Citation
Diario de la marina

Material Information

Title:
Diario de la marina
Publisher:
[s.n.] ( Habana )
Publication Date:
Language:
Spanish

Subjects

Genre:
newspaper ( sobekcm )

Record Information

Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact Digital Services (UFDC@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
1915261 ( ALEPH )
11968619 ( OCLC )

Downloads

This item has the following downloads:


Full Text





_- ___f* -m~ -DARIOLAMARINA ,
223.nt 4imcedd 000pA AtA M M"I"11cio ft~ ic9,$,M."A-11lt OS

later LAIJliI Y poraat FUE toU UR D ,''" OFI C t-cH, SON






Ca ~ ~ d avendi6 19m I.4., ,ao de .1E7 600 rn"rP'ren.,b 41 _, -bnkne 41 p er1Ia WI~%~o203.1.~~ lepodri D E LA M A IN --40 ypldewia I" --0riede~uiA~a
comp~r ~. Cuweaillpid ~hn a~Parame~o ~~( ._ft '~Ieye. 1~eIJv. obnd mei tS vewee. (AA.AAA __WAB(NVW A, (fe A fffftAt Mien.Af ~ tf ~ t~t tftlcm (Aft ftp AWA (1f.A OA ft (((((
ft'~1s ftftftfA. AA~f(A (t~ AftfftftA (t a4.A s~f LO WC(~flen (t (ftf~ft, A A ,


A. ((Af, .1 ftpft

Al A A. A A(AA AA(ff(. .A 'A

AUZ LA LIBR C(frah FENUURD 0R CEO
(f f~fttff~f, tAffftft tfft fft"
fttltfAQfttf ft. LUE deincodlE IL T R uafpat ()t. deft A DE O E T
(Af .fttfftft tffStr.f G.fttff ftaia L A ~ LA ((ft amis'Af A
ftttdttff(AttfIf ftA ftf "'~AAff ~ t .f(A nf
17A Dttff~ffI VIft (Aft vin ftmo Ecrdft( EN~f ELt CON RES .1tif lftt'!A Hf Il~ft AIE.fftA (ft -A (Aft ftE IC
ft ft ft efA ft ettffttfftfttf Aft E p t ftftffttf ftt(fffeff dr tot~ttff ftft. A title
flsncoe i nrtoC nie t ban de mtift( Aite i Aig~fc A. rft ftffieaolntis ____ ---ftSIN TN S;*. : Ap t Ia t g"dea b ta(Apo rli iaona. -fstfti i pl" ~r nlvitrt AAinl Sgi
log fetfttaftfff de ftftft(ia, ff ftfta Aftft ft r e A. PAftttff 1- 0' -P~b 4, 'Itf ft.'er clii 4e ioelAe I, ftftse. dofttf .'ft. ftt
fttffft fnf( G~rri Ru tbr fintuftfA ft.- da e e r s l ftf utf t i bfn tf t ; y Ret(A ~ t ire ft. I t (~ t( .A f
ai:eftft,,l -! Q. ftfft P IP I.'DL oXAM A Iftft eo e d r Aftgo lftfftf i isAt ea i im
~~r A Aft 1.1. (AR Afttfttft Al. HASA DF fAtfttAL FtIADf(ffOf
"NO( ft.CT AA NU -S R ECA.AA, (Att('f, fA (f ffttt t At ttfff( ffftt ftA(A'IntAtt tAtt (f ttfffttfftttI_ t(ffttttaf
ftARttgt ftt rtt(f~tt ,,- IA,,, f IR C E T DE L LA O M N S A "t. -f ft ft "I tA Vft((fI(Aff I'll
Ift~~~~tftft(A ft._ If Aft I" rA f ,Af ft (fftf (A-A(t ttt f( tttt fff t -ttA ( -fffff Aff f (f tttA~ tA
I(t'f( f~ttt At~ttt ff( ((f A Do.tt~t rA ft ,__ fft ftr-A1l Y (A C ft fttf ",-'ll,(Afttf (f tttffft (t ftAA(- f A
(A b leftt. Aft i entf 1948t ptrt valort det 28.577f600tfftt excco"t ((A, : 'ft(ni el ftftftftftftft Drft. Pritfesftftt((tfttf Aftb r (fttffttft ftft fttffttf(AftA Af efftft d Jfirr latle ftft ft btf a~,
AA~f~fttftA.(AA t~f (ft .'~ ftft ft ft., 1 t f ( (A~tA( ft~t~fft~t(A (fttftfft~t(A ft~.(~ft~t~
I tAtff IAflff ItA (ft A(. in Re,41b.Af.A( ft~r Fftftftftftftft"
litffttfA lef~ttfffff. (Aftr per 2.01 ,110 Ahoft fte podri '1ft AA", , ftr~ ftf~fff ft de A.ie n ft los ftftfto mrlgyp d ftl ," I) :, ," l (Aer i r.t~il h enft (ft. t ftttrttfflfff e II ar
1.~~~~~ A. ,tttf ft (Af ftf I A.I.,(ffttt ffffttff f
tecft ftrtn r (Aft. tAffttA ,,,'ft'ffttt (A ((Af ft. A (( ft Af(Aff "f I(ft A( I(tt f VI It.1--'(ffttftt'A (A t"f( ftA tA ff A.,b (A((ftft (fif F eI ef,, ArsiD IARI I-T O ,, r ,, I I Ii P ( ) L 9 l) ,LII I a, j ik -I1 A 1
(A.~~ ~~~~~~~ ~~~~ I(tttf~f ,.ttf~ t~ ~ A fttttA .I ftt( 111 ,lI O (tl 1.e FW'ft. Ont- AftA A A Ift tA ftfttfttftfft
tm loo A a (Ae r t l d ,1 D A 1(l D A R A 10 r g i -, !, A t ftttttAIlt,, -l A-- u. ft7~o ttfra((tt( ftt( it .'ars ( r ft f t 1-A '1 'A. A. ) ,VltR, ,,, cii, ,,

P46iden lbr gart-I1k- ,as h an Aft 'At ftAfftt ft AtAff ,( A
coon(A Usct'. r ,n r I (.- .' '17. A, .l .( ft [ ftft ftffttf 5 -. e o
A .' If-I' ,Il (A. Al, ,, -ItA'IfIt-C AA-1 1ftftft0 _.,t- ftftft ,,
foh" n (dnt fti(acli- fttt I~ttf fttftAtttff --. (A,- ? fto ft. l Ink I ", 14 --
(A~fftfftf (A ft'~ (A .(A AAAA.A 'ItI t(At((ft f *(ft( ft t.'' ~ t~~tftj fftft(Afftfftf (Azft ftfIAAT At IaAA--j-0-n .ft l .A-Ift'Af
-. A( ft It I fttft ll _1_1 %A f 11 A I(f (A Af-ft A AA fAA f f( P(Aftftftftft' ft "."'I~fft t -7ft "1(A( ft
Aftftft i A ( .s. -tv c, = f' g r nolt ,J Al- -1, .ftft(A(Ako (ft.'.' If :~tff It tlfff Af fttI~t I ftttff Int Il to t1 t- t inoc e P, .Ift el Aftftf,11t,,I -d' '
ftI ft d t (." 'l Aa 1tjftf ftJ,. ft.'- Af Afffff Id~ftff Itt Itt Af 1 IftAAIItIf ft. Afetffd 120 A.' AftI fftftftP tf 1 ft

on uaruin t m onotdoil Vt~ m~ti (I I~t P1- .( Af ftIfff~f Af Aft ,(f Al 1'(Ag ('fttfttftAft II ((((PAo "teI1 j11, I I
ft~ ~~~~~~~~ ~~~~ ft ftfAfff .,ft-, T ((At!f :fA A A ,t ft, ((A A- ftttt. t(f rlAt(ff -der, -A, (A rft ft ftf Itt tA 'f Af 1tfftfAf At ftl t(R ft ft ftflA 'ft ttft. ,tttt( ft k A (A.fffftttf
ft.-~~ ~~~~~~~~~ ~~~~~~ I~t. Itt.tf (Af (Af AfffifAf (A A-AA(( -f~t~ t '(((A .ttA ltffAf( (((t"fdf tjtfA. H,-- ftA.A 'ttf IA( ( A ft ftItf( A(f tA .A( I ttt. I ft (Aflt A AA, ff -(f I(tft(f ftAf (Aft ( f -ft "A l. A, ftftttl(((fttfftA((tAA ftAA~tA(A Af~ftftAf ffttfttfftt (ft' Af~ltftftft Afft~tffttf AAA A (At Aft~f~f (ft (At ft((f At, z~d
itf~ttt ftffttfft, t ftffttf(Afld tf fto se nn en en Iu ft' Xft,"lft, d(tff ""'ftf atttl~tff ((Af (Af ALt fttt(ff -1.,",f P(Aft :1:t "Att(At6 A _tA ftftt t

((OfjI 1C : ,I pr i, y I l 7 . t ft( ftG "t. (( ~t( .( "' -A "t Af." A. 'lul t(
AIA(AA~~~ ~~~ I-tA I -tAA(f WA ((( ft(fl(A f fttfft ((t fftfttfftfttt (( hutffttf fft(A A V( At((A ff A AtAifAftt AI (I tfftftt(Y tf Ift "(( lt- jAfftf- f f(Aft ,.( f -AAfbtf(((: t .'fpf(( ( A.
.bttft A ug~fltttCttt(ffl(f Af-A ( f. t A (ttf( t(g(fff(f( ft -f f~ t.(. fttttttffIt~ tAffff~ tfffff C(A ft fttfA ftf ff(A (Attf tf I Ifftt ffttfA fttf ff~fAtt. At(ftt 't fttf fttd (A (ftt(ft-ftt( AtAAA_(( AfftfttftftJtt (to ta ll. r .'A l tft el n rnftA o ,4ft : IAA f ( f f f f d P A- lf, t f A f lff f ( A f ( t tf f ( ( ( f f f t t f ft ( -.I a' A lf f (A f .ftft.A ftftl-ftffr ftAI~t A f A ft A (( f ft l A l f ft f f Y~t tf f ( ft t ( tf ff f-tfftt t f (A t tt t ( ft ff.'(A "_ n n r a d n I" 1 1 l t l- ~t ftft tft .t(A A ftftf ft-ft( ftf ft
noftAt" (t'f~f(A( f d dtotf 48.' fttetf"tfftf (((f (ftftt!tf ft din~ .>~.~'~ t'. tffffA (A i ,C9 (Attf" t I t.ff *Attff A" IA T I ft ,6" 1 Af AAItftl.fftft; ,,,AA ft. ft1( fttAf
((A l j' !" A l fl" " i a t ft 'd l n nlAftlftft n.' ft1 C 1 : a d I I A l ((f -((A) t. A .1 ( A I (f t AA ft lt tA ttA (A ft t 'It(( f P t A. T ft & - (A f .'. ft tf ft A A D-f A t 1 1 ff f i t 1
L.wftmftft. lln-,ftftt In (A :o(((Aft -,
sv tA ((At fttAA 'At (ft ft 1_1ft --c'.'.' t(fftft tf.''A .' coA1 I P.'.' I- P .'fft(AftIA(A- (A ,f ftttf(f Afftfft. L ftftftfA ft. fttt ,f-tfttff f t ft(fAft(f At At ft nk" Atf (((Aft Afttf, Aftin t t( (((f ft "A ;A ftA Iftt( ff(A (t
Af A ftttf, ftA(fttAffftttA (Atff~f(A tt-ff ((ftft Xt~ ttf( t tt t~ f'A I- l ,mftft!(A- .-PO ftAslf Wf"tt Ift rtftft.'AAA1tft(((Iftfttftftftft.,((U:tftftftflY ftftoA'. (Af ftt.tAtf1ftttffftA1-tlfA(AA(it(f((ffttIffftf
ft Af et i A .'.' (tfitt(fA, t( (AA-d f"Tftt fT r- tA( (l(f t-f(~ A fI AtfI (A~ .'' .f('ff(ff~ t(( tt( ~t ftf t(l~tfftft ftf Attt tf ,rrAAAAA e7tfftf "mfif(.it. !- ,, ,.', "i 7" ."" ,, ,I" (A -A Aft(dA(IIftftAtftftA Aft Lt"
ftftA~~~, A--A .'.'. fttt.t 4tttA ((Ai c.' cn'rA-. ft' ftfAAA (((( ft ,- _~ffftff (rft A__ ,,, ftt-(~ t A.11 dI It(ffttt (AftA(AI( ((Arr ((ftl IAftIotfA,1ftfIfI'
Af-tf( (fnfA f ioI Tfttftftf .r t1ot -Aft A (((( ((AA AftntAA (A (((fff. ftft (Ao pA (. A( Af((. tft( ((Af (AAA -- t'fAAf~t A- Af tfff Ailft.' Ali m -( l Aozt( p.'A(A. dofff(A(ffttff (ff
A~~t a~oiii (( ftftftftf ft Pftt1ftt tf d, Irf:- ft.'.' ftf,((Afft;f ftA, fttfttf ftt fY 4titf, A f AftfdfttftftA, ftt 'j-- -tA(A,,ftA(Aftftt
l.'ft.'I ~ ~ ~ ~ ~ ~ ~ ,; Afff-tff 1 naff Aft fttffttff IAdA Aft .4 ftftt- -f .A ffffftttlf .t(ff A.Afq- seentItft-(A tA
rttf.ff.'"-(. KA(A I(Atyf~t(~t Ab fA (Atft fftttff
(((f (Af-f ((AlA Ii u ',u r ,! 1 z r t. r r n "'t "Ii" fj n l nl 4 n t -) i co u
t~ftt (A ,, It) le i, In, ftfffA f((ff( Ia W W ~ ~ J ~ Al ; Affttflt( A.er AAt fftff .' y. ftT .fl- 6I ft~t Inft AA(' -ltf ftfto ft( I (((Afntfd I IftI
(Aft~ft pfftAtf( ,I, ex rI A ftttfflfftfff tf ,I "AIA tr l
,,-tlttlf _, ,L _ft, fttff JA --AA%" T AIt G;t ftfff((ffA ( (t ((f t ( f.
ft(l f t ft ft At o e l. d i b --tft -u, A f l A t 6 0 ~ " i -, l, I (A A (Ajtri , n w i y r
prsf PTft ratlft df I.tff A~v],7 Aft -(l Aft~r, A- -Af dotfttt ft A L f'lu g V e f U n ft1. Y a (ft ',, (((A A. ((Af -fA _. J ((f tt IJ ~ ft f (f ft (f (A f
pl'ftfI-tftf f a o It I fl~ t ftfftt(Af fftt IA ( ft~o vnft A t, Iftft a .' '( i(tt (AftAi~l ,_ t : n~ ,'!; -ftAr.' I IA f( tt( A f f,,t ft j- fto. ft
ftml(AA~~ rAfA~flA ((t. (A(fff ffff(ff t'ft f,(t(fff tt(ttt Ob rt (AAAA( ;" ft tf tfea (I I. AA P f(AA f tfffttA At ((f Att ffttt((At (f (f (4tAl tff A At(Af
~((l~, A. laO~ Id (YL'a d u o reio(f ~tA ffAf ( f t f o n f Mao sDw(A (f f( At
Aft (Ag 4iAA (A lAA-Aft(( .-'. ft- -,, TA'. ftIff !tttfftfff ,Eftrofted1i- n I ui' ed ) bl",
I ft ftt. Aftjr ftsli ftfttAVttff(A f fttfft( It((ft 1 I, -d
(AtfffttA ~ tWA ftft'fttt((t( t(AAt pa'a at, prd 4 t VL.' ,.' .''. .' L~r I. -', p n e n e w .' . I .' .'- ftft mft ftftft((lftftft (p((At (
,,,,,Ift AAAA tf ft (AP's (A.'a "I a 611E V ft1ftft fftA(((Af(A ft(AffIfft-tftftftA (Aft f- (Aft. flft(((AA( ft ((AstA( ftntI(A (((((n(( T
I(A i .- A.dAo~(fA bfAf((AtAAt ftt(, tttf(fffttf~tAAt(ff ftAt ,(A(AftA f t Al 41 A(Atftcf ftf(.ttfff(ffftfffff ft,
k A (~rre A .( IK ft Ae,-* alt(tt).f~t.ff( Itttfff (A-- (A'. ft.' (A ,,( (A. Intt'ff (ft ((Aft. -n IT .' V l G ob oo ChtefiIt(O 11 tntu aft (A Auftctlarftffflt f( tf
Al,. ~ ~ ~ d (Aft .Aftd.''u l, , It Aft(n ftlftft ((A- Af"l. ft.f( ~ t ftYft( (A-. ftItftttt(af (ft
(ftll 3.1 cffttfA(-f ft'' in-(A, ftft--, -t Cr. que- f. (AC .A ,,T'(-A AA ,- I TlA A -; P (ftftUl (( ft ((At. ltftft(A ift(Aft. dt.ftft( (.'r 1,,f( A Cd~e tft',: t b ftr?uextm tim I~nlftci.ma f Jtft(aA((Af ,IiTVtttffff'At(ff
IA "AtfAf .' A. ((f. I-t -'. ftLU(vo I-~t( -loafta-t c.' P-'AffAfAAAtttA tA(f AAAtAtff~tff llutft((f eAf~f (Atff 11,t~f ( (Atf ( .
411~ '.f Ri a.fftt AU, IAA A. ((fU grave qfutlOtCOf -'. f tt(((t ~ ftt tf-( A At. .t(f~ffA ftEff (( c.' IA 'n A'14-1tA ft f t I "(A'' (ftfAft t tl ftfftA f t dot( ft' ttAA
fttI(f ftttffltflf (Aft ft,,p'- mfAtff l-rft (( 'o ftftft'f(A ftm .'A- ,.A. ft* ', F- -.A A ftftfftft~tftf Nl' A.1 ft(, -~A Af ((, f
Is t Oft.d Afte, Am (ft Atlftf ft'. -- y T" n.'.' A faA.( t' fA AA ( tttttt( ~ttttAt(f~t tttf(fl'fA lA Aft- T ft, ,I f:, :11 ftAl or'2 i P-', (AAAftA"t (A A.' A.'- ,tA. ((fr"(l((AA(,A(Af A
nA tftAA -ftft- tA ftftftf U ftt(Af(ffA ft(- f tr "(t d Afta det(~ t fffft Aft
stffttf((Af ft cr~' ".'f~tl Aft Aft- -Af -AftA .ft:AAA((ftfd o I ( .ftftfftt a n _,I ., ,, AA Itft( (- (At AAA(f((fttf AftftA lfttft( ftt(A( tft(t t( m d"')
Aftft ~ ~ ~ ISft' ft.,-L (( ((tffft-,ff (A, ((AlA Ao. -tftft(Af A.'t(.I dtff( (tffff~t A .0 !''. A(A TA t f AAA ( tt.f(( 'tff( tt-f (IA t(1(ft(t't(((f AtfA A ftttl: t ((t. f ff Af7tf t A A t'.
-A.s "tft ditf Itf -(tfttttfff ft (ftt. ;(A'- IL. r -f~ttff~t ((Aft( a.( A. (At : Aftftt ,ftt ftlfftf ,_AA (Aftt _tf Aft ft7. ftf t I (Aft~~t, A V ft-f I((( f onAf (f(fA f((fff( ftJ fff AA(t t (.f~tlt (t
(((t, -dotfa ft t.fado (A _,fAA nt ,A ft( dfAf~ t. (((A ft'd( --tf~t(t~ tff~tttf. ((fts I TtAfftt ft (ftctf tft IAftttt.AiAtA .,tI- tfttA fttt(f cfA(CtOf Ift(tff
(AA~~~~~ftft ~~r, ftff(A"t -tft Af tmt 1,( A- - .A.A. A-,ftf (Aol ftftf .t t~tttf ((f(( .'.'A .' '.''. ((f tAfft A(fA l AtAtA'( (((A(ftAftftftf IA(AAAA ftIn -1 def(((A(f( A Ckfttt(f, fA( l ((-' A, "(f (.Ilab.' -*'3 i' A't((~ f t
(f -ffttff Jar fttiW Pttfff(Atf (A IA -'.' f(ft ,,(tt((I ft II,( ((Af( (( tt
-fffff~tf~ttftt(A(ff~ ttAf( (((f (Aft, ft'. -fttf tt ((W fttf ftffItff fttttt tt( r(f fl'. ,A,,,-- Aft-ft .'t.'(tl fttrttfftAf( .'(Atf"- la e t- ha f fttf((t (A ((lA A tA(tAA(A(f( Af (f fft(fAA
L- tmft=ft rftf t -tt Af tft' -n s( fttf f A n-t.A'ff(A A(~ t~ tffA ffA(tAtffff ((.'( AA1A ((AtAf Af ". (((f (A., TftDtlf .1, IAAIA (Attff( IA 'hi 1oA nod al Int ( (((A, ~ ~ ~ ~ ~ i ,At (Aft Bsrsi(A -A~ Aft ,,-t ftfft(AAft AAA fttV(At fttffAA (f.(tf fAAtf (( ft t(tt(fff Ifft (AAfla A(1 1 (((ft Aft -,ftttff (A (t' ttfA AAf (AU AtI ft rAf f f
(Af Clnft aft.'. ft BreAA A((t ff in- ftf ftft Aftc-I rn -Tfttff A (AttfA f: f ((fft( ffttttf If ft-t fAf'f~ tf.'tff~ 't. ft _ ,",c c ~' rt t t rne cerddd tt
AA~~ftA.' ft '. (((ftt A(A ftt((A( ftftft A, -A (ffttfft(A((f ((f fi
l (l .I A~r ft.'- ,,,' A-~h t Qff .(A If Aft A.1 ,A2ttt'ff .A (A7 ft ft_7~ff (A (A ftfftf(A((f WZfftlt=f-ft ftf(In--- ((((A Aft f.ftftfrftftftI t'('ft'(A ft A.'ftnftlftF-(IAAAAAADM(((ftaftA
Aftft.( ft.'ft (Aftl .'ais A'i~a AA fItAftffsttA)tC .fA fct ttfltt fA Afattf ft frtttt tttf-ftttictif(A fltt((lo"r ,(AA(ftA ((f~t(f((.(t. ff(fIA A(tffft(((((
Vo, ftttft ftatttttf (A tfftfafftfft ftt~t ftftft ftf.(fttA AAAfef ft, zt ftft 0A fttffffttttt ((Aftz ft f ff, t ttfft AAft Atftft(ftt1t ttfft fO((A t'A tl 'fA AftttA LI. Atd f ((t ((f
ft3fft rV tA f( ft fA tA f t( f. f.f(A f ", cA f~ffftAd ,leAAtAf~tA~f~ttAtAA~ tA l ii n r, (ffAd tftt Aftft(A ln tr((tftffff(f
ft.'~l ft.'11 ft -ffAftt'A "',(A ft(f ((f Aft fttffftt (f
19ttfp fftttfff ( fA ( ( f 5 ft 10A ~ tf~f~t f. fto As W-(ft(A I(i-Aft,, ft ft( (((d, c- d (Af F e ft ft ft c iA a lA~ tttAt D A .' t fttttttt(.ttttfffffOtf
(ftlf 11 1 ft1 a~ (tff AfIfht(A~tf(A A RX IntftftA a ftetf a s 1(:f((
Em, ((Aftftnfff.t(A ft (AftftftftftCht Il(Aft.' fdftDI.ft(Aftftftft nft;ft _-,fd, .f, -, ttiA -- ft ft(-(ftSA f ftftA(Aftc C ( ft(ottA.ft(Atftttfftf.'tfftflfftftfftftt. ftt fint-'AAftt(ftffttfft((f(.fI( A l b
dA ~(.' _: .'t A~ pt:-(A- (f _A- ftftft ft (A -( ftttA(f ftA (At tflttA'tttf t fff(At ff((t.ff( fff
ft fft~t.Lf.((tft(ftfftfA~fttftt ft'ftt A ftf A t A~t f~ftl A ft. (Al ftP V ft. ((At fftfttftft ftAAftfftftt(AftAAAfttI((A tfI, .' '.V lfatftttAftrjfttA'.' .to' (((ftl
((Afftfttftftft~l.ftfttft~tftftA~ftf- (A (Af.' (Aft (( ft~f ftAAA. ft Aft -(A ft ~ ftf~ftt fttftAAftftfttl~tft ft~f((fftftt (A (At(AtAfttftf ftft f f.Af_ t(A ll AfItftP(A-t (((t (( ftfft ttfftfliftft -(((toftt, I"(fftf
ft.A.~~C1: Ig .' i' .'. ,Aftft ftfft A .', (f-f.- ft fftttfffftf ff(A ffttA( f.Af( t .'.(Atfft .- A(A Apffft-t I'ff to AA
(A AANtfftftAf 't A ft f l ( At(' A f( 'tf- (ft'fftff I'( ft' ffl L( f. ff fffft(r(A At.Aff tt A Af- (ff(ft,.A(A ''.
ZAl ,'"Yl ft ft ,f (%"" -T (ft.In A, -Af ,tA ((f. Ajlf t '. sffI -(A-t-, (f.(f ~ t(ff A A
_,tffftt .' 1'.' Al.' (Af (Aaii~cii (ftori A-.';em~~;SIov Pomrr" yu ,"'
fI I oq e e trd t ftft -ft. o I- .A I: AftftA ftB.fftt-t __ .(A~f AftZ m eIC, do ,1 ft Af,(ff( fttff doftf((A Iff~ ttttA ttt(( ffffA A tt f( (A t m,; ( ((tft
IntAff ftfA fA z" nA-Aft. ((f .' i A(f, t A(,,_,A1,, ft ftftftf (A l"ftftf- ftffA tA f~tt.(~ tt ,ff (AfttAA (A -tttltffffA (A(n'ItA if(fttAf( (ft (((. ftE ,, ;rftA ft ftAA(A A(- f tfttt(f t.~ (ft -l~( '. ,'ttA'A l Atli 11(Ad

"ol A.U-1 .A onaf frxr(ft do;tAf In,~f Aft- (At. (A, ftAAA dtftf-tA.~l -i ler l- :, pr( ftA AfAffffAfA (Aft. ftr.ff~ttA ff(~ttA(t
(Aftft((,~~ ~~~~~ ~~~~~ ftt(ftf 1.t.'A t -A Aftt(A ftont(ff(Attf ((RI DEAf LAftft ((Aft1 A(6116(Aflf Y(( fttftf Aftft ftA(. 1.ttf~t A(fttf ((t (tA f1tf( (( At.At(ff A (A ( tAt( tA (fffOtt tfltt-Atttttft t(tffftt('ttttA AAf ( tAA A(tf(f t'f t f( 'rttt (
ftt-,(tt fttff -!tf -( (ft Isf ft(,ttfff tA .ff tf(fft f f(fff.ftttttt AttAf~tf tff A A At'(tA ~ '((( 'tf. At.ff.A t. l(.i~ tA A ttAff~tffff fffff ttfA f.- f( (t'((t







N*wpsDARO DE LA MARINA -MARM,$ 20 DE SEPT. 19149 1AinO CM

Chhsrelz Deirdntiioadministnuivni -- ~ Sdor a elD.iISe entrerislt6 Prif con Mferelato I poya~ el PRC

~iilagia~orF.del alcaflde licohis Castellianos i PRC en Cienfijegwl Mora y el Mlinistro del Traojol a Cat' ao
hfa eloallos el ifesuipiteto en eirwo illi~ne die .~ro l0brj~ el 0bwm -tm ~"p 'c--n ient ir et irrn mpreiat
z0o iajm atancera p040* anwdles. Exeple ~s sf'rifios bpspiultrios parl ," ,," ''.' ,' etfteajla o(u lrti 0,w onwfii-e: pa a AIcaJde ~~~~a Ir do 800 m i a
,-d-@~e~ne~ 'tlqi Qa i .rlj I'jJ ,L"le d Pant 'I -ntkao. a, coa; ri-, ;"tfeT IJ1 1 .Pli,;t, ,
-, dl i-11", d ""! -,9-,- Piel-rrit ds i *1b di e d .4s f it ie -11,1" 41 1fil1) lv,14 lt ac,
ojeluca,- el, ehbasl oac1''1lT "'~ ") "i""'14. l)issl,,,,,1 P -'5 I I__________ asssesns lins
Grncoenrai . isia cF-i'-i, 1.144 t~~it" ii i cicuucui liii, 15sh54 55 *45. i Isli sisci
isis cic ,,,flh ci sss,,b-,1 s,iIci i45ss. icc "s,4ls.l 1PC,Tit .41 "t ,", d___V" ,- "
114 siuci.A~ ,,ec %tciiiiis clciiiii c -'r yisc -.45.hil4 ci.lid, ",ei1. to 5s C,,isl& W--,ll
omodox f4thao11 -,,' l~f i, ci i S ccicicc iiiii idiqi fl, ii -. .cili 114 w ,4c is 4~ ~ ,, d'. tI,-',
1554. ,i A -lii .1111114 1-i.u5 i -i-S_ -4 hic5 5 1i1 b 5 5 ,Icsic A n ermi vo ssic A fs541. scduis l t il ii- e. ,, ll cisc,' 4cci Aiss ,.,. chi" 114 cuss, ~,it ,j ,?-, 74 I i'iscti I'lli I 4 l
,,S--' ,.s- cf- ,il cidis, 111cc i"i- ',. 1e41 Itiic
C .haMM ycn$ tll !-Id elCarg, hro, d, .-t,'Inet-,,,i- i, ,,zi ,,- ,r 1 .; ,t ;, r'. R aci,*o N n 01111,ib-si 'I- ,,,111,1, ,,i 61si t1ci~illlsii lSSliis le5555455i .1-.d IIS1,- i l~~~sis~cisslci" ft s"Kq ii Iid Ii 111 41t ci Iii ,iii l 151 isi sec c~ ~ ,5g15l~l,1 ,'. Il 11 hiitl
Il 11 radil d e A lcscciei z. il- -t iS I -l 1 I, P-li~ wI, 5c -551 d .5 t c i5 AS' Ifi Aeiici ,'_ ",cis I. 15111 li
355 ldelii r i s l I ,- 1!, 44.sI-tt ,, iic g l" iu ~ ~ iiisile c Y;" Iscs~iss "I'll"!sc 5 ,A rf- sci 411111,, : ,,,lIl%111't .
Mhssisiis~~~~~~~~sl, .- -s~s Cli_ .14c ,4 s cusll
1 -~h~ c t -el, Cc i c ,- .l d ;-1 1 oj F"i ,,c. 'T t 1 i "1 iii-tss
hisIsscss iicpic~.-4s ciccsi ssiesipe ish ,ec c, i. Ic f15 ,i-. 3sclc .si~si .l be" 14 isi cc i S ci1 "Ici14. ~l tics Isssil p ~siciuis4 scicisss~.5hlscidiiuucihc 4.~ sm~ssvll 5 ssis i cccii' lc~scs,,._.tclil.sc__el___c 11liiillhd~ul~l14uiis5It~.I1l41.i h-di "",~4.~ ,1),, t ic i 'ls0 t" ciciec 1 .111 '_c 4.Is iiii11h4yc.
" 4I" Icililsls C"Iu lie hi .1 is ii csdcl,
.1""" 41,s1 "c5 iic lc scu c ib iii-thi1 W ii ti5i.Yc 11. 1t"' 1 1 11 1, :,


A slf c 1- 551 1ral OImlc. 11 ,- 4 l. 1 'i ,'lsl sic 411111 .4. esis ,siils -IAi I.o sit "I I -411
,,ic iciuuiiiici cisiici., IV 1, Mihitst-1 I'lltlscilicie ii ll~l 1- E n frf -,' -,71"l ,,,
,_is~ C -cc ii,,l Aii. t -.i C s--i iis 1 ,, isi d cci,, lu! ic- ec1- s ci', i l ,; 'm c S .,, id-Frn rti~ '- C,. J, ,.1 JI*- ,,i: l
bkI1 il-SllsIs Ittllb ci. -sc V- d-i, i- II, 1 5l ,- A ictteihe cdi;saif,- ,c~~th II -c "ill1 (14 hiiic sclchii I -6 e
ilc~~~~~~~~~~~~s~6 ,s5sci scf In -,scissledli.Ieci- ic cIeci s1ss, 4 'etc A diisItSjslitlil A ecl!iclc lsli sisSls
is wr5555 -. i ,e 1.1ttl,,iP- Iiim-ci "
I S p~na, J ~ ri A i, ,,,. ciee, el Iss, It' i c- i -id picel t i siit -lsc 1 "b 6,I,, l t1 11 "- "Z ,, ,' ,,, 'h I
,1. ,c c lcsl TsiiIccsi dls 5sclie' I i4 c1 c I si-.s-itesdiiiiiili.l ieliccusstl iesiitct
.e~i41~i I lli4. s--_______. ______'1.,t Ii-.15 secj d -eii 1 sii 4. iic c i "*St1 I -ll itiIsii4 ic" ci4

Is iisl siets ic ei-, n G,- c A. Psto Isis-ic,., il',ls ,11'5. 4. i qicl -11, I 115. I:E I~ e l" Iss l- sicc A(rlcrl l -6-1,
T dtt ul V ld 4. I't __- t ,i, i__ i ciusuuss-o0,,,es- 1f 11'csc 111"o iltel Cciii ,Ist ,,,F,-l11
seIc s 11 Prmsc tciis C --ess -i d1114 lhillcci Aiin iji l l"7 ,, ce' zl "i,.- ,c .- is ,ss hi t~~iili 111 s t cccl ss11ifl it ,I
,is's Isi CiIIcc cli is, d 1.411. ii s5 I c ,-c ,a,- .~ieiii~ tisec Ic "5 ; l111.t, I sn ieltccs IcchI- r stliUe 1Ic 'lI lie 1 I 'sls l,
).t 5 'T,, s,. Scisles 11.11 nsl in ISs- -iitei i, dlll z csl i c1 "ett """~ 54 ~ i15555 '.~ ccf r45' i"liti iii, hilsed, ,I ciie COAlc
ilciiss~sS 55.5se c s I -ilhi 1151 nit Is. 154 4,,55 sli ,,uil C's st'ec55 11 s c, ;lci~ s45~1l11
deSsnl ilhs 4. -; du i, I Tc.s. si -tCeetit51411141i i ,n"515 -14.1151cuesliC th- s std s 4t4, isciI ,il 1 5csl
,clscil~c~~ls.5disin-i Si i- siietd4. 5 Scdlc iee11ii si t St~i.eiee'u-iiti,1ti~i c I 1155515ci51,
s- ,;ccc ,I -11 dG I 1 hel , -,ipi ,t P _, li n2l--~ stlJl" itn Isi 'vs sll s 4. -------i~il 0z 1,,Ili.
C.1 _cssc5 4-1 d'!isl DId, isis.fl Vs4 n-leds ,I-i.lnci-e I ---cislesscusisssc.4 i. -t ""cbi-.uil ccscd isilicclIlis sicsn -Shi 11lili cc il lc 1
elil5~ 11 ,,, : rtscsi.5loqis,, ; a-t - -, -; s,i4sl is 11' n-.-u Iiici 'I'" ,cs -n (i55515111ti5 5L
A-l 14ei C- ,-is z _, , ,f ,, I h.- c'"i shecs hi Is n-ecl sl'l
(hilisus ,,cici", 7 _-~ic li us- . 151 I_~laco I~~sli _-_--1i554i 4- I I 11 1 55- 1 sin V til il huliec ,,.,W,, r f t",i4 ss -l IstciOis4l. dcs 1s -m Iid, 4.ilsili 4.ll i its' 5 Cts tc '-,i -, e ,1r, l4 Ii I" Iwii~~ n-c.l__', 11
.~cc, I s I-Ictn lcs lss I C.le-t- I ic -,- di -,1 .h- Ic 'IlilIcclhisii I" i- "11
55i es sssce.isilcidi-i' d-s. 0* --hiim lwsusiln I,,, ,r, ,Il 0*- iil~ c cti iL ssu dti~edi c c c slrl
.1"' i. Aiitst u,e, Iitc~ c ei,- c i s i 1 i ;ltic 5'cdsiii is hi"' Iie I)c ,511 itsii -is .1i s
to JQ'" 6,- lft, ,~l Ilcsi cd,lsi iSA dls, is-' Is c ", yli ,ltsiI
Id ,_,r, ,,,; dI ' I514c Iccl it""l.,.I-'c pee Ici t ci ciceisil ,1 510 1 5,I 51 Al
otro~j-, VOiu Al iel inIc- ,, -n-!PS __ __
Jtlicc -~nc~tie sn n-s ,l C!ci n-I ,. cus I islsl 41 .~~s i-i hitdu- cc li, 't
G, ,atel~drd, _1v' " 1l ,1 lI,- ,1 JW , A~. ,4:" i,r,,ii l cc s--- -iec ictii I si-e _55c sic, -1115 .--,ii-clislsshi,
, ~ ~ ~ ~ ~ ~ ~ ~ es -, Psllcs ,i PhI 11 m~i ic ci. I .Isuctbcc, t ,r~ l-_'Siit i-cc C, 555i ,l -~u die li i.i.ncs c u ci ti~ii ssi_ 55144 sI, ?siul tn- ,sls r1cilci -I ", 'cd
Cs, ~ ~ ~ ~ ~ ~ ~ hi, slll;cl ts- cci ss Iss c1c Isu'I I 11 sel' u. I in -nn.c s.41141i c ii~il1.4 1iidcil4
G-. Csscccis ccish -i--~- i, ciii's,- s,-l eIu .11 -i ,u 11 114. I c ceitc110.d t 1
sI P i I- il- Ilc ccc 11,, ; -,-j r, --- 1- "'ill C"i -elll "lei Si c4 Issi eis ecd Id lsi ,,cc -11c 0ililis it515 "I",c~ O
slccis P, ,c~lccc cc Ic' 1- .l ,- ;:1 -ts Icihisis~, Is ,i 4.h Iscic (Iccc Ild r isclc icli Ih e "'.
liii I 'I7.J d'!i 114.511 "c-i 1,s 1- ic dids !,ci f-s Iusds ,licl -i icec Ii ,. ilill ,~5
-cs~sui Is, 4.14 ccl is- ,li I-sue--l A. iuc-icc -d ,stcc \-l Ic ci/le ,- s hem Is 'I- Il7 IlFe dlAA licels"",",,,,l"",dis. 5, 5tcs i incslh -i hi .~cs 4s - ,1 )11 sil-ii elciS-, It i i'ii Il e 11th A1 tcsic-15ii4 I
5511 3cc Isiccs l : &I li _Ls g--------- ------ -- -csl clii dietcdl.5 1- 111 ei-i 5d ics-4 i dlS
Ss i ss- l ic Iiit I o ifon ev i cli 22 11 1 ; I -1 I siliceu ic ccicil riic uds -1uuiii c;i 15- ,1-1, 4
555Cicsssss iWl i I ,~ ,~u a m u 'v, 1~csliti~ci isi did"l -u Is Is dl4 l l cn i-uin- nMTl
15455- c- I 11 ., I'u' Id liicilllilnIcuu isi Iccic4 -ieil i t his
Isc"i I. ln-- P5~ 15.55 i iscs I -,1cc 551' IU ~ U 'j. l"",-ii4 11 c5.li iiiuil iu f ls;I,-,,,,k i
Icr. rareics sicii l ,,iiiiu fAl siric a vcicc c ip1itl ellIUU, l' uig-siticclcc l
tili din I 1,115.V i- iS,-I :side qi ,,tbiui T .idil ci ecI s lluiselui ,ccc l ,, ,,! ,,,;,,,,Isisl

tclsedtclustucl1d 'isss ____ )14. 1en c",11 Iu ;11 1cdl ", .iIf,,, i1Alt,
Il~ i 5 i- 5 c c, Il lic -i r cii fs. -icitu ',,' p -,i t ,~ c l I t 4AT -i. --i -. ii i-' Ii __ __l i -i, I -I ___, Is -, i c 11 lu lc 1l1 el ss C 4.i jelii1 s~ Iiu uilli 1 c
isic Miseci - I.It C "I c As Ics. -ul- i ,e c ,ci c iAsl -, Isi 3 I5 Iiihu;;eetts'll, ciieei'siin-Sil
Ilcsici-cec Iss -t~cciss I~,sd h -- I fU FlPidi'e5.ccllilJltSi
sb dl P-,10 icc lisi l "i '1114 I I"I", isis
F.lie MII Ic c eie-i --' ,"ti' l l1111111c S0ctiu.u~ii~e s 5 s p r
v I'dsltc, -I :a,-t eci-i i-c-l ill- ci ,, nd a. Ii eleli ,uls Ik t .1 E l
Wileicll i r, tei dcl 14il 14 -_t'le 1-i ,hi~ic Ii I is S1cticcis Ic 'l I 1f - 1"~i .IIk
,,, ,, 11 Camnt"R .- 1 do -aci Malansas alar -sl- "",iiieI VAUO

e-c.ir~iuii"-1 ,ii sls cn-ci-llt-- 01 4042 dooa feah ISctld da arrienlet quol c stye n suieildIsiigd s-1i
III ~ ~ ~ ~ ~ ~ ~ -l--i'scd iesflrd d dons 5-t is ii, -sd 4. lilie rd1i5 lie iithiii tci-,,---Y I T,-," ",r l, 1,'r! "t,'-&~
C, _______________________ An4.ac Wrn as~iii- lo e t.o 10 e-a 0.! ccci n-i- ,liss'lihic. ,.-. I~ -iudlsI1,dpll
:" !e tlil!t dilli -ii ., 5, sesiis t-si -ton e T ibor'. Sn -P. .ia
.il, ts 4.cc'5in *1 En an nen *Enpo. h _ld p 5iad pa '!Al.a, "o." 515AA MA11 "csic sic,0
de,~~1151 IliI ACi1TC5 -- -, -- A cf l -l" len,: .,
R aw s urrcs E TC O Li4e.s'd 'Ite llei- ds. la adnoiislr ida do, 011 nogaclae,. byj ,r1 al Iiiao a ud A~ncl -l llc c
Hoehs d soa~n % ii,, --ll- wyc"' Ji -'i- -g55 .u~ ,~Ici~ e- n-.iI Acii o
d515i,5T= = = 5 s s av5 .'. 5.da w.
licul-ccid- 'l fl sO ,I i~o 1090100. 100 l;; is '. Plum-a Lis_ 9 i d. I S ,hu11., i 5 .1,a.
Adsscic_,Il, 7 -, -ss lid Mi ,a,-c.t4icc~l ,ci '~ee ded1.oa I 00r0 c ccsAcceu M c" ~ ,,l- ,
CuAd G~flcciui3 S lD nc 1.- - - -_ ,l 1.I- lc'lpa--c lo b li Ina- &05 ulcs d,16 mioet ced
is-c ft," Pi. p, li Aic -aac
= t. ide n sis'd c ,_ l-c dco aa'saa ci-' 9.4.A I- r U el ut -cp,' e

iA -es-, - 1 i- I iIaI_ Z a - o s : u c a t y -or M S iiu i I-il. 1111 ccili tddi I- i s I -d s s c ss s t s s l
A 1 r 'Ii sicfc i tisiii t -s s i r ,~ ,' Is Iss ". csc,1.ci 1~ia~d 1us us1i di ct -stld ss sc s 'cisssd ls
ran roconazrftsas"Ili r Osi A pO f i s. ssI u riarsjuflactccton cI -fu leiislc dd tor" Pbs P1., 11 dc PZ 1 r d l e c V
Tien, ie J01.- corrot -:pandienlo s lanes las-. quo in usiv,
_icp re-an i-. I Ie-e Is -esh 1, ilf t "191
'tA Is ssiesl sisidi Is I__ _ _ 1' 5 I ss 25 -s ucitsie'st-I ly 1,l s.
Is ss- -iil Wsl 10 oao- po4ico quo 001 Scsino Ia maiv _O ia 11f 51004 icilc scieid dcl1.eltl it cull Si-i-nd I,
,iiti in.-.i &5 ill dtl nlss4*A P. -ie e- Illieteicic"j Ii ,I ll Ii e iPeic- 5

l14 R. I -In'~drar .'csu aa bansitud n de l i Isriuc il e tu cius r I-i ie- tnthin
I ,iI l~i i, V ,,, i t tfiiiO ella 4 por duicasil oseirre71ci11s .ci c e os n t psds
ir-1ol -,tcci In do s ,I nl uf sO qu 4r054-.I c le Je d 11, ~iu d:, s i, use act s1"Dia y ate
,-11 rlelic,'r di:, 1i se icocdil e
-1 l - C .c Y-. r.c-i U, S.s .an- l e x n-I sd. llccl set. S. Z- i t ,I
15 L --- -1~s Fciii~c c-i seduc t"ii cSi
0 sli- "s a- l- 1d -s ss ss SI c is, l c c, ,5 .Vc, l5s,1.s1n-. 'iIe s lsnt e ie Ilmt l sill-itsis is': ouoflns _ff2" ,- -I .J .1 1 21 I10 ja = = ,, IStia cdii sI 51, s i iilt__ ,it isss BR -- -nsc ciiilt Fero ar -e t5re edict Re
7A- stsisl ,, ,P-i-s orga ttj~l~~ 1011 r.ad~~5 .5ise s's "cciilc A't l f-7 o "f
I" h ,t ,I, ;- - I Iu Ii cuse :l~ usl ,ehill -~ 4--11 --I- ln .1116 .1' sa = ciiforerde sils Is ltldiit Ier
I -_ ariaqu s cicess lile nl~ c- c .1-i-'
C1u11, et dii 3- icl --cc Ise c -, ,j 1 .f~ ,~- l ~ kUo o.








-AND CXVII DIARTI) DE LA MARINA.-MART{-9. 20 DL SEPT. DE 1949 PAGINA TRES



La Habana te~~Urnse para defender sit deree haiL ~ __AIN 5


d46n,3 3/33/3 fm., % NACA ci seflotSNl6/5 5
di. 3/33: L. 13,2I.b.-, ,I

de 33/333333. 33S. ., i Z ~ 'Mvrr"I~an tiesteban!
3eo r.ody 1n3. 3333323'it 13 --i---r---i
a3.36.3/ /3/13/33deqeenbee i iliaiocedeIietri.
to.3 d. o h AIT I/N2coAIE33O ADA n /3 du /3333/33., -A- y3Poe U/.333/3-3.
sent3/ 3326332g~, 13163.3 P- cl,3./3 W/. /3/3 .33 3 ./32w -, 3/63.1- p- 3313.3,3.t III Azearo. I
/3.3/3.33~~~~~ ~ ~~~ A33 /~333. ,23/3.313313//3233
/331333313/I3TN 3TO ewtan3A 333/13- 323333//3333,/3 1-315i .3 1. SA. i he/13333/3//3/33333/ 233./.3 Wig.33 ,u7,,,,3/3/3333/33.33.33.3.3333.3
32 13~32~ 33/33233/33333. 333 3/3- -v 33r~. ha. 3 /3133 3. t-1 10 .~ 3/./3.3. /, 331/3 /313i 33r.332/63i 6
To. 33 313.3/33. /333/3 33 -3 33333/ 313 /2332/3//33 /113/s13323 13332 1 3.2.33 33 2/.
darlea~~~~~1/ 3232 Et,2313 1. p3/!3 do./63.332/pr3t.btil- 3pi- q -i. r/ro3321.,. a 3.3/32d re a33/ y//3 /3,-3 f3trPryienr W n,
de/331.323// 333/.333333.333////3/3233/3/313 33/333/3 333/3333.//,33do23233.1.6/332333
3/3333/3333/333/32/3 .a w- Poe,/1323///33133133333133t/3333336
da 3/j~ Co./ e33/ el32/33//332/3,332 In 33 A323/2 A3/3 e13 3. 3133y/13333/3///313 33t!, I2/33133/2/1/3
'd23,1, 6i., n3rnr -16 /33333 3/133el311-23P333A3 110,3313*3331 33,/3233323,3
r3 13, ni nta 3/3/333/ 33/32/ 63' t/3-331/3 3333 3to3//33/3
an P/33/3/33.33333 / 1,3,l3/333/13333332 Union3 deRt I"b l3//3/ d/ 33 3/. Aso .~.33A.33o 3/3/3/33//3 133/,33 63/ 3//3/31333/32 /2333
/~~~~~~~~~ 3. m n~o jol3/ 3/_ 3.1.-/, d,3233 ;./ 33333 ////33 3333
/3333h 33332336/ 32 36-33/a3/3.y 333333 ~ 22 33331333 33.33/333313 l 3,333/6/33


nust ,2E5 I c d33/3a Aeln l3oi23 reI33
/33333332333333/3133 331333.13333333/3333/ A2/3.33 .,.a t/3333
33.3 336333//3/32323 to333/ 333 oe33/3*13/
3.eg 323303133.333 doll,32/333 33333/333 32/
1.33/33. 33333333/33 b/uy -e l n,_o t t 19se-A
mrn333133/23323331/2/3/ q- /S-/3~ 333/.33 33,3 -3/33 Ao 13333-33 2//333/31333/33. 1 //3/3 3./33331/1/ 3 33
I3333 333313/ deCln-
]a 3333 1332 de I2~~ r, H. to3 632/na d,3.1 13 //33/33 11 0//
oa t3.it333 3,, 6p- de/l3// t.3,33/1/333334j323 a,6/63333322/33333
y3Plane3333/33333r-nr332333333/3/3232RtA33(n
13333/3333,3233.333333/ nA I3.33233 ,3 1 3/3/3/.3323I. -P ,,
333333333/./32 color333,/3312 3.33 I-363/236/33 h.23/////33 dif- 3/31/33e033I
3/3313232333 A F Et -.3/~3~ 3/333/3333//22333 363.313.3363/
ir~o l .W i- 1 o/,3/ UB I
I K /,.P ct;i~x/z 2/ /3g. d, 333 r a3 3233/13U3/3

333 3/3 333 .3 al'rln Mr OR 18_ t32v Afl -eN1~j!YHNRSD RI
6/31313.323'a/132 el6 /niMr 1-13/ t/": 33.3/33.3/363/3./32/314 K11W",
q23t/3 323/33 3 3 3 /I /3 3/ 11-a /3e / -: d, 3/3,3I




,d-.3 -, SHE /
1,,, -b-2l;~ &I 10x y eo rn ~oao

po/333313233/333 e3 tsinll Ides. 323/33.3/13 A I An
CITlIL -/ 333 C ", de Ar o 333 /33
633 33333333333 Per323/3 b-- / / 1 31 33333.33//333 33/3/3233
-b.3 pr33d 3n 1,3.3332 Oil/33333336/3/1/
Habana 33233/-333-3 'n Wm3.32 lz D3 3e t 3n /ea 3/333/33//. 323333/3/. d, 1333233333332/3/
3h.d. /3 32 1c,3 3 3/31333 1133 Y133333.331331 1 333 d2r!233/ 33 ~ I3 ~ /333// 313323332333323 333133 ~ ~ ~ ~ ~ o,- 3/b~ y3 3.C/33//./,.3. 333333 3332 3633 3// /3
013/333./3e3/ one33/33233 /33/3/26/33311 Tif -SP --f14
/3333333 de /33333e c33 9 ,0 1333333 1333313 33/33 33/ 333 3. 333 '- 33.33.33//333

VIA3P /3.3.33.6,Ia exe333/33cl33//3 de/3 /.33.3o333-3,-/3333333A63.3Tin3
33/333.33233313332/3/332/333/333v2 "oao r, /333/3233,/33333 33.233333322/33333/.33333./3.23/ Pon"

PARA333 LA332/323/\333DE333MARTI3.3/33./3333.13/33.33.333/323.de3/3k3 3 3 3 2 / '0
32.o32~~323.3~~I33333/33~L t/333 tie 3/33ntl Inn"3.3 s,3/333332333323- 32333/33i3//W//3333 33./3' /2333///3/333/3333/3/33
Se_____d,6 _______.___--e,,______________________________t____a
ret-~~~~~3 P-33 I333./~33 33, 3S el 3/33 33/v Ia333 3332/ntaabuat1a4 onies wlWr
3.3/33/323333.33/3323333/.13 02/3 3/3.3/3/./30p/23/2333323223/ I,331,,2 E N n_ O
de2$93,00/33j333/3///3. .dest317 1i: 334-33C/33t
de 33t', b .3/3-l-o 32e 3o~ 32pei3 /341 .33333333
33-3 3333 ~33333330 23/33
d'3/33"twill.33-33/3 323,iv Ae C',31/3/33 3233.3.t-3/3333322l//3 / ./ 3/ 3 3 3 3. 3 ,/3.I
/d. .33333 .23 1333/332 3333133 /33/332 a, o. /t /6 3 /33 3 /3 3 / /32,3333




VEN LM16n DtIEn~fl.Z %.)
lo/,' 333.33f.;3,,
Tlln ~~~ ~ ~ ~ ~ 1 333333333/ 1 et. r ;6 J6 ,ti-uel .d ~
3 3.33 3 /33 3.t63,t~l2,
u,. . . . . 3. 3/ t y/311 332d. /.n~i, -n313/



D14T. . . 3 Y de d- e di 8 /in.r 3J9
v3 in3 p,,- i32i2.33323/33.33d








A peCotnsr de ma par el ~ bano


or- CA gEltU D O6rG t,



It4 d4d de hi
ent t,,t . . . 33a~l ,, -_ f
alx -do

r 332Ma 3D 3 mi







ELM ONDo pities ii! No vedeo Coto soaeneund
d Sdlere an C no" 33 333133
1333333333233/333333/3333-33.331/333 32/333/ 13333 32 333333/33333/3/3// 2/3~2 3 3 A331331.3333
33.33/31333~~~~~ap-w ZENTH 133.333333323 /333/33/ 33 33/36 /31323331 233233 133 3 34 E3.0 43

~ /~/33/3333/3/333 ~ 332/13313 13/3 1.323 32333TO. 23/333333 /3/333





I ~ aa adaecn ts


Si ~ ~ ~ ~ ~ ~ ~ ~ n voe oe oru ai angaed aia ecpina3 esdnEl RT UAHSAOEL ET
oba y aig SEE Zeit Imera y voe J__ Ilear apefci-a itsa hene Io 0o 1 ETCUC WE
____ ____ ____ 33. 1r

A' ta33/3os 33. LA P C

E//H3OICEON~~~~~~~ t.1*/AA A36011 _ ap c
033332 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ry E: serm32 e333333333 a!3 /3333333 33333333/33333/ __________333.3333 ~~~~~~ ~Cotia do 3.m/3 3ar el2 3. 333 33 3.1 ~~,,3 .33

*323332/33333 '33333/33 ~~73 /333203 333. 3333333333333233333 t3o~33~333. SESC sBSEY NUCJSEEl


332.333 3/ 3. 3 /33333,3 ,33 333333.3233/33333333/3 -I 2333J33/
3223 333. 3. 3333 /333 /33 3 3~t1 3 r .:-~ l. 3EEEO E A AWMo A /E/P MJR UEID YQU ASEAAT VNU




_____________ 3A



AG3N3AO13 433140023312/334 N /0013LA EPAEU4








I PATINA CUATRtO D1)14G GU LA MAINA.- TAREN. 20 DL 11 DY 149 AIO X1
DIARIODE---, LA MA IN I______ '_1)A H I (0)1)~4 Fy1'A N] ItI N A -- IE ENUELNEA DE AFTER Pot Rttsciiitda DE LI DE
Jprlt,i, 11 1)10, An 0iq -1044, 0,t'-1 ,-I11" "Il"" E N R L N A A4oo A I( .' E L N E
11411- -1o 1 80 I [111 S1 4d. !", 1 -sl 1 411y f!lORIIti, 9 D A',i ,1 it MA U4 D3fJl4 ElR,,,. no A S I
BlocwisS.0 t kobsan 4) 28doetrdo h87 ,-I fay quo oretr un toreillo
VtRE1Mtill Ft A 11Pe 1 ninda, Areandts 5)40 J (t) 3,IXztR
14141STDNT Dto) A144 F t41"ItlA
D, J.tC IIO- Naa A1241417A0 F A on i*114 1i 14)40 AS 1-- 15)44 4144um efr
Ina, mad Itn /5tid Uj- Gna ti-a o &m )n14 45+4)1.004411 440 11 4
PRSCOIO RDX BUSC I NI On : 00 4144. ,41 41 A-11ci6i 04oloi 141410 )41 01 soo I4 Iz p ti0)4iR441 I- 4,
1i414oi4411111 1411 iid iiO. 411101 1.0 444 411714 // /I41~ml ,y,,-, t- ~l ". xpllif,
kAi4o4 4141li If"" I441 )4141aI t ~,H .qiFW 0" 1ie yRrii-Ilib Iiadi,,,Iflr "

In0. .11 ia t C" I 014 So D1 E4 S Ui4 9e C RO I014411-,"" ,, ,," i'~.''"6 A t,,, -- / /
AI4 41040,. . 41 ,1 -oio is l o Io 14I looS ,,,,,," I" 114000. I i'teIm lltI I

-41n44 4)44i44) -I o4bI I 440-o1.4!III, 114t1e 1(,\04' elI) 440 .)
1_0 e 4- 11 ro c J 1 ,, . _ _ 1
$ ;.--I4 41041. ,aid, tie 4 ) 0 1 4 1 ,f !,1141 ,I44400 ,, ,, ,ii Is til 414 i"14, "
M,14 I i .~o 1-- -- .10 A1. 14 *4 ,t 11ono 11oo 40041,41041_4;41400 4141 .14104 404 7 6 14100 4f6 -0 t,
.04)41 511 l4,05 s 0 ) -.4 -rii-,-11i. 14- ,,!
14404 0,-.,, A1~ on .,.0 01 0040 4 1 044p)401)4 i 0401 044001 100 04,
0041. .04-4414~ ~~~~~~~~ ~~ ~ ~~~~ 0 *i 0144040 -) 1ss1 io(~~ ~ 44lOE01444441 f1 40 40
041~~~ :nbi .,,. I441 I010144poan M1 141141 1 jond 101141 I4044 0444 'Anl 4.oI il. ~t Y14 4. 4141 14.1)) c i
0 ir : 7 7 --o, 1 I ,314 1) 104n o a t 04 ,0 554411) 41 4 0 1 4 0 1 4I \, ) d 4 1 f .4 0 l l D~ d -( r I44 o o o 1 o 1 14 41 1 1 ) 1 1 1 0 1 I t44 40 4 .4104-50)
44 04 iopr4% 44

Ateta ane (1.ma sin d ls rog s-O11l .1 410i11 ,,4410 414140 14 40004 --4 Ioooo
05 ~~~ ~7 44 ,_ ,14e0m)400)44.4.044010 4t11 440 noo144i004
410010 40414 04 4014444A 0I 414 00 414$0404) 4)5001441 0 4) 1n44 d oo1 44 )0)0


a 1 4) .1 e4 oe 4)v0 4- 441414 1)1414)04 ,)1 1 4 ) I4 oo
peoo4O4Ioio040 00 10140 o4.44140004440oAoO~) it00 M'44440M040004 E,4444.44411110404 Its Oi
41041000400 IosI'll,4e0I4000054000.100. e00014o4)'.4.)001141-4o4 ,'- 0s441os141041, 414110 0440!"'I
E)4e144)451410 ))101040 ,0114440440 4oel 144' INA}AC(METRIb

004 r 44 4>fl3 *SiiiliO1.1 .1 . 1A 5 5 T00 4.1441*o - [ I ") ,( (,' p ii fIt .Ii 4100 14440 11004410I 144I Ii .1441- M 0052 10)4) 4 40oiso-i- I'o540oll 0 544-0o40 310 Irr Ii 4141141O44t ire poroan Jf.ifE 4 j1
40I,,4, 00400444 i44po00004Ri40)114 4114)00I I ,, l -t l m'i t '
-444. ij __ 44)14 14 41404 41404 q(41 40101) 44, _1, el, 404104) -41440n, 0414 I~ W, rn / T ,'" I ,a I4I~o Io IoS Atat a ,)4104 0)"tV IlJ11 0) 1 t "'o41 , " ."I 40 41t0.1 041414 0 I 4 'I~~0040)44 41 A4411144044 40 ,(45llj ,I t rg
R,100414i4i414 E\ 00"4014 504141 44441041444041011414"4400 o,44i4 44 41101044104 l0414
y4)44410044 I1i0441410400 110)1 ii)40do44600404t1441000144o 4100, ".04'I e40It 41441, 0414 to ri4).4C oD14 3ooo.o.o 444044 044440 11 4414441i041441141004i040i1441
4141~~~~~~~ ~~~~ 41404e1e1p"oo~l4))1 .041) I011111 4040410 144 "' 41-;1 00)114010 0 4 t, 4000)400 04~140414 I4011404 /104114 l' 0414 4114) p 4 4 014~ ;t" 1 4105140 I 0401 ol 04444414)
4'"', -11 41)4 44404 45'-0)I41411~00404 0144)-0t4- e444411 i E, 0eo0 14l114451104, ;41o o000410)41-o il
tio0o~444140)40004444.010)i410410). t '- ,- 444rI, i-ii,, 41e44 Z!8 ,,404144 .',0040d- *044,411444140 0404 40144 I ,4 .11140 040 n4"144044110 he4411o -1,;144 -, 141441
0414441) HI ,10 I404i40 54414 t. I 4~. 4450 do 0)41ija 41 044 /o l0 el 41,1,$ -,' 0414, 0014 )~soo14
H~o~410i004141.oyq1O~tI~oo)o41.4) 4.e04t4055410 414504S ~)4'l 145~40)444t15444%>-4110oeo)11)01444 1054 444)4 1op404411041o.41.414 040l4111110'I44144154441
54000040)14 yoooio I00t414144in,,)41.4104r10 I ;'" "! ,, ,I o,44Oo4))o 4144 04441
l~~ooeootyrI~~~ooo00d~~o41oM4O I0141.11440451e14)114to--0 0)540414 I S 4141040414414)410)4w 1)4 Io IO 414l44 00)41ii041a0-I1040- 410b444i11)044144.p1
y44441e440141.114044o~oo4410i1041)411-o140 0444144400140 en 0Oo1 o-4st,140 0o0 4041100404,14 44oI404.4440414~.44 So 14) 44) 0)4 ""'14 ~ 4' o~o. 44.1 1I44144404-,- 0411 ,,,14414,,1404441015005 .
ooo400144ooo44-.i.4~ ~ ~ A10 III10044 41Ihl If-41)4 w1 P0, 0_ 414140, 10 40444404 11401144141540440
144140044114144 o4:1,040 1)0514e44)1)4444440) 10I 0 14-- 41 4I 41 pit,l,-0.14 ,t 11- 141 40444 4441 I4 40o44 111110 '40100- 04o:1541144o0O4
dolo ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 4) 0t41 i001441 04 414 .041010 1411 04)44)4 4-4 4040)0)0 14 41-1 414 4 441 .os41 41 1'0r141it, 1 4 4 14044 4:1404 0440401 041 441 414.41441 044414 4104 -101 )4 ilidIt 04 -r ."loo, -o41r, 4144141400t fr- Ii -l l "il
441erto L 414104 fit0 4141044-140 r 041 1 44)00) 1 4 g 5 4 I 40it' Q- 41 415- -1 )) )14o 0 0. 001t41 41)04404)44 4-4- 14 014 414" 14 44lnt 1 0. 4I, 1111 14l 4111044.d oop
.1414)4
411404-44445141 44>0'0140 0044 441400411 40141 444400t1i40444
0410044000010e0444 1)110 005404140444ee044404)1440011t 0040114100~41410)440o)001411 410100 4 140 ,41.404 01414140 144400411. 4140)1).0414.00014144"4 11
14)de04140004144140440 '4 I4004444 041414041415 ,''A 04004 0-4414474 t414 4 41:t 44440)040 1 00, 0I004 10 44104411401 4,01
L4i144i4100.44410001440/1141444404144)1 44 1 44444II040441441 oel,/,_. on oonto, -4404144) 50s41)104%4 445
,hoooo~~todoailoohoiF) 4141440'a-11C,4)00440),4044-t1-41 0 a'' -44. 1 ,,14-.- "he 14410 I.440-'4140 4111444 44005e 014) 04 ".0440041i44141- lm400oi4114.
140., ~ ~ I _, 4054145'114 I0-144 44440411 ,44 4r4.444 lolts)4,4H"It4- I "I40410144440)44)401
1440) ~ ~ 0 do -1oor)-o 441 04044--411444o I0 451444044111 -014 41410)100. 44n41000'l "I 41-O)410, ', 0 1 i,0_05000't 4,4,,404404114o u).4,A44.I0I4410 ___1I0I4'I44In l41t IpooIodoflinbos4), Io41411o144 14114144)
L A4e1004)14.4141)41100)444404404114400141 4'"' 4l""411 do"' tir-i r 411O') 410104)441-4544001-,44foIt' 4411444I00404 I)01,044I040I004)440041001 4 154iep1 n1404115141440,410 14044-0140014044000 14404 4)4401440041 __004410441r0 -44410I%41, '4-1. vr- 004 ,1).0 I 404 -- I.,' I 40044414-44111) lo t 4o11- I0110) 1104)04441 !400111014 444 I,~4 41e41)o 5411400041)0)04 ioo00)414.414 ~ ~ ,,, 4) 0)4414 14004 ol 41441 01l44)4) t 4 4 ~ 4110414414-444 41 i'i' 4115 I i4 La 141 in o d e l oos dii 444 I0) 41101 .11)4 l 041140404 I .) ff114 .I 41 ,1004001 e4444o 00000 p., ,, I ,I
4440 44) e4.O "44 ot p 10I 14)4 444 4 ,- 444 0 1 ,, -t4 4 141 4- 0 I04 O 4 11- 4 1 )5)i4!t,4 41- ) - v ,v tit ,1 41o 0 -4 , 414 414 404 41I4 4I5 14)-411 )-I 1 1444---50----1 04----444---4 441 441 4450 R04 401I 10R 01444"1,41
4 4414 I 15 l4 1,1)4, I41 4, 4 4, o, ,--414'414'0 4--1-o--4 4-4------------------0_4_4414_4404040. .-. 41 4)41 104I I) 1 414 00 4104 4 ) 411 .1 4 1 n 1 1 4 5 41 0 1 1 0 4 4 0 4 .0 1 4 14 't o so o 4 4 4 14 0'I oI t
444)50400 d-i "" 410,-- I,440 0)4.140 -o s00 04111444 o1o04) o4 4o s. 411 I 0-444 ,11 ,: I~ 4 I 1.40 It oo 04 [_4 _,4- 011o--1 410 4414)44 01010 4 0-04 44i1 411414144444501 s 041011. 0n o.- )11 41411 11o.C o 4) 00
4)Ir 14441 4)1441).~i 41441 0 '4141,,0' -440 I0 14 4 40,4114 41044 044 M-044)4 4111444 !, It l I 4_4 441 4) _444o _ _i _014 _o14 __5 _0 s 44 _1 0441041 I4 s 4 4 141 11 4 -401
"414411 n14441-4 4'o,4 It 04't'it11440"04 4-4441441444)44414040 ,0io00)0140441A144450-'p04-4440t441 I)41141.441-4114)04410044 1 ,14411
C44411)0. 4414101041044 0),_ _'" r - "" -104 40 -4 4041441041: 4441i401 "414t 4 4, ,4 A1 II. 0 44 114' 4110eIo 1oo410 S Yp4o 444441414 04)044 T 0444141041 04 5)4C411-, ,-j-0040141444It,000 4) ,,, Iod,ooy4ep o di 14 4.4- p-,4 ,~1 41,1-0, I -'44 I1001414 4004 4. 14 4- 444440 0,4 44) 0 4)1)44444 11104 -4 4414114410 4e 14)0 I401 40)01 do 14 ,40o14 --4 4i-p, nI s, 510414- 1 1-)))5444 I41)00 04 10140 4144)4 1 0'1 o 41441,4 o S1114) 44 141011"0404 -0444444 00 4 44I44 0)4114 55)> 004 oj ti 4 lo 444 Itt6, 411414
4-1'141' 4114i 044444 'it_'. I- o41.4 .00441d4-4-s441t4- ,005. 044101041044 40411,,004;414,414 t u1441d q4i04.*II 041tjI 4
P'dooo -o ,,oI. .414 r.4I04, 4101004 11 1 41 41-- ,041 4144 I1 11 14 -: 000 41'4_ 411 I44141e04040.d Iit vi io w i T 15404 444 (1004144,, ,l 0410040 n ( 11o141 t-1
q-o~ 0)) dr 014140 ,,,,,I, Prdi44 I ,i~i-- 1F rW.F ri diFop ,14041,1 Mdo lo,. -104 414 )4 C.1 Io"_,,won ,,)!4 ,14 11"1I4', t
W:000 do I-4100 41440 0)d 41- -4 ;54)444 4-10 I,14 14t 144)44 ,i1 44114. -d __ __ ,I I 1 t,
41144014044 41I "1 41 4 4114' In Is--n 4441411 .404)1044444404140 C4441111.410010 1

ml -I400414,,,61 4441-.4.4.4P 7,I-I0400 1,, 04140 ,4414 I04.4- 40.00:t11 14I04 I44411-40) 4,04.00 00, .0%0-4445 tlOit'
Y, q- d-i"', -1 q04' I il I I -. ., 1 : I -, : -144II-414 441050. 1,o-.oo.41041404100.45014.5 _1114 1 I 4.tr ,' )1"400 I I4541411104>400"
I I I I )04 41);14444, ,,4414I- .00,0101411441100444 444 4))11404441)40. 4," 1 4444441444)1414104,i, t o)454041i41441, )41_, n os41e
044101410 I 0- 41- 414140 4I 414 t, 4,4' I )44I4t ~ I 141 I t-.) 40I4"'Io II : 4144411-ll1' 40,1404-1I4,444i14III 441 5541, 14)141514'11 Iabdo",'I t ,loo,111-s 'Ioo 4) "1414004 1
44 411 1 4, 44 4044 0, 41 0004
0441 do Inp 00444441 41414 4 o,, 40 141 44. "04 14 41 1 1 4 4 t 411414, -, 4 144 z I 1 4 ,1 444040 i4 4- 04 7)0 !,1 4 i10 4 )1 14 0
oo0t~4.4o1d4h414i444s)14410.01o0o441)1Ig~ ,410,0000 -- I0400o44:o, 4)4104140)444141I4 04)oo d ,e-oo Is451 -niio, d, I o44oo401 .0
do~~~~~~ I444 I14441444 4014141. -;t0 -.444 .4 o 4.14 411441410441 4- 4 1404)1-,45400 041)t410)I4,4I.001 40o44444 I4011 i"p001411.15.4 4 ")44)0110114450)44
It4.14444)~ 041114004 I"1014 140)41414 04, ha" 44'Ii, U 04 4) Raw, 411 4004 ;~ I'll, 4)4) mos I-005


ji- ,]Jo .Os- 444-01 04141 1-0- t., 414)1 14)-114 4)4111 til, 140414114s- t, 41) 0045 I1041 4) oi1si~ 00-9 !) 40' :I',--4154 1414 0 1,0) tO ", "
4410400444404.54)414414414.4.4 Io doi- I44o41044.41404404 44, 1",,, ,1144404004. 4 45. eo o44 14444 4141e4)0 414514,400a40
40 041 404414)0)0041400., --', 1 'l, Idt Ii ,, ,I IIli ,, ,I$p 0 p ., 1 ~np, ,ld
44d4144io-q414)41414w04)1-o.1414414104o ;4 h.11'i4I,44-41.4100) I 144)otsII s) -'I'lol4eo44 I 141.44.4410I44)4I.'' -10.1o4141)0.114 44)041).041- 04)10 I 44so 14 "05"I -ii54)140I410114)414n4I14a", I i d'n
004~~~~~~ ~~ 144S 00411 do o4e44-4)144 No1.4 4)41 14 )o 411 4)5 444114111'1404 00 4104))1 044440 T 40140440410,0044-I - - - - -- 14 ")n II,4 I"o. 6n i-4
h"ooo0441y04It'd m144 r4 4144141414 0440,I, 40.414 >'. 4144,,,I, -', I4 414 l" 44.'- 4 1)'- 0- 0- 50444I1oo" Il i ,4)4 044-4 1o1y I ,1 441,, ,114441 )144 r0414 ,01 41 41)4!111 40 1)tI 040404i55,4400,

Idoo)144)p401o4'4.14010 oo.It 44t41.41444444I .I04- 414410 I on 1414411o 41404. 41I41,4 I .4404,4.4.444A414400410I4t1.x :
t11'' 404144- 04 .4111014'4444411040 1,14140,i.440444-540 4 1 41t o0 1 4104-''; 4)4 -t10140)4t~ t)
4)144404 4 144- 444)4")t1,A440141i' 4144441140'10 0041-p 040 44 0.e1-140) I 14.o0 -,,,- .4)114)444)4414414)4 0C0- 5 741410004140004141444le "I 4141014040115. & 41,t 044)4044411)4014 444 ii40 041o444 e
A II- u ,I' 04)04)45 44 1144 I4) I4404'.--44 ;:'11014 04 444444-44014 -4.41 4 4.) 4 401,44 04 4414 4410)41-0,44"1 'I ,,1 IIIoots C'04444040))4044'1 44s440414004 1t'
)00,04)041404004"I40400'441004404)4, 41 ,0: -)0414 q%,,,4444 1541414141' I 5'4I0414115 .4 -1~ 4"41 1 041 ,I4I4414104'l 1 4 I 4I4-54,414141444141.41000 41441, _0144,44s,4o1444.P.14it,444144, 45444004441515004) t4s410 'eoo1,o ioo


I- _ _ _ _ _ ___ 1 0. 1 4 40-l 41 4 0 5 It 4o t 14 50 4 1 0 0 4 4 1'. 00 ) 1 4 I In n I I ,I II I i ,I
T e m a~~~~~~~~~~~~~~~~~ 44 411 000111 41'414lf 4 4515 4 4 00 14)44-0 0 14 4 041.14 41 4 4 41 0 0)4 41)- ,I4 14441 0 44404 1 10 14t40 411 1400
--sde- boy It Ia ce tp Z4 ; so : 1. 4 2 :: 4 21 :0 : : I)4 4-141 Is -,s4 o0.05440144q-ehy10)on41)400t
1 r 4401040-l441044444 -14440111001444140 0444440-44t504 oIo sI -1144 ln. 'I -. eso.'o, eal ,,, Y,'"
III 1 1 1114 40 4140' 54004141 i[-a-titer,4-)-l' IO 54)41,41155 I.440-I 4141).Pr4,1441;4)0441ob401414. 4ew.)Seio o ,

1)0)444 14000. __ ,01 44 41144 44 -so 001 4104 I14)s0 ;01,0 41 )5,p44 r1s It top 14444 )lon, " 410, 40 044144. 440o4140)4ls4141 ,110 0 4)4100,
I' I441 I I. ,- -01.44 4414141 141-1'41 4.05 0)i 14 lin 0 1 4411 4050 4) 3.,. If, I400 ff4 II, ,14'ti, 40 0414 ,4040 d,41414) 44d"',, j t
10.40) t~ -! ,I do Is, 1444414 -, < '44 40411044 A 00I)4.))-1 -o 41t 4144"1 -')1,e4o 44 I144 Io 411)44 "-' 50 I14 51 444 00, 414 I14 or414 Stts 410). D04 444 40al ,,44a0 41440 141 44-01 aj 14
144444~~~~~~ I41 4-5044 I4 0i 'i4 1-- 4.4o to.1o4 ,I, -_441 010, 0 40414 o de04.44 t.4 0 4 141 440-. 44 q-1444 511040444 4.,t o41 0 4004. poon14-e441015) 141
541)44 4)4I 4441444 t 41!I 0,444-1 I I- III44i141 Z , I -.- -- II ;,I I -. -1It I-I I I-A tPd y w f h : 1 y t atd. d m i I, ,g nI d q it, , t
40041)044141044441144401411.41) 4)4)4414 4'010144)111 4454-4)4104.0411" 00 4444 II 01014 do 04114 401 .,1004 -4141,41 -r,54 14 'I III, -144500444 50)14)i,)441a)1n z0451. 1 go Qt441, 04404404-'
00401100)44 01444 41444444 4414)4, 4d 4 4 44444144414 4)14414 4))41)445 0041) 4444 0445,44.0I I4ot1ol pda4411444454)444r1 .-1044 ols0)414


,j- .,I I Il 1 I440 I1441 14 -441 14 .44 l44 1441 -"
44t41 ,4 I) 0)4.41 I' 44144 11 -o 4 1 4 04 0414-)4 14440441 ,,in~ 044441. )4144)4 444441)11141441 44444v4'' 44 )4-I4410)t1440 1 onPut044 4d.44.- t)141 51001 14o514R 41 40544404. 1% 44044 40]411>41 I-4 s 4o o1)- os 44 1 I4.oo de En404) 14 o14.,id -4 el0414041444444041 0 4140041 .I,- 140 1441. .-I144014)' 1 1 nd S II
00140 W44041 do ". 414-4 ,,o l -,e 1 IitId 0"I414 oi-501441tt' ,1 40-r44 4441 40 t4 cal4 own101d 1. h0
40140414 41,4 4 14 I044 do 4011 5104 41 o 11441111 "4) I I4 14 1 0504I144 ,0 io 0.400, 444004015544 I10.4)1 o,1
jo ;.t4 4)4 41444 I041 14 r41,s 414),0-040rliI t , 4) 4I 00 I 40 4045 4 4I 410400 4 0)141 I 4 I OoI- 41, 414 414 1)0 ': 4 I 410) ,14440 I40 4041 4040" I04oI
I~14414o to 1III' , I s"IIo o,41o I 11 I4 .- 1.40014.oa)14 I4444)I410 ,4,54141, 44 41,04)4-14444000)Y444-44 i"b i 4) 11 4044444441.t~,,d iilnab 440 444) 14444'4144100444
041014~~~~,, --'4 04011.144 1, -'0114 4l4.44O 44,oodo 140. 1oe44o-1oodI 5 0)- 0.-4444I0I14I.44 to4. 1. 4141F1)41--45010 too iiIo 0
it, o ,4-,,41 ,, 1'414 41404'i404 000I 5)lA. .40I 0.0 ool)41.44oio04 0041444I I.14I 10 14041414010-41040044
41414 .s. I4141-54" 0)44,541e4440 .4 o d 414l 1414404 0)41)1444 1.4444141ll41IIi4tta', eInnrr,- ,
00104104-4 ,1" ,45541141'0iiS'4'-', '14o4oIo1 1o)4 414441"I 4 I44 ) 1 4 54 0 4 4 14o44004 41.4 I04 44 0 4 4 0 4 4) 5 0 0 0 1 0 -10 Io 4 ol pa t4 i 44 0 I4:0 .I,4 II ,0I0 I, 1 144PI0410-444-4 4z,, 444141041. I II nto b 1
0044.~~ ~~ 404144 .4144 do -54411 41004 ,144 744141 Is I0000040 04444 4044_140110))) 44 )44440010)to0 01144 11 4 0o44t444441404 a44 01 400440044 o In- eraot
41141II 4041404444040, -, I I ) 4)44-400404411 41)i4451014144 I,04045 4100441 .o14o 51 411 I)411o44404 Iibo~i~0 1414))4. 1004100at4110
1040,t 11,- t Io 4 1410 4 1 I I 4 1 4 14,,0)41, 1 4 44I4r Io- 4414 4s o, 4 1 5 4e14, -, I - 4t i~ ~l o. o"~o t 1 o ,-1 54 o 4t,4 I0 40 ~ ~ p 41 4 0 4 4 4 1 o i 4 4
414.1 , 041404414 I .44 f14041I44_o4e. I'l)44l,41o.4 I ,04,,404o,414400541--.4 000414)0)4 -1410 41 )041044 11o.04.eI44))i40 404040444 p441004 1)4)04140',
,I404 444441)I'4 1 I do 40 -444 1 I s)0 4- I I4o 11 14"~4 .'0i 404 I 401 -0) os 0 ,41 41 I i'o q-404444 14- -41 boos ,441 04 540 450440 00 lo 14-40440 4)l do 1osos 015
1-4I ', r 1 1 12 Il 444044041414441 11. do I y__ _ _ _ _ _ 4- -44 -4 4010 1- 1 0-I0-)0.4044a nqut ,d.ii
I I 1 i E o 40' -4 00 14 04 I)4 00I I1 4 1 0 0 14 0, 0 I4 4 I0) i " 1 o
004140144,0.14'414414141I.!14141 I 414.I Ireg o 0 0.0 1 040 40)1oo44 ~Io)14 .1) 141 4.144014a.4) -541440"440441414-4100


E 1 'l t 4 di o i u 1, _4 41- I, - -4- oll o o i 40 1 1 4 1 44 41 1 4 44 4 0 41 4141 )0 0 4 '4144 0 I 1), d1 a I slo 4doo it 4 i o ) oota 040 41de1 10 4 4)00, 4e 14 415, 00 411 4 )4 0)414r, L 410411 0415501 q -4. 4 )0 1 144a'l S44l 4t I T441) )04"
.4444_, 400, 4101)4-144444)11 044no.01414014444 O a411olnt ,o4O oO4Il dio 1.000044414)14l4 p0-1 pl iit eia i A Idfrtcn In044104441401a44l1 at-n 0)04144144404104141
C tlc jde, -I 40-44414440101440)) 4-10 ollo 0104 _4 ,ie I 1015)4144110100 -;m4, I 44I t I 040
41104141411444 .4114 11o1o01)I o4n11 I -5)41 .01.14 1 4. -10 1)sgs4)4445s0414 -a 444000411444000410 14o 404001010444i41

~ ~ ~ ~ ~ I, .,,11d-lo140o 4144,1 40444004141o11o I 40 1414' 0 -t I441a11 4 -4040004104000410410041 14404 d0444141ra o nlu iAtoh,,Ad 4114, ., 00441, ).441)440) 4154 414044044)40 doo1)sl~44104.1 100o
0a41.lndo 1144) b-tl"P-40 ,I,,-4
7o50114414 ~ ~ ~ ~ 40 1 1.44 4.1 44 4 ,41 1 4 1 4 4 0 0 1 1 4 4 4 4 0 4 4. 41 0 5 !40 0)1 0 1 0e44 1 1 4 04 1 0 4 I ,To114 lo n"4 4 'P 04 0 04144144 0. 4 0 01 4 4 4 14 4 4 t fo ,n4 L5 .41. Pa- 44 "'Ite,4
0 ,,551 a q- ;-441I1) 4441)4 14141 .)0414040-044044o414. 1 04I-414t)00) '41041)404140 0 -,"' -4nj l .pt o.III
a,' 4)o"' .4444.444-4114 _-- 4. oo4141 44f St 4444144441 1.4 441441 y1004544,14110 400 411 4414o 4414)041' 41 4041114 045 e4444l44040-))1 01ond 0 o ). 414 44)041 )444
4)454 i, or.o f",10 ll--444140 %r--,I 441. I 44).4410440004040014. 404I40:104151414'44,11,,0 I Itiuniain 4)4414041414 y1440 find. oes q. .4d444oo14a11441,4C 44441)140.45 lodionto, y44 40044440104411444 n401
re, iti, n i lt14 e.41o4I44410o14,0)1441 r -A 0 144441 )4 10 do -, I --I 400"I I40 ,n4 1454s4114040o554.,0441y40.01'.42Z 441400444.0141 10141 it0,14400544 ,0144.tr0 41450t1 404)-I .- 00$ V1 t)4il.tsI4141)s;-at)45
4)~~~~~~~~~~~~~ 4111 41 1044441144 do, 144.40044 to I04144I044 I- I40)5 ,04444 14pod. 1401441 41)0 p. t)u 14144040 41 44410)44, o 04)404000 41 4S4110 14, 4101.100440414 101 o .01 44.no4. 4 4 14 n.14
hmab4)o5 ieia444).04 el4414). i.4 --4 -'0414%04)41'0 04I"I0I)I)I I tY4I41444.4I .00I 00ItI'0I05044044 100)0 -1 451i- 4'. 414)I411441414)40 oIn % ))1.4 40, 504)10 44444 40 A5114410044404)1 )4lI0)04541Antigua4y)4a40041410.b0)0454 5)4)414 ,441)0e) i -iIt 44 410014, 41 4104.4t4I 04- 0444 ,- 4- 414)40 I-44.444441404 -400 I I 414 44- 04 040 441 )0 041 14 0 I4) ,0)4 41e 00 11 441 0 444 .14 0 004 0) dd Iso ll no. 440 0n10 4' 044 411 4.twilS
,u I ~j 1.marf I _*0jd.en'. --de d,,.1.Ji, d I Iil1- tn







~Y!DM 1 E LA MARINA. MARTS *20 D EPT.~DL 1949 PACTM CINCO
C ron ca Hlaban er a

Par xis e readskREGALOS para BODAS

VAJILtLA DE CRISTAL. FINO
Vr 3T LAt,3CRT SA!WX LOUIS



















C010=03





JEC no 1.00.peoi VCqea

LAPIZ LABIAL YPOLVOS FACIALES Iegante recepdi6n aver 1farte





id. tozubi 0 prefemi ID 1*I~f WAISIS d. F- t t-,
*EriALDINE CRAVYX oo T7~1 10t~ 1ht~ 1)~ 0
Aoo~. 1. ~ ~,~ ***~*.~ ~'* 'LGACEti deso nsardo
exalmo nt ri. o -Pot *i01 mu m O00 01dada <. A111 OdooS1.do Aol0o ooood 1ohd, IIIi
nOj 00000 10008800 01f ~ 000800 looooo,0 20,, oooo.oodoy010,000 0 Oodd 1000 0000,.do 0 810 10 o
e0e0 dioo 110T,0 Tit 'A, T M00'0
habt 0000 1000100003 100 m01 0010',,,oooo 0,,,Ololo 1-01010 ,0,1,000000 10000o.,oi.Mara,1d ~0 10 0 1
01~~~~~~~~~~d TZ0010010 00 OooI 00 o1 hood00 080 0 8010 sa t Iooo doE 1.0000 E. 0" LRCAdooo0,odo01,, Ilmoo b oo0 In oeobuoq0 mpars I. o 18000 ,. o 11.1 000 010000 oo~o0000,.0 0010 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ J- 000.110.000 't1o0~0 0.10000il dO0lO,,000 000 L 7Ia~~
00100 00000 T~, t! o Agoo. de Jod 00 ,,0 00 "I- 001100_110 T -l
much sos p. oo~saos ~ ~ l00010,0 ~ 10000 d COo~tit 00
"Vodlo,.otodoo nob.o mle,1odo~ob0000d0010000,00 voo10. 000tz R00008 Im0 0ly.Daadip
Uo loholo o.ooO 1o00010ld00.~0000O0l0010.~ ~001d~l1.0001 01700 000 ooo 0800000 110


0V,00 daliclina TALC05 0
00. 00110 00i000 0000 0,01.1- It f 001000 0.0 0100110,1,
do 0. .d~ 011.000000100000000001 1,,0010,001,00o,.10,0,',10,d010'0l 00 .loo0'o Codo. 1'it
.Elm000 0,,0,010- 10100ZO.,01 11O80OdK~ ,ood.o 001,1 00,01
I l~o,000,011000 00.10', 0 10.01,00000000100,101d~0010 000d01000. 000100801010TS00" 0010001~V InO100000d 000 1010 10000lOooood 00,0 0' oOo.dlooiOO
10oo00000.0001001d00000 io',i,.o~dol~lO,01000.10d~l~. d0001,00110,000-.0 -' 11,1 tvoo, 01It


8000000l~o Ooo'-'o11 ~ o0'~0, oooo~dodo 80 000 o 1.000 0~o00oolo Ado~ 0'oooo000 A 00100000000 '0 0
00000 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ El Cubes oo doo1-100010' I~ ,.00.11
0'0 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 19 00000- Diu .O0 100'00,-o 1 Oo- loo .10 .l 0,0


1,001OO_000000010o00o10001000100d0l80 000.001000000C

.0 ,,Ool 0,'M ., To,01 o 0 dO,.0


Mo', r -odod OlooC.,o'.o0 dolo Con
00000.000000000000000000,0- En01 00 0.0,0 000000 101 0b 001,0 '1
1000 ~ ~ ~ ~ ~ ~ Pe a.Ooodl o00, ~~o 0.0
_______________ _____________ 000710
___________________ '00,Coo. O~o~oO, 0180Coo0,l,, r ,0ino
~W s i g 01A070 0ooo 111~
S000,1101, loo 70 "00110

000 ~ ~ ~ ~ ~ ~ ~ ~ Pe a10 Yl d01 000 0,100.1
.000~~~~Camlie doCd.,Jo c d ood, o
WSCRBASEal DARI DE A MAINA.o o. 100000 1.0000000
-C ,T0o0 i000o00 Ct100
P loooZ
_1z 01010001.
'ILI0 0do00010
W h U ~ h A UEQ A0-Oo1 d do,- 0000000010. I
1E00110 0,ooooI 1 0
0000 000' 000'000000000000000 0000000'01 00000000 0000,0 o.Ooodot~odoolooooo tif,00looO tol ol~looy pit.




1 1 1 POmci na oo,,ol C$



ElCocnjroOodd part deo 13,50


LO01 10 000110 0/,00001
115.1cr 100. 0.lo.111 orn 0 C Is RADIO,6 Svil
A,0 dL L000. R,- f~-l
000a (3 010801 pido !att 001 oooooo o00
MAlviuo so) sonIt blse= tds4 oooooollo ooOo



16t, ol,~o 001. M10 rs018Co. ,n,$
a.0, art. 01 1001011 f010111 . 000018.'

REBAJADO. ~ ~ ~ ~ q Aa SO O $7 0 E o oodeQ~;ro



artimaoa. 00001000 1 10.
do t deooo 10er LI id P-800 10.1
Got,~~~~~~~~o y 0 8o00.1d Pom01001n00001
10~~iri Raul 0000ta 10080000100110000
00000an 0 0i00100000
*M ~ ~ ~ ~ ~ ~ ~ ~ iadtoet d.d 070IAooloo00 1000000000
0081.00tr a1 01000 aef oi oo. Lima,


: 0,11W 00. 1 0 .ohlo
u.lll 1.800, ufet finsoo1 Ao 01claceani.H hicaia
op oclr z Ademi do,0 y.1 liooo o nao 000 dll ~ q l o u vo a a o


E, .J, ~sAgoc~s wtrieds itsob~~ A", In 8081, 00000 ww?; vt* 1 heht Gx~tl 4 A itete a a ecsi.d e000018000 uev, ino, ifr0.e



00 e10 do d 646 F0pdo
CAL081. 04M 00.01a 04 0080 0= 00000
A-2911 1-% 2 0001000 0.:- 1ES 01-~~r1 I1T':10 ?OD 00A 0000A UO. Rego. Vi8110ctor0110 m



h4)IAII S1 f~ Juli 01e oa oleae y 081a n-00110,110540910001 00




~~~ Porov000. 8000000 110001 wt 10 Ciorst d









PACNA 01001 DCLA ABIA.~MARTES, 20 N, SEPT. DF 1949 ; -O XVII


EXLUI ~N ospechan de IF rv /it a i bra a aye de alest 11'1 s 'augur 1sf 61



U na repentina It, W." -0, ~? n~tyz
fuuut- 11. ft110 tut1ftu 14,n A ~ f
*I N~i ngAt' 4uecis ui u 4urus4.,444 4444444~t4444u4 dcci44in rua4 444444444444 iu~y~. 4.~!44 ig') 4

Are i i ni n ratar 4 is4 ~ftlu 4 ttsu
4 444 u4 u 4 44 444 ~ ~ u4. 44444ft~u4444 ., 4d

______ ~~F- stiltifin 4444404 4u 44 de A4 ifa. i I I, 4. Au af i ip




h42 "ja~n TK~it
444444 4' !. 4 u ~ 44~,C~ J" -uu! ,f 4444.4 44!. .0! '
4.NUEVO 4 4. 4 44 44 4.'4. 4~u 4u,4. uuu
144 44 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 1,i 714. , 14~ 44444t,4u4u4.4~ t u4 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 4 4 4'4 t 4 44 ftt-~ 4 4 .~~ 4 4
A. ~ ~ 44 '4444 44 f44.t444 4'

NUIr- - -'. 4x 4~'4444 ~;4444i 444 u 44 44 444~4'4 4444444 44u4 ~ x
t4 4 4 j i'. ~44~4
NUEVO44 44 4 44~4 t4 444~4'u 4 4 44 44 ~4 44444.444444$444444444444
444 44444444u,44~ 4 4 .4444 44 44 4~~4444.0,ft444 44
M il4," t4t4 4 44444 ~ '~ 4 4 4 4uiut ~u4u4'44$



304 44 44 4.4444 44 Auft ,-4 c~p jc
EASY4 FS. MAS444 44 4 ,,4 4444444,444444A
4 4444444 4' ~ ,~ 4 uA~ ,4 u 444444 44 4444444 4 4444' 444 4~4 4 44 t~ 444444744 7

L A4 4 4 444.,4. 44, .44 44 444444 4.4' 4
C4. 4 4 444giia y44 44 4 4 de 4 444044 i44 4 4 44 S,4 A,4444 44~ 4 44
____ 44. 4 44 "4A:~.~''"' ~ 4 44 40 ~ ~ 44 4 m out,.Adtt
444'4 444 44 4 4L 44 '444 4 44 4 4 4 44~44~Y444 4444 44a444 4444444v4444
d" I44 "'. 4 4 4' 4W4 4444 ~'1444 4 4' 04 4 0tn4 ,44 444444

em 4 s 44 4 44 g 44444444
La 4 "'4 44444444 y 4444 4 .4-4. 44 - J4 444
v i 44't"tt4 4' 44 4' 44 .,4444 44444444 44T-444444 4quit 4. 44444 4444444$
"EASY4444 aL,,, to I,,u, h' t y" 4"4>2%~"~ 4 4 4 .444 44 444 4 ~q 4




.44444 4144444 44 rnts .; o4' .
444 ~ ~ ~ ~ i; 4440 4444 '''4 n4 I44444 444 444a 4
1Do 4"-ta en do4444 Peo4 4 4'i -I Is '444 44 4t44t4 4444 l



4 ~ ~ 44.444.4444 _I 4 444 't44
Q- ai, 4o oa P- il I deb444 -444, 4 4i, i 44 i' 44
Elim~~~~~~~~~ns~~, o.e dedg.be fa!' as litt11 44144 Oh4444444 .444 d b orenWt.
-' -6S 4.rerlesd r til P.a1,e 14444 y 44444 P '4' a'. .1. 4 b 4 o p Mes onesmiJ onUa"iA~~~d 4444444444444 44444 4 444,a,444 4 4 4
I'.~~~~~~~~~~~~~~~~~~ "4 ""a 4'44 D4 44444 44 44. 4 o4 4
n he44 4'44.,he I to4 2144 4 4 0,M044IS.4.4.4434a$ S4 4444"brasfl .'od o
t-ia de R444 b" i'111y 4 444 la ',444 444 4 4
~~~~~.1115 14 4 PU P IP R [RPaI
4 44 44, 4 ,,44 444,4 ,44444 '~44444 ~ ,4444t 4,4'.p.44.,44tt4~44 444'4444444.o.4 4t4, 44i40d
o0444 4,,t44 I,44 4t44 44,4 444Ior, de"in4 4444st en 4 4t 4$~ci 4 444 4 44 4 4 4 4 44!44 '. 4444 4 L C4
4 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 6 qu 1. 44d 44 444 i444 1, 4144444e ~ tou d44-0 ,V.,.Ca.21



Jot 440., 44 444 -ar h III4 4, 44444 44enioiit- jncoa0l4 t~
Do~~~~; 444,4 444 4 "I I4 4 Y 44 44 Q- 4444a4yl e I':x an
EL ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ w -NAT ynr SEAR ___________ '4 a4 4' ~~ 44 44444444 ~4
4444 ~ ~ ~ ~ ~ 'rt. 444 4ft 4" ""' 44,'.4 ,.I error.~, l ,4 4444
4 44 444 444 4 .4 444 io 4 4 o 4 4 444 4144 < M ,,: F;;,7 "44 E
~~~~~~~~~~~~~~~~~~o do 4 4 441, 4 444444$44444$ ~ ~ 4 4 4'
4 4 4440444 ~ 444444, 4 44 4,4 44~t144 44~4,' 41444, 4, 4 4 444 4444444tto
44 ~an P4. 44 44444404.4 444
I 4 es. .d 4 4 4,,4 or4 'e ~ a
~~~~~~r d no,,5$t ,.et~ yl




C A SA E L E T R 444 4 le' C -44444 A i,444444444 Garcia,4444, 44444 444 i l l r do d t T I f 14- 0 1 a te
4 ~ ~ ~ 1 Alt 4 n~r .444 V~ 444,, l 4, cio Eduard 444.4 4444 ,,
4,444444 4 4~4 It4 ,,,4 C C ,4 ;4~ 444~lwa 44 4444 4 a-, 44 4 4 444u4it,
----- ra 4ibo 444 4 'r"4 .4 dirce4
444444~~~44>4 1. 44.41 4 ". ~ 4 $ d4 44,4,4 dii-44d rn4t
4444444no 444Wdd 4tW del4" orat m p I4% .44444 4, 44
4 ,44 4444 '~~ 44~44 4444 Il,,4da Iqiur44440 An'4tonio44~ 4 4 1 4~444444 444 *~afropeI'jn
.444 4,. 444 r4 444 a.444 u 4fln r1 laCId~. os
44 b 4444444444. 44444444 4 coma 44d4444'44i0 4444 44~44 ,,6lA. 0 u spoe IS
444 '44 44444''4'.' 4 onto 4" 44444 %4 I40 4 4 4 4 do404l t4,444' t i de441611 10
~~~~~~~~'v 4 444,4444, 444444 d4.4 4k 4444 so DE. ~ AS, ,oaap 444 ,4,44 '. '.44 4'4444, 44' 44 4 ~ rhoo Au444 a4r u44t4 due444 h~n'4. 44 '. turn4 Vt~~~~~o~~~~tb~~~~t~~~~t~~~m~ CAS ELE TR *oon n do Sol4 p 4'lhl a44 44 .4 4 4444 444 4444 4 444 44 la, Precept. 44d p,. LilyF.1 p 44. 21del. 4100$4'
R4444J44$44 4,44441 4 4~ 4 4444444 4 44 4'4'44 4 4 >4' 4444 4',4 4 4~4444 44 4 44 4444 44 ,4444~ 4 O 4 ~r44444 do4 44444 44 44. ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ d '44 4~k C. or. on El44 44'44"t m4 844 444 44 doctor 44 44 444 4' 4 4.44.4. 4 .4 4~44 ~ 44444 44 4.4 4~44444 t4t
444 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ -idr 444 4 4 44 ,4 4 4 44 44 4444 4 4e~ 4 .
4 ,44,4 $4 c44 it44 4 4. ,44444 tog 4444 44r' ".4 444 lle 440,s44 $1444 4444i4 44444444 4444d e4 44 44 444.4 d e44 4 1, iod' 1' ., o4 ip 4 4.4 e- t '.r .4444Miguel 44A. Sur 4444

44 4 4'4 44 4 ~ ~ ~ ~ ~ ~ el 4,i.' ley4444~ 4 44taint144,4.4 4 444 4 4 44444 1 4 rmer. 4- 4>, Ct4440$ 4 t C.,,t.
to 4 4 44 4 4 4 44 44 4 4 4 4 4 4 4 4 44 4 44 del' f 4 4 44 4 4 d doctor to '4 t 440 4 4 44 4 4 4 '44 4,44~t44 ~4 4 44444 ~444 4 4,4 4$44.44"-A4444p44to4 444te4t4 4 del 44 44.4,44440 11
4 444' t >4'4 4.44 ,4 ,4 ;.444~44444 ,4 414 tm ,,t4 44l444 4 4 4 4.4 4444 ~ ~ ~~~~~~~~~~e to .744- o, ialert 4 4b e, 440 S4444 444 4' A 4 4 44444 44
~~~~~~~~~esaoy dod4 44n 4 t '444e 4 far 444 iv444t44 044 4'4 4444444~ t.
44444,444,44,~~~ ~~~ '4 u_4_44, 4444444,$4 p444 44 d4 as4 P. $0444 4e 44 4u4,444 44
4 44444 4dol I44 4444444444 Social.44 44444444.444.444444444414 44 4444 '.,,l 444
4 444 444 44' 4 4 444444404 44rhos4, 44 4, 4. 44"4 V44.4 a4 ,44I 4, .4444'elo 44b of4 4 .z.444 44444I4ste4444444rroi
4 4 44 '444 44444444 4444j h.4 tpeso 4, $4 4 e,,44 444444 M 4 4 t 4 ti
________________ 1"~ ~ 444 444444 444444 444444, 444 t ,,444 Dr
4 ~ ~ ~ ~ cl304ld 41i~ 4444, T41 044444 44414 1 44"
_______~~~~~e tat 444 4444 a444 4 44 4 d o to S ua rez44 4 4 0
____~~~~~~ 44,I 4 4444 4.,4 ,,4,44,4444444 4 .4 4,t 4444 44 .4 444.444 y4&n- ro,,44, 444~44,,ySrgn. vi l l,i.
44444'44 44444444444444 4,44 444444 I444 ~44 444 4( ~ con44 o ",. rali tw 7=7_ 4, 44 444 4444444444444con,444444.44 I I. 44444444444440 4 44 C44444Ar 444 z a44'. ,t4
4 4 44 t el44 Holds4' ,44p 444. y44.444 44 4444 on4I4 hi44 44 tir 44 del~ Ed a4. d 44444444'4 4 4 4 444~~~44 444 lie444. ~44~4 $$ 4$44 444 44 4 ~t 4 h4.440, I 4 4,s 1 4, '.4 444 444444444'',44 44 4 44 d~l 4" ~ 4I 44 uet .I .4pa
41444$t4444t 444,41l44444 44444444 444~ 4 444 444 444' ,4t444,444444 4 4f444an444t,
0 4 444 4.44444444 444444 444 444444. 444444444 l t ,' 4t;. O: fi 414 pa 4 04444444 en ~ ,4 .2444444 4;4:4 A, 4 .
'44rea 444 a4.4 S .,4d-, 4d Id I
7 444 4 44 d4444 '4o 4 't44 4~44. 4~44 4444 'a44444 44 el441 4444*4$4 tr co.4 444 4 r. d4 V4 $ it.4 44, ~ ~ ~ t 4t- 144 4n r.4444 4 44 444r14 "4~ m aorr'4!444444' ,444 4444, 44 44
4 ~ ~ ~ ~ ~ ~ ~ ~ d 1. ha44 4 4 ,d u.4 Set, p44 ,4444r444 444 o .'. 4,4 444 44 4444444 44 444 -ii.44 444 44444444 4444444 444 .4 0 4
4 44 4 -u44 4 -b n444444 4444444$ 0 ,4 494 44444 4444 .44 4 to 4 44444444044,44444L 4.4 444444 44~~~~~~~~~~~~~~ an 24$4441 .,4u 4 4 44.4 o. 444t74 440 p44 r 4444444 4,ro 444 44 dia Il ,ut ,4 4 404. 44444I
4 14 444 P44 44444 .444 rtle 1.11M 4444- 4epet 444 444443 4rno 4e 44 44444 4 4 4444444~44 4 t,4tbi t Aoil 4,
44444 A.44 Is 4 4444444d de bri4,on4s 444 44icta 4.444 44 44444 444 .4,.4 .4444 4444 44 l,4, a4
'44'4'4444444, 444I) dari4444 do~' 14u ,4444 44 Pr44. 4 m 444 ie4 444.4 4 $ 4n 4 4 4 tarato4,44 an~4 y 4 ;:d,4' 44444 44 444444 ~ 44 4, 1,4 4.4 4444444 44444. 444 14 10.4444 444,4 444 444. 4~144 44 41 4.0444 .44,4,1 .411444., 444,4'A4444 111rerti4.444 ,t,',44444444,4 t444 444au 4444'" 0440er 4144, 14 4 I rttt r 4.! 4 l'h 0
It% to,'a1,444 4.4,a4 d i Al4o44e4I444

Is ,'4, ,.44 4 ,44 444444t44,e 44.44gi


44 4 ma 44 44 4,4 44, 444,4r 444. el0 Gable4 444 44 0 444 4 4 44044.4 ese P. do4 4, ha do ,44.
44444444m. 4I 44 44 4 4, Vit rtl4444,4 40 s i d 1444 4 4444, on eltO0 I01 4V0&, 74 U" 444 4-j4 t4 a014,44"64t pt.44 44Ctl 44.4


.de' i-l an 444 4 04 444 1.b4 44' e 4444.44.rh~ V:
em4w 4,444 W4 .444 446 II
1 44 44 4 10 I!4d14 "



t. I .ibed rgJ 4 .or4:z Julia Clave FerndndezP
44 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ at 4&4 P44444 4 ,44.4444444tt4 o4 die 44n ,4444 4u. 4,.4444tlo0444,,$a 4tIs 4.44 4 4 1d,
4~~44 4414 44~s h'=44 ,4~444
4 4444 44 4444444~ 4''444444 '4 44'4444444 4p'44444p,4 4~4444 '. .''4 4 4~$ 44 4.4444444"'ir4 re,4,4el,441 ,, 44, 44444, $ 4,,4tlv, 4 ROMAtb4 Sept4i4c
Q 4444 4t 4 144 ~. 444444 "444 4 4 4 d. P4 4 ~ c444 r ~14 I-'- .p ,do ,.,44.
44, ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ e d4- ; ).4 4 14o.'4 1'444 4 4 4.t 4 4044 '.4 .4', 444444t4 -et con~ ,~t .o,,ct a 4tlla~ e
I4it '4444444 4r d44' 4, 4 4404444h4* T444444 ls" 444 4444 l~ deo 1 tt 4no 44 44 ~ 4'44444 44~~ 4 4'.4 444 44 4'444'.444 4 44 4 ,44te44.4, 44444444444444 4,4d, a4444 44,44.4,44.t1l4441404 '4444 (t44-U.444t4'4%44.
4*44 444T' 4 4 u-4., .44'44 y444 444 40 loor~ ~ p.44444 Ilion.4'.die4 "I ,444 r 4444 4par.44 p4'.,4&
44. 444 4' 4~'4 ,4 4444 44444'.'44 ~4'44 4444444 444 4 444 44 4 4, 4~ ~' 1444~~ 4 4 4444 444a, 44.44444.4 4~ 44~ $4~ 0~44o4., all,1 ~1, 44444494444 4 44~ 44 44 ft4a~ ~ 4~' ,t.1 4,4.4, 'fr.4. 44 0 4, 54i F quill,,4a44$ 400 Q.,4n:d4Its4 Ldt:4.
44'' ft 44 4,4 ~ 4 44 444~4 44 444.
4444444 444444 4,4> t4,44 4 40444 444 14444 444444 44444 4' 411 I ~b;5011.51,4414444 4. 444 er m4o
N ~ ~ ~ ~ ~ ~ ~ 4 lit444 441 '. o 44 4441ue iacer 6 eItdiali .
r~~~~~~~vj~404 d 4444 b 414 4)r- r n ,1 .'hr i Ic lb i
Poe144 dola4444 prdj la44 $4441$al o u rs g t
44 44.4 -4'4 ,4 44 44 44, 444d l" 5 e 1- 1 o c n l
no do1. 4ri. d r4d, uit .444444444,4en4a 4, 4 ,e l''.t 4444sor'bi' it!raterdo ron n pch 4I.4444'n 4
444 S .4444 a' .414! In4 4 S44 5 Q U0 d4,0, *a 4 I4 4u - ,
4 44444.4I D ~ul IBB poArAC ONUk
4 ~~44444 44444' 4 4 4 .1 4 4 ,ut4 4 4





IF 1;no .1oinld -






AW COXVIl DIARIO DE LA MARINA Cro ca abanera MART. 20 DM SEPT 1 PACNA SIE

BodvA de ocenbhre o 7 ove e xnotnd lnonmrs o
Escribans Ahorre Dinero. Gdne Tiempoa d gra unr ht e C npd

COMPRE en MIAMI MAD TAMAHRA
OFRECErMOS UN NUEVO SERVICIO: tt1t1ttt";!a ttttMttM nAtre t:t tttttttt:t:ttttttotu tn tnore a dora do loS Baios de Cera Cnstal
n~~~~~~~~~~Hr DURNT fls a13 mDE enn voamr sorrau urrrssENTSBE

OttOa dn n v -1, a tn tu l e ,t t tt t t tnnt ta 1/Incara Tarnahra
FFOREIGA O TRADE Inc. EtiVtOLmpiAH o Cbs a Made ra Tamora


to~~~~r't- d-tte.' .
$t.tt t00 $3 00
7tttMADA TAMEA a a aMA a
EL FAMOSO NUEVO
oAE ita tandthorhnle 10 das Croa do Perolana













M uM S T wt to7.Ja I un uche
A C o t bcn bEL bNeANTO e r
















e~~~d !I Tlesdl 2ala
LMbeXM ASeVlaaooo ad a deepa a: Ot ans$00 a $0



com4,) Aa -T,) po-rc, Ln-1 T-, M I. ik AT nn
oftecAeva ao$300











O Ott t ceEP~ot BeOrENDIP


taatLd .n to m ten.ac t
At OMERttt M C n d nwNE
OntoMAASt tRnt, putedo Ctolat< N A



















C r e o A n to Coht ot ht
D T General torta a
M dJORAotdSCONDICI S
Dt SU N'IOCIO!

































ttoqessctnetlcntrcn Yl qea i mortance Esttanon tttnttttttnttttdtn totttt onont t aguotaintoannst locatttstttrantentmas tcctonadots petttaootmostOUnadad
Pett t tn SCRIAS EYA tIESE E L 4IARI0 Dpo GLA E RAALRINA










































ECHINION V VMINTA
.1. ~~~~~ ~ ~ dn Ott,.o totanto taot to Vttrtottr 1 ttt .p



ooo totidntttt -nuyooot tpastot Pott&.b r to-toA, totVottt 'tdotto ut- tntoo








o Ato stLoVAV A. Lot 6 12 t 2L A F L O O F A


n~tt. Man to oP AN S
to i onO to n tttot Otot delntol3 I04 2 9 to Otttoo- ttoto tttttoOtottt.Oottto ttttt
c~ntttotOt~tottttetoooootnoo otlotottdit: t no ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 1 oto Ot3o0tttotttt t.d oto
"'I"o~ot~~to Coo sato oO. ot ot oOttt
PoooCtotooDttttRtootCototttoooyoottn~tootohttt
Elttto ooootttoo00A tO ttnt~o~ttt toO o

LiXooOnootoohoto tp ttc.o oooo t t~~ototot
F" otaooot~tato Dtooo otoOtI 0t~totOil Ittotnotl cot Inp o. t o ot D Sh a F I(M S K Uoo to tottO Oob (ot uo.,otoo. tot ttuoo tJ rnttt 4 t ofooett pt00 o)to n o 1tttotoo0t nCooo tot tt tOtCo
toot 0tot Ot t Ottot Ott Ot
not t tdtotpto ohodoot oto'totootono tno-~tttooy o ootototo Oto~oR.

n t~~~~~~~~~~.CC 1tootoo deottn to tt to- Ototo tttnottttto.0
do OUOST Z to S~h SOPlS~btt to tt tootttoto to~n Oto uot eontOtoao~t Ot Oto S cia t~~~~~ot. ~ ~ ~ ~ E II pnntoriu"- atgt 1ta toOt-IOoooot ttot tot 0
OtttxOA ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ d TCO o-, de o-I n 00taootttt.OtOtoot nOt o
io tt otottt Ootoat toOtotuto tt tot d Ono lron d e At abr Wi ton ttn oooot- tt otnottootttt
ptnoo~~~~~~~n~~~thto~~~~~o~~~not oalootooootottoo~atodttttotoo uOttotntaI
Snto(o Adu to. t ttp oo 0 too o toooOt ttonttt t So otudn do !dt



Moondct dote Ottto ototoAt ttto-i to ot Mn to to to- t toottt~ttot tt~nAn Oot oto'tait O
o~toa~onodtn~tttt t~tt~ottotttoootttotoootottoa Otuttnottitn A Ptot ,~atoooS totAtttn





otn~~n no Ito ~ f ho1dttn tin ttl t nt t ai at tAS yibSO Otov to otl tottOtotttoo~ttooto tStooOt ttot10t
pieOtote ootts tomp vot Inpotttot Ot Ctoo.d
tottotlad ttt ton O~n.P ALMER loon toontv to ttoo-onttttt conot do iopt -tot zt tpiotO i0olnz ton p
tooooto~~tntotn~ootoo w FSC aR c ulcl s Potnlnoovtttto. @ ttoln oooptototttottoottot hot faomtflon.O noaltanAR2ao MOOOI PE~tTO oo to GototA- MOTORS,1~
~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ D poplin, ontot Ott toS hot Oto t oCnott. ttt aaod


-oidd Fannoifononoor
-On ~ ~ Ia ot hotootoo 44.


Vfl~ ~ ~ ~ ~ ~ ~~fd moenAn.ao d g8-t [o: wis




'd i t o EnCUD to no od" Potot0
ow t w pttot o.tto oOt
MEJIA LA CONICINa -z t





LI.a Oi EAR olid io o~ onoil e
HE ~ ~ ~ ~ ~ ~ .8 C.2 H IZ3o.ayonet4 lad. o
l0o 32 nI I 4a. A. S S

-0~~~~~~~~ ~ ~ ~ ~ ~ 7tt4 nt 12t M" PRt TO 4 S-t-, N '95 Ceayae OWsl W
OHtCOIOAOyon SA NIOA0AAMGS









PAGINA 0(HO DIARIO F LA MARINA ( i I),0) AND CXVI
444u4. ."4 .

Nan !ersonas Grtiesas i> i


if11 r30Hii fl il1












Legaron Vestidos -.,%VA C( SSE

on Models L t

Especiales Para 1-o

Personas

May Gruesas

Ev Iola# s h a;I u
441fha d" la [orr laman
44 ."4,." ,4404." 444 4.4










4444Com es 1-4 14 dE V
















HOTELPAR DE PARAMFTO






























SAN MIGUol 264
44NT4 SAN RIIOLOS4Y GAUAN



2I N9. N( 4441













HOTEI operUS






VA
Especiales Par 744 d4,4los44pr44on4s























PedIN press jn igsogo"
406 4'a4 4
\V4 'p,44 1 4







































r!No de 6err1ble V-Ct at
En 4444 44 44444 4440 a 4 44(1.t /4'44444







































ly we to sabs.

c66ll \61e muches66
v no\ soo deoune


on ~ ~ ~ 6 ac tol 1 ,to
*4,4~ov 444 64e It~44 %.4e 'S4 .444 4 '









4,44.41~ ,414444,444 UN4 4 4'4A 4t 44U1A P IO VEDAD NV1EONDO V RNAN




































Ie ,
Rt~-.pro 444n 1 44 o. 1 4444t a'4 ~ ~ 44




(V414 444444DO4 41444 44
va *so." Ma ,,",'t.";r PARA 0U

Cab ll q uo 4uh a 440 '4 C 2 1 L4 4 ,4 44A44
7" perona ('444144 4144"4,444444 444domrA4 44
y4444 no44,44 io 4o 444o4b4
1444 ~ ''."-44. 444444Y

SAN MIGUE 26A44L
j~ ~ ~~~NR VeAg aIOA VeYs - - - - - - - 444,4"
14EFN A4'44,40153444144444





ASO CXV DM1O DE LA MARINA. crdCid HR anera MARTES, 20 DE SEPT. DE 1949 PAGINA NUVE

soIrIN Almn en Tra DIA 24: Ntra. Sru de las liercees
auliquo shlema do Ia am. dina4*I o5.
Ae D Q U I Er RA
aadRUIra *1 fossYarh C




]aD la or, fdad 6 e
44 . 7






o,~
1.1 adraa't~a soes 4, n q ra adaal






dt: o I A,,t .m e do


mm, n




b ~ ~ la laapilladde do o n Fa



















.VV




Guayabert" asWas lancesgvnco: utua
--gsl v- Ulft.









Pataons Pul lover



























y~dof Camsa dhSor
Vea enesre athdl P reos'elcar.SUP oLU
1-da aIMsy coaakeo.TOMA U A



























pafpPblanct71con c psolplanched*
n ken, se*v*D F1JARLA ALPIS
Art la~a*> 6*pl de lot Lomiica






























as. Todesis50' *sih1s Ghrs Orso
Abere 6.95 Laa.1 E Ael is a
d9Acm l AI 0s as heades 1strrs























PULVRInv,*ses oa as oieorte lmdl YAMAT,.,,IC $PE DE.3U S Il Cf

ZAPATdRIA y eclra o LUXE *an 1s lems 'sas Oeneces. ra______________________whencexii y de~d onitni mieedrcp akt
LA MORISA NAeSOTentjdse 4 _____ _____ trasfrma d 1a &e'.5vade e la er a

Abra-O.- s. nddo.rtrv.n epranokuepawr
A- n a4ftpeco aniai of1ee-sar a eo>ew a ao paupoa
a. is. aes*d Ho hin calsao e o l~ann rnr'a




Soi~hE C/dit .a n aAala POcnala sia ls pa .nla soa 5.> 6. a a
pL Ly AV ) f 1%
J. y









Pa* >lo>,>'.Pa Pullovery C m e Sportj

Io z- n
vel~~ ~ ~ fit" e tv 's,-L
N und yb son. EL 10.1 1 UA, 56M0.16 ENJ310 LAVA
fojuA0 s 3 VECES 5 S, EIME Sl j L156115 Y






PANTALONE. -o *vs FUNCIONA SIN NEISD
oaia, ontaaaga 1 a*Cs. DE FIJARLA AL P150
MTda Ha
IIl >s sBENDIX pm o> m tis t~~ 5*l>555*lI 71. Ia

PULO ER 012 A i! of114ptr eI amsdels CYRAMATIC SUPER I

A a '- .9 c Ud p>*4.ls5ss*ss>*ae n su n uble ebegamt

CAMISAS 4e SPORT *n tei!o 5 alade .*I*o5***515*1d>41Isd *>*0* 91, .I. aS EO.
4s tntc" el .>,,d>l la*,* do la5. laSr
colo azuL 1>5*06 beige y~~1 *,*aro cons'ol5 1157* -Ami o .1' Salaas a IAA I
coia l,4;. IA l***ln >*155~ **0*sAl d5I*>I15**'5>sPIn Vi05 Ww15 A CU i 1. GYsRAM 10C*

Aay m6 *oi pr is tsabiisi I al et 1* *,.>te**.*>*5 p* mW
mos Trais de Hawsi dpel Palm
yech de su .m
baislrbsids*6, pato Cuba







SoIdit Cr' ito m fi si to dwa ~ c .as, ue.'
so p Q' ~ tat








PAGINA DIEZ DIAR1O EF LA MARNA.-MARES. 20 0F SEPT D 1049 11 --, ARO CM'

Solemnei inauguradoi~n del cursor INo t i c i as .Nuevo seriviio de vfoprers entre N o at i a s Tog vaisco-iu varros se euperan

on cl seminfiro El Buen Pastor( Cait 6 Ii ca s N. York, La Haibana ly Veraeruzj 4i vc r sas ef la ayadr 41 msU ,Qflwerrleos

Prst',cllt oM t Itv~lmirf dcl dia -11,4" d cn Vhll P t~ "* t- t" vkj --I It.1 1ti d a a tablei fa Id& R Artnl ui l d ia ~ A t ~ i

IMalln I Artvaga juit l cI ircular ,It urTjo t, V-pu 6' T- -t- I d rark Bf~llf pMnii t aA
col teras Aignidadcs I I,1 p,,-J -Flgitiva catlAica. [ am cii 3M, Atu i ,"I ,N Ad- ,1 1, Ha iN -Ja de Ittm 1w ,Nist .1. que ha I(I abra jut aamutc
IFCO C T tC lNaNt N'- ( "a ll N. NI At'aa, PUE- NN.NN. I-~N N' S.C--i 1,0N, I 1P --- A,u Jua.T I. ll~at ""tf '-""! e ;-N deN b N. ~ iN ,' NI (" p it fit; ,

,.NNNINT ""I . i ItA'iNN. N.IN1CNI]. t,,i .,a I P", c'. diNli P.,N
I a I"~ N. ,a T,~ '] t a 'T ,. IT 1 II, T1 a ,,,. t I T I r- I NA iN N I I--,-,-,-, -,
CNN." Nt, Nit~"' ,NNN. a' ,t , I : ', ,N ~t IN~ ~ N ~~"' N d. ,,t y ,;i
"",Dt , N -Ni. ,''ii 1 1 A 11 ,, S, ,-- t,", l N t N! i it T"'a. T' I al, a i l.- '. N t Ti
i ., g.NeN."NN. A NIN.' INN. T,' N1tI N''NpNI N .'NN.'NI Ni ~ i" iti ;i NiNTNN t. I i IN. 1t C.N. t-N~ t N IC~i' NN ""
.bA, , Ci1 i i '. N Nai. r 11 I,, f. I Ia I~ .t NN t." C ,! ''NNN,, ,, "'- i N, ,
N AN'",r ,- T i - 11 i N N NIt .! 'I~ .t t ,.' a .~ itTi',I IC 1-N J.4 ,+N NN N.N t tC N N ii 'N
TN .N IN i ANN I I iN., I I tI 1 '1 -id- ,-, tI tii IN, i
Ni- 1.-1 1;1,j, i I1-1 i N.' -t -.N' Ct1tta ''N -" 'N ttN .,NN -C,'a ',C t -1e~ AtN N '' INN I A, N't'iNN"
11 i 11 IIll4N ll 1~N iti -NN~N~, N CI IN- M N .NI'llN N.V.' I I fi, -, ,4NC N ,,, 1" iNt-pi, ,, iNNNCN ,-' t
F" :N.N N '- 1 I I N % C i - , I T 1,i N a I. N N', ~ Ni N ", N NNi' YiN ,,', I 'lN .i ."
(C.ai, ,iuC. Nk.N.'G N t Ta ' N N u gI,,,,,1 tI" I t t.:,, N, I 1 it-.Tu IIt 'll 'i 'Ci Z 1 ', T, ": ,' 't, 1] ig I 1i
11,,Ni f 1 q t ,,a f -f N a ,,,," ,NN C ,'C N i~ N N N z. a'. N N N N .,N N N C j I !, N N i I

Ii i' 4iN .'N'I I t ,s: I ,i, N iN MNI "IT, tfN .t a.N N i ,11C, 1t i -,!N ,!'-,PI, I it, N Pr-NN iN Ni
IN I I ,N, N .N . .4' N ,. ,t!N., I~"N N I''N N ,', IN AI II T,,'j l' ;,, ,,

'tNCN. [N i, .''N -N '~N NNN c' ,N N ,NNN rN~ NA., 'NN,.NNN-.N'NNNN-- -N I I I. I 1
I !I,ilNilt. iN:,- r -.C' -NN 'NNNN .NNNNN~NNN
-,. NN. il"N r I Nat N." .a". INNN INN """I NN, I I ON w ld eov Ia~ IO I*inir'ii '"N i 'N I- NI -N-N -,'N N,
N-I, NNN ,i I' a IN~ I''C N IN I,~
NN.N'NNNNN~~~~.'bN~~iNN.~ -NN ,NN.NN 1 N.i'N.N.i INN.N~N~NNNN C.T.N" ,.bNN.NN~ N.' 1.NNi.S.NNNNNN
--A.i ,(N NNi,, N~ ,"", 11 ',! ".i N N NNNa NN"". NJ "Nx c"t J IIII ,-,I jI,,,1 t i
'N N aN .'t.NN4N N NN'' NTN 'NII",E t- ,, ," ,iii '
I- it -, dn 'aNtN tNNNNNi I-N a't C,'CbNt,.N'- N"'i
-1ITN, ," NN- t NNN~N" gNN~iN CNNN N N' C. IN.NINCN
,,i ,,, ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ a '- N,, CIN N : 1 NN4,,J NN"N' -.N ,NNN N ,P t I II ,,, I,111111i ItA,, I ,,,I.I,,,i j",,
N t I, ",t- I NN N N NN'N I N'.i. "Ill'b NI, NjNNi .u IN IN I,,.,, "'ll
'Ni P-TiI,,' N.- N'~p - Nii~ -N -N~N -NN t-" N. N"NN NNN', NN.NSN NN NN' NNNe-, .-Ti ,.!N ,
N",iNNNN.dN -et-".A, fNN,., T NN- N ,Tai iNt) N -CNI I I14 .'N a aN N I'N ii.NN.'NNN'CaN'NN tiI' ,1N, IN-bNN -.N.i~ .tatab ae -tN I pNb lNN ,N --ICIC

N ,,, '"a.NNi, CA -A I N ,N NN IN N'N t N* N Ia N."N t .''N N i NN N I N ,N NN. -- ""'' .N N.,N",'.NN. :t~ ie iN. N NC,N tN
P'NN .NNN 'I N N iN C N N ii'. --i~ N , - -- -- ------------------- t , 11 ,,, t i a i 11 Nb P 'Ni iN it
Ni 'N ,., '-i ,' N i Ni iN N iN~N ,,,,NN iNN i T 40 Nbi NiiNN ,-i 1NNN(N."
1 , t N N ,NI I N NI C t I 1, I i i u 'iI l i ii t a N e I N .i N N 4 S N NN,, c I 1, 1: I
N11 t ,I i ,i i" .'i N N N N N N N N N iI i I I Is- I t T ,N"t" ,',N" ,N i, '"PS 't"Ii it, i iti IiiN e'," :.t I'iN IN IN IN~ Ni 1 ,, ,,I Il
NN',.N, NiNi ~ N. t.bia Tia i ,iti 'N A ,NN I I NiN'N'N'.N' NN' I N 1. NC N,,, NN-N.TNNN -f ',,N tN' Ni'N tN ii~tNN N Nt I CCN.NCN,,;CN,,NNr,,NI(NNNCNN,"" I I,,,;i N, NN iat ,iN ,bNN. t NNNN iNAN.C NNiN t.~ iiii~Ni.N''~ YNNN N.','' ,. tN NN t'' 'N ,N i N.NNNN N1 I N' ,!NN .A.N. 1 ,I CNNN CNN.,NiN'~N NYiN' PNN 'SNN iti,, i ,,'i."NNi.,N a'.:aa
Ni~tiNNNNi.NNN~CNN.Nt.NNNN. iNNi IOS uIi'NN .,., N. i.NN.N.it TNNi C" "NNN.N. NNNNNN.,NNi INNNNt i iN-NNNNC.N ,NNNS iCtNit


N it C.NN rN NN,t A NI t 'i I. IN ,C.,., ,,N, Nt NiN N1- ifCN N;. P i, '
.IN i.CNN t NN .iN N C I N,'i IN N N I' IN N~ I" I~"' I I 1II 1 T1 ,,,i : ,: I ,S N I,'Sa"iCNN
, N iII IAN i It N .N .N N N, INN N N i N N N, C N I' ,N N C N t . N N A N ,C N 'NI 1 , , ,1,, I "NINtN N 1 I I -, I, ,. ; " I 1 1 i ' .
v I .1 I I ; , 11 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~~'. ICCNr I1 II IiN-'N.,NN',, , iN i N, N 'NC tiN ,' T t 1' 1i : 11
SN NN N~N~ NNN~ N N~N N 'N .' .' N N iaN N NN .i N N .,,b diA CN ti N~iNN1 ii ,N sbi" N ,N'N ~


" N II I II I IN I' QNCI I, I I.a~N.N Ii INN'N I II ''CIN.I'NI' tNN N .N N IN N'A 'i C. N CN.N1. T.N~iN ,N ,i ', 'NN I CCrNINN.NNNNNNN'NNN'CNAN'II Nj I NNCNNCNt, N, i iN iii i~t Ati
CIC N1 C.C.N .' ,N N TNNNN I NN I a iN NI N. I II I, I 1 I II I I tII I Il
, t t-N i I N ,C C 'NII CIf l ,NI 1i NI IN NI IN1 1, I IN 1' NI I.N ~ I.N : I ^ r 1 I I "I ,I I ,, ) ,, , , t , I I I 1 N hN ., C i ;i t ",' -. N i a t
I ,L, ,iCN .NtNN b, i .Nt CI t NN~iN bN,.'1.II.NdI N.,'itII,'i II I I ,, I I1 I NTi ,,TN NNN ,,- 1-I INiNN~~ I I,'N.'iC .N NC ~ tbN NCN P N INNNNCT., , NNN; ,
1 ,, , ,, , I 1, -- ~ ~ ~ ~ ~ N ,-" I N ,NN ,, 1,i. 2 ,i~ N ,tiNN , ,,tN I.'. NN N,'i Ni N.NN ,N ,N' TNN N. I 'N i I II P Cite.
, , NNNN ,NNNN N" T ,II, ,- ,I,,,, t , ,, 1TitI ',1,:, , I T, INNNN'NTN 1' NLi N INi. , 1tT,;I 6 I i Ii 1I1
,,N0,' I-NNN N, A.NN' ANN CA CN-NN N'N '. I~"" I''N '~ "N NN' NN'.N I,' II ,IN 1 Ni ,NNNNNN5 tN.i. ".afN . ,tN.CiN NN i i'iNN,tb s N I itt int, ,
N iNCN 'tN',tNNNNCNI "' .' 7 I Ia 'N s-CN. "12-~ NN TNNNNNiN. -.N. ,i'' 'il Nt iN~iN iC N, CN I I NNNd11iNC-Nit 'CNCN.CiN:I


N .t'IN. t Tin ,-i ;O SbO NN N N,,i I~ NI a' i -" I," N '' N NN N a' NN''NN.NN i g, NfNii i t 4 N'. R ; NI NN, N. N.t -iN.N N1" 1 ,,IIIIII, I t IN, 1 ,,,a
s-NtN eh it-.~ gCNtiNIitN,' III Nt N' "N1 IN N CNN N Ib.',Ih' it,-, d 1 NINN' 'llN CNI IN N.;i I IC a,1', N. N N N i "t "~ iN ,C d' uI~ i N NNzN iipi'
N.NNNN'N~~~ ~~ NNi.i, Nu Ii A'NN NN iN N-~ N I,'. I NiN "' I T.~ N I P.4 N.,, z tNN ~' N,.ie ,;N Ca, ,C, N' ,N "T.NN ,N~, Pie ,C TN'N N ,,' it i,'C~
uiN7 ', '-- -1 k ,,NNN , I ,r 1 I",NN ,, N F, Cu ,N N N 1 ,,TI-n d1(;I. ,,,N'NIIIN II 1 1 I 1- Ia i, Ii~ N N ~ NN N ', '. N ,I(it1tr II, I f-I NSC N~ f'N t.)IN I ie,-II i f, i N i' ,~ i~ ~ a~ tN i N a~ tN N.sI N
TI ','NiN 'N N jN (NAN 'N N .Ntbi C.i.N N N I I' N I I "ii' ,- N'I 1,A'N ,aN ,T, tT I I, iI , t, -II- I 1 I lt' IT I 'N' SNNN' T ,N~NNu'N NtC N'~Nii~N i.'~N Ni~ b I iNtI I i,'NC t I iItN 1a' T. ,, ,I t
it" I N ,. N C N- I l C N NNtN NC- I T ,N1 a N"1, I I N, N N N N N .N i N i C. N i a IN C~ I. .~u IN ,Ntt I~t IN B I a. N ,S i i
N. -N C, -. Ni I' NN I~ I' IN.,i AI NN'N N AN I NN IC N.i,N N.tGN,, I lii -N Ntiia it-N' a- Nit iai t i., Ni
J~~n a ,.", 'i a i 'N N 11N N ,T ,, 11 il ," II I I "' 'N t
-~~N~i' NC ---N-N "I I~.C i~N N i"N. I.' NN ,t ,'aC NN N% Ci--- ---,,- dipi i N it NI~ ,''NtNN i t
Nit. NNN c.NNN Ni ;NN tNt.A' It 111 ,ItN ; 'N ~ i ti'. """ 'iN N. -N.NCC., N.CNN ,tit I~ N. N N.i-NNNli
TN~~~~~~ NC,' .NN.N N, ;N.~N" -,A ',.'"," .'N iN N N NN,.N~T N.'.5.N~tiNNN~ Ntit,,, tNN ittu f i
NN .N' NN N N "" kNN NN .,NN NN,' iN" NN J, Ni A NNI -, II 1 I I I , "iAt, ,,, NI it N "t'-', ;", , ,i" iN'N'NNN II; t, 1 I~~.u~ N i'N ~ ~~aa NN N i ib itTNt, iitI, 'eN'
TNN.C IN I C ', I1 ,-II.I II I I 1 1,T I I I'NI It, N' ,N tNN. I N N 'NC. "INIu. JN ai .aCt N 'N p C'~ui cII j ,,, a. ; uu~t a N ; i ,IataI,-- r ,,,
Nt N,.'N 2~i.~ N I''N~ Nrttt (SC~ ii, uC' f.N aN i aiiN N, II I
,'NI-I .!NNN'CNI ( NN.N t Net AN 't NN'N-AT!,NAN .N N','NI"IIN "N'TN I. baCi __ __ __ N'NN., .NNN,TNIC t, I t, iN Pit. i.N u.' Nii iNi ,,'N,'i5,NN1." biti I
NNCNNN I I ,, -I I I , II 1 I N" ,N NN' NCN ,:, ,i ,i' iN N AN. iN C. : i j" .,e ,' I, N ,,, f, N iN N "N 'N, Ni, ,I,, T i ,T .I
NNN N, N. NNN, N,. NiN td, ,,1 -: I 1 7 -. 1I ," 1, , iC iN NN CC Ni N~ N, .I i 1 1 e-Ni Gi tu N Ni i i ,~ t~ :- tNN I T

II II NN1, -N I~N Ni '" N. :.~ N' N Ni N- I Na , t N C.,i' ,NN P CN i~ . ,a 'i i NNIN, INN N .Pi-i
I IN,'N" tIT 1- II 1 .I I I:, NN N .'u NN N,.'N ~ . N ,N N. 1 tI ,I I.1 ,, ,- I, T, I ,,,,,," :,,, : :- ' !,-. ,, d
I .CNN' I N, ,iNN ~.,' ', '''tN ~ N~~N N 'N Ie i NTII, I Ie ,I -II1 :,"N ii -r ,;' N,, iN i "AtC iiN .11 ti.Ni iC ; a ,T , r ,tiCN e IuCCNCN Ai u ,ttNNN
n ,,,,i ,, I i'. : N'N NaII' I.N." A" .i' J'~ I I ,Ni I'f~t~rC I~.N iN IN.NtA -' N.it It IC. NIiNt INNN SI Iais-N N, I IiN a Ni Niri0 sI-.I

.,LN.NNN CN.Nt '.,N NN' N I r I Iifl N,,N N iP N' 'Ni,' IN.N C N" I et~ NI G, i, 1 Tr d ei i ist a I
e, N: i li, N.N NC C' TA 'C N NiN-~u ii~tN i~ C ,d,.eII I I II I I Iit r T
IN.V.,4, 'N--N N~i.NN t AI C N Ni, N 'NIN I I N~ I I'.N, ___ iN N ~ I T~u,,. iA 1,- .T ,,i idT ,f nolea -i d- I Imt
iNN Iia INN Ii N -A A N INi I I:aT'tNN, ., I ,, ),, N T- IAN ,i~~ At i i CNI NNN N "iN aN., fla.i1iN~~N iN N"N CC N. 'N NA Ni LA ,O7INCII eN -" I, I 1,I"' 1,I ,II,,I ;
T, 11 i UtNNNNN, N- 'N ", T' T C , I NI !T i,'W "iN0 C N j 1 ti, ii aiu t t N N ti- .a. A I t i ,.
,, I, 1 m o ']N u a , -, NNNN. -I I I-T,ut. Ni N, NN I I r,,, se t tr a I', ,N'sAs II 1eN IC i,N N t N i ,. NC ,N,"I Ia T N'NIiNC , !IiNN,, I I ', S i NNCNANIINi a NN-.- 'N a li
N. 't. C.NaCT" "N N."NNN, it NiN NN.S N N!,iNci ri NiN-i, t -C N,, ,ui iN ititNN'.- iapI.I I A-N-Nu-NIa.-NNitItN,,-N t1N NitNN.N.S'a.
NCN,'NN NSN'.LN TN 'I'~~N'N ."N ;i, i'itN, Fi,*N i ,ib N N' Cii N Ii.~' .i N N NI NN, :N ,,.j i -Nii CiNN, I ,- iT'
-ii tO- ,C NNN i Ni N' N. ,N NN N ~- N ,B i iiN 'NN N a ,i'N, Ni -NNN tAei ,NSN ,N a "I0.5C
't T u i a I I k, I ) ~ ~ ~ ~ ~ '" N, IA, ,N NN ("NN'N lN I' .a a 1,I i IT,,,,IT ,. I III1 IN IiIi N' -.NN CN NN N IN NI~ , NN ,,I 1 ,I-- It ,T

NC 1' I, I1 T s-t,N. ,,, NNN. A ., -- ',' I. .N N, 'i NN 'N Ni ii N .N 5.NN i S 'N N,N INI.NN I N.N i ,I.'t N ,Na t N i N~N ,CCN CCN it Ni' Mi-i Ci,~C S NC i CN N. INC ,t iNNC. I, ICt .,,I I I 1 .N'iN A N 1 -, T I' : TN ,i NNC A N N N C NI N .IIN T ', .T ( I iN i t1I ;T1 t ,
"IN,,I NiIN' 1i Ni, C.",, N I N1tC: NN.N-i N iNNiNN.NC ,iNN~C~~Ni~ NN ,iN. ,ia iNu~~N ,'i NCN, .
a' N -'tNiNi N~~ IN', 'N 'N Ni ,C P. NN tN N IN N I N ,' INAN IN ItNO SuN A,.'. N "N N IsIiC,, I~t~ INiNi. -~u~ N.C ,,'N t Ni.N i
NCI1 III 11 .' ,N N N i NN N N N 'I I I' IIN "ii N. AN, N I. N,'i N CNN N C.N i'."N ,,,, I,,, ,- 1 I,, I, ,, i! ,IIr1(N. NC .NCNCA i a I 1 ,Iait'iC S a
Ci , ,,N,'Ni i II Is-.INt.I.N.'IgN %. .r .iN N N NN ;I IT AI INCi l, :I I,, 1 , -- ,- IN I CN t.N .i , vt,'. 'J. I I (N ~~iN ia 'NtiiN ,i:1 iT."i~u t r t i it'iN 'i


""N- II ICN -"N N, N.,., C : ,- "'. NN" ~ iSL Na Ni N N iC 'i,' (NC "~N~, NI N i 'i
N I N NiN. N .i NiN' ,aNNi e, uC Cu OCi. tC, NC N 0 ,NiNN N,i,'N 1 N CNN, N Ni T, ~' N -N.N ,'I
N 1II. z NNN N'N' Ni NI A.,'.,I' 71 C~.p. Tii .,,,, ,,, I C i"",!,"T ,- 11p6 Ci ,IlC i --pt., I
------ 1 I I ~C ICN'N I iN.' z (N a'N ,N, i, N. aN T I" ,, -i I N11~ ,NN i y~ i N N~ N N N t ~ i '-ii'T Mii~ 1Ni ,iii J ,, ,1
N.,'~~ ~~ I I NN., iI ~ IN I 'NN CN .',NN.N NNi i't Na ItNN'N N.N.i NN I~ ,'. Ni1 'Int I It-i ~ti, tt~ N d.uC AN tCdi .SN i Ni ?-NC.N N
,.N N- 7NN'a ii N.bN N, ,a IN. _~t'ii Ma.,'NN:,CN,.NiNN.' ,
Aiigt1 N! i N I N' C,t ,'I r'' I,, N.N NNN ,'i' i ~ ~ i NC i i i Na 1'~,N.N ,' C NN NiN I tNACII.CCN't-IiiibII'T 1 I, ,,fT' i, ,,, ,I
CNNNCNNNN.CCC.' .NNN"" N.'N~.NNi(NiNt ~,NeNNNN~,~N.'~"NNNN.i'm AN ,'N N i~ pCIN NN,'N.NNiNNNN iI iI NNIitN .iNNCITTa.at'i. NS 'fNC "i'N.
Na~~~t.Ca'N~~~~i Ni~' I~ NNNN~~. ,(ii,. ,N',' NNN NN.NiN NiNN'a~~iN~~ ~iNi.iN EN N NNiN, 1nI 1-1T ,N, it~~~,iNi'N(N.,piNiCN Nin,
T,,.~i -~.C'aNNC~ IC, IN Ia .ita '.N i i I IN N,. N I ,,aitiN''N .~ti, NNI.NI iNN; I tu~ i~,N ,N t 'i ,iit Ni ~N iC- NCNaN- CNN, CCiN eaN ,' .aN NNI"NiN-.I,'411-d
t.NNNANN~I ICNN b' tt. i ~,N I'NN. NN I''NN iN I T"'N NI .,NNiiN ', Ni",. ,~i. Ni I.it ,' -i -NN ,Ni M N~ ,NNN NC .'.N.Ci.iC~ ii,
is-~,nNNN. AN'NNN ,N'''i INN N T, T" ,N~ .n u I ,N NI t'Ni iS INNN I, I~ Ni .N, NN AN ,N~ A, i ,'NN P;. eC t!N"eNi, a'A g. AIii M ii NC~N~N.N iN N~ C 'N "I", I,' I N ut i~ .i iiN
CNN iN .N II , ,,N' I I NiNNN iN Nt sN I e x'NN .' iN iN't NiN' :,t i,.,NNN i ;ii: NNN aN .,'1N -itC C N.iNi (I N , I T i C ,~iiiCt ,' ,'.Ni '" SN I, - i, yC. i s-Na,'. u T,1
IUC IA EY N N IS EN ,'N NN~' NN.iNCN NN ,' ii N ii I ~. ,ai, 1 I,', -'NNNN N.: NI N Ni r.N-NCN. Nt, I I aT .iitu. t :.E IC I ,"NNNTS, NAC"- t.CN i ui, ,'iN '.iA N 'sN :iNrai --~NS
,, A,'Nat Iz. I I ,' ,NNN IN t i. ,N Ni iN ,'N I I I I t ,b, ,'NdN .N ,',Ni NN NN.CC N"t' t a. NN ',' Ni ,itN iCii i iN t" N 1CN i Nibd Ni T-i. s-iC,.' -~t,'a 11, i
CI Pi11NN, I ,.i -,' -i NI, CN N.,,.CNI ,1 1 Ca It~ iN C N i ,N i t.CNN Ni r N ,' u Ni. N N I, a' N I NS DC - AY-A~ C C .D CNNN- t- ,' ~ Ni MiN u
ARI R LA I A I A 'N .T .Ni NN,' ,t, N u -iN, IC'i CN ,'NNN NN ,i ,t'~i' di :.C.bN,, NC N.', t' NiN Lt,'i CN Ni titu SN' iaC biN N '.;i Mu"a EC'a aIa. IN 1A N N, N,'CN Mii Oi Ni Ja N i i N",u.

I ANN , ,'N -a NS~ NN Ii Ie IC~ ICN N Ia a N, N 'I I'NIN I iN ,'Ci i N.N I ,: N t It' ,'NNN sN a. ,"' C ii Ni N ," t-N r'-N1N.,i MNt .i: iuiidN, -, iiici I da'
pitNCNN (iNN t.- N.- T, N.' aN, -i,'- N. NN ,N.,'aitt .SOC ICION Ni VSAtANN'INtN.IC A,' N, s-Is-u, .N IN NICI I I CN

T ;- t ,N ,' N CN I I N i',~ Ii N"a N , -1 C iC ,'Nt N, s-Nt" N "N Ni NtCN A ,',C i Ii, dN.N
N i, iN NN' N,,'., :N.N -SN: IN.Ia N' I I Ii'NN N bN, I i, ,C N i 'N Ni1 N'N.N ,i-' ,: N, N' N i ,'Nt. NiI,'I ,IiI'i,'Iu Ii RNCN, ,'id' C,'NNN. N a. ,' Ni CCNN. N p N
T, LA IEO R ,NNN,, Ni.o.ea t,, NNN 'NN ,~~,~ iiN '.sNC.'~NN N'- %:.N ,1 'N N iNN,,,t C,'a, Nti, ',iN Na~ C N i~ N'1 ;NIIIANC,,, pI ,, t', ,,

1) -1 ,i mu i Ii IiSiL"I IN IS tNNN N ,a N,~i, Nii 'N Ib ,i ,SI tNI ', I~ i.iN N.~ tiN NN i

INI t ,.'NN.N ,N i ,AII IN. -III ,''N Ia C,' i, I N~ i'~ I N I ~ ~ N ii -i N N, ,CN ;i ,N N C,' (N'N -N~N ~ iT tN NNN N S -NIO C NATNSN .i Ni ,. Nl, I' a C,'~ DIi Ni N,,


iN N SN iN ;'N, ,'NN NC, N. CNC N,. I~ ,~ OINSO Ni ,i' N-s iu ,btu I!L -N i C-ii'.ii N iiii"iC Si, Na Nil i, i;N :i a. Ni 1T iN 1-" iitC N Ma l it
N i NIt NI N s- IN N i N N. .1 i~s NI Ia 1.N ~ s-i iA ~ pii ,i iN Ca a-i C IA ,i TS~ A NI N i it ,i ,'S M- Ni,-
N N1 (S T, Iipa N ,i ii' NI'. i i i N l I N. s- i i' d i"- ui. it "i .C -' Iu iiiT 1t u0 CN ,IViu
Ni IsiNi ,i )d Ni -ii~i N a. C aiit i'C id aN, S. asia.u' N. it ,i'-Z a. It NNN IN I-ius -iu a NN I ( ba. l, e
p, tNa" i N ,, ANa' iNN 1 e ,k1,- %Tt T s- C l'N w iN iaC ai, a. N M.i Ti I I 1 1 A4 ICQ A N N .
It T- I II II I- It" t. ,. I I i ii'i .'. Ii _a N i -' i ,i, 1 It ,i Ai~~N ,;):A 6~-aN Ninw N.Cis-,'N.N.N,,A-ttaN.iCSNNNdea.NNli

Si d iit p r~ i Mm iiNSNuNNN iii ,' ii AN i n C (' E N i, iTN IS N. %,t"

I, .''.j.' -N,, - , .%






AD XVII DIARIO DE LA MARINA MARTES 70 LT. E 94A A

Del flambu flub
espeznwts~$Z~W 4SARANAS C ON
LPe esperame0 Cia aR

eo oo. Pij. mo." S. .30
enM XC ''itoIOOWn4OCOOa Z' 2.00
1CO
-11. 4. 1, anmd < t, 71 s 2x99 3.00
este ternno, . Uiba, smoro IMPEIIAL bonl td

la ses en los paotoresoos canal" dtl WdAeA1DS s SILO
romatsco \obhm co oe an s a0- W~t adol do lt- pottt 114
cantadasplayasdeAcapulo bnco VA1ttt o do b
guards p ustd moc es am o o y pt
a 41'.1'4.3 0
Jooo'too tW-to Ot*toAtWoo ol boli. to htlo Belko loo ms Ott, toots 4.5 Attot, ottootW~tsso.o ttolino O be itl, -t aO -Io.- too. 5-A Mott, otoo I.Woo,, olso O, /24 d.o #-o. ptt, lttbtto i somco

5 O &rA 7,25 Y 5.40
Otto t tt Vttt tttttOa Oto t R4A. ANT. PARA ed'.A MER. P 1 t At t Wararo do b Io, s 5
ltototttttyotot'to t tsttt ol t ototto tt 2.10 Br AmIAn MA OM LTO PA A LA NOVIA eOtBI r ue to C o o 'too a rolt ot deo yttO fa tols #obro aton
ott~~~Et, .s o tootoood dooood o atooC"osO,



Pae Una's ,Mamon molydsle 4
haalando ml propiu i M h tm en fonT
am)iosl ee4a e r r topd aru
11u tisphyq el vat~ de sI ne"ro t
Pto setaw cao de moneda yort a n
partip d ol do unt emto r u ri i/
qoo e tperan en tl Pais de I0l0 (,r 00 Oo Cgttoy o fggtg artOtns t oot
bsbisoolV t ooodmoso *dtottOott ot









tDA Y VUELTA ,t





















Vso Io A soaro. to ot fodot taoost natto o re o a o 1t o lot Et
w toovtt owIconotteottco, g.c-t t g 0,t t at' t t
































PMRST A LWEA 95 NM*
Ioo tocitss
. o.o 000. 0 t to 9
























es ~~~ ~ ~ ~ imr rrecoowo tasoec .oax o
iioooolsat otpooot 'a ttvttto t0 .;; ot too', ot ltt tO Ot o taooOt 00 o

tottotaltttotat Ot












Vv.0000 Yt oA K-RAOt AtAA.A'.'.
At odo yAPMJJ
A,.
C' ootttt IN,
0MN2 ()k*MA



7~~~~~~~MO tooA to[SAIUIIAD NAMALEBRMTC
POXootooit to UtMooootbMt to ?UottKo IBM%,obo
t-o---tto----t--o--t
ft t~ to ol Mt tooM A-oUV Mtots tottt Ma



cowum I Mt~nAf.1(
IS~t pl'o Z,4"a~ o' ANR"







PATINA DOCE FOARM DE LA MARINA-MARTES, 20 DE SEPT, DE 1949 _ARC) CXVI

Dan a conocer las reglas praeli,, iIL," i 1;. Reclflma una rderi:;w61fe Jl nClmler y jIxeasanl de almenazas fle muerte a

coneurso en, min mn de Romay li i 111 ;, 2;" Ich 111* jpesos Im urn''!"w railpemisora jM ovcaip in mganteas de "A. R. C."

Sciri premniatdo con quini atos pj',w el *nejor I i14 l!~ r!-od 1 ,ag 6i mim .i u e~Atluo ntim' e neqiateCa
extuio hiogniko i-hre es sabio tfroba o ai hoyat cumpl a h~a ahora.-Eiirla aI fi e nr I a i 14. Lii ,, if a n enfecaPSIefila-ufolf l Minlitterin de Cantm irdacionee

,Z I NIN NT RTR IUT ItEC L'T NVALNES rA! I i.t~itiL ,w i De Cogrmu I n ini ne.', 1 rit ,, roil Ttiiirii ioti it0I.,T, -l',,ttIIA,
(' , ,, Poro t,ti t 01 000 rtr S. t O iii0tt itOtVt n, A!R;o, i ~-l~- o rnk o V rl Ot iifO itttiid rir, ritotot-.
ttitoo 1o--Irr trttt --- Io Itttt It ittti -:o~ .rt -, itttt "t i fi e, contiiimtnf" VIAa EROS toOrr,-OoA.ttttAirTr .~ ~
t I'l I INNG N tedA nrto it.C Quint IIN A A r ti. .oir AI _ot A trtt iittitt Ar tttt ottroITtort~t to rtot 1 "I":- A t rA- ,-r.rtr1At It oI
S~rArtottttott~dritAo.ttororoitt _111tirit P1 ~~ltrt oio or iooortrt r1t_ t- Ooo11tto,
-ro lk ld -1r qo !i totA flt trAooroO o tibit.to_ -ttoitti- rt In Trooo Sot'l,, A Fflr ,tio o titioo Ioy to -tt to p~" to ~obrrt. it1rto itro -Aor- I r, I I 11N ot-rrd o o ,ir~ttittut it z rt rt o rt otoIrt W", rititr A-t o -toto itnrrit !"fi,,,,cali " Jld, "i1,;,1 !,Solo ~ ~ ~ ~ i_ i,, co tin ,rorrtotoororr.4tot.rtoottr~t At ito 1 ittrtrr ittott,rtt--tp,o,,Afrr-i,1'---rtto;, 11 l r," ,, -i.i lmt1 l - --, T T- 1 'to.

51-ro rd .1 it,; 71 1i., ot, r t o ,,, r ,i tt i tr t oT r oin Ar ti tor A r tA tt oo ti F ,ort ro .'r trr ,;o rt: too1 ooo 11 1t, At1,o ,O A t o r
Ia rg!7 -ooe bR, 0 hto,/trr Oo tit ttotowi~ or- ,, ,,,A I -Oor -, : ii r T -r ,n O ,,,t r ctrit itu ; ?r 2~ .r ,-to itoxtt r it 1 i .' ,"tt t ttt~-,'jttCn ,it 1
4' r I -t" '.titttt Et pt1 1 _0_1 il trO,,""i ; 0 ,, ),,, I I l- 1 Otitite,_ ti tottiot Co- it it t o it,, ,, htt -t ttitroooo ~l e.1 11
O- 1 oTotitr" r t, tt r r _-" rtit' t tt I to1,, j i, 0, 41 it -t-titt tIo """"'ttO tt .to t~ t r o tot r1z o d to rtr! tote -,. toot
ittritaa tl tO ti tttit o Tto. 000e t u ur ai 1 -, St in Trir ,, titii ,, "_ ,0,0I.,1R0 DE1 ",I T - I i abn i t tto -otont 1k~l ,Altto1T -t;,,

ao tZb. to C~ ro o Iir o to i, .rto, ~ Arott, T, itt- 'ToIo.
Fot tio tito ti IO I 0I00 Ar tlo ri 00 t,- to O tt ,, -ooo ot r o rr, ftrrrti- ,,i, rtO, t At000 tIrrtrititI t rootiot m t Ito. tot!ot--", : 000, ,;,lii ittttjoltttto o ootr j,tt ,,ot t Att0 20 ,~r, rrZro' tort oti .
tot I 10 ,, I 0V ottr !o to o t to 0 m oottttinrroItooiot tOOAO tA000o Coot,, t ot,, 0, 0tttittti 00tO-ttot, 000 itOttrt10,t- ttotAloot1t oitttit t oorrIoro-or
s0rtororottr ottototA;( .Orim rl" I ,I",I' or-nt, "rto ~ roto oto~ too too 'it ,, ttttoi,, nt,, t ooo lt," ,: Ar 0 0 0

O ntItlit I 1to r ,r Itt roo io - t o to t Or to tto ito ,o o ot t or tr ,,,,t,,V ,,l~ h I -t-tRortrtI, I C'! i" , 1 toott i I 'Ii r -, ottO ,,! t ronto t t
",to e"Ctror;o-tIoIo. otp a p r te gAct0n d0 0-,:-t "I 0 0 t 7i %oto ,nt, Ar-- ,t-trotot- 'I, IIt "At" t' f'i't" t" ,t, it00 t" A,,,too, 1" ot, torii tO toot"" T 0,
-~ ~~~~~~~~ Iortot itiIii itot r, it Ti tirotorIo A too, ritto i it 't 0P 0, t, tooot -AOOO tttot -o oooo o Ioto toI trIttitiii t 1 to i-iltitii r rt ittoott it ,,,r~ ooi
00- T ittt ,ttr I r o~ -oe ,l~~i t , ," ,!,,1 1 00, ,, -,Ii ,! "- it t iro~ r~ totrtti It : ,,- 11; l" -, Ot ,it i t 0000, -ltot drto
trootit~oooooot~rottototott~oorO Io it1rroiirrtriooot --iorooioorti~~tt~o It00oot~ Art Ooitoi to%, ,~toto t .ro id oo -Aroort, 0tto~toor0ooo~o oororot toIorototo"ll'

it,oo Otto ________ ___._,, o rrtooroti 00,00 tro,0i00,Ot tt ,-tl t" ot lo;ittO orottilritIottP to-1. o!ott:tr:tittitr'Ito
too ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ itoro Ir Ar 00 _r tO OO1-iti 1"' "t -o~ t 0,'r,, "o~ or "o Art ooitri "',-0-roro (-tottootot Ot""tooot oi,,0t Otit Jott ,oitit "or "ttooitit r,,i
ttttt to-tt I.,orI'llotI 11oi~ to 0t 00 it Ritt tr rtti to 1 ott toot Alo !" A'll t,t A ot-tto totot At tttli ott rderr f" Po
tr~~* ,tborli Ai _i Ioor, '0 Or. r,,0, ) Otoor' rotit Ar~oo-3z to itt"tI ~ Ar toIt~ott tro too. 0
,tot, ill ,,,r rotoittr rtos r i ro- :I, ,, ,; -00. Tr ~ iI I ,1 i -O 'oit"t00t o!ito 0000,- Ar totooo- 0100',, f .-ttiti. ititlo t, -- oitootett, JTitr ,r otlq it it,
C" ,: o:t -~t/~ r r Ott oti, -rro -tot_ ', ,,. -";
" '' _ I -:O t1o I i W T t ,0 0, 1 00 tot P0 , ,. A v -t o t o o r- i'l ,,, r ', tto t -;-o- -o1 o to o it, tt'J tl


0.0 0-0 Ar I0 otr :ttol 00 ,r~ ~rt Ar To'o0, Ittt Ar ito ,~r tttoo
pr im titibititjloo 24 oe o oj ,2 !2 -, r It ,rt-to I t !,, ttrrtoo tt% AtIl t ;oirtt00i~tott Ar t. :i-n-t',, , I ,- ~ i t o ,; ;ioj ,,,roottoo oto,7 ,oo"I 1o tit "to to o rttoo o;Ooo o ro tt totoor -toO Ititotro to,:o nt 'ritr _oittrt irittto Ito o r t , -Oit ,,it it io.0 to r o o 0-it ot ,7otr Oo tt' ttt ot ,,. too C 1, ,_, I , l ,

.00000I I000 rotI I I itr, I~ 000',-, )ttt -,,,,.*,- 0orro !000 rto ,, ,"I1il, -3W !,,''! ",
,,t I0 i%,titt 0000- ii / ,_t 00 rr0 0,i looot Oooo- or o t-o l-- rot ,otot rottortitt1 11 1 ''Iit
Ot,,1~ r t t, I' l~ I tt-'tooO ,. 00' lot 0- tt 00,-A-to-,I ,,, too 0 o 0 otgor 0,0 *ot~ or .tr .tot it Or, ,, 1 -, - ,
ott1oi1 toit, ettt000t 1 1 I i ,- I I~ o o - I ~ It ,, ,,, ,, -r.I f, ,
I \oh toorotiroroto io 1, i, 0; :_1 :I,,,,-,II1 1 ,,,I1 1 1i
it 1 Or Ito -r 01, ,otrt Or I ", i C',,- lII I ,,,, i,.,,_ ,, -i' 'I r000ii ot otr or A 'A' ,-0000,,__ rotoo ,t~ 0000 "" 0 A 00-t tot O A00000A tittooroAt

rdiit, I Or Or tiitoi t~ .r. ( ) - T,0 SoI 0,00 I i 1 I 00,0 t-ti 00 "tot. it to totr , -11, 1 nritwI wI I' h-,
t"r t' ,o0 it I~t r tj a t i ll f,- I; l1 1 0,ItIA ,A -1 I -in I o or- ,c- ~ IOrrO1 ,, ,I OI000ito Itr Ototoi rtott to. roe L toooo 7, ,oo Mi t-t Aor 00 trotooor it totto. 00 to t itot It l, n, 1
Ii t1,11~t,,P ,1 M ot000 i O 1or1 o A. C ro o otto ,0t., 0.,-0 0 ,0,0 I00, A. tor,, ", itI
I~~~~~~~~,ro Arort E.- 00l A ,ti0 00, 00000 oo 0.00L N It. ll ~ '. ti e .I I,
", ,,:I- rtooo ono It I oto -t Il ,, ito ton ,od tot ot intttttt. 0 tA, lk ll lltt,,,itO,, r0 O~ r,ro. 00 ,~O .it 5o000 1ooo -oi Po tt Ie40 to to "o moot ittt oorit lott, ~i Ioi,,, ".,e,- irla-~b I I 11 "', it., ntA ,rooo 000~ %.1.,1 1I i,1,,,,0, Iioo~ti Arr- .o oorr 'It ro- 1;,T 4"-M')' I l r,.
0,1teitIto1orbotitt rit11 I. _rtr-.- -to, orto otr Ol tor, Ot ,ooo-.A"ett",inA.Ar'itro-
,,- ito rotortrOO rlooo t ,~ t :" 1 I tot ~ l !, ,0o rtrto I tt li torrot ",1 'lI, ttot-ttot0, jrt" I~,it .tiN
,nA _nd tilil,~ ,s !io -,_1 ll- ,rC I a : :~ 2 Ar - ttto I 00 it 00 Ar ;,1" o, t Ar1 it 00 it. Jootti ,lltrr 1yitti t .i o 1"i itt I ll
i - Bol -,-1 ,_, ,:-- ,- -" -, i: ontot too iti too ,to I. "to 0 i .t "~ Ar Iitr i dtr To tio it tt itittii
200 00 Attoitotlo Oooee too AoottVtlti t t 000 O roC. St -irot Ar -tt Itti it oo ,, ,
-11 \ \ to -o to do ASO ,O r rit Ar 'i~~t it ntttO I t IA , ,t roto r, or ~ tootoittor, ,t~ totti ro tiri t. Ai.- 0
d A 1 1 n to Pt y -, ,- I- to o , itI 00 O r Oi, ~ t t toto-I i Ir r ,oo it r t i -0 fO O ;to0 000 "o o tt t O tr t. to M o t .ot 000. (
Iat.0'crIbastL boo m s f to- odo to b tI -ooootitbttrorOtoit~ Oooo t o tr.t Arror IT, rPlitri t ,; ot;) -,itititit ,
US 1 --__ TE pu d ITto LA RELNA, it,i Arotio or itt r -,,,,- _i ., -1 to It~etr -tto Ioi 1tt it 01 toioto 0000 1%r j",
Ooeototoriottiot 000- to itto-t rto rr -~rtot Ait Aotioor or 1--l--,, nit -,,

os, Io ,A o, o .0, itttrnt ooiorto~ tr- i~ tro i ,1.0, too, Y-l

CUB I ,i," tit Ao_ ~ Oto LO t p., toitrti Littto'*oA I 5 Tt1
of ,ttA oittoor oI' Irb A ter: rot _to Ar, oI,
SINo eARlI I .tiroo 100 it .rtrtoi rr I i-it,rto ,-_ 'I, -I i r- "_ ,12
-oq lot beo -r~ ,ltlcao y dar di I De -i Vi2 Cii to1itotitrJi. tit" ,ir,,t22, to
Dr. l0 Mar ine 5N 10 dc Iotr r 0 _ot A - -_h1 I ., r" ,ot ,, Gir it _trri Aioo itti l Vrorttit -.trav7tt1
-~~~~~~ttto ,r -itibiio I Pitt., I'-, l -0 ,i .C
__ A I a iti-i-io 0 tor kr or Zo 0 Teo- ,I:. V 'ot f iit It'itrA~ii "

Itoo At I~ A. tot Ar 00 it ItO Ar tit i
_,d At0, I, .0 0 Ir 0 (t r Ar- it- Art ,l. l d lh c ,l r il
~ ~ ~ ~ ~ ~ ~ ~ ~ 0 to, o, Ar toto 11E00S ~ i~m-a f~w.cie l
O m iit A r-1tti tol iteg e 0I00 rro t o M r ,,,,tit I5 n .,. .Ib h 1d,, .
rOO t~ t Ii 00 tr i tO' A- ~ Lr-_otit Io o" tr 0 -i r _, 1 "I- a "
I- .- iti,tor St ttr rI I, . 0.- Loortrrt 0.0 to tT n Sot
at0 ittt 0000 rtkt:oer r
000~d et~ i i itttii tootn tiAet to.'ld Ir it" ""o iU S ti ti
eoior A. to. O.Oo. A.__ot iti torotititi-titiet- A, orit Incootit
0 a tA gU R A N E lU TU R O I I ;,0o0 000. tii 0Aot, t, 'l ,roo-l'- I0, Itit "tIter to Otiit Ii A. Ki Oirir .4 itttiar t, ra a irto t it
0000t, ---I-, P ,, ,,l _, *ZI err - oro1, oo it o Or r oO r '- ot Ar 0 ort , c .Iit. t~ o 1 R !
.rte~rtiet11e, 0 r-1 I t 1- I tit, to, tit t,itor ot.T 0 j ,. rat!""' I ttt. .ttt a 'o td o tttit.iit 4
M.It~~oO orit Aal IA.r~r 0,t it' tb-t Itt tto" _000000 toti, Ai-i 100,-it, , 1 11, ,
Aoodtt~ld lt Il Trjt e, ot Irt I oIti it eritn Miriot Ar 00 1-1 ,- ;i',- 000-l ll", ri It.1o to, Si i~ ~t~iar ~r. A, it .dtr. 4.,;

",--t 2Z do ro .rc Ato Ir e_~ do Sot oot !tt t ttepO rt Dr ~ r ittorti it 0-0. 'P UL I I
o p oit n or p "-itor *rtto t l: o I io I oo r 00. _ioi~ I t, .it_ 7oro t r io, Or t- 0 Ito A t or r tr dl 'ott T b p e . S g. n Eitia it.- ni, It~ ,


-littio ~~~~ ~ ~ ~ ito Itttttit o Oritt itto it root .1 I-', ,iI I1 AB ,,~ I , 1
tt~~~ittor~~ Ittriis obtoo it. doro i Intaiit~ tr e to,.ci ti A i

d,. .,: -11. oA r.A it Irtr Ar I T, rbri rr A otor-. it C,,,- '
o a 0 It I ," Pot. Ar 00 0 t x tr 00l t roo ,t to .a qi nrn ,,
in~~~~lnt'i~Atto dM r C ie. C'0_ -- 0,o0.,. I l., n~ d d,
to it- -_-






AXC MXIT NARIC DE LA NIARINA. Cnnc hnr MARTU. Dn n S FF. DFif'm PAUIA WPECZ

w -I r t.~~ M i;z~~t
M -dtdok Nl VMs,. V a
Ca0*S1S*,
%k -- hOt jv t' I C 8 I 8 850 IE
Looot"oA ooojomd '1< Ail-l"homTo'I



To4 om1 doA-~mo Asyto OS-T hoChi000loot !m




Oho ~~~ ~ Eqialni deoyA.4 0oo enmtrep0' Aa IlS ayorrbploPO
O~mmy W3m~ yrnlae 4000le del do o y.up WM I
O5AsO~ ~ .mdm .d.
19412 *oooowm6omo. '<


_________ ANUME UNOJ EN CAPITALIZACION Y CASA PROPIA











etc moohmdstoooo mo




YENTA del Roy0 dladk h 1 000.1rl'" dIo C
el ooodo

d i d el Ve1g. do. ~ 1 '


4tordamo 1<0p0ott< 1.o phica 00~ fa 4o0 odoen .de ri ye i. ~ s""o qo $193'.500oo PAGADOS A UCRIPTORES AL VL NOIMIEN140DE SUS TITULOS
del l~o oo o 00el 1 00 do Clh hoood"" poml, l .o .O tsto$ l. oooh 0 too '0 ftes I,,, mo ogMA .hoo. .,ddod, 0 .0 00 ,Vh~.oooommoo"o mm.o 01la ~ 0'm *,g4 ool oo ol 4fAnmorto
n,"dftmm 0o0m Y o 0"t o~o mOsm' < 0 4.
onw wp pcu. p o<.odh'mo' ,. . <
doi.O.omo,.00m"< 50 0 0'. 0,, > ">
toto 00 000 f00 0001d.oooom oo mm2 O'ojos "'






doioa do domooo. 40000 <0.004 o-.
3100 Letrao lo 'oo o<0<<"o C ,,d





hmom AAO010 ed.os .m.O, 0 .
Sia odId Wdo A ie ho.oo01po.somod"m<~P
1 atoriihio 00t1000td "s. Ims Dry. 005 N 11 a
f.w.W1 s 1~s~ 1 0s' 000 -." :00 , .I

.o do. doTIG Do LAS~' VEAS NAd.



C 0' ON0 11000 0 m ,. o. ot t ~ '< ~"'


ooonl ~ ~ ~ ~ ~ ~ t AC',oo' ooolmo~ doo
0 oo to000 0 000000 oooo4 osodoo00 "om".' h~~o 0' h~oo~ dloo do0 CoO tom1 mo. 1ohooo.d C. j5 0

dod dl 00do 000.0. o, oooooo 04. Ooi LA0 0O PA I '01000<00 12'0Ooohsooo AMO DOoMPIsENoLEAosURN U""ott"D W NE



0V 0000'- V' 0

Coitoniai cm~rs sehkm$.h50 ~ O clo l pgo 00',o. .

<00uteo cam mras, d Cm'.m00." .ol'5 $2.00' teo 4Y'11C< 00



hi$cmymto Alt a yom oi Co'"so PCd"
sobriIscitoro doorts Ldooeid 0. foojo 0- C ooss
t1i p05 01004O. m
$1ftels doG Id Tohd paa .ho.0o v yoy
Huhs, yardos .o. $0.70h%=-K o.YTI


0 ie Conb0oody0m 0.1A=


ma 00otm ooot~oflo I.
SANCHEZ~lm. Moo 0i' Adol Mena a


00.4. W.m Y Her'"

do.0 soy



Solo doto $930q Cr.v y ee00010fl.-









PAG NA CATORfE FRDI DE LA MARINA MART, 2 SEPT. DE 1949



ROY AMERICAi Escenario y Carteral a
EL MEO EPAMA IDE FRANIFAUSTO sPantlla Aw A RE A PQ
PAMt~ 44444I4ll
DEAR PARI Inr AsaW T no It .C,
sea g Trs 444a ;n
Not k ROBINSON 'A4

1 Ultme ds d FASSMIAN ao
OtUMSI PITRSDEYKA en el Teatro MARTIAp
Consultat grais t T- 4 I444
PAs
smoWAlbuDORA^:
am~~~C Sa ssa BASN Ror 1" ade ka ad,

o o sN044 ADELINA LOS XEYS oso4om
TORRES AtnR 1'1W as o- scos



l, FASTUOSA ti WAnFo u ero
CEDIA MUNL o a s oua

Una ROCHE o, 41Z


TABARIN V




TOROSEY TOR ROS




regto mlnt LaWAN




:: ~ 7A. .1 v71n7s










"TTEATR AUDITORIUM'
o444 4QR4 a4~4444 HOYMA TES20de epiem reala4915 m S444 A Se 4
t_ 4X44A




44 ~~~44M I4 4 44

























.0 ~~~~~~~ ~~ ~ e aI .Para lo oco el!ro ench)s ARO os7n ad




COS INO Tre Nsre ai yN-cora




a~n, n ai .t.p



manlfxA icim on 'oido.s co e










to EIMA TRC A US
AIRE ACON DICI NO










tAU~U COrORPono
PALMIAR 118 IBE
4OTRO4 EXITOO DE LA WARN
































'14 i 1Ij k I jZE tH FIMS PtisORA CON

-'EXTRAQRDINAR10 EXIT
"TOROSTR Yl 'IT R U TOit ROS- G 2Ali,44444444
















4 4 4 4 4 4 4 4 I 4 4 4 4 4 . fe r e m i a d
n on- e4.444 4
0 )HOY MART 20 dospimr -a :1 ~ q,- y Ilt I.,044,














. ST 44 A I4.IN- A t J 6 I,,
4444 44Ju4 ACONDS Ntd
P Ao4
PORI NO T4, ,44 st01 I'44l44444























FERNAND~O GRVE "SE A
D4 akb444 b 44 fat4 en que4 T CT a eaCOdOn



















schore Jurde etpayd qey

NOT~~~~tm reatd paraA -ometerto su"lcnus sbe U
PLAZA44 -4444 STA.4444 CAALN4-44C
. ________________ .44. 4444444444 44444 o _____6 ____44(44 i-t 044Aa 44,444 qw 44mf 0



AI4tVADZS _-L VE; lE D D-t PI.,T [
VAN44141l~ HEFLI 4444,T RYAN4444C- 44444444-, d-~~ ll-Y
144444444444444 JUl P' 44444444AR R -,dadt 3 jd. dg"1 4
444444444444444' 44444144 4ha d, 444444444 1.444-h.
W~~~t -tc A U D T O IU 44- 4 1 4, )l el- 4.A 4444 E? A SNRO
444~~~41L 4sJtitP IL A I( 404 444 444
44~e VJr W~a5Ae 44 44 4444 C.-.4

IlI U M -all hl




CISDN ESIS



MALO. .JR1 G d, 1', co furs sobre Ot A RS T :0

4O D 1-44 selo 1 11 Clubi o H O V
Tf4 E E1 4 N 4 F 4 R44 ___S-M87 Ta,'".
ES 44 44,4444 de I-- dnen E a444044d4





1%AA PATICIKNGH

44444444, cls r44P4444I4I44 44 _ _ _ 4


sc444 da 4 4 G444444b 4444
44444444444444 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 6,z 444 4 4,44 4 044 4444 C- ,4'4 4444 4444 44444 t 4 G-44 .4 444,444444'


UI MRATFNi~ 0ID 44444IA 4A M4444444 elt t4, 4 4 :'4 444 44 44 44 4 444444444
-4 4444fi44444444,444444-444 44 4" 1
ZM Nlut, 44 444444444, 44444 444sp-44. 44444,4 44 4



44, d/ T D LL B






Aft CXV1I DIARTO DE LA MARINA.-AARTES. 20 BE SET. BE 1949 PACINA 9211j

La tonfereneia de In AIR tendn~i PROGJIAMAS PARIA HIOY Protestan de

~owaede ift a1aa tie New Y~r,:*6- '- anr wartime 10: trlaslados

Goar Mnotrn, iotorunfi RESIMEN DEL, VIA unfiz"It. q. ann ttu -at. Ialhnnnat au01 tn loat ula n a;de de tita
nunw mu- *un.ivi Vl It .- --Ai~lM it tv Parh~ uliranfa 4ala
quit~~ ~~ at T1tttai 1A ACVUAIDAD ".M. N-.n mZI K A, u n~anl~ u nnA .M
land/n~~~~~~~~~~~~~o rSl ~rrtrahunfuYeTt nruuunarla
ft~~~ Aot "1) -- -e4u.A larnn.a In acla uai ib Dr. Prru y al Mautntro,
attnrumI "An,. CI1. Atn 1,- a1nuw~ a~an



e. -. de NOT*I eUr Iulkumun -"Iruaa, lart aicrj INn clon* ma da ;.rwmr-eR
yn.ut y p.,ru wehlre Hi ure Mto ~ nIlnu ta" ut -t-- "I aurn /n

6",h ;z" rundeeat-Grmn
6ntt 1 Antrae. -Vurfiera Crll ent,!. N-111. m ten n~et.~ ,, Iu'eeC-b-5
nan nr~thtet- ranmtcrettr, ca ntneraate r ,- cmu ett-e/ u.
lrrtu~a ta Carnanruta Au .aaf.rau deaa rRe n-u
Wtant, urn ten 51n
trtrnurat"nVu -:itnhaa-ft-o. tameu atntu eurmet
Pot, ,, ratn l t u en N-) -unrae n tn e/ira xea nnna n rec n a ut.er ian u-.teat I.ETNAO aunh ta4! ar~eehtr
ruiimn.T.Rlkn r- sgebasmttno elr.na cmnnn 9,,r. Gtna1 nIn unat~ua It. n tt"' ad tttn i "t-ttrhatt
tr Can/aca a., yC Auq -ll teaa ntnhr hiu Z.l aata u. rtanrttemht tn.ite au
ur4aira rn ethun e a nFt, a theCra ra uaa.uaWuE1ln ar enan.uii[eIrnmtn erttn nie


era ;r. el tar" ecant -Ire urno" hr. ac t ree
ah~ntnnnlt ahucaraa. e te heetteu.
ra d et 1 UNIO RA I) uR eun -urt A. .1 t :;:I tr: ta a canhcc -Icteem4ttiirt
rhni, -- e n n e -aano taermtr- rtren tuaert.-h
ituam.Ien lnae na NION tRrrrhtmmu k tailel(i~ecat t t a t a nautnaeuera-u I (t~tlmn-trt tm
I ptn INC l't t t-rm arCr. h -tuttnareh r em -r C-ea teAmt rIe e. neaChw




an, nnuan tn y Inttn ean he ermn.aatte.ht tn te aeaetcrthamer
Oltnanra a n ~ c a y tre mce ttmmc
.ea~~~~~~~~~~~~~~~ ~~~~~~~ Jt~hI t~n Al anNa An thAn Ftmhteal/lnn -una A-t ItaRAanutnaaa utnhtLtr.h
Pn-nu.pntn n-. ana da u nt un. nat n-~ urA Cu uattar
ian -ta- 6,t- ,1 Z 11utcatanam/
Cannannata"47 Vualat yar Cttn Ian thhr'e tnte en tthtnh ne s ne ~ a ,t I na eee -e
a_1 ditd-. R.ra I., tth/i a l-nnuate un Amtea u t a te anm -. n a.ue ntrareere At ea


an etrat" .-ett In La;n laC_ aenun 1a~ 1m "z r. ,t t aa. e, n :


AnteaaaunatI~u ~h h uias n ett mt/ uef e-.er 14 --11- Ceizt. iete et.

nrans nta nny n I etaetm toye- ae r I rn A het tc h
Mo do "nnn Vin.- enl 9a th ieet .aCena/edutraLnnA Amerhae/rr u u-t/n1su cemaenm e nnh teta ntea

Ahnten I& rt al in P her e. z-nlnh 7nae Pmmealeae e traea-a.n m

et n11 ntnnm ni tnuaC rn. tna m/ eee Jmh tnnn'e ela a nt ltn neaA aenA emDt ~-a





__ __ _ __ __ _ __ I
Cate de Di j S
aaamanu~la~~Cana-lt rnn~nnenlaea/u raaat ernaann~naataC5T
ACTULEDAEN NCAN! 'ZNARS I VOL
anr yal D neaa L, aca nae n na rm-aa-eanm X'n a na t.eraZ a r-r.e eia a re-e=a-ter Aeuin-n.Let 1,n Ken~ Aarer Z ~ a-etad. T' l-mu -maf. e 1 e ta tree

ati I I a


slat"' ta-tt Iuete V anR n-a tonren,lea tetal- Aac rtem nar ofci mac retutoj cana te- ; re cn Anuf~~ S a T cteete / R -c ee7ii tuccat Cr foew eceelh majo aiete elC da

eco. enrn. a, ia T-naat Fn Tn Pn
7: 'atent area aEME i-na dot re1necmnenu -1
ataear areaenla eatnod PC emet-ener~cc c~f"aqd, tea et
ca~ine do ruorrenao/
Aan Se~ta T Rrei ---- LE/Y par cimeo
W- N r n -/aC n Cnt anat 1a7 II ate ae ~ta n- c .C




en nr-/I% artmV { -' -rete emnen-e t m. at MLA Nfl

unI u/a Ia Ctnefet I In- a Ve A S UAEI
ASTCORI V erae--enet-enm a-uerueer-ea maI -.4

B- aN ta ti, e6mn1u Vu i/A/Ri tea~r Do stre anteto"C
amNz Imf Cl I Crac tnu-ntren cRcni Elc 'rem-men nnet-t-n/t ntc
antv r a- N .-I aal t-aha-t
N eIt At A )E


A.~~~~P' anRALro Cehol e-tivi mcmWet-eaanaab*1.TR N
1.1-ala~C -z an. rue -dm na -atat, tn aa nc te Eeermatir on IVuat ea, n aa an Ia-t-eaL4 ann n-t ran -> Lnt L-It eAttew/a k.e- I'le1 ScM La ,a
neen TROu~- rAMNO F-) Tc wier Cr c' cCB Wac-if &a n an' era;n
ai tan. uz cr1d run. fails o nnycol n cio uraanrliae-aaneotli. j
-.a4ranM D an aM1 aWt -.U On-aa ;W01040em a" f virol ___ara__bie_ tta*$ _an.AM .- nr n t-1Ii ta-wt. ThATCOT 0onf e acntr enaeutMl-trutennettarWet -i 'aV EN I-flA t- 1 Lrnt us Aim a~ahte l -_ t a- naal 'MA.
~~~~~~~' a-nna 31,ta rat tar va-.e e0 tI-ea aancez Anane
e~~~~~dt~~~~~~tani,1t /tunntA y1FA TAL~n~aaru ue h-et enaa a ~~~~~~~~~~~~~~~ ITeej I-mnc -nuataaa er tu r L

aesa a.li usM~ *nprils eta Habnna anrnnafa atm nu5rIn0I
____________AOVIS 3-3 f-iunnunr f NVESLIal

a n-.en. an-iv"-.
T.c nmuna s t~ eh tulcan r-n/Ae Ia e tat an mnna an
X ~ ~ C/a % YmttryMA I euu jatd y so r /.~ antal8l-.








PAGINA DIECISEIS DIARIO DE LA MARINA SEPTIElIRE 20 DE 1919


Expedientes contra industrias I Ialian per Ilegr a Gobernaw n muchos presupuestos municipales
PICADILLO CRIOLLO -----(ue Orifln tif aI A ft11llm-e IIffW81 Inf Ileolldwi de Guara de !Welernu derlabrsi frgoa d I o
dr s am cu l f de l5plimbre, th deo lat (uirsdd I rn
atw rsu4l4 b s prorot tn mor tan de pu s a' dVr t ( 014 Tit -4,11 Mr 1 4 a .d a bl
/0d11 11- .0 d-'E pro li )6l Awik CIOvnd 1 4 ,, 1 ~
form c In a oe -f proiblemna ef tirr vtrwr la Im.1nyil," ,N
44, Nil44 f-4I441 444'It







ol det In ttlaynI.
ddl











Dictan~~ an, pcettpr pg

fl Tgrat herne aeto




dd









0,,,;o ste be He A a da iomspovms u be e
fi e, i se til P 'l, it Tae u eh s iaie n c lo e ia e





IAZNfLO t, aiaoso ,o corsrcleoo




I AIN25









Y vULT A ioo




Y vUELTA t1142




L/I in ro I a! del 1 I
1 it" I 1 jA4 4 4 A I I f I





























decnoeonopdol dare dzner lo EJeh




T eT a ti i i e Ts r 1o s ee c
t I ce Tt up p a 44 ru ped do
44












































TI i rNN ran~vre a ,js6r enagree s s dedo Ape c neo sh d
de~~ner Agena :,n soC locehdadPrvinia Utci i est e p r)deIn

'Iicierparted 56r; Lota Harba13
Envienm lsartac ulo cu a otnuto da



c0t aae c~ Cnia to o sued:d s.c lsC

o eCj NombinreJ






T emo zaric egol seobci ear susra de one 6 aeseToq

extratenda su en lr deb na i:rec~ r lamenut
dt i1 1 4 11tT 41Z NCLO 4.441441 3c 44044144 !o04 y0 44 41 o444 44 4444


















































Call' No
40 044, 4ue 40 Goo post I O cen.4









































t I \1 1, brovfn i 'T i




CAIDD ORCAIDD inSi


Para obnr ,, ,,c ar ticl le cuestPa 140 m su e io E EN A T ar Iuoge cet an mas enELENCANT
Ik 7
4144444 4 44444 10044444001 1~4* j4 44.o4 g r 144. ooo t14o o; o. 044l4004044e. 4441444.4.Cents11 0411144.0o411 1404s 140,14141 4~1o
44404414444111 4>4114 1, i 11 41 1 4 44 4/410 40 1l4 4,0 41 4441441144414444,4 l444414'4441411460"'l1111
44 6~ EL44 44E1141444.4. 1 4 4 o0oA4o4,44 4.14 14044,4(14. EL~44 41 404144 1 41'4444.444414411144414414 40
41 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ Rrb~ 4444444 cai4z Y4 4414441444 t0it!o .1, 11. 011, 4,41 4t. .44 444444 o.140441144. 04Iwo14 4444114114114e014141
14 ~ ~ ~ ~ ~ ~ ~ ~ ~ er n cd no4 4411111 4 114414' 4444,4.1 4 l'14 44440 l01014 444 14111 el1444.1 41404141144 hecho14441 A1414145. Lal14#4114144ldo 56, L141a Ha l4~>14a 4

01441'41 4 4~ 1414144444444 T 1;44 4011101114 1 :,i, iI 44ala, 4.41441 014444L TALLA 4014 44444 14014,14
44414141444144'141441l' 41014444ll.44141441044414 114444444l11401l41,.l1414.lOl44l414044440140lll4 4144 444~', 4 4410144141 4441l44'4l1441 41'4111441140 44,141 414 ,1 14 4 4140441,44.o4.4l.1,l,.4411111444 441 444444. 414144 4,l44.441,4144144141414444C144,
41 44 ~~44 4 4 4444 411 4 14114 4444 41 111114 ,141.44441.1444411 111414144.1 4
41,44444 ~ ~ ~ ~ ~ ~ ~ vr 41441441444'.44.44144>441414.444 .4.4444 111114
444 AJ DE'.144 444' JR-.411 D414E4414,DA 114' 11,!0 .44 4441 4,444 401.014414. 404,44144441141 1 44.lat e t
44LT $132444,11'141.1414 4414444441407 5 b eu

4444'444,l4 4444114144444 41 441401444,40A014444441. 4,444144144 4144 44 Giro4414.441,1140144 4 .4 4441 J -4E 4144401 DE44 IDA4 14 44e4 U440n14a4. 444 41444444.~~~~~~ 4D44 441u 41440 44'o poto 444 441044 104414. _________________________441~~~~~~~~~~~~~~ ~~~~~~~ 44 7--11 144 4441-44440404 4144414,* 144V 4044 4444. 1 11 14444. ,4144 b141drla a u
1444444444414114144 $4444~44411420414414' z4l44414440444.l 4444
41,444 4,44144144444~44414444141441414414411144141 44144140444Ca041Ile14No,1
44444 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~~T 44414'44,4.41141414411.414444404144.114.444444i .
1441444441 414! Illl No.441.41141104144444 40"4444 44414144114444
44141 41 IS1 44414S 44444401 441414 S Sm1l1 414144 P iwv~v poeur414441 ~ ~ ~ ~ ~ ~ ~ ~ ~ -i I, 44411 401144414 444 4
4.4IA 44444 141414 41444 1 4 1I ,4441 1 1444"4410.4441 444R4 .40,
44.144144 444(41 4 14444414 1. 4 41104114144l114444111 444. 4414'444444v044444
.44444444,~~~ti 441, :i-1 -.p t11 d.44 41444444,444 4l 41,1 14444444
14444444444 11 414 414444 44 s 1444 1414 1 4,11.441041444.44
4 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ L 144414441444444.414 4 4 I4
01444147.4 Tit4 IT4444 1' 4444114 4141 44414444411 4a ha l
44444414411444444 4144441444l4444414414,l444
4 4444 4 ~ 4440~44~041 41 44 4444 44441111.41144 4444 4444.1'414.4444 4441
444 ~ ~ ~ ~ ~ ~ ~ ~ p~tr vit-ri,4 Ii4 414144.41444444 t. 144d 041141 4414141''11 144
444144,444411444IT4 id.44444.A41444.'44444114414441144'
4 4 4441444441144444 4 4 14444411 44 4444 1411144.44 .41V4 4446444 4 44 44j,
444,44, ~ ~ ~ ~ ~ ~ ~ ~ ~ dn~. I. 44444444444144 440 1444 0441 4
1444144414444144404444.4.411414'1414.4440it)1 44' 41444
444IT f1 I4,4444 414 I. 14414 4414d 4414t1. el-4400414 4 Ill
4~~~b 444,4444141 4444 444DA 44414441l CA4104 44-.440 .4444414 ningft414440 444
Am14 44414 In Milan' art414 cuokc esaM14n4LEN A T
4464444 144444 I'l 4444744 00 14 4 44,cul le '414 ~ n L E C A






Perspetiva La Prensa




DIARIO DE LA MARINA 2 -S esa fi Ia




FEDERAL COMERCE & NYIGAIION on versacioecalias4

00,Uf nternaiconales (irC S. S17tin 77________77__ 4414147

a~~. ~4*444. SE1$VJCIO CANADA -AHABAA4*44444414444 4
or ~~ ,,, Esperan ao In "deirInawi~dte derreeho. v 44 4.444
i~rnia E nr I K A' *1 bers tie In persona enl Ili siidad Cu 1, FIRmn~ IN.I
b- -m imM~ri, Tr4 44,4 d4*.44
414, 4.t',, e at, -1, 8o44,& d1 St John sabto el1274 dosoptiombeo Plg _________I____S/S "FEYDERAL MARINE4R" '" .a~14444a~
tm'u.4" An4nQuinm4 4*rpq- SW4 do Monoal acr, oct. 1 1 Iy do 4 Tt 4. 14, .444444* 44IC


444Voc V.444. I 44 Aq-1 n44 P fit44* 444*144 4
ama44pt.4 ,cab, o .a- TOUS & ASTO0R G UI, S, A, a 't ,.4 .t-,4,, 4.41144444444.4144 t~.4,4* 4


4 n 4*444*444444ICT4O1*104 LONJA 2Gs H IABANA 141, A-BU ,- ".~4 4, .4,,.p44 a. c,4 1t.~ 4*4, LOS4. N44U 4 a 4 .444,44444 44444 .44 .44
14., v41 d4, ttaI4. 4 444 444. ,a.a, 4 ,44.,./ L S NU V S444-44 4144 *.
.444 .414a.4q.4 tt.pn1 1T444 e 4 e a a L4 .444 4* 444 ,1 411 t7f*., e44.4 4444W
-b-44*4 1 N1, W.44414, AL DFAN DE44,1 LO PEGSTAD.t .4r r4-1.n4,a.4 4444 t4 O E 44**44,4*4,444
4.444 4.44~44 44**444. *.444*** 44*f14*O~4OfS44444444 414~ 444444.414 444*' ,44 444 44444 4 444 4. 44 a47a4
1*1 ~ ~ 11P-U 1444444444 t-111 'A i. .4444 "4 4 444 4a1,44. .41t 44.~44144444 444* 4 14.4.414 ,.4*
I4*44 do.14*4 44 44,44444 4414444444444 ~ 444* 1- ?444*444444 ,
,,4**444 t.4 it44L 4.4 11 4464*4*d44'f4W 4.41 i4.44,44,,44 4414*444441V444.-44 4444 44414 .444.- 4 4 -*4,414 44,*44
& d1444* 6Q4 4*44.J44.144444h*,**.44 I44I4444p4*44414*,444**.44444.4444%*44*-44444444A44444



dt*44.4th 4t41414. 44, 444*441 (att, 44-4 4 4.4 T4I44 4.4I44I4.41I4444'4*4*44444t4 I441 Z4444 d41441*
a.44d 4.*4.o I da 1 414* 444444h,4.44.4444144 -4r *4144, 444 ~4a.444 44*4441,44441
g444*14 4*44144444' 4.a.4*4444**4*4444.444444444 44.4a44 .



444.44444444444.* DIR ECTO DE ITALIA Y 4,44 ;44. 4~j~7544

4.41444a,14ESPANA4 A IAIABANA E 1444 4,4rs elogiadla In 14 44414*44* 4A**44444*414 ii, atz,. actatud (l Sr.PPIE 44 44444444p4
4*4444444*4 44 ., Nafriciso Pardo 2NLEE Zx 1 ti-ttt
snvra 4*444. 41~4444~4~ EN BLANC4444,4.
4. *44~ ,44 44g4Vapor H,'4" Y COLORES .
1,D4*4,1,4-.!d4., t440T, "HENRY LOMB" 'T,-*44444*44-41,~44 I4444444.4 4 4



44*4 ),~t y 1 Vapor "4*.4~4~4 4ZOELLA LYKES"44444444. ~ 4~. 44 4 44

4414d 44444.ba 7.9 :.T.444 44*14 A*,

~ 4 4. 444l41,414l~ LYKES BROTHERS HAVANA AGE??V4 444144 44~44 44444.44 71*4444414.414,1
4.4.4*144144 Ruiz ll 44414444,44414444 IN4444444O 4.44.444


i.1, 4*tt r h, Ck ADA- HABANA VERACRUZ A OTO 44444*4 DE or, ti 1444 i,4', 44 4A4.4
4444,44FA4444* *4,~4 ~ 4 444OhSETLS b 4*4 4, 444444,, 5454VI100 DIM =407 4* CARC; TL44 444*44.44 4 4 44.4444444*4 GRAN NOMEAD 44e44It 4 44da ,* 44.* G
-ro 4ct5 -r plat444 f4 41 44.4,44 4444,44.1**4444,44 1d,
ext444.444 I. g- 44444444 4.4.I444.i
444444*4 444 p4. 444. 4 4, ~ 4144444
444.4 44cti 44 4444 44 4, 14t Lt4-44 4 44
4*m4r 44441 el 14.4.44 A4 6t, 4b 11-5-44 4, '44444444 P444 d4,444.
4*4.4444e4414644*44444444 4,44.4444*4 41. 44*d 444.4 444. 44
44414444444444,4 -u ,.o -144 4444144444,4 ** 44144441
elg4 to 4* 1, 444 ~4t P N U L 4 44 44
441 444 "1 w*44144 ii 4. 4 q4 44*44o44444444 o i 4 4*4*"it -44414
,4.4444*4444444414441444 4*4*~444144,14 .44.114,44
414.44f1*.44441444 le44 i 44414 4444 1444. 4*p44 4 4.4444444444 4441*1444414
44 I4444 4.4~t~ t 4444.444
4,4*44 44 4444 1444444, 4 414444 44 444 4 44 4 44 ., 4 444144144444 ,1 74444
4414.1'- 4144444444 44*44. ~p 44.44 44- 4 1444441 14 l11444 14~ 44*444144

2.4,04404 yt4441444. I. .- -4.------1


Las4.4444.444del 444444 141.DISH AMERICAN LINE 14i4a444 4 4444*4144.444414444114444444 4444lb4*444*4P4*4 4*C"*4*444"*,44.4
dn.t10 44443504 1-; D. --g d,,44. T447, I A y-Kt -~ ~7T1%t4 ~ 4 / ~ ~ ~ *44441 444
4444444*.4444.444,4 4- 4 ,4 de1 q-1* j444444444444444444444*4444 14*4*4444444 44*4444441444*1 44y 4414*4*,4.441*4*4
4 44 4 4. 2-1,444 14,,,, P. 1j'" "4',** ll 4 *4* 44444 4 1 4 44 44* 4- 4 44.411.444441,
41.,- AGM& 11. liiI TYEON0 9271 T____________H__________________________A
44*444114444 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ U 4lm30 "I44444I1.l~~ 44*444444.444*441441444444



A1FT it* r ij J,4444 ja n 044444. 4o, 44 Sj
4JR aZ -] nuo4 f. 414 44 w Lt.g




_t, 44144 M44,441 4 "MONTE AL ET tt4 d441.141 I-44*4.44



q- 4 44i '- N "MONTEb A RL4s*i. 414144 4.*4144
3 ".7 F*4 444441444444 41rl'l" 4, itlv 44 Ior 414.4
44.1~~~~~~~ig cm444*444441 flflfl .Ba eln 44 ~ i 4.44444* 4
c44414444,144 7,44 44 4 4.o 4
4444d b4 44444 444 y44 , 4.144 .4.I -i* M



BeU a CO1mrAC 44 4i, 4* 4-16rt
.4444 1144? '*
Co~~~~on*4c~~to 249 v dlfbes -, Aitr 1Ai C OP A A LR l4401
4*4S 4444444444444* S44 A,* F*,ch;4 CLTRA
t44444444444 1* 4 0 ,~ e sal a e- 4 444 144* ~
H"414~d a Wc4 40 ut



"4444---4--.4*a4*4,44444-4-tl e sp ii p~uartug per. 1* el4.;;, 1



444y***t4c1e44 T UI Luis Caballero, S. A., 411, 4,! 4 P'1_.,

4*44,*.44444- n n a ui de Puerto t6 i4*wor t *4*1qd o

B Y E R.S 4744Santa Mario, Espaha. 44*4414 pc4*4
4444*444*4444re4L4Te4. 16d 441446 4414t4 ziino*4', t*4.4 zn ', 41 W*14,4* 4 444 4




q.4. 44n Au4444 4ii 4 I 4 44 *44 4, ,44 4
a41 444 4~444, 4444*44.4 1 4
44*4414444*4* 1i-ili dot3 ;:-1115 1~444. 444 1
44t i dc41 ,4*11. 4*44444 4AV~nA 4.ND I444. 4141.44
4.444 44441 144444 4* 1414 44 4*1144 4540.4*.0103 4 4* 1. I *


4414*144 ~~~ ~ ~ ~ ~ ~ CBLLR *41 14*44 ""ll$" 4~CBLLR 4

tid 4.4ado14. -, C- rikiaW~ aco64coa*4mAt a15n4 nu*Jonav P= *IPt 0 itrod- 21 -.
c .4**44444 44t-0 -1. d4*444 444., de I 4*4* ~blia

4*PI411401 ,.DM 156 nFaa a wm
14ti Jim *441*4444_______________________S A*slftaflJ o 1 P444441 1*44.444
4.i, It-. 4444*41441444* 'il -Wt a S.S S
41*441444~~~~~~~ABLLR 14.ii el 4*4*4r 44 4 44.4444*44 4 4-7.M50 ffAA4


1*444,44441 1 44 44 4*444144444, 4* = Aptd4 -89 -7 444014,, stm *.* *jIo

*.4*41 1 1, d, 44 144044*'I4414444
*4*-4; p44 4 4414H4.444A44,-, 4 4*44t 444* .,.4444 A~4,*4,
444*4*4*4,,~~~~~~njda A4ct*4-4,4 *4414*44*444 4*4*4144 ,44 4*0
A! .44 L *4 4* III lw d1 t 444.444144444








PAGINA DIRCIOCIO 1MAR10 DR [A MARINA. MARTO 20 DR SEPT. DR 19490 APO CXVi


La Pusvlia errron de baja ayer todos los promedios en la fti ade New York! Lat (IC lorize ira de hit lbra

______________~~~~~~~~ ._____ .J ~ ~ 4 UE1t ntasma


p- I-- J- itmel ptOllOft Tr I II 1, La i c ot ttlt .t do A OIf en 4.0. -0 unl d. $ nlcornon cr, o tt clotc ;p tot o -i. a.
e,,, Icil, vaio d"c4, 526i,00 yococet oni 1. M OD lcoo, ;



-~d As!o- r,0,.mro


to -m__'II___oIt olteic' 6"ii'. 440. -op ionlic 0 tit'koo lti 44~ttly lO~t li

lid t,.r- t q- ttIee C' "I~li' 'cly ,cWc





x~10, coloootolooi -0111 i'llt lliW 1
tliodIotco oicolI



N&7-,?AA~IT2 IL101



in 05000 i~t'ilt'o~ooc
P10c Oii~l I 1 111'i' i'1 "'i't'I 0 1itotccot l~'o1Ito'o ttti ~ flb ,
(WARD 'iLIN'1111o'iltII~tcolt tl56Ieslt









Espc: Rrioo ta';nrspmnob0 Ictitlt,-e Upliols 1tIolt to t pjeoo 0
Ao-,loo 0GA LOA BAC











a0 oto ItO pcg- otcd


441 Ao'l' 0010 in010r144

Ol0I0051 tot


Inno' 0MVROA2AO
V lbc ~ e~poe~ooto





6Attttd ,1. oi7otno .tdi.ti. 1"- 00 1 '0
lcurc I t11 titt'v -t, 't cc I'm 1.



016'






Not Antorl na too
So tio-v itOt~ IOA ~opd o




t N ol A n lt t t


ttt
1.0 .'OtI' 1. 11.0" 900S DEi N 5 t to-po opo oooin olineio ps





I 2 doO 'tioco rercols toto setttoot.rc p l,







Pic.cioptolocc dcO cubc Ocy 0! 000 05d loseE SA A 7000 LOS

Cottot p~srl e o et ottdo .' tooIio~ c









IS .N h- Atlnti and ko Gulf e Steams i Co.,on Iclil
S4-006 AAA TE193






ANO CXVII DIARIO DE LA MARINA, MARTES, 20 DE SEPT, DE 1949 PAGINA DICl)EV














CONOZCA LOS USOS DEL















MULTIPLES APLICACIONVS EN EL TRANSPORTE


DE ALIMENTOS Y CONSERVACION DE


ARTICULOS OUE REOUIERAN


BAJA TEMPERATURE




a n ode a frnula cienlifca del HIELO SECO (Bixido de Catbono silido) >esenla nmedo nas economico y p;Acico Para el e ae po refrigeradoa

Con an poder de enf riamiento 10 veces mayo> que el hielo corrient Ste nuevo producto ofrece positvas ventajas a la industua y el comerco.




ALIMENTOS
Leche, pescados, comes, huevos y otros productos expuestos a la descomposici6n, pueden conservarse y transportarse en condiciones m6s pr6cticas, reduciendo los gostos, y permitiendo el transported de mayor volumen de merconcia, con el control exacto de to temperature.

FLORES VEGETALES
Lo conservaci6n d estos articulos dlicodos se control perfectomente a menor cost pudiendo combindrse el HIELO SECO con el hielo corriente pora montener la humedad necesaria en cada coso

TR ANSPORTES
EL HIELO SECO abre un nuevo compo a la industrial del transporte permitiendo ocondicionor la temperature interior do los comiones pare infinidad do usos comerciales, Iibrondo a los equipos mec6nicos del destructor efecto de la homedad.

MEANMICA
El alto poder de enfriamiento de HIELO SECO permit aplicarlo con 6xito on modernos process de contracci6n y dilatoci6n de metales. Gustosamento snformoremos sore esta aplicaci6n sensacional del enfriamiento para fines mec6micos.


UN MEDI0 MODERN DE ENFRIAR MEJOR

*CON MENOS COSTO!g



HAGA SU C IA."G A SES I N DU STRnI AL ES", S. A.
PEDIDO A: Distribaldores Exclusives; Agular 367 Apto. 312, Habana Tel~ono M-4536










PA INA %INEDAR10 DEL1A NIRNA~ MAT5 0 DEsv.D g1N W

REUBIC D CBA Juiarws informaciones sobre To desdriviifind I Wr fib )IrdC fie Cmi(T a f't s P 1ia .


NiNJIERtJ W C~FD1fN /a de 1,l11naci 61 de I( libra 40:;f 3. :;i.


N t ( ( 1AIM 3333 ((ftO R03333 3 3f1333 (330 (4 3 03333.f3 ,0

A VtI303S (3Of, 3,334 00. A~f3540fooo 3
43333333333 33330. 330333A
d33 1. l fib 3 fft-3 t f 3f( 03 30,t(3 4
h.t3t033t3 ft vf rftdtbtOO f
AVISO $1, d, ft03 zrm21 iOtm36f "'1 .1, 01 f
(333 333333 33333300 330 333 tof(03 tO.0.0.A3.33f ft 33330 43 0* 4*0 ft 33333ftf OA
luni .ft0i A4 ff tf 3 303330 t33333 o6 t 3 f3 0~0f tt.tt.(
3ft333ft(3(11f At K!?t a1,1 A
333. ~ 3033t30303t.~3333 ~3~oo00ft( 0o3)*0o3. fttft3 3 ~ ft,0(f 33 (ft 3(0(03 0 0l*AtftftfO03 30. ftf~ftt, 0033*40 fftf~ftt~f333fA LA( in-(333333, f fff( OPA 33 33 03f3 Ot(033 30 33t0~~A 0.~~~ L A 3 f 13 ~ ff~t 0 t
p-i3f33 3333f 33(3 (3 0f t333,f t ototf 3 3 ft f. 3 t3 30 0. 3 3 tf 3 f f (t 3t3 A t 0 3 3 4(
(333 oo(3 ftfttft333 (00 ft. ft ~ ft 030 ~ 3 0 30 ~ 3~ ((((A 3 .AI'fjftt,- d33333 333333 3F! 0t 033f33tt3 3 ( 3 ff3E3 3( 3 3 3 33(3 3333 l3,fa ft t f

33333333 3(3(3ft ((33oo0y~o 0303(3fftfftft ((03ft3303ft 333 333ft3 3 333 f( 3 330 30 336 ~ 3033 Of ~ -d,3





3333(33303t Rt3 (( '30f3 (3 ff.ffttt f.3333 f 33ft. f( ((3 o'00it3 (33 f
33S3(C 333 3 03 0f0333. .fo0ttffff .f 03 (34t0ff0( 33.t.0 3 f tt 3 f33A3 333 o3-o 3 3 t.03ftftf tt3 t0 f. (6 ( t3tA3(t .
.33 o33333~ftt(3~3D3Ai 3.4 3ft~3 fft ft tftft 3.3333333 3.300333 3tft 33 3ftft3ft3333Oft 333 33fft3 3 3 033 03. 0300 333 ft 430.

3333ft3.'(3(3~~~~~~~~333333,~~4 N3. t f ~o03 3 o to o .3 4 ~ 30 0f 7(V33333 33 3 333 3 0 33 3 ~ 4 03333 00(0 33
(.(33(3 33. ~3 tf33333.33303.3 (333330 3333'3~3333 ~ ~ 3 3(306 ~ f 4034. 33ft30 f It 3A 333(33
IT(33 Of 3 (tFD3f33 03333403 fo .43I00f03t 33 3tt34.3 0t0 (. 33 ft33.330333 Ot0303 04 (3 33 33(000 0 f 6So (t0
3333 I I 30((t(C3.333333333 3~ ~ 333303 J30 03 0 303303 030 ~ 3 ottot.3. f 0







IF3.3( rl3e .3333.033>r 4.'3 Lu. 3
o~o~-N3 A3(3(f0333 I .Al -R A . ITT(t
33I~ (3L3A -133 y0333 u3-0333.3333 tf33 3
333333303333333333430 333 ft 33,
igf (4033333.33 (4t( f 33333
3~~33o~o333333 3 333 3 3333 3 33
(3(3333-r 03 3030
P3 L4430031> P-1 3e 0~rr 33e- I-f( f f'.
333333333333333333(3,3333,333~~cu-a: 10 33333330 33e 3333 333 In0 33ut del at.f 10003 330 f130 f tf . 3 3. f 333t .34 f-t03n
0ft03 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 1 0,l 3 .3 ft3333 3 3 3 n-W,3. 33) 33, 31 33(00 0 (((333J'33O333(333;3J~~~~~~~~~~~~~~3NE YORK,33 333300' 33. 1 3, 330 33t0 (3330,3 3 3t3t3 (f 0 303rK

333333i Mend 333 3tf3 33333 ,3
033( !A30 (330A r3303 (13 dl-, Tor~ I 030*3
33333033330,3 33. itf 2 (30, A Itf. Y 3, 33 33 33 3 0 .3 3 3 3 30 33fff, 3 333f
3333(.33333333333330333(33333333( U,3 33gimen~30 de( 3303ab del3Sur30(3(330(303 (0(0
33333333333 3T i .T- dL o, t ;
33 n3 333 3, OD~ 3333(33 3333 I_3 i.333 3,, I =(300 (El 3~e 33003. ftd33 3 3 3 tf t 1
3.303303 ~~ ~ ~ ~ ~ ~ ~ ~ ClR 33 30 333033 L'30 DOL Sio 333 0 4,o0* 3 4 30 1 3 .33330
_______ ______ It0333 3300 Aon 0(3333 u(3l- Le
3ft3~333((303A00(3a 330 (300 Q-I3
33303 3333r 3de3 .rm (3yf
33un L (3333 do 1o03 .40 fti 00le
33333333 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ o Al 300000(03330 dl303 1A 3033 3*03 f .(0to 33333 o033 3333
(3.33.3 tfto30(
.3S t- 1-t .00(3(3 33 3 3


33t3 I3 I"3 0 ulet 0. tndt. am,3 3333 3
LA0033333 3300 .BO O8 SE% HA(0 (333330 EN3 A333 i333(3,
PROM ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~~~~~~~!i I)IO'3 GRA333333 33 _______ N3 33OS.0.333 33 3433303330
33333333.3 .333 .330~ .333 3.333 3. 3 .03 .3 TT,3333 333(33, or(0 3433 (ft LA(3 0 LAS R IC 0 D
D R D R -IT 33 33 3~ . (0 0 3 (
333330 333, 3,o,3 33333333. ft.DRV.( 3~0ft 3333 333 33 3 ~'.33333333~33333333(33 333 3(33 333 3DE3 330 t 0
o. York(33333333333333 -3 Ftmob 333. (3oki0a30330004 0 t

333330033333 coo3 Bum 03333su,3333333333k300333 (333.330333333333333(33333 33(3, 3333 3 33 3 0 3 3 3 3 3 3

E3033,300,3. (0333330 SAL33033330333.f03333333.333333330.333A303 304333.3. 3 3 4 3
-,Int de t333 Im00A LOS VIt.3(33 DI33 MW0 YORK.3100
________________________________ 3333 3033333333 ~ 333330 3ft, .333 00333 33-3-33 o3( ,3
1 ~ ~ ~ ~ ~ ~ I nil el LO 30TI 331 MfI3A3Coo.33 0030(3333,33fA(
0333333330333333.A I/ 0 (Z N33 A03 3(

Suri3 ampltw3 de3 Mo 33 330 3 3333033333 ~ ACO O
03T3 33 3r T-(3333t 33T, 'I*0* &3
333033 Aio
0 t3 34o3'3 JERS33o. 1
3333~~~~~~~~~ __________3-333. 34
33030 0330333303.33030303o303 00 3 33330333 ft3a3
3333333,333333(0 33 333 3333 3033303 o.4 (30303(3333333 0303
3333 I0f .3c3 PI AO LAofft 30.00033030030033
33.33 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ d 33333 0 333 t30 33f t o0oo4af4uo
PANAM 3ITY
3j07. NT. ftT x3 3 000333 3 033 303
33330033333334.3 3 33 33300 .t.3oft 33333o* 03 03033 13 3303 0330000AMPA300 f33 3330 t0rl 3 33333 3 3 t33 3 03 03303 t 1. 3033
i33 33 at43 I.,4 SAVA

333333333 33303 03 33 033 03 333 3t33f333* m3334 YORK 4 34333 *30 34 &334
33 3333 0 3 33o o 3 0f3303333.330 0*3f300200t' 313(*433(343 3*333v 7N ; -3 3 3 -t- -oooo~~~~~~o.333333. ~ ~ ~ ~ ~ ~ ~ at 03n "d, HA333BANA33030o0y fO 0303 3330 3o0 33333 3o.o
30 t3t33tfO (034f 4 3.(3313433030333t30.3tt
________ 00303333 .3333300 333,30 00330333"330333030(3 330003333 303( 63303333m 43370(3dft( 6e(0330ft43;O3f
8 C~~~bt134 03.3300 333f~~~~~~~~~t AL1. ,00 330* 033 3 fo340 3001 df
________________________________________________- 333 3I 333 ____262__________________________________ t33 M-3936333317,33 I I d ft o3v33I( 34((.3.3333(3 333. 33333 3 333ft330333 333 03300ft330333.333ft( 30 3 (o. 33 0033(0Son 1016oft
-d00 1. 1,- at 1,, 111u, 3433
33~~~C*J*T~~~~~USA ,,NAV033333,33A LIN INC. ISO orow3(0333. (34(33(33 YORK
(033ES EN3 030 03033 033~30 330



033333 ~ ~ g .33 330 3 1
i3033 1A iR,-03 f-.0 d. GRA D I

DUADR OY SAYAN333.00 0033 3033330 (033303~ 0403( 3
G O T"'33 330(33 3433330 3330 3330303 40 3333 30340S R I I
3033030t 004303 C00333
33333333033~33 N33 33(03(33333333303 3 3
I' I0 T033o d, I030333 Z3 k43 ('I.33*140*
03j,~~(3~~333333(,~~~(3,,33(73ftY 6t -is3 d,033 -he33 03i 1. 0t333.3333003043333 30 3 3 ,W33003
3333.33 333333330.333 33 333333 ch.0 003 ,3 A r13 Abj.oo 0o0 333

ECONOMICA ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 3 I'd 33313.033333033333330333 00033;(30333(33*3 3(33 LOSVIE*N DIN8WY
(03) 3

3030300 ~ ~ ~ ~ ~ n~ 00(30! 0II W I3 3333( P33, t330333333343 3e-333(33300031133333n3
3003ft33(~1 -3 4 d30t333333o H333333333 3333 ,,J n30333000 DE(0 UN303 AR HV0D3ET
(300.3~~'1 F. -43 -rid,3330 _333_ 1_ CP333a 330 li(3 l(3t33 3330 333
033003(330~dt 333330330 Iuu3T de 3" 33 o 33(3o3oo(3333 33 3033
33303( 333
q,30333( d333 1- 333 3333(0333 1. l . o 333 0 30 (33333333
33 ~ ~ ~ ~ -b 3333n 333ti~ Se3330 00n 30nttn 0333.3oo -t,3 qules 333.3 33000333 3303.0 T3 (0333( (303 333 03333 30 33 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ b 334 33. 33d.0333333333o33033 33~X 33- -0- ;6 y333 3330 3.333333 3 33 03.330033333
3333333333333333
33030*333033 0. 3~ 33 o3 03430 (0 PA AMA CIT
__________________ (30(00333333330333330033333333333 33300 30 '330033 3033 30 03333 MAN EC 3303003t30333303033333303 333. o3.o3333 33 ~3033333 30T333ll 3 34ft~30303330033o33330I- P033333300303303( fltO 333333333 33033 AMPAIe it
_______________ ~ ~ ~ ~ ~ ~ ~ ~ ~ ye 3330333333033 P.tdT 333 Ter.0 33303333033333(33
03.3333o0343o(33. 330333. 333.o33oooo033 33O0333.33333033300S30 30 00 0330 00 ft3ft0 033 SAV NNA (303(03333030 ft43.03 03Y,3
Soboo~~~~ In3333303333 33o all333 4330 3334.30((3003313 t
333033 l!f33303333o 000, 0 33
43333330(30333 ~ 3333(30 33 0Tu43




CON3333 3333(033333303 DE3 3ARCCO 0~ DE 33303300033S 003303LI F )SP03.*0 DtASM4A3T3Ip-MHtW 33#o

C3ITA 33333(P330330033343 fS ANUNCIESE:, i~~jut
b333 33(333303(33333 333033(0333333 4t 03 3
330333033 HM M AR33. o3.o330o 13303333ft.33 (033333003 3i(33y 34*30303330333 33 3333333333300333033000.340NA* aj jej
33333303330300333330 OF33303 3oo3M4C(I30 "Or3 do. em Cai do003Paaspra g
SEIC.'URO~~~3 333 EP3o11 033333333 3330UTI Evit 333tine y30 330- 33os (033303 so 0333330 par30 30.d t of
3333330333333333333~~~~~~~~~~~~~ d(300330 330033o3oo 3303303._________(3333 33030030. EN333 RO LO 33330333 33osos 0333033 30(03 33300333030333330.te o do od 03303300 33 A OTA 13(A C S 33330303(33333.333(0343.3.0303333. 30330d00cod.




33333333033.33~~~~~~ i03f3 33.333333 333 333 33030' w--33333(000 di"' 0034P33 OooOAo1ft PA330Mlagu hsdouo oene o
F~30 333 33F3330 3333333 C3 f 0 L3 A M (0 T3 R030333 C)P01 oANA HAf3ANAP M0oLAE
T.Iif-- M S PAPEL TO LL33PARA31030(03a6(0303r,33333bem 33(33pu330033r 303,ft A4ctf33
78, ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~( 33307 .3047 I 3 3330330333 L33 A Y A I 0. .r,-d. dl.pmfaaslt0mdd 3333333.TA 033n 333333 0333 0033 f 3.30300t3 3 rMoo
3303000333330103333330340*00 0334.03CPITA
33~~TET O BUENOtS(33 03,330S 3(3003 DIT3IT MOE 333 ASTELEfto34 Y003 33 33t33303, S.4403A.0(331
333333(306(333303333.3333030~S ftS.33030 30 3 o~o NE. 30300 DE3.0 C3300 3333*333Ot 030f0*j3333340(0~03033343330
33330330~~~~~~e 330.033f. 3300343
33N330333 ftA33333 3 0 3.0 3 3~~00333303330 30 (30 Ot 3
3 MO 0333 330303003 003003 .33
333 333333330333 No.33 33 Teefno M-95 La 3 330 3(3tfbt 333
33333333333 No.30.3ft 33.33ON 3 M-31709& 03







ARO0XVII S POR T S DIARIO DELA MARINA-MARTS2DE SETDEI1949 SP O-RTS5 PACN VNRA



WILLIE PEP PONE EN JUEGO ESTA NOCH E ELJ CETRO0 PLUMA VS. ED1,JDIE COMP



Derrotados los aethir

SEl DIAIIIO epi los deportes &rdnes- 7otcoKiu


A -Noticiatno deC tofto. Ill martin. SAN LUnti."t YI.l Prh hiV.Ah A
-Robinso iw pondri a la altura de Ruth. u t.
41 peo panci "no-hit-tno-aa",rllt~ I. 1"nd' Itt a.ir ,tant i i ri ,

Por ELALIJO SECADESn!,; ,,IIII I Y
7"g,6 h I hiihh Api iii





rtaald den". ,,.4i dan I alh riaitact lhh.l 11'. n thihhh~ h. 4--1h11t '1ta e4--- 1uil. lpcuItahhd hiu Atirath Chift tit h44 Q tir~ 411eealhhhladtaI i i hu nt ii


1 1 ,1 Es'nth Uridui d~atu111 h hl qii deli. n, n-V.
L', t- Chuulh i, m 4 r!uita~lpi1 Ij diar q1 d-iittu d.- -h1,nrd V. r 4 h, A, ig11

Dasia ,lliau- hdlllatihlhl Ml ul lhhnnil~aadl A.1 11r11t11ilulttit11,.1Al1
tP" a lz]dcz td .nlu. lita ltut 4. 7Jnpu i, iid hi. lhlP h"ul 1 -1 1 1




Iluiui.ui ll. Aii1,n INrni in htl -is- Al t1~~i ~ hu
dituhnluutp~uiidiiillupanll~uinuiruyqv A~bi Aueuf11 1.iilth1~
tniuethiu, d~~e n, ~ aut/ IIIhhuiiuc1lru in ia 'hllt hI 1 1'55.


1111114 fieahiah a 111 lacil t)i-0, 1t1I


111 liasci Am i:,1tt41


La 1, 1ded qcI h11 ifricil I iuhyn M al luI -1141 del hiitlp a Itl Eu H,"1


da ida1,t hIila e!bl duni 30141 if, OID 1IS 1.111 .ei pldugn i-a it~a, 11 'ac1riut1nd1ha t l. 4 e I I111 i!lllAn ila~
catlicusi t- la"ctielt ,lna.11 .aIdeIud.e-dlnhl' ip 1111 itt huatne aataai- Ii an CURMSMd l 54ll SC-~~iWi~ hhtu 1.1 lli i- 1a an id a5114
cipnahiau~ucslapa i1 C--p-lnthin, il.t4itit1-tCi1tla111c ctlpla1thluaau4nen ri al,7Ptu4A11111h
anI uq a.arlh a ud 4 i, aalniI da e iiaagu5,e ta.1h 11M IIh dh htt iaia1a~1 it utd~ 114 1~ I1 ilt
.~dhldsuaa~tIahdddhlitP Ohliri1ged1 n~c t l i-ci atit 111 11 17-ITPh 1.Ct1uit11111 111 4 Pic. i11114411141 1 tltlt aM pMii.Palu T~iZ PhTLSi lattii(ti
Sciheh. isihal~aad Lhiuui ~dehipieup11nili~idadl U ,i~~ a. l taue.Ur--'-e -AU~iithl Mt lptau,.Aat1i I 1.Vtaa11Cul 4
Ale Liead 4 Men Yta ih p e 'Ih t1hhdl Tni~ La puFa tI.1*i hunt ha AaitauA



htadic enudc lsta aiid r l uain- dF! atlahd1a~ldA~ a lahi t ne 1116 'l .L niha -IAks 4.Whicg- 1t Mcue de Ii a eait Ac a t-his luicld adeaaodlluluses Uuas In, n1.41 inu- pe ulta idet. ai; 1111b Ehaaea-hi.a- rls M-- caldo de tla o a,/
lb,.~~~~~~~~~~~~~~~ 0lqecin cd pasa allsdn ltud iaAiit. thi"lDn Jauh hi dln, aaipi.,tdal c1 lin ncad qui ehrr- aeut.tt
aepuI anldliE iad ehha- iatiia d1t ouipphi6p u lad El eddI D c c0 i~la. hi :a J.-., 1 I iie ta ibt Mt. aaleh


t.6, ha i i dda'et K111 hit d. t L de01d e1 al. hibI- deit-in.nc paln Ia3 uhasItn ehiianl din L nU, ntr e

Ati lhv n lr d enh a ha~o 111- aa1et ruluzsa uhle.uet-,A nlp~aeti~eehitdltt.nlaiunei~a Kaieui1
MauddeII iaeai ~q~ficdhl anlduurll 11liiittIad
deasta.a p l-~a ptna i l mplr u-t.P15a1 11 Pand .t



d,,lsl~a~.ht~ Iani ulni -enl P eni
LP1 l ptidash, .ney~at 1e-1-llan61fipedl1.aF;i1-t L eglu Ilmia rl-1-gIh~iil paulnatIihlh1Atanaeteaa




cslIeat lldpc iiik, Ealiia~- iuautii1tapeau p4gaa tlada. el l pud t aMniaddhahu n nlad p .Eue in ntt~




A e iap t 1 InI ing zj :I, S
upnt 4~it pa iilt din t:iil ha-~ I5 iit
ta nt. - n qhhag A .- I
ha7,n P, hlhal--1____tal aul.ui-tui
lat u Ahs-Iaa anhe en4 elqslaNittaaS4thti nle


hENe LA -RNE CLeacAi ,ew a a Pep lcetetaning 4 avU


,';I-11 .- 1 s ia- I & Wtipaay na Ptfd .a1Ial al 4
I ,t ap chtllui -hn cl acijai i


Fdcelia 411 1 11r 7,nt L s I I -tclah



L 3A AHnh A c I .a. n Mn l
h i n hirkR .1 .11 e 7 ^ l lla



hilt"Ipt P -i -11 1111S'1V 7,n1
Wahc i f-. Al a 1 4
Pu~hhlealiaal~na d hp~a u. u1hipe h a 111.1 1
Dctpait, IIt~ Pilae's H

Chin A. IahaYn- asa.
11-0 rs. 1- 1 c llul. (as-IS
Cleulah aI -t ~ iI Prolnge ill-hIesurnjh
eta i1 cl 1t. s
"'ll' Lunl es Wat
(S -kat hu-aali illIl) 3h



a. halhiaET Y CI.-s41.ieniicd


Protnsta el manager do
Pep por un eronomotrialML77M waP uiqath hiuandy -N-P U. Romate", clahniatla
WATESSS11 Ca altan insaelc~c )-L- VlSLC ADO EL PROBLEMA DE aifacaydrcvnd n Rncsd
Q,,e Nretl' has -o a SANltE ROPT HNell
autnat clalnt Atlulo elD
tado 53-a hlllaal. aracca Ic Dpco LA RETENCION DE HERNIAS io e'~dsa neyc~joo

,&c6laa uc N-Pp tind.Shaci
a11"n ctlaA YdditC-tpe. El C O-t asde 8- L.,htcaasadeCai I& -ne acsa -esltI6 q.,, alech I ctt~b ienahasc Alabama. ELInE., Wa.-p afc astqaaeh us ha Zaecs l deasaae taa tjial extra evie 5uc alhets la m a ahaaaal, V st hla~d ati~h c er 1,,, ic tn rar~ldcste dc W-c heacla t HIAAA Dcgeiaa Oaasia h lI irie eehieidt ib ih d, So~i"t. s -dn .eace a sAtaws dte as epans- y aanaa MAYA!
elpI.e 4 eaaa. al.Ile apnh Zs lsdaCilet elh ehaalal a1 puf &-,5 pAea.koC&lr-Joe
aqsaa a l~ ., ln tt-c hhe.en qa-sa aqie t S.2ANTA Culls.R-o aMlasleach Ia hI. 4 t~~~c isllclccec tl 1115 aa hltcs atl ac.l~.4C~tP10S a
latI ~ tt I lhaeela dl e n al ataalcaladla 155c l c- 1Sn Peisad 165 aa"a I. cuz auces (aui hae .aluala P AN1 pace.S picrslr Tjs altik A a_______ __ Ty na sethea, .a ens )-,.d. 1!I MA.-ac Cans. 3-t Cr00041
Taasnaaa psiap las 41ietdrlad,a 1 AViILA 1- 740 F~r V. RM
H'P ,cc,-caaIsa Utaslas maeea edsit. amx ViitsCe Bodega SANCHEZ KUMAII HNE S.
Lii ~ ~ F oiltR he. bse as. AHa-iad Il3, (51 5en aaeicdi M'pel 005$ aa 21







PAGINA VEINTIDOS S P 0 R T S l)IARIO DF I A MARJ.NA\ MARTS IU20 DE SEPT I)E 1949 SPD 0 781 A'NO CEWII


COIN LOPrAT EN EL ROX 'VENCIERON LOS YANKEES 'AL CIA' VLND 6_POR1 0



JUGARA EL JUEvE RIal E'Squedd ____________ lpooa Aartgihc i d aei

LA SELECO Conttra Sierr a declaraciones de importancia B
UN FLIET 1OU00 cec acel
Flrtrata deun jovenpeeadr que t ".J ,ea.ta -.1t,, d.ttoa da. -vit; lw anlt rel le -Caraa ilv q na nit vi
lee obtiniclo seiialade ttt tt a teeeco e lpectclatne. c n attaln ~ 1 l en d c 6xntr!o-e ttroa.
Pela e edeed ten II.Stem ~~ eete lheete [tpetcn d, a- lee C E rie l dh -4eut lltta Rodliti"AM agnr.
eteeeee0tceete Pele elsbaeetne

aneetect pute d. 'ec tttettte ta et ta n a e t Per iRENT MOLINA
"aettaaeeeetatt~ec a eteet55ttatt~ea taptte n ncanzt~te t ~etteeet ~ tt ccttneta 1ry eatet tecte etttt
ec~ceatteehe01 d-,.ee ~ ~ ~ ~ ~ aeetceeetetten~ettaeeeeett
eccaeeee teee ttA e c t' cece atteetta~ taa ta e~etaee e c ee ta tetetet tcta tnet na et ctt 1 teea:et0

Dee ttt~t eteetteeec ece ~ttnettete c~aeeeeeete~aetetcteetetee a. tceeteeeetea. a eecttettetttteat.tette t. eeeitat itte tet ac c t eatp ee d ettt- tee tcec eeta t tt'e teettmtetteteeeeete c eetteea eettettecnecae'teettaeetc at'aetettceattttacaatcetnt et tta ttettetetcc. eeetetece~etpttttcetea

tec~tcettcetcc ~ THOMPSONtet PRO ctDUtCTSeet taeee.tcnaecec'etantt'en'eeteammaeeae INC.eceatteteaetteet
I ytcenaetnccctetteeet ttte te~tttc~cP'nctetcpt'ect~tDee ~' ~ etet ea ten teteatateetc~teta
ctcecee"etcee~ccct _______ __________ ce~ceeaceaa nenccteeccee~t ne t tet'ettt
eetcteccenee nn'a~e~ ett pteteecc ctnca en ttatatece t~tteeceeeeteeaaceectteteeca
ceeceetceaeceeeleveland, O hiot eeecetyecttentnentcettetbcenecete tcteccettaceetee

tett.igo Jce ktttic 4te eenetteeta eae~ea tetnnc e, ecc pettecm c ttee et
ttctttee'e'cttttD tta Sttte c tttttteee tttece a ttcL 1 eeccpce tateeeaatneaateat
tettDE PISTOcNteeeta eeeeeeee1teteete dtcctete. ceeteceeete etcc
cc~~~~~1 cane Kc -1, tectttt teteeetci
teteeyttcAOS R.tdt~eete HnMI~ E RNANDEZn ee~t.te atenpaeneeecaict nectttteeeeeceeett

a.TE Yc acAeteeccee ae tette tetcttt tttettce a 'etc enea a l~ ee'mac pee''ee tc atcaee accat~ mete n~'a. ~ te ti cca te tetecc atcett0c, creF e tttttcettet e~~~~~~~ZNJ ectttec6mete4n 1aaaVOIFlna oh63io LeA tanece eeetteac t.etteAet
eteeta cnmpttencctec tce tttetaete ceeetneteAcactcc 'c eccn ta~eat
All;tteecetecatetc aetaeee etteeeattetecte tecta nttntte ecettc
ten~~~~~~~ etacttet zntac tre adatttnea a Peee tctceP
ect ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ l tetrWpc tseeeteca ce~ett nttca atae ~ tt
ttetttt.4 tc't ce aet eae al ae nana e ea eetcattaccceetite eceeceeetatSacne eaaDe eeteatnEc Petc P! teeece
yin ae' acee cecaeetcc te '~cte~eectta tt et eeceecceecc scaat'
etc etettctaja cteatee cetIatttt'ee atrAcee tatt t te aeet tt tteee tttctet.ceetec eecctepc tec
et et'tectt c mtct ecetan eacetct c ctenttetetaancenentteeaecma eelente'ceetetp ate

ttttint etttec. ePetettee
eteeeetnecn inect ttct eet te'eece teeneer" eecttnna L o b acte ea ete tetetttepaetee tneeeeetce e ie
Re' Mcaccaa'a r,,, reicetc cc.tecttat'tec tce ta t atteccctecteee eetee te t tetete' snnl
cettttcttecte' m ~ 'at tte ae ttceettnatc catetetet tecttmeeeeteecete eceemeteeteecct ecttcm
tmttc si ae c'ccpeetetttteca ee ta eect e nn ii-, a TR KI MI W E tetetet" te caee Aat eanmtac
a~~~~~~~am ccmee tc tacttm yecc eecnui jugt,.,t e teetmpca- ta etce~'tteen c ecece tetetatcte ea te etee cteent me taetePn
N u v e tc ttt r ette'ec eScltt Iecc' 'cc cce eceteeetecettttcalmtet tteta eate ctecttt etacpe' etetec 'tttecte teneceettt
cceeetacinceeeteteceetentceeetatecctcecctctt"I I'lltteetYnaKeeteat1 teaatte ctptetiteteece ntteee ~ ce acete eetemceeettcte u eetecea
~ ~ ~~~~~~~~~I F R Ecem t ttet ee ccnecCA T S jIa' ACCE ORI@ cseanccctea Cor T- et -tcte actc peetc 1, en tt ae ntee et cat.c eette t cmta acat t


CARACAS, c I e NOYa'e 1c,"ectmta 1cc e a1 cn cc pce e a e, e aect etee at pecttc a tt t poesetal qua hae'hcteeccea
equ ep. a t tetttcc act.o 'tcecttcce CcegCpentecctcicnateee
teezm da' Ceolorceece tee tecem leanlwl 1-ctcc cc., dc naan tean amcaneet eccttetcte us, D tea e l ctttttttteccceaneicc
at ateetr ee cac-1 'ccneccatetin atta Pstatetee 'citttaatccinaeec a .dira i-d.1, t. .7to


ta3 te 'imet cc'a, aara t'ce meetto

P. e cct~p ancct eee btad n nueo Ce etate ecccueeC accaedc acl eenceaccn ecetteetnt
anctee ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ tqucd pca cpeeeretr tee etete 'te~eteteeactt pi
Pcces te ece'atnZ t cct Johnnya tar.e ce erasac ec r eearn ettcamtan eeeaann
at sasteta 'ectetec etmacace Dan~~~a t e a t a es ineinca. calle c te tttt qc.ieic eteaeeeecu tet a ane
a'ctee'ceee ~ ~ ~ ~ ~ ~ ~ ~ ~ ol tin 11tetas '5fa'an etc Is*~< ecacaaet c mete ac"r c t ti.apeea~
Nuevrt dero i.,V J-__.________tee can ace quinee at--t atieteee aetatatcc
d.l -i"o no bo, DEATAjLeLADOSt ly -.a. ian~ elCrben anrn1
P -r-ceee t.ct nrc cattc etmi. tte c t n ebra'aaaaa'anc'ad" E T1 11aee cI- d e teuisd n ao oitarn otet Cd o q. a ne meeee nee eteI .c Felle Ct tepee anl neecee ei etc;

ea ,aee aececai tone tta'n-bl.Obt
teseea toutseinne Catecua et e e ; e e ctptincc-i. Int dae iec a t J, etpia r
Cttea~~~~~~o etc cel tea. cc e 7ee tc
eccec. ttte'ecc'tee etainctmecetete mettetmctacn e a mneceta e a ratmatt eta an
N, Yc,. 2 2c ece ceet emcee a. r r i netee a rtnta a t te d t 1. set eta teCc cci ectet t It ;e at r.ay a e

teceain.c tine~ de caeaecpamaat
ecodu act ac anneer cn ettcn'tcn a ea tea aetet
pel et inate cc btae a Jm ttee e uine taa cet Atcntaaec
Ptteect i D atcptaeeeeetm elceac so aty et etao catecac. a c ceeinna Immae eccta
poa ettr tt teeri e e tan k ,do n :t cierone~t dotey eaeAmbe ota~tle oalu St. raet~ia'
mc rate rataner ~rct cc k I.,ec ctec itetec at aneteete c. cc~~ ~~aza~~~u~~~uauata,~~i acteaceaecaacctn t fecactevmte tccttcccc att aetee
aaacat LAal SeatB L ~ 1 a0 V.apt Ct Ic te0ete A etc neo acceeeeamatc
do! 11. nce e c-c.tecaanct e cetee easett mc nttatttete c te mtet
tce -fteeen tepeettceeceeaete it 't ctetatece ~a.M
etteete i-I. mcae taep ., se tet a tetcyeeect tae0 a e ctcemaeara
t Pttecc .cee dtee tne tkm 8-d mc. mIcIeIace aite aattece W entn S neeatet
et ieeee ,em cc etea t ond e cate cec tea cc taaa ate pctctta eeetntnte ea
1.ice e-1 ecet.e rc c. tectea Tceen tel c ecat.Oatsc
aracnetet et ce c tc eeec na ce etccr0tetitean
et p cmn~~~~~~ ceeeecnec ean-y, t e.e .apneercete et.etiacmaettaat
Pttcateeee ~ in tee ninaecceaentcenettie e tam e ee (Uec

RA CO TtA c 5 0ece rc at eepc mat eit ctrace a a ee ts- ca
cc all t a ea Ie teeetea cccarecaee a ec ea
Feeac~~~~~ aaeaac.ale .) ]te.' a c
tat e cptac teca aL aIMP sa caeta do ae tet ae Itecec8 eett
later~~~IiI Resri in naalCeecpaace eeaeeaeaeaca ns t
c~t~atintt C. suacty tt tecre Yrta quaitca aea'a




Cet6241 or u e t atee ate mtee tt caatexrlO


"Pctecc a. t ttt t- t cc e te ar 1. entraeByt n atceets
Ceaas cEciinacac~ elAoad tr e. aa
tttt'ctett.~~~~~~~~~ nctatectp rtece 'cA t teaetcatmttataeataea
teems ac -incc 5ctea tc0a "1c- - - cncacatcctntn aac i' 0
ceaacctaeeiaccc, t ftt ta 1'~ 1eed te e tea tceeattteeetceeetma
ec~~~~~~~~~~~ 2emeaeacce'ea cc ~ PpIatpem
a t,,cceenctatccee4- tre pae teen h, c4 c c a1 cc ate eatttccm ,,1U Z11e etch acetrral



/coetce $U6E: a"r rte 4ce A t 2 tmc0 Redsetcc enanInJigb
ce teteccecte 4p a! 9atee Cintate 2e. cc t 3ut caaa nmtme ertcljosa=caccna
seeto eaeceetefoeer,70 c',t,
letp ~ ~ ~ ~ ~ Vs qwa ergint Clev o'pceo y e et l ONc a w onat ;aawcartca Aatatn ttaat
Ctcee. Peee mtee imaueetcs Hcecc C patnoi puad 1t 1c eecec Cecoerre

etcettinec C nad od le ab 1,d.eerenaT Doule p lte a toron natee y' W lit~i
cc oct, ccc tateeat a tn c-_ ttee t i a Ce t in
Cor m'- gletcur a ecmcc; eracrtno le Goa
'ere'cetcPlo actarlo oumcetn canmo tett can ctcaaaeet tactete

m.a ccec ce C eaI aen os ccatt dateaee tee baecfcn crdtcedo tk4,d tiecrac 7, Bonsecanentardlil ceate en ueo 5cc1 pmp cc oneds l en Holc t aeInpnbldds eerreeEtcenUila
gen ral atlo m jrre sri-o
et ctae tta Panam lee 1eac~ a'teeea .metm c~ indea'el Ct ttte ttte e i p 0 ttt
cpcl eaetea eetaC u acen e Y I yec n~ i ncC. 2tta3 etar ac na ta
attn ue ecece eectea dato m sid 30s i llena d as i uy n p o n tord a reluid a taleclo; tiene au t aeteDettea m c nocacaia e Cteeee trp rc~ pteoi l o P go te" a omo lae ptttilclole qua Cei anetade' pe tC an eeratao


Snasa tbtdc ara te C'ettei pceepacni quo o eto pter c s deri pl acn slt rezrenies pare al c n 1 t Witt t E cteattaSmet an atreat ,
-eve Peea aactc 'in ctc' a -LO

aePetattnara ite uli preeabeeecd rs e g n u ngeo oe ucfo p eat Cavii Petta te ttt S mteea
teeteetet Vea eemc, a atae e ,eteeoco fnosed b eoo oicdyo uca oatetild~s am mene aacn .ttetectrera r .
hnee a tner.'t"i ttteceere caatinocetecencBrtan
beta ateb . lu Iie'o I %a a c er 1
prsiclte clels oia tictrca mca capcae te petanccce ateo etc Co sv a t eeinaf ntat ccllrm enO E

reurioti aumetcCca LtL g
accept tetet Ieea asor aeutta e eettet e tc
a, do tin raceet






AM~ CXVII S PORATS3 DIARIo DELA MARINA-MARTES20ODE SEPT. DE 1949 SPORTS PAIN VEJ&IEE



BARNEYI DEJO EN UN SOLO HIT A LOS CUBS Y GANAROi"#N ILOS DODGERS 4x 0




_________ Futbolisticos~ a' ei


F o r t n n y C ti n t r o Go l l c g o l o f i n n l i s i s s . .4 A. 0 4 4 F 4 05 t l


"4.0411 jugarh ('00 Estadons Uoidos, mnfoaoa. My o -le; Aj0ot, om1000e die

Pot "PEI'ER"1 Pttto liltt

,do dl ololton0orlo 10 04 0 Pp. Coodoo Otto Jiltwo Pluiutl haoo de toa s- anoto po el tlot. 7'(1 P 0100 :Dl tbo PLAYMAKIR.
yi, ,. 1.initneopodeed-, f P togoodo po, p .t- d doido. Forgeoo noa (00 rtp~ e10( naldo1 PeiOO(IIO deseopatliI xntl loteooood ROLN SPORT, htoo ,,
Co.H0000~tdkco 5, -lcaet 0010 I010 gO 000. ot Agt rct-:nooot 42LLIN 000ina T A7.
,_n a tnu p Allo tlndolYttt -blllt.1 delti0000100dqu pot Ibri o nt (00000 t S00ot.on doflo. A eo100o, 0 got otd. 000 o d.0OlO.t tn 8 lbn
Pin.1 100 tt bo. doopoloon 11lltttntOn del10 1 01 it be, .n. bo. 16. e 0 t,


,, don CIl-ldiool.dtil t A p-100 d, 1.01 p~ E~l, ooo 01 di-toid,, -o1 I11 Relnldo P1000-00I holbt, ldo Ill 11010s do Proofetio. 01100 es oho- Penalty, Plo 000 61- &lo i to 00010I10001660100o dogtloolooot--lltooo.leptodod.a ma



P00 00001111d t Goo~- -notooo do -odo4 1~. (001 dlnolldel Deport do011000.oolldooon ~odt bi~lqloootdoo oooott

p001Igv tpdlto do 00 Pooo al0(1l100 o oi doogo, ""-d p10101d0l d(1 t looo Ldb o 1 d,10101000o.OtOoo~d 000 oql~ tboo



nit, )1 ".i_ Cde titI P.,t til (Uil r
on_________ e. 0001000100 u s i h tr~ m d"



Dteron un solo &%1tin e01rt 0a t a Ro SXICICI~Z itrtl 1wotiniI




ponodoo loo, !odo dotF10 fo" 01010100$
olpo 00000001 100000 p0100 I~ -Ioo do00 00(1 "Po
VC 5hii 63Cogo, .o I 0 00. 0 Pot doP.p dot (0(0 do .YI
pooh.o -00. 0t0 d.0 00.0lo10 toP 01( 10. 0 1 0- 0030 do"g par, t001 g0o 0,0


Bobt debl olob 0010 00. em. oo 10e 6.1,1 0
oooobotO~iodopolO~l~o .0 ooo"oo6~o ,100' 61 q-0 zex, do to 1100 oot o d0011

P-do d, Rol oootbi -o eboo0 00ki R0100-0 01000 i 7-O dotot Toh010 1 l,( 0''1e Washington Ave. Motor Co.

-. el M. oLA' W MARINA 135 HABANA 0.~ o/
epco t p! tio. do Coooot
"rnt opi W0lod y2(1'Valos en as lea Agencies STUDEBAKER de la Repithuice.


10160, -i 110000






Ro. 10y i, 3
Coo1 ltI 01d0p0000' p, 0001

Tool" 0 0 00000" p
,10 0 'ft.

t.10 -'- .'. oo 0(4 000 UB\2XARD.0 oooo 00.6 00




B.olooll 0 Oo 0 lldo 14ttd To. a' d~o 0 tt1 0

DWI Co-odl(Ot't1,( fLiograo fl tro' l O't0000 I (oto~~''1 o t d ('000 a odoo ooo 1 o 1.-6 0




coz udo to 0(0110 to 1o to Ot _d.0(040 drt t;billpl.0 0 ooodo op odo o




-doo" C 0.0. 0( dol 0!.l010
Ot.h do J00 l o g ol. Oo o op.dool odo 110 0000600

(6 ooo 4 loot. od Fooo n Celzonciles doologo, I gologo do 0 011601 doo dl Pooo., p p ooo







500 0 00060 0 0 0O


Gilloetoo




Ha Colo don oloriay b en umo

boo~ar ogowoo polow dooobo nodi tooio


00J o odoo doo I4 01 "06 0 u u o

L ~ ~ ~ ~ ~ UEI &ENITE PEREZAtli g o CATIbinfi
basito 514mai 0~r OlIPtoop A.95 o Hoboo
oiolvm ow tntOO0OfO O MiI2 osma


IBATIL A019







ri- A \fJSINWA1IH0 DIARI DE, LA MARINA -MARTE3. 20 DESPDE 1049 .M XI

Pilen que se Len gn en cuenta en Discutenl It 'SuspensL6n (1e una(i Infrm Iorepo().dosd

Salubridwid o los i'eterimirios, 7flC(IU (it Secontrol del rtinxilto 1;Ql e1CINoS lacer jwr si hitjo1 hi industrializaci6n del kenaf"

H 29) qije t6 i taild~ Lo, 1in 1', 1, fii zol Daao i I ;t t p p~hii e esan'mctt ,i" ctril rI i i Fillt;u~i Coaana-ott elfn tiitonm protuti l anp Pitol g Rio~ Ii ,lt iii ttootr~llfIri t. ta. 3-4. .mp 01.oo H*A Garlo p,"W Hobon .il a,. 1- Iamo ai o a
i a ou 1 ti o-a: I lljor oldad Iehp Tabt ai CO W~ ws if -- .*~f' Y1)0 Dtt, 010- vitt>Ont -n atitft nit" til ti llltt
01,111 VSi __________ GACETA OFlCL4L ,Yt11144YWo t44dd Waoi 1,1,0 Tt .r-cd tst, ,, ,-. ,Ito j"I" -'ff li"."

I'V1 1Nt 1LSI I tao11 ttlyldo falo*i vs.oO~ot Iso 10'llIv tt I n t t t il I'I -1011101001 I
(It F0100 Si O,.Ito ON A. 0ifti0L. h aVoots010 Ita10 lt OOndtt 0llitttOO oIiott ttptttltttottot
It t*0i0*r l ,'1O'r iR toot~tltttxtlG.tttt,0 aoxi*0 .1r!, ,,,.' 'I gq ,0140d ""'"1144e 1,J.L. o-*s1 vtft~ HRA".1 ,,z "I",h~iI f. ,-IotI l- J. d! f!'
Ill = I,.,tto'I I'lllolot lotittoltIdl 1",'I" 1 ,tI' _11000 D11i-l,1-tdo11- tol0 L00,00 itt I""Iotot I t. i$o~O 010~d In ot t,_1lf',P9lo orooo 01 l" o t-~oooIotliiilt
tttttl Oihit -1100~o10tl CIotlo If0 ttotOl0Ot100l i~t,Itol11 -,t 01'-di001 1. It, *r t ,tI tn 01
II ~ , I1 ,1 *o Iil i P 1, 01 ha oat 0000 ,,,ot ioo'lol ,,- aot,, l%1 donon'i-~t 't tiJn"o fOllI ta
toll~~~~~~~~~~~~~ 011011 ,101100 0 ~~tot tlO tl 'O!i ,i "*1000 ti ;jI i t 10 iot, 01 ott C u ba.I'' ~-1 0 m~ V I t. 0#1 1 1 6. tol. 01 11t 0 .1 ,", t t11 ito 1 11 fitt t 10001001 ,00 l jatO Ot 110 t ot.b111
11 "I :" -I I -, .- : iD d. iil tllt"t1"t,0000Pttt"0i0 W li
11oto l o It F100 1 Folttn ott lt tot t otloI ,to i o~ ~ l, 4 o- t,ttl O : t i tt t. lt nt 0 0 i to 1 0 1t *t 0 to 1 0 1* 0 0 t1110ii 00100" M foO~n oonilo a 100*011000 i i 00, It t ot 0 1 ,, 00 t- lt,,~0 "oo i~ 010 -olt ti l n o o 01. In ,0

10000 ,011 ,ooo lol l0110ol 1100110 1, I, In o 0 0 o o ~ t~l O 0 .,,O o io 00 ,, 11*1 (,o lttloooi Ott ololo too, I ',De~ I.Y, I
lotooootlolotiooo 0001001.0001010000 000100000'6 ll I, pf'" ,Iio " Ot t ttlaI l ot0 1 to1o1oh Ioltto Iotiott tOI.-, '. tot -,q-1 .1-l I otttootooo .1to
t t001011It, ,oloo1.o ,, ,I,, d i, ,,1 ,"_I ~ ( 1 000,I1t10 110 10,0. 001 It 010 I0011 ,llI',! 00 ,- 0,.00*t 01,- ~t 1 It 00 I[I0t~ i0 00(i 01.'J 00,,,, I0 00,0 01ltltO O lt~i~t l,1001 1110111100100I, 000000t*1
0 I ," 1 ,,d,100t11010 Mo tI,- 001 )00110llltO to000000 1010,0. oo,,o; todo; tltttt* ol., 00d,,0- 1*t0ollO oP",,tt 1,, ,I 1 000 00Pd iiflf,1010 ooootoot o-p ii "' ,111i
11 11 00 00 0 1100101 -111,,0 0 10 ill Llyoooottoioyo.loo'O01O" ,i" 11 ,11 1 0 0 0 0 At,, 100111111, toO,, I~ llot l I 100 1
to 111111 1000000, 1, 1011110?111.0 1101 110i d i 11 11 1 lo l lf Ootl I00100, 3t, 11 100'- 'j ,I 'll,, 0110* -0* 0I11 t"l 01*1, ,l01ooo ,,It I"dt,',II01t0Iif I ,I0010011l.0110000010t0,1i'tolt,. I it,, I 1 ',N III- I ,3, 1-i,,I11O tI I
01 10 10 0* 1 'o,,I I tdfo tu _tftoi0*', 00 :loo11. tI l n 10 "; ,;lttt t; ,,' ', -~i, ,l Il
Il I oI ,, i I I ,, ,I , 10 ,,< 1111 d 0 0 01- 01011*00i 01 010 1 1 . .- ,, ,,, fh .lt tO 0 110 0 I""; ""i O ,,bf 010000*ono d to Ot
Iloo I10 I0 ,1 0*0 f ot 000 11* 0 00- I1lt I1 O'O_-loot 1,- j,
"I, 0 I0010 ",, 000011 t0110 01*001010 C1 000 i' 1Io 1:01*I 011001001101100001,0000 100Y1,1010010011* 10,001011 0 0010 0 tot o ilotht. o-oI0111Otoodo 010O0ld007100I0,0.0011 *ohoitto-0 100*01 1000111010
I000 III111 otl, ,,. ot'o-, ol, 0I 111 1' 0 I ,o '10 1101 P00100 01*0000 001 ,1 00 100 01, 0itoOV-,, P-0 -,*000 I 0*1 010 0010 0001 000 01 110110 -- t" tot, l"'!10 F00 :"00l, I100010 11
00, I001.00000000 0* ItO-l ,I - ,b n ,
11 I_ I I1 ,01 00 0 0 t OO 0010000 110"*1110 : 0*01. 1101, 010000II o- I,* 101 bool 1 *-doltolillo di t
0000 o, 0101 0I0 00 001111 oil ,"a01 -1 aI 10*0 101001110 to ltll (o pooooo -0,0 tO "1100to. to o Iio Iot looo,1 10 til
1,' 01 0~ ; 1oo ," I,,Il ', 111 1 tl_ Vp:,oooih",.,"",iii--lt.-nt.i ,,:- I I"1- I","; 1 ,,, ,,Il
110101100_11~t ,,. 4011010100 Y1110 0 11 )oot "I -l -ooooo -00110101 1 01110d 1 -to Iptftt 0 ,,t0111too l1 ,, , to ol "l' trO, tlt~ t~
Itoo 011 Q II , ,I 000 lo,-, ao.~ totoooiit1tOooo',0o too 10 i' Pollto0 il ?i"Il 'bl 111,'b1 ,10l00010
Crai c ntdad t0000010001* 10000 __________ o ooo C inyo n 1*0H00 oop 00001. 1110111 000 11110"1*0toI0*tpn0ooloot160*1o. z lol011111000111ot0ill,1,, oo
de -aal ha -. If: odl ada -t0 00*00 0* i* to *1**1* 010 001 01000 "01lt~~S) ______I__(__;';
I a .i10 1tt1o 0 0 *I0 I100*01 booo o Il0 lo ttd-lll l
001001 m,," ,,, % .,, I 'lI i ?", Ili,-, If,00 ;lIoto boo o,lloto to. "1-f.'I l'~l 000001100*0000011000010011 lohd -o-lt 7!,- l- h .! ,,ffIIi
I0010 101, ,oI o~h IO0 *10 ,0 ot I ,- II ,,II i 11 "101 ,01*1001 000000i00 lo l I, ito ldo
oooI"ofo l d*, 1, It I ,,," ,;!,, I -- , I,00o0 .10 I to ,to I0oo*l0 0*1 1 00 T1000, 001 oooooioo 001100011010000111110011I, rf "Iioo t lIIItI t ',
'Iitrt *'ltt ,00t t 'itl ", "0-00000* I ':t~ t zooooo,1 00 ,oOtt 10 tt~oboo ,oo ,ool 0, 00 ,, ,,I I 1 -tI- I- : 01I fq o 1t t p 1001 011101 ,f" oo"tototo~dt tI-ltlto
Ill0I I I : ItI , I' I" I" I11.0 Oo 0. 0. t1, 0000011000 -0111000 11 1 .1- f001, 0j00 it f ,11l00010006f-00b0010, ''i'i ,oo 0,1100 Ooooo ,o C001-0,,0t0 --0I,0110000I, I ,~l ,I It o''od 000 ", tottol tlio011 oott 1,'0 111 00 oo100000*0000 10000011t010001*01000lOloti
ioo 011 ,,0 ,0 010 .1. Oo,~l~~ -111 oooOol 10 I 01 to, to *-0010 00001 0001 -,0060 oooooool il,~o ,0 it00
Iooo~lootoooo~oI 0_ tollO lttt 000.*0 01000 t000000'bttO 00000*001001*0000 bttoto, oo01 0t 1011)0001000111d r ,, -o -.,000, 10,0 totolo11 100010 01 d11 01000 Loooo I-0.oo klo-ooo M-o I.1~o~i~l A 100110,011110,,
i : ,,,I 1,1 1 0 0' 11 % ,, 00 I 1I1tI I: 1, ^ ,, 1,, N 1 1 I 10*l1It0," 0" ,,f ,, 1 ,
oooloolo"I 1oo ti,, o, t'o001000( I" 01 .01110 boo 0.00 I IO Io .0 oo Ot.oO 1000%10*01 ,:o ,,-oiooto hoo 01*00101001 0-0010,0I0,
-11,,,l 01001 ,101 *101 00 110)00.00006010t0001 ,0~ i _: ol r-10.0.0. ,, - I'o t~ ho I.,, 0 p-, 11 0 '_ .00*- 10 11 11;, -I '!0' 010001 00011, ,""It toaoau' ,1 ,i,"oAi oIi,
110,1000 I -1001101 01 0I1 I ttt Itoo 00 t-loto to 0010 o-t1 o t 1 01 ooo, oI !V o 100,1 10 1 too 11, "oo 00I -O 00 0*Io10 010010010010o01 0t '00! 7f,01000100n t110 0I
l~~l11tl~~~~iI~~ot10000~~~ I .,.t.o o 1O ttt .0 0 00100 %I10.1 000. 01 T10--000- 01 011 Il ;otoy
G ran t can tidad ( M it N*11000010 I~otott~oooito -oott I,,ool $ 10111110 I 'o .01II Iti011t11 0100.011tI; 1 ;00000lOO 1000 ,o-r-lol ~li t11lohI -i AO ES I0.1 l .-,,,I, I* I i~ ,
I *1 1110001100-01100 I-0,1 I I I -oo ot,11to',o -ii, Tooi!-.0A,0. ooo -1 .,. . .I'll-, -,___I-.,.f0100111
00111 I;0-I1 I0 Y II I 0-11 i0*1000 10 01100I ,-ltob tl ItI ItoI"" 001 1001100 'd" 0100000000.Oti,,, ,ll,;,t drll0
0o001o1$011,Ol~0*00 11 11110 .'Jti rito i~er~dos oo,.to oo. oo, 000 *000 0101110~010 00 100011. **1 *011I111 100 olo o Iotoooo oo d,, 00111000 0 1-,000 000 01011

I,0I100,1-010 I 11 I 1*000i00f 01. t.If it 7 11 0*0T0 1 '11,001 010011* I00 01011to0101000 *10 1101001 -1110 1 -0*.0010 0 ,", 7
CotoOI ",,". I- I oI-oi, ',I 000 000001 '101- .0 a".110010111 01*010 1 .00 *
olo llo1b'opoo do ltoi t I 000 11 oIf loioo A 1 o 1 1 11,1 .o,,,, ,i. "i 01 00 00010 00 000000 00001 -00001,000100000" '"II "k"ih'f ,,,
1I tIl 01I -, I10100 11l!".1 1 4Ioo,.~ ., 0.-0 0110000000
tI I0 10 IO 1) .10100 )0110ill, ',01110*10 -1 -A I I I -R A I Ito".,'',, . It 000.11 0000000,'li 10001*r, ," ,,,''"',, '', ,11
I,601o 5liA-rO-.A oIoIllt:1," ooIt I 0 ,10 .0 1 00100 11t iooo ioolo 011, 10001110t10 tooilttlO00.ttb-oo- i I -00010*10011 I o." I0010100 0100 100, A-,l~ p-*0011 10111 00610 *100 Vff'-i-thto 1) . AU l
lQ 00I I 1111100 01110l ( fIt Itoro00 11* 11 11. 001011111 It 01. to -10,1 01 01.1 ,, 100otoo 0 000z00 0000 0001 -0 1000.11100*1, W .- I '' ,il r .i i. ,, .
0000110111 111-01001,1 ,0 ,, 00010I0 I, I0O 10ll llIt110,111I*IO-01*.1I00io0.11-1I0000100I*l t 001 0 011000010000*0*0 ll" 00001
,,f0 t,11. I L Otit 1 I0 011 I00 0 0000 1 006 ) 0100 )0 l o0 t Irm.%1a li , I l" ,, , I I I Iia ,, I11 ," ,- ,1 ,," E Y (, 4 i
I ;tI,10t10 III0,,oliooIIo I I ,I: 'l, tI ,, -i Ito 0 " 11 O 1t.0' tII~ .- .0 10,0,, 00 01 l'itt, oo lo 4 ; ,o00'" u I I


00 110I 001 00 I01,1000 1,0%0*0,00111-- f I , Io I 0 o0 o 0 0 10 1 o 000006000000000D i
;',ooItI 100010 0,0010010 100000 0o110 10, 01.- ,!0*0. -00 110000' 10' 0 1 tO I* I I "I00*'I1,I1110 011 0' "I0~0 lot, 0. lO t 00001 I00,01, 1 10 It 0000 0, ,,, ,, h ""I'd,~tt *Oot010 "I0,1S
,710000* -000* -010 (110 t 000 01, 11000001 1010*0000 I 0 I1~ 0'o' 0 Olt t I f ,,, I I I "t- IIi1 0*. ',i" 1 Il I % l lftF -j O N O
000 *I011-,100-1,0I0I1101-0 "10 0 0,o t~0t0*o0 0t ~0 000 ,000 0 I oo o l o l 000111100100,000. _ _ _ _

11; 01*000 1 00 01 Io,0 10 r I F t .,11 '0'0 010t -1l -00 10001 01 ,1 111, 01,, I:, I
--0-0I0001 lo. I I 1 11I It0, I0*011 101 101001 1 0000 ),, Rt
0,. 71, ,0 00 .0 0 o.0 1 1 0t ttt ~ l *010 0 ,,-1 I ,- 4, l
,f 1 I t0 110 0.0 00 000 1 I-1 0- 1 0 0, -, o, 0, -0 10 00 00 --~ 00 00 -," ,I, (l ,
000001.1.10*0 0, ,,oO -,o-.b11o 00 ,, If r e to IIIt-I 1 -1 I o I" o Il 0*1110010*00* "I 1100 Ito0 I'o
M riooo IC- -111 I1 ,,'-_ -1o1.1oIoI,, -! -oo,010111I I011) ,:'1 11.0'I otl*0100 1101 1*001100001011
]"01000001000*010010 'otItII, oo,0'I- ,o- I I1 tO 0. O,. 1010 0 "I -ott .1 10 to -10 0, 10 1110 ________________00- 000 -00 -_lolool 0110010000', --00,00DooI, 1G io.0I1-.001010001 P10, 1*P100000100OI! 000.1 ooo1,t010000* lo-ot 0 0I010tnoIto
00_1 *00 tIioo 010001001 Ot'oo o*710'.O'.o 101 600 0cc de10 11g im : 00 0.,1 I I as, 0.00 ,, t .'1111 rot 0, g f ,--,- -,I, ,01 00 00000000.000.00 tOOoll 10-100 ,Iobto 10011*110111 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 1 0000100 01*0 -001 ,ooo~toooo 1, 0100, 0017010 ,,0'-11 '1 ,,,,10 ,1 790 1100,,t00,01000 ot 001 00t 10106 100010 0001 boo t,, 00100 40d .1oo alooooo 10
*0001010 001000, l, ooloo 00010*0 -0 Iob *0*11 o00110010110'.0 1012 IIInod 00 0 I00, .0 000 00.0100 ,- 11 ,loAoOOot tO' 10* t -ltotoooo1o01o1 itir .I.;1 Fa:oo

I.loli0o0 0110001100,I0t -, -- ;! R10r- I0llrr~ ,0' 0,! 1 0000 ,o o i t i toltoo'o Ioooo 010 Itotob. t1 0 I 0*00Iot 01 .0 'itoo L )-i.1000f
*00100* I"0,00*10* o. I0 1 lfr-f ft00 fill0, 11.miu 01'plf, qFf00000bo~zo ;:t I 0001O~ tt000) 0 10000* 0011 Ia olo ,o d, ho- .10 ,


f t t ,. 100 1 111 -oo~oo 0011 ',iO1110li0000001011 e00000 o Io ;00 h ",,'l d E T R o
_,'00,000I,,1,,Ii I ,, i 1. 0,C I ,0101 .11 -, 0100000, 01 1;0 1 Ai 'oLo" : 00 10:1 00100*0400 ,40010100!.,,
00,, tfi.!, it I00.00 00-, 001-00 00*00 1000 boo 00.I_0000 :

itt
10, ooo olob ,t t o o l o 01. f 0000010. ,d : I"
0000_ 1101010010 -010, lot01t 00 -oo 01100110 ,*tt 00 00, :. 00:0010 I-t ,,j I,- 2 I
13 0 I looo10ooI-, 4" 11. 00 0001 11%o11000 ,i 'I*0_,110o00 010 0* I' ,lot 0. I0110
-ItI~~1101 00I1 1. to. 0110 0011' .
00 00 ,1 00 OooI10 00 000 00310000 .4 1 I- - I A '',ll l -l, d
00-1 1 ,- ,-I , 11 I 1 1I ,, 1001 - 10 :7o01 17:t -1"t Po l 1- to .I Io, -I I I -0tonI olbloo t l oa I '01
0001I1 6r!010111000 0 ",to 11 -0-, 0000 00 0 00000,0110I110011 0,11-o'-o .00 0 f.0 _o 00 too 100010010-' b t- *, 00*100 010I0I00000*00 .I.I0.0001
I,0 01l0 i, n,- l, I0 ,,00I", 011 t'0'b10 4o 0 0*00000 ,10110 ,,,0I 0,t oI l~ 1100 I 0 I1 0 0' ",* ,,, ", ao,, ,
I,101.1 ,0011 000 ,Oilo 00 00 01000,O, 0*0000 0001 ,oo*Oo 00 o 0.0I0I
,10 01010 I.00.1 .00000 0, G:.000 :,00 010Rport i p bto. 00 :
000000010 n, 0 000.,000000 10,* 00- 0'_ 0 ,; ,; cI- o, I en e;o ,. I, a, o a ,0 t -.II o oo


I0 I11.000100,.100000010, I 11.0 0' I* I 1 7 I- 0000 0. OooO I.0 0 *00 I I I01011000-01 I00o 1 c, 00 01 000000 100. 10
000000101 ,,, ,0,,4 'l xI II I1100z0100I I00 I0 -o0,O :tlt 0I",0 o00 10 ,011 _000100 1 -d0 0*00 10 -,oooI I MY o oOP
I'lo"IlI'.IIz, Ioo Iol o oI I I- ot0-, I0000000100*0 I 00 1*00, t11 000 -60 'I,0.0 - 011.Cb, 0, O0.o .0 00.o0 .a0,

I-111 0000; -000 11 11 - II 011 1000, 11- II 0.00000 i 000000 Ooo1 lot 10*,, "l d o 0 0 1 0 1 *00,0 0
,,~it00o Ito~o 000016 I0, rol ,', ~ 0 o,'~ o ,'I fo ,o.o 1t1~to 000 0, 100* 0 to t 00 Ioo I 11 III .7
00, I ,!10101111010o1'11 1I I 0,0.00' ". I pl ,,,,I1 001 -0o0t0O00lt0t0t~' Oioo1oo.oo~o1 o1- io O-otoa.___ 10;.I-.o'oo, "m i m z

-'110 ,, ,,, ,- ," "," , l fe :- , t Ioo oolo OOot- ,Iiit VII. 0001100*t*0 00*0I0F0A0R 10.0A.C0I0A1 IS'
000000 o00110000O11o o~oooo~0.ooo ~ ~ Coob~ V00*0 01000010 t00' I 01100 .0
I" ItoO0 I0 I01000 -,0 1. 00000 I" 00000 0004II001 I I "!
,00110",, 'f00000000*00. ,' .' ,' I 1 1 0'l 000000 :I tO 00001010 .010.001111 00*11 oh 0100 0100 .10n 04*0. loy 00 '&11 ,10100 -1010' ";000 11,' -.0 -lO .f~11~ I000 01* t a s0.00001 ,i ,
I.0",. 6111 .1,- 1 010 41 -2,00If10 ,0001oi 1.1-00*11 1 1 1 1
-0 0- 11. I ,*0i010-" 11 0 ~ 0I-00001 ,,
wit-,00 0:,'- t t01'0 ,~10 '0000
"liI, ,,Ic- 6 ;, ,- ,tlid Ii ,- dc ', i, - -1, I I- 1-1 I001 1-7;.4" -*I",*
,,,, I I- -,I ,000 ,-' 010, 0, 1 , '.0 10011 000 0 ,0 .0. .1. 0 "f10,, t i.00 ,_0,3)0 0,01,,do _*_ 10* SA TA110 15 00 O
,:tl~itli-, ),, ,- ",'I lillli ,-,,Itil"'- -00,01t 0kI 10I I0,, zo tO 00 i10000000*001_100000 t--00.t 4 0 1 1I 0.0 0*-I 4000 MAR

____ *i 000I.400000R c MA'O71 'tV ,, I" ho "o ,0000 111001 ,0001 00100 61000100.11 to a**,OO, _o 0t000040000'1Otorr,', l~oo o fr' Ifi' 1 . 14i
,00 00 .1 t.o .oo t~0 0 .0000 000 000101000,.1 1 "lp f j l' .1 ,l~ ,' mp t,~ 1 I I 5 0 0
000*0000 t 0 "It 0 0 to, 000 11 do 00100000 000100 001100 01*00 O l ,, ,,- - ,Io0 0 11 ,oo .l10 'it j __';,-fi. 1-1 ,il.Ftyailq I t

11oooooo. 0*0 I0,1000* 0 I 0 0 00001 11 I 000 10000 00 100%I ; 1 I114- A yZ I~f.,
01, ,,i , 1 Oo to 00 Ott I0 0. 010 do 011 00, I I0010 01 ,,,i ' C t- N ,7 l I M

o.~~~~10 too0 ,o 10%- -0*1 1 0 0*00I0I0 I -, "I: ,
6 IlUS'CKIA-lSEYANUNC,, -ES do00*00100000000010 '-i- 8 VAF 4~0~
_,, 111 I I I II '' ,: tiI 1, li I iz 111i S, ,I I :- 7 , ,l.I1 1 : ,, II 1 i M vt N U 0 0 0
El.,- l,~-, ~~c DI O EI LA MAIN ot I00 0 I11 1100 -10 .0O1 IROM IW IN :: 100 Imo
_______ ,______ "I____AII________________ ________-__KU)_ YSS-ve ___________0_ 10 I1 1 0, I 1 I 1 I .








Aclaran que es de buena calihad AANiIT1JNNCNCI 0S C1,A SIHtllC AIX)S 1)I, it 1,tutM A ft()R A

el gua que, consume, Lat ilabana ______ -- ----- --- --- -" _II
I~ ~n~lIqrn. I *- it l-C)l PH O f' )N A CO E S M P PA5 V EN TA S IVENTAS
.~~~~~~~AV AM ~ I A -) --- "_ --- --
4 d.i fe0 t,1 tI, ,I k K U O A S IF T .i .41 pRV? 1A 4 I44 I. 411 A
onIntrw tx u s opae ltAi At.nar~m 1AAA ,.AAAAAA: yAA -1'AAA ,.', 1,:,.A -AA Aelt. t:
*A AA AA A( A~ AAA AI h,,!,AAA A ---AAA -( -AA -~ ---A - _AAA --AAAA -AA~ -A A A AAAA.A- l - -t
Av __ _ _ __ _ _ i, ,ALAAAA 'llA "" ,A 11 1 MIt Ii I11"
1, *A A 'itBAB AI K~l At*) ,",," II AAAA-d *AA ,A ,, IAAAA A AA
AM4At"" MAAAgAA (At I( IA A A AAA A ~ A At~ (AZ (I ""! ,AA ,l At It A Al 1 ,
if.~t4A~A tttttlt Aol. He At ,,tAAA A A inAA A,, A ,A WA _M AAI A4l I -
AAAAAEA AA AA y* rptbtAAsd A(AAAAI Iittlst M A i, 'l' ,. I - - A I "s I; ^) ,,,7 _.76; 4 iI~ r ,~ ,I i i FF I ,

itA -44 AA A I t( t(l Att A\'-1I, CA I p' M S I: l. ,,,,' I 1
AtVAA.-actrIog Conti deIA MA AA IAA A IA I.A ,l A IIAA Atl.1 ,, t.

,AI A:Ie- CAAAAi T, A :A IA:A A IIA A A I A' I. IA A At " "
AM~ ijhltit t A~t W R E 4 n- 1.AtIA A A,,AAA E -' A A AAi ,A A stAC- ,IAAAAA AAA D A ._A. AIIA I -A ,Al ,,II, I I, AAAAA, AAAA, I_ AA, ,,A -t t
At ies t,~ ."el AAAtumb AAA AAA:,6n tprttl AA.A it- Itr~d ,,,,,
(AttM~I ,AA A A A A A A .A IA A. At IA~ ll tA I tl A 1 A I" I A l I A
t. I d 1 id. 0-,, ,.tl (A, ttI ,Ii A itV (n ,-1 II "" -- -.,.A~ 4A I, (AAAAAA AAAAA Aoi~id i- -i' t (AZAM01t-It A1i~id' AA(A CA" tC N O IC 11-1 -M -t ,,, I t. ', t A t MAA(ARAA(_' ,(AA-A(((A(A At AI'll tt t r1j1D A tA.IIAAA A ttIA .AA ilAA
-.~AAAAABA 'rtA IttA.A (At 1IAAiAAA t A (1 :r~s Ii AAAIA Zt t-- -I-A . t ~ -AA4A4 AA;I:AA '_ _11A4(lA -AAAt I,~ 4~ AAI A ~ ,
(A~ (tt~tt t llAA UAAA t It 1 A tAAA A44*A(A O l A t AillA At A1 At A A, - - ,, ,.tA At. tt ItA: t t I4 Ar f41 A. A 4,. 1(4 91 Arl 1 11 111 t it ItAA A. .1AI .A4 LAAA At,! __ 4 -A __4A 444li C t A tttA AM At A t t, ".A:A lt A,,,_ AIA A A AIII ,1: ,l T itA t ;Al IA
'1t 1. AA ,I AA AI A ", 1 AAA( (A AAAAA (4A I "A AV IA Al At A A; A, _l ,~ lt 41 IA.A4 'A t AI :41 A7 lt At 1 "

((At~~ At- AAAAIAI1 A~ ~AAAAA I (. ltt4 AIAtA -AAAAAAtAA A hlM ,1 ,-AAA gt~~~ DIITA AttJ I l>I IA SA A A lt A1 ~ lt I A 1111'
-1f, d, vt 1*, ____CI_1-_-_____________I -l ,I 14 At A.
At~~~~~~~~~~ .t tA t II'AAAA '4 AAAtA, -,AAAAAAAAA4A "tIA At It ,l~ t1t A11 tA lt AA( 41 : 11A AAB tA I,
AtAAAAAAA X(A t 'll",AA 44 6, It AAAAAAAAA t""l~ ttI 4A4At l II4AAAAltl ttt ,l II A Att IA At "~AtAA t. I I AA A' YJI RE
IA4 A A ,1 -A l A. IA IA l l I44 1 1 P l"l, *~t IA A A A A A A A A A t A , ,,, ,- I , .
(.4 e is ', 1 tAAIoAl A44AAAA -A~AAAA tt tt t t lt A -Il, ItA It At, Ilt A: IA At A
PRAt .AAA taIAAA tl ltmt-r lA IA Il~ll lt-l IA A 41 r (At r A II I tI A A. All z it Al At IIA A ,AA AAA R11 UAIN- 1 I I JJO, AAA-AAA4 1 AA((AAAAAVAAA.A14 AAA Yt It A ,t AItlt AIAInl At" tt, I ~ 14-0.14 AAAI tA I Al ''ll IIIA. At lA AtIA ,t, ;7A A ,.AA A l 1 1 tA 1- 1 - t AAsg i Ate l A l, ,I A t II. n A I A r 1 11 f M t k -*1- 1' A lt '1 4 -_ A -AIA N A IA
i _ __4A AI" AMIItA tAAA AAIA ---t 11- AAIAA IA- --t- IAA A AA IA A I 1,I At A A tIN
A .l l 1 t o , ; i d 7 8 ) At (t. n -AA I -~ A A A t I jtA llt A9 m A M 14 -1 1 1 ll A i -1445li --414:l
tilI1 eAlb~i"I l- t 11A 41, 1- F,~tA AAAA (A ; _i ttI I An-ttA -A -., At.5 Al AIIM: A I 'tl At ItI ,AA AIA l l . . . . . 4*.in4 Anr d -AA At- AnI" A(: Atl 1M t.1,AIl*l 11 tA. ,
H.II I 't. tt' 1t A ti b Alt' """t (At IR A IIA AIAI A l 11 1. 11 1 p ,A1"' lA: tA I l 1 ,
1 tll ti Iiri le.,, I, D t' i ll "" MA- i At,,,- ,lt ttti A ,t IiJM 'A I A- At ,, : AA.:% AAA IA t 1 ,", 4 I.- t AlP t
(AMI.:6 1,I" fA I tt"" t 1VA. ""AA;A4M44 I t ,A4AAAA I AA.A- hAI- At ttA: IAAA A A. AA I "I:"".,"
3~tk 1~t ittZ4 At AAMAA (At, I t t-ll t IA4 A A Ilt A 1AIIIM All I bt1 AI1Il -1 '"", A IAAA IAtliAtl
ld.t"",'t~ltttttA ,,,,,,itttU ,, iptir- Al t ,,, t Al At AttA t.~l 1114 PAAI ,,,~1. l"t It "I",4 4 11* P
I I i I P I i 2 I I I "" I . A A AIAA 1l1~ I't I t, ,,
te,1 ah~ ,pbi MA MA 44 ttt I t SOA R 1lt :,,, tlA .: r.fhi. 1 1 ;
"l t1A~,Qi il- I I'- .I I id t r, ,, t II A A, fI- 1i1141l Il lt I N A t( -A A. WAl12 52'
li t4lp id i 11444I l ,.[I I i Ilt A tl A IA I tl ,: Alt '_ ,," I" A : Al I I Al- _,_I%"" l (74,, . 1 .
X,"lA 114 "H ~ """.22 ,, C M R V DA O 7 fI" "" tAlI ~l Il't
___,l t didi ,,t 1 (4, e r sa b er.,% n "" "" t k i- M R 4 J.O E I I2~ O t I l, tA" lll AI""'AI "AI,"At,
AtA~ ~ I Ati llIA. At AltA All,
flntl"t: AAAI. k 1 1 -AtA ---9 -,," I, I ,1 1 I t ,
t," itA 1 9Ip ,,lA ,,- ,ttI A I 44*114 .tttl t I _______,____,___-___II__I'tlt iAt At (t~lt' A AI "l iI5t 1 A(l A t R Jt4 ItI. ''A 't t~ I 411441 -1,111 -11V"t1A .t'AA At, AA (414 t- Ithid AI~~ A, p tp ", At i. de co un sm I I41~lA AlA tit "I Al ---I
ItA t~ AII t AA i' ~ I, ''l I J W It I ,_ A 11 '111' ,,: I A A
Y At AMAIA U4(In Ae NorAAA All l(IIAy114"tA 11,;Ai4At-MMl i" i"I'-Al. "'AM. Att tt1 1IEIAAEA Vt_41 ', IAI 't' I x4h,-($44444).
t ~ ~ i htttt .v- I A 4 I I'11(i, 4I, I I ,' ,.- : r 1 ,l . If",-- 1.1 , "I., ,
I'll,~tt~ttt~t~ __ _ _ _ _ lrelltn ',11 ~ ___ tt'Tlt" ,~ ,A 4I1 P I 1XAt~ OF At A
.,AA A, ,AAA A A l., A-A AIA Alt --- A -"" IA, .",- I" .I" EAtt A
I ttAtii 11 ii,'t" AIM ttAA4AA"I I I I I'll 4A AIlA I -t A A I tA 1tI I t ll,(4 444 IA ,1*. A'AIAA' If, 14 A At 1,1'I~tl
ill~~~~ illAtt Al .114 (l, A $V44 1144 Al.: Al *~At (At .II 1 1 N $1
I ,i t 1(A' At AAAIAA, jIIIIri) IV I A A A, 41_: 1 AAltttA
41 41144 M ttt ,,cAAA l A ~ l A Itl~lA tI"ll' I, A il 1. At'A A At I tl Itttt Alt '.11 Atl.A A t. A' A111 A_ _ _ __ _ _ a,A'tA.'AttttlttAA ;t '-"t t 't A $ 4(4411 it A I A i~t -AA" ,llI tA -A I r AI A AA It- 11"t .f-- 1 ,l ,
IlA ,~t A IIAA ,_~llll Alt A,-1 itAAAI,, I,-D 44E IS '(I4E5It .
AAAAAAIA~AAA IfAAA4 t l At AAA I lA fAA AM t, IIAAA 411-lAAAAAAII4A-,~t
l~tl ~I"A 'Atlt- ,I' Il A"I _?tt A tt1 1(AI"AAA AA l1141 t~~ 1111 1': 1 ,t, :AI I il l Vtet; "ll' t ItIA A-1 ::lt '* ( 44I4 N I J I "' .",, ""AI t .
__ ~ ~ ~ ~ A.1:I At (111AM tl kAAi I It A,'"' 1 ',!_I ,, I I 11 In. ;,AIPA4AA1 IM~ "AI ": I1 -11 A-A--- IA_ A ItAI A 1 c A IA t,,", n l t. : t_ a',A (t. AIt 1"
AlA ll 111 A I IA IAI AIA AIA IAAI1(A AltA "ll IIAA IA AAAAIA' l I AAAAIIIAI AlA ~ t IAA A. ittIAAAAA. ItIl ;l-IL fAA .AAPIItt I'tl l,, 41A- i I tA 1141
At,7n, n; (4 AAI I'll l- ,I I Al All Al AM ItIA A A I Att 44 t11 ,tlItf l Al l t tl.lo A I g'lg *i4 f 14, A I .- AII A t
At14 (-A .(.l-ii -AA A-A 9,IAlt tIt ~ I t, ,"t"1 t;'t't, %I.,
I t, I, A I ,i "t 1 1 Al til 'I I tlt
At.'i- ''' At- I 1'"41,- 1 441,. At '' 14(4 t~ Alt Al AI I itA AV N, t- 1211 htl .,, -- t 2l B, I IAIA It' t, 2 4414
F e ic ta aAIAAA "7447:4"ii~t?",I' I t
tItiIt. -l~~ Al AIAI A. 44 AIIAAAA -' .A tll ",A -f -I I t 1 A At, i
,,,,; .3 3, - ll dt i. ., _' I 1 h o, w l ii r ta itt :,
Itta~,I I,- 11 i' 1 -I,-,,,- HAVANA, I 7441 RE Al
_ _ _ _ _ _ ;:!eA A IA "t I AIit d 1, 04f A t 1,A M t.t I~t At -t t1 A irL E 2 2 ,E E C P D M A A A A A t 1 A l A
Batista~~~~ ~ ~ ~ ~ ~ po l -,,AIojzt L -tA ,d IIIIA ,' IA A t '41*11 ALM ,tA AIAAI~IAA1", *IAAA l l ______I_____________._I-15
,,, ,I", til 4i.411 (All _l~ At(M t t diei p zloc i I ,-, 1t14" t A A t tAA ,t
;_Al At .:% li I (I I ,A -t l_ 1- 1 4A A-I- AIAAIA (l,(4) SU XE I'' 54 A, Atit -.ttItl It- _t -~t 9 " IAWAYA '
,21ThA D !l "t ,AAAAA MtA"4 AMA -;--t A IAI *4 A""I At141 l, j ,'
l, ,l ,l-AA tA4IA(IAMAAIA 414l tt, I t, vu ""aAIAA RotoAAAA I -, tl ttA ''l 41A tA~~t~
4441441414, A ICAA 'lI 41141 A j-IA A tA t .t. .~WA JsIICI A A tI A x $10(W AAit
iA At-tc- f A14, At, 4AAIIAA AM Attl I tbtt ltt IA Atl tt Al -4 It t At t. 41
It4 I 11AI(AAAIAE~~A
j~~r-i 1- n7'_-; Al1 Ill - '' Il- !IlIllt;lj -n 0 AttlA 1"'tAAA AB AAIA')"1V, 2 t ------- 14__ _- -_ (AM'
Al.' 1)AAl eAAAAt IAAAIrA At At AlAAAAPE ,
l, l;,i,]"-'-'I~t "_ rl4rA'A;eA I 'tllA-B-A, ,, t t -A A I tlA ,. I1,144!11.1tI
6, ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ I 11111114 6.l AAII, IIllII SAlO VU RE t_ 11'e _,- ~ l,"l Il' "'"ltT1k~zS VVAun q i r a" AAAAA,,' ,.11 %'11.1 I "tl, : P A,- 1All,
I1 11l zIAIIItlAtA 4.1 t~l A t A A ~A A
Itt AllD Ill0"AlAA It1M T - - --t- - --I' IA-t -:44 "To,~ttA t IA- A, Alt., IA ,
'l 'li IA ,I~l AtA- .t AAAA t' A it lA A4A$ IAIAAIA00
d,: -141 IAi AII fPIwt ItA It Al ,AAIG $1474 MAAIAAi.IAA A 4*14

D IA R T O _,A R N a,4AA.44il A 441 I -tAAI.'"" I "I~ AIAAAAIA MII 4 A ll RAINT 114 1 4114 AtAtI M AAl1tl1_b41'I IAAIAt I, A- AA nI MAAAAI 4'N IA llt "' A t__- t,-tlt.n.IIA: llA.AAAIIAAAA, At -AMA
I,, Al-d,, AM .~t ,MA AAAAA AlA .1 lm l~l : 1 tlr. At A_ I lt _ t
I ~~~~~~~~ ~IIIIA 4 ,II, Il ltat_ -1 - , A t
A- _A A I44IA A4I AIAItA I A A l A-, tA-1, t 441. Itt t" l
4114 t,41 ~t I A ,:"1 t 1 MAI A411t At''A $3000l ,
AtlI1I1t1 B1ilr!l1 IA 1ell tIt~t AA t tM AII A lA Att ".li ~ AA IA A -15tt~ LE ? Y D D : $ 2
Al il- (Al pte- MAAAIAA l t ltA :AAA M '' A ll
I - I I Atl; l t 11 1M 1- At- ,A AA~AA I -- M ,- I41, [,FfT ] 11II 1If "
Al. M4IMA-i tIt BA'"~ lAIA IIIAA 4IIIA l ~ Alt II AtIAAAB IAM '_ :'A A tInt ,-A,, A- MA: "t :4 ItNT 114I 1. j-'t. --At -AA AAIp4v41AAA wtIA A I l Al (A AM MAMA. C ,MAI- 1 IA BA. 1 t I'll"tA AIMl AM I AM.1
1i Il-,1A1'litlltlCAll t-"i" AII A Ait nt lt All Atl, BA A t, A A,, BA ," t't AM A, I2z4 ,
dia qu" T ShIW1 I n d7 Ip nt me .tMAI4 -, 4AI II',t'4,l -1A1 I .1AA
IAWT11 ,"" A At ,M A, It (M ,tA,
-tttrtjA~tA mmiMA v IA,, i t ilt tAI 1 ll44 Al It tlIdl tA AMI At AA l'lt ~ .A t4A1AA44r4 JINT -44 (44.444- AAIA 'NTD A Al tA REST
P(43,I_ -I, 4lll.lAlltIAA t~fIlA A I AA AA AAAIAAA It 1tAI.1' A11t114M. AAAAA AAAl0AtAt
I( -1,ttAt IAIM Al t AAA tr 14 ,I4A MA tA I, AIAA Al 't Il~t IttFNO tV-IAAA S411: :A Z, 1,t6,1,"t ,t
IAIAA l. l 11 I IA AM A .A I i. ,A t 6l I AAA AI M A I(4 MA A'A1 444 I'l 4444;1 1 i~ A t ; 411a A Air
Ill .dn-I ' I I I I ,_, -I'l 1A Al- AI At At l t t I AAA ttttA AA
t lI l --- 414 A Ml tIlI A.AlM-"A, l A G U1l AM R 20 1411 ,

flt~t. I tII t .t At. I IA I '"1 H A i 1 ,W0 M I __ _t p41 At Atom At:tal A A II A 4 Ann- i
I-A I I I AAA.A 4 A -AAA-IA:I.,t, A",A. A I ,tA tAA 4, ,_4A~t~ MA
dlItiml.lI ,,, 11 C II ,b B MY A I A111 -1 ttA fB :%, -4 At At i, tI -I Al A 1,,4 t A l i 4 At A A BA
RAM I~ I 11 M I Al At t ll t. I, l At ,- ," AM M ""'! VED4 >Q IA VAi I At 2~M ,AM Hiatlt l
'I l l Al' A blP t-t, _ At I 4
I, 'd It Att tA 'II A I t A M A I Al t" MA,, At ,A A A hA
Ili,~~~lt AA AA AB ttAttA.:tAA 44 MA (tW i ,,t,, -1 .I 'IfFtndAA3 rA14AVAVACA A-60
p-h ~ ~ $8 1 al em e tr At AM t~ AM Ai AM,,3,3tt A1:M AlA, AM. AAAt 111114, I t t tt-,- ,ldI -1 ,11- ,n1,V
A. A t AAAIA'A'A AA 4A lA4AAAA AAA IA At1 r-: tFll At AM Al. 1t, -tt II AAIII:0 i1,1- i-, lI --78 -82

iucis it "~ida ,e ho zr d, (tA It AMAA 44 t.,M AA N M ,10044 t I

At, I 4 L v AAA44M t I__ 4I I .t At IiA Ittt, Alt, .~l --~t tt,
43 tAt IAA~ A AB- C A tF ABA DEOA A l
A., It AM 44~i BA IMA ',V l ,I'" III II .,4I I" l i At
(44AS B G S z 111. o A .T) U RE ,3 2 w ,' i NI. ______ l" i 1 011 A tAitA AA
PAtAGASt At bA At ,, At ,,I-'rt t I AIAAIA 13 ET

-,t't -t M~A A I l-et At l AA 4, I Al A l I A-A,- A,-AZAMGperDZL U AD I 14 ms 4AM MA 441 ttf i A, 41, I ttAtl
_ _ _ _ _ _ _ _ _ _ _ I tn 44 Al 1 2I 4C tA I I, A: :. A M M It At r n',- I
A't A VAIAA 0n rA gt It. zt I A I t Mt tAM A A IA A: I bl At A" A AM ,- t C
A t AtM,,, I ' A t I : tl -,, AlII N.AAAI Att.1 4 IM A '"






PA(JNA VEINlklS DIARIO DE LA MARINA -RMRIES 20 DE SEPT DF 1949 ANO XV

ANUNCIO S CLASIFIC Al)O S 1)E fTI MAA ifO RA

VENTAS VENTAS VENTAS VENTAS V NTAS VENTAS V NTAS V ENTAS
s cASS aII CASAS 49 SOLARES 4RE So FINCA3 RUSTICA3 AU VS ACCh5 S3 AUOMOVILES Y ACC 53 AUOMO A
SAVE RANCHO BOYEiob wo

LASA FN 1I1. 1 $13 $0nr_
$20.00 VARA, VEDA00, .

cVa o, Precioso Chalet .I.
C1onruc6tin de Primera A (F r
oo "Terreno Vendo $10 00 Vora rt.
PIIoodte GraNrto JORGE GONZALEZ e~
VADAD IAR 206 M 78

PARA FABRICAR

.~ --- .AN -V TA A.V .

RK UN -. 1K I oor 4 I'll, 1. 40-11 11 n th 0 porto lu
Ti1IILO It Iq~ SOLAR, P4NRCEA keg
111;8111A DESOUPI'X)1k RFP1RTO 1105T A RA1. oo ut

18081A 1146 IFICA IESj SY FFi TRFCA VA (AA I eal I }tl( luit 1 1(.1111~ 1 A1I kT R \nue at

12. Aprend as Mane ^ ne
F 18014 Ieou d dnor, ,I .

.l. ""I te r

Ou N 10 ndo S N7 I "t79V91
an 1 STABLECJMIENTOS,
T1 FoFo R$ 0
unqi~~~~~~ag~~ 0u S ":." nowne O E D U ES 0
Carro 'I da, Runcho oeo


11Fll)I7 1 1 II



pA Ir n dd 7= illQle
GQnuDO 1 0 1\6 \ 01QtidTr

EDFIGO RENT
HIq t lA111 m.t ( 1 IO PO OI1R80) TU 1G A3 G(A
PFQLFOBAR1000

GRd BODEGAr P1030f0 TT1


POR '(11, U"I8D EG4tc C4NTINl 1 L"U e

80DIs G1r Ai0 198 119500IO NIT

111 11IC BI SnoonFDI ECGE
41rui a ion e nts nTT FAIweESD A

m N IN F- C_0F1-1 ", per j e ana eario


GRAN




perto operarlo


y CONCORDIA
VAOR L2BRE
U,~~ ~ ~ hea, rol. 47lsBar n
Oldernobl 11. f relntim


Ru7 STH, sham

tidur B tanan labora1.6a
"w"~~O II 815.I 2,l:U25
T 10 do 0.iPmnnellLHD 1 D1Gl








tl4MI BEAH O MINll

JUICK JL RTG

9I1 Harin A-he- 7 tD
2 ~ ~ ~ ~ ~ EDZ B EA on L 0 49 oo-ontn
01mp 115,l i ATAEf M I ,1,19211 T0 00000 R000 A00 N 0 00 0000 I000000 Lo00 00 00000. 00000 olit ooo A 0,00 DW Icu-0 D0 E0 U. S000 0


























AMP AL EoAE .1a.1 m r q1 n 1 -o
f,111, L~ft L 1)>I 0 1)11 1 H 1O1 F 191


BUIlK Suot entr8 12yI 18 1 ee o 25
E ~~ ~ tn~se Nn WOE sosa" tl .1,-.12 t,2, 6an.eoO 559hollxio p~
1 0 11) 1it 1,449 1 1 11 F I I R
(Ill,~~1111$12 i1t0 N U O E V pao 9SD~tt ,L


MENCASAS YIA REilNCIA
gurci.t.a de usevo CHERL V ROL T 9W (uoSnF~ioy2

BELL 005 Y ~ 194921 .-Au ti
Remc aidnia ahOLS EOOLE T 19urrn 48 11ER4 97FE 2 R1 194


F IN CR O L E 4UT A p t a d elt c o8 ( H P1dli f_ 1 9N

OLDSOBIL Futurarose 48o
pil NO 0 o a P L ET 1911
? sr s aCHEYOLET 1948, 4 plus. EARD0Ec S AUNRA
I. (HElROLFI 194 BOA10RR ROl)HA Piconeo DIE SOTO chDAN, RADiIO 19 co a 2ema9 OLARES 54.00 Ilan .23K ru . .ggsPowoa n 1940
p00 85, F1,QUIT REC EO-,l PAC 14nD 0000 0 000000-0939

a h. b- S7o0 prese IoC m c b e 3 v C
e a V oo ENDE 0o des d 0 c__ ,_ 0411PI IA0 Fif lLIDADES


Lell 11Rll CA RA C :RL F1~~r, LIU:A O y nJ e a p
Informa 3n ine al m4nn CH M OL 1949SA E II 1 fe uiaa i6 I no Wcanl.- ""t, PEQ EN FINQUITAi- ACAR 37.o o otrs a m as' ou Abetn
C, ra ROBERTO FloClae ARO AYSO0 53 AUTOMOBILE T C E IN PA T DaE P F4f na aP 0 pit' 00 0 0 00 0 0
f.~~( ro Ill 101 Ann 11urERAIIIIW.I
1.00.00 SE VEND r iaost do-or ia Sm--)S














1948 L1 1948 ARIO INM
AASCOTRALE Ait ESCGE Yt aa~npr
RRAMS~AILDAE DE PAGOEO hiiiA t
002 0 ORAL 0AY, 0 EO ERA V A U000000000.0000000,0000D CLIERC00000000000


0 0EM00 0 Bara

____ Ro___ _CHRYSLER
I 0N A110Y 10 70 PASA00TER00S00 0O
00 0,000000 00000,0 0 AI_____ EN0,00,0/DE0PAGOIfu d, aBUIC 'AISTUDEB R 0 0
00000000.0000 ,0,0000F O RD0
o11'11r 5355oo00000000 000000 0 00o~oooO 00000 000a ~ A1QIIA 0) ODODGE0.00004

000b 000000 00o0000.000000.00 000. 000000 0 00000i00 000000 OO ))o000CA M ION ESo)~ bIooon0'I 34 000 000 0 0.001000Do.oooo0o 000000000 l~~oo 00000Ann,0000000'0000 0 000 0000, 00 p~HO 0000OFAR000G00O







_______________TOL5000
____________________0000 00000,000000000000000 000 0,00)000 0)0) io~oro0o ~ 0 0 00000INFANTAinOONo 00104 0
__________________00000000 00000, 000 0, 0.000(00ntre San Francis0ooo y 250
0000,0 FL RE~cI LIZ SOAIN0 000 00 00000 00n000000000a.20000cuadreo32oode3S0.0L000 )
CHALT 0000000000 Ooo0Oo. Onnooooooo00100000000oo, 0eso0 0 s000
0,00 0 00.00 00 0000 oo00 000.00oIA 01084 OotI00n00O0~ 0000,0000000 00000 0, 00000'0.000000'000 o~54ooMAQUINARIAS00/0
0ooooo~oOOO~ooo 00000 00000 0)nodo~l 0038 0n0 00000 00.0.0000.00 00000000000000000in0 00000.00 00 0000000000 00000000000 0T00.ITURADORAS0o00
0000 000000000000 10,0000 0 0 00 00.'oO S ISASIOCIMI3fl0S 000100PULVERIZADORA0'0000
000000000b,0,0000000000 PL~O0 0I)80000)bOoo,0.OOono non 000000 0 00 000"LIPPM1ANN"0000
0@ Moline0de Piedr
000,000.000000000000000 0 deQui__ada___PiiaIIyu11sr.
00000000000000000 90, 0000.11 8). 9' ~l).8385 00000, Oo~ooo 000000000000 4R illo FLIneve A8I.
____ ____ ___ 0,00,00000, ___ ____ ____ JOSE DU@SEnt0rega inmediata.n





V tmoIf c000.0.0000" 0.00000,:13:"?? "V 1 mcms _ _ m_ _2





A10 CM MARIO DF LA MARINA. MARTE_ 20 DF, SFPT. DE 1r)0 I PAGNA MM M
:



Al N 'U N C V0 S C L A S I i F I C A 1) 0 S 1) E U 1, T I M A
-,-,- 111.1--l'.-- ,---,---,",--"--" "",- -- I 11-1-11-1-111--, ______1 I - --------- ---,--
__ I 1-1- -_ ______, -- - ------- _____,___, ,__,___,_,___,_ __-, _____________,____
.
V E N T A S ,' E N T A S V E 14 TA 9 V E N T A S V 1: N 11, A S l NNFR( ) HIPOTECA A T, Q TJ T L E R F 1 A 1, Q U I L E R E S
-___ - - __ _______, _- _____ -1 . --- it - __ ____ :
t I I' l l
ii*_____ - I J I N A 2 PA ; 't 0 YOMOVILF-1 Y ACCES, 56 MVERLES T PRENDAS I M I A I I I E I ft I I I AtY- I I E CW I (Wli 10' ,'APiW, ,. ( FF FTA.l t 0 APAP, (AslVIft0,'; I Z 2, A PA R TA MENTO,
-___1___ _1_1 -____ __ ___,_,11_ I IS-111-1-11-- . - I - --- _,_______. FA RAQ
APROVE I'll".-I. .1.1 111111"I'l,"I" , """ ,,, ,'l,,;,.P;,, ,o,, Tlta()i S ANIT II L' l. I I ,,, -I 111-1-11 ,l-.- --jl-,,I- .l(,I1,I AlAtTA-'4A11F CANCk ", "" _L "' "' ,,, "V""'!"t". ,l! -,;" I 04LIWIVNI1,111-11 _. I I I'll I "". "" _-l"t, 11 I I 1.11 '11
"'! ";!, ', ""I" '"', i ,, I ,,, l, ,,, ,
,,, ":, ,l I ,, ', l!' ,,;, I --- 111-1 I I 11 I 11 11,1,1- 11 -" ,'ll 11,1- I "", 1- ", 1. I I .
T Pt- l.t--0 1. 1:11-1111 "I __ l :' I 11111 I I 1 1 I 11 1, - :, :1 I "" _w '1), 111111-, I ii" "t 1 "I", "'Ift-"I'll"'n, I" 1.11_1"i,1 11', ,, i-- 1, I'l- ,-- , """, I, 1
14 d, poIr-61,., e. j- I 111-1111 11 11111, ,, ", rl,"'., 1'1 ,';

I
"I'll 1-1 I I "I'll, 11 -I,--,' - I I i I I 1,1111111""I 'W """:; i "" !"',-l ,4,,, 'I'll, I - ""i 0 1 l ;

l " I "', i'. ,
P_,: re".
f. 4 l- p
fort"re-li'i Call j (t ",,,, ,,;,,,,,""!",* ,11, ,,"",. :,'. %-4: -,,-, .-, ,, ,; - - "I., DO R TA v Cia. Iii7wii -'' "' i- i -, ;,i"-"ir ,l I'll I'll I -T7 ""' ''I .r t, -1-1. I I -- ,, 1-11 -",,-Iltl "' ,,* 1 ,,',l 11, 11- "I 1 11 :l,'11 A lll 1-111111' Ill, I "I -1111 -!' ,--__, r' ,- ,,-'I"; I Llrl.

Inforildro I lil A" -I 11 "I'll I-I I.",", I i, i ,_ i ,i_ : l, l, I-- I I I ,Ill, I'll ill, I ", i'l", , , 1, -I!,,
", z': ,:: "",." -l "l- C_, li. -1 I'll I f , , ,. - P-, -P" I _- 1,", ;, ,*,*, i l,1 11: 1 '1.11'1_11_"' ;', ,, " i"t '' ,
I __ "__, ., ,
M-1454. 444.%. 1 1, "Ill 11 I "". "" ,, -- 11 I'll
1 r" ;it , CHISTINA No. 433 "';-' ,,I'll IT- -l- 1 ,,;, if GIl", 1.1r,"- A i "
i-n HAQUINAltIAS ""l-, 1-1 I., li I "12 7
., ,,, I,- I "" ----_- I Y16__ l I -_ ,
1' ,', ," ,, "' " i T I.ioooa A4"O A-4233 l' '- I""'!" ., .,- MSTWMSTMSOVM , ,, I-AlIlt, -I1T'1--'1 f I. _ __" 1 1'1 _,= 7
-, 1, ; "I _____ - -- 'Itf I I ;It,, 11 I "I'll, ", ,,,, -- I ; ,nl-,6. it ,UH-B-5422-54-2 I "t.,, ; __ -- I'll I'll, -,-- ___DK -1 111,, I 1) h -1 A I I 1, 11 --, 11-11 ,
1- itl- -- 'o-, s"a jR_1,l.o.1 tj'r 0- Do CT -1., (lo I _', 1 I"," -1I I., I ., T'll" :, ,.", "Ill
I 11 -it", -, 1-l-l-l.,
I o l, -r "I
I '. -d,,,-f-1'1-,, ,i_,_ t,--' ENSLIPANZ S ,1 i" i I l, -,,, l " l' -I --.1!-,;;.P .,.*;.rayr= MATERIA
Francisco Mestre Jr. , -_ V T;$ N. I I LES : 6-ensacionall ','" ,,,,, ,',_ 1,,,,,,:,.- il ll, :
I "". -l. "t- , ., ,,, InW oir AOFFSOPES cF:ftA0 ocki'I'l- CW 1,41111,111 ', ', "', 11 I -1
,- dI c-lapa. 0. 4 ,.,I ;, -F -11. 1 -ij- P.'--1,!7'1 11 ,,, DE i I 'i(*eco a law at nlol _, _", U- 31-st - "'ll"Ild I __ 1- ,:%, I'!- -- i
I 1111t, ___ I 1,1!1111 1111lll '.
I -- 1010 AVISO I PLANCHk .ol, .11! 1'11 11_ltrl 11-11, 11_,", ,Itz j-, -!_: __:"_"_::'_ ,,l ,"t,'* --- -_ _-____ -intrutt, do I 1, COHSTRUW l I S I ,ltl,, rtnu, ,,tl, Nutvo
(I Ill ,; i, :i
IBAN PAS "I Zlt; "'I'll" i ,,,l !,,,l,,,1_. t" ,", ,,, __ ,,_ "'It. -- I ,,, " "I
111, t,-I t, I 1- 1-1 - ., ,, '. ,-,,,_I'll"I'll 11 11 ,,,, Vt--111 111 ;-i I - "I'll" 1. It;- 1 , ""'
1 - 1 1-- I Ill -l. r, I , il "", I I-,,,,,- 11 11 .' _,'_ "I" "I", 1'1 I "I ll 111110 11
n ,,, 7 7 a! T-1-11 1 :-, Eli "LECTTtICAS DE i ___, ----------- _,___"___,i!. T_ ,_!" 114.111111-, I I", I I I 11"
i I I I'll ---,-,- ,--"---,-,
"' ,
Ii -1111- I I "I'll -1 "I I i 111. l "I I It". I "I 1-1 I -- "I , -;Iiq _W---- ,,, ,,,, -1


I I I I I
11 0 STRONG -1P. ,I, '11, i i I I 1- __ -111,_l,1_____' 111''I'l I I, t-,l ti, i .- "I I I I'll' l1l'i 11 I M
o!, IP-1 111-111111. 1 1-, ,%, '11111'11111111_1 1 1, i/ -, _--;,-I'l "." ',, ,I 11111-11-1 I I 11 ,-- ,I,, w, 1,11 -,
l,', ,-, ", __: "l I y A i () R ,-, 11-1 -1-11-11 111111 .11l ---.,_ "
jlli -- .--- .ll" _',,l;',l" :,l1,' ;;-oll, ,-llr lzl, ,,,,, ,, ,," , ',:,",,',,*,',,',,,,' , %1" 't I ";; ""' - -- ,,, 1, ""', -.", ''
0 P .1 I 11 1,11-, ,_ I "- I 1-1--, , I I ,,i,-,;_ i- rtirr;._,lrrA_ rr'v---, ,,, --- --' ': ,',.' 1to-l-l1 1-1 11 I 11
do Y.", %1, i ., I lv% I EFECTOS "' I I'll ''I I 11 "'.-I, ,,,,,,,,I, 1".
I I I NO AHUMAN NO Q17MAN.' l l ,, i, f ,- % .1,
i__rnn_ ,R(_"n7 i lo-" -!o ,j-,o-, "I ",' *1'_'11_ , ", ". I".:"",, "I "I 11 I 11 I'~ ,I o, "",
VENTA y ALQUILER ; 1, .1- I1111111111 I '. i ,
I _%, ,_- -- - SANITARIOS 11 DEJAN LA ROPA IGUAT, i 1-1 I'll'', I I It 11 11 11,11. '_ -1 I I ,, ,'I w :,l l ., ."ll"
1- I ,, 1, -, I -- .--. I I ll-11111 11
.; -,", . 7- "'i" )I I k, -, t -At:,"t il i ow
,, ,l_ 0 1 Qi Vft0VF','( tA W ,:, !It I,, .r, i, ""o J; o,
prodox sin tompotoncla. 1 17, _TF I)E ,r11,70F;ER1A M EC AN 0 I t
I Rtaf;l, ,,, ;li ,:,, ,'I,,,, p;I till ', ,, ,,ll", I 11 111111-11 I i 11-1 I 1. """, -i . 1".
11 1, I 1- , I ,, I , I l" 11 "", It, ",%'I 11, ,, ,,: '- ",
Seriodad y Garantia I NIODEWI lj I I f tiIh) riim, I I 11- ,- ,,,I,,, i, --' T"'! l , I i i I ,,, i ;- 1 ,,, t :, I ,
SEGURAS ,_ !, l' $-I I; 11 I 1 I I I I I 11 P
VIA BLANCA ontro Ju-cin 1-11.1 ill, I '. 95 11 11ot Kt ,, -, Ut-l"', '!;,lJWl, I I "I 11 --,,! I I I I illll "_'111 ;1' i """"t, ,I', "", P.,I) I v (c f o "W" t "If'J'-'),R
'11 JO X-I'A I r, ,,,;;! I, l .1", ,,-.' ,, I I ',V T,:;mn, In '1'1111 1,11111 Ill ll "
,- "'t; i ', F ;, "l, A': Iillil ,,',!, *;" ,.,f_1 1'1_ I 11 I 11 "" ",
Luc,,, I ,,,, -""_ , Alam n fle 4 1 , "" , --,"""', "i", """"""'
----- ___- --- if RAJOS PRECIOS 1_11 1i_--'- ,i, "';_1 horde integral 11 -, .", ,- "" .11 111-111 1-11.11 11-1
l" r- , -11 11 I 1 [ "T" "I I ", ", , "., ", ,,, -5 I,- 111___ I 1, , ":, " t" ,, ; I I I 1, -1,
I -11, :t i l -', "'; I I FE71ilIFTERA I I,, ,
lill z 1, t ,, , i- ___ __ I- 1" j, " I I ,,,
__ --- DAtrl I I I a ri quo alto i i I I 1,11 'I 171 A 11 -1 1i 1
,
illl, I 4 _ __ __M- D P, r l I A SE AIAWITAl ,N li;MVIIJIS
i:11T 1 _tl-, tl I I I --- __- I 11 --- "':
11 [ otem I Z corn 'i fir"'t. ,, t",""k,*, '% l "' I'll
I i ; .o dlillo Il 1,7 1-,7 111111 "I J- 1 It I 1. "I'll", 11 "I', 11 I,11,
I 11 EFMIGEHN'ADUOPP E'l ""' " 11 I I : ", ,,w;,tto.lIi1',r I i,,,iW l-,-- ,,, I t'." 11 -"' 0 "' ^igUE W P1010 1 1, P.q, , "I ."., _. M I.* li"11111111 11 -:- ,,,,,
1 A -01 S x vEw Y 7 a 'li ill _11 11 11 :--, '',"', 11 1 I Illl -'I'll
111P 1117- 11 i ", ", _", I I 11 ,,, ,,, I 11 I- 5,11.1.1 1, t I 1, , -1 I I-,
,, ,,;,toi U-2 01 '-:- 'O z It
", ";
'? ,: ,'11'1, l, ,,(!, , "I", l ,4
.-- I 111,11"'o" ":", , I 11 "-I tI ,,, I I -11e, I'll '-, ,
""t' ' " "" Z I i 1" __._ _,_= __ __9MMeMWWMMI7 --- : ;I ll
POR SU 0, C ,---", ------ --- ----- II320,00 'I" ,l', ,%,, ;, ,Hii
4 1 M O ANY, S A l, I I "I'll I'll 1-1 11 I 11 '111" ', 1 l ;_ I_,,'y,,-,',-,- -- h 7 '_7.11, ,, arxr. "t" ,__ I~ -1 I-- I 1-1 "', -"". 1. I I I .i",, ,-,I.
s7 N NICOLA$ las I 1 I I I I I'll ln l i' 'T"''f il ,, i It li !,, ;i:! -, 'I"I %, ", *1'1': '11,1:1: 7. : --, "I". 11 n I l., 1, ,_,
I . --, ','_ I -1- , "I DINERO HIPCr]" '_ A 'N J, ,kfl i, ', -,_ "" ;. _, "r';';'.;'::
BOMBA OF AGL.', 7-", Y,-sq "I I -1. MADM IA "A WA ,,,Iml)(, 'l"., Ill 11 .1- I t
Hab=a 'V G aa I'll, - ----- 1- __ I 11-1 I "I -. 11 I'll, I, P1.111 i 1 .1" _1111 "I Ii- I'-1
_______7 I __ ,_ ,_ _,_, __ 1 93 1110 LICTTUD 11 ,I ., t 11 I I'll 11 I 11 ;,","ll.
I :1,_",',- :""". l,,," l,, ,,,,, ,,,,, ",-,.""i -- '-,,- -:l1l,-, ,,, I-, rt'; i ,m
ADQUIERA UNA - I- -'A,,, , it ETHIGil fz WW I' ;. ,,[ 4" I I 11 I I I I - - I I W, 1 11-111-11-1,111
I I ,l 11 111 11 I I ,,
BOMBA TURBINA -, -, 131CICLETAS I ri V It T I N (" H l I , I I L., '1gfi- I ill'', , i It,- *11, -1lt'.1l,_11"_,-",11 1* "I il", 1,
,- I I 11 I I , ,: Apafta'mento interior,: "'',-"- ,'',-""", ,
-, ro, do ra-t -t ,t i-i ': I":,"', __ I I" il- I ill -1 :' ,, ;, ,, .- ". ?,.
NUEVA , :,- I .--- "ll. 1 1 ;-' i 2 -. _., , I I I -- "i "I' ,,, 1, --,
,,, ,, 'Slruu r I I i-;( I I I "I" -1 il 1;
il , .17 I .1, 3 ,,t_,:, t '41--n " ': I 11 l I 11 19,,',(I, 1101,
' 1' -"- "-- "t"T '
1, _Ln'l- 1-11 l-l--,,-_, l , r"t. 1_'-, ;11111, 7-11 - __ I I., I 11:1 Z
MAS AGUA I -,,- I I 1 --.A, ill, - 11 11 11 v,%lLE,, BAJOS I'll 1. 3 1 ,,,, ,,, I - ,,.
o, I,_ _ ,,, 1--,
I '; -. ', _- T""', i OBJET03 VAP103 --- -1111 11 i 1 1, 1, it, 11-1 -,
MENDS CON UMO I F _OW -,i ,! t, ,* -, ,- 1 'I I I I If, ,, S fl.t, 1,,,l,',,Scior. prp.ndcq, rfl,, ,
,[ ,ttna I ( "I t 'It. 11 11 ", ",
.1 -1 I -1 .'_'_ ol',1,;;; '_ M21110 -1-11' ii a, ,,, i,,, ins, patio, ague abun- i'' i -1Ir ','-Il c"""', L:"_1-_'-"' I' t- , Is- 1 35 WA "I'll Ai. sta r An 1, i C - x -vitt, ,4t,_6
I' -, . 7- 'I
SKENCIOSA 4 l l ___ I i, trtf,, llglo sevillano, Se piden XpAair wtioit, i ,;Z ,W,
I - -- z "", I I ", i 11, l I ": _, 14 :_ 000 '\Lx=a 1 ,-, I ,
fTj0'7,*, MENS LL 1, MUERLES T FRENDAS 'l 11 0 lre o:l,-ncio Puede verse a to c;', "I . " h"' Ili~
1 , IFF lA T- i, !,n t- 1- f ,, Ill, .", i" n, ii tIL l 60,000 Hti .Stna V x ".l.t. d. I ljda. hores. Informes Tel, U-1233 Rldt, 14 ,ii, -i-m-1,, to t ,l., : _,_ -- 1 12,500 ; Vedado 1!
--, t-,- I : 111 'it I,~ 1 "'I -- 1 ,: H-7677-82-24, -- "' 11 1 Iill _1 i'' ., __ _i---,,__-,! J -, t 1 16TOW V-,-c Ma-ianao i I- ,--,,,
I , 11 I i r"W Par. = 93 DEPArTAKENT03
l I I t-!i-l t L -- t I I I i Alin jatttmtizacl a i ,dard.o. Olt 'TAI, 1", , ____
,, _, ,, ::, I "I -,- -:, ,! ,TYN l 1 1, I -,. I'll quo Vs I L p .:M. _-. ,' %' 4 C-all' $1 A UIS.A U %)?, AKT 10
I I_-1 11 -1 : I I -- -- -, l-' len lice 4 Es ictio, de loa famosoat r.r. rl'a4l 't-1,111al LQ 9 ASIAN Ifla
I ,a .
'oo,11 _ ", 11of 1 .d., _dA. ,,I. d. -t., am. -Jr.
MODICA ENT,: IDA I I E- ,,if ,_ .Pa , 1 -221,11, ., -, :1- r 1,
--- ,- Icanfidad prvs da. Pays infor. I fast q. ,it-per .elualda. ,Wl". .' il-'.Pa fP "I M 211t__Il d. #.,' Par. Irl -4,
-, .11-1-, .1 lligr !,
-, __1 I , T- !'A I A-C'". _,ts,
--l'i- I'll -1 I ____ atelt tomplotoia y, at doses, visi, I I it
I '. 1- !- - , ; ro-o" P ,z "I"ot- r I 1, I I ; "I'le REPAwro MIRAMAR A1.01131,0 DIPARTAN 10. M "TVPide infortnes: .
-- ,, -', , I propieda" -1 "I a-41. X-1.1 ___111 _!, : hi,,,t, _t 1-- to A iUSW 4!10UW IW HAVA',A BUSINESS AVSWWA U., RK"t a Y IS Pl". a. W.-ra.-da'. "P.hasnaeft, St.
-1 - -- -, 1- 1, i .1 ;, tdnI Hadne a: 1, I -_ Wooaaa, As
Hlabstallf.
lt, .
mora-ofia comp ly l 4 1 11 1, l A ,,z I I ACADEMY Iarl- As- 0-4
m i-- ; Para qu ,,,. los --lit, I 11 ., I ,, wIri E,* P',=' '.,,,-.,,'."d-. 1. '. Ill~ "U. .

a I I I'. I ROBERTO A VETIVS I I I 1. H."37-0-11
7 _1-1111 1_1 1- 1 _1. 11 A-,, tert;.dr- g-d', . I bl- t- gar- y d.*.
I r" ; I 4.r I Rodust, Hiv-:Ielas. 1 8 Eactlelas, M i Habana. .4 1$1" rad. .
11 -_ I 1-. I 1,0 1 I Y ,,--- i -!- I
S. A. ,'I -1--l-I I,- I li til-l"t 1 CA&fea diurnas y :i,,cturnaa. MENDOZA Y COMPAMA , -,
'Elio. a. I
11 _- -, r I,,-_ !, --_ Ilr_,
Ili _, -- T a EL 1. -qmlll"lll I a . . Obispo 30. M-6921.
San Nicallis V 105. 11-1, --, n-3, 't n'. i I -0-15 S. 1-- loso
'- -1 I
*,, "', -- -;--,,, !-I t l I _1
_1_1, IRI- I 7 1, : 16, 1_ 4 Tigl-p to 2.1 Ill it W !7 c, I I "t- _11 __ ,
Telifort. M-1: -, t. 1 1,1 7 :,,, _', I I - -- -- it-11 1 1-111t,-, 'keo I- I
'i 1. I I~ ", t re I- "., Vj, 'L MIRAMAR
I I I 1, I I- ", Z -: -- 5 "go --- -- ,, .1', -- -'l,,-, ; k"'E"Cl-k t'P,117,11) .- e -- - I -, -, nm a r, C- E
I __ -, 1-1 .711".1-- ; (; klA %No 2) 2, 1 1 ) ,ldirir_;-* t','-,- visa C.STMI., 1 .7r=W_.S 26, antre Ira. y 3ra. ,
__ __ I I ,,, I 11 1, 11' I I 1 l;t "i" i n v taw ent
I I _, ,, 219411A l
1-1 -- ------- ---- -- r - 11 I .- ,__ .- - - - l .,, ,,, , V, I I . I 11
I I I 311 -, ?IaA .--- r.,ld . .- I-1_ Tliz ". : t -- r -, _d i ,, \ il _tl i I "- 4. -'--' d"' &' '14-r- 2 "w" t- t U '.Its' C.I.d. It, C--I-i Prl-. 'A-- -- I I I t.i 112 1 1 -- ____==== MM - _Pda .Aa, ;"- -'- L"-- Par- --a'q-tar V- -stars-, "Iflid" te"Paradl-All-, asu. Iatradar, C, ,,t., b.A.
I t 'i ,I!!!. 'M 4 _:"" 4- -_- __ .,,,. aasa a- d- .1-11. y -1,4.d .A. --A- I -A- I ba. irrler-l". _1- ,-,T ---,- ,,,,-- - I -1 11, -, .bar,, 1. AA=,
1. t "I I I .,,-I'll "I' I, __ I H 1071
--- _____ S- "W" -*MA-d- "" ""'l tV'!%-1;bf.';9*dd!" I ', It
iVIAQUI ul A hit'p, "' -'i"", "'I", 'V"_ _aa "'_'2_ a ,
11 , ,J, ,.
_ I '-)UILERES l3-1 vw-,S 3mw2-" ; lt, cal-l-, 1 ,E
1 ; 57 LMLZS DE OFICU41A,
t 1- __ __ __ ----,- __ -1 A L .
-___ __ - 7 1 _____ C7 TAS 1.01. .qWri
1 _', "r c, ,i: " ll 1 1 "I il, l I 7: _: I I- I'll 11 11
,-,
,i,
-- I It I _., -, Be ., , ik' I In(,,,-rP#
F14 EXC EFIVf, I ,Vlc--1. 1, ., AMUEBLADO
"' , - I 4 I- 11 - --- - - I HUESPED
-- .,,- ., I -0 lid. Pi-i Alq.il. I
-_ I -:' L:-_'- --, -- I C.HrA I I SALUD T all A, ', ad.TVN.- d.bl,
Cotereterag, REX L I I I - _- _ 11 Z L ., I t - i I I ,,, ,i : i __ 4 'T Z -Y.1_11Y -- :,__:,::: :i-7- I
l-- v I- I : ,,7 " I I I I ,_ 1; : i Y, :--A W.,- Pat- b .I- W. ao11, l i-1,11"I "11- , :, , I , lt -.4-PPI- _b.A. i-., ,.,d1d= ;l1 P,, A
I ,_ ,-:, I -. L -; 1 .a -to , 7, "
I 11.1'. ". I r1l"Pa. CPart entregsi Inmedix a, ', , -, ,,',, i,_- - I 11 .: Valeas , rj " a, 7- ,U "If. rZ61ilm .r.,;1.1, 94 IMITACIONES
2 11 j r__ 7 "-. assfoaats .1 rassoo, I., AN"" 1.9 r I ,,N,
11, I 141 11%, 1. .,., I I , 1.d, Cl.*1111 11-11
Alwaav I ASA HVIrs, Des. rz= l, ,P .1 P-Pt- 21010--CIA 11,-"I'Ll VIA.
,
.14.,tan a MW ;, 11 I'd,, l .1,
llo__,_-_kn ___ _11-o7l I ". , I 1, U I -dr, del V*dd Clvda NO I"
H EW S I I 1 _!_ I -i i, 1, isI-S, losearia. Tues. .ol P. 1 14, ,ei or ,;t'k ALtaU
:, ,- ltfrillar. fasislass, .4. =,1111: 1111_,_ t-i 11.1- " 7__ t, I .1 an. 191." "dalloa. - y A, Sartori. rabs la.lab. tatt, P.Bombs' -1 Idr I ;-,I 1 I 11 I I I I - _,otd- Uff-114749 82-2 4 1. d. --1 TaNfam D-,
3,000a 0 11. 1- '-1"; I adra. _16. t, .- P.0 l ,, Ven-,5,-,- 1, lu-l.r1i. ." stareah. awli.t. raiwad.ar. ---I- ,---- aalat.-ta. T'AlmlP Lt. X M Ill, a-.
here, 4 ,, a- jr, I I" -i I -_ :, 7 p-i.t_ T-A. .h OFE- 31-111"46-13
11 I ,l I b ? Ti L -% RAVIIMA Fla vsufs B04NITO APARTAMENTO ALQUM* SAISITACION ANtIsIt"l"", -1 17 NQ $00 ESQ. C, VEDADD I.
Winch6. I I,- .,, ,"' ,, ,, :1 _1'1'1 2ill, l = __ Ai jill ,- ___ I atottablAdo., Part *lul =4=1= ,"a
V I : , I ple-MISSICA. Alql ta h.,.-. b-lPtwl6- o tAa d .1. = 1 = = V.,*. z, r1aft.11,
, !7 _7 1 oll, il_ -- "' a 0'rall, Par. at'll.-J,-, W& It.% SNItfoloora, ball. lrdl.I.d., Sol.-- AS-2*1. V-7791-844,11
Corworea de rehIII&A. ; __:, i _1'1 113 YIPWI I -, atPri
-1. T ___, 7 , 11 11 I ; , : ;Sairot-St #W h.aitar 6 - P.A.-", _Q- I-1.0
-A 7, Il 71_'-, ,---, 7l ,a V- -"' y -Ma" "" 11 _A RAWTAMO. ARM, I
I 1110S oart= ,"a. S. d- tl= lr"
CuTeallEA ems to, I -, I 11 ,:1 _1 -L' - I 1 "', -a Wa-i- 4 iAl7b';?*"A.d,",'. '3asi t. a 1.&dZd.', bPrabra
,',,I . , H1117-40-n st IA ,t I, rado.-I. W. IS"' - I - - I -AA fl-Arv tr"'al- to 1. .11.4 Sal."d No 157.
1 11 I -,-- ii i Dta, PSADO 10; ALTDI: 'f"'M" ;' "'I' d'a"w" d' '" 'a dP P". A __ St. IA- I a.-It:r
= 410"s per 11", ,.,,, ,, --, ', --__ %w_14A . T.Itt". 2.11 I
eourrelo, I I I M -r__,,, -I _,; 1 1_11_ 2- ,iz- ,, i-i I ,14 14.1- I h.bu.6arl rP 'i.t., 1140444-21,
I limt 5 _i A, -I .1., ; W-Aa ro.", a. __.,__ .
ll, 111, 4 AS ALQU" ]MAIT, AXVZSLAI)A, WAE
_1-1 1 "I, _,,z,_ _, I" I 1, __ _11-00".10
I,1Q1l11 ol -_ I lot Formld _, ,fi : 4.1*1s. __. --ill. b". -ld. I 6. Uff "2 rft 'Wt., bAft --I A parsaaa .9.
, I I ;I7 '". at -"
motor" "taflonarlo ;- I I --- A t13, P-- K-Aa, r., -arda W_ ". _11aftedaulevos, Diesek I -1 I I" ,:, .: I I H-ld- Z
-1 _., 1.1". i_, ___7_1l0__ V-14'(7.7ft-st-W tilabima. Retarto AyeslarAn. $23. T.I*f lr-=4 B.709 V
lso-di-M un 14 I IN H P -r-, I I I AIII.C. Vs. Pal .rlq- Vill'. AN AldloCIA ISASITTACrala Ann".
:: 1-1 1 '. __ MI~ r, V CoP JMMTV I d. .11% x
I 11 I ,;, - , I wiuham qw Ild, -, -- I-. _l ." bxl. -b-,- l& 4 M .0. .Wr. PA.11U. I la. b.kft 1. 1.11. xd-w am
'Ata"'Tasa'. : :: I P I i, 'l I , 4 I I -,I ., d-" tI."J. ,tP't- I 'i,'EDES Marao y wl"C "" errtal, I., 1 .at'. D-su. y reld'a,
-- 'I -.0 Corinne cost OAS! I., .-.A." oZ11,'I'' l pu I .1: X-M-Il-Tt,
r, - Y-c:, --,- T, _, _m4 i 1_ 1 I =-- r-aliff, ,a. 0 12 -1
IrR, : I ': I , A :)9, FAquilax 11 N." 2 h,-- .bli-a ., I a.
G- t SAO~ 1. - -- g.: JIM III, VAEA" CASA PAIVOULAS AL': I l -, -1 ',I 'I": 1". ,- M. :lii ,, S e ,,- - "- $a .1 -. hlbl-lar, rP.W.-I. I~ = 2 b.hm t-- I-dclatarol U.N. M Ij -1 IAH W., l-v Ot .1 Wit-la 1. -11. h.hitard" .--bl.U ,, D,,,, ,
i"11- __1r_1'1-t.1_ I LA MPOTECA, NO PIER. ,.a.1 Saba' "I '1: IT I V W, ot.
-, I a1r_ i T.0141, at,. at. .W. M. CAl
11 r. S. "DEt, c -,s,, da tiempo, vat a Martinez y Pa,_" .' '.Dtal vad"T"- a 2. bal- J. CtbP-,RPdJ=
Matores, estarionairl., d* -1 : I i 1.11, l -11 - Itc _4 l I .
I ;1_1' I Iji 1, I I H-180-0-W UH-11-81" VtTl .k., ,"t,
gna.ll., .-- I 1, 11 ; --,- ." r a "" '_'rII I I on quipo Prieto. Experietteis, seriedild y -_ ISILANCO.Ult SaA 1-Ink, a, -A.1, I
._.aam a U, I, . I 11 lz, n. ,, ,.',- _-"x, I n. rapititz, al 5%. no 41K allies CoM Lot lilt
ciaryfla, a I Tainbilin dames 'C"LliC AD A, ,,,, 0 -1 AN 11, h I,11_ ,,, %r-l'01 :: i'l, ,,- I I ,Iitft _I_ .:_ I'._ ,
I I A -i-,. PW. -, 0 ,2 -1,,l-' .- Ad-,
-1111t: ,!; Iti I altr 6 ." ,,,, x eri fabricaci6n. Compramos ca- 11- 11 Pao "' Oartadoa .1, d.r. U-7#04W=.
----",, -, __ - - I I r b Lftl, ,, ir'In. t I-d-.a l 6 A _ t y "._ls., 'P'lla, ,
Platmax rIeztriess Pica (;1-'N ,)I,(Iwa- ,mmi U ,, " ,"! 1 "', sas y solare& .Martinez y Pritt ,',':l i- d- .T. P. Iloa ,fa ;,. A." "Pa 89 A
I 'af-I.-P. _- l n:- LQVILA WtA HAWTAIlON A VoW.
r2, Alltutnr ',,IneMlt- Fio, 1i_1111i F9_5% ,r e , 1 sa "M!ts ". ., It. I." art -1. ,P1., ". P -14., .
121 "I 1" I I 0 Rrill- 309: A-6951, 1-3456, R 41 rt I01-Ift. V A y W.M.d., d. as hdfll1-= .lr.lxr, As- .61ha 7 "
110 )Y C-i Rr talndal , IT ,-H-8038-64-19 Oct vIttAito ad wt Par Its VINA A GUAN S- .- ,rl.d,;; I.-d.- Prank. lal . Saa C-1- VS
0. tl 0105 Y AFARAWS, 11 rallArl .14PI). 4 Itai am 1,,b. U.4261.
0 I ,,,, l 11 I I 4. ,I,- #-do y ',= ." "',X,: *."' 0'- '"' .P".V ,Y 2$ To. .
I"' I l 1, ,,, P'
l 1'r ", ,,, FIFI TRICOS I I I I d. d. rl .-,gadP I __ __ At ALQIVMA MASSSrAcStow, Ajtxos Cox
11 l, I 11_. _11l- 11 I 41 I=4 bak6n 1, -11,. haral,,,I, $Pin, 9 sw,
Plant" ,fttrirA# NSA "; ' ' 4 I i Z= 1= aar. ft. 1W. 8" P0,
.1 I I I - a, I- TPIL Y'" t .raa .W _-, X.P.b., N.M 5
Ilr- -- -11 11 -1 I I I l W3105-aft- UH 11_123""2
,,l ,-- ,- I il
sr- TA KVA_ i'll"I", '1_1, "_ -,: ,,:l ":-'-.", li I I I : % x-ra"'.0 :
ftst. I XV - i-1-11 11 t-I '- T-4 I.' !i' j j I I I
= ,V I, ja "" , -- , ,; : ,q CAM DR COM AS SE A
Tom -ft I I I ____ l I 1- alaral X. ,.94-1. P-J.,
_111 - ,ll :,-. 11 0- tad P= . waffar. .I., 'Vill.
-, I I I n 7 , MP I C*MtOAt; A Domen,10, xj; Gantral lAquirta, "' -_ - I l ; I .1 1. WAVITACH)w AMIXIA, IsUrf --.-,
L_ 1 I, ,.-i, l 0 PiSTRUVVqT0S D: A 'AE0WML-,;M------ P-le-, IV,,- 0 M.P. d. I. =; ,, na, Stara ow, St.W: a,. CA 11a d. Ayeatara., ainr- Pa G--I. 212t -oIra 040-1,
I~ SA 01-n Ky , I -I - : I 1 4 -1 -11- 07 19 ,AtlottP ItP A.t. is. V. j.,
-' -- I., l- I I .;:, c5 S2.ft Ab.-d. .1 W oate? I i.,
Comprosarro do aim 1 : L 't, '--- o,11-1 -1$-1 '1111' I -- -------- _- -- -- L _- .tIa.t. ". aal
"L , __ I I _-- 6 Switte, Monta 410, K_7*304" 1
Axad : r, -i.-, i, '.-, -i- flit. $l= ;' ,V1 1i A l -- I- ------ I 1_M':'.*y'* b". %.rjbtn,=
_r, '!, vr, I UJIT 1144)D = astriou wP,.1 BE ALQUtLA NN CASA LE.F
t_ _, 7z,,_%1114'7 ,' ;, A l_-4-, A- Mad La. I= t2W 3=
outra I dtpr l -- = I b.bitarl6l, .1.
_,i tt, l-, z -:t", t'l- -- -_ Garlaral Air r N- N* als
l rlll 0 It aoll , i, ", , ;, ,,, I to, NP Stl, aPtra .Pt As
I 82 APARTA TO.- A lula" VoI.d
"" = = t _C MQ 1, I tl ,_ , , I I ':Ated" 4. lio:, - - l--- -;', : I 47 L : - H."r."'As
I I , i -, t, I I,- 1 '4 ,
10, ___ ; T _,", I- .- I, -1 __ I COMERCINff E, ALQVMQ, SIALDIA in, UNTRZ BAN mi. iii-,H-Ml-u-3i 111SANAZA PS9 AILT09 EMSES, sEKUS=X
4-t : d:.7 .-at I A1q." ,lablud" a_ - "'_ 1-l-I tl, ill ,;! l "! ": Pal" I M-4- I.- tatal .
Notam MOD" of", I '-, ,,,, l",-,-:% iii -,, ,-_ ,, - 1. I I ,Ia" 'Noortlea.t., .9. tri. Y .11-. i W ""' a-fb- -'- -teI -Ia. ALTURAS LHELEN -l .",'* If ", ,,, I ,!,-,,, U,, ,Ij, - i ., 4 , I I I ; 71 L lea. S&S.W. LIA .".0 Pit-. stem rsf__PjNot"ols y do me. I T- I,, .4i-i ,iilt- ""T -;i1o"", -1 ,,, I I I : INDUSTRIAL, b_. I,-A.: atwaaaa 4. -_ .W- 2. "new ott- 1. A aa ttl- I )A.191* =
leg '. m I ttt ', I- t 1, l ,i I V-, "" '- l,,,-%, I 1- ta Wt A-*M, ;7"= -" ." Pa',7,.r;;-;7 ,, St. ALQV. UNA A. 1ASIA,
= AI M.tqI,,.; ,.,.*:.,: 2 4 It -, - t I I I - J I H-7011.01-22 lia,
Pat.- 07, It 1 1-l .111-1 it 1-11411-1 i 2 M- PP,,J.-- [ d- _- baal-ta, la"
M--% '-':,.i'.*.'.%,::; IMPORTAPOR, #_W__ATAV_9_Q ArAZT'AMS tmile= ,,o."Pr, 2 IS~ I. 1. ,
I- X" 119 WA* liNtAlUortal bafta, t H-7#584441
Mark ", t-ld _,'', .- - - W _- I~- __. a. ralwolar. d. b.lwIald h "I
"-;1-1- ?111 _i "'A"
,t; "" - Ir 1, _61,1. 'W'.4 _a,
,_,-1-,:t'P"', -t ,- ,- I;,-r", 'e, ., . _5 I. am Y PCIP, T.W 214, Aow, lp."=.%
.1 . -"" -, 1 'I --i -:. ios .V
- ;: , z , ,_ '114.d 14I j! , C",* "' '", *,q, ", v d"*
i.d. -W. dara Pro~ pl. jPf- A t, h
I .: ,;%. Ise ; -. _' 111-1 ;1.11111', , I .1_,.d. I 9Z ALOUR.Ar RAWTACION A 110014.
w l . 1 - 1, till a:., 1 ; Z-,-5 A- :l- i I ", "' 1-1, 11-11i. r-I , I Z Vald. A, 0 ", _"all-P-21, IA- tal. a _tdrarIPP wo Pil 1"i, 1--, f r' a ;"In, .6, L ,-- -tz- I --1 l-, = _. .,= ) ost 9, Wo, Dim Apto, 3. tiquirts, a
__ _1 I In .L4CUAW _': ll,!L _'12_1_ "I - I, l ,_. 0 4- --m 1111-SaSN'tol. CA=11 _7 -7= - _=1 .Allaro.
i I % _A- -'! I,-,, ,, 'l-iI,:, an.- U- Ad.-d. k _- 11 11 H-421041441
Aviones Piper Cub, 1 ,t I __ - MATERIALES DE COMT. 1 ", emarivallentoe C--lettlef, WE D-4055", UNA HANITACION AKRXA AL Oft
. ", ., a- -C;z ,,! i Y EFtCrG5 SAINITAW S [I Liqu!"Sn" San gran I- 1, A I _gwi Ia lf
a CSTAIVIS APAATAis i; I APARTAMENTOS DUPLEX ,dr, d. L 11_6 M.
Molests "Evisruds,1% I Call- lit. Is I It P-Tt. I I I r1a, .&CIP, a. .M.I., a. .am. .df- ; at,-. P.M. A Wu ".
I Hl per dejar esta little Li irl I ir W'. oi a y 3 tabl-ta-1, Amueblados a sin amneb! .11 0-1094-H-23
I I I Allatelar d. ,a., 1-#., aLgja, I., sitd,&Fu ft ideal, prb.
--I?* -Pierds ]a Ckpo-r-t-i'd"A d JUEGO S D E 1 Ill '.:7alsr 411, Depta. 400 11 .1l,,
motom marl"as do I all I -%- .4-- - Sza ". NU-a edifiel Atoump Al"VrAclonn
''.d. I 10 aeleadal, ara.altI.'. 7, rovm#, battens jaA, mf 11 YI ft. ?',,,,.I. 1. aaa-, .joa. X.1al __ ag.; at,., b.km 1. nr 41
of- A
I -F,,7n a:-127-6, H-8112,12.22 100,IC fr. coio. ,*,txZM'tI* "" "
1. _.tP -d 0 , ZI. I AS, entr.d. 6d k.lbgasolinst altetros. -ba; "*19- Sctwh, ,, B A IW ) 7 banlyn" pars, bar" ; 1 7-7---- ------ ---- ", .A, *I. ., Call. 15 NP M, T.It, I'M,
I 0. -'e-d- 4 sarar" I --- - --- - .I- I,
EW ,,P :.%.*:1 I i,, ll, '!, 1. I 't, i -1 -,t.,la = ,1, MI _Y 1 ."A'Aaa 1
qp o r- "ar. .14-. I- sum ll"AN SMA0.
:: " A, i-). AeUr-1 f- il 11, DO, I reft Urania, PuHm-, me. ,, ,-. k1114344-tt
141 ff P 3; IN01>0RO ACOPLA - alatak, .P.M.OM. H.1a, Az AIAVUA UNA SIAWV;A ox, Ily
-1 I _,.,
Coal. t - 31 1= Milli- = X-rtst, n 140, silnsan 91-aaf. 1-1 ."I,. r ,llt,
orail, : :: 1; :: :: :: :-, ? ; I ll a _, i LAVAIA" O GRANft AS= parp lelifont", clini- ,l_ trWA4"1"4WU Wl ., ,
LA"rea 3 iLpp i I 'W"
. ,,, y BlDrT con I 1 %i. r! I /D, .,-4. a- I i , C,
. il It IS I 0 d fodox Was AP KT 111 1705 M Es"Reg, A", -1 . 1. -M
fth I ,_ y % .-It", Ft.,. Marfra., C att. 0 y IL l A"Unlo AUTIUA, 01.1-0.1 I.
accefzrtez it Cast manic I m r& MA'arm. T.I.I., .1'. % bast I.1'Pottsia, boa .I., --!, -,J,; ,-.jSj.
colchones 'Simmons I ureo, otC. -'_ to I i, '"
I 2.- igEW
.A ,, .1d" 6 at.
a m 1 Co,.lP11lit_7!= flV ," - lu)"a o"iela lllopil_, I rolor r.1.1-olax. A-1- ", I0, baj"
DistribuktWoo, psr4 Cuba A ft' lV. N iy Start, .-it. It ,,ta, 1981'.00 P .i.4". -.
do Ina CgEnjorta, ".Ml Cji -f1W -AWk- P.- -ii- 0 1-1 A-= U,!. I-., z)% tr"llaw" tafiaud- W__ a_,,*,. 'It-t. _" Atwil, y lt,,,,-,ts ,
I P A -a- wt -, : 11 An'i- y Emp.1rad.j. "" do apartatmerto e*n&pnt.-z,, t 1,-i= A
-,. z. Totr'. site$ y frescoo'babl" oftes, I w
t a- tattled. VIA. -x-4P Vito. _p+ 10 I lls ALSCddA, los"A eattialar, tres L.t
h_ f., ___ 11.1 . Wal m X)ST" do a"
*W_ = j i 1. canc mant. 72a, .4. a, 1. -1
I
"'; f, 1"_ "'I j ",4" : I i-R-11f, M I 1;;'W_'1'-1L' '-". 4:r rl.,M T. ni M
"4TORS MARI' FERRETER" I _' A"Ou" ""I'Aclon' Coll UA,*,:C ,
11 9 V=Wx ivmo LIVINO-ROM 4 l i An! r ortrada ,
-1 i an lujalam, hadoo, clor" L Q I _t" I%
.1-111W-V2.1014 job- Mtast_ HUM BO y antiffins, devader, casarto 1A.-Par. sAls, b.- n4w *1-" IM07-M-21
1 mi 1. l_-t-_' ClooblA 00, ENTIRE Altstumalk or tt.", "Vap11-I'lPt.04.21, i r .A QVC.A. CoN fwAz.,
CORP. 4 1 0 1H E R 0 '.1lo. I Z ti, -1--to ot-o se"Ide erls, lo "-. .1a. soZ" M-111k., .11.
1- __ U-1 _- .PI-, -, a ,.: ".
i 'kl, W-- .,I
S. A. i I D- a ,,, S "
I des.
MAiINA Y VAPI)e I - 1-_ -.1o't" -t dd -hl- 1,_61 It. y -I- U.- 1. "., r1l.,
OIF, I I, I:;. _0 1111ii-1-11- hj -11" F- CALL2 N1 W __P.a,
T e' 'Allmcot lt' 7,h; 1 "Ill. 1111=, I'll It,
U-2282, -.I . I HUMOLD Is 1, egg, a P. -.1 e-d- r-,l d'""S'n
I~ ITl'r.M .-;",,*,= U 2 5 0 1 : ir1I-Q11IA VV 140DO I notsum ZiVMW"A ifrr_- _,"._ _a Z ._Rti;_,,
11 __ I A-3933 Sr S 6 ;-. -11- t, .11, l"', - #-M M, "DO I Is -111 .1 11"lvi ll M, -U. VI1111f , M=1 = -:rt, *V: I At, 1, .E,
-_P 11-111 17 P'111"
l4w_1171 -1 - P* MI ,It a 7 - V- __1 -IJ 111- 0 ,M 11 'l, .MMWP. A, LUV::;::'_aPi.= "ll -&,- MI, C.- __ _: "I I 1 td, V.d.do, bad.a. XM, 0011111BIL- I- I I I I ---. 2 .- ,
'Was I ukrCMMC.x I --- : rmi,-iiik4 p -l. ,., a. t, I r I I
W& 9-a"#44M oat. 134102-113-13 i _-
I
I I I
I I
I









PASGINA VEINTIOCI DIAR10 lIE LA MARINA-MARTS 20 KI SEPT. lI 1949 1AFO CXVU1



ALQI N E VLVLEE S SLIFIA C A SO)I AN S 1 [I, I FFAE EOE I II( l

I ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ A _1A._ AAAA ", " C,_ _____ _____-'-- ,""""----- -- ",_ __, .___________ _______________ ,- ,,I (Cfo FKj EACN
_______ ______ -- ---"------",-,-,- --,-,"-,,--,", -"-- --"-^ . . -_ ,"', ,A- __________-________________II__---_______, ----, -A, 11 I ;tiL
- --_ _ _ I- I 'll__ __ _AIA II I I II "I11 I I 1,,AAA ': -_ I 1,1, I -1,
____ ,---I,- -_ _I _- ___11111-1_ '-" 1 ,t
AA I, A ___ - ----- "A----------- A I ,,A-iA I , IA -_ AA I -_AA IAA AAAA.AAAAAA
j~~~~~~~~kl~~~~l T I IAAAAAAAAAAIA.AinAA NAAAA IAA AAAAAAA. IA IAAAA1I, !' 1 '1- 1I I 1 I 11 :" IllII" 11 1 11 _,111'1 ,ll.11 ~
11 1, I I i ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ __ __ AAAAA 1:I Al-- 1IAAAAAIAA.A 41,AA;AAAA ,-w; ,i-,,--i-Tl-'-Iv I 11. 1 ,,,
I__ _ _ _ _ _ _ 1,AAAAAAAA AA'AAAA.A,!, "- ,v i .1 ""1 i",,- '., I I I.-I- -, I AAS
r_ -, , _ , I , , I I : ,v l , A -C A A -A A 0 :,, 1 I A _AEAAA'-_A-AAAACAAAAAA. )t.f) T(1F 1,
'AAA A'AAAAAAA "'; A :, AAAA A A. AAAAAAAAA AAA -A.AA A ,AAA A AA AA 1 A1-1ill . IAA
AA I I ,, 1 iA A A AA At -AA 11 M 1,A .C CA A- I AiA A, I. A l, A11 A, ,j AAA1' A A1 A; -,I A A A A, ,A 'I' A I
;-,AA WlAi ,i ,, I A AA AA A IAA AA AA 'I ACA'AA'AA AAAA ICA IA IA _ _ _,___,_ __AAA C A AA . CA AA .EE IA AA A.-- lA A , ,l e I 'l
,. _A AAAAAA'AAAAAAA ACA A ,T- A A" _,AAAA; CAAAAAAAAAAA AACmA A,-,,- A'__1 IA I Ai "AA -A I I A11i 1. I-AAAAt"A___ __-__ I ',AA A1 A.
,_ __ __ __I __ __ AA AAAAA-- AAAAA AAAA AATvr A ,AAAA AA, IAAD NF'A)A
______,_-__ I A"I A- ITIIA F I AAA-A'-AAAA 1- ---A'AAAAAlt" CAAAA IA A AAAAAAA--AA ,AAAAA-A -AAACAAAA AAAAAAA AA-AA It. JESU SUEIAA I IN-E
Ai' IAA A, AAA _,: A AA AA AC AAACA AAAA A, AAAAAAAA AA'AAA CI AAAAAAAA AA.AA "I ,- IACA A A-lA" I IAA1F" AAACAAAA g" hAAi
SSEVIENID1I,;t II,,, 1- -EIll- : Il, I -11 AA-AA AAA'AA ," II -1 LSADOSSAS -1 AAAAAAAAAAL'AA; IAIAA ACAAA pCAA I
A A1 A A A A A 'A AAAAAAA ,,, A , CA ,AAAAAA1;f 1 iI I1,111i, 1, ,- ,,_ I_ _ _ _ _- I, ",, ,' "'", il l,
CR ,1, ,003 ________ __ __-_I_________"IlI ,,AA AAAIAAA,-,AAAAAA AAA AA_;AAAAA. ;' -IA CI, A ,, ,, ,I ,AAA.A I
11: ~ ~ ~ ~ ~ OIIA ,______:______.___-__- -l; ,'_i.1,1
,__ 1A A C A A A A A A CA AC C A A AA A A A to] AAAAAAAS AAACs-f -6 ,~ i ii -, ; -- A'1 -: IA, AAAA1 y VAICICACICIIC 7 I I t - ~ l ', - AA A3, AII'E IIAA
IAAAA :. -,AIA AAA ,, "IAA1A.111I AIA i

: ;A A A A AA C CA A'AAAAA -A IA AI A A A, AI A A--11 ."I"AA A_ A A,,, 1 1-4 i,-i Ii
I, AAlAAA AAICI ACAA "AAAAAlAA AC IA4AA AAAAA__ACAAAAAAA. .AA-AAAAAAAACA _ ____ ,__ ,____ I
IC I_ I -A A C_ I IAA 'll _AAA AAAAAA
-A 9_$', A" AAA ,ACAA AAAAAA AAAAl -A-AACA AA A, A-CA A, A AAAA"AC--ACIli AAACA AAAAAAAAACCAAA A A A AAAAA.CCAAAAAA. IICJR EDIJ RII, ,- I v r-cAAAAAAAAAAAACAAIAIllCI iAIA ., AC AAA ------A-,,,,A_-'1A1-AI' A CrI AICiii A. AAAIAA-I AAAA A1A1 AAAI'lAIAA- A-,,AWAI AAAA'W l f CAAAAAA ;AAACAAAAAAAAAA, .,,,3


A CAAAAA-A----IAA4A6AA-AA :____"________ __- 1- __ACAAAAA: . LAAAzi iCAAECAAAA"llAAA, TAAA. CA ,e.- IIA IA1C'k",[A A A AN~it

.,, 1 _________I ______-__1 ______ _,-__,______________________________,'I___f_ I AA , ", ,ii,,, _'"' ,1'w!',,I.
i________-____________I ____ ,-1 I 1 I" ___F -', AAC-AAAC -- -AAACCAAAA A CAA-- AA I-,W, ~t


__ _ _ __ _ _ ACEli AACAAAA ,AAAAAAAAACAA _- A :' ., 1_,, 11 1 I 1 1
AAAAA __ _ __ _ _ CCA CCA "IIC- 1 I _1 -- I 1 ;1 - I 1,I- 1 , ,,, f ,,, ,, I l A
AAA CC IA .CAC AAC 10AAAAAA CAACAAAD S -,. .


IIM,- 1 : I ,,, S' AzCAACA ,E FS C CACC15C PACCC i1C--I A) 1- ," 1

:AC _, A CA AC A ACA AO CA :: CA AA A IA IAC ._ __ __ __ __ A.A CA AA ______AA AA CC C _CAAAA AAAAA A'C C AA ', tACCAAAy i~ jp"
___ ___ __ __1_1-11----_ __,______ ICCCAACCCAAAAAC I____)_A A A I A C C, A A ,A I -A -- '- 1- : I,, I : AAE 14iAAAAAAAA _ _ _ _ _ _ :' AACAAAACAAC AAAA; ,,AACCAAAACAAAAAACCAACAAAAAA
TAAACACCA AAACAl AAAACA CAACCAAAA CA I CAA CA A1 IC I AAACAAACA 'llC A AA -R- MS RAMOSII ,- ,,, :
~~A A1111 1 C11 AC E, AE A1 A "I" ACA lA C A" ;A CA ACA AA C A- A- . I- -AA AC C A AAC A;, C A A A A.
C. CACAA,A CC A, I 4S -ACCA AAA AAA ICAA A A A CA CA ,A ACC CA"AA CC'"AI qAA-1' ACA lI1111 1"III'l. ,,, 1II1 1 .I Il- - 1In "n 1 I .,
IA, I A 'l IA I CIA CA, -AAA.AIAIAI CACACAC1 C AAA'A'A'A S I AlII_________________- LN'1,'AI-O 124 LAI ISDIRASAIAAV EROS A CAAACAA ACCACAIAI CA AAA AC'ACACA A AA CA ACAAA ,CC-C A'
*,, -7A MigAC 4 5 M.1SI I f
__ _ __._ _ _ CA ,A 13 ,FESITAS 1551953;-" -" i-, IAAAAACAA ACAC AC--A'ACA. ,, . l t- ls: ,, R
AC. AAACAA C ACAAC. CC AAAAAC CAAAACCAAAACOA ACCCA ACCCA.CAC_ II______I____I- A IA lA A A, CA C, IA CA A, A I A,1 I Ai C il CC A1 A' I 1 1 , ,--C A 9I o I
;, -t- CACCOA "","'I'llA A- A 1C IACCAAAACAACCAA AA'ACA A ,A 1C 7AAAAAA CAAAAA CAAAAAA CA .qi1 1 II ;111 ,, ,,,
CA. C - A, A:' ", C A C C -Aa A1 CA AAA CA, ACAAAAA C1. C1 A.tif - ,,-AAA1- A C I .I
ACAA AAC A AAAA CA OCCA ~ ACA CC CCCC A ~ It _C A-. I A A A A A C I A CA I A . A. IAAA C' _ _ _ _ _* C I AA -AC,, C ACA. CAAAA -AA -A CCAC A C "
A ACC 'AAACCAAAACI ___ ,-,-",, I'll - ____ - CAAAA ACAAA AAACAAA CA DR.l EMI ATRA
I__ _ _ _ _ CC CC -A A .1 AA, -A- "IA1CA1,AI I'lAICCTIA11 SOLACATU ECAVC"ICAA IACI121 II" ,.RIS .AAA. A %A," A 'I1AA AACIC AACAAAAI 'ACCACCCAAC CA
A _AACCAAAAAACA CA IA IACCA AC Al1 1 1 AA AC ACAA CCC ACA AIA IA ,, I "- --"I" -1 1I AA IC AAAiA C,1CtA "11CCACAA1A AAAAAIA'CACAAA 'A AA'CAAAACAACAA CA ,"I ,,. 1i AAOACAC CACA CAAA ICCAACCC IACC ICACAO ,A'CC AA"A AAC i 1 / _1 )l;I) I ,1 ,- , CAA IC I ;C C.AAA AA 'CA AA IAC. IE Ii

_W MT-_ ______ ____ 1041i A AA, AA AC -1, LW BE-R-_MiUOEZ_ _ _r',,", .11 1 -11
ILRT1SM HA1TC1- ALIAA D- I~ "E 1 "I
CACACCC- I AI CAC.ACCIA1 C -AA '. I"C .- _____________.____'I______-__:_________I___ CIAIAICCCAAAA"
A1 CA C CA CC- A IA C A I A C IC A, A A '' AA A A A, A A A A A A1 A1 A I I A C' A, A I A1 A~t C CAA


_ _ CERI AAND __ __ ACAAAACCACAA CC CA _,_ _ __" "'-I1 -II VJ 'UINRA"
_______________, ,_ C lI. --II11-II TRC 'I CI I A A AAAA IAR WATES ,S O


P'4~~ ~ ~ ~ _ __._ CA I' A. AAAC ICA I"AAAAA-tIC:_ _,", _ _-,-11,' ,,,e7 l ', W1 ,, '

A C A CCA, AACICAC I CO I- ICAOC AOAA A AAIACA C1- lACA I 7 V-ETORIR"A--RIOSii i 7 I "I1._______________ ALQ ,OC AAA .A. At .AC.A CCA ILAOACACCAA A, C, CACC CC I, AAACA, ACCCC CAC CAAICtAI"ICA-I 1CO l --CAO ICCA CAAA CO i0CAC '3S C zAIS __-_________IA__f0_I______ _______ __
C id A ~ C l AAAA (C A 'it IA AC It A C AAAA A A A
11 11 I , -I I l' ,, % ,-,--, A -CA! AAC-CSO ?AAACCC tAACAAAA S E OE EC "__________________II__ i -il l._ -- It--. I-
__ __ _ AC AC A CA.A AAA C FSASIO ,Ci _AC CAC C'AACC CAL i H i EO 1HF i'dli~,1;It"U
Coi CACAi 0CA' Amp. AICA1C ; CCACC-AAI- -t : 1 I --r "1AC5 013FE35R9 1, iI ,"j0R
C' ACCA CAC CA AC AA 'A- A"C IAC AC CACCCAA C C A A A ni" A Aili AA, PA' ,?R .11 1 1 ,)

I I C 2A C C ,- ,~ll 1l 732- l,, I CCC, CI CCS. F C I C IC CA t CC CAAA N".4
A. 4-CA 1 ,- ,I, ,,,,,iC-- I C AAC AACA CC, I'AA'A' IN CO A" A CAAAACTCACACCCAACCACCCCAO CAA'A, C
'11 ", I EI" -I________ _____ __ ___ __ IAA ,-31 __________________fC C A ' _A A ,ACAA CAC CAAC C. RCAFC-AII CASACI I,1ICC'A
c ARAN. ElA. CCeCCO ALCt.CA CCCACC I C.ICAICCA11 ;., t, A C C IAC 3 CA" "AACCAA AAA CAC A AC,, OR --; ,DA ;A ACAIA"CA A. -AI". AA , I I -AAC OCC-ACCALCiCA2CCACCO TSCSCAAC C, -1: ,, CAC C -CA-ACCAAOAAAAICAAeAlCA
_ __ A AC __1 __AA I IA- C-C.A AA-l"A"AC,-_-__ _ _ if _ __,_
A _AA AA .A A1'i 'C IAA tACAA IA -, -A_ CAAC COAAAC CA A,,AC C,- "-" 1- 1,I1
US.'5111l1 __ TI
I~.I 'A'tI C, C, A"- - Cl- C'CC CACCA CIC ACOCCAOCCAAACC AOO1,AA ClAAC'A CACC A' ,AAAACACAA,
.1. IFCOA AC ,_AAAACC CCC iAAC, _ACAO IAAA CA 'C. I-I , -, q ,,,' ,SACCSC>ICSC PARB X SW.
tiCz C CC CCAA ICC ACA 15 I'CJtS TR .,CPAC IA 'CA AC'AA I -CC AC 'C A I______________ I. A'Arl-AAO' .1- CCA I'll I 1CAISCOACAAC8CACAPI-A .1 e lA .' C AIC A ACACA -, tAA COCC A'C CACAACAO IOAAA "AAC IA _'CAC'C' AAAA C HCA 'E A I AAC
-, ",", __ J_ II A1 C _-,AAO _CA ,CA .CD-CI'L'C-PAC CS.IECII ,ACCCCACA A A A
A1 I AA I 'A CA-AA I I 'CAOC. 1 5 -AGENTES' VISI I 5OIIES __________,,_!-i__-_-.__.C&wCO A A;AACACAAA A'If,'-A--AAA---- 0C
A______7___)__r__ _' A'CAA.AC'AAA AC IAC -A _-IIAAAA CA,
0CC CAOAA COC A CA CC ,vA CCAAC ,C IO'C CA O 'AAACCACACACAAA _ _ _ _ _ ACCAA

_1 IA, I IAACACC7 ,, ICACCCC C-C C-OACACCA I0~A CA, ACCA -AA CAzzr CAWA' BIF T 5111 FR1~ 0 DEI, 1~r.' _. ." -iRANOFCIAA ___________ 'C ,, I__________ A 11 _______I,"I-_.__-_________1.-111l,
AAS AATOT "ACC CA CCO'ACCA CC -1 "A "5 'PCSSA CO AAC ACCI ACCCCC ,ACA :AAAA -AC -AAA C------- ----- A..44I A . -vi"! ~ o A IA CA ACA AI C'CA'C. I Ii ,AAAAACCAIA A-AAAAO.A __-, I__-_I
I'A, 1C SCCC .1 .CCCC CI IC 4 1 1 I CCAA ACOCOO C-! AACAAO A IAC11 1 ,Il ~r ~ 1 I

OCOOCOCOi It "I~ 524 ACACCAOAAA'A, __ __ __ __ __ )AAACCCCAACAOCAA ___11D A AAI'Al
.A 1 1 1 lAlI, ,,.Cf --_ ______________._________________ C CCA AC' l11 0CC- I i -T, 7""l" 1,IIf-E "'C A'CO -A ______ ______ "RANO
,,o11 AE OCAO"l A1A. AA AC CAC I CA _ACCA 00 ClA 'ACA C
C. IC CC 14., Ap 1o 1. I AA AC ICAAAAACACCA 6OAA CA COA A'A .-OOCCAC A. 0 IA.A 0 .f. AAACAA CAil CI-11 AC ,AC C ACCCCCCIo A
A0CFAC CO A, C _I- 2 1I1
IiAC .r- AACAA.- CCACCC'' _ __ __ ----____ __ CA A ACAtsUSjit O D, TC-uCCl-~l11---_
A CCACICA AC CO -5zI1211 1 l SCOFRC"flr
C CCCAO 3 CA OCA l, t 11" CLAREAS'LAVNEROS 00 CACAC AC-C -C -CC I C A ,_'-'- A- iCC -- AAAAAAA it-AA COAf ACOACC CACAC CAAAiC "EIC OCULIST 1142 1 ,0 0 COSAI 28MO
iRTS.AC RA 'ACIMV AC AAT Ci EACA 00A INCCCA C, CAL -1 .- 11 IC -,OO --CCOA 11- .T.CC C -- C AO0ACA-h 'dI A A C 1 C COC C, MC C IO C, I. A A 7
M .E IDltZICC IIA L r IA 11CCC CI A COCA iviCC IA111 CCA 4- 4. 1 lA .'ACAA AA C AC A AA ,A A C A, 0'--, 'C IOAA C ii"'A IC COC C "A
A AC C A 'A'A CA AA C C AA A C AC A CA C C A C AC COACCCCC C AC COC, A C A ACC IA A C ACC ACA C C CCAACC ACOCA, IC C0-C.A CO C C. CAACCA-1 C-O'A'A-CC--AC CC-IliA, goCl) -L AI AC CAAAA AACAOA A IIC CC COI IAA CC.A AAC I -A' 'C A A C : C on CAs ACCC CA ACCOLO CIA RA ACA CI IAOA CA 0C
57 ~ I COOACOAO COAA IC .CA .AA -00C .AACOC IAACAC -A -C 2A A So OACCA F NCCO50000.i-7 x
-_ ______,_____ . _, i_ _ ItAB
-1~~~~ ~ ~ ~ 1.61, toO AIC CAOC A'AAA ,llA0 CO MPRA__. -"" d-,w ,u -II1 .,ll ., 1' ,,, I 1- .
__.___ __ __ __ __ CCC"ACACA CO 152' JADSAO OCAA COCIACAC COC- IC ,'AO-CC ACCAC ICAAA CA C CC CA CAC C AAOO CO A IIlt -, 1 1 ,
F,6A 1 CO A OCA C ICA -C CA CC A CC 'AC A A CC. CA CA CA AC A AC C AA A AC COC I CC AA IC
COCA. Red. -I,,_,;, ",AAA i -AC O, IOACI ['LCOIC-,A-_-____z___-____t1'-11 .1AII IAI-'CACACCAIrClCOCA'-__ C -CCOC AAAAAAA, C"CCC "_"CAC -CA
A -A ,~ ~~ A C I A 0 A IC CC IO C C C IA - C-C A A A O C O A AC A A A C 1 S ,p -C A C C C O A A -C-A C A _ _C _C A O - -CA t .A A A C 6 1 1o CiI I C A C* o C CA C AA1C4C C C C CAC1
0CA C ACw.A- A'l" C CCC' AC ,C CC 0, ACO -AA C CC' -C 1iA 00 CCL IC oo l C -C o OCCACO i-.AC -ACC A A I ,:, I ACCCC" IA nA CI CCAC
--C -A,.'.I.C ACCA IC C CIO A AC AAACCCAA COC MARl- I A - slAA_.AA-AAEc A'A Cov A-C CA. %CAOACA- -- CC,Ii- CoO





00D CXVIII DLARIO D~E LA mARINAMARTES 20D ETT DE 1149) P___ VJI77U

C M AS REPARACIONES VENTAS VENTAS VENTAS VENTAS --VFNI'AS -.-VENTAS 111
It MwUESL PRENDAS 44 RADIOS 43 CASAS 411 CAM 45 wk_ CAS I________ soIA sF CAS 10 MRI, ,'i EkrCWXM~,'T
B-5301! COMPRO IUIIIES JIIt 4$5Z ?eeOAN frm 7Ue11 U 0 "I., kA '4 t Ili.,V,--T, T ":,""'U N% rALLP'l IPICN, CCIOVEND
hienm do obj -1.'4' 'd ____, ,nm4 I44 ,,,4,,, T- I., 4M I
,;II e.OT.o O,4 4.,,4 1 'II4" 1 , " ,,mo,, ,. oo 4
tvArl, m aqwb o ,i lhre III __ _ __ __ _ .Ion," j 11h 91 Ms ~ -11 - tt ,".I T ,I I-e no. 1,ma 044 i4e n ,,-o 100 I 4,':11 ~ ,, 1TI ,T,-4
en _,4 mo"o il SI.1.W- .11- T, I' I"' -" ------- ---C~ RU ----ia $1 0 .ar ._.____________,_;_,"'""
________________, r.,A Il -___ ____ ,_, 1 II: 1: V I",,._I QUINCAL.LA I-Im. d-- -- Mir2-r' -oda NO AG ER PA ACO0EST~ r" 1,. a .na -iOa, --,,, "I I. o. 4 .' I '4' ,
Ivrao ,B 0 I;A4 (olipOn." ,0 ,,400 0001.20,t;I iz .

0"T' 'f ,,40. '0 A-m on Ino a, ,,~ 4440, Oo MI AM R I ,!!,T-"_ ,,,40 1 oob ,' 01 0t, 044044 4004204004404004044 4. t,
ro 0drm qoooem --. t-, otla --,- Cona ,' -e'o CO~il. n, lidaIs __n 77 j4o, ,. 'l". ',oooll', "I", o I_ Ao,0 ib -oj 20 oo _o po11d '200 T1 O'" .'4o 40,
dorm ooajilao Ina osompt ,0 "'4 Its -'~ -.a Tainbi late n ri, j-'i u'v v I, 1 ~ 1i 1 VEDEA0I4-CNT
I ,- 1- t 1, o ar u u $1 I,. i "' oo o ooo ,o 4 "t-, "T oIn i ,I .I ,oono. 440 40o 4,240 ,400400204eo
Htpdr.C m J-084 -17-16 0 011 "- ,. 420 0-00404 Ied o ns OO 'e CaOC ntCO 2 ,,,I r00a 20~i Will 4l7. 10-1, in. IT I Ti~ IflI . !,,1,--1 ,"' 1 00 ".t1.

objetaii aol, Roo eab e 162 r eoo -.O ;t~ VENooo. PORE0I '4200 0, 0,00 (_,j'4'-, !,im 10404 40.0 0,,4 -,440 ,44 -044 4 0 ,4 401,
CA0042 IS f0420202 "ao40recd~" Arm _6, "~'I" ,- I~ ,1.-1 r1 1 1 A11 00200rli 20.0044j ,04 1r,2 '4. .n 40400 04, 0040:00-I.
04000s doriene, 00peaorol. -v rni, ____ ___ ____ ___ a~ Olgot -0,14 0* t'-0.400 it-00040,2011.1 0.020 0004 MIRAMAR CHALE, $15140-'"' ": ltt044,0440442040 0,20400 I
0.44 040 r- 1- 140 00 o44 40 .42 00 40 40- ,0 I44 ,o~ 04 0 4 40 4 4 4 40,4404 I. 40I4 -0 4444 4 4 40 4 4 440-4 4 0
cou-or 4404400p 044040 a'4n0004 an'4oaO I".'440.20.4 40 d4404 C0 I4044400 44444 40", 04, 0440,,, I-- :
TrtaoO~ ~~~~~~~~~~~~~~ ye1a 7 4tlaa itso'oassz1 --t -oiio UA tM wrALTIN VACI 0.r, ,0, ,,.490'4404'4444',404444 't4444044,04 I,.' 0440 440 '4.,4 1,--440 ,,0 4.4 4, 40.0
pian ~ t~do doro o T, Ob- &''4 44 .t 0042 4 4 -4 4,I,, It,404 444 44, ,,. ona 'at GTao- ,
0~~ ~ ~~~ ITdi it'~ I0-b. "n '4220 *000 ", ,20I 0'4" 0 420 I ,.to t; .00 0.04.044 _0.0.2 40,, 40440 !,4,4 0, 44i 444 _-i,0 ,IIA IISIA 4o444 4,0420,020 444044 011t 'l _~44 ,,404 4.0 ,4410,. 0, 4 0 4 44 .44
bi, ajs au ale ~i4g r T,1,,,,, ,- ,- i. 044^li e on0 n l4 e 20 .2 4. 0 20 40 4 It lia _" m00400000o40ot .o i aone I'll,0444000 i-_ _ _ 1 "I' I--do eavaioas c se comp0' .ta I0444 4 .4-0440 ,, T,'a "" ," 44044 X- le Ill :1, 1- 7 00,011. 1 0004040 '-,4 442 0 ,24 ,4 SE.0 ~ V A 1 0.400.00.
M 2655;t. MOPR 0 44004 020,_ 0 -00 -,0 "" .'' ~ o RET, O{OIO0.044 if40,00417404,44 V0444400040
OR ooi oe, C as J 00o. A 067 7 4400 V.00 v a r as af lflt n lo t s cc it 40044204.0.4i.004t44- -0T- 4444 ,044400 040040440.1 I' 4l, 40I'll 20401 000.
00 0 4 0 400 202 0 0 On 0rm l d co n c ar eteri E Na, 1 40 4 ,- "',1, I200004;_444.400440200 000,,- ,, ,, -
'04000400440o00004.0002040440400 A T "ffOOOIOo ooo4, -"' 4 4,2 4,. 4402044. 044 00 20o00_000o 004 --a-0400 44444. 4 00444 44
0,0.04400 2000002200,,40 V N TW I UIL J oeoo,0 424.0004.004000040444044. 4 40 04I 000000,00 0 J 0,.40440 -4r0040a40.,004I 40,44400440 e04104 24 Ili00
0, 00 0, I2 1 .r r 40, O,4440, 44004. 0,u 20 44 4400 el k to42 0 0 0 0 0 444 0.4 III2 4440044, d0_ 44 20 0 00 0 40 0 0 _04 44 I40 04 'C 04 4 4 40 4 4 04 0l.4"4 ,I4 42
0040 ,, 00 I-0.044 "I'',044 0.04040 -'00 0000000404,n0042040204, 44.00'0044 444 J-424,, T" .004 1 000. 0 0040404 0 ,,COMPRAMO8.1 LA P ,I110000 -_ 24021. HVEDADCE 1-5.12 1On'4 T! -0444404 A, 0444404004,'24,0400o40 ,,4, 4 oo 4.4444040 4 04440444040400020,
Cn0,00100br0041 0. ma .A.0.4,00. I00.0 4O.0.0 -,--4, 4404, 020404ld d,40,tb1ricr 004000060 V4 MI A A 01som hr00 4004 404442. 000.4 44404 o4440
00 00 4 4 444 0 0. 4 4 00 40 0. I0 -4 44 40 400. 4,0 ":0., I0 .44044 440 ''.4 4 0,0444 44 ,4 00 ,44 t, 44 40404 2004
banas,~~~ aba "avo11 y t040 M LA b N L E D R __ ________-__-IZ't"""" w",,00A ,'' Ha; 414s B.anco CandC tteD ,V, V 5-1 JI I
C -2bt a A r t a P r e I U 0 I0 Z00 20 00 -O I~ o n ,Oo ~ o D r U T" T I4 0 - I -0---__ __ __ 4'I .- 11 2000. 0 10140O ,0 -11 4420440T0400.44 -" I1,I -- -t_-t "
004 t-04 0 "" T "' '0 't20 044 200402 Al44 It 0, -0 it 0 OloooO 5PUI U # 4044 ,02 000 4 i4 I~ CASA, $28,000' BUENOS BE PLAYASP VI O EA PA _T
B o c s A r i g M D E L l e 0d0 04400 0 1 ,, 0 4 0 4 0 4 0 v 4 2 2 2 0 A g m, I $ r S I '4ap a A f l thiI l ,Ii 1 I I I 4044204004.00.0 4040,4~f~ __0 4 00002 040,- i' oao .4 "I. n-T. ,I 44 I n -t 0 404 40 a' HABANA RE REPARIO Y- JARDINE MA M I E N N
noAMP doMIDA E 4sio COM ERCI(OS_ ,-,Ti ., , ,
________________)~iCu FFF R E ;U C LCIO __ _ _ ___ 444001-. B-e~ a y;I ,,, ,-T,, ," t 1Il, v
______________I-1__ 11 __ __ __ __ 000.l RECRED" ______ b. zl
0.200'' 4: ""000,0 ,40.42 4004.440140044440,40.4444,444
000040.00 0 r i u o pl at040 '0. 00 4 0 I. E N,4 0. 0 020040 .0 00 00 0 -4 44, c i' T ,' O '1,4 4020 -, 400., 0 1 t" i, 000 20 0 04 0 '4 0 4 4, 4 0 0 ,, L IS S 2I P 1 51 N TRpianos_ __ __ __ y~0 0~ 0 0 a 4 0 0~ P 44040 4o44.,40 04ta 00444 00- -4444004 ALd, CON AIN V,6 Al,,, PLAZOt 7 -l- .- _, ,, t i I
2040.000200 .00 I.00 0 0 4 1 44004004404000440.444.004444020444400400044
r 1, 1, -1 1" It', 1-, 0i -i -.-7.4 !14.4,4. -,404,I 40024004-,- 00i I04,4044040444400 4000 TC4,o 404-. re __ oleeol
t og4400 n r la a ', ''' ' 00 I00 0 4 2 2 I0 -o1oo o 00 11 - I J IJ E A IJ B ILOti T 4, .44,.4440 0 4 40 4 ,4-40 0 04 4 40 4 44 0 -0 ,-0 4 4.
.4a 0o as -'-000444 004 400 $$55 A L1 ,I a-_4044100044440 40, 00 .00,44.0 4 4.i 000 0444444 440404 04 t m jo10 u aoe d e
004 4. ,. 0 eF":,,- V, *,.",. 4 004,444 0 404 4400 0,4004 4 4440 0,4044 020"04 4044 00 2000' .4.04140
00 ', "' IT4 '"04 4 ED DO I"00 0141 0.A $,400 RENTA .1,1 1t ;"'
00040400000 -1c oo, o .1 oh it 00 T" t't 0. 440 2 "IA"E 14 2 ,1 1 00, 040 004, oi _ 040 IT040 44, 004 -04004440 -.0 4 40 0,1" "O.I 4 000 2 O
A-103 -1 7 Oc 44,_ 1 t, l r l I ,00 I0 0 0 ,00 0 r.0 440 4 ,000 '4 40 4 40 ,4 0 04 ,4 0 00 4 4 0 0 4 4, 4 Il44 1 " i ii I;
PI~~~~~~ono.~~~~!" Po'ko a I Iofia "0044 200 .00. 4. I0 044 40, 1- 4440 40404 ''I'l 40400444 .04, 200 $1ao.4 poeoca Voln Ia a .1
0020'f_, Z- 040," ,- 20_ a"oI 2 50 T." _ -0.11 --- z" -0 4 00440 0 40 0404444 444440 ,4 0.0 40- 21 Sep.
2-i000000.0i0 0040 -020 040 0 rti 0140" 5 040420000420040404,44, 000 40. '
0000000.0000"A" T, 4024' 000I000 I00 0000004 0, E A 004400 20 -- $3511.0 000 S R IS 44.4 042004, 0.0' 20.000
M -2655: 20.0 440 00. .0* ;;040004004040.4-4-0-0200,4000_- 'o -1 1 -, 202040440 .4.42 4,0.
"-b4' I. R1-11 0.l I0t" 00040 40". 04e02.-00,, ,11 '1.,. 0. i~ ,oono 0004 20 v, 042 I0 040444000 0,0 "", ,, T04an 40,: it00 ,44 00000
.d aa4 r eba -nao ti~ I jarronc . C o20400. ,6 000440 200 "I.4 40T I2.0 -400 "I02004 0 2040 .1 0

,m,_- _1bbr _1 0 -e i- __ ,___ _,___ ____,_ ___ 1CO>44.44! 1, I- -4 0 V E A D C H L E 00 4 4 .42000 P1 LA V A 2, 015147_414114 040 0'. no 4 .0 000 0. 0 -A M E 'I C I
10~~~ p10000_ 0084 0, 00 0, VIO R I 00 440 100 T40 0 ;0 0 'll"04 0 00 02 02 2 IOO O 1 I44 -Z 400'j , 4 4 I4 4 4 4 it
00 4044 .0 .0 oooA S 4 3 I 04-0 1,,._ _4, 0 ,04 40_ ,44__ C A S A 0 Z94N401 10, 40044.44F1 4 34.1.I T -0-, -00 100T- 7 ,44 04.40,0It0 I4_ I'll,0I0I 00444.00 I0 44 .4440,I0"I4444" I ;1-11- 11 I~ ~ -,0 .11.111 I
Ie o It. P0044T LI - 1- 40- )." 004 200 40.0 ,,, 444, 400, ,I V am '4 4",00 04 0 4 00 40 0 4 0 4 0 0 I3 A U O I -I T -CC I ,I
-,, 1 01"1. ETI, E 1. Ria. .0444 s,' -4.' _, ,, 0(0 I- -," T, 0' 4444400 /%0'. '400.4 44000,-7' I20 44_,_4 __0 4400200 00 402 -,, 4 '--l?50fffl 110
1 4 2 2 2 C B O i? dp p l aAts 4lc a I 0 0- 0 0 o I s4 2 - -4 o l ,,0 .4 0 .4 e ,44 0 4- .0 1 4 -0 44 00 0 0 4 0 0 .; _4 04 020.l.! 1 1 T0 4 40 0 4 1 0 0 ,0 0 0 0 0 " ll00 0 t1 -14'4 4 4 0 0 I40 0 t. 0
te do ro c s,042014P(,c~' I,--- .4 2 I04- 400404440244000044,0444 0.0z0000, i ,, ",1
ims abanigosn o br3ta Ito O LI C O A004 004400400 ,00P.41. ,- (jR~tR C jFG A~1 0.0 004_ 11.2 .4Oo0 0.044 I,4o 0020.0 4000 ,ENT I2 I240 I002 ,044 000 2040040 02I
P~~5aooon~~~ biea0 -- I000100 do= On- -_ oo'_ __00 .0 00 00 r I- 1-1. "I "I.4 040 0,4020040244 I40 I0444. 0042 044 ,__40 4_,040_ 40400440
0000400 204044404040004.4400 o44,4000000004404., ,0,o44o4 0404,. 004.440000 00, 00-,44400440400440.4 0.44.2040 A.$13 5000 0.0.44n00a 4002000400 002204400000 0
,n A 09, -)t ,1,, oao a 1T In 000, I __ "I"" I- 00 10 I'l -4,.424400424404004 ---'ll",, Io~~0$ I ---D
am20p7- joyao ala- A-- '1 "0 .0. IT 002T0 .040 T__- 0.20 --04 IIi,
Moli em,'0,' 5- 10.' -0 V-D 44400,I" I, 440444404.0,40 44 00. $ 8 00 444 4000404.020004004, 004,42000,0BE02PLAYAS,000."
00 l 20 4004 4i 0014 - $-4 DA F0 4 10 -0 IA 320ni r b 0 0(7 I4 - ,0 4000 0. 40 0.140 440.0 44440. 0040 44 04 0 4 4004 0 0 0 0 02 4 0 0
CAA E OO oo,i.'-,_ .i,- 20 040 '.0 4 20 40-- 1,0400 16 0.0000
w40 00!: I4 00 l 440 oo 400 00 04 404 4 42 4 04 4 I00 0400 A $ 3 0 .oo0.02040 000000,00 420 1J4 a
000,0.0000 s i Ma-R IO 04042 20SA 040.4 .- -7 7.-; 40440.2002.,_ -' Pl-onnRI FS ARM OaLES
44. OotO,40. -. T I A_____________ .,m . . . . . 020 4 i 04 ,4 04 ,01, A_ tro r t ,4 44 o44440 I0.400 00,0420. 0
__ __ __ 40alo.0400 000"0 &1. ,tTL, I. .2- 4,40 14014 So.l I~n 4400.20., 004 -,, 0 0, 400. -020.00. 0.0400420.
T40 4 C-P R Ii E V o o_ Ti00 2 0 0 0 0 _.0 0 0 , r _ I 1 , ,~ 't o o 0 ,o ~ o C 6 4 O S 0 40-0 0 0 0 0 20_0 0 0 0 0 0 40_0. .4 0 -4 2
paj -i1. Mi-to WEITO - siio ________,____I________-_I -0 0 1 ,'- - -0 n;- 4 040 404 I 4 40 I -00 .4.00_.4 000 40 0004400.040 000 40 004 0.I0 0.4 0.2 .0
CrXIb R. 14 1 1,41O p. o eo F004440 04040040 040 000 04 .2 00.00 0.20r0 0.0.002.- AT0.o 0,s 040440 o oO0.0 -44 ,00404 4404.4 00 400407;~ -, -," 0 ". 04 ,0 -4. 400 4, 44," 0."% 0 4 .44 0F V0 00 A400004 042. 2002
420 4.00 040044 20000 0 o4o40. .i 40. I000 I00 000, 44, 004 0 -'0000 _0000 It400'll
wld 00., PIt5.044 Gb 1 4 1 4 EEP:T KO PL o n ,o -o44 0 4 .00 40 -t002000004004200444 -004 0442000,400.0 00.00444 4404 ,40 44o00 44.0.0. 200400 0,00.04 040. -. 0 440.440,,,-00,I
440040 44 0 $ 401 .0 0 4 0 ,4 4 4:.,0 t04 ,-0 _., , " 1, ,, ,, ,,00 0% ,_40 0 .0 0 0 4 0, 4 0, -4i -0r 'T T 042i 0 00r t 'll W .T0i ol) tC"1 6 O
_ _ _,,I,-d_ _ _r," '_ _ _t i44 44I0.40,, 444.- > l0'4"4 I I4400 ,.40 444-'0, I2,200000 44044224002,40442 rOO 0.40 Ig~-o 000 2C
4000a 00.04ros 00404 0 440 4 I0 t44000444000, T 0.400004T 0.2044. "", ,t -- -40 -V A ;A $ 4 o
4. 444420 0,40,00 ooooo004 -4 4 .4 0 0 0 0 oer A M P -L E R E T E N T A0' $1T01142 40 .0 04 0 0 000 000000040.0.11 1 ,,, 1 , % n n e i d ol r 6 tl
004220044 40 04400004044.040,4 002442 00. 00 440 ~ 404, 444,o474 0, a 0 004 to 00 4220 44.,40 00 0400004 oo0.044 40 0~'4,0004400000140404000b
042 2 0_0 4 0 0 0 4 0 2 0 4 ,00 0 0 2 0 ",404200
000.4440>0.,4 oo oo.0400400 00 ,o 0 0 40, 04.00444.0040.0.0 EN OFIQUTA 00.00 202.o.0a 0-040
to.4 .4 00.P1 000100040 44 4 M.04 -0 III 1 -42 44' 6,200040 440.0 0 4 40, 004 00040 4, 0 0 00 4 40 0 ,0 0 0, 2
44000.0040.00.04000.0400.0. 04 0,,,, 0. 202 R5 nTA ,_ 04004 20,' 044 I0 ,osri 00 4.y.4 040 0.40 00 404r4. 400400 4ao 40. 0 A E T SA O O S
0.0,004 !004 20404002 0; .0 0440 044 0 4 0 0 0 0 o,0 t 04.00040 04 020,0400.2 44 4402 0 000.0,,0040
44400,04440DADO 002040000 400, 000 400204 MORRO0 R05 __AC!A: I.~oo. 40roo,044 00 0440 00 ,-!o am ,ET $-1- (",00 400"00 "'40 0.04.00 004440004020 40400040 -40 0,.400 0 02
0000~~ ~~~~~~~~~~~~~~ 0440 00.42-4.4 202 04404.04 t, 0.0. 2000 400 0 0.44 4 0 4'.40 0oo4o444004040.'000400- 400004244 0 "'00040 o 0no oo oif 00 .Ou ,, 0on2
00-2004.00.40 ~ ~ ~ ~ ~ I 00.400.00, 440,,02 0040 4444'0.0420 04040 1. 44400 00 24.40 00440, 400.'0 0 U400004000040004000
040040, _0__.044 I4.0040 20 0444,, 00 ". I~ T .4000I0_4.00 .,40 00000. 202. o
0_ 0000 40 0 4 I40 2 4 I _AO LO f001301- ", e I -a 10
04 00~ 00 0 0 -04 0404 _0 ,, , 2 0. 0 0 40 00 00 a 00 0 0 I, 0000' ,,' ,0 ., 4 44 4 0 20 0 > 4 40 44 ,, 44,0o I0 04 0 t ll 00 0 40 0 40 444044 00. 000202. 1
It_40 0 0 0 0 T O n _20 .0 4 ._0 ,t _0 ___ :_ _ _ _
o44 ~fl -.04 a 04 0 0 it 0 0 0 0.1 4 ;0 0 0 0 1 0 04 0 4 04 2 0 0 0 0 0 4 0 0 4 I4 _404 0 0 2 0 t~ 040000 004400 -44 0 A I L C 1 4 E T
115530 C Or e ln a P R O a ti et T 40n 004; V,0 4 4 4 0 4 "00 4 4 00 00 00 0.0 04 400 0 e!en n -0.4 0 0 20 4 4 0 0 0 0 0_ _4 0 _0 0s ,04 4 0 0y. 4044 444. 0 404200 0444d. 0 50,44040 40,V O N 00, e n tid u a Pt eb 0ARTS
0.l a- ,-__-1-i. r7a y .EqrKHY =S OL AES AI it0 ,.-to ".0 00- ,, .,[ ,104,11 0.04 ;0 ai -, tat -- 0.440,4I F IX C04_ 4ait d ,IRM 404510000 40040002200.1olat020.0.040 (6tost6.do.,.
: M~l 4 C .m o b lm 444 jI L N l fl:rw oo o 4 04 0 0 0 0 0 n,, I d T - 'f s ,S
400, "04 704:,: ^_040,0 --- 4 ,, 20 404000004 ,- 0_ .04.00 r st o 00 1
1 .M4,n 004 _0. _4 0000 0000 00 0 :' 00,1 :40444 40 00 4,00 000 k 000. 04000 Re.4 Ro. 00W0.0 ot0 "lWm -11 a
laan.a C431o 04000 "1 O ; I, _ot 0't, _____- I0 20.44.04 04400sit 4 .04I, ,its4it 440040 li. 440.;
C -- -1 I 00 I n a 44 -0 P 521 D O C H A E T PAala t o B eo1b- 1 C lo b. .u SI S C t
COM pRAM OS PIANOR L S LA GA G DEL. :z14 -f2 I 0004000_ tz', 20 2ff0 5 ,3 U 5 U 5 7 J ,1 00 N 0. 00 0400004 404040440 4440000. 44400 40004 p2:72, t4-m a: $7,500; 9 1 HI t
-40 0 .0 02 042 0, 04 40 44 0 000 ,00 0 0 0 0 0 0 4 00-t 1 .z l s y i 00.00 2 40T20 I _440 0,S 0NA 4 04 001 204 400 I 0000000.042044420 0040 0,, B
00r o o cl na ,j r o e ,Po'a. = = 20 "" 000, f, 00000 ,0 I 040000 Isyss0 4,00 4 00 4 0.400 ,.000 04. 00200 r as I 200. a tr 0024T R osat nato,00042
0004000, 4.000400 20o~i I000000 .os 01 1 44044 4442 DE CA PI $201,f00 -R0I0 __2 4000 0c0 a40 t_.4 -0 0200 0000440 404000 XA-on000- 00. Td-oatn00040000,Sn
0 0000004,,, 44 -1 0-0 .000 40 E T 0000 0;01C 0000 ,A_000 0400 "I.44 0400040 S_00 00000 o-A ,.,.Te 00 45
Raijil crs ta eiETO pa teS oa tias I 0 io- ,n !Ta~ anL Y ,,A L 7 2 0 0 ,ooa ,, C L~ a 04 0_02 0 0 0 0 4 4 n, L S O I E 1 4 .
_1-_AV-_____r-1_____________""' ,4 .00020000 ,000 004 4404 0020 440440 Ion, --n- B.513 a;M1b04000002024000000000VAN,004004.2 00ke 04U 0240 .0.0004404 444.20000004.4 2040 U 40000 V .0 44 ,aa _,dsolop, V
0_- ,i_ _nn - ,_ JE AD 1 T II O 0000420 20ui. 400. t 0 400002 ; 04'04400 40001000400CO
00,ULTMA OFE TA 0 R NT 00 0 ,DA~ o 25,400 ,04044n0 040 0044404020 4044004,420. 4 00,.0PLAYA.000 41400.4004001$40.4 0004'. 44-40. 004-. 400 _-_ 20 age-ia,$2,SI. oloam
0 04 -00V 40 00 000 4440 4000 I.00 p0040l 00004.4 $-,21 Reet i
REPARACIONESI: Ln 4.00 0000.00 1 -4 01111 C_ LE -E ,.o- 5o 0.000 hot.00 aoao 11n Io U E T Otl e22

.4t001", N D L C M O,$ ,C "in'' 4, 2000, :44 0 00t, 00044 404 --- 004 0,04,00 410H 04_22. .444 N& H 4400 -44 041000, 04 di."y O. aljd s 000
TAI'ICERIAY ~ ~ ~ ~ ~ ~ ~ ~ c0E CIO- 4o0 i0-~ ---0 20040 I ,- 04- -o- 00 0,, 40 lx0 4 0 04 40'0',0-44 00.0 000.00.40040000044-, 4004Sit42 000044.0 44200 C- alc 142 4pur
0Ver 04444044 y.000 dati n Re,000404 LTNE~ 00P50 .440 0NT E Y 0040 400 toO 020 "44040.44 ,-0040.0 t04.00004020.-440104 Cteooo 1940.4 pue A-8002 Reaao ambs oo T, ,,- I044 000I, '- -- 00440 440.40400I000000 25 G -1 -I I,"A Z TY
Ta~~~~~~~~~~~~~ ,000 50!0 y domo -1 It 0000 00. 04404 0,0! 0 0 40 t00 4 .0 000 040. 4.00.000 0400_,0 440.044 02040404o0000004 0004400.to4~
VFDADor. Tobaogaa 00 44440 '-n04 '- r, I, 'II ,.Fn, HW4 :1 ll ,o~ i. ?ORI I 29. 00000 0. 004 40,44 00,200020,o4040404440.2004004404E00044. tdoBelVegas
itt $0 EF T ,- $1 001 ,00 4 0000,00004000VA ,Vale ID CK aDA
CO POn JOYarn MObo R 255 .i,-- ---__ __ _ It 0 00 00 I0 20- -,004 4.401 . .0 .40 I.4000 Ct i j ONE -tit-10 t40.
00000, blen, 40444r 4400. .4000 000 00 404; O TrAr
004 -4!,',1-R141. 4 I 2000., 4 4 04. 0404I4I040 to, I 0420400, 00.000 200000144.00 -11.S -ovip-o1, 00000.00RTO, F nS SCrr CON
tot~~~00 Soii 04404iz 0 0 4 0,04. !"A", 2000.04 00 40 0,20.I T_-0 4-404.0, I4-I0002040-440200, N0440000 N440040. WIW, I00 400.00 0 ,4. So Tomoso 200o mimaTo
PINTO~~ ~~~~~~~~~~~ A II_ 0404,20040 -40 ~0 .~ $11 REA $1 00 "!wO~040042 0 ,000 4 00 ,200.0 02 t4 0 4020 040044440012004 t -- oio1I
40 0 0 0 0 0 00 2 0 0020 0400- si0-.040201 1
0.040, ~ ~ ~ ~ ~ ~ ._ 00000 000000 .; 0,. 0440 0n or00 404000 nOOO* 00NC RUSTI0C0 00 0 000 204044 .0 0 4' 0. 44020 0 '. 8g
000020000200 pulses 400020ll 404044:L 110 0 00 0 0 .0 .0 4 ,O '4a00000 -0 0004--- _,_Z _Ii,_ 1 t 00.n00200004040. 044000020000044400 -'
ore.000 y joiyo, valor.~f~O04 AI1IRAMAR 40000 C0-4 04400 4,-' 00000 04000t00 20000 -oo EF C UA O TO0040 244,004.N A IA A
000040400~~~~~~~~~~~~~~~~~~~~~~~ .l_____________ ,-~ 000 .0.024 4 0 n 2104 000, 00044 004 000 04 TI4. 00440 00. 040000 400400 0 004 0
TIPIC 11 i-EB1 2000002100 -0~4e00 0- AM TEL ,R_ R :,O ,,,.77md .3P .1 11S:40.2 40-4i .00- M_ Co r0 um
-010 5 SA-2,J4T - -,, .S __RE T0444004 _00 ba' 400 00 MISAMA0 55 20 $7,WS400 D 0.00000000002 ,2004440444-44ACAS4I .42.4 0040420 00000000 Ontt .0.
0004,002000200 Coas 400 1104~n4 1140oo0-0 40.00 2404. 0.0 04000 00020404244
00020 .lOS C004000 114>,,,.0P~0.04004a0044000 00200 _0 4 ,- 04 4004 404 00.400.0 000 I000,04000.0000440.40000. 441 a.rto~b4 To
44200 440404 .40 .4000 ,,, 0,0 0040,4 -04 44 0.0,000 00 440, 44420I 004 40040 440400402.00400 0 00. .44000040,44 At240020400200000
2004000200004240040. 0 !-04404000000000,0002004.0.000 00004 "402 000000 0 4 20.; -!= 0, "= = 040 40 4 0004n ]a 444 4400440444444400~l. 4-a- 4204. 4, li 4.4, 4t0 louoiCr
0004020000.0 A i -;, 040 4000240200000400. 00 .40040000,000000200000004I0,044 4040.I00.0 I2 0 0i4t 00402000b.,000400 rot ato lbrola ate,00204. 4,04404444 0.41,11N), 4 Pl0,. 97" ati
0044,oa, 4200 0400 40000 c 000 .4V1 00, 0' 00 0.004 00 40200 .I 002.20 04- -_ --ooo0 G-04040 us tanne21









PAGINA WREINTA I IARIG0. LF A MARINA NMART S.- 20 0 v SEPT, u 1949 AS XVII

VENTAS VENTAS VENTAS IVENTAS VENTAS VI tA VETA IDIN---O---- l'OI-,-A
5$ :t~ A ITOAOVIS YV A C C $4 i MAQUINARTAS I SdI MUERLES Y PrENDAS 5 MUFMBLIS I ROUNDS 5; UrILERS DE ORKIA- MATERIAVASi PR IRT ja 011YROS S MN
OPOTU IT)I) TANQUE DE ACPRO I ", t litlIII-. rt'ttttt a 1- at1 "I'o O I A N' LARORCATO I - i, --,, M---,RI, --- ra, tWa- -tat Atta t ssa toats t
It _l j-_, "ala '," r ",t tatsat l-ta LIJO O U R E "t~ la- IaI a a" a Pa ai asa" tata !,,-,,' %' ,-, '-- AS --,s Il tM.1
a I ~ i a1 a 11 a I"i, i a-1. i a,,I a ,o al -,r lard, a, I' a at' .~n tialIr -la as m a as- at :1- 1" IC R1 IJ n"_ _ _ ,ra tit la a n,, ,~ I -'': ,a t I It ,a l as- ,, tt P I . .b. .ta
'r N , I A G R A 0 7 4 ,titIa ri- i I at - l t a r h l l tt r I I-; 1 I I 1 1 1, aI -1 a- - a tt Ir a a a -a ta f V t tt t-t "-tIN S i l 1- t N a t a a a a -s -aaaas,
"l, ar arla ailrat ," r.,,,,. tltt Oai)S) NUE I Qal ta,~ 11 aIs~~f5 nat. as a. tat _________ -___
-aia an alaa tata Iata ta -aasta Ia a ia Vaa aa. asaaas.1t'!, ft. A. ,,, ft .EL (R Ny S a tt a
_ _ _ _ _ 11I I.IIPODR S ,,, ,, ,,"., ,,,,,,"TECAS
__ ___1111_ __ __ __ gutasa W1ti" tlacat-", ,r 1 - as- ta-" ,
t. at I las "saian .alt at.tn ,l', , .- ; -OPR, .I ta, -l -a nasal'l .-- - --' ,,, M I R naaar tata ,ii ta242 11t~ a- ata) UAA -V O $" ,iala-s-nA" 'tiA atltitIPt1 1
'1:1, NIG k I 74 'I' taaaadal$ "'0 t1ta tU tL "Iaa-.,--1,1lntttttry" Aan lttl),Dzr.: ,ta- II t I
rtaia ~ ~ ~ ~ ~ ~ nta~ rata raana 'sirt (I SO IlO IE SU O SI RAISAm r! Crittta ls. t Iaa It soat a ata saa altt ta ,d 'Ir
a-n lat tat I.oa .1 atstai tlatlt ar taa -att atita ;tata. 'tit'," Itt,"" L n ii .W ,,, 1 1 P O E IF L RNN V ,7 :A 1 ,hr~~ ra tha '-aii a'l 11a Ita atta M n rtat- alo tVa~ ela att6 '"0 ra i $5.00' 1aaatr In ai
,: -r: -a,-a Ia-aI a1 ra rtaatr Iutii .rta -1- ta It -al add -It-at AIR4wQ-UITE-CTOS1 ', IO T E C AIU AS RCO OIIO ,DE ' D "I R t4- ar 'I
at rraaath taat;a r ja a ta atatl 1art-- -qda aoasata $3.0 Pit0a ,--laa .as ca1a, a.~- ''" '. r,5 Odi Iaatrt titat $30 -a atla
__--_______I_______-- a hr t a ha t,htlhaas tI -t1 Iaas MI E Stlt,-,,t
i'__________E___N -----__- -- --- I oa Pe m i atar iaa l t llaa tarta111"*I" laa,,-." ,!'l
attn~~ ta -a tt ioaiEZ jIOEtN I _aalalae faastlti rl Ma, IA O ~ MS~ a ;a ~ a a2tI .a. tie 3 f l ams at $175 ra, anaIat -.1 'r",d0-Maa atn .a aa tanO baa 0 Na'i~ r-iaa do gA -. .ttaa Cp boialm ea a to ', L ."',- ataa .1 a1ta.1 a a t-Ian.-~~~~~CTIO atatatti atahtita palr rta tao, tai ttp t.atlttttaaa
Canptto aralt aar. lat "In.asn., Iraa ,a'It 'rrrat" as h Iltagatlta.- I1'La Coat dat*i Pt- a*, -."" ",a.at". a, llO-th"ta", '- a.
"IIt__ 1 ,_ "s -iit. i rh -"i --t- 0073e6-S asp. yaah~oa altat e.I JU G S tatROXE tttt dns ntaw a- "I lataaba ll -M- -- I

ann-sr.ni la. II ritas a- aan$a50 P tn-ra, si: tas lfataa '2, ta laasatt arata'll rrt.IT t-thaa aat --arladatarlltiatt

a, % FN Df laItIiha ia'ad":ro !o-aca 'laasaaaa' lna. attot-nIatIGaLdSI SINIa 0-3k0747-M, t, a r -to-as alasIaittatat aaatatTa. tt "Ita 'tlt. ha
-, I, -, ito PlatO-' Static I) trfl@"I Jjb~ll l jl-"Ile,- 1
_________r___ Ir' aIat ;r rgti- r. I- _______________ tria 0ad PTo MIINO lt1SMA PUENT( Do( Riv I I

_ __1 a, ata tii ahah at,, ,, r ,r, :- r -, -- I~_ _ M ,,I ,tu o2 0 ?191A S A A S
'Ta V e ad a ,'a a l .~tg adh .ht h h .a-a .ti aiih hh it far ba 7 ta r t ~a a IE~ a A G A G m o ra Ia ia i Je li de CM an---- IZ!, l duerfaa Ia tIeytw tnII. I IM U,, i Iatattr ir n. ,-1 - - --t n, ,Ir ,,t I- Ia Ad "I"' at a r '-Z a I,,


a ttat:atttta~ata.at I ,, : ,,-," tI 1 1 ,," r Q E 0
a. I.~ ii 11 ta Ialto araIIitt 1 ,I iatidh-' ta "i aahiar atsa "d tata naaaa atstt atatt tla a' "' "'% I t-t Col de Ce -. a, a tad', isa laaslt p ,
,r ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ nl a : ida te I0l000.%zw ON;f --1 -- -- -I, as ---ltra 1.ea tat Agtla l ,,t I- ti- ,- "'1 t
1-1 MUMBLES, II~ -0 PIR IA at lia h astr~ alta --a tl ,,,, 1- Ata ) NE S T LL ,S N -aa t t r Io o dat- -- --- .akt ta.a. .i a- I Pt- at" --- or 7V trae t "til a a llti505C 41 PU NT% ;al ra- Ir aha :h dada1a nra itlatd Iaiala a loaat~cIt 5!"i 51 e ,sd Oa _aa BoM tat I 5_--_ ,4__a- ta- fhht at tah _____________ Oat,1~~5 35 .1-57at

ra-,-iikttihh ll rihoI to jetu bttit Mon 1.1770 n."soeblli lo,, "I-Ii, "
sf v ndta P ccl 0( (;I nlz ,, I '" 1 : I 1,r, t, r \, AN(, m rl ,,,r ,ltopI, -,al 1adSAIta
_______________ -ia VeaIIrtgoI l l itt I~~d4li~ (Ott dot taso I Mat 11to1t.l- Oaiit .--ttl tk j.~ '--ba
,,, I,: ,-- 1 ; _I ,,__ _. CUB NIT attrtom (h ra a-a __ _ __ _ at ada. "llP-'",l, wxdbvI A a - ---- -a ta at taa ltt taoa itln draata Ll_____________ Kflerdrora otiapraaa-AZLJ,!-3Z*LJ oa p.Rd nltadt rlr-a ort. al.,pt
Iala-, II, ,- t I r, : Cao ,,, r t~ C 4 5 --9 ti t ~t Z, A taia l do e 4. 1 j''~ 4 tl ta Ia a.a.lo," ga ------a-t-r-- -teio ta l- -ot ttr :,ota-itlsts gartalt, I -a a I rtd aoii I 0- 'aular Ia OP N lN 0 1. dlta ara da Icdl ft rt ;-ata M, t Va~l rd, i Modarsa. Sairel 10 asUAo T Ia -odts 10 a"r "'lSdt
Jaiatd -oa. a a i _____________ ._on- aPcdlrti 31 lats ot:d pittr eta-AaOd 024023Ot latta Trtr t, ar
., --,, aribat ladai to aoata -,tar I h M TO E T R -. r- --r k Ra" e i 6 0 I aqdliME TOa -a aaatio lstadoad de-,i1,* T Ital ttaada 20 4ro Veddo Tell~o, otI ym E A _- 0 *5
It- fl- A5 Ft-,- ;a j It

I ,, 'r -'' ,,M.0735.MCl ,zao Iti Cel" raiad o Vaadnat ala ita on Eaipcdtralil tos
at ta-a ii. ta at I ,, ,,n -ha--ta-,- ia iaot t '',,I7 r 'rt. tll, atal taalaa s a I_ _ _ __ _ _ .rett s AItil r "Ie lo Iti~a Iso vailats aI ,o pir
I tttatritatttaa aa"a -a-a I a~ta ha 0-- ta h a a -- .u a -al ttt I 3o ff T NI A PON6,4 -1T SENr miasmra e. a oma ri tra. Al a II tac tto a na t
E VENDO PO .AN A ha r. rota I I, -a 1tas l'1c at-a1-a t-- t-tt aaa la* Aprave--- --asaa Vilo 3 at ann -- Pleat- Yo- Stat
;,~~ ~ ~ ~~ ~ ~ ~ ~ --LE "IE OPCS ar aa-aaahIaa in maTr ralY F ARC d ~~,,Cp, IA
__ __.a i I-h a a -- I r, Sala 110 -t-da 0 t. ola ,OII O ,i M I 1,P ratas.I itn -, [ s aj~i do, -srt t d,%obla ,,If t~s- i i rrrh ,ar --- a' tr "I at t; aao1iET n 1-a idar. aaih : Saasitstaa V ala'. Tall aIta ll tad, t
I, -, r______.___ 1 a ,-t - a Paitt: da n ratth h ta ---- -- tl-ttiata C r ",____________ ____________x a S a a',A- -, v," t l ,iaaraaa a,I l r ,-a- ,trt Iht ad ,,a ata-0 r, asi as ro cA al iat a- IS,01 P RO F Sr AS, a.y PRO P O REN S N
BUICK ~ aar~sr ata hPERA a II 56 MJSE YPS IIIII 2., % 1 f a 1 l .1 a d: Iapoa~- ra. a I,-atlt de ;-~S rA A fl ;j11 aetsaaa-s totatat '
MU D L ORD. A a -atd rt IS-U-07-I30I --. Cl-jtI" nje~~*-M 1 Gal ULI1ISIIR asc
,, -.ai. :, i o i r,?, Ia oa a o Ma ____ t- I_ _II I._ - jj);,,A tlo nn:(), re fo
Pllit t.M t[l 1(1 -- rt- : RS SUE I~ a I h hI -5 gottda a --ta --- A Lastttata' ,j "laattta-IIaa-Milasdac~fpf~titr .hhspaddtatta gira' dI Et-t a1 ,,- ,,, !I A F A
-,~~~~talt It- bens agraIIsgad)laCt- I I"
_____________ a I'lltft -t aO It t (a-- daa toh Saaa ta t a-Ita dt a a-tttalalla.ttdat edta
a hht at-- tatiatat r-da ata-C terotts te Fbrlaartat oraa atn. a t~ ta, tt Ittaa a an tat~t. ttaat tattasItatas at
otm toa DOrGr 19aLaaa It e: faa agIZ M O 5 a-,- -, e q:,a ,aI aba- ,It ,, a-a- cd 14tan ata 1 M0 tie bie al" -,1, ', iasasaatlas -aO ato r atalait tattarat at-tnt. 11
_ll n aaaa ta a ai a a IttcTf~ timi mate ietb alattii -.I atat.Saa aaso


TTa ar oat. a it atc eta I-i Oat E;tt aIt Coi al amastatta a, a
Isa tali, aadr -. ,! -la -:%t r r I JA CA - CRI I aaa a Itatlat attashatmata-~ 'Ue0 '
", tar it raw Ecl, mf aaaa ., a" t 1- I---- II I,,- I I; , NL IU ___ ___ ___ ___ __ 300, 0E apia p~ -ompaio taas ", a aatas tm a'Amatm
tati a, ma- -,-_-,a , -a z,,d : C -a a -ilta laa-raaad I ,T N i t at 1153 I t I a a, a ta .ssa, a as il~) CEJtO 1505 o,-] ti -t 3 -3 nnc antad aalta

___.__ a a-"I raiat Saaaht -VatItat apa-- t l.r a--a- t I Ia. a -arItot1 aa--t!,,atalln alt to:sa a. aas -aataanat aatn tt- t- -5tt alit ravx asn al. a. rant. -4a5,,etan
".~~~~ ~ ~ ~ La-1,,N ., ^ n rtraaa 7/t :'i _aaht ar- Oh t ttiatha aa. "'t"tttatattttalt -a--- II t 1 7 E 17-

__ __ __ __ __ -l ta.a aaaaaaaa had Itton it siaaiaa t--- ttaaaanadatit.Ia___. -toatattIItitttto l~o ltms l,,z:AKmay ontoas-tl ains
-r.~~~~~~n a_. I' L tIl 1 ar.a ata ran a an -ltn I- a t in ~ racats tar araraoan, re-tat
1--- ~ ~ ~ ~ aaa caa ota -a- I- -.F -F "I" a trtatra-ill a =aat nat mo an sa tari, ta
AMOTIGUADORES- ", t-a t ra5- a -has aa --a- 00a i---a Iia aI b httr Ag1 ai2z tF, ,tra-a alaaas ar tt;,i a. anas -a tia 5j f,$ a a a
-la. t. I-htt ,ha hb~ -i ta ata I ta.aaa ,. aa aa:na aajataaa at at __atatttts at,-l'1, r.as,
-'aai.tjada -4iiaaaaa- Ca.ah Ir: ,aaartro :La aalat t 7o.1a ust l ta r asa
TALN" AVNV --at taaraat a-a pa>t 'a-rr ~I ana. -10 tttl ataara isl otts ia- QICLEON OAATA EDI As TN ad alzt a, Etr a s at aoa gaan
a--E --I-ahhlaa,: - a -o a-altar- I - als-- ari aO attsi misa as ata m n naa stotaa,attatsittt I t ta
SEVNDPO MA_ A;-- l_' LI ______ __ __ l_ _ _ _ _ _ _ _ _ ___I _" -_niOTNE___tI lt Iosaelnus e
ri~il, 1, I 1 I f'- RIFT I W A R ,tE 1 ,1' l" 1 ~ s 1. I_ _ _ _ '- a 5t a a a- ,Ftt tt ttt .s. dit ri io re ttove taaalo asa ttt i on l ,V l j s3 9 ai, -1a1 1. Ptee.taorktaat atat a r -a
lel_ ___,,I __ I-tata r1 tartar atts he 01o -a--ftatsr- e t-'s--s oa~oatatttaatstlt
_ n r- tai-"- a:Z aa-aa tt -tss , 1.- ,1
Dj .,-, II" -- iAr 1 I I I UIA A ohaaha-ttataas t- ttthti tt-aa tuna-Sa te n e-na 1. 1,ni -75 P dr a aN
amUnn. tn S ay adosat poatt e s- nato. ELFastttat fla ____________ Sp,
j.-' r raI atI d Ib-t dr Ia- a sataai a-o aa s h- o-b 'Iirraot _isat~ Hr ,aaana attas 'I !t~dtdal -- -- -- Dt a e _ __ _
b"I aar-ha tta-dpha rI l ,:~dit~td taia~tt7,aaalaa-aaar,laatataaataaotioaottm a ifanu~~ -tatatddts.a5 si --ACa.LCrimp
ai -a a-rr-fha 11-iaitaraat a a-Itaaoa aaakm nao uaaodaa ear EMUaaGtlijtsttatta ENo $100,0tanaon fh rettlattt a t s ntttaaa"a~aasat eon-'4 ataatt aaaalt at "' a 7 ,


I hI ia aaro r- at-" t-aa- IPCO IA TRO Ia tio Ii atitaoa 1 Paaa IA&tta a-Iarta '',,Oa'lC ro -30
asa -. a armA BEOETE aGU a ama1o 1t.- la~l -1n
'' ', ,l M E LE tat'S ia tatado atoia Raoad -H -08- -25a a Octt.s. aaa sa. rttaam t maso"'- ta" n-m r-a Pattalttsoaia~ at ta ,stttta amaa -," ,n ta ta Iaatt a-aIU ,%,R I 'tz

-11 Ita Ios I- r -~i -1.' '- 11i-a r- I lao z- Ia Iei~ ,,,at UU"R~ Il E IW L a I ta--m I ras .tat ItatI-o v aao ,, ,'" 'll'.


"' _ __ _ -o~ah rt- a-a at at ta -N~ IG __,,,,_,__ M EM O a-na -s. ",oboiaa ,s gk" -a ra -a apatatada Ittt taA a T--"'L~4 --I D"a"st-l tat.s 11ST.-:'% I I I W, ,an."I' ton eaata:a'-aaaaa ata 10720.l rat$1aItqoaa TIa& de-FOaricTatn Come: 203, aa,,i1ala1--1&--1- .trCaAm % Ftltl toe Pasta~
064 MAOIA5A data" il,- 1 "- I- 1- nato sblits, tuera d -h-o b -as POPL
at.- ,, saa-tii -tth a- a haa-iaa atasa ga 39aa~ ttpatattl-2-- I
h-h;,' ,C,1 a .~. -- -- :-o -- at -a Al naat 0 Sabre atqw) Trat asasaatra yt amas aor y
-___________ It as as a a as a h ah.Asrat t I ta taClsd i C n i a~ 3 att ~ eat --s O asttta oama. It____C,1,\_A_____DI%__I_____ .010 CASA nOLE aataaaad. a 1 ,- --a 2- aIaoLa ua-a Inez0 corsonde tes aaptmapea a -s,
I0IPE 8OREO .oa77oiO0 JCEO CU RO - ota-at tirtia itta gi-aa .I IM EE ALE jMAO T I -. .t I t111 ato -i abjta- t.ANAON M .A
i 1:-h aapr it Ga 'aIa -- a.ue flu --n t otea Aete amptas eats clJp
MUEBLERIA '5PRATSEI lorga-IGreatist-'"I'lrint Gpo,-,mt4 ._c"_--'11"____1-133. 01:72aaCl -si arttt ate Vat -ttsa tat a-atd-at- atis;ttaa
a r- a~~- I a t a ratdo ~ 0 oleqit o als trtcaai ra Va% ata & EqatiS, m6," a ta amat In -E ,Z- h tat
I tt at1 T a-T"I1 l "I t ,- a-nn tz-, abAc ~

a-.ao son ar atai a' a dl CAJA CONTADOR~ A A IO NAL DR""
to ata "asarIitata aa tai aaat atts a -a- a. f taaaa Iatada ma. -aj pr-ecaXs I1-I
tabO, Aalta t~ a1 I ,~ -Iadla -t o*na p m .e avettatt4 ili s- .U- na,t 14. a -a- s'-taataa L M RI R L A I~
aa~atait ar- \a'Iait ~t tead._________________ It a~a stta tatsa t rtat. atbtIV tta'. Tiaipit I03ISanatIn ttlt.sai aaa t,. a t -a et'sTatatt. t a
t"I I I -- 11 I I I'll 1 . , I 1 "taoa lttllatlsa. t141,.a-s5 "21r-raaa-ao a1.aIas!-1,tn otat 3st11t. Hmaatatta.,,,a-,s ts a --,a.traA
a I S .til 70 Iap a-tt" I~tah atatia isttst hliit r-.t-aa~ -a -A tat. ---ttat %aattt-





AND M1VI DIARIO DE LA MARINA- MARTES, 20 DE SLOE. DE 1949 1 P~ktINA TR'I NTA Y U 10

-ENSENANZAS. ALQUILERES ALQUILERES ALQUILERES ,ALQUILERES IALQUILERES IALQ UII EROS IES-LICITA
77 ACADEMIAS t 78 O~f1 SO _E 82, AARTAiifmEI4TO I2 APAP TAMESTO 0' -p itA1trACIDSF'" -I --I,-- - --I---- --- PA_ Atl AND -11 I) M- 88800 '


IJNIVRSIDA _____AsO dOLT sirsF. Peso coon- ,,, ,,rOS __ _ _ _ .b AP, ICALASAZAB M 1111 I I 1I ,, -I- I
% o r,7 ,or "I plts -st-orol 0. Bo, *-0 o s or _%,.O.r.r Is., oI".sor '1 so -KNA-8A810 I , "* "- I -1" ''l 1

I 0-n ,- I 1i- I ,"* rrn :rrr'r-So 0550 -ss """ ossr 1:rcr so ,: -, ."5,as o,* IOIOICIIAAADA.-IEIILA


rrorr1 roCP1!1!Oo11 AlO-EL 'fl-,,E ,flOEL- "_O__""",* -P-TE-_ .1r c, soo 50, IllI ," 50 I't ,,, ,,'i -,, -, -- -I I' II I f -11 IJ N I__ M__ c_ ,,, T,
__ __________ Itoas n vists HI -_____-_________-, ',,
ACADEMIA PA RO -oobr ,.oI.,sro -M-ts, ,- I 4" 1 "', 5,- Ir'le
rr O rI ,-.oa -,, -i C- 11s IO LIn s Ipe n n o o -nno n ''I__ _ __ _ I'l I'll r,, o

;nj-.o p1 MotI t'poo I'lr ore1e, e,, Isc no-os rr-eer I-' ,- s', or '. sr',5
o ,,1 ,,Il 1 1 11 -o-ss -5-o -nrs orsnn s S;rr l, ri s ,:55s,., so ,-,
5- IS A- 5 I -o. Y rror-o1 -t11t IA IA1O Sreo- 5-OS 1,r~
""__ 51 __ 1 I'l,___ _____1 1--o-1s.1 r- 5, SA -I0JI Il. LO A OS r O
CASTRO~U POa' s ori-o s ro APRToerIT S IN i9 REo A -" ,os 0" 14- ._ __ __


,,,,, 000 ,so ,o, Sc , __________ IOS- - -~ ,e-ro '5 0
D1"" 1D'n" m-itA -- Sle 555 sntioro $oes, fo mtcoee'o o to-e- V.o a55 0, 5 ." .I.i s. '.5 118 _IECA CO-AC --------5

O rS- O t r e ,; ,o o S7 I~~ so s -s - - Il 1 sIs Ise s o -1 ie rl o r 0 I 0l I 1 is s e o os,
so s so S e- ,O -: C- S -.e. ,,I - .~5 00, 0005 r-0 0 S r
"" - o s 30ot r- I. o -o I, I I 0 -i I~ I~- so Soora -- io~ s e ,rcooo 0550 I 50'
-CDMAO IMS. ,M nonitraao rcoc r e r" A m Ov Io So e v -3o AS Ior-o os- c,voosrc "_ _ _ _ _ ,lt~O $,' I AL
50 -O I Or lf _I4__l -5o Assds 5 S t ". -no-I t IR CR- A CR124005 0
~ l __RtE ,_ilI. 1-_. _- - I -1I I, Ai__ so-S As -Jss A" 51 A Q II5 EN -PRIM-EI.EA. -1rsnc0'~-cS~~eer~,sc Ac ni'O1,~ 5c5 ,ee- SE Is Or-SllI I
-;. .,SE, lgeba n', AL .OL -s 1 1AN.1 3Os ly 12 ,- Atsis-so 05oe 505501n.,5550500505-5 Ii! ,"' ,
ores-, -Rbj '00 orocs Cor r dns ii ISo 005 a. .911 P -,h- It' 50 o ooa as os So_ JOSO, on2 r-r-a r-soo.i05 I- I0 05s5O nennenno Ia n on '
~~ 005 00 r. 0 ,; GsO 0 srsson r so Os r1er 5n 005 sos Aror 55 so 05 Ii Ori,",I II I .,4: I
-16. ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 088520- -1soscssdssaacsssode I.4. .I413. W ,' -''t I,- ",I, l I o ba' ___ AWit_________-__I__I__eI_,1
50_5. RSICAOA F '1~ gs ot -0 0 I O S0S oas05sovosoa lsfreosoprt- nsssor0000
11_.-HOR,_ %o 1 'h e-co- n-7s- - - ei~scdo- -i ,IooO_ 1vOO_ 1 I I I- s1 I _ t ,, ,,,

t o o' z o e IIoIc ', ."'m - l"0-- Or 0 I 'l S I 0,0 -~o ", I , so s s so ro So r o 0 I" r I 0 r. 5, 'l,50 0 11tt~ s a t 00 00 0 I, rS rS S Isrr Or'e-.I: ,i 1 : I
4,; ,,= IL,0zS-- oS-O'i o, Iso,0 Ocee.- -oS so. is, ,-oeoro "", S1' Czre-no", ,,S l x, cn- n-onon 000, "010--~ -- LA I R A osos''tos.os r


O cIr-Is-. 11os a 11 I-~ s S Is SiSS o 0, ,3i o Is' n1 S -o s 'l I ~ S, -- s r o r rr o -r---o-----r-- ,"Il, -000 0 I esono s c n 00 ,00 ,
ot o o r ool a e -- 5_ Isod I ?, foo N T~r _o a e- e s
000~~~ rerr.~a I-' OO '0-0 555 oSSO 050 c55 S, IS, Os, _ _.__.
rallALaUO0 APAITAREt'T 0 PlzNet Sosu o S~ ois e-tOo N %00 ,0000_- 'lIi-1, T1 I-,11II1 1 I AWP i V,,P ; -Il-= -s-so-esb"' i-ore oo I, c e, 0 s:: _,si 00, .O I ER1C,;i- s ISO Ir ,I 1 1 1,, 1
cc7 c- 0N0 ,r~ _c~ so Soo 50 11 Iso~ XoI~ s CAI O EU' n noos ooo cers 0
_LI IT EIRE S. I s S s o o o e r s s s 0 5. tsIso e L-rs~ 'lls, "I ll' - I- ,, 0 s 0 0 0 1 - I -5 8 .
- A" n -1" ll " Im o. gao_ Una vista H_ _ _ _ _ _ _ _ _ _ __-_ __n _ _, ,- 1MANEJA ,8Oe I IS

,0 ,oe s so '- ~ o sc oI I "os s 05 re r -, I I-SI t -I noI LACADEIii Ad testso r in PeO io cn mcs M-953 soosle ocs _n ooo'e sos s"r ro sr-S-So -- ,, .5 .1 000 Oroe o 5 55050

es' oos o 0 ISo I0 00 r s Iro~oss ns e r. e-SIo, ;,,, I14 Io to o;ocs Ioosj I0005 Isd eesrso io. I50 1
A~- ~ ~ 0 t. "I, I a : I ,--_1- __,_,_, I'l, "
-r a1 solo b- o s --s I g 1C IR 50 1 I S -: 1D E 'A1A DE Io so s Io Ie 5~ L l I I S, I I to. I r-Seo- S O
I 1 1 1 1I- >O OS Ir _ _I__ _____ _ reSer "SO _0 soS ro-ossS I I ,:,7
I NOOU T i-coN T Os 055 er 'Il M i ar o on A v A eolc I0, I--0S Se I822 1 l, 'i I I I 4ST. ITD I I
o d es A oYe-ar i .erres o sM r ,o -s I I 1 I I I ,y 1 1 I .1 I -_ I _- I 0 00-00 1sod% ,O r- I lA s A lio d o r- I Is. IoIoi ri -s .JAD1R31S lo o n oi-s"so 'o rs
224 _s -cIs 1y o Sto 1. ., ,' ;.50 5 ,5 0 88-,t A H A-T C O r I o-o -o oi -o Or r551 03 Io s r so s o s C5 5 I , , I i I I I 1 or o S I ~ So - so a d -1 o 0005

s e s s 0 0 IIO O 1 t lt fi ,,t", 1ln -t ,' D o L V R ) A S I A V I D O I
Sr too".t --n-~ C" o ,- NA I --~ So n~ o r-r5 I 0 S 0 55 %5 ,ios do 55W 05 I22 3005 Sc Io sro Iso e-r 00S OOSO so os005000 s(oo m -,05 010 5 I ~ e 00, S55-rrO S-sroer-S ,, 00 0000 0
,20 Sla Ii-oo Orro 5 e-rs, 50S ere 'e'rSo Q
'So z: ,, 7",I %,, '", ',"" oSros 055 0 I4 OPCN 'I:- I '' "" I- -, '"
= I.,!_D_=__ ___ _ __ _ -_ _ _ _ _ _ odr Kosd 050 0 tudo As- Iror Ios IeOS I- COass or ,I II .1, I I 1 II
RDE;tEAZCO o- roenos;" 0500 L.010i-~ooiiO osrrro s 0oso 7' Csoeoog-oA- -1IilI II l III IfarronosIJ ,f Iw,
_ OT IO 0 I 5 ', .O. .o s '. 00 l i r s n n 'O s o 0 5 o s 5 2 C IID E P O R K 8 I ,i- _, -, , I I I Il ,,, ? 1, L I I , IIl 1
I 11 ssI s ri i 5 I I iIrT 00 s 1eo- 11 I arso- 5113I55 -2, 0-I 0 ro,-e-s, o 5 0 IrIIsI o, ,5 I5 ,ro I I
C As o S TR O O or -0005r500S'Sot -o 050 o, o s Os-r Ios~ o~ Io o 0 0 e ,o e eS -- NO Ir osr1 "Is- - oI 0- so s o 50c N 00! :0 0 00 0 0II00Il0. .
cm'. ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ o- - 0 0 5'" on 0 50 or -00 0o5n .Ioa -, t - 5 0 ,Iz 1 ,, I "

I l~ V-s do Is AIrr e o eI coI ore 4Osr 00 55

OroosIr _oSso~0 050 5 0 7 p on, Issner To F-, so OPC IS

L A L E'IS, ,SO H ,n ,o 05 0 0 I -rs -- -_05 uOCO i-on 0505I0500l ;

HOTCA ELM IA RITZ"i __ __ __ __ 11 X,-S~ -05, cO -o -oo -________________", ," "_- I, II 1 1 I'i ,- 1 ,"1onM__ 2__ _ 11 7-__ _.- -_ AI ST TA 3J G R P CONRIEETENO 1, ,, ," 1," r'
m ar o ,d o 5 O o t 1 si 9 a p lo s* -a 1. . I so e s o o r -o 1 1 : - soo O s s- s- d s- o d 'r oi 1, 1 - I ll I l I- o os r N.:S, W A S "ID I A S 1 1, te iI os I I d, s s sI p I5oseoooS Soo o0 5 - --,s 50o-550r'OI c e srr 00 5-co',0 05005 505_ 0050 slt-droc uoadro. oe
S o 50. O SoS-or o -5 -, T0 1 I So -5 ,5 -S d -s ro s -co Si- ri -e O r os r So So 55ol I as So o o e s r - j'- " " 1 - po 'sono s to c l e s -s'

so ne-i ____________ IEDDRO RF I0-sO
5055. M-Sf. a i-S.V ISO50 __ __ __ SOO r-1e-1 or -o-s 50 r5 5O So_
H O E O O I j 0 s o ,'A= o-o", - 1oo l0 _c_ ~ s'e-- Ao V555 _- O o So Ors UA W orn- SO ACE ITF

UbtlWA, ~ ~ Ao. 00 - I f0. 5 i-So' x : 't,
soIt _, -e Sr-" Os SoOS -rr so or-n oe- i -o- _A de Se or s 000 a!scor Or-oe so-Oo I55_0'SId. J 1 .I
0500 ~ ~ ~ ~ ~ ~ ~ --sosoHooeoro -r __________ oo5. 5st5 Ioo-- e-sr-! ne-vsorItl rossrisr ni0'0 REEDE)OE S "5;
N,- ~ ~ ~ ~ ~ ~ ~ s a, -ooe-50 '-2-. l ~ : ,n o i- c -ace 50 wor 5 ros 50 - 6, ~ me sua n e- ; E AO LIA sosoc O"_0o o
52 t I I 7 , I m R 3', S e 55 5 s, 5, co O o rso o o 05 5 so ros o Isb 50o 1 oll Ir-~S o l Sc1 S e- .oso. .o s o. o 0 1e -- n-- - - - - n- r n or
t .~ o s i o _r , l o I a I5o r 1 n o- 1 o s o O s o d I 0tt s ie o1.o
HOTEL M A HA TA A -" rs 50or t' I O- j -'l~-5 -ioooiso 00 -oe-r ,d ods os. I oso r 0055., 'sor b-os- j a11;)o,'. ,;M J

CoS- d.o,1 "oe-foo treso 5I005 550 l5d00O5 000 0, So Odtrlt ao d sn Ropoot CoorsRD il '_, ,', ."
,~~~~ ~ ~ Eo -~po df -c n d l~r ld


eons -I -O~ "e z0 200 Noesi Conoi 0 n 5 p r a Soo ""rdrooo 0500 "'Ss 5 Og r 7 r. r-o ri- e5 Ioo
Srn 1 =5 -l",oeeo 0E000 .s S Or' _os _roo~~ Sor-i c3So looro bs--s 05 orrr Srso e Co Ionr Os r- 1,000 i-or-no2,baR.K
'00A 0i W-00 0- At-O 0- 005 n
sic ~,, ti7 Osoe _~fsi do 21c- rooooo. 15 Ocmt, p rt&-eS s s 0 o soo5 oS

no $79 Proo Ia dia lr .srs I soet ter" 000'soo -5 ROIITSS jj, 0"-AS00 tr mjv D ol
i tt, -0 Ie -r r 0s 5 -5 0 5 5 55. no. nI 0 0 0 0 t ,, a I
o f -n g l sh075-0:: O ct ; 1 ._ 1-2 l 2t o r-o or r-r--r 55 55 -r OO-S ,,na, a ,~ ,i 7 I W S A -t .











SEPTIEM RE 20 'E 1949 [IARiI 1W LA MIAM"A EJEMPLAII: 5 CNAO



Trp unpin 1-a enp ci 41, N at s




Sa ,Rafaeel l hn 'Rliln "Pi' aa 111*aa a

qu agh r;!lsda de f inza. Arn el o~ti K 1a

-l. dlla p- IE f1. Qu inta A, vai I d
ha oho -uia ho 1 1C. -~ arisnao. Raz6n: oracn
A o taw a V.1- h y A Cty
h(oaIA-pD OOAA Aohado-ta1o .
Vaoo 11o 1oan
IR-4ilade pi OAAO~ ~e o A ohA
R- no11 j- L. ~ hl~ ,Ao 04'-"a0(/ 0
'r Aoaotk 4, la o'a o 00O o~ o L 0 0O0OOO 00 0000 0 00 A0 00
Alv oa oo 00000 a'o 0







lo u Poo~~o IA0
Aoo23-o1241o0booooA'yo000C0000 j00(0
A7i 000B0000.1,10,oo '0000 00 'o" 00 000000
231191000000(O~Aa00000A000O0AA000V00 Q. PIPoo p-taOO
S10o00 000 'oo 000 00A. Z00 000. ooo
23-1105o 000000 0000U1401000, 000 "000
M0000000000
2U8 NO .I(00
NC)0000000 MI MWo LI.,00(0 ot o~o~t


o000 ooo0070o0 00000t o 000010*








AA'1,oooo,,t 7-_ -__1I oooaaA00 t~aoo~I

___________oo~a 00(A'





0000000 00A00 00000 00000 h~oo~oa toAo opoolo


ooaooa0000 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 4 Lo a 'o0o otoo0 00o'o000.0 otoaylo

1101111 1C 11 116 0 oo~OO oo oo Aooa 0i 0< 0'oaeto















(0 0 V~a ,,ooo00000 00~400o .ma '
23-IfiD ISEIA. oler. f')Ullfl ~llIlCC X AW #Unl j~00 000/000 00~00 0010 00 000001L, ,oA000o00 ~ n0'o q. 00
831201 MOSfl~tt~e ~ 0 000 00000000(000000000000000,0' 000000 ~ja oh 0;,. 0o0 00,4,0 00, o ( o ot/oao/oo'6






6, 5, in o n~om/ics o oo
cs ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ a 50 Homeo'ooo~' 00000000o oo0o Ae000O0kAooA00o0
0000 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ I rig000 01 000 Ao, 000 00" 000 'o' a 0~oa .o 00 94-190 dorra al000 din 28 do piimbe 0000 ~~~~~ ~ ~ ~ ~ S 0.~te o00000000000" do 'O.Aoo'.00 0. TX000o0.0
-SA A Aa 0 0~ 0 a 0 VEOAE tKIE Egojo
do ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~e Cao 00 00'00 00'00'0"A ~ k00000 0 000000000dodol 00 CtN CDCa0 0000'00000 CC0 00 Oo 00.~oo, ',





111p oAoooooo' 6,o Mo000o odoo0 000aa s
O~oOooo~o~'aooaa'oo*~oo Tell. B10A O 914
'/~~~00'oo~~ M00 lA 00 An 0 o~ z0,0 Oo























ACTNAC NA

































domro l a t At A icom <.%>* apsaree -uddes pm iut uu ee S-, cnr coiur r Eso n 1. drwho y pn 1. mer tar Vanm eln y. et- erena ys arisica o 11 C rian a lP rter a, Ache-n Brin y Prr.vl de luaawne Da Mlath y breth



















aro en III L'r dleyree rm Ncr u dio qw costs V an vb a w d e oasg














en70annt~~~~'I rIT o cs nit ea lm





















IT ~ ~ ~ rV Atg2 ann.




de wagdoa t) 'n mmo rmo (Fet )




















ean 1, m rVrl, 7,11 VT/ r a TI












4S DE LA C
MUM ff. 1A MAMA


Pm


T"t
Tt
-T,
T", -T,




A;


V










1-,f Tt





TT IL






C- oun luelft F,



W. d. 1. 1

r.W

it. Kd-ft
wh-, .1
F-moto I.: :'T 'T T
14-1 Y wbm Y In Zu
j
lym d. F-6- Cbln- 7





E. .1 Habana TE Club w MW 0 ab -una flecla herruasuWA P.- clftuvur tm tanypo da d. Vaewe AAW, qu u0lelft a, 11 =PT11, .tdame ft4 club It' IT
carlm ronts. ft l kl Rovea Degur. rlli % yl %= d. Vftm I He7."dus do Lllixzz Y 1-1 k,
PI",zi
Nemzi
Z!,
MlnW
ran


TI












. . . . .






-ft,




1. E.W -T


f't.,
el, Club,
J-4 J.

P,


















IT
y
A Hoyt




-T


E ja ;gl.Ja de ta R.Sta 0 d.-POwen, -1 d pj-d.r, Ig sefloAt. 3 vIllal6n Y ol doctor JUVIW ralz Y Garcia, I>- --I-1, rvr,4,d broa fatogram. A Is Im-lard A.doao I. en pfteenela Rydo. ftd e Huxl JowU. Gucia Elm do J.*U Al -tr., 1. "via, -1 dmtr Juan Manuel menocal Baryom, Y a Is dere bl*D40 la tellcitacift 4. 1 Zmalt. menocol as


T4i,

L 0



P-I.amal Pr imap-lblo d--Id-uzld pl u- que 11 da g-pluo .1 Ill. qKil
-walta lu,17 bl-, P-, IT t
1 1. Quo = 11.

Pr.h;- di P.J. Y -m. 4



re, dir a h n conb QUe crela i-t-lbl,
I CA-SADO Cl-& QUMPLI 6
'F
whd.d i tiwl- VZ Z, Gvu Y L.;o Norieza, 'EL
Qu-FFE














I4 \A tfov. mpaea

'RONICA _'HNERA OF POS4A










































































o













tta a dt] rnrw-y Clm-.,jr soo














ST.NTRmCEN o












MDtf@B DEIA MAllMA















































de l0 m o t;F ,t At- y1 ITi,
eual Angel Csd es y swa 0, Reker tn n Ao G t n11 y nurstro mpar, <00 G6 y agrac ada comaatr d0 DIAR-O seOorn
































d o de So yso d Amer 6n
Itst

































ITI AA




C~



N P-




Full Text

PAGE 1

'elieitn al por un e(]¡ Organlizari Yatron ,t a 1919~3,J !,,,!Pier aa a tf loiitr# bancoslsinednitt omsiaEn oben al guuen hub Dcil ceal, el 9.~ 7 1 nl t-, u,,qli ar. r~~ er libey y mbr dlb"r. ogstg&aisedsncray& uea A uetoscopoms ut umi ag por ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ -Jm i ca v re enb e elrnt __i. tr 11yT, Plueonee nad aesbstneanaqe u eaino opeaanro e etm .1 7Id dsmsaee atende~~~~~~~~~~~~~~~~ tid lhm aaJn&Ai.enms uraqenn prmrs alud,,s ~u 1rdaloc Y MM, tcsps Tned n aat e y r abore fp!P 1a, "cu 1ni' ns 1om C., a bk sM mj o aetaa lmnspra hiau oreors meta eaitd r 1 0 t b n o a e d ra t -~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ju,1Ve ids ua 1, nad e-, de dos Paes paHast el mogmento let leval ltsiood isrcncraomypot. taoe lesocroiad de.1 e vntrse lC Sr, d. rAmistad Y eHaaa no ts or a ra e itn idosdrcinyaeEnrlc.alrgeod Tisea "ooi"hcinoacneraie berd em mperaau ~Z cilrra asciender a 120 an l eontudn eetal loron ess¢iocoosem-snodltrrtro tlansbr u umr e o uetsa 2-eaup prm lscndcoe .on, J 7l r l Ir 10 manr ipoii nssor e e im csera le rl tar, -t,, 'r Blcarrem; de rp teraal a b q ed ua ~Cutcul ;!d¡al re auaaprlse n e ne le ei eir eH n o gn s a "Deant I.e,: que la eaoAd ew ea, d Lllpeo e pea iG ,N hni eptbe tl! Y1,va Jdavz e sn lm d ua n, btinre eT e. -l,, odlmac lis S l t bi;a doad y u labe S_, ecEn ritd dls aa r d nc i u a cba al 2 r:A d e ri"tey "NMODIC, rhaeler o lAcender min pa z eneaif r U SieFlp eopr ei a hor yK1 a eev e pr mn i d tito =lw lmzpd saoyocree on ogdsd lfnle unoextnpsbiiae es oez e o imo oets ioAhso u o ple mr u ctt deltu 1.ue p.edc rvima d. 1. truettd. .120, u n a de l pi aco e lo e l rr u d aL L s a t ri a e to a m t ras e p cfi a e c da e u c n o b z s e c n ia u a os te e l e p n abld d n a o cot e n nt u ud em s e a a ec b n tnosd a iae5~p r d s o b e pc, y a a e ier nti rti n c m er o, dEl cacdo c con S ei eb s t e i do e vvr e a ne nsu bj Zj!e aurdo detnne e e e a de Y1t nvi d2 ,1 es. de. asN lonsU iase ~ .p,, mantenendo ~ ~ ~ ~ ¡ Biruu re!loni eaiae l dseodirsasde lo pei d e g up. que clomo u1ahonceaals a ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ Snt e¡. trea deer 4u dequd rsii ns u, o pnmsaars ILX 'ol "l %L a. cta.ld ree uefaena e oien ubl o n o Itende U crmio c, ra _T r est I. si rn r ltz ,an ys u ,a -11 e n , e r ensn -e r o s ialat r 1. mco¡. Contais c m b o c a -~ ~ ~ ~ i Re.t jG ind anoche enoseruirnhy su s p e t azo drc que ello ea ocac dpidammte~~~~~~~~tdet para coifrr. laddne realeet de Cl -e lo imslzsyl im o U elsEtdsW de ali man ~ ~ ~ ~ ~ ~ ~ ~ ~ nl derm HongK dcap.ti caapolm itaoa E d -' R' i*"'* a eErp u eo R RO SK -par "" -"we ern- 11 R liO do rm d. ca mens o adeeend-11. e .¡.d. eatlnq epiraos r ee qa a ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ l Crbjdrs AESCi! et 0(ats pre acusd anaE e et t ia .t" eler gobierno cl e nt o afez d oiro asi erose ureequeEU .a c metdO laComsi Naionl d Cope.Unias e Jaugrar ho enFa hijra, se l(t tileob 1 r y apr tue tre D utae Gva apoba .pie.,me i aese t p eos rcha ede l OranBro tna g a VeegtliOCRCI D tania l solun gobal el cofer de, obriorpiamsone 01 a le"m -ee sre"ar "en us-es aberad ra de PAsA -ptemr, 19d.] esy b.au, a tr$4 Gico poibildads dereabver lguns de Empro, os oservdore conide E pY¡. a dri .Bu kng d,, rresogsa de a Un Tabdend"jodos 1n e so El araacn mu re aly sin Hn id pesntaos92pleg, s aaimprtnts roleasen anqu e csm d Tto e c1 isinuid esiestceitlino edPrss.-Esers lleads i ldo Uido rcoocn ueleD, r Egintriene, d3. d,, n des:a rase a g nc -eaga a a o mn a m e n o i us om ,ala Rode1 aaa erisl aalc ieon q e m ns -m caca db sr u ecs ne sus ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ R Ce tisado t;I J17,ebr tq. a 1d 3 p aosd osb ncsy 5 po s a u a l uete asnaaenet m palH nS. rodet d a e IKtea M tust auea di~ n ealane d lsd les o en ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ d P.c e.sm manra ti ry nar opoar elaemtoa. y para s&nints cntatmnt 3ga eeadsts oeto.S re u e rmepaia;als :0del ade a rofoJrd ,,, lnaraeanrosd ospeis te ams e5 7W e qu lo EsadosUnios an omeido as apeacinesa ls acerds d la delas 9-ncioes ,mdas. Enre a e i e eleir l pesient u recrro vsitndonuesra api doobipo n un ceemoia ecr¡e m n1puee iponri ender ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ = en p,Cuez E.n ~euvcai Clcncdrunitc e oc'e, tp nPa els 1enc. a en nde e l Heerrreilte atepe-tl asohod a ohe ati Elazbip Brnseecumaen E cat a ecniek d mercado ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ nuia d. 1d. ed-d mundial, Las .nad elr. 1etmet car mann, sol. L es_ sr atrc si d mcni iprtnes dcsrcinc aez ldad a ntadea bcn d eo gb eno p ir laGran ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ilra Brque el etqu ddaa u Reara pasi Ypp rba -lo del mundor. de Mr i u vIrne, g tr redanra d 4Oranzcin e dao paea ver pepraa dseraun nev a mn I om eec o e gndearraaberalaseio. e om rautde e asgcalciWnHNGado calca, Ace d hc on e ej r1 ,Amr uns nEwad .me, e e ., ,ms onedeein a tr a oe e en usitue i asete ocor ar dete debatpore d. ee u nur emb.!. d. e I. PAlstoUm s ctreaie ode smr tr de Ebd--ani 7,aar Pedr laet Se ~. -b. .e H.i y eie Cub los All"", toaias 1>n aje, V,.-:ilty, que ndd umpeel anarz hleo ee ri nCbRoetBteseete ea ut eOaosd dsa Alet lrsCaag u u esara i ust argrsa aY. nseplad ba le ateirme cnidtopralaorsdee vs reemnr one sisdet erlic j qe .apobc.na apvine epbCcs lwrp pet -,Ira iem ugsdyr sro o o n leeteat a r hoy a1 M 1-aua OdN Uc la IVoe "'ra sr ulrdcaalspeids ad n n de om ua padhebr n ieg ATAtat onedaha dode a an efctuad paro umilres oe. volugaren Pais, Vshlnsy, a~n d.,s. d.n t r.s B ,an i qu u. qutrI Nos aPes pra ag reled1te :l, s : A nud Srtrr. d G.ni~. y pn~bsrl.nsreiia e at aaacd o sao ¤Encat a rsdni elC.d a aal aptlcb nee i aetne u ocntle ns edsuoh Eln exaa e r ev rP#e 9 E r td sn t",?. ldd trublo ,r Cuan.caca oneepeaanea m aapoaa ta dsoicoendlDr-nta u rcenee es a e risAs rnbl en Fl s goa l w .r da Re f : E S l UiE de ut ., ~~dijoor od do sa mr C u e u-qesr laa 11 iopr o-peiened aJnad oen o sa vle unadi at e r de liger optimiNC s. Nmo.I ndrm a uk sgnlsobe*nsto aap xeina ct areibl a tlce s rgme arg6 d osa ic, n ad ds d n l sauls l rso-u e e -9-P., s~gesaharouteid e am a e a tope. al itea a ano y ue Pdr anfstr*Tt semr h ade Mran tnac Er srrnes qu la prsi Mden i reoie br 9.Ap e ur psc pprnsen Rrrtuna cln l ea eepo s e ira etr'caa co o un co u isa aio a i t,,. Jo-d GV~l De t 20 1. Peprci Anatresa _i de 1re. Mh. El en E. t~ e ~~~ .Cl e pr u as ~In 4. gdeai RluclA-n t e tribi 1.aŠ sotci deges 1. .J:.Ma El GobI5dlgds ot-mdMjd M hi nvaeprtt moo erg iertnto, Sc e ote no abandn u o niamos la Ucre Que EU. h o ndo ot a cyudnd o ., c~ ~~ 'd-ar 'u a Ceda"s unidnuns.o pM ez u it, s oW i 4= lo lo urnta.

PAGE 2

m 1 11 el 4340 el presup3es34 en 33co miil,3l3n3 de .Zon&ffantanuaa.'4 Ex3.elen3f e serricion hppUIh3rio Gran conceentraci,n 3334ad339334 no 3 de 99'39r 3-.d333,39939p9gn3.393-orts>d1ua e4 sbado fe l, lf'oa' dotrM"" ,,393 ,99 33 ou'''' 33'493d 339d4933933393. r 3 .9 39999 3133933333333 l,. iMo d, 3~a Josec de o, n a obneooiinsa d es oos eule as *9u op rel bm 9n33399 .3313 ~rt-.3334, 9933 G 93 39m33 an9 a9 3933 n493393 .333343~33333 3333333393.33ir 4n39e, 333,eM 3933.3934393 '. d 933.33933r933393eigncas& a ubn E433339 U9 393339 333,9m,33r393,3,339d.33939r.339,3993333,99933 833 pueblos 933349334mada 333933339339339939333933333H99 9 ne ar33el 33 n a m G 94z Mart C3933 3933mo3493939,,.e m-crn em dop 9n3nro 9333n3 3, 3339 pa ge Gad.Aga ca rfni M ,t 90993333333 r, 33,n', a 3 3a 3r 3 dec' rr, 3993333 4 Tr, 3 3u.q, Ls 3.3a eto. elvirp 'a dequ pe lrno optl C39433 3a 3939 taer ePaa 433 ti, 3 e ,99 .r r n ,3 9,3993.39399993333a3.3 3933 a 33 P. Y 3 9 ~,3 eoF -le4 n L ,l 39b993493933393933333333333334. .93333339333"3339 el rec43333333333449,33 9ntr339n33.333r9,.93339-33r339d9 a9, 3939333 33r993933 Ar]P-11. r s ,o d~ ~o d ptl d oar 33339, Mar333333g4. Enr33.3933339 S3n 339333n93399o93m9d3339, 39d 9333339933933933339 e'o c 433.33r33333.33333R3933lir t.itvji de -PN da 22,3 m,; aon3 9r ,3n 333333393339393339399 333e d .llegara 3o 34333 CC m 333333 39 Jn33333er 3 r One aie ele 399.3,39393339,39,433r 93333 trmd SnJs. d 33933 333o 943v99epr43dep.-e 3 A. Puj 83333933. 4Pueb.33 Cubar39n 33333d9 r 0. 3 3333333-3 3 333 4333337 997333g Do ~eno eet., 1raiad .D T,, &TN 7, k. a 33,3 33 3 O g,, r~3 33 30333933 G. A. P3j3, bnd.] Castille doctlr, gn fr aL Habn rceet --I -p ent re spedro Di-, y elr-s -Z-do U ~ds eu a lia o ai r er se Jg 1.iente enla -oa d agio lsde red am hra a d, y ~oh, de ily d c"praod soa aaa yaprsdes d.¡ Partido del Pr r n-ao-eni eeredle 11, y lalrvn rooavstrnbaao o rnet adrS a nmerOgOa Cl ra er v louto a ee il ietal d d e R del Part ii Paae mjrin e eos: dc, L eoo -o or g -a nanirr Kilai d' ,tb"d den S. dee T ra de ~Omm e d on, Croarenw T i e n sea epeiev a e r 01 ti c ,R p be r pa e -p a ot 75,rdswo eo e ree Un notario di le Cuea IR rC1tn1tX1r CCC ,rB i e5an l' 0renden-" r" eao a M iT deapovnil dl Pid Lb oP":.re 1 -9 vnilos_ en matej e i mralar AmuerMinstr demt dOF eIga "el'* 4,0 lam o dd & a nda -nIe6 yl C.,do CColoanon lae pr irexe d dund atener r dens un c4ul los JntereaIr .de1 i"Un Llaa loos R l untsdonq .d~, caca roale 1,1 nimo d1,1 tio a ua 33333,3333333qu333394333,4433 3. 99 -~ 3 .9 3939 j~ Do.a durJ .-: de ln"coe 71,io EAMQ cluls tien enn ue n t ma panes odcrw relorjes yd p a e gran arida em pmre p d dmn o es ad S~u11 r en ~ ~ ~ ~ 3 i i e a C -1 .1. se g tejea Poulre y ffluna irm ncHort 333933930333334393 33333.333333993333,33n33m 43 9933m,. k3 w19 33333339 9 33 399-3 doctor ~ ~ ~ ~ ~ ~ e Armanda #emul Sertn m roo ques .ida o p od emmn a d 8343s D .333343kr 339943.se G3 3999339 033 39ire 39333 3333,9333 39993s 9933 .3a 339333 3.A c -de feley., g~, 9,3939 DA o ~ 3 3333IDDe 3d. 333 IW on Tc XosWSLX .99933339,m ydiliad9 de darG3rlo Los droen en toe us 33P 3 33t de <1 R 39 ~~asaned .wni ~e ca 3 esa 3 d.3 ; r oa decuLibe ora 4333 aumes 3343 ed en33333 Or3n v 3r3edade, L3 9 P.oi33 333 3 3333333. 394 33393333, 3.9393.3 3 33333999333 333, 9 .99333 3o .99Cma3 d3933,9 3 39.333999333,3 39999333433 239.333399339394333.3 .33 3 93.9 n993 3333.3 339339393333 a Tiene el P de 399 n 99,3 qu o A3339o 9 39 33339 Pinai del R o ~ 99~999933 333 ,93 .9 yy IS oah> <1 e de, go 33399393 ,3-9.33 .93339.d 9333 A-.,. 9934V33993a. 993399333 933333333,3333 33 3.9 .3 C3 93 .33333,39999333 -3.3393333993-A3439 33.33-3 933334933 Prq con Menelao 1poya el PRC Ministro del Trobnj a 'C pra Ate4ase l om prudodOOe0 urrO m II4 praAltal ¡4gEREMO3f MA$ PAfTWl is a ye* -e-a y P.eso I a pl ,33e 339 fa r Pela39,9 339 1 r9 eM9 7--r : 1334ugu3a3 otro L > Ibeo en3 la barriadl del Cerro 9, del 393r, P.3 l., cu9a39 a derra 1 laagrcŠndNcn A.tti-"e~* d.* es brrio, q"u e .les Y.r .efecto 1. -oh. a.¡ ~ate. di. 9933en cerr, y 93,ti3 En e e it -di. .1 min ct,. dentr. del lasrtido, -a E. ai de 1.s que b.bl.r.s Amrhato l. wiliamn 0thon, Er riesto AMiuiiltU. Nilo Zuaznmbz,D., V L.i. P-rd es D. Ma o 9 ~, u3aquero, ea333 Dr. Ad.lt. Ch.ple, N-¡l d.] Pirle, D,. J. Diuz G-,rd< y ~nd-r d-t.r Fe 93333334L39,3039993 .~ M UY MP ORTA NT E La Compaa de Jarcia de Matanzas hace constar por este medio, que ha sido intervenida ile galmente por el Gobierno medialte el Decreto No. 4042 de fecha 16 del corriente, que conshltuye una confiscacin de bienes prohibida y penada expresamente por la Conslitucn y dems leyes de la Repblica. En consecuencia, esta Empresa ha sido privada por la fuerza, de la administracin de su negocio y sus actividades han quedado en spes. Que ella impugna la referida Intervencin, la desconoce a todos loo efectos legales y comerciales, y no se haca responsable de las obligaciones de cualquier clase que contraiga el Interventor en el ejercicio de su cargo. Que por tanto, todos los actos y contratos, incluso pagos, cobros y compraventa de cualesquiera clase de mercancas, que reatice al Interventor del Gobierno, Sr. Bernardo de la Rionda, no s& rn reconocidos por esta Compaa, la cual har judicialmente las correspondientes reclamaciones, en las que demandar inclusive, los daos y perjuicios que se le ocasionen con motivo de los mismos. Hacemos constar, que al proceder en esta forma, estamos amparados expresamente por el Articulo 40 de la Constitucin, que declara legtima la resistencia que hagan los ciudadanos para la proteccin de los derechos individuales que ella garantiza. La Habana, 19 de Septiembre de 1949. ornaffla de Jarcia de Matanizas R-ld. ~n s~a on el Tribunal sudill mgtrd, b J .dcoW mer d. M-11t y 1. t3 0ecr3933333 el i3,.r At 3 MenndeC33 < .d.pd5 los 1ii~ntes auroi A conr~11n de 1, Junt, M,iepal Eletv,,, d,! Cento d, La 39b-3< repcoa qe a¡ ~n 1 dwv-, l d, C39,-A.,,,de Afili.a3l3, -3,Ib. Reg. 34393393ne 33e n oi. Je por12u dlcrfaiel 3339r33 33 33,9,',3tr3.3 33l49339333 mnd-s 1a. nulvi ¡n#icoesr durdas, TrMnadece se atord dCile que 11, ,1 di, , l. de ce te~, e e nt lnaro dt aliliados ,u, ap8rec~ ein los R, ¡tiltr~11-amn1 1 o el Q.e wt, remo0 .1 9elr9 de l,, Regit, P,33anente en 1. 333 9 ]el.3". 'A ,,nulta de 3, 2uI3pal de C¡dra wle i'l Vara 1,1r iembro d Comisn de Isr r u Ce~ur~ .,3933. dl, J-, que ,3 m9~ d33. -',.3, 5., 35.33,'.%" elicil ~n dirchlo -n tl aure.nn 4 3, 3933 23pl 3 5343. 393de 399 l J 3399,3 993 3 'ial MZad La E lleral u llavoe dre1.ntAlek.oco Al.o N.--~: rail.a o es.do ca y n de1 pa. g3del 33r3e.rio de39 3.3 P-33 u 9 cp Eeor de LaEm1. d.ae 39lare de 9,,3aat, 3e : 39pr 43,93. ues atior arlare3ida M 1 l id tri d Jusn i a ar uu l. .1 r33 1 3393 ,3 1. P.:39.4 39 1. O as o do .t uep! 03.33333n3933Ciudad ugv,3,9M9.391, 333e 39¢.11,: e la393 39333p dee Nih. C.roitg dIeuba untih Dtd ya s ,eno dl,,Ind p~, Junta M fi3ip3a d bi3d. -.p9 .a o p o, g .e.r, devirle P., telgraZfp~. ,A t3 de 3 9 uI33 a l d, 39933e 9, 599.99 33993t~. 33, l. ~e cede admiti, b.i., d, fla ,o. de a bi, Que stn distant 393 ',.34er 3393 'dificil.3 .33.3de3 3 -3 3, 09i, .,34 "'~.od ,t r cad. i1 di, I.,comisones 1,$ta Ju r.: .v.,rd otstre qee f. e J.as b.j. Idens Y ilv, codarne hast. -t cierr, d, "r¡peno 9~r~1. de Iilarind. ~ ner. d~ l ec d bRr2da del Cerr e n aPl ei.o, erl ms. .t=u enfr. Aurelio Ciltt~ wili coc}i eo a el., el presi i. G_ d, Y .1 saor FlI. L. DISUELTO EL SINDICATO DI ACCIONEU DE LA HAVANA UTHIES COMPANY En Junt. .1eraae di 1 7 d .bj3t.de .9n Pln d, ,. 33934 de C. 393a43 ElictrZcIO.d y Lilld.i6n de le tl 3,J1 .t ~~. 333o,-33 oreentad. con v.rctergevco p~r 33333r 33 del 33S3 s Manuel Grcia Menndez y Ben Snmin e.e Gv. .d34333 en 33939 33 9., 33 99 ceprri el pan d rco ln 1 ,1ue m1. qu vine ~ a sut b ,;M a, ¡.t-m 9 9 3 i 9 3, 3 d e o s a 3 n £ 9 3 3 3,3 e w sa33.9r b3,.3. ..3333u,999~ 9 3933393 an3to, 3iv99 pla4 d 11.,3 pa33 9 que re9493n su, 9 E) sindio.I. Y' di.,urito de All, q o t lh .an Et,,triv & 1 no v lsavio u o ea ceona p dRen ac than .aopbiad laprensa, adea d. o u Rpbir$, hernos A,radL= cn ti.a enad~ Jos -Mam Alents, en 11o aMtient. de pln. rilia S my npn de laoa dle3n I,3 nt3, d l r9ti399 33 niinade s ,sdn a es Sevici 4,1 InHaa 1-, ~~lcapr arec ta da "o cedstmaonbrand, al efcoun. oiir nerd o elaenadtr JJm Jn 1 de L Habana, aellNc Cs Almnuerzo poii0e 433 933 .3 33333. 3eda Loa y eVceaOea Boj lding ss in Jo, d ,Ia pote J-oo. 1 i .r uco ,,r l e, 1,t1,1 vnla oraine p em u,, ,i.nancesn od a bEnree beleorei u d tl11 , u maenn Jo"lev andoI:t Y .-h .!l e:Na laere osti d .e. t d ¡, l --' 1125.3393'9 4339? ,99 A"-3333 d e ua .tiia l rseto d d a"A lg s r1, ,i t ;j1," anae, del serco laeAg J opera de 11nt Vuiialgo 333399333d,9333393393 333333333 33393393 933933339y9334,33r3339 9ia 39 33 9333033933r33333331 993393.9339. El 1S' de ¡eso@ss estn presas en los ferres,del tstr¡141# V ,C ¡y no le saben,.! EL Y-C (VAHO CABELLUDO) es ese 331 *lor del cabello que M349bs personas padecen

PAGE 3

DIARIO DE LA MARINA--MARTES. 20 I)E SEPT? DE 1949 La Habana dedia 9,1 :L. cliu cnene aD. hid dA diios d. An ,un f~. cli viclo h¡ nunca llesg. t oti s present ~ .todo el di. y l Aoc eher en-se rablag Ir. p co, i idi lo, ; ilil dieldo cal -i, 1. p~ djis d~.a de 1. terypo, tura que hace, de La Hbn. reire i a mdad 1,1 delicioa ce es, e 1 llrid. M.,.,aib. e e. ~lti ,nlne P omi piei.lla'nu ini est oedsde 'res¡. o ae .Iv:an ', ,,a, 1,hent ~~ri de 1. ciudadi en t .,:are dere 1. r,.a y "nige de eit., \~i-~ n s air e i lie 5~ ,,esa y 1. sipor:e 1 ~ca, tart. e n pica el di ble I ~did e les h-n dpd l. iigili' l|sd i pi di ,El :ioi cAi d, ll iii dia seenild Po a l, ti.m d 1. naraidn, le ened ~ el :fig el I'l pd r em pie rra ".,ilea llna de -d, plpdi i n i lerni d, i1ur M. ,iiii, Law ~bes dlW pobru e esirli s. t I R rl l bu d De venta en las buenas tiendas PUNTO CILINDRICO a Casa (]uintana c AANo 358 SAN MU 255 Tnnse pora delnder su derecho labl ante la las asociaciones de los ubiNAAes .._NACA el seor esignan delegados cada ognnistino para integrar un a Frente Unco que luchar contra la anuncaa rebaja, Santiestebani A iiiira de que en bris iiic y ddi uo e de le r.d. y-dAda iilei .l t~s diada irr ,iridi iiii li iil dd re ~taniipie¡i t i isiad di ii i u Azucarero. Detant ri: La 1~ iei.dis h. -=dd.tf~i idil l i -ii i.su all-dIl a da l r n oyu rei u ua ra de piii l 511 di la-uili iiai s ¡ id. .i ini s fd.le nilii~dillliiE ldO idiyld i, l, ild elbn., en todo 1d e libre yda del id ,Md cl 'zI Lntd DAR F1A MARINA uiii1iiidiiLi1,im rle>liiiPii Ii iidiiii d uIi CibildiyP ii d di T1 d lac U' idn iuid- Isis v P. soiln d o ina .a au yildiiiiili perei eda ¡ i iiliid, d,il.iPi ,tiawdliii i, O didii iiii A i a i se d 1 h di '1 ili u iliid i., rnen irni qu iu~ laor deiigud ii p" nuni ur 'o 'e' u o eie d idn c ccidu .as iiid .si lc lilllddiqi d l -d. e u n y plaear th d ate suie s -a jy ¡u P.m sno hil n 1 Rae~d lis dat e, Z.de I-a ¡'tOer Pu \nt l Adiuiil iAdr i d. lJ- sp lal Paii pdiiicdc ill la-liu, di'Fai iiil i d lsiieaeiili'O i u:ai i i' -ie i. s ,u i 01 e piiiucO epi

PAGE 4

PAGINA CUATRO 1) 1 A 111 1) F L A NI A B 1 N A Oded n.ol 10.919 na ,otmo o 1 1,440,14 r 1 *4R4er0104A04 1dledo po 7p0ATO DE LA MAm40A Socltdid Atorm hon.ooud en la c o4iu 4d L 0n J L 2 oro dd 107. f PRESIDENTA DE tAEPEA gurva Hr n d .1111~~e VICE PRESTDYNTE DE LA EMPREMA: Dr. JarrO Sarrr.o 4 141i0 nECo*: ADMINISTRADOR: 0414 ¡ tnoO. nitro Berndes 0.44r LIoso y Serti1des 1. PRECIOS D E S U B C R P C r N t 1ro 4444 0 r4 05"aner yIrlon d T-rlineri. "A" "R" eoat *40404444 r.rr444. t.444r4404.i44 borl4 Ml ..*11150 rnsa Tromtl Or ..,. ,. 44 45 4.74 0 44 o0eroo 4. pol 00100tr40. .4,14 14.4* 12.74 ioroollt o A1o ..10 10 10 e p Al, oInial ..* 9 ;n 1 Direeian:Ad c lwtit e!: r a D E. O OA-47 Fe or1 J DtdeIf rat .44 .A82 d iitA*er.4f. 10414 O4 t Cllrtnollo .an:. .A-757? 00ee .50 o no, dprr .04o11o4. .,.,, A.4447 A4rt1oIQ4o4400.0.M4404 444040,r441 *otogrboo.777 Anoo1o4 C0010040410 .04-0144 014044440 Ord 444n,. M-5,0 Aootoit* C01t*IOlotdtt .74.712 g.4os or E D IT ORBIAL 4,1t114 PoRonada DESLIN pt Hay que apretar Por Jun J,. f~ 4 4 fui¡44 tad14 d4u timo 4a 104 d I1Ir41.1/'I lovde m4e*4 yW lo-ou p" oeio eabn qec i pea n ion m i-n i ,h.upa t PO, K. Alerta ante la invasin le las drogas t0404014*41'404444140'"441 440"110'04 10lIl'14 00 404'0001 noIr 4 1110*44 I,&oio' Nt 04 14 010n 00nra 11400r0 001 040r -or tplo-ool0014l411nra 1 dmr0 .o000ue 114loo0l 04 compoor co lo rlroo d rb 0440m4lr00141410 Dobvlo d1414 041n114404o 444 0n404n01 441411 01004r1401 400 0 0r4010014114ia 41104gr 441 r 0104 1 01 104l100 p 1n00400n 4l10000 to podro 11.o. 14 m441. 0 40 ohiob rl porllmr--4.1r4mro400000l1. .oOlrd.d rio iddo El oa ol.114o 4144 lodo4 roo 4,4, lot 00114 Har que roth i r1noa14tk Ooto e 440114 4a4or 0014 r400lo.0444n04n114141000100t010'40r44 pu41r414r e44.t-a Hometey4dlol.r oy ,geso lreot*o. imi:rl 41011 44414444 11o4 6to reororslooodouoo 1l, h11rl.44041104147401444l1001r 01o oa lo m14111 dol 011AR|0 toooioroao 414440r00 d o 14 44104 do 41r1444 Lo hoilo o4r4 c00mpl11r4 0r 11110 dbr -lm llto4 144100,110 1. A4o0d444 Oohr lo 9110 04 4 0444 1 ro rno 440 poSrm0 dr 044 4m11 n 4 1 1o o oN r o 1 o d o 4a i 4 4.1 0 1 1 1 1 4 4 1 0 0 0 4 4 1 0 0, 004 0.4 14 041 1', t1a do lo agaay eoo01c44140--010l-111""4440.14 er ott 10111141 0en ntoro Oellt 00r1n ioo44p 44 411111-10 4r1 01s1r oo in, do 04 011400 00 0110114 14101o 41100100 40441104 Po 40 044 1410 oOolodo llM Oe4l 4 1414 01 ho drodtdoe dO111oI4140 44 yu u qto sc~.ilr, m a r n i r n p arcr e,,r, oo 40444001 4400 quir osa te (10114 1411h "0l iolllO 040141' ,, hoh 04740q014 440410 droroa aon4o oe 414140 144 1000 ,lo o o 10 ad lo 44 .1. hicorr14ooiOstOmO4 Odo 11 lo 4 \440 do 41100 14*0 1 \00. 00 : r ae 1410 1001011r1 obo114 doa eat ¢pro f 0141400140 4010 1 4nt 1144 o oho'oi rooNN 44i4 ^ 4144 y. .rl obo lo1410444' .r .a\ ' 'o 14 r 00 o1 r ob r4lour 1144, .i 1410 l 14401,r141 001414t44104," ~i a re i~ o drl 401er 0 1 44 4 4 .0 o 00 404114 04441104. be ra OOl1."4010440111 11044. oo,'010 0101. It 00140 11 0'-u Por W. Friande4 F4ro: 4oo J~S M*ri '~~to~ yCabo ,le' ,_ t. 4. 011444040 4.0 0. 44o'rr414 Q".440404. 701114_410444o4 Ooo'n4ood4 *400" 0440.4> 4 1 1 d ~~ ~ ~l p~ 1 t iasCq, sse 040'00001l10 d,~~" fi~No4 do'.o blo,4144o iI440140444004440404110400444 4 4 r .14 100 E40144 o tRo 4040 141014 71 11 n 7 rol404t41 144'0 14r144 400414401404001 >r14 d ro 0044041044 O4ro 1r op4ta4o40l00 4d 4.lo e o' 04 -aie• i p thr~ >,i iaV led u d lg d 9< ha ~ ~ ~ ~ ~ ~ p ] Ina l 1~2 aqu nmo aenid i a .3 3 m a e i r q me e ,t m u e o t irmi ~ L .~ e .>-rs rai bn t. t zt res p ^. e m r p r e em a b e s p s e r-e a a e ., o e p ae s w d -Z e t ~ lev a es l, ¡t" a ter t 44141401041'44444 104''140 0~0 00414 ~,4o,404.04' 404 1444 1d.4d004401**e'o au ra a se t taa ido --a je,, o t, U M ead o bed is 4 D c e m i ed, denlrt s ~ ~ ~ ~ ~ ~ ~ ~ ~ d d,,e tn o am n a de e -laei~ .thnri l db, J,pi d,,a et p 1.n r dhi,,iddr a -a t a o o o er e: Der-Oi b i api t4a. i raa: 'T etts 11,1~d L'Mmina, r e pose a e ~~~se -o ~h.ssaiads ala-yret o s' o a' s a a ~cns ejolresqehyeiG o a a e e tua e e a e cres Jesr abandono o t.l.", dn Slan. ya aoAosoqeee l q-neni n~lic. Date d. ys Pa.r. lced -~~~~~Sh lifct l nme xb 1401014~~ 40011044 44~. L,-> .0.144 d,!o 74,1 ,l-''4 4444'rl 440 4ob01 0110140'O O 4 4,111 d -a i at.ba-dey 9rn ~ -.d nllle U. .t de li itan nracred eendd sd S aC a ¡,u s .arnpco est el de 9faini e e o 044414.r41401040d404444 to 4d14e04 440 h .odirl 41141d 04Velm1sm 04 de sren;ad Cm 0 04p1r.h0-n 004 7 ~ ~ ~ ~ ~ u e. Unt pr' 1. -l¡bienn d. me 1. ent irvils ameitl 1tco ser tiefi d e ri Ttrald ' 'u hadd 1 111 4004001 44e 40 r4014 d,4 1114000 d, 04 1 d40 o:opes se 0 -4 4~ me 4414 40441 u144a 40400411144004t11."0441"" ooo~ 01404104744444 4444 144 rsa n a u rle o4,nomr4l*44004.moIr 44. 4 '41 Or 0.404404444.40444411404d1lo dec Vlvrd U apeatineun m dr 04r,1104,0a ae nus als reei cn un n turt 0d 0 04iae6 0O1004 j4n.4 440 414 41ro, 014440 011410 41114 440.0040. 4114 na 14114010144 00044010 o4n 410044hd0 10440d41400b40d44044,qu'. 0-o' e .41d1444441d4414ts po4 'og40bcar 11 t4d0 n4o141444040} rm da40044"lde .1 f ,4nr0de In 40 -ceatand 4 4 t .0 cia d D na c re e i a rent a m chasde as e titcions d ei omtaos"a om hge ar ledeh oa: y p~ tyener qa d,, qu rp~r.:n.a P 4144'7111oo4 14114 04404100 04044 11o'1oo .do .ograd o. 4.ra 04 ad 4 sag ls.l u 40 040p4hd014d1b41ds.d 4,4,110 ne 0404.ooootnm 444444 404 loo 001r4 44obo ptor el o4cro4poodo44hddl4400l 1d'401 1040141404 4' -4000444404 l oodo 004. 44A ue ,4404 40.4001104404 n edr l'-d:egende ;e e-a rspeco di r-ud or Euageniors IYO r i cuelo m~rrn ia d m], ene Denild ai l g lo a0rv~ e e ~ ~ ~ ~ ~ ~ : 'si d. pueoap ee eq s edm aaG ca"-e3 'n' e -v gr de rat lar ierc y' as lurnto ata a rp o c, ~a dr itr l t i.ior i, ilicio'ntie Ta b. e ra mt -Si la rViul iVRpequ sf r autcg a na craua m j -o a i, .l 't. y sa ard od n abc brd e, de l yr' esto ~to derles d.o e ie nl e m shcoa1 ol la rg: n a e ;s e bc' e re l lei a a e -ra me ria deu el m nig delndo .ril: u el ti se. den ~irLsA oa uri alr' an u ,ani n, caa qui_ :,, *l 1,11 ni 1>r'> 1111l, eno b lcnr e a o 2 -W .la lsm dd ioaois a p o r -.m naree a lsdlmn zo< ~ ~ ~ ~ ~ ~ ~ _. Jo e i e d a moU itdtp oa e ptd bn u 'r e am t BM aH ucd ocle n e e hrgoy u L all iltencioio co o clr que leserA F-p n \ ar' a a s M-nd un eedro delmz -tale e ¡tias agao Cor dso o \Ul md ids o e etios ,re iecad ol m t e c r m r eee o ac nM a eant le vb p.t. -qe 'se ha. -r oraen pd r e, Czn 1ni a r y,. sin po b .cd de re, ee a a d e -a e 1 m ener'r entr el Cese t Ties l i t mptu tad dadedesn u ilt mara unan i lao-~1 P uic fantem. d~~1. queod pci v l r e ki. ciil eed.t,,, em a e N 44 7y0004400e 0 01o1,4410040 0 011 m 401r44 r 4 clama ~ ~ ~ ~~ h d. e. .H. bum.dd1. .v.s. porrs y, o ta ieln rcpoa a t s cienal ~ ~ ~ ~ ~ ~ ~ ~ e 1tea i, d. -Y I.& te etii C dh:tod Madid Est dlti ea cr.ntenr Uiisda en c d rBenu u etsnta e de44C004p4l1ioo4ol4d4r0o441404.11.40nl40I4n1o1 114040 r'bbd'4a Em44r-0.eq4 441414, s assibisi 00440401414e,.rt 0144 d1411 014 40100n4erv 0140444v444.4101000 0r0104bi000440dpen4414014rnna lo ma re e -s s o elea s de de uesros as onc rads e M. h¡,u l .tuo d q1. l -~ a t dsa, rt e d 'a .r ,ad c .d."o ee c o ~ rea dtie. p,a e a Ya cot Pau ,i c u a dute,. q Del,a ,l e oi b sa teto ara Tit,r.es qu e yo int n u n l e, y d nu n n ,P r e tnio. ni. e ~ a s ci d, 14 beet ra g l enn g n ar q e ia r .depaR.a ent. e -n Siecointrae o.r qu i no bu d.n m1an sto a o csu n h r u o fr a l u a 4.444404l 014404o4 040 ., ---)"'oin. ol b e$e pa ~n .t M ti; qu a e ede Y dirde duga de t 1oto d.n* c urre crre que nt la n 'tee ex r n e o ~ u e e e ln, .plqe y s d a c nc a e er t a a z!, .---e .rIi rr puava p b e a ou a lr tn oe e n ede etn ar .aqe n ru e oe q e tdn a -t b a 1000014 0r140041104 p, 00,4014 o,140004411101.4144 44".0 Odl S 144 '0 ,4."I40d 1100 441" 040140 P., r1o4Il44lolIr0 0440440 t.44 lo olo ohriica 444 ""'101r40 70y4Adverti du ooo4d104004441 144010i0404.41a El*4da0d e tla 1444040 41414440d de4 lloo 4110'nte d"el14 70404144. noooobr tiMbrttrlt, lo pstb aneyr d. 011ec 400404, e ]he. .a i o ~q e s ihy H y en et 1 mpa ~ q etd ted i44444 ds-1 01 ~444 --.it.1 qu 414404 44ria Al4 40410. 144044 ls Udlmd oitco. LnO tOOpr bd.444 de t. deooo4 4o 44404' ,ren e oo in eoa 404o0 5.404400 dip eso 140 M*4 *4404404 int *ti Cil id c i 4a c 4 Part m441 ~044 1ta de orl reapo sa es 1N1o es '44*4"l w s eco l o u o g. s 4441404 1404441 9444 4104044',4'4114,44''411104 ~ i40ioooldd40444". 04410.4401041410144414 7tOO4414'44,4410t1 41 444441444, 444, 44el p4440444044 2S,04 ,e4444 414 01040 44011 4110 So a 1141gentes 4o04i01 oisr 40440ral ticOt404t 40014440044044101440. 4444440044404440 011000% 44 dol P.-441 0444 1 lu. ooiot4.41 4040004.04 Do!l E o ioo oo 14 01o o d Oo 4404 Yoooo p~410000 ~44 01441 0 1401 ,4 010 c 144 1' e 44144g. 1400c a .te bn Y 0,4440 d r 14 11 01 44 1 440. 0 4o~ ~ e .0 0 444 rld e l o4 d hab tac n d,40N e -0 POd l odo .o ra P 'S D 0o114r ~ tho, ooo rls 14414 rdo'ue40'et 4 04140400114l04401 04a" el404404 p""044 44400"111 011o4004040404450401 que no400 han4 0, 040 00144 q1h04 P,-01 1.44i .0 41140 00d 4410411 -4414 4440414 di. 04 01 44 rbo do ine11 144 c lo,, ¡ 4b1. 0444 54~ 40at.,4 44400 4 04 4000004.41'-l drul ,fe144' dotolo de 4 n0r404144o40 ticioauelottlo0 0l 44 de un fona444a4t4-cd4444gacia1e11410l 01004 04i.00104 01440411041, 1 bolo dr 14100 441 ,100 044 040040414 44 40,0 14 4 0004040441, 1404 4104 0 d40 440 14144 0 1 iido 4 I 401, 14oO 114 pa, 14 00 y 0 o11110 131~ I0Metadeqey o l "1440 04400441a 00410da par041 40api* lr sqeui.td. .ttn si. e u bi n pone 04, .lo~~ a.en041 00 _l, ti' ,mgno ha p 04444 y ddomo, 544. ooOldoto dt obrao 904440r040000hay qu0 1pr' boo. 04y0 ooluntrd P0r7 4p0 tath, ree obede TM~s J1~Mri v*4104 e, rl 3~o0o .4*44. 44 r50 4440, mt ilnts. 4444 Puy ha iolorto4l*4 0004 dj 40 401140 0 440444 di 40*405trot s

PAGE 5

Clao qno l di LAPIZ LABI ,jo GERALDIN saite eyotel. llois yst lerbn y msn e l,, briId l OERALDI5I( C tpiro o pnefnnn; n nncnllen#tn n di clmpen 5 si. difentft, haleed cnn cel linocmnAn bios msito mis qs liale heblc d ca nIlI, TA; c, deic.cnccT enlcceede ct mAA ,S. ., pero I n a nne que iu e ames me re y ca a AL y POLVOS FACpALES rle ant re. pcsn ayer lar n E 5 A X acn Artfln s nu i r d rcpl na nnnpacce d aura dreh mnsod Klrid c o ng l, ,ln ennnaeOcrl. ctenede c la ceCoer MAecce cl qcA t.t g e a ri 05 eceele lete Ocen Pkrec ecn ce hea. qtoio lc A a e de n ¡.s VcIelecAec c n c lc d de e n c e RAU p,-, u Original y graYSn r F .M pzrquo no ion MUY q!a9 n clety porque entro WSu brilant4Y nOvOdOZOS mItic0, -1r 1 arez que ls acentarn marav s t ., n "Xaro, 11 la-5a , -j, y n r LIyaheets O V S -ALES -t LCO, tdosco latagMan ,s B d ar e -¡. P.l A, oa rw d s ear ci jf -o c~ Li Ga ro .nn z cdllececcce. Oeccacecta.e=r r.wi -cec -c -lcee -c eeclle -.Icccncc -lcce ce el c ee eee.cel cae lccl.ec.5llccAP.elcleeccee-ce e cc. -ceeeeeceec Cc.c c pe c re c 1. o cl e ce de maa~~~~~~ da o ro a n r nrn o-n In nnntActn cn.n -----d -cceeec cccce e cc lc. L eeeaed ccecee I ccllecec sinnnbAqc S I itul Y le-ecce -c lecec -e. l cllcccc cc cc c ecec eyccce DeeelcAeclc dlcecd eee-le ccAA.cccecccclle M NA~ e cl .5 .ea .f ecele a dl .doC, ce ,nnieccie. Icncnd ceennee cececec IA.c e ccncc clceccaneicncnc aceecelee eceea dccc. ano cincp .ecca Cecele e Cencece. cecACneecia de l neccce ca ccca cldc Al ioual que en los Estados Uni4ot, We9tinighou, hace una rInsacionLl 1eba A. REBAJADO. *Ocl 7t y <1 Mue ble de eecquinttcc bele-ec 5 tubos Weseinghouye Conexi6n psec ccdi'ccos y Gabinete y.ehaenc cTropicaltzadaac 114 D $ 1 42 D E A i" Dil ,]j $ 3 0¡ P O E H CianElct de E e U Cuba p3 pabgddorecAA AA5O 40L. ?5005 M-YO3% 7 A-291 1, A-2912, -NABANA ACINTIS AUTOBAZAOOS V0 TODA LA REIBUUCA AL ACNCE S De ZSndegu Selee o he, lc¡ nuiv ~~ ~ee otr~itreat cnerecec cAc cIcle qcc ciece ofe. cede lc pcnaCi c 'a g c elucin culececebaj e-el cl lOl llaegc e CcpeCc. Iedcd de e-,%ane" 23 obceI d, Oey c'r-Ipendl a un "riO.Cecc lca dcCed,. SE, acce dcl pace de Mec licce qee dcrc co d lead i A lde eny alece ec cOacla. qCe ene.laciCi ld aenaerilce. erada eec cl dcetcde ccececelelcea El edeteil pcrsy de aylr Acc, en Incydldcca e-ea cA 1. sae-se, elelea cnla clc ecaicc dc, e nl OceI lnce del retlla de h a d alaanc(ie del da P ocas tiene, Aeende .1 Otaecncdc de. IRAocca, cquee nlcela d lU clbccc, cee-liea dco eeecc pceerlclc a c clnen CamA renl ac., nelcceoc. aItr .ee d l n d A de iren a ca elda Re quyiecn aese deA.ececccicd lan cien, t.eee c.e d.ae lao cleec rioiatica ae lo seor es ro e aonzcc Lnc c l ornetie.alc lee o a eoitsy anfl de 1rsu e-yee cl deyeec ee cddlare l-lilur R~luid. , nsident cee tia le-c dscdcec Scacccr cen cn fen cte craelcjadac l elnecmsieos Men ei ooclse 211 *tme a las settrs Atiuio Aleda de Lsr~o, .a. irma D.Y dy& Pmitclid c d Lc aec e, et eCmniUn ee e tce, de n, M -ynn t-e JJtae cha ersAita im y de Mne, ancDde cees, di wec de Raro, ccn c e. cl e acI. a lc ee caeAn n c, e. Eo t daeccee, yt.e, a Lee Accc cn ~, e d Pede, ac"c cccalcc c Crcc ncOcca Aellad Alll dcc .~Acc, elbo V1d e ecy dn Me, Edaede e" cecn elva a e cnA La ctcea One ncese Ae e-es L anc5tcl Clarcee e la nCcne, e ¡a eena L.¡. Dad Ro. liec Mcnucl y Angel Huet, JO e necyea caeAe. Ycdcp. ccriCc-a decc.ca. GALAo Cccc d o eSAA A.lnn 7 LBci CJo desc nsadO o 1. nscnIA O SLE7
PAGE 6

DIARIO DF. LA MARtNA. MATS 0D FP.I¡49 Elrns olores desagradables on ouorfrigerdor. o neop t, poouc odo, 0 o ooolo do *y Utsrn, rdten es .Y,. MI. p~ 0, Lo "If dOiOOoo o of0oo 0, aimtnmicie. PUP AR, el ~od-~n de~ad-r~r P.T ~ltfrgrao .va la dsgaa e ;rpre.¡"n producida plr 1. MmCia d, 1. distinto. U>oes De venta enEL ENCANTO y SEARS VlOobo iooiooi nCASA ELECTRA si 10 iC o p _dal 0 ooolooooo 0 oodo0 lobombres y mu ren que 'ie hs0a 000 moda mo aanda, y d0-o.Oooo do 0,vamente ceol da y JalaMbe. e~bro ¡as wstadisi!us amindemnsa 1 , hoy da. nules de peruna ecorim eieca dkroOo.dpo.oOrqOOe Oo. a0en como prolegere cora laoleore0m'io 1r5 d0 le ejel. S Ud. Se Soo con m aroidAd .u. examen M0o, 0,0, 00e ,1,0o 00 pu den 000 opoo m.o" o e o -J. 'o ri 0004t0s y se 0ge&0n g~~s de zU. P nsg ~ r. ,tuu 0100' 00 g0ner0-0 a, anzada p, :de vwiz con una efrea M ie, e imr 04,0405 o oishnh. foto en bu0n0.0000 reccga ti cra 9e cr -su anunwi d-na e d-d;caa z l, p'00m4 do 0,a-00 y old phloo. A1~ op,00700 ~c00 -0m, lA 000perac0 00h4 ~ 0 m~d,1 0 o 0,0 p e pr,ge ~.o ~ja, l b=eeg,r Oi~ y meul, ,00.00,0 Yrm0 u4.t0 00o o Sospechan de FuerzU b, libra a que devalen. FII e' ugar ¡u 0000010n0,40a 4,e lo Ci PflMittO O)O 40.,o. tido GrPOol, qo.,00m ttOOOttO>t0, 4 t& lg. 20)MKIO ¡trna repentina A <, y r 000r0 h 00 4 0 ,. a decisinl rusa' 0 obj00 d to r oo.ooo,,trn.,.oooP;0oio.oat' re 1 Arced a'traear bobre' ooO, d .ooiot oAOOO00t0 0 ioo ooo.A0 00 Y < r Co it, ul-~~~~d oA'0o,< do. la,,.,,0o00000,0. .idgl 0 do,, do Ititt eto-. POl 00000 PR0C0 oopotioobo 00 da aa Cb. Vad im ~ t e, .,e.M en c0n la. le,. trre -C erif ~In el >ae e de De d 0000010 eeeam ine mdcnaelm io ats despuspooo des l So! oo l.o0 b0000 Ms n d su YA tye sa le d" 1, m 1 tra 1. e. 0 el 1.t> -.b2 qUn P.4 -t" Para ver ,bepeefo l rooi$ 1 0u 00 c, d l., prd4op>o 0, .r0 0 -e .wedel a t,,r> m la n del Pamil: -e MlpOrI 00000 de docto' ¡ 1 d S r lu M s e on .*mic d Dc0, -o .o. ~2 .e,. -t. al0 d, e; P. 0 l.oi o e a se ed el P.t. .re. S"e m1arm l, 1.o oit o ,o00o0, do 0 "o~ eso,0 0ar' 0 e,,0 00i000 0 0irbri1 teoiomponen0e, e d., r u rs,,>o, o .01, 0co t -ih;;it, a ,, >o 0j0 jo o iit i a n a.a' .( ,oOiOif0 O rI ru a a r &.km; PIPI su HFydlo EIr .ul Ood ,oo-' n o n iioho <0 o, o o o to oin Vdeo.r .td l. -Cob o 211 s m diot ns,. -~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ .dt. 5u .u ezms 5 e.e sr tA rm:o u a antr 00 P o-ooo 4-r $orro.oo o ndooo o,,in0i00o peceto l;:I ,,TLv A .6078 at dl auo qo., o pe raio p odoo o o Peup n S, Pra i dne eodid oc d .r -n a ob beaci.n d. enr la A r n t),[ spolr .-e dE. o ,.gdced uspeuso y a q. moiicr c.jve de cab* -,.r d e thop -es 01 al d sep:: nur. 19 io td g. q. .qu b. leoad lz u aa t etrae vedie oio e 1. e U~h. a rrr,,i d~., ; un di" P., coi enel a rp Ttb e lecio. r. .0.n. que~. d.au V lbr .--4 ', poooOO.t'o 00 ,i p.do i~.o gu n el p el q la dd ra S n las 11.12dp I sea docent en d -g. daeo PerdId~lo 1, o PopOO, oorl 0 000000. P,,re do, ntp d lbre p t*dio yo le se m diro quet.ro ,oe. o .oo, d speto 0a n en ,0-0 0 s. N io T 19, a PO J.P riasnear y un di porde toe cmh D Jos M d b-r, habie dirIg.J. e. el G b., o, y en,-J d uior luae .er. D_ --po d l40 urdoo,00ne a nte rr aritebe4 t raca ut de 32 rael~ de con 1 I e goII al de Prresbdetcl doett do lo 0i00e, a 00100 su .00 o o n : O d :urpa, acusoh00d o nioto; psed i, bocteno r do do -,' y Pe, d.ona rlrie oro d n0.1,1~ haer o OOio:
PAGE 7

Escribano: Ahorre Dinero. Gane Tiempo o--COMPRE en MIAMI = OFRECEMOS UN NUEVO SERVICIO: A d 1. itdie b iii 1: elal nr CRlAU 41 M E}l [ Ia le is Un w -1 -de ',-lill wl ide un~ ~~ Z Al 1e l'pto l'N.mA Vosun fVICIO RA IDO ENMAs1R ADO Paiisn l AUFNIA iN'I RINA('40NAL Di ENCARGOS arnlas aRlaisid EaIL.\NOR. INPECIPIQCI DI:TALLE4 Y PIDA PRE:CIOR di iii \FOREIG d, los or. iiliiietodud di t ia hii qiui huir u,- U PARA DaSPRMEND ii aoliddort. i ia l ra 05 AidiPORTASII.DAO si aa co ii heudulas ira isR padd MIXMATER Ufl mduioen0 gEnfriadcafM
PAGE 8

ParaPersilis Gr¡esas e 7 Llegaron Vestidos en Modelos Especiales Para Personas Muy Gruesas DES Venga a Ver los! PINAR DEL RIEL lIrI O .-SADIELOO\1. sI S 5 LIs.-LINEEO Ss,,i FEr 11, ':IS --001 Lrt A .P1 DE. c"d-s 9.-C IEGO l1 1\111 1 >s'n 0 E VAI9AGLIE so, 11-:,ELEs1 11119I Mercancia de PRIMERA al Precio ULTIMO HOTEL DE APARTAMIPTOS vedado LJ~ i MAR TE.S, 20 J SVr' 0[J 19419 AO CXVI .r -.-.---, S'1'191Sso 59r 11iEO,1 lEsIS' 15 fr'''o DI 119 El 05111 1' ll11 s O"E0lo '1,1Ds}o,' E.s o 01, 0 E 1,, 4 3 15 tio un .5 ff 011 Sl Als 0, .r 11 M 14151 liit al 151 ~ 5) 5 555' EISE -, E 1.111a10 5,1111m5195 OIl4Es1EE 1195.E9111159>4' EiS59ID5Ii59 D4,,s01llli15llr 1 REVEO115 115 599 RSllflS ES 191 Sl 051 11 11, r101111 05 11,94 1r511r1 1 -isl LESEII .105 1511'0151 11.o.E1 0 9 11911,lL1OsS,01511191,lO ldsyooA 111O n E1oS1 L910 OESl'O 01 1,1111 V l -s 1. 11lEi1l 1911 ELldIlr 1 1 111 r oSlis. 510>1 ,11511,1 01.1L11515 s DSE'1475E. 11E1LL4A50155 84ENVENIDO TERINANDEZ 558si91 E915 515199 ('u mshss$oo L"051'91 Slol"011'10EE11 1,11 115 111 ""5101,05 0ssl1s0"oO1,91'9> ,sdsupo -AS E r,1 1 1 5? 11o511 l ,Is A1s1o 111 '9"S 5 1A51 s1s1s d1l F510 r >1' 519 l919l4119l ss'o1 o1 1?1 1o1S E As opera El VAHO CABELLUDO k 15% de les penes sile press en 1$ goros del erriile V-C ¡y ne la saben,,! EL V-C (VAHO CABELLUDO) es es mal olor del cabello que muchas personas pedecen y no se den tuente. /Y SAN MIGUEL 264 ENTRE SAN NICOLS Y GAUIANO TELEFONO A-0153 ct ) a 9.o14 04 0 %11 #,>te4$ osI 41y tu'~L 1115 <1'15 C.\ 0,Ni0 9 0,el4> ~ 1 G*\ 011 8611 ,oys IIIIANI¡AClO eOCIT .A LA* jiaff2Rf¡tc 9st b 1111118t11599 'A ¡ 0959 .7 5 1 [tNi A 151 Q(DNA A PAMO WDADO IIIEIO O I SOU %k s

PAGE 9

AO CXU 1 m 1 N 9 el ctosoo, inconveniente y antiqou sistema d* lavar. ADQUIERA la avadlra otrUsica TAY 10 R 1h~ 4 DIARIO DE LA MARINA. -uCrnica Habanera Alm4rion en Tarari MARTES, 20 DE SEPT, DE 1949 PAGINA NIVE DLI4 24: Ntra. Sra, 't en iOficina 'il "ea ESTALBUL u _________~__~___~__~~ E4'JUAOd 3 y l$CCV FUNCIO DE F ir iiENDI'4 UA, REMOJA, ENJUAGA LAVA, ECES UAS EXPRME, si UMPIA Y NIA SIN NECiJD IJARLA AL PISO pm ..a i pi enC a q.t 1 .ui dai co a plci di as lavadcias icaaas. h pmdtd ofrcer el modelo GYRAMATIC SUPER DE LUXE coi l cs 0 ~ ,dilaititbi'ii. paa que Ud pueds in lr en su cala un Mueble tOnt or tc y de C5i"tencio ip d ,cs ys < er 1,s l tr o el da de¡ ado de la rpa ?, ,r dii icida'is y l ,i, iti cdi id" ii di 2, e a vnrz in su pnpia cAs con ab.CIIv higen? vi4" c cdu t ei5id ta ula i "icdi ic-c y ,, Bcidr E 'N D ii ii4tdi44i'iCl Ql. ~c4bdd 4, ir" ici 44i4. 44 idtr4d i. JiYRAMAT¡CG SUPER4 4444 41U444 dcc,cdi DAD 1 ese, .-'--M

PAGE 10

~Ti i 4 i iA ...lil 0I ..--io H ---..ii i .1i r e O ri e tt yi i .M -l r l t 31 -re : n o .-llibliotrx-i f-x (kr,ii^n el vilpor 1 ,,, ,, l n .,, Feliz ani,rzr, 1 M imil ,1t"t : jusil i 1, ( ir<.11ar .,1, ,, ,, Ij .t,, ,Iit, 1 1,i ific-nlfil Co 011 141 (ligitillit(1 1r -, t,,!,~ ' -l*'tigiti-l <;1 l<,I .,iixi,'ri,-ati,> A viiriT i ,,,, ', ,,l -,, 1i la",, l l n l(11lu ii> 1 1, i,, i ,, ( ,, i, C. ,: 1 ~i ,le -,] V, ,l, ,. 1, , , -, ,, 1 1, \\rn ,l, .~ d -Ue1 l ; 1 ~ ~ ~ --_'Ii :,, ,e :, i,>,,,> -,1~ ;1 ~ '1 i' 11 1 ,; .i l, ,1 : i,, t 1 ,, -t T r 1 .1o ii --, l , ib r -M " 1 al,*, l t, ~ ~ ~ ~ ~ ~ ~ ~ ~ b "-r"t -1 1n Ie.d ,rM ,e , .1 1.1,at!,i~ ,, ," t i -e, ; l 11 1 , d , ziii -9e :1 1 Yr, ; -1o e s .* ',,. gr -I," ,, 1 n p ,I .n! ,,,1 ~ I, -1r.1. ni -, ~m m -1 " rr1 .1 ^, ,, , 1,l ~ i t ,c 1 r 1a ~. r --er ~ ~ ,r, i ~ 11 1 .i, r ~ ~ 11 1 i l 1 ' , > i1 , i, ,l ~ 1, -,, 1, 1, ~ --1 1 1, 1, ,~' ,, -2 -, ', -, t i ;, l, -n ,' Y,", .n -51 d 1,1 ~ ~ ,, ,,l,, l 1 or 1 ,1 ,~ .1 ,11 ,e 11 1, n -,1 ~e Ir ti 1 < , l .i ~ 11 .1. 11, ~. l ', -, .-, ,r I ~, a + ~ -11 1 I I :1 -r ,,,, n ,< ,, 1 1 n 1 ,, ,, ,,; ,: -, ,, ~ ~ q -1 1 Z 1 1 11i1 l ~ ~ ~ ~ ~ ~ ~ ~ ~ n 11 r, Am 5n --11,, 1 ,11, ,"I11,n ~ ~ l~. ignl ', ,~1 .1 1 [1 ~ ~ ~ ~ ~ ~ ~ ~ ~ c b n ,1 1 ,, ~ 1 ~ fl, Ii~~~~ -. 11 1 1 ~l n4N1~ , ",,,,, ,:"n ,e 1 1 ,eu e -i1 1 -1 1 - :p -n 11 1 , 1,1 ~s rea, m sra 1~ n :na M -r , J nmb jad -l -i< ,r , ~ar 1 ,: d ., , ,1s 1g 1.g .:. r I j d 4 de, -Ab , x --l orM ar 11e i 1 ,u p, der z ,, .,i ,po "':s o M a ',st ' --,, 1 c .o , .'_ 1 ,a n .-d1 i~t e, , ,,, ,, ---, 1,1r 1a', a A e e w o p a m r ', r r ,e i n t -. 1r 1_ ,t ri -, iii d i~ ~ ~t o , r , ,-" -!,a e ' ,1,11t,,, -1 1 d' t1 z, 1 111 1.1 1 .11 pii , 1 1 1 1 : 1 I , ., i r 11, 1, -I --1 .cr r ,O J u a \>r 1 1, u A 1 , :! -, ,l, ---.-f M: 1 1t r ,e 1 1n 1 , 1 1 1 , [ l 1, ,,, n" ,' ,e : t_ n 1 l 1, 3 i1 1 ---1 :' ,r M c C , 1 H,m ,zuu 1o : T: 1 1~11111 1d u 1 1~ ~ 1 11 ," 1, 1~ ~ --.,. 11 1G g y' ,n o a a, .A. ., 1 1 ~ ~ I 1 , , 1 , , : '! 1~~~~ ~ ~ ~ 1p ,e 1a 1r 1 ,1 ar 1, , ', 1 r ,, -' .-, l i . 1 : i .1 ," , 1 1, 1 -1 1 ~ , , --> 1 ', f -i G' ', ,, Rar ~1 x, .t,. 11 r1 1i,1,1 111111 ,, ,',' " ,,, 1, ,1-"~, n,~ 1 l ..ne A, ,r l ', -,1-1 ~ ," -, 1 -, , 1 ~ , i' ):, i -! a e 1 in e e 1ur ," 1 ,n, ", , ,1, , ,^, ,, ,, , , ¡l : ,,!,--i" !,, 1e ,,rk ~ ~ -, n ,e a ,m d -, 1" ,, 1 ,,,,~~ C m,,, -1 ,,, oI 1 11 1 .1: e, ,, l < ,, - 1 ,-1 ~~ >,, , l ,,' l ' 1 1 1 ,' 1 r. -n. ~a i , , 1 , x I a C1 1 ;c, ro A-lpv 1 ~ ~ ~ ~ ~~~~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ -1 1 1a r 1 -1 , 7 , 1 1 11 --1 , 1 1 i , , z t , t, 1 r, -, -, ,rd Cs'da y ',i" ,-1j 1,, 1 ,1 , 1 1, ,11 i~~ --, -, -' ,, z M on s .A, 1. 1 .1 ~ , ,, ,1 1, > l ,r r,' '11 ...1 1 1 1 i 1 --, cr ,a -a 1 , -> ,r1, -' ,~~~ 11,1,1 , ---:-ny ,ra -i, l ---1 -1 5 .: 1 -,n Do .: Pi 1~ ~ ,e'. -1 p~' ,, li, l,,,,,d,,11,Ji ,1 1"7 t, --~ -.~ 1 1 --,1 : .' ,: 1 1,, 1 11 ',1,11nis , -l -G ii -Z I ,, :-. r ,, . > A ~ r t i1 1I l r, ,,i, ._ -e ,t ,e ic t On eg M arp -1 1 - 1 , 1 ,1 ~ ..-, ,,, . . t ,' -1 X -ms M n An u P h iei11 ? i z ch ,:, ,' ~ 1 ,,. :', , ,,c id,' , n m -n I~ 1i ; , , , - -, 1 ,1 -n . -, 1c, ,1 1 ,1 1 1 i k 1 -11-1l !,!1 .1' 1. ,ee te e G a D C e n -C e, I, ~ "iluz,1 r, , 1 1 n1 1 1r .p r1 1 ., l 1 ;n 1 , ,i -, ,n , i~ J l ,i 1 1, b e i -N T R A1u U 1 ~F M a A1 ,, 1 1 1 1 1 1 n 1.I1 1 11 ', 1 - -1 1 1 , , 1 1 1 1 z _, 11 i c p,, ', n t ,.11A:: ., t 1 i,~~~~ ~ ~ ~ ,i ,)a le ,,hd ,,, -1, 1 ,,, --, ,R .~~~~~~~~~ -, , -! C> ,, G 1,a P i r a r k i .a e e -? d r a r d M l a -,r ~e ,T .M ,, r; 1 1 1[ ., , 1 ,1 ,1i -! ~ 4 .1ra -:. :, a m e ', ,1; , 1 11; wr. : d m r la l,--s Ca Ga 1or 1: a e N 1 , ,, nnr :, 1 1 ,r 1 , ,p,, '~~ ~~~ .., ,e r 1a~p -, 1 1 , !,, -l ' y m , l,,~~~~~ ',e d1 u n pc, d C ., , , ~ 1 -1 1 -, n pl , l ~ ~~ ~ ~ ~ ~ ,1! M.u 1t' An or i, k : -, -,:,,, i 1111-,,r>:" : i A r i m: ,, -., ,-' C, ,U "' 1e r ', ,,' - i , 1 ,, ., c , , 1 1 -1 i , -1 , --^ t , 1 --15 ,e r-a .d , -, , ,: i , n c e n t . ~ 1 ,1 : , p .~ ', ~ 7 - 1 --i, 1 E l , ,1 ,,Ir ,, 1 1 1 ~ t? z 1 , l ,x r,1 ~ :1 t,1 m M F o ,,l n -, ', , ,, -, --11 n-1, 1 1 1 1 1 , ; -1 _;-r11 _. ~ n . ~ ~ ~ 11r1 ~ ~ -,Q - rao La.b'W (,,i,,1," 1 1, --~ ,~ ~ , ,!1~ l, R 1 ~ ,,,,,~~ ~ ~ ~ , l-e -e 1x Ip 1a me 1 1S11 -: ---_ ~ -.1 -, 1 --1 ,eM -* a e ra ~ ':w 1 : , n , ,1,,1, ,, ,,',._ , --' -, e m ', , , 1 1. 1 -, 1U ) F AY N A M E T D, ,h ~ 5,r' .d e- 11 1 , 11 1 1,d,1 1 ,A , ~ ,,, ,i ., - w j, C iI -n 11 i -r, ,, , ,l , ,,,~~~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ , A 1e pr m 1 m r pa >e ,o t ,e e y 1" .1 1 1 1 1 1 1 1 1 -' -.1 1 1 1 n -, ,, 1~ ,,, C -, ,, I C ( l , ~ -1 y1z ', n ," 1 1 - 1, ~ 1 1 1 ,C 1 1e -,a M u -P 1'1,, ~ , -, , r ~c, C, ! !,, .e, .e e y r an! rs T O -' -4 C-d ~11~~~~~~~~~ ~ ~ ~ ~ ~ ~ ~ 1A E M Y,U ~A.TD r,, \,ne ~ 1-1, , , - -,n 1 11 ,l .1-,1~ 0-1 A ., -C IA J1. i:. ,e *l G :N 'e ,dr - ,, , n -, 1 11 ~ -' p ,ni : ,-i~ 1: Prbud UNn s n >p m Pr ,r Pablo>. R, ,, -,lo y ,', :d~~ ~~ -- ,m -a :t ,lrerm i -rd n -c -11-1,, -, 1, .~ 1 ,1 -:,,, ._1., , F l MI -. o V M : .P ., e l C la 1, y ~ ~ n ,1 ~, CE -ER ~ M -G -m de 1 l re s a e-lvI, ,], , .TI ,,r i-1 1 .-z ,d e 1 r e .1D 'n .le C .1l :,1C a l e F r, 1 11 , ,-, 1 -1c -,lr: . Prad , J, ', C~ c-c 1n ar , ,1 , -' 1 ., 11 1,,,~ ,,1 M11, f liit!tf , --: 7 ,r al 4 . i, r A1 t iem : JO [g ,N AN ju;a"i r, d~1, 1 -1 -1M T r ,p A U m -, .-,. 1 2a ,, o' -~~~~~ 1 1FP 1 1 .i, 1 1 - ,, ,1 <, ~ 1i 111 ,1 ,, 1 11 1 t s ;,1 1:1 -i i -1 1 7 ,i ~ ~ A ~ ~~~~ ---. 1, -1 , p d ,, 1 1 1 ,nl, -,, ,, 1 111 1 .1 , 1 -,1 1 ~ 1 , 11 --, i -, 1z -, , I Ii, e ., -. , i,, , ;, 1 1 , 11 r1 l n ., ,, , >?" i " h I -p iI P, , ', - -" m, ~ 11 , ,,1,, , ,1 A , 1, ~ 1 r, 1 ,,,~~~2 _- 1 -, . 1 ,, ,' ,, ~ f,:u -., -, - 1. l, il:nr A, E 1 11 e .orn 11 : e c i w , :,, , ', ,,' l~~~~~~~ ~ ~ ~ ~ ~ ,,:; ,1 r ~~ r 11' 1 1r-, t ; ~ .~ 1 , ~ i -, .1 1 ~~~~~~ Ini :idy,1 ,-'~ ,' _' 1 Z:i Tw d, ~u sr Prea d , 91 :da ,.c ; , d .-,, p 11. T ,,I, r,!-!, ap ~ ---1 ad d" -"1, -2. 0 nmb e p1 1oo Ut idl .~~m d, -a b 11.1 m 1, 1 n .0 1r,esHte ,, repauro (s: ,a y > ca uao la ic t3 d ', ,a -l pr 11ga un _stll ---qu ,i -ue en11~ hac l -s cl .,in PART iDO J U Il, p sde ntU ~ O PA I NAVER DEL CAR, ,B , i~ a re ~a -d m rao d~ ,a n ~a ' --e 1s en n1ar -CO ~~S A11 ,1 ,n e d 1 i e e D r ,s a N a ra,1 ,. " ',o -, r a'a, t ,, , ~ 1 C E 1. w m & e .-; m l) D ., ~ 1m a , 1 1n, 0 p -' l ,e 1 ~n e n dea ie ,l arr. ,r mne -gnt a ,, r,-e 1 n TR e 1 A ti, U V.prsie Ar 1 oba -e -r e a anar mcd m aand rlme-premia at se -1 a ,maa oan 1~~~e w 1~a :m In. 1~ ,. -.s. .e r. - .r r ,a ,aa suber',4 --_ , ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ e e d nie st. l"""ra ,n i -,-s -, ~d e : nas ,o oL B Qu , > ~d .1 f, -P ,_ .3 i In B 1a an 17, t1r,, ._, i, ~L, e1111 .b ,p,

PAGE 11

qtw kMem n en el pa y <~ 11 icom 1<-< Cba y .fxic u DA Y VUELTA 4CU4N. 4<4/1*444r m&s ( AS4N sa cn.1, A ehrr efme ejn ret. m aeis FAe4e esCeN b e 1a P 144y5rHato fuma c" un 5,1 dter co na mcn a de 1.r ft~e """" " nidos pr <1C ea44 4<1'. 14 < 44 << 444<42<4< <<<<4< 4<< 0< "< 4<<<4 44< <4 4,,, 4444 44<4 < 11 <441 < 4144.4444 A454 <4 < 444 r<41I44<1111< 4<44444 q4<1444 44<4< 2<<2<4e<,1.4 FI abst .irrire 2< 1152< 2 <<4< rARTES 2 DE SEPT. DE 949 PAGINA 0"40 30L30 SBamb ClubU N ON 4< < <4<4<4< &1O Ira anua P fiTT | ib w-e *Adol holner d. d, iego l.oMI io T 5.4'< '9, S ,2 54 11<.1 *. 3.40 4, bjrIAr, y<1 y< y v<< do onoAr 620 721 y .4 <44<4 11< 12<' >44< 4 BRA MANTE PARHA I1VAYASBERA% <114<< 4<1' 4 n1<4 1< ue41 d y 014 41 144224aru* ir hed .0,b44<44 I<4244 4. <444<< 2<<425<4<4,4'01<4444<44< 11<44<44 IRAA di col 3M IMEARIE 115 <
PAGE 12

.H A CRA20 DI PAGINA DOCE DIARIO DE LA MAR 9 Dan a conocer las reglas para el¡ Reclma una indenizachn de El Cancler y Ac n d n a1zs de mere a concurso en manri de Roma yocho il pes ,, r ioemisora j. M.casnova, e airo,¡a rantes de A. R. G." sera premliallo c1,11 tiflfl"tnY j),,m,< el mejor 1, 1 , 1 S ldo ,,'i o p o l r ~1~1,11 1 U si< o ord enad o el pago de l misma sin que S i• n I ¡lltnron un trmsva on la esquini de Charn y esturio iiogr/Fico so4re ese sabio cuaboo ,' oa cumplido hasta ahora.-Escrito a la Audiencia Itdc¡ t, LII a l" 11,i5, : ,1 -, Sr i a l ao s a s oda au-s-t Leaba at~sa~ ro.tda f e mat aao a ind a PtaF 11~ ~ -'ININGUNA OrRA rINTA OFRECE ESTA VENTAJA1 1E o -acuer-i ,11 ,,,propet 1$ C0 il ~1iO e -|n ,,,,,, rznetir ,le\ nm e a r ,1e 1 Ve~, d 10 1o r11 GaGro 1 z um ~c -s'l O ,s t Ate C ,r .,r d s sunda no .saa t ail 7,, ern r, d sa vor g t ia ~u ,e .1 1^ ~1 -1,,; 1 0E mgico sol, X en Quink 1 n, na, ,r ,r ',e -g -, alal ,; .A J E,1,!,<,9~ Y!, r 1 ; noi ~ ra e ,-,p ,4 11,i ment ,o : dih ' -1 '1 ,a-0m ce lu, r ro,a *lere E-dl eIr 1 r11 1a crat ,nud r1 ,, r-ernde 1-J1T d1, rm taso tr dat C t LA ~dtaast ~ 1 amt ta to Aah Ye s y o p ta ia a Pltt l ra.d raa veso taaalase4 r a p tauadustosoaa utdo m.n o>qu pataga tas Ot a #5,SiTao assupest Aa l. casstaasmtmat l DA OD LAt De aaabo s aa a :t ttt -n rba das ssatssns pn intas da It Osa Al prttuse a sts data< contie plumasa 1oa dl W, dd, to A ',dn n OnJN 1 sast 1 sa1o a s tnrn aa ,¡, ', ,, 3r d -pla a~ p ta lasle n del z '-. , , ,e r s m |a 1o hac qu la tir tm ae Aiir uf,!d_ ' ~ om , i l^ ar i r ~ Jesu Gr r b Ca r di e ,¡ r4 ,~,h> n,' ,,,, ',elra o ru u coOm ata ta as Ctcuttuo,a rsdss sds os PasI 5 I' atat dae lah dtt d aa eelr rnriN;n aP a'per dtla attttt Ci s relenesatas.o aseo dtant unarat MStuta Tatru al tta CAaoi dr, ~ ~ - -r ie a -, i r -'_ ^ re A "rd d]e,, ,I n p , ., e e 8 ~ ~ ~ ~ ~ s l r4 i r' 1meenta Colv. d pra rei, 1, p1 , 1, 1m1[ uaaeeAltrr u ereFR a.ahimpies y protege atn da tia u~ 00 tstatta .1 lIu-tadu tutat 10 G abas aslaadda aa radta.,. Set r i5~5 talacttr a r C a s ao 1ptS aadssa O (fmQ crerna rhari~ a D anJa e sltraias M ts ataatan da resa-n. s 't taa r rnda Oa/ae re ti, tt I II iI <-i as a ,ae ti -,s~ .aa Ita ,sas iits.ttoA 11,1 1 1itt ,, 4. 1aas ,l'11 .at.a as,11 ssn1d~ loe1 o, i s, p-, 1t5r r el , 1 b p > 1 , n 1 -plu m a (lar i t1 it ~ A ittrta s 'stt asssel M,,> tas tir ita tarr>sa s itnaitasge mirg~.e 1 co n ,' ,,,,,ii,, 1 !~ :al a~a 5sait -1,it ,,,.aitait ,ti5attisttaulaiaaassaatst;,is i -atltt!! -5satsIt,st<.lti,, 1 ,: 1 t', 1 itsd -m a u;n v -as a 1 a i Piadi ^o Ittitttia Q iI5 1 :in~, uta hramr t ~ -1 :n-,1t t i t T, a tl t d.ia stsa R ~ si P1a ~ I ,s,1 s a .i a t i tias hutas esOm1tt taura 0l:-,tti I5 i itsiiti 5 1 1, ,_ ,, -05 i--;,ir ita ti -, 1 ,, (ittia tI -i{isti q t-ta 1111' , tttstaa1 IitIta ltr -i tt -- t t -i -c 0 ¡5, 1 ' c -1 1 1, ~ ~ ~ 1 i -ta ttts,, y , ,,1 , -~ " ., 1 1 ~ t .., , l 1 ,, 1 aa ~ata. a -, 1ada as si it 'tea tlt t talsluat IPas ti ~ , ir,,tsIl it Ir .u a tt I -s t , tt ii-- idtp iti(tluta ata-ints11 ,,, -',staaa sa aastss si',1, aatt aatti Mllaatsaita, jl, , ~ _ ," a.T ,, pees~taa.~s~a~ ~jattcsa, iriaaLaa-c5alsa as'l -, 1 :,ist itatiass I , ,MI.stt-iit:"a lt ata l,atttta~~~asstits", -. 1 ~ ---, -!, d,,utalsttatttt5ta tJtatasa,5dtt da u it i e itadaP asas 455, ,1a a, - ati asd atq-t t i i t a ~~~ -dSittit t asataas'i5 d i ur1 itt Itiitat a. aa-ait ,l it a aJtn aa l as atu, 1 1 '1, 1 ,r'a ,p1,l 1 ut, <5 5 i ~t ~ i t i -, t -iit al 'tau it a t t55~ aali,ititii, i ,l ,--sI lt' -11s5,1 t tn t a arJ sststi'tdrAriatndaInaitsri,si tsru. i td lrtranAtaa o ala s vi esa -. .5 ,, a tssIt a da aa lIait d a i t t, -, lt , a '5,,a SsS aaa c d,. lininh me ay aea sata ita Atiat< os a, alul ttas s sa t aiansa,teis asa ,'ssahtalssa da itta dt sitets ia it. ~~t5t tta lusu t55 a :A a a -.ss n a aassta erl r a ts Caalais2t veis d Cadtta 2a t p-tarlips-n A os3 3347 141,9 7 tau e -ass a le Itisista spaa taaaas atasr a ar ttassit de asaana tatta atadl p r x i m o, 1 1a d 1h 2 4 1 -, -, f -, t I.i ,;r ,, -rs e e .d r -a J a lD o -d -a r estO ~~~~t-.J o te -ts s S a 5 t~ tisgia a Iaaatta Mtataaeee .stamaa dsa tasgrr s atll de tastsa atats 55 asassso -ts t55psas l tsddasCasl,a ulItm a Visrr aStLaasplsaMs qes lataa aal l Dar un rao n j al 115 -msostaa Vasaa tas It 5t taia It ,td!, a ,atisa Aaaa :O-*,, 11 3d-is 15 "l,~1s-sa ,,,1 ,1 1 ',st ptsstItauIa da taa .511 at-i satan da CAt a t s sol o-s ,a-s, -us1, -, p D r. ', ,, -l 7. M ar ine M al ,l -, l' oJ - as p aa at da:a, da ,a la i Si t i sa da it le pa r x m a s a d o d 4tji o it tor" ts ta d arit i G t tit it ti Ia C ssa a ii i t ts t i da lam asa a ta .Z, a la, t a i t da, -se ASo-i tia t til~a, s a sabeas 2151 alSal asoatitleenaAauaniia -aa uidpimIt-iaa tla Z ,, 1a l ~ La1 1ti 1 CiiaStsa111,>i1tit11 ---7-a Abi t a a it s a s ita r ta ss.b t -saO aa EG.iasotis-ll "asta Ci a at aas a ia a at a ia ttr aria t atAsttatSltaatisttBadt it1 a t -aE 0 0i cs ABGA5 dr5,Att 9-asaauAiasliista,tlaasdead s asem d ttote r d a, an t t ad i ds i a t i i .itta ~t _,uncan i ttaamoussa't M L tas tl~15_ s a t >t, , t i t i -ttGars ', "" i a sia ilattda e a lt iittta Ou da-r icar v' d s a, s ss-,a srm ,a, It-st a a as i a ~ass -, naa sa, sa ,0r s 1 1, -a, ,-,, P a-a aa 1 i G .d r p 6 e a d -,1 i e a St-a sa a ~s a a s s ,---1a i sa5 ~a e a ',;,att d Atatite,ta ca s td: a da ,5rtatr u ,s tt i t C5t at t stssasstta tOl555ttttattas. i er ttitd ita tssti ta-tsa S-La tatn stolai d aap\sstt an a trs dati Gtoa,. E T E asAti, sA tl at aasslsiALts atnAts at l-ls-alssi irs. -aallat I as aise a rF--evalaeostjahtsdeitttttaiveO d hl.rlo eio h alt Itue s ln-Oatittst 'S e-,,i aa ll.asliltrlaaiisaalaittiAOiit:rao o a' d 0r it l lmt r, 4 ,sst ai ~ ,_ A t A 1 :: A 1 J d 1 a 1 mrl l4t itttt ieta da d, 1,1 rti, ~td r -r \ s r i a l tk t t aie l -I Ita s Vn e -, 1 r -i q u e t i tu asalstats ta ts dsi5551t5 5it5-5i1 -iaa s, aa .eao dtiitIt ,ta i \ial Or a nst ss, dttl-al titst!t Sps ., sa Cr a -itt tt -gaaiosaets ,,,~~ j, -,-, a ;c 1b o m , \; ,e ,1 l~ -,nh ,,, hh ~l qu, 1,s 1 iutoirer.1 ,, lata, SsaisIts ttt AtiisIti II>iii n a ids a a tital g;at a s A tii tasr tt-ts C s s alta 5. rUdstalea ' arz 1 ,, ,,,, ,, ~ e r r g A C u -1 11 , ,n un vs d, ,ga R f a t dalasPis Oatass, itilaata titti 1u ,i tao,1-palttu-ttt A ad-t-Masta Mansa1 1 _N $ 00Bat-a Ctts a ts c ,attA 1 aaed un505a ae dm a ,, ats-tts adma 1 -stt 1ittintta i sa -t, t al a Ps a Pstn sat 1a 1 SA,,r ~11', 11 ,111 11 ---tt A a-it -ie ii ar l l::r ttsls a l da Ms: aaa at si an0 ds L att at nav A IVI rOn T g Ak -a o- t Osa o 5 a-i tstt e e ait r -a-a itasMatat Tr a nttto da er Pa a a t a sa a -aa ___________________ _______ .________ ____________,_____ __,___ buve,¡,an¡e .iasatassi.aisiatadCi a,, 51i-ott5J 15rt5 ltr aLaaOsddartata trsdansutmer aa aaa-sss-.s aa a o rrn It aliit tsa ta sitsds iter Musarita vtPathsta uts altaan aasn aatttsttstast La5procsamatIn de taaaa ydsa lamas ss efcda ts entsa tdssns tsradt asaiasJ cat da 15 sa, adtta as ay Cnaaa AdACE, u~t ,asa,,ga¡da ~ 1 0 1 '1 r,, 1 -, l lt 5 t att a i 5sta t au i d ttdad,, ,a ua i tus Sa sa saasscas5:_arr~-saaisis,hAst a tistaata sasa-cre abas it le a -ss CeVnzasiMia,d 0pas ldaa as l tntd s a arss dsaT opStae o ino 1 d -r ita dtttl ta tatat lS'ia Itaaa 5 t Pa al t tt att atts eitd t atstdtaAd tssa c c oada raitsttda ,s dn tiata si as a-taas 5 asajerastasldatsa m lasl s as aa~ssaiatitiata, t a-ap a Sattta, ,ats a t P d s o a aOsasta, asa-0,da f' D Ssun D R aDtT dDa i R[ a stl lA it a Asatia A tl itad S e t"*G asi Sas sst iaal astsl at titINateLalA sEatiBtsaaaMtet J areot tsAdsiE l dsi\it tatiaaalasmadaiatal a aaaasstimassaa e e rie> .n 1 LJ par 0tJ Mrer Iv5 Lepld rngr aas saataa sa-SI AC FII atata "tts ats-ltaitt-a taag St tit La Oai Oaatia.Esm % d Sals Sassaaas ( ~ ~ ~ $lliittlda .sasatPatat t Venes;& t a pastias. n aaats laus ptt at slta paattst tapsiao esaa nu taadtsdadan dareao aaearast at 5 oti d55Asi Cui staiiaitlaaa iad saaa aa t r ts G istd a ,aaa Aasopea a n as ¡n crba a ho 1PLIZ custi 1 it lttiati 'catt 1;a-At ,as la aiit it i5 tt ii:O l, CAas da.asaesa,' ,t ,: -h-,, Ut tSTED i geturd rtnk Cptb LAaRPedr el mafeaa balal tA E L1 A O EL EL ,t RO aiiaa alspsl adsaa tal, audsstb, daa-~1s lo Aasa ~~ l taS.asts O S aaestla sdot r si lr aia saadlasa todos lo jar es de La oria l N !oang,:a a d ata a t a a a 1 b1rd i , aan Ita sttss-sasta asde Dba a aasdad Ad aaa auHr Banr Nuas ub -b a litio dr los fondos el s -o d 1 asa dlos~ 55euo de Saaa i Sal arAsa da Jatu Caatalaesz. t-aa sasasa pag malas Sal i taao se n ht-aIssat la .,e deca, er :, p; ,5eso"!JcW, "" ruanu ~o eo ~~~ UINIOt O ~E~EOR~O1 T II O S ~ R Gdt ssltsn s-aaaasauaiaa, ,as Pas QLJI CAL O CUB. Est fi t ofr e tod l io tsir de lta Liana aa s d a CAsadae pa als cotsaaTe r snri talit saaa-sdtea dptasas e-a Aa assta a SteAsasaasr t saAsslU~) \ Manadtlaaane aas to Ssa, tad Ae nsasb Baris isa Easaa ataca. a tatod la tauadid luba a Ctsa aals tbs Atk detatlda *ar t raataaaas --EwEnTAD D E, ,U R 1' tdo jot la Aa~sta s la-a sanatst, La' s y Vistas a5s aa s a, E% r .-.a ,r ,1~~ ,tos orrepondnna e s asaa Vat amta paa-tJast-a la s galse a ta o la s j l.12 ilr nSaore sst or atemo tttaAattslad estaUni la mpoibildad e cntinar s duGonzler ont a las atid A tt Lbato P Wvnlttata basias asaseS. ----A-EVIC t. 1 ~ .1. Er ~ d~ ~s -a o ,,, ,p i e e -o o -w e d a d -d c o c n o o n a pnvaciones. oama Terraten 5t d a 5 l at e aa d Al d rs de C~Z,n lu ai, , -incapacidad !, ~ 1 l ;,r, pssS tA aas da aat a t. ar a t -5 o s i a ,lo a, ,at 11a es iesas otena e deeco asanr u atomdaden 5 sal ptssiard als 55a'as.ne aaa ua s dar na-t.adiass s a4 C d at Lata sn -egit -a > Mun ~ 1 Bi-ee :e ~orer. Prl ars y ~s s d di r 1atsa a C i ar-. ,,, Lap sa sSs s ,r ita al .-taS j st D e tSar ar ,a at ssr at to, S~:A_ 1 ~ a s u e aue r a 5,brd e tOS ASUTOn eh :2 f'i -si oreeber e 9 or Pas a ta ,, a, , D es oa s a a ti AS G RA D ,iL. -Ir --tisat , :,~~sa-^ sasassta,,, -rs -ta2 -510 taO ,1 _~ ps ,iaas ,,ssa5ba st:,b 2TS;iM, 1 - 10 , n nd .-o U _-.~ ~1 ,Zeto proy,, -, ir ', tsta ses ia itia alsstt O s Aar Oa atl a ioot a Tem-ay aasssaasSsaaVsadssaisa~it Tstsa dsus -sRet~s-n-.11p~s~ -t5 a5 Zatst as kas -~ aaaasaoI, t, ~ daa 1steas -ata ata adasaaaas Di, as.17a -taaa da, -,stas, aisao, 5aA.se~5aa ,,1, 1 7 4,C R E i 1 f 5 j ~ ~ tasdt 1~de 1 ea -5u - -,7. --s s s i t s a t p o s t t ata tsa a ld s AM f ..,.o P aro ,1 p-, -eg asdO pasa las lal "::, 1S si ~tr o ~e ~o h~ .O aios M a -as b e a, S sr, --s at 5 o s sIwa s sa a.C a, e eta r.,t: a. sasaiadn o, .~ads t ssssl ,aSt i ao, ttapsibl ida ta asuaaa ,5 ~~ a a5 assssaas Ss ~~aasaa u_.1 ~ ',f iR VI ta psAlas -)a ,ssas ,15 l~ ta Aa .-, ,,a S tas. alaAaa-e tbaio,,, asab. qae praiisa -s ada sabt iS i, -as.a toa sCt-sa Saa s.s t, ~ss --55 a 1 .--~,: T --ea as ~ Aa Ci as :0 yFutssa -,ad ~ V slo ASt.aSPta da asa ta 1~O a t---> --as _, 1 asa- , Cssspsa tau ta a~t 'a asas as, taas Ss raa da 'as a-11 O, lo qu Sitasc l. daSeal M srsd.is sasas liasa F¡¡¡ sa rtAse1 a deao b s -aas asttaa ts ,s alodal az tiead saia a 1s a-a asa ata saasttltSd tss 1"~a Os.at011 que %ri ~ p si ta a, --sadsa 5 ,tsa da isstaa ssnta.-Bs .l-aa,.~~~~~~~~~~~~ ~ ~ ~ ~ ~ ~ ~ ~ Jas As. tasi, As. sis.\ As-1 , 1,~, ~ Z -, -paaA r ~ : ,asar soY.k -i a 5 a ata el aaa tasna-l -w:e las 1 ---1 1, ~,, ,,_ -, ~ -, saaadasasete~ ,Faea ~ d s la bien1 s.,. ,-i essaad.sa i1 tOesi ita ', ,r te 0-a-ta tat a~~sta -as1~iat0 ; ich h o o ~ ^ 1 -, ,, ---, 1 ', 11 H F I R 1 ,1 k T ,r . , 1 -' -r --',S a o,,ta1 ?sata C tobAaa -r nas ia5 .Y .Fsa itn 1 asai.,.

PAGE 13

o CXil ./ <0 a''rr r' 5IS 7,O F -9412 .p #e #(lado y la osIcul, ¡ etc. 1 AGA d c.440k • 9u9rAce< ¡ 'ENI HOYO M Y y Y Ag, Agua 4* _0 O .4.440 p ~ri 6 p4444.44 0,onoa 404.0441 i t0 tAI DE LA MA90 Sociedad de Artos 1.p x er c ita f .u, med de 1, t y oia Caa -. ro44444 0.444. r. 04. 444 tual ~ ~ -t.c. Muoqufer romneros,, lo ada re rs, y .ira4as caeras, E4.4 d adas Dtose de l r.Peie. SaANCH Ye CiaA .&a a L eo Gold G4a4.40444. 44044 Cokhcdm94zard, .en pr.m.4. $ lhont a00.nt0.4 Mo.4qot.44 .sep .4.4,.9 *Sokron essmrs 491044 nidoa,. baldo .. A£OLCd490.4mlrtf 4 SANCHZYCA., DIARIO DE. EA MARINA PAGIINA WECE Cr IIal>*twr MARTE. 20 DE SEPT. DE l4') 4444.4 n40 0444 :m.4 r44 004444 0,. 44.4' e • ,o 4.44 .4444.4 444 Nicataa ~ ~ ~ ~ 1 A1y J, 1o, G 1rd:A sl. w loi M',tlo A "nenysl, yeyW 40004r44.4.4.44.4.44 .440 r044444 40 ...4.4.44 4444, 4G T44444 .A. ,, .,4 ,,, 4 N, 4444C 4 4 44 .4. y 44o4.ra 1 oa44 44444 .r4 .4. 44444944g444.4C44444444.4. ..440rrS. 4 r4r 44 1 A4r44.4:4 4 447rŽy.A¡d.4C4 rr4. t4.4 ,.v.4.4 n4 r (44.44. y 4 4 4 v 4r ¡ 14.4444 4r400444 nCdo(,iee an 41 44444 44444044rr44u 4.44r.444.r, .4444444 40.44.4.4 4 4o e r~ .4 r444444 44m.o Ch,4 y .444.44. C40040 44444 4>4. 44<4404n"Iny .444c0 04440 44444444 441< a 4 ,4 4.44 4 .4444' 44. R0.4odr 4. 4444444.444 444. 4 .44 44.444 -4.444444. 44r.4 44 .r 4 04:444 044,4 44.44444 1444444044444<4 0.40A14044004440044 de .4' 4444440444.4.444.44414r.4 .4a44<044 444d044.4r 4m t 404 n 444.44 4' u .404.4.4 444444y 40.v4re. 44u4444<4 C4404 C 44 40 4< 44 4440044 .4 44 444 n44 44444 .444444444 4400044 .444.44.4.4.444 4.44<4 do4 a ny -r r r0444 444.44 444 .4444.4. 44 44.4.44. Eddy 44<0 r4444444.44. 44C ...4.44o.4 44m444 44.440444444.444440444.044.44.4. .444444.4. 44044444. 4 4 444 d4 444*o 0<.444 M dr ~ 44444 444< 444444O0.444.4.4.444044<4. .44444 t re. .4444red444444 40.444d 4444.444. A4 4< .1y de 0nu y0.40.4d4.4 .T4 .444.44 t es p0r0m n a querian ~ ~ ~ ~ ~~~ ~enc yjfua ieet eaMraaMedzyAtnoMr .de esdee $3.50he at Gnr elaVg sr r 444.4004444.f4 r oo4oo 44. 4.444n0 ¡1.4rr 4.4.4.4or d .4Bar440 < .....n $ 1 3 t. . .,t y A ,om n n Triun111.0 tamb6y Mar¡* Alta Mrr, y Y!. $0.70d odos stea d CtA aon4n lCa a y leoa a Cafi~¡t C $9.50r d ermnassm La wftm Ee de Cw Aa SnHoy. ~ ~ GIl Marrla vTveaa e~ n Sart R1 y --aZ.ia P HrwoLo J-laSmn y Cqnld l tae r a ,rI.d a A n se ~ ~ ~ ~ ~ _e Wy yr .-rgnsy utvoA 44444440r 044 4440.444.44 .44444 E444440r4444d 4444444444 < par4y lol.4y, pare 4.4: "'<0 4444.44.4 044<.04 444d C .u4ryC .u 440.4.A.4 444. 444. An 4m 44<44<4 4 44.4 14 44.4400.444 .4<4.4 4 .4444 1404 gue4<4 04400444 04444 44.409 0 9EAIRS .) *000 4 SA0*1nMA ATU Equivalencia de loras entre la Habana y ine principales enl)itil es de¡ rundo. PAI NUM RO UNO EN CAPITALIZACION Y CASA PROPIA 355 CASAS CON UNA INVERSION DE $4,685.304.oa, ENTREGADAS A SUSCRIPTORES. $I9B,5QO.o PAGADOS A SUSCRIPTORES AL V NCIMIENTO DE SUS TITULOS. SANTIAGO DE LAS VEGAS. M-6. LA COMPAIA CUYOS 12 AOS DE CUMPLIMIENTO LE ASEGURAN QUE PUEDE UD. OBTENER PREVISORA LATINO AMERICANA, 44.4t94e 1444, de sa plan. CASA PROPIA .IRI 11AI Dorrnda O ¡godo ¡49rez 4444.4.400444444 j44 b4n444 4 444 m4y 44n<44 444.m4444m .d 4,44 444.44r44 t444.44.44.444.4.444444.4444.4<444.4.4444 4.444s otaaun en R-11 s h G. de ay a lssnme eu yva .4 4Sa0 ,b4 a I4 51 G4d.4y 444.4u4h44 4A mao lar e l oIa u u al r o.buutsd a era m 440r0.4l nvi, seo 44444 d de .4
PAGE 14

A EQ SALAE TECHICOLOR DE DE • DST SurDES TEATRO AUDITOR HOY MARTES 20 de septiembre a las (Para los socios del turno de no Sde g NACIONA PCena a los alumnos de la Escuela de Declam cn ¡ l esrn 0 5 CLFA dA e d amoico en tres actos origina! de MATILDE M 0%O QUIJOTE DE L u H 'CISNE Directora y primera arinz: HORTENSIA \NtDADES Rm i : E %'P b c e a e e c na p4,f 01 Que dCApOA ^ deON MOnR P i UDTOLSI L U EUX/T .4QT< 'EAEZ. COMBATEN DOS FAMILIAS A MADRlI E) emE NC-MACHETAZOS eurp!,rt d. a, d, l ut SAS ANDRES DE LA CRUZ. w, 1~~ guSEU SE t-. M.U SsERt 19 AP'Se U t suigns. dy ErIdad Du E r g cual ~ ~ dsamh rtrndedr u lma nrd b u h dadn Earlos veo do q e d e les tal s .dsrb yro m s a taera ab<,dlen erna cau D EoEdR! E ro REDPSEDEE RE ER SE ERD NE SAE DsDERE RERE S mEr yD EUR¢E44 UNDE.D IM SICAL lUM 9:15 p.m. cha) acin en el poema UROZ: GELABERT FW 1It" ,GRA 17 ~dUD ~6I~ SNRIE5"'S' AD SE E MI SDED

PAGE 15

DIARe-Il 'e-e ¡A biIIJN.AR DT lle-eW 9W IA La Conferencia de la AIR tenir PROGRAMAS PARA HOY nomo sede la cudad de New York 15 '=U-r Pt % ta, en"nsi-' ar Puore" -: Gor Mtre, inform RESUMEN DEL DIA r., ,. t."4' 4w. artresr cfc4"11mmr cri que ae eteMuari en l. TUALIDAD m 'Cuer ie .aa los dlit 1/4, 15 y ] (tc u~ ol 11. es K-= sCAGrieyPn In b--e teler New Yrk CL ~Mi M. en .t-1 se. Sra I.tre-nhet d e .lo e4ic e te-yse 111 4.1 .le' s argao que e, d re -etN tle-et leeeelecr te fe. ecc a a. .4. Cbntce.ee l c e Jun Ctenan e brad ch n o cee-an -D doo d eD tnirpeunc Eicedad eee.eri el ee-DCte e-Bc ele-eec ele-cr4 toerIO. 1ud. 4 o A. s 1. lcdc Pc Tcllrel DM11,4. Tem.eld. maII cealec n e i l d.4• ce po e. eeS ashld afcadl3 e ,s u ai e d tc-m .,. ele ee. 'e'd Brl .t.eeeeal deqe. cden Ale-,clecna 'Rclbee.'a e. eel eet-ca eeenOMe l.e e-le ago rcellehe y er. iur dcel ce.ecescnte 4.'.a 'motc e lra lele-e Bto erle-.ee ,cc ar dtl-l "aC nee.j.ccne:cel d Lpet. del e-IeceC -cee-e-. a om Cr ctil d lhZadn 7Ile. Cetg. leden rtDpeellt, la ee-lee-., ctoteeda -nrlele 4. cccera, d k: t .o, tt.d -Lt r.l e r no ura a ms m e-prtc J.e.e d. Rer. .7.1. le4.%c Ce,-ec e, Tel4d, daIlr eaeeetle tc ne ioa pedlee ecl cede 11ocpr Uc.s a re-e Je en feaeyDJto aiND e-ll f ceeA-leD ,eeemaaai 4c a e.,le-le -n n ceel-A e--t iTe -eje.hn Gale tedte.ec e" MSl ccdc .tlelei ncee-a e-ceePece-.le-ese-e-o--. neeeeeee. e een.ra telec.elele. c D e-lene-PL ADe.e-e-e.e-JeelehtdGi.e-lledee!ee-c ee V E cN 1) A D Ec nerl Le'.nc' D Cele ee R ee-e e --c ae-e-e'. e--le".rr-iL DrLAZA lP delee cee e 'S.eeece e. c c.l e e-ltlDlerY Ie celle lee e:e ', ale etee.t n s _____ NE______ T______ e-e.eee -e ecomeeec-ele e-e ceeie e-le e.ee-n ce-'leen "* leele eni. teltete-Ie P-.eeleel, eee" ceCel ce-ee-e-c e LeiYiVtZle Lunt BEL $C A? eMcee-e--elen e.de.e-er-dcee leeo. ece-. 2ant e ene.auan15 ec, lJ:elce-c IIP"S lc t ee. elcad e.ny u. le.le-T•" 1--e -ce teec nee 1P e o ede Clee-lei r1. D-eyYeee e-lle en ee-l Rece lee e il?. eA.T tDet AMe-CC o s edd.~Tst -34 WdATRO CAMINOS e' S.~aM aG3% c?S y.c. -n"-"" eIr U Y A eNeO de "¡. e Mre e. e, e-e e ceciceree-se-ee= en ceennc be eee .e-t cec 1 e.ca. c-c.it ide •yArCl ed la 0 cee-teLee e-t.ee-e-,. ec-eleR ~E C e-cN E e. eC .NECITOLam e .e-ee-e-lecec. e-eEeno ecai e" ~ jee ce-ell 1 cleeeIeT clleR il la 46 ets, halea .ccceeDe-LMeeA. neM tejen re-'e-l ee-tlnt creee-me.-.e-ee 1l y 30 et.eA -e" cE ten en n. e.Ni-o .e 1 en .t e-el e-.c,:. c Delu e elVa EOAcnSr ac LuX ;ee.e-iv) l b e -Aecee y30'L fni e o e w e-c.tn, e te.eepREN CIM ENA Ile._Ile-c e J ennet hree.ece la ice-e, te-a e. ao.Ye ~e'.eccecee neetee ca e-ns.lMt LA Vdee-4at e m VED et DOet elanaL ~~ ~e 1111. Jss am p leed lee.e"NA De. cttueecee elle Ile PMe1-15d l-a De-#bcllle dN. CAM OS ncc s e n -ede ce .en, Lee-e. LlI -L.e e .Pe-Le-ee-AlISten? ~ -IM n.-e e -yelI le y Der--a-leee"n __ec lebtlte.P UVAN O en e Le. EetrXDPl cene REU .-y~~ ceet~~e LC'tS t. CIEM dd2*r nauv farbne cloe0Noh OBed le R eo cee luele• ceeeceee Tre!e -____J__U______Y___nrehncMricoDr .ree bdlalt. aey te e. le c, eeee l R Atte-etllee-lj, pe-lcd de Ce-le 111 Mine-ce-, lee-eec le-ele 4r bler4e-e, syelee-eec del CenIt lens edc n ~ e-, ce- acl, eerle-le et0 d 1 # i u e ellldelCreee -ee l ett -aata WMe".l NaglE a lA2UGE51I1 pde e e.u ,ele encec ecac pee-l hela. xil laMarG Egisrao e IGOrilU e-e-cnec 4.e-ee ele e-cble ie n o as meoca las y alenel. e-eeeeeee-yee', lee dcctl e-.cqeelee. l '-C Cee-t tiee-l del e-ce e-ce ecsecIle-e ete ha qe qedc e-lueeeece cle gree-elec C,-limatizador:arre l c,alme1 .b oga, oeie e-eee eeee-elee.e,eClce-e~ CaMer uedlse einu del meie tb eut e clca dcle 1e, el A e-.ld e"le. t -k. o ed .el e~cio p"einanente de PEIR -n rma c~n a dil l, o, de e lee.ienceia, tel -e-el cor e e c epeldei, c e e Modeo tExeutivet l,~cioe iifi. De acero, eec ceebad ecarelite eteure Aprcpede par habiltioc-es e lerce e e&A eed.,' &em cigcnies gbietes huio ¡$abad* ,e lDcele. e eae. 6 tdioen tu £9~c, e dieeae ecu tm~ u e dic e ouedn instelao ea oael mi~ dio. 'Moelo s tD Lox en eendd. 1 tl-et.tl De ee *at en te tspeetI*. .dt para ha eilot is a mtylaeeal,4 que e leeama promedi. Lamparilla 9 Le RabeeTol 14-w0 :r A E -z PAGINA 9ULN.E AVMDI CXV ..1DPA -ATS2 ESP E14 As

PAGE 16

44444-44 ~'de g'rarifiaw¡ones a maestros ( 0e 7:_ m d s eni dn s M 44" un ca444 letrs .Y e un tiro, peo el DEe EX' rDEn nh eoc p r1.d or m n 1 y4 y 4 44,4, 4 halr ~ ~ ~ ~ ~ ~ ~ l 1~ rr 1 < p en-• \ PASAJE -)En r XCa7c 0, DE DAdun n2 -7~1 p pe r Seh vnO pMA IO ti# ll dae, R-f G. b .,m qu 0rr.1 .e e en n de y e adrnlsd p 1 ~t.nn Clb j, Par -~ d y al iga u Yr e Dtae t. d. id U~ 1 q cd 13 tAlmt b1pr71 pbe 20~~~ nd s, 44444,4 4 44.444 44444 44'4444 --444r44r444r4444s 444444h44r444 44 -4444 44444 444444 444 44'4 4 4444 4. C4444 444444444444 444 4444gu44r4 4 4.4 rado4 de4 44' 444 Ce4 s 44E444444444444444 44444. -4444444444444. a4-444.44.4.' 44,4 4444 444444C 4.144-44-444-'4-e44,4 4-4D-m.4-4444. : ,4d44G4444." 44 4 :4 '. '4444 erped de la pe 444444444n. 44444444 444 da44444444C4 q 4a444 4444 4444444, -4 4. 444.' .444.444CI .al CaDradfed 4 PA44.44A4 4,E4DE4 EXCUR4444 N DE 44 IDA44-44 4k 4 44 4 -a4 ,44 4dr, 4, 4 4, 4. 44444444444444 ~ ~ 4"44 to .-4'444444a 444a44c 44 44c e PASAJE4E.4 XUR44 O DE 'I4A 4444 V44 EL444A 4444444444444 444444-.4 444444.444444 444 444r'44'4d44444 44444.444d4 4-4 44-444 44 4 44 4 4 '4 4 "'4-"44-4 44444444, ''g. -d c e -n 44444 s ca co p4444444dp44 444a ks 44e p ~nNha lsinao 44L44 4-444 '44444 44 U 44" 444 4444 ,44AR 4444$iN st C B s -n .'444'loado d ,e 44444 4444444444444e4 4.,444-4. 44a.n4J 44-444 e4 44444de 44444m 4444r44 44C4 A M 4444 44444E44V .4.4.4444444.44a444. a 44444,44444 a c44' reort a4444d44444444.:, tres 4r444e"444'e4.4444c4b44 44'444 4444-4-~~r44en-' -er' .44"44 444"44'anad' 4d4444 pa'44 4"' 4444 4'po3 tb de 4e444444 44'44 g44 4-t .n4444-r4444444d4444445 44g.4,:rad'4ue 444a 4vu44-. P 4a' 4444444 49 44 444 aux4. el44 444444 a rd 44.4444444444r 4.s:rent ~"~~"444" 4-44. 44,4L 4 44d444s 444444n4 44.4a 44444444444444 44444'44 u-44n44 p-44t444u444d44p4-444a44a44444d44E4444444d444r4d444N44ar4E444 4",'4444 444~444p44444444444444444444.44-444' S'4 n 4a4.4C pr4es44.m44-44 detras gu4t44 mp44 cuand444'4 aba una 4 4444-4444d44N44-r44 4.d-44mp-4.v's4-y44.'qr.4444.4c4n4var4""s4r44es'd4" pe4" s4"'4444 4444d44r44-v444 44444e'444-4a''44-4u4nt444 444r44dep4 444-44 4u4as-4ao 4444.44.444k' 444444d444 n-444d44qu44n.444n.u4a44ab4444er4d4444-44un4.des44-444:d44 E4444 4 4 4-4 4 4 4 4 '.4e ears. setaoas, lg alqe yr ee 444444444444444444' 444,r44 4444 4' 44 p4e44 .ve:: 4. d.4 he4o4anent 44 4er4 4 4-a 4'4m4r444r44444444s44re4s4s4a 'n4. ,-4,44444-4.44t44' 44. 444 -'e4' tr4k'44'4 nd.44 4u 4.'er e 'e 44m4n 44a -.4 1 44a .4 d4 :.4 cr 444444444444444444444444. j~"4a 4444p 4 4,444 444-44 -4444 44444 r .4444.r444' 44p 44444444 .444.44.444444,.4'.44~444'4444444w444444 44444r444a444'44 'd4444 444.444444444444 .44 4ned 444r: C4 44 44444d4 4.44ar na 444 .''4 444 444 .' poias d am szd mtuend 444444 44, CALZONCILLOS -4 De c6modo y 40 o44do4 C~ 11pec,ciemne o -,,¡dos en 44444444 444414 444444 4 '' I 4l¡4 44, 1,25 CAMIETAS de 044.430 4414' 1e 4 14 pa4. 1.25 Utilice 44te 444444 pa444 44444 su pedido, EL ENCANTO. Apartado 56. La Ha6aba. Caid ARTICULO TALLA IMPORE ....... UCheque < Gir stal411 Cuenta Cal¡le N*. Loalda ______ P444444 n4 444444 4444y 4444444441, 44U4 44 44444434 444444 44444, 444 44444 4 nrs C''J siM CI 4444 n 3 U ec. 4,95 1444 14s 224 6.95 CALIDAD POR CALIDA artculo, le cuesta ms en EL 1 I

PAGE 17

Perspectiva Por Arturo Alfonso R~el1 Elogit ddo eOeolea M CalladWy N 3 1 134 111 31143 33 l, 1133 31 33431-1 43 3n diara de 3snt333 n 1 333 43d l3 ,,¡ini33 d, l. o n. y o gpra a alane, CN.ba c14n 8ov 1,3 33 3313 del 33133 3qu3 ~31 d3nad,3prec3m1331, por loa mImba 1 343 presuetmoainsu c >'i,,,n regio av q, <334333334333 e la 31134u1 d33 133333433y33r1d31 d a 41W-4 313331 fra31-o11,,3 que d3h13n3a, q41 431e m<33<3430s 4e C-a 333i4-1 7 ,n fo ante 3<1 11g31qu 3 so.der. ea re. c ~ d .m 3 4~ e s 1 3jl 3 3m m ~ 1 1 .As .e rm o e ~bae q,, t. e. -e 3 : 31in ~ re1Ir £43444341 11~ 334 3434_ e a¡ .t? d t-ho M 434 3,3,, -l34443 4144 t1,7 d,.U dp~: dt e ao u 1-344 .4 4: 4 4, -d 3 P -113 44 ,l,, A4l 34 -< 34, 4333-4,1,1 -. di 34 434 .3 o33c0 .33444 h 1-44,34 3444434133 .3 '1-3343 34 :134 43r434 ran3< : 3 r 3 0t 313ma .44 ar. r3113en4 3 3 .ich tb.radau glud fa stes rpa" 333 4s 13< e 340 r1334331-14' < b1444 31di 3434334 83411434 sa -~ 1,-11 343 33413433 33 1131m: 313334 333 od 333 14114 04 33r1133311444 113r n 143e 333 3144 333"3141131o 43 r 4113n e 34 114433 113333d33 £4441134 e d14 13331433413 £d1no8 441 £413,, 310r3 331-3313 n 43 br 34343 3133 0pen-3n-313r. E<41-s 3304333434u3 repr.d3 443 34 > 433d333 14s 1-3411143 <1p3144ic o 1 v33ven 43n-4d11n1s<111g44,31331-1-34333331334 "T;m 31nd 33134 3433333 y433 3331111-e 333333433 3338 E33p434 343s 434, co 333 4, a1 e0 333rmet 333a13 333 331sp4l 33433 oaI3n 43r301031, 43r ren13d13 31-3m338 pofta, g3a433a4343,3E33 a' J MAR 20.i .PT ..1949. sEnCMm REGDU NZU. ~X WSADAS Vapor "HENRY LOMB" Vapor "ZOELLA LYKES" 33343 31 S;. .-4Aea' 33< C :s o. O .2 C 4d 4:<3 04 AES BROTHERS BAYANA AO CANADA -HABANA -VERACR t R r.T Am AM RIAN LIUTN 1 EERCO CAUSCO AIGA 11333 34131 -4L 3ON1 13 1431SWEIS AM, EPLCA LUi NAEVIENRAE AEZENAR. SABN D M "MON'TE ABL VICIO &I TERAE SNA SERVICIO MED3TRRANO0ANA A '3 turd -Nuboso -elE de HIERRO FORJADO r3u10133'13314 .IN A.,. .11 1 RM -e LOS NUEVOS COLOR E ~>4 -4 ---------INA ti 4aitud del Sr3 POPLINES _Narcis r o. iNGLESES 2.2 1EN BLACO Y COLORES 30 C0C ~ 34 < 3114 13 -3 a. E 4 1e 3 133 44341 4 13 4 3 4>4 a a 44344443 ,3-LEa4 aaas 31333341434 33144-4^ 043443 M9 U3 34314f4443143 4>1334 431344 ~TROS ESTILOS DE 3em 443 333433GRAN NOVEDAD ESAOE 33 4344DESDE ,7-, iz '>:lte di 11 d,1>3 .1>3, t3.1 K. ,s IN ~ r7 .et aa el NA p,.,a tDe .er esd rtrdd rne s ce c d e ~llid Ga ns c tsmu mo o e a ues ear-a npeo Z4 -> 1,1>,1 ~3 441-11-334.4443<4333434.34 :d, ____ q_______ an ___ y cr___ nd_______ j_____ y c 3 .a>11-d 03 :a 13333 nruacmi nprae rdo ecs 33l434334 44 33s 8ompa 3r443e 3> s.i e -Ertn -r idd IABLEARI e fect oe.a ien: en wlos 1 4 134g~,o4333 1333313433433344 31 340 1>14<3a 31 *3 -bodegas d Luisar Ca aleo S. AS Aase~~d Puerto URPR AunSanto EMoraFncal, Espaa.o 1 C<> ' -Peua de, 1 3444 144 4< l4a 1314-440,<0l 14 33<4< 43 1333<3413 134 3133383 3 --____________ 4 -333433 1143 1-34.3343l 334331-34333. ,343< 34334333 131-3 r3 341 33 r 11-131 ESTREPTOMICINA .aA ESPAA 1Qn NEGRA GALVANIZADA da desde Jeada para w~bao an Inonlo, nzt. eins ig2r~c alse acomndlzlo~ do ei y en qenatl pw= la ledeiRl ~ donde s bonbeen lquidn cnrTae.'. PIDA 0N8ORMEN Al ALDO Y MARTINEZ, S. A.' -$8 ~ine ~eeetdo elientee 251 -A-7754 .Morcodene 2114 >lboo. Aptdo. 789. 31'3 34e 41438334 33 144343413 4 0 pa ca41e.r4 zs Edr 34 3333311433 33 14114 .3s 31 444,d 43< 34e 3a31v3,431e 31114p -n reauo o ooe lea r onaisbeai idp7 3:<1a01333que 3g4. s 44,4 1 1-143 ~3.1a ~o 44 el Dipu.cn y .o p, i Itld, ''abe d ii,,; -, p Js 433,,434 3 11414434< 1331133 ~211,1 1 r1 5l um s elbln ~ A,* l,te .M333 1-311 3343114 ,34 -444343 A.d 1 e,r, i, cprh.r, D. r ir leJa rd a nuent .rTpl e oh ro rm&lszw, p r :n tare r1 va 3 13i3 1 ];o e 4 i3333 333m34 .4 3< 4 13 044134 4 ', 3143< u-1 3<4313<3 En434 1 dad e de Ay, M,.-,t El 41 1e lr ,r1r344r4 433 3< 1134 3 Io, l31 144333 /> 413ar33 4 s3 43 r33 3 e1,r Morar k. lmme b y xr. q1,1~ hizo I nterna n Wr e munqe mi nisfsr, 1,.itd oti.loara a -ht m cel publ esof. prrn i ras w aafdadU uetdta e Aftaell6 & ue ~tr. potc exvl -d, q-l 1133,m1-3de 131333111,413d34, o un .133113333 .d,3, 3.431,311 34M114131 ],.4t* M3 p313y1-33,4 pre343 313<1d43 1131833333333333.e H3a3331e4343-44311-4431433,133. 3J4, er 111343314 .1 n 11j113 1 rlas y11113130, 331-333re303<3,4341131nd K<1133, 13 333333 443, 3<3431334<41 lo 13331834 413d33334 4314,44rr1 13343483 en4l 31 83 a 43 01-34 31 11431-434431 31 11R4A11-3 1133133 3 NJE11-434 3L341 33tiio 04d43 114331334 13' 34340r4134333413411C140e313433
PAGE 18

PiSCINA DIECIOCIIe9 DIARIO DE 1.4 MARINA< MARTES. 20 DEi SEPT. DE ¡949 ARO CXVII La Plusvalia Per l n.Cr er e eeel (Cr' U s ee lle e l n 1 Azence eci.re rece hu crena ele neceen rp e.le ne muy ciaomneCb )eaz cc rele huelee hme e ecenmcdr eri nlMeceyininnie re le. ered Crdtre dcedre eooo haenda s e n elee nce vre r eea: delee rn 'edi erenp l1n.s n y que es, m krae .n, t.ndas1 ass-n ru jaa, r~. C.b;, co Ii Inn e lee del prree d'' dir eiiiaine. eeden' eu r aleeb o nc 'e bee1 c eren e e el e eu e, d,,, y ap~,a ~tas"css. y~ ~ tbs qr5 1 -el' erraron de baja ayer todos los promedios en la Bolsa de New York iLa 1evloriz
PAGE 19

40Cxvu MULTIPLES APLICACIONES EN EL TRANSPORTE DE ALIMENTOS Y CONSERVACION DE ARTICULOS QUE REQUIERAN BAJA TEMPERATURA a moderna fr mula cien ¡ca del HIELO SECO (Bixido de Carbono slido) representa wn medio ms econ mico y prctico para el transp rie refrigerado. Con un Poder de enfriamiento 10 veces mayor q¡e el hielo corriente, ste ssevo producto ofrece positivas ventajas a la indstria y el comerc¡o. A LIME N TOS Leche, pescados, carnes, huevos y otros productos expuestos a la descomposicin, pueden conservarse y transportarse en condiciones ms prcticas, reduciendo los gastos, y permitiendo el transporte de mayor volumen de mercancia, con el control exacto de la temperatura. FLORES -VEOETALESe La conservaci n e estos articulos delicados se controlo perfectamente a menor costo, puuiendo combindrse el HIELO SECO con el hielo corriente paro mantener la humedad necesaria en cada caso. T RAN SPORT E S EL HIELO SECO abre un nuevo campo a la industria del transporte permitiendo acondicionar lo temperatura interior de los camiones paro infinidad de usos comerciales, librando a los equipos mecnicos del destructor efecto de la humedad. MECAICA El alto poder de enfriamiento de HIELO SECO permite aplicarlo con xito en modernos procesos de contraccin y dilatocsn de metales. Gustosamente informaremos sobre esto aplicacin sensacional del enFriamiento para fines mecnicos. iUN MEDIO MODERNO DE ENFRIAR MEJOR CON MENOS COSTO! HAGA SU CIA. "GASES INDUUSTR&AiALE" .A PEDIDO A: Ditribuidores Exclusivos

PAGE 20

PAGINA VEiNTE DIARIO DELA MARINA -MAR 20 DE SEPT DE 1949 AO CXVIi REPUBLICA DE CUBA J nomioe sobre 'Lo ds, .o midtibrai .' ."' .a P MINISTERIO DE COMERCIO .A A;, A ,yr" 4, r AAAAA lAo4 h io ane-o-a vr et AAAAAAAAur I bAeiar oe Ins, rrp ArA ne ArA :jsA nand AtA r r A r rAni, A LAA AA. m .d.A n AmA AA q AUAA DA AA !AA Al i At AA EAAn FA AA AA vet 4w AA AAAAnAAnAMAAAA AApA. YA AA EAn A aA AVISO. 2 AA.t A tAr A A r AA. PArlA r n t m a AAAA Aue r A AAn rA AAAnA m i vAA y A AAAAI s. .AIn w' A rArE UU.A LA 4rA dA uA N A .An' rAcn rAAAAAAA AA A A nAA' AAA. a t vA l a G r Ab A A A 4 o t d(A AlA pri a en Ac .i An lA. JAnan e n A .a A AA re AnAc o AercA p e A N AA Aa AA AA oP BrAAAA A A devAluAda la hbr4 c. tr. de una eunin lGain dedeAAArr d oerA ne4e r 1 d'pA Abre e A eme unt3 reb A AjAA 3 AAAA s AA Ae U ArtAvA d4 r p Ara A. puA rd L T E A AA cdAds t nAlAs e cAdA cAbA. Ar Al A 1A; pubA.a r eA, P AA'inAet T4 BrAAAA A A' uA d n d.rr u m L. n Ar .A p Am E -A A CA A SA < UAn AA nv~AbrA rAAadAn Aba d a r Er'n rA.n enmALAAA dAyv t r r.d d TRA. sA .AAAAA p AA a n A Am E .n e r AA rAa nAA B c Ad .A A(u AA AA (ArdenAsU UcA slA a A DAnSA bAgA mA 15da M d AA AA AA A A A b A d ,A A A dAA .AA A. N4ay o bre mo L AUvq.A A Aue A A A 4AgAd ,. l sdu -Esim r sc n ib e b e Dr 'A A A AAdA A A AAAr A, Ab A' uA r AAmAA A tA A rAA A p o A: A AA rn AA d b A A. d i A Ar ( A DAU T AUJILL rAPA' A 51~ A 4 1 p AAAu A A AdAA d A n m r r LA AdA ATAA A O A!AdA.Arm od quem a a ArE.A AA AA A rde AlA AA AOAAC'AA.AAT A eubiA. qeH-eno a osse GrAAA A A An eAAA aAA IAAr AAAA.AAA.u 'A AU 'AA we AAApAAA wrnfer Ad A a os Ar A qu .,n A A Aeh e AAAA'A as ase A A .A CAAreAA 14'' U ern AA.AA' AA' AA sob<;TA'CAA. el rA."de RI AA mAAAA :Aron. rAdAA Atr A a : r Abar. A. .'A AA As AlA IA m APA aEA A A S "1"CA .\CCAA TE A e A .'.' A A A 'A lt A dAA bA'AA A AA CA'A.s m' > hAA n. hd A% t IrA A r A A hA AA rAle A Y14, d, ..E G r d rdAA d n drAn dU'd r d A~wA A'4 AA-~A~ d d r .-lArbAA 3i AAAAAAAA. AAAA 14 IAA AfAA A, XIAA AA u, AL n AAA A NY, AA A 'AAn AIse AA lt Gr A A nArA A aA aum o nd d A Aae.a:d e, AA' AAA .AA d A Asjt.A l'c.rAmA:. AAA'n la se iA orAA io ocAl ra A Acno AAAAAAde AAe Ai pAAAAA p5 imto l A fruA ArA A r 4AA be A nAAAAAA' AMP.\AA'AAAAAAEAGAAA N IAA yI lA An. A r t, AA A e bt el I -A A AA AIA'r'A A'AAAA zAAdA AA AAA Ac b AlAe sene AA .ernd m.A go ''A 'A Amrcn gAlmnt AAA '."U'A' '"'rsndeNw An d tA ApAAAA.A En A. A at ld Ad, n A '"A .As d u e y md d cb A .ls AilAe A A AAAI AAAAA AAl AAAA .AA r AA. AIA'AnA A AAduAAAAAeAAA AAAAAA AdP A tpAAr.A A AA y AIAAAA ArPA A .'.IAA A A A AA,4A A AAA AAAA:AR .E AAAs -A u e At .b .e0 .'A<.A AAA A Ar. -AA AA-y dAAAA AAAAANAA .AAAAAA AAd Ae 7 A AArAdAA .: *T 54 5N 5 -53 51 .53 AqAA AA AA'e ArA. eA 'A' AlANi d A te A A'sq f Al A.eAdA"A 'A'.DIAl .A A' A eAs< ,A .AA ea::ac. 1AAAAAA'AAAAde. er sAAAA:AYA AA .rec rgr u a cartr o e se AAAAAAAA-AAAA:.AA A'AA A' .AAAAIAAAA'.n4 A' AAAAAA.A.AA A'' bras.''. deA"A "~""""""' AA A A AAAAA AAAA', bAli YAAA. AAAt e, A. AAAA.I.AA EA-. Il AIAA4 """"A'AA'AAAA .4 A poc .epe evr:rn2ltswsa o a ,AAAIAAAAA.AA A'A AA.Al AAAAA A'Aqu l A eA".'l o 'AA ''A A AA h Ao IrA'' Ae AAi enoA ATA~AAA'AU.AAAAAUAAAAAA~AlA.AAAAAA l AA P.A. .A'

d1Ad AAA 'A A As i A A Al 'A AR H V DE MA'AA A A AA' AA .A AA( A A AA lA,. A AA. t. AAAyAIAAA lArr. rIAnanAAA AAAAAAA anion lo semr AAAAAA.A A AAAA A aSve2 D oe. rf:asAre: Aa ',nd Abrcne lmee d "mjtad AAAA AA AAA r A lAAA' At AA A 2, di evnsn e gc .S n g M 1e qun, s edi o F. 1. c Pantoo, voo los cro funhn Y~^ 1 ~AA ,1 n' J a d '. : et r., CA A d.~ ~. taRi rnd rmar e ru a ,p, A ________________________ Sete ~ ~ ~ %-t a, ync gewa Eprn tZ.,lo areatsd L5:WL I)d.lra deltf de fRepES A 1AAAAAnA A rAA A rA A:,,! D, A del A Ai AA AAA 1 Ab E-TalA A A nesdo e rmaa l o s rn ez r Doa',de H D", ~el DHAD R 0 A A A AlA "CA A''. AAA'AA AA. L. AA UA 1 AZ AA C'.A 1AAA A.NA'AAA AAA DA AAAIAAA AAhil AftADA g~ la DhU CUETASPlNN0POO9,SA yAA.AAAA AAAApAAAAA:AAA Al' A ':AAAAA>r Enet lz eL a AnA. SGU111 ~ ~ ~ ~ ~ ~ ~ re 1, 11.rgRNTS~OEAR P, Lt-re -n dI qoes C lhct L~bpe, y C"paa \ aaitro xe DSsesinblne0 Dvs* jsa l$ SEGURO~~va DEta AccEN1 po-eozdi dar en Coj d*trr Bolos. Parn sepra yo agma .SEGU R O CA TA CENACAON. Avit frAAAioneA 'AA A? ALaA AAA s AAAndA Cor amy.N2A8 e APA. A ~AAAA ARI 104.dr. AA'.' o mAoleto s tras Ay ASAle. cANA A A coda PAPEL SAM Ri PARA GAB Jorgo cirnnde doll usndi y ennte AA M d '.A:AAAAAAA AlEN .ROLAOA AAAAA.AAA y AAAAA ItA r APEL A AUA A RA y lpAAr A AAdAdA CA'A'ueAAAAAuAA' SERAAAlA A VAAA HASa e AAY A AA CM."AA A1? A AAAAA. pAAA A A A A.AAAAAI
PAGE 21

r-Uno d aettae da e r remn aa becote traj d a ocir tnea. e cteidr-oatatuai t<1 accedre edad ha erd-cic Cec e tn4 oeio de aa acaobenote ioie C I'RIOSIDADEq: Td Wllame nno, u ha de aZrt. pica deide que e htn pc-eanat dl depicto cetebra el noerccifoc et dra 3d de ctlabre. ceraue nc urae otena duane la coancada edtiil di lrai bid .La orato Bobnen fre ca un co :r de art piie paro
PAGE 22

PAGINA VEINTIDOS SPORTS DIARIO DE LA MARINA MARTES. 20 DE SEPT. DE 1949 P 0 R TS A9O XV11 CON LOPAT EN EL ROX VENCIERON LOS YANKEES AL CLE VELAND 6 POR 0 JUGAR E JUEVS Ral Esqueda w tn nv_¡El promotor Abarrategui hace Epid e u a JUAAE JE ,qel Rpidas Ama¡eurs LA **SELECCION .V contra Sierra declaraciones de 'importan ia UN FUERTE EOUIPO -d < ne<, t trata de in joven peleador -.1" da Eph r przscal rr ]o, por -r ha obtend selalados re e tor clem ro. eo trcrt dOrrms C ter rae rotrie dOrrOrrrOorororOOObCnOaOOeOr OocrorOrreor eroeoroeoro b odoor'so dreoroos r oee< es r ma raoOco':n ortr e orsotpofeOorrssO< rOse eO <005aosY SNuea derroto ___________r___v__d_ nd f pr1eleqp o C ma00 obororOrOro cOre on'ooerreeorLcg, Obeoroe! -iaDe a ? sDtr ee eo'o r oorr OC a o rore tr rror oor oiOCni"ese d U n 00 <0dC y Un n00C; tne.Gd o m e tOs .po 'ores nOtto, Otoreen o ter mo -or hr, e bor o~ r r ,.Y Bra e
PAGE 23

tPflI RTt5 AO CXVDl I P 0 R T DIARI LA MA9AIIV4.41 w 20 DE Ser l 4>41 4 49 PAGINA VEI&TFTRE$ BARNEY DEJO EN UN SOLO BIT A LOS CUBS Y GANARON LOS DODGERS 4x0 T*picos Fbitho1isticos -Fortuna y Cntro Gallego, los finalistas. -Ifisertirn el domingo la "Copa Habana". -Cuba jugar con Estado, Unidos, maana. Por "PETER" En e l !,f dpo de ~eesn 'oren a¡ fuera ura cutotin persoal ,d.s -d, n=trcs oqeas entre ctrrenePlipa Cordero que Jplier Pluvus hace de las suanot por el ierla, Y-s Pr,:1 l ,-.sm puede decv E. l.a sgund. parie, nt do .h.,. lo Ii.on.d.s de¡ baln re1>, ql-nc o)eit. a. brega, Re, d4ndo, Porqe no, nos negarn> q .e naldo Pealver dealempat 4 an w para la pr eJ.rnada del t leo in. 1P.-o 2.1 .fav. d. 1.s Con. H14na loe catedrati> co' Al~.>, y ef>e g4 refiult pctla4r, .J4 ventd A ,4ur 1 n 144>ent. 1 d41 tiu.f .P1rque 4)c4 Iberi¡o>444>I>4. >1n >m1 5, f~~p1_ s.>4>4e Pareci 4i le 4 441 ucedi lod1 lo coni4ario. Vencion ti e Y Rhea, Y > 4n cuando la temp J.a de¡ Fernina y iruinftr, l5, i -u orfct~ P., o qupes centro G leg e >c>mb>o ~r~4 4 rc que 1,71U; y ceo erii, 1. equip.a quc it fect, y derde ento9ces deey Ir d in 0 ju n tcnca, Po qtie demu co o a, 1-de, 1crn,;! cr .d.g co o.iib, 16and e 1 Pc.o '-po 1-eaa re41, Por >4>4>44>4>, la Copa >1s4, No >1hay quien lo contro cga y mginr ie ti 1P> l-44 >> .l., g.tite,l. que -4 > >4>iscut41 4 e1-1>44> u r n4>v> gel, le. q-e d-n CNudic Conde taj e de A pesar, d, 1.s pearep. Espa a, para -e di-ctid,, exi las Reloald, Peria'ver haba f#11,do t jitai da rfsinls Q.o -s hr o. lty, Po, mn-s del Ckilic, R, 4o4 y >i1p re 41i>o el r. d > >e 14 v> emple >id1 iu',ri>l pu>4 1. ma444 dr> >4 4gntar 44l 0o po, 4> 0> preidente del Deportv Ce4>r4 G4. Ce 4 4 o 1 de 44 4>4444 14 pen> 19144, 4u4 44u >)'r> 4p4r44> m>xim, Y 41 n>4414> ej14u>4> 44 1> reio 414>r 4>1>.444p, '14 o4 d4>J4an414 .ga >ir de Fut'>l 4> L a Ha41n4, 1>4) P1r 1y 4 14 >1441>lr>44144 >141 que c.u >444 > >n 1> d >, .J>'h> >44>441r 4ue >4 >14 4>>4 irque eu fenc.,e, etdidAh.epn. poeh np d, Ro l ra que ginorb, ds v1e "egdo r~~4,eva u io rz y b -ndo l pnaly-kck.F4ees wa & a tands rinnes in s~ndfr~ -se en 1~~ la ~ irae r ad. Mas o 1b4r4y 4r G g r-d,4 4 4> >4 >f1 4 t.1 l a f.nilt M-ha 1adI >r eia e t-emo d',ia te r el, to l , MApe R O :o fti-adI 1 yd Ma, Lezpz Pc Deron ¡in solo G11: syBns ecn en la t ur( d1 nr h a R. Bar1ne14> C>1d444 >. 4>1>4> En, l, eelelarimo binenro Jm -, paaqt C 4ICAGO ept 1 4n 4 > t1 d A >i -y1 e>nw 4l.>1 ti>unfar en un 1>4>4-4l 4 n4 4io l Lur y Bw :, t a 4 4)>rrya >n Con Re. D.rney co Ann Trao M.nw uo 2dodest loa a e rfd ui, n0QCRant a@ 3n obeni av r mhbital. J.a Dodgera dciB, p s n. no narvmo .dea p -lyn vencitro cuatropr, r o u ac de ob ________ _______ di ese .d ir Cus ejChu.ag, .lJI,que Bar t: roo.ep e ncodlmac u a n n a a e j bit ->11 441..>4 lePo Deronn umn over sohrek4oZtLSi, m8 > Rmos,> j<¡<¡j < .i u ,><¡ ¡isradY4>>4144>a >h4,ng 4>n14>r1g4 >14444 CEl >>r> dr d'> 4¡>'A>44>4a- d, >44* 14'>>4 >4> E B'>1>sh1r na1a> >4> CHCA. ¡e l 1 101 >4>414>>1> 1 jea de1 Sa. Lii, re.,vaur V'd i, d Ve saadrdsdt eeaoD C -oNno n tbsasnuo m4ntl de> >4e d. > 1sta, e F.1.1'> ___ ___-______________ 04414 Ph>4 0>1d414444,4 '.> >1e >141n ~h. C 14> 4> r >MAXIOC ra, que deL.t eate tarde e atr taraspra n e r no u swona u necoarnrcpoaet aaos cena bas.1l44>44>>14>. >14>4n>> >1>m4. >4 44 4e>1-. d4 4> >J r n n .4411>4>114>4>41 .,, ec ,i 4>0 ti.d4. 4,1414. n M,,. >4 41 -1>444'> 4>4>* 101441'4>14'>4414 C10 Ja4k4Y e,1i>>)n r4> 1> > A4>444 yC>1 >4 4m .4 .4 > >o 4> y 44 >n444pr o41 144 1) 4>144 4> un>) 4| a 4,4>c 4d> 4 4 J1y C4r1p1 1. Mary 41k1 >1> e1' 444wr 44>'>1 41,444 o>1i 1 1' M r n y 4> r r d .4 4>d 4 n r >4> r1 v 4> d14 >4>1 0> 04 Cr c 4n444>444>U rr d' >>,' >44 r> > n 4 > .u 4 4> .m r > r 4 r n J ene .b .m1 b fto eh N pr 1,ograon tres. 1 t ee cr syn ortcrm re ifet oo rrila r a nad LA eiaoao ae l lv aed oiorce u Bd r y, 4 4., 11, 1 1 t 1 1 t d1 4 -.---en4 4 1 1 t 4,>,, 4 al llegar .1p nra m a eo n uaa T4141.> s27 1 1 44>n 4e>1p>14>1 tI D X L n n er gt dr .C i, -4,.4 -A nr '>4r>144, >& > 2 14 >4.41>444 n >14, naala m nae n e e e mrw 04444 4>4 M41>> 4444 Ckvr ra raa de gd opriaue g aoe prniae nPtH dfms uk o eol a t1i1 >1 1 14'>' 14>1>44>4>1>1> .li E l A t L I F, )> Calzocillo pw .' .d 14 >.4'> 04 >4, 4 4 . 4. y s d >4>41n.4>) 44. >114> 7 1 4--.r.>in bnnah ame 4> re .44>44> curt yqun 414>1 dicho14 04>414441> 41>' >444 4 444. '>41 44> >14 14 '>>m yo a nop o da, #di rnaci pead rip ,es eecrr-o l e a Nsr >11444 45 414 411>14> >10 T>1a44 > 4 .>1.~ 4 044 1 1> msaBw ve hr nr rrh444ag 4 0)440 >10 (ana~ .>1e et .44) .4 .>1>1pr aa coe Cle5: HodKen Doble pigysHay una b adrio R unO-A nr eo ,cn a ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ pr todo:Res ogr a udo ei sadsU o trirz der r a f bn la~s Brorkcy ~"b mhcg pwznatPrksmpoe dga n as ~ ~ ~ o irar m3 filoa u e ~ o *p rec : e d r Ip'>E 4>E 444 fordok ump -.la uua ern ns 00 "' ubna gano ofi s o' m Cruara RNOelO!ll Anba g istribidc Exlsv 1, que-ll 314o -to Te33r A-d8952e -a Hansb orioe 4>4 044 44.de 4,>. m >144 44 1 4 >>104 44 >14em >4 l >14r1>14 441 >4>4> 4 >4>. >'no sep de >1>e 10du1>4>1 ¡>44> en4 4>trcr ¡o qu o10. r>1 pqEn Ca pIzarncallro esu 41.g5WA >11>1 ~*m)4> 444444 ALAS 1 cta GS8miuta. ta nn mtra7o. > 4nn HassaEUSEBdO SENIl 5 PERES l b0 Y54144044 Mr89r2a,4 Hgabo4 L1! ,ia, ee de Y ri , e 0>d p pof~ 1 1ble l,pp yhe Washington Ave Motor Co> MARINA 135 HABANA V>alas en tadas las Agencias STUDEBAKER de la Repblica. Color de alegra y buen humor con CRISTAL bien fra. ?¡.,,>54~JnivX¡>t¡Decir n4 4 41.> ii140110 4 0 41~~>4 y M-c, M os >14 4. >PLAYMAKEP. >1>1>4 ~ ~ t >0411O A44n44>RoLLING SPORT SA M on fl>e 4414. 44T>4 lI.1 A-7949. SUSCRIBASE Y ANINCIES. EN EL DIARIO DE LA MARINA en e dsnade .> i d L _a.

PAGE 24

Piden que se tenga en cuenta en Discuten 1 Salubrida a los reterinarrios meu. t ri' i'er rsiBu0delah 4,4144.44p4414444444 4 4 d4 .44a.4 l4444en -41444 1441444 144 de.4 ,444 1 dpu.b. .,-,n queh44drn4 L 1,0,000 quintalri dresal -s aa a d egso, ee a as e e n sae m ae e ri.ee sndr aaov lH f: m s 12 g m a'c sa d s d e aa-e a -"a s o e n i t r1 es h ln e i o l l M -s p~ 1 ., a s ~b II, a on h ia a anoe ua il ~ ~ ~ ~ ~ ~ a frece tiro hz r, qicn4 unad ulir r -to m a y:. n irolm n ain s acrnrd nu m • 3ena eu ate ico'.e,, dp A,-,,!,,, Zj e por, e (ir a rp$ t 1111va m x e si ohr s r al E ia e c dprest fdibl q en la coRe pbl c p R-44444,, 44444444444414 444r4, r: 4 ,, 4 4 4 n4 4 41 4 4 4 4 Ca:4 .r 4 n44 n444 44 r bri 44 1,, P. 444144444144444414 44 4 -44144444 444,44r414r H-4 44my,1 I~~~~~~~~~s~ Mni~.,nn Iel uMm rse leto ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 1n rrd~~1-d. U, de.ret kg.d P-tr.G ue sG ea:ae e, tae o or sndrCsnv iou 444d44444,444444 C4444"444444d4444444444"4-4444444 i 4s4d 4444,4414444444444.4444441444414 1444r444 d 44444 41 mo e 4 4 4 44r44 444 aspec414 de 44 m4n444n4da p4an.4 4444414r444444444144444 ,d1 ;-A 41\ 4b44 y4 gu u jnrGis m ~~~~~ ~Iez n "e mpd con Broff a 2o,-alo Qrn nr>suo vemt m rrespondiemede FlIZ, INe d l c,~n epeotqepr msl o ZPo ro rr qu h1 -t U csais ~ ~ ~ ~ ~ ~ ~ e T.b.i. d~ae e ute eao u -,.jdr dedlK ns ud crpa tr ~ d. wt ¡4 1t..44444 4 44 4 4 144444, 4, 444.444444$ 441 p1r4441C144 ena C444'.a 44444444444444 44444444444144 444444,44 44e 4144444, 44444 4 14t 4144414444 C441441, Pes¡odsas 444444444444444444444441 444414444b.me Bu a4444 44 4444r441414m41444r 444s44 444444 C44r 44444d4,44M4 44444444444.441 ,444444444 44b 1 44 r44441 144444r4444da 444444n4Ju 4n Y 4444,4.44.an 4144444444444441444444444444444444414444444444n44 41444 444 44 T4 44,,/4444414444444.4,R4nch441V444 e nc e e 1-d ar 1 DrLaisA %nle tatatesto aika Dh n, 414r4M4r:444C4r444 o 44 s4 be44 a 444 41441444444 44144444441444 41 11.4444 4144 d 44G' .444s 444444444,444144144''a eiahaa ea i 44r4 e 444. 1444444 4444144 444 ce, a 4444444 444444 d11111r* a er 4d -444444,44 e 4 41eca 4444 < 4,444r4444H444y 444En4ru4&1da 4d4d V Al44 M14 44r11414 14144441"44 4 444444441dena stana Duaese m Qml Car44., 4444 s Agu44444444444 4 414444444-441 44re a anarc a a ro n .n 'e r s P 4rs 4veranc 4 Pr444.4444144 4 44444444.11144444r4444444444444 e Vila Mcaen SataCrr elSu 41444444144''444,444 4r 4^4 ''4 C44r44elsc Centra4'444441444 gram444 o n44 -4s441414144.4:444444,444.44444 4' 4 J 14ar4 4444n 144sBrau Ga44 44-a, 44>44,4r4 4444 44444,444 44 444444ec444,44d4, Flrad 44444 4.444 44 444444444,44 d444,444.44d4414444e 444,141444444444444444,44444 44444n4 4 4 44444.4 4 ,4 44 44 1444.441 444 4444 44 4, 444444, 4. i 4 e4e 444444444, 44 44 4n 44um n a r nd 444 44 reci 44u, 44 444444,444444414,4.444,4 44tro .444 444444444s y44C414444444144 44444.44144444C4m4444444444r4444y4444,41 444 44 4444144,,4a444. 4441444444,44414C14444441 44.4Cr4l44. 144444444444,, 414r44444 Ge4444.444 pr4vn44 44414 414414 4~4444 E4 44444444414 144444r 444444444 44 44,44 4,444444, 144444'. no 44 14144,44 ,4 444444 444 444 44~44144.4.4444 444444 4 4444444 444 t d44414 44nt 41444144 4 > 1* K BE 1 1444444 444444 444, 4414 -44 4ar 44r 4 a4. 411444 44444444 444 4 444 144444 444-4 .44 44 44 4e 444 144444444144444444444144 44 r44 444444.44444444n444 44 44 4. 4r,.an44444 444444~4444 4444 4 4.444 44444 441444444 4.44444 4 1r 4444 44, 444.4,444d 444444.4 n opo 44 444.d 144ed 444 44ro44 da ceee> e le BreptbU 4 4m 44414 4rr 4r 44q444 444 4 4 44 4 4q. 444444 de UNA AGOM R A MAGICA en4144444m 4ne eta "4n44 ra 4 .4444 me si 4 e ctar4) ae 4q414 cota 441,444 4144144 n 444 __ 4444 444444 4144 74144444,44444r 1 4d444T44a 414,441 4 fa.J44r4lrC44l4 4nTrem4d1 j.4rn ___ 4 444 4 ~444 4 4444444,r4444 4414144a44,41, 14 i4 444 tr__rred n ua or eu 44 44, tra144, re 44,4 ar 44444.44 4 e 4ea 444444144 4, Br444 44 .4 4r44 44 444 144444 44,444444 44,r 444 4,1 444ne 414 4ndrr 44 44444444 q44. 14. '4.44444 4reY C44,. el 44144. C we dsoesAQM eneol Pre lensar' ason~-eparaedra a144444444o c de 444 e 444 d4'4 444, 44,444 4444 j4444eg44m44 4n 4o sl 11,pa4,1 4444aa rpd cooeaetecnbt am 4444nt 44444444414444 44444444444, 4 4414 -44 ,t 444444 4441441 1b444 4444444d44444444,444444u 4444 4,es4444ab44444444 44 44441,44d444414 4 444 4144,44 adad 114s4abors de444 44ensae.u.o.o 44 4, .44 44444 444 4 44 444 4 .4444444 444444444,44 414144,, 44144444 d 44444rehsg 44 n 44 44444444 4444i44 4 444144 4444,4 1444. 4,4444 .44, 4 r4 a 444 444444 44 4444 4444 444444444444444444444444444 441 4,4 p 44444 44444 n.444444444444.444444414441r4 44 4 4,444,444~ 44444444444~ 4 44~ 44441444441444444444444444,41444444,4444444,4444 444,4444444 4,4444444. 4 -4 ~~~~4141444444441144R44SE YANUN4E44 E 4N m444444 44444444444444w44444444444444444,4 4. 44 4444444144444444 .,4'4 1444444 44 14ar 44 m444 41444444444444444a 4,Lj~44 ? .4444 .44~~~~L DIR1 DE 4AM, A 44, .444444 '4 .4 44444 4444444444444444 44144444414U, N444A 1444444 Podor del ll< S •,, -122U 11• A.¡s3, 14L ASTA I> F

PAGE 25

GR ptAi RecIa el DIA RIOn L MARINA lo ardwick y ulcar -i mes dil 1~ s

PAGE 26

VENTAS V ________A___A ___ '.AS $5 0.1 ., s ..1 .. _____________Vaco, MARIANAO, S ,51 noo' l),A C VEDADO 44, _________________., .~.-. ----.444~ -4.44 -_ _ __ _ ROBERTO JUNCO O.PARTO AVESTARA .4 44, 1TrJ\OLL 21t SOLAR. PARCELA 1 ) 4 11 1 sm, AVENT0S'ARAN \ 44.'< n able Finca 1 244 r040(,\.m ES, SMAGNECA ENTREGA VACIA Ii 1,O i ( \1 N (\ 444\4TAAR\.Ar on 155,. f Aprenda a Manejar CHALET 040 RU44 $444r4 a q od A 1 Mil N \l 1O RL R N I \ \SOA 51 D0LCMU#Q t ~ VEDDO 44441444''. ~ UIELO UD rat------------------f Obip. .3m t G ., 12V nau, ~~~~ ~ ~ i U. 1a L'ETMONETanaoeo N. i-4.4 FLORENCIO LIZASdAIN lr n OAYEGAS00A10 P A ____ EDIFICIOS RENTA 10. UTA~ A CANTINA.$0 00 de al\near r f1tD ^,5 I1 1 fEliA 4414 < ones para Aulo 4444444. 414044 400 04 CROLL, $ ~''. y Camione- Ta Ape i op ra i 1Tr \ p ai nae11 R 00 L 3 01 10 E p rlo op era ___________ <'"4.' SA FRAN1CISCO 1TR O BAR 000 s~ ------4------,MENDOZA Y CIA. B 000 1 P 4,,,d 4.44,4 414p 4 4!,444 '444 44 444F 4 4 iL r a M .JACK JISTCE4. 4 ~ 4444' '4 44404,,4,, 44. o~ ye Eo -ato Q. B.r -to L.1 Telfo.P00140 4I 444 11444-114NT $300 5,44a4l444 a lr.004 414V-555 4 41 .1 001 CASAS Y RESIDENCIAS: _ _ _ _ [ ~ 4 4.4444 .4.444444 y Bl E L L 0 Y 4 T ~ ~ ~ ~ ~ coe par AA U1L I XosDU .0'444.444.44~~~~~ .]¡l.__ __ 4CM74454 .:0,' 4CI VROL T 4 ~o ~n m o:uen v. 44~~~BUC on1444,, 444.4, TRAN1UILO i IMI' k 1441044 1~~,1EN.44R11 R144.4 .1 con DE~ yIS 4041ho xl o,,e renn 2 4 E l en pgy ctosond5s, mas EN IA Mpu444,4, iplarinex44 yCup Con4, CHEV OLET 40 MENDOZA Y CIA. -" -1 44 4 4. 4 iop 305. T111. M14921. 4 ptai con ,.,o .x!. s 44<444 .44 4444.444 ~ 50 FINCAS RUSTICAS ..1 .4 OLET 1141. p. 9r H rmg na-n, 44d44 ,1 4 DAR BODEGA 5 DE SOTO h1co" hitd Alec i y 1 ~ V 194 d -O ctnbr n i55 cl PRe 40SOLARES m.44 ma-4.'.4444.44.44'44.44 4011,400 .11 44 0 o. e TlnunzI 89; 444544P44 _________________ 4.o 4444.4444 la5 4 .n al, DESDE $1,20.A 4ri0Sa PACI D 411-1 cijo4e.,, R s b r r e. 7 aINQ TA RECREO T 1 12.$61 2 o, ~ ~~ -j o-, 51.10;.-s BUICK up$ r L48 pu 44.4.44<. yn4' n0-4r. U4.' "735"1-20 > PACIA 37 y ta 4 4.4 R mj4.7444 4, t, ," 4. 444 ,, 4 .z. vr.4 .h, ~~ 44r4 44 44 4 4 CHERO eT 44 es 4 SE VENDE 4 04, 44j E DE o.i44.4a4 m z a:044 4444 1. 4 CARRASCO 4404044 H4.44.4441~44. LA. QUINCALLA.DE CO. 4 PLAA IIENIR 1"4 444 ~44.44440 4444 4444 400 RRA1.EIS Y CIENELJECOS 1li.d DENN IS CRAY, 4 CAp Co4 4 ,4 444 L 1 e CH EVR V LET 1549 A O4, ,4' .ATOEN PATS E DE>r PAGO 4444.44444 <.44, 4444,. 4444044.4.441,44.44 44 4 4.444. 44444 4444 .444 4 44'444' F4 4 CA .4'4U44T40CA41 4,4 0 04 4 444.4 4 P4RTIO:I 1d,0 ,b v t" 4, 4.44.444444, ¡ U4.44.4444 E L -IEVROLET 1947 cMr ERCIAL 1; 9t7r ie Hi mholl., r<4 1 4n., 1 MEo.RLF R \ .1 11949 yMVOE (Y 949O R OWIOS AECIBIR Y EPRLI FAILIDADE Irrr e so. P¡ In 1,94. dIf nnP F 0 R D 14 A c K CHEVEOLET CA IONES INFARNTA NO 104 (Entro Sn Y' ncico y 25 a V1 cuedran d9 S. Lar) TRITURADORAS PLVERIZADORAS MolinA do Pier4 de Quijada, Pis y 444r. pr EnCeulne im 40TORS MART CORPS. ,l n y a 'por 04110000. C 1 0 S FAS TI A 1 1

PAGE 27

PACINA VEINTIRETE A N U N C IO S C L A S I F I C A D O S D VEN1TM VETA VENTA1 VE rNtA V lN J Le 54 JAQUNAA t 3i AITOMOVILES Y ACCE&. S MUER1.ES Y PRENDAS MATERIA.ES DE COSI. e2 xoeTos vA1 I (0 APR VcsuE ,ANS. ce'eee"e"aee e, |I eeee s ecce eec a4elee'eeellNee cee eee.Leeeeeeeee 5t EP'ECTOS SANTARI>S e, ,,,., ,,, .,, TrIc nentoa, • aoe w a aelcee eeeeeele.lecleeleeeee.,e. e.CIc* •4 cececel. ee l T 14 de pi rlee, en ler --e e ..e, ee e ,.ee a1e Cias .~, ..-s-, ;(1 vOiT 14 yC pnrts oara a r iA ro PR( 1' peee. Informeiee ele, reCel ee .luee e e, c .e e Cl le e,'ee'' e e, e ilC CCc. e.e. 5 M flI.IeJIA eeel cel eeeeee.lc, ICoroeeecee eceCeeeelcercc c. e eeC eecleO leed ell CccsOA. n M-1454. M146' .MAQUINAR~S T*4" '" Co CRISTINA No. 453 m e avr A. Slelce.eeeeee.,btc ec eeeeeee el eeee,.ReIMS A r7 eel ae ,. Ul8c1-5422. 420 SE VENDE cceeeeeeece 5e -2 Francisco Mr J __ __ _enr ef C le N* e e e, DE Olrce e ued el reete e.e.e e, rdel -or nosMad enge saname ULTIMO AVISO CONSTRUCCU1N PLANCHAS TRACTORES EN ELECTRICAS DE e e GENERAL BUJLLDOZERS AAVAR yeeeeeleaeeaece, de V"i % .% "* AHULMAN No qUEMhtN. VENTA y ALQUILER e. SANITARIOS DEJA LA ROA UA e peccios el coreoencr. C e l C ., PARA Y, da te a a arnez A erW1:1 up Plr ie e ¡a e Exp erenia, erie. Taul y eoi eecc e cecceea lee eeca cA IlabeOF Ca eia le Reeeleeeeeel0 aoet lCeee,"eleleeeeec' e cen c e ndSeaC laR emoau a a c ee en e d er 1,1100 e se e e e ce eret rc ep e e e ,e y r i. ,l ele e .ceeeeceeeee c e cle caue s rh:a n gaed ed esnl t. CPeetaesele eepcle eanio H otecaV (t ce. e eee cecc ec ee e. l ec Le ,eceec T P e 309 le cc. e e a. lec e PALACI AAMA ceca e e. e e ae aC e, 202 Hb0si2mp d leaecee.el. Moelee eee e e. ececenaeceel ele c e r e. cecee.memr Ria nt. e c e e.e .e.e aer cecee UDINee ece. ee lele le-ee cee eeee ____________T____________ Miro ececcreei eer .,. en e e Peeee ee eeele DCccuepceced CC ___.________sai sbr caa.en cecelma eee. c 4e leeuieleecrC .eec.e U AL U c n ~ aeeeece.c :• i leed.Teee .eleC ca Pal m .-eeeee-.e G.enelei e.eeeee -. le ece ceee'cl elcceec ele se DS scCA, O ¡alEE.leleee Clee.l. ae, ~p ec.e e "e. lee lecee le enePARA llen e C, N l P e, y 6ompe acrew de cle.,, w7e. -, Motores esinconariw cecee ece ee eU esUn elcees eleie C eelel ira een:-ee r pr.iEeG.date po e aM rinzy ele .e e llcce Cle -ee ele~ ee cljtel tCe. ecelic i le e r rr lee l e ui rpete. Experl nc2 eieda yt e Ccecel. c a e ae eleRag.m aie e ::,bn co. rp e alele. Cepa e e e-os PINeta~ elelelc ie e. LEAS OPORTUNIDA mCsnspeceelare .McItp .y7P002eltle CC e\ca. PaC Aeled M-c8lePlc 1L031 2t -$ll17251 TO)' to. O IeI 30 A-91,.l -456 ,Cael Repalee 15 RADIOS APAATOS i R D cna e c Ae .ce le ,ee e le lr-e-e. re" l e e e ee nte eele le e ., ce lele e e RLECTRICD5B NRAAi 193 Aroti fi e Cul uq id mo un,. lo -rAea.rrn Pleelc e rI&ccae 1Cllleele. e,,ee .s, ,,eeec elece. eeccemcaees eer r e m L 4 om e lt le! : ele ce e aleece. por dea eaa eea .c e e .e c ecee ,l vlt 00 t e eec ,eCe eee Ce -oaee ce.e en celeelel lleelre.e enere Cel ece Ceecceel ele lcl.itoClee.e, ce.le,.leepC.D"N ee.eeNAe 1 RIA l AasaPeat o cene. reCl'l cecee de .leeee dee ~iC 4le1, D e,, 400 JUEG SEISTIIIROSeRl DEe.eeee.f'eeee, Cmpretares de de 1 -n e~ X -~~~ a7~ r. irIN DORe ce-ecea rea El lece le ame.e. c.ceepcceeaeea ele elec cece. ceCee. -. e Aw ae eeee. -eee ce e sac ________ Aeeele,~~~~~ eeeleee c= ¡Pe. su e, IZOece ee ..ccecee__ __ laa elle eec cecee ceece Ce e c yled tu, m ee c #,e. y MCneeee eeece e lesca g eno .e.e-ie e. aeee-dc ceuacoele clela e ec cee ee cee~o e, leee tuaYU1,SIE Aeerleed ~ pl d ceee bieee .eA gea ,. 8e eCle 5. e. Slaeee celleaec engomeleeC e.sc l.ee,. l-e.$ell.c. del.s n% ee cc ele e e.e", 1N~C ec eeeec e ele .e e ceYw cea ee1AR eleej rom o _______ ______ e IMPORTAOO7 CO d e. P leile .e., e e. e. e, eP eeez. ma leA 9 e le ece. lee.e c ee eie Ve. 'o a, Teeeeecl.c Mlek .,.e.e.eeee Tie eeee ee, e, 1a omA ACe e. eec cea eAnrn .tN eeeeccceePece~ eeM ack ., ..cecee sa ave. aeoe neel e ,sas ecedee crsd, ece ae, 1 E' e e CDeCpparCl e .ce e ., ec b lem e c r .o aurc Ao ce ce. ee -anc, e r, ele ea ea. ya celd eeeeee eCl. 0 lueleI ..e. e eCC,, .eelle. e cee ec ee .le ec .e1 ee'n Ua82 ue d ee ee e e lel 5 E T Aeleece Plpee. Cele, e pre 5t.M .,, e leceem. eee eeeec Ariones Piper eleeele ,ces Yf ¡fC5T)5 SASITAElOS LCedao neC ree ECCe e .A Melece"Ue 1 pe ee, .--'' ce ee le DE. l e epe ile 4l, Depce 400c Moors ains e Nd e cf ceCelel ICCIC a. Pll Tel eecn M9276.e .le ..ce ce e. .cale e. l n .., ...,. Ce. e c e,. .e e ~ e, LAVAMANIO GRA1DE ee, e I e ellelI ECA laee l ..ceeee C lP _______________ 8105? gde eecc ele e esencueAn e. Pfier e.c L cc eece.Pc leerecr.a tain y cosrc n Pelee, CCee ee~CC00e.uge1 eeeeeele leeee lre Ce Ce cel CeInen, le cerec en e rence le sWW IW OIIlIWI1 $.Cleee8 eee lneeC e sad.Te >l el ¡ DlI rIeslIce peee n Cebe eeeees.i eeee e a, ee e. ce. A-esEdle .C lleClceceea e Iece Ceceecnee "Mallc" *" cee c we,ece ea leecelee e rae I nformeee eee ecTele le 33 SEs aa ,l L di a y lceurnal. MENDOZA Y COMPAIA Obispo 30. M921. Peo UH C43-7 V .1 -11 42U NER0a ENERAL MAD26, entro Ira. y Sra. eecag aae.eee e. 2ireealellelenYec. e o e L¡.n .lee, e ceem1 elew siaea.cae, ecC ee e cclee d-cceleee lea eceee Cee bce -elee ALQUI1L ER ES ple.e.ee.-e cCeeaec II CASAS DE R UESPEDES ee AMUEBLADO Inelreee Fe350 r e e eee.taneele %) lle lee e, nee ecleecc ce. ecua.ed ceeaa d e ,. ee. recrea dor.eradi SI HA lE C NE m c lee. c le e e e~ eCe, cmpeeC, ce es le ee ".2 lecece ecel ce cc a ececele eceacrecr,, eec H A ll.3noitraao ce .iCat Cel ece ,cC.eee cAeA aee e r4e.e BA loe ALTos Vde, e C .e en leele-0 ele, c c eec eceeee Cl W ~ 1kha M ~ -01aioes m. o m~ "11 111.11~e , .1 ~nr t a g cecee,, ee e e le le P. c,. bJ. ,e,. lee, naec l ee. ~e Ie PS. cecel eCCeae.eeecd ec lel,. ce .n e--s B0NITO APARTAME'TO A ceee ceeeel.le 17 N9 5e ESQ. C. VEDADO ~1e,.eCe. le cee., eec cece, l cei e e.een eec Ceeie.cie lace nerelele. ee"ce P. ed.e lee elie lee -ace e e ~aC,. Peclec e .cecel ~ Urle WCe Acec.A eeAC". 1e eccee. d-ecl le, Psieeee l, lelllele. _4 ~ lee ceeeeel~ e_______________________a -ecee Ce,leeec e .i leleele eee ce.d le e.ee,. eaaeme eee encele e e Ce Mi .nt leyG ed e prble, ena Ge.e cecee. NO 157. tei -A U.-sr#za pa0 zsnso eALT.r:n 2-7,4solo. oversnareavre.se aermn ab_ Atutt" Ab". AIMssLAIA. VAICele.,e 'eee ccce, u er; eaelle,> elecUee @0 l. -e.e e .ellebn cec ee,. A erLeee cAe.; el" '"'Cl. ei" eee a c'.tlerace e ele, cece e .e, eo tncasns ~a.en. Reeele Aedae. i "e le T 5. to eneree Paneeeele.eneel eele Ccale e eceeeU. ce6 D, aS, Eequina 11 g., 2 heoae. e-eieeZe.eec eALc ce$s, aeecee e e eeeec, eceieeAle ~AbA l Ale Ale e eleo e,.aio eae m e ce . teer acC Illl, Infrmn n ,,na. qi e ceecece cn cme i4 cele e, 0 le l Ce """ 'a .as relale e. ca e. ee, e, elece lel cec. .LASCOeeN iee ,cae e .es A.,l Galieno 414 altos CAfl La lae AD A U, e, a 1 elaeec Alele acEec .e ececeee,.ALQUIlO .lMA c Ca ., e, memeee cee eeee cede meeeee ^Ceeleelec moeree e ce. elee. .ee .ecmee, lel-,ee. 1 e. eCee cele, eclecemile e e aecle p ran e ee. r eceel ceeeeeemee lelee eeeeeeleeecce. e.ee.e elloe, cceieeecee. ec, -e.emeeecetelereec eheece,. **Ao t ** 80''AA o*A rn eervee eeee erlaceeleeledernl .ecelil leen s cl, .Mle eae 4Je.e **Ce,, e"ee elc Ce eplele l"',c,celei e.e.csa .i le.eee, eeece-ceeseecec leceee pi.a rne ccee,. aceiene C cee rrne ecel e lcrao(Id ePecce CC AeclULe ceAeeTAeeee,eeeTO.eCe e •;g o '" "" saicb.W, 1. -11. .o r. ls eele.leeeee-e,.e ecec. e., SI CASAS DE COMIDAS SE ALCQUJILA .C". we l eel~ee03 reeeAe a ee eleere Mee e,, u ce .reie Ceera celA ce, .,CAle ceroa e o rcazde e.ce elepar ., ,eceeaaeeel.e.eeece ,eel e ste mooAondsaie, c eeeaeteaeaeAeut ee .ee c v, ecc e. ee cae ,Cede, MoA c eer. elle eacceeIIn ela-s el eeCr e e re,9 lele eceeeee, acn eeeleeeeeeeb, eele.ele, 4. APARTAMENTOS inra ec A.ee lelce cne ce lee Net e de e leccee, eanrea e, teeec ee e. cCCe.eee-le-elee alae, ce l,,l ee ae C eece. aeeeleececl Lee.aeeeieeiec .1d b e, e,es ,,.e e, cee,, ,eae., ALTURAS DF RELEN eClele ea Ile,. .ele,, eeeeaceee, e cece e Cle A N"!. 8acee A-AE e lteele e leen N* En-, ~ e.VIO aece L OIcc loeee, ecla Ceeiccee M.2 eL EXIMAZ M eceS, N= 2fetCeaeaeecee ee, eee een 3 acnscords a ejens Ape bste e. n ce da es A .eeece APaAe NT E$' hi Om 0eu,2gada aitnscU tececee C Ia eae ele, eee,,rdo naiCie-le ea eccc eeelle.baeeeereeeeeaio e, ele. c cee .a A ifi A.e oe. e. Ae rpae e cee ca.d aerdd e ea ce e, e Aeceeeaee ]fra en r be ele mceeceblae el.hn La ,d ALQUILAA UNA AleAeee cce, cc llene 3 entre iramar yLa¡u eeAemlneeielece-C7elele. ce ctape., c" -^ e N e, .eleenme APATlE NTce DUe LX __,"___',, _",__a l* oe.o leeceal'a' ecem"e". eC ce .,e c .ee ee ec ee ese'ede sae .coe e re,eccy ce hbtepoe e -, cele e e ccc.mebla .,na y ¡aiR t"lo d all vI1$ RS. 1mt' suv dll itstnielo M W M A eM D lEe. ece 1 e, 13", "e ~ae ,ce e eeen eJe.Ce, Lcc~ c :.A eCCecde ee. lInorm e neplcneIl+ -c enta ine ete, eena arbeA-sto sAA.Li .c lec. eeeceee rp y ,cs .un coac e,aeceeec Teee aee ca.0440,93 0 r.eee ,, e e pIne yntee.c.ellalee lece.eea. ee eeec enee. Alel neee, P.ee, teeeece. ce. .n le A ee eAl leeM.P eACY cI ceros e, -~ os. e .cd e A M e e ee ee.e4lere a S. pe,.ll eecccrc yn e ncce eeeeecceee ---elle eeeeeeeeeycc ,. Cea ec wee e ua ATN .%TM~ zNN zMann. APATMNOSDPE d ,116 P Ter a e eee6,ba c ecead, S eOe .ee cl, e l As telaelcc elec e e.leel. cmee.r. ec C3 Cell, l A muebladC oAIeL Er Amu e u. ceo ed" C, l.o Clp clep.< le. elAe.leeee ed.l I AULA. VIL A63 -¡t NS 1QUL AIA10 O A.O .eml-cMed pt.) ~ er C t .a 9nd y 1. r9m btelng hnd.poo aacr si $3 lee, ,. .%~ce .________ ,__ ySeE ALQaUI ce.e A e e. nne-e.ee-e e M. ~ .a ¡ee M ..ece JIM B -Ii 1A L 71"1 53 i a1,1r dya l, ,.4r osm luj hal clor.1-sattsanM 11 A k X i AV ., 52 APARTAMENTOS mpeeneeto Nueeva 93 pepceAMeee ea el 1Cece, d. ~ -, ~ee, eccc d,. -P-c lltee de .Z .1 l e uie a e l ecC elele Cllee ee 1*e.ee II elC e C era 1 eeeeeeCecceCCl CeeCeeCleecC.Cdelc ecl.r leecl,,ele lcleCeelee ee.CcC e eC rCele el A A ccecceceeeeel.C Cecleeele e ljCCe.c eeCee.le CCCC T ecee l ae elCe eeee C, N V D I D LA MARINA M 9

PAGE 28

PAGINA\ k0FIoc-O DIARIO [)F U MARINA~-MARTES, 20 DE PT. [) 1949 r XI AN i CI---IIC DO D-~ ---ITI ,MA-,,-ORA2 Q~~~---N-A8N4 HIAIN C 7 1 AAN 09 S .C L S 1 11C ANE 1)N 0 1 S IAA RW) O 111 lj u BA.CCH m 15 01 (P T11 ,l flo FSO A, AAAAAAAA AAAAAAAA AA A A A AAAAAAAAAA AAAAAAAAAAAAA AAAAAA~AA A'.1I~o. IvEO PlIT ____ N A AA1 ALQUILERES___ 19LU LL LS 1 PERDIDA l.A'A'AAAA ": AA A OFfF:E, ,r'~ sfAAAA'Ml _~ l - -1 ~ ~ 1,7_~ --__-_,________ Ai____1. ___ ~____________8_______9AOLCIUDD AAQ(tLR,14 GET -VN bESA' n 'A ff AD CAAAADO _1 AAAA(> AAAA'A MErt) Z OIEEESTl A,', 'AA~AA ,,,, AA-------A~A A AAA --A-,"A,,-,A, ,AA, A W -A '1 1 A.,1, AAA""" r wAAA ~lAAAA'AAAAAAAAAA ','l~ 'l" ," "l,,11 ~ ,1 1,~- ~ ~~ ~ ~ ~AAAAAAA AA -A 1~~ ~D 31 ~~ ~~ti.A; -I 5AAA lo AONCA COLOCAc-~ ~EA~ AAA'AAAAAAiiAAAAAAiAAUi"A ,,n AAA' AAAA AAA, A'.AA l J,¡'A,,',AAA,'-1 AAAAAAAAA AA',A :. -, 1 1 ,., -,,~ ,,1 ~ 1,, ,, ; 1 ~ ~ ~~ ,A~ 1 i Jnt 11 rtv Af so,1 VE AD 10 CRI-A .RA O 1.AAAAAAA', 1,1J1l 'ADA:, ,' ~,111 .l 1~t1 11 T> A ~ A: A" A i A A IIIAi AIABAA A AA_____iA AAAAA A AAAAAAAAAA A*AAA AAAAA A A~AD AAAAAA, ,AAAAADAAAAA 1,1 ~ --------~~ ~ ~ ~ ~ ~ ~ AA ,A A 'A A A -A AA AA AA AAAAAA ,AAAAA iA A AA A AA ,,' ,, -11 -1,11.11 '',",, AA.A~AAA ",, ,, 1,,, ,, ,1 tZi_ -l_ ,____l ,,, ~ , ,' " ~1 1 AA ~AAAA AAAAAAAAAAAA-" ,AAA ~~AAAAANr, A 1 AAAAAAA " i AAAA1AAA -AA AA AA A AAAAAAAAAA AAA.AAAAAAA ___-_ -AA Ui ~ AAA ,AAAAAAA AAAAAAAAArA-A.A'A,.AAAAAA-A ,A-A~~ 11,~__i________ I -~~ ~ A , AAA7lcA AA1 A AA .AA AAA1AA;AA :1 AA ~~A, -,A~ AAAAArAAADAAAA~AAA1~AA, AAA A,AA. ,A~ AAA-','A,1 1EDUARDO1 BRUNET ,, A AAA A lA A0 AAAW A AA ~~ A A" AAAAAA A, A A AA AA-, AA AA AAAAA: t AA A, AA -,, '89III 3 AAA1ADAA ~AAAA>AAAA.AAAAp1 -~ -¡-, ,Ti ];i;i,, l ~ 1 -111l, ,,-.AA ;,AA ,1AAA, iA AA AAA AAAAAA AAAA AAAiAAAAAAAAAAAAAAAAAAAAAAAAAAAA ___~~~~~~~~~ ~~~ ____ ___ A AADAAAAAAAAA.AAAA 3 AAAA.AA __ _ __ _ __ lA AA AA ___ A, AArAA AA AAAAA AAA AAAAA AAAiAAAAAy' A,, 1. ~iRIJ7O 111 ET4TOTA1 1.l A1 _ _ _ A A AAArAA AA ~AAAAAAAA -1A-AA AAA-AA>AAA-_-------_~_,_~_ _ 1~_-____ ~. ~ ~ ~ AA ~ADAAA 11 SOAIIT7DS AAAAAAAAA AAA AAA AAAAAAAA i~AAAAA A.AA.AAA, AA 1 : 'AA A ,D _________ ____1 ,11 .1 -,, -~ ,-, !",", -., AAAAAAAAAAAAAA AAAA, "" ii: AAAAA,. 'P AAAAAAA AAA AAA~ ~~ t7 AAAA,~l A'A AAAA AA~AAA A~ A ,lA AAAAAA ~ ,AA>A.A AAAAAAAAAAA,1AAAA :A-AAAA -AA.A ~AAA --~~~~~~ -AAk-'AAAA.AAA.AA, p, , 1 --, l ,, 1 1, -, , i -' ~ ~AA -A A AA A AAA AA AAA AAAA A1 AAA'-T .A, 1 1, 1 1 .1 1 11. ; ] 1 ,A _ _ -, AAAA1 - ~ ,~ .1A1AAAA.AAAAAAAAAAA ,AAAA A 1 uit :ALUANIJKU, 1 .1 -A AAAAAAAA',AA.AAAAA'-A'AAAAAAA'A A',AAAA AAAA A~ ~ DAA AA _ _ _ _ _,, AA A, M , ~ l ~ ~' 1, ________________ -___ ,__ A''AA -VIA 10 ,GECARLCNARIA~ S ,, 1 1 ,111,, ~11 11 1 1 --1 -~A, A.AAAA 1A. .:'AA,, rAA 'A ~AA .A A A 'A A A DA A D 18 CE R PA AT: .A A A A A A A AAAA'ADAAAA , ,1 , , 1 ,111 11 1 .-i 11W 1 ) 1, > l, ) .N AA A'A A A1__ _ _ _~~__ _ _ _ _~ ~ A,,,,, -1 -1' -1' A 1 A A -AAA AAA ~~AAAA AAA ~ ~AAAA~A 1 1 1 ., 1 , AA -A -AAA ---AA A AA A A _ _ LA AALI ~ AAAAA _ _ A,~ 1 1,1 il, ,I",1,lk, l)i, E V AAA'AAA A, -11 -, ---A AA,,' ,. 'AA-si,--,f&1 ~~ ~ ~111-~~ ~, : ,A AAAAAA AAA 1,A'AAAAAA 977 IN7TIT9ITRICE DAAAA AAA A AA ,A) AAA TRA T R O NEX AIF AAAAAAAAADAAAAAA 1 A'A AAAA~n AAAAA-AAAAAAAAAAAAAAAAAAAA-, AAAAAAAAAAAAAAAAAAAAA'AAA'A, 1 -AAAAAAA~u,', --AAA'A AA ,, -AAAA 5AAAAAAAAAAA AAAAAAAA AA AA 1AAAA AAAAAAAAAAAAAAAAA -AAAAAAA AAA',11 -r : 10 1,,F A O ,,, ,,,,.-,, ,, 1, ~AA~A.AA. .A IAAA A 'AA, ,AAAAA D AD AA-AAAA A1A A A AAAA~A~AA~ AAAAAA A-~AA A -A AA~AAAAAAAAAAAA AAAA.AAAAAAA A A A A A A A A A A A A A A A A A A _ _ _ _ _ A A~ A A A A A A A A A A A A A A A A A A A A A A A A D A A A .D A A A A A A AAA AA1 11 1 l) % >, 1 1' l ll AAAAAA AA AAAAA' <, 11~~A ______, ____PE ____________ A AAAA-,11 -1,1AA1 A1A'AA1,1 ~A, A A: AAAAAtAAA AA AAAA < AAAAAAAA 1 1 AA AAAAA A,, AAA A : n,; '!, 1,,7l A A' AA AAAAA AAA AD AA ,-17,AAA:zAAA , AAADAADAA AAAAAAAAAAAADAAAAAAAAAAAAAAA.AAAAAAAA.AAAAAAAAAAAAAAAAAAAAA A~--AAAAAAAAAAAA8 5A .>A -5AR O AAAA , 11 ~ ~ ~ ~ ~ ,, ,, ~ l ,, ~ .;.AA AA ~ AA ,AAAA -:,; A AA A 'AA____________;_, ____ AAAA AA ,AAA A 1 A A 'A'AAAAAADOAA ,-AA, -A A1-1E ,I ,,ECE 111 11,A 1A,1 1, ,AA~ ,> AAA C"IA,1 IDT A A AAA AAAA AA AAAAA -AA , A AA1. DA AA-AA --A ------AAAA -AAA AAAAA AA, 7AAAA AADA9AA AAAAAAAAAAi '97 iAAA AAAA zAAAAVE A O --A1 .1 A~-AAAA-~ ~ ~AZfoA A11 . ,-," ~ i, ,~ ~ 1,11 1 , I; '")J AAAA AA.AA. AA1AAAD l~. A'AAA A1 A, AAAAA AA AA~A AA AAAAAAAAAA AAAAAAA AAAAA ~AAAAA AAAAA AAA," 111 ~ ~ ~ 111111 --:,i, A~~~~~ AA, -ADA1AAA AAA. AAAAAA A A A' "A ~A AAA t-A AA ¡AA'AA'l ~CC~EA COIEO A ~ AAAAAA A, AAAAA DAFDAIAA ,'AAAA AAA AA -~AA v-,-,, ',~~~~~~ ~ ~ ~ ~ ~ ~ ~ AAAA'AAASAAAA A AAAA AA-A~ v~~AAA AAAAAAA A,, AA _ __~_ __~1_1, ll," :1"-"" 11, 1,-l-^?'11, ,M---AA~ A A A A A A A A A A1 AA A AAA AA A1__ _ _ _ R EA R M _ _ _ A ~A AAAAAAAAAAAAAAAA AA'.A A, A----AA --A A,," ,Ik>tl AAAAAAAAADAA AAAAAAAAAAAAAAAADADAA AAAAA.AA AA AA AAA^ A A A A A A A A ~ A A, AA A A A .AA .A1 AAAAAD A A A1 A -zA AAAAAA A A, A A. AAA A A A A A A A AAAA A'AAAAAAAAAA AAA -AAAAA DAAAAAA; ,AAAAAAAAAAAA11 -v 1 ~ -AAAAAAAAAAAAA.i1 ~A .AAA AA AA1 AA CA1 D 1 L O EAAI ------~ ~~ ~__ _ __ _ _ IN1E NA IN -A ~A -A-,,-i AAAAAA A A A< AAD AAAAD AAA A 1 ~AAAAAAAAAA A AD A (> A ,____________________ AA A 1V DR S A'' 1 AAAAAAAAAAAAA,11 1i -,~- '~ 11 ,,PP,,,, 1 ___ __ __ __ ~~ AA AA A AAAA A A A A A AAAAA1AAA A A A. A -A. AAAAA ~ ~, ,,-,, -~,( HV ,,l i A~~~ -AA ----A-AAA AAAAAAAAAAA,--A AA A A AAAAA :AAA 11~AAAAAADAA,A,_2iAAAAAA, AAAA AA AAAA AAAA A AAAA AAAAAA A.A~'AAADA ~ AA~ ~ AAAAAAA A.A AAA AAAAAA~DADAAA AAAA AA~AA AAAAAA AA.AAAAA AAA.A.AA~ ~AAAA. AA-AA A A AAA,'AAAA -i1 A1 AAA ADAD AA' A~ AAAAA A",' ; AAAA AA ~AA AAAA i AAAAA AAAAA AAAAAAAAAAAAAA, , AADA A'T 55 AAAAA, AA A A AD A A A AAA A AAA D.A A A"' A_AA'1,AAA1 A 1 ',AA' .1AAAAA11A~A1 AAAA1 11AA-,'AA ,AAi A!AA, AA>4,\A AAA.AAA1AAAAAAAAAAAAA111-DR. CA-BRERAi AAAAAA ~AAA AAAA AAA __ __ _ __ _ ^__________ ~__ii__,-______ __ _ __ _ __ _ ~A AAA A AA~ AA.AAA AA 1" A AAAAA 1,AAAAA ADADA1 A CADAAA i~A MiAD .2N 1.1M : -,,l ,':,,,. N9 ,, ,l, ~_ __ __ A AAAA AAAA AA AD ADA, DAS VA 8, AAAAAAAAA AAAA AADAAAAA, ~ ~ 11,"1111 ,, ,1 ,,,,' l¡ M n, 111 1~ 1 11, ,,, , : -, 1 11 ~ ~~~~~~~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ AA AA AA AAAAAAA~A AAAA A ,,,i , 1 ,-,1, AA 131 OFElAAAAA ,,, A1 AA~ ~ AA AA AAAAA A A A A A A, A, A1 A A, A -,AA A .AAAA AAAA AA 11CADA -- ~AAAA AA DAAAA -', ___i~_,__,_,_________?______ A A AAAADA A AA DA ti' A, A, A. bA--, -,AAAA1---1 ~ ~ ,,11-1:-- A\ A, A1 A4 A, AAAA \ D DA ADA. AA A A1 1,AAA A1 A AA AA AAAAAA ,AA''A A'A. AA A ,_ _ _ _ _ _ -DAAAAAAAAI ,OS c ~Dl DA.A ,AD ,A --AAAA AAAAA A, AAA AA, AA AA AI Y A AA AAAAAA AAAA AAAAAAA AA" AA 'AAAA A AA 1, ~AD 'AAAA'A A',ii, ____ ___ ___ ___ 1-7 C7IOPERE AAAA.AAAAAAAA.-1 1 ~ ., ,i 1 1 A~AA AAAAA AA, ADA AAAA AAA DA DAAAA"AD ____________ AA AA'AAAA AAA 'A .ri AA A'.r"ir AAAAAA ~7 CRIDA CRAO AAAA AA AA ,AAA AAAA AAAAAA A ADQAA DAADAAD DA lA .AA A' AA' AA .AA111 1 .-, ~ ,,~ 11 1 1 ~ 1 A ~ ~ ~ ~ ~ ~ ~ ~ -AA ,A ,AA A A A ,AAA A1 Al A, A, A 1~~ A, A A, A, ~AA ~~~ AAAAAADA AAAAAAAAAAAAA AAAA AA DAAD 'AAAAA A. ~AAD AAAA AA~A~ AD A. .AA D A A, A A1 A A DA A AAAAA AS AlAUItAa AAA ~A:AADAADAA11A~A1A1A1-AA1AAAAAAA'1A-AS -A A ~A 1AAAAAA ,,:,A A-AA A A A, A A A A A~AAA ~A~AA : AAAAAA AAA AAAAA~A',1A ,-A A A ___________________________________________________________ ___________ D. LIS ERMJDE A A A A A .AA AA .A1 AA AA A AA1,, , l,, i. S AI IJD ,5 V R I S1A1 A 1 1 A lA 1 ,<;1AA A A " 7 A11 ", -~ AA AA AAA AAAAAA ,,i ¡ ,, i:,,,~ ~ , 11 1~ ,, A AA ~AA AD AA~~ i~ AD A AAAD ~~A ----D AA:, DA' ,AA "" ,AA -AAAAAA ,D ADA AA C~ ~IC --I.O O A 1 10 COI8RS'OIEO DAAA AA AA AAA .AAA A AA'A AA-1-AAAA AA.A, AAAAAA AAAAAAA1 AAil AAAA AAAAAAA A AA AAAAA AAAA ,AA1,11-, ,-~~ -A~ A A A, 1 A1 A A A A A A A A A A A A A 11 AA. 1 i --DA A1 A A1 yA .A ,_ _ _ 1 1 1 ,AAAAAAAAAAA11. 1 AAAAAAAA 11 i-1AAAA~ 1,1AA ,A, AAA. AA~~~AA.A. ~AAAAAAAAA 1 -1 ,LINDIS8MA , EIBTCDd ALL A DE 8,1 EN ,AAAAAA l AAAAAA D AA AAAA ~AD ADAA! ADA'A;

A AAAAAA A A-'AAA-' AAAAA ~ AD A A AA A A A A" A Ai, AA, A A ~A A11,1 -AAAA A ~A A AA AD ~~-~1-, -A,,, l leAA )Is10 111: -, -,,,,.-.,"l AiI-<--A P -,yl A -l AADAA A A, A A" AA A A A. ~A A A:1 A1 A,, A ~ (A A A A A''Y, A --rn111 --" ', A A A A A" A -A~111--A A A," xl, Uf ,wt' A AAA A, A AAA DAD A A ,, AAA A AA AA Al AAAA A AA-AA ,,A ADAAAAAAAA,-,7,z DAD AAA.A AAA AAAA, ,>CAA AAAAA ADAAAAA"i" AA AAAAAAAA AA ~~AAAAAADAAAAAAAAAA'AA 'A ¡ AAAAAADAADD ._ _ __ _ _ ~AAA AAA ,AAAAA A1 AAAAA AAAAAAAA A AAA .AAAAAAAAA',,n A40 A A A A A~ l n AA.ADAA. A'A1AAA.AA~ ~117:, ~ ~ ~, ~AA ~A -AA ', -,AA'AAA.DAAAAD'AAAAAID, AD AAA ADA ~AAD ADAAAADAAAAA.AA A, AAA !,AAAAAA AA l1~,,t$ AA'AAAAAAAAAAAA. --11 AA~AAA AAAAAAAAAAAAAA.LAAA DDADAD ,IAA D R, AEANDAAAAAAAADA DA A~ AAAA AAAA AAA AAAA ~A' AA AA A '" 'A A'AAAAA -'A AA,AA ~A~A A ~ AAD A.AA A~' ,AA AAAAAAA AA AAAAAAAA __ _ __ AAAA ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ADAAAA AAAA AAAA DAA AA iAAA AAA ,AD AA A AAA ,DA -DAAD AAADAA A~ ADSD iA A9 C, AAAAA. lAA AA A l'A AAA A AA. AD ~~ AA, AA DMAA -A AAAAAA A AA A A: ~. A1 A A A ADAA A DENT A i IDAMASA MADA -D AA &9DAAAAAA AAAAA AAAAAA AAErDAAAAD1 1 w ~11, ~',:, ', AAADAAAA,, ~ ~~ ~~~ ------------A---AAA----'A1 'AA3 ..ME-, _ -. 1 AAA AA AAAD AAAA~AA AA AA AA 1,AAAA A'.DD1, ~ l D A A A,, DADA. , ~ ~ ,,, ",., ,vx __ __ __ _ ~ AA~,'-1 A'A A-A AAA AAAAA ~1ADA AAA ,A 1AA A l,-AA' AA6 T AAA A.AA AA, A, A A A A AAAA 114. W T 1 B A A!A< AA ~ Pi AAAl Ai I, AA AA* A A A11 AAAAAI AA AA A .A A, AA AA A A A, .AAAA A A A A A AA A-A, -AAA ,TAAAA ,C A A A A A DA'. A DAAA AD. A A -~ A' AA AA ~~ A AA A A1 A A A A A A A 1 A A A tAAA A A AA ArdA I ~MAAAAA -, A DA AAA ,______ __________________ A~AA AA AADAAAAAA AAAA'A'AAA AA' AAAAo AE,1-1 ,~1,11 ,~ -i -_ ~ ~ '",,'"" , 11 AAAAAAAA ADAA A A AAAAAAAAAA A .AA,A1 AAA~A AA-AA AA A'AA -l A'AAA '-'A'. __~____,__________~_____,__,_,_,A A a A clDA AAA ,AA A A A A AA' A'AA'AA AA 1 A AA AAA~ AAA A'AA'D ID --AD yO S ,LSA ADA 11,111,1,ilL^.i11",," s~_____________,_____~-_, ___J,___,_-_____l_ ______,1______________,-__,.________________ VETSRINA 1 -,OS AI AAIAADAA ~AIAA A AAAAAA. ~AAA AADAAAAA~AAAAAA ,, 1 ,,,,' l,1 , ,,,l.AAAAA .AAA A AAAAAAAAA 141_________________________ AAA~ A A. A A -'A 1 : * --1 1 ,~ A1 A 7~l A1 ADIAIAt A A AAAR A5 AA'~AADA ---7n, AA DAAADAA-AAA IA AA A AAAA-, A A 'AD ,AA ,AA 1AA AAAA ________________z________ c______ AA1 A2 A A .~ A A AAA A AA. A AAA A A A A 1AA1 AA A A1 A~ AAAD AA A A D AnAAD AA :1 A DAA AADI¡'1''7AAA AAAAADDAA-DAAAA AAAAAA-AAAIDAAAAADAIDD AAlI AA ~AAA AA A A AAAA AAD AAAAAAAAA AAAA DD 1 A A A' A A A A A_~~ A A1 A A A A A A At A A A1-^tf" A ~ ~~AAA A -.AA. .AAA A U ~AAA AAAADAAAAAAAAAAAAAA'A-AlADAAAA.AAAAAAA.D 1.A AA AAAA A ,;: ~1A DISPENSARIO ,-_ 1 LABOR TORI ~~ AA',AA A A~AAAAAA __ A AA A A AA AAI'AADAADA AAAAA .ADDAAAA~~A~i P.f -, .,!"",,,-i,",,: A2 A AAAAA AAALA AA 1~ 1 AA A DA A ~D AAA AAAA AA AA ADAA A. A1-1 A1 A, A A1 A ,, AA Ai AIAAA AAAAA, AA A --ILM A, AA DAAAAAA~AAAAD' DA AAADA AAAAA A-DAA AAAA AA COMETFNTEMt CHOFERl, CA dA dA -AAAAAd pAA1AA LNIOVTEIAI .8D'A~ DA1~ c~~ADA DA~AA.'.A.A.A _AA__AAAA AD DAAA AAAAAADAr ADAAAA4A4 bAAA'A-DA A TADA AANDAIDDA AAlAAAAAAA --AA5fl OE CUZA AAAAAA.DAAAAA AADAAD DAAAAA 'AAAAAAADDAAAD A. AD AD DAAAD AA A-DA AA ;SA AA AAAA , AAAA ~AA iAA AAA ADADAAA AAAAAAAAA ,AAA A, A"~AAAAD"1 DA~DA DAAAAADAAAAAAAAADAAAAAAAAAA AAA-A AAAAAA AA ADAA A DA 74 DADA ,AADAAA AI'AA AAAAAAAA, AAAA -AAA AAAA AA'1 -~ AAAAA A1--AAA AAAAA AA "A A 'AAA AAA DAD ,7 5 -AAA AA A'AAAAA DAD.,. A1,7At~. i4''7-2.2 1,dA, ,AAAA AA dD D D 1A'A A DAADAAAyAAAAAAA 7AAAA. -AAA ~~AA AD ADA DAlAI ADA -D ASD dAi NADApSADS ,iD deI O DAA AAAA AAS A AA ~ A~AA A ,z, "7 'AA ~AAA -A' A ,A 'AADAADD AAAAAD AAALAADDAA D ALDDAAADAAA~AAAAA DDDAA AADD,-D ADJDDAAAA Tl' ~ _______________________________ AA.ADAAA -M >AAA A AD A AA t, ,D AA, ir A ,D'A' 1A 7778.:nmt A' 'Al'NRI AA 1 DE AO 9 T AAAA A AAAAA DA tAA :A AA AA DAA ~AA MA ABGAO ~ NOTRIO A1 A-D AAAAAAA A D aAD ~~AD ~ -AA ID D D .!ADAD ~DIAA ,AA AAAAAAAIAAAAAr - 1i",7, 1,-1, 11 1~~ -, , -DD A A A ID DAID AA AA t Al AA AA. AAAA .t AAAS l AA zA __ __ __ __ __ __ A.ld,l1-I,1 -_ -~ --AA AA AA AA AAAA' Al DAAA,A A'AA'A' BU ET REEIO FRAN,C C DURANI m,_ _ __ _ DA AA~AAAAAAA AADAAAAD OPTOMETI~I'IMTA11 1k A U. AA.AA ,AA ,AAA AA. AAA B iS T SAR EDZ AADA'A 'A D YAA AA AD'A AAAA Ci AA A D AAADD DIA-AYAAAA -OIINSA AA.,DAAA AAAA.~A.A, ADAAA AD.AAAA AAA.4 .An~ A AuAD. AA, ADDA IAAADAAA DADA, ADIDD DAIDD AA DAD DAD DAADA AAAAAA ~A ,,AA AA AAAAD ADAAA DAAA DAD ~AAAAALOFRTS ___-_ __~ ~__ __ __ __~~__ A AAADAA AAA, AA ~AD ~D A A AAAAAM.AAD-:,* ~~ 1 -i ag zw .~ ~D AA' AA1,1 -DA1 1AA>A AAAA AA AADAA'Al-4z7 A ~ ~AtA Dl ASM DAAA DDAAA A DA ~~~D A A A A A 'A Al A A A A" A A17 1 e D A M A AA S A All l l .A1 A A t t i ~ D A A~ ~ :AA.: 1 ~ ~~~~~~~~~ ___AAA-A ',AA A D.AAAAAAD ~fiinr 1,FIe ________DA Azmrl AA'A ~ __ ___ _~in~._ AAA!,-" 1 AAA ADA'"" .AAA A, A1 Al A ADDAA B.ET A.DA-.~ I3~ 1, ~ ~ D DAi ADA. AAj, 1AAAAAAAAAAAAAA 'AAW ~ M D N AAAAAA.AA A.AADA. AAADDA AAA lADAV --AAAA A ~AAAA ADDAA ADDI AAADA C OM~P R A 1AI En 'I PAlADIO A~AI~A'. RAi-MANE1DORAS1 ADOID ADADAADADAiMA.A ~ A ~~~ t-,,A. AAAA gD. AAAA, A' AAA A DADDADA~~ PA1,11~ A ~ i lA ~ l, ,L -5,,,' , ~ -~ :' i~ 'A --p-AAAAAADI.AAD ~~MD',AD~DDi, G ,. 1 ~~ADAIDI DA 1~ ADA ___-!'-__~ ~________________~_~ ~ DA~A.AADAAADD~§1DID -A-IvDDDAAMAS RA B U Y Z DI D D A A -AAA -A--A~AAA ., 'AA -~~ -,, ~ 25AAi A' Il. ~ AAA AA-. ~pAIAA I' -DD ,DA1 DAM AD ~ A1 A, A,1, A A A A,111ll-.,11, DAAA A AAADADAAAIA A ADA'A .-.A, A iliAAAAAAAx, REINA A4A 1' 1'' A AAAA AD' ~ADDDD' _ ~~I ~~ ~ ~ ,A AD ADA -AD AAAD A'SAA.A Al A n~ ~nA. ADA A,AAD DAAD ~AIA DDAA AA DAA A AAA ,A A '-. .A ~ 1 AA~~~ AAA ~AA ~AADAA AlAD AA ADA DAADDA 7ID A O A ,ADADADDM l'DAA 30~ APA' 47' Al'.1 AA. DA AMI AAAAD A DA'A DAAAA.DID D'DAADAA DlAADADD AU' A.DAAADA A A.A .ADD AAAI AAAAA D AAAA DMA AA, AlDA Al, AMA.D A. .AAD AD AA ,ADAAAAAAAADAAAA. AADADAD. I' ADA A ADDADA-A DAAA~tA AA lADA. AA. 'MA. AAIDAA. DAADA DA~AAAAA AAADAA. At AD DA ME ALQUILA AD do L, 'TIAS'', DID DADA ADAA ASI A.A ~,AAAA AAAAAAAA .AAAA ~AD7~ ~ ~ E A S -A rAD A UADA AMYA' AID'. ADAAAA4A~AA A A. v .A DA- A,~A AMI DA AA AD .D .E IC O C.I T .74 2 COSAIPRAM OS, 1 ~ e <, , ,~ 1 11 n , 1 -1 1 5, ,,1 .' 5 u 1 ,_~~~D' -NOI PIT _______________DRLisERM BE ~A ,A A ~ -AS -l.A¡A AD AA AAAD~ ,,A ,,AA ~, A A~,AD D AA A AAA 'A' DA DAD AA SAAAD AA nAAA D '_ _ _ _ _ _ ,a~ ~ ~ ~ ~ ~ ~ A AAAMAAA A.AA A,AA,7 1, DAD~ AA1AAAA,,l."T. DI: lA AAeA AlD --AD-A __ __ __ -7 ~UIEE ARO ,'A'.' AAAI "A ASD ADA AA-_ _ _ __ _ _ ,AA1. V RVCCI sr aDnsacl'C)l -lO-0 2 ADA'. 11 nCIE ,-C Cn R( ,,, .AA AA DA ,A AIA, ADDIA -Dl.AD .AA-DAAD' 1 DSISSA ~AAO-DAD ,____ __ _ _ DA ADAA ~-AD AA,, AAAAAAA-I A 1195: ,.M ~d,~i-_ __ __ iA DNE O ADASLAI ADAA DAADS AA A~A AD DA, AAI--A ADA1i,1 A ,r,,, .~~~~~~~~~~~~ ~ ~ ~ ~ ~ ~ AA. A'i AAA AA AA ,AA DAAD D'ADA :~ ---1 ,-,,4112,n ,,1 ., r~,,1 ,~ iDAIS AAA D[AAD DAADAAAAA. AA. ADAA 1~AD AA1AAAA DA AM A ., AD MASA tAAA. -,, e". ADA 1~ D" A~~ AAIIAADAA'D 1'ADAMA .AAAAADAA AD A A, DA A A, DA ,, ~, 17:~. 1 ,, 1 ~~ -, DADA,~~ AD'. ,'A A' ~AAAA'AAAMAA SUCISS .~~DAD'A IDD -AODI D *lOS ,l AMAAA.AA -~l-AAA AlA AAnirs Aatii AD DA A A AA~ AMA AA AA A, A A.1, D~D DA111 ~-,,,-2 i M AADAAA' DADO AADADAADDA AAAA A-AAAA A~M D 1A ADA .A ~A DAD AAA"A~ ,, A A AA ' AA-DA DIDADA AAAA--, DM SAAAA~1 ll D'.A-.,D'.'ALDDOftC 1XIDAN .A, 1~ ~, , ., -,,1, ~ ,1, l'.11D AS AA. DAt A AlA .AA A. ALD, A ,D ,D III SAAA, AA DD.D -1 AADAAA ~A AADD ,'DAAD ~IA. AMASADA". -AA DAD.a ~i A A'~''AA A, AD -AA' 1 ~ ,1 Z'AA'A' 'Aiiz
PAGE 29

PAGINA VL¡m1NVEVE AO CXVfl1 LAIPU DE2UNk4N22 2X22Mrlw1,2, itr COMPRAS 1REPARACIONES VENTAS VENTAS VENTAS 10 MUEBLES 2 PREND11AS 4 "DIS01 CASAS 4n CASIAN __414 __ ASAS B.501: COMPRO MUEBLE iS 22.22222O 224122282-2 01422 222422222 222 "222 2222222 2 2 2222222 22222 ,22 22222222222222 2 ',22 22 ,2 ,~ 22. ~ ~l22. 'M,2211 1.1.2 2 _,__2 _2,422 2222 II 2222 ,1"111 22222222222222 222222 11.," <222 2. .2 222 ,022 ,2 22 _2 : 222222 ~ ~ ~ ~ ~ .11 ~~ 222222,2222222 2 .222 1. 222,2_2~~2. .22 .,222.22,,22~~~~2222 12222.*,Y,"1111 222222 ~~222 2, 122222 2 -22 222222." 11 ~ 22,io, nltx(2bl ofln ,.,-'' -_22. 22~ a 122,z" J.222222 (22 .22222. 2 2. ~ 2 22222222222 22.22222 u ,,>,,~~ treadeliimrT1slW,%tPA U EARACIONLS 22 l, l, ~2 2 ___ __ ___ __ __ ~~ 222 222422222 .842.171 0~ 1.222 ~12 2 22 222222 ,222 a -. U ., ___________________.1 A227 OrOPAO !jl"A --e"n QUINTAS D RCEO 5 PLAYA MlgORl 1 A2222222 co eomqia2osr 2sr-A iat Propiotarioa de C22222 da ad, .2. -. 22222 -202. 2222222, 222222222 -222 do22es,v2ajills,2casas 2222252 .-222 2 1~ 22 ,22. 2222> Tamb 12222 22220 VEND $1.' ".,, 22252m "l 222 ~~*2, 2,,,,l,' varas ambi lote 22 mu-1 222 222222225222222 VW22V 222222222,22 2 ^2222 2222 ~2.22 222227 5JT1"2 221~l 1 1, 1 22 22 22,1 2~ ~2 22 .21 2 222. 2no2s2 deesil, Lmpar12a2220s 2.22222 2 2 22 2 22222a 22, 2222'5, 2__ 1 ,_ 22, 222-i 2~ ,,11il2 2 2.222222,2.2222222 2222 22-101.17-2 --3 2 222 p2 222222 2,2 ~22 22222.222.22,22,2r 22222.222 22222222 Tri2222, 2ou ers 2222222cu RTO .4 I IN--, -,2 2222 22222222 22 2 22 te g 222s 222er 2222'd 22 22222. 1 2222222 11 1132 11 111 1 9 22iI 222,, 22 22 2 .2 2 2 2 2 2 21m y,,,1ie>7a> C22.-722l ~c" 22222. COMPRAMOSLAM 41 ,AAS ,4212 2222 ,-2 1-;-" c.71 12, ,22 22222 220,2-. ~2 2222222 22222,,,,, "" 22 22 2_ s 22 -ll, 122222. aba 2222.y ~ ~ 1 22 '2 22122 AMPLIA IONALM NDARE 22',, ,, -_ ~~_-__ ~~1_________ Zi'.L A g221 202,,,,,,, ~~114 222 22 ~~2 ~~ ,222 22 -l,: ~0AM R 922,,,, 0,~22 71~222d.P 2222 2 22 .22222.22 2 222 22 2 222222222RI, 22 -i,_ 222.2 22 222222l 2222222222222?222.222222222222222222~~ ,2 t,2222 .2222. -2 2 2 2 22 22 22 ee, obeo (te plata, me 2" 2 v ,~ 22 ~IA21E 2222 t-~222 i22222 2,2 2 22 222222 22.2 2222. 2 222 ~ ~, 22,I, ,., ~ ~ ~ ~~ 2 2 2, 2222 t -"2 _ _ .2 22 222.2222 .;22 ~2 .2.2.11 22222222 brncs 222222. i 22. el -2222 22 ~ 22,2,2 222 .--22 22 ~22 2, 222 ~ 22 22 22 22 22 2 .2Z 22222222222 2222222 209, 2-04 .2 222. -l ~2 2222 22-22 VEAO $22222 iiA 2 1,50 RENTA 22ddo 22241 $13a 250 113 2, 222 , i, 2ttta t" ,2" RIVOA A. RE1(l ~1A2 C-2103 17: oc.11-uumr¡w1 ~ 1 ~ 1 ::, -1~ ~'-'i~91, -~ 11 222rt 2222 2 222222 ', 2 ,22 ,2, ,'_ 2 1~ 22 22 2 22 P2m2m. 1>o2222lanos y Mar~~ 22 4" Ir ~222 l,222,2,.222 1.1 -2 ~~ ~n'2 222,22222222 22222 2 2 2 2 22.22. " 1 -_ i-; . E T A $ 5 22: 22 2 ..22 y .~~~22 _2,22 2 2~ 22,11 2 22 222222222-2 l -1,2~ r2222,.22222222.2222,-, CASA 22 222222 OR t22.222222222222222 1v, .i -B6ft o 222222222 .22 i222222 -f 22222 P.DARE -1:, ll~ r 92,22A40FRCO A --.,,7-z,., 22, 2222222222 ,22 2222 1-12 1~ 92 ,55 - 2222222222 l-2222, ¡4. ~~ 22,222 22222 20222. VEDAD C11ALET 1 wdI 22 ,clno :arns 2 2.2222l, ,1 2_ 2 .22,22 22 ____,,,, 222 >, -22 .2222,2222222222222222 12i10s 322522222121 i221222222''. 222.' .2,2 7~-22 2. 222 22 --222 -C Y C -1LT $2, .2.222212r 1 ~ 222220 -2222222222 2c 2222.22." n22 2t 2 2 22222222 22 222222 u2.222 0,~ 5 Y22222, m12 21 2 222, 22 VI.R 2 22"'' ~ ~ ~ 22222. 222 22222222222222222222. 2 2,222222 222222 ~22222 ,I ~2 2222.2222222222222 212"Eq ,a2 IP21d2 0222 .222 o" -, 5. DE CA PO 32.0 ~2 20 ,I. 2 22,2o 22, 2222. A-1422. 04-21 21> VEAD VEDADO,2 $ 22222 22222 kW0 RNT iJ " !. rIt22,~~1212I222, -~222 E 222 2221 ~2222 -2222.22222.22~222222222222 COMPRO~~~~~~ JOAS ,ODER .222 222 22 ~22 2422_ 2222 222 222_ 22 el,~ 222 222,2222p2 20 1211212 -2 22222 2222022222 2222 2222 22 AL E DA E 0010 222222222222 2202 22,2222222 2 ,2't-22222 i22 2,. 2222222 -,2 ~e-.22222 ,-222,222222 RES Palamo. bin -222 212 !22 -0222 ~ 2222222 ,2222 222222 22 -2 -2 2 222,22 ~2.2 ,22 222. ~2 2 ~22. 2 ., 22 222 22 TA -1-, 1 ~ A122 93,211:22 Ch~ 2 22222222222222.2222.22.222222222 2222222222222222 2, 2222 222C 1 12 22~222,222 ', -2 2> 22.22222 1222222 ~ ~222 2222, <222. ~~ .2, 222221 2022 22 212 222 2222 222 22222 22 2 222222 22222 2 1 A,2 2 ~~2 22 2 ~ 2222222 222222222 222> 2 2222222222 0-2-1.0 22 12.2222 u -.~2 -1 CAA EiIFII RENTA $125 03101 :m ,2 22 22a. 22222 1.t, 2. 222 1 1 - CO P A O 1[ 22 ,i,! 2 Av .22q2, 2 2, 22222.-l 222LE 22 ,2,22 22 22 22222 2222222222r, ti 22222 22 z 22 222 22 22.22224 lay d 22Il.lI .22.222 2022222222, , , ',: 2 .222 222.22222~~~22.22222. 22222, -1 2222222. 22 2222222. I-¡ SE VEND CAS 222 2 ~ 22 ,,¡l2 22A,. ~ ,! COM RA OS MU BLE2,22 2, 2222222 2222, r222 MOE le ___ ,,l,~ z,ol se J1 -, 2.222.p22.2 ~22 i2 22222 ,2 2 ~ 004, 90.01 RENTA $30 NA T ESUIA 937,5 .2222222 ,* 222.22222 222 .2.222022222-,2222222222 222222,2.222 2 2222222222222222 A-4474.~ ~ ~ ~ ~ ~ ~ ~~tCOPR S1>,ULES Y 2222. .2 222,2222222 22 22 222 2 222 222222 2222 222 222.2222 2222222.2222 22 2226142012222~~ 2222 :1z522 ,11 222222222222 l 222222 22220, 222 2 22222 2 2 22 ~222 2 2 2 2 22, 22222222 2 2 ,t,, i~22222 MI22 ., d~ 02 222 ;-222222202 .~222 adro2oreaa, 2arns P~ 22222222222222 I 2.2 ~22-2 -22.2. 22 ~l-2,22 ~~,2222.22222222222222 _2 1.2 y -,22 22222222222222 12 .222222.22222222 22222222222222222~222l,2212 - 1m 1021214 y 2212222212252. 224,2222 i2222 t_~ 22222 222 PROX A PRADO E2, 2 p aaejilol 11, 2 1222 222 2222 y 222-plata,2 oro ,222 .22 22 22222222 2222 22.22 2222C222.P22 2222,f22 22. ~222 VENDO~~~~ ~ ~~~ 22,22222 22222422$ ,2 115 2222222s 22222 2222, 222222 ~22222. t,,2022N!.'" ____ ____ ____ _:, 22., 12222222~22 .22 2222222 22222,5 -,:~222 22222 222222 Al-2a2222222222.d ~~2222 r22 .22222222.2~22~2,2 2222222222222,2- ,-, l -222.22 .2222222 22brpimio 0404, X: .%t:27r22. 222~~ ~~ 1~~~ ~ ,, 2s222222222~2. ,~ 2222.2 19 ~ ~ ~ ~ ~ ~ ~ ~ ,L iIRO O- fl1472¡5Q 22222~ -,22 22 i ~ RETA 92"5 222222 22222 des'*, ~ ~ Equipajes.2 22222,222asa2--22222222"~222.2222.20222,:_2,2N.2DL2CAMPO,$2.22222 ,025~2222~~2222.22222022.22.22221~ 22222222222.22222.222222242222222.222 222222222222222222222220222222222222., 22 2.22.2222222222222222222222222222. ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 22222222 -.2.22120.,12222222.,22222 -.222 ~2 22 222 -22 2222 .2 222.22 22-222.-27-222 sp.22 222 222222222222222 2222222 22222 2222 22222 2222 2222222222 2. 2., A82. ~~ --l 2222222222222222222222222~222,22-2I-2,2222i2-122,,.2t 222222222222 2222222 22.22 D E>' _, 2., 22 22 222222 11 l2T ,475 2222 222 222,.222.2 222 2 .~~222 22.22. 22222222222222,2222222222222 221220222VCA 2.2222 22.22222222,224~2222-22.22 ____JOAS______ .~ ~. ~~ ~~ ~ 2 ,2 ~ 22222 12 2 22 22 22 ~ .~~ 2222222222222222 rij,222222222 .22222 -i' ,, 2 2 .22.222 222 = 22 2 222222222~D -22222 222222 I2 2 2 222 22 22 2 222 22 -22,~ .~i, ~ > 1,111M11 ~ -, , 22 22222 .22222 22 2 2,I ',7, ";, .22 02 222 ~ 1 122 22.22 ~ 1 R 1,01 -1CASAS, -u ~ ¡.7 02 $7 _>212221 022 2 E NODACO ~A21 22, 2- ,~2 1l 22222222,l~i 222 22222 222222222 222.22,20 -2 .~.22222 C222 2 LIT.2222 .2_ W000 22222222022222222 ~22 .2222 1 -b~c,~ 1 2222212223 ,,,~ ~ 22222222. ,M. ~, 22 222222 2,22.22 91.5 RENT 0057 _02222 la~ ll 7.1 i 2222, ,5 20222 1 2222 2,22-,2 .22 2 ,2 222222 2 2. 1,_ W .2222222 2227 2222222222-; -.,U ~~ 1 ,.1111 22 2. 1 2 .2o.22 22222.2 ,2 2 22 2, 222 222,2 22 2222 222 22222 222222 2 722i .2 22 i 22222222 2 2 22 .222 ~2222222 ",,-l >, ,,,. i_______________ -2 22222 2222 r_____ ~,' ,".>, ,t.Td 2222 2222 2222 22222 22 2 ,H2 22 -VE A O 52.5 222 22 222ri M .22aar t 22 222222 CHfl A ET , 2 ,' ,~ 11N 120 _2 ,2 i,2,iPP , 1 50 2.222. 22at 22 2 22 22 ,2 2222222,-_~ ,1 4q_____________ -11 2-.!7 22 2,22 ~~ 22 W' 222222 222222222M1 - ,;t r.2.2 .;.2 222 22222222 i2222P P ~ -22,2222 2 2,222222 li P.R C O E 222202222222~2 ,u 222 .2O 22irL SO ER ~~R 222. 222222 22 ,? -. ~,r 421 5212.1 PRESEAS 222-l: 2 .2 1,2222222222 ~ 2222222222i2T,-~2 1 .~2~~ V TAl RAo E RCOON 22222222 22.22150 22222 22 22222 -~, 22 2222 222_~24 2 1 .2222 2 2 2222;; 2222;2222222 22.bbi ~ ,' 2;, ,, --2 222 222, -2 2 ,,, ,~ ~ ~2." 2 2 22 22 2 2 22 22 .2 -2 2222 ~ ~l 1i922222 2. 22 2,2222 22 11, r, 22 22 ~ 1: 2 22". U ~ d2 .,2 01-152 e. 1-4--1 ~ -R2p 2222 222220222222 ,2222.2 2 ~2 22. .1 2 2>22 0 .2212,$ 2 ~ -22 ~ 22222,2222222222 2 22222~22.2Cln 2 222 222 2222,2 .222222222222222222222222 222222 22222222212222222222222222222222 ~ 11 ,2 22222 222 222222222222 2. MIAM R .0,50 t2222 22 ~I-22 2.22.22 rl, t22 ~I22 .2222 ~222 -22222222 ~1~2 1 222 2 .22222.1 122 2222222 .222222 22222222.222 2 22 2 .22 $$22222222 ,22.2222222 ~ 2. -222222222. .20 ~ 2222222~22 ~2 22 2222 l?.i 222222 ;,2,1 22. -222.2~22. 2 2,,22.222 .222 ~ 5 22 -2 ,A 2 942.50 22212 _ _ __Prs f__~ ~02222222222 .22 2222 2,2, l,, *l ---P222222^22!2222222222 -i 2222222222,2222>222,222 :2.2,22, ES L17,222 22222 $22222222225 22 2 2222 22 1 22 Eopl, MIJOS 1.ASTOS. SURE 2222 I 2-, 2, 2.T 2222 222 .2 ~~AM 12 R I125 2222-222,222222,22 ,,,-,,,,,,, ,, 22 ,2 ,,2222222222222 2 222252 222222 222 2222222 22222222, ,1, ~ ,-'T1 n : ,_ ~ ~i ~22~2 ,, 1 ,, ,_22222 *22222222222-222 J,222 ,1 222222.22.2.2222222,21 2222 ~ 2 -122. 2222 22222 2222. 22l221 l 22222222222222 2222,2, 20222 2 2,222222 22 2 222 222 2222., -1, 4t 222i2 -"22222222222.2 22224 222222222,222222,22 2222,22222 2222. 22.2222222222 22 -2 l .222222.222 -2 2 2222222222222222222222 22.2,2222224.222222-2,2222~2 .2 ..2 222 ~ 222222 .22222-2c2 ,,1 2, 22 22222.'' -222 2.22222 222 2~ 222,202 2i~ ~22.2 .22 _ d 14~ PATNA VIJ INIlli:T, --- -. 1 1 inrt VEPN TAS VFNT AS VENTAS i 4A -(ArA,% 11, SOiIAi 1 s $I 5,AllCIW,Nf' ---------~E D ,O A E__IN 11ALLER11 DE1111CONFECCIONES--__~ ~ -,,,,, 3i ,,,,,'''' j ; :M1kll1,i ,l( I V I, lFZp :(( j fE I N 1,1 111.1,1 ,1 1 1. ~,~ ~ ,1 ,, 1 1 1 ,1 1 ~ ~ 1., ,, > 1, 2 4 2. 11 ~ ~ ~ ~ , , .1,> -, ~ 1. 2222 ~21 20m1,1 22 25222 1,2 2) 21 XIS~ YE D ES C P D V drado 105 0 som ra _'_______________" 2 ', 2.22, l~ 2.¡l, 22:22 ,,2, .' ,2.222 22 2 22 22 -, v,!, -, "" 222222 _, ~ -f<-22 22 22 2 22 2 ~2 > ,V. l22,22 ,l 22222. 1,1 ~ ~ ~ ~ 222222 22222 222222 222 2 2 (222w2,,i,S, ;,,, ,,, MIRAMAR, CHA ET c 222 ~22 22,22 > 1 222 1 222 222 ~~. casas 1, ,r2222; 2'2l,1, .2~ .!2211,1 .11.1 22222222.~~~~ ~ ~222 22 M222 222 2222,2,222 222222 2 2222 22 1 -l 222222 22 ~~i22 2 ~~22222 2 ,24 l2 22 ( 22222222222222 22,222222222222 , H r, ~ 2222222,2 -1 1 1 11~ -22222,-! 222222222222, 222222, 222.222 n2222 22222222222 222222 -." ~ ~ 2 22 22215 ti l;"¡'' "22, 2, <,1 22. 22 2 222, 1, !, >_ M, _,, 1i2222222 s2222 t,2 22222222, 2222222222222222222222,'TI 2 2 22 I2 22222 22 22,,,, 222,, H2 2 1 ,, 2, 1 -2 22 2.2 22 ~ ~~2222 ,2 -, ~ ~222 ~ ~~ 2l222 p 222 222 22 2 2 2 2 2 2 2 2 22222 22222222 2 ,_ ASAS,,. $2800 DUNSDPAA HABAN-A, RENTA-i,,, ~22 REARO Y, JADIE MARMOE ,PENR-N 22222,2222222 222, 22 -, 22 2~ 22 ~2 222, 222 ~22222222222~i 222 222222 122 -~25 22 1522222 211 t22. 222 222,2,22 2.4. ~2 22222 r2222 2222,2 2222 22 22222 2 22 0212 2 11,1221~ 2222222,, 222222222 , 222, 22-2~22,, 2222 1 ',1522 ,2122 V1212222 1 122222222210 22222 1, .222, 2222~ 22202 222222, ,H01,11' 2' 22 -. 2 --202212 1010. 222222222 22222222 222222 222 ,22222 (-7542 22 ,222222 ", ~ ~,l 1 ,O A E 2222 2222 2222222222 2222, 222222 2222 22 ~22 -_222 2 222 l.,222 2222 22222222' 22222222r22222 22 2-22~~22222~22222222~~2~2i22.22222222222,222-22-,2222,22222222~n 222222222 2D222222, 22 i 2222 2222 22222 22222 222222222 2 12 ~~12 2 -22 22222 ~~,22 I.~ 222 ~o 2 22-2222 222.2.2 ~ 222222222222222222222222222222222222222 -', 1,11~ 1_____________ ~222 2222222~21~22 22. __ __ __, ___ MAM~E ~ COS,, ,!, PLAYA ~ ~ ~ -M~R AR ~Z2~2~ 22222222222.22 ~ ,22222222222 2 ~22~222 ,22 22~2 "l. 22222 22 ,2 22 22 11ffl ff l¡0 11 111 1 1, 2~.-2 22 222222 2222, 22222 22 ,2 22~ 22. 222622222 22222222 2 22222 22222, 22r ~2222 22~.2222 2222, 2222 221 2222 2222 2, 2222 2 222222~2222 222, 22 2 ~2222222222.22222222222222 222222 2222222222 222~22 -22,~~21222222222,-, ,, ,22222 ,22,~22222 ,, 222222 ~~. -,222 222222 2.11 2222 1-2 2222.2222 2222 ~~p22 ~2222 122.222.2 ~~22222 2 ,22 ~22222-2122 .~ ,122222; .1 4122, 222~.11222112 -Ayu221 -222222,2.222.22 2222222222222 14 ,,Pa22,licuIu 2222 22222 222 P ~I -----_ 12222 A22A2 $s 22,00 12222 22 NO 2 DE 222222 A22. 22 2.2 2222222 -2222222 N 222222 2222,wf,2 22222222 1222~1) 2222 12 122. 1222222 222 222.22 222222222222222 H uAAN 2A 034 SEN .$ 1200i 22222222.22222222222 222222222 2222222222222.2 "l 2222,2211-,,11~ -222222!REPARTOS2Y J. 2 2222212,22,22 h,22 2222,2222h_,222,2i>~~ 222. 1111,,,, 1.84 .222222 22222.s y222 Panteones_____ >, V2 222222222222222.2222 12222.22222,222DE22222.2222 22 1~22 2 22 2222222222222222222, 2i22,2LISTOS222222,22222 222222 2222222222222222A2. 22222222222222222222 222 222.2222 ~222 22222222 21 2222i.22,2222 2222222222.21 2.2222"., .2222 ~-,~~I,~ 2 2222222222,2.222222 ~~~~22222222AL2222D AC AZ _", 1, --,'1~ 22222~ ,r~ 22.2222,, ,, >11,1, 222.2222222.2222.42222-2222,2.22 2222 .222222.2 22222 222222. 222222222,"" 222 222 ,222 22 22222222.T-n .i l., Jc 22222222 22222222 222222 22122 .,,,.L .222222 2222222 ~2222222, 222222.222. 222, ,,l,, J "11 Id 1 SI~~~~ d 22221~22~22222222 22222222222222-222222222222222.2s2,--22 222 2 222222 22222222~222222222222222222222222222222 del C 222222222222222-. 22222222 010 VARA ~~ ~ 2222222222 22222222222l.":""' ''" re tro eConilllc,' t 2 ",, -2 22 2 222 2 ., ~ 22 :2 22. 2 .22 22. 22 222 222222 22 222, 2 2 2 22:', 22 22 2 22,22222 2U' 22 2222 22 222 a 22 222 2 2 2 2 12 222 2222 2222222 22222222222222222222 1 22222222222222222222222222222 -',___________ ,1~ 222222 22222222 ~22 222 2" 22222),fj 22 en Vao. 22222222j o2222,,2 2.222222222 2 22.l 2222222 22 ,22 2, 22 22222, 22~22222. l2 22 222222,220.22 222222, a 22 22 222 2222222212.22 ,222 t,,,22 ~. 2. 2 2 2222222 22222 22222n.22 2 22222222~~~ 222220222 222222222-I. VENDO F d.UT 2222222222 I5~22-2 ser. 221.222 ,2.22 ~2~2 d.222. 1105,111A2CON2su 22208 .l. 2222222222 22222F l22222. 2222 222 ~r 222 222=,l. 0~ 22 ~. AES A AN MTy 2222222222222222.l 2.22222.2222lu,,r ,rr1~= o 2222222222,2222222222222222 222222222 12222 222222 REPARTO. so,_ __ __ 2222tM 222222I u2 y2 222 2. EORIL7Y1~ .~ f -kld .~.,~ .P-22222222222 $L222M222 112222222222 222~2 0 2, o,, 22 ~~~22 22.2. 2222II ETA I I .O 2222 22. H2222 322 -222 0222222 -VEDADOWO LON M EJORus 222222.2 22. CO 2222 222222. 22L 2222. 222222 YA 2I22 AR2,A2-2.l.22.212~~,t__2 _2 222_2222 2222. 2222.2.v 221 22 A U 222, M y22 222222 t-222 222 -~d_ 2222 -222 ~2 1d. 22222 C aD A 1141. 4 PUERTAS.l C _______________ ~22 222222222 o~.22222 222 22. 222222: 2122d 2272 2 ¡. V NT RA04 -: : 22 .2222.b. M.sadi~A.n2 d222fg. -t1. 521122 52,1 222,22 2222222222222, 2222 222, 22222 22 2222, 222 22222 Y222 A. 2'.l11 222D 22XVN D 222D 22.x 0. 112122 i2221122 221 222 222222022122 SOAR mb 4A -.2212~ ~ i~ d2.222,. 2ot 22~a th 1w ':222 1222 2r22 22 ~2222u2 22222222 2202 .2222 o. .SP;. 220C-i1 Ag222 $722000, 22222lI 22222222222,222,2 .11. 2 2222222~e,P .= 122 1422 ~~2222 221221 422,22. 222222sA. ~222 I~2,2. -~ i.2 .-2222 T2.¡222222 222222 222222 2 2. 222222 2 11 222222., 2d,22 2222222 ~222 222222 , 2 =22 T1~ M-Isla~2222222222 2 2222222 222i 222222 22222 22 222222222 .-1~ .D _.V ND 22222a22Mni I. 2 2222. 2222.2222222 24. 2 Ag22a .400 Ol"a SE2222 VENDE.2 TERR22 2222 REN TE MIEN.C$21Ca .M~. Re-ugio -1~ 10222222.222 222222 224022222222222222 m,-nl al y n , ..-? 2222222022222 22222222.d.,222222,22222222222222222222222222222222 22ieto 222222 r trama22 a2222 r~ 222222 222222 22222222222222 PI ORR 108,FOD.RA 2.2222222222.2.0227w2.2 222222 222 222222 22 11 ~622 119,000.22 202222ud 2,222i, 22222222.22 22222 2 22 ,T .22222 2J .2 22222221 A 2 2 YW 22-222222 .6 5, .2.222 CA IO E SR11O.11m_43,, .VOL.~ VEN. 2 TRES. .ARCELIdp T AI 2.2 2222 2222 222222 22 2222222 ~22. 02222122222d r" -1122 27 33.320 ~22.1 222&" 1,122 .%b. 302 22, d~ 11 2 2222222 2222 222222 2222222 222 -22 2222-.M T1 LM .J .222222 2222, 222222 2222 D2p222o 02227. a ¡2222 1~vo M-,22 22 ,2 22.22a o2 2222, 2,, 222 2222b222222 Co 2222,222. 222222. 2.2 "222 22 22 ,222 bl .22,22 2222222 2222 0.12,22 21102 22122 8222 222222. ~ ~ lu X21252 222222222 222222 -~222 ,K., 2222~222222 ".l"2.2122 2222222 22 2 22O 2, XL 222 UX 22222222 22222.2 22222 222~22222 ala 222 22222 y2 m222222 2222 2a .22 ,s. 222222 2222 0-22 Z 222 222222 22 M 2-792222 2251. S 2220221 2 0 22.2222222 ~222 222 222222222222 22.22 252. -M-1,222222 ~~222222222222 del222222 ff2 2 pequas2. .2,i2. si,222222222 c U NAd .1 3 4 1 P A E .2 2 2 2 2 2 2 2 2 2 2 2 2 2 d .2 2 2 2 22i 21 2.2 2 & 2 L i -1 0 o122 m 2 .2 2 2 1 2 2 2 6 2 222222 2222 ~ 222222C222E2.20-222 22222222 -111-1 -~-d.1 221242.d 2.* ~ TrI -22 0o, .2222l.2 2 c -1

PAGE 30

PAGINA TREINTA DIARIO DE LA MARINA MARTES. 20 DE SEPT DE 1949 CXVII TVENTAS VENTAS VENTAS VENTAS VENTAS DINERO-HIPOTECA VE T VENTA S V E TA -ENT A S .1111 -- ~~ Aw AT0'VILES y ACCES $4 MAQUINARJAS S MUEBLES Y RENDAS 56 MUEBLES PlENA S UTILES DE OICRNA ~ MA U; DE CONST Sz OBJETOS VARIOS UA urErA _3 _ _,~._A UN RAS----~ l-.mta3 m n ta s rrsue.N n aaaon s*n namior, saa o1,1 ~<., 1 ASO ~~ [0 A ~R O ~o ~, L4tfl44>[lCA q( INA Y LABORATORIO -EFECOS SANITA ,,OS ,.n1 .., o. ,,o, .0 .,-0, Q O 1,0 ~c )P RT i)\ T.\NQUI.S DE ACE RO ,,,, ~ n y2 0001|$~~, J EGO DE CUA TO ~ C EErIO -,u ~ree "S1~ro 1111 1111 1~" -1""1 "III ---e """ -•' CO 1L .r ~~~ C-l 1. ) b d 0 C1. 4004 ', sa Tu"l .-.04. -an er. c 040 '4444". 040d00U00m000sa4a0$0440r. p000 te 000 s004 H6'6MC1 c 0-00 040 0 pudecos ralounasud ccia 5 0 ieassults. o nOC4444u050 ,AQ0ECO0.CNR -CATRS ECLEoD _ 44004404 _s_ srio rco _ 0040isas __eais ugo urdse535e dln 11 L .Vooooo Jog Co 400 es b0r4 0 E M --0 -,. 00 1 5 4 Pu s dto 41.11ie -> 17,~ -.-tj--I1i ~., Ya AL. .d b op ebila o od o, do,,,,,,, , ., --,1l ,a ~aae 4. Man -* b~s bs 1oia d,, t"s it naeasybul7erpcalspa .5 om a ~~ 0. 0,, MIRE ESTO ooo.44o40 uo-joo M.U oe O 2 no k, MA ETu S 2¡VIO-N #:RA LAs DAMSR LA~~~~~1 A~ t aanu n oo e c Em ee cl f Abztu lin D ',n ~ mum mge , ,20 77 PEU UE 1 5), ~ t 0 11-31 Pd pr o ,, i., ,m 1 ,we, . a ,1 , i.e -, 1-11 I O E A ---,, "ro F'za 4,1 4 arein o en v ms b~ \-L \7 5C8H 64 C 1o ' ~ ~11 4~ 11s ¡•'> -,,r l -U L ES 0 0 1 4 ~~ 004 ioo i d,. e 00 0Z ,i"'t'"t rp, den $3, 00 ti trai 'ZId o ~p m rS L 1 I A5 P E T S D ,i1_ -a_ , .--s -11 -1 AMA ET SAJI N STA"', -------_ _~~~ llar:os m deo n e d c rra Pdr i sum) b Zano," -'.l u , 441 o. ¡ NUEOS 4,N u y IIU, .U1. U. JEO DEnCAr! LA 0 000 -4 Ooo 00' 440 1"_ ,,,0~. -4040 .1 ----1--1 7 1 1 ~~ 1~ ,_,1,tPO SOL $1 ,0 NI NsA l S# c CAI O JY APA ATO M ocha "K ,yt1n s ,ar bel amno e .ie 1~ .e u o rm a a 1 Uselo da_ y rc e 4 .0 0 ..i 0 t' ~~~~ -,-, ~~l0 4. ~ 11Y~ ~ ~ ~ 19 ri > --, --9, t n e s Cas P,1eI*11lll.I,, .-or~ad ~~x~ab, ,-r ,,, ,.,. l!-w 1m, 1.~ ~ ~ ~ ~ ~ ~ ~ ~ ~ e C-,524 ,14 ra ,, r~1~o de,1 uh V't 111 ', .*"'' 1 U'O D C A TO .C EEC R1 -'", -10, 00,004400 CdTR404 0¡NTjoe olaLaUS (Apaor> Ftootolsllr>"oooTdoo $n002 4300pr.0. 400o0d04>04t 4p0staSs'nTtipn y0. 5.270 Vi.4TE0.E4400AooAooLA>004DA 040 -. 4. I u o la, $0 d o estantes oro. e n no r 4 4 ~ .i .4, tm o U o r1~ .44 4, 410 55,u. e_0 4 ,7 40 l n .tr oos 53.0n730-0004 Oc ,-. C-1 4.40 4--________ "'4'e 0004srtid eo-oos y 40 a. 0404*4 .AIQUcECOS lCNTA 00.UN RO. .g 0440 r40 4 0-, 44.04.4.4 *MAT;.4SpiElai JAuegCA 044040 debsde 4ap7s e auo o 11 1, r1 Un oio -;!, ( ra ',, -.itn I ilres"-lil C)-t --eta --ve ded--Au-----n rar---v H .50. 440-0->40404444 lodosos, llaese avo o 11a c11 -1 1. ~B L i ~l \ l,0 ~rc d r y, Co .% ait ', ,,,a ,aa mu1o 1n, et,',13) ~ CA ,-LI AL -.' C _P ,, 1,, 044 , bidrs 0e,11, o ga so s1,iloto y bal esd0o pec ale pa .. $3,75 0 4 4 0044410 4,n n y D, 'o .en ,::- -Pa vendedo .suamint 1w tfogrn BU C 4 1TA 1 1 56 MUEBLES 1, PREN1A~, 1~ -ri,, -e,,lb e i 'E b, ,8 8 -22 Prp, S tiZeyt n N .-, ,o-----,rdli,< ,u c par ~ ~ 1,~e M 11 .c. ,AM___ 0,0440,~4444 ~~1 4 1 .de ya o 1t ar m M1s -ldr¡tas 210 -Mer 3e. pa A LAS t^,E ''0404444 4 0" r .00 4 40 i H -abi~ai l Oln ~o4 t 4ma444 Mzta y 0 '404t -l~r0 ~e d r m 4 44 r r d c / .UL0004* 4e4 __r_ y1 p,l,. C.~_ odl P e ___ d 1 a 11 r_ mus_ p_ erIf A .P R DA -Otl~ r 1o ',la po me1 A7l o ,z 4 1 4 en ,o IIl ,a A e" p rae me"a' l ila na et r -m e tsg rni ,x - ,w ": ~ ir d l c a ,a Bl nc 1 t o .e pr m r Ct A -, C-224-6625, s', A,!,tr Terr 41, en r ---e Raae 10 esov. c iraptp a Oque o (St""Anr IIC' y t('s lomaa ~~ J y 4-, ,ead T~~ F-, -7 2-75M -Oc ,atzaa Veta plzo co Expco copt gara-n-.tr ,1,,"i,]pe ,, , -s~ dta o oe ,Ar,-Nainl Vlea 359 1as il, Insttt Ne York ~~, Sa.Gar 1 -111 J ,11 1 1 l 1 --_ --57 UT~E DE ~~I IN -d ro --r ---ns--C -5-,1 -c ~ Al u 1e e M ari --o' -_ ~ 7 i --11I -l ,1 ,,t. __ ,44444' ,4,4o 44 44d04 144 04 444.44 04440 440.04044.44 1 ', ,, $4,90 MENSUALES, SIN EN. ~ 4 0>10 ----------044004040~~,,-,-, -7,I,'",1; MOTOR 42 br 0d 4 \4 -A s1 Vano md s D oS s od : su bao o E ECT MASAJSTA 4 0"0 '0"' 00,044444.44 .44.0 .160444044 404004 ,, ~dosd $12y rdiosvaris i45t0144d analind paeta e >40 00tas,4 040 b4404 MASAIST ,1,14 4 G a T Ca PA 4o4mada CnoaidpbSe pasa baro 4, -4 000 -~, E EN. 4 r 4 7 ', Tas o R i Va at Tu i a pr' En 9o Cosa1p a enta y l PRtES PASA ASFEAMAS ~ M OTORES CEN¡URY 1s40A07ADE T I d oCE TE an i ' i* , . 1 ni n :0 IC, t !. ', -,,, 1' 1 1 \ 1, 1' ,-nri saa 1 1a e ~aan ,r 2, l. ,,n l,* v.vlljpri 20, pt.-s Y, od 3 t,.a. o t 1 ~~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ am 1, 1eo agegd ~ ,cn, vao ',ag 1,m -ss -w -am -e -so.," -,ti _-,,,.e. ut -,r ,l - 0.4.4 .-4s40 ,44 4.04 ' ,' 1 i, 440444 0444004<04 04'1:1 a444440 000 000004 la Calol del Ce . > Aad, gaboredinas laooole, y1 r ~ e o ~ e, ~ -ls ,> ,a , , ,, ,. a ,ila -u er a d~ i rr ba ',' ~" ,, 2 N T f ,0 -2 *' ,, ~~,_,~4444 , ,a444000,~0,4 04 00 w' oo404 o:440 .i00,0495 400.* 4'. -11a 40040B444.04T4 L. C 04000 N4440 A4.E40404 rr40 MA gALESr: DE FAU Al Fbia ao 440>4 \4 -04 9-0 .c sus pa rEs co iIm svepdondoomnteWIa Em li p 4 nc e lerosm _______n__n______ IL\L 511 Ts 40440000 0.a aoa,4400a 40000 oa ao4,o444 las mejor matealddes a oyCS -73 d ,. S cro uls, w. soto et. BUCE4PUROS 06 MEBE PENAJ44 444' CAUDA4 LE4S c.0.o n a04440 an404 p4a poredC 00e apaoSamot 200, Tel4ss 440, 0 4 ~ 4 0 ~, ,4 44 40 0 4 , 5A ¡ '1 e 1 1 )I o-H o7 jM Cl oa-1 2t1 5 lchad teS o, Z oy oma rtta al ,, ________en_,___b___ea_____L U3_, _rapa _La pan 1 >1300 n or Cvllm>40r' o S 4e4m4 taAILAMte e' Ag ae PlANO OE CLEJA snm.454t loo oo7 M Rojoo "Naos-62-3go¡¡j¡ > p¡y¡o>g¡ T --t a ..-44400 4 R cano 004140 cEda.d pr ^es Traami a garassto 40064, 14404444404 Esoo'a -' o .4 also .4 0o44ao qeno lStada0l d loo alaado 4m0* 72yr 4.rz Veao Tel!. 50-6572.n ~.d d. ~ .S o, , o 1 C-0 -L > 5 , 2 ~ 01~t -.1~'" "'c i "b r o y rfitD I t r SC H I IOTEC A T ~6Soi ~ 4l 4 ti ,, -, a oc -1 : -1" 1 -1"" ~' __ -z, I, 1, I 1, 13 1O I U E ~ ~1 ~ ~ ma, -, ," ,t.t, ] C-20-sl Z 4 .4 oa t 4 4 ,0 ot.mas 444 todas zs 51000 o s lie y bmo ,rd e e. MUEBLES Y P r I II a 11 i, 40 L, me or, Ll, 'Sni taeio ,,,. 4044444440444__ ___ VEUNALRS GRNTA DFATS 2 L Len e*a2O '' I BUIAK 7 -PR 5 6 .1 ~ ~x 35 .m c., 11 1 1 1 1 1 t ,, .,s o ., e: ,,,,, ~ , ,,,, la. N,,ea a .os nta, cransr an m < ot o M d rzre iy tie TA 191. 1 1 -.1 :o y oo .e no r, ,n ,, .!(,,,,lli ,n l",o ,,i y,,*,, lz- F a PICmP, ni-C, -211 1, ', de 1, ,_;i ,,r Z a, 1 . ..,.C I ,: ,o ~0 me en,?! -,czM -, 1,1 1 1 eet ,.,cee ,an ,ba "er7ei .. u -rro'' lWi ,Irzrrn 2W', Ti ar s o is es ~ 1 - ;o > 1 -1 -' ,ro T-sn ---, s sa ea eas u ae .a 1031 5, n Mu n11 D G 11 \ 7t .\ --2' ,u e: 1 ~ 'o l ii --4 -F R A -,;'2 ''i IX AD I:, i,,,,",,":!% .CA I A I A O Ii 11U,1 A DE.1T1C-1N GANA ERs > 1, 1 ~. 1e.a ",Iee dres we, 1 -1. ., ~ -_ ---_ 1 1 1 1 -S l, ,, ?,t 1 4 I,, ae 1 1 ,I ,e, ~. a ,g gg gg g g ---.-, a ~ _ ~ 1 b1 ~ a I su m" r, ,l e ., t .ne 1' na ,t 1* ,'" .ri, i tlt irie. '10s a .le 1 T en ~r i ,_ ,e: uaJ Is toa a,], ann .---oaac r. C CN S" E L O e --raco ., e,,, ,,, n zZ --, i u , Z -,l O ,, ,; are;*II, ,, c 0T icooA 6n ze o u rlatacho a A A" L A A Amsa 1,e aHn 72 yt -j ,, -, 1 11 , ,, CZIc-s LmaLO8 ul io N LLcm s de e r o yem pi Mel 84L]1' b so ,RE(EJL, UtERi ~t, Q~~ ~ -N COSER 1, GER ~ E-ECT--A IT ---S -s 1ip m ;-n mia y r1a--c, e " .t.o g es ,.,,ta 0.44 40 4' 4 ,444 Oo,40 4 4o c a a a u s ss a a con 4od 4-0,4,0 TdaliDpo s202 tonns2 3 s o soas no mo Asuas gon s """",3 g g S V E NCE P OR E -,r0u0 40> t r. 44 04 400444 4,4 41 eeeniss A qu i es de las"nado> los o de cer, p ie> 0444 > 004 40' 44 4 404.40 004040,44r440 r1.444.044 doies aidaerors1e ¡p euveaoneal" Vnn oi l oss. c suimta ew Yne o rk Oratao. G ao. 4040, "! 44,40,440 4000 " '' '' "' -1 -04 4 "0 45 4 104404 40 -l -le, r, ,A ul ce !1 1fi32102,.s r 4001,,; Ilo " c,¡cs 2 r ]E D Q E On crba mas e 04 00r. 44ac !4ur l0 44404 Vaa e dem oio s,, mogolic en qin o Vi. e A-81. bi 5675 Pmason de aroio 530 44, 4440 4 00 iTLS E 05105 a 4440 o. aso o mo.4 Oo a deo4N 5 m aoo -Ys41A 0rrsto4ed u4e C tr5nd2-l Oc 7 ltrs en cans 0'" 4 e a s C ac sEnsro 'am GNG AD .O E C10.0 44d44.C4TAeLms aat 40 444 444*if ","0,;40444 M0TEMAT0CA 40 ,4044 ~ -4 44 4 .0 -11 5e -4 or44> 04" 2. u .a lo -~ sc En xseca afca co-, ,san ~sa as,. A 1. -.ll ,_ --2se ~noe re an 1e 1: ,2 -0-5 1 1~~______ 4 44. ., -4704 do, ,04 ,40'4 4.44 444 044 4,0 -a 2-2 004 es osioo a ala O 04'4 ron o po s r, "e"n"~ -Embe ,, 1cen y~ ~ d-e----n-sextra>ue .e1, mar .a .n.-2 CL macas Fankli, -,, m ta oras ation l 1.C64-70 Q Oc rnrc A m asno ''\4 >S's <444 7 L 4 C O 44ar'.S4ne5rns0u-1en el Cerrro "-30 CAP' AS " nr "" 4440000 aoa.o00 O ~.~~~ ge_ i." Ag.ta ,Z co ,um ~e ~o ,e monam contmass iems 4mernns aL L E .n tanspAreDes C p s "444 R badorost y "KrMsky", 041. ¡" .44 t' M-all, aaro ber en ,o o mu h ma Wa as-a1s~s D s," sipo blecaimsee-#£ Y A£ lARA manos -,1 ~ ~-La R-;e s ,u ~n o e ' ~ --Lom jrmw 'Sntarios Vasatu n y es nd sra 4 4 4 0 0 0 0 '> E -' -II01l0 -400l00000 74444, 4,4474644 -,o AS AP-00E ESTI AtO CUE TE Ap stui a. ooo rfoo -nuevas o-o lI.W o, --04.x -0444044 0044zo4oo i, 0, ~o ,oo -n "' ,n ,as zsqu; ,, La, pz ~i Tu1 2-3 cas ~~ --a -i m r &. E-im n Co-7-1,_ ., e u -4 4 4 1 4 a1 4 l .' 0 40 a ny le .A sagre a. Ma ~ ,,0 "400 7 ~4l,, o. o, o 045. Solo t'4o410a40. d04 4. 444444.. 4414-444 "L 'da 4; 04.4. 04444 -044 00400~44s- ,, ~-, teo do Farcc oomu 4400 01 0004 -oa ¡lo",40 Tulp 203 00 04040 050400 ,-. ~ ~ ~ 1-1 -1 :, 1)R -1 7 1m ,a 1, Ba 1-79M -ct :1, - O i O-21-75C 1O t a 'ia V n" Exua c cm lta aari _ _ _ _ e_ -~U 0 3 0B B 4 -s U D0N E0 a b l .bE dAb i o o ya d s d e b 0 0C0 4MA C 2N L P RC A O R E O t $44 4 4 E O E S T I L O s o -r s os 0 r4 S t A IA;L E S G b o .g l aan i o o a s y d o o s b r y e os d e v e n .a B E N T N ~ ~rno _cer o_ __e_ _a_-_ __s_ _has m esa p raea oo -0-i e K IN, V I O A II O m 'l. 4 4 ~.40040. ~ -oono .oos".SE bENDE PORim EMBARCAR 2 1u ,1m _,l alet ar a--d ban ,rr-mdrn m se Am a ,6 Pon 33IMI la***"d 4 4 .4~n, 0s0x4 n pue s0 4 r 01 0 o deom~o mae 'aleo .4P04 0 0 mismas a. 440n.~ D~ C J .8 10 sm la o a 1u g -G r nia "1,ca tip co e cipro_ : ete LT]teim,s ade.lant1 s del .41 01 044400 -b ~a. e, za~ L.s114.4 ~ ~ S0 .u s distribuidores a 1 O s oS v-no. os 444105 o no ., 0-0040000 eXc EG, 4 C4 4>4 s Tu0040n ..e C C U A E ds manuf ct doV p os o151 n d go e n ey boL ,w Yo,'0 0 ECA0 G a :._ ._ -, ~ 31 --1 -71 -1~ D .taurV n de s m a n ui s r e -4460n a 1 4 Tte. 4 .1 -6n25Pa d re 000e0 ,N 9 .1r. .m ,, ', zo .~ ~ E1 M A E A E DE C-S tu ico In u tr, M a h n 1st -m m 1a 1 , 1 1 m , 1ndr s r 2rc Y u g t w 000440>.l 404..0044d,4444 ~~~044 44044 '04 1 ,.. 1 1 - 45 46 044 bOFI e -o ,~ ~ ¡u ¡u 2-5 3'>10.101 ,~ , '.o004400o, ,oo4 Ooeo.4B 444 ".4 '. e0~ 4t d,4 -4 ~ ~4a ---r444 0g --00-01V6-4, ,r~0s sBJE T C ARIOSp 3DE .pi o Lm ai lla. 00 > Alturas ,004 400000004004 ~~ aer 1o i p1zo c.10do ,1 1A st 33 Tee n 26. 1ne ." in ^" ~ 444 C4e 417, '.t ,e ~ ,44 L4,Lss mjorss mssg e > bellos 040 45-70-24 Sp, ,dzab . _nhpao ugo ,1,t,, C-60 6 -*.a5! l CO IN ELEC RIC o n arms cmedor, __ ea sarchive ,' 0c ad v lmsbj rcodl CAA O T DR S FOLN A JOND 2AL 000 40500004 0 1 so > o D, , .r K K 1 : mo camb mos1 1 s "L A P R L A"1 1 1 1, ~ ~ 1 ,1,,,,,, .1 ,,k ,I I. $.90.9,.r. ,ra,.Crim.e. ,''s baratos d"1 E1. D~A DE ~LA 1A~ ~~ ,o ..CA CUL R ---: -si-,, siten -1eco v ner -ae .t S niaro V a .all .u i ''."' m -o ~~ 't' 1 ,,, U8004. 0400044,40 M-1oo4oo--" 1 X > 1 l0 '> 1 R 4 4 o I s I O L o1 D E 0 4 0 4 :c D o 4 4 0 S-R-s V N D E B R T .l0 4. 0 ,r '. rl4 .0 .o.eez a ,l C e r r o 0 .10 00 ,0 m 00 '44 ,: Z, 40, 140 ',ZO 4400 444400 40 f0 2-H 6040 -ct.¡444. 4 444 40 0 4444040 4. 40444 440. 0004000 1004404',1"i ,44 44444oT4441 470>000 Al 40, 404 AFIADRE 44004>0 QUM DOE DE GA 04004004 400 4444'4040444004400404.00404 e~~~ 7~ ~ ~ ~ . '!11. I> ¡11"" "", 1." ' I1 3 7 4C 1 o t aessn o _; C >_ __II____IY__Y_,____t___;___ t_9 El.y_ --_ 4040p 044.0400004440440 si, eo E 440440404 4 ,1 0 0000 ~~~~ ~~ 44 4404,40400000.00400444, 1i4444>4040.04i_. 1 .040000.0 0000404000.4040 K0040400 ~____nustrogirle____5_--_-11__l~_ -004. 04.44400404404440 ooaveo. 1 00000404000 A-S1IS r0.07.77~ , .__o Y e le e._ 404 --44.t .d M r 5.11--4~~4001 oo4044 ~~0 .40-0 ~0400 ""040000 I-00 ~0 ,0000400 4 '404400 0 .0 000~4~ ~~04y4~~~ ~t4444444004 le hemos osoooo00, fllJ 'ff 000411,Li~ ,1 ,; :,, ,, ., 4000040 4-0000 004 -4004.4044040 lS1J14.t olaMo ~000044044 1 ~ IIsIl =NhII $3001MENOiI' CUN~ -ESC-RITO' -~x -1 1 -fRIOS,a SiLLA >04*04. 4,' 040 0 o ~. Soaoo 404400 000040400 4,4044004 ,000 '3751. 00000 0000000 400044 440 50410100 ,04, 1400400 0.,440440 000444400000404440004000om:4y0>l,r~,~ :, 04r>40.004000000 00, v>44 c ,;, T-1,~404 4400 .00 050 4000040, 400404444404..o.4 44 4 -4 -~,". , ~ ~ N< .4010i4 ,ooos ~m Ooa eo ~04 2440040ines ,,,Ik 0 '4 0 4 1 >4 404 .44~ .4. -' -'' Z ,, _11111--CL A 44 01 ST .'Za .o KI D RG R E 0 0,A-'"' .1, ,M -.44 00 0 0 0 0.4 5 0 4 i40 0 4 00 0 0 0 ,4 0 0 4 4 00 4 4 4.04 DE,11 1 U BLS D FCN ART r. '<, 1, r0000> 4000401 e'0la00a0400044O se>0 venden04000404400algunas 0400070505m.00 e440451 M .< '1 .5: ,1.1 N 5 Q I A o O t 0 ,0 0 00 0 0 <4 -4z,11"c a i a i s a a l .~ II I ~' 1,ooo ,4 ,4 4.4 P 0 44 -4474 """ .5M Q IA E T N I N A A E O 44 44~ 44 0040400 0.0 44 ,, 44044 40 4 444 J 4 0444. 044404 4 "4 44 444 44~0700 ~4410 --r4_ ~004 CAJ0 0404004000404 54AU0 paeac te. D c piel,.000 0000 44704040444440 >~45440 11"-e" ., .e "," 30 wObpaeou Y0,44 L-aila -' ~"-" .4004. P.o4 5 1,74 0.1 -15 Oc 1 1 '5.04 154 77 VeOSn A $t, 4405.441 con:,, lu brlane ntobO -t 55 PA A I dLa5.& 0o44o40 VA IO C ~ .0 00 ,,~~~~~~~~ ~ ~ ~ ~ ~ Po"aooso'4 4-4 .404000 1100400 1 0 0-l0-: - :, ::,, V ~ ~ ~f -u - 1___ 4000400 04003404s4 446'4 EEIA0EO COST saia a1 lim en coia de-: 1ots 0o>n 44m40 rarjtas 1~ 1~40440000~~d.4 0010044 44.4 40. 4~7 14 C'0 0 40 ESAE rLOO -AQ IN COSE SI1E 1 EFO -AIAO ~41 .io :s 404011E FOL00' CONTADORAS NATO oA 1041400 0o~~~~04 e D.T ~tnir ' ~a~04 0a'44 -4k 5444540.4 044' ,0 j- f~e.i ~ ,41.,'00. 00s4 C0 ~ 04~ 10 4* r o~. =.0, 40 0> 44 ..004.04 .oo 0 Cos P-os 05.'5 1. '41-'4 744444 "Lo -rltoeo a -14440, -,l boliim isno aL t FUMIG0404001A0400 4400004 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~~~~~,, 00004 1 ARHIO ME A11 LIC dos Emelcs y ,Mdr --oSalots ma40 1lo 4004 4o ooo ilo e oso>oo 00 o* D,,.* I4 004 000-704 ,l,__ _ _ 4040 0 4 0 0 44 4 "0 4 4 4 4 4440.04 Va a .Isam s In sro 0~ "1' -004404er,-'~ 1 -2" ~ d . M. --o MAQUINARIAS ~"~ ~ .,' -,o ,t;c~ -~0 44,4 0.4oo04oo 000 mach d e 0~l' d, MUEAOEer&ySrey0 DIER GAS 7< y oso 000M .W-1 40,i 4. 000444040440 ..oooo ,,.>>544 .1 -. any, In. A-* a 33L Telfon Sor ;ao en Lua Oiott4d_ ,1, m a ~ 9,2: .0000 -4 0 5044 ,.),l ~~0 .l -, .~' '0100 JUG CURT MO>. seois lires sila gi_~ 'S ARNE VALED MASOR SI - 'o y' ~ cls do. objeto -1,~go MARIA COOMINAa "~b ul o> oeo*s ni r, ~ -oos W. 300 -l, ,~ 0~0-I,, .00040 44 0>00 1~ 1 1. 44 00400414 Calzada 1 js> 2.1la-oSorgo. Ooant400U.>Vi cmx4,lipoiB mr-nl,-co-000-1>2 ~~~ oo 444440, 0 440. 004 410 Mot 20 0>44 ~ocon '> 4 .t 0"" 4044.0 7.00,<. ~ ~010~~1.--o1l. ..1 ~111 --___ __ -------C-215~0 SA LE DE BO EG Y CA ~ ',,,1~>0 Y. 444. 5040 ~o. mcn~S ordo 50010 "1004 mo1 .o .o.44 t-.o0 DI.00 00Ur ~t-1 SE A C', s 0 -004, 400000 1O4~0 444Oa .4044o valo, , ji, .~ .l!. d. a del ospIros eSol t $ 0 I00004 al 5 oo400o04 .oooooo4oto~ 140044440440~ .0 DINER ~1,1~0cO06*44"~ 0444 ~~,, : 15 -0>~4404 ,t l~ ~ ~, LE0 0'04 44444400' .1.33. 400 1 oloc Is mej.' Lo o t-;a 4cot ,. Telcn r~70 00 ,0>0 0. a59o~1ooo.!., ,.4 , .;Q I CA L R S G ~ I, .O 1,0,0' ', -~ 0. -40>44 ,4004404.0 ; ,4014 co edr 0i14'eo ~4 000 000 440 0 444'00 10.40 14 ~~ c .25,,t.e-1. ola do. -sop.r,,I.040452.2 o . _0 04004000 l94~z 44 044440000 400 000440 ~00 ,0 4 00 0 t00400 CAJA '10004000 >00440.05 DEZAS,< , ,,1n~~ '144 ~ ~ 1 14'4,04 50004 4040 .44 1 4000 ~ 00 400 1 <.o o 'dd ~~ baj prdi de CO.oomoon. 000.000-00400 0*044000044000444440, 04 00c, ¡4444044000 A yO0 44ood tl 'd 1~ p ~44 44 loto -1. ~40000040004040 0S ~ 0404 404_t oSSCISSEJoIJCI 004 0,. C4mpaono 44 so4l4400 "L Pt L -4 401,1V.040. ooo. tr< Vaal" '~ 0 00 0 0 1 ,4 40, ,000 0* ,> ,.4,0 EL, 4 0 0 4 0 0do.1o 0 0 A l0040 .0 . M .~ ~ 1,1l, ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 00440 l0 104 440 004 -4 40 ______ C__11 ,__________ l._,1te 1t ._ ih_ -,,J1,4.7'510 1,1_ __ _ __ _ 000. 1400 'Solpo 20,0 04 0 4 00440.000000040 ,1, ,, 1 __________.,: ___:UA, ~ l ,001, O JE4S E4ATE004401 1 ..4 4--0 -10 -44 1 -41 .~ -U d,1,o~4.""l0 0400.b 4000001. 4>is, o ,.501,41. 44 0 0 0 '. 0 7 Co' 4L 2 5Se1 c~~400~04 0r, n4. 440 000 S.,00 .0 4 .1330.c -e00 4 > 4 0 4 > 004, "". ,d"

PAGE 31

SAO MXVI DIARIO DE LA MARINA.MARTES, 201 DE SEFI DE 1949 PGIA TREINTA" Y UNO, ENSEANZAS ALQUILERES ALQUILERES AL Q UILER ES ,AL QUILERE S ¡ALQ OUTILERES iALQnUILE ES SF51,,ESOL()IiTAN1ii 77 ACADEMIAS ~ -Wy'i 72 BO ,E 82~ APRA-T4 42 i --1 APRTAMENTOS P1 ItrPCIN, !ni BO"jESlif 1, iKAS ,5 tOl;YANO s4 HY I591.U20IDES VAStAS EMERSON COLLIt HO0TEL ROMA" 4"'" <'! 2444 -1244~4 ,,,,, ~~ CAA ,AS~SIEI8IAI>AS ,,, 1 1 1 ,,, 1, P R A R T T U i 5.5',, ,11 > ,' , ', "4, ,,o' '< ~ < ''' ~ ~ -84 LA~O r 1 ,n F ME I ~~ ~ ~ ,,-~ RSDA a<"',, """5'r,, ~,, .,, 0-. l,;s -,,,~~ 1 ,17,-,1,, , 0 2 ? T a" '",!,!"',1:i' TROTCHA, I7 4 rt j ',"4"4., s<'" -_< ,:, ,1;~ ,' ,,^' 1 ,i 5 11 4c',, 5., ca"' Frsa baiaons rds PAT TLSNETE A " ,*< 5', ,'" ass "' 1 .'""'f'" 5 5"" t -,1 s, ,,,~ ~ ,s "4n ,,s c 11~ -, 5a5i5,4 ,-'e -,'-e ser , "< ,.,,, 1 1,, ', ;E: 1r 1zla, ,. I, -a-,',esPr, soanen' .ss~ece ~5,,,r~osee^ 1 1, 1 1 1._ 1,_ -a frfilI I 1 nanne -a Cliid Y d. -39, ~, -,, ___' ~ ,__ .A 1 ..___, __," 1 -" ,,1, :' ,:" ,_ _"~, ,Ail5SA,, z 1~ ~ ~ n'ree medrna "d"'' 4.5. -1. ¡.,A ,,, ,11 ".'5 e~esa.<--ed.irisesPrecies acionse rodaAPsMS. SIamEIApse.taaser.e,,e-o~nada1 _11_,1,_._1 ,_w__, ten 55ortasa"ssd Ved-ede ~,<5 .ae . 5 'rS ~___________ l___-___________ bo~la y Medie, Porc 'bi . '5> =1.J',,1 11 ~. ~~ -w^o sli i-i cm s, <"'5,i 5. 1, _,>< P lLNl 113 ,,E i 0-18_ <, .o.;> .<'51,1> 0~ 11 SE SO I I A ,< , 11, AC DE I P£.mNzv< zt. UIEc< A -w' -' 1 1 S1 .' -ii-1. -1~ ~ -i< -a'<<< 5 <,<5 ,o - -s' l5, *5'55 'i ~ -" < er, 554~ .,ra < 5 >i rr%1,,,i,, i, 4. 54 ,'ni ~1,r. a. z.' r."'.-. ,u". e. ~~ ,,a,'a .
,<'i<,-,, 11, --' .ice>,-<' <55> u, ,a r "" '-,", e, ,<,< ,<< -, <'. ases , ,'. ,, o', i, -bi'<,ed. "," I ~d~f r'5' = ,z,: L-_ ,AlPA LOAE __________ ,-, ~1,1' < ""' ---< -~ l-1 e', -, '' 55.55a,'ra'>.>> ,,,.a, ~ < -e ,a, < .ceo e '1 <,Y 2 1 ; o,>"<:, -,--e -,so e 'sus. 111:rmee .LILA I4 FA.LA ~~~ ~~5" siil C s a< 5 < -c li ,11 -1 "-ir __ _ _ _ _ < e <.5< 5~ ~' 1,,1~ 4 1 - '5'.1 ',r -< '"l acrre fi"erres", 'a'euis '. 1~'.'1 1 1 1- SERA -COCIN1R-S1< -> s -1111,1<11 INTERE GENERAL"! 1 1 i ls 1, 'un aru'i. ru> 555<. '<<- 111 1,, ,11O,' 4as m .50' ',1 on raee n~u au~i -n ~ .e.e cose r n e. 1 55 11 e 15 a -,1 n" 1 ,<5 i' L~odai d ,, 1 Osa s, ,s' rmear m55 -cu 1 ,,> a'5 ,,, ll'5 "c"5 ce o,, o. .a 1,rgO e~7 e .s ~s, ~ ~n ao su,5 L os Be sZiV -1 1 11 1 1 s'.'.,51 1 1 1e>. <'o As n d enr SS S -" 1 5" C e Lsr s > a a e raa ne brcuo cer-cas cae 1 ,, ,',_ sss --e> ces-" a, o',""" r5r <,O, ~ -> i -r< ." '" ~ <'<' ________________~______1 1 1----j 10 Aepisss 1,' '-rs ~. s,. rse 'ss a-or i" seda.11, Soit m'm5c' -s ~s' "~e >" 'r. 5'ees'55 ~ b s c, .l¡ r -.r ___ ,e da crads 2 ~tecesoas,1 1 <'cg, 1, ,]Y <"-a 55 1a 1,. -o 11-s-.> ar>ni 5 .~ ~ ~ ~ ~ __ _ _ _ ,'55 comd~r eeie s~ccA><"'<1 '1 11 ~ 1 """' ~.raiA~ A. e 1EFD cee~r.ie < '.<<'.>> ,' sie ersdoi "55a. -o1s ', ,______ sus ',, e. o me." . ,, ,, isee'aeenesrsee, ,ae a,1--ANEA LV EO C ____________ ~___________ ads Pued rc ~~ ~aa bu ~s e',. ' ce 1 "'1 .5 ~'.o'< <5. '1 ,5 ? it2 5 > "><'<' 7<4 is I' ,01 CHOFERES , -? 7',~~e a'c ss er ,u < i~ e s a ,< 1e sa a;ep >1 11~s os ss-ao ~~.~' r<'sir 44 '5 .s.)4.-4''.iirb'55 ~ ru-'5s"'r ,cero i.'5" 4si: -,',' -k .1 ce~s '1 HA AN ,, .' ~a'.a',,,, -: 1,' 5 ',12 OTERA OITS eifduep$ erepe ,ase4n ~tie5 srrnus ialo reC,tie edtaiidd ,Lrm< '^ ,' ,, .", .:~ a _M . ,j ~dw>. __ -.5,5 -o<5 -'~ ~ ga -e sca ~aeese m Mu. ~ ,,,,.,0,~~~ ~~ 1 t 1_ .1 ___ 1 .sp_ e1,_ ,__.s u-'o ar-o .a-ra b.~~s~. d ,," _ _ _ __ ~ -,--,--,--" ,l asas-2 e, ~ra.s' e ,aee Amceur, ,>~5 .sr>s trr"' ,rSi< 5-5;'< AS-P1AL --, ,>s-e< < 1rs,, >r l-, -, <4 5" ', Sb_ Solsalsa -,.aad> Esp. ..-asr ~~o. .7="b1 ea ra-. xs oass~sa e.< H-6-,, 3 ~,.uo AMPOS SUARE!, HDZ -< SO-CTA a ~ ~ ~. lor. 1 -_ <11 i Z,--,l.i saar.- M765 Prn s ps1r "ustn =.< 'aea -er. -ae ces ~s eas>-~ -., .l.s '.e'.e pu i.aA ss-se al"=^.>^ dial' .", rs a 'aa eas -ars --t S5.<0 ~ur sea rs ~~~LCTO AIS"0c e ,s~sisapes'nera$22iTspariad1s ,,, sesanlre J1.13.1,~, 1 1e-"~aie -'-1 MI5oa1pI ~ ~~ ~ ~ ~ ~ 1 ir is. f< es > os a 55 1 '.1 *l, >.
PAGE 32

SEPTIEMBRE 20 DE 1949 2330 nMIS ERI>. Boleo HAY1 Q U E4 sTU REPSARSM nI5 VDA. Lalar. 2U NO] DICA Dc. 444>4 4444U4T>. >4>5 r44 .44 44.R>r., i5>4 IAFIIDEWLAMIAI A_ __ El MPLAR-: ate P $ 0, fa >2 I0 Son Rafael d1h P' para aua ¡0,11 nra 1 d 'a qie es1'n eludos da fiman .-Acta elj d co0eeos Fran. ee, 4444~4> 44>44,444 ->4>4 W. C - -Quinta A 1 1 d 1,t" .~ d ~V i-i --m h. ves¡ a -.d -R,,I --, I >444>' 4>4>> 44a>44 >4>4 >4aria44 Razxs: ornato 4 -4 M4 .1 ;. 4. 1~~~0 1r n -Ala -> 4 > vn 4, -> 44'44 44>4>>444>4 >4 44>>4y 4> ->4 >44 r~ 4> ---4> 41 '4 4>4>44>444Q> 4444r>>4 -4 4".4'4>n>4 4>4 a 4>> -44> 4.4'.4>4' 44>444>44r4>4> >>> -----M'C4,4,444>4.4y,444>4> > 4 n> 4> 4>4>>>4>4>' ""' >~" >44a0 4 a>A ^ 44444 4,4>.'> 4>'>>4n44>>4,>4 '444 4,4 4>.'>'>'>'4>4 4 4> 4' c,4 >4' 4 '" >1414 za> 4a. 4 4 44 4>4 4 .~>.,>,d.>,>n>e:.'y:4444 4 U)raaf Ju 0ea -xJxweaug a ~44>> 444 4a>44. 4444>44444,~¡44 .4, >4> 4> 4 4> 44>4">4~ii?4>~ 4>444. 4,44> 4 4v4>44 >44 4', R&>*flaa q4> 4>4>4>rn'fr 1' <~,4 5' lya' 4 4444n414 >444144>" 4>> 4 >4>44444 >'>.4>444 .4 .,>>>>>>44 > > n 44 -P>4444444444>>44 4>4>4 44. 4>444444 4,4 4 < 4.">44>'4>444> 444.>'> 4>1444>>4 4~44 444> 444444>41>>4>4>4> >4 4444 >4>44 "' 1 1 1 A.t ; .G ARRETA Y 5> 44e4cdzy '>2 y 4>5 Tele M_3987. >">>> >44o 44 14 >44 4> 4.44 >444> t4 4> 4>4.' "y 444 >4.> 44444444 ~4 4444>>444414 >>4 44>4 1 4' 14>444> 4 44.4'>,,> 44"n 441>4d 4 > nai ,4>'>'4 4>' >44> i 44 >444 4 4>4 4444 >4'> SCENTAVoS 4' 4>414444 y ¡>4/>444 44>4 >4r444>444 3-44>4>l>4 4>44>" "4(/ "44> .>/444 xr44 > r4.> ci 44>4>. 44>44/444/4 4 ,.44d 4 d. /r4>44>' egfc 4d 4>4>d, 44/44>444/>. d444 4., 444 ~fP-1 -Y 1. 4 'DTS 4 4444444444444>44444 4 % 44444444>4,4444>>4' 44.4 44444>44" >,41.E4AC>'>/414>. >>4 a 4444444'., > 4>4>44>4 a ura€m!ilka 4> 4>4>4>4>44e 4r44 44 44n:4>q444>4ad444>m4>44>4>44 s uerda a >'r, >;44>4>4d4>44p'na qu> es4di444c4444nd4e e. m Unwe sydme a podeosa4>n4>n4 que ',4'a >'4rmac4n '4>.>4er 5ade e 0U.LTAasre, On I mySI mo askcint >41.44>f444 y> 4444>4 /454>>4414 C14>44>4>44> 54>1141 /44114 144d>4>4>4>4 e B, S. Horno Econn>mi Sti ri l p a l Ck o 1949.1950 Ce IOrra el de 28 do scoaimbre, 9 Se Cdtsama le e db Z lb" laxos. iostoo pn reyo 44.4>4.917> 513110 Illait en2H

PAGE 33

fUPLLEb1ENTO DiAIO EN ROTOGNAIIADO ACTLALItAD INTERNAC .ŠALJT £29 D 1949 AMI4.1$ADOk ACTUWALEDAD NACIcINA E EfTEMNAGZINAL Enelnsceaclebrado p., l-s MepreWn~tel 9~h oeToeca u fr rn pc d'¡ AtlAlmeo ~ta ape~e ~nirde P-r dcai ~umtadfmin seu unt-a Ra-muson y D. K."_'an d. Dnmaca _rndlCnd, VanEean ySilerruadeBlglca: PerMmn4 ~tcetr., ulad Etd rtme rcn t el srtri Ach-.in Belhn y rmrm, de insiatee De 11.Atl Y P-rCim Z, Lgo y Moygen ierm .N*rwge; Stkker y Van Kleflens, dEHu. y ,d L r, ; L-nb~ y TM .d. It* y ots rA. t. WM) y ~.d. d4., En ate de asects e d ceebrd a findeidlAConmotvode la firma de trtd -MerIa y d. amf.vad, ~enr tb S~~~~b~ 4.Z M, d. ug o,1 dy4yy P,4.t. 11.1nyy C,.y,1 r,2 W W, m~, Giy C be, el r dead Ra ~Ru ey adoctora 5,1 nr1 orsaisetAAladlcs a Mnsr de Etd ngen~.o H-vl, ~ado lectur al tex, jid., d C~Annm, sr~s vido vi~i pand., Mm-.t. Gr5. 3a .m6 Tr,!dl GE_. d y144 0 1t4 del C -junt. de CA.le C Ab b0, u e pr srtitd Pn cun an ha en!d desarollado .t. mrea i /

PAGE 34

iAlO D LA MAPiNA GRAFICAS DE LA C por ,LS A, d, dlh d.In tA IAlAld lAd E~ A. HA11y dbm y la ld H. e-j Teh~p.sEni E.t .1 Haa" ya$da lub Euad lee ene uana ti ernw~Mii teclsa~ la tenuedea y V~eo, yuu aPA P&rW CdIe1IA y dmle HAdAA YAAl d.a fle.= SHer-im .d"nt de C dte yeVrn yAtM 11r AlA El ActAA LLAIcA lladrsl AApAAn deLA bj deAA ClA AYAYora A Y e LArAA IIA 'cAA LlAm y AYLA AlA. 1 [1 L 0L 5 PELO .1lvz se p¡.~a que I. da grae idao m. darl. -Pille e1 d11 quAurdA -~ta lulr bln, pue l!, AA A R-M A, jip~tA .lt" pe yset eehae Amoe. prdia. mpJm me m re, r dlr a un homb" ¡Ue e cela mecbe. l rmar manuismeun mzcladadoa deamm n I 'F1~E CABADO CAS QUMPRLI dnmeta DilYdYd A AYit ALnrY A AlLAAn. A GAYAAyA ltA E-AA teA A: AAuY ~ yriCAzAaL IlE YAA 'YYALAA-Ll< jA1 YYAAAA yL YL 'Y'Y>1< YY En la igei e santa PiLa 0e dU.P*Wro Ana. eeretttA dA glAw u plaYAr, la AIAYrAA 3 VIllaln y el dCauir Javier Palil y G .u.D et -YALA rprAouIAoA trea fato~AAY. A la A:tq d LAndtAt LA -rra e ~r lA del RVdo. Padre HAlA JAtYIA GLela Bro d. J.A*S. Al YAtrA lA ",vla, .l dottr Jtan Manuel menomAL Bar~rPA, y a la dere blindo La feI~IA I 4. A tA, llAltt xonAlAI ]u nh e er y e 4 3

PAGE 35

U LA A§ 4nL RONICA IaINERA DE POSA£¡ Tabne 1e a UaaYah lub M*z, E'red K\ ¡\ ~N 1 n n al"nra lanvaredlJn al bur ddl rt RortoHbmn yacht C, a~etr r~e meb jc4.nw d .1 Trm wen l d--tor JT sM-11lRme' y am -o P-y d y~r.n se de ns ca die: cua ilet ga Nicome .y su lg .W¢rderasta el hedW del sbado en et t Habana Yacht ESE GITIS Q T21sD2A IGTED 1/22A :733",0 2 LO3 057 3

PAGE 36

ry p-r dl DIARIO. au4er en i, cda oc ms m groienci y lae oeehc naoojtv c 4b tAC t L C J1.&o Jo o Ho ecne pr, casau bl 'P.nc de t ,etr, senmCcico y un-ior ioehnd oa e profundas ~ ~ ~ ~ ~ pe ele nd, ascsubwscbns goisol e ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ne des ineeatsoonsd ;n idmic seem, Rata EuceenetSegu de ida ste, esa z