGGGACTTTCTGGATAATGAGATTGGGATACGC CATx7/exon 7GCAGTGTTACTCATAATCCTGTAAGCACTCATTCACAGC CATx8/exon 8ATTGAGTATGTGTATGTGGCGTGAATCCCACAAGGTAAC CATx9/exon 9GAAGTTTACAGCCCATTCCCAAGTAACATCTGAGGTGG CATx10/exon 10TAGCAGATGGCAGCGTTCGATACATCAGACAGTTGGG CATx11/exon 11AAAGTGAAGGACACA ACCCCAAACAGCTAAGGACGATG CATx12/exon 12ACTCTGAGGCTG GCATTGACAGTGGCAGGTAATGGC CATx13/ exon 13TTCACTGGCAA AACACATACAAGAGTCTGGTAGCAGTTTA

PAGE 82

69 known catalase polymorphism. This strate gy allowed for the visualization of an increased amplitude of the polymorphic SNP peak on the sequence chromatograph. This experiment proved that in a small pool (ten patients) it would be possible to observe a SNP or mutation present in only one of the ten patient s sequenced in that pool. Thirteen pools were then created with ten pa tients each, regardless of past catalase genotype. PCR was carried out in a 10L volume containing 10x PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2); 60 M of each dNTP, pooled patent and control genomic DNA, 2 pmol of each primer and 1.5 U Taq DNA polymerase. Samples were subjected to 35 cycles of 30 s at 94 C for denaturing, 30 s at optimum annealing temperature, and 30 s at 72C for extension. Direct sequencing of PCR products After PCR amplification, products (10 L ) were electrophoresed on a 2.0% agarose gel. Bands were excised from the gel and transferred into 1.5-mL Eppendorf tubes. DNA was eluted from the agarose gel using Quantum Prep Freeze and Squeeze DNA gel extraction spin columns (Bio-Rad). An aliquot of products (30 L) was then used directly for cycle sequencing using the ABI Prism BigDye terminator (Applied Biosystems) according to the manufacturerÂ’s instructi ons. The sequencing reactions were then precipitated in 3 vol. 100% ethanol and 0.1 vol 3 M sodium acetate, pH 5.2. The pellets were washed with 250 L of 70% ethanol, and spun down in a dye-terminator removal column (Qiagen), dried in a vacuum dryer and then dissolved in 20 L of template suppression buffer (Perkin Elmer). DNA seque ncing was carried out using an ABI 310 automated sequencer (Applied Biosystems).

PAGE 83

70 Results Catalase Gene Polymorphisms Three catalase gene single nucleotide pol ymorphisms (SNP) were genotyped in this study, two of which were found to be uninfor mative (Table 4-2). A T/C substitution in the CAT 5'-untranslated region, previously ch aracterized in Hungarian acatalasemic and hypocatalasemic subjects was genotyped by AFLP analysis (Goth et al., 1998). A Pst I (CTGCAG) RFLP was created by changing one nucleotide in the reverse PCR primer (Table 4-2). This polymorphism was found to be uninformative for our Caucasian patient and control populations, as near ly all subjects were homozygous for the T allele (data not shown). A T/C silent substitution in e xon 10 (Leu-419), genotyped by RFLP analysis using the restriction endonuclease Bst N I (CCWGG) was also shown to be uninformative. In this polymorphism, the T allele is cleaved by Bst N I; whereas, the C allele remains uncut. Nearly all subjects genotyped were homozygous for the T allele, which differs from the allele frequencies of 0.78 T and 0.22 C reported in the NCBI SNP database (data not shown). The informative CAT genetic marker was a T/C silent substitution in CAT exon 9 (Asp389), which was genotyped using RFLP analys is of amplified genomic fragments with the restriction endonuclease Bst X I (CCANNNNNNTGG) (Forsb erg et al., 1999). With this polymorphism, the T allele is cleaved by Bst X I, whereas the C allele remains uncut. We observed allele frequencies of 0.82 C a nd 0.18 T in our control population (Table 43), which were similar to those reported by Forsberg et al.(1999) for only 58 Caucasians (0.87 C and 0.13 T).

PAGE 84

71Table 4-2. Sequences of primers used for CAT genotypingPCR Primer Sequences (5 to 3 ) Polymorphism Restriction EnzymeForward PrimerReverse Primer Anneal Temp. NCBI SNP IDb T/C 5 UTR Pst ICAT-1GCCAATCAGAAGGCAGTCCCAT-2GCGTGCGGTTTGCTCTGCa 60 C rs1049982 T/C exon 9 Bst X ICAT-5GCCGCCTTTTTGCCTATCCTCAT-6TCCCGCCCATCTGCTCCAC 64 C rs769217 T/C exon 10 Bst N ICAT-7CCTAAGTGCATCTGGGTGG TCAT-8TACATCAGACAGTTGGGGCA 68 C rs704724aUnderlined nucleotide in primer CAT-2 was changed from the germline G to a C to create the Pst I RFLP. bNational Center for Biotechnology Information Single Nucleotide Polymorphism database: http://www.ncbi.nlm.nih.gov/SNP

PAGE 85

72 Association of the T/C Exon 9 ( Bst X I) CAT Marker with Vitiligo The observed allele and genotype frequencie s for the T/C SNP in exon 9 in control and patient populations are shown in Table 43. The allele frequencies for this CAT genetic marker did not differ significantly between the control and patient populations ( p =0.54). When the observed control and pa tient genotype frequencies were compared with expected values using a 3x2 contingency table in a standard 2-test (Table 4-3), they were found to be sign ificantly different ( p =0.0024), suggesting possibl e association of the T/C exon 9 ( Bst X I) CAT marker with vitiligo. The obs erved genotype frequencies of the control population did not significantly di ffer from those predicted by the HardyWeinberg equation ( p =0.26). However, the genotype fre quencies observed in the vitiligo patient group did not appear to be in Hardy-Weinberg equilibrium ( p =0.016), with an apparent excess of heterozygotes and defici ency of each homozygote class in the patient population. Comparison of individual allele carriage rates and the percentage of heterozygotes vs. homozygotes (Table 4-4) reve aled that the overall C allele carriage rate and the frequency of heterozygotes were signif icantly higher in patients than in control subjects. Family-Based Association Further suggestive evidence for genetic association between the CAT gene and vitiligo susceptibility was obtained using TDT, a family-based study design that considers heterozygous parents and evaluate s the frequency with which alleles are transmitted to affected offspring. A 2-test was used to evaluate the deviation of the rates of transmission and non-transmission of the C and T alleles of the T/C exon 9 ( Bst X I) CAT marker from the random expectation of 50:50. Forty-three informative

PAGE 86

73Table 4-3. Distribution of allele s and genotypes for the T/C SNP in CAT exon 9 in vitiligo patient and control populationsObserved allele frequencies Observed genotype counts (%)Expected genotype countsbNCTC/CC/TT/TC/CC/TT/T p value Controls1770.820.18122 (68.9)46 (26.0)9 (5.1)1195260.26 Patients2350.800.20144 (61.3)89 (37.9)2 (0.8)1517590.016 p value0.0024a a controls vs patients using the 2 test with 3 2 contingency table b observed vs expected according to Hardy-Weinberg equilibriumTable 4-4. Carriage rates and heterozygosity of the T/C SNP in CAT exon 9 in vitiligo patients compared to controls Heterozygotes vs homozygotes C carriage rate (%) T carriage rate (%) C/T (%)C/C + T/T (%) Controls94.931.126.074.0 Patients99.138.737.962.1 p value0.0083n.s.a0.011 Corrected pb0.0250.033a n.s., not significant b using BonferroniÂ’s correction

PAGE 87

74 (heterozygous) parents were identified among all of the patients and family members genotyped. The C allele was transmitted more frequently to affected offspring than expected as a result of random chance ( 2=3.93, p =0.047). Catalase Sequencing The catalase gene was sequenced across 13 exons using 12 pools of five patients each. Using this method, we were able to observe polymorphisms used in our genotyping study. Although several new single nucleot ide polymorphisms were identified none resulted in amino acid changes that could affect enzyme activity or exert an obvious effect on gene expression. No new interes ting SNPs were found in exon 9, where the T/C SNP was genotyped (Table 4-5). Discussion Both family based and case/control associa tion studies suggest a role for catalase, an enzyme responsible for the degradati on of hydrogen peroxide to water and oxygen, in vitiligo pathogenesis. Because catalase is one of many redundant antioxidant enzymes, the absence of catalase enzyme activity in blood and tissues predis poses patients to oral infections by peroxide-generating bacteria such as streptococci and pneumococci, but most forms of hypocatalasemia and acatalasemia are asymptomatic (Eaton et al., 1995). Vitiligo-like depigmentation is not a report ed phenotypic feature of acatalasemia or hypocatalasemia. However, a possible role fo r catalase in vitili go susceptibility was suggested by reports of low epidermal catalas e activity in both lesi onal and non-lesional skin of vitiligo patients, with c oncomitant increases in epidermal H2O2 (Schallreuter et al., 1991, 1999a, 1999b). Whereas epidermal levels of catalase were de creased in vitiligo patients, erythrocyte levels of catalase were reported to be comparable in 10 vitiligo

PAGE 88

75 Table 4-5. Catalase gene singl e nucleotide polymorphisms (SNPs). SNPPositionLocation A/T3653515 base pairs 5' of mRNA start site G/A364665' UTR G/A36303Intron 1 C/T36296Intron 1 T/C36238Intron 1 C/T26328Intron 1 T/C18934Intron 7 G/T6919Intron 11 T/G6915Intron 11

PAGE 89

76 patients and 20 control subjects s uggesting that the ca talase deficiency in vitiligo patients may be limited to the skin and otherwise asymptomatic (Maresca et al., 1997). The elevated levels of H2O2 observed in the epidermis of vitiligo patients, can depress catalase activity by irreversibly in activating the heme active site of catalase (Aronoff et al., 1965). As discussed in de tail by Schallreuter et al. (1999) several biochemical defects have been reported fo r vitiligo patients can contribute to the accumulation of epidermal H2O2, including defects in the de novo biosynthesis and/or recycling of the essential cofactor (6R)-L-erythro5,6,7,8-tetrahydrobiopterin (6BH4) (Schallreuter et al., 1994), increases in epidermal monoamine oxidase A (EC 1.4.3.4) activity (Schallreuter et al., 1996), and reduced glutat hione peroxidase (EC 1.11.1.9) activity (Beasley et al., 1999). The oxida tive burst associated with NADPH oxidase activities of inflammatory cells observed to infiltrate the peri-lesional skin of some patients with active vitiligo is another potential source of H2O2 in patient skin (Ortonne et al., 1993). Other possible mechanisms of catalase defi ciency in the skin of vitiligo patients include tissue-specific differences in gene expression or enzyme structure/function in patient melanocytes and/or keratinocytes Qualitative comparison of catalase mRNA levels in cultured melanocytes from lesional or non-lesional epidermi s of vitiligo patients or healthy controls showed no differe nces in expression between these groups (Schallreuter et al., 1999b). Genetic associat ion of the catalase gene with vitiligo susceptibility is suggested by both by case-co ntrol and family based association studies, suggesting that low catalase enzyme activity ma y be due to mutations within the catalase gene that influence catalase activ ity in skin cells. Our associ ation data suggest it is the

PAGE 90

77 heterozygote genotype for T/C SNP in CAT exon 9 that confers suscep tibility to vitiligo pathogenesis. A possible explanation for th is observation might be a dominant negative effect of another mutation(s) linked to the C allele, resulting in a quantitative deficiency of catalase enzyme activity. As observed for other multimeric proteins, mutations that interfere with subunit assembly, interaction and/or f unction can lead to assembly of mutant multimers that interfere with the function of the normal allele (Nussbaum et al., 2001). According to this model, such a CA T mutation in the heterozygous state would result in the expression of catalase enzyme tetramers with varying numbers of normal and mutant subunits. Assuming equal levels of protein expression from both alleles and depending on the nature of the CAT mutation( s), mixed molecules with possible reduced enzyme activity could represent up to 80% of the tetramers. Inte restingly, a quantitative deficiency in catalase has also recently be en suggested to play a role in diabetes pathogenesis, as Hungarian patients with a demonstrated catalase deficiency exhibited a higher frequency of diabetes than unaffect ed first-degree relatives and the general Hungarian population (Goth et al., 2000). No CAT genetic analyses or gene expression studies have been reported for diabetes thus far. Sequence analysis of the entire catalase coding region was completed to screen for the presence of any potential SNPs that may serve as functional mutations in the catalase gene. SNPs in exon 9 were of particular interest, however no f unctional SNPs/potential mutations were observed in the region. These results can be explained in several different ways. Firstly, the mutation may not be in the sequenced exonic regions, mutations in introns can affect splice sites, allowing for variation in translated proteins. SNPs we have found “uninteresti ng” could still cause variations in the tr anslated proteins,

PAGE 91

78 amino acid substitutions anywhere in the c oding region, even those that are conserved could impact protein secondary structure, which could potentially affect the binding of the two catalase subunits. Given the lack of association between acatalasemia and vitiligo, and the localized decrease in enzyme activity, it is possible th at the effects of CAT mutations contributing to vitiligo susceptibility may be tissue-specific, resulting in changes in gene expression or enzyme structure/function in patient melanoc ytes and/or keratinocytes. Such mutations might lead to a quantitative deficiency of catalase activity in the epidermis that is a contributing causative factor for the accumulation of H2O2, rather than simply a consequence of H2O2 accumulation from other sources. Overall, these results suggest that the catalase gene may be a susceptibility gene in some vitiligo patients, and further support the epidermal oxidative stress model for vitiligo pathogenesis. Further gene expression studies could help to define a causative role of th is enzyme in the etiology of vitiligo, and chapter 5 discusses our approach and results.

PAGE 92

79 CHAPTER 5 CANDIDATE VITILIGO SUSCEPTIBI LITY GENE EXPRESSION STUDIES Introduction Genetic association evidence points toward s a possible involvement of catalase and genes in the LMP/TAP region of the MHC cl ass II region with vitiligo pathogenesis. Gene expression and/or function studies are needed to provid e further evidence for a role of any of these genes in vitiligo pathogenesi s. As our genetic studies have revealed, vitiligo pathogenesis may include involve ment of both biochemical defects in melanogenesis as well as an inappropriate immune involvement. As a result of this finding, we have chosen to look at gene e xpression in antigen presenting cells, which serve as a bridge between in tracellular events and the imm une system. Because vitiligo is a dermatological disorder, the most appropria te cell for this study should be the dermal Langerhans cell. However, because this ce ll type is extremely difficult to isolate in numbers needed for expression study analysis, we have chosen to look at gene expression in monocytes isolated from peripheral blood. We are hypothesizing th at any defect seen in dermal APCs maybe seen in all other APCs as well. Changes in expression of mRNA from catal ase or any of the antigen processing genes would bolster evidence of that geneÂ’s involvement in vitiligo pathogenesis. Thus, gene expression studies were performed on catalase, as well as on genes involved in antigen processing and presentation, including MHC class I and the IFNinducible genes of the MHC class II region, TAP1, TAP2, LMP2 and LMP7. RNA expression studies of the LMP and TAP genes should reflect an IFNinducible upregulation of the

PAGE 93

80 message. MHC class I expression is also IFNinducible, and is easily observable by surface 2-microglobulin ( 2m) expression using flow cytometry. Catalase can be quantitated by measuring enzyme activity as well as through semiquantitative RT-PCR of catalase RNA. It is unknown if catalase expression is IFNinducible, however, we observed mRNA and catalase enzyme expressi on with and without the addition of IFN. Variability in expression of mRNA or the enzyme activity of any of these genes might implicate that gene further in the pathogenesis of vitiligo. Materials and Methods Monocyte Isolation and Culture PBMCs were obtained from whole blood from vitiligo patients who had contacted the research group after read ing about the study through a website set up at both the University of Florida and at the Nationa l Vitiligo Foundation. Vitiligo patients and controls donated 35 mL of blood on their first visit and 50 mL of blood on any subsequent visit. PBMCs used for isolating monocytes used in RNA assays were isolated by centrifugation (50 x g for 30 min at 25C) on Ficoll gradients, washed with 1x PBS, and resuspended in RPMI-1640 plus endotoxin-free 10% FCS. PBMCs were counted, and their viability was assess ed by trypan blue exclusion. Cells were plated at 1x107 cells per well in a 6-well plate. Ce lls were allowed to adhere to the plate for 2 hours, and then washed vigorously with 1xPBS to remove non-a dherent cells. Cells for flow cytometry and catalase enzyme activity assays were su bjected to a negative selection rosetting protocol to isolate purified monocytes us ing RosetteSep monocyte enrichment antibody cocktail (StemCell Technologies). After antibody treatment to whole blood, monocytes were isolated by centrifugation (500 x g for 20 minutes at 25C), washed with

PAGE 94

81 1xPBS+2% FBS, and RBCs were subjected to lysis using RBC lysis solution (139 mM ammonium chloride; 17 mM Tris-HCl, pH 7.65) Purified monocytes were then cultured in 5 mL polypropylene tubes (Falcon) at 2x106 cells per tube. All cells, both adherencepurified and rosetted, were plated in duplicat e, +/the addition of either 1000 U or 500 U human IFNand incubated 24 hours at 37 C in 5% CO2. Semi-Quantitative RT-PCR RNA was extracted from 6-well plates using RNAqueous-4PCR Kit protocol (Ambion), and purity of the RNA was assessed spectrophotometrically at 260 and 280 nm. LMP2, LMP7, TAP1 TAP2 and CAT RNA expression in monocytes cultured overnight was monitored using semi-quantitative RT-PCR using the RetroSCRIPT kit (Ambion). 250 ng of RNA from each sample were used to synthesize the first-stand complementary DNA (cDNA), using random decamer primers and M-MLV (Ambion). The primer sequences used to amplify cDNAs are shown in Table 5-1. Gene specific and 18S alternate primers/competimers (Ambi on) were used in this experiment. Competimers for 18S amplification chemically modify 18S primers, compete with the 18S primers and reduce the efficiency of the 18S amplif ication so that the 18S primers do not become limited. Five L aliquots of the RT reaction were used to amplify gene specific and 18S fragments, respectively, with 10X dNTP (2 L each dNTP, 92 L 10 mM Tris-HCl, pH 7.5), 10X PCR buffer ( 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2), 2.5 M gene-specific primers (forward and reverse) or 18S primers/competimers (8:2; 2 L) and 1.25 U Taq polymerase. Amplification of gene specific and 18S cDNAs was performed for 35 cycles, each cycle consisting of 1 min denaturation at 95C, 30 s annealing at 58C, and 30 s extension at 72C. cDNA was electrophoresed on a 2.0%

PAGE 95

82 Table 5-1. RT-PCR primer pairs and PCR conditions for LMP2, LMP7, TAP1, TAP2 and catalaseGenePCR Temperature C Forward PrimerReverse Primer CAT58AGTGGCCAACTACCAGCGTGATCCAGTGATGAGCGGGTTACA LMP258TTGTGATGGGTTCTGATT CCCGCAGAGCAATAGCGTCTGTGC LMP758TCGCCTTCAAGTTCCAGCATGGCCAACCATCTTCCTTCATGTGG TAP158CAGAATCTGTACCA GCCCCTGGCTGATGCATCCAGG TAP258TACCTGCTCATAAGGAGGGTGCATTGGGATATGCAAAGGAGACG

PAGE 96

83 agarose gel, and visualized using et hidium bromide staining and a 312 nm UVtransilluminator Flow Cytometry of 2-microglobulin Monocytes purified by rosetting were incubated in FACS buffer (1% RIA grade BSA, 0.1% sodium azide in 1x PBS, pH 7.4) with endot oxin-free lyophilized mouse serum (Sigma Chemical Co.) for 20 minutes Anti-CD14 PE (monocytes), FITC labeled isotype control, and FITC labeled anti2-microglobulin (MHC class I) antibodies were added to aliquots of cells and incubated for an additional 20 minutes. Cells were then fixed with 4% formaldehyde for 20 minutes. Fixed cells were washed twice in FACS buffer, and then resuspended in 200 L FACS buffer. Flow cytometric analysis was performed using a FACSscan or FACSCalibur flow cytometer (Becton Dickinson Immunocytometry Systems), collecting between 5,000 to 10,000 ungated events. Catalase Enzyme Assay One mL of whole blood was taken from each patient and control and immediately frozen at -70 C, to use as an erythrocyte control in the catalase enzyme activity assay. Monocytes purified by rosetting were pelleted and washed twice in 1x PBS. The cells were resuspended in 40 L of sample diluent (surfactan t in phosphate buffer) provided in the Catalase-520 kit (OxisResearch) and frozen at -70 C. Samples of whole blood and monocytes were thawed and the whole blood samples were diluted 1000-fold in sample diluent. 30 L of each sample were placed in a clean 1.5 mL tube, and 500 L substrate (10 mM H2O2) was added and incubated for exactly one minute. After 1 minute, 500 L of stop reagent (sodium azide) was added, a nd each tube was capped and inverted. 20 L of each reaction was added to cuvettes, and 2 mL of HRP/Chromogen reagent was added,

PAGE 97

84 and incubated for 10 minutes. In this assay, the rate of dismutation of hydrogen peroxide to water and molecular oxygen is proportional to catalase concentration. The sample is treated with a known quantity of H2O2, and then quenched with sodium azide. The amount of H2O2 remaining in the reaction mixture is determined through the oxidative coupling of 4-aminophenazone and 3,5-dichl oro-2-hydroxybenzenesulfonic acid in the presence of H2O2 and catalyzed by horseradish peroxida se. Absorbance is then read at 520 nm, and catalase concentration of each unknown was determined by fitting diluted standards to a second order polynomial regression. H2O2 Treatment of Monocytes Monocytes isolated by rose tting were exposed to 100 M H2O2 for 24 hours to simulate oxidative stress, and to determine catalase and 2-microglobulin expression in both vitiligo patients and controls. After 24 hours, cells were pelleted and washed twice with 1x PBS before the catalase assay, or flow cytometry for 2-microglobulin expression was performed. Results Catalase Assay Catalase enzyme concentrations were determined in whole blood and purified monocytes from 10 patients and 10 contro ls. Whole blood samples were frozen immediately after the blood draw, and purified monocytes were cultured for 24 hours +/500 U IFN. Catalase levels were determined us ing a colorimetric assay, which detects the degradation of H2O2 by endogenous catalase present in the sample, measured as absorbance at 520nm. Unknown sample concen trations were determined by applying the absorbance to a standard curve of known catalase sample concentrations. Catalase

PAGE 98

85 concentrations were found to be significantly lower in vitiligo patient monocytes ( p = 0.0252), as determined by StudentÂ’s t test (Fi gure 5-1). Concentrations did not seem to vary with or without the addition of 500 U IFNto the monocyte cultures. As seen in previous studies (Maresca et al., 1997), catalase concentrations did not vary significantly in erythrocytes of the same vitiligo patients and controls (Figure 5-2). These results show a decreased catalase enzyme le vel in vitiligo patients in m onocytes, which is not seen in patient whole blood. 2-Microglobulin Expression Flow cytometry was employed to determine expression of MHC class I on the surface of monocytes using 2-microglobulin as a marker. PE-labeled anti-CD14 antibodies were used to label monocytes. Pu rified monocytes were treated +/500 U IFNovernight. Because the percentage of cells expressing 2-microglobulin was not significantly different throughout patient and control populations, mean fluorescence (MF), or the amount of 2-microglobulin on the cell surface of each monocyte, was compared between patient and control populations. As expected, MHC class I expression, as measured by 2-microglobulin expression, was upregulated in response to IFNin both patient and control purified monocytes. 2-microglobulin expression was also shown to be significantly hi gher on control monocytes after IFNtreatment than in vitiligo patients ( p =0.0496 using a StudentÂ’s t test) (Figure 5-3). Expression of 2microglobulin on untreated monocytes also ap proached significance between the patient and control populations ( p =0.0512). This data suggest that vitiligo patients have a lower expression of MHC class I on their monocytes than normal controls. It is important to note that there is one control individual whose 2-microglobulin expression is much

PAGE 99

86 Figure 5-1. Monocyte catalase levels in patients and controls. Patient monocytes have significantly less catalase activity than controls after tr eatment with 500 U IFN( p = 0.0252 by StudentÂ’s t test). As terisks represen t significant differences in allele frequenc y between patient and controls.

PAGE 100

87 Figure 5-2. Erythrocyte cata lase levels in vitiligo pa tients and normal controls.

PAGE 101

88 Figure 5-3. 2-microglobulin expression on patient a nd control monocytes. There is a significant difference between patient and control 2microglobulin in monocytes treated with 500 U IFN( p =0.0496 StudentÂ’s t test). Asterisks represent significant differences in a llele frequency between patient and controls.

PAGE 102

89 higher than other pool drops the difference between 2-microglobulin on the surface of patients and control controls and patients sa mpled. Removal of this individual from the data removes the treated monocytes fr om significance. As variance in human populations can be expected, it can be conclu ded that there is a trend suggesting vitiligo patients may have lower class I expression on their monocytes. Further experiments with a larger sample size, however, need to be run to confirm these results. H2O2 Treatment Purified monocytes were treated ove rnight with or without 500 U IFNand with 100 M H2O2. We found dramatic reduction in the number of H2O2-treated monocytes by flow cytometry. This reduction in numbers of monocytes is most likely a result of the death of these cells due to H2O2 toxicity. Therefore it is di fficult to draw any conclusions from these cells due to the dr amatic reduction in cell number. The catalase enzyme assay was performed as described above on these cells. No significant difference was seen between patient and contro l cells treated with H2O2. Many of these patient and control samples did not have any catalase activity, mo st likely due to the large loss of monocytes as seen in the flow cytometry analysis. RNA Expression Studies Adherence-purified monocytes were treate d overnight with or without either 1000 U or 500 U IFN. RNA was harvested and used in RT-PCR to create cDNAs of several antigen processing and presentation gene s, LMP2, LMP7, TAP1, TAP2 and the antioxidant enzyme catalase. Genotypes of the patients used in the 500 U IFNexperiments, and their corres ponding catalase activities and 2-microglobulin expression on monocytes can be seen in Table 5-2. In the first set of expe riments, 1000 U of IFN-

PAGE 103

90 Table 5-2. Genotypes of pati ents treated with 500 U IFN, and used in mRNA, catalase and, 2-microglobulin expression studies with corresponding catalase enzyme activity and mean 2-microglobulin fluorescence.Patient NumberCAT 5/6Catalase enzyme activity U/mL TAP1 10/11LMP7 4/7 Mean 2microglobulin fluorescence 243-1CT36.9GGTT360.4 358-1CT50.8GGTG744.3 513-1CC4.9GGGG337.3 517-1CT16.3AGTG372.6 518-1CC10.1GGTG381.2 521-1CC85.1GGTG882.0 523-1CC85.5GGTG320.2 524-1CT0AAGG288.0 527-1CT29.7GGTT289.7 532-1CC1.0AGTT250.2 Allele percentages of these 10 patients 75% T 25% C 20% A 80% G 55%T 45%G Allele percentages of total patients 80% T 20% C 14.8% A 85.2% G 47.8%T 52.2%G

PAGE 104

91 was used to treat the monocytes. Messe nger RNA expression was evaluated for LMP2, LMP7, TAP1 and TAP2 using 10 patients a nd 8 controls. In these preliminary experiments the fold increase in RNA expression was determined after treatment with 1000 U of IFN. There were no significant cha nges in induction of mRNA by IFNfor LMP2, LMP7, TAP1 or TAP2 between the pa tient and control populations (Figure 5-4). In the second set of experiments 500 U of IFNwas used to stimulate the monocytes. 500 U was chosen to dete rmine whether a lower dose of IFNmight allow for more subtle differences in RNA expres sion between patients and controls to be uncovered. Messenger RNA expression was evaluated for LMP2, LMP7, TAP1, TAP2 and CAT using 10 patients and 10 controls. The amount of RNA extracted from the monocytes in this experiment was far lower th an in the first experiment. As with the expression studies done with 1000 U of IFN, those done with 500 U showed no difference in expression between vitiligo patien ts and controls (Figure 5-5). Likewise, no differences in expression of catalase mRNA were seen between patients and controls (Figure 5-6). This result demonstrates that the decreased expression of catalase enzyme seen in both monocytes and in the epidermis of vitiligo patients might be caused by a decrease in catalase enzyme function or pr otein expression rather than a decrease in mRNA expression. Discussion Gene expression studies were perf ormed on LMP2, LMP7, TAP1, TAP2, 2microglobulin, and catalase using a variety of techniques. Semi-quantitative RT-PCR found no differences in expression of any of the antigen processing and presentation genes and catalase between patients and contro ls. Enzyme expression studies of catalase

PAGE 105

92 Figure 5-4. Messenger RNA expression of LMP2, LMP7, TAP1 and TAP2 in patient and control monocytes after overnight treatment with 1000 U IFN.

PAGE 106

93 Figure 5-5. Messenger RNA expression of LMP2, LMP7, TAP1 and TAP2 in patient and control monocytes after overnight treatment with 500 U IFN.

PAGE 107

94 Figure 5-6. Catalase/18S RNA ratios with and without overnight treatment with 500U IFN.

PAGE 108

95 using vitiligo patients and controls whol e blood and monocytes showed no changes in catalase expression in whole blood, however catalase expression in monocytes from vitiligo patients is significantly reduced. This reduced expression of catalase does not appear to correlate with any genotype of the T/C SNP found in exon 9 of the catalase gene (Table 5-2). Flow cytometry using 2-microglobulin as a marker for MHC class I expression on the surface of patient and contro l monocytes revealed vitiligo patients may express a lower concentration of 2-microglobulin on the surface of their monocytes after IFNtreatment than normal controls. This decreased expression of 2-microglobulin was also not correlated with any particular genotype from either the G/T SNP in intron 6 of LMP7 or in the G/A SNP in exon 10 of TAP1 (Table 5-2). Our data shows vitiligo patients may express lower levels of 2-microglobulin on the surface of their monocytes than normal controls, suggesting a lower MHC class I expression. Results showed a signi ficantly decreased expression of 2-microglobulin on vitiligo patientsÂ’ monocytes after treatment with IFN, a trend that approached significance even without IFNtreatment. The removal of one control individual results in the loss of statistical significance. Due to this effect, it is only fair to say that there is a trend towards decreased 2-microglobulin expression in vi tiligo patients, a result that needs to be repeated with an increased patient and control population for confirmation. Decreased expression of MHC class I is of ten seen in tumor lines, and is thought to be a mechanism for the tumor cell to avoid detection by the hostÂ’s immune system (Chen et al., 1996; Cabrera et al., 2003; Miyagi et al., 2003). Concomitant decreases in LMP2, LMP7, and TAP1 have also been found in va rious tumor lines, and associated with poor prognosis (Cromme et al., 1994; Matsui et al., 2002; Dissemond et al., 2003). On the

PAGE 109

96 other end of the immunological spectra, th ere is evidence of hyper-expression of MHC class I molecules in other inflammatory autoimmune disorders such as IDDM and autoimmune thyroid disease, presumably due to the local increased expression of inflammatory cytokines such as IFN(Vives-Pi et al., 1997). It may seem counterintuitive that we obser ve decreased expression of 2-microglobulin on the surface of monocytes from vitiligo patients. However, decreased expression of class I has also been reported for other inflammatory autoim mune diseases such as diabetes (Faustman, et al., 1991), lupus erythematosus, SjgrenÂ’s syndrome, rheumatoid arthritis, GravesÂ’ diseases, HashimotoÂ’s thyroiditis, (Fu et al., 1998) and multiple sclerosis (Li et al., 1995a). Fu et al. (1998) argue that this decrease in MHC class I expression may contribute to autoimmunity, as T-cell av idity and selection may be determined by the affinity and density of complexes MHC class I:self peptide, and T-cell avidity is thought to be critical for both positive and negative T-cell selection Another possible explanation for this phe nomenon is described by Chan et al. in their study of lupus in the 2-microglobulin ( 2m)-deficient MRLFaslpr (MRL /lpr ) mouse. In these mice, lupus skin lesi ons are accelerated, whereas nephritis is ameliorated. The authors suggest that imm unoregulation differs in different organs, in this case between the skin and the kidneys. Because the skin, like other barrier sites, is designed to provide a rapid inflammatory re sponse against invaders, it might also be prone to inflammatory diseases such as l upus, atopic dermatitis, psoriasis, and vitiligo. Chan et al. suggest that th ese barrier sites may be arme d with specialized regulatory mechanisms to downregulate inflammation. In this case, the regulatory cell is a 2microglobulin dependent regulatory cell, whic h may operate in the skin, but not the

PAGE 110

97 kidneys of ( 2m)-deficient animals. This s uggests that skin has a natural proinflammatory tendency, presumably not found in the nonbarrier organs (i.e. kidney), and may be unopposed in the absence of 2-microglobulin. If this model is correct, it would make genetic analysis of autoimmune diseases much more complex, as genetic defects could confer pathogenes is seen only in particular target organs (Chan et al., 2001). Although many of the genes located in the MHC class II locus have been associated with autoimmune disease through ge netic studies, there have been far fewer studies showing altered expre ssion of either the message or the protein associated with autoimmunity. Several of these studies dem onstrate a deficiency of antigen processing and presentation genes. TAP1 and LMP2 ha ve been found to be associated with both autoimmunity and with a decreased surface expression of MHC class I. As mentioned previously, many tumor cell lines are deficien t in expression of LMP and TAP, as well as MHC class I (Cromme et al., 1994; Matsui et al., 2002; Dissemond et al., 2003). A recent report has demonstrated that tumor cells that do not express MHC class I were deficient in several proteasome s ubunits, including LMP2, MECL-1, PA28 and PA28 This suggests that impaired expression of these subunits might be involved in loss of MHC class I expression (Miyagi et al., 2003). Expression studies in the NOD mouse reveal ed decreased expression of TAP1 and LMP2 as a result of a mutation in its shared bidirectional promoter (Yan et al., 1997). In human lymphocytes, varying decreases in expression of mRNA for all 4 antigen processing and presentation genes we st udied, LMP2, LMP7, TAP1 and TAP2 were reported in patients with IDDM, SjgrenÂ’s syndrome, GravesÂ’ disease, and HashimotoÂ’s

PAGE 111

98 thyroiditis (Fu et al. 1998). Other studies have reported in creases in expression of TAP1 and LMP2 mRNA and protein in juvenile dermatomyositis and GraveÂ’s disease, respectively (Tezak et al., 2002; Kohn et al ., 2000). Increased TAP1 expression has been reported for islet cells and thyrocytes in pa tients with newly diagnosed type I diabetes and autoimmune thyroiditis (S ospedra et al., 1997; Vives-Pi et al., 1996; Hanafusa et al., 1983). LMP7 is also found to be hyperexpres sed on thyrocytes (Vives-Pi et al., 1997). Although we did not observe any alterations in mRNA expression in any of the genes we studied in the MHC class II region, we did observe a decrease in expression of MHC class I on the surface of monocytes of v itiligo patients. Preliminary Western blots performed on protein extracts from patient a nd control monocytes did not appear to show a difference in expression between LMP7 and TA P1 in patients and controls, however the sample size was far too low to draw any meaningful conclusions (data not shown). Theoretically there may be a defect in th e function of any of these proteins LMP2, LMP7, TAP1 or TAP2 that does not affect mRNA quantity or stability, as demonstrated by a recent study on monocytes exposed to tob acco extracts. In th is study, cells exposed to tobacco extracts in culture have reduced membrane HLA class I, as well as TAP1 protein expression (Fine et al., 2003). Th is reduction of TAP1 is found only at the protein level, with no concomitant decreas e in TAP1 mRNA levels. A decrease in protein expression/function of any of thes e genes in the MHC class II region could be what is driving genetic association with vi tiligo, and may also be contributing to the decreased expression of MHC class I seen on vi tiligo patients. It is also possible is a gene in the MHC class II region, other than th e LMP and TAP genes, is the gene that is responsible for conferring gene tic susceptibility to vitili go, as there are many genes in

PAGE 112

99 this region, some of which we do not yet know their function. Factoring in the high probability of linkage disequilibrium with other genes in the region, it is possible that the TAP and LMP genes are not major contributi ng factors in the pat hogenesis of vitiligo. Nevertheless, further studies on protein expression of these genes are needed to completely rule these genes out. Decreased concentrations of catalase al ong with increased concentrations of H2O2have been found in the epidermis of vitili go patients (Schallr euter et al., 1991, 1999a, 1999b). This decrease is not found systemicall y, as catalase levels in RBCs of vitiligo patients are not significantly di fferent than in controls (M aresca et al., 1997). A recent report looked at catalase concentrations in vitiligo patient PBMCs and reported a decreased catalase expression in these cells. This study also reiterated there were no differences in expression of catalase in RBCs of vitiligo patients versus controls (DellÂ’Anna et al., 2001). Our study looked at expression of active ca talase in purified vitiligo patient monocytes, and revealed a si gnificantly decreased expression of catalase in the monocytes of vitiligo patients. We observed no significant difference in the catalase activity of patient and control RBCs. We also looked at catalase mRNA expression in these same monocytes thr ough semi-quantitative RT-PCR. We found no significantly different expression of catalase mRNA in vitiligo patients compared with normal controls. Taken together these result s suggest that the decrease in vitiligo patient monocyte catalase enzyme activity is not a result of changes in mRNA expression or quantity. These results support those discovered by Schallreuter et al. (1999a) who found mRNA expression extracted from keratinocytes and melanocytes from both patients and controls

PAGE 113

100 did not show any differences in expression, wh ile catalase activity was decreased in the epidermis of vitiligo patients. The questi on remains as to whether the deficiency of catalase enzyme activity in vitiligo patient skin is due to defects in the catalase enzyme itself, or is due substr ate inhibition caused by a localized accumulation of H2O2 from other sources. Nevertheless, we have obs erved functional changes in catalase enzyme activity in circulating monocytes of vitiligo patients, which helps to support the genetic association found through our case/control and family-based analyses.

PAGE 114

101 CHAPTER 6 DISCUSSION: OXIDATIVE STRESS AND THE IMMUNE SYSTEM IN VITILIGO PATHOGENESIS This chapter discusses the interplay betw een the regulation of oxidative stress and the immune system in vitiligo pathogenesis, and in other autoimmune diseases. Vitiligo pathogenesis is likely an extremely comple x event involving both genetic susceptibility as well as environmental triggers. The tw o major theories of vitiligo pathogenesis include an autoimmune etiology for the dis ease and an autotoxicity in the melanocyte. There is ample evidence supporting a ro le for both autotoxic and autoimmune pathogenesis mechanisms in some patients. Although these two theories are often presented as mutually exclusiv e entities, it is likely that vitiligo pathogenesis may involve both autotoxic and autoimmune events, for wh ich there is variability within a patient population. Oxidative Stress Reactive oxygen species (ROS) are produc ed as byproducts of melanogenesis in melanocytes, and controlled in the epider mis by several redundant antioxidant enzymes such as catalase and glutathione peroxidase, both of which are decr eased in the epidermis of vitiligo patients (Schallr euter et al., 1999a). Oxidativ e stress plays a very important protective role in the imm une system, as phagocytic cells generate reactive oxygen intermediates such as O2 (superoxide), H2O2 (hydrogen peroxide), and NO (nitric oxide), which are toxic to many pathogens. While RO S are damaging to pathogens, they are also

PAGE 115

102 damaging to host cells as well. Current rese arch is beginning to demonstrate that ROS and oxidative stress may in fact play a critic al role in initiating and/or exacerbating the effects of autoimmunity. Our research has s hown genetic association of a gene(s) in the MHC class II region and the catal ase gene with vitiligo, as we ll as decreased expression of MHC class I and catalase activity in vitiligo patient m onocytes. Given the role of oxidative stress in both melanogenesis and in the immune system, we hypothesize that biochemical defects in the melanin biosynthe sis pathway, as well as possible defects in patient antioxidant enzymes, are responsible for the generation of reactive oxygen species in the epidermis of vitiligo patients. We s uggest that it may be the build-up of ROS along with possible immune system defects that allows for the inappropriate autoimmune response against normal melanocytes. Oxidative Stress and Inflammation There is a tenuous balance between helpfu l and harmful oxidative stress in the immune system. The phagocytes as part of the innate immune system are very important in providing the first line of defense agains t invading pathogens. Phagocytes such as macrophages ingest and destroy opsonized extracellular pat hogens, secrete proinflammatory cytokines, and generate a variety of ROS through a process known as a respiratory burst. Under ideal situations, th e ingestion of the ops onized pathogens and the secretion of toxic oxygen sp ecies by these phagocytic cells he lp to kill and/or contain the spread of these pathogens The secreted pro-inflammatory chemokines and cytokines attract cells of the ad aptive immune system to help ri d the host of the invading pathogen. Low levels of intracellular ROS can be beneficial, as they are able to activate transcription factors, such as NF B and AP-1, which are i nvolved in regulating the

PAGE 116

103 production of inflammatory mediator s, such as the cytokines TNFand IL-1, and a number of matrix metallopr oteinases (Dai et al., 2003). In autoimmune disorders the immune system inappropriate ly targets host cells for destruction, often creating a chronic or re mitting/relapsing inflammatory milieu. The effects of chronic inflammation can be de vastating on the host, eventually causing damage and/or destruction of the of the target organ. In this inflammatory environment, ROS can accumulate with a toxic effect on the surrounding cells. Buildup of ROS can cause direct damage to proteins, lipid pe roxidation and DNA base modification, leading to tissue damage (Dai et al., 2003). Current re search studies are begi nning to evaluate the role of these ROS in autoimmunity. In many cases it is unclear what is causing this aberrant inflammatory response in autoim munity, begging the question as to whether these ROS are a result of the chronic infl ammation and autoimmunity, or part of the cause of the autoimmune response. Reactive Oxygen Species and Autoimmunity Antioxidant Levels in Autoimmune Disease Antioxidant enzymes such as catalase, superoxide dismutase, glutathione and glutathione peroxidase usually control the buildup of reactive oxygen intermediates in the host. Although these antioxidants are often re dundant, decreases in any of these enzymes could leave the host at an increased risk for oxidative stress. Recent studies have begun to investigate the levels of these antioxidant enzymes in inflammatory autoimmune disorders such as IDDM, arthritis, SLE, multip le sclerosis, and vitiligo (Lortz et al., 2003; Gotia et al., 2001; Cimen et al., 2000; Taysi et al., 2002; Calabrese et al., 2002; Yildirim et al., 2003; Casp et al., 2002). Studies of islet cells in I DDM have shown that beta cells in general show very low activity levels of the antioxidant enzymes catalase, glutathione

PAGE 117

104 peroxidase, and superoxide dismutase. This weak antioxidative defense status leaves these cells with poor resistance against oxida tive stress (Lortz et al., 2003). Studies of antioxidant expression in islets of mice s how a 30-40% reduction of SOD from levels found in the liver of the animal, a 15% re duction of glutathione peroxidase and an undetectable level of catalase (Lenzen et al., 1996). Studies of SLE patient sera revealed elevated levels of superoxide dismutase activity, while the activ ities of glutathione peroxidase and catalase were lower in pa tients SLE compared with healthy controls (Taysi et al., 2002). Decreased levels of catalase were found in the blood of children with juvenile rheumatoid arth ritis (Gotia et al., 2001). A dult patients with rheumatoid arthritis (RA) were found to have increased levels of SOD and normal levels of both catalase and glutathione peroxidase (Cimen et al., 2000). In multiple sclerosis patients, a significant decrease in reduced glutathione and significant increases in oxidized glutathione were observed (Calabrese et al., 2002). Significantly increased levels of erythrocyte SOD, as well as a marked reduction of erythrocyte glutathione pero xidase and glutathione, were observed in patients with generalized vitiligo (Yildirim et al., 2003). Ca talase levels are reduc ed in the epidermis of vitiligo patients as well as in PBMCs (Schallreuter et al., 1991, 1999a, 1999b; DellÂ’Anna et al., 2001). We have also de monstrated a decreased expression of the catalase enzyme in monocytes of vitiligo patients (Chapter 5). Abnormal levels of antioxidants in these disorder s could leave these individua ls at a far higher risk of autotoxic damage to cells as a result of increased oxidative stress. The chronic inflammatory states of these diseases coul d potentially exacerba te the oxidative damage caused by the abnormal expression of these an tioxidant enzymes. It is unknown whether

PAGE 118

105 the decreased expression of these enzymes is a result of a genetic de fect or the result of the chronic inflammation and increased oxida tive stress in these autoimmune disorders. However, our genetic data suggests a genetic flaw in the catalase gene may be in part responsible for the decreased e xpression of the catalase enzyme seen in vitiligo patients. Transfection of Antioxidant Genes Decreased expression of any of these antio xidant genes could leave the host at an increased risk of oxidative stress. Reduced expression of these enzymes could also be a causative agent, or could exacerbate progres sion of autoimmune disease. In rheumatoid arthritis (RA), the generation of reactive oxyge n species within the inflamed joint has been suggested to play a significant pathologi c role. Given the pot ential role of ROS in RA, Dai et al. (2003) hypothesized that the transfer of anti oxidants into joints could suppress inflammatory processes in a rat m odel of antigen-induced arthritis (AIA). Ex vivo gene transfer of SOD and catalase produced about a sixto se ven-fold increase in SOD activity and a twoto three-fold increase in catalase activity compared with control animals. Furthermore, rats treated with cells over-expressing SOD, catalase or a combination of both enzymes showed signi ficant suppression of knee joint swelling, decreased infiltration of inflammatory cells within the synovial membrane, and reduced matrix metalloproteinase activity in knee joints. Transfection of antioxidant genes into is let cells may be a future direction in diabetes research. Because islet cells are naturally so low in antioxidant activity, transfection of antioxidant genes into islets may allow for these cells to better handle oxidative stress. Lortz et al. (2003) used insulin-produci ng RINm5F tissue culture cells and transfected them with SOD and catalase. Overexpression of the hydrogen peroxideinactivating enzyme catalase provided protecti on of insulin-producing cells in situations

PAGE 119

106 of increased hydrogen peroxide generation, and a combination of an overexpression of catalase and SOD caused an even greater protection of thes e cells against H2O2 damage. This concept of increasing antioxidant leve ls in islet cells th rough gene therapy to ameliorate oxidative damage is being i nvestigated in conjunction with islet cell transplantation. Because islet cells express such low levels of antioxidants, and because both islet isolation and transp lantation processes generate oxygen radicals, damage from oxidative stress may pose a major obstacle to is let replacement therapy. Islet grafts that overexpress SOD have been shown to func tion about 50% longer than control grafts (Bertera et al., 2003). Sim ilarly, in rat beta cell lines, adenoviralinduced overexpression of glutathione peroxidase enha nces the resistance of the cells to both ROS and reactive nitrogen species cytotoxicity (Moriscot et al., 2003). In the future, gene therapy with antioxidant genes may be therapeutic in contro lling beta cell autoimmunity in IDDM, and preventing further cell loss after transplantation. Antioxidants and Reactive O xygen Species in Autoimmunity New research has begun to reveal more evidence for the roles of decreased antioxidant levels and/or in creased ROS in autoimmunity and/or chronic inflammatory disorders. The production of new or alte red antigenic epitopes by ROS could provide a mechanism for the presentation of cryptic ep itopes to the immune system, allowing for a breach of peripheral immunity. Duthoit a nd coworkers (2001) observed that during in vitro thyroid-hormone synthe sis, hydrogen peroxide cleaves thyroglobulin (Tg) into peptides found to contain the immunodominant re gion of Tg that is recognized by anti-Tg autoantibodies from patients with autoimm une thyroid disorders. Although the normal synthesis of thyroid hormone produces locally high levels of H2O2, the addition of extra H2O2, and other ROS with local inflammation or immune response could be enough

PAGE 120

107 oxidative stress to inappropriately cleave Tg into peptides with cryptic epitopes that might allow for a breach in peripheral tolerance. Theoretically, as H2O2 levels rise both inside the thyrocyte as a result of hormone synt hesis, and external to the cell as a result of inflammation, so does the cleavage of Tg, allo wing for a buildup of th ese altered peptides inside the cell. High concentrations of H2O2 also could cause cell necrosis, allowing for a large-scale release of these cryptic ep itopes, prompting APCs in the surrounding inflammatory environment to phagocytize and present these cryptic peptides (Dulhoit et al., 2001). Modification of proteins by oxidative stre ss may also be involved in autoantibody production in type 1 diabetes. Trigwell et al. (2001) have demonstrated that oxidation reactions catalyzed by copper, iron or hyd rogen peroxide can alter glutamic acid decarboxylase (GAD) in the is lets of rats. Oxidativ e modification produced high molecular weight, covalently linked aggregat es containing GAD. Sera from patients with IDDM reacted with this modified GAD, whereas sera from normal controls did not. This study again implicates oxidative stress as a potential mechanism for target organ induction of autoimmunity. Antioxidants could also play a role in the induction of autoimmunity or chronic inflammation. Research studying patients w ith primary sclerosing cholangitis (PSC), a chronic cholestatic liver dis ease of unknown etiology, has rev ealed autoantibodies against catalase. These autoantibodies, found in 60 % of patients, could implicate the loss of catalase, and a role for oxidative stress in PSC pathology (Orth et al., 1998). Catalase autoantibodies have also been found in patien ts with inflammatory bowel disease (IBD) (Roozendaal et al., 1998).

PAGE 121

108 These studies delineate further a role for oxidative stress, and the importance of regulation of oxidative stress in the pathology of autoimmun ity. It is obvious that a delicate balance exists betw een generation and regulation of oxidative stress and the immune system. Disrupting this balan ce in any way might not only increase the complications of ROS toxicity, but may also leave the individual at a higher risk for the development of autoimmunity or ot her chronic inflammatory disorders. Antigen Processing, Oxidative Stress and Vitiligo Vitiligo and Oxidative Stress We believe that vitiligo pathogenesis is a multifactorial process, beginning with a dysregulation of oxidative stress, and e nding with an organ-specific autoimmune response in the epidermis. ROS are gene rated through the normal production of melanin in the melanocytes. Vitiligo patients have been shown to have an increased hydrogen peroxide concentration in their epidermis, for which there are many different possible sources. As reviewed by Schallreuter et al. (1999), defective de novo synthesis of 6BH4allows accumulation of 7BH4 which causes an inhibition of PAH resulting in a concomitant upregulation of H2O2. Vitiligo patients also have an increase in expression of epidermal monoamine oxidase A (M AO-A), which also contributes to H2O2. Patients also may have an age-dependent reduction in glutathione peroxida se activities, which also increase the H2O2 burden. Cellular immune infiltrates could potentially allow for even more H2O2 production through phagocytic generati on of ROS (Schallreuter et al., 1999b). Vitiligo and Catalase We have found a genetic susceptibility of the catalase gene with vitiligo. This susceptibility is seen with a SNP marker in exon 9 of the catalase gene. The heterozygote

PAGE 122

109 genotype is found more frequently in patien ts than in controls (Chapter 4). We hypothesize that such a heterozygous catalase gene mutation results in the expression of catalase enzyme tetramers with varying numbe rs of normal and mutant subunits, leading to decreased enzyme activity in the skin. It is possible that with this defect, enzyme activity could be decreased up to 80% (Casp et al., 2002). We have also observed a functional decrease in catalase enzyme ac tivity in monocytes from catalase patients, which is not mirrored in erythrocytes from these same patients (Chapter 5). A decrease in catalase RNA is also not observed in thes e cells. This decrease in catalase activity could be a result of either the hypothesized heterozygous mutation, or due to catalase inactivation by H2O2, or a combination of both. Neverthe less, an increase in ROS in the epidermis is the end result, causing to xicity to the surrounding melanocytes. Morphological changes in melanocyte r ough endoplasmic reticulum, as seen by electron microscopy, are suggestive of retenti on of peptides in the RER (Boissy et al., 1991; Im et al., 1994). Pigmentation is a multistep process critically dependent on the functional integrity of tyrosinase, the rate-limiting enzyme in melanin synthesis. If tyrosinase is damaged or misfolded it is of ten retained in the endoplasmic reticulum. These malformed proteins are ubiquitin-tagge d and targeted for degradation via the proteasome (Halaban et al., 2002). If oxida tive stress causes necr osis of these cells retaining misfolded tyrosinase, a large amount of the protein can then be released into the inflammatory microenvironment to potentially be picked up by APCs. It is also possible that ROS as seen with thyroglobulin and GAD, are modifying these retained proteins, allowing the presentation of cryptic epit opes by either APCs or by the melanocytes themselves, which have been shown to pha gocytize and present antigen themselves in

PAGE 123

110 times of stress through MHC class II (Le Po ole et al., 1993a; Le Poole et al., 1993b). Recruitment and involvement of other cells of the immune system can function to increase oxidative stress in the area due to respiratory bursts by phagocytes. Secretion of chemokines and cytokines into the local e nvironment can increase inflammation, and potentially target cells for fu rther destruction by necrosis a nd apoptosis. Dead and dying cells may accumulate in the epidermis, draw ing the attention of circulating monocytes. This may further permit an increased presenta tion of self-peptides to cells of the immune system. Vitiligo and MHC class II genes We have also demonstrated genetic associ ation of vitiligo with a gene(s) in the MHC class II region. Although RNA expre ssion studies revealed no changes in expression of either of the LMP or TAP genes (Chapter 5), there still may be a functional difference in the expression of these protei ns. It is tempting to hypothesize that a mutation in one of the LMP genes is allowing for the altered cleavage of a self-peptide, or that one of the TAP genes is allowing for the inappropriate trans port of a self-peptide across the endoplasmic reticulum. We ha ve discovered evidence for some type of immune system dysfunction in vitiligo patien ts, as we have found decreased levels of MHC class I on monocytes of vitiligo patients. Perhaps this defect allows for the escape of self-reactive T cells from the thymus during positive and negative selection. Regardless, the genetic association studies, as well as the decreased class I expression found in vitiligo patients points to some type of involvement of the immune system in vitiligo pathogenesis. This defect, accomp anied by concomitant increases in epidermal oxidative stress, may allow for the onset of vitiligo pathogenesis in susceptible individuals.

PAGE 124

111 Future Directions RNA analysis of both the MHC class II ge nes and catalase revealed no altered expression at the mRNA level (Chaper 5). Because MHC class II ge nes are very tightly linked, the gene that is truly conferring sus ceptibility to vitiligo may not be any of the genes used in our genotyping studies. Furthe r case/control studies could be performed on other genes in the region, especially as ne w sequence data is now available with the completion of the human genome project. Flow cytometry studies of 2-microglobulin expression need to be performed with an gr eater number of vitiligo patients to determine whether MHC class I expression is truly lo wer on patient monocytes. Further studies need to be performed to rule out variatio ns in protein expression of the MHC class II genes and catalase as playing a role in viti ligo pathogenesis. As patient samples were limited by IRB protocol, we were unable to perform Western analys is on these proteins of interest. Especially with catalase, pr otein expression studies may help answer the question of whether decreased enzyme expressi on is due to a defect in the catalase gene or due to inactivation of th e enzyme by hydrogen peroxide. Animal studies could be designed to furthe r elucidate the role of catalase in vitiligo. The Smyth line chicken (SL) is the most appropriate animal model of vitiligo pathogenesis. The development of vitiligo in SL chickens is believed to depend on two interacting components, an inherent melanocyt e defect as well as an autoimmune reaction to melanocytes, characterized by lymphocytic infiltration into the feather (Erf et al., 2001). Studies of catalase, other antioxidant enzymes, and hydrogen peroxide in feathers and monocytes of these animals might furt her implicate a role for oxidative stress in vitiligo pathogenesis. If catal ase were found to be deficient in these animals, transgenic

PAGE 125

112 SL chickens could be created to hyper-expre ss catalase to determin e if this phenotype would “rescue” these animals from vitiligo. To our knowledge, there have been no knockout catalase mice created, although several groups are in the process of desi gning such animals. Knockouts of other antioxidant enzymes such as MnSOD have been created, however, knocking out MnSOD in these animals is a fatal phenotype (Li et al., 1995). Because acat alasemia in humans is a mostly benign phenotype, it is unlikely that knocking out the catalase gene in mice would be a fatal disorder. Studies have s hown injecting mice with recombinant vaccinia virus encoding murine tyrosinase related protein-1 (TRP1), a melanocyte autoantibody often found in sera of vitiligo patients, cau ses spontaneous vitili go-like lesions in mice (Overwijk et al., 1999). Studies of r VV encoding mTRP1 in catalase-knockout mice, might reveal if the absence of catalase w ould serve to increase hypopigmentation in these animals. Likewise, performing these e xperiments in catalase-overproducing murine transgenics, which do currently exist, may de termine if increased catalase levels could rescue this phenotype. It would also be interesting to perform tran sfection assays of catalase into cell lines of vitiligo patient melanocytes, to see if catalase expression could be upregulated. If catalase enzyme expression can be upregulate d, and if upregulation of the enzyme means amelioration of vitiligo symptoms, as s uggested by the efficacy of the topical pseudocatalase cream, there may be a role in the future for gene therapy treatment of vitiligo patients with the catalase gene.

PAGE 126

113 LIST OF REFERENCES Abdel-Naser, M. B., W. D. Ludwig, H. Gollnick, and C. E. Orfanos. 1992. Nonsegmental vitiligo: decrease of the CD45RA+ T-cell subset and evidence for peripheral T-cell activation. Int. J. Dermatol. 31:321-326. al Badri, A. M., A. K. Foulis, P. M. Todd, J. J. Gariouch, J. E. Gudgeon, D. G. Stewart, J. A. Gracie, and R. B. Goudie. 1993. Abnormal expression of MHC class II and ICAM-1 by melanocytes in vitiligo. J. Pathol. 169:203-206. al Fouzan, A., M. al Arbash, F. Fouad, S. A. Kaaba, M. A. Mousa, and S. A. al Harbi. 1995. Study of HLA class I/IL and T lymphocyte subsets in Kuwaiti vitiligo patients. Eur. J. Immunogenet. 22:209-213. Alkhateeb, A., G. L. Stetler, W. Old, J. Talber t, C. Uhlhorn, M. Taylor, A. Fox, C. Miller, D. G. Dills, E. C. Ridgway, D. C. Bennett, P. R. Fain, and R. A. Spritz. 2002. Mapping of an autoimmunity susceptibili ty locus (AIS1) to chromosome 1p31.3p32.2. Hum. Mol. Genet. 11:661-667. Arcos-Burgos, M., E. Parodi, M. Salgar, E. Bedoya, J. Builes, D. Jaramillo, G. Ceballos, A. Uribe, N. Rivera, D. Rivera, I. Fonseca, M. Camargo, and G. Palacio. 2002. Vitiligo: complex segregation and linkage disequilibrium analyses with respect to microsatellite loci spanning the HLA. Hum. Genet. 110:334-342. Aronoff, S. 1965. Catalase: kinetics of photooxidation. Science 150:72-73. Badri, A. M., P. M. Todd, J. J. Garioch, J. E. Gudgeon, D. G. Stewart, and R. B. Goudie. 1993. An immunohistological study of cu taneous lymphocytes in vitiligo. J. Pathol. 170:149-155. Beazley, W. D., D. Gaze, A. Panske, E. Panzig, and K. U. Schallreuter. 1999. Serum selenium levels and blood glutathione peroxidase activ ities in vitiligo. Br. J. Dermatol. 141:301-303. Bertera, S., M. L. Crawford, A. M. Alexande r, G. D. Papworth, S. C. Watkins, P. D. Robbins, and M. Trucco. 2003. Gene transfer of manganese superoxide dismutase extends islet graft function in a m ouse model of autoimmune diabetes. Diabetes 52:387-393. Bhatia, P. S., L. Mohan, O. N. Pandey, K. K. Singh, S. K. Arora, and R. D. Mukhija. 1992. Genetic nature of vitiligo. J. Dermatol. Sci. 4:180-184.

PAGE 127

114 Bochtler, M., L. Ditzel, M. Groll, C. Hartmann, and R. Huber. 1999. The proteasome. Annu. Rev. Biophys. Biomol. Struct. 28:295-317. Boissy, R. E., Y. Y. Liu, E. E. Medrano, and J. J. Nordlund. 1991. Structural aberration of the rough endoplasmic reticulum a nd melanosome compartmentalization in long-term cultures of melanocytes from vitiligo patients. J. Invest. Dermatol. 97:395-404. Bos, J. D. 1997. Skin Immune System 2nd edn CRC Press, Boca Raton. Bronte, V., E. Apolloni, R. Ronca, P. Zam boni, W. W. Overwijk, D. R. Surman, N. P. Restifo, and P. Zanovello. 2000. Genetic vaccin ation with "self" tyrosinase-related protein 2 causes melanoma eradication but not vitiligo. Cancer Res. 60:253-258. Brooks, P., G. Fuertes, R. Z. Murray, S. Bose, E. Knecht, M. C. Rechsteiner, K. B. Hendil, K. Tanaka, J. Dyson, and J. Rivett. 2000. Subcellu lar localization of proteasomes and their regulatory complexes in mammalian cells. Biochem. J 346 Pt 1:155-161. Buc, M., B. Busova, E. Hegyi, and K. Kolibasova. 1996. Vitiligo is associated with HLAA2 and HLA-Dw7 in the Slovak populations. Folia Biol.(Praha) 42:23-25. Cabrera, C. M., P. Jimenez, T. Cabrera, C. Esparza, F. Ruiz-Cabello, and F. Garrido. 2003. Total loss of MHC class I in colore ctal tumors can be explained by two molecular pathways: beta2-microglobulin in activation in MSI-positive tumors and LMP7/TAP2 downregulation in MSI-negative tumors. Tissue Antigens 61:211-219. Caixia, T., F. Hongwen, and L. Xiran. 1999. Leve ls of soluble interl eukin-2 receptor in the sera and skin tissue flui ds of patients with vitiligo. J. Dermatol. Sci. 21:59-62. Calabrese, V., G. Scapagnini, A. Ravagna, R. Bella, R. Foresti, T. E. Bates, A. M. Giuffrida Stella, and G. Pennisi. 2002. Nitr ic oxide synthase is present in the cerebrospinal fluid of patients with activ e multiple sclerosis and is associated with increases in cerebrospinal fluid protein nitrotyrosine and S-nitrosothiols and with changes in glutathione levels. J. Neurosci. Res. 70:580-587. Campbell, J. J., G. Haraldsen, J. Pan, J. Rottman, S. Qin, P. Ponath, D. P. Andrew, R. Warnke, N. Ruffing, N. Kassam, L. Wu, and E. C. Butcher. 1999. The chemokine receptor CCR4 in vascular recognition by cu taneous but not intestinal memory T cells. Nature 400:776-780. Carrington, M., J. C. Stephens, W. Klitz, A. B. Begovich, H. A. Erlich, and D. Mann. 1994. Major histocompatibility comple x class II haplotypes and linkage disequilibrium values observed in the CEPH families. Hum. Immunol. 41:234-240. Casp, C. B., J. X. She, and W. T. McCo rmack. 2002. Genetic association of the catalase gene (CAT) with vitiligo susceptibility. Pigment Cell Res. 15:62-66.

PAGE 128

115 Casp, C. B., J. X. She, and W. T. McCo rmack. 2003 Genes of the LMP/TAP cluster are associated with the human autoimmune disease vitiligo. Genes Immun. 4:492-499. Chan, O. T., V. Paliwal, J. M. McNiff, S. H. Park, A. Bendelac, and M. J. Shlomchik. 2001. Deficiency in beta(2)-microglobuli n, but not CD1, accelerates spontaneous lupus skin disease while inhibiting nephrit is in MRL-Fas(lpr) nice: an example of disease regulation at the organ level. J. Immunol. 167:2985-2990. Chang, J. T., B. M. Segal, and E. M. Shevach. 2000. Role of costimulation in the induction of the IL-12/IL-12 receptor pathway and the development of autoimmunity. J. Immunol. 164:100-106. Chen, H. L., D. Gabrilovich, A. Virmani, I. Ratnani, K. R. Girgis, S. Nadaf-Rahrov, M. Fernandez-Vina, and D. P. Carbone. 1996. Structural and functional analysis of beta2 microglobulin abnormalities in human lung and breast cancer. Int. J. Cancer 67:756-763. Cimen, M. Y., O. B. Cimen, M. Kacmaz, H. S. Ozturk, R. Yorgancioglu, and I. Durak. 2000. Oxidant/antioxidant status of the eryt hrocytes from patients with rheumatoid arthritis. Clin. Rheumatol. 19:275-277. Cominelli, F., C. C. Nast, A. Duchini, and M. Lee. 1992. Recombinant interleukin-1 receptor antagonist blocks the proinflamm atory activity of endogenous interleukin1 in rabbit immune colitis. Gastroenterology 103:65-71. Cromme, F. V., J. Airey, M. T. Heemels, H. L. Ploegh, P. J. Keating, P. L. Stern, C. J. Meijer, and J. M. Walboomers. 1994. Loss of transporter protein, encoded by the TAP-1 gene, is highly correlated wi th loss of HLA expression in cervical carcinomas. J. Exp. Med. 179:335-340. Cui, J., Y. Arita, and J. C. Bystryn. 1993. Cyto lytic antibodies to melanocytes in vitiligo. J. Invest. Dermatol. 100:812-815. Cullen, M., J. Noble, H. Erlich, K. Thorpe, S. Beck, W. Klitz, J. Trowsdale, and M. Carrington. 1997. Characterization of recomb ination in the HLA class II region. Am. J. Hum. Genet. 60:397-407. Cullen, M., S. P. Perfetto, W. Klitz, G. Nelson, and M. Carrington. 2002. High-resolution patterns of meiotic recombination across the human major histocompatibility complex. Am. J. Hum. Genet. 71:759-776. Dai, L., A. Claxson, S. L. Marklund, R. Feakins, N. Yousaf, Y. Chernajovsky, and P. G. Winyard. 2003. Amelioration of antigen-indu ced arthritis in rats by transfer of extracellular superoxide di smutase and catalase genes. Gene Ther. 10:550-558. Daniel S., S.Caillat-Zucman, J.Hammer, J. F. Bach, and P.M. van Endert. 1997. Absence of functional relevance of human transpor ter associated with antigen processing polymorphism for peptide selection. J. Immunol 159: 2350-2357.

PAGE 129

116 Davoodi-Semiromi, A., J. J. Yang, and J. X. She. 2002. IL-12p40 is associated with type 1 diabetes in Caucasian-American families. Diabetes 51:2334-2336. Dell'Anna, M. L., V. Maresca, S. Briganti, E. Camera, M. Falchi, and M. Picardo. 2001. Mitochondrial impairment in peripheral blood mononuclear cells during the active phase of vitiligo. J. Invest. Dermatol. 117:908-913. Deng, G. Y., A. Muir, N. K. Maclaren, and J. X. She. 1995. Association of LMP2 and LMP7 genes within the major histocompa tibility complex with insulin-dependent diabetes mellitus: population and family studies. Am. J. Hum. Genet. 56:528-534. di Giovine, F. S., E. Takhsh, A. I. Bl akemore, and G. W. Duff. 1992. Single base polymorphism at -511 in the human interleukin-1 beta gene (IL1 beta). Hum. Mol. Genet. 1:450. Dissemond, J., P. Goette, J. Moers, A. Linde ke, M. Goos, S. Ferrone, and S. N. Wagner. 2003. Immunoproteasome subunits LMP2 and LMP7 downregulation in primary malignant melanoma lesions: association with lack of spontaneous regression. Melanoma Res. 13:371-377. Djilali-Saiah, I., S. Caillat-Zucman, J. Schmitz, M. L. Chaves-Vieira, and J. F. Bach. 1994. Polymorphism of antigen processing (TAP, LMP) and HLA class II genes in celiac disease. Hum. Immunol. 40:8-16. Djilali-Saiah, I., V. Benini, S. Daniel, R. Assan, J. F. Bach, and S. Caillat-Zucman. 1996. Linkage disequilibrium between HLA class II (DR, DQ, DP) and antigen processing (LMP, TAP, DM) genes of the major histocompatibility complex. Tissue Antigens 48:87-92. Driscoll, J., M. G. Brown, D. Finley, and J. J. Monaco. 1993. MHC-linked LMP gene products specifically alter peptidas e activities of the proteasome. Nature 365:262264. Duthoit, C., V. Estienne, A. Giraud, J. M. Durand-Gorde, A. K. Rasmussen, U. FeldtRasmussen, P. Carayon, and J. Ruf. 2001. Hydrogen peroxide-induced production of a 40 kDa immunoreactive thyroglobulin fragment in human thyroid cells: the onset of thyroid autoimmunity? Biochem. J. 360:557-562. Eaton J.W.and Ma M. 1995. Acatalasemia. In The Metabolic Bases of Inherited Disease Scriver C.R., ed. McGraw-Hill, New York, pp. 2371-2380. Einarsdottir, E., I. Soderstrom, A. Lofgre n-Burstrom, S. Haraldsson, S. Nilsson-Ardnor, C. Penha-Goncalves, L. Lind, G. Holmgren, M. Holmberg, K. Asplund, and D. Holmberg. 2003. The CTLA4 region as a gene ral autoimmunity factor: an extended pedigree provides evidence for synergy with the HLA locus in the etiology of type 1 diabetes mellitus, Hashimoto's thyroiditis and Graves' disease. Eur. J. Hum. Genet. 11:81-84.

PAGE 130

117 Eizirik, D. L., D. E. Tracey, K. Bendtzen, a nd S. Sandler. 1991. An interleukin-1 receptor antagonist protein protects in sulin-producing beta cells ag ainst suppressive effects of interleukin-1 beta. Diabetologia 34:445-448. Erf, G. F., T. K. Bersi, X. Wang, G. P. Sreekumar, and J. R. Smyth, Jr. 2001. Herpesvirus connection in the expression of autoimmune vitiligo in Smyth line chickens. Pigment Cell Res. 14:40-46. Faustman, D., X. P. Li, H. Y. Lin, Y. E. Fu, G. Eisenbarth, J. Avruch, and J. Guo. 1991. Linkage of faulty major histocompatibility complex class I to autoimmune diabetes. Science 254:1756-1761. Finco, O., M. Cuccia, M. Martinetti, G. Ruberto, G. Orecchia, and G. Rabbiosi. 1991. Age of onset in vitiligo: rela tionship with HLA supratypes. Clin. Genet. 39:48-54. Fine, C. I., C. D. Han, X. Sun, Y. Liu, and J. A. McCutcheon. 2002. Tobacco reduces membrane HLA class I that is restored by transfection with tr ansporter associated with antigen processing 1 cDNA. J. Immunol. 169:6012-6019. Foley, L. M., N. J. Lowe, E. Misheloff, a nd J. L. Tiwari. 1983. Association of HLA-DR4 with vitiligo. J. Am. Acad. Dermatol. 8:39-40. Forsberg, L., U. de Faire, and R. Morg enstern. 1999. Low yield of polymorphisms from EST blast searching: analysis of genes re lated to oxidative stress and verification of the P197L polymorphism in GPX1. Hum. Mutat. 13:294-300. Fraile, A., A. Nieto, J. Vinasco, Y. Beraun, J. Martin, and L. Mataran. 1998. Association of large molecular weight proteasome 7 gene polymorphism with ankylosing spondylitis. Arthritis Rheum. 41:560-562. Friedmann A. 1999. HLA and Dermatological Diseases. In: HLA in Health and Disease Lechler R.and Warrens A., ed. Academic Press, San Diego, pp. 365-386. Fruh, K. and Y. Yang. 1999. Antigen presenta tion by MHC class I and its regulation by interferon gamma. Curr. Opin. Immunol. 11:76-81. Fu, Y., D. M. Nathan, F. Li, X. Li, and D. L. Faustman. 1993. Defective major histocompatibility complex class I expre ssion on lymphoid cells in autoimmunity. J Clin Invest 91:2301-2307. Fu, Y., G. Yan, L. Shi, and D. Faustman. 1998. Antigen processing and autoimmunity. Evaluation of mRNA abundance and function of HLA-linked genes. Ann. N. Y. Acad. Sci. 842:138-155. Fuhlbrigge, R. C., J. D. Kieffer, D. Armerding, and T. S. Kupper. 1997. Cutaneous lymphocyte antigen is a specialized form of PSGL-1 expressed on skin-homing T cells. Nature 389:978-981.

PAGE 131

118 Goth, L. 1998. Genetic heterogeneity of the 5' uncoding region of the catalase gene in Hungarian acatalasemic and hypocatalasemic subjects. Clin. Chim. Acta 271:73-78. Goth, L. and J. W. Eaton. 2000. Hereditary ca talase deficiencies and increased risk of diabetes. Lancet 356:1820-1821. Gotia, S., I. Popovici, and B. Hermeziu. 2001. Antioxidant enzymes levels in children with juvenile rheumatoid arthritis. Rev. Med. Chir. Soc. Med. Nat. Iasi 105:499503. Griffiths, A.J.F., J. H. Miller, D.T. Suzuki, R.C. Lewontin, and W.M. Gelbart. 1999. Introduction to Genetic Analysis. 7th edn. W.H. Freeman and Company, New York. Groettrup, M., S. Khan, K. Schwarz, and G. Schmidtke. 2001. Interferon-gamma inducible exchanges of 20S protea some active site subunits: why? Biochimie 83:367-372. Halaban, R., S. Svedine, E. Cheng, Y. Smicun, R. Aron, and D. N. Hebert. 2000. Endoplasmic reticulum retention is a comm on defect associated with tyrosinasenegative albinism. Proc. Natl. Acad. Sci. U.S.A 97:5889-5894. Hanafusa, T., R. Pujol-Borrell, L. Chiova to, R. C. Russell, D. Doniach, and G. F. Bottazzo. 1983. Aberrant expression of HLADR antigen on thyrocytes in Graves' disease: relevance for autoimmunity. Lancet 2:1111-1115. Hann, S. K., Y. K. Park, K. G. Lee, E. H. Choi, and S. Im. 1992. Epidermal changes in active vitiligo. J. Dermatol. 19:217-222. Harding C.V.1997. MHC Molecules and Antigen Processing R.G. Landes Company, Austin. Hayney MS, G.A. Poland, P. Dimanlig, D.J. Schaid, R.M. Jacobson, and J.J. Lipsky. 1997. Polymorphisms of the TAP2 gene may influence antibody response to live measles vaccine virus. Vaccine 15: 3-6. Honda, Y., Y. Okubo, and M. Koga. 1997. Relationship between levels of solubleinterleukin-2 receptors and the types and activity of vitiligo. J. Dermatol. 24:561-563. Im, S., S. K. Hann, H. I. Kim, N. S. Kim, and Y. K. Park. 1994. Biologic characteristics of cultured human vitiligo melanocytes. Int. J. Dermatol. 33:556-562. Jeffreys, A. J., A. Ritchie, and R. Neum ann. 2000. High resolution analysis of haplotype diversity and meiotic crossover in th e human TAP2 recombination hotspot. Hum. Mol. Genet. 9:725-733.

PAGE 132

119 Kantarci, O. H., D. D. Hebrink, S. J. Ac henbach, E. J. Atkinson, A. Waliszewska, G. Buckle, C. T. McMurray, M. de Andrade, D. A. Hafler, and B. G. Weinshenker. 2003. CTLA4 is associated with suscep tibility to multiple sclerosis. J. Neuroimmunol. 134:133-141. Kao, C. H. and H. S. Yu. 1990. Depleti on and repopulation of Langerhans cells in nonsegmental type vitiligo. J. Dermatol. 17:287-296. Kemp, E. H., R. A. Ajjan, E. A. Waterman, D. J. Gawkrodger, M. J. Cork, P. F. Watson, and A. P. Weetman. 1999. Analysis of a microsatellite polymorphism of the cytotoxic T-lymphocyte antigen-4 gene in patients with vitiligo. Br. J. Dermatol. 140:73-78. Kemp, E. H., E. A. Waterman, B. E. Hawes, K. O'Neill, R. V. S. R. Gottumukkala, D. J. Gawkrodger, A. P. Weetman, and P. F. Watson. 2002. The melanin-concentrating hormone receptor 1, a novel target of autoantibody responses in vitiligo. J. Clin. Invest. 109:923-930. Kohn, L. D., G. Napolitano, D. S. Singer, M. Molteni, R. Scorza, N. Shimojo, Y. Kohno, E. Mozes, M. Nakazato, L. Ulianich, H. K. Chung, H. Matoba, B. Saunier, K. Suzuki, F. Schuppert, and M. Saji. 2000. Graves' disease: a host defense mechanism gone awry. Int. Rev. Immunol. 19:633-664. Kristensen D.L. The genetics of human vitili go susceptibility; a cas e/control association study of tyrosine metabolism and immune response candidate genes. 2000. Masters Thesis, University of Florida. Kumagai, S., S. Kanagawa, A. Morinobu, M. Ta kada, K. Nakamura, S. Sugai, E. Maruya, and H. Saji. 1997. Association of a new allele of the TAP2 gene, TAP2*Bky2 (Val577), with susceptibility to Sjogren's syndrome. Arthritis Rheum. 40:16851692. Kwon, J. M. and A. M. Goate. 2000. The candidate gene approach. Alcohol Res. Health 24:164-168. Lamoreaux L. and Boissy R.E.. 2000. PUVA therapy. In: Vitiligo Hann S.K.and Nordlund J.J., ed. Blackwell Science, Oxford, pp. 281-297. Le Poole, I. C., R. M. van den Wijngaard, W. Westerhof, R. P. Dutrieux, and P. K. Das. 1993a. Presence or absence of melanocytes in vitiligo lesions: an immunohistochemical investigation. J. Invest. Dermatol. 100:816-822. Le Poole, I. C., P. K. Das, R. M. van den Wijngaard, J. D. Bos, and W. Westerhof. 1993b. Review of the etiopathomechanism of vitiligo: a convergence theory. Exp. Dermatol. 2:145-153.

PAGE 133

120 Le Poole, I. C., R. M. van den Wijngaar d, W. Westerhof, and P. K. Das. 1996. Presence of T cells and macrophages in inflammato ry vitiligo skin parallels melanocyte disappearance. Am. J. Pathol. 148:1219-1228. Le Poole, I. C., R. E. Boissy, R. Sarangarajan, J. Chen, J. J. Forristal, P. Sheth, W. Westerhof, G. Babcock, P. K. Das, and C. B. Saelinger. 2000. PIG3V, an immortalized human vitiligo melanocyte ce ll line, expresses dilated endoplasmic reticulum. In Vitro Cell Dev. Biol. Anim. 36:309-319. Lenzen, S., J. Drinkgern, and M. Tiedge. 1996. Low antioxidant enzyme gene expression in pancreatic islets compared with various other mouse tissues. Free Radic. Biol. Med. 20:463-466. Li, F., M. J. Linan, M. C. Stein, and D. L. Faustman. 1995. Reduced expression of peptide-loaded HLA class I molecules on multiple sclerosis lymphocytes. Ann. Neurol. 38:147-154. Li, Y., T. T. Huang, E. J. Carlson, S. Melov, P. C. Ursell, J. L. Olson, L. J. Noble, M. P. Yoshimura, C. Berger, P. H. Chan, and 1995. Dilated cardiomyopathy and neonatal lethality in mutant mice lack ing manganese superoxide dismutase. Nat. Genet. 11:376-381. Lortz, S. and M. Tiedge. 2003. Sequential inactivation of reac tive oxygen species by combined overexpression of SOD isoforms and catalase in in sulin-producing cells. Free Radic. Biol. Med. 34:683-688. Majumder, P. P., J. J. Nordlund, and S. K. Nath. 1993. Pattern of familial aggregation of vitiligo. Arch. Dermatol. 129:994-998. Maksymowych, W. P., T. Ikawa, A. Yamaguchi M. Ikeda, D. McDonald, L. Laouar, R. Lahesmaa, N. Tamura, A. Khuong, D. T. Yu, and K. P. Kane. 1998. Invasion by Salmonella typhimurium induces increased expression of the LMP, MECL, and PA28 proteasome genes and changes in the peptide repertoire of HLA-B27. Infect. Immun. 66:4624-4632. Maresca, V., M. Roccella, F. Roccella, E. Camera, G. Del Porto, S. Passi, P. Grammatico, and M. Picardo. 1997. Increased sensitivity to peroxidative agents as a possible pathogenic factor of melanocyte damage in vitiligo. J. Invest Dermatol. 109:310-313. Marron, M. P., L. J. Raffel, H. J. Garchon, C. O. Jacob, M. Serrano-Rios, M. T. Martinez Larrad, W. P. Teng, Y. Park, Z. X. Zh ang, D. R. Goldstein, Y. W. Tao, G. Beaurain, J. F. Bach, H. S. Huang, D. F. Luo, A. Zeidler, J. I. Rotter, M. C. Yang, T. Modilevsky, N. K. Maclaren, and J. X. She. 1997. Insulin-dependent diabetes mellitus (IDDM) is associated with CTLA4 polymorphisms in multiple ethnic groups. Hum. Mol. Genet. 6:1275-1282.

PAGE 134

121 Matsui, M., S. Machida, T. Itani-Yohda, and T. Akatsuka. 2002. Downregulation of the proteasome subunits, transporter, and an tigen presentation in hepatocellular carcinoma, and their restoration by interferon-gamma. J. Gastroenterol. Hepatol. 17:897-907. McClelland, P. B., P. Morgan, E. E. Leach, and J. Shelk. 1997. Psoralen photochemotherapy. Dermatol. Nurs. 9:403-415. McNeely, W. and K. L. Goa. 1998. 5-Met hoxypsoralen. A review of its effects in psoriasis and vitiligo. Drugs 56:667-690. Mishto M., M. Bonafe,S. Salvioli, F.Oliv ieri, and C. Franceschi. 2002. Age dependent impact of LMP polymorphisms on TNF -induced apoptosis in human peripheral blood mononuclear cells. Exp. Gerontol. 37:301-308. Miyagi, T., T. Tatsumi, T. Takehara, T. Ka nto, N. Kuzushita, Y. Sugimoto, M. Jinushi, A. Kasahara, Y. Sasaki, M. Hori, and N. Hayashi. 2003. Impaired expression of proteasome subunits and human leukocyte an tigens class I in human colon cancer cells. J. Gastroenterol. Hepatol. 18:32-40. Moins-Teisserenc, H., G. Semana, M. Alizad eh, P. Loiseau, V. Bobrynina, I. Deschamps, G. Edan, B. Birebent, B. Genetet, O. Sabouraud, and 1995. TAP2 gene polymorphism contributes to genetic su sceptibility to multiple sclerosis. Hum. Immunol. 42:195-202. Morales, J., B. Homey, A. P. Vicari, S. H udak, E. Oldham, J. Hedrick, R. Orozco, N. G. Copeland, N. A. Jenkins, L. M. McEvoy, and A. Zlotnik. 1999. CTACK, a skinassociated chemokine that preferential ly attracts skin-homing memory T cells. Proc. Natl. Acad. Sci. U.S.A 96:14470-14475. Morel, S., F. Levy, O. Burlet-Schiltz, F. Bra sseur, M. Probst-Kepper, A. L. Peitrequin, B. Monsarrat, R. Van Velthoven, J. C. Cerottin i, T. Boon, J. E. Gairin, and B. J. Van den Eynde. 2000. Processing of some antigens by the standard proteasome but not by the immunoproteasome results in poor presentation by dendritic cells. Immunity. 12:107-117. Moriscot, C., M. J. Richard, M. C. Fa vrot, and P. Y. Benhamou. 2003. Protection of insulin-secreting INS-1 cells against oxid ative stress through adenoviral-mediated glutathione peroxidase overexpression. Diabetes Metab. 29:145-151. Morrison W.L. 2000. PUVA therapy. In: Vitiligo Hann S.K.and Nordlund J.J., ed. Blackwell Science, Oxford, pp. 168-172. Mozzanica, N., U. Frigerio, A. F. Finzi, A. Cattaneo, M. Negri, F. Scaglione, F. Fraschini, and S. Foppa. 1990. T cell subpopulations in vitiligo: a chronobiologic study. J. Am. Acad. Dermatol. 22:223-230.

PAGE 135

122 Nath, S. K., P. P. Majumder, and J. J. Nordlund. 1994. Genetic epidemiology of vitiligo: multilocus recessivity cross-validated. Am. J. Hum. Genet. 55:981-990. Njoo M.D., and Westerhof W. 2001. V itiligo. Pathogenesis and Treatment. Am. J. Clin. Dermatol. 2:167-181. Nordlund J.J.and Ortonne J.P. 1998. Vitiligo vulgaris. In: The Pigmentary System. Physiology and Pathophysiology Nordlund J.J., Oxford University Press, New York, pp. 513-551. Nussbaum R.L. 2001. Thompson and Thompson Genetics in Medicine 6th edn. W.B. Saunders, Philadelphia. Obst R, E.A., Armandola, M. Nijenhuis, F. Momburg and G.J. Hammerling. 1995. TAP polymorphism does not influence transport of peptide variants in mice and humans. Eur. J. Immunol 25:2170-2176. Ogg, G. S., D. P. Rod, P. Romero, J. L. Chen, and V. Cerundolo. 1998. High frequency of skin-homing melanocyte-specific cy totoxic T lymphocytes in autoimmune vitiligo. J. Exp. Med. 188:1203-1208. Ongenae, K., N. Van Geel, and J. M. Naeyaert. 2003. Evidence for an autoimmune pathogenesis of vitiligo. Pigment Cell Res. 16:90-100. Orecchia, G., L. Perfetti, P. Malagoli, F. Borghini, and Y. Kipervarg. 1992. Vitiligo is associated with a signifi cant increase in HLA-A30, Cw6 and DQw3 and a decrease in C4AQ0 in northern Italian patients. Dermatology 185:123-127. Orth, T., R. Kellner, O. Diekmann, J. Faust, K. H. Meyer zum Buschenfelde, and W. J. Mayet. 1998. Identification and characteriza tion of autoantibodies against catalase and alpha-enolase in patients with primary sclerosing cholangitis. Clin Exp. Immunol. 112:507-515. Ortonne, J. P. and S. K. Bose. 1993. Vitiligo: where do we stand? Pigment Cell Res. 6:61-72. Overwijk, W. W., D. S. Lee, D. R. Surman, K. R. Irvine, C. E. Touloukian, C. C. Chan, M. W. Carroll, B. Moss, S. A. Rosenberg, and N. P. Restifo. 1999. Vaccination with a recombinant vaccinia virus encodi ng a "self" antigen induces autoimmune vitiligo and tumor cell destruction in mice: requirement for CD4(+) T lymphocytes. Proc. Natl. Acad. Sci. U.S.A 96:2982-2987. Overwijk, W. W., M. R. Theoret, S. E. Finke lstein, D. R. Surman, L. A. de Jong, F. A. Vyth-Dreese, T. A. Dellemijn, P. A. Antony, P. J. Spiess, D. C. Palmer, D. M. Heimann, C. A. Klebanoff, Z. Yu, L. N. Hwang, L. Feigenbaum, A. M. Kruisbeek, S. A. Rosenberg, and N. P. Restifo. 2003. Tumor regression and autoimmunity after reversal of a functi onally tolerant state of se lf-reactive CD8+ T cells. J. Exp. Med. 198:569-580.

PAGE 136

123 Pamer, E. and P. Cresswell. 1998. Mechanisms of MHC class I--restricted antigen processing. Annu. Rev. Immunol. 16:323-358. Picker, L. J., J. R. Treer, B. Ferguson-Darnell, P. A. Collins, P. R. Bergstresser, and L. W. Terstappen. 1993. Control of lymphocyte recirculation in man. II. Differential regulation of the cutaneous lymphocyteassociated antigen, a tissue-selective homing receptor for skin-homing T cells. J. Immunol. 150:1122-1136. Pitkanen, J. and P. Peterson. 2003. Autoimm une regulator: from loss of function to autoimmunity. Genes Immun. 4:12-21. Prahalad, S., D. J. Kingsbury, T. A. Gri ffin, B. L. Cooper, D. N. Glass, W. P. Maksymowych, and R. A. Colbert. 2001. Polymorphism in the MHC-encoded LMP7 gene: association with JRA without functional significance for immunoproteasome assembly. J. Rheumatol. 28:2320-2325. Quadri SA and D.P. Singal. 1998 Peptide transport in human lymphoblastoid and tumor cells: effect of transporter associated with antigen presentation (TAP) polymorphism Immunol. Lett. 61: 25-31. Rechsteiner, M., C. Realini, and V. Ustrell. 2000. The proteasome activator 11 S REG (PA28) and class I antigen presentation. Biochem. J 345 Pt 1:1-15. Redondo M.J., P.R. Fain, and G.S.Eisenbart h. 2001 Genetics of type 1A diabetes. Recent Pro. Hormone Res. 56:69-89. Robert, C. and T. S. Kupper. 1999. Inflamma tory skin diseases, T cells, and immune surveillance. N. Engl. J. Med. 341:1817-1828. Rock, K. L. and A. L. Goldberg. 1999. Degrad ation of cell proteins and the generation of MHC class I-presented peptides. Annu. Rev. Immunol. 17:739-779. Rodriguez, M. R., A. Nunez-Roldan, F. Aguilar, A. Valenzuela, A. Garcia, and M. F. Gonzalez-Escribano. 2002. Association of the CTLA4 3' untranslated region polymorphism with the susceptibili ty to rheumatoid arthritis. Hum. Immunol. 63:76-81. Roozendaal, C., M. H. Zhao, G. Horst, C. M. Lockwood, J. H. Kleibeuker, P. C. Limburg, G. F. Nelis, and C. G. Kallenbe rg. 1998. Catalase and alpha-enolase: two novel granulocyte autoantigens in in flammatory bowel disease (IBD). Clin Exp. Immunol. 112:10-16. Sandler, S., D. L. Eizirik, C. Svensson, E. Strandell, M. Welsh, and N. Welsh. 1991. Biochemical and molecular actions of in terleukin-1 on pancreatic beta-cells. Autoimmunity 10:241-253. Shaffer, J. P. 1995. Multiple Hypothesis Testing. Ann. Rev. Psych 46: 561-584.

PAGE 137

124 Schallreuter, K. U., J. M. Wood, and J. Berger. 1991. Low catalase levels in the epidermis of patients with vitiligo. J. Invest. Dermatol. 97:1081-1085. Schallreuter, K. U., C. Levenig, P. Kuhnl, C. Loliger, M. Hohl-Tehari, and J. Berger. 1993. Histocompatibility antigens in vitiligo: Hamburg study on 102 patients from northern Germany. Dermatology 187:186-192. Schallreuter, K. U., J. M. Wood, I. Ziegler, K. R. Lemke, M. R. Pittelkow, N. J. Lindsey, and M. Gutlich. 1994. Defective tetra hydrobiopterin and catecholamine biosynthesis in the depigm entation disorder vitiligo. Biochim. Biophys. Acta 1226:181-192. Schallreuter, K. U., J. M. Wood, K. R. Lemke, and C. Levenig. 1995. Treatment of vitiligo with a topical appl ication of pseudocatalase and calcium in combination with short-term UVB exposure: a case study on 33 patients. Dermatology 190:223229. Schallreuter, K. U., J. M. Wood, M. R. Pittelkow, G. Buttner, N. Swanson, C. Korner, and C. Ehrke. 1996. Increased monoamine oxidase A activity in the epidermis of patients with vitiligo. Arch. Dermatol. Res. 288:14-18. Schallreuter, K. U. 1999a. Successful trea tment of oxidative stress in vitiligo. Skin Pharmacol. Appl. Skin Physiol. 12:132-138. Schallreuter, K. U., J. Moore, J. M. Wood, W. D. Beazley, D. C. Gaze, D. J. Tobin, H. S. Marshall, A. Panske, E. Panzig, and N. A. Hibberts. 1999b. In vivo and in vitro evidence for hydrogen peroxide (H2O2) accu mulation in the epidermis of patients with vitiligo and its successful rem oval by a UVB-activated pseudocatalase. J Investig. Dermatol. Symp. Proc. 4:91-96. Schallreuter, K. U., J. Moore, J. M. Wood, W. D. Beazley, E. M. Peters, L. K. Marles, S. C. Behrens-Williams, R. Dummer, N. Blau, and B. Thony. 2001. Epidermal H(2)O(2) accumulation alters tetrahydrobi opterin (6BH4) recycling in vitiligo: identification of a general mechanism in regulation of all 6BH4-dependent processes? J. Invest. Dermatol. 116:167-174. Schallreuter, K. U., J. Moore, S. Behrens-Williams, A. Panske, and M. Harari. 2002. Rapid initiation of repigmentation in vi tiligo with Dead S ea climatotherapy in combination with pseudocatalase (PC-KUS). Int. J. Dermatol. 41:482-487. Schwab, J. H., S. K. Anderle, R. R. Br own, F. G. Dalldorf, and R. C. Thompson. 1991. Proand anti-inflammatory roles of interl eukin-1 in recurrence of bacterial cell wall-induced arthritis in rats. Infect. Immun. 59:4436-4442.

PAGE 138

125 Schwarz, K., B. M. van Den, S. Kostka, R. Kraft, A. Soza, G. Schmidtke, P. M. Kloetzel, and M. Groettrup. 2000. Overexpression of the proteasome subunits LMP2, LMP7, and MECL-1, but not PA28 alpha/beta, enhances the presentation of an immunodominant lymphocytic chorio meningitis virus T cell epitope. J. Immunol. 165:768-778. Seegers, D., A. Zwiers, W. Strober, A. S. Pena, and G. Bouma. 2002. A TaqI polymorphism in the 3'UTR of the IL-12 p40 gene correlates with increased IL-12 secretion. Genes Immun. 3:419-423. Selig, W. and J. Tocker. 1992. Effect of in terleukin-1 receptor antagonist on antigeninduced pulmonary responses in guinea pigs. Eur. J. Pharmacol. 213:331-336. Sijts, A. J., S. Standera, R. E. Toes, T. Ruppert, N. J. Beekman, P. A. van Veelen, F. A. Ossendorp, C. J. Melief, and P. M. Kloe tzel. 2000. MHC class I antigen processing of an adenovirus CTL epitope is linked to the levels of immunoproteasomes in infected cells. J. Immunol. 164:4500-4506. Song, P. S. and K. J. Tapley, Jr. 1979. P hotochemistry and phot obiology of psoralens. Photochem. Photobiol. 29:1177-1197. Song, Y. H., E. Connor, Y. Li, B. Zorovich, P. Balducci, and N. Maclaren. 1994. The role of tyrosinase in autoimmune vitiligo. Lancet 344:1049-1052. Sugimoto Y., N. Kuzushita, T. Takehara, T. Kanto, T. Tatsumi, T. Miyagi, M. Jinushi, K. Ohkawa, M. Horimoto, A. Kasahara, M. Hori, Y. Sasaki, and N. Hayashi .2002. A single nucleotide polymor phism of the low molecular mass polypeptide 7 gene influences the interferon response in patients with chronic hepatitis C. J. Viral Hepat 9:377-384. Spielman, R. S. and W. J. Ewens. 1996. The TDT and other family-based tests for linkage disequilibrium and association. Am. J. Hum. Genet. 59:983-989. Tanaka, K. 1998. Molecular biology of the proteasome. Biochem. Biophys. Res. Commun. 247:537-541. Taylor, A. and F. P. Gasparro. 1992. Extraco rporeal photochemotherapy for cutaneous Tcell lymphoma and other diseases. Semin. Hematol. 29:132-141. Taysi, S., M. Gul, R. A. Sari, F. Akcay, and N. Bakan. 2002. Serum oxidant/antioxidant status of patients with systemic lupus erythematosus. Clin. Chem. Lab. Med. 40:684-688. Tezak, Z., E. P. Hoffman, J. L. Lutz, T. O. Fedczyna, D. Stephan, E. G. Bremer, I. Krasnoselska-Riz, A. Kumar, and L. M. Pachman. 2002. Gene expression profiling in DQA1*0501+ children with untreated dermatomyositis: a novel model of pathogenesis. J. Immunol. 168:4154-4163.

PAGE 139

126 Tobin, D. J., N. N. Swanson, M. R. Pittelkow, E. M. Peters, and K. U. Schallreuter. 2000. Melanocytes are not absent in lesi onal skin of l ong duration vitiligo. J. Pathol. 191:407-416. Trigwell, S. M., P. M. Radford, S. R. Page, A. C. Loweth, R. F. James, N. G. Morgan, and I. Todd. 2001. Islet glutamic acid decarboxylase modified by reactive oxygen species is recognized by antibodies from patients with type 1 diabetes mellitus. Clin. Exp. Immunol. 126:242-249. Tsunemi, Y., H. Saeki, K. Nakamura, T. Sekiya, K. Hirai, H. Fujita, N. Asano, M. Kishimoto, Y. Tanida, T. Kakinuma, H. Mitsui, Y. Tada, M. Wakugawa, H. Torii, M. Komine, A. Asahina, and K. Tamaki. 2002. Interleukin-12 p40 gene (IL12B) 3'untranslated region polymorphism is asso ciated with susceptibility to atopic dermatitis and psoriasis vulgaris. J. Dermatol. Sci. 30:161-166. Tu, C. X., H. W. Fu, and X. R. Lin. 1999. Levels of soluble interleuki n-2 receptor in the sera and skin tissue fluids of patients with vitiligo. J. Derm. Sci. 21:59-62. Ueda, H., J. M. Howson, L. Esposito, J. Heward, H. Snook, G. Chamberlain, D. B. Rainbow, K. M. Hunter, A. N. Smith, G. Di Genova, M. H. Herr, I. Dahlman, F. Payne, D. Smyth, C. Lowe, R. C. Twells, S. Howlett, B. Healy, S. Nutland, H. E. Rance, V. Everett, L. J. Smink, A. C. Lam, H. J. Cordell, N. M. Walker, C. Bordin, J. Hulme, C. Motzo, F. Cucca, J. F. Hess, M. L. Metzker, J. Rogers, S. Gregory, A. Allahabadia, R. Nithiyananthan, E. Tuomilehto-Wolf, J. Tuomilehto, P. Bingley, K. M. Gillespie, D. E. Undlien, K. S. Ronningen, C. Guja, C. Ionescu-Tirgoviste, D. A. Savage, A. P. Maxwell, D. J. Carson, C. C. Patterson, J. A. Franklyn, D. G. Clayton, L. B. Peterson, L. S. Wicker, J. A. Todd, and S. C. Gough. 2003. Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. Nature 423:506-511. van den Wijngaard, R., A. Wankowicz-Kalinska, S. Pals, J. Weening, and P. Das. 2001. Autoimmune melanocyte de struction in vitiligo. Lab. Invest. 81:1061-1067. van Endert, P. M., M. T. Lopez, S. D. Patel, J. J. Monaco, and H. O. McDevitt. 1992. Genomic polymorphism, recombination, a nd linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes. Proc. Natl. Acad. Sci. U.S.A 89:11594-11597. Venneker, G. T., L. P. de Waal, W. Wester hof, J. D'Amaro, G. M. Schreuder, and S. S. Asghar. 1993. HLA associations in vit iligo patients in the Dutch population. Dis. Markers 11:187-190. Vives-Pi, M., M. P. Armengol, L. Alcalde, M. Costa, N. Somoza, F. Vargas, D. Jaraquemada, and R. Pujol-Borrell. 1996. E xpression of transporter associated with antigen processing-1 in the endocrine cell s of human pancreatic islets: effect of cytokines and evidence of hyperexpression in IDDM. Diabetes 45:779-788.

PAGE 140

127 Vives-Pi, M., F. Vargas, R. F. James, J. Trowsdale, M. Costa, M. Sospedra, N. Somoza, G. Obiols, R. Tampe, and R. Pujol-Borrell. 1997. Proteasome subunits, lowmolecular-mass polypeptides 2 and 7 are hyperexpressed by target cells in autoimmune thyroid disease but not in insulin-dependent diabetes mellitus: implications for autoimmunity. Tissue Antigens 50:153-163. Weir BS and Cockerham CC. 1984. Estimating Fstatistics for the analysis of population structure. Evolution 38:1358-1370. Wong FS, and L. Wen 2003. The study of HLA class II and autoimmune diabetes. Curr. Mol. Med. 3:1-15. Yan, G., Y. Fu, and D. L. Faustman. 1997. Reduced expression of Tap1 and Lmp2 antigen-processing genes in the nonobese di abetic (NOD) mouse due to a mutation in their shared bidirectional promoter. J. Immunol. 159:3068-3080. Yeo, U. C., Y. S. Yang, K. B. Park, H. T. S ung, S. Y. Jung, E. S. Lee, and M. H. Shin. 1999. Serum concentration of the soluble inte rleukin-2 receptor in vitiligo patients. J. Dermatol. Sci. 19:182-188. Yildirim, M., V. Baysal, H. S. Inaloz, D. Kesici, and N. Delibas. 2003. The role of oxidants and antioxidants in generalized vitiligo. J. Dermatol. 30:104-108. Yu, H. S., K. L. Chang, C. L. Yu, H. F. Li, M. T. Wu, C. S. Wu, and C. S. Wu. 1997. Alterations in IL-6, IL-8, GM-CSF, TNF-alpha, and IFN-gamma release by peripheral mononuclear cells in patients with active vitiligo. J. Invest. Dermatol. 108:527-529.

PAGE 141

128 BIOGRAPHICAL SKETCH Courtney Bradley Casp was born in Silver Spring, Maryland, to Connie and Tim Bradley. She graduated from Walter J ohnson High School in Bethesda, Maryland, in 1994. She then received her Bachelor of Science degree from the University of Richmond in 1998, majoring in biology. She proc eeded to the University of Florida to pursue a degree in biomedical science, with a concentra tion in immunology. There she did her dissertation research in the laboratory of Dr. Wayne McCormack. On August 18, 2001, she married Mr. Justin Casp in Rockville, Maryland. On May 23, 2003, she celebrated the birth of her first daughter, Ashl yn Nicole Casp. She finished her degree in December 2003, and is currently resi ding in Gainesville, Florida.