Citation
Construction and Evaluation of Escherichia coli Strains Expressing Yeast Ketone Reductases for Utility in Organic Synthesis

Material Information

Title:
Construction and Evaluation of Escherichia coli Strains Expressing Yeast Ketone Reductases for Utility in Organic Synthesis
Creator:
Charron, Catherine
Stewart, Jon ( Mentor )
Place of Publication:
Gainesville, Fla.
Publisher:
University of Florida
Publication Date:
Language:
English

Subjects

Genre:
serial ( sobekcm )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
All applicable rights reserved by the source institution and holding location.

Downloads

This item has the following downloads:


Full Text













Construction and Evaluation of Escherichia coll Strains Expressing Yeast
Ketone Reductases for Utility in Organic Synthesis

Catherine Charron


ABSTRACT


Baker's Yeast (Saccharomyces cerevisiae) is a known source of enzymes capable of reducing organic compounds
such as alpha- and beta-keto esters, and ketones. By using recombinant DNA techniques, it is possible to clone

these enzymes into expression systems in foreign hosts such as Escherichia coli. Three genes were chosen to

be cloned into pET26b plasmids and transformed into E. coli BL21(DE3): FDH1, Ydr541c and Ynl274c. The

engineered strains are then used as a source of catalysts to carry out whole cell biotransformations which offer
an inexpensive and environmentally friendly method for organic reduction reactions



INTRODUCTION


The Genetic engineering in molecular biology has made great progress in the past 30 years. Easier and
less expensive cloning methods keep developing with the advent of technology. 1 Recombinant DNA technology

has been used extensively as an efficient and controlled avenue for the production of eukaryotic proteins in

foreign hosts like Escherichia coli.2 E. coli is a favored vehicle for the expression of foreign proteins since it

is inexpensive and provides high yields in a short amount of time. 1 These yields are controlled by the chosen
cloning vector which usually contains an origin of replication under the control of a specific promoter, an

antibiotic resistance gene, and a polylinker site to facilitate the insertion of the foreign DNA.3


Baker's yeast (Saccharomyces cerevisiae) has been recognized as a source of enzymes capable of reducing
alpha- and beta-keto esters, and ketones. Six families of carbonyl reductases re known and a number of

these reductases have been characterized by several individuals.4,5 However many more similar proteins

are believed to exist and complete identification of these proteins will probably be based on sequence comparison

to known reductases since the complete genome of baker's yeast is now available.6,7


Three genes were chosen to be subcloned into the pET26b plasmid vector: Ydr541c, Ynl274c, and FDH1. Ydr541c is

a short-chain alcohol dehydrogenase similar to GRE2; and FDH1 and Ynl274c are part of the D-

hydroxyacid dehydrogenase family.7 Each gene will be under the control of the T71ac promoter.8 Lac promoters
allow for high levels of gene expression and are induced by isopropyl $-D-thiogalactopyranoside (IPTG).

Once activated, the lac protein drives the T7RNA polymerase gene included in the host E. coli BL21(DE3), which

in turn activates the T7 promoter on the pET vector and thus allows for gene transcription and protein

translation.2 The protein is over expressed in its new host which facilitates analysis and organic reactions.


Chiral alcohols are useful building blocks in the synthesis of enantiomerically pure pharmaceuticals and

other chemicals.9 Whole cell biotransformations offer a clean and stable source of enzymes which are capable

of carrying stereoselective and regioselective reactions under environmentally friendly conditions with
high enantiomerically pure yields.10 Using the engineered E. coli strains, one can quickly test the specificity of

each enzyme and determine the yields and purity of the products with chiral and non-chiral gas


I UF I jourtial of L.41derlgradUate Re.,carch University of Florida





chromatography, infrared and nuclear magnetic resonance spectra, and optical rotations. Biocatalysis is an

innovative new approach with an enormous amount of possible applications, which when combined with

genetic engineering will make the possibility of enzyme and chiral compound production a more stable and

specific and less expensive process. 1



GENERAL OVERVIEW OF PROCEDURE


Background The construction of overexpression plasmids requires many steps in order to ascertain the

conservation of the DNA sequence of interest. The polymerase chain reaction (PCR) was used in order to amplify

the chosen gene from yeast genomic DNA.11 Since the DNA Taq polymerase used in the PCR reaction adds

the adenosyl (A) nucleotide to the 3' end of each strand, the PCR product was cloned into a plasmid vector

(pCR2.1: from Invitrogen Topo T/A Cloning Kit) which contains overhanging thymidine (T) residues.12,13

These clones were then transformed into E. coli cells and grown on LB/Amp plates. The transformants were

grown, the plasmids purified, and then analyzed by restriction digestion to determine the success of the ligation.

A colony containing the correct plasmid was then grown on a large scale in order to purify the plasmid in

milligram concentration by a CeCI gradient centrifugation3. This plasmid was sent for sequencing to determine if

any errors were introduced to the gene during amplification. When the correct sequence was obtained, the gene

was cut by the restriction enzymes introduced to its ends from the PCR primers, and will be ligated into the

pET26b plasmid. This ligation product will be transformed into E. coliBL21(DE3), analyzed by alkaline lysis

and restriction digestion, and will then be ready for use in whole cell biotransformations.



RESULTS AND DISCUSSION


FDH1




FDH1 was amplified by PCR then subcloned into the pCR2.1 vector. After performing a mini-prep and

restriction digestion from the grown transformants, it was amplified and purified by CeCI gradient

centrifugation. After the sequencing results were returned, they were compared to the known gene sequence and

it was determined that two mutations were introduced in the DNA sequence. Since the active site of the protein

is unknown, the mutations may not affect the activity of the enzyme and thus the cloning will not be repeated.

This gene has been excised from the pCR2.1 vector and will soon be ligated into pET26b.






Yand5' per
primefn


Htfl 1wrtp


tW3y CoT Tyr

"pAI:9.0 C
,Up u Ii-


ISCcnomricDNA


pCfl2.1




H11 Difrig s wits'd
pCEC3 1, .Vdl


+


.1-F,

2 EcoRE


5271 N l

i. GdprfiLcatn
S2. *4DNA ligas


Figure 1. Construction of FDH1 Overexpression Plasmid.




Ydr541 c




Ydr541c was amplified by PCR and subcloned into pCR2.1. After the chemical transformation, one of the

plated colonies was selected for a large-scale preparation and CeCI plasmid purification based on the positive

results of the restriction digestion of the harvested plasmids in a mini-prep. After the sequence was obtained

from the ICBR Core Laboratories, there was only one non silent mutation identified in the gene sequence. The

cloning will not be repeated since the change in amino acid may not affect the enzyme activity. Ydr541c was also

cut from the pCR2.1 plasmid and is now ready to be purified and ligated into pET26b.


I pft.Mb -�





pni' ' erm
pn, "Tier


15( gfntcj DNA


( - dr; ' I'


'A5ML 'Wtr


)


uhgpli�*1A W1lh

II. Gel AefjB aior


I2 T4NA


Figure 2. Construction of Ydr541c Overexpression Plasmid.








Ynl274c


The sequence results of this gene reported a change in a codon to a stop signal at base pair 286. Thus the T/
A cloning reaction with the original PCR product was repeated and the colonies obtained were grown and prepared
by alkaline lysis to retrieve the plasmid. After restriction digestion, the results showed no sign of the desired
gene. The best way to fix this problem will be to start the PCR amplification over again and repeat the cloning
steps in order to hopefully acquire the correct sequence from a new large scale purification.





Vd 5' pa


YrLZ* Mti'


{ I. 2









































Figure 3. Construction of Ynl274c Overexpression Plasmid.













During the sequencing stage of the cloning, many setbacks were experienced. The sequencing results came
Polymerase Chain Reaction (PCR)E
24--





























and refrigure 3. Crationstruction of nc verexression lasid.C.









Table 1
Primers used for PCR

Type Forward (3') Reverse (5')

CATATGTCGAAGGGAAAGGTTTTG AAGCTTATTTCTTVTGTCCATAAGCTCTGG
FDH1
Nde I Hind III

CATATGTCTAATACAGTTCTAGTTTCTGGCG GAATTCATAATCTGTTCTCCTTCTTCAA
Ydr541c
Nde I Eco RI

GAATTCAAACTAATGGCTTAGATTCATTGGG
Eco RI


Cloning/Transformation/Analysis of Transformants




The TOPO TA cloning kit provided by Invitrogen was used to clone the PCR products into the pCR2.1 TOPO

plasmid vector. The procedure for cloning and transformation of the ligation product into the provided TOP10 E.

coli cells were followed exactly.







The analysis of the transformants (mini-prep) was done by a small-scale preparation of plasmid DNA by lysis in

alkali solution. The method was adapted from the protocol found in Sambrook (1989).14 Solutions I, II, and III

were prepared as indicated. The entire cultures were centrifuged for harvesting of the cells. After the

phenol: chloroform extraction, the water phases were ethanol precipitated (2.5V EtOH, 0.025V 4M NaCI) and iced

for 30 minutes. The DNA was recovered by centrifugation, vacuum dried and resuspended in 45uL TE pH8.0 and

5uL RNAse A (20ug/mL). An appropriate amount of these solutions were then digested by restriction enzymes

and visualized by gel electrophoresis.







Storing Transformants



LB/Amp plates: per liter of LB solution add 15g Agar. Autoclave and add 4mL of 50mg/mL ampicillin when

cooled down. Pour into sterile plates







Restriction Enzymes



Obtained from New England Biolabs at 20,000 U/mL.







Agarose Gel Electrophoresis



All gels were 0.8% agarose (Molecular Biology Certified) by volume. They were run at 86 volts for one hour on

a BioRad Power Pac 300 in 0.5X TBE solution.






Large Scale Plasmid Preparation and Purification


A 500mL culture of the cells was grown in LB overnight at 370C. The preparation of the plasmid DNA was

done according to Protocol 6 in Sutton (1998)3, which is an alkaline lysis method. The purification of this DNA

was done in a cesium chloride density gradient (protocol 8 in Sutton, 1998)3, and retrieved by dialysis.

The ultracentrifuge used was a Beckman Ultracentrifuge Model L5-65 (75T rotor).

CATATGAGTAAGAAACCAATTGTTTTGA
Yn1274c
Nde I



Sequencing



All sequencing reactions were prepared according to the required parameters provided by the ICBR Core

Laboratories at the University of Florida.






REFERENCES


1. Seo, J.-H.; et al. In Enzymes for Carbohydrate engineering, Park, K. H., Robyt, J .F., Choi, Y. D., Eds. Elsevier

Science B.V.: Amsterdam, 1996; 12, p 201-214.

2. Shin, C. S.; Hong, M.S.; Bae, C. S.; Lee, J. Biotechnology Progress. 1997, 13, 249-257.

3. Sutton, J. M. In Essential Techniques: Vectors Cloning Applications, Jones, P., Ed. John Wiley & Sons: Chichester,

1998; p 3-32.

4. Ishihara, K.; Kondo, S.; Nakamura, K.; Nakajima, N. Biosc. Biotech. Bioch. 1996, 60 (9), 1538-1539.

5. Rodriguez, S.; Schroeder, K.T.; Kayser, M.M.; Stewart, J.D. Journal of Organic Chemistry. 2000, 65, 2586-2587.

6. Sybesma, W. F. H.; et al. In Biocatalysis and Biotransformation, Leak, D., Ed. Harwood academic publishers:

Amsterdam, 1998.

7. Stewart, J.D.; Rodriguez, S.; Kayser, M. M. In Enzyme Technologies for Pharmaceutical and Biotechnological

Applications, Zmijewski, M. H., Kirst, H. A., Yeh, W.-K., Eds. Marcel Dekker: New York, in press.

8. Sutton, J. M.; Richardson, D. R. In Essential Techniques: Vectors Expression Systems, Jones, P., Ed. John Wiley 8

Sons: Chichester, 1998; p 3-20.

9. Shimizu, S.; Kataoka, M.; Kita, K. Journal of Molecular Catalysis B: Enzymatic. 1998, 5, 321-325.

10. Patel, R. N., Ed. Stereoselective Biocatalysis. Marcel Dekker: New York, 2000.

11. Kolmodin, L. A.; Williams, J. F. In Methods in Molecular Biology: PCR Cloning Protocols: From Molecular Cloning tc

Genetic Engineering, White, B. A., Ed. Humana Press: New Jersey, 1997; 67, p 3-16.

12. Jones, P. In Essential Techniques: Vectors Cloning Applications, Jones, P. Ed. John Wiley & Sons: Chichester,

1998; p 106-118.

13. Ken, G.-F.; Shaw, J.-F.; Wu, J.-L.; Lin, C.-T. Journal of Agricultural and Food Chemistry. 1998, 46, 2863-2867.

14. Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning, a laboratory manual, 2nd Ed. Cold Spring Harbor

Laboratory Press: 1989.





Back to the Journal of Undergraduate Research


College of Liberal Arts and Sciences I University Scholars Program I University of Florida |


� University of Florida, Gainesville, FL 32611; (352) 846-2032.


Sff UNIVERSITY ,f
U FLORIDA
kh J\HnS is. TrGbr .