xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E8H5HWI5R_MMFDKT INGEST_TIME 2014-05-01T07:07:45Z PACKAGE UF00098723_00034
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
PAGE 1
ISSN 1409-3871VOL. 13, No. 3 JANUARY 2014Instalacin de la primera Junta Asesora del Jardn Charles Lankester RAFAEL LUCAS RODRGUEZ CABALLERO JAMES D. ACKERMAN From Cuba to most of the Neotropic: Habenaria bicornis (Orchidaceae) is widespread from Mexico to southeastern Brazil JOO A. N. BATISTA, KARINA PROITE, BRUNO M. CAR VALHO, ALINE A. VALE and LEONARDO P. FELIX Illustrations and studies in Neotropical Orchidaceae. The Specklinia condylata group (Pleurothallidinae) in Costa Rica and Panama DIEGO BOGARN, ZULEIKA SERRACHN and ZABDY SAMUDIO A new species in the Cohniella ascendens complex from Amazonian Venezuela (Orchidaceae: Oncidiinae) WILLIAM CETZAL-IX, GERMN CARNEVALI and ELIANA NOGUERA-SAVELLI The Reverend Charles Samuel Pollock Parish plant collector and botanical illustrator of the orchids from Tenasserim Province, Burma DUDLEY CLAYTON Slipper orchids in art and science PHILLIP CRIBB Three new Masdevallia species from Peru (Orchidaceae: Pleurothallidinae) STIG DALSTRM and SAUL RUZ PREZ 40 TH ANNIVERSARY CELEBRATIVE ISSUE155 157 165 185 207 215 229 251 I N V I T E D P A P E R Scontinues
PAGE 2
New species and records of Orchidaceae from Costa Rica. III MELANIA FERNNDEZ, DIEGO BOGARN, ADAM P. KARREMANS and DANIEL JIMNEZ El grupo Epidanthus, subgrupo Selaginella de Epidendrum ERIC HGSATER and ELISABETH SANTIAGO AYALA What is in a orchid name: a tribute to the early naturalists in Costa Rica RUDOLF JENNY Lankesteriana, a new genus in Pleurothallidinae (Orchidaceae) ADAM P. KARREMANS CARLYLE A. LUER Consideraciones sobre la historia de la prioridad taxonmica de Oncidium ornithorhynchum Consideration on the historical background of a nomenclatural taxonomic priority of Oncidium ornithorhynchum LAURA C. MAZO, ALBER TO GMEZGUTIRREZ, SONIA R. QUINTANILLA, JAIME E. BERNAL and PEDRO OR TIZVALDIVIESO, SJ A new species of Vanilla FRANCISCO MOLINEROUR TADO, ROBER T TULIO GONZLEZ MINA, NICOLA S. FLANAGAN and J. TUP AC OTERO Charles H. Lankester (1879): his life and legacy CARLOS OSSENBACH based on matK/yfc1 plastid data W. MARK WHITTEN, KUR T N. NEUBIG and NORRIS H. WILLIAMS 259 283 291 319 333 337 353 359 375iiINDEX LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 3
R E G U L A R P A P E R SOdontoglossum (Orchidaceae: Oncidiinae) from the Cusco region in Peru STIG DALSTRM and SAUL RUZ PREZ A new and striking Odontoglossum (Orchidaceae: Oncidiinae) from Peru STIG DALSTRM and SAUL RUZ PREZ Nocturnal pollination by fungus gnats of the Colombian endemic species, Pleurothallis marthae (Orchidaceae: Pleurothallidinae) CAROL ANDREA DUQUEBUITRAGO, NSTOR FABIO ALZATEQUINTERO and J. TUP AC OTERO Organizacin espacial y estructura de una poblacin de Ionopsis utricularioides (Orchidaceae) en un rea suburbana de Pinar del Ro, Cuba ALFREDO GARCAGONZLEZ y FRANDER B. RIVERN-GIR Reviewers of the manuscripts submitted to Lankesteriana, Vol. 13 395 401 407 419 429INDEXiii LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 4
LANKESTERIANAINTERNATIONAL JOURNAL ON ORCHIDOLOGY Copyright 2014 Lankester Botanical Garden, University of Costa Rica Effective publication date: January 30, 2014 Layout: Jardn Botnico Lankester. Cover: Lankester Botanical Gardens 40th Anniversary celebrating medal Printer: MasterLitho. Printed copies: 500 Printed in Costa Rica / Impreso en Costa RicaR Lankesterian a / International Journal on Orchidology No. 1 (2001)-. -San Jos, Costa Rica: Editorial Universidad de Costa Rica, 2001-v. ISSN-1409-3871 1. Botnica Publicaciones peridicas, 2. Publicaciones peridicas costarricenses
PAGE 5
Se necesit 40,000,000 de aos de la accidentada trayectoria geolgica de esta regin para formar el istmo centroamericano que conocemos y la acin del tibio, violento y hmedo clima del caribe para dar forma en l al paisaje natural, asombrosamente rico en especies y en nmeros. Se necesit el alma de un hombre como Charles H. Lankester, que al tiempo que contribua a la destruccin inexorable de este paraso natural, precio obligado del avance de la agricultura y del progreso, fue por 3 generaciones amigo y compaero de los exploradores lleg a apasionarse per ella en todas sus formas, que viendo 30 aos antes de la oleada de preocupacin que hoy corre por el mundo, la destruccin inminente de tantas especies y de tantos paisajes, supo soar en un abrigo, un refugio para el bosque que vea desaparecer ltimos instantes de su vida. Se necesit la mirada sensitiva de varias personas, entre las que destacaron la Dra. Mildred E. Mathias, la Sra. Betty Marshall y muy conspicuamente, la orquideloga Rebecca Tyson Northen, quien afortunadamente nos acompaa hoy, para emper en un llamado para buscar el modo de conservar este jardn y continuar la labor que quedaba inconclusa al extinguirse aquella chispa de entusiasmo que alentaba en Don Carlos Se necesit la devocin por todo lo que puede de otro ingls, Stanley Smith, manifestndose despus de su deceso en un Fondo establecido para fomentar la horticultura dondequiera fuese posible, an en tierras nunca visitadas por el, y cuyo director tambin nos acompaa y las caractersticas generosidad y tendencia a la accin cooperativa del pueblo norteamericano, manifestndose en un llameo hecho por la Asociacin Norteamericana de Orquideologa por medio de su Fondo para Investigacin y Educacin, algunos de cuyos dirigentes hoy nos honran con su compaa para reunir la suma necesaria y entregar este jardn a la Universidad de Costa Rica, la cual la acept comprometindose a mantener en l el ideal, la Al reunirnos aqu para instalar la primera Junta Asesora del Jardn Carlos H. Lankester, rindamos individuo notable, Charles H. Lankester, quien mereci del pueblo que lo contara como uno de los suyos [Don Carlos], al amor por la horticultura de Stanley Smith, que desboradaba los bordes de su mundo para envolver la tierra entera en su entusiasmo y a esa fraternal generosidad de los orquidelogos norteamericanos, muchos de los cuales ni haban visitado Costa Rica ni pensaban llegar nunca a visitarla, pero supieron ayudar Que este homenaje de admiracin, de recuerdo y gratitud nos gue en el desarrollo futuro de este jardn.LANKESTERIANA 13(3): 155. 2014. I N T R O D U C T O R Y P A P E R INSTALACIN DE LA PRIMERA JUNTA ASESORA DEL JARDN CHARLES H. LANKESTER RAFAEL LUCAS RODRGUEZ CABALLERO Escuela de Biologa, Universidad de Costa Rica* como contribucin para las celebraciones del 40 Aniversario de la institucin.
PAGE 6
FIGURE LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.156 LANKESTERIANA
PAGE 7
LANKESTERIANA 13(3): 157. 2014. The orchid mystique is alive and well. The rarity of many species have captured the attention of enthusiasts and academics for nearly two centuries. Population declines of marquee species have been obvious due to over-collecting and habitat degradation (e.g., Miranda 1990, Cribb 1998, Soto Arenas et al. 2007). Consequently, orchids are frequent if not prominent occupants of endangered species lists and all 28,000-plus species of the family (Govaerts et al. 2010) have been placed on either appendix I or II of the Convention on International Trade in Endangered Species (CITES). Moreover, several books have focused on orchid conservation (e.g., IUCN/SSC et al. 2003). Are these symptoms of a dire outlook for the family? Will orchids survive rapid climate and land use changes? To address these questions, I look at how the family has responded to disturbances through history. population biology of the family in the northern Andes I N V I T E D P A P E R RAPID TRANSFORMATION OF ORCHID FLORAS JAMES D. ACKERMAN Department of Biology and Center for Applied Tropical Ecology and Conservation, University of Puerto Rico, PO Box 23360, San Juan, PR 00931-3360, U.S.A. ackerman.upr@gmail.com ABSTRACT. What does the future hold for the Orchidaceae? Historically the family has been quite plastic and responsive to large-scale habitat transformations, perhaps none so dramatic as the changes experienced during the formation of the cordilleras of the Northern Andes and lower Central America. Coupled with the backdrop habitats and changed climate locally. These mountains are one of the most biologically diverse regions of the planet and may have served as a species pump for the Caribbean and other regions of Central and South America. The development of such diversity occurred over a scale of tens of millions of years to perhaps just a few thousand. While the same processes of the past are likely operational now, the current rate of habitat change may be unprecedented outside asteroid or major meteor impacts as global climate change accelerates, humanto change as populations respond evolutionarily through adaptation, extinctions and immigrations. Certainly the total destruction of a habitat, whether caused by volcanic eruptions or strip mining, is sure to have dire recovery. As most orchids occupy ephemeral habitats or at least substrates, their natural population behavior natural or human-assisted range expansions overcome extinction losses? Will they be among those that become the genetic material for a new wave of adaptive radiations? Much depends on population variation, patterns of form of intervention the pace of change underway may be more than what orchid populations can overcome. KEY WORDS : This contribution was prepared as part of the special edition of LANKESTERIANA that is dedicated to the commemoration of Lankester Botanical Gardens 40th anniversary.
PAGE 8
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.158 LANKESTERIANAand the cordilleras of Panama and Costa Rica, two regions of extraordinary species diversity (Dressler 1981, Myers et al. 2000, Bogarn et al. 2013). Variance in age estimates for the Orchidaceae has been rather substantial (Arditti 1992, Gustafsson et al. 2010), but our current data indicate that the family is rather et al. (2007) and Gustafsson et al. (2010) based on molecular clock et al. (2012) who have found that the most recent common ancestor of the Orchidaceae existed roughly 80-90 Ma, in the Late Cretaceous. From their analyses, most, if the global disturbance and mass extinctions associated with the Cretaceous/Paleogene (K-Pg) boundary. This boundary, likely instigated by an asteroid impact at the edge of the present day Yucatan Peninsula (Morgan et al. 2008), not only caused extinctions of many forms of life, most famously the non-avian dinosaurs, but also opened doors to the evolutionary theater for clades represented by subfamilies Orchidoideae and that accounts for most of the species diversity of the orchid family as it is known today. Many clades from those subfamilies diverged just 15-20 Ma BP in the et al. 2007, Guo et al. 2012). Of course, not all species that evolved during these natural process and does not need the helping hand of humans. Nevertheless, we may assume that there has been an overall net gain in species. So, although the familys origins are rather old and some clades are relatively species-poor, the Orchidaceae as a whole is hardly relictual or static. While broadlinked to large-scale disturbances, tectonic dynamics and other families (Hughes & Eastwood 2006). A good example is the recent rise of lower Central America and northern Andean cordilleras over the last 0.510 Ma (Dodson 2003, Kirby 2007, Karremans et al. habitats, which become isolated not only by valleys and ridges within mountain ranges, but also by intervening hotter and drier lowlands between them (Kirby 2011). Not surprisingly, topographic diversity is strongly associated with orchid diversity, even exceeding area as a factor linked to species richness (Dodson 2003, Ackerman et al. 2007). This relationship is well illustrated by the Maxillariinae of Panama and Costa Rica. Kirby (2011) found that widespread species of the subtribe tend to occupy lowlands whereas the narrow endemics and more derived species are those occupying the cooler, wetter montane slopes and valleys. While we expect such barriers to substantially analysis of Fst (or Gst) statistics that indicate high levels et al. 2012). But if natural selection is intense enough and sustained, then selection could overcome any distance dispersal, allowing for local adaptation and et al. 2005). Changes in neutral alleles would be mutation-dependent and divergence from parental populations may take a long time to occur. On the other hand, frequencies of alleles under selection may change rapidly as has been observed in other organisms (Losos 2014) and such differences would be missed by population genetic data based on assessment of neutral alleles. While rapid rise of mountain ranges are clearly associated with the evolution of biological diversity, it is not a prerequisite for rapid orchid speciation. Gustafsson et al. (2010) found that much of the extant diversity of the orchid genus Hoffmannseggella in diverged since the Pliocene (< 2.5 Ma). During this same period significant fluctuations in moisture availability occurred (Auler & Smart 2001, Ledru et al. 2005), perhaps climatically fragmenting the landscape and affecting gene flow among populations with consequences akin to abrupt mountain building.
PAGE 9
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. ACKERMAN 159 The driver for the remarkable evolutionary of pollination (van der Pijl & Dodson 1966, Stebbins 1984, Nilsson 1992, Chase 2001, Papadopulos et al. 2013), though the family also shows a broad range of physiological and vegetative adaptations (Dressler associations in orchid evolution (e.g., Otero & Flanagan 2006; Motomura et al. 2010, Martos et al. 2012). The plethora of pollination mechanisms, some rather fantastic, and the exploitation of a broad spectrum of pollinators suggest that the post Lepidoptera and Hymenoptera, is closely tied to the evolutionary potential of the Orchidaceae, although not necessarily in a co-evolutionary dance et al. 2011, see also Schiestl & Dtterl 2012). Species with little sequence divergence may have arisen rapidly via exploitation of existing pollinator diversity. This is perhaps best (e.g., Lepanthes R.Br., Ophrys L., Telipogon Kunth, Chiloglottis et al. 2003, Neubig et al. 2012, Peakall et al. 2010). is recent, geologically speaking. It appears that orchids are adept at responding evolutionarily to change occurring over millions of years to perhaps just a few thousand. Gentry and Dodson (1987) even suggested that speciation may occur over just a few decades, an idea with virtually no support, but it had planted the seed for breaking the shackles of gradualism in orchids (Tremblay et al. 2005). Habitat changes over ecological time. Change is ubiquitous and has always been that way, but the current rate of habitat change may be unprecedented outside asteroid or major meteor impacts as global climate change accelerates, human-altered landscapes spread, and shifts occur in land use. Habitat destruction is the foremost threat to orchids (IUCN/SSC Orchid Specialist Group 1996), so the question is whether the family as a whole has the resiliency to withstand the onslaught of change. One obvious way in which orchids may respond the family and the presumably high frequency of rare species, the number of known extinctions is quite low (IUCN/SSC Orchid Specialist Group 1996). This is counter-intuitive since rare species should be more vulnerable to habitat destruction. One explanation may be a function of the lack of human effort to document extinctions and the other may be a function of the I will explore the latter. Rapid changes in habitats have occurred throughout history and some dramatic events that have occurred recently will serve as examples. Disturbances that have caused population extinctions may occur at every scale. When a host tree sheds twigs and branches or dies entirely, so do its epiphytes. In 1989, a strong hurricane passed over Puerto Rico and through a decades. Nearly half the trees fell or snapped off and those that withstood the winds had all their orchid epiphytes stripped away (Migenis & Ackerman 1993). Volcanic eruptions can be even more destructive than hurricanes. Krakatau is the best known example of nearly instant devastation when it exploded in 1883, destroying itself and nearby islands, covering extensive areas with debris, generating severe earthquakes and tsunamis, and by the infusion of sulfur dioxide in the stratosphere, cooling the planet for years afterwards (Thornton 1997). In a somewhat older violent eruption, Tungurahua II of the Ecuadorian Andes literally blew its top approximately 3000 years ago devastating the landscape with massive amounts of rubble and thick layers of ash (Hall et al. 1999), presumably creating lifeless moonscapes as were observed in the Krakatau explosion. Despite such ever-present yet rare natural threats to habitat stability, the most pressing issues for orchid conservation are the devastating consequences of human activities. Like natural disturbances, those caused by man can be at every scale up to regional or even global. At very local levels human activities such as trampling can have both indirect and direct effects on orchids (Light & MacConaill 2007; Ballantyne & Pickering 2013). In the orchid-rich tropics, slash and burn agriculture created forest gaps, but much of that has been replaced by increasingly larger scale agriculture to the point of having farms measured in square kilometers rather than in hectares where topography and environmental
PAGE 10
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.160 LANKESTERIANAconditions permit it. Perhaps the greatest changes will come from accelerating (anthropogenic or not) climate changes whose effects may be seen even within a span of a few years to decades (Allen & Breshears 1998, Kelly & Goulden 2008). Whether it is the warming trend with accompanying drier or wetter conditions (depending on region), or the increasing severity of weather, we have already begun to see changes and developing consequences, and cloud forests, where orchids thrive, seem to be highly susceptible (Pounds et al. 1999, Parmesan 2006, Gradstein 2008). Recovery. I expect that natural disturbances beget natural recoveries. Small-scale disturbances are common and most orchids likely have the capacity for recovery. After all, epiphytic orchids must constantly be on the move as bark and branches are shed and trees die, so orchid population dynamics may resemble metapopulation behavior (Ackerman 1983b, Tremblay et al. 2006). Certainly one expects that after a hurricane, orchids should be resilient since they have been for millions of years (Ackerman & Moya 1996, Mjica et al. 2013). Recovery can be relatively rapid, even after volcanic eruptions. Among Krakatau were orchids, and now the number of species continues to accumulate (63 species after 115 years) as the vegetation structure becomes more complex and more hospitable for epiphytes (Partomihardjo 2003). As for the Tungurahua II eruption in the Ecuadorian Andes, the mountain has rebuilt to 50% of its former disappear as others replace them. The overall effect is the mountain becomes orchid-rich once again, which includes a number of species that presumably occur nowhere else, with the implication that they may have evolved in just a few thousand years (Dodson 2003). The case of this volcano is not likely unusual. Ecuador has over 200 volcanoes and according to naturalist each is endemic to that volcano ( com/orchid). soon be with us on a grand scale. While deforestation still continues in some regions of the world at an alarming rate, there has been a reversal in the trend, agriculture has not been practical (Aide et al. 2012). A general reforestation trend has been occurring in both temperate and tropical regions such as Europe, USA, Puerto Rico, Dominican Republic, Costa Rica, Ecuador and Colombia, a phenomenon often associated with abandonment of small rural farms as et al. 2012). I expect that orchid population recovery should follow provided the existence of nearby refugia that may serve as propagule sources. Once forests are restored or recover from human to past conditions? Considering the forests themselves may not return to past structure and composition (e.g., Thompson et al. 2002, Lugo 2004), we may assume ecological and evolutionary reasons. The extensive were once thought to be pristine, but we know now that they were deforested and extensively cultivated by Mayans, which was severe enough to create several et al. 2006). The forests are now orchid-rich, but we will never know whether they have lost or even gained species from pre-Maya times. In a relatively well-documented case, approximately 95% of the island of Puerto Rico was deforested and converted to farmlands by the 1940s (Roberts 1942, Wadsworth 1950). This was followed by a change from an agrarian to an industrial-based society accompanied by human migration from rural areas to cities. The abandoned farmland formed secondary forests composed of a mix between native and non-native trees. Despite high human population densities, over 40% of the island now has forest cover (Grau et al. few of the reported species for the island have been lost, and most of those that have not been seen for decades were known from only a single specimen, if any at all (Ackerman 1996). Small refugia were likely for vegetation transition on other islands (de Boer et al. 2013). But where disturbance had been severely
PAGE 11
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. ACKERMAN 161habitat altering, recovery for some orchid species has yet to occur, even after ecosystem recovery (Bergman et al few decades have been dramatic. Large populations of twig epiphytes were once commonly encountered but now have become uncommon as forest recovery has progressed, shading out both the orchids and their hosts. Moreover, non-native orchids have taken hold in many parts of the island, currently making up about Conclusions. Orchids throughout their history seem to have done well in face of climatic change caused by levels and temperatures. All these phenomena occur today but the rate of change seems to be occurring faster than the detectable past. Nature reserves are of course as susceptible to climate change as anywhere else. Liu et al. (2010) estimate that populations of at least 15% of the orchid species in a diverse region of southwestern China will be threatened with extinction over the next two centuries given projected climate changes. We already see a drying trend in some cloud forests of the world, including Costa Rica, raising real concerns for those species such as the hundreds of Neotropical Lepanthes that depend on cool, wet conditions (Nadkarni & Solano 2002; Olaya-Arenas et al. 2011). How orchids respond remains to be seen but be the same as before. to habitat complexity and fragmentation. Orchids also show ecological resiliency with the capacity for capacities likely depends upon dispersal from refugia (large or small), the severity of disturbance, effects of invasive species, and the natural history of the individual orchid species. Should refugia cease to exist, or habitat restoration becomes constrained, then the species composition and relative abundance patterns of the past. And whether changes are local or global, we can only hope that the ability of orchids to adapt or migrate will keep pace. Coda. There are few botanical institutions in tropical regions of high orchid diversity. Over a relatively short period of time, Lankester Botanical Garden role in tropical orchid systematics and conservation, effectively promoting in-house research; facilitating studies at other institutions through collaborations and the development of the online resource, EPIDENDRA ; and fostering communication among botanists by publishing Lankesteriana development of the ideas contained herein, but articles in Lankesteriana did as much as any to help coalesce them. ACKNOWLEDGEMENTS I thank Stephen Kirby and Raymond Tremblay for fruitful discussions over the years that helped solidify some ideas contained here, though any blame falls squarely on my shoulders. I delivered a version of this essay at IV Andean Orchid Conservation Conference (Guayaquil, Pridgeon and Jos Portilla Andrade, for facilitating my CREST-CATEC (Elvira Cuevas, project director, National Science Foundation, USA, HRD-0734826) for which I am grateful. LITERATURE CITED of the orchid-euglossine bee interaction. Biol. J. Linn. Soc. 20: 301-314. Ackerman, J.D. 1983b. On the evidence for a primitively epiphytic habit in orchids. Syst. Bot. 8: 474-477. Ackerman, J.D. 1996. Caribbean Islands. Pages 59-61 in IUCN/SSC Orchid Specialist Group. Orchids status survey and conservation action plan. IUCN, Gland Ackerman, J.D. 2007. Invasive orchids: weeds we hate to love? Lankesteriana 7: 19-21. Orqudeas. Pages 189-246 in R. L. Joglar, ed. Biodiversidad de Puerto Rico: Agustn Stahl, Flora, Hongos. Serie de Historia Natural de Puerto Rico. La Editorial Universidad de Puerto Rico, San Juan. Ackerman, J.D. & S. Moya. 1996. Hurricane aftermath: resiliency of an orchid-pollinator interaction in Puerto Rico. Carib. J. Sci. 32: 369-374. Ackerman, J.D., J.C. Trejo Torres & Y. Crespo Chuy. 2007.
PAGE 12
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.162 LANKESTERIANAOrchids of the West Indies: predictability of diversity and endemism. J. Biogeogr. 34: 779-786. Levy, D. Redo, M. Bonilla-Moheno, G. Riner, M.J. and reforestation of Latin America and the Caribbean (2001-2010). Biotropica 45: 262-271. Allen, C.D. & D.D. Breshears. 1998. Drought-induced shift of a forest-woodland ecotone: rapid landscape response to climate variation. Proc. Nat. Acad. Sci. (USA) 95: 14839-14842. Arditti, J. 1992. Fundamentals of orchid biology. John Wiley & Sons, New York. Auler, A.S. & P.L. Smart. 2001. Late quaternary paleoclimate travertine and water-table speleothems. Quatern. Res. 55: 159-167. Ballantyne, M. & C. Pickering. 2012. Ecotourism as a threatening process for wild orchids. J. Ecotourism 11: 34-47. Bateman, R.M., P.M. Hollingsworth, J. Preston, Y.-B. Luo, A.M. Pridgeon & M.W. Chase. 2003. Molecular phylogenetics and evolution of Orchidinae and selected Habenariinae (Orchidaceae). Bot. J. Linn. Soc. 142: 1-40. Lohse. 2006. Impacts of the ancient Maya on soils and soil erosion in the central Maya Lowlands. Catena 65: 166-178. Lindleyana 1: 73-89. Bergman, E., J.D. Ackerman, J. Thompson & J.K. Zimmerman. 2006. Land use history affects the distribution of the saprophytic orchid Wullschlaegelia calcarata in Puerto Rico. Biotropica 38: 492-499. pollination in Lepanthes (Orchidaceae: Pleurothallidinae). Ann. Bot. 95: 763-772. Bogarn, D., F. Pupulin, C. Arrocha & J. Warner. 2013. Orchids without borders: studying the hotspot of Costa Rica and Panama. Lankesteriana 13: 13-26. Chase, M.W. 2001. Origin and biogeography of Orchidaceae. Pages 1-5. In A. Pridgeon, P. Cribb & F. Rasmussen, eds. Genera Orchidacearum. Vol. 2. Oxford University Press, Oxford. Cribb, P. 1998. The genus Paphiopedilum 2nd edition. Natural History Publications (Borneo), Kota Kinabalu, Malaysia. De Boer, E.J., H. Hooghiemstra, F.B. Vincent Florens, C. Baider, S. Engels, V. Dakos, M. Blaauw & K.D. Bennett. 2013. Rapid succession of plant associations on the small oceanic island of Mauritius at the onset of the Holocene. Quatern. Sci. Rev. 68: 114-125. Dixon, K.W., S.P. Kell, R.L. Barrett & P.J. Cribb, eds. 2003. Orchid conservation. Natural History Publications (Borneo), Kota Kinabalu, Malaysia. Dodson, C.H. 2003. Why are there so many orchid species? Lankesteriana No. 7 3(2): 99-103. Dressler, R.L. 1981. The orchids: natural history and MA. Gentry, A.H. & C.H. Dodson. 1987. Diversity and biogeography of neotropical vascular epiphytes. Ann. Missouri Bot. Gard.74: 205-233. Govaerts, R., K. Kratochvil, G. Gerlach, G. Carr, P. Alrich, A.M. Pridgeon, J. Pfahl, M.A. Campacci, D. Holland Baptista, H. Tigges, J. Shaw, P. Cribb, A. George, Orchidaceae. Facilitated by the Royal Botanic Gardens, Kew. http://www.kew.org/wcsp/monocots/ accessed 24 June 2010. Gradstein, S.R. 2008. Epiphytes of tropical montane forests impact of deforestation and climate change. Pages 5165. In S.R. Gradstein, J. Homeier & D. Gansert, eds. The tropical mountain forest patterns and processes in a biodiversity hotspot. Universittverlag Gttingen. Grau, H.R., T.M. Aide, J.K. Zimmerman, J.R. Thomlinson, E. Helmer and X. Zou. 2003. The ecological consequences of socioeconomic and land-use changes in postagriculture Puerto Rico. Bioscience 53: 11591168. Guo, Y.-Y., Y.-B. Luo, Z.-J. Liu & X.-Q. Wang. 2012. Evolution and biogeography of the slipper orchids: Eocene vicariance of the conduplicate genera in the Old and New World tropics. PLoS ONE 7: e38788. doi:10.1371/journal.pone.0038788 Gustafsson, A.L., C.F. Verola & A. Antonelli. 2010. Reassessing the temporal evolution of orchids with new fossils and a Bayesian relaxed clock, with implications Hoffmannseggella (Orchidaceae:Epidendroideae). BMC Evol. Biol. 10: 177. doi10.1186/1471-2148-10177 1999. Tungurahua Volcano, Ecuador: structure, eruptive 91: 1-21. Hughes, C. & R. Eastwood. 2006. Island radiation on a continental scale: Exceptional rates of plant Acad. Sci. USA 103: 10334. IUCN/SSC Orchid Specialist Group. 1996. Orchids status
PAGE 13
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. ACKERMAN 163survey and conservation action plan. IUCN, Gland & M.J.M. Smulders. 2013. Phylogenetics of Stelis and closely related genera (Orchidaceae: Pleurothallidinae). Pl. Syst. Evol. 299: 151-176. DOI 10.1007/s00606-0120712-7 Kelly, A.E. & M.L. Goulden. 2008. Rapid shifts in plant distribution with recent climate change. Proc. Nat. Acad. Sci. USA 105:11823-11826. Kirby, S.H. 2007. Geological processes and orchid biogeography with applications to southeast Central America. Lankesteriana 7: 53-55. Kirby, S.H. 2011. Active mountain building and the distribution of core Maxillariinae species in tropical Mexico and Central America. Lankesteriana 11: 275291. Timber, Press, Portland, Oregon. L. Martin. 2005. Paleoclimate changes during the last rainforest region and interhemispheric comparison. Quatern. Res. 64: 444-450. Light, M.H.S. & M. MacConaill. 2007. Effect of trampling on a terrestrial orchid environment. Lankesteriana 7: 294-298. Liu, H., C.-L. Feng, Y.-B. Luo, B.-S. Chen, Z.-S. Wang & H.-Y. Gu. 2010. Potential challenges of climate change to orchid conservation in a wild orchid hotspot in Southwestern China. Bot. Rev.76: 174-192. Losos, J.B. 2014. What Darwin got wrong. Chron. Higher Ed. http://chronicle.com/article/What-Darwin-Got-Wro O3I5ZRh1NX8ZYn9wbl9QFw%3D%3D Lugo, A.E. 2004. The outcome of alien tree invasions in Puerto Rico. Frontiers Ecol. Environ. 2: 265-273. A. Selosse. 2012. The role of epiphytism in architecture networks of tropical orchids. Mol. Ecol. 21: 5098-5109. Migenis, L.E. & J.D. Ackerman. 1993. Orchid-phorophyte relationships in a forest watershed in Puerto Rico. J. Trop. Ecol. 9: 231-240. Morgan, J., C. Lana, A. Kearsley, B. Coles, C. Belcher, global K-P boundary indicate an origin from a single, high-angle, oblique impact at Chicxulub. Earth and Planetary Sci. Lett. 251: 264-279. Motomura, H., M.-A. Selosse, F. Martos A. Kagawa & T. Yukawa. 2010. Mycoheterotrophy evolved from mixotrophic ancestors: evidence in Cymbidium (Orchidaceae). Ann. Bot. 106: 573-581. Long-term hurricane effects on populations of two epiphytic orchid species from Guanahacabibes Peninsula, Cuba. Lankesteriana 13: 47-55. Myers, N., R.A. Mittermeter, C.G. Mittermeter, G.A.B. da Fonseca & J. Kent. 2000. Biodiversity hotspots for conservation priorities. Nature 403: 853-858. Nadkarni, N.M. & R. Solano. Potential effects of climate change on canopy communities in a tropical cloud forest: an experimental approach. Oecologia 131: 580-586. Neubig, K.M., W.M. Whitten, N.H. Williams, M.A. Blanco, L. Endara, J.G. Burleigh, K. Silvera, J.C. Cushman & M.W. Chase. 2012. Generic recircumscriptions of Oncidiinae (Orchidaceae: Cymbidieae) based on maximum likelihood analysis of combined DNA datasets. Bot. J. Linn. Soc. 168: 117-146. Nilsson, L.A. 1992. Orchid pollination biology. Trends Ecol. Evol. 7: 255-259. R. Tremblay. 2011. Demographic response by a small epiphytic orchid. Amer. J. Bot. 98: 2040-2048. Otero, J.T. & N.S. Flanagan. 2006. Orchid diversity beyond deception. Trends Ecol. Evol. 21: 64-65. Papadopulos, A.S.T., M.P. Powell, F. Pupulin, J. Warner, J.A. Hawkins, N. Salamin, L. Chittka, N.H. Williams, W.M. Whitten, D. Loader, L.M. Valente, M.W. Chase signals underlies the success of Neotropical orchids. Proc. Roy. Soc. B 280: 20130960. http://dx.doi. org/10.1098/rspb.2013.0960 Parmesan, C. 2006. Ecological and evolutionary responses to recent climate change. Ann. Rev. Ecol. Evol. Syst. 37: 637-669. Partomihardjo, T. 2003. Colonisation of orchids on the Krakatau Islands. Teleopea 10:299-310. Peakall, R., D. Ebert, J. Poldy, R.A. Barrow, W. Francke, sexually deceptive orchids: implications for pollinatordriven speciation. New Phytol. 188: 437-450. Phillips, R.D., K.W. Dixon & R. Peakall. 2012. Low population genetic differentiation in the Orchidaceae: Ecol. 21: 5208-5220. Pounds, J.A., M.P L. Fogden & J H. Campbell. 1999. Biological response to climate change on a tropical mountain. Nature 398: 611-614. N.E. Pierce. 2007. Dating the origin of the Orchidaceae from a fossil orchid with its pollinator. Nature 448:
PAGE 14
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.164 LANKESTERIANA1042-1045. Doi10.1038/nature06039 Goldman-Huertas, N.D. Tsutsui & N.E. Pierce. 2011. pollinator mutualism. Science 333: 1742-1746. doi: 10.1126/science.1209175 Roberts, R.C. 1942. Soil survey of Puerto Rico. Washington 2012. Land cover change in Colombia: surprising forest recovery trends between 2001 and 2010. PLoS One 8: e43943. doi:10.1371/journal.pone.0043943 and olfactory preferences in pollinators: coevolution or pre-existing bias? Evolution 66: 2042-2055. Risk of extinction and patterns of diversity loss in Mexican orchids. Lankesteriana 7: 114-121. Stebbins, G.L. 1984. Mosaic evolution, mosaic selection and angiosperm phylogeny. Bot. J. Linn. Soc. 88: 159164. Thompson, J., N. Brokaw, J.K. Zimmerman, R.B. Waide, E.M. III, Everham, D.J. Lodge, C.M. Taylor, D. Garca-Montiel & M. Fluet. 2002. Land use history, environment, and tree composition in a tropical forest. Ecol. Appl. 12: 1344-1363. Thornton, I.W.B. 1997. Krakatau: the destruction and reassembly of an island ecosystem. Harvard University Press, Cambridge, Massachusetts. Tremblay, R.L., J.D. Ackerman, J.K. Zimmerman & R.N. Calvo. 2005. Variation in sexual reproduction in orchids and its evolutionary consequences: a spasmodic journey Do epiphytic orchids behave as metapopulations? asynchronous population dynamics. Biol. Conserv. 129: 70-81. pollination and evolution. University of Miami Press, Coral Gables. Wadsworth, F.H. 1950. Notes on the climax forest of Puerto Rico and their destruction and conservation prior to 1900. Caribb. Forester 11: 48-47.
PAGE 15
Habenaria Willd. (Orchidinae, Orchideae, Orchidaceae) is a large genus of terrestrial orchids comprising approximately 881 species (Govaerts et al. 2013) distributed throughout tropical and subtropical regions of the Old and New Worlds (Pridgeon et al. 2001). In a synopsis of the New World species of the genus, Batista et al. (2011a) listed 298 taxa for the 79 species, are the major centers of diversity of this genus in the New World. Although some species are LANKESTERIANA 13(3): 165. 2014. I N V I T E D P A P E R FROM CUBA TO MOST OF THE NEOTROPIC: HABENARIA BICORNIS (ORCHIDACEAE) IS WIDESPREAD FROM MEXICO TO SOUTHEASTERN BRAZIL JOO A. N. BATISTA 1,3 KARINA PROITE 1 BRUNO M. CAR VALHO 1 ALINE A. VALE 1 & LEONARDO P. FELIX 21Departamento de Botnica, Instituto de Cincias Biolgicas, Universidade Federal de Minas Gerais, 2Departamento de Cincias Biolgicas, Centro de Cincias Agrrias, Universidade Federal da Paraba, 5Author for correspondence: janb@icb.ufmg.br ABSTRACT. Habenaria bicornis and from a few records in Panama from the 1920s. Here we show that H. bicornis and H. goyazensis, known Niche modeling and collection data indicate that this species has a preference for wet lowland savannas and its distribution is predicted to include most of the Neotropics with suitable habitats. The molecular phylogenetic analyses based on DNA sequences from the nuclear internal transcribed spacer (ITS) region and part of the plastid matK gene placed H. bicornis in an isolated position near the base of the Neotropical clade, although with low support. In terms of its morphology, its relationships are likewise not clear as there are no evident similarities between H. bicornis and the basal subclades or any other Neotropical subclade. Cytogenetic analysis indicated a basic chromosome number of x=21, similar to other basal Neotropical species. RESUMEN : Habenaria bicornis este pas y unos pocos registros de Panam, de 1920. En el presente estudio, demostramos que H. bicornis y H. goyazensis Mxico hasta el sudeste de Brasil. El modelado de nicho y la recoleccin de datos indican que esta especie posee una preferencia por sabanas hmedas de tierras bajas y es predicho que su distribucin incluye gran nuclear (ITS) y plastidial (matK) ubicaron H. bicornis en una posicin aislada prximo a la base del clado Neotropical, aunque con bajo soporte. En trminos de su morfologa, sus relaciones no estn aclaradas, ya que no hay similitudes evidentes entre H. bicornis y los subclados bsales o cualquier otro subclado Neotropical. Los anlisis citogenticos indican un nmero cromosmico bsico de x=21, similar a las otras especies basales del Neotrpico. KEY WORDS : Biogeography, cytogenetics, molecular phylogenetics, Orchidinae, taxonomy* This contribution was prepared as part of the special edition of LANKESTERIANA that is dedicated to the commemoration of Lankester Botanical Gardens 40th anniversary.
PAGE 16
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.166 LANKESTERIANAwidely distributed throughout the American tropics and subtropics, most (69%) are restricted to a single country. Narrow endemics are few, however, and in many cases endemic taxa can represent obscure taxa or species known from a few collections or just the type material, so that their exact identity often remains unclear. Studies of New World Habenaria and New World Orchidaceae have generally been undertaken on a piecemeal basis, and limited by geographic and political subdivisions. Floras have been published for several countries, but revisions on continental scales are few and have largely been limited to groups with small numbers of species. As a consequence, several species (especially those with broad distributions) have been described several times from different countries. An example of this situation is Kunth, which is currently known from Mexico to Paraguay, and Costa Rica and now comprises 21 synonyms (Batista et al. 2011b). Habenaria bicornis Lindl. was described by Lindley (1835) based on a collection of Poeppig the record for Cuba (Richard 1850, Grisebach 1866, Gal 1938, Len & Schweinfurth 1946) and the several collections known from that country suggest that the species is relatively common there. In the 1920s, Ames (1922) recorded H. bicornis in Panama based on a single collection from the Canal Zone ( Pittier 6792). Several other authors subsequently reported the species from Panama (Ames 1928, Williams 1946, 1956, Dressler 1980, 1993, DArcy 1987, Correa et al. 2004), but only one additional collection was made (Powell 315), with most workers simply quoting the original record without critical reexaminations of the identity of the specimen. Presence in Panama of a species previously known only from Cuba seemed curious, but no one investigated further the subject or revised the identity of the Panamanian specimens. In a synopsis of New World Habenaria, Batista et al. (2011a) noted that H. bicornis is similar to H. goyazensis Cogn. and that the identities of the two species should be assessed in more detail. Habenaria goyazensis was described by Cogniaux ( Gardner 3995) and is currently known there from Grosso, Par, Pernambuco, Sergipe, and Tocantins, as well as from Guyana (Batista et al. 2008, 2011a). Here we investigated here the morphological and taxonomic relationships between H. bicornis and H. goyazensis based on examinations of the respective type material and additional herbarium collections. Based on a previous molecular phylogenetic analysis of New World Habenaria (Batista et al. 2013), we also assessed the phylogenetic relationships of H. bicornis, performed niche modeling analyses to infer the potential distribution of the species, and performed cytogenetic analyses to determine its chromosome number and CMA/DAPI banding patterns. This paper was prepared as part of the commemorations for the 40th anniversary of the Lankester Botanical Garden. Material and Methods Taxonomic analyses. Descriptions were based on examination of pickled and herbarium material. Floral details were examined under a stereoscopic microscope and measured using a digital caliper. Gynostemium images of H. bicornis were done with a digital camera DFC295 coupled to a stereoscopic microscope (Leica M205C) and assembled using Leica Application Suite v. 3.8.0 software. Data were obtained from the labels of herbarium specimens. A total of 48 specimens and digital images (photographs) of H. bicornis were examined from the following herbaria: A, AMES, BHCB, BM, BR, CEN, EAN, EAP, G, GH, HB, IPA, K, MO, NY, OXF, P, RENZ, S, SP, US, and W. In addition to these herbaria, material of morphologically similar species were examined from: ALCB, B, CEPEC, CESJ, CTES,ESA, HBG, HRB, HRCB, HUEFS, IBGE, ICN, L, LP, M, MBM, MBML, OUPR, PMSP, R, RB, SI, SPF, UB, U, and UEC. Descriptive terminology is based on Stearn (1992) and Simpson (2006). Taxon sampling for phylogenetic analyses. The datasets for the phylogenetic analyses consisted of the combined ITS and partial matK DNA sequences of 208 terminals of 157 Neotropical Habenaria species, corresponding to 52% of the total number
PAGE 17
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis167of species known from the Neotropics (Batista et al. 2011a, 2011b); four African Habenaria species and Gennaria diphylla Parl. were was used as the functional outgroup. This dataset is basically the same used to infer phylogenetic relationships of New World Habenaria by Batista et al. (2013), but including Habenaria bicornis and excluding most of the Old World taxa. Voucher information, geographic origins, and GenBank accession numbers can be found in Batista et al. (2013); information concerning the newly sequenced accessions is provided in Table 1. Molecular markers. Nucleotide sequences from one nuclear (ITS) and one plastid (matK) genome regions 5 ends of the 18S and 26S ribosomal RNA genes, re-spectively, the internal transcribed spacers (ITS1 and ITS2), and the intervening 5.8S gene of the nuclear region were performed using primers 17SE and 26SE (Sun et al. 1994). We used an internal fragment of ap-proximately 630 bp of the matK primers matK-F2 and matK-R2 (Batista et al. 2013), which approximately corresponds to the region wide-ly used for barcoding land plants (Chase et al. 2007). This fragment is the most variable region of the gene in several orchid groups (e.g., Whitten et al. 2000). carried out following standard protocols, as described by Batista et al. (2013). Bidirectional sequence reads were obtained for all of the DNA regions, and the re-sulting sequences were edited and assembled using the Staden Package software ( et al. 1995). The edited sequences were aligned with MUSCLE (Edgar 2004), and the resulting alignments were manually adjusted using MEGA4 software (Tamura et al. 2007). Phylogenetic analyses by means of parsimony and Bayesian inference. Searches were performed only with a combined matrix, because no cases of strongly supported incongruence were detected in our previous analyses with the same datasets (Batista et al. 2013). Phylogenetic analyses using maximum parsimony (MP) were performed using PAUP* version 4 (Swofford 2002) with Fitch parsimony (equal weights, unordered characters; Fitch 1971) as the optimality criterion. Each search consisted of 1,000 replicates of random taxon additions, with branch swapping using the tree-bisection trees per replicate to avoid extensive swapping on suboptimal islands. Internal support was evaluated by character bootstrapping (Felsenstein 1985) using 1,000 replicates, simple addition, and TBR bootstrap support levels, we considered bootstrap percentages (BPs) of 50% as weak, 71% as moderate, and >85% as strong (Kress et al. 2002). Bayesian analysis was conducted using MrBayes v. 3.1.2 (Ronquist et al. 2005), treating each DNA region as a separate partition. An evolutionary model for each DNA region was selected using the Akaike Information Criterion (AIC) in MrModeltest 2 (Nylander 2004). Each analysis consisted of two independent runs, each with four chains, for 5,000,000 generations, sampling one tree every 1000 generations. To improve chain swapping, the temperature parameter for heating the chains was lowered to 0.01 in the combined analysis. Convergence between the runs was evaluated using the average standard deviation of split frequencies as the burn-in, the remaining trees were used to assess topology and posterior probabilities (PPs) in a majority-rule consensus. PPs in Bayesian analysis are not directly comparable to BPs, being generally much higher (Erixon et al. 2003). Therefore, we used criteria similar to a standard statistical test, considering groups with PPs >0.95 as strongly supported, groups with PPs ranging from 0.90.95 as moderately supported, and groups with PPs <0.90 as weakly supported. Taxon Voucher Origin ITS matK Habenaria bicornis Lindl. L.P. Felix 10803 (EAN) Brazil: Paraba KF998087 KF998088 TABLE 1.Voucher information and GenBank accessions for the new sequences produced for this work.
PAGE 18
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.168 LANKESTERIANANiche modeling. We assembled a database of 40 taxonomically depurated, georeferenced unique occurrence records, based on revision of specimens from 22 herbaria (see Taxonomic analyses, earlier). The geographic coordinates were plotted using ESRI ArcGIS 9 software. The extent of occurrence (EOO) was calculated by tracing a minimum polygon, with angles exceeding 180 and containing all points of occurrence (IUCN 2010). The environmental variables were extracted from the database in Worldclim (Hijmans et al. 2005) at a spatial resolution of 0.98 km. Niche model was generated using Maxent version 3.3.2 (Phillips et al. 2006, Srgio et al. 2007) under the default values. The threshold was determined to turn the probability model into a model of presence and absence designed to distinguish appropriate and inappropriate areas for H. bicornis. We adopted the Lowest Presence Threshold (LPT) method, which purpose is to identify unknown distribution areas and et al. 2007). GIS techniques were applied (ESRI ArcGIS 9.2) for the absence value of 0.15 was adopted (LPT) to view the predicted area. The model was evaluated based on the jackknife method developed by Pearson et al. (2007). situ hybridization). Root tips from specimen L.P Felix 10803 were pretreated with 0.002 M of Carnoys solution. CMA/DAPI banding and FISH et al. (2012). Fixed root tips were washed in distilled water (v/v) pectinase (Sigma) solution at 37 C for 120 min and macerated in a drop of 45% acetic acid; the coverslip was later removed in liquid nitrogen. The CMA/DAPI double-staining technique was for 3 days, stained with CMA (0.1 mg mL) for 60 min, re-stained with DAPI (1 g mL) for 30 min, mounted in glycerol:McIlvaine buffer pH 7.0 (1:1), and subsequently aged for 3 days before analysis in were captured with a Cohu CCD video camera using Leica QFISH software, and were subsequently edited in Adobe Photoshop CS3 version 10.0. The rDNA Lotus japonicus (Amersham) and 45S rDNA from Arabidopsis thaliana probes. Labeling was performed by nick translation. The 45S rDNA probe was detected with sheep antiwith rabbit anti-sheep FITC conjugate (Dako). The (v/v), 10% dextran sulfate (w/v), 2 SSC, and 5 ng/ L of each probe. The slides were denatured at 75 oC for 3 min. Stringent washes were performed, reaching the best cells were captured as previously described. Results and discussion Taxonomic and morphological analyses. Examination and comparison of the type specimens and several other collections of H. bicornis and H. goyazensis (see list of the materials examined) sharing the following distinctive characters: welldeveloped, patent, lanceolate leaves up to 28 cm long 4 mm long), anterior petal segment longer than the posterior segment; and spur 2.5.6 cm long, being about 1.3.1 times as long as the pedicellate ovary (Fig. 1 and Table 2). In terms of the overall Habenaria bicornis shares some similar characters with, and has been mistaken for, other species such as H. caldensis H. exaltata Barb.Rodr. (Fig. 2) that also have a spur Right FIGURE 1. Floral and vegetative morphology of Habenaria bicornis and similar species. From left to righ on each row: lateral view of ovary, spur and gynostemium, dissected perianth, and habit. Habenaria bicornis. A Batista 683, CEN. B Santos et al. 2422, CEN. C Pastore 1452, BHCB. Habenaria caldensis. D Batista et al. 1382, CEN. E Batista 2415, BHCB. F Borba 102, BHCB. G Munhoz & Martins 94, BHCB. Habenaria exaltata H, I Batista 2798, BHCB. J Batista 2520, BHCB. Habenaria rodeiensis. K, M Batista & Peixoto 3273, BHCB. L Mota 2824, BHCB. Scales = 1 cm, for ovary, spur, gynostemium, and dissected perianth; 5 cm for habit.
PAGE 19
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis169
PAGE 20
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.170 LANKESTERIANA H. bicornis H. caldensis H. exaltata H. rodeiensis Leaves length width (cm) 13(28) (0.8)1.1(2.5) 5(16) 0.3.9(1.4) 8.5 1.5.5 5 0.6.6 Dorsal sepal length width (mm) 4 4.5(8) 5 4.5 3.7.3 3.8.8 4.5 4 Lateral sepals length width (mm) 6.5.5 3 6.2.8 2.6.8 4.7.8 2.3.4 5.58 2.53 Corola color base white, segments green white throughout base whitish, segments green base white, segments light green to whitish Posterior petal segment length width (mm) 4.6.1 1.7.85 4.8 1.3.8 3.7.7 1.8 4.5.5 2.5 Anterior petal segment length (mm) 6.8.8 8 1.2.4 4.5(7) Anterior petal segment length relative to posterior segment 1.3.5 times as long 1.6.2 times as long 0.2 times as long 1.2 times as long Ovary length (mm) 13 10 11 12 Pedicel length (mm) 2.3 5 1.5.4 18 Spur length (mm) 25 32 28 28 Spur size relative to the pedicelate ovary 1.3.1 times as long 1.6.3 times as long 1.5.8 times as long 0.9.2 times as long Spur position relative free from the bracts free from the bracts free from the bracts placed between the bracts Spur clavate clavate linear linear Spur apex subacute to acute rounded acute acute Hemipollinaria separated united separated united Rostellum midlobe apex obtuse, placed between the anther loci acute, projected beyond the anther loci obtuse, placed between the anther loci subacute, projected beyond the anther loci Distribution Mexico, Guatemala, Honduras, Panama, Cuba, Venezuela, Guyana and Brazil (PA, PB, PE, SE, GO, MT, TO, MG) Brazil (BA, GO, MG) Brazil (MG, PR, RS, SP) and Paraguay Brazil (BA, DF, ES, GO, MG, MT, PR, RJ, SP), Paraguay and Peru**The records of H. rodeiensis H. longipedicellata H. lehmanniana H. ernestii Schltr. TABLE 2. Diagnostic characters comparing H. bicornis states are: BA, Bahia; DF, Distrito Federal; ES, Espirito Santo; GO, Gois; MG, Minas Gerais; MT, Mato Grosso; PA, Par; PB, Paraba; PE, Pernambuco; PR, Paran; RJ, Rio de Janeiro; RS, Rio Grande do Sul, SE, Sergipe; SP, So Paulo; TO, Tocantins.(Fig. 1, and Table 2). However, H. caldensis differs in the smaller plants with smaller leaves, a completely white corolla, anterior petal segment 1.6.2 times as long as the posterior segment, and rounded spur apex. On the other hand, H. exaltata is distinguished from H. bicornis by its shorter anterior petal segment (1.2.4 mm long), which is about 0.2 times as long as the posterior segment, and the spur linear throughout (Figs. 1, 2; Table 2). Other differences are found in the morphology of the gynostemium: in H. bicornis the midlobe apex of the rostellum is obtuse, placed between the anther loci and the hemipollinaria
PAGE 21
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis171 FIGURE Habenaria bicornis and similar species. Habenaria bicornis. Felix 10803, EAN. C Flower, from Batista 683, CEN. Habenaria caldensis Batista 2633, BHCB. E Flower, from Batista 2621, BHCB. Habenaria rodeiensis. Batista & Peixoto 3273, BHCB. Habenaria exaltata I Flower, both from Batista et al. 2520 BHCB.
PAGE 22
FIGURE 3. Gynostemium morphology. A Habenaria bicornis, from Batista et al. 683, CEN. B Habenaria caldensis, from Batista 2621, BHCB. C Habenaria exaltata from Batista et al. 2520, BHCB. D Habenaria rodeiensis, from Batista & Peixoto 3273, BHCB. Scale bars A = 2 mm; B-D = 1 mm. Ac = anther canals; An = anther; Ap = anterior petal lobe; Au = auricules; Co = connective; Ds = dorsal sepal; Pe = petal; Pg = pollen grains; Pp = posterior petal lobe; Ra = rostellum arms; Rm = rostellum midlobe; Sp = stigmatic lobes; Spr = stigmatic projections; Vi = viscidium.are separated, whereas in H. caldensis the rostellum midlobe apex is acute, projected beyond the anther loci, and the hemipollinaria are united (Fig. 3). In H. exaltata the stigma lobes have a protruding, erect projection that partially divides the space between the stigma lobes and the entrance to the spur into two apertures (Fig. 3), which is a very distinctive character not found in any of the other species mentioned LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.172 LANKESTERIANA
PAGE 23
above. Habenaria bicornis has also been confused with H. rodeiensis Barb. Rodr. However, the leaves of the latter are smaller and more appressed to the the ovary, the spur is linear throughout and usually covered by the bracts, the posterior segment of the petals is wider (Fig. 1; Table 2), and the hemipollinaria are united by the viscidia (Fig. 3). Further differences between H. bicornis and the species mentioned above are outlined in the key below and in Table 2. specimens of H. bicornis has been straightforward. This species was previously only known from Cuba, and is very distinct from other Cuban species of Habenaria. The identity of H. goyazensis and its taxonomic history, on the other hand, has been confusing because each taxonomist who examined material of the species of H. goyazensis because there is a sheet in his (Fig. 4) of the type collection (Gardner 3995), but he apparently never assigned a name to this material. There is also a duplicate of the type collection (W-R 51336) at the Reichenbach herbarium (W-R) and another sheet in the same herbarium (W-R 54022) bearing a sketch 4), as well as a reproduction of Lindleys drawings at K-L. Curiously, the two major orchid taxonomists of the 19th century examined collection Gardner 3995 in detail (judging from the illustrations they drew; Fig. 4), but neither reached a conclusion about its identity. For his description of H. goyazensis, Cogniaux (1893) apparently did not examine duplicates of the type material nor the illustrations located at K-L and W-R, as his protologue only mentions material from B and G. Cogniauxs herbarium, now in BR, holds a fragment of the type collection of H. goyazensis as well as a complete specimen of the species (Pohl s.n H. sartor H. goyazensis one as H. exaltata ( Lindman 2765) and the other as H. caldensis ( Lindman 2791). Hoehne (1940) Pickel 3615, which is H. goyazensis, but his concept of the species was equivocal, as he used the same name for another species, currently known as H. tamanduensis Schltr. Pabst (Pabst & Dungs 1975) apparently only examined one collection of the species ( Macedo 1695 H. caldensis, using the name H. goyazensis for several other species (including H. caldensis, H. dusenii Schltr., H. glaucophylla Barb. Rodr., H. longipedicellata Hoehne, H. macilenta [Lindl.] Rchb.f., and H. rodeiensis collections of H. goyazensis remained indeterminate H. caldensis by Excluding the material from Panama, other Central American and Mexican specimens of H. bicornis remained indeterminate or received disparate H. bractescens Lindl. or H. jaliscana S. Watson). Ames (1922, 1928) was the only taxonomist able to correctly identify extraCuban specimens of H. bicornis; probably because several specimens from Cuba. Phylogenetic analyses. The matrix with the combined ITS and partial matK gene consisted of 1372 aligned characters, of which 304 (22%) were parsimony-informative. The parsimony analysis retained a total of 5150 most parsimonious trees with a tree length of 935 steps, a consistency index (CI) of 0.65, and a retention index (RI) of 0.85. The strict consensus of 5150 trees was for the most congruent with the Bayesian majority-rule consensus tree, but because the latter was more fully resolved and had stronger overall support it was chosen for presentation here (Fig. 5). The relationships recovered were similar to those of our previous molecular phylogenetic study (Batista et al. 2013), with the New World Habenaria species forming a well-supported monophyletic group (1.00 PP, 87% BS, Fig. 5) that was sister to the African species H. tridens Lindl. (1.00 PP, 100% BS). Within the New World clade, several well-supported subclades were recovered (Fig. 5) that corresponded analyses (Batista et al. 2013). Habenaria bicornis formed a polytomy (0.75 PP) with a clade formed by subclades 2 and 3 and another formed by subclades 4 LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis173
PAGE 24
FIGURE 4. Historical illustrations of Habenaria bicornis and H. goyazensis. A Habenaria bicornis. Lindleys original drawing of the species based on the holotype: E.F. Poeppig s.n. (K-L 000463128). B Habenaria goyazensis. Lindleys drawing of the type material based on G. Gardner 3995(K-L 000363784). C Habenaria goyazensis. Reichenbachs drawing of the type material (Gardner 3995), probably from W-R 51336. D Habenaria goyazensis. Lindman 2791 (S 06-6545). A and B reproduced with the permission of the Royal Botanic Gardens, Kew. C provided by the National History Museum, Vienna. Right FIGURE 5. Bayesian majority-rule consensus tree of the combined ITS and matK (partial) datasets. Numbers next to the nodes represent the posterior probabilities from the Bayesian analysis (PPs) and bootstrap values from the shown. Neotropical subgroups are numbered according to Batista et al. (2013). Old World taxa are indicated by an asterisk (*). The generic name for all Habenaria species is abbreviated. Habenaria bicornis is highlighted in bold and indicated by an arrow.LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.174 LANKESTERIANA
PAGE 25
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis175
PAGE 26
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.176 LANKESTERIANAto 6. In the strict consensus of the parsimony analysis this node collapsed and H. bicornis was placed in a polytomy near the base of the Neotropical clade. (1892, 1901) placed H. bicornis in sect. Macroceratitae placed H. goyazensis in sect. Pentadactylae H. bicornis and H. goyazensis do not match the morphological characters of the corresponding sections, and also because all Neotropical sections of the genus are polyphyletic or paraphyletic (Batista et al. 2013). The morphological relationships of H. bicornis with other Neotropical species or subclades are likewise unclear because Habenaria bicornis is morphologically distinct from any of the basal subclades (Fig. 5, subclades 2 to 6) and any other Neotropical subclade. Niche modeling. The potential distribution of H. bicornis as modeled with Maxent using the threshold (LPT) value of 0.151 as the upper limit is shown in 93%. The potential geographic distribution of the species extends from the Atlantic coast of the state of The bioclimatic variables that contributed most to the model were mean monthly diurnal temperature ranges (maximum temperature minus minimum temperature), precipitation seasonality, and annual temperature range (maximum temperature of warmest month minus minimum temperature of coldest month). Distribution modeling predicted a larger area of occurrence than that currently known for the species, which includes the Yucatan Peninsula in Mexico, Guatemala, Honduras, Panama, Cuba, results, however, H. bicornis should also be expected major islands of the Antilles, as well as Colombia, Suriname, Ecuador, Peru, Bolivia and Paraguay. Many of the predicted areas of occurrence should be expected based on the current known distribution of the species, such as other Mesoamerican countries some high probability areas of occurrence were unexpected, such as the coastline of Ecuador and parts of the states of Rio de Janeiro and Espirito Santo Cytogenetics. Habenaria bicornis has 2n = 42 (Fig. 7A-C, G) and a symmetrical karyotype, with and being mainly metacentric to submetacentric, except for two small acrocentric pairs (Fig. 7C, arrows). Regular meiosis was observed, with 21 chromosomes in each cell of the dyad in meiosis II (Fig. 7D-F). Although the species did not show clearly differentiated CMA/DAPI bands in meiosis, B) were observed in mitosis. Terminal chromosome regions staining slightly more intensely with CMA than with DAPI were observed only in mitotic prometaphases (Fig.7C). Two 45S rDNA sites were observed on the terminal chromosome regions of a large metacentric pair (Fig. 7G) that did not cooccur with CMA bands. Two 5S rDNA sites were observed in the interstitial and subterminal regions of a long arm on two chromosome pairs per monoploid complement (Fig. 7G). The basic number x = 21 is the most frequent among Neotropical and Old World FIGURE 6. Occurrence records and potential distribution of Habenaria bicornis inferred with Maxent. Political divisions are highlighted in white. Country abbreviations are as follows: Arg, Argentina; Bol, Mex, Mexico; Nic, Nicaragua; Per, Peru; Pry, Paraguay;
PAGE 27
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis177species of Habenaria (Felix & Guerra 1998, 2005). This number was previously reported for H. pratensis H. repens Nutt. (Felix & Guerra 1998), both of which are basal species in our previous molecular phylogenetic analysis of Neotropical Habenaria (Batista et al. 2013), suggesting that x = 21 maybe the ancestral basic number for Neotropical Habenaria. The banding patterns observed in H. bicornis stand out because of the presence of pericentromeric and terminal heterochromatin. Pericentromeric heterochromatin has been observed in unrelated groups of orchids, such as Psygmorchis pusilla (L.) Dodson & Dressler (Felix & Guerra 1999; Epidendroideae, Oncidiinae), several species of Ophrys L. (DEmerico et al. 2005; Orchidoideae, Orchidiinae), and Heterotaxis discolor (Lodd. ex Lindl.) Ojeda & Carnevali (Cabral et al. 2006; Epidendroideae, Maxillariinae), suggesting that the loss or acquisitions of this heterochromatin may be recurrent events in orchids. However, the occurrence of GC-rich heterochromatin on the terminal regions of all chromosomes in H .bicornis has not been reported for any other orchid species. The evolution of CMA/DAPI band patterns in subtribe Maxillariinae is highly variable within and between different monophyletic lineages and has been important for (Moraes et al. 2012). If this is also true for Habenaria, CMA/DAPI band patterns may provide an additional for testing phylogenetic hypothesis in the genus. FIGURE 7. Habenaria bicornis. A-C, G. Mitotic metaphases. D-F. Meiotic metaphase II. A, D. Stained with DAPI. B, E. Stained with CMA. C, F. CMA/DAPI overlap showing CMA terminal bands and DAPI pericentromeric bands. G. FISH with 45S (green) and 5S rDNA sites (red). Arrows in C indicate acrocentric chromosomes; scale bar in A corresponds to 10 m.
PAGE 28
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.178 LANKESTERIANAHabenaria bicornis Lindl., Gen. Sp. Orchid. Pl. 309. 1835. Type: CUBA. 1822, E.F. Poeppig s.n. (Holotype: K [s.n.]; isotype: K-L [000463128, drawings of holotype by Lindley]). Synonyms: Habenaria tricuspis A. Rich., Hist. Fis. Cuba, Bot. 11: 249. 1850. Type: CUBA. 1836, R. de La Sagra s.n. (Holotype: P [00408997]; isotype: W-R [43232]). Habenaria goyazensis Cogn., Fl. Bras. (Martius) 3(4): campos (marsh) near Conceio [Conceio do G. Gardner 3995 (Holotype: not indicated; Lectotype, designated by Batista et al. 2011a: K [000363814]; Isotypes: B [destroyed], BR [642571; fragment from B or G], BM [000032714], F [24791; negative from the specimen from G], G [00169025], K [000363815], K-L [000363784], OXF, W-R [51336, 54022], RENZ [1446; photo, drawing and fragment from W-R 51336]). Terrestrial herb. Roots few, short, at the base of the stem. Tuberoid fusiform, 2.2.0 1.0.8 cm. Stem erect, (25)37() cm long, including the Leaves 6(), spreading, largest at the center of the stem, lanceolate, 13() (0.8)1.1.0(.5) cm. lanceolate, acuminate, (1.3)1.5.8(.2) cm long, ovary. Flowers 19(), resupinate, greenishwhite; pedicellate ovary parallel to or spreading from the rachis, (13)21() mm long; ovary slightly arched, 13 mm; pedicel shorter than the ovary, 2.3.2 mm. Sepals green, aristate, smooth; dorsal semm; lateral sepals obliquely lanceolate, acute or subPetals bipartite; posterior segment falcate, 4.6.1 1.7.9 mm, sub-acute, lying beside or free from the dorsal sepal, base, middle part and inner margin white, outer margin from the middle to the apex light green; anterior segment divergent, linear, inserted at the base of the posterior segment, 6.8.8 0.4.8 mm, 1.3.5 times as long as the posterior segment, base whitish, towards the segments apex light green. Lip tripartite, light green, base white, towards the segments apex light green; undivided basal part prominent, 1.8 1.7.5 mm; side segments linear, 7.8.8(1.0) 0.6.9(.0) mm, 1.3.5 times as long as the median segment; median segment linear-ligulate, straight, 5.5.0 0.9.9 mm; spur slightly sinuous to hooked, some-times projected frontwards, free from the bracts, sub-clavate, 1.3.1 times as long as the pedicellate ovary, 2.5.6 cm long, base 0.6.4 mm wide, whitish, apex 1.4.4 mm wide, green. Gynostemium erect, 2.6.9 mm high; connective emarginate, light green; auricles -Taxonomic treatment KEY TO HABENARIA BICORNIS AND MORPHOLOGICALLY SIMILAR SPECIES 1. Petal posterior segment 2.0.5 mm wide; spur about the same length as the pedicellate ovary, usually hidden between the bracts H. rodeiensis 1. Petal posterior segment 1.0.85 mm wide; spur 1.3.3 times as long as the pedicellate ovary, free from the bracts 2 2. Petal anterior segment 0.2.0 times as long as posterior segment; spur linear throughout H. exaltata 2. Petal anterior segment 1.3.2 times as long as posterior segment; spur clavate to subclavate 3 completely white; anterior petal segment 1.6.2 times as long as posterior segment; spur apex rounded; hemipollinaria united; rostellum midlobe apex acute, projected beyond the anther locules H. caldensis cm; petals and lip with base white and green segments; anterior petal segment 1.3.5 times as long as posterior segment; spur apex subacute to acute; hemipollinaria separated; rostellum midlobe apex obtuse, situated between the anther locules H. bicornis
PAGE 29
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis179ed. Anther locules 1.8.3 mm high, canals short, 1.0.1 mm long, hemipollinaria separated, 3.7 mm long, viscidium 0.75 0.6 mm, spaced 1.4.6 mm apart, caudicles 1.3 mm long, pollinia 1.6 1.1 mm. Stigma lobes 2, mostly separate, in contact only at the upwards, 2.1.3 mm long, apex 1.2 mm wide, obtuse, margins not involute, space between the stigma lobes oblong to elliptic. Rostellum 3.4 mm long, white; midbetween the anther loci, 1.8 mm high; side-lobes paral-lel throughout, 1.9 mm long. DISTRIBUTION AND CONSER VATION STATUS : Habenaria bicornis is distributed from southern Mexico (Guatemala, Honduras, and Panama), the Caribbean Guyana), to northern (Par), northeastern (Paraba, Pernambuco, and Sergipe), central (Gois, Mato Grosso, and Tocantins) and southeastern (Minas Gerais) most of the Neotropics, it is uncommon and locally known from few collections (except from Cuba, where several collections are known, particularly from the province of Pinar del Rio). Despite its low frequency, but because of its broad distribution, H. bicornis can World Conservation Union Red List Categories and Criteria (IUCN, 2001). HABITAT, ECOLOGY AND PHENOLOGY : Habenaria bicornis is commonly found in lowland, permanently wet savannas (chagite, matorral, selva baja caducifolia inundable, acutica, wet grassland, wet boggy meadow, sandy wet banks, moist grassy places, wet The species also occasionally occurs at the interface between wet grassland and gallery forests. Elevations range from near the sea level to 800 m, but most records (90%) are from below 400 m. Flowering occurs from the peak of the rainy season to its end: from February to March in central and southeastern and in the northern hemisphere (Table 3). As in most species of the genus, H. bicornis begins a new growth cycle during the rainy season. A new vegetative shoot grows from the tuber formed during the previous season and produces a new stem, which forms a new of the capsules as the dry season approaches, the stem and leaves wither and are lost, and the new tuberoid becomes dormant. Because of its habitat preferences, Habenaria bicornis regimens than other Neotropical species of the genus from seasonal humid grasslands (Batista et al. 2003, 2010, Batista & Bianchetti 2010), which usually ILLUSTRATIONS H. caldensis, based on Lindman 2791 ), Hoehne (1940, H. goyazensis, based on Pickel 3615 H. caldensis, based on Wilson-Browne 2), Batista et al. H. goyazensis, based on Batista et al. 683). The illustration of H. exaltata in Flora Brasilica (Hoehne 1940, plate 68) is most probably based on Lindman 2765 (S) and referable to H. bicornis. The material illustrated in Pabst & Dungs (1975: 250, H. goyazensis, is based in on Chagas s.n. INPA 826, and is referable to H. longipedicellata. ADDITIONAL SPECIMENS EXAMINED : MEXICO. Campeche: Carretera Kalkin-El Remate, 2 km antes de llegar a El TABLE H. bicornis for each of its main geographic distribution areas. The total includes all collected specimens from each region, including materials with fruits, and with or without collection dates. Taxa Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Total Mexico and Central America 2 2 1 8 Cuba 8 4 2 25 Northeastern Brazil and northern South America 1 1 2 2 8 Central and southeastern Brazil 4 1 7
PAGE 30
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.180 LANKESTERIANARemate, selva baja caducifolia inundable, acutica, comum, M. Pena-Chocarro, J. Tun, L. Salinas & J. Hinojosa 599 (BM); Veracruz: Totutla, Mata Obscura, A.F. Ventura 7072 (EAP). CUBA. Herb. Estac. Centr. Agron. 753 (BR). Cienfuegos: Cieneguita, in wet grassy lands, not R. Combs 440 (AMES, GH, MO); Cieneguita, in wet grassland and open wood land, R. Combs 755 (GH). E.L. Ekman 2375 E.L. Ekman 6449 (US). Matanzas: San Miguel de los Baos, on slope of Jacn hill, Grassy place, 6 August 1919 B. Len & M. Roca 8898 (NY). Pinar del Rio: vicinity N.L. Britton, E.G. Britton, F.S. Earle & C.S. Gager 6337 (AMES, K, NY, US); Laguna Santa N.L. Britton, E.G. Britton & C.S. Gager 7153 (AMES, NY); Vicinity of Pinar del Ro, sandy wet bank, in pinelands, sepals green, 5-12 September 1910 (fr), N.L. Britton, E.G. Britton & C.S. Gager 7247 (AMES, NY); Pinar del Ro to Viales, N.L. Britton, E.G. Britton & C.S. Gager 7302 (NY); north of La B. Len 4585 (NY); Pinar del Ro, Sabana de Bacunagua, October B. Len 15061 (US); Sumidero, Savanna del Poeppig 1845 Poeppig s.n. (W); Poeppig s.n. (W-R 20323); in savannarum regionis humiden Poeppig s.n. (W-R 20322); campi inundati, Poeppig s.n. (P 386869); North of [Consolacion] J.T. Rog y Mesa & M.A. Chrysler 3263 (NY); west of Guane along the Mantua road, palm barren, moist grassy places, 25 November 1911 (fr), J.A. Shafer 10480 (A, NY); Cuchillas de San Sebastian, vicinity of Sumidero, siliceous formation, grassy hillside, J.A. Shaffer & B. Len 13714 (A, BM, NY); Cuchillas de San Sebastian, J.A. Shaffer & B. Len 13718 (NY). Villa Clara: Santa Clara, Banks of Lagoon Hait, B. Len & F.R. Cazans 5924 (NY); Santa Clara, near Manacas, 27 December 1915 (fr), B. Len & F.R. Cazans 5966 (NY). GUATEMALA. G. Bernoulli 922 (W-R). HONDURAS. Francisco Morazn: Near Las Mesas, in chagite, common, 2 December 1950 (fr), P.C. Standley 27834 (EAP); near Las Mesas, wet boggy meadow, L.O. Williams & A. Molina 14712 (EAP). PANAMA. Panam: Canal Zone, H.F. Pittier 6792 (fr), P.C. Standley 28982 (US); Panama City, between P.C. Standley 32032 (US). VENEZUELA. Bolivar: Cuidad Guayana, Mission deu Caroni, Canton de Upata (?), dan les Grosourdy s.n. (P 00386911); Portuguesa: Guanare, Mesa Alta (Mesa del Indio), 10 km al N-W de Guanare, en chaparrales associados com G. Aymard & C. Ramirez 7067 (MO). GUYANA. Upper Takutu-Upper Esequibo: Rupununi G. Wilson-Browne 2 (K, NY, RENZ). BRAZIL. Mossmedes, Serra Dourada, Pohl 1645 (BR, W); So Domingos, A.A. Santos et al. 2422 (BHCB, CEN). A. Macedo 1695 (HB). Serra das Araras, in campis, perianthum viride, 15 February C.A.M. Lindman 2765 (S); prope rivum Esmeril, in campo uliginoso graminoso, C.A.M. Lindman 2791 (S, spirit). Par: Jobert 141 (P, RENZ). Paraba: branco-creme, segmentos vegetativos verdes, 13 September L.P. Felix 10803 (EAN). Pernambuco: Tapera B. Pickel 3615 (IPA, NY, SP); Lagoa do Ouro, 9S, 35W, 24 August 2013 L.P Felix & E.M Almeida 14643 (EAN). Sergipe: Japaratuba, beira de rodovia pavimentada, campo limpo J.F.B. Pastore 1452 (BHCB). Tocantins: Araguau, 18-20 km aps Araguau, na estrada para Alvorada, nas bordas de mata ciliar mida com campo J.A.N. Batista et al. 683 (CEN). TAXONOMIC NOTES : Poeppig collected several specimens of H. bicornis in Cuba. The holotype in K is labeled just Cuba, 1822. The collection data of the other specimens varies from Cuba, Savana del sumidoro, October 1823, E.F. Poeppig 1845 (G 169029, W-R 20324, W s.n.), to Cuba, 1824 (W s.n.) or just Cuba without any date or collection number (P 386869, W-R 20322, W-R 20323). In a synopsis of New World Habenaria, Batista et al. (2011a) incorrectly cited the most complete collection data as the type data and interpreted the specimens in G and P as isotypes.
PAGE 31
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis181 Some authors have considered H. bidentata Poepp. ex Steud., a nomen nudum, a synonym of H. bicornis (Cogniaux 1909, Gal 1938). However, the name was H. alata Hook. Accordingly, there are several collections from Poeppig at W (W s.n., W-R 43241, W-R 20301, H. bidentata and which are all referable to H. alata. Some authors have considered H. tricuspis a synonym of H. repens (Cogniaux 1909, Ames 1910, Gal 1938, Len & Schweinfurth 1946), but examinations of the type H. bicornis. Habenaria radicans Griseb., from Cuba, was published as a synonym of H. tricuspis (Grisebach 1866), but the name is based on the specimen C. Wright 3309 (AMES 70164, BM 32525, K), which is H. repens. ACKNOWLEDGMENTS The authors thank the curators and staff of the following herbaria for providing digital images or access to their collections and support during our visits: A, ALCB, AMES, B, BHCB, BM, BR, CEN, CEPEC, CESJ, CTES, EAN, EAP, ESA, G, GH, HB, HBG, HRB, HRCB, HUEFS, IBGE, ICN, IPA, K, L, LP, M, MBM, MBML, MO, NY, OUPR, OXF, P, PMSP, R, RB, RENZ, S, SI, SP, SPF, U, UB, UEC, US, W; Gustavo Romero for scanning the image of H. goyazensis dos Santos for permission and assistance in the use of Leica M205C stereoscopic microscope, Ana Cludia Fernandes for translation of the abstract to Spanish, and two anonymous reviewers for improvements support from Conselho Nacional de Desenvolvimento a Pesquisa do Estado de Minas Gerais (FAPEMIG) and a scholarship (Pq-2) from CNPq. LITERATURE CITED Ames, O. 1910. The genus Habenaria in North America. Orchidaceae 4: 1. Ames, O. 1922. New or noteworthy orchids from different parts of the world. Orchidaceae 7: 83. Ames, O. 1928. Orchidaceae. In: P.C. Standley (ed.), Flora of the Panama Canal Zone. Contributions from the United States national Herbarium. Vol. 27. Batista, J.A.N., L.B. Bianchetti & E.G. Gonalves. 2003. An overlooked new species of Habenaria (Orchidaceae) Batista, J.A.N., J.B.F. Silva & L.B. Bianchetti. 2008. The genus Habenaria Batista, J.A.N. & L.B. Bianchetti. 2010. Taxonomy, distribution and new taxa from the Habenaria crucifera and the Guianas. Brittonia 62: 57. Batista, J.A.N., B.M. Carvalho, A.J. Ramalho & L.B. Bianchetti. 2010. Three new species of Habenaria (Orchidaceae) from Serra da Canastra, Minas Gerais. Phytotaxa 13: 27. X.M.C. Figueroa & P.J. Cribb. 2011a. A synopsis of new world Habenaria (Orchidaceae) I. Harvard Pap. Bot.16: 1. X.M.C. Figueroa & P.J. Cribb. 2011b. A synopsis of new world Habenaria (Orchidaceae) II. Harvard Pap. Bot. 16: 233. Batista, J.A.N., K.S. Borges, M.W. Faria, K. Proite, A.J. Molecular phylogenetics of the species-rich genus Habenaria (Orchidaceae) in the New World based on nuclear and plastid DNA sequences. Mol. Phylogenet. Evol. 67: 95. sequence assembly program. Nucleic Acids Res. 24: 4992. Cabral, J.S., L.P. Felix & M. Guerra. 2006. Heterochromatin sites in chromosomes of four Maxillaria species (Orchidaceae). Genet. Mol. Biol. 29: 659. Chase, M.W., R.S. Cowan, P.M. Hollingsworth, C. van den Berg, S. Madrin, G. Petersen, O. Seberg, T. Jrgsensen, K.M. Cameron, M. Carine, N. Pedersen, Richardson, M.L. Hollingsworth, T.G. Barraclough, L. Kelly & M. Wilkinson. 2007. A proposal for a standardised protocol to barcode all land plants. Taxon 56: 295. Cogniaux, A. 1893. Orchidaceae. Habenaria. Pp. 18 in: C.F.P. Martius, A.G. Eichler & I. Urban (eds.) Flora Brasiliensis 3(4). Mnchen, F. Fleischer. Cogniaux, A. 1909. Orchidaceae VII. Habenaria. Pp. 297 in: I. Urban (ed.), Symbolae Antillanae seu F. Borntraeger. Correa, A., D. Mireya, C. Galdames & M.N.S. Stapf. 2004. Catlogo de las Plantas Vasculares de Panam. Smithsonian Tropical Research Institute, Panama. DArcy, W.G. 1987. Flora of Panama. Check list and index. Part I: The introduction and checklist. Missouri Botanical Garden. St. Louis, Missouri. DEmerico, S., D. Pignone, G. Bartolo, S. Pulvirenti, C.
PAGE 32
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.182 LANKESTERIANATerrasi, S. Stuto & A. Scrugli. 2005. Karyomorphology, heterochromatin patterns and evolution in the genus Ophrys (Orchidaceae). Bot. J. Linn. Soc. 148: 87. Dressler, R.L. 1980. Checklist of the orchids of Panama. Monographs in Systematic Botany from the Missouri Botanical Gardens 4: 1. Dressler, R.L. 1993. Field guide to the orchids of Costa Rica and Panama. New York, Cornell University Press. Edgar R.C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32: 1792. Erixon P., B. Svennblad, T. Britton & B. Oxelman. 2003. Reliability of Bayesian posterior probabilities and bootstrap frequencies in phylogenetics. Systematic Biol. 52: 665. Felix L.P. & M. Guerra 1998. Cytological studies on species of Habenaria Willd. (Orchidaceae-Orchidoideae) 224. Felix, L.P. & L.P. Guerra. 1999. Chromosome analysis in Psygmorchis pusilla (L.) Dodson & Dressler: the smallest chromosome number know in Orchidaceae. Caryologia 52: 165. Felix, L.P. & L.P. Guerra. 2005. Basic chromosome numbers of terrestrial orchids. Pl. Syst. Evol. 254: 131. approach using the bootstrap. Evolution 39: 783. Zool. 20: 406. Gal, J.A. 1938. Catlogo descriptivo de las orquideas cubanas. Bol. Estac. Exp. Agron. Santiago de las Vegas. Vol. 60 Govaerts, R., P. Bernet, K. Kratochvil, G. Gerlach, G. Carr, P. Alrich, A.M. Pridgeon, J. Pfahl, M.A. Campacci, D. Holland Baptista, H. Tigges, J. Shaw, P. Cribb, A. Orchidaceae. Royal Botanic Gardens, Kew. Available from: http://apps.kew.org/wcsp/ (accessed: 11 July 2013). Grisebach, A. 1866. Catalogus plantarum cubensium. G. Grisebach, A. 1873. Habenaria. Pp. 233 in: F.A. Sauvalle (ed.), Flora Cubana: enumeration nova plantarum cubensium. Havana, La Antilla. Hoehne, F.C. 1940. Orchidaceas. Habenaria. Pp 52 in: F.C. Hoehne (ed.) Flora Brasilica 12(1). So Paulo, Secretaria da Agricultura, Indstria e Comrcio de So Paulo. Hijmans, R.J., S.E. Cameron, J.L. Parra, P.G. Jones & A. Jarvis. 2005. Very high resolution interpolated climate surfaces for global land areas. Int. J. Climatol. 25: 1965. IUCN. 2001. IUCN Red List Categories and Criteria, Version 3.1. IUCN Species Survival Commission, Gland. IUCN Standards and Petitions Subcommittee. 2010. Guidelines for Using the IUCN Red List Categories and Criteria. Version 8.1. Prepared by Standards and Petitions Subcommittee in March 2010. gattung Habenaria Willd. Engl. Bot. Jahrb. 16: 52. Orchidacearum genera et species. Vol. I. Habenaria. Mayer & Mller, Berlin. Kongl. Svenska Vetenskapsakad. Handl. 46: 1. Kress W.J., L.M. Prince & K.J. Williams. 2002. The (Zingiberaceae): evidence from molecular data. Amer. J. Bot. 89: 1682. Len, H. & C. Schweinfurth. 1946. Familia 2. Orquideas. In: H. Len (ed.) Flora de Cuba. Vol. 1. Contribuciones ocasionales del Museo de Historia Natural del Colegio de La Salle, 8. Habana, Cultural S.A. Lindley, J. 1830. The genera and species of orchidaceous plants. J. Ridgways, London. Moraes, A.P., I.J. Leitch & A.R. Leitch. 2012. Chromosome studies in Orchidaceae: karyotype divergence in Neotropical genera in subtribe Maxillariinae. Bot. J. Linn. Soc. 170: 29. Nylander, J.A.A. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University. Pabst, G.F.J. & F. Dungs. 1975. Orchidaceae Brasilienses. Vol. 1. Brucke-Verlag Kurt Schmersow, Hildesheim. Pearson, R.G., C.J. Raxworthy, M. Nakamura & A.T. Peterson. 2007. Predicting species distributions from small numbers of occurrence records: a test case using cryptic geckos in Madagascar. J. Biogeog. 34: 10217. Phillips, S.J., R.P. Anderson & R.E. Schapire. 2006. Maximum entropy modeling of species geographic distributions. Ecol. Model. 190: 231. Pridgeon A.M., P.J. Cribb, M.W. Chase & F.N. Rasmussen .2001. Genera orchidacearum, Vol. 2. Orchidoideae, part 1. Oxford University Press Inc, New York. Habenaria (Orchidaceae) in the Guianas. Candollea 47: 483. Richard, A. 1850. Ophrydeae. Habenaria. Pp. 249 in: y natural de la isla de Cuba. Segunda parte. Historia Natural. Tomo XI. Botanica. Paris, A. Bertrand. Ronquist, F., J.P. Huelsenbeck & P. van der Mark. 2005. MrBayes: Bayesian Inference of Phylogeny. Program distributed by the authors. Available from: http:// mrbayes.sourceforge.net/index.php Sousa. 2007. Modelling bryophyte distribution based
PAGE 33
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BATISTA et al. Taxonomy and distribution of Habenaria bicornis183on ecological information for extent of occurrence assessment. Biol. Conserv. 135: 341. Simpson, M.G. 2006. Plant systematics. Elsevier Academic Press, Burlington, San Diego and London. Snuverink, J.H & L.Y. Th. Westra. 1983. Studies on the Habenaria Willd. in Suriname (Orchidaceae). Proc. Kon. Nederl. Akad. Wetensch., C, 86(4): 567. 2012. Cytogenetic and molecular evidence suggest multiple origins and geographical parthenogenesis in Nothoscordum gracile (Alliaceae). Ann. Bot. 109: 987. Sprengel, C.P.J. 1826. Systema vegetabilium. Editio decima sexta, vol. 3. Sumtibus Librariae Dieterichianae, Gttingae. Stearn, W.T. 1992. Botanical Latin. 4o ed. Timber Press, Portland. Swofford, D.L. 2002. PAUP*. Phylogenetic analysis using parsimony (*and other methods). Version 4. Sinauer Associates, Inc., Sunderland. Sun, Y., D.Z. Skinner, G.H. Liang & S.H. Hulbert. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theor. Appl. Genet. 89: 26. Tamura, K., J. Dudley, M. Nei & S. Kumar. 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596. Whitten, W.M., N.H. Williams & M.W. Chase. 2000. Subtribal and generic relationships of Maxillarieae (Orchidaceae) with emphasis on Stanhopeinae: Combined molecular evidence. Amer. J. Bot. 87: 1842 1856. Williams, L.O. 1946. Orchidaceae. Habenaria. Pp. 11 in: R.E. Wood & R.W. Schery (eds.), Flora of Panana. Part. 3. fas. 2. Annals of the Missouri Botanical Garden. Vol. 33(1). Facsimile reprint (1980). Williams, L.O. 1956. An enumeration of the Orchidaceae of Central America, British Honduras and Panama. Ceiba 5(1): 1. APP ENDIX Additional specimens examined of morphological similar species. Habenaria caldensis. BRAZIL. A. Ghillany s.n. (HB 57918), A. Glaziou 16372 (BR, P, RENZ), A. Macedo 2964 (NY, RB, US), 5206 (HB), A.C.D. Munhoz & C.A.N. Martins 91 (BHCB), 94 (BHCB), A.C.D. Munhoz et al. 69 (BHCB), 84 (BHCB), 157 (BHCB), 165 (BHCB), A. Salino et al. 10863 (BHCB), A.B. Joly et al. 1246 (SP), 1366 (SP), A.F. Regnell III 1181 (P, S, US, W), A.J. Sampaio 6706 (BHCB, R), 6888 (SP, R), A.P. Duarte 7835 (NY, RB), B. Orssich s.n. (HB 66528), C.M. Sakuragui et al. in CFCR 15109 (SPF), D. Zappi et al. 9568 (SPF), E.N. Lughadha & J.R. Pirani H51022 (K), E. Pereira 8903 (AMES, HB, RB), E. Simonis & I. Cordeiro in CFCR 4098 (SPF), E.L. Borba 102 (BHCB), 107 (BHCB), E.P. Heringer & A. Castellanos 6014 (AMES, HB), 6074 (UB), 6219 (UB), 6219-A (HB), 6228 (UB), 22243 (R), E.P. Heringer 6229 (UB), E.R. Pansarin & A.O. Simes 786 (CEN, UEC), 803 (CEN, UEC), F.C. Hoehne s.n. (SP 4945, SPF 65025), G. Hatschbach & Z. Ahumada 31572 (MBM), G. Hatschbach & J. Cordeiro 51837b (MBM), G. Hatschbach et al. 28748 (HB, MBM, NY, UEC, US), 36315 (HB, MBM, NY, RENZ), 40828 (MBM), 64355 (HBG, MBM), 64355 (BHCB, MBM), G. Martinelli et al. 11343 (RB), G. Windisch 2582 (HB), G.W.A. Fernandes s.n. (BHCB 27951), H.S Irwin et al. 12406 (HB, NY), 18782 (HB, NY, UB), 19899 (AMES, HB, RB, UB), 19993 (AMES, HB, M, NY, RB,UB, US), 20869 (AMES, HB, NY, RB, UB, US), 22045 (UB), 22391 (HB, NY, UB), 22556 (HB, NY, UB), 22701 (UB), 23431 (AMES, HB, NY, RB, UB, US), 28037 (HB, UB), 32177 (NY, UB), 34025 (HB, HBG, NY, UEC), 34025a (UB), 35417 (NY), Jobert 87 (P), J. Badini s.n. (OUPR 9712, 9721, 9726), J. Semir & A.B. Joly 3811 (SP), 3814 (SP), J. Semir & M. Sazima 4941 (SP, UEC), J.A. Lombardi 4615 (BHCB), J.A.N. Batista 154 (CEN), 250 (CEN), 1828 (BHCB), 2621 (BHCB), 2633 (BHCB), J.A.N. Batista & A.R.C. Lemos 1061 (CEN, UEC), J.A.N. Batista & E.R. Pansarin 1139 (CEN), 1156 (CEN, UEC), J.A.N. Batista & K. Proite 987 (CEN), 1021 (CEN), J.A.N. Batista & L.B. Bianchetti 396 (CEN), 895 (CEN), 919 (CEN), J.A.N. Batista et al. 714 (CEN, MBM, SP), 1359 (CEN, SP), 1382 (CEN), 1389 (CEN), 1798 (BHCB), 1818 (BHCB), 1900 (BHCB), 1950 (BHCB), 2405 (BHCB), 2413 (BHCB), 2415 (BHCB), 2458 (BHCB), 2737 (BHCB), 2794 (BHCB), 2820 (BHCB), 2856 (BHCB), 2877 (BHCB), 2955 (BHCB), 3120 (BHCB), 3147 (BHCB), J.R. Pirani et al. 2212 (SPF), 2296 (SPF), 3963 (SPF), in CFCR 9144 (SPF), L. Damasio s.n. (OUPR 9707, 9708), L.B. Smith et al. 15958 (HB, US), L. Mickeliunas & E.R. Pansarin 03 (CEN, UEC), 15 (CEN, UEC), 34 (CEN, UEC), L. Th. Dombrowski 7000 (MBM), L.A. Martens 255 (SPF), M. Barreto 4870 (BHCB), 4871 (BHCB, SP), 8929 (BHCB, R, SP), M. Magalhes 1100 (BHCB, SP), 1126 (BHCB), M.F.A. Cali et al. 29 (SPF), M.G.L. Wanderley et al. 577-A (SP), M.M. Arbo et al. 4629 (AMES, K), 5215 (AMES, SPF), M.S. Werneck 66 (BHCB), M. Sazima 13400 (UEC), N.L. Menezes et al. 7099 (SP), N.S. Bittencourt Jr. 00/42 (UEC), P.L. Viana s.n. (BHCB 69740), P.L. Vianna 577 (BHCB), Piliackas et al. 10907 (SPF), R. Mello-Silva et al. in CFCR 8862 (SPF), 9040 (SPF), R.C. Mota & P.L.
PAGE 34
LANKESTERIANA 184Viana 1704 (BHCB, CEN), 1711 (BHCB), R.C. Mota 1698 (BHCB, CEN), 1720 (BHCB), 1729 (CEN, BHCB), 2733 (BHCB), R.S. Oliveira 276 (CEN, UB), R.S. Oliveira et al. s.n. (UB), R.W. Windisch 2596 (HB), R.W. Windisch 491 & A. de Ghillany (HB), S. Mayo et al. 7010-A (SP), S. Mayo et al. 7013 (SP), T.F. Daniel & N. Hensold 2298 (SPF) 2298A (SPF), 2315 (BHCB), 2369 (BHCB), V.C. Souza et al. 8226 (ESA), W.A. Teixeira s.n. (BHCB 26081), W.R. Anderson et al. 35415 (HB), 35417 (HB, MBM, NY, UB, US), 36098 (HB, NY, UB, US). Habenaria exaltata. BRAZIL. Amadeu 37 (HB, ICN), E. Hassler 8721 (BM), G. Hatschbach 10946 (HB, L, MBM, U), 13773 (MBM), 15962 (HB, MBM), 18323 (MBM), G.F.J. Pabst 1318 (B, HB, HBG, K, RB, S), J. Dutra 1074 (ICN, SI, SP), J. Klein 149 (BHCB), J.A.N. Batista et al. 2771 (BHCB), 2520 (BHCB), 2798 (BHCB), J.L. Waechter 1976 (ICN), L. Arzivenco 521 (ICN), M. Emmerich 3174 (HB, R), M. Pedron 6 (ICN), P. Jorgensen 4646 (US), 4648 (S, SI), P.K.H. Dusen 3272 (R, SP, SPF), Z.A. Trinta 1204 (HB, HBG, K, L, LP, M). Habenaria rodeiensis. BRAZIL. A.A. Vale et al. 133 (BHCB), A. de Saint-Hilaire B1 854 (P), B2 2201 (P), A. Krapovickas & C. L. Cristbal 33555 (CTES), A. Ruschi 52 (SP), A.C. Brade 10657 (SP), 11367 (R), 12541 (RB), s.n. (R 28922, RB 53103), C. Spannagel 228 (SP), C.M. Izumisawa et al. 167 (PMSP), C.N. de Fraga 609 (MBML), D. Sucre 2522 & Braga 363 (RB), D. Sucre 2292 (NY, RB, US), E.P. Heringer et al. 6332 (IBGE, K), 11078 (HB), 16824 (HB), 18146-A (IBGE), 18201 (IBGE), E.R. Pansarin & L. Mickeliunas 1015 (BHCB, UEC), E. Ule 4006 (HBG), F.C. Hoehne 241 (SP), F.H. Caetano s.n. (HRCB), F.R. Nonato 994 (HUEFS), G. Edwall in CGGSP 3670 (SP), G. Hatschbach 1211 (MBM), G. Hatschbach et al. 13451 (MBM), G.F.J. Pabst 690 (HB), 928 (HB, NY), 937 (HB, NY), 938 (HB, K), 947 (HB), 964 (HB), 6822 (HB), 7323 (HB), G.J. Shepherd et al. 7451 (UEC), H. Schenck 2346 (BR), J. Vidal 89 (R), J.A.N. Batista 1419 (CEN), J.A.N. Batista et al. 77 (CEN), 1471 (CEN), 1472 (CEN), J.A.N. Batista & T.R. Peixoto 3273 (BHCB), J.A. Jesus & T.S. Santos 404 (CEPEC), Kuhlmann 6010 (RB), L. Kollmann 86 (MBML), 2732 (MBML), 2733 (MBML), L. Kollmann & R.R. Veruloet 2826 (MBML), L. Kollmann et al. 2526 (MBML), L.H. Bailey & E.Z. Bailey 1110 (AMES), M. Mattos s.n. (R 28932, 28954), N.L. Abreu et al. 143 (CESJ), O. Handro 2033 (SPF), 2085 (SPF), P. Martuscelli 101 (SP), R. Kautsky 88 (HB), 591 (HB), R.C. Mota 2824 (BHCB), R.F. Campos s.n. (SP 28922), R.M. Valado et al. 67 (ALCB), S.A. Mori et al. 10045 (CEPEC), S. Lima & A.C. Brade 14322 (RB), T. Konno et al. 763 (SP), T. Jost et al. 364 (HRB), V.C. Souza et al. 3651 (ESA), W. Boone 366 (MBML), 533 (MBML).LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 35
Lindley (1830) established Specklinia Lindl. Pleurothallis R. Br. Lindley did not choose a type for the genus. In Folia Orchidacea, Lindley (1859) himself decided species contained in Specklinia into a broad concept of Pleurothallis. More than a century later, Garay S. lanceola (Sw.) Lindl. (=Epidendrum lanceola Sw.) as the lectotype of Specklinia. Then, Garay (1974) determined to treat Specklinia under Pleurothallis s.l. and proposed to classify the group under Pleurothallis subgenus Specklinia (Lindl.) Garay. Luer (1986) followed Garay in considering those species under a broad concept of Pleurothallis and created in addition two new subgenera: Empusella Luer and Pseudoctomeria sections Muscariae Luer and Tribuloides Luer. Species of Specklinia remained in Pleurothallis until Pridgeon & Chase (2001) assessed the monophyly of Pleurothallidinae. In one of the most parsimonious trees of the complete ITS nrDNA matrix, they found that S. lanceola belongs to a clade (treated as Scaphosepalum clade or Clade F) encompassing the species of subgenera Specklinia (sect. Hymenodanthe Barb.Rodr., Muscariae and LANKESTERIANA 13(3): 185. 2014. I N V I T E D P A P E R ILLUSTRATIONS AND STUDIES IN NEOTROPICAL ORCHIDACEAE. THE SPECKLINIA CONDYLATA IN COSTA RICA AND PANAMA DIEGO BOGARN 1,2,3 ZULEIKA SERRACN 2 & ZABDY SAMUDIO 21Jardn Botnico Lankester, Universidad de Costa Rica. P.O. Box 302-7050 Cartago, Costa Rica, A.C.2Herbario UCH, Universidad Autnoma de Chiriqu, 0427, David, Chiriqu, Panama3Author for correspondence: diego.bogarin@ucr.ac.cr ABSTRACT. Taxonomy of discrete groups of taxa within Pleurothallidinae is critical for a better understanding of species diversity, evolution and phylogenetics. This paper focuses on the taxonomy and systematics of the species related to Specklinia condylata in Costa Rica and Panama. The taxonomic history and its phylogenetic Each taxon is described on the basis of living material and illustrated in a composite plate. Overall distribution, maps, derivation of name, notes on species ecology, natural variation and diagnostic features are presented for RESUMEN : La taxonoma de grupos discretos de taxones dentro Pleurothallidinae es fundamental para una mejor sistemtica de las especies relacionadas a Specklinia condylata en Costa Rica y Panam. Se discute su historia para la ciencia. Cada taxn se describe con base en material vivo y se ilustra en una lmina compuesta. Para cada taxn se presenta la distribucin general, mapas, derivacin del nombre, notas sobre ecologa, variacin natural y caractersticas diagnsticas. Se proporciona una clave para las especies y un cuadro comparativo para KEY WORDS / PALABRAS CLAVE : new species, Platystele, Sarcinula, Scaphosepalum, taxonomy* This contribution was prepared as part of the special edition of LANKESTERIANA aimed to celebrate Lankester Botanical Gardens (JBL) 40th anniversary.
PAGE 36
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.186 LANKESTERIANATribuloides), Empusella and Pseudoctomeria, together with the traditionally accepted genera Acostaea Schltr., Dryadella Luer, Platystele Schltr. and Scaphosepalum and Luer (2006) published numerous transfers to Specklinia new circumscription of Pridgeon & Chase (2001) as a polyphyletic aggregation of many taxa. Instead, he proposed to split Specklinia major groups of Muscarella Luer, Pabstiella Brieger & Senghas, Panmorphia Luer, Sarcinula Luer and Specklinia; the smaller groups of Phloeophila Hoehne & Schltr., Ronaldella Luer, Sylphia Luer and Tribulago created for the rest of the morphologically aberrant species Luer (2006). Different interpretations of the morphologic and phylogenetic evidence make Specklinia genus have been published but the exact number of species is still hard to calculate and it depends on the clades (Pupulin et al. 2012). When Pridgeon & species. In Pridgeon (2005), Specklinia was treated as comprising some 200 species, ranging from Mexico Specklinia is still variable in terms of vegetative ramicauls shorter than the leaves, an abbreviated stem with an annulus, the leaves erect, elliptic, obovate or orbicular, coriaceous, the sepals and petals mostly acute or obtuse, membranous, the lateral sepals variously connate, the petals oblong-spatulate, acute or obtuse and the lip is hinged to the column foot. The column is winged, terete or clavate, with an erose or toothed clinandrium. The anther and stigma are ventral. The pollinarium is made up by two pollinia, free or lightly adherent to minute viscidia (Bogarn et al. 2013, Luer 2006, Pupulin et al. 2012, Pridgeon et al. 2005). This paper is focused on a group of Specklinia that comprises the species close to S. condylata (Luer) Pridgeon & M.W.Chase. Here, it is informally treated as S. condylata group. The Specklinia condylata be known of this group was collected by Augustus Talamanca in the locality of Boca de Dota, towards Cerro Pito in Costa Rica. He depicted the plant in a however the species was never published (W0020241). Luer (1976) described the same species as Pleurothallis condylata based on a plant collected in western Panama around San Vicente de La Concepcin, Chiriqu at 500 m of elevation. Luer (1976) compared the plant with P. brighamii S. Watson and its allies larger, with yellow sepals and petals and dispersed purple-red dots or speckles. The purple, cuneate lip had the apex folded or decurved, appearing truncate. Luer (2006) also suggested a close relationship with S. areldii (Luer) Pridgeon & M.W.Chase from western Panama, a species with obovate, wider leaves, which we exclude from the S. condylata group because the acuminate sepals and the oblong lip, features that acrisepala (Ames & C. Schweinf.) Pridgeon & M.W. Chase. In general, plant morphology is fairly uniform and it is almost imposible to identify a specimen are quite similar when they are not in bloom i.e: S. acrisepala and S. brighamii (S.Watson) Pridgeon & M.W.Chase]. The separation among species is largely mainly by the caespitose plants to 5.0-8.5 cm tall, with ramicauls enclosed by two tubular sheaths at base, the elliptic, oblong or obovate, coriaceous, conduplicate leaves, narrowing into a short petiole, the racemose the rachis congested appearing fasciculate and the forming like a mass of old bracts and pedicels. The sepals and petals are entire, smooth, acute or obtuse, tailless, frequently speckled, maculate or stained; the lateral sepals are connate at the base, sometimes shallowly so, often forming a synsepal; and the petals widen towards the middle. The lip is oblong, spatulate or pandurate, always mostly purple, arcuate, entire, denticulate or erose, sulcate with a pair of longitudinal,
PAGE 37
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group187parallel, apically convergent keels running up to the apex, basally glandular-trichomate, glutinose from the base towards the apex and between the calli on the median groove, hinged to the column foot. The apex is acute or obtuse but can be often curved downward so appearing retuse or emarginate. The column is arcuate, toothed and erose at apex. The anther and stigma are ventral and the pollinarium is made up by a pair of free, ovoid pollinia ending in a small hook at the base. The plants treated in this study are restricted to the in Costa Rica towards western Panama at elevations between 300-1640 m (mostly between 300-600 m). They are somewhat common and can be found along streams and rivers in warm, humid areas in gallery forest, edges of primary forest or disturbed vegetation Potential pollinators have not been observed. The S. berolinensis Pridgeon et al. (2001) evaluated the phylogenetic position of S. brighamii and S. condylata. In one of the most parsimonious trees of the ITS nrDNA, both species were grouped into a subclade sister to Platystele and Scaphosepalum. The previous subclade is sister to another subclade comprising the species allied to S. lanceola, the type of Specklinia. However, the position of S. brighamii-condylata as sister to Platystele and Scaphosepalum is weakly supported (equally weighted bootstrap percentages < %50) in the ITS nrDNA analysis. Thus, the subclade S. brighamiicondylata is absent in the strict consensus tree from the combined matK/trnL-F/ITS nrDNA data set. In that combined analysis, the type clade of Specklinia is sister to the Scaphosepalum-Platystele clade with 95% support. Although the position of S. brighamiicondylata is not clear in Pridgeon & Chase (2001), they decided to transfer both species and their allies into Specklinia. Luer (2002) considered that Specklinia as proposed by Pridgeon & Chase (2001) is still polyphyletic and suggested retaining the species in Pleurothallis. Later, Luer (2006) proposed to classify S. condylata, along with 24 other species, in Sarcinula plants (similar to many others), elongated peduncles and a fascicle of pedicels forming a extremely congested raceme. The sepals are tailless and variously connate and the petals are acute or obtuse, widened towards the middle and always entire. Some species of Muscarella and Panmorphia also share the fasciculate congested raceme however the sepals and shape of the lip distinguish them from Sarcinula (Luer 2006). Nevertheless, as proposed by Luer (2006), Sarcinula is polyphyletic and certainly includes several species embedded within the type clade of Specklinia, as found by Pupulin et al. (2012). Specklinia barbae (Schltr.) Luer, S. chontalensis (A.H.Heller & A.D.Hawkes) Luer, S. corniculata (Sw.) Steud., S. fulgens (Rchb.f.) Pridgeon & M.W.Chase, S. guanacastensis (Ames & C.Schweinf.) Pridgeon & M.W.Chase and S. psichion (Luer) Luer. The type clade also encompasses: S. lentiginosa (F. Lehm. & S. tribuloides (Sw.) Pridgeon & M.W.Chase and S. endotrachys (Rchb.f.) Pridgeon & M.W.Chase and its allies (Pupulin et al. 2012). The type of Sarcinula, Specklinia acicularis (Ames & C. Schweinf.) Pridgeon & M.W. Chase, has not been yet evaluated phylogenetically, however it is morphologically different from the species allied to S. brighamii-condylata as it has thick, acicular leaves (vs. oblong-elliptic, conduplicate) and the sepals are cellular-glandular, spiculate within (vs. glabrous). The phylogenetic position of S. brighamiicondylata group is still subject of evaluation. Preliminary evidence presented in Bogarn et al. (2013) showed both species in a subclade basal to Specklinia s.s. The Specklinia clade which includes S. lanceola and its allies, S. absurda Bogarn, Karremans & R.Rincn, S. fuegii (Rchb.f.) Solano & Soto Arenas, [=Sylphia fuegii (Rchb.f.) Luer], S. grobyi (Bateman ex Lindl.) F. Barros, S. picta (Lindl.) Pridgeon & M.W. Chase and S. costaricensis (Rolfe) Pridgeon & M.W. Chase is again sister to the ScaphosepalumPlatystele clade (Bogarn et al. 2013, Pupulin et al. 2012, Pridgeon et al. 2001). Species closely allied to the S. condylata group include at least: Specklinia acrisepala, S. alexii (A.H. Heller) Pridgeon & M.W. Chase, S. areldii, S. brighamii, S. calderae (Luer) Luer, S. scolopax (Luer & R. Escobar) Pridgeon & M.W. Chase and S. simmleriana (Rendle) Luer.
PAGE 38
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.188 LANKESTERIANA A solid taxonomic basis is critical for phylogenetic evaluations. This paper is part of a series of contributions on the taxonomy of discrete groups of taxa within Specklinia s.l., and other allied genera, intended for a better understanding of species diversity within clades and future phylogenetic evaluations. Here, we clarify the taxonomy of the S. condylata group. Fieldwork activities in Costa Rica and Panama led to the discovery of three new species allied to S. condylata that are here described and illustrated. Additional data related to S. vierlingii Baumbach are provided and discussed. Data on distribution, habitat and ecology, etymology, phenology and variation among populations are given for each species. A key to the species and a comparative table is given to aid Materials and Methods. This study was performed at Jardn Botnico Lankester (JBL) and the Herbario UCH of the Universidad Autnoma de Chiriqu, Panam. Sketches and images were prepared from living specimens with a Leica MZ 9.5 stereomicroscope with drawing tube, Nikon D5100 digital camera with a AF-S VR Micro-NIKKOR 105mm f/2.8G IFED lens and Epson Perfection Photo Scanner V600. Composite plates were diagrammed as consistently as possible to facilitate species comparison by using Adobe Photoshop. Ink drawings were prepared in smooth Fabriano paper of 240 g/m2 with a Rotring Rapidograph 0.1mm using black capillary cartridges and traced in Artograph LightPad A920. Specimens at JBL (from living and spirit collections), and dried and spirit material available at CR, INB, JBL, L, UCH and USJ were reviewed. The new species were illustrated from living specimens. Phenological data were recorded the Holdridge Life Zone System (Holdridge 1987) and the Mapa Ecolgico de Costa Rica by Bolaos et al. (2005). The map and georeferences for specimens were obtained by using a Garmin eTrex Vista GPS, Google Earth 6.1.0 and the EP IDEND R A (www.epidendra.org) database. The identity of S. condylata was studied by interpreting electronic images of the holotype of S. condylata available at SEL and EP IDEND R A together with the protologue (Luer 1976). A visit to the type locality of the type specimen with living material and to assess its natural variation. The plants gathered were documented by pictures and ink drawings following the procedures already described and deposited at UCH. Taxonomic treatment Specklinia acoana Bogarn, sp. nov. near Villa Argentina, ca. 9N 83W, en cultivo en el vivero de orqudeas de Gerson Villalobos en San Miguel de Santo Domino de Heredia, 27 octubre 2011, D. Bogarn 9352 (holotype, JBL). Figs. 1, 2 A 2 B 3, 4 A stains and blotches on the sepals and petals; the spatulate, minutely denticulate lip, less than 5 mm long; and the connate sepals to 5 mm forming a concave synsepal to 12.0 x 7.0 mm distinguish S. acoana from its close allies. Epiphytic, caespitose herb, up to 8.5 cm tall. Roots Ramicauls slender, erect, 5-6 mm long, enclosed by 2 tubular sheaths up to 1 cm long. Leaves narrowly elliptic to obovate thick, coriaceous, acute, conduplicate, emarginate, with a short apiculus, 2.7-7.5 0.8-1.2 cm, cuneate, the base narrowing into an indistinct petiole less than 1 cm long. racemose, distichous, glabrous, patent, erect or suberect, successively singlecongested, appearing fasciculate, shorter than the leaves, up to 3.7 cm long, peduncle up to 3.3 cm long, rachis up to 0.4 cm long. Floral bracts ovate, acute, conduplicate, membranaceous, tubular, imbricating, up to 3 mm long. Pedicel 5 mm long, persistent. Ovary to 2 mm long, glabrous, green. Flowers the sepals and petals whitish-yellowish with purple-red stains, the lip purple, the column greenish with purple stains, anther cap reddish. Dorsal sepal ovate-elliptic, acute, entire, concave, 3-veined, dorsally keeled, connate to the lateral sepals for about 2 mm, 11 5 mm. Lateral sepals oblong, acute, connate for 5 mm, forming a mentum at base, 3-veined, dorsally keeled, 12 7 mm. Petals oblique, ovate-lanceolate, cuneate, acute, 3-veined, 4.1 2.6 mm. Lip spatulate, obovate, basally unguiculate,
PAGE 39
FIGURE 1. Specklinia acoana E Column. F Pollinarium and anther cap. Drawn from the holotype by D. Bogarn and D. Solano.LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group189
PAGE 40
FIGURE 2. Flower morphology of: A. Specklinia acoana (D. Bogarn 9352). B. Specklinia acoana (JBL-11957). C. Specklinia berolinensis (F. Pupulin 2325). D. Specklinia berolinensis (A. Karremans 5807). E. Specklinia condylata (D. Bogarn 10364). F. Specklinia condylata (D. Bogarn 7855). G. Specklinia icterina (D. Bogarn 8767). H. Specklinia vierlingii (F. Pupulin 2894 ). I. Specklinia vierlingii (D. Bogarn 7350).with a pair of small lobules at the middle, adnate to the column foot, slightly erose, arcuate, obtuse, with two longitudinal, parallel, apically convergent keels running up to the apex, sulcate, basally glutinose from the base towards the apex between the calli, 5.0 2.2 mm, the apex obtuse but often curved downward so appearing retuse. Column cylindric, footed, to 5.2 mm long, erose, the anther and stigma ventral, greenish stained with purple. Pollinia two, ovoid, without viscidium, ending in a hook. Anther cap cucullate, white, stained with purple. DISTRIBUTION Rica (Fig. 3). HABITAT AND ECOLOGY : epiphytic in tropical moist forest, tropical moist forest premontane belt transition in secondary and primary vegetation at around 500800 m of elevation. LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.190 LANKESTERIANA
PAGE 41
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group191 ETYMOLOGY : named after Asociacin Costarricense de Orquideologa (A.C.O) founded in 1970 by a group Roy Lent and Margarita de Lent among others with the support of the Latin-American Committee of Orchidology and Helena Baraya de Ospina, former President of the Sociedad Colombiana de Orquideologa. A.C.Os efforts through Rafael Lucas Charles H. Lankester at El Silvestre that was later transferred to the University of Costa Rica on March 2, 1973. PHENOLOGY from October to November. stains and blotches on the sepals and petals; the spatulate, minutely denticulate lip, 5 mm long; and the sepals connate to 5 mm forming a concave synsepal to 12.0 x 7.0 mm distinguish S. acoana from other members of the group. It is most similar to S. condylata with dispersed speckles on the sepals and petals (vs. whitish with blotches and stains) and the lip is longer, >7.5 mm long and wider > 3.0 mm (vs. ~5.0 mm long, <2.2 mm wide), pandurate (vs. spatulate to oblong) and the callus is made up by two prominent whitishyellowish cushions at the middle (vs. two purple low keels) (Fig. 4 A ). For a detailed comparison among its allies see Table 1. ADDITIONAL MATERIAL EXAMINED : Costa Rica. San Jos: Lankester by D. Jimnez s.n., June 26, 2012 (JBLJardn Botnico Lankester, Universidad de Costa Rica, October 31, 2009, JBL-11957 (JBL-spirit) (Fig. 2 B ). Specklinia berolinensis Bogarn, sp. nov. Ramn Norte, trail to the summit of Cerro Peln, 1420-1640 m, secondary mature and primary lower montane moist forest, 3 May 2000, F. Pupulin 2325, FIGURE 3. Geographic distribution of Specklinia acoana Specklinia berolinensis and Specklinia icterina .
PAGE 42
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.192 LANKESTERIANA Character S. acoana S. berolinensis S. condylata S. icterina S. vierlingii Ovary green spotted with red spotted with red green spotted with red Dorsal sepal ovate-elliptic, 11 x 5 mm ovate, 8.0 x 4.5 mm oblong-elliptic, 12.0-16.0 x 3.36.0 mm ovate, 13.5 x 4.5 mm oblong, 12.0-14.0 x 5.0-5.5 mm Lateral sepals 12 x 7 mm, oblong, connate to 5 mm oblong, 9.4 x 6.3 mm, connate 1.5 mm oblong-ovate, 12-17 x 4-8 mm, connate 5-9 mm or sometimes almost free ovate, 14.5 x 8.5 mm, connate to 5 mm oblong-ovate, 12-14 x 6-7 mm, connate to 6.5 mm Petals ovate-lanceolate, 4.1 x 2.6 mm oblong-obovate, 3.5 x 1.7 mm obovate-lanceolate, 4.5-5.0 x 2.0-3.0 mm obovate, 4.5 x 2.0 mm narrowly oblong, 4.0-5.0 x 1.01.5 mm Lip spatulate to oblong, minutely denticulate, 5.0 x 2.2 mm spatulate, entire, 4.5-5.0 x 1.7-2.0 mm pandurate, denticulate, 7.5-8.0 x 3.0-3.5 cm oblong, minutely denticulate, 5.0 x 2.5 mm pandurate, erose, 8.0-10.0 x 3.5-4.0 mm Lip apex often with the apex folded the apex never folding often with the apex folded often with the apex folded rarely with the apex folded Lip color purple purple purple basally yellowish, apically purple purple Column greenish-yellowish, maculate, 5.2 mm greenish-yellowish, 6.0 mm greenish-yellowish, 9 mm greenish, immaculate 5.4 mm greenish-yellowish, 12 mm Flower color whitish with dispersed blotches and stains along sepals and petals yellowish with blotches and stains along the veins of sepals and petals yellowish with many dispersed red-purple speckles along sepals and petals yellow, immaculate yellowish-cream with purple speckles and blotches and sometimes with the veins purple Habitat Elevation (m) 500-800 1420 to 1640 200 to 600 see Habitat and ecology for S. condylata 500 to 920 300 to 650 Life Zone tropical moist forest, tropical moist forest premontane belt transition premontane wet forest tropical wet forest premontane wet forest, rain forest transition and tropical wet forest premontane belt transition tropical wet forest, tropical moist forest premontane belt transition and tropical moist forest TABLE 1. Comparison of the main differences among the species of S. condylata group.
PAGE 43
L. Spadari, J. Cambronero, V. Jurez-Prez & K. Granado (holotype, JBL). Figs. 2 C 2 D 3, 4 B 5. Specklinia berolinensis is distinguished by the stripes along the veins of the sepals and petals, the smaller sepals < 3.5 mm long, the dorsal sepal < 8 mm long and lateral sepals < 9.5 mm long, the lateral sepals almost free and not developing an evident synsepal and the entire lip with rounded apex, never folding or curved down apically. Epiphytic, caespitose, pendent or suberect herb, in diameter. Ramicauls slender, erect, terete, to 7 mm long, enclosed by 2 tubular sheaths up to 1 cm long. Leaves narrowly obovate thick, coriaceous, acute, conduplicate, emarginate, with a short apiculus, 3.58.0 0.6-0.9 cm, cuneate, the base narrowing into a indistinct petiole less than 4 mm long. racemose, distichous, glabrous, patent or creeping peduncle bracts tubular to 3 mm long, the rachis congested appearing fasciculate, up to 6.5 cm long, peduncle 3-4 cm long, rachis up to 1.5 cm long. Floral bracts tubular, apiculate, conduplicate, membranaceous, imbricating, up to 4 mm long. Pedicel 5 mm long, persistent. Ovary to 2 mm long, glabrous, green spotted with red. Flowers hyaline, whitish or greenish, the sepals stained with purple red along the veins with few dispersed purple dots in between, the dorsal sepal adaxially striped with purple, the petals yellowish with purple stripes and purple apex, the lip purple, the column greenish-yellow with purple red stripes along the margin. Dorsal sepal ovate, acute, connate to the lateral sepals for about 1.5 mm, 8.0 4.5 mm. Lateral sepals oblong, acute, connate for 1.5 mm, forming a mentum at base, 3-veined, dorsally keeled, 9.4 6.3 mm. Petals oblique, oblong-obovate, cuneate, acute, 3-veined, 3.5 1.7 mm. Lip spatulate, oblong-obovate, basally unguiculate, with a pair of small lobules at the middle, adnate to the column foot, entire, arcuate, rounded, with two longitudinal, parallel, apically convergent keels running up to the apex, sulcate, basally glutinose from the base towards the apex between the keels, 4.5-5.0 1.7-2.0 mm. Column cylindrical, footed, to 6 mm long, with a pair of apical arms, erose, the anther and the stigma ventral, greenish stained with purple. Pollinia two, ovoid, without viscidium, ending in a hook. Anther cap cucullate, white, stained with purple. DISTRIBUTION : restricted to the type locality at Berln de areas of Fila Temblor, Fila Zapotales, Cerro Peln and FIGURE 4. Comparison of lips (front view): A. Specklinia acoana (D. Bogarn 9352). B. Specklinia berolinensis (F. Pupulin 2325). C. Specklinia icterina (D. Bogarn 8767). D. Specklinia condylata (D. Bogarn 10364). E. Specklinia condylata (D. Bogarn 7855). F. Specklinia vierlingii (F. Pupulin 2894 ). Scale bar = 5 mm.LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group193
PAGE 44
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.194 LANKESTERIANA FIGURE 5. Specklinia berolinensis E Column. F Pollinarium and anther cap. Drawn from the holotype by D. Bogarn and D. Solano.
PAGE 45
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group195the hea of Cordillera de Talamanca in Costa Rica. (Fig. 3). HABITAT AND ECOLOGY : epiphytic in premontane wet forest along the edge of primary forest in trunks with mosses from 1420 to 1640 m of elevation. ETYMOLOGY Zeledn, San Jos where this species is restricted. PHENOLOGY from August to November. Compared to its allies, S. berolinensis is blotches, stains and stripes along the veins of the sepals and petals (vs. dispersed speckles or blotches); the smaller sepals < 3.5 mm long (vs. > 4 mm) (see Table 1); the dorsal sepal < 8 mm long (vs. > 11 mm) and lateral sepals < 9.5 mm long (vs. > 12 mm); the lateral sepals almost free (connate for about 1.5 mm) and not developing an evident synsepal (vs. connate > 5 mm, developing an evident synsepal) and the entire lip, with rounded apex, never folding or curved down apically (vs. denticulate or erose, acute or obtuse and folding sometimes they are creeping down, prostrate on the Specklinia berolinensis is found at higher elevations (between 1420 to 1640 m) in comparison to its allies that have been recorded from lower elevations (< 920 m, mainly between 300-600 m). Specklinia berolinensis and S. condylata are quite stains along the veins of sepals and petals (vs. yellowish with many dispersed red-purple speckles along sepals and petals), the spatulate, entire, shorter lip to 4.5-5.0 1.7-2.0 mm (vs. pandurate, denticulate, larger to 7.5-8.0 3.0-3.5 cm) which never folds apically (vs. folding apically) and without two prominent cushions at the middle (vs. with prominent whitish-yellowish cushions at the middle). Flowers of S. berolinensis produce a strong carrion-like smell in the afternoon and evening similar to that of S. vierlingii but no smell has been perceived for S. condylata. Plants of both species are vegetatively similar but S. berolinensis has narrower leaves < 0.9 cm long whereas S. condylata has wider leaves > 0.9 cm long and up to 1.2 cm. Here, we accept S. condylata as a species ranging from the lip apex and coloration (see Table 1 and discussion of S. condylata). However this variation does not overlap with the features observed in S. berolinensis. The color S. berolinensis are consistent among the populations studied. Those features were not observed in the variation range of any of the populations of S. condylata. ADDITIONAL MATERIAL EXAMINED : Costa Rica. San Jos: of Cerro Peln, 1420-1640 m, secondary mature and primary lower montane moist forest, 3 May 2000, F. Pupulin 2326, L. Spadari, J. Cambronero, V. JurezPrez & K. Granado Zeledn, Berln, A. Quesada-Chanto s.n. (JBLTemblor, ca. 2 km al noroeste de Berln, 9.22N 83.97W, 1429 m, bosque pluvial premontano, A.Karremans 5807 & D. Bogarn (JBL-spirit) (Fig. 2D). Specklinia condylata (Luer) Pridgeon & M.W. Chase, Lindleyana 16(4): 257. 2001. Pleurothallis condylata Luer, Selbyana 3(1-2): 80-81, f. 143. 1976. Sarcinula condylata (Luer) Luer, Monogr. Syst. Bot. Missouri Bot. Gard 105: 208. 2006. TYPE: Panama. Chiriqui: epiphytic in trees along the stream near San Vicente, alt. 500 m., between Concepcin and Volcn, 11 Sept 1976, C. Luer & H. Butcher 1198 (holotype, SEL). Figs. 2 E 2 F 4 D 4 E 6, 7, 8, 9, 10. Epiphytic, caespitose, pendent or suberect, herb, up to 8 cm tall. Roots mm in diameter. Ramicauls slender, erect, 5-8 mm long, enclosed by 2 tubular sheaths up to 1 cm long. Leaves narrowly obovate, thick, coriaceous, acute, conduplicate, emarginate, with a short apiculus, 3.58.0 0.9-1.2 cm, cuneate, the base narrowing into a indistinct petiole less than 4 mm long. racemose, distichous, glabrous, pendent or suberect, bracts tubular to 3 mm long, the rachis congested, appearing fasciculate, 3.5-6.0 cm long, peduncle 3.5-
PAGE 46
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.196 LANKESTERIANA FIGURE 6. Specklinia condylata lip, side view. E Column. F. Pollinarium and anther cap. Drawn by D. Bogarn and D. Solano based on D. Bogarn et al. 10364 (UCH).
PAGE 47
FIGURE 7. Specklinia condylata and lip, side view. E Column. F Pollinarium and anther cap. Drawn by D. Bogarn and D. Solano based on D. Bogarn 7859 (JBL-spirit). LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group197
PAGE 48
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.198 LANKESTERIANA FIGURE Specklinia condylata: A. (D. Bogarn 7855, Costa Rica). B. (M. Fernndez 173, Costa Rica). C. (M. Fernndez 171, Costa Rica). D. (D. Bogarn 7859, Costa Rica). E. (Z. Samudio s.n., Panam). F. (D. Bogarn 10364, Panam). G. (D. Bogarn 7855, Costa Rica). H. (D. Bogarn 7859, Costa Rica). I. (M. Fernndez 168, Costa Rica).6.0 cm long, rachis up to 1 cm long. Floral bracts tubular, apiculate, conduplicate, membranaceous, imbricating, up to 2-4 mm long. Pedicel 4-7 mm long, persistent. Ovary to 3 mm long, glabrous, green or with purple spots. Flowers showy, hyaline, yellowish, sepals and petals densely speckled with purple-brown, the lip purple red, the column greenish stained with maroon. Dorsal sepal oblong-elliptic, acute, entire, to the lateral sepals for about 2 mm, 12.0-16.0 3.3-6.0 mm. Lateral sepals oblong-ovate, acute, connate for 5-9 mm, forming a mentum at base, 3-veined, dorsally keeled, 12-17 4-8 mm. Petals oblique, obovatelanceolate, cuneate, acute, 3-veined, 4.5-5.0 2.03.0 mm. Lip spatulate, obovate, basally unguiculate, with a pair of small lobules at the middle, adnate to obtuse, with two longitudinal, parallel, apically
PAGE 49
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group199convergent keels running up to the apex, forming two prominent cushions (whitish-yellowish) at the middle, sulcate, basally glutinose from the base towards the apex between the calli, 7.5-8.0 3.0-3.5 cm, the apex often curved downward so appearing retuse. Column cylindrical, footed, to 9 mm long, with a pair of apical arms, erose, the anther and stigma ventral, greenish stained with purple. Pollinia two, ovoid, without viscidium, ending in a hook. Anther cap cucullate, white, stained with purple. DISTRIBUTION Rica and Panama. HABITAT AND EC OLOGY : epiphytic in tropical wet forest on trees along streams and rivers, gallery forests and coast from central Costa Rica towards western Panama, from 200 to 600 m of elevation Luer (2006) cited two records of S. condylata from cultivated plants obtained from L. Acosta allegedly from 1500 and 1800 m (one in a quite odd location above San Cristbal where no herbaria). The other comes from above San Vito the type locality of S. icterina however it was not possible to check both specimens at MO. Although those records seem to considerably extend the elevation range of S. condylata, no other records of this species are known from 600 to 1800 m. It seems that the locality given in the specimens of L. Acosta are erroneous or may correspond to a different species. Plants were observed growing on Zygia longifolia (Fabaceae) in Panama. ETYMOLOGY : from the Latin condylatus, with knuckles, or knuckled and Greek kondylos knuckle, specimen. PHENOLOGY from April to November. Luer (1976) described this species from a collection in western Panama. He stated that the species is vegetatively similar to P. brighamii and its golden sepals and petals which are diffusely dotted with brownish-purple. The lip is deep purple, broadly FIGURE 9. Geographic distribution of Specklinia condylata and Specklinia vierlingii .
PAGE 50
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.200 LANKESTERIANA in a gauntlet (Luer 2003). Luer (2006) also suggested a close relationship with S. areldii (Luer) Pridgeon & M.W.Chase (see introduction). Augustus R. Endrs collected and illustrated the however it was never published (W-0020241) (Fig. 10). Specklinia condylata is easily distinguished by the yellowish sepals densely speckled with purplebrown, and the pandurate lip, deep purple or reddish with yellowish calli at the middle. It is most similar to S. vierlingii however the latter species has yellowishsometimes with the veins purple (vs. yellowish, densely speckled with purple-brown) and the petals are narrowly oblong, < 1.5 mm wide (vs. obovatelanceolate, > 2 mm wide). Specklinia acoana is also purple stains and the lip is shorter, < 5 mm long (rather condylata and S. vierlingii. Both species present a larger lip (> 7.5 mm long, > 3.0 mm wide) when compared to their allies (vs. < 5.0 mm long, < 2.5 mm wide). Other differences among its closest relatives are Plants gathered from the type locality in Panama show variation in the lip apex and coloration (Figs. 8 E 8 F reddish with yellowish calli (Fig. 4 D 4 E ). However, the characters cited by Luer (1976) in the protologue were also observed in the plants studied from the type locality. In Costa Rica, this species is also variable in the colour with purple-brown and red to purple lip (Fig. 8). The lateral sepals are connate for 9 mm but sometimes they are almost free, connate to 5 mm (A.R. Endrs 267, W; H 8 E 8 C 10). FIGURE 10. Drawing of Specklinia condylata by A.R. Endrs (W-0020241). Reproduced with the kind permission of the Herbarium, Naturhistorisches Museum, Wien.
PAGE 51
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group201 ADDITIONAL MATE R IAL EXAMINED : Costa Rica. San Jos: Puriscal, Chires, Santa Rosa, Parque Nacional La Cangreja, orillas del Ro Negro y Quebrada La Cangreja, 9.5 N 84.9 W, 383 m, bosque 2010, D. Bogarn 7859, R.L. Dressler, M. Fernndez & C. Smith (JBL) (Figs. 7, 8H). Same locality, D. Bogarn 7855 (JBL-spirit) (Fig. 8A, 8G), M. Fernndez 168 (Fig. 8I), M. Fernndez 171 (Fig. 8C), M. Fernndez 173 (JBL-spirit) (Fig. 8B) and M. Fernndez 175 Dec, A.R. Endrs 267 (W) (Fig. 10). Puntarenas: Osa, y Baneguitas, cuenca superior de Quebrada Banegas, bajando hasta la Quebrada Digo digo, 8N 83W, 350 m, 13 enero 1991, G. Herrera 4818 (INB). Osa, Sierpe, San Juan, cuenca superior de Ro enero 1991, G. Herrera 4871 (INB). Panama. Chiriqu: Bugaba, La Estrella, orillas del ro Escrrea, cerca de San Vicente, 8.96N 82.4W, 253 m, Zygia longifolia, 25 julio 2013, D. Bogarn 10364, Z. Samudio & Z. Serracn (UCH) (Fig. 6, 8F). Same locality, Z. Samudio s.n., D. Bogarn & Z. Serracn (UCH) (Fig. 8E). Chiriqu: sin ms datos, obtenida de Finca Drcula, cultivada por Gerson Villalobos en Santo Domingo de Heredia, Costa Rica, 23 enero 2012, D. Bogarn 9452 (JBL-spirit). Specklinia icterina Bogarn, sp. nov. TYPE: Costa Rica. Puntarenas: Coto Brus, Limoncito, Jabillo, orillas del Ro Cotn, ca. 500 m, invenit Orquidario Happy Garden, 20 abril 2011, D. Bogarn 8767 (holotype, JBL; isotype CR). Figs. 2 G 3, 4 C 11. Specklinia icterina is readily distinguished by the immaculate yellow, ovate, acute sepals and petals, the oblong lip with the apex obtuse but often curved downward so appearing retuse or emarginate, basally yellowish with purple from the middle towards the apex, the green immaculate ovary and column and the white anther cap. Epiphytic, caespitose herb, up to 7.5 cm tall. Roots Ramicauls slender, erect, 5-6 mm long, enclosed by 2 tubular sheaths up to 1 cm long. Leaves narrowly elliptic to obovate thick, coriaceous, acute, conduplicate, emarginate, with a short apiculus, 6.0-7.0 1.0-0.8 cm, cuneate, the base narrowing into a indistinct petiole less than 1 cm long. racemose, distichous, glabrous, patent, erect or suberect, successively singlerachis congested, appearing fasciculate, up to 7.5 cm long, usually longer than the leaves, peduncle up to 5.7 cm long, rachis up to 1.8 cm long. Floral bracts ovate, acute, conduplicate, membranaceous, tubular, imbricating, up to 5 mm long. Pedicels to 1 cm long, persistent. Ovary to 2 mm long, glabrous, green. Flowers the sepals and petals yellow, immaculate, the lip yellowish-cream basally, purple red apically, with the callus yellowish, the column green, the anther cap white. Dorsal sepal ovate, acute, entire, concave, 3-veined, dorsally keeled, connate to the lateral sepals for about 1.5 mm, 13.5 4.5 mm. Lateral sepals ovate, acute, connate for 5 mm, forming a mentum at base, 3-veined, dorsally keeled, 14.5 8.5 mm. Petals oblique, obovate, cuneate, acute, 3-veined, 4.5 2.0 mm. Lip oblong, basally unguiculate, adnate to the column foot, minutely denticulate, arcuate, obtuse, with two longitudinal, parallel, apically convergent keels running up to the apex, sulcate, basally glutinose from the base towards the apex between the calli, 5.0 2.5 mm, the apex obtuse but often curved downward so appearing retuse or emarginate. Column cylindrical, footed, to 5.4 mm long, erose, arcuate, the anther and stigma ventral, greenish stained with purple. Pollinia two, ovoid, without viscidium, ending in a hook. Anther cap cucullate, white. DISTRIBUTION in Costa Rica. It is likely found in Panama as one of the localities is about 3 km far away from the frontier. (Fig. 3). HABITAT AND ECOLOGY : plants were found growing epiphytically in premontane wet forest, rain forest transition and tropical wet forest premontane belt transition in secondary and primary vegetation, from 500 to 920 m of elevation. ETYMOLOGY : from the Latin icterinus or ictericus and from the Greek jaundice or
PAGE 52
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.202 LANKESTERIANA FIGURE 11. Specklinia icterina E Column. F. Pollinarium and anther cap. Drawn from the holotype by D. Bogarn and D. Solano.
PAGE 53
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group203 PHENOLOGY from May to October. Specklinia icterina is restricted to the premontane forest of San Vito, Sabalito and neighbouring areas in with Panama. The plant is vegetatively similar to its allies however the species is readily distinguished by the immaculate yellow, ovate, acute sepals and petals; the oblong lip basally yellowish and purple from the middle towards the apex; the green immaculate ovary and column; and the white anther cap (Figs. 2 G 11). Frequently the lip apex is curved or folded apically so appearing retuse (Fig. 4 C ). It also happens in S. acoana and S. condylata, its close relatives. However, those species have purple or red brown maculate, speckled sepals, petals and column. From S. condylata, it also differs in the oblong, shorter lip up to 5 mm long, tinged basally with yellow (vs. pandurate, 7.5-8.0 mm long, purple). Other differences among its closest ADDITIONAL MATERIAL EXAMINED : Costa Rica. N 82 W, 923 m, F. Oviedo-Brenes 2537 (HLDG). Coto Brus, San Vito, sin ms datos, cultivada por Gerson Villalobos en Santo Domingo de Heredia, Costa Rica, 23 enero 2012, D. Bogarn 9453 (JBLspirit). Specklinia vierlingii Baumbach, Orchideen (Hamburg) 63(5): 405. 2012. TYPE: Costa Rica. s.l.; ex cult. hort. Gerhard Vierling; leg. Norbert Baumbach et Jurgen Roth, 7 August 2012 (holotype, HAL). Figs. 2 H 2 I 9, 12. Epiphytic, caespitose, pendent or suberect, herb, up to 6.5 cm tall. Roots in diameter. Ramicauls slender, erect, terete, to 5 mm long, enclosed by 2 tubular sheaths up to 1 cm long. Leaves narrowly obovate, thick, coriaceous, acute, conduplicate, emarginate, with a short apiculus, 2.56.5 0.6-1.0 cm, cuneate, the base narrowing into a indistinct petiole less than 4 mm long. racemose, distichous, glabrous, pendent or suberect, long, the rachis congested appearing fasciculate, up to 6 cm long, peduncle 4.2-5.2 cm long, rachis up to 1.1 cm long. Floral bracts tubular, apiculate, conduplicate, membranaceous, imbricating, up to 4 mm long. Pedicels 6 mm long, persistent. Ovary to 3 mm long, glabrous, green spotted with red. Flowers showy, yellowish, the sepals stained or speckled with purple red from the centre towards the apex, the dorsal sepal adaxially striped with purple, the petals yellow with red purple stripes and purple apex, the lip purple red, the column greenish-yellow with purple red stripes. Dorsal sepal slightly arcuate, 3-veined, dorsally keeled, connate to the lateral sepals for about 2 mm, 12.0-14.0 5.0-5.5 mm. Lateral sepals oblong-ovate, acute, connate for 6.5 mm into a ovate, acute, basally concave, entire, dorsally keeled, 12-14 6-7 mm. Petals narrowly oblong, acute, 4.0-5.0 1.0-1.5 mm, subfalcate, Lip spatulate, obovate, basally unguiculate, with a pair of small lobules at the middle, adnate to the column foot, erose or parallel, apically convergent keels running up to the apex, sulcate, basally papillose and glutinose from the base towards the apex between the calli, with the apex rarely folded, 8.0-10.0 3.5-4.0 mm. Column cylindrical, footed, to 1.2 cm long, with a pair of apical arms, erose, the anther and stigma ventral, with purple dots and stripes along the margin. Pollinia two, ovoid, without a viscidium, ending in a hook. Anther cap cucullate, white, stained with purple. DISTRIBUTION : only known from central and southern HABITAT AND ECOLOGY : epiphytic in tropical wet forest, tropical moist forest premontane belt transition and tropical moist forest in secondary and primary forest along humid patches of forest and river banks in the Fila Costea in Costa Rica between 300 to 650 m of elevation. EPONYMY : named after Gerhard Vierling, who cultivates this species in Germany. PHENOLOGY from May to November.
PAGE 54
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.204 LANKESTERIANA FIGURE 12. Specklinia vierlingii E Column. F Pollinarium and anther cap. Drawn by D. Bogarn and D. Solano based on F. Pupulin 2894 (JBL-spirit).
PAGE 55
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. BOGARN et al The Specklinia condylata Group205 This species was published by Baumbach (2012) based on a plant collected in Costa Rica and imported to Germany. According to the protologue, the plant comes from the Botanischer Garten Heidelberg and has been in culture by Gerhard Vierling. The holotype was deposited outside of the country of origin (HAL). During the preparation of this research, this species was well known by the authors for several localities in sometimes with purple veins. The most important oblong petals to 4.0-5.0 1.0-1.5 mm, unique among its relatives. Baumbach (2012) differentiated S. vierlingii from S. condylata S. condylata and S. vierlingii in both species (see the discussion of S. condylata and Table 1) (Fig. 4 D -4 F ). The illustration provided in the protologue by Baumbach (2012) is confusing and it mixes features of S. condylata. At least, he copied exactly the plant habit from the original drawing of P. condylata by Luer (1976). The drawing shows the same four for P. condylata. lateral view of the column and lip were also copied and they do not represent its real morphology. The drawing by Baumbach (2012) does not agree with the morphology of S. vierlingii as it was exactly copied from the drawing of the type of S. condylata (Luer 1976). This species was intended to be published in this paper therefore, we provide the data we had prepared for its description such as full locality data, distribution map, illustrations and pictures of several individuals, a composite plate based on a living plant and a comparison among its closest relatives (Table ation of this species. ADDITIONAL MATE R IAL EXAMINED : Costa Rica. San along the boarder of Ro Divisin, 320 m, 9N 83W, epiphytic on tall trees along the river shore, 21 January 2001, F. Pupulin 2823, D. Castelfranco & L. Elizondo (JBL-spirit). Same locality, F. Pupulin et al 2894 (JBL-spirit) (Fig. 2H, the Quebrada del Camarn, about 450 m, 9N 83W, epiphytic in disturbed primary forest, wet premontane forest, 20 January 2001, F. Pupulin 2817, D. Castelfranco & L. Elizondo (JBL-spirit). Same locality, F. Pupulin et al 2816 (JBL-spirit). San Isidro de General, barrio El Hoyn, mrgenes del Ro la familia Valverde Arias, Desamparados, San Jos, R. Valverde 160 Peas Blancas, orillas del Ro Caliente, 9.0 N 83.6 W, 629 m, bosque hmedo tropical, transicin a premontano, en bosque secundario remanente a orillas del ro, 28 julio 2009, D. Bogarn 7350, J. Cambronero & F. Pupulin (JBL-spirit) (Fig. Finca de Neftal Cordero, Fila el Zoncho, 9.0 N 83.7 W, 900 m, 11 mayo 1999, A. Estrada 2185 (CR). Turrubares, Parque Nacional Carara, Valle del Trcoles, Estacin Bijagual, 9 N 84 W, 600 m, 26 julio 1995, M. M. Chavarra 895 (INB-spirit). KEY TO THE SPECIES OF SPECKLINIA CONDYLATA GROUP 1. Sepals and petals yellow, immaculate; base of the lip yellowish S. icterina 1. Sepals and petals maculate, stained or speckled; base of the lip purple 2 2. Lip > 7.5 mm long, > 3.0 mm wide, column > 9 mm in length 3 2. Lip < 5.0 mm long, < 2.5 mm wide, column < 6.5 mm in length 4 3. Petals narrowly oblong, < 1.5 mm wide S. vierlingii 3. Petals obovate-lanceolate, > 2 mm wide S. condylata 4. Flowers whitish with stains and blotches dispersed on the sepals, sepals connate to 5 mm, 12.0 x 7.0 mm S. acoana 4. Flowers yellowish with stains and blotches along the veins of the sepals, sepals connate to 1.5 mm, 9.4 x 6.3 mm S. berolinensis
PAGE 56
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.206 LANKESTERIANA ACKNO W LEDGMENTS del Ambiente, Energa (MINAE) and Sistema Nacional de reas de Conservacin (SINAC) of Costa Rica and Autoridad Nacional del Ambiente (ANAM) of Panama specimens were managed. We are indebted to Clotilde Arrocha, Ivonne Oviedo, Franco Pupulin, Rafael Rincn and Jorge Warner for their continuous support on the study Oviedo-Brenes (HLDG), Jeremy Quesada and Gerson anonymous reviewers greatly improved the manuscript. This research was enabled by the Project 814-B2-161 JBL and Herbario UCH, supported by the Vice-Presidency of Research, Universidad de Costa Rica and Universidad Autnoma de Chiriqu and Flora Costaricensis: Taxonoma y Filogenia de la subtribu Pleurothallidinae (Orchidaceae) en Costa Rica (814-BO-052). LITERATURE CITED Baumbach, N. 2012. Eine neue Specklinia -Art a us Costa Rica. Orchideen (Hamburg) 63(5): 404. Bogarn, D., A.P. Karremans, R. Rincn & B. Gravendeel. 2013. A new Specklinia (Orchidaceae: Pleurothallidinae) from Costa Rica and Panama. Phytotaxa 115(2): 31-41. Bolaos, R., V. Watson & J. Tosi. 2005. Mapa ecolgico de Costa Rica (Zonas de Vida), segn el sistema de San Jos, Costa Rica, 1 p. Garay, L.A. 1974. Acostaea y los gneros del complejo Pleurothallis Orquideologa 9: 103-124. Garay, L.A. & H.R. Sweet. 1972. Notes on West Indian orchids. J. Arnold Arbor. 53: 515. reimpresin. Instituto Interamericano de Cooperacin para la Agricultura (IICA), San Jos, Costa Rica, 216 pp. Lindley, J. 1830. The genera and species of orchidaceous plants 8. Asher, London. xvii, 554 pp. Lindley, J. 1859. Folia Orchidacea, an enumeration of the known species of Orchids, 43: Pleurothallis part 2. 1. Luer C.A. 1976. Miscellaneous species of Pleurothallis Selbyana 3(1-2): 38-201. Luer, C.A. 1986. Systematics of Pleurothallis (Orchidaceae). Icones Pleurothallidinarum III. Monogr. Syst. Bot. Missouri Bot. Gard. 20. of the Pleurothallidinae versus a strictly phylogenetic method. Selbyana 23(1): 5710. Luer, C.A. 2003. Pleurothallis Pp. 386-452 in: B.E. Hammel, M.H, Grayum, C. Herrera & N. Zamora (eds.), Manual de Plantas de Costa Rica. Volumen III: Monocotiledneas (Orchidaceae-Zingiberaceae). Monogr. Syst. Bot. Missouri Bot. Gard. 93. Luer, C.A. 2006. A reconsideration of Masdevallia Systematics of Specklinia and vegetatively similar taxa (Orchidaceae). Icones pleurothallidinarum XXVIII. Monogr. Syst. Bot. Missouri Bot. Gard. 105. Pridgeon, A.M. 2005. 355. Specklinia Pp. 402 in: A. M. Pridgeon, P.J. Cribb, M.W. Chase & F.N. Rasmussen (eds.), Genera orchidacearum Vol. IV. Oxford University Press, Oxford, UK. Pridgeon, A.M. & M.W. Chase. 2001. A phylogenetic Lindleyana 16: 235-271. Pridgeon, A.M., R. Solano & M.W. Chase. 2001. Phylogenetic relationships in Pleurothallidinae (Orchidaceae): combined evidence from nuclear and plastid DNA sequences. Amer. J. Bot. 88: 2286-2308. Pupulin, F., A.P. Karremans & B. Gravendeel. 2012. A reconsideration of the empusellous species of Specklinia (Orchidaceae: Pleurothallidinae) in Costa Rica. Phytotaxa 63: 1-20.
PAGE 57
The genus Cohniella et al. 2013a). The genus is distinguished from others members of the Oncidiinae by the relatively small (<13 mm) and subspherical, 1-leaved pseudobulbs whose sheaths lack foliar and Oncidium et al. 2010); furthermore, anatomical characters such as unifacial leaves and the presence raphides in the epidermis et al. 2013b) also help distinguish the genus. LANKESTERIANA 13(3): 207. 2014. I N V I T E D P A P E R A NEW SPECIES IN THE COHNIELLA ASCENDENS COMPLEX FROM AMAZONIAN VENEZUELA (ORCHIDACEAE, ONCIDIINAE) WILLIAM CETZAL-IX 1,2,5 GERMN CARNEVALI 2,3 & ELIANA NOGUERA-SAVELLI 41El Colegio de la Frontera Sur (ECOSUR), Unidad Chetumal, Av. del Centenario km 5.5, Chetumal 77014, Quintana Roo, Mxico2 43. No. 130. Col. Chuburn de Hidalgo, Mrida 97200, Yucatn, Mxico 3Orchid Herbarium of Oakes Ames, Harvard University Herbaria. 22 Divinity Avenue, Cambridge, Massachusetts 02138. U.S.A.4Francisco de Montejo, Mrida 97203, Yucatn, Mxico5Author for correspondence: rolito22@hotmail.com ABSTRACT. Cohniella amazonica (Orchidaceae, Oncidiinae, Trichocentrum-clade) a species in the Cohniella ascendens on morphological characters. The new taxon is similar to C. nuda, from which it differs in the subquadrateoblong lateral lobes of the labellum that are in the same plane as the central lobe, the 5-partite callus, the bipartite Union for Conservation of Nature) criteria. We provide a key and table of characters to diagnose the Cohniella ascendens species in this group. RESUMEN : Cohniella amazonica (Orchidaceae, Oncidiinae, cladoTrichocentrum), una especie en el complejo Cohniella ascendens morfolgicos. El nuevo taxn es similar a C. nuda, de la cual se distingue por los lbulos laterales del labelo subcuadrado-oblongos que se encuentran en el mismo plano que el lbulo central, el callo 5-partito, las alas caracteres para diagnosticar las especies del complejo Cohniella ascendens KEY WORDS : Cohniella Trichocentrum* This contribution was prepared as part of the special edition of LANKESTERIANA that is dedicated to the commemoration of Lankester Botanical Gardens (JBL) 40th anniversary. Botanical collections of the JBL have been relevant to understand the identity and distribution of Cohniella species in our previous studies, cited in this paper.
PAGE 58
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.208 LANKESTERIANA lobes of the labellum, shape, position, and number of the column base, and shape and position of the column et al. 2013a). Regarding the species leaf, the position, number, and the arrangement of the shape of the platform of the labellum callus, and the shape and presence or absence of the base of the column. Furthermore, species or species complexes can be with discrete patterns of ecological and geographical Cohniella are morphologically, ecologically, and geographically discrete; moreover, they are recovered as monophyletic in morphological and molecular phylogenetic analyses The Cohniella ascendens complex includes C. aguirrei (Kniger) Kniger, C. ascendens (Lindl.) Christenson, C. helicantha Carnevali, C. lacera and C. nuda (Bateman ex Lindl.) Christenson (Table 1). Its species occur in humid to subhumid habitats, from low-statured inundated, semi-evergreen to evergreen forests and, more rarely, in semideciduous forest at elevations of 0-800 meters. Members of the Cohniella ascendens complex share a habit featuring the semipendulous or semi-erect leaves with rarely racemose the length of the leaf, more infrequently exceeding it; furthermore, the sepals are rounded whereas the petals are subquadrate with subtruncate apex; the callus of the labellum presents a hemispherical platform. Species are distributed from northern Tamaulipas and the central portion of Mexico to the northern and northwestern Colombia and the northern Cohniella ascendens and C. nuda present the widest distributions within the complex (and the genus); other species, such as C. aguirrei and C. lacera, are much more geographically restricted (Figure 1). n 1995 a plant collected by Carlos Garca Esquivel in an area of tropical humid forests with a strong dry Oncidium cebolleta (Jacq.) Sw. by one of us (GC). However, despite this plant has morphological features characteristic of the Cohniella ascendens complex. We here interpret the combination of morphological characters and distribution as evidence of species status for this plant, which is herein proposed as the new species Material and methods. The description of the new species was prepared from herbarium material preserved in a 70:25:5 ethanol:water:glycerine solution. Additional material of related species used from herbarium material were soaked in concentrated ammonium hydroxide for about one minute for rehydration, then rinsed in water until soft and ready for study under a dissecting microscope. Flowers thus pretreated were temporarily preserved as above for further study and eventually returned to herbarium taken with a SONY Cybershot DSC-W120; others at several resolutions, ranging from 600 to 1200 dpi. Digital line drawings were produced with Canvas X, using the digital images previously captured to provide outlines. Cartography was produced by plotting the image data shaded and colored SRTM elevation model (NASA/JPL/NIMA 2002) using ArcView 3.2 (ESRI 1999). Taxonomic treatment Cohniella amazonica sp. nov. ( FIGS 1) C. Garca Esquivel s.n. sub. G. Carnevali 3080 (holotype: CICY; isotypes, AMES, VEN). .
PAGE 59
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CETZAL-IX et al. A new species of Cohniella209 Characters C. aguirrei C. amazonica C. ascendens C. helicantha C. lacera C. nuda Leaf length (cm) 30-67 (13-)15-86 35-62 24-70 27-69 14-50 25 (11-)14-65(-80) 25-48 (7-)13-63 60-165 Flower position Resupinate Resupinate Resupinate Non-resupinate Resupinate Resupinate Flower size (mm) 16-18 15-18 15-22 10-15 18-25 13-16 Central lobe of the labellum (mm) 4.0-4.2 7-8 3-5 5-6 5-7 8.5-13.0 3-5 7-9 7-10 (12-)14-16 3-5 6-10 Central lobe of the labellum (proportions not counting the isthmus) Wider than long About as long as wide or longer than wide Wider than long Wider than long Wider than long Wider than long Lateral lobes of the labellum (position) Parallel to the central lobe Parallel to the central lobe Perpendicular to the central lobe Parallel to the central lobe Parallel to the central lobe Parallel to the central lobe Lateral lobes of the labellum (mm) 3-5 2-3 4-6 3.5-4.0 4-8 2-4 2-3 0.7-1.0 3-4 1.1-2.0 2.0-3.5(-5.0) 0.8-2.0 Lateral lobes of the labellum shape Triangular Oblong Oblong Triangular Linear Linear Isthmus (mm) 0.8-2.5 0.5-3.0 2.0-2.2 2.5-3.0 0.5-4.0 1.3-3.0 1.2-3.0 2.7-3.0 4-6 1.5-1.8 2-4 0.5-1.4 Labellar callus 5-partite 5-partite 5-partite 5-partite 1-partite 3-partite Proximal teeth of the callus (shape) Cylindrical Conical Cylindrical Cylindrical Absent Absent Distal teeth of the callus (shape) Conical Cylindrical Conical Conical Absent Conical Lateral margins of labellum disc Rugose Smooth Rugose Rugose Rugose Smooth Column wings (shape) Terete Bilobed Terete Terete Triangular Triangular TABLE 1. Morphological comparison of the Cohniella ascendens species complex.
PAGE 60
FIGURE 1. Distribution of the Cohniella ascendens species complex. A Cohniella species belonging to the Cohniella ascendens complex and related to C. nuda from which it is different by the subquadrate-oblong lateral lobes of the labellum that are in the same plane as the central lobe, the 5-partite callus, the bipartite column wings, and distribution restricted to the northeastern portion Plant epiphytic. Leaf terete, missing from the only specimen available. solitary and borne from the base of the pseudobulbs, to 25 mm thick, terete, with 7 bracted internodes, peduncle bracts 6.0.0 2.5.0 mm, the basal-most longest, narrowly elliptic, acuminate. Flowers resupinate, 15 mm diameter, ovary with pedicel 13 mm long, of which 3 mm corresponds to the ovary, 0.8.0 mm thick. Sepals basally clawed, spreading or somewhat Dorsal sepal 6 5.5.5 mm, obovate, apically obtuse and minutely apiculate, concave in the upper half, the claw 1.0.2 1.0.1 mm. Lateral sepals partially fused at the very base, then free, similar to dorsal, 6.0.0 5.5.5 mm. Petals 6 3 mm, oblong to oblanceolate, somewhat oblique, the apex rounded. Labellum 3-lobed, 101 mm long from the base to the apex of the central lobe, 81 mm wide across the apices of the lateral lobes, the lateral lobes in the same plane as the central lobe and more or less perpendicular to it. Central lobe 3 5 mm, oblong-spathulate in outline, apically rounded, basally produced into a long isthmus, 2.0.2 2.5.0 mm. Lateral lobes 4.0.0 3.5.0 mm, patent, somewhat apically truncate-rounded, the upper and lower margins of the lateral lobes entire. Disc 3.5.0 3.5.0 mm, LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.210 LANKESTERIANA
PAGE 61
in general outline oblong, with a well-developed callus, ca. 2.2.5 2.5.8 mm, consisting of a large, more ca. 1.0.2 2.5.6 mm, basally with two lateral smaller, divergent, teeth that are conical and point upward, 1.0 1.2 mm long, distally with two divergent, cylindrical lateral teeth, these 0.4 0.2.3 mm; the central tooth 1.8 mm tall, laterally compressed, the lateral sides of the callus with two small, conical teeth, 0.5 mm tall. Column 2.5.0 1.0.2 mm, the ventral face perpendicular to the plane of the labellum lobes, ovate, subcylindric, tabula infrastigmatica subquadrate, stigmatic surface obovate, ca. 0.8 0.6 mm. Column wings 1.0.2 0.7.8 mm, bilobed, oblate. Anther cap 1.5.6 1.2.3 mm, apically operculate, obovate. Pollinarium and capsule not seen. ETYMOLOGY specimen was collected. DISTRIBUTION AND ECOLOGY Cohniella amazonica is only known from the vicinity of Puerto Ayacucho in humid forests, possibly in sympatry or parapatry with FIGURE 2. Cohniella amazonica. A Flower. B, C Labellum front view. D Labellum back view. E Sepals and petals. F Disc and callus. G Flower, lateral view. H Column, front view. I clinandrium, front view. Scale: A LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CETZAL-IX et al. A new species of Cohniella211
PAGE 62
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.212 LANKESTERIANAC. cebolleta (Jacq.) Christenson, C. croizatii & Carnevali, and C. ultrajectina However, these last three species are part of the Cohniella cebolleta by the lateral margins of the disc convex with conical teeth, the column base conspicuous, 5-partite callus (3-partite in C. croizatii), the disc covered by brown or reddish spots only at base, and the platform of the callus rectangular (absent in C. croizatii et al. 2013a). The hemispherical platform of the callus (Figs. 2F-4B) and relatively narrow central lobe, oblong-spathulate in outline and narrower than long renders this new species unmistakable among other Cohniella species of the area (Fig. 2A-C). Cohniella amazonica, it is easy to distinguish from related species in the Cohniella ascendens complex such as C. aguirrei, C. ascendens, and C. helicantha by the narrow central lobe to the labellum (Fig. 3). Furthermore, the callus features conical lateral teeth at the base whereas distal calli are cylindrical; this pattern is reversed in the related taxa (Figs. 3-4). IUCN Red List category. According to IUCN (2004), Cohniella amazonica would be considered as collection from the Puerto Ayacucho area, it is therefore suspected to be under no special threat, as this area is largely uninhabited except for a few indigenous tribes, primarily Yekuana. However, albeit the region around FIGURE 3. Morphological comparison of the Cohniella ascendens species complex. A Cohniella aguirrei [based on Kniger 95, M]. B Cohniella amazonica [Carnevali 3080, CICY]. C Cohniella ascendens [Cetzal 17, CICY]. D Cohniella helicantha [Carnevali 7027, CICY]. E Cohniella lacera [Carnevali 7311, CICY]. F Cohniella nuda [Carnevali 7283 CICY].
PAGE 63
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CETZAL-IX et al. A new species of Cohniella213Puerto Ayacucho has been severely altered during the past few decades, there are still abundant forested KEY TO THE S P ECIES OF THE CO H NIELLA ASCENDENS COM P LEX 1. Isthmus of the labellum much longer than broad (2-4 0.5-2.0 mm); callus consisting of 1 to 3 teeth or keels 2 1. Isthmus of the labellum approximately as long as broad (0.5-4.0 0.5-3.0 mm); callus consisting of 5 teeth or keels 3 2. Flowers 18-25 mm diameter; labellum with the lacerated margin; column wings conspicuous; callus of the labellum 1-partite; plants endemic to the central portion of Panama C. lacera 2. Flowers 13-16 mm diameter; labellum with the entire or slightly lacerated; column wings reduced or absent; callus of the labellum 3-partite; plants from the eastern portion of Panama and northern C. nuda 3. Central lobe of the labellum 5-6 mm wide; lateral margins of the labellum smooth; column wings bipartite; plants from C. amazonica 3. Central lobe of the labellum 7-13 mm wide; lateral margins of the labellum rugose; column wings terete; plants from Mexico to Colombia 4 4. Flowers non resupinate; lateral lobes of the labellum triangular, short and thin (2-3 0.7-1.0 mm); plants from Panama and Colombia C. helicantha 4. Flowers resupinate; lateral lobes of the labellum various (obovate, oblong or triangular), lengths and widths (3-8 2-4 mm); plants from Mexico to Colombia 5 FIGURE 4. Comparison of the labellum callus of the Cohniella ascendens species complex. A Cohniella aguirrei (based on material type). B Cohniella amazonica. C Cohniella ascendens. D Cohniella helicantha E Cohniella lacera. F Cohniella nuda
PAGE 64
5. Lateral lobes of the labellum erect, usually spathulate, broadly obovate; column wings terete; plants of northwestern Mexico to the southeast of Costa Rica C. ascendens 5. Lateral lobes of the labellum patent, not spathulate, oblong-triangular; column wings subtriangular; plants from the valleys between the central and eastern Andean Cordilleras from Colombia C. aguirrei ACKNOWLEDGEMENTS We thank Franco Pupulin (JBL) for inviting us to participate in this special issue of Rodrigo Duno (CICY) commented on earlier drafts of this management of herbarium loans. LITERATURE CITED Carnevali, G., Cohniella (Orchidaceae, Oncidiinae). Brittonia 62(2): 153. de Cohniella Oncidiinae). El Colegio de la Frontera Sur, Chetumal, Quintana Roo, 276 pp. Oncidium lacerum, an older and ignored name for Cohniella stipitata (Orchidaceae, Cymbideae, Oncidiinae). Ann. Bot. Fenn. 49(1): 137. Carnevali. 2010. A revision of Cohniella 137(2): 180. Cohniella Cohniella cebolleta ? A recircumscription plus new and resurrected species and combinations. Syst. Bot. 38(3): 1. Carnevali. 2013b. Anatoma foliar comparada y sistemtica del clado-Trichocentrum con nfasis en Cohniella (Asparagales: Orchidaceae). Rev. Biol. Trop. 61(4): 1. ESRI. 1999. ArcView gis 3.2, Environmental Systems Research Institute, Inc. New York. IUCN. 2004. Guidelines for using the IUCN red list categories and criteria. Rapport IUCN. Gland, NASA/JPL/NIMA. 2002. NASA, Jet Propulsion Laboratory. NASA Earth Science Enterprise, Washington, D.C. Available from http://photojournal.jpl.nasa.gov/catalog/ PIA03364 (accessed: 20 July 2013).LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.214 LANKESTERIANA
PAGE 65
The name Parish as a collector of orchids in Burma (Myanmar) will be familiar to those who study orchids but it is unlikely that many people will know very much about him. Charles Samuel Pollock Parish (1822-1897) (Fig. 1), like many of his contemporary clergymen in the 19th century, pursued classical education. His abiding interest was in natural philosophy, which he pursued with considerable born, the second son of the Reverend Henry Parish (1791-1873), on the 26th January 1822 at Dum Dum, a town about 4 miles northeast of Calcutta (Kolkata) in India and the primary artillery cantonment for the Bengal Army of the Honourable East India Company (HEIC). Henry Parish was appointed Chaplain in the HEIC in 1820 and shortly after Charles was born, he became Senior Chaplain, with the Garrison of Fort William in Calcutta. This was followed by service at Agra from November 1826 and this is where he remained until he retired in 1839 after completing eighteen years service (McNally, 1976). A few months after their arrival at Agra, Henry Thomas, the eldest of three sons died, aged seven years. No record has yet been found, but it is most likely that Charles Parish returned to England for his formal education in 1832 or thereabouts, aged ten. On 12th Edmund Hall, Oxford where he was awarded a Bachelor of Arts degree on 2nd December 1841. Shortly after leaving Oxford, he moved to Somerset and at the general ordination held by the Lord Bishop of Bath and Wells on 7th June 1846 (Bath Chronicle and Weekly Gazette, 1846), he was ordained into Holy Orders as a deacon and then as a priest on 30th May 1847 (Sherborne Mercury, 1847). On 15th August 1846 he was appointed curate at West Hatch, Somerset (Exeter and Plymouth Gazette, 1846) but he moved during December 1849 to his second curacy at Bickenhall and Orchard Portman ( Sherborne Mercury, 1849). Parish started collecting plants in 1844 in the neighbourhood of Esher, Surrey, where he resided with his parents who had, following their return from India, based themselves to be near Epsom, the Parish family home. Charles Parish widened his search for plants to other parts of Surrey, Sussex and the London area and by 1845 he extended his collecting to Kent, where the Parish family had connections. In 1845 he LANKESTERIANA 13(3): 215. 2014. I N V I T E D P A P E R THE REVEREND CHARLES SAMUEL POLLOCK P ARISH PLANT COLLECTOR & BOTANICAL ILLUSTRATOR OF THE ORCHIDS FROM TENASSERIM PROVINCE, BURMA DUDLEY CLAYTON Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, United Kingdomdudley.clayton@btinternet.com ABSTRACT. Charles Parish collected plants in Burma (now Myanmar) between 1852 and 1878. His orchid collections, both preserved and living plants, were extensive. He sent plant material and watercolour sketches to Sir William Hooker at Kew and living plants to the British orchid nursery of Messrs Hugh Low & Co. of Upper Clapton. H.G. Reichenbach obtained examples of the Parish plant material from Hugh Low and he visited Kew where he studied the Parish orchid specimens and illustrations and many of them were subsequently described by Reichenbach. His beautiful and accurate watercolour paintings of orchids were bound in two volumes and eventually came to Kew following his death. They have been extensively used by botanists such as Robert region. Parishs life, collecting activities and collections are discussed here.* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary.
PAGE 66
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.216 LANKESTERIANAvisited Ayrshire, the Isle of Arran and Loch Lomond in the west of Scotland. Specimens were collected in Somerset from 1845 and in 1846 he visited Ireland. During the period 1846-1849, he collected more than 100 specimens each year, mainly from Somerset, neighbouring Wiltshire and Devon. He also made an extensive collection in Wales; in Snowdonia, along the west coast and in the north. His specimens were named and preserved to form a herbarium that includes a range of temperate terrestrial orchids (now deposited with the Somerset Heritage Centre). To complement his botanical interest, he developed an understanding of geology and the Blue Lias formations at Lyme Regis with their rich source of fossils. he explored the geology of Somerset and assembled a large collection of fossils. Sadly, this no longer exists and it was possibly dispersed and absorbed into other collections. To gain a better understanding of geology, he purchased Lyells Elements of Geology and Principles of Geology and, as a result, he was fascinated with the description of a volcanic island in the Bay of Bengal (Parish, 1861): I was particularly taken by the description of a certain volcanic island still active and standing up, far from land, like a solitary sentinel, in the Bay of Bengal, called Barren Island. Besides its isolated position (for volcanoes are generally in groups) the remarkable feature of it, as described, was that the sea, entering by a gap in the outer crater, completely surrounded the inner or secondary crater, so that a boat could enter and be rowed round between the two. I thought, as I read the account, how much I should like to see this strange island, not thinking at the time that there was the remotest likelihood of my ever doing so, situated as the place was on the other side of the world and, moreover, very much out of the ordinary trade vessels. But as it is the unexpected that always happens so this extremely improbable thing, in course of time, actually came about. In 1852, following in his fathers footsteps, he obtained an appointment with the HEIC and he was placed under the authority of the Bengal Presidency, effective from 19th May 1852. He arrived in Calcutta to be immediately dispatched to Burma, embarking on another vessel bound for Rangoon (Yangoon) where he arrived in late May or early June 1852 at the height of the 2nd Anglo-Burmese War (1852). Rangoon had just been captured after a sea assault by the forces of the HEIC. Charles Parish was to remain at Moulmein (Mawlamyaing) for the next 25 years, apart from a period of leave in England during 1872-73. He served initially as Assistant Chaplain, then as Chaplain from as a Senior Chaplain. His duties were to look after the garrison and their dependents at Moulmein and the other smaller garrisons, with their dependents, in Tenasserim Province. Following the Indian Mutiny, the HEIC ceased to exist with the transfer of its responsibilities to the Crown from 1st November 1858, but life for the servants of the old Company did not change. As part of his duties, Parish was responsible for the governance of the European School in Moulmein and he also had to make periodic visits to the outlying stations at Tavoy (Dawei) and Mergui (Myeik), coastal stations to the south, some 200 miles (320 km) and 300 FIGURE 1. Reverend Charles Samuel Pollock Parish (18221897). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 67
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CLAYTON The Reverend Charles Samuel Pollock Parish217miles (480 km) from Moulmein and he had to travel by boat. After 1858, a prison was opened at Port Blair on the Andaman Islands and Parish had to make regular visit to the islands as part of his duties. In 1854, two years after he arrived in Moulmein, Charles Parish married Eleanor Isabella Sarah Johnson, Infantry, Madras Army serving at Moulmein. They had seven children, four daughters and three sons, all born in Moulmein, but their second daughter only survived for one year. We know that Eleanor shared Charles interest in botanical illustrating and a number of her illustrations form part of the collection in the two volumes donated to the Royal Botanic Gardens, Kew in 1898 by Eleanor, after the death of Charles Parish. Parish now had the opportunity in Tenasserim to not just orchids. He was particularly impressed with the remarkable limestone rocks which stood 1000-2500 ft (305-762 m), generally straight and inaccessible. The pinnacles were worn by the rains into needle like points and they were wonderfully rich in plants, but only one in twenty could be climbed. His obvious desire to expand his botanical knowledge had to take second place to his duties and it meant he was unable to explore the region on a regular basis and make a systematic appraisal of the region. At best, he could venture some 20 miles (32 km) from Moulmein. The administration of the province was in the hands of districts on a regular basis, including the exploration of the unknown areas, surveying, recording the geographic features, agricultural practices, crops, indigenous plants and wildlife. Parishs botanical knowledge made him a valuable companion to take on some of these expeditions. Even if he was unable to gather botanical material and Parish thus increased his overall knowledge. He initially collected mosses and from 1859, orchids became a major interest and it is mainly through the collecting and study of ferns and orchids that we know him. The earliest preserved letter from Parish is in the Directors Correspondence at the Royal Botanic Gardens, Kew and is dated 31st July 1855. This letter and another from 31st August 1855 were written to Dr Thomas Thompson in response to enquiries made by Thompson when he was the Director at the Calcutta Botanic Gardens. Parishs letters were forwarded to Sir William Jackson Hooker (1785-1865), Director at the Royal Gardens Kew, because of the information contact for plant material from Tenasserim. Parish then began a regular correspondence with Sir William until just two months before the latters death in August 1865. In addition to the letters, he sent regular consignments of plant material, mainly mosses, ferns and orchids, to Kew and orchids to Messrs Hugh Low summer of 1859 to Hugh Low included Cymbidium parishii Rchb.f. and Vanda gigantea Lindl. (= Vandopsis gigantea by Parish during the expedition he made in February 1859 with Major (later Colonel) Samuel Tickell (18111875). Vanda gigantea was growing high up on a tree and he never found it again, and the one plant he had his elephant. The specimen could be placed across a consignment of plants sent to Messrs Low & Co. was lost when the steamer Cape of Good Hope was cut in half by the P & O steamer Nemesis, and sank in the Hooghly River. Various other trials and tribulations were suffered with plant material sent to England, with ships foundering and packages delayed en-route by the shipping companies. Eventually, he used with success the Wardian case, a small sealed glasshouse. Colonel (later General) Robson Benson, who was based at Rangoon and collected for James Veitch & Sons of Chelsea, was a friend of Parish. They met regularly and material was often exchanged. The annual visits to the outstations at Tavoy and Mergui were a highlight in Parishs year and as the European populations at these stations were small, Parish found Tavoy, Mergui and the Mergui Archipelago (Myeik Kyunzu). His comments on these visits were a regular feature of his letters to Sir William. Letters to Sir Williams son, Joseph Dalton Hooker (1817-1911), who became Director at Kew after his fathers death, were sporadic from 1862, but became regular again from 1865 until Parish retired in 1878. The memorable
PAGE 68
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.218 LANKESTERIANArecord left by Parish concerning his visit to Barren Island, already alluded to, and now lodged with the British Library (Parish, 1861), occurred during one of the routine visits he made to the Andaman Islands. In mid-October 1861, the local steamer made a straight course from the mouth of the Tavoy River to Port Blair and Barren Island lay in almost a direct line between the two places. As the island came into view and as Parish and a few others were anxious to land, the master of the steamer agreed. Initially, the steamer was sailed around the island and then hove to at a convenient distance from the shore. Parish records surrounding water, as described by Lyell. He may not have known that there had been an eruption in 1852 and this coupled with earlier eruptions in the century, and Parish were rowed ashore and they explored the island. The only orchid referred to in the article was encountered on their descent from the summit of the volcano, when Parish caught sight of a pure white speck in strong contrast with the background of black ashes, near the bottom of the opposite slope, and he healthy plant of Dendrobium formosum, a common but extremely beautiful orchid and known to the Burmese as the Silver Flower. It was in full bloom and Parish thought it must have fallen off some overhanging tree on the ridge and slid or been washed down by the rain to its singular position. FIGURE 2. Cleisostoma parishii (Hook.f.) Garay in 23: 173. 1972. Sarcanthus parishii Hook.f., Bot. Mag. 86: t. 5217. 1860. Type: Burma, cult. Low, Parish s.n. (holo. K). Parish illustration vol. 2, p. 56, dated 1860. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 69
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CLAYTON The Reverend Charles Samuel Pollock Parish219 FIGURE 3. Coelogyne parishii Hook.f. in Bot. Mag. 88: t. 5323. 1862. Type: Burma, Tenasserim, Moulmein, cult. Low, Parish s.n. (holo. K). Parish Illustration vol. 1, p. 84, dated 1860. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 70
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.220 LANKESTERIANA FIGURE 4. Cymbidium parishii Rchb.f. in Trans. Linn. Soc. London 30: 144. 1874. Type: Burma, Parish s.n. (holo. W). Parish illustration vol. 2, p. 19, dated 1867. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 71
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CLAYTON The Reverend Charles Samuel Pollock Parish221 From 1859 Parish was writing articles and his discoveries were being discussed, in botanical and grew about 150 species in his garden. Parish used local knowledge as a means of obtaining material around Moulmein. A regular supply of plants arrived which he would plant in his garden and watch them grow, and as he remarked hardly a day passed on which I did not either draw or examine microscopically one orchid or another. Finding suitable individuals to collect for him was not easy. In 1864 he lamented the loss of his regular Burmese had climbed to get out of the way. Parishs 300 illustrations are bound in two volumes, each comprising about 80 pages. The pages are often annotated with more than one name and Dendrobium is the most abundant species in the record. Many are drawings of type material, including Cleisostoma parishii (Fig. 2), Coelogyne parishii (Fig. 3), Cymbidium parishii (Fig. 4), Dendrobium parishii (Fig. 5), Hygrochilus parishii (Fig. 6), Paphiopedilum parishii (Fig. 7), Peristylus parishii (Fig. 8), Porpax parishii (Fig. 9) and Phalaenopsis parishii (Fig. 10), were named in his honour by Reichenbach and Joseph Hooker. Reichenbach (1874) listed most of the more than 200 orchid species collected by Parish around Moulmein and described many novelties based on Parishs collections. Other Parish species were described by him in a variety of German and British journals. Following his retirement, Parish made a substantial contribution on Orchidaceae in the third edition (1883) of Francis Masons Burma, its people and productions; Pegu and Burma. Vol. II, Botany, rewritten and enlarged by W. Theobald, who had just retired from his post as Deputy-Superintendent Geological Survey of India. A typical Parish entry concerns Vanda: I have lying on the table before me as I write, Vanda roxburghii, of V. roxburghii var. unicolor, V. bensonii, V. denisoniana, and of a Vanda which I have marked doubtfully, as V. bensonii. among all these which, in any other order of distinction. . Parish retired after more than 25 years in Burma, on 20th June 1878 but he remained an active clergyman in the Taunton area. His wife Eleanor and their children had remained at Taunton when Parish returned to Moulmein after his period of leave in 1872-73. On the 8th July 1885, it was reported that at the Orchid Congress held in London he was awarded a gold medal from the Royal Horticultural Society, in recognition of his exertions in connection with the importation of Burmese orchids, of which he was an extensive and enthusiastic collector when resident in the colony (Taunton Courier, and Western Advertiser, 1885). He died quietly in his sleep, on the 18th October 1897, aged 75, at Roughmoor House, his home in Bishops Hull on the outskirts of Taunton. ACKNOWLEDGMENTS I am grateful to the Director of the Royal Botanic Gardens, Kew for enabling me to use the facilities at Kew as an honorary research associate. I particular wish to thank the staff of the Herbarium, Library and Archives for their valuable assistance with accessing Parishs illustrations and the Kew Directors Correspondence in relation to my on-going research of Charles Parish and his contribution to Orchidaceae I also thank Dr Leonie Ryder of Brisbane, Queensland for providing me with her transcription of A Little Known Volcano. I also appreciated the opportunity to exchange information with her on the genealogical aspects of the Parish family, to which she has a maternal link back to a brother of Henry Parish. All images reproduced by kind permission of the Director and Trustees of the Royal Botanic Gardens, Kew. LITERATURE CITED British Newspaper Archive, British Library, London; accessed via a personal subscription: Bath Chronicle and Weekly Gazette 1749-1950; 11th June 1846. Exeter and Plymouth Gazette 1827-1950; 15th August 1846. Sherborne Mercury 1789-1867; 12th June 1847 and 29th December 1849. Taunton Courier, and Western Advertiser 1833-1963; 8th July 1885. Kew Directors Correspondence (KDCAS651-657; KDCAS1812; KDCAS2090-2112; KDCAS2114-2138; KDCAS2155; KDCAS2809-2812; KDCAS2814-2826). Letters from CSP (Charles Samuel Pollock) Parish to
PAGE 72
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.222 LANKESTERIANA FIGURE 5. Dendrobium parishii Rchb.f. in Bot. Zeitung (Berlin ) 21: 237 .1863. Type: Burma, Parish s.n. (holo. W). Parish illustration vol. 1, p. 49, dated 11 March 1882. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 73
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CLAYTON The Reverend Charles Samuel Pollock Parish223 FIGURE 6. Hygrochilus parishii 1: 112. 1897) Vanda parishii Rchb.f., Xenia Orchid. 2: 138. 1868. Type: Burma, Moulmein, Parish s.n. (holo. W). Parish illustration vol. 2, p. 29, dated 5 April 1870. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 74
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.224 LANKESTERIANA FIGURE 7. Paphiopedilum parishii (Rchb.f.) Stein, Orchideen-Buch : 479. 1892. Cypripedium parishii Rchb.f., Flora 52: 322. 1869. Type: Burma, Parish s.n. (holo. W-RCHB; iso. K). Parish illustration vol. 2, p. 88, dated 1867. Charles and Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 75
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CLAYTON The Reverend Charles Samuel Pollock Parish225 FIGURE 8. Peristylus parishii Rchb.f. in Trans. Linn. Soc. London 30: 139. 1874. Type: Burma, Tenasserim, Moulmein, cult. Dawson, Parish s.n. (holo. W-RCHB; iso. K). Parish illustration vol. 2, p. 81, dated 15 June 1868. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 76
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.226 LANKESTERIANA FIGURE 9. Porpax parishii (Lindl. & Rchb.f.) Rolfe in Orchid Rev. 16: 8. 1908. Eria parishii Lindl. & Rchb.f., Trans. Linn. Soc. London 30: 147. 1874. Type: Burma, Parish s.n. (holo. W). Parish illustration vol. 1, p. 55, dated 1856. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 77
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CLAYTON The Reverend Charles Samuel Pollock Parish227 FIGURE 10. Phalaenopsis parishii Rchb.f. in Bot. Zeitung (Berlin ) 23: 146. 1865. Type: Burma, Tenasserim, Moulmein, Parish s.n. (holo. W-RCHB). Parish illustration vol. 2, p. 70, dated 20 April 1869. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. Sir William Jackson Hooker (1855-1865). Kew Directors Correspondence (KDCAS5360-5363; KDCAS5365-5371; KDCAS5373-5380; KDCAS53825410; KDCAS5412-5413). Letters from CSP (Charles Samuel Pollock) Parish to Sir Joseph Dalton Hooker (1862-1882). Mason, F. 1883. Burma, its people and productions; Notes and Burma. Vol. II, Botany rewritten and enlarged by W. Theobald, Late Deputy-Superintendent Geological Survey of India. Published by Order of the Chief Commissioner of British Burma. Stephen Austin & Sons, Hertford. McNally, S.J. 1976. The Chaplains of the East India Company. List of all Chaplains appointed to the service of the East India Company 1601-1861 (transcript) with biographical details, compiled 1935-1976 by Sidney Parish, C.S.P. 1856-1874. Drawings (coloured) of Orchidaceae () in 2 volumes. Royal Botanic Gardens, Kew Catalogue No. 114242. Parish, C.S.P. 1861. A Little Known Volcano, visited 19th October 1861 (a copy donated to the British Library by G.M. Parish, Broadstone, 1953. British Library, Manuscripts, MSS. Eur. D674 (transcription by Dr L.A. Ryder (2012), Brisbane, Queensland, Australia). Reichenbach, H.G. 1874. Enumeration of the orchids collected by the Rev. (E.C.) C.S.P. Parish in the neighbourhood of Moulmein, with descriptions of the new species in Transactions of the Linnean Society of London, 30: 133-155. London.
PAGE 78
LANKESTERIANA
PAGE 79
Be guided by nature. Do not depart from it, thinking that you can do better yourself Albrecht Drer (1471-1528) Modern botanical drawing may be said to date from the publication in 1530 of Brunfels Herbarum Vivae Eicones Wilfred Blunt & William Stearn The Art of Botanical Illustration (1994) Introduction. Modern botany has its origins in Ancient describing and naming plants of use to physicians was prepared in the eastern Mediterranean by a student of Plato, the Greek physician Theophrastus of Lesbos (371-287 BC) (Arber, 1986). Much of the knowledge in his Enquiry into Plants and On the causes of Plants was distilled by Dioscorides (40-90 AD) in his De Materia Medica, a text that was copied and widely used by physicians for the following 1500 years. The earliest surviving copy is the Codex Julian Anicia of 512 AD, prepared for Juliana Anicia, the daughter of the Emperor Anicius Olybrius in Constantinople and preserved in the Austrian National Library in is illustrated in colour with life-like and recognisable illustrations can be traced to the ease with which they with the written word. In essence, they make the easier. Images of orchids do not appear in the Codex, published in the Renaissance. Botanical art made its greatest impact with the Wilfred Blunt and William Stearn (1994), Modern botanical drawing may be said to date from the publication in 1530 of Brunfels Herbarum Vivae Eicones. Otto Brunfels herbal was illustrated with survive in the herbarium of Felix Platter (Figs 1, 2), preserved in the City Library in Bern. Brunfels herbal LANKESTERIANA 13(3): 229. 2014. I N V I T E D P A P E R SLIPPER ORCHIDS IN ART AND SCIENCE PHILLIP CRIBB Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, United Kingdom P.Cribb@kew.org ABSTRACT. botanical and horticultural literature on them is extensive. Artists and designers have also been intrigued by them and they feature in many illustrated botanical and horticultural books and decorative items, from tapestries to porcelain and stamps. In this article, the history of slipper orchids is illustrated by reference to illustrations of them, mostly in the collections of the Royal Botanic Gardens. Kew. KEY WORDS : Orchidaceae, Cypripedioideae, botanical illustration, Kew* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary. Charles Lankester formed a close association with Victor Summerhayes, Kews orchid specialist from 1928 until his retirement in 1964. They he corresponded frequently and Lankester sent many living and preserved plants to Kew that he could not identify. This relationship contributed many rarities to the Kew orchid herbarium and living collections over the years and enabled Lankester to provide identities and names for his many discoveries which he grew on in his private garden which is now the Jardin Botanico Lankester. The relationship between the botanists there and at Kew continues fruitfully to the present day. It is a pleasure to contribute this article to the celebration of Charles Lankesters legacy which is now a thriving
PAGE 80
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.230 LANKESTERIANAincluded orchids, although no ladys slipper, a surprise because it is native and not uncommon in Germany. We have to wait until later in the 16th century for slipper what distinguishes the ladys slipper orchids. Slipper orchids. Ladys slippers, comprising about 160 species (Pridgeon et al., 1999), are found throughout Asia, Europe and the Americas as far south as Bolivia Australia. They are among the most popular of orchids. The earliest record we have of their cultivation is that by Philip Miller in 1731. He grew the native Ladys slipper orchid (Cypripedium calceolus) at the Chelsea Physic Garden. Nowadays, no collection is complete without its selection of slipper orchids. Ladys slippers have features that set them apart which have lateral sepals joined to form a synsepal, a slipper-shaped lip termed, two fertile lateral anthers of the inner whorl, a sterile more or less shield-shaped staminode at the apex of the column, and a stalked trilobed stigma that lies ventrally on the column behind the staminode. Consequently, they have been considered to be primitive orchids. They represent as small percentage of the family Orchidaceae, certainly less than 1% in terms of numbers of species and genera. Furthermore, many are rare and threatened with extinction in their native habitats. Slipper orchids are now recognised as a distinct subfamily, the Cypripedioideae, within the Orchidaceae (Dressler 1981, 1993, Chase et al., 2003), comprising genus Cypripedium for almost a century after the name was established by Linnaeus (1737). Constantine the diversity within the slipper orchids, establishing the genera Sacodon, Stimegas, Cordula, Menophora and Criosanthes but his work was largely ignored by his contemporaries because it was published in obscure and little circulated works and he was less than clear himself about the status of his taxa.. Of these names Sacodon and Criosanthes refer to species now included in Cypripedium, while the rest refer to species now included in Paphiopedilum which has been conserved over Cordula and Stimegas (Farr et al. 1979). H. G. Reichenbach (1854) established the genus Selenipedium for the tropical American species which have a trilocular ovary. Blume (1858) discounted this character because he found unilocular ovaries of some species were trilocular towards each end. However, George Bentham and Joseph Hooker (1883) followed Reichenbach in dividing the slipper orchids into two genera. ground for the modern generic treatment of the slipper orchids by recognising the correlation of leaf type with perianth persistence. He established the genus Paphiopedilum for the tropical Asiatic and American species with hard leaves and a deciduous perianth, leaving the plicate-leaved northern temperate species with a persistent perianth in Cypripedium and the tropical American ones in Selenipedium. Robert Rolfe (1896) revised the slipper orchids. He FIGURE 1. Felix Platter herbarium volume. Courtesy of the Historical Museum of Bern. FIGURE 2. Orchids in the Felix Platter herbarium. Courtesy of the Historical Museum of Bern.
PAGE 81
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CRIBB Slipper orchids in art and science231restricted the genus Paphiopedilum (now c. 70 species) to the Old World hard-leaved species with imbricate imbrications, but placed the New World hard-leaved species in a new genus Phragmipedium (now ca. 21 species) based on their leaf type and valvate imbrication of the sepals. The use of Cypripedium (now 47 species) and Selenipedium (now 5 species) The monotypic Mexipedium genus, was established by Albert and Chase (1992) to accommodate a dwarf Mexican slipper orchid which had morphological features intermediate between those of the tropical American Phragmipedium and the tropical Asiatic Paphiopedilum. It was originally included by Soto et al. (1990) in Phragmipedium on account of its possession of the valvate aestivation of its sepals, the absence of sinuous epidermal cells in the perianth, the fusion of the side lobes of its lip and the ventral synsepal being larger than the dorsal sepal. Albert and Chase added a further character of Phragmipedium but absent from Paphiopedilum of data from DNA analysis, Albert (1994) found that Mexipedium was basal in the Phragmipedium clade. Slipper orchids have also fascinated generations of studied by Charles Darwin, the pre-eminent biologist. They have consequently featured prominently in botanical art. Here, the history of slipper orchids in art is considered and illustrated by some of the collections of the Royal Botanic Gardens, Kew Illustrations of slipper orchids Cypripedium . Cypripediums The grandest and most august of the Orchidaceae, one great race which is supreme alike in the open and under cover, deserves full treatment by itself. Reginald Farrer (1919) in The English Rock Garden In the subdued light in the basement of the Historisches Museum Basel hangs a remarkable tapestry which depicts a summer scene of the small walled south of the Bodensee (Lake Constance) (Fig. 3 A ). The tapestry dates from 1510 and, for the botanist, FIGURE 3 A Cypripedium calceolus in the lower part. Courtesy of the Basel City Museum.
PAGE 82
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.232 LANKESTERIANAits beauty is enhanced by the accurate depiction of a number of native plants, including oxlip, columbine, wild strawberry and a ladys slipper orchid (Fig. 3 B ). image is situated on the lower border slightly to the the normal form which has a yellow pouch and maroon sepals and petals. However, plants with pure yellow Cypripedium in 1737 in his Flora Lapponica in describing the European species as Cypripedium foliis ovato-lanceolatis, the name Cypripedium alluding to Cyprus, the island that was the mythological birthplace of Aphrodite (Venus), and pedilum a shoe or slipper, in allusion to the popular name of Ladys slipper. In 1753 he named and described two species C. calceolus and C. bulbosum. The former concept included the well-known European C. calceolus and the North American species now treated as (var.b), C. acaule (var.g), and C. guttatum (var.d). The last is now considered to belong to the distinct and unrelated genus Calypso. slipper orchids. The earliest description and published illustration of a slipper orchid can be traced to the herbal of Rembert Dodoens (1568) entitled Florum, et coronarium odoratarumque nonnullarum herbarium historia. His wood-cut illustration of Damasonium nothum C. calceolus drawing was sent to him by Joannes Vreccomtus of garden, the earliest record of its cultivation. Mathias de LObel (1576) reproduced Dodoens illustration in his Plantarum seu stirpium historia while Dodoens (1583) used it again in his Stirpium historiae FIGURE 3 B Detail od Cypripedium calceolus Courtesy of the Basel City Museum. FIGURE 4. Rembert Dodoens illustration of Cypripedium calceolus in his Florum, et coronarium odoratarumque nonnullarum herbarium historia (1568). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 83
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CRIBB Slipper orchids in art and science233pemptades... pods (Fig. 5). The latter originated in the contemporary herbal Rariorum aliquot stirpium... of Charles de LEcluse (1583), also known as Clusius. Dodoens used the name Calceolus Marianus, Pfaffen schuh, Papen schoen and Calceolus Sacerdotis, while Clusius, referring to it as Marienschuh, placed it next to the helleborines, Elleborine . Dodoens stated that it was found in Helvetiorum, & Norici, ac Pannoniae superioris sive Austriae montibus. Clusius had seen the plant in the wild in Austria and Hungary and it seems likely that his illustration was based on a wild plant seen on his travels. The wood-cut would then have been produced for his own work but shared with Dodoens who was a good friend (Arber,1986). Dodoens plate reappears in several later herbals, notably those of John Gerard (1597) in his Herball and John Parkinson (1629) in his Paradisi in sole paradisus terrestris.... Large chunks of Dodoens work appear in Gerards Herbal in translation. However, this was an accepted methodology of the day and Gerard did add notes on plants with which he was familiar. He calls Cypripedium calceolus Our Ladies shooe or slipper and notes that it groweth upon the mountains of Germanie, Hungarie, and Poland. He grew a plant given to him by his friend the Apothecary Master Garret and this is the earliest reference I can trace of the cultivation of the species in the British Isles. It is interesting that Gerard was unaware that it was a native British species. Its recognition as such was left to John Parkinson (1629) who called it Helleborine vel Elleborine maior, sive Calceolus Mariae. Parkinson recorded it as growing in Lancashire, neare the border of Yorkshire, in a wood or place called the Helkes, which is three miles from Inglborough, the higest Hill in England, and not farre from Ingleton, as I am informed by a courteous Gentlewoman, called Mistris Thomasin Turnstall, who dwelleth at Bullbanke, near Hornby Castle...(she) hathe often sent mee Garden. The Ladys Slipper survived in that area until into the present century and Parkinsons only mistake is his suggestion that Ingleborough is the highest hill in England. Parkinson was indeed an astute observer and noted that the seed of C. calceolus is very small, very like unto the seede of the Orchides or Satyrions, and contained in such like long pods, but bigger. Cypripedium with the orchids and to note their tiny formally include slipper orchids in the orchid family. The earliest known colour illustration of C. calceolus is that by Conrad Gesner (or Gessner) dating from 1541, a watercolour of a plant from Mt. Saleu in the Swiss Jura near Geneva (Fig. 6). It is an accomplished likeness, far superior to the later woodcuts in the LObel, Dodoens and Clusius herbals, while in botanical accuracy and for another two hundred or more years. Gesner died from plague before he was able to publish his botanical illustrations. Schmiedel (1754-1759) published part Opera Botanica and included the coloured illustration and account of C. calceolus as Calceolus Mariae. They FIGURE 5. Cypripedium calceolus from Dodoens herbal Stirpium historiae pemptades (1583). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 84
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.234 LANKESTERIANAhave recently been reproduced in facsimile by Zoller, Steinmann & Schmidt (1973-1980). A useful list of early descriptions and illustrations of slipper orchids is included. Another early colour illustration of C. calceolus is that by Daniel Rabel (1578-1638), recently reproduced in the second edition of Blunt & Stearn (1994). The original is in the Bibliotheque Nationale in Paris and it was probably painted in 1631 or 1632. Parkinson (1640) returned to the theme of Our Ladyes Slipper or the great wilde Helleborine in his Theatrum botanicum. There he recorded a North American species, undoubtedly C. reginae, as a sort thereof.......brought from the North parts of America, differing onely in being greater both in stalkes, leaves strakes through the bellies of them. An earlier reference to a North American species, however, is that of J.P. Cornut (1635) in his Canadensium Plantarum Historia where he listed Calceolus marianus canadensis, a reference to C. acaule, Cypripedium reginae and three other North American taxa, C. acaule and var. () and var.pubescens, were described by Leonard Plukenet (1700) in his Mantissa being illustrated by him in 1705 in his Amaltheum Botanicum (Fig. 7). These line illustrations are the earliest representations of North American slipper orchids. The earliest coloured illustration of a North American species is that of rubente (=C. acaule) (Fig. 8) by Mark Catesby (1754) in The Natural History of Carolina, Florida and the Bahama Islands. Gardeners Dictionary, published in 1731, included three species of hardy slipper orchid: the European species as ; FIGURE 6. Conrad Gesners illustration of Cypripedium calceolus ca. 1540. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 7. Leonard Plukenets plate of C. acaule and C. var. and var. pubescens from his Amaltheum Botanicum (1700). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 85
CRIBB Slipper orchids in art and science235LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 8. Mark Catesbys illustration of Cypripedium acaule from The Natural History of Carolina, Florida and the Bahama Islands (1754). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 86
and two North American species Helleborine; , one of the varieties of and Helleborine; Canadensis, sive calceolus mariae, probably C. reginae. He commented that all (are) Natives of Woody and shady Places. He provided a coloured illustration in his Figures of the most beautiful, useful and uncommon published British plant as Miller reiterates that it was found in it at Chelsea where, no doubt, the coloured illustration by R. Lancake was made. The German artist Georg Dionysius Ehret who worked at the Chelsea Physic Garden for Miller also illustrated a plant of the North American var. pubescens (Fig. 9) which Miller probably grew at Chelsea. Linnaeus (1753) apparently overlooked Parkinsons and Millers references to North American species but including Cornut and Morisons names within C. calceolus, the European species which must have been familiar to him in his native Sweden. William Aiton (1789) listed three species in his Hortus Kewensis: the European C. calceolus, and the North American C. reginae (as C. album) and C. acaule as being grown at Kew. C. reginae had been introduced by William Hamilton in 1786 and C. acaule by William Young in 1770. Johann Amman (1741) and Johann Georg and illustrations of Asian slipper orchids (Fig. 10). The former illustrated Siberian C. macranthos as Calceolus purpureus speciosusand C. guttatum as C. calceolus, C. ventricosum and C. macranthos, the last as Calceolus purpureis speciosus based the names C. ventricosum and C. macranthos on Gmelins collections.LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.236 LANKESTERIANA FIGURE 9. var. pubescens by Georg Dionysius Ehret, ca. 1758. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 10. Plate of Cypripedium calceolus C. macranthos and C. x ventricosum from Gmelins Flora Sibirica (1747-1749). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 87
western botanist to visit Japan. Cypripedium japonicum and C. macranthos (as C. calceolus) were described in his Flora Japonica (1784), the former also being illustrated there (Fig. 11). The Japanese slipper orchids C. japonicum, C. debile and C. macranthos Somoku Zusetsu of 1874. However, Ludovic Savatiers watercolours of C. japonicum and C. macranthos made between 1856 and 1866 survive in the Kew collection. Most of the species in the Far East remained unknown for nearly a century more until botanists began to penetrate into the mountainous west of China. CRIBB Slipper orchids in art and science237LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 11. Carl Peter Thunbergs illustration of Cypripedium japonicum from his Flora Japonica (1784). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 88
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.238 LANKESTERIANA Cypripedium species was the collection in 1864 by Pre C. luteum (now ) at Moupin in what is now western Sichuan. However, the diversity of the Chinese cypripediums was not apparent until the last few years of the 19th century. From 1894 onwards, the indefatigable French missionaries, Delavay, Soulie, Maire, Monbeig and Farges, based in Yunnan and Sichuan, began to send back large numbers of collections to Paris, many to be described as new to science by the French botanist Franchet. By the turn of the century the British collectors Augustine Henry in Hubei, Sichuan and Yunnan and Ernest Wilson in Sichuan and Hubei had added further species. New Chinese species have continued to be discovered and described this century (Tang & Wang, 1951; Cribb, 1992; Cribb & Chen, 1994; Chen et al., 2013) and many have been illustrated in Curtiss Botanical Magazine, founded in 1878 and the oldest surviving journal illustrated in colour. Paphiopedilum to botanists and horticulturists. The establishment of botanic gardens, initially to introduce crops for number of intrepid collectors and botanists, particularly those associated with the Calcutta Botanic Garden which had been established in 1787. William Roxburgh collected orchids and employed Indian artists to draw them. Nathaniel Wallich, his successor, developed the garden and started the herbarium of the East India Company, the latter being the basis of our current countries. He also employed native artists to illustrate novelties and these watercolour paintings are now held cypripediums and paphiopedilums. Two from 1826 are reproduced here, namely Paphiopedilum insigne (Fig. 12) from the Khasia Hills and the Himalayan P. venustum. The former had earlier been sent by Wallich to London where Samuel Curtis illustrated it for John FIGURE 12. Paphiopedilum insigne by an unknown Indian artist for the Calcutta Botanic Garden, ca. 1820. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 13. Samuel Curtiss Paphiopedilum insigne drawn for John Lindleys Collectanea Botanica (1821). Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 89
CRIBB Slipper orchids in art and science239LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Lindleys Collectanea Botanica (1821) (Fig. 13). Plant collectors occasionally illustrated the plants that they discovered. Several of these original paintings survive at Kew. Hugh Lows original watercolour of Paphiopedilum lowii (Fig. 14) also survives at Kew. The beautiful watercolours of Charles Parish, including his watercolour of the eponymous Paphiopedilum parishii, are dealt with in an accompanying article (Clayton, 2013). Many of their collections and those of other plant hunters ended up being sold by European nurseries, particularly Over the past 226 years, many novelties have been first figured in the pages of Curtiss Botanical Magazine. Walter Hood Fitch, Matilda Smith, Lilian Snelling, Stella Ross-Craig, Margaret Stones, Pandora Sellars, Cristabel King and Carol Woodin have all produced outstanding illustrations of slipper orchids for the journal (Figs. 15-18). Some of Fitchs finest slipper orchid paintings were prepared for Robert Warners Select Orchidaceous Plants (Lovell Reeve, London: 1862-1878) (Figs. 19, 20). Kew possesses many remarkable illustrations in its archives, none more so that John Days 53 scrapbooks, comprising over 2800 watercolour paintings of orchids (Cribb & Tibbs, 2004). Day cultivated and illustrated 44 species and 46 hybrid slipper orchids in three genera, Cypripedium, Paphiopedilum and Phragmipedium, in his scrapbooks. His illustrations labelled as Selenipedium and Uropedium are now considered to belong to the genus Phragmipedium, while the Southeast Asian and Indian species of Cypripedium belong to Paphiopedilum. During Days lifetime many species new to science were discovered and described, including thirty species of Paphiopedilum, almost half of the genus. When he many of Reichenbachs orchid names were based on Days plants and his specimens and drawings form part of the type materials of many species. FIGURE 14. Hugh Lows painting of his collection of Paphiopedilum lowii, drawn in Sarawak, Borneo, ca. 1847. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 15. Lilian Snellings Paphiopedilum callosum. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 90
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.240 LANKESTERIANA FIGURE 16. Stella Ross-Craigs Paphiopedilum tonsum. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. slipper orchids. Paphiopedilum dayanum (Fig. 21) was named in his honour and P. stonei (Fig. 22) after illustrate Paphiopedilum sanderianum (Fig. 23), one of the worlds most desirable orchids. The most famous slipper orchid in his collection was Paphiopedilum stonei var. platytaenium (Fig. 24) which was also probably the most valuable plant of the day and much sought after by other growers who were willing to pay high prices for rarities and spectacular orchids. His
PAGE 91
CRIBB Slipper orchids in art and science241LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 17. Pandora Sellars Paphiopedilum superbiens. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 18. Carol Woodins Paphiopedilum vietnamense Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 19. Walter Hood Fitchs Paphiopedilum hirsutissimum for Robert Warners Select Orchidaceous Plants. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 20. Walter Hood Fitchs Paphiopedilum callosum for Robert Warners Select Orchidaceous Plants. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 92
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.242 LANKESTERIANA FIGURE 21. John Days Paphiopedilum dayanum. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 22. John Days Paphiopedilum stonei. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 93
CRIBB Slipper orchids in art and science243LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 23. John Days Paphiopedilum sanderianum. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.Selenipedium and Phragmipedium . The Spanish discover and collect tropical American slipper orchids. Between 1777 and 1788, on behalf of the Spanish King Carlos III, they undertook a botanical exploration of Peru and Chile. The results of their expeditions, over 3000 collections of herbarium specimens and 2500 watercolour illustrations, formed the basis of their proposed ten-volume Florae Peruviana et Chilensis their life-times. The illustrations, made by the artists collections of the Royal Botanical Garden in Madrid. Amongst them are watercolours of Phragmipedium caudatum and P. boissierianum. Unfortunately, neither Matthews for Sir William Hooker. He described one as Cypripedium caudatum to be too badly preserved for description (Lindley, 1840). FIGURE 24. John Days Paphiopedilum stonei var. platytaenium. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 94
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.244 LANKESTERIANA American Cypripedium species in Mexico between 1787 and 1803. Their collections are in the herbarium of the Royal Botanic Garden, Madrid. They collected two species to which they gave the manuscript names C. turgidum and C. acuminatum. The former name was eventually published posthumously in 1890 (by which time it had already been described C. irapeanum). The latter name, referable to Lindleys C. molle, has never been published. Contemporary coloured illustrations of the two Sesse & Moino species are preserved in the Hunt Institute collection in Pittsburg (Cribb & Soto, 1993). Lindley described Cypripedium lindleyanum based on a specimen collected and named by Robert Schomburgk (1804-1865) that had been collected by him near Mt Roraima in Guyana. Lindley commented at the time I unwillingly consent, at the particular instance of Mr Schomburgk, to allow this plant to bear my name, who have no title to the compliment. Schomburgks original watercolour illustration (Fig. 25) remains in Lindleys herbarium at Kew. Schomburgks adventures on Roraima were probably the inspiration for Sir Arthur Conan Doyles Lost World (1912). A watercolour of Selenipedium palmifolium, also drawn in situ by Everard Im Thurn (1852-1932) who scaled the mountain some years later, also survives at Kew (Fig. 26). collector in Colombia and Ecuador also painted his discoveries, probably to show European nurseries what he had to offer when he occasionally visited Europe to solicit business. His paintings of phragmipediums were published recently in this journal (Cribb, 2010). John Day watercolours of Phragmipedium species include early depictions of P. boissierianum, P. caudatum, P. schlimii (Fig. 27), and P. wallisii. FIGURE 25. Robert Schomburgks Phragmipedium lindleyanum, drawn on Mt Roraima, Guyana. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 26. Everard Im Thurns illustration of Selenipedium palmifolium ca. 1884. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 95
CRIBB Slipper orchids in art and science245LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 27. John Days Phragmipedium schlimii Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.Artificial Hybrids . John Day had access to, and illustrated in his scrapbooks, nearly all of the early slipper orchid hybrids raised by John Dominy and his successor John Seden for Messrs James Veitch & Sons of Exeter and Chelsea. The significance of these is considerable because systematic collections of illustrations of hybrids, for example that of the Royal Horticultural Society, did not start until the end of the 19th century when many of the early hybrids had already disappeared. Although enthusiastic about some, Day prophetically commented in his appraisal of Cypripedium ( Paphiopedilum) Apiculatum, a hybrid between P. barbatum and P.villosum var. boxallii, that I am afraid we shall be overcome with hybrids soon and orchids will gradually descend to the level of florists flowers and lose their interest (Scrap Book 51, p. 95). He also depicted all of the early Paphiopedilum hybrids, including P. Harrisianum (Fig. 28) and P. Morganiae (Fig. 29) and Phragmipedium hybrids, including P. Dominii (Fig. 30), P. Sedenii (Fig. 31), P. Cardinale and others in their first flowering at the Veitch nursery in Chelsea. Thus, Days paintings of the early hybrids are an invaluable record of English nurseries early ventures in orchid breeding. His pioneering work on illustrating hybrids was taken up by the Royal Horticultural Society which has employed a series of artists to paint awarded orchids for over a century, a collection that now includes many images of slipper and other orchids and a tradition that endures to the present day (Figs. 32). It seems likely that the idea for the RHS illustrations came from the common practice of orchid nurseries equipping their salesmen who sold orchids around the country with sets of watercolour paintings of their best clones so that growers could order plants based on the paintings. Some of these samples survive at Kew, such as that of Paphiopedilum W.R. Lee and P. Morganiae (Fig. 33). Conclusion. Slipper orchids have been a popular subject for botanical artists for over four centuries and remain so today. Their unusual and often showy the resulting images are often striking and far easier to interpret than descriptions, thereby facilitating
PAGE 96
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.246 LANKESTERIANA FIGURE 28. John Days Paphiopedilum Harrisianum. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 29. John Days Paphiopedilum Morganiae. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 3 0. John Days Phragmipedium Dominianum. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 97
CRIBB Slipper orchids in art and science247LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 31. John Days Phragmipedium Sedenii. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 32. Paphiopedilum lawrenceanum var. hyeanum by Nellie Roberts for the Royal Horticultural Society. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew. FIGURE 33. Trade painting of Phragmipedium Morganiae from the late Victorian period. Reproduced with the kind permission of the Director and the Board of Trustees, Royal Botanic Gardens, Kew.
PAGE 98
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.248 LANKESTERIANA FIGURE 34. Mary Griersons Cypripedium calceolus for P. Francis Hunts Orchidaceae (Bourton Press, Bourton. 1973).
PAGE 99
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. CRIBB Slipper orchids in art and science249 have been illustrated many times, occasionally inaccurately as in Mary Griersons painting of Cypripedium calceolus (Fig. 34) for Peter Hunts Orchidaceae which endows it with tubers! The history of their discovery and introduction into cultivation can be traced through the chronology of their depiction. The archives also can be used to orchids for the horticultural trade, through collections of paintings by enthusiasts, for example, John Day and by the artists employed to illustrate awarded plants by the Royal Horticultural Society in London. In recent years the popularity of botanical art has reached a level not previously seen since Victorian times. Watercolour paintings of slipper orchids are Slipper orchids have also been used to illustrate the cover of foodstuffs, such as ice cream and chocolates. However, it is probable that the most lucrative line for slipper orchid illustration is for postage stamp issues. Cypripedium calceolus, the Eurasian ladys slipper, has appeared on the stamps of numerous countries, including most European countries, the United Nations and, surprisingly the Grenadines of St Vincent in the Caribbean. Tropical slipper orchid species and hybrids are also popular subject for stamp issues. The small island of Jersey, for example, has produced stamps featuring both Paphiopedilum hybrids and the Peruvian Phragmipedium besseae. ACKNOWLEDGEMENTS I would like to thank Marilyn Ward and Julia Buckley for their help in sourcing illustrations at Kew; Dr. Margret Ribbert, Curator of the Historisches Museum Basel; and Samuel Sprunger and Werner Lehmann of the Swiss Orchid Foundation for alerting me to the image on the tapestry. LITERATURE CITED Aiton, W. 1789. Hortus Kewensis. G. Nicol, London. Albert, V. A. 1994. Cladistic relationships of the slipper orchids (Cypripedioideae: Orchidaceae) from congruent morphological and molecular data. Lindleyana 9(2): 115-132. Albert, V. A. & M. W. Chase. 1992. Mexipedium : a new genus of slipper orchids (Cypripedioideae: Orchidaceae). Lindleyana 7: 172. Amman, J. 1741. Quinque nova plantarum genera. Science Academy, St Petersburg. Arber, A. 1986. Herbals and their origin and evolution. 3rd ed. Cambridge University Press. Blunt, W. & W. Stearn. 1994. The Art of Botanical Illustration Antique Collectors Club, Woodbridge, Suffolk. Blume, C. L. 1858. Collection des orchides les plus remarquable de lArchipel Indien et du Japon. G.C. Sulpke, Amsterdam. Catesby, M. 1754. The Natural History of Carolina, Florida and the Bahama Islands. Chase, M. W., K. M. Cameron, R. L. Barrett & J. V. Freudenstein. 2003. DNA data and Orchidaceae Dixon, K.W., S. P. Kell, R. L. Barrett & P. J. Cribb (eds.), Orchid Conservation: 69-89. Natural History Publications, Kota Kinabalu, Sabah. Chen, S.C., Z. H. Liu, L. J. Chen & L. Q. Li. 2013. The genus Cypripedium in China. Science Press, Beijing. Cornut, J. P. 1635. Canadensium Plantarum Historia. S. le Moyne, Paris. Cribb, P. J. 1992. The Chinese spotted-leaved cypripediums. Bull. Alp. Gard. Soc. 60, 2: 165-177. Cribb, P. J. 2010. The life and travels of Friedrich Carl Lehmann. Lankesteriana 10, 2-3: 9-30. Cribb, P.J. & S. C. Chen. 1994. Further thoughts on the Chinese spotted-leaved cypripediums. Orchid Rev. 102: 321-323. Cribb, P.J. & M. A. Soto. 1993. The genus Cypripedium in Mexico and Central America. Orquidea (Mexico) 13, 1-2: 205-214. Cribb P.J. & M. Tibbs. 2004) A very Victorian passion. The orchid paintings of John Day. Thomas Nelson, London. Dodoens, R. 1568 Florum, et coronarium odoratarumque nonnullarum herbarium historia. Dressler, R.L. 1981. The Orchids. Natural History and Harvard University press. Dressler, R.L. 1993. orchid family Cambridge University Press. Index nominum genericorum. Bohn, Scheltema & Holkema, Utrecht; Junk, The Hague. Gmelin, J. G. 1747-1749. Flora Sibirica, sive Historiae plantarum Sibiriae Science Academy, St Petersburg. Iinuma, Y. 1874. Somoku Dzusetsu, ed. 2. Mino, Ogakai. Linnaeus, C. 1737. Flora Lapponica. Amsterdam. Linnaeus, C. 1753. Species Plantarum. L. Salvius, Stockholm. Miller, P. 1731. Gardeners Dictionary. C. Rivington, London. Parkinson, J. (1640). Theatrum botanicum. T. Cotes,
PAGE 100
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.250 LANKESTERIANAParkinson, J. 1640. Theatrum botanicum. T. Cotes, London. Pavord, A. (2005). The naming of names, the search for order in the world of plants Bloomsbury, London. Orchideenblthe. C. Winter, Heidelberg. Pridgeon, A., P. J. Cribb, M. W. Chase & F. Rasmussen (eds.). 1999. Genera orchidacearum vol. 1. Oxford University Press. plantes. J. Phys. Chim. Hist. Nat., 89: 96-107. Flora telluriana Philadelphia. Reichenbach, H. G. 1854. Xenia orchidacea vol. 1. Rolfe, R. A. 1896. The Cypripedium group. Orchid Rev. 4: 327-334, 363-367. Schmiedel, D. C. C. (ed.) 1754-1759. Conradi Gesneri... Opera Botanica J.M. Seligmann, Norimberg. Phragmipedium xerophyticum a new species from south-east Mexico. Orquidea (Mexico) 12, 1: 1-10. Zoller, H., M. Steinmann & K. Schmidt. 1972-1980. Conradi Gesneri Historia plantarum. Urs Graf, Dietikon, Zrich.
PAGE 101
In the most traditional circumscription, genus Masdevallia Pleurothallidiinae, distributed throughout the New World tropics from Mexico in the north to southern Bolivia, primarily along the Andes, but with a few Masdevallia has changed considerably over the years, however, and many groups of species have been transferred to new genera, such as, Dracula Luer, Dryadella Luer, Porroglossum Schltr., ScaphosepalumTrisetella Luer. These transfers were to a considerable extent morphology, which is user-friendly and makes the genera relatively easy to identify, even without the remaining about 350 species of Masdevallia (Luer 1986) included vegetatively rather similar plants, which made it easy to spot a Masdevallia even without however, molecular work with DNA sequencing has complicated the picture (Abele et al. 2005, Pridgeon & Chase 2001), which led Luer to propose a division of the genus, by then about 500 species rich, into 16 new genera, in addition to three already described segregates and the original Masdevallia (Luer 2006). Many growers and scientists have not accepted this proposition and maintain the genus more or less as it was circumscribed by Luer in 1986. For practical reasons, in addition to strict taxonomic reasons, we chose to follow a broader concept of the genus and therefore describe the species treated here as members of Masdevallia sensu Luer 1986, but at this time without placing them in any particular subgenus or section. Masdevallia hortilankesteriani sp. nov. TYPE: Peru. Junn. Terrestrial along road Comas Cochas, S11.008, W075 04.22, 2800 m. 13 Nov. 2011, S. Dalstrm 3510 (holotype, USM). FIGS 1. Diagnosis: Masdevallia hortilankesteriani is similar to the sympatric M. rimarima-alba Luer (Fig. 5.) but differs by a more compact vegetative habit, a more tails and a narrower lip. Geophytic or lithophytic herb. Plant medium LANKESTERIANA 13(3): 251. 2014. I N V I T E D P A P E R THREE NEW MASDEVALLIA SPECIES (ORCHIDACEAE: PLEUROTHALLIDINAE) FROM PERU STIG DALSTRM 1,3 & SAUL RUZ PREZ Ringling Boulevard, unit 119, Sarasota FL 34237, U.S.A. Lankester Botanical Garden, University of Costa Rica, Cartago, Costa Rica and National Biodiversity Centre, Serbithang, Bhutan Allamanda 142, Surco, Lima 33, Peru Corresponding author: stigdalstrom@juno.com ABSTRACT. Three new Masdevallia species are described, illustrated and compared with similar species. A brief Masdevallia and not as M. rimarimaalba M. dudleyi and M. nunezii but differs in the richly pubescent sepals, and the third species is distinguished from other similar Masdevallia species by the rugose lip KEY WORDS : Orchidaceae, Masdevallia Pleurothallidiinae, Epidendreae, new species, Peru, taxonomy* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary.
PAGE 102
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.252 LANKESTERIANA FIGURE 1. Masdevallia hortilankesteriani lip and petal views. Drawn from the holotype by Stig Dalstrm.
PAGE 103
DALSTRM & RUZ PREZThree new Masdevallia species 253LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.genus. Ramicauls erect, slender, 1.0.5 cm long, enclosed basally by 3 to 4 tubular sheaths. Leaf erect, coriaceous, petiolate, blade basally conduplicate and cuneate, elliptic, obtuse to acute, 6 0.8.1 cm, including the 1.5.0 cm long petiole. erect, terete, ca. 15 cm long peduncle; peduncular bract 1, tubular, below the middle of the peduncle, ca. 1.7.8 cm long; appressed, tubular, ca. 1 cm long; pedicel ca. 2.0.2 cm long; ovary smooth, ca. 0.4 cm long. Flower attractive, campanulate; dorsal sepal white to pale rose, with purple longitudinal stripes along the 3 veins, glabrous and carinate externally, glabrous to microscopically pubescent internally, slightly concave, cuneate, angulate-obovate and connate to the lateral sepals for ca. 13 mm, acuminate into a dorsally rather thick, frontally dull greenish yellow, ventrally purplish tail, ca. 36 10 mm, including the ca. 16 17 mm long tail; lateral sepals similar in texture and coloration, 3-veined, connate for ca. 13 mm, angulate-ovate, acuminate with apical, rather thick, slightly recurved tails, ca. 30 16 mm, including the ca. 13 mm long tails; petals white, cartilaginous, obliquely oblong and apically truncate and obliquely bilobed, with a ventral continuing along the lower edge and diminishing near the apex, ca. 6 2 mm; lip brownish purple, with darker longitudinal ventral stripes and a dark purple-brown apex, hinged on the column foot, with a basal swelling and shallowly notched, cuneate, oblong-elliptic, apically truncate, recurved and bluntly apiculate, dorsally slightly canaliculate between column white with brown-purple ventral stripes, semi-terete, straight, ca. 4 mm long, with an equally long, curved foot that is slightly pubescent dorsally near the apex; anther cap white and campanulate; pollinia not seen. PARATYPES : Peru. Junn. Terrestrial along road Comas FIGURE 2. Masdevallia hortilankesteriani in natural habitat. Photo by Stig Dalstrm. FIGURE 3. Masdevallia hortilankesteriani in natural habitat. Photo by Stig Dalstrm. FIGURE 4. Masdevallia hortilankesteriani Stig Dalstrm.
PAGE 104
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.254 LANKESTERIANACochas, S11.008, W075 04.22, alt. 2800 m. 13 Nov. 2011, S. Dalstrm 3508 (USM). DISTRIBUTION : Masdevallia hortilankesteriani is only reported from steep grassy and rocky slopes of the Andes near the town of Comas, in the region of Junn, where it often grows in full sun along the road. ETYMOLOGY : Named in honor of Lankester Botanical Garden and its staff, in recognition of their support for orchid research in general and in the New World tropics in particular. Masdevallia kareliisp. nov. TYPE: Peru. Puno, Sandia, along Rio Chullo in dense, mossy cloud forest, S14.769, W69.836, alt. ca. 2700 2800 m, 25 Nov. 2010, S. Dalstrm 3533 (holotype, USM). FIGS 6. Diagnosis: Masdevallia karelii is most similar to species such as Masdevallia dudleyii Luer, M. nunezii Luer & Dalstrm, M. juan-albertoi Luer & M.Arias, and M. terborchii Luer, all occurring in the highlands of central Peru, but our new species is distinguished from them all by the rich magenta sepaline pubescence. Epiphytic herb. Plant root-thickness medium for the genus. Ramicauls stout and erect, blackish in the wild, (presumably from a benign fungus) 3.5.8 cm long, basally enclosed by 3 to 4 tubular sheaths. Leaf erect, coriaceous, petiolate, blade basally conduplicate and cuneate, elliptic to ovate, obtuse, 10 1.8.3 cm, including the to ca ca. 13 cm long peduncle; peduncular bract above the middle of the peduncle, tubular ca. 0.9 cm long; tubular, to ca. 1.3 cm long; pedicel ca. 2 cm long; ovary smooth, ca. 0.8 cm long, densely covered by blackish dots in the wild. Flower campanulate, attractive; dorsal sepal basally dark yellow, then rich magenta purple, and apically white with 3 greenish veins and tail, minutely and scatteredly pubescent externally, and richly covered internally above the middle by long purple-magenta hairs, concave, cuneate, angulateobovate, connate with the lateral sepals for ca. 1.2 cm, then obtuse to acute with a slender, gently curved tail, ca. 5.5 1.5 cm, including the 3.5 cm long tail; lateral sepals similar in color and texture, connate for ca. 1.4 cm, angulate-ovate, acute with a slender, recurved apical tail, ca. 5.0 2.7 cm, including the ca. 3 cm long tail; petals white, shortly unguiculate, cartilaginous, oblong, truncate and obliquely bilobed apically, and with a large, incurved basal lobe, or edge, diminishing towards the apex, ca. 6 2 mm; lip apex, hinged on the column foot, with a basal swelling, the hypochile cordate to truncate, ovate to pandurate, the epichile with down-folded edges, acute, dorsally shallowly canaliculate between swollen longitudinal ridges, ca. 5.0 2.7 mm; column white with brownpurple ventral stripes, semiterete, straight, ca. 4.5 mm long, with an equally long, curved foot; anther cap white, campanulate; pollinia not seen. DISTRIBUTION : Masdevallia karelii is only reported from a limited area near Sandia, Puno, Peru, where it grows epiphytically on mossy trunks and branches, commonly near and sometimes on the ground among mossy debris, at 2600 2800 m. FIGURE 5. Masdevallia rimarima-alba, Huasahuasi. Photo by Stig Dalstrm.
PAGE 105
DALSTRM & RUZ PREZThree new Masdevallia species 255LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 6. Masdevallia karelii holotype by Stig Dalstrm.
PAGE 106
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.256 LANKESTERIANA EPONYMY : Named in honor of Karel Deburghgraeve who participated in the discovery of this colorful species. Masdevallia rugosilabia sp. nov. TYPE: Peru. Huancavelica, Salcabamba, Tayacaja, S. Dalstrm 3491 (holotype, USM). Figs. 9, 10. Diagnosis: Masdevallia rugosilabia is distinguished from all other species in the genus by the combination a concave and rugose epichile of the lip. Epiphytic herb. Plant slender but tall for the genus, Ramicauls erect 9.0.5 cm long, enclosed basally by 3 to 4 tubular sheaths. Leaf erect, coriaceous, slender, petiolate, the blade basally conduplicate and cuneate, ovate to elliptic, acute to obtuse, ca. 15.0 2.2 cm, including the 3.0 cm long petiole. dark purple, erect and ca. 16 cm long peduncle and a to ca. 4 cm long rachis; p eduncular bracts 3, bel ow the middle, ca. 5 mm long; tubular, ca. 1.5 cm long; peduncle ca. 1.6 2.0 cm long; ovary ca. 0.4 cm long, weakly carinate. Flower nodding, campanulate; dorsal sepal dark brownish purple externally, dark yellowish brown covered by darker spots internally and with a dull, dark yellowish tail, slightly concave, glabrous externally and verrucose to rugose internally, connate with the lateral sepals for ca. 6 mm, oblong and weakly angulateca. 20 4 mm, including the ca. 10 mm long tail; lateral sepals similar in color and texture, connate for ca. 10 sepaline tail, ca. 15 10 mm, including the 5 mm long tail; petals white, thickly cartilaginous, truncate oblong, apically weakly constricted, then truncate and weakly and diminishing near the middle, and with an additional FIGURE 7. Masdevallia karelii in natural habitat (S. Dalstrm 3533). Photo by Karel Deburghgraeve. FIGURE 8. Masdevallia kareliiS. Dalstrm 3533). Photo by Stig Dalstrm.
PAGE 107
FIGURE 9. Masdevallia rugosilabia the holotype by Stig Dalstrm. DALSTRM & RUZ PREZThree new Masdevallia species 257LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 108
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.258 LANKESTERIANA the middle up to the apex, ca. 3.5 1.2 mm; lip pale purple, hinged on the column foot, with a basal swelling, truncate to corda weakly rugose, the epichile down-folded and convex from above, rounded, rugose, dorsally canaliculate from near the base to the apex, ca. 3.5 2.0 mm; column white, semiterete straight, ca. 4 mm long, with an equally long, curved foot; anther cap white, campanulate; pollinia 2, DISTRIBUTION : Known only from the type locality in central Peru. ETYMOLOGY : The name refers to the rugose lip of the ACKNOWLEDGEMENT The authors thank the staff at the Instituto Recursos Naturales (INRENA), and Betty Milln at the Universidad de San Marcos, Museo de Historia Natural, Lima, for aiding in providing the necessary collecting permits. We also thank Wesley Higgins for commenting on the manuscript, Steve Beckendorf, Guido and Karel Manolo Arias together with his staff and family in Lima for gracious logistic support. LITERATURE CITED Abele, C., B. Rudolph, J. Thiede & J. G. Rohwer. 2005. Phylogeny of the genus Masdevallia on morphological an molecular data. Proceedings of the 18th World Orchid Conference, Dijon, France, 111-115. Luer, C. A. 1986. Icones Pleurothallidinarum 2, Systematics of Masdevallia (Orchidaceae). Monographs in systematic botany from the Missouri Botanical Garden, vol. 16. Luer, C. A. 2006. Icones Pleurothallidinarum 28, A reconsideration of Masdevallia Systematics of Specklinia and vegetatively similar taxa (Orchidaceae). Monographs in systematic botany from the Missouri Botanical Garden, vol. 105. Pridgeon, A. M. & M. W. Chase. 2001. A phylogenetic Lindleyana 16(4): 235-271. FIGURE 10. Masdevallia rugosilabia S. Dalstrm 3491). Photo by Stig Dalstrm.
PAGE 109
Costa Rica has witnessed the emergence and naturalists of the Americas at the beginning of the last century. Names like Alberto Manuel Brenes, Karl Werckl, can be found among those who made Century, hired for three years by the Sarapiqui Estates Ltd. coffee company. Captivated by the natural richness of the country, he came back from England a few years later to build a life in Costa Rica His inclination and acute observation of natural creatures and phenomena in general, and of epiphytes in particular, soon brought the attention of some of the greatest orchidologists and botanists of the time: Dr. Oakes Ames (University of Harvard Herbarium), Paul C. Standley (Director of the United States National Museum) and Robert Allen Rolfe (curator of the orchid herbarium at the Royal Botanical Gardens, Kew), with whom he shared his areas in the region of the Cartago province. Lankesters tremendous passion for plants, great capacity to Costa Rican orchid studies. His last dream to preserve the botanical collections held in his farm and to make a contribution to conservation came true in 1973 with the foundation of the Lankester Botanical Garden. This paper is the third part of a series aimed towards the completion of the Costa Rican Flora Orchidaceae. In the last few years knowledge on the Costa Rican et al. 2008; Karremans et al. 2012). Bogarn (2011) reported 1519 species for the country, which meant up to 20 additions per year in the last decade. That trend was expected to be maintained by Karremans et al. (2012), but even though the country already hit the 1600 species mark (Karremans & Bogarn 2013), the novelties might increase rather than decrease in the LANKESTERIANA 13(3): 259. 2014. I N V I T E D P A P E R NEW SPECIES AND RECORDS OF ORCHIDACEAE FROM COSTA RICA. III MELANIA FERNNDEZ 1,2,4 DIEGO BOGARN 1,2 ADAM P. KARREMANS 1,3 & DANIEL JIMNEZ 11Jardn Botnico Lankester, Universidad de Costa Rica, P. O. Box 302-7050 Cartago, Costa Rica.2Herbario UCH, Universidad Autnoma de Chiriqu, 0427, David, Chiriqu, Panama.3Naturalis Biodiversity Center NHN Universiteit Leiden, The Netherlands. 4 ABSTRACT. The establishment in Costa Rica of the great naturalist Charles H. Lankester in the 19th century brought a tremendous increase in the knowledge of Costa Rican Orchidaceae. His desire to leave the collections of Lankester Botanical Garden (JBL). Since then, JBL has followed Lankesters legacy with its consolidation as a leading center for the study of Neotropical orchids, resulting among others in more than 180 new Costa Rican species and records in the last 12 years. This manuscript includes the description of four new species and seven new records, as part of JBLs contribution to the completion of the Costa Rican orchid inventory. KEY WORDS : Epidendrum jorge-warneri, Platystele tica Platystele catiensis, Platystele sylvestrei, new species, new records, Orchidaceae, Costa Rica* This contribution was prepared as part of the special edition of LANKESTERIANA dedicated Lankester Botanical Gardens 40th anniversary.
PAGE 110
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.260 LANKESTERIANAcoming years. Here, we describe four new species and report the presence of six new records, illustrated with both photographs and detailed line drawings. Although Sobralia bletiae Rchb.f. was previously known to occur in Costa Rica, an illustration and photograph based on a Costa Rican specimen is also included. 1. Epidendrum jorge-warneri Karremans & Hgsater, sp. nov. TYPE: Costa Rica. Puntarenas: Buenos Aires, Buenos Aires, Oln, cumbre del Cerro Tinuk, 9.1 N 831.2 W, 2417 m, bosque pluvial julio 2012, A.P. Karremans 5545, D. Bogarn, D. Jimnez & V.H. Ziga (holotype, CR!; isotype, A ). Epidendro anoglossoido Ames & C.Schweinf. simile sed planta minore, caulis complanatis, folia longiores, labello lanceolato longiore differt. Epiphytic, sympodial, caespitose, erect herb, up to 20 cm tall. Roots from the base up to above half the Stem 15-20 cm tall, erect. Leaves up to 5, distributed along the stem, mostly close to the apex as the basal ones fall off with time; leaf sheath tubular, rugose, 1.5 cm long; blades 2.8-3.6 0.8-1.3 cm, elliptic to narrowly-ovate, obtuse bilobed, articulate. Spathaceous bracts lacking. apical, mostly from lateral branches, distichous, Floral bracts equal to longer Flowers 2-4, simultaneous, resupinate, brownish-yellow; fragrance sweet during the day. Ovary 8.0-8.5 mm, laterally Sepals free, spreading, the dorsal prominently bent inwards, narrowly-ovate to elliptic, acute, 9-veined, margin entire; the dorsal sepal 15 3.5 mm; the lateral sepals 15 4.0-4.5 mm, oblique. Petals 13.0-13.5 1.5-2.0 mm, spreading, strongly bent backwards, ligulate to narrowly-elliptic, obtuse, 3-veined, margin entire. Lip 12.5 5.5-6.0 mm, united to the column, ovatelanceolate, slightly 3-lobed, margin wavy, embracing the column, completely covering it; callus Y-shaped, prolonged into a central rib extending to the apex of the lip; lateral lobes hemi-rhomboid; mid-lobe triangular, acute, apiculate. Column 3.5 mm long, straight, with two apical somewhat rounded wings. Clinandriumhood short. Anther narrowly ovate with a prominent central rib, 4-celled. Pollinia 4, obovoid, laterally compressed, caudicles granulose. Rostellum apical, slit. Nectary penetrating the ovary up to near the base. Capsule not seen. NOTE : Description based only on Karremans 5545. DISTRIBUTION : known only from Costa Rica. EPONYMY : The name honors Jorge Warner, current Director of the Lankester Botanical Garden of the University of Costa Rica. With more than a decade in his position he has been paramount in the development of the research center at the garden, and in the creation and execution of the research projects, which allows HABITAT IN COSTA RICA : Known only from the plants found on the summit of Cerro Tinuk, Costa Rica. It grows epiphytically and lithophytically in a small area of isolated paramo, at around 2400 m elevation. PHENOLOGY Epidendrum jorge-warneri belongs to the monopodial, branching stems, the spike-like, distichous Subgroup which has a branching habit with fewby the laterally compressed stems, the laterally compressed rachis and ovary, the 2-4, large, brownishcompletely and the Y shapped callus of the lip.. Epidendrum anoglossoides Ames & C.Schweinf. is the most similar species, but it has much smaller, up to 9, long, lip 6 mm long, and callus of the lip tri-dentate. 2. Lepanthes ankistra Luer, Orquideologa 16(3): 12. 1986. TYPE: Panama. Prov. of Chiriqu: epiphytic in cloud forest on Cerro Colorado, alt. 1500 m, 15 February 1985, C. Luer, J. Luer, R.L. Dressler & K. Dressler 10534 (holotype, MO).
PAGE 111
FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III261LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 1. Epidendrum jorge-warneri A.P. Karremans 5545 (JBL-Spirit). A B C D E
PAGE 112
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.262 LANKESTERIANA FIGURE 2. Lepanthes ankistra D. Bogarn 9698. A B C D F E
PAGE 113
FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III263LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. DISTRIBUTION : endemic to the Cordillera de Talamanca in southern Costa Rica and western Panama. ETYMOLOGY : from the Greek ankistra allusion to the shape of the lower lobes of the petals. HABITAT IN COSTA RICA : epiphytic in premontane wet Talamanca from 1500 to 2147 m of elevation. Plants were found growing in primary oak forest. PHENOLOGY July. COSTA RICAN MATE R IAL STUDIED : Puntarenas: Coto Brus, Sabalito, Zona Protectora Las Tablas, 13 km al noreste de Lucha, Sitio Coto Brus, Finca de la familia Sand-Hartmann, camino hacia la fontera Costa Rica Panam, 8.5 N 82.6 W, 2147 m, D. Bogarn 9698 (JBL-Spirit!; figs. 2, 14 B ). COSTA RICA-PANAM. Puntarenas-Bocas del Toro: divisoria de aguas ingresando por el camino de la Finca Sand-Hartmann El Capricho, 8.34N 82.69W, 2154 m, bosque pluvial montano bajo, 11 Diciembre 2013, D.Bogarn 10741, A. Karremans, M. Fernndez & L. Sandoval (JBLspirit!). Among the Costa Rican Lepanthes, L. ankistra is the surface of the leaves, within the central groove. setiform lobes at the base of the upper and lower lobes with sharply uncinate lower lobes. The lip lobes are hiding the column and the appendix is oblong, pubescent, scaphoid and conspicuous. This species is closely related to L. brunnescens Luer, an endemic to Cerro Jefe in central Panama, but the latter species lacks the uncinate lobes of the lower lobes of the petals. These Lepanthes species are unusual in Costa Rica. They are indeed closely allied to the South American L. mucronata Lindl., one of the most frequent species of the genus in the Andes (Luer 1996). Besides L. mucronata, there are at least 17 species from South America that may be related to L. ankistra and L. brunnescens (Luer 1996). The transverse setiform lobes at the base of the upper and lower lobes, the lip lobes united and hiding the column and the variously pubescent, scaphoid appendices may group all those species. 3. Lepanthes otopetala Luer, Lindleyana 6: 76. 1991. TYPE: Panama. Chiriqu, collected by A. Maduro, Orchids, Easton, CT, May 1990, C. Luer 14741 (holotype, MO). DISTRIBUTION : endemic to the Cordillera de Talamanca in southern Costa Rica and western Panama. ETYMOLOGY : from the Greek otopetalon, an ear-like petal in allusion to the ear-like upper lobes of the petals. HABITAT IN COSTA RICA : epiphytic in lower montane wet Talamanca at around 2400 m of elevation. Plants were found growing on primary oak forest. PHENOLOGY and May. COSTA RICAN MATERIAL STUDIED : Puntarenas-Chiriqu: Cerro Pando, despus del mojn N.338, 81.22N 82.18W, 2446 m, bosque muy hmedo 2011, D. Bogarn 8715, D. Jimnez & A.P. Karremans (JBL-Spirit!; figs. 3, 14 C ). This species shares features with the members of the Lepanthes disticha Garay & R.E. Schult. complex such as the erect plants, blackish amplectent lepanthiform developed beneath the leaf. However, the matt dark ciliate lip blades and the conspicuous ear-like upper lobe of the petals, which is longer and wider than the lower lobe easily distinguish this species (Luer 1991). The voucher cited here was collected along the border of Costa Rica and Panama. 4. Lepanthes truncata Luer & Dressler, Orquideologa 16(3): 9. 1986. TYPE: Panama. Prov. of Bocas del Toro: epiphytic in wet forest between Fortuna and Chiriqu Grande,
PAGE 114
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.264 LANKESTERIANA FIGURE 3. Lepanthes otopetala view. E Lip, spread. Drawing by D. Bogarn and D. Solano based on D. Bogarn 8715. A B C D E
PAGE 115
FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III265LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.alt. 350 m, 17 February 1985, C. Luer, J. Luer, R.L. Dressler & K. Dressler 10618 (holotype, MO). DISTRIBUTION : endemic to the Caribbean lowlands of Costa Rica and Panama. ETYMOLOGY : from the Latin truncatus, truncate in allusion to the truncate apex of the upper lobes of the petals. HABITAT IN COSTA RICA : epiphytic in premontane rain forest, on the Caribbean watershed of the Cordillera de Talamanca below 400 m of elevation. PHENOLOGY to October. COSTA RICAN MATERIAL STUDIED : Cartago-Limn: Turrialba y Siquirres, Pacuarito-Tayutic, Parque Nacional Barbilla, sendero hacia el Ro Dantas (Venado), 9.35N 83.33W, 382 m, y secundario, 25 mayo 2012, D. Bogarn 9652, A.P. Karremans & J. Sharma (JBL-Spirit!; figs. 4, 14 DE ). sepals and petals and the lip is reddish-pink with the blades separated, not hiding the column, and the appendix is minute, pubescent. As noted by Luer & Dressler (1986), the most distinctive character of L. truncata is the broadly truncate apex of the upper lobe of the petals. 5. Platystele catiensis Karremans & Bogarn, sp. nov. TYPE: Cartago: Turrialba, Turrialba, Campus del Centro Agronmico Tropical de Investigacin y 9N 83.5W, 639 m, bosque muy A. P. Karremans 5442, D. Bogarn & J. Sharma 5, 14 F ). Species haec P. oxyglossa (Schltr.) Garay similis, sed aequilonguis, minutissime glandulosis, acutis, labello ovato-elliptico glanduloso differt. Plant minuscule, epiphytic, caespitose, erect, Roots Ramicauls erect, slender, 1-2 mm long, enclosed by tubular, imbricating, slightly compressed, membranous sheaths, becoming brownish and papery with age. Leaf elliptic, erect, conduplicate, subacute, emarginate, abaxially keeled and terminating in a short apiculus, 5-8 2-3 mm, narrowed at the base into a conduplicate petiole. racemose, open at a time, up to 1.2-1.3 cm long, peduncle to 6-8 mm long, pedicels 1.0-2.0 mm long. Floral bracts acute, conduplicate, to 0.5 mm long. Ovary terete, smooth, to 0.4 mm long. Flowers sepals and petals transparent yellowish-green, lip and column reddishorange, about 4.5 mm in diameter. Dorsal sepal narrowly lanceolate-elliptic, spreading widely, acute to shortly acuminate, marginally glandulose, 2.2-2.3 0.7 mm. Lateral sepals subequal to the dorsal sepal, lanceolate-elliptic, spreading widely, acute to shortly acuminate, marginally glandulose, 2.0-2.1 1.0 mm. Petals spreading widely, narrowly elliptic-lanceolate, acute to shortly acuminate, margins glandulose, 1-veined, 2.1 0.4 mm. Lip ovate-elliptic, shortly acuminate, glandular-hirsute, especially at the apex, with a small glenion at the base, 1.5 mm x 0.7 mm. Column short, sub-cylindrical, 0.4 mm long. Anther apical, stigma subapical, transversely bilobed at each side of the anther. Pollinia 2, ovoid. NOTE : Description based on Karremans 30, 5442, 5443 and Bogarn 9661. PA R ATY P ES : Costa Rica. Cartago: Turrialba, Turrialba, Espaveles. 9 N 83 W, 600 m, 30 de enero del 2004, A.P. Karremans 30 & J. Velsquez (JBL-Spirit!). Turrialba, Turrialba, Campus del Centro 83.5W, 639 m, bosque muy hmedo premontano, 24 mayo 2012, A. P. Karremans 5443, D. Bogarn & J. Sharma (JBL-Spirit!). Cartago-Limn: Turrialba y Siquirres, Pacuarito-Tayutic, Parque Nacional Barbilla, sendero hacia el Ro Dantas (Venado), 9.35N 83.33W, 382 m, bosque pluvial premontano, D. Bogarn 9661, A.P. Karremans & J. Sharma, 25 Mayo 2012
PAGE 116
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.266 LANKESTERIANA FIGURE 4. Lepanthes truncata Luer & Dressler. A Habit. B Flower. C Dissected perianth. D Column and lip, lateral view. E Lip, spread. F Pollinarium and anther cap. Drawing by D. Bogarn and D. Solano based on D. Bogarn 9652. A B C D F E
PAGE 117
FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III267LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 5. Platystele catiensis Karremans & Bogarn. A Habit. B Flower. C Dissected perianth. D Column and lip, lateral view. E Lip, spread. F Pollinarium and anther cap. G Sepal margin. Drawing by D. Bogarn and A.P. Karremans 5442 (JBL-Spirit). A B C D F E
PAGE 118
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.268 LANKESTERIANA(JBL-Spirit!). Heredia: Sarapiqu, Puerto Viejo, Finca La Selva, 3 km SE of Puerto Viejo de Sarapiqu, 50150 m, 22 Nov. 1979, C. Todzia 1035 (CR!). Sarapiqu, station near junction of Puerto Viejo and Sarapiqu rivers. Elevation 40-100 m. Camino Circular Lejano (CCL) 950. 11 Mar. 1991, K. Richardson (CR!). Sarapiqu, Puerto Viejo, Estacin Biolgica La Selva, at Atlantic slope. 10N 84W, 50-100 m, growing on twigs near major treefall along Camino Circular Lejano, 12 Oct. 1990, M. Grayum 9994 (INB!). Limn: shores of Cao Perreira; periodically inundated swamp forest, Priora dominant. 20 Mar. 1897, W.D. Stevens, G. Herrera & O.M. Montiel 25151 (INB!; MO). OTHER RECORD s: Costa Rica. Heredia: Sarapiqu, Puerto Viejo, Estacin Biolgica La Selva, O. Vargas 2148 (Digital Photograph!). DISTRIBUTION : known only from Costa Rica. ETYMOLOGY : the name honors the Centro Agronmico is, like Lankester Botanical Garden, celebrating its 40th Anniversary in 2013. HABITAT IN COSTA RICA : epiphytic in primary and and mature secondary humid premontane forest, at around 300-650 m elevation. It is known from the Caribbean lowlands, especially the Sarapiqu, Siquirres and Turrialba areas. The species grows on the protected dense mature vegetation right behind the main building of CATIE, where it is found on small branches that fall from the large trees in the Espaveles path, which on the path that descends to Dantas river in the Barbilla National Park. PHENOLOGY Platystele catiensis has been confused in Costa Rica with the apparently widely distributed and variable P. oxyglossa. The latter is also found in the country (Luer 1990), but P. catiensis is typically found growing below elevations of 650 m in the Caribbean lowlands (vs. growing at an elevation of 1000-2500 m in the Central and Talamanca Cordillera), it has a much smaller plant with 1.0-2.0 mm long pedicels (pedicels 2.5-7.0 mm long), with less than 5 mm between each one (distance with sepals and petals up to 2.3 mm long (vs. up to 3.5 mm long), and the lip up to about 1.5 mm long (vs. 2.5 mm long). From the Guatemalan type material of P. oxyglossa, P. catiensis can be distinguished by the shorter (2.2-2.3 mm), shortly acuminate and marginally glandular sepals (vs. sepals 2.5 mm, long acuminate, glabrous), the petals and lip are longer, subequal to the sepals, the petal margin is glandular, while the lip is elliptic, and completely glandular-hirsute, especially near the apex (vs. sepals and lip 1.5 mm, much shorter than the sepals, and are glabrous, the lip is ovatelanceolate). It might well turn out that none of the Costa Rican material can be referred to P. oxyglossa. In that case the larger species found in the Central Cordillera should be referred to as Platystele schulzeana (Schltr.) Garay, described from La Carpintera. For the time being we only segregate the easily distinguished and morphologically constant P. catiensis, and point out that the name P. oxyglossa has been applied to two have been placed under synonymy of P. oxyglossa, but from what we have seen they are most likely not the same species, and certainly are not the same as those found in Costa Rica. The recently described Platystele paraensis Campacci & da Silva has the typical general P. oxyglossa complex, and is as tiny as P. catiensis. It can be distinguished by the caudate, that have an orange mid-vein and are much longer than the lip, which is apically yellow-orange. Platystele psix cellular-pubescent sepals and petals. Another similar species occurs in Panama and Ecuador, Platystele taylorii is long acuminate and exceeds the glabrous sepals. 6. Platystele sylvestrei Karremans & Bogarn, sp. nov. TYPE: Costa Rica. Cartago: Paraso, Orosi, Tapant, Parque Nacional Tapant, camino entre el portn del Mirador hacia el Ro Humo, Proyecto
PAGE 119
FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III269LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Hidroelctrico Tapant, 9.9N 83.2 W, 1650 m, bosque pluvial premontano supra arbores et ad truncos prostratos vetustos ad Tapanti, 18 Noviembre 2010, D. Bogarn 8240, R. Gmez, A.P. Karremans, B. Klein, G. Meza & F. Pupulin Species haec P. oxyglossa (Schltr.) Garay similis, petalisque angustissimis, labello angusto-ovato lanceolato differt. Plant medium for the genus, epiphytic, caespitose, Roots Ramicauls erect, slender, 5-8 mm long, enclosed by tubular, imbricating, slightly compressed, membranous sheaths, becoming brownish and papery with age. Leaf narrowly obovate-elliptic, erect, conduplicate, obtuse, emarginate, 20-35 5-7 mm, narrowed at the base into a conduplicate petiole. up to 12 cm long, peduncle to 7 cm long, pedicels 1.0-1.5 cm long. Floral bracts acute, conduplicate, to 1 mm long. Ovary terete to suborbicular, smooth, Flowers cleistogamous or autogamous (at least in the material at hand), sepals and petals transparent whitish, with a violet blotch on the base of the lip and violet markings on the column, about 4 mm in diameter. Dorsal sepal narrowly ovate, spreading widely, acute, glabrous, 2.3-2.4 0.5 mm. Lateral sepals subequal to the dorsal sepal, narrowly ovate, spreading widely, acute, glabrous, 2.3 0.60.7 mm. Petals spreading widely, linear to narrowly lanceolate, acute, margin somewhat irregular, 1-veined, 2.0 0.2-0.3 mm. Lip very narrowly ovatelanceolate, shortly acuminate, glabrous, without an evident glenion at the base, 1.6-1.7 0.5 mm. Column short, thick due to autogamy, sub-cylindrical, 0.5 mm long. Anther not noted, stigma deformed, apical. Pollinia not observed. NOTE : Description based only on Bogarn 8240. PA R ATY P ES : Costa Rica. Alajuela: San Ramn, Piedades, unpaved road from Piedades Norte to Piedades Sur, San Antonio de Zapotal, 10.9N 84.5W, 1410 m, Caribbean watershed of the Continental Divide, premontane cloud forest, 24 March 2005, F. Pupulin 5595, E. Salas-Pupulin, D. Bogarn & A.C. Rodrguez (JBL-Spirit!). Puntarenas: Reserva Biolgica Monteverde, Ojo de Agua, 10N 84W, 1600 m. 14 nov. 1987. W. Haber & E. Bello 7808 (INB!; Illustration-INB!). Puntarenas: slope and continental divide, road to divide, swamp along Sendero Pantanoso and Sendero Chomogo. 10N 84W, 1550-1600 m. Epiphyte. 14 Mar. 1990. W. Haber & W. Zuchowski 9798 (INB!). Costa Rica Panama: Puntarenas-Bocas del Toro: divisoria de aguas ingresando por el camino de la Finca Sand-Hartmann El Capricho, 8.34N 82.69W, 2154 m, bosque pluvial montano bajo, 11 diciembre 2013, A.P. Karremans 6130, D. Bogarn, M. Fernndez & L. Sandoval (JBL-Spirit!; D. Bogarn 10744, A.P. Karremans, M. Fernndez & L. Sandoval (JBLB ). DISTRIBUTION : known only from Costa Rica and Panama. ETYMOLOGY : El Silvestre (the uncultivated) was the name of Charles H. Lankesters farm before becoming Lankester Botanical Garden in the hands of the University of Costa Rica. This species honors the gardens 40th anniversary. HABITAT IN COSTA RICA : epiphytic in mature humid premontane forest, between 1410 and 1650 m elevation. It is known from a few but distant localities, Tapant National Park in Cartago, close to San Ramn in Alajuela, the Monteverde area in Puntarenas, and on both sides of the continental divide close to the Costa Rica Panama border. PHENOLOGY and November and December, considering the Platystele sylvestrei probably belongs to the P. oxyglossa species complex, however, it has a relatively large habit, reaching above 10 cm when including the
PAGE 120
FIGURE 6. Platystele sylvestrei Karremans & Bogarn. A Habit. B Flower. C Dissected perianth. D Column and D. Bogarn 8240 (JBL-Spirit). A B C D ELANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.270 LANKESTERIANA
PAGE 121
ovate-lanceolate lip. 7. Platystele tica Karremans & Bogarn, sp. nov. TYPE: Costa Rica. Puntarenas: Buenos Aires, Volcn, 09N, 83W, ca. 450 m, bosque muy hmedo premontano transicin a basal en bosque secundario muy alterado a orillas de un riachuelo, 17 de abril 2012, A.P. Karremans 5315, J. Cambronero & J. Geml (holotype, JBL-Spirit!; GH ). Species haec P. oxyglossa (Schltr.) Garay similis, sed petalisque acutis latiores, labello ovato acuto differt. Plant minuscule, epiphytic, caespitose, erect, Roots Ramicauls erect, slender, 1-2 mm long, enclosed by 2-3 tubular, imbricating, slightly compressed, membranous sheaths, becoming brownish and papery with age. Leaf elliptic, erect, abaxially keeled and terminating in a short apiculus, 5-7 1.5-2.5 mm, narrowed at the base into a conduplicate petiole. racemose, distichous, successively long, peduncle to 1.2 cm long, pedicels 1.5-2.0 mm long. Floral bracts acute, conduplicate, to 0.5-0.8 mm long. Ovary terete, smooth, to 0.3 mm long. Flowers monochrome yellow, about 1.8 mm in diameter. Dorsal sepal narrowly ovate-elliptic, spreading widely, acute, glabrous, 0.9 0.5 mm. Lateral sepals subequal to the dorsal sepal, broadly elliptic, spreading widely, acute, glabrous, 0.9 0.7 mm. Petals spreading widely, narrowly elliptic-lanceolate, acute, margins irregular, 1-veined, 0.9 0.3 mm. Lip ovate, shortly acuminate, glandular, especially at the apex, margin irregular, with a small glenion at the base, 0.8-0.9 0.4-0.5 mm. Column short, sub-cylindrical, 0.3-0.4 mm long. Anther apical, stigma subapical, transversely bilobed at each FIGURE 7. Platystele sylvestrei (Karremans 6130Bogarn 10744). Photographs by A.P. Karremans (A) and D. Bogarn (B). FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III271LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 122
FIGURE Platystele tica Karremans & Bogarn: A The specimen that served as type material, in situ, compared with a pencil. B On the left Platystele microtatantha (Schltr.) Garay (Bogarn 10241), on the right Platystele tica (Karremans 5929A). Photographs by A.P. Karremans. LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.272 LANKESTERIANA
PAGE 123
FIGURE 9. Platystele tica Karremans & Bogarn. A Habit. B Flower. C Dissected perianth. D Column and lip, lateral view. E Column, front view. F Pollinarium and anther cap. G Sepal margin. Drawing by D. Bogarn and A.P. Karremans 5315 (JBL-Spirit). A B C D E FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III273LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 124
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.274 LANKESTERIANAside of the anther. Pollinia 2, ovoid. NOTE : Description based on Karremans 5315, 5829A and Pupulin 2928. PARATYPES : Costa Rica. Puntarenas: Buenos Aires, Volcn, Cacao, orillas del Ro Cacao en bosque secundario bajo el puente de la Carretera Interamericana, 9.441N 83.002W, 449 m, bosque muy hmedo premontano transicin a basal, A.P. Karremans 5829A, D. Bogarn, J. Cambronero & F. Pupulin along the boarder of ro Divisin, 320 m, 9N 83W, epiphytic on tall trees along the river shore, 21 Jan. 2001, F. Pupulin 2928, D. Castelfranco & L. Elizondo (JBL-Spirit!). OTHER RECORDS protegida. Cuenca del Naranjo y Paquita. Valle del General, Longo May. Ro Sonador, 1400-1800 m, J. F. Morales 13937 (INB!; INB-Spirit). Geographical suggests that this specimen is P. tica, however, the with certainty and we were not able to locate the spirit specimen. A text and its accompanying photographs by Pontus Aratoun featuring a Platystele species from Mecana beach, Choco, Colombia (available through http:// miniorchids.wordpress.com), possibly represents the same species. DISTRIBUTION : known only from Costa Rica. It may also be present southwards into Colombia. EPONYMY : the name honors Costa Rica, country where this minuscule species was found, and the people of which are known as tico and tica. The nickname tico or tica comes from the Costa Rican linguistic custom Platystele. HABITAT : epiphytic in secondary forest in premontane wet forest, between about 300 and 450 m (1400-1800 m?) elevation. It is known only from the Costa Rican PHENOLOGY to June, however considering the slowly successive for months at a time. Platystele tica is without obvious close relatives in Costa Rica. General plant morphology would suggest P. oxyglossa group, as does the lip shape. The new species, however, lacks the typical caudate sepals and the reddish-purplish coloring of reminiscent of (Schltr.) Garay, however that species has a creeping habit. P. tica only by that of P. enervis Luer, P. ornata Garay and P. umbellata Rican famous dwarfs, P. jungermannioides (Schltr.) Garay and P. microtatantha (Schltr.) Garay, look large. This species might not necessarily be rare, we have observed at least a couple of specimens more in the of herbarium collections and habitat loss in the area it grows, it is not unsurprising that it had escaped description. 8. Ponthieva villosa Lindl., Pl. Hartw. 155. 1845. TYPE: Ecuador. In montibus Paccha rarissima, T. Hartweg s.n. (holotype: K). Syn. Ponthieva crinita Garay, Fl. Ecuador 9: 214. 1978 (AMES!). DISTRIBUTION : Costa Rica, Colombia, Ecuador and Peru. ETYMOLOGY in reference to the prominent ventral vesicle behind the perianth. HABITAT IN COSTA RICA : the only known specimen was found growing as an epiphyte on a roadside close to Tapant National Park, in sub montane wet forest, at about 1500 m. COSTA RICAN MATERIAL STUDIED : Cartago: Paraso, Orosi, Tapant, sobre el camino a Tausito, unos 4 km del cruce al Parque Nacional Tapant, 9.82N de la calle, bosque pluvial premontano, 12 de febrero 2012, A.P. Karremans 5040 I ). The specimen here cited was collected singly, in bloom, on a roadside of a frequented collecting site, and was initially thought to be a novelty. However, the illustrations of Ponthieva villosa from Ecuador
PAGE 125
FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III275LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 10. Ponthieva villosa Lindl. A Habit. B Flower. C Dissected perianth. D Column and lip, lateral view. A.P. Karremans 5040 (JBL-Spirit). A B C D E F
PAGE 126
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.276 LANKESTERIANAin Dodson and Dodson (1989) and from Colombia P. crinita (which has been considered a synonym of P. villosa), are so similar to the Costa Rican plant that we are unable to distinguish them with the material and information at hand. Unfortunately not much is known about P. villosa in general, the original description is holotype. The specimen collected close to Tapant is in any case a species morphologically quite distinct to any previously reported species of Ponthieva from Costa Rica, and for now will bear the name P. villosa. completely hirsute, from the leaves to the back of the sepals. The leaves are quite narrow, with the margins undulate. The sepals are greenish, while the petals are yellowish-green with a large white spot above the middle. The lateral sepals are almost entirely free. The lip is prominently concave and glossy. 9. Restrepia aberrans Luer, Orquideologa 20(2): 117. 1996. TYPE: Panama. Bocas del Toro, epiphytic in forest above Chiriqu Grande, alt. 350 m, 17 Feb 1985, collected by C. Luer, J. Luer, R. Dressler & K. in Bristol, CT., 26 Apr 1987, C. Luer 10612 (holotype, MO). DISTRIBUTION : Costa Rica and Panama. ETYMOLOGY : from the Latin aberrans, aberrant, other species of the genus (Luer 1996). HABITAT IN COSTA RICA : Known only from the premontane wet forests of Costa Rican Atlantic watershed between 350 m to 790 m of elevation, growing on branches of Ficus sp. COSTA RICAN MATERIAL STUDIED Pejibaye, La Marta, laderas del ro Gato. Reserva Biolgica La Marta, sendero Tepemechines, creciendo en ramas de Ficus sp. 9N 83W, 790 m, A.P. Karremans 5069 J ). Restrepia aberrans narrowly triangular dorsal sepal, concave at the base, the lateral sepals partially connate with erect sides towards the base, the parallel petals slightly widened at the apex, the trilobed lip with the lateral lobes erect, oblique, and two inner, erect blades; the column is half the length of the lip, widened towards the apex. The specimen here cited was found growing in the premontane wet forest of La Marta Wildlife Refuge, located in the Costa Rican Atlantic lowlands. Based on the available literature, the only specimen known before this record was that of the type specimen, which was coincidentally found in the Atlantic lowlands of western Panama, near the border with Costa Rica. Opposed to the type specimen, no evidence of cleistogamy was observed in the Costa Rican plant. Likewise, the lateral sepals of the latter remained 10. Sobralia bletiae Rchb.f., Bot. Zeitung (Berlin) 10: 713. 1852. TYPE: : Chiriqui Panama, Warszewicz s.n. (holotype, W). DISTRIBUTION Rica and Nicaragua. ETYMOLOGY : most probably refers to the similarity of Bletia. HABITAT IN COSTA RICA : Known from the tropical wet forests of the Osa peninsula in southern Costa Rica, growing at low elevations in secondary forests. COSTA RICAN MATE R IAL STUDIED : Puntarenas: Osa, Sierpe, camino a Baha Drake, entre Rincn y Rancho Quemado, 8.3N 83.5W, 214 m, en bosque secundario y cercas a orillas del camino, bosque muy hmedo tropical sylvas ad peninsula Osa regione sinus Dulce versus Drake prope Rancho Quemado, D. Bogarn 8497, A.P. Karremans & J. Sharma K ); Puntarenas: Osa, P.N. Piedras Blancas, 8.69 -83.23, Estacion Rio Bonito, 100 m, E. Fletes 424 (INB, MO); Puntarenas: Osa, 08N 083W, 20 300 m, epiphytic in disturbed primary forest, 6-7 Feb. 1974, R. L. Liesner 1817 (MO). The habit of S. bletiae is similar to that of several other Sobralia, such as S. decora Bateman and S. mucronata
PAGE 127
FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III277LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 11. Restrepia aberrans Luer. A Habit. B Flower. C Dissected perianth. D Column and lip, lateral view. based on A.P. Karremans 5069 (JBL-Spirit). A B C D E F
PAGE 128
FIGURE 12. Sobralia bletiae Rchb.f. A Habit. B Flower. C Dissected perianth. D Column and lip, lateral view. based on D. Bogarn 8497 (JBL-Spirit). A B C D E F LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.278 LANKESTERIANA
PAGE 129
FIGURE 13. Trichosalpinx caudata Luer. A Habit. B Flower. C Dissected perianth. D Column and lip, lateral M. Fernndez 546 (JBL-Spirit). A E B C D F FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III279LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 130
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.280 LANKESTERIANA
PAGE 131
red-to-brown keels, and a mucronate apex. The column narrows towards the base, and the pollinia are dorsally Although several authors had reported this species as present in Costa Rica (Ames 1937, Williams 1956, Mora & Garca 1992, Dressler 1993, Garca et al. 1993), the existence of two Costa Rican herbarium specimens was unknown until relatively recently (Pupulin 2002, Dressler 2003): R. L. Liesner 1817 (MO), and E. Fletes 424 (INB, MO), both from the lowlands of the time based on Costa Rican material. 11. Trichosalpinx caudata Luer & R.Escobar, Monogr. Syst. Bot. Missouri Bot. Gard. 64: 20. 1997. TYPE: Colombia. Antioquia: La Tebaida, collected by Colomborqudeas, 16 May 1993, C. Luer 16907 (MO). DISTRIBUTION : Costa Rica, Panama and Colombia. ETYMOLOGY : from the Latin caudatus, caudate, referring to the tails of the lateral sepals (Luer 1997). HABITAT IN COSTA RICA : T. caudata has been found growing epiphytically at low elevations in disturbed areas close to water bodies along the northern Atlantic plains and in open areas of the Osa Peninsula, mostly at 100 m [to 1200-1400 m] COSTA RICAN MATE R IAL STUDIED : Alajuela: San Carlos, Boca Tapada, alrededores del Hotel Laguna de ro Lagarto, en jardn del hotel Arenal Paraso, 100 m, 10 oct 2004, C. Ossenbach 368 & P. Casasa (JBL-Spirit!). M. Fernndez 546 13, 14 L ). Puntarenas: Osa, San Juan, cuenca media del morada de pice anaranjado, conspicuo, 5 noviembre 1990, G. Herrera 4568 Carretera Interamericana, La Ese, km 114-122, orilla de la carretera, 9N 83W, 1200-1400 m, 12 julio 2005, A. Rojas 6474 & H. Kennedy (JBL-Spirit!). Trichosalpinx caudata and T. orbicularis (Lindl.) Luer are vegetatively almost indistinguishable. the most conspicuous differentiating character. The sepals can reach up to 8.5 mm long (vs. 3.5-6.5 mm), the dorsal sepal is narrowly triangular (vs ovate), while the lateral sepals are connate only at the base, The petals are narrowly acute to acuminate (vs. acute longer than the column (vs. one-third longer than column). ACKNOWLEDGEMENTS services of Costa Rican Ministry of Environment and Energy (MINAE) and its National System of Conservation which wild species treated in this study were collected. To the Vice-Presidency of research of the University of Costa Rica for providing support under the projects Inventario y (814-A7-015), Flora Costaricensis: Taxonoma y Filogenia de la subtribu Pleurothallidinae (Orchidaceae) en Costa Rica (814-BO-052), Filogenia molecular de las especies de Orchidaceae endmicas de Costa Rica (814-B1-239) (814-B2-161). We are also grateful to the personnel at CR, INB, JBL and USJ for granting full access to their Darha Solano, illustrators at JBL, who prepared some of the plates included in the article. LITERATURE CITED Ames, O. 1937. Orchidaceae. Orchid Family. In P. C. Standley (ed.) Flora of Costa Rica. Vol. 18. Field Museum of Natural History Botany, p. 292. Bogarn, D. 2011. How many orchid species in Costa Rica? A review of the latest discoveries. In: A. M. Pridgeon & H. G. Navarrete Zambrano (eds.). Proceedings of the Lankesteriana 11(3): 185. Left, FIGURE 14. A Epidendrum jorge-warneri, (A.P. Karremans 5545). B Lepanthes ankistra (D. Bogarn 9698). C Lepanthes otopetala (D. Bogarn 8715). D & E Lepanthes truncata (D. Bogarn 9652). F Platystele catiensis (A.P. Karremans 5442). G & H Platystele tica (A.P. Karremans 5315). I Ponthieva villosa (A.P. Karremans 5040). J Restrepia aberrans (A.P. Karremans 5069). K Sobralia bletiae (D. Bogarn 8497). L Trichosalpinx caudata F, G, I) and F. Pupulin (H). FERNNDEZ et al New species and records of Costa Rican Orchidaceae. III281LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 132
Bogarn, D. & A. P. Karremans. 2010. Un nuevo Platystele (Orchidaceae: Pleurothallidinae) de la regin central de Costa Rica/A new Platystele (Orchidaceae: Pleutothallidinae) from central Costa Rica. Orquideologa 27: 208. Bogarn, D., A. P. Karremans & F. Pupulin. 2008. New records and species of Orchidaceae from Costa Rica. Lankesteriana 8(2): 53. Dodson, C.H. & P.M. de Dodson. 1989. Icones Plantarum Tropicarum 2(6): Orchids of Ecuador. Missouri Botanical Garden. Dressler, R. L. 1993. Field Guide to the Orchids of Costa Rica and Panama. Cornell University Press, p. 319. Dressler, R. L. 2003. Sobralia. Pp. 506 in: B. E. Hammel, M. H. Grayum, C. Herrera & N. Zamora (eds.). Manual de plantas de Costa Rica Volumen III, monocotiledneas (Orchidaceae-Zingiberaceae). Monogr. Syst. Bot. Missouri Bot. Gard. 93. Garca Castro, J. B., D. E. Mora de Retana & M. E. Rivas Rossi. 1993. Lista de Orqudeas Comunes a Costa Rica y Panam. Brenesia 39: 106. Karremans, A.P. & D. Bogarn. 2013. Costa Rica, land of endless orchids. Orchids (West Palm Beach) 82(7): 4081. Blanco. 2012. New species and records of Orchidaceae from Costa Rica. II. Lankesteriana 12(1): 19-51. Luer, C.A. 1990. Icones Pleurothallidinarum VII: Systematics of Platystele (Orchidaceae) Monogr. Syst. Bot. Missouri Bot. Gard. 38: 115. Luer, C.A. 1991. New species of Lepanthes (Orchidaceae). Lindleyana 6(2): 64. Luer, C.A. 1996a. Icones Pleurothallidinarum XIV. Systematics of Draconanthes, Lepanthes subgenus Marsipanthes, and subgenus Lepanthes of Ecuador (Orchidaceae). Part Three: The genus Lepanthes subgenus Lepanthes in Ecuador. Monogr. Syst. Bot. Missouri Bot. Gard. 61:1. Luer, C.A. 1996b. Nuevas especies de Restrepia New species of Restrepia. Orquideologa 20(2): 117. Luer, C.A. 1997. Systematics of Trichosalpinx Monogr. Syst. Bot. Missouri Bot. Gard. 64: 20. Luer, C. A. 2003. Platystele Pp. 216 in: B. E. Hammel, M. H. Grayum, C. Herrera & N. Zamora (eds.). Manual de plantas de Costa Rica Volumen III, monocotiledneas (Orchidaceae-Zingiberaceae). Monogr. Syst. Bot. Missouri Bot. Gard. 93. Luer, C.A. & R.L. Dressler. 1986. Nuevas especies de Lepanthes de Panam. Orquideologia 16(3): 3. de las Orqudeas de Costa Rica. Brenesia 37: 79. Ponthieva R.Br. Pp. 444 in: R. Escobar (ed.). Orquideas Nativas de Colombia Volumen 3: Maxillaria -Ponthieva S.A. Medelln. Pupulin, F. 2002. Catlogo revisado y anotado de las Orchidaceae de Costa Rica. Lankesteriana 4: 1. Epidendrum anoglossoides Ames & C.Schweinf. In Hgsater. E. & Williams, L.O. 1956. An enumeration of the Orchidaceae of Central America, British Honduras and Panama. Ceiba 5(1): 25.LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.282 LANKESTERIANA
PAGE 133
Epidendrum, es considerado uno de los gneros ms grandes de orqudeas neotropicales. Est constituido por unas 1500 especies distribuidas desde el sur de los Estados Unidos hasta el norte de Argentina (Hgsater 1985). En el transcurso de los aos, muchos autores han intentado dividirlo en subgneros (Barringer 1991), los cuales han llegado a reconocerse, en varios casos, como gneros (Williams 1940), basndose en caractersticas como el nmero de polinios, la presencia de tallos engrosados y/o la cerca de 300 especies secuenciadas en su ADN, hemos llegado a la conclusin de que se trata de un gnero grupos y sub grupos con caractersticas vegetativas similares (Hgsater & Soto 2005). En 1940, Williams, tomando en cuenta bsicamente en el nmero de polinios, propuso al grupo Epidanthus como un gnero: Epidanthus L.O. Williams y Epidendrum: E. paranthicum Rchb.f., E. muscicolum Schltr. y E. goniorhachis Schltr. Garay (1977) y Barringer (1991) tambin evaluaron este grupo, el primero opinando que efectivamente deba tratarse como gnero separado, y el segundo establecindolo como un subgnero de Epidendrum, y agregando una especie nueva. Con el estudio de las numerosas especies que integran el gnero Epidendrum, se ha demostrado que el nmero de polinios no representa una caracterstica exclusiva del grupo Epidanthus. En el gnero Epidendrum, existen especies que tienen 2, 4 y hasta 8 polinios (Hgsater & Santiago 2010). El grupo Epidanthus, es de pocas especies y se con tallos muy delgados, hojas cortas y angostas, algo carnosas con una lgula diminuta opuesta a la lmina sur de Mxico hasta Ecuador, con particular diversidad en Centro Amrica. Actualmente, consideramos que est formado por 11 especies divididas en dos subgrupos: el subgrupo Epidanthus (que incluye a las especies que tienen hojas semiteretes, 2 polinios y el labelo generalmente 3-lobado, (con excepcin de Epidendrum LANKESTERIANA 13(3): 283. 2014. I N V I T E D P A P E R EPIDENDRUM ERIC HGSATER & ELIZABETH SANTIAGO AYALA herbamo@prodigy.net.mx www.herbarioamo.org RESUMEN. La revisin de una gran cantidad de ejemplares de herbario determinados como Epidendrum selaginella Schltr. que mostraban diferencias foliares evidentes comparadas con el ejemplar tipo que sirvi para describir esta especie ampliamente distribuida en Costa Rica y Panam as como el anlisis de los segmentos Epidendrum selaginella y por mucho tiempo confundidas con esa especie centroamericana: Epidendrum astroselaginella y Epidendrum stenoselaginella Se presenta una clave ilustrada ABSTRACT. The revision of a large number of herbarium specimens determined as Epidendrum selaginella Schltr. and which had evident foliar differences compared to the type served to prepare a detailed description of this of two new species closely allied to Epidendrum selaginella, and confused with that Central American species: Epidendrum astroselaginella and Epidendrum stenoselaginella An illustrated key is provided KEY WORDS : Epidendrum selaginella astroselaginella stenoselaginella Epidanthus, Costa Rica* Este artculo fue preparado en el marco de las celebraciones del 40 Aniversario del Jardn Botnico Lankester.
PAGE 134
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.284 LANKESTERIANAgoniorhachis que tiene el labelo entero), y el subgrupo Selaginella, que incluye a las especies con hojas planas, 4 polinios y de labelo entero, en el cual sta incluido Epidendrum selaginella Schltr. Revisando detenidamente una gran cantidad del material de herbario determinado bajo el nombre de Epidendrum selaginella (Fig. 1 y 4), encontramos 2 nuevas especies relacionadas, y por mucho tiempo confundidas con sta especie bastante comn y ampliamente distribuida en Costa Rica y Panam. Epidendrum selaginella fue descrita por Rudolf Schlechter en 1906 a partir de un ejemplar colectado por J. Cooper en Costa Rica: Se reconoce fcilmente por sus plantas pequeas (de no ms de 12 cm de alto, hojas cortas y planas, generalmente ovadas con el de los detalles que llam nuestra atencin cuando forma de las hojas en algunos ejemplares determinados bajo el nombre de sta especie, los cuales tenan hojas de forma distinta. La lmina foliar de estas plantas era claramente linear lanceolada y de una anchura menor a las hojas de E. selaginella (Santiago y Hgsater 2007; Fig. 4). Estudiando detenidamente stos ejemplares, de varias de stas plantas, encontramos adems, que distribuidas a lo largo del raquis y la mecnica de notoriamente distinta (la posicin de los mismos era casi totalmente extendida). Notando que stas caractersticas se mantenan de forma constante entre stas plantas, en el ao de 2007 procedimos a describir dos especies nuevas. Una bajo el nombre de Epidendrum astroselaginella Hgsater & E.Santiago (Hgsater y Santiago 2007a; Fig. 2 y 5); la etimologa del epteto de sta especie, hace referencia a la posicin una estrella. Haba otro pequeo grupo de ejemplares, similar a Epidendrum selaginella, pero con diferencias FIGURA 1. Epidendrum selaginella Schltr. basado en E.Hgsater 6537, Panam: Cerro Horqueta, testigo: AMO A-589. Foto E. Hgsater.
PAGE 135
HGSATER & SANTIAGO El subgrupo Epidendrum selaginella285LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. distribucin ms amplia que va desde Nicaragua hasta Panam (Fig. 7), lo describimos como Epidendrum stenoselaginella Hgsater & E. Santiago (Hgsater y Santiago. 2007b; Fig. 3 y 6); el epteto hace referencia a las hojas ms angostas, comparada con E. selaginella. CLAVE DE IDENTIFICACIN DE LAS ESPECIES DEL GRUPO EPIDANTHUS, SUBGRUPO SELAGINELLA hojas aplanadas, semejantes en tamao y forma, generalmente cortas (2.7-10.5 mm de largo), el labelo entero y la antera con 4 polinios. 1 Hojas ovadas a oblongo ovadas, hasta 3.4 mm de densamente papilosos; Costa Rica y Panam E. selaginella Schltr. 1 Hojas linear lanceoladas, hasta 1.9 mm de ancho, ovario y spalos glabros 2 FIGURA 2. Epidendrum astroselaginella Hgsater & E.Santiago basado en E.Hgsater s.n., Jardn Botnico Lankester, Costa Rica. Foto E. Hgsater. FIGURA 3. Epidendrum stenoselaginella Hgsater & E.Santiago basado en E.Hgsater 11115; Costa Rica: Volcn Pos-San Jos, testigo: AMO 15886, holotipo. Foto: E. Hgsater.
PAGE 136
FIGURA 4. Epidendrum selaginella Schltr. basado en R.L.Dressler 5730; Panam, Cocl, 8 km N of El Cop; testigo: AMO LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.286 LANKESTERIANA
PAGE 137
FIGURA 5. Epidendrum astroselaginella Hgsater & E.Santiago basado en L.D.Gmez P. 23814, Costa Rica, Cordillera de HGSATER & SANTIAGO El subgrupo Epidendrum selaginella287LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 138
FIGURA 6. Epidendrum stenoselaginella Hgsater & E.Santiago basado en E.Hgsater 11115, Costa Rica, Volcn Pos-San LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.288 LANKESTERIANA
PAGE 139
HGSATER & SANTIAGO El subgrupo Epidendrum selaginella289LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. mm de largo, labelo proporcionalmente ms largo que ancho, columna con un par de dientes laterales prominentes; Costa Rica y Panam E. astroselaginella Hgsater & E.Santiago de largo, labelo proporcionalmente tan largo como ancho, columna con un par de dientes laterales incipientes; Nicaragua, Costa Rica y Panam E. stenoselaginella Hgsater & E.Santiago LITERATURA CITADA Barringer, K. 1991. A revision of Epidendrum subgenus Epidanthus (Orchidaceae). Brittonia 43(4): 240-252. Garay, L.A. 1977. The Subtribe Epidanthinae L. O. Wms. The Orchid Digest, 41(1): 19-22. Hgsater, E. 1985. Towards an understanding of the genus Epidendrum. En K.W. Tan, (ed.), Proceedings of the 11th World Orchid Congress: 195-199. Miami, U.S.A. Hgsater, E. y M.A. Soto. 2005. Epidendrum. En A.M. Pridgeon, P.J. Cribb, M.W. Chase y F.N. Rasmussen (eds.). Genera Orchidacearum 4: Epidendroideae, part one: 236-251. Oxford University Press, Cambridge, U.K. Hgsater, E. y E. Santiago. 2007a. Epidendrum astroselaginella. En (eds.), The Genus Epidendrum, Part 6, Species New and Old in Epidendrum. Icon. Orchid. 9: t. 917. Hgsater, E. y E. Santiago. 2007b. Epidendrum stenoselaginella. En (eds.), The Genus Epidendrum, Part 6, Species New and Old in Epidendrum. Icon. Orchid. 9: t. 991. Hgsater, E. y E. Santiago. 2010. Epidendrum peristerium. En Genus Epidendrum, Part 9, Species New and Old in Epidendrum. Icon. Orchid. 13: t. 1370. Santiago, E. y E. Hgsater. 2007. Epidendrum selaginella. En Genus Epidendrum, Part 6, Species New and Old in Epidendrum. Icon. Orchid. 9: t. 984. Williams, L.O. 1940. A new genus of the Orchidaceae from FIGURA 7. Mapa de distribucin de Epidendrum selaginella, E. stenoselaginella y E. astroselaginella .
PAGE 140
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.290 LANKESTERIANA1 Hojas ovadas a oblongo ovadas, hasta 3.4 mm los spalos densamente papilosos; Costa Rica y Panam E. selaginella Schltr. mm de largo, labelo proporcionalmente ms largo que ancho, columna con un par de dientes laterales prominentes; Costa Rica y Panam E. astroselaginella Hgsater & E.Santiago 1 Hojas linear lanceoladas, hasta 1.9 mm de ancho, ovario y spalos glabros 2 mm de largo, labelo proporcionalmente tan largo como ancho, columna con un par de dientes laterales incipientes; Nicaragua, Costa Rica y Panam E. stenoselaginella Hgsater & E.Santiago APNDICE
PAGE 141
Pablo Biolley and Telipogon Biolleyi Paul (Pablo) Auguste Biolley (Fig. 1 A ) was born as son of a teacher on 16th of February 1862 in and became member of the Socit des Sciences Naturelles de Neuchatel and the Socit Neuchatelois de Gographie. After graduating, he went as teacher for 2 years to the Netherlands. In 1885 Biolley was invited as teacher and scientist by the Costa Rican government of Bernardo SOTO, he arrived in San Jose in 1886. Together with Henri Francois Pittier, Biolley undertook a number of expeditions through Costa Rica, in 1902 he joined the expedition to the Cocoisland and in 1907 he published results of this trip in the book Mollusques de la Isla del Coco. His main interest was entomology, but beside insects he also collected plants and made important contributions to a quiet man, beside his duties as teacher he spent all his free time collecting animals and plants. He married a Costa Rican and got the Costa Rican nationality, for a short period in 1904 he became director of the Instituto as teacher and was a victim of criticism from colleagues and staff; this was certainly one of the reasons why he early death on 16th of January 1908 at the age of only 46. Only a few publications by Biolley are known, beside the one about the molluscs mentioned above, his main works are Elementos de Historia Natural from 1887 and Costa Rica et son avenir (Costa Rica and its future), published in 1889 in Paris (Fig. 1 B ). Telipogon bolleyi (Fig. 1 C ) was described in 1910 by Rudolf Schlechter in Feddes Repertorium, the in forests on the slope of the volcano Barba (no.1340) was published by Mansfeld in Feddes Repertorium in herbarium in Berlin in 1943 (Mansfeld 1931) (Fig. 1 D ). From the same collection of Biolley a second, unnamed specimen with the same number 1340 is in the United States National Herbarium (Fig. 2 A ), originally from the 1983 as neotype and again by Robert L. Dressler in 1999 as the lectotype of Telipogon biolleyi. LANKESTERIANA 13(3): 291. 2014. I N V I T E D P A P E R WHAT IS IN AN ORCHID NAME: A TRIBUTE TO THE EARL Y NATURALISTS IN COSTA RICA RUDOLF JENNY rjorchid@gmx.ch ABSTRACT. mainly European by birth, who dedicated themselves to explore a still virgin country, bringing back from their trips a treasure of species to be apprehended by science. While some of them where just occasional voyagers and explorers, other establish themselves in Costa Rica in a long and fecund relationship, that raised to the are sometimes unknown, their names are linked forever to the orchid that helped to reveal to science and to humanity. What follows, and using as an excuse the name of some orchids, is a brief overview of the life and deeds of some of these early naturalists, as a tribute to their contribution to the development of Costa Rican orchidology KEY WORDS : History of botany, Costa Rica, Orchidaceae* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary.
PAGE 142
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.292 LANKESTERIANA FIGURE 1. A Portrait of Pablo Biolley. B Frontispiece of Biolleys Costa Rica and son venir, Paris 1889. C Telipogon biolleyi illustrated by Lothar Braas. D Telipogon biolleyi from the original sketch by R. Schlechter.
PAGE 143
JENNY Costa Rican orchid names293LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 2. A Lectotype of Telipogon biolleyi (US). B Drawing of T. biolleyi by A. R. Endrs (W-R). C Isotype of T. endresianum (AMES). D Telipogon endresianum, from the Orchid Journal, 1953.A B C D
PAGE 144
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.294 LANKESTERIANA Telipogon endresianum was described by Annalen des Naturhistorischen Hofmuseums Wien, his description was based on a perfect drawing and 2 B ). The type and the drawing are in the herbarium specimen collected by Huebsch, this specimen is also in Vienna. Another Endrs specimen, determined as an isotype of Telipogon endresianum is in the AMES herbarium at Harvard (Fig. 2 C ). A detailed drawing 1952 in Alex D. Hawkes Orchid Journal (Allen 1952) (Fig. 2 D Telipogon endresianum would be a synonym of the older Telipogon biolleyi. Telipogon biolleyi (Fig. 3 A 3B ) is one of the most common species of the genus in Central-America. Like most other species it is a fast growing twig-epiphyte. Most species of Telipogon alive in cultivation for more than 2 or 3 years, this problem is known from many small twig-epiphytes. These plants are producing seeds in their second or third year, the generation-succession is fast and due to the fact that their typical habitat is changing fast, they do not survive long in nature. The only way to keep them propagation from seed. In nature, species of Telipogon are apparently pollinated by pseudocopulation of male Alberto Manuel Brenes and Campylocentrum brenesii When Rudolf Schlechter published 1923 his Beitrge zur Orchideenkunde von Zentralamerika in Feddes Repertorium Beihefte, more than half of the new species he described have been collected by Alberto Manuel Brenes in Costa Rica. Schlechter (1923) dedicated a series of orchid species to Brenes: Barbosella brenesii, Campylocentrum brenesii, FIGURE 3. Telipogon biolleyi
PAGE 145
JENNY Costa Rican orchid names295LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Catasetum brenesii, Dichaea brenesii, Elleanthus brenesii, Encyclia brenesii, Epidendrum brenesii, Habenaria brenesii, Lepanthes brenesii, Maxillaria brenesii, Microstylis brenesii, Notylia brenesii, Oncidium brenesii, Pleurothallis brenesii, Ponthieva brenesii, Spiranthes brenesii, Stelis brenesii, and Trichocentrum brenesii. At least in part Alberto Manuel Brenes (Fig. 4 A 3B ) also belongs to the Swiss connection like Brenes was born in San Ramon in Costa Rica on September 2th, 1870. He studied in Costa Rica until 1890, when he left Central America for Europe. He stayed in Paris for a short time and then went the university for one year, followed by a time in Geneva where he stayed until 1898, taking botany and natural history courses with Professors Renvier, Dufour, Chodat and Briquet. During the time when Brenes was in Europe, Henry Franois Pittier founded the Instituto Fisicodevoted to the natural sciences, a part of this institute was the Herbario Nacional de Costa Rica and grew Costa Rica in 1903, the herbarium was taken over by the Museo Nacional. Brenes returned to Costa Rica in 1898 and started teaching at the Escuela de Farmacia (School of Pharmacy) in San Jose. In his spare time he collected plants together with Henry Franois health reasons Brenes left this appointment in 1903 and returned to San Ramon. In this time he worked and changed to the Escuela Normal in 1911. In 1920 he became the head of the section of botany at the Museo Nacional, a position he held until 1935. In 1921 Brenes began a series of collections that would eventually total more than 23 numbers of plant specimens. He usually collected in the very rich forests around San Ramon. The vegetation in this area is extremely rich not only in orchid species but also in other plants because it forms a gap between the Cordillera Central and the Cordillera de Tilaran. Moisture-laden winds from the Caribbean plain are forced up to the eastern slope and across this gap, creating areas of cloud forest at unusually low elevations. Before 1924 the primary set of Brenes collections was deposited in Costa Rica, although the unicates of many groups were sent to specialists. Rudolf Schlechter in Berlin received most of Brenes orchid collections during this period. After Schlechters time most of the orchids have been sent to Oakes Ames at Harvard and to the Field Museum in Chicago. Brenes also made a number of pencildrawings of the plants he collected, these drawings are kept at the Departemento de Proteccion del Patrimonio Historico, Museo Nacional de Cost Rica. We dont know how many drawings Brenes made, the drawing of Gongora armeniaca is carrying the number 115 (Fig. 6 D ) the one of Catasetum macrocarpum the number 272. Seven of them have been printed in the biography of Brenes by Alberto collections of orchids from Costa Rica, including some specimens collected originally by Brenes. It was Brenes. Schlechter wrote 1919 to Brenes, asking him about the possibility to collect orchids for the planned a very large collection of specimens from Brenes, the collection was extremely rich in small species from the subtribe Pleurothallidinae and Schlechter decided to publish 1923 the results in an own treatment under the title Orchidaceae Brenesianae. All species named after Brenes and also the genus Brenesia have been published in this article in Feddes Repertorium Beihefte. Schlechters herbarium in Berlin was destroyed during the war in 1943 and all the specimens collected by Brenes were lost. Fortunately Oakes Ames was interested in Schlechters Central and later on Schlechters wife Alexandra to make drawings of this material for his own herbarium So at least a larger part of Schlechters collection from Costa Rica survived in form of drawings. Brenes died in San Ramon in 18. May 1948. Still his name is present in Costa Rica, the journal Brenesia, published by the Departemento de Historia Natural, Museo Nacional de Costa Rica is named after him, the stamp with Brenesia costaricensis was issued by Costa Rica, in the same series with some other Orchids also a
PAGE 146
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.296 LANKESTERIANA FIGURE 4. A, B Two portraits of Alberto Manuel Brenes. C Drawing of Campylocentrum brenesii by A. R. Endrs (W-R), from Bogarn & Pupulin 2010. B A C
PAGE 147
JENNY Costa Rican orchid names297LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 5. A, B Two modern illustrations of Campylocentrum brenesii by D. Bogarn (from Bogarn & Pupulin 2010). Campylocentrum brenesii. B A D C
PAGE 148
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.298 LANKESTERIANA FIGURE 6. A Lectotype of Campylocentrum brenesii (AMES). B Holotype of Campylocentrum calcaratum (AMES). C Drawing and photograph of the type of Campylocentrum calcaratum (AMES). D Drawing of Gongora armeniaca by A. M. Brenes (Museo Nacional de Costa Rica). B A C D
PAGE 149
JENNY Costa Rican orchid names299LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.stamp with a portrait of Brenes was included. The genus Campylocentrum was mentioned the of the Linnean Society. The genus belongs in fact to the Angraecinae and includes about 60 species in the West Indies. Campylocentrum is a sister genus of Dendrophylax species. The genus Todaroa, described in 1844 in Comptes Rendus Hebdomadaires des Seances de lAcademie des Sciences by Achille Richard and Henri Galeotti1, is today considered as synonym of Campylocentrum. Richard and Galeotti were not aware that the generic name Todaroa was already used for a genus of the Umbelliferae by Parlatore in 1844. Although Bentham agreed with the concept of Todaroa he could not use this name and proposed instead Campylocentrum as generic name (Bentham 1881). Campylocentrum brenesii was described by Rudolf von Zentralamerika in Feddes Repertorium Beihefte (Schlechter 1923). The plant Schlechter used as type was collected in 1921 by Brenes at San Pedro de San Ramon, Alajuela, Costa Rica. Schlechters herbarium in Berlin was destroyed in 1943 and the type-specimen of Campylocentrum brenesii was lost (Fig. 6 C ). Another specimen of the species, also collected by Brenes in September 1921 in Costa Rica was selected by Barringer in 1984 in Fieldiana Botany as the lectotype (Barringer 1984) (Fig. 6 A ). Another specimen of the species was collected by A.R. Endrs in the second half of the 19th century. The specimen remained undescribed in the herbarium of Heinrich Gustav Reichenbach in Vienna, together with two very accurate pencil-drawings by Endrs (Fig. 4 C ). Brenes collected the species again between 1925 and 1927 in the area of La Palma de San Ramn and at La of the genus Campylocentrum in Costa Rica, published by Diego Bogarn and Franco Pupulin in Harvard Papers in Botany from 2010, Campylocentrum longicalcaratum Ames & Ch.Schweinfurth (Fig. 6b) is a synonym of Campylocentrum brenesii (Fig. 5 A 5 D ). The plant was collected in July 1925 by Charles H. Lankester near La Estrella, Costa Rica, and was described by Oakes Ames and Charles Schweinfurth in 1930 in Schedulae Orchidianae. Also Campylocentrum parvulum Campylocentrum brenesii., the species was described by Schlechter 1923 in Feddes Repertorium Beihefte after a collection by the brothers Alexander Curt Brade and Alfred Brade near La Palma, Costa Rica, in 1400 m altitude. Richard (Ricardo) Pfau and Trichocentrum pfavii We have only little information and details about the life of Richard (Ricardo) Pfau. The family Pfau (Fig. 7 A ) was very famous in Winterthur near there, they where stove setters and stoves from their southern Germany. Some members of the family where also active in politics and became members of the town council. Ricardos father Matthus Pfau and politician in Winterthur, and was in 1862 one of the 13 founding members of the precursor of the bank which should become 150 years later the largest for health reasons. He bought the Kyburg-Castle family and his art-collection to the Kyburg. Ricardo was the youngest of the three sons of Matthus Pfau, born in 1856 and grown up at least in part in the Kyburg. The elder brothers where Jakob Pfau (born 1846) who became architect and later Professor at the Technikum in Winterthur, and Eduard (born 1851) who became merchant in Milan, Italy. Ricardo seems to have been the black sheep of the family. In 1887 he tried to publish a novel and asked Gottfried Keller, famous author in Zurich, for an expertise. However, the result was not as good as expected, the novel was never published. When Robert Keller, botanist and high school teacher in Winterthur, published in 1 Todaroa, but the publication in Comptes Rendus Hebdomadaires des Seances de lAcademie Clynhymenia in the same publication of 1844 is accepted as valid, the same must be true for Todaroa.
PAGE 150
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.300 LANKESTERIANA FIGURE 7. A The family Pfau; Richard is the boy with a gunon the right. B Catalogue of Pfaus nursery in Costa Rica, ca. 1895. C Pfaus illustrated manual for the tropical apiculturist (1895). D Modern illustration of Trichocentrum pfavii from Pupulin 1997. B A C D
PAGE 151
JENNY Costa Rican orchid names301LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.1891 his Flora von Winterthur he mentioned in the introduction also a small collection of plants given to him by his friend Richard Pfau. Obviously Richard had collected plants around the Kyburg. We dont know when Richard left Europe for the year 1880. Following some of the articles he published in 1883 and 1884 in Gardeners Chronicle he already had been in Costa Rica but not permanently, he also cultivated Orchids and lived in Chiswick, England. Remarks in the publications like: but on experience in my own culture of Orchids in Chiswick, which I began only a few months ago (Pfau 1883a), .I discovered this species last year .in my houses at Chiswick they seemed to do best in baskets (Pfau 1883c). In Kew there is a businesscard from Pfau, written in 1895 or 1896 with the following note: Richard Pfau who thanks to the has had the honor of paying Sir Joseph Hooker a visit 2 years ago before starting for Central-America, begs the favour an interview to show him some new plants he has found. Obviously Richard made several trips to Costa Rica when he lived in England and sometime around 1885 he settled in San Jose, Costa Rica. He returned for a visit in 1893 and again Richard succeeded to bring in 1896 a small number of Epidendrum endresii and Miltonia endresii alive to England. Richard founded a nursery in San Jose in Costa Rica, he published most probably in 1895 a catalogue of Orchids he had for sale and export (Fig. 7 B ). In the catalogue he also gave advice about the cultivation and exportation of Orchids and he made comments like: Cattleya skinneri, some ten years ago, was a common orchid all over Central America; but in the last few years it has been exported by shiploads; and today at least in Costa Rica it has almost become rare. He sent plants to Europe and and Gustav Wallis through Eduard Ortgies from the Botanical Garden in Zurich. Richard also had an apiary in his nursery, he wrote: In 1893 I introduced into Costa Rica the Italian Bee and modern Langstroth bee-keeping system, with the latest American inventions, he sold the honey via a company in Medina, Ohio, USA and offered on demand an illustrated manual for the tropical apiculturist (Fig. 7 C ). Although Richard was as collector mainly active in Costa Rica it is based on the plants he sent to Europe probable that he also collected in Colombia, Panama and even Mexico. Richard Pfau died with 41 years on 14th of March 1897. A few orchids carry his name as epithet (species name), but interestingly all are written as pfavii and not as pfauii. In the Latin alphabet the letter U is written as V, most probably this was the reason for Rolfe, Reichenbach and Schlechter to write pfavii. Trichocentrum pfavii (Fig. 7 D 8 C ) was described by Reichenbach in Gardeners Chronicle in 1881 based on material collected 1880 by Pfau in Chiriqui, Costa Rica. Reichenbach got living material, dried specimens and a sketch, the type specimen in the herbarium of Reichenbach (no. 42179) includes two drawings of the species by Reichenbach himself and a A ). Trichocentrum pfavii var. zonale (Fig. 8 D) described in 1883 by Reichenbach in Gardeners Chronicle is a synonym of Trichocentrum pfavii (Reichenbach 1883). The commentary of Reichenbach is interesting: Mr. Pfau appears to be an excellent correspondent and collector, but his Trichocentrum is an abdominable plant, quite a crux Orchidologorum. this once more. An unpublished species with much lip, turns out as belonging to this species, though it looked widely distinct. I would not quote this name, Trichocentrum zonale, were it not engraved on an unpublished lithographic plate belonging to one of my unpublished pamphlets. I can only regard it now as a variety. Trichocentrum pfavii subsp. dotae (Fig. 9 A, 9 B, 9 D ) was described by Franco Pupulin in 2001 in Selbyana (Pupulin, 2001). The plant was collected in April 1999 by A. Flores (San Jos, Dota, Santa Mara, Garden in 1999, the type specimen is at the herbarium of the Escuela de Biologia, Universidad de Costa Rica (USJ) (Fig. 9 B ). In the same publication Pupulin
PAGE 152
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.302 LANKESTERIANA FIGURE 8. A The holotype of Trichocentrum pfavii at WR. B, C Endrs sketches of the species he intended to describe as Trichocentrum saundersii (W-R). D Unpublished plate of Trichocentrum zonale, from Reichenbachs Xenia Orchidacea. B A C D
PAGE 153
created a section Lobulatae for the group of species around Trichocentrum pfavii. Trichocentrum saundersianum and Trichocentrum saundersii are names on several sheets in the Reichenbach herbarium, the material was collected and illustrated by Endrs (Fig. 8 B, 8C ), but never validly published; it belongs to Trichocentrum pfavii. Henry Franois Pittier and Oncidium pittieri Henry Franois Pittier (Fig. 10 A-10D ) also came Waadt, on 13th of August 1857. He graduated as a civil engineer from the University of Lausanne. After the years at the university he started a map survey of the FIGURE 9. A, B Trichocentrum pfavii subsp. dotae. Original illustration by F. Pupulin (2000), and the holotype in the Herbarium of the University of Costa Rica (USJ). C Trichocentrum pfavii D Trichocentrum pfavii subsp. dotae (photographs by F. Pupulin). JENNY Costa Rican orchid names303LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. B A D C
PAGE 154
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.304 LANKESTERIANA2 Pittier come to Costa Rica hired by the government. See Ossenbach 2009: However, the last two decades of the a group of European academics to staff the two new public high schools in the capital, San Jos (The Liceo de Costa Rica for boys and the Colegio Superior de Seoritas for girls, both founded under Sotos administration). The arrival of these =Physical-Geographical Institute ) and the National Museum, founded in 1887 and 1889, respectively. Among the hired teachers were Pablo Biolley (1861-1908) and Henri Francois Pittier (1857-1950), who arrived in 1886 and 1887.3 Henri Pittier National Park is the oldest national park in originally created in 1937 under the name of Rancho Grande by decree of President The park was renamed in 1953 with the name of Henri Pittier by the accident, Pittier started to read intensively about natural sciences. He got into contact with the work of Haeckel and was so fascinated by Haeckels ideas that he decided to go to Jena,and a short time later started doctoral studies at the University of Jena in Germany. The information about the academic titles of Pittier are not consistent; following Tobias Lasser, Pittier had a doctorate in philosophy from Jena and from Lausanne a doctorate of science. Following John D. bachelor. Following his interests in the tropics, Pittier immigrated in October 1887 to Costa Rica2, and never Institute of Costa Rica, one of the objectives was to make a map survey of the republic of Costa Rica. It time. Pittier was also involved in the organisation of a National Herbarium in San Jose. Between 1887 and 1904 Pittier collected in Costa Rica, often together was the Primitiae Florae Costaricensis, which he published in three volumes between 1891 and 1901 in collaboration with Theodore Durand from the Botanical Garden in Brussels. In 1904 Pittier went to Washington D.C. to work for the United States Department of Agriculture under the very promising title Special agent in botanical investigation in tropical agriculture in the Bureau of plant industry. The title was changed to Botanist in 1912. Between 1905 and 1919 he worked in Central and South America, he collected in Panama, Mexico, Guatemala, El Salvador, Colombia and in very important for the Flora of Panama. At the age of 62 he left Washington and went to Caracas. Again and in spite of his age he travelled the National Herbarium in Caracas and published some 300 books and articles in different journals. He died 3 There are still Pittier, but without any doubt he made a very important are dedicated to this important botanist, mainly by Rudolf Schlechter in Berlin, who got Pittiers orchids Oncidium pittieri Schltr., Maxillaria pittieri Schltr., Scaphosepalum pittieri Schltr., Pleurothallis pittieri Schltr., Lockhartia pittieri Schltr., Vanilla pittieri Schltr., and Epidendrum pittieri Ames Unfortunately most of Pittiers orchids have been destroyed during the second world war in Berlin, together with almost the entire herbarium of Schlechter. Some of the species have been illustrated in 1931 in Feddes Repertorium, based on the original drawings of Schlechter and published by Rudolf Mansfeld. Oncidium pittieri was described by Rudolf Schlechter in 1910 in Feddes Repertorium (Schlechter 1910). The plant was collected by Pittier near La Palma in Costa Rica in September 1896. The type specimen was destroyed in 1943 but a copy of it is still in the AMES herbarium (Fig. 10 A
PAGE 155
JENNY Costa Rican orchid names305LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 10. Portraits of Henry Francois Pittier. A In 1880. B In 1903. C In 1914. D In 1946.C D A B
PAGE 156
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.306 LANKESTERIANA FIGU R E 11. A Oncidium pittieri, copy of Schlechters drawing of the holotype. B O. pittieri, Schlechters sketch of the Oncidium luteum (K). D Type of Oncidium cheirophoroides (W). B A C D
PAGE 157
JENNY Costa Rican orchid names307LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGU R E 12. Oncidium luteum. A, B Sketches by A. R. Endrs (WR). C Illustration from Icones Plantarum Tropicarum B A C D
PAGE 158
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.308 LANKESTERIANA5 Popular name in Costa Rica for a small grocery store.dissection on this drawing is exactly the same as published by Mansfeld in 1931 (Fig. 11 B ) in Feddes Repertorium Beihefte (Mansfeld 1931). Obviously Schlechter was not aware of the existence of Oncidium luteum, described by Robert Allen Rolfe in 1893 in Bulletin of Miscellaneous Information (Rolfe 1893a). Rolfes description was based on a plant cultivated in the collection of Trevor Lawrence in Burford Lodge and sent in summer 1892 to Kew for determination (Fig. 11 C ). It is not known from where Lawrence had the plant. Following descriptions, drawings and typematerial, it is clear that unfortunately Oncidium pittieri has to be declared as synonym of the older Oncidium luteum (Fig. 12 D, 12D ). Oncidium cheirophoroides is another synonym of Oncidium luteum, it was described by Friedrich Costa Rica by Endrs, the type specimen is in the herbarium of Reichenbach in Vienna (no.45055) (Fig. 11 D ). Two drawings by Endrs of an un-named Oncidium in the Reichenbach herbarium (no.33448 and 33732) (Fig. 12 A, 12B ) are showing also Oncidium luteum (determinated by Dressler in 2001). Jean Franois Adolphe (Adolfo) Tonduz and Masdevallia tonduzii A, 13B ) was born as the youngest of 7 children of Paul Gustave studied at the Technical School in Lausanne, after this he started to study medicine at the University of Lausanne from 1881 to 1885. During this time he got and more interested in natural history and especially botany. This was the reason why in 1885 he moved as Conservator to the Botanical Museum of the Botanical Institute of the same University in Lausanne. In 1889 William Barbey offered him to become Conservator at the Herbarium Boissier in Geneva, and it was to get an employment from the government of Costa left Geneva and arrived in Costa Rica on June 17th. A short time after his arrival he got into contact with Henry Francois Pittier de Fabrega, another Swiss active as botanist in Costa Rica. Soon they became good friends and together they travelled between Nacional, founded by Pittier. Both collected some 20 specimens. Most of the herbarium specimens have been distributed by T. Durand, director of the Botanical Garden in Brussels, to different institutes. Almost complete sets are kept at the Conservatoire Jardin Botanique in Geneva and at the Smithsonian Institution in Washington. Between 1903 and 1920 Nacional. In 1920 he went to Guatemala and worked there as plant pathologist for the Agricultural Service. He died in Guatemala on 20th of December 1921 at the age of 60. In one of his biographies his life is described as very eventful, changing from poorness to times not travelling he lived in San Francisco de Guadalupe,4 where a road is named after him. Rudolf Schlechter in Berlin in 1921. After the war of Central America. He got positive answers from several people, among them Don Jos C. Zeledn and his wife Doa Amparo de Zeledn in Costa Rica. Doa Amparo owned a large collection of orchids, and also Werckl to select interesting material from her collection, she herself also paid Werckl for his work. The genus Amparoa, Habenaria amparoana, Sobralia amparoana and Gongora amparoana are dedicated to her. Most of the species described by Schlechter in his article Orchidaceae Amparoanae in Feddes Repertorium Beihefte (Schlechter 1923) from Doa Amparos collection. Together with his Alberto M. Brenes and helped Schlechter to get into direct contact with Brenes. During his time in Costa
PAGE 159
JENNY Costa Rican orchid names309LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGU R E Masdevallia tonduzii at G. D Protologue of Masdevallia tonduzii, from Bulletin de lHerbier Boissier (1906). B A C D
PAGE 160
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.310 LANKESTERIANA FIGU R E 14. A Masdevallia tonduzii, illustration from Icones Pleurothallidinarum 22 (2001). Exploraciones botnicas en Talamanca (1895). C, D Masdevallia tonduzii B A C D
PAGE 161
JENNY Costa Rican orchid names311LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.in Geneva and sent from time to time living material to Geneva. There are only a few known publications by la parte meridional de Costa Rica in 1893, two others are Exploraciones botanicas en Talamanca in 1895 (Fig. 14 B ) and Herborisations au Costa Rica in 1895 1897. The latter was published in several parts in the Bulletin de lHerbier Boissier, it is a very detailed diary of some of his travels in Costa Rica. Tonduzia Pittier (1908, Apocynaceae), Tonduzia F.L.Stevens (1927, invalid) and Tonduzia (Cyperaceae, 1895). Several orchid species are only a few of them have been illustrated: Elleanthus tonduzii, Stelis tonduziana, Camaridium tonduzii, Restrepia tonduzii, Cycnoches tonduzii, and Masdevallia tonduzii (Woolward 1906). Masdevallia tonduzii (Fig. 14 A, 14C, 14D ) was described by Florence Woolward in Bulletin de lHerbier Boissier (Woolward 1906) (Fig. 13 D ), incorporated in 1894 in the orchid collection of the Conservatoire Jardin Botanique in Geneva. Under cultivation of Paul Simmler Masdevallia tonduzii she got some plants in her hands. Unfortunately it was too late to include the species in her famous book The Genus Masdevallia and she did not publish an plants remained in cultivation in Geneva at least until 1910, the type specimen is in the herbarium Boissier in Geneva (Fig. 13 C ). Karl (Carlos) Werckl and Kefersteinia wercklei Karl (Carl, Carlos) Werckl (Fig. 15 A ) was born on 18th of July 1860 in the village Wiebersweiler (Vivverville) in the department Alsace-Lorraine in France as son of Carl Werckl and Christine Deher. We dont know much about his early years, but obviously he visited the secondary school in Nancy. It is said that Werckl was a man of extraordinary education, he was is also said that he understood enough of Latin, Greek and even Hebrew to read books in those languages. Beside this he had also skills as cartographer and as philosopher. We dont know whether the story about his German manuscript The Philosophy of the Absolute which he planned to publish and which was stolen from his home and used in a local pulperia5 to wrap soap and candles, is entirely true. Although French by birth Carlos always insisted to be German. Sometime around 1892 Werckl most probably with his oldest sister Julia left Europe for the USA and worked for the company of John Lewis Childs (Fig. 15 B ) of Long Island, New York. Childs (1856 1921) was selling seeds and bulbs and was founder of Floral Park (Fig. 15 C ). The only photograph of Werckl we know shows him together with his boss John Lewis Childs and Anastasio Alfaro visiting an exhibition in 1893 in Chicago (Fig. 15 A ). Werckl was sent to Costa Rica to collect plants and seeds for Childs, he arrived some sources he had his sister Julie with him. He had Theophile Brune, another plant collector, with him or that because some of Werckls collections of orchids were dated November 1897, and there are specimens of the fern Loxomopsis costaricensis in the herbarium of Hermann Christ, described in 1904 and collected by Werckl and Brune. Carlos sister got pneumonia and went back to the USA where she died a short time later. Carlos went with her and was 1898 employed by the Rose Hill Nursery of Henry A. Siebrecht and Albert tropical plants, ferns, palms and orchids. The company published catalogues in regular intervals and set up own orchid shows in New York. Obviously Werckl also had relations to the New York Botanical Garden, Rica from the company and from Nathaniel Lord Britton, at this time director of the New York Botanical Garden. He had no success and so he returned on his own resources to Costa Rica, he reached Puerto Limon on 7th July 1902. Rudolf Schlechter, orchidologist in Berlin, was trying to get contact to collectors in Central America America. He got positive answers from several people, among them also Don Jos Castulo Zeledn and Doa Amparo de Zeledn (Fig. 15 D ). Doa Amparo owned a large collection of orchids, mainly
PAGE 162
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.312 LANKESTERIANA FIGU R E 15. A Carlos (Karl) Werckle (on the right) with Anastasio Alfaro (on the left) and John Lewis Child (center) in 1893. B John Lewis Childs. C Advertisement of Floral Park. D Doa Amparo de Zeledn. B A C D
PAGE 163
JENNY Costa Rican orchid names313LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGU R E 16. A, B Copies of Schlechters original sketches of the type of Kefersteinia warcklei. B An unpublished plate from Reichenbachs Xenia Orchidacea, illustrating K. wercklei (as Zygopetalum umbonatum). C A modern illustration of K. wercklei, from Pupulin 2001. B A C D
PAGE 164
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.314 LANKESTERIANA FIGU R E 17. Kefersteinia werckleifrom Costa Rica and based on recommendation of Alfred Brade, head-gardener of the town San Jose, interesting material for Schlechter. She herself also paid Werckl for his work and sent him on collecting 15 specimens for the herbarium of the Museo Nacional, although Werckls way to collect plant material was not state of the art: ..his favourite way of preserving an interesting plant was to roll it into a bundle and stuff it in a pocket, where it remained even looking at the label (Standley 1926). The of Doa Amparo and where subsequently prepared collections, Schlechter described later 4 new orchid genera and more than 80 new species. Besides orchids, Werckl was also very interested in ferns and bromeliads, he had an extremely good trained eye for them, and collected hundreds of species studied and described later by Hermann Christ in for Agriculture sent Werckl to southern Colombia, obviously he collected several Cacti and Bromeliads and took them home to Costa Rica. In 1911, Werckl was employed for a few months by the herbarium of the Museo Nacional. Beside all those activities, in Cartago and later in San Jose. He published a series Rica about the orchids of this country (Ossenbach 2003) in Boletin do Fomento. His main work was in 1909. Some of his articles were published in German periodicals like Monatsschrift fr Kakteenkunde From a letter of Henry Nehrling to Theodor Luqueer Mead from December 1918 we learn that Werckl was also collecting and selling Bromeliads. Nehrling (1853) started Nehrlings Tropical Garden and Arboretum in 1917 in Naples, Florida and was in close contact with Mead (1852) who had a collection of tropical plants including orchids in Oviedo, Florida. Nehrling wrote to Mead: Do Carlos Werckle wrote me some time ago that he has discovered a number of new Bromeliads rivalling in beauty with Caraguata zahnii, Massangea musaica and others and still very distinct. He intends to send me distinct kinds. He says that the center of distribution of Bromeliads in Costa Rica is found in the mountains around Cartago. Says that his wife is in many respects
PAGE 165
JENNY Costa Rican orchid names315LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.an ideal, but she is extremely nervous, and not at all healthy. In another letter from November 1925 we read: Carlos Werckle, an old friend of mine and now dead, discovered some most beautiful new species in the mountains of Costa Rica. They all have been Knigsberg). He sent me a consignment about 6 years ago 50 species, mostly new. They came as far as Jacksonville but were returned by the man who acted for the Federal Plant Board and Werckle never could be induced to send me another lot, even after I had sent him special permits. Werckl was not married, the remark about his wife is wrong, most probably he talked about his sister. In 1922 Oakes Ames was looking for a collector in Central America and contacted Charles Lankester in Costa Rica in order to get his opinion about Werckl, Lankesters answer from 11th of October 1922 was very clear: Werckl is a dipsomaniac, an appalling wreck knowledge and might be of use yet (Ossenbach 2003). In his later years Werckl started to develop a passion for alcohol, he drank and this was most probably the reason for his early death on 24th of November 1924. Kefersteinia wercklei (Fig. 16 D 17) was described in 1923 by Rudolf Schlechter in Feddes Repertorium, Beihefte based on a plant collected by Werckl in June 1921 near La Palma. The article was dedicated to Doa Amparo de Zeledn as Orchidaceae Amparoanae (Schlechter 1923), the Schlechter. Again, the type specimen of Kefersteinia wercklei was lost in 1943, but a copy of Schlechters drawing and the type specimen is in the AMES herbarium in Harvard (Fig. 16 A, 16B ). In 1944 Charles Schweinfurth described in American Orchid Society Bulletin Chondrorhyncha pusilla from Peru and recombined in a footnote the allied species Kefersteinia wercklei Schltr. to Chondrorhyncha wercklei (Schltr.) C. Schweinfurth (Schweinfurth 1944). The part about the subtribe Huntleyinae for the 3rd edition of Schlechters Die Orchideen was Umbonata for the species-group around Kefersteinia costaricensis and included also Kefersteinia wercklei. They also mentioned the unpublished taxon Kefersteinia umbonata as synonym of Kefersteinia wercklei (Senghas et al. 1992). Kefersteinia umbonata is based on a drawing by Endrs named Zygopetalum umbonatum in Reichenbach;s herbarium in Vienna (W-R no.336). Of the same drawing a lithograph was made, planned to be published in Xenia Orchidacea and named Zygopetalum umbonatum (Fig. 16 C ). On a description as Zygopetalum (near Kefersteinia) and Kefersteinia umbonata is not mentioned on any of the sheets of the Endrs-material in Vienna. In the German journal Journal fr den Orchideenfreund genus Senghasia based on the section Umbonata of Kefersteinia He recombined Kefersteinia wercklei to Senghasia wercklei Senghas, orchidologist, longtime-director at the Botanical Garden Heidelberg and co-author of the third edition of Rudolf Schlechters Die Orchideen. LITERATURE CITED Allen, P. H. 1952. Telipogon endresianum Journal (A.D.Hawkes) 1: 292 Ames, O. & C. Schweinfurth. 1930. New or noteworthy Orchids. Schedul. Orch. 10: 112. Anonymous. 1897a. Gardeners Chronicle ser.3,21: 241. Anonymous. 1897b. Orchid Review 5:109 Botanischen Gesellschaft 32: IXX Orchidaceae, types collected by A. Brenes. Fieldiana Bot. new series 17: 1. Societe Botanique de Geneve, ser.2, 14: 12. Bentham, G. 1881. Notes on Orchideae. Journal of the Linnean Society 18(110): 337. Bogarn, D & F. Pupulin. 2007. El genero Campylocentrum en Costa Rica: algunas preguntas criticas y unas pocas respuestas. The genus Campylocentrum in Costa Rica: some critical questions and a few answers. Proc. of the Bogarn, D. 2010. Revisin taxonmica del gnero Campylocentrum (Orchidaceae: Angraecinae) en Costa Rica. Dissertation. Universidad de Costa Rica. Pp. 39. Bogarn, D. & F. Pupulin. 2010. The genus Campylocentrum
PAGE 166
(Angraecinae) in Costa Rica: a revision. Harvard Papers in Botany 15(2): 353. Cogniaux, A. C. 1897. Orchidees nouvelles ou recement introduites. Chronique Orchidenne 1(4): 32. Dressler, R. L. 1993. Field Guide to the Orchids of Costa Rica and Panama. Comstock Publishing. Costarricense XII: Hermann Christ, su vida, obra e Costarricense XII: Carlos Werckl. Brenesia 14: 361. Hsler, B. & T. W. Baumann. 2000. Henri Pittier, 1857 in den Neotropen. Reinhardt Verlag Basel. Harding, P. 2008. Huntleyas and related orchids. Timber Press, Oregon. Instituto de defensa del Caf de Costa Rica 15(131): 523. Kniger, W. 2007. Oncidium, eine Monographie, 3. Verlag Helga Kniger. Pp. 89. Telipogon H.B.K. Annalen des Naturhistorischen Hofmuseums Wien 33: 29. IV.50(2): 199. Len, J. 1945. Notas sobre la labor botanica de don Alberto M. Brenes. Revista del Instituto de defensa del Caf de Costa Rica 15(131): 526. Lobo, S. 2004. Tipos de Orquidaceas Brenesianas, descritas por R.Schlechter, en el herbario nacional de Costa Rica. Lankesteriana 4(1): 37. Luer, C. A. 1986. Thesaurus Masdevalliarum 7: sub. t.13. Luer, C. A. 2001. Icones Pleurothallidinarum 22. Monographs in Systematic Botany from the Missouri Botanical Garden, 86 :769. Mansfeld, R. 1931. Bluetenanalysen neuer Orchideen, II. Mittelamerikanische Orchideen. Repertorium Specierum Novarum Regni Vegetabilis Beihefte 59(2): Mirenda, T. 2010. Telipogons, the ultimate orchids. Orchids (West Palm Beach) 79: 552 Mora de Retana, D. E. & J. T. Atwood. 1993a. Masdevallia tonduzii Woolward. Sub. pl. 1558 in: Orchids of Costa Rica, part 3. Icones Plantarum Tropicarum 16. Mora de Retana, D. E. & J. T. Atwood. 1993b. Oncidium luteum Rolfe. Sub. pl. 1572 in: Orchids of Costa Rica, part 3. Icones Plantarum Tropicarum 16. 57-58: 19. Ossenbach, C. 2003. History of Orchids in Central America, from prehispanic times to the new millennium 2: 131 132, 135. Unpublished manuscript. Ossenbach, C. 2006. Orchids in Costa Rica, part I : The era of Rudolf Schlechter. Orchids (West Palm Beach) 75: 38. Biocenosis 21(1-2): 13. Ossenbach, C. 2009. Orchids and Orchidology in Central America: 500 years of history. Lankesteriana 9(1): 149. Pfau, R. 1883a. The climate of Central America, orchid culture. Gardeners Chronicle, new ser. 20: 558. Pfau, R. 1883b. Hints on the culture of some rare Central American orchids. Gardeners Chronicle, new ser 20: 658. Pfau, R. 1883c. Cypripedium caudatum. Gardeners Chronicle, new ser. 20: 722. Pfau, R. 1884a. Cypripedium roebbeleni. Gardeners Chronicle, new ser. 21: 16. Pfau, R. 1884b. Trichocentrum pfavii. Gardeners Chronicle, new ser. 21: 50. Pfau, R. 1894. Notes on the fertilisation of orchids in the tropics. Orchid Review 2: 295. Pfau, R. 1895. New, rare, and beautiful orchids of Costa Rica and how they grow at home. San Jos, Costa Rica. Pp. 1. Pfau, R. 1896. Costa Rica and its Orchids. Gardeners Chronicle, ser.3, 19: 548. (24.2.1922). Pupulin, F. 1995. A revision of the genus Trichocentrum (Oncidiinae). Lindleyana 10(3): 183. Pupulin, F. 1997. The Trichocentrum pfavii group. Caesiana 8: 1. Pupulin, F. 2001. Miscellaneous new taxa in neotropical Orchidaceae. Selbyana 22(1): 14. Pupulin, F. 2005. Vanishing Beauty. Native Costa Rican Orchids. Vol. 1: AciantheraKegeliella. Editorial de la Universidad de Costa Rica, San Jos. P. XXI Costa Rican orchid species described from collections by K.Werckl. Botanical Journal of the Linnean Society 163: 111. Pupulin, F. & D. E. Mora de Retana.1994. A revision of the Costa Rican species of Trichocentrum. Selbyana 15(2): 87. Reichenbach, H.G. 1881. New garden plants: Trichocentrum pfavii, Cirrhopetalum abbreviatum, Cirrhopetalum trigonopus. Gardeners Chronicle, new ser. 16: 70. Reichenbach, H.G. 1883. New garden plants: Calanthe Lentiginosa, Trichocentrum pfavii, Trichocentrum pfavii zonale, Odontoglossum hebraicum lineoligerum, LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.316 LANKESTERIANA
PAGE 167
Dendrobium chrysanthum anophthalmum. Gardeners Chronicle, new ser. 19: 44. Rolfe, R. A. 1893. New Orchids: Decade 6. Bulletin of Miscellaneous Information (Kew) 1893: 172. naturalista. Editorial de la Universidad de Costa Rica, San Jos. Rica, Manuel Alberto Brenes. Brenesia 57-58: 7. Schlechter, R. 1910. Orchidaceae novae et criticae, Decas XI. Repertorium Specierum Novarum Regni Vegetabilis 9: 30, 293. Zentralamerika. Repertorium Specierum Novarum Regni Vegetabilis Beihefte 19: 1; 157; 268. Schweinfurth, C. 1944. A genus and species unrecorded for Peru. American Orchid Society Bulletin 12(11): 384. Senghas, K., H. Dietrich & G. Gerlach. 1992. 689. Chaubardiella. In: R.Schlechter, Die Orchideen Ed.3, 1B(26): 1646. Standley, P. C. 1926. Carlos Werckl. Science 63(1626): 221. Stevens, F. B. 1977. Epidendrum pfavii (Rolfe). Orchid Review 85(1008): 176. Senghasia, eine neue Gattung der Zygopetaleae. Journal fr den Orchideenfreund 10(4): 332. Campylocentrum. Brenesia 18: 117. Werckl, C. 1904. Heteromorphismus epiphytischer Cereen. Monatsschrift fr Kakteenkunde 14: 62. Werckl, C. 1905. Cactaceae in Costa Rica. Monatsschrift fr Kakteenkunde 15: 3, 165, 179. Werckl, C. 1907. Cacteen in Zentral-Columbien. Monatsschrift fr Kakteenkunde 17: 18. Williams, L. 1956. Enumeration of Orchidaceae of Central America, British Honduras and Panama. Ceiba 5(1): 195. Woolward, F. H. 1906. Masdevallia tonduzii spec. nov. Bulletin de lHerbier Boissier ser.2,6:82. JENNY Costa Rican orchid names317LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 168
LANKESTERIANA
PAGE 169
Introduction by Pridgeon and Chase (2001) was largely based on the results of the molecular phylogenetic studies of the subtribe (Pridgeon et al. 2001). The initial analyses were made on a representative set of species and their results were extrapolated to the whole subtribe by by Luer (1986), based on morphological similarities. The circumscription of each genus was discussed and Subsequent molecular studies have shown that several of the genera of Pleurothallidinae still require the monophyly criterion. Anathallis Barb.Rodr. is no exception. In the phylogenetic trees of Pridgeon et al. (2001), species of Pleurothallis R.Br. subgen. Acuminatia Luer (Luer 1999), including the type species of genus Anathallis, formed a clade together with species of Pleurothallis subgen. Specklinia sect. Muscosae Lindl. The clade was found sister to a clade which includes Trichosalpinx Luer and Lepanthes Sw., among others, and a broad concept of genus Anathallis was re-established (Prodgeon & Chase 2001; Pridgeon 2005). However, Pridgeons data set included only species of Pleurothallis subgen. Acuminatia sect. Alatae Luer and did not include representatives of sect. Acuminatae noted that species belonging to sect. Acuminatae were not related to those of sect. Alatae, but instead were found embedded within Stelis Sw. (sensu Pridgeon 2005), and suggested that, based on morphology, the same would be true for all other species in the section. The studies by Chiron et al. (2012) and Karremans et al. Acuminatae belonged in Stelis even proposed a new combination for Anathallis rubens (Lindl.) Pridgeon & M.W.Chase in Stelis, but neglected to transfer all other species of the section. Luer (2006) later segregated species of Pleurothallis subgen. Specklinia (Lindl.) Garay sect. Muscosae Lindl. into Panmorphia Luer resulting in a genus of 73 highly heterogeneous species with Specklinia-like habit and Anathallis variation within Panmophia graded into the concept of Anathallis, and he reduced his Panmophia as a synonym of the latter (Luer 2009). Analyses of molecular data by Panmorphia (including the type) were embedded within Anathallis. LANKESTERIANA 13(3): 319. 2014. I N V I T E D P A P E R LANKESTERIANA, A (ORCHIDACEAE) ADAM P. KARREMANS Lankester Botanical Garden, University of Costa Rica, P.O. Box 302-7050 Cartago, Costa Rica. Naturalis Biodiversity Center NHN Universiteit Leiden, The Netherlands adam.karremans@ucr.ac.cr ABSTRACT. We estimated phylogenetic relationships within Anathallis and related genera using Bayesian analyses of nrITS sequence data. The genus is biphyletic in the molecular trees. A novel generic concept, Lankesteriana, is proposed for the species Anathallis barbulata and 19 close relatives. The genus is more closely related to some species of Trichosalpinx and Zootrophion than to Anathallis s.s. Species previously transferred from Pleurothallis subgen. Acuminatia sect. Acuminatae to Anathallis are here transferred to Stelis to which they are related phylogenetically. A few additional transfers to Anathallis are made. Lankesteriana is described and KEY WORDS : Anathallis Lankesteriana, Specklinia Stelis phylogenetics, systematics* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary.
PAGE 170
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.320 LANKESTERIANAThis conclusion wa et al. (2012), who included a broad representation of Anathallis species in their analyses. One Anathallis species, the broadly distributed and highly variable Anathallis barbulata (Lindl.) Pridgeon & Chase, was shown to be distinct from all the other species (Chiron et al. 2012). It is probably the most well known species of the group here genus Pleurothallis R.Br., A. barbulata and a few close relatives were placed in Pleurothallis subgen. Specklinia sect. Muscosae Lindl. (Luer 1986). Later on, they were transferred to Anathallis by Pridgeon and Chase (2001) and Panmorphia by Luer (2006). We present nrITS analyses showing that most species of Panmorphia, including the type species, Anathallis sertularioides (Sw.) Pridgeon & Chase, are embedded within Anathallis. Our data also show that Anathallis barbulata and a few sister species are not closely related to other Anathallis and require generic recognition to maintain monophyly. Most of these Specklinia-like species of Anathallis have also been treated as species of Specklinia Lindl. at some point or another. A more extensive molecular phylogenetic analysis of Specklinia (Karremans et al. unpublished), excludes the species here treated as Anathallis (Pupulin et al. 2012, Bogarn et al. 2013, Karremans et al. 2013b), requiring the circumscription of those genera in the present manuscript. It becomes necessary as well to propose the systematic within Anathallis, Specklinia, and Stelis and to propose a segregated generic concept for the A. barbulata and its close relatives. Material and Methods. This study was conducted at Jardn Botnico Lankester (JBL) of the Universidad de Costa Rica and Naturalis Biodiversity Center Leiden University, between October 2011 and October 2013. Living material was studied at Lankester Botanical Garden and the Hortus Botanicus in Leiden, while dried and spirit material was deposited at CR, JBL-spirit and L-spirit. Taxon names mostly follow Pridgeon (2005). Photography . Color illustrations of complete while photographs of the columns and pollinaria were taken using a DFC295 Leica digital microscope color camera with Leica FireCam version 3.4.1 software. Scanning electron microscope (SEM) micrographs glacial acetic acid 5%, water 35%, ethanol 50%). series of ethanol steps and subjected to critical-pointdrying using liquid CO2. Dried samples were mounted and sputter-coated with gold and observed with a JEOL JSM-5300 scanning electron microscope at an accelerating voltage of 10kV. Phylogenetic analysis . The data matrix included 56 individuals (Table 1), 18 of which were produced in this study. The remaining data were obtained from GenBank (Pridgeon et al. 2001, Chiron et al. 2012, Karremans et al. 2013a). Plants were obtained from living collections at Lankester Botanical Garden in Costa Rica, the Hortus Botanicus in Leiden, and private collections. Vouchers were deposited in cuttings of approximately 1 cm2 were dried with silica performed following the DNEasy procedure (Qiagen). The nuclear ribosomal internal transcribed spacer by Sun et al. (1994), and Sanger sequencing was done commercially by Macrogen on a 96-capillary Biosystems, Inc.) using standard dye-terminator chemistry (Macrogen, Inc.). The Staden et al. (2003) package was used for editing of the sequences. Contigs were exported as & Maddison 2007), where they were checked for base calling errors, the matrix was aligned manually. The ends of each data set were trimmed to eliminate possible erroneous data, and gaps were regarded deposited in the Dryad Digital Repository (Heneghan et al. 2011). Echinosepala aspasicensis was used as the outgroup, as it was found to be one of the most distantly related of all included species (Pridgeon et al. 2001). The trees were produced with an analysis of the nrITS dataset of 43 sequences using BEAST v1.6.0. (Drummond & Rambaut 2007). Parameters
PAGE 171
KARREMANS Lankesteriana, new genus321LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.were set to preset, except for substitution model GTR with 10 categories, clock model uncorrelated lognormal, tree prior Yule process, and number of generations 20,000,000. The resulting trees were combined using TreeAnnotator v1.6.0., where the (Rambaut 2009) was used to edit the resulting tree. Posterior probabilities are given for each node in decimal form. Results. The consensus gene tree (Fig. 1) was obtained from a BEAST analysis of a matrix of 56 ITS sequences (Table 1), including 41 individuals belonging to 34 different species of genus Anathallis. The resulting tree includes two highly supported clades of Anathallis Anathallis and the second clade has been coded Lankesteriana. Clade Lankesteriana (P.P. = 0.98) includes the accessions of the species Anathallis barbulata, A. cuspidata, A. duplooyi and A clade including Trichosalpinx berlineri and T. dependens (Trichosalpinx II) is highly supported (P.P. = 1) as sister to the Lankesteriana clade. Sister to both is a clade including species of Zootrophion with high support (P.P. = 0.94). Clade Anathallis is highly supported (P.P. = 1) and includes all accessions of genus Anathallis with the exception of those found in clade Lankesteriana. Clade Anathallis includes A. obovata, type species of the genus, and A. sertularioides, type species of genus Panmorphia. A clade including Trichosalpinx blaisdellii and T. orbicularis (Trichosalpinx I) is found with low support (P.P. = 0.35) sister to the Anathallis. Altogether they are sister, with medium support (P.P.=0.66), to a highly supported (P.P. = 1) clade which includes the accessions of Frondaria Luer, Lepanthes Sw. and Lepanthopsis (Cogn.) Ames. Both mentioned clades are sister to each other, and in turn to an accession of Trichosalpinx arbuscula (Trichosalpinx III), with low support (P.P. = 0.44). High support (P.P. = 1) is found for a clade which includes all the accessions of Anathallis, Frondaria, Lepanthes, Lepanthopsis, Trichosalpinx and Zootrophion Luer. Branch length varies greatly within the whole group. The length of accessions of clade Lankesteriana double or triple those of Anathallis, the latter having accumulated many more nucleotide changes. Discussion The DNA based evidence obtained here supports the results of Chiron et al. (2012), showing that Anathallis is non-monophyletic. The addition of other accessions of the variable A. barbulata, and of its close relatives A. duplooyi, A. cuspidata and whole should be excluded from Anathallis. The two highly supported clades of Anathallis are not sister to each other. Most of these species had already been segregated from Anathallis into Panmorphia by Luer, together with several others. However, Panmorphia is not monophyletic. The type species of Panmorphia is a member if Anathallis s.s., necessitating a novel generic concept for the remaining species of the former Panmorphia. When describing Panmorphia, of variations among them, however, he did mention little group. In fact, this species group can also be easily distinguished from other species of the genus on morphological grounds, and they are therefore Lankesteriana Karremans, Gen. Nov. TYPE : Pleurothallis barbulata Lindl. Folia Orch. Pleurothallis 40. 1859. Replaced name for Pleurothallis barbata H.Focke, Bot. Zeitung (Berlin) 11(13): 227. 1853 (non Pleurothallis barbata Westc., Phytologist 1: 54. 1841). Species of Lankesteriana are somewhat similar to Anathallis but can be distinguished by the tri-alate lateral sepals convergent and usually fused to above the middle (vs. sepals free and spreading), the deeply depressed), the bilobed, helmet-shaped rostellum (vs. ligulate, not bilobed). Additionally, none of the known species of Lankesteriana have: 1) a habit that Anathallis. DESCRIPTION : Plants very small, 0.5-3 cm tall
PAGE 172
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.322 LANKESTERIANA FIGURE 1. Consensus tree from a BEAST analysis of a matrix of 56 ITS sequences. The analysis ran for 20,000,000 generations. A Branch length transformed to be equal for each species. Values on the nodes are Posterior Probabilities. Species names for each terminal is included. B Relative branch lengths maintained, showing amount of evolutionary changes. Scale equals a 2% change. Posterior probability values and species names are excluded, but are equal to those of A. Trees edited by A.P. Karremans using FigTree.
PAGE 173
KARREMANS Lankesteriana, new genus323LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. TABLE 2005. Taxon Voucher collector and number GenBank number Source Anathallis adenochila (Loefgr.) F.Barros (1) van den Berg 2148 (HUEFS) JQ306490 Chiron et al. 2012 Anathallis adenochila (Loefgr.) F.Barros (2) Karremans 4871 (L) KC425725 This study Anathallis angustilabia (Schltr.) Pridgeon & M.W.Chase Manning 890604 (K) AF262868 Pridgeon et al. 2001 Anathallis aristulata (Lindl.) Luer van den Berg 2042 (HUEFS) JQ306338 Chiron et al. 2012 Anathallis barbulata (Lindl.) Pridgeon & M.W. Chase (1) Chiron 11071 (HUEFS) JQ306457 Chiron et al. 2012 Anathallis barbulata (Lindl.) Pridgeon & M.W. Chase (2) Bogarn 8606 (JBL) KC425726 This study Anathallis barbulata (Lindl.) Pridgeon & M.W. Chase (3) Karremans 5750 (L) KF747834 This study Anathallis bolsanelloi Chiron & V.P.Castro van den Berg 2000 (HUEFS) JQ306342 Chiron et al. 2012 (Luer & Sijm) Luer Karremans 4857 (L) KC425727 This study Anathallis citrina (Schltr.) Pridgeon & M.W.Chase van den Berg 2086 (HUEFS) JQ306498 Chiron et al. 2012 Anathallis corticicola (Schltr. ex Hoehne) Pridgeon & M.W.Chase Hermans 3685 (K) AF262870 Pridgeon et al. 2001 Anathallis cuspidata (Luer) Pridgeon & M.W. Chase Bogarn 9619 (JBL) KF747835 This study Anathallis depauperata (Cogn.) Karremans 4808 (L) KC425735 This study Anathallis duplooyi (Luer & Sayers) Luer Karremnas 4888 (JBL) KF747836 This study (Ames & C. Schweinf.) Luer (1) Bogarn 8988 (JBL) KC425728 This study (Ames & C. Schweinf.) Luer (2) Bogarn 8988 (JBL) KC425729 This study Anathallis grayumii (Luer) Luer (1) Karremans 2747 (JBL) KC425730 This study Anathallis grayumii (Luer) Luer (2) Pupulin 3794 (JBL) KC425731 This study Anathallis heterophylla Barb.Rodr. van den Berg 2031 (HUEFS) JQ306339 Chiron et al. 2012 Anathallis kautskyi (Pabst) Pridgeon & M.W.Chase van den Berg 2051 (HUEFS) JQ306340 Chiron et al. 2012 Anathallis lewisiae (Ames) Solano & Soto Arenas Bogarn 1056 (JBL) KC425733 This study Anathallis linearifolia (Cogn.) Pridgeon & M.W.Chase Hrmans 2336 (K) AF262869 Pridgeon et al. 2001 Anathallis microgemma (Schltr. ex Hoehne) Pridgeon & M.W.Chase Manning 940319 (K) AF262894 Pridgeon et al. 2001 Anathallis minutalis (Lindl.) Pridgeon & M.W.Chase Jimenez-M. 1044 (UNAM) AF262922 Pridgeon et al. 2001 Anathallis nanifolia (Foldats) Luer Karremans 4793 (L) KC425736 This study Anathallis nectarifera Barb.Rodr. van den Berg 2078 (HUEFS) JQ306458 Chiron et al. 2012 Anathallis obovata (Lindl.) Pridgeon & M.W.Chase (1) Kollmann 6092 (MBML) JQ306497 Chiron et al. 2012 Anathallis obovata (Lindl.) Pridgeon & M.W.Chase (2) Stenzel 840 (CU) JF934822 Stenzel 2004 Anathallis obovata (Lindl.) Pridgeon & M.W.Chase (3) Karremans 4796 (L) KF747797 This study Anathallis ourobranquensis Campacci & Menini Chiron 11220 (HUEFS) JQ306459 Chiron et al. 2012 Anathallis pabstii (Garay) Pridgeon & M.W.Chase Karremans 4821 (L) KC425737 This study Anathallis pachyphyta (Luer) Pridgeon & M.W.Chase Karremans 4795 (L) KC425734 This study Anathallis peroupavae (Hoehne & Brade) F. Barros Karremans 5759 (L) KF747837 This study Anathallis petropolitana (Hoehne) Luer & Toscano van den Berg 2089 (HUEFS) JQ306491 Chiron et al. 2012 Anathallis piratiningana (Hoehne) F.Barros van den Berg 2066 (HUEFS) JQ306344 Chiron et al. 2012 Anathallis pubipetala (Hoehne) Pridgeon & M.W.Chase van den Berg 2106 (HUEFS) JQ306460 Chiron et al. 2012 Anathallis rabei (Foldats) Luer Karremans 4794 (L) KC425738 This study Anathallis radialis (Porto & Brade) Pridgeon & M.W.Chase Chiron 10144 (HUEFS) JQ306345 Chiron et al. 2012 (Pabst) Pridgeon & M.W.Chase van den Berg 2127 (HUEFS) JQ306461 Chiron et al. 2012 Anathallis sertularioides (Sw.) Pridgeon & M.W.Chase Solano 807 (UNAM) AF262871 Pridgeon et al. 2001
PAGE 174
TABLE 1. Continues. Taxon Voucher collector and number GenBank number Source Anathallis welteri (Pabst) F.Barros van den Berg 2009 (HUEFS) JQ306341 Chiron et al. 2012 Echinosepala aspasicensis (Rchb. f.) Pridgeon & M.W. Chase Hermans 2160 (K) AF262905 Pridgeon et al. 2001 Frondaria caulescens (Lindl.) Luer Luer 18778 (K) AF262914 Pridgeon et al. 2001 Lepanthes felis Luer & R. Escobar Hermans 2899 (K) AF262891 Pridgeon et al. 2001 Lepanthes steyermarkii Foldats Hermans 2682 (K) AF262889 Pridgeon et al. 2001 Lepanthes woodburyana Stimson Hermans 2931 (K) AF262890 Pridgeon et al. 2001 Lepanthopsis astrophora Garay Manning 941040 (K) AF262893 Pridgeon et al. 2001 Lepanthopsis (Rchb. f.) Ames van den Berg 2063 (HUEFS) JQ306336 Chiron et al. 2012 (Lindl.) Luer Hermans 1266 (K) AF262888 Pridgeon et al. 2001 (Luer) Luer Hermans 1605 (K) AF262900 Pridgeon et al. 2001 (S.Watson) Luer Kew 1997-7412 (K) AF262887 Pridgeon et al. 2001 (Luer) Luer van den Berg 2011 (HUEFS) JQ306456 Chiron et al. 2012 (Lindl.) Luer Hermans 1349 (K) AF262886 Pridgeon et al. 2001 Zootrophion atropurpureum (Lindl.) Luer (1) Kew 1997-7414 (K) AF262898 Pridgeon et al. 2001 Zootrophion atropurpureum (Lindl.) Luer (2) van den Berg 2056 (HUEFS) JQ306415 Chiron et al. 2012 Zootrophion serpentinum Luer Manning 921030 (K) AF262899 Pridgeon et al. 2001Ramicauls ascending, shorter than the leaf, never proliferating, with 1-3 imbricating, tubular, glandular to microscopically glandular sheaths. Leaf erect to prostrate. elongate, frequently exceeding Flowers usually brownish-purple, sepals glabrous to ciliate. Ovary trialate. Sepals elliptic, acute, the lateral ones fused to above the middle or least convergent, forming a synsepal. Petals lanceolate to ovate-elliptic, widest near the middle, obtuse or acute, to acuminate, sometimes caudate. Lip oblong, to more or less pandurate, with a pair of basal sub-orbicular lobes, with a deep linear middle depression. Column winged, shaped, with prominent lateral lobes. Anther helmetshaped. Pollinia in pairs, with reduced, granulose, whale-tail shaped caudicles (Fig. 2 & 3). ETYMOLOGY : The name honors both the Lankester Botanical Garden of the University of Costa Rica, which is celebrating 40 years of existence, and also Lankesteriana, International Journal on Orchidology. DISTRIBUTION AND ECOLOGY : Nineteen species of Lankesteriana however as is frequent with other tiny Pleurothallids, and lumped together into broad and variable species concepts. Species of Lankesteriana are distributed from southern Mexico, through Central America, the (Fig. 4). Costa Rica, Ecuador and Colombia contain center of diversity of sister genus Anathallis, has just a few Lankesteriana; they are notably absent from the Antilles. They occur between 280 and 2800 m in elevation, but most are found at mid elevations between 600 and 2000 m. treated as Lankesteriana were similar to some species of Trichosalpinx subgen. Trichosalpinx ( Trichosalpinx I & II in Fig. 1). In fact, they resemble species of Trichosalpinx much more than Anathallis. Trichosalpinx was established by Luer for a group of species which shared the lepanthiform bracts of the stem and which Draconanthes (Luer) Luer, Lepanthes or Lepanthopsis (Luer 1997), however that meant that they did not share a particular synapomorphy, and may not represent a natural grouping. The inclusion LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.324 LANKESTERIANA
PAGE 175
KARREMANS Lankesteriana, new genus325LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.of a few species of Trichosalpinx in the DNA studies of Pridgeon et al. (2001) evidenced the polyphyly of the genus. A phylogenetic analysis of genus Trichosalpinx, including many more additional species, further evidences the need for a complete re-circumscription of this highly polyphyletic genus, which is diversely et al. unpublished). Subgenus Trichosalpinx is biphyletic in the analysis presented here (Fig. 1), with a clade including the type of the genus (Trichosalpinx I), sister to Anathallis, and a second clade (Trichosalpinx II), sister to Lankesteriana. A reconsideration of Trichosalpinx FIGU R E 2. SEM images of micromorphology of Lankesteriana species. A Column ventral view showing the the basal sub-orbicular lobes and the glandular hairs near the apex. Specimens are Lankesteriana cuspidata (A-left & B; Bogarn 9619; JBL-spirit) and Lankesteriana barbulata (A-right; Karremans 5444; JBL-spirit). Photographs by A.P. Karremans Left, FIGURE 3. Micrographs taken with the Leica stereo microscope. A. Apex of the column in ventral view, from left to right, of Lankesteriana cuspidata (Fernndez 695; JBL-spirit) and Anathallis polygonoides (JBL28237; JBL-spirit). B. Pollinaria, from left to right, of Lankesteriana cuspidata (Fernndez 695; JBL-spirit), Anathallis polygonoides (JBL-28237; JBL-spirit), Anathallis lewisae (Bogarn 1056; JBL-spirit) and Trichosalpinx blaisdellii (Pupulin 1092; JBL-spirit). Photographs by A.P. Karremans.
PAGE 176
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.326 LANKESTERIANAtask that falls outside of the scope of this study. It Anathallis and Trichosalpinx (Trichosalpinx I) distinct enough to keep them as separate genera and that the clade which includes Lankesteriana and Trichosalpinx II was until now unnamed. When revising Trichosalpinx in the future it can be re-considered if it is advantageous to include the few species belonging to Trichosalpinx II in a broadened Lankesteriana, however, based on morphology and genetic distance, such a move is in our view unfavorable. With species of subgen. Trichosalpinx they share the fused sepals (with a few exceptions), the usually lip, with a pair of rounded lobes at the base, and a midline depression and the helmet-shaped rostellum. These traits suggest that both groups share a similar pollinator group. Species of subgen. Trichosalpinx however can be easily distinguished from those of Lankesteriana by the much larger plants, with long ramicauls covered with lepanthiform bracts and the KEY TO THE GENERA WITH SPECKLINIA-LIKE HABIT inornate to narrowly winged ..................................... ........................................... Muscarella (Specklinia) usually not caudate, petals entire to minutely denticulate, infrequently caudate, column ornate ......... 2 2. Petals linear to lanceolate, acute to acuminate, column wings quadrate to triangular, androclilacking a deep mid-line depression, rostellum ligulate .......................................... Anathallis brownish-purple, lip with deep a midline depression, rostellum helmet-like bilobate ..... ................................................. Lankesteriana 2. Petals elliptic to spathulate, obtuse, column wings rounded, androclinium erose or inornate ......... 4 4. Lip mostly linear-ligulate, column wings prominent, pollinia without caudicles ............ ....................................................... Specklinia 4. Lip trilobed, with a pair of suborbicular lobes close to the middle, columninconspicuously ornate or inornate, pollinia with caudicles ..... ....................................................... Pabstiella Lankesteriana abbreviata (Schltr.) Karremans, comb. nov. Bas. Pleurothallis abbreviata Schltr., Repert. Spec. Nov. Regni Veg. 10: 352. 1912. Lankesteriana barbulata (Lindl.) Karremans, comb. nov. Bas. Pleurothallis barbulata Lindl. Folia Orch. Pleurothallis 40. 1859. Replacement name for P. barbata H.Focke, 1853. Note: Specklinia pereziana Kolan. published in 2011 from Colombia, is virtually indistinguishable from Lankesteriana barbulata, a common, widely distributed, variable species with several heterotypic synonyms. As L. barbulata was not even mentioned by the author there is no evidence to separate the two. FIGURE 4. Distribution map (in green) of the 19 known species of Lankesteriana Karremans. The highest diversity of the genus in found from Costa Rica to Colombia and Ecuador.
PAGE 177
KARREMANS Lankesteriana, new genus327LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Lankesteriana casualis (Ames) Karremans, comb. nov. Bas. Pleurothallis casualis Ames, Sched. Orch. 9: 30, 1925. Lankesteriana caudatipetala (C.Schweinf.) Karremans, comb. nov. Bas. Pleurothallis caudatipetala C.Schweinf. Bot. Lankesteriana comayaguensis (Ames) Karremans, comb. nov. Bas. Pleurothallis comayaguensis Ames, Bot. Mus. Lankesteriana cuspidata (Luer) Karremans, comb. nov. Bas. Pleurothallis cuspidata Luer, Selbyana 3: 282, 1977. Lankesteriana duplooyi (Luer & Sayers) Karremans, comb. nov. Bas. Pleurothallis duplooyi Luer & Sayers. Rev. Soc. Bol. Bot. 3: 48, 2001. Lankesteriana edmeiae (F.J. de Jesus, Xim. Bols. & Chiron) Karremans, comb. nov. Bas. Anathallis edmeiae F.J. de Jesus, Xim. Bols. & Chiron, Richardiana 13: 296. 2013. Lankesteriana escalarensis (Carnevali & Luer) Karremans, comb. nov.. Bas. Pleurothallis escalarensis Carnevali & Luer, Novon 13: 414. 2003. (Ames & C.Schweinf.) Karremans, comb. nov. Bas. Ames & C.Schweinf., Sched. Orch. 10: 26, 1930. Lankesteriana haberi (Luer) Karremans, comb. nov. Bas. Pleurothallis haberi Luer, Selbyana 23:36. 2002. Lankesteriana imberbis comb. nov. Bas. Pleurothallis imberbis Lindleyana 11: 163, 1996. Lankesteriana inversa Karremans, comb. nov. Bas. Pleurothallis inversa Soc. Bol. Bot. 3: 50. 2001. Lankesteriana involuta (L.O.Williams) Karremans, comb. nov. Bas. Pleurothallis involuta L.O.Williams, Bot. Lankesteriana millipeda (Luer) Karremans, comb. nov. Bas. Pleurothallis millipeda Luer, Orquideologa 20: 216. 1996. Lankesteriana minima (C.Schweinf.) Karremans, comb. nov. Bas. Pleurothallis minima C.Schweinf., Bot. Mus. Lankesteriana muricaudata (Luer) Karremans, comb. nov. Bas. Pleurothallis muricaudata Luer, Selbyana 7: 119. 1982. Lankesteriana rubidantha (Chiron & Xim.Bols.) Karremans, comb. nov. Bas. Specklinia rubidantha Chiron & Xim.Bols., Richardiana 9: 125. 2009. Lankesteriana steinbuchiae (Carnevali & G.A.Romero) Karremans, comb. nov. Bas. Pleurothallis steinbuchiae Carnevali & G.A.Romero, Novon 4: 90. 1994. Anathallis Barb.Rodr., Gen. Sp. Orch. Nov. 1: 23. 1877. TYPE : Anathallis fasciculata Barb.Rodr., Gen. Sp. Orch. Nov. 1: 23. 1877. This relatively old genus remained mostly unused until it was re-established by Pridgeon and Chase clear how many and which species actually belonged to the concept, but initially about 90 species were transferred. About 90 more names were added by other authors since then (mostly transfers from other genera, but also new species). If we exclude the species that belong to Lankesteriana and Stelis, we end up just shy of 140 species, a number which seems reasonable. Species of Anathallis are distributed from southern Mexico through Central America, the Antilles and all South America down to Argentina. They are most with linear to lanceolate, acute to acuminate petals
PAGE 178
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.328 LANKESTERIANA placed and very sensitive, its general shape is linearligulate but frequently it has small lobes at the base and/or middle. The column is sharply winged and and have reduced whale-tail shaped caudicles. One species before treated as Specklinia is transferred here to Anathallis based on those morphological features. Anathallis napintzae comb. nov. Bas. Pleurothallis napintzae Lindleyana 11: 173. 1996. Stelis Sw., J. Bot. (Schrader) 2: 239. 1799. LECTOYPE : Epidendrum ophioglossoides Jacq., Enum. Pl. Carib., 29. 1760. Although this genus has been traditionally accepted (Karremans et al. 2013), it was greatly et al. (2005). As such the genus was broadened from species groups before placed in Pleurothallis. Stelis and extensively discussed by Karremans (2010) and Karremans et al. (2013), and was proven largely monophyletic if the species of Pleurothallis subgen. Acuminatia sect. Acuminatae were transferred to it. That species group was found to be closely related to the species of Stelis in a strict sense (Luer 2009). bett preferred by the author, these species are transferred to a broad sense of Stelis where they are more accurately placed than previously. In any other scenario this species group would require generic recognition, however, several other circumscribed as well. This might be possible at a later stage when the species belonging to each of those other groupings are well understood. The species transferred here were in any case already proven nonmonophyletic as a group by Karremans et al. (2013), however, all still within the broad concept of Stelis. Stelis ariasii comb. nov. Bas. Pleurothallis ariasii 12: 42. 1997. Stelis asperilinguis comb. nov.. Bas. Pleurothallis asperilinguis Bonplandia (Hannover) 2: 114. 1854. Stelis aurea (Lindl.) Karremans, comb. nov. Bas. Pleurothallis aurea Lindl., Ann. Mag. Nat. Hist. 12: 397. 1843. Replaced synonym: Dendrobium acuminatum Kunth in F.W.H.von Humboldt, A.J.A.Bonpland & C.S.Kunth, Nov. Gen. Sp. 1: 357. 1816 = Anathallis acuminata (Kunth) Pridgeon & M.W. Chase. Note: The name Dendrobium acuminatum has priority over P. aurea, however Stelis acuminata occupies the combination in Stelis. The heterotypic synonyms of this species, if not proven distinct and if not occupied in genus Stelis, have priority in the necessity of a new name. Therefore Stelis aurea is proposed for this species. Stelis candida comb. nov. Bas. Pleurothallis candida Syst. Bot. Missouri Bot. Gard. 76: 107. 1999. Stelis catenata Karremans, nom. nov. Replaced synonym: Pleurothallis ramulosa Lindl., Fol. Orchid. 9: 33. 1859. ETYMOLOGY : From the Latin catenatus referring to the chains of ramicauls formed. Note: The name Stelis ramulosa Luer & Dalstrm (2004) occupies the combination in Stelis required for Pleurothallis ramulosa [=Anathallis ramulosa (Lindl.) Pridgeon & M.W. Chase]. Its heterotypic synonym Pleurothallis superposita Schltr. (1916) cant be combined in Stelis either as Stelis superposita Schltr. (1915) is also occupied. A new name for the species is therefore proposed. Stelis coripatae comb. nov. Bas. Pleurothallis coripatae Phytologia 46: 362. 1980. Stelis dimidia (Luer) Karremans, comb. nov. Bas. Pleurothallis dimidia Luer, Monogr. Syst. Bot. Missouri Bot. Gard. 76: 109. 1999.
PAGE 179
KARREMANS Lankesteriana, new genus329LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Stelis jesupiorum comb. nov. Bas. Pleurothallis jesupiorum Lindleyana 11: 164. 1996. Stelis lagarophyta (Luer) Karremans, comb. nov. Bas. Pleurothallis lagarophyta Luer, Monogr. Syst. Bot. Missouri Bot. Gard. 76: 112. 1999. Stelis lamprophylla (Schltr.) Karremans, comb. nov. Bas. Pleurothallis lamprophylla Schltr., Repert. Spec. Nov. Regni Veg. 15: 205. 1918. Replaced synonym: Pleurothallis dolichopus Schltr., Repert. Spec. Nov. Regni Veg. 10: 394. 1912 = Anathallis dolichopus (Schltr.) Pridgeon & M.W. Chase. Note: The name Pleurothallis dolichopus has priority over P. lamprophylla, however Stelis dolichopus Schltr. occupies the combination in Stelis. The heterotypic synonyms of this species, if not proven distinct and if not occupied in genus Stelis, have priority in the necessity of a new name. Therefore Stelis lamprophylla is proposed for this species. Stelis lauta Karremans, nom. nov. Replaced Synonym: Pleurothallis concinna Luer & ETYMOLOGY : From the Latin lautus a replacement for the also Latin adjective concinnatus used in the original description of this species. Note: The name Stelis concinna Lindl. (1834) occupies the combination in Stelis required for Pleurothallis concinna [=Anathallis concinna Pridgeon & M.W. Chase]. A new name for the species is proposed. Stelis lennartii Karremans, nom. nov. Replaced Synonym: Pleurothallis anderssonii Luer, Lindleyana 11: 145. 1996. ETYMOLOGY : The name honors Lennart Andersson, to whom the species was originally dedicated. Note: The name Stelis anderssonii Luer & Endara occupies the combination in Stelis required for Pleurothallis anderssonii [=Anathallis anderssonii (Luer) Pridgeon & M.W. Chase]. A new name for the species is proposed. Stelis maguirei (Luer) Karremans, comb. nov. Bas. Pleurothallis maguirei Luer, Monogr. Syst. Bot. Missouri Bot. Gard. 76: 113. 1999. Stelis mediocarinata (C.Schweinf.) Karremans, comb. nov. Bas. Pleurothallis mediocarinata C.Schweinf., Fieldiana, Bot. 33: 26. 1970. Stelis melanopus comb. nov. Bas. Pleurothallis melanopus Bot. Jahrb. Syst. 26: 443. 1899. Replaced synonym: Pleurothallis stenophylla Anathallis stenophylla & M.W. Chase. Note: The name Pleurothallis stenophylla has priority over P. melanopus, however Stelis stenophylla Rchb.f. occupies the combination in Stelis. The heterotypic synonyms of this species, if not proven distinct and if not occupied in genus Stelis, have priority in the necessity of a new name. Therefore Stelis melanopus is proposed for this species. Stelis meridana (Rchb.f.) Karremans, comb. nov. Bas. Pleurothallis meridana Rchb.f., Linnaea 22: 826. 1850. Stelis montserratii (Porsch) Karremans, comb. nov. Bas. Pleurothallis montserratii Porsch, Oesterr. Bot. Zeitsch. 158. 1905. Replaced synonym: Pleurothallis rubens Lindl., Edwardss Bot. Reg. 21: t. 1797. 1835. Note: The name Pleurothallis rubens has priority over P. montserratii, however as Stelis rubens Schltr. (1910) occupies the combination in Stelis, a new name has to be proposed in that genus. Chiron et al. (2012) proposed Stelis neorubens Chiron, however the heterotypic synonyms of this species, if not proven distinct and if not occupied in genus Stelis, have priority in the necessity of a new name. Therefore Stelis montserratii is proposed for this species and has priority over S. neorubens, unless it is proven a distinct species. Stelis papuligera (Schltr.) Karremans, comb. nov. Bas. Pleurothallis papuligera Schltr., Repert. Spec. Nov. Regni Veg. 10: 453. 1912. Stelis regalis (Luer) Karremans, comb. nov. Bas. Pleurothallis regalis Luer, Selbyana 5: 178. 1979.
PAGE 180
Stelis scariosa (Lex.) Karremans, comb. nov. Bas. Dendrobium scariosum Lex. in P.de La Llave 39. 1825. Stelis schlimii (Luer) Karremans, comb. nov. Bas. Pleurothallis schlimii Luer, Monogr. Syst. Bot. Missouri Bot. Gard. 76: 120. 1999. Stelis sclerophylla (Lindl.) Karremans, comb. nov. Bas. Pleurothallis sclerophylla Lindl., Edwardss Bot. Reg. 21: t. 1797. 1835. Stelis soratana (Rchb.f.) Karremans, comb. nov. Bas. Pleurothallis soratana Rchb.f., Xenia Orchid. 3: 25. 1881. Stelis spathilabia (Schltr.) Karremans, comb. nov. Bas. Pleurothallis spathilabia Schltr., Repert. Spec. Nov. Regni Veg. Beih. 27: 56. 1924. Stelis spathuliformis comb. nov. Bas. Pleurothallis spathuliformis Luer & Stelis unduavica comb. nov. Bas. Pleurothallis unduavica Phytologia 46: 372. 1980. Stelis vasquezii (Luer) Karremans, comb. nov. Bas. Pleurothallis vasquezii Luer, Phytologia 49: 220. 1981. Conclusions. High species diversity and the many cases of convergence and parallelism make the systematics of features are often congruent with phylogenetic hypotheses based on DNA data, but homoplasy can occur in morphological traits; similar morphological history. Molecular data provide an independent data set that can be used to evaluate morphological homoplasy. Anathallis, Specklinia and Stelis have been proposed here in an effort to circumscribe genera that are both monophyletic and diagnosable using morphological characters. With the exclusion of the species belonging to Lankesteriana and Stelis, the recircumscribed Anathallis is monophyletic based on all available data. It must be stressed that the present work does not intend to be a molecularly based phylogenetic study of Anathallis and Lankesteriana. Instead, a systematic re-circumscription of those genera is proposed using an all evidence approach in which clear morphological patterns are correlated with available DNA evidence. The analyses of additional genetic regions and of relationships among these species, however, as already evidenced in several earlier studies the basic phylogenetic reconstruction produced using a representative number of nrITS sequences is mostly found unchanged (Pridgeon & Chase 2001; Karremans 2010; Karremans et al. 2013), especially when the morphologically (Luer 2002; Karremans 2010). Lankesteriana genus of some 19 species. They are widely distributed in the Neotropics with the noteworthy exception of the Antilles. The genus is phylogenetically closely related to some species of Trichosalpinx and Zootrophion, however, the tiny habit with an extremely reduced ramicaul with adpressed inconspicuous bracts, and the relatively long species of Anathallis and Specklinia much more closely. usually fused lateral sepals and an extremely sensitive lip are once again reminiscent of some species of Trichosalpinx subgen. Trichosalpinx. ACKNO W LEDGMENTS I am thankful to the Costa Rican Ministry of Environment and Energy (MINAE) and its National System Passports under which wild species treated in this study were collected. My colleagues Franco, Diego and Melania at Lankester Botanical Garden have been most insightful, and have helped with the collecting and documenting the studied material. Some of data was produced as part of the research projects under supervision of Barbara Gravendeel in diverse LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.330 LANKESTERIANARight, FIGURE 5. Representative species of genus Lankesteriana. A Lankesteriana barbulata (Karremans 5187; JBLspirit). B Lankesteriana barbulata (Karremans 5447; JBL-spirit) C Lankesteriana cuspidata (Bogarn 9619; JBL-spirit). D Lankesteriana duplooyi (Karremans 4888; JBL-spirit). E (Bogarn 8988; JBL-spirit). F Lankesteriana sp.nov. (Karremans 4900; JBL-spirit). Photographs by A.P. Karremans.
PAGE 181
KARREMANS Lankesteriana, new genus331LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 182
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.332 LANKESTERIANAlabs at Leiden University and the Naturalis Biodiversity Center. In general I wish to thank all the staff of JBL and L for the unrestricted access and help. I am most thankful to Lio and Ibra for the delight they have been during this period. Lisa Thoerle and two other anonymous reviewers made a series of improvements to the manuscript, and I am very thankful to them. I am also in debt to the Vice-Presidency of Research of the University of Costa Rica for providing support through regin Mesoamericana (814-A7-015), Flora Costaricensis: Taxonoma y Filogenia de la subtribu Pleurothallidinae (Orchidaceae) en Costa Rica (814-BO-052), Filogenia molecular de las especies de Orchidaceae endmicas de Costa aislamiento reproductivo y diferenciacin de nichos de Specklinia endotrachys (814-B3-075). LITERATURE CITED Bogarn, D., A.P. Karremans, R. Rincn & B. Gravendeel. 2013. A new Specklinia (Orchidaceae: Pleurothallidinae) from Costa Rica and Panama. Phytotaxa 115(2): 31-41. Chiron, G.R., J. Guiard & C. van den Berg. 2012. Pleurothallis sensu lato (Pleurothallidinae, Orchidaceae): evidence from nuclear ITS rDNA sequences. Phytotaxa 46: 34. Drummond, A.J. & A. Rambaut. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7: 214. Heneghan C, M. Thompson, M. Billingsley & D. Cohen. 2011. Data from: Medical-device recalls in the UK and the device-regulation process: retrospective review of safety notices and alerts. Dryad Digital Repository. http:// dx.doi.org/10.5061/dryad.585t4. Karremans, A.P. 2010. Phylogenetics of Stelis (Orchidaceae: Pleurothallidinae) and closely related genera, based on molecular data, morphological characteristics and geographical distribution in the Central American and Andean Cordilleras. MSc Thesis, Plant Sciences Group and Biosystematics Group, Wageningen University. & M.J.M. Smulders. 2013a. Phylogenetics of Stelis and closely related genera (Orchidaceae: Pleurothallidinae). Plant Syst. Evol. 29(1): 69-86. Karremans, A.P., F. Pupulin & B. Gravendeel. 2013b. Taxonomy, molecular phylogenetics, reproductive isolation, and niche differentiation of the Specklinia endotrachys species complex (Orchidaceae: Pleurothallidinae). Lankesteriana 13(1-2): 132-133. Luer, C.A. 1986. Systematics of the genus Pleurothallis (Orchidaceae). Mongr. Syst. Bot. Missouri Bot. Gard. 20. Luer, C.A. 1997. Systematics of Trichosalpinx. Monogr. Syst. Bot. Missouri Bot. Gard. 64. Luer, C.A. 1999. lcones Pleurothallidinarum XVIII. Systematics of Pleurothallis Subgen. Pleurothallis Sect. Pleurothallis Subsect. Antenniferae, Subsect. Longiracemosae, Subsect. MacrophyllaeRacemosae, Subsect. Perplexae, Subgen. Pseudostelis, Subgen. Acuminatia. Mongr. Syst. Bot. Missouri Bot. Gard. 76. Pleurothallidinae versus a strictly phylogenetic method. Selbyana 23(1): 57-110. Luer, C.A. 2006. Icones Pleurothallidinarum XXVIII. Reconsideration of Masdevallia, and the Systematics of Specklinia and vegetatively similar genera (Orchidaceae). Mongr. Syst. Bot. Missouri Bot. Gard. 105. Luer, C.A. 2009. Icones Pleurothallidinarum XXX. Lepanthes of Jamaica and Systematics of Stelis, Stelis of Ecuador, part four and addenda: systematic of Masdevallia, new species of Lepanthes from Ecuador, and miscellaneous new combinations. Mongr. Syst. Bot. Missouri Bot. Gard. 115. Maddison, W.P. & D.R. Maddison. 2007. Mesquite: a modular system for evolutionary analysis. Mesquite v. 2.72. Available at http://mesquiteproject.org Pridgeon, A.M. & M.W. Chase. 2001. A phylogenetic Lindleyana 16(4): 235-271. Pridgeon, A.M., R. Solano, M.W. Chase. 2001. Phylogenetic relationships in Pleurothallidinae (Orchidaceae): combined evidence from nuclear and plastid DNA sequences. Am. J. Bot. 88(12): 2286-2308. Pridgeon, A.M. 2005. Subtribe Pleurothallidinae. In: A.M. Prigeon, P.J. Cribb, M.W. Chase & F.N. Rasmussen (Eds.), Genera Orchidacearum. Volume 4 Epidendroideae (Part One). Pp. 319-422. Pupulin, F., A.P. Karremans & B. Gravendeel. A reconsideration of the empusellous species of Specklinia (Orchidaceae: Pleurothallidinae) in Costa Rica. Phytotaxa 63: 1-20. Rambaut, A. 2009. FigTree v1.3.1. Available at http://tree. bio.ed.ac.uk/software/ Sequences Using the Staden Package and EMBOSS. In: Bioinformatics. A Theoretical and Practical Approach. Human Press Inc., Totawa, NJ 07512. genus Pleurothallis R. Br. (Orchidaceae) in the Greater Antilles. Dissertation Thesis. MathematischNaturwissenschaftlichen Fakultt I der HumboldtSun, Y., D.Z. Skinner, G.H. Liang & H. Hulbert. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theor. Appl. Genet. 89: 26-32.
PAGE 183
Bill and Marie Selby built their retirement home in Sarasota on the bay front in the early 1920s. Bill had amassed a fortune with Texaco Oil Company. Without heirs, they created the charitable William G. and Marie Selby Foundation with Palmer Bank as trustee. I knew Mr. Selby, only in consultation in his terminal illness in 1956. I cared for Mrs. Selbys surgical problems, but I knew nothing about her intention of leaving her home for a botanical garden. Only in June 1972, one year after her death, were conditions of her will announced at a meeting of the board of Palmer Bank. By coincidence, I was in attendance. I had been a director for six or seven years, not because I knew anything about banking, but because of my surgical practice. In her will, Mrs. Selby left her home and grounds with the adjacent vacant lot to the north, to be used as a botanical garden at the discretion of the directors of Palmer Bank. She had purchased the lot to the north, also on the bay, where the home of prevent the construction of a high-rise. Her idea of a botanical garden had been a pretty garden where she could hold garden club meetings and social events. For maintenance, she designated a small endowment, all the rest of her estate reverting to the Selby Foundation. The endowment with the proceeds from the sale of her property would also revert to the Foundation, at the discretion of Palmer Bank. Bill Coleman, the chairman of the board of Palmer Bank, was a friend of ours. We shared an interest in Swamp. I explained to the board the possibility of creating a true botanical garden, but there was no enthusiasm. Zoned for high-rises, her seven-acre property must have been worth a fortune. Privately, I described the potentialities to Coleman, and he was receptive. He was a forceful chairman, so during the summer of 1972, it was decided that there would indeed be a Marie Selby Botanical Gardens. Consultants from the New York Botanical Garden in one small group of plants such as orchids would be feasible. Several alternative, larger sites east and south of Sarasota were investigated, but her home with seven acres of land near downtown Sarasota was a botanical garden. There was considerable opposition to a botanical garden from more than one source. All kinds of questions were raised by the city commission, seemed like one roadblock after another was being thrown in our path. Were we to become an amusement LANKESTERIANA 13(3): 333. 2014. I N V I T E D P A P E R CARLYLE A. LUER 3222 Old Oak Drive, Sarasota, FL, 34239-5019, U.S.A. cluer@juno.com ABSTRACT. In her will, Marie Selby left her home and grounds to be used as a botanical garden at the discretion overcome. Cal Dodson, Professor of Botany at the University of Miami, was a chosen as a director. The Gardens soon acquired more grounds and staff. A volunteer program was begun, and volunteers contributed vastly to our rapid growth. Our many accomplishments include the quarterly Bulletin Selbyana KEY WORDS : William Selby, Marie Selby, Sarasota, botanical garden, Calaway H. Dodson* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary.
PAGE 184
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.334 LANKESTERIANA about your neighbors? How about pollution? Would anything be sold? Could we be taxed? By the end of 1972, a special exemption for a botanical garden was granted reluctantly by the city. We applied for and received tax-exempt status from the IRS to become a charitable institution. Next, a director had to be found. Cal Dodson, Professor of Botany at the University of Miami, at that time on a year sabbatical in Ecuador, was a candidate. In January 1973, Bill Coleman, his wife and their discuss the situation with him. Dodson thought that the proposition seemed too good to be true, that new botanical gardens were not being made any more. He was not aware of the impending Lankester Garden. He reasoned that if the scope of the garden were restricted to one small group of plants, such as epiphytes, it might offer. Abandoning his tenure with the University of Miami and his sabbatical, he and his family arrived in Sarasota the following month. In February 1973, the Dodson family moved into the moldy Selby house that had been closed for over 18 months with a leaking roof before they found a place to live. Mrs. Selbys yard had become a massive last 20 years of her life. Months were spent clearing the invasive plants. Where to place what kinds of greenhouses and where to place the walkways had to be decided. who had worked for Mrs. Selby. In April 1973, Dodson hired Ruby Hollis, who became a masterful secretary and backbone of administrative duties for the next generation. Hans Wiehler and Kiat Tan, doctoral candidates in botany from the University of Miami, were brought to the Gardens as staff members. Soon after our beginning in 1973, one of our most important acquisitions with Selby Foundation funds was the botanical library of William Cole of Winter Park. From him and Weldon and Wesley, rare book dealers in England, we obtained famed treasures such as Batemans Orchidaceae of Mexico and Guatemala as well as his Monograph of Odontoglossum, Lindleys Sertum Orchidaceum, Lindens Pescatoria, Warners Select Orchidaceous Plants, Warner and Williams The Orchid Album, a complete run of Curtis Botanical Magazine, and Woolwards Monograph of Masdevallia. An attractive, substantial gate house, with a front reception desk, restrooms, and plant shop, was built in 1973 and opened to the public with a dedication ceremony in January 1974. The property across the street from the gate house, and the adjacent lot and house to the north, were acquired for parking, and the corner house by highway 41 was acquired for administration, all with grants from The Selby Foundation in 1973. Across the street from the newly acquired administration building was the Payne belonged to Dr. Paulk, an orthodontist and friend of ours. After negotiations, the price agreed upon for the Payne house was paid by the Selby Foundation and a donor, so by the summer of 1973 we had considerably expanded the physical scope of the Gardens. During the summer of 1973, the Gardens hosted of Southern Illinois University. He and his family lived on the grounds. Also that summer, the Gardens bromeliad, a gesneriad, and a Peperomia) and the date 1973 was designed on our kitchen table. Greenhouses were completed in the summer of 1974. In the largest one close to the gate house, we built a meandering trellis-covered walkway beside a massive, rugged, cliff-like wall of lava rock boulders, dripping wet and festooned with lush vegetation. It became the display house. Workers, volunteers, and many visitors came and went. Paid memberships in the Gardens were begun. A volunteer program was started without which we could not have existed. Volunteers contributed vastly to our rapid growth. One of their many accomplishments was the quarterly Bulletin Selbyana journal, was published in January 1975. Our small endowment was dwindling. Our new eliminated the expensive services of an outside from Palmer Bank, under which we had been a dependent and charged a fee. Even after elimination of the above losses of revenue, our income from the
PAGE 185
LUER335LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.endowment was so meager, we could scarcely survive. On at least one occasion, a donor made the payroll. In July 1975, we decided that we would start charging visitors a fee of one dollar. Already open a year and a half, none of us thought that this date would be cited incorrectly, some 30 years later, as the beginning of Selby Gardens. Meanwhile, Dodson initiated a student internship Luther in bromeliads, John Atwood in orchids, and Mike Madison in aeroids joined us. Dr. Raven, director of the Missouri Botanical Garden, came down for the formal dedication of the Gardens, a gala reception held 3 April 1976. The Selby Foundation but that ceased after four. The next acquisition of land, purchased by a donor, was the frame house on Orange Avenue with an existing driveway, next door to the building that presently houses the library. This would give us a second access to the Gardens, but the city said no, because it would be too dangerous near the busy intersection of 41 and Orange. After arguing our case before a hostile city commission, Ken Thompson, the city manager, said, let them try it. Begrudgingly, Kens suggestion was allowed. Of course, it worked, but we agreed that the exit would be limited by a no left turn. Nothing more was ever heard. The next acquisition was the two-story, frame house east of the administration building, purchased mostly from donated funds. It was used as student quarters until it was demolished for more parking. with funds from the Selby Foundation, Eric Young, an English philanthropist, and donors. It became known as the EYMC, the Eric Young Micropropagation Centre, which eventually failed and was abandoned. Volunteers worked tirelessly on exhibits, luaus, plant sales, auctions, and all kinds of social events to raise money. Money was always a problem. We spent money we did not have, but we had tremendous assets, so there was never a possibility of our facing bankruptcy. Had we always waited until we could afford something, we would have been still sitting in Mrs. Selbys house. We were in debt, but by the end Income from sales, special events, and donations was increasing, and the debt was decreasing. The board had been expanded to include bankers who thought a new director was necessary. A retired Air Force General was hired to replace Dodson who was made Director of Research. Camaraderie and enthusiasm vanished. Volunteers were alienated. A promised research building with endowment from the new director general proved how much the greenhouses with extensive collections, such as aeroids and gesneriads, were wasting money. He decided to convert a large, valuable greenhouse into a room for meetings and social events. After the slow years that followed, the growth of the Gardens would inevitably accelerate with the great infrastructure already in place. It could not fail, and it did not fail. The momentum regained in the last 30 years has been phenomenal.
PAGE 186
LANKESTERIANA
PAGE 187
Introduccin. La familia de las orqudeas cuenta con el mayor nmero de especies de todo el reino 1996). Ellas se encuentran en todos los continentes polares. Colombia puede considerarse como una registrado hasta hoy ms de 3000 especies de orqudeas en el territorio colombiano (Asociacin Bogotana de Orquideologa 2013). Oncidium ornithorhynchum Kunth es una especie de orqudea perteneciente al gnero Oncidium griega onkos ornithorhynchum procede de las palabras griegas ornitho, relativo a las aves, y rhynchos de los pramos, ubicadas entre 2850 y 3340 metros sobre el nivel del mar (msnm) y se reconocen por la & Hgsater 2010, Pridgeon et al. 2009). La descripcin taxonmica de Oncidium ornithorhynchum ha variado con el tiempo y los crculos de investigadores involucrados, hasta presentarse confusiones fenotpicas y biogeogrficas como la LANKESTERIANA 13(3): 337. 2014. A R T C U L O I N V I T A D O CONSIDERACIONES SOBRE LA HISTORIA DE LA PRIORIDAD TAXONMICA DE ONCIDIUM ORNITHORHYNCHUM LAURA C. MAZO 1 ALBER TO GMEZ-GUTIRREZ 1,2,5 SONIA R. QUINTANILLA 1, 2, JAIME E. BERNAL 1, 2 & PEDRO OR TIZ-VALDIVIESO, S.J. 2,3 1 2 Bogot D. C., 110231, Colombia3Asociacin Bogotana de Orquideologa, Avenida calle 63 # 68G-14, Bogot D. C., Colombia5Autor para correspondencia: RESUMEN : La historia de la prioridad taxonmica de la orqudea Oncidium ornithorhynchum est an por aclarar si se consideran las diferentes descripciones y publicaciones de esta especie propuestas en los siglos XVIII y XIX por botnicos como Jos Celestino Mutis, John Lindley, Alexander von Humboldt, Aim Bonpland y Carl identidad del ejemplar tipo conservado en Pars, hemos procedido a ordenar las fuentes primarias asociadas con su descripcin y nomenclatura botnica. ABSTRACT. The history of the nomenclatural taxonomic priority of the orchid Oncidium ornithorhynchum is yet nineteenth centuries by botanists such as Jos Celestino Mutis, John Lindley, Alexander von Humboldt, Aim Bonpland and Carl S. Kunth, among others. In order to resolve the inconsistencies in taxonomic reports of this conserved in Paris, we proceeded to review the primary sources associated with its description and botanical nomenclature. PALABRAS CLAVES : Orqudeas, Oncidium ornithorhynchum, O. pyramidale, exsicados, herbario* Este artculo fue preparado en el marco de la celebracin del 40 aniversario del Jardn Botnico Lankester.
PAGE 188
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.338 LANKESTERIANA (2010). Este no es un caso nico en el trabajo combinado del tro cientfico conformado por Humboldt, Bonpland y Kunth (H.B.K.), pues se conocen al menos 2 ejemplos ms de inconsistencias biogeogrficas en las colecciones H.B.K. La primera, en la que la localidad de la coleccin Santa Fe fue interpretada como Santa Fe, Mxico (hoy en da parte del estado de Nuevo Mxico, USA), lo cual no slo le sucedi a Kunth, sino tambin a Linneo (Oscar Vargas, com. pers. 2012), como fue publicado respectivamente para dos especies de la familia Asteraceae, Diplostephium phylicoides (Kunth) Wedd. (Vargas 2011) y Lycoseris mexicana et al. 1997) La primera de estas inconsistencias en la coleccin H.B.K., fue reportada por Vargas (2011) en los siguientes trminos: Diplostephium phylicoides (Kunth) Wedd., Chlor. And. 1: 205. 1856. DISTRIBUTION: COL. SERIES : Phylicoidea. Aster phylicoides Kunth, Nov. Gen. Sp. Pl. 4:93. 1820. TYPE: COLOMBIA [erroneously cited as Mexico], [without date], Humboldt & Bonpland s.n. (P Herb. Bonpland, holotype; P Herb. Bonpland, isotype; F, fragment). The type specimen was supposed to be collected in Mexico, it is known that some of the Humboldt & Bonpland collections were wrongly labeled as collected in Santa Fe, Mexico (now USA), while they [were collected near] Bogot (before: Santa Fe de Bogot), Colombia. coleccin H.B.K., correspondiente a la orqudea Telipogon nervosus Druce, fue reportada por el padre Una de las primeras plantas que envi Mutis a Linneo fue recolectada en las minas de oro de Surat (Santander) que Linneo interpret de manera equivocada y public como Tradescantia nervosa Linn. en 1771. Mutis, en cambio, s se dio cuenta de que se trataba de lo que Linneo llamaba una ginandra (hoy orqudea) y pens en darle el nombre de Mormolycanthus tradescantioides pero nunca la public el gaditano y esto lo conocemos solo por una carta de Mutis al botnico sueco Peter Jonas Bergius (1730-1790) con fecha de enero de 1786 (Archivo epistolar del sabio naturalista Don Jos Celestino Mutis 1968, pp. 277-292). Humboldt y Bonpland encontraron la misma planta, probablemente en los alrededores de Bogot (donde todava es frecuente), y no, como Nova genera, donde se anota que crece sobre los rboles en la regiones templadas del Reino neogranadino, junto a Santa Ana y Mariquita, alt. 400 toesas (lmina LXXV del Nova genera et species plantarum). Esta especie nunca ha sido encontrada de nuevo en esa regin y a alturas tan bajas (600 m sobre el nivel del mar), y de ordinario se ha encontrado entre los matorrales en el suelo. Probablemente hubo alguna fue el publicarla como un nuevo gnero Telipogon angustifolius Kunth solo que, como ya haba sido era necesario conservarlo, y as, en 1917, el botnico nueva combinacin a Telipogon nervosus, nombre que en imprenta). Con base en estos antecedentes, y en las consideraciones particulares expuestas en lo que concierne a la orqudea Oncidium ornithorhynchum, es conveniente ordenar la cronologa de las diferentes descripciones taxonmicas de esta especie para resolver adecuadamente su identidad. Cronologa de la descripcin de Oncidium ornithorhynchum. Esta especie fue colectada y registrada en la Real Expedicin Botnica del Nuevo Reino de Granada que funcion formalmente entre los aos 1783 y 1816. En su descripcin, Mutis no registr su nombre taxonmico en la lmina correspondiente, y sta sera denominada posteriormente por los estudiosos del Real Jardn Botnico de Madrid, como Oncidium pyramidale proviene del trmino latino pyramis, -idis = pirmide, S.J., 2000, p. 51). En medio de los reportes botnicos de la Real Expedicin Botnica del Nuevo Reino de Granada, y considerando que Jos Celestino Mutis lleg a este virreinato espaol en 1760, se puede considerar que
PAGE 189
MAZO et al. Historia taxonmica de Oncidium ornithorhynchum339LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.el reporte no fechado de esta orqudea habra tenido lugar entre 1760 y 1808, ao de su fallecimiento. Esta especie, dibujada por uno de los pintores de la Expedicin Botnica en aquella poca (Fig.1), fue Valdivieso, S.J. (1926-2012) como: agregados ovoides, 2.5-7 cm de alto, cubiertos en la base por 2 o 3 pares de vainas conduplicadas, escamosas, con pice agudo, bi-trifoliadas; tiene hojas elptica-oblongas hasta oblanceoladas, agudas o corto-acuminadas, de 14-20 cm de largo y 3,38 generalmente piramidal, de hasta 70 cm de largo, con manchas pardas, fragantes, con segmentos extendidos; spalo dorsal oblongo-lanceolado, ca. 7.5 mm de ancho, laterales libres, linear-lanceolados, oblicuos ligeramente ms largos que el dorsal, ptalos aovado-oblongos, abruptamente agudos, apiculados, de igual longitud spalo dorsal pero el doble de ancho; labelo ms largo que los otros segmentos, pandurado-trilobado, ssil, con base abrupto-auriculada, bilobado en el pice, 10-12 mm de largo y 9.81.3 mm de ancho a travs de los lbulos laterales; los lbulos laterales suborbiculares, lbulo medio oborado, emarginado o bilobado; disco en la base, con un callo plurituberculado, blanco, columna pequea, fuertemente signoidea en vista lateral ca. 3 mm de alto, con un par de aletas erectas en la pared apical, profundamente bilobuladas, tabla infra estigmtica prominente; rstelo linear, antera FIGURA 1. A Lmina original a color de la orqudea Oncidium pyramidale en la coleccin de la Flora de la Real Expedicin Botnica del Nuevo Reino de Granada. Esta aparece sin descriptor taxonmico. B En el verso de la lmina original y esta descripcin fue atribuida a Charles Schweinfurth (1890-1970). Otras inscripciones reportadas sobre esta lmina (http://www.rjb.csic.es/icones/mutis/paginas/laminadibujo.php?lamina=837).
PAGE 190
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.340 LANKESTERIANA FIGURA 2. Lmina 39 que acompaa la publicacin impresa de la orqudea Oncidium pyramidale en la obra Flora de la Real Expedicin Botnica del Nuevo Reino de Granada. Vol. XI, Orchideaceae, Vol XI. Tomo 5.
PAGE 191
MAZO et al. Historia taxonmica de Oncidium ornithorhynchum341LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.alargada, polinios en nmero de 2 con estpite largo y viscidio pequeo (Figs. 2). Su hbitat y distribucin Valdivieso, S.J. 2000) Por otro lado, a comie von Humboldt (1769-1859) y Aim Bonpland (17731858) viajaron a Amrica y colectaron varias especies de orqudeas, que fueron enviadas al herbario del Museo Nacional de Historia Natural de Pars (Fig. 4). Posteriormente, en el ao 1815, basndose en el ejemplar tipo colectado por Humboldt y Bonpland, Carl Sigismund Kunth (1788-1855) publica la descripcin de Oncidium ornithorhynchum (Fig. 5) en el tomo I de la obra Nova Genera et Species Plantarum (Fig. 6), sin referirse al color de la especie colectada. Esta especie habra sido publicada coloreada en de las ediciones de lujo del Nova Genera et Species Plantarum George Ure Skinner (1804-1867) habra enviado a James Bateman (1811-1897) una orqudea colectada en Guatemala, quien la public errneamente en 1837 como Oncidium ornithorhynchum (Fig. 7) en su obra The Orchidaceae of Mxico and Guatemala & Hgsater 2010) (Fig. 8). En esta publicacin centroamericana solo se hace referencia a Humboldt y Kunth (sic), excluyendo al botnico Aim Bonpland, colector y coautor del Nova Genera et Species Plantarum (2010) que hay copias coloreadas a mano donde prioridad a la referencia sobre el lugar en donde habra sido colectada la planta. Luego, en 1840, John Lindley (1799-1865) publica incorrectamente a esta misma especie como Oncidium ornithorhynchum (Fig. 9) en el Botanical Register (Fig. 10) y la describe, haciendo en primer lugar referencia a la descripcin previa de Humboldt, Bonpland y Kunth y, en segundo lugar, a la descripcin de Bateman. En el ao 1845, Sir William Jardine (1800-1874) y colaboradores describen esta orqudea por primera Oncidium pyramidale en The Annals and Magazine of Natural History (Fig. 11). Este nuevo nombre, cuya prioridad se atribuye a Lindley, obedece a que sera una especie intermedia entre Oncidium excavatum Lindl y Oncidium ornithorhynchum, y hace referencia a una colecta de Theodor Hartweg en la regin de Pasto, en el sur lmina correspondiente. XX, se propondran como sinnimos de esta especie a Oncidium chrysopyramis 12), publicada en el ao 1854 por Berthold Seemann (1825-1871) y Wilhelm Seemann (c1820-1868) en Bonplandia, y a Oncidium maderoi Schltr (Fig. 13), publicada en el ao 1920 por Friedrich Fedde (18731942) en Repertorium Specierum Novarum Regni Vegetabilis. esta especie con el nombre Oncidium pyramidale Lindl. en su obra Orchidaceae-Monandrae, Tribus Oncidiinae-Odontoglosseae pars II (Fig. 14), Ecuador, sin ninguna referencia a Centroamrica, ni a Oncidium ornithorhynchum. Recientemente, en 1996, Mara Dolores Montes El cerro, frontera abierta recorrido ecolgico por el cerro de Usaqun reportan con el nombre que les fue indicado por Oncidium FIGURA 3. Lmina no. 486a que acompaa la publicacin original de Oncidium pyramidale en la obra Flora de la Real Expedicin Botnica del Nuevo Reino de Granada. Vol. XI, Orchideaceae, Vol XI. Tomo 5.
PAGE 192
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.342 LANKESTERIANA FIGURA 4. Foto del ejemplar tipo de Oncidium ornithorhynchum
PAGE 193
MAZO et al. Historia taxonmica de Oncidium ornithorhynchum343LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.ornithorhynchum en el norte de Bogot y la describen (30 5 cm), plantas medianas o pequeas con o muchas veces vistosas. Se encuentra desde Mxico hasta Chile, en todos los climas. Estos autores dan una distribucin claramente equivocada, siguiendo lo reportado por Kunth en cuanto a la localidad del tipo de O. ornithorhynchum como: El Puerto Andaracuas, & Hgsater 2010). Esa localidad corresponde a la donde abundan los encinares secos, muy pobres en Laelia speciosa Kunth (Hgsater et al. 2005). De acuerdo con el reporte del GBIF (Global Biodiversity Information Facility) habra 131 ocurrencias de Oncidium ornithorhynchum en Amrica incluyendo, de norte a sur, los siguientes pases: Estados Unidos (1), Mxico (88), Guatemala (6), Nicaragua (2), El Salvador (3), Panam (1), FIGURA 5. Lmina no. 80 que acompaa la publicacin original de Oncidium ornithorhynchum en la obra Nova Genera et Species Plantarum, basada en el ejemplar colectado por Humboldt y Bonpland en Amrica y conservado en el herbario de Pars. FIGURA 6. Descripcin taxonmica original de Humboldt, Bonpland & Kunth, 1815, pp. 345-346. FIGURA 7. Lmina que acompaa la publicacin original de Oncidium ornithorhynchum en la obra Orchidaceae of Mexico and Guatemala
PAGE 194
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.344 LANKESTERIANAColombia (27) y Ecuador (3) (GBIF, consultado en noviembre 6 de 2013), sin reportarse hasta la fecha en esta base de datos ocurrencias de esta especie en otros revisar el detalle de las plantas centroamericanas incluidas en este reporte, la imagen asociada es una orqudea violeta que, de acuerdo con el reporte de Oncidium sotoanum. orqudea al iniciarse el siglo XXI incluyen las elaiophores in the orchids (Schltr.) Hoehne (Maxillariinae sensu lato) and Oncidium ornithorhynchum H.B.K (Oncidiinae sensu lato) 2010 que hemos venido citando, titulado Oncidium ornithorhynchum, una especie mal interpretada y un nombre para una vieja especie: Oncidium sotoanum el nombre de esta planta mexicana. Por otra parte, nuestro grupo public en 2012 el artculo Extraction conserved for more than half a century in a herbarium FIGURA 8. Descripcin taxonmica original de James Bateman, 1837, pp. 34-35. FIGURA 9. Lmina que acompaa la publicacin original Edwardss Botanical Register.
PAGE 195
MAZO et al. Historia taxonmica de Oncidium ornithorhynchum345LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.in Bogot, Colombia, reportando la presencia de Oncidium ornithorhynchum en Duitama (Boyac) a 2870 metros de altura y tambin en Santandercito (Cundinamarca) a 2000 metros de altura, de acuerdo et al. 2012). FIGURA 10. Descripcin taxonmica original de John Lindley, 1840, pp. 30-31. FIGURA 11. Descripcin taxonmica original de William Jardine et al. 1845, p. 384. FIGURA 12. Descripcin taxonmica original de Berthold Seemann y Wilhelm Seemann. 1854, p. 108
PAGE 196
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.346 LANKESTERIANADiscusin. Al comparar cada una de estas publicaciones se observan varias inconsistencias en el epteto orqudea Oncidium ornithorhynchum (Tabla 1). En hacen referencia en sus publicaciones a la obra de Humboldt (Nova Genera et Species Plantarum), el primero citando como colaboradores a Bonpland y a Kunth, como debe ser, y el segundo solamente a Kunth, excluyendo inexplicablemente a Bonpland. Mencionan que hay dos copias de esta obra coloreadas error podra corresponder, alternativamente, a un error de transcripcin del lugar de coleccin de la planta llevada a Europa por Humboldt y Bonpland. En 1990, Miguel ngel Soto tuvo la oportunidad de ver en el herbario de Pars el ejemplar tipo de Oncidium ornithorhynchum (Fig. 4), y all constat que la especie que se encontraba distribuida en Mxico no corresponda con dicho ejemplar. Posteriormente, en 1997, Adolfo Espejo viaj al herbario de Pars y tuvo la posibilidad de tomarle una foto al ejemplar tipo de O. ornithorhynchum Con la ayuda de esta imagen, al examinar y comparar los ejemplares tipo de Oncidium el herbario de Pars, no concordaba con la especie que las marcadas diferencias fsicas que hay entre los dos que se encuentra en el herbario de Pars, presenta un margen membranoso en las vainas foliosas de la FIGURA 13. Descripcin taxonmica original de Friedrich Fedde, 1920, p. 191. FIGURA 15. Foto de Oncidium ornithorhynchum. Tomada por FIGURA
PAGE 197
MAZO et al. Historia taxonmica de Oncidium ornithorhynchum347LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.por pseudobulbo, erecta, con las ramas de la base alargadas, acortndose gradualmente hacia el pice casi erectos, ligeramente sinuosos, el callo del labelo se compone de dos quillas cortas hacia los lados y otras tres hacia el pice, las alas de la columna son erectas y cuneadas. En contraste, la especie el margen de las vainas foliosas es membranceo pero este es inconspicuo, midiendo 1 mm de ancho; cada pseudobulbo produce simultneamente 2-4 base del raquis cortas, las de la mitad largas y las del y las alas son oblicuamente dolabriformes y paralelas Debido a la confusin en la descripcin de esta artculo de 2010, postularon que debe haber un error en la indicacin de la localidad del Oncidium ornithorhynchum, colectada por Humboldt y Bonpland, como si fuera de Mxico. El ejemplar tipo, que se conserva en Pars, tanto como el dibujo correspondiente, muestran que este espcimen no es lo que a partir de Lindley se ha considerado como Oncidium ornithorhynchum de Mxico y Centroamrica (y no de Suramrica), sino que corresponde a lo que se ha llamado Oncidium pyramidale de Colombia, Ecuador y Per, siendo este O. pyramidale sinnimo de O. ornithorhynchum (Fig. 15). Por otra parte, la Oncidium sotoanum (Fig. 16-17). A pesar que se ha propuesto a Oncidium chrysopyramis Rchb.f. como sinnimo de O. ornothorhynchum Hgsater establecen que al presentar esta especie una FIGURA 16. Oncidium sotoanum Basado en R. Jimnez 626 AMO [ilustracin tomada de Icon. Orchid. (Mexico)1: pl.77]. FIGURA 17. Foto de Oncidium sotoanum Hgsater; M. A. Soto 4900, Chiapas. Tomada por de R.
PAGE 198
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.348 LANKESTERIANA Titulo publicacin Autor Ao Nombre correcto Hbitat Real Expedicin Botnica del Nuevo Reino de Granada Jos Celestino Mutis [Pedro Ortiz Valdivieso] 17601808 [2000] [Onc. pyramidale ] Onc. ornithorhynchum Amarilla Colombia, [Ecuador y Per] Nova Genera et Species Plantarum Alexander von Humboldt, Aim Bonpland y Carl S. Kunth 1815 Onc. ornithorhynchum Onc. sotoanum Amarilla Mxico-Puerto de Andaracuas, entre Guanaxuato y Valladolid de Michoacn Orchidaceae of Mexico and Guatemala James Bateman 1837 Onc. ornithorhynchum Onc. sotoanum Violeta Michoacn, Oaxaca y Guatemala Edwardss Botanical Register John Lindley 1840 Onc. ornithorhynchum Onc. sotoanum Violeta Mxico y Guatemala The Annals and Magazine of Natural History William Jardine et al 1845 Onc. pyramidale Onc. ornithorhynchum Pasto Orchidaceae-Monandrae, Tribus Oncidiinae-Odontoglosseae, pars II Fritz Kranzlin 1922 Onc. pyramidale Onc. ornithorhynchum Colombia y Ecuador El cerro, frontera abierta recorrido ecolgico por el cerro de Usaqun Mara Dolores Montes y Pedro Eguiluz 1996 Onc. ornithorhynchum Onc. ornithorhynchum Desde Mxico hasta Chile TABLA
PAGE 199
MAZO et al. Historia taxonmica de Oncidium ornithorhynchum349LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. TABLA 2. Resumen de las publicaciones mencionadas a lo largo del escrito. Ao Autor 1760-1808 Jos Celestino Mutis, quien colecta en el Nuevo Reino de Granada a partir de 1760 y fallece en 1808, dirige la Real Expedicin Botnica del Nuevo Reino de Granada y describe Oncidium ornithorhynchum denominada posteriormente como Oncidium pyramidale en la Flora de la Real Expedicin Botnica del Nuevo Reino de Granada (Real Expedicin Botnica del Nuevo Reino de Granada, 1783-1816). 1801 Alexander von Humboldt y Aim Bonpland viajan a Sudamrica y colectan la orqudea que bautizan Oncidium ornithorhynchum La depositan en el herbario de Pars. (Jimnez & Hgsater 2010). 1815 Carl S. Kunth, con base en el tipo colectado por Humboldt y Bonpland, publica la especie Oncidium ornithorhynchum en su obra Nova Genera et Species Plantarum (Humboldt, Bonpland & Kunth 1815). 1836 Theodor Hartweg le enva a Loddiges una orqudea con el nombre Oncidium ornithorhynchum colectada en Oaxaca, Mxico, de tal forma que la introdujo al cultivo en Europa; tambin este ao George Skinner le enva una James Bateman. Flores violetas. (Jimnez & Hgsater 2010). 1837 James Bateman publica una orqudea con el nombre Oncidium ornithorhynchum en su obra Orchidaceae of Mxico and Guatemala Flores violetas (Bateman 1837).1840 John Lindley publica esta orqudea en con el nombre de Oncidium ornithorhynchum (Lindley 1840). 1845 William Jardine et al. la publican como Oncidium pyramidale en History (Jardine et al. 1845). 1854 Berthold Seemann y Wilhelm Seemann reportan Oncidium chrysopyramis Rchb. f & Warsz como sinnimo de Oncidium pyramidale en Bonplandia 2: 108 (Seemann & Seemann 1854). 1920 Fedde publica Oncidium maderoi como sinnimo de Oncidium pyramidale en Repertorium Specierum (Fedde 1920). 1922 Fritz Kranzlin publica esta especie como Oncidium pyramidale en la obra (Kranzlin 1922). 1968 Pedro Ortiz Valdivieso, S.J., reporta Oncidium ornithorhynchum en Colombia, y en el ao 1975 la deposita Oncidium pyramidale de la Real Expedicin Botnica y con la planta denominada Oncidium ornithorhynchum de la coleccin de Humboldt y Bonpland depositada en el Herbario de Pars 1990 Miguel ngel Soto viaja a Pars y ve que la Oncidium ornithorhynchum que est en el herbario no concuerda con orqudeas mexicanas de la misma regin (Jimnez & Hgsater 2010). 1996 Mara Dolores Montes y Pedro Eguiluz publican una Oncidium ornithorhynchum en su libro El cerro, desde Mxico hasta Chile (Montes & Eguiluz 1996). 1997 Adolfo Espejo viaja al herbario de Pars y le toma una foto al tipo de Oncidium ornithorhynchum (Jimnez & Hgsater 2010). 2008 Rolando Jimnez, con base en la foto tomada por Adolfo Espejo, compara O. ornithorhynchum de Pars con la especie de Mxico (Jimnez & Hgsater 2010). 2010 Rolando Jimnez y Eric Hgsater, publican que el tipo de Oncidium ornithorhynchum conservado en Pars coincide con la Oncidium pyramidale que se distribuye en Colombia, Ecuador y Per de tal forma que el nombre Oncidium pyramidale queda como sinnimo del primero. En cuanto a la Oncidium ornithorhynchum que se distribuye en Mxico, fue renombrada con el nombre de Oncidium sotoanum (Jimnez & Hgsater 2010). 2011 Laura Mazo et al. establecen la secuencia de los genes matK de tres (3) especmenes de Oncidium ornithorhynchum colectados en Colombia (Madrid-Cundinamarca y Duitama-Boyac) de los cuales el primero corresponda a una planta fresca y los dos restantes se encontraron conservados en el Herbario respectivamente (Mazo et al. 2012).
PAGE 200
Oncidium pyramidale En conclusin, tanto John Lindley como James violetas, hbitat en Mxico y con el nombre errneo de Oncidium ornithorhynchum, diferencindose un poco de Kunth quien la public con este mismo nombre y hbitat, aunque, a diferencia de los dos botnicos anteriores, la describi de manera explcita como una Oncidium pyramidale, Mutis) y como hbitat: Colombia, Per y Ecuador. Es importante recalcar que estos ltimos 3 botnicos Lo anterior se explica gracias a la aclaracin que las descripciones de John Lindley y James Bateman corresponden ciertamente con la orqudea presente en Mxico pero se equivocaron al nombrarla (siguiendo a Kunth) como Oncidium ornithorhynchum la planta centroamericana, distribuida en el sur de Mxico y Centroamrica, como una nueva especie llamada Oncidium sotoanum una nueva subespecie O. sotoanum ssp. papalosmum Oaxaca y Chiapas, Mxico. En el presente artculo nosotros postulamos que:1. La orqudea descrita en Bogot antes de 1808 por Jos Celestino Mutis, y luego en el curso del siglo Ecuador, y denominada Oncidium pyramidale, es la que correspondera al mismo ejemplar publicado por Kunth con el nombre de Oncidium ornithorhynchum, en consonancia con que el Oncidium pyramidale haya pasado a ser sinnimo del primero.2. El ejemplar tipo de Oncidium ornithorhynchum que se encuentra hoy en el Herbario Histrico del Muse National dHistoire Naturelle de Paris, y que tuvimos la ocasin de volver a examinar en mejor a una orqudea colectada en el territorio que se llamaba en aquella poca Virreinato de la Nueva Granada, y que comprende hoy territorios de Colombia y Ecuador.3. El registro manuscrito de esta orqudea en el Diario botnico o Journal botanique de Aim Bonpland, tipo conservado en Pars, puesto que en general cada uno de los registros de este libro de campo fueron inscritos en orden consecutivo y cronolgico, y podemos deducir, con base en las consideraciones del presente artculo, que el registro de esta especie del actual Ecuador con fechas entre septiembre de 1801 y mayo de 1802.4. Finalmente, nos proponemos intentar la comparacin molecular del exsicado tipo conservado en Pars con ADN extrado de ejemplares de Oncidium ornithorhynchum colectados en Colombia o Ecuador. AGRADECIMIENTOS. Los autores agradecen al personal Instituto de Gentica Humana (Facultad de Medicina, colegas del grupo de investigacin en ADN antiguo, as como a las doctoras Marpha Telepova, Ccile Aupic y Myriam Gaudeul, del Muse National dHistoire Naturelle de Paris, y a la musegrafa Claudia Navas-Courbon, en la misma ciudad. Dedicamos este artculo a la memoria del LITERATURA CITADA Asociacin Bogotana de Orquideologa. http://www. orquideasbogotaabo.com/index.php?option=com_ content&view=article&id=72&Itemid=30. Consultado: 17-01-2013. Bateman, J. 1837-1843. Oncidium ornithorhynchum. Pp 34-35 in: The Orchidaceae of Mexico and Guatemala. London, Ridgway. picta (Schltr.) Hoehne (Maxillariinae sensu lato) and LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.350 LANKESTERIANA
PAGE 201
MAZO et al. Historia taxonmica de Oncidium ornithorhynchum351LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Oncidium ornithorhynchum H.B.K. (Oncidiinae sensu lato). Ann. Bot. 104: 221-234. las tribus Barnadesiae y Mutisieae (Asteraceae) para la Flora de Colombia. In: Monografas del Jardn Botnico Jos Celestino Mutis, Vol. 1. Bogot: Jardn Botnico Jos Celestino Mutis. Fedde, F. 1920. Oncidium maderoi Schltr. In: Repertorium specierum novarum regni vegetabilis. Dahlem bei Berlin: Verlag des repertoriums, Fabeckstr. 191 p. Global Biodiversity Information Facility (GBIF) http:// data.gbif.org/occurrences/searchCountries.htm?c[0]. s=20&c[0].p=0&c[0].o=5322086 (consultado en: noviembre 6 de 2013) 2005. Las Orqudeas de Mxico. Instituto Chinon, Mxico, 304 p. Jos Celestino Mutis. Instituto Colombiano de Cultura Hispanica. Editorial Kelly. Bogot, D.C. Vol 3, Tomo 1, pp. 277-292. Humboldt, A., A. Bonpland & C. S. Kunth. 1815. Oncidium ornithorhynchum. In: Nova Genera et Species Plantarum. Pars: Schoell. 1: 345-346. Jardine, W., P. J. Selby, G. Johnson, C. Babington, J.H. Balfour & R. Taylor. 1845. Oncidium pyramidale. In: Zoology, Botany and Geology, Londres: R. and J. E. Taylor. 15: 384. Oncidium ornithorhynchum, una especie mal interpretada y un nombre para una vieja especie: Oncidium sotoanum (Orchidaceae). Lankesteriana 9(3): 411422. Oncidium pyramidale Lindl. Pp. 195196 in: Orchidaceae-Monandrae: Tribus OncidiinaeOdontoglosseae pars II. Lindley, J. 1840. Oncidium ornithorhynchum. Pp. 30-31 in: Edwards Botanical Register, Vol. III. Londres: James Ridgway and Sonos, Piccadilly. DNA from orchid exsiccates conserved for more than half a century in a herbarium in Bogot, Colombia. Lankesteriana 12(2): 121-129. Recorrido ecolgico por el cerro de Usaqun. Bogot: Santillana. 110 p. Oncidium pyramidale Lindl. In: Flora de la Real Expedicin Botnica del Nuevo Reino de Granada (1783 1816). Vol. XI, Orchideaceae, Vol XI. Tomo 5. Madrid, Espaa. Ediciones de Cultura Hispnica. 51 p. orqudeas de Colombia en la obra de Humboldt, Bonpland y Kunth. In: Los hermanos Alexander y Wilhelm von Humboldt en Colombia. Huellas continentes. Pridgeon, A. M., P. J. Cribb & M. W. Chase. 2009. Genera Orchidacearum, Vol. 5. Oxford University Press, Oxford New York. Expedicin Botnica del Nuevo Reino de Granada (1783-1816), dirigida por Jos Celestino Mutis: www. rjb.csic.es/icones/mutis. Real Jardn BotnicoCSIC. Consultado: 14-03-2013 Seemann, B. & W. Seemann. 1854. Oncidium chrypsopyramis. In: Bonplandia. Vol II. Londres: Williams y Norgate. Pars: Fr. Klincksieck. 158 p. Vargas, O.M. 2011. A nomenclator of Diplostephium (Asteraceae: Astereae): a list of species with their synonyms and distributions by country. Lundellia 14: 32.
PAGE 202
LANKESTERIANA
PAGE 203
Vanilla Plumier ex Miller, a pan-tropical genus within the Orchidaceae, contains over 100 species, with several species, principally Vanilla planifolia Andr., being of economic importance in the food and cosmetics industries. These commercially-valuable species form part of the so-called fragrant clade: Vanilla subgenus Xanata Soto Arenas & Cribb, comprising species producing fragrant fruits, and which are naturally distributed exclusively within the neo-tropics (Soto-Arenas & Cribb 2010). While V. planifolia is the predominant commercial species, other fragrant Vanilla species are of interest for their potential in vanilla breeding programmes. However, the diversity and biology of this clade has been poorly studied. In a recent generic review, the existence of undescribed neotropical species became evident (Soto-Arenas & Dressler 2010), with a new species, Vanilla espondae Soto Arenas, described from the Magdalena river valley of Colombia (Soto-Arenas 2010). Vanilla is a taxonomically-challenging genus, with our understanding of the diversity and biology of these species hindered by plants being rare and hyperdispersed in their native forest habitat. Furthermore, herbaria material is sterile. In Colombia, 11 Vanilla species have been reported to date (Table 1). The genus Vanilla reaches its greatest diversity in South America, and, given the rare distributions of these plants, the inadequate nature LANKESTERIANA 13(3): 353. 2014. I N V I T E D P A P E R VANILLA RIVASII (ORCHIDACEAE), A NEW SPECIES FROM THE FRANCISCO MOLINEROS-HUR TADO 1, 2 ROBER T TULIO GONZLEZ MINA 1, 2, NICOLA S. FLANAGAN 1, 3 & J. TUP AC OTERO 1,4,5 1Grupo de Investigacin en Orqudeas, y Ecologa y Sistemtica Vegetal 2 Buenaventura, Colombia34Departamento de Ciencias Biolgicas, Universidad Nacional de Colombia, Sede Palmira, Palmira, Colombia5Instituto de Estudios Ambientales IDEA, Palmira. Universidad Nacional de Colombia, Sede Palmira, Palmira, Colombia ABSTRACT. We describe a new species of fragrant Vanilla from the Choc biogeographic region of Western Colombia, named Vanilla rivasii sp. nov. in honor of the local farmer who drew it to our attention. This species is related to the Vanilla hostmannii group, also containing V. dressleri, V. ruiziana and V. cribbiana, in the lip apex. Vanilla rivasii with a conspicuously bi-lobulated central lobe; and basally fused lateral sepals. Vanilla rivasii can be distinguished from the most morphologically-similar species, V. cribbiana and V. hostmannii, by the economically-important genus, and underlines the need for further botanical exploration in the highly biodiverse region of the Choc. KEY WORDS : Orchidaceae, Vanilla fragrant clade, V. rivasii, Buenaventura, Choc, Colombia* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary.
PAGE 204
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.354 LANKESTERIANAof most herbarium specimens and the poor botanical records of lowland areas, it is likely more species will be reported for the country, both described and undescribed. Here we describe a new Vanilla species native to of Colombia. This region has the highest documented plant diversity (Faber-Langendoen & Gentry 1991), and is still relatively under-explored botanically. The region retains more than 50% of its original vegetation cover, and continued taxonomic description of the diversity of the region is essential in order to establish conservation priorities. Vanilla rivasii J.T.Otero, sp. nov. TYPE: Colombia, Valle del Cauca, Buenaventura, Sendero El Paraso, cultivated by A. Rivas, R. T. Gonzalez 1118 (holotype, CUVC). FIGURES 1. Hemi-epiphytic herb. Stems dark green, 6.8-8.0 mm thick, terete, smooth, the internodes 8.0-9.3 cm long. Young aerial roots greenish to greyish, subterete Leaf shortly petiolate, the petiole ca. 10 mm long, blade oblanceolate, acuminate, the apex incurved, base subobtuse, the basal margin revolute, subcoriaceous, pale green with a central concavity, 16.5-24.6 4.0-5.5 cm. green rachis of 12-40 cm in length and 0.7 cm in thickness with white dots in the epidermis, a shortly pedunculate raceme, the rachis congested, with Bracts pale green, basal ones alternate distichal. Distal bracts ovate and concave, 3-4 5 mm. Ovary subterete to sub-trigonous, curved, pale green with white base and white dots in the epidemis, 45-55 mm length and 4.5 mm in diameter, white in the base and pale green in the rest. Flowers ephemeral with 2-4 open simultaneously, conspicuous with buds pale yellow at base, apex green, 10-12 cm diameter when yellowish green outer, whitish yellow inside, basal surface of the lip yellow, mid lobe and throat yellow lined dark yellow-ochre; the segments spreading, strong rose fragrance. Dorsal sepal yellowish green, deeply recurved, long-lanceolate, narrow at the base, apex sub-acute and sub-calyptrate, with 13 veins, o f equal length to lateral sepals, 68 8-10 mm. Lateral sepals directed downwards, long-lanceolate, subacute, base long attenuate, lateral sepals fused in the proximal third of the length; with 13-14 veins, very smooth, 67 8-11 mm. Petals pale yellow to cream, slightly recurved at the apex, narrowly elliptic-oblanceolate, obtuse, concave, narrower than the sepals, longitudinally keeled on the abaxial surface, the keel broad and conspicuous, 7-8 veins, 68 9 mm. Lip showy, 66 35 mm forming a long TABLE 1. List of Vanilla species reported for Colombia (Soto Arenas & Cribb 2010). Species Reference Year Vanilla calyculata Schltr Repert. Spec. Nov. Regni Veg. Beih. 7: 42 1920 Vanilla columbiana Rolfe J. Linn. Soc., Bot. 32: 468 1896 Vanilla dressleri Soto-Arenas Lankesteriana 9(3): 303, f. 5 2010 Vanilla espondae Soto-Arenas Lankesteriana 9(3): 281, f. 1 2010 Vanilla hostmannii Rolfe J. Linn. Soc., Bot. 32: 462 1896 Vanilla odorata C. Presl Reliq. Haenk. 1(2): 101 1827 Vanilla palmarum (Salzm. ex Lindl.) Lindl. Gen. Sp. Orchid. Pl. 436 1840 Vanilla pompona Schiede Linnaea 4: 573 1829 Vanilla ribeiroi Hoehne Comm. Lin. Telegr., Bot. 1: 28 1910 Vanilla sprucei Rolfe J. Linn. Soc., Bot. 32: 461 1896 Vanilla trigonocarpa Hoehne Arq. Bot. Estado So Paulo 1(6): 126, t. 139 1944
PAGE 205
MOLINEROS-HUR TADO et al. Vanilla rivasii sp. nov. from Colombia 355LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 1. Vanilla rivasii Drawing by Nhora Helena Ospina Caldern.A B C D E
PAGE 206
tube, marginally fused to the column at least 40-42 mm, with 30 veins; when spread out trilobed with the midlobe oblong, bilobulated, the lateral lobes above the column, oblong-triangular to sub-square, tapering at apex, with thickened axial cushion near the lip apex ca. 6 23 mm with 7-8 thickened keels with papilose texture extended to the lateral lobes. slightly verrucose at the base with brownish papillae, the apex somewhat narrowed and forming a cushion, the penicillate callus 4.5 6.0 mm covered by 4 yellow showy lacerate structures of scales thickened in the distal portion, separated 44 mm from the lip base. Column subterete, elongated 45.0-49.0 2.6 mm, yellow whitish, with brownish tricomes in the distal ventral part; membranous wings 5.3 mm; bilobed stigma with rectangular emergent lobes, 1.2 1.1 mm. Anther versatile, ovate, 3 2.6 mm. Fruits elongated, pale green, subtriangular with white dots in the epidermis. 130-180 11 mm, dehiscent when mature into two valves, with a strong vanilla aroma detectable over more than 200 m. PARATYPE : Colombia, Valle del Cauca, Buenaventura, Baha Mlaga. N. H. Ospina 466 (CUVC). OTHER RECORD s: Colombia, Buenaventura, F. G. Lehmann H.K.1185 (K, fruit!). DIST R IBUTION : Known region in the Valle del Cauca, and Choc Departments, Colombia. The species has been observed occurring naturally in the wild in small isolated populations, mainly in regenerating secondary growth forest. Known populations comprise between one and twelve apparently separate plants. The largest population of twelve plants occurs over an area of 25 Ha. Localities have apart. The association with secondary forest may be a consequence of sampling bias, as most exploration has been conducted close to populated regions. It is likely that, with further exploration of the Colombia along the coast, more populations will be found. The known localities will not be mentioned explicitly so as to protect the small populations of this species from the threat of collection from the wild. PHENOLOGY : No clear seasonality has been observed. of January, corresponding with a dryer climatic period until April, June, July and September, resulting EPONYMY : This species is dedicated to Luis lvaro Rivas, a local farmer committed to sustainable agricultural practices and biodiversity preservation. The type specimen consists of the collection R. T. Gonzalez 1118 from Buenaventura, and N. H. Ospina 466 from Bahia Malaga, with pictures taken by F. Molineros-Hurtado. Vanilla rivasii Flanagan & Otero belongs within Vanilla subgenus Xanata. Vanilla rivasii V. hostmannii group, possessing the thickened veins in the lip apex and the distichous arrangement of the basal bracts of Vanilla rivasii may be distinguished from the other Vanilla species in the group by the frequent terminal position than those of related species such as V. cribbiana Soto-Arenas, V. ruiziana V. dressleri Soto-Arenas. Flowers are larger, with deeply recurved sepals. The lateral sepals are fused in the basal third. The mid-lobe of the labellum is LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.356 LANKESTERIANA FIGURE 2. Vanilla rivasii in situ. Photo by F. Molineros-Hurtado.
PAGE 207
MOLINEROS-HUR TADO et al. Vanilla rivasii sp. nov. from Colombia 357LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.conspicuously bilobulated with a thickened axial cushion near the apex bearing 7-8 thickened veins with papilose texture extending into the lateral lobes. Vanilla rivasii is morphologically most similar to V. cribbiana but differs from this species in the fused lateral sepals in the basal third, the bi-lobed shape of the central lobe of the labellum and the greater number of thickened veins. Vanilla rivasii differs from the sympatric species V. dressleri in the tri-lobed labellum and non-granulose sepals. Additionally, the V. rivasii has much less conspicuous orange longitudinal stripes on the labellum than those of V. dressleri. Vanilla rivasii is more heliophytic than V. dressleri, with subcoriaceous, deep green, smooth leaves. It differs from V. ruiziana from Peru and Bolivia which has an ovate mid lobe of the lip, and 1-3 thickened veins on the lip apex. Vanilla rivasii plants have been documented with terminal recorded for V. hostmannii of 60, and for V. cribbiana, and V. dressleri Mature fruits are dehiscent. ACKNOWLEDGMENTS We thank Nhora Helena Ospina Calderon for the line drawings; lvaro Rivas for kindly sharing his knowledge and experience regarding vanillas; and the Semillero de Investigacion en Recursos Nacional de Colombia, sede Palmira, (DIPAL), and the Vicerectora de Investigacin of Universidad Nacional de Colombia. LITERATURE CITED Faber-Langendoen, D., & A.H. Gentry. 1991. The structure and diversity of rain forests at Bajo Calima, Choco Region, Western Colombia. Biotropica 23(1): 2-11. Soto-Arenas, M.A. & R.L. Dressler. 2010. A revision of the Mexican and Central American species of Vanilla region of the nuclear ribosomal DNA. Lankesteriana 9(3): 285-354. Soto-Arenas, M.A. 2010. A new species of Vanilla from South America. Lankesteriana 9(3): 281-284. Soto-Arenas, M.A. & P. Cribb. 2010. A new infrageneric Vanilla Plum. ex Mill. (Orchidaceae: Vanillinae). Lankesteriana 9(3):355-398.
PAGE 208
LANKESTERIANA
PAGE 209
Twenty three years ago today, the good ship Atrato (now alas asleep in the depths off the N. Irish coast) left Southampton with myself on board en route for Costa Rica, and here I am still ... Charles Lankester, letter to Oakes Ames, December 1923 Three famous names form the most illustrious trio of collectors in Costa Ricas history of orchidology: Auguste R. Endrs (1838-1874), Alberto Manuel Brenes (1870-1948) and Charles Herbert Lankester (1879-1969). Undoubtedly the most important of the three was Auguste R. Endrs, who prepared the family. His orchid collections, with over 3,500 numbers, form an important part of the Reichenbach orchid herbarium at the Vienna Natural History Alberto Manuel Brenes, born in San Ramn when Endrs was living in this small city of the northwestern LANKESTERIANA 13(3): 359. 2013. I N V I T E D P A P E R CARLOS OSSENBACH Orquideario 25 de mayo ABSTRACT. Charles Herbert Lankester (1879-1 American orchidology during his time. Better known as Don Carlos, Lankester was born in Southampton, England, on June 14 1879. It was in London that he read an announcement offering a position to work as an assistant to the recently founded Sarapiqu Coffee Estates Company in Costa Rica, he applied and was hired. However, living in Cach, at that time one of the regions with the greatest botanical diversity, he must have fallen under the spell of the plant world as he soon began collecting orchids in the nearby woods. Many of the plants he collected at this time proved to be new species. With no literature at his hand to determine the plants he collected, Lankester started corresponding with the assistant director of the Royal Botanic Gardens at Kew, Arthur Hill in 1910, and somewhat later with Robert Allen Rolfe, Kews most eminent authority on orchids. At the same time, Lankester began his collection of living plants that would become so famous years later. He 1920 to 1922, hired by the British Government to do research on coffee plantations in Uganda. When returning to England, he found that Rolfe had died the year before. Many orchids that he had brought to Kew were left would discover more than 100 new species among the specimens he received from Costa Rica. In 1922, Ames began a series of publications on orchids, which he named Schedulae Orchidianae. In its third fascicle, in January 1923, Ames started to describe many of the Lankester orchids, which were deposited at Kew and had and Ames seem to drift slowly apart. Ames was taken in more by administrative work at Harvard, and Lankester traveled abroad more frequently. In 1955, after his wifes death and already 76 years old, Lankester decided to sell his farm but retained the small part which contained his garden, a piece of land called El Silvestre. Lankester moved to a house he had bought in Moravia, one of the suburbs of the capital, San Jos. On a section of this farm called El Silvestre, Lankester began his wonderful collections of orchids and plants of other families, which formed the basis of the Charles H. Lankester Botanical Garden of the University of Costa Rica KEY WORDS : Charles H. Lankester, Costa Rica, botany, history* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary.
PAGE 210
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.360 LANKESTERIANACentral Valley, did little botanical work but made extraordinary collections of orchids in the surrounding described by Rudolf Schlechter in his Additamenta ad Orchideologiam Costaricensem (1923) in a chapter entitled Orchidaceae Brenesianae. But it would be Charles Herbert Lankester (1879-1969) (Fig. 1), without doubt the dominant time, who should rightly bear the soubriquet of lynxeyed investigator, given by Reichenbach some 50 years earlier to Auguste R. Endrs. The early years (1900-1908). Better known as Don Carlos, Lankester was born in Southampton, England, on June 14 1879, the son of Charles Lankester and Helen West. He lost both parents when only three years old and was raised, together with his sister, by two aunts. in color photography at the Polytechnic Institute. It was in London that he read an announcement in the Daily Telegraph, offering a position in Costa Rica to a young Englishman willing to work as an assistant to the recently founded Sarapiqu Coffee Estates Company. Lankester applied and was hired, landing a few months later in Puerto Limn, then going on by train to the capital of Costa Rica, where he arrived just in time to take part in the Ball of the New Century, given by the president of Costa Rica, Rafael Yglesias, in the National Theater, San Jos. Sarapiqu, in the Atlantic region, proved too humid for the commercial production of coffee and the plantations had to be abandoned three years after Don Carlos arrival. It was here, surrounded by the most exuberant tropical vegetation, that his interests in plants, insects and birds began. As Dr. Louis Williams wrote in his obituary, Don Carlos Lankester arrived at the right place at the right time to join into the active biological exploration of Costa Rica, perhaps the most exciting place biologically on our continent. in his family; his fathers cousin, Sir Edwin Ray Lankester (1847-1929) (Fig. 2), had been the third FIGURE 1. Charles H. Lankester (1879-1969), photographed ca. 1925. FIGURE 2. Ray Lankester by Leslie Ward, Vanity Fair, 1905.
PAGE 211
OSSENBACH Charles H. Lankester, his life and legacy 361LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Director of the Natural History Museum in London. The arrival of Lankester in Costa Rica marked the end of a period the last two decades of the nineteenth development of a national science in Central America. In Costa Rica, as part of an educational reform aimed president Bernardo Soto (1885-1889) hired a group of European academics to staff the two new public high schools in the capital, San Jos;The Liceo de Costa Rica for boys and the Colegio Superior de Seoritas for girls, both founded under Sotos administration. The arrival of these academics marks the beginning of a small ( =Physical-Geographical Institute) and the National Museum, founded in 1889 and 1887, respectively. Among the teachers hired were Pablo Biolley (1861-1908) and Henri Francois Pittier (1857-1950) (Fig. 3), who arrived in 1886 and 1887. Pittier lived in Costa Rica until 1905 and spent some of this time conducting a systematic exploration of the Costa of tropical America at that time. According to Paul C. Standley, in his introduction to the Flora of Costa Rica: Henri Pittier [] undoubtedly gained a more intimate knowledge of the natural history and especially the botany of Central America and northwestern South America than has ever been possessed by any single person (Standley, 1937:49). The combined labors of Pittier and Biolley, and, Carl Werckl, and Brenes as well as the Brade brothers (Alfredo and Alexander Curt) resulted in the formation of the National Herbarium, which initially comprised more than 5,000 species. Again citing Standley, in 1903 the National Herbarium was unequaled below the Ro Grande del Norte (Standley, 1937:50). Lankester and Pittier began a lifelong friendship when the latter visited Sarapiqu. The other players would also be important to Lankester, as they often accompanied him on his collecting excursions and were frequent visitors to his farm in Cartago. When his contract expired, Lankester went back to England. He returned to Costa Rica a few months later, summoned by Pittier to take over the experimental station, which the United Fruit Company planned to establish in Zent, near the Caribbean port of Limn. This project, however, never came to fruition. Lankester was thus forced to work with different companies until 1908, when he left for England to marry Dorothea Mary Hawker. First botanical activities (1910-1922). In 1910, he returned to Costa Rica with his wife (Fig. 4), taking over the administration of a coffee farm in Cach, on the eastern limits of Costa Ricas Central Valley, where he lived for the next nine year. As Amelia and Philip Calvert would write a few years later: Mr. Lankesters house was beautifully situated half a mile from the above it. It was not a typical Costa Rica residence, for although built of adobe it was two-storied and had no patio. A wide veranda or corridor ran across the FIGURE 3. Henri Francois Pittier (1857-1950). Portrait by
PAGE 212
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.362 LANKESTERIANA places, for they were set with plants and hung with when we were there (Calvert & Calvert, 1917: 160) (Figs. 5). one of the regions with the greatest botanical diversity, he must have fallen under the spell of the plant world as he soon began collecting orchids in the nearby woods. Many of the plants he collected at this time proved to be new species. With no literature at his hand to determine the plants he collected, Lankester started corresponding with the assistant director of the Royal Botanic Gardens at Kew, Arthur Hill in 1910, and somewhat later with Robert Allen Rolfe, Kews most eminent authority on orchids. is in a letter to Hill of December 1910, where he wrote: interest, which I will send when it gets warmer on your side. Stelis barbata Rolfe (Fig. 7), a plant collected November 1912 and described by Rolfe in the Bulletin of Miscellaneous Information of Kew in 1913, was Rica. Others would follow: Dichaea ciliolata Rolfe, Pleurothallis dentipetala Rolfe and Pleurothallis costaricensis Rolfe. At the same time, Lankester began his collection of living plants that would become so famous years later. Lankester returned to England in 1920 to enroll his schools. Another daughter, his youngest, was born in England that same year. Lankester traveled to Africa FIGURE 4. Dorothea Mary Hawker, Lankesters wife. FIGURE 5. Orchids in Lankesters house in Cach, photographed by himself. FIGURE 6. Orchids in Lankesters house in Cach, photographed by himself.
PAGE 213
OSSENBACH Charles H. Lankester, his life and legacy 363LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.from 1920 to 1922, hired by the British Government to do research on coffee plantations in Uganda. When Lankester returned to England, he found that Rolfe had died the year before, just as he was preparing to to tropical America. Many orchids that Lankester had The relation with Oakes Ames. Lankester was back in Costa Rica in 1922, the year that was a turning point correspondence with Oakes Ames (1874-1950) -the start of a deep and long-lasting friendship. To understand what was happening in the world of orchidology, it must be remembered that up to the 1920s, the study and knowledge of orchids was strictly an European business. Orchidology in the nineteenth century had been dominated by an Englishman, the great John Lindley (1790-1865), followed by a German, called) (1824-1889). After Reichenbachs death in 1889, Robert Allen Rolfe (1855-1921) became the worlds foremost orchidologist, soon challenged and replaced by the German Rudolf Schlechter (1872-1925). It was not until Rolfes death in 1921, followed by Schlechters who took a dominant position in the orchid world that was never challenged until his death. After returning from a trip to Europe, Ames wrote At Kew I saw many specimens collected by you in Costa Rica, the greater part unnamed. As it will take some time for Kew to recover from the loss of Rolfe and as the Germans are making great efforts to assemble Costa Rican material through Werckl, Jimenez and Tonduz, it seemed to me that you might be willing to co-operate with me by stimulating orchidological interest among your neighbors. And continued: It would surely be worthwhile if you can see your way clear to send me herbarium specimens and to send collectors into the orchid regions of Costa Rica. I have already Pleurothallis. I refer to P. palliolata (Lankester 192). FIGURE 7. Stelis barbata
PAGE 214
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.364 LANKESTERIANAThe specimen was sent for determination by Hort. Kew (Fig.9). Lankester by saying: We must work fast if we hope to keep abreast of the Germans. I was surprised to see how far reaching their efforts have been to secure a monopoly of tropical American species. We must keep in mind that, at that time, Rudolf Schlechter, the famous German orchidologist, was describing hundreds of new Central American orchid species, based on the collections by Powell in Panama Rica. Ames letter to Lankester was followed by one from Charles W. Powell, who had been collecting for years in Panama and who had met Don Carlos some years earlier. In a letter dated September 25 1922, Powell wrote to Ames: This will introduce to you (by letter) my good friend Mr. C.H. Lankester, of Las Cncavas, Cartago, Costa Rica. Mr. Lankester wishes to take up with you the subject of Costa Rican Orchids, with which he is well familiar. He has a undetermined, which he would like you to have you procure and determine for him. Also he wishes to send to you anything new which he may discover for determination. In his answer to the letter from Powell, Ames showed his delight in learning that he could count on Lankesters help: Now that I know from your letter that he has contemplated sending his things to me, this day begins with plenty of sunshine even though heavy clouds obscure the sky (Letter from Ames to Powell, October 6 1922). Ames was undoubtedly playing a double game: while he could not sever his relations with Schlechter (the German had too much information that Ames needed desperately), he tried to block Schlechters access to Powells and Lankesters materials. and went on to become the experts favorite collector. more than 100 new species among the specimens he received from Costa Rica. In his letter to Ames of October 11, 1922, Lankester wrote: I fear stimulation of orchidological interest is exceedingly improbable or likely to be successful in Costa Rica. I think I alone have the necessary madness. Orchids had become the center of Lankesters world, and would remain so until his very last day. In 1922, Ames began a series of publications on orchids, which he named Schedulae Orchidianae. In its third fascicle, in January 1923, Ames started to describe many of the Lankester orchids, which were deposited at appendix). Ames described more and more new orchids from Costa Rica and kept asking Lankester to send more and more specimens. Your specimens have arrived... They made my day cheerful to the end. I wished they were more. But if you had sent ten times as many, I would still say that (August, 1923). One of the specimens that Lankester sent to Ames was the reason for a famous anecdote: Your number FIGURE 8. Oakes Ames (1874-1950), American orchidologist and founder of the worlds largest orchid herbarium. FIGURE 9. Pleurothallis palliolata Ames, collected by Lankester near his house in Cach. Photograph by E. Hunt.
PAGE 215
OSSENBACH Charles H. Lankester, his life and legacy 365LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.387 is not an orchid, it is a Bromeliad wrote Ames in 1923. Lankester replied: Look again. An unusual new orchid genus had been discovered. Ames admitted his error and a week later wrote to Lankester: There seems to be a new genus among your specimens, Lankesterella would be a good name (Fig. 10). After World War I, prices for tropical commodities such as coffee and bananas rose quickly. The restrictions imposed on the import of such goods into Europe and the United States by four years of naval warfare were now replaced by an increasing demand. Owners of coffee plantations in Costa Rica had one of their most prosperous periods during the 1920s, and coffee production and exports increased constantly. Lankester was not the only one to take advantage of the situation. In 1924, he moved to Las Cncavas, a coffee farm that he had acquired in the vicinity of Cartago. Coffee had been the reason for his initial emigration from England to Costa Rica, and his livelihood would depend on coffee for the rest of his life. His orchid collection was already enormous. In August 1924, he wrote to Ames: we hope to move this means among other things the translation of about 1,800 orchids over unimaginable roads. It is therefore easy to understand why Lankesters farm would become, over the years, a Mecca for botanists and orchidologists from all over the world. With its beautiful collections of plants, Las Cncavas could not go unnoticed by the worlds naturalists. The gardens had important collections of cacti, palms and bromeliads although orchids were always Lankesters favorites. Among the visitors to Las Cncavas were famous names such as Arthur Hill, director of Kew Gardens, Thomas Barbour of Harvard, Harvey Stork, William Maxon, Wilson Popenoe, Philip Calvert, James Rehn and Louis Otho Williams. By December 1924, after only two years of corresponding with Lankester, Ames had already described 66 new species among his collections. A self-made man with no formal botanical training, Lankester had developed a sharp eye for novelties. The year of 1925 shows us Charles Lankester, who had just reached the age of 45, at what appears to be the peak of his success as a planter and as an orchidologist. He saw his children again during a FIGURE 10. Lankesterella costaricensis Ames, the type species of the genus that Ames dedicated to his favorite collector. Photograph by F. Pupulin.
PAGE 216
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.366 LANKESTERIANAshort trip to England (Fig. 11), his new coffee farm was in full production, and in July of that year he was elected an honorary member of the American Orchid Society (Fig. 12). What was, however, the real condition of Lankesters business? There seem to have been problems which went largely untold. By 1924, he had already tried to convince Ames to invest in his coffee farm -a proposal that Ames had politely declined. Then, in November 1925, he seemed to have decided to sell everything and to leave Costa Rica: It is just possible I may complete sale of this place during the coming week, if so Costa Rica will soon see me no more. We will probably never know what really happened, but luckily Lankester did not sell and did not leave although it seems that he was life. He continued collecting orchids to send to Ames, now often attaching to his herbarium specimens crude sketches or black and white photographs, all preserved today in Ames documents at the Oakes Ames Orchid Herbarium (Fig. 13). FIGURE 12. Lankester named honorary member of the American Orchid Society. FIGURE 11. Lankester, wife and daughter, 1925. FIGURE 13. Letter from Lankester to Ames, with a sketch of a species of Oncidium.
PAGE 217
OSSENBACH Charles H. Lankester, his life and legacy 367LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Paul Standley in Central America (1921-1925). A very special visitor came to Costa Rica in January 1924 and again in December 1925: Paul Carpenter Standley (1884-1963) (Fig. 14). Three years earlier, on December 19, 1921, Standley, a botanist with the U. S. National Museum, had arrived at the port city of La Libertad, El Salvador in the history of botanical exploration of the region Much can be expected from such a young and capable element Standley collected intensively in all of the countries of Central America and published a series of fundamental knowledge of the region, not only about its botanical aspects, but also its culture and traditions. He was a friend to all the Central American scientists of his time and contributed like no other to furthering the study and research of the local naturalists and collectors, as well as to the development of existing herbaria and the creation of many new ones. ... Standley hoped that every Central American country would have a and a comprehensive herbarium, formed by local collectors (McCook, 1999: 119). Standley arrived in Panama in November 1923. plant specimens in the Canal Zone. In December 1923, January 1924 and during a week in November 1925 (during his second stay in Panama), he collected 800 additional plants on the island of Barro Colorado, recently established as a protected area. As a result of these visits, he wrote his Flora of Barro Colorado Island and the Flora of the Panama Canal Zone, published in 1927 and 1928 respectively, by the Smithsonian Institution. The two visits by Standley to Panama were followed by extensive collecting trips to Costa Rica, a country then again between December 1925 and March 1926. Standley collected an enormous amount of material in Costa Rica -over 15,000 plant specimens, of which no less than 30 orchid species were new to science. Standley is in New York to-day. When he arrives in Costa Rica, shower orchids on him. Make it a rule that no orchid goes unpressed (Ames to Lankester, November 13, 1923). At this stage of the undertaking, quantity rather than quality is important (id., December 3, 1923). While Standley was working in Honduras, Lankester visited him, and the two became intimately acquainted; they continued to have frequent contact until their later years. Standley always remembered the gesture of the Lankesters in December 1925, while he was collecting in the region of Santa Mara de Dota: The writer has not forgotten that they sent a special messenger upon a two days journey to bring a greeting at Christmas time (Standley, 1937: 59). Y ears of indecision: between England and Costa Rica (1925-1939). Lankester was still far from the publication of his Schedulae Orchidianae, now with Charles C. Schweinfurth as co-author. With the publication of fascicle 9 in July 1925, the number of new species collected by Lankester and described by Ames reached 99. In 1927, Lankester visited Charles W. Powell, Panamas famous orchid collector, and FIGURE 14. Paul Carpenter Standley (1884-1963). Courtesy
PAGE 218
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.368 LANKESTERIANAwrote to Ames in one of his most famous passages: I have just spent a fortnight with my fellow sufferer from Orchiditis, CWP, and it was a very delightful time of talk and talk and then talk. I wish we could have had you there as High Priest of our cult. Possibly a few tangles might have been unraveled. After 1930, Lankester and Ames seem to drift slowly apart. Ames was taken in more and more by administrative work at Harvard, and Lankester traveled abroad more frequently. In a letter of April 1932, Ames complained about the separation. I have missed you. Those little crumbs from your orchidologist feasts always made me feel that you were near at hand. Since your return to England I have felt that you had departed almost to another planet! Later in 1932, and back in Costa Rica, Lankester was named by the president of Costa Rica as a member of the board of the National Museum; a great honor history of the orchids of Costa Rica: Anastasio Alfaro and the grande dame of Costa Rican orchid history, Amparo Zeledn. Abroad again, Lankester visited the Canary Islands in 1934, exploring Tenerife with Professor Balinaga, director of the Botanical Gardens traversing the Continent, left through Bolivia. In 1934, already 55 years old, Lankester was back in Costa Rica, where he collected the last three orchids that Ames described based on Lankesters collections. These were published between 1934 and 1935 in the orchids were three different species of Stelis: Stelis crystallina, S. latipetala and S. transversalis (Fig. 15). The American naturalist Alexander F. Skutch (1904-2004), who lived in Costa Rica from 1935 until his death, soon became one of the countrys most respected leaders in the study of natural sciences especially ornithology-and in the development of an original philosophical paradigm for understanding the relationship between mankind and its natural environment. Skutch collected orchids in Guatemala in 1933 and 1934, before moving to Costa Rica, so that it should come as no surprise that he soon met Lankester. In 1950, Skutch married Lankesters daughter Pamela; they spent the rest of their lives on a small farm on the River Peas Blancas that Skutch named Los Cusingos, after the local name for the orange beaked-toucanet (Pteroglossus frantzii). At the end of a decade marked by enormous indecision about his future, torn between his love for both his homeland and his children, Lankester went to England again before the outbreak of World War II. He returned to Costa Rica with his wife at the end of 1939, very narrowly missing being torpedoed in the convoy in which they crossed the Atlantic; a small ship to the side of them was the unfortunate victim. Lankesters last package of plants was sent to Ames, according to our records, in March 1942 although their correspondence continued until Ames passed away in 1950. In the early 1940s, the orchids of his adopted country: a book that would be entitled Costa Rican Orchids. News of this work soon spread, and the orchid world wanted to see it. Paul H. Allen, the foremost expert on the orchids of Panama, wrote to Lankester in 1946: Through the grapevine, I have heard that you have done a manual on the Orchids of Costa Rica. It is most fortunate in my opinion that you have done so, since you have probably seen more Lankester did not only want to write a book, he also wanted to raise funds for the conservation of his farm as a paradise of Costa Rican orchids. He wrote to Rodney Wilcox Jones, president of the American Orchids Society from 1942 to 1948, who gave a polite but clearly negative response: I would be inclined to believe there is not much that can be done Of course, now with your book coming along, I can see where it could be a basis to start an interest in conserving your place as an orchid haven. The years went by, and the manuscript was never published, although Lankesters dream of preserving his garden More and more, Lankester dedicated himself to building up his orchid and plant collections. In 1949, he sold his house in London, deciding to stay in Costa Rica although three of his daughters were married and living in England. As he wrote to Gordon Dillon in 1960: No idea of returning to live in England, I sold my house in London in 1949, but retain the link of 3 married daughters there, a summer like last years is certainly inviting, but the winters (Fig. 16).
PAGE 219
OSSENBACH Charles H. Lankester, his life and legacy 369LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. In 1955, after his wifes death and already 76 years old, Lankester decided to sell his farm but retained the small part which contained his garden, a piece of land called El Silvestre. Lankester moved to a house he had bought in Moravia, one of the suburbs of the capital, San Jos. A few years later, on June 10, 1961, in a ceremony at the British Embassy in San Jos, Lankester Lankester would be proud to the end of his days (Fig. 17). Gordon Dillon had especially gentle words about Lankester a few months before his death, and in one of his letters called him plantsman extraordinaire. Charles Herbert Lankester passed away in 1969, alone but for the company of his daughter Dorothy, years. Shortly before his death, Lankester confessed to Dorothy: I am only sorry that, with all the opportunities I had, I never made enough money. As one of his friends wrote in his guest book: Time is unfair to this place and these people (Fig. 18). Louis Williams described Lankester in his obituary FIGURE 15. Lankester in his garden at Las Cncavas, 1936.
PAGE 220
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.370 LANKESTERIANAwith these words: Generous to a fault, hospitable to all, he was counselor to all scientists who came to birds, but most especially epiphytic plants, orchids, bromeliads and aroids. And Paul Standley wrote: A naturalist in the best and widest sense of that word. Cncavas(= concavities) is the local Spanish name for circular, clayand three to four feet-deep. They are frequently found to the east of the Costa Rican city of Cartago. to Costa Rica during the last months of the year to escape the harshness of the North American winter. A coffee farm with the name of Las Cncavas featured one of these beautiful lagoons. Established in the second half of the 19th century by Francisco Quesada, it was bought in 1924 as we have seenby Charles H. Lankester (Fig. 19). On a section of this farm called El Silvestre, Lankester began his wonderful collections of orchids and plants of other families, which formed the basis of the Charles H. Lankester Botanical Garden of the University of Costa Rica. El Silvestre, which Lankester kept when he sold the rest of his farm in 1955, was inherited by his daughter FIGURE 17. Lankester receiving the Order of the British Empire from the British Embassador, San Jos, 1961. FIGURE 16. Lankester with wife Dorothy in 1952. FIGURE 18 Charles H. Lankester shortly before his death, in his house in Moravia, 1968.
PAGE 221
OSSENBACH Charles H. Lankester, his life and legacy 371LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.conserving the place as an orchid heaven. Dorothy was forced to put the garden up for sale. However, through the efforts of the Costa Rican Orchid Society group of members of the American Orchid Society (led by Rebecca T. Northen), raised half of the purchase price: $25,000. The other half was donated by the Stanley Smith Horticultural Trust of Great Britain. An evaluation committee was formed, and the garden was inspected by Thomas A. Bartenfeld, president of the Conservation Committee of the AOS, Eric Young, president of the Orchid Society of Great Britain and Dr. Calaway H. Dodson, whose expertise on Costa Rica was of great value. Their decision was positive, and the funds were deposited. The University of Costa Rica purchased the property and began to operate it as a botanical garden. And so, on March 2 1973, the Charles H. Lankester Botanical Garden was formally inaugurated (Fig. 21). budget, the garden could not be kept open to the public and could only be visited by special appointment with University named Dora Emilia Mora de Retana (Fig. 22) the garden was slowly transformed from a small farm of 10,7 hectares (aprox. 25 acres) into a world-renowned botanical garden. In a very similar way to Charles Lankester, Dora Emilia turned the Garden into a meeting place for the worlds most prestigious orchidologists. Calaway H. Dodson, Norris H. Williams, Robert L. Dressler, John T. Atwood, Carlyle A. Luer, Rudolf Jenny, Eric Hgsater, Henry Oakeley, Gnter Gerlach, Klaus C. Horich and many others were frequent guests at Charles Lankesters old farm at Las Cncavas. Her interaction with other botanists resulted in 300 Costa Rican orchids being illustrated in the series Icones Plantarum Tropicarum, mostly based on the living collections kept at the gardens. As Atwood remembers, Dora Emilias did not see Lankester Gardens as just a tourist garden for generating income, but as a garden dedicated to with Robert L. Dressler, who at the time was a visiting FIGURE 19. A concava at Lankesters farm in Cartago. Photographed by C. Lankester. FIGURE 20 Dorothy Lankester. FIGURE address at the inauguration of the Lankester Botanical Garden. Next to him Gordon Dillon, Secretary of the American Orchid Society and to the right Rebecca Northen, who led the fundraising efforts in the United States to buy the gardens.
PAGE 222
professor at the University of Costa Rica. Her main taxonomy was the treatment of the subtribes Maxillarinae and Oncidiniinae for the Flora Costaricensis, prepared in collaboration with John Atwood. Many new orchid species were dedicated to Dora Emilia Mora de Retana. Hgsater named his Epidendrum mora-retanae in her honor, Gerlach his Kefersteinia retanae, Dressler his Sobralia doremiliae, Luer his Stelis morae and Dodson & Escobar their Telipogon retanae. in her obituary: her greatest legacy is to rise above personal ambitions to foster efforts of those around her. Because of her, Lankester Gardens is blessed with a talented, imaginative, and altruistic staff Joaqun B. Garca Castro (1944-2001) (Fig. 23), called Quincho by his friends, was Dora Emilias friend and main collaborator for over 25 years. Rican orchids after Paul Standleys Flora of Costa Rica (1937), to which Oakes Ames had contributed with the treatment of Orchidaceae. In this Lista actualizada de las orqudeas de Costa Rica, Dora Emilia and Joaqun Garca added 46 genera and 467 species to the previous catalogue. A doctor of medicine and a university professor, Joaqun Garca was, for many years, the mentor of numerous Costa Rican orchid lovers. A brilliant scholar, Joaqun liked to lecture his friends on complicated themes, such as the biochemistry of colors genetics. As John Atwood liked to say: I dont have library. Always generous with his knowledge and his time, Joaqun served several terms as president of the Costa Rican Orchid Society. Shortly after his death, Franco Pupulin named Prosthechea joaquingarciana in his honor. The Lankester Botanical Garden has become the most important center for orchid research in Central America and the Caribbean. For this reason, in 2003 the University of Costa Rica changed its status and converted the garden into an experiment station. In December 2005, the Ministry of the Environment declared the Lankester Botanical Garden National Center for the Conservation of Flora and National Epiphyte Sanctuary. For its institutional merits, Luer named Masdevallia lankesteriana, and Pupulin named Chondrorhyncha lankesteriana (today Stenotyla lankesteriana) in honor of the gardens. FIGURE 22. Dora Emilia Mora (right) with Pamela Lankester (left), wife of Alexander Skutch. FIGURE 23. Joaqun Bernardo Garca Castro (1944-2001). Photograph by Eduardo Bitter.LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.372 LANKESTERIANA
PAGE 223
LITERATURE CITED Atwood, J.T. 2001. Dora Emilia Mora de Retana, a remembrance. Lankesteriana 2: 9. Paul C. Standley. Chicago Natural History Museum Press. de Agricultura, Oct. 1967: 248-264. McCook, S. 1999. Creole Science: Botanical Surveys of Costa Rica, 1880-1940. Endeavour 23(3): 118-120. Northen, R. 1964. Charles H. Lankester Orchidologist of Costa Rica. Amer. Orchid Soc. Bull. January 1964: 4350. Ossenbach, C. 2003. Breve Historia de la Orquideologa en Costa Rica Editorial de la Universidad de Costa Rica. Ossenbach, C. 2006. Orchids in Costa Rica Part II: Charles H. Lankester and Oakes Ames. Orchids (West Palm Beach), February 2006: 120-127. Ossenbach, C. 2006. Orchids in Costa Rica Part IV: The Charles H. Lankester Botanical Garden. Orchids (West Palm Beach), April 2006: 284-291. Ossenbach, C. 2009. Orchids and Orchidology in Central America: 500 years of history. Lankesteriana 9 (1-2): 1-268. Schlechter, R. 1923. Additamenta ad Orchideologiam Costaricensem. Repert. Sp. Nov. Regni Veg. 19. Standley, P.C. 1937. Flora of Costa Rica, Part I. Field Museum of Natural History, Botanical Series, Vol. 18, publication 391. Williams, L.O. 1969. In Memoriam: Charles Herbert Lankester 1879-1969. Amer. Orchid Soc. Bull. : 860862. OSSENBACH Charles H. Lankester, his life and legacy 373LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. APPENDIX New orchid species collected by Charles LankesterCampylocentrum lankesteri Ames Campylocentrum longicalcaratum Ames & C.Schweinf. Chondrorhyncha estrellensis Ames Cranichis lankesteri Ames Cranichis saccata Ames Cryptocentrum gracillimum Ames & C.Schweinf. Dichaea ciliolata Rolfe Dichaea lankesteri Ames Dichaea verrucosa Ames & C.Schweinf. Elleanthus tricallosus Ames & C.Schweinf. Epidendrum adnatum Ames & C.Schweinf. Epidendrum bilobatum Ames Epidendrum circinatum Ames Epidendrum crescentilobium Ames Epidendrum cristobalense Ames Epidendrum dentiferum Ames & C.Schweinf. Epidendrum dolabrilobum Ames & C.Schweinf. Epidendrum equitantifolium Ames Epidendrum estrellense Ames Epidendrum exile Ames Epidendrum intermixtum Ames & C.Schweinf. Epidendrum lankesteri Ames Ames & C.Schweinf. Epidendrum peraltense Ames Epidendrum ramosissimum Ames & C.Schweinf. Epidendrum rugosum Ames Epidendrum santaclarense Ames Epidendrum vagans Ames Habenaria lankesteri Ames Hexisea lankesteri Ames Hexisea sigmoidea Ames & C.Schweinf. Lankesterella Ames Lankesterella costaricensis Ames Lepanthes cascajalensis Ames Lepanthes chameleon Ames Lepanthes estrellensis Ames Lepanthes exasperata Ames & C.Schweinf. Lepanthes eximia Ames Ames & C.Schweinf. Lepanthes micrantha Ames Lepanthes rostrata Ames Lepanthes sanchoi Ames Lepanthes subdimidiata Ames & C.Schweinf. Lepanthes tridens Ames Limodorum lankesteri Ames & C.Schweinf. Lockhartia lankesteri Ames Malaxis lankesteri Ames Malaxis uncinata Ames & C.Schweinf. Ames & C.Schweinf. Ames & C.Schweinf. Maxillaria confusa Ames & C.Schweinf. Maxillaria foliosa Ames & C.Schweinf. Maxillaria lankesteri Ames Notylia lankesteri Ames Oncidium lankesteri Ames Ornithidium lankesteri Ames Ornithocephalus lankesteri Ames Physosiphon obliquipetalus Ames & C.Schweinf. Pleurothallis angusta Ames & C.Schweinf. Pleurothallis arietina Ames Pleurothallis cachensis Ames Pleurothallis cerea Ames
PAGE 224
Pleurothallis costaricensis Rolfe Pleurothallis crassilabia Ames & C.Schweinf. Pleurothallis crescentilabia Ames Pleurothallis cucullata Ames Pleurothallis dentipetala Rolfe ex Ames Pleurothallis dichotoma Ames (nom. ill.) Pleurothallis geminicaulina Ames Pleurothallis glomerata Ames Pleurothallis longipedicellata Ames & C.Schweinf. Pleurothallis nana Ames & C.Schweinf. Pleurothallis palliolata Ames Pleurothallis papillifera Rolfe Pleurothallis peperomioides Ames Pleurothallis peraltensis Ames Pleurothallis peregrina Ames Pleurothallis periodica Ames Pleurothallis pompalis Ames Pleurothallis rectipetala Ames & C.Schweinf. Pleurothallis saccata Ames Pleurothallis sanchoi Ames Pleurothallis scandens Ames Pleurothallis segregatifolia Ames & C.Schweinf. Pleurothallis strumosa Ames Pleurothallis vinacea Ames Restrepia lankesteri Ames & C.Schweinf. Scaphyglottis bicallosa Dressler Sobralia atropubescens Ames & C.Schweinf. Sobralia carazoi C.H. Lank. & Ames Sobralia mucronata Ames & C.Schweinf. Spiranthes lankesteri Standl. & L.O.Williams Stelis barbata Rolfe Ames & C.Schweinf. Stelis cascajalensis Ames Stelis crystallina Ames Stelis cucullata Ames Stelis cuspidata Ames Ames Stelis elliptica Ames & C.Schweinf. Ames & C.Schweinf. Stelis glandulosa Ames Stelis lankesteri Ames Stelis latipetala Ames Ames & C. Schweinf. (nom. ill.) Stelis propinqua Ames Stelis sanchoi Ames Stelis transversalis Ames Stelis vestita Ames Ames & C.Schweinf. Stenorrhynchus bracteosus Ames & C.Schweinf. ASTERACEAE Vernonia lankesteri S.F.Blake ex Standl. BROMELIACEAE Araeococcus pectinatus L.B.Smith CACTACEAE Discocactus lankesteri Kimnach CAPPARACEAE Capparis lankesteri Standl. EUPHORBIACEAE Croton triumfettoides MALVACEAE Wercklea lutea Rolfe PIPERACEAE Peperomia lankesteri Trel. RANUNCULACEAE Thalictrum lankesteri Standl. SAPOTACEAE Bumelia lankesteri Standl. SOLANACEAE Lycianthes lankesteri Standl. VERBENACEAE Citharexylum lankesteri MoldenkeNew species collected by Lankester in other plant families LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.374 LANKESTERIANA
PAGE 225
Cymbidieae include many of the showiest Neotropical epiphytic orchids and an unparalleled Many researchers have posed questions such as How many times and when has male euglossine et al. 2011), or (Reis et al. 2000) within this clade, but answering such questions requires a densely sampled and wellsupported phylogenetic hypothesis. Although the broad outlines of relationships within Cymbidieae were revealed by the rbcL/matK analyses of Freudenstein et al. (2004) and summaries of Chase et al. (2003), both of these studies were constrained by low taxon sampling and low bootstrap support for many clades. The most recent publication of the Genera Orchidacearum series (Pridgeon 2009) provided a concise and authoritative summary of knowledge of this clade that includes 11 subtribes. Phylogenetic trees for Neotropical Cymbidieae published in that volume were based upon our nrITS/matK/ycf1 data sets that were unpublished and included many sequences not deposited in GenBank. In attempting to rework these data for publication, we decided that attempting to align nrITS sequences across the entire tribe was unrealistic due to high levels of sequence divergence, and instead to concentrate our efforts on assembling a larger plastid data set based on two regions (matK and ycf1) that are among the most variable plastid exon regions and can be aligned with minimal ambiguity across broad taxonomic spans. Although various plastid spacer regions such as trnL-F or atpBrbcL are more rapidly evolving (Shaw et al. 2005), we present phylogenetic analyses of ca. 280 taxa of Cymbidieae including representatives of 10 subtribes the majority of the matK exon and a ca. 1500 base pair (bp) portion of the 3 end of ycf1. Phylogenetic relationships within Oncidiinae were addressed in detail by Neubig et al. (2012). Relationships within Maxillariinae were studied using nrITS/matK/atpBrbcL spacer by Whitten et al.(2007), and the Bifrenaria trnL-F by Koehler et al. (2002). Zygopetalinae relationships were previously studied using nrITS/matK/trnL-F (Neubig et al., 2009b; Whitten et al., 2005).LANKESTERIANA 13(3): 375. 2014. I N V I T E D P A P E R CYMBIDIEAE (ORCHIDACEAE) BASED ON MATK/YCF1 PLASTID DATA W. MARK WHITTEN 1,2 KUR T M. NEUBIG 1 & N. H. WILLIAMS 1 1Florida Museum of Natural History, University of Florida Gainesville, FL 32611-7800 USA2 ABSTRACT. Relationships among all subtribes of Neotropical Cymbidieae (Orchidaceae) were estimated using combined matK/ycf1 (BS) analyses yield 100% BS support for all subtribes except Stanhopeinae (87%). Generic relationships within subtribes are highly resolved and are generally congruent with those presented in previous studies and as Genera Orchidacearum Maxillaria cacaoensis J.T.Atwood in Camaridium. KEY WORDS : Orchidaceae, Cymbidieae, Maxillariinae, matK, ycf1, phylogenetics, Camaridium, Maxillaria cacaoensis, Vargasiella* This paper was prepared in the framework of the celebration of Lankester Botanical Gardens 40th anniversary.
PAGE 226
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.376 LANKESTERIANAMethods Most matK sequences were downloaded from GenBank from previous studies of Cymbidieae subtribes. Additional sequences were generated using primers matK-19F (CGTTCTGACCATATTGCACTATG) and matK 1520R (CGGATAATGTCCAAATACCAAATA) Whitten et al. (2007). A ca. 1500 bp portion of 3 portion of ycf1 primers and protocols in Neubig et al. (2009a). A list of taxa, vouchers, and GenBank numbers is presented in Table 1. Matrices were aligned using Muscle (Edgar, 2004)followed by manual adjustment of gaps to maintain reading frame using Se-Al (Rambaut 1996). The matK matrix was trimmed to eliminate Polystachya was chosen as the outgroup based upon broader sampling (Neubig et al. 2009a). Matrices and a list of vouchers are deposited in the Dryad Digital Repository (http://doi.org/10.5061/dryad.2rm60) or are available from the author. The resulting combined matrix consists of 288 ingroup taxa and 1 outgroup (Polystachya); the aligned matrix consists of 3618 characters (1605 for matK; 2013 for ycf1). Gaps are coded as missing data. likelihood (ML) as implemented in RAxML-HPC Blackbox version 7.6.3 (Stamatakis, 2006) via the CIPRES Science Gateway computing facility (http:// www.phylo.org/index.php/portal/). Analyses were run using default values with 200 fast bootstrap replicates. opened in PAUP* (Swofford 2003), and a majorityrule consensus tree was generated to display bootstrap support values. FigTree 1.4.0 (Rambaut 2013) was used to edit and print the best ML tree. Results and Discussion The resulting best ML tree is presented in Figures 1-5; bootstrap (BS) values above 75% are annotated on this tree. Overall, the tree agrees well with previous studies based on plastid and nuclear regions (Grniak et al. 2010). Subtribe Cymbidiinae is represented by only a single taxon (Cymbidium); it is sister to all remaining taxa. All subtribes (as delimited in Genera Orchidacearum) received 100% BS support (except for Stanhopeinae), but most relationships among subtribes lack BS support. Eulophiinae (Fig. 1). Out of the nine genera only two Neotropical genera; the majority of species are from the tropics of Africa, Madagascar, Asia, and Australia. Eulophiinae are weakly sister to Catasetinae in the single ML tree. Catasetinae (Fig. 1). Recent molecular phylogenetic studies (Batista et al., In press) place the three species of Cyanaeorchis Barb.Rodr. in Catasetinae; it is sister to Grobya Lindl., and they are sister to all of the seven genera, with Grobya and Mormodes Grobya as monophyletic and a member of Catasetinae (Monteiro et al. 2010). Unpublished ycf1 and matK sequences for Cyanaeorchis arundinae (Rchb.f.) Barb.Rodr. and Grobya species (Whitten and Batista, incongruence among sections of Cycnoches. distinctiveness of this monogeneric subtribe from the vegetatively similar Catasetinae; Cyrtopodium is weakly sister to all remaining Cymbidieae, and not Pridgeon and Chase (Pridgeon & Chase 1998). Oncidiinae (Fig. 1). Our sampling of Oncidiinae was minimal, including placeholder representatives of the major clades within the subtribe; a much more extensive sampling based on matK/ycf1 plus other regions was presented by Neubig et al. (2012). Oncidiinae are in a highly supported clade that includes subtribes Eriopsidinae, Zygopetalinae, Stanhopeinae, Coeliopsidinae, and Maxillariinae but relationships within this clade are poorly supported. Eriopsidinae (Fig. 2). Dressler (1981) included Eriopsis and pollinarium structure but later regarded it as incertae sedis created a subtribe to accommodate this anomalous other subtribes.
PAGE 227
WHITTEN et al. Generic and subtribal relationships in Neotropical Cymbidieae377LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. TaxonmatK ycf1 Voucher:Herbarium Acineta chrysantha (C. Morren) Lindl. KF660253 KF660372 Whitten 91360 (FLAS) Acineta (Kunth) Rchb.f. KF660254 KF660523 Whitten 3378 (FLAS) Aetheorhyncha andreettae (Jenny) Dressler AY869932 KF660386 Dressler 6360 (FLAS) Rchb.f. AY870006 KF660404 Breuer s.n. (M) pulchella Lindl. AY870007 KF660403 Breuer s.n. (M) hohenlohii C. Morren AF239429 KF660512 Whitten 3023 (FLAS) Ruiz & Pav. KF660255 KF660364 Whitten 3263 (FLAS) Batemannia lepida Rchb.f. AY869990 KF660323 Gerlach 92-3900 (M) cornuta (Garay) Dressler AY869927 KF660450 Whitten 1818 (FLAS) estradae (Dodson) Dodson AY869930 KF660398 Gerlach 96-4287 (M) hajekii (D.E.Benn. & Christenson) Dressler AY869929 KF660377 Whitten 1751 (FLAS) (Schltr.) Dressler AF239421 KF660363 Whitten 1747 (FLAS) Bifrenaria inodora Lindl. DQ210744 KF660365 Whitten 0097 (FLAS) Bifrenaria (Lindl.) Schltr. DQ210751 KF660529 Whitten 0506 (FLAS) Bifrenaria tyrianthina (Lodd. ex Loudon) Rchb.f. DQ210752 KF660379 Whitten 0507 (FLAS) Braemia vittata (Lindl.) Jenny AF239476 KF660338 Chase 84748 (FLAS) Brasiliorchis (Lodd.) R. B. Singer, S. Koehler & Carnevali DQ210811 KF660426 Whitten 2303 (FLAS) Brasiliorchis schunkeana (Campacci & Kautsky) R. B. Singer, S. Koehler & Carnevali DQ210799 KF660421 Whitten 1992 (FLAS) Brassia aurantiaca (Lindl.) M.W.Chase AF239492 FJ563573 Williams s.n. (FLAS) Brassia jipijapensis Dodson & N.H.Williams FJ564762 FJ563258 Whitten 1829 (FLAS) Camaridium Schltr. DQ210963 KF660468 Whitten 2639 (FLAS) Camaridium carinatum (Barb.Rodr.) Hoehne DQ210828 KF660431 Whitten 2337 (FLAS) Camaridium ctenostachys (Rchb.f.) Schltr. DQ210967 KF660471 Whitten 2647 (FLAS) Camaridium cucullatum (Lindl.) M.A Blanco DQ210753 KF660354 Whitten 2547 (FLAS) Camaridium Schltr. DQ210952 KF660463 Whitten 2627 (FLAS) Camaridium horichii (Senghas) M.A. Blanco DQ210937 KF660461 Whitten 2602 (FLAS) Camaridium Schltr. DQ210964 KF660469 Whitten 2643 (FLAS) Camaridium ochroleucum Lindl. DQ210626 KF660312 Gerlach 2003-3648 (M) Camaridium paleatum (Rchb.f.) M.A.Blanco DQ210907 KF660458 Whitten 2561 (FLAS) Camaridium scalariforme (J.T.Atwood) M.A.Blanco DQ210957 KF660466 Whitten 2633 (FLAS) Camaridium vestitum (Sw.) Lindl. DQ209866 KF660304 Atwood & Whitten 5070 (SEL) Catasetum expansum Rchb.f. KF660256 KF660525 Whitten 3543 (FLAS) (C.Schweinf.) Garay AY869973 KF660378 Whitten 1853 (FLAS) surinamensis Rchb.f. AY869974 KF660309 Gerlach 2001-2159 (M) Ackerman AY869944 KF660416 Whitten 1620 (FLAS) (Schltr.) Garay AY869945 KF660407 Whitten s.n. (FLAS) (Garay & Dunst.) Garay AY869946 KF660311 Gerlach 1651 (M) Chondrorhyncha Dodson AY869916 KF660389 Whitten 1637 (FLAS) Chondrorhyncha Dodson AY869913 KF660406 Maduro & Olmos 217 (FLAS) Chondrorhyncha rosea Lindl. AY869914 KF660385 Whitten 1760 (FLAS) TABLE 1. List of taxa sequenced with GenBank numbers and voucher information.
PAGE 228
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.378 LANKESTERIANA TaxonmatK ycf1 Voucher:Herbarium Chondroscaphe (Schltr.) Senghas & G.Gerlach AY869966 KF660391 Whitten 1855 (FLAS) Chondroscaphe (Rolfe) Dressler AY869971 KF660390 Dressler ex Hoffman s.n. (FLAS) (Dressler) Dressler AY869915 KF660408 Dressler 6361 (FLAS) Chondroscaphe (Linden & Rchb.f.) Senghas & G.Gerlach AY869969 KF660320 Gerlach 93-3342 (M) Christensonella ferdinandiana (Barb.Rodr.) Szlach., Mytnik, Grniak & Smiszek DQ210670 KF660353 Koehler 109 (UEC) Christensonella nardoides (Kraenzl.) Szlach., Mytnik, Grniak & Smiszek DQ210890 KF660452 Whitten 2502 (FLAS) Christensonella pacholskii (Christenson) S.Koehler DQ210851 KF660437 Whitten 2393 (FLAS) Cirrhaea fuscolutea Lindl. KF660257 KF660508 Whitten 2976 (FLAS) Cirrhaea seidelii Pabst KF660258 KF660333 Gerlach s.n. (M) pusilla (C.Schweinf.) Dressler & N.H.Williams FJ565130 FJ563799 Whitten 3300 FLAS Clowesia dodsoniana E.Aguirre KF660259 KF660524 Whitten 3542 (FLAS) Cochleanthes (Sw.) R.E.Schult. & Garay AY869965 KF660513 Whitten 99113 (FLAS) Coeliopsis hyacinthosma Rchb.f. AF239440 KF660337 Whitten 93153 (FLAS) Comparettia falcata Poepp. & Endl. FJ563869 FJ563283 Williams N084 (FLAS) Comparettia macroplectron Rchb.f. & Triana FJ565135 FJ563804 Whitten 3425 (FLAS) Coryanthes Linden & Rchb.f. KF660260 KF660318 Whitten 87267 (FLAS) Coryanthes macrantha (Hook.) Hook. KF660261 KF660319 Gerlach O-21458 (M) Coryanthes verrucolineata G.Gerlach KF660262 KF660317 Gerlach 96-4284 (M) Cryptarrhena Schltr. AY869983 KF660476 Pupulin & Campos 2957 (USJ) Cryptarrhena lunata R.Br. AY869982 KF660405 Whitten 98000 (FLAS) Carnevali KF660263 KF660307 Beckendorf s.n. (CICY) Cryptocentrum peruvianum (Cogn.) C.Schweinf. DQ210820 KF660430 Whitten 2322 (FLAS) Cryptocentrum roseans (Schltr.) A.D.Hawkes DQ210903 KF660457 Whitten 2554 (FLAS) Cycnoches cooperi Rolfe KF660264 KF660526 Whitten 3591 (FLAS) Cycnoches lehmannii Rchb.f. KF660265 KF660328 Whitten 87011 (FLAS) Cycnoches manoelae P.Castro & Campacci KF660266 KF660310 Gerlach 05-1231 (M) Cycnoches pachydactylon Schltr. KF660267 KF660316 Gerlach 00-3414 (M) devonianum Paxton KF660268 KF660325 Chase 87030 (K) Cyrtidiorchis alata (Ruiz & Pav.) Rauschert DQ210627 KF660321 Gerlach 94-4005 (M) Cyrtidiorchis alata (Ruiz & Pav.) Rauschert DQ211044 KF660505 Whitten 2932 (FLAS) Cyrtochilum serratum (Lindl.) Kraenzl. FJ563842 FJ562462 Chase O-032 (K) Cyrtopodium andersonii (Lamb. ex Andrews) R.Br. KF660269 KF660329 Kew no voucher Cyrtopodium (Nees) Link & Otto ex Rchb. KF660270 KF660522 Whitten 3377 (FLAS) Cyrtopodium Dodson & G.A.Romero KF660271 KF660453 Whitten 2504 (QCA) Daiotyla (Rolfe) Dressler AY869917 KF660396 Whitten 1932 (FLAS) Dichaea Folsom EU123625 EU123747 Pupulin 1094 (USJ-L) Dichaea Folsom EU123628 EU123750 Pupulin 4601 (USJ-L) Dichaea panamensis Lindl. EU123650 EU123772 Whitten 2556 (FLAS) Dichaea trulla Rchb.f. EU123671 EU123792 Whitten 2475 (FLAS) TABLE 1. Continues.
PAGE 229
WHITTEN et al. Generic and subtribal relationships in Neotropical Cymbidieae379LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. TABLE 1. Continues. TaxonmatK ycf1 Voucher:Herbarium Dipteranthus (Lindl.) Pabst AF350587 FJ563191 Chase O-103 (K) Dressleria dilecta (Rchb.f.) Dodson AF239507 EU490731 Whitten F1046 (SEL) Dressleria Dodson KF660272 KF660327 Dodson 8855 (SEL) Dressleria helleri Dodson KF660273 KF660326 Hills 87145 (FLAS) herrenhusana (Jenny) Jenny KF660275 KF660314 Gerlach 04-2526 (M) (Claes ex Cogn.) Dodson KF660276 KF660313 Gerlach 05-2172 (M) Eriopsis Lindl. DQ210866 EU490743 Whitten 3327 (FLAS) Eriopsis Lindl. DQ210866 KF660441 Whitten 2439 (FLAS) Eriopsis Lindl. DQ461806 KF660515 Whitten 3153 (QCA) Erycina pusilla (L.) N.H.Williams & M.W.Chase FJ565025. FJ563690 Whitten 1771 FLAS Eulophia Lindl. AF239509 EU490745 Whitten 99029 (FLAS) Eulophia petersii (Rchb.f.) Rchb.f. KF660274 KF660332 Chase 22361 (K) (Rchb.f.) M.W.Chase FJ565079 KF660454 Whitten 2537 (FLAS) (Lindl.) Garay & Dunst. FJ565009 FJ563674 Whitten 1700 FLAS tica Mora-Ret. & Garca Castro FJ564944 FJ563591 Dressler & Atwood s.n. FLAS Galeandra devoniana M.R.Schomb. ex Lindl. KF660278 KF660330 Pupulin 1133 (JBL) Galeottia (Rchb.f.) Dressler & Christenson AY869987 KF660400 Maguire & Politi 28175 (AMES) Galeottia ciliata (Morel) Dressler & Christenson AY869989 KF660401 Breuer s.n. (M) Galeottia (Garay) Dressler & Christenson AY869986 KF660397 Gerlach 93-3396 (M) amparoana Schltr. AF239481 KF660367 Whitten 91036 (FLAS) armeniaca (Lindl.) Rchb.f. AF239482 KF660334 Hills 86143 (FLAS) armeniaca (Lindl.) Rchb.f. AF239482 KF660374 Whitten F1636 (FLAS) Whitten KF660279 KF660347 Whitten 95023 (FLAS) Dodson & N.H.Williams KF660280 KF660349 Whitten 93109 (FLAS) ilense Whitten & Jenny AF239480 KF660509 Whitten 2982 (FLAS) portentosa Linden & Rchb.f. AF239485 KF660341 Bennett 5258 (FLAS) portentosa Linden & Rchb.f. KF660281 KF660350 Bennett 5279 (FLAS) seideliana Rchb.f. KF660282 KF660348 Whitten F-1635 (FLAS) sphaerica Jenny KF660283 KF660331 Whitten 2003 (FLAS) tridentata Whitten AF239483 KF660373 Whitten 1083 (FLAS) Grandiphyllum (Rchb.f.) Docha Neto FJ563959 FJ563597 Whitten 1777 FLAS (C.Schweinf.) G.A.Romero & G.Carnevali KF660284 KF660410 Maguire & Politi 27931 (AMES) Heterotaxis crassifolia Lindl. DQ210897 KF660455 Whitten 2544 (FLAS) Heterotaxis (Schltr.) Ojeda & Carnevali DQ210877 KF660448 Whitten 2483 (FLAS) Heterotaxis maleolens (Schltr.) Ojeda & Carnevali DQ209972 KF660486 Whitten 2764 (FLAS) Heterotaxis santanae (Carnevali & I.Ramrez) Ojeda & Carnevali DQ209973 KF660487 Whitten 2765 (FLAS) Heterotaxis (A.Rich.) Ojeda & Carnevali DQ210950 KF660510 Whitten 2620 (FLAS) Heterotaxis violaceopunctata (Rchb.f.) F.Barros DQ210807 KF660424 Whitten 2294 (FLAS) Hintonella mexicana Ames FJ564940 FJ562874 Whitten W513 (FLAS) Horichia dressleri Jenny AF239458 KF660340 Whitten 93151 (FLAS)
PAGE 230
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.380 LANKESTERIANA TaxonmatK ycf1 Voucher:Herbarium Houlletia Lindl. KF660285 KF660335 Gerlach s.n. (M) Houlletia odoratissima Linden ex Lindl. & Paxton KF660286 KF660315 Gerlach 97-3285 (M) Houlletia sanderi Rolfe AF239467 KF660376 Whitten 93079 (FLAS) Houlletia Linden ex Lindl. AF239466 KF660375 Whitten 91354 (FLAS) Huntleya wallisii (Rchb.f.) Rolfe EU123674 EU123796 Whitten 88026 (FLAS) Hylaeorchis petiolaris (Schltr.) Carnevali & G.A.Romero DQ211020 KF660352 Whitten 2874 (FLAS) (Rchb.f.) M.A.Blanco DQ209946 KF660417 Whitten 1677 (FLAS) (Rchb.f.) M.A.Blanco DQ210960 KF660467 Whitten 2636 (FLAS) chartacifolia (Ames & C.Schweinf.) M.A.Blanco DQ209942 EU490750 Whitten 1597 (FLAS) chartacifolia (Ames & C.Schweinf.) M.A.Blanco DQ211000 KF660485 Whitten 2752 (FLAS) viridisepala (Senghas) Dressler AY869942 KF660418 Whitten 1749 (FLAS) Kefersteinia excentrica Dressler & Mora-Ret. AY869934 KF660507 Dressler 6236 (FLAS) Kefersteinia maculosa Dressler AY869938 KF660422 Whitten 1997 (FLAS) Kefersteinia microcharis Schltr. AY869937 KF660308 Pupulin 252 (USJ) Kefersteinia trullata Dressler AY869936 KF660423 Whitten 1998 (FLAS) atropilosa L.O.Williams & A.H.Heller AF239459 KF660342 Whitten 93101 (FLAS) kupperi Mansf. AF263666 KF660339 Whitten F167 (FLAS) Koellensteinia (Lindl.) Rchb.f. AY870003 KF660429 Chase 159 (K) Lacaena (Klotzsch) Rchb.f. KF660287 KF660346 Whitten F-184 (FLAS) Lockhartia amoena Endres & Rchb.f. FJ564686 FJ563116 Blanco 1803 (FLAS) Lueckelia (Summerh.) Jenny KF660288 KF660382 Gerlach 96-6072 (M) Lueddemannia pescatorei (Lindl.) Linden & Rchb.f. AF239472 KF660488 Gerlach 2003-1482(M) Lycaste aromatica (Graham) Lindl. AF263669 KF660322 Freudenstein s.n. Lycomormium H.R.Sweet AF239441 KF660528 Whitten 91340 (FLAS) auyantepuiensis (Foldats) Carnevali & R.B.Singer DQ210830 KF660432 Whitten 2347 (FLAS) (Ames & C.Schweinf.) Carnevali & R.B.Singer DQ210747 KF660305 Atwood & Whitten 5075 (SEL) Maxillaria acostae Schltr. DQ210965 KF660470 Whitten 2644 (FLAS) Maxillaria Ames, F.T.Hubb. & C.Schweinf. DQ210993 KF660479 Whitten 2735 (FLAS) F.Lehm.&Kraenzl. DQ211026 KF660500 Whitten 2893 (FLAS) Maxillaria Schltr. DQ210773 KF660414 Whitten 1583 (FLAS) Maxillaria Schltr. DQ211047 KF660506 Whitten 2940 (FLAS) Maxillaria cacaoensis J.T.Atwood KC747493 KC747494 Whitten 3362 (FLAS) Maxillaria calantha Schltr. DQ210900 KF660456 Whitten 2550 (FLAS) Maxillaria canarina D.E.Benn. & Christenson KF660289 KF660518 Whitten 3256 (FLAS) Maxillaria chionantha J.T.Atwood DQ210969 KF660472 Whitten 2649 (FLAS) Maxillaria confusa Ames & C.Schweinf. DQ210994 KF660480 Whitten 2736 (FLAS) Maxillaria dalessandroi Dodson DQ211024 KF660499 Whitten 2889 (FLAS) Maxillaria dillonii D.E.Benn. & Christenson KF660290 KF660496 Whitten 2878 (FLAS) Maxillaria ecuadorensis Schltr. DQ210989 KF660478 Whitten 2724 (FLAS) Maxillaria Rolfe DQ210921 KF660460 Whitten 2576 (FLAS) TABLE 1. Continues.
PAGE 231
WHITTEN et al. Generic and subtribal relationships in Neotropical Cymbidieae381LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. TaxonmatK ycf1 Voucher:Herbarium Maxillaria exaltata (Kraenzl.) C.Schweinf. DQ210818 KF660428 Whitten 2317 (FLAS) Maxillaria Dodson DQ210975 KF660475 Whitten 2656 (FLAS) Maxillaria Dodson KF660291 KF660497 Whitten 2879 (FLAS) Maxillaria Cogn. DQ210775 KF660415 Whitten 1593 (FLAS) Cogn. KF660292 KF660445 Whitten 2468 (FLAS) Maxillaria hennisiana Schltr. DQ210918 KF660459 Whitten 2572 (FLAS) Maxillaria litensis Dodson KF660293 KF660498 Whitten 2888 (FLAS) Maxillaria Lindl. DQ210999 KF660484 Whitten 2751 (FLAS) Maxillaria Lindl. DQ210996 KF660482 Whitten 2745 (FLAS) Maxillaria lueri Dodson DQ210954 KF660464 Whitten 2629 (FLAS) Maxillaria meridensis Lindl. DQ210870 KF660443 Whitten 2451 (FLAS) Maxillaria ochroleuca Lodd. ex Lindl. DQ210844 KF660435 Whitten 2378 (FLAS) Maxillaria platypetala Ruiz & Pav. DQ211033 KF660502 Whitten 2909 (FLAS) Maxillaria porrecta Lindl. DQ210948 KF660462 Whitten 2617 (FLAS) Maxillaria pulla Linden & Rchb.f. DQ210872 KF660444 Whitten 2459 (FLAS) Maxillaria silvana Campacci DQ210997 KF660483 Whitten 2747 (FLAS) Maxillaria sp. nov. KF660294 KF660520 Whitten 3337 (FLAS) Maxillaria splendens Poepp. & Endl. FJ565112 FJ563781 Whitten 2949 FLAS Maxillaria triloris E.Morren DQ209887 KF660411 Blanco 1640 (USJ) Maxillaria triloris E.Morren DQ211038 KF660503 Whitten 2917 (FLAS) Maxillariella (Lindl.) M.A.Blanco & Carnevali DQ211013 KF660491 Whitten 2810 (FLAS) Maxillariella elatior (Rchb.f.) M.A.Blanco & Carnevali DQ210797 KF660420 Whitten 1986 (FLAS) Maxillariella oreocharis (Schltr.) M.A.Blanco & Carnevali DQ210971 KF660473 Whitten 2652 (FLAS) Maxillariella ponerantha (Rchb.f.) M.A.Blanco & Carnevali DQ210973 KF660474 Whitten 2654 (FLAS) Maxillariella procurrens (Lindl.) M.A.Blanco & Carnevali DQ210854 KF660438 Whitten 2397 (FLAS) Maxillariella (Bateman ex Lindl.) M.A.Blanco & Carnevali DQ210995 KF660481 Whitten 2737 (FLAS) Miltonia Rchb.f. AF239491 FJ563571 Chase 86059 (K) Mormolyca peruviana C.Schweinf. DQ210885 KF660451 Whitten 2497 (FLAS) Mormolyca polyphylla Garay & Wirth DQ211009 KF660489 Whitten 2789 (FLAS) Mormolyca richii (Dodson) M.A.Blanco DQ210836 KF660434 Whitten 2362 (FLAS) Mormolyca (Lindl.) Gentil DQ210680 KF660493 Whitten 2857 (FLAS) Mormolyca schlimii (Linden & Rchb.f.) M.A.Blanco DQ210847 KF660436 Whitten 2386 (FLAS) murrayana (Gardner ex Hook.) Schltr. ex Garay AY869997 KF660402 Gerlach s.n. (M) Neomoorea wallisii (Rchb.f.) Schltr. DQ210743 EU490754 Whitten 3010 (FLAS) (Rchb. f.) I.Ojeda & Carnevali DQ210756 KF660419 Whitten 1869 (FLAS) (Rchb. f.) I.Ojeda & Carnevali DQ209857 KF660303 Atwood & Whitten 5056 (SEL) Notyliopsis P.Ortiz FJ565086 FJ563753 Whitten 2674 FLAS Oeceoclades maculata (Lindl.) Lindl. KF660295 KF660519 Whitten 3333 (FLAS) Oncidium cirrhosum (Lindl.) Beer FJ563845 FJ562480 Chase 86235 (K) Oncidium sphacelatum Lindl. FJ563863 FJ563267 Whitten 3467 (FLAS TABLE 1. Continues.
PAGE 232
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.382 LANKESTERIANA TABLE 1. Continues. TaxonmatK ycf1 Voucher:Herbarium Oncidium weinmannianum (Kniger) M.W. Chase & N.H. Williams FJ565036 FJ563701 Whitten 2328 FLAS Ornithidium Rchb.f. DQ210880 KF660449 Whitten 2488 (FLAS) Ornithidium canarense (J.T.Atwood) M.A.Blanco & Ojeda DQ209959 KF660440 Whitten 2437 (FLAS) Ornithidium coccineum (Jacq.) Salisb. ex R.Br. DQ209875 KF660494 Whitten 2860 (FLAS) Ornithidium donaldeedodii Ackerman & Whitten KF660296 KF660527 Forbes s.n. (UC) Ornithidium Rchb.f. DQ209968 KF660465 Whitten 2630 (FLAS) Ornithidium Lindl. DQ210817 KF660427 Whitten 2316 (FLAS) Ornithidium multicaule (Poepp. & Endl.) Rchb.f. DQ211032 KF660501 Whitten 2905 (FLAS) Ornithidium serrulatum Lindl. DQ211010 KF660490 Whitten 2800 (FLAS) Ornithidium sophronitis Rchb.f. DQ210809 KF660425 Whitten 2296 (FLAS) Ornithocephalus dalstroemii (Dodson) Toscano & Dressler FJ564705 FJ563134 Blanco 2980 FLAS Ornithocephalus dalstroemii (Dodson) Toscano & Dressler FJ564705 FJ563761 Blanco 2980 FLAS Ornithocephalus Lindl. DQ315891 FJ563120 Blanco 2545 (FLAS) (Kunth) N.H.Williams & M.W.Chase FJ564700 FJ563129 Blanco 2856 (FLAS) (Kunth) N.H.Williams & M.W.Chase FJ564700 FJ563129 Blanco 2856 FLAS Otostylis lepida (Linden & Rchb.f.) Schltr. AY870009 KF660399 Gerlach 94-968 (M) Otostylis paludosa (Cogn.) Schltr. KF660297 KF660517 Whitten 3250 (FLAS) Paphinia clausula Dressler KF660298 EU490758 Whitten 3600 (FLAS) Paphinia neudeckeri Jenny AF239471 KF660371 Whitten 88041 (FLAS) Peristeria elata Hook. AF239442 EU490761 Whitten 90158 (FLAS) Pescatoria cerina (Lindl. & Paxton) Rchb.f. AY869952 KF660384 Whitten s.n. (FLAS) Pescatoria coronaria Rchb.f. AY869954 KF660368 Whitten 1758 (FLAS) Pescatoria lamellosa Rchb.f. AY869953 KF660369 Whitten 1755 (FLAS) Pescatoria lawrenceana (Rchb.f.) Dressler AF350662 KF660393 Whitten 1636 (FLAS) Pescatoria lehmannii Rchb.f. AF239422 KF660492 Whitten 2848 (FLAS) Pescatoria pulvinaris (Rchb.f.) Dressler AY869950 KF660388 Whitten 1748 (FLAS) Pityphyllum (Kraenzl.) Whitten DQ209957 KF660439 Whitten 2402 (FLAS) Pityphyllum laricinum (Kraenzl.) Schltr. DQ209961 KF660446 Whitten 2473 (FLAS) Pityphyllum (Dodson) Whitten DQ461805 KF660514 Whitten 3084 (QCA) Polycycnis Endres & Rchb.f. AF239469 EU490769 Whitten 93178 (FLAS) Polycycnis Endres & Rchb.f. AF239469 EU490769 Whitten 93178 (FLAS) Polyotidium (Mansf.) Garay FJ563960 FJ563598 Romero 3124 AMES Polystachya cultriformis (Thouars) Lindl. ex Spreng. DQ091312 KF660306 Carlsward 213 (SEL) Promenaea stapelioides (Link & Otto) Lindl. AY870002 EU123797 Whitten 94102 (FLAS) Promenaea xanthina (Lindl.) Lindl. AY870000 KF660366 Whitten 1860 (FLAS) Psychopsiella & Braem FJ565152 FJ563820 Whitten 3561 FLAS Psychopsis sanderae FJ564712 FJ563158 Chase 86126 (K) Rhetinantha acuminata (Lindl.) M.A.Blanco DQ210981 KF660477 Whitten 2698 (FLAS) Rhetinantha (Rchb.f.) M.A.Blanco DQ210645 KF660351 Koehler 0033 (UEC)
PAGE 233
WHITTEN et al. Generic and subtribal relationships in Neotropical Cymbidieae383LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. TABLE 1. Continues. TaxonmatK ycf1 Voucher:Herbarium krameri (Rchb. f.) M.W. Chase & N.H. Williams FJ563847 FJ562488 Chase 83166 (K) (Schltr.) Hoehne AF239433 EU490776 Whitten 97020 (FLAS) sp. FJ564977 FJ563642 Whitten 1618 FLAS Sauvetrea chicana (Dodson) M.A.Blanco DQ461813 KF660516 Whitten 3187 (QCA) Sauvetrea chicana (Dodson) M.A.Blanco KF660299 KF660521 Whitten 3338 (FLAS) Sauvetrea (Lindl.) M.A.Blanco DQ210832 KF660433 Whitten 2358 (FLAS) Schlimmia alpina Rchb.f. & Warsz. KF660300 KF660345 Bennett 5130 (MOL) Schlimmia stevensonii Dodson AF239463 KF660343 Whitten 94107 (FLAS) Scuticaria hadwenii (Lindl.) Planch. AF239424 KF660370 Whitten 97109 (FLAS) Scuticaria salesiana Dressler DQ210875 KF660447 Whitten 2478 (FLAS) herrenhusana Jenny AF239453 KF660336 Whitten 93010 (FLAS) Soterosanthus shepheardii (Rolfe) Jenny AF239457 EU490784. Dodson 18580-3 (FLAS) Stanhopea anfracta Rolfe AF239450 KF660511 Whitten 3022 (FLAS) Stanhopea annulata Mansf. AF239444 EU490786 Whitten 87242 (FLAS) Stanhopea cirrhata Lindl. AF239464 KF660360 Whitten F1296 (FLAS) Stanhopea confusa G.Gerlach & Beeche AF239449 KF660359 Whitten 94006 (FLAS) Stanhopea ecornuta Lem. AF239445 KF660362 Whitten 90026 (FLAS) Stanhopea pulla Rchb.f. AF239451 KF660361 Whitten 93117 (FLAS) Stanhopea Bateman ex Lindl. FJ564736 FJ563222 Whitten 3585 FLAS Stenia Dodson & D.E.Benn. AY869920 KF660392 Whitten 1698 (FLAS) Stenia calceolaris (Garay) Dodson & D.E.Benn. AY869919 KF660394 Whitten 1699 (FLAS) Stenotyla lankesteriana (Pupulin) Dressler AY869962 KF660383 Dressler 6363 (FLAS) Stenotyla lendyana (Rchb.f.) Dressler AY869963 KF660381 Dressler 6228 (FLAS) Stenotyla picta (Rchb.f.) Dressler AY869961 KF660395 Dressler 6235 (FLAS) Sudamerlycaste ciliata (Ruiz & Pav.) Archila KF660301 KF660495 Whitten 2877 (FLAS) hystrix (Dodson) N.H.Williams & Dressler DQ315899 FJ563601 Whitten 1824 (FLAS) parvulus C.Schweinf. DQ315909 FJ563574 Whitten 99259 (FLAS) Rchb.f. AF239488 FJ562506 Chase O-123 (K) Tolumnia (C.Wright ex Griseb.) N.H.Williams & Ackerman FJ565132 FJ563801 Whitten 3358 FLAS Tolumnia pulchella (Hook.) Raf. FJ564820 FJ563411 Whitten 3499 (FLAS) Trevoria (Schltr.) Garay KF660302 KF660324 Dodson 17309 (MO) Trichocentrum jonesianum (Rchb.f.) M.W.Chase & N.H.Williams AF350653 FJ562496 Chase 86118 (K) Trichocentrum luridum (Lindl.) M.W.Chase & N.H.Williams FJ564957 FJ563449 Carnevali 6243 (CICY) Trichoceros antennifer (Humb. & Bonpl.) Kunth FJ564953 FJ563612 Whitten 1803 (FLAS) acuminatum Bateman ex Lindl. DQ210640 KF660358 Koehler 363 (UEC) acuminatum Bateman ex Lindl. DQ210867 KF660442 Whitten 2442 (FLAS) Bateman ex Lindl. DQ210714 KF660356 Koehler 317 (UEC) Bateman ex Lindl. DQ210730 KF660357 Koehler 361 (UEC) Rchb.f. ex Benth. & Hook.f. DQ211041 KF660504 Whitten 2926 (FLAS)
PAGE 234
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.384 LANKESTERIANA TABLE 1. Continues. TaxonmatK ycf1 Voucher:Herbarium Rchb.f. DQ210713 KF660355 Koehler 315 (UEC) falcata Lindl. FJ563850 FJ563198 Chase O-129 (K) Dodson AF239473 KF660344 Vasquez s.n. (FLAS) discolor (Lindl.) Rchb.f. AY869959 KF660412 Whitten 1859 (FLAS) Rchb.f. AY869958 EU490794 Whitten s.n. (FLAS) wailesiana (Lindl.) E.Morren AY869960 KF660387 Gerlach 93-3314 (M) Warrea warreana (Lodd. ex Lindl.) C.Schweinf. AF239417 EU123798 Whitten 1752 (FLAS) (Rchb.f.) Benth. ex Rolfe DQ209970 KF660413 Whitten 2683 (FLAS) (Hook.) G.Nicholson AF239434 EU490795 Whitten 1876 (FLAS) Dodson AF239435 KF660380 Whitten 1881 (FLAS) maxillare Lodd. AY869996 FJ562864 Whitten 94103 (FLAS) tatei (Ames & C.Schweinf.) Garay & Dunst. AY869994 KF660409 Maguire & Politi 27494 (AMES)Zygopetalinae (Fig. 2). Our results are largely congruent with our previous study (Whitten et al. 2005) based on matK/trnL-F/ITS data, although there is less support for many genera. The nonmonophyly of Warczewiczella is unusual, and might be due to mislabeled DNA samples; resampling with new collections is needed. Relationships within Dichaea et al. (2009b). Subtribe Vargasiellinae consists of one genus with two poorly collected species, one from the tepuis of unable to obtain DNA of these taxa. Dressler (1993) included Vargasiella C.Schweinf. in Zygopetalinae but suggested it might warrant subtribal status. Romeroname and suggested that it should remain in its own subtribe pending better specimens and molecular data. Recent collections and DNA sequences of Vargasiella peruviana C.Schweinf. place it with high support in Zygopetalinae in an unresolved clade with Warrea warreana (Lodd. ex Lindl.) C.Schweinf. and Warreopsis et al., in press; M. Kolanowska, pers. comm.). Vargasiella is sister to Warrea Dresslers intuition (Dressler 1993) regarding its subtribal position; therefore, Vargasiellinae should not Coeliopsidinae (Fig. 3). Our sampling included one species of each of the three genera comprising this small subtribe. The subtribe is highly supported but weakly sister to Stanhopeinae in agreement with Whitten et al. (2000). Stanhopeinae (Fig. 3). Although the circumscription of generic boundaries within this subtribe are highly subtribe has the lowest BS support (87%). The odd monotypic Braemia vittata (Lindl.) Jenny is sister to all other genera. These data are highly congruent with the trees of Whitten et al. (2000), but the placement of Sievekingia requires more study. In the Whitten et al. (2000) analyses based upon matK/trnL-F/ nrITS, Sievekingia is strongly sister to Coryanthes. In the plastid matK/ycf1 trees, the single sample of Sievekingia Stanhopea (creating a paraphyletic Stanhopea). More extensive sampling with nuclear and plastid regions is needed to resolve this, because it appears to be one of trees in Cymbidieae. One possible source of error within the Stanhopea/Coryanthes/Sievekingia clade is from missing data in ycf1 for Coryanthes; the 3720F primer did not amplify for Coryanthes; consequently, about half of the ycf1 sequence data are missing for Coryanthes species. Maxillariinae (Figs. 4, 5). Relationships within Maxillariinae were addressed in greater detail by Whitten et al. (2007), Blanco et al. (2007; 2008), and Blanco (2013) based upon a larger taxon sampling of matK/nrITS1&2/atpB-rbcL spacer. Our sampling with matK/ycf1 was smaller (119 taxa vs. over 600),
PAGE 235
WHITTEN et al. Generic and subtribal relationships in Neotropical Cymbidieae385LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. 0.02 Brassia aurantiaca Polyotidium huebneri Fernandezia sanguinea Cymbidium devonianum Erycina pusilla Otoglossum globuliferum 1 Ornithocephalus inflexus Dressleria helleri Telipogon parvulus Eulophia guineensis Oeceoclades maculata Trichoceros antennifer Cyrtochilum serratum Telipogon pognonostalix Trizeuxis falcata Catasetum expansum Miltonia regnellii Cycnoches pachydactylon Oncidium sphacelatum Psychopsiella limminghei Otoglossum globuliferum 2 Tolumnia gundlachii Hintonella mexicana Comparettia macroplectron Oncidium weinmannianum Cycnoches cooperi Grandiphyllum robustissimum Dressleria dilecta Trichocentrum luridum Cycnoches manoelae Oncidium cirrhosum Rossioglossum krameri Lockhartia amoena Dressleria fragrans Trichocentrum jonesianum Clowesia dodsoniana Tolumnia pulchella Chytroglossa marileoniae Ornithocephalus dalstroemii 1 Ornithocephalus dalstroemii 2 Fernandezia tica Notyliopsis beatricis Cycnoches lehmannii Galeandra devoniana Polystachya cultriformis Cyrtopodium andersonii Cyrtopodium flavum Psychopsis sanderae Dipteranthus grandiflorus Eulophia petersii Cischweinfia pusilla Fernandezia cuencae Cyrtopodium longibulbosum Telipogon hystrix Comparettia falcata Brassia jipijapensis100 87 100 100 100 97 90 84 100 75 100 89 96 100 100 95 100 100 98 100 100 100 100 90 98 100 100 100 99 100 100 100 100 96 100 100 100 100 100 82 100 100 100Maxillariinae (Fig. 4 & 5) Stanhopeinae (Fig. 3) Coeliopsidinae (Fig. 3) Zygopetalinae (Fig. 2) Eriopsidinae (Fig. 2)100 Oncidiinae CyrtopodiinaeCatasetinaeEulophiinae Cymbidiinae FIGURE 1. Best ML tree with bootstrap values added, showing Cymbidiinae, Eulophiinae, Catasetinae, Cyrtopodiinae, and Oncidiinae.but the two data sets recovered the same major clades, supporting the generic concepts presented by Blanco et al. (2007). Our sampling included two individuals of several species; in each pair, there are nucleotide differences separating the two, indicating that ycf1/ matK is often capable of resolving not only closely Several taxa not present in the 2007 sampling were added to this study. These include Cryptocentrum Carnevali and Maxillaria cacaoensis J.T.Atwood. an anomalous species with large pseudobulbs, is placed within Cryptocentrum with 100% BS support (Fig. 5). Maxillaria cacaoensis to be a member of the Camaridium cucullatum (Lindl.) M.A.Blanco clade (=Psittacoglossum La Llave & Lex., but DNA samples of this rare taxon became available only recently. Maxillaria
PAGE 236
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.386 LANKESTERIANA 0.02 Daiotyla albicans Dichaea eligulata Chondrorhyncha rosea Benzingia cornuta Chondroscaphe laevis Chaubardiella pubescens Chaubardia klugii Eriopsis biloba 2 Pescatoria lawrenciana Pescatoria pulvinaris Benzingia estradae Huntleya wallisii Chondrorhyncha hirtzii 1 Pescatoria coronaria Aganisia pulchella Chondroscaphe eburnea Warczewiczella marginata Koellensteinia graminea Chondroscaphe amabilis Cryptarrhena lunata Cochleanthes flabelliformis Kefersteinia microcharis Galeottia ciliata Chaubardia surinamensis Batemannia lepida Promenaea stapelioides Pescatoria lehmannii Stenotyla picta Pescatoria cerina Kefersteinia trullata Chondrorhyncha hirtzii 2 Warczewiczella discolor Kefersteinia maculosa Benzingia reichenbachiana Chaubardiella tigrina Eriopsis biloba 1 Benzingia hajekii Stenotyla lendyana Stenia bismarkii Chondroscaphe flaveola Galeottia colombiana Stenotyla lankesteriana Promenaea xanthina Eriopsis biloba 3 Otostylis lepida Cryptarrhena guatemalensis Zygopetalum maxillare Stenia calceolaris Polystachya cultriformis Kefersteinia excentrica Chaubardiella subquadrata Galeottia burkei Pescatoria lamellosa Dichaea fragrantissima Ixyophora viridisepala Neogardneria murrayana Aetheorhyncha andreetae Otostylis paludosa Warczewiczella wailesiana Dichaea trulla Dichaea panamensis Warrea warreana Aganisia fimbriata Zygosepalum tatei89 84 99 100 100 98 100 96 100 85 100 100 100 89 100 100 100 100 100 100 100 100Oncidiinae (Fig. 1) Cyrtopodiinae (Fig. 1) Catasetinae (Fig. 1) Eulophiinae (Fig. 1) Cymbidiinae (Fig. 1)100 100 87 100Maxillariinae (Fig. 4 & 5) Stanhopeinae (Fig. 3) Coeliopsidinae (Fig. 3) Eriopsidinae Zygopetalinae FIGURE 2. Best ML tree with bootstrap values added, showing Eriopsidinae and Zygopetalinae.
PAGE 237
WHITTEN et al. Generic and subtribal relationships in Neotropical Cymbidieae387LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 3. Best ML tree with bootstrap values added, showing Coeliopsidinae and Stanhopeinae. Peristeria elata Coryanthes verrucolineata Kegeliella kupperi Stanhopea pulla Coryanthes elegantium Sievekingia reichenbachiana Gongora tridentata Stanhopea confusa Gongora portentosa 1 Cirrhaea seidelii Houlletia brocklehurstiana Kegeliella atropilosa Acineta chrysantha Gongora armeniaca 1 Gongora sphaerica Houlletia sanderi Trevoria zahlbruckneriana Vasqueziella boliviana Braemia vittata Houlletia odoratissima Gongora escobariana Schlimmia stevensonii Gongora hirtzii Houlletia tigrina Stanhopea annulata Stanhopea tigrina Schlimmia alpina Lycomormium fiskei Gongora ilense Acineta superba Gongora portentosa 2 Embreea herrenhusana Embreea rodigasiana Coeliopsis hyacinthosma Gongora seideliana Paphinia clausula Soterosanthus shepheardii Paphinia neudeckeri Stanhopea ecornuta Lacaena spectabilis Gongora amparoana Lueddemannia pescatorei Horichia dressleri Stanhopea anfracta Polycycnis gratiosa 2 Cirrhaea fuscolutea Polycycnis gratiosa 1 Gongora armeniaca 2 Stanhopea cirrhata Lueckelia breviloba Coryanthes macrantha100 100 100 99 95 94 96 87 100 100 100 100 100 100 97 98 100 100 78 100 100 90 100 100 100 100 100 78 87 100 100 100Coeliopsidinae Zygopetalinae (Fig. 2) Eriopsidinae (Fig. 2) Maxillariinae (Fig. 4 & 5) Stanhopeinae100 0.02 Polystachya cultriformis100 100 100 100 100Oncidiinae (Fig. 1) Cyrtopodiinae (Fig. 1) Catasetinae (Fig. 1) Eulophiinae (Fig. 1) Cymbidiinae (Fig. 1) cacaoensis is sister to C. cucullatum in our ycf1/ matK trees (Fig. 5), and requires a new combination in Camaridium. It was erroneously transferred to Mapinguari et al. (2012). Morphologically, it resembles a dwarf C. cucullatum, and the capsule has apical dehiscence, a trait shared by all Camaridium species for which we have observed mature fruits. Based upon these molecular and morphological data, we transfer this species to Camaridium.
PAGE 238
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.388 LANKESTERIANA FIGURE 4. Best ML tree with bootstrap values added, showing basal portion of Maxillariinae. Hylaeorchis petiolaris Scuticaria hadwenii Ornithidium multicaule Heterotaxis santanae Heterotaxis violaceopunctata Nitidobulbon nasutum Bifrenaria tyrianthina Heterotaxis crassifolia Ornithidium coccineum Guanchezia maguirei Heterotaxis equitans Rudolfiella saxicola Sudamerlycaste fimbriata Xylobium pallidiflorum Ornithidium canarensis Ornithidium fulgens Lycaste aromatica Rudolfiella sp. Xylobium zarumense Ornithidium donaldeedodii Anguloa hohenlohii Bifrenaria inodora Scuticaria salesiana Heterotaxis maleolens Ornithidium aggregatum Ornithidium giganteum Anguloa uniflora Ornithidium serrulatum Neomoorea wallisii Xylobium leontoglossum Bifrenaria tetragona Nitidobulbon proboscideum Ornithidium sophronitis Heterotaxis valenzuelana77 100 100 100 100 100 90 99 100 100 100 100 94 100 100 99 100 100Zygopetalinae (Fig. 2) Eriopsidinae (Fig. 2)100 0.02 Polystachya cultriformis100 100 100 100 100Oncidiinae (Fig. 1) Cyrtopodiinae (Fig. 1) Catasetinae (Fig. 1) Eulophiinae (Fig. 1) Cymbidiinae (Fig. 1) 87 100Stanhopeinae (Fig. 4) Coeliopsidinae (Fig. 3) remainder of Maxillariinae (Fig. 5) Maxillariinae (in part)100 98 Camaridium cacaoense (J.T.Atwood) Whitten, comb. nov. Basionym: Maxillaria cacaoensis J.T.Atwood, Selbyana 19(2):254. 1999 (1998, pub. 1999). Mapinguari cacaoense Biodiv. Res. Conservation 25:30. 2012, syn. nov. The Whitten et al. (2007) and Blanco et al. (2007) analyses of nrITS/matKtrnK/atpB-rbcL spacer for et al. nrITS matrix that is largely congruent (though less resolved) than the Whitten et al. trees. The resulting proposed by Blanco et al. (2007) but splits many of them to increase the number of genera from 17 to 37. A detailed, genus-by-genus critique of the et al. the scope of this paper, but we reject the generic coworkers reject monophyly as a criterion for generic rank; therefore, many of their genera are paraphyletic
PAGE 239
WHITTEN et al. Generic and subtribal relationships in Neotropical Cymbidieae389LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGURE 5. Best ML tree with bootstrap values added, showing remainder of Maxillariinae. Peristeria elata Coryanthes verrucolineata Kegeliella kupperi Stanhopea pulla Coryanthes elegantium Sievekingia reichenbachiana Gongora tridentata Stanhopea confusa Gongora portentosa 1 Cirrhaea seidelii Houlletia brocklehurstiana Kegeliella atropilosa Acineta chrysantha Gongora armeniaca 1 Gongora sphaerica Houlletia sanderi Trevoria zahlbruckneriana Vasqueziella boliviana Braemia vittata Houlletia odoratissima Gongora escobariana Schlimmia stevensonii Gongora hirtzii Houlletia tigrina Stanhopea annulata Stanhopea tigrina Schlimmia alpina Lycomormium fiskei Gongora ilense Acineta superba Gongora portentosa 2 Embreea herrenhusana Embreea rodigasiana Coeliopsis hyacinthosma Gongora seideliana Paphinia clausula Soterosanthus shepheardii Paphinia neudeckeri Stanhopea ecornuta Lacaena spectabilis Gongora amparoana Lueddemannia pescatorei Horichia dressleri Stanhopea anfracta Polycycnis gratiosa 2 Cirrhaea fuscolutea Polycycnis gratiosa 1 Gongora armeniaca 2 Stanhopea cirrhata Lueckelia breviloba Coryanthes macrantha100 100 100 99 95 94 96 87 100 100 100 100 100 100 97 98 100 100 78 100 100 90 100 100 100 100 100 78 87 100 100 100Coeliopsidinae Zygopetalinae (Fig. 2) Eriopsidinae (Fig. 2) Maxillariinae (Fig. 4 & 5) Stanhopeinae100 0.02 Polystachya cultriformis100 100 100 100 100Oncidiinae (Fig. 1) Cyrtopodiinae (Fig. 1) Catasetinae (Fig. 1) Eulophiinae (Fig. 1) Cymbidiinae (Fig. 1) or polyphyletic as plotted onto any molecular or morphological tree and are based on idiosyncratically vegetative), often without molecular data or with contradicting molecular evidence. Many of their new genera consist of one or two morphologically odd species embedded within larger genera [e.g., Marsupiaria Hoehne = Heterotaxis valenzuelana (A.Rich.) Ojeda & Carnevali; Vazquezella Heterotaxis
PAGE 240
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.390 LANKESTERIANAequitans (Schltr.) Ojeda & Carnevali; Chrysocycnis Linden & Rchb.f., Anthosiphon Schltr., Hoehnella Rhetinantha witseniodes (Schltr.) M.A.Blanco; Pseudocymbidium Maxillaria lueri Dodson]. Other genera are composed of 15 or more species that are monophyletic but are embedded within other genera (e.g. Calawaya Maxillaria Pav.). Camaridium Lindl. is split into at least eight genera. Some segregates (e.g., Chaseopsis & Sitko) are based solely upon morphological traits and include species that were not included in either molecular study [e.g., Camaridium burgeri (J.T.Atwood) M.A.Blanco]. Their circumscription of Chaseopsis omits taxa that are sister to the generitype generic characters ( Ames, F.T.Hubb. & C.Schweinf. = Camaridium ramonense (Schltr.) M.A.Blanco; Maxillaria lankesteri Ames = Camaridium aurantiacum (Schltr.) M.A.Blanco). The et al. are easily suited to production of dichotomous keys, because any morphologically anomalous species are automatically placed into another genus. Because there is no objective basis for selecting critical without merit. Conclusions The matK/ ycf1 data produce trees that are highly 5 Genera Orchidacearum. Most subtribes have high bootstrap support, and generic relationships are congruent with previous molecular studies. In comparison to plastid intron/spacer regions (e.g., trnL-F, atpB-rbcL), these coding regions can be taxonomic groups (e.g., tribes), especially if they are aligned using amino acid translations. This combination also appears capable of providing species-level discrimination in some genera, although more detailed sampling is needed to evaluate this fully. In terms of sequencing ease and cost effectiveness vs. phylogenetic resolution, the combination of matK/ ycf1 within Orchidaceae. Nevertheless, these plastid trees fail to provide resolution and support of relationships among subtribes. Givnish et al. plastomes to estimate phylogenetic relationships among 39 orchid taxa. Although only a few subtribes of Cymbidieae were represented in their data set, subtribal relationships were still unresolved. Their results imply that the addition of more plastid genes with the objective of resolving these nodes may be futile and that these relationships will only be resolved by the addition of nuclear data sets. Clearly, much more data are needed before we fully understand the patterns of evolution within Cymbidieae. We hope to add more representatives of Cymbidiinae, Eulophiinae, and Catasetinae. Catasetinae might provide an excellent system for Catasetum, Cycnoches, Clowesia, Dressleria, Mormodes are sister to Galeandra Grobya and to Cyanaeorchis, with unknown pollinators. methods to estimate the age of subtribes within et al. limited taxon sampling that was biased towards androeuglossophilous taxa. Our more complete sampling of generic relationships based on more sequence data might warrant reexamination of these age estimates. ACKNOWLEDGMENTS We thank Gnter Gerlach (Munich Botanical Garden), Ron Determann, Becky Brinkman (Atlanta Botanical Garden), Gustavo Romero (AMES), Andy and Harry Phillips (Andys Orchids) and the Portilla family (Ecuagenera) for generous access and help in obtaining specimens and vouchers. Lorena Endara provided valuable assistance in Ecuador, and Mario Blanco and Robert Dressler (Lankester Garden) provided specimens and valuable discussions. Kent Perkins was invaluable in accessioning and imaging specimens. Marta Kolanowska generously shared unpublished information on the placement of Vargasiella. Alec Pridgeon provided valuable criticisms and edits. We thank Savita Shanker and Patrick Thimote at the Interdisciplinary Center for Biotechnology Research at UF for DNA sequencing services.
PAGE 241
WHITTEN et al. Generic and subtribal relationships in Neotropical Cymbidieae391LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Batista, J. A. N., A. C. M. Mota, K. Proite, L. de Bem Bianchetti, In press. Molecular phylogenetics of Cyanaeorchis (Cymbidieae, Epidendroideae,Orchidaceae) and a new species from the cerrado of central and southeastern Blanco, M., G. Carnevali, W. M. Whitten, R. B. Singer, S. Koehler, N. H. Williams, I. Ojeda, K. Neubig, and L. Endara. 2007. Generic realignments in Maxillariinae (Orchidaceae). Lankesteriana 7:515-537. Blanco, M. A. 2013. New combinations and synonyms in the Maxillariiinae (Orchidaceae). Selbyana 31:52-59. Blanco, M. A., G. Carnevali, W. M. Whitten, R. B. Singer, S. Koehler, N. H. Williams, I. Ojeda, K. M. Neubig, and L. Endara. 2008. Generic realignments in Maxillariinae (Orchidaceae): Corrigenda et addenda. Lankesteriana 8:15. Chase, M. W., K. M. Cameron, R. L. Barrett, and J. V. Freudenstein. 2003. DNA data and Orchidaceae 69 in Orchid Conservation (K. W. Dixon, S. P. Kell, R. L. Barrett, and P. J. Cribb, eds.). Natural History Publications, Kota Kinabalu, Sabah, Malaysia. Dressler, R. L. 1981. The Orchids: Natural History and Massachusetts, USA. Orchid Family. Dioscorides Press, Portland, Oregon, USA. Edgar, R. 2004. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. doi:10.1186/1471-2105-5-113. BMC Bioinformatics 5: 113. Freudenstein, J. V., C. van den Berg, D. H. Goldman, P. J. Kores, M. Molvray, and M. W. Chase. 2004. An expanded plastid DNA phylogeny of Orchidaceae and analysis of jackknife branch support strategy. American Journal of Botany 91:149-157. Givnish, T. J., M. Ames, S. P. Lyon, K. M. Cameron, K. M. Neubig, W. M. Whitten, M. K. Arroyo, J. LeebensMack, M. A. Clemets, and N. H. Williams. Year. The 39 Steps: A plastome phylogeny for orchid tribes, with implications for the evolution of epiphytism, CAM in Monocots V: 5th International Conference on Comparative Biology of Monocotyledons, New York Botanical Gardens:48-49. Grniak, M., O. Paun, and M. W. Chase. 2010. Phylogenetic relationships within Orchidaceae based on a low-copy nuclear coding gene, Xdh: Congruence with organellar and nuclear ribosomal DNA results. Molecular Phylogenetics and Evolution 56:784-795. Koehler, S., N. H. Williams, W. M. Whitten, and M. D. E. do Amaral. 2002. Phylogeny of the Bifrenaria (Orchidaceae) complex based on morphology and sequence data from nuclear rDNA internal transcribed spacers (ITS) and chloroplast trnL-trnF region. International Journal of Plant Sciences 163:1055-1066. Monteiro, S. H. N., A. Selbach-Schnadelbach, R. P. d. Oliveira, and C. van den Berg. 2010. Molecular phylogenetics of Galeandra (Orchidaceae: Catasetinae) based on plastid and nuclear DNA Sequences. Systematic Botany 35:476-486. Neubig, K. M., W. M. Whitten, B. S. Carlsward, M. A. Blanco, L. Endara, N. H. Williams, and M. Moore. 2009a. Phylogenetic utility of ycf1 in orchids: a plastid gene more variable than matK. Plant Systematics and Evolution 277:75-84. Neubig, K. M., W. M. Whitten, N. H. Williams, M. A. Blanco, L. Endara, J. G. Burleigh, K. Silvera, J. C. Cushman, and M. W. Chase. 2012. Generic recircumscriptions of Oncidiinae (Orchidaceae: Cymbidieae) based on maximum likelihood analysis of combined DNA datasets. Botanical Journal of the Linnean Society 168:117-146. Neubig, K. M., N. H. Williams, W. M. Whitten, and F. Pupulin. 2009b. Molecular phylogenetics and the evolution of fruit and leaf morphology of Dichaea (Orchidaceae: Zygopetalinae). Annals of Botany 104:457-467. Osmophore and elaiophores of Grobya amherstiae (Catasetinae, Orchidaceae) and their relation to pollination. Botanical Journal of the Linnean Society 159:408-415. Pridgeon, A. M., and M. W. Chase. 1998. Phylogenetics of subtribe Catasetinae (Orchidaceae) from nuclear and chloroplast DNA sequences. Pages pp. 275-281 in Proceedings of the 15th World Orchid Conference (C. E. de Britto Pereira, ed.) Naturalia Publications, Turriers, France. Pridgeon, A. M., P.J. Cribb, M. W. Chase, and F.N. Rasmussen. 2009. Genera Orchidacearum Volume 5 Epidendroideae (Part Two). Oxford University Press, Inc., New York. Rambaut, A. 1996. Se-Al: Sequence Alignment Editor. Available at Rambaut, A. 2013. FigTree, version 1.4.0. Goldman-Huertas, N. D. Tsutsui, and N. E. Pierce. plant-pollinator mutualism. Science 333:1742-1746. LITERATURE CITED
PAGE 242
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.392 LANKESTERIANAReis, M. G., A. D. de Faria, V. Bittrich, M. D. E. Amaral, rewards Oncidium (Orchidaceae). Journal Of The Reappraisal of subtribe Vargasiellinae (Maxillarieae, Orchidaceae). Novon 3:79-80. Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. Miller, K. C. Siripun, C. T. Winder, E. E. Schilling, and R. L. Small. 2005. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot. 92:142-166. Stamatakis, A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:26882690. Swofford, D. L. 2003. PAUP*: Phylogenetic Analysis Using Parsimony (*and other methods), version 4.0b10. Sinauer. Ejsmont. 2012. Taxonomy of the subtribe Maxillariinae (Orchidaceae, Vandoideae) revised. Biodiversity Research and Conservation 25:13-38. Institute of Botany, Polish Academy of Sciences, Krakw, Poland. press. Taxonomic position of the genus Vargasiella (Orchidaceae, Vandoideae) based on molecular and morphological evidence. Molecular Phylogenetics and Evolution. Whitten, M. W., N. H. Williams, R. L. Dressler, G. Gerlach, and F. Pupulin. 2005. Generic relationships of Zygopetalinae (Orchidaceae: Cymbideae): Combined molecular evidence. Lankesteriana 5:87-107. Whitten, W. M., M. A. Blanco, N. H. Williams, S. Koehler, G. Carnevali, R. B. Singer, L. Endara, and K. M. Neubig. 2007. Molecular phylogenetics of Maxillaria and related genera (Orchidaceae: Cymbidieae) based on combined molecular data sets. American Journal of Botany 94:1860-1889. Whitten, W. M., N. H. Williams, and M. W. Chase. 2000. Subtribal and generic relationship of Maxillarieae (Orchidaceae) with emphasis on Stanhopeinae: combined molecular evidence. American Journal of Botany 87:1842-1856.
PAGE 243
LANKESTERIANA 13(3) January 2014R E G U L A R P A P E R S
PAGE 245
The genus Odontoglossum Kunth (treated by some authors as Oncidium), has revealed miscellaneous new species in recent time. Some are rather similar to closely related taxa while others show surprisingly diminutive Oncidium koechlinianum Collantes & G.Gerlach (2011), which was transferred to Odontoglossum by Dalstrm (2012a, where valid reasons for maintaining the taxonomic status of the performed by the authors and others also show that an elevated taxonomic status, such as Odontoglossum furcatum Dalstrm (2012b), and the species published here. Odontoglossum auroincarum Psp. nov. TYPE: Peru. Cusco. Alfamayo, ca. 2600 m, S 13 03.647; W 72 24.351, Dec. 3, 2011. S. Dalstrm 3594 (holotype, USM). F IGS. 1, 2A, 2A1, 2A2, 3, 4). DIAGNOSIS: Odontoglossum auroincarum is similar to O. epidendroides Kunth (Figs. 2E, 2E1, 2E2, 5), but ca. 101 mm long versus 13 14 mm), and differently curved column with shorter wings. It differs from O. cruentum Rchb.f., ( FIGS. 2B, 2B1, 2B2, 6), and O. juninense Schltr. ( FIGS 2D, 2D1, 2D2, 7), by a broader and more rectangular column wings as well as a less lobulate anther-cap. Epiphytic herb. Pseudobulbs caespitose, ancipitous, ovoid to pyriform, glossy, bifoliate, 4 7 cm, surrounded basally by 5 to 7 distichous sheaths, the uppermost foliaceous. Leaves subpetiolate, conduplicate, elongate elliptic to slightly obovate, acuminate 27 2.5.0 cm. axillary from the uppermost sheaths, erect to arching, Pedicel with ovary 2.0 2.5 cm long. Floral bracts appressed, scalelike to ca. 1 cm long. Flower relatively large and showy, stellate; dorsal sepal dark yellow with large irregular red-brown spotting, cuneate, ovate laminate, acuminate and slightly oblique, ca. 35 101 mm; lateral sepals similar in color, slightly unguiculate, ovate laminate, acuminate, slightly oblique, ca. LANKESTERIANA 13(3): 395. 2014.ODONTOGLOSSUM (ORCHIDACEAE: STIG DALSTRM 1,3 & SAUL RUZ PREZ 2 1 2304 Ringling Boulevard, unit 119, Sarasota FL 34237, U.S.A. Lankester Botanical Garden, University of Costa Rica, Cartago, Costa Rica and National Biodiversity Centre, Serbithang, Bhutan2Allamanda 142, Surco, Lima 33, Peru3Corresponding author: stigdalstrom@juno.com ABSTRACT. Plants of a colorful Odontoglossum were recently found by separate parties in the Cusco region of Odontoglossum epidendroides, independently by both from the similar O. cruentum and O. juninense by morphological features of the column, such as the lateral callus structure on the lip. Our new species is also distinguished from the rather similar O. epidendroides by KEY WORDS : Orchidaceae, Oncidiinae, Odontoglossum, new species, Cusco, Peru, taxonomy
PAGE 246
FIGURE 1. Odontoglossum auroincarum. A Plant habit. B Column and lip, lateral view. C Lip, frontal view. D Column, lateral and ventral views. E Anther cap, dorsal view, and pollinarium, lateral and back views. F Flower dissected. Drawn from holotype by Stig Dalstrm. LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.396 LANKESTERIANA
PAGE 247
Figure 2. A. Odontoglossum auroincarum, (S. Dalstrm 3594, USM), column lateral view. A1. Anther cap dorsal view. A2. Pollinarium lateral and back views. B. Odontoglossum cruentum (S. Dalstrm 481, SEL), column lateral view. B1. Anther cap dorsal view. B2 Pollinarium lateral and back views. C. Odontoglossum subuligerum (S. Dalstrm 3611, USM), column lateral view. C1. Anther cap dorsal view. C2. Pollinarium lateral and back views. D. Odontoglossum juninense (S. Dalstrm 2378, Dalstrm archives), column lateral view. D1. Anther cap dorsal view. D2. Pollinarium lateral and back views. E. Odontoglossum epidendroides (S. Dalstrm 3282, USM), column lateral view. E1. Anther cap dorsal view. E2. Pollinarium lateral and back views. Drawn by Stig Dalstrm. DALSTRM & RUZ PREZ A new Odontoglossum from the Cusco region 397LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 248
33 101 mm; petals similar in color, broadly unguiculate, ovate laminate, acuminate, oblique, ca. 27 8 mm; lip similar in color, adnate to the basal ca. 2.0.5 mm, then free and strap-like for ca. 1 mm, apical portion angled downwards into a large, pandurate lamina, with serrate to lacerate frontlobes, and a folded, canaliculate, apiculate apex, ca. 17 7 mm; callus the base to ca. one third of the length of the lamina, terminating in a shallowly canaliculate, raised ridge, ending with several pairs of acute, projecting angles, with a larger, erect, irregular, denticulate knob, and 3 keels; column pale greenish white with some minor brown ventral dots, erect and straight for ca. 2/3 of its length, then curved towards the lip, ventrally canaliculate, basally micro-pubescent, with distinct ventral angles below the stigma, which is covered laterally by a pair of almost rectangular, serrate wings, ca. 101 mm long; anther cap pale yellow, campanulate, rostrate, with a minute and low apical lobule; pollinarium of two pyriform, cleft/folded pollinia on a yellow colored, almost rectangular, ca. 1.8 mm long stipe, on a hooked and pulvinate viscidium. OTHER MATERIAL STUDIED : Peru. Cusco, Urubamba, Machu Picchu, collected in the Machu Picchu Sanctuary and cultivated in the garden of the INKATERRA Machu Picchu Pueblo Hotel, photo by Benjamn Collantes in Orquideas en INKATERRA Machu Picchu Pueblo Hotel (Collantes et al. 2007). D ISTRIBUTION: Known only from the cloud forests of Alfamayo, and from the Machu Picchu sanctuary in the Urubamba region of Cusco, central Peru. E TYMOLOGY: The name refers to the golden yellow botanical Inca gold, which comes from the area in Peru that once was the center of the powerful Inca culture. Odontoglossum auroincarum were collected within the borders of the Machu Picchu sanctuary by the staff of the INKATERRA hotel. Plants were replanted in the orchid garden of were then taken by Benjamn Collantes and published, labeled Odontoglossum epidendroides (Collantes et al. 2007). A few years later, plants were found in the Alfamayo region by the second author of this paper, and brought into cultivation for propagation. be O. epidendroides, but with some question marks. be made, which was compared with drawings of similar species. The conclusion was that a new and attractive species had been discovered. Although features of the column and lip structure as well as the anther and pollinarium are quite distinct and display FIGURE 3. Odontoglossum auroincarum, plant habit. Photo by Stig Dalstrm. FIGURE 4. Odontoglossum auroincarum Photo by Stig Dalstrm.LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.398 LANKESTERIANA
PAGE 249
a combination of characteristics that create a unique Odontoglossum is O. subuligerum Rchb.f. (Figs. 2C, 2C1, 2C2, 8) which is easily distinguished by the large knob on the anther cap and by the extremely narrow pollinarium stipe. A CKNO W LEDGEMENTS. The authors wish to thank the staff at the Instituto Recursos Naturales (INRENA), and Betty Milln at the Universidad de San Marcos, Museo de Historia Natural, Lima, for aiding in providing the necessary collecting permits. We also thank Wesley Higgins for commenting on the manuscript, Steve Beckendorf, Guido and Karel Deburghgraeve for together with his staff and family in Lima for gracious logistic support. LITERATURE CITED Collantes, B., C. Soto & J. Koechlin. 2007. Orchids Orqudeas en INKATERRA Machu Picchu Pueblo Hotel. Inkaterra Asociacin, Lima, Per aus Machu Picchu (Peru) aus der Subtribus Oncidiinae. OrchideenJournal (2): 79-81. Dalstrm, S. 2012a. New combinations in Odontoglossum (Orchidaceae: Oncidiinae) and a solution to a taxonomic conundrum. Lankesteriana 12(1): 53. Dalstrm, S. 2012b. A well-known but previously Odontoglossum (Orchidaceae: Oncidiinae) from Ecuador. Lankesteriana 12(3): 155. FIGURE 5. Odontoglossum epidendroides Photo by Stig Dalstrm. FIGURE 6. Odontoglossum cruentum Photo by Stig Dalstrm. FIGURE 7. Odontoglossum juninense Photo by Stig Dalstrm. FIGURE 8. Odontoglossum subuligerum, Chapare, Bolivia, DALSTRM & RUZ PREZ A new Odontoglossum from the Cusco region 399LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 250
LANKESTERIANA
PAGE 251
In the accompanying text to the plate of Odontoglossum wattianum Rolfe, which was published in Reichenbachia (Sander 1892), we can read: It is a great thing now-a-days to be able to introduce species of Odontoglossums absolutely new to science. Years ago, when the wilds of Columbia were more untrodden novelties in Odontoglossums. This quote illustrates an often heard opinion about Odontoglossum (treated as Oncidium by some authors, see below). Even today experienced orchid hunters seem to think that there is not much more to discover when it comes to this attractive genus. But this has been proven to be a hasty conclusion thanks to the discovery of several new species in later years (Dalstrm 1993, 1996, 1999, 2010, 2012b, 2013) although in honesty, it must be said that Odontoglossum taxonomy needs some special effort to be understood properly. This also appears to be one of the main reasons why genera Cochlioda Lindl., Odontoglossum Kunth, Sigmatostalix Rchb.f. and Solenidiopsis Senghas were transferred to Oncidium (Chase et al. 2008, 2009). This transfer may well have been allowed by molecular analysis but the argument that few people can separate an Odontoglossum from an Oncidium Sw., which has been heard in subsequent discussions, is not really true once you become more familiar with these plants. an alternative taxonomic treatment (Dalstrm 2012a), which explains why keeping a slightly enlarged genus Odontoglossum is preferable, and also how to separate this genus from Oncidium based on a combination of morphological, ecological and geographical characteristics. This is supported by the same molecular evidence used by Chase et al. (2009) in their transfer of Odontoglossum species to Oncidium. Another argument that has been heard in the debate about how to best treat these orchids is that many new names have to be created for various smaller groups of plants if we want to keep Odontoglossum as a valid genus. However, the only new names that eventually may have to be created concern two smaller groups of species (here referred to as the boothianum clade and the chrysomorphum clade respectively) that for some intriguing reasons are placed near the base of the larger Odontoglossum clade. In contrast to using this as an argument for lumping all concerned taxa into a large waste basket Oncidium, we believe that this is really a strong reason to do the opposite and further study placed where they are. Morphological analysis of the species in the O. boothianum and O. chrysomorphum clades show LANKESTERIANA 13(3): 401. 2014. ODONTOGLOSSUM (ORCHIDACEAE: ONCIDIINAE) FROM PERU STIG DALSTRM 1,3 & SAUL RUZ PREZ 2 1 2304 Ringling Boulevard, unit 119, Sarasota FL 34237, U.S.A. Lankester Botanical Garden, University of Costa Rica, Cartago, Costa Rica and National Biodiversity Centre, Serbithang, Bhutan2Allamanda 142, Surco, Lima 33, Peru3Corresponding author: stigdalstrom@juno.com ABSTRACT. A new species of Odontoglossum described, illustrated with a photograph and a line drawing, and compared with similar and presumably closely related species, such as O. epidendroides and O. juninense. The new species belongs to the Odontoglossum elongate base of the column, below the attachment of the strap-like lip-base. KEY WORDS : Oncidiinae, Odontoglossum, new species, Pasco, Peru, taxonomy
PAGE 252
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.402 LANKESTERIANA FIGURE 1. A Plant habit. B Column and lip lateral view. C Column lateral and ventral views. D Lip dorsal and frontal views. E Anther cap frontal view, and pollinarium ventral and lateral views. F Flower dissected. Drawn from the plant that served as holotype by S. Dalstrm.
PAGE 253
DALSTRM & RUZ PREZ A new Odontoglossum from Peru403LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.some interesting and distinctive features, such as the compressed, glossy and often purple-mottled, unifoliate pseudobulbs, that seem intermediate between some species of Odontoglossum sensu strictu, and species from some Oncidium sensu lato clades, (here referred to as species of Heteranthocidium Oncidium abortivum group). Some of the species in the chrysomorphum clade also produce aborted morphological similarities in the pollination apparatus (column, rostellum and pollinarium shapes primarily) to species in the Heteranthocidium complex. Since many Heteranthocidium species grow together and Odontoglossum species, while more typical Oncidium species do not, plausible, which may explain the origin and placement of this clade. Plants in the boothianum clade also show similar intermediate features and only marginally differ from the chrysomorphum clade. The fact that these two smaller groups occur one after the other near the base of the Odontoglossum clade may perhaps be the result from several occasions of ancient natural not be taken for anything other than just that at this time, but rather than to close the door (and settle the debate) to a deeper understanding of the evolution of these orchids, they should be seen as encouragements to further studies. Although many Odontoglossum species may combination of morphologic features such as the elongated column together with the extremely long which readily set it apart from its closest relatives; O. epidendroides Kunth (Fig. 3), and O. juninense. Schltr (Fig 4). sp. nov. Figs. 1. TYPE: Peru. Pasco: Exact locality unknown but recent observations suggest that the true origin is somewhere near the town of Oxapampa. The type G. Deburghgraeve 282 (holotype: W). Diagnosis: differs from the similar O. epidendroides Kunth (Fig. 3), and O. juninense Schltr. (Fig. 4), by the unique combination of the elongated column, ca. 1.7 cm long versus ca. 1.0.1 cm (O. epidendroides), and ca. 1 cm (O. juninense) together with the extremely long and devloped and shortly digitate to curved and spinose callus teeth for the others. Epiphytic herb. Pseudobulbs caespitose, oblong ovoid, bifoliate, ca. 5 8 2 cm, surrounded basally by 6 to 8 distichous sheaths, the uppermost foliaceous. Leaves subpetiolate, conduplicate, elongate elliptic to obovate, narrowly acute to shortly acuminate, 19 2.0.3 cm. 1 to 3, axillary from the base of the uppermost sheaths, arching to subpendent, racemes or loosely paniculate with few basal fewca. 60 cm long; bracts 0.5 1.3 cm long. Pedicel with ovary 2.5.5 cm long. Flower stellate to slightly campanulate and rather arachnoid; dorsal sepal yellow almost covered with large brown spots, subunguiculate, elliptic to ovate, acuminate, ca. 4.4 1.0 cm; lateral sepals similar in color, slightly obliquely elliptic, narrowly acute, ca. 4.5 1.1 cm; petals similar in color but less brown, obliquely elliptic, acuminate, ca. 3.8.0 1.0 cm; lip basally pale yellow with a large brown spot covering most of the lamina, and with a pale yellow to white of the column by a linear ca. 8 mm long claw/unguis, then free, developing very short, erect sidelobes, abruptly plicate and laminate, indistinctively cordate, obovate to oblong pandurate, apical part of lamina more canaliculate or convolute, acuminate, ca. 3.0 3.4 1.0 cm; callus glabrous keel, emerging from the base and extending to the lamina where it develops into a series of spreading, more or less falcate, narrowly denticulate to spinose, middle, with a small tooth in between; column basally pale green, then white with some brown marking near
PAGE 254
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.404 LANKESTERIANA FIGURE 2. G. Deburghgraeve 282). Photo: G. Deburghgraeve. FIGURE 3. plant habit (G. Deburghgraeve 282). Photo: G. Deburghgraeve.the apex, erect, clavate, straight for 3/4th of the length, then weakly curved towards the lip, canaliculate below the stigma, and with a pair of rather short, lacerate to palmate wings on each side of the stigma, ca. 1.7 cm long; anther cap white, more or less marked with brown, campanulate, rostrate, dorsally lobulate; pollinarium of two obovoid to pyriform, cleft/folded pollinia on an oblong-rectangular ca. 2.5 mm long stipe on a hooked, pulvinate viscidium. The type plant was originally imported to Europe as Odontoglossum epidendroides, or possibly O. juninense (the details were lost with time). The original then known Odontoglossum species. Due to legislative complications it has not yet been possible to deposit a type specimen in a Peruvian herbarium (USM) at this time. When, and if, the government of Peru establish this issue may be solved in a favorable way. ADDITIONAL RECORDS : Peru. Pasco (?): Exact origin unknown but probably from the area near Oxapampa,
PAGE 255
Dec. 2002, S. Dalstrm 2765 (color transparency in Dalstrm Archives). DISTRIBUTION : Recent observations suggest that this species is limited to seasonally wet cloud forests near the town of Oxapampa, Pasco, Peru, at approximate elevations of 2400 2500 m. ETYMOLOGY : The name refers to the extraordinarily ACKNOWLEDGEMENTS The authors thank Wesley Higgins for commenting on the manuscript, Guido Deburghgraeve for cultivating the type plant, and Manolo Arias together with his staff and family in Lima for gracious logistic support. The authors also thank the staff at the Instituto Recursos Naturales (INRENA) for aiding in providing necessary Universidad de San Marcos, Museo de Historia Natural, Lima, for supporting ongoing orchid research projects and making herbarium material available for studies. LITERATURE CITED Chase, M. W., N. H. Williams, K. M. Neubig & W. M. Whitten. 2008. Taxonomic transfers in Oncidiinae to accord with Genera Orchidacearum vol. 5. Lindleyana in Orchids (West Palm Beach) 77(12): 20-31. Chase, M.W. 2009. Subtribe Oncidiinae. In Pridgeon, A.M., M.W. Chase, P.J. Cribb, & F.N. Rasmussen [eds]. Genera Orchidacearum, Vol. 5. Epidendroideae Oxford University Press. Dalstrm. S. 1993. A new species of Odontoglossum (Orchidaceae; Oncidiinae) from Bolivia. Lindleyana 8(1): 15-19. Dalstrm. S. 1996. A New Small Flowered Species of Odontoglossum (Orchidaceae; Oncidiinae) of the O. astranthum complex from Bolivia. Lindleyana 11(2): 114-117. Dalstrm. S. 1999. A new Bolivian species of Odontoglossum (Orchidaceae; Oncidiinae) in the astranthum complex. Lindleyana 14(2): 87-91. Dalstrm. S. 2010. A new species of Odontoglossum (Orchidaceae: Oncidiinae) from Ecuador. Lankesteriana 9(3): 505-508. Dalstrm. S. 2012a. New combinations in Odontoglossum (Orchidaceae: Oncidiinae) and a solution to a taxonomic conundrum. Lankesteriana 12(1): 53-60. Dalstrm. S. 2012b. A well-known but previously Odontoglossum (Orchidaceae: Oncidiinae) from Ecuador. Lankesteriana 12(3): 155160. Dalstrm. S. 2013. Eine neues, seltsames Odontoglossum as dem Astranthum-Komplex (Orchidaceae: Oncidiinae) 62-67 Sander, F. 1892. Odontoglossum wattianum. Reichenbachia 1(2), sub Pl. 9. H. Sotheran & Co., London. DALSTRM & RUZ PREZ A new Odontoglossum from Peru405LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. FIGU R E 4. Odontoglossum epidendroides. Photo: S. Dalstrm. FIGURE 5. Odontoglossum juninense. Photo: S. Dalstrm.
PAGE 256
LANKESTERIANA
PAGE 257
Introduction. As we are facing the sixth global biodiversity extinction (Canadell & Noble 2001), the ultimate goal of plant conservation biology is to preserve an adequate environment in which species can persist (Swarts & Dixon 2009), with continued evolutionary change. The effective conservation of individual species requires a deep taxonomic understanding (Flanagan et al. 2006), especially among those groups demands the maintenance of species interactions in natural environments. One of the critical interactions for many plants is pollination by animals. It is also LANKESTERIANA 13(3): 407. 2014. OF THE COLOMBIAN ENDEMIC SPECIES, PLEUROTHALLIS MARTHAE (ORCHIDACEAE: PLEUROTHALLIDINAE) CA R OL AND R EA DU Q UEBUIT R AGO 1 NSTO R FABIO ALZATE-QUINTE R O 1 & J. TU P AC OTE R O 2, 3, 4 1 Departamento de Ciencias Biolgicas, Facultad de Ciencias Exactas y Naturales, Herbario FAUC, 2 Departamento de Ciencias Biolgicas, Facultad de Ciencias Agropecuarias, Universidad Nacional de Colombia, Sede Palmira3 Instituto de Estudios Ambientales IDEA, Universidad Nacional de Colombia, Sede Palmira4 Author for correspondence: jtoteroo@unal.edu.co ABSTRACT. Contemporary patterns of plant biodiversity result from the ecological and evolutionary processes generated by species interactions. Understanding these interactions is key for effective biodiversity conservation at the species and the ecosystem level. Orchid species often have highly specialised pollinator interactions, and the preservation of these is critical for in situ orchid conservation. The majority of orchid species occur in tropical regions, and information regarding their interactions is limited. We present data on pollinator identities, Pleurothallis marthae. We evaluated the mechanisms of attraction, the presence of osmophores, and the reproductive system of the species. Pleurothallis marthae is self-compatible with nocturnal anthesis pollinated by Mycetophila sp. Bradysia sp. (Sciaridae) that feed on nectar in the labellum. Osmophores and nectaries were detected in the epidermis of the sepals and petals. We present new evidence that the genus Pleurothallis is adapted to Diptera pollination. Our study indicates that the pollination mechanism of P. marthae is based on the nocturnal attraction of two species of fungus gnats, probably combining food attraction and brood place deception. RESUMEN Los patrones contemporneos de biodiversidad vegetal son el resultado de procesos ecolgicos y evolutivos generados por la interaccin entre especies. El entendimiento de estas interacciones es clave para la conservacin de la biodiversidad a nivel de especies y ecosistemas. A menudo las orqudeas tienen interacciones in situ. Pleurothallis marthae, endmica de Colombia. Evaluamos los mecanismos de atraccin, la presencia de osmforos, y su sistema reproductivo. Encontramos que se trata de una especie auto-compatible Mycetophila sp. (Mycetophilidae), especie atrada probablemente por el olor a hongo que libera la orqudea y Bradysia sp. (Sciaridae), la cual se alimenta de gotas de nctar en el labelo. Los osmforos y nectarios fueron detectados en la epidermis de los spalos y ptalos. El mecanismo P. marthae atraccin alimenticia y mimetismo de sitios de apareamiento. KEY WORDS : Bradysia, orchid pollination, fungus gnats, pollinators, Mycetophila olfactory mimicry
PAGE 258
one of the interactions that have provided substantial evidence of evolutionary processes in the wild; transport (Darwin 1885). Nevertheless, pollination had been nominated as an endangered interaction due to losses of plant species and their pollinators as well as their natural habitats (Kearns et al. plant family that combines both, threat conservation in some species and interesting pollination interactions is the Orchidaceae. plants with about 800 genera and more than 28,000 species (Govaerts et al. 2012); many species are endangered, and listed in biodiversity red lists; for example, in Colombia there is a partial list of 207 endangered orchids (Caldern 2007). There are several critical aspects of orchid biology that contribute to those threats. Orchid conservation requires the consideration of two bottlenecks in the orchids life cycle: seed germination and pollination (Tremblay & germination (Otero et al. 2002; 2004; 2007) that may have had complex co-cladogenic processes (Otero et al. 2011); however, there is still much to learn about the tropics (Otero & Bayman 2007). In the Andes, the highest threat to orchid conservation is habitat loss; nevertheless, pollination is also crucial. Orchids are renowned for the complex and intriguing pollination mechanisms adapted to pollination by animals (Darwin 1885, van der Pijl & Dodson 1966, Singer 2002, Borba & Braga 2003), especially insects (Dressler 1981). It is now well known that bees and wasps are responsible for about 60% of the pollination of the family (Williams 1982, Ackerman 1983; Whitten et al. 1993; Camargo et al. pollinate 15-25% of species (Borba & Semir 2001), and Lepidoptera, Coleoptera and birds pollinate about 1525% remaining (van der Pijl & Dodson 1966; Singer et al. may provide a variety of rewards to their pollinators, like substances (Neiland & Wilcock 1998; Pansarin 2008); however, nearly a third of orchid species forms of deception for pollination (Ackerman 1986; most common means of deception, sexual mimicry, is reported in about 20 genera of Orchidaceae with various pollinator types such as solitary and social bees, wasps, et al. 1991). This mechanism includes visual and/or olfactory features attracting insects. The best known cases of reproductive deception involve pseudo-copulation, a phenomenon mimic female structures and chemical pheromones of certain insects (Singer et al. 2005), and are pollinated by male insects seeking a mate (Dressler 1981; Williams & Whitten 1983; Singer 2002). The emission of fragrances that resemble the insect sexual pheromones for reproduction is an important factor associated with the mimicry, including Barbosa et al. 2009; Barriault et al. 2010; Endara et al. 2010 Peakall et al. 2010). Some studies suggest that the subtribe Pleurothallidinae (Orchidaceae: Epidendreae) is mainly adapted to pollination by Diptera species (van der Pijl & Dodson 1966; Chase 1985; Duque 2005; Pupulin et al. 2012), with several reports of deception by sexual mimicry (Christensen 1994; fragrances and pollinator activities. Acianthera johannensis (Barb. Rodr.) Pridgeon & M.W. Chase (as Pleurothallis johannensis Barb. Rodr.) and Acianthera fabiobarrosii (Borba & Semir) F. Barros & F. Pinheiro (as P. fabiobarrosii Borba & Semir) are pollinated by females of the genera Tricimba (Chloropidae) and have Acianthera teres (Lindl.) Borba (as P. teres Lindl.) and Acianthera ochreata (Lindl.) Pridgeon & M.W. Chase (as P. ochreata Lindl.) have a diurnal smell of rancid cheese and produce nectar like liquid at the base of the labellum. The latter are pollinated by Megaselia spp. (Phoridae) (Borba & Semir 2001), Acianthera adamantinensis (Brade) F. Barros (as Pleurothallis adamantinensis Brade) has a dog feces odor and is Hippelate ssp. (Chloropidae) (Borba variability showing a high percentage of polymorphic loci ranged from 50 to 83%, with a mean number of alleles per locus between 2.1 and 3.8, and a mean LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.408 LANKESTERIANA
PAGE 259
et al. 2001). Acianthera johannensis, A. fabiobarrosii, and A. adamantinensis showed a low level of genetic structuring while A. teres and A. ochreata showed high genetic structuring (Borba et al. 2001). However, the actual evidence has not been applied for conservation purposes, but in recent years the genus had been subdivided in smaller groups. Pleurothallis marthae (Luer & Escobar) Luer is an interesting research model because it has relatively frequent species in Yotoco Nature Reserve, Colombia. Little information is reported in the literature on this species. It is listed in the CITES Appendix II (W3Tropicos, accessed on Dec 2012) and is endemic to Colombia. Recently it was recorded from Yotoco et al. 2009). The species grows as both an epiphyte near the ground (no more than one meter high) and a terrestrial plant, at 1400-1800 m elevation in mountain forest. The objectives of this study are to describe the pollination system and mechanisms of pollinator attraction of P. marthae. Material and Methods Study species. Pleurothallis marthae is a terrestrial species or rarely epiphytic, without pseudobulbs, leaves broad, deeply cordate (Luer & Escobar 1996), it has a was described as P. marthae by Luer & Escobar from a collection by E. Valencia from Garrapatas (Valle del Cauca, Colombia) (Luer & Escobar 1996) and then transferred to Acronia Luer (2005). As Acronia is not broadly accepted we use Pleurothallis. P. marthae has yellowish dorsal sepal the broadly ovate, obtuse, lateral sepals completely connate (synsepal) is lilac, with glandular trichomes, petals rose, concave, with glandular trichomes too, lip light rose, thick, convex, transversely obovate. The second (pink-morph) has a dots, the synsepal is magenta with glandular trichomes, the petals are larger than the yellow-morph (Fig. 1) and the lip is similar to yellow-morph. In both morphs the column is short and cream-colored with an apical anther and a bilobed stigma (Fig. 1). Study site. We did this study at the Yotoco Forest Reserve (YFR), located on the eastern slope of the western Cordillera de Los Andes in Colombia, in the municipality of Yotoco. The site was situated in remnants of the subtropical wet-dry transition forest of Valle del Cauca (3N, 76W) at an elevation of 1400-1600 m. Average annual temperature is 20 C; average annual precipitation is 1500 mm; and relative humidity averages 85% (Escobar 2001). Two populations were surveyed, accounting 250 individuals in total; each individual was marked with an aluminum tag with a previously assigned code. Individuals were considered genets if all physically separate from other plants. Individuals were the longest shoot. The classes are the following: SIZE I (6-20 cm), SIZE II (21-40 cm), SIZE III (41-60 cm), SIZE IV (> 61 cm). Reproductive events (OF), pollinaria removed (PR), closed stigmas (CS) and swollen ovaries (SO) were recorded weekly as indirect evidence of reproductive effort and pollination events. As the data were not normally distributed, the anthesis was evaluated with a linear regression. All data 1. Flower visits. Observations were initially made between 0600 and 1800 h to identify periods of activity observed during the day, so the observation period were extended until 2000 h. Visitors were observed using red light located two meters from the plants to broaden the spectrum of light to avoid pollinator disturbance they were highly sensitive to direct illumination. With these additional hours we discovered visitation was nocturnal, so all further nocturnal observation periods were done between 1800 0600 h, for a total of 97 hours of observation (not including the diurnal times). For 30 individuals, the time of arrival of visitors was and number of visitors, and additionally video and DUQUE-BUITRAGO et al. Nocturnal pollination of Pleurothallis marthae by fyngus gnats409LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.
PAGE 260
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.410 LANKESTERIANAphotographic records. Flower visitors and pollinators were differentiated by behavior. Floral visitors were laboratory at Universidad of Caldas where high resolution macro photos were taken. As Colombian law prohibits exportation of wild biological material, Dr Sarah Siqueira de Oliveira, at the University of So Osmophore detection.. From each of the populations, stained in a bath of neutral red 1:1000 for 20 minutes (Stern et al. 1986) to detect scent-secreting glands (osmophores) or nectaries as neutral red indicate sites that is metabolically active (Kearns & Inouye 1993). Reproductive system 20 plants with net mesh to exclude insect visitors. Once by a wet and sticky stigmatic surface, we performed the following hand-pollination treatments: autogamy of the same plant); xenogamy (removal of pollinaria plant); and natural pollination. All treatments with the exception of the natural pollination treatment were bagged again to prevent insect visitors impacting the results. Pollinations were monitored until fruits treatments with a non-parametric Kruskal-Wallis test. Results. Flower buds develop in 10-15 days, and like odor and lightly sweet nectar at night time. Anthesis of P. marthae release a fungus-like odor (as detected by the human FIGURE 1. Flower of Pleurothallis marthae: a) lateral view, b) frontal view, c) two color morphs, d) Habit of Pleurothallis marthae.
PAGE 261
411LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.nose) and nectar secreted by the lip. As time passed the smell gradually increased in intensity, and peaked at 23:30. There after the intensity decreased until approximately 05:00, when it became imperceptible. from 19:00 until 09:00. Reproductive events early May through mid June (six weeks), with a peak at P-value = 0.03) with small individuals producing fewer of pollinia removed (H test, P-value = 0.14), stigmas closed (H test, P-value = 0.31) and ovaries swelled P-value = 0.02). There was a correlation between in anthesis per reproductive season (Fig. 2). The time from pollination to fruit dehiscence was between 9 and 10 weeks. The reproductive events did not differ statistically between two different coloration patterns (morphs) observed (H test, P-value > 0.05). Flower visitors. The mo visitors were herbivorous caterpillars (Lepidoptera: Geometridae), which feed on buds, ovaries, and fruits in early developmental stages. We also observed adults of two Orthoptera species: Eumastacidae and Acrididae cydno cydnides Staudinger (Lepidoptera: Heliconidae) and two species of spiders, Araneidae and Thomisidae, families known to hunt pollinators. Occasionally, we observed ants eating the nectar from the lip. We observed two pollinators species, Bradysia sp. (Diptera: Sciaridae) and Mycetophila sp. (Diptera: Mycetophilidae), both fungus gnats. The Bradysia sp. the petals to consume the nectar on the labellum for a few seconds. Subsequently, the gnat contacted the apex of the column and probably causing the pollinarium to adhere to the ventral section of the thorax. Visits of Bradysia sp. were very brief (10 seconds) and were only observed on two occasions, in one of them, the individual had two pollinaria attached. The Mycetophila sp. (Fig. 5) was presumably and began a series of wing and thorax movements while lifting the hind legs (Fig. 6), and sometimes moving the abdomen as if to oviposit. Probably pollinaria adhere to the ventral part of the thorax when individuals court time (sometimes overnight). We often observed many individuals of Mycetophila same time (10 individuals), observed 47 individuals in total. On several occasions we observed mating among the Mycetophila sp. but we did not observe pollination events. Nevertheless, indirect evidence of their DUQUE-BUITRAGO et al. Nocturnal pollination of Pleurothallis marthae by fyngus gnats FIGURE reproductive season vs. number of fruits. FIGURE 3. Bradysia sp. with Pleurothallis marthae pollinaria adhered to the dorsal side of the thorax.
PAGE 262
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.412 LANKESTERIANApollination activity was obtained from the collection P. marthae pollinarium attached. Osmophore detection. Osmophores were detected in the epidermis of synsepals, dorsal sepal and petals, with an obvious presence in scattered spots located mainly at the edges of the structure (Fig. 7). The petal tips had glandular trichomes. Reproductive system. Our hand-pollination experiments indicated that Pleurothallis marthae is self-compatible. Self-pollination treatment within a cross-pollinations had 60% fruit set and natural were observed between the different treatments (H test, P value> 0,05). FIGURE 4. Visit sequences of Bradysia sp. in Pleurothallis marthae Bradysia sp. arriving to the petals and facing to the labellum; b Bradysia sp. consuming nectar from the labellum; c Bradysia sp. crossing by the column and climbing by the lower part of the dorsal sepal; d Bradysia sp. crossing by the lower part of the dorsal sepal to FIGURE 5. Mycetophila sp. with pollinaria of Pleurothallis marthae. a Mycetophila Pleurothallis marthae with a pollinarium in the ventral part of the thorax. b Close up of Mycetophila sp. and pollinarium. The pollinarium was detached of the insect during the specimen manipulation.
PAGE 263
413LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.Discussion Pleurothallis marthae is probably pollinated by two species of fungus gnats: Mycetophila sp. and Bradysia sp. Visitors can remove pollinia and not necessarily be pollinators, nevertheless, form in which deposited pollinia, court of other species through visits and biology of fungus gnat, we believe that they are pollinators. This case is similar to that found by Endara et al. (2010), in this work on pollination of Dracula Luer & Dalstrm and Dracula felix (Luer) Luer, authors argue that the pollination process occurs when individuals of Zygothrica The effectiveness of fungus gnats orchid as and Dodson (1966) on the pollination of Stelis aemula Schltr. Most recently, other orchids had been reported as fungus gnats pollinated, for example Lepanthes glicensteinii is pollinated by Bradysia Octomeria crassifolia is pollinated by Bradysia (Barbosa et al. 2009). In California, Listera cordata (= Neottia cordata; Orchidoideae) is pollinated by Mycetophila sp. and Sciara sp. (Ackerman & Mesler 1979). Mycetophila forms distinct groups of closely related species, which are within the group usually separable only by the characters on the male terminalia. Mycetophila is one of the most abundant families of order Diptera encompassing more than 3000 described species, with a world-wide distribution (Gaston 1991). Pleurothallis marthae coloration patterns (morphs). Pollination success was detected equally in both morphs, suggesting that color is not a key factor determining reproductive success, and supporting the hypothesis that both fragrances and nectar are key attracting factors. Nevertheless, abundance and the number of pollinator visits. This DUQUE-BUITRAGO et al. Nocturnal pollination of Pleurothallis marthae by fyngus gnats FIGURE 6. Display of Mycetophila sp. in Pleurothallis marthae
PAGE 264
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.414 LANKESTERIANAis likely to be an increase in the emission of aroma and possibly a greater supply of nectar, making these Pleurothallis marthae seems to mimic the smell of a fungus; this case had been reported in Zootrophion sp. (Orchidaceae) and coincides with the syndrome & van der Pijl (1971). Although oviposition behavior was observed by Mycetophila sp., we did not observe eggs or larvae under microscope, which suggests a mechanism females at the same time attract males (Ackerman & Mesler 1979). Mycetophila sp. was observed mating Mycetophila sp. were most commonly observed on the scent glands (osmophores), suggesting that the attraction of this species occurs by the emission of a Both pollinator species are commonly known as fungus gnats because they are almost always dependent upon fungal substrates for larval development. The Bradysia sp. may have been initially attracted by the smell and then by the presence of nectar, which longer periods of time to enhance the probability of pollination (de Melo et al. 2010). Our results on the reproductive system suggest that P. marthae compatible with the observed behavior of pollinators, P. marthae reproduction. This phenomenon has also been observed in other species (Mesler et al. 1980; Borba & Semir 2001; Singer 2001; Barbosa et al. 2009). While we did not conduct a pollination treatment to test for self-pollination, fruit and seed production in most self-compatible orchids are pollinator-dependent, and P. marthae is likely no et al. 1992; Singer & Zasima 1999; Singer 2001; Singer et al. 2004). The natural fruit set observed in this study was 60%. This value is higher than the ranges suggested by Neiland & Wilcock (1998) for tropical orchids, although those reported for Listera cordata 61-78% (Ackerman & Mesler 1979) and 93.3-96.7% (Singer 2001), species pollinated by that Diptera pollination can be a very favorable strategy for orchids. genus Pleurothallis. Fly pollination had already been reported for species Lepanthes glicensteinii Luer, Listera cordata (L.) R. Br., Tolmiea menziesii (Pursh) Torr. & A. Gray, Asarum caudatum Lindl., Dracula Luer & Dalstrm and Dracula felix (Luer) Luer, Specklinia pfavii (Rchb.f.) Pupulin & Karremans FIGURE 7. Portion of the dorsal sepal (a) before and (b) after staining with neutral red. Arrows shows the presence of osmophores and/or nectaries in the adaxial side of the sepal.
PAGE 265
415LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.and Specklinia spectabilis (Ames & C.Schweinf.) Pupulin & Karremans (Mesler et al. 1980; Lu 1982; Goldblatt et al. 2004; Okuyama et al. 2004; Endara et al. 2010, Pupulin et al. 2012), revealing them to be very important pollination vectors that have case suggesting fungal-like odors may be involved in attracting pollinators in Pleurothallis and the second for the Subtribe Pleurothallidinae (Christensen 1994). and species pollinated by fungus gnats. Lepanthes may be nocturnally pollinated too (Tremblay & Ackerman 2007). Further studies in our research group are focused in the understanding of the fragrance composition of of P. marthae for the conservation management of this Colombian endemic orchid, P. marthae; of course, we have to include the conservation of their nocturnal fungus gnat pollinators. ACKNOWLEDGEMENTS. The authors are thankful for the Universities. We thank Sarah Siqueira de Oliveira for the Hidalgo and the staff of the Yotoco Forest Reserve of the Universidad Nacional de Colombia-Palmira for assistance in the development of this study; James D. Ackerman, Nicola S. Flanagan, Paul Bayman, Nhora Helena Ospina and Marcela Cuartas for their comments and contributions to the manuscript; and the Grupo de Investigacin en Orqudeas, Ecologa y Sistematica Vegetal (COL 0066015) of the Universidad Nacional de Colombia-Palmira for logistical support. LITERATURE CITED of the orchid-euglossine bee interaction. Biological Journal of the Linnean Society 20: 301-314. Ackerman, J.D. 1986. Mechanisms and evolution of fooddeceptive pollination systems in orchids. Lindleyana 1: 108-13. Ackerman, J.D. & M.R. Mesler. 1979. Pollination Biology of Listera cordata (Orchidaceae). American Journal of Botany 66: 820-824. especies simptricas de Stelis (Pleurothallidinae, Orchidaceae). Acta Botnica Mexicana 74: 155-168. Barbosa, A.R., M.C. de Melo & E.L. Borba. 2009. Self-incompatibility and myophily in Octomeria (Orchidaceae, Pleurothallidinae) species. Plant Systematics and Evolution 283: 1-8. Barriault, I, D. Barabe, L. Cloutier & M. Gibernau. 2010. Pollination ecology and reproductive success in Jack-in-the-pulpit (Arisaema triphyllum ) in Quebec (Canada). Plant Biology 12: 161-171. Pollination in Lepanthes (Orchidaceae: Pleurothallidinae) by Fungus Gnats. Annals of Botany 95: 763-772. Borba, E.L. & P.I. Braga. 2003. Biologia reprodutiva de Pseudolaelia corcovadensis e autocompatibilidade em uma Laeliinae. Revista Brasileira de Botnica 26: 541-549. Borba, E.L., J.M. Felix, V.N. Solferini & J. Semir. 2001. Fly-pollinated Pleurothallis (Orchidaceae) species markers. American Journal of Botany 88: 419-428. and Convergence in Fly-pollinated Pleurothallis (Orchidaceae) Species: A Multiple Population Approach. Annals of Botany 88: 75-88. Colombia. Volumen 6: Orqudeas, primera parte. Serie Bogot, Colombia. Instituto Alexander von HumboldtMinisterio de Ambiente, vivienda y desarrollo territorial. 828 p. Camargo, E., V, Silva & E. Leit. 2006. Reproductive biology of two Cattleya (Orchidaceae) species endemic to Canadell, J. & I. Noble. 2001. Challenges of a changing earth. Trends in Ecology and Evolution 16: 664666. Chase, M.W. 1985. Pollination of Pleurothallis endotrachys. American Orchid Society-Bulletin 54: 431-434. Christensen, D.E. 1994. Fly pollination in the Orchidaceae. In J. Arditti [ed.], Orchid Biology: Reviews and perspectives, VI, 415-454. (John Wiley & Sons. New York, USA. evolutionary consequence of deception? Trends in Ecology and Evolution 20: 487-494. mediated selection and experimental manipulation of Chloraea bletioides Functional Ecology 24: 1219 -1227. http://dx.doi.org/10.1111/ j.1365-2435.2010.01737.x DUQUE-BUITRAGO et al. Nocturnal pollination of Pleurothallis marthae by fyngus gnats
PAGE 266
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.416 LANKESTERIANADafni, A. 1984. Mimicry and Deception in Pollination. Annual Review of Ecology and Systematic 15: 259278. Darwin, C.D. 1885. The various contrivances by which UK. Dressler, R.L. 1981. The Orchids, natural history and DC, USA. Pleurothallis Orquideologa 19: 55-69. Endara, L., Grimaldi, D. A., & Roy, B. A. 2010. Lord of Dracula orchids. Lankesteriana 10: 1-11. Escobar, E. 2001. Presentacin de Yotoco Reserva Natural Flora: Plantas Vasculares. Universidad Nacional de Colombia, Palmira, Colombia. Faegri, K. & L. van der Pijl. 1979. The principles of pollination biology. Oxford: Pergamon Press. Flanagan, N.S., R. Peakall, M.A. Clements & J.T. Otero. the case of the Australian orchid, Microtis angusii. Conservation Genetics 7: 847-859. Gaston, K.J. 1991. The magnitude of global insect species richness. Conservation Biology, 5: 283-296. Goldblatt, P., P. Bernhardt, P. Vogan & J.C. Manning. 2004. Pollination by fungus gnats (Diptera: Mycetophilidae) and self-recognition sites in Tolmiea menziesii (Saxifragaceae). Plant Systematics and Evolution 244: 55-67. Govaerts, R., J. Pfahl, M.A. Campacci, D. Holland-Baptista, Wood. 2012. World checklist of Orchidaceae. The Board of Trustees of the Royal Botanic Gardens, Kew. http://www.kew.org/wcsp/monocots/ [accessed 24 June 2012]. Kearns, C.A. & D.W. Inouye. 1993. Techniques for Pollination Biologists. University Press of Colorado, Colorado, USA. Kearns, C.A., D.W. Inouye & N.M. Waser. 1998. Endangered Mutualism: the conservation of plantpollinators interactions. Annual Review of Ecology and Systematics 29: 83-112. Lu, K.L. 1982. Pollination Biology of Asarum caudatum (Aristolochiaceae) in Northern California. Systematic Botany 7:150-157. Luer, C.A. & R. Escobar. 1996. Nuevas especies de Pleurothallis de Colombia. Orquideologa 20: 68-71. Luer, C.A. 2005. Icones pleurothallidinarum XXVII. Dryadella and Acronia section Macrophyllae Fasciculatae : addenda to Acianthera, Andinia Dracula, Dresslerella Lepanthes and Masdevallia new taxa, validation of taxa, errata. Missouri Botanical Garden, St. Louis. de Melo, M.C., E.L. Borba & P.E. Sousa. 2010. osmophores and nectaries of four species of Acianthera (Orchidaceae: Pleurothallidinae). Plant Systematic Evolution 286: 141-151. Mesler, M.R., J.D. Ackerman & K.L. Lu. 1980. The effectiveness of fungus gnats as pollinators. American Journal of Botany 67: 564-567. Neiland, M.R. & C. Wilcock. 1998. Fruit Set, Nectar Reward, and Rarity in the Orchidaceae. American Journal of Botany 85: 1657-1671. Nilsson, L.A. 1992. Orchid pollination biology. Trends in Ecology and Evolution 7: 255-259. Okuyama, Y., M. Kato, N. Murakami. 2004. Pollination by fungus gnats in four species of the genus Mitella (Saxifragaceae). Botanical Journal of the Linnean Society 144: 449-460. Otero, J.T., J.D. Ackerman & P. Bayman. 2002. Diversity fungi from tropical orchids. American Journal of Botany 89: 1852-1858. Otero, J.T., J.D. Ackerman & P. Bayman. 2004. Differences orchids. Molecular Ecology 13: 2393-2404. conservation. In: E Caldern-Sens [ed.], The Red Book of Orchids of Colombia, V, 6: Orchids, First Part. Series The Red Book Species of endangered species of Colombia, 771-796. Instituto Alexander von Humboldt, Ministerio de Ambiente, Vienda y Desarrollo Territorial, Bogota, Colombia. Otero, J.T., N.S. Flanagan, E.A. Herre, J.D. Ackerman, neotropical, epiphytic orchid, Ionopsis utricularioides (Orchidaceae). American Journal of Botany 94: 19441950. Otero, J.T., P.H. Thrall, M.A. Clements, J.T. Miller & Fungi. Australian Journal of Botany 59: 480-497. Pansarin, E.R. 2008. Reproductive biology and pollination of Govenia utriculata through a pollen-deceptive mechanism. Plant Species Biology 23: 90-96. Peakall, R., D. Ebert, J. Poldy, R.A. Barrow, W. Francke,
PAGE 267
sexually deceptive Chiloglottis orchids: implications for pollinator-driven speciation. New Phytologist 188: 437-450. 2009. Inventario orquideolgico de la Reserva Bosque de Yotoco, Valle del Cauca. Acta Agronmica 58: 189196. Pupulin, F., A.P. Karremans & B. Gravendeel. 2012. A reconsideration of the empusellous species of Specklinia (Orchidaceae: Pleurothallidinae) in Costa Rica. Phytotaxa 63: 1. nectar availability on effective visitation frequency in Comparettia falcata (Orchidaceae). American Journal of Botany 79: 1009-1017. Sasaki, M., M. Ono, T. Asada & T. Yoshida. 1991. Oriental orchid (Cymbidium pumilum) attracts drones of the Japanese honeybee (Apiscerana japonica ) as pollinators. Experientia 47: 1229-1225. Singer, R.B. 2001. Pollination biology of Habenaria (Orchidaceae: Habenariinae) in Southeastern Singer, R.B. 2002. The pollination mechanism in Trigonidium obtusum Lindl. (Orchidaceae: Maxillariinae): Sexual 163. in the Pelexia alliance (Orchidaceae:Spiranthinae). Botanical Journal of the Linnean Society 131: 249-262. Singer, R.B., A. Flach, S. Koehler, A.J. Marsaioli & M.D.C.E. Amaral. 2004. Sexual mimicry in Mormolyca ringens (Lindl.) Schltr. (Orchidaceae:Maxillariinae). Annals of Botany 93: 755-762. Singer, R. B., Breier, T. B., Flach, A., & Farias-Singer, R. 2007. The pollination mechanism of Habenaria pleiophylla Hoehne & Schlechter (Orchidaceae: Orchidinae). Functional Ecosystems and Communities, 1: 10-14. Swarts, N.D. & W. Dixon. 2009. Terrestrial orchid conservation in the age of extinction. Annals of Botany 104: 543-556. Tremblay, R. & J.D. Ackerman. 2007. Floral color patterns in a tropical orchid: are they associated with reproductive success? Plant Species Biology 22: 95-105. Tremblay, R. & J.T. Otero. 2009. Orchid conservation biology: Predicting species dynamics and community on Andean Orchids, 97-107. Universidad Tcnica Particular de Loja, Loja, Ecuador. van der Pijl, L. & C.H. Dodson. 1966. Orchid Flowers: their pollination and evolution. University of Miami Press, Miami, USA. sources of chemicals that attract male euglossine bees. Journal of Chemical Ecology. 19:3017-3027. Williams, N.H. 1982. The biology of orchids and euglossine bees. In: J. Arditti [ed.], Orchidbiology II, 121-169. Cornell University Press, Ithaca, New York. fragrances and male euglossine bees. Methods and advances in the last sesquidecade. Biological Bulletin, 164: 355-395.417LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. DUQUE-BUITRAGO et al. Nocturnal pollination of Pleurothallis marthae by fyngus gnats
PAGE 268
LANKESTERIANA
PAGE 269
Introduccin. Las orqudeas son probablemente las ms evolucionadas de todas las plantas vasculares y son un componente muy importante de la biodiversidad a consecuencia de su gran diversidad de especies (Mujica et al. 2000). No obstante, las orqudeas sus bajas densidades sugieren poca competencia intra Schmidt 2006). En Cuba actualmente se reconocen aproximadamente 99 gneros y 308 especies de la familia Orchidaceae (Llamacho & Larramendi 2005), de las Larramendi 2005). LANKESTERIANA 13(3): 419. 2014. DE IONOPSIS UTRICULARIOIDES (ORCHIDACEAE) EN UN REA SUBURBANA DE PINAR DEL RO, CUBA ALFREDO GARCA-GONZLEZ & FRANDER B. RIVERN-GIR El Colegio de la Frontera Sur (ECOSUR), Unidad Tapachula. Carretera Antiguo Aeropuerto, km 2.5, Apartado Postal 36, Tapachula, Chiapas, Mxico. C.P. 30700*Autor para correspondencia: alfredmx22@gmail.com RESUMEN. Se determin la estructura poblacional y hbitos de crecimiento de una poblacin de Ionopsis utricularioides (Orchidaceae), en un huerto de naranjos (Citrus sinensis; Juanita, Pinar del Ro, Cuba. Se tuvieron en cuenta todos los rboles de naranjo del huerto y la poblacin total de I. utricularioides Se midieron las siguientes variables: altura y dimetro de los naranjos y ramas donde o agregadas y especie de los vecinos en el caso de las agregadas. Se estudiaron un total de 10 rboles de C. sinensis I. utricularioides. En el tronco de los rboles no se encontraron plantas de I. utricularioides y en las ramillas creci 98.61% de la poblaci n. El nmero de plantas es relativamente abundante en los dos estadios de vida. Gran parte de las plantas de I. utricularioides se encontraron creciendo en agregacin con otros individuos de su misma especie o con otras brindar ventajas competitivas a I. utricularioides ABSTRACT. We determined the population structure and some habitat conditions of a Ionopsis utricularioides (Orchidaceae) population in an orange orchard (Citrus sinensis, Rutaceae), located in the La Juanita farm, Pinar del Ro, Cuba. We took into account all the orange trees of the orchard, and located all the individuals of I. utricularioides orchid distribution on phorophytes (trunk, branches or twigs), life stage of the orchids (immature or adults), orientation of orchids in the phorophyte, if the plants were solitary or aggregated, and kind of neighbours in the case of the aggregate. Of the 10 trees of C. sinensis, eight trees had orchids of I. utricularioides with 217 plants. Almost all orchids were observed on the twigs (98.61 %) and none were observed on the trunk of the tree. The number of plants is relatively high in the two stage of life. Most plants of I. utricularioides were found growing aggregate with individuals of the same species, or with other species of vascular epiphytes. This is a stable and mature population. Growing up in aggregation can give competitive advantages to I. utricularioides PALABRAS CLAVES : naranj o
PAGE 270
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.420 LANKESTERIANAhabitan en Cuba es Ionopsis utricularioides (Sw.) Lindl. (Ackerman 1995, Mujica et al. 2000, Llamacho 2012) (Figs. 1AB ). Esta es una especie neotropical, con un amplio mbito de distribucin, que incluye Florida, Mxico, Antillas Mayores y Menores, Amrica Central, Amrica del Sur e islas Galpagos (Ackerman 1995, Mujica et al. 2000, Llamacho & Larramendi 2005, FNA 2008). Es muy comn encontrarla creciendo et al. 2005, Llamacho & Larramendi 2005), asociada a plantaciones de ctricos, caf y cacao (Hgsater et al. 2005, Llamacho & Larramendi 2005). Teniendo en cuenta que I. utricularioides es una especie que frecuentemente crece asociada a cultivos de esta orqudea sobre arboles de Citrus sinensis (L.) Osbeck (Rutaceae) y se estudiaron otras variables relacionadas con su ecologa en un agroecosistema morfolgicas que le permiten ser exitosa en estas condiciones antrpicas. Materiales y Mtodos Caracterizacin del sitio . El estudio se desarroll durante los aos 2010 y 2011, en un huerto de naranjos (C. sinensis), una especie frutal originaria de las regiones tropicales y subtropicales de Asia y el Archipilago Malayo, introducida en el Nuevo Mundo en 1493 (ACTAF 2011). Este huerto, de Juanita, aproximadamente 10 km al noreste de la ciudad de Pinar del Ro, Cuba. El promedio anual de precipitaciones en esta rea es de 1600 mm, y las predominando I. utricularioides. Unidad de muestreo . rboles de C. sinensis existentes en el huerto y se naranjo en los que creca I. utricularioides (Garcatodas las plantas de I. utricularioides y se anotaron las siguientes variables: altura y dimetro de la rama en la que crecan, micrositio que ocupaban (tronco, ramas o ramillas), clase de vida de las orqudeas (inmaduras o adultas), orientacin cardinal de las plantas sobre I. utricularioides Altura y DAP de los naranjos . La altura (m) de todos los rboles de naranjo se estim empleando una vara recta de madera, de 4 m de largo, graduada et al. 2011). El DAP (dimetro a la altura del pecho, a 1.30 m de altura) (cm) se determin midiendo la circunferencia (C) del tronco de todos los naranjos y luego aplicando se determin la altura y dimetro de las ramas en las que crecan orqudeas. Micrositios . et al. (2011), para arbustos de caf (Coffea arabica L.) y se elabor un sistema propio para los rboles de naranjo (Fig. 1 C ), donde se elimin el micrositio horquetas. Mediante observaciones previas al estudio se observ que en estos naranjos las horquetas eran pequeas y estrechas, por lo que no presentaban caractersticas ecolgicas (ej.: acumulacin de materia orgnica, mayor presencia de musgos y lquenes) que ramas primarias. Clases de vida . et al. (2011), que reconocen tres estadios de vida (plntulas, juveniles, adultos), se desarroll una versin propia para este estudio, donde las plantas de I. utricularioides vida: inmaduras (I) y adultas (A). Todas las plantas de aos anteriores, fueron incluidas en A, las restantes en I. . Mediante cuatro tramos de cuerda de 2 m, que fueron colocados en el suelo en
PAGE 271
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. GARCA-GONZLEZ & RIVERN-GIR Ecologa de Ionopsis utricularioides421de los naranjos, y empleando una brjula, se determin la posicin en que se encontraba ubicada cada orqudea noroeste (NO), noreste (NE), sureste (SE) y suroeste (SO). Estado de las orqudeas (solitarias o agregadas) . Las plantas de I. utricularioides se dividieron en dos grupos, segn lo planteado por Mujica (2007) y et al. (2007) para Broughtonia cubensis (Lindl.) Cogn: radio de 10 cm o menos de otro individuo de I. utricularioides vasculares. radio mayor de 10 cm de otro individuo de I. utricularioides, de otras especies de epfitas vasculares, o habitando en solitario en un forfito. Anlisis estadsticos . entre las frecuencias de aparicin por medio de una prueba de Montecarlo. Este algoritmo se emple en el caso de las variables: nmero de orqudeas en cada micrositio, nmero de orqudeas creciendo agregadas y creciendo solitarias, y nmero de orqudeas que crecan agregadas con otras plantas de su misma especies y las agregadas con otras especies Oriana (Versin 1.01) para la prueba de Uniformidad de frecuencias con las categoras de altura (Bajo: 1.28-2.28 m, Medio: 2.29-3.28 m, Alto: 3.29-4.16 m) 0.8-2.8 cm) en las que se encontraron las plantas de I. utricularioides altura y de dimetro se dividieron equitativamente en tres categoras, teniendo en cuenta los mnimos la media y la desviacin estndar. Resultados Organizacin espacial . Se evaluaron un total de 10 rboles para detectar la presencia de la orqudea. Estos rboles tienen una altura promedio de 4.11 0.58 m, y un DAP promedio de 10.92 1.74 cm I. utricularioides (Tabla 1). La mayor parte de las orqudeas se encontraron en la categora Medio de altura (2.29-3.28 m) (Fig. 2), cm) (Fig. 3). Micrositios, clases de vida, orientacin y estado de las orqudeas. En el tronco no se encontr creciendo ninguna planta de I. utricularioides. FIGU R A 1. Ionopsis utricularioides
PAGE 272
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.422 LANKESTERIANA (Montecarlo, p< 0.001). El nmero de plantas de I. utricularioides entre ambas clases de vida no presenta diferencias relativamente abundante en las dos clases (I: 41.9 %; A: 58.1 %) (Tabla 1). No hay una marcada preferencia de I. utricularioides por ninguna orientacin en particular (Uniformidad Circular de Rayleigh, p= 0.75), aunque rbol Altura (m) DAP (cm) No. de orqudeas Tronco Ramas Ramillas Orqudeas por estadios de vida I A 1 3.7 8.59 15 0 0 15 2 13 2 4.2 10.82 2 0 0 2 0 2 3 4.15 10.03 2 0 0 2 0 2 4 4.4 10.82 9 0 0 9 0 9 5 4.35 12.1 13 0 0 13 2 11 6 4 12.1 102 0 3 99 55 47 7 4.2 12.42 33 0 0 33 10 23 8 4.6 11.46 0 0 0 0 0 0 9 4.8 13.21 41 0 0 41 22 19 10 2.7 7.64 0 0 0 0 0 0 Total ------217 0 3 214 91 126 Promedio 4.11 0.58 10.92 1.74 ------------------TABLA 1. rboles de naranjo estudiados, altura y dimetro a la altura del pecho (DAP) de cada uno, nmero de plantas de Ionopsis utricularioides (tronco, ramas o ramillas) y estadio de vida de cada planta de orqudea (I: inmaduras o A: adultas). FIGURA 2. Categoras de altura en las que se encontraron las plantas de Ionopsis utricularioides (Bajo: 1.28-2.28 m, Medio: 2.29-3.28 m, Alto: 3.294.16 m) y nmero de plantas en cada categora. FIGU R A 3. Categoras de dimetro en las que se encontraron las plantas de Ionopsis utricularioides Finas: 0.8-2.8 cm) y nmero de plantas en cada categora.
PAGE 273
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. GARCA-GONZLEZ & RIVERN-GIR Ecologa de Ionopsis utricularioides423las orientaciones con mayor nmero de plantas fueron E (16.1 %) y SO (16.6 %) (Fig. 4). Gran parte de las plantas de I. utricularioides se encontraron creciendo en agregacin (74.2 %), con otras orqudeas de la misma especie o con otras creciendo agregadas y las que crecan solitarias (Montecarlo, p< 0.001). Tambin existen diferencias I. utricularioides (94.4 %) y las agregadas con otras p< 0.001). Las orqudeas que crecen agregadas tienen como promedio 2.93 1.87 plantas en un radio de 10 vasculares en agregacin con I. utricularioides, estas son: Sw. (siete plantas) y Tillandsia recurvata (L.) L. (dos plantas). Discusin de hospederos en las orqudeas (Walter 1991. Tremblay et al. 1998. Llamacho & Larramendi 2005. Trapnell & Hamrick 2006. Mujica et al. 2010), aunque se sabe que algunas especies de rboles como Citrus spp., son especialmente buenos hospederos para determinadas especies de orqudeas (Walter 1991, Llamacho & Larramendi 2005). Pese a ser C. sinensis una especie extica en Cuba I. utricularioides, aunque se hicieron varios recorridos exploratorios en los parches remanentes de bosque existentes en los alrededores de la poblacin de orqudeas estudiada. No obstante, en este sitio C. sinensis del gnero Tillandsia, aunque I. utricularioides es I. utricularioides en cuatro rboles de naranjo (C. sinensis) en una huerta abandonada, aproximadamente que de estas orqudeas se haya originado la poblacin estudiada, debido a que estn relativamente cerca, estos rboles de naranjo (C. sinensis) eran antiguos y muchas de las I. utricularioides que los ocupaban eran de mayor tamao y aparentemente de mayor edad que las de la poblacin estudiada. Luego de que las semillas de orqudea llegan a un sustrato, su germinacin y posterior establecimiento depende de muchos factores biticos y abiticos (Trapnell & Hamrick 2006). La preferencia de I. utricularioides por C. sinensis puede estar asociada et al. et al. 2007, Mujica et al. 2010) y la estructura de su cobertura de Citrus sinensis presenta una estructura en la seleccin de sustrato de I. utricularioides es la posible presencia del o los hongos micorrcicos con los que se asocia esta especie de orqudea para germinar y desarrollarse (Walter 1991, Otero et al. 2004, Trapnell & Hamrick 2006, Mujica 2007, Otero et al. 2007, Mujica et al. 2010, Ravents et al. 2011). FIGU R A 4. Orientacin de Ionopsis utricularioides en los NO: noroeste, SE: sureste, SO: suroeste). FIGU R A 5. Estado en el que se encuentran creciendo las plantas de Ionopsis utricularioides (solitarias o agregadas) y especies con las que se encuentran agregadas (con otras I. utricularioides
PAGE 274
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.424 LANKESTERIANAenfocados para determinar la posible presencia C. sinensis-I. utricularioides y determinar con cuales se Otero et al. (2004) y Otero et al. (2007), plantean que I. utricularioides generalmente se asocia y es a los Ceratobasidium D.P. Rogers. Estos hongos tienen una amplia distribucin, y su asociacin con I. utricularioides puede explicar en parte la amplia de esta especie de orqudea (Otero et al. 2004, Otero et al. 2007). De los 10 rboles de naranjo estudiados, dos de igual porte, edad y bajo las mismas condiciones que los ocho restantes, se encontraban totalmente desprovistos de orqudeas (Tabla 1). Esto puede estar ocasionado por circunstancias aleatorias en la dispersin de las semillas de I. utricularioides por el viento, pero es factible que en el futuro cercano estos naranjos tambin sean haya sido el rbol nmero 6, que es el que cuenta con el mayor nmero de orqudeas de forma general (Tabla 1) y el mayor nmero de orqudeas, tanto inmaduras como tambin son las ms grandes y desarrolladas. Se pueden encontrar plantas de I. utricularioides a lo largo y ancho de la copa de los naranjos, pero expuestas de los rboles (Fig. 2 y Fig. 3), con una marcada ausencia de orqudeas en el tronco, escases en las ramas y abundancia en las ramillas (Tabla 1). Esta distribucin probablemente est relacionada con lo planteado por Johansson (1974) y Krmer et al tienden a mostrar patrones de distribucin vertical en La preferencia de I. utricularioides por las ramillas probablemente se encuentra estrechamente relacionado con la mayor intensidad luminosa en este micrositio. En estudios anlogos desarrollados en cafetales de sombra en el Soconusco, Chiapas, Mxico, con Oncidium poikilostalix Williams, una orqudea con porte y caractersticas ecolgicas similares a I. utricularioides, el micrositio et al. 2011). En este caso la preferencia puede ser consecuencia de las prcticas agroculturales que se le hacen a la plantacin de caf (Coffea arabica L.), donde el extremo de las ramas se poda peridicamente, perdindose gran parte de las ramillas, eliminando con ellas las plantas que las ocupaban y limitando la et al. 2011). Las preferencias de micrositio y las adaptaciones morfolgicas que muestra I. utricularioides, como ser plantas de porte pequeo a mediano (Ackerman 1995, Mujica et al. 2000), tener hojas con cutculas muy gruesas para conservar el agua en los tejidos (Hgsater et al. 2005) y, en comparacin con otras especies de orqudeas, tener races numerosas, delgadas, largas y morfolgicamente adecuadas para curvarse y (Ackerman 1995, Mujica et al. 2000), concuerdan con las caractersticas tpicas de las llamadas orqudeas de ramilla (Hgsater et al. 2005), lo que coincide con lo planteado por Ackerman (1995). No est del todo claro como estas orqudeas obtienen los nutrientes que necesitan y algunos autores sugieren que pueden ser parcialmente parsitas de sus rboles hospederos (Ruinen 1953). Frecuentemente crecen en ramillas muertas o poco vigorosas, pero no existe evidencias de que obtengan nutrientes de sus hospederos (Hgsater et al. 2005). De la biologa de este tipo de orqudeas an se desconocen muchos aspectos, plantendose meses o un ao despus de germinar) y que tienen tiempos generacionales muy cortos (de 1-5 aos), que suelen ser muy longevas (Hgsater et al. 2005). Dentro del microhbitat ramillas tambin se pueden apreciar pequeas diferencias de ubicacin entre las alturas a las que se encontraron las orqudeas y entre los dimetros donde crecen (Fig. 2 y Fig. 3). est acorde con las caractersticas de las orqudeas de ramilla, pero manteniendo esta preferencia, crecen ms fcilmente en la categora Medio de altura (2.29-3.28 m), donde cuentan con las condiciones para las que estn adaptadas y al mismo tiempo estn ms
PAGE 275
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. GARCA-GONZLEZ & RIVERN-GIR Ecologa de Ionopsis utricularioides425protegidas que en la categora Alto (3.29-4.16 m). La relativa abundancia de I. utricularioides tanto adultas, como inmaduras (Tabla 1), indica una poblacin equilibrada, con una saludable tasa de reclutamiento relevo de las posibles bajas que ocurren de forma natural (Mujica 2007). La predominancia de orqudeas madura, con abundancia de plantas reproductoras, la expansin de la especie hacia nuevos nichos no ocupados, siendo la etapa adulta la ms importante de 2001; Garca-Soriano 2003; Mondragn 2009). No reproductivos de esta especie, para lograr obtener que permitan apreciar exactamente el estado actual de la poblacin y su posible comportamiento y permanencia en el futuro. Ionopsis utricularioides no muestra ninguna 4). Probablemente en este caso las plantas germinen orientaciones donde sean depositadas las semillas por el viento y encuentren las condiciones adecuadas, siendo ms susceptible esta especie de orqudea a la El mayor nmero de plantas en las orientaciones E y SO (Fig. 4) puede ser completamente aleatorio, por lo con el resto de las orientaciones (Fig. 4). No obstante, la ubicacin de las orqudeas en una u otra orientacin probablemente tambin pueda estar determinada por la direccin y velocidad predominante de los vientos et al. 2007), las necesidades orientacin de los sitios donde se encuentran las plantas los rodean (Mujica 2007). Por ejemplo, Tremblay y en Puerto Rico, encontraron que la orqudea Lepanthes eltoroensis crecer en el lado noroeste de los troncos de los rboles que ocupa, probablemente a consecuencia de los constantes vientos que suben del mar Caribe, con ms frecuencia por barrancos ubicados al sudeste del rea, principalmente vientos del este y del noreste. Al igual que ocurre con I. utricularioides et al. (2007) y Ravents et al. (2011) reportan que en el Parque Nacional Guanahacabibes, Cuba, es ms frecuente encontrar a B. cubensis creciendo en parches o en agregacin, fenmeno habitual en muchas Tremblay 1997). Tambin similar a I. utricularioides, B. cubensis se agrega ms comnmente con plantas de su misma especie, pero a continuacin los vecinos ms usuales fueron cuatro especies de orqudeas, aunque et al. 2007). El micrositio principal que ocupa I. utricularioides directamente relacionado con que la especie potencie el patrn agregado por encima del patrn solitario et al. (2007), es posible que entre las I. utricularioides que crecen las especies de Tillandsia, y que esto sea una de las la poblacin, es probable que luego de eliminar el Generalmente las ramillas es el microhbitat con menor disponibilidad de recursos para la orqudea (Chase 1987. Brown 1990. Gravendeel et al. 2004. Hgsater et al. 2005, Mondragn et al. 2007), por lo que las plantas de I. utricularioides que crecen agregadas con otras de la misma especie o con otras especies de pueden funcionar como cestas, brindndoles a estas orqudeas mayores ventajas competitivas y mayores posibilidades de supervivencia, al ser capaces de retener mejor la humedad y acumular mayor cantidad de materia orgnica y partculas de polvo. Por otro lado, dado que las ramillas es la porcin ms delgada de los rboles, con altos niveles de perturbacin e inestabilidad (Chase 1987, Brown 1990, Gravendeel et al. 2004, Hgsater et al. 2005, Mondragn et al. 2007), las acumulaciones de races tambin pueden ayudar a las plantas que crecen agregadas a permanecer ancladas al soporte y por tanto, a perdurar. En ste microhbitat, para I.
PAGE 276
utricularioides, representa una ventaja tener el mayor nmero posible de races, extenderlas alrededor de la propia ramilla y de las ramillas vecinas, y formar tempestades, fuertes vientos o si se seca y quiebra su ramilla. Es muy frecuente observar I. utricularioides solitarias o grupos de stas, que perdieron su ramilla y se sostienen colgando de sus entramados de races que se extienden a otras ramillas. Generalmente en estos casos los grupos de I. utricularioides se sostienen ms con un anclaje ms endeble y ms propensas a caer al suelo y morir. AGRADECIMIENTOS Agradecemos a la familia Garca, Marsilio por su importante colaboracin en el trabajo de campo. Al Dr. Dennis Denis vila, por sus valiosos conocimientos, puestos en funcin de este estudio. trabajo. A los dos revisores annimos que tuvieron a su cargo la correccin del manuscrito original, por su tiempo y dedicacin. LITERATURA CITADA of seed plants of the West Indies. Smithsonian Contributions to Botany. Number 98. Smithsonian Institution Scholarly Press, Washington D.C. the Virgin Islands. The New York Botanical Garden, Memoirs 73. Nueva York, E.U. ACTAF (Asociacin Cubana de Tcnicos Agrcolas y Forestales). 2011. Instructivo tcnico para el cultivo de los ctricos. Biblioteca ACTAF. Instituto de Investigaciones en Fruticultura Tropical (IIFT), Cuba. Ministerio de la Agricultura (MINAGRI), Cuba. evidence that certain orchids and bromeliads act as shoot parasites. Selbyana 5: 135-144. del Parque Nacional El Rey, Argentina: composicin 155-166. Chase, M. W. 1987. Obligate twig epiphytism in the Oncidiinae and other Neotropical orchids. Selbyana 10: 24-30. futuro. Seminario Mesoamericano de Orquideologa y Conservacin. Universidad de Costa Rica, San Jos, Costa Rica. Cuba). Volumen 4. Abc Taxa. Belgian Development Cooperation. FNA (Flora of North America). 2008. Ionopsis utricularioides Orchidaceae. Vol. 26: 646-647. (Consultado: 20 de julio de 2011, http:// id=116467). Valle-Mora. 2011. Population structure of Oncidium poikilostalix (Orchidaceae), in coffee plantations in Soconusco, Chiapas, Mxico. Lankesteriana 11: 23-32. 2011. La comunidad orquideolgica en la Reserva de la Biosfera Sierra del Rosario, Cuba. Rev. Biol. Trop. 59: 1805-1812. Garca-Soriano, R. 2003. Demografa, manejo y conservacin de Artorima erubescens en Oaxaca, orqudea endmica del sur de Mxico. Tesis en opcin Autnoma de Yucatn, Mrida, Mxico. Estructura y ecologa de la poblacin del endemismo cubano Broughtonia cubensis (Orchidaceae), en Cabo San Antonio, Pennsula de Guanahacabibes, provincia de Pinar del Ro, Cuba. Lankesteriana 7: 469-478. Gravendeel, B., A. Smithson, F. J. W. Slik & A. Schuiteman. for orchid diversity?. Phil. Trans. R. Soc. Lond. B. R. Dressler. 2005. Las orqudeas de Mxico. Productos Farmacuticos, S.A. de C.V. Instituto Chinoin. Mxico D.F., Mxico. Johansson, D. 1974. Ecology of vascular epiphytes in West African Rain Forest. Acta Phytogeogr. Suecica 59:1129. Krmer, T., M. Kessler & S. R. Gradstein. 2007. Vertical montane forest of the Bolivian Andes: the importance of the understory. Plant Ecol. 189: 261-278. Llamacho, J. A. & J. A. Larramendi. 2005. Las orqudeas de Cuba. Greta, Sevilla, Espaa. Mondragn D. 2009. Population viability analysis for Guarianthe aurantiaca, an ornamental epiphytic orchid harvested in Southeast Mxico. 24: 35-41. Mondragn, D., C. Maldonado & R. Aguilar-Santelises. 2007. Life history and demography of a twig epiphyte: A case study of Erycina crista-galli (Orchidaceae). Selbyana 28: 137-144.LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.426 LANKESTERIANA
PAGE 277
LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014. GARCA-GONZLEZ & RIVERN-GIR Ecologa de Ionopsis utricularioides427 Broughtonia cubensis (Lindley) Cogniaux, Dendrophylax lindenii (Lindley) Bentham et Rolfe y Encyclia bocourtii Mjica et Pupulin en el Cabo San Antonio, Pennsula de Guanahacabibes, Cuba. Anlisis espacio-temporal e implicaciones del impacto de un fenmeno atmosfrico severo. Tesis en opcin al Alicante, Espaa. la seleccin de sustrato por parte de Dendrophylax lindenii (Orchidaceae) en Cabo San Antonio, Pennsula de Guanahacabibes, Pinar del Ro, Cuba. Lankesteriana 9: 533-540. Ramos. 2000. Gneros de orqudeas cubanas. Felix Varela, La Habana, Cuba. Otero, J. T., J. D. Ackerman & P. Bayman. 2004. tropical orchids. Molecular Ecology 13: 2393-2404. Otero, J. T., N. S. Flanagan, A. E. Herre, J. D. Ackerman & epiphytic orchid Ionopsis utricularioides (Orchidaceae). American Journal of Botany 94: 1944-1950. Ravents, J., E. Mujica, T. Wiegand & A. Bonet. 2011. Broughtonia cubensis (Orchidaceae) populations in the dry forests of Guanahacabibes, Cuba. Biotropica 43: 173-182. Ruinen, J. 1953. Epiphytosis. A second view on epiphytism. Annales Bogorienses 1: 101-157. Ter Steege, H. & J. H. C. Cornelissen. 1989. Distribution and Ecology of vascular epiphytes in lowland rain forest of Guyana. Biotropica 21: 331-339. Trapnell, D. W. & J. L. Hamrick. 2006. Variety of epiphyte, Laelia rubescens (Orchidaceae). Selbyana 27: 60-64. Tremblay, R. L. 1997. Distribution and dispersion patterns of individuals of nine species of Lepanthes (Orchidaceae). Biotropica 29: 38-45. of an epiphytic herb on trees in subtropical rain forest. Tropical Ecology 50: 211-217. Tremblay, R. L., J. K. Zimmerman, L. Lebrn, P. Bayman, I. Sastre, F. Axelrod & J. Alers-Garca. 1998. Host endemic Puerto Rico orchid Lepanthes caritensis. Biological Conservation 85: 297-304. (edit.). Historia natural de Costa Rica. Editorial de la Universidad de Costa Rica. orchids (Lycaste aromatica, Jacquiniella leucomelana, and J. teretifolia) in a Mexican humid montane forest. Selbyana 22: 27-33. Dimerandra emarginata. J. Trop. Ecol. 14: 725-741. epiphytic orchid Aspasia principissa. Biol. Conserv. 129: 82-90. epiphytes: current knowledge, open questions. J. Exper. Bot. 52: 2067-2078.
PAGE 278
LANKESTERIANA
PAGE 279
LANKESTERIANA 13(3): 429. 2014.REVIEWERS OF THE MANUSCRIPTS SUBMITTED TO LANKESTERIANA, VOL. 13 The Editor-in-Chief, Managing Editor, Editorial Committee, Editorial Board and Editorial staff of LANKESTERIANA acknowledge the reviewers listed below for their willing cooperation. It is greatly appreciated that they have generously invested their time and competence in providing valuable comments and advice, for LANKESTERIANA James D. ACKERMAN Department of Biology and Center for Applied Tropical Ecology and Conservation, University of Puerto Rico, San Juan, PR, U.S.A. Jess AGUIRRE GUTIERREZ Naturalis Biodiversity Center NHN Leiden University, The Netherlands. Rafael ARVALO BURBANO University Of Wisconsin, Madison, U.S.A. Cssio VAN DEN BERG Univ. Estadual de Feira de Diego BOGARN, Lankester Botanical Garden, University of Costa Rica. Ken CAMERON University of Wisconsin, Madison, WI, U.S.A. Germn CARNEVALI Centro de Investigaciones Guy CHIRON Herbiers, Claude Bernard University Lyon 1, France. Benjamin COLLANTES MEZA Inka Terra Association (ITA), Peru. Phillip J. CRIBB Royal Botanic Gardens, Kew, U.K. Stig DALSTRM Lankester Botanical Garden, University of Costa Rica, and National Biodiversity Centre, Serbithang, Bhutan. Nicolas DAVIN Naturalis Biodiversity Center NHN Leiden University, The Netherlands. Calaway DODSON Missouri Botanical Garden, U.S.A. Robert L. DRESSLER, Lankester Botanical Garden, University of Costa Rica. Lorena ENDARA Florida Museum of Natural History, University of Florida, U.S.A.. Melania FERNNDEZ, Lankester Botanical Garden, University of Costa Rica. Gnter GERLACH Botanischer Garten Mnchen Nymphenburg, Mnich, Germany. Barbara GRAVENDEEL Naturalis Biodiversity Center NHN Leiden University, The Netherlands. Eric HGSATER Herbario AMO, Mxico D.F., Mxico. Wesley E. HIGGINS The American Orchid Society, Coral Gables, U.S.A. Luko HILJE Centro Agronmico Tropical de InvestiRudolf JENNY Rolando JIMNEZ Herbario AMO, Mxico D.F., Mxico. Carlyle A. LUER Missouri Botanical Garden, U.S.A. Ernesto MUJICA Centro de Investigaciones y Servicios Ambientales E COVIDA Pinar del Rio, Cuba. Carlos OSSENBACH Orquideario 24 de mayo, Sabanillas de Montes de Oca, Costa Rica. Joel Tupac OTERO OSPINA Universidad Nacional de Colombia. Alec M. PRIDGEON Sainsbury Orchid Fellow, Royal Botanic Gardens, Kew, U.K. Rafael RINCN Herbario UCH, Universidad Autnoma de Chiriqu, Panama. David A. ROBER TS Durrell Institute of Conservation and Ecology, University of Kent, U.K. Gustavo A. ROMEROGONZLEZ Harvard University Herbaria, Harvard University, Cambridge, Massachusetts, U.S.A. Gerardo A. SALAZAR CHVEZ Instituto de Biologa, Universidad Nacional Autnoma de Mxico.
PAGE 280
Luis SNCHEZ SALDAA Herbario AMO, Mxico D.F., Mxico. Lisa THOERLE The Orchid Digest, Laguna Niguel, CA, U.S.A. Rodolfo SOLANO GMEZ Universidad Nacional Autnoma de Mxico. Raymond TREMBLAY University of Puerto Rico Ro Piedras, PR, U.S.A. Jorge WARNER Lankester Botanical Garden, University of Costa Rica. W. Mark WHITTEN Florida Museum of Natural History, University of Florida, U.S.A..LANKESTERIANA 13(3), January 2014. Universidad de Costa Rica, 2014.430 LANKESTERIANA
|