Citation
Revision of Passiflora Subgenus Decaloba Supersection Cieca (Passifloraceae)

Material Information

Title:
Revision of Passiflora Subgenus Decaloba Supersection Cieca (Passifloraceae)
Creator:
PORTER-UTLEY, KRISTEN E.
Copyright Date:
2008

Subjects

Subjects / Keywords:
Boxes ( jstor )
Calyx ( jstor )
Geometric lines ( jstor )
Leaves ( jstor )
Limen ( jstor )
Literary characters ( jstor )
Nectaries ( jstor )
Petioles ( jstor )
Species ( jstor )
Taxa ( jstor )
City of Key West ( local )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Kristen E. Porter-Utley. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
8/1/2004
Resource Identifier:
71211499 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

REVISION OF PASSIFLORA SUBGENUS DECALOBA SUPERSECTION CIECA (PASSIFLORACEAE) By KRISTEN E. PORTER-UTLEY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2003

PAGE 2

Copyright 2003 by Kristen E. Porter-Utley

PAGE 3

iii ACKNOWLEDGMENTS This study was supported by grants fr om the National Sc ience Foundataion (Doctoral Dissertation Improvement Grant , DEB-0104824), the American Society of Plant Taxonomists (Research Grant s for Graduate Students), the Passiflora Society International (Graduate Research Award), Sigma Xi (Grant-in-Aid of Research), and the Haitian Resource De velopment Foundation (Travel Award). Norris Williams also provided funds for DNA sequencing and allowed me unlimited access to his laboratory in the Un iversity of Florida Herbarium (FLAS) at the Florida Museum of Natural History . Mark Whitten spent countless hours in the DNA sequencing lab (FLAS) with me w here he patiently taught me various molecular techniques and generously provid ed advice, and for that I am eternally grateful. Pam Soltis also allowed me access to her laboratory and I greatly appreciate all of her help. Windy Zomlef er kindly donated her time to teach me techniques of botanical illustration and her ex pert advice is greatly appreciated. Tom Emmel generously allowed me to use his greenhouse so that I could cultivate the species in my study gr oup. Peter Jrgensen sent me digital photographs that he took of herbarium specimens at the Musum National d'Histoire Naturelle, Paris, France (P), t he Real Jardn Botnico, Madrid, Spain (MA), and the Universitt Gttingen, Gtt ingen, Germany (GOE T) that I would have otherwise not seen. Emil Kugler is a great historian of the Passifloraceae and kindly translated into English several old German publicati ons for me. Axel

PAGE 4

iv Frank also kindly donated his time to help me with several German to English translations and sent me digital copies of old paintings of several species of supersection Cieca . Special thanks are due to Hugh Popenoe who has been a source of encouragement and support throughout my graduate career. Alexandra Paul accompanied me on two collecting trips and spent several long days helping me search for species of Passiflora . In addition, her wonderful family kindly allowed me to stay in thei r home during our trip to Haiti. Tracy Commock and Mr. E. Scott of the Institut e of Jamaica were very knowledgeable and helpful during my field trip to Jama ica. George Proctor gave me advice on collecting localities and assisted me in findi ng several of the species in my study group while I was in Jamaica. Andrea Donaldson, of the Natural Resources Conservation Authority, assi sted me in obtaining collecti ng permits in Jamaica. I am especially grateful to German Carnevali for helping me with collecting permits and giving me collecting advice during my trip to Mxico. Demetria MondragnChaparro was my assistant and traveli ng companion during my field trip to Mxico and is a very dear friend. Her ecological knowledge and experience in traveling around Mxico made for a flawless trip. Demetria's family also opened up their hearts and homes to me while I wa s Mxico. I would also like to thank those who provided me with greenhouse plants and material for DNA extraction: Richard Abbott, Noel Atherton, Carolee Boyles, Ron Boender, Doug Goldman, David Hearn, Jean Jacques, Jutta Jedz ig, Elma Kay, John MacDougal, Mario Posla, Tim Skimina, John Vanderplank, and Max Weigend. I am particularly grateful to Norris Williams and Kent Perkins for providing space at the University

PAGE 5

v of Florida Herbarium, Florida Museum of Natural History, Gainesville, Florida, USA (FLAS) for my thousands of loaned he rbarium specimens. I would like to thank the following in stitutions for sending herbarium specimens or providing digital images of herbarium specimens: Arnold Arboretum, Harvard University, Cambridge, Massachusetts, USA (A); Univ ersity of Aarhus, Aarhus, Denmark (AAU); Botanischer Garten und Bot anisches Museum Berlin-Dahlem, Zentraleinrichtung der Freien Universitt Be rlin, Berlin, Germany (B); The Natural History Museum, London, England, UK (BM); University of Copenhagen, Copenhagen, Denmark (C); California Academy of Sciences, San Francisco, California, USA (CAS); Centro de Inve stigacin Cientfica de Yucatn, Mxico (CICY); University of Cambridge, Ca mbridge, England, UK (CGE); Museo Nacional de Costa Rica, San Jos, Co sta Rica (CR); Dudley Herbarium, San Francisco, California, USA (DS); Duke Un iversity, Durham, North Carolina, USA (DUKE); Economic Herbarium of Oakes Ames, Harvard University, Cambridge, Massachusetts, USA (ECON); Field Museum of Natural History, Chicago, Illinois, USA (F); Museo di Storia Naturale dell'Universit, Firenze, Italy (FI); Conservatoire et Jardin botaniques de la Ville de Genve, Genve, Switzerland (G); Gray Herbarium, Ha rvard University, Cambridge, Massachusetts, USA (GH); Universidad de Antioquia, An tioquia, Medelln, Colombia (HUA); Jardn Botnico Nacional Dr. Rafael M. Moscoso, Sant o Domingo, Dominican Republic (JBSD); Jepson Herbarium, University of Califor nia, Berkeley, California, USA (JEPS); Royal Botanic Garden, Kew, England, UK (K); Lundell Herbarium, University of Texas at Austin, Austin, Texas, USA (LL); Botanische Staatssammlung

PAGE 6

vi Mnchen, Mnchen, Germany (M); Real Ja rdn Botnico, Madrid, Spain (MA); Universidad Nacional Aut noma de Mxico, Mxico City , Distrito Federal, Mxico (MEXU); University of Minnesota, S t. Paul, Minnesota, USA (MIN); Missouri Botanical Garden, St. Louis, Miss ouri, USA (MO); Ludwig-MaximiliansUniversitt, Mnchen, Germany (MSB); United States Na tional Arboretum, USDA/ARS, Washington, District of Colu mbia, USA (NA); Tulane University, New Orleans, Louisiana, USA (NO); New York Botanical Garden, New York, New York, USA (NY); University of Oxford, Oxford , England, UK (OXF); Academy of Natural Sciences, Philadelphia, Pennsylva nia, USA (PH); National Museum in Prague, Praha, Czech Republic (PR); Un iversidade Federal do Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil (R ); Swedish Museum of Natural History, Stockholm, Sweden (S); Universidad Nacional Autnoma de Honduras, Tegucigalpa, Honduras (TEFH); University of Texas at Austin, Austin, Texas, USA (TEX); University of the West Indi es, Saint Augustine, Trinidad, Trinidad, and Tobago (TRIN); Nationaal Herbarium Nederland, Utre cht University Branch, Utrecht, Netherlands (U); University of Ca lifornia, Berkeley, California, USA (UC); Smithsonian Institution, Washington, Dis trict of Columbia, USA (US); Fundacin Instituto Botnico de Venezuela Dr. Tob as Lasser, Caracas, Venezuela (VEN); University of Wisconsin, Madison, Wisc onsin, USA (WIS); Instituto de Ecologa, Xalapa, Veracruz, Mxico (XAL). Special thanks are due, again, to all of my committee members, Walter Judd, John MacDougal, Hugh Popenoe, Pam Soltis, and Norris Williams. They have all been very supportive of my work and have kindly donated their time and

PAGE 7

vii resources to this project. Walter J udd has been a wonderful advisor throughout the course of this study. His door wa s always open and he constantly provided me with much needed support and encouragem ent. He is truly a wonderful teacher and I am very fortunate to have had such a great mentor during my dissertation work. I would especially like to express my gratitude to John MacDougal. John has played a critical role in this project from its inception. He introduced me to Passiflora , gave me free access to his abundant files pertaining to the Passifloraceae, constantly sent me information that has enhanced the quality of my work, spent countless hours on the telephone giving me advice, and he and his family provided me with a place to stay and support during visits to the Missouri Botanical Garden. I would like to thank my family for t heir love and support. My husband, Luke, has been a constant source of love, pat ience, and encouragement. My parents have continually believed in me and helped me in innumerable ways. My sister and her family have always been willing to open up their hearts and home to me. My brother, Bill, and John May have always been around whenever I needed reassurance. Jim and Dolores Ut ley have also given me a helping hand whenever they could. I am truly fo rtunate to have such a caring family.

PAGE 8

viii TABLE OF CONTENTS page ACKNOWLEDG MENTS .......................................................................................iii LIST OF T ABLES................................................................................................xii LIST OF FI GURES.............................................................................................xiv ABSTRACT ........................................................................................................xxi CHAPTER 1 INTRODUC TION..............................................................................................1 2 TAXONOMIC HISTOR Y...................................................................................5 3 MATERIALS AND METHODS........................................................................16 Morphological Da ta Set...................................................................................16 Molecular Data Set.........................................................................................23 Phylogenetic Search Strategi es......................................................................25 Species Conc epts...........................................................................................26 4 MOLECULAR AN ALYSES .............................................................................74 5 PHENETIC MORPHOL OGICAL ANAL YSES.................................................82 The Passiflora suberosa Complex..................................................................82 The Passiflora coriacea Comple x...................................................................98 6 CLADISTIC MORPHOLO GICAL ANAL YSES..............................................110 7 DISCUSSI ON...............................................................................................130 Separate or Combined Analyses: A Comparison of the Molecular and Morphological Clad istic Anal yses................................................................130 The Passiflora coriacea Complex.................................................................135 The Passiflora suberosa Complex................................................................137 Pollination Biology .........................................................................................143 Fruit Dispe rsal...............................................................................................147 Butterflie s......................................................................................................148

PAGE 9

ix Distribution and Ecology ...............................................................................154 Speciati on..................................................................................................... 158 Species Conc epts.........................................................................................162 Summary .......................................................................................................164 8 TAXONO MY.................................................................................................168 Description of Passiflora ...............................................................................168 Description of Passiflora Subgenus Decaloba Supersection Cieca ..............170 Key to the Species of Passiflora Supersection Cieca ...................................173 Passiflora pallida ...........................................................................................181 Description of Passiflora pallida ..............................................................181 Distribution and Ecology .........................................................................185 Vernacular Names..................................................................................186 Ethnobotany ............................................................................................186 Additional Specim ens Examin ed.............................................................186 Notes ......................................................................................................221 Passiflora suberosa ......................................................................................229 Description of Passiflora suberosa ..........................................................229 Distribution and Ecology .........................................................................233 Key to the Subspecies of Passiflora suberosa ........................................234 Description of Passiflora suberosa ssp. suberosa ..................................234 Distribution and ecology ...................................................................235 Vernacular names............................................................................ 236 Additional specim ens exami ned....................................................... 236 Notes................................................................................................248 Description of Passiflora suberosa ssp. litoralis ......................................253 Distribution and ecology ...................................................................257 Vernacular names............................................................................ 257 Additional specim ens exami ned....................................................... 257 Notes................................................................................................282 Passiflora tridactylites ...................................................................................287 Description of Passiflora tridactylites ......................................................287 Distribution and Ecology .........................................................................289 Additional Specim ens Examin ed.............................................................290 Notes ......................................................................................................291 Passiflora lancifolia .......................................................................................295 Description of Passiflora lancifolia ..........................................................295 Distribution and Ecology .........................................................................297 Vernacular Names..................................................................................297 Additional Specim ens Examin ed.............................................................297 Notes ......................................................................................................298 Passiflora macfadyenii ..................................................................................303 Description of Passiflora macfadyenii .....................................................303 Distribution and Ecology .........................................................................305 Vernacular Names..................................................................................306 Additional Specim ens Examin ed.............................................................306

PAGE 10

x Notes ......................................................................................................306 Passiflora tenuiloba .......................................................................................309 Description of Passiflora tenuiloba ..........................................................309 Distribution and Ecology .........................................................................312 Vernacular Names..................................................................................312 Additional Specim ens Examin ed.............................................................312 Notes ......................................................................................................318 Passiflora eglandulosa ..................................................................................321 Description of Passiflora eglandulosa .....................................................321 Distribution and Ecology .........................................................................323 Vernacular Names..................................................................................323 Additional Specim ens Examin ed.............................................................324 Notes ......................................................................................................325 Passiflora trinifolia .........................................................................................329 Description of Passiflora trinifolia ............................................................329 Distribution and Ecology .........................................................................331 Additional Specim ens Examin ed.............................................................332 Notes ......................................................................................................332 Passiflora clypeophylla .................................................................................333 Description of Passiflora clypeophylla .....................................................333 Distribution and Ecology .........................................................................335 Additional Specim ens Examin ed.............................................................335 Notes ......................................................................................................337 Passiflora obtusifolia .....................................................................................338 Description of Passiflora obtusifolia ........................................................338 Distribution and Ecology .........................................................................340 Vernacular Names..................................................................................341 Additional Specim ens Examin ed.............................................................341 Notes ......................................................................................................342 Passiflora juliana ...........................................................................................344 Description of Passiflora juliana ..............................................................344 Distribution and Ecology .........................................................................347 Additional Specim ens Examin ed.............................................................347 Notes ......................................................................................................348 Passiflora viridiflora .......................................................................................352 Description of Passiflora viridiflora ..........................................................352 Distribution and Ecology .........................................................................354 Vernacular Names..................................................................................355 Additional Specim ens Examin ed.............................................................355 Notes ......................................................................................................357 Passiflora mcvaughiana ................................................................................361 Description of Passiflora mcvaughiana ...................................................361 Distribution and Ecology .........................................................................363 Additional Specim ens Examin ed.............................................................363 Notes ......................................................................................................364 Passiflora tacana ..........................................................................................367

PAGE 11

xi Description of Passiflora tacana ..............................................................367 Distribution and Ecology .........................................................................369 Additional Specim en Exami ned..............................................................369 Notes ......................................................................................................369 Passiflora coriacea ........................................................................................372 Description of Passiflora coriacea ...........................................................372 Distribution and Ecology .........................................................................375 Vernacular Names..................................................................................376 Ethnobotany ............................................................................................376 Additional Specim ens Examin ed.............................................................376 Notes ......................................................................................................381 Passiflora megacoriacea ...............................................................................385 Description of Passiflora megacoriacea ..................................................385 Distribution and Ecology .........................................................................388 Vernacular Names..................................................................................388 Additional Specim ens Examin ed.............................................................388 Notes ......................................................................................................392 Passiflora sexocellata ...................................................................................395 Description of Passiflora sexocellata ......................................................395 Distribution and Ecology .........................................................................398 Vernacular Names..................................................................................399 Ethnobotany ............................................................................................399 Additional Specim ens Examin ed.............................................................399 Notes ......................................................................................................406 Passiflora itzensis .........................................................................................411 Description of Passiflora itzensis ............................................................411 Distribution and Ecology .........................................................................413 Vernacular Names..................................................................................414 Additional Specim ens Examin ed.............................................................414 Notes ......................................................................................................414 Passiflora xiikzodz ........................................................................................417 Description of Passiflora xiikzodz ............................................................417 Distribution and Ecology .........................................................................420 Vernacular Names..................................................................................420 Additional Specim ens Examin ed.............................................................420 Notes ......................................................................................................422 APPENDIX: CLADISTIC ANALYSIS OF GRANULE-BOUND STARCH SYNTHASE ( WAXY ) GENE SEQU ENCES ..............................................424 Introducti on...................................................................................................424 Materials and Methods ..................................................................................424 Results and Di scussion.................................................................................427 LIST OF REFE RENCES..................................................................................433 BIOGRAPHICAL SKETCH ...............................................................................444

PAGE 12

xii LIST OF TABLES Table page 5.1. Characters used in the morphol ogy-based principal components analysis of the Passiflora suberosa complex. ............................................................86 5.2. Component loadings for axes I, II, and III from a principal components analysis of the P. suberosa complex. ......................................................88 5.3. Component loadings for axes I, II, and III from a principal components analysis of the P. suberosa complex. ......................................................91 5.4. Characters used in the morphology -based neighbor joining analysis of the Passiflora suberosa complex...................................................................92 5.5. Character values used in the c onstruction of the neighbor joining tree for taxa in the P. suberosa complex . .............................................................95 5.6. Characters used in the morphol ogy-based principal components analysis of the Passiflora coriacea complex. ...........................................................100 5.7. Component loadings for axes I, II, and III from a principal components analysis of the P. coriacea complex. ......................................................102 5.8. Component loadings for axes I, II, and III from a principal components analysis of the P. coriacea complex. ......................................................105 5.9. Characters used in the morphology -based neighbor joining analysis of the Passiflora coriacea complex..................................................................106 5.10. Character values for taxa used in the phenetic analysis of the Passiflora coriacea complex . .................................................................................108 6.1. Characters used in the mo rphology-based cladistic analysis of Passiflora supersection Cieca ................................................................................122 6.2. Character values for taxa used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................................127 7.1. Reports of herbivory on species of Passiflora supersection Cieca by the Heliconiinae butterflie s (Nymphali dae)...................................................152

PAGE 13

xiii 7.2. Table indicating the type and amount of evidence for monophyly for the species of Passiflora supersection Cieca ...............................................163

PAGE 14

xiv LIST OF FIGURES Figure page 3.1. Outline of a leaf of P. megacoriacea demonstrating method of measurement ...........................................................................................17 3.2. Outline of a leaf of P. pallida demonstrating method of measurement.......18 3.3. Outline of a leaf of P. suberosa demonstrating method of measurement...18 3.4. View of flower of P. coriacea from the top demonstrating method of measurement ...........................................................................................19 3.5. View of the flower of P . coriacea from the bottom dem onstrating method of measurement ...........................................................................................20 3.6. View of a longitudinal section through the flower of P . coriacea demonstrating method of measurem ent..................................................21 3.7. Box plots of lateral lobe lengths evaluated for but not used in the Neighbor Joining analysis of the P. suberosa complex. ..........................................28 3.8. Box plots of character 19 (andr ogynophore length) used in the Neighbor Joining analysis of the P. suberosa complex. ..........................................29 3.9. Box plots of character 4 (hypanthium diameter) used in the Neighbor Joining analysis of the P. suberosa complex. ......................................................30 3.10. Box plots of character stem di ameters evaluated for but not used in the Neighbor Joining analysis of the P. coriacea complex.............................31 3.11. Box plots of characte r 8 (length of filaments in th e outer coronal row) used in the Neighbor Join ing analysis of the P. coriacea complex...................32 3.12. Box plots of character 7 (sepal width) used in the Neighbor Joining analysis of the Passiflora coriacea complex. ...........................................33 3.13. Box plots of distances of petiola r nectaries from petiole bases evaluated for the cladistic analysis of the Passiflora supersection Cieca .................34 3.14. Box plots of characte r 1 (pedicel length) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................35

PAGE 15

xv 3.15. Box plots of character 2 (stipe l ength) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................36 3.16. Box plots of character 3 (sti pe length/pedicel length) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........37 3.17. Box plots of charac ter 4 (hypanthium diameter) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................38 3.18. Box plots of character 5 (sepal le ngth) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................39 3.19. Box plots of character 6 (se pal length/sepal width) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........40 3.20. Box plots of charac ter 7 (number of filaments in the outer coronal row) used in the cladistic analysis of Passiflora supersection Cieca ................41 3.21. Box plots of characte r 8 (length of filaments in th e outer coronal row) used in the morphological cladistic analysis of Passiflora supersection Cieca .42 3.22. Box plots of characte r 9 (length of filaments in the outer coronal row/sepal length) used in the cladistic analysis of Passiflora supersection Cieca ....43 3.23. Box plots of charac ter 10 (number of filaments in the inner coronal row) used in the cladistic analysis of Passiflora supersection Cieca ................44 3.24. Box plots of charac ter 11 (length of filaments in the inner coronal row) used in the cladistic analysis of Passiflora supersection Cieca ................45 3.25. Box plots of charac ter 12 (length of the inner co ronal row/length of the outer coronal row) used in the cl adistic analysis of supersection Cieca ..46 3.26. Box plots of character 13 (sta minal filament length) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........47 3.27. Box plots of character 14 (ant her length) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................48 3.28. Box plots of character 15 (style l ength) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................49 3.29. Box plots of character 16 (ovary l ength) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................50 3.30. Box plots of character 17 (nec tary width) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................51

PAGE 16

xvi 3.31. Box plots of character 18 (androgynophore length) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........52 3.32. Box plots of character 19 (stami nal filament length/androgynophore length) used in the cladistic analysis of Passiflora supersection Cieca ................53 3.33. Box plots of char acter 20 (operculum length) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................54 3.34. Box plots of character 21 (nec tary height) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................55 3.35. Box plots of charac ter 22 (limen height) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................56 3.36. Box plots of charac ter 23 (limen floor diameter) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................57 3.37. Box plots of character 24 (fruit l ength) used in the mor phological cladistic analysis of Passiflora supersection Cieca ................................................58 3.38. Box plots of character 25 (fruit width) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................59 3.39. Box plots of character 26 (seed lengt h) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................60 3.40. Box plots of character 27 (seed wid th) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................61 3.41. Box plots of character 28 (seed length/seed width) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........62 3.42. Box plots of charac ter 29 (central vein length) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................63 3.43. Box plots of charac ter 30 (lateral vein length) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................64 3.44. Box plots of characte r 31 (lateral vein length/c entral vein length) used in the morphological cladistic analysis of Passiflora supersection Cieca .....65 3.45. Box plots of character 32 (centra l vein length/leaf width) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........66 3.46. Box plots of charac ter 33 (angle between pr imary lateral veins) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........67

PAGE 17

xvii 3.47. Box plots of character 34 (leaf lobe depth) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................68 3.48. Box plots of character 35 ( degree peltate) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................69 3.49. Box plots of character 36 (pos ition of petiolar nectary) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........70 3.50. Box plots of char acter 37 (number of laminar nectaries) used in the morphological cladistic analysis of Passiflora supersection Cieca ...........71 3.51. Box plots of character 38 (sti pule length) used in the morphological cladistic analysis of Passiflora supersection Cieca ..................................72 3.52. Box plots of character 39 (stipule wi dth) used in the morphological cladistic analysis of Passiflora supersection Cieca ................................................73 4.1. The first of three most parsimoni ous trees from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgroups ......................................77 4.2. The second of three most parsimoni ous trees from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgroups ................................78 4.3. The third of three most parsimonious trees from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgroups ................................79 4.4. Strict consensus of three most parsimonious tr ees from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgr oups........................80 4.5. Portion of the strict consensus tree from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgr oups..........................................81 5.1. Principal components analys is of the data set for the P. suberosa complex based on 51 morphological characters....................................................87 5.2. Principal components analys is of the data set for the P. suberosa complex based on 31 floral characters...................................................................90 5.3. Unrooted neighbor joining tree resulting from t he analysis of the morphological data from entities within the P. suberosa complex . ...........97 5.4. Principal components analys is of the data set for the P. coriacea complex based upon 44 morphological characte rs..............................................101 5.5. Principal components analys is of the data set for the P. coriacea complex based upon 27 floral characters .............................................................104

PAGE 18

xviii 5.6. Unrooted neighbor joining tree resulting from t he analysis of the morphological datafrom entities within the P. coriacea complex . ...........109 6.1. The single most parsimonious tree from the morphologic al data set of Passiflora supersection Cieca ................................................................128 6.2. The single most parsimonious tree from the morphologic al data set of Passiflora supersection Cieca ................................................................129 8.1. Flowers of several species of Passiflora supersect. Cieca .......................173 8.2. Passiflora pallida ( Porter-Utley & Mondragn 412 ) from the Yucatn Peninsula, M xico..................................................................................220 8.3. Distribution of Passiflora pallida ................................................................221 8.4. Passiflora pallida from Papua, Indonesia, illustrating the invasive potential of the species in t hat regi on....................................................................... 228 8.5. Flower of P. suberosa ssp. suberosa ( MacDougal 421 ) from the Virgin Islands. ..................................................................................................247 8.6. Flower and leaf of P. suberosa ssp. suberosa from St. Croix ( Porter-Utley 6 )...........................................................................................................247 8.7. Distribution of P. suberosa ssp. suberosa and P. suberosa ssp. litoralis ..248 8.8. Flowers of Passiflora suberosa ssp. litoralis .............................................285 8.9. Flower and leaf of Passiflora tridactylites ( van der Werff 1950 )................293 8.10. Dried flower and fruit of P. tridactylites ( van der Werff 1951 )..................294 8.11. Distribution of Passiflora tridactylites ......................................................294 8.12. Herbarium specimen of P. lancifolia ( Proctor 23725 ).............................302 8.13. Distribution of P. lancifolia and P. macfadyenii .......................................303 8.14. Leaves and flowers of P. macfadyenii ( MacDougal 452 )........................309 8.15. Flower and leaf of P. tenuiloba ( MacDougal 227 )...................................320 8.16. Distribution of P. tenuiloba. .....................................................................320 8.17. Flower of P. eglandulosa ( MacDougal 316 )............................................328 8.18. Distribution of P. clypeophylla , P. trinifolia , P. obtusifolia , and P. eglandulosa ...........................................................................................329

PAGE 19

xix 8.19. Flower of P. trinifolia ( MacDougal 637 )...................................................333 8.20. Habit of Passiflora clypeophylla (based upon Smith 1625 ).....................336 8.21. Flower of P. obtusifolia ( MacDougal 495 )...............................................344 8.22. Leaves and flowers of P. juliana ( MacDougal 492 ).................................350 8.23. Flower of P. juliana ( Porter-Utley & Mondragn 358 ).............................350 8.24. Distribution of P. mcvaughiana , P. juliana , and P. viridiflora ...................351 8.25. Flowers of P. viridiflora ( MacDougal 351 )...............................................359 8.26. Leaves and bright red stem of P. viridiflora ( Porter-Utley & Mondragn 362 )........................................................................................................360 8.27. Leaves, flower, and fruit of P. mcvaughiana ( Porter-Utley & Mondragn 345 )........................................................................................................366 8.28. Fruit and seeds of P. mcvaughiana ( Porter-Utley & Mondragn 345 )....367 8.29. Distribution of P. tacana , P. sexocellata , P. megacoriacea , and P. coriacea .............................................................................................370 8.30. Habit of P. tacana ( Martnez 20782 ).......................................................371 8.31. Flower of P. coriacea from Colomb ia...................................................... 384 8.32. Flower of P. coriacea from Colo mbia......................................................384 8.33. Passiflora megacoriacea from Costa Rica.............................................. 395 8.34. Leaf and flower of P. megacoriacea from Costa Rica............................. 395 8.35. Passiflora sexocellata from Veracruz, Mxico ( Porter-Utley & Mondragn 326 )........................................................................................................410 8.36. Flower of P. itzensis ( MacDougal 4633 ).................................................416 8.37. Distribution of P. itzensis and P. xiikzodz ...............................................417 8.38. Flower of P. xiikzodz ( MacDougal 4677 ).................................................423 A.1. Structure of portion of GBSSI gene in Passiflora coriacea .......................427 A.1. The first of 124 most parsimonious trees from the GBSSI data set of Passiflora supersection Cieca and outgr oups........................................ 431

PAGE 20

xx A.2. Strict consensus of 124 most par simonious trees from the GBSSI data set of Passiflora supersection Cieca and outgroups ....................................432

PAGE 21

xxi Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for t he Degree of Doctor of Philosophy REVISION OF PASSIFLORA SUBGENUS DECALOBA SUPERSECTION CIECA (PASSIFLORACEAE) By Kristen E. Porter-Utley December 2003 Chair: Walter S. Judd Department: Botany Passiflora subgenus Decaloba supersection Cieca is a monophyletic group of herbaceous to woody climbers found in subt ropical and tropical regions of the world. The 19 species, including two subspecies, recogniz ed here are primarily distributed in the southern United Stat es, Mxico, Central America, South America, and the Caribbean. Two species, P. suberosa and P. pallida , also occur in various regions of t he Old World, likely as a result of naturalization. The species of the supersection are recogni zed by their small, apetalous, usually greenish flowers with the filaments of t he corona mostly in two series. The supersection contains two probl ematic species complexes, P. suberosa and P. coriacea . Phylogenetic relationships within supersection Cieca are investigated by means of phenetic and cladistic analyses of morphological (external morphology) and molecular (nucleotide sequences of ITS-1, ITS-2 and the intervening 5.8S region) characters. The morphological and molecular data sets

PAGE 22

xxii were analyzed separately because of incongr uity due to taxon sampling and the complicated evolutionary hi story of entit ies within the P. suberosa complex. The morphological and molecular analyses pres ented here confirm the monophyly of the supersection. Molecular and morphol ogical phylogenetic analyses show that the P. suberosa complex is a non-monophyletic group of cryptic species, and inter-taxic hybridization and polyploidy have contributed to the confusing and complex pattern of variation evident wit hin the group. Four taxa that were formerly included in this complex are recognized here: P. pallida , P. suberosa ssp. suberosa , P. suberosa ssp. litoralis , and P. tridactylites . On the basis of molecular and morphological dat a, three species from the P. coriacea complex are recognized: P. coriacea , P. sexocellata , and P. megacoriacea . A key, detailed descriptions, distri bution maps, and illustrations are included in the revision. Pollination, dispersal, an d herbivory of the group are reviewed. Hummingbird pollination has evolved more than once in the supersection. The distribution and ecology of the specie s within the supersection are also discussed. Lastly, the utilization of only one species concept was found to be inadequate for the rapidly evolving specie s in this group. Thus, I integrated several concepts, i.e., phylogenetic (both diagnosable and apomorphic), phenetic, and biological, in delimit ing species within supersection Cieca.

PAGE 23

1 CHAPTER 1 INTRODUCTION Passiflora L. subgenus Decaloba (DC.) Rchb. supersection Cieca (Medic.) J. M. MacDougal & Feuillet is a mon ophyletic group of herbaceous to woody climbers found in subtropical and tropical r egions of the world from latitude 34N to latitude 34S. The 19 species recogni zed here are primarily distributed in the southern United States, Mxico, Centra l America, South America, and the Caribbean. Two species, P. suberosa L. and P. pallida L., also occur in various regions of the Old World, likely as a result of naturalization. Friedrich Medikus (Medikus, 1787) was t he first to recognize this group, and he proposed the generic name Cieca for the apetalous species of Passifloraceae. Since Medikus' time several monographers have also acknowledged the phenetic cohesiveness of these species and placed them (or most of them) in their ow n genus or section. Howeve r, the species with tubular, hummingbird-pollinated flowers were o ften excluded and other species of uncertain relationship included. John MacDougal, as part of his revision of Passiflora subgenus Decaloba section Pseudodysosmia (Passifloraceae), was the first to not only include the tubul ar-flowered species in supersection Cieca but also to transfer various vegetatively di vergent species out of the supersection (MacDougal, 1983). Supersection Cieca belongs within subgenus Decaloba on the basis of having flowers with the corona in a few series, a plicate operculum, secondary opercula

PAGE 24

2 on the pollen grains, and a base chromosome number of six. The species of the supersection are easily recognized by t heir small, apetalous, usually greenish flowers with the filaments of the corona mostly in two series. In addition, the plants commonly lack c-glycosylflavones but possess flavonol 3-0-glycosides. Several factors enhance the biological significance of Passiflora supersection Cieca . Of the four pollination syn dromes commonly reported for Passiflora , supersection Cieca exhibits three: melittophily (pollination by bees), sphecophily (pollination by wasps), and ornithophily (pollination by birds) (Gilbert, 1991; Koschnitzke & Sazima, 1997; Lindberg, 1998; MacDougal, 1992). The species of the supersection are also utilized as larv al hosts by both primitive and advanced genera of the subfam ily Heliconiinae ( Agraulis , Dione , Dryandula , Dryas , Euptoieta, Heliconius , and Philaethria ) (Benson et al., 1975; Spencer, 1988). Perhaps most importantly, four of the 19 species within this group are listed as endangered or threatened in the 1997 IUCN Red List of Threatened Plants ( http://www.unep-cmc.org/species/plants/redlist.htm ). One species, P . clypeophylla Mast., may be extinct and is repr esented by only a single herbarium specimen. The status of another species, P. macfadyenii C.D. Adams, is uncertain, because it has not been found in its native habitat in Jamaica since the inception of this project (1998). In addition, the mo rphology of supersection Cieca is very diverse and has provided nu merous phylogenetically informative characters. Supersection Cieca contains two problematic species complexes, P . suberosa and P . coriacea Juss. Ever since Linnaeus first described P. suberosa in his

PAGE 25

3 Species Plantarum , taxonomists have disagreed about the circumscription of this widespread species and, as a result, ov er 60 synonyms exist for it (Linnaeus, 1753; The Herbarium of the Royal Botani c Gardens, 1996). My analysis of the herbarium specimens of P . suberosa s.l. indicate that this variable species has served as a “taxonomic garbage can” for at least four entities ( P. pallida , P. suberosa L. ssp. suberosa , P. suberosa ssp. litoralis (Kunth) K. Porter-Utley, and P. tridactylites Hook. f.) that cannot be assigned to any of the other members of the supersection. Molecular and morphol ogical phylogenetic analyses show that the complex is a non-monophyletic group of cryptic species, a situation not unusual in plants (Rieseberg & Brouillet, 1994). Inter-taxic hybridization has contributed to the confusi ng and complex pattern of variation evident within this complex. Passiflora coriacea , as traditionally circumscribed, is another “species” that exhibits marked morphological variat ion over its distribution from eastern Mxico to northern South America, and evidence presented in this study indicates that it contains three distinct entities ( P. coriacea , P. megacoriacea K. Porter-Utley, and P. sexocellata Schltdl.). The most recent published revision of supersection Cieca was done by Killip in 1938 and is now very outdated because of its typological approach, nonphylogenetic perspective, and limited spec ies coverage. The primary goals of this study are to clarify spec ies limits within supersection Cieca , generate a hypothesis of phylogenetic relationships, and confirm its monophyly. A detailed revision of this rapidly evolving group, focusing on an analysis of DNA sequences (ITS-1, ITS-2 and the intervening 5.8S r egion) and morphological characters was

PAGE 26

4 undertaken. In this revision, the P. suberosa and P. coriacea species complexes were studied in detail and specific ent ities redefined based on morphological and molecular analyses (using phenetic and cladis tic methods). A key, descriptions, distribution maps, and illustr ations are included in this revision, along with cladistic analyses and a discussion of biogeography and ecology. Close attention was paid to pollination biology in order to attemp t to understand the forces that led to a sh ift from hymenopteran (e.g., P . juliana J. M. MacDougal) to hummingbird (e.g., P . viridiflora Cav.) pollination. Where possible, the hymenopteran pollinators and Heliconiinae herb ivores were identified (from the literature) in order to investigate the hypothesized coevolutionary relationship between the Heliconiinae and Passiflora .

PAGE 27

5 CHAPTER 2 TAXONOMIC HISTORY The genus Passiflora L. (Passifloraceae; tribe Passifloreae) is a large and diverse group of approximately 521 specie s of vines, lianas, and trees (Feuillet & MacDougal, 1999; Killip, 1938; Wilde, 1971) . The geographical distribution of Passiflora is primarily restricted to New World tropical, subtropical, and occasionally temperate areas, but approx imately 20 species are also found in Southeast Asia, Oceania, and Australia. Nineteen species are recognized in supersection Cieca , and of those, two are newly described in this revision. Traditi onally, the tubular-f lowered members of the group have been separated from those t hat possess dish-shaped flowers; the tubular-flowered species often have been placed in segregate sections and genera. The supersection, as recognized in this revision, was not understood as constituting a natural group until the work of MacDougal (MacDougal, 1983). The unique flowers of Passiflora , with their often brightly colored and unusual filamentous coronas, fascinated early expl orers and were among the first plants of the New World to be grown in the gardens of Europe (MacDougal, 1983). The first published record of a passionflower was by Pedro Cieza de Len in his Parte Primera de La Crnica del Per (Cieza de Len, 1553). He wrote of the fragrant and flavorful “granadillas” that grew along the banks of a river close to the village Lile, located near present-day Cali, Co lombia; the Spanish name “granadilla” means "little pomegranate" (Kugler , 1997; Cieza de Len, 1553).

PAGE 28

6 In 1554, Nicolas Monardes published a manuscript describing the medicinal plants of the West Indies (Monardes, 1574). In it he devoted a small section to the “granadilla.” The plant that he descr ibed was delivered to him from Peru and was used by both the Span ish and indigenous peoples there as a refreshing drink; it was also used medicinally as a cathartic. Furthermore, this was the first published account of the religious signifi cance of the passionflower, though the symbolism and fame of the plant were alre ady known in Europe by that time (Kugler, 1997; Morren, 1842). In 1610, an Augustinian friar named Emmanuel de Villegas arrived in Rome with drawings of a passionflo wer. He showed them to Giacomo Bosio, an Italian ecclesiastic and historian, who found the flower “stupendously marvelous.” Bosio then began to receive additional drawings and descriptions of the passionflower from Mexican Jesuits (Hoch, 1934; K ugler, 1997; Morren, 1842; Vanderplank, 2000). In 1609, Simon Parlasca, a Domini can at the University of Bologna, illustrated and described what Linnaeus later called Passiflora incarnata L., accompanied by religious poetry (cited in Hallman 1749, Hoch 1934, Linnaeus 1745, and MacDougal 1994). With the acquisiti on of these additional illustrations and accounts, Bosio decided that it was hi s obligation to present to the world the flos passionis as the most extraordinary exam ple of the passion of Christ discovered in forest or fi eld (Hoch, 1934). In his Della Trionfante e Gloriosa Croce (1610), Bosio described the flower as having white petals tinged with rose. The three stigmas exemplified the nails t hat were used to secure Christ’s feet and hands to the cross. The outer corona represented the crow n of thorns and

PAGE 29

7 the limen floor possessed five spots re sembling human blood, symbolizing the five wounds. The 72 inner coronal f ilaments were believed, according to tradition, to be the number of thorns that were found on Christ’s crown. The leaves were spear-shaped, representing the lance that pierced Christ’s side. Finally, the glands found on t he undersides of the leaf were thought to signify the thirty pieces of silver that were paid to Judas to betray Christ (Bosio, 1610; Hoch, 1934; Kugler, 1997; Morren, 1842; Vanderplan k, 2000). Since Bosio’s account, others have described differing religious sy mbolisms and allegories in the various parts of the passionflower, but many have disputed the superstitions. For example, Castelli wrote, “I do not see in the entire plant a cross nor indication of the passion of Christ, nor nailshaped styles, nor spear it is pure fiction. On this account and on torturing my spirit, I would see the passion in an infinity of flowers” (Castelli, 1625:56). For fu rther information about the legends surrounding the passionflower see Hoch (1934), Kugler (1997), and Vanderplank (2000). From 1570-1577 Francisco Hernndez, the pers onal physician of King Philip II of Spain, traveled in the Americas in s earch of new medicines. Hernndez spent his time in Mxico and enlisted native guides, artists, herbalists, and physicians to teach him about the materia medica , resulting in the earliest treatment of Mxico’s natural history. However, it was not until 1651 that his manuscript was published in Rerum medicarum Nov Hispani thesaurus seu plantarum animalium mineralium Mexicanorum historia . In it was the first description of a plant from supersection Cieca , Passiflora sexocellata Schltdl. Hernndez gave

PAGE 30

8 the Aztec name for it, Tzinacanatlapatli , followed by a brief description and illustration of the plant. He found that the Aztecs used t he juice of the leaves to treat eye problems (Hernndez, 1651). Charles Plumier (1693), in his Description des plantes de l'Amrique , described and illustrated four mo re “species” of supersection Cieca : Clematitis indica , folio hederaceo major , fructu olivae formi (= P. suberosa ), Clematitis indica , folio angusto , trifido , fructu olivae formi (= P. suberosa ), Clematitis indica alia , flore minore pallido (= P. pallida ), and Clematitis indica , flore minimo pallido (= P. pallida ). His descriptions and illustra tions of the members of the Passiflora suberosa complex are truly outstanding and indicate that he had an extensive knowledge of the variation of the group in the Caribbean. In the year 1719, Joseph Pitton de Tournefort created two genera of passionflowers: Granadilla and Murucuia . One species with fused coronal filaments was placed in the genus Murucuia (= P. murucuja L.). The remaining 23 species recognized by Tournefort, including the species of supersection Cieca described and illustrated by Plum ier, were placed in the genus Granadilla (Tournefort, 1719). Plumier and Tournefort, along with aut hors like Robert Morison and Leonard Plukenet, laid the foundation for the wo rk of Johann Gstaf Hallman, a graduate student at Uppsala University under the di rection of Carolus Linnaeus (Hallman, 1749; Linnaeus, 1745; Morison, 1680; Plukene t, 1691, 1696). In his dissertation, Hallman illustrated the leaves and describ ed 22 species of passionflowers with direct references to earlier synonyms, f our of which are memb ers of supersection

PAGE 31

9 Cieca : Passiflora foliis indivisis ovatis integerrimis , petiolis biglandulosis (= P. pallida ), Passiflora foliis trilobis peltatis (= P. suberosa ), Passiflora foliis trilobis villosis , floribus opposites (= P. pallida , but considered within P. hirsuta by Linnaeus), and Passiflora foliis trilobis integerrimis , lobis sublanceolatis: intermedio productiore (= P. pallida , but considered within P. minima by Linnaeus). He included information about t he history, nomenclature, distribution, superstitions, and medicinal and economic uses of the plants; he ended his dissertation with two poems. In Linnaeus’ (1753) Species Plantarum , all of the 22 species from Hallman’s dissert ation were placed in the genus Passiflora , along with two additional species. In 1782, Friedrich Kasimir Medikus began to publish essays treating the Passifloraceae (Medikus, 1782/1783,1784). In 1787, as a tribute to Pedro Cieza de Len, he created the genus Cieca for the apetalous members [ Cieca viridis (= P. minima ) and Cieca nigra (= P. suberosa )] of the group; he did not rename or treat P. pallida . He recognized Linnaeus’ genus Passiflora but also revived Tourneforte’s Granadilla and Murucuia (Medikus, 1787). The next published monograph was Decima dissertatio botanica de Passiflora (Cavanilles, 1790) in which a total of 43 species (all placed in the genus Passiflora ) were described; 32 of the species were illustrated. One new species of supersection Cieca [ P. peltata Cav. (= P. suberosa in this revision)] was included, in addition to the four descri bed by Linnaeus. In 1799, Cavanilles, in his Icones et Descriptiones Plantarum , described another species of supersection Cieca , the tubular-flowered P. viridiflora (Cavanilles, 1799).

PAGE 32

10 In 1805, Antoine Laurent de Jussieu formally described 13 new species of the genus, including Passiflora coriacea ; he also recognized the genera Murucuia and Tacsonia. Because of its tubular flow ers, he placed the apetalous P. viridiflora in the genus Tacsonia . In this treatment, Jussieu also discussed in great detail questions of generic delimitat ion and relationship, and he was the first to suggest that Passiflora , Murucuia , and Tacsonia should be placed together in their own family. However, Jussieu did not use a family name in the official sense (Jussieu, 1805a, 1805b). Henri Francois Anne de Roussel, in 1806, was the first to validly publish t he family Passifloraceae, with credit to Jussieu. Until recently, the first valid publication of the Passifloraceae was attributed to Carol Sigismund Kunth ( 1817); however, Roussel’s description of the family was pubished more than ten year s before Kunth’s. Incidentally, Kunth also published the species P. tubiflora but was probably unaware that Cavanilles had already named it P. viridiflora (Humboldt, Bonpland & Kunth, 1815-1825). In 1826, Kurt (Polycarp Joachim) Sprengel transferred P. viridiflora into the genus Murucuia (Sprengel, 1826). One year late r, William Hamilton, in his Prodromus Plantarum Indiae Occidentalis , described three new species of Passiflora. One of these, P. lancifolia Ham., is a red, apetalous, hummingbird-pollinated member of supersection Cieca from the Antilles (Hamilton, 1825). In 1828, Augustin Pyramus de Candolle subdivided Passiflora into eight sections based upon bract and calyx morphology: Astrophea , Polyanthea , Tetrapathaea , Cieca , Decaloba , Granadilla , Tacsonioides , and Dysosmia ; he thought that all members of the tribe Passifloreae lacked a corolla. He placed all

PAGE 33

11 of the species with dish-shaped flowers that were either ebracteate or possessed small bracts and a five-lobed calyx in section Cieca . However, he mistakenly placed individuals that we now know posse ss five petals and five sepals (a tenlobed calyx, according to de Candolle) in the section. He did not place P. lancifolia Ham. in a section because he felt t hat the species was not sufficiently known. Additionally, he placed Passiflora viridiflora in the section Psilanthus and accepted Jussieu’s placement of the species in the genus Tacsonia (Candolle, 1828). In the same year, Reic henbach (1828) raised section Decaloba DC. to the rank of subgenus. Additionally, he placed Passiflora viridiflora in the genus Synactila . Max Joseph Roemer (1846) published a monograph of the Passifloraceae and raised de Candolle’s sections to the rank of genera. Thus, most of the apetalous species discussed above were once again placed in their own genus, though Roemer repeated de Candolle's mistake and also placed petalous species in the genus Cieca . He placed P. lancifolia in the genus Decaloba and recognized Psilanthus viridiflora DC. (Roemer, 1846). Soon after the publication of Roemer’s monograph, Joseph Dalton Hooker supported de Candolle’s broad and more conservative concept of the genus in his treatment for Genera plantarum (Hooker, 1867). In the interim, a nother apetalous species belonging to supersection Cieca , P. tenuiloba Engelm., was described by Georg Engelmann in the Boston Journal of Natural History (Gray, 1850). In 1871, Maxwell Masters published a preliminary taxonomic paper on the Passifloraceae in the Transactions of the Linnaean Society that would be

PAGE 34

12 expanded upon in a comprehensive monogr aph of the family that appeared a year later in Carolus Martius’ Flora Brasiliensis (Masters, 1871, 1 872). In the 1871 publication, he validly esta blished four subgenera within Passiflora based upon various floral characteristics: Astrophea , Plectostemma (with sects. Cieca , Dysosmia , and Decaloba ), Murucuia (with sects. Eumurucuia and Psilanthus ), and Granadilla . Section Cieca consisted of the apetalous members of Passiflora that lacked bracts and possessed dish-s haped flowers; he also mistakenly placed some petalous species in the group. In addition, many of the species that previous authors recognized as distinct from P. suberosa were reduced to varieties (see discussions of P. pallida and P. suberosa for details). Masters also placed Passiflora lancifolia and Passiflora viridiflora in an unnamed section, along with other tubular-flowered species. In the 1872 monograph, he maintained section Cieca as described above, but he recognized not only varieties of P. suberosa but also subvarieties. In addition, Masters placed P. lancifolia and P. viridiflora (and the associated species from the 1871 paper) in section Psilanthus . Masters (1871) appeared to be unaware that Reichenbach (1828) had already elevated Decaloba to the rank of subgenus. In fact, until MacDougal (1983), all other workers who have recognized subgenera in Passiflora have overlooked this fact and in correctly used Masters’ subgenus Plectostemma (MacDougal, 1983). Triana and Planchon (1873), in their monograph of the Colo mbian Passifloraceae adopted Masters’ 1872 classification with one modifica tion. They reduced the genus Tacsonia to a subgenus within Passiflora . In 1887 and 1891, Masters described two additional

PAGE 35

13 species of supersection Cieca that are endemic to Guatemala, P. trinifolia Mast. and P. clypeophylla (Masters, 1887, 1891). In 1890, Martn de Sess and Jos Mariano Mocio, in their Plantae Novae Hispaniae , described P. obtusifolia Sess & Moc. (here placed in supersection Cieca ). There is also an illustration of the species in Icones Florae Mexicanae (McVaugh, 1977, 1980, 1982; Sess & Mocio, 1887-1890, 1894). However, no later author unt il Killip (1938) mentioned the plant. Harms, in his Die Natrlichen Pflanzenfamilien (1893, 1897, 1925), revised the generic and infrageneric classification of t he family. Harms, instead of dividing the genus Passiflora into subgenera, separated it in to 21 sections; the sections were often divided into subs ections or series. He also recognized the New World genera Dilkea , Mitostemma , and Tetrastylis . He defined the members of section Cieca as possessing small, whitish or greenish, bowl-shaped flowers without petals. He mistakenly thought that P. inamoena A. Gray (= P. bryonioides HBK) lacked petals and therefore included it in section Cieca . He placed the apetalous P. gracilis J.F. Jacq. ex Link in the se ction. However, MacDougal (1994) determined (based upon morphologi cal evidence) that it is more closely related to species in supersection Bryonioides (Harms) Feuillet & MacDougal than to members of supersection Cieca . Harms did not indicate where P. lancifolia belonged, but he placed P. viridiflora by itself in section Chloropathanthus (Harms, 1893, 1897, 1925). In 1938, Ellsworth P. Killip publis hed a revision of the American Passifloraceae. Killip’s revision, by his own admission, closely approximated that

PAGE 36

14 of Harms. The most important differences were the raising of Harms’ sections to subgenera and the regrouping of the species placed by Harms in sections Decaloba and Cieca . Killip defined section Cieca as those members of subgenus Plectostemma (= subgenus Decaloba ) that possess petiolar glands, reticulate seed coats, and bracts that are scattered along the peduncle and more than 1mm long; he considered the lack of br acts in many of the species of the section to be the result of deciduousness. He placed in the group the apetalous species of Cieca Medic., the “Bryonioideae” of Harms, and several other species of uncertain relationship. However, in comparison with other genera in the Passifloraceae, the character states t hat he used to define the section are plesiomorphic, and the members of his section Cieca are now considered an artificial assemblage (MacD ougal, 1994). He placed P. viridiflora and P. lancifolia in subgenus Chloropathanthus , based upon the lack of a plicate operculum, even though all of the other char acters that he used to define this subgenus are the same as those t hat he used to designate section Cieca . In 1967, another tubular-flower ed species of supersection Cieca was described, P. macfadyenii , a Jamaican endemic (Proctor, 1967). From 1989 until 2001, John M. MacDougal described four additional species in supersection Cieca : P. eglandulosa , P. juliana , P. xiikzodz , and P. mcvaughiana (MacDougal, 1988, 1992, 2001). In each case, he pr ovided detailed descriptions and illustrations with thorough explanations regarding their taxonomic placement. The most recent revision of the genus Passiflora , A new infrageneric classification of Passiflora , was presented by C. Feuillet and J. M. MacDougal at

PAGE 37

15 the International Botanical Congress in August of 1999 (Feuillet & MacDougal, 1999). Feuillet and MacDougal proposed that only four subgenera are sufficient to reflect the phylogene tic relationships within Passiflora : Astrophea , Deidamioides , Decaloba , and Passiflora . These subgenera are further separated into supersections, sections, and series. They recognize Medikus’ Cieca as a supersection, all the species having sm all, apetalous flowers with the corona mostly in two series. In addition, the plants commonly lack c-glycosylflavones but possess flavonol 3-0-glycosides.

PAGE 38

16 CHAPTER 3 MATERIALS AND METHODS Morphological Data Set The morphological investigation of supersection Cieca is based upon the careful study of over 4,200 dried specim ens from 44 herbaria, supplemented with observations from plants preserved in ethy l alcohol and living plants in the field and greenhouse. Of the 19 species in the supersection, 13 (all except P. clypeophylla , P. eglandulosa , P. macfadyenii , P. trinifolia , P. megacoriacea , and P. tridactylites ) were collected during field work in Jamaica, Haiti, and Mxico, or donated to the Passiflora greenhouse collection at the University of Florida; several correspondents and colleagues cont ributed living material during the course of this study. Voucher s are deposited at CICY and FLAS. An average of 330 macr omorphological characters were measured or observed on each of 95 plant specimens . All of the herbarium specimens representing supersection Cieca were carefully observed, and those spanning the morphological variation and geographica l range of each species were chosen for measurement. Depending upon the ma terial available, up to five measurements were taken for each quantit ative character on each specimen. Characters were measured or scored from corresponding positions on mature, reproductive plants from throughout the geographical range of the supersection in order to minimize error due to deve lopmental differences . Measurements of the dried leaves of the species in supersection Cieca were taken according to the

PAGE 39

17 conventions in Fig. 3.1-3.3. The flow ers were measured in accordance with the standards in Fig. 3.4-3.6. Dried flowers from herbarium specimens were rehydrated by placing them in warm wa ter with a wetting agent (Aerosol OT) or immersing them in concentrated ammoni a (Toscano de Brito, 1996; Taylor, 1975). Color names used in this treatm ent follow the Munsell Color System (Long & Luke, 2001). All draw ings of flowers were m ade either from material fixed in standard FAA [70% et hyl alcohol (90%), glacia l acetic acid (5%) and formalin (5%)] and preserved in 70% ethy l alcohol or from herbarium material that was expanded and softened. Figure 3.1. Outli ne of a leaf of P. megacoriacea demonstrating method of measurement. a. Distance fr om petiolar base to nectary. b. Length of petiole. c. Degree peltate (distance from point of petiolar insert ion to leaf base). d. Length of central vein. c+d = leaf length. e. Length of lateral ve in. f. Width of leaf. g. Angle between primary lateral veins.

PAGE 40

18 Figure 3.2. Outli ne of a leaf of P. pallida demonstrating method of measurement. a. Distance from petiolar base to nectary. b. Length of petiol e. c. Length of central vein/length of lea f. d. Width of leaf. Figure 3.3. Outli ne of a leaf of P. suberosa demonstrating method of measurement. a. Distance fr om petiolar base to nectary. b. Length of petiole. c. Length of central vein/l eaf length. d. Length of lateral vein. e. Distance from outline of leaf to margin of sinus. f. Distance from outline of leaf to leaf base measured across deepest part of sinus. g. Angle between primary lateral veins. h. Width of leaf.

PAGE 41

19 Figure 3.4. View of flower of Passiflora coriacea from the top demonstrating method of measurement. a. Length of outer coronal filam ent. b. Width of outer coronal filament. c. Length of inner coronal filament. d. Width of inner coronal filament. e. Nectary diam eter. f. Length of staminal filamen t. g. Width of staminal filament. h. Length of anther. i. Width of anther. j. Length of style. k. Width of style. l. Length of stigma. m. Width of stigma.

PAGE 42

20 Figure 3.5. Shown to the left is a view of the flower of P . coriacea from the bottom demonstrating method of measuremen t. Shown to the right is a flower stipe and pedicel of P. coriacea demonstrating method of measurement. a. Width of hypanthium. b. Length of sepal. c. Width of sepal. d. Length of pedicel. e. Width of pedicel. f. Length of stipe. g. Width of stipe. h. Length of bract. i. Width of bract.

PAGE 43

21 Figure 3.6. View of a longitudi nal section through the flower of P . coriacea demonstrating method of measurement. a. Length of andr ogynophore. b. Width of androgynophore. c. Width of limen fl oor. d. Height of limen. e. Width of limen. f. Height of nectary . g. Length of ovary. h. Width of ovary. Note that the operculum is straightened and (s haded) measured from base to tip. Seventy quantitative charac ters were initially ev aluated for the Neighbor Joining analysis of the P. suberosa complex, but 25 were discarded due to lack of variability or lack of non-ambiguous gaps in the pattern of variation, making state delimitations difficult (see for exam ple Fig. 3.7). Of t he 45 remaining, six show no overlap in the range of variation of their states (see for example Fig. 3.8). The remaining 39 quantitative char acters were utilized even though they exhibit some arbitrariness in state de limitation (see for ex ample Fig. 3.9). Seventy quantitative charac ters were initially ev aluated for the Neighbor Joining analysis of the P. coriacea complex, but 37 were discarded due to lack of variability or lack of gaps in the pattern of variation, making state delimitations

PAGE 44

22 difficult (see for example Fig. 3.10). Of the 33 remaini ng, 17 show no overlap in the range of variation of their states (see for example Fig. 3.11 ). The remaining 16 quantitative characters were utilized ev en though they exhibit some overlap between delimited states (see for example Fig. 3.12). Seventy quantitative charac ters were initially eval uated for the cladistic analysis of the supersection, but 31 were discarded due to lack of variability or problems in delimiting character states (see for example Fig. 3. 13). Of the 39 remaining, only one shows no overlap in the range of variation of its states (Fig. 3.52). The remaining 38 quantitative char acters were utilized even though they exhibit some overlap in the range of va riation assigned to different character states between taxa (Figs. 3.14-3.51). In all species descriptions (Chap. 8), the flower diameters were mathematically determined: 2(sepal length) + hypanthium diameter. Distribution maps were produced in Ar cView GIS Version 3.2 (Environmental Systems Research Institute, Inc., Redlands, California , USA). Label data from herbarium specimens were used to det ermine the latitudes and longitudes employed in the construction of distribut ion maps. The gazetteer consulted for localities in the United States was the Geographic Names Information System (GNIS), developed by the U.S. Geological Survey (USGS) in cooperation with the U.S. Board on Geographi c Names (US BGN) ( http://geonames.usgs.gov/ ). For international localities, the primary gazetteer consulted was the Geographic Names Database ( http://gnpswww.nima.mil/geonames/GNS/index.jsp ). The Geographic Names Database is on the GEOnet Names Server (GNS), the official

PAGE 45

23 repository of foreign place-name decisions approved by the United States Board on Geographic Names (US BGN). A secondary source for international localities was the Worldwide Direct ory of Cities and Towns ( http://www.calle.com/world ). The coordinate system for data served by the GNIS, GNS and the Worldwide Directory of Cities and Towns is WGS84. Principal components analyses (PCA) we re produced using the computer program Multi-Variate St atistical Package (MVSP) 3.13d (Kovach Computing Services, Anglesey, Wales, UK). A ll measured quantitative characters for specimens in the P. suberosa and P. coriacea complexes were used in the analyses. Only those characters and specimens for which there was an abundance of missing data were deleted from the analyses. The mean values of measurements were used for each specim en. Box plots were produced using the computer program SPSS for Windows Release 11.5 (SPSS, Inc., Chicago, Illinois, USA). Neighbor joining trees were produced in PAUP* Version 4.0b10 for Macintosh (Sinaeur, Sunderland, Ma ssachusetts, USA). Morphological characters were also analyzed cladisti cally, and cladistic methods are discussed under the heading "Phylogenetic Search Strategies.” Molecular Data Set Total genomic DNA was extracted from fresh, heat dried, or silica dried leaves or flowers utilizing the CTAB method of Doyle and Doyle, scaled down to 1.0 ml extraction volumes (Doyle & Doyle, 1987). DNA was precipitated for approximately one to eight hours at -20 C with 0.65 volume of isopropanol, centrifuged, washed twice with 70% ethy l alcohol, and dried. The pellet was resuspended in 75l of Tris-EDTA buffer and stored at -20C.

PAGE 46

24 Amplification of the internal transcr ibed spacer (ITS) region of 18S-26S nuclear ribosomal DNA (nrDNA) was per formed using 50 l reactions, 2.5 mmol/L MgCl2, 1.0 mol/L betaine, and a hot st art at 94C for between 3 minutes, using Epicentre (Epicentre Technologies, Madison, Wisconsin, USA) buffers and Taq polymerase. For material extrac ted from herbarium specimens, the above amplification pr otocol was modified by using 3.0 mmol/L MgCl2, no betaine, and a hot start at 99C for 30 seconds. A touchdown thermal cycling program was used for fresh and silica-dried samples. An initial denaturation at 94C for three minutes was followed by an initial annealing tem perature of 76C (decreasing 1C per cycle for 17 cycles to 59C), extension at 72C for one minute and denaturation at 94C for one minute. This was followed by 22 cycles of annealing at 59C for one minute, extension at 72C for one minute, denaturation at 94 C for one minute and a final extension at 72C for four minutes. Amplification and sequencing primer s were those of Sun et al. (1994). For the herbarium material, an initial den aturation at 94C for two minutes was followed by ten cycles of annealing at 55 C for 30 seconds, extension at 72C for 30 seconds and denaturation at 94C for 20 seconds. This was followed by 33 cycles of annealing at 55C, extension at 72C for one minut e, denaturation at 94C for 20 seconds and a final extension at 72C for seven minutes. Amplification and sequencing primers were those of Blattner (1999). PCR products were cleaned using QIAquick columns (Qiagen, Santa Clarita, California, USA) and underwent dye te rminator cycle sequencing with Applied Biosystems Inc. (ABI) (Foster City, Calif ornia, USA) reagents (5L reactions).

PAGE 47

25 The ITS region for members of supersection Cieca was sequenced directly from the cleaned amplified product in the DNA Sequencing Core Facility on the University of Florida campus (DSEQ, UF) with ABI 377 and ABI 373A automated sequencers. Sequences were edited and assembled using the ABI software packages Sequence Navigator Version 1.0.1 and Auto Assembler Version 1.3.0 on an Apple PowerMac computer and a ligned visually. Gaps were coded as missing values. Selected cleaned PCR products were cloned into TOPO-TA Cloning (Invitrogen, Carlsbad, California, USA) vectors according to the manufacturer’s instructions, except that the ligation reactions were halved. Transformation reactions were incubated in SOC broth (2.0% tryptone, 0.5% yeast extract, 10mM NaCl, 2.5mM KCl, 10mM MgCl2-6H2O, 20mM glucose) at 37C for one hour before being spread onto plates containing S-Gal/LB Agar/Kanamycin Blend (Sigma, St. Louis, Missouri, U SA) and incubated at 37C for 8 hours. Only large white colonies, representing potentially recombinant plasmids, were selected for amplific ation and sequencing. Phylogenetic Search Strategies Two matrices were analyzed cladistically for this study: morphology (32 taxa including outgroups) and ITS sequence data (71 taxa including outgroups). The morphological character states were carefully delimited (see discussion under “Morphological Data Set”). Many charac ters are qualitative, and discrete states were delimited within quantit ative characters by assessment of gaps in the pattern of variation (Stevens, 1991). Mult istate characters were considered to be unordered and ingroup/outgroup relationships were analyzed simultaneously.

PAGE 48

26 Outgroups from the subgenera Decaloba (supersections Auriculata , Bryonioides Decaloba , Hahniopathanthus , Multiflora , and Pterosperma ) and Deidamiodes (section Tryphostemmatoides ) were selected based on studies by two Passiflora specialists, C. Feuillet and J. M. MacDougal (Feuillet & MacDougal, 1999); no modern cladistic analyses of the family or genus have been published. Cladistic analyses were performed using PAUP* Vers ion 4.0b10 for Macintosh (Sinauer, Sunderland, Massachusetts, USA) with all but one character equally weighted. In the morphological analysis, the absenc e of petals was given a weight of two merely to enforce the monophyly of the ingroup taxa, as is strongly supported by my DNA-based analysis. The morphological and molecular data sets were analyzed using the heuristic search option (MULTREES, SPR, 1000 random replicates, holding five trees per rep licate, using the delayed transformation optimization). Trees were evaluated on the basis of tr ee length, consistency index (CI), and retention index (RI) as calculated by PAUP*. Bootstrap consensus trees were generated for all data sets ( 1000 replicates). Congruen ce of the separate data sets was assessed by comparison of t he tree statistics and topologies of the strict consensus trees. Species Concepts The phylogenetic species concept sensu Wheeler and Platnick was primarily employed in this study (Wheeler & Plat nick, 2000:58). The definition is as follows: “. . . the sma llest aggregation of (sexual) populations or (asexual) lineages diagnosable by a unique combination of c haracter states.” The biological (Mayr, 1942), phenetic (Sokal & Crovello, 1970), and autapomorphic

PAGE 49

27 (Donoghue, 1985; Mishler, 1985) species co ncepts were also considered, and frequently proved useful. Species circum scription was particularly important in this study, as entities within two problem atic species complexes needed to be carefully delimited.

PAGE 50

28 Figure 3.7. Box plots of lateral lobe l engths evaluated for but not used in the mor phological Neighbor Joining analysis of the Passiflora suberosa complex. Red box = interquartile range; T-shaped line = range; internal line = median; species names are abbreviated.

PAGE 51

29 Figure 3.8. Box plots of character 19 ( androgynophore length) used in the morphological Neighbor Joining analysis of the Passiflora suberosa complex. Red box = interquartile range; internal line = median; horiz ontal lines extending the width of the graph = values used for the delimitat ion of the character into states; ita licized numbers along y-axis = assigned character states; species names are abbreviated.

PAGE 52

30 Figure 3.9. Box plots of character 4 (h ypanthium diameter) used in the morpholog ical Neighbor Joining analysis of the Passiflora suberosa complex. Red box = interquartile range; internal line = median; horiz ontal lines extending the width of the graph = values used for the delimitat ion of the character into states; ita licized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indi cated by an asterisk.

PAGE 53

31 Figure 3.10. Box plots of character st em diameters evaluated for but not used in the morphological Neighbor Joining analysis of the Passiflora coriacea complex. Red box = interquartile range; T-s haped line = range; in ternal line = median; species names are abbreviated.

PAGE 54

32 Figure 3.11. Box plots of character 8 (l ength of filaments in the outer coronal row) used in the morphological Neighbor Joining analysis of the Passiflora coriacea complex. Red box = interquartile range; T-shaped line = range; internal line = median; horizontal lines extendi ng the width of the graph = values used for t he delimitation of the ch aracter into states; italicized numbers along y-axis = assigned charac ter states; species names are abbreviated.

PAGE 55

33 Figure 3.12. Box plots of character 7 (sepal width) used in the morpholog ical Neighbor Joining analysis of the Passiflora coriacea complex. Red box = interquartile r ange; T-shaped line = range; internal line = median; horizontal line extending the width of the graph = value used for t he delimitation of the character into st ates; italicized numbers along y-axis = assigned character states; species names are abbreviated.

PAGE 56

34 Figure 3.13. Box plots of distances of petiolar nectaries from petiole bases evaluated for but not used in the morphological cladistic analysis of the Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median.

PAGE 57

35 Figure 3.14. Box plots of charac ter 1 (pedicel length) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 58

36 Figure 3.15. Box plots of charac ter 2 (stipe length) used in the mo rphological cladist ic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; hori zontal lines extending the width of the graph = values used for the delimitat ion of the character into states; ita licized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indi cated by an asterisk.

PAGE 59

37 Figure 3.16. Box plots of character 3 (stipe length/pedicel length) used in t he morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal lines extending the width of t he graph = values used for the delimitation of t he character into states; italicized numbers along y-axis = assigned character stat es; species names are abbreviated.

PAGE 60

38 Figure 3.17. Box plots of character 4 (hypanthium diameter) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 61

39 Figure 3.18. Box plots of characte r 5 (sepal length) used in the mo rphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; hori zontal lines extending the width of the graph = values used for the delimitat ion of the character into states; ita licized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indi cated by an asterisk.

PAGE 62

40 Figure 3.19. Box plots of character 6 (sepal length/sepal width) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 63

41 Figure 3.20. Box plots of character 7 (num ber of filaments in the outer coronal ro w) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shape d line = range; internal line = median; horizontal lines extending the width of the graph = values used for the delimit ation of the character into states; italicized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 64

42 Figure 3.21. Box plots of character 8 (l ength of filaments in the outer coronal row) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shape d line = range; internal line = median; horizontal lines extending the width of the graph = values used for the delimit ation of the character into states; italicized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 65

43 Figure 3.22. Box plots of character 9 (le ngth of filaments in the outer coronal row/sepal length) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; Tshaped line = range; internal line = median; horizontal lines extendi ng the width of the graph = values used for t he delimitation of the ch aracter into states; italicized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 66

44 Figure 3.23. Box plots of character 10 (num ber of filaments in the inner coronal ro w) used in the mor phological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shape d line = range; internal line = median; horizontal lines extending the width of the graph = values used for the delimit ation of the character into states; italicized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 67

45 Figure 3.24. Box plots of character 11 (l ength of filaments in the inner coronal ro w) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shape d line = range; internal line = median; horizontal lines extending the width of the graph = values used for the delimit ation of the character into states; italicized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 68

46 Figure 3.25. Box plots of character 12 (lengt h of filaments in the inner coronal row/length of fila ments in the outer coronal row) used in the morphologic al cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; Tshaped line = range; internal line = median; horizontal lines extendi ng the width of the graph = values used for the delimitation of the character into stat es; italicized numbers along y-axis = assi gned character states; species names are abbreviated; taxa scored as polym orphic indicated by an asterisk.

PAGE 69

47 Figure 3.26. Box plots of character 13 (staminal filament length) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 70

48 Figure 3.27. Box plots of charac ter 14 (anther length) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal line extending the width of the graph = value us ed for the delimitation of the character into states; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 71

49 Figure 3.28. Box plots of characte r 15 (style length) used in the mor phological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviated.

PAGE 72

50 Figure 3.29. Box plots of character 16 (ovary lengt h) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal line extending the width of the graph = value us ed for the delimitation of the character into states; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 73

51 Figure 3.30. Box plots of charac ter 17 (nectary width) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 74

52 Figure 3.31. Box plots of characte r 18 (androgynophore length) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviated.

PAGE 75

53 Figure 3.32. Box plots of character 19 (staminal filame nt length/androgynophore length) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; Tshaped line = range; internal line = median; horizontal lines extendi ng the width of the graph = values used for t he delimitation of the ch aracter into states; italicized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 76

54 Figure 3.33. Box plots of character 20 (operculum l ength) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 77

55 Figure 3.34. Box plots of character 21 (nectary hei ght) used in the morphologic al cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 78

56 Figure 3.35. Box plots of charac ter 22 (limen height) used in the mo rphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 79

57 Figure 3.36. Box plots of character 23 (limen floor diameter) used in the morphological cladi stic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 80

58 Figure 3.37. Box plots of character 24 (fruit lengt h) used in the morphologic al cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; hori zontal lines extending the width of the graph = values used for the delimitat ion of the character into states; ita licized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indi cated by an asterisk.

PAGE 81

59 Figure 3.38. Box plots of characte r 25 (fruit width) used in the mo rphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; hori zontal lines extending the width of the graph = values used for the delimitat ion of the character into states; ita licized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indi cated by an asterisk.

PAGE 82

60 Figure 3.39. Box plots of charac ter 26 (seed length) used in the mor phological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 83

61 Figure 3.40. Box plots of character 27 (seed width) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; hori zontal lines extending the width of the graph = values used for the delimitat ion of the character into states; ita licized numbers along y-axis = assigned character states; species names are abbreviated; taxa scored as polymorphic indi cated by an asterisk.

PAGE 84

62 Figure 3.41. Box plots of characte r 28 (seed length/seed width) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 85

63 Figure 3.42. Box plots of characte r 29 (central vein length) used in t he morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 86

64 Figure 3.43. Box plots of character 30 (lateral vein length) used in t he morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 87

65 Figure 3.44. Box plots of character 31 (l ateral vein length/central vein length) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal lines extending the width of t he graph = values used for the delimitation of t he character into states; italicized numbers along y-axis = assigned character states; species names are abbr eviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 88

66 Figure 3.45. Box plots of character 32 (central vein length/leaf width) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal lines extending the width of t he graph = values used for the delimitation of t he character into states; italicized numbers along y-axis = assigned character states; species names are abbr eviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 89

67 Figure 3.46. Box plots of character 33 (angle between primary lateral veins) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal lines extending the width of t he graph = values used for the delimitation of t he character into states; italicized numbers along y-axis = assigned character states; species names are abbr eviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 90

68 Figure 3.47. Box plots of charac ter 34 (leaf lobe depth) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal line extending the width of the graph = value us ed for the delimitation of the character into states; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 91

69 Figure 3.48. Box plots of character 35 (degree peltate ) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviated.

PAGE 92

70 Figure 3.49. Box plots of character 36 (position of petiolar nectary) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal lines extending the width of t he graph = values used for the delimitation of t he character into states; italicized numbers along y-axis = assigned character states; species names are abbr eviated; taxa scored as polymorphic indicated by an asterisk.

PAGE 93

71 Figure 3.50. Box plots of character 37 (number of laminar nectaries) used in t he morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal line extending the width of the graph = value used for the delimitation of the c haracter into states; italicized numbers along y-axis = assigned character states ; species names are abbreviated.

PAGE 94

72 Figure 3.51. Box plots of character 38 (stipule l ength) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = r ange; internal line = median; horizontal lines extending the width of the graph = values used for the delimitation of the character into states ; italicized numbers along yaxis = assigned character states; species names are abbreviat ed; taxa scored as polymorphic indicated by an asterisk.

PAGE 95

73 Figure 3.52. Box plots of character 39 (stipule width ) used in the morphological cladistic analysis of Passiflora supersection Cieca . Red box = interquartile range; T-shaped line = range; internal line = median; horizontal line extending the width of the graph = value us ed for the delimitation of the character into states; italicized numbers along yaxis = assigned character states; species names are abbreviated.

PAGE 96

74 CHAPTER 4 MOLECULAR ANALYSES The cladistic analysis (PAUP* 4.0b10) of the molecular ITS-1 and ITS-2 data resulted in the generation of three equally parsimonious trees (F igs. 4.1-4.3) of 590 steps, a consistency index (CI) of 0.636, and a retenti on index (RI) of 0.837. The topologies presented in these trees are all quite similar, with only minor rearrangements occurring within the P. pallida and P. suberosa clades. The strict consensus tree is pr esented in Fig. 4.4. Supersections Decaloba and Multiflora appear to be monophyletic, with bootstrap values of 92% and 100%, respectively. The two taxa sampled from supersection Decaloba section Xerogona , P. citrina J. M. MacDougal and P. rubra L., form a monophyletic gr oup (100% bootstrap). Passiflora penduliflora Bertero ex DC. and P. perfoliata L. are also monophyletic in this analysis (100% bootstrap). The species sampled from supersection Multiflora ( P. inca P. Jrg., P. lobbii Mast. ssp. ayacuchensis Skrabal and Weigend, and P. podlechii Skrabal and Weigend) are monophyletic. Passiflora lobata (Killip) Hutch. ex J. M. MacDougal (supersection Bryonioides ) forms a polytomy at the base of the tree with supersection Multiflora . The monophyly of supersection Cieca is strongly support ed (100% bootstrap). There is also evidence for the monophyly of P. pallida (95% bootstrap), P. lancifolia (87% bootstrap), P. tenuiloba (100% bootstrap), P. sexocellata (93% bootstrap), P. viridiflora (96% bootstrap), P. juliana (100% bootstrap), P.

PAGE 97

75 obtusifolia (50% bootstrap), and P. mcvaughiana (84% bootstrap). The Passiflora coriacea/P. sexocellata and P. xiikzodz J. M. MacDougal /P. itzensis (J. M. MacDougal) K. Porter-Utley clades are monophyletic and well supported with bootstrap values of 100% and 90%, respectively. Passiflora juliana and P. viridiflora form a clade (77% bootstrap). A clade consisting of several populations of P. suberosa ssp. suberosa from the Greater Antilles and St. Croix is supported with a bootstrap value of 83%, though this subspecies is, as assessed in this analysis, paraphyletic. A moderately supported clade (73% bootstrap) indicates that an entity of P . suberosa ssp. suberosa from the Caribbean is more closely related to the red, hummingbirdpollinated, Jamaican endemic P. lancifolia than it is to other morphol ogically similar entities of P . suberosa ssp. suberosa (e.g., P. suberosa ssp. suberosa , St. Croix). The strict consensus tree shows that P. itzensis , P. xiikzodz , P. mcvaughiana , P. juliana , P. viridiflora , and P. obtusifolia form a clade, with P. obtusifolia sister to the other above-listed species. Within this group, P. juliana , P. viridiflora , and P. mcvaughiana , three species from southwestern Mxico, constitute a clade. Passiflora coriacea , P. sexocellata , and P. tenuiloba are also grouped together in all trees. Passiflora suberosa is non-monophyletic, but a large number of the accessions of this species do constitute a clade in the strict consensus tree. In addition, P. suberosa ssp. suberosa and P. suberosa ssp. litoralis are also both non-monophyletic. In addition, the cladograms indicate that P. pallida may be sister to the remaining species of supersection Cieca .

PAGE 98

76 Of particular interest are the cl ones of the vari ous entities of P. suberosa and P. pallida (Fig. 4.5). Sequences cloned from a single individual of Passiflora suberosa ssp. suberosa from Haiti are found in two different clades, with two clones (“a” and “b”) falling within a moder ately supported clade containing other members of the subspecies from t he Caribbean and the other two (“c” and “d”) forming a group in the strict consensus tree t hat is positioned sister to most of the taxa in the supersection. In addition, cloned entities of Passiflora suberosa ssp. litoralis from the states of Puebla and Vera cruz, Mxico are found in separate clades. The clones of the “ sub. w/ pall. aff. USA(FL)” entity from Florida occur in both the well-supported P. pallida clade (“a” and “c”) and the clade containing P. suberosa along with the rest of the species fr om the supersection (“b” and “d”), indicating that there is gene flow, likely resulting from hybr idization, between P. suberosa and P. pallida .

PAGE 99

77 Figure 4.1. The first of three most par simonious trees from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgroups. Numbers above branches are branch lengths. Bootstrap values are given below corresponding branches. Tree length=590; CI=0.636; RI=0.837; RC=0.532. Names followed by the letters “a”, “b”, “c”, “d”, and “e” denote clones of the same individual from a particular locality.

PAGE 100

78 Figure 4.2. The second of three most parsimonious trees from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgroups. Numbers above branches are branch lengths. Bootstrap values are given below corresponding branches. Tree length=590; CI=0.636; RI=0.837; RC=0.532. Names followed by the letters “a”, “b”, “c”, “d”, and “e” denote clones of the same individual from a particular locality.

PAGE 101

79 Figure 4.3. The third of three most parsimonious trees from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgroups. Numbers above branches are branch lengths. Bootstrap values are given below corresponding branches. Tree length= Tree length=590; CI=0.636; RI=0.837; RC=0.532. Names followed by the letters “a”, “b”, “c ”, “d”, and “e” denote clones of the same individual from a particular locality.

PAGE 102

80 Figure 4.4. Strict consensus of three most parsimonious trees from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgroups. Tree length=590; CI=0.636; RI=0. 837; RC=0.532. Names follow ed by the letters “a”, “b”, “c”, “d”, and “e” denote clones of the same individual from a particular locality.

PAGE 103

81 Figure 4.5. A portion of the strict cons ensus tree from the ITS-1 and ITS-2 data set of Passiflora supersection Cieca and outgroups highlight ing cloned entities. Numbers above branches are branch lengths. Bootstrap values are given below corresponding branches. Tree length= 590; CI=0.636; RI=0 .837; RC=0.532. Names followed by the letters “a”, “b”, “c ”, “d”, and “e” denote clones of the same individual from a particular locality.

PAGE 104

82 CHAPTER 5 PHENETIC MORPHOLOGICAL ANALYSES The Passiflora suberosa Complex A principal components analysis (PCA) of the 51 character morphological data set (Tab. 5.1) for the P. suberosa complex is presented in Fig. 5.1. Taxa recognized in this revision as P . suberosa ssp. suberosa , P. suberosa ssp. litoralis , P. tridactylites , and P . pallida were included in the analyses and are labeled accordingly. In addition, entit ies that may be of hybrid derivation and possess both P. pallida and P. suberosa affinities are indicated. Principal components I, II, and III account for 48.3% , 14.2%, and 7.7% of the variation, respectively, for a total of 70.2%. Pr incipal component axis I is most highly influenced by (presented in decreasing or der of component loadings)(Tab. 5.2): (1) length of the lateral leaf lobe, (2) dist ance from the outline of the leaf to the margin of the leaf sinus, and (3) leaf wid th; axis II by (1) androgynophore length, (2) sepal length, and (3) stipe length; axis III by (1) petiole length, (2) distance of the petiolar nectaries from the petiole bas e, and (3) number of laminar nectaries. The PCA plots of axes I and II and axes I and III separate P. tridactylites from the other taxa in the analysis, but the remaini ng taxa are poorly separated. The first principal component (PC1) consists prim arily of informati on from vegetative characters and is largely an indication of leaf size and leaf lobe depth. The second principal component (PC2) has low component loadings for the vegetative characters and high component l oadings for the floral characters and

PAGE 105

83 is primarily an indicator of flower size . Because PC1 and PC2 are by definition not correlated, this division of floral and vegetative characters between these first two PCs indicates that there is little correlation between floral and vegetative characters among t he entities in the P. suberosa complex. A PCA analysis of the data set for the P. suberosa complex based on 31 floral characters (Tab. 5.1) is presented in Fig. 5.2. Principal components I, II, and III account for 47.1%, 15.0%, and 9.5% of the va riation, respectively, for a total of 71.6%. Principal component axis I is mo st highly influenced by (presented in decreasing order of component loadings) (T ab. 5.3): (1) andr ogynophore length, (2) sepal length, and (3) length of the filam ents in the outer coronal row; axis II by (1) number of filaments in the inner coronal row, (2) pedicel length, and (3) number of filaments in the outer coronal row; axis III by (1) pedicel length, (2) stipe length, and (3) nectary width. The PC A plots of axes I and II and axes I and III clearly separate P. tridactylites , P. suberosa ssp. suberosa , P. suberosa ssp. litoralis , and P. pallida . The first and third principa l components are a measure of overall flower size and PC2 is mostly a measure of the re lationship among the number of filaments present in each coronal row. When PC1 and PC3 of floral characters are plotted for individual plant s (Fig. 5.2), individuals from the same species and subspecies tend to cluster t ogether although there is limited overlap among entities of P. suberosa ssp. litoralis and P. pallida , possibly resulting from hybridization. The pattern reflected in the scatter plot of the first and third components in Fig. 5.2 strongly relates to the overall size of the flower, with

PAGE 106

84 entites in the left half of the scatter plot having larger flowers than those individuals in the right half. The unrooted neighbor joining tree pr oduced from an analysis of the entire morphological data set of the P . suberosa complex (Tab. 5.4-5.5) is shown in Fig. 5.3. Passiflora suberosa ssp. suberosa and P. tridactylites , the two most morphologically distinct taxa in the P. suberosa complex, are clearly resolved at the “top” of the tree. One accession of P. suberosa ssp. litoralis from the Galapagos is more similar to P. tridactylites than to other members of the subspecies from Central and South America, but P. tridactylites can be easily separated from this accession by it s elongated androgynophore (the average androgynophore length of P. tridactylites is 7.5 mm and the average androgynophore length of this accession of P. suberosa ssp. litoralis from the Galapagos is 5.9 mm; char. #19) and longer outer coronal filaments (the average length of the filaments in the outer coronal row of P. tridactylites is 7.5 mm and the average length of the fila ments in the outer coronal row of this accession of P. suberosa ssp. litoralis from the Galapagos is 5.2 mm; char. #8). Passiflora suberosa ssp. suberosa forms two distinct clusters, a Lesser Antillean group and a largely Greater Antillean group, wit h one accession from Hawaii (Oahu) and one from St. Croix found within th e Greater Antillean cluster. Most of the P. pallida accessions form a cluster to ward the “base” of the neighbor joining tree, but four accessions of P. pallida are placed elsewhere, intermixed with P. suberosa ssp. litoralis , indicating that the differences between these two taxa are sometimes difficult to discern. There are many smaller

PAGE 107

85 clusters of P. suberosa ssp. litoralis , all primarily positioned adjacently on the tree between the P. tridactylites / P. suberosa ssp. suberosa group and the P. pallida group . These results suggest that both P. tridactylites and P. suberosa ssp. suberosa may have evolved from a non-monophyletic P. suberosa ssp. litoralis . One small cluster of two accessions from coastal areas of Ecuador and Peru are located in a small group ju st “below” the larger P. tridactylites / P. suberosa ssp. suberosa cluster. However, the re st of the clusters of P. suberosa ssp. litoralis contain individuals from mainly high el evations in Mxico and Central America with South American accessions scatter ed within them. In addition, two individuals, which may be of hybrid origin and possess affinities of P. pallida and P. suberosa , occur at two different locations in the neighbor joining tree, but they are both most similar to P. pallida .

PAGE 108

86 Table 5.1. Characters used in the morphology-based principal components analysis of the Passiflora suberosa complex (* = characters used in the PCA analysis of the data set for P. suberosa complex based on floral characters). All measurements were recorded in mm. For a discussion of character state delimitation see Chap. 3. 1. *Pedicel length 2. *Pedicel width 3. *Stipe length 4. *Stipe width 5. *Hypanthium diameter 6. *Sepal length 7. *Sepal width 8. *Number of coronal rows 9. *Number of filaments in outer coronal row 10. *Length of fila ments in outer coronal row 11. *Width of filam ents in outer coronal row 12. *Number of f ilaments in inner coronal row 13. *Length of fila ments in inner coronal row 14. *Width of filam ents in inner coronal row 15. *Staminal filament length 16. *Staminal filament width 17. *Anther length 18. *Anther width 19. *Style length 20. *Style width 21. *Stigma width 22. *Nectary width 23. *Androgynophore length 24. *Androgynophore width 25. *Ovary length 26. *Ovary width 27. *Operculum length 28. *Nectary height 29. *Limen height 30. *Limen diameter 31. *Limen floor diameter 32. Distance of petiolar nectary from petiole base 33. Petiole length 34. Petiolar nectary position 35. Length of pubescence on petiole 36. Petiolar nectary diameter 37. Petiolar nectary height 38. Degree leaf peltate 39. Lateral leaf vein length 40. Central leaf vein length 41. Quotient: lateral to central lobe length 42. Distance from leaf outline to sinus margin 43. Depth of leaf lobe 44. Leaf width 45. Length of pubescence on leaf 46. Number of laminar nectaries 47. Stem diameter 48. Length of pubescence on stem 49. Stipule length 50. Stipule width 51. Tendril width

PAGE 109

87 Figure 5.1. Principal components analysis of the data set for the P. suberosa complex based on 51 morphologica l characters (Table 5.1).

PAGE 110

88 Table 5.2. Component loadings for axes I, II, and III from a principal components analysis of the P. suberosa complex (Figure 5.1). T he values were computed from quantitative vegetative and floral variables. Variables PCI PCII PCIII Pedicel length 0.072 -0.186 0.174 Pedicel width 0.002 -0.015 0.013 Stipe length 0.065 -0.294 -0.101 Stipe width 0.006 -0.047 0.005 Hypanthium diameter 0.060 -0.187 0.081 Sepal length 0.054 -0.307 0.127 Sepal width 0.046 -0.150 0.009 Number of coronal ro ws 0.003 -0.013 0.006 Number of filaments in outer coronal row 0.019 -0.005 0.040 Length of filaments in outer co ronal row 0.081 -0.230 0.202 Width of filaments in outer coronal row 0.005 -0.024 0.029 Number of filaments in inner coronal row 0.039 0.058 0.177 Length of filaments in inner co ronal row 0.071 -0.222 0.204 Width of filaments in inner coronal row 0.003 -0.019 0.005 Staminal filament length 0.053 -0.230 0.052 Staminal filament width 0.005 -0.034 -0.018 Anther length 0.022 -0.125 -0.029 Anther width -0.001 -0.027 -0.037 Style length 0.058 -0.190 0.012 Style width 0.010 -0.054 -0.018 Stigma width 0.008 -0.022 0.030 Nectary width 0.069 -0.179 -0.048 Androgynophore length 0.093 -0.338 0.248 Androgynophore width 0.015 -0.067 -0.016 Ovary length 0.045 -0.169 0.148 Ovary width 0.036 -0.112 0.007 Operculum length 0.049 -0.166 0.093 Nectary height 0.022 -0.04 0.065 Limen height 0.022 -0.025 0.037 Limen diameter 0.005 -0.002 0.032 Limen floor diameter 0.034 -0.071 0.058 Distance of petiolar nectary fr om pet. base 0.040 -0.115 -0.336 Petiole length 0.081 -0.146 -0.357 Position of petiolar nect aries -0.018 0.012 0.000 Length of pubescence on petiole 0.011 0.000 -0.058 Petiolar nectary diamet er 0.032 -0.067 -0.112

PAGE 111

89 Table 5.2. Cont. Variables PCI PCII PCIII Petiolar nectary height 0.000 -0.008 -0.058 Degree leaf peltate 0.032 -0.029 -0.114 Length of lateral leaf lobe 0.695 0.270 -0.127 Length of central leaf lobe 0.028 -0.212 -0.284 Quotient: lateral/central lobe length 0.095 0.041 0.018 Distance from leaf outline to sinus margin 0.608 0.148 0.214 Depth of leaf lobe 0.078 0.038 0.123 Leaf width 0.220 -0.177 -0.207 Length of pubescence on leaf 0.027 0.024 -0.083 Number of laminar nect aries 0.099 -0.243 -0.318 Stem diameter 0.030 -0.040 -0.093 Length of pubescence on stem 0.001 0.050 -0.079 Stipule length 0.016 0.020 -0.313 Stipule width 0.010 0.023 -0.094 Tendril width 0.017 -0.053 -0.075

PAGE 112

90 Figure 5.2. Principal components analysis of the data set for the P. suberosa complex based on 31 floral characters (Table 5.1).

PAGE 113

91 Table 5.3. Component loadings for axes I, II, and III from a principal components analysis of the P. suberosa complex (Figure 5.2). T he values were computed from quantitative floral variables. Variables PCI PCII PCIII Pedicel length -0.242 0.189 0.652 Pedicel width -0.020 0.011 -0.035 Stipe length -0.282 -0.032 -0.592 Stipe width -0.048 0.016 -0.057 Hypanthium diameter -0.231 0.021 -0.028 Sepal length -0.335 -0.058 0.036 Sepal width -0.174 0.015 -0.106 Number of coronal rows -0.014 0.046 -0.016 Number of filaments in outer coronal row -0.027 0.150 -0.001 Length of filaments in outer co ronal row -0.317 0.028 0.044 Width of filaments in outer coronal row -0.032 0.003 0.022 Number of filaments in inner coronal row -0.020 0.955 -0.153 Length of filaments in inner co ronal row -0.295 0.021 0.098 Width of filaments in inner co ronal row -0.021 -0.003 -0.015 Staminal filament length -0.255 -0.050 -0.052 Staminal filament width -0.033 -0.002 -0.058 Anther length -0.125 -0.023 -0.172 Anther width -0.018 -0.009 -0.142 Style length -0.218 -0.029 -0.075 Style width -0.050 -0.038 -0.018 Stigma width -0.035 0.030 -0.053 Nectary width -0.196 -0.062 -0.214 Androgynophore length -0.417 -0.039 0.204 Androgynophore width -0.072 0.017 -0.065 Ovary length -0.213 -0.061 0.096 Ovary width -0.131 -0.004 -0.077 Operculum length -0.199 -0.041 -0.009 Nectary height -0.066 -0.005 -0.012 Limen height -0.048 0.015 -0.010 Limen diameter -0.015 0.022 0.004 Limen floor diameter -0.110 0.059 -0.016

PAGE 114

92 Table 5.4. Characters used in the mor phology-based neighbor joining analysis of the Passiflora suberosa complex (Figure 5.3). For a discussion of character state delimitation see Chap. 3. 1. Pedicel length (mm) 12.50 (0); >12.50 (2) 2. Stipe length (mm) 2.10-6.70 (0); 6.71-9.00 (1); > 9.00 (2); <2.10 (3) 3. Stipe length/pedicel le ngth (quotient) <0.42 (0); 0.42-0.98 (1); >0.98 (2) 4. Hypanthium diameter (mm) 3.37-4.94 (0 ); 4.95-6.54 (1); 6. 55-8.25 (2); >8.25 (3); <3.37 (4) 5. Sepal length (mm) <5.80 (0); 5.81-8.68 (1); 8.69-12.87 (2); 12.88-14.62 (3); 14.63-18.74 (4); >18.74 (5) 6. Sepal width (mm) <2.74 (0 ); 2.74-4.13 (1); >4.13 (2) 7. Number of filam ents in the outer coronal row ( number) >25 (0); 18-26 (1); <18 (2) 8. Length of filaments in the outer cor onal row (mm) <2.75 (0); 2.75-4.00 (1); 4.01-5.88 (2); >5.88 (3) 9. Length of filaments in t he inner coronal row/sepal le ngth (quotient) 0.42-0.72 (0); >0.72 (1); <0. 23 (2); 0.23-0.41 (3) 10. Number of filam ents in the inner coronal row (number) 18-31 (0); 32-37 (1); 38-45 (2); >45 (3); <16 (4); 17 (5) 11. Length of filaments in t he inner coronal row (mm) >3 .26 (0); 1.95-3.26 (1); 1.33-1.94 (2); <1.32 (3) 12. Length of filaments in the inner coronal row/length of filaments in the outer coronal row (quotient) >3.1 (0); <0.30 (1) 13. Staminal filament length (mm) <2.51 (0); 2.51-3. 53 (1); 3.54-4.34 (2); >4.60 (3) 14. Anther length (mm) 1.48-2.00 (0); 2.01-2.47 (1); 2.48-2.67 (2); >2.67 (3) <1.48 (4) 15. Style length (mm) <4.08 (0); 4.085.34 (1); 5.54-6.34 (2); >6.87 (3) 16. Stigma width (mm) 0.61-1. 12 (0); >1.12 (1); <0.61 (2) 17. Ovary length (mm) <2.35 (0); 2.35 (1) 18. Nectary width (mm) 0.41-1.33 (0); 1.34-2.67 (1); >2.67 (2); <0.41 (3) 19. Androgynophore length (mm) <4.41 (0); 5.00-6.07 (1); 8.0012.63 (2); >13.12 (3) 20. Androgynophore width (mm) 0.57-1 .40 (0); >1.52 (1); <0.57 (2) 21. Staminal filament length/androgy nophore length (quotient ) >0.45 (0); 0.340.43 (1); 0.31 (2) 22. Operculum length (mm) 2.00 (0); >2.00 (1) 23. Nectary height (mm) 0.53 (0); >0.53 (1) 24. Limen height (mm) 0.35 (0); >0.35 (1) 25. Limen floor diamet er (mm) >2.19 (0); 2.19 (1) 26. Fruit length (mm) 9.63 (0); 11.10-11.50 (1); 11.88 (2) 27. Fruit width (mm) 10.00 (0); 10.50 (1) 28. Seed length (mm) 3.54 (0); 3.67 (1)

PAGE 115

93 Table 5.4. Cont. 29. Seed width (mm) <1.80 (0); 1.80-2.13 (1); >2.13 (2) 30. Length of central leaf vein (mm) <136 (0); 136 (1) 31. Width of central leaf lobe (mm) 10.00 (0); 10.01-26.00 (1); >26.00 (2) 32. Length of central leaf vein/width of central leaf lobe (quotient) 4.00 (0); 4.019.50 (1); >9.50 (2) 33. Width of lateral leaf lobe (mm) < 11.00 (0); 11.00-20. 00 (1); >20.00 (2) 34. Angle between lateral leaf veins (degrees) >94 (0); 58-94 (1); <58 (2) 35. Distance from the leaf outline to t he sinus margin (mm) <8.26 (0); 8.26-20.99 (1); >20.99 (2) 36. Distance from the leaf outline to the leaf base (mm) >24.00 (0); 24.00 (1) 37. Leaf lobe depth (quotient: distance from leaf outline to margin of sinus/distance from leaf outline to leaf base) 0.22-0.35 (0); 0.36-0.63 (1); >0.63 (2); <0.22 (3) 38. Length of central leaf ve in/length of lateral leaf vein (quotient) >0.44 (0); 0.44 (1) 39. Length of lateral leaf vein/width of la teral leaf lobe (quotient) <5.00 (0); 5.0010.40 (1); >10.40 (2) 40. Leaf width (mm) 5.01-41.99 (0 ); >49.99 (1); <5.01 (2) 41. Distance from petiolar nectary to petiole base (mm) <14.13 (0); 14.13 (1) 42. Position of petiolar nectary (quotient: distance from petiolar nectary to petiole base/petiole length) 0.49 (0); 0.50-0.65 (1); 0.66-0.75 (2); >0.75 (3) 43. Diameter of petiolar nectary (mm) <0.75 (0); 0.75-1.20 (1); >1.20 (2) 44. Stipule length (mm) >7 .40 (0); 2.37-7.40 (1); 2.36 (2) 45. Stipule width (mm) >0.80 (2); 0. 48-0.80 (1); 0.20-0. 47 (0); <0.20 (3) 46. Inflorescences not present (0); inflorescences present as condensed shoots with aborted laminas (1) 47. Bracts absent (0); bracts present (1) 48. Spur absent (0); spur present (1) 49. Sepals greenish yellow (0); sepals whitish (1) 50. Sepals pubescent (0 ); sepals glabrous (1) 51. Two coronal rows present (0); one coronal row present (1) 52. Outer coronal filaments without red/ purple pigmentation (0); outer coronal filaments with a flush of red/purple pigmentation at base (1); outer coronal filaments with evident red/ purple pigmentation (2); outer coronal filaments with conspicuous red/pur ple pigmentation (3) 53. Outer coronal filaments linear (0); outer coronal filaments dilated toward apex (1) 54. Outer coronal filaments erect (0); outer coronal f ilaments spreading flat (1) 55. Outer coronal filaments not fused (0 ); outer coronal filaments fused (1)

PAGE 116

94 Table 5.4. Cont. 56. Inner coronal filament s without red/purple pigmentat ion (0); inner coronal filaments with a flush of red/purple pigmentation at base (1); inner coronal filaments with evident red/ purple pigmentation (2); inner coronal filaments with conspicuous red/pur ple pigmentation (3) 57. Androgynophore without red/purple pigmentation (0 ); androgynophore with a flush of red/purple pigmentati on at base (1); androgynophore with conspicuous red/purpl e pigmentation (2) 58. Ovary ellipsoid (0); ovary globose (1); ovary fusiform (2); ovary obovoid (3) 59. Ovary glabrous (0); ovary pubescent (1) 60. Operculum present (0); operculum absent (1) 61. Operculum without red/ purple pigmentation (0); operculum with a flush of red/purple pigmentation at base (1); operculum with evident red/purple pigmentation (2); operculum with cons picuous red/purple pigmentation (3) 62. Nectary without raised annulus (0 ); nectary with raised annulus (1) 63. Limen recurved (0); limen erect or inclined toward the operculum (1) 64. Limen without red/purpl e pigmentation (0); limen wit h a flush of red/purple pigmentation at base (1); limen with conspicuous r ed/purple pigmentation (2) 65. Limen floor without red/ purple pigmentation (0); lim en floor with a flush of red/purple pigmentation at base (1); limen floor with evident red/purple pigmentation (2); limen floor with cons picuous red/purple pigmentation (3) 66. Fruit globose (0); fruit ellipsoid (1 ); fruit fusiform (2 ); fruit ovoid (3) 67. Petiolar nectaries opposite (0); peti olar nectaries subopposite (1); petiolar nectaries alternate (2) 68. Petiolar nectaries capitate (0); pet iolar nectaries obconical (1); petiolar nectaries cupulate (2); petiolar nectar ies discoid (3); petiolar nectaries urceolate (4) 69. Leaves not peltate (0); leaves peltate (1) 70. Leaves trilobed (0); leaves unlobed (1); leaves bilobed to trilobed (2); leaves unlobed to trilobed (3) 71. Leaf base cordate (0); leaf base not cordate (1) 72. Leaf margin entire (0); leaf margin crenate (1) 73. Leaves not variegated (0); leaves variegated (1) 74. Leaves with primary veins diverging and branching at base (0); leaves with primary veins diverging and branching abov e base (1); leaves with secondary veins forming a series of loops (2) 75. Laminar nectaries absent (0); laminar nectaries present (1) 76. Stem entirely greenish yellow (0); stem with reddi sh purple coloration (1) 77. Stipules glabrous (0); stipules pubescent (1)

PAGE 117

95 Table 5.5. Character values used in the constr uction of the neighbor joinin g tree for taxa in the P. suberosa complex (Figure 5.3) . A = 0/1; B = 0/2; C = 0/3; D = 0/5; E = 1/2; F = 1/2/3; G = 2/3; ? = condition unknown.

PAGE 118

96 Table 5.5. Cont.

PAGE 119

97 Figure 5.3. Unrooted neigh bor joining tree resulting from the analysis of the morphological data (Tables 5.4-5. 5) from entities within the P. suberosa complex .

PAGE 120

98 The Passiflora coriacea Complex A principal components analysis (PCA) of the entire morphol ogical data set (Tab. 5.6) for the P. coriacea complex is presented in Fig. 5.4. Species that are recognized in this revision as P . coriacea , P. megacoriacea , and P . sexocellata are included and labeled accord ingly. Principal component s I, II, and III account for 30.8%, 19.2%, and 10.5% of the variation, respectively , for a total of 60.5%. Principal component axis I is most highl y influenced by (presented in decreasing order of component loadings) (T ab. 5.7): (1) degree that t he leaf is peltate, (2) stipe length, and (3) androgynophor e length. Axis II is most highly influenced by (1) degree that the leaf is peltate, (2) leaf width, and (3) length of the lateral leaf lobe, and axis III by (1) pedicel length, (2) number of filam ents in the inner coronal row, and (3) length of the pubesce nce on the stem. The PCA plots of axes I and II and I and III separate P. megacoriacea from P. coriacea and P. sexocellata . The first principal component (PC1) and the third principal component (PC3) consist of information from both floral and vegetative characters. The second principal co mponent (PC2) has low component loadings for the floral characters and high component loadings for the vegetative characters and is primarily an indicator of the degree that the le af is peltate and leaf size. The graphs in Fig. 5.4 place individuals with larger flowers that have short floral stipes and long pedicels and la rger leaves that are less peltate with narrower lateral lobes in the ri ght half of the scatter plots. A PCA analysis of the data set for the P. coriacea complex based on floral characters (Tab. 5.6) is presented in Fig. 5.5. Principal components I, II, and III account for 41.5%, 16.6%, and 12. 0% of the variation, res pectively, for a total of

PAGE 121

99 70.1%. Principal component axis I is mo st highly influenced by (presented in decreasing order of component loadings)(T ab. 5.8): (1) stipe length, (2) androgynophore length, and (3) sepal length; axis II by (1) pedicel length, (2) number of filaments in the inner coronal row, and (3) androgynophore width; axis III by (1) stipe length, (2) number of f ilaments in the inner coronal row, and (3) nectary width. The PCA plots of axes I and II and I and III indicate that all three species, P. megacoriacea , P. coriacea , and P. sexocellata , are phenetically separable. Individuals of the same species tend to cluster together although there is only a small amount of overlap among entities of P. coriacea and P. sexocellata . The pattern reflected in both plots in Fig. 5.5 strongly relates to the overall size of the flower, with entites in the right hal f of the scatter plot having larger flowers than those individuals in the left half. The unrooted neighbor joining tree pr oduced from an analysis of the entire morphological data set (T ab. 5.9-5.10) of the P . coriacea complex is shown in Fig. 5.6. The accessions representing P. megacoriacea and P. coriacea , the two most morphologically distinct taxa in the P. coriacea complex, are each clearly clustered toward the “top” of the neighbor join ing tree. Accessions representing P. sexocellata are clustered toward the “base” of the tree, but two accessions representing P. sexocellata (from Belize and Mxico) are more similar to P. megacoriacea than to other members of P. sexocellata from Mxico and Central America. However, P. megacoriacea can be easily separated from these accessions by its elongated androgy nophore (the average androgynophore length of P. megacoriacea is 7.5 mm and the average androgynophore lengths of

PAGE 122

100 the accessions of P. sexocellata from Belize and Mxico are between 3 and 5 mm, respectively; char. #15). Table 5.6. Characters used in the morphology-based principal components analysis of the Passiflora coriacea complex (* = characters used in the PCA analysis of the data set for the P. coriacea complex based on floral characters). All measurements were recorded in mm. For a discussion of character state delimitation see Chap. 3. 1. *Pedicel length 2. *Pedicel width 3. *Stipe length 4. *Stipe width 5. *Hypanthium diameter 6. *Sepal length 7. *Sepal width 8. *Number of filaments in outer coronal row 9. *Length of f ilaments in outer coronal row 10. *Width of f ilaments in outer coronal row 11. *Number of f ilaments in inner coronal row 12. *Length of filaments in inner coronal row 13. *Width of filaments in inner coronal row 14. *Stamen filament length 15. *Stamen filament width 16. *Anther length 17. *Anther width 18. *Style length 19. *Style width 20. *Stigma width 21. *Nectary width 22. *Androgynophore length 23. *Androgynophore width 24. *Ovary length 25. *Ovary width 26. *Operculum length 27. *Limen floor diameter 28. Distance of petiolar nectary from petiole base 29. Petiole length 30. Length of pubescence on petiole 31. Petiolar nectary diameter 32. Degree leaf peltate 33. Lateral lobe length 34. Lateral lobe width 35. Central lobe length 36. Number of laminar nectaries 37. Laminar nectary diameter 38. Angle between lateral lobes 39. Leaf width 40. Stem diameter 41. Length of pubescence on stem 42. Stipule length 43. Stipule width 44. Tendril width

PAGE 123

101 Figure 5.4. Principal components analysis of the data set for the P. coriacea complex based upon 44 morphological characters (Table 5.6).

PAGE 124

102 Table 5.7. Component loadings for axes I, II, and III from a principal components analysis of the P. coriacea complex (Figure 5.4). The values were computed from quantitative vegetative and floral variables. Variables PCI PCII PCIII Pedicel length 0.164 -0.012 0.826 Pedicel width 0.016 0.017 -0.050 Stipe length -0.309 -0.092 0.056 Stipe width 0.005 0.045 0.004 Hypanthium diameter 0.190 0.104 0.044 Sepal length 0.211 0.188 -0.011 Sepal width 0.163 0.092 -0.057 Number of filament s in outer coronal row -0.179 -0.107 0.000 Length of filaments in outer co ronal row 0.182 0.187 -0.031 Width of filaments in outer coronal row 0.081 0.074 -0.011 Number of filaments in inner coronal row -0.197 0.054 0.352 Length of filaments in inner co ronal row 0.130 0.116 -0.008 Width of filaments in inner coronal row -0.074 -0.010 -0.034 Staminal filament l ength 0.166 0.024 0.020 Staminal filament width 0.074 0.037 -0.043 Anther length 0.178 0.036 0.029 Anther width 0.074 0.055 0.003 Style length 0.141 0.068 -0.116 Style width 0.015 -0.002 -0.023 Stigma width 0.087 0.059 -0.069 Nectary width 0.135 0.072 0.015 Androgynophore length 0.246 0.125 0.028 Androgynophore width 0.031 0.073 -0.154 Ovary length 0.146 0.099 0.026 Ovary width 0.149 0.098 -0.022 Operculum length 0.163 0.079 -0.009 Limen floor diameter 0.211 0.136 -0.064 Distance of petiolar nectary fr om pet. base 0.126 0.302 0.116 Petiole length -0.180 0.262 0.058 Length of pubescence on petio le -0.050 -0.001 -0.117 Diameter of petiolar nectaries 0.014 0.018 0.002 Degree leaf peltate -0.375 0.400 0.013 Length of lateral leaf lobe -0.128 0.335 -0.015 Width of lateral leaf lobe -0.223 0.307 -0.051 Length of central leaf lobe 0.125 0.302 -0.053 Angle between lateral leaf lobes -0.109 0.054 -0.017 Leaf width -0.183 0.367 -0.038 Number of laminar nect aries 0.037 -0.114 -0.192

PAGE 125

103 Table 5.7. Cont. Variables PCI PCII PCIII Diameter of laminar nectaries -0.095 -0.002 0.033 Stem diameter -0.016 0.065 0.054 Length of pubescence on stem 0.122 -0.007 -0.194 Stipule length 0.013 0.001 0.106 Stipule width -0.004 0.002 0.011 Tendril width 0.004 0.092 0.034

PAGE 126

104 Figure 5.5. Principal components analysis of the data set for the P. coriacea complex based upon 27 floral characters (Table 5.6).

PAGE 127

105 Table 5.8. Component loadings for axes I, II, and III from a principal components analysis of the P. coriacea complex (Figure 5.5). The values were computed from quantitative floral variables. Variables PCI PCII PCIII Pedicel length 0.192 0.919 -0.054 Pedicel width 0.017 -0.067 0.075 Stipe length -0.358 -0.018 0.694 Stipe width 0.017 -0.019 0.057 Hypanthium diameter 0.241 0.000 0.231 Sepal length 0.283 -0.059 0.169 Sepal width 0.215 -0.072 0.140 Number of filaments in outer coronal row -0.213 0.042 -0.066 Length of filaments in outer coronal row 0.268 -0.041 0.045 Width of filaments in outer coronal row 0.119 -0.009 0.018 Number of filaments in inner coronal row -0.194 0.271 0.478 Length of filaments in inner coronal row 0.191 -0.004 0.062 Width of filaments in inner coronal row -0.072 -0.026 0.041 Staminal filament l ength 0.173 0.006 0.021 Staminal filament width 0.092 -0.055 0.033 Anther length 0.186 -0.001 0.012 Anther width 0.099 -0.001 -0.086 Style length 0.165 -0.132 0.056 Style width 0.020 -0.024 0.032 Stigma width 0.115 -0.073 0.001 Nectary width 0.196 -0.021 0.324 Androgynophore length 0.290 -0.011 0.121 Androgynophore width 0.058 -0.171 0.033 Ovary length 0.185 0.031 0.034 Ovary width 0.199 -0.015 0.100 Operculum length 0.194 -0.023 0.016 Limen floor diameter 0.281 -0.079 0.135

PAGE 128

106 Table 5.9. Characters used in the mor phology-based neighbor joining analysis of the Passiflora coriacea complex (Figure 5.6). For a discussion of character state delimitation see Chap. 3. 1. Pedicel length (mm) 10.75 (0); 11.25-13.15 (1); 15.25 (2) 2. Pedicel width (mm) 0.80 (0); 0.87 (1) 3. Stipe length (mm) 3.88 (0); 4.00-9.38 (1); 10.88 (2) 4. Stipe length/pedice l length (quotient) 0.56 (0); 0.66-1.20 (1); 1.45-1.60 (2); 2.05 5. Hypanthium diameter (mm) 6.50 (0); 6.88-9.50 (1); 10.88-11.00 (2); 12.1312.88 (3) 6. Sepal length (mm) 10.88 (0); 11.25 (1) 7. Sepal width (mm) 5.50 (0); >5.50 (1) 8. Number of filam ents in the outer coronal row ( number) 25 (0); 31 (1); 34-42 (2); 43-51(3) 9. Length of filaments in the outer coronal row (mm) 4.60 (0); 5.47-8.25 (1); 9.25 10. Width of filaments in the outer coronal row (mm) 0.73 (0); 0.88 (1) 11. Number of fila ments in the inner coronal row (number) <10 (0); 27-43 (1); 45 (2) 12. Length of filaments in the inner coronal row (mm) 1.91 (0); 2.20 (1) 13. Width of filaments in the inner coronal row (mm) 2.50 (0); >2.50 (1) 14. Nectary width (mm) 1.20 (0); 1.33-2.50 (1); 2.94 (2) 15. Androgynophore length (mm) 5.94 (0); 7.00 (1) 16. Androgynophore width (mm) 1.20 (0); 1.21-1.40 (1); 1.47 (2) 17. Staminal filament length (mm) 2.87 (0); 3.00 (1) 18. Staminal filament lengt h/androgynophore lengt h (quotient) 0.55 (0); 0.560.87 (1); 0.89 (2) 19. Anther length (mm) 2.13 (0); 2.14-2.47 (1); 2. 48-2.80 (2); 2.81-3.50 (3); 3.74 (4) 20. Style length (mm) 2.40 (0); 2.54-3.94 (1); 4.00 (2) 21. Operculum length (mm) <2.00 (0); 2.00 (1) 22. Nectary height (mm) 0.80 (0); 1.40 (1) 23. Limen floor diameter (mm) <4.94 (0); 4.94-5.27 (1); 5.60 (2) 24. Seed length (mm) <3.75 (0); 3.75-4.80 (1); 4.88 (2) 25. Seed width (mm) <3.00 (0); 3.00 (1) 26. Position of petiolar nect aries (quotient: distance from petiolar nectary to petiole base/petiole length) <0.53 (0); 0.53 (1) 27. Number of leaf lobes (number) 2 (0); 3(1) 28. Central leaf vein length/c entral leaf lobe width (quotient) 0.76 (0); 0.93-1.54 (1); 1.63 (2) 29. Lateral leaf vein length/cent ral leaf vein length (quotient) 1.26 (0); 1.30-1.39 (1); >1.39 (2)

PAGE 129

107 Table 5.9. Cont. 30. Distance from the leaf outline to the leaf base (mm) 21 (0); 29-58 (1); 67 (2) 31. Distance from the leaf outline to the sinus margin (mm) 4 (0); 5-12 (1); 14 (2) 32. Leaf lobe depth (quotient: distance from leaf outline to margin of sinus/distance from leaf outline to leaf base) 0.24 (0); 0.26 (1) 33. Angle between lateral leaf veins (degrees) 120 (0); 122 (1) 34. Outer coronal filaments dark reddis h purple at base with yellow apex (0); outer coronal filaments purplish at base and whitish toward tips (1) 35. Limen erect or inclined toward the operculum (0); limen recurved (1) 36. Nectary without raised annulus (0 ); nectary with raised annulus (1) 37. Leaves transversely elliptic (0); leaves distinctly trilobed and ovate in general outline (1) 38. Leaves not variegated (0); leaves variegated (1)

PAGE 130

108 Table 5.10. Character values for ta xa used in the phenetic analysis of the Passiflora coriacea complex (Figure 5.6) . A = 0/1; ? = condition unknown.

PAGE 131

109 Figure 5.6. Unrooted neigh bor joining tree resulting from the analysis of the morphological data (Tables 5.9-5. 10) from entities within the P. coriacea complex .

PAGE 132

110 CHAPTER 6 CLADISTIC MORPHOLOGICAL ANALYSES The cladistic analysis of the morphological data (Tab. 6. 1-6.2) for supersection Cieca and outgroups resulted in the generat ion of one equally parsimonious tree of 548 steps, a consistency index (CI) of 0.429, a retention i ndex (RI) of 0.526, and a rescaled consistency index (RC) of 0.226 (Fig. 6.1-6.2). While only one tree was found in the analysis, branch support is low for most of the tree. Only six of the branches have bootstrap sco res >50%, and only three have values where some confidence can be obtained: the branch grouping P . arbelaezii L. Uribe and P . lancetillensis J. M. MacDougal & J. Me erman has a bootstrap of 92%, the branch grouping P . lobbii Mast. ssp. lobbii and P . exoperculata Mast. has a bootstrap of 95%, and the branch grouping P . itzensis and P . xiikzodz has a bootstrap of 100%. The presence/absence of petals (characte r # 45, state 2) was given a weight of two in this analysis (all other characte rs having a weight of one) in order to insure that the ingroup is resolved as monophyletic; the monophyly of the supersection has already been confidently established (100% bootstrap value) with molecular sequence data (see chapter 4). The monophyly of supersection Cieca is supported by the following apomorphi es: the absence of petals, styles that are less than 6 mm in length (#15, 1), outer coronal filaments that are commonly less than 5 mm in length (#8, 4) , fewer than 35 filaments present in the inner coronal row (#10, 2), staminal filaments that are fr equently less than 5.5

PAGE 133

111 mm long (#13, 1), and 0-2 floral bracts ( #42, 1). The absence of petals is the only nonhomoplasious character supporting the monophyly of t he supersection. Within supersection Cieca , Passiflora clypeophylla , P . juliana , P . viridiflora , P . megacoriacea , P . mcvaughiana , P . xiikzodz , P . itzensis , P . sexocellata , P . coriacea , P . tacana , and P . obtusifolia form a clade. Within this group, P . juliana , P . viridiflora , and P . megacoriacea constitute a clade, with Passiflora juliana and P . viridiflora being most closely related. A clade consisting of P . mcvaughiana , P . xiikzodz , P . itzensis , P . tacana , P . sexocellata , and P . coriacea is also evident, with P . xiikzodz and P . itzensis present as sister species. The two Guatemalan endemics, P . trinifolia and P . eglandulosa , form a clade. A clade consisting of P . tridactylites , P . lancifolia , and P . macfadyenii is also present, with P . lancifolia and P . macfadyenii sister to each other. Passiflora tenuiloba , P . pallida , and P . suberosa ssp. litoralis form a clade, with P . tenuiloba and P . pallida being most closely related. Finally, Passiflora suberosa ssp. suberosa is cladistically basal within the supersection. Passiflora suberosa ssp. suberosa is defined by the presence of white sepals (#49, 1), filaments in the inner coronal row that are reddish purple at the base with a yellow capitate head (#56, 2), whit ish pollen (#64, 1), a sulcate floral nectary floor (#71, 1), ovoid fruits (#76, 3) and three-lobed leaves (rarely unlobed or bilobed)(#84, 4). The remaining me mbers of the superse ction form a clade based upon a shift from plants that co mmonly possess four or more laminar nectaries to those that possess none (#37, 2 )(with shifts to leaves with less than four and more than four laminar nectaries occurring in many taxa) and ellipsoid

PAGE 134

112 ovaries (#65, 1)(with several shifts to globose and fusiform ovaries in several taxa). Within Passiflora supersection Cieca P . lancifolia , P . macfadyenii , P . tridactylites , P . tenuiloba , P . pallida , and P . suberosa ssp. litoralis form a clade (Fig. 6.1-6.2). This group possesses petiolar nectaries that are positioned on the upper half of the petiole (#36, 1) and androgynophores that possess red or purple pigmentation (#59, 1). The taxa commonly lack laminar nectaries, but when laminar nectaries are present they are submarginal glands that are associated with minor veins of the abaxial surface and never occur proximal to the lateral leaf veins (#89, 6). Passiflora lancifolia and P . macfadyenii form a clade with 66% bootstrap support. Passiflora lancifolia and P . macfadyenii are both Jamaican endemics and possess the following synapomorphies: sepals that are greatly elongated (21.06-24.13 mm) (#5, 3), long staminal filaments (commonly greater than 6 mm)(#13, 0), no inner coronal filaments or a very reduced inner corona (0-10 fila ments)(#10, 6), an erect lim en (#73, 1), a distinctly sulcate floral nectary floor (#71, 1), and bright red flowers (#49, 4; #53, 4). Passiflora lancifolia is unique in having the widest floral nectary in the supersection (2.08-3.00 mm)( #17, 3). It is also defi ned by its long pedicel (> 20 mm)(#1, 2), wide hypanthium (8.34-10. 31 mm)(#4, 1), connate inner and outer coronal filaments (#55, 1; #58, 1), ta ll limen (commonly 0.44-1.10 mm)(#22, 1), ellipsoid ovary (#65, 0), and shallow leaf lobes (quotient, i.e. , distance from the leaf outline to the sinus margin/distance from the leaf outline to the leaf base, commonly 0.05-0.15)(#34, 1). Passiflora macfadyenii bears flowers in pairs at

PAGE 135

113 the nodes as well as in inflorescences present as condensed terminal shoots with aborted laminas (#40, 1). It is also distinguished by its fused sepals (#48, 1), outer coronal filaments that are adnat e to the sepals (#51, 1), inner coronal filaments that, when present, are very shor t (< 1 mm) (#11, 3), an ovary that is conspicuously and densely pubescent with l ong hairs (#67, 2), very long fusiform fruits (> 25 mm)(#24, 1), seeds that are at least twice as long as they are wide (#28, 2), long central leaf veins (comm only 31-41 mm)(#29, 2), and a central leaf lobe that is narrowed at the base (#86, 2). Passiflora tridactylites is positioned as more closely related to P . lancifolia and P . macfadyenii than it is to other taxa that comprise the P . suberosa complex s . l . Passiflora lancifolia , P . macfadyenii , and P . tridactylites possess staminal filaments t hat are commonly less than half the length of the androgy nophore (#19, 2), long pedicels (commonly 16-40 mm)(#1, 1), fusiform ovaries (with a reversal to ellipsoid ovaries in P . lancifolia )(#65, 2), and a leaf base that is not cordate (#87, 1). Passiflora tridactylites is defined by its very long inner coronal filaments (commonly 3-4 mm)(#11, 1) and seed with the micropyla r end and chalazal beak erect and not inclined toward the raphe (#95, 1). Relatively short staminal filaments (<3.5 mm)(#13, 2) unite Passiflora tenuiloba , P . pallida , and P . suberosa ssp. litoralis . Passiflora pallida and P . tenuiloba are placed as sister species and have very narrow floral nectaries (commonly <0.5 mm in diameter)(#17, 0). Passiflora pallida is distinctive in having the narrowe st hypanthium in the supersection (commonly 3.34-4.00 mm)(#4, 3), very s hort inner coronal filaments (commonly <1.5 mm)(#11, 3) and capitate to obconi cal petiolar nectar ies (#80, 0/1).

PAGE 136

114 Passiflora tenuiloba is defined by its very short central leaf vein as compared to its leaf width (quotient, i.e., central vein length/leaf width, commonly ranging from 0.64-0.22)(#32, 3), very wide angle betw een the lateral leaf veins (145-343 degrees)(#33, 3) and often very long latera l lobes as compared to the central lobe (quotient, i.e., lateral vein length/c entral vein length, commonly ranging from 3.35-7.75)(#31, 3). In addition, this species has between 35 and 50 coronal filaments in its outer and inner coronal rows (#7, 1/2; #10, 1), a floral nectary floor that is sulcate (#71, 1), seeds that are between 4 and 5 mm long (#26, 1) and narrower than they are long (quotient, i.e., seed length/seed width, commonly ranging from 1.94-2.93)(#28, 2), and coriaceous leaves (#81, 2) with a short central vein (commonly 5.74-18.50 mm)(#29, 3). Passiflora suberosa ssp. litoralis commonly possesses three leaf lobes ( only very rarely having unlobed or bilobed leaves)(#84, 4). The remaining members of the supersection ( Passiflora clypeophylla , P . juliana , P . viridiflora , P . megacoriacea , P . mcvaughiana , P . xiikzodz , P . itzensis , P . sexocellata , P . coriacea , P . tacana , P . obtusifolia , P . eglandulosa , and P . trinifolia ) are defined by their widely divergi ng lateral lobes (the angle between the lateral leaf veins is between 115 and 165 degrees) (#33, 2), central leaf veins that are between half to three quarters the width of the leaves (#32, 1), and discoid petiolar nectaries (#80, 3). Passiflora eglandulosa and P . trinifolia are placed as sister species and possess wide fo liose stipules (#39, 1; #90, 2) and seeds with the micropylar end and chalaz al beak erect and not inclined toward the raphe (#95, 1). Passiflora trinifolia is unique in having a very reduced limen

PAGE 137

115 (0.13-0.14 mm in height)(#22, 3) that is greenish yellow with reddish purple spots and streaks (#74, 3) and leaves that are sclerophyllous (#81, 3). It is also distinguished by its short central (16-40 mm)(#29, 2) and lateral (14-31 mm)(#30, 1) leaf veins. The flowers of P . trinifolia possess a short floral stipe (1.8-3.4 mm)(#2, 0), 35-40 outer (#7, 2) and 38-47 inner (#10, 1) cor onal filaments, an androgynophore with a flush of red/purple pi gmentation toward the base (#59, 1), and an erect limen (#73, 1). Passiflora eglandulosa possesses flowers with long pedicels (commonly 11.35-18.00 mm)(#1, 1) , spurs that occur between each of the sepals (#43, 1), very short inner co ronal filaments (0.66-1.50 mm)(#11, 3), narrow limen floors (1.57-2.13 mm)(#23, 1), short staminal filaments (2.13-3.67 mm)(#13, 2), ellipsoid ovar ies (#65, 0), and anthers that present pollen laterally (#63, 1). Its seeds are gr eater than 5 mm in length (#26, 0/1) and 3 mm in width (#27, 1) with weakly developed chalazal beaks (#96, 1). Las tly, as its name implies, P . eglandulosa lacks laminar (#89, 6), and petiolar nectaries (#36, 3). Passiflora clypeophylla is sister to the remaining species in the supersection ( P . juliana , P . viridiflora , P . megacoriacea , P . mcvaughiana , P . xiikzodz , P . itzensis , P . sexocellata , P . coriacea , P . tacana , and P . obtusifolia ). All of the species in this larger terminal clade have coriaceous leaves (#81, 2) commonly peltate (#82, 1; #83, 2), rarely cordat e (#87, 1) and possess laminar nectaries (#37, 1). Passiflora clypeophylla has flowers with long pedicels (16.8-17.3 mm)(#1, 1) and stipes (9.4-14.3 mm)(#2, 2), coronal filament s with flushes of red/purple pigmentation toward s their bases (#53, 2; # 56, 2) and outer coronal filaments that are moderately long (5.0-5.5 mm)(#8, 3). In addition, P .

PAGE 138

116 clypeophylla has some of the shallowest leaf lobes in the supersection (quotient, i.e., distance from the leaf outline to t he sinus margin/distance from the leaf outline to the leaf base, commonly 0.03-0.07)(#34, 1). Passiflora obtusifolia is positioned as the sister of the remaining species in the supersection ( P . juliana , P . viridiflora , P . megacoriacea , P . mcvaughiana , P . xiikzodz , P . itzensis , P . sexocellata , P . coriacea , and P . tacana ). All of the species in this group possess conspicuous inflorescences present as condensed terminal shoots with aborted laminas (#40, 1) and an average of over 40 filaments in their inner coronal rows (#10, 1). Passiflora obtusifolia possesses short sepals (<7 mm)(#5, 2), inner cor onal filaments that are nearly equal in length to the outer coronal f ilaments (quotient, i.e., length of filaments in the outer row/length of filaments in the inner ro w, commonly ranging from 0.67-0.87)(#12, 2), outer coronal filaments that are s lightly capitate (#54, 1), and petiolar nectaries that are positioned on the upper half of the petiole (#36, 1). The remaining taxa in this analysis occur in two major clades. With the exception of two taxa ( P . megacoriacea and P. obtusifolia ) all of the species that have been separated out of the P . coriacea complex ( Passiflora tacana , P . mcvaughiana , P . itzensis , P . xiikzodz , P . sexocellata , and P . coriacea s . s .) form one major clade. The second major clade consists of P . juliana and P . viridiflora , along with P . megacoriacea . These two major groups form one larger clade that is delimited by the follo wing synapomorphies: more than 40 filaments in the outer coronal row (#7, 1), e llipsoid ovaries (#65, 0), se eds that are more than 3.8

PAGE 139

117 mm in length (#26, 1), and the presence of more than four laminar nectaries (#37, 0). Positioned basally to P . viridiflora and P . juliana is P . megacoriacea . All three species possess tall limens (commonl y 0.75-1.14)(#22, 1), long opercula (commonly 2.0-4.0 mm)( #20, 2), and long ovaries (> 2.5 mm)(#16, 0). Passiflora juliana and P . viridiflora are sister species in this analysis, and aside from adaptations in P . viridiflora resulting from a shift in pollinators, these two species with greenish yellow flowers from the Pacific coast and coastal plain of southwestern Mxico are very similar v egetatively with leaves that have a central lobe which is distinctly narro wed at the base (#86, 2). Passiflora juliana possesses a very short floral stipe (the s hortest in the supersection)(#2, 0), a limen floor that is distinctly purpl e (#75, 2) and an androgynophore flushed with purple at the base to just above the middle (#59, 2), m oderately long outer coronal filaments (commonly 3.13-3.69 mm)(#8, 2/3), and large (9.44-14.81 mm long and 3.81-9.31 mm wide)(#38, 2; #39, 1) foliose stipules (#90, 2). Passiflora viridiflora differs from P . juliana in its adaptations for hummingbird pollination: a greatly elongated androgynophor e (17.40-26.10 mm)(#18, 3) that far exceeds the length of the stamen filaments (q uotient, i.e., st amen filament length/androgynophore length, commonly r anging from 0.16-0.20)(#19, 3), no inner coronal filaments (#10, 6; #11, 4; #12; 3; #50, 2), very narrow limen floor (commonly 0.63-2.07 mm)(#23, 1), wide floral nectary (commonly 1.30-1.82 mm)(#17, 2), long operculum (3 .00-4.60 mm)(#20, 1) that is not incurved at the margin but erect and lies against the androgy nophore, fused sepals (#48, 1) that

PAGE 140

118 are greatly elongat ed (16.88-32.00 mm long and ca. 7.5 times longer than they are wide)(#5, 3; #6, 2) and much l onger than the outer coronal filaments (quotient, i.e., length of filaments in the outer row/sepal length, commonly ranging from 0.09-0.21)(#9, 3), outer coronal filaments that ar e connate (#55, 1) and adnate to the sepals (#51, 1), pollen t hat is presented laterally (#63, 1), a sulcate floral nectary floor (#71, 1), and a limen that is not recurved but inclined toward the operculum (#73, 1). Passiflora viridiflora also possesses fruits that are widely ovoid with a conical tip (#76, 4). Passiflora megacoriacea is distinctive based upon its wide hypanthium (comm only 8.9-12.5 mm)(#4, 0/1) and limen floor (commonly 5.0-7.0 mm)(#23, 2) , elongated androgynophore (commonly 7.38.0 mm long)(#18, 0), staminal filam ents that are generally less than half the length of the androgynophore ( #19, 2), 30 to 40 outer cor onal filaments (#7, 2) that are between 7.7 and 10.3 mm in length (#8, 1) and somewhat dilated toward the apex (#54, 1), floral nectary with a raised annulus (#70, 1), petiolar nectaries that are most commonly on the upper half of the petiole (#36, 1), and seeds that are about 5.0 mm long (#26, 0) and 3.0 mm wide (#27, 1). The clade containing most of the s pecies that have, in the past, been separated out of P . coriacea possess the following synapomorphies: transversely elliptic leaves (#85, 2) with short central leaf veins as compared to the leaf widths (quotient, i.e., central vein length/leaf width, commonly ranging from 0.19-0.44)(#32, 2), very shallow leaf lobes (quotien t, i.e., distance from the leaf outline to the sinus margin/distance from the leaf outline to the leaf base, commonly ranging from 0.02-0.20)(#34, 1) , and lateral veins that are much

PAGE 141

119 longer than the central veins (quotient, i.e. , lateral vein length/central vein length, commonly ranging from 1.0-3.0)(#31, 2). Passiflora tacana , known from only one fruiting herbarium specimen, is found on Volcn Tacan in a high mesophytic forest in southern Mxico. It has no la minar nectaries (#37, 2), wide seeds (2.83.1 mm)(#27, 1), foliose stipules (#90, 2) that are 6.3-7.5 mm long (#38, 2) and 2.5-3.5 mm wide (#39, 1), nonpeltate leaves (#83, 0) and seeds with a chalazal beak that is not welldeveloped (#96, 1). Passiflora coriacea , occurring in tropical moist forests of Colombia, Ecuador, Peru, Bolivia, and Venezuela, is the sister taxon to a clade containing P . sexocellata , P . mcvaughiana , P . itzensis , and P . xiikzodz . These five species commonly possess bilobed leaves (#84, 2) with central veins that are frequently betw een 14.1 and 45.6 mm (fro m the point of petiole insertion to the c entral lobe apex)(#29, 2). Passiflora coriacea has a long stipe as compared to its pedicel (quoti ent, i.e., stipe length/pedicel length, ranging from 0.77-2.85)(#3, 1), seeds that are between 3.6 and 3.8 mm long (#26, 2), and a dark reddish purple operculum (#69, 2). Passiflora sexocellata , a species found primarily in low, moist fore sts from eastern Mxico to Nicaragua, is sister to P . xiikzodz , P . itzensis , and P . mcvaughiana . These four species possess outer coronal filam ents that are commonly great er than 5 mm in length (#8, 2) and limens that are absent ( P . xiikzodz and P . itzensis ) or not recurved ( P . mcvaughiana and P . sexocellata )(#73, 1). Passiflora sexocellata possesses staminal filaments that are comm only half the length of the androgynophore (quotient, i.e., filament length/and rogynophore length, r anging from 0.410.71)(#19, 2), between 29 and 30 inner co ronal filaments (#10, 2), and a

PAGE 142

120 greenish yellow operculum with a flush of dark red at the base (#69, 1). Passiflora mcvaughiana , a species occurring in high pine-oak forests of southwestern Mxico, is sister to P . xiikzodz and P . itzensis . These three species possess fruits that are betw een 10 and 15 mm wide (#25, 2), seeds that are generally greater than 5 mm in length ( #26, 0), and petiolar ne ctaries that are positioned on the upper half of the petiole (#36, 1). Passiflora mcvaughiana is distinctive because it possesses styles t hat are pale greenish yellow with reddish purple spots and streaks (#60, 2). It comm only lacks inflorescences (#40, 0), has between 31 and 36 outer coronal filaments ( #7, 2) that are 3. 5-7.1 mm long (#8, 3), anthers that possess reddish purple marg ins (#62, 0), the widest seeds in the subsection (at least 4 mm in width)(#27, 0), and lacks laminar nectaries (#37, 2; #89, 6). The taxa treated as P . xiikzodz and P . itzensis in this revision are sister species that constitute a well-support ed clade in this analysis (100% bootstrap value). These two taxa are commonl y found in tropical deciduous forests on limestone outcrops in southeastern Mxico , Guatemala, and Belize. They were treated at the subspecific level in MacDougal (1992) and are undoubtedly very closely related. However, the recognition of these ta xa at the specific level seems justified based upon the lar ge number of autapomorphies for P . itzensis . Additionally, cross-pollinations per formed by MacDougal (1992) in the greenhouse between these entities proved unsuccessful. Passiflora xiikzodz and P . itzensis are sister species based upon their dar k red coronal filaments (#53, 4) occurring in seven series (#50, 3), lack of fl oral nectaries (#17, 5; #21, 3), lack of limens (#22, 4; 72, 1), denticulate (#68, 1) , dark reddish purple (#69, 3) opercula

PAGE 143

121 that are between 0.25 and 0.72 mm in length (#20, 5), second coronal rows with filaments that are not capitate or c apitellate (#57, 0), and long stipes as compared to their pedicels (quotient, i. e., stipe length/pedicel length, ranging from 2.3-12.4)(#3, 0). Passiflora itzensis has the following apomorphies: the lack of or presence of a greatly reduced dark reddish purple androgynophore (01.7 mm)(#18, 2; #59, 3), fewer filaments in its outer (22-31 )(#7, 3) and second (20-30)(#10, 2) coronal rows, short styl es (0.81-1.78 mm)(#15, 2), androecium and gynoecium with red pigment ation (#60, 4; #61, 3), and distal presentation of pollen (#63, 2). Passiflora xiikzodz possesses the apomorphies of long outer coronal filaments (commonly 7.63-9. 28 mm)(#8, 1) and a wide limen floor (commonly 5.20-6.13 mm)(#23, 2).

PAGE 144

122 Table 6.1. Characters used in the morphology-based cladistic analysis of Passiflora supersection Cieca . See Chap. 3 for a discussion of state delimitations and codings. 1. Pedicel length (mm) 12.50 (0); 12.51-17.83 (1); 17.84 (2). 2. Stipe length (mm) 2.75 (0); 2.76-8.00 (1); 8.01-14 .00 (2); 14.01-19.00 (3); >19.00 (4). 3. Stipe length/pedicel lengt h (quotient) >2.86 (0); 2.532.86 (1); 0.1 -2.52 (2); 0.14 (3). 4. Hypanthium diameter (mm) >12.00 (0 ); 8.24-12.00 (1); 4.00-8.25 (2); 2.203.99 (3). 5. Sepal length (mm) 15.76-21.00 (0); 7.13-15.75 (1); 4.85-7.12 (2); 21.01-23.28 (3); >23.38 (4). 6. Sepal length/sepal widt h (quotient) 1.33-3.00 (0); 3.01-4.38 (1); >4.39 (2). 7. Number of filam ents in the outer coronal row (number) >60 (0); 41-60 (1); 3140 (2); 21-30 (3); 17-20 (4). 8. Length of filaments in the outer cor onal row (mm) >15.00 (0); 7.67-15.00 (1); 5.87-7.66 (2); 5.00-5.86 (3); 1.22-4.99 (4). 9. Length of filaments in t he inner coronal row/sepal le ngth (quotient) >0.75 (0); 0.35-0.75 (1); 0.25-0.34 (2); 0.09-0.24 (3). 10. Number of filam ents in the inner coronal row (number) >75 (0); 38-75 (1); 1337 (2); 10-12 (3); 5-9 (4); 2-4 (5). 11. Length of filaments in t he inner coronal row (mm) >5 .00 (0); 2.68-5.00 (1); 1.53-2.67 (2); 0.75-1.52 (3); 0 (4). 12. Length of filaments in t he inner coronal row/length of filaments in the outer coronal row (quotient) 0.15-0.36 (0 ); 0.37-0.73 (1); >0.73 (2). 13. Length of staminal filam ents (mm) >5.63 (0); 3.345.62 (1); 1.10-3.33 (2). 14. Anther length (mm) 1. 00-3.50 (0); >3.50 (1). 15. Style length (mm) >6.00 (0); 2.00-6.00 (1); 0.81-1.99 (2). 16. Ovary length (mm) >2.54 (0); 1.06-2.54 (1). 17. Nectary width (mm) 0.30-0.59 (0); 0.601.22 (1); 1.23-2.00 (2 ); 2.01-3.54 (3); >3.54 (4). 18. Androgynophore length (mm) 5.95-14.13 (0 ); 1.68-5.94 (1); 01.67 (2); >14.13 (3). 19. Length of staminal f ilament/androgynophore length ( quotient) 0.69-0.92 (0); >0.92 (1); 0.25-0.68 (2 ); 0.13-0.24 (3). 20. Operculum length (mm) >4.79 (0); 3.004.79 (1); 1.87-2.99 (2); 1.28-1.86 (3); 0.73-1.27 (4); 0.29-0.72 (5). 21. Nectary height (mm) >2.62 (0); 0.86-2.62 (1); 0.05-0.85 (2). 22. Limen height (mm) >1.8 (0); 0.47-1.8 (1); 0.150.46 (2); 0.10-0.14 (3). 23. Limen floor diameter (mm) 2.14-5.00 (0); 0.63-2.13 (1); 5.01-8.5 (2); >8.5 (3). 24. Fruit length (mm) >30.00 (0); 25.0030.00 (1); 17.14-24.99 (2); 9.10-17.13 (3). 25. Fruit width (mm) >30.00 (0); 15-30 (1); 6-14 (2). 26. Seed length (mm) >4.88 (0); 3.95-4.88 (1); 2.67-3.94 (2).

PAGE 145

123 Table 6.1. Cont. 27. Seed width (mm) >3.63 (0 ); 2.89-3.63 (1); 1.81-2. 88 (2); 1.53-1.80 (3). 28. Seed length/seed width ( quotient) 1.21-1.42 (0); 1.431.82 (1); >1.82 (2). 29. Central vein length (mm) >116.00 ; 44.00-116.00 (1); 19.00-43.00 (2); 3.0018.00 (3). 30. Lateral vein length (mm) 0 (0); 8.0028.00 (1); 29.00-84.50 (2); >84.50 (3). 31. Lateral vein length/centra l vein length (quotient) 0 (0 ); 0.31-1.02 (1 ); 1.03-2.97 (2); >2.97 (3). 32. Central leaf vein/leaf width (quotient) >0.77 (0); 0.54-0.77 (1); 0.17-0.53 (2); 0.04-0.16 (3). 33. Angle between primary lateral vein s (degrees) 48.00-57.00 (0); 58.00-114.50 (1); 114.51-162.00 (2); >162.00 (3). 34. Leaf lobe depth (quotient: distance from leaf outline to margin of sinus/distance from leaf outline to l eaf base) not lobed (0); 0.02-0.11 (1); >0.11 (2). 35. Degree peltate (distance from point of petiolar insertion to leaf base)(mm) not peltate (0); 0.34-2.12 (1); 2.13-7.83 (2); >7.83 (3). 36. Position of petiolar nectary (quoti ent: distance from petiolar base to nectary/petiole length) 0.12-0. 50 (0); 0.51-0.84 (1); >0.9 0 (2); no nectaries (3). 37. Number of laminar nectaries (number) >3 (0 ); 1-3 (1); 0 (2). 38. Stipule length (mm) 0.47-0.91 (0); 0.92-6.38 (1 ); >6.38 (2). 39. Stipule width (mm) 0.09 -1.38 (0); >2.5 (1). 40. Inflorescences not present (0); inflorescences present as condensed shoots with aborted laminas (1). 41. True peduncles branching off of tendr il (0); true peduncles present but not branching off of tendril (1); true peduncles absent (2). 42. Three floral bracts present (0); 0-2 floral bracts (1). 43. Spur absent (0); spur present (1). 44. Flowers actinomorphic (0); flowers zygomorphic (1). 45. Petals present and half to three quar ters the length of the sepals; petals present and less than half the length of the sepals (1); petals absent (2). 46. Petals not fused (0); petals fused (1). 47. Petals greenish white (0); petals greenish yellow (1); petals white (2); petals yellow (3); petals red (4). 48. Sepals not fused (0); sepals fused (1). 49. Sepals greenish white (0); sepals white (1); sepals greenish yellow (2); sepals yellow (3); sepals red (4). 50. Three coronal rows present (0); two coronal rows present (1); one coronal row present (2); seven coronal rows present (3). 51. Outer corona not adnate to perianth (0); outer corona adnate to perianth (1). 52. Outer coronal filaments linear (0); outer coronal filaments distinctly tapering to a point toward apex (1); linear/capita te (2); fused into a tube (3).

PAGE 146

124 Table 6.1. Cont. 53. Outer coronal filaments without red/ purple pigmentation (0); outer coronal filaments with a flush of red/purple pigmentation at base (1); outer coronal filaments with evident red/ purple pigmentation (2); outer coronal filaments with band of red/purple pigmentation (3 ); outer coronal filaments with conspicuous red/purpl e pigmentation (4). 54. Outer coronal filaments not distinctly capitellate, capitate or dilated toward apex (0); outer coronal filaments distinct ly capitellate, capitate or dilated toward apex (1). 55. Outer coronal filaments not connate (0 ); outer coronal filaments connate (1). 56. Inner coronal filament s without red/purple pigmentat ion (0); inner coronal filaments with a flush of red/purple pigmentation at base (1); inner coronal filaments with evident red/ purple pigmentation (2); inner coronal filaments with conspicuous red/pur ple pigmentation (3). 57. Inner coronal filaments not distinctly capitellate, c apitate or dilated toward apex (0); inner coronal fila ments distinctly capitellate, capitate or dilated toward apex (1). 58. Inner coronal filaments not connate (0 ); inner coronal filaments connate (1). 59. Androgynophore without red/purple pigmentation (0 ); androgynophore with a flush of red/purple pigmentation at base (1); androgynophore with evident red/purple pigmentation (2); andr ogynophore with conspicuous red/purple pigmentation (3). 60. Styles greenish yellow (0); styles very pale greenish yellow (1); styles pale greenish yellow with purplish sp ots and streaks (2); styles red (3); styles very dark reddish purple (4). 61. Staminal filaments greenish yellow (0); staminal filaments pale greenish yellow with pink streaks at the base (1); staminal fila ments red (2); staminal filaments very dark reddish purple (3). 62. Anthers with red/purpl e pigmentation (0); anthers lacking red/purple pigmentation (1). 63. Presentation of pollen subproximal to proximal (0); presentation of pollen lateral (1); presentation of pollen distal (2). 64. Pollen yellow (0); pollen whitish (1). 65. Ovary ellipsoid (0); ovary gl obose (1); ovary fusiform (2). 66. Ovary not edged (0); ovary edged (1). 67. Ovary glabrous (0); ovary with appress ed, small, curved trichomes (1); ovary pubescent with dense long unicellular or multicellular hairs (2). 68. Operculum plicate (0); operculum denticulate (1). 69. Operculum without red/ purple pigmentation (0); operculum with a flush of red/purple pigmentation at base (1); operculum with evident red/purple pigmentation (2); operculum with cons picuous red/purple pigmentation (3). 70. Nectary without raised annulus (0 ); nectary with raised annulus (1). 71. Nectary floor not sulcate (0); nectary floor sulcate (1). 72. Limen present (0); limen absent (1). 73. Limen recurved (0); limen erect or inclined toward operculum (1).

PAGE 147

125 Table 6.1. Cont. 74. Limen whitish (0); limen yellow (1); limen greenish yellow (2); limen greenish yellow with reddish purple spots and streaks (3); lim en greenish yellow with a yellowish red tip (4); limen greenish yellow with a reddish purple tip (5); limen greenish yellow with purplish tip (6); limen bright reddi sh purple (7); limen red (8); limen very dark reddish purple (9). 75. Limen floor without red/pur ple pigmentation (0); floor with a flush of red/purple pigmentation at base (1); floor with evident red/purpl e pigmentation (2); floor with conspicuous red/pur ple pigmentation (3). 76. Fruits globose (0); fruits subglobose to widely ellipsoid (1); fruits ellipsoid (2); fruits ovoid (3); fruits ovoid with conica l tip (4); fruits fu siform-ellipsoid (5). 77. Fruits indehiscent (0); fruits dehiscent (1). 78. New growth straight (0); new growth cernuous (1). 79. Nine petiolar nectaries present (0); ei ght petiolar nectaries present (1); seven petiolar nectaries present (2 ); six petiolar nectaries present (3); five petiolar nectaries present (4); three petiolar nectaries present (5); two petiolar nectaries present (6); one petiolar necta ry present (7); no petiolar nectaries present (8). 80. Petiolar nectaries capitate (0); pet iolar nectaries obconical (1); petiolar nectaries cupulate (2); petiolar nectar ies discoid (3); petiolar nectaries auriculate (4). 81. Leaves membranous (0); leaves chartaceous (1); leaves coriaceous (2); leaves sclerophyllous (3). 82. Leaves not peltate (0); leaves peltate (1). 83. Leaf venation with primar y veins diverging and branch ing at base (0); leaf venation with secondary veins forming a seri es of loops (1); leaf venation with primary veins diverging and branching above base (2). 84. Leaves unlobed (0); leaves bilobed (1); leaves bilobed and rarely trilobed (2); leaves trilobed (3); leaves trilobed and rarely unlobed or bilobed (4). 85. Leaves ovate (0); leaves obovate (1); leaves transversely elliptic (2); leaves elliptic to circular (3). 86. Leaves unlobed (0); leaves with the cent ral lobe not narrowed at the base (1); leaves with the central lobe narrowed at the base (2). 87. Leaf base cordate (0); l eaf base not cordate (1). 88. Leaf margin with 1-2 teeth or glandular denticulate at the leaf base (0); leaf margin entire (1). 89. Laminar nectaries marginal (0); la minar nectaries submarginal, associated with minor veins of the abaxial surface and with several nectaries proximal to the lateral lobes (1); laminar nectaries submarginal and associated with minor veins of the abaxial surface (2), laminar nectaries present as ocellae between the central and lateral veins and with severa l nectaries proximal to the lateral lobes (3); laminar nectaries present as ocellae between the central and lateral veins (4); laminar nectary present at the very apex of the central vein (5); no laminar nectaries present (6). 90. Stipules narrowly ovate (0); stipules ovate auriculate (1); stipules ovate (2).

PAGE 148

126 Table 6.1. Cont. 91. Stem terete or subterete (0); stem angled (1); stem 3-carinate (2). 92. Plants without hooked trichomes (0); plants wit h hooked trichomes (1). 93. Two prophylls present (0); one present (1). 94. Seeds punctate-reticulate (0 ); seeds grooved-sulcate (1). 95. Seeds with the chalazal beak inclined aw ay from the raphe (0); chalazal beak erect (1); chalazal beak inclined toward the raphe (2). 96. Chalazal beak well developed (0); chalazal beak poorly developed (1). 97. Plants possessing C-glycosylflavones and lacking 3-O-glycosylflavonoids (0); plants lacking C-glycosylflavones and posse ssing 3-O-glycosylflavonoids (1). 98. Chromosome number 2n = 18 (0); chromosome number 2n = 12 (1); chromosome number 2n = 24.

PAGE 149

127 Table 6.2. Character values for taxa used in the morphological cladistic analysis of Passiflora supersection Cieca . A = 0/1; B = 0/2; C = 0/3; D = 0/1/2; E = 0/1/2/3; F = 0/1/2/4; G = 0/1/3; H = 1/2; I = 1/2/3; J = 1/3; K = 1/6; L = 2/3; M = 2/4; N = 2/5; O = 2/5/8/9; P = 2/ 6; Q = 3/4; R = 3/4/5; S = 3/6; T = 4/6; U = 5/ 6; V = 5/6/7; W = 6/7; X = 6/7/8; Y = 6/8; ? = condition unknown.

PAGE 150

128 Figure 6.1. The single most parsimonious tree from the morphological data set of Passiflora supersection Cieca . Numbers above branches are branch lengths. Bootstrap values are given below corre sponding branches. Tree length=548; CI=0.429; RI=0.526; RC=0.226; HI=0.571; G-fit=-48.398.

PAGE 151

129 Figure 6.2. The single most parsimonious tree from the morphological data set of Passiflora supersection Cieca . The numbers beside the branches and symbols on the branches indicate c haracter changes. Tree length=548; CI=0.429; RI=0.526; RC=0.226; HI=0.571; G-fit=-48.398.

PAGE 152

130 CHAPTER 7 DISCUSSION The morphological and molecular analyses presented here confirm the monophyly of Passiflora supersection Cieca . In addition, both phenetic and cladistic analyses have increased our understanding of some of the complex biological issues influencing the evolut ion of the group. A revision of the supersection, which inco rporates information from both the morphological and molecular phylogenetic hypotheses, is presented in Chapter 8. Separate or Combined Analyses: A Comparison of the Molecular and Morphological Cladistic Analyses Congruence between phylogenetic hypothes es generated from independent data sets, when subjected to reliable meth ods of phylogenetic analysis, is often thought to be evidence for considering thos e hypotheses as representative of the "true" phylogeny. Conflict may indicate t heoretical or procedural problems in one or both of the analyses, or that additional data are needed to resolve the phylogenetic relationships in question ( Hillis, 1987). There is a considerable amount of incongruence between the mo lecular and morphological phylogenies for Passiflora supersection Cieca presented in previous c hapters. Sample size has likely had an influence on this incongr uity. For the morphological data set, specimens for all the species of t he supersection from throughout their geographic ranges were carefully measur ed and examined in order to determine the extent of variation of the characters. However, such a large sample size in

PAGE 153

131 the molecular study was not feasible due to limited sample availability and expense of analysis. There were also several polymorphic sites evident in the ITS sequences for several of the species within supersection Cieca , further increasing the need for more infraspecific sampling. Most importantly, the complex evolutionary history (involving hy bridization and polyploidy) of several of the entities within the gr oup has undoubtedly had a significant effect on both data sets, increasing the amount of incongruity in the analyses. In an attempt to overcome the difference in sample sizes between the morphological and molecular data sets, additional cladistic analyses were undertaken in which the operational taxonomic units were reduced to those for which both molecular and morphological dat a were available. Separate analyses of the reduced morphological and molecu lar data sets resulted in the production of four equally parsimonious trees t hat were 224 steps long and 1,638 equally parsimonious trees that were 332 steps in length, respectively. The consensus trees from both of thes e analyses were compared and were conspicuously incongruent in their topologies. In additi on, there were significant changes in the resulting phylogenies, as compared to the original analyses, that were likely due to decreased (and likely inadequate) ta xon sampling. I have chosen not to combine my morphological and molecular data sets because of this incongruence and the knowledge that comp lex biological processes are likely influencing the pattern of diversity within Passiflora supersection Cieca . On a more positive note, the phylogenetic hypotheses based on the morphological and molecular dat a sets for supersection Cieca agree in several

PAGE 154

132 respects. In the molecular analysis, t here is evidence for the monophyly of P. pallida (95% bootstrap), P. lancifolia (87% bootstrap), P. tenuiloba (100% bootstrap), P. sexocellata (93% bootstrap), P. viridiflora (96% bootstrap), P. juliana (100% bootstrap), P. obtusifolia (50% bootstrap), and P. mcvaughiana (84% bootstrap) (Fig. 4.1-4. 4). In the morphologica l analysis, each of these species is also diagnosable by unique comb inations of character states (Fig. 6.16.2). The molecular and morphological analyses also agree in their support for the monophyly of a clade containing P. itzensis and P. xiikzodz and a clade composed of P. juliana and P. viridiflora . The sister-group relationship between P. xiikzodz and P. itzensis is highly supported in both the molecular (90%) and morphological (100%) trees. In the morphological analysis P. xiikzodz and P. itzensis are diagnosable by a number of morphological characters. In additi on, crossing studies by MacDougal (1992) suggest that these species are unable to interbreed, whereas fruits with viable seeds were easily produc ed between two clones of P. xiikzodz ( MacDougal 4690 and MacDougal 4677 ). However, though the two species are separated from one another in the strict consensus tree in the molecular analysis, there is no bootstrap support for either of the species-level clades. Despite the lack of statistical support for P. itzensis and P. xiikzodz as cladospecies in the molecular analysis, I have elevated P. xiikzodz ssp. itzensis and P. xiikzodz ssp. xiikzodz to the rank of species based on their consistent differences in floral morphology. The way in which P. itzensis displays its pollen is dramatic ally different from that of P. xiikzodz , indicating a shift in pollinators. Thus, P. xiikzodz and P. itzensis

PAGE 155

133 are considered sibling species, which do not appear to be able to interbreed and possess consistent and easily observed di agnostic morphological characters. Both the molecular and morphological data support the monophyly of a clade containing P. juliana and P. viridiflora ; each is considered a cladospecies, and together they compose a moderately s upported (77%) clade in the molecular analysis. In his original description of P. juliana , MacDougal (1992) discussed its similarities with P. viridiflora , and both species are found in similar habitats along the Pacific coast and in the Pacific coasta l plain of southwestern Mxico. The primary differences between these two spec ies are the shape of the stipules and several changes in floral and vegetative morphology associated with a shift in pollinators (hymenopteran to hummingbird polli nation). Again, each of these two species is well-supported with bootstr ap values greater than 95% in the molecular analysis and are morphol ogically diagnosable cladospecies. The phylogeny based on the molecular data is different from that based on the morphological data in many ways (c ompare figs. 4.1-4.4 and 6.1-6.2). Passiflora mcvaughiana is most closely related to P. juliana and P. viridiflora in the DNA-based trees. In t he morphological analysis, P. mcvaughiana is in a clade with P. itzensis , P. xiikzodz , P. sexocellata , P. coriacea , and P. tacana because they all possess bilobed or shallo wly trilobed, transversely elliptic leaves and very similar flowers, especially in the case of P. coriacea and P. sexocellata . Passiflora obtusifolia is sister to the clade containing P. itzensis , P. xiikzodz , P. mcvaughiana , P. juliana , and P. viridiflora in the molecular cladogram. However, in the morphological analysis, P. obtusifolia is sister to all of the species listed

PAGE 156

134 above ( P. itzensis , P. xiikzodz , P. mcvaughiana , P. juliana , and P. viridiflora ) plus P. megacoriacea , P. sexocellata , P. coriacea , and P. tacana. Passiflora coriacea , P. sexocellata , and P. tenuiloba form a clade in the molecular analysis. In the morphological analysis, P. tenuiloba is most closely related to P. pallida , a species that also occurs in southweste rn Texas and northeastern Mxico. In the molecular analysis, P. coriacea is sister to P. sexocellata and they form a monophyletic group. In t he morphological analysis P. coriacea is also sister to P. sexocellata , but they are in a clade with P. mcvaughiana , P. xiikzodz , and P. itzensis . Based upon the molecular data, Passiflora lancifolia is sister to P. suberosa ssp. suberosa but is more closely related to P. macfadyenii , P. pallida , and P. suberosa ssp. litoralis in the morphological anal ysis. In the molecular analysis P. pallida is sister to all of the member s of the superse ction, whereas P. suberosa ssp. suberosa is positioned as sister to the other taxa in the morphological analysis (see fi gs. 4.1-4.4 and 6.1-6.2). Clearly, additional molecular data from more variable gene regions are needed to help resolve phylogenetic relationships in Passiflora supersection Cieca . Several gene regions were sequenced in an attempt to attain independent sets of molecular information, but none proved vari able enough to resolve the phylogeny ( trn Ltrn F, cytosolic-expressed glutamine synthetase, G3pdh , psb Atrn H). The only region that pr oved promising was waxy (granule-bound starch synthase), but up to seven copies of the gene are f ound within diploid individuals from the supersection and my preliminary result s could not be interpreted without extensive and additional sampling (see Appendix).

PAGE 157

135 The Passiflora coriacea Complex Jussieu described P. coriacea in 1805 from a specimen collected in Colombia by Bonpland. Shortly afterward seve ral authors (e.g., Smith 1814 and Kunth 1817) described additional species based upon characters of the leaves ( P. clypeata Sm. and P. difformis Kunth). However, their de scriptions seem to give only an account of the vegetative variat ion within different populations of P. coriacea Juss. in Colombia. Schlechtendal (1854) described P. sexocellata and differentiated it from both P. coriacea and P. difformis based primarily upon the vegetative morphology of the species (because the flowers of P. coriacea were largely unknown), but his careful descripti on of the flowers of his new species differed markedly from those in Kunth's brief description of P. difformis (for further information please see discussion of P. sexocellata in Chapter 8). In his revision of the American species of Passifloraceae, Killip (1938) listed all of the species discussed above plus several others ( P. obtusifolia and P. cheiroptera Corts) in synonomy under P. coriacea . However, since that revision, MacDougal (1992, 2001) has described two new species, P. xiikzodz and P. mcvaughiana , and resurrected one previously described species, P. obtusifolia , that were reported from southwestern Mxico under the name P. coriacea . In addition, both the phenetic and cladistic analyses based upon both molecular and morphological data presented here support the recogni tion of three distinct taxa: P. coriacea , P. sexocellata , and P. megacoriacea. The multivariate statistical analysis of the quantitative morphological characters for P. coriacea s.l. produced a plotting pattern that clearly supports the delimitation of the previously undescribed species P. megacoriacea , but it is

PAGE 158

136 not until an analysis of the floral c haracters alone was undertaken that P. coriacea and P. sexocellata became phenetically separabl e. Neighbor joining analyses of both the qualitative and quantit ative morphological characters also support the recognition of these three taxa, with only two accessions representing P. sexocellata (from Belize and Mxico) appearing more similar to P. megacoriacea than to other members of P. sexocellata from Mxico and Central America. The morphological cladistic analysis of the supersection suggests that P. sexocellata and P. coriacea evolved from a common ancestor, but that P. megacoriacea is more closely related to P. juliana and P. viridiflora . Passiflora megacoriacea is placed with these species primarily based upon characters relating to an increase in flow er size (ovary size, operculum length, etc.) that might be a ttributed to independent shifts to larger pollinators. However, vegetative and reproductive characters othe r than those relating to overall flower size (e.g., the shape of the flowers with an erect outer corona that is bent toward the androgynophore, leaf shape, etc.) in P. megacoriacea suggest a closer relationship with P. coriacea and P. sexocellata . Unfortunately, I was unable to obtain material of P. megacoriacea for DNA sequencing, and a molecular analysis that includes P. megacoriacea is needed and will likely settle the issue. Nevertheless, it is clear in the mole cular and morphological cladistic analyses that P. coriacea and P. sexocellata are sister to each ot her (with a bootstrap value of 100% in the DNA-based tr ee) and are both clearly diagnosable cladospecies, and it is also likely that P. megacoriacea is closely related to these two taxa.

PAGE 159

137 The Passiflora suberosa Complex The oldest herbarium specimens that I have seen of any of the members of the P. suberosa complex were collected in the 1700s, and since that time plant collectors have deposited thous ands of specimens of P. suberosa s.l. (3,244 of which I annotated) in her baria around the world. Linnaeus (1745, 1753) originally described four species that have, over the years, been considered to be part of (at specific and/or subspecific levels) the P. suberosa complex. Since that time, various systematists engaged in revising the genus and family have described new species (e.g., Cavanilles 1790; Hooker 1867), varieties and subvarieties (e.g., Roemer 1846; Masters 1872) or lumped various entities under one species name (Killip 1938). In his revision of the American species of Passifloraceae, Killip (1938) recognized P. suberosa in the widest sense and considered the various species, subspecies, and varietie s falling within this species to be too intergrading and indistinct to merit tax onomic recognition. He concluded that P. suberosa was an extremely variable species and that no constant characters permitted the maintenance of the proposed variants as distinct taxa. Since Killip's revision, the variability in gro ss morphological characters, as seen in herbarium specimens of P. suberosa s.l. , the over-reliance of many authors on the vegetative morphology in sorting out entities within t he "species," and the sheer task involved in sorting through t he thousands of specimens collected from around the world, has helped to perpetuate hi s broad concept of this species. However, both the phenetic and cladistic analyses based upon both molecular and morphological data presented her e support the non-monophyly of P.

PAGE 160

138 suberosa s.l. and the recognition of four distin ct taxa within this complex: P. suberosa ssp. suberosa , P. suberosa ssp. litoralis , P. pallida , and P. tridactylites. In the multivariate analyses of the quant itative morphological characters for P. suberosa s.l. , little correlation was found between floral and vegetative characters. Instead, the variability in m any of the vegetative characters in the complex made it difficult to elucidate dist inct taxa. However, an analysis of the floral characters alone produced an ordi nation pattern that supports the delimitation of P. pallida , P. suberosa ssp. suberosa , P. suberosa ssp. litoralis , and P. tridactylites , though some overlap among entities of P. suberosa ssp. litoralis and P. pallida does exist. Neighbor joini ng analyses of both qualitative and quantitative morphological characters also support the recognition of four taxa, but accessions of P. pallida were intermixed with accessions of P. suberosa ssp. litoralis , further indicating that the differ ences between these two taxa are sometimes difficult to disce rn. The results of the neighbor joining analysis also suggest that both P. tridactylites and P. suberosa ssp. suberosa may have evolved from P. suberosa ssp. litoralis . The morphological cladistic analysis of the supersection as a whole indicates the converse, that is, P. suberosa ssp. suberosa is sister to the rest of the species in the supersection. The position of P. suberosa ssp. suberosa in the cladistic anal ysis is questionable. Nevertheless, it is placed there because it shares a number of characters (e.g., sepal color) with the chosen outgroups whic h are probably actually derived within the supersection. Passiflora suberosa ssp. litoralis , P. pallida , and P. tridactylites are in a clade with P. tenuiloba , P. lancifolia , and P. macfadyenii in the

PAGE 161

139 morphological analysis. Passiflora pallida and P. suberosa ssp. litoralis are present in a clade with P. tenuiloba , underscoring the close relationship between P. pallida and P. suberosa ssp. suberosa , with P. tenuiloba forming a clade with P. pallida based upon the width of t he floral nectary. Passiflora tridactylites is placed in a clade with P. lancifolia and P. macfadyenii , which is likely a consequence of the increased flower size and other adaptations to nonhymenopteran pollinators in these three species. The molecular analysis indicates that P. lancifolia is sister to P. suberosa ssp. suberosa , though with only moderate support (73%), and according to my morphological analysis, P. macfadyenii is sister to P. lancifolia. In addition, P. tridactylites is very similar in many morphological characters to P. suberosa ssp. litoralis , both of which occur on islands of the Galapagos, underscoring their probable close relationship. Passiflora tridactylites , P. lancifolia , and P. macfadyenii are similar in many aspects to P. suberosa , and all three likely evolved fr om it. However, it is doubtful that they are each ot her’s closest relatives. In the molecular cladistic analysis, so me of the ambiguities apparent in the results from the phenetic analyses and morphology-based cladistic analyses were resolved or at least clarified. In all three trees resulting from an analysis of the ITS sequence data of supersection Cieca , P. pallida appeared to be monophyletic with bootstrap support of 95%, but P. suberosa ssp. suberosa and P. suberosa ssp. litoralis are not indicated as monophyletic. Their nonmonophyly is likely due, at least in par t, to some amount of gene exchange between these entities. While the amplification of the ITS region yielded a single

PAGE 162

140 product for all accessions of the supersect ion as revealed by gel electrophoresis, I noticed that the directly sequenced P CR product for several accessions of P. suberosa ssp. suberosa , P. suberosa ssp. litoralis and what morphologically appeared to be P. pallida contained polymorphic sites (where two discernible peaks of approximately equal strength appeared in the ch romatograms). Thus, I began to clone several of my PCR products and found that the accessions with polymorphic sites often proved to possess differing, apparently functional copies of ITS; there were no significant nucl eotide substitutions, insertion-deletion events, or substitutions (particularly in conserved regions) apparent in the sequences that would indicate that the copies were nonfunctional. Four individuals of supersection Cieca contained polymorphic sites (two accessions of P. suberosa ssp. litoralis from Puebla and Veracruz, Mxico, one accession of P. suberosa ssp. suberosa from Haiti, and one accession from Florida, USA that had small flowers similar to P. pallida ), while the rest of the species did not contain any polymorphisms in the IT S region. The cloned sequences of Passiflora suberosa ssp. suberosa from Haiti were placed in two different clades, with two clones falling within a moder ately supported clade containing other members of the subspecies from t he Caribbean and the other two forming a group in the strict consensus tree, which is positioned sister to P. suberosa ssp. litoralis . In addition, cloned entities of Passiflora suberosa ssp. litoralis from the states of Puebla and Veracruz, Mxico ar e found in separate clades. The clones of the accession that morphologica lly fits the description of P. pallida [“ sub. w/ pall. aff. USA (FL)", see Fig. 4.5] from t he United States occur in both the well-

PAGE 163

141 supported P. pallida clade and the clade containing P. suberosa along with the rest of the species from the supersection, indicating that there is gene flow, likely resulting from hybridization, between P. suberosa and P. pallida . This gene flow has likely obscured the distinctiveness of P. pallida and contributed to the broad circumscription of P. suberosa . All of the published chromosome counts of the species of Passiflora supersection Cieca support x = 6 as the base chromosome number (Beal, 1969, 1971; Diers, 1961; Melo, Cervi & Guerra, 2001; Melo & Gue rra, 2003; Snow & MacDougal, 1993; Storey, 1950; Turner & Zhao, 1992) . Individuals of Passiflora suberosa ssp. litoralis from Argentina, Brazil, Australia, and New Guinea have been shown to be polyploids (including triploid, tetraploid, and hexaploid counts) (Beal, 1969, 1971; Melo & Guerra, 2003). However, Diers found the diploid chromosome number of 2n = 12 in P. suberosa ssp. litoralis from Lomas de Lachay, Peru. I have not been able to lo cate Diers' voucher specimens to confirm his determinations, but bas ed upon the collection locality alone (Diers, 1961), the plant that he sampled was likely an individual of P. suberosa ssp. litoralis . Storey (1950) also counted the chro mosomes of Hawaiian material of P . suberosa . He found chromosome numbers of 2n = 24 and 2n = 36 in wild populations of the species. He determi ned that the 36-chromosomal form was likely an autotriploid derivative of the 24-chromosomal form. He did not describe the plants that he sampled, but he not ed that there were no conspicuous morphological difference between the tw o chromosomal races. He found only that the triploid race had slightly larger leaves and more anthocyanin

PAGE 164

142 pigmentation in the young stems and abaxia l surfaces of the sepals (Storey, 1950). I was unable to locate his vouchers and because P. suberosa ssp. suberosa and P. suberosa ssp. litoralis both occur in the Hawaiian Islands, I cannot be certain which subspecies he sampled. Snow and MacDougal (1993) also found that P. pallida from Jamaica was a polyplo id (tetraploid) with a chromosome number of 2n=24. With regard to breeding systems, Passiflora pallida and P. suberosa ssp. suberosa are often self-compat ible and autogamous in cultivation. MacDougal also found that a clone of P. suberosa ssp. litoralis from Mxico was not self-compatible, but a different clone from New Caledonia did prove to be self-compatible. As shown in the phenetic analyses of P. suberosa s.l. , there is clearly some overlap in the morphological characters of P. pallida and P. suberosa . This may indicate that there is limited gene flow occurring between these species, and the molecular data are consistent with this hy pothesis. However, most specimens of P. suberosa and P. pallida are clearly separable and the inclusion of P. pallida , a well-supported cladospecies, within the circumscription of P. suberosa would render this species extremely non-monophy letic and obscure the distinctiveness of an early divergent lineage wi thin the supersection. According to the molecular data there definitely seems to be gene flow between the subspecies of P. suberosa , and though they are morphol ogically distinct, I felt it best to treat these two somewhat geographically isolated taxa at the subspecific level (as opposed to the species level). The exact impac t that hybridization and polyploidy are having on the evolution of P. pallida and P. suberosa remains unknown, but it is

PAGE 165

143 clear that these processes have blurred the distinctions between these species and made the sorting out of phylogenetic relationships within these widespread and variable taxa extremely difficult. Howeve r, population level studies incorporating cytological data and DNA fing erprinting likely would reveal their consequences, clarifying the circumscription of P. suberosa and its subspecies. Pollination Biology I have not conducted thorough field studies of either the pollination biology or the dispersal agents of any species of Passiflora supersection Cieca , but I will present information regarding these topics fo r the supersection that was obtained from the literature or personal communication with other specialists in the group. The flowers of Passiflora are extremely variable in si ze, color, and shape, and represent adaptations to many differ ent pollinators. Based upon outgroup (Salicaceae s.l. see Chase et al. 2002; Judd et al. 2002 and Adenia Forssk.) comparisons of floral morphology and theories of pollination syndromes, MacDougal (1994) suggested that the anc estor of the genus was pollinated by insects, likely hymenoptera. Polli nation by bees is the most widespread condition in the genus, with wasp, hu mmingbird, and bat pollination arising independently in several groups (MacDougal, 1994). The pollinators of only three species of supersection Cieca have been recorded: P. sexocellata , pollinated by small to medium guild bees ( Colletes sp. Latr.; R. Clinebell, pers. com.); P. suberosa ssp. litoralis , pollinated by wasps ( Polistes sp. Latr.)(Koschnitzke and Sazima 1997); and P. viridiflora , pollinated by hummingbirds (MacDougal 1992; label data from herbarium specimens collected by W. L. Foment Foment 1125 ). MacDougal (pers. com.) determined

PAGE 166

144 the sugar concentration (measured as su crose equivalents in percent weight per total weight) of the nectar of thr ee species in the supersection: P. juliana, 3538%; P. macfadyenii , 29-44%; and P. megacoriacea , 43-45%. The flowers of P. megacoriacea have a strong, sweet, waxy odor and open in the morning, suggesting that the species is probably pollinated by bees. Passiflora juliana has flowers that have no detectible odor, but the structure of t he flower suggests adaptation to a small or medium-sized in sect; MacDougal (1992) reported seeing a hummingbird visit the flowers of this species in coastal Oaxaca, Mxico. Passiflora macfadyenii possesses bright red, tubular flowers with no odor, an elongated androgynophore, and poorly developed cor ona suggesting that hummingbirds are the likely pollinators. The majority of the species in the s upersection are probably pollinated by bees (e.g., P. coriacea, P. m cvaughiana, P. megacoriacea, P. sexocellata, P. trinifolia ). Most of the species have small, cup-s haped flowers that last less than one day. The flowers possess at least one row of we ll-developed coronal filaments that act as a landing platform for pollinators and hav e conspicuous areas of yellow and/or purplish coloration to attract them. In addition, they commonly have a clearance distance of less than 2.5 mm between the landing platform and the dehisced anthers or receptive stigmas. MacDougal (1994) noted that pollinati on by wasps may be important and widespread in subgenus Decaloba . Several species of Passiflora subg. Decaloba supersection Decaloba are primarily pollinated by wasps (e.g., P. affinis Engelm., P. capsularis L., and P. sexflora Juss.). These species have

PAGE 167

145 semierect to erect flowers with coronal filaments that lack conspicuous banding and possess a musky-sweet or scatolelike fragrance (MacDougal, 1983). Several species of supersection Cieca also possess many of these characteristics (e.g., P. eglandulosa , P. obtusifolia , P. pallida , P. suberosa ssp. litoralis ), and their pollination biology should be investigated further. Moth pollination in Passiflora is very rare. MacDougal (1983) reported that P. hahnii (E. Fourn.) Mast. in Veracruz, Mxico is visited by moths. Kay (2001) observed a sphingid moth po llinating the flowers of P. penduliflora in Jamaica, though she concluded that the insects were infrequent pollinators of the species. Goldman (2003, in press) found that P. arizonica (Killip) Goldman blooms in the evening, has light colored flowers, a distinct fragrance and a relatively deep hypanthium suggesting that moths are t he pollinators of this desert plant. Though not much is known about the biology of P. tridactylites , the flowers of this species are greenish yellow with coronal f ilaments that are gr eenish yellow with a dull red tinge toward the base, the andr ogynophore is very long, the anthers are oriented perpendicular or near ly perpendicular to their filaments at anthesis, and the staminal filaments spread but do not become fully perpendicular to the androgynophore; the fragrance and flowering time are unk nown. It seems that this species is adapted to a larger pollinator than its relative, P. suberosa ssp. litoralis , and MacDougal (pers. com.) found abundant Lepidoptera scales on the inside of the flowers of P. tridactylites ( Clark & Clark 207 ), indicating that many of the unusual floral characters listed above for this species may be due to a shift to

PAGE 168

146 moth pollination. Detailed studies of t he pollination biology of this species are needed. Pollination by hummingbirds is common in several groups of Passiflora , and MacDougal (1994) hypothesized that dependence on hummingbirds for pollination has arisen several times in the genus. He suggested that the traditional reliance by taxonomists of Passiflora on flowers for plant classification has led to the repeated recognition of hummingbird pollinated groups at misleadingly high ranks. The mole cular and morphological hypotheses presented here suggest that the subgenus Chloropathanthus recognized by Killip (1938) represents two independent shifts to hummingbird pollination, once in P. lancifolia and P. macfadyenii and again in P. viridiflora . These species have flowers characterized by an el ongated androgynophor e, an elongated hypanthium, a reduced corona, and inodorous flowers. Passiflora lancifolia and P. macfadyenii possess red flowers. Passiflora viridiflora has greenish yellow flowers but the stems, st ipules, tendrils, leaf margins and floral pedicels are bright red. Passiflora viridiflora is most closely related to P. juliana , and P. lancifolia and P. macfadyenii appear to be most closely related to P. pallida and P. suberosa . Thus, characters of the flower resulting from a shift to hummingbird pollination in these species are due to convergence. Passiflora itzensis and P. xiikzodz have very unusual flowers (see Figs. 8.36 and 8.38), and their pollinators are unknow n. The flowers have a greatly elaborated corona with seven ro ws of filaments but completely lack a floral nectary and do not produce nectar. Thus, an operculum that would cover and

PAGE 169

147 protect nectar from rain, desicca tion, and non-pollinating organisms is unnecessary, and, while almost all species in the genus have a functional operculum, both P. itzensis and P. xiikzodz possess a very reduced one, represented only as minute teeth. Becaus e the flowers of these species do not produce nectar, it is possible that the pollen itself is the reward or that pollinators are attracted by deception. The floral fl oor in both of these species is shiny and very similar to glistening nectar. In addition, the flower is very dark reddish purple with very long outer coronal f ilaments that could be mimicking rotting flesh, although the flowers do not hav e a strong odor. The flowers of P. itzensis are unusual in having short styles and staminal filaments and anthers which dehisce distally so that pollen is dusted on the ventral surface of any pollinators walking on the flower (compare Figs. 8.36 and 8.38). The bright yellow color of the pollen in this species is in sharp cont rast to the very dark -colored flower and may function to attract pollen collectors. Perhaps there has been a shift from the attraction of pollinators by deception in P. xiikzodz to one in which the pollen is displayed to pollen gatherers in P. itzensis . The pollination biology of these sibling species needs detailed study. Fruit Dispersal The fruits of supersection Cieca are unilocular berries with thin pericarps that are very dark purple, sometimes with a glaucous bloom. They may contain few to many arillate seeds, with the arils mo stly clear to slightly opaque and covering one half to three quarters of the seed. The fruits persist on the pedicels for some time after maturity and most are probably bird-dispe rsed, but other forms of zoochory may also occu r. Van der Werff ( van der Werff 1951 & 1420 ) reported

PAGE 170

148 that finches eat the fruits of P. tridactylites and P. suberosa ssp. litoralis in the Galapagos Islands . Clifford Smith (Univ. of Hawaii) has found that the seeds of P. suberosa are dispersed by alien frugivorous birds in Hawaii ( http://www.botany.hawaii.edu/fa culty/cw_smith/pas_sub.htm ). The Mariana fruit bat, Pteropus mariannus mariannus Desmarest, is known to feed on the fruits of Passiflora pallida on Guam. Passiflora pallida is a weedy vine there and will grow up into and cover the canopies of forest trees species, especially in disturbed habitats. Feeding by the Mari ana fruit bat occurs mostly when the vines grow up in the tops of trees and t he bat lands in the tree to feed (Dustin Janeke, pers. com.; http://www.batcon.org/discover/ffecon3.html ; http://www.passionflow.co.uk/bats11.htm ). Butterflies Species of Passiflora are of particular interest to entomologists, as these plants are larval hosts for passion flow er butterflies (Subfamily Heliconiinae, Family Nymphalidae). Larvae of the subf amily are almost uniquely restricted to food plants in the Passifloraceae, giving rise to the name "passion flower butterflies.” The close association of species in the Heliconiinae and Passifloraceae is commonly held up as an ex ample of plant-insect coevolution. Benson et al. (1975) published the host plant records for many species of the Heliconiinae and attempted to generate higher level taxonomic correlations between these butterflies and taxa within Passiflora . They concluded that the Heliconiinae and Passiflora show parallel evolution with considerable mutual influence. However, Mitter and Brooks ( 1983) challenged Benson's hypothesis and concluded that the host-associate re lationship between the Heliconiinae and

PAGE 171

149 Passiflora is not necessarily due to association by descent and that it is quite possible that evolution of t he Heliconiinae occurred after the diversificiation of the Passifloraceae. Part of the controversy lies in the fact that butterfly taxa are often recorded for more than one host s pecies (often from other subgenera), making the test for mutual descent co mplicated. Spencer (1988) published a paper on the chemical mediat ion of coevolution of the interaction between Passiflora and the Heliconiinae. He statistica lly established a significant positive correlation between the pr oposed phylogenies of Passiflora subgenera and species (as interpreted from Killip's 1938 revision of the Passifloraceae) and the Heliconiinae (based upon Brown's pr oposed phylogeny of the Heliconiinae published in 1981) at several taxonomic le vels (Brown, 1981; Killip, 1938). However, he also found that they were not wholly congruent. Based upon his detailed analyses of cyanogenic compounds in Passiflora , he proposed that the initial relationship of the Heliconiinae with Passiflora was exploitative and facilitated by insect adaptation to an init ially undiversified plant chemistry, with adaptive radiation of plant c hemistry. This was followed by plant speciation, resulting from several centers of intens e herbivore pressure. However, despite these detailed studies, the ex tent and nature of mutual de scent in this system still remain largely unknown, as well-support ed phylogenies of the Passifloraceae and Heliconiinae have not yet been pr oposed. Nevertheless, many entomologists and botanists are current ly accumulating morphological and molecular data for cladistic analysis and this controversy will hopefully be resolved in the coming years. Penz ( 1999) recently publishe d a higher level

PAGE 172

150 phylogeny of the passion flower butterflies based upon larval and adult morphology and has another more recent a nalysis of the group in press. In addition, Brower and Egan (1997) have proposed a phylogeny of the genus Heliconius and relatives based upon mitochondrial and nuclear genes. However, a phylogeny of the Passifloraceae has not been published, though labs at the University of Texas, USA, and the Instit uto de Biocincias, UFRGS, Brazil, are doing higher level analyses of the genus (Muschner et al., 2003). Most of the species of Passiflora supersection Cieca are utilized by common and widespread species (both advanced and primitive assessed by comparison with the phylogeny of Penz, 1999) of the subfamily Heliconiinae ( Acraea Fabricius, Agraulis Boisduval & Leconte, Dione Hbner, Dryandula Michener, Dryas Hbner, Euptoieta Doubleday, Heliconius Kluk, and Philaethria Billberg). The known butterfly herbivores of species of supersection Cieca are listed in Table 7.1. Most species in the supersection have only one or two known herbivores, but, as one would expect, the s pecies that are widely distributed have a greater diversity of herbivores. T he more advanced species of supersection Cieca ( P. xiikzodz, P. juliana, P. viridiflor a, P. coriacea, P. sexocellata, P. megacoriacea ) are mainly used by species of Heliconius . The more primitive species in the supersection ( P. eglandulosa, P. lancifolia, P. pallida, and P. suberosa ssp. litoralis ) are also commonly utilized by Heliconius spp. but are also hosts for more primitive genera of the Heliconiinae ( Acraea, Agraulis, Dione, Dryas, Dryandula and Philaethria ). Passiflora tenuiloba , which is sister to P. pallida in the morphological analysis but is more closely related to P. coriacea

PAGE 173

151 and P. sexocellata in the molecular analysis, serves as a host for the primitive genera Agraulis and Dryas and the more advanced genus Heliconius .

PAGE 174

152 Table 7.1. Reports of herbivory on species of Passiflora supersection Cieca by the Heliconiinae butterflies (Nymphalidae). Species Heliconiinae Place Reference P. coriacea Heliconius erato Central Colombian Valleys and N Venezuela Benson et al. 1975 P. eglandulosa Heliconius hortense N Central America MacDougal 1988 P. juliana Heliconius charitonius Mxico MacDougal 1992 P. lancifolia Dryas julia Jamaica Benson et al. 1975 P. megacoriacea Heliconius cydno Heliconius erato Panama and SE Costa Rica Costa Rica Benson et al. 1975 DeVries 1987 P. obtusifolia Heliconius charitonius Mxico J. M. MacDougal and J. Miley 495 P. pallida Acraea andromacha Agraulis vanillae Dione juno Dryas julia Euptoieta claudia Euptoieta hegesia Heliconius charitonius Australia Jamaica Peru Jamaica Florida, USA Texas, USA Jamaica Hawkeswood 1991 Benson et al. 1975 Benson et al. 1975 Benson et al. 1975 Minno and Minno 1999 Phil Schappert, pers. com. Benson et al. 1975 P. sexocellata Dryas julia Heliconius erato Mxico and N Central America Mxico and N Central America Benson et al. 1975 Benson et al. 1975 Meerman 2001

PAGE 175

153 Table 7.1. Cont. Species Heliconiinae Place Reference P. suberosa ssp. litoralis Agraulis vanillae Dione juno Dryandula phaetusa Dryas julia Heliconius charitonius Heliconius erato Heliconius sara Philaethria wernickei SE Brazil Peru S Brazil Peru, SE Brazil Peru SE Brazil SE Brazil SE Brazil Benson et al. 1975 Benson et al. 1975 Benson et al. 1975 Benson et al. 1975 Benson et al. 1975 Benson et al. 1975 Benson et al. 1975 Benson et al. 1975 P. tenuiloba Agraulis vanillae Dryas julia Heliconius charitonius Texas, USA Texas, USA Texas, USA Benson et al. 1975 Mike Quinn, pers. com. Larry Gilbert, pers. com. P. viridiflora Heliconius charitonius Mxico MacDougal 1983 P. xiikzodz Heliconius erato Belize Meerman 2001

PAGE 176

154 Distribution and Ecology The Passifloraceae has a poor fossil record, therefore, little is known about the history of the family. There are several references to fossils of Passifloraceae in the literature, but they remain unconfirmed: Passifloraephyllum Rsky (Type: P. krauseli Rsky) from the upper Eocene in Hungary, based on leaves (Rsky, 1960); Passiflora kirchheimeri from the Miocene in East ern Europe, based on a seed (Mai, 1960); Passiflora sp. first reported from the Miocene but now known to be from the Pliocene of Veracruz , Mxico, based on pollen (Graham, 1976; A. Graham, pers. com.); Passiflora heizmannii from the Miocene in Southern Germany, based on a seed (Gregor, 1982); Passiflora sp. from the Eocene in New Zealand, based on a leaf (Pole, 1994) . Because little is known about the fossil history of the family , the phylogeny of the group is still in part uncertain, and no analyses of the genus utilizing a molecular dating method have been conducted, it is inappropriate to discuss detailed biogeographic hypotheses related to Passiflora supersection Cieca . However, a general description of the distribution and habitats of the spec ies in the group will provide a better understanding of their diversification. Species of supersection Cieca are found from Florida and southern Texas in the United States of America, thr ough Mxico and Central America, from Colombia and Venezuela to Argentina and southern Brazil, and in the Caribbean; they are absent from the Guyana Shield region. Passiflora pallida and P. suberosa are also found in many areas of the Old World tropics and on many north and south Pacific islands to the east of the International Date Line, as the

PAGE 177

155 result of introduction by humans. However, the center of diversity is in southern Mxico and northern Central America. Of the 19 species recognized here, five species ( P. juliana , P. viridiflora , P. mcvaughiana , P. tacana and P. itzensis ) are endemic to Mxico, two to Guatemala ( P. clypeophylla and P. trinifolia ), two to Jamaica ( P. lancifolia and P. macfadyenii ), and one to the Galapagos Islands, Ecuador ( P. tridactylites ). Passiflora juliana and P. viridiflora are both found along the Pacific coast and in the Pacific coastal plain of southwestern Mxico in disturbed tropical deciduous or semideciduous forests of low to moder ate elevation (Fig. 8.24). These two species are not sympatric, with P. juliana found farther north, from areas around the Bahia Chamela in Jalisco to those just south of Manz anillo in southern Colima, and P. viridiflora occurring from regions just nor th of Lazaro Cardenas in Michoacan to areas around the Gulf of Tehuantepec in southern Oaxaca. Passiflora itzensis is found in tropical semideciduo us forests from areas near Chichen Itza in Yucatn to localities in southern Quintana Roo north of Chetumal (Fig. 8.37). Passiflora mcvaughiana is also found in southwestern Mxico, in high elevation oak, pine/oak or pine fore sts or montane mesophytic forests on moist hillsides and in barrancas (Fig. 8.24). Passiflora tacana is known only from one collection in a high altitude tropical montane forest on Volcn Tacan in Chiapas, Mxico along the border with Guatemala (Fig. 8.29). Passiflora clypeophylla has not been found since the type was collected in 1889 (Fig. 8.18). It is a plant of moderate elevation (ca. 762 m. alt.) and, based upon information about the ecology of the area, was lik ely found in seasonally dry areas

PAGE 178

156 associated with oaks and pines. Passiflora trinifolia is a rare plant found in open, strongly seasonally dry pine and oak fore sts in northeastern Baja Verapaz, Guatemala (Fig. 8.18). Passiflora macfadyenii was last collected in 1979 and repeated attempts to find the plant by myself, Elma Kay (Missouri Botanical Garden), and George Proctor (Institute of Jamaica) have failed. It has been found in tropical dry forests in roadside thickets and wooded limestone hills in the parishes of St. Andrew and St. Thomas (Fig. 8.13). Passiflora lancifolia , another Jamaican endemic of supersection Cieca , is found in tropical lower montane mist forests on steep wooded hillsides in t he Blue Mountains (Fig. 8.13). Passiflora tridactylites is an endemic of the Galapagos and grow s in dry tropical forests at altitudes ranging from sea level to 800 m (Fig. 8.11). Many of the species of the superse ction have wider geographic ranges in Mxico, Central America, and South America. Passiflora tenuiloba is a plant occurring in arid and semiarid thorn scrub and grasslands from southern Texas to northern Mxico (Fig. 8.16). Passiflora xiikzodz is found in the same habitats as its sister P. itzensis , but in addition to being found in the Yucatn Peninsula of Mxico, its range extends to Beli ze and Guatemala (Fig. 8.37). Passiflora sexocellata is found from southern Mxico to Nicaragua (Fig. 8.29). Throughout its range this species is found in low, mo ist to wet tropical forests near streams and rivers, but, in the state of Veracr uz, Mxico, it can be found growing on seaside cliffs. Passiflora megacoriacea is found in Costa Rica and Panama. In the northwestern corner of Costa Rica, in the province of Guanacaste, this species is deeply trilobed and occurs in the premontane transit ional belt between

PAGE 179

157 the dry tropical forests typical of t he Cordillera de Guanacaste and wetter midelevation forests (Fig. 8.29). Throughout the remainder of its range it is found at lower elevations in dry to wet tropical forests inland and near the sea along the Atlantic and Pacific coasts. Passiflora coriacea is found from northern Colombia and northwestern Venezuela to northern Bolivia (Fig. 8.29). It occurs in moist to wet tropical forests commonly at elev ations of 50-1500 m, reaching higher elevations in the north ern part of its range. Passiflora obtusifolia is found from sea level to 1500 m elevation in tropica l deciduous and semideciduous forests in the Pacific lowlands and foothills of southwestern Mxico, El Salvador, and Costa Rica; it is found at higher elevations of 500-1500 m in the southern part of its range (Fig. 8.18). Passiflora eglandulosa occurs in shady ravines and at the edges of premontane to montane (15002800 m) broad leaved forests on volcanic cones from Guatemala to El Salvador and central Honduras (Fig. 8.18). The species in supersection Cieca with the widest ranges are P. pallida and P. suberosa . Passiflora pallida has a circum-Caribbean distribution and is found in and along the edges of low elevation, dry tropical forests both inland and near the seashore (Fig. 8.3). This species has also been introduced into the areas of the Old World such as Australia, Co mmonwealth of the Northern Mariana Islands, Comoros, Federated States of Micronesia, India, Madagascar, Maldives, Mauritius, Palau, Republic of Seychelles, Singapor e, Solomon Islands, and Sri Lanka. Passiflora suberosa ssp. suberosa is primarily restricted to the islands of the Greater and Lesser Antilles and is found in and along the edges of semideciduous to deciduous, dry to mois t tropical forests, both inland and near

PAGE 180

158 the seashore, from sea le vel to 1600 m, but it has also been collected in the Hawaiian Islands, where it is introduced (F ig. 8.7). In the Greater Antilles, P. suberosa ssp. suberosa is commonly found in and along the edges of moist forests, primarily at higher elevations. It is relatively common on all of the islands of the Greater Antilles, exc ept for Jamaica where it is very rare. In the Bahamas and the Lesser Antilles, it does occur at hi gh elevations but primarily occurs at lower elevations and is found in dry to moist forests. Passiflora suberosa ssp. litoralis has the widest geographic range of the taxa in supersection Cieca (Fig. 8.7). It grows in and al ong the edges of semideciduous to deciduous, dry to moist tropical forests and in secondar y successional areas, both inland and near the seashore, from sea level to 2800 m, from northern Mxi co, through Central America, to central Argent ina and Brazil. In the Old World tropics it has been introduced in Australia, Fiji, French Overs eas Territory of New Caledonia, India, Indonesia, South Africa, Spain, Sri Lanka, Taiwan, and Uganda. Speciation As defined in Judd et al. (2002:113), s peciation is "the permanent severing of population systems so that migrants from one system would be at a disadvantage when entering another.” This could result from a lack of mates for the migrants due to reproductive isolation in the two systems or an inability of the migrant to compete well with members of another system. Often the migrant is unable to withstand the pat hogens, pests, and predators in the new system and has trouble attracting pollinators and agents of dispersal. Ultimately, speciation leads to the origin of new and independent evolutionary lineages (Judd et al., 2002).

PAGE 181

159 There are two primary types of speciati on: allopatric or geographic speciation, and sympatric speciation. The allopatri c model of speciation requires the geographic isolation of two populations to prevent gene flow and divergence. Sympatric speciation can occur without geographic separation, but some type of strong barrier to gene flow is still necessary. By and large, the species of supersection Cieca are not sympatri c. Where the ranges of two or more species do ov erlap, the plants are found growing at different elevations or in different habitats. Passiflora tridactylites , a Galapagos endemic, seems to be a good example of the peripheral isolation model of speciation. It seems likely that the progenitor of Passiflora tridactylites originally arrived on the Galapagos Islands from Ecuador by long distance dispersal and began to diverge morphologically, in res ponse to new environmental pressures. The species is very similar to populations of P. suberosa ssp. litoralis both in the Galapagos and in other areas of western South America, and P. tridactylites cannot be separated from that entity bas e upon vegetative morphology alone. However, the reproductive morphology of these taxa is very different, likely resulting from a shift in pollinators (s ee discussion under “Pollination Biology”). This neospecies has spread to many isla nds of the Galapagos and occurs in dry lowland areas, but P. suberosa ssp. litoralis is found in more mesic habitats both there and on the mainland of South America. Thus, P. tridactylites has developed a divergent ecologi cal amplitude that has allo wed it to invade novel habitats and exploit a different spectrum of pollinators. It is seems likely that other members of the supersect ion fit this model as well.

PAGE 182

160 Based upon the morphological, molecu lar, and cytological data presented here, it appears that P. pallida and P. suberosa are polyploid taxa between which gene flow, likely in the form of hybridization, is occurring or has occurred recently. It is not known to what ex tent hybridization and polyploidy are influencing the evolution of these species, but both processes have played a considerable role in plant evolution. Po lyploids are often more widely distributed and found in more extreme habitats than t heir diploid relatives and a shift to polyploidy is sometimes accompanied by a loss of self-incom patibility (Judd et al., 2002; Soltis & Soltis, 2000; Stebbins, 1950). Passiflora pallida and P. suberosa exhibit both of these feat ures. In addition, hybrid ization has played an important role in the evolution of pl ants, not only as a source of new gene combinations but also as a mechanism for speciation. Hybrids are frequently associated with a disruption of habitat and adaptations that once isolated two species may be broken down by natural disturbances (e.g., new herbivores or pests, fire, floods, or volcanic activity). Regardless of its cause, hybridization often creates complex patterns of variat ion that weaken the morphological and genetic distinctiveness of specie s but at the same time t he fitness of their hybrids may increase (Funk, 1985; Judd et al., 2002; Stebbins, 1950). This phenomenon may be partly responsible for the increased adaptive abilities and wide distributions of P. pallida and P. suberosa . However, it is interesting that these two species have not been found to be sympatric. While collecting in Haiti, I found that P. suberosa ssp. suberosa was restricted to high elevation forests and P. pallida was found at or just above sea level frequently in close proximity to the

PAGE 183

161 ocean. However, I do know of one case in which P. suberosa ssp. suberosa is found in close proximity to a possible hybrid entity. Christian Feuillet (Smithsonian Institution) s ent me pictures of two pl ants growing within 50 yards of one another on the island of St. John's in the United States Virgin Islands. One was clearly P. suberosa ssp. suberosa , and was frequently found throughout the island, the other, a much rarer plant, appeared to be morphologically intermediate between P. suberosa ssp. suberosa and P. pallida. I have seen this same phenomenon in herbarium specimens, particularly on smaller islands in the Caribbean (e.g., Islands of the Bahamas, the U.S. and British Virgin Islands). That is, there are specimens that fit the circumscription of P. pallida and P. suberosa ssp. suberosa occurring on many islands, accompanied by accessions that appear to be intermediate in morphology. In coastal dunes in the Yucatan Peninsula, t here are also plants t hat perfectly fit the circumscription of P. pallida , yet when sequenced, appear more closely related to P. suberosa ssp. litoralis . In order to determine t he impact of polyploidy and hybridization on the evolution of P. suberosa and P. pallida , extensive sampling of these species throughout their r ange accompanied by detailed molecular analyses such as DNA fingerprinting may be necessary. The pattern is clearly complex, and the diagnosis of these tw o, non-sister, species is occasionally problematic, likely as a re sult of hybridization. Passiflora suberosa is clearly a non-monophyletic species. Levin (1993) maintains that most plant species are products of geographically local speciation and, as a result, he believes that close to half of them are non-monophyletic. In

PAGE 184

162 addition, Reiseberg and Brouillet (1994) ar gue that species derived through local speciation will follow a sequence of polyphyly paraphyly monophyly and insist that a criterion of monophyly for species recognition is inadequat e and that it is more logical to view the phylogenetic stat us of a species as a property that will vary over time (Rieseberg & Brouillet, 1994). Undoubtedly, P. suberosa and the other species of supersection Cieca are rapidly evolving as compared to other groups of plants and even other groups within Passiflora (as illustrated by Shawn Krosnick's work on Passiflora supersect. Disemma , pers. com.). It is quite possible that Passiflora suberosa has been caught in the polyphyletic to paraphyletic stage of speciation, but further molecular work is needed to justify this hypothesis. Nevertheless, it should be noted that the mon ophyly of the other 18 species of supersection Cieca was supported in my analysis (see below). Species Concepts The phylogenetic species concept sensu Wheeler and Platnick was primarily employed in this study (Wheeler & Plat nick, 2000). That is, the smallest aggregation of populations or lineages dia gnosable by a unique combination of character states were recognized as "spec ies.” However, other species concepts such as the biological species conc ept (Mayr, 1942), phenetic species concept (Sokal & Crovello, 1970) and autapomorphi c concept (Donoghue, 1985; Mishler, 1985) were also considered and frequently proved useful. In the phenetic analyses of the P. suberosa and P. coriacea complexes, I looked for gaps in the pattern of variation and used sets of morphological characters in species delimitation. I also considered the i nability to interbreed, along with other evidence, as an indication that P. itzensis is a good species. In addition, nearly

PAGE 185

163 all of the species in supersection Cieca are cladospecies and possess molecular and morphological autapomorphies (Figs. 4.1-4. 4, 6.1-6.2; Tab. 7. 1). I originally began this project with the idea that one of the phylogenetic species concepts would apply to the spec ies of supersection Cieca , preferably the one that was the least subjective (i.e., the autapomorphic s pecies concept). Howe ver, as I delved deeper into the biology of this group it bec ame evident that t he utilization of only one species concept was inadequate, and I found myself beginn ing to integrate elements of several concepts, a situation which will likely reoccur in studies of other groups of rapidly evol ving, complex species groups . Table 7.2. Table indicating the type and amount of evidence for monophyly for the species of Passiflora supersection Cieca ; "-" = taxa not included in the molecular analysis. Species Evidence for Monophyly (Molecules MOL; Morphology MOR) Number of Molecular Apomorphies/ Number of Morphological Apomorphies P. clypeophylla MOR -/6 P. coriacea MOL/MOR 5/3 P. eglandulosa MOR -/12 P. itzensis MOL/MOR 4/8 P. juliana MOL/MOR 15/7 P. lancifolia MOL/MOR 1/8 P. macfadyenii MOR -/9 P. mcvaughiana MOL/MOR 3/8 P. megacoriacea MOR -/11 P. obtusifolia MOL/MOR 5/4 P. pallida MOL/MOR 63/3 P. suberosa Not monophyletic P. tacana MOR -/7 P. tenuiloba MOL/MOR 18/10 P. tridactylites MOR -/2 P. trinifolia MOR -/10 P. viridiflora MOL/MOR 5/19 P. xiikzodz MOL//MOR 10/2

PAGE 186

164 Summary Passiflora supersection Cieca consists of 19 species of climbers possessing small, apetalous flowers that lack floral bracts or have only one or two such bracts. The species are primarily dist ributed in the southern United States, Mexico, Central America, South Amer ica, and the Caribbean. The two most widespread taxa in the supersection, P. pallida and P. suberosa , are also found in various regions of the Old World, likely as a result of natura lization. Five new species, P. megacoriacea , P. pallida , P. sexocellata , P. tacana , and P. tridactylites , were recognized as part of this project. Phenetic and cladistic analyses of the supersection based on morphological and molecular characters were utilized to generate hypotheses of species phylogenetic relationships and redefine spec ific entities, espec ially within the two species complexes. The phylogenet ic analyses presented here confirm the monophyly of the supersection. In t he molecular and morphological analyses each of the species of the super section, with the exception of P. suberosa , is monophyletic and diagnosible by a unique co mbination of character states. There is support in the molecular and mo rphological analyses for the monophyly of a clade containing P. itzensis and P. xiikzodz and a clade composed of P. juliana and P. viridiflora . In addition, there is str ong support in the molecular analysis for a clade comprising P. coriacea and P. sexocellata . Four taxa that were formerly included in the P. suberosa complex are recognized here: P. pallida , P. suberosa ssp. suberosa , P. suberosa ssp. litoralis , and P. tridactylites . Both the molecular and morphological analyses show that Passiflora suberosa is not monophyletic, a situati on that may be quite common in

PAGE 187

165 plants, suggesting that a cr iterion of monophyly for species recognition may be inappropriate. It is quite possible that P. suberosa has been caught in the paraphyletic "stage" of speciation, and the data indicate that it might be more logical to view the phylogenetic status of a species as a property that may change over time. Peripherial isolate spec iation, such as that which presumably has given rise to the Galapagos endemic, P. tridactylites . Passiflora tridactylites possesses a flower that appears to be adapt ed to a larger pollinator than its relative P. suberosa , which is mainly poll inated by hymenopterans, and P. tridactylites may be moth pollinated. The analyse s also indicate that there is limited gene flow, likely in the form of hybridization, occurring between P. suberosa and P. pallida . This gene flow has obscured the distinctiveness of P. pallida , a species that is likely sister to the remaining members of the supersection, and has contri buted to the traditional broad circumscription of P. suberosa . Passiflora pallida and P. suberosa have also been shown to be polyploids (including triploid, tetraploid and hexaploid counts). The exact impact that hybridization and polyploidy are having on the evolution of P. pallida and P. suberosa is unknown; however, it is clear t hat these processes have blurred the distinctiveness of these two species and made the sorting out of phylogenetic relationships between and within them very difficult. Three species from the P. coriacea complex are recognized: P. coriacea , P. megacoriacea , and P. sexocellata . It is clear in the molecular analysis that P. coriacea and P. sexocellata are sister to each ot her, and both are clearly diagnosable. It is also likely that P. megacoriacea is closely related to these two

PAGE 188

166 taxa. Passiflora megacoriacea and P. sexocellata were recognized as specifically distinct as a re sult of this investigation. Passiflora xiikzodz and P. itzensis are recognized at the specific-level, as opposed to the subspecific-level, due to consistent differences in floral morphology which likely resulted from a sh ift in pollinators. Based upon floral morphology, the majority of the species in the supersection are probably pollinated by insects, likely hymenoptera. However, pollination by hummingbirds has also been reported for several specie s of the supersection and appears to have evolved at least twice, once in P. viridiflora and again in the common ancestor of P. lancifolia and P. macfadyenii , leading to dramatic shifts in floral form in these species. The species of supersection, for the most part, are not sympatric and where two or more specie s coincide, they are found growing at different elevations or in different habitats. Several species within the supersection (e.g., P. lancifolia , P. macfadyenii , P. tridactylites , and P. viridiflora ) fit the peripheral isolate model of speciation and have developed divergent ecological amplitudes that have allowed them to invade novel habitats and exploit different spectrums of pollinators. Most of the species of Passiflora supersection Cieca are utilized by common and widespread species of the subfamily He liconiinae. Many of the species in the supersection have only one or two k nown herbivores, but, as one would expect, the species that are widely di stributed have a greater diversity of herbivores. The extent and nature of mutual descent between the species of supersection Cieca and the Heliconiinae, stil l remains largely unknown.

PAGE 189

167 Lastly, the utilization of only one concept to define the species of supersection Cieca was inadequate. However, meaningful biological entities were identified through the integration of elements from se veral concepts (e.g., the biological, phenetic, autapomorphic and diagnostic sp ecies concepts), along with information from many new taxonomic colle ctions, observations of living material, and detailed phenetic and phylogenetic analyses (based on DNA and/or morphological data).

PAGE 190

168 CHAPTER 8 TAXONOMY Description of Passiflora Passiflora L., Sp. Pl. 955. 1753. TYPE SPEC IES (designated by N. Britton and A. Brown, 1913, Ill. Fl. N. U.S., ed. 2, p. 565): Passiflora incarnata L. Herbaceous or woody, perennial (rarel y annual or with annual shoots from perennial roots), tendril-clim bing vines or lianas, rarely shrubs or small trees lacking tendrils; usually containi ng cyanogenic glycosides having a cyclopentenoid ring system; glabrous to densely pubescent with simple trichomes, rarely gland-headed. Stems terete to lobed or sharply angled, occasionally with anomalous secondary growth, the shoot apex erect to cernuous. Leaves alternate (very rarely subopposite to opposite), simple (rarely palmately compound), petiolate, oft en with variously shaped and positioned extrafloral nectary glands on the petio le; laminas unlobed or lobed, often heteroblastic, pinnately to often palmately (rarely pedately) veined, variegated or not, entire to serrate, peltate or not, oft en bearing small nectaries associated with marginal teeth or indentations, or abaxia lly submarginal, or abaxial between the major veins. Stipules setaceous to fo liaceous, persistent or early deciduous, entire to serrate, sometimes the margins with glands, occasionally cleft. Tendrils axillary, simple (rarely compound), repres enting a modified flower stalk of the

PAGE 191

169 central part of the inflore scence, straight, curved, or circinate during development at the shoot apex, rarely with adhesive te rminal disks. Inflorescences axillary, bracteate or rarely ebracteate, cymose , the central pedicel developed into a tendril, the peduncle very reduced or usua lly absent, the pedicels then arising collateral to the tendril (s ometimes aborted), solitar y or paired; secondary inflorescences may be present as c ondensed axillary or terminal shoots, determinate or rarely indeterminate; pedicels articulate distal to bracts, the distal portion called the floral stipe; bracts setaceous and scattered to foliaceous or pinnatifid and involucrate, occasionally gl andular at margin. Flowers bisexual (sometimes functionally staminate), acti nomorphic or rarely the reproductive parts zygomorphic; hypanthium flat to campanulate, occasionally the perianth basally connate/adnate into a floral tube; sepals 5 (very rarely 8), quincuncially imbricated (rarely non-overlapping) in t he bud, occasionally carinate, sometimes with a subapical projection; petals 5 (ver y rarely 8) or so metimes wanting, quincuncially imbricated (rarely non-over lapping) in the bud, the same length as or shorter (rarely longer) than the sepals; corona presen t at the base of the calyx or corolla or adnate to the insi de of the floral tube, in 1 to many series of distinct to occasionally connate, s hort to elongate, often show y filaments or outgrowths, sometimes membranous, the innermost series, called the operculum, often connate at least basally, frequently memb ranous and shielding the nectary; the limen (extrastaminal nectariferous disk) pr esent as a ring or cup around base of androgynophore (or rarely the ovary if androgynophore absent), or discoid or conical and adnate to the fl oor of hypanthium. Stam ens 5(8 in one species),

PAGE 192

170 usually alternate with t he petals, borne on an often elongate androgynophore or androgynophore rarely absent; filaments free just below ovary or rarely connate into a tube around ovary; ant hers introrse in bud, moving to become extrorse (rarely latrorse) at anthesis, dorsifixed, versatile, dehiscing longitudinally, borne parallel or perpendicular to thei r filaments; pollen binucleat e, 3to 12-colporate. Carpels 3(-5), connate, ovary superior , unilocular, borne on an often elongate androgynophore (rarely sessile), placent ation parietal, anatropous ovules numerous on each placenta; styles distin ct, rarely connate near base; stigmas capitate, clavate, reniform, or occasiona lly bilobed. Fruit a few to many seeded berry, rarely a loculicidal capsule. S eeds arillate, usually flattened, the testa pitted, reticulate-foveate, or transversel y grooved or sulcate; endosperm slightly ruminate, oily, abundant; embr yo straight, the cotyl edons usually elliptic to oblong-elliptic; germination epigeal (rarely hypogeal). Chromosome numbers: n = 6, 9, 10, 12 (rarely 7, 11, 18, 42). Description of Passiflora Subgenus Decaloba Supersection Cieca Passiflora subgenus Decaloba (DC.) Rchb. supersection Cieca (Medik.) J. M. MacDougal & Feuillet. A new in frageneric classification of Passiflora . Passiflora 14, in press. 2004. Cieca Medik. Malvenfam. 97. 1787. Passiflora sect. Cieca (Medik.) DC. Mm. Soc. Ph ys. Genve 1: 435. 1922. Passiflora subgenus Decaloba section Cieca (Medik.) Mast. Tran s. Linn. Soc. 27: 630. 1871. TYPE SPECIES (designated by E.P. Killip, 1938, Field Mus. Nat. Hist., Bot. Ser. 19:

PAGE 193

171 25): Cieca viridis Medik. [nom. illeg. based upon type material of Passiflora minima L. (= Passiflora pallida L.)]. Monactineirma Bory. Ann. Gn. Sci. Phys. 2: 138. 1819. Meioperis Raf. Fl. Tellur. 4: 103. 1838. T YPE SPECIES (designated here): Passiflora suberosa L. Small to medium-sized climbing or pr ocumbent vines with annual or perennial stems from woody perennial rootsto cks or taproots, ant rorsely appressedpuberulent more or less throughout, with unice llular, curved or occasionally erect trichomes, and sometimes sparsely to dens ely pubescent with longer unicellular, rarely multicellular, curved trichomes. Stems terete to somewhat compressed and two-edged, the shoot apex erect. Leaves simple, commonly bearing nectaries on the petiole (except in P . eglandulosa and P . mcvaughiana ); petioles sometimes canaliculate, biglandular (ra rely eglandular or with only a single gland) with opposite, subopposite or alternate, discoid, cupulate, obconical or capitate extrafloral nectaries; laminas unl obed or 2to 3-lobed (rarely 5-lobed), often exhibiting heterophylly, sometimes co rdate at base, entire (very rarely crenate), venation pinnate or usually palmate, variegat ed or not, peltate or not, sometimes bearing small abaxial disciform or crateriform nectaries present submarginally between the major vein s (very rarely associated with leaf crenations). Stipules setaceous to fo liaceous, persistent, narrowly to widely ovate, rarely oblong or obovate, symmetric al or sometimes a symmetrical, entire,

PAGE 194

172 not glandular. Tendrils simple, lacking adhesi ve disks, straight or slightly curved during development at shoot apex. Inflore scences sessile in leaf axils, the pedicels solitary or paired, collateral with tendril, ar ticulate, the articulation generally several mm below the flower; secondary inflorescences sometimes present as condensed axillary or usually te rminal shoots, determinate or usually indeterminate; bracts 1-2 or lacking, narrowly ovate to entire. Flowers erect or rarely horizontal, greenish yellow some times with purplish to reddish markings, or red, hypanthium usually shallow, occasionally the calyx basally connate into a conspicuous floral tube; s epals ovate-triangular, not corniculate, greenish yellow or red; petals absent; coronal filaments in 2 series (rarely 1 or 7 series), greenish yellow, sometimes with yellow and/or purple to red marki ngs, or purple to red, linear, often subcylindrical in cross-se ction, inner filaments usually capitate; operculum connate, membranous, plicate (ver y rarely denticulate), incurved or rarely semierect and laying against androgynophore; nectary trough-shaped or rarely absent, commonly lacking a low annular ridge (nectar ring); limen adnate to floor of hypanthium or rarely absent (in P. viridiflora the limen present as a shallow cup around base of androgynophore), recurved or sometimes erect to inclined toward operculum. Stami nal filaments with the free portions actinomorphic; anthers extrorse at anthesis with their axes maintained parallel to the filament or rarely only moving slightly from the original introrse position to dehisce distally (upwards); pollen ellipsoi d to spherical, 6-syncolporate. Carpels 3; ovary ellipsoid or globose, rarely sli ghtly ovoid, obovoid or fusiform, glabrous or rarely densely pubescent with curved, unicellular or rarely multicellular

PAGE 195

173 trichomes; styles slender, less than 1.5 mm in diameter; stigmas capitate, depressed-ovoid. Fruit a few to many -seeded purple or very dark purple berry, arils pale-translucent coveri ng approximately 3/4 of t he seed. Seeds more or less compressed, often beaked at chalazal apex, reticulate-fov eate. Germination epigeal. Chromosome numbers: n = 6 (12, 18). Commonly lacking cglycosylflavones and usually containing flav onol 3-0-glycosides. Fig. 8.1. Figure 8.1. Flowers of several species of Passiflora supersect. Cieca . a. P . viridiflora ( MacDougal 351 ). b. P . juliana ( MacDougal 492 ). c. P . trinifolia ( MacDougal 637 ). d. P . eglandulosa ( MacDougal 316 ). e. P . suberosa ssp. litoralis ( MacDougal 568 ). f. c.f. P . obtusifolia Costa Rica ( MacDougal 1486 ). g. P . obtusifolia Mxico ( MacDougal 495 ). h. P . mcvaughiana ( MacDougal 369 ). Scale bar = 8.0 mm. Image a composit e of two photographs taken by J. M. MacDougal. Key to the Species of Passiflora Supersection Cieca 1. Stipules 2.2-11. 3(-15.0) mm wide. 2. Leaves peltate, deeply trilobed (0.42-)0 .50-0.86 the distance from the leaf outline to the leaf base, base truncate, central lobe narrowed at the base; 4-11 laminar nectaries present on the abaxia l surface; petiolar glands present. 11. P . juliana .

PAGE 196

174 2. Leaves not peltate, distinctly trilob ed 0.30-0.45 the dist ance from the leaf outline to the leaf base or bilobed to obscurely trilobed 0.02-0.29 the distance from the leaf outline to t he leaf base, base cordate, central lobe not narrowed at the base; laminar nectaries absent or 1-4 nectaries present on the abaxial surface; petiolar glands absent or present. 3. Petiolar glands absent; lateral l eaf lobes 0.64-0.97 times the length of the central lobe; laminar nectaries absent. 7. P . eglandulosa . 3. Petiolar glands present; lateral l eaf lobes 0.67-1.86 times the length of the central lobe; laminar nectaries absent or present. 4. Laminar nectaries absent; lateral leaf lobes 1.41-1.86 times the length of the central lobe; 2 petiolar nectaries borne on the proximal half of the petiole (0.44-0.50 of the distance from the base toward the apex of the petiole). 14. P. tacana . 4. Laminar nectaries 1-4, positioned near or at the leaf sinuses; lateral lobes 0.67-1.28 times the length of t he central lobe; 2 petiolar nectaries borne proximally or distally on the pet iole (0.29-0.90 of the distance from the base toward the apex of the petiole). 8. P . trinifolia . 1. Stipules less than 1.5 mm wide. 5. Leaves peltate; sparsely to lightly pubescent with trichomes (0.2-)0.4-1.0 mm long; sepals greenish yellow to white. 6. Leaves as long as or longer than wide; capitate or somewhat discoid petiolar nectaries present; flowers not borne in leafless inflorescences or very rarely inflorescences present.

PAGE 197

175 7. Laminar nectaries absent; leaf base cuneate to acute; sepals (2.3-)4.0-7.0(-8.3) mm long; hypanthium 2.8-4.1 mm wide; androgynophore (1.7-)2.2-3. 5 mm long; outer cor onal filaments 1.2-4.0 mm long; inner coronal filaments less than 1.4 mm long; staminal filaments 1.4-3.0 mm long, pollen ye llow; fruits globose or ellipsoid. 1. P. pallida . 7. Laminar nectaries present or absent; leaf base commonly cordate or cuneate to acute; sepals 4.0-14.6(-20. 5) mm long; hypanthium (3.0-)4.08.8 mm wide; androgynophore (2.1-)2.7-6.1(12.6) mm long; outer coronal filaments 2.5-8.1 mm long; inner coronal filaments more than 1.4 mm long; staminal filam ents 1.6-6.0(-6.8) mm l ong, pollen whitish or yellow; fruits ovoid, ellipsoid or transversely ellipsoid. 2. P. suberosa . 6. Leaves wider than long; discoid petiolar nectaries present or absent, flowers sometimes borne in leafless inflorescences or rarely ( P . clypeophylla ) inflorescences absent. 8. Laminar nectaries absent throughout; petiolar nectaries absent or rarely 1-2 nectaries present; fruits with (2-)6-11 seeds per fruit, seeds more than 3.5 mm wide. 13. P . mcvaughiana . 8. Laminar nectaries present on t he distal leaf blades or sometimes absent; petiolar nectaries present; fruits commonly with more than 11 seeds per fruit, seeds less than 3.5 mm wide.

PAGE 198

176 9. Flowers with the corona in sev en series; outer coronal filaments very dark reddish purple with yell ow tips; floral nectary absent, operculum denticulate. 10. Androgynophore 2.74.1 mm long; 40-50 filaments in the outer coronal row; androecium and gynoecium greenish yellow; anthers dehiscing proximally; styles 4.16.3 mm long including stigmas. 19. P. xiikzodz . 10. Androgynophore absent or 0.3-1. 7 mm long; 22-31 filaments in the outer coronal row; androeciu m and gynoecium reddish purple; anthers dehiscing distally; styles 1.8-3.1 mm long including stigmas. 18. P. itzensis . 9. Flowers with the corona in one or two series, outer coronal filaments greenish yellow, greenish yellow with yellow tips, greenish yellow with a flush of reddish purple at base and yellow at tips, reddish purple at base, greenish yellow at mi ddle, yellow at tips, or white with a reddish purple base and appearing band ed with light reddish purple near middle; floral nectary present; operculum plicate. 11. Androgynophore 17.4-26.1 mm long ; corona in one series, 3650 filaments; sepals 20.5-30.1 mm long, at least six times longer than wide, fused into elongate tube; pollen presented laterally. . 12. P . viridiflora .

PAGE 199

177 11. Androgynophore less than 11 mm long; corona in two series, outer corona with 28-53 filam ents, inner corona with 12-50 filaments; sepals 4.7-20.5 mm l ong, up to three times longer than wide, not fused; pollen presented subproximally to proximally. 12. Leaves obscurely trilobed (0 .02-0.07 the distance from the leaf outline to the leaf base) and subrotund. 9. P . clypeophylla . 12. Leaves distinctly trilobed (0 .30-0.61 the distance from the leaf outline to the leaf base) or bilobed to obscurely trilobed (from 0.02-0.29 the distance from the le af outline to the leaf base) and transversely elliptic. 13. Outer coronal filaments 1. 3-3.0(-4.3) mm long, strongly curved at the base so that the filaments spread ca. horizontally, with the tips oft en curved toward the sepals, linear, often capitellate; inner coronal filaments 0.9-3.3 mm long, with the inner coronal f ilaments commonly three quarters the length of to equal in length to the outer coronal filaments; leaves distinctly trilobed (0.36-0. 60 the distance from the leaf outline to the leaf base) or bil obed to obscurely trilobed (0.090.28 the distance from the leaf outline to the leaf base). 10. P. obtusifolia . 13. Outer coronal filaments 3.1-14.0 mm long, suberect at base and spreading ca. 30-100 with the tips more or less curved toward the androgynophore, linear, sometimes slightly

PAGE 200

178 dilated toward tip; inner cor onal filaments 1.4-5.6 mm long, with the inner coronal filaments commonly 1/2-3/4 the length of the outer coronal filaments; leaves bilobed to obscurely trilobed (0.02-0.27 the distance from the leaf outline to the leaf base) or distinctly trilobed (0 .31-0.61 the dist ance from the leaf outline to the leaf base). 14. Limen floor very dark reddish purple or heavily spotted with very dark reddish purple; outer coronal filaments very dark reddish purple at base, greenish yellow at middle and yellow at tips; fruits globose. 17. P . sexocellata . 14. Limen floor greenish ye llow or greenish yellow with some reddish purple spots and streaks; outer coronal filaments greenish yellow with yellow tips, greenish yellow with a flush of reddish purple at base and yellow at tips, or white with a reddish purple base and appearing banded with light reddish purple near middle; fruits globose or ellipsoid. 15. Outer coronal filament s white with a reddish purple base and appearing banded with light reddish purple near middle, 3.1-5.3(-7.0) mm long; inner coronal filaments 1.4-3.2 mm long; hypanthium 4.9-7.4(-8.1) mm wide; androgynophore (3.3-)3.8 -5.0 mm long; fruits globose. 15. P . coriacea .

PAGE 201

179 15. Outer coronal filaments greenish yellow with yellow tips, sometimes with a flush of reddish purple at base, 6.8-14.0 mm long; inner coro nal filaments 2.3-5.6 mm long; hypanthium (7 .8-)8.1-16.1 mm wide; androgynophore 4.1-10.0 mm lo ng; fruits ellipsoid. 16. P . megacoriacea . 5. Leaves not peltate; sparsely to dens ely pubescent with trichomes (0.2-)0.41.0(-1.4) mm long; sepals red or greenish yellow to white. 17. Androgynophore 17.8-23.5 mm long; flowers red; laminar nectaries absent; densely pubescent with uni cellular, curved trichomes. 18. Leaves unlobed or shallowly trilobed, lateral lobes usually less than half the length of the central lobe, c entral lobe not narrowed at the base; pedicels 2.4-5.5 cm long; outer coronal filaments fr ee from sepals; fruits globose. 4. P. lancifolia . 18. Leaves distinctly trilobed, latera l lobes more than half the length of the central lobe, central lobe distinctly to obscurely narrowed at the base; pedicels 1.1-1.8(-2.3) cm long; outer coronal filaments adnate to sepals; fruits fusiform. 5. P. macfadyenii . 17. Androgynophore 1.7-14.1 mm long; flowers greenis h yellow or whitish; laminar nectaries present or absen t; sparsely to densely pubescent with unicellular, curved trichomes. 19. Fruits fusiform; outer coronal filam ents 5.7-8.9 mm long; androgynophore 8.0-10.8(14.1) mm long. 3. P . tridactylites .

PAGE 202

180 19. Fruits globose, elli psoid, or ovoid; outer coronal filaments 1.2-6.0 (-8.1) mm long; androgynophor e 1.7-12.6 mm long. 20. Leaves as long as or longer than wide. 21. Laminar nectaries absent; leaf base cuneate to acute; sepals (2.3-)4.0-7.0(-8.3) mm long; hypanthium 2.8-4.1 mm wide; androgynophore (1.7-)2.23.5 mm long; outer coronal filaments 1.2-4.0 mm long; inner coronal f ilaments less than 1.4 mm long; staminal filaments 1.4-3.0 mm l ong, pollen yellow; fruits globose or ellipsoid. 1. P. pallida . 21. Laminar nectaries present or absent; leaf base commonly cordate or cuneate to acute; s epals 4.0-14.6(-20.5) mm long; hypanthium (3.0-)4.0-8.8 mm wide; androgynophore (2.1-)2.76.1(12.6) mm long; outer coronal filaments 2.5-8.1 mm long; inner coronal filaments more than 1.4 mm long; staminal filaments 1.66.0(-6.8) mm long, pollen whitis h or yellow; fruits ovoid, ellipsoid or transversely ellipsoid. 2. P. suberosa . 20. Leaves wider than long. 22. Central vein length less than half the width of the leaf; central and/or lateral lobes often lobed; laminar nectaries commonly absent, petiolar glands positioned at or near the petiole apex, only very rarely found proximally; flowers not borne in inflorescences; floral stipes 1.14.1 mm long. 6. P . tenuiloba .

PAGE 203

181 22. Central vein length more than half the width of the leaf; central and lateral lobes not lobed; lamina r nectaries present or absent; petiolar glands present on the dist al half of the petiole; flowers usually borne in inflorescences; floral stipes 3.1-4.6 mm long. 10. P . obtusifolia . Passiflora pallida Description of Passiflora pallida 1. Passiflora pallida L. Sp. Pl. 955. 1753. Meioperis pallida (L.) Raf., Fl. Tellur. 4: 103. 1838. Cieca pallida (L.) M. Roem. Fam. Na t. Syn. Monogr. 2: 142. 1846. Passiflora suberosa var. pallida (L.) Mast. Trans. Linn. Soc. London 27: 630. 1871. LECTOTYPE (designat ed here): Plum. Desc. Pl. Amer. pl . 89 . 1693. EPITYPE (designated here): DOMINI CAN REPUBLIC, vicinity of Ciudad Trujillo, Province of S anto Domingo, 0-25 m, H.A. Allard 16368 (epitype: US!; duplicate of epitype: NY!). Passiflora hirsuta L. Sp. Pl. 958. 1753. Passiflora suberosa var. hirsuta (L.) Mast. Trans. Linn. Soc. London 27: 630. 1871. LECTOTYPE (designated here): HISPANIOLA, Plum. Desc. Pl. Amer. pl . 88 . 1693. Passiflora minima L. Sp. Pl. 959. 1753. Cieca minima (L.) Moench. Suppl. Meth. 102. 1802. Monactineirma minima (L.) Bory. Ann. Gen. Sci. Phys. 2:

PAGE 204

182 138. 1819. Meioperis minima (L.) Raf., Fl. Tellur. 4: 103. 1838. Passiflora suberosa var. minima (L.) Mast. Trans. Linn. So c. London 27: 630. 1871. LECTOTYPE (designated by E.P. Killip, 1938, Field Mus. Nat. Hist., Bot. Ser. 19: 93): CURAAO (lectotype: LINN 1070.20, microfiche seen). Passiflora nigra Jacq. Observ. Bot. (Jacquin) 2: 27, pl . 46 , fig . 3 . 1767. LECTOTYPE (designated here): COLO MBIA, Cartagena, Boca Chica Inlet, Jacq. Observ. Bot. 2: 27 pl . 46 , fig . 3 . 1767. Passiflora parviflora Sw. Prodr. (Swartz): 97. 1788. Passiflora hirsuta var. parviflora (Sw.) M. Roem. Fam. Nat. Syn. M onogr. 2: 174. 1846. TYPE: JAMAICA, O . P . Swartz s . n . (holotype: S, photograph seen; isotype: MO!). Passiflora heterophylla Aiton. Hortus Kew. 3: 309. 1789. Cieca heterophylla (Aiton) Moench. Suppl. Meth. 101102. 1802. TYPE: WEST INDIES, introduced into cultivation at Kew Gardens in ca. 1773. (holot ype: not found). Not P . heterophylla Lam. (= P. heterophylla Aiton). 1789. Passiflora warei Nutt. Amer. J. Sci. Arts 5: 297. 1822. Cieca warei (Nutt.) M. Roem. Fam. Nat. Syn. Monogr. 2: 146. 1846. TYPE: UNITED STATES, Florida, T . Nuttall s . n . (holotype: BM !, photograph AAU!).

PAGE 205

183 Slender, climbing, perennial vine 1-7 m long or more, sparsely to densely pubescent with unicellular curved trichomes on petiole, leaf, stem, and stipule, 0.20-0.30(-0.7) mm long, 0.02-0.03 mm wide, also minutely antrorsely appressed-puberulent throughout with unicell ular, curved trichomes, 0.06-0.11 mm long, 0.02-0.03 mm wide. Flowering st ems terete or some what compressed, 0.6-1.6(-2.5) mm in diameter, greenish ye llow to very dark reddish purple, with the base woody and cork-covered. Stipules narrowly ovate-triangular, sometimes slightly falcate, acute, 2. 1-6.9 mm long, 0.2-0. 9 mm wide; petioles 0.3-1.8(-2.9) cm long, with 2 (rarely 1) , opposite to alternate, stipitate or sometimes sessile, slightly obconical to capitate nectaries (very rarely crateriform), 0.30.8 mm wide (on the widest axis), 0.2-1.1 mm high, borne in the distal half of the petiole (0.49-0.92 of the distance from the base toward the apex of the petiole). Laminas 1. 8-8.8(-12.0) cm long, (0.3 -)1.4-8.2(-10.6) cm wide, membranous, unlobed to 3-lobed, lobed 0.20-0. 50(-0.90) the distance to the leaf base, ovate to elliptic (rarely obovate), bas e cuneate to acute, lateral lobes ovate to oblong, acute (rarely obtuse or rounded), 1.0-5.1(-6.8) cm long, 0.3-2.1(-3.0) cm wide, central lobe ovate to elliptic (ra rely obovate), central vein 1.8-8.8(-12.0) cm long, angle between the lateral lobes (3 3-)50-110(-152), ratio of lateral lobe to central vein length 0.46-0.78(-0.87), ma rgins entire, hyaline, primary veins 1-3 (when more than one veins diverge and br anch at base), laminar nectaries absent; tendril 0.2-0.7(-1.1) mm wide, pres ent at flowering node. Flowers borne in leaf axils. Pedicels (2.0-)3.3-9.4(-17. 0) mm long, 0.3-0.6 mm wide, 2 per node; bract(s) absent or rarely with one narrowly ovate, acute, br act present on the

PAGE 206

184 distal half of the pedicel, 0.4-0.6 mm l ong, ca. 0.1 mm wide; spur(s) absent. Flowers (6.9-)11.7-20.4 mm in diameter wit h stipe 1.4-4.4(-6.3) mm long, 0.3-0.7 mm wide; hypanthium 2.8-4.1 mm in diam eter; sepals (2.3-)4 .0-7.0(-8.3) mm long, 1.2-3.3 mm wide, ovate-triangular, acute to rounded, reflexed at anthesis, abaxially and adaxially greeni sh yellow to very light greenish yellow (5GY 7/4, 8/4-8/2); petals absent; cor onal filaments in 2 series , the outer 20-30(-34), 1.24.0 mm long, (0.1-)0.2-0.6 mm wide, li near, slightly spreading, greenish yellow with yellow tips (5Y 8/10) or flushed with reddish purpl e (5RP 5/6-3/6) at base and greenish yellow at middle with yellow ti ps or very dark reddish purple (5RP 3/4-2.5/4) at base and yellow toward tips , ratio of outer coronal row to sepal length 0.20-0.69(-0.82), t he inner (11-)20-34, 0.8-1. 3 mm long, 0.04-0.16 mm wide, linear, capitate, erect, greenish yellow with yellow tips or greenish yellow flushed with reddish purple at base and yell ow toward tips or very dark reddish purple with yellow tips, ratio of inner cor onal row to outer coronal row length 0.360.66; operculum (0.6-)1.0-1.4 mm long, plicate, greenish yellow or greenish yellow with a flush of reddish purple at base or reddish purple or very dark reddish purple, margin white with minutely fi mbrillate teeth; nectary (0.1-)0.2-0.4(0.6) mm high, 0.2-0.6(-0.8 ) mm wide; limen recurved, erect or slightly inclined toward the operculum, 0.10.4 mm high, 0.10.3 mm wide, greenish yellow or greenish yellow flushed with reddish purple or reddish purple or very dark reddish purple, limen floor 1.6-2.6 mm in diameter, greenish yellow or greenish yellow flushed with reddish purple or reddish purple or very dark reddish purple; androgynophore (1.7-)2.2-3.5 mm long, 0.4-0.9 mm wi de, greenish yellow or

PAGE 207

185 greenish yellow with a flush of reddish purple at base or greenish yellow with reddish purple spots and streaks or very dark reddish purple; free portions of the staminal filaments 1.4-3.0 mm long, 0. 2-0.4 mm wide, linear, greenish yellow; anthers 1.1-1.9 mm long, 0.51.3 mm wide, pollen yellow; styles 1.6-4.3 mm long including stigmas, 0.1-0.4 mm wide, gr eenish yellow; stigmas 0.5-1.2 mm in diameter; ovary 1.1-1.8 mm long, (0.7-) 1.0-1.5(-1.9) mm wide, ellipsoid to globose, greenish yellow. Be rry 7.6-9.5 mm long, 6.9-8. 8 mm wide, globose, or ellipsoid, very dark purple (5P 2.5/2). Seeds (4-)8-24(-33), obovate in outline, 2.8-3.5 mm long, 1.9-2.2 mm wide, 1.1-1.4 mm thi ck, acute at both ends, reticulate-foveate with each face marked with ca. 12-20 foveae; germination type epigeal. Chromosome number 2n=24 (Snow & MacDougal, 1993). Fig. 8.2-8.4. Distribution and Ecology In New World tropics: Antigua and Ba rbuda, The Bahamas, Belize, British Overseas Territories, British Virgin Islands, Colombia, Cuba, Dominica, Dominican Republic, French Overseas Departments, French Overseas Possessions, French Overseas Territo ries, Grenada, Guat emala, Haiti, Honduras, Jamaica, Mxico, Netherlands Antilles, Netherlands Autonomous Country of Aruba, Nicaragua, Panam, Puerto Rico, Saint Lucia, Trinidad and Tobago, United Kingdom Overseas Territo ries, United States, United States Territories, United States Virgin Isl ands, and Venezuela. Introduced in the Old World tropics: Australia, British Indian Ocean Territories, Commonwealth of the Northern Mariana Islands, Comoros, Feder ated States of Micronesia, India, Madagascar, Maldives, Mauritius, Palau, Republic of Seychelles, Singapore,

PAGE 208

186 Solomon Islands, and Sri Lanka. Growing in shrubs, trees or trailing on the ground in secondary successional areas and along the edges of dry tropical forests, both inland and near the seashor e, primarily at low elevations but sometimes occurring at elevations as hi gh as 800 m. Commonly associated with calcareous/alkaline substr ate. Flowering and fr uiting throughout the year. Vernacular Names Mono hbil (Colombia), cabeza de ormiga arieda (Mxico), cansel ak' (Mxico), coceh (Mxico), corky-stem(med) passionflower (United States), dwarf passionflower (United States), lobed-leaf Passionflower (United States), poc-poc (Republic of Seychelles), pochil (Mxic o), sac cance ak' (Mxico), small passionflower (United Kingdom Overseas Territory of Bermuda), soots' ak' (Mxico), petit grain d'encre' (Reunion), ts unllahi (Mxico), uvas ak' (Mxico), wild pumpkin (United Kingdom Overseas Territory of the Cayman Islands), xlosion ak' (Mxico), x-losion xiw (Mxico ), x-st'unyah' (Mxico), and zae cansel ak' (Mxico). Ethnobotany In Reunion, the fruits may be used as a substitute for ink (Jean Jacques, pers. com.). Additional Specimens Examined Antigua and Barbuda . Antigua, St. John, of Willock Village, Box 894 (BM, US); Antigua, Bodkin Estate, Box 1258 (BM, US); Antigua, Wullschlager 235 (M);

PAGE 209

187 Antigua, Wullschlager 240 (M). Australia . –QUEENSLAND: Rockhampton, Boorman s . n ., August 1912 (B). Bahamas . –ACKLINS AND CROOKED ISLANDS: Acklins Island, Gold Rock, Brace 4414 (NY, US); Crooked Island, Marine View Hill, Brace 4774 (US); Acklins Island, about 4 mi. N of Pinefield, Correll 44459 (NY). –BIMIN I: S Bimini, Howard & Howard 10072 (A, GH, NY, S, US); S Bimini, Millspaugh 2351 (NY); S Bimini Island, along road to airport where it meets road to Sunshine I nn and Port Royale, about 1-1/3 mi. SE of the NW tip of island, Stimson 1101 (DUKE). –CAT ISLAND: At lantic shore at Bird Point, Byrne 242 (A); just S of Bennets Harbor, Byrne 319 (A); just E of Old Bight, Correll 46295 (NY). –EXUMA: Hummingbird Cay, Blair 4672 (GH, US); Hummingbird Cay, Blair 4767 (MO); Great Exuma, about 4 mi. NE of George Town along Queen's Hwy., Correll & Correll 42395 (LL, NY); Hog Island, Eggers 4051 (BM); Hog Island, Eggers 4406 (C, M); Hummingbird Ca y, at top of Mt. Earlham, Nickerson & Gross 3017 (A, MO); Hog Island, New Providence, Wilson 8262 (NY). –FREEPORT: Eight Mile Rocks, Britton & Millspaugh 2463 (NY); Eight Mile Rocks, Britton & Millspaugh 2474 (NY); Mangrove Cay, Coker 228 (NY); Grand Bahama, ca. 0.5 mi. W of Haw ksbill Creek channel (vicinity of Eight Mile Rock), Webster 10914 (US). –FRESH CREEK: Andros, across road from Andros Town Airport, Fehling 17 (NY). –GOVERNOR' S HARBOUR: Great Abaco, Abaco, along Queen's Hwy. about 8 mi. S of Marsh Harbour, Correll & Wassjausen 52077 (US); Governor's Harbor, Hitchcock s . n ., 18 November 1880(?) (MO). –HARBOUR ISLAND: S road to E end, Austin & Conroy 4724 (NY); N Eleuthera, in coppice near turn-off to road to ferry slip to Harbour Island,

PAGE 210

188 about 1.5 mi. N of Lower Bogue, Correll 40996 (NY); Maroon Hill, Correll , Nixon & Nixon 45960 (NY); Great Inagua, NW point, roadside, Dunbar 198 (A, BM); Inagua: Inagua, Hitchcock s . n ., 3 December 1890 (MO); Mathew Town, Nash & Taylor 883 (NY); Blakeville, Nash & Taylor 1097 (NY); Turtle Cove, Nash & Taylor 1167 (NY); Matthew Town, Nash & Taylor 1368 (NY); Maroon Hill, Proctor & Gillis 33948 (A, B); Eleuthera, Hatchet Bay, West s . n ., 29 June 1944 (FLAS). –KEMPS BAY: Andros Island, Mangrove Cay, Bryant 4 (GH); N Andros, Somerset Beach (S of Fresh Creek), Harvey 7753 (TEX); Andros Island, near IFAS Field Station, Kjellmark 24 (DUKE); Andros Island, Conch Sound, Northrop & Northrop 427 (NY); Andros Island, Conch Sound, Northrop & Northrop 428 (NY); Andros Island, Coppice, Crow Hill, Long Bay Cays section, Small & Carter 8713 (NY); Andros Island, Coppice, Crow Hill, Long Bay Cays section, Small & Carter 8726 (NY); Andros Island, near Fresh Creek, N section, Small & Carter 8815 (NY); Andros Island, Coppice , near Fresh Creek, N section, Small & Carter 8822 (NY); Andros Island, Coppice, near Nicholl's Town, N section, Small & Carter 8963 (NY). –LONG ISLAND: upper beach strand, Clarence Town, Harbor Area, Hill 823 (A). –MARSH HARBOUR: Abaco, Cherokee Sound, Brace 1955 (NY); Hight Point Cay, Brace 5292 (NY); Abaco, along Forest Drive, about 1.5 mi. NW of Marsh Harbour, Correll & Meyer 44600 (NY); Abaco Heights road, 1.5 mi. E of its junction with main road, Sauleda , Sauleda , Lassiter & Lassiter 3732 (NY). –NEW PROVIDENCE: Lake Cunning Lane, Britton 127 (NY); Moodlands, Lake Curving Lane, Britton 143 (NY); 1.5 mi. S of Nassau, Wight 156 (GH, NY); near Adelaide, Correll & Correll 41995 (NY, MO); near

PAGE 211

189 Waterloo, Degener 18853 (GH, NY, PH); W of Lyford Cay, Degener 18917 (MO); between Love & Gambier, Degener 18929 (GH, NY); near Harrold & Wilson Ponds, Degener 18964 (NY); Nassau, Earle 47 (NY); Northrop & Northrop 216 (GH); Salt Cay, Northrop & Northrop 242 (G). –NICHOLLSTOWN AND BERRY ISLANDS: Anderson Cay, Great Harbour Cay, Correll & Correll 43669 (NY). – SAN SALVADOR: Watling's Island, Gr aham's Harbor to Columbus' Monument, Britton & Millspaugh 6174 (NY); N of Pigeon Creek, Calkins s . n ., February 1973 (FLAS); E edge of Cockburn Town, Correll & Wasshausen 46856 (US); along path to N Arm of Great Lake, Fernndez , Gilbert , Roberto & Thornton I-56 (FLAS); Watlings, Hitchcock s . n ., 22 November 1890 (MO); Off Jake Jone's Road (to Little Lake S from Queen's Hwy.) near Barker's Point, NW part of island, Romansky , Bailey , Johnson , Breitbarth & Goussis 13 (FLAS); E Beach, E side of island, Smith with class 4767 (FLAS); near lighthouse, Stevens & Yamamoto 313 (FLAS); 2 mi. E of Rocky Point, Van Eenwyk & Holway 4-126b (FLAS); Watling's Island, SE end, Wilson 7312 (NY). Belize . –BELIZE: SW Cay II, 0-3 m, Fosberg & Sachet 53886 (MO, US); Sibun Road, Gentle 23 (F, US); Caye Caulker; N Island, Whitefoord 8223 (BM, F, MA, MO). –STANN CREEK: Northeast Cay, Glover's Reef, 0-3 m, Fosberg & Sachet 53819 (B, BM, F, GH, MO, NY, US); Tobacco Range, coconut grove in N part of Cay, Fosberg & Spellman 54461 (F, GH, NY, US); Scipio Cay, 1 m, Lentz , Claret , Costello , Griscom , Marchal & Wiesen 2344 (NY); E-central part of island, S Water Cay, 22.4 km SE of Dangriga, Pringle 1924 (MO); Middle Cay, Gl over's Reef, 0-3 m, Sachet & Stoddart 1618 (BM, MO, US); S Water Cay, 5-6 ft., Northeast Cay,

PAGE 212

190 Glover's Reef, Stoddart 66 (UC); Spellman & Stoddart 2142 (MO, US). – TOLEDO: NE Sapodilla Cay, Spellman & Stoddart 2322 (MO, US); Nicolas Cay, Spellman & Stoddart 2337 (BM, C, MO, US); Lime Cay, Spellman & Stoddart 2366 (MO, US); Hunting Cay, Spellman & Stoddart 2436 (US). Bermuda . – PAGET: Paget, Harshberger s . n ., 19 June 1905 (MO). British Indian Ocean Territory . Chagos Archipelago, Diego Garcia, Hutson 27 (BM, US); Chagos Archipelago, Diego Garcia, ocean side at NW Point, Rhyne 439a (US); Chagos Archipelago, Diego Garcia Atoll, E Point settlement, seaward coast, Stoddart 768 (US); Chagos Archipelago, Diego Garcia Atoll, W rim of atoll, S end, Stoddart 847 (US). British Overseas Territory . –TURKS AND CAICOS ISLANDS: N Caicos, along Bottle Creek airstrip, Correll 43434 (NY); Grand Turk, between village and airstrip, S of settlement, Gillis 11785 (A, BM, MO); E Caicos, Jacksonville and vicinity, Millspaugh & Millspaugh 9073 (NY); Grand Turk, Nash & Taylor 3779 (MO, NY, US); N Caicos, vicinity of KEW, Proctor 9025 (A). British Virgin Islands . Anegada, near settlement, Britton & Fishlock 1005 (NY); Anegada, Fishlock 5 (NY); Virgin Gorda, Fishlock 136 (NY). Colombia . – ATLNTICO: Usiacur, Ar royo del Higuern, 100 m, Dugand & Garcia 2277 (US). –BOLVAR: Entre Cartagena & Turbaco, 100-200 m, Dugand & Jaramillo 2844 (US); vicinity of Turbaco, 200-300 m, Killip & Smith 14164 (F, GH, MO, US); vicinity of Turbaco, 200-300 m, Killip & Smith 14168 (GH, NY, US); vicinity of Turbaco, 200-300 m, Killip & Smith 14329 (GH, US). –MAGDALENA: Buritaca, 50 mi. E of Santa Marta, Smith 1531 (NY). –SAN ANDRS AND PROVIDENCIA: Isla de San Andrs, Daniel 5650 (US); San Andrs Island, Toro

PAGE 213

191 29 (NY); San Andrs Island, along beach near Sound Bay Cemetary, Weston & Weston 5542 (UC). –SUCRE: Mpio. Cartagena, Archipelago San Bernardo, Isla de Tintipn, Mar Caribe, 2 horas por bote NW de Tol, Callejas & Bornstein 11031 (HUA). Commonwealth of the No rthern Mariana Islands . Saipan, E of Ogso Tafotchau just N of K annat Tadung Laulau, 170-190 m, Fosberg 50550 (US); Tinian, Puntan Tahgong, 5 m, Herbst & Falanruw 6791 (US). Comoros . – ANJOUAN: Schlieben 11161 (B, M, MO). –GRA N COMORE: S edge of Moroni, D'Arcy 17538 (MO). –MOHELI: Schlieben 11248 (B, M, MO). Cuba . – CAMAGEY: Camagey, 200 m, Rutten-Pekelharing 389 (U); vicinity of La Gloria, Shafer 121 (NY, US); savanna N of La Gloria, Shafer 380 (NY, US); Cayo Ballenato Medio, Shafer 1013 (NY); Silla de Cayo, Cayo Romano, Shafer 2529 (BM, NY, US); Cayo Paloma, Shafer 2564 (NY, US); Cayo Paredn Grande, Shafer 2768 (NY, US). –CIENFUEGOS: Ja rdn Botnico de Cienfuegos, area surrounding Atkins House in garden, Aceverdo-Rdgz , Oviedo & Fernndez 6503 (US); Cieneguita, Combs 304 (GH, MO, NY); Trinidad Mountains, San Blas, Howard 5254 (GH); Vegas, Soledad Estate, Jack 4196 (A); Soledad, Jack 4669 (A, DS, US); Soledad, Jack 4994 (A); Limones, Soledad, Jack 5296 (US); Farallones de Guajmico, on the coast E of Cienfuegos, Morton 10492 (US); Farallones de Guajmico, on the coast E of Cienfuegos, Morton 10518 (US). – CIUDAD DE LA HABANA: Rincn, Britton & Wilson 483 (NY); near Havana, Curiss 552 (BM, C, G, GH, M, MINN, MO, NY, PH, PR, US); Havana, Ekman 822 (S); Ro Almendares, Ekman 950 (S); Havana, Jolis s . n ., February 1871 (G); Morro Castle, Killip 13523 (US); Havana, Cojimar, Killip 13828 (US); Havana,

PAGE 214

192 Rodriguez s . n . (MA); Havana, Sagna 312 (G); Havana, Sess & Mocio 4451 (F, US); Prov. of Havana, Santiago de las Vegas, Van Hermann 863 (NY); Prov. de Havana, Santa Fe, unknown collector 7496 (US); Havana, unknown collector s . n . (MA); Havana, unknown collector s . n . (MA); Havana, unknown collector s . n . (MA). –GUANTNAMO: Guantanamo Ba y, United States Naval Station, Britton 2019 (NY, US); Ekman 3718 (G, S); E of Guantnamo, on the Va Azul, near sea level, Morton & Alain 8813 (DUKE, US); Punto de Cuer o, a mountain N of Imas, S coast of Oriente, 100-600 m, Morton & Alain 8857 (US); Beside the Ro Jauco, S coast of Oriente, 50 m, Morton & Alain 9159 (US); Ad Taco bay (Baha de Taco), vicinity of Baracoa, Pollard , Palmer & Palmer 79 (GH, MIN, MO, NY, PH, US). –HOLGUIN: near Cananova, Clemente 6238 (GH); Punta Gorda, Moa, Clemente & Alain 3940 (GH); Punta Gorda, Moa, Clemente & Alain 3941 (GH, US); Ad "El Taller", Sierra de Nipe, Ekman 2069 (S); Sierra de Nipe, prope Ro Piloto, Ekman 2708 (S); Sierre Nipe ad Ro Jimbambay, Ekman 4737 (G, S); Holguin, Cerro de Fraile, Ekman 7551 (S); Sierra de Nipe, Loma de la Estrella in fruticetis, Ekman 9837 (S); N slope of Sierra Nipe, 400 m, Morton & Acuna 2936 (US); N slope of Sierra Nipe, 400 m, Morton & Acuna 3000 (UC, US); S of lumber camp, crest of Sierra Nipe, 600-700 m, Morton & Acuna 3091 (US); Crest of Sierra Nipe, 600-700 m, Morton & Acuna 3171 (UC, US); S of lumber camp, crest of Sierra Nipe, 600-700 m, Morton & Acuna 4522 (US); Sierra Nipe, near Woodfred, 450-550 m, Shafer 3071 (NY, US); Sierra Nipe, near Woodfred, 450550 m, Shafer 3073 (NY, US); Sierra Nipe, near Woodfred, 450-550 m, Shafer 3208 (NY, US); Sierra Nipe, near Woodfred, 450-550 m, Shafer 3597 (NY). –

PAGE 215

193 ISLA DE JUVENTUD: Nueva Gerona, Sie rra de Caballos, on top of the Sierra, Ekman 12349 (S); near Culeta Grande, Jennings 525 (NY); near Culeta Grande, Jennings 528 (NY); N of Hotel Isle of Pines, Nueva Gerona, Killip 44110 (US); along road to San Francisco de las Piedras, Killip 44886 (US); along road from Nueva Gerona to Santa Brbara, Killip 45109 (US); Santa Fe, Treleau s . n ., 10 March 1807(?) (MO). –LA HABAN A: between Madruga and Robles, Shafer 36 (NY); near Bajucal, Van Hermann 331 (NY). –MATANZAS: vicinity of Matanzas, Britton , Britton & Shafer 28 (NY); vicinity of Matanzas, near Matanzas Bay N of city, Britton , Britton & Shafer 179 (NY); vicinity of Matanzas, Empalme, Britton , Britton & Shafer 584 (NY); Prov. Matanzas, gorge of the Luruuni, Britton & Wilson 130 (NY); Cardenas, Britton & Wilson 193 (NY); Varadero, Killip 13941 (US); Matanzas, Rugel 169 (NY); Circa Matanzas, Rugel s . n ., 1857 (NY); Prov. Matanzas, near Matanzas, Van Hermann 914 (NY). –PINAR DEL RO: Pinar del Ro, Alain 2278 (GH); Ames s . n . (ECON); Junto a Soroa, subida al Castillo de las Nubes, 250 m, Casas & Valverde 10741 (MA, MO); Soroa, Een s . n . (S); W of Guane, Shafer 10378 (NY); Base of Sierra Guane, Shafer 10564 (NY, US); vicinity of Los Palacios, Shafer 11677 (NY, US); vicinity of Sumidero, Shafer 13509 (NY); trail from Buenaventur a to San Juan de Guacamaya, Wilson 9348 (NY, U). SANTIAGO DE CUBA: Santiago, Bailey 15109 (US); near Santiago, Clemente 5139 ; (GH, US); Nipero, Santiago, Clemente 5187 (GH, US); El Morro, Santiago, Clemente 5309 (GH, US); Sardinero, Santiago, Clemente 5779 (GH, US); Sardinero, Santiago, Clemente 5781 (GH); Sardinero, Santiago, Clemente 5784 (GH); Sardinero, Santiago, Clemente 5829 (GH, US); Justici, Santiago,

PAGE 216

194 Clemente 6250 (GH); Justici, Santiago, Clemente 6369 (GH, US); Justici, Santiago, Clemente 6395 (GH, US); between Sardi nero and Siboney, Santiago, Clemente 6396 (GH); prope Santiago de Cuba, in fruticet is litoralibus ad Santiago bay, Ekman 1431 (S); prope Santiago de Cuba, Ekman 7977 (S, US); en las Lomas junto al Pueblo de Siboney, Santiago de Cuba, Figueiras 198 (US); Santiago, Havard 33 (NY); Santiago, Havard 35 (NY); Santiago, Havard 165 (NY); near El Morro, Santiago de Cuba, Morton 3314 (US); near El Morro, Santiago de Cuba, Morton 3315 (US); Morro Castle, near Santiago, near sea level, Morton , Alain & Lopez 8727 (DUKE, US); Femina, Wright 2597 (GH). – VILLA CLARA: La Magdalena, Cayamas, Baber 4947 (NY); Ro San Juan, Britton , Earle & Wilson 5899 (NY); Dist. Cienfuegos, Cieneguita, Combs 50 (GH, NY); 10 kms W of Santa Clara, Howard 5037 (GH); Potrero Seboruco at Gaviln, Howard , Briggs , Kamb , Lane & Ritland 30 (UC); 5 km W of Santa Clara, Howard , Briggs , Kamb , Lane & Ritland 441 (A, MIN, UC); Soledad, Hunnewell 11583 (NY); Caunao River to Cienfuegos Bay, mouth of Caunao River, Jack 4183 (A); Soledad, Cienfuegos, Jack 6011 (A, US); Limones, Soledad, Cienfuegos, Jack 6057 (A); Magdalena, Neeiter s . n . (MA); vicinity of Sancti Spritus, Shafer 12145 (NY); Caleton de Don Bruno, N of Castillo de Jagua, Smith , Hodgdon , Cheadle & Taylor 3075 (GH, US); La Luisa in Monte Toro, Wright 1245 (NY); Playa Larga W part, unknown collector 891 (PR); Playa Larga, cooperativa pasquera, unknown collector 937 (PR). Dominica . –SAINT PATRICK: SE coast, path between Delices & Belvedere Estate, 250 m, Whitefoord 3758 (BM). –UNKNOWN PARISH: Ehb . 341 (B); Curassae, Schlmeyer 42 (B); Curassae, Schlmeyer 331

PAGE 217

195 (B). Dominican Republic . –BAORUCO: Dos Brazos, 8.5 km N of Neiba, 400 m, Maas , Maas & Garcia 8391 (U). –BARAHONA: Trujin, sea level, Abbott 1715a (US); Trujin, sea level, Abbott 1724 (US); Fuertes 160 (G, NY, US); N end of Beata Island, Howard 12449 (A, US). –DIST. NACION AL: vicinity of Santo Domingo, 0-25 m, Allard 16368 (NY, US); Haina, Faris 24 (US); Haina, Faris 310 (US); about 0.9 km NE of Boca Chica, 50 ft., McDaniel 27160 (NY); 1.5 km W de Boca Chica, frente a la playa de Andrs, 5 m, Mejia & Cabral 1767 (NY); 1.5 mi. N of Autopista de Las Am ricas, due N of Aeropuerto de Las Amricas, 25 m, Mejia & Zanoni 6080 (JBSD); 8 km from La Batatas (via Laguna La Jagita) on road to Mata de Piedra and La Catalina, 20 m, Mejia & Zanoni 9744 (MO, NY); Jardn Botnico Nacional; en la parte N de la reserva forestal, 70-80 m, Peguero , de la Cruz & Davis 1591 (MO); Santo Domingo City, Rose , Fitch & Russell 3796 (NY, US); 4 km E of Boca Chic a on limestone outcrops, sea cliffs, Terborgh & Brockmann 148 (GH); S side of hwy. (Santo Domingo to San Pedro de Macoris) between Guayacanes and Juan Dolio, 5 m, Zanoni , Mejia & Ramrez 11433 (NY). –EL SEIBO: vicinity of Higuey, near Canada Honda, Howard & Howard 9754 (BM, GH, NY, S, US); vicinity of Higuey, Howard & Howard 9828 (GH, NY, S, US). –ELAS PIA: Vieja Estrelleta, 9.1 km SW de El Cercado en la carretera a Hondo Valle, entre Sonador & Juan Santiago, 740 m, Zanoni 27976 (JBSD). –INDEPENDENCIA: aprox. 12 km S de Duverg, en el lugar llamado Monte Palma, 860 m, Garcia , Caminero & Honer 4451 (B); Balneario La Zursa, 30 km SE of Jiman, on road to Du verg, or 1.5 km E of Baitoa, Mejia & Zanoni 7139 (MO, NY). –LA ALTAGRACIA: Bayahi be, carretera Higuey-Bayahibe a 1.5

PAGE 218

196 km del cruce, 20-30 m, Acevedo-Rdgz ., Siaca , Garcia & Pujals 8480 (NY, US); 1.2 km NW de Cabeza de Toro, camino de costa, in cocal cerca de playa, Mejia & Zanoni 6283 (NY); Half-way between Boca del Yuma town and El Caracol (old bridge over Ro Duey, N of town), 20-60 m, Zanoni , Mejia & Ramrez 10740 (JBSD, MO, NY). –LA ROMANA: Saona Island, Fairchild 2625 (CAS, NY, U, US); Saona Island, Jimnez & Marcano 3389 (US); Saona Island, Jimnez & Marcano 3391 (US); Ro Cumayasa river valle y, just N of town of boca de Cumayasa, on SW side of river mouth, 0-20 m, Mejia & Ramrez 14786 (JBSD, MO, NY); Altos de Chavn, on road from Altos to Presa de Chavn, 60 m, Mejia & Zanoni 6193 (JBSD); SW of the Presa Chav n, area of upland on W side of Ro Chavn, 50-60 m, Mejia & Zanoni 9178 (MO, NY); La Uvita, S of Cumayasa, km 10 on Mar Caribe coast, 10 m, Mejia & Zanoni 9381 (NY); about 1 km N of bridge over Ro Dulce at city of La Romana, NE bank of river limestone cliffs, 30 m, Zanoni , Mejia & Ramrez 11670 (JBSD); Isla Catalina en la costa occidental N del Campamento de la Marina de Guerra, 5-8 m, Zanoni , Mejia , Garcia & Santana 37212 (NY); Isla Catalina el lado de l sur, entre Punta Perez (SW) & Punta Berroa (SE), 5-10 m, Zanoni , Mejia , Garcia & Santana 37263 (JBSD, NY). –LA VEGA: vicinity of Piedra Blanca , knob S of Piedra Blanca, 200-500 m, Allard 17783a (US). –MARA TRINIDAD S NCHEZ: Cabo Frances Viejo, Smith 10452 (JBSD, NY). –MONTE CRISTI: 600 km N de la reserva cientfica "Dr. Orlando Cruz Franco", 125 m, Garcia & Pimentel 781 (JBSD); near Puerto Libertador, Manzanilla Bay, Howard & Howard 9633 (BM, GH, NY, S, US). – PEDERNALES: 22 km N del puerto de C abo Rojo en la carretera de Alcoa

PAGE 219

197 Exploration Company a las Mercedes & Aceitillar, 400 m, Zanoni & Pimentel 25943 (JBSD); Mina Las Mercedes de Alcoa Exploration Company, N de Cabo Rojo, 400-420 m, Zanoni , Howard & Howard 39059 (A). –PUERTO PLATA: en manigua costera, Cabaret e, Puerto Plata, Alain & Liogier 26347 (JBSD); Cercanas a Cofresi, Colella , Garcia & Pimentel 1304 (LL). –SAMAN: Saman and vicinity, Miller , Jr . 1116 (US); Saman and vicinity, Miller , Jr . 1117 (US); Playa El Rincn, alon g Ro Fro, sea level, Mejia & Zanoni 6545 (NY); Playa El Rincn, above Ro Fro, at NW edge of beach, 0-50 m, Mejia & Zanoni 6566 (JBSD, MO, NY); Saman, Wright , Parry & Brummel 27&28 (US); Saman, en la zona Costera entre el km 4 & el km 5 E del pueblo de Las Terrenas, en el rea de "protillo," 3 m, Zanoni & Mejia 17728 (NY). –SAN CRIST”BAL: Nigua, Faris 442 (US). –SAN PEDRO DE MACORIS: 20 km W of San Pedro de Macoris, Howard & Howard 9498 (B, GH, NY, US). Santiago, El Castillo, Santiago de los Caballeros, 200 m, Jimnez 1419 (US); Los Montones, 800 m, Jimnez 1646 (US); Jaiqu Picao, midway between Santiago de los Caballeros and San Jos de las Matas, Jimnez 3584 (US); Town S of Boca de Soco, at SW bank of Ro Soco at its mouth, small villa ge along river and sea coast, 5 m, Mejia & Zanoni 8595 (JBSD). –SANTIAGO RODRGUEZ : 20 km desde Sabaneta en la carretera a Moncin, 250 m, Zanoni & Pimentel 25441 (JBSD, MO, US). Federated States of Micronesia . –POHNPEI: Ascension Island, 500 ft., Saltis 385/5 (BM). French Overseas Department . GUADELOUPE. Port-Louis, Duss 2626 (NY); Duss 3539 (NY); Gourbeyre (Mor ne Boucanier), 250-650 m, Duss 3616 (C, NY, US); Gozier, Mouls, Duss 3616 (NY); St. Barthlemy, Chauvette,

PAGE 220

198 Le Gallo 534B (U); Lamentin, Apres Duportail , en prenant le sentier du Chemin des Contrebandiers, 300 m, Jeremie 295 (A, US); St. Barthlemy, Le Rhin, Questel 323 (US); St. Barthlem y, Morne Dalrin, Questel 585 (US); St. Barthlemy, Hub Janiche, Questel 666 (US); St. Barthlemy, L'Orient, Questel 370 (NY); Port Louis, Questel 4033 (US); Pointe Pitre, Stehle 1493 (US); Marie Galante, Capesterre, 25 m, Stehle 190 (S, US); Saintes, Terre de Haut, Stehle 253 (US); Route de Pointe Pitre au Zoner, Stehle 317 (US). MARTINIQUE: Saint Martin, near Mullet Pond, Boldingh 2764 (U); Grimpant, Hauteurs des Crois-Flets, Duss 886 (NY); Duss 4690 (C, NY); Saint Martin, Rijgersmaa s . n . (S). French Overseas Possession . Glorioso Islands, NW corner of Gloriosa Island, sea level, Frazier 107b (CONN, US). French Overseas Territory . NEW CALEDONIA: Sable de corail, Anse Vata pres Nouma, Baumann 5126 (NY); Pente SW du Pic Nga, le des Pins, Baumann 13826 (US); lot Matre, Korallen, Baumann-Bodenheim 5085 (MO); Loyalty Islands, Lifu Island, Cap des Pins, Cheesman 3319 (BM); Sous-bois S sol calcaire, lot Matre pres Nouma, Guillaumin & Hurlimann 727 (NY, US); Route de Yat, Les Dalmates, 150 m, MacKee 30708 (MO); Anse Vata, McKee 1974 (US); Ouen Toho, at S end of Nouma, 20 m, McPherson 4591A (MO); Ouen Toho, at S end of Nouma, McPherson 4591B (MO); W side of Rivire des Pi rogues near Baie des Pirogues, Musselman , Delzell & Rich 5360 (UC). Grenada . –ST. GEORGE: near Mount Parnassus, Broadway 1720 (GH, NY). Guatemala : –PETN: W des Lago Petn Itz, in der umgebung einer weide nahe dem seeufer, das ist 0.8 km NE Zentrum von San Jos (NNE Chakmamant ok-Felsen bzw. SE Nuevo San Jos),

PAGE 221

199 120-140 m, Wallnfer & Tut-Tesucun 5916 (MO); W des Lago Petn Itz, Bereich des Gipfels am Chakmamantok-Fel sen, das ist 0.5 km NE Zentrum von San Jos, 150 m, Wallnfer & Tut-Tesucun 6006 (MO); Dos Lagunas, Ixcanro, on Aguas Turbias Road, Contreras 8687 (F, LL, MO). Haiti . –ARTIBONITE: vicinity of Ennery, 325-900 m, Leonard 8811 (US); N of Ennery, 325-900 m, Leonard 9726 (GH, US); NE of Gros Morne, 235 m, Leonard 9788 (US); Marmelade, 3400 ft., Nash 785 (NY). –NORD: vicinity of St. Michel del Atalaye, 350 m, Leonard 7140 (NY, US); W of St. Raphal, 350 m, Leonard 7662 (US); vicinity of Pilate, 325 m, Leonard 9631 (US); Bayeux, near Port Margot, sea level, Nash 155 (NY); Cap Haitien, about sea level, Nash 948 (NY). –NORDOUEST: Port de Paix, Ekman 3925 (S); vicinity of Port de Paix, Leonard & Leonard 11181 (NY, S, UC, US); Tortue Is land, vicinity of La Valle, Leonard & Leonard 11323 (US); vicinity of Cabaret, Baie des Moustiques, Leonard & Leonard 11901 (MO, NY, US); Tortue Island, vici nity of Basse Terre, beach E of harbor, Leonard & Leonard 13952 (US). –OUEST: Massi f de la Selle, Port-auPrince, near Mariani, Ekman 9347 (S, US); Morne L' Hospital, Port-au-Prince, 300 m, Holdridge 1128 (US); vicinity of Etroite, Gonave Island, Leonard 3314 (US); vicinity of Port-au-Prince, on road to Ptionville, Leonard 3462 (NY, US); vicinity of Port-au-Prin ce, road to Ptionville, Leonard 3463 (US); tang Saumtre, vicinity of tang, Leonard 3562 (BM, GH, PH, US); vicinity of Ptionville, 350 m, Leonard 4997 (BM, US); Gonave Island , vicinity of Pikmi, Leonard 5135 (GH, NY, US); Herbarium at the Faculte D'Agronomie at Medicine Veterinaire at Damien, 310 m, Paul & Porter-Utley AP516 (FLAS); near Hotel

PAGE 222

200 Castel Haiti, Port-au-Prince, Read 232 (A). Honduras . –ISLAS DE LA BAHA: Swan Islands, larger Island, Nelson 106 (GH); Swan Islands, larger Island, Nelson 107 (GH); Isla Santillana o de Swan, Nelson , Ruz & Gmez 9728 (TEFH); Cayo Grande de Cayos Vivorillo, Valerio 270 (MO, TEFH). India . – WEST BENGAL: Calcutta, Kuntze 6385 (NY). Jamaica . –CLARENDON: Peckham Woods, near Aenon Town, 2300 ft., Crosby & Anderson 1233 (DUKE); Round Hill, SW of Milk River, 10-360 m, Gentry & Kapos 28403 (MO); Lower Clarendon, 300 ft., Harris 12747 (GH, MO, NY, US); Portland Point, West & Arnold 153 (FLAS). –HANOVER: Lucea, Hitchcock s . n ., 3 January 1891 (MO). –KINGSTON: vicinity of Kingston, Maxon & Killip 338 (BM, GH, MO, US). – MANCHESTER: VICINI TY of Mandeville, Crawford 115 (NY, PH); vicinity of Mandeville, Crawford 680 (PH); vicinity of Mandeville, Crawford 681 (PH); vicinity of Mandeville, Crawford 737 (PH); vicinity of Mandeville, Crawford 742 (NY, PH); vicinity of Mandeville, Crawford 759 (PH); near Greenvale, Maxon & Killip 1701 (BM, GH, US). –POR TLAND: Navy Island, Fredholm 3076 (NY, US); Port Antonio, Hitchcock s . n . (MO); Port Antonio, Wight 23 (NY). –ST. ANDREW: near Ferry, 50 ft., Adams 8327 (DUKE); Lime Cay, 4 ft., Adams 12258 (M); Red Hills, Sutherton, 200 m, Grant & Barkley 22J065 (DUKE); Content Road, 1260 m, Harris 6649 (BM, NY); vicinity of Mona Mountain, E of Hope Gardens, near Kingston, 1200-1500 ft., Maxon 1679 (US); 1.5 mi. SSW of Lucky Valley, along the road to Bull Bay, 403 ft., Porter-Utley , Paul , & Scott P-57 (FLAS); N slope of Long Mountain, 800 ft., Yuncker 17191 (BM, NY, S); N sl ope of Long Mountain, 1000 ft., Yuncker 17325 (NY). –ST. ANN: Mine are near Lydford Post Office,

PAGE 223

201 Howard & Proctor 13477 (A); Middlesex, Hunnewell 11040 (NY); County of Middlesex, Mt. Diablo, Hunnewell 15320 (GH); Middlesex, Hunnewell s . n ., 31 January 1938 (NY); Middlesex, Hunnewell & Griscom s . n ., 13 March 1936 (GH); Union Hill and vicinity, N slopes of Mount Diablo, 400-750 m, Maxon 10398 (US); Discovery Bay, Whitefoord 1439 (BM); 100-200 m, Yuncker 18631 (NY). ST. CATHERINE: Bog Walk, Crawford 824 (PH); vicinity of Ewarton, 200-300 m, Maxon & Killip 343 (US); vicinity of Ewarton, 200-300 m, Maxon & Killip 389 (BM, GH, US); Pigeon Island, 10 mi. off Old Harbour Bay, Maxon & Killip 1580a (US); E slope of the Hellshire Hills, 200-400 ft., Proctor 7518 (TEX). –ST. ELIZABETH: near pit 101, Kaiser mine area S of Gutters, Howard & Proctor 13763 (A); near pit 101, Kaiser mine area S of Gutters, Howard & Proctor 13866 (A); on the Jones River, not far fr om Ginger Hill, 900 ft., Kramer 1752 (U); Saugster 540 (BM). –ST. JAMES: n ear the mouth of Great Riv er, W of Montego Bay, sea level, Maxon & Killip 1426a (US); vicinity of Montego Bay, Maxon & Killip 1655a (US); vicinity of Montego Bay, Maxon & Killip 1657 (GH, US). –ST. THOMAS: Mi. 13.5 on Windward Rd., 300 ft., Adams 5496 (BM); Yallahs Valley, 668 m, Harris 6877 (BM, NY); 14 mi. SE of Kingston toward Morant Point, Wunderlin 5135 (MO); Morant Point, 0-10 ft., Yuncker 18184 (BM, G, MO, NY, S). – TRELAWNY: near road between Troy and Crown Lands, 1700 ft., Anderson & Sternberg 3238 (DUKE); Quickstep Forestry Road, Kay SQFR1 (FLAS); Florida Beach near Falmouth, West , Arnold & James 790 (FLAS). –WESTMORLAND: about 2 mi. W of White House, 0-100 m, Yuncker 18026 (NY). Madagascar . Lemberano, Hildebrandt 3264 (G, M). Maldives . –SEENU: Addu Atoll, Gan

PAGE 224

202 Island, S side of airstrip, Sigee 55 (US). Mauritius . –AGALEGA ISLANDS: N Island, Stoddart 7231 (US); S Island, Stoddart 7263 (US). –UNKNOWN DISTRICT AND DEPE NDENCY: Round Island, basalt islet off N coast of Mauritius, 340 m, Lorence DL1559 (MO); Black River, Tillich 3558 (MSB). Mxico . –CAMPECHE: Mpio. Calakmul, 1 km N de Narciso Mendoza, camino a Xpujil, 250 m, Alvarez 466 (MO); 10 km N del Centro Regional de Calakmul, 55 km S de Conhuas, Cabrera , Rammamoorthy , Godinez & de Cabrera 4475 (DUKE); Mpio. Hopelchn, 11 km S de la frontera Yucatn-Campeche, ca. de San Antonio Yax-che, Carnevali , May & Tapia 5675 (CICY); Carmen, Edo. de Mxico rumbo a Monclova, 12 m, Chan 6370 (CICY); 10 km S de Constitucin, Mpio. Champotn, 141 m, Gutierrez 4265 (CICY); Chicana, Mpio. Champotn, 150 m, Gutierrez 4442 (CICY); regin de Calakmul , a 2 km W de Calakmul, camino a La Laguna, 184 m, Martnez , Alvarez & Ramrez 27676 (MO); Mpio. Calakmul, loc. a 6 km S de la entrada a Calakmul, 120 m, Martnez , Alvarez , Ramrez , Lira , Madrid 28871 (MO); Calkin, camino entre el Remate & Tancuch, 5 m, Rico-Gray & Burgos 509 (CICY, XAL); Poxil, Champotn, 80 m, Ucan 3947 (CICY); Entre Chicana & Chichonal , carretera a Chetumal, Mpio. Champotn, Zamora 4644 (CICY). –QUINTANA RO O: 8 km S de Akumal, carretera Cancn-Tulum, Cabrera 1475 (MEXU); 2 km E de Carrillo Puerto, rumbo a Viga Chico, Cabrera & de Cabrera 3556 (MEXU); 8 km al S de la desviacin a Puerto Morelos sobre la carretera a Tulum, en el Rancho el Chechen, Cabrera & Cabrera 7834 (MO); 1 km S de Playa San Francisco, Isla de Cozumel, Cabrera & Cabrera 10526 (MO); 3 km N de la carretera transversal

PAGE 225

203 sobre el camino a San Gervacio, Isla de Cozumel, Cabrera & Cabrera 10575 (MO); en el antiguo aeropuerto de Cancn, sea level, Cabrera & Larate 1545 (MEXU); 6 km S de Akumal, s obre la carretera a Tulum, Cabrera , Sousa , Davidse & Chater 2584 (MEXU, MO); Jardn Bo tnico Benito Jurez, Duran 2368 (CICY); Xcaret, Solidaridad, Duran & Cruz 2356 (CICY); Carillo Puerto, entre Lag. Uvevo & Punta Herrero, nivel del mar, Espejel 551 (CICY); Punta SSE de la isla Punta Celerain, Mpio. Cozumel, Espejel & Rico-Gray 119 (CICY); San Carlos, Mpio. Jiquipilas, 680 m, Farrera 605 (MEXU); X'cacel-X'cacelito, aprox. 13 km N de Tulum sobre la carre tera federal 307 Chetumal-Puerto Jurez, estas bahas colindan N con la s de Chemuyil & S con las de Xel-ha, Mpio. de Solidaridad, Gallardo , Rincn , Hanan & Lozada 2253 (MO); Cob, Lundell & Lundell 7653 (LL); Cayo Centro, lado E Banco Chinchorro, Mpio. Othon P. Blanco, 1 m, Narvaez & Ucan 892 (CICY); Hwy. 307 between Chetumal and Cancn, 30 m, Porter-Utley & Mondragn 393 (CICY); 53 km S de Tulum, Tellez 2054 (CAS, MEXU); Punta Sam, a 7 km NW de Cancn, Mpio. Isla Mujeres, Tellez & Cabrera 1547 (CICY); 15 km S de F. Carrillo Puerto, Tellez & Cabrera 2071 (MEXU, MO); 17 km N de Felipe Carrillo Puerto, Tellez & Cabrera 2513 (MEXU); 4 km de Quintana Roo, Tellez & Rico 3357 (MEXU); Tulum, rumbo a Boca Paila, Solidaridad, 5 m, Ucan & Poot 5074 (CICY); Isla Mujeres near Punta Sur, Webster & Lynch 17623 (MO). –SAN LUIS POTOSI: Temazunchale, Edwards 583 (F). –TAMAULIPAS: San Jos, LeSueur 307 (US); Gmez Farias, 3 km below city plaza off main road, MacDougal 259 (DUKE, US); Las Yucas, along the road which bears W-SW from Village of Las

PAGE 226

204 Yucas for 2.2 mi., 360-400 m, Mayfield , Hempel & Jack 861 (TEX); 3 mi. W of Gmez Farias, ca. 40 mi. NW of Ciudad Mante, Ward 5856 (FLAS). – VERACRUZ: Ejido Villa Rica, Mpio. Actopan, 250 m, Acosta & Vazquez 634 (XAL); Mpio. Emiliano Zapata, 0.5 km de la desviacin a Carrizal por la carretera Xalapa-Veracruz, Calzada 1838 (F, XAL); Mesa de Olvera alrededores de Jalcomulco, Mpio. Jalcomulco, 700 m, Castillo & Medina 2872 (XAL); Jalcomulco, Cerro del Brujo, 3 km NE de Jalcomulco, Mpio. Jalcomulco, CastilloCampos & Zamora 8660 (XAL); Playa La Roqueta, cerca de Laguna Verde, Mpio. Alto Lucero, 2 m, Chazaro & Hernndez 3331 (XAL); Mpio. Alto Lucero, alrededores de la Planta Laguna Verde, 10 m, Dorantes 5281 (XAL); along road from Baos de Carrizal to Emiliano Zapat a (=Carrizal), 2-6 km SE of Emiliano Zapata, Mpio. Apazapan, 250-400 m, Hansen & Nee 7513 (F); Carrizal, 400 m, Nevling , Gmez & Gmez-Pompa 2352 (F); Plan del Ro, Mpio. de Dos Ros, 300 m, Ventura 5788 (CHAPA); La Cumbre, Mpio. de Dos Ros, 250 m, Ventura 8538 (CHAPA). –YUCATN: Rancho Sant a Ana (localidad dudosa), Buctzotz, Caballero & Sosa 254 (CICY); 2 km W de Chelem, sobre la carretera ProgresoChuburn, Cabrera & Cabrera 9333 (MEXU); Mpio. Progreso, Colonia Costa Blanca, por la carretera para Chicxulub, 10 m, Calizada , Ucan , Chan & Burgos 6540 (CICY, XAL); Mpio. Mrida, Jardn Botnico Regional del CICY, region NW de la Ciudad de Mrida, cerca de Cordemex, 8-10 m, Carnevali 5120 (CICY); Mpio. Progreso, carretera Mrida-Sierra Papacal-Chuburn Puerto, ca. 11 km N de Sierra Papacal, 3-10 m, Carnevali & May-Pat 5946 (CICY); Mpio. Progreso, Chelem Puerto, 0-15 m, Carnevali & Ramrez 4270 (CICY, MO); Mpio. Progreso,

PAGE 227

205 Chelem, unos 3-5 km W de Progreso, 0 m, Carnevali & Ramrez 5588 (CICY); Xcaret, Solidaridad, Duran & Cruz 2357 (CICY); Mpio. Tizimn, 6 km W de Tizimn, Duran , Sima & Tun 2606 (CICY); 1 km N de Conkal (Zona No. 7), Progreso, Flores s . n ., 1932 (F); Buena Vista Xbac, Gaumer 1082 (A, CAS, F, GH); Silam, Gaumer 1304 (F, PH); San Anselmo, Gaumer 2168 (F, MO); San Anselmo, Gaumer 2169 (F); Gaumer 23971 (F, G, GH, MA, MO, US); Gaumer 24417 (F, G); S Kancabconot, Gaumer & sons 23606 (F, G, GH, US); Lake Chichankanab, Gaumer & sons 23669 (F, G, UC, US); Lake Chichankanab, Gaumer & sons 23692 (F); Las Coloradas, Mpio. Ro Lagartos, nivel del mar, Leal & Espejel 199 (CICY); Chichn Itz, Valladolid Road, Lundell & Lundell 7446 (LL); Chichn Itz, near Pist, Lundell & Lundell 7546 (F, GH, LL, TEX, US); Progreso, km 29 Mrida Road, Lundell & Lundell 8030 (LL, TEX, US); Mpio. de Valladolid, Xuilub, 25 m, Mogensen 1226 (AAU); Al S del campamento de Uxmal, Mpio. Santa Elena, 70 m, Narvaez & Puch 354 (CICY, XAL); Oxkutzcab, en Labn cerca del arco, Narvaez & Puch 530 (CICY, XAL); Mrida, CICY, Jardn Botnico, 20 m, Porter-Utley & Mondragn 412 (CICY); Off of Mxico 180 between X-can and X-Uilub, 60 m, Porter-Utley & Mondragn 403 (CICY); Zona de experimentacin del INIP, Mpio. Mococha, Puch 777 (CICY); Mpio. Tekax, Labn, adherida a la parte trasera del arco, 80 m, Puch & Narvaez 239 (CICY); Oxkutzcab, Labn, S de la entrada, 10 m, Puch & Narvaez 488 (CICY, XAL); 6 km de Sisal, rumbo a Celestn, Mpio. Hunucm, nivel del mar, Puch , Narvaez & Espejel 572 (CICY, XAL); camino Uxmal-San Simn, Mpio. Santa Elena, 70 m, Puch , Narvaez & Ucan 561 (CICY); 2 km SW de Conkal, Mpio. Conkal, Rivera

PAGE 228

206 25 (CICY); Mpio. Conkal, Rivera 157 (CICY); Oxkutzcab, Xu l, lado SW camino a milpa dsv. 3 km carreter a Salv. Alvarado, 60 m, Sanabria & Sima 159 (CICY); Oxkutzcab, Xul, camino antiguo a Benito Jurez 4 km, 60 m, Sanabrio & Sima 194 (CICY); Mrida, Schott 157 (BM); Mrida, Schott 898 (BM, F); Mrida & cenote, Zambula, Schott 983 (BM); Tixcacaltuyub 13 km rumbo a Peto, crucero Santa Mara, Yaxcab, Sima 421 (CICY, MEXU); Pist, Steggerda 240 (F); M . Steggerda 45a (F); Valladolid, a la orilla del camino hacia Tinum, en las viviendas, 22 m, Ucan 130 (CICY); Tinum, en los terrenos de Chan noh haltun a 100 metros de, 22 m, Ucan & Ucan 2382 (CICY, XAL); Yaxc ab, Tixcacaltuyub, 20 m, Vargas & Sima 370 (CICY); Yaxcab, Tixcacaltuyub, Vargas & Sima 450 (CICY, XAL); Yaxcab, Tixcacaltuyub, 24 m, Vargas & Sima 595 (CICY). Netherlands Antilles . BONAIRE: Boldingh 7042 (U); Soebi, Boldingh 7203 (U); Mont Kr, Boldingh 7396 (U); Stoffers 545 (U). CURAAO: Boldingh 4726 (U); Boldingh 4926 (U); Boldingh 5107 (U); Santa Martha, Britton & Shafer 2975 (NY, U, US); Hofje Abau, Curran & Haman 184 (GH); near Sint Christoffelberg, Curran & Haman 205 (CAS, GH, PH, US); near sea level, Killip & Smith 21044 (GH, NY, US); Roi Beru, Stoffers 209 (A, U); Christoffelberg, bij het Zadel, Stoffers 1304 (U); Piscaderabaai, Voet Veerisbe rg, Slingerend over struiken, de Wilde 44a (U). SINT EUSTATIUS: N rim of the Quill, 580 m, Howard 18112 (A). Netherlands Autonomous Country . ARUBA: Arnoldo 187 (U); Boldingh 6515 (NY, U); Stoffers 1693 (U); Stoffers 2036 (U). Nicaragua . –ZELAYA: Cayo Palmeta, 010 m, Stevens & Krukoff 20764 (MO). Palau . –KOROR: R . Bishop P-10192 (US). Panam . –PANAM: Bella Vista, at sea level, Killip 12039 (US); Bella

PAGE 229

207 Vista, Standley 25357 (US); Nuevo San Francisco, Standley 30733 (US). –SAN BLAS: San Blas, Duke 6502 (MO); Isla Mosquito or Sunset Island, Duke 8874 (MO); Soskatupu, island ca 1.5 mi. long, 0.5-0.7 mi. broad, 0-150 ft., Elias 1692 (MO, UC); near Puerto Obald a, San Blas coast, 0-50 m, Pittier 4402 (US). Puerto Rico . –BAYAM”N: Bo. Hato Tejas, series of mogotes W of Rt. 871 (only central pair collected), 25-100 m, Axelrod & Axelrod 2346 (MO). –CABO ROJO: Salinas de Boquern, Britton , Cowell & Brown 4637 (NY); Salinas de Cabo, Rojo ad Punta de Aguila, Urban 644 (BM, G, GH, M, PR, S). –CAJA DE MUERTOS: Caja de Muerto Island, Cobin & Woodbury MB274 (NY); Cayo Muertos, N.L. Britton, Cowell & Brown 5030 (NY). –CIALES: Bo. Hato Viejo, Rt. 6685, 1 km N jct Rt. 632, 50 m, Axelrod & Axelrod 4430 (NY). –DORADO: Mpio. de Dorado, Rte 693 at the freeway extension and on mogotes just E, Tayloe , Lumer & Schoer 10050 (MO). –GUNICA: Prope Gunica in litoralibus-ad salinas, Urban 3487 (BM, GH, NY); prope Gunica in litoralibus ad salinas, Urban 3488 (BM, G, GH, M, MO , NY); prope Gunica, Urban 3642 (G, MO, NY). –ISLA DESECHEO: Desecheo Island, Stevens 1827 (NY); Desecheo Island, Warshall 106 (GH). –MAYAGEZ: Isla de Mona; Sardinera, lado E, Acevedo & Siaca 4302 (NY); Mona Island, Stevens 6343 (NY); Mona Island, Stevens 6394 (NY); Mona Island, Stevens & Hess 6135 (NY). –PONCE: Ponce to Peuelas, Britton , Britton & Marble 1764 (NY); Ponce, Heller 6068 (G, GH, MO, NY). – QUEBRADILLAS: Rt. 437 ca 12 km S of rte 113, 100-200 m, Taylor & Gereau 10487 (MO). –RINC”N: Rincn, Urban 5667 (G). –TOA ALTA: Rt. 677 ca. 3 km S of Rt. 2, 100 m, Taylor & Miller 10409 (FLAS, MO). –VEGA ALTA: Rt. 620

PAGE 230

208 km, 4.0 m, Taylor & Molano 8680 (MO); Rte 620 km, 4.0 m, Taylor & Molano 8681 (MO). Republic of Seychelles . –ALDABRA ISLANDS: West Island (Ile Picard), path just N of Settlement, Fosberg 48730 (US); Il Esprit (Euphrates I.), near W end, Fosberg 48778 (US); West Island, Settlement, Fosberg 49652 (MO, NY, US); Astove Island, Grand Anse, Fosberg 49714 (US); Cousin Island, N coast back of beach ridge, 2 m, Fosberg 52169 (MO, US); West Island (Ile Picard), Settlement, Fosberg & McKenzie 49451 (US); West Island (Ile Picard), back of Settlement, Fosberg & MacNae 49515 (US); Assumption Island, center of Assumption, sea level, Frazier 745 (US); Mah Island, Mah, Pointe La Rue hill, 1200 ft., Osborne-Day 124 (BM); West Island, Renvoize 829 (US); West Island, Renvioze 838 (B, US); West Island, vicinity of W Pt. village, Rhyne 862 (US); Astove Island, Ridgway 11 (US); Assumption Island, traverse of island, Stoddart 1067 (US); Bird Island, Stoddart 7090 (MO); Amirantes Islands, Desroches, Stoddart & Poore 1403 (US); Farquhar Islands, Atoll de Farquhar, N Island, Stoddart & Poore 1366 (US); Mah Island, Grand Anse, Robertson 2484 (MO); Diego Garcia, Whistler 9837 (US); West Island, 100 m E of Research Station, Wood 1681 (US). Saint Lucia . Vieux-Fort, Maria Island, Pierre , Felicien & Slane 261 (A); Morne, 800 ft., Sturrock 192 (A). Singapore . Clemens & Clemens 7981 (NY); Telok Paku, Sinclair 6467 (US); Frauye Road, unknown collector s . n ., 1894 (BM). Solomon Islands . –GUADALCANAL: Lunga, sea level, Brown 1448 (BM); Lunga, sea level, Brown W/206 (BM). Sri Lanka . – CENTRAL: campus of Univ. of Ceylon, Peradeniya, 500 m, Comanor 324 (MO, US); 2 mi., E of Illukkum bura, Matale District, 600 m, Jayasuriya 287 (US);

PAGE 231

209 Ganoruwa Hill, Peradeniya, Kandy Dist., Wirawan 609 (NY, US). – SABARAGAMUWA: 12th mi. post on t he road between Panamure and Kilanne, Ratnapura Dist., Balakrishnan & Jayasuriaya NBK911 (US). –WESTERN: Induruwa, Jacobsen 13-6 (C). Trinidad and Tobago . –TRINIDAD: Verdant Ave., Maraval, Barbeau 31838 (TRIN); Carenage, Britton & Sean s . n ., 29 March 1921 (TRIN); Fendler 376 (BM, NY); Hart 641 (TRIN); Saint George, Caledonia, Hart 5017 (TRIN); Saint George, Island of Monos, Domus Bay, Skovsted 25 (C); Bird of Paradise Island, Yellowtail Walk, 60 m, Webster 24186 (TRIN); Saint George, Gasparee, Williams 12568 (TRIN, US); Port of Spain, post office back yard, unknown collector 2593 (TRIN); Back fork and amensyl bush, unknown collector 3618 (US). –TOBAGO: Banaan, Broadway 4236 (M). United Kindom Overseas Territory . –ANGUILLA: Boldingh 3498 (U); Goodwin & Goodwin 5 (NY); Bottom district, N of The Valley, Proctor 18538 (A, BM, US). –BERMUDA: Hamilton, Shelley Bay, Andrews 251 (NY); Spittle Pond, Brown 718 (GH, NY, PH, US); Smith's, near Flatts, Brown & Britton 23 (NY, PH, UC, US); Flatts, Collins 235 (GH, NY, US); Paget, Harshberger s . n ., 19 June 1905 (PH); Paget, Harshberger s . n ., 19 June 1905 (NY); Paget, Harshberger s . n ., 19 June 1905 (GH); Paget, Harshberger s . n ., 19 June 1905 (US); Paget, Harshberger s . n ., 19 June 1905 (PH); MacKenzie s . n ., July-August 1910 (PH); Saint George's, Trott's Pond, Tucker's Town, Manuel 244 (A); Smith's, Middle Road, Moore 3060 (CAS, GH); Orange Valley, Rendle 520 (BM); Hamilton, Robinson 134 (GH); Paget & Warwick, Setchell & Setchell s . n ., 6 June 1921 (UC); Saint George's, on "shortcut" road from Biological Station to hwy., Taylor 49-1076 (GH). –CAYMAN

PAGE 232

210 ISLANDS: Grand Cayman, N of Joe Conyer, Brunt 2144 (BM); Grand Cayman, near larva survey site 80, trans island road, Brunt 2164 (BM); Western, Grand Cayman, Hitchcock s . n ., 17 January 1891 (MO); Western, Grand Cayman, Hitchcock s . n ., 17 January 1891 (MO); Western, Grand Cayman, Hitchcock s . n ., 18 January 1891 (MO); Grand Cayman, Bu lton Tree Road N Side, 20-80 ft., Kings 238 (BM, NY); Western, Grand Cayman, N of Georgetown, Popenoe s . n ., 24 April 1968 (MO); Grand Cayman, vicinity of Grape Tree Point, Proctor 11994 (BM); Little Cayman, vici nity of Salt Rocks, Proctor 28057 (BM); Grand Cayman, W bay N of Beach Club, Stoddart 7026 (BM, US). United States . –FLORIDA: Brevard Co. : Merritt's Island, Baldwin 45 (NY, PH); near Cape Malabar, Curtiss 974 (BM, G, GH, M, MIN, MO, NY, US); Indian River region, Fredholm 5545 (GH); Indian River region, Fredholm 5608 (GH, US); Merrit Island, Rhoads s . n ., 13 November 1936 (FLAS); Merrit Island, Angel City, Rhoads s . n ., 28 October 1936 (FLAS); Cocoa Beach, Rhoads & West s . n ., 4 June 1938 (FLAS). Broward Co. : along U.S. 27, 6 mi. N of Andytown, Beckner 769 (MO); along canal N of Rt. 84 near Florida State Forestry Station, W of Florida Turnpike, Correll , Correll & Brackmann 40198 (MO); 26 Mile Bend on Rd. 25 in Everglades, Davis , 156 (FLAS); Canal bank, US 27, N of Hollywood Jct., Lakela 28416 (FLAS); along US 27, 1 mi. S of intersection with Fla. 84 at Andytown ("Twenty Mile Bend"), ca. 18 mi. W of Ft. Lauderdale, Ward & Burch 3334 (FLAS). Charlotte Co. : Bull Key, opposite Lemon City, Small & Carter s . n ., 6 November 1903 (NY). Collier Co. : on tram, lower Fahkahatchee strand, Atwater 684 (FLAS); Goodland Point, Marco Island, Brass 18081 (FLAS, US); Golden Gate Subdivision NE of Naples,

PAGE 233

211 Lakela 31283 (MIN); Lagoon embankment W of Everglades City, Lakela 31716 (CONN, FLAS, GH, MIN); Scull s . n ., 20 February 1940 (NY); Shell island in Gulf of Mxico, Scull s . n ., 20 February 1940 (FLAS). Duval Co. : Mouth of the St. John's River, Curtiss 973 (FLAS, G, GH, M, MO, NY, US). Hendry Co. : E side on dirt road, 5 mi. S of Fla. 846, ca. 10 mi. due ESE of Immokalee, Ward , Beckner & Carmichael 5396 (FLAS). Highlands Co. : The Archbold Biological Station, Cooley , Cooley , Bass & Lakela 9434 (GH). Hillsborough Co. : 2511 LaSalle St., Almeda 367 (FLAS). Indian River Co. : N limit of Indian River Shores, D'Arcy 2851 (FLAS); near Roseland; near co rner of 110th St. along road bordering Indian River, 0.3 mi . S of junction with US 1., Wunderlin & Beckner 6490 (NO). Lake Co. : in city park, Leesburg, Baltzell 6619 (FLAS); Eustis, Van Hyning s . n ., 9 September 1938 (FLAS). Lee Co. : Dog Key, Estero Bay, Brass 14912 (US); Middle Captiva Island, Brumbach 6055 (FLAS, NY); Woodring Point, Sanibel Island, Brumbach 7749 (FLAS); upper Captiva Island, Brumbach 7770 (GH, US); Marco, Hitchcock 105 (GH, MIN, NY, US); Pine Island, S of jct. Rt. 767 & Rt. 78, Lakela , Long & Broome 305897 (FLAS); Captiva, Orrok s . n ., February 1915 (NY); vicinity of Fort Myers, Mulock Creek, Standley 18987 (US); Mound Key, Estero Bay, Todd 129 (FLAS). Levy Co. : Waccasassa Bay State Preserve, N of Turtle Creek, Abbott & Williams 8461 (FLAS); Cedar Key, Garber s . n ., October 1877 (FLAS, GH, NY, US); Rosewood, Garber s . n ., April 1876 (US); on Seahorse Key off Cedar Key, Laessle s . n ., 15 April 1955 (FLAS); Sumner, Pasture Survey s . n ., 27 July 1937 (FLAS); Seahorse Key, West , Ford & Bennett s . n ., 1 August 1958 (GH). Manatee Co. : Manatee River, Rugel 255 (BM, GH,

PAGE 234

212 NY); Jewfish Key, Tracy 7518 (GH, MO, NY, US); Perico Island, Tracy 7655 (BM, G, GH, MIN, MO, NY , US); Longboat Key, Tucker 304 (DUKE). Martin Co. : S.R. 714, 16 mi. W of Palm City, McCart 11226 (FLAS). Miami-Dade Co. : near Miami, Alexander s . n ., May 1930 (NY); Homestead, Avery s . n ., 18 November 1966 (FLAS); Cutler, Britton 407 (NY); Gosowans, Britton 158 (NY); Miami, Britton 463 (NY); Nixon Hammock, Buswell s . n ., 3 November 1934 (CONN); Coral Gables, Buswell s . n ., 25 February 1936 (CONN); Miami, Buswell s . n ., 26 February 1936 (CONN); S of Coral Gables, Buswell s . n ., 13 March 1936 (CONN); Elliott Key, Cantif 39 (GH); Levee 31W directly outside the Everglades National Park entrance, Christenson 185 (CONN); Coconut Grove, Cowles 5-28 (G); Homestead, Cowles 10-5 (G); Black Point & Homestead, Cowles 10-15 (G); Homestead, Cowles s . n ., 1906 (NY); Bay Biscayne, Curtiss 176 (GH); Elliott's Key, Curtiss s . n ., April 1886 (NY); R.R. tracks N of FLA 27 at Florida City, D'Arcy 2248 (MO); Nixon Hammock 4 mi. W of Homestead, Deam 60971 (DUKE, UC); Jenkins, 14-20 mi. S of Cutler, Eaton 216 (ECON); S of Cutler on glade side, Black River Region, Eaton 275 . 5 (ECON); Coconut Grove, Eaton 935 (ECON); Pine Island, 25 mi. S of Miami and E of Naranja and Homestead, Elder 398 (DUKE); Ingraham Hwy., vi cinity of West Lake, Fennell & Jones 890 (UC); Miami-Dade Co.: near Coconut Grove, Fennell & Jones 906 (A, DUKE, NA, NY); Biscayne Key, Garber s . n ., March 1877 (GH, NY, PH, US); SW 167 Ave., Kendall Drive (88 St.), Miami, Garber s . n ., June 1877 (FLAS, PH); cultivated at the home of Monroe Birdsey, 13081 SW 77th Ave., Kendall, Gillis 7010 (MO); along Chrome Avenue, Hialeah, Gillis 7166 (MO); Goulds, Seminole Wayside

PAGE 235

213 Park, Gillis 11503 (A); Homestead, Godfrey 65588 (FLAS); 0.2 mi. N of SW 288th St., to the W side of SW 170th Ave., Homestead, Goldman & Hammer 1654 (MO); near Osteen hammock, Granskog 11 (MO); Hattie Bauer Hammock, Harris 17410 (GH, MIN); Murden Hammock, Harris 23214 (MIN); Bird Drive Basin, Herndon 3135 (TEX); vicinity of Miami, Hunnewell 5866 (GH); Hialeah by Fla. 826, Kral 49163 (MO); SE of the Post O ffice Building, Homestead, Lakela 27295 (GH); Lake Worth, Lennon s . n ., May 1891 (US); Big Pine Key along coast S of Rt. 1 m, Mehrhoff 11809 (CONN); Key Biscayne N end of Key Biscayne, Mehrhoff 11819 (CONN); Buena Vista, Moldenke 323 (DUKE, MO, NY, PH); along Tamiami Trial, E of Big Bend, Moldenke 340 (DUKE, MO, NY, PH, US); near Brickell Hammock, Miami, Moldenke 516 (DUKE, MO, NY, PH, US); near Brickell Hammock, Moldenke 517 (MO, NY, PH); Buena Vista, Moldenke 526 (MO, NY, PH, US); Lewis-Nixon Hammock, Redlands District, Moldenke 550a (DUKE, MO, PH); along Tamiami Trial, 25 mi. W of Miami, Moldenke 3764 (NY); Paradise Key and vicinity, Mosier 268 (US); Royal Palm Hammock, Mosier s . n ., November 1917 (NY); 5 mi. NW of Homestead, O'Neill 8244 (UC); 6 mi. W of Fulford, O'Neill s . n ., 9 September 1929 (FLAS); Ecol ogical Research Division, Mediterranean Fruit Fly Eradica tion, 6 mi. W of Fulford, O'Neill s . n ., 9 September 1929 (US); Ecological Research Divisi on, Mediterranean Fruit Fly Eradication, O'Neill s . n ., 18 September 1929 (US); Paradise Key, Rehder 909 (A); Indian River, Reynolds s . n ., 1878 (GH); Homestead, Rossbach 1810 (FLAS); Paradise Key and vicinity, Safford & Mosier 32 (US); Paradise Key and vicinity, Everglades of Safford & Mosier 227 (US); Paradise Key and vicinity, Everglades of Safford &

PAGE 236

214 Mosier 298 (US); Paradise Key, Safford & Mosier 299 (US); SW of Miami, Scull s . n ., 2 October 1937 (DUK E); SW of Miami, Scull s . n ., 2 October 1937 (FLAS); between Miami and Coconut Grove, Small 4087 (NY); Bet. Long Prairie & Camp Jackson, Small & Carter 63 (PH); between Perrine & Long Prairie, Small & Carter 194 (US); between Coconut Grove and Cutler, Small & Carter 731 (MIN, NY, PH); Small & Carter 790 (NY); between Cutler and Longview Camp, Small & Carter 812 (NY); Caldwell's Hammo ck near Silver Palm School, Small & Carter 2617 (NY); between Homestead and Camp Jackson, Small & Carter 2618 (NY); between Miami and Ke ndall Station, Small & Carter 2619 (NY); Long Key (Everglades), Small & Carter 3074 (NY); Homestead to Big Hammock Prairie, Small , Carter & Small 3399 (NY, PH); near the Homestead road between Cutler and Longview Camp, Small & Carter s . n ., 9-12 November 1903 (CONN); Pinelands between Miam i and Kendall Station, Small & Carter s . n ., 5 November 1906 (CONN); between Miam i and Kendall Station, Small & Carter s . n ., 5 November 1906 (MIN); between Miami and Kendall Station, Small & Carter s . n ., 5 November 1906 (NY); Caldwell's Hammock near Silver Palm School, Small & Carter s . n ., 8 November 1906 (MIN); between Peter's Prairie and Homestead, Small & Carter s . n ., 10 November 1906 (NY); Vacca Keys, Small & Carter s . n ., 28-29 January 1909 (NY); Vacca Keys, Small & Carter s . n ., 28-29 January 1909 (US); Vacca Keys, Small & Carter s . n ., 28-29 January 1909 (GH); Key Vacca, Small & Carter s . n ., 28-29 January 1909 (PH); bet ween Cutler and Longview Camp, Small & Carter s . n ., November 1953 (PH); between Cutler and Longview Camp, Small & Carter s . n ., November 1953 (US); Cox Hammock, Small &

PAGE 237

215 Mosier 5511 (NY); Adams Key, Small & Mosier 5733 (NY); Goodburn Hammock, Small & Mosier 5923 (G, NY, UC); Brogdon Hammock, Small & Mosier 6336 (NY); Sykes Hammock, Small , Mosier & Simpson 5787 (M, NY); Cox Hammock, Small , Mosier & Small 6586 (NY, U); Coconut Grove, Small & Nash 196 (NY); Elliott's Key, Small & Nash s . n ., 6 7 November 1901 (US); Elliott's Key, Small & Nash s . n . 6 -7 November 1901 (NY); Royal Palm Hammock, Small & Small 5416 (NY); Black Point, below Cutler, Small & Wilson 1815 (NY); FLAS, MO, PH); 2.5 mi. from Krome Ave. (Fla. 27), along Richmond Rd., Smith & Myint 757 (FLAS); ca. 2 mi. N of Homestead Cit y limits, along Fla. 27, Smith , Myint & Will 890 (FLAS); Vacant lot in S Miami, Stimson 175 (DUKE); Coral Reef County Park, at intersection of 146th St. and 80th Ave. in Rockdale N of Perrine, Miami, Tan & Raymond CR42 (FLAS); West Lake, Tatnall 744 (PH); 2.8 mi. S of jct with US 41 on FL 27.5-10 m, Thompson & Nishida 2761 (HUA); Ross Hammock, just N of Silver Palm, Thorne 10186 (UC); Miami, Tracy 9168 (BM, G, GH, MIN, MO, PH, NY, TEX, US); Miami, Tracy 9425 (MO); along US 41, 2.2 mi. W of int. with Fla 27 W of Miami, Ward & Burch 3983 (FLAS); Homestead, Weber s . n ., 10 May 1929 (FLAS). Monroe Co. : Pinecrest, Arnold s . n ., 1 March 1952 (FLAS); Key West, Blodgett s . n . (GH); Key West, Blodgett s . n . (NY); Key West, Blodgett s . n . (NY); Middle Cape Sable, Buswell s . n ., 19 November 1933 (CONN); Cape Sable, Buswell s . n ., 22 February 1941 (CONN); 10 mi. E of Rt. 1 on Key Largo road, Key Largo, Carr & Mullen 1018 (US); Key West, Chapman s . n . (GH); vicinity of Pine Crest, off Fla. Rte. 94, Cooley , Eaton & Lakela 9155 (GH); vicinity of Pine Crest, off Fla. Rte. 94, Cooley , Eaton & Lakela 9157 (GH); upper Metacombe

PAGE 238

216 Key, Curtiss 5641 (FLAS, G, GH, MIN, MO, NY , UC, US); upper Metacombe Key, Curtiss 5641 (CONN); along road 4A about 0.5 mi. S of Islamorada, Deam 61084 (DUKE); Key Largo, back of Johnson's, Planter, Eaton 407 (ECON); Key West, Garber s . n ., September 1877 (GH, NY , PH, US); Cape Sable, Harris 23136 (MIN); Happy Vagabond Ca mpground, Key Largo, Hemingson s . n ., 18 March 1981 (CONN); Big Pine Key, Killip 31667 (US); Big Pine Key, Killip 40681 (US); Big Pine Key, Killip 40875 (US); Big Pine Key, Killip 40996 (US); Big Pine Key, N end of key, Killip 41554 (US); Sugerloaf Key, Killip 41876 (B, NO, TEX, US); Big Pine Key, Killip 43430 (FLAS); Key West Botanical Garden, Stock Island, Killip 43458 (US); Key West, Hammock betw een Flagler Ave. and airport, Killip 44478 (US); ca. 2 mi. S Monr oe Station by Fla. 94, Kral 51906 (MO); N Key Largo, 6.5 mi. from US 1, on Fla 905, Long , Pardue , Lakela & Meagher 2800 (MIN); Cape Sable, McFarlin 9799 (FLAS); along Tamiami Trial, Moldenke 24043 (AAU, LL); just S of Isla Morada on Low er Matecume Key on Hwy. 1 between mi. markers 75-77, Mori & Gracie 24052 (NY); Newport, Key Largo, Pollard , Collins & Morris 158 (BM, G, MIN, NY, US); Key West, Rugel 254 (BM, G, GH, NY); Key West, Rugel 256 (BM); Key West, Rugel 258 (BM, GH, NY); Key West, Rugel s . n . (BM); Boca Chica Key, Small 3928 (NY); Summerland Key, Small , Carter & Small 3586 (NY); Long Key (mainland), Small & Carter s . n ., 21-24 January 1909 (PH); Summerland Key, Small , Carter & Small s . n ., 28 February 1911 (PH); Big Pine Key, Small & Cuthbert s . n ., 9 May 1919 (FLAS); Cape Sable Region, Small , DeWinkeler & Mosier 11088 (DUKE); Key Largo, Card Sound Road, Stern , Beaman , Phipps , Rock & Sweitzer 2707 (GH); Pinecrest , S of Fla. 94 ("Loop

PAGE 239

217 Road"), 4 mi. W of Miami-Dade-M onroe county line, NE corner of Ward & Burch 3309 (FLAS, GH); Side of road embankmen t, N end of Lower Sugarloaf viaduct, Ward & Ward 1777 (FLAS); Swamp Jungle, Key Largo, Welch 1547 (NY). Palm Beach Co. : Rt. 27, near S Bay, Brass 21153 (US); Palm Beach, Davis , s . n ., 1 August 1935 (FLAS); along the entrance ramp to I-95 N, to the E side of I-95, and just to the N of Yamato Road, Boca Raton, Goldman , Lewis & Sadle 1659 (MO); Singer Island, 9 mi . S of Lost Tree Village, McCart 11155 (FLAS); Lake Worth Inlet, Webber 225 (MO); Lake Worth, West s . n ., 23 December 1929 (FLAS); Boynton, Loucks & West s . n ., 10 April 1930 (FLAS). Pinellas Co. : NE St. Petersburg, Croley s . n ., 2 October 1966 (GH); Pinellas Co.; NE St. Petersburg, Croley s . n ., 2 October 1966 (US); Ft. DeSo to County Park, Dogwood Key, 5 ft., Thorne & Benny 44209 (FLAS); St. Petersburg, Walker s . n ., 25 October 1929 (FLAS); N end of Long Key, to wn of St. Petersburg Beach, near Ciega Bay, Ward & Ward 2333 (FLAS); St. Petersburg, Williamson s . n ., July 1895 (PH). Polk Co. : vicinity of Crooked Lake, McFarlin 3958 (TEX); Ca. 3 mi. N of Lake Wales, Oswalt s . n ., 17 June 1971 (FLAS); Lake Alfred, Thompson s . n ., 4 July 1929 (FLAS). St. Johns Co. : S end near South Point loop, Harrison & Harrison 722 (FLAS). St. Lucie Co. : on W side of A1A, 9 mi. S of N end of Hutchinson Island, about 1 mi. N of Big Mud Creek, Beckner 2235 (FLAS); Ft. Pierce, Indian River Drive, Crevasse s . n ., 15 July 1940 (FLAS); along edge of Indian River, Fla. 707, 1.3 mi. S of jct. with Fla. 712, ca. 4 mi. S of Ft. Pierce city limit, Ward & Crosby 4839 (FLAS, NY). Sarasota Co. : Sarasota Beach, Crevasse s . n ., 9 August 1940 (FLAS); Manasota Key, 6070 Manasota Key Road

PAGE 240

218 (S.R. 776), 3.2 mi. from S.R. 774, Lott & Lott DT1085 (FLAS); Oscar Scherer State Park, Rabinowitz s . n ., 8 December 1981 (FLAS); Osprey, Smith s . n ., 3 March 1904 (DUKE); Osprey, Smith s . n ., 3 March 1904 (PH). Volusia Co. : Turtle mound, near New Smyrna Beach, Feagan 50 (U); N end of Meritt Island, Apollo Beach between Turtle Mou nd and the House of Refuge Site, Cape Canaveral National Seashore, Judd , Goulson & Godfrey 3245 (FLAS, NY, U); New Smyrna, Palmer s . n ., 12 April 1874 (NY); Turtle Mound, ca. 8.5 S of New Smyrna Beach, Prichard 1156 (A); ca. 9 mi. S of Ne w Smyrna Beach at Turtle Mound (ancient kitchen midden) , along Mosquito Lagoon, Ray , Wood , Smith & Eaton 10786 (LL); Smyrna, Rugel 257 (BM). Multiple Cos. : Dade and Monroe Co., Everglades National Park, Craighead s . n ., December 1953 – February 1954 (BM); Collier or Monroe Cos., Ten Thousand Islands, Simpson 260 (US). – TEXAS: Cameron Co. : La Palmas Plantation, about 4 mi. SW of Brownsville, Correll 14852 (GH, TEX, US); Laguna Atascosa National Wildlife Refuge; headquarters, Fleetwood 3762 (TEX); Clay Dunes, Loma de la Estrell, Johnston 20303 (TEX); vicinity of Brownsville, Rose 18110 (US); SE of Brownsville, Rose & Russell 24283 (NY, US); Brownsville, Runyon 433 (TEX); So. Texas, Community house #2, El Jardin, 30 ft., Runyon 512 (TEX, US); Olmito Lake, 40 ft., Runyon 3094 (TEX); the Lower Ro Grande Valley, Runyon 4906 (TEX); Brownsville, York s . n ., 19 March 1907 (TEX). Hidalgo Co. : Ca. 0.5 mi. ESE of Anzaldua Dam, ca. 4.5-4.6 ai rmi. S of jct. of US Rt. 83 and F.M. 1016 at Mission, Ro Grand Valley National Wildlife Refuge, Gabrielson Tract, Mission Quadrangle, 105-110 ft., Carr & Hernndez 14374 (LL); Santa Ana National

PAGE 241

219 Wildlife Refuge S of Alamo, Fleetwood 3174 (TEX). United States Territory . – GUAM: Agana Swamp, Chernin 844 (US); Trust Territory Compound, NAS, Agana, 70 m, Fosberg 46212 (BM, UC, US); La Cienaga (Agana swamps), Stone 4235 (US). United States Virgin Islands . –ST. CROIX: A . Benzon 199-5098 (C); Orsted s . n . (C); Pavon s . n . (C); Reugen 199 (C). –ST. JO HN: Cruz Bay, Maria Bluff, 90 m, Acevedo , Reilly & Stone 2330 (US). –ST. THOMAS: Orsted s . n . (C); Orsted s . n . (C). Venezuela . –BOLVAR: Carapo, unknown collector 27 (PR). –DEPENDENCIAS FEDERALES: Archip ielago Los Testigos, Isla Testigo Grande, Playa Guzmn, Fernndez Jos, Flores-Javier & Fernndez 607 (NY). –FALC”N: Dist. Silva, al pie de los penascos calcareos, S de la Punta Faustino, SE de Chichiriviche, 1-3 m, Steyermark & Manara 110380 (MO, US). –SUCRE: vicinity of Cristbal Coln, La Planisa, Broadway 340 (US); vicinity of Cristbal Coln, Broadway 374 (GH, NY, US). Cultivated Material . FRANCE: Jardn de M. Audibert, a Ponnelle pres Parascon, unknown collector s . n ., September 1821 (GH); Jardn de Montpellier, unknown collector s . n . (DS). INDIA: Londerbund, Botanical Garden, Calcutta, Native collectors s . n . (M). UNITED STATES: North Carolina, cultivated at Duke Univer sity 1980-1984 from seeds sent by Jack Longino in 1979 from Florida, MacDougal 662 (FLAS, MO); Missouri, cultivated at Missouri Botanical Garden and in J. M. MacDougal's outdoor home garden 1987-1991 from seeds collected 26 Jan. 1987 by Julie X., Nonesuch Caves and Athenry Gardens, Portland Parish, Jamaica, MacDougal 3025 (MO); Illinois, grown in University of Illinois Greenhous e (Urbana, Champaign Co., Illinois), 200 m, Potgieter 37 (MO); Missouri, cultivated at Missouri Botanical Garden,

PAGE 242

220 greenhouses, unknown collector 155/05 (MO); cultivated at Missouri Botanical Garden, greenhouses, unknown collector 8/20/07 (MO). Figure 8.2. Passiflora pallida ( Porter-Utley & Mondragn 412 ) from the Yucatn Peninsula, Mxico. Scale bar = 4.0 mm.

PAGE 243

221 Figure 8.3. Distribution of Passiflora pallida . Notes In Linnaeus' 1753 edition of Species Plantarum , he describes three smallflowered entities, P . pallida L. ("Habitat in Dominica, Brasilia"), P . hirsuta L. ("Habitat in Dominica and Curassao") and P . minima L. ("Habitat in Curassao"), for which the historical references incl ude phrases such as ”flore minore" ( P . pallida L.), "flore & fructu minimis" ( P . hirsuta ) and "flore flavescente omnium minimo" ( P . minima L.). Charles Wright (1869), in an article discussing the genus Jussiaea L., chose the name P . pallida over P . minima . In the article he commented on the "embarrassing" status of the species of Passiflora and the unwise reliance upon vegetative morphology in species circumscription within the

PAGE 244

222 Cuban species of Passiflora (Wright, 1869:480). In the article he states, "I have lately carefully examined the Cuban species called P . minima , hederacea , pallida , angustifolia , suberosa , &c., and come to this conclusion:– P . pallida , L., is an old and appropriate nam e, to which belong P. minima , L., and P. angustifolia , Sw., certainly; P. hederacea , Cav., P. suberosa L., probably; and, from the description, I judge P. lineariloba , Hook. f. to be only another form of it.” It is possible that Passiflora hirsuta was not considered by Wright in his article because of the confusion surrounding its ci rcumscription (see below) or because he had not encountered the taxon in Cuba. In the 1753 edition of Species Plantarum , Linnaeus indicated that he was wellacquainted with P . pallida and refers to the diagnosis and drawing in the 1745 dissertation by J. G. Hallman, which Li nnaeus directed, that shows an unlobed, ovate leaf with two petiolar nectaries pos itioned near the apex of the petiole. Linnaeus cites an illustration by Plumier ( pl . 89 , in Description des plantes de l'Amrique , 1693) that also exemplifies his P . pallida . However, he also refers to a figure by Morison (1680) that shows a plant with a large flower that possesses sepals and petals (likely in the subgenus Passiflora ) with unlobed, ovate leaves. In the 1745 dissertation, Hallman specific ally states that the flowers of P . pallida L. are "pentapetala", referring to the la ck of petals; this decision was based upon the careful comparison of diagnoses from other petalous taxa in the treatment. An examination of the Linnaean herbarium (microfiche) did not reveal an herbarium specimen that could reasonably be attributed to the species described as P . pallida by Linnaeus. There is one spec imen in the Linnaean herbarium

PAGE 245

223 labeled P . pallida , but it is a post-Linnaean accession that represents a largeflowered taxon from subgenus Passiflora . Though there is a small amount of confusion surrounding P . pallida L., largely attributable to Linnaeus' reference to Morison's illustration and the post-Linnaean accession referred to above, it is clear from the diagnoses in the 1753 edition of Species Plantarum and the 1745 dissertation by Hallman, that Linnaeus wa s referring to a plant that had unlobed, ovate leaves and small, pale, apetal ous flowers. The lectotype of P . pallida L. (designated here) is Plumier's plate in Description des plantes de l'Amrique (1693) in which he illustrat ed several entities of both P . pallida and P . suberosa ssp. suberosa . An epitype is also designated here as the flowers and fruits in the lectotype drawing appear a little large fo r the species. Incidentally, Linnaeus chose the epithet, pallida , to refer to the pale-color ed flower. Though the flowers are frequently pale in color, they may also be highly colored. In the 1753 edition of Species Plantarum , Linnaeus describes Passiflora minima L. as a trilobed plant in which the c entral lobe is longer than the lateral lobes. He cites the diagnosis and drawing in the 1745 dissertation by Hallman that shows a plant with narrowly trilob ed leaves that lack petiolar glands. Linnaeus also refers to a figure by Plukenet (1696) that closely matches Linnaeus' diagnoses and the drawing in Hallm an's dissertation. Neither Linnaeus nor Hallman described the flowers of P . minima L., but it can be inferred by the historical references in the dissertati on that the flowers were small and lacked petals. In Killip 's treatment of P . suberosa , he states that there are two sheets of P . minima of uncertain origin in the Linnaean Herbarium. However, according to

PAGE 246

224 Steve Cafferty (pers. com.) of the Linnaean Plant Name Typification Project, the lectotype of P . minima L. (designated by Killip 1938) is specimen 1070.20 (LINN). The lectotype closely matches Linnaeus' diagnoses and the drawing in the dissertation and possesses small flowers apparently lacking petals (as observed on a microfiche of the herbarium). However, the lectotype of P . minima is a very unusual example of the smallflowered entity, as the lack of petiolar nectaries in this taxon is very rare. Passiflora hirsuta L. has been the source of confusion for several taxonomists of Passiflora , and under his treatment of Passiflora foetida var. moritziana (Planch.) Killip ex Pulle, Killip (1938) discussed the problem. Linnaeus (1753) cited several references in his treatment of P . hirsuta , often with accompanying illustrations, that undoubtedly refer to P . foetida . However, he also referred to an illustration by Plumier ( pl . 88 , in Description des plantes de l’Amrique , 1693) that is clearly P . pallida . As in his other species descriptions, he also cites the diagnosis and drawing in the 1745 dissertat ion by Hallman that shows a trilobed, densely pubescent leaf with rather large pet iolar nectaries that are positioned on the distal half of the petiole and, thus, cannot be P . foetida as this species lacks petiolar nectaries. The di agnosis in the 1753 edition of Species Plantarum is unclear. However, in the 1745 dissertation Ha llman states that t he flowers of this taxon are pale and small, the involucre is lanceolate, and the frui ts are deep blue. Hallman goes on to say that the taxon that he is descr ibing is somewhat similar to the next ( P . foetida L.) but differs in that the fl owers are opposite (paired) and the involucre consists of only a single br act. Hallman is clearly describing one of

PAGE 247

225 the entities in the P . suberosa complex, as the flowers are commonly paired in the leaf axils, members of the specie s complex do sometimes possess one or two lanceolate bracts, and the frui ts are very dark purple. In Passiflora foetida only one flower is present in the leaf axils, the involucre consists of three bracts that are pinnatifid or pinnatisect, and the fr uits are yellow to red. Though the leaf as illustrated in the dissertation is distin ctly cordate and broadly ovate, which is a bit unusual for P . pallida , Linnaeus' reference to Plumier's drawing leads me to conclude that P . hirsuta L. is a synonym of P . pallida . Passiflora pallida as recognized here exhibits a substantial amount of morphological variation across its range. The various fo rms that the leaves may take have led to the proposal of many s pecies and varietal names. For example, a plant of this species may possess only unlobed leaves, only trilobed leaves, or leaves that are unlobed, bil obed, and trilobed. This type of variation can be seen throughout the range of this specie s. However, the flowers of P . pallida are diagnostically small, with a narrow hy panthium, short sepals, short coronal filaments, and narrow floral nectaries. The only species with which P . pallida may be confused is P . suberosa . Passiflora pallida is vegetatively similar to both P . suberosa ssp. litoralis and P . suberosa ssp. suberosa , and without flowering material these taxa can be difficult to distinguish. The position of the petiolar nectaries has often been used to separate species in closely related taxa in Passiflora . However, though the petiolar nectaries are gener ally located closer to the petiole apex in P . pallida than in the South Am erican populations of P . suberosa ssp. litoralis and P .

PAGE 248

226 suberosa ssp. suberosa , the upland Mexican/Centra l American populations of P . suberosa ssp. litoralis also have petiolar nectaries positioned very near the petiole apex. The leaf base of P . pallida is commonly not cordate. Passiflora suberosa possesses leaves that are frequently cordate, though this character is somewhat variable in the upland Mexi can/Central Americ an populations of P . suberosa ssp. litoralis . Though foliage color is difficu lt to discern from herbarium specimens, my experience in the field and photos taken of P . pallida and P . suberosa in the field by others show that P . pallida commonly possesses leaves that are paler in color and often less lustrous than P . suberosa . Reproductive structures are more reliable in separating P . pallida and P . suberosa . The hypanthium of P . pallida is commonly 2.8-4.1 mm in diameter and the inner coronal filaments ar e usually less than 1.5 mm long. In P . suberosa s.l. , the hypanthium is commonly 4.0-8.8 mm in di ameter and the inner coronal filaments are frequently 1.5-3.9 mm long. The outer coronal fila ments are also short, less than 4.0 mm in P . pallida , and although that overlaps wi th the 2.5-8.1 mm range observed in P . suberosa , the character is frequently observable in herbarium specimens. Where t he distributions of P . pallida and P . suberosa overlap in the Antilles, P . pallida is typically found in and along the edges of subtropical and tropical forests at or near sea le vel (rarely exceeding 200 m), whereas P . suberosa commonly occurs in and along the edges of tropical forests above 500 m. The most common variant of P . pallida (as exemplified by E . Killip 41876 , on Sugarloaf Key, Monroe Co., Florida, USA; E . Cabrera 1475 , S of Akumal,

PAGE 249

227 Quintana Roo, Mxico; and J . Tillich 3558 , in Black River, Mauritius) has ovate leaves that may be unlobed, bilobed or trilobed on the same plant. When unlobed, the leaves are co mmonly greater than 2.0 cm wide. When lobed, the leaves are usually shallowly lobed 0.20-0. 41 the distance to the base, the lateral and central lobes are greater than 1.0 cm wide, and the angle between the lateral lobes is 45-100. Another less common variant of P . pallida (as exemplified by J . K . Small & C . Mosier 5511 , in Cox Hammock, Miami-Dade Co., Florida, USA; and J . Small & J . Carter 194 , between Perrine and Long Prairie, Miami-Dade Co., Florida, USA), has narrowly ovate l eaves that may be unlobed, bilobed or trilobed on the same plant. When unlobed, the leaves are commonly less than 1.0 cm wide. When lobed, the leaves are usually deeply lobed 0.82-0.90 the distance to the base, the lateral and c entral lobes are comm only less than 0.7 cm wide, and the angle between the lateral lobes is greater than 100. However, all the specimens brought together here as P . pallida are all relatively small in stature in their native habitats in the New World, possess similar small flowers with short coronal filam ents and occur in a simila r range of elevations. MacDougal has reported the appearance of an occasional, well-formed but small petal in other s pecies within supersection Cieca (MacDougal, 1992). I have also seen this in P . pallida in several of my greenhouse accessions and in the field in Quintana Roo, Mxico. Passiflora pallida appears to be largely self-com patible and autogamous in cultivation. Artificial se lf-pollinations of a clone of the species from Tamaulipas, Mxico ( MacDougal 259 ) by John MacDougal proved successful. Passiflora

PAGE 250

228 pallida produced (4-)15-27(-33) seeds per fruit. The fruits turned purple 30-33 days after pollination. Stegmaier (1973) reported that Dasiops passifloris McAlpine (Diptera: Family Lonchaeidae) infests the fruits of P . pallida in southern Florida. He found that the female fly oviposits on the fruits and the larvae feed on the arils and fruit flesh. In this study, in which he collected a to tal of 1040 wild passion fruits from P . pallida occurring on a single farm in Hialeah, Florid a, he also found that the mature fruit may contain from 4 to 17 seeds per fruit (Stegmaier, 1973). Passiflora pallida is a pest plant where it occurs in many areas of the Old World (Fig. 5). In Papua, Indonesia, Ne ville Kemp reports that the probable disperser of P. pallida is the Northern Common Cucscus ( Phalanger orientalis ). Figure 8.4. Passiflora pallida from Papua, Indonesia, illustrating the invasive potential of the species in that region. Photo by N. Kemp of the Indo-Pacific Conservation Alliance.

PAGE 251

229 Passiflora suberosa Description of Passiflora suberosa 2. Passiflora suberosa L. Sp. Pl. 958. 1753. Granadilla suberosa (L.) Gaertn. Fruct. Sem. Pl. 2(4): 480. 1791. Cieca suberosa (L.) Moench. Suppl. Meth. 102. 1802. Monactineirma suberosa (L.) Bory. Ann. Gen. Scient. Phys. 2: 138. 1819. Meioperis suberosa (L.) Raf. Fl. Tellur. 4: 103. 1838. LECTOTYPE (designated by Wijnands, 1983, Bot. Commelin s, p. 171): DOMINICA (lectotype: LINN 1070.21, microfiche seen). Passiflora angustifolia Sw. Prodr. 97. 1788. Monactineirma angustifolia (Sw.) Bory. Ann. Gen. Scient. Phys. 2: 138. 1819. Meioperis angustifolia (Sw.) Raf. Fl. Tellur. 4: 103. 1838. Cieca angustifolia (Sw.) M. Roem. Fam. Nat. Syn. Mon. 2: 143. 1846. Passiflora suberosa var. angustifolia (Sw.) Mast. Trans. Linn. Soc. London 27: 630. 1871. TYPE: JAMAICA, O . P . Swartz s . n . (holotype: S, photograph seen; isotype: BM!). Passiflora longifolia Lam. Encycl. 3: 40. 1789. TYPE: HISPANIOLA (holotype: P, in the Jussieu herbarium, photograph seen). Passiflora peltata Cav. Decima diss. bot.: 447, pl . 274 . 1780. Monactineirma peltata (Cav.) Bory. Ann. Gen. Scient. Phys. 2: 138. 1819. Meioperis peltata (Cav.) Raf. Fl. Tellu r. 4: 103. 1838. Cieca peltata (Cav.) M. Roem . Fam. Nat.

PAGE 252

230 Syn. Mon. 2: 141. 1846. TYPE: ANTILLES, J . D . Surian 203 (holotype: P, in the Surian herbarium). Passiflora hederacea Cav. Decima diss. bot.: 447. 1780. Monactineirma hederacea (Cav.) Boty. Ann. Gen. Sc ient. Phys. 2: 138. 1819. Meioperis hederacea (Cav.) Raf. Fl. Tellu r. 4: 103. 1838. Cieca hederacea (Cav.) M. Roem. Fam. Nat. Syn. Mon. 2: 141. 1846. Passiflora suberosa var. hederacea (Cav.) Mast. Trans. Linn. Soc. London 27: 630. 1871. LECTOTYPE (designated here): Pl um. Desc. Pl. Amer. pl . 84 . 1693. Passiflora kohautiana C. Presl. Bot. Bemerl.: 72. 1844. TYPE: MARTINIQUE, F . Kohaut s . n . (holotype: PRC). Passiflora calliaquatica Krause. Beih. Bot. Centralbl. 32(20): 340-341. 1914. TYPE: ST. VINCENT, between Kingstown and Calliagua, 25 January 1890, H . Eggers 15718 (holotype: B!). Slender, climbing, perennial vine 1-5(-10) m long or more, commonly sparsely to densely pubescent with unicellular or multicellular curved trichomes on leaf, petiole, stem, stipule, sepal, and tendril (very rare) (0.14-)0.20-1.13 mm long, 0.02-0.03 mm wide, also often minutely ant rorsely appressed-puberulent on leaf, petiole, stem, stipule, and sepal with unicellular, curv ed trichomes, 0.05-0.10 mm long, 0.02-0.03 mm wide. Flow ering stems terete or so mewhat compressed, 0.5-

PAGE 253

231 3.1 mm in diameter, greenish yellow to reddish purple to red, with the base woody and cork-covered. Stipules narro wly ovate-triangular, acute or rarely slightly attenuate, (1.5-)2. 2-8.4(-11.6)mm long, 0.11.3 mm wide; petioles 0.42.7(-3.7) cm long, with 2 (very rarely 1), opp osite to alternate, stipitate or sessile, cupulate, discoid or capitate nectaries (v ery rarely urceolate), 0.4-1.5 mm wide, 0.2-1.6 mm high, commonly borne in the dist al three quarters of the petiole (0.270.93 of the distance from t he base toward the apex of t he petiole). Laminas (1.4)3.0-14.2(-19.0) cm long, (0.8-)1.6-10.0(17.1) cm wide, not peltate or sometimes slightly peltate (the distance from leaf base to point of petiole insertion 2.3-2.5 mm), commonly membranous, 3-lobed, rare ly unlobed, ovate, commonly with base cordate or cuneate to acute, late ral lobes ovate to oblong (very rarely obovate), acute (rarely obtuse or rounded), (0 .9-)1.4-7.5(-12.0) cm long, 0.3-3.0(4.8) cm wide, central lobe ovate to ellipt ic, sometimes obovate, central vein (1.4)3.0-9.0(-14.2) cm long, angle between the lateral lobes (21-)40-140, ratio of lateral lobe to central vein length (0.30 -)0.38-0.87, margins entir e, rarely crenate, hyaline, primary veins 1-3 (when more than one, veins dive rge and branch at base or diverge and branch above base), laminar nectaries absent or sometimes with 1-10 submarginal nectaries associat ed with the minor veins of the abaxial surface, rarely associated with a crenati on of the leaf margin, rarely with 2-4 nectaries proximal to the lateral leaf vein s, 0.3-1.0 mm in diameter, circular to widely elliptic, sessile; tendril 0.2-1.1 mm wide, present at fl owering node except in inflorescence. Flowers borne in l eaf axils or sometimes in indeterminate axillary or terminal inflorescences; infl orescences 2.0-4.0 cm long, associated

PAGE 254

232 reduced laminas 2.0-4.3 mm l ong, 1.5-3.1 mm wide. Pedi cels 2.3-17.9 mm long, 0.2-0.7 mm wide, 2 per node; bract(s) absent or rarely with one or two narrowly ovate-triangular bracts present at (0.23)0.42-0.88 of the dist ance from the base toward the apex of the pedice l, 0.4-1.5(-2.3) mm long, 0.1-0.2 mm wide, acute; spur(s) absent. Flowers 12.3-49.1 mm in diameter with stipe (0.2-)1.4-11.5 mm long, 0.3-1.0 mm wide; hypanthium (3.0-)4 .0-8.8 mm in di ameter; sepals 4.014.6(-20.5) mm long, 2.0-5.0(-6.4) mm wi de, ovate-triangular, acute to rounded, reflexed at anthesis, abaxially and adaxially greenish yellow to very light greenish yellow (5GY 7/4, 8/4-8/2) or white; pet als absent; coronal filaments in 2 series (very rarely 1 series), the outer 20-36, 2.5-8.1 mm long, 0. 1-0.8 mm wide, linear, sometimes capitellate, erect (ca. 70) or slightly spreading (ca. 110) or spreading (ca. 180-220), greenish yellow with yellow tips (5Y 8/10), or flushed with reddish purple (5RP 5/6-3/6) at base and greenish ye llow at middle with yellow tips, or reddish purpl e (5RP 3/8-4/8) at base, greenish yellow at middle and yellow toward tips, ratio of outer co ronal row to sepal length 0.34-0.95, the inner (10-)18-45(-53), 1.5-3. 9 mm long, 0.1-0.3 mm wide, linear, capitate, erect to slightly spreading, greenish yellow, or greenish yellow with yellow tips, or greenish yellow flushed with reddish purpl e at base and yellow toward tips, or reddish purple with greenish yellow tips , ratio of inner coronal row to outer coronal row length 0.21-0.76; operculum (0.7 )1.0-3.0 mm long, plicate, greenish yellow, or greenish yellow with a flush of reddish purple at base, or reddish purple, margin white with minutely fimbrilla te teeth; nectary 0.1-1.1 mm high, 0.31.8(-2.7) mm wide; limen recurved, erec t or slightly inclined toward the

PAGE 255

233 operculum, 0.1-0.7 mm hi gh, 0.1-0.6 mm wide, gr eenish yellow or greenish yellow with reddish purple tip, limen floor (1.3-)1.8-4.0 mm in diameter, greenish yellow or greenish yellow flushed with reddish purple; androgynophore (2.1-)2.76.1(-12.6) mm long, 0.3-1.8 mm wide, greenish yellow or greenish yellow with a flush of reddish purple at base or greeni sh yellow with reddish purple spots and streaks; free portions of t he staminal filaments 1.6-6. 0(-6.8) mm long, 0.2-0.7 mm wide, linear, greenish yellow; anthers 1.4-3.3 mm long, 0.3-1.7 mm wide, pollen whitish or yellow; styles (1.7-)2.1-6.5(-7.7) mm long including stigmas, 0.1-0.5 mm wide, greenish yellow; stigmas 0.3-1. 7 mm in diameter; ovary 1.2-4.1 mm long, 0.8-3.7 mm wide, ellipsoid to globos e, greenish yellow. Berry 7.9-15.8 mm long, 7.4-13.4 mm wide, ovoid, ellipsoid or transversely ellipsoid, very dark purple (5P 2.5/2). Seeds ca. 8-34, obovate in outline, 2.5-4.0 mm long, 1.5-2.5 mm wide, 1.0-1.8 mm thick, reticulate-f oveate with each face marked with ca. 12-16 foveae, acute at both ends, chalazal beak and micropyle inclined toward raphe; germination type epigeal. Chromosome number 2n=12, 24, 36 (Beal, 1969; Diers, 1961; Storey, 1950). Fig. 8.5-8.8 Distribution and Ecology New World tropics, but introduced in the Ol d World tropics. Growing in shrubs and trees or trailing on the ground in secondary successional areas, along the edges of semideciduous to deciduous, dry to wet tropical forests, both inland and near the seashore, 0-2500 m. Flower ing and fruiting throughout the year.

PAGE 256

234 Key to the Subspecies of Passiflora suberosa 1a. Sepals white, 7.6-20.5 mm long, glabrous; androgy nophore 5.0-12.6 mm long; outer coronal filament s reddish purple at base, greenish yellow at middle and yellow distally; inner coronal filam ents reddish purple with yellow capitate heads; staminal filaments 3.4-6.8 mm l ong; pollen white; fruits ovoid. 2a. P . suberosa ssp. suberosa . 1b. Sepals greenish yellow, 4.0-9.0(-10. 8) mm long, pubescent with long, curved trichomes 0.16-1.13 mm long; androgynophore 2.1-4.4 (-6.1) mm long; outer coronal filaments greenish ye llow with yellow tips or gr eenish yellow with a flush of reddish purple at base and yellow at tips; inner coronal filaments greenish yellow, greenish yellow with yellow c apitate heads, or greenish yellow with a flush of reddish purple at base and yellow capitate heads; stam inal filaments 1.63.9 mm long; pollen yellow; fruits ellipsoid, subglobose, or globose. 2b. P . suberosa ssp. litoralis . Description of Passiflora suberosa ssp. suberosa 2a. Passiflora suberosa L. ssp. suberosa Sparsely to densely pubescent with uni cellular or multicellular curved trichomes only on leaf, petio le and stem (very rarely on stipule) 0.14-0.62 mm long, 0.02-0.03 mm wide, also minutely ant rorsely appressed-puberulent on leaf, petiole, stem, and stipule (sepal glabrous ) with unicellular, curved trichomes,

PAGE 257

235 0.06-0.10 mm long, 0.02-0.03 mm wide. Laminas not peltate or slightly peltate (the distance from leaf base to point of petiole insertion 2.3-2.5 mm). Flowers borne in leaf axils or sometimes in indeterminate axil lary or terminal inflorescences; inflorescences 2.0-4.0 cm long, associated reduced laminas 2.04.0 mm long, 1.5-3.0 mm wi de. Pedicels 6.9-17.6 mm long, 0.4-0.7 mm wide, 2 per node; bract(s) absent or with one or two narrowly ov ate-triangular bracts present at (0.23-)0.42-0.66 of the distance from the bas e toward the apex of the pedicel, 0.4-1.5(-2.3) mm l ong, 0.1-0.2 mm wi de, acute. Flowers 21.3-49.1 mm in diameter with stipe 3. 3-11.5 mm long; hypanthium 5.5-8.8 mm in diameter; sepals 7.6-20.5 mm long, 2.96.4 mm wide, abaxially and adaxially white; coronal filaments in 2 series, the outer 3.7-8.1 mm long, linear, slightly spreading (ca. 110), reddish purple (5RP 3/8-4/8) at base, greenish yellow (5GY 8/4-8/6) at middle and yellow (5Y 8/10) towa rd tips, ratio of outer co ronal row to sepal length 0.34-0.74, the inner 10-30 (-42), erect, reddish purple with greenish yellow tips; operculum 1.4-3.0 mm long, r eddish purple, margin wh ite; nectary 0.2-1.1 mm high, 0.7-1.8(-2.7) mm wide; limen recu rved, greenish yellow with reddish purple tip, limen floor greenish yellow; androgy nophore 5.0-12.6 mm long, 0.5-1.8 mm wide, greenish yellow; free portions of t he staminal filaments 3.4-6.8 mm long, anthers with nearly whit e pollen; styles 3.2-7.7 mm lo ng including stigmas. Berry 11.3-13.8 mm long, ovoid to ellipsoid. Seeds ca. 21-34. Fig. 8.5-8.7. Distribution and ecology Antigua and Barbuda, the Bahamas, Barbados , the British Virgin Islands of Tortola and Virgin Gorda, Cuba, Domini ca, the Dominican Republic, the French

PAGE 258

236 Overseas Departments of Guadeloupe and Martinique, Grenada, Haiti, Jamaica (rare), the Netherlands Antilles islands of Saba and St. Eustatius, Puerto Rico, Saint Lucia, Saint Vincent and the Grenadine s, the United States Virgin Islands of St. Croix, St. John and St. Thom as, and the United Kingdom Overseas Territory of Montserrat, and the United St ates (O'ahu, Hawaii). Growing in shrubs, trees or trailing on the ground in secondary successional areas, along the edges of semideciduous to deciduous, dry to moist tropical forests, both inland and near the seashore, 0-1600 m. Flowering and fruiting throughout the year. Vernacular names Huehue haole (Hawaii, United States), meloncillo (Cuba), and wild watermelon (Dominica). Additional specimens examined Antigua and Barbuda . Antigua, St. George, Long Island, Box 895 (BM, US); Antigua, Weatherills, Box 1294 (MO); Antigua, Rose , Fitch & Russell 3460 (US); Antigua, Wullschlagel 238 (M); Antigua, Wullschlager 239 (M). Bahamas . – ACKLINS AND CROOKED ISLANDS: Cr ooked Island, road to Stopper Hill, Brace 4810 (NY). –BIMINI: near center of Cat Cay, Correll & Correll 45674 (GH, MO, NY). –CAT ISLAND: Port Howe, Hitchcock s . n ., 12 November 1890 (MO); Gun Cay, Millspaugh 2318 (NY). –NICHOLLSTOWN AND BERRY ISLANDS: Whale Cay, Britton & Millspaugh 2189 (NY, US); along Santa Maria Drive, Great Harbour Cay, Correll & Correll 43707 (NY, TEX). –SAN SALVADOR ISLAND:

PAGE 259

237 near Museum, Sarant, Saums & Warekois 57 (FLAS). Barbados . upper Rusher Gully, 800 ft, Blooding 128 (BM); Saint Michael, Dash 518 (NY, US). British Virgin Islands . Tortola, Sage Mountain, 500 m, D'Arcy 113 (MO); Tortola, Harrigans, 300 m, D'Arcy 253 (MO); Virgin Gorda, North Sound, Fishlock 24 (GH); Virgin Gorda, Fishlock 39 (GH); Virgin Gorda, Fishlock 141 (GH); Tortola, Experiment Station, Fishlock 152 (GH, PH, US); Tortola, Slaney Point, Fishlock 264 (NY); Tortola, Guana Island, E of White Bay, 10 ft., Proctor 42509 (NY). Cuba . –CAMAGEY, Sierra Cubitas, Shafer 442 (NY, US). –CIENFUEGOS: Trinidad Mountains, Santa Clara, Hanabanilla Falls, Britton , Earle , Wilson 4857 (NY); Dist. Cieneguita, Combs 50 (MO); Limones, Soledad, Jack 4807 (A, US); Limones, Soledad, Jack 5485 (A, US); Las Vegas de Matagu, Trinidad Mountains, Morton 10536 (US); Las Vegas de Matagu, Trinidad Mountains, Morton 10790 (US). –GRANMA: Corojo, in "Pinarde Corojo", ad viam (prope Bayamo ad. austr.-orient. versus), Ekman 5045 (S). –GUANTN AMO: vicinity of Baracoa, Pollard , Palmer , & Palmer 249 (MIN, NY, US). –HOLGUN: Sierra de Nipe prope Ro Piloto in fruticetis, Ekman 2696 (S). Pinar del Ro, Limestone hills between Ro Cayaguat eje and Sierra Guane, Shafer 10474 (NY); Monte Verde, Wright 1245 (G, GH, PH). –PINAR DEL RO: Limestone hills between Ro Cayaguate and Sierra Guane, Shafer 10474 (US). –SANTIAGO DE CUBA: Sardinero, Santiago, Clemente 6298 (GH); Himgro, subrada del cassina a la Gran Piedra, Clemente & Chrysogone 7250 (GH); Bayate in sylvis prope Ro Jagua, Ekman 2025 (G, S); Bayate in fruticetis, communis, Ekman 2607 (S); Bayate in fruticetis prope viam, Ekman 5663 (S); Bayate in fruticetis prope viam,

PAGE 260

238 Ekman 5665 (S); Sierra Maestra, La Gran Piedra prope cacumen, 1200 m, Ekman 8844 (S); vicinity of Piedra Gorda, 30-150 m, Shafer 3705 (NY). –VILLA CLARA: San Blas-Buenos Aires, Trin idad Mountains, atop of Boma Ventana, Howard 6507 (GH); San Blas, La Sierra, 600-800 ft., Jack 5770 (A, US); Las Lagunas, Buenos Aires, 2500 ft., Jack 7049 (A); Lomas de Banao, Santa Clara, Luna 395 (NY); above San Blas, Sierra Gavilan, 300-600 m, Morton 4008 (US); Sierra San Juan, above San Blas, 300-600 m, Morton 4079 (US). Dominica . – SAINT DAVID: Carib trail from Salybia to Hatton Garden (1 mi.), Hodge 3082 (GH, NY, US); Reserve Cariaibe, Salybia, 25 m, Stehle 6411 (US). –SAINT GEORGE: Deux Granges, 1000 ft., Nicolson 2095 (DUKE, US). –SAINT JOHN: Cabrit Swamp, 30 ft., Nicolson 1889 (BM, US); N of Prince Rupert Bay, W Cabri, 50-190 m, Smith 10323 (NY, US). –SAINT JOSEPH: Layou River Valley, Clarke Hall Estate, 400 ft, Ernst 1265 (US). –SAINT PETER: 3 km S of DuBlanc on the coastal road to Roseau, 75 m, Miller & Merello 8871 (MO). Dominican Republic . –AZUA: caada Miguel Mar tn between Sabana de Miguel Martn and Sabana de San Juan, 1500-1600 m, Mejia & Zanoni 8250 (JBSD); Sierra Martn Garca, caada de Tinari, apr ox. 13-14 km SW de Barrero, 400 m, Pimentel , Garcia & Caminero 368 (JBSD). –BAORUCO: Fuertes 160 (BM, GH); Santo Domingo, 1300 m, Fuertes 1338 (A); Montiada Nueva, forested hillslopes SE of Polo, 3500 ft., Howard & Howard 8509 (B, GH, NY, US); en la parte baja de La Filipina, Barahona, 50 m, Liogier & Liogier 25836 (NY); Sierra de Baoruco, Parque Nacional Sierra de B aoruco, Sector de La Isla, Palaez 1819 (JBSD); near mouth of Ro Baoruco, Smith 10027 (MO, NY); Ro Baoruco from La Hortaliza

PAGE 261

239 (about 1.5 km up from mout h of Baoruco) to 2 km further upstream, 30-50 m, Zanoni & Mejia 16485 (JBSD, MO, NY). DIST. NA CIONAL: vicinity of Ciudad Trujillo, 0-25 m, Allard 16370 (S, US); Llano Costero, St o. Domingo City, Cantes of Ro Ozama, Ekman 12355 (S); Haina, Faris 121 (US). –EL SEIBO: Jovero, near sea level, Abbott 2507 (US); Monte Redondo, E of Jovero, 300 m, Abbott 2834 (US); 0.5 km W of Sabana de Nisib n on hwy. to Miches, 15-20 m, Mejia , Ramrez & Zanoni 10130 (MO, NY). INDEPENDENCIA: aprox. 10.5 km al "S" de Puerto Escondido en la carretera a la Caseta No. 1 & la Caseta No. 2 de Foresta & Aceitillar, no lejos de la Caseta No. 1., 1240 m, Zanoni , Mejia , Pimentel & Garcia 34633 (JBSD). –LA VEGA: Cordillera Central, Constanza, 1200 m, Ekman 14073 (S); nico ejemplar visto, Ruego la Devolucin, Valle de Constanza, 1200 m, Jimnez 1541 (US); Salto de Constanza, 1215 m, Jimnez 2209 (US). PERAVIA: Arroyo Parra, La Vareda, 950-1000 m, Gentry & Zanoni 50539 (MO); Arroyo de Parra, betw een Cerro de Quemada and Loma del Rancho, upstream from habita tions of El Tamarindo, 800 m, Mejia & Zanoni 8106 (NY). –PUERTO PLATA: Puerto Plata, Abbott 1469 (US). –SALCEDO: Cordillera Septentrional, 16 km N de Tenares, siguiendo la carretera hacia Gaspar Hernndez; en el lugar llamado Boca Arriba, 550-600 m, Garcia & Jimnez 4203 (JBSD). –SAMAN: Seccin Las Galeras, Paraje Rincn, lugar denominado Laguna Salada, 10-20 m, Peguero & Veloz 94 (JBSD); Snchez, road to Aremoso, Taylor 79 (NY); 3.5 km E del pueblo de Las Terrenas & entre 1 hasta 4 km, S de la playa en la finca Hacienda Nydia (Propiedad de familia Paiewonsky), 50 ft., Zanoni & Mejia 17780 (MO, NY); Cerca del poblado de El

PAGE 262

240 Escarbado (N de La Majagua), W limite de la sierra de la pennsula de Saman & lmite, W de la Loma La Majagua, 30 m, Zanoni , Mejia & Perez 24681 (JBSD, MO, NY). –SAN CRIST”BAL: Gualupita (6 km N of Medina) which is 27 km N of main plaza of San Cristbal on road to Medina and Madrigal, 100 m, Mejia , Ramrez & Zanoni 10379 (MO, NY); Ro Comate where it crosses road at town of Sierra de Agua, 180 m, Mejia & Zanoni 8042 (NY). –SAN JUAN: Hondo Valle, 3500 ft., Howard & Howard 8688 (GH, NY); Hondo Valle, 3500 ft., Howard & Howard 8689 (GH); Juan Santiago, 3500 ft., Howard & Howard 9265 (B, BM, GH, NY, US); Cordillera Central, Par que Nacional Ramrez, "La Lomita", una loma cerca de la caseta del Parque Nacional de El Valle de Tetero, 1550 m, Zanoni & Garcia 41471 (NY). –SAN PEDRO DE MACORS: San Pedro de Macors, Rose , Fitch & Russell 4164 (NY, US). –SANTIA GO: Meseta, Moncin, 350 m, Alain & Liogier 24531 (JBSD); Loma Las Mil Tareas, N de Navarrete, 920 m, Dod s . n ., 4 October 1981 (JBSD); Base Cord illera Central, Parcela 4 (de U. Klotz) del Compartimiento 493 del Proyec to Forestal La Celestina (W de San Jos de Las Matas) prximo al campamento del proyecto & la carretera a Rubio, Klotz s . n ., 1988-1990 (JBSD). –SANTIAGO RODRGUEZ: along Yaguajal River, 120 m, Liogier 13235 (NY). French Overseas Department . – GUADELOUPE: Bartrana 4645 (US); Morne l'Eau (Grippon), Duss 3538 (NY); Basse Terre (ravine Souffleur), Gombegri, Viem-Turl, Monte, Duss 3540 (C, NY); Ravine Souffleur (pres de la Basse Terre), 20-500 m, Duss 3563 (NY); Camp Tacul, Grand Camp, 10-600 m, Duss 3909 (US); Environs de la Basse-Terre, 30600 m, Duss 3909 (NY); Pointe-Noire, Belle Htesse, 500 m, Jeremie 131 (A);

PAGE 263

241 Vieux-Fort, Mts. Caraibes, en bordur e de foest ouverte seche a env., 300 m, Jeremie 305 (A); Moule, 40 m, Questel 816 (US); Yas. Torras, Moule, Questel 816 (US); Morne--l'Eau, Questel 4488 (US); Basse Terre, Deshaies, Baie de Grand Anse, Sastre & Sastre 2064 (A); Basse Terre, Crete du Village, debut du chomin mesant aux 2 Mamelles, 700 m, Sastre , Sastre , Fournet & Fournet 2566 (MO); Anse-Bertrand, 10 m, Stehle 1586 (US); Bois inferior de Bains Jaunes, 650 m, Stehle 5629 (US); St. Barthlemy, von Goes s . n (S). –MARTINIQUE: Anses d' Arlets, Marm (Gommier) Case-Pilote, Duss 873 (NY); Anses d' Arlets, 0-500 m, Duss 874 (NY); Casa Navire, Case-Pilote Fuinte, Duss 874 (NY); CasePilote Fuinte, Duss 874 (C); Crois-Flers Mac oube, Parnasse, St. Marie, Duss 876 (NY); Belleville N of Prcheur, 50-100 m, Larsen & Larsen 35348 (AAU); Jardin de Tivoli, 250 m, Stehle 4335 (US); Tivoli bow Rivire Madame, 210 m, Stehle 4511 (US); Le Morne Vert, 480 m, Stehle 4845 (US); Rivire Pilote, 15 m, Stehle 6543 (US); St. Piene au Morne Rouge, 300 m, Stehle 6219 (US); Fort Royal in limosis, Tsert s . n ., 1787 (C). Grenada . –SAINT JOHN: Grand Anse, Broadway s . n ., December 1904 (GH, NY); near Gouyave, Miller 316 (US). –ST. MARK: Tufton Hall estate, 200-1000 ft., Proctor 17151 (A, BM). –ST. PATRICK: 0.5 mi. N of Tivoli, 100 ft., Proctor 16888 (A, BM, US). Haiti . –ARTIBONITE: Bazil, Morne Sale, Cook 48 (US); vicinity of Kalacroix, Dessalines, 700 m, Leonard 7952 (US). GRAND' ANSE: Fonds Vare ttes, vicinity of Mission, 1000+ m, Leonard 3610 (BM, GH, PH, US). –NORD: La Victoire, Holdridge 1840 (BM, NY, US); vicinity of St. Michel de l'Atalaye, Mt. la Cidre, 350 m, Leonard 7394a (US); vicinity of Marmel ade, W of Marmelade, 800 m, Leonard 8116 (US); St.

PAGE 264

242 Raphael Road 4 mi. E of St. Michel de l'Atalaye, 350 m, Leonard 8521 (GH, US, NY); Marmelade, 3000 ft., Nash 773 (NY). –NORD-OUEST: vicinity of Jean Rabel, Leonard & Leonard 12713 (NY, US). –OUEST: vi cinity of Anse Galette, Gonve Island, Leonard 3038a (US); vicinity of Furcy, 1300 m, Leonard 4818 (GH, NY, US); vicinity of Ptionville, 350 m, Leonard 4852 (PH, US); Morne Boutellier, SE of Port-au-Prince, 3000 ft., Proctor 10658 (US). –SUD: Massif de la Hotte, Parc National Pic Macaya, Bwa Formon, 1000 m, McBride s . n ., March 1989 (FLAS); Massif de La Hotte, 13.6 km N de Camp Perrin en la carretera a Roseaux & Jrmie, "Tombeau Cheval", 720 m, Zanoni , Mejia & Pimentel 24320 (JBSD, MO); Massif de la Ho tte, sobre Morne Rochelois; 2.8 km W de Miragone & 22.4 km "S" en la carretera a Paillat & las minas de Reynolds, Haitian Mines, 900 m, Zanoni , Pimente & Garcia 28635 (JBSD). –SUD-EST: Massif de la Selle, group Mornes des Commis-sair es, Anse Pitre, Banana, 200 m, Ekman 6908 (S); near Petite Source, Mornes des Commissaires, 1400 m, Holdridge 1212 (NY, US). Jamaica . See specimen listed under cultivated material. Netherlands Antilles . –SABA: Winwardside, 500 m, Arnoldo 3229 (A); Windwardside, 500 m, Arnoldo 3387 (U). –ST. EUSTATIU S: Top of the Quill, 400 m, Boldingh 192B (U); Top of the Quill, 400 m, Boldingh 313B (U); Top of the Quill, 450 m, Boldingh 342B (U); Top of the Quill, 500 m, Boldingh 490B (U); Slope of the Quill near Bengalen, 200 m, Boldingh 690B (U); Boldingh 837B (NY); Groll-Meyer 271 (U); Volcnic cone "The Quill" , 2-2.2 km E of Oranjestad, 200 m, Iltis 30271 (WIS). Puerto Rico . –BARCELONETA: Bo. Garrochales, Rt. 22, km 57 (near jct Rt 140)., 50 m, Axelrod , Proctor & Colon 8382 (MO). –

PAGE 265

243 BAYAM”N: Cabra Island, San Juan, Otero 108 (MO); prope Bayamn in repibus, Stahl 608 (S). –CAROLINA: in NW urban Carolina, at Campo Rico Final and Fudalgo Daz, Taylor 7835 (NY). –CULEBRA: Britton & Wheeler 38 (NY); Culebra, Island of Culebra, Britton & Wheller 80 (NY); Cayo Luis Pena, Ortega 49 (NY). –FAJARDO: SW of Fajardo, 100-200 m, Alain , Liogier & Martorell 28005 (NY); Cabezas de San Juan Nature Reserve, trail from entrance to lighthouse and down to beach, 0-60 m, Axelrod & Roubik 3854 (NY); Cabezas de San Juan Natural Reserve, along road that borders the lagoon, on the W side of the lagoon, near the reception house, sea level, Ortiz-Zuazaga , Escobar , Tremblay & Ortega 5 (US). –HUMACAO: Cayo Santiago, Caribbean Primate Research Center, Big Key, side, 30 m, Axelrod , Turnquist & Berard 4158 (NY). – JUANA DAZ: Mpio. Juana Daz, shore S of road 1 about 2 mi. E of road 149 W of Santa Isabel, SE of Juana Daz, Stimson 4031 (DUKE). –LUIZA: near Rd. 187 at Pinonez, Houghton , Vivaldi , Lippincott & Proctor 1234 (NY). –MARICAO: Maricao Forest Reserve, 20 mi. E of Mayagez, 800 m, Gentry & Zardini 50449 (MO). –MAUNABO: Punta de la Tuna, Urban 5114 (BM, GH, NY); Hill at Maunabo, Wagner 1817 (A, U). –MOCA: Bo. Roc ha, Rt 112, km 13.0, 250-300 m, Axelrod & Nir 8329 (MO); Bo. Rocha, Rt 112, km 13.0, 250-300 m, Axelrod & Nir 8331 (MO). –NAGUABO: junction of Rt. 31 & 3, Evans 78 (A). –PONCE: Ponce to Peuelas, Britton , Britton & Marble 1763 (NY); Ponce, Heller 6068 (NY, PH); W on the Adjuntas road 10 mi. from Ponce, Heller s . n (NY); Ponce at the construction site of the new prison, Taylor & Ross 8179 (NY). –RINC”N: Prope Rincn, Urban 5668 (BM, GH). –RO GRANDE: along Puerto Rico Rt. 185, on

PAGE 266

244 the W slopes of the Luquillo Mountains, Pfeifer & class 2704 (CONN); along road from Palmar to Luquillo National Forest, Pfeifer & class 2886 (CONN). – VIEQUES: vicinity of Isabel Segunda, Shafer 2506 (CAS, NY); Lighthouse Peninsula, Shafer 2788 (CAS, NY). –YAUCO: Bo. Ro Prieto, W slope of Monte Membrillo, along road above Hacienda Asuncin, 850 m, Axelrod & Axelrod 8546 (CICY). Saint Lucia . –GROS-ISLET: Bois D' or ange near mouth of the river, 5 ft., Slane & Boatman 251 (A); La Feuillet, 200 ft., Sturrock 506 (A). – SOUFRIRE: Colombette (S oufrire-Canaries Road), 1200 ft., Box 1881 (BM). –VIEUX FORT: on the trail to the lighthouse from Vieux Fort, Howard 11435 (A). Saint Vincent and The Grenadines . –GRENADINES: Kick'em Jenny, Grenada territory, Howard 10790 (BM, GH); Carriac ou, Grenada territory, Howard 10859 (B, BM, GH, NY). –SAINT VINCENT: NW peninsula of Cannuoan Island, Howard 11111 (GH); cove on NW peninsula, Bequia, Howard 11266 (GH); Windward, 1000 ft., Smith & Smith 615 (GH); 800 ft., Smith & Smith 1314 (BM); Calliaqua (S end of the island), Smith & Smith 1616 (GH, US). United States Virgin Islands . –SAINT CROIX: Eliras Retreat, Eggers 437 (C); Eggers 547 (C); Eggers s . n ., November 1870 (C); Eggers s . n ., December 1870 (C); U.S. Virgin Islands, St. John, Raunkiaer 2691 (C); Ricksecker 186 (GH, MIN, MO, NY, US); Ricksecker 322 (MO, US); Ryan s . n . (C); Schow s . n . (C); Arvua's Hope, Thompson 362 (GH); River Estate, Thompson 367 (US); Tsert s . n . (C). –SAINT JOHN. Dirt road to Bordeaux Mountain, about 0.5 km from Center Line Road, Acevedo 3133 (US); Bordeaux, 400 m, Britton & Shafer 587 (US); Kingshill, 1000 ft., Eggers 3013 (C); Cruz Bay, Ostenfeld 374 (C, U); Western, Raunkiaer s . n .,

PAGE 267

245 15 February 1906 (C). –SAINT THOMAS: Fortuna Quarter, road 30, 140 m, Acevedo , Siaca & Reilly 5196 (US); Borgeneu 39 (C); Borgesen s . n ., 1905 1906 (US); Bank, St. Peter, Britton & Marble 1228 (NY, US); Eggers s . n ., 22 September 1876 (C); Eggers s . n ., 22 September 1876 (MO); Flaghill, 600 ft., Eggers s . n ., 22 December 1876 (GH); Cowells Hill, Eggers s . n ., November 1880 (NY); Eggers s . n ., 1884 (C); 1300 ft., Eggers s . n ., 1885 (GH); Hombeck s . n . (NY); Krebs s . n . (C); Krebs s . n ., 29 March 1845 (C); Krebs s . n ., 1871 (C); Nulliberg, Laub s . n ., 1932 (C); Disturbed area along rt. 38 near Point Pleasant, Mehrhoff 13364 (CONN); Orsted s . n . (C); Orsted s . n . (C); Raunkiaer s . n ., 5 November 1905 (C); Wydler 88 (G). United Kingdom Overseas Territory . – MONTSERRAT: St. Peter, wooded area above Salem, Howard & Howard 15111 (GH); St. Peter, slopes of the Centre Hills, above Salem, 500-1000 ft., Proctor 18884 (GH); St. Peter, near Little Bay, Shafer 424 (NY, US); Roehrs, road to Surruryo Hill, Shafer 620 (NY). United States . –HAWAII: Honolulu Co. : O'ahu, Honolulu, 127 Dowsett Avenue, Clarke s . n ., 1927 (BM); O'ahu, 50 feet from beach at Punalu'u, Degener 7112 (NY, US); O'ahu, near sea, Kaipapa'u, Degener & Park 9947 (MO, NY, PR, US); O'ahu, NW slope of Kaluanui Valley, Hau'ula, O'ahu, Degener , Salucofs & Arlantico 11866 (B, NY, US); O'ahu, Cooper Ranch Inn, Hau'ula, 100 m, Fosberg 12286 (MO); O'ahu, on Hau'ula mountain rage, walking off t he foot trail at the end of the jeep trail, around the ridge, 360 ft., Herat & Wirawan 167 (B); O'ahu, along ridge tra il starting at the old abandoned Mormon church and cemetery on the Kw side, 360 ft., Herat & Wirawan 188 (B); O'ahu, Kpapa Isle t, Kne'ohe Bay, 5 ft., Herbst 6114 (US);

PAGE 268

246 O'ahu, Punahou area, Ualakaa St., Lau 1503 (MO). Cultivated Material . – UNITED STATES. North Carolina, cultivated at Duke University, from L. Gilbert, collected in Virgin Islands, MacDougal 421 (FLAS, MO); United States, Missouri, cultivated at the Missouri Botanical Ga rden and in J. M. MacDougal's outdoor home garden 1987-1990 from seeds collect ed 26 Jan. 1987 by Julie X. in Jamaica, Portland Parish, MacDougal 3026 (FLAS, MO); United States, Missouri, cultivated at the Missouri Botanical Ga rden, 1994-2000 from cu ttings from C. Feuillet of unknown provenance, said to be an adventive in his greenhouse, his 281 , MacDougal 6023 (FLAS, MO); Florida, cultivat ed at the University of Florida from material collected by T. Zimmerman in St. Croix, Porter-Utley P-4 (FLAS).

PAGE 269

247 Figure 8.5. Flower of P. suberosa ssp. suberosa ( MacDougal 421 ) from the Virgin Islands. Note white pollen of P. suberosa ssp. suberosa . Scale bar = 8 mm. Photo by J. M. MacDougal. Figure 8.6. Flower and leaf of P. suberosa ssp. suberosa from St. Croix ( PorterUtley 6 ). Scale bar = 8 mm.

PAGE 270

248 Figure 8.7. Distribution of P. suberosa ssp. suberosa and P. suberosa ssp. litoralis . Notes In the Greater Antilles, P . suberosa ssp. suberosa is commonly found in and along the edges of moist forest s, primarily at higher elevat ions. It is relatively common on all of the islands of the Greater Antilles, except for Jamaica, where it is very rare. In the Lesse r Antilles, it does occur at high elevations but primarily occurs at lower elevations and is found in dry to moist forests. The vegetative morphology of P . suberosa ssp. suberosa is incredibly variable. However, throughout most of its range the subspecies commonly

PAGE 271

249 possesses trilobed leaves at reproducti ve nodes, with only ca. 10% of the specimens examined having l eaves that are unlobed at all nodes. However, ca. 20% of the specimens possess unlobed, bilobed and trilobed le aves on sheets of the same collection. The leaves of Passiflora suberosa ssp. suberosa are commonly lobed less than 50% of the distance from the outline of the leaf to the leaf base and the lateral lobes are one hal f to three quarters the length of the central lobe. The leaves are frequent ly dark green in color on their adaxial surfaces and possess cordate bases. The juvenile leaves of P . suberosa ssp. suberosa are often peltate and frequently pos sess laminar nectaries. However, the leaves on older plants are only very rarely peltate and usually do not possess nectaries. The vegetative parts of the plant also possess varying amounts of reddish purple pigmentation, and the st ems and new growth are often entirely reddish purple. Passiflora suberosa ssp. suberosa is relatively small in stature, rarely exceeding a length/height of five or six meters in the field. The flowers are large, greater than 2.5 cm in diameter, with white sepal s, coronal filaments that are dark reddish purple with ye llow apices and whit ish pollen. The fruits are also ovoid and very dark purple. In the Lesser Antilles, there are three morphological variants. One of these variants occurs in the Grenadines and posse sses large leaves (over 10 cm wide) that are deeply trilobed (more than half the distance from the leaf outline to the leaf base) with long, commonly oblong lateral lobes that are at least three quarters the length of the lateral lobe. T he leaves are often distinctly peltate and frequently possess four laminar nectaries (t wo on either side of the central leaf

PAGE 272

250 vein and one proximal to each lateral vein). Another variant occurs primarily in Dominica and Martinique and possesses deepl y trilobed leaves with wider, ovate lateral lobes and deeply cordate bases. The leaves are not as large as the first variant (ca. 5-8 cm wide), but possess four laminar nectaries in the same positions as the entity in the Grenadines. The last variant occurs on several of the Windward Islands and possesses trilobed leaves with ca. 10 laminar nectaries. The nectaries are positioned near the leaf margin, creating crenations where they appear. Additionally, the nec taries are commonly positioned proximal to the lateral leaf veins, a very rare c ondition in the subspecies. All of these Lesser Antillean forms possess the longes t floral stipes and sepals in the subspecies. In the Dominican Republic and Cuba there is an additional variant that has unlobed leaves at all nodes. The leaves are exceptionally long for the subspecies (>10 cm), more coriaceous and possess petiolar nectaries that are wider and somewhat discoid, as opposed to the more cupulate or capitate condition typical of the subspecies. Passiflora suberosa ssp. suberosa is sympatric with three species in supersection Cieca : P . pallida , P . lancifolia , and P . macfadyenii . It can be easily separated from P . lancifolia and P . macfadyenii using both vegetative and reproductive characters. The most obvi ous features are t hat the leaves of P . macfadyenii and P . lancifolia are very densely pubescent with long, unicellular curved trichomes, whereas P . suberosa ssp. suberosa appears glabrous (i.e., primarily microscopically antrorsely appressed-puberulent). The flowers of P . macfadyenii and P . lancifolia are also tubular and possess bright red sepals.

PAGE 273

251 Passiflora suberosa ssp. suberosa has the cup-shaped flowers typical of the supersection and white sepals. However, P . pallida and P . suberosa ssp. suberosa can be difficult to separate without repr oductive material. The leaves of P . suberosa ssp. suberosa are darker green in color than those of P . pallida and sometimes have laminar nectaries , these strictly absent in P. pallida . They are also wide, i.e., (2.9-) 5.0-12.0(-17.1) cm, in P . suberosa ssp. suberosa , and although this overlaps with the (0 .3-)6.0-7.0(-10.6) cm range in P . pallida , the character can frequently be used to disti nguish between them. In addition, the leaf bases of P . suberosa ssp. suberosa are cordate (when they are not peltate), whereas those of P . pallida are very rarely cordate and usually are acute to cuneate. The stems, leaves (especially at their margins), tendrils, and stipules are frequently reddish purple in P . suberosa ssp. suberosa , and the vegetative parts of P . pallida generally possess little, if any , reddish purple coloration. Passiflora pallida may be densely pubescent where it occurs in the Caribbean, but P . suberosa ssp. suberosa appears glabrous. The flowers of P . pallida are much smaller than those of P . suberosa ssp. suberosa . Passiflora pallida has sepals that are very rarely greater than 8 mm long, but the sepals of P . suberosa ssp. suberosa are always longer than 8 mm. The hypanthium in P . pallida is 2.24.2 mm wide, whereas that of P . suberosa ssp. suberosa is 5.5-8.8 mm wide. Passiflora pallida has short staminal fila ments (1.4-3.0 mm), and P . suberosa ssp. suberosa has staminal filaments that are 3. 4-6.8 mm long. The sepals of P . suberosa ssp. suberosa are white, whereas those of P . pallida are commonly greenish yellow; though P . pallida may possess light colored sepals in the

PAGE 274

252 Yucatn Peninsula of Mxico. The fruits of these taxa are also quite different; P . suberosa ssp. suberosa has ovoid fruits and P . pallida has globose or ellipsoid fruits. In the Greater Antilles, P . suberosa ssp. suberosa is commonly found at higher elevations and in more mesic habitats than P . pallida . In other areas in the world their habitats are less distin ct, but the species can be distinguished morphologically. Passiflora suberosa ssp. suberosa and P . suberosa ssp. litoralis have different geographic distributions, with P . suberosa ssp. suberosa occurring in the Caribbean and P . suberosa ssp. litoralis in Mxico, Central America, and South America. They only co-occur on the isla nd of O'ahu, Hawaii, USA, where they have been introduced. The two subspecies are very similar vegetatively, but P . suberosa ssp. litoralis is commonly conspicuously and densely pubescent with longer unicellular or multicellu lar curved trichomes, whereas P . suberosa ssp. suberosa appears glabrous. Passiflora suberosa ssp. suberosa does not possess inflorescences present as c ondensed shoots with aborted lamina, but P . suberosa ssp. litoralis may have them. The sepals of P . suberosa ssp. suberosa are glabrous, and those of P . suberosa ssp. litoralis are pubescent. The staminal filaments of P . suberosa ssp. suberosa are often greater than 4 mm long, whereas those of P . suberosa ssp. litoralis are less than 4 mm long. Passiflora suberosa ssp. suberosa also possesses a longer androgynophore (> 5 mm), and the androgynophore of P . suberosa ssp. litoralis very rarely reaches a length of 5 mm. The fruits of P . suberosa ssp. suberosa are larger (commonly > 1.0 cm)

PAGE 275

253 and ovoid, whereas P . suberosa ssp. litoralis has depressed globose to globose to ellipsoid fruits that are commonly less that 1.0 cm long. MacDougal found one clone of P . suberosa ssp. suberosa ( MacDougal 421 ) from the Virgin Islands to be self-compat ible in the greenhouse. The two clones of P . suberosa ssp. suberosa ( Feuillet 281 and Porter-Utley P-4 ) in my greenhouse collection at the Universi ty of Florida were autogamous. Clifford Smith in the Dept. of Botany at the University of Hawaii reports that P . suberosa ssp. suberosa , as recognized here, is a minor weed in Hawaii in subcanopy layers where it smothers shrubs , small trees and the ground layer. In some areas it can also smother the upper canopy layer. He has also found that the seeds are dispersed by alien frugivorous birds ( http://www.botany.hawaii.edu/ faculty/cw_smith/pas_sub.htm ). Description of Passiflora suberosa ssp. litoralis 2b. Passiflora suberosa L. ssp. litoralis (Kunth) K. Porter-Utley. Comb. nov. Passiflora litoralis Kunth. Nov. Gen. Sp . 2: 138. 1817. Cieca litoralis (“ littoralis ”) (Kunth) M. Roem. Fam. Nat. Syn. Mon. 2: 145. 1846. TYPE: PERU, Patibilca, A . Humboldt & A . Bonpland s . n . (holotype: P, photograph seen; isotype: B, destroyed). Passiflora limbata Ten. Index Seminum Horto Bot. Neapol. 12: 10. 1839. Ann. Sci. Nat. ser. 2, 13: 378-381. 1840. Cieca limbata (Ten.) M. Roem. Fam. Nat. Syn. Monogr. 2: 148. 1846. T YPE: (holotype: not found).

PAGE 276

254 Passiflora pseudosuberosa Fisch. Index Sem. (St. Pe tersburg) 9: 82. 1843. Cieca pseudosuberosa (Fisch.) M. Roem. Fam. Na t. Syn. Monogr. 2: 146. 1846. TYPE: BRAZIL, unknown collector s.n. (holotype: LE). Passiflora olivaeformis Vell. Fl. Flumin. 9: pl . 83. 1831. Cieca olivaeformis (Vell.) M. Roem. Fam. Nat. Syn. Mon. 2: 144. 1846. TYPE: BRAZIL, Ro de Janeiro, Vell. Fl. Flumin. 9: pl . 83. 1831. Passiflora globosa Vell. Fl. Flumin. 9: pl . 85. 1831. Cieca globosa (Vell.) M. Roem. Fam. Nat. Syn. Monogr. 2: 144. 1846. TYPE: BRAZIL, Vell. Fl. Flumin. 9: pl . 85. 1831. Passiflora flexuosa Gardner. London J. Bot. 1: 174. 1842. Cieca flexuosa (Gardner) M. Roem. Fam. Nat. Syn. Monogr. 2: 148. 1846. LECTOTYPE (designated here): BRAZ IL, near Ro Comprido, G. Gardner 50 (lectotype: BM!; isolectotype: K, photocopy seen). Passiflora suberosa L. var. divaricata Griseb. Bonplandia (H anover) 6 (1): 7. 1858. TYPE: PANAM, unknown collector s . n . (holotype: GOET, photocopy seen).

PAGE 277

255 Passiflora suberosa L. var. hirsuta (L.) Mast. subvar. argentea Mast. Trans. Linn. Soc. London 27: 630. 1871. LECTOTYPE ( designated by W.B. Hemsley, 18791880, Biol. Cent.-Amer., Bot. 1: 480): MXICO, Puebla, Tehuacn, H . Galeotti 3663 (lectotype: K!; isolectotype: G!, photocopies (2), BR!). Passiflora suberosa L. var. longiloba Triana & Planch. Ann. Sci. Nat., Bot. 17: 157. 1873. TYPE: COLOMBIA, Tocayma, J . Goudot s . n . (holotype: P, photograph seen). Passiflora suberosa L. var. longipes S. Watson. Proc. Amer. Acad. Arts 25: 149. 1890. TYPE: MXICO, Jalisco, Guadalajara, 26 September 1889, C . G . Pringle 2966 (holotype: GH!; phot ographs, AAU!, DUKE!, F!). Sparsely to densely pubescent with uni cellular or multicellular curved trichomes on leaf, petiole, stipule, st em and sepal 0.16-1.13 mm long, 0.02-0.03 mm wide, also minutely antrorsely appre ssed-puberulent on leaf, petiole, stem, stipule and sepal with unicellular, curv ed trichomes, 0.05-0 .10 mm long, 0.020.03 mm wide. Laminas not peltate. Flower s borne in leaf axils or sometimes in indeterminate axillary or te rminal inflorescences; inflorescences 2.0-4.0 cm long, associated reduced laminas 2. 0-4.3 mm long, 1.5-3.1 mm wide. Pedicels 2.317.9 mm long, 0.2-0.7 mm wide, 2 per node; bract(s) absent or rarely with 1 or 2 narrowly ovate-triangular bracts present at (0.23-)0.42-0.88 of the distance from the base toward the apex of the pedicel, 0.4-1.1(-2.3) mm long, 0.1-0.2 mm wide,

PAGE 278

256 acute. Flowers 12.3-26.1 mm in diamet er with stipe 0.2-7. 5(10.1) mm long; hypanthium (3.0-)4.0-6 .3(-7.1) mm in diameter; sepal s 4.0-9.0(-10.8) mm long, 2.0-5.5 mm wide, abaxially and adaxially greenish yellow to very light greenish yellow (5GY 7/4, 8/4-8/2); co ronal filaments in 2 series (very rarely 1 series), the outer 2.5-7.5 mm long, linear, sometimes capi tellate, erect (ca. 70) or slightly spreading (ca. 110) or spreading (ca. 180-220), greenish yellow with yellow tips (5Y 8/10) or flushed wit h reddish purple (5RP 5/6-3/ 6) at base and greenish yellow at middle with yellow tips, ratio of outer coronal row to sepal length 0.390.95, the inner (1-)20-50(-53), erect to spreading slightly, greenish yellow or greenish yellow with yellow tips or greeni sh yellow flushed with reddish purple at base and yellow toward tips; operculum 0. 7-2.3 mm long, greenish yellow or greenish yellow with a flush of reddish pur ple at base or reddish purple, margin white; nectary 0.1-0.9 mm high, 0.3-1.3 mm wide; limen recurved, erect or slightly inclined toward the operculum, greenish yellow or greenish yellow with reddish purple tip, limen floor greenish yellow or greenish yellow flushed with reddish purple; androgynophore 2.1-4.4 (-6.1) mm long, 0.3-1.3 mm wide, greenish yellow or greenish yellow with a flush of r eddish purple at base or greenish yellow with reddish purple spot s and streaks; free portions of the staminal filaments 1.6-3.9 mm long, anthers with yellow pollen; styles 1.7-4.7(5.8) mm long including stigmas. Berry 7.9-11.9 mm long. Seeds ca. 8-34. Chromosome number 2n=12, 24 (Beal, 1969; Diers, 1961; Melo & Guerra, 2003). Fig. 8.7-8.8.

PAGE 279

257 Distribution and ecology In the New World tropics: Argentina, Bolivia, Brazil, Colombia, Costa Rica, Ecuador, Guatemala, Mxico, Nicar agua, Paraguay, Per, and Venezuela. Introduced in the Old World tropics: Austra lia, Fiji, French Overseas Territory of New Caledonia, French Polynesia in the Society Islands, India, Indonesia, South Africa, Spain, Sri Lanka, Ta iwan, Uganda, and the United St ates (O'ahu, Hawaii). Growing in shrubs, trees or trailing on the ground in secondary successional areas, along the edges of semideciduous to deciduous, dry to moist tropical forests, both inland and near the seashor e, 0-2800 m. Flowering and fruiting throughout the year. Vernacular names Baleeya'il an its'aamal (Mxico), Chilic ayotillo (Guatemala) , granada (Mxico), granada de zorro (Mxico), mburuciuja (A rgentina), moquillo (Guatemala), nonbo cimarron (Per), norbito (Per), and parchita de culebra (Venezuela). Additional specimens examined Argentina . –CATAMARCA: Sierra de Ancast i (Falda E), entre El Alto & el dique de Coyogasta, 950 m, Hunziker & Cocucci 17284 (F, NY). –CHACO: Fontana, Meyer 13313 (US); Fontana, Meyer 2634 (F); Colonia Bentez, Schulz 533 (B); Colonia Bentez, Schulz 534 (B). –CORRIENTES: Dep. Lavalle, Ruta 27 & Ro Santa Luca, Caceres , Caponio , Schinini & Urbani 309 (F); Dep. Capital, Molina Punta, Schinini 4429 (G); Dep. Capital, Santa Catalina, Harrola 931 (GH); Ituzaing, Rincn Omb Chico, Krapovickas , Cristobal , Schinini &

PAGE 280

258 Gonzalez 25533 (AAU, G, UC); Dep. Mburucuy , 15 km NO de Mburucuy, camino a Descabezado, Krapovickas & Mroginski 22226 (G, MO); Dep. Gral. Paz, 12 Km E de It I bat, costa Ro Paran, Morginski , Schinini & Pueyo 632 (G); Outskirts of Corrientes, Pedersen 1721 (C, US); Dep. Mburucuy, Estancia "Santa Teresa", Pedersen 4516 (C, MO, NY, S, UC, US); Dep. Empedrado, Las Tres Maras, Pedersen 11676 (A, C, MO); Dep. Capital, 10 km S de Corrientes, Riachuelo, Schinini 10742 (G); Dep. Bern de Astrad a, 46 km W de It Ibat, Valencia, Schinini 14037 (US); Dep. Bern de Astrad a; 15 km W de It Ibat, Ayo. Santa Isabel, Schinini 14077 (F); Dep. Capital; 15 km E de Corrientes por Ruta 12, Schinini 14648 (C, F, G, MO); Dep. Ituzaing, Rincn Omb Chico, Schinini , Ferraro , Tressens & Gonzalez 11361 (G, UC); Dep. Santo Tom, E Bertrand (Infran Cue), 23 km SW de Virasoro, Tressens , Ferrucci , Marunak & Pellegrini 4014 (A, F, MO). –ENTRE ROS: Dpto Diamante, Punta Gorda, Troncoso & Bacigalupo 3003 (MO); Dep. Diamante, Punta Gorda, Bacigalupo & Deginani 16 (HUA). –JUJUY: Dept. Santa Brbara, 1320 m, Deginani , Cialdella & Bortiri 900 (MO); Dept. Ledesma, Parque. Na cional Calilegua, Tapuapa, 730 m, Deginani & Taylor 1394 (MO); 10 km WNW of Ledesma, at Arroyo Agua Negra, 700 m, Hjerting , Pedersen & Rahn 38 (C, MO); Capital, 1258 m, Meyer 8321 (A); Dept. Santa Brbara, NE of Li bertador, ca. 20 km S of Palma Sola on the road to El Sauzal, 850 m, Taylor , Mulgura & Deginani 11489 (MO); San Pedro de Jujuy, Schreiter 5208 (US); Dep. El Carmen, Ruta Nac. 9, camino del dique La Cinaga a Abra de S Laura, Zuloaga & Deginani 3492 (MO); Dept. Ledesma, Parque Nacional Calilegua, sendero a La Junta, 720 m, Zuloaga ,

PAGE 281

259 Morrone & Pensiero 6320 (MO). –MISIONES: Posadas, La Granja, Ekman 1511 (S); Dep. Caingus , Monte Carlo, 205 m, Montes 14811 (NY); Dept. Caingus, Ruta Prov. 7, camino de Aristbu lo del Valle a Jardn Amrica, 4 km de del Valle, 270 m, Morrone , Deginani & Cialdella 629 (MO). –SALTA: Dep. Capital, 20 Km E de Salta, Ruta Salta a Gral. Gemes, Krapovickas & Schinini 30408 (C, F, G, US); Dep. La Via, Coronel Moldes, 1100 m, Meyer 3721 (UC); La Via, Coronel Moldes, 1100 m, Meyer 35664 (GH, NO, NY, UC); Dept. Capital, Cerro San Bernardo, prximo a la cima, 1400 m, Novara 1625 (G); Montealto, Osau, Rodriguez 1123 (NY); Embarcacin (Ro Berwejo), 250 m, Schreiter 5407 (US); Dept. La Candelana, Ro Unquillo, 1400 m, Schreiter 9450 (US); Ledesma, Spegarrini 15544A (B); Dept. Tiraucas, Ro Tipayo, 1250 m, Venturi 4404 (MA, NY, U, US). –TUCUMN: W de Tucumn, Dep. Capital, Lillo 2400 (US); Trancas, San Pedro de Colalao, Meyer 9843 (F); Gob. Formosa, Dep. Pilocomayo, Ruta 11, Km 6, Morel 1316 (CAS); Dept. Tafi, 500 m, Peirauo 9526 (US); Dep. Tafi, Quebrada de Luler, 500 m, Peviano 13268 (NY); Cadillal, 600 m, Schreiter 1220 (US); Dept. Alberdi/Cocha, along Ruta 9 from Juan B. Alberdi to Balcosna, 7 km below of dique Escaba, 670 m, Till 10248 (MO); Dept. Capital, Villa Lujan, 450 m, Venturi 357 (US); Dept. Burruyac, La Ramada, 500 m, Venturi 1607 (US); Burroyac, Cerro del Campo, 800 m, Venturi 7916 (CAS, F, GH, US). Australia . –NORTHERN TERRITORY: Nightcliff, Darwin, Arnhem Land Aboriginal Reserve, Specht 160 (US). Bolivia . –CHUQUISACA: Prov. Tomina, Monteagudo 64 km hacia Sucre, 1400 m, Beck 6350 (MO). – COCHABAMBA: Tunari, 1600 m, Kuntze s . n ., 14 May 1892 (NY); Prov.

PAGE 282

260 Campero, a 26 km de Aiquile rumbo a Pea Colorada, 2240 m, Saravia 522 (MO). –LA PAZ: Viciniis Lorat a, San Pedro, Larecaja, 2550 m, Mandon 612 (BM, G, GH, NY, S). –SANTA CRUZ: Prov. Cordillera, Camiri, 900 m, Cardenas 4707 (US); Ro Grande, Velasco, 200 m, Kuntze s . n ., July 1892 (F); Ro Grande, Velasco, Kuntze s . n . (NY); Prov. Andrs Ibez, Jard n Botnico de Santa Cruz, 12 km E of center of Santa Cruz on road to Cotoca, 375 m, Nee 40425 (NY); Prov. Caballero, 8.6 km SE de Comarapa por el camino a Santa Cruz., 1750 m, Solomon & Nee 17942 (MO); Lara (montecitos de la pampa), Steinbach 2521 (US). TARIJA: Cercado, 450 m, Steinbach 2706 (US); Prov. Cercado, Baado del Paray, 450 m, Steinbach 13066 (F). Brazil . –CEAR: Allemao & Cysneiros 726 (R); Maranguape, Serra de Maranguape, Trinta , Trinta , Santos & Sacco 1280 (R). –DISTRITO FEDE RAL: Santa Teresa, unknown collector s . n ., 1888 (R). –GOIS: Goyaz, S le plateau central de la province, Glaziou 21461 (G). – MATO GROSSO DO SUL: Assent amento Tamarineiro, Mpio. Corumb, Pott 1812 (NY). –MINAS GERAIS: Serra do Ci p (110 km NE of Bello Horizonte), Vaccaria, 800 m, Chase 9262 (US); Lagoa Santa, Engle 1176 (C); Lagoa Santa, Engle 1177 (C); Lema de Caldas, Henschen & Regnelli III640 (MO, S); Caeti, Minas, Hoehne 6376 (R); Pocos de Caldas ad Capu'ary, Mosen 1855 (S); Caeti, Minas, Randon 6369 (R); Caeti, Minas, Randon 6372 (R); Minas Gerae, Sect 138A (R); Lagoa Santa, Warming s . n ., 20 December (C). –PARAN: Ltare, in silvula, Dusen 9960 (S); Jaguariahyva, 740 m, Dusen 14972 (GH, MO); Jaguariahyva, 740 m, Dusen 18020 (MO, S); Parque Nac. Cataratas (Mpio. Foz do Iguau), Hatschbach 23163 (S); Morro Cajuru (M pio. Jaguariaiva), 1000 m,

PAGE 283

261 Hatschbach 52826 (C); Agua Branch (Mpio. Adrianpolis), 250 m, Hatschbach & Silva 51299 (C, MO, US); Cerradinho, Mpio. Tomazina, Hatschbach & Silva 52483 (US). –PERNAMBUCO: Tapera, Pickel 465 (R). –RIO DE JANEIRO: Climita Boa Vista, Rio de Janeiro, Brade & Freire 24384 (R); Proc. Praia Vermelha, Colhida 13 (R); Rio Janeiro, Commerson s . n . (G); Serra do Tingu, Glaziou 5875 (C, R); Pedregulho, Glaziou 5875a (R); Rio de Janeiro, Pedregulho, dans le bois, Glaziou 21461 (C); Rio de Janeiro, Glaziou s . n . (S); Rio de Janeiro, Lunchnall s . n . (OXF); Rio de Janeiro, Bragana, Miers 75 (BM); Parque de Museu Nacional, Rosa 43879 (R); ruinta da Boa Vista, Sawp 3907 (R); Serra dos Tapes, Schwache 2859 (R); Rio Comprido, unknown collectior 50 (AAU, BM, MO). –RIO GR ANDE DO SUL: Estrada Oscar Marcelino Cardoso prximo a Faz. Renato J ohan, Banhado Grande, Viamo, Abruzzi 814 (F); vicinity of San Antonio, Beetle 1394 (US); Viamo, Morro da Grota, acesso pelo Leprosa Rio, Bueno 2584 (F); H. Botanicao I.A.S. Pelotas, da Costa 701 (F, NY); Prto Velho (Portovelo), 800 m, Espinosa 2471 (US); Prto Alegre, Gerwak 361 (S); San Leopoldo, Henz 33 , 435 (MO); Prto Alegre, Lindman 247 (R); Prto Alegre, in dumetis, Lindman A247 (S); Prto Alegre, Morro da Polcia, Malme 614 (S); Rio Grande do Sul, Hamburgberg, Malme s . n ., 20 October 1892 (S); Prto Alegre, Moinhos de V ente, Chcara Mostardeire, Pabst 5728 (B); Vila Manresa, P. Alegre, Rambo 29405 (B, S); Serra dos Tapes, Schwacke II-361 (R); S. Salvador, Montenegro, 600 m, Sehnem 3468 (B, CAS); Montenegro, Pareci Novo., 50 m, Strieder 33057 (B, S). –SANTA CATARINA: Morro dos Conventos, Ararangu, 50 m, Reitz & Klein 9 , 639 (B, F, G, M, NY, UC, US);

PAGE 284

262 Florianpolis, Bom Abrigo, Sacco 2086 (M); Florianpolis, Bom Abrigo, Santos 1824 (M); Mpio. Florianpolis, Canavieras, Ilha de Santa Catarina, 1-5 m, Smith & Reitz 12264 (NY, R, US). –SO PAUL O: Botucatu, Rubio Jnior, Branzer 702412 (U); Botucatu , Rubio Jnior, Branzer 703501 (U); Ilha da Queimada Grande, Emygdio & Reute 2012 (R); So Paulo, Haun 343&436 (C); Cidade Jardim, Kuhlmann & Hoehne s . n ., 11 April 1935 (F); Perus, Santos & Trinta 2602 (R); Campinas, Viegas & Viegas 2891 (US). Colombia . –ANTIOQUIA: Bello, 1500-1800 m, Archer 152 (US); Medelln, 1500 m, Archer 370 (U, US); Medelln, 1500 m, Archer 759 (F, GH, S, US); Medelln, 1500 m, Archer 1009 (US); Beln, Archer 1041 (US); Mpio. Medelln, corrimiento Bel n, sector Aguas Fras, km 2.1, en predios de Alfarera Buenavista, 1500 m, Callejas & Escobar 3270 (NY); La Amrica, near Medelln, Daniel 1466 (US); Medelln, Daniel 3966 (US); Mpio. Andes, 6 km de Andes hacia Vereda Momb lan, apiario Ledesma Restrepo, 1480 m, Fonnegra , Roldan , Betancur & Ortiz 2387 (HUA); Mpio. Andes, 6 km de Andes hacia Vereda Momblan, apiario Ledesma Restrepo, 1480 m, Fonnegra , Roldan , Betancur & Ortiz 2405 (HUA, MO, NY); Mpio. M edelln, barrio Calazanz, cerca a subestacin de energa, 1550 m, Javier & Marulanda 106 (HUA, MO); Santa Brbara, Cauc a Valley, 1800-2000 m, Pennell 10919 (GH, US); Mpio. Medelln, barrio Calazanz, cerca a subestacin de energa, 1550 m, Roldan & Marulanda 107 (CAS, HUA, MO); Mpio. de Libor ina, km 4 of road LiborinaSabanalarga (32 km before Sabanalarga), 920 m, Zarucchi , McPherson , Roldan & Escobar 7248 (HUA, MO); Lima, Chancay, unknown collector s . n . (G). – CALDAS: Al lado de la carretera entre La Felisa & Manizales, 1400 m, Escobar

PAGE 285

263 & Brand 2059b (MA); Entre Filadelfia & Manizales, 1450 m, Escobar & Brand 2059 (HUA, MA, MO); Vereda La Argelea, 0.5 km arriba quebrada del billar, entre Manizales & San Pelegrino, 1690 m, Escobar & Uribe 416 (TEX); Pereira, 1400-1700 m, Killip 10165 (GH, NY, PH, US); San Francisco, along Ro Campoalegre, Cordillera Central, 1300-1400 m, Pennell 10182 (GH, NY, PH, US); Anserma, W of Anserma, 1500-1700 m, Pennell 10641 (US). –CAUCA: Mercaderes, 1100 m, Haught 5151 (US); Mondomo, Cauca, carretera a Popayn., 1400 m, Hoyos & Santa 213 (HUA); Cordillera Central, Vertiente Oriental, Mpio. de Inz, Parque Arqueol gico de San Andrs, 1700-2000 m, Idrobo & Weber 1368 (US). –CUNDINAMARCA: Mpio. Apulo (Rafael Reyes), Vereda El Portillo, 9 km de Viot, 455 m, Escobar , Folsom & Rincn 3002 (HUA); Mpio. Nario, Valle del Apauta & zonas aledanas, 350-450 m, Fernndez Alonso & Jaramillo 6970 (MA); Cundinamarca, 2800 m, Lehmann 2512 (G, US). – MAGDALENA: Sierra Nevada de Santa Marta, SE slopes, hoya del Ro Donachui, below the village Donachui near the river, 1350-1230 m, Cuatrecasas & Romero 24402 (US); La Magdalena, Neeiter s . n . (MA); Magdalena, Neeiter s . n . (MA); Magdalena, Neeiter s . n . (MA); Magdalena, Neeiter s . n . (MA). – NORTE DE SANTANDER: between Ch incota and La Esmeralda, 1000-1300 m, Killip & Smith 20887 (GH, US); Cordillera Ori ental, regin del Sarare, la Cabuya, 1300 m, Cuatrecasas , Schultes , Smith 12081B (US); Ad montem Corcovado, Prov. Sabastianos, unknown collector 44 (NY). –QUINDO: Mpio. Pijao, carretera a Caicedonia, 2 km ant es de Barragn, Fca. Las Acacas, 1140 m, Arbelaez , Velez , Carvajal & Uribe 970 (HUA). –SANTANDER: Entre

PAGE 286

264 Bucaramanga & Pie de Cuesta, 800 m, Escobar , Folsom & Rincn 3115a (HUA); N slope of Mesa de los Santos, 1000-1500 m, Killip & Smith 15029 (GH, NY, US); between Surat and California, 1740-2000 m, Killip & Smith 16834 (GH, NY, US); vicinity of La Baja, 2200 m, Killip & Smith 18398 (GH, US); Peralonso en los alrededores de Santiago, 120 m, Molina & Barkley 18 N . S . 101 (UC); Mpio. Piedecuesta, subiendo al paraje Los Curos, 1110 m, Santa & Buitrago 898 (HUA); Mpio. Bucaramanga, carretera a La Matanza, Vereda Coral de Piedra, 1030 m, Santa & Escobar 1089 (MO); Mpio. de Bucara manga, carretera a La Matanza, vereda Coral de Piedra, 1030 m, Santa & Escobar 1091 (HUA). TOLIMA: Doima, 700 m, Haught 2436 (US). –VALLE DE CAUCA: Cordillera Occidental, Vertiente Occidental, hoya del Ro San Quinini, 1200 m, Cuatrecasas 15341 (F, US); Cordillera Occidental, vert iente occidental, Hoya del Ro San Quinini, 1200 m, Cuatrecasas 15371 (F); Cerros cerca de Alcal, 1300 m, Cuatrecasas 22864 (F, U, US); carretera vieja ent re Cali & Buenaventura, km 30 entre Ayerbe Borrero & Queremal, 1350 m, Escobar , Folsom , Brand & Rincn 2513 (HUA, MA, NY); carretera vieja de Cali a Buenaventura, cerca a Queremal, Dagua, Valle, 1680 m, Hoyos & Santa 226 (F, HUA, MA); Bitaco Road 1 km N of junction with main road to Dagua (and Buenaventura), 5000 ft., Hutchison & Idrobo 3075 (UC, US); Restrepo, 1600 m, Killip 11262 (US); Pavas, Cordillera Occidental, 1500-1600 m, Killip 11673 (GH, NY, PH, US); Ro Digua valley, La Margarita, 760 m, Killip 34897 (US); Cali, 1000 m, Lehmann 3387 (BM, G); Anserma, Lehmann 3852 (G); Vereda Pabitas, Finca Aguaclara, Monsalve 3209 (MO); Vereda de Ro Grande, Restrepo, 1000 m, Ramos 419 (MO); Mpio.

PAGE 287

265 Restrepo, Vereda del Ro Grande, entre Pavas & Restrepo, 1000 m, Ramos 621 (MO); Mpio, Restrepo, Vereda de Riogrande, en el lmite entre los Mpio.s de La Cumber & Restrepo, 1000 m, Ramos , Reyna & Reyna 3596 (MO). Costa Rica . –CARTAGO: Floreieron, Jard n Botnico Lankester, Blanco 2260 (USJ); Haies a Ochomogo, Conduz 10903 (US); Cartago, near the Mi rador Ujarrs about 4.5 SE of Paraso, 1200 m, MacDougal 906 (DUKE); vicinity of Cartago, 1425 m, Standley 33363 (US); vicinity of Finca Las Cncavas, Prov. de Cartago, 12001300 m, Standley 41490 (US). SAN JOS: San Francisco de Guadalupe, 1500 m, Pittier 7151 (BR). Ecuador . –CHIMBORAZO: caon of the Ro Chanchn near Huigra, 4000-4500ft., Camp 2945 (F, NY, US); vicinity of Huigra, mostly on the Hacienda de Licay, 4000 ft., Rose & Rose 22294 (NY, US); vicinity of Huigra, mostly on the Hacienda de Licay, Rose & Rose 23854 (US). –ESMERALDAS: Atacames, near Esmeraldas, Barclay 764 (BM). –GALPAGOS : Gardner Is., near Hood Is., Howell 8747 (CAS, US); Santa Cruz, Academy Bay, 10 m, Schimpff 52 (AAU, BM, G, M, M O, NY, S, U); Albemarle Island, Tagus Cove, 400-2000 ft., Stewart 2074 (CAS, GH); Hood Island, 450 ft., Stewart 2076 (CAS); Indefatigable Island, SE side, 600 ft., Stewart 2077 (CAS, GH); James Bay, James Island, Stewart 2078 (CAS); Albemarle Island, Villamil, sea level, Stewart 2080 (CAS, GH); Duncan Is., Stewart 2082 (CAS, US); Santa Cruz, near the Caseta, 800ft., van der Werff 1420 (CAS, NY, U); Santa Cruz, in transition zone along "Old Trail" from Academy Ba y toward Bella Vista, 60 m, Wiggins 18513 (MO). –GUAYAS: on the property of Richard Zeller near the village of Loma Alta, located about 10 km NE of the coasta l village of Valdivia, N of Santa Elena

PAGE 288

266 peninsula, Ro Valdivia drainage, 100 m, Anderson 2480 (MO); Guayaquil, Asplund 7686 (S, US); Guayaquil, Cerro Santa Ana, Asplund 15217 (AAU, B, NY, R, S); vicinity of Naranjito, 120 ft., Camp E-3559 (NY); Cerro El Burro, 650 m, Cornejo & Bonitaz 884 (MO); Capeira, km 21, Guayaquil to Daule, 20-200 m, Dodson & Gentry 12562 (MO); road Guayaquil Nobol, km 24, Harling & Andersson 21071 (AAU); San Ignacio, Holmgren 55 (BM, G, S, US); near Julio Moreno, Jativa & Epling 969 (S); prope Guayaquil, Mille 42a (US); 2-4 km W of Bucay, 170 m, Gentry 12307 (MO, S); Guayaquil, Mille 42b (S); prope Guayaquil, Mille 157 (NY); Guayaquil Canton, Guayaquil, carretera a Salinas, km 15, 400 m, Rubio & Tipaz 2334 (MO); Barraganetal, Stevens 322 (US); Barraganetal, Stevens 324 (US); Cerro Azul, Velez 2055 (MO); Balao, unknown collector 14427 (M, US). –LA CHORRERA: on Cerro Tiandeagote, 800 m, Jativa & Epling 13 (UC). –LOJA: Bosque Petrif icado Puyango, quebrada Cochurco, 350 m, Cornejo , Cornejo & Bonitaz 4034 (MO); Entre Catacocha & La Jaigua, 18001930 m, Costa Solis 8009 (F). –LOS ROS: Hacienda Clementina, 30 m, Harling 236 (NY, S); Hacienda Clementina between Babahoyo and Montalvo, 20 m, Sparre 17922 (S). –MANABI: ad El Recreo, 0-200 m, Eggers 15583 (PR); P.N. Machalilla, Agua Blanca, hasta cerro Las Goteras, 380 m, Josse 688 (AAU). Fiji . –MAKONDRONGA: Ma kondronga Island, 60 m, Degener & Orndonez 13801 (NY). –NGAU: Shore of Herald Ba y, in vicinity of Sawaieke, 0-30 m, Smith 7923 (NY, UC, US). –OVALA U: near Levuka, 10-30 m, Degener & Orndonez 13788 (NY); E of Lovoni Valley, 100-300 m, Smith 7288 (NY, UC, US); slopes of Mt. Koronimoko, in vici nity of Thawathi, 250-350 m, Smith 8087 (NY,

PAGE 289

267 UC, US). French Overseas Territory . –NEW CALEDONIA: Au pied de l'Ouen Toro pres Nouma, Baumann 6059 (UC); Baie des Pec heurs, Nouma, 10 m, Baumann-Bodenheim 5184 (MO, NY); 134 km N of Nouma; road from Sarrama to Koh, 180 m, Fallen 185 (MO); New Caledonia, MacDougal 438 ; Ouen Toro, at S end of Nouma, 50 m, McPherson 4593 (MO); Nouma, unknown collector 1364 (BM). French Polynesia . –SOCIETY ISLANDS: Tahiti, Pirae, Rt. du Belved ere, km 1.8, 125 m, Florence 2275 (US); Tahiti, Papeete, Crete est de la Tipaerui, sentier du Mt. Marau, 1200 m, Florence 9735 (US); Tahiti, at and above Orston Geophysica l Laboratory, Pa matai, 325-400 m, Fosberg 61056 (US); Tahiti, ridge E of Vallee de Tuauru above Mahina, Fosberg 61320 (MO, US); Tahiti, road to Pic Rouge, above Papeete, 80 m, Fosberg 62924 (US); Tributary on N si de of upper Tuauru Valley, Fosberg 63809 (MO); Tahiti, along road to the Belvedere Restaurant, 100 m, Whistler W4789 (US). Guatemala . –BAJA VERAPAZ: Mpio. San Jernimo. km 137 carretera La Cumbre-Salam, 1030 m, Tenorio , Martnez , Droege & Daz 14839 (MEXU). – CHIMALTENANGO: Chimaltenango to S an Martn Jilotepeque, 1500-1900 m, Standley 57852 (F, US); Chimaltenango to San Martn Jilotepeque, 1500-1900 m, Standley 57884 (F, US); between Chimaltenango and San Martn Jilotepeque, 1500-1700 m, Standley 80887 (F); between Chimaltenango and San Martn Jilotepeque, 1500-1700 m, Standley 80928 (F); between Chiquimula and La Laguna, 500-1000 m, Steyermark 30703 (F). –ESCUINTLA: Aguilar 1773 (F). – GUATEMALA: Aguilar 211 (F); Aguilar 390 (F); 20 km NW of Guatemala City, 5000 ft., Andrews 541 (NY); Guatemala, 3900 ft., Deam 6193 (US); carretera

PAGE 290

268 FDR, km 20 N.O. de ciudad Guatemala, 1500 m, Molina 15243 (F, NY); along F.D.R. Hwy., 21 km NW of Guatemala City, 1800 m, Molina , Burger & Wallenta 15989 (F, NY); vicinity of San Andrecillo, 1700 m, Molina & Molina 27552 (F, U); Barranco de las Vacas, near Guatemala, 1380 m, Standley 59534 (F); near Fiscal, 1100 m, Standley 80378 (F). –HUEHEUTEN ANGO: Ro Selegua, MacDougal 583 (MO); vicinity of San Sebastin, 1600 m, Molina & Molina 26507 (F, U); along Ro Selegua, opposite San Sebastin H., 2000-2100 m, Steyermark 50460 (F); Cerro Pixpix, above S an Ildefonso Ixtahuacn, 1600-2800 m, Steyermark 50611 (F, US); between San Ildefons o Ixtahuacn and Cuilco, 13501600 m, Steyermark 50693 (F); above Democracia on trail towards Jutal, 1000 m, Steyermark 51040 (F, G). –JALAPA: Laguna de Ayarza, 8000 ft., Heyde & Lux 3777 (GH, M, MO, NY, US); NE of Jalapa, 1400-1600 m, Standley 76851 (F); along road between Jalapa and San Pedro Pinula, 1400-1800 m, Standley 77083 (F); Volcn Jumay, N of Jalapa, 1300-2200 m, Steyermark 32401 (F). – PETN: Santa Elena, Walker 1344 (MO). –SACATEP QUEZ: slopes of Volcn de Agua, N of Santa Mara de Jess, 1800-2100 m, Standley 59341 (F); Finca El Hato, NE of Antigua, 1950-2040 m, Standley 61188 (F, NY, US); near Antigua, 1500-1600 m, Standley 61719 (F); above Dueas, 1590-1800 m, Standley 63200 (F); near Antigua, 1500-1600 m, Standley 63859 (F). –SOLOL: mountain slopes above Lake Atitln, about 3-5 km W of P anajachel, 2100 m, Williams , Molina & Williams 25309 (F). India . –UTTAR PRADESH: Mothranwala, Dehra Dn, Parker s . n ., 27 November 1927 (UC). Indonesia . – JAVA: Cibodas, Nitta 15054 (MO). Mxico . –CHIAPAS: along the Tana Te'

PAGE 291

269 River near Sahal K'esh, paraje of Mahben Chauk, Mpio. of Tenejapa, 2900 ft., Breedlove 7706 (F); Steep canyon between Soyal and La Bomban on road to Chicoasn, 10 km W-NW of Soyal, Mpio. Osumacinta, 1067 m, Breedlove 51972 (CAS); along road from Atzalan to El Palmar, Mpio. Ixtapa, 915 m, Breedlove 52183 (CAS); near the Zinacantn Paraje of Muctajoc, Mpio. Ixtapa, 1065 m, Breedlove & Davidse 54010 (CAS); 56 km S of Mexican Hwy. 190 near junction to Jeric on road to Nueva C oncordia, Mpio. Villa Corzo, 700 m, Breedlove & Davidse 54392 (CAS); along Mexican Hwy. 190, 3 mi. S of La Trinitaria. Mpio. of La Trinitaria, 5100 m, Breedlove & Raven 13212 (F); Barranca La Venta at Cascada El Aguacero, 16 km W of Oxozocuautla on Hwy. 190 and at the end of the road to the river, 650 m, Mayfield, Hemple & Jack 977 (MEXU); Chiapas, MacDougal 568 (MO); Mpio. Tzimol. 5 km SW de Tzimol., 1150 m, Reyes Garcia & Urquijo 769 (MEXU); Mpio. Tzimol., 5 km SW de Tzimol, 1150 m, Reyes Garcia & Urquijo 812 (MEXU); 1 km SE del entronque TzimolUninajab, camino a Uninajab, 1110 m, Reyes & Urqujio 846 (MEXU). – CHIHUAHUA: Guasaremos, Ro Mayo, Gentry 2910 (F, GH, MO); Maguarichic, Knobloch 6035 (US). –DURANGO: Sierra Madre, Rose 3504 (US). – GUANAJUATO: 5 km W de Iramuco, sobr e el camino a Santa Ana Maya, 1950 m, Rzedowski 44847 (CHAPA, XAL); La Mina, 9 km al S de Xich, Mpio. de Xich, 1100 m, Ventura & Lopez 7514 (XAL). –GUERRERO: Tasco, Taxco, Abbott 335 (GH); Lyonnel 303 (US); Acapulco and vicinity, Palmer 409b (US); Close to mirador over Taxco on Mxico 95, 1790 m, Porter-Utley & Mondragn 343 (CICY); 7 km SE de Taxco, Mpio. Taxco, 1550 m, Soto & Martnez 3219

PAGE 292

270 (TEX). –HIDALGO: Zimapn, Coulter 58 (GH); Trancas, 13 km NE de Zimapn, Mpio. de Zimapn, 2000 m, Hernndez 3695 (MEXU, MO); Bordes de las barrancas de Tolantongo, Mpio. Cardonal, 1800 m, Hernndez 3769 (MO); Borde de las Barrancas de Tolantongo, l ado occidental, Mpio. de Cardonal, 2000 m, Hernndez & Rodriguez 4975 (MO, XAL); Jacala, Kenoyer 449 (F); Jacala, Kenoyer s . n ., 20 October 1937 (MO); Ixmiqu ilpan, Sierra de la Mesa, Purpus s . n ., July 1905 (UC); Ixmiquilpan, Purpus s . n ., 1905 (UC); Ixmiquilpan, Sierra de la Mesa, Purpus s . n ., 1905 (UC). –JALISCO: Guadal ajara, Las Trancas, camino a Mascuala, Mpio. Ixtl ahuacn del Ro, 1600 m, Guerrero & Chazaro 283 (MO, TEX); Mpio. Villa Guerrero, a medio km S de La Cumbre de Bolaos, 18 km NE de Chimaltitn, camino a Villa Guerrero, Lott , Rico & Tellez 2118 (DUKE); near Guadalajara, MacDougal 478 ; Barrancas, W of La Quemada, 1400 m, Pennell 19896 (PH, US); Mrgenes de Ro Caliente por la brecha al balneario La Primavera, Mpio. Zapopan, 1500 m, Reyna 437 (WIS); Barranca Ibarra, Guadalajara, 1400 m, Reko 4574 (US); Mesa Colorada, Mpio. Zapopan, 1590 m, Rodriguez & Suarez 1451 (IBUG); Mesa Colorada, Mpio. Zapopan, 1590 m, Rodriguez & Suarez 1456 (IBUG); Bolaos, Rose 2946 (GH, US); near Tequila, Rose & Hough 4748 (US); near Guadalajara, Rose & Painter 7395 (US). – MXICO: Nanchititla, Temascaltepec, Hinton 4519 (BM, GH, US); Nanchititla, Temascaltepec, Hinton 4700 (G, US); Villaneda, Temascaltepec, Hinton 6533 (CAS, US); Pantoja, Temascaltepec, Hinton 8607 (GH, NY, US); Tejupilco, Temascaltepec, Hinton 8216 (NY); Cerro de los Capulines, Palmar Chico, 1100 m, Matuda 31332 (US); Entre Valle de Bravo & Donato Guerra, 1800-2500 m,

PAGE 293

271 Matuda & sus colaboradores 31600 (CAS). –MICHOACN: Zitacuaro-Salto de Enandio, 1600 m, Hinton 13492 (GH, LL, NA, NY, PH, TEX, US). –MORELOS: Xochitepec, Lyonnel 1425 (US). –NAYARIT: W slope of Volcn San Juan at km 6 on road from Tepic to Jalcocotan, Mpio. Tepic, 900 m, Breedlove & Almeda 45168 (CAS). –OAXACA: Cerro San Antonio, Cuijano, Dist. del Centro, 1700 m, Conzatti 2183 (GH); Jaunatry, 5000-6000 ft., Galeotti 3667 (BR); 5 km al e de Tamazulapan, camino a Chilapa, Dist. de Teposcolula, 1800 m, Garcia & Rottes 1464 (MO, XAL); Dist. de Teposcolula, ca. 8 km SW de Tamazulapan, camino a Chilapa, 2330 m, Lorence , Lorence & Garcia 3722 (MO); Coixtlahuaca, Concepcin Buenavista, base del Cerro Pl uma, base del caon del puente Santa Luca, sobre el Km 99-100 de la carrete ra Tehuacn-Oaxaca (cuota), 1350 m, Panero & Calzada 4024 (TEX); Mesa del Calvario, Cerro de el Ramn, NE de el Rodeo, Mpio. Tepelmeme, Dis t. de Coixtlahuaca, 2100 m, Tenorio , Romero & Martnez 9262 (US); La Loma Pachona, 6 km NE de Guadaloupe Cuatepec (1 km E del entronque Carret, Huajuapan de Len-Tehuacn & la brecha a Guadaloupe Cuatepec), 2060 m, Salinas & Campos F-3670 (MEXU, XAL); NNE de Chazumba, 2 km W de Trujapan, Salinas , Davila , Medina , Tenorio & Ramrez 5443 (F); Arroyo below Cueva Blanca, Schoenwetter JSOX-9 (US); 6 km NW de Pinotepa Nacional, 330 m, Sousa , Tellez & Magallanes 5489 (MEXU); along road to microwave tower about 3.6 mi. S of Matatln on Hwy. 190, about 1 mi. S of Km 595, Stevens 1216 (DS, DUKE, GH, MO, NY, TEX); Mpio. Concepcin Buenavista, Cerro Cedro, W de El Enebro, 2260 m, Tenorio & Romero 9383 (MEXU, US); 64.4 mi. NW of Teh uantepec on Mxico 190, 4600 ft., Weaver 2165

PAGE 294

272 (DUKE, MO). –PUEBL A: La Villita, 1780 m, Boege 804 (DUKE); Puerto Las Palmas 15 km S of Izcar de Matamoros, 1525 m, Breedlove & Almeda 65224 (CAS); 2 Km SW de San Antonio Texcala, por la carretera a Huajupam de Len, Chiang , Villasenor & Duran 2106 (TEX); Cerros calizos NE de Tehuacn, vecinso al campo de tiro del ejercito, Chiang , Villasenor & Duran 2037b (TEX); Tehuacn, 5500 ft., Galeotti 3663 (BR, G); Jardn Botnico Helia Bravoh, road between Tehuacn and Zapotitln Salinas., 1450 m, Porter-Utley 344 (CICY); Tehuacn, Purpus 1272 (G, MO, UC); vicinity of S an Luis Tultitlanapa, Puebla, near Oaxaca, Purpus 3543 (BM, F, GH, MO, NY, UC, US); vicinity of San Luis Tultitlanapa, Puebla, near Oaxaca, Purpus 3544 (BM, F, GH, MO, NY, UC, US); vicinity of San Luis Tultitlanapa, near Oaxaca, Purpus 3545 (MO, UC); vicinity of San Luis Tultitlanapa, Puebla, near Oaxaca, Purpus 3547 (UC); Tlacuiloltepec, 7000-8000 ft., Purpus 4072 (UC); Tlacuiloltepec, 7000-8000 ft., Purpus 4073 (UC); San Luis, Purpus s . n ., July 1907 (UC); near Tehuacn, Rose & Hay 5838 (US); near Tehuacn, Rose , Painter & Rose 9957 (US); 1.5 km S de Zapotitln de las Salinas (a lo largo de un pequeo arroyo), Salinas , Campos , Bonilla & Rojas F-3735 (WIS); Barranca del Agua Fra, 1. 5 km W de San Luis Atolotitln, Mpio. Caltepec, 2100-2800 m, Tenorio & Romero 4018 (TEX); Barranca de La Compaa. Mpio. Caltepec, 1900 m, Tenorio & Romero 6640 (TEX); Tlacuilosto S de Atzingo, Mpio. Atzingo, 1900 m, Tenorio & Romero 9444 (TEX); Cerro E de Tecamachalco, Mpio. Tecamachalco, 2300 m, Tenorio & Romero 14178 (CAS, TEX); San Francisco Xochiltepec, 2350 m, Valiente , Casas , Viveros , Montana & Montana 953 (XAL); Totutla, unknown collector 64 (C). –QUERTARO: Jalpan,

PAGE 295

273 800 m, Arguelles 909 (CAS); 4-5 km SE de Ayutla, Mpio. Arroyo Seco, 720-760 m, Carranza 2819 (IEB); 3 km W de Macon, Mpio. Cadereyta, sobre el camino a Vizarrn, 2000 m, Rzedowski 47664 (IEB); Ro Santa Mara, Campamento de la SARH, abajo de Tanchanaquito, Mpio. de Jalpan, 240 m, Servin 1412 (IEB). – SAN LUIS POTOS: Sagr ada Familia, Mpio. Tanquian, Alcorn 3316 (TEX); Mpio. Moctezuma, La Calera, 2.5 km W del Es tanco, entrando por el km 40 de la carretera del Altiplano, 1980 m, Bustos s . n ., 20 October 1976 (CHAPA); Temazunchale, Edwards 924 (F); 6.5 (rd) mi. S of Arista, in Chihuahuan Desert, on limestone hills, 5000 ft., Henrickson 6428 (TEX); Ca. 6 mi. SE of Hwy. 57-80 along road towards Cerritos just above Chihuahuan Desert, 5000 ft., Henrickson 6488 (TEX); near Cardenas, Pringle 3520 (GH); Minas de San Rafael, Purpus 5048 (UC); Minas de San Rafael, Purpus 5049 (UC); ~8 km NW de Guadalczar, 2000 m, Rzedowski 6673 (XAL); Mpio. Villa de Zaragoz a, 8 km E de Las Rusias carretera a Ro Verde, 1570 m, Tenorio & Romero 2225 (MEXU). –SINALOA: 1 mi. E of Santa Luca along Hwy. 40., Keil & Canne 8837 (TEX); 60 m W de la casa Ramn Cabrera, ejido Cuitavac a, a 35 km de Agua Caliente de Zevada, Mpio. Sinaloa de Leyva, Perez 71 (CAS, UC). –SONORA: 4.3 km SW of Santa Ana de Yecora on road to Nuri, 745 m, Goldberg & McLaughlin 77-181 (TEX); just S of Arroyo Palo Pinto (Barranca Los Arcos) bridge on Mx. 16 (E by air of La Quema), 580 m, Reina & VanDevender 98-1409 (MO); Mpio. Onavas, arroyo de la Uvalamita, Rancho La Mula, 25.5 km SE of Ro Yaqui on Mx. 16, 685 m, Reina , Van Devender , Castillo , Krebbs , Russell & Russell 2000-494 (MO); Ca. 1.5 km NW (by air) of Curea, Arro yo Tepoca (=Arroyo la Quema), 460 m, Reina ,

PAGE 296

274 VanDevender , Trauba 98-1226 (MO); Arroyo Santa Ana (Tepoca C. Obregn hwy.), 2.3 km SW of the turnoff to La Quema, 8.5 km (b y air) W of Guadalupe Tayopa, 510 m, Van Devender , Reina , Len de La Luz & Perez 97-1043 (MO); Santa Ana de Yecora, 850 m, Van Devender , Reina , Trauba 98-1420 (FLAS, MO); Rancho Las Uvalamas, E slopes of Si erra de Alamos, 7.5 km (by air) S-SE of Alamos, 340 m, Van Devender , Van Devender , Gilbertson & Piper 95-23A (MO); Arroyo El Mentidero at the crossing of El Chinal Road, 11.5 km (by air) S of Alamos, 240 m, Van Devender , Van Devender , Johnson & Bernzott 93-66 (MO); near Tojibambo, 19.5 km N-NW of San Bernardo on road to Mesa Colorada, 740 m, Van Devender , Van Devender , Yetman & Lopez Estudillo 931500A (MO). –TAMAULIPAS: 7 mi. S of Antiguo Morelos, 800 ft., Graham & Johnston 4568 (TEX); 30 km W de Tula, Mpio., Tula, 1690 m, Hernndez 621 (MO). –VERACRUZ: Mpio. Emiliano Zapat a, entre El Palmar & El Roble, Castillo & Tapis 764 (F); 4 km antes de Tacotalpan, camino a Jalcomulco, Mpio., Jalcumulco, Castillo & Zamora 7860 (XAL); Cacalilao-Mandez, Chiang 158 (MEXU); Entre El Chico & Chavarrillo, Mpio. Emiliano Zapata, 1000 m, Chazaro & Oliva 2319 (XAL); Mpio. Alto Lucero, al rededores de la Planta Laguna Verde, 10 m, Dorantes 5281 (F, TEX); El Mirador, Mpio. Totutla, Espiritu , Martnez 18 (XAL); Jaunatry, Bois de Mirador, 3000 ft., Galeotti 3657 (BR); Bois de Mirador, 2000 ft., Galeotti 3659 (BR); Zacuapan, 3000 ft., Galeotti 3661 (BR, G); Mirador, 300-3800 ft., Hohenacker s . n . (G); Mirador, Linden 751 (BR, G); Jalapa, Laguna de Ayarza, 8000 ft., Lux 3777 (GH); Morro de la Mancha (hondonada de dunas ), Moreno , Castillo , Rodriguez , Pisanty , Garcia & Garcia BD1124 (MEXU); 4 km,

PAGE 297

275 antes de Aculizingo, rumbo a Orizaba, 2000 m, Nevling , Gmez & GmezPompa 2217 (F); along beach near Boca del Ro, Paxson , Webster & Barkley 17M633 (TEX); Zacuapan, Purpus 203 (UC); Zacuapan and vicinity, Purpus 2067 (F, GH, MO, NY, UC, US); Zacuapan, Purpus 14228 (A, F); Zacuapam, Purpus 15740 (UC); Zacuapan, Purpus 16228 (F); Zacuapan, Purpus s . n ., October 1921 (BM); Zacuapan, Purpus s . n ., October 1921 (DS); Paso de Ovejas-Paso de Mular, 130 m, Rosas 637 (A); La Laja, entre Corral FalsoPinoltepec, a 900 m de la carretera Jal apa-Veracruz, Desv. a 16 km SE Jalapa, Mpio. Zapata, 900 m, Sousa & Ramos 4872 (CAS); Palo Blanco, Mpio. Xalapa, 1350 m, Ventura 2379 (MO); Pinoltepec, Mpio. Dos Ros, 800 m, Ventura 3717 (CHAPA); Colonia Revolucion, Mpio. Boca del Ro, 10 m, Ventura 5394 (GH. MO, XAL); Plan del Ro, Mpio. Dos Ros, 300 m, Ventura 5788 (MEXU); Ejido Martires de Chicago, Mpio. Xalapa, 1300 m, Ventura 10084 (MO, XAL); El Chico, Mpio. Dos Ros, 1050 m, Ventura 10116 (CAS); Rancho Viejo, Mpio. Dos Ros, 850 m, Ventura 11285 (MO); Mirador, unknown collector 66 (C). Nicaragua . – CHONTALES: along road from Juigalpa NE toward La Libertad, ca. 17.4 km NE of Ro Mayales, at ford of Ro Bizcocho, 350-400 m, Stevens & Krudoff 4162-b (MO). –ESTELI: Loma Ocotecalzado (Me sas Moropotente), ca 11 km NE of Hwy. 1 at Estel, 1260-1300 m, Stevens , Krukoff & Grijalva 15609 (MO). JINOTEGA: along trail between Jinotega an d Las Mesitas, W of Jinotega, 11001400 m, Standley 9717 (F); Regin of La Montaita an d Las Mesitas, in sierra W of Jinotega, 1100-1400 m, Standley 10407 (F). –MADRIZ: Lado E cerro Volcn Somoto (Volcn Tepe Somoto), 1300 m, Moreno 2949 (MO); Cerro Volcn

PAGE 298

276 Somoto (Tepe Somoto) "Finca San Martn" lado W, 1100 m, Moreno 2981 (MO). –MATAGALPA: along road between San Simn de Palcila and Mesa La Cruz, 1150-1220 m, Stevens , Krukoff & Montiel 18533 (G, HUA, MO). –NUEVA SEGOVIA: La Tronquera, 660-700 m, Moreno 19449 (MO). Panam . – UNKNOWN PROVINCE: Grisebach s . n . (GOET). See specimen listed under cultivated material.. Paraguay . –CAAGUAZ: Tava, 1 km S of Hospital, Zardini 7744 (MO, TEX); Ruta 2, km 98, Zardini & Aguayo 10551 (MO). – CONCEPCI”N: Arroyo Tagatiya-Misin, Zardini & Tilleria 38858 (MO). – GUAIRA: Mbocayaty-Melgarejo, 2 km E of Mbocayaty on Arroyo Gerbasia Gallery Forest, Zardini & Tilleria 32349 (MO). –NEEMBUCU: Humait, Schulz 7770 (F). –PARAGUAR: Parque Nacional Ybycu, Hahn 1951 (HUA, MO). Per . –AMAZONAS: Prov. Chachapoyas. 9 km below and W of Chachapoyas on the road to Caclic, km 501, 2000 m, Hutchison & Bennett 4514 (F, NY, UC, US); Prov. Chachapoyas, Utcubamba Riv er Valley, just above turoff to Chachapoyas on Chachapoyas -Celendn Road, 1850 m, Smith & Cabanillas 7120 (MO, US). –ANCASH: Prov. Huac ho, Sayn, road to Acobamba, 700-900 m, Weigend & Dostert 97/116 (F, MSB). –AREQUIPA: San Augustn, La Convencin, 950 m, Bnes s . n ., November 1928 (US); Prov. Caravel, Lomas de Atiquipa (= km 591 Pananerica Sur), 150-750 m, Weigend & Forther 97/922 (MSB). –CAJAMARCA: Dept./Prov. Cajama rca, 3-5 km from Chilete on the road to Contumaz, 1600-1750 m, Brandbyge & Astholm 156 (AAU); Prov. Contumaz, El Alagarobal-San Benito, 1000 m, Lopez & Sagastegui 8434 (F, MO, NY); Prov. Contumaz, Yeton (San Benito-Guzmango), 2200 m,

PAGE 299

277 Sagastegui , Alvitaz , Carnia , Lopez 9721 (MO, NY, TEX); Prov. San Pablo, Las Tayas, 2100 m, Rincn 2820 (F); Contumaz, entre Ch ilete El Rupe, W de la carretera Chilete-Contumaz, 1680 m, Rincn Vega 4223 (F, MO); Prov. Contumaz, road Contumaz to Chilete, 2500 m, Weigend , Dostert & Drieble 97/456 (MSB). –CALLAO: Callao & Loma, Didrichsen 4398 (C); Callao, Gaudichaud s . n ., 4 January 1832 (G); Callao, Gaudichaud s . n ., 1852 (G); Hedge near Callao, Sargent 36 (A, US). CUSCO: Prov. La Convencin, 139 km de Cusco en Quellomayo, subiendo hacia la "ceja", entre Santa Teresa & Chaullay, 1200-2600 m, Nunez & Motocanchi 8782 (MO). –LA LIBERTA D: Prov. Trujillo, Cerro Campana, ca. 15 km S of Trujillo., 400-680 m, Dillon , Molau & Matekaitis 3042 (AAU, TEX, MO, NY); Prov. Otuzco, encima de Samne, 1500-1600 m, Ferreyra 14082 (MO); Cerro Campana, Localidad Trujillo, 700-996 m, Jaramillo , Sagastegui , Alvitez & Narvaez 748 (AAU); Prov. Trujillo, Cerro Campana, 600 m, Sagastegui 0388 (US); Coina, Prov. Otuzco, 1600 m, Sagastegui 7330 (US); Procedencia, Cerro Campana, Prov., Trujillo., 600 m, Sagastegui 10950 (AAU); Prov. Cajabamba, road from Cajabamba to Cajamarca, 8 km from Cajabamba, 2300 m, Weigand , Dostert & Drieble 97/318 (MSB). –LIMA: between Lima and Vitarte, Asplund 13903 (CAS, G, R, S, US); Ex r egione inferiori Peruviae prope Lima, Candivilla, Ball s . n ., April 1882 (GH); Prov. Lima, Lomas de Atocongo a 32 km S de Lima, 300 m, Cerrate 2724 (MO); Prov. Chancay, Lomas de Lachay, 460 m, Cerrate 3623 (MO); Cuming 1047 (BM); Lachay, 89 km N Lima, 1.50 m, Ellenberg 2764 (U); Villa a 20 km S de Lima, Ferreyra 2075 (MO); Prov. Cajatambo, cerca a Sayan, 750-800 m, Ferreyra 3513 (MO); Prov. Lima, Lomas

PAGE 300

278 de Atocongo, 400-500 m, Ferreyra 11129 (MO); Prov. Chancay, Lomas de Lachay, 400-500 m, Ferreyra 11512 (MO); Lima, Lomas de Lurn, 350-400 m, Ferreyra 11911 (MO); Atocongo, 400-500 m, Ferreyra 12425 (MO); Prov. Lima; La Molina, 200 m, Ferreyra 14412A (MO); Las Cascadas de Barranco, 10 km S of Lima., 1-3 m, Fosberg , Ferreya & Cerrate 28232 (BM, DUKE, GH, MO, NY, UC, US); Callao-Lima, San Lorenzo, Gaudichaud s . n ., July 1836 (G); Chocita, 40 km E of Lima in valley of Ro Rimac, 900 m, Gentry 16381 (MO); Prov. Lima, Loma de Amancae, S of Lima near Pachacamac, 120-410 m, Gentry 16475 (AAU, MO, NY); about 1 km E of Barranca, Hudson 1117 (MO, US); Lima Botanical Garden, Killip & Smith 21524 (NY, US); between Lima & Callao, 200 ft., Laudeman 5288 (OXF); Chosica, 3000 ft., MacBride 2855 (F, S); Chorrillos, Macrae s . n ., 1825 (G); road Lima to Ancon, 122 m, Mexia 8101 (BM, G, GH, NY, U, UC, US); Centre la M agdalena & el Callas de Lima, Neeiten s . n . (MA); La Magdalena, Neeiten s . n . (MA); Lurn, 5-20 m, Pennell 12207 (GH, NY, PH, US); Atocongo, 250-500 m, Pennell 14772 (PH); Prov. Canta, Ro Chillon near Yangas, 3500 ft., Plowman & Davis 4620 (GH, U); Chancay, Poiteau s . n . (G); Chancay, Ridnutt 12039 (MO); vicinity of Lima, Rose & Rose 18773 (NY, US); Soukup 3753 (LL, S, U); Prov. Huaral, Lom as de Lachay, SW slope, 100-500 m, Weigend & Forther 97/536 (MSB). –PIURA: Prov. Huanacabamba, Procedencia, Porculla, km 38, 1800 m, Quiroz 2349 (TEX). –TUMBES: Prov. Zarumilla, Matapalo, El Cauco-Campo Verde parcela de evaluacin permanente "E", 700 m, Daz , Osores , Figari , Daz , Castaneda & Pena 7426 (MO); Prov. Zarumilla, Matapalo, carretera entre Naranjal & Campo Verde, 650 m, Daz ,

PAGE 301

279 Osores , Figari , Daz , Castaneda & Pena 7472 (MO); Prov. Tumbes; Mts. E of Hacienda Chicama, 800-900 m, Webebauer 7638 (F). Samoa . Motootua, Upolu, Whistler W5368 (BM). South Africa . –KWAZULU-NATAL: Colony, District Alesandra, Station Dumisa, 400 m, Rudatis 1225 (BM); Umzinto, Strey 5215 (B, M); 3030 BC Port Shepstone, Ifafa river heights, Strey 8312 (M, MO); Denison Residence, Rutemaritburg, Weigend 2190 (M); Umdoni Park, Woud, in effense skadu, van Wyk 4256 (MO). Singapore . Nassim Road, Togashi 6211611 (AAU). Spain . –CANARIAS: Isle of La Palma. Santa Cruz, Hausen 66 (C). Sri Lanka . –UVA: road between Bandaraw ela and Haputale, just below Kahagalla tea factory, Koyama , Sumithraarachchi , Mii , Strudwick & Hanashiro 16035 (AAU); road between Bandarawela and Haputale, just below Kahagalla tea factory, Koyama , Sumithraarachchi , Mii , Strudwick & Hanashiro 16036 (AAU); Badulla District, near 15/6 road marker along Bandarawela-Badulla Road, Sumithraarachchi & Waas DBS254 (US). Taiwan . –CHIA-I: vicinity of Lianyun waterfall along the Tsengwen Hsi river, 300 m, Bartholomew & Boufford 6176 (US). P'ING-TUNG: Nan-jen Shan, Chang 2107 (MO); Ken-ting, Chuang & Kao 3950 (US); Kenting National Park, Oluanpi park, 5 m, Lammers 8488 (MO, US); Kenting-Hengchun, Saito 7557 (MO); Kuraru, Saito 8685 (US). Uganda . – KAMPALA: Kyadondo, Mengo, Kyambogo, 1200 m, Rwaburindore 1735 (MO, US). United States . –HAWAII: Honolulu Co. : O'ahu, on steep ridges above 'Aiea, Iltis H-610 (US); O'ahu, Kupehau Gulch, Wainae Range, 1200 ft., Webster 1072 (TEX, US). Venezuela . –ARAGUA: Edos. Aragua & Miranda, bosque nublado de Loma de Hierro, 1350 m, Colella & Morales 731 (VEN); Summit of

PAGE 302

280 Alto Choron, Croat 21515 (MO); 8-9 km from the r edoma at Cata Beach, SW towards Cuyaga, 400 m, Holst , Bunting & Carnevali 2298 (MO). –BOLVAR: in valley on road from El Valle to La Miranda, Pittier 11970 (G, NY, US); upper part of W slopes E of Miamo, altiplan icie Nuria, 300-500 m, Steyermark 88187 (M, NY, VEN). –DISTRITO FEDERAL: Sanchorquiz, Eggers 13440 (C); Sede do col Waracay, Lutz 1788 (R); Parque Nacional El Avila entre el Teleferio & Papeloir, 1900 m, Manara s . n ., 30 June 1977 (NY, VEN); P.N. El Avila, Arriba de Los Venados, El Viga, 1660 m, Meier , Kelch & Tarff 200 (VEN); Cuenca del Ro Macarao, Montes 317 (VEN); Entre Campo Alegre & Sanchorquiz, camino viejo de Caracas, a la Guaira, 1100-1700 m, Pittier 9567 (VEN); Las Castillitos, Sanchorquiz and vicinity, above Caracas, 1300-1500 m, Pittier 9567 (GH); on the old road from Caracas to La Guayra, 1100-1700 m, Pittier 9567 (NY); on the old road from Caracas to La Guayra, betw een Bell Vista & Sanchorquiz, 1300-1450 m, Pittier 9567 (US); between Antmano and Las Adjuntas, Pittier 12259 (US); Ingoma, near Turmerino, 970 m, Pittier 13598 (MO, US); S slopes of Cordillera del Avila, just above Caracas, along trail towards Los Venados, 5100 ft., Steyermark 55007 (F, US). –FALC”N: Penns ula Paraguana, Cerro Santa Ana, near top., 800 m, Mennega 4287 (NY, U); Cerro Santa A na, ascensin del lado S desde el pueblo de Santa Ana, 600-700 m, Steyermark & Braun 94621 (F, NY, US); Dist. Silva, al pie de los penascos ca lcareos, S de la Punta Faustino, SE de Chichiriviche, 1-3 m, Steyermark & Manara 110380 (U). –LARA: Al S de Quibor hacia Cubiro, Dist. Menez, 800 m, Steyermark , Espinoza & Nehlin 110061 (NY, VEN); La Esperanza, lmi te entre Lara-Yaracuy, Tamayo 282 (US). –MRIDA:

PAGE 303

281 between Sabana Grande and Baruta, 1000 m, Alston 5457 (BM); Colinas de Carrizal, 20 km de Caracas, Morillo 2820 (NY); Lower Cotiza, near Caracas, 1200 m, Pittier 7871 (GH, US); between La Cumbre, San Jos, and Mucutuy, 1820-2590 m, Steyermark 56249 (US). –MARACAY: Prope coloniam Tovar, Fendler 473 (GH, MO, NY, PH); SW del Va lle de Caracas, Colinas de Bello Monto, Edo. Miranda, 1100 m, Ramrez & Lopez 3273 (VEN); Trockenhang, Vogel & Zugegangen s . n ., November 1934 (M). –MONAGAS: Ladera S de Cerro San Bonifacio, en Bella Vista, 4 kms arriba del empalme con carretera Caripe-Teresn, 750-900 m, Bunting 2645 (GH). –SUCRE: vici nity of Cristbal Coln, Broadway 291 (GH, NY, US); Los Cocoteros (Via Casanay), Dist. Ribero, Cumana & Ceequea 4229 (WIS). –TACHIRA: Ejido La Enfadosa, 1550 m, Lopez-Palacios 2129 (VEN); Sierra El Casadero, 13 km N of Rubio, between Las Dantas and Las Adjuntas, 900-1050 m, Steyermark , Liesner & Gonzalez 120139 (MO); Sierra El Casadero, along hwy. between Las Dantas and Las Adjuntas, 850 m, Steyermark , Liesner & Gonzalez 120174 (MO, NY). Cultivated Material . –CUBA: Ciudad de La Habana, Cult. at Santiago de las Vegas, Baker 2617 (B). –PANAM: Island off the coast of Panama, Atherton , 1998 (FLAS). –SPAIN: Madrid, en el Jardn Botnico de Madrid, Barra s . n ., 21 September 1978 (MA). – SINGAPORE: University of Singapore campus, Maxwell 76-735 (AAU); Botanic Gardens, Wee-lek 1448 (AAU, UC). –TAIWAN: T'ai-tung, Taihoku Botanic Garden, Formosa, Yamamoto s . n ., 8 October 1930 (PH). –UNITED STATES: California, Pacific Beach, unknown collector s . n ., 1927 (US); Illinois, grown in University of Illinois Greenhouse (Ur bana, Champaign Co., Illinois), 200 m,

PAGE 304

282 Potgieter 24 (MO); Illinois, grown in Univer sity of Illinois Greenhouse (Urbana, Champaign Co., Illinois), 200 m, Potgieter 26 (MO); Illinois, grown in University of Illinois Greenhouse (Urbana, Ch ampaign Co., Illinois), 200 m, Potgieter 40 (MO); Illinois, grown in University of Illinois Greenhouse (Urbana, Champaign Co., Illinois), 200 m, Potgieter 41 (MO); Missouri, St. Louis, Missouri Botanical Garden 15/00 (MO). Notes Passiflora suberosa ssp. litoralis has the widest geographic range of any species in supersection Cieca . In the New World, its range extends from northern Mxico, through Centra l America, to central Argent ina. In these areas it may be confused with P . pallida and P . obtusifolia , which are sometimes similar vegetatively. The similarities and di fferences between these two species are discussed under their respective descripti ons. The primary difference between P . pallida and P . suberosa ssp. litoralis is the hypanthium diameter, with that of P . pallida rarely exceeding a width of 4.0 mm and that of P . suberosa ssp. litoralis commonly 4.0 mm or wider. One of the more useful characters employed in separating P . obtusifolia and P . suberosa ssp. litoralis is the presence/absence of inflorescences. When mature, Passiflora obtusifolia bears flowers in long inflorescences (i.e., 5.3-18.3 cm) and P . suberosa ssp. litoralis almost always lacks inflorescences; when P. suberosa ssp. litoralis does possess inflorescences they are not as long (i.e., 2.0-5.0 cm). There are three major mo rphological variants of Passiflora suberosa ssp. litoralis . In Mxico and Central America, P . suberosa ssp. litoralis possess

PAGE 305

283 shallowly trilobed leaves (commonly le ss than half the distance from the leaf outline to the leaf base) with the length of the central lobe often greatly exceeding that of the lateral lobes and an angle betwe en the lateral veins that is frequently between 40 and 80. The lateral lobes are also oblong to elliptic. The broadly capitate petiolar nectaries are commonl y positioned on the distal half of the petiole, often over 0.60 the distance from the base to the apex of the petiole. The leaf bases are often cuneate to acute but rarely cordate. In Mxico and Central America, Passiflora suberosa ssp. litoralis is often found in high elevation (1000 -3000 m) moist pine and oak forests along streams and rivers, but it may also occur in very dry forests with cacti (e.g., Cephalocereus forests of Tehuacn) and other species common in matorral vegetation (e.g., Tamaulipan matorral). On the western side of South Americ a (Colombia to Per and Argentina), P . suberosa ssp. litoralis possesses leaves very much like those of the Mxico/Central American variant, but the petiolar nectaries may be more discoid and are commonly positioned on the proximal half of the petiole. The lateral lobes are commonly distinctly ovate and di verge at an angle of 80-100. The leaf bases are also distinctly cordate. In th is region it is found in low (near sea level and on cliffs above the sea) to high (to 3,000 m) elevation moist forests commonly along streams and rivers, but it al so occurs in tropical dry forests. On the eastern side of South America, in southeastern Brazil, the leaves are commonly trilobed but may also have unlo bed, bilobed or trilobed leaves present on the same plant. The petiolar nectar ies are commonly discoid and positioned

PAGE 306

284 on the proximal half of the petiole. The la teral lobes are ovate, but longer than those common in western South America, and commonl y diverge at an angle of greater than 100. The leaf bases ar e distinctly cordate. In Brazil, P . suberosa ssp. litoralis is more common in coastal dunes and tropical dry forests, but it does occasionally occur in higher elevation mois t forests as well. This variant is the only form of P . suberosa ssp. litoralis found in the Old World. Laminar nectaries are commonly present in all th ree of the these variants. A clone of Passiflora suberosa ssp. litoralis from Guadalajara, Mxico ( MacDougal 478 ) has been shown to be self-incompatible, as more than 20 attempts by J. M. MacDougal to self pol linate it in the greenhouse failed to yield fruit. However, a different clone ( MacDougal 438 ) from New Cale donia did prove to be self-compatible. Two other clones from Chiapas, Mxico ( MacDougal 568 ) and Ro Selegua, Guatemala ( MacDougal 583 ) never set fruit by autogamy while in cultivation.

PAGE 307

285 Figure 8.8. Flowers of Passiflora suberosa ssp. litoralis . a. From along a stream in oak forest in Guerrero, Mxico ( Porter-Utley & Mondragn 343 ). Scale bar = 3.0 mm. b. Dry cactus ( Cephalocereus sp.) forest in Puebla, Mxico ( PorterUtley & Mondragn 344 ). Note flat outer corona. Scale bar = 1.0 cm. c. At edge of forest of Cryptocarya , Ficus , Hypolepis , Rubus , and Melastoma , Jalisco, Mxico ( MacDougal 478 ). Scale bar = 8.0 mm. Photo by J. M. MacDougal. Koschnitzke and Sazima (1997) found t hat, in Brazil, the flowers of Passiflora suberosa ssp. litoralis open at dawn and have no odor. The flowers are selfcompatible and their main pollinators are wasps. Beal (1971) determined that P . suberosa ssp. litoralis from both coastal Argentina and New Guinea had a chromoso me number of 2n = 24. He also counted the chromosomes (2n = 24) of a plant of the subspecies from the a b c

PAGE 308

286 "U.S.A.", but the locality seems ques tionable based upon the morphology of the voucher. In addition, Passiflora suberosa ssp. litoralis does not occur in the wild in the United States, but it is commonly cultivated there. He also found the same chromosome numbers for three clones of P . suberosa ssp. litoralis collected in Australia (Beal, 1969, 1971). Diers (1961) found the diploid chromosome number of 2n = 12 in P . suberosa ssp. litoralis from Lomas de Lachay, Per. However, I have not been able to locate his voucher specimens (Diers, 1961). Storey (1950) also counted the chromosomes of Hawaiian material, which he called P . suberosa . However, I was unable to lo cate his vouchers and because P . suberosa ssp. suberosa and P . suberosa ssp. litoralis both occur in the Hawaiian Islands, I cannot be certain whic h subspecies he sampled. However, he did find chromosome numbers of 2n = 24 and 36 in wild populations of the species. He determined that the 36 membered form was lik ely an autotriploid derivative of the 24 member ed form. He did not describe the plants that he sampled, but he noted that there were no conspicuous morphological difference between the two chromosomal races. He only found that the triploid race had slightly larger leaves and more anthocy anin pigmentation in the young stems and abaxial surfaces of the sepals (Storey, 1950).

PAGE 309

287 Passiflora tridactylites Description of Passiflora tridactylites 3. Passiflora tridactylites Hook. f. Trans. Linn. Soc. London 20: 222-223. 1847. LECTOTYPE (designated by D.M. Po rter, 1980, Bot. J. Linn. Soc. 81: 123): ECUADOR, Charles Island, October 1835, C . Darwin s . n . (lectotype: CGE, photocopy seen; isolectotype: K, photocopy seen). Passiflora lineariloba Hook. f. Trans. Linn. Soc. London 20: 222. 1847. Passiflora suberosa var. lineariloba (Hook. f.) Mast. Fl. Bras . 13(1): 580. 1872. LECTOTYPE (designated by D.M. Porter , 1980, Bot. J. Linn. Soc. 81: 123): ECUADOR, Gallipagos, James Island, J . Scouler s . n . (lectotype: K, photocopy seen). Passiflora puberula Hook. f. Trans. Linn. So c. London 20: 223. 1847. LECTOTYPE (designated by D.M. Porter , 1980, Bot. J. Linn. Soc. 81: 123): ECUADOR, James Island, C . Darwin s . n . (lectotype: CGE, photocopy seen; isolectotypes: CGE, K, photocopies seen). Slender, climbing, perennial vine to 2.5 m long or more, sparsely to densely pubescent with unicellular curved trichomes on petiole, leaf, and stem, 0.13-0.33 mm long, 0.02-0.03 mm wide, also minut ely antrorsely appressed-puberulent on petiole, leaf, stem, stipule and sepal with unicellular, curved trichomes, 0.06-0.08

PAGE 310

288 mm long, 0.02-0.03 mm wide. Flowering st ems terete or somewhat compressed, 0.5-1.3 mm in diameter. St ipules narrowly ovate-triangul ar, acute, 0.8-2.7(-3.6) mm long, 0.1-0.3 mm wide; petioles 0.4-0.9(-1.7) cm long, with two, opposite to subopposite, sessile, discoid or widely obc onical nectaries, 0.3-1.0 mm wide (on the widest axis), 0.1-0.5 mm high, commonl y borne in the distal half of the petiole (0.44-0.86 of the distance from the base toward the apex of the petiole). Laminas 1.9-7.7 cm long, 1.8-7. 9(-9.2) cm wide, membranous, shallowly to deeply 3lobed, ovate in general outline, lateral l obes ovate, elliptic, or very narrowly oblong (rarely obovate), acute (rarely obtus e), 1.0-5.5 cm long, 0.2-1.7 cm wide, central lobe ovate, elliptic or very narrowly oblong (rarely obovate), acute (rarely obtuse), central vein 1.9-7.7 cm long, angle between the lateral lobes 92-129(180), ratio of lateral lobe to central vein length 0.47-0.91, margins entire, hyaline, primary veins 3, diverging and branching at base, laminar nectaries absent (rarely present); t endril 0.2-0.5 mm wi de, present at flowering node. Flowers borne in leaf axils. Pedicels 12.0-18.3 mm long, 0. 3-0.5 mm wide, 2 per node; bract(s) absent; spur(s) absent. Flowers 23.9-33.3 mm in diameter with stipe (1.9-)3.3-5.3 mm long, 0.5-0.7 mm wide; hypanthium 4.6-7.1 mm in diameter; sepals 9.0-14.3 mm long, 2.04.3 mm wide, ovate-tr iangular, acute to rounded, sepals greenish yellow or whitis h; petals absent; cor onal filaments in 2 series, the outer 21-30, 5.78.9 mm long, 0.1-0.5 mm wi de, linear, not fused or fused 0.6-1.0 mm at base, f ilaments whitish with yellow tips or yellow, ratio of outer coronal row to sepal length 0.47-0. 75(-0.89), the inner 19-30, 2.8-5.4(-6.4) mm long, 0.1-0.2 mm wide, li near, capitate, filaments wh itish with yellow tips or

PAGE 311

289 yellow, ratio of inner coronal row to outer coronal row le ngth 0.34-0.60(-0.94); operculum (1.5-)2.0-2.6 mm long, plicate, very pale yellow to yellowish dried, sometimes with reddish purple spots and st reaks; nectary 0.2-0.5 mm high, 0.71.1 mm wide; limen recurved, (sometimes erect), 0.2-0.3(-0.6 ) mm high, 0.1-0.3 mm wide, yellowish or yellowish with a reddi sh purple base dried, limen floor 2.23.6 mm in diameter, yello wish or yellowish with reddish purple spots and streaks dried; androgynophore 8. 0-10.8(-14.1) mm long, 0.61.0 mm wide, purplish; free portions of the staminal filaments 2.9-6.5 mm long, 0.3-0.5 mm wide, linear, yellowish dried; anthers 1. 5-2.5 mm long, (0.3-)0.5 -1.2 mm wide, oriented perpendicular or nearly so to their filam ents; styles 3.4-5.0 mm long including stigmas, 0.2-0.4 mm wide, greenish yellow; stigmas 0.5-0.9 mm in diameter; ovary 2.8-5.3 mm long, 1.3-2.1(-2.9) mm wide, ellipsoid to fusiform, greenish. Berry 12.8-17.1(-21.1) mm long, 6.8-8.0 (-10.0) mm wide, fusiform, very dark purple. Seeds ca. 20, obovate in outline, 2.7-3.1 mm long, 1.5-1.8 mm wide, 1.21.4 mm thick, acute at both ends, reti culate-foveate with each face marked with ca. 24 foveae. Fig. 8.9-8.11. Distribution and Ecology Ecuador in the Province of Galpagos: Gardner Island (near Isla Espaola), Isla Fernandina, Isla Floreana, Isla Isabela, Isla Pinta, Isla San Cristobal, Isla Espaola, Isla San Salvador, Is la Santa Cruz, Isla Santa Mara, Isla Santiago. Growing in shrubs, trees or trailing on the ground in secondary successional areas and in dry tropical forests with Castela , Scalesia , Psidium , and Bursera , 0800 m. Flowering and fruiting throughout the year.

PAGE 312

290 Additional Specimens Examined Ecuador . –GALPAGOS: Charles, Ande rsson s.n., 1853 ( AAU); Charles, Andersson s.n. (AAU, S); Hood Island, Baur 160 (GH); September 1835 (K); Santiago, James Bay, 55 m, Eliasson 1017 (AAU); Isla Isabela, Volcn Alcedo, on the inner SW slope of the Caldera, 800 m, Eliasson 1218 (S); Isla Isabela, Volcn Alcedo, SE part of t he rim of the caldera, 1100 m, Eliasson 1282 (S); Isla Santa Cruz, Fagerlind & Wibon 3279 (S); Isla Fernandina, SW slope of Narborough Island, 300 m, Fosberg 45002 (CAS, K, MO); Narborough Island, SW slope, in broad green strip runn ing from summit to sea, 300 m, Fosberg 45064 (CAS, K, MO); Santia go, James Bay, 50 m, Gradstein , Weber & Lanier V62 (U); Charles Island, Habel s . n ., 1868 (K); James Island, James Bay, Howell 9665 (CAS, G); Isla Pinta, firs t part of transect, 1-240 m, Lawesson 2587 (AAU); Isla Pinta, S slope, 240-400 m, Lawesson 2620 (AAU); Isla Espaola, landing site on N coast, beach area and area to El Chaco, Lawesson 3126 (AAU);Isla Santa Cruz, Academy Bay, 10 m, Schimpff 52 (CAS); Gardner Island, Snodgrass & Heller 625 (GH); Gardner Island, Snodgrass & Heller 321 (GH); Isla Santa Cruz, 250 m, Snow 470 (K); Gardner Island, near Hood Island, Stewart 2075 (CAS, GH, MO, NY); Abingdon Island, Stewart 2079 (CAS, GH, US); Chatham Island, Wreck Bay, 400-650 ft., Stewart 2081 (CAS, GH); Indefatigable, Taylor TT126 (K); Isla San Salvador, James Bay, 20 ft., van der Werff 1095 (AAU, CAS, K, U); Isla Isabela, W rim of Caldera of Alcedo, 3050 ft., van der Werff 1951 (U); Isla San Cristobal, about 3.7 km abov e Puerto Bacqueriso (Wreck Bay) along road to El Progreso, Wiggins & Porter 403 (CAS, GH, K, S).

PAGE 313

291 Notes Passiflora tridactylites was described by J. D. Hooker in 1851. At the time he actually described what he considered to be three distinct species: P . lineariloba , P . tridactylites , and P . puberula . He based his descriptions primarily upon vegetative morphology. He described P . lineariloba as a slender vine having deeply trilobed leaves with long, very na rrow lateral lobes that are broadly diverging. Hooker apparently did not see the flowers of P . lineariloba because he does not describe them and the type specimen is sterile. Passiflora tridactylites was described as having deeply trilobed leaves with subcordate bases and shorter, linear-oblong lateral lobes. Hook er described the flowers of this species as large (3/4 inch in diameter), with five linear, obtuse sepals with the ovary possessing a greatly elongated "pedice l" (androgynophore), and coronal filaments that are subequal to the sepals. Passiflora puberula was described as being covered in short, microscopic hai rs and possessing trilobed leaves with cuneate bases and shorter, linear-lanceolate lateral lobes. Hooker goes on to describe the flowers, which possess fi ve narrowly linear sepals that are pubescent, and fruits, which are ovateoblong; though not mentioned in his description, the lectotype specimen of P. puberula possesses a very long androgynophore. Lawesson (19 88) differentiated between P. suberosa and P. tridactylites , but did not list the synonyms of ei ther species in his treatment. Because Hooker based his description of P . tridactylites on both vegetative and reproductive material with a detailed descrip tion of the flower, I chose to use that name for the Galpagos entity, with P . lineariloba and P . puberula treated as synonyms. Though the type specimen of P . lineariloba is sterile, vegetatively

PAGE 314

292 identical specimens with very larg e flowers and long androgynophores have been collected at the type locality. Thus, I have included it as a synonym of P . tridactylites rather than P . suberosa ssp. litoralis , which also occurs on the Galpagos Islands. Killip (1938) lumped P . lineariloba , P . tridactylites , and P . puberula with P . suberosa . He found that the entities on t he Galpagos Islands with very narrow leaf lobes that had been labeled P . lineariloba matched material collected by Safford and Mosier ( 227 ) from Florida. In addition, he noted that material similar to P . tridactylites exactly matched specimens collected by Brown ( 115 ) in Jamaica. Based upon vegetative characte rs alone he is quite correct, but the flowers of these Galpagos specimens are distinctive. The specimens of Safford and Mosier and Brown are examples of P . pallida , and the flowers and fruits of that species are far smaller than those of P . tridactylites . Lawesson (1988) differentiated between P . tridactylites and P . suberosa stating that the species were easily separated by the shape and size of the sepals and the androgynophore length. Passiflora tridactylites may be confused with P . suberosa ssp. litoralis , which also occurs in the Galpagos Islands. Both species exhibit a great amount of variation in their vegetative morphology , with both species possessing all of the different vegetative forms described by H ooker, and I have not been able to find any vegetative characters that can reliabl y be used to distinguish between them. However, the flowers and fruits of thes e two species are quite different. The sepals of P . tridactylites are commonly 10-14 mm long, whereas those of P .

PAGE 315

293 suberosa ssp. litoralis do not exceed a length of 10 mm. The outer coronal filaments are long, mo re than 6.6 mm, in P . tridactylites , and the filaments in P . suberosa ssp. litoralis are commonly less than 6.0 mm long. The androgynophore in P . tridactylites is diagnostically long, more than 8.0 mm, whereas that of P . suberosa ssp. litoralis is always less than 6.0 mm. Passiflora tridactylites has long fusiform fruits, exceedi ng 12.8 mm. The fruits of P . suberosa ssp. litoralis are 7.1-11.9 mm long and ellipsoi d to globose. According to Lawesson (1988), the habitats of t hese two species are different, with P . tridactylites occurring in dry lowland areas and P . suberosa ssp. litoralis in mesic habitats. MacDougal (pers. com.) al so found abundant Lepidopteran scales on the inside of the flowers of pressed P . tridactylites specimens, indicating a probable shift in pollinators as a likely se lective force leading to the clear floral differences in these two species. Van der Werff ( van der Werff 1951 ) reported that finches eat the fruits of this species in the Galpagos. Figure 8.9. Flower and leaf of Passiflora tridactylites ( van der Werff 1950 ). Flower appearing partially damaged, possibly by moth pollinator. Note lateral presentation of pollen. Scale bar = 9.0 mm. Photo by H. van der Werff.

PAGE 316

294 Figure 8.10. Dried flower and fruit of P. tridactylites ( H. van der Werff 1951 ). Scale bar = 1.0 cm. Figure 8.11. Distribution of Passiflora tridactylites .

PAGE 317

295 Passiflora lancifolia Description of Passiflora lancifolia 4. Passiflora lancifolia Ham., Prod. Pl. Ind. Occ.: 48. 1825. Passiflora lanceolata Ham. ex G. Don. Gen. Hist. 3: 54. 1834. Decaloba lancifolia (Ham.) M. Roemer, Fam. Nat. Syn. 2: 159. 1846. TYPE: ANTILLES, N . A . Desvaux s . n . (holotype: P, photographs DUKE!, GH!; isotype: P, photograph seen). Slender, climbing, perennial vine 3 m l ong or more, densely pubescent with unicellular curved trichomes throughout (exc ept ovary), 0.5-1. 4 mm long, 0.020.06 mm wide, also sparsely, antrorsel y appressed-puberulent with unicellular, curved trichomes on stems, leaves and stipules, 0.03-0.05 mm long, 0.02 mm wide. Flowering stems subter ete to terete, 0.7-2.2 mm in diameter, with the base somewhat cork-covered. Stipules narrowly ovate, acute to attenuate, longitudinally striate-nerved, 4.1-8.5 mm long, 0.3-0.9 mm wide; petioles 0.7-1.9 cm long, eglandular (rare) or commonly beari ng in the distal third (0.69-0.97 of the distance from the base toward the apex of the petiole) (1-)2, round or elliptic, opposite to alternate, long-stipitate, c upulate nectaries, 0.10.5 mm wide, 0.4-1.2 mm high. Laminas 3.5-8.5 cm long, 1. 5-5.2 cm wide, unlobed to shallowly 3lobed 0.05-0.72 of the distanc e to the leaf base, when present, lateral lobes elliptic, acute to rounded, 1.14.0 cm long, 0.5-3.0 cm wi de, central lobes ovate to

PAGE 318

296 elliptic, acute to attenuate, 3.5-8.5 cm long, 1.0-3.5 cm wide, angle between the lateral lobes 53-115, ratio of lateral to central lobe length 0.29-0.56, margins entire, primary veins 1(rare) or 3, diverging and branching at base, laminar nectaries absent; tendril 0.3-0.6 mm wide, present at floweri ng node. Flowers borne in leaf axils. Pedicels 24.0-55. 0 mm long, 0.3-0.8 mm wide; bract(s) absent or with one, narrowly ovate, acut e bract, 0.9-1.8 mm long, 0.1-0.3 mm wide, the bracts 20.6-34.8 mm from base of pedicel; spur(s) absent. Tubular flowers 7.1-12.8 mm in di ameter with stipe 2.9-7.4 mm long, 0.5-1.0 mm wide; hypanthium 7.1-12.8 mm in diameter; sepals 20.1-31.8 mm long, 3.4-6.9 mm wide, narrowly ovate, acute, abaxially and adaxially reddish purple (5RP 4/6-4/8) dried; petals absent; coronal filaments in 1 (rare) or 2 series, the outer 26-30, basally connate 1.1-3.8 mm, the free portions 5.810.3 mm long, 0.3-0.8 mm wide, linear to narrowly ovate, erect, reddi sh purple, lighter distally, ratio of coronal (fused and free portions) to sepal length 0.28-0.49, the inner not welldeveloped with 2-4 fila ments or well-developed (rare) with 30-31 filaments, free or basally connate (rare) 0.8-0.2 mm, the free portions 1.1-2.9 mm long, 0.1-0.2 mm wide, linear, sometime capitellate, erect, appearing reddish purple when dried, ratio of inner coronal row to outer coronal row length (fused and free portions) 0.11-0.41; operculum 1.7-2.9 mm long, plicate, appearing light reddish purple dried, the margin with narrow minutel y fimbrillate teeth; nectary 0.09-0.13 mm high, 1.1-3.5 mm wide, su lcate; limen slightly recurved to erect, occasionally slightly inclined toward operculum, 0.21.1 mm high, 0.1-0. 3 mm wide, appearing light reddish purple (5RP6/6) dried, lim en floor 2.1-6.1 mm in diameter, appearing

PAGE 319

297 light reddish purple dried; androgynophore 17 .8-22.3 mm long, 0.6-1.3 mm wide, reddish purple dried; free por tions of the staminal fila ments 3.3-8.0 mm long, 0.30.7 mm wide, linear, greenish yellow; anther s 1.8-4.0 mm long, 0.5-2.0 mm wide; styles 4.3-7.0 mm long including stigma s, 0.1-0.4 mm wide, greenish yellow; stigmas 0.4-1.1 mm in di ameter; ovary 2.6-6.7 mm long, 1.2-3.8 mm wide, elliptic, greenish yellow. Berry 12.8-13. 9 mm long, 11.0-14.4 mm wide, ovoid to obovoid, very dark purple. Seeds ca. (6 -)14-23, obovate in out line, 3.0-3.2 mm long, 1.8-1.9 mm wide, 1.3 mm thick, acute at both ends, reticulate-foveate with each face marked with ca. 15-17 foveae. Fig. 8.12-8.13 Distribution and Ecology Endemic to Jamaica, in the parishes of St. Andrew, St. Thomas, and Portland. Tropical lower montane mist forests on st eep wooded hillsides and in thickets; growing on shrubs and trees; ca. 8501220 m. Flowering and fruiting May to December. Vernacular Names Lanceolate-leaved passionflower (Don, 1934), granadilla de las sierras (Goyena, 1909). Additional Specimens Examined Jamaica . –PORTLAND: Silver Hill Woodcutter’s Gap, 3500 ft., Adams 11 , 936 (UCWI); Silver Hill, 3500 ft., Harris 6536 (BM, UCWI); Silver Hill, Blue Mountains, 3000 ft., Philipson 971 (BM); along the Buff Bay Road 0.5 mi. due W of Section,

PAGE 320

298 3100 ft., Proctor 22948 (GH, US). –ST. ANDRE W: Newcastle Rd., 2800 ft., Adams 5723 (BM, UCWI); Newcastle to Hardwar Gap, 3700 ft., Adams 8152 (BM); track Chestervale-Clydesdale, Burrowes 13017 (UCWI); between Newcastle & Greenwich, Hart 1440 (BM); along track between Bellevue & Mt. Rosanna, Port Royal Mts., 3800-4000 ft., Proctor 23573 (GH); along road between Chestervale & Clydesdale, 3200-3400 ft., Proctor 23725 (GH); road from Newcastle to Freewich, RDR 1440 (UCWI); Fern Walk, Catherine’s Peak, 4000 ft., Skelding 6788 (UCWI). –ST. THOMAS: Farm Hill, Orcutt 3437 (UC, US); Arntully, Orcutt 3841 (UC, US); along track between Farm Hill and Whitfield Hall, 4000 ft., Proctor 9659 (US); along the Stony Valley River near Arntully, 3000 ft., Proctor 33513 (DUKE). Notes The name P. lancifolia was originally published by Hamilton as " Passiflora lancifolia Herb. Prof. Desv.,” and the species has often been cited as " P. lancifolia Desv. in Ham." or " P. lancifolia Desv. ex Ham." However, in the preface of his book, it appear s that Hamilton himself took responsibility for the new species and genera described ther ein and only acknowledged the advice and assistance of Desvaux (see MacDougal & Mcvaugh, 2001 for further details). Soon afterwards, Don (1834) described the taxon P . lanceolata . However, Don's description of P . lanceolata is identical to that of P. lancifolia in Hamilton and is based upon the same type mate rial, therefore, the name P . lanceolata G. Don is a taxonomic synonym of P. lancifolia Ham. In 1850, Macfadyen wrote his second volume of Flora of Jamaica and included in it the description of a different plant,

PAGE 321

299 which he called P . regalis , now known as P . macfadyenii . However, Macfadyen unexpectedly passed away before the publication of his flora, though a large portion of it was distributed. As a resu lt, several authors viewed the new species that were described by Macfadyen as ineffectively published and began to publish new species based upon his work. Grisebach (1860) was one of these authors and published a description of P . regalis , which he attributed to Macfadyen. However, the species that he described was P . lancifolia and not Macfadyen's P . regalis . In addition, Ramrez Goyena (1909) published a description of P . regalis , which he attributed to Macfad yen, but the species that he described was also P . lancifolia and a later homonym of P . regalis Macf. ex. Griseb. Incidentally, Ram rez Goyena's description of P . regalis , other than being in Spanish and not in English, is vi rtually identical to that of Grisebach. Killip (1938) placed P . lancifolia together with P . viridiflora in the subgenus Chloropathanthus . However, the discovery of P . juliana , a species that very closely resembles P . viridiflora but is clearly a member of supersection Cieca , reinforced MacDougal's hypothesis (1983) that the apetalous, tubular-flowered species belong in supersection Cieca (MacDougal, 1983, 1992). Passiflora lancifolia is very similar to another Jamaican endemic, P . macfadyenii . They both possess bright red, elongated tubular fl owers that are likely pollinated by hummingbirds. Howe ver, these two species can be easily separated utilizing both vegetative and reproductive characters. Passiflora lancifolia possesses shallowly trilobed leaves (rarely unlobed) with the lateral lobes commonly significantly less than half the length of the c entral lobe, and the

PAGE 322

300 central lobe is ovate and nev er narrowed at the base. Passiflora macfadyenii possesses distinctly trilobed leaves with the lateral lobes commonly more than half the length of the centra l lobe, and the central lobe is obovate with a distinctly narrowed base similar to that in P . juliana and P . viridiflora . The pedicels in P . lancifolia are greater than 2.3 cm long, whereas those of P . macfadyenii rarely exceed a length of 1.8 cm. The floral nectary of P . lancifolia is the widest in the supersection, greatly exceeding that of P . macfadyenii . The outer coronal filaments are connate and often not adnat e to the sepals or barely so in P . lancifolia , whereas those of P . macfadyenii are distinctly adnate to the sepals. Passiflora lancifolia often has two rows of coronal filaments (rarely with one row or a poorly develo ped inner row) and P . macfadyenii lacks an inner coronal row (with a poorly developed second coronal row seen in one flower from a plant in cultivation, i.e., MacDougal 452 cultivated from cuttings of Thomas 2032 ). The fruits of P . lancifolia and P . macfadyenii are distinct, with P . lancifolia having globose fruits and P . macfadyenii possessing fusiform fruits . The habitats of the species are also different with P . lancifolia growing in tropical lower montane mist forests at 850-1220 m and P . macfadyenii found in tropical dry forests at 200-310 m. Benson et al. (1975), in a study of t he coevolution of plants and herbivores, reported that Dryas julia is an herbivore of P . lancifolia . However, the authors relied upon the keys in Killip (1938) in making their botanical determinations, and at the time of Killip's monograph, P . macfadyenii had not been described.

PAGE 323

301 Additionally, the habitats of both P . lancifolia and P . macfadyenii are within the range of Dryas julia (DeVries, 1987).

PAGE 324

302 Figure 8.12. Herbarium specimen of P. lancifolia ( G. Proctor 23725 ).

PAGE 325

303 Figure 8.13. Distribution of P. lancifolia and P. macfadyenii . Passiflora macfadyenii Description of Passiflora macfadyenii 5. Passiflora macfadyenii C. D. Adams in Proctor. Bull. Inst. Jam., Sci. Ser., 16: 27. 1967. TYPE: JAMAICA, St. Andrew, ca. 1.5 mi. SSE of Lucky Valley, 16 Dec. 1956, G . Proctor 15884 (holotype: IJ!; isotypes: GH!,MO!).

PAGE 326

304 Slender, climbing, perennial vine 3 m l ong or more, densely pubescent with unicellular curved trichomes throughout, 0.2-0.7 mm long, 0.02-0.03 mm wide, also minutely antrorsely appressed-puberulen t throughout with unicellular, curved trichomes, 0.08-0.10 mm long, 0.02 mm wide. Flowering stems somewhat compressed, 0.9-2.1 mm in diameter, bas e somewhat woody and cork-covered. Stipules linear-narrowly ovate, acute to attenuate, longitudina lly striate-nerved, 2.0-8.0 mm long, 0.3-1.1 mm wide; petioles 0.4-1.5 (-3.7) cm long, commonly bearing in the distal half (0 .54-0.83 of the distance from the base toward the apex of the petiole) (1-)2, round or elliptic, oppos ite to alternate, sessile (rare) or stipitate, cupulate nectaries, 0.3-0.6 mm wide (on the widest axis), 0.3-1.0 mm high. Laminas 1.4-9.0 cm long, 1.6-6. 4(-11.9) cm wide, deeply 3-lobed 0.21-0.93 of the distance to the leaf base, latera l lobes oblong to obovate, acute to rounded (rarely emarginate), (0.8-)2.0-4.2(-7.3) cm long, (0.1-)0.6-1.8(-2.3) cm wide, central lobes elliptic to obovate, acut e to rounded (rarely emarginate), 1.4-5.2 (-9.0) cm long, (0.2-)0.5-3.0 cm wide, often narrowed at base, angle between the lateral lobes 79-134, ratio of lateral to central lobe lengths 0.60-0.96, margins entire, primary veins 3, diverging and branching at base, laminar nectaries absent; tendril 0.3-0.7 mm wide, present at flowering node. Flowers borne in leaf axils. Pedicels 11.0-18.0(-23.0) mm long, 0.4-0.8 mm wide; bract(s) absent; spur(s) absent. Tubular flowers 5.5-8. 1 mm in diameter wit h stipe 1.5-6.5 mm long, 0.4-0.9 mm wide; hypanthium 5.58.1 mm in diameter ; sepals 19.3-26.1 mm long, basally connate 7.1-12.5 mm, 1.3-3.1 mm wide, linear to narrowly ovate, acute to rounded, abaxially and adaxially red (ca. 5R 6/10), free portions

PAGE 327

305 of sepals reflexed at anthesis; petals abs ent; coronal filaments in 1 series, adnate to the calyx tube, 25-30, the free portions 2.0-5.7 mm long, 0.1-0.3 mm wide, linear to narrowly ovate, erect, appearing red with yellow apices when dried, ratio of coronal (portion not adnat e to sepal) to sepal (free portion) 0.250.44; rarely a trace second coronal row of filaments may be present just outside the operculum; operculum 1.4-2.0 mm long, plicate, appearing red when dried, the margin with narrow minutely fimbrillate teeth; nectary 0. 1-0.5 mm high, 0.72.5 mm wide, sulcate; limen slightly recu rved to erect, 0.1-0. 7 mm high, 0.1-0.5 mm wide, red when dried, limen floor 2.95.0 mm in diameter , red when dried; androgynophore 17.8-23.5 mm lo ng, 0.8-1.1 mm wide, r ed when dried gradually getting lighter distally or with the red co loration nearly reaching the apices of the staminal filaments; free portions of t he staminal filaments 5.4-8.0 mm long, 0.30.6 mm wide, linear, greenish yellow or red; anthers 2.8-3.5 mm long, 0.7-2.0 mm wide; styles 4.2-5.5 mm long includi ng stigmas, 0.1-0.3 mm wide, greenish yellow; stigmas 0.73-1.33 mm in diamet er; ovary 3.6-8.0 mm long, 1.0-2.7 mm wide, fusiform, greenish yellow. Berry 25.0-26.0 mm long, 5.9-9.0 mm wide, ellipsoid and tapering at bot h ends (fusiform), very dark purple. Seeds ca. 20, obovate in outline, 3.1-3.7 mm long, 1.6-1.8 mm wide, 1.21.3 mm thick, acute at both ends, reticulate-foveate with each face marked with 15-17 foveae. Fig. 8.13-8.14. Distribution and Ecology Endemic to Jamaica, in the parishes of St. Andrew and St. Thomas. Tropical dry forests in roadside thickets and wooded limestone hills near Lucky Valley (St.

PAGE 328

306 Andrew) and Cambridge Hill (St. Thomas ); growing on shrubs, small trees, limestone boulders and rocks on very limited to moderat ely developed soils; ca. 200-310 m. Flowering and fruiting from December to February, sometimes flowering in June. Vernacular Names Crimson flowered passionflower. Additional Specimens Examined Jamaica . –ST. ANDREW: Newstead, 500 ft., Adams 8976 (UCWI);1.5 mi. SSW of Lucky Valley, along road betw een Bull Bay & Cane River Falls, 700 ft. Proctor 16172 (BM); 1.5 mi. SSE of Lucky Valley, 700 ft. Proctor 24913 (BM, US); 2 mi. N of Bullbay on road to Cane River Falls, Thomas 2032 (DUKE). –ST. THOMAS: Cambridge Hill, 1000 ft., Adams 10232 (BM, DUKE, UCWI). – PARISH UNKNOWN: Plato Road, Harris s . n ., 5 October 1897 (UCWI). Cultivated Material . –UNITED STATES: North Carolina, Durham, Duke University, cultivated from ma terial collected by Thomas ( 2032 ), MacDougal 452 (FLAS). Notes Passiflora macfadyenii was described by Adams as a new species in 1967, and he discussed the differences between it and P . lancifolia and some of the taxonomic confusion asso ciated with these species. As mentioned under P . lancifolia , Macfadyen described the plant now known as P . macfadyenii as P .

PAGE 329

307 regalis in his unpublished Flora of Jamaica in 1850. However, shortly afterwards, Grisebach (1860) and Ramrez Goyena (190 9) incorrectly applied the name P . regalis to another similar but distinct taxon, P . lancifolia . Fawcett and Rendle, in 1926, did attempt to rectify this si tuation and published a description of Macfadyen's true P . regalis , which they attributed to him. However, P. regalis Macf. ex Fawc. & Rend. is an illegitimate name because it is a later homonym of P. regalis Macf. ex Griseb and P. regalis Macf. ex Goyena. Therefore, Adams gave Macfadyen’s true P. regalis a new name, P. macfadyenii , and designated a new type specimen. As mentioned under P . lancifolia , P . macfadyenii is somewhat similar to that taxon but differs from it in characters of the leaf, flower, and fr uit. Both species are quite distinct and can be easily separat ed in the field and herbarium. It is interesting that the leaf shape of P . macfadyenii is very similar to that of P . juliana and P . viridiflora . Killip (1938), under his description of P . lancifolia , also noticed their vegetative similarities. Passiflora macfadyenii is very restricted in its distribution and has only been collected in the vicinity of Lucky Valley in the dry tropical forest s of the Port Royal Mountains, St. Andrew, Jamaica. I visi ted this area in June of 2000, but the region was experiencing a severe drought and 4 days of searching for the plant revealed neither vegetative nor reproduc tive material. Elma Kay (St. Louis University and Missouri Botanical Garden) and George Proctor (University of the West Indies and the Institute of Jamaic a) have also made several trips to the area and have not been able to find P . macfadyenii . It was last collected in 1979

PAGE 330

308 ( Thomas 2032 , 2034 ) and was listed as a rare plant in the 1997 IUCN Red List of Threatened Plants ( http://www.unep-cmc.org/spec ies/plants/red_list.htm ). It is my opinion that its status should be upgraded to extinct/endangered. It is fortunate that MacDougal obtained cuttings of P . macfadyenii from Thomas ( MacDougal 452 , Thomas 2032 ) and grew the plant in the greenhouses at Duke University from 1979-1982; they are no longe r in cultivation. Thanks to their efforts we have a better understanding of the biology of this very rare taxon. Passiflora macfadyenii appears to be self-incompatible, as no fruits were produced from ca. 30 controlled self-polli nations performed in the greenhouse by MacDougal ( MacDougal 452 ). In addition, no fruits were produced by autogamy during the ca. four years that it was in cultivation by him. In an unpublished manuscript, MacDougal determined the total sugar concentration measured as sucrose equiva lents in percent weight per total weight to be 29-44% in P . macfadyenii . He also found the flower to have no odor. The flower shape and morphology, co mbined with these data, indicate that P . macfadyenii is (or was) likely utilized by hummingbirds. Dried leaf samples of MacDougal 452 were chromatographically screened by McCormick for flavonoids. Detectable leve ls of flavonol 3-O-glycosides were found but no C -glycosylflavones (McCormick, 1982) .

PAGE 331

309 Figure 8.14. Leaves and flowers of P. macfadyenii ( MacDougal 452 ). Scale bar = 6.0 mm. Photo by J. M. MacDougal. Passiflora tenuiloba Description of Passiflora tenuiloba 6. Passiflora tenuiloba Engelm. Boston J. Nat. Hist. 6: 192. 1850. TYPE: UNITED STATES, Western Texas, "On the Liano", F . Lindheimer s . n ., 1869 (holotype: MO!).

PAGE 332

310 Passiflora bigelovii Small. Bull. N. York Bot. Ga rd. 1: 283. 1899. LECTOTYPE (designated here): UNITED ST ATES, Texas, Camp Green, C.C. Parry , Mexican Boundary Survey 393c (lectotype: NY!; isolectotype, GH!) Slender, low-climbing or scrambling, per ennial vine 1 m long or more, densely pubescent with unicellular curved trichomes on petiole, and adaxial leaf surface, 0.21-0.38 mm long, 0.02 mm wide, al so minutely antrorsely appressedpuberulent throughout with unicellular, cu rved trichomes, 0.01-0.29 mm long, 0.02-0.07 mm wide. Flowering stems tere te, 0.5-1.4 mm in diameter, base somewhat woody and cork-covered. Stipules narrowly ovate, acute to attenuate, longitudinally striate-nerved, 1.9-3.6 mm long, 0.2-0.5 mm wide; petioles 0.2-1.1 cm long, commonly bearing in the distal half, (0.36-)0.52-0.81 of the distance from the base toward the apex of the pet iole, 2, elliptic, opposite, sessile, cupshaped nectaries with raised ri ms, 0.8-2.2 mm wide (on t he widest axis), 0.2-1.3 mm high. Laminas 0.3-3.7 cm long, 3.0-14. 8 cm wide, coriaceous, occasionally variegated as juveniles, 3to 5-lobed 0.37-0.90 of the di stance to the leaf base at the deepest sinus, lateral lobes linear to narrowly ovate, acute to attenuate, 0.37.0 cm long, 0.1-0.6 cm wi de, often the primary latera l lobes with 1 to 4 smaller lobes, central lobes ovate to oblong, acute to obtuse, 0.3-3.7 cm long, 0.1-3.0 cm wide, often with 2 to 3 smaller lobes towa rd apex, angle between the lateral lobes 145-343, ratio of lateral to central l obe lengths 0.58-23.33, margins entire, hyaline, primary veins 3 to 5, divergi ng and branching at base, laminar nectaries absent or with one subm arginal nectary associated wit h the minor veins of the

PAGE 333

311 abaxial surface, 0.6-0.9 mm in diameter, ci rcular to widely elliptic, sessile; tendril 0.1-0.5 mm wide, present at flowering node. Flowers borne in leaf axils. Pedicels 1.3-8.5 mm long, 0.4-0.6 mm wide, paired in the leaf axils; bract(s) absent or rarely with one narrowly ovate, a ttenuate, bract present on the distal tip of the pedicel, ca. 0.8 mm long, 0.3 mm wide; spur(s) absent. Flowers 12.8-20.6 mm in diameter with stipe 1. 1-4.1 mm long, 0.6-0.8 mm wide; hypanthium 4.3-5.9 mm in diameter; sepals 3.98.1 mm long, 1.7-4.3 mm wide, ovate-triangular, acute to rounded, abaxially and adaxially greenish yellow; petals absent; coronal filaments in 2 series, the outer 35-47, 2. 7-4.9 mm long, 0.20.5 mm wide, linear, tapering to a point or slightly capitellate , reflexed above middle and the tips often slightly incurved, greenish yellow towa rd the base and yellow toward the tip or reddish purple (5RP 3/4) at the base and ye llow toward the tip, ratio of outer coronal row to sepal length 0.44-0.90, t he inner 35-50, 1.6-3. 1 mm long, 0.1-0.3 mm wide, linear, capitate, greenish yellow with yellow tips or reddish purple with yellow tips, erect, ratio of inner coronal row to outer coronal row length 0.46-0.68; operculum 0.9-1.3 mm long, plicate, gr eenish yellow with yellow margin or reddish purple with yellow margin, the margin with narrow minutely fimbrillate teeth; nectary 0.1-1.0 mm hi gh, 0.4-0.7 mm wide, slightly sulcate; limen recurved, 0.1-0.7 mm high, 0.2-1.1 mm wide, greenish yellow with a white margin or reddish purple with a white margin, limen floor 1.1-2.9 mm in diameter, greenish yellow or greenish yellow with reddish purple spots and streaks; androgynophore 2.9-4.2 mm long, 0.8-1.2 mm wide, greenish yellow or greenish yellow with reddish purple spots and streaks; free porti ons of the staminal filaments 1.9-3.6

PAGE 334

312 mm long, 0.3-0.7 mm wide, linear, greenish yellow; ant hers 1.7-2.9 mm long, 0.51.9 mm wide; styles 2.5-4.0 mm long including stigmas, 0.2-0.5 mm wide, greenish yellow; stigmas 0.6-1.0 mm in di ameter; ovary 1.0-2. 6 mm long, 0.9-2.4 mm wide, globose to slightly obovoid, greeni sh yellow. Berry 7.1-14.6 mm long, 7.3-15.3 mm wide, ovoid to obovoid, very dark purple. Seeds 12-25, obovate in outline, 4.1-4.8 mm long, 1. 9-2.5 mm wide, 1.3-1. 5 mm thick, acute at both ends, reticulate-foveate with each face marked with ca. 17-25 foveae. Chromosome number 2n=12 (Turner & Zhao, 1992). Fig. 8.15-8.16 Distribution and Ecology Mxico, in the northern states of C oahuila, Nuevo Len, and Tamaulipas to central and southern Texas in the United States. Arid and semiarid thorn scrub (e.g., Mesquite-Black brush, Opuntia-Prosopis scrub, Tamaulipan thorn scrub) and grasslands; climbing on shrubs or scrambling on limestone outcrops and hills, or in open grassy areas on very limited to moderately developed soils; ca. 150-1500 m. Flowering and fruiting March to December. Vernacular Names Bird Wing Passionvine, Pata Gallina, Slender Passionflower, Slender-Lobe Passionflower, SpreadLobe Passionflower. Additional Specimens Examined Mxico . –COAHUILA: 22 mi. N of N ueva Rosita, near K163, 1500 ft., Bates , Blanchard & Fryxell 1479 (CAS, TEX, NY); Mpio. Castaos, Hwy. 57, ca. 20 mi.

PAGE 335

313 S of Monclova, Dorr & Atkins 2240 (NY, TEX); 38 (rd) mi. S of Monclova along Hwy. 57, at the N end of the Cuesta de Mura lla of the Sierra Govia just below the N-most bridge, Henrickson , Riskind , Engard & Daniel , 16078 (TEX); Sierra de San Marcos, low N end of SW of Cuat ro Cienegas, 2653N, 102'30"W, 1100 m, Johnston , Wendt & Chiang 10916 (TEX); Below the "rapids" in Boquillas Canyon, inside of canyon on Mexican side, 29'N, 102'30"W, 720 m, Johnston , Wendt , Chiang , Saustrup & Saustrup 12370 (TEX); N Coahuila, about 25 mi. W of Nueva Roseta, Uriste Ranch, Latorre 12 (TEX); Monclova, Marsh 1660 (GH, TEX); Puerto de San Laz aro, Sierra de San Lazaro, Muller 3046 (US); Cuatro Cienegas Basin, tip of Sierra de San Marcos, NE-facing slopes, 800-1000 m, Pinkava , Lehto & Keil P5114 (TEX); caon de la Barrica (S-draining), gently SW-sloping upper-bajada-type area in mouth of canyon, 27'02"N, 102'50"W, 1490 m, Wendt & Lott 1232 (TEX). –NUEVO LE”N: Mpio. Higueras; W side of Mex 85, 10 km N of Cienega de Flores, ca. 1.6 km S of El Ranchito, near S end of major curves in hwy., 26'30"N, 100 07'15"W, 480540 m, Bridges & Woodruff 13121 (TEX); Monterrey, Edwards & Eaton s . n . (NY); Rancho Resendez, Lampazos, Taylor 440 (MO, TEX); Monterrey, Totwall 2 (GH). –TAMAULIPAS: Sierra de S an Carlos, vicinity of El Mulato, Bartlett 11010 (US); 48 mi. from Reynosa on the San Fernando Road, 27 mi. from MatamorosSan Fernando hwy. turnoff, Graham & Johnston 4376 (GH, GH). United States . –TEXAS: Bandera Co. : N side of F.M. 470 ca. 300 ft. W of road-summit in Seco Pass, 9.3 mi. E of F.M. 187, Seco Pass Quadrangle, Carr 9090 (TEX). Bexar Co. : San Antonio, Bottimer s . n ., 5 June 1962 (TEX); on Austin Chalk plain at

PAGE 336

314 mouth of Government Cany on, E side of current main entrance road, W side of abandoned entrance road, 0.6 mi. N of gate at 90 curve on Galm Rd., ca 5.0 mi. (by air) WSW of jct. SR 16 and Loop 1604, 29'35"N, 98'54"W, 980-990 ft., Carr 14560b (TEX). Blanco Co. : Tharp 203 (TEX). Brewster Co. : Del Norte Pass, Berkman 3616 (TEX); Lower San Francisco Ca nyon, a major tributary of the Rio Grande, Butterwick & Lamb 1975 (TEX); Bullis Gap, on the NE side of Bullis Range, Butterwick & Lott 3645 (TEX); 3 mi. from mouth of Heath Canyon, Correll 31586 (TEX); Del Norte Pass, Tharp 3616 (US); Mouth of Panther Canyon, Glass Mountains, Warnock 171 (GH, TEX); Reagan Canyon, 3 mi. form the Rio Grande, Warnock & Hinckley 1875 (TEX); lower and middle Reagan Canyon, Warnock & Hinckley 3749 (NY); Ridge Spring, 11 mi. S of Marathon, Sperry T1295 (US). Brown Co. : Dallas, Reverchon s . n ., 12 August 1877 (NY). Burnet Co. : Marble Falls, Carsuer & Studhalter 4338 (TEX). Crockett Co. : 22 mi. W of Ozona on U.S. 290, Flyr 5 (TEX); 25 mi. W of Ozona on U.S. 290, Johnston 6409 (TEX). Dimmit Co. : Chaparral Wildlif e Management Area, Gilbert s . n ., 10 May 1979 (TEX); Carrizo Springs, Hoglund 203 (TEX). Duval Co. : San Diego, Croft 64 (NY); Texas hwy. 359, 6. 5 mi. E of Bruni, Texas, Vergara , Arreola , Davila , Hein Jr . & McCart 8570 (TEX). Edwards Co. : E side of Hackberry Creek, just S of Deadman's Ho llow, Devil's Sinkhole, 7.5' USGS Quadrangle, Butterwick & Smith 476 (TEX); Devil's Sink Hole, Cory 35655 (GH). El Paso Co. : W Texas, on the road to El Paso del Norte, Schott s . n . (NY). Hays Co. : San Marcos and vicinity, Stanfield s . n ., June 1897 (NY); NW from Kyle, Tharp 1538 (TEX, US). Hidalgo Co. : Mission, Lomita Alta, Cameron 100 (TEX);

PAGE 337

315 E side of Sullivan City, Correll & Johnston 18048 (TEX). Jim Hogg Co. : 17.6 mi. SW of Hebbronville along Fa rm Rd., 3073 to Miranda City, Turner & Turner 15119 (TEX). Jim Wells Co. : along S.R. 624, ca. 5 mi. N of Orange Grove, Brown 4884 (NA). Kerr Co. : Turtle Creek, Bray 164 (TEX, US). Kinney Co. : 15 mi. E of Brackettville on hwy. #90, Butterwick , Smith , Cuba & Turner 316 (TEX); Anacacho Ranch, Anacacho Mts., Correll & Rollins 32551 (TEX). La Salle Co. : near Cotulla, Laredo to San Antonio, Small & Wherry 11947 (NY). Live Oak Co. : 9 mi. N of Jim Wells Co. line along U.S. 281, Ayers & Turner s . n ., 4 July 1979 (TEX); 7.2 mi. N of Live OakJum Wells County line, Rt. 281, Escobar , Turner & Pletmann 602 (TEX); 1 mi. N of George West, Ledingham 4666 (NY); 12 mi. E of George West, Turner & Crutchfield 80-48A (TEX). Mason Co. : Johnson City, Mason, Whitehouse 203 (TEX). Maverick Co. : S side of Eagle Pass, Correll & Wasshausen 27734 (TEX). McMullen Co. : 4.8 mi. S of Loma Alto, Cory 17227 (GH). Medina Co. : Hondo, 750 ft., Pilsbry s . n ., 12 April 1903 (PH). Pecos Co. : Limestone hills 1 mi. N of intersection US #285 and R.R. 2400, about 45 mi. S of Ft. Stockton, Correll & Hanson 29886 (TEX, UC); 24 milses W of Sheffield, Correll & Johnston 18269 (TEX); Madera Mts., 28 mi. S of Ft. Stockton on road to Marathon, Correll & Schweinfurth 25413 (TEX); Hwy. US 290, 10 mi. E of Sheffield, Miller s . n ., 16 June 1948 (NO); Tharp 43-720 (TEX); on Buena Vista Road about 8 mi. N of Ft. Stockton, Warnock 485 (TEX, US); 40-45 mi. SE of Ft. Stockton, 3200 ft., Warnock 13494 (TEX); Warnock 20083 (TEX). San Patricio Co. : Ca. 2 mi. NW of Mathis al ong edge of Frel's Caliche pit, Turner 80-87M (TEX); Frel's salich ranch NW of Mathis, Williges 419 (TEX). Starr Co. : on road

PAGE 338

316 between La Gloria and McCook, Fleetwood 11005 (TEX); Roma, Nealley 204 (CAS, PH); Farm Road 1017, 6 mi. NW of La Gloria, Rincn , Rodriguez & McCart 8345 (TEX); 8 mi. W of Roma on Hwy. 83, Smith & Butterwick 55 (TEX); Woods near Santa Mara Dr ive In, Roma, Texas, Wood 683 (TEX); NW of Roma, Wood 694 (TEX). Sterling Co. : Sterling Co. hills, Tharp 3615 (US). Sutton Co. : Uncommon along X 290, 14.2 mi. E of Sonora, Mears & Mears 1492 (TEX). Terrell Co. : Independence Creek, Dryden-Sheffield Road, 2200 ft., Hinckley & Hinckley 347 (US); along Rio Grande between Reagan Canyon & Sanderson Canyon, 2000 ft., Warnock 15857 (TEX); Blackstone Ranch, cedar-sotol mesatop 14 mi. S of Sheffield, Webster 163 (TEX); Blackstone ranch, cedar-sotol mesa-top 14 mi. S of Sheffield, Webster 177 (TEX). Travis Co. : Austin, Buckley s . n ., 1883 (NY); Austin, above Barton Cr eek, 1 mi. S of Loop 360, 600 ft., Larke 1 (TEX, NY); 8 mi. W of Travis Peak, McCart 5790 (DUKE); Austin, Tharp 2850 (US); Austin, Tharp s . n ., 9 May 1935 (TEX); Austin, Tharp s . n ., 3 July 1939 (CAS); Pedernales, 35 mi. W of Austin, Whitehouse s . n ., 31 August 1929 (TEX); Shoal Creek, Austin, York & Wolf s . n ., 2 October 1908 (TEX). Uvalde Co. : Concan, Palmer 10192 (CAS, US). Val Verde Co. : Ferne Cave on Martn J. Rose, Jr., Ranch, 18 mi. N of Comstock, Correll & Correll 26134 (TEX); on a rocky hill 1 mi. W of Comstock, Rt. #90, Correll & Johnston 21241 (TEX); 6 mi. W of Langtry, Innes & Moon 1285 (GH); 4 mi. W of Langtry, Johnston 6485 (TEX); Seminole Canyon State Historical Park campgrounds, Labus 086 (TEX); Del Rio, Lewton s . n ., 4 September 1908 (TEX); Devil's River, McClark 4115 (B, G); Intersection of U.S. Rt. 277 and 377, 29'N, 100'W, 550 ft., Miller , Brant &

PAGE 339

317 Noyes 5670 (DUKE, TEX); Rocky canyon of Pecos River, Palmer 33487 (NY); 6 mi. W of Langtry, Rose-Innes & Moon 1285 (TEX); Devil's River Natural Area Study, ca. 0.5 mi. NW up the Devil's River from the confluence of the Devil's River and Dolan Creek, Smith & Butterwick 211 (TEX); Ca. 1 mi. W of Kinney Co. line along hwy. 90, 29'N, 10042'W, Turner & Zhao 16016 (TEX); near entrance to Seminole Canyon State Pa rk, along hwy. 90, 29'N, 101'W, Turner & Zhao 16025 (TEX); along hwy. between De l Rio and Loma Alto, 2450 ft., Warnock 11251 (TEX); along hwy. near mouth of Pecos River, Warnock 11707 (TEX); 10-12 mi. N of Del Rio toward Loma Alta, 1050 ft., Warnock & McBryde 15010 (TEX); 3.5 rd. mi. SE of Comstock by hwy. US-90, Worthington 12000 (NY). Webb Co. : State Hwy. 359, 7 mi. E of Laredo, Alvarez , Guajardo , Salazar & McCart 7627 (TEX); 7 mi. E of Laredo, McCart , Cantu , Sandova . & Ramos , Jr . 50 (TEX); State Hwy. 359, 7 mi. E of Laredo, Ramos , Sandova . & McCart 200 (DUKE, TEX); 3 mi. W of Oilton on Rt. 359, Strother 863 (UC). Wilson Co. : Sutherland Spring, Palmer s . n ., August 1879 (GH); Parry s . n ., 1852 (PH). Zapata Co. : 13.9 mi. N of San Ygnacio al ong US Hwy. 83, W side of hwy. along either side of the barbed wire fenc e line, locality best marked as between 2.1 and 2.3 mi. S of county line marker (Webb/Zapata counties), Turner 80-68M (TEX). Cultivated Material . –UNITED STATES: North Carolina, Durham, Duke University, cultivated from material co llected 17 June 1978 at Pedernales State Park, Texas, MacDougal 227 (FLAS).

PAGE 340

318 Notes Engelmann, in his description of P . tenuiloba , states that the type specimen was collected in October "on the Li ano" (likely meaning “on the llano”) by Lindheimer and that only a single specimen was collected. The specimen, which is clearly labeled as being collected "on the Liano" and possesses a Latin description of P . tenuiloba from Engelmann, is held at the Missouri Botanical Garden (MO). There is another specimen collected by Lindheimer at MO, but it is not type material. The form described as P . bigelovii possesses central leaf lobes that are longer and nearly equal in length to the lateral lobes. Passiflora tenuiloba is very distinctive in the form of the leaves. It possesses leaves that are shallowly to deeply 3to 5lobed, often with lateral lobes that are up to 8.0 cm long and between 0.2 and 2.1 cm wide. The lateral lobes frequently possess 2-3 lobes at their apices. The c entral lobe is short (<1.0 cm) or longer (to 3.7 cm), sometimes with three lobes at its apex. The petiolar glands are positioned on the distal half of the petiole, often at the petiole apex or even on the base of the leaf. Passiflora tenuiloba also has very distinctive seeds with reticulate centers and grooved edges. Passiflora tenuiloba occurs in southwest Texas and northern Mxico along with P . pallida . The small flowers of these two species are somewhat similar, but they can be easily separated by vegetat ive characters. The most obvious difference is the shape of the lamina, with P . tenuiloba possessing leaves that are transversely elliptic in general out line. In addition, the flowers of P . tenuiloba have a wider hypanthi um than those of P . pallida and have more and commonly

PAGE 341

319 longer filaments in their co ronal rows. The seeds of P . tenuiloba are 4.1-5.8 mm long, whereas those of P . pallida do not exceed a length of 3.5 mm. Out of eighteen artificial self-pollinat ions carried out by MacDougal in the greenhouse, only 3 set fruit. However, t he seeds produced were generally small or poorly developed. He was able to cross P . tenuiloba with P . pallida , P . megacoriacea , P . juliana , and P . trinifolia . Passiflora tenuiloba has been included in three other studies of passionflowers. Benson et al. (1975) found that Agraulis vanillae (Gulf fritillary) is an herbivore of this species. Mc Cormick (1982) chromatographically screened leaf samples of P . tenuiloba for flavonoids and did not find detectable levels of flavonol 3-O-glycosides or C -glycosylflavones. Klucki ng (1992) found that the leaf venation pattern of this species is similar to P . sexocellata and P . eglandulosa and was classified as actinodromous and pinnate secondary venation with irregular to regular interc ostal venation consisting of lineate and transverse veins. According to Klucking, the leaves of P . tenuiloba are more like those of P . eglandulosa , because they have acute lateral lobes, an angle between the lateral veins that is betw een 120 and 140, and leaf bases that are cordate.

PAGE 342

320 Figure 8.15. Flower and leaf of P. tenuiloba ( MacDougal 227 ). Scale bar = 6.0 mm. Photo by J. M. MacDougal. Figure 8.16. Distribution of P. tenuiloba.

PAGE 343

321 Passiflora eglandulosa Description of Passiflora eglandulosa 7. Passiflora eglandulosa J. M. MacDougal. Ann. Missouri Bot. Gard. 75: 1658-1662. figs. 1, 2B, and 3. 1988. TYPE: GUATEMALA, San Marcos, wet mountain forest at Aldea Fraternidad, Wfacing slope of Sierra Madre between San Rafael Pie de La Cuesta and Palo Gordo (ca. 14’N, 91’W), 1,8002,400 m, 10-18 Dec.1963, L . O . Williams , A . Molina and T . P . Williams 25997 (holotype: F; isotypes: E NCB, C, G!, NY!, S!, US!, W). Slender, climbing, perennial vine 2-4 m long or more, sparsely to lightly pubescent with unicellular curved tric homes on petiole, st em, and stipule, (0.1)0.4-0.6(-0.8) mm l ong, 0.02 mm wide, also minutely antrorsely appressedpuberulent throughout (except ovary) with un icellular, curved trichomes, 0.050.10 mm long, 0.02-0.03 mm wide. Flowering stems terete or su bterete, 0.6-2.1 mm in diameter, with little secondary growth . Stipules ovate, slightly oblique, acute to slightly attenuate, 5-9 veins departing from the base, (3.5-)5.3-12.6(20.0) mm long, 2.50-6.4(-9.0) mm wide; petioles 0.7-4.6 cm long, eglandular. Laminas 2.5-12.0 cm long, 2. 2-14.5(-17.0) cm wide, c hartaceous, not variegated, ratio of leaf width to central vein length 0.28-1.88, 3-l obed 0.26-0.45 of the distance to the cordate leaf base, lateral lobes ovate-triangular, acute to slightly attenuate, 1.6-8.7 cm long, 0.8-4.4 cm wide, centra l lobes ovate-triangular, acute to slightly attenuate, 2.5-11.1 cm long, 1.0-5.7 cm wide, angl e between the lateral

PAGE 344

322 lobes 127-170, ratio of lateral to centra l lobe length 0.64-0.97, margins entire, primary veins 3, diverging and branching at base, laminar nectaries absent; tendril 0.3-1.1 mm wide, pr esent at flowering node, abs ent in inflorescence. Flowers borne in leaf axils. Pedicels 5.6-20.0 mm long, 0.50.9 mm wide, (1-)2 per node; bract(s) absent; spur(s) absent (occasionally) or 5 retrorse spurs present between the bases of the sepals, 0.7-1.1 mm long. Flowers 16.9-21.5 mm in diameter with stipe 2. 1-7.9 mm long, 0.5-0.9 mm wide; hypanthium 4.0-5.9 mm in diameter; sepals 5.58.5 mm long, 2.3-3.9 mm wide, ovate-triangular, acute to rounded, the 2-3 outermost wit h a (0.5-)0.8-1.2 mm blunt subapical horn, abaxially and adaxially greenish yell ow, often with a flush of reddish purple (5PR 3/4-4/6) abaxially; petals absent; cor onal filaments in 2 series, the outer 2431, 2.0-4.1 mm long, 0.1-0. 3 mm wide, linear, reflexed above middle and the tips often slightly incurved, greenish yellow at base, yellow distally, ratio of outer coronal row to sepal length 0.30-0.70, t he inner 18-34, 0.7-1. 5 mm long, 0.1-0.2 mm wide, linear, often capitate, erect, greeni sh yellow, ratio of inner coronal row to outer coronal row length 0.28-0.66; operculum 1.4-2.9 mm long, plicate, greenish yellow, sometimes with a flush of reddish purple at center, whitish distally, the margin with narrow minutely fi mbrillate teeth; nectary 0.06-0.88 mm high, 0.6-1.5 mm wide; limen recurved, 0.2-0.5 mm high, 0. 2-0.3 mm wide, whitish, limen floor 1.6-2. 1 mm in diameter, whitis h; androgynophor e 1.3-3.5 mm long, 0.8-1.3 mm wide; free portions of t he staminal filament s 2.1-3.8 mm long, 0.3-0.5 mm wide, linear, gr eenish yellow; anthers 2.33.8 mm long, 0.5-1.7 mm wide, greenish yellow, or iented perpendicular or nearly so (laterally) to their

PAGE 345

323 filaments at anthesis; styles 3.5-6.7 mm l ong including stigmas, 0.2-0.4 mm wide, greenish yellow; stigmas 0.5-0.9 mm in di ameter; ovary 1.2-2. 8 mm long, 0.8-2.2 mm wide, widely ellipsoid to globose, greeni sh yellow. Berry 9.6-14.4 mm long, 10.0-15.3 mm wide, widely ellipsoid to gl obose, very dark purple with glaucous bloom. Seeds 5-10, obovate in outline, 4.5-5.7 mm long, 3. 1-3.5 mm wide, 2.02.7 mm thick, acute at both ends, reti culate-foveate with each face marked with with ca. 15-19 foveae. Fig. 8.17-8.18. Distribution and Ecology El Salvador, in the departments of A huachapn, Santa A na, and Sonsonate; Guatemala in the departments of El Progreso, Guatemala, Jalapa, Quetzaltenango, San Marcos, Suchitepq uez, and Zacapa; Honduras in the department of Santa Brbara. Growing in shrubs and small trees in shady ravines and at the edges of premontane to montane broad-leaved forests on volcanic cones; 1500-2650 m. Floweri ng and fruiting January-May, JulySeptember and December. Vernacular Names Ala de murcilago (El Salvador), flor a murcilago (Guatemala), granadilla (Guatemala), granadilla de culebra (Guatemala), hoja de murcilago (Guatemala).

PAGE 346

324 Additional Specimens Examined El Salvador . –AHUACHAPN: Cerro Grande de Apaneca, 1700 m, Weberling 2610 (M). –SANTA ANA: M ountain Cerro Verde, 1800 m, Molina & Montalvo 21514 (F, NY). –SONSONATE: near top of Cerro Verde, 1860 m, Croat 42222 (MO); Laguna de las Nias, 1829 m, 13'N, 89'W, Villacorta 750 (MO); Laguna Verde, 1650 m, 13'N, 89'W, Villacorta & Gonzalez 683 (MO). Guatemala . –EL PROGRESO: Montaa Canahui, between Finca San Miguel and summit of mount ain, near upper limits of Finca Caieta, 1600-2300 m, Steyermark 43787 (F). –GUATEMALA: Aguilar 89 (F); Choacorral, km 20 aprox. llendo a San Juan Sacatepquez, 2000 m, Castillo , Jurez , Duarte 82347 (F); vicinity of San Andrecillo, 1700 m, Molina & Molina 27543 (F, U, US); near Canales, 1900 m, Williams & Molina 11822 (F). –JALAPA: Volcn Jumay, N of Jalapa, 1300-2200 m, Steyermark 32352 (F). –QUETZALTENANGO: 2.5 mi. below tunnel at Santa Mara de Jesu s between km post 202-203 on Hwy. 97, 14'N, 91'W, MacDougal 316 (FLAS, MO); slopes of Volcn de Zunil, at and above Aguas Amargas, 2430-2850 m, Standley 65404 (F, US); Aguas Amargas, on W slope of Volcn de Zunil, 2450 m, Standley 83336 (F); along road above Santa Mara de Jess, 1680 m, Standley 84846 (F, US); El Pocito, S of San Martn Chile Verde, on road to Colomba, 2200 m, Standley 84997 (F, G); above Mujulia, between San Martn Chile Verde and Colomba, 1800 m, Standley 85571 (F); slopes and ridges between Quebrada Chicharro and Montaa Chicharro, on SE-facing slopes of Volcn Santa Ma ra, 1300-1400 m, Steyermark 34360 (F, US); W slopes of Volcn Z unil, opposite Santa Mara de Jess, 1500 m, Steyermark 35094 (F). –SAN MARCOS: Barranco Eminencia,

PAGE 347

325 road between San Marcos and San Rafael Pi e de la Cuesta, in upper part of the barranco between Finca La Lucha and Buena Vista, 2500-2700 m, Standley 86379 (F); Barrancos 6 mi. S and W of Tajumulco, NW slopes of Volcn Tajumulco, below cliffs along Ro Malacate, 2300-2800 m, Steyermark 36663 (F, US); on outer slopes of Tajumulco Volcan o, Sierra Madre mountains about 8-10 km W of San Marcos, 2300 m, Williams , Molina , Williams , Gibson & Laskowski 26864 (F, GH, NY, US). –SUCHITEPQUEZ: Volcn Santa Clara, between Finca El Naranjo and upper slopes, 1250-2650 m, Steyermark 46628 (F, US); Volcn Santa Clara, between Finca El Na ranjo and upper slopes, 1250-2650 m, Steyermark 46692 (F, US). –ZACAPA: Ravi ne bordering Quebrada Alejandria, summit of Sierra de las Minas, vinc inity of Finca Alejandria, 2500 m, Steyermark 9859 (F). Honduras . –SANTA BRBARA: Cuestas de piedra caliza, Dept. de Santa Brbara, 10 km W de Lago Yo joa, 1500-2000 m, 14'N, 88'W, Clewell & Hazlett 3858 (MO, TEFH). Notes For many years after the publicati on of Killip's 1938 monograph, the name P . trinifolia was applied to two distinct taxa: P . eglandulosa and P . trinifolia . In fact, Standley and Williams (1961), in their description of P . trinifolia , drew information from Killip's description of P . trinifolia , which strictly applied to P . trinifolia Mast., and their own personal observations of P . eglandulosa (MacDougal, 1988). MacDougal noticed the extreme variati on in both vegetative and reproductive characters among the herbariu m specimens circulated as P . trinifolia and became aware of t he existence of P . eglandulosa . It is true that the two species

PAGE 348

326 both possess wide foliose stipules, simila rly trilobed leaves at fertile nodes and seeds with the micropylar end and chalaz al beak erect and not inclined toward the raphe. However, P . eglandulosa is distinguished by flowers with longer flower pedicels, spurs that occur between each of the sepals, narrower sepals, narrower outer coronal filaments, shorte r inner coronal filaments that are not broadly capitate, narrow limen fl oors, short staminal fila ments, and anthers that present pollen laterally as opposed to s ubproximally. The seeds are longer and wider than those of P . trinifolia , and as its name implies, P . eglandulosa lacks both laminar and petiolar nectaries. MacDo ugal collected living material of both of these species and noticed several other important characters not immediately evident in herbarium specimens. Passiflora eglandulosa possesses flower buds that are slightly horned at the apex and flowers that are oriented above rather than near or below the horizontal plane. He also commented on the more gracile androecium and gynoecium of his new species (MacDougal, 1988). In comparing the habitats of the tw o species, MacDougal found that P . eglandulosa is found in shady ravines and at the edges of wet premontane to montane broadleaved forests on Volcanic cones, whereas P . trinifolia is found in open, seasonally dry pine/oak fo rests. In addition, P . eglandulosa is a larger plant that may climb to 4 m or more, but P . trinifolia rarely exceeds a height of 1 m. The chartaceous leaves of P . eglandulosa are bright green adaxia lly and possess drip tips, but the leaves of P . trinifolia are dark green, lack drip tips and are very stiff and rigid (MacDougal, 1988).

PAGE 349

327 Passiflora eglandulosa is also similar vegetatively to P. tacana , a species found in montane forests on Volcn Tacan of Chiapas, Mxico. Both species possess wide, foliose stipules. However, the two species are easily separated because P. tacana possesses petiolar nectaries. The fruits of P . eglandulosa also possess fewer than 10 seeds, whereas P. tacana possesses ca. 20 seeds per fruit. In greenhouse studies, MacDougal found P . eglandulosa to be self-compatible but not autogamous in cultivation, whereas P . trinifolia is self-incompatible. The fruits of P. eglandulosa reach maturity in 40-44 days and an average of 9-10 seeds are produced per fruit in this species (MacDougal, 1988). The development and physiology of the floral nectary of P . eglandulosa , misidentified as P . trinifolia , was examined by Durkee et al. (Durkee et al., 1981). She found that the floral nectary devel opment and nectar secretion in this species is similar to that in the two other species of Passiflora that she studied. She concluded that the nectary ring result s from the activity of an intercalary meristem, increased starch deposition in th e amyloplasts of the secretory cells parallels the maturation of the nectary phloem, and granulocrine secretion in the "starchy" nectaries does not occur. She also observed large membrane-bound protein bodies in the phloem parench yma cells (Durkee et al., 1981). In 1982, McCormick studied the flavonoid chemistry of Passiflora subgenus Decaloba and analyzed several members of Passiflora supersection Cieca (McCormick, 1982). She chromatogr aphically screened leaf samples of P . eglandulosa (listed under the collection number MacDougal 316 in Table 7 of the

PAGE 350

328 dissertation). Though the concentrations were so low that no compounds could be verified, traces of flavonol 3-O-glycosides were detected but not Cglycosylflavones (MacDougal, 1988; McCormick, 1982). Benson et al. (1975), in a study of t he coevolution of plants and herbivores, reported that Heliconius hortense is an herbivore of P . eglandulosa (misidentified as P . trinifolia ). This report was confirmed by MacDougal (MacDougal, 1988). Figure 8.17. Flower of P. eglandulosa ( MacDougal 316 ). Scale bar = 4 mm. Photo by J. M. MacDougal.

PAGE 351

329 Figure 8.18. Distribution of P. clypeophylla , P. trinifolia , P. obtusifolia and P. eglandulosa . Passiflora trinifolia Description of Passiflora trinifolia 8. Passiflora trinifolia Mast. Bot. Jahrb. 8: 217. 1887. TYPE: GUATEMALA, Baja Verapaz, Santa Rosa, 1600 m, 16 April 1882, J . Lehmann 1314 (holotype: K, photograph DUKE!; isotype: G!).

PAGE 352

330 Small, slender, low-climbing or trailing, perennial vine 0.2-1.5 m long, minutely antrorsely appressed-puberulent throughout (except ovary) with unicellular, curved and erect trichomes, 0.1-0.2 mm long, 0.02-0.03 mm wide. Flowering stems terete, red (5R 4/8) when young, 0.9-1.8 mm in diam eter, with the base somewhat cork covered. Stipules asy mmetrically ovate, acute to attenuate, (3.8-)5.3-10.1 mm long, 2.2-7.3 mm wi de, 5-13 veins departing from base; petioles 0.4-1.2 cm long, with 1 or 2 (rare ly eglandular), round or elliptic, opposite to subopposite, sessile or shortly stipitat e, saucer-shaped nectaries with flat rims, 1.0-1.5 mm wide (on the widest axis), 0. 8-1.1 mm high, borne below the distal third of the petiole (0.290.90 of the distance from t he base toward the apex of the petiole). Laminas 1.6-4. 0 cm long, 2.1-6.7 cm wide, subcoriaceous, 3to 5lobed 0.05-0.52 the distance to the leaf base, lateral lobes elliptic, acute, 1.3-3.1 cm long, 0.5-1.7 cm wide, central lobe elliptic, acute to rounded, 1.6-4.0 cm long, angle between the lateral lobes 93-145, ratio of lateral lobe to central lobe length 0.67-1.28, margins entire, hy aline, primary veins 3, diverging and branching at base, laminar nectaries, 1-4, circular , submarginal, associated with the minor veins of the abaxial surface, 0.6-1.1 mm in diameter, sessile; tendril 0.2-0.7 mm wide, present at flowering node. Flowers borne in leaf axils. Pedicels 5.3-7.6 mm long, 0.3-0.7 mm wide, 2 per node; bract(s) absent; spur(s) absent. Flowers 26.6-30.9 mm in diameter with stipe 1.8-3.4 mm l ong, 0.5-1.0 mm wide; hypanthium 8.1-8.4 mm in di ameter; sepals 9.1-11.4 mm long, 5.5-6.3 mm wide, ovate-triangular, acute, abaxially and adax ially greenish yellow, reflexed at anthesis; petals absent; coronal filaments in 2 series, the outer 35-39, 4.7-5.1

PAGE 353

331 mm long, 0.4-0.5 mm wide, linear, somewhat dilated to ward tips, semi-erect, greenish yellow at base, yellow at tips, rati o of outer coronal row to sepal length 0.42-0.53, the inner 38-47, 1.9-2.5 mm long, 0.1-0. 2 mm wide, linear, capitate, erect, greenish yellow with purple (5P 5/ 8) spots and streaks toward base, tips whitish, ratio of inner coronal row to outer coronal row length 0.37-0.51; operculum 1.8-1.9 mm long, plicate, whitis h, tinged with purple, the margin with narrow minutely fimbrillate teeth; necta ry 0.1-0.5 mm high, 0.9-1.0 mm wide; limen erect, 0.1 mm high, 0. 3-0.4 mm wide, limen floor 4. 0-4.3 mm in diameter, whitish; androgynophore 3.84.0 mm long, 1.2-1.4 mm wide, whitish with purple spots and streaks; free porti ons of the staminal filam ents 3.5-4.2 mm long, 0.70.9 mm wide, linear, greenish yellow; anther s 2.9-3.3 mm long, 1.8-2.0 mm wide, greenish yellow; styles 4. 4-5.3 mm long including st igmas, 0.4-0.5 mm wide, greenish yellow; stigmas 1.3-1.7 mm in di ameter; ovary 1.9-2. 3 mm long, 1.8-2.0 mm wide, widely ellipsoid, greenish yellow . Berry 10.5-12.9 mm long, 10.3-10.5 mm wide, ellipsoid or globose, very dark purple. Seeds obovate in outline, 3.64.0 mm long, 2.1-2.4 mm wide, 1.6-1.8 mm thick, acute at both ends, reticulatefoveate with each face marked with ca . 12-15 foveae. Fig. 8.18-8.19. Distribution and Ecology Guatemala, in the department of Baja Verapaz. Seasonally dry limestone hills with open forest of pine, some oak, and agav e; 1600 m. Flowering and fruiting in February, April, and July.

PAGE 354

332 Additional Specimens Examined Guatemala . –BAJA VERAPAZ: Hacienda S anta Rosa, now in the Estrada family, type locality on old rd. from Pan tn to Salam (Rt. 5), ca. 4.5 km S of Pantn, 21 km from Salam, 5200 ft., MacDougal & Miley 637 (FLAS, MO); Cuesta de Cachil, near Salam, 1200-1600 m, Pittier 160 (US); Santa Rosa, von Tuerckheim 1207 (G, GH). Notes Passiflora trinifolia is known only from Baja Verapaz, Guatemala. It is usually easily distinguished from other members of supersection Cieca by its stiff and rigid leaves and very small stature. Passiflora trinifolia has been confused with P . eglandulosa , but several vegetative and reproductive characters can be used to separate these taxa, as pr esented under the description of P. eglandulosa . The most notable of these is the pr esence/absence of petiolar and laminar nectaries, with P. trinifolia possessing 1-4 laminar nectaries and 1-2 petiolar nectaries, and P. eglandulosa having neither laminar nor petiolar nectaries. MacDougal (1992) found Passiflora trinifolia to be self-incompatible in the greenhouse, as 33 attempts to self-pollinate it failed to produce fruits. However, its sister species, P. eglandulosa , is self-compatible.

PAGE 355

333 Figure 8.19. Flower of P. trinifolia ( MacDougal 637 ). Scale bar = 5.0 mm. Photo by J. M. MacDougal. Passiflora clypeophylla Description of Passiflora clypeophylla 9. Passiflora clypeophylla Mast. Bot. Gaz. 16: 6-7. 1891. TYPE: GUATEMALA, Alta Verapaz, Barranca del Rubelcruz, alt. 2,500 pp., estimated coordinates 15 29’N, 90’W, April 1889, J.D. Smith 1625 (holotype: US!). Climbing vine, minutely antrorsely appr essed-puberulent throughout with unicellular, curved trichomes, 0.03-0. 10 mm long, 0.03 mm wide. Flowering stems subterete, 2.1-3.4 mm in diameter. Stipules narrowly ovate-triangular, acute, (3.3-)5.9-6.4 mm l ong, 0.8-1.3 mm wide; petiole s 3.3-3.8 cm long, with 2, opposite to subopposite, sessile, discoid necta ries with flat rims, 1.3-1.7 mm wide (on the widest axis), 0.5-0.6 mm high, borne on the proximal half of the petiole (0.37-0.47 of the distance from the base toward the apex of the petiole). Laminas 6.0-8.7 cm long, 6. 7-10.8 cm wide, somewhat coriaceous, distinctly peltate (the

PAGE 356

334 distance from leaf base to point of petiole insertion 10.4-14.4 mm), subrotund, obscurely 3-lobed 0.02-0.07 the distance fr om the leaf outline to the leaf base, lateral lobes somewhat elliptic, obtuse to emarginate, 4.0-6.2 cm long, ca. 3.0-5.6 cm wide, central lobe somewhat elliptic, obtuse to emarginate, central vein 4.67.3 cm long (measured from point of pet iole insertion to the leaf apex), angle between the lateral lobes 110-125, ratio of lateral lobe to central vein length 0.76-0.87, margins entire, hyaline, primary veins 3, diverging and branching above base, laminar nectaries present, 2, submarginal, associated with the minor veins of the abaxial surface, 0.8-0.9 mm in diameter, circular to widely elliptic, sessile; tendril 0.5-0.9 mm wide, present at flowering node. Flowers borne in leaf axils. Pedicels 16.9-17.3 mm long, 0.6 mm wide, 2 per node; bract(s) absent; spur(s) absent. Flowers 25.0-26.3 mm in diameter with stipe 9.4-14.3 mm long, 0.5-0.8 mm wide; hypanthium 5.8 mm in diameter; s epals 9.6-10.3 mm long, 4.35.0 mm wide, ovate-triangular, acute, greenish yellow; petals absent; coronal filaments in 2 series, the outer 28, 4. 7-5.5 mm long, 0.40.6 mm wide, linear, spreading, purplish to reddish with greenish yellow or yellow ti ps when dried, ratio of outer coronal row to sepal lengt h 0.46-0.58, the i nner 31, 2.3-2.5 mm long, 0.3 mm wide, linear, capitate, erect, purplish to reddish wh en dried, ratio of inner coronal row to outer coronal row length 0.42-0.51; opercu lum 1.6 mm long, plicate, purplish to reddish with greenish yellow tip when dried, the margin with narrow minutely fimbrillate teeth; necta ry 0.3 mm high, 1.2 mm wide; limen recurved, 0.3 mm high, 0.2 mm wide, purplish to reddish at base lightening toward tip when dried, limen floor 2.7 mm in diameter, purplish to reddish when

PAGE 357

335 dried; androgynophore 3.8 mm long, 0. 9 mm wide, purplish to reddish on proximal half and greenish yellow on distal half when dried; free portions of the staminal filaments 3.4-3.8 mm long, 0. 5-0.6 mm wide, linear, greenish yellow when dried; anthers 1.7-2.0 mm long, 0. 9-1.3 mm wide; styles 3.8-4.3 mm long including stigmas, 0.4-0.5 mm wide, gr eenish yellow when dri ed; stigmas 1.1-1.3 mm in diameter; ovary 1.8 mm long, 1.5 mm wide, globose, greenish yellow when dried. Fruit unknown. Fig. 8.18, 8.20. Distribution and Ecology Guatemala in the department of Alta Verapaz at ca. 762 m altitude. Based upon the ecology of the area, P. clypeophylla is likely found in seasonally dry areas associated with oaks and pines. The species has been collected in flower in April. Additional Specimens Examined Only known from the type specimen.

PAGE 358

336 Figure 8.20. Habit of Passiflora clypeophylla (based upon Smith 1625 ). Scale bar = 1.0 cm.

PAGE 359

337 Notes Passiflora clypeophylla is known only from the type locality in Alta Verapaz, Guatemala. Passiflora clypeophylla is distinctive in supersection Cieca because of its large, conspicuously peltate leaves that are deltoid in general outline. The flowers are not known to be borne in infl orescences and the pedicels are greater than 16.8 mm long. The floral stipe of P . clypeophylla is also one of the longest in the supersection and is greater than 9.4 mm long. In addition, th e plant has very shallow leaf lobes (0. 03-0.07 of the distance from the leaf outline to the leaf base). Passiflora clypeophylla resembles both P . trinifolia and P . sexocellata , which are somewhat similar vegetatively and also occur in Guatemala. Passiflora clypeophylla is easily distinguished from P . trinifolia by its considerably narrower stipules, the obtuse to rounded leaf lobes that are very shallow and the leaves that are coriaceous as opposed to char taceous in texture. The primary difference between Passiflora sexocellata and P . clypeophylla is the ratio of the lateral to central lobe length. Passiflora clypeophylla has lateral and central leaf lobes that are nearly equal in length, whereas P . sexocellata has lateral lobes that are commonly 1.3 to 2.8 time s longer than the central lobes. Passiflora sexocellata also commonly has a shorter central leaf lobe and more laminar nectaries than P . clypeophylla . As with P . trinifolia , the lateral leaf lobes in P . sexocellata are acute to attenuate as opposed to obtuse to rounded. The one known flower of P . clypeophylla has fewer filaments in the outer coronal row (28 filaments) than either P . trinifolia (35-39 filaments) or P . sexocellata (40-50). The staminal filaments in P . clypeophylla are nearly equal to the androgynophore

PAGE 360

338 length, but the filaments in P. sexocellata are commonly half the length of the androgynophore. The seedling leaves of several species in supersection Cieca (e.g., P. sexocellata , P. megacoriacea, P. juliana , and P. viridiflora ) are peltate and very similar in shape to the mature leaves of P. clypeophylla, and evolution by neoteny in this taxon seems plausible. Passiflora obtusifolia Description of Passiflora obtusifolia 10. Passiflora obtusifolia Sess & Moc. Pl. N. Hispan. ed. 1: 156. 1890; ed. 2: 145. 1893. LECTOTYPE (designated by R. McVaugh, 2000, Bot. Results Sess & Mocio, p. 428): MXICO, Michoacn, Apatzingn, October 1790, M . Sess & J . Mocio s . n . (lectotype illustration: Sess & Mocio, Ill, Hunt Institute 6331.830, 1787-1803; photograph F!). Slender, low-climbing, perenni al vine 1.5-3 m long or mo re, minutely antrorsely appressed-puberulent throughout with unicellul ar, curved to erect trichomes, 0.10.2 mm long, 0.02-0.03 mm wide, also sparsely pubescent with longer, unicellular, curved to erect trichomes on petiole and stem, 0. 2-0.4 mm long, 0.020.03 mm wide. Flowering stems terete or somewhat compressed, 0.9-2.1 mm in diameter, with the base woody and cork-covered. Stipules very narrowly ovate, acute to attenuate, longitudinally striat e-nerved, 1.4-5.7 mm long, 0.3-1.0 mm

PAGE 361

339 wide; petioles 0.5-2.8 cm long, 2, round to elliptic, opposite, sessile, discoid nectaries, 1.1-2.2 mm wide, 0.2-1.3 mm hi gh, borne below the distal half of the petiole (0.40-0.83 of the distance from t he base toward the apex of the petiole). Laminas 2.4-12.6 cm long, 3.4-18.2 cm wide, subcoria ceous, sometimes peltate, distinctly trilobed 0.36-0.60 t he distance from the leaf out line to the leaf base or widely divaricately bilobed to obscurely 3-lobed 0.09-0.28 the di stance from the leaf outline to the leaf base, lateral lobes elliptic, acute to obtuse, occasionally attenuate, 2.0-10.0 cm long, 0.7-4.4 cm wide, central lobe elliptic to obovate, or present merely as a widely acute to obtus e tip, rarely emargi nate, central vein 2.4-12.1 cm long, angle between the latera l lobes 88-151, ratio of lateral lobe to central lobe length 0.74-1.64, margins entir e, hyaline, primary veins 3, diverging and branching at or above base, laminar necta ries present or rarely absent, 2-4(11), circular, submarginal, associated with t he minor veins of the abaxial surface, 0.6-1.3 mm in diameter, sessile; tendril 0. 3-1.1 mm wide, present at flowering node, absent in inflorescence. Flow ers borne in leaf axils and terminal inflorescences; inflorescences 5.3-18. 3 cm long, associated reduced laminas 2.3-4.9 mm long, 0.5-1.4 mm wide. Pedicels 3.8-6.8(-1 9.5) mm long, 0.4-0.8 mm wide, 2 per node; bract(s) absent, or with 1-2 narrowly ovate bracts present on the distal half of the pedi cel, 1.0-2.0 mm long, ca. 0.1 mm wide; spur(s) absent. Flowers 14.6-21.6 mm in di ameter with stipe 3.1-4.6 mm long, 0. 4-0.9 mm wide; hypanthium 4.3-6.3 mm in di ameter; sepals 4.7-7.8 mm long, 2.1-4. 7 mm wide, ovate-triangular, acute, greenish yello w, often flushed with reddish purple abaxially; petals absent; coronal filaments in 2 series, the outer 28-38, 1.3-3.0(-

PAGE 362

340 4.3) mm long, 0.3-0.4 mm wi de, linear, often capitellat e, strongly curved at the base so that the filaments spread horizontally, with the tips often curved toward the sepals, greenish yellow, sometimes fl ushed with reddish purple at base, ratio of outer coronal row to sepal length 0. 22-0.56(-0.85), the i nner 38-40, 0.9-3.3 mm long, 0.1-0.3 mm wide, linear, capitate, er ect, greenish yellow, ratio of inner coronal row to outer coronal row lengt h 0.55-1.15; operculum 1.0-2.1 mm long, plicate, greenish yellow, sometimes reddi sh purple at base, the margin whitish with narrow minutely fimbrillate teeth; nec tary 0.1-0.5(-0.9) mm high, 0.8-1.5 mm wide; limen erect, 0.1-0.5 mm high, 0. 1-0.4 mm wide, greenish yellow, limen floor 1.0-3.5 mm in diameter, greenish yellow; androgynophor e 0.7-3.9 mm long, 0.71.3 mm wide, greenish yellow, whitish at base; free portions of the staminal filaments 1.6-3.7 mm long, 0.3-0.7 mm wide, linear, gr eenish yellow; anthers 1.03.0 mm long, 0.5-1.7 mm wi de, greenish yellow; styles 2.2-4.1 mm long including stigmas, 0.2-0.5 mm wide, greenish yellow; stigmas 0.8-1.6 mm in diameter; ovary 2.0-2.3 mm long, 1.42.2 mm wide, widely ellipso id to globose, greenish yellow. Berry 2.3-2.6 cm l ong, 2.1-2.4 cm wide, widely ellipsoid to globose, very dark purple. Seeds obovate in outline, 3.3-3.6(-5) mm long, 2.0-2.3(-3.2) mm wide, 1.5-1.8 mm thick, acute at bot h ends, reticulate-foveate with each face marked with15-17 foveae. Germination unknown. Chromosome number: 2n=12 (Snow & MacDougal, 1993). Fig. 8.18 and 8.21. Distribution and Ecology Costa Rica in the province of Guanacas te; El Salvador in the department of Ahuachapn; Mxico, in the states of Colima, Jalisco, Michoacn, Nayart, and

PAGE 363

341 Oaxaca. Tropical deciduous and subdeciduous forests or disturbed areas in the Pacific lowlands and foothills; near sea le vel to 300 m in Mxico, 650-1200 m in El Salvador and Costa Rica. Flowering and fruiting October to January and May. Vernacular Names Ala de murcilago (El Salvador), murcilago (El Salvador). Additional Specimens Examined Costa Rica . –GUANACASTE: Guanacaste, La Cruz, Santa Elena, Parque Nacional Guanacaste, Estacin Maritza, 650 m, Estrada 3028 (MO). El Salvador . –AHUACHAPN: alrededores de Ataco, por la calle vieja a Ahuachapn, 1200 m, Linares 3776 (MEXU); Departamento de Ahuachapn, Padilla 163 (US); Padilla 475 (US); Sierra de Apaneca, in the region of Finca Colima, Standley 20188 (US); Parque Nacional El Imposible, Villacorta , Toledo & Lopez 879 (MO). Mxico . –COLIMA: Back of dunes E side of Manzanillo Bay, Ferris 6208 (US); Isla Socorro, Archip ielago de Revillagigedo, 220 m, Flores & Martnez 851 (MO); Ravine ca. 0.7 km N-NW of summit of Cerro, Socorro Island, 915 m, Levin 2046 (MO); 1.7 km SE de Cerro de Ortega, Ribera del Ro Coahuayana, Lott & Magallanes 840 (DUKE); Santiago vill age, near Manzanillo, 5-10 m, Stork , Eyerdam , Morrison & Horton 25409 (UC, US). –JALISCO: Entre la Manzanilla & el Tamarindo, Mpio. La Huerta, Guzman Mejia 180 (IBUG). – MICHOACN: Mpio. Coahu ayana, San Telmo, MacDougal & Miley 495 (MO, US); Apatzingn, Sess & Mocio 4462 (AAU, F, G, MO). –NAYART: Mara Madre, Tres Maras Isl ands, S of Penal Colony, Ferris 5589 (MO, US); S of

PAGE 364

342 Penal Colony, Mara Madre, Tres Maras Islands, Ferris 5598 (A, DS); Tres Maras Islands; Mara Madre, Howell 10492 (CAS); Tres Maras Islands, Mara Madre, Arroyo Honda, Mason 1172 (US); Cerro de la Cruz, E of Tepic, 1000 m, Mexia 666 (UC). –OAXACA: Temazcal, Tuxtepec, MacDougal 4687 (FLAS); Dto. Tuxtepec, cortina de la Presa Miguel Alemn, Temazcal, Martnez & Ramos 24029-A (MEXU). –EXACT LOCALITY UNKNOWN: Sess & Mocio 4462 (AAU, F, GH). Notes As noted by MacDougal and McVaugh (2001), Passiflora obtusifolia is quite variable in its vegetative morphology, especia lly in the depth of the leaf lobes, the shape of the lobe apices, and the number of laminar nectaries. Despite its name, the lobes of P . obtusifolia are commonly acute. The ty pe is an illustration of an unusual form that has only been collected again near Cerro de Ortega, Colima, Mxico ( Lott 840 ), not far from the type localit y. The type possesses shallowly trilobed leaves with obtuse lateral lobes , rounded to emarginate central lobes, and six laminar nectaries per leaf, with two glands situated proximal to the lateral leaf veins (MacDougal & McVaugh, 2001). As discussed under the description of P . mcvaughiana , P . obtusifolia is similar to that species, which is also found in southwestern Mxico. However, these species differ in leaf shape, depth of lobi ng, number of laminar nectaries, number of petiolar nectaries, pedicel length, s epal length, outer coronal length and shape, seed size, and habitat. Passiflora obtusifolia also sometimes occurs very near P . eglandulosa . At first glance these two species are somewhat similar

PAGE 365

343 vegetatively with their dist inctly trilobed leaves. Ho wever, the stipules of P . eglandulosa are much wider and foliose, the leaf bases are cordate, and the leaf apices are acuminate. In addition, P . eglandulosa does not possess inflorescences and its flowers are more delicate with narrower sepals and thinner outer coronal filaments. Passiflora obtusifolia is also similar to P . suberosa ssp. litoralis . However, P . suberosa ssp. litoralis is never peltate at the reproductive nodes, whereas P . obtusifolia is commonly peltate. Passiflora suberosa ssp. litoralis does not produce flowers in long in florescences. The fruits of P . obtusifolia are over 20 mm long and 18 mm wide, but the fruits of P . suberosa ssp. litoralis rarely exceed a length of 12 mm and a width of 10 mm. MacDougal found that one clone of aff. Passiflora obtusifolia ( MacDougal 1486 ) was self-incompatible in the greenhouse. Two clones of Passiflora obtusifolia ( MacDougal 495GR and MacDougal 4687 ) did not set fruit over several years of cultivation at the University of Flori da or at Missouri Botanical Garden. However, T. Skimina was able to successfully cross P . obtusifolia with P . itzensis . McCormick (1982) chromatographically screened leaf samples of P . obtusifolia for flavonoids and did not find detectable levels of flavonol 3-O-glycosides or C glycosylflavones.

PAGE 366

344 Figure 8.21. Flower of P. obtusifolia ( MacDougal 495GR ). Scale bar = 3.0 mm. Photo by J. M. MacDougal. Passiflora juliana Description of Passiflora juliana 11. Passiflora juliana J. M. MacDougal. Novon 2: 358-361. fig 1. 1992. TYPE: MXICO, Michoacan, Mpio. Coahuayana, high point on coastal road (Hwy. 200) between San Telmo and San Juan de Lima, 70 m, 2 Nov. 1979, J . M . MacDougal 492 (holotype: DUKE; isotypes: B!, CAS, CHAPA, DUKE, ENCB, F!, G!, GH!, IBUG, MICH, MO, MEXU!, NY , TEX!, US!, XAL). Slender, climbing, perennial vine 3 m long or more, minutely antrorsely appressed-puberulent throughout with unicell ular, curved trichomes, 0.03-0.13 mm long, 0.02-0.03 mm wide. Flowering st ems terete to some what compressed

PAGE 367

345 with rounded edges, greenish yello w or reddish purple (5RP 5/6), 1.0-2.7 mm in diameter, with the base somewhat w oody and cork-covered. Stipules asymmetrically ovate to obovate, acut e, 5-10 veins departing from the base, (6.0)8.3-18.9(-23.0) mm long, 2.8-11.3(15.0) mm wide; petiole s 1.1-4.3 cm long, inserted 2.3-15.8 mm from the basal margins of the peltate blades, commonly bearing on the proximal half (0 .21-0.52 of the distance from the base toward the apex of the petiole), 2, round or ellipti c, opposite to subopposite, sessile or shortly stipitate, saucer-shaped nectaries with flat rims, 0.92.7 mm wide, 0.3-2.1 mm high. Laminas 3.4-14.0 cm long, 6.0-20.0 cm wide, coriaceous, occasionally variegated as juveniles, conspicuously peltate, deeply 3-lobed (0.42-)0.50-0.86 the distance from the leaf outline to the leaf base, lateral lobes e lliptic to obovate, acute to obtuse, 2.9-11.1 cm long, 1.2-4. 5 cm wide, central lobes obovate, acute to obtuse, 3.1-13.2 cm l ong, 1.3-5.0 cm wide, narro wed at base, angle between the lateral lobes 95-160, ratio of lateral to central lobe length 0.75-0.99, margins entire, thickened, sometimes purplish r ed, primary veins 3, diverging and branching above base, 4-11 laminar nectari es present, submarginal, associated with the minor veins of the abaxial surface, 0.3-1.0 mm in diam eter, circular to widely elliptic, sessile; tendril 0.4-1.1 mm wide, present at flowering node, absent in inflorescence. Flowers paired in l eaf axils or in terminal inflorescences; inflorescences 4.7-9.8 cm long, asso ciated reduced laminas 7.0-14.4 mm long, 0.5-1.3 mm wide. Pedicels 2.9-19.0(-27.0) mm long, 0. 5-1.1 mm wide; bract(s) absent; spur(s) absent. Flowers 24.5-31.3 mm in diameter with stipe 0.9-2.0 mm long, 0.6-1.3 mm wide; hypanthium 6.08.3 mm in diameter ; sepals 9.3-11.5 mm

PAGE 368

346 long, 2.6-4.9 mm wide, ovate-triangular , acute to rounded, abaxially and adaxially greenish yellow; petals absent; coronal fila ments in 2 series, the outer 38-46, 4.97.2 mm long, 0.3-0.7 mm wide, linear, tapering to a point, spreading flat, greenish yellow becoming gradually lighter in colo r apically, unmarked or with purple (5P 3/6) spots and streaks near base, ratio of outer coronal row to sepal length 0.470.74, the inner 40-47, 3.0-3.8 mm long, 0.2-0.4 mm wi de, linear, capitellate, erect to slightly spreading, greenish yellow, unmar ked or with a flush of purple at very base, ratio of inner coronal row to outer coronal row length 0.43-0.73; operculum 2.0-2.5 mm long, plicate, greenish ye llow, the margin with narrow minutely fimbrillate teeth; nectary 1.3-1.9 mm high, 0.7-1.3 mm wide; limen recurved, 0.81.1 mm high, 0.2-1.0 mm wide, greenish yello w, unmarked or with a violet to dark purple tip, limen floor 2.6-3.3 mm in diameter , dark purple (5P 2.5/6); androgynophore 3.9-5.5 mm long, 1.0-1.4 mm wide, whitis h with a flush of purple at the base or with the purple colorati on nearly reaching the apices of the staminal filaments; free portions of t he staminal filaments 2.9-4.0 mm long, 0.50.7 mm wide, linear, commonly greenish yellow except as noted above; anthers 3.2-4.8 mm long, 1.0-2.2 mm wide; styles 4.0-6.5 mm long including stigmas, 0.2-0.5 mm wide, greenish yellow; stigmas 1.1-1.7 mm in diam eter; ovary 2.6-3.1 mm long, 2.0-2.4 mm wide, globose to ovoi d, greenish yellow. Berry (13.0-)17.318.1(-25.0) mm long, (13.0 -)14.3-14.4(-20.0) mm wide, globose, very dark purple with glaucous bloom. Seeds 45-55, obovate in outline, 3.7-4.1 mm long, 2.3-2.6 mm wide, 1.5-1.9 mm thick, acute at both ends, reticulate-foveate with each side

PAGE 369

347 marked with ca. 11-18 foveae. Germinati on epigeal. Chromosome number: 2n=12 (Snow & MacDougal, 1993). Fig. 8.22-8.24. Distribution and Ecology Mxico, in the Pacific lowlands and foothills of Jalisco, Colima, and northern Michoacn. Disturbed tropical deciduous or semideciduous low and medium forests (selva baja caducifolia and selv a mediana subcaducifolia); growing on shrubs, trees, boulders, and rocks (somet imes limestone); sea-level to ca. 610 m. Flowering and fruiting August to November. Additional Specimens Examined Mxico . –COLIMA: Mpio. Tecoman, N of Tecoman, 3.9 mi. NE on Hwy. 110 from junction of road to Tecoman (Hwy. 200), MacDougal & Miley 486 (US); Hwy. 200 between Manzanillo and Tecoman, sea level, 19.77N, 104.78W, Porter-Utley & Mondragn 359 (CICY, FLAS). –JAL ISCO: Mpio. La Huerta, Rancho Cuixmala, road to Cumbres 1 from Station 45, E of t he Puerto Vallarta, B. de Nav. (MEX 200) hw y., 19'N, 104'W, Ayala 1212 (CAS, MO, TEX); Chamela, sendero El Tejn, 19'N, 105'W, 100 m, Gentry & UNAM Tropical Ecology Class 74432 (MO); Estacin de Biologa, Chamela, IBUNAM, Chacahalaca Trail, 90 m, 19.92N, 105.63W, Porter-Utley & Mondragn 353 (CICY, FLAS); At entrance to the Es tacin de Biologa, Chamela, IBUNAM, 80 m, 19.64N, 105.81W, Porter-Utley & Mondragn 357 (CICY, FLAS). – MICHOACN: Mpio. Apatzingn, Tanc itaro Region, Mt. Apatzingn, 2000 ft, Leavenworth & Hoogstraal 1717 (F).

PAGE 370

348 Notes Passiflora juliana is most closely related to P . viridiflora and aside from floral adaptations in P . viridiflora resulting from a shift in pollinators, these two species with greenish yellow flowers borne in conspicuous, indeterminate, terminal inflorescences are very similar. Both species possess large, peltate, trilobed leaves that have a central lobe that is dist inctly narrowed at the base. They both may possess stems that have some red pigmentation, but those of P . viridiflora are generally bright red, while those of P . juliana are commonly reddish purple. Passiflora juliana can also be separated from P . viridiflora vegetatively because that species has small, narrowly ovate st ipules, as opposed to the larger, ovate, foliose stipules of P . juliana . Passiflora juliana bears the shallow cup-shaped flowers typical of most of the me mbers of the super section and subgenus, whereas P . viridiflora possesses long, tubular fl owers with a greatly elongated androgynophore. Passiflora juliana is a very distinctive taxon possessing the shortest floral stipe in supersection Cieca , a limen floor that is distinctly purple and an androgynophore flushed with purple at the base to just above the middle. Controlled self-pollinations performed by MacDougal (1992) produced no fruits in P . juliana , indicating that the species is self-i ncompatible. In addition, he found that no fruits were produced by autogamy duri ng ten years of cultivation. I also found this to be true in my one clone of P . juliana ( MacDougal 492GR ) grown in greenhouses at the Univ ersity of Florida. The light green flowers are likely adapted to a small or medium-sized insect pollinator, but J. M. MacDougal (1992) observed a hummingbird visiting the

PAGE 371

349 flowers of this plant. In an unpublis hed manuscript, MacDougal determined the total sugar concentration measured as sucr ose equivalents in percent weight per total weight to be 35-38% in P . juliana , which is within the range typical for utilization by bees. MacDougal also found that lacebugs and the butterfly Heliconius charitonius are important herbivores. McCormick chromatographically screened leaf samples of P . juliana for flavonoids and found detectable levels of flavonol 3-O-glycosides but not C glycosylflavones (McCormick, 1982).

PAGE 372

350 Figure 8.22. Leaves and flowers of P. juliana ( MacDougal 492 ). Scale bar = 1.0 cm. Photo by J. M. MacDougal. Figure 8.23. Flower of P. juliana ( Porter-Utley & Mondragn 358 ). Scale bar = 5.0 mm.

PAGE 373

351 Figure 8.24. Distribution of P. mcvaughiana , P. juliana and P. viridiflora .

PAGE 374

352 Passiflora viridiflora Description of Passiflora viridiflora 12. Passiflora viridiflora Cav. Ic. Pl. 5: 15. pl. 424. 1799. Tacsonia viridiflora (Cav.) Juss. Ann. Mus. Hist. Nat. 6: 389. 1805. Murucuia viridiflora (Cav.) Spreng. Syst. Veg. 3: 43. 1826. Synactila viridiflora (Cav.) Raf. Fl. Tellur. 4: 104. 1838. Psilanthus viridiflora (Cav.) M. Roem. Fam. Nat. Syn. 2: 143. 1838. TYPE: MXICO, Guerrero, Acapulco, L . Nee s . n . (holotype: MA!; photographs DUKE!, F!, MEXU; isotype: F!). Passiflora tubiflora H. B. & K. Nov. Gen. & Sp. 2: 139. 1817. TYPE: MXICO, Guerrero, Acapulco, A . Humboldt & A . Bonpland s . n . (holotype: P; photograph seen). Slender, climbing or trailing, perenni al vine 3 m long or more, minutely antrorsely appressed-puberulent throughout (except on ovary) with unicellular, curved trichomes, 0.05-0.13 mm long, 0. 02 mm wide. Flowering stems somewhat compressed and two-edged, red (4/12) w hen young, 1.1-2.8 mm in diameter, with the base somewhat woody and cork-covered. Stipules asymmetrically narrowly ovate-falcate, slightly attenuate, longitudinally striate-nerved, 2.5-7.9 mm long, 0.5-1.4 mm wide, often red (5R 4/12) at fl owering nodes; petioles 1.17.6 cm long, inserted 0.4-22. 0 mm from the basal margin s of the peltate blades,

PAGE 375

353 often red (4/12) at flower ing nodes, commonly bearing in the proximal third, 0.120.33(-0.55) of the distance fr om the base toward the apex of the petiole, 2, round or elliptic, opposite to subopposite, sess ile or shortly stip itate, saucer-shaped nectaries with flat rims, 0. 9-2.5 mm wide (on the widest axis), 0.3-1.5 mm high. Laminas 3.7-14.1 cm long, 1.6-19.6 cm wide, coriaceous, occasionally variegated, conspicuously peltate, deeply 3lobed 0.60-0.82 of the distance to the leaf base, lateral lobes oblong to obovate, acute to rounded, 1.6-10.6 cm long, 1.0-5.8 cm wide, central l obes obovate, acute to rounded, 1.9-14.1 cm long, 1.06.5 cm wide, narrowed at base, angle betw een the lateral lobes 117-180, ratio of lateral to central lobe length 0.60-1.34, margins entire, thickened, often red (4/12), primary veins 3, diverging and branching above base, laminar nectaries present or absent (rare), (0-)4(-7), subm arginal, associated with the minor veins of the abaxial surface, 0.3-1.1 mm in diam eter, elliptic, sessile ; tendril 0.3-1.1 mm wide, present at flowering node, absent in inflorescence. Flowers borne in leaf axils or terminal inflorescences; inflor escences 11.6-19.2 cm long, associated reduced laminas 7.3-11.3 mm long, 0.8-1. 9 mm wide. Pedicels 7.5-25.0 mm long, 0.6-1.3 mm wide, paired in the leaf axils, often red (5R 4/12); bract(s) absent; spur(s) absent. Tubular flowers 5. 1-8.6 mm in diameter with stipe 4.511.4 mm long, 0.9-1.5 mm wi de, greenish yellow (5GY 8/6); hypanthium 5.1-8.6 mm in diameter; sepals 20.5-30.1 mm l ong, basally connate 5.8-15.4 mm, 1.33.9 mm wide, linear to narrowly ovate, acute to rounded, abaxially and adaxially greenish yellow (5GY 8/6), free portions of sepals reflexed at anthesis; petals absent; coronal filaments in 1 series, adnat e to the calyx tube until they become

PAGE 376

354 free, 36-50, 2.2-4.0 mm l ong, basally connate 1.22.5 mm, 0.1-0.4 mm wide, linear to narrowly ovate, erect, greenish yellow, ratio of coronal (portion not adnate to sepal) to sepal (free portion) l ength 0.09-0.35; rarely a trace second coronal row of colorless filaments ma y be present just outside the operculum; operculum 3.0-4.6 mm long, plicate, gr eenish yellow, the margin with narrow minutely fimbrillate teeth; nectary 0.3-3. 1 mm high, 1.1-2.0 mm wide, sulcate; limen erect, 0.8-1.7 mm high, 0.1-0.5 mm wide, greenish yellow, crenulate-lobed, very close to the base of the andr ogynophore, limen floor 0.6-2.1 mm in diameter, greenish yellow; androgynophor e 17.4-26.1 mm long, 0.6-1.1 mm wide, greenish yellow; free portions of t he staminal filaments 2.6-5.3 mm long, 0.3-0.7 mm wide, linear, gr eenish yellow; anthers 4.05.9 mm long, 0.6-2.4 mm wide, pollen presented laterally; styles 3.16.2 mm long including stigmas, 0.2-0.5 mm wide, greenish yellow; stigmas 0.9-1. 7 mm in diameter; ovary 2.2-5.3 mm long, 1.1-3.5 mm wide, ellipsoid to fusi form, greenish yellow, glabrous. Berry 15.5-24.0 mm long, 12.9-19.0 mm wide, fusi form to ovoid, very dark purple. Seeds 39-53, flattened, obovate in outline, 4.0-5.0 mm long, 2.4-3.6 mm wide, 1.4-2.0 mm thick, acute at both ends, reticulate-foveate with each side marked with 15-18 foveae, sometimes pale in colo r at maturity. Germination epigeal. Fig. 8.24-8.26. Distribution and Ecology Mxico, in the Pacific lowlands and foot hills of southern Michoacn, Guerrero and Oaxaca. Disturbed tropical deciduous or semideciduous low and medium forests (selva baja caducifolia and selv a mediana subcaducifolia); growing on

PAGE 377

355 shrubs, small trees, boulders and rocks (som etimes limestone) on very limited to moderately developed soils; sea-level to ca. 610 m. Flowering and fruiting throughout the year. Vernacular Names Flor de aretillo and uva monta. Additional Specimens Examined Mxico . –GUERRERO: Acapulco, mountainous, Barclay 1966 (BM); above Hotel Papagayo, 1 mi. E of Acapulco, Barkley 14062 (F, TEX); Mpio. Zihuatanejo, Playa Majahua, W de Baha de Zihuatanejo, 17 40'N, 101 34'W, 30 m, Castillo & Zamora 6302 (XAL); Mpio. Zihuatanejo, Cerro el Rialito, base O entre punta Ixtapa & el Rialito, Castillo , Zamora & Moreno 6599 (XAL); Puerto Marques, Chiang , Lopez-Forment , Tellez & Medelln 721 (DUKE); Puerto Marques, col. al lo largo del camino O, por las residencias, Forment 775 (XAL); 2.5 km W Puerto Marques, Forment 1125 (UC, XAL); Acapulco, Haenke 873 (PR); Dist. Galeana, Atoyac, 20 m, Hinton 10999 (GH, US); 25 mi. E of Acapulco, Johnson 725-79I (MO); Mpio. Acapulco, Cascada de Chorro, 73 km S de Chilpancingo por la carretera a Acapulco, 280 m, Koch , Fryxell & Wendt 79191 (DUKE, NY); Mpio. Acapulco, 3 km W de Cuarenta y Dos, 27 km N de Acapulco (Glorieta Diana) sobre la terraceria al la Estacin de Microondas 42 & La Providencia, 610 m, Koch , Fryxell & Wendt 79221 (CHAPA, DUKE); Mpio. Tecpan, 22 km W de San Luis de La Loma, a 3 km S de Papanoa, carr. Acapulco-Zihuatanejo, Ladd 212 (CAS, MO); Ruta 95 Acapulco a Mxico, ca 19

PAGE 378

356 km N de Acapulco por camino, 250 m, Lorence , Miller & Cedillo 3830 (CAS, F, MO); Acapulco, en los arbustos del chaparral, 100 m, Lyonmet & Chavez 3279 (US); Mpio. Acapulco, Acapulco-Pinot epa Nacional, km 32 E de Acapulco, Martnez & Tellez 87 (CAS, HUA, MO); along road to El Tamarindo, 6 km from Mex Hwy. 200 between Acapulco and San Marcos, 140 m, Miller & Tenorio 567 (MO); between Juchitn & Ometepec, 300-1000 ft., Nelson 2317 (US); Acapulco, Palmer 207 (F); Acapulco, Palmer 237 (BM, F, GH, MO, NY, UC, US); Side of Hwy. 200 between Lazaro Carden as and Zihuatanejo, 50 m, Porter-Utley & Mondragn 366 (FLAS); Side of Hwy. 200 overlooking the ocean between Petatln and Atoyac Alvarez, 20 m, Porter-Utley & Mondragn 371 (FLAS); Side of Hwy. 200 between Acapulco and San Marcos, 50 m, Porter-Utley & Mondragn 374 (FLAS); 3 km NE de Coyuquilla, Mpio. Petatln, 90 m, Soto , Roman & Solorzano 12503 (F); just inland from Acapulco, along hwy. 95 about 25 mi. N of the city, Taylor 2667 (DUKE); Mpio. Zihuat anejo, 15 km NE de Zihuatanejo, por la carretera Zihuatanejo-Ciudad Altamirano, 70 m, Tenorio , Martnez & Romero 384 (MO); mountains 20 mi. NE of Acapulco, F.A. Barkley, Webster & Paxson 17M751 (TEX, US). –MICHO ACN: Hwy. 200 between El Faro and Maruata, 20 m, 18.31N, 103.60W, Porter-Utley & Mondragn 362 (FLAS); 4 km NE de Playa Azul , carr. a Nueva Italia, 150 m, Soto Nunez & Boom 2101 (US); 8 km NW de Caleta de Campos, Mpio. de Lazaro Cardenas, 40 m, Soto Nunez & de Soto 3756 (CHAPA, MO, XAL). –OAXACA: Tuxtepec, 100 m, Conzatti 4501 (NY, US); E and below La Soledad, Ernst 2561 (US); Furgensen 154 (OXF); Dist. Jamiltepec, a 6 km NW de Pinotepa Nacional por

PAGE 379

357 carretera a Acapulco, 240 m, Hernndez & Torres 431 (MO); Dist. Juquila, Puerto Escondido, 0.1 m N of Rt. 200, MacDougal 349 (DUKE, US); Dist. Juquila, 5 mi. NW of Puerto Escondido along Rt. 200, MacDougal 350 (DUKE, US); Dist. Juquila, Puerto Escondido, 150 m SE down coast from town, on rocky peninsula 15 m above ocean, MacDougal 351 (CHAPA, DUKE, US); between Mixtepec & Colotepec, 250-800 ft., Nelson 2446 (GH, US); Pochutla, Popenoe 818 (NA); Pochutla, 90 m, Reko 3753 (US); along the Pacific coast, just W of Puerto Escondido in the Carrazillo Trailer Park, sea-level, Taylor 2663 (DUKE); 27 km SW del Morro Mazatln, carr. Salina Cruz-Pochutla, Dist. de Tehuantepec, Torres , Cedillo , Rico & Torres 549 (DUKE). Notes Passiflora viridiflora has been placed at various generic (e.g., Murucuia ) and infrageneric levels (e.g., subg. Chloropathanthus ) within the family Passifloraceae. The elongated, tubular fl owers of this ta xon inspired many previous workers to group it with other ta xa that possess tubular flowers or in a group of its own because t he flowers are not only tubul ar but also apetalous. Killip (1938) placed it in the subgenus Chloropathanthus with P . lancifolia , an apetalous Jamaican endemic. MacDougal (1983) was the first to suggest that P . viridiflora be placed within Cieca based upon its apetalous flowers and flavonoid chemistry. In 1992, MacDougal resolved the placement of P . viridiflora by describing P . juliana , a species clearly referable to Cieca and morphologically similar to P . viridiflora . Both the molecular and morphol ogical data in this study also show that P . juliana and P . viridiflora are sister species.

PAGE 380

358 Vegetatively, P . viridiflora and P . juliana are very similar, and the most obvious difference between them is the size and shape of their stipules. However, P . viridiflora also differs from P . juliana in its adaptations for hummingbird pollination including: vegetative parts that are co mmonly accentuated with or entirely bright red, a greatly elongated androgynophore that far exc eeds the length of the stamen filaments, no inner coronal filaments, a very narrow limen floor, wide floral nectary, long operculum that is not incurved at the margin but erect and lays against the androgynophore, fused sepal s that are greatly elongated, pollen that is presented laterally, and a sulcate floral nectary floor. MacDougal, in an unpublished paper on the morphology and vascular anatomy of the node of P . viridiflora , found that the nodal anatomy with regard to the vascular tissue of this species is consis tent with the view th at the tendril is a modified axillary branch or shoot system, as established previously by Cussett (1968). MacDougal also concluded t hat the close asso ciation of the vascularization of the flower peduncles with the tendril point to the fact that the tendril is part of an inflorescence. Limited artificial se lf-pollinations of P . viridiflora performed by MacDougal in the greenhouse failed to produce fruits. However, MacDougal was able to successfully cross P . viridiflora with P . megacoriacea , P . mcvaughiana , P . pallida , P . trinifolia , P . filipes , and P . macfadyenii . On an herbarium specimen colle cted by W.L. Forment ( 1125 ), he indicated that P . viridiflora is utilized by hummingbirds, whic h is consistent with its floral morphology and lack of floral fragrance.

PAGE 381

359 McCormick (1982) chromatographically screened leaf samples of P . viridiflora for flavonoids and found detectable levels of flavonol 3-O-glycosides but no C glycosylflavones. Figure 8.25. Flowers of P. viridiflora ( MacDougal 351 ). Scale bar = 5.0 mm. Photo by J. M. MacDougal.

PAGE 382

360 Figure 8.26. Leaves and bright red stem of P. viridiflora ( Porter-Utley & Mondragn 362 ).

PAGE 383

361 Passiflora mcvaughiana Description of Passiflora mcvaughiana 13. Passiflora mcvaughiana J. M. MacDougal. Novon 11: 69-75. figs. 1 & 2. 2001. TYPE: MXICO, Mxico, Mpio. Temascaltepec, N of Temascaltepec on rte. 134, ca. 11 mi. S of road to Teques quipn, 6200 ft., oak woods, 24 Aug. 1978 (fl), J . M . MacDougal 369 (holotype: DUKE!; is otypes: IBUG, MEXU). Slender, low-climbing or trailing, per ennial vine 8 m long or more, sparsely pubescent with unicellular curved trichom es on petiole, leaf, stem, and stipule (rare), 0.3-0.6 mm long, 0.02 mm wide, also minutely antrorsely appressedpuberulent throughout (except ovary) with un icellular, curved trichomes, 0.1-0.3 mm long, 0.02-0.03 mm wide. Flowering st ems terete or some what compressed, 0.9-2.6 mm in diameter, with the base woody and cork -covered. Stipules narrowly ovate, acute to slightly attenuat e, longitudinally stri ate-nerved, 3.8-7.5 mm long, 0.3-0.8 mm wide; petioles 0.8-5.3 cm long, inserted 1.1-6.9 mm from the basal margins of the peltate blades, egl andular or rarely with 1 or 2, round or elliptic, opposite to subopposite, sessile or shortly stipitate, discoid nectaries with flat rims, 0.8-1.3 mm wide (on the widest axis), 0.4-1.3 mm high, borne just below (rare) or in the distal half of the petiol e (0.45-0.86 of the di stance from the base toward the apex of the pet iole). Laminas 0.9-7.3 cm long, 6.2-22.0 cm wide, coriaceous, occasionally variegated along pr imary veins, conspicuously peltate, transversely elliptic (widely divaricately b ilobed), lateral lobes elliptic, acute to

PAGE 384

362 slightly attenuate, 3.1-12.0 cm long, 1.0-5.6 cm wide, c entral vein 0.7-6.8 cm long (measured from point of petiole insertion), angle between the lateral lobes 101182(-190), ratio of lateral lobe to centra l vein length 1.15-4. 57, margins entire, hyaline, primary veins 3, diverging and branching above base, laminar nectaries absent, associated with the minor veins of the abaxial surface, 0.8-1.1 mm in diameter, sessile; tendril 0. 3-1.0 mm wide, present at flowering node, absent in inflorescence. Flowers borne in leaf axils or rarely in inflorescences; inflorescences 2.5-5.8 cm long, asso ciated reduced laminas 1.3-2.3 mm long, 0.5-1.0 mm wide. Pedicels 5.6-25.0 mm long, 0.3-0.6 mm wide, (1-)2 per node; bract(s) absent or with one or two, narrowly ovate, acute bracts , 1.1-1.2 mm long, 0.1 mm wide, the bracts ca. 3.7 mm from base of peduncle; spur(s) absent. Flowers 15.0-25.3 mm in di ameter with stipe 3.1-9.0 mm long, 0. 5-0.7 mm wide; hypanthium 5.0-8.3 mm in di ameter; sepals 6.7-8.5 mm long, 3.3-5. 6 mm wide, ovate-triangular, acute, abaxially and adax ially greenish yellow, reflexed at anthesis; petals absent; coronal filaments in 2 series, the outer 31-36, 3.1-7.1 mm long, 0.3-0.7 mm wide, li near to slightly narrowly obovate, erect, dull purple (5P 4/6) at base, yellow at tips, ratio of outer coronal row to sepal length 0.410.89, the inner 40-60, 1.3-2.9 mm long, 0. 1-0.3 mm wide, linear, capitate, erect, greenish yellow speckled with dull purple, ratio of inner coronal row to outer coronal row length 0.20-0.56; operculum 1.01.8 mm long, plicate, whitish green, the margin with narrow minutely fimbrillate teeth; nectary 0. 2-1.1 mm high, 0.61.0 mm wide; limen inclined away from androgynophore, 0.20.7 mm high, 0.20.5 mm wide, whitish green, speckled wit h purple, limen floor 2.5-4.9 mm in

PAGE 385

363 diameter, whitish green, speckled with purple; andr ogynophore 1.5-4.7 mm long, 0.9-1.3 mm wide; free portions of the staminal filaments 2.1-3.3 mm lo ng, 0.4-0.8 mm wide, linear, greenish yellow anthers 1.7-3.2 mm long, 0.7-1.7 mm wide, greenish yellow with a dar k purple edge; styles 2. 7-4.9 mm long including stigmas, 0.3-0.5 mm wide, greenish yellow; stigmas 0.6-1.3 mm in diameter; ovary 1.3-3.6 mm long, 1.13.0 mm wide, widely ellipso id to ovoid, greenish yellow. Berry 10.0-14.4 mm long, 12.8-13. 8 mm wide, globose, very dark purple. Seeds (2-)6-11, widely elliptic to widely obovate in outline, 4.8-5.5 mm long, 3.64.1 mm wide, 2.1-2.7 mm thi ck, obtuse at both ends, reticulate-foveate with each face marked with 15-22 foveae. Fig. 8.24 and 8.27-8.28. Distribution and Ecology Mxico, in the states of Jalisco, M xico, and Guerrero. Pine and oak forests (bosque de pino y encino) or montane meso phytic forests (bosque mesfilo de montaa); growing in trees and on the steep banks of canals (barrancas) or streams, and moist hillsides; 1100-2000 m. Flowering and fruiting June to December. Additional Specimens Examined Mxico . –JALISCO: caada que sube al Filo de la Vaca, por la toma de agua, El Zarzamoro, 1980 m, Cuevas & Guzman 4198 (CHAPA); San Sebastian, trail to El Ranchito, 1500 m, Mexia 1448 (CAS, F, US). –MXICO: Temascaltepec, Rincn, 1960 m, Hinton 3030 (BM,US); Temascaltepec, Rincn, 2000 m, Hinton 4655 (BM); Hwy. 134 between Tema scaltepec and Tejupilco,

PAGE 386

364 1760 m, 19.46N, 100.95W, Porter-Utley & Mondragn 345 (CICY, FLAS); Hwy. 134 between Temascaltepec and Tejupilc o, seedling, 1760 m, 19.46N, 100.95W, Porter-Utley & Mondragn 346 (CICY, FLAS). –LOCALITY UNKNOWN: Sess & Mocio 4457 (AAU, F); Sess & Mocio 4458 (F). Notes Passiflora mcvaughiana is one of three species found in southwestern Mxico previously known under the name of P . coriacea Juss. The other two species are Passiflora obtusifolia and P. tacana , which are both extremely similar vegetatively to P . mcvaughiana . Passiflora mcvaughiana can usually be separated from P . obtusifolia because P. mcvaughiana commonly has a central leaf lobe that is nearly as long as the la teral lobes at fertile nodes, as opposed to having lateral lobes that are commonly twice as long as the central lobe in P . mcvaughiana . Passiflora obtusifolia is commonly 3-lobed more than 0.20 the distance to the base, as opposed to 3-lobed less than 0.20 the distance to the base in P . mcvaughiana . Passiflora mcvaughiana lacks laminar nectaries, whereas P . obtusifolia commonly has 2-6 nectaries present between the primary leaf veins. Flowers are rarely produced in inflorescences in P . mcvaughiana , but P . obtusifolia commonly has very long inflorescences. The pedicel in P . mcvaughiana is longer than 10 mm, but the pedicel in P . obtusifolia is commonly less than 10 mm long. The out er coronal filaments of P . mcvaughiana are longer than 4.0 mm, linear, and dull purple toward their bases, those of P . obtusifolia are commonly less than 4.0 mm long, linear/c apitellate and greenish yellow or greenish yellow with a flush of reddish purple at the base. Passiflora

PAGE 387

365 mcvaughiana possesses the widest seeds in the supersection (over 3.6 mm wide) and P . obtusifolia has seeds that are less than 2.3 mm wide. Additionally, P . mcvaughiana and P . obtusifolia occupy different habitats, with P . obtusifolia commonly occurring in lower elevation tropical deciduous or semideciduous forests in Pacific lowlands and foothills and P . mcvaughiana in high elevation oak, pine/oak, pine or montane me sophytic forests of Mxico. Passiflora tacana is a newly discovered species from Volcn Tacan, Chiapas, Mxico. Like P . mcvaughiana , it occurs in montane mesophytic forests. However, P. tacana is easily separated from P . mcvaughiana by its foliose stipules that are more than 3 mm wide. The fruits of P. tacana also possess ca. 20 seeds, whereas those of P . mcvaughiana produce only 2-10 seeds. Passiflora mcvaughiana is also quite similar vegetatively to P . sexocellata , though this species does not occur in southwestern Mxico. The leaves of P . mcvaughiana are not as coriaceous as those of P . sexocellata and are darker green. In addition, P . sexocellata always possesses 4-13 laminar nectaries often with 2-4 of the nectaries occu rring proximal to the lateral leaf veins. The petiolar nectaries of P . sexocellata are commonly positioned on t he proximal half of the petiole, whereas those of P . mcvaughiana are positioned on the distal half of the petiole. Flowers are often produc ed in long inflorescences in P . sexocellata , and P . mcvaughiana commonly lacks inflorescences. The fruits of P . sexocellata are also much larger than those of P . mcvaughiana and possess between 40 and 50 seeds per fruit.

PAGE 388

366 MacDougal attempted limited (less than ten) artificial self-pollinations of Passiflora mcvaughiana without success. However, P . mcvaughiana did cross with several other members of the supersection including P . megacoriacea , P . viridiflora , P . trinifolia , P . pallida , and P . suberosa . McCormick (1982) chromatographically screened leaf samples of P . mcvaughiana for flavonoids and did not find det ectable levels of flavonol 3-Oglycosides or C -glycosylflavones. Figure 8.27. Leaves, flower and fruit of P. mcvaughiana ( Porter-Utley & Mondragn 345 ). Scale bar = 1.0 cm.

PAGE 389

367 Figure 8.28. Fruit and seeds of P. mcvaughiana ( Porter-Utley & Mondragn 345 ). Scale bar = 1.0 cm. Passiflora tacana Description of Passiflora tacana 14. Passiflora tacana K. Porter-Utley. Sp. nov . TYPE: MXICO, Chiapas, Mpio. Unin Jurez, Volcn Tacan, ent re Talquin & Tonin, 1700-2700 m, 7 May 1987, E . M . Martnez S . 20782 (holotype: MEXU!). Passiflora scandens; stipulae 2.5-3.5 mm la tae; petioli in parte medium vel in parte infra medium bigl andulosi; folia peltata , bilobata , basi cordata , lobis lateralibus acutis vel raro attenuatis , lobis centralibus obtusis , marginibus integris; pedunculi ebracteatis; stipites fructum 6.9-8.5 mm longi; fructus ellipsoidei ad globosi; se mina 4.6-4.9 mm longa , 2.9-3.1 mm lata , retifoveata.

PAGE 390

368 Vine, pubescent with unicellular curved trichomes on petiole, adaxial leaf surface, and stipules 0.28-0.38 mm long, 0.03 mm wide, also minutely antrorsely appressed-puberulent throughout with unicell ular, curved trichomes, 0.06-0.08 mm long, 0.02 mm wide. Flowering stems terete or somewhat compressed, 1.51.8 mm in diameter. Sti pules ovate, acute to acum inate, 6.3-7.5 mm long, 2.53.5 mm wide; petioles 2.3-2. 6 cm long, commonly beari ng at or just below the middle (0.44-0.50 of the distance from the base toward the apex of the petiole) 2, elliptic, opposite to subopposite, sessile, di scoid nectaries with the rims slightly raised, 1.0-1.1 mm wide (on the widest ax is), 0.5-0.6 mm high. Laminas 3.8-5.3 cm long, 12.4-14.2 cm wide, membranous, subpeltate or slightly peltate (the distance from leaf base to point of petiole insertion 1.0-1.7 mm), transversely elliptic, 3-lobed 0.02-0.10 of the distance to the leaf base at the deepest sinus, lateral lobes elliptic, acute to attenuate, 6.9-7.5 cm long, 2.64.2 cm wide, central lobe elliptic or present as an obtuse to r ounded tip, central vein 3.7-5.2 cm long (measured from point of pet iole insertion to the leaf apex), angle between the lateral lobes 109-130, ratio of lateral lobe to central vein length 1.41-1.86, margins entire, hyaline, primary vein s 3, diverging and branching above base, laminar nectaries absent; t endril 0.7-0.9 mm wid e, present at flowering node. Pedicels 11.9-13.0 mm long in fruit, 0.5 mm wide, paired in the leaf axils; bract(s) absent. Flowers not seen. Stipe 6.9-8. 5 mm long in fruit, 0. 5-0.6 mm wide. Berry 25.0-26.0 mm long, 24.0-26.0 mm wi de, ellipsoid to globose, very dark purple. Seeds ca. 20, obovate in outline, 4.6-4.9 mm long, 2.9-3.1 mm wide, 2.0-

PAGE 391

369 2.1 mm thick, acute at both ends, reti culate-foveate with each face marked with ca. 22-26 foveae. Fig. 8.29-8.30. Distribution and Ecology Mxico, in the state of Chiapas. Bosque mesfilo de motana, 1700-2700 m altitude. Flowering and fruiting May. Additional Specimen Examined Known only from type specimen. Notes Passiflora tacana is known only from the locality and though Martnez ( Martnez 20782 ) states that the flowers are purple, the specimen does not possess flowers and I have not been able to lo cate any duplicates. It was found in montane mesophytic forests on Volcn Tacan in southwestern Mxico and was collected in May during the rainy season. Passiflora tacana is very similar to P . eglandulosa , which grows on the adjacent Volcn Santa Mar a of Guatemala. T he mature leaves of P. tacana greatly resemble the juvenile leaves of P . eglandulosa and are trilobed, with the middle lobe greatly reduced and widely obtus e to truncate. The laminas are also cordate and eglandular, and both of these species possess wide foliose stipules. However, P. tacana possesses petiolar glands posit ioned near the middle of the petiole, whereas P . eglandulosa does not possess petiolar glands. In addition,

PAGE 392

370 the fruits of P. tacana possess more seeds and the chalazal and micropylar ends of the seed are inclined toward the raphe. Figure 8.29. Distribution of P. tacana , P. sexocellata , P. megacoriacea and P. coriacea .

PAGE 393

371 Figure 8.30. Habit of P. tacana ( Martnez 20782 ). Scale bar = 1.0 cm.

PAGE 394

372 Passiflora coriacea Description of Passiflora coriacea 15. Passiflora coriacea Juss. Ann. Mus. Natl. Hist. 6: 109. pl. 39, fig. 2. 1805. Monactineirma coriacea (Juss.) Bory. Ann. Gn. Sc i. Phys. 2: 138. 1819. Cieca coriacea (Juss.) M. Roem. Prospect Fam. Nat. Syn. Monogr. 2: 148. 1846. TYPE: COLOMBIA, Tolima, Santa Fe, near Honda, A . Humboldt & A . Bonpland s . n . (holotype: P!, photograph AAU!, is otype: P!, photographs AAU!, DUKE!). Passiflora clypeata Sm. in Rees. Cycl. 26: Passiflora no. 20. 1814. LECTOTYPE (designated by E.P. Killip, 1938, Field Mus. Nat. Hist., Bot. Ser. 19: 85): COLOMBIA, J . Mutis s . n . (LINN 1070.16, microfiche seen). Passiflora difformis Kunth in Humboldt, Bonpland and Kunth. Nov. Gen. Sp. 2: 136. 1817. Cieca difformis (Kunth) M. Roemer. Prospect Fam. Nat. Syn. Monogr. 2: 140. 1846. TYPE: COLO MBIA, El Moral, Quindo Trail, A . Humboldt & A . Bonpland s . n . (holotype: P, photograph AAU!, isotype: B, destroyed, P, photograph AAU!).

PAGE 395

373 Passiflora cheiroptera Corts, Fl. Colomb. ed. 2, plate between pages 112 and 113. 1919. LECTOTYPE (designated here) : COLOMBIA, Corts Fl. Colomb. ed. 2, plate between pages 112 and 113. 1919. Slender, climbing, perennial vine 2-8 m l ong or more, sparsely pubescent with unicellular curved trichomes on petiole, leaf, stem and stipule, 0.20-0.64 mm long, 0.02-0.03 mm wide, also minutel y antrorsely appressed-puberulent throughout with unicellular, curved tric homes, 0.03-0.10 mm long, 0.02-0.03 mm wide. Flowering stems greenish yellow (5GY 8/4) to reddish purple (5RP 4/6), terete to somewhat comp ressed, 1.0-2.9 mm in diam eter, with the base woody and cork-covered. Stipules narrowly ovat e-triangular, acute, 2.6-7.5 mm long, 0.4-1.0 mm wide; petioles 1.1-4.3 cm long, with 2 (rarely 3), opposite to subopposite, sessile, discoid nectaries wit h flat rims, 1.1-2.1 mm wide (on the widest axis), 0.1-1.5 mm high, borne in t he proximal two thirds of the petiole (0.21-0.64 of the distance from the base toward the apex of the petiole). Laminas 2.8-5.9 cm long, 6. 2-18.8 cm wide, coriaceous, pelta te (the distance from leaf base to point of petiole insertion 1.611.4 mm), transversely elliptic (widely divaricately bilobed) or sometimes 3lobed, lateral lobes elliptic, acute to attenuate, 3.3-9.5 cm long, 1.8-7.3 cm wide, central lobe elli ptic to obovate or present merely as a widely acute to obtuse tip (rarely retuse), central vein 1.8-6.4 cm long (measured from point of petiole insertion to the leaf apex), angle between the lateral lobes (97 -)110-160(-170), ratio of late ral lobe to central vein length 1.36-2.61, margins entire, hyal ine, primary vein s 3, diverging and

PAGE 396

374 branching above base, laminar nectaries pr esent, 5-13, submarginal, associated with the minor veins of the abaxial surfac e, with 2-4 nectaries proximal to the lateral leaf veins, 0.7-1.3 mm in diamet er, circular to widely elliptic, sessile; juvenile leaves bilobed and variegated; tendril 0.3-0.9 mm wide, present at flowering node, absent in inflorescenc e. Flowers borne in leaf axils or inflorescences; inflorescences 2.5-6. 5(-12.0) cm long, associated reduced laminas 2.5-5.0 mm long, 1. 5-2.8 mm wide. Pedicels 2.2-8.1 mm long, 0.4-1.1 mm wide, 2 per node; bract(s) absent; spur (s) absent. Flowers 18.0-30.0 mm in diameter with stipe 6.3-15. 1 mm long, 0.7-1.0 mm wide; hypanthium 4.9-7.4(-8.1) mm in diameter; sepals 5.8-10.9 mm long, 3.3-6.4 mm wide, ovate-triangular, acute to rounded, abaxially and adaxially greenish yellow (5GY 8/4); petals absent; coronal filaments in 2 series, the outer (36-)49-53, 3. 1-5.3(-7.0) mm long, 0.2-0.5 mm wide, linear, spreading, dark re ddish purple at base (5RP 3/6-4/6), medium reddish purple just below the mi ddle (5RP 4/4-5/4), light reddish purple (5RP 6/6-6/8) just above middle and white on the distal third, ratio of outer coronal row to sepal length 0.43-0.76, the inner 33-50, 1.43.2 mm long, 0.20.5(-0.7) mm wide, linear, capitate, er ect, dark reddish purple (5RP 3/6), lightening slightly towards tips, ratio of inner coronal row to outer coronal row length (0.29-)0.44-0.63(-0.72); operculum 1. 3-2.0(-4.3) mm long, plicate, reddish purple (5RP 3/6-4/6), the ma rgin with narrow minutely fi mbrillate teeth; nectary 0.2-0.5(-1.5) mm high, 0.7-1.1 mm wide; limen recurved or sometimes erect, 0.20.5(-0.7) mm high, 0.1-0.4 mm wide, r eddish purple (5RP 3/ 6-4/6), limen floor 2.0-3.5(-4.7) mm in diameter, pale greeni sh yellow with reddish purple (5RP 3/6-

PAGE 397

375 4/6) spots and streaks; androgynophore (3.3-)3.8-5.0 mm long, 1.0-1.5 mm wide, pale greenish yellow (5GY 8/2) with r eddish purple (5RP 3/6-4/6) spots and streaks; free portions of the staminal filaments 2. 4-3.2 mm long, 0.5-1.1 mm wide, linear, greenish yellow; anthers 1.9-3.9 mm long, (0.6-)0.9-2.3 mm wide; styles 3.2-4.6 mm long including stigma s, 0.2-0.5 mm wide, greenish yellow; stigmas 0.6-2.2 mm in diam eter; ovary 1.7-2.9 mm long, 1.5-2.5(-4.0) mm wide, widely ellipsoid to globose, greenish ye llow. Berry 17.1-21. 0 mm long, 12.0-19 mm wide, globose, very dark purple (5P 2. 5/2). Seeds ca. 44-61, obovate in outline, 3.6-4.0(-5.0) mm long, 2.1-2.5 mm wide, 1.5-1.8 mm thick, acute at both ends, reticulate-foveate with each side marked with ca. 15-17 foveae. Chromosome number 2n=12 (Diers, 1961). Fig. 8.29, 8.31-8.32. Distribution and Ecology Bolivia, in the department of La Paz; Colo mbia, in the divisions of Antioquia, Bolvar, Caldas, Choc, Cundinamarc a, Huila, Magdalena, Santander, Tolima, and Valle; Ecuador, in the province of Es meraldas; Per in the departments of Cuzco, Junn, Madre de Dios, San Martn; Venezuela in the st ates of Falcn, Lara, Yaracuy, Zulia; reported once from Guyana ( Lejos 43 , B, destroyed). Growing in shrubs and small trees in secondary successional areas, along the edges of moist tropical forests near rivers and streams, and al ong the seashore, 0-1500 m. Flowering and frui ting throughout the year.

PAGE 398

376 Vernacular Names Ala de murcilago (Colombia), basus acha (Per), bejuco de blatijito (Colombia), desjarreladera (Colombia), granadillo de indio (Colombia), uchu anquirisi (Per). Ethnobotany Timothy Plowman in a note on a s pecimen collected by him in 1976 ( T. Plowman 6029 ), noted that in Per a medicine for the liver is prepared from P. coriacea by boiling the whole plant and then drinking the syrup. Additional Specimens Examined Bolivia . –LA PAZ: Rurrenabaque, S an Buena Ventura, 1000 ft., Cardenas 1196 (GH, US); Prov. Alto Beni, Chaco, cerca de Santa Ana de los Mozetenes, 450 m, Seidel & Schulte 2525 (TEX). Colombia . –ANTIOQUIA: Mpio. Yolomb, Vereda La Cancana, 35 km de Am alfi a Medelln, Cordillera Central, 960 m, Betancur , Rolda & Escobar 727 (HUA, MO); Escobar & Roldan 8675 (HUA); Mpio. Giraldo, 1 km del pueblo hacia Santa Fe de Antioquia, 1800 ft. alt., Lehmann 2777 (BM); Mpio. Tamesis, entre la carretera que va a La Pintada a Puente Iglesias, 700-800 m, Posada 27 (HUA); Bolombolo, Venecia, 700 m, Renteria & Curso de Fitogeografia 3679 (F); Bolombolo, 545 m, Renteria & curso de Fitogeografia 3664 (HUA); Dabeiba, 500 m, Santa & Brand 776 (HUA); Mpio. Salgar, along road to Salgar , 4 km from Bolombolo, Bolvar Road, 900 m, Zarucchi , Brant & Betancur 6102 (FLAS, HUA, MO). –BOLVAR: vicinity of Cartagena, Heriberto 392 (US). –CALDAS: Entre Aranca & Manizales 35 km de

PAGE 399

377 Manizales, 1500 m, Escobar & Uribe 483 (HUA, LL); carretera a Manizales por La Felisa, quebrada Despensa, Filadelfia, 800 m, Hoyos & Santa 169 (F, HUA); Manizales, Wayside, near Ro Guac aica, W of Manizales, 1000-1500 ft., Pennell 10190 (GH, PH, US). –CHOC ”: Cerca a Buga, 1050 m, Espinal 2041 (ECON); carretera San Jos del Palmar, ca. 5-10 km de Ansermanuevo, 950-1000 m, Forero , Gentry , Sugden & Daly 3580 (MO); Mpio. Rosucio, Parque Nal. Nat. Los Catios, camino Tilupo Peye, Quebrada Peye, 40 m, Forero & Jaramillo , Len 1770 (MO). –CUNDINAMARCA: Poblacin de Nario, bosque donde finaliza la carretera de los Mangos, 350-450 m, Fernndez , Jaramillo & Pinzon 5480 (MA); Tocaima to Girardot, 500 m, Garcia-Barriga 21224 (US); Quebrada Carmargo, N of Apulo, 460-480 m, Killip , Dugand & Jaramillo 38234 (US); Bogot, La Mesa, 1300 m, Pavon , s . n . (BM); Mpio. Guaduas, carre tera Honda-Guaduas, llegando a Guaduas, 1080 m, Santa & Buitrago 869 (HUA); Bogot, La Mesa, 1300 m, Triana , s . n ., 1851-1857 (BM); Nilo, 510 m, unknown collector s . n ., July 1930, (US). –HUILA: Altamira, 1040 m, Garcia-Barriga 18186 (F, GH, US); about 5 km N of Villavieja; upper basin of Ro Magdalena, 500 m, Mason 13808 (UC); Foothills E of Guadalupe, W margin of Cordillera Oriental, 950 m, Mason 13918 (UC). –MAGDALENA: carretera entre Santa Marta & San Lorenzo, Torre de Televisin, 1000 m, Escobar & Santa 3466 (HUA); about 8 km N of Codazzi, 250 m, Haught 3752 (S, US); about 8 km N of Codazzi, 250 m, Haught 13808 (US); Flanco N de la Sierra Nevada de Santa Marta, Romero 761 (US); alrededores de San Andrs, 100-1300 m, Romero-Castaneda 7607 (AAU). –SANTANDER: between Nario and El Tambor, 150-300 m, Killip & Smith 14970 (GH, US);

PAGE 400

378 Bucaramanga and vicinity, 1000 m, Killip & Smith 16343 (GH, US); River Surat valley, between Bucaramanga and El Jaboncillo, 800-1500 m, Killip & Smith 19062 (GH, US); upper Ro Lebrija valle y, NW of Bucaramanga, 400-700 m, Killip & Smith 21156 (US). –TOLIMA: Andes, Cordillera Central, 1250 m, Cuatrecasas 3245 (MA); S of Mariquita, Ro C uamo, Quebrada del Penitente, 380 m, Dugand & Jaramillo-Mejia 4670 (US); Mariquita, 535 m, Escobar , Hoyos & Roldan 4587 (HUA); Cauca, cerca al Ro Paulo, 1100 m, Espinal & Ramos 2636 (HUA); Mpio. Guamo, ca rretera a La Chamba, 450 m, Forero , Jaramillo & Quinones 10031 (MO); Barrio El Topacio, enfrente manzana 1 casa 15, orilla izquierda cafetal, Ibagu, Giron 35 (HUA); Ro Cuello, New Quindo Trial, Cordillera Central, 1000-1500 m, Hazen 9652 (GH, US); Ro Cuello, New Quindo Trial, Cordille ra Central, 1000-1500 m, Killip 9726 (GH, US); Mariquita, 500 m, Schneider 749 (S). –VALLE: Mpio. Tu lu, Corr. Mateguada, Jardn Botnico, 1100 m, Escobar 1045 (HUA); Puerto Caldas Cauca Valley, 860-900 m, Killip & Hazen 11023 (US); Cisneros, 300-500 m, Killip 11442 (GH, US); Cisneros, 300-500 m, Killip 35520 (US); El Valle, "La M anuelita," Palmira, Cauca Valley, 1090-1100 m, Buga, road to Alaska, 1000 m, Murphy 638 (MO, US); Pennell & Killip 6180 (GH); El Valle, quebrada Nueva to Cuchilla, E of Zarzal, Cauca Valley, 1100-1300 m, Pennell , Killip & Hazen 8500 (US); Ro Agua Bonita to Ro Vieja, E of Zarzal , Cauca Valley, 1100-1300 m, Pennell , Killip & Hazen 8581 (GH, PH, US); Mpio. Yotoco, ingenio La Carmelita, seccin San Martn, zona A, dentro de un guadual que esta en medio de la cana, mas o menos una hora de Mediacanoa, 950 m, Ramos , Ramos & Ramos 2811 (MO); Mpio.

PAGE 401

379 Yotoco, hacienda San Martn por la quebrada que limita con la hacienda La Negra, en frente del campamento de I ngenio La Carmelita, seccin San Martn, 1100 m, Ramos & Ramos 2936 (MO); Mpio. Zarzal, hacienda El Medio (carretera Panamericana entre La Paila & Zarzal, parte plana del Valle del Ro Cauca), 950 m, Silverstone-Sopkin , Paz & Larrahondo 3075 (MO); Mpio. El Cerrito, hacienda San Gerardo, parte plana del Valle del Ro Cauca, cerca de frontera con Mpio. Guacar, cerca de pueblo de Guabas, 950 m, Silverstone-Sopkin , Paz , Ramos & Cabrera 3399 (MO); Mpio. El Cerrito, haci enda San Gerardo, muy cerca de frontera con Mpio. Guacar, cerca de pueblo de Guabas, parte plana del Valle del Ro Cauca, 950 m, Silverstone-Sopkin , Paz & Heredia 3661 (MO); Mpio. Zarzal, hacienda El Medio (carretera Panamericana entre La Paila & Zarzal, parte plana del Valle del Ro Cauca), 950 m, Silverstone-Sopkin & Paz 3728 (MO); Toro, Vereda La Colonia, Finca La Sonora, a 6 km del pueblo de Toro, por la carretera a San Francisco (San Pacho), 950 m, Silverstone-Sopkin , Giraldo , Bolaos 5376 (MO); El Cerrito, ha cienda El Milagro, a 4 km S del purblo de El Cerrito, parte plana del Vall e del Ro Cauca, 1000 m, Silverstone-Sopkin 6113 (MO); Mpio. El Cerrito, hacienda El Milagr o & hacienda Adyacente, a 4 km S del pueblo de El Cerrito, parte plana del Valle del Ro Cauca, 1000 m, SilverstoneSopkin & Giraldo-Gensini 6180 (MO, US). DIVISION UNKNOWN: Cordillera Central, Vertiente Occidental , around Buitrera, Palmira, Figueiras 8094 (US); Santa Marta, Victoria, Viereck s . n ., 29 December 1922 (US). Ecuador . – ESMERALDAS: El Timbre , towards Esmeraldas, Asplund 16532 (AAU, S); El Timbre, near Esmeraldas, 70-90 m, Jativa & Epling 426 (AAU, S, UC, US);

PAGE 402

380 Hacienda Guayas, ca. 20 km S Esmeraldas, Sparre 15493 (S). –PROVINCE UNKNOWN: Rimbach 255 (MA, US). Per . –CUZCO: Herrera 783a (US); La Convencion, N bank of Ro Alto Urubamba, across from village of Kiteni, 500 m, Knapp & Mallet 6356 (US); La Convencion, abajo de Echarate en el Alto Urubamba, 670 m, Nunez , Palma & Arque 10110 (MO). –JUNN: San Ramn, 900-1300 m, Killip & Smith 24907 (F, MA, US); camino a Quimire S de Junn, 900 m, Schunke 6226 (F). –MADRE DE DIOS : Prov. Tambopata, Cuzco Amaznico, across Ro Madre de Dios on road to Lago Sandoval, 200 m, Gentry & Curso de Posgrado de la Universidad de San Marcos 68962 (F, MO); Prov. Tambopata, 10 km NE of Puerto Maldonado, Lago Sandoval, 400 m, Nunez 12363 (MO). –SAN MARTN: Juanju-Tar apoto road, 20-30 km NE of Juanjui, 400 m, Gentry & Smith 44941 (MO); 10-25 km S of Tarapoto, 300-350 m, Gentry , Smith & Tredwell 37669 (MO); 30 km S of Tarapoto, 350 m, Gentry , Smith & Tredwell 37842 (MO); Chazuta, Ro Huallaga, 260 m, Klug 3963 (BM, CAS, F, GH, MO, S, UC, US); San Martn, hills above Chazuta, ridge to W of Quebrada Chazuta, 200-300 m, Knapp 8361 (MO); San Martn, environ of Chazuta, on Ro Huallaga, 200-400 m, Knapp & Mallet 6877 (MO); Tarapoto, Ro Shilcayo, 350 m, Plowman 6029 (ECON); Prov. Mariscal Cce res, Dist. Tocache Nuevo, Schunke 3823 (F, GH, MO, US); Prov. Mariscal Cceres, Dist. Tocache Nuevo, Fundo "Curare Land", propiedad de Jos Sc hunke V. (Ro Cauto), 500-520 m, Schunke 10959 (HUA, MO); Alto R o Huallaga, 360-900 m, Williams 5517 (F, US); Alto Ro Hualla ga/Tarapoto, 360-900 m, Williams 5751 (F, US); Gramalote to Saposoa, 400 m, Woytkowski 5421 (F, MO, S); Saposoa, 400 m, Woytkowski

PAGE 403

381 5491 (MO); Juanju, 400 m, Woytkowski 7101 (GH,MO, UC, US). Venezuela . – FALC”N: Parque Nacional Quebrada de la Cueva El Toro, trail going to La Piedra, 600-900 m, Liesner , Gonzalez & Wingfield 7831 (MO, VEN); Parque Nacional Quebrada de la Cueva El Toro, tr ail to water tank and trail along pipe down to valley pumping station, 600-900 m, Liesner , Gonzalez & Wingfield 7916 (VEN); Dist. Zamora, cerro El Caballo, 300 m, Ruz & Equipo de Ecologa 1974 (VEN). –LARA. E border near state of Yaracuy, Guaremal River, NE of Barquisimeto, Meijer & Smith 56 (MO). –YARACUY. Dist. Urachiche, Quebrada Higueronal, afluente del Ro Urachiche, W de Urachiche, cerca de la Sabana de Mendez, 50 m, Steyermark , Liesner , Sobrevila , Fernndez & Hernndez 124671 (VEN). –ZULIA. Dist. Mara, alrededores del Puesto "El Bosque" de la Guardia Nacional, 1450-1600 m, Bunting , Liesner , Rosario & Len 12264 (MO). – DISTRITO FEDERAL. Pico Naiguat , Vertiente N, Las Delicias, Manara s . n ., 10 March 1976 (VEN); Cerro Naiguat, slopes near the sea to the N, above the town of Naiguat, Lomas de Las Delicias, between Quebrada Basenilla and Quebrada Guayoyo, 9-12 km SE of Hacienda Cocuizal, 1000-1300 m, Steyermark 92078 (US). Cultivated Material . –UNITED STATES. Missouri, cultivated at the Missouri Botanical Gar den, from material collected by J.L. Zarucchi ( Zarucchi 6102 ) in Antioquia, Colombia, MacDougal 3029 (FLAS, MO). Notes In Antoine Laurent de Jussieu's original description of P . coriacea (1805) he included a detailed diagnosis and drawing of the spec ies. The isotype of P . coriacea (at P), closely resembles the dra wing in Jussieu, but there are no

PAGE 404

382 locality data on the specimen. The holotype of P . coriacea consists of two leaves and a small portion of the stem and does not resemble the type drawing of the species, but written on the specimen are locality and descriptive data in Jussieu's hand. Passiflora coriacea is extremely similar to P . sexocellata and P . megacoriacea in its vegetative morphology, but is easily distinguished by its flowers. The flowers of P . coriacea possess long floral stipes as compared to their pedicels (the stipes are usually two to three times the length of the pedicels) and an operculum that is dark reddish purple. Passiflora sexocellata has floral stipes that are commonly shorter than or equal in length to the pedicels and an operculum that is greenish yellow with a fl ush of dark reddish purple at the base and a white margin. Passiflora megacoriacea possesses floral stipes that are commonly less than half the length of t he pedicels and an operculum that is greenish yellow with a white margin or greenish yellow with a mere flush of reddish purple at the base and a white margin. Passiflora coriacea is also distinguished by outer coronal fila ments that may appear banded with light reddish purple. In addition, the outer cor onal filaments are more dilated distally, much like P . megacoriacea but in contrast to P . sexocellata . The limen floor in P . coriacea is very light greenish yellow with dar k reddish purple spots and streaks, again much like P . megacoriacea . Passiflora sexocellata usually possesses a very dark red limen floor. Schlechtendal (1854) attempted to us e mostly vegetative characters to distinguish P . coriacea from P . sexocellata ; incidentally, he was the first to notice

PAGE 405

383 differences in the stipe and pedicel lengths of the two species. He used the following characters to differentiate them : position of the petiolar nectaries, the number of laminar nectaries, the shape of the stem, leaf v enation, the leaf margin, and the leaf texture. However, in my analysis of these species, I did not find any of these vegetative characters to be wholly reliable in distinguishing between these two species. Both have petiolar nectaries that occur in various positions below the middle of the petiole , stems that are terete to somewhat compressed, five distinct leaf veins, thick leaf margins and coriaceous leaves. Passiflora sexocellata does tend to have fewer nectaries than P . coriacea on average, but there is a signi ficant amount of overlap in the range of variation. A clone of P . coriacea ( MacDougal 3029 ) did not produce fruits by autogamy in over 4 years in cultivation. This greenhouse accession was given to me by MacDougal, who originally received it as seedlings from J. Zarucchi ( Zarucchi et al. 6102 ). Heliconius erato (Lepidoptera: Nymphalidae, Heliconiinae) has been reported to be an herbivore of P . coriacea in the central Colombian valleys (Cauca and Magdalena) (Benson et al., 1975). Fajardo et al. (1998) in a study on t he genetic variation analysis of the genus Passiflora using RAPD markers, used P . coriacea and P . adenopoda DC. as representatives of taxa from subgenus Decaloba . They found P . coriacea to be genetically distant from the other taxa in his study, including P . adenopoda , but due to insufficient data, they were not able to discuss the significance of this result (Fajardo et al., 1998).

PAGE 406

384 Figure 8.31. Flower of P. coriacea from Colombia. Scale bar = 5.0 mm. Photo by C. Feuillet. Figure 8.32. Flower of P. coriacea from Colombia. Scale bar = 5.0 mm. Photo by R. Bernal.

PAGE 407

385 Passiflora megacoriacea Description of Passiflora megacoriacea 16. Passiflora megacoriacea K. Porter-Utley. Sp. no v. TYPE: COSTA RICA, Limon, bluff above mouth of river at Moin , about 7 km N of Limon, sunny clay bank along road, 9 Aug. 1980, J . M . MacDougal 1204 (holotype: DUKE!; isotypes: C!, CAS!). Passiflora scandens; stipulae 0.4-0.7 mm latae; petioli in parte proximali biglandulosi; folia peltata glandulosa bilo bata vel obscure ad distincte trilobata , lobis centralibus obtusis ad acutis , lobis lateralibus acutis vel raro acuminatis , marginibus integris; pedunculi ebra cteatis vel raro unibracteatis , stipites florum 1.7-5.7 mm longi; petala nulla; sepala 10.0-20.5 mm longa , viridiflava; filamenta coronae 2-seriata , filamentis exterioribus linearibus , 6.8-14.0 mm longis , pro parte maxima viridiflavis , ad apicem flavidis , interdum ad basim purpureis , filamentis interioribus capitatis , 2.3-5.6 mm longis , pro parte maxima viridiflavis , ad apicem flavidis , interdum ad basim purpureis; operculum plicatum; androgynophorum 4.1-10.0 mm longum; ov arium glabrum; fructus ellipsoidei; semina 4.9-5.1 mm longi , 3.0-3.1 mm lata , retifoveata. Slender, climbing, perennial vine 2-4 m long or more, sometimes trailing on ground, sparsely pubescent with unicellular curved trichomes on petiole, leaf and stem, 0.2-0.4 mm long, 0. 02-0.03 mm wide, also minutely antrorsely appressed-

PAGE 408

386 puberulent throughout with unicellular, cu rved trichomes, ca. 0.1 mm long, 0.020.03 mm wide. Flowering stems terete or somewhat compressed, 1.0-2.4 mm in diameter, with the base w oody and cork-covered. Stipules narrowly ovatetriangular, acute, longitudinal ly striate-nerved, 1.7-5.7 mm long, 0.4-0.7 mm wide; petioles 1.1-3.8 cm long, inserted 1.4-9.6 mm from t he basal margins of the peltate blades, with two, round or ellip tic, opposite to subopposite, sessile or shortly stipitate (rare), saucer-shaped nectaries with flat rims, 1.3-2.1 mm wide (on the widest axis), 0.4-1.6 mm high, co mmonly borne in the distal half of the petiole (0.30-)0.53-0.77 of the distance from the bas e toward the apex of the petiole. Laminas (2.7-)3.3-7.1(-8.2) cm long, 6.6-17.3 cm wide, sometimes glaucous beneath, coriaceous, peltate, tran sversely elliptic (widely divaricately bilobed) or 3-lobed, lateral l obes elliptic, acute to sli ghtly attenuate, 3.5-9.1 cm long, 3.7-25 cm wide, central lobe elliptic to ovate or present merely as an acute to obtuse tip, central vein 2.4-7.7 cm long (measured from point of petiole insertion), angle between the lateral l obes 104-176, ratio of lateral lobe to central vein length 0.85-2.47, margins entire, hyaline, primary veins 3, diverging and branching above base, laminar necta ries present, 6-10, submarginal, associated with the minor veins of the abax ial surface, 0.3-1. 5 mm in diameter, circular to widely elliptic, sessile; tendr il 0.3-1.1 mm wide, pr esent at flowering node, absent in inflorescence. Flowers borne in leaf axils or inflorescences; inflorescences 5.6-11.7 cm long, asso ciated reduced laminas 2.6-9.0 mm long, 1.0-2.8 mm wide. Pedicels 4.4-17.5 mm long, 0.4-1.1 mm wide, 2 per node; bract(s) 1 (rare) or absent; spur(s) abs ent. Flowers 29.556.7 mm in diameter

PAGE 409

387 with stipe 2.6-6.1 mm long, 0.9-1.4 mm wide; hypanthi um (7.8-)8.1-16.1 mm in diameter; sepals 10.0-20.5 mm long, 4.312.1 mm wide, ovate-triangular, acute to rounded, abaxially and adaxially very pale greenish yellow; petals absent; coronal filaments in 2 se ries, the outer 31-40, 6.814.0 mm long, 0.4-1.1 mm wide, linear, dilated toward tips, erect, gr eenish yellow (5GY 8/4) with very light yellow tips (5Y 8/6), ratio of outer coronal row to s epal length 0.48-0.85, the inner (12-)30-45, 2.3-5.6 mm long, 0. 1-0.4 mm wide, linear, capitate, erect, greenish yellow with whitish apices or greenish yellow with a mere flush of reddish purple (5RP 4/8-4/10) at the ve ry base and whitish tips, ratio of inner coronal row to outer coronal row lengt h 0.30-0.52; operculum 2.1-4.2 mm long, plicate, flushed with reddish purple toward the base and whitish toward the tips, the margin with narrow minutely fimbrillate teeth; nectary 0.4-0.8(-2.3) mm high, 0.8-2.5 mm wide; limen recurved or rare ly inclined slightly away from androgynophore, 0.4-1.3 mm hi gh, 0.2-0.9 mm wide, whit ish, limen floor 3.3-8.4 mm in diameter, whitish with reddish purple spots and streaks toward base; androgynophore 4.1-10.0 mm long, 0.9-1.9 mm wide, whitish at base with reddish purple spots and streaks becoming light greenish yellow toward apex; free portions of the staminal filaments 2.8-3.9 mm long, 0.5-1.3 mm wide, linear, greenish yellow; anthers 2.84.4 mm long, 0.8-2.6(-5.1) mm wide; styles 3.2-6.7 mm long including stigmas, 0.3-0.7 mm wi de, greenish yellow; stigmas 1.2-2.5 mm in diameter; ovary 2.14.0 mm long, 1.43.6 mm wide, widely ellipsoid to globose, greenish yellow. Berry 24. 0-27.0 mm long, 19.0-25.0 mm wide, ellipsoid, very dark purple (5P 2.5/2) wit h a glaucous bloom at maturity, immature

PAGE 410

388 fruit greenish yellow, sometimes mottled wit h white or yellow. Seeds (27-)45-50(60), obovate in outline, 4.95.1 mm long, 3.03.1 mm wide, 1.9-2.0 mm thick, acute at both ends, reticulate-foveate with each face marked with ca. 15-20 foveae. Fig. 8.29, 8.33-8.34. Distribution and Ecology Colombia in the division of Bolvar; Co sta Rica in the provinces of Cartago, Guanacaste, Herdia, Limn, and Punt arenas; Panam in the Panam Canal Zone and provinces of Chiriqu, Cocl, Darien, Panam, and San Blas. Growing in shrubs or trees in secondary successional areas, along the edges of tropical moist to premontane wet forests, and near the seashore, 0-1100 m altitude. Flowering and fruiting throughout the year. Vernacular Names Ala de murcilago (Costa Rica), bejuco de blatijito (Colombia). Additional Specimens Examined Colombia . –BOLVAR: Torrecilla, near Turbaco, 150-300 m, Killip & Smith 14415 (GH, US). Costa Rica . –CARTAGO: Pejibaye, Lankester 1298 (F); Pasture beside Ro Pejibaye, 2 km SW of Taus, 750 m, Lent 2960 (F); Las Vueltas (de Tucurrique), 635 m, Tonduz 12808 (US). –GUANACASTE: Parque Nacional Guanacaste Estacin Biologa Volcn Cacao, 1100 m, Alvarado 28 (CR, MO); Cantn Liberia, Parque Nacional Guanacaste, Cordillera de Guanacaste, Estacin Cacao, 1100 m, Alvarado & IV Curso de Parataxonomos

PAGE 411

389 59c (MO); Rincn de la Vieja, Parque Nacional Guanacaste, Estacin Santa Mara, Chacon s . n ., 6 September 1982 (CR); Parque Nacional Guanacaste, Estacin Cacao, 1100 m, Espinoza 89 (MO); Parque Nacional Rincn de la Vieja Liberia, Cordillera de Guanacaste, Estacin Las Pailas, 800 m, Espinoza 708 (CR, MO); Parque Naciona l Guanacaste Estacin Mengo, Volcn Cacao, 1000 m, Hammel & parataxonomo curso INBio 17632 (MO). –HERDIA: Los pastizales de la Finca de Napoleon Murillo, Chacon 778 (DUKE); Finca La Selva, the OTS Field Station on the Ro Puerto Viejo, just E of its juncti on with the Ro Sarapiqu, 100 m, Grayum 2782 (DUKE); N base of hill s to the S of the Ro Sarapiqu, opposite Chilamate, 60-100 m, Grayum , Ray & Jacobs 5316 (MO); Finca La Selva, the OTS Field Station on the Ro Puerto Viejo, just E of its junction with the Ro Sarapiqu, 100 m, Hammel 9189 (DUKE); Finca La Selva, the OTS Field Station on the Ro Puerto Viejo, just E of its juncti on with the Ro Sarapiqu, 100 m, Hammel 12518 (DUKE); Turrialba, Inter-American Institute grounds, Schroeder s . n ., 29 July 1962 (UC); Finca La Selva, the OTS Field Station on the Ro Puerto Vi ejo, just E of its juncti on with the Ro Sarapiqu, 100 m, Wilbur & Jacobs 34677 (DUKE). –LIM”N: Puerta Cahuita, Acevedo 405 (US); vicinity of Limn, 0-100 m, Burger & Burger 8480 (CR, F); between Siquerres and the Ro Pacuare, and rem nant forest on steep hills S of the railroad bridge over R o Pacuare, 50-100 m, Burger & Liesner 6868 (F, MO); Canton de Siquirres, llanura de Santa Cla ra, puente sobre Ro Barbilla, 50 m, Chavarria & Solis 955 (MO); La Bomba-Cahuita, Gmez & Hampshire 20137 (DUKE, MO); Talamanca, Sixaola, en la fila entre Gandoca & Manzanillo frente a

PAGE 412

390 Punta Mona, 50-100 m, Herrera & Bloemen 7632 (F, MO, US); Potrero (Lorek), Siquirres, Kupper 20 (M); along beach between Port Limn and Moin, Pittier 3630 (BM, US); Parque Puerto, Vargas, Poveda & de Ramury 3270 (CR, F); Limn-Portete, Quiroz 473 (CR, F); Costa del Portete, Quiroz 507 (F). – PUNTARENAS: vicinity of Palmar Norte, 100 ft., Allen 5526 (F, US); Carara National Park, near Ro Carara, near guard post, 120 m, Gentry , Hammel , Grayum & INBio parataxonomy course 79273 (CR, MO); Canton de Buenos Aires, caon del Ro Grande de Terraba, cerca del Proyecto Boruca-ICE, 100 m, Hammel , Kennedy & Solomon 17870 (CR, MO); Parque Nacional Corcovado, Sirena, Ro Claro Tr ail-Ro Claro, 0-150 m, Kernan 131 (MO); Canton de Osa, R.B. Isla del Cao, Pennsula de Osa, 1 m, Lepiz 462 (MO); Burica Pennsula, unnamed quebrada opposite Quebr ada Macho of Panam, 11 mi. S of Puerto Armuelles, 20-200 m, Liesner 184 (MO); Reserva Biologa Carara, 200 m, Morales 1267 (MO); Bords du Ro Platanar, Hacum, pres Buenos Aires, 250 m,. H . Pittier 6584 (MO); Canton de Buenos Aires Reserva Indgena Boruca, 200 m, Rojas & Zuniga 158 (CR, MO). –UNKNOWN PROVINCE: Brenes 12289 (F); Poveda & Aguirre s . n ., 4 May 1977 (CR); Hacienda de Gent., United Fruit Company 344 (US). Panam . –CANAL ZONE (currently separated into the provinces of COL”N and PANAMA): Barro Colorado Island, shoreline on end of E point of Pea Blanca Pennsula, Croat 5414A (MO); shorelin e of E side of Pea Blanca Point across from front no. 8 light, Barro Colorado Island, Croat 6732 (MO); Ro Maj, along rive r from waterfalls near Bayano Lake to Finca of Choc Indian Eduardo Maycha, ca. 2 mi. upstream, 30-60 m, Croat 34557 (MO);

PAGE 413

391 vicinity of Panam Railroad crossing at Guillard Hwy., across road from former Summit Hills golf course, Croat & Zhu 76290 (MO); Ca. de la Represa Madden, Daz 5 (DUKE, MO); Albrook, U.S. Army Test Site, Dwyer S-40 (MO); between Chilibre & Madden Dam on Transisthmian Hwy., Dwyer & Correa 9397 (MO); Tower at Barro Colorado Island, Ebinger 229 (F, MO); Forest preserve, near Green Park, Folsom 228 (MO); Barro Colorado Island, N of Wheeler, 11 m, Foster 1020 (DUKE); S of Barbour Point, Foster 1347 (DUKE); Barro Colorado Island, SE of Gross Point, Foster 2285 (DUKE); Barro Colorado Island, tower clearing, Foster 769 (DUKE); Gaillard hwy., mi. 12-13, Garwood 1861A (F); Gaillard 1909 (US); Gatn Locks, Gilbert 409 (FLAS); on brush along railroad, Summit Gardens, Hammel 1787 (MO); Barbacoas Station, Hayes s . n ., 3 June 1862 (BM); ca. de Represa Madden, Campo de Exploradores, Kant 21 (DUKE); junction of Chiva-Chiva and Gaillard Hwy., 50 m, Knapp & Schmalzel 4870 (MO); Gamboa, Martn s . n ., March 1983 (BM); Empire to Mandinga, Piper 5479 (US); Around Alahajuela, Chagr es Valley, 30-100 m, Pittier 3456 (US); Boy Scout Road, Madden Dam area, Porter , Dwyer , Durkee , Croat , Castillon 4014 (MO, UC); Barro Colorado Island, Schmalzel X19 (MO); near Madden Dam, Semple 1 (MO); Barro Colorado Isl and, clearing at tower, Semple 14 (MO); Barro Colorado Island, Shattuck 57 (F, GH, MO, US); Las Cascadas Plantation, near Summit, Standley 29594 (US); Darien Station, Standley 31617 (US); near Survival School, Curund, Tyson 1054 (MO); Boy Scout Camp on Madden Lake, Tyson 5454 (MO); Fort Clayton, no. 519, the old hospital building, Tyson & Blum 3901 (MO, US); Paraiso et in tes Maume et Gorgone, Wagner 7 (M); N side of island

PAGE 414

392 beyond bridge, White 86 (GH, MO, US); vici nity of Miraflores, White 133 (MO); Shore N of end of Chapman Trail, Woodworth & Vestal 501 (A, F, MO); Ro Vigue Beach, Zetek 5564 (MO); Barro Colorado Island, Arrajan, Zetek 5571 (MO). –CHIRIQU: near San Juan, Seemann , s . n ., 1844 (K). –COCL: N rim of El Valle de Antn, 600-1000 m, Allen 1667 (MO); El Valle, 0-1800 ft., Allen 4473 (MO, US); Forest behind Club Campestre, 700 m, Duke 13270 (MO); Behind Hotel Turstico, El Valle, 2200 ft., Hammel 1778 (MO); NE of El Valle de Antn, 2000 ft., Lewis , MacBryde , Oliver & Ridgway 1703 (MO). –DARIN: 3 km S of Jaqu, 0-100 ft., D'Arcy & Sytsma 14553 (MO); Hill ca. 1 mi. NE of Nura, 200 m, Duke 10084 ( 3 ) (ECON, MO). –PANAM: 1 km E of Chorrera City limits, Folsom 3466 (MO); SE slope of Cerro Campana, Lewis , Blackwell , Hawker , Nowicke , Oliver , Ridgway , Robyns & Verhoek 3130 (MO). –SAN BLAS: on mainland in front of Ustupo, D'Arcy 9527 (MO). –UNKNOWN PROVINCE: Ro Hondo, Bartlett & Lasser 16887 (DUKE, GH, MO); Hayos s . n ., 1828 (BM); Seemann s . n . (BM). Notes Passiflora megacoriacea is a new species that is relatively common in Costa Rica and Panam. MacDougal brought my attention to the variation of vegetative and floral characters of some of the Costa Rican and Panamanian specimens then identified as P. coriacea . He began growing clones of plants from Panam and Costa Rica in 1979, colle cted the type in Costa Rica in 1980, and received descriptions of t he plant from others (e.g., Jim Mallet) in the field.

PAGE 415

393 Passiflora megacoriacea , as noted above in the discussion of P. coriacea , is very similar to P. coriacea and P. sexocellata , and although not sympatric, without reproductive material it c an be difficult to separate them. Passiflora megacoriacea may be recognized by commonly having petiolar nectaries found on the distal half of the petiole, (0.30 -)0.50-0.77 of the di stance from the base toward the apex of the petiole, and alt hough that overlaps t he 0.21-0.54(-0.64) range of P. coriacea and P. sexocellata , the character is easily seen in herbarium specimens. Passiflora megacoriacea can also possess deeply trilobed leaves (commonly 0.11-0.61 the distance to the base), especially in populations along the Pacific coast of Costa Rica and in the Panam Canal Zone, whereas P. coriacea and P. sexocellata do not possess deeply trilobed leaves (commonly less than 0.11 the distance to the base). The reproductive structures of these three species provide a number of distinguishing characters. Passiflora megacoriacea possesses floral stipes that ar e commonly less than half the length of the pedicels, whereas P. coriacea possess stipes that are usually two to three times the length of the pedicels and Passiflora sexocellata has floral stipes that are commonly just shorter than or rarely up to two times the length of the pedicels. The overall size of the flower of P . megacoriacea exceeds that of both P . coriacea or P . sexocellata , with P . megacoriacea commonly having a wider hypanthium, longer sepals, larger and fewe r outer coronal filaments, a longer androgynophore, longer stam inal filaments, longer anthers, and a longer operculum. The most informative of t hese is the length of the androgynophore, with P . megacoriacea having an androgynophore that is 6.9-8.8 mm long and the

PAGE 416

394 androgynophores of both P . coriacea and P . sexocellata not exceeding a length of 5.9 mm. In addition, the nectary floor is raised in P . megacoriacea , never raised in P . sexocellata , and only rarely raised in P . coriacea . The outer coronal filaments of both P . megacoriacea and P . sexocellata are erect, while those of P . coriacea spread to ca. 140-160 degr ees. The flowers of P . megacoriacea are commonly referred to as white, greenish white, or cream on herbarium labels and this is due to it having no (or relatively little) reddish purple coloration in the mature flowers; the flowers of P . coriacea and P . sexocellata both commonly have a significant amount of reddish purple coloration. According to Benson et al. (1975), Passiflora megacoriacea has a different passionflower butterfly herbivore than P . coriacea and P . sexocellata . Heliconius cydno has been reported to be the primary herbivore of P . megacoriacea in Panam and southeastern Costa Rica, though Heliconius erato is also known to utilize this species. Heliconius erato is the primary herbivore of P . coriacea and P . sexocellata . Dryas julia is also an herbivore of P . sexocellata (Benson et al., 1975). Passiflora megacoriacea is apparently self-incompatible, since 27 attempts by MacDougal to self-pollinate it in the gr eenhouse failed to yield fruit. However, P . megacoriacea did cross with other members of the supersection including P . mcvaughiana , P . viridiflora , P . tenuiloba , and P . suberosa . In an unpublished manuscript, MacDougal determined the total sugar concentration measured as sucrose equiva lents in percent weight per total

PAGE 417

395 weight to be 29-44% in P . megacoriacea . He found the flower odor to be sweet, waxy, and strong. These data indicate that the flowers are likely utilized by bees. Figure 8.33. Passiflora megacoriacea from Costa Rica. a. Plant and fruits. b. Close up of fruits. Photo by R. Boender. Figure 8.34. Leaf and partially closed flower of P. megacoriacea from Costa Rica. Photo by J. M. MacDougal. Passiflora sexocellata Description of Passiflora sexocellata 17. Passiflora sexocellata Schlechtend. Linnaea 27: 521. 1854. LECTOTYPE (designated her e): MXICO, Veracruz, Along Hwy. 180 between a b

PAGE 418

396 Tampico and Pozarica, 12 mi N of Ozul uama, 38 km N of Naranjos, 110 m, 5 June 1987, T.B. Croat 66095 (lectotype: MO). Slender, climbing, perennial vine 2-6 m l ong or more, sparsely pubescent with unicellular curved trichomes on petiole, leaf , stem, sepal, and stipule, 0.20-0.64 mm long, 0.02-0.03 mm wide, also mi nutely antrorsely appressed-puberulent throughout with unicellular, curved tric homes, 0.03-0.12 mm long, 0.02-0.03 mm wide. Flowering stems terete to somew hat compressed, 1.02.4 mm in diameter, with the base woody and cork-covered. Stipules narrowly ovate-triangular, acute, 2.5-6.0 mm long, 0. 4-1.3 mm wide; petioles 1.25.7 cm long, with 2 (rarely 3), opposite to subopposite, sessile, discoid nectaries with flat rims, 1.0-2.1 mm wide (on the widest axis), 0. 3-1.3 mm high, borne in t he proximal half of the petiole (0.34-0.54 of the distance from t he base toward the apex of the petiole). Laminas 2.6-8.5 cm long, 6.5-23.5 cm wide, coriaceous , peltate (the distance from leaf base to point of petiole inse rtion 3.0-18.9 mm), transversely elliptic (widely divaricately bilobed) or sometimes 3-lobed, lateral lobes elliptic, acute to attenuate, 3.7-12.9 cm long, 1.9-7.5 cm wide, central lobe elliptic to obovate or present merely as a widely acute to obtuse tip (rarely retuse), central vein 1.8-7.0 cm long (measured from point of petiole insertion to the leaf apex), angle between the lateral lobes 132-188, ratio of lateral lobe to central vein length 1.33-2.77, margins entire, hyaline, primary veins 3, diverging and branching above base, laminar nectaries present, 4-13, submarginal, associated with the minor veins of the abaxial surf ace, with 2-4 nectaries prox imal to the lateral leaf

PAGE 419

397 veins, 0.5-1.4 mm in diameter, circular to widely elliptic, sessile; juvenile leaves bilobed and variegated, the variegation seen in some clones at maturity; tendril 0.3-1.0 mm wide, present at flowering node, absent in inflorescence. Flowers borne in leaf axils or inflorescences; in florescences 2.0-18.5(-25.1) cm long, associated reduced laminas 2. 0-4.3 mm long, 1.5-3.1 mm wide. Pedicels 1.915.8 mm long, 0.4-0.9 mm wi de, 2 per node; bract(s) absent; spur(s) absent. Flowers 18.4-33.4 mm in diam eter with stipe 3.1-8.6(-9 .4) mm long, 0.5-1.3 mm wide; hypanthium 5.4-8.2 mm in diamet er; sepals 6.5-13.3 mm long, 2.9-6.3 mm wide, ovate-triangular, acute to rounded, aba xially and adaxially greenish yellow; petals absent; coronal filaments in 2 seri es, the outer 40-51, 5.5-8.4 mm long, 0.3-0.7(-0.8)mm wide, linear, more or less erect, very dark reddish purple (5RP 3/2) on proximal third, gr eenish yellow (5GY 8/4) on mi ddle third, yellow on distal third (5Y 8/10), ratio of outer coronal ro w to sepal length 0. 59-0.94, the inner 2740, 2.3-3.8mm long, 0.2-0.5(-0.6) mm wide, linear, capitate, erect, greenish yellow with a flush of very dark reddish pur ple at base, ratio of inner coronal row to outer coronal row length 0.35-0.52; operculum 1.2-2.0 mm long, plicate, greenish yellow with a flush of very dark re ddish purple at base, the margin white with narrow minutely fimbrillate teeth; necta ry 0.1-0.5(-0.6) mm high, 0.5-1.2(-2.9) mm wide; limen not recurved but inclined toward the operculum, 0.1-0.5(-0.7) mm high, 0.1-0.4(-0.5) mm wide, very dar k red (5R 2.5/2), limen floor 2.5-5.1 mm in diameter, very dark r ed; androgynophore (2.1-)3.5-6.0 mm long, 0.4-1.3(-1.5) mm wide, the distal half dark red then greenish yello w with dark red spots and streaks; free portions of the staminal filaments 1. 5-2.8 mm long, 0.5-0.9 mm

PAGE 420

398 wide, linear, greenish yellow; anthers 1.9-2.9 mm long, 0.6-1.5(-1.9) mm wide; styles 1.8-4.9(-5.4) mm long includi ng stigmas, 0.2-0. 5 mm wide, greenish yellow; stigmas 0.8-1.7 mm in diameter ; ovary 1.6-2.7 mm long, 1.1-2.1 mm wide, widely ellipsoid to globose, greenish yellow. Berry (12.4-)18-23.1 mm long, (13.4-)18.4-33.0 mm wi de, globose, very dark purpl e. Seeds ca. 40-50, obovate in outline, 1.8-4.8 mm long, 2.1-2.9 mm wide, 1.5-2.1 mm thick, acute at both ends, reticulate-foveate with each face marked with ca. 12-17(-19) foveae. Germination epigeal. Chromosome num ber n=6, 2n=12 (Beal, 1971; Snow & MacDougal, 1993). Fig. 8.29, 8.35. Distribution and Ecology Belize in the districts of Belize, Ca yo, Corozal, Orange Walk, Stann Creek, and Toledo. El Salvador in the departments of Cabaas, La Libertad, San Salvador, San Vicente, and Sonsonate. Guatemala in the departments of Alta Verapaz, Chiquimula, Escuintla, Izabal, Petn, Retalhuleu, San Marcos, Santa Rosa, and Suchitepquez. Honduras in the departments of At lntida, Coln, Comayagua, Corts, Gracias a Dios, and Santa Barbara. Mxico in the states of Campeche, Chiapas, Oaxaca, Puebla, S an Luis Potosi, Tabasco, and Veracruz. Nicaragua in the departments of Chontales , Matagalpa, and Region Autonomista Atlntico Norte. Growing in shrubs, tr ees or trailing on the ground in secondary successional areas, along the edges of semi deciduous to deciduous, dry to wet tropical forests, both inland and near t he seashore, 0-1171 m. Flowering and fruiting throughout the year.

PAGE 421

399 Vernacular Names Ala de murcilago (Guatemala, Mxico), granadilla (Guatemala), granadilla de raton (Guatemala), hoja de murcilago (Guatemala, Mxico), las hubes (Guatemala), medialuna (Belize, Guatem ala, Honduras), murcilago (Mxico), xiikzodz (Belize). Ethnobotany The vine is sold in Guatemalan herb ma rkets and is sold dried where the plant does not grow naturally. A decoction of the leaves is commonly taken as a diuretic, especially in the treatment of ki dney infections (Morton, 1981). In El Salvador and Honduras the leaves are combined with lard and used as a poultice on wounds and swellings (Morton, 1981). Additional Specimens Examined Belize . –BELIZE: Mi. 42.5 on N Hwy., N of Maskall River, Dwyer 11002 (MO); Burrel Boom; thicket near ferry, Dwyer 11063 (MO); along Belize River near Burrel Boom, near sea level, Gentry 8046 (MO); Gracie Rock, 1.5-4 mi. S of Mi. 22 on W Hwy., 100 m, Liesner & Dwyer 1531 (MO); Burrell-Boom, Vincent , Hickey & Osborne 6026 (F). –CAYO: Cayo, Bartlett 12011 (US); El Cayo and vicinity, Chanek 4 (S, US); 11 mi. E of Central Farm, Dwyer , Elias & Maxwell 73 (MO); Little Cocquericot, Belize River, Lundell 3836 (US); Little Cocquericot, Belize River, Lundell 3839 , (S); Little Cocquericot, Belize River, Lundell 3841 (GH); Creek, 15 km E of Augustine ( on Notch Line Road) Mountain Pine Ridge Forest Reserve, 530 m, Meave & Howe 1288 (MO); Caves Branch Base Camp,

PAGE 422

400 Whitefoord 1327 (BM). –COROZAL: Gentle 215 (US); Gentle 544 (BM); Alfonsoville, Gentle 821 (MO, NY, US). –ORANGE WALK: Mi. 54, N Hwy., Dwyer & Liesner 12214 (MO); Honey Camp, Lundell 5 (F); Honey Camp, Lundell 139 (F); Honey Camp, Lundell 636 (DS, F, MO, NY, UC, US). –STANN CREEK: Kendal, 150 ft., Schipp 803 (A, BM, F, GH, MO, NY, S, UC). –STANN CREEK: Swasey Branch, Monkey River, Gentle 3931 (GH, NY). El Salvador . – CABAAS: Ilobasco, Villacorta & Rivas 2117 (MO). –LA LIBERTAD: Santa Tecla, Garcia 151 (UC). –SAN SALVADOR: San Salvador, Calderon 829 (NY, US); Cerro de San Jacinto, near San Salvador, 800-1171 m, Standley 20602 (GH, NY, US); vicinity of San Salvador, 650-850 m, Standley 22723 (US). –SAN VICENTE: vicinity of San Vicente, 350-500 m, Standley 21306 (US); vicinity of San Vicente, 400-500 m, Standley & Padilla 3444 (F). –SONSONATE: vicinity of Izalco, 400-600 m, Pittier 1949 (US). Guatemala . –ALTA VERAPAZ: Chahal, in airfield, Contreras 7815 (LL); near Secanquim, trail to Cohaban, Goll 27 (US); Cacao, finca Trece Aguas, 900-1100ft., Goll 43 (US); Chama, 900ft., Johnson 273 (US); Cacao, Trece Aguas, Lewton 315 (F); 1 km N de finca Mercedes, Telemn, Panzs, 32 m, Martnez , Tenorio , Droege & Daz 22859 (MEXU); near Pancajch, 360 m, Standley 70642 (F); Pantn, below Tamah, 600 m, Standley 70882 (F); along Ro Polochic, near Pancajch, 900 m, Standley 91913 (F); vicinity of caves, SW of Lanqun, 600-1000 m, Steyermark 44120 (F); Cubilquitz, 350 m, von Tuerckheim 8215 (GH, US). –CHIQUIMULA: Chocn Plantation, Watson s . n ., 20 March 1885 (GH). –ESQUINTLA: San Luis, N of Escuintla, 450 m, Standley 60135 (F). –IZABAL: Cristina, ditch along RR,

PAGE 423

401 Blake 7595 (US); Cadenas, bordering Sarstn River, Contreras 6795 (TEX); along Ro Sauce, 0-2 km N of Lake Izabal, near sea level, Jones & Lynden Facey 3475 (F, LL, NY); about 4 km NE of El Estor, on Ro Sause Road, Lundell & Contreras 19364 (LL); Mpio. Puerto Barrios, a 3 km S de Punta de Palma, 5 m, Martnez , Stevens , Daz & Droege 23602 (MO); Jocol, Johnson 1054 (US); 27 km from junction of Atlant ic Rt. with road to Tikal, McDade 210 (DUKE); By Mayan Ruin, Quirigu, Muenscher 12586 (F); Zapotillo airstrip, Lake Izabal, Snedaker D-63 (FLAS); Zapotillo, Snedaker E-169 (FLAS, GH); vicinity of Quirigu, 75-225 m, Standley 24014 (NY, US); vicinity of Puerto Barrios, sea level, Standley 24959 (US); near Quirigu, 72-150 m, Standley 72332 (F); near Puerto Barrios, at sea level, Standley 73080 (F); Cheyenne, about 15 mi. SW of Bananera, 50 m, Steyermark 39174 (F). –PETN: Remate, bordering the village, Contreras 716 (LL); Remate, bordering Itza lake, about 12 km W of the village, Contreras 1005 (LL); Dolores on old Machaquil Road, 700 m, Contreras 2349 (LL); Dolores, border ing arroyo S about 500 m, Contreras 3122 (LL); Km 63/64 of Poptn Road, La Saraneta, Contreras 7229 (LL); Flores, El Jobo, bordering Laguna Petn, Contreras 7282 (LL, MO); La Cumbre, km 134/135 of Cadenas Road, Contreras 8935 (CAS, DUKE, LL); SE part of Cerro Cauhui, Walker 1172 (MO); oficina de Cerro Cauhui, Walker 1264 (MO). – RETALHULEU: above Asintal, on road toward Colomba, 750-800 m, Standley 87879 (F); region of Ajax, E of Santa Cruz Mulu, 330 m, Standley 88205 (F); vicinity of Retalhuleu, 240 m, Standley 88637 (F); vicinity of Retalhuleu, 240 m, Standley 88693 (F). –SAN MARCOS: vi cinity of Pajapita, 120 m, Molina &

PAGE 424

402 Molina 27104 (F). –SANTA ROSA: Region of La Morenita, NE of Chiquimulilla, 400 m, Standley 78869 (F); vicinity of Taxisco, 220 m, Standley 79022 (F). – SUCHITEPQUEZ: Las nimas, 650 m, Shannon 274 (US); near Mazatenango, 420 m, Standley 66995 (F). –UNKNOWN DEPARTMENT: San Felipe, Deam 10 (GH); R . Tejada 248 (US). Honduras . –ATLNTIDA: Tela, Lancetilla Valley, above Experiment Station, along stream and slopes above stream but below the dam, 30-60 m, MacDougal , House & Zuniga 3184 (MO); Valle Ro Lean near El Mazapn N of Mezapa, 20 m, MacDougal , House & Zuniga 3298 (BM, CHAPA, MO, TEFH); vicinity of Tela, at sea level, Mitchell 92 (GH); Refugio Nacional de Vida Silvestre, Barra de Cuero and Salado ; 32 km, W de La Ceiba, nivel del mar, cocales de barra Zacate a barra Salado, Soto 298 (TEFH); Lancetilla Valley, near Tela, 20-600 m, Standley 52783 (F, US); vicinity of Tela, at sea level, Standley 54712 (F, US); vicinity of Tela, at sea level, Standley 56658 (F, US); trail W of Tela River, Puerto Sierra, Wilson 256 (NY, US); road near Puerto Sierra, Wilson 533 (NY); near Lancetilla, 90 ft., Yuncker 4775 (F, MIN, MO); vicinity of La Ceiba, Yuncker , Koepper & Wagner 8280 (BM, GH, MO, NY, S, US). –COL”N: Old airport r oad to Castillo, 3 km E Trujillo, Saunders 315 (MO, TEX); along beach 1 km W Trujillo, Saunders 515 (TEX). –COMAYAGUA: 1 km SW Palmitia, 840 m, Lentz 996 (TEFH); Pitosolo Yojoa, 500 m, Valerio Rodriguez 2895 (F). –CORTES: E of Lake Yojoa, 2200 ft., Allen 6570 (F); mountains E of Lake Yojoa, 600-800 m, Morton 7760 (US); Aldea de Corinto & alrededores, frontera c on Guatemala, 55 km W de Puerto Cortes, Nelson , Vargas , Erazo , Garcia & Sierra 2832 (MO, TEFH); along Ro Lindo, near

PAGE 425

403 Carrizal, 550 m, Williams & Molina 17799 (F). –GRACIAS A DIOS: Leymus, orilla del Ro Segovia o Wanki, 100 km SO de Puerto Lempira, 30 m, Nelson & Cruz 8707 (TEFH). –SANTA BARBARA: San Pedro Sula, 1200 m, Thieme 5242 (US). Mxico . –CAMPECHE: Mpio. Cham potn, alrededor del aguada el Paraiso, 10 m, Chan 3790 (CICY); Mpio. Escarcega, camino a Nueva Chontalpa, junto al aserradero, 22 km de Escarcega a Villahermosa, Gongora 483 (CICY); Mpio. Candelaria, Ro Candelaria, lugar llamado "Dos Arroyos", ca. 30 km SE Candelaria, Mondragn , Carnevali , Tapia , May-Pat , Carillo , Alvarez & Martnez 38 (CICY); Champotn, Steere 1888 (US). –CHIAPAS: Mpio. Tonal, 21 km S of Tonal, 750 m, Breedlove 38111 (CAS); Mpio. Catazaj, along shore of Laguna Catazaj near El Cuyo, 60 m, Breedlove 47251 (CAS); en la finca Santa Sofa, Mpio. Tuzantn, 600 m, Calzada , Avendano & Ortega 3804 (XAL); Vicintiy of Huimanguillo and Villahermosa, 150 m, Chavelas , Gonzalez & Perez 2692 (CHAPA); 3 km W of the Chia pas/Tabasco border on Hwy. 186, 150 m, Conrad & Conrad 2985 (MO); Edge of rain forest at Palenque, Gensel 57 (CONN); Mpio. Palenque, 35 km SE de Pale nque, camino a Chancal, Martnez 13362 (MEXU); Mpio. Ocosingo, el ejido Chajul a la orilla del Ro Lacantun, 150 m, Martnez , Dominguez & Lombera 26047 (XAL); Esperanza, Escuintla, Matuda 17497 (F); Cacaluta, Escuintla, Matuda s . n ., 14 August 1947 (F); W side of toll bridge crossing Ro Usumacinta along MEX 186, Vaughan , Dwyer , Spellman & Wunderlin 211 (MO); Mpio. Tapachula, Canton Manga de Clavo, 180 m, Ventura & Lopez 338 (MO). –OAXACA: 5 mi. E of Temascal (10 mi. W of Veracruz border), 45 ft., Janzen s . n ., 13 November 1963 (UC); Temazcal, Sousa 1348

PAGE 426

404 (MEXU); Mpio. Matias, Dist. Juchitan, 6 km S de Palomares, Torres , Cortes , Torres 9707 (MEXU). –PUEBLA: Y ancuictlalpan, Cuetzalan, Basurto & Patron 186 (MEXU); Mpio. Tenampulco, Tenampulco, Chavez & Kerbel 327 (CICY); Tenamupulco, Shapiro 95 (CAS, MEXU); El Cerro, Mpio. Hueytamalco, 300 m, Ventura 16044 (MEXU); Mpio Hueytamalco, Paxta, 250 m, Ventura 19700 (XAL). –SAN LUIS POTOSI: Collected along Hw y. 85, 36 mi. NNW of Tamazunchale, 250 ft., Dunn , Harmon & Walker 17554 (MO); Mpio. Ciudad Valles, ca. 1 km upstream from Rancho Pago Pago on Ro Mesillas, 120 m, Fryxell & Anderson 3449 (CHAPA, MO); Tamazunchale, Kenoyer A515 (F); Otilitla Road, Kenoyer & Crum 3921 (A); Tamazunchale, Lundell & Lundell 7149 (US); Tamasopo, Sierra Madre Oriental, 400 m, Pennell 17985 (PH, US); along Ro Amajac at Tamazunchale, Spellman 2120 (MO). –TABASCO: km 58 rumbo de Paraiso a la Barra de Tupilco, Cowan 2314 (CAS, NY); Cerca de la parcela de Don Justo Hernndez, Ejido Fernndez Manero, km 12. 1 del camino hacia cacaos de la desviacin KM 32 de la carretera Villahermosa hacia Escarcega, Cowan 2815 (CAS, NY); Mpio. San Pedro Balancan, interior de la parte N de la Zona de Reserva Federal Sur Plan Balancan-Tenosique, 80 m, Garcia & Palma 127 (XAL); Boca de Cerro, 10 km E de Tenosique, German , Pinzon & Ramos 1096 (DUKE); Mpio. Paraiso, en la call e de la Secundaria Federal, 300 m, Magana 46 (CAS, CHAPA); San Isidro, near Balancan, Matuda 6045 (LL); camino de Curahueso, cerca de San Juan Bautista, Revirosa 212 (PH, US); Mpio. Teapa, E Azufre 16 km E de Teapa, Tenorio , Tellez & Magana 5576 (MEXU); on hwy. 195, about 35 km S of Villahermosa, Tucker 2577 (DUKE). –VERACRUZ: Mpio.

PAGE 427

405 Coatzacoalcos, Coatzacoalcos, entro la s dos lenguas de la laguna del Ostion, Castillo-Campos & Acosta 16155 (XAL); above San Jos de Gracia 1 mi. S of hwy. between Cordoba and Veracruz, 750 m, Croat 39610 (MO); along Hwy. 180 between Tampico and Pozarica; 12 mi. N of Ozuluama, 38 km N of Naranjos, 110 m, Croat 66095 (MO); Prov. Huasteca, Wa rtenberg, near Tantoyuca, Ervendberg 211 (GH, PH); Playa Escondi da, N of Sontecomapan along Caribbean, 10-60 m, Gentry & Lott with UNAM Tropical Botany class 32607 (MO); Campamento Hnos. Cedillo a 9 km a La Gloria, Hidalgotitln, 15 m, Juan 144 (F, XAL); Laguna Tamiahua 25 mi. S Tampico, LeSueur 308 (F, TEX); Jicaltepec, Liebman 4083 (US); Mpio. Tlacotalpan, along the hwy. following the Ro Papaloapan towards the coast, 2 km NE of Tlacotalpan, 2 m, Nee & Taylor 26567 (F, MO); Misantla, Purpus 5880 (BM, UC, F, GH, MO, NY, US); Santa Lucrecia, Purpus 9259 (UC); Mpio. Aguacapan, Catemaco, 450 m, Robles 136 (XAL); Mpio. Tezonapa, Sierra Cruz Tetela, a 5 km SE de Presidio, 500 m, Robles 844 (XAL); 5 km de Martnez de la Torre a Mizantla, Roldan R-5917 (MEXU); N of Tuxpan along the road to Tamiahua on the Gulf coast, about 20 mi. N of Tuxpan or 1-2 mi. S of Tamiahua, 30 m, Taylor 2091 (DUKE); Mpio. Coxquihui, Acsmaxni W de Chapultepec, 170-270 m, Tenorio , Grimes & Martnez 8539 (TEX); Mpio. de Tlapacoyan, La Palmilla, 100 m, Ventura 1270 (CHAPA, MEXU); Mpio. Nautla, La Unin, Ventura 3324 (DS); Mpio. Atzalan, El Filo, 300 m, Ventura 4018 (CAS); Mpio. Tlapacoyan, Masarango, 200 m, Ventura 14195 (MEXU, XAL); Mpio. Tlapacoyan, El Encanto, 100 m, Ventura 19595 (CAS, XAL); Mpio. Martnez de la Torre, Coapan, 50 m, Ventura 20111 (MEXU);

PAGE 428

406 El Embarcadero, Tlapacoyan, 150 m, Ventura 20273 (MEXU, MO); San Lorenzo Tenochtitln, 22-75 m, Wing 38 (GH). –UNKNOWN STATE: Pring 289/05/13 (MO). Nicaragua . –CHONTALES: Cerro Oluma, 750 m, Gentry , Stevens , Grijalva & Moreno 43989 (MO); 3 km N de Santo Tom s, carretera a San Pedro de Lvago, 280-300 m, Moreno 16084 (MO); 2 km N de Santo Toms, carretera a Santo Domingo, 340-380 m, Moreno 16223 (MO). –MATAGALPA: carretera al Tuma 6 km NW de Cuatro Esquinas, 700-800 m, Guzman , Castro & Montiel 812 (MO). –REGION AUTONOMISTA AT LNTICO NORTE: camino entre Nueva Guinea & La Fonseca, Araquistain 3171-b (MO); Experiment Station El Recreo on the Ro Mico, 30 m, Davidse , Grijalva & Sousa 30715 (MO); Matorrales de la Playa S de Puerto Cabezas, 0 m, Molina 14759 (F); Comarca Wayaws; 10 km S of Siuna, 100 m, Neill 4281 (MO); Sector de Negro Was, entre El Empalme & Rosita, 200 m, Ortiz 2166 (MO); Mpio. Rama, camino desde "Santa Julia" hasta "La Palmera", 60-95 m, Robleto 667 (MO); vicinity of Wan including Ro Uli, 90-110 m, Stevens & Krudoff 7313 (MO); Ca. 14.5 km W of Ro Wawa ferry on road from Puerto Cabezas to Rosita, at (Cano) Kauhru Tingni, 10 m, Stevens & Krukoff 8614 (MO). Cultivated material . –UNITED STATES: Missouri, St. Louis, cultivated at Miss ouri Botanical Gar den from 1988-1992 from four seeds collected 24 December 1987 in Belize (Cayo) by S. Paltin, MacDougal 3007 (FLAS, MO). –BERMUDA: Pembroke, Stanmore, Manuel 1141 (A). Notes Passiflora sexocellata was originally described by Schlechtendal in 1854. He cited P . marmorea hort., as a synonym, but this ho rticultural name was not validly

PAGE 429

407 published. It is interesting that the spec ific epithet “marmorea” means marbled, as the leaves of this species are often va riegated. Holm-Nielson et al. (1988), in the synonomy of P . coriacea , stated that P . sexocellata is an illegitimate name that was based upon material of P . coriacea Juss. and P . difformis Kunth. However, I do not see any reason wh y Schlechtendal's species has to be considered illegitimate. He carefully descr ibes the plant from cultivated material that he had at hand in the Botanical Gar dens in Halle, Germany and spends a paragraph differentiating his species from both P . coriacea and P . difformis . I was unable to locate the type of P . sexocellata , and U. Braun (curator of the herbarium at the Herbarium at the In stitut fur Geobotanik und Botanischer Garten, Halle) was unable to find any material under the name P . sexocellata . Braun was also unable to locate appropriate material under P . coriacea or P . difformis . Other species of Passiflora from Mxico and Central America were in cultivation in Europe by 1830 (Loudon, 1830), and it is plausible that Schlechtendal had such material at hand when he described P . sexocellata . Schlechtendal's P . sexocellata seems to fit the descripti on of the Mesoamerican entity that I am recognizing as a species distinct from P . coriacea and other similar taxa from supersection Cieca . However, some of the vegetative characters that he uses to distinguish P . sexocellata are actually quite variable, but he only had one live specimen availa ble to him when he described the species. He describes the flower as having five green sepals, outer coronal filaments that are "lila c" at the base but "yellowis h green" otherwise, inner coronal filaments that are dilated at the apex and "lilac" in color at the tips and

PAGE 430

408 lighter toward the base, an operculum that is dull "lila c" at the base and becoming "yellowish green" toward the apex, and a "yellowish green" androgynophore. The use of the term "lila c" is somewhat misleading, but the description of how the colors vary on the various parts of the flower is diagnostic. For example, P . coriacea possesses outer coronal f ilaments that are reddish purple at the base but obviously white toward the tips with a band of reddish purple and not "yellowish green.” In addition, the operculum of P . coriacea is wholly reddish purple. However, P . sexocellata possesses outer coronal filaments that are reddish purple at their bases, greenish yellow at their middles and yellow at their apices and an operculum that is dark reddish purple at the base and greenish yellow otherwise (oft en with a white margin). Based upon Schlechtendal's detailed de scription, I apply the name P . sexocellata to this species and have designated a neotype. Passiflora sexocellata is very similar to P . coriacea and P . megacoriacea , and some of their similarities and differenc es are discussed under their respective descriptions. According to Jan Meerman (pers. com.), Passiflora sexocellata and P . xiikzodz grow side by side in Belize, with P . sexocellata growing in the sun and P . xiikzodz growing in the shade. Where t hese two species are found in the Yucatn Peninsula of Mxico, I found that P . sexocellata occurs in wetter forests along rivers and lakes to the west and P . xiikzodz and the related P . itzensis are found in drier forests to the east. Howeve r, MacDougal did find that these plants grow together at some sites in t he Yucatn (MacDougal, 1992). These two species are easily separated because P . xiikzodz and P . itzensis possess

PAGE 431

409 petiolar nectaries at or near t he apex of the petiole whereas P . sexocellata has petiolar nectaries on the proximal half of the petiole. In addition, numerous floral characters can be used to distinguish between them. The most obvious difference is the number of coronal rows, with P. xiikzodz and P . itzensis possessing seven series and P. sexocellata possessing only two. Klucking (1992) classified the leaf venation of P . sexocellata , identified as P . coriacea , as actinodromous and pinnate secondary venation with irregular to regular intercostal venation consisting of lin eate to transverse veins. The peltate, trilobed leaf illustrated is the typical form for P . sexocellata . There are three primary veins and two acrodromal veins wh ich extend two-thirds the length of the lateral lobes, the lateral lobes are acut e, the angle between the lateral veins is 150, and there are six laminar nectari es apparent on the abaxial surface (Klucking, 1992). In Belize, Meerman (2001) found that Heliconius erato is an herbivore of P . sexocellata (which he identified as P . coriacea ). Benson et al. (1975) found that Dryas julia was also an herbivore of P . sexocellata (again, identified as P . coriacea ). In 1990, Joanna Turner found that Plaster bees, Colletes sp. regularly visited flowers of P . sexocellata in Belize. The bees are appr oximately 10 mm long, 3-4 mm high, including some off-the-ground l eg clearance, and have a thorax that is 2.0-2.5 mm high.

PAGE 432

410 Figure 8.35. Passiflora sexocellata from Veracruz, Mxico ( Porter-Utley & Mondragn 326 ). a. Plant, flower and immature fruits. Scale bar = 4.0 cm. b. Flower. Scale bar = 5.0 mm. a b

PAGE 433

411 Passiflora itzensis Description of Passiflora itzensis 18. Passiflora itzensis (J. M. MacDougal) K. Po rter-Utley. Comb. nov. Passiflora xiikzodz J. M. MacDougal ssp. itzensis J. M. MacDougal. Novon 2: 361-364. figs. 2-4. 1992. TYPE: MXICO, Yucatn, Chichn Itz, C . L . Lundell & A . A . Lundell 7470 (holotype: LL!; isotypes: MEXU, MICH, US!). Slender, low-climbing or trailing, perennial vine 1-3 m or more, minutely antrorsely appressed-puberulent throughout with unicellular, curved trichomes, 0.06-0.11 mm long, 0.02 mm wide. Flow ering stems terete or somewhat compressed, greenish yellow (5GY 8/4) to very dark reddish purple (5RP 2.5/2), 1.4-2.3 mm in diameter. St ipules narrowly ovate, acute to slightly attenuate, longitudinally striate-nerved, 2.5-5.6 mm long, 0.4-0.6 mm wide; petioles 0.9-1.8 (-3.0) cm long, inserted 2.4-6.1(-7.0) mm from the basal margins of the peltate blades, with 2, round or elliptic, opposite, se ssile, discoid nectaries with flat rims, 1.3-1.9 mm wide (on the widest axis), 0.5-0.9 mm high, borne in the distal third of the petiole (0.62-0.83 of the distance from the bas e toward the apex of the petiole). Laminas 2.3-4.6 cm long, 5.0-12.4(-13.1) cm wide, coriaceous, often variegated along primary veins and major sec ondary veins, ratio of leaf width to central vein length measured from point of petiole inse rtion 1.9-5.1, depressed obovate to transversely elliptic (widely divari cately bilobed), lateral lobes elliptic, acute to slightly attenuate, (3.5-)4.3-7.4 cm long, 1.7-4.1 cm wide, central lobe

PAGE 434

412 commonly obsolete or present as an obtuse ti p, central vein 1.8-3.1(-4.1) cm long (measured from point of pet iole insertion), angle between the lateral lobes (85-)103-140, ratio of lateral lobe to cent ral vein length 1.4-2.8, margins entire, hyaline, primary veins 3, diverging and branching above base, laminar nectaries present, 6-19, submarginal, associated with the minor veins of the abaxial surface, 0.6-1.8 mm in diameter, widely e lliptic to circular, sessile; tendril 0.4-0.9 mm wide, present at floweri ng node, absent in inflores cence. Flowers borne in leaf axils or inflorescences; infloresc ences 5.3-9.6 cm long, associated reduced laminas 1.9-2.5 mm long, 1. 3-2.7 mm wide. Pedicels 1.3-3.4(-5.8) mm long, 0.61.1 mm wide, (1-)2 per node; bract(s) absent; spur(s) absent. Flowers 20.3-25.5 mm in diameter with stipe 9.1-14.3 mm long, 0.6-1. 0 mm wide; hypanthium 4.06.2 mm in diameter; sepals 7.5-9.8 mm long, 2.6-4.3 mm wi de, ovate-triangular, acute, abaxially and adaxially greenish ye llow or sometimes greenish yellow with very dark reddish purple streaks abaxially ; petals absent; coronal filaments in 7 series, the outer 22-31, 6.38.1 mm long, 0.2-0.3 mm wide, linear, spreading flat, the tips often slightly incurved, very dark reddish purple (5 RP 2.5/2-3/2) with yellow (5Y 8/4-8/6) at tips, ratio of out er coronal row to sepal length 0.67-0.97, the second 20-30, 2.5-5.0 mm long, 0.1-0. 2 mm wide, linear, spreading flat, very dark reddish purple with yellow tips, ratio of second coronal row to outer coronal row length 0.33-0.64(-0.75), the third ca. 50, 0.7-2.1 mm long, 0.05-0.13 mm wide, linear, spreading flat, very dark reddi sh purple with yellow tips, ratio of third coronal row to second coronal row length 0.22-0.59, the fourth through seventh ca. 100 per series, 0.7-1.1 mm long, 0. 05-0.11 mm wide, linear, capitate, erect,

PAGE 435

413 very dark reddish purple, ratio of coronal rows 4-7 to third coronal row length 0.51-0.62(-0.90); operculum 0.3-0.4 mm long, denticulate, very dark reddish purple, nectary absent; limen absent, limen fl oor 2.8-4.1(-5.7) mm in diameter, very dark reddish purple; androgynophore a ppearing absent, or 0.3-1.7 mm long, 0.9-1.8 mm wide; free portions of the staminal filaments 1.9-3.4 mm lo ng, 0.5-0.8 mm wide, linear, very dark reddish purple; anthers 1.3-2.0 mm long, 0.7-1.4 mm wide, introrse at anthesis with their axes maintained more or less parallel to the filament, anthers dehiscing distally; styles 1.8-3.1 mm long including stigmas, 0.3-0.5 mm wide, very dark reddish purple or greenish yellow with very dark reddish purple tinge toward base; stigmas 0.9-1.4 mm in diam eter; ovary 1.7-2.4 mm long, 1.2-1.3 mm wide, widely ellipsoid to globose, greenish yellow. Berry 26.0 mm long, 14.0 mm wide, ovoid to obovoi d, greenish yellow with white spots, becoming soft at the base at maturity. Seeds 30-40, elliptic to slightly obovate in outline, 5.0-5.5 mm long, 2. 0-2.2 mm wide, 1.31.8 mm thick, acute at both ends, reticulate-foveate with each face mark ed with 20-22 foveae. Germination type epigeal. Chromosome number: 2n=12 (MacDougal, 1992). Fig. 8.36-8.37. Distribution and Ecology Mxico, in the states of Campeche, Quintana Roo, and Yucatn. Tropical semideciduous forests (selva medi ana subcaducifolia and selva mediana subperennifolia); growing in shrubs or trailing along the ground on soil of little depth, lying directly on top of limest one; 0-23 m. Flow ering and fruiting September to June.

PAGE 436

414 Vernacular Names Mac-xiquin-zootz (Mxico) and xiikzodz (Mxico). Additional Specimens Examined Mxico . –QUINTANA ROO: Puerto Morelos, Jardn Botnico Benito Jurez, 3-8 m, Escalante 127 (CICY); along MXICO 307 between Chetumal and Cancn, 18.71N, 88.34W, 20 m, Porter-Utley & Mondragn 395 (CICY). – YUCATN: Chichn Itz, near Pist, Lundell & Lundell 7375 (MICH); Mpio. Tinum, A 3 km de Tinum rum bo a San Francisco, 23 m, Ucan 2303 (CICY). Cultivated material . cultivated at Duke Univ ersity 1989-1992 from a cutting collected in 1989 by Sr. Dzib and E. Leiter at Chichn Itz, MacDougal 4633 (MO). Notes In 1992, MacDougal noticed marked vari ation in reproductive and vegetative characters among the herbariu m specimens circulated as P . coriacea from Belize, Guatemala, and the Yucatn Peninsula of Mxico and described P . xiikzodz . He found the floral corona of th is new species to be fundamentally different from P . coriacea and the other members of supersection Cieca , as it is 5-7-seriate as opposed to 2seriate. He noticed the abs ence of the floral nectary and the very reduced, denticulat e operculum of this species. The seeds are also longer than all of the other species in the supersection. The petiolar nectaries are positioned on the distal third of the petiole in P . xiikzodz and the floral stipe is diagnostically long. These floral and vegetative characters clearly separate this

PAGE 437

415 species from other me mbers of supersection Cieca . MacDougal further separated P . xiikzodz into two subspecies, P . xiikzodz ssp. xiikzodz and P . xiikzodz ssp. itzensis . Though he found numerous diffe rences in the flowers of the two subspecies and artificial cross-pollinat ions between them proved unsuccessful, he felt that more in formation was needed to support the recognition of two separate species. I recognize the two species, P . xiikzodz and P . itzensis , not only based upon the detailed st udies of MacDougal (1992), but also because my morphological and molecu lar analyses of the taxa support their recognition (see chapters 4 and 6). Passiflora itzensis and P . xiikzodz are identical vegetativ ely, but the flowers are quite different. The flowers of P . itzensis lack or have a greatly reduced dark reddish purple androgynophore, are smaller, possess fewer filaments in the outer and second coronal rows, an androecium and gynoecium with reddish purple pigmentation, very short styles, stigma s with their receptive surfaces presented distally, and anthers that do not flip over to an extrorse position after the flower buds open but move only slight ly from the original intr orse position to present their pollen distally. In the herbarium, it is not necessary to have perfectly preserved flowers to differentiate between P . itzensis and P . xiikzodz , as the floral stipe of P . itzensis is commonly shorter than that of P . xiikzodz . Incidentally, in the dried flowers of both P. itzensis and P. xiikzodz , the coronal filaments appear nearly black. MacDougal noticed the occasional appearan ce of one or two small but wellformed petals in cultivated material of P . itzensis ( MacDougal 4633 ) (MacDougal,

PAGE 438

416 1992). I also noticed this in the same clone ( MacDougal 4633 ) and in another clone given to me by T. Skimina ( Skimina 131 ). Tim Skimina (pers. com.) successfully crossed MacDougal 4633 and Skimina 131 . The fruits from this cross were greenish yello w with white spots and posse ssed 30-40 light brown seeds. After approximately 35-40 days, th e mature fruits began to soften at the base and, at that time, became very at tractive to animals in and around his garden. It is due to Tim Skimina’s e fforts that we now have such detailed information about the fruits of this species. Passiflora itzensis is likely self-incompatible. Artificial self-pollinations of several clones of this species were carried out by MacDougal but proved unsuccessful, and no fruits were pr oduced by autogamy in two years of cultivation (MacDougal, 1992). In t he four years that I have grown P . itzensis at the University of Florida, no fruits have been produced by autogamy. However, T. Skimina (pers. com.) was able to cross P . itzensis with P . obtusifolia. Figure 8.36. Flower of P. itzensis ( MacDougal 4633 ). Scale bar = 5.0 mm. Photo by J. M. MacDougal.

PAGE 439

417 Figure 8.37. Distribution of P. itzensis and P. xiikzodz . Passiflora xiikzodz Description of Passiflora xiikzodz 19. Passiflora xiikzodz J. M. MacDougal. Novon 2: 361-364. figs. 2-4. 1992. TYPE: MXICO, Campeche, Tuxpea, 186’N, 90’W, 19 Jan. 1932, C . L . Lundell 1210 (holotype: MICH; photocopy s een; isotypes: ARIZ, DS, F!, GH!, MICH, MO!, NY, US!, WIS, U).

PAGE 440

418 Slender, low-climbing or trailing, perennial vine 1-3 m or more, minutely antrorsely appressed-puberulent throughout with unicellular, curved trichomes, 0.1-0.2 mm long, 0.02-0.03 mm wide. Flow ering stems terete or somewhat compressed, 1.3-2.3 mm in di ameter. Stipules narrowly ovate, acute to slightly attenuate, longitudinally striate-nerved, 1.0-4.9 mm long, 0.3-0.7 mm wide; petioles (0.1-)0.5-3.0 cm long, inserted 1. 4-7.3(-8.9) mm from the basal margins of the peltate blades, with 2, round or elliptic, opposite to subopposite, sessile, discoid nectaries with flat rims, 1.1-1.9 mm wide (on the wides t axis), 0.3-1.0 mm high, borne in the distal third of the pet iole (0.63-0.87 of t he distance from the base toward the apex of the petiole). Laminas 1.1-5.8 cm long, 3.4-13.7 cm wide, coriaceous, commonly variegated along primary veins and major secondary veins, conspicuously peltate, ratio of l eaf width to central vein length measured from point of petiole inse rtion 2.0-5.9, depressed obovat e to transversely elliptic (widely divaricately bilobed), lateral lobes elliptic, obtuse or acute to slightly attenuate, 2.6-7.3(-8.1) cm long, 0.8-4.9 cm wide, central lobe commonly obsolete or present as an obtuse to retuse tip, central vein 0.9-4.4(-5.4) cm long (measured from point of pet iole insertion), angle between the lateral lobes 53162, ratio of lateral lobe to central vein length 1.3-3.0(-4.8 ), margins entire, hyaline, primary veins 3, diverging and branching above base, laminar nectaries present, 6-17, submarginal, associated with the minor veins of the abaxial surface, 0.8-1.3 mm in diameter, widely e lliptic to circular, sessile; tendril 0.4-0.8 mm wide, present at floweri ng node, absent in inflores cence. Flowers borne in

PAGE 441

419 leaf axils or inflorescences; infloresc ences 4.5-22.3 cm long, associated reduced laminas 2.1-5.3 mm long, 1. 3-2.5 mm wide. Pedicels 1.3-3.1(-9.9) mm long, 0.41.1 mm wide, (1-)2 per node; bract(s) absent; spur(s) absent. Flowers 18.8-31.9 mm in diameter with sti pe 12.3-19.0(-23.3) mm long, 0.4-0.8 mm wide; hypanthium 4.8-8.1 mm in di ameter; sepals 6.5-12.3 mm long, 3.1-6.3 mm wide, ovate-triangular, acute, abaxially and adax ially greenish yellow; petals absent; coronal filaments in 7 se ries, the outer 40-50, 6.310.4 mm long, 0.1-0.3 mm wide, linear, spreading flat, reflexed abov e middle and the tips often slightly incurved, very dark reddish purple with yellow at tips, ratio of outer coronal row to sepal length 0.73-1.38, the second 35-50, 2.3-4.8(-5 .1) mm long, 0.1-0.2 mm wide, linear, spreading flat, very dark reddish purple with yellow tips, ratio of second coronal row to outer coronal row length 0.23-0.60, the third 40-50, 0.83.0mm long, 0.06-0.13 mm wide, linear, spr eading flat, very dark reddish purple with yellow tips, ratio of th ird coronal row to second coronal row length 0.20-0.65, the fourth through seventh ca. 100 per seri es, 0.6-1.3 mm long, 0.1-0.2 mm wide, linear, capitate, erect, very dark reddish pur ple, ratio of coronal rows 4-7 to third coronal row length 0.30-0.72(-0.91); oper culum 0.3-0.7 mm long, denticulate, very dark reddish purple, nectary absen t; limen absent, limen floor 4.7-7.1 mm in diameter, very dark reddish purple; androgynophore 2.7-4.1 mm long, 0.7-1.3 mm wide; free portions of t he staminal filaments 2.33.6 mm long, 0.4-0.7 mm wide, linear, very dark reddish purple; ant hers 1.6-3.1 mm long, 0.7-1.7 mm wide, extrorse at anthesis with t heir axes maintained parallel to the filament; styles 4.16.3 mm long including stigma s, 0.3-0.5 mm wide, greeni sh yellow with very dark

PAGE 442

420 reddish purple tinge; stigmas 0.7-1.6 mm in diameter; ovary 1.3-3.7 mm long, 1.4-2.7 mm wide, widely ellipsoid to gl obose, greenish yellow. Berry 14.4-26.0 mm long, 12.5-19.00 mm wide, widely ellips oid to ovoid, greenish yellow with white spots, becoming soft at the base at maturity. S eeds ca. 10, widely elliptic in outline, 5.0-6.1 mm long, 2.1-2.7 mm wide, 1.3-1.9 mm thick, acute at both ends, reticulate-foveate with each face marked with 12-24 foveae. Germination type epigeal. Chromosome number: 2n=12 (Snow & MacDougal, 1993). Fig. 8.37-8.38. Distribution and Ecology Belize, in the districts of Cayo and Coro zal; Guatemala in t he state of Petn; Mxico, in the states of Campeche, Quintana Roo, and Yucatn. Tropical semideciduous forests (selva medi ana subcaducifolia and selva mediana subperennifolia); growing in shrubs or trailing along the ground on soil of little depth, lying directly on top of limest one; 20-500 m. Flowering and fruiting September to June. Vernacular Names Ala-murcilago (Mxico), granadilla (Mxi co), mac-xiquin-zootz (Mxico), and pepen-ak’ (Mxico). Additional Specimens Examined Belize . –CAYO: near Camp 6, Gentle 2377 (GH); along Macal River, Hodges & Klassi 20 (MO); Crist O Rey, 350 m, Monro 1101 (BM); Xunantunich (Maya

PAGE 443

421 ruins), 600-700 ft., Proctor 29617 (BM); 1 mi. NE of Benque Viejo on road to Xunantunich, near the ferry, Turner s . n ., 25 March 1990 (MO). –COROZAL: Cerro maya Ruins, Lowry's Bight, Crane 513 (TEX); Gentle 255 (US). –NO SPECIFIC LOCALITY IN BELIZE GIVEN: Gaumer 24 . 415 (G); Jacinto Hills, 400 ft., Schipp S-603 (F). Guatemala . –PETN: Tikal National Park, in ramonal, on Pinar Road about 6 km N, Contreras 3825 (TEX); Temple 1, Ti kal National Park, Tikal, Contreras 5578 (F); Santa Elena, on La Libertad Road, km 5, Contreras 6083 (TEX); Dos Lagunas, 5 km W on Carmelita Road, Contreras 8478 (CAS, F, NY, TEX); Tikal, Yaxmuxan, 100-500 m, Cook & Martn 196 (US); 8 km N del poblado Melchor de Mencos, frontera con Belice, 17”N, 89”, Durn , Espadas , Sim & Mndez 3281 (CICY); Tikal National Forest, on temple (1st) (east), Group, Lundell 16786 (TEX); Lake Petn Itza, on cliff along shore E of San Jos, Lundell 17235 (MO, TEX); La Cumbre, San Luis area, Lundell & Contreras 20711 (TEX); Plaza Mayor Tikal Ruins, 300 m, Molina 21075 (F); Tikal, Parque Nacional, cami no Zococzal a Tikal, km 16, Ortiz 271 (F). Mxico . –CAMPECHE: Hwy. 186 between Cata mul and Xpujil, km 105, 210 m, 16.27N, 89.58W, Porter-Utley & Mondragn 387 (CICY, FLAS). Hwy. 186 between Catamul and Xpujil, km 112, 260 m, 18.40N, 89.14W, PorterUtley & Mondragn 389 (CICY, FLAS); 1 km S de Zoh Laguna, Hopelchn, 18.00N, 89.00W, Sim 1382 (CICY). –QUINTANA ROO: 16 km S de San Jos de la Montaa, sobre el camino a Toms Garrido, Cabrera & Cabrera 5565 (F, MO); Calica, 7.5 km S de Play a del Carmen, Cozumel, 20.25N, 87.00W, Duran , Sima , Granados & Trejo 2272 (CICY); Jardn Botnico,

PAGE 444

422 Benito Jurez, 20.30N, 86.00W, Duran & Cruz 2369 (CICY); Jardn Botnico, Benito Jurez, 20.30N, 86.00W, Duran & Cruz 2730 (CICY); Puerto Morelos, Jardn Botnico, Benito Juarz, 20.30N, 86.00W, Escalante 127 (CICY); road off of Hwy. 186 between Xpujil and San Francisco Villa, 260 m, 18.94N, 89.40W, Porter-Utley & Mondragn 391 (CICY, FLAS); trail off of Hwy. 186 between X pujil and San Francisco Villa, 280 m, 18.75N, 89.78W, Porter-Utley & Mondragn 392 (CICY, FLAS); Hwy. 307 between Chetumal and Cancn, 30 m, 18.88N, 88.46W, Porter-Utley & Mondragn 394 (CICY, FLAS); road between of Hwy. 307 and 180 between Punta Nizuc and Alfredo V. Bonf il, 20 m, 21.40N, 86.30W, Porter-Utley & Mondragn 401 (CICY, FLAS); 3.4 km hacia Nuevo Becal, partiendo de la carretera de Zoh-Laguna a Chunchintok, Hopelchn, 1837.00N, 89.35W, Trejo , Olmstead & Granados 582 (CICY). –YUCATN: camino de Temozn a Xluch, 10 m, Chan 3540 (CICY); Mayaw Region, G. F . Gaumer 24415 (G, GH, MO); Goldman 622 (US); Chichn Itz, Lundell & Lundell 7470 (TEX, US); road off main hwy. (no number) between Va llodolid and Tinum, 20 m, 20.32N, 88.48W, Porter-Utley & Mondragn 408 (FLAS); 3 km de Tinum rumbo a San Francisco, 23 m, Ucan 2303 (CICY). Notes As discussed under the description of P . itzensis , I have chosen to recognize MacDougal's P . xiikzodz ssp. xiikzodz at the species level. The work of MacDougal and molecular and morphologic al analyses presented here support the specific recognition of this very distinct taxon. Passiflora xiikzodz is

PAGE 445

423 vegetatively identical to P . itzensis , but numerous floral characters may be used to separate them (see description of P . itzensis ). The most obvious difference between these species is the extreme reduction or lack of an androgynophore in P . itzensis . Passiflora sexocellata is also vegetatively similar to P . xiikzodz . However, these species differ in the position of the petiolar nectaries, with P . xiikzodz having nectaries positioned towa rd the apex of the petiole and P . sexocellata possessing nectaries at the middle or on the proximal half of the petiole. According to MacDougal (1992), Passiflora xiikzodz appears to be selfincompatible and no fruits have been produced by autogamy in this species. Fruits with viable seeds were eas ily produced between two clones of P . xiikzodz ( MacDougal 4690 and MacDougal 4677 ). However, artifici al cross-pollinations between P . xiikzodz and P . itzensis proved unsuccessful. In Belize, Meerman (2001) found that Heliconius erato is an herbivore of P . xiikzodz . Figure 8.38. Flower of P. xiikzodz ( MacDougal 4677 ). Scale bar = 5.0 mm. Photo by J. M. MacDougal.

PAGE 446

424 APPENDIX CLADISTIC ANALYSIS OF GRANULE-BOUND STARCH SYNTHASE ( WAXY ) GENE SEQUENCES Introduction Granule-bound starch synthase (s ometimes referred to as “ waxy ” because of its mutant phenotype in maiz e) was investigated in Passiflora supersection Cieca because this gene has demonstrated phylogenetic utility in other groups of plants and appears to be a singleor low-copy gene (Mason-Gamer et al., 1998; Miller & Rausher, 1999; Evans et al., 2000; Mason-Gamer, 2001; Evans & Campbell, 2002; Mathews et al., 2002; Sm edmark et al., 2003). In a ddition, the preliminary data presented here indicates that GBSSI displays as many , if not more, informative sites than the ITS region in supersection Cieca and has the potential to answer difficult questions about evolut ion within this comp lex group of plants. Materials and Methods Total genomic DNA was extracted from fres h, heat dried or silica dried leaves or flowers utilizing the CTAB method of Doyle and Doyle, scaled down to 1.0 ml extraction volumes (Doyle & Doyle, 1987). DNA was precipitated for approximately one to eight hours at -20 C with 0.65 volumes of isopropanol, centrifuged, washed twice with 70% ethy l alcohol, and dried. The pellet was resuspended in 75l of Tris-EDT A buffer and stored at -20C. Amplification of the granule-bound star ch synthase region (GBSSI) of nuclear ribosomal DNA (nrDNA) was performed using 50 l reactions containing Taq

PAGE 447

425 DNA polymerase (Sigma-Aldrich; 0.04 U/L), the included buffers (1X), MgCl2 (4.5 mM), and primers (eac h 0.2 M). A hot start at 95C for 10 minutes was followed by 40 cycles of 94C for 45 seconds, 57C for one minute and 15 seconds, and 72C for two minutes. Amplification was completed with a 10minute elongation step at 72C to maximize A-tailing and increase efficiency of cloning into T-tailed vectors. The a lignment of six dicot GBSSI sequences ( Ipomoea carnea Jacq.: GenBank AF111128; Manihot esculenta Crantz: GenBank X74160; Phaseolus vulgaris L.: GenBank AB029546; Prunus virginiana L.: GenBank AF285991; Solanum tuberosum L.: GenBank X83220; and Symphoricarpos albus (L.) S.F. Blake: GenB ank AF277633) was used by Mark Whitten and I to design amp lification primers 2F (TGGTGGACT YGGTGATGTTC) and 10R (TCTTCTAGY CTRCCAATGAASC) (Fig. A.1). Primers 2F and 10R were used to amp lify a product approximately 1,700 base pairs in length, spanning 7 exons and 8 introns. Subsequently, primers 558F (TAGAGCAGGAGAGGATTACC) and 561R (AGATTGAGGAGCGAGAAGTC) were designed from alignments of Passiflora supersection Cieca GBSSI sequences to facilitate sequencing the middle of the amplified region (Fig. A.1). PCR products were cleaned using QIAqui ck columns (Qiagen, Santa Clarita, California, USA) and underwent dye te rminator cycle sequencing with Applied Biosystems Inc. (ABI) (Foster City, Calif ornia, USA) reagents (5L reactions). The GBSSI region for me mbers of supersection Cieca was sequenced directly from the cleaned amplif ied product in the DNA Sequ encing Core Facility on the University of Florida campus (DSEQ, UF) with ABI 377 and ABI 373A automated

PAGE 448

426 sequencers. Sequences were edited and assembled using the ABI software packages Sequence Navigator Version 1.0.1 and Auto Assembler Version 1.3.0 on an Apple PowerMac com puter and aligned visually. Selected cleaned PCR products were cloned into TOPO-TA Cloning (Invitrogen, Carlsbad, California, USA) vectors according to the manufacturer’s instructions, except that the ligation reactions were halved. Transformation reactions were incubated in SOC broth (2.0% tryptone, 0.5% yeast extract, 10mM NaCl, 2.5mM KCl, 10mM MgCl2-6H2O, 20mM glucose) at 37C for one hour before being spread onto plates containing S-Gal/LB Agar/Kanamycin Blend (Sigma, St. Louis, Missouri, U SA) and incubated at 37C for 8 hours. Only large white colonies, representing potentially recombinant plasmids, were selected for amplific ation and sequencing. Cladistic analyses were performed usi ng PAUP* Version 4.0b10 for Macintosh (Sinauer, Sunderland, Massachusetts, USA) wit h all characters equally weighted. As some informative insertions-deleti ons (indels) were found in the GBSSI sequences, indels were coded as discrete characters (presence/absence). The integration of indels in the phylogenetic analysis provided more informative characters. The GBSSI data set was anal yzed using the heuristic search option (MULTREES, SPR, 1000 random replicates, holding five trees per replicate, using the delayed transf ormation optimization).

PAGE 449

427 Figure A.1. Structure of portion of GBSSI gene in Passiflora coriacea showing 9 translated exons and their intervening in trons (lines); arrow heads indicate position and direction of primers; designations 2F and 10R mark the boundaries of the fragment amplified in Passiflora supersection Cieca ; designations 558F and R are the internal sequencing pr imers; scale bar represents 100bp. Results and Discussion The cladistic analysis of the molecula r GBSSI data resulted in the generation of 124 equally parsimonious trees (the first tree is presented in Fig. A.2) of 416 steps (CI=0.772; RI=0.871). The strict co nsensus tree is presented in Fig. A.3. The overall structure of G BSSI (in contrast to the st ructure of this gene in the Rosaceae; see Evans et al., 2000) in supersection Cieca is very similar across all species (Fig. A.1). Based on the por tion of the gene examined, there is no evidence for widespread loss of gene function in the form of insertions /deletions in the exons, or the acquisition of stop codons. Passiflora citrina (supersection Decaloba section Xerogona ) forms a polytomy at the base of the tree with P. lobbii ssp. ayacuchensis (supersection Multiflora ). The monophyly of supersection Cieca is strongly support ed (100% bootstrap). Within supersection Cieca , P. mcvaughiana , P. juliana , and P. viridiflora form a well-supported clade (100% bootstr ap). Within this clade, P. juliana and P. viridiflora are sister to each other (71% bootstrap), and ther e is evidence for the

PAGE 450

428 monophyly of P. viridiflora (82% bootstrap). Passiflora itzenis and P. xiikzodz form a clade with 100% bootstrap suppor t; however, the clones from an individual of P. xiikzodz do not form a monophyletic group. The sister relationship of P. sexocellata and P. coriacea is strongly supported (94% bootstrap). Passiflora obtusifolia is sister (82% bootstrap) to a clade containing most (but not all) of the clones of two individuals of P. suberosa ssp. suberosa from Puerto Rico and St. Croix. Passiflora lancifolia is most closely related to a clone of P. pallida from Jamaica and P. suberosa s.l . Of particular interest are the cl ones of the vari ous entities of P. xiikzodz , P. viridiflora , P. suberosa , and P. pallida (Fig. A.2-A.3). Sequences cloned from a single individual of Passiflora xiikzodz from Mxico are found in two different clades. Two clones ("a" and "c") constitu te a moderately supported clade (74% bootstrap), and the other two (" b" and "d") are sister to P. itzensis . These data show that there are at least f our copies of GBSSI present in P. xiikzodz , a putative diploid (Snow and MacDougal, 1993) . Clones from an individual of P. viridiflora constitute a clade, but at least four copies of GBSSI ar e present in that species. There are also at least thr ee copies of this gene in individuals of P. suberosa ssp. suberosa from Puerto Rico and St. Croix. An individual of Passiflora suberosa ssp. litoralis from Taxco in the state of Guerrero, Mxico possesses at least five different copies of waxy . Passiflora pallida from Jamaica also has at least five copies, and P. pallida from Puerto Rico possesses four. The topologies of the gene trees resulti ng from the separate analyses of the molecular ITS data (see Figs. 4.1-4.4) and the GBSSI data (see Figs. A.2-A.3)

PAGE 451

429 agree in several ways: 1) there is strong suppor t (100% bootstrap in both analyses) for the monophyly of Passiflora supersection Cieca , 2) within supersection Cieca , P. mcvaughiana , P. juliana , and P. viridiflora form a clade (100% bootstrap in the GBSSI analysis and by consensus in the ITS analysis), 3) P. juliana and P. viridiflora are sister to each other ( 71% bootstrap in the GBSSI analysis and 77% bootstrap in the ITS analysis) , 4) there is evidence for the monophyly of P. viridiflora (82% bootstr ap in the GBSSI analysis and 96% bootstrap in the ITS analysis), 5) P. itzenis and P. xiikzodz form a clade (100% bootstrap in the GBSSI analysis and 90% bootstrap in the ITS analysis), 6) the sister relationship of P. sexocellata and P. coriacea is strongly supported (94% bootstrap in the GBSSI analysis and 100% bootstrap in t he ITS analysis), and 7) P. suberosa is not monophyletic. However, com parison by eye of the topologies provided by the GBSSI sequences (Figs. A.2-A.3) and the ITS sequences (Figs. 4.1-4.4) also indicates that signific ant incongruencies exist between the two gene trees. In the analysis of ITS sequences, P. pallida is sister to the remaining species of supersection Cieca . However, in the analysis of GBSSI sequences, P. mcvaughiana , P. juliana , and P. viridiflora are sister to the remaining species of the supersection. Passiflora pallida and P. xiikzodz are both monophyletic in the ITS gene tree, but they are not m onophyletic in the G BSSI gene tree; the non-monophyly of P. pallida was brought about by a single evolutionary unit (“ pallida Jamaica e"). In the ITS gene tree, P. obtusifolia is most closely related to P. itzensis , P. xiikzodz , P. mcvaughiana , P. juliana , and P. viridiflora . In the

PAGE 452

430 GBSSI gene tree, P. obtusifolia is most closely related to P. suberosa ssp. suberosa . It is difficult to discuss the phylogenetic relationships amongst the species of Passiflora supersection Cieca , given the limited taxon sampling and complex nature of the gene not only in known polyploid taxa (e.g., P. pallida ) but also in known diploid taxa (e.g., P. xiikzodz ). It is likely that increased taxon sampling (along with an extensive analysis of cl oned sequences for each taxon) will help us understand not only the phylogenetic relati onships within the supersection as a whole, but also the influence that pol yploidy and hybridization has had on this complex group of plants.

PAGE 453

431 Figure A.1. The first of 124 most parsim onious trees from the GBSSI data set of Passiflora supersection Cieca and outgroups. Numbers above branches are branch lengths. Bootstrap values ar e given below corresponding branches. Tree length=416; CI=0.772; RI =0.871; RC=0.672. Names followed by the letters “a”, “b”, “c”, “d” and “e” denote clones of the same individual from a particular locality.

PAGE 454

432 Figure A.2. Strict consensus of 124 mo st parsimonious tree s from the GBSSI data set of Passiflora supersection Cieca and outgroups. Tree length=416; CI=0.772; RI=0.871; RC= 0.672. Names followed by the letters “a”, “b ”, “c”, “d” and “e” denote clones of the same indi vidual from a particular locality.

PAGE 455

433 LIST OF REFERENCES Bat Conservation International, Inc. Pl ant species visited by pteropodid bats for food, http://www.batcon.or g/discover/ffecon3.html, November 25, 2003. Beal, P.R. 1969. Chromoso me numbers of the exotic Passiflora species in Australia. Queensland Journal of Agricultural and Animal Science 26: 407-421. Beal, P.R. 1971. Chromosome numbers in some recently introduced species of Passiflora in Australia. Queensland Journal of Agricultural and Animal Sciences 28: 179-180. Benson, W.W., K.S. Brown, and L.E. Gil bert. 1975. Coevol ution of plants and herbivores: Passion flower butterflies. Evolution 29: 659-680. Blattner, F.R. 1999. Direc t amplification of the entir e ITS region from poorly preserved plant material using recombinant PCR. BioTechniques 27: 1180-1183. Bosio, G. 1610. La trionfante e gloriosa croce . A. Ciaccone, Rome. Brower, A.V.Z. and M.G. Egan. 1997. Cladistic analysis of Heliconius butterflies and relatives (Nymphalidae: Heliconiti): A revised phylogenetic position for Eueides based on sequences from mtDNA and a nuclear gene. Proceedings of the Royal Entomological Society , London B264: 969-977. Brown, K.S. 1981. The biology of Heliconius and related genera. Annual Review of Entomology 26: 427-456. Candolle, A. de. 1828. Passifloraceae. In Prodromus systematis naturalis regni vegetabilis , ed. A. de Candolle, 321-338. Treuttel & Wrtz, Paris. Castelli, P. 1625. Exactissimo descriptio rari orum quarundam plantrum quae continentur Romae in horto farnesiano . J. Mascardi, Rome. Cavanilles, A.J. 1790. Monadelphia classis dissertationes decem. Decemia dissertatio botanica, de Passiflora . Typographia regia, Madrid. Cavanilles, A.J. 1799. Icones et descriptiones plantarum . Ex Regia typographia eius operas dirigente Lazaro Gayguer, Madrid.

PAGE 456

434 Chase, M.W., S. Zmarzty, M.D. Lled, K.J. Wurdack, S.M. Swensen, and M.F. Fay. 2002. When in doubt, put it in Flacourtiaceae: A molecular phylogenetic analysis based on plastid rbcL DNA sequences. Kew Bulletin 57: 141-181. Cieza de Len, P. de. 1553. Parte primera de la crnica del Per . Minesterio de Montesdoca, Sevilla. Cusset, G. 1968. Les vrilles des Passifloraces. Bulletin de la Socit Botanique de France 115: 45-61. DeVries, P.J. 1987. The butterflies of Costa Ric a and their natural history . Princeton Academic Press, Princeton, New Jersey. Diers, L. 1961. Der Anteil an Poly ploiden in den Vegetationsgurteln der Westkordillere Perus. Zeitschrift fur Botanik 49: 443. Don, G. 1934. A general history of t he dichlamydeous plants . J.G. and F. Rivington, London. Donoghue, M.J. 1985. A critique of the biologi cal species concept and recommendations for a phylogenetic alternative. The Bryologist 88: 172181. Doyle, J., and J. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11-15. Durkee, L.T., D.J. Gaal, and W.H. Reisner . 1981. The floral and extra-floral nectaries of Passiflora L. I. The floral nectary. American Journal of Botany 68(4): 453-462. Evans, R.C, L.A. Alice, C.S. Campbell, E.K. Kellogg, and T.A. Dickinson. 2000. The granule-bound starch synthase (GBSSI) gene in the Rosaceae: Multiple loci and phy logenetic utility. Molecular Phylogenetics and Evolution 17(3): 388-400. Evans, R.C, and C.S. Cam pbell. 2002. The origin of the apple subfamily (Maloideae; Rosaceae) is clarified by DNA sequence data from duplicated GBSSI genes. American Journal of Botany 89(9): 1478-1484. Fajardo, D., F. Angel, M. Grum, J. Tohme, M. Lobo, W. Roca, and I. Sanchez. 1998. Genetic variation analysis of the genus Passiflora L. using RAPD markers. Euphytica 101: 341-347.

PAGE 457

435 Falling Rain Genomics, Inc. Global gaz etteer, http://www.calle.com, November 25, 2003. Feuillet C., and J.M. MacDougal. 1999. A new infrageneric classification of Passiflora . XVI International Botani cal Congress Abstracts , p. 173. St. Louis, USA, August 1-7. Feuillet C., and J.M. MacDougal. 2003. A new infrageneric classification of Passiflora . Passiflora 13(2): in press. Funk, V.A. 1985. Phylogenetic patterns and hybridization. Annals of the Missouri Botanical Garden 72: 681-715. Gilbert, L.E. 1991. Biodive rsity of Central American Heliconius community: Pattern, process and problems. In Animal and plant coevolution , ed. L.E. Gilbert and P.H. Raven, 210-240. Univer sity of Texas Press, Austin. Goldman, D.H. 2003. Passiflora (Passifloraceae) in the Sonoran Desert: A new taxonomic combination and an in troduced species in Arizona. Madroo , in press. Goyena, M.R. 1909. Flora Nicaraguanse: conteniendo la botanical elemental . Compania Tipografica Internacional, Managua. Graham, A. 1976. Studies in Neotropical Paleobotany. II. The Miocene communities of Veracruz, Mxico. Annals of the Missouri Botanical Garden 63(4): 787-842. Gray, A. 1850. Plantae Lindheimeriana. Boston Journal of Natural History 6: 192. Gregor, H.J. 1982. Die Jungtertiren floren Sddeut schlands. Palokarpologie , phytostratigraphie , palokologie , paloklimatologie . I. Enke, Berlin. Grisebach, A.H.R. 1860. Flora of the Britis h West Indian Isles . Part 3 . J. Cramer, Weinheim. 193-315. Hallman, J.G. 1749. Di ssertatio botanica de Passiflora , quam cum consensu amplis. Amoenitates academicae Camper edition, 1: 244-279. Hamilton, W. 1825. Prodromus plantarum Indiae Occidentalis . Apud Treuttel et Wrtz, London. Harms, H. 1893. Passiflorac eae. In: Engler A, ed. Die Natrlichen Pflanzenfamilien . Leipzig: Wilhelm Engelmann. 69-92.

PAGE 458

436 Harms, H. 1897. Passiflorac eae. In: Engler A, ed. Die Natrlichen Pflanzenfamilien, Nachtrag . Leipzig: Wilhelm Engelmann. 253-256. Harms, H. 1925. Passiflorac eae. In: Engler A, ed. Die Natrlichen Pflanzenfamilien . Leipzig: Wilhelm Engelmann. 470-507. Hawkeswood, T.J. 1991. Some observa tions on the biology of the Australian butterfly Acraea andromacha andromacha (Fabricius)(Lepidoptera, Nymphalidae). Spixiana 14: 301-308. Herbarium of the Royal Bot anic Gardens Kew. 1996. Index Kewensis. Supplement twenty. Names of seed-bear ing plants at the rank of family and below published between January 1991 and the end of 1995 with some omissions from earlier years . Royal Botanic Gardens, Kew. Hernndez, F. 1651. Rerum medicarum Novae Hispaniae thesaurus seu plantarum, animalium et miner alium Mexicanorum historia . V. Mascardi, Rome. Hillis, D.M. 1987. Molecular versus mo rphological approaches to systematics. Annual Review of Ecology and Systematics 18: 23-42. Hoch, J.H. 1934. T he legend and history of Passiflora . American Journal of Pharmacy 106: 166-170. Holm-Nielsen, L.B., P.M. Jrgensen, and J.E. Law esson. 1988. 126. Passifloraceae. Flora of Ecuador no. 31: 1-130. Hooker, J.D. 1867. Passifloreae. In: Genera plantarum , ed. G. Bentham and J.D. Hooker, 807-816. Reeve & Co., London. Humboldt, F.W.H.A., A.J. v on Bonpland, and C.S. Kunth. 1817. Passifloreae. In Nova genera et species plantarum , vol. 2, pp. 126-144. Lutetiae Parisiorum, sumtibus Librariae Graeco-Latino-Germanico, Paris. Irvine, M. Passiflora online, nectar-feeding bats, ht tp://www.passionflow.co.uk/ bats11.htm, November 25, 2003. Judd, W.S., C.S. Campbel l, E.A. Kellogg, and P.F. Stevens. 2002. Plant systematics: A phylogenetic approach , 2nd edition. Sinauer Associates, Sunderland, MA. Jussieu, A.L. de. 1805a. Premier mmo ire sur quelques nouvelles espces du genre Passiflora , et sur la necessit d'etablir une famille des passiflores. Annales du Musum d'Histoire Naturelle Paris 6: 102-116, t. 58-60.

PAGE 459

437 Jussieu, A.L. de. 1805b. Second mmoir e sur le famille des passiflores, et particuliremente sur quelques espc es nouvelles du genre tacsonia. Annales du Musum d'Histoire Naturelle Paris 6: 388-396. Kay, E. 2001. Observat ions on the pollination of Passiflora penduliflora . Biotropica 33(4): 709-713. Killip, E.P. 1938. The Americ an species of Passifloraceae. Publications of the Field Museum of Natural History, Botanical Series 19: 1-613. Klucking, E.P. 1992. Leaf venation patterns, vol. 6 (Flacourtiaceae) . J. Kramer, Berlin. Koschnitzke, C., and M. Sazima. 1997. Biologa floral de cinco especies de Passiflora L. (Passifloraceae) en mata semidecidua. Revista Brasiliera de Botnico 20: 199-226. Kugler, E. 1997. Kurze gesch ichte der passionsblumen. In Passionsblumen Eine faszinierende Gattung , ed. B. Ulmer and T. Ulmer, 17-28. Laupenmhlen Druck, Httenstrae. Kunth, C.S. 1817. Passifloreae. In Nova genera et species plantarum, ed. F.W.H.A. von Humboldt, A. J. Bonpland, and C.S. Kunt h, vol. 2, 126-144. Lutetiae Parisiorum, sumtibus Librar iae Graeco-Latino-Germanico, Paris. Lawesson, J.E. 1988. C ontributions to the flora of the Galapagos Islands, Ecuador. Phytologia 65(3): 228-230. Levin, D.A. 1993. Local speciation in pl ants: the rule not the exception. Systematic Botany 18(2): 197-208. Lindberg, A.B. 1998. Passionflowers and their birds, bees and butterflies: the ecology and evolution of pollination and herbivory in Passiflora L. Dissertation , Department of Ecology and Genet ics, University of Aarhus, Denmark. Linnaeus, C. 1745. Dissertatio botanica de Passiflora , quam cum consensu amplis . Upsalla, Stockholm. Linnaeus, C. 1753. Species plantarum . Holmiae, Impensis Laurentii Salvii, Stockholm. Long, J., and J.T. Luke. 2001. The new Munsell student color set . Fairchild Publications, Inc., New York.

PAGE 460

438 Loudon, J.C. 1830. Loudon's hortus Britannicus : A catalogue of all the plants indigenous, cultivated in, or introduced to Britain. Part I. The Linnaean arrangement: Part II. The Jussieuean arrangement . Longman, Rees, Orme, Brown, and Green, London. MacDougal, J.M. 1983. Revision of Passiflora L. section Pseudodysosmia (Harms) Killip emend. J. M. Ma cDougal, the hooked trichome group. Dissertation , Department of Botany, Du ke University, Durham. MacDougal, J.M. 1988. Passiflora eglandulosa , a new species in section Cieca (Medikus) DC., formally included with P. trinifolia Masters. Annals of the Missouri Botanical Garden 75: 1658-1662. MacDougal, J.M. 1992. New species of Passiflora subgenus Plectostemma (Passifloraceae). Novon 2: 358-367. MacDougal, J.M. 1994. Revision of Passiflora subgenus Decaloba section Pseudodysosmia (Passifloraceae). Systematic Botany Monographs 41: 1-146. MacDougal, J.M. 2001. Two new species of passionflower ( Passiflora , Passifloraceae) from southwestern Mxico. Novon 11: 69-75. MacDougal, J.M., and R. McVaugh. 2001. Passifloraceae. In: Flora NovoGaliciana , ed. W.R. Anderson, 1-55. Univ ersity of Michigan Press, Ann Arbor. Macfadyen, J. 1837. Order LXXXI. Pa ssifloreae. The Passion-Flowers. In Flora of Jamaica: a description of the plants of t hat island arranged according to the natural orders . With an appendix , containing an enumeration of the genera according to the Linnan system , and an essay on the geographical dist ribution of the species . Vol. II . ed. J. Macfadyen, 147-152. Distributed by the British Museum of Natural History, London. Mai, D.H. 1967. Die florenzonen der fl orenwechsel und die vorstellungen ber den klimaablauf im Jungtertir der Deutschen Demokratischen Republik. Abhandlungen des Zentralen Geologischen Institutes 10: 55-81. Mason-Gamer, R.J., C.F. Weil, and E.A. Kellogg. 1998. Granule-bound starch synthase: Structure, functi on, and phylogenetic utility. Molecular Biology and Evolution 15(12): 1658-1673. Mason-Gamer, R.J. 2001. Origin of North American Elymus (Poaceae: Triticeae) allotetrapoids based on granule-bound starch synthase gene sequences. Systematic Botany 26(4): 757-768.

PAGE 461

439 Masters, M.T. 1871. Contri butions to the natural histor y of the Passifloraceae. The Transactions of the Linnean Society of London 27: 503-645. Masters, M.T. 1872. Passifloraceae. In: Flora Brasiliensis , ed. A.W. Eichler, 13(1): 529-628. Sumptibus J.G. Cottae, Munich. Masters, M.T. 1887. Plantae Lehmannianae in G uatemala, Costarica et Columbia collectae. Passiflor aceae et Aristolochiaceae. Botanische Jahrbcher fr Systematik, Pfl anzengeschichte und Pflanzengeographie 8: 216-221. Masters, M.T. 1891. Undescri bed plants from Guatemala. Botanical Gazette 16: 7. Mathews, S., R.E. Spangler, R.J. Ma son-Gamer, and E.A. Kellogg. 2002. Phylogeny of Andropogoneae inferred fr om phytochrome B, GBSSI, and ndh F. International Journal of Plant Sciences 163(3): 441-450. Mayr, E. 1942. Systematics and the origin of s pecies from the viewpoint of a zoologist . Columbia University Press, New York. McCormick, S.P. 1982. Flavonoid chemistry of Passiflora subgenus Plectostemma . Dissertation , Department of Botany, Univeristy of Texas, Austin. McVaugh, R. 1977. Botani cal results of the Sess and Mocio expedition (1787-1803). I. Summary of excursions and travels. Contributions of the University of Michigan Herbarium 11: 97-195. McVaugh, R. 1980. Botani cal results of the Sess and Mocio expedition (1787-1803) II. The Icones Florae Mexicanae. Contributions of the University of Michigan Herbarium 14: 99-140. McVaugh, R. 1982. The lost paintings of the Sess and Mocio expedition: A newly available resource. Taxon 31: 691-692. Medikus, F.K. 1782/1783. Botanische Beobachtungen . Neue hof-und akademische Buchhandlung, Mannheim. Medikus, F.K. 1784. Botanische Beobachtungen . Neue hof-und akademische Buchhandlung, Mannheim. Medikus, F.K. 1787. ber einige kunsliche Geschlechter aus der MalvenFamilie . Neue hof und akademische Buchhandlung, Mannheim.

PAGE 462

440 Meerman, J.C. 2001. Lepidopt era of Belize 1. Butterf lies, 2. Emperor moths and hawk moths. Tropical Lepidoptera 10(Supplement 1). Melo, N.F. de, and M. Guerra . 2003. Variability of the 5S and 45S rDNA sites in Passiflora L. species with distinct base chromosome numbers. Annals of Botany , in press. Melo, N.F. de, A.C. Cervi, and M. Guerra. 2001. Ka ryology and cytotaxonomy of the genus Passiflora L. (Passifloraceae). Plant Systematics and Evolution 226: 69-84. Miller, R.E., and M.D. Rausher. 1999. Phylogenetic systematics of Ipomoea (Convolvulaceae) based on ITS and waxy sequences. Systematic Botany 24(2): 209-227. Minno, M.C. and M. Minno. 1999. Florida butterfly gardening: a complete guide to attracting , identifying , and enjoying butterflies of the lower south. University Press of Florida, Gainesville. Mishler, B.D. 1985. T he morphological, developmental, and phylogenetic basis of species concepts in bryophytes. The Bryologist 88: 207-214. Mitter, C., and D.R. Brooks. 1983. Phyl ogenetic aspects of coevolution. In Coevolution , ed. D.J. Futuyma and M. Slat kin, 65-98. Sinauer Assoc., Inc., Sunderland. Monardes, N. 1574. Segunda parte de la historia medicinal de las cosas que se traen de nuestras Indias occidentales, que sirven al uso medicina . En casa de Alonso Escriuano, Sevilla. Morison, R. 1680. Plantarum historiae universalis Oxoniensis . E. Theatro Sheldoniano, Oxonii. Morren, C. 1842. Recherches littrair es sur les fleurs de la passion, suivies d'observations anatomiques sure l'une d'entre elles ( Passiflora quadrangularis L.). Bulletins de l'Acadmie Royale des Sciences Bruxelles 9: 202-203. Morton, J. 1981. Atlas of medicinal plants of Middle America: Bahamas to Yucatn . C.C. Thomas, Springfield. Muschner, V.C., A.P. Lorenz, A. C. Cervi, S.L. Bonatto, T.T. Souza-Chies, F.M. Salzano, and L.B. Freitas. 2003. A first molecular phylogenetic analysis of Passiflora (Passifloraceae). American Journal of Botany 90(8): 12291238.

PAGE 463

441 National Imagery and Mapping Agency. Introduction to geographic names, http://gnpswww.nima.mil/geonames/GNS/i ndex.jsp, November 25, 2003. Penz, C.M. 1999. Higher level phyloge ny for the passion-vine butterflies (Nymphalidae, Heliconiinae) based on early stage and adult morphology. Zoological Journal of the Linnean Society 127: 277-344. Plukenet, L. 1691. Phytographia, seu stripium illus tratum et minus cognitarum icones, tabulis neis, summ di ligenti elaborat; quarum unaquaeque titulis descriptoriis, ex notis suis propriis, & characteristicis desumptis, insignita, ab aliis ejusdem sortis facile discriminatur . Selbstverlag, London. Plukenet, L. 1696. Almagestum botanicum sive Ph ytographi Pluckenetian onomasticon methodo synthet ic digestum, exhibens stirpium exoticarum, rariorum, novarumque nomina, qu descriptionis locum supplere possunt . Selbstverlag, London. Plumier, C. 1693. Description des plantes de l'Amrique . Imprimerie Royale, Paris. Pole, M. 1994. An Eocene macroflora from the Taratu Formation at Livingstone, North Otago, New Zealand. Australian Journal of Botany 42: 341-367. Proctor, G. 1967. Additions to the Flora of Jamaica. Bulletin of the Institute of Jamaica, Science Series 16: 27. Rsky, K. 1960. Pflanzenreste aus dem Obereozn Ungarns. Senckenbergiana Lethaea 41: 423-449. Reichenbach, H. G.L. 1828. Conspectus regni vegetabilis . Carl Cnobloch, Leipzig. Rieseberg, L.H., and L. Brouillet. 1994. Are many species paraphyletic. Taxon 43: 21-32. Roemer, M.J. 1846. Familiarum naturalium regni vegetabilis synopses monographicae . Landes-Industrie-Comptoir, Weimar. Roussel, H.F.A. de. 1806. Flore du Calvados et terreins adjacents: compose suivant la mthode de M. Jussieu, compare avec celle de Tournefort et de Linn, 2nd edition. Caen: Impr. de F. Poisson. Schlechtendal, D.F.L. 1854. Abhandlu ngen der Naturforschenden Gesellschaft zu Halle. Linnaea 27: 521.

PAGE 464

442 Sess, M., and J.M. Mocio. 1887-1890. Plantae Novae Hispaniae . Oficina de la Secretara de Fomento, Mxico. Sess, M., and J.M. Mocio. 1894. Flora Mexicana . Oficina de la Secretara de Fomento, Mxico. Smedmark, J.E., T. Erikss on, R.C. Evans, and C.S. Ca mpbell. 2003. Ancient allopolyploid speciation in Geinae (Rosaceae): Evidence from nuclear granule-bound starch synthas e (GBSSI) gene sequences. Systematic Biology 52(3): 374-385. Smith, C.W. Hawaiian alien plant studies, Passiflora suberosa , http://www.botany.hawaii.edu/faculty/ cw_smith/pas_sub.htm, November 25, 2003. Smith, J.E. 1814. Passiflora ( no. 20 ). In The cyclopaedia; or , universial dictionary of arts , sciences and literature , ed. A.R. Rees, vol. 27. Longman, Hurst, Rees, Orme & Browne, etc., London. Snow, N. and J.M. MacDougal. 1993. New chromosome reports in Passiflora (Passifloraceae). Systematic Botany 18: 261-273. Sokal, D.E., and T. Crovello. 1970. The biological species concept: A critical evaluation. American Naturalist 104: 127-153. Soltis, P.S., and D.E. Soltis. 2000. The role of genetic attributes in the success of polyploids. Proceedings of the Nationa l Academy of Sciences 97: 7051-7057. Spencer, K.C. 1988. Chemical m ediation of coevolution in the Passiflora Heliconius interaction. In Chemical mediation of coevolution , ed. K.C. Spencer, 167-240. Academic Press, San Diego. Sprengel, K. 1826. Systema vegetabilium . Sumtibus Librariae Dieterichianae, Gottingae. Standley, P.C., and L.O. Williams. 1961. Flor a of Guatemala. Passifloraceae. Fieldiana: Botany 24(7): 115-146. Stebbins, G.L. 1950. Variation and evolution in plants . Columbia University Press, New York. Stegmaier, C.E. 1973. Dasiops passifloris (Diptera: Lonchaeidae), a pest of wild passion fruit in south Florida. The Florida Entomologist 56: 8-10.

PAGE 465

443 Stevens, P.F. 1991. Charac ter states, morphological variation, and phylogenetic analysis: a review. Systematic Botany 16: 553-583. Storey, W.B. 1950. Chromosome numbers of some species of Passiflora occurring in Hawaii. Pacific Science 4: 37-42. Sun, Y., D.Z. Skinner, G.H. Liang, and S.H. Hulbert. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89: 26-32. Taylor, P. 1975. Orchids broug ht to life in the herbarium. Proceedings of the 8th World Orchid Confer ence Palmengarten, Frankfurt : 505-509. Toscano de Brito, A.L.V. 1996. The use of c oncentrated ammonia as an excellent medium for the restoration of orchid pollinaria: an example from the subtribe Ornithocephalinae (Orchidaceae). Lindleyana 11: 205-210. Tournefort, J.P. 1719. Institutiones rei herbariae . Typographia Regia, Paris. Triana, M., and J.E. Planchon. 1873. Passifloraeae. Annales des Sciences Naturelles 17: 121-186. Turner, B.L., and Z. Zhao. 1992. Docu mented chromosome numbers 1992: 2. Miscellaneous USA and Mexican species, mostly Asteraceae. SIDA: Contributions to Botany 15: 147-150. United States Geological Survey. Geographic names information system, http://geonames.usgs.gov, November 25, 2003. Vanderplank, J. 2000. Passion flowers and passion fruit , 3rd edition. The MIT Press, Cambridge. Wheeler, Q.D., and N.I. Platnick. 2000. The phylogenetic species concept ( sensu Wheeler and Platnick). In Species concepts and phylogenetic theory: A debate , ed. Q.D. Wheeler and R. Meie r, pp. 55-69. Columbia University Press, New York. Wilde, W.J.J.O de. 1971. The system atic position of tribe Paropsieae, in particular the genus Ancistrothyrsus , and a key to the genera of Passifloraceae. Blumea 9: 99-104. World Conservation Monitoring Centre. 1997 IUCN red list of threatened plants, http://www.unep-cmc.org/species/plants/ red_list.htm, November 25, 2003. Wright, C. 1869. Notes on Jussia . Journal of the Linnean Society. Botany 10: 476-480.

PAGE 466

444 BIOGRAPHICAL SKETCH Kristen Elizabeth Porter-Utley was born 15 August 1970 in Jacksonville, Florida, and was raised in Lake Wales, Fl orida. She went early-entry to Polk Community College and finished her Asso ciate of Arts degree (cum laude). From there she went to the Universi ty of Florida and earned a Bachelor of Science (cum laude) in environmental horti culture. In August 1997, she received a Master of Science degree through the D epartment of Botany at the University of Florida where she studied ethnobotany u nder the guidance of David Wigston. Soon afterward, Kristen decided to cont inue her education at the doctoral level under the advisement of Walter Judd in the Department of Botany at the University of Florida and began to study pl ant systematics. She chose to focus her research on her favorite group of plants, passion flowers, and became interested in the small, apet alous members of the genus Passiflora . As part of her dissertation research, Kristen conduc ted field work in the United States, Jamaica, Haiti, and Mxico.