Citation
Nutrient Regulation of the Human CCAAT/Enhancer-Binding Protein Beta and Its Relation to Transcriptional Control of the Human Asparagine Synthetase Gene

Material Information

Title:
Nutrient Regulation of the Human CCAAT/Enhancer-Binding Protein Beta and Its Relation to Transcriptional Control of the Human Asparagine Synthetase Gene
Creator:
CHEN, CHIN ( Author, Primary )
Copyright Date:
2004

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Fireflies ( jstor )
Genomics ( jstor )
Hep G2 cells ( jstor )
Journalism ( jstor )
Messenger RNA ( jstor )
Microelectromechanical systems ( jstor )
Nucleotides ( jstor )
Promoter regions ( jstor )
Transfection ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Chin Chen. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
4/30/2005
Resource Identifier:
72823171 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

NUTRIENT REGULATION OF THE HUMAN CCAAT/ENHANCER-BINDING PROTEIN BETA AND ITS RELATION TO TRANSCRIPTIONAL CONTROL OF THE HUMAN ASPARAGINE SYNTHETASE GENE By CHIN CHEN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Chin Chen

PAGE 3

To Sung-Kuang Chung and Matthew Jonathan Chung

PAGE 4

ACKNOWLEDGMENTS My deepest gratitude and respect go to Dr. Michael S. Kilberg. Without his guidance, insight, support, and patience, this dissertation would not have been possible. Dr. Kilberg has been an excellent teacher and role model to me. I would also like to thank the members of my supervisory committee (Dr. Linda Bloom, Dr. Jorg Bungert, Dr. Harry Nick, and Dr. Hideko Kasahara) for their keen advice and help on science as well as life. My friends have seen me through many difficult times. I thank Ann Chokas for her voice of comfort and reason, and I thank Patricia OBrien for always putting a smile on my face. I am also grateful to Joan Monnier for always putting me in perspective. The former and current members of the Kilberg laboratory (especially Ione, Perry, Can, Elizabeth, Hong, Pan and Stela) have made these years enjoyable and I am thankful for their unfailing support and help. I also appreciate very much that Pat, Debbie, Nathalie, Deepa, Becky and Seunghee took the time to care and share. I would never be where I am now without the dedication and love from my family. My parents, Te-Ming and Yue-Shen, have always encouraged me to pursue my dreams. I am very blessed to have my husband Sung-Kuang. He put his career on hold so that I can achieve my goal. His love and sense of humor keep me sane and give me the strength that is necessary to face challenges and frustrations along the way. I thank God for everything and especially our son Matthew Jonathan. His smile means a world to me. iv

PAGE 5

TABLE OF CONTENTS Page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES.........................................................................................................viii ABSTRACT.........................................................................................................................x CHAPTER 1 INTRODUCTION........................................................................................................1 Asparagine Synthetase (ASNS)....................................................................................1 CCAAT/Enhancer Binding Protein Beta (C/EBP)...................................................14 2 MATERIAL AND METHODS..................................................................................23 Cell Culture.................................................................................................................23 Site-Directed Mutagenesis..........................................................................................23 Northern Blot Analysis...............................................................................................25 Slot Blot Analysis.......................................................................................................26 Transient Transfection................................................................................................27 Luciferase Reporter Assay..........................................................................................29 Genomic Cloning of the Human C/EBP Gene.........................................................30 Real-time Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR).................34 3 CHARACTERIZATION OF THE NUTRIENT-SENSING RESPONSE ELEMENTS FOR THE ASPARAGINE SYNTHETASE GENE.............................43 Introduction.................................................................................................................43 Results.........................................................................................................................43 Discussion...................................................................................................................48 4 REGULATION OF THE HUMAN CCAAT/ENHANCER-BINDING PROTEIN BETA GENE TRANSCRIPTION BY AMINO ACID AVAILABILITY................59 Introduction.................................................................................................................59 Results.........................................................................................................................61 Discussion...................................................................................................................66 v

PAGE 6

5 REGULATION OF THE HUMAN CCAAT/ENHANCER-BINDING PROTEIN BETA GENE BY ENDOPLASMIC RETICULUM STRESS...................................87 Introduction.................................................................................................................87 Results.........................................................................................................................89 Discussion...................................................................................................................97 6 CONCLUSIONS AND FUTURE DIRECTIONS...................................................125 Nutrient Control of the Human Asparagine Synthetase (ASNS) Gene....................125 Nutrient Control of the Human C/EBP Gene.........................................................127 APPENDIX ADDITIONAL RESULTS. LIST OF REFERENCES.................................................................................................135 BIOGRAPHICAL SKETCH...........................................................................................150 vi

PAGE 7

LIST OF TABLES Table page 2-1 PCR primers for generating human C/EBP promoter fragments or 3 genomic sequences..................................................................................................................39 2-2 Constructs generated for investigating transcriptional control of the human C/EBP gene..........................................................................................................................40 vii

PAGE 8

LIST OF FIGURES Figure page 1-1 Summary of the DMS in vivo footprinting and the site-directed mutagenesis...........22 2-1 Human C/EBP gene structure...................................................................................36 2-2 Firefly luciferase reporter constructs..........................................................................37 2-3 Firefly luciferase reporter constructs (continued)......................................................38 3-1 Single nucleotide mutagenesis of the ASNS promoter region from nt to -37.....53 3-2 C/EBP LAP and LIP isoforms modulate ASNS promoter activity accordingly......55 3-3 C/EBP activates ASNS promoter activity................................................................56 3-4 The sequence alignment of the ASNS proximal promoters.......................................57 3-5 The hypothesis for ASNS transcriptional induction by the AAR or the UPR...........58 4-1 Amino acid deprivation increases C/EBP mRNA content.......................................72 4-2 The C/EBP mRNA content decreases following amino acid deprivation...............74 4-3 Induction of the C/EBP gene by amino acid deprivation requires de novo protein synthesis...................................................................................................................76 4-4 The increase in C/EBP mRNA content following AAR activation is not due to mRNA stabilization..................................................................................................78 4-5 The C/EBP promoter region alone is not sufficient to mediate induction following amino acid deprivation.............................................................................................80 4-6 The genomic region downstream of the protein coding translation stop codon is required for induction of the C/EBP gene via the AAR.........................................82 4-7 The C/EBP 3 genomic sequence nt +1554/+1646 can confer amino acid responsiveness to an otherwise inert promoter.........................................................84 viii

PAGE 9

4-8 The C/EBP 3 genomic sequence contains novel DNA cis-elements to mediate the AAR.........................................................................................................................86 5-1 The C/EBP and C/EBP mRNA content after glucose deprivation......................102 5-2 The C/EBP and ASNS mRNA content in response to glucose deprivation...........104 5-3 The C/EBP mRNA content is increased by UPR activators..................................106 5-4 The C/EBP protein content is increased following ER stress................................108 5-5 The increase in C/EBP mRNA following ER stress requires de novo protein synthesis.................................................................................................................110 5-6 The increase in C/EBP mRNA content following ER stress is not due to mRNA stabilization............................................................................................................112 5-7 The C/EBP genomic 5 upstream region alone is not sufficient to mediate increased transcription following ER stress...........................................................................114 5-8 The C/EBP genomic region downstream of the protein coding sequence is required for transcriptional induction by ER stress..............................................................116 5-9 The C/EBP gene contains a cis-element, 3 to the protein coding sequence that mediates transcriptional activation in response to ER stress..................................118 5-10 An UPRE binding site is responsible for the transcriptional activation of the C/EBP gene in response to ER stress...................................................................120 5-11 Overexpression of XBP1 transactivates C/EBP transcription..............................122 5-12 The genomic sequence corresponding to the 3 UTR of the C/EBP gene for human, rat and mouse.............................................................................................124 A-1 The C/EBP 3 genomic sequence nt +1554/+1646 can confer amino acid responsiveness to the inert C/EBP promoter........................................................132 A-2 The C/EBP 3 genomic sequence nt +1554/+1646 is functional in reversed orientation...............................................................................................................133 A-3 Time course of the transcriptional induction mediated by the C/EBP 3 genomic sequence nt +1423/+2213 in response to the AAR and the UPR...........................134 ix

PAGE 10

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NUTRIENT REGULATION OF THE HUMAN CCAAT/ENHANCER-BINDING PROTEIN BETA AND ITS RELATION TO TRANSCRIPTIONAL CONTROL OF THE HUMAN ASPARAGINE SYNTHETASE GENE By Chin Chen May 2004 Chair: Michael S. Kilberg Major Department: Biochemistry and Molecular Biology Asparagine synthetase (ASNS) catalyzes the ATP-dependent synthesis of asparagine from aspartate and glutamine. Transcription of the human ASNS gene is activated not only by amino acid deprivation, but also by carbohydrate limitation or endoplasmic reticulum (ER) stress. The purposes of my study were: (1) to characterize the nutrient-sensing response elements (NSREs) within the ASNS promoter; (2) to identify the trans-acting factors that bind to NSRE-1; (3) to examine the regulation of the transcription factor CCAAT/enhancer-binding protein beta (C/EBP) by amino acid availability; and (4) to investigate the mechanism by which the human C/EBP gene is activated by ER stress or carbohydrate deprivation. The results from single nucleotide mutagenesis demonstrate that the sequences 5-TGATGAAAC-3 (NSRE-1) and 5-GTTACA-3 (NSRE-2), located within the ASNS proximal promoter region, are absolutely required for the ASNS transcriptional induction x

PAGE 11

by nutrient limitation. These two sequences are also necessary for maintaining ASNS transcription in nutrient-fed state. Yeast one-hybrid screening and electrophoresis mobility shift assay suggest that C/EBP is one of the protein factors that bind NSRE-1. The functional role of C/EBP in regulating ASNS transcription was examined by overexpressing activating (LAP) or dominant-negative inhibitory (LIP) isoform of C/EBP. LAP and LIP modulated the ASNS promoter activity accordingly. To walk backwards up the nutrient-sensing response pathway, regulation of the human C/EBP gene in response to nutrient availability was investigated. The expression of C/EBP, like that of ASNS, is increased in response to ER stress or nutrient deprivation. This increase is due to elevated transcription of the C/EBP gene. Interestingly, C/EBP promoter region plays no major role in regulating this transcriptional induction. The cis-regulatory element responsible for activating nutrient-dependent transcription for the C/EBP gene is located within the genomic region 3 to the protein coding sequence. The cis-element 5-TGACGCAA-3 was identified to be essential for increasing C/EBP expression in response to glucose limitation or ER stress. Exogenously expressing a mammalian ER stress mediator XBP1 induced the luciferase reporter activity in the presence of this cis-element. xi

PAGE 12

CHAPTER 1 INTRODUCTION Asparagine Synthetase (ASNS) Asparagine synthetase (ASNS) catalyzes the ATP-dependent synthesis of asparagine from aspartate and glutamine, with glutamate being the second product. The ASNS cDNA has been cloned from a number of species including human, rat, mouse and hamster. Analysis of the cDNA sequence reveals a high degree of homology (1). A predominant ASNS mRNA species of approximately 2.0 kb is expressed in rat, hamster and human cells. In the hamster a larger mRNA of approximately 2.5 kb is also expressed. Three ASNS mRNA species of 2.0, 2.5 and 4.0 kb are observed in rat cells, and all three are induced by amino acid deprivation (2). Northern blot analysis using the 3 untranslated region (UTR) of the 2.5 kb rat cDNA as a probe revealed hybridization to the 2.5 and a 4 kb species only, suggesting that the multiple mRNA species are synthesized by either alternative slicing or alternative polyadenylation. The ASNS expression has been linked to cell cycle control. By studying a temperature-sensitive mutant hamster BHK ts11 cells which are blocked in G 1 phase of the cell cycle when grown at the nonpermissive temperature, the ASNS was first identified as a gene that is able to complement the ts11 cells and thus necessary for the G 1 progression (3, 4). Basilico and colleagues (5) later demonstrated that at the nonpermissive temperature, the mutant ts11 cells produce an inactive ASNS which leads to low levels of the cellular asparagine and a corresponding increase in the ASNS mRNA content. The work from Basilico and colleagues suggested a link between asparagine 1

PAGE 13

2 content and cell cycle progression. Colletta and Cirafici (6) provided further evidence that the expression of ASNS gene may be controlled in a cell cycle-dependent manner by documenting the entry of quiescent rat thyroid cells into the S phase and a concurrent induction of ASNS mRNA following the treatment of thyroid-stimulating hormone. Asparaginase (ASNase) catalyzes the reversed reaction of ASNS, and it is one of the drugs in combination chemotherapy used to treat childhood acute lymphoblastic leukemia (ALL) (7, 8). ALL cells express extremely low levels of ASNS and therefore are sensitive to the depletion of asparagine by ASNase. However, exposure to ASNase can result in developing resistance in a population of ALL cells. Aslanian et al. (9) demonstrated that elevated ASNS expression alone is sufficient to confer ASNase-resistance to the parental ASNase-sensitive ALL cells without drug selection. Therefore the ASNS gene represents a potential target for developing gene therapy strategies to reverse ASNase resistance in ALL. Besides the apparent role of nutrition in metabolism, development and disease progression, little is known about nutrient-regulated gene expression and the upstream signaling events in mammals. The human ASNS gene is induced by not only amino acid deprivation but also glucose limitation thus represents a useful experimental model for investigating nutrient-dependent transcription in mammalian cells. This thesis focuses on the aspects of transcriptional regulation of the ASNS gene and its upstream regulator CCAAT/enhancer-binding protein beta (C/EBP by nutrient availability. General Amino Acid Control in Yeast The molecular mechanisms involved in the control of gene expression in response to amino acid availability have been extensively studied in yeast (10). In addition to

PAGE 14

3 specific control of genes involved in the biosynthesis of individual amino acids, yeast employs a general control process (GCN, general control non-repressible) whereby 500-1000 different genes are regulated by starvation of the cell for a single amino acid (11). This general control response is mediated by a transcription activator, Gcn4p and thus occurs at the level of transcription (12). Gcn4p binds to a DNA regulatory element (5’-ATGACTCAT-3’) that is present within every amino acid biosynthetic gene under general control (12). The amino acid deprivation signal initiates at the level of translation of the Gcn4p (12). Hinnebusch (10) proposed a ribosome scanning model for this translational regulation. The 5’ leader sequence of the GCN4 mRNA transcript contains four short abortive upstream open reading frames (uORFs). Under the amino acid-fed condition, the ribosome translates uORF1 and then dissociates, leaving the 40S subunit continuously scanning the mRNA until the necessary factors reassociate with it to make the subunit competent to reinitiate translation. The ribosome then reassembles at uORF4 and translates it. After translating uORF4, the ribosome dissociates from the mRNA once again and no reinitiation occurs at the GCN4 coding region, and thus no GCN4 is translated. Under the starved condition, however, reassembly of the 40S initiation complex is slower. After translating uORF1, the ribosome dissociates and the 40S subunit scans past the uORF4. The ribosome then reassembles at the GCN4 coding region and reinitiates translation of GCN4. The induction of GCN4 translation under amino acid-deprived condition requires the protein kinase Gcn2p. Amino acid deprivation leads to the accumulation of uncharged tRNA. The protein kinase activity of Gcn2p is activated by binding of uncharged tRNA

PAGE 15

4 to its regulatory domain related to histidyl-tRNA synthetase (12). Limitation for any single amino acid activates the protein kinase activity of Gcn2p (13). The activated Gcn2p then phosphorylates the subunit of the eukaryotic translation initiation factor 2 (eIF2) on Ser 51 (12). Phosphorylated eIF2-GDP is unable to be converted to eIF2-GTP by guanine exchange factor eIF2B, resulting in reduced level of eIF2-GTP. Consequently, this causes the 40S initiation complex to scan past the uORF4 in the GCN4 mRNA and reinitiate at the GCN4 coding region to induce GCN4 translation (12). Regulating the ASNS Gene by Amino Acid Response (AAR) It has been known for many years that ASNS enzymatic activity is elevated in response to amino acid limitation (14). More recently Gong et al. (15) determined that the ASNS mRNA content is increased not only in cells derived of asparagine, but also in cells limited for leucine, isoleucine or glutamine. Hutson and Kilberg (2) also documented an increase in ASNS mRNA level following limitation for all 20 amino acids in cultured rat Fao hepatoma cells and in normal rat liver tissue. Furthermore, depriving the cells of a single essential amino acid, such as histidine, threonine or tryptophan, caused a strong induction of the steady-state ASNS mRNA. Depleting phenylalanine, leucine and isoleucine from culture media also enhanced the ASNS mRNA, but to a lesser extent. These observations indicate that the expression of ASNS mRNA is not controlled only by the asparagine level but rather regulated by the availability of other amino acids as well. These findings also suggest a more general spectrum of regulation for the AAR pathway in mammalian cells. The increased ASNS mRNA is translated into protein after amino acid limitation as determined by increased ASNS mRNA association with polysomes (16) and also by

PAGE 16

5 pulse-chase labeling of ASNS protein synthesis (17). This is in consistent with the finding of Arfin et al. (14) that the ASNS enzymatic activity is elevated in Chinese hamster ovary (CHO) cells following 24 h of amino acid deprivation. The tissue distribution of the ASNS varies widely. The protein content is most abundant in the rat pancreas, testes, brain and spleen (18). Even before a cDNA for ASNS was cloned, Arfin et al. (14) demonstrated that the CHO cells incubated in asparagine-free medium exhibit reduced aminoacylation of tRNA Asn and increased level of ASNS activity. Likewise, the level of asparaginyl-tRNA Asn decreased while ASNS activity elevated, when a cell line containing a temperature-sensitive asparaginyl-tRNA synthetase mutation was transferred to the nonpermissive temperature (19). ASNS activity is also increased in CHO cell mutants with temperature-sensitive leucyl-, methionyland lysyl-tRNA synthetase when grown at the nonpermissive temperature, even though the content of asparaginyl-tRNA Asn remained unchanged (19). These results are in agreement with the hypothesis that the GCN2 kinase senses amino acid limitation by binding a wide variety of uncharged tRNAs (20, 21). When rat Fao hepatoma cells were treated with 5 mM of the amino alcohol histidinol that prevents the formation of histidinyl-tRNA His by inhibition of the corresponding tRNA synthetase (22), ASNS mRNA content was induced to a level equal to or greater than that observed in cells deprived of all amino acids (2). Given that histidinol treatment increases ASNS mRNA content without depleting cytoplasmic free histidine, the AAR signaling pathway is not likely to be triggered by the level of free amino acids. Taken together, these results not only documented that tRNA charging is

PAGE 17

6 important for sensing the amino acid deprivation, but also illustrated that the sensing mechanism in mammalian cells is similar to the general amino acid control of yeast, in that limiting any one of a number of amino acids activates all 73 amino acid biosynthetic genes. Guerrini et al. (23) demonstrated that the increase in ASNS mRNA by amino acid deprivation is regulated at the level of transcription. When a CAT (chloramphenicol acetyltransferase) reporter gene was linked to a 3.4 kb human ASNS genomic DNA fragment containing a putative promoter region and the first two exons and introns, an increase in the CAT reporter mRNA content and activity was detected in response to either asparagine or leucine deprivation. In contrast, the level of CAT mRNA and activity under the control of the simian virus 40 (SV40) early promoter decreased under the same conditions. To identify the minimum ASNS upstream genomic sequence responsive to amino acid deprivation, a deletion analysis was performed (23). The results showed that the sequence spanning from nucleotide to +44 within the ASNS 5’ region retained full inducibility by amino acid deprivation. Further scanning the to +1 region of the ASNS promoter by site-directed mutagenesis revealed that a cis-element, positioned between nucleotide and , was essential for amino acid regulation of the ASNS gene. This element, 5’-CATGATG-3’, was termed the Amino Acid-Response Element (AARE) (23). Substitution or deletion of the AARE sequence destroyed the amino acid starvation-induced as well as basal expression of the ASNS promoter in transient transfection and CAT reporter assays, implicating a role of transcription activator(s) in mediating amino acid-dependent regulation of the ASNS gene (23).

PAGE 18

7 Electrophoresis mobility shift assays (EMSA) using double-stranded oligonucleotides containing this AARE sequence documented the formation of specific protein-DNA complexes in vitro, but the absolute amounts of these complexes were not changed when nuclear extracts from amino acid-starved cells were tested (23). The AARE sequence within the ASNS promoter did not correspond precisely to a consensus sequence for any known transcription factors in database. As described in chapter 3, further investigation has better defined the AARE for the ASNS and its role in regulating transcription in response to nutrient availability. In addition to the AARE mentioned above, DNA sequence comparison of the ASNS gene revealed a FIRE-like element (fos-inducible response element) located just downstream of the major transcription start site within the untranslated first exon (23). Interestingly, the FIRE sequence can also be found in the untranslated first exon of four other genes, fos, jun, myc, and ornithine decarboxylase, all of which appear to be induced by amino acid starvation (24). EMSA experiments using single-stranded DNA oligonucleotides covering the FIRE-homology sequence within the ASNS coding region documented the formation of two specific protein-DNA complexes (23). However, the binding of these single-strand DNA binding proteins did not change with amino acid starvation. Moreover, deletion or mutation of this FIRE-like element within the context of ASNS minimal promoter containing the first exon resulted in increased basal CAT reporter expression, but amino acid-dependent regulation was still maintained (23). These results suggested that the FIRE-homology sequence plays no major role in regulating amino acid-dependent ASNS gene expression.

PAGE 19

8 The ASNS Gene and the Unfolded Protein Response (UPR) What is the UPR? Disturbance of the protein folding process in the endoplasmic reticulum (ER) activates a signaling pathway called unfolded protein response (UPR) (25). Glucose deprivation, inhibition of protein glycosylation or imbalance in calcium concentration induces the UPR. The cellular UPR was first described as the response after viral transformation (26). The authors showed that viral transformation induced-glucose limitation could induce gene transcription (26). More recently, Lee (27) demonstrated that glucose deprivation enhances the expression of the ER chaperone glucose-regulated protein (GRP) genes. Because productive protein folding process demands extensive amount of energy, it is believed that glucose limitation reduces the cellular energy level and therefore results in misor un-folded proteins, which in turn activates the UPR (28). Alternatively, Glucose deprivation may cause misor un-folded glycoproteins in the ER, which then leads to the activation of the UPR (28). The UPR pathway in yeast Saccharomyces cerevisiae is well characterized. The ER stress signal is detected by an ER transmembrane protein kinase/endoribonuclease Ire1p. Upon accumulation of unfolded proteins, Ire1p dimerizes and autophosphorylates to activate its endoribonuclease activity, which in turn splices HAC1 mRNA and generates a potent transcription activator bZIP protein Hac1p (29-33). Hac1p then binds to the UPR element (UPRE, consensus sequence 5-CAGCGTG-3) (34, 35) and activates the UPR target genes such as molecular chaperons and folding enzymes to correct misor un-folded proteins in the ER. By studying the promoter region of the mammalian ER chaperon proteins, a consensus sequence 5-CCAAT-N 9 -CCACG-3, termed ER stress response element

PAGE 20

9 (ERSE) to distinguish from the yeast UPRE, was identified to be responsible for mediating mammalian ER stress response (36, 36). In mammals, multiple ER stress-responsive pathways exist. Three ER stress proximal sensors, IRE1, PERK and ATF6, have been documented (28). Two mammalian IRE1 proteins, IRE1 and IRE1 (37, 38), have been identified, and XBP1 has been described as the mammalian counterpart to yeast Hac1p (39-41). Upon activation of the UPR, XBP1 mRNA is spliced by the IRE1 to remove an intron of 26 nucleotides. This splicing results in a translation frameshift and in turn generates a highly active transcription factor (39-42). XBP1 binds to the 3 half of the ERSE (5-CCACG-3) (34) and the sequence 5-TGACGTGG/A-3(40, 43). To reflect the observation that binding of the later sequence is preferred by XBP1 over ATF6, and the conservation of a splicing activation system, the sequence 5-TGACGTGG/A-3 has been referred to as the mammalian UPRE (mUPRE) (39). It has been demonstrated that XBP1 activates a second set of ER stress-responsive genes by binding to the mUPRE (40, 43). Lee et al. (44) also identified a subset of ER resident genes whose expression is XBP1-dependent. The proteolytic activation of the transcription factor ATF6 plays an important role in UPR-mediated transcriptional activation (45-47). The precursor form of ATF6 is an ER transmembrane protein. Upon the accumulation of unfolded proteins, ATF6 precursor translocates to the Golgi compartment where it is cleaved by S1P and S2P proteases to release a 50-60 kDa bZIP transcription factor ATF6 (45). ATF6 then migrates into the nucleus where it activate target gene expression by binding to the 5-CCACG-3 motif of the ERSE, when the 5-CCAAT-3 half site is occupied by the transcription factor NF-Y (45, 46, 46, 48).

PAGE 21

10 Endoplasmic reticulum (ER) stress in mammals also causes transient inhibition of protein synthesis, and it is mediated by the protein kinase PERK (PKR-like endoplasmic reticulum kinase). PERK is activated under the same conditions that activate IRE1 (49-51). Upon UPR activation, PERK is activated to phosphorylate the subunit of the eIF2 on Ser51 to attenuate translation initiation by inhibiting the conversion of eIF2-GDP to eIF2-GTP, a mechanism identical to Gcn2-mediated translational attenuation in response to amino acid deprivation (49, 50). Similar to the mechanism by which Gcn4 translation is induced by Gcn2 following amino acid limitation in yeast, the translation of a bZIP transcription factor ATF4 is enhanced by PERK following UPR activation (52). Harding et al. (52) showed that ATF4 mRNA translation is also induced following amino acid deprivation via Gcn2/eIF2 phosphorylation. These evidences suggest that the AAR and UPR converge on eIF2 phosphorylation, which would eventually lead to the transcriptional activation of amino acid biosynthetic genes such as ASNS by either amino acid deprivation or glucose limitation. The Kilberg laboratory (53) has demonstrated that activation of the ASNS gene by the AAR or the UPR is mediated by ATF4 via binding to a DNA regulatory element in the ASNS proximal promoter. Regulating the ASNS Gene by the UPR Barbosa-Tessmann et al. reported that expression of the human ASNS gene is also induced by glucose deprivation (54), and that this induction is mediated by the UPR pathway (55). The initial increase in ASNS mRNA content in human HepG2 hepatoma cells following glucose limitation was detectable by 8 h, and reached a maximum by 12 h (54). This increase in ASNS mRNA content was followed by an elevation in ASNS protein level (54). The glucose deprivation was conducted in the presence of all twenty

PAGE 22

11 amino acids in minimal essential medium (MEM) lacking only glucose. Glucose limitation-dependent ASNS mRNA induction was evident in a variety of cell types examined, including a mouse hepatocyte cell line BNL-CL2, a rat C6 glioma cell line, a human leukemic lymphocyte cell line MOLT4 and HepG2 cells (54). As discussed above, glucose deprivation causes protein misfolding in the ER and thus activates the UPR pathway. Other recognized activators for the UPR pathway include the protein glycosylation inhibitor tunicamycin and amino acid analogs such as the proline analog, azetidine-2-carboxylate (Aze) (56). Barbosa-Tessmann et al. demonstrated that ASNS mRNA content is induced in HepG2 cells incubated in MEM containing 5 g/mL tunicamycin or 5 mM Aze, and that glucose starvation and tunicamycin treatment together does not further induce ASNS mRNA (55). These results suggest that the human ASNS is a target gene for the UPR pathway. Therefore, ASNS represents the first link between amino acid metabolism and the UPR pathway in mammalian cells. The induction in ASNS mRNA content by glucose deprivation appears to be transcriptional. Barbosa-Tessmann et al. (55) reported that transcription of the human growth hormone (GH) reporter gene is significantly enhanced by glucose starvation when it is driven by a 10 kb DNA fragment corresponding to the human ASNS promoter sequence. This induction of the human GH reporter by glucose deprivation was maintained when the ASNS promoter sequence was progressively deleted from the 5’ end to a 224 bp fragment spanning from nucleotide to +51. This 224 bp ASNS promoter fragment also induced the GH reporter transcription in the presence of tunicamycin in cell culture medium, suggesting that glucose removal was activating

PAGE 23

12 ASNS expression via the UPR pathway. As a negative control, transcription of the human GH reporter under the control of the mouse metallothionein (MTT) promoter did not increase in response to glucose limitation or tunicamycin treatment. To define the cis-elements within the ASNS promoter mediating the UPR, a series of deletions was made to the /+51 fragment from both the 5’ and 3’ directions. The results indicated that the cis-elements responsible for the UPR control of the ASNS gene are located from nt to within the ASNS promoter. Common Elements Mediating the AAR and the UPR for the ASNS Gene Barbosa-Tessmann et al. (57) further demonstrated that activation of the human ASNS gene transcription by depriving for amino acids or glucose is mediated through a set of common genomic elements within the ASNS proximal promoter. Deletion analysis, in vivo dimethyl sulfate footprinting, and initial single nucleotide mutagenesis of the ASNS proximal promoter region, all indicated that the AAR and the UPR response of the ASNS gene were mediated by the same elements. The minimal ASNS promoter sequence responsible for induction by both amino acid and glucose starvation appears to be located from nucleotide to . This sequence, when placed in front of the thymidine kinase (TK) promoter in either forward or reversed orientation, can confer AAR and UPR-dependent regulation to this otherwise inert promoter. The ASNS promoter region 173 nucleotides upstream of the major transcription start site contains six separate regulatory elements, sites I-VI, as revealed by in vivo footprinting (Fig. 1-1) (57). The ASNS promoter sequence nt /-34 contains sites III-VI (Fig. 1-1). Site I-III are GC-boxes. Although they are not required for induction of the ASNS transcription following nutrient deprivation, these GC-boxes function in a permissive manner to maintain the highest possible transcription rate in both amino acid

PAGE 24

13 fed and starved conditions (58). Among the six sites, only sites V and VI showed nutrient-dependent protein binding by in vivo footprinting (57) (Fig. 1-1). Site V overlaps the AARE first identified by Guerrini et al. (23). However, in contrast to the observations by Guerrini et al. (23) in HeLa cells, when nuclear extracts isolated from HepG2 cells were tested by EMSA, increased amounts of specific protein-site V complexes were detected with extracts from amino acid-limited cells (57). To define the core sequence and the boundaries of sites V and VI, extensive single nucleotide mutagenesis of the ASNS promoter region from nt to was performed and the data are described in Chapter 3. The site V sequence 5’-TGATGAAAC-3’, located from nucleotide to within the ASNS proximal promoter, is responsible for induction of the ASNS gene following activation of not only the AAR, but also the UPR pathway. The UPR activation demonstrates that this sequence serves more than simply as an AARE, as originally suggested by the Guerrini et al. (23). To reflect this broader substrate detecting capability, the site V sequence 5’-TGATGAAAC-3’ is referred to as the Nutrient Sensing Response Element-1 (NSRE-1). Furthermore, the site VI sequence 5’-GTTACA-3’ (nucleotide to ), positioned eleven nucleotides downstream of the NSRE-1, has been shown also to be absolutely required for induction of the ASNS gene by both amino acid and glucose starvation. This element is referred to as the NSRE-2. The results from single nucleotide mutagenesis provide further evidence that NSRE-1 (site V) and NSRE-2 (site VI) work in concert to mediate both the AAR and the UPR for the ASNS gene. It has been documented that the expression of ATF4 is translationally increased by amino acid deprivation and ER stress (52), it makes ATF4 a potential regulator for ASNS

PAGE 25

14 expression. EMSA using HepG2 nuclear extracts revealed three specific NSRE-1-protein complexes (Complex A, B, and C), and the amount of all three complexes was increased by limitation of either amino acid or glucose (53). EMSA/supershift using antibody against ATF4 diminished the complex A and resulted in two new slow migrating (supershifted) complexes in nuclear extracts from cells deprived for either amino acid or glucose (53). Overexpressing ATF4 further enhanced the transcription in nutrient-fed and -deprived condition. Conversely, exogenously expressing a dominant negative form of ATF4 decreased the basal transcription and inhibited deprivation-activated induction (53). Collectively, ATF4 mediates the AAR and the UPR for the ASNS gene expression binding to the NSRE-1. Yeast one-hybrid screening of a human pancreatic cDNA library using NSRE-1 sequence as bait, identified C/EBP family of transcription factors as NSRE-1 binding protein (59). EMSA/supershift were then performed to screen all known C/EBP family members for NSRE-1 binding in HepG2 cells. As mentioned above, three nutrient-regulated protein-NSRE-1 complexes, Complex A, B, and C, were formed. Anti-C/EBP antibody supershifted complex C and caused most dominant supershift complexes in cells deprived for either amino acid or glucose. Investigation of the functional role of C/EBP in modulating ASNS expression is discussed in chapter 3. The regulation of C/EBP itself by the AAR and the UPR is presented in chapter 4 and 5, respectively. CCAAT/Enhancer Binding Protein Beta (C/EBP) General Properties CCAAT/enhancer-binding protein beta (C/EBP is a member of the CCAAT/enhancer-binding protein family of transcription factors (60, 61). The other

PAGE 26

15 members include C/EBP, , , , and CHOP (C/EBP homology protein) (62-66). The genes for C/EBP, C/EBP, C/EBP, and C/EBP are intronless, while C/EBP and CHOP gene possesses two and four exons, respectively (67). These transcription factors share a highly conserved (>90% sequence identity) basic leucine zipper (bZIP) domain at their C-terminus, which is responsible for DNA binding (basic region) and dimerization (leucine zipper) (68). Due to this high homology, C/EBP family members can dimerize with the other C/EBP family members as well as transcription factors from other bZIP subclasses such as the ATF/CREB family. The specificity of dimer formation is determined by the electrostatic interactions between amino acids along the dimerization interface (69). C/EBP has been reported to interact with CREB/ATF (70), AP-1 (71, 71), as well as non-bZIP factors such as the p50 subunit of NF-B (72), glucocorticoid receptor, hepatitis B virus X protein, and the retinoblastoma protein (73). Such a vast range of heterodimerization implicates a profound influence of C/EBP in cellular functions. Dimerization is a prerequisite for DNA binding by C/EBPs. The specificity of DNA binding is determined by the amino acid sequence within the basic region (74). The spacing between the basic region and the leucine zipper is also critical for the binding activity (75). An optimal consensus sequence for C/EBP binding is a dyad symmetrical repeat 5 A/G TTGC GC/TAAT/C 3 (76). However, C/EBPs are promiscuous and most binding sequences contain a conserved half-site paired with a more divergent sequence with at least 2 bp of the consensus (76). In contrast to the highly conserved C-terminus, the N-terminus of C/EBP proteins varies greatly (< 20% sequence identity), with the exception of several short stretches that

PAGE 27

16 appear to be activation domains (77-79). These activation domains interact with components of the basal transcription machinery to stimulate transcription (77-79). C/EBP and C/EBP also contain negative regulatory regions in their N-terminus. The precise functions of these regions are yet to be determined (77, 78). Two C/EBP isoforms, LAP ( l iver-enriched transcriptional a ctivator p rotein) and LIP ( l iver-enriched transcriptional i nhibitory p rotein) have been described (80, 81). It is proposed that they are translated from the same mRNA by alternative translation initiation on multiple AUG codons (80). LAP, translated from the second in frame AUG, is a transcription activator because it is a full-length C/EBP protein and contains the N-terminal activation domain. LIP, however, is translated from the third in frame AUG and therefore lacks the N-terminal activation domain. Because LAP and LIP share the same C-terminal region including the leucine zipper domain for dimerization and the basic region for DNA binding, LIP can dimerize with LAP and bind to the same DNA regulatory elements to attenuate transcription (80). Therefore, LIP is a transcription repressor and functions as a dominant negative form of LAP. The ratio of LAP to LIP is proposed to be important in control of cell proliferation and differentiation. Changes in the LAP/LIP ratio have been observed in liver differentiation (80), acute phase response (82), and neoplastic transformation (83). The third C/EBP isoform, the extended full length protein LAP*, is translated from the first in frame AUG and is in lower abundance than LAP (80, 84). LAP* is also a transcription activator and has a 21-amino acid extension at the N-terminus when compared to LAP. Kowenz-Leutz and Leutz (84) demonstrated that LAP and LAP* are functionally different in their capability to activate genes with higher order chromatin structure. They

PAGE 28

17 proposed that the extreme N terminus in LAP* is responsible for chromatin remodeling by recruiting SWI/SNF complex. Biological role in carbohydrate metabolism CCAAT/enhancer-binding protein (C/EBP involves in a wide range of important cellular processes, such as energy metabolism (85, 86), inflammation (60, 62, 87), cellular proliferation (88-90), and differentiation of various cell types including adipocytes (64), macrophages (91), mammary epithelial cells (92) and ovarian luteal cells (93). For the purpose of this thesis, its role in energy/carbohydrate metabolism will be further elaborated. There are at least two distinct phenotypes of C/EBP -/knockout mice (phenotype A and B) reported, which makes determining the exact functions of C/EBP in metabolism somewhat difficult. Phenotype B knockout mice die shortly after birth due to hypoglycemia, because these mutants are incapable of mobilizing their hepatic glycogen or expressing gluconeogenic enzyme phosphoenolpyruvate carboxykinase (PEPCK) (85). Although C/EBP -/knockouts with phenotype A survive to adulthood, they exhibit fasting hypoglycemia due to impaired hepatic glycogenolysis (85). These mice also show defects in hepatic glucose production in response to glucagon, and in free fatty acid release in response to epinephrine (85, 86). Based on the results from the knockout studies, it is proposed that C/EBP mediates subtle metabolic response by regulating the expression of genes that allow organisms to adapt metabolically to environmental (such as nutritional) changes (94). To my best knowledge, however, no investigations have demonstrated the direct effect of nutrient availability on C/EBP gene expression. Although Marten et al. (95)

PAGE 29

18 has documented that the C/EBP mRNA content in H4-II-E rat hepatoma cells is increased by single amino acid deprivation, no further investigation was conducted to study the mechanism of this increase. On the other hand, as described below, extensive investigation has revealed that CHOP, another C/EBP family member, is a nutrient-regulated gene. Transcriptional regulation of CHOP by nutrient availability C/EBP homology protein/growth arrest and DNA damage protein 153 (CHOP/GADD 153) was originally identified as a gene that was induced by DNA damage, now it is recognized that CHOP is activated by a number of stress stimuli, including limitation of amino acid (96, 97) or glucose (46). Glucose deprivation, treatment with tunicamycin (Tm) or thapsigargin (Tg) increases CHOP mRNA expression via the UPR pathway, and this increase is transcriptional (46). In the human CHOP promoter, there are two overlapping ERSEs, CHOP-ERSE1 and CHOP-ERSE2, oriented in the opposite directions (46). By deletion analysis and mutagenesis, Yoshida et al. (46) demonstrated that only CHOP-ERSE1, located from to , is functional in mediating the transcriptional induction following UPR activation. Furthermore, the binding of ATF6 to the ERSE appears to be critical for this induction. As a contrast to the ASNS gene, a different cis-acting element is responsible for induction of the CHOP gene via the AAR than that via the UPR (98). Bruhat et al. (99, 100) identified the core sequence of the AARE for the CHOP gene as 5-TGATGCAAT-3, located on the bottom strand of the CHOP promoter from nt to . This sequence was able to bind C/EBP and ATF2 in vitro, however, the induction following

PAGE 30

19 amino acid deprivation was lost only in ATF2 -/mouse embryonic cells (MEFs) (99). Moreover, complementing the ATF2 -/MEFs with ATF2 expression plasmid restored amino acid-dependent control and a dominant negative form of ATF2 suppressed the induction in ATF2 wild-type MEFs (99). Recently, Averous et al. (101) demonstrated that the transcriptional induction of CHOP by amino acid limitation requires both ATF2 phosphorylation and ATF4 expression. The core sequence and flanking region of the ASNS NSRE-1 (102) and the CHOP AARE share a high degree of similarity (100) differing by only two nucleotides. While the CHOP AARE alone is sufficient in mediating the transcriptional induction by amino acid deprivation, the ASNS NSRE-1 requires the presence of the NSRE-2 (100). Interestingly, ASNS NSRE-2 can confer ER-responsiveness to the CHOP AARE (100). Bruhat et al.(100) further demonstrated that, unlike CHOP, induction of the ASNS expression following amino acid limitation does not require ATF2. These differences in mediating the AAR led the authors to propose that different molecular mechanisms are involved for the transcriptional activation of the ASNS and the CHOP in response to amino acid availability. Transcriptional control of C/EBP gene The promoter region of C/EBP gene has been cloned from mouse, rat, chicken and Xenopus laevis (67, 103). To the best of my knowledge, information concerning transcriptional regulation of the human C/EBP gene is not yet published. The promoter region of the rat C/EBP gene is the most extensively studied. Niehof et al. (104) have demonstrated that in HepG2 cells there are two cAMP-response element (CRE)like sequences (5-TGACG-3) located within the rat C/EBP proximal promoter at nt to

PAGE 31

20 and to , and that they are necessary for maintaining basal transcription. By EMSA/supershift, Niehof et al. (104) identified that CREB binds to both sites. These two CRE-like elements are also important for mediating C/EBP induction by the protein kinase A pathway via CREB. Furthermore, for regulation of the acute phase response in hepatocytes, the two CRE-like sequences serve as IL-6 responsive elements (105). To induce C/EBP transcription by the acute phase response, IL-6 activates STAT3 and DNA binding of a 68-kDa protein (p68) to the CRE-like sites in the C/EBP proximal promoter. STAT3 then tethers to the p68-containing complexes and acts as a coactivator to activate transcription (105). Berrier et al. (106) reported that in U937 promonocytic cells the downstream CRE-like sequence (nt to ), in conjunction with an upstream GC box (nt to -75) in the mouse C/EBP promoter, is required for activation of U937 cells by lipopolysaccharide and phorbol ester phorbol-12-myristate-13-acetate, consistent with the role of C/EBP in macrophage/monocyte differentiation. The authors also determined that members of ATF/CREB family bind to the CRE-like site and Sp family members such as Sp1 bind to the GC box (106). Recently, transcriptional regulation of C/EBP gene during adipogenesis was investigated (107). Zhang et al. (107) demonstrated that both TGA1 and TGA2 sites in the mouse C/EBP proximal promoter are required for the induction of luciferase activity by differentiation inducers. TGA1 (nt to , 5TGACG CGCACC-3) and TGA2 (nt to , 5TGACG CAGCCC-3) contain core CREB binding sites and coincide with the two CRE-like elements (5-TGACG-3) in the rat C/EBP promoter as determined by Niehof et al. (104). Using EMSA and chromatin immunoprecipitation

PAGE 32

21 (CHIP), Zhang et al. (107) documented that CREB, ATF1 and CREM associated with the C/EBP proximal promoter. Expressing a constitutively active CREB in 3T3-L1 preadipocytes activated C/EBP promoter activity, induced endogenous C/EBP expression, and promoted adipogenesis in the absence of differentiation inducers. Opposite effects were observed when a dominant negative form of CREB was expressed (107). These results provide a molecular mechanism for the role of C/EBP in adipocyte differentiation. Little is known about nutrient-dependent transcriptional regulation and the signal transduction pathways mediating it in mammalian cells. Depriving a cell of nutrients such as amino acids or glucose results in global and profound changes in its metabolic stance, and the cell must respond to this kind of environmental stress, in part, by modifying its gene expression profile. Therefore amino acids or glucose can be viewed as signaling molecules. I began my graduate work by characterizing the unique nutrient-sensing response unit (NSRU) in the human ASNS promoter. Using the sequence as a starting point, C/EBP was identified as one of the trans-factors that bind the NSRU. By studying transcriptional control of the human C/EBP gene itself, one can trace one step further backwards up the nutrient-sensing pathways toward understanding how a cell adapts to the ever-changing levels of amino acids and carbohydrate.

PAGE 33

22 Figure 1-1. Summary of the DMS in vivo footprinting and the site-directed mutagenesis. The roman numerals denote the six protein binding sites identified by in vivo footprinting: open circles represent constitutively-protected guanines, closed circles represent constitutively-enhanced guanines, open triangles represent guanines for which protection was greater in nutrient-deprived cells, and arrowheads represent enhanced adenines. For mutagenesis of site V and site VI (see Chapter 3 for details), substitutions that resulted in a loss of AAR or UPR-induced transcription activation are boxed and shaded, whereas those nucleotides marked with an asterisk (*) were mutated with no loss of transcription. The in vivo footprinting experiments were performed by Dr. Ione Barbosa-Tessmann (57).

PAGE 34

CHAPTER 2 MATERIAL AND METHODS Cell Culture Human hepatoma HepG2 cells were cultured in minimal essential medium eagle, with Earle’s salts (MEM) pH 7.4 (Mediatech Inc., Herndon, VA). The MEM was supplemented to contain 4 mM glutamine, 1X non-essential amino acids (Invitrogen, Carlsbad, CA), 10 g/mL streptomycin sulfate, 100 g/mL penicillin G, 28.4 g/mL gentamycin, 0.023 g/mL N-butyl-p-hydroxybenzoate, 0.2% (w/v) bovine serum albumin (BSA), and 10% (v/v) fetal bovine serum (FBS). Cells were maintained at 37C in a 5% CO2/95% air incubator. To test for regulated expression of the human asparagine synthetase (ASNS) gene or the human CCAAT/enhancer binding protein beta (C/EBP gene, control or transfected HepG2 cells were cultured to near 70-80% confluency prior to medium change to different nutritional conditions, including nutrient-fed (MEM), histidine-free MEM (MEM-His), and glucose-free MEM (MEM-Glc). For complete MEM, the medium was supplemented with 42 g/mL histidine and 1 mg/mL glucose. Site-Directed Mutagenesis All site-directed mutagenesis were performed using the QuikChange Site-Directed Mutagenesis Kit from Stratagene. 23

PAGE 35

24 The ASNS Nutrient-Sensing Response Unit (NSRU) Single nucleotide mutagenesis was performed within the ASNS promoter region from nt to . Each purine was changed to its alternative purine (e.g. adenine to guanine and vice versa), and each pyrimidine to its alternative pyrimidine (e.g. cytosine to thymine and vice versa). For nt , -69, -68, -49, -48, -45, and , additional mutagenesis was performed to better define the boundaries for the NSRU. More structural distortion was introduced by changing purines to pyrimidines and vice versa, as well as base pairing (e.g. adenine <--> cytosine, guanine <--> thymine). All single nucleotide substitutions were made within a construct containing the proximal ASNS promoter from nt to +51, upstream of the human growth hormone (GH) reporter gene (108). To better duplicate mammalian gene transcription and increase reporter stability, the GH reporter in the construct contains the structural GH gene including introns and 3 UTR so that the GH transcript will be transcribed and processed as endogenous genes (108). The transcriptional activity of the ASNS promoter fragments was assayed by transient transfection (batch protocol) and GH Northern blotting, each described below. The C/EBP 3 Genomic Region Block substitutions were made within the C/EBP 3 genomic sequence from nt +1423 to +2213. To avoid introducing unintentional mutations into the C/EBP promoter fragment (nt /+157), the mutations were generated using the pBluescript plasmid containing the C/EBP 3 genomic sequence nt +1423 to +2213 as the template. After confirmation by DNA sequencing, fragments of the C/EBP 3 genomic sequence (nt +1423 to +2213) containing individual block mutations were excised out with BamHI

PAGE 36

25 from the pBluescript vector, and then ligated under the control of the C/EBP promoter fragment nt /+157 (Fig. 2-2A). The wild-type or mutated C/EBP 3 genomic sequences were cloned into BamHI site downstream of the Firefly luciferase reporter gene (pGL3-basic vector, Promega Corp., Madison, WI) (Fig. 2-2A). A C/EBP-ATF site (bold face), 5TTGATGCAATC -3 (nt +1567/+1576), was mutated to 5CGAGGCGTTAT -3. The endoplasmic reticulum response element (ERSE) (bold face) and its 5’ flanking sequence, 5-GCAACCCACG-3 (nt +1618/+1627), were changed to 5TTCGATATTC -3. Large portion of the nutrient-sensing response element-2 (NSRE-2) (bold face, complementary sequence) and its 3 flanking nucleotides, 5-TGTAACTGTCAG-3 (nt +1628/+1639), were replaced by 5TGGGGACTCAGT -3. The core sequence of the ERSE (bold face) and NSRE-2 (underlined, complementary sequence), 5CCACG TGTAAC T -3 (nt +1623/+1634), was mutated to 5CATTCGAGGGAC -3. The C/EBP promoter/luciferase reporter/wild-type or mutated C/EBP 3 genomic sequence constructs were transiently transfected into HepG2 cells, as described below. The enhancer activity of the C/EBP 3 genomic sequences was assayed by measuring the Firefly luciferase activity. Northern Blot Analysis HepG2 total RNA was extracted using the RNeasy Mini kit (Qiagen Inc., Valencia, CA). Total RNA (15 g/lane) was resolved on a 1% denaturing agarose gel and blotted onto a Hybond-N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ). 32 P-radiolabled cDNA probes were synthesized using the StripEZ DNA kit (Ambion, Austin, TX). All procedures for Northern blotting followed protocols outlined

PAGE 37

26 in the Kilberg Laboratory Method Database. The GH cDNA probe was a 651 bp sequence containing the entire open reading frame (108). The LacZ cDNA probe was a 1.8 kb sequence corresponding to the entire coding region (pcDNA3.1, Invitrogen). The cDNA probe for the ribosomal protein L7a was a 600 bp sequence between two PstI sites that covered a portion of the coding and untranslated regions within the 3 half of the full-length cDNA obtained from Dr. Tatsuo Tanaka, University of Ryukyus, Okinawa, Japan. The ASNS cDNA probe was a 1842 bp RT-PCR product of the entire coding region of the human ASNS (54). The cDNA probe for C/EBP was nt +1425 to +1632, which corresponds to a fragment of the 3 UTR of the human C/EBP mRNA obtained by RT-PCR. The cDNA probe for C/EBP was the entire 3 UTR of the human C/EBP mRNA obtained by RT-PCR. The glyderaldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe was the entire coding sequence obtained from Dr. Anupam Agarwal, University of Alabama. The band intensity on a Northern blot corresponding to individual mRNA content was digitized by a phosphorimager (Molecular Dynamics, Amersham) followed by quantification using the Chemidoc software (Bio-Rad Laboratory, Hercules, CA). Slot Blot Analysis The procedure for total RNA isolation was as described in the “Northern Blot Analysis” section. Total RNA (15 g/slot) was lyophilized and resuspended in Slot Denaturing Solution (320 l 20X SSC, 1120 l 37% formaldehyde, 3200 l deionized formamide). The resuspended RNA was then denatured at 68C for 15 min and blotted onto a Hybond-N nylon membrane (Amersham) using The CONVERTIBLE Filtration Manifold System (Invitrogen). Subsequent radioactive cDNA probe synthesis,

PAGE 38

27 hybridization and blot quantification were identical to the procedures for Northern blot analysis. Transient Transfection HepG2 cells were transfected at ~50% confluency using SuperFect transfection reagent (Qiagen) according to manufacturer’s suggestions with minor modifications. The ratio of DNA to SuperFect reagent was 1 to 6 (g to l). The cells were washed once with phosphate buffered saline (PBS) (0.15 M NaCl, 10 mM sodium phosphate, pH7.4) and overlaid with MEM containing antibiotics and 10% FBS, before the addition of DNA:SuperFect complexes. For C/EBP gene analysis, HepG2 cells (2 x 10 5 cells per well in a 24-well plate) were seeded on the day before transfection. The C/EBP promoter/Firefly luciferase reporter/C/EBP 3 genomic sequence construct (1 g), and SV40 promoter/Renilla luciferase reporter cotransfection control (phRL-SV40, Promega) (0.005 g) were used to transfect each well. In case of assessing C/EBP 3 genomic enhancer activity under the control of an unrelated promoter, each well of cells were transfected with SV40 promoter/Firefly luciferase reporter/C/EBP 3 genomic sequence construct (0.9 g) and TK promoter/Renilla luciferase reporter cotransfection control (pRL-TK, Promega) (0.1 g). Eighteen hours after transfection, MEM, MEM-His, MEM-Glc or MEM+Tg was added to the appropriate wells and cells were incubated for another 8-12h. Cells were then lyzed and subjected to luciferase reporter assay. For the C/EBP overexpression study, HepG2 cells (2 x 10 5 cells per well in a 24-well plate) were seeded on the day before transfection. An ASNS promoter nt to +1/Firefly luciferase reporter construct (0.5 g), the pcDNA3.1 expression vector

PAGE 39

28 containing rat C/EBP cDNA (0.5 g) (kindly provided by Dr. Peter Johnson at NCI), and pRL-SV40 (0.05 g) were used to transfect each well. Eighteen hours after transfection, medium in each well was changed to MEM, MEM-His, or MEM-Glc, and the transfected cells were incubated for another 12 h. Cells were then lyzed and subjected to luciferase reporter assay. To examine the effect of overexpressing XBP1 or ATF6, 1 g of the pGL3 Firefly luciferase reporter construct, driven by either the human GRP78 promoter nt –132/+7 (a generous gift from Dr. Kazutoshi Mori, Kyoto, Japan) or by the C/EBP sequence nt +1601/+1646 under the control of the SV40 promoter, was co-transfected along with 0.5 ng of a reference Renilla luciferase expression plasmid, phRL-SV40 (Promega). When indicated, 0.5 g of pcDNA3.1 vector only (Invitrogen) or pcDNA3.1 containing the cDNA sequence for the active and nuclear form of ATF6 (amino acids 1-373) or the spliced and active form of XBP1 (both gifts from Dr. Kazutoshi Mori, Kyoto, Japan) was included. HepG2 cells were transfected at ~50% confluence in 24-well plates (2 x 10 5 cells/well) using the SuperFect transfection reagent (Qiagen). After transfection and a subsequent 18 h recovery in complete MEM medium containing 10% FBS, cells were then incubated for 12 h in either fresh complete MEM or MEM plus 300 nM Tg, each supplemented with 10% dialyzed FBS. The effect of transcription factor overexpression was measured by luciferase activity, as described below. Batch protocol. For single nucleotide mutagenesis of the ASNS promoter NSRU, HepG2 cells (3 x 10 6 cells/60-mm dish) were seeded on the day before transfection. Five g of ASNS promoter/GH reporter construct and 5 g of pcDNA3.1-LacZ cotransfection control (Invitrogen) were used to transfect each 60-mm dish. Eighteen hours after

PAGE 40

29 transfection, one 60-mm dish of the transfected cells was split into three wells of a 6-well plate. After another 24 h of culture, the transfected cells were incubated for 18 h in MEM, MEM-His or MEM-Glc. Total RNA was then isolated and Northern blot analysis was performed to measure the content of GH and LacZ mRNA. For C/EBP LAP and LIP overexpression studies, HepG2 cells (2 x 10 5 cells per well in a 24-well plate) were seeded on the day before transfection. An ASNS promoter nt to +1/Firefly luciferase reporter construct (0.5 g), the pSCT expression vector containing either LAP or LIP cDNA (0.5 g) (59), and phRL-SV40 (0.05 g) were used to transfect each well. Eighteen hours after transfection, cells from a single well were split into multiple (3-4) wells of a new 24-well plate. After another 24 h of culture, the transfected cells were incubated for 12 h in MEM, MEM-His or MEM-Glc. Cells were then lyzed and subjected to luciferase reporter assay. As an advantage of the batch transfection protocol, for each promoter/reporter construct tested, the transfection efficiency is comparable across dishes of cells subjected to different nutritional condition (i.e. MEM, MEM-His or MEM-Glc), because these cells are from a single transfected population. Therefore, the batch protocol eliminates the concern of transfection efficiency as a variable in reporter assays, so that the differences in promoter activity observed among conditions truly reflect the effects of nutrient deprivation on transcription. Luciferase Reporter Assay The activity of Firefly and Renilla luciferase was measured by the Dual-Luciferase Reporter System according to the manufacturer’s directions (Promega), with a luminometer (Berthold Detection Systems, Oak Ridge, TN).

PAGE 41

30 Genomic Cloning of the Human C/EBP Gene A BAC clone (RP11-112L6) containing human DNA sequence from chromosome 20 was obtained from the Sanger Institute (Cambridge, UK). The original clone was propagated in Luria-Bertani broth containing 20 g/mL chloramphenicol and the DNA was isolated using a NucleoBond BAC Maxi kit (Clontech, Palo Alto, CA). To obtain a DNA fragment encompassing the entire coding sequence as well as 5 and 3 genomic regions of the C/EBP gene, the BAC clone DNA was digested with a variety of restriction enzymes including NotI, EcoRI, HindIII, AclI or the combination of EcoRI and PvuI. The digested fragments were then separated by field inversion gel electrophoresis. Field Inversion Gel Electrophoresis (FIGE) Field inversion gel electrophoresis was performed as a way to separate large DNA fragments resulted from the restriction enzyme digestion of the BAC clone RP11-112L6. One g of restriction enzyme-digested BAC clone (RP11-112L6) DNA with 1X DNA dye (0.04% bromophenol blue, 0.04% Xylene cyanol FF, 2.5% Ficol, 50 mM EDTA pH 8.0) was loaded to one lane of a 1% agarose gel (Seakem LE agarose, Cambrex Bio Science Rockland Inc., Rockland, ME) and electrophoresed in 0.5X TBE using FIGE apparatus (Bio-Rad) for 15 h at room temperature. The gel was then stained with ethidium bromide for 30 min and examined on a UV light box. To identify the DNA fragments containing the C/EBP gene, the gel was subjected to Southern blot analysis. The restriction fragments were transferred to the Hybond-N nylon membrane (Amersham) following procedures described in the Protocol 8 of the Molecular Cloning: A Laboratory Manual (109). The resulting blot was hybridized to the radioactive cDNA probe corresponding to the human C/EBP 3 genomic region nt

PAGE 42

31 +1425 to +1632. The procedures for probe synthesis and hybridization are as described in the Northern Blot Analysis section. From these probings, an 11.5 kb EcoRI fragment containing the C/EBP gene and the flanking genomic sequence was identified. Colony Hybridization To clone the 11.5 kb C/EBP genomic fragment (nt -8451/+3074) containing the entire coding sequence as well as the 5 and 3 flanking regions (Fig. 2-1) as identified by the FIGE and subsequent Southern blotting, the BAC clone RP11-112L6 was again digested with EcoRI and PvuI. The digested fragments were then separated on 1% low-gelling temperature agarose gel (SeaPlague, Cambrex Bio Science Rockland Inc.) and FIGE, followed by ethidium bromide staining. A gel piece containing the 11.5 kb C/EBP genomic fragment was excised and extracted with -agarase I (New England Biolabs, Beverly, MA) digestion. To digest the gel piece with the -agarase I, the agarose gel slice was first equilibrated by washing twice with two volumes of 1X -agarase I buffer (10 mM Bis Tris-HCl, 1 mM EDTA, pH 6.5) on ice for 30 min each. The remaining buffer was then discarded and to melt the equilibrated gel piece, it was incubated at 65C for 10 min. The molten agarose was then cool to 42C and digested with 1 unit/200l -agarase I at 42C for 1 h. To precipitate the 11.5 kb C/EBP genomic fragment, the -agarase I-digested agarose was incubated on ice for 15 min in 0.3 mM sodium acetate and 2.5 volume of isopropanol, centrifuged at room temperature at 15000 X g for 15 min to pellet any incompletely digested agarose. The supernatant containing the 11.5 kb DNA was precipitated by adding 2 volumes of isopropanol and 1 g of yeast tRNA, mixed, chilled at -70C for 30 min and centrifuged at 20800 X g for 15 min. The pellet containing the

PAGE 43

32 11.5 kb C/EBP genomic sequence (nt to +3074) was then washed with 500 l of cold 70% isopropanol, dried at room temperature, resuspended in TE pH 8.0. The gel-purified 11.5 kb fragment was then ligated into EcoRI-digested pBluescript II SK (Strategene, LaJolla, CA), and electroporated into DH5-E. The resulting white colonies were selected and inoculated on a Hybond-N nylon membrane on top of a Luria-Bertani agar plate. After culturing for 18 h, the bacterial colonies were lyzed and plasmid DNA denatured directly on the Hybond-N nylon membrane as described in the Protocol 28, 31 and 32 in the Molecular Cloning: A Laboratory Manual (109). To screen for the presence of the 11.5 kb fragment insert in the pBluescript vector, the nylon membrane was hybridized to the 32 P-radiolabled cDNA probe corresponding to the C/EBP 3 genomic region +1425 to +1632. The hybridization and probe synthesis are as described in the Northern Blot Analysis section. The positive clone was propagated from the duplicate Luria-Bertani agar plate and the plasmid DNA was isolated using a Plasmid Maxi kit (Qiagen). Cloning of the Human C/EBP Promoter Fragments The C/EBP promoter fragment nt /+157 was obtained by digesting C/EBP (-8451/+3074)/pBluescript plasmid DNA with EcoRI and FseI. The staggered ends of the EcoRI-FseI C/EBP fragment (/+157) were blunted by T4 DNA polymerase, and then ligated with the blunt ends of the pGL3-basic vector (Promega) generated by SmaI linearization (Fig. 2-2B). The Firefly luciferase reporter construct containing the C/EBP promoter fragment nt -1595/+157 was prepared by digesting the C/EBP promoter (-8451/+157)/pGL3 construct with KpnI and BstEII to remove the C/EBP sequence upstream of nt -1595, and religating the two T4 DNA polymerase-blunted ends together

PAGE 44

33 (Fig. 2-2B). C/EBP fragment nt -325/+307 was generated by PCR using 16 ng of C/EBP (-8451/+3074)/pBluescript plasmid DNA as template. Each PCR reaction (50 l) contained: 35.5 l of sterile H 2 O, 5 l of the 10X Herculase buffer (Stratagene), 1 l of dNTP (10 mM), 1 l (16 ng) of the template, 2.5 l (250 ng) of primer “HCEBPB-PMTR-325-PL” (Table 2-1), 2.5 l (250 ng) of primer “hB-PM+307(-325)-MI” (Table 2-1), 0.5 l (2.5 U) of Herculase Hotstart Polymerase (Stratagene), and 12 l of DMSO. The PCR reactions were then subjected to the cycling program as follows: 98C 3 min, 10 cycles of 98C 40 sec, 70C 30 sec, 72C 90 sec, followed by 25 cycles of 98C 40 sec, 70C 30 sec, 72C 90 sec (plus 10 sec/cycle), and a final extension step at 72C for 10 min. The resulting PCR fragment was digested with HindIII and FseI to generate C/EBP promoter fragment nt /+157. Subsequently, the ends of the C/EBP (-325/+157) fragment was modified by T4 DNA polymerase, and ligated into the SmaI site of the pGL3-basic vector (Promega) (Fig. 2-2B). Cloning of the Human C/EBP Sequences 3 to the Protein Coding Region The C/EBP sequences 3 to the protein coding region, nt +1554/+1646, +1423/+2213 and +1423/+3541, were amplified by PCR using either C/EBP (-8451/+3074)/pBluescript plasmid (16 ng) or RP11-112L6 DNA (100 ng) as template. Each PCR reaction (50 l) contained: 40.5 l of sterile H 2 O, 5 l of the 10X Herculase buffer (Stratagene), 1 l of dNTP (10 mM), 1 l (16 ng or 100 ng) of the template, 1 l (100 ng) of sense primer, 1 l (100 ng) of antisense primer, and 0.5 l (2.5 U) of Herculase Hotstart Polymerase (Stratagene). The PCR reactions were then subjected to the cycling program as follows: 95C 2 min, 10 cycles of 95C 30 sec, 65C 30 sec, 72C

PAGE 45

34 2 min 30 sec, followed by 20 cycles of 95C 30 sec, 65C 30 sec, 72C 2 min 30 sec (plus 10 sec/cycle). The C/EBP fragment nt +1554/+1646 was amplified using primer pairs “hB3UTR-807PL-BamHI” and “hB3UTR-899MI-BamHI”, fragment nt +1423/+2213 “HB-3-676-PL-BamHI” and “HB-3-1466-M-BamHI”, fragment nt +1423/+3541 “HB-3-676-PL-BamHI” and “HB-3-2794-M-BamHI” (Table 2-1). All PCR-generated 3 downstream genomic sequences were cloned into the BamHI site downstream of the poly adenylation signal for the Firefly luciferase reporter gene in the C/EBP promoter (-1595/+157)/pGL3 construct (Fig. 2-3A). C/EBP 3 genomic sequence nt +1554/+1646 was also inserted into the BamHI site of the pGL3-promoter vector (Promega) (Fig. 2-3B), so that the 93 bp sequence was under the control of a unrelated promoter, SV40. The constructs generated for investigating nutrient control of the C/EBP gene is summarized in Table 2-2. Real-time Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Twenty-five to 200 ng of HepG2 total RNA was used in each reaction to measure the mRNA content of C/EBP, ASNS, and GAPDH genes. SYBR Green chemistry was used to amplify the genes of interest (Applied Biosystems Inc., Foster City, CA). The primers for amplification were: C/EBP: 5AGAACGAGCGGCTGCAGAAGA-3 and 5CAAGTTCCGCAGGGTGCTGA-3; ASNS: 5-GCAGCTGAAAGAAGCCCAAGT-3 and 5TGTCTTCCATGCCAATTGCA-3; GAPDH: 5TTGGTATCGTGGAAGGACTC-3 and 5-ACAGTCTTCTGGGTGGCAGT-3 (Dr. YuanXiang Pan, University of Florida).

PAGE 46

35 The RT-PCR reactions were performed and quantified using a DNA Engine Opticon 2 system (MJ Research, Reno, NV). Each RNA sample was measured in duplicate and three independent RNA samples were collected for each time point in MEM or MEM-Glc condition.

PAGE 47

36 3'UTR ( +1244/+1840 ) Pol y A si g nal +3541 -8451 CDS ( +206/+1243 ) Transcri p tion start ( +1 ) TATA box ( -28/-22 ) Figure 2-1. Human C/EBP gene structure. All numbers are relative to the transcription start at +1. CDS, protein coding sequence for the C/EBP gene.

PAGE 48

37 Human C/EBPpromoter fragment nt –8451/+157,nt 95/+157, ornt 5/+157 Human C/EBPpromoter fragment nt –8451/+157,nt 95/+157, ornt 5/+157 Human C/EBPpromoterfragment nt-1595/+157 WT or mutatedHuman C/EBP3genomic sequencent +1423/+2213 Human C/EBPpromoterfragment nt-1595/+157 WT or mutatedHuman C/EBP3genomic sequencent +1423/+2213 B A Figure 2-2. Firefly luciferase reporter constructs for A) mutagenesis, and B) C/EBP promoter study.

PAGE 49

38 Human C/EBPpromoterfragment nt-1595/+157 Human C/EBP3genomic sequencent +1423/+3541,nt +1423/+2213, ornt +1554/+1646 Human C/EBPpromoterfragment nt-1595/+157 Human C/EBP3genomic sequencent +1423/+3541,nt +1423/+2213, ornt +1554/+1646 A Human C/EBP3genomic sequencent +1554/+1646 Human C/EBP3genomic sequencent +1554/+1646 B Figure 2-3. Firefly luciferase reporter constructs (continued) for A) the study of C/EBP genomic sequence 3 to the protein coding region, and B) the effects of C/EBP 3 genomic sequence on the stress-inert SV40 promoter.

PAGE 50

39 Table 2-1. PCR primers for generating human C/EBP promoter fragments or 3 genomic sequences Primer name Primer sequence HCEBPB-PMTR-325-PL 5-GTATAAGCTTCTCCGATTCCCCCGCCTTCCAGG-3 hB-PM+307(-325)-MI 5-GGGAAGCTTAGTCCGCCTCGTAGTAGAAGTTGGCC-3 hB3UTR-807PL-BamHI 5-GAAGGATCCGCCGGTTTCGAAGTTGATGCAATCG-3 hB3UTR-899MI-BamHI 5-GAAGGATCCGGCCCGGCTGACAGTTACACG -3 HB-3-676-PL-BamHI 5-GTTGGATCCGTCCAAACCAACCGCACATGC -3 HB-3-1466-M-BamHI 5-GTTGGATCCCAAACCCAAGCCTGACACTCG -3 HB-3-2794-M-BamHI 5-GCGGGATCCTTGAGGTCAAGCCCACATTGC -3

PAGE 51

40 Table 2-2. Constructs generated for investigating transcriptional control of the human C/EBP gene Clone storage # Clone name Description 322 C/EBP 3UTR Northern probe cDNA for the human C/EBP 3UTR from nt +1425/+1632, used in Northern blot analysis to determine C/EBP mRNA content 298 LAP expression plasmid Used to overexpress rat full-length C/EBP 299 LIP expression plasmid Used to overexpress rat dominant-negative C/EBP 267 C/EBP expression plasmid Used to overexpress rat C/EBP 264 MSV/EBP Contains the ORF region for mouse C/EBP (Not tested in overexpression experiments) 443 C/EBP promoter-8451/Luc The luciferase reporter gene under the control of the human C/EBP promoter fragment from nt -8451 to +157 444 C/EBP promoter-1595/Luc The luciferase reporter gene under the control of the human C/EBP promoter fragment from nt -1595 to +157 445 C/EBP promoter-325/Luc The luciferase reporter gene under the control of the human C/EBP promoter fragment from nt -325 to +157 446 C/EBP +2213/-1595/Luc Human C/EBP 3 genomic sequence nt +1423/+2213 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the hC/EBP promoter nt -1595/+157 447 C/EBP +3541/-1595/Luc Human C/EBP 3 genomic sequence nt +1423/+3541 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the hC/EBP promoter nt -1595/+157 448 C/EBP +1646/-1595/Luc Human C/EBP 3 genomic sequence nt +1554/+1646 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the hC/EBP promoter nt -1595/+157

PAGE 52

41 Table 2-2. Continued Clone storage # Clone name Description 449 C/EBP +1646 (B)/SV40/Luc Human C/EBP 3genomic sequence nt +1554/+1646 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the SV40 promoter 450 C/EBP +1646 (S)/SV40/Luc Human C/EBP 3genomic sequence nt +1554/+1646 cloned in the SalI site downstream of the Luciferase reporter gene driven by the SV40 promoter 451 2X_C/EBP +1646/SV40/Luc Two copies of the human C/EBP 3genomic sequence nt +1554/+1646 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the SV40 promoter 452 ATF-CEBP_Del/SV40/Luc Human C/EBP 3genomic sequence nt +1583/+1646 (ATF-C/EBP site deleted) cloned downstream of the Luciferase reporter gene driven by the SV40 promoter 453 NSRE2_Del/SV40/Luc Human C/EBP 3genomic sequence nt +1554/+1626 (NSRE2 and half of the E box deleted) cloned downstream of the Luciferase reporter gene driven by the SV40 promoter 454 Mut_ATF-CEBP/-1595/Luc Block mutation of the ATF-C/EBP site core sequence within the human C/EBP 3 genomic sequence nt +1423/+2213 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the human C/EBP promoter nt /+157 455 Mut_E box/-1595/Luc Block mutation of the E box and 5’flanking sequence (NSRE2 intact) within the human C/EBP 3genomic sequence nt +1423/+2213 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the human C/EBP promoter nt /+157 456 Mut_NSRE2/-1595/Luc Block mutation of the NSRE2 and 3’flanking sequence (E box intact) within the human C/EBP 3 genomic sequence nt +1423/+2213 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the human C/EBP promoter nt /+157

PAGE 53

42 Table 2-2. Continued Clone storage # Clone name Description 457 Mut_NSRE2+E box/-1595/Luc Block mutation of both NSRE2 and E box core sequence within the human C/EBP 3 genomic sequence nt +1423/+2213 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the human C/EBP promoter nt /+157 467 hC/EBP (-8451/+3074)/pBS Human C/EBP genomic sequence from nt -8451 to +3074 cloned into the EcoRI site of the pBluescript II SK 470 hC/EBP (+1423/+2213)/pBS Human C/EBP genomic sequence from nt +1423to +2213cloned into the BamHI site of the pBluescript II SK 468 RP11-112L6 Original glycerol stock (only one tube) of the BAC clone containing the human chromosome 20 DNA from the Sanger Institute 471 C/EBP +1646/-325/Luc Human C/EBP 3 genomic sequence nt +1554/+1646 cloned in the BamHI site downstream of the Luciferase reporter gene driven by the hC/EBP promoter nt -325/+157 472 C/EBP +1646 (REV)/-1595/Luc Human C/EBP 3 genomic sequence nt +1554/+1646 cloned in the BamHI site in the REVERSED orientation downstream of the Luciferase reporter gene driven by the hC/EBP promoter nt /+157

PAGE 54

CHAPTER 3 CHARACTERIZATION OF THE NUTRIENT-SENSING RESPONSE ELEMENTS FOR THE ASPARAGINE SYNTHETASE GENE Introduction During a previous investigation, dimethyl sulfate in vivo footprinting had documented that the human asparagine synthetase (ASNS) promoter region immediately upstream of the major transcription start site contains six putative protein-binding sites, five of which are associated with nutrient regulated transcription, three GC boxes (sites I-III) and nutrient-dependent protein-binding sites, site V and site VI (Fig. 1-1) (57). The three GC boxes serve to maintain the level of basal transcription and to permit maximal activation of the ASNS gene following amino acid or glucose limitation (58). For the other two regulatory sites identified by in vivo footprinting, sites V and VI, protein binding was enhanced in response to activation of either the amino acid response (AAR) or the unfolded protein response (UPR) pathway (Fig. 1-1). In combination with the results obtained by deletion analysis (57), site V and site VI are likely to be the cis-acting elements mediating induction of the ASNS transcription following nutrient deprivation. However, the exact boundaries and the core sequence of the site V and site VI have not been established. Results Defining the Nutrient-Sensing Response Elements (NSREs) in the ASNS Promoter To define the boundaries and to establish the core nucleotides for site V and site VI, single-nucleotide mutagenesis was performed across the entire region from nt to 43

PAGE 55

44 encompassing these two sites in the context of the nt -173/+51 ASNS promoter–GH reporter construct. Strategies for mutagenesis and characteristics of the GH reporter gene are described in chapter 2. Following transient transfection and subsequent incubation of the cells in MEM, MEM lacking histidine or MEM lacking glucose, transcription was assayed by Northern blot analysis so as to avoid the effects of nutrient deprivation on GH reporter protein synthesis. For many of the nucleotides only a single mutant was prepared but, after the first round of mutagenesis, to better define the apparent edges of the site V and site VI core sequence, both transition and transversion mutations were made. The set of mutations that best defined the boundaries are shown in Fig. 3-1. The percentage inhibition caused by mutation of individual nucleotides within site V or site VI was sometimes slightly different depending on whether basal or starvation-activated transcription was assayed. These variations may reflect different proteins bound in fed versus starved states, but given that mutagenesis of each nucleotide within the two binding sites suppressed both basal and activated transcription to some degree, inhibition under either condition was seen as indicative of a contribution and was used to define the ‘core sequence’. The ‘core’ nucleotides for site V are 5-TGATGAAAC-3 (nt -68 to -60), and for site VI the core element is 5-GTTACA-3 (nt -48 to -43). In addition to amino acid limitation (i.e. histidine deprivation), the involvement of individual nucleotides within site V and site VI following activation of the UPR was examined by testing the effect of each mutant under glucose-deprived condition (Fig. 3-1). Given that substituting any single nucleotide within the core sequence of either site V or VI resulted in a loss of promoter activity in cells deprived of either amino acid or glucose, a term “nutrient-sensing response element (NSRE)” was coined to reflect the

PAGE 56

45 broader substrate detecting capability of these two sites. Therefore, site V (5-TGATGAAAC-3, nt -68 to -60) is referred to as the NSRE-1 and site VI (5-GTTACA-3, nt -48 to -43) the NSRE-2 (Fig. 3-1). Mutating any nucleotide between nt to of the ASNS proximal promoter had no effect on promoter activity in either nutrient-fed or –deprived condition (Fig. 3-1). This 11 bp intervening sequence functions as a spacer between NSRE-1 and NSRE-2 and the mutagenesis suggests that the specific composition of the nucleotides is not critical. Furthermore, by electrophoresis mobility shift assay (EMSA) analysis using an oligonucleotide probe with this sequence did not result in any specific protein complexes (Can Zhong, personal communication). However, the length of 11 bp (i.e. the distance between NSRE-1 and NSRE-2) is crucial for ASNS transcriptional induction by nutrient deprivation (102). Given that NSRE-1 and NSRE-2 work in concert with each other (i.e. mutating either element inhibited the transcriptional induction by nutrient limitation) (Fig. 3-1), the term “nutrient-sensing responsive unit (NSRU)” was coined to reflect the cooperative and the spatial relation between the NSRE-1 and NSRE-2. Therefore the core sequence for the entire NSRU of the ASNS gene is 5-TGATGAAACN 11 -GTTACA -3 (Fig. 3-4). Identification and Characterization of the Trans Factors that Bind the NSRE-1 Characterizing the NSRU of the ASNS gene presents an opportunity for identifying transcriptional regulators that mediate nutrient-sensing response pathways. To do so, the first step the Kilberg laboratory took was to investigate the identity of the factors that activate the ASNS gene via binding to the NSRU following the AAR or ERSR activation. Because the NSRU sequence does not match perfectly to any known transcription factor binding sites, yeast one-hybrid screening was performed (59). Three copies of the NSRE

PAGE 57

46 1 were used as a bait to screen a human pancreatic cDNA library. A pancreatic cDNA library was used because the abundance of ASNS mRNA is far greater in this tissue than any other (2). A total of 2.51 X 10 6 colonies were screened for growth in histidine-free condition and seven colonies were judged to be potential positives. Three out of the seven clones exhibited much greater -galactosidase activity than background level in the secondary screening -galactosidase filter lift assay. Subsequent sequencing analysis revealed that all three clones had identity to the CCAAT/enhancer binding protein (C/EBP) family of transcription factors (59). Electrophoresis mobility shift assay (EMSA) was then performed to determine which members of the C/EBP family were present in HepG2 cells and which had affinity for the NSRE-1 sequence (59). Antibodies against C/EBP, C/EBP, C/EBP, C/EBP and C/EBP homology protein (CHOP) were screened for the ability to supershift NSRE-1-protein complexes in vitro. Anti-C/EBP antibody caused the most dominant formation of shifted complexes in MEM condition and the amount of those complexes were increased following histidine or glucose deprivation. C/EBP was also detectable in the complexes in amino acid-limited condition, while there were no supershifted complexes visible using nuclear extracts from cells incubated in complete MEM. The functional role of C/EBP factors in regulating ASNS gene transcription in response to nutrient availability is investigated in HepG2 cells, by examining the effects of overexpressing C/EBP or C/EBP on the expression of reporter gene driven by the ASNS promoter. Overexpressing C/EBP LAP and LIP HepG2 cells were transiently cotransfected with a Firefly luciferase reporter gene driven by a fragment of the ASNS proximal promoter (nt -115/+1) and a plasmid

PAGE 58

47 containing either the activating form of rat C/EBP (LAP) or the dominant-negative inhibitory isoform (LIP), both driven by the cytomegalovirus promoter (80). LAP and LIP are described in greater detail in chapter 1. An Equal molar amount of the expression LAP or LIP plasmid was introduced into cells. The HepG2 cells were transfected as described in chapter 2 and then transferred 48 h later to either complete MEM or MEM lacking histidine or glucose for 12 h prior to the isolation of a cell extract for Luciferase assay (Fig. 3-2A). The expression of transfected C/EBP isoforms was confirmed by Northern blot analysis, and probing the Northern blots revealed that both the LAP and LIP were expressed at relatively similar levels (Fig. 3-2B). Consistent with previously published results obtained by transient transfection reporter assay (55, 57), the Firefly luciferase activity was increased in both the histidineand glucose-deprived cells that received a plasmid containing no C/EBP cDNA (Fig. 3-2A, control). For those cells that were transfected with the LAP form of C/EBP, the basal expression (in complete MEM) was increased significantly (Fig. 3-2A). Relative to the control cells that received vector only, the induction following histidine or glucose limitation was further increased in the cells transfected with LAP. For histidine deprivation, this additional amount of activation was statistically significant. Although the effect of LAP overexpression in glucose-deprived cells did not reach statistical significance, the trend toward higher luciferase activity in the LAP-transfected cells was reproducible in multiple experiments. In contrast, overexpression of the dominant-negative LIP form of C/EBP resulted in an inhibition of basal transcription and a complete blockade of the induction by either glucose or histidine deprivation (Fig. 3-2A).

PAGE 59

48 The effects of C/EBP overexpression Previous EMSA/supershift results indicated that C/EBP may be part of the protein complex that binds to the ASNS NSRE-1 (59). To investigate in vivo the role of C/EBP in regulating ASNS expression, HepG2 cells were transiently cotransfected with a Firefly luciferase reporter gene driven by the ASNS proximal promoter (nt -115/+1) and a plasmid containing the rat C/EBP, driven by the cytomegalovirus promoter. Transfection with C/EBP LAP and LIP was also included as a positive control. The HepG2 cells were transfected and then transferred 24 h later to either complete MEM or MEM lacking histidine or glucose for 12 h prior to cell lysis for luciferase assay (Fig. 3-3). In agreement with the results in Fig. 3-2, ASNS promoter activity was increased in cells overexpressing LAP in MEM condition and a further enhancement was observed in both the histidineand glucose-deprived cells that received LAP cDNA (Fig. 3-3). For those cells that were transfected with the LIP form of C/EBP, the transcription rate was diminished in both nutrient-fed and –deprived conditions (Fig. 3-3). Exogenous expression of C/EBP, similar to that of LAP, further enhanced both basal and deprivation-induced transcription. However, when an equal molar amount of expression plasmid was used to transfect cells, the enhancement that resulted from C/EBP overexpression was more dramatic than that from LAP (Fig. 3-3). Discussion The proximal 180 bp of the human ASNS promoter sequence was compared to the corresponding ASNS promoter region of the mouse, rat and hamster (alignment courtesy of Stela Palii, Fig. 3-4). The GC-III site is the best conserved among the three GC boxes,

PAGE 60

49 whereas the GC-I site is the most variable. The core sequences of the NSRE-1 and NSRE-2, as determined by the single nucleotide mutagenesis described in this chapter, are 100% identical within all four species. Interestingly, the intervening 11 bp sequence between the NSRE-1 and NSRE-2 is also completely conserved across species, even though mutating any nucleotide in this region had no effect on ASNS promoter activity. In contrast, the flanking sequence on either side of the NSRU is less conserved. Further characterization revealed that the NSRU functions as an enhancer (102). It mediates the activation of ASNS gene in both orientations and in a position-independent manner. The sequential order of, or the distance between, GC-III and NSRU is not critical for the induction of ASNS by the AAR. Interestingly, however, the sequential order of the NSRE-1 and NSRE-2, within the NSRU, is important and cannot be reversed. The length of the highly conserved 11 bp intervening sequence (Fig. 3-4) between the NSRE-1 and NSRE-2 is also critical. Increasing or decreasing the 11 bp length resulted in a loss of transcriptional activation following histidine deprivation. The NSRE-1 sequence shares a high degree of homology to the AARE of the human CHOP gene. In the bottom strand of the CHOP promoter from nt to , the AARE core sequence is 5-TGATG C AA T -3 (the mismatched nucleotides to the NSRE-1 are underlined). As determined by Bruhat et al. (100), the consensus sequence of the CHOP AARE, which allows for the induction by amino acid deprivation, is 5-(R/C)TT(R/T)CRTCA -3 (R=A or G), suggesting that the two nucleotide differences between the NSRE-1 of the ASNS gene and the AARE of the CHOP gene are allowed, at least for the AAR. However, there are functional differences between the two elements. While the CHOP AARE alone is sufficient in mediating the transcriptional induction in

PAGE 61

50 response to amino acid limitation, the ASNS NSRE-1 requires the presence of the NSRE-2 (100). However, multiple copies of the NSRE-1 can confer amino acid-dependent regulation to the otherwise inert TK promoter in the absence of the NSRE-2, and this effect was not dependent on the distance between the NSRE-1 and the promoter (100). The NSRU of the ASNS is responsible for mediating both the AAR and UPR, whereas the CHOP gene utilizes two different elements in its promoter, an AARE for the AAR and a classic ERSE for the UPR (see chapter 1). Interestingly, Bruhat et al. (100) demonstrated that the ASNS NSRE-2 not only confers ER-responsiveness to the CHOP AARE, but also further enhances AARE-mediated transcriptional activation following amino acid deprivation. In agreement with the EMSA results (59), transcription factor overexpression in vivo further confirmed the role of C/EBP and C/EBP in activating ASNS gene transcription in response to either amino acid or glucose deprivation. To further walk backward up the AAR and UPR pathways, it is essential to investigate whether or not the human C/EBP gene itself is also regulated by ER stress or amino acid availability. The hypothesis is that transcription from the C/EBP gene is induced in response to either ER stress stimuli or amino acid deprivation (Fig. 3-5). To the best of my knowledge, no previous reports have demonstrated that the expression of C/EBP gene is regulated by ER stress or carbohydrate availability. Marten et al. (95) documented that the mRNA content of C/EBP is increased in H4-II-E rat hepatoma cells in response to limitation of a single essential amino acid such as phenylalanine, methionine, leucine and tryptophan. However, the mechanism by which the expression of C/EBP was enhanced was not explored. My investigation of the

PAGE 62

51 mechanism that activates the human C/EBP gene in response to amino acid availability is described in Chapter 4, while Chapter 5 documents the regulation of the C/EBP gene by ER stress.

PAGE 63

52 050100150200 MEM, GH / LacZ mRNA-Glc, GH / LacZ mRNA 020406080100120 20406080100120140 -His, GH / LacZ mRNA MutationsWT-68-60NSRE-1-48-43NSRE-2TGAAACCAGCAGGGACCTTTATGTAATCCCTCAAGATTCAGGCATGATGAAACTTCCCGCACGCGTTACAGGAGCC 050100150200 MEM, GH / LacZ mRNA 050100150200 MEM, GH / LacZ mRNA-Glc, GH / LacZ mRNA 020406080100120 -Glc, GH / LacZ mRNA 020406080100120 020406080100120 20406080100120140 -His, GH / LacZ mRNA 20406080100120140 -His, GH / LacZ mRNA MutationsWT-68-60NSRE-1-48-43NSRE-2TGAAACCAGCAGGGACCTTTATGTAATCCCTCAAGATTCAGGCATGATGAAACTTCCCGCACGCGTTACAGGAGCC -68-60NSRE-1-48-43NSRE-2TGAAACCAGCAGGGACCTTTATGTAATCCCTCAAGATTCAGGCATGATGAAACTTCCCGCACGCGTTACAGGAGCC (Site VI) (Site V)

PAGE 64

53 Figure 3-1. Single nucleotide mutagenesis of the ASNS promoter region from nt to -37. HepG2 cells were cotransfected with the ASNS promoter (wild-type and mutated)-GH reporter construct and pcDNA3.1-LacZ plasmid to correct for transfection efficiency between dishes, as described in chapter 2. Transfected HepG2 cells were incubated for 18h in complete MEM (top panel), MEM lacking histidine (-His, middle panel) or MEM lacking glucose (-Glc, bottom panel), prior to isolation of RNA and subsequent analysis of GH reporter and LacZ transfection control by Northern blotting. The wild-type (WT) nucleotide sequence of the ASNS proximal promoter from nt to nt-37 is presented in the top line, whereas the bottom line shows the mutations examined. The nucleotides at , -69, -68, -49, -48, -45, and -43 were changed to more than one nucleotide to better define the boundaries of the NSRE-1 and NSRE-2 sites, but the graphs depict the results from the mutations indicated in the bottom line. The expression of GH reporter is normalized for that of LacZ (GH/LacZ mRNA), and the data is presented as percentages of control values (set to be 100 %) obtained with the wild-type sequence.

PAGE 65

54 0123456Luciferase activity, fold induction MEM -Glc -His MEM -Glc* -His** MEM* -Glc** -His** Control LAP LIP ABControlLAP cDNALIP cDNAe-C/EBPLAPLIP 0123456Luciferase activity, fold induction MEM -Glc -Glc -His -His MEM -Glc* -His** MEM -Glc -Glc* -His** -His** MEM* -Glc** -Glc** -His** -His** Control LAP LIP ABControlLAP cDNALIP cDNAe-C/EBPLAPLIP

PAGE 66

55 Figure 3-2. C/EBP LAP and LIP isoforms modulate ASNS promoter activity accordingly. A) HepG2 cells were transiently transfected with vector containing no cDNA insert (Control), the cDNA for the activating LAP C/EBP isoform, or the cDNA for the inhibitory LIP C/EBP isoform. The LAP and LIP cDNA sequences were from the rat. The cells were simultaneously cotransfected with the ASNS promoter (nt /+1)/Firefly luciferase reporter construct (to monitor ASNS transcription in response to overexpression of C/EBP isoforms), and with a reference plasmid containing the Renilla luciferase reporter under the control of the SV40 promoter (to correct for transfection efficiency between wells). After transfecting using the batch protocol as described in chapter 2, the cells were incubated for 12 h in complete MEM (MEM) or in glucose-free MEM ( Glc) or histidine-free MEM ( His), and then cell were lysed and analyzed for both luciferase activities. The Firefly luciferase activity was normalized for the Renilla luciferase activity and the ratio is expressed as the means S.D. of four individual assays, which were repeated with multiple batches of cells. The normalized luciferase activity in the control cells incubated in MEM is set to be equal to 1.0. The differences in the ASNS promoter activity between the control and C/EBP-transfected cell populations under a given nutritional condition were calculated by Student's t test (*, p < 0.05; **, p 0.005). B) RNA was also isolated after transfecting HepG2 cells with expression plasmid containing either LAP or LIP cDNA. The mRNA for LAP and LIP were then detected by the Northern blot analysis to confirm expression of both isoforms. Endogenous human C/EBP mRNA (e-C/EBP) was also detected under the experimental conditions.

PAGE 67

56 0246ControlLAPLIPC/EBP MEM-Glc-His Relative Luciferase Activity 0246ControlLAPLIPC/EBP MEM-Glc-His Relative Luciferase Activity Figure 3-3. C/EBP activates ASNS promoter activity. (A) HepG2 cells were transiently transfected with vector containing no cDNA insert (Control), the cDNA for the activating C/EBP isoform (LAP), the cDNA for the inhibitory C/EBP isoform (LIP), or the cDNA for C/EBP (C/EBP). All C/EBP sequences were prepared from the rat. The cells were also simultaneously cotransfected with the ASNS promoter (nt /+1)/Firefly luciferase reporter construct and with a reference vector harboring the Renilla luciferase reporter driven by the SV40 promoter. After transfection and culture as described in chapter 2, the cells were incubated for 12 h in complete MEM (Fed) or in MEM lacking glucose ( Glc) or histidine ( His), and then cell lysates were analyzed for both luciferase activities. The Firefly luciferase activity is normalized for the Renilla luciferase activity to correct for the transfection efficiency between wells, and the data is expressed as relative luciferase activity.

PAGE 68

57 Figure 3-4. The sequence alignment of the ASNS proximal promoters. The human ASNS (AF239815) proximal promoter region nt /+1 was used to align the homologous 5 upstream regions of the mouse (AF262321), rat (NW_043740) and hamster (M27838) ASNS genes. The GenBank accession numbers are given in the parenthesis. The sequences were aligned using the ClustalW software and the output formatted with the Boxshade Software (version 3.21). The five cis-elements involved in the nutrient regulation of the human ASNS gene transcription are underlined and labeled. The nucleotides shown in capital letters in the consensus sequence indicated that those nucleotides were identical within all four species, whereas the lower case letter represents the nucleotide that was conserved in three of the four species (Alignment courtesy of Stela Palii)

PAGE 69

58 AA DEPRIVATION ER STRESS (-Glc, +Tm, +Tg) C/EBPGENEC/EBPmRNAC/EBPPROTEIN ASNS GENEASNS mRNAASNS PROTEIN + + AAR UPR AA DEPRIVATION ER STRESS (-Glc, +Tm, +Tg) C/EBPGENEC/EBPmRNAC/EBPPROTEIN ASNS GENEASNS mRNAASNS PROTEIN + + + + AAR UPR Figure 3-5. The hypothesis for ASNS transcriptional induction by the AAR or the UPR. The AAR and the UPR converge on the C/P gene to increase its transcription through unidentified upstream steps, which in turn leads to an increase in C/EBP protein content. C/EBP protein, along with other transcription factors, binds to the NSRE-1 in the ASNS proximal promoter to induce ASNS transcription and protein abundance.

PAGE 70

CHAPTER 4 REGULATION OF THE HUMAN CCAAT/ENHANCER-BINDING PROTEIN BETA GENE TRANSCRIPTION BY AMINO ACID AVAILABILITY Introduction Amino acids are usually viewed as the building blocks for protein synthesis, and their importance in general nutrition, development and disease progression is well established. Depriving cells of amino acids causes imminent stress on cellular functions. For cells to sense amino acid deprivation and respond in part by altering gene expression, amino acids function as signaling molecules. This response is better characterized in yeast Saccharomyces cerevisiae, reviewed in chapter 1, whereas little is known in mammals. The interest of my study focuses on the mammalian genes whose expression is transcriptionally induced by amino acid limitation. The examples of such genes include asparagine synthetase (ASNS) (57), CCAAT/enhancer binding protein (C/EBP) family transcription factor C/EBP homology protein (CHOP) (99, 100), and system A amino acid transporter (SNAT2) (110). The nutrient-sensing response element (NSRE)-1 (5-TGATGAAAC-3) and NSRE-2 (5-GTTACA-3) with the 11 bp spacer sequence in between, located within the human ASNS proximal promoter region from nt to , are responsible for mediating transcriptional induction of the ASNS gene in response to the amino acid responsee (AAR) (chapter 3). The sequence 5-TGATGCAAT-3, differ from the ASNS NSRE-1 (5-TGATGAAAC-3) by two nucleotides, is positioned in the promoter region of the human CHOP gene and shown to be necessary for increasing CHOP gene 59

PAGE 71

60 expression following amino acid deprivation (reviewed in chapter 1) (99, 100). This sequence is also present in the first intron of the human SNAT2 gene and functions as an amino acid response element (AARE) to activate SNAT2 transcription in response to amino acid limitation (110). Yeast one-hybrid screening, electrophoresis mobility shift assay (EMSA) with supershift and transient overexpression indicate that C/EBP is one of the transcription factors that bind the NSRE-1 to regulate nutrient-dependent ASNS gene expression (59) (Chapter 3). C/EBP is a member of the C/EBP family of transcription factors, and shared among them is a highly conserved bZIP domain at the C-terminus (reviewed in chapter 1). Given that the ASNS transcription is activated by amino acid deprivation, one can hypothesize that the expression of C/EBP gene itself is also regulated by amino acid availability (Fig. 3-5). Although Marten et al. (95) reported that C/EBP mRNA content is increased in the H4-II-E rat hepatoma cells by amino acid deprivation, no further investigation was conducted to examine the mechanism of this increase. This chapter documents that the induction of human C/EBP mRNA content following amino acid limitation is dependent on de novo protein synthesis, and that the mechanism for this induction is increased transcription. However, C/EBP promoter plays no major role in activating the gene. Instead, the cis-element mediating the AAR for the C/EBP gene is located within the genomic region 3' to the protein coding sequence.

PAGE 72

61 Results Induction of C/EBP mRNA by Histidine Deprivation To examine whether or not C/EBP mRNA content is altered in response to histidine deprivation, the HepG2 cells were incubated in histidine-free MEM for 0-12 h and Northern blot analysis was performed (Fig. 4-1). An initial increase in C/EBP mRNA content is observed between 1-2 h following histidine deprivation. This increase in mRNA reached a maximum of about 8-times the control value (0.2 mM histidine) at 8 h (Fig. 4-1B). On the contrary, C/EBP mRNA content in HepG2 cells declined slowly during the initial 4 h of histidine limitation, and then dropped more rapidly to 50% of the time 0 value at 12 h (Fig. 4-2). However, during the first 4 h, C/EBP mRNA is more abundant in amino acid-deprived cells than in amino acid-fed cells. Induction of C/EBP mRNA by the AAR Is Dependent on De Novo Protein Synthesis To determine whether an upstream regulator may be required for induction of the C/EBP gene, HepG2 cells were incubated in histidine-free MEM in the presence or absence of 0.1 mM cycloheximide (Fig. 4-3). Inhibition of protein synthesis also had an effect on the turnover of C/EBP mRNA, as indicated by the elevated mRNA content in cells incubated in complete MEM containing cycloheximide. A number of mRNAs have been shown to be stabilized by inhibition of protein synthesis, presumably the results of a protein factor that itself has short half-life. Cycloheximide completely prevented the increase in C/EBP mRNA content following AAR activation, suggesting that de novo protein synthesis is required to activate the C/EBP gene. .

PAGE 73

62 Induction of C/EBP mRNA Content by the AAR Is Not Due to mRNA Stabilization To test for mRNA stability as a possible mechanism for the AAR induction, HepG2 cells were incubated in histidine-free MEM for 8 h to induce C/EBP mRNA content and then transferred to either fresh histidine-free MEM or complete MEM, both containing 5 M actinomycin D (Fig. 4-4). The results showed that the half-life of C/EBP mRNA with or without histidine was approximately 1 h. The lack of a change in half-life indicated that the AAR-dependent elevation in C/EBP mRNA is likely not the result of an increase in mRNA stability. The C/EBP Promoter Region Alone Is Not Sufficient to Mediate Induction via the AAR The human C/EBP gene is intronless (111) and located on chromosome 20 (Genbank accession number: AL161937). Relative to the transcription start site, the first of multiple protein start sites is at +206 and the universal translation stop codon is at +1243 (60) (Fig. 4-5A). Although not fully characterized, a polyadenylation signal (5 AATAAA 3) is located approximately 1.8 kb downstream from the transcription start (Genbank accession number: NM_005194) (Fig. 4-5A). To investigate the potential role of the proximal promoter region in mediating C/EBP gene induction in response to amino acid limitation, a fragment (nt /+157) corresponding to the human C/EBP proximal promoter was tested (Fig. 4-5B). Compared to the 7-fold induction of C/EBP mRNA following histidine deprivation for 12 h (Fig. 4-1), this promoter fragment achieved no increase in luciferase activity under histidine-limited condition. To test the possibility that the cis-acting elements required for full induction may be located further 5 upstream, longer genomic fragments (nt

PAGE 74

63 -1595/+157 and -8451/+157) were examined. Similar results were obtained, in that neither 1.8 kb nor 8.6 kb promoter region was sufficient to produce a significant induction of C/EBP-mediated transcription. The C/EBP Genomic Sequence 3 to the Protein Coding Region Is Essential for the AAR Activation Given that the promoter region alone does not support induction by amino acid deprivation, the C/EBP 3 genomic sequence was investigated (Fig. 4-6). Sequentially deleted 3 fragments were ligated downstream of the luciferase reporter gene driven by the C/EBP promoter fragment nt to +157. To eliminate the contribution of mRNA stability, the C/EBP 3 genomic fragments were inserted downstream of the polyadenylation signal within the reporter plasmid (chapter 2). The C/EBP 3 sequence from nt +1423 to +3541 induced reporter gene expression 6-fold when cells were deprived of histidine, compared to the 1.2-fold induction achieved by the endogenous promoter alone (Fig. 4-6). When this 2.1 kb genomic sequence was deleted from its 3 end to a 0.8 kb DNA fragment covering nt +1423 to +2213, the approximate 5-fold degree of induction following amino acid limitation was maintained, and the absolute rates of both basal and induced transcription were moderately increased. When the C/EBP 3 sequence was narrowed even further to a 93 bp DNA fragment (nt +1554 to +1646), the absolute rates of both basal and amino acid deprivation-activated transcription were further enhanced, but because the increase in the basal rate was greater, the relative degree of induction was decreased to 2.8 fold (Fig. 4-6). Taken together, the data of Fig. 4-5 and 4-6 indicate that the cis-activating element(s) necessary to mediate the AAR induction for the C/EBP gene are located 3 to the protein coding

PAGE 75

64 sequence rather than within the upstream promoter region. The results also suggest that repressive elements for basal transcription exist within this region, including a reasonably strong element between nt +1423 to +1554 or +1646 to +2213. The C/EBP 3 Genomic Sequence Can Confer Amino Acid-regulated Transcription to an Unrelated Promoter To test the hypothesis that the genomic sequence nt +1554 to +1646 of the C/EBP gene could confer amino acid responsiveness to an unrelated promoter, the C/EBP promoter fragment used in the previous experiments was replaced with the SV40 promoter (Fig. 4-7). The SV40 promoter alone was inert to histidine deprivation, but when a single copy of the 93 bp C/EBP genomic sequence was present, transcription was induced to 3.5 times the MEM control, comparable to the fold induction resulted from the same 3 genomic fragment driven by the C/EBP promoter (nt /+157) (Fig. 4-6). When two copies of the C/EBP sequence (nt +1554/+1646) were present, the transcription rate was further enhanced in both the amino acid-fed and –deprived conditions; a 2.8-fold increase in transcription following histidine limitation was also observed (Fig. 4-7). Novel Amino Acid Response Elements Are Responsible for the C/EBP Gene Induction Interestingly, when the 93 bp sequence, nt +1554 to +1646, was analyzed by computer analysis and visual inspection, several sequences were identified that are similar to known amino acid response elements (Fig. 4-8A). To further investigate the possible genomic elements by which C/EBP gene transcription is increased in response to amino acid deprivation, mutagenesis of these potential amino acid response elements in the context of C/EBP 3 genomic region nt +1423/+2213 was performed (Fig. 4-8B).

PAGE 76

65 The wild-type sequence under the control of the C/EBP promoter /+157 induced luciferase reporter expression by approximately 8-fold in the histidine-deprived condition (Fig. 4-8B). The sequence 5TGATGCAAT3 (C/EBP-ATF site) from +1568 to +1576 (Fig. 4-8A), present also in the CHOP proximal promoter and the system A SNAT2 transporter intron 1, has been shown to induce CHOP and SNAT2 gene expression in response to amino acid limitation (99, 110). Although substituting this entire sequence within the C/EBP 3 region resulted in a decrease in the fold induction by histidine deprivation (decreased from 8to 3-fold), the absolute rates of transcription in both amino acid-fed and -deprived conditions were enhanced (Fig. 4-8B Mut-1). Similar results were obtained when the core and flanking sequences of the C/EBP-ATF site were deleted from the C/EBP 3 genomic fragment nt +1554/+1646 (Fig. 4-7). This suggests that the sequence 5-TGATGCAAT3 functions as a repressive element rather than an activating element, and is not the primary regulatory element for C/EBP gene expression in response to amino acid limitation. The obligatory element, NSRE-1 and NSRE-2, are responsible for mediating the AAR for the human ASNS gene (102, 112). Within the C/EBP 3 genomic region a NSRE-2 sequence is located from +1628 to +1633 (Fig. 4-8A). Mutation of the sequence 5 to the NSRE-2 (Fig. 4-8B Mut-2), or the NSRE-2 core and its 3 flanking region (Fig. 4-8B Mut-3) were tested for their effect on AAR-activated transcription. These two mutations caused a significant increase in basal transcription relative to the wild-type sequence, which contributed to a decrease in the fold-induction by histidine limitation (Fig. 4-8B, Mut-2 and 3). The results suggest that mutating the NSRE-2 like sequence (Mut-3) did not decrease the absolute transcription rate in the histidine-depleted MEM

PAGE 77

66 compared to the wild-type sequence. However, when the sequence immediately 5 to the NSRE-2 was mutated (Mut-2, Fig. 4-8B), there was a trend toward decreased transcription in the amino acid limiting condition, although when compared to the wild-type rate it did not reach statistical significance. Given that mutation of the sequences that are identical to those that function as AAR elements in other genes did not appear to completely block regulated transcription, identification of the element responsible for transcriptional induction of C/EBP gene by the AAR requires further investigation. Discussion The study in this chapter documented that: The mRNA content of C/EBP, but not that of C/EBP, is increased by histidine deprivation. Induction of C/EBP mRNA content requires de novo protein synthesis of a factor upstream of C/EBP along the AAR pathway. The increase in C/EBP mRNA content in response to amino acid limitation is transcriptional. The C/EBP promoter region alone is not sufficient to induce C/EBP expression following AAR activation. The DNA cis-elements necessary for the induction of C/EBP gene by the AAR are located within the genomic sequence 3 to the protein coding sequence. The transcriptional activation of C/EBP gene following amino acid deprivation may be mediated through novel regulatory elements. In 1994, Marten et al. (95) reported that in H4-II-E rat hepatoma cells, the mRNA content of C/EBP and C/EBP is increased in response to depletion of phenylalanine, methionine, leucine or tryptophan from culture media. Consistent with their results, my study documented an increase in human C/EBP mRNA content in

PAGE 78

67 response to histidine deprivation. Interestingly, however, human C/EBP mRNA content declined in response to amino acid limitation, as shown in this chapter. The discrepancy may be due to a difference in experimental procedures, because Marten et al. (95) incubated cells in amino acid-deprived media under a serum-free condition following 24 h culture in serum-free media. The HepG2 cells used in my study were cultured and deprived for histidine in the presence of 10% FBS. It is possible that the regulation of C/EBP mRNA is a serum-sensitive and/or cell cycle-dependent process. The Kilberg laboratory has shown previously that C/EBP activates ASNS gene following amino acid deprivation (59). C/EBP binds to the NSRE-1 in the ASNS proximal promoter to mediate the AAR (59). The experiments here provide further evidence for the hypothesis that C/EBP is an upstream regulator of the ASNS along the AAR pathway, in that the expression of C/EBP gene itself is also regulated by amino acid availability. To continue description of the AAR pathway and identify factors involved upstream of the C/EBP gene, it is essential to study the mechanism by which C/EBP gene is induced in response to amino acid limitation. The results here have demonstrated that the increase in C/EBP expression following AAR activation is due to increased transcription, not increased mRNA stability. Interestingly, this transcriptional activation is not mediated through the C/EBP promoter, but rather the genomic sequence 3 to the translation stop codon. This observation is in sharp contrast to the only previously known amino acid responsive elements, the C/EBP-ATF composite site for the CHOP gene (99) and the nutrient-sensing response unit (NSRU) for the ASNS gene (102), both of which are located in the proximal promoter region.

PAGE 79

68 Computer analysis revealed that within the C/EBP 3 genomic region there are perfect matches for the CHOP C/EBP-ATF site and the ASNS NSRE-2 sequence, and those two elements are completely conserved across the 3 genomic regions of human, rat and mouse C/EBP genes (Fig. 5-12). Mutating the core and flanking region of the C/EBP-ATF and NSRE-2 sequences within the C/EBP 3 genomic region, however, did not block the induced transcription following amino acid deprivation (Fig. 4-8, Mut-1 and Mut-3). This result suggests that the AAR for the C/EBP gene is mediated through elements not previously associated with amino acid-dependent control. Interestingly, substituting the entire C/EBP-ATF site in the C/EBP 3 genomic region resulted in a significant enhancement in transcription in both amino acid-fed and -limited conditions, suggesting that this site functions as a repressive element for C/EBP gene expression (Fig. 4-8, Mut-1). In the case of the CHOP and SNAT2 genes, the C/EBP-ATF sequence 5-ATTGCATCA3 (complementary to 5-TGATGCAAT-3 for the C/EBP gene) functions as an AARE enhancer to increase transcription in amino acid-deprived condition (100, 110). Mutating this sequence has, if any, inhibitory effect on basal transcription for those two genes (99, 110). Similarly, mutating the NSRE-2 sequence in the C/EBP 3 genomic region (Fig. 4-8, Mut-3) resulted in the opposite effect than that in the ASNS promoter region (chapter 3). The deletion analysis of the C/EBP 3 genomic sequence (Fig. 4-6) demonstrated that the nt +1554 to +1646 contains a positive DNA regulatory element that activates transcription in response to amino acid deprivation. This 93 bp sequence can also confer amino acid responsiveness to an inert SV40 promoter (Fig. 4-7) and to C/EBP proximal

PAGE 80

69 promoter nt /+157 (Appendix Fig. A-1). The induction achieved by the 93 bp sequence under the control of different promoter fragments is similar (approximately 3-fold). This sequence can also function in an orientation-independent manner (Appendix Fig. A-2), suggesting that it has enhancer-like activity. A potential C/EBP amino acid response element may be the sequence 5-TGACGCAACC-3, located within the C/EBP 3 genomic region from nt +1614 to +1623. By mutagenesis, this sequence was shown to be essential for the induction of the C/EBP gene in response to ER stress (chapter 5). This sequence was also responsive to XBP1 overexpression (chapter 5). Besides the well-established role of XBP1 in mediating ER stress response, the mRNA content of XBP1 is also increased by amino acid deprivation (Can Zhong, unpublished data; Dr. Kazutoshi Mori, personal communication). Mutating the GCAACC half of the sequence 5-TGACGCAACC-3 resulted in a decrease, although not statistically significant, in the transcription rate under the amino acid-deprived condition (Fig. 4-8, Mut-2). Furthermore, Bruhat et al. (100) demonstrated that the minimal consensus sequence for the amino acid response element of the C/EBP family member CHOP gene is 5-TGAYG(Y/A)AA(Y/G)-3 (Y=C or T). The ASNS NSRE-1 (5-TGATGAAAC-3) is compatible with this consensus, so is the C/EBP sequence 5-TGACGCAAC-3 (nt +1614/+1622). Further functional analysis is needed to examine whether this sequence is responsible for mediating the AAR for the C/EBP gene. When the C/EBP 3 genomic sequence nt +1423/+2213 was examined, although the transcription rate in the histidine-deprived condition was comparable to that of the 93 bp fragment (nt +1554/+1646), the magnitude of induction produced was closer to that of

PAGE 81

70 the endogenous mRNA (~7X) (Fig. 4-6 and 4-7 WT). This difference is due to a decrease in transcription under the amino acid-fed condition with the longer fragment (Fig. 4-6). Therefore, one can hypothesize there is a negative regulatory element located in the C/EBP 3 region from nt +1646 to +2213 or +1423 to +1554, to suppress C/EBP expression in amino acid-fed cells. It is conceivable because in the non-stressed condition the expression of a transcription factor such as C/EBP has to be kept at a low level to prevent disturbance of the cell’s normal gene expression profile. When a cell is deprived of amino acids, this repression is relieved and the transcription of C/EBP is further enhanced by the positive element located within its 3 genomic region. In summary, this study demonstrated that C/EBP is an amino acid-regulated gene and this regulation appears to be transcriptional in mechanism. The results showed that the regulatory cis-element necessary for C/EBP induction by amino acid deprivation is located, not in the promoter, but in the genomic region 3 to the protein coding sequence. The data in this chapter also suggest the presence of a cis-element that is different in sequence than the two AARE activities previously reported for the human CHOP, SNAT2 and ASNS genes. In vivo footprinting and further mutagenesis of the C/EBP 3 genomic region nt +1423 to +2213 should be performed to identify the specific regulatory sequences responsible for the C/EBP induction following AAR activation.

PAGE 82

71 MEMMEM-HisC/EBPGAPDHHour0240.51812240.51812 2040608010002468101Hour MEM -HisC/EBP/ GAPDH mRNA, Percent of maximum MEMMEM-HisC/EBPGAPDHHour0240.51812240.51812 MEMMEM-HisC/EBPGAPDHHour0240.51812240.51812Hour0240.51812240.51812 2040608010002468101Hour MEM -HisC/EBP/ GAPDH mRNA, Percent of maximum 204060801002040608010002468101Hour MEM -HisC/EBP/ GAPDH mRNA, Percent of maximum 2 2 2

PAGE 83

72 Figure 4-1. Amino acid deprivation increases C/EBP mRNA content. HepG2 cells were maintained in complete MEM to reach 70-80% confluency (hour 0). The cells were then transferred to fresh complete MEM (MEM) or MEM lacking histidine (-His). Total RNA was isolated at the time indicated and Northern blot analysis (15 g/lane) was performed to measure the mRNA content for C/EBP and GAPDH (as a loading control). The blots were digitized using a phosphorimager followed by quantification using the Chemidoc software, as described in chapter 2. The data were plotted as the normalized C/EBP mRNA content (C/EBP/GAPDH mRNA). The value in the –His condition at 8 h was set to be 100%.

PAGE 84

73 MEMMEM-HisC/EBPL7aHour0240.51812240.51812 255075100024681012HourC/EBP/ L7a mRNA (%) -HisMEM MEMMEM-HisC/EBPL7aHour0240.51812240.51812 MEMMEM-HisC/EBPL7aHour0240.51812240.51812 255075100024681012HourC/EBP/ L7a mRNA (%) -HisMEM 255075100255075100024681012HourC/EBP/ L7a mRNA (%) -HisMEM

PAGE 85

74 Figure 4-2. The C/EBP mRNA content decreases following amino acid deprivation. HepG2 cells were maintained in complete MEM to reach 70-80% confluency (hour 0). The cells were then transferred to fresh complete MEM (MEM) or MEM lacking histidine (-His). Total RNA was isolated at the time indicated and Northern blot analysis (15 g/lane) was performed to measure the mRNA content for C/EBP and L7a (as a loading control). The blots were digitized using a phosphorimager followed by quantification using the Chemidoc software, as described in chapter 2. The data were plotted as the normalized C/EBP mRNA content (C/EBP/L7a mRNA). The value at the hour 0 was set to be 100%.

PAGE 86

75 t t t C/EBPL7a3681012CHXM-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+Hour0 02040608010024681012 MEM MEM+CHX -His -His+CHX C/EBP/ L7a mRNA, Percen of maximumHour C/EBPL7a3681012CHXM-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+Hour0 C/EBPL7a3681012CHXM-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+M-M+H-H+Hour0 02040608010024681012 MEM MEM+CHX -His -His+CHX C/EBP/ L7a mRNA, Percen of maximumHour 0204060801002040608010024681012 MEM MEM+CHX -His -His+CHX C/EBP/ L7a mRNA, Percen of maximumHour

PAGE 87

76 Figure 4-3. Induction of the C/EBP gene by amino acid deprivation requires de novo protein synthesis. HepG2 cells were maintained in complete MEM to reach 70-80% confluency (hour 0). The cells were then washed, and incubated in either fresh complete MEM (M) or MEM lacking histidine (H), in the presence or the absence of cycloheximide (CHX). Total RNA was isolated at the time indicated and Northern blot analysis (15 g/lane) was performed to measure the mRNA content for C/EBP and L7a (as a loading control). The bands for individual mRNA were quantified by a phosphorimager and the Chemidoc software, as described in chapter 2. The data were plotted as normalized C/EBP mRNA content by correcting for RNA loading (C/EBP/L7a mRNA). The value in the -His condition at 6 h was set to be 100%. (RNA blot courtesy of Dr. Van Leung-Pineda)

PAGE 88

77 1201234HourC/EBP/ GAPDH mRNAMEM-His + Act. DMEM + Act. D MEM + Act.DMEM-His + Act. DC/EBPGAPDHHour0240.518240.518 1201234HourC/EBP/ GAPDH mRNAMEM-His + Act. DMEM + Act. D 12120123401234HourC/EBP/ GAPDH mRNAMEM-His + Act. DMEM + Act. D MEM + Act.DMEM-His + Act. DC/EBPGAPDHHour0240.518240.518 MEM + Act.DMEM-His + Act. DC/EBPGAPDHHour0240.518240.518 MEM + Act.DMEM-His + Act. DC/EBPGAPDHHour0240.518240.518

PAGE 89

78 Figure 4-4. The increase in C/EBP mRNA content following AAR activation is not due to mRNA stabilization. HepG2 cells were maintained in MEM lacking histidine for 8 h to reach maximal induction (hour 0). The cells were then washed, and incubated in either fresh complete MEM plus 5 M actinomycin D (MEM+Act.D) or fresh MEM lacking histidine in the presence of actinomycin D (MEM-His+Act.D). Total RNA was isolated at the time indicated and Northern blot analysis (15 g/lane) was performed to measure the mRNA content for C/EBP and GAPDH (as a loading control). The bands for individual mRNA were quantified by a phosphorimager and the Chemidoc software, as described in chapter 2. Normalized C/EBP mRNA content (C/EBP/GAPDH mRNA) at hour 0 was set to be 100%, and the data were plotted as the logarithm of mRNA content versus time.

PAGE 90

79 CDS (+206/+1243)-8451+3541 Transcription start (+1) Poly A signal TATA box (-28/-22) 3'UTR (+1244/+1840) A 00.511.5 MEM -HisRelative luciferase activity Luc -8451+157 Luc -325+157 Luc Luc -1595+157 B CDS (+206/+1243)-8451+3541 Transcription start (+1) Poly A signal TATA box (-28/-22) 3'UTR (+1244/+1840) A CDS (+206/+1243)-8451+3541 Transcription start (+1) Poly A signal TATA box (-28/-22) 3'UTR (+1244/+1840) A 00.511.5 MEM -HisRelative luciferase activity Luc -8451+157 Luc -325+157 Luc Luc -1595+157 B 00.511.5 MEM -HisRelative luciferase activity Luc -8451+157 Luc -325+157 Luc Luc -1595+157 B

PAGE 91

80 Figure 4-5. The C/EBP promoter region alone is not sufficient to mediate induction following amino acid deprivation. A) Human C/EBP genomic structure. The transcription start site for C/EBP mRNA was set as nucleotide +1. The 5 upstream region was designated by “-“ numbers. All features were labeled based on the numbers of nucleotides counting from the transcription start (+1). B) The C/EBP promoter activity in response to histidine deprivation was tested after incubation of transfected HepG2 cells in either MEM (open bars) or MEM-His (black bars) for 12 h. Various C/EBP upstream regions (left panel) were tested for the ability to drive the expression of the Firefly luciferase reporter gene. Details for cloning the human C/EBP promoter fragments refer to chapter 2. HepG2 cells (2 x 10 5 /well) were transfected as described in chapter 2 using 1 g of the Firefly luciferase reporter construct and 6 l of the SuperFect transfection reagent. The cells were transferred to MEM or MEM-His 18 h after transfection. Relative luciferase activity represents the Firefly luciferase activity normalized for transfection efficiency as measured by the activity of the Renilla luciferase driven by the SV40 promoter. The value of the relative luciferase activity of the C/EBP promoter fragment nt /+157 in the MEM condition was set to 1. All data are expressed as the averages standard deviations. The data shown are from a single experiment that is representative of multiple experiments.

PAGE 92

81 0481216 MEM-His 1.25.75.22.8Relative luciferase activity+1646 Luc -1595+157+1554^ Luc +157 -1595 Luc +157+1423+3541^ -1595 Luc +157+1423+2213^ -1595** 0481216 MEM-His 1.25.75.22.8Relative luciferase activity+1646 Luc -1595+157+1554^+1646 Luc -1595+157+1554^ Luc +157 -1595 Luc +157+1423+3541^ -1595 Luc +157+1423+2213^ -1595**

PAGE 93

82 Figure 4-6. The genomic region downstream of the protein coding translation stop codon is required for induction of the C/EBP gene via the AAR. Sequentially deleted C/EBP 3 genomic fragments are ligated downstream of the Firefly luciferase reporter gene under the control of the C/EBP promoter fragment nt /+157 (left panel). Details for cloning the human C/EBP 3 genomic fragments refer to chapter 2. HepG2 cells (2 x 10 5 /well) were transfected as described in chapter 2 using 1 g of the Firefly luciferase reporter construct and 6 l of the SuperFect transfection reagent. The cells were transferred to MEM or MEM-His 18 h after transfection. After incubation of the transfected cells in MEM or MEM-His for 12 h, transcription activity of the C/EBP 3 genomic sequences was measured by Firefly luciferase activity. To correct for the transfection efficiency between wells, the activity of the Firefly luciferase is normalized with that of the Renilla luciferase driven by the SV40 promoter (relative luciferase activity). The value of the relative luciferase activity of the C/EBP promoter fragment nt /+157 alone (without 3 sequence) under the MEM condition was set to 1. The numbers above each black bar represent the times increase in luciferase activity by histidine deprivation over the respective basal MEM condition (open bars) for each construct. All data are expressed as the averages standard deviations. The data shown are representative of multiple experiments. The asterisks (*) indicate statistical significance in basal transcription between the promoter only construct and the constructs containing 3 genomic sequences (p<0.005, Student t-test).

PAGE 94

83 0481216 MEM-His Relative Luciferase Activity Luc SV40 Luc +1554/+1646SV40 Luc +1583/+1646(Del C/EBP-ATF) SV40 ^ Luc 2X+1554/+1646SV40 04812160481216 MEM-His MEM-His Relative Luciferase Activity Luc SV40 Luc SV40 Luc +1554/+1646SV40 Luc +1554/+1646SV40 Luc +1583/+1646(Del C/EBP-ATF) SV40 ^ Luc +1583/+1646(Del C/EBP-ATF) SV40 ^ ^ Luc 2X+1554/+1646SV40 Luc 2X+1554/+1646SV40

PAGE 95

84 Figure. 4-7. The C/EBP 3 genomic sequence nt +1554/+1646 can confer amino acid responsiveness to an otherwise inert promoter. C/EBP 3 genomic fragments were inserted downstream of the Firefly luciferase reporter gene driven by the SV40 promoter (left panel, chapter 2). TK promoter-driven Renilla luciferase was used as a control for transfection efficiency. HepG2 cells (2 x 10 5 /well) were transfected as described in chapter 2 using 0.9 g of the Firefly luciferase reporter construct and 6 l of the SuperFect transfection reagent. The cells were transferred to MEM or MEM-His 18 h after transfection. After incubation of the transfected cells in MEM or MEM-His for 8 h, transcription activity of the C/EBP 3 genomic sequences were measured by Firefly luciferase activity. To correct for the transfection efficiency between wells, the value of the Firefly luciferase activity was divided by that of the Renilla activity (relative luciferase activity). The transcription rate of the SV40 promoter alone in cells incubated in MEM was set to 1. All data are expressed as the averages standard deviations for four determinations.

PAGE 96

85 +1554 GCCGGTTTCG AAGTTGATGC AATCGGTTTA AACATGGCTG AACGCGTGTG TACACGGGACTGACGCAACC CACGTGTAAC TGTCAGCCGG+1644 GCCC/EBP-ATF cgaggcg ttat Mut-1ttcgat attc Mut-2NSRE-2 ggga ctcagt Mut-3A XBP1-like site 81216 MEM-His Relative luciferase activity C/EBPPromoterOnly WT Mut-1 Mut-2 Mut-3 ****B promoter & C/EBPnt +1423 / +2213+1554 GCCGGTTTCG AAGTTGATGC AATCGGTTTA AACATGGCTG AACGCGTGTG TACACGGGACTGACGCAACC CACGTGTAAC TGTCAGCCGG+1644 GCCC/EBP-ATF cgaggcg ttat Mut-1ttcgat attc Mut-2NSRE-2 ggga ctcagt Mut-3A XBP1-like site+1554 GCCGGTTTCG AAGTTGATGC AATCGGTTTA AACATGGCTG AACGCGTGTG TACACGGGACTGACGCAACC CACGTGTAAC TGTCAGCCGG+1644 GCCC/EBP-ATFC/EBP-ATF cgaggcg ttat Mut-1cgaggcg ttat cgaggcg ttat Mut-1ttcgat attc Mut-2ttcgat attc Mut-2NSRE-2 ggga ctcagt Mut-3NSRE-2 NSRE-2 ggga ctcagt Mut-3ggga ctcagt ggga ctcagt Mut-3A XBP1-like site 81216 MEM-His Relative luciferase activity C/EBPPromoterOnly WT Mut-1 Mut-2 Mut-3 ****B promoter & C/EBPnt +1423 / +2213 81216 MEM-His MEM-His Relative luciferase activity C/EBPPromoterOnly WT Mut-1 Mut-2 Mut-3 ****B promoter & C/EBPnt +1423 / +2213 4 4 4 0 0 0

PAGE 97

86 Figure 4-8. The C/EBP 3 genomic sequence contains novel DNA cis-elements to mediate the AAR. A) The genomic sequence of the C/EBP genomic region containing nt +1554 to +1646. Wild-type amino acid response elements (boxed) identified in other genes include: the C/EBP-ATF composite site (CHOP, SNAT2) and NSRE-2 (ASNS). Mutated sequences for the C/EBP-ATF site (Mut-1), NSRE-2 and flanking sequence (Mut-2 and Mut-3) are underlined and shown in lower case letters. The XBP1-like site identified in chapter 5 as critical for induction by the UPR pathway is also indicated. B) Block mutation of known amino acid response elements was performed in the context of the C/EBP 3 genomic fragment nt +1423/+2213 inserted downstream of the Firefly luciferase reporter gene driven by the C/EBP promoter fragment nt /+157. Mutagenesis, transient transfection and luciferase reporter assay are described in chapter 2. The relative luciferase activity (the ratio of the Firefly to Renilla luciferase activity) for the wild-type (WT) construct in the MEM condition was set to 1. All data are expressed as averages standard deviations. The asterisks (*) indicate statistically significant difference in basal transcription activity between the WT and mutants in the MEM condition (p<0.005, Student t-test). Although the luciferase activity of the Mut-2 in the –His condition was less than that of the WT, the difference did not reach statistical significance.

PAGE 98

CHAPTER 5 REGULATION OF THE HUMAN CCAAT/ENHANCER-BINDING PROTEIN BETA GENE BY ENDOPLASMIC RETICULUM STRESS Introduction CCAAT/enhancer-binding protein beta (C/EBP) is a member of a family of transcription factors that also includes C/EBP, , , , and C/EBP homology protein (CHOP). The properties and characteristics of C/EBP are reviewed in greater details in chapter 1. Briefly, the C/EBP members contain a basic leucine bZIP domain at their C-terminus, which is responsible for DNA binding and selective dimerization with other bZIP family members. Although C/EBP plays a role in a wide range of important cellular processes, such as adipocyte differentiation, carbohydrate metabolism, inflammation, and cellular proliferation, investigation of the transcriptional control of the C/EBP gene itself is limited. It has been reported that the cAMP-response element-like sequences, located within the rat C/EBP proximal promoter, are required for C/EBP expression and IL-6-mediated induction of the gene during the acute-phase response (113). Disturbance of the protein folding process in the endoplasmic reticulum (ER) activates an ER stress-signaling pathway called the unfolded protein response (UPR), reviewed in chapter 1. Briefly, in the yeast Saccharomyces cerevisiae, ER stress activates the kinase/endonuclease Ire1p, which in turn mediates an unconventional splicing of HAC1 mRNA. The processed HAC1 mRNA codes for a bZIP protein, Hac1p, which 87

PAGE 99

88 binds to a UPR element (UPRE) in the appropriate target genes. Two mammalian Irelp forms,IRE1 and IRE1 (37, 38), have been identified, and XBP1 has been described as the mammalian counterpart to yeast Hac1p (39-41). However, at multiple ER stress-responsive pathways exist in mammals, and proteolytic activation of the transcription factor ATF6 also plays an important role (45, 46, 48). The precursor form of ATF6 is an ER transmembrane protein which is proteolytically cleaved in response to ER stress and the N-terminal portion is thereby, is released as an active transcription factor which translocates to the nucleus. A bipartite mammalian ER stress response element (ERSE), 5-CCAAT-N 9 -CCACG-3, was identified (34, 36), which was shown to bind either XBP1 or ATF6 at the CCACG half-site (34). However, more recently it has been demonstrated that XBP1 activates a second set of ER stress-responsive genes by binding to a genomic element comprised of the consensus sequence 5-TGACGTGG/A-3 (40, 43), and this element has been referred to as the mammalian UPRE (mUPRE) (39). Asparagine synthetase (ASNS), which catalyzes asparagine biosynthesis, is transcriptionally regulated in response to a variety of cellular stress signals, including either amino acid limitation or ER stress (23, 55, 57), summarized in chapter 1. The nutrient-sensing response element (NSRE)-1, located within the ASNS proximal promoter at nt to , contributes to this induction under the stress conditions mentioned above, and binding of C/EBP to the NSRE-1 is increased following activation of these stress pathways (chapter 3). Marten et al. (95) was the first to

PAGE 100

89 document that the mRNA content of C/EBP is increased by amino acid deprivation, but regulation of the C/EBP gene by ER stress has yet to be examined. The study described in chapter 5 was designed to test the hypothesis (Fig. 3-5) that transcription from the human C/EBP gene is induced in response to ER stress and to examine the mechanism of this induction. C/EBP mRNA content was increased following ER stress conditions including glucose deprivation, tunicamycin (Tm), or thapsigargin (Tg) treatment. Given that ER stress did not alter the turnover rate of the C/EBP mRNA, it was proposed that this increase was due to increased transcription. Transient transfection of genomic fragments linked to a luciferase reporter gene demonstrated that a 46 bp region, located at a genomic site that corresponds to the 3 untranslated region (UTR) of the C/EBP mRNA is required for the induction following ERSR activation, and that the C/EBP promoter plays no major regulatory role. Mutagenesis further indicated that a cis-regulatory element located at nt +1614 to 1621 (5-TGACGCAA-3) is responsible for activation of the C/EBP gene by ER stress. This element differs from the consensus mUPRE (see above) by two nucleotides (43), but expression of exogenous XBP1 activated transcription from a C/EBP genomic fragment containing this sequence. Results Induction of C/EBP mRNA by Glucose Deprivation To examine whether or not C/EBP or C/EBP mRNA content was altered in response to glucose deprivation of HepG2 cells, the cells were incubated in glucose-free MEM for 0-12 h and Northern blot analysis was performed (Fig. 5-1A). An initial increase in C/EBP mRNA content was observed between 2-4 h of glucose deprivation

PAGE 101

90 and then reached a maximum of about 7-times the control value (5.5 mM glucose) at 8 h (Fig. 5-1B). In contrast, C/EBP mRNA content remained relatively steady for 4 h and then declined during the 8-12 h period of glucose deprivation (Fig. 5-1C, data provided by Elizabeth Dudenhausen). To obtain a quantitative analysis of C/EBP regulation by glucose, the mRNA levels for C/EBP, GAPDH, and as a positive control, ASNS, were measured for three independent experiments by real-time quantitative RT-PCR (Fig. 5-2). The induction of C/EBP mRNA measured by Northern blot analysis and quantitative RT-PCR followed a similar pattern, reaching a comparable degree of induction at 8 h. The increase in ASNS mRNA (Fig. 5-2B) was in agreement with previously published results measured by Northern blotting (54). These data illustrate that under the glucose-limited condition, C/EBP expression is induced and that this increase parallels that of the ERSR target gene, ASNS. Induction of C/EBP mRNA and Protein by ER Stress To further investigate whether or not the ERSR pathway was responsible for the increased C/EBP mRNA content, HepG2 cells were incubated with known ERSR activators such as Tg, an ER Ca 2+ -ATPase inhibitor, or Tm, an inhibitor of protein glycosylation (114). Consistent with their common mode of action, Tm treatment and glucose deprivation increased C/EBP mRNA content over a similar time frame, with the initial increase being observed between 2-4 h, and reaching a 7or 8-fold induction at 8 h (Fig. 5-3). In contrast, Tg treatment also induced C/EBP mRNA content, but the maximal induction of 8-fold was achieved by 4 h.

PAGE 102

91 To test whether or not C/EBP protein content was also increased, whole cell extracts from control (MEM-incubated cells) or Tg-treated HepG2 cells were subjected to immunoblotting (Fig. 5-4, data courtesy of Dr. YuanXiang Pan). ER stress caused an elevation of full-length (LAP) C/EBP protein that was consistent with the rise in mRNA level, although the absolute magnitude of the protein increased was less than that for the mRNA. The peak of C/EBP protein occurred at 4 h and stayed relatively high for the remainder of the 12 h period investigated. Induction of C/EBP mRNA by the ERSR Is Dependent on de novo Protein Synthesis To determine whether or not synthesis of an upstream regulatory protein was required for induction of the C/EBP gene, HepG2 cells were incubated with Tg in the presence or absence of 0.1 mM cycloheximide (Fig. 5-5). Cycloheximide completely prevented the increase in C/EBP mRNA content following ERSR activation, suggesting that de novo protein synthesis was required at some unidentified step leading to activation of the C/EBP gene. Inhibition of protein synthesis may also have a minor effect on the turnover of C/EBP mRNA, as indicated by the small, but consistent elevation in mRNA content in cells treated with cycloheximide in the absence of Tg (Fig. 5-5). Induction of C/EBP mRNA Content by the ERSR Is Not Due to mRNA Stabilization To test for increased mRNA stability as a possible mechanism for the ERSR induction, HepG2 cells were incubated in glucose-free MEM for 8 h to elevate the C/EBP mRNA content and were then transferred to either fresh glucose-free MEM or complete MEM, both containing 5 M actinomycin D (Fig. 5-6). The results showed that the half-life of C/EBP mRNA with or without glucose was approximately 1.5 h,

PAGE 103

92 indicating that the ERSR-dependent elevation in C/EBP mRNA is likely not the result of mRNA stabilization. The C/EBP Genomic 5 Upstream Region Does Not Respond to the ERSR To investigate the role of genomic 5 upstream sequences in mediating C/EBP transcription in response to ER stress, a fragment corresponding to the human C/EBP proximal promoter nt /+157 was tested initially (Fig. 5-7). Compared to the 7-fold induction of endogenous mRNA by glucose deprivation or Tg treatment (Fig. 5-1, 4-2 and 4-3), this promoter fragment did not respond to the glucose-limited condition and resulted in less than a 70% increase in Tg-treated cells (Fig. 5-7B). To test the possibility that the cis-acting elements required for full induction may be located farther upstream, much longer promoter fragments (/+157 and -8451/+157) were examined, but similar results were obtained (Fig. 5-7B). The C/EBP Genomic Sequence 3 to the Protein Coding Sequence Is Essential for the ERSR As depicted in Fig. 5-7A, the human C/EBP gene is intronless and relative to the transcription start site, the first of multiple translation start sites is at nt +206 and the single translation stop codon is at +1243 (60). Although not fully characterized, an apparent polyadenylation signal (5-AATAAA3) is approximately 1.8 kb downstream from the transcription start (Genbank # NM_005194). Given that a 5 upstream fragment of nearly 8.5 kb did not support induction by ER stress, the C/EBP genomic region 3 to the protein coding sequence was investigated (Fig. 5-8). Sequentially deleted fragments were ligated downstream of the Firefly luciferase reporter gene, driven by a C/EBP promoter fragment containing nt to +157. To approximate the endogenous

PAGE 104

93 location, the C/EBP 3 genomic fragments were inserted downstream of the Firefly coding sequence within the reporter plasmid. The C/EBP sequence from nt +1423 to +3541, containing the sequence corresponding to the mRNA 3 UTR and some additional 3 genomic sequence, induced transcription by 17-fold when cells were treated with Tg (Fig. 5-8). The degree of induction was similar when this 2.1 kb genomic sequence was deleted to an 800 bp DNA fragment covering nt +1423 to +2213. The ER stress-responsive region was narrowed even further by establishing that a 93 bp DNA fragment containing nt +1554 to +1646 activated transcription (Fig. 5-8). The 93 bp sequence yielded an induction level of about 8 times the control, less than the longer fragments, but nearly identical in magnitude to the maximal increase in endogenous mRNA content following Tg treatment (Fig. 5-2 and 4-3). The decline in the relative increase was due to an increase in the basal rate rather than a decline in the absolute transcription rate following ER stress. Taken together, the data of Fig. 5-7 and 4-8 indicate that the DNA regulatory element necessary to mediate the ERSR activation of the C/EBP gene is located 3 to the protein coding sequence and within nt +1554 to +1646. The C/EBP 3 Genomic Sequence Can Confer ER Stress Responsiveness to an Otherwise Inert Promoter To test the hypothesis that nt +1554 to +1646 of the C/EBP gene (Fig. 5-9A) could confer ER-stress-regulated transcription to an unrelated promoter, the C/EBP promoter fragment used in the previous experiments was replaced with the SV40 promoter (Fig. 5-9B). The SV40 promoter alone was inert to Tg treatment, but when a

PAGE 105

94 single copy of the 93 bp C/EBP genomic sequence was present, transcription was induced to 9 times the MEM control. A UPRE-like Binding Site Is Responsible for the Induction of the C/EBP Gene by ER Stress Computer analysis of the 93 bp region revealed no perfect match for either the ERSE (5-CCAAT-N 9 -CCACG-3) (34, 36) or the NSRU (5-TGATGAAAC-N 11 -GTTACA-3) (chapter 3), either of which can mediate the ER stress signal. However, a sequence corresponding to the ATF6/XBP1 half site of the ERSE (5-CCACG-3), is present at nt +1623 to +1627 and a sequence identical to the second element of the nutrient-sensing response unit (NSRU), NSRE-2 (5-GTTACA-3), is present between nt +1628 and +1633 (Fig. 5-9A). A perfect match to the CHOP C/EBP-ATF sequence is also located within the 93 bp C/EBP genomic region at nt +1576 to +1568 (Fig. 5-9A). CHOP is also induced by ER stress and contains a functional ERSE (46) (chapter 1), but the C/EBP-ATF binding site (nt /-302, 5-ATTGCATCA-3) has been suggested to also influence the regulation of the CHOP gene by the ERSR pathway (115). An additional sequence of interest in the C/EBP gene is present at nt +1614 to +1621 (5-TGACGCAA-3) and is similar to a consensus sequence referred to as the mammalian UPRE (39, 43). The mUPRE represents the recognition site for an ER stress pathway in mammals, and selectively binds XBP1 rather than ATF6 and, in this way, mediates the activation of UPR responsive genes that do not contain the ERSE sequence (39) (chapter 1). To investigate the contribution of the C/EBP-ATF composite site in the C/EBP gene, the core element and surrounding sequence (nt +1554 to +1582) were deleted from

PAGE 106

95 the +1554/+1646 genomic fragment (Fig. 5-9B, Del C/EBP-ATF). Although deletion of the C/EBP-ATF sequence reduced the fold-induction by Tg, it did so because the basal transcription rate was elevated, the absolute luciferase activity in cells incubated in the presence of Tg was not decreased. To confirm this result, rather than deletion, a block mutation of the C/EBP-ATF core sequence was tested, and similar results were observed (Fig. 5-9C, Mut-1). Furthermore, this site was proposed to modulate the ERSR by binding ATF4 (115), but induction of C/EBP expression by glucose deprivation still occurs in ATF4 -/mouse embryonic fibroblasts (Dr. YuanXiang Pan, unpublished data), supporting the conclusion that at least a component of the regulation of C/EBP gene expression by ER stress is independent of the C/EBP-ATF site and the ATF4 pathway. To examine the potential role of the CCACG and NSRE-2 sequences, each was mutated in the context of a C/EBP fragment corresponding to nt +1423/+2213. When the CCACG box and its 5 flanking sequence GCAAC was mutated (Fig. 5-9A), a significant loss in Tg-induced luciferase activity was observed (Fig. 5-9C, Mut-2). However, when the CCACG sequence and its 3 flanking sequence TGTAAC T (underlined nucleotides are identical to the ASNS NSRE-2 site) was substituted, the absolute transcription rate in Tg-treated cells was not significantly reduced compared to the wild-type sequence, although there was a decline in the fold induction due to an increase in basal transcription (Fig. 5-9C, Mut-3). Collectively, the results indicate that the sequence immediately 5 to the CCACG box is required to mediate the ERSR for the C/EBP gene, but neither the CCACG box itself nor the flanking 3 NSRE-2-like sequence are critical.

PAGE 107

96 To continue the characterization of this region, the sequence covered by nt +1554 to +1646 was first dissected in half, and the ability of each fragment to respond to ER stress was tested (Fig. 5-10A). When the 5 half of the 93 bp sequence (nt +1554/+1600) was tested, only a slight effect of Tg treatment was detectable. Conversely, when the 3 half was tested (nt +1601/+1646), Tg treatment resulted in a 9-fold induction over MEM, a result comparable to the 7to 8-fold increase in endogenous C/EBP mRNA (Fig. 4-3). Collectively, the data of Fig. 5-9 and 4-10 suggest that the ER stress responsive element for the C/EBP gene resides between nt +1601 and nt +1623, and consequently, additional mutagenesis targeted the region containing the mUPRE-like sequence at nt +1614/+1621 (Fig. 5-10B). When nt +1601 to +1609 was substituted (Fig. 5-10C, Mut-4), the relative induction by Tg treatment was only modestly reduced, but mutation of the sequence 5-GGACTGAC-3 from nt +1610 to +1617 (Fig. 5-10C, Mut-5) or 5-GCAACC-3 from nt +1618 to +1623 (Fig. 5-10C, Mut-6), completely prevented the Tg-induced increase in transcription. These results suggested that nt +1610 to +1623 (5-GGACTGACGCAACC-3), containing the XBP1-like binding site (5-TGACGCAA-3), was the sequence harboring the responsive element. To investigate the boundaries of this potential mUPRE sequence, the 5 (Mut-7) and 3 (Mut-8) flanking nucleotides were mutated (Fig. 5-10C). Whereas modifying the two 3 nucleotides caused a significant reduction in transcription, mutation of the 5 GGA had only a modest effect (Fig. 5-10C). XBP1 Modulates C/EBP Transcription To investigate whether or not transcription from the C/EBP gene was enhanced by increased expression of ATF6 or XBP1, HepG2 cells were transfected with the active form of each, along with a luciferase reporter construct containing the C/EBP mUPRE

PAGE 108

97 sequence (Fig. 5-11). Exogenously expressed XBP1 further enhanced both basal (MEM) and Tg-induced transcription by 5and 2-fold, respectively. ATF6 over-expression modestly increased the transcriptional activity in the control (MEM) condition, but actually blocked the induction by Tg treatment when compared to control (Fig. 5-11). As a positive control, the promoter activity of GRP78 (nt /+7) containing three ERSE sequences (34) was examined (Fig. 5-11). In general agreement with previously published results by others (39), GRP78 promoter activity was induced by Tg treatment, or by expressing either ATF6 or XBP1 in non-stressed cells (MEM) (Fig. 5-11). Neither factor produced a further enhancement when coupled with Tg treatment, but it is interesting to note that ATF6 expression did not block the Tg-induced transcription of the GRP78 promoter as it did for the C/EBP element. Discussion The results described in this chapter document the following novel observations: Human C/EBP mRNA and protein content is increased by glucose deprivation and other causes of ER stress, whereas C/EBP is decreased. This increase in C/EBP mRNA is dependent on de novo protein synthesis, suggesting the need for synthesis of an upstream regulator. Stabilization of mRNA does not contribute to the mRNA accumulation, and genomic analysis illustrated transcriptional control of the human C/EBP gene. The genomic 5 upstream sequence, up to 8.45 kb, is not sufficient to induce transcription following ERSR activation, whereas a mUPRE, located 3’ to the protein coding sequence, is responsible for transcriptional induction of the human C/EBP gene.

PAGE 109

98 The C/EBP mUPRE exhibits enhancer-like properties in that it can convey responsiveness to a heterologous promoter. The C/EBP mUPRE responds to an elevated level of XBP1. The C/EBP gene has not been reported previously to be responsive to, or a mediator of, mammalian ER stress pathways. To respond to ER stress, cells activate genes involved in ER functions such as protein folding, export, and degradation (116-118), and to eliminate cells that have accumulated an irreparable level of damage, ER stress eventually induces genes implicated in growth arrest and apoptosis, such as CHOP (119, 120). CHOP is a member of the C/EBP family of transcription factors and Fawcett et al. (121) showed that in response to oxidative stress the expression of both C/EBP and CHOP is induced and that they interact in vivo. Those authors further proposed that C/EBP trans-activates CHOP expression through a C/EBPATF composite site in the CHOP promoter (nt /-302, 5ATTGCATCA-3). The increased CHOP to C/EBP protein ratio may lead to the heterodimerization of CHOP with C/EBP and consequently, given the dominant negative effect of CHOP (122), this heterodimerization could block the trans-activation effect of C/EBP on numerous genes, including the CHOP promoter itself, thereby completing an autoregulatory loop for CHOP expression. This proposed mechanism for oxidative stress may parallel the increased C/EBP expression following ER stress, documented in this chapter, because Ma et al (115) provided evidence that C/EBP transcriptionally up-regulates CHOP expression following ER stress via the C/EBP-ATF composite site in the CHOP promoter. This sequence, in concert with a functional ERSE site also present in the CHOP promoter

PAGE 110

99 region (46), was proposed to activate CHOP expression to an optimal level after ER stress. Although the human C/EBP gene contains a C/EBP-ATF composite site sequence (nt +1568 to +1576), the data in this chapter demonstrate that the C/EBP-ATF sequence is not essential for induction by the ER stress. Instead, the results demonstrate that the human C/EBP gene contains a mUPRE that mediates this response. The C/EBP -/mice (B phenotype) die shortly after birth. These newborn pups have a severe hypoglycemia, likely the result of a lack of the hepatic gluconeogenic enzyme phosphoenolpyruvate carboxykinase (123). Given that the ERSR pathway steps downstream of C/EBP are likely defective in these animals, the possible lack of critical ERSR-dependent mechanisms must also be considered as contributing factors to their mortality. One possible reason that the ERSR pathway might be activated shortly after birth is the adaptive response to oxidative stress that would result from increased oxidative metabolism (124). Although the physiologic importance of increased asparagine biosynthesis during ER stress remains unknown, the Kilberg laboratory have previously demonstrated that ASNS expression is induced by ER stress (55, 57), and that C/EBP modulates ASNS transcriptional rates via binding to the NSRE-1 site within its proximal promoter (59). The results in this chapter extend those previous observations, by illustrating that the expression of C/EBP itself is induced after ER stress. As an upstream regulator of ASNS expression, C/EBP may be a metabolic switch that links carbohydrate metabolism and/or ER stress to amino acid metabolism. The C/EBP mUPRE is highly conserved across the human, rat, and mouse genomes (Fig. 5-12). Why this element is located at the 3 end of the gene is unclear, but

PAGE 111

100 it may have to do with the fact that the gene is intronless. The general importance of the 3 downstream region of the C/EBP gene is emphasized by the extensive conservation among species of large stretches of sequence in this region (Fig. 5-12). In contrast, the corresponding region of the human C/EBP gene, which is not induced by ER stress, as documented here, does not contain a UPRE-like sequence, based on computer analysis. To my knowledge, all previous examples of ER stress-activated genes that have been tested have the corresponding ERSE or UPRE sequences located within their promoter region. Therefore, the C/EBP gene may represent a novel model for investigating how such distal elements interact with the general transcription machinery.

PAGE 112

101 MEMMEM -GlcHour00.5 1 2 4 8 12 0.5 1 2 4 8 12 C/EBPGAPDHC/EBPAB204060801000 2 4 6 8 10 12Hour MEM -Glc C/EBP/ GAPDH mRNA,percent of maximum C 204060801000 2 4 6 8 10 12Hour MEM-Glc C/EBP/ GAPDH mRNA,percent of maximum MEMMEM -GlcHour00.5 1 2 4 8 12 0.5 1 2 4 8 12 C/EBPGAPDHC/EBPAMEMMEM -GlcHour00.5 1 2 4 8 12 0.5 1 2 4 8 12 C/EBPGAPDHC/EBPMEMMEM -GlcMEMMEM -GlcHour00.5 1 2 4 8 12 0.5 1 2 4 8 12Hour00.5 1 2 4 8 12 0.5 1 2 4 8 1200.5 1 2 4 8 12 0.5 1 2 4 8 12 C/EBPGAPDHC/EBPC/EBPGAPDHC/EBPAB204060801000 2 4 6 8 10 12Hour MEM -Glc C/EBP/ GAPDH mRNA,percent of maximum B204060801000 2 4 6 8 10 12Hour MEM -Glc C/EBP/ GAPDH mRNA,percent of maximum 204060801000 2 4 6 8 10 12Hour MEM -Glc C/EBP/ GAPDH mRNA,percent of maximum C 204060801000 2 4 6 8 10 12Hour MEM-Glc C/EBP/ GAPDH mRNA,percent of maximum C 204060801000 2 4 6 8 10 12Hour MEM-Glc C/EBP/ GAPDH mRNA,percent of maximum 204060801000 2 4 6 8 10 12Hour MEM-Glc C/EBP/ GAPDH mRNA,percent of maximum

PAGE 113

102 Figure 5-1. The C/EBP and C/EBP mRNA content after glucose deprivation. Cells were maintained in complete MEM to reach 70-80% confluency (hour 0) and then transferred to either complete MEM (MEM) or MEM lacking glucose (-Glc). Total RNA was isolated at the time indicated and Northern blot analysis was performed to measure the mRNA content for C/EBP, C/EBP, and GAPDH (as a loading control) (Panel A). Normalized C/EBP mRNA content (C/EBP/GAPDH) in the –Glc condition at 8 h was set to be 100% (Panel B), whereas normalized C/EBP mRNA content (C/EBP/GAPDH) at time 0 was set to be 100% (Panel C, data courtesy of Elizabeth Dudenhausen).

PAGE 114

103 A MEM -Glc 246810024681012**C/EBP/ GAPDH mRNA,arbitrary units Hour B 0.511.52024681012 MEM -Glc** HourASNS / GAPDH mRNA,arbitrary units A MEM -Glc 246810024681012**C/EBP/ GAPDH mRNA,arbitrary units Hour A MEM -Glc 246810024681012**C/EBP/ GAPDH mRNA,arbitrary units Hour MEM -Glc 246810024681012**C/EBP/ GAPDH mRNA,arbitrary units Hour B 0.511.52024681012 MEM -Glc** HourASNS / GAPDH mRNA,arbitrary units B 0.511.52024681012 MEM -Glc MEM -Glc** HourASNS / GAPDH mRNA,arbitrary units

PAGE 115

104 Figure 5-2. The C/EBP and ASNS mRNA content in response to glucose deprivation. HepG2 cells were maintained in complete MEM to reach 70-80% confluency (time = 0) and then transferred to either complete MEM (MEM) or MEM lacking glucose (-Glc). Total RNA was isolated at the time indicated and real-time quantitative RT-PCR was performed to measure the mRNA content for C/EBP, ASNS, and GAPDH (as a loading control). The results shown are from three independent experiments and are expressed as the averages standard error of the means (SEM). Where not shown, the SEM bars are contained within symbol. The asterisk indicates that the mRNA content in the –Glc condition is significantly higher than that in the MEM condition at that time point (Student t test, p<0.05).

PAGE 116

105 C/EBPL7aMEM+Tm+Tg-GlcMEM+Tm+Tg-GlcMEM+Tm+Tg-GlcMEM+Tm+Tg-Glc12 4 8HourC/EBP/ L7a mRNA,percent of maximumHour 0204060801002468 MEM +Tm +Tg -Glc C/EBPL7aMEM+Tm+Tg-GlcMEM+Tm+Tg-GlcMEM+Tm+Tg-GlcMEM+Tm+Tg-Glc12 4 8Hour C/EBPL7aC/EBPL7aMEM+Tm+Tg-GlcMEM+Tm+Tg-GlcMEM+Tm+Tg-GlcMEM+Tm+Tg-Glc12 4 8HourC/EBP/ L7a mRNA,percent of maximumHour 0204060801002468 MEM +Tm +Tg -Glc C/EBP/ L7a mRNA,percent of maximumHour 0204060801002468 MEM +Tm +Tg -Glc MEM +Tm +Tg -Glc

PAGE 117

106 Figure 5-3. The C/EBP mRNA content is increased by UPR activators. HepG2 cells, at 70-80% confluence, were incubated in complete MEM (MEM), complete MEM plus Tm (+Tm), complete MEM plus Tg (+Tg), or MEM lacking glucose (-Glc). Total RNA was isolated at the time indicated and Northern blot analysis was performed to measure the mRNA content for C/EBP and the ribosomal protein L7a (as a loading control). Normalized C/EBP mRNA content (C/EBP/L7a) in the +Tg condition at 4 h was set to be 100%.

PAGE 118

107 Hour 0 2 4 8 12 2 4 8 12MEM MEM + Tg C/EBPprotein, times control 0123424812MEMMEM +Tg Hour 610 Hour 0 2 4 8 12 2 4 8 12MEM MEM + Tg Hour 0 2 4 8 12 2 4 8 12MEM MEM + Tg C/EBPprotein, times control 0123424812MEMMEM +Tg Hour 610 C/EBPprotein, times control 0123424812MEMMEM +Tg Hour 610

PAGE 119

108 Figure 5-4. The C/EBP protein content is increased following ER stress. HepG2 cells were incubated for 0 h in MEM or MEM containing Tg (Tg, 300 nM). At the times indicated, total cell extracts were collected and subjected to immunoblotting, as described in the Materials and Methods section. All blots were stained with Fast Green to confirm equal lane loading. The results shown in the upper panel are a representative blot, whereas the graph illustrates the densitometric averages standard deviations of three independent experiments. (Data courtesy of Dr. YuanXiang Pan)

PAGE 120

109 C/EBPL7aCHX --+ + --+ + --+ + --+ + --+ +MTMTMTMTMTMTMTMTMTMT0 1 2 4 8 12Hour Hour 20406080100024681012 MEM +Tg MEM+CHX +Tg+CHX C/EBP/ L7a mRNA, percent of maximum C/EBPL7aCHX --+ + --+ + --+ + --+ + --+ +MTMTMTMTMTMTMTMTMTMT0 1 2 4 8 12Hour C/EBPL7aC/EBPL7aCHX --+ + --+ + --+ + --+ + --+ +MTMTMTMTMTMTMTMTMTMT0 1 2 4 8 12Hour Hour 20406080100024681012 MEM +Tg MEM+CHX +Tg+CHX C/EBP/ L7a mRNA, percent of maximum Hour 20406080100024681012 MEM +Tg MEM+CHX +Tg+CHX MEM +Tg MEM+CHX +Tg+CHX C/EBP/ L7a mRNA, percent of maximum

PAGE 121

110 Figure 5-5. The increase in C/EBP mRNA following ER stress requires de novo protein synthesis. HepG2 cells, at 70-80% confluence (time=0), were transferred to either fresh complete MEM (M) or MEM plus Tg (T or Tg), in the presence or the absence of 0.1 mM cycloheximide (CHX). Total RNA was isolated at the time indicated and Northern blot analysis was performed to measure the mRNA content for C/EBP and the ribosomal protein L7a (as a loading control). Normalized C/EBP mRNA content (C/EBP/L7a) in cells treated for 4 h in MEM + Tg was set to be 100%.

PAGE 122

111 MEM + Act.DMEM -Glc + Act. DC/EBPGAPDHHour 0 0.5 1 2 4 8 0 0.5 1 2 4 8 120123HourC/EBP/ GAPDH mRNAMEM + Act. DMEM -Glc + Act. D MEM + Act.DMEM -Glc + Act. DC/EBPGAPDHHour 0 0.5 1 2 4 8 0 0.5 1 2 4 8 MEM + Act.DMEM -Glc + Act. DMEM + Act.DMEM -Glc + Act. DC/EBPGAPDHHour 0 0.5 1 2 4 8 0 0.5 1 2 4 8 120123HourC/EBP/ GAPDH mRNAMEM + Act. DMEM -Glc + Act. D 12120123HourC/EBP/ GAPDH mRNAMEM + Act. DMEM -Glc + Act. D 4 4 4

PAGE 123

112 Figure 5-6. The increase in C/EBP mRNA content following ER stress is not due to mRNA stabilization. HepG2 cells were maintained in MEM lacking glucose for 8 h to reach maximal induction (time = 0), and then the cells were incubated in either fresh complete MEM plus actinomycin D (MEM + Act.D) or fresh MEM lacking glucose in the presence of actinomycin D (MEM Glc + Act.D). Total RNA was isolated at the time indicated and Northern blot analysis was performed to measure the mRNA content for C/EBP and GAPDH (as a loading control). Normalized C/EBP mRNA content (C/EBP/GAPDH) at time = 0 was set to be 100%.

PAGE 124

113 B 0.511.52Relative Luciferase Activity, times control MEM-Glc+Tg Luc -8451+157 Luc -325+157 Luc Luc -1595+157 A CDS (+206/+1243)-8451+ 3541 Transcription start (+1) Poly A signal 3UTR (+1244/+1840) B 0.511.52Relative Luciferase Activity, times control MEM-Glc+Tg Luc -8451+157 Luc -325+157 Luc Luc -1595+157 0.511.52Relative Luciferase Activity, times control MEM-Glc+Tg MEM-Glc+Tg Luc -8451+157 Luc -8451+157 Luc -325+157 Luc Luc Luc -1595+157 Luc -1595+157 A CDS (+206/+1243)-8451+ 3541 Transcription start (+1) Poly A signal 3UTR (+1244/+1840) CDS (+206/+1243)-8451+ 3541 Transcription start (+1) Poly A signal 3UTR (+1244/+1840)

PAGE 125

114 Figure 5-7. The C/EBP genomic 5 upstream region alone is not sufficient to mediate increased transcription following ER stress. Panel A shows a schematic of the human C/EBP genomic structure, in which the transcription start site is labeled as nucleotide +1 and the protein coding sequence is labeled CDS. Panel B illustrates C/EBP promoter activity and the response to glucose deprivation (gray bars) or Tg treatment (black bars). Specific C/EBP genomic fragments were tested for their ability to drive the expression of the Firefly luciferase reporter gene. The relative luciferase activity of the C/EBP promoter fragment /+157 in the MEM condition was set to 1. All data are expressed as the averages standard deviations for four determinations and the data shown are representative of multiple experiments.

PAGE 126

115 01020304050 + Tg MEM Relative Luciferase Activity,times control Luc ^ Luc -1595/+157 Luc +1423/+3541^ Luc ^ -1595/+157-1595/+157-1595/+157+1423/+2213+1554/1646 0102030405001020304050 + Tg MEM Relative Luciferase Activity,times control Luc ^ Luc -1595/+157 Luc +1423/+3541^ Luc ^ -1595/+157-1595/+157-1595/+157+1423/+2213+1554/1646

PAGE 127

116 Figure 5-8. The C/EBP genomic region downstream of the protein coding sequence is required for transcriptional induction by ER stress. Sequentially deleted C/EBP genomic fragments were ligated downstream of the Firefly luciferase reporter gene coding sequence under the control of the C/EBP promoter (nt /+157). The transcription luciferase activity of the C/EBP promoter fragment alone under the MEM condition was set to 1. The data are expressed as the averages standard deviations for four determinations and the data shown are representative of multiple experiments.

PAGE 128

117 +1554 GCCGGTTTCGAAGTTGATGCAATCGGTTTAAACATGGCTGAACGCGTGTG TACACGGGACTGACGCAACCCACGTGTAACTGTCAGCCGGGCC +1646C/EBP-ATF cgaggcgttat Mut-1 ttcgatattc Mut-2ERSE NSRE-2 attcgagggac Mut-3AB 51015202530 MEM+ Tg Relative Luciferase Activity, times control Luc +1554/+1646SV40 Luc +1583/+1646(Del C/EBP-ATF) SV40 Luc SV40 ^ 5101520253035 MEM+Tg Relative Luciferase Activity, times controlC/EBPpromoteronlyWTMut-1Mut-2 promoter & C/EBPnt +1423 / +2213Mut-3**C+1554 GCCGGTTTCGAAGTTGATGCAATCGGTTTAAACATGGCTGAACGCGTGTG TACACGGGACTGACGCAACCCACGTGTAACTGTCAGCCGGGCC +1646C/EBP-ATF cgaggcgttat Mut-1 ttcgatattc Mut-2ERSE NSRE-2 attcgagggac Mut-3A+1554 GCCGGTTTCGAAGTTGATGCAATCGGTTTAAACATGGCTGAACGCGTGTG TACACGGGACTGACGCAACCCACGTGTAACTGTCAGCCGGGCC +1646C/EBP-ATF cgaggcgttat Mut-1 ttcgatattc Mut-2ERSE NSRE-2 attcgagggac Mut-3C/EBP-ATF cgaggcgttat Mut-1C/EBP-ATF cgaggcgttat Mut-1 ttcgatattc Mut-2ERSE NSRE-2 attcgagggac Mut-3 ttcgatattc Mut-2ttcgatattc Mut-2ERSE NSRE-2 attcgagggac Mut-3attcgagggac Mut-3AB 51015202530 MEM+ Tg Relative Luciferase Activity, times control Luc +1554/+1646SV40 Luc +1583/+1646(Del C/EBP-ATF) SV40 Luc SV40 ^ 5101520253035 MEM+Tg Relative Luciferase Activity, times controlC/EBPpromoteronlyWTMut-1Mut-2 promoter & C/EBPnt +1423 / +2213Mut-3**CB 51015202530 MEM+ Tg Relative Luciferase Activity, times control Luc +1554/+1646SV40 Luc +1583/+1646(Del C/EBP-ATF) SV40 Luc SV40 ^ B 51015202530 MEM+ Tg Relative Luciferase Activity, times control Luc +1554/+1646SV40 Luc +1583/+1646(Del C/EBP-ATF) SV40 Luc SV40 ^ 51015202530 MEM+ Tg MEM+ Tg Relative Luciferase Activity, times control Luc +1554/+1646SV40 Luc +1583/+1646(Del C/EBP-ATF) SV40 Luc SV40 ^ ^ 5101520253035 MEM+Tg Relative Luciferase Activity, times controlC/EBPpromoteronlyWTMut-1Mut-2 promoter & C/EBPnt +1423 / +2213Mut-3**C 5101520253035 MEM+Tg Relative Luciferase Activity, times controlC/EBPpromoteronlyWTMut-1Mut-2 promoter & C/EBPnt +1423 / +2213Mut-3** 5101520253035 MEM+Tg MEM+Tg Relative Luciferase Activity, times controlC/EBPpromoteronlyWTMut-1Mut-2 promoter & C/EBPnt +1423 / +2213Mut-3**C

PAGE 129

118 Figure 5-9. The C/EBP gene contains a cis-element, 3 to the protein coding sequence that mediates transcriptional activation in response to ER stress. The genomic sequence of the C/EBP gene (nt +1554 to +1646) is shown in Panel A. Sequences related to known transcription factor binding sites are boxed. Mutated sequences are shown in lower case and labeled Mut-1 to Mut-3. Block mutation of the three putative protein binding sites shown in Panel A were performed in the context of the C/EBP fragment nt +1423/+2213 and the data are shown in Panel C. To collect the data shown in Panel B, C/EBP genomic fragments were inserted downstream of the Firefly luciferase reporter gene driven by the SV40 promoter, whereas for the data shown in Panel C, the C/EBP promoter (nt -1595/+157) was used. SV40-driven Renilla luciferase was used as a transfection control for experiments shown in Panel C. The transcription rate of the promoter alone in cells incubated in MEM was set to 1. All data are expressed as the averages standard deviations for four determinations and the data shown are representative of multiple experiments. The asterisks indicate statistically significant differences in Tg-treated condition between the wild type and the mutant construct (p < 0.01, Student t-test).

PAGE 130

119 A A A A Btccactta MUT-5+1601 GTGTACACGGGACTGACGCAACCCACGTGTAACTGTCAGCCGGGCC +1646 tccMUT-7 atMUT-8ttcgatMUT-6 taacggctcMUT-4 0246810 Relative Luciferase Activity,times MEM control MEM +TgMut-4SV40promoteronlyWTMut-5Mut-6Mut-8Mut-7 SV40 promoter & C/EBPnt +1601 / +1646**** C 0306090120150 C/EBP+1554/+1646 C/EBP+1554/+1600 C/EBP+1601/+1646 SV40 promoteronly +TgMEM Relative Luciferase Activity Driven by SV40 promoter*Btccactta MUT-5+1601 GTGTACACGGGACTGACGCAACCCACGTGTAACTGTCAGCCGGGCC +1646 tccMUT-7 atMUT-8ttcgatMUT-6 taacggctcMUT-4 Btccactta MUT-5+1601 GTGTACACGGGACTGACGCAACCCACGTGTAACTGTCAGCCGGGCC +1646 tccMUT-7 atMUT-8ttcgatMUT-6 taacggctcMUT-4 tccactta MUT-5tccactta MUT-5 MUT-5+1601 GTGTACACGGGACTGACGCAACCCACGTGTAACTGTCAGCCGGGCC +1646 tccMUT-7 tccMUT-7 atMUT-8 atMUT-8ttcgatMUT-6 ttcgatMUT-6 taacggctcMUT-4 MUT-4 0246810 Relative Luciferase Activity,times MEM control MEM +TgMut-4SV40promoteronlyWTMut-5Mut-6Mut-8Mut-7 SV40 promoter & C/EBPnt +1601 / +1646**** C 0246810 Relative Luciferase Activity,times MEM control MEM +TgMut-4SV40promoteronlyWTMut-5Mut-6Mut-8Mut-7 SV40 promoter & C/EBPnt +1601 / +1646**** 02468100246810 Relative Luciferase Activity,times MEM control MEM +Tg MEM +TgMut-4SV40promoteronlyWTMut-5Mut-6Mut-8Mut-7 SV40 promoter & C/EBPnt +1601 / +1646**** C 0306090120150 C/EBP+1554/+1646 C/EBP+1554/+1600 C/EBP+1601/+1646 SV40 promoteronly +TgMEM Relative Luciferase Activity Driven by SV40 promoter* 0306090120150 C/EBP+1554/+1646 C/EBP+1554/+1600 C/EBP+1601/+1646 SV40 promoteronly +TgMEM Relative Luciferase Activity Driven by SV40 promoter 0306090120150 C/EBP+1554/+1646 C/EBP+1554/+1600 C/EBP+1601/+1646 SV40 promoteronly +TgMEM Relative Luciferase Activity Driven by SV40 promoter 0306090120150 C/EBP+1554/+1646 C/EBP+1554/+1646 C/EBP+1554/+1600 C/EBP+1554/+1600 C/EBP+1601/+1646 C/EBP+1601/+1646 SV40 promoteronly +TgMEM +TgMEM Relative Luciferase Activity Driven by SV40 promoter*

PAGE 131

120 Figure 5-10. An UPRE binding site is responsible for the transcriptional activation of the C/EBP gene in response to ER stress. The C/EBP sequence from nt +1554 to+1646 was separated into two halves and each half was tested for the ability to confer ER responsiveness to the SV40 promoter (Panel A). Block mutagenesis was performed within the C/EBP sequence in the context of the +1601/+1646 fragment (Panel B). The block mutations made are shown in lower case letters and labeled Mut-4 to Mut-8. The mUPRE-like sequence is blocked. The effect of mutating the C/EBP sequences is shown as the ratio of Firefly to Renilla luciferase activity (Panel C). The data of Panels A and C are expressed as the averages standard deviations for four assays and the data shown are representative of multiple experiments. The asterisks indicate statistically significant differences (* , p<= 0.05 and **, p <= 0.005) compared to the wild-type fragment (WT) in Tg-treated cells. (Data courtesy of Elizabeth Dudenhausen)

PAGE 132

121 Relative Luciferase Activity MEM MEM + Tg0 ** ** 20406080 ControlXBP1ATF6 020406080100120 * ** MEM MEM + TgC/EBP, nt 1601 / +1646 GRP78 promoter Relative Luciferase Activity MEM MEM + Tg0 ** ** 20406080 ControlXBP1ATF6 Relative Luciferase Activity MEM MEM + Tg0 ** ** 20406080 ControlXBP1ATF6 020406080100120 * ** MEM MEM + Tg 020406080100120 * ** MEM MEM + TgC/EBP, nt 1601 / +1646 GRP78 promoter

PAGE 133

122 Figure 5-11. Overexpression of XBP1 transactivates C/EBP transcription. HepG2 cells were transiently transfected with pcDNA3.1 vector (Control) or pcDNA3.1 containing the cDNA for the active form of either ATF6 or XBP1. The C/EBP genomic fragment nt +1601/+1646 was inserted downstream of the Firefly luciferase reporter under the control of SV40 promoter. The human GRP78 promoter fragment nt /+7, placed just upstream of the Firefly gene, was used as a positive control. Details for transient transfection and luciferase reporter assay refer to chapter 2. The transcriptional activity, regulated by the C/EBP or GRP78 sequences, were tested under control (MEM) or ER-stressed (+Tg) conditions. Asterisks (*) designate significant differences (p <= 0.01, Student’s t-test) resulting from transcription factor over-expression compared to transfection with empty vector (Control). All data are expressed as the averages standard deviations. The data shown are representative of three independent samples and the experiment was repeated multiple times using different batches of cells.

PAGE 134

123 C C A G G C G C C G G C G G G C G G G C C G G T T T C G A A G T T G A T G C A A T C G G T T T A A A C A T G G C T G A A C G C G T G T G T G C A G C C C G C G C G C C G G T T T C G A T T G A T G C A A T C G G T A A A C T G G C T G A C G C G T G T G C A G C C C G C G C G C C G G T T T C G A T T G A T G C A A T C G G T A A A C T G G C T G A C G C G T G T G C A C G C A C C T G C A C G C G C A C C G G G T T T C G G G A C T T G A T G C A A T C C G G A T C A A A C G T G G C T G A G C G C G T G T G G T A C A C G G G A C T A C G C A A C C C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C G C T T A A A G A T G T T C C T A C A C A C G G G A C T A C G C A A C C A C G T G T A A C T G T C T A G C C G G G C C C T G A G T A A T C C C T T A A A G A T G T T C C T C A C A C G G G A C T A C G C A A C C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C C T T A A A G A T G T T C C T C G A C A C G G G A C T G A C G C A A C A C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C A C T T A A A G A T G T T C C T G C A C G G G C T T G T T G T G T T T G T T T T G T T T T T T T T G T T T T T T G G T C T T C G G G T T G T T G A T G T T T T T G G T T T G T T T T G T T T T T T T T T T T T T T G G T C T T C G G G T T G T T G T G T T T G T T T T T G T T T T T T G T T T T T T T T T G G T C T T G C G G G G T T G T T G C T G T T G A T G T T T T G T T T T T G T T T T T T G T T T T G T T T T T T T T T T T G G T C T T A T T A T T T T T T T G T A T T A T A A A A A A T A A T C T A T T T C T A T G A G A A A A G A G G C G T C T G T A T A T T T G G G A A T C T T T T C C G T T T T T T G T A T T A T A A A A A A T C T A T T T C T A T G A G A A A A G A G G C G T T G T A T A T T T G G A A C T T T T C C G T T T T T G T A T T A T A A A A A A T C T A T T T C T A T G A G A A A A G A G G C G T T G T A T A T T T G G A A C T T T T C C G T T T T T G T A T T A T A T A A A A A A G T T C T A T T T C T A T G A G A A A A G A G G C G T A T G T A T A T T T T G A G A A C C T T T T C C G G T T T C A A G C A T T A A G A A C A C T T T T A A A A A T G A G G T T T C A G C A T T A A G A A A C T T T T A A A A A G G A G A A G C C A A A G T T T C A G C A T T A A G A A A C T T T T A A A A A A A A A C G G C A C G A G G T T T C G A G C A T T A A A G T G A A G A C A T T T T A A T A A A C T T T T T T G A G A A T G T T A HumanMouseRat C/EBPmUPREConsensus C/EBP-ATF NSRE-2 C C A G G C G C C G G C G G G C G G G C C G G T T T C G A A G T T G A T G C A A T C G G T T T A A A C A T G G C T G A A C G C G T G T G T G C A G C C C G C G C G C C G G T T T C G A T T G A T G C A A T C G G T A A A C T G G C T G A C G C G T G T G C A G C C C G C G C G C C G G T T T C G A T T G A T G C A A T C G G T A A A C T G G C T G A C G C G T G T G C A C G C A C C T G C A C G C G C A C C G G G T T T C G G G A C T T G A T G C A A T C C G G A T C A A A C G T G G C T G A G C G C G T G T G G T A C A C G G G A C T A C G C A A C C C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C G C T T A A A G A T G T T C C T A C A C A C G G G A C T A C G C A A C C A C G T G T A A C T G T C T A G C C G G G C C C T G A G T A A T C C C T T A A A G A T G T T C C T C A C A C G G G A C T A C G C A A C C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C C T T A A A G A T G T T C C T C G A C A C G G G A C T G A C G C A A C A C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C A C T T A A A G A T G T T C C T G C A C G G G C T T G T T G T G T T T G T T T T G T T T T T T T T G T T T T T T G G T C T T C G G G T T G T T G A T G T T T T T G G T T T G T T T T G T T T T T T T T T T T T T T G G T C T T C G G G T T G T T G T G T T T G T T T T T G T T T T T T G T T T T T T T T T G G T C T T G C G G G G T T G T T G C T G T T G A T G T T T T G T T T T T G T T T T T T G T T T T G T T T T T T T T T T T G G T C T T A T T A T T T T T T T G T A T T A T A A A A A A T A A T C T A T T T C T A T G A G A A A A G A G G C G T C T G T A T A T T T G G G A A T C T T T T C C G T T T T T T G T A T T A T A A A A A A T C T A T T T C T A T G A G A A A A G A G G C G T T G T A T A T T T G G A A C T T T T C C G T T T T T G T A T T A T A A A A A A T C T A T T T C T A T G A G A A A A G A G G C G T T G T A T A T T T G G A A C T T T T C C G T T T T T G T A T T A T A T A A A A A A G T T C T A T T T C T A T G A G A A A A G A G G C G T A T G T A T A T T T T G A G A A C C T T T T C C G G T T T C A A G C A T T A A G A A C A C T T T T A A A A A T G A G G T T T C A G C A T T A A G A A A C T T T T A A A A A G G A G A A G C C A A A G T T T C A G C A T T A A G A A A C T T T T A A A A A A A A A C G G C A C G A G G T T T C G A G C A T T A A A G T G A A G A C A T T T T A A T A A A C T T T T T T G A G A A T G T T A HumanMouseRat C/EBPmUPREConsensus C C A G G C G C C G G C G G G C G G G C C G G T T T C G A A G T T G A T G C A A T C G G T T T A A A C A T G G C T G A A C G C G T G T G T G C A G C C C G C G C G C C G G T T T C G A T T G A T G C A A T C G G T A A A C T G G C T G A C G C G T G T G C A G C C C G C G C G C C G G T T T C G A T T G A T G C A A T C G G T A A A C T G G C T G A C G C G T G T G C A C G C A C C T G C A C G C G C A C C G G G T T T C G G G A C T T G A T G C A A T C C G G A T C A A A C G T G G C T G A G C G C G T G T G G T A C A C G G G A C T A C G C A A C C C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C G C T T A A A G A T G T T C C T A C A C A C G G G A C T A C G C A A C C A C G T G T A A C T G T C T A G C C G G G C C C T G A G T A A T C C C T T A A A G A T G T T C C T C A C A C G G G A C T A C G C A A C C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C C T T A A A G A T G T T C C T C G A C A C G G G A C T G A C G C A A C A C A C G T G T A A C T G T C A G C C G G G C C C T G A G T A A T C A C T T A A A G A T G T T C C T G C A C G G G C T T G T T G T G T T T G T T T T G T T T T T T T T G T T T T T T G G T C T T C G G G T T G T T G A T G T T T T T G G T T T G T T T T G T T T T T T T T T T T T T T G G T C T T C G G G T T G T T G T G T T T G T T T T T G T T T T T T G T T T T T T T T T G G T C T T G C G G G G T T G T T G C T G T T G A T G T T T T G T T T T T G T T T T T T G T T T T G T T T T T T T T T T T G G T C T T A T T A T T T T T T T G T A T T A T A A A A A A T A A T C T A T T T C T A T G A G A A A A G A G G C G T C T G T A T A T T T G G G A A T C T T T T C C G T T T T T T G T A T T A T A A A A A A T C T A T T T C T A T G A G A A A A G A G G C G T T G T A T A T T T G G A A C T T T T C C G T T T T T G T A T T A T A A A A A A T C T A T T T C T A T G A G A A A A G A G G C G T T G T A T A T T T G G A A C T T T T C C G T T T T T G T A T T A T A T A A A A A A G T T C T A T T T C T A T G A G A A A A G A G G C G T A T G T A T A T T T T G A G A A C C T T T T C C G G T T T C A A G C A T T A A G A A C A C T T T T A A A A A T G A G G T T T C A G C A T T A A G A A A C T T T T A A A A A G G A G A A G C C A A A G T T T C A G C A T T A A G A A A C T T T T A A A A A A A A A C G G C A C G A G G T T T C G A G C A T T A A A G T G A A G A C A T T T T A A T A A A C T T T T T T G A G A A T G T T A HumanMouseRat C/EBPmUPREConsensus C/EBP-ATF NSRE-2 C A T A C A C A G G G C C A C G G G C A T A C C C A G G G C C A C G G G G G A A G G G A A G C G A G G G T T T T G T T T T T G T T T G T A T T A T T G G C G A T T T T G T T T T T G T T T A T T A T T T T A G T A A C T A G T A T A C T C T T T T T T T A A T G G T T A G A G T G A T C T T T T T T G A A T G T T T A A G A G T G A C A T A C A C A G G G C C A C G G G C A T A C C C A G G G C C A C G G G G G A A G G G A A G C G A G G G T T T T G T T T T T G T T T G T A T T A T T G G C G A T T T T G T T T T T G T T T A T T A T T T T A G T A A C T A G T A T A C T C T T T T T T T A A T G G T T A G A G T G A T C T T T T T T G A A T G T T T A A G A G T G A C A T A C A C A G G G C C A C G G G C A T A C C C A G G G C C A C G G G G G A A G G G A A G C G A G G G T T T T G T T T T T G T T T G T A T T A T T G G C G A T T T T G T T T T T G T T T A T T A T T T T A G T A A C T A G T A T A C T C T T T T T T T A A T G G T T A G A G T G A T C T T T T T T G A A T G T T T A A G A G T G A

PAGE 135

124 Figure 5-12. The genomic sequence corresponding to the 3 UTR of the C/EBP gene for human, rat and mouse. The human C/EBP 3 UTR sequence (NM_005194), starting at nt +1244, was used to align the same region from the rat (NM_024125) and the mouse (NM_009883) gene. The alignment was performed using the Vector NTI 7.1 software. The Genbank accession numbers are given in the parenthesis. The alignment shown corresponds to the human C/EBP sequence from nt + 1536 to the polyadenylation signal. Black box indicates the nucleotides that are identical across three species, whereas gray box represents the nucleotides that are conserved in two out of three spices. The human C/EBP mUPRE (nt +1614 to +1621), responsible for activating the gene in response to ER stress, is underlined and labeled. The elements known to mediate the amino acid response, the C/EBP-ATF site for the human CHOP and system A amino acid transporter SNAT2 genes, or the NSRE-2 for the human ASNS gene, are also indicated.

PAGE 136

CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS Nutrient Control of the Human Asparagine Synthetase (ASNS) Gene A nutrient-sensing cis-acting element unit for the ASNS gene, nutrient-sensing response unit (NSRU), was characterized by single nucleotide mutagenesis, transient transfection and Northern blot analysis. The core sequence for the NSRU is 5-TGATGAAACN 11 -GTTACA -3, located from nt to within the ASNS proximal promoter region. The NSRU is responsible for mediating transcriptional activation of the ASNS following limitation of either amino acid or glucose (102). Nutrient-sensing response element (NSRE)-1 (5-TGATGAAAC-3) and NSRE-2 (5-GTTACA -3) function cooperatively; mutating any single nucleotide in either site resulted in a loss of not only basal but also nutrient deprivation-activated transcription. The sequential order of the NSRE-1 and NSRE-2 is essential for amino acid-dependent transcription (102). Although the exact sequence of the 11 bp intervening region between NSRE-1 and NSRE-2 did not seem to be crucial as determined by single nucleotide mutagenesis, the length of 11 bp was critical for induction of the ASNS gene in response to the amino acid response (AAR). Alteration of the 11 bp length resulted in a blockade of transcriptional activation in the amino acid-deprived condition (102). The core sequence of the NSRE-1 is highly similar to the amino acid response element (5-TGATGCAAT-3, bottom DNA strand) for the human C/EBP homology protein (CHOP) gene; they differ by only two nucleotides. 125

PAGE 137

126 Using electrophoresis mobility shift assay (EMSA)/supershift and yeast one-hybrid screening, CCAAT/enhancer-binding protein beta (C/EBP was identified as an NSRE-1 binding protein (59). My data show that overexpressing the activating form of C/EBP (LAP) in HepG2 cells not only increased ASNS promoter activity in nutrient-fed state, but also enhanced further the activity in cells deprived of either amino acid or glucose. Conversely, overexpression of a naturally-occurring dominant negative form of C/EBP (LIP) blocked deprivation-induced transcription and inhibited basal promoter activity. These results established a functional role of C/EBP in regulating ASNS gene expression in response to nutrient availability. With regard to future analysis, to understand fully how the ASNS gene transcription is modulated by nutrient deprivation, it will be essential to identify proteins that interact with NSRE-2 and the possible bridging factors that interact with both NSRE-1-and NSRE-2-binding proteins. It has been difficult to identify NSRE-2-binding protein. The reason may be that protein binding at the NSRE-2 site requires the binding of NSRE-1 proteins first. Using the entire NSRU instead of NSRE-2 sequence alone as a bait for the yeast one-hybrid screening may be one of the future approaches. Another approach would be DNA affinity columns containing resin beads attached to the NSRU sequence. Unfortunately, both of these approaches will have the NSRE-1 binding proteins as “background”. Chromatin immunoprecipitation (ChIP) analysis can be used to characterize in vivo the dynamic protein binding profile surrounding the NSRU in the ASNS proximal promoter region. By comparing binding of the key regulators for the ASNS gene expression such as C/EBP (59), C/EBP, ATF4 (59), and ATF3 (125) at different time

PAGE 138

127 points in the nutrient-deprived state, one can see at the molecular level how these proteins interact with the NSRU to activate ASNS transcription. Examining the presence of basal transcription machinery components (such as RNA polymerase II, TATA-binding protein, and general transcription factors), coactivators, histone acetyltransferases, as well as modifications (ex. acetylation, methylation and phosphorylation) of histones would also provide valuable insight into how ASNS expression is activated and how chromatin structure is modified in response to amino acid or glucose deprivation. Nutrient Control of the Human C/EBP Gene My research is the first to identify the C/EBP gene as the target of the mammalian endoplasmic reticulum (ER) stress. The expression of C/EBP is increased by glucose limitation, treatment of cells with tunicamycin or thapsigargin, and this increase appears to result largely from transcriptional regulation. The C/EBP promoter plays no major role in mediating this unfolded protein response (UPR). Deletion analysis and mutagenesis identified a mammalian unfolded protein response element (mUPRE)-like element, 5-TGACGCAACC-3, in the genomic region 3 to the protein coding sequence, from nt +1614 to +1623, as the one responsible for mediating most, if not all, of the UPR for the C/EBP gene. Overexpression of XBP1, a known mUPRE binding protein (39), caused an increase in transcription that was mediated by the mUPRE under basal and ER-stressed conditions. In the future, EMSA can be performed using the C/EBP mUPRE sequence and surrounding region as a probe to examine the formation of specific DNA-protein complexes and whether the abundance of these complexes is increased following ER stress. Supershift experiments using antibodies against potential mUPRE binding proteins

PAGE 139

128 such as XBP1 and ATF6, can complement the observations obtained by these overexpression experiments by testing the binding of these factors at the C/EBP mUPRE. ChIP analysis of the genomic region surrounding the C/EBP mUPRE can not only confirm the factor binding in vivo, but most importantly may provide insight into how an enhancer located 3 to the protein coding sequence interact with the basal transcription machinery at the promoter to increase transcription. The knockout cells for XBP1 (44) and IRE1 (40) would be useful to confirm that the induction of C/EBP by ER stress is initiated at IRE1 and then mediated through XBP1. It would also be interesting to see whether the increase of ASNS expression is also blocked in those mouse embryonic fibroblasts. This thesis work confirmed the initial observation of Marten et al. (95) that the mRNA content of C/EBP is increased by amino acid deprivation, and extended that observation to examine the mechanism of this increase. Although the increase in the C/EBP mRNA content is due to increased transcription, the promoter region of the C/EBP gene does not contain the necessary information to mediate the AAR. The genomic region corresponding to the C/EBP 3 sequence from nt +1554/+1646 induced transcription in amino acid-limited cells to the level similar to, if not greater than, the C/EBP 3 genomic fragment nt +1423/+2213 did. Interestingly and unexpectedly, the sequence identical to the CHOP amino acid response element (AARE), located in the C/EBP 3 genomic region nt +1568 to +1576, is not responsible for activating the C/EBP gene in response to the AAR. In the future, to test the hypothesis that the C/EBP mUPRE sequence is also the cis-element responsible for activating C/EBP gene following amino acid deprivation,

PAGE 140

129 mutagenesis of the element should be performed in the context of the C/EBP 3 nt +1423/+2213 fragment. If substitution of the C/EBP mUPRE sequence shows a blockade in amino acid limitation-activated transcription, as preliminary experiments suggest, EMSA and supershift experiments can be performed as an initial screening for the factor binding at the C/EBP mUPRE in amino acid-deprived condition. The candidates include C/EBP family members such as C/EBP and C/EBP, as well as ATF family members such as ATF2, ATF3, and ATF4. After identifying the factor binding in vitro, transcription factor overexpression and ChIP analysis can be used to further characterize the mechanisms of C/EBP gene activation by the AAR. It would also be interesting to investigate the possible involvement of XBP1 in regulating C/EBP transcription via the AAR, and to examine whether XBP1 is a target gene of the AAR. The effect of XBP1 overexpression on C/EBP transcription following AAR activation should first be tested using transient transfection of a luciferase reporter plasmid containing wild-type or mutated C/EBP mUPRE in the context of the C/EBP sequence nt +1423/+2213. It has been shown that the mRNA content of XBP1 is increased by amino acid deprivation (Can Zhong, unpublished results; Dr. Kazutoshi Mori, personal communication). Nuclear run-on assay and an mRNA half-life study with actinomycin D can demonstrate whether this increase is due to increased transcription. If the up-regulation in XBP1 mRNA is transcriptional, a human XBP1 proximal promoter fragment (nt -330 to +129) (126) can be tested initially for amino acid-regulated transcription. More deletion analysis and mutagenesis can be performed if the results are positive, or studies initiated to look elsewhere in the gene if they are negative. IRE1 -/

PAGE 141

130 mouse embryonic fibroblasts would also be valuable in determining whether the induction of XBP1 mRNA by amino acid deprivation is dependent on IRE1 activation. My research demonstrated that transcription of the human C/EBP gene is regulated by both the AAR and the UPR nutrient-sensing pathways. It would be interesting to investigate the effects of nutrient deprivation and cellular stress on translationalor post-translational control of the C/EBP gene as well. Phosphorylation plays a key role in modulating C/EBP function. Phosphorylation of C/EBP can induce (127) or suppress (128) its trans-activation potential, decrease its DNA binding activity (129), or cause its nuclear translocation (130). Xu et al. (131) proposed that deacetylation of C/EBP allows trans-activation mediated by STAT5. It has also been suggested that C/EBP is a target for sumoylation (132). All of the above post-translational modifications of C/EBP, phosphorylation, acetylation, sumoylation and nuclear translocation, have yet to be linked to nutrient availability. Alternative translational initiation at multiple AUG start codons has been proposed to be a mechanism for the production of different C/EBP isoforms (i.e. LAP and LIP), and the ratio of LAP to LIP are likely to be functionally important (80). A conserved out-of-frame short upstream open reading frame (uORF) is also present in C/EBP mRNA, and such a uORF has been shown to inhibit C/EBP translation in cis (133). Calkhoven et al. (134) demonstrated that the integrity of the uORF is essential for initiating translation of different isoforms, and that the ratio of C/EBP isoforms is controlled by the RNA-dependent protein kinase (PKR)-eukaryotic translation initiation factor 2 (eIF2) and mTOR-eIF4E pathways. Given the known effects of amino acid availability on the eIF2 and mTOR pathways, it is conceivable that amino acid deprivation regulates

PAGE 142

131 translational control of different C/EBP isoforms. Glucose limitation and ER stress also induces translational attenuation (50). Therefore it would be of interest to investigate translational regulation of C/EBP by the UPR as well.

PAGE 143

APPENDIX ADDITIONAL RESULTS C/EBPpromoter(nt /+157) 13572.6 MEM-His Promoter&C/EBPnt +1554/+1646Relative Luciferase ActivityC/EBPpromoter(nt /+157) 13572.6 MEM-His MEM-His Promoter&C/EBPnt +1554/+1646Relative Luciferase Activity Figure A-1. The C/EBP 3 genomic sequence nt +1554/+1646 can confer amino acid responsiveness to the inert C/EBP promoter (nt-325/+157). The C/EBP 3 genomic fragment nt +1554/+1646 is inserted downstream of the Firefly luciferase reporter gene under the control of the C/EBP promoter fragment nt /+157. The C/EBP promoter activity in response to histidine deprivation was tested after incubation of transfected HepG2 cells in either MEM (open bars) or MEM-His (black bars) for 12 h. HepG2 cells (2 x 10 5 /well) were transfected as described in chapter 2 using 1 g of the Firefly luciferase reporter construct and 6 l of the SuperFect transfection reagent. The cells were transferred to MEM or MEM-His 18 h after transfection. Relative luciferase activity represents the Firefly luciferase activity normalized for transfection efficiency as measured by the activity of the Renilla luciferase driven by the SV40 promoter. The value of the relative luciferase activity of the C/EBP promoter fragment nt /+157 in the MEM condition was set to 1. The C/EBP sequence nt +1554/+1646 increased transcription in the –His condition 2.6 fold over the MEM control. All data are expressed as the averages standard deviations. The data shown are from a single experiment that is representative of multiple experiments. 132

PAGE 144

133 MEM-His Relative Luciferase ActivityC/EBPpromoter(nt /+157)Promoter&C/EBPnt +1554/+1646 (REV) 02468104.4 MEM-His MEM-His Relative Luciferase ActivityC/EBPpromoter(nt /+157)Promoter&C/EBPnt +1554/+1646 (REV) 02468104.4 Figure A-2. The C/EBP 3 genomic sequence nt +1554/+1646 is functional in reversed orientation. The C/EBP 3 genomic fragment nt +1554/+1646 is ligated in reversed orientation downstream of the Firefly luciferase reporter gene under the control of the C/EBP promoter fragment nt /+157. HepG2 cells (2 x 10 5 /well) were transfected as described in chapter 2 using 1 g of the Firefly luciferase reporter construct and 6 l of the SuperFect transfection reagent. The cells were transferred to MEM or MEM-His 18 h after transfection. After incubation of the transfected cells in MEM or MEM-His for 12 h, the Firefly luciferase activity was measured. To correct for transfection efficiency, the activity of the Firefly luciferase is normalized with that of the Renilla luciferase driven by the SV40 promoter (relative luciferase activity). The value of the relative luciferase activity of the C/EBP promoter fragment nt –1595/+157 alone (without 3 sequence) under the MEM condition was set to 1. The C/EBP sequence nt +1554/+1646 in reversed orientation induced transcription in the –His condition 4.4 fold over the MEM control. All data are expressed as the averages standard deviations.

PAGE 145

134 051015202524681012HourMEM+Tg-His Relative Luciferase Activity 05101520252468101224681012HourMEM+Tg-His Relative Luciferase Activity Figure A-3. Time course of the transcriptional induction mediated by the C/EBP 3 genomic sequence nt +1423/+2213 in response to the AAR and the UPR. The C/EBP 3 genomic fragment nt +1423/+2213 is ligated downstream of the Firefly luciferase reporter gene under the control of the C/EBP promoter fragment nt /+157. HepG2 cells (2 x 10 5 /well) were transfected as described in chapter 2 using 1 g of the Firefly luciferase reporter construct and 6 l of the SuperFect transfection reagent. The cells were transferred to MEM, MEM-His or MEM+Tg 18 h after transfection. After incubation of the transfected cells in MEM, MEM-His or MEM+Tg for the time indicated, the Firefly luciferase activity was measured. To correct for the transfection efficiency between wells, the activity of the Firefly luciferase is normalized with that of the Renilla luciferase driven by the SV40 promoter (relative luciferase activity). Six independent samples were assayed for each time point under each condition, and all data are expressed as the averages standard deviations. For some data points, the standard deviation bars are contained within the figure legends.

PAGE 146

LIST OF REFERENCES 1 . Richards NGJ and Schuster SM Mechanistic issues in asparagine synthetase catalysis Adv. Enzymol. 72: 145-198, 1998. 2 . Hutson RG and Kilberg MS Cloning of rat asparagine synthetase and specificity of the amino acid-dependent control of its mRNA content Biochem. J. 303: 745-750, 1994. 3 . Greco A, Ittmann M, and Basilico C Molecular cloning of a gene that is necessary for G 1 progression in mammalian cells Proc. Natl. Acad. Sci. USA 84: 1565-1569, 1987. 4 . Greco A, Gong SS, Ittmann M, and Basilico C Organization and expression of the cell cycle gene, ts 11, that encodes asparagine synthetase Mol. Cell. Biol. 9: 2350-2359, 1989. 5 . Gong SS and Basilico C A mammalian temperature-sensitive mutation affecting G1 progression results from a single amino acid substitution in asparagine synthetase Nucleic Acids Res. 18: 3509-3513, 1990. 6 . Colletta G and Cirafici AM TSH is able to induce cell cycle-related gene expression in rat thyroid cell Biochem. Biophys. Res. Commun. 183: 265-272, 2-28-1992. 7 . Capizzi, R. L. and J. S. Holcenberg. Asparaginase. In Holland, J. F., E. Frei, R. C. Bast, Jr., D. W. Kuffe, D. L. Morton, and Weichselbaum, eds. Cancer Medicine. Philadelphia, R.R.Lea & Febiger. 1993, 796-805. 8 . Muller HJ and Boos J Use of L-asparaginase in childhood ALL Crit. Rev. Oncology/Hematology 28: 97-113, 1998. 9 . Aslanian AM, Fletcher BS, and Kilberg MS Asparagine synthetase expression alone is sufficient to induce l-asparaginase resistance in MOLT-4 human leukaemia cells Biochem. J. 357: 321-328, 7-1-2001. 135

PAGE 147

136 10 . Hinnebusch AG Mechanisms of gene regulation in the general control of amino acid biosynthesis in Saccharomyces cerevisiae Microbiol. Rev. 52: 248-273, 1988. 11 . Natarajan K, Meyer MR, Jackson BM, Slade D, Roberts C, Hinnebusch AG, and Marton MJ Transcriptional profiling shows that Gcn4p is a master regulator of gene expression during amino acid starvation in yeast Mol. Cell Biol. 21: 4347-4368, 2001. 12 . Hinnebusch AG Translational regulation of yeast GCN4 J. Biol. Chem. 272: 21661-21664, 1997. 13 . Wek SA, Zhu S, and Wek RC The histidyl-tRNA synthetase-related sequence in the eIF-2 alpha protein kinase GCN2 interacts with tRNA and is required for activation in response to starvation for different amino acids Mol. Cell Biol. 15: 4497-4506, 1995. 14 . Arfin SM, Simpson DR, Chiang CS, Andrulis IL, and Hatfield GW A role for asparaginyl-tRNA in the regulation of asparagine synthetase in a mammalian cell line Proc. Natl. Acad. Sci. USA 74: 2367-2369, 1977. 15 . Gong SS, Guerrini L, and Basilico C Regulation of asparagine synthetase gene expression by amino acid starvation Mol. Cell. Biol. 11: 6059-6066, 1991. 16 . Hutson RG, Warskulat U, and Kilberg MS An example of nutrient control of gene expression: amino acid-dependent regulation of asparagine synthetase Clin. Nutr. 15: 327-331, 1996. 17 . Hutson RG, Kitoh T, Amador DAM, Cosic S, Schuster SM, and Kilberg MS Amino acid control of asparagine synthetase: relation to asparaginase resistance in human leukemia cells Am. J. Physiol. 272: C1691-C1699, 1997. 18 . Hongo S, Fujimori M, Shioda S, Nakai Y, Takeda M, and Sato T Immunochemical characterization of rat testicular asparagine synthetase Arch. Biochem. Biophys. 295: 120-125, 1992. 19 . Andrulis IL, Hatfield GW, and Arfin SM Asparaginyl-tRNA aminoacylation levels and asparagine synthetase expression in cultured Chinese hamster ovary cells J. Biol. Chem. 254: 10629-10633, 1979.

PAGE 148

137 20 . Berlanga JJ, Santoyo J, and De Haro C Characterization of a mammalian homolog of the GCN2 eukaryotic initiation factor 2alpha kinase Eur. J. Biochem. 265: 754-762, 1999. 21 . Sood R, Porter AC, Olsen DA, Cavener DR, and Wek RC A mammalian homologue of GCN2 protein kinase important for translational control by phosphorylation of eukaryotic initiation factor-2 Genetics 154: 787-801, 2000. 22 . Hansen BS, Vaughan MH, and Wang L-J Reversible inhibition by histidinol of protein synthesis in human cells at the activation of histidine J. Biol. Chem. 247: 3854-3857, 1972. 23 . Guerrini L, Gong SS, Mangasarian K, and Basilico C Cisand trans-acting elements involved in amino acid regulation of asparagine synthetase gene expression Mol. Cell. Biol. 13: 3202-3212, 1993. 24 . Pohjanpelto P and Holtta E Deprivation of a single amino acid induces protein synthesis-dependent increases in c-jun, c-myc, and ornithine decarboxylase mRNAs in Chinese hamster ovary cells Mol Cell Biol. 10: 5814-5821, 1990. 25 . Kozutsumi Y, Segal M, Normington K, Gething MJ, and Sambrook J The presence of malfolded proteins in the endoplasmic reticulum signals the induction of glucose-regulated proteins Nature 332: 462-464, 3-31-1988. 26 . Pouyssegur J, Shiu RP, and Pastan I Induction of two transformation-sensitive membrane polypeptides in normal fibroblasts by a block in glycoprotein synthesis or glucose deprivation Cell 11: 941-947, 1977. 27 . Lee AS Mammalian stress response: induction of the glucose-regulated protein family. Curr. Opin. Cell Biol. 4: 267-273, 1992. 28 . Kaufman RJ, Scheuner D, Schroder M, Shen X, Lee K, Liu CY, and Arnold SM The unfolded protein response in nutrient sensing and differentiation Nat. Rev. Mol Cell Biol. 3: 411-421, 2002. 29 . Cox JS, Shamu CE, and Walter P Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase Cell 73: 1197-1206, 6-18-1993.

PAGE 149

138 30 . Mori K, Ma W, Gething MJ, and Sambrook J A transmembrane protein with a cdc2+/CDC28-related kinase activity is required for signaling from the ER to the nucleus Cell 74: 743-756, 8-27-1993. 31 . Cox JS and Walter P A novel mechanism for regulating activity of a transcription factor that controls the unfolded protein response Cell 87: 391-404, 11-1-1996. 32 . Mori K, Kawahara T, Yoshida H, Yanagi H, and Yura T Signalling from endoplasmic reticulum to nucleus: transcription factor with a basic-leucine zipper motif is required for the unfolded protein-response pathway Genes Cells 1: 803-817, 1996. 33 . Nikawa J, Akiyoshi M, Hirata S, and Fukuda T Saccharomyces cerevisiae IRE2/HAC1 is involved in IRE1-mediated KAR2 expression Nucleic Acids Res. 24: 4222-4226, 11-1-1996. 34 . Yoshida H, Haze K, Yanagi H, Yura T, and Mori K Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose-regulated proteins J. Biol. Chem. 273: 33741-33749, 1998. 35 . Mori K, Sant A, Kohno K, Normington K, Gething MJ, and Sambrook JF A 22 bp cis-acting element is necessary and sufficient for the induction of the yeast KAR2 (BiP) gene by unfolded proteins EMBO J. 11: 2583-2593, 1992. 36 . Roy B and Lee AS The mammalian endoplasmic reticulum stress response element consists of an evolutionarily conserved tripartite structure and interacts with a novel stress-inducible complex Nucl. Acids Res. 27: 1437-1443, 1999. 37 . Wang X-Z, Harding HP, Zhang Y, Jolicoeur EM, Kuroda M, and Ron D Cloning of mammalian Ire1 reveals diversity in the ER stress responses EMBO J. 17: 5708-5717, 1998. 38 . Tirasophon W, Welihinda AA, and Kaufman RJ A stress response pathway from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein kinase/endoribonuclease (Ire1p) in mammalian cells Gene. Devel. 12: 1812-1824, 1998.

PAGE 150

139 39 . Yoshida H, Matsui T, Yamamoto A, Okada T, and Mori K XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor Cell 107: 881-891, 12-28-2001. 40 . Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, Okada T, Yoshida H, Mori K, and Kaufman RJ IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response Genes Dev. 16: 452-466, 2-15-2002. 41 . Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, Clark SG, and Ron D IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA Nature 415: 92-96, 1-3-2002. 42 . Shen X, Ellis RE, Lee K, Liu CY, Yang K, Solomon A, Yoshida H, Morimoto R, Kurnit DM, Mori K, and Kaufman RJ Complementary signaling pathways regulate the unfolded protein response and are required for C. elegans development Cell 107: 893-903, 12-28-2001. 43 . Wang Y, Shen J, Arenzana N, Tirasophon W, Kaufman RJ, and Prywes R Activation of ATF6 and an ATF6 DNA binding site by the endoplasmic reticulum stress response J. Biol. Chem. 275: 27013-27020, 9-1-2000. 44 . Lee AH, Iwakoshi NN, and Glimcher LH XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response Mol. Cell Biol. 23: 7448-7459, 2003. 45 . Haze K, Yoshida H, Yanagi H, Yura T, and Mori K Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress Mol. Biol. Cell 10: 3787-3799, 1999. 46 . Yoshida H, Okada T, Haze K, Yanagi H, Yura T, Negishi M, and Mori K ATF6 activated by proteolysis binds in the presence of NF-Y (CBF) directly to the cis-acting element responsible for the mammalian unfolded protein response Mol. Cell Biol. 20: 6755-6767, 2000. 47 . Li M, Baumeister P, Roy B, Phan T, Foti D, Luo S, and Lee AS ATF6 as a transcription activator of the endoplasmic reticulum stress element: thapsigargin stress-induced changes and synergistic interactions with NF-Y and YY1 Mol Cell Biol. 20: 5096-5106, 2000.

PAGE 151

140 48 . Li M, Baumeister P, Roy B, Phan T, Foti D, Luo S, and Lee AS ATF6 as a transcription activator of the endoplasmic reticulum stress element: thapsigargin stress-induced changes and synergistic interactions with NF-Y and YY1 Mol. Cell Biol. 20: 5096-5106, 2000. 49 . Shi Y, Vattem KM, Sood R, An J, Liang J, Stramm L, and Wek RC Identification and characterization of pancreatic eukaryotic initiation factor 2 alpha-subunit kinase, PEK, involved in translational control Mol Cell Biol. 18: 7499-7509, 1998. 50 . Harding HP, Zhang Y, and Ron D Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase Nature 397: 271-274, 1-21-1999. 51 . Liu CY, Schroder M, and Kaufman RJ Ligand-independent dimerization activates the stress response kinases IRE1 and PERK in the lumen of the endoplasmic reticulum J. Biol. Chem. 275: 24881-24885, 8-11-2000. 52 . Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M, and Ron D Regulated translation initiation controls stress-induced gene expression in mammalian cells Mol. Cell 6: 1099-1108, 2000. 53 . Siu F, Bain PJ, LeBlanc-Chaffin R, Chen H, and Kilberg MS ATF4 Is a Mediator of the Nutrient-sensing Response Pathway That Activates the Human Asparagine Synthetase Gene J. Biol. Chem. 277: 24120-24127, 7-5-2002. 54 . Barbosa-Tessmann IP, Pineda VL, Nick HS, Schuster SM, and Kilberg MS Transcriptional regulation of the human asparagine synthetase gene by carbohydrate availability Biochem. J. 339: 151-158, 1999. 55 . Barbosa-Tessmann IP, Chen C, Zhong C, Schuster SM, Nick HS, and Kilberg MS Activation of the unfolded protein response pathway induces human asparagine synthetase gene expression J. Biol. Chem. 274: 31139-31144, 1999. 56 . Li WW, Hsiung YC, Zhou YH, Roy B, and Lee AS Induction of the mammalian GRP78/BiP gene by Ca 2+ depletion and formation of aberrant proteins: activation of the conserved stress-inducible grp core promoter element by the human nuclear factor YY1 Mol. Cell. Biol. 17: 54-60, 1997. 57 . Barbosa-Tessmann IP, Chen C, Zhong C, Siu F, Schuster SM, Nick HS, and Kilberg MS Activation of the Human Asparagine Synthetase Gene by the Amino

PAGE 152

141 Acid Response and the Endoplasmic Reticulum Stress Response Pathways Occurs by Common Genomic Elements J. Biol. Chem. 275: 26976-26985, 2000. 58 . Leung-Pineda V and Kilberg MS. Role of Sp1 and Sp3 in the Nutrient-Regulated Expression of the Human Asparagine Synthetase Gene. Journal of Biological Chemistry , 16585-16591. 2002. 59 . Siu FY, Chen C, Zhong C, and Kilberg MS CCAAT/enhancer-binding protein beta (C/EBP) is a mediator of the nutrient sensing response pathway that activates the human asparagine synthetase gene J. Biol. Chem. 276: 48100-48107, 10-24-2001. 60 . Akira S, Isshiki H, Sugita T, Tanabe O, Kinoshita S, Nishio Y, Nakajima T, Hirano T, and Kishimoto T A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family EMBO J. 9: 1897-1906, 1990. 61 . Chang CJ, Chen TT, Lei HY, Chen DS, and Lee SC Molecular cloning of a transcription factor, AGP/EBP, that belongs to members of the C/EBP family Mol Cell Biol. 10: 6642-6653, 1990. 62 . Poli V, Mancini FP, and Cortese R IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP Cell 63: 643-653, 11-2-1990. 63 . Roman C, Platero JS, Shuman J, and Calame K Ig/EBP-1: a ubiquitously expressed immunoglobulin enhancer binding protein that is similar to C/EBP and heterodimerizes with C/EBP Genes Dev. 4: 1404-1415, 1990. 64 . Cao Z, Umek RM, and McKnight SL Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells Genes Dev. 5: 1538-1552, 1991. 65 . Williams SC, Cantwell CA, and Johnson PF A family of C/EBP-related proteins capable of forming covalently linked leucine zipper dimers in vitro Genes Dev. 5: 1553-1567, 1991. 66 . Ron D and Habener JF CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription Genes Dev. 6: 439-453, 1992.

PAGE 153

142 67 . Ramji DP and Foka P CCAAT/enhancer-binding proteins: structure, function and regulation Biochem. J. 365: 561-575, 8-1-2002. 68 . Vinson C, Myakishev M, Acharya A, Mir AA, Moll JR, and Bonovich M Classification of human B-ZIP proteins based on dimerization properties Mol. Cell Biol. 22: 6321-6335, 2002. 69 . Newman JR and Keating AE Comprehensive identification of human bZIP interactions with coiled-coil arrays Science 300: 2097-2101, 6-27-2003. 70 . Vallejo M, Ron D, Miller CP, and Habener JF C/ATF, a member of the activating transcription factor family of DNA-binding proteins, dimerizes with CAAT/enhancer-binding proteins and directs their binding to cAMP response elements Proc. Natl. Acad. Sci. U. S. A 90: 4679-4683, 5-15-1993. 71 . Hsu W, Kerppola TK, Chen PL, Curran T, and Chen-Kiang S Fos and Jun repress transcription activation by NF-IL6 through association at the basic zipper region Mol. Cell Biol. 14: 268-276, 1994. 72 . LeClair KP, Blanar MA, and Sharp PA The p50 subunit of NF-kappa B associates with the NF-IL6 transcription factor Proc. Natl. Acad. Sci. U. S. A 89: 8145-8149, 9-1-1992. 73 . Lekstrom-Himes J and Xanthopoulos KG Biological role of the CCAAT/enhancer-binding protein family of transcription factors J. Biol. Chem. 273: 28545-28548, 10-30-1998. 74 . Johnson PF Identification of C/EBP basic region residues involved in DNA sequence recognition and half-site spacing preference Mol Cell Biol. 13: 6919-6930, 1993. 75 . Agre P, Johnson PF, and McKnight SL Cognate DNA binding specificity retained after leucine zipper exchange between GCN4 and C/EBP Science 246: 922-926, 11-17-1989. 76 . Osada S, Yamamoto H, Nishihara T, and Imagawa M DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family J. Biol. Chem. 271: 3891-3896, 2-16-1996.

PAGE 154

143 77 . Williams SC, Baer M, Dillner AJ, and Johnson PF CRP2 (C/EBP beta) contains a bipartite regulatory domain that controls transcriptional activation, DNA binding and cell specificity EMBO J. 14: 3170-3183, 7-3-1995. 78 . Nerlov C and Ziff EB Three levels of functional interaction determine the activity of CCAAT/enhancer binding protein-alpha on the serum albumin promoter Genes Dev. 8: 350-362, 2-1-1994. 79 . Williamson EA, Xu HN, Gombart AF, Verbeek W, Chumakov AM, Friedman AD, and Koeffler HP Identification of transcriptional activation and repression domains in human CCAAT/enhancer-binding protein epsilon J. Biol. Chem. 273: 14796-14804, 6-12-1998. 80 . Descombes P and Schibler U A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA Cell 67: 569-579, 11-1-1991. 81 . Ossipow V, Descombes P, and Schibler U CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with different transcription activation potentials Proc. Natl. Acad. Sci. U. S. A 90: 8219-8223, 9-1-1993. 82 . An MR, Hsieh CC, Reisner PD, Rabek JP, Scott SG, Kuninger DT, and Papaconstantinou J Evidence for posttranscriptional regulation of C/EBPalpha and C/EBPbeta isoform expression during the lipopolysaccharide-mediated acute-phase response Mol Cell Biol. 16: 2295-2306, 1996. 83 . Raught B, Gingras AC, James A, Medina D, Sonenberg N, and Rosen JM Expression of a translationally regulated, dominant-negative CCAAT/enhancer-binding protein beta isoform and up-regulation of the eukaryotic translation initiation factor 2alpha are correlated with neoplastic transformation of mammary epithelial cells Cancer Res. 56: 4382-4386, 10-1-1996. 84 . Kowenz-Leutz E and Leutz A A C/EBP beta isoform recruits the SWI/SNF complex to activate myeloid genes Mol Cell 4: 735-743, 1999. 85 . Liu S, Croniger C, Arizmendi C, Harada-Shiba M, Ren J, Poli V, Hanson RW, and Friedman JE Hypoglycemia and impaired hepatic glucose production in mice with a deletion of the C/EBPbeta gene J. Clin. Invest 103: 207-213, 1999.

PAGE 155

144 86 . Croniger CM, Millward C, Yang J, Kawai Y, Arinze IJ, Liu S, Harada-Shiba M, Chakravarty K, Friedman JE, Poli V, and Hanson RW Mice with a deletion in the gene for CCAAT/enhancer-binding protein beta have an attenuated response to cAMP and impaired carbohydrate metabolism J. Biol. Chem. 276: 629-638, 1-5-2001. 87 . Poli V The role of C/EBP isoforms in the control of inflammatory and native immunity functions J. Biol. Chem. 273: 29279-29282, 11-6-1998. 88 . Greenbaum LE, Li W, Cressman DE, Peng Y, Ciliberto G, Poli V, and Taub R CCAAT enhancer-binding protein is required for normal hepatocyte proliferation in mice after partial hepatectomy J. Clin. Invest 102: 996-1007, 9-1-1998. 89 . Buck M, Poli V, Hunter T, and Chojkier M C/EBPbeta phosphorylation by RSK creates a functional XEXD caspase inhibitory box critical for cell survival Mol Cell 8: 807-816, 2001. 90 . Buck M, Poli V, van der GP, Chojkier M, and Hunter T Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP beta is required for hepatocyte proliferation induced by TGF alpha Mol Cell 4: 1087-1092, 1999. 91 . Natsuka S, Akira S, Nishio Y, Hashimoto S, Sugita T, Isshiki H, and Kishimoto T Macrophage differentiation-specific expression of NF-IL6, a transcription factor for interleukin-6 Blood 79: 460-466, 1-15-1992. 92 . Robinson GW, Johnson PF, Hennighausen L, and Sterneck E The C/EBPbeta transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland Genes Dev. 12: 1907-1916, 6-15-1998. 93 . Sterneck E, Tessarollo L, and Johnson PF An essential role for C/EBPbeta in female reproduction Genes Dev. 11: 2153-2162, 9-1-1997. 94 . Roesler WJ The role of C/EBP in nutrient and hormonal regulation of gene expression Annu. Rev. Nutr. 21: 141-165, 2001. 95 . Marten NW, Burke EJ, Hayden JM, and Straus DS Effect of amino acid limitation on the expession of 19 genes in rat hepatoma cells FASEB J. 8: 538-544, 1994.

PAGE 156

145 96 . Bruhat A, Jousse C, Wang X-Z, Ron D, Ferrara M, and Fafournoux P Amino acid limitation induces expression of CHOP, a CCAAT/enhancer binding protein-related gene, at both transcriptional and post-transcriptional levels J. Biol. Chem. 272: 17588-17593, 1997. 97 . Fafournoux P, Bruhat A, and Jousse C Amino acid regulation of gene expression Biochem. J. 351: 1-12, 10-1-2000. 98 . Jousse C, Bruhat A, Harding HP, Ferrara M, Ron D, and Fafournoux P Amino acid limitation regulates CHOP expression through a specific pathway independent of the unfolded protein response FEBS Lett. 448: 211-216, 1999. 99 . Bruhat A, Jousse C, Carraro V, Reimold AM, Ferrara M, and Fafournoux P Amino acids control mammalian gene transcription: activating transcription factor 2 is essential for the amino acid responsiveness of the CHOP promoter Mol. Cell Biol. 20: 7192-7204, 2000. 100 . Bruhat A, Averous J, Carraro V, Zhong C, Reimold AM, Kilberg MS, and Fafournoux P Differences in the Molecular Mechanisms Involved in the Transcriptional Activation of the CHOP and Asparagine Synthetase Genes in Response to Amino Acid Deprivation or Activation of the Unfolded Protein Response J. Biol. Chem. 277: 48107-48114, 12-13-2002. 101 . Averous J, Bruhat A, Jousse C, Carraro V, Thiel G, and Fafournoux P Induction of CHOP Expression by Amino Acid Limitation Requires Both ATF4 Expression and ATF2 Phosphorylation J. Biol. Chem. 279: 5288-5297, 2-13-2004. 102 . Zhong C, Chen C, and Kilberg MS Characterization of the nutrient sensing response unit in the human asparagine synthetase promoter Biochem. J. 372: -, 3-10-2003. 103 . Foka P, Kousteni S, and Ramji DP Molecular characterization of the Xenopus CCAAT-enhancer binding protein beta gene promoter Biochem Biophys. Res. Commun. 285: 430-436, 7-13-2001. 104 . Niehof M, Manns MP, and Trautwein C CREB controls LAP/C/EBP beta transcription Mol Cell Biol. 17: 3600-3613, 1997. 105 . Niehof M, Streetz K, Rakemann T, Bischoff SC, Manns MP, Horn F, and Trautwein C Interleukin-6-induced tethering of STAT3 to the LAP/C/EBPbeta

PAGE 157

146 promoter suggests a new mechanism of transcriptional regulation by STAT3 J. Biol. Chem. 276: 9016-9027, 3-23-2001. 106 . Berrier A, Siu G, and Calame K Transcription of a minimal promoter from the NF-IL6 gene is regulated by CREB/ATF and SP1 proteins in U937 promonocytic cells J. Immunol. 161: 2267-2275, 9-1-1998. 107 . Zhang JW, Klemm DJ, Vinson C, and Lane MD Role of CREB in Transcriptional Regulation of CCAAT/Enhancer-binding Protein {beta} Gene during Adipogenesis J. Biol. Chem. 279: 4471-4478, 2-6-2004. 108 . Selden RF, Howie KB, Rowe ME, Goodman HM, and Moore DD Human growth hormone as a reporter gene in regulation studies employing transient gene expression. Mol. Cell Biol. 6: 3173-3179, 1986. 109 . Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. 2001. 110 . Palii SS, Chen H, and Kilberg MS Transcriptional control of the human sodium-coupled neutral amino acid transporter system A gene by amino acid availability is mediated by an intronic element J. Biol. Chem. 279: 3463-3471, 1-30-2004. 111 . Takiguchi M The C/EBP family of transcription factors in the liver and other organs Int. J. Exp. Pathol. 79: 369-391, 1998. 112 . Kilberg MS and Barbosa-Tessmann IP Genomic sequences necessary for transcriptional activation by amino acid deprivation of mammalian cells J. Nutr. 132: 1801-1804, 2002. 113 . Niehof M, Kubicka S, Zender L, Manns MP, and Trautwein C Autoregulation enables different pathways to control CCAAT/enhancer binding protein beta (C/EBP beta) transcription J. Mol. Biol. 309: 855-868, 6-15-2001. 114 . Pahl HL Signal transduction from the endoplasmic reticulum to the cell nucleus Physiol. Rev. 79: 683-701, 1999. 115 . Ma Y, Brewer JW, Diehl JA, and Hendershot LM Two distinct stress signaling pathways converge upon the CHOP promoter during the mammalian unfolded protein response J. Mol. Biol. 318: 1351-1365, 5-17-2002.

PAGE 158

147 116 . Patil C and Walter P Intracellular signaling from the endoplasmic reticulum to the nucleus: the unfolded protein response in yeast and mammals Curr. Opin. Cell Biol 13: 349-355, 2001. 117 . Kaufman RJ Orchestrating the unfolded protein response in health and disease J. Clin. Invest 110: 1389-1398, 2002. 118 . Harding HP, Calfon M, Urano F, Novoa I, and Ron D Transcriptional and translational control in the Mammalian unfolded protein response Annu. Rev. Cell Dev. Biol. 18: 575-599, 2002. 119 . Zinszner H, Kuroda M, Wang XZ, Batchvarova N, Lightfoot RT, Remotti H, Stevens JL, and Ron D CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum Gene. Devel. 12: 982-995, 1998. 120 . McCullough KD, Martindale JL, Klotz LO, Aw TY, and Holbrook NJ Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state Mol. Cell Biol. 21: 1249-1259, 2001. 121 . Fawcett TW, Eastman HB, Martindale JL, and Holbrook NJ Physical and functional association between GADD153 and CCAAT/enhancer-binding protein beta during cellular stress J. Biol. Chem. 271: 14285-14289, 6-14-1996. 122 . Ron D and Habener JF CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription Gene. Devel. 6: 439-453, 1992. 123 . Croniger C, Trus M, Lysek-Stupp K, Cohen H, Liu Y, Darlington GJ, Poli V, Hanson RW, and Reshef L Role of the isoforms of CCAAT/enhancer-binding protein in the initiation of phosphoenolpyruvate carboxykinase (GTP) gene transcription at birth J. Biol. Chem. 272: 26306-26312, 10-17-1997. 124 . Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, Sadri N, Yun C, Popko B, Paules R, Stojdl DF, Bell JC, Hettmann T, Leiden JM, and Ron D An integrated stress response regulates amino acid metabolism and resistance to oxidative stress Mol. Cell 11: 619-633, 2003. 125 . Pan Y-X, Chen H, Siu F, and Kilberg MS Amino acid deprivation and endoplasmic reticulum stress induce expression of multiple ATF3 mRNA species

PAGE 159

148 which, when overexpressed in HepG2 cells, modulate transcription by the human asparagine synthetase promoter J. Biol. Chem. 278: 38402-38412, 2003. 126 . Ponath PD, Fass D, Liou HC, Glimcher LH, and Strominger JL The regulatory gene, hXBP-1, and its target, HLA-DRA, utilize both common and distinct regulatory elements and protein complexes J. Biol. Chem. 268: 17074-17082, 8-15-1993. 127 . Nakajima T, Kinoshita S, Sasagawa T, Sasaki K, Naruto M, Kishimoto T, and Akira S Phosphorylation at threonine-235 by a ras-dependent mitogen-activated protein kinase cascade is essential for transcription factor NF-IL6 Proc. Natl. Acad. Sci. U. S. A 90: 2207-2211, 3-15-1993. 128 . Guo S, Cichy SB, He X, Yang Q, Ragland M, Ghosh AK, Johnson PF, and Unterman TG Insulin suppresses transactivation by CAAT/enhancer-binding proteins beta (C/EBPbeta). Signaling to p300/CREB-binding protein by protein kinase B disrupts interaction with the major activation domain of C/EBPbeta J. Biol. Chem. 276: 8516-8523, 3-16-2001. 129 . Trautwein C, van der GP, Karin M, Hunter T, and Chojkier M Protein kinase A and C site-specific phosphorylations of LAP (NF-IL6) modulate its binding affinity to DNA recognition elements J. Clin. Invest 93: 2554-2561, 1994. 130 . Metz R and Ziff E cAMP stimulates the C/EBP-related transcription factor rNFIL-6 to trans-locate to the nucleus and induce c-fos transcription Genes Dev. 5: 1754-1766, 1991. 131 . Xu M, Nie L, Kim SH, and Sun XH STAT5-induced Id-1 transcription involves recruitment of HDAC1 and deacetylation of C/EBPbeta EMBO J. 22: 893-904, 2-17-2003. 132 . Kim J, Cantwell CA, Johnson PF, Pfarr CM, and Williams SC Transcriptional activity of CCAAT/enhancer-binding proteins is controlled by a conserved inhibitory domain that is a target for sumoylation J. Biol. Chem. 277: 38037-38044, 10-11-2002. 133 . Lincoln AJ, Monczak Y, Williams SC, and Johnson PF Inhibition of CCAAT/enhancer-binding protein alpha and beta translation by upstream open reading frames J. Biol. Chem. 273: 9552-9560, 4-17-1998.

PAGE 160

149 134 . Calkhoven CF, Muller C, and Leutz A Translational control of C/EBPalpha and C/EBPbeta isoform expression Genes Dev. 14: 1920-1932, 8-1-2000.

PAGE 161

BIOGRAPHICAL SKETCH Chin Chen was born in Taipei, Taiwan, in 1972. In 1994, she received her undergraduate degree in technology in medical sciences from the Kaohsiung Medical University, Taiwan, where she first became interested in molecular biology. In 1995, she was admitted to the Master of Science program of the Department of Molecular Genetics and Microbiology, University of Florida, and came to the United States for the first time. She conducted Master’s research under the guidance of Dr. Gregory S. Schultz, Institute for Wound Research, University of Florida. She was awarded a Master of Science degree in 1998. It was in the Schultz laboratory that she strengthened her interest in molecular biology and medical research. To further prepare her for the career in science, she then applied for and was admitted to the Interdisciplinary Program of the College of Medicine, University of Florida, in 1998. In 1999 she joined Dr. Michael S. Kilberg’s laboratory for her doctoral research, where she was inspired by the many wonders of studying gene expression. She wishes to obtain her postdoctoral training in the field of gene regulation in the United States and to continue investigating how genes are regulated with relevance to medical conditions. 150