Citation
Characterization of plasmepsin 9 from the malaria parasite Plasmodium falciparum

Material Information

Title:
Characterization of plasmepsin 9 from the malaria parasite Plasmodium falciparum
Creator:
Garuz, Jeyko
Publication Date:
Language:
English

Subjects

Subjects / Keywords:
Enzymes ( jstor )
Erythrocytes ( jstor )
Gels ( jstor )
Hemoglobins ( jstor )
Inclusion bodies ( jstor )
Insecticides ( jstor )
Life cycle ( jstor )
Malaria ( jstor )
Merozoites ( jstor )
Parasites ( jstor )
Aspartic proteinases
Malaria
Malaria--Immunological aspects
Genre:
Undergraduate Honors Thesis

Notes

Abstract:
Malaria is still a devastating global problem. Each year Malaria affects 350-500 million people and causes 1 million deaths. Malaria in humans is caused by any of four intraerythrocytic protozoa, Plasmodium malariae, P. ovale, P. vivax, and P. falciparum. The genome sequencing project of P. falciparum has revealed ten aspartic protease genes. Four of these genes code for digestive vacuole plasmepsins: PfPM1, PfPM2, PfPM4 and a histidine aspartic protease (HAP). The plasmepsins and HAP are proteins responsible for degradation of host cell hemoglobin and are found active in the parasite’s digestive vacuole. They were thought to be vital for the completion of the parasite’s life cycle and are not found naturally in humans. Recent gene knockout studied have shown that these plasmpesin are not essential for the completion of the Plasmodium like cycle. Aspartic protease inhibitors used on these knockouts do effectively kill the cells which suggest another protease that is vital to Plasmodium life cycle. Plasmepsin 5, 9, and 10 are found inside an infected red blood cell and could be a novel drug target against malaria. These proteins are aspartic proteinases, a group of bilobal enzymes, which have a deep active-site cleft containing two aspartic acid residues, necessary for catalytic activity. Side chains of the two aspartic acid residues hold activated water, which acts as a nucleophile to cleave the peptide bond in hemoglobin, the scissile bond. This sequence of events causes the degradation of hemoglobin. Introduction of an inhibitor to this active site would prevent the cleavage of the scissile bond in hemoglobin. This project will focus on improving the expression of plasmepsin 9. This would allow for kinetic and crystallographic studies that can be used to determine the specificity of substrate and inhibitor. The understanding of these specificities will guide the development for improving inhibitors and designing new anti-malaria drugs. ( en )
General Note:
Awarded Bachelor of Science; Graduated May 4, 2010 magna cum laude. Major: Microbiology and Cell Science
General Note:
Advisor(s): Dr. Ben M. Dunn
General Note:
College/School: College of Liberal Arts and Sciences

Record Information

Source Institution:
University of Florida
Rights Management:
Copyright Jeyko Garuz. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

Char acterization of plasmepsin 9 from the malaria parasite Plasmodium falciparum Jeyko Garuz

PAGE 2

Abstract Malaria is still a devastating global problem. Each year Malaria affects 350 500 million people and causes 1 million deaths. Malaria in humans is caused by any of four intraerythrocytic protozoa, Plasmodium malariae, P. ovale, P. vivax and P. falciparum The genome sequencing project of P. falciparum has revealed ten aspartic protease genes. Four of these genes code for digestive vacuole plasmepsins: PfPM1, PfPM2, PfPM4 and a histidine aspartic protease (HAP). The plasmepsins and HAP are proteins responsib le for degradation of humans. Recent gene knockout studied have show n that these plasmpesin are not essential for the completion of the Plasmodium like cycle. Aspartic protease inhibitors used on these knockouts do effectively kill the cells which suggest another protease that is vital to Plasmodium life cycle. Plasmepsin 5, 9, and 10 are found inside an infected red blood cell and could be a novel drug target against malaria. These proteins are aspartic proteinases, a group of bilobal enzymes which have a deep active site cleft containing two aspartic acid residues, nece ssary for catalytic activity. Side chains of the two aspartic acid residues hold activated water, which acts as a nucleophile to cleave the peptide bond in hemoglobin, the scissile bond. This sequence of events causes the degradation of hemoglobin. Introdu ction of an inhibitor to this active site would prevent the cleavage of the scissile bond in hemoglobin. This project will focus on improving the expression of plasmepsin 9. This would allow for kinetic and crystallographic studies that can be used to determine the specificity of substrate and inhibitor. The understanding of these specificities will guide the development for improving inhibitors and designing new anti malaria drugs.

PAGE 3

Introduction History of Malaria believed the disease was caused by tainted vapors from marshes or swamps (1, 2). The symptoms of malaria were described thousands of years before the Romans in ancient Chinese medical book, the Nei Ching, which translates to The Canon of Medicine. Edited by Emperor began to suspect a bacteria as the cause of Malaria. The actual cause of Malaria was not discovered until 1880 by Charles Louis Aphonse Laveran. Laveran was professor of military diseases and an army doctor. He was stationed in Algeria in 1878, a French territory at the time, where he studied the lesions of in organs and blood from different patients suffering from Malaria. Although some patients experienced different levels of malaria, from severe to chronic, Laveran discovered granules of black pigment in the blood was a constant component in all malaria cases. In 1 880 Laveran observed the exflagellation of a male gametocyte, this phase usually occurs in the stomach of the Anopheles mosquito. This convinced Laveran that malaria was caused by a protozoan (4). In 1881 Carlos Finlay, a Cuban doctor, hypothesized mosqui toes could transmit yellow fever and malaria. A year later Albert King, a physician from Washington D.C., proposed 19 reasons why mosquitoes were vectors for malaria. Neither Finley nor King had experimental evidence for their hypotheses (5). It was not un til 1897 when Sir Ronald Ross dissected the stomach of an anopheline mosquito, which fed on a patient suffering from malaria four days earlier, and found the malaria parasite. This showed evidence that mosquitoes played a role in malaria transmission. Sir Ross went on to use bird models with bird malaria to demonstrate that the parasite developed in the mosquitoes and migrated to the insects salivary glands, allowing the mosquito to infect a bird with another blood meal (6). Only a year later a team of Ital ian investigators, led by Giovanni Batista Grassi, fed anopheles claviger to patients inflicted with malaria. Their investigation led to the understanding of the complete sporogonic cycles of the Protozoan organisms, which caused malaria: Plasmodium falcip arum P. vivax and P. malariae (3). The earliest account of a remedy that would be used against malaria dates back to second century BC in China. The Qunghao plant, or Artemisia annua L, was recorded in the dui han Dynasty Tombs. Ge Hong Hong of the East Yin Dynasty was the first do describe the antimalaria properties that Qunghao plant. This plant would be called annual or sweet wormwood in the United States. It was not until 1971

PAGE 4

that the active ingredient of the Qinghao was isolated by Tu youyou working on a research program headed by the Chinese army (7). The active ingredient would be called Aremisinin and through metabolic pathways it produces free radicals which destroy and destabilize Plasmodium falcip arum but does not harm red blood cells (8). Another antimalaria derivative, quinine, was discovered in the early 17 th century. Spanish Jusuit missionaries learned from Indian tribes that the use the Cinchona bark had antimalaria properties. Resochin, whi ch would later be called quinine, was isolated and named in 1820 by French pharmacist, Joseph Bienamine Caverntou and Joseph Pelletier (9). Quinine concentrates in red blood cells and is toxic to Plasmodium parasites by interfering with their protein and g lucose production. Patients that use quinine can have a relapse of malaria because the parasite may not be completely killed outside the bloodstream (10). The widespread use of t strains, reduction of the cinchona plant, and the need to protect troops from malaria during World War II pressured the synthesis of quinine derivative: chloroquine, primaquine, proguanil, amodiaquine, and solfadoxine/pyromethamine. Developed in 1934 by Hans Andersag in Germany, chloroquine did not become important until WWII. Chloroquine became the leading drug against malaria until resistance emerged just ten to twelve years after its use (9). Clinical relevant resistant strains of Plasmodium to artemis inin have not been reported although labs have been able to created stable resistant strains (11). The Need for novel drugs against malaria increases as the potential for resistant strains continues to amplify. The construction of the Panama Canal marke in the fight against malaria. The Panama Canal extends across the Isthmus of Panama from South East to North West. The Isthmus of Panama is a model environment for mosquito breeding and proliferation. Increase in the malaria vector would eventually lead to an increase of people becoming infected with malaria and yellow fever. Drs. Gorgas, LePrince, and Darling were responsible for the implementation of the malaria program that reduced malaria infections and eventu ally lead to the timely completion of the Panama Canal. The program consisted of draining all pools within proximity of living areas, cutting of brush and grass, oiling and larviciding ponds and swamps, screening all government buildings, and most importa ntly a prophylactic quinine dose was given to the work force responsible for the construction of the Panama canal. Hospitalization due to malaria dropped dramatically because of the malaria program. In particular the percentage of workers hospitalized due to malaria decreased from 9.8% in 1905 to 1.6% in 1909. The malaria program from 1905 to 1910 eradicated yellow fever and radically reduced malaria deaths (12). The control of malaria in the United States began in 1914 by Henry Rose Carter and Rudolph H von Exdolf of the U.S. Public Health Service. In 1933 the Tennessee Valley Authority

PAGE 5

(TVA) was created to direct the potential for hydroelectric power and improve the waterways and land in order to build up the region. Thirty percent of the population wa s affected in this region when the TVA took control. With the help of the U.S. Public Health Service research and control operation led to the elimination of malaria by 1947 in this region (3). The U.S. Public Health Service created an agency in Atlanta o n July 1, 1946 called the Communicable Disease Center which stemmed from Malaria Control in War Areas. The name of this agency is now the Centers for Disease Control and Prevention (CDC) and created the National Malaria Eradication Program in 1947. While t he focus of the CDC was to eradicate malaria in this time, it adjusted its focal point to prevention, surveillance, and support nationally and globally ever since the eradication of malaria in the United States in 1950 (13). Global Implications Although malaria has been eradicated in the United States there is still an average of 1500 cases a year due to people visiting other countries and not taking the proper precautions to prevent an infection. The mosquito responsible for the malaria transmis sion in the United States, Anopheles quadrimaculatus and A. freeborin are still prevalent and causes a risk of reintroduction of malaria into the United States. Sixty three outbreaks have occurred in the United States since 1957 (14). There are currently m ore than 3 billion people at risk of getting malaria, 190 311 million clinical cases were estimated in 2008 with over one million resulting in death, according to the World Health Organization. Malaria is the 5 th leading cause of deaths by any infectious disease worldwide, 89% of which occur in Africa and affects more children under 5 years of age than any other age group (14, 15).

PAGE 6

Figure 1. Global incidence of malaria per 1000 population in 2006. Highest incidence rates occur in sub Saharan Africa. Figure from World health Organization, World Malaria Report 2008, pg. 33 Malaria is transmitted in tropical and subtropical areas where the humidity, temperature, and rainfall are just right for the An opheles mosquitoes to survive and reproduce. The malaria parasites also need specific climate factors in order for it to complete its growth cycle in the mosquito. Different malaria parasites may have different climate factors in which they can survive. Plasmodium falciparum the most deadly of all malaria causing parasites, cannot survive in temperatures below 68 o F, while P. vivax is more tolerant to lower temperatures (16). These ecological conditions coupled with socio economical circumstances can make it difficult for a region to control malaria transmission. Areas such as sub Saharan African and parts of Asia which have this combination show greater levels of malaria infections than other parts of the world. A country affected by malaria will have negative socio economical effects caused by this disease. It has been projected that a country facing a malaria endemic will have a 2% less rise in their gross national income when compared to a similar country without a malaria problem (17). Malaria like any other disease can prevent a population from working or attending school. In severe cases cerebral malaria can damage physical and neurological development (18). Like many of the countries faced with a malaria country they also have to deal with other diseases such as AIDS and malnutrition. These problems may cause severe health difficulties which may

PAGE 7

last many decades. This problem increases the necessity for cheaper, more accessible drugs to prevent the outbreak of malaria and end the hardships that m any regions are facing Malaria Prevention and Treatment Prevention of malaria transmission and control of infection are indispensible components in the battle against malaria. Malaria prevention focuses on decreasing the number of mosquito blood meals o n the human population, administering prophylactic anti malaria medication, and vaccinating against the malaria parasite. Although great accomplishments have been achieved by the first two prevention methods, creating a malaria vaccine has yet to be attain ed because of the lack of funding in that area of research, the lack of developers, and the complexity in the development of an anti parasitic vaccine. Complexity is a major problem which occurs because of the large genome the malaria parasites have. Creat ing vaccines for viruses is much normal because an average virus has 10 100 genes while the average Plasmodium parasite has about 5000 genes. The parasite is very good at evading the immune system by traveling from the mosquito to the human blood stream and to the liver, making it difficult to design an effective vaccine. It is still not completely known how the immune system responses to rid the body of the malaria parasite and this need to be taken into consideration when developing a vaccine. Even thou gh a malaria vaccine faces many obstacles there are groups such as PATH Malaria Vaccine Initiative that acknowledges the importance and need for a malaria vaccine and has made it their goal to develop a malaria vaccine with 50% effective protection by 2015 By the year 2025 they hope to increase the effectiveness to 80% and provide protection for four years (19). Currently a malaria candidate vaccine, RTS,S/AS01, is undergoing testing and development (20). This vaccine is being design for children and would not be administer to adults because it has been shown that immunity against malaria builds up at an early life over time after frequent encounters with different malaria parasites (21). Prevention measures that are currently in effect include eliminating the malaria vector, the Anopheles mosquito. Controlling the population of the Anopheles mosquito has been done by larviciding and indoor insecticide spraying. Larviciding is the use of chemicals on breading grounds, in this case standing bodies of water where mosquitoes reproduce, to reduce the mosquito larva population. This is only used when vectors show the pattern of breeding in permanent or semi permanent water bodies that can be identified and treated (22). Larviciding can include the use of oils o ver waters, preventing the larva from getting enough oxygen. Another form of larviciding is the use of insect feeding fish. Microbial larvicides have been shown to be extremely effective. One study conducted in Kenya showed a 95% reduction of

PAGE 8

Anopheles la rva and 92% reduction in human bites by Anopheles mosquito (23). Larviciding would be the ideal form of eliminating the malaria vector but what makes it difficult is finding and treating all the breading sites, these bodies of water are scattered, small, a nd often temporary. Insecticide spraying focuses on killing the adult mosquito population. The most effective insecticide, dichlorodiphenyltrichloroethane (DDT), has been widely used to control the population of Anopheles mosquito because it is inexpensiv e, long lasting, and proficient at killing the mosquito. Much of the world has banned the use of DDT because of its adverse affects on the environment. South Africa banned DDT in 1996 and replaced it with other, more environmentally friendly pesticides. Th e mosquitoes soon became tolerant to the new pesticides and the malaria rates rose by 1000% (24). This increase in malaria forced South Africa to reintroduce DDT as its primary insecticide against the malaria vector. Since the reintroduction of DDT malaria rates have decreased and continue to do so. Preventing the Anopheles mosquito from taking human blood meals has been broadly accomplished with the use insecticide treated material. The most commonly used is the insecticide treated mosquito nets (ITNs), which have been shown to reduce mortality rates caused by mosquito transmitted disease by 20% (25). The nets are used while sleeping to prevent a mosquito bite. They do this effectively only when treated with insecticide. Untreated nets are not recommended because mosquitoes can still feed through the net and even a small whole can allow mosquitoes to get through. When treated the nets can repel and even kill mosquitoes. If enough people use these nets the population of mosquitoes can actually go down and e ven people without nets would be protected. Only pyrethroid insecticides are used on ITNs because of the minimal health risk on humans and mammals. The pyrethroid insecticide does not break down unless washed or exposed to sunlight. Long lasting insecticid e treated nets are already being created to minimize the breakdown of insecticides on these nets (26). Another problem these ITNs face is an increase in vector resistance to the pyrethroid insecticide (27). Prevention is essential for the control of malar ia but there are still 300 million becoming infected with over a million resulting in death. Malaria treatment is equally important as prevention and current drugs include: artmesinin, quinine, chloroquine, melfoquine, atovaquone proguanil, sulfadoxine pyr imethamine, and doxycycline. Chloroquine, the once most effective drug again P. falciparum is now mostly useless against this parasite because of the emergence of resistance against the drug. When chloroquine began to fail sulfadoxine pyrimethamine was i ntroduce and in a shirt time resistance to that drug was seen as well. Now it is recommended to take artemisinin based combination therapies (ACTs). Although ACTs show promising results in the elimination of malaria from a patient its implementation in som e

PAGE 9

parts of the world have lagged behind because of it relatively high cost (28). Although compounds such as quinine and artemisinin were discovered so long ago the mechanism in which these compounds and their derivatives work is still not completely unders tood (29). Malaria Life Cycle The malaria parasites belong to the genus Plasmodium which contains hundreds of species that can infect mammals, birds, and reptiles. There are only four species that cause malaria in humans which are: P. falciparum P. vi vax P. ovale and P. malariae The entire life span of these four species is spent in its insect vector or a human host. The insect vector is a female from the insect genus Anopheles Only the female can infect human with the malaria parasite because the males do not have the mouthparts to be able to penetrate human skin and thus they feed solely on plant juices (30). There are three phases to the life cycle of the malaria parasite: the sporogonic phase which occurs in the mosquito, the exoerythrocytic s chizogonic phase which occurs in the human liver, and finally the erythrocytic phase. An important aspect to note in the life cycle is the alternation of sexual and asexual phases in the parasites hosts. The asexual phase of the parasite is called schizogo ny and occurs in the human host, while the sexual phase is called gamogony and occurs only in the mosquito host. Another asexual phase occurs this time in the mosquito and is called sporogony. The infective form of the parasite is called the sporozoite (31 ). During a mosquito blood meal the sporozoite, which is located in the saliva of the mosquito, can be transferred to a human under the epidermis and into the bloodstream. After about an hour of primary inoculation, the sporozoite disappears from circula tion only to appear 24 48 hours later in the parenchymal cells of the liver, starting the exoerythrocytic phase. It is not completely understood how the sporozoite targets hepatocytes but it is known that the surface coat of the sporozoite, called the cicu msporozoite coat, is recognized by receptors on the hepatocytes (31). Inside the hepatocytes the sporozoite develops into a tropozoite and consumes the host cytoplasm through a micropore. Depending on the species of Plasmodium within 1 2 weeks the tropozoite undergoes enough fission cycles to produce thousands of merozoites. As the merozoite grows in number they eventually rupture the host cell and are released into the bloodstream (31, 32).

PAGE 10

The merozoites enter erythrocyte through a series of step s. The merozoite first attaches to specific erythrocytic receptors. The merozoite arranges itself so that its apical end is touching create a junction allowing t he merozoite to enter the erythrocyte (33). This invasion is determined by the specificity of the antigen present on the red blood cell. Merozoite invasion in P. vivax P viva x These antigens do not affect the other malaria species and thus resistance is harder to obtain in a human population to these other species of malaria parasite (31). The entry of the merozoite into a red blood cell initiates the erythrocytic phase. The merozoite grows into a ring trophozoite, undergoing another round of fission to produce a new generation of merozoites within each infected red blood cell. The red blood cell ruptures releasing hemozin and glucose phosphates isomares. These toxins stimulat e the production of cytokine and other factors. Cytokine production is the reason why symptoms are seen during the erythrocytic phase. These merozoites can again infect new erythrocytes and repeat the process or become gametocytes. The path the new merozoi te chooses, either schizogony or developing into a male microgametocyte or female macrogametocyte, is still unknown. Merozoites that turn into gametes are unable to mature in the human host. It is only when a female Anopheles mosquito takes a blood meal fr om a person containing these gametes can the gametes mature. The gametes are ingested into the stomach of the mosquito where the red blood cell is lysed while the gametes are unaffected by the digestive juices. In mes mature into male microgametes and females macrogametes. The microgamete penetrates a membrane derived fertilization cone that the macrogamete has formed. The male and female pronuclei fuse to produce a diploid zygote. After 12 24 hours the zygote elong ates into a motile ookinete. The ookinete penetrates the gut Within the oocyst, haploid cells called sporoblast proliferate. The sporoblast nuclei divid produci ng thousand sof sporozoites enclosed in a sporoblast membrane. Continued division eventually causes the membrane to rupture and sporozoites to enter the oocyst. It takes 10 24 days for the oocyst itself to rupture; releasing sporozoite into the hemocoel wh ere they are carried to the salivary gland ducts and are capable of infecting another person (31).

PAGE 11

Figure 2 Depiction for the life cycle of the malaria parasites that infect humans. Figure from CDC website infecting humans there are minor differences that need consideration. P. ovale and P. vivax can persist in a dormant stage in the liver. The parasite can develop into a hy pozoite, keeping its human host asymptomatic for years. All, with the exception of P. malariae which has a quartan or 72 hours erythrocytic cycle, have a tertian or 48 hour erythrocytic cycle. The minor differences in life cycle can make it harder to creat e anti malaria drugs which can be used against all malaria causing parasites (31). Malaria Parasite Aspartic Proteases With the rise of are in need that target the early stages of de velopment and effectively reduces the number of malaria infection in the most prevalent regions. The focus has turned to P. falciparum because it is the most deadly species of the four that cause malaria to humans. Much attention has

PAGE 12

been given to the process f hemoglobin degradation which is not only an essential step for the completion of the parasites life cycle but also an early step, making it a suitable target for new antimalaria drugs. The hemoglobin destruction by the parasite is accomplished by several proteases including aspartic proteases, metalloproteinases, and cysteine proteases (34). These proteases have already been considered as appropriate targets for novel antimalaria drugs. The genome sequencing project of P. falci parum has revealed ten aspartic protease genes (35) Four of these genes code for digestive vacuole plasmepsins: PfPM1, PfPM2, PfPM4 and a histidine aspartic protease (HAP). The plasmepsins and HAP are proteins responsible for degradation of host cell hemo globin These proteins are aspartic proteinases, a group of bilobal enzymes which have a deep active site cleft containing two aspartic acid residues, necessary for catalytic activity (36) Side chains of the two aspartic acid residues hold activated wate r, which acts as a nucleophile to cleave the peptide bond in hemoglobin, the scissile bond (37) This sequence of events causes the degradation of hemoglobin. Introduction of an inhibitor to this active site would prevent the cleavage of the scissile bond in hemoglobin. Plasmepsin 1, 2, 4 and HAP were thought to be life cycle and are not found naturally in humans. Recent gene knockout studied have shown that these plasmpesin are not essential for the completio n of the Plasmodium life cycle (36, 37). Aspartic protease inhibitors used on these knockouts do effectively kill the cells which suggest another protease that is vital to Plasmodium life cycle is involved. Plasmepsin 6, 7, and 8 are expressed within the s porogonic cycle in the mosquito which makes these plasmepsin unsuitable as drug target. Plasmepsin 5, 9, and 10 are found inside an infected red blood cell and could be a novel drug target against malaria. Plasmpesin 10 shares sequence homology with Plasm epsin 1, 2, and 4 but plasmepsin 5 and 9 have very little homology (40). With extensive research not covering plasmepsin 5, 9, and 10 this study hopes to it as a drug target against the malaria parasite. With plasmepsin 9 already being sequenced and expressed in small quantities we hope to increase the yield of the production of plasmepsin 9 in a recombinant system by optimizing its codons to fit our expression ve ctor. By improving the expression of plasmepsin 9 in E. coli cells we can continue by conduction kinetic experiments and purify the protein for x ray crystallography. The improvements created by this project will begin the process of understanding plasmeps in 9 in order to use it as a drug target against malaria.

PAGE 13

Methods Site Directed Mutagenesis The Quick Change Site Directed Mutagenesis Kit (Stratagen) was used to mutate a methionine ATG, into a leucine TTA. The mutation was created by using primers that are complimentary to the coding and the non coding strands of DNA. The reaction was prepared by combining 5 50 ng of plasmid, 5uL of 10X reaction buffer, 125 ng of each upper and low er primer, 400 ng dNTPs, 1 L of Pfu Turbo DNA polymerase (2.5 U/ L), and water to increase the final volume of the reaction to 50 L. The PCR reaction began with heating the mixture to 95 o C for 30 sec. The reaction was then cycled 16 times by the followi ng procedure: a melting step at 95 o C for 30 sec followed by an annealing step at 55 o C for 1 min, and extension at 68 o C for 5 min (1 min/kb of plasmid length). At the end of the procedure, the reaction temperature was dropped to 4 o C. One uL of the restricti on enzyme DpnI (10 U/ L) was added to the PCR reaction and incubated at 37 o C for 1 hr to remove the original template DNA. At the end of the incubation, 5 L of each reaction and 2 L (10 ng) of pWhitescript 4.5 kb control plasmid (5 ng/ L) was used to tra nsform XL1 Blue supercompetent cells. Transformation of XL1 Blue Supercompetent Cells One milliliter of thawed XL1 Blue supercompetent cells was aliquoted to 50 L to 8 prechilled 14 mL BD Falcon polypropylene round bottom tube. One microliter of Dpn I treated DNA from each control and sample reaction to separate aliquots of the supercompetent cells. An optional control was done to verify the transformation efficiency of the XL1 Blue cells by adding 1 L of the pUC18 control plasmid (0.1 ng/ L) to a 50 L aliquot of the supercompetent cells. The transformation reactions were swirled gently to mix and incubated on ice for 30 sec. The transformation reactions were then heat pulsed for 45 sec at 42 o C and then placed on ice for 2 min. Half a milliliter of S OC (2.0% Tryptone, 0.5% Yeast Extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl 2 and 20 mM glucose, pH 7) media was preheated to 42 o C and added to each transformation reaction. The reactions were incubated for 37 o C for 1 hour with shaking at 250 rpm. The agar plates for color screening were prepared by adding 80 g/mL of X gal (5 bromo 4 chloro 3 indolyl D galactopyranoside), and 20 mM IPTG (isopropyl 1 thio D galactopyranoside) on premade LB plates with ampici llin. The appropriate volume of transformation reactions were spread on these plates: 250 control, 250 Plates were incubated at 37 o C for 3 days. Colo nies were picked and used to inoculate LB media

PAGE 14

with ampicillin (50 g/mL). Media was incubated at 37 o C overnight (16 18 hr) with shaking at 250 rpm. Fifty milliliters of each overnight was used for plasmid DNA purification. Plasmid DNA Purification Plasmid DNA purification was done using QIAprep miniprep kit and a microcentrifuge. Fifty millimeters of overnight was centrifuged for 12 min. Supernatant was aspirated and pellet was resuspended in 2.25 mL of P1 buffer (50 mM Tris, 10 mM EDTA, and 100 L/ mL RNase A, pH 8.0). The resuspended material was aliquoted into 10 microcentrifuged tubes, 250 L each. 250 L of P2 buffer (200 mM NaOH, 1% SDS) was added to each tube and mixed thoroughly by inverting the tube 6 times. 300 L of N3 buffer (composition c onfidential) was added to each tube and mixed immediately and thoroughly by inverting the tube 6 times. The tubes were centrifuged for 10 min at 13,000 rpm in a microcentrifuge. The supernatant was added to a QIAprep spin column by decanting. The column wa s centrifuged for 60 sec to discard flow through. The QIAprep column was washed by adding 0.75 mL of PE buffer (composition confidential) and centrifuging for 60 sec. The flow through was discarded and the column was centrifuged again for 60 sec. The flow through tube was discared and each column was placed in a clean 1.5 mL centrifuge tube. The DNA was eluted by adding 50 L of ddH 2 O and let stand for 1 min and centrifuged for 1 min. The DNA collected was verified by sending for DNA sequencing Eurofins MWG Operon and used for subsequent transformation experiments. Transformation of One Shot Rosetta 2 (DE3) pLysS Competent Cells (Novagen) One tube containing 0.2 L Rosetta 2 (DE3) pLysS competent cells (Novagen catlog# 71401 3) was thawed on ice. One microl iter of DNA was added and swirled gently to mix. Tubes were placed on ice for 5 min and then heat pulsed for 30 sec in 42 o C water bath without shaking. The tubes were returned to ice for 2 min and then 250 L of room temperature SOC media was added the tub e. The cells were incubated at 37 o C for 1 hour while shaking at 250 rpm. 60 L of cells were spread on premade plates containing ampicillin and chloramphenicol. Plates were incubated at 37 o C overnight. A colony was picked and used for inoculating 200 mL of LB media, containing ampicillin (50 L/mL) and chloramphenicol (34 g/mL) and grown over night at 37 o C with 250 rpm shaking overnight.

PAGE 15

Transformation of One Shot BL 21 (DE3) pLysS Competent Cells (Invitrogen) One tube containing 0.2 L BL 21 (DE3) pLysS competent cells (Invitrogen catlog# C6060 10) was thawed on ice. One microliter of DNA was added and swirled gently to mix. Tubes were placed on ice for 30 min and then heat pulsed for 30 sec in 42 o C water bath without shaking. The tubes were returne d to ice and 250 L of room temperature SOC media was added the tube. The cells were incubated at 37 o C for 1 hour while shaking at 250 rpm. 60 L of cells were spread on premade plates containing ampicillin and chloramphenicol. Plates were incubated at 37 o C overnight. A colony was picked and used for inoculating 200 mL of LB media, containing ampicillin (50 L/mL) and chloramphenicol (34 g/mL), and grown over night at 37 o C with 250 rpm shaking overnight. Protein Expression One liter of LB media containin g ampicillin (50 L/mL) and chloramphenicol (34 g/mL) was used to express protein. A 2% inoculation with cell culture growth overnight was achieved by adding 40mL of overnight to One liter of LB media. The expression culture was incubated at 37 o C with 250 rpm until an OD 600 of 0.8. The expression was induced by addition of IPTG (1 mM) and allowed to grow for 3 hours. Samples were taken before and every hour after inoculation. Time points collected would be used in gel electrophoresis. Time points were imme diately centrifuged at max speed in tabletop microcentrifuge for 2 min. The supernatant was aspirated and the pellet was resuspended in solution of 100 L TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) and 20 L of 5X LSB. Suspension was passed through 20 gauge syringe in order to lyse the cells. These samples would be boiled and 16 L used for gel electrophoresis on a premade 10% Tris HCl SDS PAGE gel. The cells were harvested by centrifugation at 10000 x g for 5 min and cell pellets were stored at 20 o C after recoding the cell pellet weight. Inclusion Bodies Extraction and Purification The c ell pellets stored at 20 C were resuspended in 60 mL of Buffer A (0.01 M Tris, pH 8.0, 0.02 M MgCl 2 0.005 M CaCl). Cells were lysed using an SLM Aminco French Pressure Cell at 1000 psi. 10 mL 27% sucrose was added in 30 mL Corex tubes and cell suspension was layered over. Tubes were spun at 12000 x g in a JS 13.1 swing bu cket rotor for 45 min at 4C. A 1 mL sample of supernatant was saved for later SDS PAGE analysis. The remaining supernatant was decanted. Each pellet was resuspended in 5 mL of Buffer B (0.01 M Tris, pH 8.0, 0.001 M E mercaptoethanol), 0.1 M NaCl). 10 mL 27% sucrose was added in 30 mL

PAGE 16

Corex tubes a nd cell suspension was layered over. Tubes were spun at 12000 x g in a JS 13.1 swing bu cket rotor for 45 min at 4C. A 1 mL sample of supernatant was saved for later SDS PAGE analysis. The remaining supernatant was decanted. Each pellet w as resuspended in 15 mL Buffer C (0.05 M Tris, pH 8.0, 0.005 M EDTA, 0 .005 M BME, 0.5% Triton X 100). Resuspension was transferred to clean 30 mL Corex tubes and spun at 12000 x g in JS 13.1 swing b ucket rotor for 15 min at 4C. A 1 mL sample of supernatant was saved for la ter SDS PAGE analysis. The remaining supernatant was decanted. The remaining pellet was resuspended in 40 mL Buffer D (0.05 M Tris, pH 8.0, 0.005 M EDTA, 0.005 M BME). Resuspension was transferred to pre weighed 50 mL plastic tubes and spun at 12000 x g in JA 20 rotor for 15 min at 4C. A 1 mL sample of supernatant was saved for later SDS PAGE analysis. The remaining supernatant was decanted. Final pellet (purified inclusion bodies) was weighed. Inclusion bodies were resuspended in TE buffer (10 mM Tris HC l, pH 8.0, 1 mM EDTA) to give a final concentration of 100 mg/mL and stored at 80C. Only f or unmutated, original PfPM9 cell culture, were methods continued from this point on. Denaturing of Inclusion Bodies and Anion Chromatography Purification An 8 M urea solution was prepared by adding to an initial volume of 300 mL of ddH 2 O while heating. Ten grams of Dowex ion exchange resin (Amersham) was added and allowed to stir for 30 min to remove hydrolysis products created by heating the urea. The resin was added to give final concentrations of 50 mM 0.05 M, 5 mM, and 0.2 M BME, respectively. DdH 2 O was added to the buffer to bring it to a final concentration that depen ded on the amount of inclusion bodies being used. Inclusion bodies would have a final concentration of 1 mg/mL. The mixture was allowed to gently stir for 2 hours. To purify the protein, the urea solution was loaded onto a HighTrap Q HP column (GE Healthca re) using a HiLoad Pump P 50 (GE Healthcare). The column was washed with buffer (20 mM ). Sodium phosphate dibasic, pH 7.0) for 5 min, buffer with 1 M NaCl for 5 min, and buffer for 10 min prior to loading the sample. The protein was eluted with a salt g radient (up to 1 M NaCl) using an FPLC system (Amersham Pharmacia) driven by an LCC 500 Plus Controller and 2.5 mL fractions were collected using a Frac 200 (Amersham Pharmacia). Fractions were then tested for protein by assaying at OD 280 using a Varian Cary50 spectrophotometer with an 18 cell sample handling system. Samples from fractions containing protein were then run on a SDS PAGE gel to determine where the purified semi proplasmepsin eluted.

PAGE 17

Goal Plasmepsin 9 is a highly sought a fter target against the malaria parasite but its biochemical and structural properties are largely a mystery. Difficulties of obtaining this information stem from the complexity of obtaining proper expression yields. The primary plan of this project is to improve expression yields through gene mutation and codon optimization. Results Original Plasmepsin 9 Culture Before the beginning of this project Plasmepsin 9 had been expressed in yields enough to do kinetic studies but insufficient to conduct x ray cry stallography trials. Original protocols called for refolding of the protein before purifying by anion chromatography. The refolding processes resulted in precipitation which caused loses in protein. After manipulating the protocol to remove the refolding step and purify in a urea solution, enough protein was collected to be analyzed by gel electrophoresis. Figure 3. SDS PAGE gel of Plasmepsin 9 fractions from anion exchange purification. Samples ran on a 10% Tris HCl Ready Gel (BioRad) and stained with Coomassie Blue (BioRad). Ladder is Precision Plus Protein Standard (BioRad catlog# 161 L of material. Semi proplasmepsin 9 is expressed as a 56.8 kDa marker. Fraction 21 has the highest concentration of protein. Arrow 1 on fraction 21 is semi proplasmpepsin while arrow 2 and 3 are self cleavage products or alternative translation occurrences.

PAGE 18

The gel in figure 3 shows fraction 21 as having the highest concentration of protein. On this fraction arrow 1 demonstrate d the semi proplasmpepsin as a 56.8 kDa marker. Arrow 2 and 3 on this fraction are possible self cleavage fraction or alternative translation occurrences. These three bands, shown as arrow 1, 2, and 3, were sent to Interdisciplinary Center for Biotechnolog y Research (ICBR) at the University of Florida for mass spectroscopy. Band 3 was lost by ICBR but results show that band 1 and 2 are from the semi proplasmpepsin protein. Analysis of the DNA sequence of semi proplasmpepsin used resulted in the finding of a n alternative ribosomal binding site, which matched the molecular weight of the band shown in arrow 3 of figure 3. A mutation was devised to remove the alternative ribosomal binding site by mutating the ATG, which acts as a start codon, into a TTA which co des for Leucine. Although the amino acid should be methionine there are no other codons that code for methionine and are suitable for expression in E. coli Leuicine make a good replacement for methionine because of their similarity. Sequence changes are seen below: Original sequence GGGTAGATAAAAATTTTTTT GAAGGAG ATATATAT ATG TTTCCTGTTGTTAAGGAATATTATTGGG Mutatgenic from Met (ATG) to Leu (TTA) GAAGGAG ATATATAT TTA DNA Sequence 1. Showing the changes made to the plasmepsin gene to remoce alternative ribosomal bind site. The DNA sequence above shows in green the Shine Delgarno site, in red the ATG (alternative translation start site) was mutated into TTA that would code for Leuicine amino acid rather than a methionine. This mutation would eliminate the capacity of ribosomes initiating translation at an inappropriate site due to the ATG codon being at the right position to a Shine Delgarno sequence

PAGE 19

Expression The mutation of Plasmpesin 9 showed a slight increase in expression within the BL 21 cell line when compared to the unmutated original plasmepsin 9 and the new mutated plasmepsin 9 expressed in Rosetta cell line. Figure 4. SDS PAGE gel of Plasmepsin 9 expression time points Samples ran on a 10% Tris HCl Ready Gel (BioRad) and stained with Coomassie Blue (BioRad). Ladder is Precision Plus Protein Standard (BioRad catlog# 161 0374). Each sample lane was loaded with 16 L of material. Semi proplasmpepsin 9 is expressed as a 56.8 kDa marker. The original plasmepsin gel is time points from expression of unmutated plasmepsin 9 that contained the alternative ribosomal binding site. Mutated plasmepsin in Rosetta and BL 21 cell line have a mutated ATG (Met) to a TTA (Leu) in o rder to remove the alternative ribosomal binding site. BL 21 cell lines with the mutated plasmepsin 9 enzymes show an increase in protein production when compared to both the original plasmepsin 9 expression and plasmepsin 9 in Rosetta cells. Rosetta cell line did not show a significant increase in protein production even after the mutation. Semi proplasmpepsin can be seen at the 56.8 kDa marker.

PAGE 20

Inclusion Bodies Inclusion bodies were collected for the original unmutated plasmepsin 9 and only for the mutated plasmepsin 9 in BL 21. Samples of each supernatant during the purification process and a sample of inclusion bodies were collected and ran on gels. Figure 5 SDS PAGE gel of Plasmepsin 9 supernatants and inclusion bodies Sam ples ran on a 10% Tris HCl Ready Gel (BioRad) and stained with Coomassie Blue (BioRad). Ladder is Precision Plus Protein Standard (BioRad catlog# 161 0374). Each sample lane was loaded with different amounts of material. Semi proplasmpepsin 9 is expressed as a 56.8 kDa marker. The arrow points to the protein of interest, plasmepsin 9. Figure 5 shows the protein plasmepsin 9 depicted by an arrow for both the unmutated and the mutated plasmepsins. The mutated plasmepsin 9 shows a slightly stronger band when compared to unmutated plasmepsin 9. This slight increase in plasmepsin 9 enzyme within the inclusion bodies represents an improvement in the gene expression caused by removal of the alternative ribosomal binding site. Conclusions As resistance continue to increase to current anti malaria drugs the need for novel drugs target also increases. Most importantly, P. falciparum the deadliest human malaria causing parasite is harder to treat because current medications are failing. Protease treatments have shown to be promising approach for the fight against malaria. These types of treatments have already been used or currently under developed for diseases such as HIV, HTLV, hypertension, atically increased

PAGE 21

our knowledge of the malaria proteases. Although these four proteases were considered as drug target because of their involvement in hemoglobin degradation, it is now known through gene knockout studies that they are not detrimental to t he parasites survival. There must be other proteases that are indispensible to the parasite and our aim is to study these new enzymes for their potential as antimalaria drug targets. The P. falciparum genome project revealed plasmepsins 6, 7, and 8 who are expressed in the sporogonic cycle thus minimizing their chance to be good drug targets. The remaining plasmepsins 5, 9, and 10 are found in the intra erythrocytic stage and could be suitable drug targets. This begins to explore the opt imization of expressing plasmepsin 9 so that further studies can one day reveals the mysteries of this enzymes function and structure. The poor quality and amount of enzyme currently being produced for plasmepsin 9 has halted the continuation of further ex periments to reveal the working of the enzyme. This project has focused on searching for way to improve the primary step of protein expression. Methods were modified to preserve the enzyme in order to better examine the errors that are occurring during exp ression. It was determined that Plasmepsin 9 was undergoing alternative translation in an incorrect starting site. This is primarily due in part because P. falciparum is a Protozoa, a singled cell eukaryotic organism which has different codon usage when co mpared to the expression vector E. coli Eukaryotic organisms do not utilize the Shine Delgarno sequence, which is a ribosomal binding site that helps in the recognition of the start codon ATG. This alternative shine delgarno was 8 base pairs away from an ATG methionine. This distance is precisely the distance needed for a ribosome to bind to and recognize the ATG as a start codon instead of the intended methionine. Gel electrophoresis of expression trials show an increase yield of proteins in the new mutat ed plasmepsin 9 gene. In particular the expression was increased by using BL 21 cells rather than the Rosetta cells that were originally used. Inclusion body purification analysis confirms the slight increase in plasmepsin 9 enzyme production. Mutation of the ATG has shown an increase in expression but further exploration has to be conducted to completely understand the significant of this change. Although this project is at its infantile stage the continuation will bring about beneficial results. The completion of this project will increase the expression of plasmepsin 9 and open the doors to new experiments that will unravel the mysteries of this enzyme. Future projects will include sufficient yield of protein purification which will then be used in kinetic analysis with different inhibitors to test for the inhibition constants. Inhibitors that exhibit a strong affinity for the active site will th en be used in x ray crystallography. The results of the kinetic analysis and the structures obtained from x ray crystallography can direct the way to a new drug target against malaria that may have the potential of saving millions of lives

PAGE 22

Acknowledgmen ts I would like to thank all those who provided their assistance and support. To Dr. Nathan Goldfarb thank you for your instruction during the course of this project. To Phuong Nguyen, thank you for the letting me teach you the skills I have learned and f or continuing this project when I leave To my mentor Ben M. Dunn thank you for your guidance and the opportunity to learn, explore, and work on such an important project. Literature Cited 1. British Broadcasting Corporation News. Malaria Global Menace. < http://news.bbc.co.uk/2/shared/spl/hi/world/05/malaria_global_menace/html/ancient_scourge.stm > 2. McPherson, Now Public. (2010) Malaria fights back be st t hera py losing e ffectiveness. < http://www.nowpublic.com/health/malaria fights back be st therapy losing effectiveness > 3. Centers for Disease Control and Prevention. ( 2010 ) The History of Malaria, an Ancient Disease. < http://www.cdc.gov/malaria/history/index.htm>. 4. Charmot, G. (2004) History: Laveran and the d is covery of the malaria p arasite. Centers for Disease Control and Prevention . 5. Sherman, I (1998) Malaria: parasi te biology, pathogenesis, and protection, Vol. 3 p p 3 6 American Society for Microbiology, Washington, D.C. 6. Centers for Disease Control and Prevention (2004) History: Ross and the discovery that m osquito es transmit malaria p arasites. < http://www.cdc.gov/malaria/history/ross.htm>. 7. Yu H W and Zhong S M. (2002) Ar temisia species in traditional c hinese medicine and the discovery of artemisinin. Artemisia pp 149 1 57 Taylor & Francis, London 8. Hsu, E (2006) Reflections on the discovery of the antimalaria qinghao British Pharmacological Society 61 666 670 9. K akkilaya, B.S. Malaria Site (2006) History of malaria t reatment. < http://www.malariasite.com/malaria/history_treatment.htm> 10. B ookrags S taff (2005) Quinine . 11. A. Afonso, P. Hunt, S. Cheesman, A. C. Alves, C. V. Cunha, V. do Rosrio, and Cravo P (2006) Malaria p arasi te can d evelop s table r esistance to a rtemisinin but l ack m utations in c andidate g enes atp, tctp, mdr1, and cg10. Antimi crobial Agents and Chemotherapy 50 480 489 12. Centers for Disease Control and Prevention (2006) The P anama Canal < http://www.cdc.gov/malaria/about/history/panama_canal.html >. 13. Centers for Disease Control and Prevention (2010) CDC and m alaria. < http://www.cdc.gov/malaria/about/activities.html>.

PAGE 23

14. Centers for Disease Control and Prevention (2010) Malaria f acts. < http://www.cdc.gov/malaria/about/facts.html>. 15. World health Organization, (2008) World m a laria r eport. < http://whqlibdoc.who.int/publications/2008/9789241563697_eng.pdf > 16. Centers for Disease Control and Prevention (2010) Where m alaria o ccurs. < http://www.cdc.gov/malaria/about/distribution.html >. 17. Greenwood, B. M., Bojang, K., Whitty, C. J., an d Targett, G. A. (2005) Malaria. Lancet 365 1487 1498. 18. Hunt N H Grau G E Engwerda C Barnum S R van der Heyde H Hansen D S Schofield L and Golenser J (2010) Murine cerebral malaria: the whole story. Trends Parasitol In Press. 19. PATH Malaria Vaccine Initiative (2009) Malaria vaccines. < http://www.malariavaccine.org/malvac overview.php>. 20. Vekemans J Leach A and Cohen J. (2009) Development of the RTS ,S/AS malaria candidate vaccine. Vaccine Suppl 6, 67 71. 21. Giles, C Malaria (2009) Why do < http://malaria.wellcome.ac.uk/doc_WTX033040.html > 22. World health Organization (2010) Other me thods of malaria vector control < http://www.who.int/malaria/vector_control/other/en/index.html> 23. F illinger U and Lindsay, S. (2006) Suppression of exposure to malaria vectors by an order of magnitude using microbial larvacides in rural Kenya Tropical Medicine and International Health 11 1629 1642 24. Bate, R. Spiked Science. (2001) Wi thout DDT, malaria bites back. < http://www.spiked online.com/Articles/000000005591.htm> 25. World health Organization (2010) Insecticide treated materials < http://www.who.int/malaria/vector_control/itm/en/index.html> 26. Centers for Disease Control and Prevention (2 010) Insecticide treated bed nets. < http://www.cdc.gov/malaria/malaria_worldwide/reduction/itn.html> 27. Guessan R Corbel V Akogbeto M and Rowland M. (2007) Reduced efficacy of insecticide treated nets and indoor residual spraying for malaria control in pyrethroid resistance a rea, Benin. Emerg Infect Dis. 13 199 206. 28. World health Organization (2010) Guidelines for the treatment of m alaria. < http://whqlibdoc.who.int/publications/2010/9789241547925_eng.pdf> 29. Ersmark, K. Bertil S ., and Hallberg A. (2001) Plasmepsins as p oten tial targets for new antimalarial t herapy. Medicinal Research Reviews 26 626 666. 30. Centers for Disease Control and Prevention (2010) Malaria p arasites. < http://www.cdc.gov/malaria/about/biology/parasites.html >

PAGE 24

31. Bogitsh B Carter C and Oeltmann T. (2005) Human P arasitology Ed. 3: pp 132 144 Elsevier San Diego 32. Centers for Disease Control and Prevention (2010) Biology < http://www.cdc.gov/malaria/about/biology/index.htmlhtml > 33. Aikawa, Miller, Johnson, and Rabbege. (1978) Erythrocyte entry by malarial parasites. A moving junction b etween erythrocyte and parasite. J Cell Biol 77 72 82 34. McKerrow J Rosenthal P and Bouvier J. (1993) The proteases and p ath ogenicity of p arasitic p rotozoa. An nual Review of Microbiology 47 821 853. 35. Bowman S Lawson D Basham D Brown D Chillingworth T Churcher CM Craig A Davies RM Devlin K Feltwell T Gentles S Gwilliam R Hamlin N Harris D Holroyd S Hornsby T Horrocks P Jagels K Jassal B Kyes S McLean J Moule S Mungall K Murphy L Oliver K Quail MA Rajandream MA Rutter S Skelton J Squares R Squares S Sulston JE Whitehead S Woodward JR Newbold C and Barrell BG (1999) The complete nucleotide sequence of chromosome 3 of Plasmodium falciparum Nature 400 532 538. 36. Bonilla, J. A., Bonilla, T. D., Yowell, C. A., Fujioka, H., and Dame, J. B. (2007) Crit ical roles for the digestive vacuole plasmepsins of Plasmodium falciparum in vacuolar function. Mol Microbiol 65 64 75. 37. Guruprasad K Dhanaraj V Groves M and Blundell T L (1994) Aspartic proteinases: The structures and functions of a versatile super family of enzymes Perspectives in Drug Discovery and Design 2 329 341. 38. Madabushi A Chakraborty S Xoe Fisher S Clemente J Yowell C Agbandje McKenna M Dame J Dunn B M and McKenna R. (2005) Crystallization and preliminary X ray analysis of the aspartic protease plasmepsin 4 from the malarial parasite Plasmodium malariae Acta Crystallogr Sect F Struct Bio l Cryst Commun 61 228 231. 39. Bonilla, J. A., Moura, P. A., Bonilla, T. D., Yowell C. A., Fidock, D. A., and Dame, J. B. (2007) Effects on growth, hemoglobin metabolism and paralogous gene expression resulting from disruption of genes encoding the digestive vacuole plasmepsins of Plasmodium falciparum Int J Parasitol 3 317 327. 40. Coombs, G., H., D. E. Goldberg, M. K Colin B John K and Jeremy C. M. (2001) Aspartic proteases of Plasmodium falciparum and other parasitic protozoa as drug targets. TRENDS in Parasitology 17 532 537. 41. Brinkworth R I Paul P Loukas A and Brindley P J. (2001) Hemoglobin degrading, aspartic proteases of blood feeding p arasites J. Biol. Chem. 276, 38844 38851. 42. Westling J Cipullo P Hung S H Saft H Dame J B and Dunn B M (19 99) Active site specificity of p lasmepsin II, Protein Science 44, 2001 2009. 43. Beyer B B Johnson J V Chung A Y Li T Madabushi A Agbandje McKenna M McKenna R Dame J B and Dunn B M (2005) Active site specif icity of digestive aspartic peptidases from the four species of Plasmodium that infect humans using chromogenic combinatorial peptide libraries. Biochemistry 44, 1768 1779.