Citation
Biochemical and functional analysis after in utero delivery of recombinant adeno-associated virus to a mouse model of glycogen storage disease type II

Material Information

Title:
Biochemical and functional analysis after in utero delivery of recombinant adeno-associated virus to a mouse model of glycogen storage disease type II
Creator:
Schleissing, Mary Rucker
Place of Publication:
[Gainesville, Fla.]
Publisher:
University of Florida
Publication Date:
Language:
English

Subjects

Subjects / Keywords:
Diaphragm ( jstor )
DNA ( jstor )
Gene therapy ( jstor )
Generally accepted auditing standards ( jstor )
Genomes ( jstor )
Glycogen ( jstor )
Glycogen storage disease type II ( jstor )
Liver ( jstor )
Plasmids ( jstor )
Skeletal muscle ( jstor )
Dissertations, Academic -- Molecular Genetics and Microbiology -- UF ( lcsh )
Molecular Genetics and Microbiology thesis, Ph. D ( lcsh )
acid, alpha, diaphragm, gene, glucosidase, GSDII, in, rAAV, therapy, utero
Genre:
government publication (state, provincial, terriorial, dependent) ( marcgt )
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Abstract:
ABSTRACT: Inherited metabolic disorders, such as glycogen storage disease type II (GSDII), result in early and sometimes irreversible cellular damage. Deficiency in acid alpha-glucosidase (GAA) leads to lysosomal accumulation of glycogen in all cell types, resulting in abnormal myofibrillogenesis in striated muscle. Contractile function of the diaphragm muscle is severely affected in both infantile-onset and later-onset patients with death often resulting from respiratory failure. We showed that delivery of recombinant adeno-associated virus (rAAV) vectors encoding the human GAA cDNA to the developing mouse model of this disease results in high-level transduction of diaphragm tissue and restoration of normal contractile function.
Abstract:
We injected Gaa-/- mice at 15 days gestation in the peritoneal cavity with rAAV-CMV-hGAA and analyzed expression in the diaphragm muscle at 1 month of age. Acid alpha-glucosidase activity reached normal levels and in some cases, was more than 10-fold higher than normal. Histological glycogen staining of treated diaphragms revealed prevention of lysosomal glycogen accumulation in almost all fibers when compared to untreated controls. Up to 50 estimated vector copies per diploid genome were quantified in treated diaphragms. Contractile function studies of diaphragms from 6-month-old in utero treated animals showed that treated diaphragms exhibited normal function unlike untreated controls. Delivery and expression of the therapeutic transgene to the mouse model of GSDII during the embryonic stage of development prevented lysosomal glycogen accumulation and abnormal contractile function in the diaphragm muscle. We showed that early correction of a genetic defect using rAAV gene therapy can effectively restore normal cellular function.
Abstract:
By delivering the transgene during embryonic development, before the immune system is fully developed, we were able to reduce many of the immunologic effects associated with transgene expression when vectors were delivered later in life. Results from this study can be applied directly to the rAAV gene therapy strategies currently being developed to treat patients suffering from GSDII.
Thesis:
Thesis (Ph. D.)--University of Florida, 2002.
Bibliography:
Includes bibliographical references.
System Details:
System requirements: World Wide Web browser and PDF reader.
System Details:
Mode of access: World Wide Web.
General Note:
Title from title page of source document.
General Note:
Includes vita.
Statement of Responsibility:
by Mary Rucker Schleissing.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Schleissing, Mary Rucker. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/1/2003
Resource Identifier:
029835333 ( ALEPH )
78123277 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

BIOCHEMICAL AND FUNCTIONAL ANALYSIS AFTER IN UTERO DELIVERY OF RECOMBINANT ADENO-ASSOCIATED VIRUS TO A MOUSE MODEL OF GLYCOGEN STORAGE DISEASE TYPE II By MARY RUCKER SCHLEISSING A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2002

PAGE 2

Copyright 2002 by Mary Rucker Schleissing

PAGE 3

This is dedicated to my grandmother. From Nanny I learned to have the courage to keep experiencing life, no matter the difficulty. That inspiration pulled me through breaking moments, and further, it encourages me still as I continue to challenge life, especially during these exciting times.

PAGE 4

iv ACKNOWLEDGMENTS It is with great appreciation and sincere thanks that I list here the individuals without whose tireless assistance and thoughtful insight this manuscript could never have been completed. I thank my mentor, Dr. Barry Byrne, especially for his innovative thoughts and broad knowledge of science and medicine. He has always been available as friend or mentor to guide me both professionally and personally. I appreciate the opportunity to work on cutting edge research in the young but promising field of gene therapy. I would like to thank all those in the lab who made my past few years memorable, especially Denise Cloutier, Thomas Fraites, Irene Zolotukhin, Greg Simon, Kerry Cresawn, Cathryn Mah, Laura Elliott, and Stacy Porvasnik. Most of them I have known as long as I have been at UF and I will greatly miss spending time with them. I am deeply grateful for the countless hours Stacy dedicated to surgeries and necropsies needed to complete this project. Tom provided critical experience and effort in the muscle-function experiments. I give special thanks to Irene for her dedication to providing the high quality vectors used in this study. Appreciation is extended to the Vector Core Lab, the Molecular Pathology Core, and the Electron Microscopy Core Facility (especially Melissa Lewis, Marda Jorgensen, Rosemarie Ross, and Jill Verlander) for their scientific support in the designated area. I would also like to thank my committee members and colleagues who I looked to for focus and direction.

PAGE 5

v Lastly, I would like to thank my parents and my sisters and their families for their continued support through the years, especially during critical or monumental times. I send a special thanks to all my close friends these past few years, especially, Jen, Angela, Laura, Tina, and Stacy. We have one thing in common: we possess all the power we need to succeed.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS..................................................................................................iv LIST OF TABLES..............................................................................................................x LIST OF FIGURES............................................................................................................xi ABSTRACT.....................................................................................................................xi v CHAPTER 1 INTRODUCTION.........................................................................................................1 Glycogen Storage Disease Type II................................................................................1 Deficiency of GAA among Pompe Patients......................................................2 Clinical Features of GSDII................................................................................2 Infantile-onset GSDII............................................................................2 Late-onset GSDII..................................................................................3 Cloning of the Human GAA cDNA...................................................................3 Mutation-Disease Correlation...........................................................................4 Methods of Diagnosis........................................................................................6 Acid -glucosidase Enzyme Trafficking, Processing, and Biochemistry.........6 Animal Models..................................................................................................9 Therapies for GSDII........................................................................................10 Gene Therapy Vectors Based on Adeno-Associated Virus........................................12 Basic Biology of AAV....................................................................................12 Gene Therapy Vectors Based on AAV...........................................................13 Recombinant AAV Vectors of Different Serotypes and Capsid Mutants.......14 Murine In Utero Gene Therapy...................................................................................15 2 MATERIALS AND METHODS................................................................................17 Cell Culture.................................................................................................................17 Culturing HEK-293 and C12 cells..................................................................17 ESC Culture Medium......................................................................................17 Murine Embryonic Fibroblasts........................................................................18 Passaging ESCs...............................................................................................18 Transient Transfections...............................................................................................19

PAGE 7

vii Protein Expression Assays..........................................................................................19 Acid -Glucosidase Activity Assay................................................................19 Acid -Glucosidase Staining of Tissues.........................................................20 Luciferase Expression Assay..........................................................................21 Beta-Galactosidase Expression Assay............................................................21 Beta-Galactosidase Staining of Tissues..........................................................22 Protein Concentration Determination..............................................................22 In Vitro Transcription/Translation Reactions..............................................................23 Purification of GAA Protein from Human Placenta...................................................23 Western Blotting.........................................................................................................24 Molecular Cloning of rAAV-h GAA 2.8 Plasmids........................................................25 Molecular Cloning of h GAA Truncations...................................................................29 Cloning of h GAA Truncation Expression Cassettes....................................................32 Production and Purfication of rAAV..........................................................................32 Recombinant AAVGAA Expression Titering............................................................32 Animal Techniques and Methods................................................................................33 In Utero Vector Delivery................................................................................33 Perfusion and Necrospy..................................................................................34 Histology.....................................................................................................................3 6 Periodic Acid-Schiff (PAS) and Hematoxylin and Eosin (H&E) Staining of Paraffin Embedded Tissues....................................................36 PAS Staining of Osmicated Tissues Embedded in Epon................................36 Electron Microscopy.......................................................................................37 Screening Gaa-/Breeders by PCR..............................................................................38 In Vitro Assessment of Diaphragm Contractile Function...........................................39 Diaphragm Muscle Strip Preparation..............................................................39 Determination of Optimal Length-Tension Relationship (Lo) and Isometric Force-Frequency Relationship (FFR).......................................40 Measurement of the Diaphragm Strip Cross-Sectional Area..........................40 Quantification of Vector Copies by Quantitative-Competitive PCR..........................41 Serum Antibody Imunoassay......................................................................................42 3 MOLECULAR CLONING OF VECTOR CONSTRUCTS AND FUNCTIONAL ANALYSIS OF RECOMBINANT AAV VECTORS.....................44 Analysis of rAAV-h GAA 2.8 Plasmids........................................................................45 Analysis of h GAA Truncation Plasmids......................................................................46 Translational Analysis of h GAA Truncations..................................................50 Functional Analysis of h GAA Truncation Expression Cassettes....................50 Discussion of Relevant Human Mutations......................................................53 Analysis of rAAV-h GAA 2.8 Vectors..........................................................................57 4 EMBRYONIC STEM CELL TRANSDUCTION......................................................64 Background of Murine Embryonic Stem Cells...........................................................64 An In Vitro Model of In Utero rAAV Transduction...................................................64

PAGE 8

viii Transduction of Embryonic Stem Cells......................................................................65 Isolation of ESC Clone with rAAV1 Stable Integration.............................................71 5 PRELIMINARY STUDIES........................................................................................75 Biochemical, Histological, and Electron Microscopic Analysis of Developing GAA Knockout Mice............................................................................................75 Acid -glucosidase Enzyme Activity Analysis..............................................76 Histological Analysis of Glycogen Content....................................................76 Electron Microscopic Analysis of Glycogen Content and Myofiber Structure....................................................................................................79 Genotypic Screening of Gaa-/Breeders.....................................................................85 Analysis of rAAV Infectious Titer Before and After Exposure to a Hamilton Syringe..................................................................................................................86 Development of In Utero Surgery Technique.............................................................88 Localization after In Utero Hepatic Injections............................................................89 Localization after In Utero Injections at Other Sites..................................................91 Survival Study of Gaa-/In Utero Injections...............................................................91 6 IN UTERO HEPATIC INJECTIONS WITH RECOMBINANT AAV2: BIOCHEMICAL AND FUNCTIONAL ANALYSIS OF DIAPHRAGM TRANSDUCTION......................................................................................................94 High Level Transduction of Diaphragm Muscle after Hepatic In Utero Delivery of rAAV2................................................................................................94 Acid -glucosidase Expression in Diaphragm Muscle after In Utero Delivery of rAAV2................................................................................................96 Western Analysis of Vector Produced GAA in Treated Diaphragms.........................97 Prevention of Lysosomal Glycogen Accumulation in Treated Diaphragms.........................................................................................................100 Preservation of Diaphragm Muscle Contractile Function.........................................100 Long-Term Gene Expression after In Utero rAAV2 Transduction..........................102 7 HIGH-LEVEL GENE EXPRESSION AFTER IN UTERO DIAPHRAGMATIC TRANSDUCTION WITH RECOMBINANT AAV SEROTYPE 1........................105 Expression of -Galactosidase after In Utero Delivery of rAAV Serotype 1..........105 Higher Level Expression Achieved Using rAAV Serotype 1...................................106 Prevention of Glycogen Storage Phenotype in Mouse Diaphragm...........................110 Determination of Genome Copy Number by QC-PCR.............................................112 Diaphragm Transduction as a Result of Intraperitoneal Exposure to rAAV In Utero ...............................................................................................................119 8 CORRECTING GAA DEFICIENCY IN OTHER MUSCLE GROUPS.................125 Transduction of Other Muscle Groups by In Utero Delivery of rAAV1..................125 Transduction of Gaa-/Skeletal Muscle after In Utero Intramuscular Injections.............................................................................................................127

PAGE 9

ix 9 TOLERIZATION TO VECTOR DERIVED PROTEIN IN MICE AFTER IN UTERO DELIVERY OF RECOMBINANT AAV..............................................133 Reduced Immune Response to Infusion of Recombinant Beta-Galactosidase after In Utero Delivery of rAAV1-CMV-LacZ..................................................135 Complete Tolerization of Gaa-/Mice to Recombinant Human GAA after In Utero Delivery of rAAV1-CMV-h GAA 2.8....................................................136 10 DISCUSSION AND FUTURE DIRECTIONS........................................................143 General Significance.................................................................................................143 Preclinical and Clinical Status of In Utero Gene Therapy........................................143 Advantages of In Utero Therapy...................................................................144 Immune Tolerance after In Utero Gene Therapy..........................................145 Risks Associated with In Utero Gene Therapy.............................................145 Germline Transmission.................................................................................146 Ethical Considerations...................................................................................147 Good vs. Poor Disease Candidates................................................................147 The Impact of In Utero Studies in the GSDII Mouse Model....................................148 Inexpensive and Effective Method of Vector Delivery to Prenatal Mice.....148 Expression Trends after In Utero rAAV Transduction.................................148 Biochemical and Functional Correction in Diaphragm after In Utero Peritoneal Exposure to rAAV.................................................................149 Intraperitoneal Delivery as a Efficient Method for Diaphragm Transduction............................................................................................150 Transduction of Skeletal Muscle after In Utero Delivery of rAAV.............151 Tolerance to Transgene Product Following In Utero Gene Delivery...........151 Duchenne Muscular Dystrophy as another Target Disease for Diaphragm Transduction........................................................................................................151 GSDII as a Candidate Disease for In Utero Gene Therapy......................................152 Established Results........................................................................................152 Useful Data Accumulated during this Study.................................................154 Future Studies in Nonhuman Primates..........................................................154 GLOSSARY....................................................................................................................156 LIST OF REFERENCES................................................................................................158 BIOGRAPHICAL SKETCH..........................................................................................175

PAGE 10

x LIST OF TABLES Table page 2-1 Primers used to create h GAA truncation 3Â’ ends...................................................31 5-1 Acid -glucosidase activities among 10 p.c., 15 p.c., and newborn Gaa-/and normal mice....................................................................................................77 7-1 Biochemical and genomic analysis of diaphragms after IP in utero delivery of rAAV1-CMV-h GAA 2.8..................................................................................124 9-1 Circulating hGAA antibody levels after in utero delivery of rAAV-h GAA ........142

PAGE 11

xi LIST OF FIGURES Figure page 1-1 Known mutations in the GAA gene.........................................................................5 1-2 Chemical structures of glycogen, maltose, and glucose..........................................8 2-1 Cloning strategy for removing h GAA 3Â’ UTR and constructing p43.2-h GAA 2.8......................................................................................................27 2-2 Human acid -glucosidase rAAV vector constructs.............................................28 2-3 Design for cloning new h GAA truncation 3Â’ ends into TopoII..............................30 3-1 Human acid -glucosidase rAAV vector constructs.............................................47 3-2 Recombinant AAV-h GAA constructs with and without 3Â’ UTR encode active proteins.......................................................................................................48 3-3. Secreted form of GAA produced from rAAV-h GAA constructs is active............49 3-4 Natural glycosylation and processing sites of human GAA..................................51 3-5 In vitro transcription/translation of h GAA trunctions produces proteins of expected size.........................................................................................................52 3-6 Human GAA truncation mutations do not produce active protein.........................54 3-7 No protein is detected in cells transfected with hGAA truncation plasmids.........55 3-8 Recombinant AAVGAA 2.8 vector constructs and particle titers.........................59 3-9 Expression titer of rAAV2-CMV-h GAA 2.8..........................................................62 3-10 Expression titer of rAAV2-CBA-h GAA 2.8 is significantly lower than rAAV2-CMV-h GAA 2.8........................................................................................63 4-1 Transduction of murine embryonic stem cells by rAAV......................................67 4-2 Patterns of expression within ESC colonies after rAAV1 transduction................69

PAGE 12

xii 4-3 Mosaic pattern of murine embryonic stem cells transduced by rAAV1-CBA-GFP.................................................................................................70 4-4 Isolation of stable embryonic stem cell line after rAAV1 transduction................72 5-1 Large glycogen inclusions are observed in 1-month-old Gaa-/heart...................81 5-2 Comparison of glycogen content among 1-month-old Gaa-/and normal skeletal muscle......................................................................................................82 5-3 Glycogen content of 1-month-old Gaa-/and normal diaphragm..........................83 5-4 Abnormal glycogen content is observed in 1-month-old Gaa-/liver....................84 5-5 Example of genotyping Gaa-/breeders by PCR...................................................87 5-6 Pictorial of murine in utero injection technique....................................................90 5-7 Localization of fluorescent beads after in utero hepatic injection........................93 6-1 Luciferase expression in diaphragm and liver after hepatic in utero delivery of rAAV2-CBA-Luc................................................................................95 6-2 In utero transduction of diaphragm muscle leads to production of wildtype levels of enzymatically active GAA protein in Gaa-/mice...................98 6-3 Mature 76-kD active form of human GAA is detected in rAAV2 transduced dipahragms..........................................................................................99 6-4 Accumulation of lysosomal glycogen is prevented in diaphragm of in utero rAAV2-CMV-h GAA 2.8-treated 1-month-old Gaa-/-mice.....................101 6-5 In utero delivery of rAAV2-CBA-h GAA 2.8 preserves diaphragm muscle contractile force in Gaa-/mice............................................................................103 6-6 Long-term GAA expression detected in 6-month-old Gaa-/rAAV2 in utero -treated diaphragms.................................................................................104 7-1 Beta-galactosidase expression in diaphragm after rAAV serotype 1 in utero transduction............................................................................................107 7-2 Biochemical analysis of GAA expression in diaphragm after in utero transduction with rAAV1-CMV-h GAA 2.8.........................................................109 7-3 Diaphragms treated with rAAV1-CMV-h GAA 2.8 are free of glycogen deposits................................................................................................................111 7-4 PCR of increasing copy number of vector and competitor plasmid DNA..........114

PAGE 13

xiii 7-5 QC-PCR of 5 x 105 copies of vector plasmid in the presence of increasing copies of competitor plasmid.............................................................115 7-6 Vector genome copies of rAAV1-CMV-h GAA 2.8 in utero -treated Gaa-/diaphragms determined by QC-PCR...................................................................118 7-7 Acid -glucosidase activity and western analysis of diaphragm muscle after intraperitoneal in utero delivery of rAAV1-CMV-h GAA 2.8......................122 7-8 Determination of vector genome copy number within diaphragm muscle after in utero intraperitoneal delivery of rAAV1-CMV-h GAA 2.8......................123 8-1 Beta-galactosidase expression in the quadriceps muscle after in utero delivery of rAAV1-CMV-LacZ...........................................................................126 8-2 Acid -glucosidase activity and western blot of skeletal muscle after intramuscular in utero delivery of rAAV1-CMV-h GAA 2.8................................129 8-3 Vector genome copy number within in utero IM injected skeletal muscle.........130 9-1 In utero partial tolerization of recombinant -galactosidase...............................137 9-2 In utero tolerization of recombinant human GAA protein in Gaa-/mice..........141

PAGE 14

xiv Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BIOCHEMICAL AND FUNCTIONAL ANALYSIS AFTER IN UTERO DELIVERY OF RECOMBINANT ADENO-ASSOCIATED VIRUS TO A MOUSE MODEL OF GLYCOGEN STORAGE DISEASE TYPE II By Mary Rucker Schleisisng December 2002 Chair: Barry J. Byrne Department: Molecular Genetics and Microbiology Inherited metaboloic disorders, such as glycogen storage disease type II (GSDII), result in early and sometimes irreversible cellular damage. Deficiency in acid -glucosidase (GAA) leads to lysosomal accumulation of glycogen in all cell types, resulting in abnormal myofibrillogenesis in striated muscle. Contractile function of the diaphragm muscle is severely affected in both infantile-onset and later-onset patients with death often resulting from respiratory failure. We showed that delivery of recombinant adeno-associated virus (rAAV) vectors encoding the human GAA cDNA to the developing mouse model of this disease results in high-level transduction of diaphragm tissue and restoration of normal contractile function. We injected Gaa-/mice at 15 days gestation in the peritoneal cavity with rAAV-CMV-h GAA and analyzed expression in the diaphragm muscle at 1 month of age. Acid -glucosidase activity reached normal levels and in some cases, was more than

PAGE 15

xv 10-fold higher than normal. Histological glycogen staining of treated diaphragms revealed prevention of lysosomal glycogen accumulation in almost all fibers when compared to untreated controls. Up to 50 estimated vector copies per diploid genome were quantified in treated diaphragms. Contractile function studies of diaphragms from 6-month-old in utero treated animals showed that treated diaphragms exhibited normal function unlike untreated controls. Delivery and expression of the therapeutic transgene to the mouse model of GSDII during the embryonic stage of development prevented lysosomal glycogen accumulation and abnormal contractile function in the diaphragm muscle. We showed that early correction of a genetic defect using rAAV gene therapy can effectively restore normal cellular function. By delivering the transgene during embryonic development, before the immune system is fully developed, we were able to reduce many of the immunologic effects associated with transgene expression when vectors were delivered later in life. Results from this study can be applied directly to the rAAV gene therapy strategies currently being developed to treat patients suffering from GSDII.

PAGE 16

1 CHAPTER 1 INTRODUCTION The research presented in this manuscript encompasses the use of recombinant adeno-associated virus (rAAV) for in utero gene therapy to prevent human disease, particularly acid -glucosidase (GAA) gene replacement for the treatment of glycogen storage disease type II (GSDII). Although results were promising, there is currently no cure for this devastating form of cardiac and skeletal myopathy. A synopsis of genetic mutations, pathogenesis, clinical features, diagnostic measures, and treatments associated with GSDII is presented in this chapter. Relevant animal models of GSDII, both naturally occurring and genetically generated, are described herein. Acid -glucosidase glycobiology and how it relates to protein or gene replacement strategies is also discussed. Finally, a summary of relevant rAAV delivery strategies including in utero gene transfer is presented. Glycogen Storage Disease Type II Glycogen storage disease type II (GSDII) or Pompe disease is a rare autosomal recessive disorder caused by a defect in the gene encoding acid -glucosidase (GAA) (60, 116). Acid -glucosidase reduces lysosomal glycogen and maltose to glucose by hydrolyzing -1,4 and -1,6 linkages at acid pH. In the absence of GAA, glycogen accumulates within lysosomes and cytoplasm of all cells. Pathophysiology of the disease is limited to striated muscle where accumulated glycogen causes disruption of the contractile apparatus, eventually leading to muscle weakness.

PAGE 17

2 Deficiency of GAA among Pompe Patients This deadly syndrome was first identified in 1932 by Pompe (112), when he described a 7-month-old patient as having an extremely enlarged heart and massive vacuolar deposits of glycogen in all tissues examined. Several decades later Hers (57) reported the identification of an acid -glucosidase protein and described its absence in five Pompe patients. The same laboratory next presented results from fractionation studies that localized the rat liver acid -glucosidase to the lysosomal compartment (78). The results of these studies established that GAA hydrolyzes glycogen within the lysosomal compartment and that deficiencies in the enzyme cause accumulation of its substrate within the same compartment. Of the nearly 40 lysosomal storage diseases now known, GSDII was the first to be characterized (96, 101). Clinical Features of GSDII Glycogen storage disease type II encompasses a broad spectrum of clinical manifestations. This is indicated by the varying degrees of disease severity, range in age of onset, scope of tissue involvement, and differences in residual enzyme activity (36). Two broad classes of GSDII are presented in this section: infantile onset and late onset. Infantile-onset GSDII Classically, Pompe disease refers to the more severe, infantile-onset form of GSDII. Symptoms present early in life, and patients are typically diagnosed after being admitted with pneumonia or similar respiratory illness. Chest x-ray demonstrates the massively enlarged heart and upon closer physical examination, patients are found to also suffer from severe muscular weakness, macroglossia, and mild hepatomegaly (60). Surface ECGs that result in short PR interval and tall QRS complexes are indicative of infantile Pompe disease (46). An increase in myocardioal mass index observed by ECG

PAGE 18

3 correlates with autopsy descriptions of thickened ventricle walls and septum along with decreased dimension of the inner chambers (60). Progressive thickening of the left ventricle leads to obstruction of left ventricular outflow, causing fatal ischemia or arrhythmia (60). In addition to limited cardiac output, patients also suffer from respiratory insufficiencies caused by respiratory muscle weakness and bronchial compression from the nearby enlarged heart. Biochemical analysis of muscle and skin biopsies reveals no residual GAA enzyme activity and above-normal levels of glycogen (144). The presence of lysosomal glycogen among these biopsies is confirmed by histochemical analysis and electron microscopy (11, 36, 48-50, 65). The infants succumb to cardiorespiratory failure typically before reaching one year of age (60). Late-onset GSDII There is a disease continuum among late-onset GSDII patients. Age of onset (from early childhood to adult years), residual enzyme activity levels, and tissue or organ involvement vary, but common among all patients is a greater prevalence of skeletal and respiratory muscle as opposed to cardiac involvement (37). Many times the disorder is misdiagnosed as a muscular dystrophy, until biopsies reveal abnormal glycogen and reduced levels of GAA activity (95, 119, 144). The disease progression among late-onset patients is much slower than in the infantile form. After a long disease course, death typically results from respiratory failure, a direct effect of diaphragm muscle weakness (36). Cloning of the Human GAA cDNA There has been significant progress in the treatment of GSDII since the cloning of the human cDNA and analysis of the genomic sequence. The gene was first mapped to the long arm of human chromosome 17 (17q25.2-q25.3) and found to be linked to the

PAGE 19

4 thymidine kinase locus (53, 64, 93, 139). Cloning and sequencing of the 3.6 kb cDNA soon led to the discovery of the 28 kb genomic sequence, which contains 20 exons (61, 62, 91, 94). The promoter region is a classic “housekeeping” promoter in that it is GC-rich, lacks TATA or CCAAT motifs, but contains several potential transcriptional binding sites: 2 AP-2 and 4 Sp-1 sites (62, 94). The GAA gene is ubiquitously expressed, but protein expression levels vary among and within tissues, suggesting that regulatory factors may be present at the translational level. A 25 bp cis -regulatory element containing Hes-1 and YY1 binding sites was identified within intron 1 (176). Depending on the cell line examined, the element was found to have both silencer and enhancer functions (177). This indicates varied transcriptional regulation among tissues. Mutation-Disease Correlation Many laboratories have attempted to establish correlations between the type of mutation and clinical manifestations of GSDII. This has been difficult because of the discovery of over 70 different mutations since the acid -glucosidase gene sequence was first identified less than two decades ago. These mutations are summarized in Figure 1-1, adapted from a recent review (116). Most mutations have been identified among individual patients, but a few mutations are more common among the general population. Genotype-phenotype correlations are more obvious among infantile-onset patients. Some mutations are deleterious, in that no active protein is encoded. Patients with the severe form of the disease are commonly homozygous or compound heterozygous for the same or different deleterious mutations (60, 116). Two deleterious mutations, exon 18 and

PAGE 20

5 Figure 1-1 Known mutations in the GAA gene. Devastating mutations of all sorts are found spanning the entire region of the GAA genomic sequence (Raben, N., P. Plotz, and B. J. Byrne. 2002. Acid alpha-glucosidase deficiency (glycogenosis type II, Pompe disease). Curr. Mol. Med. 2: 145-166).

PAGE 21

6 Arg854X, are discussed in Chapter 3, as they pertain to truncation mutations that were created in the h GAA cDNA. Methods of Diagnosis Aside from the standard screening methods previously mentioned (electrocardiogram, and enzymatic and histological analysis of muscle and skin biopsies), other methods of diagnosis have been established. These include immunocapture assays that can be used to detect different isoforms of GAA present in a blood sample and to determine whether the protein present is active (151, 152). Also, the use of liquid chromatography to detect tetraglucose oligomers in plasma and urine was recently explored (4). Elevated serum creatine kinase (CK) level has been used as a marker for muscle damage and is a more useful diagnostic tool among adult GSDII patients (7). Scanning of patients from certain ethnic backgrounds for known common mutations is also useful. Less-invasive methods such as measuring enzyme activity in leukocytes and cultured fibroblasts remain a reliable method of diagnosis (5, 7). Acid -glucosidase Enzyme Trafficking, Processing, and Biochemistry Exon 2 through 20 of the human acid -glucosidase gene code for the 952-amino acid protein, with the first exon of the gene not being translated (61, 62, 91, 94). Acid -glucosidase is a lysosomal enzyme that undergoes significant modifications before reaching the lysosome and being converted into its enzymatically active form. High mannose oligosaccharide groups are added to GAA and other lysosomal enzymes in the endoplasmic reticulum (ER) and the proteins are released from the ER membrane by cleavage of their C-terminal signal peptides (55, 169). The proteins are then transported to the cis -Golgi, where the bound mannose groups are phosphorylated at carbon 6 (111,

PAGE 22

7 148, 162). Mannose 6-phosphate receptors (M6PRs) present in the membrane of the trans -Golgi and at the cell surface recognize and bind mannose 6-phosphate (M6P) bearing enzymes and route them to lysosomes through a series of transport vesicles and endosomes (74). A small subset of lysosomal enzymes escapes M6PR-mediated routing from the trans -Golgi to the lysosome, and is instead released from the cell through the secretory pathway (169). The extracellular 110-kD precursor form of GAA is recaptured by M6PRs, present on the cell surface of the same or a nearby cell, and routed to the lysosome (73, 135, 161). In the lysosome, the 110-kD precursor form of GAA is successively cleaved at both termini to produce 95-, 76-, and 70-kD isoforms, of which 76and 70-kD are catalytically active toward their natural substrates, glycogen and mannose (61, 104, 169). At pH 4.3, GAA optimally cleaves -1,4 and -1,6 linkages of glycogen, maltose, and several synthetic substrates, releasing glucose as one of its products (57). Figure 1-2 shows an electron micrograph of glycogen -particles accumulated within lysosomes of heart of the Gaa-/mouse. Also pictured are the chemical structures of glycogen, maltose, and glucose with -1,4 and -1,6 linkages indicated (159, 160). The 110-kD precursor and 95-kD intermediate form of GAA exhibit limited activity on synthetic substrates, but exhibit extremely low activity on large macromolecules such as glycogen. It is believed that when the protein undergoes proteolytic cleavage to produce the mature 76and 70-kD isoforms, the catalytic site becomes more accessible to glycogen (104). Glycogen enters the lysosome either through autophagic vacuoles or by direct invagination of the plasma membrane; in both cases, the resulting vesicles eventually fuse with established lysosomes. In GSDII, glycogen goes undegraded and accumulates

PAGE 23

8 Figure 1-2 Chemical structures of glycogen, maltose, and glucose. Glycogen is a macromolecule consisting of individual glucose monomers linked in chains by -1,4 bonds or branches by -1,6 bonds. Maltose is a disaccharide of two -1,4 linked glucose monomers. Acid -glucosidase hydrolyzes lysosomal glycogen or maltose at their -1,4 or -1,6 linkages (Voet, D. and J. G. Voet. 1995. Glycolysis and Glycogen Metabolism, p. 443-512. Biochemistry. John Wiley & Sons, Inc., New York.). Glycogen MaltoseGlucose

PAGE 24

9 as lysosomes continue to fuse. Cytoplasmic gluconeogenesis, which controls the level of glycogen in the neutral environment, is not affected in GSDII patients. Animal Models In addition to naturally occurring animal models of GSDII (Brahman and Shorthorn cattle, Lapland dog, cats, sheep, and Japanese quail), two Gaa knockout mouse models have been created and extensively characterized (60). The main differences between the two strains are the region of the mouse genomic sequence in which a neomycin-resistance cassette was inserted and the background strains used. Both exon 13 and exon 6 targeted insertions were created in 129 ES cells and confirmed clones were injected into C57BL/6 blastocysts to produce 129-C57BL/6 chimeras. Exon 13 knockouts were maintained as backcrosses of the original chimeras to either C57BL/6 or FVB mice while exon 6 knockouts were maintained by intercrossing of progeny from the original chimeric male to a C57BL/6 female (16, 115). Analysis of the knockout strains revealed the presence of low levels of mutant mRNA, but no mutant protein was observed by western analysis, and all tissues reflected deficiency in GAA enzyme activity. Glycogen stores were detected as early as 3 weeks in exon 6 knockouts and 6 weeks in exon 13 knockouts (16, 18, 69, 115). Differences between the knockout strains were established phenotypically. Exon 13 knockouts develop cardiomyopathy, cardiomegaly, and left ventricular dysfunction by 32 weeks as determined by ECG and gross anatomy (16, 69). Cardiac dysfunction is not as obvious in exon 6 knockouts, but more sensitive physiologic testing is currently underway (115). Exon 6 mice develop more severe skeletal muscle weakness, with noticeable reduction in motility as early as one month of age (115). Progression of the disease in both strains eventually results in kyphosis, anterior muscle wasting,

PAGE 25

10 paralysis, and seizures (16, 115). Differences in modifier genes within the background strains could play a role in causing variation identified among the Gaa knockouts strains. The experiments performed in this study were completed using the exon 6 knockout line. Therapies for GSDII Until recently, all attempted treatments for GSDII failed. These treatments included high-protein, low-carbohydrate diets and steroid supplements to reduce glycogen synthesis; bone marrow transplantation; and protein replacement using purified unphosphorylated GAA from Aspergillis niger and human placenta (11, 29, 36, 67, 167). Currently, there is no widely accessible treatment for GSDII, although enzyme-replacement therapies (ERT) have progressed significantly in the treatment of many lysosomal storage disorders including GSDII (2, 10, 35, 68, 98, 127, 153, 154). The premise of ERT is based on targeting circulating enzyme to the lysosome through MPR-mediated endocytosis. Several studies showed that deficient cells in culture effectively take up human GAA isolated from various sources (62, 92, 120, 156, 157, 158, 179). Further, recombinant human protein has been delivered to animal models of GSDII and results indicate deficient tissues take up circulating protein (15, 17, 71). Limited success was reported from clinical trials (2, 153, 154) initiated to assess the efficacy of weekly injections of purified recombinant human protein, bearing M6P groups. Unlike gene replacement strategies, ERT requires lifelong treatment to maintain an effective outcome. We and others (22) showed the potential of viral vectors in treating GSDII. Early studies using retroviral constructs demonstrated gene replacement of GAA in deficient myoblasts and fibroblasts (180). Our group and others (3, 31, 32, 90, 102, 106, 107, 150) reported delivery of replication defective, E1-deleted adenoviral vectors containing the

PAGE 26

11 human GAA cDNA to human fibroblasts and myoblasts in vitro and to animal models of the disease in vivo through direct intramuscular, intracardiac, or portal vein injections. In vitro and in vivo transduction experiments indicate production of therapeutic levels of GAA and corresponding reduction of intracellular glycogen stores. In vitro transwell experiments with rAdGAA show that a fraction of GAA is secreted and can be taken up by neighboring untransduced cells (106, 107). Cross-correction of distant organs such as heart and skeletal muscle was achieved through high levels of rAdGAA transduction of liver in GAA deficient animals. Regrettably, anti-GAA antibody titers increased corresponding to a two-log reduction in the initial level of GAA enzyme (31). Clinical applications of gene-replacement strategies using recombinant adenoviral vectors are currently limited because of toxicity and transient expression due to host immune responses. A newer class of gene therapy vectors, based on adeno-associated virus (AAV), has become a popular vehicle for delivering genes to cells for the treatment of several diseases. Two recent studies (44, 81) demonstrate the use of recombinant AAV vectors encoding the human GAA cDNA for gene-replacement in deficient patient cells and two animal models. Lin, et al. (81) injected rAAV directly into the pectoral muscle of the Japanese quail model and demonstrated expression of GAA correlating with a decrease in intracellular glycogen content and an increase in muscle performance as measured by wing motion. Our group (44) showed the usefulness of intramyocardial and intramuscular delivery of a similar vector to the exon 6 knockout mouse model of GSDII. Both delivery methods established that near normal levels of GAA activity could be achieved, and in

PAGE 27

12 the case of the direct intramuscular injections, the increase in GAA activity correlated with an increase in muscle function. Gene Therapy Vectors Based on Adeno-Associated Virus Adeno-associated viruses (AAV) are small, nonpathogenic human viruses classified in the dependovirus genus within the Parvoviridae family. They are nonenveloped viruses and consist of a capsid structure surrounding a 4681 bp single-stranded DNA genome. Like other dependoviruses, AAV depends on coinfection with a helper virus, such as adenovirus, herpesvirus, or vaccinia, to complete a lytic infection (14). In the absence of a helper virus, AAV enters a latent phase, preferentially integrating into human chromosome 19 at a specific location called the AAVS1 site (75). Upon later infection with a helper virus, the AAV genome is excised from chromosome 19 and reenters the lytic phase. Long-term stable integration, which is a property of the latent phase of the AAV viral life cycle, makes this virus appealing as a gene-delivery system (43, 100). Basic Biology of AAV The AAV genome consists of two 145 bp inverted terminal repeats (ITRs) and two overlapping reading frames that encode Rep and Cap proteins. Rep transcripts are produced from the p5 and the p19 promoters. These encode for Rep 78 and 52 proteins. Alternative splicing of both transcripts allows for the translation of smaller Rep proteins, Rep 68 and 40. Rep 78 and 68 complete DNA excision and replication functions that are necessary for the lytic phase of the viral life cycle. Two alternatively spliced transcripts are transcribed from the p40 promoter. They encode the three viral capsid proteins (VP1, VP2, and VP3). The proteins VP2 and VP3 are translated from the same transcript using

PAGE 28

13 different initiation sites (14, 43). These proteins are provided in trans when recombinant AAV vectors are produced. Gene Therapy Vectors Based on AAV AAV possesses many attributes, within its lytic and latent phases, which are necessary for effective gene delivery systems (43, 100). Recombinant AAV is produced by infecting cells expressing the rAAV vector genome with a helper virus or providing them with the necessary gene products in trans. (51, 56, 80, 124, 174) . Therefore, the lytic phase of the AAV life cycle is recapitulated in tissue culture. The latent phase of the AAV life cycle is exploited during viral gene transfer. Once recombinant AAV enters a cell, the vector genomes are thought to be maintained by either stable integration into the host genome or by forming episomal intermediates (25, 34, 138, 140). Once integrated, the vector genome provides stable expression of the transgene, which is a critical attribute for gene therapy protocols. The viral ITRs are the only cis -acting sequences necessary in the production of rAAV. They are essential in viral replication, packaging, and rescue of both wild-type AAV and rAAV. The viral genes are omitted from the vector cassette since all Rep and Cap proteins are provided in trans . The cloning capacity of the expression cassette within the ITRs is approximately 4.7 kb. This is a critical drawback when the size of the promoter plus transgene is beyond this packaging capacity. Numerous experiments have been conducted using rAAV on cultured primary and transformed cells. More important, in vivo transduction experiments indicate the successful transduction of a variety of tissues including airway epithelium (42), skeletal muscle (25, 70, 40, 173), neurons (72, 108), retina (41, 79), and liver (137). There is

PAGE 29

14 variability in rAAV transduction efficiencies among the different tissue types. This is a result of varying viral receptor density on the surface of each cell type. Recombinant AAV Vectors of Different Serotypes and Capsid Mutants Six different serotypes of AAV have been isolated, and others are expected to be identified. AAV basic biology and rAAV transduction experiments described here were completed using serotype 2 vectors. There is a high level of homology among the different serotypes, but there is enough difference for each to have its own cell surface receptor. The receptor for rAAV2 and rAAV3 is heparin sulfate proteoglycan (117, 147). Fibroblast growth factor receptor 1 (FGFR) and V5 integrin have been identified as rAAV2 coreceptors (114, 146). Serotypes 4 and 5 bind sialic acid either as a receptor or as a component of a receptor complex (163, 164). Receptors for rAAV serotypes 1 and 6 have not yet been identified. Studies indicate preferential transduction of tissues by one vector over the other. In theory, this would indicate that that cell type expressed more viral receptors for that particular virus. Methods have been established by which rAAV vectors bearing capsid proteins from serotypes 1-6 can be efficiently produced (8, 23, 24, 117, 122, 171). The in vivo transduction potential of vectors created from these other serotypes is currently being investigated by several groups. Like others, our laboratory found that serotype 1 is more efficient than serotype 2 at transducing skeletal muscle cells (44). Other groups have gone a step further in trying to expand the tropisms of rAAV. AAV2 capsid proteins have been modified to expose specific ligands on the surface of rAAV (47). Yet another method of targeting specific cells is to use phage libraries, which express different peptides on their surface, to scan the tissue for specific protein

PAGE 30

15 sequences that bind. The nucleotides encoding the preferential ligands are then inserted into the capsid gene at a region which will expose the ligands on the outer surface of the vector molecule. Murine In Utero Gene Therapy Several studies in the literature report the delivery of gene therapy vectors, plasmid DNA, or genetically modified cells in utero to various animal models. Examples are delivery of recombinant vectors or genetically modified cells into fetal nonhuman primates, sheep, rabbits, guinea pigs, and rats through a variety of routes including intraamniotic or intratracheal administration as well as injection into the circulation by way of the umbilical vein (13, 19, 132, 133, 178). The gestational period of these animals varies greatly as does the size of the embryo that was injected. On the other hand, mice are about the size of your smallest fingertip when they are three-quarters through their gestation period. Therefore, for the purposes of this study, we found it of greater importance to focus on what is currently known in the area of murine in utero transduction. However, most of the information in this overview was not available when these experiments were initiated. There is very limited information on murine in utero gene delivery in the literature. The first murine in utero vector transduction experiments were conducted using recombinant adenoviral vectors. Pioneer studies involved delivering the LacZ , CFTR, or Factor IX gene in adenovirus into the amniotic fluid of fetal CFTR-/mice at 15 days p.c., three-quarters through the gestation period. Expression of the transgene was detected in the liver, epidermis, lung, and gastrointestinal tract (26, 33, 63, 77, 129). Several in utero CFTR treated knockout mice were rescued from lethal intestinal obstruction (26). Other studies using adenovirus were directed toward liver transduction

PAGE 31

16 via intrahepatic, intraperitoneal, yolk sac vessel, or retro-orbital injections to midgestation mice. These studies involved the delivery of the luciferase or LacZ reporter gene under transcriptional control of the cytomegalovirus (CMV) promoter (82, 83, 86, 126). When the animals reached a month of age, only minimal transgene expression was detected after a gradual decline in activity (82). Other vector studies indicated that CMV transcriptional activity is turned off a few weeks after initial expression. It is not known if expression in the liver after in utero vector delivery decreases because of promoter shut-off, an immunologic response to adenoviral transduction, or dilution of vector genomes as cells of the liver divide during fetal development. Even less is known about in utero delivery of adeno-associated virus to the developing murine fetus. To date, three published manuscripts and a handful of abstracts address this issue. Similar CMVLacZ or CMV-luciferase expression cassettes were used in the context of rAAV. In cases where the vector delivery was intrahepatic or intraperitoneal, expression was detected mainly in the liver and luminal wall of the peritoneal cavity. This activity dropped significantly over time (85, 130). However, studies involving intramuscular injections of vector containing CMV-driven LacZ or human factor IX expression cassettes indicated that transgene expression was maintained throughout the course of the experiment (99, 130).

PAGE 32

17 CHAPTER 2 MATERIALS AND METHODS Many methods were used in the experiments presented in this dissertation. In this chapter, procedures are described in significant detail to enable researchers to use the experiments presented. Any modifications to these procedures are explained in the following chapters. Molecular cloning methods are included in Chapter 4. Cell Culture Culturing HEK-293 and C12 cells Human embryonic kidney cells (HEK-293) and C12 cells (a derivative of the human cervical carcinoma cell line HeLa that contains the rAAV Rep gene) were cultured in DulbeccoÂ’s Modification of EagleÂ’s Medium (DMEM) containing 4,500 mg/L D-glucose and L-glutamine, no sodium pyruvate, Pen-Strep (100 IU/mL penicillin, 100 g/mL streptomycin), and 10% fetal bovine serum. ESC Culture Medium Embryonic stem cells (ESCs) were cultured in 3M media that contains specific supplements necessary for their maintenance. The formulation of 3M media is as follows: 500 mL Dulbecco's Modification of Eagle's Medium (DMEM) with 4,500 mg/L D-glucose and L-glutamine, no sodium pyruvate; 5 mL Pen-Strep solution (10,000 IU/mL penicillin, 10,000 g/mL streptomycin); 5 mL 100X Nonessential amino acids (all from Mediatech, Inc., Herndon, VA); 5 mL nucleoside stock (80 mg adenosine, 85 mg guanosine, 73 mg cytidine, 73 mg uridine, 24 mg thymidine dissolved in 100 mL Sigma water; all from Sigma, St. Louis, MO); 0.9 mL 2-Mercaptoethanol (1000X stock);

PAGE 33

18 75 mL Knockout™-SR (both from GIBCO™ Invitrogen Corporation, Carlsbad, CA); and 50 L ESGRO-LIF® (107 U/mL) (Chemicon International, Temecula, CA). Leukemia Inhibitory Factor (LIF) is a necessary component because it inhibits spontaneous differentiation of ESCs. Murine Embryonic Fibroblasts The ESCs were cultured on a feeder layer of murine embryonic fibroblasts (MEFs) for several reasons. The MEF’s secrete vital proteins, including Leukemia Inhibitory Factor (LIF), and serve as an attachment surface for dividing ESCs. The MEF’s were isolated from 13-day-old mouse embryos after digestion in a concentrated solution of Trypsin-EDTA at 37 C. They were cultured on 0.1% gelatin-coated 100 mm tissue culture dishes in DMEM supplemented with 15% fetal bovine serum, 100 IU/mL penicillin, and 100 g/mL streptomycin. Confluent layers were passaged 1 to 4 for additional propagation, or were treated for 3 hours with 10 g/mL Mitomycin C (Roche Diagnostics Corporation, Indianapolis, IN) diluted in culture media to prevent further proliferation. The ESCs were then plated onto the mitotically inactive MEFs. Passaging ESCs Since ESCs grow as colonies unlike other cell types, it is necessary to completely trypisinize the cells before they are seeded to new dishes. Also, the cells grow quite rapidly and need to be passaged 1 to 10 every 3 to 4 days with fresh media being added daily. If allowed to culture longer than this, the colonies become too large and the cells begin to grow on top of each other. At this stage they stand a greater chance of differentiating. Upon passage, the cells were trypsinized and triterated to reach a single

PAGE 34

19 cell suspension and seeded onto a confluent layer of MEFs plated on 100 mm dishes coated with 0.1% gelatin. Some experiments required culture of ESCs in the absence of MEFs. The ESCs were cultured as previously described, but when passaged, they were seeded directly onto 0.1% gelatin-coated dishes. On first passage, only a few ESCs attached to the dish and formed colonies, but after passaging 3 to 4 times, they finally adapted to the surface. This also gave the remaining mitotically inactive MEFs a chance to thin out at each passage. Transient Transfections Plasmid DNA (2 to 5 g) purified using a QIAprep kit (Qiagen, Valencia, CA) and 10 L Lipofectamine™ Reagent (GIBCO™ Invitrogen Corporation, Carlsbad, CA) were each separately mixed with 100 L OPTI-MEM medium (GIBCO™ Invitrogen Corporation) and then combined and incubated at room temperature for 45 minutes. The volume was brought to 1 mL with OPTI-MEM and the liposome-DNA mixture was added to one well of a six-well tissue culture dish containing approximately 70% confluent HEK-293 cells. Five hours later, the medium was exchanged for fresh OPTI-MEM medium not containing fetal bovine serum. Culture media and cell extracts were assayed for gene expression 48 to 72 hours later. Protein Expression Assays Acid -Glucosidase Activity Assay Acid -glucosidase naturally cleaves the 1,4-bond of glycogen, and in this fluorimetric assay converts the synthetic substrate 4-methylumbelliferyl-Dglucopyranoside (4-MUG, Calbiochem-Novabiochem Corp., San Diego, CA) to 4-methylumbelliferone (4-MU) and glucose (118, 123). Snap frozen tissues were

PAGE 35

20 homogenized in water using a PowerGen 35 homogenizer (Fisher Scientific, Pittsburgh, PA) and cell pellets were resuspended in water and lysed by 3 freeze/thaw cycles. Lysates were isolated by centrifugation at 14000 rpm for 2 minutes. Then, 20 L of tissue or cell extract was added to each well in triplicate to a black 96-well Costar® plate (Corning, Inc., Acton, MA). Next, 40 L of substrate solution (2.2 mM 4-MUG in 0.2 M sodium acetate pH 3.6) was added to each well. The plate was covered with parafilm and incubated at 37 C for 1 hour. Then each reaction was stopped by adding 200 L of 0.5 M sodium carbonate (pH 10.7). Standards ranging from 1 to 500 M 4-MU were included on each plate. Concentrations of 0, 3.125, 6.25, 12.5, 25, 50, 100, and 500 M 4-MU in a volume of 20 L were added per well in addition to 40 L of 0.2 M sodium acetate, pH 3.6 and 200 L of 0.5 M sodium carbonate (pH 10.7). Fluorescence was then measured using an FLx800 Microplate Fluorescence Reader (Biotek Instruments, Inc., Winooski, VT) by exciting the sample at 360 nm and detecting at 460 nm. Acid -glucosidase specific activity was quantified in nmoles of substrate hydrolyzed (nmoles 4-MUG/hr/mg protein) based on a standard curve of 4-MU concentrations and standardized by protein concentration determination by DC Protein Assay (Bio-Rad, Hercules, CA). Acid -Glucosidase Staining of Tissues Acid -glucosidase expression in tissues was visualized using a method similar to that used to detect -galactosidase. Acid -glucosidase was detected by cytochemical staining using the synthetic substrate 5-bromo-4-chloro-3-indolyl-D-glucopyranoside (X-Gluc, Calbiochem-Novabiochem Corp., San Diego, CA). After the animals were perfused with phosphate buffered saline (PBS) and the tissues harvested, a portion was

PAGE 36

21 placed in 4% paraformaldehyde for 1 hour. After washing with PBS, X-Gluc stain (0.25 mM potassium ferricyanide, 0.25 mM potassium ferrocyanide, 1 mM magnesium chloride, 1 mg/mL X-Gluc in PBS reduced to pH 3.6) was added and the samples were incubated at room temperature overnight. The tissues were photographed using a digital camera attached to a dissecting microscope. Luciferase Expression Assay The Luciferase Assay System (Promega, Madison, WI) was used to quantify the expression of luciferase. The samples were prepared by homogenization in 300 L of water. Then 20 L of the supernatant and 100 L of luciferase assay substrate diluted in assay buffer were added to a glass test tube and incubated at room temperature for 20 minutes. The intensity of light emitted from the reaction was detected using the Monolight® 2010 luminometer (BD Biosciences, Mississauga, ON). Luciferase expression was reported as relative light units per g protein as determined by DC Protein Assay (Bio-Rad, Hercules, CA). Beta-Galactosidase Expression Assay One method used to determine -galactosidase expression was luminescence detection using Galacto-Star™ chemiluminescent reporter gene assay system (Applied Biosystems, Foster City, CA). Tissues were snap frozen in liquid nitrogen and stored at -80 C in cryotubes until assayed. Tissues were homogenized in the presence of 300 L lysis buffer, the homogenates spun down, and the lysates transferred to new tubes. Dilutions of recombinant -gal ranging from 5 ng/mL to 10 g/mL were used for a standard curve. Either 10 L of lysate or -gal standard was added to a glass test tube and 100 L of reaction buffer added. The reaction was allowed to proceed for 1 hour at room

PAGE 37

22 temperature after which luminescence was detected using the Monolight® 2010 luminometer (BD Biosciences, Mississauga, ON). Beta-galactosidase expression was reported as ng -gal per g protein as determined by DC Protein Assay (Bio-Rad, Hercules, CA). Beta-Galactosidase Staining of Tissues Beta-galactosidase expression in tissues was also analyzed by cytochemical staining. After animals were perfused with PBS, the tissues were harvested and placed in 4% paraformaldehyde for 1 hour. After washing with PBS, X-Gal stain (5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM magnesium chloride, 1 mg/mL 5-bromo-4-chloro-3-indolyl-D-galactopyranoside (X-Gal from Sigma, St Louis, MO)) in PBS was added to the tissues. After overnight incubation at room temperature, -galactosidase expression in the tissues was imaged using a digital camera attached to a dissecting microscope. Protein Concentration Determination The DC Protein Assay kit (Bio-Rad, Hercules, CA) was used according to manufacturer’s suggestions to determine protein concentration of cell extracts and tissue homogenates. The colorimetric assay was based on the Lowry method of protein determination. Dilutions of bovine serum albumin ranging from 0.2 to 1.5 g/ L were used to create a standard curve. Standards and samples (5 L) were added to a clear 96-well microtiter plate, followed by the addition of reagent A (25 L) and regeant B (200 L). The reaction was allowed to proceed for 15 minutes at room temperature after which absorbance at 750 nm was determined using a Quant microplate reader (Biotek

PAGE 38

23 Instruments, Inc., Winooski, VT). Protein concentrations were reported as g/ L of sample. In Vitro Transcription/Translation Reactions TNT® Quick Coupled Transcription/Translation System (Promega, Madison, WI) was used as described by manufacturer’s recommendations. Circular plasmid DNA (2 g) was mixed with Sp6 TNT® Quick Master Mix in the presence of methionine and Transcend ™ Biotin-Lysyl-tRNA. The Master Mix contained rabbit reticulocyte lysate, reaction buffer, Sp6 RNA polymerase, nucleotide mixture, amino acid mixture, and RNasin® ribonuclease inhibitor. The biotinylated lysine-tRNA complex allowed for easy detection of translated proteins after separation by SDS-PAGE. The following was mixed and incubated at 30 C for 90 minutes: 40 L master mix, 1 L of 1 mM methionine, 2 L of 0.5 g/ L plasmid DNA, 2 L Biotin-Lysyl-tRNA, and 5 L nuclease-free water. The translated proteins (5 L of 50 L total reaction) were combined with SDS-sample buffer, denatured, and separated on an 8% Tris-Glycine gel. The gel was transferred to nitrocellulose membrane, blocked, and probed with streptavidin-HRP to detect biotin-labeled proteins. Purification of GAA Protein from Human Placenta Approximately 300 g of human placenta was mixed with 1 L distilled deionized water and homogenized using a blender. The homogenate was filtered through gauze and the pH reduced to between 3.8 and 4.0 using 12 N hydrochloric acid. Upon centrifugation at 2000 rpm for 30 minutes, the supernatant was neutralized using 4 N sodium hydroxide. After the addition of ammonium sulfate (NH4SO4) at a final concentration of 500 g/L, the mixture was incubated at 4 C overnight under constant mixing. Precipitated proteins

PAGE 39

24 were pelleted at 2000 rpm for 30 minutes and resuspended in a minimal volume of AP buffer (50 nM sodium acetate, 20 mM sodium phosphate, 1 M sodium chloride, pH 5.2). The suspension was dialyzed overnight at 4 C in AP buffer, with fresh buffer being exchanged every few hours. The dialyzed mixture was centrifuged at 12,000 rpm for 20 minutes at 4 C and the supernatant was loaded onto a Concanavalin A-Sepharose 4B (Amersham Biosciences, Piscataway, NJ) column equilibrated with AP buffer at a rate of 25 mL/hr. The column was rinsed with AP buffer at the same speed overnight and the flow-through was collected in 8 mL fractions. Each fraction was checked for protein content. Acid -glucosidase protein was then eluted overnight from the column using AP buffer plus 1 M methyl -D-glucopyranoside at 25 mL/hr. After screening all fractions for GAA activity, positive fractions were pooled and concentrated using Centricon® Plus-80 concentrators (30 kD cut-off membrane) (Millipore Corp., Bedford, MA). Purity and content was determined by separating the purified protein on a 10% SDS-polyacrylamide gel and analyzing by Coomassie stain and western. Specific activity was then quantified and aliquots of pure protein were stored at -80 C. Western Blotting Rabbit polyclonal antiserum was raised against placentally derived human acid -glucosidase as previously described (107). The antiserum was used for Western blotting to detect hGAA protein. Cell pellets were resuspended in PBS followed by 3 freeze/thaw cycles and snap-frozen tissues were homogenized in water using a PowerGen 35 homogenizer (Fisher Scientific, Pittsburgh, PA). Lysates were isolated by centrifugation at 14000 rpm for 2 minutes. Depending on the experiment, 5 to 25 g of total protein was applied to Novex® 8% Tris-Glycine gels (Invitrogen Life Technologies,

PAGE 40

25 Carlsbad, CA) and separated at 125 V for approximately 2 hours. After transfer to nitrocellulose filters, blots were probed with 1:1000 dilution of primary antibody followed by 1:5000 dilution of peroxidase-labeled anti-rabbit IgG (Amersham Biosciences Corp., Piscataway, NJ) and detected using the ECL+Plus chemiluminescence kit (Amersham Biosciences Corp., Piscataway, NJ). Human placental GAA was included on each blot as a positive control. Derivations of this procedure are clarified within each chapter where western blotting is used. Molecular Cloning of rAAV-h GAA 2.8 Plasmids In order to create h GAA 2.8 plasmids, the 3’ end of the human GAA cDNA had to be altered. First, the 3’ end of the h GAA cDNA, minus the 3’ UTR, was amplified from p43.2-h GAA 3.1 (Figure 2-1A) using a 5’ primer synthesized from bp 2285-2300 of the h GAA coding sequence (5’-AAGTGACTGGCTACTT-3’) and a 3’ primer containing bp 2848-2856 of h GAA coding sequence as well as a BclI site (which includes an in-frame TGA stop codon) and an XbaI site (5’-TCTAGATGATCAACACCAGCT-3’). The new 3’ end of the h GAA cDNA was amplified through 35 cycles of denaturation at 95 C for 1 minute, annealing at 60 C for 1 minute, and elongation at 72 C for 2 minutes using a RoboCycler® Gradient 96 thermocycler (Stratagene, La Jolla, CA). The plasmid, TopoII-h GAA 3’end, was created by cloning the 594 base pair PCR product into pCR-TopoII (Invitrogen Life Technologies, Carlsbad, CA) (Figure 2-1B). The 5’ portion of h GAA from p43.2-h GAA 3.1 was isolated via NheI-EcoNI digestion, and ligated into TopoII-h GAA 3’end after SpeI-EcoNI digestion to create TopoII-h GAA 2.8 (Figure 2-1C). The rAAV2 expression plasmid, p43.2-h GAA 2.8 (Figure 2-1E), was created by cloning

PAGE 41

26 the h GAA coding region from TopoII-h GAA 2.8 (Figure 2-1C) into p43.2 (Figure 2-1D), by way of like KpnI-XbaI sites. The rAAV vector, pTR-CBA-h GAA 3.1 (Figure 2-2C) containing the h GAA coding region and 3Â’ UTR under the control of the CBA promoter, was generated by replacing the CMV promoter of p43.2-h GAA 3.1 with the CBA promoter found in the rAAV2 vector, UF12. The CBA promoter fragment was released by a BglII/SpeI digest of UF12 and cloned in place of the CMV promoter after p43.2-h GAA 3.1 was digested with BglII/NheI. A similar construct, pTR-CBA-h GAA 2.8 (Figure 2-2D), containing only the h GAA coding region, was constructed by digesting both p43.2-h GAA 2.8 (Figure 2-2B) and pTR-CBA-h GAA 3.1 (Figure 2-2C) with SnaBI-StuI, and replacing the CMV promoter and 5Â’ coding region of GAA in p43.2-h GAA 2.8 with the CBA promoter and 5Â’ portion of GAA from pTR-CBA-h GAA 3.1. A plasmid was also generated in which the 3.1 kb h GAA cDNA was under the control of a truncated CBA promoter. First, a 300 base-pair deletion of the CBA promoter was created in the rAAV2 vector, UF11, between restriction sites Bpu1102I and Bsp120I. The new plasmid, UF11-300, contained a deletion within the first intron of -actin. The 5Â’ portion of the CBA promoter from pTR-CBA-h GAA 3.1, was replaced with the same region of the CBA promoter from UF11-300, but which contained the 300 bp deletion. To achieve this, both UF11-300 and pTR-CBA-h GAA 3.1 were digested with KpnI and SgrAI and the appropriate fragments ligated to generate pTR-CBA300-h GAA 3.1. The same strategy use to generate pTR-CBA-h GAA 2.8, was utilized in the construction of pTR-CBA300-h GAA 2.8 (Figure 2-2F). Both pTR-CBA300-h GAA 3.1 (Figure 2-2E) and p43.2-hGAA2.8 (Figure 2-2B) were digested with SnaBI-StuI. The

PAGE 42

27 Figure 2-1 Cloning strategy for removing h GAA 3Â’ UTR and constructing p43.2-h GAA 2.8. The original rAAV h GAA construct containing the coding sequence plus the 3Â’ UTR (A) was used to amplify a 584 base pair fragment containing only the 3Â’ coding region of h GAA . The PCR product was ligated into TopoII to create TopoII-h GAA 3Â’end (B). TopoII-h GAA 2.8 (C), which contains only the coding region, was constructed by ligating the 5Â’ coding region of h GAA into TopoII-h GAA 3Â’end (B). The rAAV expression plasmid p43.2-h GAA 2.8 (E) was constructed by ligating the coding region of h GAA from TopoII-h GAA 2.8 into the rAAV2 expression plasmid, p43.2 (D), within the MCS located between two ITRs. Poly Ap43.2-h GAA 3.1 (4840 bp) ITR CMV Promoter h GAA cDNA 3Â’UTR ITRXhoI PshAI EcoNI XbaI 584 bpp43.2 ITR CMV Promoter Poly A MCS ITRNheI, XhoI, EcoRI, KpnI , XbaI , SalI, NotIp43.2-h GAA 2.8 (4540 bp) ITR CMV Promoter h GAA cDNA Poly A ITRXhoI PshAI EcoNI MCS MCSNheI, XhoI, EcoRI, KpnI BclI, XbaI, SalI, NotIA5Â’ AGCTGGTGT TGA TCA TCTAGA 3Â’NsiI, HindIII, KpnI, SacI, BamHI, SpeI, EcoRI BclI, XbaI, EcoRI, EcoRV, NotI, XhoI, NsiI, XbaIBcl I Xba I STOP New 3Â’ end of hGAATopoII-h GAA 3Â’end SP6 h GAA 3Â’ end T7 EcoNI BclI, XbaI 584 bp MCS a MCS b B D E CTopoII-h GAA 2.8 SP6 T7 EcoNI NsiI, HindIII, KpnI , XhoI, EcoRI MCS a BclI, XbaI , EcoRI, EcoRV, NotI, XhoI, NsiI, XbaI MCS b h GAA cDNA

PAGE 43

28 Figure 2-2 Human acid -glucosidase rAAV vector constructs. Diagrammed are rAAV vector constructs consisting of the full h GAA coding region plus 3Â’ UTR under the transcriptional control of the CMV promoter (A), the CBA hybrid promoter (C), and the truncated CBA300 promoter (E). Also pictured are smaller constructs in which the CMV, CBA, and CBA300 promoters are cloned upstream of the h GAA coding region (B, D, and F, respectively). The packaging size of each vector within its ITRs is also noted. p43-h GAA 3.1 (4840 bp) ITR CMV Promoter h GAA cDNA Poly A 3Â’UTR ITRPoly A ITR CMV Promoter h GAA cDNA ITRp43-h GAA 2.8 (4540 bp)Poly ApTR-CBA-h GAA 3.1 (5648 bp) ITR CBA Promoter h GAA cDNA 3Â’UTR ITR CMV epTR-CBA-h GAA 2.8 (5348 bp) ITR CBA Promoter h GAA cDNA Poly A ITR CMV epTR-CBA300-h GAA 3.1 (5355 bp) ITR CBA300 P h GAA cDNA Poly A 3Â’UTR ITR CMV epTR-CBA300-h GAA 2.8 (5055 bp) ITR CBA300 P h GAA cDNA Poly A ITR CMV eA B C D E F

PAGE 44

29 CMV promoter and 5Â’ segment of h GAA within p43.2-h GAA 2.8 were replaced with the fragment containing the CBA300 promoter and 5Â’ coding region of GAA from pTR-CBA300-h GAA 3.1. Molecular Cloning of h GAA Truncations A cloning approach similar to the one used to create the 3Â’ UTR deletion was utilized in generating h GAA 3Â’ truncations. The new truncated 3Â’ ends of the coding region were amplified and cloned into pCR-TopoII (Invitrogen Life Technologies, Carlsbad, CA) (Figure 2-3). After sequencing, the clones were designated TopoII-924, TopoII-880, and TopoII-815. Listed in Table 2-1 are the primers used to create the new 3Â’ ends and the size of each amplification fragment. Each antisense primer was designed to have flanking regions of 12 bases which hybridized to the nucleotides encoding the amino acids before and after the natural processing site. A KpnI site, an in-frame TAA stop codon, an XbaI site, and a second in-frame TAG stop codon located within the XbaI site were engineered between the flanking regions. In the event the truncation proteins were active, the KpnI site offered a way to create in-frame GFP fusion proteins. The XbaI site, located at the very end, presented a convenient way to clone the final truncations into rAAV expression cassettes. The remaining 5Â’ coding region of h GAA was cloned upstream of each truncation 3Â’ end. TopoII-924, TopoII-880, and TopoII-815 were digested with SpeI (located in the MCS) and AarI (located in the gene) to allow for direct ligation of the 5Â’ end of h GAA isolated from p43.2-h GAA 3.1 after digestion with NheI and AarI. The resulting full length truncation plasmids, TopoII-h GAA 924, TopoII-h GAA 880, and TopoII-h GAA 815, were confirmed by sequence analysis.

PAGE 45

30 Figure 2-3 Design for cloning new h GAA truncation 3’ ends into TopoII. Primers listed in Table 3-1 were used to amplify new 3’ ends (KpnI TAA A XbaI (TAG)) for three different h GAA truncation mutations based on natural carboxy-terminal cleavage sites at amino acid residues 926, 881, and 816 of the human GAA protein. These amplified fragments were ligated into pCR-TopoII and verified by sequence analysis. 76 kD mature enzyme 70 kD mature enzyme 140233390470513-524652 925 882 140 68 70 77 119 122 123 1 2 29204 206 228816926 881 952 pCR-TopoII MCS Formula for new 3’ ends (X-1) — KpnI — TAA — A — XbaI (TAG) — (X) — (X+1) where X is amino acid at natural cleavage site

PAGE 46

31 Table 2-1 Primers used to create h GAA truncation 3’ ends 924 truncation 3’ end – 513 bp 5’ primer 5’AAGTGACTGGCTACTTCC -3’ 3’ primer 5’GGTGAAGTTGGATCTAGATTTAGGTACCGACAGGGACACC -3’ 880 truncation 3’ end – 381 bp 5’ primer 5’AAGTGACTGGCTACTTCC -3’ 3’ primer 5’GTTATTCCTGGCTCTAGATTTAGGTACCCAGGAAGATGAC -3’ 815 truncation 3’ end – 526 bp 5’ primer 5’TTCCTGGGCAACACCTCA -3’ 3’ primer 5’CAGGTGGACGTTTCTAGATTTAGGTACCGATGGTGTCCAG -3’

PAGE 47

32 Cloning of h GAA Truncation Expression Cassettes A series of CMV expression plasmids were constructed to determine if the proteins encoded by the truncation cassettes were enzymatically active. The rAAV2 expression vector, p43.2, and each of the h GAA truncation shuttle vectors, TopoII-h GAA 924, TopoII-h GAA 880, and TopoII-h GAA 815, were digested with EcoRI. EcoRI restriction sites flanked the truncation genes allowing them to be directly inserted into the MCS of p43.2, immediately downstream of the CMV promoter and between the AAV ITRs. Production and Purfication of rAAV The vectors used in this study were created through a combined effort from the Vector Core Lab and Irene Zolotukhin. Highly purified rAAV serotype 2 vector was generated using methods developed in the lab (181). Producer cells were cotransfected with expression plasmids (p43.2-h GAA 2.8, pTR-CBA-h GAA 2.8, pTR-CBA300-h GAA 2.8 and pTR-CBA-Luc) and a rAAV2 helper/packaging plasmid, pDG (174). After 48 hours of culture, the cells were lysed and crude lysate was first purified on an iodixanol gradient. Resulting viral fractions were pooled and further purified on a heparin column. Pure virus was concentrated and analyzed by dot-blot to determine the particle titer and infectious center assay to quantify infectious titer. Similar techniques were used to produce serotype 1 rAAV-CMV-h GAA 2.8 and rAAV-CMV-LacZ, but pXYZ1 was used as the helper/packaging plasmid and the heparin column purification step was eliminated (117). Recombinant AAVGAA Expression Titering Serial dilutions of each vector were prepared in a 96-well dish after first mixing 2 L of pure virus with 198 L of media (10-2 dilution). After this, 20 L of 10-2 dilution

PAGE 48

33 was added to 180 L of media. This step was repeated three more times until 10-5 dilution was reached. Each dilution of vector (50 L) and 150 L of 1:100 dilution of wildtype adenovirus was added in triplicate to a confluent 12-well dish of C12 cells in a total volume of 300 L of media. The cells were incubated at 37 C for 48 hours, harvested, resuspended in PBS, and lysed after 3 freeze/thaw cycles. Acid -glucosidase activity was assayed as described and averages from triplicate samples were plotted as a function of infectious particles present in the dilution. Animal Techniques and Methods In Utero Vector Delivery Animal procedures were performed in accordance with the guidelines of the University of Florida Institutional Animal Care and Use Committee. On day 15 of gestation, pregnant females were anesthetized using 0.03 mL/gm total body weight of 20 mg/mL Avertin (tribromoethanol in tert-amyl alcohol diluted in PBS) administered intraperitoneal. This dose ensured that the mouse was anesthetized for approximately 20 minutes. A midline laparotomy was performed on each pregnant female with the abdominal wall being retracted to expose the peritoneal cavity. Each horn of the uterus was exposed individually onto a prewarmed saline-moistened sponge to keep the fetuses moist. The liver of each fetus was identified and correctly positioned using a dissecting microscope. Up to 10 L of saline, beads, or vector was injected into each fetus. Trypan blue dye was added to the injection medium to ensure a direct injection was achieved. A preloaded Hamilton syringe bearing a 33 gauge needle with beveled end and side pore (Hamilton Company, Reno, NV) was inserted through the uterine wall into the fetal liver or peritoneal cavity. The needle was retracted and slight pressure applied to the injection

PAGE 49

34 site using a cotton applicator until the uterine wall resealed. After the injections, the first horn was returned to the abdominal cavity and an identical procedure was performed on the second uterine horn. After replacing the entire uterus into the abdominal cavity, 1.0 mL prewarmed saline was added to the cavity to ensure the contents were moist. The abdomen was then closed in two layers. The abdominal muscle layer was sewn using 5-0 prolene and the skin layer was closed using 5-0 vicryl. Ampicilin (2.4 L/gm body weight of 0.1 g/mL stock) and Buprenorphine (0.1 mg/kg) were administered after the surgery to control infection and pain. Mothers were monitored until they regained consciousness after which they were returned to the colony and permitted to proceed with the pregnancy. Newborn pups were kept with their mothers for 1 month before weaning. Perfusion and Necrospy The animals were anesthetized using 0.03 mL/gm total body weight of 20 mg/mL Avertin (tribromoethanol in tert-amyl alcohol diluted in PBS) administered intraperitoneal. After weight and sex were determined, the animals were secured on a perfusion tray and opened along their midline. Organs were displaced to locate the lower main artery and a 1 mL syringe and a 29 gauge needle were used to extract approximately 0.5 cc of blood. The chest was then opened to expose the heart, being careful not to damage the diaphragm in the process. A 24 gauge catheter was placed in the left ventricle of the heart and a syringe connected to perfusion tubing was then attached to the catheter. Preloaded PBS at pH 7.4 was then circulated through the heart at a rate of 2 mL/min. After perfusion began, the jugular vein in the right side of the neck was cut to release the perfusion outflow. The PBS rinse was allowed to proceed for 5 minutes, after which the stopcock was switched to the tubing containing preloaded fixation solution

PAGE 50

35 (2% paraformaldehyde/1% glutaraldehyde in PBS, pH 7.4). After ten minutes of fixation perfusion, the catheter was removed and the animal moved to a harvesting station. In some cases, fixation was not necessary and the catheter was removed after 5 minutes of PBS perfusion. Organs were successively removed from the animal using sterile surgical utensils first beginning with skeletal muscle removed from the lower extremities, then gonad, spleen, kidney, liver, diaphragm, lung, heart, tongue, and brain. Careful consideration was taken when harvesting to note any unusual anatomy. Each tissue was dissected using a fresh razor blade. Only skeletal muscle, liver, diaphragm, heart, and brain were harvested from perfusion fixed animals. These tissues were divided into two different fixation mediums. Tissues being analyzed by electron microscopy or embedded in epon followed by PAS staining, were dissected into very small cubes to ensure proper fixation when stored overnight in 2% glutaraldehyde. Tissues to be paraffin embedded followed by PAS or H&E staining, were sectioned and placed in 10% formalin overnight before being embedded in paraffin. Tissues from animals perfused only with PBS were divided into two groups: snap frozen in liquid nitrogen and stored at -80 C in Nunc CryoTube™ vials (Nalge Nunc International, Rochester, NY) to be later analyzed for GAA activity, luciferase activity, -galactosidase activity, or rAAV genome copy number; and frozen in Tissue-Tek® O.C.T. Compound embedding medium (Sakura Finetek, Inc., Torrance, CA) and stored in foil at -80 C for any other necessary assays. The blood collected was allowed to coagulate for one hour and was spun down for 20 minutes at 5000 rpm. The serum was removed and kept frozen at -80 C in cryotubes.

PAGE 51

36 Histology Periodic Acid-Schiff (PAS) and Hematoxylin and Eosin (H&E) Staining of Paraffin Embedded Tissues Animals were fixed by perfusion with 2% paraformaldehyde/1% glutaraldehyde in PBS. Tissues were dissected and stored in 10% formalin at room temperature until they were processed by dehydration with graded ethanol solutions, cleared with xylene, and embedded in paraffin. For histological determination of glycogen content, PAS staining was utilized. PAS specifically stains glycogen, but also reveals reticulum, collagen, basement membranes, and fibrin. After sectioning of embedded tissue, 5 m sections were hydrated in graded alcohol, immersed in period acid, and stained with Schiff’s reagent followed by hematoxylin. To complete H&E staining, 5 m sections were hydrated in graded alcohol, and stained with hematoxylin and counterstained with eosin. After PAS or H&E staining, the sections were dehydrated and a coverslip placed over the tissue and secured by Permount. All embedding, sectioning, and staining procedures were performed by the Pathology Core Lab. PAS Staining of Osmicated Tissues Embedded in Epon Approximately 1 mm (W) x 1 mm (H) x 2 mm (L) tissue sections were dissected after perfusing the animal with fixation solution (2% paraformaldehyde/ 1% glutaraldehyde in PBS, pH 7.4). Tissues were subsequently placed in a container filled with 2% glutaraldehyde (diluted from 50% in PBS) and stored overnight at 4 C. They were stored in 0.2 M sodium cacodylate buffer at 4 C until processed and embedded. For processing, tissues were osmicated in 1% osmium tetroxide for 1½ hours; rinsed in 0.2 M cacodylate buffer; and dehydrated in graded ethanol solutions (1 x 10 min in 50% ethanol, 1 x 10 min in 70%, 2 x 10 min in 95%, and 5 x 10 min in 100%). After

PAGE 52

37 dehydration, the samples were rinsed twice with propylene oxide and submerged in 1:1 epoxy resin in propylene oxide for 1 hour, 2:1 resin to propylene oxide overnight, and pure epoxy resin for 3 hours. Tissues were then embedding in epoxy resin and hardened in a 60 C oven for 2 to 3 days. Glutaraldehyde, sodium cacodylate, osmium tetroxide, propylene oxide, and resin components were purchased from Electron Microscopy Sciences (Fort Washington, PA). Semithin 1 m sections were cut, mounted on glass slides, and dried onto the slides using a hotplate. The slides were immersed in 0.5% periodic acid for 15 minutes, briefly washed in distilled water, submerged in SchiffÂ’s reagent (Sigma, St. Louis, MO) for 30 minutes, washed for 10 minutes in running water, and counterstained with toluidine blue for a couple minutes until a faint blue color was visible. Slides were thoroughly dried and a coverslip placed on top and secured with Permount. All embedding, sectioning, and staining procedures were performed by the Pathology Core Lab. Electron Microscopy For electron microscopy, tissues were dissected into 1 mm cubes and fixed in 2% glutaraldehyde. They were then rinsed in 0.1 M sodium cacodylate buffer and incubated at 4 C in 2% osmium tetroxide in cacodylate buffer for 1 hour. Subsequently, tissues were rinsed twice in cacodylate buffer and dehydrated in a series of graded alcohol solutions (1 x 10 min in 70% ethanol, 1 x 10 min in 90%, and 5 x 10 min in 100%). After dehydration, the samples were rinsed in 100% propylene oxide, and immersed in 1:1 TAAB resin mixture (48% TAAB resin, 19% dodenyl succinic anhydride (DDSA), 33% nadic methyl anhydride (NMA)) in propylene oxide for 1 hour,

PAGE 53

38 2:1 resin to propylene oxide overnight, and pure resin for 4 hours. Tissues were embedded in TAAB resin plus 2% 2,4,6-tri-dimethylaminoethyl phenol (DMP-30) and hardened in a 60 C oven for 2 to 3 days. Glutaraldehyde, sodium cacodylate, osmium tetroxide, propylene oxide, DDSA, NMA, and DMP-30 were purchased from Electron Microscopy Sciences (Fort Washington, PA) and TAAB resin was purchased from Marivac (Halifax, Canada). Thin sections (.01 m) were cut, stained with lead citrate and uranyl acetate (Electron Microscopy Sciences, Fort Washington, PA), and photographed with a Zeiss EM10 transmission electron microscope at 80kV. All sectioning and some staining procedures were performed by the Electron Microscopy Facility. Screening Gaa-/Breeders by PCR Before mating any Gaa-/breeders, their genotype was confirmed by PCR. The primers utilized (exon 5 sense, 5’-CCTTTCTACCTGGCACTGGAGGAC-3’ and exon 7 antisense, 5’-GGACAATGGCGGTCGAGGAGTA-3’) were designed to hybridize to the region flanking the neo cassette insertion in exon 6 of the mouse Gaa gene. Homozygous wildtype present a characteristic 692 bp product representing the 3’ portion of exon 5 (70 bp), intron 5 (328 bp), exon 6 (122 bp), intron 6 (93 bp), and 5’ portion of exon 7 (79 bp). This product was sequenced and confirmed to be the correct amplification product. Homozygous Gaa knockout mice show a single larger band which runs at about 2 kb. The amplified product includes the wildtype product (692 bp) plus additional nucleotides of the neo insertion cassette. Amplification of DNA from any heterozygous breeder ( Gaa+/-) produced products of both 692 bp and 2 kb. Ready-To-Go™ PCR beads (Amersham Biosciences Corp., Piscataway, NJ) were used according to manufacturer’s suggestions. Reactions were arranged by adding 200 ng

PAGE 54

39 of total DNA, 20 pmol of each primer, and water to the beads in a total volume of 25 L. The final concentration of magnesium chloride was 1.5 mM. PCR of control Gaa+/+, Gaa+/-, Gaa-/DNA was included with each run. The PCR was completed using a RoboCycler® Gradient 96 thermocycler (Stratagene, La Jolla, CA) under the following conditions: 30 cycles of 1 minute denaturation at 95 C, 1 minute annealing at 62 C, and 3 minute extension at 72 C. Products were separated on a 1% agarose gel and visualized using the Eagle Eye™ II imaging system (Stratagene, La Jolla, CA). In Vitro Assessment of Diaphragm Contractile Function Diaphragm Muscle Strip Preparation Mice were anesthetized via intraperitoneal injection of sodium pentobarbital (65 mg/kg). After reaching a surgical plane of anesthesia, the diaphragm was surgically excised, with the ribs and central tendon attached, and placed in a cooled disecting chamber containing Krebs-Henseleit solution equilibrated with a 95%O2/5%CO2 gas mixture. A single muscle strip (3-4mm width) was cut from the ventral-costal diaphragm parallel to the connective tissue fibers. Segments of the rib and central tendon were used to facilitate attachment of the strip to two lightweight Plexiglas clamps. Using these clamps, the muscle strip was suspended vertically in a water-jacketed tissue bath (Radnoti, Monrovia, CA) containing Krebs-Henseleit solution equilibrated with a 95%O2/5%CO2 gas mixture. The bath was maintained at 37 ± 0.5 C, pH ~ 7.4 ± 0.05, and osmolality ~ 290 mOsmol. In order to assess isometric contractile properties, the clamp attached to the central tendon was connected to a force transducer (Model FT03, Grass Instruments, West Warwick, RI). Transducer outputs were amplified and differentiated by operational amplifiers and

PAGE 55

40 underwent A/D conversion using a computer-based data acquisition system (Polyview, Grass Instruments). Determination of Optimal Length-Tension Relationship (Lo) and Isometric Force-Frequency Relationship (FFR) After a 15-minute equilibration period, in vitro contractile measurements began with empirical determination of the muscle stripÂ’s optimal length (Lo) for isometric-titanic tension development. The muscle was field-stimulated (Model S48, Grass Instruments) along its entire length using custom-made platinum wire electrodes. Single twitch contractions were evoked, followed by step-wise increases in muscle length, until maximal isometric twitch tension was obtained. Once the highest twitch force was achieved, all contractile properties were measured isometrically at Lo. Peak isometric titanic force was measured at each of the following frequencies: 10, 20, 40, 80, 100, 150, and 200 Hz. Single 500 ms trains were used, with a four-minute recovery period between trains to prevent fatigue. At the conclusion of each study, calipers were used to measure Lo before the strips were removed from the apparatus. Measurement of the Diaphragm Strip Cross-Sectional Area After removing the muscle strips from the Plexiglas clamps, the muscle tissue was carefully dissected from the rib and central tendon, blotted dry, and weighed. The muscle cross-sectional area (CSA) was determined as using the equation CSA (cm2) = [muscle strip mass (g) / fiber length Lo (cm) x 1.056 (g/cm3)], where 1.056 g/cm3 was the assumed density of muscle. The calculated CSA was used to normalize isometric tension, which is expressed as N/cm2.

PAGE 56

41 Quantification of Vector Copies by Quantitative-Competitive PCR Competitor plasmid construct, p43.2-h GAA 2.8-5’del, was created by digestion of p43.2-h GAA 2.8 with KpnI-SacII followed by T4 polymerase extension of 5’ overhangs and blunt-end ligation. Approximately 350 nucleotides from the 5’ end of the GAA gene were removed. Primers were designed to amplify 595 nt of rAAV-CMV-h GAA genomic DNA and 239 bp of the p43.2-h GAA 2.8-5’del competitor template. The 5’ primer (5’GCTAGCCTCGAGAATTC3’) was located in the multiple cloning site after the CMV promoter of p43.2 and 3’ primer (5’CGGTTCTCAGTCTCCATCAT3’) was positioned beginning at nucleotide 514 of the h GAA coding sequence. Total DNA was isolated from snap-frozen specimens using DNeasy® tissue kit (Qiagen, Valencia, CA). An RNase digestion step was included to remove any mRNA species which may contaminate the QC-PCR. Reactions were arranged by adding 200 ng of total DNA, competitor plasmid DNA (ranging from 0 to 108 copies), 20 pmol of each primer, and water to Ready-To-Go™ PCR beads (Amersham Biosciences Corp., Piscataway, NJ). The reaction contained 1.5 mM MgCl in a total volume of 25 L according to manufacturer’s suggestions. Samples were subjected to 30 cycles of denaturation at 95 C for 30 sec, annealing at 60 C for 30 sec, and elongation at 72 C for 30 sec using a RoboCycler® Gradient 96 thermocycler (Stratagene, La Jolla, CA). QC-PCR samples were separated on a 2% agarose gel and photographed using the Eagle Eye™ II imaging system (Stratagene, La Jolla, CA). The amplified products were quantified using Imagequant™ software (Amersham Biosciences, Piscataway, NJ). Intensities of products from amplified genomic rAAV-CMV-h GAA and competitor plasmid DNA were plotted on the same graph using SigmaPlot 2001 software (SPSS,

PAGE 57

42 Inc., Chicago, IL). The point where both lines crossed was considered the point of equal amplification. Given that the amount of competitor and sample template is equal at this point, we approximated the number of vector genome copies present in the sample. Data were reported as estimated vector copies per diploid genome after converting from vector genome copies/200 ng DNA using a conversion factor of 5 pg DNA/diploid nucleus. Serum Antibody Imunoassay The recombinant protein of interest was used to coat 96-well Dynatech Immulon 4-B plates (Fisher Scientific, Pittsburgh, PA). Recombinant human GAA or -gal diluted in 0.1 M sodium bicarbonate (200 L of 5 g/mL protein) was added to each well and incubated overnight at 4 C. Any unbound protein was removed by rinsing three times with 300 L of wash solution (0.1% Tween-20 in PBS). After two hours of blocking at room temperature with 300 L of blocking solution (10% FBS in 0.1% Tween-20 in PBS), each well was once again rinsed three times with wash solution. Serum samples were diluted 1:40 in blocking solution and 100 L of each dilution was added in triplicate to the plate. Binding was permitted at room temperature for one hour and any unbound serum proteins were removed with three rinses of wash buffer. Anti-rhGAA or anti-r -gal IgG antibodies present in the serum, which bound the protein coated on the plate, were recognized by anti-mouse IgG horseradish peroxidase antibody (Amersham Biosciences, Piscataway, NJ). Anti-mouse IgG HRP antibody (100 L of antibody diluted 1:10,000 in blocking solution) was added to each well and allowed to bind for 30 minutes at room temperature. After three rinses with wash buffer, the HRP conjugate was detected by adding 100 L of 3,3Â’,5,5Â’-tetramethyl-benzidine substrate (TMB, Sigma, St. Louis, MO). Wells that contained anti-rhGAA or anti-r -gal antibodies turned

PAGE 58

43 blue. When the brightest well had ample opportunity to react (4-5 minutes), the reaction was stopped by adding 100 L 1 N sulfuric acid. Absorbance was detected at 405 nm using a Quant microplate reader (Biotek Instruments, Inc., Winooski, VT). Antibody levels were reported as absorbance units at O.D. 405.

PAGE 59

44 CHAPTER 3 MOLECULAR CLONING OF VECTOR CONSTRUCTS AND FUNCTIONAL ANALYSIS OF RECOMBINANT AAV VECTORS Several reports support the use of the hybrid promoter, chicken -actin promoter plus the CMV enhancer (CBA), in hepatic gene transfer studies for high level transduction (28, 141, 170, 175). This was our promoter of choice since the vectors were being delivered to the embryonic liver. Efficient transduction of the fetal liver could provide therapeutic levels of the secreted form GAA which could be taken up by distal tissues, such as the heart. Also, if the vectors were systemically delivered by hepatic in utero delivery, then the cytomegalovirus promoter (CMV) would work very efficiently in muscle tissue (70, 121, 142, 173). This is important since heart, skeletal muscle, and diaphragm are the main target tissues in the treatment of GSDII. We believe that the CBA and CMV promoters are the two best candidates to use in these in utero studies. The human acid -glucosidase cDNA is 3.6 kilobases in length and the packaging capacity of rAAV is about 5.0 kilobases. This leaves only a little over 1 kilobase for a promoter, multiple cloning sites, a polyadenylation signal, and 2 AAV inverted terminal repeats (ITRs). The 5Â’ untranslated region (UTR) of the human GAA cDNA was removed and a shorter 3.1 kb cDNA, containing only the h GAA coding region and 3Â’ UTR, was cloned into rAAV. When this 3.1 kb cDNA is under transcriptional control of the cytomegalovirus promoter (CMV), the packaging size of the vector is 4840 base pairs, well within the packaging limits of rAAV. However, when the cDNA is driven by the

PAGE 60

45 hybrid promoter CBA, the vector reaches a length of 5648 base pairs within the ITRs, greatly surpassing rAAV packaging capacity. Several approaches were taken to reduce the size of the vector constructs. The first was to shorten the CBA promoter by deleting 300 base pairs from the first intron of the chicken -actin promoter region. Another was to remove the 3Â’ UTR of the h GAA cDNA, reducing the size by over 300 base pairs. Even further, a series of plasmids were created which coded for truncated hGAA proteins. The molecular cloning of these vector constructs and the functional activity of proteins encoded by the plasmids and corresponding rAAV vectors are summarized in this chapter. Analysis of rAAV-h GAA 2.8 Plasmids The plasmid pCIGAA , containing the human acid -glucosidase cDNA minus the 5Â’ UTR under the transcriptional control of the cytomegalovirus (CMV) immediate early promoter, was constructed as previously described (44, 107). The plasmid p43.2-h GAA 3.1 was created by cloning the CMV-h GAA expression cassette (from pCIGAA ) into p43.2, between two AAV serotype 2 inverted terminal repeats (ITRs). The 3.1 kb h GAA cassette was also cloned downstream of the full length CBA promoter and the CBA-300 promoter. The 3Â’ UTR of the h GAA cDNA was removed to decrease the size of the expression cassette within the ITRs. A detailed explanation of the molecular cloning strategy for removing the 3Â’ UTR and cloning the 2.8 kb h GAA coding region downstream of the CMV, CBA, and CBA-300 promoters are presented in Chapter 2 and in Figure 2-1. To validate that enzymatically active protein is produced from the h GAA coding region in the absence of the 3Â’ untranslated region, p43.2-h GAA 3.1, p43.2-h GAA 2.8,

PAGE 61

46 pTR-CBA-h GAA 3.1, pTR-CBA-h GAA 2.8, pTR-CBA300-h GAA 3.1, and pTR-CBA300-h GAA 2.8 (Figure 3-1A-F) were transiently transfected into HEK-293 cells. Each construct was added in triplicate to 6-well dishes containing 70% confluent HEK-293 cells using 5 g of Qiagen-purified plasmid DNA as described in Chapter 2. The cells were cultured in serum-free media and harvested after 48 hours of culture. The cellular extracts and media were then analyzed for the production of active GAA protein by enzyme assay. Activity values from cell extracts and media are plotted in Figures 3-2 and 3-3, respectively. Results from triplicate transfections indicate that p43.2-h GAA 2.8, pTR-CBA-h GAA 2.8, and pTR-CBA300-h GAA 2.8 do express enzymatically active protein even in the absence of the 3Â’ UTR (Figures 3-2 and 3-3). In fact, significantly higher activity is detected in the media and extract of cells transfected with h GAA 2.8 constructs when compared to h GAA 3.1 (labeled with asterisks in Figures 3-2 and 3-3). This is contrary to what might be expected if the 3Â’ UTR served to stabilize the mRNA and removing it decreased mRNA stability. We are not sure why removing the 3Â’ UTR in this case had a beneficial effect. It is possible that negative cis-acting elements are located within the 3Â’ UTR or bringing a strong poly adenylation signal closer to the end of the open reading frame stabilizes the mRNA. Subsequently, rAAV vectors produced from h GAA 2.8 plasmids were utilized in in utero experiments. Analysis of h GAA Truncation Plasmids The third method of reducing the size of rAAV-h GAA vectors was to create h GAA constructs which encoded truncated proteins. A series of mutations were made based on natural processing sites of the human acid -glucosidase protein, located at amino acid

PAGE 62

47 Figure 3-1 Human acid -glucosidase rAAV vector constructs. Diagrammed are rAAV vector constructs consisting of the full h GAA coding region plus 3Â’ UTR under the transcriptional control of the CMV promoter (A), the CBA hybrid promoter (C), and the truncated CBA300 promoter (E). Also pictured are smaller constructs in which the CMV, CBA, and CBA300 promoters are cloned upstream of the h GAA coding region (B, D, and F, respectively). The packaging size of each vector within its ITRs is also noted. p43-h GAA 3.1 (4840 bp) ITR CMV Promoter h GAA cDNA Poly A 3Â’UTR ITRPoly A ITR CMV Promoter h GAA cDNA ITRp43-h GAA 2.8 (4540 bp)Poly ApTR-CBA-h GAA 3.1 (5648 bp) ITR CBA Promoter h GAA cDNA 3Â’UTR ITR CMV epTR-CBA-h GAA 2.8 (5348 bp) ITR CBA Promoter h GAA cDNA Poly A ITR CMV epTR-CBA300-h GAA 3.1 (5355 bp) ITR CBA300 P h GAA cDNA Poly A 3Â’UTR ITR CMV epTR-CBA300-h GAA 2.8 (5055 bp) ITR CBA300 P h GAA cDNA Poly A ITR CMV eA B C D E F

PAGE 63

48 Figure 3-2 Recombinant AAV-h GAA constructs with and without 3Â’ UTR encode active proteins. After 5 g of each rAAV-h GAA plasmid was transfected in triplicate into HEK-293 cells, cell extract was assayed for GAA activity by enzyme assay. The columns with standard error bars represent activity values averaged from triplicate transfections. Significant differences between h GAA 2.8 and h GAA 3.1 when under control of the same promoter are indicated by asterisk (**P < 0.01, *P < 0.05). A c i d G l u c o s i d a s e A c t i v i t y i n C e l l E x t r a c t ( n m o l 4 M U G / h r / m g p r o t e i n ) 0 50 100 150 200 250 300 350 No DNA CMV GAA3.1 CMV GAA2.8 CBA GAA3.1 CBA GAA2.8 CBA300 GAA3.1 CBA300 GAA2.8 ** ** *

PAGE 64

49 Figure 3-3. Secreted form of GAA produced from rAAV-h GAA constructs is active. After transfecting rAAV-h GAA plasmids into HEK-293 cells, media was assayed for GAA activity after 48 hours of culture. The columns with standard error bars represent activity values averaged from triplicate transfections. Significant differences between h GAA 2.8 and h GAA 3.1 when under control of the same promoter are indicated by asterisk (**P < 0.01, *P < 0.05). 0 10 20 30 40 50 No DNA CMV GAA3.1 CMV GAA2.8 CBA GAA3.1 CBA GAA2.8 CBA300 GAA3.1 CBA300 GAA2.8A c i d G l u c o s i d a s e A c t i v i t y i n M e d i a ( n m o l 4 M U G / h r / m g p r o t e i n )** * **

PAGE 65

50 residues 816, 881, and 926 (Figure 3-4) (169). Since GAA is normally cleaved at these amino acids, truncation mutations were created in the coding region of h GAA that would result in the translation of proteins ending at amino acids 815, 880, and 925. The truncations designated h GAA 815, h GAA 880, and h GAA 924 were first cloned into TopoII shuttle vectors for translation analysis and finally into the p43 expression cassette. Cloning strategies and methods are described in Chapter 2. Translational Analysis of h GAA Truncations To determine if each h GAA truncation plasmid was capable of producing protein of the expected size, an in vitrocoupled transcription-translation kit was utilized. The TopoII-h GAA truncation plasmids were designed with an Sp6 promoter located upstream of the coding region. Plasmid DNA was added to Sp6 transcription/translation mix in the presence of biotinylated lysine-tRNA complex and the mixture was incubated at 30 for 90 minutes. One tenth of the final reaction was denatured and separated on an 8% Tris-Glycine gel. The gel was transferred to nitrocellulose membrane, blocked, and probed with streptavidin-HRP to detect biotin-labeled proteins. Proteins encoded by plasmids containing the h GAA truncations (TopoII-h GAA 924, TopoII-h GAA 880, and TopoII-h GAA 815) as well as the plasmid containing the entire h GAA coding region (TopoII-h GAA 2.8) were detected in this manner (Figure 3-5). Results indicated that as more of the coding region of GAA was removed, the size of the translated product decreased. All truncation products (Figure 3-5, lanes 3-5) were significantly smaller than the full length GAA protein (Figure 3-5, lane 2). Functional Analysis of h GAA Truncation Expression Cassettes A series of CMV expression plasmids were constructed to determine if the proteins encoded by the truncation cassettes were enzymatically active. Each of the

PAGE 66

51 Figure 3-4 Natural glycosylation and processing sites of human GAA. The precursor form of human acid -glucosidase contains several aminoand carboxy-terminal processing sites (dotted lines) and sites of N-glycosylation (triangles). The catalytic site is represented with a star. Truncation mutations were created based on the natural carboxy-terminal cleavage sites at amino acids 926, 881, and 816 (169). 1 110 kD membrane bound precursor 110 kD secreted precursor 110 kD secreted precursor 95 kD processing intermediate 76 kD mature enzyme 70 kD mature enzyme 140233390470513-524652 925 882 140 68 70 77 119 122 123 2 29204 206 228816881926 952

PAGE 67

52 Figure 3-5 In vitro transcription/translation of h GAA trunctions produces proteins of expected size. In vitrocoupled transcription-translation reactions performed with no DNA (lane 1), TopoII-h GAA 2.8 (Lane 2), TopoII-h GAA 924 (lane 3), TopoII-h GAA 880 (lane4), and TopoII-h GAA 815 (lane 5) indicate that protein is produced from each construct (asterisk). Prestained markers were run in lane 6. 103 kDa 77 kDa 1 2 3 4 5 6

PAGE 68

53 h GAA truncations was inserted into the multiple cloning site of p43.2, immediately downstream of the CMV promoter and between the AAV ITRs. To determine enzymatic activity of the truncated proteins, the resulting constructs, p43.2-h GAA 924, p43.2-h GAA 880, and p43.2-h GAA 815, as well as a CMV-GFP (negative control) and p43.2-h GAA 2.8 (positive control), were transfected in duplicate into HEK-293 cells as described in Chapter 2. The cells were cultured for 72 hours in serum-free media after which the cell extracts and media were assayed for GAA activity as described. Unlike cells transfected with the full coding region of h GAA (p43.2-h GAA 2.8), no enzymatic activity was detected in any lysates from cells transfected with truncation plasmids (Figure 3-6). Western analysis was performed to investigate if GAA protein was present and simply not active. Cell extract (5 g), previously assayed for enzyme activity, was separated on an 8% Tris-Glycine gel, blotted to nitrocellulose, and probed with a 1:2000 dilution polyclonal rabbit anti-hGAA antibody followed by a 1:5000 dilution of rabbit anti-IgG HRP (Figure 3-7). Except for the positive control (Figure 3-7, GAA 2.8 lanes), cells transfected with truncation plasmids did not produce GAA protein above background level ( GAA 924, GAA 880, GAA 815 lanes). The background level detected is similar to that seen in untransfected cells (Untrans lanes) or GFP transfected cells (GFP lane). The major bands detected by western are the 95-kD intermediate and 76-kD mature isoforms of GAA. Discussion of Relevant Human Mutations A variety of mutations within the 20 exons of the GAA gene have been identified among the human population. Depending on the mutation, a number of events are seen

PAGE 69

54 Figure 3-6 Human GAA truncation mutations do not produce active protein. CMV-h GAA 2.8 and CMV-h GAA truncation plasmids were transfected into HEK-293 cells in duplicate. After 72 hours, GAA enzyme assay was performed on cell extracts. The columns with standard error bars represent activity values averaged from duplicate transfections. No active protein was detected from those cells transfected with truncation plasmids ( GAA 924, GAA 880, and GAA 815) unlike those transfected with the full coding sequence ( GAA 2.8). Acid -Glucosidase Activity in Cell Extract (nmol 4-MUG/hr/mg protein) 0 50 100 150 200 250 300 UntransGFPGAA2.8GAA924GAA880GAA815

PAGE 70

55 Figure 3-7 No protein is detected in cells transfected with hGAA truncation plasmids. Western analysis was conducted on the same cell extracts used for enzyme analysis in Figure 3-6. Cells transfected with h GAA truncation plasmids ( GAA 924, GAA 880, and GAA 815) did not produce GAA above the normal level of HEK-293 cells (untransfected and GFP lanes). Arrows indicate the 95and 76-kD isoforms of GAA that are produced from the GAA 2.8 plasmid. UntransGFPGAA2.8GAA924GAA880GAA815 103 kD 77 kD

PAGE 71

56 for different mutant mRNA or proteins. Two mutations common among the patient population relate directly to the truncations which were created. The first is a deletion mutation frequent among Dutch patients. A region including exon 18, between intervening sequences 17 and 18, was deleted by a recombination event between two 8 nucleotide direct repeats, leaving one repeat at the junction site (66). Exon 18 encodes for amino acids 828-882 which includes the proteolytic cleavage site for the 76-kD mature form at residue 881 and a site for N-glycosylation at 882 (169). The more severe, infantile form of the disease ensues when patients show homozygosity for this mutation (155). No active protein was detected by enzyme assay (76). The mutant precursor produced is of reduced molecular weight. It is thought that the protein is misfolded or misprocessed while in the endoplasmic reticulum or Golgi, forcing the precursor to be degraded (6). The second mutation, Arg854X, is a nonsense mutation originally identified among African Americans (1, 12, 54). The C to T transition (C2560T) occurs at a CpG dinucleotide located within exon 18. This creates an in-frame translation termination codon before carboxy-terminal cleavage sites at residues 881 and 925. When this termination mutation was cloned and transfected into COS cells, a smaller precursor protein was synthesized, but was not phosphorylated. No active protein was detected by enzyme assay (54). Again, when this mutation is found in homozygosity, it results in a severe phenotype (12). It is important to consider the severity of these two human mutations and that no active protein is found among patients with the same mutation on both alleles. Since no protein was found by western analysis in the cells transfected with our truncations

PAGE 72

57 (Figure 3-7), it could be hypothesized that the mutant protein was degraded when misfolding occurred at the ER. Protein of the correct size was translated from the truncation coding sequences as revealed by the in vitro transcription/translation experiment. Both of these experiments support this hypothesis. However, additional experiments are necessary for complete validation. Several of the original rAAV constructs were vastly larger than the packaging capacity of rAAV (Figure 3-2C, D, E, and F). The h GAA truncations were initially created to reduce the cassette size to provide more efficient rAAV vector production. However, these plasmids did not code for active proteins. Deletions within the coding region of h GAA could provide an alternative method of reducing the cassette size. Unfortunately, after studying the modification and processing sites located within the GAA protein (Figure 3-4), cleavage and N-glycosylation sites required for normal protein fuction span the entire protein. The required catalytic site is positioned neatly in the middle. This left only small regions that could possibly be deleted. These regions were shortened further when this map was compared to a similar protein map containing all known human mutations (Figure 1-1). It was determined that no deletions within the h GAA coding region could be constructed that would make a significant difference in the packaging size of the vectors. Analysis of rAAV-h GAA 2.8 Vectors A series of rAAV vectors were produced from the h GAA 2.8 plasmids described previously in this chapter. Figure 3-8 describes the plasmids used to create the various rAAV vectors of serotypes 1 and 2, as well as their respective titers (both total particle and infectious particle if known). Each virus preparation was given a numeric value to simplify further explanations. A good indicator of efficient packaging was a low total

PAGE 73

58 particle to infectious particle ratio. This ratio as well as expression titers determined which vectors were suitable for animal studies. Unfortunately, there is currently no suitable infectious titer or expression titer protocol available for rAAV serotype 1, therefore its packaging efficiency can not be analyzed. Expression plasmid p43.2-h GAA 2.8, in which the CMV promoter is driving expression of the coding sequence of GAA , was packaged into both rAAV serotype 1 and 2. Both serotypes packaged well; rAAV2-CMV-h GAA 2.8 (Figure 3-8, preparation #1) reached a total particle titer of 9.4 x 1010 particles/mL (total particle to infectious particles ratio of 1:1) and rAAV1-CMV-h GAA 2.8 (preparation #2) reached 8.14 x 1012 particles/mL. Two other rAAV plasmids, pTR-CBA-h GAA 2.8 and pTR-CBA300-h GAA 2.8, did not package as efficiently. Both were packaged twice within the context of rAAV serotype 2 (Figure 3-8, preparations #3-6). Even though rAAV2-CBA-h GAA 2.8 (preparation #3) had a high particle titer (2.4 x 1013 particles/mL), its total to infectious particles ratio was 1000:1. Since the infectious titer of preparation #3 was still relatively high, it was used in in utero experiments. The second preparation of this vector (preparation #4) did not fair as great. It had the same ratio of 1000:1, but it consisted of less total particles (7.2 x 1011 particles/mL), making its infectious titer only 5.7 x 108 infectious particles/mL. Titers from vector preparations of rAAV2-CBA300-h GAA 2.8 (preparations #5-6), were equally low and the total particle to infectious particle ratio of preparation #6 was about 500:1. Virus preparations #4, #5, and #6 were not used in animal experiments because of low infectious particle titers and high total to infectious particle ratios.

PAGE 74

59 Figure 3-8 Recombinant AAVGAA 2.8 vector constructs and particle titers. Three different rAAVGAA 2.8 expression plasmids driven by different promoters (CMV, CBA, or CBA300), were packaged into rAAV1 or rAAV2, purified, and titered. Each virus preparation was designated a number to simplify descriptions in the text. Preparations #1, #2, and #3 were used for in utero experiments described in later chapters. 1 rAAV2-CMV-h GAA 2.89.4 x 1010 particles/ml9.4 x 1010 infectious particles/ml 2 rAAV1-CMV-h GAA 2.88.14 x 1012 particles/ml 3 rAAV2-CBA-h GAA 2.82.4 x 1013 particles/ml2.3 x 1010 infectious particles/ml 4 rAAV2-CBA-h GAA 2.87.2 x 1011 particles/ml5.7 x 108 infectious particles/ml 5 rAAV2-CBA300-h GAA 2.86.7 x 108 infectious particles/ml 6 rAAV2-CBA300-h GAA 2.87.2 x 1011 particles/ml3.1 x 109 infectious particles/ml pTR-CBA300-h GAA 2.8 (5055 bp) ITR CBA300 P h GAA cDNA Poly A ITR CMV epTR-CBA-h GAA 2.8 (5348 bp) ITR CBA Promoter h GAA cDNA Poly A ITR CMV ePoly Ap43-h GAA 2.8 (4540 bp) ITR h GAA cDNA ITR CMV Promoter

PAGE 75

60 The packaging efficiency appears to directly correlate with the vector size between the two ITRs. Both rAAV-CBA-h GAA 2.8 and rAAV-CBA300-h GAA 2.8 are well over packaging capacity for rAAV and this is apparent in the total particle titer as well as the total particle to infectious particle ratio. In order to directly compare the transduction efficiency of rAAV2-CBA-h GAA 2.8 (Figure 3-8, preparation #3) with rAAV2-CMV-h GAA 2.8 (preparation #1), an expression titering assay was performed. Serial dilutions of each vector were prepared and an equal volume of each dilution was incubated with 100% confluent C12 cells in the presence of wild type adenovirus in triplicate. After 48 hours, the cells were harvested and GAA enzyme activity determined in the cell extracts. These activity values were plotted as a function of infectious particles of each vector (Figures 3-9 and 3-10). Enzyme activities reached into the thousands of units when cells were transduced with 109 infectious particles of rAAV2-CMV-h GAA 2.8 (data not shown). A direct comparison indicated that with similar infectious particles, rAAV2-CMV-h GAA 2.8 (Figure 3-11) had an expression titer almost 100-fold higher than that of rAAV2-CBA-h GAA 2.8 (Figure 3-12). Similar experiments were performed with vector preparations #4 and #6, but results comparable to preparation #3 were obtained for both vectors in which the expression titer reached only 50 U for 5 x 109 infectious particles of each vector. Promoter strength could play a role in the differences observed between the expression titers of rAAV2-CBA-h GAA 2.8 and rAAV2-CMV-h GAA 2.8. Previous experiments indicated that the CMV promoter is slightly stronger than the CBA or CBA300 promoter in HEK-293 cells (Figures 3-2 and 3-3), but this does not account for the 100-fold difference seen in this experiment. The rAAV2-CBA-h GAA 2.8 vector

PAGE 76

61 described here (Figure 3-8, preparation #3) was used in in utero experiments, but the most dramatic data was generated from in utero delivery of rAAV-CMV-h GAA 2.8 serotypes 1 and 2 (preparation #1 and #2).

PAGE 77

62 Figure 3-9 Expression titer of rAAV2-CMV-h GAA 2.8. Serially diluted rAAV2-CMV-h GAA 2.8 was incubated with C12 cells in a 12-well format in the presence of wild type adenovirus. After 48 hours, the cells were harvested and GAA enzyme activity determined in the cell extracts. The closed circles with standard error bars represent activity values averaged from triplicate transduction experiments. These values were plotted as a function of infectious particles. The solid line at 20 nmol 4-MUG/hr/mg protein is the background level of GAA detected in untransduced cells. A c i d G l u c o s i d a s e A c t i v i t y i n C e l l E x t r a c t ( n m o l 4 M U G / h r / m g p r o t e i n )Infectious particles 1e+41e+51e+61e+71e+81e+9 0 100 200 300 400 500 600 700

PAGE 78

63 Figure 3-10 Expression titer of rAAV2-CBA-h GAA 2.8 is significantly lower than rAAV2-CMV-h GAA 2.8. Similarly, serially diluted rAAV2-CBA-h GAA 2.8 was incubated with C12 cells in the presence of wild type adenovirus. Enzyme activity in the cell extracts was determined after 48 hours of culture and plotted as a function of infectious particles. The closed circles with standard error bars represent activity values averaged from triplicate transduction experiments. The solid line at the bottom indicates the background level of GAA activity in these cells. A c i d G l u c o s i d a s e A c t i v i t y i n C e l l E x t r a c t ( n m o l 4 M U G / h r / m g p r o t e i n )Infectious particles 1e+31e+41e+51e+61e+71e+81e+ 9 10 20 30 40 50 60 70 80 90

PAGE 79

64 CHAPTER 4 EMBRYONIC STEM CELL TRANSDUCTION This chapter presents the first discussion of rAAV serotype 1 transduction of murine embryonic stem cells and the isolation of stable cell lines after prolonged culture. Background of Murine Embryonic Stem Cells Murine embryonic stem cells (ESCs) are primary, nontransduced cells that are isolated from the inner cell mass of 3.5-day post coitus blastocysts and are pluripotent in nature. These cells are capable of producing any of various cell lineages, and when reintroduced into the developing blastocyst, generate cells of ectoderm, mesoderm, endoderm, and even germ cells. In culture, ESCs have the potential of unlimited self-renewal (20, 168). An In Vitro Model of In Utero rAAV Transduction This project began with the notion that rAAV transduction of Gaa-/ESCs would be a satisfactory in vitro model of in utero rAAV transduction of Gaa-/fetuses. It was proposed that after exposure to rAAV-h GAA , Gaa-/ESCs could be cultured in such a way as produce “muscle-like” aggregates or embryoid bodies. The cells would then be analyzed by electron microscopy to determine if early transduction restored a normal myofiber phenotype as is predicted with the in utero model. The first step in this project was to explore the rAAV transduction potential of murine ESCs. This was attempted several times using rAAV serotype 2 with reporter constructs, specifically GFP under the control of CMV, CBA, and ELF promoters. Several different transduction formats were attempted, but none were successful. For example, ESCs were cultured with rAAV in

PAGE 80

65 volumes as low as 20 L in hanging drops, or even incubated with a mixture of rAAV and wild type adenovirus, which could provide necessary helper functions. Only recently has rAAV been efficiently produced and purified bearing the capsid proteins from various serotypes (117). ESC transduction experiments involving different serotype vectors are presented here. Transduction of Embryonic Stem Cells To date, there has been only one brief report of rAAV transduction of ESCs. In a recent abstract, Smith-Arica et al . report that murine ESCs can be transduced by rAAV serotype 2, but at very low efficiency (136). The present account is the first description of rAAV serotype 1 transduction of ESCs, and further, this report describes stable expression of the transgene. Embryonic stem cells (129/Sv RW4 ES cells from Genome Systems Inc.) were altered by homologous recombination to contain a neo cassette within exon 6 of the murine Gaa locus as previously described (115). One of the several clones verifed by Sourthern analysis to be Gaa+/was labeled #104 and was used in the following experiments. A similar ESC clone was used to produce the Gaa-/mouse which has been extensively characterized and was used in the in utero experiments presented in this work. The ESC line #104 was grown on 100 mm tissue culture dishes coated with 0.1% gelatin in the absence of fibroblast feeder cells. Feeder cells provide a source of leukemia inhibitory factor (LIF), which inhibits spontaneous differentiation of ESCs. Therefore the medium was supplemented recombinant LIF. Feeder cells were omitted because they are easily transduced by rAAV making it difficult to visualize transduced ESCs amongst many fluorescing fibroblasts. Since ESCs do not grow well without a

PAGE 81

66 feeder layer, these cells were maintained over several passages to ensure adequate adaptation before any transduction experiments were attempted. Approximately 50 ESCs were plated into a 96-well dish in a 30 L volume and immediately, 10 L of rAAV-CBA-GFP serotype 1, 2, and 5 (particle titers unknown) was added to each well. This corresponded to 5 x 1011 total particles of serotype 1, 7 x 1010 total particles of serotype 2, and 1 x 1011 total particles of serotype 5. As a positive control, HEK-293Â’s were seeded on the same dish and received similar amounts of rAAV. The cells were incubated for 1 hour before 100 L of complete medium was added to each well. The cells were observed daily for any sign of transgene expression by fluorescence microscopy. After 24 and 48 hours of culture, there was no indication of expression by the ESCs. However, expression was detected in HEK-293 cells as early as 24 hours. ESCs grow quite rapidly, and at this time they were beginning to form sizable colonies. However, after 5 days, the colonies began to merge and the media started to turn acidic. It was at this point that fluorescence was observed in ESCs cultured in the presence of rAAV1, but no other serotype. The results of this experiment at day 5 are pictured in Figure 4-1. Light field (Figure 4-1a, c, e, g, i, k, m, and o) and fluorescence photographs (Figure 4-1b, d, f, h, j, l, n, p) were taken of each well. Each light field photograph shows confluent cells (ESCs or HEK-293s) filling each corresponding fluorescence field. HEK-293 cells were efficiently transduced by rAAV serotype 1 (panel l), serotype 2 (panel n), and serotype 5 (panel p). However, only rAAV serotype 1 was able to efficiently transduce ESCs after 5 days of culture (panel d). ESCs (panels a and b) and HEK-293s (panels i and j), incubated for 5 days in the absence of any vector, were photographed as negative

PAGE 82

67 Figure 4-1 Transduction of murine embryonic stem cells by rAAV. Light and fluorescence microscopy was used to analyze murine embryonic stem cells cultured for 5 days in the absence and presence of rAAV expressing GFP (a-h). ESCs were efficiently transduced by rAAV serotype 1 (d), but not by serotype 2 (f) or 5 (h). HEK-293 cells cultured under the same conditions (i-p) showed positive transduction with rAAV1 (l), rAAV2 (n), and rAAV5 (p) vectors. ESC293 Uninf Type 1 Type 2 Type 5 a c e g b d f h i k m o j l n p

PAGE 83

68 controls. Significantly lower GFP expression was observed when ESCs were incubated with 10-fold less rAAV1 vector (data not shown). Several explanations are proposed as to why serotypes 2 and 5 did not induce GFP expression. Since the same CBA promoter was used in all the transduction experiments, lack of expression from rAAV2 or rAAV5 due to differences in promoters can be excluded. Differences in transduction efficiency could be due to incubation with different MOI of each vector. A more interesting theory is that ESCs express cell surface receptors compatible with ligands only available on the capsid surface of rAAV serotype 1 and not serotype 2 or 5. The receptor of rAAV2 is heparin sulfate proteoglycan (147). Fibroblast growth factor receptor 1 (FGFR) and V5 integrin have been identified as coreceptors (114, 146). The receptor for serotype 5 is sialic acid (164). The receptor for rAAV1 has not yet been identified. The reason for delayed expression after ESCs are transduced with rAAV1 is unknown. On day 5 when GFP was first detected, the colonies formed from these individual cells displayed a mosaic pattern of expression (Figure 4-2, panels f-h and Figure 4-3). When the cells first encountered the vector, they were in single cell suspension. Therefore, after 5 days, each colony in the well had originated from only one of those cells. The mosaic pattern observed can only lend to one broad hypothesis, that expression has occurred some time after several rounds of cell division. Either the vector enters the cell after much cell division, or after entry, there is a delay before gene expression. Both of these theories indicate a time gap between vector exposure and gene expression, allowing sufficient time for cell division. This is unlike the expression pattern which is seen in the HEK-293 cells. Since expression is observed as early as 24 hours

PAGE 84

69 Figure 4-2 Patterns of expression within ESC colonies after rAAV1 transduction. Large colonies of ESCs were photographed by light microscopy after 5 days of culture in the absence (a) and presence of rAAV1-CBA-GFP (b-d). The corresponding fluorescent field is shown below indicating no expression when rAAV1 was omitted (e) or various expression patterns after rAAV1 transduction (f-h). abcd efgh

PAGE 85

70 Figure 4-3 Mosaic pattern of murine embryonic stem cells transduced by rAAV1-CBA-GFP. The mosaic pattern of ESC transduction observed after 5 days of culture was captured by confocal microscopy. Since the cells began to grow on top of each other after 5 days, fluorescing cells from other focal planes bled into the captured focal plane causing the image to appear blurry.

PAGE 86

71 after HEK-293 cells are exposed to the vector, it can be assumed that the internalization of the vector happens within minutes. In fact, many groups have extensively characterized AAV and rAAV2 binding, internalization (presumably through endocytosis), diffusion, and entry of the encapsidated genome into the nucleus (9, 125, 131, 172). In the presence of wild type adenovirus, AAV entry into HeLa cells happens as rapidly as a few seconds, and entry into the nucleus within minutes of initial exposure to the virus. (131, 172). However, in the absence of wild type adenovirus, AAV rapidly enters the cell, but is not released from the endosomes until several minutes later, and uncoating and nuclear entry does not occur until 12-24 hours later (172). It is likely that this process takes even longer during the transduction of ESCs in the absence of wild type adenovirus. Isolation of ESC Clone with rAAV1 Stable Integration We wanted to determine if transduction of ESCs with rAAV would result in stable integration of the vector genome and if a clone could be isolated. The previous experiment was repeated, but after 5 days of culture, the resulting colonies from one well of a 96-well dish were thoroughly trypsinized and triterated to ensure that a single cell suspension was obtained. These cells were then plated onto 3 gelatin-coated 100 mm dishes in the absence of feeders and cultured until individual colonies were observed. The first time this experiment was performed, only one GFP positive colony was found among all 3 dishes, indicating a very low integration frequency. Two colonies among the 3 dishes were photographed under light and fluorescence microscopy (Figure 4-4). The colony pictured in panel c does not express GFP while the lone GFP positive colony is shown in panel d. Note how every cell in the colony is expressing GFP. Next to the GFP

PAGE 87

72 Figure 4-4 Isolation of stable embryonic stem cell line after rAAV1 transduction. After murine ESCs were transduced with rAAV1-CBA-GFP, they were plated to isolate single colonies. Two such colonies are pictured here under light (a and b) microscopy. Fluorescence microscopy was used to locate GFP positive colonies. The colony pictured in panel a does not express GFP (c) while the every cell of the colony in panel b is positive for GFP expression (d). ab cd

PAGE 88

73 positive colony is one of the few remaining fibroblasts, of which some expressed GFP (Figure 4-4d). This experiment was repeated to isolate additional colonies revealing genomic integration of rAAV1-CBA-GFP. This time between 1 and 5 GFP positive colonies were discovered among hundreds of negative colonies. Both of these experiments indicated a very low rate of rAAV integration within ESCs. To isolate the colonies, they were drawn into a pipette with the aid of a microscope and cultured individually in 96-well dishes. Once the colonies had become settled, they were trypsinized to isolate individual cells and seeded in the same well. Once expanded, the stable clones were confirmed for GFP expression and then frozen in an isopropanol bath and stored in liquid nitrogen. When all the cells of a colony were GFP positive, it was assumed that the colony had originated from an individual cell transduced with rAAV1-CBA-GFP. The only way the GFP cDNA could be maintained throughout repeated cell divisions, would be to integrate into the host genome or be maintained as a stable episome. In either case, the vector genome would be replicated at each cycle. Our group is motivated to determine if these rAAV1 stable clones when injected into 3.5 day blastocysts, will differentiate into germ cells and eventually produce an rAAV1-GFP transgenic mouse. Before these studies are initiated, it is necessary to confirm integration of the vector genome by Southern blot. The initial goal of creating an in vitro model to study in utero rAAV transduction was altered. The hope was to transduce murine ESCs with rAAVGAA and allow the transduced cells to differentiate into muscle cell-like embryoid bodies. However, this

PAGE 89

74 would be extremely difficult, since very few cells become transduced with rAAV and that expression is seen after 5 days of culture. The anticipated experiments require 100% transduction of ESCs before culturing into embryoid bodies. However, these ESC transduction studies are ongoing in the laboratory.

PAGE 90

75 CHAPTER 5 PRELIMINARY STUDIES Preliminary experiments relating to the in utero transduction study are discussed in this chapter. We present biochemical, histological, and electron microscopy analyses performed on developing Gaa-/mice. We also describe genotypic screening of Gaa-/breeders, analysis of vector adherence to the inner surface of the injection syringe, preliminary in utero delivery experiments, and a surgery survival study. Biochemical, Histological, and Electron Microscopy Analysis of Developing GAA Knockout Mice We anticipated that in utero gene delivery of the h GAA coding sequence to Gaa-/mice could prevent the disease course associated with lysosomal glycogen accumulation. However, the optimal point in the disease process at which to analyze treated tissues was not known. We wanted to find the earliest age that Gaa-/mice exhibited significant glycogen accumulation. A developmental study of Gaa-/mice presented in this chapter was used to determine the earliest age to sacrifice treated mice and analyze tissues for gene expression and phenotypic correction. Several diagnostic studies were completed comparing Gaa-/mice to normal mice (either C57B6/C3 or C57B6/129-SvJ) over ages spanning 10 days post coitus to 1 month of age. Acid -glucosidase enzyme activity, intracellular glycogen content, and morphological studies were completed on these age groups. Based on the results presented, we decided that animals would be sacrificed at one month of age.

PAGE 91

76 Acid -glucosidase Enzyme Activity Analysis The level of GAA enzyme activity was established among Gaa-/and normal Gaa+/+embryos and various tissues from newborn mice (Table 5-1). Gaa-/and normal mice were harvested at 10 and 15 days post coitus (p.c.) and at birth. Whole embryos (1 Gaa-/at 10 p.c., 1 Gaa-/at 15 p.c., 3 C57B6/C3 at 10 p.c., and 4 C57B6/C3 at 15 p.c.) and skeletal muscle, kidney, brain, spleen, liver, lung, and heart isolated from four Gaa-/and two C57B6/C3 newborn mice were frozen in embedding medium. GAA activity of whole embryos and newborn tissues was determined from approximately five 30 m sections of tissue dissolved in PBS. Activities from embryos and tissues of newborn mice were averaged and plotted as nmol 4-MUG/hr/mg protein (Table 5-1). As expected, Gaa-/mice exhibited little or no enzymatic activity over the course of development. Results among normal mice showed an increase in enzyme activity from 10 to 15 p.c. and greatest activity in liver and brain among newborn tissues. This may correlate with an increased need for glucose within these tissues during development. Histological Analysis of Glycogen Content Staining histological sections with Periodic Acid-Schiff (PAS) revealed intracellular glycogen with a bright pink stain. Using this method, a developmental analysis of glycogen accumulation was completed among Gaa-/and C57B6/C3 or C57B6/129-SvJ normal mice at 15 p.c., birth, and one month of age (data not shown). Little to no difference was observed in Gaa-/heart, skeletal muscle, or liver when compared to C57B6/C3 tissues at 15 p.c. Both appeared to have significant glycogen content at this point in development. But by birth, slightly more pink stain was seen in knockout tissues versus normal (data not shown).

PAGE 92

77 Table 5-1 Acid -glucosidase activities among 10 p.c., 15 p.c., and newborn Gaa-/and normal mice Acid -glucosidase activity (nmol nmoles 4-MUG/hr/mg protein) 10 p.c. Embryos Gaa-/(n=1) C57B6/C3 (n=3) Whole embryo 0 37.55 15 p.c. Embryos Gaa-/(n=1) C57B6/C3 (n=4) Whole embryo 1.50 100.57 1-day-old mouse Gaa-/(n=4) C57B6/C3 (n=2) Skeletal muscle 2.28 18.38 Kidney 1.86 53.02 Brain 2.01 117.88 Spleen 2.80 15.85 Liver 0.73 173.95 Lung 1.13 30.01 Heart 0.18 11.01

PAGE 93

78 Sacrificing the animals at birth may not give the vector enough time to fully express the transgene. Recombinant AAV exhibits an initial phase of single-strand to double-strand conversion (38, 39). The gap of time before which transgene expression is high enough to be detected, has been referred to as the lag phase. The lag phase appears to vary from days to weeks depending on the cell type transduced, the promoter used, and the sensitivity of the expression assay (25, 58, 59, 70, 89). Also, based on these histological studies, there does not appear to be enough of a difference in glycogen content among heart, skeletal muscle, and liver at this point in development. We wanted to find the earliest point at which a significant difference can be observed to illustrate the greatest impact of gene correction after in utero rAAV transduction. Significant glycogen accumulation was evident in several tissue types as early as one month of age in the Gaa-/mouse (data not shown). PAS stained histological sections of 1-month-old Gaa-/or C57B6/C3 heart, skeletal muscle, liver, and brain showed brighter pink stain within Gaa knockout myofibers, hepatocytes, and brain dark matter. Based on these preliminary experiments, 1-month-old animals were sacrificed after in utero transduction. If GAA expression was detected in any of these tissues from in utero -treated Gaa-/mice, we could use PAS staining as a method to determine any positive impact on glycogen accumulation. During the course of in utero transduction experiments, an alternative method of PAS staining was brought to our attention. This involved staining semithin sections (1 m) from osmicated tissues embedded in epon. This new method presented several advantages: preservation of intracellular glycogen was improved during processing of smaller tissues; glycogen was not easily washed away during staining procedure; and

PAGE 94

79 PAS stain appeared to localize to globular regions indicative of glycogen filled lysosomes. Previous PAS staining appeared more cytoplasmic rather than lysosomal. Since GSDII is diagnosed by lysosomal accumulation of glycogen, the new method of staining seemed to be a more appropriate diagnostic tool for in utero transduction studies. Using this new method of PAS staining, we determined that by one month of age, enormous glycogen inclusions are apparent in heart, skeletal muscle, liver, and diaphragm of the Gaa-/mouse. One-month-old tissues from Gaa-/and C57B6/129-SvJ normal mice were stained with PAS to determine differences in glycogen content between knockout and normal strains. We found significant differences in glycogen content in heart, skeletal muscle, diaphragm, and liver of 1-month-old Gaa-/mice when compared to normal animals (Figures 5-1 to 5-4, panels a and b, respectively). A pink punctate staining pattern was seen among all Gaa-/tissues, indicative of centralized lysosomal glycogen. Glycogen was observed in high proportion within the myofibers of all Gaa-/striated muscle cell types: cardiac, skeletal muscle, and diaphragm (Figures 5-1 to 5-3, panel a). This is characteristic of GSDII muscle pathology. Electron Microscopic Analysis of Glycogen Content and Myofiber Structure Electron microscopy allowed for the capture of remarkable pictures which illustrated abnormal glycogen deposits within various tissues of Gaa-/mice and how this could result in abnormal muscle function. We examined heart, skeletal muscle, diaphragm, and liver of 1-month-old Gaa-/and normal (C57B6/129-SvJ) mice by electron microscopy (Figure 5-1 to 5-4, panels c and d, respectively). Even at this early age, enormous glycogen inclusions were seen crowding muscle fibers of Gaa knockout heart (Figure 5-1c), skeletal muscle (Figure 5-2c), and diaphragm (Figure 5-3c). Massive

PAGE 95

80 amounts of glycogen were also identified in knockout liver (Figure 5-4c). Deposits of glycogen were rarely observed among normal tissues (Figures 5-1 to 5-4, panel d). Some glycogen was found associated with lysosome-like membrane structures, while in other cases, deposits were seen grouped in the cytoplasm without defined membrane structures. Most aggregates of glycogen observed in Gaa-/skeletal muscle were associated with what appeared to be cellular debris (Figure 5-2c); this has also been observed among GSDII patient tissues (48-50). This was not seen among other Gaa knockout tissues. Glycogen seemed to take on different forms among knockout tissues. For instance, in the heart, the glycogen seemed dense (Figure 5-1c), while it was more dispersed in skeletal muscle and liver (Figures 5-2 and 5-4, panel c, respectively). It has been previously described from electron microscopy studies of Pompe patients that glycogen can take on various forms (48-50). It has been suggested that this could be an artifact and could be caused by fixation differences among tissues with dense glycogen indicating better preservation of the tissue. Several theories have described the direct and indirect effects of lysosomal glycogen accumulation on muscle function. One hypothesis is that massive glycogen-filled lysosomes overcrowd the myofibers, causing the striations to misalign. This is evident in electron micrographs comparing Gaa-/and normal mouse heart tissue (Figure 5-1c and d, respectively). The striations in the diseased tissue appear to misalign due to overcrowding directly caused by pressure from the masses of glycogen. It seems possible that misalignment of the fibers could cause the muscle weakness characteristic of this mouse model.

PAGE 96

81 Figure 5-1 Large glycogen inclusions are observed in 1-month-old Gaa-/heart. Heart tissue from 1-month-old heart from Gaa-/(a) and normal C57B6/129-SvJ (b) mice was stained for glycogen content. Light micrographs were taken using a 60x objective. Electron micrographs at 14,800x magnification of similar Gaa-/(c) and normal (d) tissue are also shown. cd ab

PAGE 97

82 Figure 5-2 Comparison of glycogen content among 1-month-old Gaa-/and normal skeletal muscle. By 1 month of age, differences in glycogen content are quite apparent. Pictured are PAS stained histological sections of Gaa-/(a) and normal C57B6-129SvJ (b) skeletal muscle (60x objective). Large membrane-bound vesicles containing glycogen and other autophagic material is seen in electron micrographs taken of Gaa-/skeletal muscle (c). These were not visible among normal tissue (d). Electron micrographs are pictured at 14,800x magnification. c d ab

PAGE 98

83 Figure 5-3 Glycogen content of 1-month-old Gaa-/and normal diaphragm. Significant PAS positive material is observed in Gaa-/diaphragm (a) when compared to C57B6/129-SvJ normal tissue (b). Glycogen is found to be membrane bound when Gaa-/diaphragm is observed by electron microscopy (c). Normal tissue lacked large deposits of glycogen (d). Light micrographs were taken using a 60x objective and electron micrographs are pictured at 14,800x magnification. c d ab

PAGE 99

84 Figure 5-4 Abnormal glycogen content is observed in 1-month-old Gaa-/liver. PAS-stained histological sections of Gaa-/(a) and normal C57B6/129-SvJ (b) liver demonstrates the high level of intracellular glycogen which has accumulated in the knockout tissue (60x objective). Electron micrographs of Gaa-/liver (c) illustrate abnormal glycogen deposits which are not visible in control tissue (d). Micrographs are pictured at 14,800x magnification. c d ab

PAGE 100

85 The second theory is that the glycogen filled lysosomes rupture due to contractile pressure within muscle cells and they release glycogen and toxic enzymes into the cytoplasm. It is possible that these enzymes may still function at neutral pH and digest myofibrillar material (48). Within several electron micrograph fields of Gaa-/muscle, we found areas of concentrated cytoplasmic glycogen which was in direct contact with the contractile apparatus. We envisioned treating Gaa-/mice with a genetic therapy that would prevent this pathology and maintain normal muscle function. We planned to utilize in utero delivery of recombinant AAV to introduce the human GAA cDNA into Gaa-/mice at an early stage in development, and to supply active GAA protein before glycogen begins to accumulate and cause long-term irreversible damage to striated muscle. Genotypic Screening of Gaa-/Breeders A straightforward screening protocol was developed to ensure each Gaa-/breeder was indeed a homozygous knockout. This method involved a PCR assay using genomic DNA isolated from mouse tail. The region containing the neo cassette insertion in exon 6 of the mouse Gaa gene was amplified using primers designed to exon 5 (sense) and exon 7 (antisense). A 692 bp product (containing the 3Â’ portion of exon 5, intron 5, exon 6, intron 6, and the 5Â’ portion of exon 7) was detected when the wild type allele was amplified. However, when the knockout allele was amplified, a 2 kb product resulted due to the disruption of exon 6 with the neo cassette. Amplification of DNA from any heterozygous breeder would have presented both 692 bp and 2 kb bands. Otherwise, all Gaa-/breeders revealed only the 2 kb amplification product. Any breeders showing anything other than the knockout genotype would have been euthanized.

PAGE 101

86 Procedures for the Gaa genotype PCR are described in detail in Chapter 2. An example of one genotype experiment is presented in Figure 5-5. Gaa+/+ (labeled WT-A and WT-B) and Gaa+/(labeled Het) DNA were included in each experiment as controls. Amplification of the wild type DNA produced a strong signal of 692 bp (WT-A and WT-B lanes), whereas 2 bands (692 bp and 2 kb) were seen after amplifying heterozygous DNA (Het lane). The annealing temperature of the PCR was set to where the wildtype allele was amplified more easily, as indicated by the intensity of the 692 bp wild type band. In the screening experiment presented in Figure 5-5, all Gaa-/breeders screened showed only the 2 kb knockout amplification product and were therefore indeed all homozygous knockouts. Analysis of rAAV Infectious Titer Before and After Exposure to a Hamilton Syringe In utero transduction experiments were carried out by inserting a 33 gauge needle, attached to a glass Hamilton syringe, into the embryo and injecting the vector mixture contained within the syringe. We used the GAA expression titer assay previously described to determine if the infectious titer of vector loaded into the syringe was the same as when it was expelled. It was possible that rAAV vector could adhere to the inner surface of the glass syringe, or that the status of the capsid structure could be altered. In both cases, the vector infectious titer would have decreased after exposure to the syringe. Ten microliters of rAAV2-CMV-h GAA 2.8 was mixed with 1 L of Trypan blue on a piece of Parafilm and drawn into a glass Hamilton syringe, as was done for every in utero injection. The vector was expelled onto the parafilm and vector GAA expression titers of vector before and after exposure to the syringe were determined. Serial dilutions of each vector were prepared and an equal volume of each dilution was incubated in

PAGE 102

87 Figure 5-5 Example of genotyping Gaa-/breeders by PCR. DNA isolated from Gaa+/+, Gaa+/-, and Gaa-/breeders was amplified using primers designed to exon 5 and exon 7 of the mouse Gaa gene. A 692 bp product indicated a wildtype allele and 2 kb product was produced from amplification of a knockout allele where a neo cassette had been inserted into exon 6. Only the 692 bp product is detected from Gaa+/+ DNA (WT-A and WT-B lanes), both 692 bp and 2 kb products from Gaa+/DNA (Het lane), and only the 2 kb product from Gaa-/breeders (lanes labeled by assigned animal number). 692 2 kbN o D N A W T A W T B H e t 2 9 7 2 9 8 2 9 9 3 0 0 4 3 3 4 3 4 4 3 7 4 4 1 4 4 2 4 4 3 4 4 4 4 4 5 4 4 6

PAGE 103

88 duplicate with 100% confluent HeLa cells in the presence of wild type adenovirus. After 48 hours, the cells were harvested and GAA enzyme activity determined in the cell extracts. The activity values were plotted as a function of infectious particles of each vector (data not shown). These results showed that practically identical expression titers were achieved from vector before and after exposure to the Hamilton syringe. This indicated that little or no vector was left behind in the syringe during in utero injections and that the embryos were receiving the full and expected dose of vector. Development of In Utero Surgery Technique Only a few surgical techniques for in utero vector delivery to mice have been published. All employ the use of a microinjector attached to a micromanipulator. This method is costly and time consuming. Each pregnant Gaa-/dam could bear up to approximately 10 pups. Because each fetus is positioned differently and identical injection sites are necessary, it takes several minutes to position the microinjector correctly for each embryo. The chance for survival decreases as the time the fetuses are kept from the closed womb increases. We have devised a less expensive and relatively fast method of in utero vector delivery. The same method was used for hepatic, intraperitoneal, and skeletal muscle in utero injections, only the site of injection was varied. Similar techniques could be used when performing in utero brain injections as well as injections into the amniotic sac and placenta of murine fetuses. A detailed explanation of the injections is described in Chapter 2, but an abbreviated description is presented here. On day 15 of gestation, pregnant Gaa-/females were anesthetized using 0.03 mL/gm total body weight of 20 mg/mL Avertin administered by intraperitoneal injection. A midline laparotomy was performed on each pregnant female with the

PAGE 104

89 abdominal wall being retracted to expose the peritoneal cavity. Each horn of the uterus was exposed individually onto a prewarmed saline-moistened sponge (Figure 5-6a). For hepatic and intraperitoneal injections, the bright red-pigmented liver of each fetus was identified and correctly positioned using a dissecting microscope (Figure 5-6b and c). Up to 10 L of saline, fluorescent beads, or vector was injected into the liver or peritoneal cavity of each fetus. A preloaded Hamilton syringe bearing a 33 gauge needle with beveled end and side pore was inserted through the uterine wall into the fetal liver or peritoneal cavity (Figure 5-6d). After the injections, the first horn was returned to the abdominal cavity and an identical procedure was performed with the second uterine horn. Trypan blue dye was added to the injection mediums to ensure a direct injection was achieved; note the purple coloration of the livers after injection (Figure 5-6e). After replacing the entire uterus and adding 1.0 mL of prewarmed saline into the abdominal cavity, the abdomen was then closed in two layers. The abdominal muscle layer was sewn using 5-0 prolene and the skin layer was closed using 5-0 vicryl. The mothers were monitored until they regained consciousness and subsequently were allowed to proceed to term. Localization after In Utero Hepatic Injections We focused on in utero hepatic delivery of rAAV with the anticipation of achieving high level gene expression of GAA in the liver. GAA produced in the liver could be secreted and dispersed via the circulation to target tissues such as heart, diaphragm, and skeletal muscle. In the target tissue, the protein would be escorted to the lysosome via mannose 6-phosphate receptor-mediated endocytosis. Localization of the injected medium after in utero hepatic injections was investigated using 10 L of 0.1%

PAGE 105

90 Figure 5-6 Pictorial of murine in utero injection technique. Timed pregnant Gaa-/dams are anesthetized to surgically remove the uterus bearing fetuses at 15 p.c. (a). The bright red livers of each fetus are identified (b, arrows indicate livers) and positioned using a dissecting microscope (c). A 33 gauge needle attached to a Hamilton syringe is used to deposit the vector through the uterine wall and into the fetal liver or peritoneal cavity (d). Trypan blue dye is added to the injected medium as a marker to ensure that a direct injection is achieved (e, arrows are pointing out blue-dyed livers after injection). The fetuses are placed back into the abdominal cavity, the incision is sewn, and the mother is monitored until she has regained consciousness. ab c de

PAGE 106

91 w/v 30 nm fluorescent beads. The beads were introduced by injecting through the uterine wall and into the red-pigmented liver of the fetus as pictured in Figure 5-6. The animal was sacrificed at 1 week of age and the liver frozen in O.C.T. embedding medium. Fluorescence microscopy was used to analyze 10 m serial sections. Fluorescent beads were found localized in the liver (Figure 5-7a); and a closer look indicated that the beads did not travel far from the site of injection (Figure 5-7b). This was an important aspect since the diameter of the fluorescent beads (30 nm) and rAAV (approximately 25 nm) are similar. From these results, we were confident we could successfully deliver rAAV to the liver of the developing murine fetus and that the fetus could be carried to term. Localization after In Utero Injections at Other Sites Other groups have performed in utero delivery of adenoviral vectors to the amniotic sac, retro-orbital vein, and placenta of developing murine fetuses. These reports indicated that delivery to the amniotic sac resulted in gene expression mainly localizing to the liver, epidermis, lung, and gastrointestinal tract; and retro-orbital and placental injections targeted the liver (63, 82, 99, 126). After intraperitoneal or hepatic injection, adenoviral and rAAV vectors typically transduced liver and the peritoneum (82-86, 130). Two reports showed that injection of rAAV vectors into the skeletal muscle results in localized expression of the transgene (99, 130). Survival Study of Gaa-/In Utero Injections Throughout the entire study presented, a total of 294 Gaa-/fetuses at 15 days gestation from 50 timed-pregnant females were injected, of which 167 fetuses were brought to term leading to a surgery survival rate of 60.5%, compared to 100% normal birth rate. Of the 148 injected mice allowed to reach a weaning age of 3 weeks, 108 remained. This indicated a post-birth survival rate of 73.0%, a rate similar to animals of

PAGE 107

92 this strain not in utero -treated. Most of these deaths were due to maternal neglect or cannibalization which is normally seen among this and other knockout strains.

PAGE 108

93 Figure 5-7 Localization of fluorescent beads after in utero hepatic injection. After hepatic in utero injection, 30 nm fluorescent beads were found localized to the liver at the injection site of a mouse sacrificed at 1 week of age (a). A closer look indicated that the beads did not disperse very far from the site of injection (b). ab

PAGE 109

94 CHAPTER 6 IN UTERO HEPATIC INJECTIONS WITH RECOMBINANT AAV2: BIOCHEMICAL AND FUNCTIONAL ANALYSIS OF DIAPHRAGM TRANSDUCTION Several novel experiments are presented in this chapter. This is the first time rAAV in utero transduction has been demonstrated in a knockout mouse model of human disease. We show evidence of efficient gene replacement and expression in diseased tissue, and also present data to support that structure and function of the tissue is vastly improved because of rAAV-h GAA transduction. High Level Transduction of Diaphragm Muscle after Hepatic In Utero Delivery of rAAV2 The level of luciferase expression was determined in several tissue types 1 month after in utero hepatic delivery of 3 x 107 infectious particles of rAAV2-CBA-Luc to Gaa-/fetuses on day 15 of gestation. Expression levels were highest in the diaphragm and liver (Figure 6-1A and B), while no significant expression was detected in kidney, spleen, skeletal muscle, gonad, lung, heart, brain, and tongue of 1-month-old Gaa-/vector-treated mice (data not shown). In Figure 6-1, luciferase expression levels of individual samples are shown by closed circles while averaged activity values of saline and rAAV2-CBA-Luc-treated tissues are indicated by open and gray bars, respectively. More than 100-fold higher luciferase expression was detected in rAAV2 in utero -treated diaphragms compared with saline-treated mice. It is likely that high-level diaphragmatic transduction occurred through intraperitoneal exposure to the rAAV2 vector. Since the liver was the site of delivery, we were surprised to find drastically lower luciferase expression in rAAV2-CBA-Luc-treated livers when compared to treated

PAGE 110

95 Figure 6-1 Luciferase expression in diaphragm and liver after hepatic in utero delivery of rAAV2-CBA-Luc. At 15 days gestation, Gaa-/fetuses were injected in the liver with 3 x 107 infectious particles of rAAV2-CBA-Luc. Luciferase activity, reported as relative light units (RLU) per g protein, was detected highest in 1-month-old diaphragm (A) followed by liver (B). No other tissues assayed exhibited detectable activity. Closed circles ( ; n=4) reflect values of individual samples while averages from saline-treated and rAAV2-treated samples are represented with the open and gray columns, respectively. Standard errors are indicated with bars. A Diaphragm 10 100 1000 10000 100000 SalineCBA-LucRLU/ g protein 0 10 20 30 40 50 60 Liver SalineCBA-LucRLU/ g protein B

PAGE 111

96 diaphragms. This could be attributed to a dilution effect when non-integrated or episomal forms of the vector are dispersed to daughter cells as the liver divides during development. Alternatively, rAAV2 may not transduce embryonic liver with high efficiency since a majority of the cells of the fetal liver are hematopoetic progenitors. Cells of hematopoietic lineage do not transduce easily with rAAV2 (143). One of many possible reasons proposed is that these cells do not express high enough levels of the AAV2 receptor, heparin sulfate proteoglycan, and co-receptors, FGFR and V5 (114, 146, 147). Acid -glucosidase Expression in Diaphragm Muscle after In Utero Delivery of rAAV2 We injected Gaa-/fetuses at 15 days gestation with 2 x 108 infectious particles of rAAV2-CBA-h GAA 2.8, 1 x 109 infectious particles of rAAV2-CMV-h GAA 2.8, 3 x 107 infectious particles of rAAV2-CBA-Luc, or saline. Four C57B6/129-SvJ normal mice, four saline and rAAV2-CBA-Luc-treated Gaa-/negative controls, eight rAAV2-CBA-h GAA 2.8 (numbered as animals 1-8) and four rAAV2-CMV-h GAA 2.8 (1-4) treated Gaa-/mice were sacrificed at 1 month of age to isolate liver, kidney, spleen, skeletal muscle, gonad, diaphragm, lung, heart, brain, and tongue for GAA activity assays. Again, vector-treated diaphragms yielded the highest enzyme activity (Figure 6-2), while levels in the other tissues tested did not reach significance (data not shown). In Figure 6-2, closed circles show individual enzyme values. Average GAA enzyme activity in normal diaphragm was 23.6 nmol 4-MUG/hr/mg protein, and this level was attained in animals numbered rAAV2-CBA-h GAA 2.8-2 (26.2 nmol 4-MUG/hr/mg protein) and rAAV2-CMV-h GAA 2.8-1 (27.3 nmol 4-MUG/hr/mg protein) while higher than normal levels were observed in rAAV2-CMV-h GAA 2.8-3 and -4 (44.5

PAGE 112

97 and 40.0 nmol 4-MUG/hr/mg protein). On average, the rAAV2-CBA-h GAA 2.8-treated group reached almost 25% of normal GAA activity, while the rAAV2-CMV-h GAA 2.8 group surpassed normal levels. It appears that several animals from both rAAV2-h GAA 2.8 treated groups had reduced intraperitoneal exposure to the vector because no GAA activity was detected in their diaphragms (rAAV2-CBA-h GAA 2.8-4 through -8 and rAAV2-CMV-h GAA 2.8-2). The rAAV2-CMV-h GAA 2.8-treated group attained higher levels than the rAAV2-CBA-h GAA 2.8 group possibly because the CMV-treated group received 5 times more vector, although differences in promoter strength can not be excluded. Western Analysis of Vector Produced GAA in Treated Diaphragms To determine which isoform of hGAA protein was being detected enzymatically, western analysis of diaphragm extract from the same 1-month-old rAAV2-CBA-h GAA 2.8 and rAAV2-CMV-h GAA 2.8 in utero -treated animals, as well as Gaa-/untreated and normal diaphragm, was performed using a polyclonal antibody specific for hGAA. Acid -glucosidase purified from human placenta was used as a control to show the predominant isoforms, 95-kD intermediate and 76and 67-kD processed forms (Figure 6-3A and B, lane 1). An unknown cross-reacting protein (about 50 kD) was detected in all samples, but served as a loading control. Endogenous murine GAA in the normal diaphragm extracts was not detected by this antibody, which is specific against hGAA (Figure 6-3A and B, lane 2). As expected, no signal was detected from untreated Gaa-/diaphgram (Figure 6-3A and B, lane 3). Those animals expressing detectable levels of hGAA by enzyme assay, rAAV2-CMV-h GAA 2.8-1 and -2 and rAAV2-CBA2.8-h GAA -1, -3, and -4, revealed the presence of the catalytically active

PAGE 113

98 Figure 6-2 In utero transduction of diaphragm muscle leads to production of wildtype levels of enzymatically active GAA protein in Gaa-/mice. Acid -glucosidase expression was detected in diaphragms of rAAV2-CBA-h GAA 2.8 and rAAV2-CMV-h GAA 2.8 in utero -treated animals. Activities from four GAA vector-treated animals reached or surpassed normal levels. Closed circles ( ) represent individual values from C57B6/129-SvJ normal diaphragms and untreated, rAAV2-CBA-Luc treated, rAAV2-CBA-h GAA 2.8 treated, and rAAV2-CMV-h GAA 2.8 treated Gaa-/diaphragms. Animals within treated groups are assigned numbers to simplify explanations in the text. normal Gaa-/-CBA-LucCBA-hGAACMV-hGAAAcid -Glucosidase Activity (nmol 4-MUG/hr/mg protein) 0 10 20 30 40 50 1 2 3 4-8 1 4 3 2

PAGE 114

99 Figure 6-3 Mature 76-kD active form of human GAA is detected in rAAV2 transduced dipahragms. Extracts from normal C57B6/129-SvJ (A and B, lane 2), untreated Gaa-/(A and B, lane 3), rAAV2-CBA-h GAA 2.8-treated Gaa-/(A, lanes 4-11), and rAAV2-CMV-h GAA 2.8-treated Gaa-/diaphragms (B, lanes 4-7) were separated by SDS-PAGE and the blots probed with a polyclonal antibody against human placental GAA. Acid -glucosidase purified from human placenta was included as a positive control showing predominant isoforms of 95-kD precursor and 76and 67-kD processed forms (A and B, lane 1). The 76-kD mature form was detected in those diaphragms transduced with rAAV2 that expressed the highest GAA activity (Figure 6-2), rAAV2-CBA-h GAA 2.8-1 and -2 (A, lanes 4 and 5) and rAAV2-CMV-h GAA 2.8-1, -3, and -4 (B, lanes 4, 6, and 7). The asterisk designates a cross-reacting protein of unknown origin. 116 80A 1234567891011 116 80 B 1234567 * *

PAGE 115

100 76-kD processed form (Figure 6-3A, lanes 4 and 5; Figure 6-3B, lanes 4, 6, and 7, respectively). Protein levels detected by western analysis were consistent with the relative levels of measured enzymatic activity presented in Figure 6-2. Prevention of Lysosomal Glycogen Accumulation in Treated Diaphragms Since rAAV2-h GAA 2.8 in utero -treated Gaa-/animals are exposed to vector-produced hGAA enzyme at an early stage in development, we wanted to determine if lysosomal glycogen accumulation associated with Pompe disease and observed in this animal model was prevented in the treated animals. For this purpose, PAS was used to stain intracellular glycogen deposits of normal, untreated Gaa-/-, and rAAV2-CMV-h GAA 2.8-treated Gaa-/diaphragm sections from 1-month-old mice (Figure 6-4a-c). By 1 month of age, glycogen inclusions were already evident in the diaphragm of untreated Gaa-/mice; the bright pink stain indicated centralized glycogen stores localized to the lysosomes (Figure 6-4b). Lysosomes swollen with undegraded glycogen were found both at the cell periphery and among the fibers of the microtubes. As in the normal mouse diaphragm (Figure 6-4a), little to no glycogen was seen in rAAV2-CMV-h GAA 2.8 in utero -treated diaphragms (Figure 6-4 c). Similar findings were attained from electron microscopy studies. Extremely large lysosomes full of glycogen were present among the muscle fibers of untreated Gaa-/diaphragm (Figure 6-4e), but were not seen in normal tissue (Figure 6-4d) or treated samples expressing normal levels of GAA (Figure 6-4f). Preservation of Diaphragm Muscle Contractile Function Many patients suffering from GSDII frequently succumb to respiratory insufficiencies associated with diaphragm muscle weakness. We determined that

PAGE 116

101 Figure 6-4 Accumulation of lysosomal glycogen is prevented in diaphragm of in utero rAAV2-CMV-h GAA 2.8-treated 1-month-old Gaa-/-mice. Intracellular glycogen content was determined by qualitative PAS staining of histological sections (a-c) and ultrastructural studies using electron microscopy (d-f) of normal C57B6/129-SvJ (a, d), untreated Gaa-/(b, e), and rAAV2-CMV-h GAA 2.8 in uterotreated Gaa-/diaphragms (c, f). Treated Gaa-/diaphragms (c, f), which expressed normal levels of GAA, exhibited little or no glycogen accumulation unlike diaphragms from untreated knockout animals. Light micrographs were taken using a 60x objective and electron micrographs are pictured at 12,000x magnification. abc def

PAGE 117

102 near-normal diaphragm muscle function was preserved among 6-month-old Gaa-/mice when treated in utero with rAAV-CBA-h GAA 2.8. Using isometric force-frequency relationships as an index of contractile function, we tested the contractile properties of diaphragm muscle strips from age-matched knockout and normal mice (Figure 6-5). At 6 months postpartum, impairment of contractile function was observed in Gaa-/diaphragms, as evidenced by their decreased developed tensions over a range of stimulation frequencies (circles). In contrast, 6-month-old Gaa-/mice treated in utero with 2 x 108 infectious particles of rAAV2-CBA-h GAA 2.8 did not exhibit the same functional pathology and maintained near-normal contractile properties (triangles) when compared to normal controls (squares). Long-Term Gene Expression after In Utero rAAV2 Transduction The same diaphragm strips used to study contractile function, were also assayed for GAA expression by cytochemical staining using synthetic substrate 5-bromo-4-chloro-3-indolyl-D-glucopyranoside (X-Gluc). Similar to X-Gal staining for -galactosidase expression, GAA positive cells turned blue from X-Gluc staining. After measuring contractile force, the three diaphragm strips were incubated in 4% paraformaldehyde for 1 hour followed by X-Gluc staining. Photographs taken showed that after 6 months, gene expression was sustained (Figure 6-6). However, no blue cells were observed after X-Gluc staining of age-matched normal C57B6/129-SvJ diaphragms. This staining procedure identified cells expressing GAA activity higher than normal levels, which is possible with the CBA promoters used in this study.

PAGE 118

103 Figure 6-5 In utero delivery of rAAV2-CBA-h GAA 2.8 preserves diaphragm muscle contractile force in Gaa-/mice. A dose of 2 x 108 infectious particles of rAAV2-CBA-h GAA 2.8 was delivered in utero to Gaa-/mice ( ; n=3). Animals were sacrificed and diaphragm muscle strips were prepared 6 months postpartum. In vitro isometric force-frequency relationships were obtained and compared to age-matched, untreated normal C57B6/129-SvJ ( ; n=3) and Gaa-/mice ( ; n=6).

PAGE 119

104 Figure 6-6 Long-term GAA expression detected in 6-month-old Gaa-/rAAV2 in utero -treated diaphragms. The same three diaphragm strips used to assay muscle function in Figure 6-5 ( ), were subsequently stained with X-Gluc to observe GAA expression. Several X-Gluc positive myofibers are detected indicating higher than normal levels of GAA activity within these cells.

PAGE 120

105 CHAPTER 7 HIGH-LEVEL GENE EXPRESSION AFTER IN UTERO DIAPHRAGMATIC TRANSDUCTION WITH RECOMBINANT AAV SEROTYPE 1 Based on previous experimentation, we discovered that rAAV serotype 1 is superior to serotype 2 at transducing muscle tissue when delivering the human GAA cDNA to the Gaa-/mouse (44). We sought to determine if in utero delivery of rAAV serotype 1 vector would provide superior tropism and level of transduction compared to that previously found using serotype 2. Expression of -Galactosidase after In Utero Delivery of rAAV Serotype 1 Once again, by injecting the liver of fetal mice, we could examine transduction of fetal liver and diaphragm after delivery of serotype 1 vector. We chose to inject 5.8 x 109 particles of rAAV1-CMV-LacZ into 15 p.c. CD-1 fetuses. Kidney, spleen, skeletal muscle, gonad, diaphragm, lung, heart, brain, and tongue were harvested after the treated (n=3) or untreated (n=1) pups reached 1 month. To monitor -galactosidase expression, large pieces of tissue were fixed in 4% paraformaldehyde and stained with X-Gal solution, or smaller pieces were homogenized in the presence of lysis buffer and extracts used in the Galacto-Star luminescence assay. Once again, expression was only detected in the diaphragm. The untreated diaphragm and one of the rAAV1-CMV-LacZtreated diaphragms did not express -galactosidase as determined by X-Gal staining and luminescence assay. However, the remaining two treated diaphragms expressed 931 ng and 1130 ng -galactosidase/ g protein, as determined by luminescence assay. X-Gal

PAGE 121

106 staining from two of the treated diaphragms expressing -galactosidase (panel b and c) and one untreated diaphragm (panel a) are shown in Figure 7-1. Higher Level Expression Achieved Using rAAV Serotype 1 We were able to make a direct comparison between serotype 1 and serotype 2 by delivering in utero via hepatic injection, a similar vector containing the same CMV-h GAA 2.8 expression cassette. For this experiment, 8.14 x 1010 particles of rAAV1-CMV-h GAA 2.8 were delivered to Gaa-/fetuses at 15 days gestation. After allowing the vector-treated pups to reach 1 month of age, they were sacrificed to isolate liver, kidney, spleen, skeletal muscle, gonad, diaphragm, lung, heart, brain, and tongue for GAA activity assays. Once again, GAA activity was detected only in diaphragm. No other tissues expressed a significant level of GAA (data not shown). In several cases, diaphragmatic transduction with rAAV serotype 1 resulted in 10-fold higher GAA activity, surpassing both normal controls as well as rAAV serotype 2 in uterotreated Gaa-/animals. We examined GAA expression in the diaphragm by X-Gluc staining, enzyme activity assay, and western blotting. For X-Gluc staining, we immersed half of each in utero -treated diaphragm first into 4% paraformaldehyde for one hour, then into the X-Gluc solution overnight. Each was photographed to document the level of GAA expression. Figure 7-2a illustrates one stained untreated diaphragm and eight stained rAAV1-CMV-h GAA 2.8 in utero -treated diaphragms (numbered 1-8). Some showed significant blue staining (#1, 2, 5, 6, and 8), while others were indistinguishable from the untreated Gaa-/control (#3, 4, and 7).

PAGE 122

107 Figure 7-1 Beta-galactosidase expression in diaphragm after rAAV serotype 1 in utero transduction. CD-1 fetuses injected with 5.8 x 109 particles of rAAV1-CMV-LacZ in the liver, displayed efficient transduction of the diaphragm. Diaphragms from uninjected (a) and injected animals (b and c) were subjected to X-Gal staining. The amount of -galactosidase protein detected in half of each diaphragm is included below its stained counterpart (reported as ng -gal/ g protein). abc 0 9311130 ng -Galactosidase/ g protein

PAGE 123

108 The level of GAA activity determined from the other half of the diaphragm indicated that the amount of staining was relative to the level of activity (Figure 7-2b). The diaphragms with the highest intensity of staining reached over 100 nmol 4-MUG/hr/mg protein (rAAV1-CMV-h GAA 2.8 #2, 6, and 8) with one yielding over 824 nmol 4-MUG/hr/mg protein (rAAV1-CMV-h GAA 2.8 #2); those with intermediate staining attained normal levels of approximately 20 nmol 4-MUG/hr/mg protein (#1 and 5); and those that lacked staining had no detectable GAA activity (rAAV1-CMV-h GAA 2.8 #3, 4, and 7). By western analysis, we discovered that the 76-kD mature form of GAA correlated with the observed activity (Figure 7-2c). The intensity of the 76-kD band observed in each of the in utero -treated diaphragms was consistent with what was determined by activity assay and X-Gluc staining with the exception of rAAV1-CMV-h GAA 2.8 #5. Although an intermediate level of X-Gluc staining was observed (Figure 7-2a), GAA activity analysis revealed only 18 nmol 4-MUG/hr/mg protein of active GAA was present (Figure 7-2b). Correlating with the activity assay, western analysis indicated a very low level of mature enzyme was present. However, there was a predominant band of a molecular weight higher than the 95-kD intermediate form visible in the placental control lane (Figure 7-2c, lane 5). It was likely to be the 110-kD precursor form of the protein. This partially explains why the X-Gluc staining of this diaphragm did not correlate with the activity assay. The higher molecular weight species detected by western analysis may be able to enzymatically cleave the X-Gluc substrate more efficiently than 4-MUG, which was used in the activity assay. Studies have shown that the 110-kD precursor form of GAA does exhibit low level activity on

PAGE 124

109 Figure 7-2 Biochemical analysis of GAA expression in diaphragm after in utero transduction with rAAV1-CMV-h GAA 2.8. Acid -glucosidase expression in treated diaphragms (#1-8) was analyzed by three methods: X-Gluc staining (a), GAA activity assay (b), and western analysis (c). Expression levels ranged from nothing to vastly greater than normal. Western analysis indicated predominant bands at 76 kD correlated with enzyme activity. The unknown species detected at the bottom of the western serves as a loading control (asterisk). Note the log scale in panel b. GAA KO 1 2 3 4 5 6 7 8a KOWT12345678 1 10 100 1000 10000 GAA Activity (nmol 4-MUG/hr/mg protein)b 116 kD 80 kD placental hGAA12345678 c *

PAGE 125

110 particular substrates, but that this activity increased as the protein was further processed (95). It is unknown why the predominant species in rAAV1-CMV-h GAA 2.8 #5 was the precursor form, while in every other treated tissue, the mature form prevailed. The presence of a similar size precursor was also detected in other rAAV1-CMV-h GAA 2.8 treated diaphragms, but the ratio of precursor to mature form was reversed. We conclude that either this is an artifact of the sample preparation or this animal experienced an error in processing which prevented the precursor from being efficiently cleaved into its mature form. Further studies are necessary to determine what kind of processing error was responsible. Prevention of Glycogen Storage Phenotype in Mouse Diaphragm The same PAS staining method used to examine glycogen content of rAAV2-treated diaphragms, was used to study epon-embedded 1-month-old diaphragm tissue after in utero delivery of rAAV1-CMV-h GAA 2.8. Figure 7-3a, shows a normal C57B6/129-SvJ diaphragm; panel b, an untreated Gaa-/diaphragm; and in panel c, a Gaa-/diaphragm treated in utero with rAAV1-CMV-h GAA 2.8. Even at this early stage in development, the same disease pathology characteristic of GSDII, was observed in 1-month-old Gaa-/diaphragm muscle (b). Numerous pink-stained glycogen-filled lysosomes scattered the field of the untreated Gaa-/diaphragm. Conversely, all of the myofibers of the normal (a) and vector-treated Gaa-/(c) diaphragms were healthy and uniform making it impossible to differentiate between the two. These findings were confirmed by electron microscopy of normal (Figure 7-3 d), untreated Gaa-/(e) and treated Gaa-/diaphragm (f). However, we were not successful in transducing the diaphragm to act as a factory for producing secreted GAA to treat other tissues.

PAGE 126

111 Figure 7-3 Diaphragms treated with rAAV1-CMV-h GAA 2.8 are free of glycogen deposits. Epon-embedded normal C57B6/129-SvJ (a), untreated Gaa-/(b) and rAAV1-CMV-h GAA 2.8 hepatic in uterotreated Gaa-/diaphragms (c) were sectioned and stained with PAS to determine intracellular glycogen content. Electron micrographs were taken of normal (d), untreated (e), and in utero -treated (f) diaphragms to identify glycogen deposits at the cellular level. Representative micrographs from three different vector-treated diaphragms are pictured in b and e. Heart tissue from the rAAV1-CMV-h GAA 2.8 treated animal whose diaphragm is pictured in panel c was stained with PAS to show that other deficient tissues did not benefit from transduction of the diaphragm (i). Heart tissue from normal C57B6/129-SvJ (g) and untreated Gaa-/(h) mice was included as controls. Light micrographs were taken using a 60x objective and electron micrographs are pictured at 12,000x magnification. abc def ghi

PAGE 127

112 For instance, heart tissue from the same animal whose diaphragm is pictured in Figure 7-3c had significant PAS positive material (Figure 7-3i). Control heart tissue from C57B6/129-SvJ and untreated Gaa-/mice was also included (Figure 7-3g and h, respectively). Since more efficient transduction of diaphragm muscle was achieved using rAAV serotype 1, it will be important to study long-term biochemical and functional characteristics of in utero -treated diaphragms. Determination of Genome Copy Number by QC-PCR A quantitative-competitive PCR (QC-PCR) assay was devised to quantify genome copy number within treated and untreated tissues. Initially, we had performed real-time PCR of treated diaphragm tissues, but found there were factors present in the DNA isolated from diaphragms that prevented accurate amplification of the vector. This problem has been encountered by other investigators as well. Therefore, we decided to look into alternative methods of quantification. The premise behind QC-PCR is that when PCR is performed with equimolar ratios of two templates which are recognized by the same set of primers, the resulting products will appear with the same intensity when visualized by standard electrophoresis, given that both templates amplify with equal efficiency. For QC-PCR, a template of unknown copy number is mixed with competitor plasmid. The same amount of unknown is mixed with increasing copy number of competitor plasmid over a course of several reactions. The intensity of the unknown product will decrease as the intensity of the competitor increases. The point at which the intensity of both the unknown and competitor products are the same, is considered the point of equal amplification. Given the amount of competitor and unknown is equal at this point, we can approximate the number of vector genome copies present in the sample.

PAGE 128

113 For this experiment, we chose to create a competitor plasmid called p43.2-h GAA 2.8-5Â’del, in which a deletion was generated in the vector plasmid, p43.2-h GAA 2.8, between the primer binding sites. PCR was performed using a pair of primers which detected both the rAAV1-CMV-h GAA 2.8 vector (595 bp product) and the CMV-h GAA 2.8 5Â’ deleted plasmid competitor (239 bp product). To determine if the primers amplified both templates at the same efficiency, PCR was performed in the presence of equal copy number of both vector (p43.2-h GAA 2.8) and competitor (p43.2-h GAA 2.8-5Â’del) plasmid DNA. The products of the reactions were separated on a 2% agarose gel and digitally photographed. Densitometry was used as a semiquantitative measure to determine the relative intensity of each amplification product. The pixel intensities were plotted against the known copy number of each template (Figure 7-4). The amplification curves of both the vector and competitor templates were almost identical. Based on these results, we felt the primers and PCR protocol used for this assay would be adequate to determine approximate vector copy number in rAAV-treated tissues. Before analyzing treated tissues, we practiced the QC-PCR assay with known quantities of vector plasmid DNA. We performed PCR using a known amount of vector plasmid DNA mixed with increasing copies of competitor DNA in the absence and presence of background mouse genomic DNA. We hoped to test for two things. First, we wanted to determine if we could accurately quantify the amount of vector DNA we were testing. Second, we wanted to establish whether we could accurately determine vector copy number in the presence of background mouse genomic DNA. Figure 7-5 is an example of an experiment where 5 x 105 copies of p43.2-h GAA 2.8 were mixed with

PAGE 129

114 Figure 7-4 PCR of increasing copy number of vector and competitor plasmid DNA. Increasing copies (100 to 108) of vector plasmid (p43.2-h GAA 2.8) and competitor plasmid (p43.2-h GAA 2.8-5Â’del) were mixed and amplified by PCR using primers which recognized both templates. Vector (595 bp; ) and competitor (239 bp; ) products were separated on a 2% agarose gel (A). Densitometry was used to quantify relative intensities of vector and competitor PCR products and these values plotted as a function of template copy number (B). Each template was amplified at equal efficiency over all copy numbers tested. Copy Number (10x) 0123456789 Pixels 0 20000 40000 60000 80000 100000 120000 p43.2-hGAA2.8 plasmid template p43.2-hGAA2.8-5'del plasmid template 100 101 103 104 105 106 107 108 239 bp 595 bp 506 bp 220 bp A B

PAGE 130

115 Figure 7-5 QC-PCR of 5 x 105 copies of vector plasmid in the presence of increasing copies of competitor plasmid. Several experiments were performed to confirm that the copy number of vector plasmid revealed by QC-PCR was really the amount used in the reaction. In this example, PCR was performed with 5 x 105 copies of vector plasmid (p43.2-h GAA 2.8) mixed with increasing copies of competitor plasmid (100 to 106) in the presence of 200 ng of mouse genomic DNA. The relative intensities of vector ( ) and competitor ( ) products from each reaction are pictured in panel A and plotted in panel B. The point of equal intensity is marked by a straight line and corresponds to 4 x 105 copies of competitor template. This value was very similar to the actual amount of vector plasmid used in the reaction, thereby confirming the accuracy of this QC-PCR method. AUnknown = 5x105 copies hGAA2.8 100 101 102 103 104 105 106 239 bp 595 bp 506 bp 220 bp water p43.2-hGAA2.8 plasmid template (5 x 105 copies) p43.2-hGAA2.8-5'del plasmid template Copy Number hGAA2.8-5'del (10x) 01234567 Pixels 10000 20000 30000 40000 50000 60000 B

PAGE 131

116 100, 101, 102, 103, 104, 105, and 106 copies of competitor plasmid (p43.2-h GAA 2.8-5Â’del) in the presence of 200 ng mouse genomic DNA, and PCR performed as described in Chapter 2. The products were separated on a 2% agarose gel, relative band intensities were determined by densitometry, and intensities were plotted as a function of competitor plasmid DNA used in the reaction (Figure 7-5). Since both competitor and vector plasmid DNA amplify at equal efficiency, it could be assumed that the point at which the unknown vector line of pixel intensity crosses the competitor line of pixel intensity, there were equal copies of unknown and competitor DNA. The point at which the unknown (5 x 105 copies of p43.2-h GAA 2.8) line of intensity (closed circles) crossed the competitor line of intensity (open circles) was noted as 4 x 105 copies of competitor (note the line drawn at the intersection point in Figure 7-5B). This estimate was quite close to the actual vector plasmid DNA we used in this pilot experiment, which was 5 x 105 copies. We were confident that this QC-PCR method would be accurate enough to give a representation of the vector copy numbers present among rAAV-transduced tissues. Quantitative-competitive PCR was performed on diaphragm tissue from 1-month-old Gaa-/mice after in utero delivery of rAAV1-CMV-h GAA 2.8, to determine vector genome copy number. The tissues assayed were from the same diaphragms previously described in Figure 7-2. Total DNA was extracted from treated and untreated diaphragms and 200 ng of each was mixed with increasing copies of plasmid competitor DNA. PCR was performed using a pair of primers which detected both the rAAV1-CMV-h GAA 2.8 vector (595 bp product) and the CMV-h GAA 3Â’ deleted plasmid competitor (239 bp product) at equal efficiency.

PAGE 132

117 The 595 bp rAAV1-CMV-h GAA 2.8 amplified product was detected in each treated diaphragm sample, rAAV1-CMV-h GAA 2.8 #1 through #8, but to varying levels (Figure 7-6). All samples indicated the presence of vector genomes whether or not GAA protein was detected by staining, enzyme assay, or western analysis (Figure 7-2a, b, and c). The 595 rAAV1-CMV-h GAA amplified product was not detected in untreated Gaa-/animals (Figure 7-6). Densitometry was performed to more accurately determine vector genome copy number present within 200 ng of diaphragm DNA and this value was converted into vector copies per diploid genome based on a 5 pg total DNA/cell conversion factor (88). Quantitative-competitive PCR experiments for diaphragm samples rAAV1-CMV-h GAA #1-8 are summarized in Figure 7-6. Listed beside each sample number, is the copy number reported as estimated vector copies per diploid genome, the GAA activity value as previously determined, and raw data from each QC-PCR experiment. Control reactions were completed in which -actin was amplified from 200 ng DNA from each sample (bottom of Figure 7-6). This showed that the amount of DNA added to each QC-PCR reaction was relatively the same. The general trend indicated by the QC-PCR experiments was that as the copy number of vector genomes per diploid cell increased, the resulting GAA activity also increased. Diaphragm rAAV1-CMV-h GAA 2.8 #2, which had the highest level of GAA activity (824 nmol 4-MUG/hr/mg protein), contained 50 estimated vector copies per diploid genome. Diaphragm rAAV1-CMV-h GAA #1, which had a normal level of GAA activity (24 nmol 4-MUG/hr/mg protein) and over 10-fold less activity than rAAV1-CMV-h GAA 2.8 #2, contained only a slightly lower copy number at 20 estimated vector copies per diploid genome. Even sample rAAV1-CMV-h GAA 2.8 #7, which had

PAGE 133

118 Figure 7-6 Vector genome copies of rAAV1-CMV-h GAA 2.8 in utero -treated Gaa-/diaphragms determined by QC-PCR. Quantitative-competitive PCR was performed to determine vector genome copies within in utero vector-treated and untreated diaphragm samples. PCR was performed using 200 ng of total DNA isolated from Gaa-/untreated and rAAV1-CMV-h GAA 2.8 #1-8-treated diaphragms mixed with increasing amounts of competitor DNA (100 to 108 copies). In some cases (#1, 3, 4, and 7), the DNA was limited and only the most important competitor reactions were completed. Each sample is listed with their respective values representing estimated vector copies per diploid genome and average GAA activity. Raw QC-PCR data from each diaphragm is pictured to the far right. As a control, -actin was amplified from 200 ng of each sample DNA (shown at bottom). Every in utero -treated sample gave a positive vector amplification signal and as the estimated vector copies per diploid genome ratio increased, the GAA activity detected in the same tissue also increased. Copies of Competitor DNA 100 102 103 104 105 106 107 108Estimated Copies/ diploid genome GAA KO 0 0 #1 20 24.1 #2 50 823.5 #3 7.5 1.0 #4 ?? .2 #5 10 18.2 #6 15 145.0 #7 2.5 1.2 #8 15 177.4 -ActinGAA Activity 1 2 3 4 5 6 7 8 KO No DNA Ladder

PAGE 134

119 minimal GAA activity (1.2 nmol 4-MUG/hr/mg protein), was found to contain significant vector genomes with 2.5 estimated vector copies per diploid genome detected. Sample #4, which had basically no GAA activity, did give a positive amplification signal, but was too faint to determine copy number. Even though significant levels of rAAV1-CMV-h GAA 2.8 vector genome copies were present in all treated diaphragms, there was an optimal threshold of genome copies which must be present in order to produce a detectable level of GAA. We also performed QC-PCR on the four livers from treated mice in which the diaphragms exhibited high GAA activity (rAAV1-CMV-h GAA 2.8 #2, #5, #6, and #8). Three of those livers tested had positive amplification signals, and were found to contain on average 0.1 estimated vector genomes per diploid genome (data not shown). Even though it was uncertain whether the livers sampled in this experiment were actually the lobes directly injected, this did indicate that there were vector genomes present in most the livers tested. For the most accurate representation of vector genome copies in the liver, QC-PCR should be performed on DNA isolated from the entire liver. Diaphragm Transduction as a Result of Intraperitoneal Exposure to rAAV In Utero To determine if intraperitoneal exposure of rAAV-h GAA 2.8 after hepatic in utero injections was the source of diaphragmatic transduction, we performed several intraperitoneal in utero injections. We delivered 8.14 x 1010 particles rAAV1-CMV-h GAA 2.8 to 15 p.c. Gaa-/fetuses via the intraperitoneal cavity and harvested the diaphragms from three animals (#1-3) at 1 month of age. The tissues were assayed by X-Gluc staining, GAA activity, Western analysis, and QC-PCR. Each diaphragm was positive to varying extent for X-Gluc staining (data not shown) and GAA

PAGE 135

120 activity (Figure 7-7). At least normal levels of GAA activity were achieved in all treated samples. Western analysis confirmed the presence of the 76-kD mature form of GAA (data not shown). It was evident that intraperitoneal exposure to rAAV during murine embryonic development resulted in high-level transduction of the diaphragm muscle. This supported our hypothesis that during hepatic in utero injections, some vector was deposited in the peritoneal cavity allowing for direct diaphragmatic transduction. Therefore, we believe that intraperitoneal injection of rAAV is a better delivery method for achieving vector transduction of diaphragm muscle. QC-PCR was used to analyze rAAV1-CMV-h GAA 2.8 #1-#3 diaphragms for vector genome copy number. Raw results are presented in Figure 7-8. Estimated vector copies/200 ng DNA ratios were determined by densitometry as previously described. This value was then converted to estimated vector copies per diploid genome using a 5 pg total DNA/cell conversion factor and this value was listed beside the appropriate animal number. Every in utero treated diaphragm was positive for vector genomes resulting in 1 to 100 estimated vector copies per diploid genome. There were some discrepancies between relative level of GAA activity and vector genome copy number among these samples (reviewed in Table 7-1). For instance, rAAV1-CMV-h GAA 2.8 #2 exhibited significantly higher GAA activity than rAAV1-CMV-h GAA 2.8 #3, but #3 contained several more vector copies per diploid genome. This could be due to the unequal transduction over the entire diaphragm muscle. Protein for GAA activity assays and western analysis was isolated from a different part of the diaphragm than what was used to isolate DNA for QC-PCR. Nevertheless, all in utero

PAGE 136

121 intraperitoneal-treated Gaa-/diaphragms resulted in higher than normal levels of GAA activity and all were positive for rAAV1-CMV-h GAA 2.8 vector genomes. Intraperitoneal in utero delivery appears to be an efficient and reproducible method of transducing diaphragm muscle.

PAGE 137

122 Figure 7-7 Acid -glucosidase activity and western analysis of diaphragm muscle after intraperitoneal in utero delivery of rAAV1-CMV-h GAA 2.8. Acid -glucosidase activity assay was performed on transduced diaphragms from Gaa-/mice treated intraperitoneal at 15 days gestation with rAAV1-CMV-h GAA 2.8. Every treated diaphragm (#1-3; gray bars) resulted in positive transduction with expression leading to above normal levels of GAA activity (WT; black bar). Y-axis is plotted in log scale. GAA KOWT123Acid -Glucosidase Activity nmol 4-MUG/hr/mg protein 1 10 100 1000 10000

PAGE 138

123 Figure 7-8 Determination of vector genome copy number within diaphragm muscle after in utero intraperitoneal delivery of rAAV1-CMV-h GAA 2.8. QC-PCR was used to determine vector genome copy number within in utero -treated diaphragms. Between 1 and 100 estimated vector copies per diploid genome were recovered from each treated diaphragm. Copies of Competitor DNA 100 102 103 104 105 106 107 108 #1 1 #2 15 #3 100 Estimated Copies/ Sample diploid genome

PAGE 139

124 Table 7-1 Biochemical and genomic analysis of diaphragms after IP in utero delivery of rAAV1-CMV-h GAA 2.8 Intraperitoneal in utero delivery rAAV1-CMV-hGAA2.8 GAA Activity Assay (nmol 4-MUG/hr/mg protein) QC-PCR (estimated vector copies/diploid genome ) Gaa -/(n=4) 0 0 Wild type C57B6/129-SvJ (n=4) 23.6 N/A rAAV1-CMV-hGAA2.8 #1 32.6 1 rAAV1-CMV-hGAA2.8 #2 559.0 15 rAAV1-CMV-hGAA2.8 #3 154.1 100

PAGE 140

125 CHAPTER 8 CORRECTING GAA DEFICIENCY IN OTHER MUSCLE GROUPS Since GSDII is a storage disease which affects all striated muscle groups, we had initially hoped to correct GAA deficiency in heart, skeletal muscle and diaphragm of Gaa-/fetuses by rAAV-mediated gene replacement. We have shown evidence of GAA gene replacement and correction of GAA enzyme deficiency in Gaa-/diaphragm after in utero delivery of rAAV carrying the human GAA cDNA. We have also presented data to support correction of biochemical and functional abnormalities normally seen in the diaphragm of this mouse model. In this chapter, we present data toward gene replacement in embryonic murine skeletal muscle. We used the information gained from the diaphragm transduction experiments to initiate a study in which rAAV1-CMV-h GAA was delivered to other Gaa-/muscle groups in utero . We used our same surgical method to inject the left hind muscle as opposed to the liver or intraperitoneal cavity. In these injections, the needle was inserted past the uterine wall and into the left hind knee toward the quadriceps of the fetus. Transduction of Other Muscle Groups by In Utero Delivery of rAAV1 Results discussed in Chapter 7 show that -galactosidase activity was detected only in the diaphragm muscle after hepatic injection with 5.8 x 109 particles of rAAV1-CMV-LacZ. There was one exception. One of the CD-1 mice treated in utero with rAAV1-CMV-LacZ did show -galactosidase expression in its quadriceps muscle as determined by X-Gal staining (Figure 8-1 b). Neither the untreated, nor the other treated animals exhibited a similar expression pattern (Figure 8-1 a). We believe that somehow

PAGE 141

126 Figure 8-1 Beta-galactosidase expression in the quadriceps muscle after in utero delivery of rAAV1-CMV-LacZ. One CD-1 fetus injected with 5.8 x 109 particles of rAAV1-CMV-LacZ in the liver displayed -galactosidase activity in the quadriceps muscle (b). This was a rare event since the other injected muscles did not show similar expression. Shown in panel a is a quadriceps muscle from an uninjected animal. ab

PAGE 142

127 this leg came into the path of the needle during the injection. This observation spurred the next set of experiments which involved direct injection into the left hind limb of 15 p.c. fetuses. Transduction of Gaa-/-Skeletal Muscle after In Utero Intramuscular Injections Six Gaa-/fetuses were injected with 8.14 x 1010 particles of rAAV1-CMV-h GAA 2.8 at 15 days gestation into their left hind leg. The right hind limb was left uninjected as a negative control. The animals were harvested at 2 months of age to isolate liver, kidney, spleen, gonad, diaphragm, lung, heart, brain, tongue, and right and left hind skeletal muscle for GAA activity assays. No significant activity was detected in any in utero -treated tissue besides skeletal muscle from the left hind leg (data not shown). Initially, when we isolated skeletal muscle from the left and right hind quadriceps and calf, we froze down individual chunks of tissue. We found that measuring GAA activity from small regions was not an accurate method of measuring expression, since we were not sure of the exact location of the injection site. We decided to combine the remaining skeletal muscle isolated from the left and right hind limbs and perform assays on the whole muscle tissue to get an average expression profile over the entire muscle. We used a new razor blade to finely chop the skeletal muscle and split the mixture into two portions, one portion for isolating protein extract to be used for GAA enzyme assays and western analysis and the other for isolating DNA for QC-PCR. Results of activity assays from Gaa-/untreated, C57B6/129-SvJ normal, Gaa-/in utero -injected and uninjected skeletal muscles are presented in Figure 8-2A. Five of the six injected skeletal muscles (labeled 1-6I) revealed detectable expression of GAA ,

PAGE 143

128 but only one of these reached a level of normal activity. This experiment also indicated that we successfully injected only the left hind limb since no activity was detected in the uninjected right hind limbs (labeled 1-6U). Western analysis was conducted using 40 g of protein from the same extracts used in the activity assay (Figure 8-2B). Lanes containing extract from the injected muscle were labeled 1-6I and those from the uninjected muscle, 1-6U. Signal was detected in injected muscle #1 and #2, which coincided with the 76-kD mature form of GAA seen in the placental hGAA control lane. These were the two samples which exhibited the highest level of GAA activity by enzyme assay (Figure 8-2A). All other tissues with a small level of activity did not express enough GAA to be detected by western blot. As in all other western blots presented up to this point, an unknown cross-reacting protein was detected in all samples, but served as a loading control. We performed QC-PCR using DNA extracted from total skeletal muscle tissue isolated from in uteroinjected skeletal muscle. The right uninjected skeletal muscle was used as an internal negative control. In every injected tissue that showed evidence of GAA expression (#1, #2, #3, #4, and #6 Figure 8-2A), each indicated the presence of vector genomes (left side of Figure 8-3). Injected muscle #1, which had the highest level of expression as measured by enzyme assay, contained on average, one genome copy per diploid cell. The other four tissues (#2, #3, #4, and #6) which showed a low level of expression by enzyme assay, contained on average, less than one genome copy per diploid cell. Four of the six uninjected skeletal muscles had no vector genome amplification signal (right side of Figure 8-3). The two that did have low signals (#2 and #3), had bands that were hardly visible and were unable to be quantified.

PAGE 144

129 Figure 8-2 Acid -glucosidase activity and western blot of skeletal muscle after intramuscular in utero delivery of rAAV1-CMV-h GAA 2.8. Six Gaa-/15 p.c. fetuses were injected in the left hind limb with 8.14 x 1010 particles of rAAV1-CMV-h GAA 2.8. Activity assays of injected and uninjected skeletal muscle revealed detectable enzyme activity in five of six injected tissues (A, 1-6 I). Expression was not detected from any uninjected muscles (A, 1-6U). Only one of the six injected muscles expressed at or above normal levels. Western analysis was performed with 40 g of extract from injected and uninjected muscles (B). Only the two injected muscles with the highest enzyme activity levels (#1 and #2) were detected by western blot. The isoform detected was the 76-kD mature form which was observed in the placental hGAA control lanes. KOWT1I1U2I2U3I3U4I4U5I5U6I6UAcid -Glucosidase Activity nmol 4-MUG/hr/mg protein 0 10 20 30 40 50 placental hGAA placental hGAA1I 1U 2I 2U 3I 3U 4I 4U 5I 5U 6I 6U 80 kDA B

PAGE 145

130 Figure 8-3 Vector genome copy number within in utero IM injected skeletal muscle. Gaa-/fetuses received 8.14 x 1010 particles of rAAV1-CMV-h GAA 2.8 in their left hind quadriceps. QC-PCR was performed on 200 ng of DNA isolated from injected (left) and uninjected (right) hind skeletal muscle from 2-month-old treated mice. The amplified products were separated on a 2% agarose gel. The relative intensities of the products were established by densitometry and plotted to determine estimated vector copies per diploid genome. Vector was amplified from five of the six injected muscles (#1, #2, #3, #4, and #6) and barely visible amplification signals were observed among two of the uninjected muscles (#2 and #3) indicating the vector was successfully delivered to the appropriate muscle. Injected muscle #1, which had the highest level of enzyme activity, contained on average, one vector genome copy per cell. All other treated samples, which had below normal levels of GAA activity, averaged less than one vector genome copy per cell. Beta-actin was amplified from 200 ng of DNA from each sample to show similar amounts of DNA were amplified in each QC-PCR. Copies of competitor DNA 100 102 103 104 105 106 107 108Injected Skeletal MuscleUninjected Skeletal Muscle#1 43.4 1 #2 6.4 0.15 #3 4.7 0.25 #4 2.2 0.0125 #5 0 no signal #6 1.1 too faint -ActinNone 1-Inj 1-Uninj 2-Inj 2-Uninj 3-Inj 3-Uninj 4-Inj 4-Uninj 5-Inj 5-Uninj 6-Inj 6-Uninj Copies of competitor DNA 100 102 103 104 105 106 107 108MarkerEstimated Copies/ diploid genome GAA Activity

PAGE 146

131 Amplification of -actin from 200 ng of skeletal muscle DNA was again used as a control to show relatively equal amounts of DNA from each sample were used in the QC-PCR assay (bottom of Figure 8-3). Animal #1 of the 2-month-old treated animals had extremely high expression, presumably resulting from its one vector copy per cell ratio. In this muscle group, there seems to be a threshold of one vector genome per cell which allows for normal levels of GAA expression. The other treated tissues, which had a ratio of less than one, had detectable levels of GAA expression but nonetheless, expressed below normal levels. Before we assayed these 2 month treated samples, we had harvested injected and uninjected muscles from rAAV1-CMV-h GAA 2.8 IM in utero injected Gaa-/animals when they were 2 weeks, 4.5 weeks, and 5.5 weeks of age. In brief, there was no activity detected from injected skeletal muscle of the 2-week-old group, but moderate expression from the 4.5and 5.5-week-old animals (data not shown). Those expressing GAA at these earlier time points had levels resembling the low expressers from the two-month-old treated group (#2, #3, #4, and #6, Figure 8-2A). We were hoping to see higher expression than this and to ensure that the vector had a chance to initiate expression of h GAA , we had decided to isolate the reported group at the later age of 2 months. Overall, we found much higher expression levels from transduced diaphragm tissue after intraperitoneal or hepatic in utero injection of rAAV1-CMV-h GAA 2.8 than transduced skeletal muscle from IM in utero injections. Many factors could affect this. The most likely scenario is that global transduction of the diaphragm muscle is achieved through intraperitoneal exposure to the vector as opposed to skeletal muscle where the vector is delivered to one small area, limiting global exposure of the muscle to the vector.

PAGE 147

132 This seems likely since other rAAV experiments in which vector is delivered IM, indicate the vector localizes to the site of injection (70). Also, we assayed for GAA activity and vector genomes over the entire skeletal muscle with results reported as average values. We assume that if we had isolated the exact location of the IM injection, we would have found the highest level of vector genomes and GAA expression localized to this area. This value would have been much higher than the average which was reported in these experiments and would presumably be more along the levels observed in the diaphragm transduction experiments. Unfortunately, we were left with the current method of analysis because the small size of the mouse at the time of injections prevented us from localizing the injection site.

PAGE 148

133 CHAPTER 9 TOLERIZATION TO VECTOR DERIVED PROTEIN IN MICE AFTER IN UTERO DELIVERY OF RECOMBINANT AAV One difficulty encountered among gene replacement strategies is that vector derived proteins can elicit host immune response. In most cases, knockout mice are created with a mutation in a specific gene which causes the translated protein to be absent. The Gaa knockout mouse used in these studies was generated by insertion of the neomycin gene within exon six of the Gaa gene, causing the transcript to be truncated. There is little to no messenger RNA produced and no detectable GAA by enzyme assay or western blot. Therefore, when these mice undergo protein or gene replacement, they are receiving or making a protein they have never before encountered. Our group has observed that in protein replacement studies, many Gaa-/animals die of anaphylactic shock when they receive several injections of recombinant human GAA (rhGAA) protein. The rhGAA protein is initially recognized as foreign and elicits a humoral antibody response. Upon repeated exposure to rhGAA, the mouseÂ’s immune system responds by secreting neutralizing antibodies; some of these are IgE which readily bind mast cells and trigger the release of histamine and other agents. The proteins released induce vasodilation by contraction of smooth muscle cells causing bronchoconstriction or a fall in blood pressure that results in anaphylactic shock and most likely death. Investigators in our laboratory discovered that Gaa-/animals can also respond immunologically to vector-derived GAA. When mice received rAAVGAA by way of

PAGE 149

134 portal vein injection, hepatocytes were effectively transduced and produced high levels of GAA as detected by enzyme assay. Rather than the expression level being sustained over time, GAA activity gradually decreased. Initial experiments indicated this may be attributed to cell-mediated or humoral immune response to vector-derived GAA. Since GAA activity in the liver decreased over time and circulating antibodies against GAA increased during this same time period, we believe the animals formed an immune reaction against the “foreign” protein. A recent study reported the absence of immunological responses toward the transgene or adenovirus after in utero delivery of adenovirus expressing luciferase. However, a humoral response against luciferase was observed in adult animals after readministration of rAd-luciferase after in utero exposure to the same vector (84). These results indicated that no antibodies are produced initially against the vector or transgene when it is delivered and expressed during early development. However, the later findings of this study conflict with what was anticipated at the onset of the experiments. Presumably, the vector was delivered and expressed at an early stage, when mice do not have a fully developed immune system. If the vector and encoded proteins are present before the immune system matures, then the immune recognizes them as “self” antigens and ignores their presence. One would expect that upon readministration of rAd after in utero exposure, the animal would consider the rAd vector and the transgene product as “self” proteins and not react immunologically. Similarly, we wanted to examine whether mice could be tolerized to vector-derived proteins if a rAAV vector encoding the protein were administered in utero. If the mice express the gene contained within the rAAV vector before maturity

PAGE 150

135 of their immune system, they would regard the protein as self-derived. To challenge this tolerization, we administered recombinant protein after 1 month of life and assayed for IgG antibody production against the protein. Reduced Immune Response to Infusion of Recombinant Beta-Galactosidase after In Utero Delivery of rAAV1-CMV-LacZ Three CD-1 mice received 5.8 x 109 particles of rAAV1-CMV-LacZ in utero at 15 days gestation via hepatic injection. At the fifth week of life, three uninjected CD-1 mice and the three in utero -treated mice were first bled for serum, and then infused IV with 2 mg recombinant -galactosidase per kilogram body weight. After this, each week for three weeks (coinciding with the 6th, 7th, and 8th week of life), the six animals were first bled then challenged with 2 mg/kg r -galactosidase. Two subsequent bleedings were performed weekly after the injections (corresponding to week 9 and 10). Once serum from all time points was gathered, we completed a sandwich immunoassay which determined IgG antibody levels against r -galactosidase protein. A 96-well plate was first coated with r -galactosidase. Each well was washed several times to remove any unbound protein, and then blocked using FBS. A 1:40 dilution of each serum sample was added in triplicate to the plate. After allowing any anti-r -galactosidase antibodies present in the serum to bind, the plate was washed several times and anti-mouse IgG horseradish peroxidase (HRP) antibody was added. This would bind any antibody recognizing recombinant -galactosidase that was IgG. Substrate was then added which reacts with the HRP conjugate, turning the mixture blue. Wells that contained anti-galactosidase antibodies turned blue with the intensity directly correlating with the antibody level. When the brightest well had ample opportunity to react (4-5 minutes), all reactions were stopped with sulfuric acid. After the

PAGE 151

136 positive wells immediately turned yellow, the plate was read at 405 nm using a microplate reader. The absorbance values from each group of animals were averaged, normalized, and plotted as a factor of time (Figure 9-1). No anti-r -galactosidase antibodies were detected among either the in uterotreated or untreated CD-1 mice prior to r -galactosidase injections. However, the first week after r -galactosidase injections, the untreated animals began to produce a small level of antibody whereas the in utero -treated animals did not. Each succeeding week, anti-r -galactosidase antibodies were detected at increasing concentration among both groups. However, the in utero -treated animals had significantly lower antibody levels (as indicated by the asterisks). Recombinant -galactosidase is highly immunogenic as indicated by the antibody titers produced by the untreated animals. We believe that when the animals were exposed to vector-derived -galactosidase after in utero delivery, they became more tolerant to the recombinant protein which was later injected. We expect that if the in utero -treated animals had begun to produce -galactosidase after the immune system had developed, they would have shown an anti-galactosidase antibody profile similar to that of the uninjected animals. Complete Tolerization of Gaa-/Mice to Recombinant Human GAA after In Utero Delivery of rAAV1-CMV-h GAA 2.8 We conducted a similar study simultaneously in which Gaa-/mice untreated (n=7) and in utero treated with 8.14 x 1010 particles of rAAV1-CMV-h GAA 2.8 via hepatic injection (n=9) were subjected to repeated IV injections of a 2 mg/kg dose of recombinant human GAA (rhGAA) protein. Again, all animals were injected weekly at 5, 6, 7, and 8 weeks of age. Serum samples were obtained before each injection and once weekly for three weeks after the series of injections. Antibody titers among

PAGE 152

137 Figure 9-1 In utero partial tolerization of recombinant -galactosidase. Five-week-old CD-1 mice untreated (n=3; ) and in utero treated with rAAV1-CMV-LacZ (n=3; ) received an initial injection of 2 mg/kg of recombinant -galactosidase. Subsequently, they received three additional injections at the same dose weekly. Serum was taken before each injection and once weekly for two weeks after the series of injections. Levels of circulating anti-r -gal IgG antibodies were determined by sandwich immunoassay and plotted for each group over time. Values are reported as absorbance units at O.D. 405. Times of injection after serum collection are indicated by arrows. Asterisks signify significant differences between untreated and in utero -treated groups (p<0.01). Week of Life 4567891011 Absorbance (405) -0.05 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 Untreated (n = 3) In Utero Treated with rAAV1-CMV-LacZ (n=3) Injection of 2 mg/kg r -Gal Difference is significant p < 0.01 * * * * *

PAGE 153

138 in uterotreated and untreated animals were plotted over time in a manner similar to the previous experiment (Figure 9-2). As in the previous experiment, we found that Gaa-/animals injected with rAAV1-CMV-h GAA 2.8 in utero did not produce any IgG antibodies against GAA when assayed five weeks after birth. As the experiment continued, untreated animals experienced a humoral response to the recombinant protein, while in utero vector-treated animals appeared to be tolerized (Figure 9-2). Immediately after the third protein injection, untreated animals began to die of shock presumably due to histamine reaction as a result of IgE antibody release. Two more animals within this group died; one was lost due to a similar fate after the fourth protein injection and the other was found dead between week 9 and 10. Only one animal within the in uterotreated group suffered a similar fate due to anaphylactic shock after the fourth injection (animal designated #385). This mouse started to produce antibody against GAA before the untreated group. In utero -treated animal #384 also was producing anti-GAA antibodies, but before the start of the protein injections. Since this animal was already making antibodies before the experiment began, we excluded its antibody titers when plotting averaged values from the in uterotreated group (Figure 9-2). Interestingly, this animal lived the entire course of the experiment despite extremely high antibody titers. This result indicated that animals #384 and #385 were producing antibodies against the vector derived protein. We believe that in these cases, the animals did not expressing the transgene product until after the maturation of their immune systems. Rather than tolerized, it seems that animal #384 was immunized by vector expressed GAA.

PAGE 154

139 With the exception of animal #385, only a low level of anti-rhGAA antibody was detected in two animals after the fourth protein injection. Even though #385 was making antibody before any of the untreated animals, it was not making antibody prior to the initiation of protein injections. Therefore, we included its antibody titers when averaging in utero -treated values in Figure 9-2. It was difficult to prove significance among the data presented in Figure 9-2. During weeks 7 and 8, the antibody titers of animal #385 caused the error bars to be extremely large. During weeks 9, 10, and 11, there are not enough animals left in the untreated group to perform standard statistical analysis. Based on the data, we generalize that Gaa-/mice are tolerized against GAA upon effective transgene expression before complete development of the immune system. This is supported by the death rate of untreated to in utero rAAV1-CMV-h GAA 2.8-treated animals after repeated injection of recombinant human GAA protein. We wanted to further characterize the level of antibody production after in utero delivery of rAAV to Gaa-/fetuses. When we sacrificed all the animals presented up to this point, we had isolated a terminal sample of serum from almost every animal. In Table 9-1, we present relative antibody levels among several untreated and in utero -treated animals. Most animals were at 1 month of age when assayed, but several animals treated with rAAV2-CBA-h GAA 2.8 were assayed at 6 months. It is interesting that most of the animals with detectable anti-hGAA IgG antibody in their serum were from 6-month-old hepatic rAAV2-CBA-h GAA 2.8 injected mice, or 2-month-old rAAV1-CMV-h GAA 2.8 intramuscular injected animals. Not all animals within these groups showed similar results. We maintain that if following in utero delivery of rAAV-h GAA 2.8, vector derived GAA is produced prior to the maturity of the hostsÂ’

PAGE 155

140 immune system, then these animals will not produce an immunological response against it.

PAGE 156

141 Figure 9-2 In utero tolerization of recombinant human GAA protein in Gaa-/mice. Gaa-/mice either treated in utero with 8.14 x 1010 particles of rAAV1-CMV-h GAA 2.8 (n=8; ) or untreated (n=7; ) were injected with four weekly doses of 2 mg/kg recombinant human GAA, beginning at 5 weeks of age. Arrows indicate the time of injection. Serum was collected prior to each protein injection and weekly for three weeks after the series of injections. The level of circulating anti-rhGAA IgG antibodies within each serum sample was determined by a sandwich immunoassay. The normalized absorbance values were averaged for each animal group and these values were plotted on the y-axis as a function of time. Asterisks indicate significant differences at p<0.01. Absorbance (405) 456789101112 0.0 0.1 0.2 0.3 0.4 0.5 **n=7 n=8n=8n=8n=8n=7n=7n=7 n=7 n=7 n=3 n=2 n=1 n=1Week of Life Untreated In Utero Treated with rAAV1-CMV-hGAA2.8 Injection of 2 mg/kg rhGAA Difference is significant p < 0.01 *

PAGE 157

142Table 9-1 Circulating hGAA antibody levels after in utero delivery of rAAV-h GAA Injections of 2 mg/kg recombinant human GAA are given to each mouse after bleedings at Week 5, 6, 7, and 8. is any absorbance below 25 units + is between 25-200 absorbance units ++ is between 200-300 absorbance units +++ is between 300-400 absorbance units ++++ is between 400-500 absorbance units +++++ is between 500-600 absorbance units ++++++ is 600 absorbance units and above Individual Animals Experimental Group A B C D E F G H I J 1 mo. old Wildtype 129/B6 Untreated 1 mo. old GAA KO hepatic in utero Saline 1 mo. old GAA KO hepatic in utero rAAV2-CBA-Luc 1 mo. old GAA KO hepatic in utero rAAV2-CBA-hGAA 6 mo. old GAA KO hepatic in utero rAAV2-CBA-hGAA ++++++ ++++++ ++++++ ++++ ++++++ 1 mo. old GAA KO hepatic in utero rAAV2-CMV-hGAA + + 1 mo. old GAA KO hepatic in utero rAAV1-CMV-hGAA 1 mo. old GAA KO intraperitoneal in utero rAAV1-CMV-hGAA+ + 2 mo. old GAA KO intramuscular in utero rAAV1-CMV-hGAA+++++++++++ + --

PAGE 158

143 CHAPTER 10 DISCUSSION AND FUTURE DIRECTIONS General Significance This is the first documentation of in utero delivery of recombinant adeno-associated vectors to a knockout mouse model of human disease. Further, we show efficient in utero transfer of the therapeutic gene encoding acid -glucosidase to the diaphragm of the mouse model of GSDII. This is a crucial finding in the study of GSDII since diaphragm is one of the severely affected organs of both adult and infantile onset forms. A detailed discussion of in utero gene therapy including the current status of preclinical research and the debate of possible future clinical applications is presented in this chapter. We summarize the important results obtained from our study and their significance in the treatment of GSDII and other neuromuscular disorders and to the newly emerging field of in utero gene therapy. We also explain future experiments proposed to test in utero transduction in non-human primates for the treatment of GSDII. Preclinical and Clinical Status of In Utero Gene Therapy In July, 1998, Drs. W. French Anderson and Esmail Zanjani submitted two preliminary protocols for clinical trials involving in utero gene therapy to the National Institutes of Health Recombinant DNA Advisory Committee (NIH-RAC). These were presented to initiate discussion on the scientific, medical, and ethical issues raised by prenatal gene transfer research. The NIH RAC meetings are organized forums for airing public views on unsual applications involving gene therapy. Subcommittees presented

PAGE 159

144 findings during the March, 1999 RAC meeting. The general conclusions reached were that significant technological developments must be accomplished and enough preclinical data must be accumulated before the committee would support the initiation of clinical trials (103). We present here only those findings which pertain directly to in utero viral transfer and not ex vivo prenatal gene transfer. Currently, in utero gene transfer is exclusively studied in animal models and currently no clinical protocols are approved in the United States. In the UK, the Gene Therapy Advisory Committee (GTAC) currently prohibits in vivo gene transfer protocols in utero , but reviews ex vivo procedures using the same regulations used for somatic gene therapy procedures. They believe ex vivo prenatal gene transfer poses no higher risk of germ-line transmission than postnatal somatic gene therapy procedures, which have already been approved (52, 103). Advantages of In Utero Therapy For certain diseases, in utero somatic gene therapy may hold several advantages over conventional postnatal somatic gene therapy approaches. For example, in cases where a monogenetic disorder causes irreversible damage early in life, delivering the gene during fetal development could prevent the disease phenotype. Other advantages relate directly to the gene delivery during an early gestational stage when certain tissues, organs or systems are under developed. For example, immune response can be evaded, genes or gene products may cross the blood-brain barrier, some organs may be more accessible at specific phases of development, certain vectors target rapidly dividing cells, and vector integration in rapidly dividing cells provides for permanent gene expression (27, 103).

PAGE 160

145 Other factors support the progress toward in utero gene therapy applications. For prenatally-diagnosed fatal diseases in which there are no curative treatments, in utero therapy offers an expectant mother increased choices during pregnancy. The only choices in some cases are the acceptance of an affected child or termination of the pregnancy. Also, minimally-invasive ultrasound-guided diagnostic procedures are established methods of practice. These include amniotic fluid collection, chorionic villus biopsy, procedures to reduce fluid accumulation in bladder and chest, drug infusions, and blood or platelet transfusions. Using similar techniques, gene delivery to the fetus could be achieved at similar limited risks. Lastly, there may be significant cost benefits associated with in utero gene therapy when compared to the cost of life-long treatments (27, 103). Immune Tolerance after In Utero Gene Therapy As discussed in detail in Chapter 10, the individual receiving in utero therapy could potentially develop tolerance to the gene products if the gene is delivered before development of immune competence. We must gain a better understanding of the development of the human immune system and use this to our advantage to improve the effectiveness of in utero gene therapy. If specific markers were identified which could be used to track the development of the immune system, we could use these to map out the optimal “window” during which delivery of genes would result in minimal immune responses. Sufficient time for prenatal diagnosis and clinical trial consent must also be taken into account when determining the optimal stage for gene transfer (103). Risks Associated with In Utero Gene Therapy The most prevalent concern about in utero gene therapy is the risk of germline transmission. In addition, transgene expression in tissues other than the target organ may not be appropriate in the treatment of some diseases. Undirected integration of the

PAGE 161

146 transgene could cause disruption of normal fetal development or the activation of oncogenes eventually leading to tumor formation. High gene expression at this early stage could also negatively affect development. Other risks are directly associated with vector delivery or gene expression. These include bleeding, severe injury, infection, immune reaction, and preterm labor for two individuals involved (52, 103). Germline Transmission For any gene therapy approach, either prenatal or postnatal, which involves the use of integrating vectors (e.g. AAV and retrovirus), there exists a possibility of germline transmission. Delivery of foreign DNA to germ cells is especially troublesome when the vector is administered into the circulation, intraperitoneal cavity, or amniotic fluid since this exposes the entire organism to the vector (27, 103). Studies in sheep (113, 149) revealed the presence of vector DNA in gonads of sheep treated prenatally with recombinant adenovirus delivered into the circulation or retrovirus delivered intraperitoneal. However, gene expression was not detected by RT-PCR or immunohistochemistry and germline transmission was negative when sperm from treated animals was tested for vector DNA by PCR. To date, there has been no evidence to support the transmission of genetic material through the germline after gene therapy vectors have been administered to nongonadal tissues prenatally or postnatally (27, 103). No matter how small the risk of germline transfer, the possibility cannot be eliminated. Even if in utero gene therapy clinical trials are finally approved, it will be necessary to monitor the fetus, mother, and subsequent offspring of both individuals for the transfer of genetic material. It is a great assumption that all parties involved would be willing to participate, since initially it is only the parents (and possibly only the mother) who initially decide for all individuals involved to take part in the trial. There are a few

PAGE 162

147 steps that can be taken to reduce the even now small possiblility of germline transmission. This includes continuing in utero gene therapy research in animals, creating vectors which target specific cell types, using constructs with promoters only active in the target cells, using localized delivery methods, and delivering vectors to the fetus at a point in gestation after which the primordial germ cells are compartmentalized to the gonads (after week 7 in humans) (27, 103). Ethical Considerations The most important ethical concern about in utero gene therapy is the potential ramifications of germline manipulation. Another important ethical consideration is that possible risks to the fetus and mother are minimized while the benefits to the fetus are maximized. We must also acknowledge that the fetus who never consents to the therapy will become a child and eventually an adult undergoing a lifetime of medical follow-ups. When making the decision to partake in a prenatal clinical trial, parents should only consider the best medical treatment available for the fetus. If in utero gene therapy becomes an acceptable treatment, other considerations such as healthcare changes and equal accessibility must be addressed (103). Good vs. Poor Disease Candidates The RAC suggests that the first prenatal gene therapy trials should not be conducted for the treatment of diseases which are fatal in utero . Partial correction may result in the child surviving birth, but being severely diseased or in need of life-long treatment. This would worsen an already sad situation and not benefit the public perception of in utero gene therapy. Alternatively, the best candidate diseases with which to initiate clinical trials have the following attributes: 1. monogenetic disorders in which the fetus must survive birth; 2. irreversible tissue damage begins early in development; 3.

PAGE 163

148 the genetic and biochemical aspects of the disease are well characterized; 4. a predictable genotype-phenotype correlation exists; 5. accurate methods of prenatal diagnosis are available; 6. characterized animal models of the disease are accessible for preclinical studies; and 7. postnatal treatment strategies are ineffective or only partially effective. Several lysosomal storage diseases, including GSDII, fit all of these proposed criteria. In utero gene therapy is a risky treatment for many of these disorders, but it is justifiable if even partial correction resulted in some clinical benefit (103). The Impact of In Utero Studies in the GSDII Mouse Model Several important discoveries were made which will impact this new field of gene therapy research. A review of significant findings and how these provide a foundation for further studies in prenatal gene therapy in the treatment of GSDII is presented in this section. Inexpensive and Effective Method of Vector Delivery to Prenatal Mice We have devised a rapid, reproducible, and inexpensive method of delivering vectors to the mid-gestation mouse. A survival study involving almost 300 injected fetuses resulted in a surgery survival rate of 60%, compared to a 100% normal birth rate. The post-birth survival rate was 73%, a rate similar to animals not in utero treated. This is the first study of its kind to be conducted on in utero vector delivery to knockout mice. Expression Trends after In Utero rAAV Transduction Limited work has been reported on the in utero delivery of rAAV to mice or any other model. Of those, two report high level gene expression in several tissues at day one of life after delivery of rAAV2 at day 15 of gestation. Both also report a decrease in expression as development of the animal continues with a low level of expression being maintained after 1 month of age, despite the route of intrauterine delivery (85, 130). The

PAGE 164

149 current hypothesis for loss of expression is that as cells divide throughout development, the unintegrated vector genomes are dispersed to daughter cells and the effective dose of copies per cell dramatically decreases over time. This hypothesis also explains why a steady level of expression is maintained after the initial phases of development, as cell division ceases. Our study focused on expression analysis at one month of age, after early development and after this initial dilution of vector genomes has already occurred. Biochemical and Functional Correction in Diaphragm after In Utero Peritoneal Exposure to rAAV We found that expression was concentrated to the diaphragm of in utero hepatic injected mice and that very little to no expression was found in the liver, the site of injection. We believe that during these hepatic injections, vector was released into the peritoneal cavity, allowing for direct transduction of the diaphragm. Delivery of the human GAA gene under transcriptional control of the CMV promoter and in the context of rAAV serotype 2 resulted in levels of GAA expression reaching at and above normal levels in the diaphragm. Diaphragms transduced with the same expression cassette but delivered in the context of serotype 1, expressed GAA at even higher levels that reached over 10-fold higher than normal. Chemical staining of diaphragms treated with rAAV1-CMV-hGAA2.8 shows that transduction of the entire muscle can be achieved by this delivery method. In both cases, the predominant form of GAA detected by western analysis was the 76-kD mature form. In diaphragms where GAA expression reached normal and above normal levels, most of the fibers were clear of lysosomal glycogen deposits and normal muscle structure was preserved. The diaphragms of animals treated with a lower dose of rAAV2-CBA-h GAA 2.8 were assayed for contractile function at 6 months of age. Significant improvement was

PAGE 165

150 observed when these force-frequency relationships were compared to those of untreated age-matched controls. Diaphragms from animals treated with rAAV2-CMV-h GAA 2.8 and rAAV1-CMV-h GAA 2.8 are expected to show even more significant functional improvement and even possibly preservation of normal contractile function since these tissues reached at and above normal levels of GAA expression. However, these experiments are ongoing in the laboratory. QC-PCR experiments, used to quantify vector genomes present in a particular tissue, indicated up to 50 genome estimated vector copies per diploid genome could be achieved in diaphragm when serotype 1 vectors were used. This correlates with GAA activity levels reaching over 10-fold higher than what is observed in normal diaphragm. When 1 genome copy per diploid cell was detected in treated diaphragms, this resulted in activity equivalent to the normal level. Livers from hepatic in uterotreated mice were assayed for the presence of vector DNA by the same method. On average, 0.1 estimated vector copies per diploid genome were detected. This correlated with no detectable enzymatic activity. It seems that upon direct delivery of vector to the liver, unintegrated vector genomes are diluted as they are dispersed to daughter cells by repeated cell divisions during liver development. Intraperitoneal Delivery as a Efficient Method for Diaphragm Transduction We showed that transduction of the entire diaphragm muscle is possible through in utero hepatic delivery of rAAV, but this delivery method was not as reproducible as direct intraperitoneal (IP) injection. We found that IP delivery of rAAV1-CMV-h GAA 2.8 resulted in diaphragm transduction in all of the treated mice tested. GAA activity in all cases reached at or above normal levels. However, we were not successful in transducing the diaphragm to act as a factory for producing secreted GAA to treat other tissues. We

PAGE 166

151 believe in utero IP injection of rAAVGAA to be an efficient delivery method to achieve high-level diaphragm transduction and should be explored further as a possible treatment method for GSDII. Transduction of Skeletal Muscle after In Utero Delivery of rAAV We also established that efficient transduction of skeletal muscle could be achieved after in utero delivery of rAAV1-CMV-h GAA 2.8. Normal levels of GAA enzymatic activity were detected in one treated animal and this level correlated with 1 vector genome copy per diploid cell. The same level was not reached among the other five treated animals. This could be due to the nature of our standardized method of delivery. A microinjector may provide a more accurate method of delivery for skeletal muscle transduction. Tolerance to Transgene Product Following In Utero Gene Delivery We found that as expected, in utero delivery of the GAA gene early in mouse fetal development allowed for tolerance to the gene product upon challenge with recombinant GAA. We assume that in animals where gene expression occurred before immune competence, the transgene product was recognized as a “self” protein and did not induce an immune response upon challenge. Only 2 of 9 animals treated with rAAV1-CMV-h GAA 2.8 in utero produced significant levels of antibodies against GAA after challege with recombinant protein. In these cases, we assume the transgene product was expressed after the optimal “window” of immune incompetence. Duchenne Muscular Dystrophy as another Target Disease for Diaphragm Transduction Several groups have explored the delivery of plasmid DNA or adenoviral vectors to the diaphragm of the adult mdx mouse to treat muscle weakness associated with

PAGE 167

152 deficiency of dystrophin (87, 109, 110). The X-linked mutant mouse ( mdx) is a useful model of the X-linked recessive disease, Duchenne Muscular Dystrophy (DMD) (21, 134). Studies indicate that the diaphragm muscle rather than skeletal muscle of these mice more closely resembles the disease state observed among human patients (145). Results from diaphragm transduction experiments indicate very limited transduction of muscle fibers by either direct intramuscular injection or by tail vein administration followed by clamping of the vena cava below the diaphragm (30, 109, 110). The transduction levels attained in diaphragm muscle which are presented in the current study surpass these published results several fold. Future studies could potentially involve the delivery of recombinant AAV vectors containing minidystrophin genes to developing mdx mice in utero in an effort to restore muscle function within the diaphragm muscle (165, 166). We propose the in utero route of delivery would be a highly efficient method of transducing diaphragm muscle in this mouse model of DMD. GSDII as a Candidate Disease for In Utero Gene Therapy As previously mentioned, the RAC stated it was necessary to develop several technologies and accumulate extensive preclinical data before allowing the field of in utero gene therapy to advance to the clinical level. Established data and the research presented in this study support GSDII as a candidate disease to be treated by in utero gene delivery. Future in utero preclinical studies in nonhuman primates are already planned. Established Results Significant information about GSDII has been accumulated and several aspects are in agreement with what is required of a candidate disease for in utero gene therapy. The infantile-onset form of GSDII (Pompe disease) is a progressive disorder in which

PAGE 168

153 glycogen accumulation begins early in development causing possibly irreversible cellular damage. The disease process is so rapid that patients typically die before the age of 2. There is currently no effective treatment for the disorder and parents are left with few alternatives for their affected children (60). We know that GSDII is caused by a recessive mutation in the gene encoding acid -glucosidase. The gene has been sequenced and much has been discovered about the function of the encoded protein (60). In addition, biochemical methods of prenatal diagnosis have been established (45, 97, 105). As opposed to random screening for mutations, the RAC recommends accurate disease diagnosis among fetuses in which there is a strong family history or previously affected siblings. In addition, an established genotype-phenotype correlation must exist (103). A tight genotype-phenotype relationship has been established among Pompe patients when certain mutations are present (60). In cases where siblings have been diagnosed with Pompe disease, and the mutations involved are known, an accurate prenatal diagnosis can be made. Other technological advancements support GSDII as a candidate disease for in utero gene therapy. These include the creation of mouse models of the GSDII which present similar disease characteristics evident among the patient population. Also, techniques have been established that can be used to monitor the presence of transgene products through activity analysis of biopsies, and biochemical and functional improvements can be assessed through examination of biopsies and physiological testing (60). Therefore, patients enrolled in clinical trials can be monitored for achievement of specific clinical outcomes.

PAGE 169

154 Useful Data Accumulated during this Study The RAC recommends the accumulation of more preclinical data before approving any clinical trails in in utero gene therapy (103). Many results from this study will advance what is currently known about this new therapy. We showed biochemical and functional correction of a diseased tissue in an animal model of GSDII. We delivered the GAA gene to the diaphragm during a point in development which prevented disease onset. Even if only the diaphragm was targeted in GSDII clinical trials and correction of this tissue was achieved, this would provide at least some clinical benefit for these children who suffer from respiratory insufficiency and must remain on respirators. We also addressed important questions in the mouse regarding the optimal “window” of gene delivery which allows for tolerance of the transgene product. However, we did not analyze for the presence of vector genomes in the gonads or for germline transmission after in utero gene delivery. Further preclinical studies include the use of targeted vectors or tissue specific promoters. Future Studies in Nonhuman Primates The RAC acknowledges that in utero gene replacement studies using larger animal models is useful in establishing preclinical significance. Both sheep and nonhuman primates offer several advantages because their gestational development is similar to humans and similar ultrasound-guided techniques can be used. Also, the development of the immune systems is similar, allowing for optimization of the window of time available for injection. It is necessary to perform these experiments in primates prior to human trials, but unfortunately primates do not provide an adequate disease model (27, 52, 103, 128).

PAGE 170

155 The RAC called for a collaboration of research in the area of preclinical research (103). The NIH created the Center for Fetal Monkey Gene Tranfer (CFMGT) for Heart, Lung, and Blood Diseases. Through this center, we plan test our rAAV delivery method to the diaphragm of fetal primates through intraperitoneal injecion. We will use biochemical analyses to establish transduction efficiencies in the diaphragm and other tissues, serum antibody assays to address immunological responses, and genetic analyses to determine vector distribution and germline transmission.

PAGE 171

156 APPENDIX GLOSSARY AAV Adeno-associated virus Ad Adenovirus C12 A derivative of the human cervical carcinoma cell line HeLa that contains the rAAV Rep gene CBA Hybrid promoter composed of the chicken -actin promoter and the cytomegalovirus (CMV) immediate early promoter enhancer CMV Cytomegalovirus immediate early promoter DMEM Dulbecco's modification of Eagle's Medium ELF Elongation factor promoter ER Endoplasmic reticulum ESC Embryonic stem cell GAA Acid -glucosidase protein GAA Human acid -glucosidase gene Gaa Murine acid -glucosidase gene Gaa-/Murine knockout line with both acid -glucosidase genes disrupted with a neo cassette inserted at exon 6 GFP Green fluorescent protein GSDII Glycogen storage disease type II, glucogenosis, acid maltase deficiency, Pompe disease HEK-293 Human embryonic kidney transformed cell line HRP Horseradish peroxidase detection label IgG Immunoglobulin class G

PAGE 172

157 IgE Immunoglobulin class E ITR Inverted terminal repeat LIF Leukemia inhibitory factor prevents spontaneous differentiation of embryonic stem cells M6P Mannose 6-phosphate M6PR Mannose 6-phosphate receptor MOI Multiplicity of infection; the number of vector particles (total particles or infectious particles) present per cell MEF Murine embryonic fibroblasts are used as feeder cells for culturing embryonic stem cells. PBS Phosphate buffered saline (pH 7.4) QC-PCR quantitative-competitive polymerase chain reaction rAAV Recombinant adeno-associated virus rAd Recombinant adenovirus RLU Relative light units UTR Untranslated region

PAGE 173

158 LIST OF REFERENCES 1. Adams, E. M., J. A. Becker, L. Griffith, A. Segal, P. H. Plotz, and N. Raben . 1997. Glycogenosis type II: a juvenile-specific mutation with an unusual splicing pattern and a shared mutation in African Americans. Hum. Mutat. 10 :128-134. 2. Amalfitano, A., A. R. Bengur, R. P. Morse, J. M. Majure, L. E. Case, D. L. Veerling, J. Mackey, P. Kishnani, W. Smith, A. McVie-Wylie, J. A. Sullivan, G. E. Hoganson, J. A. Phillips, III, G. B. Schaefer, J. Charrow, R. E. Ware, E. H. Bossen, and Y. T. Chen . 2001. Recombinant human acid alpha-glucosidase enzyme therapy for infantile glycogen storage disease type II: results of a phase I/II clinical trial. Genet. Med. 3 :132-138. 3. Amalfitano, A., A. J. McVie-Wylie, H. Hu, T. L. Dawson, N. Raben, P. Plotz, and Y. T. Chen . 1999. Systemic correction of the muscle disorder glycogen storage disease type II after hepatic targeting of a modified adenovirus vector encoding human acid-alpha-glucosidase. Proc. Natl. Acad. Sci. U. S. A 96 :8861-8866. 4. An, Y., S. P. Young, S. L. Hillman, J. L. Van Hove, Y. T. Chen, and D. S. Millington . 2000. Liquid chromatographic assay for a glucose tetrasaccharide, a putative biomarker for the diagnosis of Pompe disease. Anal. Biochem. 287 :136-143. 5. Angelini, C., A. G. Engel, and J. L. Titus . 1972. Adult acid maltase deficiency. Abnormalities in fibroblasts cultured from patients. N. Engl. J. Med. 287 :948-951. 6. Ausems, M. G., M. A. Kroos, M. Van der Kraan, J. A. Smeitink, W. J. Kleijer, v. A. H. Ploos, and A. J. Reuser . 1996. Homozygous deletion of exon 18 leads to degradation of the lysosomal alpha-glucosidase precursor and to the infantile form of glycogen storage disease type II. Clin. Genet. 49 :325-328. 7. Ausems, M. G., P. Lochman, O. P. Van Diggelen, H. K. Ploos van Amstel, A. J. Reuser, and J. H. Wokke . 1999. A diagnostic protocol for adult-onset glycogen storage disease type II. Neurology 52 :851-853. 8. Bantel-Schaal, U., H. Delius, R. Schmidt, and H. H. Zur . 1999. Human adeno-associated virus type 5 is only distantly related to other known primate helper-dependent parvoviruses. J. Virol. 73 :939-947. 9. Bartlett, J. S., R. Wilcher, and R. J. Samulski . 2000. Infectious entry pathway of adeno-associated virus and adeno-associated virus vectors. J. Virol. 74 :2777-2785.

PAGE 174

159 10. Barton, N. W., R. O. Brady, J. M. Dambrosia, A. M. Di Bisceglie, S. H. Doppelt, S. C. Hill, H. J. Mankin, G. J. Murray, R. I. Parker, and C. E. Argoff. 1991. Replacement therapy for inherited enzyme deficiency--macrophage-targeted glucocerebrosidase for Gaucher's disease. N. Engl. J. Med. 324 :1464-1470. 11. Baudhuin, P., H. G. Hers, and H. Loeb . 1964. An electron microscopic and biochemical study of type II glycogenosis. Lab Invest. 13 :1139-1152. 12. Becker, J. A., J. Vlach, N. Raben, K. Nagaraju, E. M. Adams, M. M. Hermans, A. J. Reuser, S. S. Brooks, C. J. Tifft, R. Hirschhorn, M. L. Huie, M. Nicolino, and P. H. Plotz . 1998. The African origin of the common mutation in African American patients with glycogen-storage disease type II. Am. J. Hum. Genet. 62 :991-994. 13. Bennett, M., H. Galan, G. Owens, R. Dewey, R. Banks, J. Hobbins, F. Accurso, and J. Schaack . 2001. In utero gene delivery by intraamniotic injection of a retroviral vector producer cell line in a nonhuman primate model. Hum. Gene Ther. 12 :1857-1865. 14. Berns, K. I. 1996. Parvoviridae : The viruses and their replication, p. 1017-1041. In B. N. Fields, D. M. Knipe, and P. M. Howley (eds.), Fundamental Virology. Lippincott-Raven, Philadelphia. 15. Bijvoet, A. G., M. A. Kroos, F. R. Pieper, d. Van, V, H. A. De Boer, A. T. Van der Ploeg, M. P. Verbeet, and A. J. Reuser . 1998. Recombinant human acid alpha-glucosidase: high level production in mouse milk, biochemical characteristics, correction of enzyme deficiency in GSDII KO mice. Hum. Mol. Genet. 7 :1815-1824. 16. Bijvoet, A. G., E. H. van de Kamp, M. A. Kroos, J. H. Ding, B. Z. Yang, P. Visser, C. E. Bakker, M. P. Verbeet, B. A. Oostra, A. J. Reuser, and A. T. Van der Ploeg . 1998. Generalized glycogen storage and cardiomegaly in a knockout mouse model of Pompe disease. Hum. Mol. Genet. 7 :53-62. 17. Bijvoet, A. G., H. Van Hirtum, M. A. Kroos, E. H. van de Kamp, O. Schoneveld, P. Visser, J. P. Brakenhoff, M. Weggeman, E. J. van Corven, A. T. Van der Ploeg, and A. J. Reuser . 1999. Human acid alpha-glucosidase from rabbit milk has therapeutic effect in mice with glycogen storage disease type II. Hum. Mol. Genet. 8 :2145-2153. 18. Bijvoet, A. G., H. Van Hirtum, M. Vermey, D. Van Leenen, A. T. Van der Ploeg, W. J. Mooi, and A. J. Reuser . 1999. Pathological features of glycogen storage disease type II highlighted in the knockout mouse model. J. Pathol. 189 :416-424. 19. Boyle, M. P., R. A. Enke, R. J. Adams, W. B. Guggino, and P. L. Zeitlin . 2001. In utero AAV-mediated gene transfer to rabbit pulmonary epithelium. Mol. Ther. 4 :115-121.

PAGE 175

160 20. Bradley, A. 1990. Embryonic stem cells: proliferation and differentiation. Curr. Opin. Cell. Biol. 2 :1013-1017. 21. Bulfield, G., W. G. Siller, P. A. Wight, and K. J. Moore . 1984. X chromosomelinked muscular dystrophy (mdx) in the mouse. Proc. Natl. Acad. Sci. U. S. A. 81 :1189-1192. 22. Chen, Y. T. and A. Amalfitano . 2000. Towards a molecular therapy for glycogen storage disease type II (Pompe disease). Mol. Med. Today 6 :245-251. 23. Chiorini, J. A., S. Afione, and R. M. Kotin . 1999. Adeno-associated virus (AAV) type 5 Rep protein cleaves a unique terminal resolution site compared with other AAV serotypes. J. Virol. 73 :4293-4298. 24. Chiorini, J. A., L. Yang, Y. Liu, B. Safer, and R. M. Kotin . 1997. Cloning of adeno-associated virus type 4 (AAV4) and generation of recombinant AAV4 particles. J. Virol. 71 :6823-6833. 25. Clark, K. R., T. J. Sferra, and P. R. Johnson . 1997. Recombinant adenoassociated viral vectors mediate long-term transgene expression in muscle. Hum. Gene Ther. 8 :659-669. 26. Cohen, J. C., S. L. Morrow, R. J. Cork, J. B. Delcarpio, and J. E. Larson . 1998. Molecular pathophysiology of cystic fibrosis based on the rescued knockout mouse model. Mol. Genet. Metab. 64 :108-118. 27. Coutelle, C. and C. Rodeck . 2002. On the scientific and ethical issues of fetal somatic gene therapy. Gene Ther. 9 :670-673. 28. Daly, T. M., K. K. Ohlemiller, M. S. Roberts, C. A. Vogler, and M. S. Sands . 2001. Prevention of systemic clinical disease in MPS VII mice following AAV-mediated neonatal gene transfer. Gene Ther. 8 :1291-1298. 29. de Barsy, T., P. Jacquemin, F. Van Hoof, and H. G. Hers . 1973. Enzyme replacement in Pompe disease: an attempt with purified human acid alpha-glucosidase. Birth Defects Orig. Artic. Ser. 9 :184-190. 30. Decrouy, A., J. M. Renaud, H. L. Davis, J. A. Lunde, G. Dickson, and B. J. Jasmin . 1997. Mini-dystrophin gene transfer in mdx4cv diaphragm muscle fibers increases sarcolemmal stability. Gene Ther. 4 :401-408. 31. Ding, E., H. Hu, B. L. Hodges, F. Migone, D. Serra, F. Xu, Y. T. Chen, and A. Amalfitano . 2002. Efficacy of gene therapy for a prototypical lysosomal storage disease (GSD-II) is critically dependent on vector dose, transgene promoter, and the tissues targeted for vector transduction. Mol. Ther. 5 :436-446.

PAGE 176

161 32. Ding, E. Y., B. L. Hodges, H. Hu, A. J. McVie-Wylie, D. Serra, F. K. Migone, D. Pressley, Y. T. Chen, and A. Amalfitano . 2001. Long-term efficacy after [E1-, polymerase-] adenovirus-mediated transfer of human acid-alpha-glucosidase gene into glycogen storage disease type II knockout mice. Hum. Gene Ther. 12 :955-965. 33. Douar, A. M., S. Adebakin, M. Themis, A. Pavirani, T. Cook, and C. Coutelle . 1997. Foetal gene delivery in mice by intra-amniotic administration of retroviral producer cells and adenovirus. Gene Ther. 4 :883-890. 34. Duan, D., P. Sharma, J. Yang, Y. Yue, L. Dudus, Y. Zhang, K. J. Fisher, and J. F. Engelhardt . 1998. Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue. J. Virol. 72 :8568-8577. 35. Eng, C. M., N. Guffon, W. R. Wilcox, D. P. Germain, P. Lee, S. Waldek, L. Caplan, G. E. Linthorst, and R. J. Desnick . 2001. Safety and efficacy of recombinant human alpha-galactosidase A--replacement therapy in Fabry's disease. N. Engl. J. Med. 345 :9-16. 36. Engel, A. G., M. R. Gomez, M. E. Seybold, and E. H. Lambert . 1973. The spectrum and diagnosis of acid maltase deficiency. Neurology 23 :95-106. 37. Felice, K. J., A. G. Alessi, and M. L. Grunnet . 1995. Clinical variability in adultonset acid maltase deficiency: report of affected sibs and review of the literature. Medicine 74 :131-135. 38. Ferrari, F. K., T. Samulski, T. Shenk, and R. J. Samulski . 1996. Second-strand synthesis is a rate-limiting step for efficient transduction by recombinant adenoassociated virus vectors. J. Virol. 70 :3227-3234. 39. Fisher, K. J., G. P. Gao, M. D. Weitzman, R. DeMatteo, J. F. Burda, and J. M. Wilson . 1996. Transduction with recombinant adeno-associated virus for gene therapy is limited by leading-strand synthesis. J. Virol. 70 :520-532. 40. Fisher, K. J., K. Jooss, J. Alston, Y. Yang, S. E. Haecker, K. High, R. Pathak, S. E. Raper, and J. M. Wilson . 1997. Recombinant adeno-associated virus for muscle directed gene therapy. Nat. Med. 3 :306-312. 41. Flannery, J. G., S. Zolotukhin, M. I. Vaquero, M. M. LaVail, N. Muzyczka, and W. W. Hauswirth . 1997. Efficient photoreceptor-targeted gene expression in vivo by recombinant adeno-associated virus. Proc. Natl. Acad. Sci. U. S. A 94 :6916-6921. 42. Flotte, T. R., S. A. Afione, C. Conrad, S. A. McGrath, R. Solow, H. Oka, P. L. Zeitlin, W. B. Guggino, and B. J. Carter . 1993. Stable in vivo expression of the cystic fibrosis transmembrane conductance regulator with an adeno-associated virus vector. Proc. Natl. Acad. Sci. U. S. A 90 :10613-10617.

PAGE 177

162 43. Flotte, T. R. and B. J. Carter . 1995. Adeno-associated virus vectors for gene therapy. Gene Ther. 2 :357-362. 44. Fraites, T. J. J., M. R. Schleissing, R. A. Shanely, G. A. Walter, D. A. Cloutier, I. Zolotukhin, D. F. Pauly, N. Raben, P. H. Plotz, S. K. Powers, P. D. Kessler, and B. J. Byrne . 2002. Correction of the enzymatic and functional deficits in a model of Pompe disease using adeno-associated virus vectors. Mol. Ther. 5 :571-578. 45. Galjaard, H., M. Mekes, Josselin de Jong JE DE, and M. F. Niermeijer . 1973. A method for rapid prenatal diagnosis of glycogenosis II (Pompe's disease). Clin. Chim. Acta 49 :361-375. 46. Gillette, P. C., M. R. Nihill, and D. B. Singer . 1974. Electrophysiological mechanism of the short PR interval in Pompe disease. Am. J. Dis. Child 128 :622-626. 47. Girod, A., M. Ried, C. Wobus, H. Lahm, K. Leike, J. Kleinschmidt, G. Deleage, and M. Hallek . 1999. Genetic capsid modifications allow efficient retargeting of adeno-associated virus type 2. Nat. Med. 5 :1052-1056. 48. Griffin, J. L. 1984. Infantile acid maltase deficiency. I. Muscle fiber destruction after lysosomal rupture. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 45 :23-36. 49. Griffin, J. L. 1984. Infantile acid maltase deficiency. II. Muscle fiber hypertrophy and the ultrastructure of end-stage fibers. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 45 :37-50. 50. Griffin, J. L. 1984. Infantile acid maltase deficiency. III. Ultrastructure of metachromatic material and glycogen in muscle fibers. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 45 :51-61. 51. Grimm, D., A. Kern, K. Rittner, and J. A. Kleinschmidt . 1998. Novel tools for production and purification of recombinant adenoassociated virus vectors. Hum. Gene Ther. 9 :2745-2760. 52. GTAC . 1999. Gene Therapy Advisory Committee. Report on the potential use of gene therapy in utero . Health Departments of the United Kingdom, November 1998. Hum. Gene Ther. 10 :689-692. 53. Halley, D. J., A. Konings, P. Hupkes, and H. Galjaard . 1984. Regional mapping of the human gene for lysosomal alpha-glucosidase by in situ hybridization. Hum. Genet. 67 :326-328.

PAGE 178

163 54. Hermans, M. M., E. de Graaff, M. A. Kroos, H. A. Wisselaar, R. Willemsen, B. A. Oostra, and A. J. Reuser . 1993. The conservative substitution Asp-645-->Glu in lysosomal alpha-glucosidase affects transport and phosphorylation of the enzyme in an adult patient with glycogen-storage disease type II. Biochem. J. 289 (Pt 3) :687-693. 55. Hermans, M. M., H. A. Wisselaar, M. A. Kroos, B. A. Oostra, and A. J. Reuser . 1993. Human lysosomal alpha-glucosidase: functional characterization of the glycosylation sites. Biochem. J. 289 :681-686. 56. Hermonat, P. L. and N. Muzyczka . 1984. Use of adeno-associated virus as a mammalian DNA cloning vector: transduction of neomycin resistance into mammalian tissue culture cells. Proc. Natl. Acad. Sci. U. S. A. 81 :6466-6470. 57. Hers, H. G . 1963. Alpha-glucosidase deficiency in generalized glycogen-storage disease (Pompe's disease). Biochem. J. 86: 11-16. 58. Herzog, R. W., J. N. Hagstrom, S. H. Kung, S. J. Tai, J. M. Wilson, K. J. Fisher, and K. A. High . 1997. Stable gene transfer and expression of human blood coagulation factor IX after intramuscular injection of recombinant adeno-associated virus. Proc. Natl. Acad. Sci. U. S. A. 94 :5804-5809. 59. Herzog, R. W., E. Y. Yang, L. B. Couto, J. N. Hagstrom, D. Elwell, P. A. Fields, M. Burton, D. A. Bellinger, M. S. Read, K. M. Brinkhous, G. M. Podsakoff, T. C. Nichols, G. J. Kurtzman, and K. A. High . 1999. Long-term correction of canine hemophilia B by gene transfer of blood coagulation factor IX mediated by adeno-associated viral vector. Nat. Med. 5 :56-63. 60. Hirschhorn, R. and A. J. Reuser . 2000. Glycogen Storage Disease Type II: Acid alpha-Glucosidase (Acid Maltase) Deficiency, p. 3389-3420. The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill. 61. Hoefsloot, L. H., M. Hoogeveen-Westerveld, M. A. Kroos, J. van Beeumen, A. J. Reuser, and B. A. Oostra . 1988. Primary structure and processing of lysosomal alpha-glucosidase; homology with the intestinal sucrase-isomaltase complex. EMBO J. 7 :1697-1704. 62. Hoefsloot, L. H., R. Willemsen, M. A. Kroos, M. Hoogeveen-Westerveld, M. M. Hermans, A. T. Van der Ploeg, B. A. Oostra, and A. J. Reuser . 1990. Expression and routeing of human lysosomal alpha-glucosidase in transiently transfected mammalian cells. Biochem. J. 272 :485-492. 63. Holzinger, A., B. C. Trapnell, T. E. Weaver, J. A. Whitsett, and H. S. Iwamoto . 1995. Intraamniotic administration of an adenoviral vector for gene transfer to fetal sheep and mouse tissues. Pediatr Res. 38 :844-850.

PAGE 179

164 64. Honig, J., F. Martiniuk, P. D'Eustachio, C. Zamfirescu, R. Desnick, K. Hirschhorn, L. R. Hirschhorn, and R. Hirschhorn . 1984. Confirmation of the regional localization of the genes for human acid alpha-glucosidase (GAA) and adenosine deaminase (ADA) by somatic cell hybridization. Ann. Hum. Genet. 48 :49-56. 65. Hudgson, P. and J. J. Fulthorpe . 1975. The pathology of type II skeletal muscle glycogenosis. A light and electron-microscopic study. J. Pathol. 116 :139-147. 66. Huie, M. L., A. S. Chen, S. S. Brooks, A. Grix, and R. Hirschhorn . 1994. A de novo 13 nt deletion, a newly identified C647W missense mutation and a deletion of exon 18 in infantile onset glycogen storage disease type II (GSDII). Hum. Mol. Genet. 3 :1081-1087. 67. Isaacs, H., N. Savage, M. Badenhorst, and T. Whistler . 1986. Acid maltase deficiency: a case study and review of the pathophysiological changes and proposed therapeutic measures. J. Neurol. Neurosurg. Psychiatry 49 :1011-1018. 68. Kakkis, E. D., J. Muenzer, G. E. Tiller, L. Waber, J. Belmont, M. Passage, B. Izykowski, J. Phillips, R. Doroshow, I. Walot, R. Hoft, and E. F. Neufeld . 2001. Enzyme-replacement therapy in mucopolysaccharidosis I. N. Engl. J. Med. 344 :182-188. 69. Kamphoven, J. H., R. Stubenitsky, A. J. Reuser, A. T. Van der Ploeg, P. D. Verdouw, and D. J. Duncker . 2001. Cardiac remodeling and contractile function in acid alpha-glucosidase knockout mice. Physiol. Genomics 5 :171-179. 70. Kessler, P. D., G. M. Podsakoff, X. Chen, S. A. McQuiston, P. C. Colosi, L. A. Matelis, G. J. Kurtzman, and B. J. Byrne . 1996. Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein. Proc. Natl. Acad. Sci. U. S. A. 93 :14082-14087. 71. Kikuchi, T., H. W. Yang, M. Pennybacker, N. Ichihara, M. Mizutani, J. L. Van Hove, and Y. T. Chen . 1998. Clinical and metabolic correction of pompe disease by enzyme therapy in acid maltase-deficient quail. J. Clin. Invest. 101 :827-833. 72. Klein, R. L., E. M. Meyer, A. L. Peel, S. Zolotukhin, C. Meyers, N. Muzyczka, and M. A. King . 1998. Neuron-specific transduction in the rat septohippocampal or nigrostriatal pathway by recombinant adeno-associated virus vectors. Exp. Neurol. 150 :183-194. 73. Kornfeld, S. 1986. Trafficking of lysosomal enzymes in normal and disease states. J. Clin. Invest. 77 :1-6. 74. Kornfeld, S. 1992. Structure and function of the mannose 6-phosphate/insulinlike growth factor II receptors. Annu. Rev. Biochem. 61 :307-330.

PAGE 180

165 75. Kotin, R. M., R. M. Linden, and K. I. Berns . 1992. Characterization of a preferred site on human chromosome 19q for integration of adeno-associated virus DNA by non-homologous recombination. EMBO J. 11 :5071-5078. 76. Kroos, M. A., M. Van der Kraan, O. P. Van Diggelen, W. J. Kleijer, A. J. Reuser, M. J. Van den Boogaard common mutant alleles and their associated clinical phenotypes studied in 121 patients. J. Med. Genet. 32 :836-837. 77. Larson, J. E., S. L. Morrow, L. Happel, J. F. Sharp, and J. C. Cohen . 1997. Reversal of cystic fibrosis phenotype in mice by gene therapy in utero . Lancet 349 :619-620. 78. Lejeune, N., D. Thines-Sempoux, and H. G. Hers . 1963. Tissue fractionation studies: Intracellular distribution and properties of alpha-glucosidases in rat liver. Biochem J 86 :16. 79. Lewin, A. S., K. A. Drenser, W. W. Hauswirth, S. Nishikawa, D. Yasumura, J. G. Flannery, and M. M. LaVail . 1998. Ribozyme rescue of photoreceptor cells in a transgenic rat model of autosomal dominant retinitis pigmentosa. Nat. Med. 4 :967-971. 80. Li, J., R. J. Samulski, and X. Xiao . 1997. Role for highly regulated rep gene expression in adeno-associated virus vector production. J. Virol. 71 :5236-5243. 81. Lin, C. Y., C. H. Ho, Y. H. Hsieh, and T. Kikuchi . 2002. Adeno-associated virus-mediated transfer of human acid maltase gene results in a transient reduction of glycogen accumulation in muscle of Japanese quail with acid maltase deficiency. Gene Ther. 9 :554-563. 82. Lipshutz, G. S., L. Flebbe-Rehwaldt, and K. M. Gaensler . 1999. Adenovirusmediated gene transfer to the peritoneum and hepatic parenchyma of fetal mice in utero. Surgery 126 :171-177. 83. Lipshutz, G. S., L. Flebbe-Rehwaldt, and K. M. Gaensler . 1999. Adenovirusmediated gene transfer in the midgestation fetal mouse. J. Surg. Res. 84 :150-156. 84. Lipshutz, G. S., L. Flebbe-Rehwaldt, and K. M. Gaensler . 2000. Reexpression following readministration of an adenoviral vector in adult mice after initial in utero adenoviral administration. Mol. Ther. 2 :374-380. 85. Lipshutz, G. S., C. A. Gruber, Y. Cao, J. Hardy, C. H. Contag, and K. M. Gaensler . 2001. In utero delivery of adeno-associated viral vectors: intraperitoneal gene transfer produces long-term expression. Mol. Ther. 3 :284-292. 86. Lipshutz, G. S., R. Sarkar, L. Flebbe-Rehwaldt, H. Kazazian, and K. M. Gaensler . 1999. Short-term correction of factor V III deficiency in a murine model of hemophilia A after delivery of adenovirus murine factor V III in utero . Proc. Natl. Acad. Sci. U. S. A. 96 :13324-13329. ,

PAGE 181

166 87. Liu, F., M. Nishikawa, P. R. Clemens, and L. Huang . 2001. Transfer of fulllength Dmd to the diaphragm muscle of Dmd(mdx/mdx) mice through systemic administration of plasmid DNA. Mol. Ther. 4 :45-51. 88. Lodish, H., D. Baltimore, A. Berk, S. L. Zipursky, P. Matsudaira, and J. Darnell . 1995. Cell Organization, Subcellular Structure, and Cell Division, p.141-188. Molecular Cell Biology. W. H. Freeman and Company, New York. 89. Malik, A. K., P. E. Monahan, D. L. Allen, B. G. Chen, R. J. Samulski, and K. Kurachi . 2000. Kinetics of recombinant adeno-associated virus-mediated gene transfer. J. Virol. 74 :3555-3565. 90. Martin-Touaux, E., J. P. Puech, D. Chateau, C. Emiliani, E. J. Kremer, N. Raben, B. Tancini, A. Orlacchio, A. Kahn, and L. Poenaru . 2002. Muscle as a putative producer of acid alpha-glucosidase for glycogenosis type II gene therapy. Hum. Mol. Genet. 11 :1637-1645. 91. Martiniuk, F., M. Bodkin, S. Tzall, and R. Hirschhorn . 1991. Isolation and partial characterization of the structural gene for human acid alpha glucosidase. DNA Cell Biol. 10 :283-292. 92. Martiniuk, F., A. Chen, V. Donnabella, E. Arvanitopoulos, A. E. Slonim, N. Raben, P. Plotz, and W. N. Rom . 2000. Correction of glycogen storage disease type II by enzyme replacement with a recombinant human acid maltase produced by over-expression in a CHO-DHFR(neg) cell line. Biochem. Biophys. Res. Commun. 276 :917-923. 93. Martiniuk, F., M. Mehler, A. Pellicer, S. Tzall, G. La Badie, C. Hobart, A. Ellenbogen, and R. Hirschhorn . 1986. Isolation of a cDNA for human acid alpha-glucosidase and detection of genetic heterogeneity for mRNA in three alpha-glucosidase-deficient patients. Proc. Natl. Acad. Sci. U. S. A. 83 :9641-9644. 94. Martiniuk, F., M. Mehler, S. Tzall, G. Meredith, and R. Hirschhorn . 1990. Sequence of the cDNA and 5'-flanking region for human acid alpha-glucosidase, detection of an intron in the 5' untranslated leader sequence, definition of 18-bp polymorphisms, and differences with previous cDNA and amino acid sequences. DNA Cell Biol. 9 :85-94. 95. Mehler, M. and S. DiMauro . 1977. Residual acid maltase activity in late-onset acid maltase deficiency. Neurology 27 :178-184. 96. Meikle, P. J., J. J. Hopwood, A. E. Clague, and W. F. Carey . 1999. Prevalence of lysosomal storage disorders. JAMA 281 :249-254. 97. Minelli, A., M. Piantanida, G. Simoni, F. Rossella, L. Romitti, B. Brambati, and C. Danesino . 1992. Prenatal diagnosis of metabolic diseases on chorionic villi obtained before the ninth week of pregnancy. Prenat. Diagn. 12 :959-963.

PAGE 182

167 98. Miranda, S. R., X. He, C. M. Simonaro, S. Gatt, A. Dagan, R. J. Desnick, and E. H. Schuchman . 2000. Infusion of recombinant human acid sphingomyelinase into Niemann-Pick disease mice leads to visceral, but not neurological, correction of the pathophysiology. FASEB J. 14 :1988-1995. 99. Mitchell, M., M. Jerebtsova, M. L. Batshaw, K. Newman, and X. Ye . 2000. Long-term gene transfer to mouse fetuses with recombinant adenovirus and adenoassociated virus (AAV) vectors. Gene Ther. 7 :1986-1992. 100. Muzyczka, N. 1992. Use of adeno-associated virus as a general transduction vector for mammalian cells. Curr. Top. Microbiol. Immunol. 158 :97-129. 101. Neufeld, E. F. 1991. Lysosomal storage diseases. Annu. Rev. Biochem. 60 :257-280. 102. Nicolino, M. P., J. P. Puech, E. J. Kremer, A. J. Reuser, C. Mbebi, M. Verdiere-Sahuque, A. Kahn, and L. Poenaru . 1998. Adenovirus-mediated transfer of the acid alpha-glucosidase gene into fibroblasts, myoblasts and myotubes from patients with glycogen storage disease type II leads to high level expression of enzyme and corrects glycogen accumulation. Hum. Mol. Genet. 7 :1695-1702. 103. NIH-RAC . 2000. Prenatal gene tranfer: scientific, medical, and ethical issues: a report of the Recombinant DNA Advisory Committee. Hum. Gene Ther. 11 :1211-1229. 104. Oude Elferink, R. P., E. M. Brouwer-Kelder, I. Surya, A. Strijland, M. Kroos, A. J. Reuser, and J. M. Tager . 1984. Isolation and characterization of a precursor form of lysosomal alpha-glucosidase from human urine. Eur. J. Biochem. 139 :489-495. 105. Park, H. K., H. H. Kay, A. McConkie-Rosell, J. Lanman, and Y. T. Chen . 1992. Prenatal diagnosis of Pompe's disease (type II glycogenosis) in chorionic villus biopsy using maltose as a substrate. Prenat. Diagn. 12 :169-173. 106. Pauly, D. F., T. J. Fraites, C. Toma, H. S. Bayes, M. L. Huie, R. Hirschhorn, P. H. Plotz, N. Raben, P. D. Kessler, and B. J. Byrne . 2001. Intercellular transfer of the virally derived precursor form of acid alpha-glucosidase corrects the enzyme deficiency in inherited cardioskeletal myopathy Pompe disease. Hum. Gene Ther. 12 :527-538. 107. Pauly, D. F., D. C. Johns, L. A. Matelis, J. H. Lawrence, B. J. Byrne, and P. D. Kessler . 1998. Complete correction of acid alpha-glucosidase deficiency in Pompe disease fibroblasts in vitro , and lysosomally targeted expression in neonatal rat cardiac and skeletal muscle. Gene Ther. 5 :473-480.

PAGE 183

168 108. Peel, A. L., S. Zolotukhin, G. W. Schrimsher, N. Muzyczka, and P. J. Reier . 1997. Efficient transduction of green fluorescent protein in spinal cord neurons using adeno-associated virus vectors containing cell type-specific promoters. Gene Ther. 4 :16-24. 109. Petrof, B. J. 1998. Respiratory muscles as a target for adenovirus-mediated gene therapy. Eur. Respir. J. 11 :492-497. 110. Petrof, B. J., G. Acsadi, A. Jani, B. Massie, J. Bourdon, N. Matusiewicz, L. Yang, H. Lochmuller, and G. Karpati . 1995. Efficiency and functional consequences of adenovirus-mediated in vivo gene transfer to normal and dystrophic (mdx) mouse diaphragm. Am. J Respir. Cell Mol. Biol. 13 :508-517. 111. Pohlmann, R., A. Waheed, A. Hasilik, and K. von Figura . 1982. Synthesis of phosphorylated recognition marker in lysosomal enzymes is located in the cis part of Golgi apparatus. J. Biol. Chem. 257 :5323-5325. 112. Pompe, J-C. 1932. Over idiopatische hypertrophie van het hart. Ned. Tijdschr. 76 :304-7. 113. Porada, C. D., N. Tran, M. Eglitis, R. C. Moen, L. Troutman, A. W. Flake, Y. Zhao, W. F. Anderson, and E. D. Zanjani . 1998. In utero gene therapy: transfer and long-term expression of the bacterial neo(r) gene in sheep after direct injection of retroviral vectors into preimmune fetuses. Hum. Gene Ther. 9 :1571-1585. 114. Qing, K., C. Mah, J. Hansen, S. Zhou, V. Dwarki, and A. Srivastava . 1999. Human fibroblast growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2. Nat. Med. 5 :71-77. 115. Raben, N., K. Nagaraju, E. Lee, P. Kessler, B. Byrne, L. Lee, M. LaMarca, C. King, J. Ward, B. Sauer, and P. Plotz . 1998. Targeted disruption of the acid alpha-glucosidase gene in mice causes an illness with critical features of both infantile and adult human glycogen storage disease type II. J. Biol. Chem. 273 :19086-19092. 116. Raben, N., P. Plotz, and B. J. Byrne . 2002. Acid alpha-glucosidase deficiency (glycogenosis type II, Pompe disease). Curr. Mol. Med. 2 :145-166. 117. Rabinowitz, J. E., F. Rolling, C. Li, H. Conrath, W. Xiao, X. Xiao, and R. J. Samulski . 2002. Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J. Virol. 76 :791-801. 118. Reuser, A. J., J. F. Jongkind, and H. Galjaard . 1976. Methods for analysis of acid alpha-1,4-glucosidase activity in single hybrid cells. J. Histochem. Cytochem. 24 :578-586.

PAGE 184

169 119. Reuser, A. J. and M. Kroos . 1982. Adult forms of glycogenosis type II. A defect in an early stage of acid alpha-glucosidase realization. FEBS Lett. 146 :36-364. 120. Reuser, A. J., M. A. Kroos, N. J. Ponne, R. A. Wolterman, M. C. Loonen, H. F. Busch, W. J. Visser, and P. A. Bolhuis . 1984. Uptake and stability of human and bovine acid alpha-glucosidase in cultured fibroblasts and skeletal muscle cells from glycogenosis type II patients. Exp. Cell Res. 155 :178-189. 121. Rivera, V. M., X. Ye, N. L. Courage, J. Sachar, F. J. Cerasoli, J. M. Wilson, and M. Gilman . 1999. Long-term regulated expression of growth hormone in mice after intramuscular gene transfer. Proc. Natl. Acad. Sci. U. S. A. 96 :8657-8662. 122. Rutledge, E. A., C. L. Halbert, and D. W. Russell . 1998. Infectious clones and vectors derived from adeno-associated virus (AAV) serotypes other than AAV type 2. J. Virol. 72 :309-319. 123. Salafsky, I. S. and H. L. Nadler . 1973. A fluorometric assay of alpha-glucosidase and its application in the study of Pompe's disease. J. Lab. Clin. Med. 81 :450-454. 124. Salvetti, A., S. Oreve, G. Chadeuf, D. Favre, Y. Cherel, P. Champion-Arnaud, J. David-Ameline, and P. Moullier . 1998. Factors influencing recombinant adenoassociated virus production. Hum. Gene Ther. 9 :695-706. 125. Sanlioglu, S., P. K. Benson, J. Yang, E. M. Atkinson, T. Reynolds, and J. F. Engelhardt . 2000. Endocytosis and nuclear trafficking of adeno-associated virus type 2 are controlled by rac1 and phosphatidylinositol-3 kinase activation. J Virol. 74 :9184-9196. 126. Schachtner, S., C. Buck, J. Bergelson, and H. Baldwin . 1999. Temporally regulated expression patterns following in utero adenovirus-mediated gene transfer. Gene Ther. 6 :1249-1257. 127. Schiffmann, R., J. B. Kopp, H. A. Austin, III, S. Sabnis, D. F. Moore, T. Weibel, J. E. Balow, and R. O. Brady . 2001. Enzyme replacement therapy in Fabry disease: a randomized controlled trial. JAMA 285 :2743-2749. 128. Schneider, H. and C. Coutelle . 1999. In utero gene therapy: the case for. Nat. Med. 5 :256-257. 129. Schneider, H., S. Adebakin, M. Themis, T. Cook, A. M. Douar, A. Pavirani, and C. Coutelle . 1999. Therapeutic plasma concentrations of human factor IX in mice after gene delivery into the amniotic cavity: a model for the prenatal treatment of haemophilia B. J Gene Med. 1 :424-432. 130. Schneider, H., C. Muhle, A. M. Douar, S. Waddington, Q. J. Jiang, M. K. von der, C. Coutelle, and W. Rascher . 2002. Sustained delivery of therapeutic concentrations of human clotting factor IX--a comparison of adenoviral and AAV vectors administered in utero. J. Gene Med. 4 :46-53.

PAGE 185

170 131. Seisenberger, G., M. U. Ried, T. Endress, H. Buning, M. Hallek, and C. Brauchle . 2001. Real-time single-molecule imaging of the infection pathway of an adeno-associated virus. Science 294 :1929-1932. 132. Sekhon, H. S. and J. E. Larson . 1995. In utero gene transfer into the pulmonary epithelium. Nat. Med. 1 :1201-1203. 133. Senoo, M., Y. Matsubara, K. Fujii, Y. Nagasaki, M. Hiratsuka, S. Kure, S. Uehara, K. Okamura, A. Yajima, and K. Narisawa . 2000. Adenovirus-mediated in utero gene transfer in mice and guinea pigs: tissue distribution of recombinant adenovirus determined by quantitative TaqMan-polymerase chain reaction assay. Mol. Genet. Metab 69 :269-276. 134. Sicinski, P., Y. Geng, A. S. Ryder-Cook, E. A. Barnard, M. G. Darlison, and P. J. Barnard . 1989. The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 244 :1578-1580. 135. Sly, W. S. and H. D. Fischer . 1982. The phosphomannosyl recognition system for intracellular and intercellular transport of lysosomal enzymes. J. Cell. Biochem. 18 :67-85. 136. Smith-Arica, J. R., R. Ansell, J. Chiorini, B. L. Davidson, and J. McWhir. 2002. Infection efficiency of human and mouse embryonic stem cells using adenoviral and adeno-associated viral vectors. Mol. Ther. 5:S43. 137. Snyder, R. O., C. H. Miao, G. A. Patijn, S. K. Spratt, O. Danos, D. Nagy, A. M. Gown, B. Winther, L. Meuse, L. K. Cohen, A. R. Thompson, and M. A. Kay . 1997. Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors. Nat. Genet. 16 :270-276. 138. Snyder, R. O., S. K. Spratt, C. Lagarde, D. Bohl, B. Kaspar, B. Sloan, L. K. Cohen, and O. Danos . 1997. Efficient and stable adeno-associated virus-mediated transduction in the skeletal muscle of adult immunocompetent mice. Hum. Gene Ther. 8 :1891-1900. 139. Solomon, E., D. Swallow, S. Burgess, and L. Evans . 1979. Assignment of the human acid alpha-glucosidase gene (alphaGLU) to chromosome 17 using somatic cell hybrids. Ann. Hum. Genet. 42 :273-281. 140. Song, S., P. J. Laipis, K. I. Berns, and T. R. Flotte . 2001. Effect of DNAdependent protein kinase on the molecular fate of the rAAV2 genome in skeletal muscle. Proc. Natl. Acad. Sci. U. S. A. 98 :4084-4088. 141. Song, S., J. Embury, P. J. Laipis, K. I. Berns, J. M. Crawford, and T. R. Flotte . 2001. Stable therapeutic serum levels of human alpha-1 antitrypsin (AAT) after portal vein injection of recombinant adeno-associated virus (rAAV) vectors. Gene Ther. 8 :1299-1306.

PAGE 186

171 142. Song, S., M. Morgan, T. Ellis, A. Poirier, K. Chesnut, J. Wang, M. Brantly, N. Muzyczka, B. J. Byrne, M. Atkinson, and T. R. Flotte . 1998. Sustained secretion of human alpha-1-antitrypsin from murine muscle transduced with adeno-associated virus vectors. Proc. Natl. Acad. Sci. U. S. A. 95 :14384-14388. 143. Srivastava, A. 2002. Obstacles to human hematopoietic stem cell transduction by recombinant adeno-associated virus 2 vectors. J. Cell. Biochem. Suppl 38 :39-45. 144. Steckel, F., V. Gieselmann, A. Waheed, A. Hasilik, K. von Figura, E. R. Oude, R. Kalsbeek, and J. M. Tager . 1982. Biosynthesis of acid alpha-glucosidase in late-onset forms of glycogenosis type II (Pompe's disease). FEBS Lett. 150 :69-76. 145. Stedman, H. H., H. L. Sweeney, J. B. Shrager, H. C. Maguire, R. A. Panettieri, B. Petrof, M. Narusawa, J. M. Leferovich, J. T. Sladky, and A. M. Kelly . 1991. The mdx mouse diaphragm reproduces the degenerative changes of Duchenne muscular dystrophy. Nature 352 :536-539. 146. Summerford, C., J. S. Bartlett, and R. J. Samulski . 1999. AlphaVbeta5 integrin: a co-receptor for adeno-associated virus type 2 infection. Nat. Med. 5 :78-82. 147. Summerford, C. and R. J. Samulski . 1998. Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. J. Virol. 72 :1438-1445. 148. Tabas, I. and S. Kornfeld . 1980. Biosynthetic intermediates of beta-glucuronidase contain high mannose oligosaccharides with blocked phosphate residues. J. Biol. Chem. 255 :6633-6639. 149. Themis, M., H. Schneider, T. Kiserud, T. Cook, S. Adebakin, S. Jezzard, S. Forbes, M. Hanson, A. Pavirani, C. Rodeck, and C. Coutelle . 1999. Successful expression of beta-galactosidase and factor IX transgenes in fetal and neonatal sheep after ultrasound-guided percutaneous adenovirus vector administration into the umbilical vein. Gene Ther. 6 :1239-1248. 150. Tsujino, S., N. Kinoshita, T. Tashiro, K. Ikeda, N. Ichihara, H. Kikuchi, Y. Hagiwara, M. Mizutani, T. Kikuchi, and N. Sakuragawa . 1998. Adenovirusmediated transfer of human acid maltase gene reduces glycogen accumulation in skeletal muscle of Japanese quail with acid maltase deficiency. Hum. Gene Ther. 9 :1609-1616. 151. Umapathysivam, K., J. J. Hopwood, and P. J. Meikle . 2001. Determination of acid alpha-glucosidase activity in blood spots as a diagnostic test for Pompe disease. Clin. Chem. 47 :1378-1383. 152. Umapathysivam, K., A. M. Whittle, E. Ranieri, C. Bindloss, E. M. Ravenscroft, O. P. Van Diggelen, J. J. Hopwood, and P. J. Meikle . 2000. Determination of acid alpha-glucosidase protein: evaluation as a screening marker for Pompe disease and other lysosomal storage disorders. Clin. Chem. 46 :1318-1325.

PAGE 187

172 153. Van den Hout, J. M., A. J. Reuser, J. B. de Klerk, W. F. Arts, J. A. Smeitink, and A. T. Van der Ploeg . 2001. Enzyme therapy for pompe disease with recombinant human alpha-glucosidase from rabbit milk. J. Inherit. Metab Dis. 24 :266-274. 154. Van den Hout, H. H., A. J. Reuser, A. G. Vulto, M. C. Loonen, A. CrommeDijkhuis, and A. T. Van der Ploeg . 2000. Recombinant human alpha-glucosidase from rabbit milk in Pompe patients. Lancet 356 :397-398. 155. Van der Kraan, M., M. A. Kroos, M. Joosse, A. G. Bijvoet, M. P. Verbeet, W. J. Kleijer, and A. J. Reuser . 1994. Deletion of exon 18 is a frequent mutation in glycogen storage disease type II. Biochem. Biophys. Res. Commun. 203 :1535-1541. 156. Van der Ploeg, A. T., M. Kroos, J. M. van Dongen, W. J. Visser, P. A. Bolhuis, M. C. Loonen, and A. J. Reuser . 1987. Breakdown of lysosomal glycogen in cultured fibroblasts from glycogenosis type II patients after uptake of acid alphaglucosidase. J. Neurol. Sci. 79 :327-336. 157. Van der Ploeg, A. T., M. C. Loonen, P. A. Bolhuis, H. M. Busch, A. J. Reuser, and H. Galjaard . 1988. Receptor-mediated uptake of acid alpha-glucosidase corrects lysosomal glycogen storage in cultured skeletal muscle. Pediatr. Res. 24 :90-94. 158. Van Hove, J. L., H. W. Yang, J. Y. Wu, R. O. Brady, and Y. T. Chen . 1996. High-level production of recombinant human lysosomal acid alpha-glucosidase in Chinese hamster ovary cells which targets to heart muscle and corrects glycogen accumulation in fibroblasts from patients with Pompe disease. Proc. Natl. Acad. Sci. U. S. A. 93 :65-70. 159. Voet, D. and J. G. Voet . 1995. Glycolysis, p. 443-483. Biochemistry. John Wiley & Sons, Inc., New York. 160. Voet, D. and J. G. Voet . 1995. Glycogen Metabolism, p. 484-512. Biochemistry. John Wiley & Sons, Inc, New York. 161. von Figura, K. and A. Hasilik . 1986. Lysosomal enzymes and their receptors. Annu. Rev. Biochem. 55:167-93. :167-193. 162. Waheed, A., R. Pohlmann, A. Hasilik, and K. von Figura . 1981. Subcellular location of two enzymes involved in the synthesis of phosphorylated recognition markers in lysosomal enzymes. J. Biol. Chem. 256 :4150-4152. 163. Walters, R. W., J. M. Pilewski, J. A. Chiorini, and J. Zabner . 2002. Secreted and transmembrane mucins inhibit gene transfer with AAV4 more efficiently than AAV5. J Biol. Chem. 277 :23709-23713.

PAGE 188

173 164. Walters, R. W., S. M. Yi, S. Keshavjee, K. E. Brown, M. J. Welsh, J. A. Chiorini, and J. Zabner . 2001. Binding of adeno-associated virus type 5 to 2,3-linked sialic acid is required for gene transfer. J Biol. Chem. 276 :20610-20616. 165. Wang, B., J. Li, and X. Xiao . 2000. Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model. Proc. Natl. Acad. Sci. U. S. A. 97 :13714-13719. 166. Watchko, J., T. O'Day, B. Wang, L. Zhou, Y. Tang, J. Li, and X. Xiao . 2002. Adeno-Associated Virus Vector-Mediated Minidystrophin Gene Therapy Improves Dystrophic Muscle Contractile Function in mdx Mice. Hum. Gene Ther. 13 :1451-1460. 167. Watson, J. G., D. Gardner-Medwin, M. E. Goldfinch, and A. D. Pearson . 1986. Bone marrow transplantation for glycogen storage disease type II (Pompe's disease). N. Engl. J. Med. 314 :385. 168. Wells, D. 1902. Production of chimeras derived from murine embryonic stem cells. Methods Mol. Biol. 180 :127-149. 169. Wisselaar, H. A., M. A. Kroos, M. M. Hermans, J. van Beeumen, and A. J. Reuser . 1993. Structural and functional changes of lysosomal acid alpha-glucosidase during intracellular transport and maturation. J. Biol. Chem. 268 :2223-2231. 170. Xiao, W., S. C. Berta, M. M. Lu, A. D. Moscioni, J. Tazelaar, and J. M. Wilson . 1998. Adeno-associated virus as a vector for liver-directed gene therapy. J. Virol. 72 :10222-10226. 171. Xiao, W., N. Chirmule, S. C. Berta, B. McCullough, G. Gao, and J. M. Wilson . 1999. Gene therapy vectors based on adeno-associated virus type 1. J. Virol. 73 :3994-4003. 172. Xiao, W., K. H. Warrington, Jr., P. Hearing, J. Hughes, and N. Muzyczka . 2002. Adenovirus-facilitated nuclear translocation of adeno-associated virus type 2. J. Virol. 76 :11505-11517. 173. Xiao, X., J. Li, and R. J. Samulski . 1996. Efficient long-term gene transfer into muscle tissue of immunocompetent mice by adeno-associated virus vector. J. Virol. 70 :8098-8108. 174. Xiao, X., J. Li, and R. J. Samulski . 1998. Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus. J. Virol. 72 :2224-2232.

PAGE 189

174 175. Xu, L., T. Daly, C. Gao, T. R. Flotte, S. Song, B. J. Byrne, M. S. Sands, and P. K. Parker . 2001. CMV-beta-actin promoter directs higher expression from an adeno-associated viral vector in the liver than the cytomegalovirus or elongation factor 1 alpha promoter and results in therapeutic levels of human factor X in mice. Hum. Gene Ther. 12 :563-573. 176. Yan, B., N. Raben, N. Lu, and P. H. Plotz . 2001. Identification and characterization of a tissue-specific silencer element in the first intron of the human acid maltase gene. Hum. Genet. 109 :186-190. 177. Yan, B., N. Raben, and P. H. Plotz . 2002. Hes-1, a known transcriptional repressor, acts as a transcriptional activator for the human acid alpha-glucosidase gene in human fibroblast cells. Biochem. Biophys. Res. Commun. 291 :582-587. 178. Yang, E. Y., D. L. Cass, K. G. Sylvester, J. M. Wilson, and N. S. Adzick . 1999. Fetal gene therapy: Efficacy, toxicity, and immunologic effects of early gestation recombinant adenovirus. J. Pediatr. Surg. 34 :235-241. 179. Yang, H. W., T. Kikuchi, Y. Hagiwara, M. Mizutani, Y. T. Chen, and J. L. Van Hove . 1998. Recombinant human acid alpha-glucosidase corrects acid alpha-glucosidase-deficient human fibroblasts, quail fibroblasts, and quail myoblasts. Pediatr. Res. 43 :374-380. 180. Zaretsky, J. Z., F. Candotti, C. Boerkoel, E. M. Adams, J. W. Yewdell, R. M. Blaese, and P. H. Plotz . 1997. Retroviral transfer of acid alpha-glucosidase cDNA to enzyme-deficient myoblasts results in phenotypic spread of the genotypic correction by both secretion and fusion. Hum. Gene Ther. 8 :1555-1563. 181. Zolotukhin, S., B. J. Byrne, E. Mason, I. Zolotukhin, M. Potter, K. Chesnut, C. Summerford, R. J. Samulski, and N. Muzyczka . 1999. Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther. 6 :973-985.

PAGE 190

175 BIOGRAPHICAL SKETCH Mary Rucker Schleissing was born on August 25, 1975 in Jacksonville, Florida. She spent her youth in Keystone Heights, Florida where she graduated from Keystone Heights High School in 1993. She obtained a Bachelor of Science degree in Chemistry from Jacksonville University in 1997. She entered the University of Florida, College of Medicine Interdisciplinary Program in Biomedical Sciences in the fall of 1997. Upon joining the laboratory of Dr. Barry Byrne in 1998, she initiated studies of recombinant adeno-associated virus gene therapy applications in the developing mouse fetus for the treatment of Glycogen Storage Disease Type II. After obtaining a doctorate degree in Genetics, Mary plans to pursue a law degree at the University of Florida beginning the Spring of 2003.