Citation
Posttranscriptional regulation of gene expression by a nuclear polyadenylated RNA binding protein

Material Information

Title:
Posttranscriptional regulation of gene expression by a nuclear polyadenylated RNA binding protein
Alternate title:
Post transcriptional regulation of gene expression by a nuclear polyadenylated RNA binding protein
Creator:
Hector, Ronald Earl, 1972-
Publication Date:
Language:
English
Physical Description:
vii, 144 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Heterogeneous nuclear ribonucleoproteins ( jstor )
In vitro fertilization ( jstor )
Introns ( jstor )
Messenger RNA ( jstor )
Nucleotides ( jstor )
Polyadenylation ( jstor )
RNA ( jstor )
Small nucleolar RNA ( jstor )
Splicing ( jstor )
Yeasts ( jstor )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Gene Expression Regulation ( mesh )
Genetic Techniques ( mesh )
Nuclear Proteins ( mesh )
RNA Precursors ( mesh )
RNA, Messenger ( mesh )
RNA-Binding Proteins ( mesh )
Research ( mesh )
City of Gainesville ( local )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 2000.
Bibliography:
Bibliography: leaves 130-143.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Ronald Earl Hector.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
025684599 ( ALEPH )
52305560 ( OCLC )

Downloads

This item has the following downloads:


Full Text











POSTTRANSCRIPTIONAL REGULATION OF GENE EXPRESSION BY A
NUCLEAR POLYADENYLATED RNA BINDING PROTEIN














By

RONALD EARL HECTOR


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2000






























This work is dedicated to my wife, Michelle, for loving me more than humanly possible.














ACKNOWLEDGEMENTS


I would like to thank my parents for giving me their continual love and support, and especially for teaching me that anything is possible. Without their guidance I would not be where I am. I thank my committee members, Al Lewin, Henry Baker, Bert Flanegan, Carl Fledherr, and my outside examiner, Scott Butler, for their assistance. I want to extend a special thanks to John Aris for his willingness to discuss my research. My mentor, Maury Swanson, has also made this a challenging, but very enjoyable experience. I thank him for helping me to realize my potential. Working with the past and present members of the Swanson lab has been a wonderful experience, I couldn't ask for a better group of people to interact with daily. I also want to thank Joyce Conners and the rest of the administrative staff of the Department of Molecular Genetics and Microbiology for help with meeting all of the deadlines. My wife, Michelle Hector, deserves special mention. Along with giving her constant love and devotion, she has given me the most precious gift of all, a daughter.


iii














TABLE OF CONTENTS

ACKNOWLEDGEMENTS .............................................................................................. iii

A B ST R A C T ....................................................................................................................... vi

INTRODUCTION .............................................................................................................. 1
RNA Processing Events and Regulation of Gene Expression.................. 4
RNA 5'-End Cap Formation ...................................................................... 4
Pre-mRNA Splicing and Alternative Splicing ........................................... 5
Pre-mRNA 3'-End Formation .................................................................... 6
Nucleocytoplasmic mRNA Export .......................................................... 11
Additional Posttranscriptional Modifications .......................................... 13
Interaction Between RNA Processing Steps .................................................... 15
Transcription .............................................................................................15
Pre-mRNA Splicing and 3'-End Formation ............................................ 17
mRNA Export .......................................................................................... 18
The HnRNP/RNA Complex is the Substrate for Nuclear RNA
Processing Events .......................................................................................... 19
HnRNP Identification and Classification ............................................... 22
Structure and Function of HnRNPs ........................................................ 22
Pre-mRNA Splicing .................................................................................23
Pre-mRNA 3'-End Formation .................................................................. 24
Other Functions of HnRNPs ................................................................... 24
Mechanisms for HnRNP Function ........................................................... 25

MATERIALS AND METHODS .................................................................................. 26
Growth Conditions and Media ......................................................................... 26
Cell Transformations ........................................................................................ 27
Yeast Genetic Manipulations ........................................................................... 27
Nucleic Acid Isolation Procedures .................................................................... 28
DNA and RNA Blot Analysis ........................................................................... 30
Yeast Total Cell Protein Isolation .................................................................... 31
Tandem Affinity Purification of Nab2p ........................................................... 31
In vitro 3'-End Processing Assays .................................................................... 33
Indirect Cellular Immunofluorescence ............................................................ 35
In Situ Hybridization and Cellular Immunofluorescence..................... 36
Yeast Two-Hybrid Screen ................................................................................ 37
Determination of Poly(A) Tail Lengths............................38


iv









Isolation of Hyperpolyadenylated RNAs and Construction of a cDNA Library.. 40 High Copy Suppression Analysis of a nab2A Strain........................ 41
Reverse Transcription-Polymerase Chain Reaction......................... 42

R E SU L T S ......................................................................................................................... 44
Research Objectives ........................................................................................... 44
Factors That Interact With Nab2p are Involved in Multiple Aspects of
RN A Processing ........................................................................................... 45
Pre-mRNA 3'-End Processing .......................................................................... 47
Polyadenylation of mRNA is Regulated by Nuclear Poly(A) Tail
Binding Proteins ................................................................................. 50
All mRNA Polyadenylate Tails are not Regulated by Nab2p.............. 59
Nab2p Regulates Poly(A) Tail Length in vitro........................ 72
Nucleocytoplasmic mRNA Export is Inhibited in nab2 Mutant Strains .............. 82
Messenger RNA 3'-End Formation and Nucleocytoplasmic
Export can be Uncoupled in Yeast ......................................................85
Pre-m RN A Splicing ........................................................................................... 96

D ISC U SSIO N ................................................................................................................. 106
Regulation of Polyadenylate Tail Length Requires Nab2p ...............106
How Does Pab Ip Compensate for the Loss of Nab2p?................. 109
Why is Nab2p Function Lost During Preparation of Extract?. ........110 Regulation of Polyadenylate Tail Length is not Essential............... 111
Nab2p-Dependent Regulation of Poly(A) Tail Length is
M essage Specific ................................................................................... 112
The Yeast HnRNP Nab2p is Required for Nucleocytoplasmic
Export of m R N A ............................................................................................. 113
Nuclear Functions of the Poly(A)-Binding Protein PabIp............... 113
Polyadenylated RNA in the Nucleolus ...................................................... 115
Nucleolar Function is Compromised in nab2 Strains...................... 117
Roles for HnRNPs in Processing Stress Response mRNAs................. 118
Nab2p may Direct mRNPs to the Nuclear Pore .................................................. 118
L im itations .......................................................................................................... 122
C onclusions ......................................................................................................... 123

APPENDIX OLIGONUCLEOTIDES, YEAST STRAINS AND PLASMIDS .... 125

R EFFER EN C E S ............................................................................................................. 130
BIOGRAPHICAL SKETCH ................................................................. 144


v














Abstract of Dissertation Presented to the Graduate School Of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

POSTTRANSCRIPTIONAL REGULATION OF GENE EXPRESSION BY A
NUCLEAR POLYADENYLATED RNA BINDING PROTEIN By

Ronald Earl Hector

December 2000

Chairman: Dr. Maurice S. Swanson

Major Department: Molecular Genetics and Microbiology

The polyadenylate tail is a common feature of most higher eukaryotic, and all yeast, messenger RNAs. Many of the functions attributed to the poly(A) tail are cytoplasmic (e.g. translation initiation and mRNA stability). While the poly(A) tail is generated in the nucleus, nuclear functions of the poly(A) tail are less well understood. The overall goal of this study was to investigate the role of the poly(A) tail in mRNA biogenesis and nucleocytoplasmic export.

Cytoplasmic functions attributed to the poly(A) tail depend on the cytoplasmic poly(A) tail-binding protein Pablp (PABP1 in metazoans). Pablp interaction with the poly(A) tail is essential, and much of our current understanding of cytoplasmic poly(A) tail metabolism has resulted from studies on Pablp and its associated proteins. To understand better the role of the poly(A) tail in nuclear pre-mRNA processing, we first identified Nab2p as a candidate nuclear poly(A) tail-binding protein. The powerful


vi









genetic tools available in yeast were then utilized to elucidate putative functions for the Nab2p-poly(A) tail complex in the regulation of gene expression at the posttranscriptional level.

The identification of proteins that interact with Nab2p in vivo suggested unusual roles for this hnRNP in both regulation of mRNA poly(A) tail length and mRNA export. Genetic analysis using conditional lethal nab2 alleles confirmed roles for Nab2p in these two processes. Surprisingly, the appearance of long poly(A) tails did not affect cell viability since a nab2-21 cold-sensitive strain showed long poly(A) tails at both permissive and restrictive growth temperatures. Screening of a cDNA library generated using hyperpolyadenylated RNA indicated that only mRNAs carried long poly(A) tails. In vitro polyadenylation assays suggested that Nab2p might be directly required for regulating poly(A) tail length in the absence of Pab Ip. Moreover, analysis of the lengths of poly(A) tails of individual transcripts synthesized in vivo suggested preferential hyperpolyadenylation of stress-responsive mRNAs. Consistent with this latter result, the nab2-21 strain showed impaired growth under osmotic and oxidative stress conditions. Thus, Nab2p may play an important role in the stress response by regulating poly(A) tail lengths of stress response transcripts.

Although long poly(A) tails were not deleterious to growth, loss of cell viability correlated with nuclear poly(A)+ accumulation in all nab2 mutants examined. Indeed, PAB was identified as a high copy suppressor of a nab2 null allele, and elevated levels of Pabip completely resolved the nuclear poly(A)+ RNA export block. These results suggest the hypothesis that formation of a ribonucleoprotein complex between the poly(A) tail and either Nab2p or Pab lp is essential for mRNA export from the nucleus.


vii














INTRODUCTION


The primary and most abundant products of RNA polymerase II (RNA pol II) transcription are heterogeneous nuclear RNAs (hnRNAs) including pre-mRNAs (Weighardt et al., 1996). Transcription of hnRNA occurs in the nucleus. Multiple processing events convert the hnRNA into a functional mRNA, which is transported through the nuclear pore complex (NPC) to the cytoplasm for translation into protein. Processing events in mRNA biogenesis include 5'-cap formation, pre-mRNA splicing, transcription termination, 3'-end cleavage and polyadenylation, adenylate methylation, mRNA editing, and nucleocytoplasmic export (Figure 1) (Swanson, 1995; Weighardt et al., 1996). Each RNA processing step is a potential control point that the cell may utilize for regulating expression from a gene.

RNA processing steps do not occur isolated from other events. Rather, RNA processing events are coordinately regulated, with many steps dependent on the previous and/or next step. This allows the identification of aberrant transcripts before they are exported to the cytoplasm, where translation might produce toxic by-products (Jacobson and Pelts, 1996). Heterogeneous nuclear ribonucleoproteins (hnRNPs) play vital roles at many, if not all levels of RNA processing (Weighardt et al., 1996). The importance of accurate and timely RNA processing is demonstrated by the number of human genetic disorders attributed to defects at many different levels of RNA processing (Antoniou, 1995; Higgs et al., 1983).

























Figure 1. Schematic representation of RNA processing events that occur during mRNA biogenesis. The first modification to the hnRNA is 5'-cap formation. Capping typically occurs within 20-30 nucleotides of initiation. Pre-mRNA splicing of introns and 3 '-end formation complete the modifications, and the mRNA is transported to the cytoplasm for translation. mRNA editing is not depicted in this diagram. Many of the RNA processing events shown actually occur cotranscriptionally.














GpppGlExon 1


r2n1


rn


FT41


capped hnRNA


pre-mRNA splicing


3'-end cleavage and polyadenylation


GpppG" I II A,


mRNA export\,


Nucleus
Cytoplasm


GpppG - 1


translation


GpppQI


GnnnC-t


I I I


4f


mRNA


I ii t


--j ji"/-A"II I-"-i-I a aI






4


RNA Processing Events and Regulation of Gene Expression RNA 5'-End Cap Formation

Eukaryotic mRNAs are structurally modified cotranscriptionally at their 5'-end by the addition of a non-templated 7-methylguanylate (m7G) via a 5' to 5' phosphoanhydride linkage (Shatkin, 1976). Addition of the cap occurs very soon after transcription initiation, with the majority of capping occurring between 20 to 30 nucleotides after initiation (Rasmussen and Lis, 1993; Salditt-Georgieff et al., 1980). This is undoubtedly facilitated by selective binding of the guanylyl transferase to the elongating RNA polymerase II (Cho et al., 1997; Yue et al., 1997).

The cap participates in many RNA processing events. Protection of mRNA from 5' exoribonucleases was one of the first functions attributed to capping (Furuichi et al., 1977; Shimotohno et al., 1977). The cap has also been shown to play a role in premRNA splicing. In the nucleus, the cap is bound by a cap-binding complex (CBC) composed of two proteins, CBC80 and CBC20 (Izaurralde et al., 1994; Ohno et al., 1990). It is through interactions with the CBC that the cap affects splicing, as immunodepletion of CBC80 from HeLa cell extracts inhibited in vitro splicing (Izaurralde et al., 1994). Capped pre-mRNAs injected into Xenopus oocytes are also processed more efficiently than uncapped precursors (Inoue et al., 1989). Nucleocytoplasmic export of mRNAs and U snRNAs is also facilitated by the presence of a 5'-cap (Jarmolowski et al., 1994), and a cap is required for translation initiation of most mRNAs (Le et al., 1997). Finally, both the cleavage and polyadenylation steps during 3 '-end formation are enhanced by the presence of a cap. Again, this is mediated by interaction with the CBC proteins (Cooke and Alwine, 1996; Flaherty et al., 1997).






5


Pre-mRNA Splicing and Alternative Splicing

Most higher eukaryotic genes contain intervening sequences, or introns, that must be removed from the pre-mRNA in order to produce an mRNA capable of translation into a functional protein. Surprisingly, introns comprise as much as 90% of the pre-mRNA sequence in higher eukaryotes. The number of introns found in a gene can exceed 50, with intron lengths extending past 3 million nucleotides (Kramer, 1995; Tollervey, 2000). Exons are generally much smaller in size, ranging from 10-400 nucleotides.

Introns are removed from the pre-mRNA by a two-step reaction called splicing. The first step is a transesterification reaction initiated by nucleophilic attack of the 2' hydroxyl of the branch point adenosine on the 3',5' phosphodiester bond at the 5' splice site. The first step generates the free 5' exon with the 3' exon still attached to the intron. The second step is a nucleophilic attack of the 3' hydroxyl of the 5' exon on the 3' splice site, fusing the two exons and liberating the intron. Numerous components must come together in an orchestrated manner for splicing to occur. These components include both protein and RNA. Approximately 30-50 polypeptides have been shown to associate with the spliceosome during the splicing reaction (Gozani et al., 1994). A number of spliceosome-associated proteins have been identified as hnRNPs (Gil et al., 1991; Mayeda and Krainer, 1992). Another group of proteins essential for splicing is the SR (serine/arginine rich) protein family (Manley and Tacke, 1996). The SR family of splicing factors not only function as general splicing factors, but also influence alternative splice site selection. RNA sequences in the small nuclear RNAs (snRNAs) direct the assembly of the spliceosome to the exon/intron junctions via base pairing to the pre-mRNA. The snRNA Ul recognizes a conserved sequence at the 5' exon/intron






6


junction, while U2 base pairs to the branch point, consequently bulging out the branchpoint adenosine. Addition of the pre-assembled tri-snRNP U4/U6.U5 to the spliceosome is the next step. Extensive base pairing between U6 and U2 destabilizes the U6/U4 interaction, allowing the transesterification reactions to proceed.

Intron splicing is an important source of diversity as well as control over the protein products produced. In higher eukaryotes, introns are spliced out in various patterns, called alternative splicing. The end result is multiple forms of a protein from one gene. Interestingly, very few genes (2-5%) in Saccharomyces cerevisiae have been shown or predicted to contain introns (Rymond and Rosbash, 1992). Because of the low abundance of intron-containing genes, lack of SR proteins, and few identified yeast hnRNPs, it was generally believed that alternative splicing was not prevalent in yeast. However, recent investigation into the use of predicted splice sites in yeast has identified two alternatively spliced mRNAs, novel splice sites, and new introns (Davis et al., 2000). Pre-mRNA 3'-End Formation

The 3'-end of most mRNAs in metazoans terminates in a non-templated polyadenylate tail. The only exceptions are the replication-dependent histone mRNAs from metazoans, which end in a conserved stem-loop structure (Dominski and Marzluff, 1999). Messenger RNA 3'-end formation is a two-step process. The first step is posttranscriptional endonucleolytic cleavage of the mRNA. The second step is polyadenylation of the cleaved mRNA (Walile and Keller, 1996). Similar to splicing, factors involved in the reaction are directed by sequence elements in the mRNA. Animal cells have four sequence elements that direct the cleavage and polyadenylation machinery to the correct site (Zhao et al., 1999). These include the U-rich auxiliary upstream






7


enhancer (USE), a highly conserved positioning element (AAUAAA) located 10-30 nucleotides 5' of the cleavage site, and a poly(A) site, typically after a cytosine (Figure 2A). The final cis-element is the U/GU rich downstream element (DSE), usually less than 30 nucleotides 3' of the cleavage site.

Required sequence elements in S. cerevisiae are more degenerate than in higher eukaryotes and may or may not include a DSE (Figure 2B). The efficiency element (EE) is UA rich, and found 5' to the poly(A) site. While the sequence AAUAAA will work in yeast, the only requirement of the positioning element is that it is A-rich. Polyadenylation also often occurs after a cytosine as in animal cells, but a pyrimidine is all that is required. The lack of a DSE may be due to the close proximity of genes in yeast. The degeneracy of sequence elements may also facilitate termination of transcription before running into the downstream gene, possibly producing inhibitory antisense RNAs. Interestingly, a class of 3'-end processing signals in yeast has been shown to fimction in both directions (Imiger et al., 1991). Also, mutation of the sequence elements in yeast does not completely abolish processing, but instead induces the use of cryptic polyadenylation sites (Duvel and Braus, 1999; Russo et al., 1993).

In both mammalian and yeast cells, cleavage and polyadenylation requires numerous protein factors (Table 1). Many of the factors have been isolated biochemically by reconstitution of an in vitro 3'-end processing reaction (Barabino et al., 1997; Bienroth et al., 1991; Jenny et al., 1994; Kessler et al., 1996; Lingner et al., 1991; Minvielle-Sebastia et al., 1997; Zhao et al., 1997). Unlike pre-mRNA splicing, an RNA component is not required. Cleavage during 3 '-end formation in mammalians requires five factors: cleavage factor I (CF Im), cleavage factor II (CF lIm), poly(A) polymerase


























Figure 2. Schematic representation of cis elements required for mRNA 3'-end cleavage and polyadenylation.
(A) Mammalian (B) Yeast.









A. Mammalian


H-- 10-30 nt. - 1-- <30 nt. --1


AAUAAA


Positioning Element


C/A


Ar


Polyadenylation
Site


U/GU-Rich


Downstream Enhancer


- 10-20 nt. -[


A-Rich


Pv/


Positioning Element


Polyadenylation
Site


U-Rich


Upstream Enhancer


B. Yeast


UA-Rich


Efficiency Element






10


(PAP), cleavage-stimulation factor (CstF), and cleavage/polyadenylation specific factor (CPSF). Polyadenylation requires three factors: PAP, CPSF, and the poly(A)-binding protein (PABP2). Yeast requires only three factors for cleavage. These include cleavage factor IA (CF IA), cleavage factor IB (CF IB), and cleavage factor II (CFII). Polyadenylation in yeast requires two of the cleavage factors, CF IA and CF IB, as well as PAP, polyadenylation factor I (PF I), and the poly(A)-binding protein (Pablp). Even though much has been learned about the proteins involved and their interactions with sequence elements, not all of the protein components have been isolated. The endonuclease responsible for endonucleolytic cleavage of the RNA has not been identified in mammals or yeast.

In mammalian cells, poly(A) tails are rapidly elongated to a final length of -250 nucleotides in two distinct phases. First, polyadenylation proceeds in a distributive mode until 10-12 adenosines are added (Sheets and Wickens, 1989). Once a binding site for PABP2 is created, PABP2 associates with the tail/polyadenylation complex and stimulates processive poly(A) addition (Bienroth et al., 1993). This poly(A) binding protein, PABP2, is also believed to regulate the length of poly(A) addition by associating with, and altering the structure of, the poly(A) tail once it reaches 250 nucleotides in length. Polyadenylate tails in yeast are much shorter than in metazoan cells and average around 70-90 nucleotides in length (Groner and Phillips, 1975). A sequence homologue of PABP2 has not been identified in S. cerevisiae, so another protein and/or mechanism must exist. The cytoplasmic poly(A) tail-binding protein (Pab lp) has been demonstrated to regulate poly(A) tail length in vivo and in vitro (Amrani et al., 1997; MinvielleSebastia et al., 1997; Sachs and Davis, 1989). In contrast to mammalian PABP2, Pablp






11


added to an in vitro polyadenylation reaction appears to inhibit the processivity of PAP in a concentration-dependent manner (Minvielle-Sebastia et al., 1997; Zhelkovsky et al., 1998).


Nucleocytoplasmic mRNA Export

In eukaryotic cells the nuclear and cytoplasmic compartments are separated by a double-layered membrane called the nuclear envelope (NE). A major consequence of this division is that newly synthesized RNAs are not accessible to the translational machinery. The nuclear envelope is impenetrable to macromolecules, making it a formidable barrier to most cellular components. Transport of macromolecules across the nuclear membrane occurs through a complex structure called the nuclear pore complex (NPC) (Cullen, 2000). The average human cell nucleus contains approximately 4000 NPCs. However, the number of NPCs is largely dependent on the size of the nucleus and can range from less than one thousand to several million. The amount and rate of transport through NPCs is staggering (greater than 106 macromolecules/min) when one considers that all macromolecular transport is conducted bi-directionally through this structure (Ohno et al., 1998). Obviously, the ability to regulate transport through the NPC is advantageous to the cell, and many independent import and export pathways have been identified for different classes of protein and RNA (Cullen, 2000; Gorlich and Kutay, 1999; Rout et al., 1997; Saavedra et al., 1997; Stutz and Rosbash, 1998; Truant et al., 1998).

Nuclear pore complexes are large, proteinaceous structures with a highly conserved architecture (Ryan and Wente, 2000). The molecular mass of the NPC is estimated around 125 MDa in vertebrates and 60 MDa in Saccharomyces cerevisiae. The






12


nuclear pore complex is composed of 30 to 50 unique proteins called nucleoporins (Nups) (Fontoura et al., 1999; Rout and Blobel, 1993). These are assembled into a highly ordered structure with eightfold rotational symmetry. The NPC consists of many substructures including spokes and rings, around a central channel, that bridges the nuclear membrane. Extending out from both surfaces are fibrils. On the nuclear side, these fibrils are connected at their ends, forming a basket (Ryan and Wente, 2000). Determination of the structure of the NPC at increasing levels of resolution supports a receptor-mediated model of translocation. The receptor-mediated pathway involves transport adapters, or importins, which recognize and direct macromolecules to the NPC. The adapter for protein import is importin cc. Importin a is responsible for recognizing the classical nuclear localization sequence (NLS). The import receptor, importin 3, associates with the importin a/NLS complex and targets the NLS-containing protein to the nuclear pore. Some hnRNPs appear to have their own dedicated importin. Kap104, in yeast, is essential for the nuclear accumulation of the yeast hnRNPs Nab2p and Nab4p (Aitchison et al., 1996).

The directionality of translocation is driven by a GTP/GDP concentration gradient that is established across the nuclear membrane. GTPase activity is higher in the cytoplasm, resulting in a higher cytoplasmic concentration of RanGDP. RanGDP has a lower affinity for the importin af3 complex, which allows its dissociation in the cytoplasm. In the nucleus, RanGTP is the prevalent form. RanGTP associates with the incoming NLS-importin c43 complex, causing release of the NLS-containing protein, while allowing export of the RanGTP-associated importins.






13


Messenger RNA export is also mediated by adapter-receptor interaction. Export adapters have been identified in both metazoans and yeast. In yeast, Mex67p binds to, and directs, mRNA to the nuclear pore (Segref et al., 1997). This is accomplished by interaction of Mex67p with Yralp and Mtr2p, which binds the nucleoporin Nup85p (Santos-Rosa et al., 1998; Strasser and Hurt, 2000). The Mex67p/Mtr2p complex also binds to repeat sequences in multiple other nucleoporins (Straser et al., 2000). In reference to NLS-mediated protein import, Mex67p is considered the export adaptor, and Mtr2p the export receptor. It is not clear at this point however what RNA sequences, or structures, are required for Mex67p interaction, or how this interaction is regulated. Additional Posttranscriptional Modifications

Base methylation is a frequent, but poorly understood modification that occurs in higher eukaryotes. Methylation at nitrogen 6 (N6) of adenylate residues is common in higher organisms (mammals), but less frequent in yeasts and slime molds. A very interesting aspect of methylation is that the majority of base methylation occurs in exons, not introns (Lavi et al., 1977). Preferential base methylation of ribosomal RNA is also observed, and it has been proposed that methylation protects the RNA that is maintained in the final product. However, studies using methylase inhibitors imply that methylation is required for nuclear RNA processing. Adenylate methylation has been found flanking introns, suggestive of a potential role in splicing. Treated cells have also been shown to accumulate intron-containing pre-mRNAs in the nucleus (Carroll et al., 1990).

Editing of mRNA involves either the modification of specific nucleotides or the insertion of nucleotides to alter the coding capacity of an mRNA. RNA editing by uridine addition is fairly common in the mitochondria of the flagellate protozoa






14


Leishmania, Trypanosoma, and Crithidia (Simpson and Shaw, 1989). In metazoans, RNA editing of mRNA is also used to create new alternative splice sites and alter codons (Rueter et al., 1999). RNA editing has been shown to be required for embryonic erythropoiesis (Wang et al., 2000) and generating antibody diversity by facilitating immunoglobin class switch recombination and somatic hypermutation (Longacre and Storb, 2000; Liber, 2000).

Another example of altering the coding potential of an mRNA is RNA editing of the apolipoprotein B mRNA. In this case, the glutamine codon 2153 (CAA) is converted to a translation stop codon (UAA) by a cytidine deaminase. The result is the production of a truncated form of the protein (apoB48), which is required for dietary lipid absorption. The catalytic subunit of the apoB mRNA editing enzyme has been identified in tissues and cell lines that do not express the apoB mRNA (Hodges and Scott, 1992). Thus, editing in this fashion is likely to occur on other mRNAs. Two other cases of mRNA editing involve a glutamine (CAG) to arginine (CGG) in the glutamate-activated cation channel (GluRB) mRNA and U to C editing (CUC -- CCC) in the Wilms tumor susceptibility gene (WTI) (Sharma et al., 1994; Sommer et al., 1991). Editing of GluRB mRNA is an extremely efficient process. More than 99% of the GluRB mRNA is edited, which changes the gating and ion conductance of the receptor. Recently, editing was identified in the mRNA of the sheep oxytocin receptor, suggesting that mRNA editing may be more prevalent in regulating receptor function than previously thought (Feng et al., 2000).






15


Interaction Between RNA Processing Steps


It is clear that each step of RNA processing is interconnected with other events in the biogenesis of mRNA. Not only do posttranscriptional RNA processing events affect each other, they impact the transcriptional and translational machinery. Nucleocytoplasmic export of mRNA is also highly dependent on accurate processing of the hnRNA into mRNA (Proudfoot, 2000).


Transcription

Most RNA processing events are coupled to transcription in vivo. This is true for 5'-capping, pre-mRNA splicing and 3'-end formation. Coupling of these events can be attributed to binding of RNA processing factors, specifically to the phosphorylated form of the carboxy-terminal domain (CTD) of RNA polymerase II. During transcription initiation, the hypophosphorylated CTD of RNA pol II is primarily associated with transcription factors (TFs). The CTD of the elongating RNA pol II is highly phosphorylated upon promoter clearance, which releases many of the TFs involved in transcription initiation, also potentially freeing the CTD for loading of RNA processing factors. Both of the enzymes responsible for 5'-cap formation, the guanylyl transferase and methylase, have been shown to bind to the phosphorylated form of the CTD (Cho et al., 1997; McCracken et al., 1997). Capping has been shown to occur within the first 10 to 30 nucleotides, most likely facilitated by CTD-associated capping factors (Rasmussen and Lis, 1993; Salditt-Georgieff et al., 1980). Interestingly, many genes stall transcriptional elongation soon after initiation. One study of three independent transcripts showed that 5 '-capping was coincident with transcriptional stalling/pausing






16


(Rasmussen and Lis, 1993). It is tempting to speculate that capping may be the determinant for switching transcriptional initiation to elongation.

Splicing of introns from the pre-mRNA has been shown to occur cotranscriptionally in many instances (Bauren and Wieslander., 1994; Beyer and Osheim, 1988). Although it is unclear as to which of the numerous splicing factors associate with the CTD, it is clear that proteins with homology to splicing regulator proteins (SR proteins) bind the CTD (Kim et al., 1997; Yuryev et al., 1996). Specific SR proteins may also be pre-loaded in a promoter-dependent manner. For example, intron removal from an alternatively spliced fibronectin gene varied depending on the promoter used (Cramer et al., 1997). Transcription rates can also influence alternative splicing. Correctly positioned transcriptional pause sites allow splicing of an intron that is normally skipped (Roberts et al., 1998).

Transcription is also coupled to 3'-end formation at the level of transcriptional termination (Yonaha and Proudfoot, 2000). The first indication that transcription termination was dependent of 3'-end formation came from mutational analysis of polyadenylation signals. It is well documented that in the absence of functional 3'-end processing signals, transcription fails to terminate at the correct site (Duvel and Braus, 1999; Greger et al., 2000; Proudfoot, 1989). In yeast, when transcription does terminate, either cryptic polyadenylation sites or the cleavage and polyadenylation signals of a downstream gene are utilized (Russo et al., 1993). Coupling of 3'-end cleavage to termination is achieved by the interaction of cleavage factors with the CTD. It has been demonstrated that CPSF is initially associated with TFIID, a general transcription factor. Whereas most TFs dissociate after promoter clearance and phosphorylation of the CTD,






17


CPSF is transferred to the elongating RNA polymerase II (Dantonel et al., 1997). This factor is responsible for recognizing the consensus AAUAAA positioning element during 3'-end cleavage. Association with the elongating RNA pol II ensures that this sequence is displayed to CPSF immediately after it is generated. Coupling has also been demonstrated in yeast. Studies in S. cerevisiae demonstrated that only cleavage was coupled to transcription termination. Temperature-sensitive mutants in various cleavage factors failed to terminate at the non-permissive temperature, while polyadenylation factor mutants did not (Birse et al., 1998).


Pre-mRNA Splicing and 3'-End Formation

Splicing has been shown to have an enhancing effect on 3'-end formation. Specifically, 3'-terminal intron splicing enhances the usage of a proximal poly(A) signal (Cooke and Alwine, 1996; Niwa et al., 1990). Coupling of splicing and 3'-end formation has also been shown to function in the reverse order. That is, mutations to poly(A) signals result in decreased efficiency of 3'-terminal intron splicing, but not of distal splice sites (Niwa and Berget, 1991). This implies interactions between factors at the 3' splice site with cleavage factors, consistent with a model of exon definition, where exon boundaries are defined by processing factors/RNA-binding proteins.

Splicing does not always facilitate the use of 3'-end formation signals. Splicing factors can also down regulate the use of a 3'-end processing site. The Ul snRNP has been shown to inhibit polyadenylation (Ashe et al., 1997). This is also seen by the failed recognition of polyadenylation sites that have been inserted into introns (Adami and Nevins, 1988). Unless splice sites are mutated, or weak to begin with, the poly(A) signal is overlooked. The poly(A) polymerase is also directly affected by the Ul snRNP A






18


(UlA). Direct, physical interaction of a UlA dimer with PAP inhibits polyadenylation (Gunderson et al., 1994). This interaction is used to auto-regulate the amount of UlA produced by limiting the amount of its own mRNA. mRNA Export

Nucleocytoplasmic export of mRNAs is coupled to the production of an exportable mRNP substrate. Accurate processing at all levels appears required to generate an exportable mRNA (Cullen, 2000). What constitutes an export-competent mRNP? How is the protein composition of an exportable mRNA different? What RNA processing events are coupled to export and how? The first export signal on an mRNA may be the presence of a 5'-cap. In Xenopus oocytes, capped mRNA substrates are exported more efficiently than non-capped controls (Hamm and Mattaj, 1990). Splicing is also facilitates mRNA export. Formation of the spliceosome on an mRNA has been shown to be inhibitory to export. This is possibly due to association of hnRNP C, a nonshuttling hnRNP, with the 3'-end of introns (Swanson and Dreyfuss, 1988). More recently, the process of splicing has been demonstrated to facilitate mRNA export. It was shown that spliced mRNPs (from an in vitro reaction) were exported rapidly and efficiently when injected into Xenopus oocytes. However, an mRNP lacking the intron was not (Luo and Reed, 1999). The conclusion was that splicing of the mRNA directed the assembly of an mRNP specifically recognized by export factors. The protein component, Aly, specific to this mRNP was recently identified in metazoans (Zhou et al., 2000). The yeast homologue of Aly, is Yralp. Yralp interacts directly with Mex67p, a known mRNA export factor (Strasser and Hurt, 2000; Stutz et al., 2000). Another RNA binding protein, Y14, was found to preferentially associate with spliced mRNAs






19


(Kataoka et al., 2000). TAP, the vertebrate homologue of Mex67p, was also present in the Y14-containing hnRNP complex. This suggested that the complex was exportable.

Accurate 3'-end formation is also required for mRNA export. It was initially believed that the presence of a poly(A) tail was all that was required. When microinjected into oocytes, the presence of a poly(A) tail facilitates export. Later, in mammalian cells, it was shown that a poly(A) tail was essential for export (Huang and Carmichael, 1996). Surprisingly, this study also concluded that the process of polyadenylation, not just the presence of a 3'-terminal poly(A) tail, is required for export. This suggests that cleavage and polyadenylation also generates an mRNP that is recognized as export-competent, although the specific factor(s) have not been identified. One possible conclusion is that nuclear processing events imprint the mRNA while in the nucleus (Figure 3). Sequences downstream of the cleavage site in mammalian genes have also been shown to bind to hnRNP C (Moore et al., 1988; Wilusz et al., 1990). Since hnRNP C does not leave the nucleus, this may also prohibit the export of an mRNA before it is cleaved and polyadenylated.


The HnRNP/RNA Complex is the Substrate for Nuclear RNA Processing Events


The substrate for RNA processing reactions is not naked RNA, but a complex between hnRNA and nuclear RNPs (hnRNPs). As soon as the hnRNA emerges from the RNA polymerase II it is recognized and bound by hnRNPs in a sequence specific manner to form the hnRNP complex. It is this complex of protein and RNA that is the substrate for all subsequent RNA processing reactions.

























Figure 3. Schematic representation of RNA processing events that generate an export-competent mRNP. The proteins Y14 and Aly were shown to associate with mRNAs that are spliced, suggesting that pre-mRNA splicing marks the mRNA by the addition of these proteins. TAP, the human homologue of the yeast export adapter Mex67p, is also present in Y14-containing mRNPs. The process of 3'-end formation has also been shown to facilitate mRNA export. However, imprinting factors such as Y14 and Aly have not been identified for 3'-end formation.






21


U I2


GpppG E %,


splicing


GpppG

3'-end formation


GpppG E


239


Nucleus

Cyoas~m 7f


Y14


A






22


HnRNP Identification and Classification

HnRNPs were originally identified as proteins that associate with hnRNA, and are not stable components of other ribonucleoprotein complexes (RNPs) such as small nuclear RNPs (snRNPs) (Dreyfuss, 1993). The identification of hnRNPs has progressed from using co-sedimentation and UV-induced crosslinking to immunopurification using monoclonal antibodies (Dreyfuss et al., 1984; Pinol-Roma et al., 1988; Wilk et al., 1985). Using these methods, more than 20 major proteins in hnRNP complexes, designated hnRNP Al to hnRNP U, were identified as well as numerous less abundant components. While the diversity of hnRNPs seen in vertebrates is lacking in other organisms, hnRNPs have been identified in numerous distant organisms including Xenopus, Drosophila, and Saccharomyces. Due to their intimate association with hnRNA, hnRNPs were originally speculated to function in mRNA biogenesis. Evidence has accumulated suggesting that hnRNPs play vital roles at many, if not all, levels of RNA processing (Weighardt et al., 1996).


Structure and Function of HnRNPs

HnRNPs are very abundant proteins. The core hnRNPs (A1, A2, B1, B2, C1, C2) are as abundant as core histones (70-90 x 106 / HeLa cell) and more abundant than ribosomes (4 x 106 / HeLa cell). HnRNPs also contain highly conserved structural motifs required for RNA binding. These are the consensus sequence RNA binding domain (RBD or RRM), RGG box, and KH domain. The most prevalent structural motif is the RBD/RRM, also called the RNP motif. This domain is often found in multiple copies in many pre-RNA binding proteins (Dreyfuss, 1993). The RGG box is a short region of 20 to 25 amino acids that contains several arginine-glycine-glycine (RGG) tripeptide






23


repeats. RNA binding characteristics of the RGG box differ with respect to the protein that contains it. Some RGG box domains bind RNA without sequence preference (Ghisolfi et al., 1992). Others, like that in hnRNP U, are sequence specific. The K homology (KH) domain was originally identified in hnRNP K (Matunis et al., 1992; Siomi et al., 1993). This domain is also evolutionarily conserved and has been demonstrated to bind RNA in vitro.


Pre-mRNA Splicing

HnRNPs have been shown to function in many RNA processing events. Numerous hnRNPs have a role in pre-mRNA splicing and alternative splicing. Antibodies against hnRNPs Al or Cl/C2 inhibit the 5'-cleavage reaction during splicing (Choi and Dreyfuss, 1984; Sierakowska et al., 1986). HnRNP Al is involved in the regulation of 5' splice site choice by activating use of distal 5' splice sites in a concentration dependent manner (Mayeda and Krainer, 1992). It also appears that hnRNP Al is an important part of the cellular response to osmotic stress conditions. Under osmotic stress conditions, hnRNP Al is phosphorylated and accumulates in the cytoplasm. This correlates with a shift in the alternative splicing pattern of a reporter construct in vivo (van der Houven van Oordt et al., 2000). The polypyrimidine tract binding protein (PTB) has been identified as hnRNP I, and its presence regulates the use of 3' splice sites. A neurally enriched form of PTB was recently identified and is implicated in the regulation of tissue specific alternative splicing (Markovtsov et al., 2000). Splicing of the c-src neuron-specific Nl exon is also repressed in vitro by the addition of PTB (Chou et al., 2000). HnRNPs have also been identified in yeast (Wilson et al., 1994). Interestingly, although Nab4p resembles hnRNP Al (by comparison of






24


structural motifs), yeast hnRNPs have not been demonstrated to be directly required for pre-mRNA splicing.


Pre-mRNA 3'-End Formation

The process of 3'-end formation in metazoans does not appear dependent on hnRNPs. However, the yeast hnRNP Nab4p was identified as CF IB, a component of the cleavage and polyadenylation complex (Kessler et al., 1997). Nab4p was also shown to regulate 3'-end cleavage site choice in vitro, much like hnRNP Al concentrationdependent regulation of splice site choice (Minvielle-Sebastia et al., 1998). Nab2p, another yeast hnRNP, is required for poly(A) tail length regulation and mRNA export in vivo (Anderson, 1995; Anderson et al., 1993). Other Functions of HnRNPs

HnRNPs also bind single-stranded DNA, making them potential transcriptional regulators. Binding of hnRNP K to the c-myc promoter in vitro has been shown to facilitate transcription (Michelotti et al., 1996). Many hnRNPs have also been identified as shuttling proteins (Shyu and Wilkinson, 2000). Some have even been visualized traversing the nuclear pore, associated with mRNA (Alzhanova-Ericsson et al., 1996; Sun et al., 1998; Visa et al., 1996). While suggestive of potential cytoplasmic functions, only in the past few years have hnRNPs been demonstrated to function in the cytoplasm. Translation is affected by three different hnRNPs under different circumstances. HnRNP A2 enhances the translation of a reporter mRNA containing a short, 21 nucleotide, cis element (Kwon et al., 1999). Translation silencing, in some instances, is mediated by hnRNP K and El, via inhibition of 80S ribosome assembly (Ostareck et al., 1997).






25


Stability of mRNAs containing AU-rich elements (AREs) has been linked to hnRNP D. Binding of hnRNP D to the ARE correlates with the decreased stability of AREcontaining mRNAs (DeMaria et al., 1997; Kiledjian et al., 1997; Loflin et al., 1999). A cytoplasmic role for Nab4p was also recently identified. Nab4p was shown to trigger decay of mRNAs with a premature stop codon via the nonsense-mediated decay (NMD) pathway in yeast (Gonzalez et al., 2000).


Mechanisms for HnRNP Function

HnRNPs are thought to exert their functions in numerous ways. The RNA in an hnRNP complex is accessible to RNases, suggesting that hnRNPs promote the display of sequences that would otherwise be hidden. These sequences may recruit splicing components to facilitate pre-mRNA splicing. It is also possible that hnRNPs compete with other factors for RNA binding sites, negatively regulating the use of those sites. Examples of this are seen with hnRNP K and the inhibition of transcription from the neuronal nicotinic acetylcholine receptor promoter (Du et al., 1998). HnRNPs have also been demonstrated to contain RNA annealing activities. This may facilitate the formation or destabilization of RNA structures that could serve as binding sites for other factors. It is also possible that some hnRNPs function to directly recruit specific RNA processing factors, or stabilize complex formation on the RNA.














MATERIALS AND METHODS


Growth Conditions and Media


Yeast cells were grown in either YPD, YPGal (1% Bacto-yeast extract (Fisher), 2% Bacto-peptone (Fisher), 2% dextrose (Fisher) or 2% galactose (Sigma, St. Louis, MO), 2% Difco-agar for plates), synthetic dextrose (SD), or synthetic galactose (SG) media (0.67% Bacto-yeast nitrogen base w/o amino acids, 2% dextrose or 2% galactose, 2% Difco-agar) supplemented with L-amino acids as needed (Rose et al., 1990). Prior to sporulation diploid cells were grown overnight on pre-sporulation plates (0.8% Bactoyeast extract, 0.003% Bacto-peptone, 10% dextrose). Cells were then transferred to sporulation plates (1% KOCH3, 0.025 mg/ml ZnOCH3) to induce spore formation. For liquid cultures, yeast strains were grown in a water bath at the specified temperature. Plasmid shuffling was accomplished by using 5-fluoro-orotic acid (5-FOA, Diagnostic Chem. Ltd.) to evict plasmids carrying URA3 (Sikorski and Boeke, 1991). All of the yeast strains used in this study are described in the appendix.

Bacteria were cultured at 37'C in Luria-Bertani media (1% Bacto-tryptone, 0.5% Bacto-yeast extract, 1% NaCl, pH 7.5, 2% Difco-agar for plates) supplemented with 100 tg/ml ampicillin as required. Unless otherwise stated, all bacterial plasmids and yeast shuttle vectors were propagated in E. coli strain DH5a (supE44 Alac U169 [480 lacZAM15] hsdR17 recAl endAl gyrA96i thi-l relA1).


26






27


Cell Transformations


Yeast cell transformations were performed essentially as described (Ito et al., 1983). Yeast cells were grown to an OD600=0.5 in YPD or SD. Approximately 5 0D600 units of cells per transformation were harvested by centrifugation at 1,500 x g for 5 minutes. Cells were washed once in 10ml of ice-cold sterile d2H20 and pelleted as before. The cell pellet was resuspended in 100 tl TE/0.1 M lithium acetate, 5 pag of denatured calf-thymus DNA, and 1 to 5 ptg of plasmid DNA. To the cell-plasmid mixture, 600 jtl of 40% PEG3500 in TE/0.1 M lithium acetate was added. This mixture was incubated at room temperature for 30 minutes, rotating end over end. Cells were heat shocked at 42'C for 15 minutes and washed two times with sterile 1 M sorbitol. Cells were resuspended in 500 p1 sterile 1 M sorbitol and 100 pl of cells was spread on SD plates. SD plates were supplemented to allow growth of cells that received the transforming DNA.

Bacterial cells (DH5x) were made electro-competent for transformation as described previously (Sambrook et al., 1989). Transformations of E. coli were performed using a gene pulser (BioRad, Richmond, CA) according to the manufacturer's instruction.


Yeast Genetic Manipulations


All genetic manipulations were performed as previously described (Guthrie and Fink, 1991). Yeast cells were mated by patching haploid strains together on YPD, incubating at 240C for 3 to 5 hours, and plating cells on media to select for diploids. Segregation analysis was done by digesting the spore wall for 10 to 30 minutes in 1.0 M sorbitol, 0.5 mglml Zymolyase 20T (Seikagakua Corporation, Tokyo, Japan). Digested






28


asci were transferred to YPD plates for micromanipulation to separate individual spores. Dissected spores were allowed to germinate and form colonies at 24�C unless otherwise stated. Cells were replica plated onto SD plates to test for auxotrophic markers. Conditional lethal phenotypes were determined by replica plating at various temperatures or concentration of stress agents.


Nucleic Acid Isolation Procedures


Yeast genomic DNA was isolated from cells grown in YPD to OD600=1-3. Five milliliters of cells were pelleted by centrifugation at 1,250 x g for five minutes. Cells were resuspended in 0.5 ml of 1 M sorbitol, 100 il 0.5 M EDTA, pH 8.0, 18 pl 1 M dithiothreitol (DTT, Gibco BRL, MD), and 50 p1 of 5 mg/ml Zymolyase 100T (Sekagaku Corp.) and incubated for 1 hour at 37�C. Spheroplasts were harvested by microcentrifugation at 3,000 x g for 1 minute. Spheroplasts were lysed by resuspension in 500 p1 50 mM Tris-HCl, pH 7.5, 20 mM EDTA, 1/10 volume 10% sodium dodecyl sulfate (SDS, Gibco BRL) and incubated at 651C for 30 minutes, with periodic mixing. To remove cell debris, 200 ul of 5 M potassium acetate was added and incubated on ice for 20 minutes. Insoluble components were pelleted by microcentrifugation at 16,000 x g for 15 minutes at 4�C. The supernatant was transferred to a new microfuge tube and the DNA was precipitated by adding one volume of isopropanol and incubating at room temperature for 10 minutes. DNA was pelleted at 16,000 x g for 1 minute at room temperature, washed with 70% ethanol and dried in a SpeedVac (Sevant, Marietta, OH). The DNA was resuspended in 250 p1 TE and treated with 5 p1l of 10 mg/mi RNase A (Sigma) at 37�C for 1 hour. The lysate was extracted twice with phenol and genomic






29


DNA was precipitated using 1/10 volume of 3 M sodium acetate (Fisher) and two volumes of ethanol. The DNA was recovered by centrifugation, washed, dried and resuspended in 100 p1 TE.

Plasmids were rescued from yeast using a previously described method (Strathem and Higgins, 1991) and DNA from crude lysates was purified using a Gene Clean kit (BIO101, Vista, CA).

Total RNA was isolated from yeast cells by extraction with 65'C acid equilibrated phenol as previously described (Guthrie and Fink, 1991). Cells were grown in the specified media to OD600=0.5- 1.0 and harvested by centrifugation at 2,000 x g for 5 minutes at 4'C. After hot acid-phenol extraction, the total RNA was extracted twice with phenol and once with chloroform:isoamyl alcohol. RNA was precipitated using an equal volume of 4 M ammonium acetate and 2 volumes of ethanol. Pelleted RNA was resuspended in diethyl pyrocarbonate (DEPC, Sigma)-treated d2H20. Poly(A)+ RNA was isolated from total RNA by selecting two times on oligo(dT)-cellulose (Gibco BRL or poly(U) Sephadex (Amersham-Pharmacia, Piscataway, NJ) as previously described (Cleaver et al., 1996). Poly(A)+ RNA was bound in binding buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.5% SDS, 0.5 M LiCl) for 30 minutes at room temperature with gentle mixing. After washing thoroughly with binding buffer, poly(A)+ enriched RNA was eluted with elution buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.05% SDS). When necessary, poly(A)+ RNA was concentrated using sec-Butanol (followed by two phenol extractions and one chloroform:isoamyl alcohol extraction) prior to precipitation with 1/10 volume of 3 M sodium acetate and 2 volumes of 100% ethanol. Poly(A)+ RNA






30


was resuspended in DEPC-treated d2H20 and the concentration was determined spectrophotometrically by A260.


DNA and RNA Blot Analysis


Yeast genomic DNA (10-20 tg) was treated with restriction endonucleases, separated by agarose gel electrophoresis and transferred to a charged nylon membrane (Hybond N+ Amersham Corp., Arlington Heights, IL) by capillary blotting (Sambrook et al., 1989). Yeast RNA samples were treated with dimethylsulfoxide (DMSO, Fisher)/glyoxal (Sigma or Alrdrich) fractionated on 1.2-1.6% agarose gels and transferred to a charged nylon membrane in 20X standard sodium citrate(SSC, 3 M NaCl, 0.3 M Na3C6H5O7o2H20, pH 7.0) (Sambrook et al., 1989). Hybridizations were performed in a hybridization oven (Robbins Scientific Corp., Sunnyvale, CA) at 42'C for oligo probes or 65'C or random prime labeled probes, for a minimum of 12 hours in hybridization solution (1% bovine serum albumin (BSA, Sigma), 1 mM EDTA, 25 mM Na2HPO4 (Fisher), and 7% SDS). RNA blots were washed twice at room temperature in 2X SSC/0.1% SDS for 15 minutes, followed by at least two more washes in 0.2X SSC/0.1% SDS at a temperature 0-51C below the hybridization temperature for 15 minutes each. Radio-labeled probes were prepared using a Random Prime Labeling kit (Gibco/BRL) and [c32p]-dCTP (3000 Ci/mmol, NENTM Life Sciences, Boston, MA). Oligo DNA probes were 5'-end labeled using T4 polynucleotide kinase (Promega Corp., Madison, WI) and [y32p]-ATP (3000 Ci/mmol, NENTM).






31


Yeast Total Cell Protein Isolation


Yeast cells were grown to OD600=0.5 to 1.0 and harvested by centrifugation. Cells were washed once with ice-cold sterile d2H20 and resuspended in 200 tl of icecold 10% trichloroacetic acid (TCA, Fisher). Acid washed glass beads were added to just below the meniscus. The glass bead mixture was vortexed four times for 15 seconds each with cooling on ice between vortexing. The cell lysate was removed and 200 jdl of fresh 10% TCA was added to the glass beads and vortexed for 15 seconds. The wash was removed and added to the cell lysate. Precipitated cellular proteins were pelleted by centrifugation at 14,000 x g at 4'C for 10 minutes. The protein pellet was resuspended in Laemmli cocktail and neutralized with 1.0 M Tris-base. Protein samples were boiled for

3 minutes prior to fractionation by SDS-PAGE.


Tandem Affinity Purification of Nab2p


The carboxy-terminus of Nab2p was tagged with a Calmodulin Binding Peptide (CBP) and the Staphylococcus aureus Protein A (ProtA) to generate Nab2p-TAP (YKN206 was generated by K. Nykamp). A Tobacco Etch Virus protease cleavage site was included between the CBP sequence and ProtA. This allowed for two successive rounds of purification. Homologous recombination was used to insert the fusion protein coding sequence at the 3'-end of the NAB2 gene in L4717 cells, using the TRPJ gene for selection. Cells expressing only the TAP-Nab2p fusion were isolated (YKN2O6). To purify Nab2p-TAP from yeast cells, total protein extracts were prepared from YKN2O6 cells grown to mid-log phase at 30�C. Cells were harvested by centrifugation and resuspended in Buffer A-TAP (10 mM HEPES-K+, pH 7.9, 10 mM KCl, 1.5 mM MgC12,






32


0.5 mM DTT) with protease inhibitors (0.5 mM PMSF, 2 mM Benzamidine, 1 tM Leupeptin, 2 [iM Pepstatin, 4 jtM Chymostatin, and 2.6 jtM Aprotinin). Whole cell lysates, by French press, were cleared by centrifugation at 60,000 x g for 30 minutes at 4'C. This was followed by centrifugation of the supematant at 130,000 x g for 90 minutes at 4'C. The supematant was dialyzed against lOOX volume of Buffer D-TAP (20 mM HEPES-K+, pH 7.9, 50 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, 20% glycerol) with protease inhibitors (0.5 mM PMSF, 2 mM Benzamidine) and stored at -80'C until purification.

Nab2p-TAP was purified using the previously described tandem-affinity purification procedure (Rigaut et al., 1999). Protein extracts were incubated with IgGSepharose beads (Amersham-Pharnacia) at 4'C for 2 hours. The beads were washed with IPP 150 Buffer (10 mM Tris-HC1, pH 8.0, 150 mM NaCl, 0.1% NP40) followed by incubation with 1 ml of TEV Cleavage Buffer (10 mM Tris-HC1, pH 8.0, 150 mM NaCl, 0.5 mM EDTA, 0.1% NP40, 1 mM DTT) and 100 units of TEV protease (Gibco BRL) at 16'C for 2 hours. Cleavage released Nab2p-TAP from the beads and the eluate was collected. Nab2p-TAP was re-purified on calmodulin affinity resin (Stratagene, La Jolla, CA) by incubation in Calmodulin Binding Buffer (10 mM Tris-HC1, pH 8.0, 150 mM NaCi, 1 mM MgOAc, 1 mM imidazole, 2 mM CaC12, 0.1% NP40, 10 mM 3Mercaptoethanol (13ME, Sigma) for 60 minutes at 4'C. Nab2p-TAP was eluted by addition of 800 jil of Calmodulin Elution Buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaC1, 1 mM MgOAc, 1 mM imidazole, 2 mM EGTA, 0.1% NP4O, 10 mM f3Mercaptoethanol).






33


In vitro 3'-End Processing Assays


In vitro polyadenylation reactions were performed using a homogeneously labeled precursor RNA. Unless otherwise stated, the substrate RNA used was pre-cleaved CYC1, transcribed from the p-G4CYCl-pre plasmid, linearized with NdeI. In vitro transcription reactions were performed in 50 tl reactions containing 1 [tg pG4CYC 1 -pre, lx T7 transcription buffer (Promega), 2.0 mM DTT, 1 tl RNasin (Promega), 0.5 mM GpppG cap (Amersham Pharmacia), 0.5 mM each ATP, CTP and 0.02 mM GTP and UTP, 40 iCi [a32p] UTP (NENTM) and 15 units T7 RNA polymerase. The reaction was incubated at 37�C for 1 to 2 hours. Template DNA was digested with RQl RNase-free DNase (Promega) for 15 minutes at 37'C. The RNA was phenol extracted and precipitated in the presence of 10 gg of RNase-free glycogen. The labeled precursor RNA was gel purified as previously described (Sambrook et al., 1989). Cell extracts competent for 3'-end processing in vitro were prepared essentially as described (Butler and Platt, 1988; Butler et al., 1990). One liter of cells was grown in YPD + Ade to OD600=2-6, harvested and resuspended in 15 ml of Buffer S (1.0 M sorbitol (Sigma)/50 mM Tris-HC1, pH 7.8, 10 mM MgCl2, 30 mM DTT) and incubated for 15 minutes at room temperature. Cells were harvested and resuspended in 15 ml of Buffer S with 40100 [d of 20 mg/ml Zymolyase 100T (Seikagaku Corp., Tokyo, Japan). This mixture was incubated at 300C with gentle shaking for 30-60 minutes, until greater than 90% of the cells were spheroplasted, as determined microscopically by cell lysis in 1% SDS. Spheroplasts were collected by centrifugation and gently resuspended in ice cold Buffer A (10 mM HEPES-K+, pH 7.0, 1.5 mM MgC12, 10 mM KCl, 0.5 mM DTT, 4 mM






34


Pefabloc-SC) with lx PicW (1 M c-aminocaproic acid, 1 M p-aminobenzamidine, 1 mg/ml leupeptin, 2 mg/mi aprotinin, in d2H20) and l x PicD (0.5 M phenylmethylsufonyl fluoride (PMSF), 5 mg/mi pepstatin A, 1 mg/ml cymostatin, in DMSO). The resuspended spheroplasts were lysed on ice in a glass homogenizer (Wheaton, Millville, NJ) using 6 strokes with the tight pestle. The cell lysate was brought to 0.2 M KCI and stirred slowly on ice water for 30 minutes. The cell lysate was cleared first by centrifugation at 22,000 x g for 30 minutes at 4�C. This was followed by centrifugation at 145,000 x g for 60 minutes at 4'C in a Ti 70.1 rotor (Beckman). The whole cell extract was removed carefully to avoid the pellet and the top lipid layer. This was brought to 40% saturation with ammonium sulfate (0.226 g/ml). The ammonium sulfate was allowed to dissolve by stirring gently on ice water for 5 minutes, and then incubated on ice for 20 minutes. The precipitated proteins were collected by centrifugation at 15,000 x g for 20 minutes at 4'C and typically resuspended in 0.5-1 ml of Buffer B (20 mM HEPES-K+, pH 7.0, 0.2 mM EDTA, 50 mM KCl, 20% glycerol, 0.5 mM DTT, 0.4 pM leupeptin, 0.7 ptM pepstatin A, and 0.1 M PMSF). The extract was dialyzed at 4'C against 1 liter of Buffer B, two times for 1.5-2 hours each. The extracted was aliquoted, flash frozen in liquid nitrogen and stored at -80'C. In vitro polyadenylation reactions were performed in 25 g1 using 2-3 g1 of extract, approximately 10 fimole of labeled precursor RNA (-300,000 cpm), 2 mM ATP, 20 mM creatine phosphate, 1 mM MgOCH3, 2% polyethylene glycol8000, 75 mM KOCH3, 1 mM DTT, and 1 U/ptl RNasin (Promega) (final concentrations). Reactions were typically carried out at 300C for 20-30 minutes and stopped by adding 1/10 volume of a stop buffer (2 mg/ml proteinase K (Roche Biomedical), 130 mM EDTA, 2.5% SDS) and incubated at 37�C for 30 minutes.






35


Reactions were phenol extracted two times, chloroform:isoamyl alcohol extracted once and precipitated using ammonium acetate and 10 [ig of RNase-free glycogen. The reaction products were resolved on denaturing 6% polyacrylamide (29:1 acrylamide:bisacrylamide) gels followed by autoradiography.


Indirect Cellular Immunofluorescence


Subcellular localization of proteins was performed using the following method. Cells were grown to an OD600=0. 1-0.5 in YPD, unless otherwise stated. For each strain, 10% formaldehyde (freshly prepared from paraformaldehyde (EM grade, Polysciences, Warrington, PA) in 100 mM KH2PO4, pH 6.5) was added to a final concentration of 4% to 1.5 X 108 cells and incubated at room temperature with gentle rocking for 2 hours. Fixed cells were pelleted at 800 x g for 2.5 minutes at room temperature and washed twice in 25 ml of WBlI (100 mM KH2PO4, pH 6.5) and once in 25 ml of WB2 (100 mM KH2PO4, pH 6.5, 1.2 M sorbitol). Cells were pelleted as before, resuspended in 1 ml of SB (100 mM KH2PO4, pH 6.5, 1.2 M sorbitol, 30 mM PME) and 30 pil of 10 mg/ml Zymolyase lOOT in WB2 was added. Cells were incubated for 30-45 minutes until greater than 90% spheroplast formation was achieved. Spheroplasts were monitored by phase-contrast microscopy (400X magnification). Spheroplasts were collected by centrifugation at 2000 x g for 1 minute at room temperature and washed once with WB2. Cells were resuspended in 1 ml of WB2 and were adhered to polylysine-coated 10-well HTC Blue slides (Cel-Line Associated, Newfeildm NJ) for 10 minutes at 40C using 10 iil/well. Slides were washed once in ice-cold PBS and sequentially incubated at -200C in 100% methanol for 5 minutes and 100% acetone for 30 seconds. Slides were washed






36


three times with PBS, incubated in 0.1% Triton X- 100 (Sigma) in PBS and washed three more times in PBS. Slide wells were blocked by incubation with 10 tl of 3% BSA in PBS for 30 minutes at room temperature. Primary antibodies were diluted in 3% BSA in PBS and incubated at room temperature for 60 minutes. Antibodies were diluted as follows: 3F2(1:500), 1Gi(1:5000), 3H1(1:500), 4C3(1:500), A66(1:500). Primary antibodies were detected using fluorescein or rhodamine-conjugated goat anti-mouse IgGI or IgG2a subclass-specific antibodies (Fisher) diluted 1:10 in 3% BSA in PBS. Secondary antibodies (10 gl/well) were incubated for 30 minutes at room temperature, washed tree times in ice-cold PBS followed by staining with 0.5 gg/ml 4'6-diamidino-2phenylindole (DAPI) and washed three more times in ice-cold PBS. Mounting media (1 mg/ml p-phenylenedianine (Sigma) in 90% glycerol) was applied and the slides were sealed with a coverslip and clear nail polish. Fluorescent images were obtained using a Nikon Optiphot-2 microscope equipped with a 1OX fluorescence/differential interference contrast (DIC) objective, or by digital microscopy as described previously (Wilson, 1996).


In Situ Hybridization and Cellular Immunofluorescence


The subcellular distribution of poly(A) RNA was examined by in situ hybridization of digoxigenin-labeled (dT)50 (Amberg et al., 1992) using a modification of a protocol kindly provided by A. de Bruyn Kops and C. Guthrie (University of California, San Francisco, CA). Cells were grown to 0D600=0.5- 1.0 and 1.5 X 108 cells were fixed, washed, digested, and washed again as for indirect cellular immunofluorescence, and resuspended in 0.5 ml WB2. Cells were adhered to polylysine-






37


coated slide wells and treated with methanol and acetone as before. Treated slides were dried in a Speedvac (Savant) for 1 minute. Slides were pre-warmed in a 37'C humidifier chamber. Hybridization solution was prepared using diethlpyrocarbonate-treated water and contained 10% dextran sulfate, 5X standard sodium citrate(SSC), IX Denhardt's solution (0.2 mg/ml ficol type 400 (Sigma), 0.2 mg/ml polyvinylpyrrolidone (Sigma), BSA), 33% deionized formamide, 10 mM vanadyl ribonucleoside complex (Aldrich), 100 jig/ml denatured salmon sperm DNA, 200 jig/ml tRNA, 0.68 Rg/ml digoxigeninlabeled (dT)50. Digoxigenin was conjugated to (dT)50 as described previously (Amberg et al., 1992). Hybridization was for 12-14 hours at 37'C followed by washes to remove excess probe as described previously (Amberg et al., 1992). Individual slide wells were sequentially incubated with 15 jtl of the following solutions for 30 minutes at 37'C: (1) 3% BSA in PBS (antibody binding buffer); (2) anti-digoxigenin monoclonal antibody (IgG1 sub-class, Boehringer-Mannheim) diluted 1:50 in AB; (3) fluorescein-conjugated goat anti-mouse IgG1 subclass-specific antibody (Southern Biotechnology Associated, Birmingham, AL) diluted 1:10 in AB. Finally, DNA was stained by treating cells with DAPI as described above. Following each of these steps, slides were washed three times in ice-cold PBS. Slides were mounted and viewed as described above.


Yeast Two-Hybrid Screen

Proteins that interacted with Nab2p in vivo were identified using the
TM
MATCHMAKER Two-Hybrid System, according to the manufacturer's instruction (Clontech, Palo Alto, CA). The coding region of NAB2 was PCR amplified, and subcloned into EcoRI-BamHI digested pGBT9 to generate pNAB2.GBT9. This plasmid






38


was transformed into the host yeast strain Y190 (Harper et al., 1993) and the production of fusion protein was confirmed by immunoblot analysis using the monoclonal antibody 3F2. This cell was transformed with a yeast cDNA library, generously provided by John P. Aris (University of Florida, Gainesville, FL) or a human library (Clontech). Transformants that were His+ and f3-galactosidase+ were retained for isolation by plasmid rescue. Interacting proteins were identified by sequencing the ends of the plasmid insert and comparison to the yeast genome using BLAST (NCBI).


Determination of Poly(A) Tail Lengths


Poly(A) tail length analysis was performed as described previously (MinvielleSebastia et al., 1991). Total RNA (1 tg) was 3'-end labeled in a 30 gl reaction containing 50 mM HEPES pH 8.3, 5 jtM ATP, 10 mM MgC12, 3.3 mM DTT, 10% DMSO, 300 jig/ml acetylated BSA, 40 jiCi of [32p]pCp (NEN) and 20 U of T4 RNA ligase (New England Bio-labs, Beverly, MA) for 20 hours at 00C. Non-poly(A) RNA was digested using 30 jig yeast tRNA, 80 U RNase Tl, 4 jtg RNase A, 10 mM Tris-HC1 pH 7.5, and 0.3 M NaCl in a final volume of 80 tl at 37 'C for 2 hours. The digestion was stopped by adding 20 pll of 130 mM EDTA pH7.4, 2.5% SDS, and 2 mg/ml proteinase K and incubated at 37'C for 30 minutes. The poly(A) tails were phenol extracted twice, chloroform:isoamyl alcohol extracted once and precipitated using ammonium acetate and 5 jig of RNase-free glycogen (Boerhinger Mannheim). Poly(A) tails were fractionated on a 8% denaturing polyacrylamide gel and visualized by autoradiography.






39


Analysis of poly(A) tail length on specific RNAs was performed using two methods. First, 10-20 lig of total RNA was incubated with a DNA oligo complementary to the 3'-end of the ORF. This was incubated with RNase H with and without oligo (dT) in a 25 tl reaction containing 20 mM Tris-HC1, pH 7.5, 10 mM MgC12, 1 mM EDTA, 20 mM NaCl, 2 mM DTT, 60 ig/ml acetylated BSA, 800 ng mRNA specific oligo, 300 ng oligo (dT)12-18, at 37�C for 60 minutes. The digested RNA was fractionated on a 4% denaturing polyacrylamide gel. The urea was removed from the gel by washing in transfer buffer (10 mM Tris-OCH3, pH 7.8, 0.5 mM EDTA, 5 mM NaOCH3) two times for 20 minutes. Fractionated RNAs were transferred to a charged nylon membrane using a semi-dry transfer apparatus following the manufacturer's (Gibco-BRL) instruction. RNA blots were probed using a second DNA oligo complementary to the remaining 3'UTR.

Ligation-mediated reverse transcription PCR (LM-RT-PCR) was also used to analyze mRNA specific poly(A) tail lengths. Poly(A)+ digested with RNase-free DNase (RQl DNase, Promega) in a 25 jtl reaction containing 1/5 volume 5X transcription buffer, 1 Il RQlI DNase, 1 .dl RNasin (40 U/ td, Promega), and 1 mM DTT. The reaction was incubated at 371C for 30 minutes followed by two phenol extractions and one chloroform:isoamyl alcohol extraction. The RNA was precipitated using ammonium acetate, and resuspended in DEPC-treated d2H20 at a concentration of 1 tg/tl. The poly(A)+ RNA was diluted to 1-10 ng in 5 tl of DEPC-treated d2H2O for cDNA synthesis. Poly(A)+ RNA was hybridized to 20 ng of 5'-phosphorylated p(dT)12-18 (Gibco BRL) by incubating at 650C for 10 minutes and transferring immediately to a 42�C water bath. Ligation was initiated by adding 13 l~l of pre-warmed (42�C) reaction






40


mix (4 jul 5X Superscript II RT buffer, 2 p1 0.1 M DTT, 1 tl 40 mM dNTPs, 1 tl 10 mM ATP, 3 tl DEPC-treated d2H20, 1 ltl T4 DNA Ligase (>10 U/jtd), 1 ld RNasin) and incubating at 42'C for 30 minutes. While the reactions were at 42�C, 1 l (200 ng) of oligo(dT) anchor [5'-GCGAGCTCCGCGGCCGCGTI2] was added, vortexed, pulsed in a microfuge, and incubated at 12'C for 2 hours. Reverse transcription was started by transferring the ligation back to 42�C and adding 1 l of Superscript II RT (200 U/pI, Gibco BRL) and incubating for 60 minutes. The reaction was stopped by heat inactivation at 65�C for 20 minutes. This was used directly for PCR amplification of the poly(A) tail. Amplifications were performed in a reaction volume of 25 pl (50 mM KCI, 20 mM Tris-HCl, pH 8.4, 1.5 mM MgCl2, 0.2 mM each dNTP, 0.5 M mRNA specific primer, 0.5 jM oligo(dT)-anchor, 1.0 U Taq. Polymerase, 0.5 ll PAT cDNA, 5-10 iCi [Xa32P]-dATP and d2H20 to volume). Reaction products were fractionated on 6-8% denaturing polyacrylamide gels and visualized by autoradiography.


Isolation of Hyperpolyadenylated RNAs and Construction of a cDNA Library


Total RNA was isolated from 1.5 liters (3 x 500 ml cultures) of GAL::NAB2 cells shifted from YPGal to YPD for 16 hours. Cells were harvested by centrifugation at 1,500 x g for 5 minutes at 4'C and washed once with 40 ml of ice-cold d2H20. Cells were pelleted, resuspended in 36 ml of AE buffer (50 mM NaOCH3, pH 5.3, 10 mM EDTA) and aliquotedi to four 50 ml conical tubes (9 ml each). To each of these, 1 ml of 10% SDS was added, followed by 15 ml of AE/phenol (68�C). This was vortexed briefly every 30 seconds for 5 minutes, cooled in a dry, ice/ethanol bath, and phases separated by centrifugation at 3,000 x g for 5 minutes. The aqueous phase transferred to new tubes,






41


extracted once more with 15 ml of AE/phenol, and precipitated using sodium acetate and ethanol. Total RNA was collected by centrifugation at 14,000 x g for 15 minutes at 4'C and washed with 70% ethanol. Finally, the RNA was resuspended in 0.5 ml of DEPCtreated d2H20 and extracted twice with phenol, once with chloroform:isoamyl alcohol, and re-precipitated.

To isolate hyperpolyadenylated RNAs, total RNA was incubated with 1.0 g of poly(U) Sephadex in 20 ml BB70 buffer (10 mM Tris-HC1, pH 7.4, 1 mM EDTA, 0.5% SDS, 0.5 M LiC1, 70% formamide) at room temperature for 60 minutes. The poly(U) Sephadex was washed 3 times with 10 ml BB70, 3 times with 10 ml BB, and RNAs were eluted with by 10 washes with 4 ml EB (10 mM Tris-HC1, pH 7.4, 1 mM EDTA, 0.05% SDS) for 5 minutes each at room temperature. Two 20 ml fractions were collected and the volume reduced no more than 10-fold using sec-butanol. The eluted RNA was phenol extracted twice and extracted with chloroform:isoamyl alcohol once. Aliquots of 400 Il/microfuge tube were precipitated using sodium acetate and ethanol in the presence of 0.5 lag RNase-free glycogen at -20'C for 16 hours. The RNA was pelleted at 16,000 x g for 60 minutes at 4'C, washed with 70% ethanol and resuspended in 15 p1 total volume. The RNA concentration was quantified using a 50 pl cuvette and determining the A260. A cDNA library was prepared from this RNA using a kit from Stratagene, and following the manufacturer's instruction.


High Copy Suppression Analysis of a nab2A Strain


YRH2O1C cells grown in YPGal were transformed using polyethylene glycol and lithium acetate with a YEpl3 genomic library (ATCC, Rockyille, MD). Transformed






42


cells were plated onto synthetic dextrose medium lacking uracil and leucine (SD-UraLeu). To determine the transformation efficiency, 1% of the transformation was plated onto synthetic galactose medium lacking uracil and leucine (SGal-Ura-Leu). This procedure yielded approximately 106 Leu transformants, of which 37 were able to grow on YPD (Nab2p repressive conditions). These colonies were plated to SD-Ura-Leu and screened by whole cell PCR to eliminate library plasmids containing the NAB2 gene. The library plasmid pHSN220 was rescued using GENE Clean (BIO 101, Vista, CA) and the ends of the insert were sequenced using primers MSS737 and MSS738. The sequence identified a 10 kb region that included the PAB] open reading frame.

To confirm that growth complementation was dependent on the PAB] gene, PAB] was PCR amplified from L4717 genomic DNA using primers MSS744 and MSS745. This fragment, containing only the PAB] gene, was cloned into YEpl3 to generate pPAB 1. YRH201C cells transformed with pPAB 1 were plated to SGal-Ura-Leu. Leu+ transformants were re-plated to SD-Ura-Leu to confirm high copy suppression by PAB!. The pGAL::NAB2 plasmid was also evicted by selection on 5-FOA, which demonstrated that high copy PAB] was able to compensate for the absence of Nab2p.


Reverse Transcription-Polymerase Chain Reaction


Total RNA (12 rig) was DNase treated in a 20 [d reaction containing lx T7 transcription buffer, 2 1 RNase-free DNase (Gibco-BRL), 1 l RNasin (Promega), 2 p1 10 mM DTT, for 30 minutes at 37�C. The RNA was phenol extracted twice, extracted with chloroform:isoamyl alcohol once and precipitated using ammonium acetate and ethanol. The RNA was resuspended in DEPC-treated d2H2O and 1 p1l of 1 .Lg/ptl oligo






43


d(T) was added prior to incubation at 70'C for 10 minutes, followed by incubation on ice for 2 minutes. Reverse transcription was initiated by addition of 14 pl of RT-mix (4 gl 5x Superscript II buffer, 1 gl RNasin, 2 ll 100 mg DTT, 2 l1 10mM dNTPs, 3 gl DEPCtreated d2H20, 2 gl Superscript II reverse transcriptase) and incubated at 42�C for 60 minutes. The cDNA was phenol extracted twice, extracted with chloroform:isoamyl alcohol once, precipitated using sodium acetate and ethanol and resuspended in 10 gl d2H20. Polymerase chain reaction amplification was performed using primers complementary to sequence 5' and 3' of the suspected intron. Amplification products were analyzed by fractionation on a 1.2% agarose gel.














RESULTS


Research Objectives


The polyadenylate tail has been demonstrated to play a major role in the metabolism of mRNA in the cytoplasm. Metabolism of mRNA is accomplished by interaction of the poly(A) tail with the cytoplasmic poly(A) binding protein Pablp. Pablp stimulates translation by recruiting the 60S ribosomal subunit (Sachs and Davis, 1989). Pablp also stabilizes mRNA by preventing 5'-decapping and degradation. Messenger RNA degradation is mediated by activation of a Pablp-dependent deadenylase activity during translation (Boeck et al., 1996; Brown et al., 1996). Nuclear functions of the poly(A) tail are much less clear. The requirement for a poly(A) tail in mRNA export is subject to dispute. Poly(A) mRNAs injected into Xenopus oocytes are exported to the cytoplasm, suggesting that a poly(A) tail is not required (Fischer et al., 1994; Hamm and Mattaj, 1990). In contrast, using COS7 cells, it has been demonstrated that a poly(A) tail is required for export (Huang and Carmichael, 1996). Experimental results also suggest that the process of polyadenylation is required, as a templated 3'terminal poly(A) tract does not facilitate export (Huang and Carmichael, 1996). The presence of a poly(A) tail may also protect nuclear hnRNA from nucleases (Ford and Wilusz, 1999). The overall goal of my research was to investigate the role of the poly(A) tail in pre-mRNA processing and nucleocytoplasmic mRNA export. This was achieved


44






45


using yeast genetics to alter the structure of the RNP-RNA complexes that are the substrate for both processing and export.

The yeast nuclear polyadenylated RNA-binding protein Nab2p was chosen for investigation due to its predominant nuclear localization, in vivo association with mRNA and high affinity for poly(A) RNA in vitro (Anderson et al., 1993), compared to other RNA-binding proteins such as Nab4p and Pub 1 p that demonstrate little or no poly(A)binding activity. These characteristics of Nab2p make it a potential functional PABP2 homologue.


Factors That Interact With Nab2p are Involved in Multiple Aspects of RNA Processing


Nab2p binding to the poly(A) tail may allow it to directly interact with the polyadenylation machinery, or possibly recruit other factors that inhibit elongation of the poly(A) tail and/or mediate mRNA export. Two alternative approaches were used to identify proteins that interact with Nab2p in vivo. A yeast two-hybrid screen using Nab2p as bait was performed with both yeast and human prey libraries. The nuclear poly(A) binding protein, PABP2, was identified from the human library, suggesting a role for Nab2p in poly(A) tail length regulation in yeast (Miller, 1998). Also supporting a role for Nab2p in 3'-end formation was the identification of Nab2p in a two-hybrid screen for proteins that interact with Nab4p (Krecic, 1998). Nab4p was identified as CFIB, a component of the 3'-end processing machinery required for selection of cleavage sites (Kessler et al., 1997; Minvielle-Sebastia et al., 1998). However, the proteins that showed the strongest interactions suggest that Nab2p might also be involved in other aspects of RNA processing (Table 2). These proteins have been reported to function in






46


Table 2. Proteins interacting with Nab2p


Yeast


PABP2

hnRNP D ....................
.............
......... ................ ... .. ::'..
Rab/hRIP 1

CUG-BP1


Pablp
INab4p
CthlIp h.....2p
Nab2p .
-' '';............. .................................. G ar
\ " -- ....... ............ G c p

Gcn3p Gfdlp I Npl3p

Ssel


Function


rlp 104p


Source


CUG-BP 1 polyadenylation, splicing (Miller, 1988) hnRNP D k2) mRNA stability (Miller, 1988) PABP2 polyadenylation (Miller, 1988) Rab/hRipl RNA export (Miller, 1988)

Yeast protein
Cthlp unknown This study Cth2p unknown This study Garlp RNA processing This study Gcn3p ' translational regulation (Uetz et al., 2000) Gfdlp 2) mRNA export (Uetz et al., 2000) Kapl04p ( hnRNP nuclear import K. Nykamp, unpublished Nab4p (2-) polyadenylation, cleavage site selection (Krecic, 1998) Npl3p 'z mRNA export, pre-rRNA processing, K. Nykamp, unpublished protein import
Pab l p ' translation initiation, mRNA stability K. Nykamp, unpublished Ssel p heat shock K. Nykamp, unpublished


Genetic interaction (1) Physical interaction (2)


Human


Human protein






47


mRNA export as well as mRNA 3'-end formation, nucleocytoplasmic mRNA export, premRNA splicing, and RNA stability.

Biochemical isolation of a soluble Nab2p complex also identified factors involved in mRNA export and polyadenylation. A soluble Nab2p complex was isolated using tandem affinity tag chromatography (K. Nykamp, unpublished). Proteins identified in the Nab2p complex include Nablp, Pablp, Kapl04p, and Sselp. NAB1/NPL3/NOP3/MTR13 has been implicated in protein import, poly(A)+ RNA export, and pre-rRNA processing (Flach et al., 1994; Lee et al., 1996). Pabpl has been implicated in poly(A) tail length regulation in vitro (Amrani et al., 1997; MinvielleSebastia et al., 1997). Kap104p is the import adapter, or karyopherin B, which mediates nuclear import of Nab2p (Aitchison et al., 1996). Sselp is an HsplI10 family member (Liu et al., 1999). Interestingly, SSEJ is also an extragenic suppressor of the tom1-2 allele which is defective in nucleocytoplasmic transport of poly(A)+ RNA (Duncan et al., 2000; Utsugi et al., 1999). These interactions support a role for Nab2p in both 3'-end formation and mRNA nucleocytoplasmic export. However, they do not rule out the possibility that Nab2p is required for other RNA processing events, such as pre-mRNA splicing.


Pre-mRNA 3'-End Processing

The first question addressed was how poly(A) tail length control is achieved in yeast, in the absence of a PABP2 homologue. Nuclear poly(A) tail length regulation in yeast could occur by several mechanisms (Figure 4). These include: (1) regulation of poly(A) tail synthesis; (2) regulation of deadenylation after poly(A) tail synthesis; (3) competition between poly(A) addition and mRNA export. Regulation at the level of


























Figure 4. Possible mechanisms for regulation of mRNA polyadenylate tail length in yeast. (A) Regulation of poly(A) synthesis.
(B) Regulation of deadenylation after synthesis. (C) Competition between poly(A) addition and mRNA export.








BC


El


export factors


ElJ--AAA\


~IILAAAAA4% (ID
deadenylase &vr r


deadenylation vt


~IliAA AA









nucleocytoplasmic
export


A


)AAA4


yAA


C






50


synthesis could utilize a functional PABP2 homologue to alter the structure of the poly(A) tail, or poly(A) polymerase activity may be directly modified. There is some indication that message-specific deadenylation occurs (Brown and Sachs, 1998) but it is unclear if this is a nuclear event. Also, message-specific deadenylation does not directly address control of nuclear tail length since deadenylation occurs after a maximal tail length of 70-90 nucleotides is reached. Competition between poly(A) addition and mRNA export is a possible, but unlikely mechanism. Most of the evidence does not support this mode of regulating poly(A) tail length. Poly(A) tail length does increase approximately 20 nucleotides when mRNA export is inhibited. However, this tail length increase is limited to 15-20 nucleotides and is believed to be due to the loss of cytoplasmic poly(A) trimming activity. As described below, regulation of poly(A) addition appears to be the predominant mechanism regulating tail length control in the nucleus.


Polyadenylation of mRNA is Regulated by Nuclear Poly(A) Tail Binding Proteins

In metazoans, length of the poly(A) tail in the nucleus is regulated by the poly(A) binding protein PABP2. PABP2 is believed to inhibit the poly(A) polymerase by altering the poly(A) tail structure once the poly(A) tail reaches 200 to 250 nucleotides (Bienroth et al., 1993). In contrast, the mechanism for controlling nuclear polyadenylation in yeast is not yet clear. Although the cytoplasmic poly(A) binding protein Pablp has been implicated in this process in vitro, Pablp effects on tail length in vivo are much less dramatic, suggesting the presence of a complementing factor in vivo. Since a structural homologue of PABP2 does not exist in S. cerevisiae, poly(A) tail length control must occur using another factor and/or by a different mechanism. The yeast heterogeneous






51


nuclear ribonucleoprotein, Nab2p, was previously identified as a nuclear poly(A)+ RNA binding protein capable of binding poly(A) RNA in vitro (Anderson et al., 1993). To determine if Nab2p was a nuclear poly(A) tail binding protein, cells were metabolically labeled using [35]methionine and subject to UV cross-linking to covalently link labeled proteins to nucleic acid. Poly(A)+ RNA was isolated using oligo(dT) cellulose and digested with RNases A and TI, leaving only poly(A) tracts. The poly(A) tails and associated proteins were re-isolated using oligo(dT) cellulose. The remaining labeled proteins were precipitated with TCA(trichloroacetic acid) after digesting the poly(A) RNA with nucleases. Nab2p and Pablp were immunoprecipitated from the pool of proteins, fractionated by SDS-PAGE(polyacrylamide gel electrophoresis), and visualized by fluorography. Nab2p levels associated with the poly(A) tail were approximately 5% of Pablp levels (Figure 5). This level is in agreement with the nuclear/cytoplasmic poly(A)+ RNA distribution; approximately 90% of the poly(A)+ RNA in a yeast cell is cytoplasmic (Groner and Phillips, 1975). Based on this, the amount of Nab2p crosslinked was expected to be approximately 10% of Pab Ip. Since Nab2p is predominately nuclear, these results suggested that Nab2p is intimately associated with poly(A) tails in the nucleus.

To determine if Nab2p was required for regulation of poly(A) tail length in yeast, conditional lethal nab2 alleles were analyzed. Nab2p was depleted in vivo using a derepressible/repressible GAL::NAB2 allele. The GAL:7NAB2 allele was generated by placing the NAB2 gene under control of the GAL] promoter. This was done in a haploid strain carrying a NAB2 chromosomal deletion. Cells survive on galactose containing media due to NAB2 expression from the GAL1.":NAB2 plasmid. When cells were shifted

























Figure 5. Nab2p is intimately associated with the poly(A) tail in vivo. Cellular protein was metabolically labeled using [35S]methionine and labeled proteins were covalently linked to nucleic acid by UV irradiation. Poly(A) RNA-protein complexes were isolated by oligo(dT)-cellulose chromatography. Non-poly(A) RNA was digested with RNase A and Tl. The remaining poly(A) RNA, and covalently attached protein, was re-isolated using oligo(dT)-cellulose, and poly(A) RNA was digested with micrococcal nuclease. Nab2p and Pablp were immunoprecipitated using monoclonal antibodies 3F2 and 1G1. Immunoprecipitated proteins were analyzed by SDS-PAGE and fluorography.





53



kDa 214


9771



.. . .. ... ..
4429





18-


14-






54


to glucose containing media, NAB2 expression was repressed and Nab2p levels decreased as the endogenous protein degraded (Figure 6B). Cells stopped growing because Nab2p is an essential protein (Figure 6A). Poly(A) tail length was monitored during Nab2p depletion by 3'-end labeling total RNA isolated at various times after shift to glucose. The labeled RNA was digested with RNases A and Tl to leave poly(A) tracts intact. Poly(A) tails were fractionated on an 8% polyacrylamide/urea gel and visualized by autoradiography. Loss of Nab2p correlated with increasing poly(A) tail length, implying that Nab2p was required regulation of nuclear poly(A) tail length (Figure 6C).

Another conditional lethal nab2 allele was isolated by PCR mutagenesis (Anderson, 1995). The nab2-21 allele contains a deletion of seventh C3H motif and a partial deletion of the sixth C3H motif at the carboxy-terminal end (Figure 7A). This allele is cold sensitive at 14C (Figure 7B). Analysis of poly(A) tail length in nab2-21 cells showed hyperpolyadenylation at both permissive and non-permissive temperatures (Figure 7C). The seven zinc finger-like C3H motifs in Nab2p were previously shown to be required for the in vitro poly(A) binding activity of Nab2p (Anderson et al., 1993). Although there was no change in tail length during shift to the non-permissive temperature, the poly(A) tail defect in nab2-21 implies that Nab2p binding to the poly(A) tail in vivo is required for regulating poly(A) tail length. The constitutive poly(A) tail length defect also demonstrated that loss of regulation of poly(A) tail length is not lethal, suggesting that defects in polyadenylation may impact negatively on other RNA processing events. Alternatively, Nab2p could be required for two, independent, RNA processing events.

























Figure 6. Nab2p is required for regulation of poly(A) tail length in vivo. (A) Growth curve of NAB2 vs. GAL::NAB2 cells following shift into glucose containing media. (B) Immunoblot analysis of Nab2p in GAL::NAB2 cells after shift into glucose. Nab2p was detected using the anti-Nab2p monoclonal antibody 3F2. The 60S ribosomal subunit protein, Pub2p, was included as a control for the amount of protein loaded per lane. Pub2p was detected using the monoclonal antibody 2B 1. (C) Total RNA from NAB2 and GAL::NAB2 cells was isolated at various times after shift to glucose, 3'-end labeled with [32p]pCp, and digested with RNases A and T1. The remaining poly(A) tails were resolved by polyacrylamide/urea gel electrophoresis. Indicated size markers are MspI fragments from pBR322.







56


C


IVY 9 A-I


201180160147

123110-


Time (h)


907667-


B


GAL::NAB2
0 2 4 6 8 12 16 24hr


-Nab2p


34-


-Pub2p


A


25 20. o 15
w
(D 10

5-


























Figure 7. The conditional lethal nab2-21 allele affects poly(A) tail length in vivo. (A)
Structural motifs of Nab2p and Nab2-21p are shown. Nab2-21p contains a deletion of the seventh and part of the sixth C3H motifs. (B) NAB2 and nab2-21 cells were spotted in a series of 10 fold dilutions and incubated at either the permissive or non-permissive temperature for 3 or 9 days respectively. (C) Bulk poly(A) tail length analysis of NAB2 and nab2-21 cells grown at both permissive and non-permissive temperatures indicates a constitutive defect in regulation of poly(A) tail length. Markers correspond to MspI cut pBR322 fragments.










A


Nab2p Nab2-21 p


Q3P RGG C3H
E R Ii i


I ses I s I


100 200 300 400 500 aa


B


140C-


NAB2

nab2-21


C


mm 3014 301400


58


217201 180160147

123110


90

7667-


34-






59


All mRNA Polyadenylate Tails are not Regulated by Nab2p

Analysis of polyadenylate tail length performed by 3'-end labeling depicts only the distribution of poly(A) tail lengths in the cell and does not allow identification of the hyperpolyadenylated RNA. Since polyadenylation has been shown to occur on snRNAs, snoRNAs, and the RNA component of the telomerase enzyme, it was important to identify the hyperpolyadenylated RNA (Abou Elela and Ares, 1998; Chapon et al., 1997; van Hoof et al., 2000). To determine if mRNA was the affected RNA species, poly(A) tail lengths for several different mRNAs were analyzed. In the presence of RNase H, mRNA-specific DNA oligonucleotides were incubated with total RNA from wild type or nab2 mutant strains. This cleaves the RNA close to the 3'-end allowing better resolution of the poly(A) tail. Reactions were also carried out with or without oligo (dT), to remove the poly(A) tail. The remaining RNA fragments were fractionated on a denaturing polyacrylamide gel and transferred to a charged nylon membrane. RNA blots were probed using 5'-end labeled oligonucleotides complementary to the remaining 3'-UTR. This method was used to analyze poly(A) tail length for CYH2, RPS23, TPIJ, and PGKJ from various nab2 strains. For each case, poly(A) tail length analysis failed to detect specific mRNAs that were hyperpolyadenylated. Surprisingly, poly(A) tails for some mRNAs tested actually grew shorter with loss of Nab2p fimction (Figure 8). This shortening of poly(A) tails suggested two possibilities. First, deregulation of poly(A) tail length in nab2 mutants does not affect mRNAs. Second, not all mRNAs are regulated in the same manner. Thus, Nab2p may be required for regulating tail length of a subclass of mRNA. To determine between the two possibilities, two alternative approaches were

























Figure 8. Analysis mRNA specific poly(A) tail length does not reproduce the hyperpolyadenylation defect seen by bulk poly(A) tail analysis. Total RNA isolated from NAB2 and GAL::NAB2 cells at various times after shift to glucose containing media was incubated with a DNA oligo specific to the 3'-end of the mRNA. RNase H was used to digest the RNA in the DNA:RNA hybrid. In a separate control reaction, oligo(dT) was included to remove the poly(A) tail. The RNA was fractionated on a denaturing polyacrylamide gel and transferred to a charged nylon membrane. A 5'-end labeled oligo, specific to the remaining 3'-UTR, was used to probe the blot. (A) Oligo-directed RNase H cleavage - poly(A) tail analysis of CYH2 during Nab2p loss. (B) Poly(A) tail analysis of RPS23A during Nab2p loss. Two separate distributions of poly(A)+ RPS23A RNA are a result of two major 3'-end cleavage sites utilized during 3'-end formation. Results for TPIJ and PGKJ also showed no signs of hyperpolyadenylation (data not shown).





61


A
CYH2
NAB2 GAL::NAB2
oligodT + - - + - -
0 0 8 0 0 2 4 8hYPD






...........







B
I RPS23A 3
NAB2 GAL::NAB2
oligo dT + - + -. . . .
0 0 8 0 0 2 4 8 hYPD


AOL


IO. .... .....,
An,.






62


used. First, multiple non-mRNA RNA polymerase II transcripts were analyzed for changes in polyadenylation status during loss of Nab2p function. Second, a screen was employed to identify RNAs affected in nab2 alleles.

Small nucleolar RNAs were examined by RNA blot analysis for changes in transcript size, indicative of poly(A) addition. Multiple snoRNAs from different classes, as well as U2 snRNA and the RNA component of telomerase (TLCJ), were analyzed (Table 3). Monocistronic and polycistronic snoRNAs were analyzed during Nab2p depletion. Monocistronic snoRNAs (snR9, snR10, snR11, snR13) showed no difference compared to NAB2 cells (Figure 9A). Polycistronic snoRNAs (snR51 and snR72) increased in abundance, but not in transcript length (Figure 9B). The intron residing snoRNA, snR39, showed increases in size, indicative of a potential processing defect during Nab2p depletion (Figure 9C). Defects in snR39 and U18 snoRNA maturation were also present in nab2 mutants (Figure 9D). However, none of the non-mRNA transcripts assayed showed signs of polyadenylation.

Hyperpolyadenylated RNAs were identified by screening of a cDNA library created from Nab2p depleted cells. Long poly(A)+ tailed RNAs were selected on poly(U) Sephadex in the presence of 70% formamide to destabilize RNAs with short poly(A) stretches, either internal or 3'-terminal. This procedure yielded a pool of poly(A)+ RNA with tails ranging from 60 to >600 nucleotides (Figure 10). A cDNA library was constructed using this RNA pool, and approximately 100 open reading frames were identified (Table 4). Most of the open reading frames represented known mRNAs. A small percentage of clones isolated did not correspond to regions with known open reading frames and may represent unknown polyadenylated non-protein coding RNAs in

























Table 3. A large fraction of RNAs transcribed by RNA polymerase II are not mRNAs. Non-mRNA, RNA polymerase II transcripts are listed. Note, bolded transcripts have been analyzed for increased transcript length, indicative of a poly(A) tail. None of the transcripts tested were determined to be hyperpolyadenylated during Nab2p depletion. DBRJ is the de-branching enzyme required for de-branching the intron-lariat produced during pre-mRNA splicing. RNTJ is an endonuclease required for processing numerous RNAs, including snoRNAs. TMG stands for tri-methyl guanosine.






64


TABLE 3. Non-mRNA RNA POLII Transcripts
snoRNA

-monocistronic (DBR1 independent)


-RNT1 independent
-TMG capped
-H/ACA
-C/D


-RNT1 dependent
-TMG minus
-H/ACA
-C/D


3, 5, 8, 9, 10, 11, 30, 31-35, 37, 42, 46, 49, 189 U3a, U3b, 4, 13, 39b, 45, 50, 52, 56, 58, 60 62-66, 68, 69, 71, 79



36, 43 (DBR1 independent ?) 40, 47, 48 (RNT1 dependent ?)


-polycistronic (DBR1 independent)


-RNT1 dependent
-TMG minus
-H/ACA
-C/D


none known
U14, 41, 51, 53, 55, 57, 61, 67, 70, 72-78, 190


-intronic (DBR1 dependent)


-RNT1 independent
-TMG minus
-H/ACA 44
-C/D U18, U24, 38, 39, 54, 59

snRNAs

-Ul , U2, U4, U5
TMG capped
polyadenylation status unknown
*U2 is extended and polyadenylated in Arntl strains

Others
-TLC1 -RNA component (template) for telomerase
-TMG capped
-box H/ACA like element at 3' end of hTR
-poly(A)+ and poly(A)- fractions


-MRP -RNA component of the RNase MRP

























Figure 9. non-mRNAs are not polyadenylated in conditional lethal nab2 alleles.
Total RNA was isolated from NAB2 and GAL::NAB2 cells at various times after shift to glucose and RNA blot analysis performed. (A) Monocistronic snoRNAs snR9, snRlO, snRll, and snR13. (B) Polycistronic snoRNAs snR51 and snR72. (C) Intronic snoRNAs snR39 and U18. (D) RNA blot analysis of snR39 and U18 intronic snoRNAs using total RNA isolated from various nab2 alleles. Note that none of the snoRNAs tested showed size increases indicative hyperpolyadenylation.









A
r-NAB2--irGAL::NAB2-1
0 2 4 0 2 4 hr


:-snR9







snRll1


C
rNAB27 r-GAL::NAB2gal glu 0 4 8162436
: i . ... Ow


snR39 precursors


B
FNAB27 r- GAL::NAB2 .
gal glu 0 4 8 16 24 36

to mm "" 40:-sn R51



. -WSI %011 -snR72


-snRl3 h r

precursors




-sn R39


U18
precursors


-snR39


-U18


66


D

























Figure 10. Hyperpolyadenylated RNAs were identified by screening a cDNA library from Nab2p depleted cells. Poly(A) tail analysis of hyperpolyadenylated RNA. The total lane is poly(A)+ RNA isolated from GAL::NAB2 cells after Nab2p depletion. The poly(U) lane is poly(A)+ RNA similar to the total lane, but subject to isolation on poly(U)-Sephadex. A cDNA library was prepared using the poly(U) selected RNA and approximately 100 cDNA clones were analyzed by DNA sequencing. These clones encoded a variety of mRNAs but not other RNAs (U2 snRNA, snoRNAs, etc.) known to be polyadenylated under some conditions. A full listing of the cDNAs sequenced is located in Table 3.






68


622 404 242 201

160 123 110

90-

76-' 67-'








34

26"-


15 -






69


TABLE 4 cDNAs isolated from Nab2p depleted cells Gene name Description of gene product

Amino acid metabolism
AR04 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase
isoenzyme
GNP] high affinity glutamine permease MET]17 O-acetylhomoserine-O-acetylserine sulfhydralase THR4 threonine synthase URA3 orotodine-5' phosphate decarboxylase YFRO55W hypothetical ORF; induced by MMS

Cell wall / multi-drug resistance CHSJ chitin synthase 1; cell wall maintenance CWH41 glucosidase I; cell wall maintenance FKSJ 1,3-beta-D-glucan synthase; cell wall maintenance MNN9 may be the alpha-I,6-mannose elongation enzyme; mutants are
osmosensitive
NCEJ02 protein translocation PDR13 pleiotropic drug resistance (PDR); HSP70 family; cell stress PMAJ plasma membrane proton ATPase SCW4 soluble cell wall protein; cell wall maintenance SLT2 suppressor of lyt2; cell stress; cell wall maintenance YCLO68C hypothetical ORF; 99% identity to Bud5p over the first 190 aa YJR124C hypothetical ORF; Member of the multidrug-resistance family YKRIO4W hypothetical ORF; Member of the ATP-binding cassette (ABC)
superfamily

Nuclear-cytoplasmic transport MTR2 mRNA transport regulator NUP192 Nuclear Pore protein of 192 kDa

Mitochondrial functions
ATP2 F(l)-F(O)-ATPase complex, beta subunit SDH3 succinate dehydrogenase cytochrome b subunit

Proteolysis
HUL4 ubiquitin ligase (E3); protein degradation UBCJ3 ubiquitin conjugating enzyme; induced by MMS APE3 aminopeptidase yscII

Protein translation apparatus TEF2 x 2 traslation initiation factor EF- 1 TIFJJ x 2 translation initiation factor EF-l A






70


TABLE 4--continued


Gene name


Ribosomal RPLJB RPL8A RPLJJA RPL14A RPL15 RPL20A RPL22B RPL29 x 2 RPL30A RPL32 RPL34A RPL38 RPL41A x 2 RPS2 RPS4A RPS7A x 2 RPSJJA RPS13 RPS20 RPS23B x 2 RPS25A RPS26B


RNA processing SOFJ SES1 YDL209C


Stress response pr CUPJ x 2 DDR2 HOR7x2 SED1 x 2 ST11
YHB1 x 2


Description of gene product


ribosomal protein LIB ribosomal protein L8A ribosomal protein LI 1A ribosomal protein L14A; intron containing ribosomal protein L 15 ribosomal protein L20A ribosomal protein L22B; intron containing ribosomal protein L29 ribosomal protein L30A; intron containing ribosomal protein L32; intron containing ribosomal protein L34A ribosomal protein L38 ribosomal protein L41A ribosomal protein S2 ribosomal protein S4A; intron containing ribosomal protein S7A; intron containing ribosomal protein S 11A; intron containing ribosomal protein 513; intron containing ribosomal protein S20 ribosomal protein S23B; intron containing ribosomal protein S25A ribosomal protein S26B


small nuclear ribonucleoprotein involved in rRNA processing serine-tRNA ligase hypothetical ORF; RNA splicing?


'oteins


copper binding metallothionein; cell stress DNA damage response
hyperosmolarity response cell surface glycoprotein, Al and oxidative stresses suppressor of lyt2, S/T kinase, cell wall defects, osmosensitive flavohemoglobin, may play a role against oxidative stress


Carbohydrate metabolism EN02 enolase 2; 2-phosphoglycerate dehydratase TPIJ x 2 triosephosphate isomerase CIT2 citrate synthase; energy generation






71


TABLE 4--continued
Gene name Description of gene product


Transcription ANC1 GCN4 GCR3 HTA1


transcription initiation factor TFIIF small subunit transcriptional activator of amino acid biosynthetic genes transcriptional activator of glycolytic genes histone H2A; cell stress


Vesicular transport BET5 TRAPP 18kDa component CLCJ clathrin light chain SEC3 subunit of the Exocyst complex

No classified ORF Intergenic (2)

Unknown / miscellaneous


SRP14 STE2 YARO27W YCL033C YDLO72C YDL1J4W YDRJOC
YDR8419.12 YFR039C YGL101W YGL 1OC YLR257W YKR0J5 W
YM9827.03C YNL119 W

YOR205C YOR252 W YPLJ 10C


Signal recognition particle subunit, protein translocation alpha-factor pheromone receptor hypothetical ORF hypothetical ORF; putative transcription regulator hypothetical ORF hypothetical ORF hypothetical ORF

hypothetical ORF hypothetical ORF hypothetical ORF hypothetical ORF hypothetical ORF

hypothetical ORF; possibly involved in cytoplasmic ribosome fimction
hypothetical ORF hypothetical ORF hypothetical ORF






72


S. cerevisiae. Nab2p-dependent hyperpolyadenylation of RNAs identified in this screen was confirmed using ligation-mediated RT-PCR. Tail length analysis demonstrated that not all RNAs respond to loss of Nab2p to the same order of magnitude (Figure 11). One class of RNA shows tail length increases of up to 80 nucleotides, similar to what is seen by bulk tail labeling (SEDJ, DDR2). Another class undergoes modest tail length increases up to 20 nucleotides (PGKJ, TPIJ, CYH2). CYC1 was tested as a control RNA not identified in the screen. CYC1 is also an RNA that is typically used for in vitro 3'-end formation assays. Interestingly, CYC1 tail length was not affected by loss of Nab2p in vivo. These results suggest that Nab2p function is mRNA subclass specific.

The mRNAs which demonstrated the largest change in poly(A) tail length during loss of Nab2p function corresponded to stress response genes, specifically, stress response genes that are induced in a non-HSE (heat-shock element) dependent manner. The stress response genes identified in the cDNA library are induced under osmotic and oxidative stress conditions. To determine if Nab2p was required during specific stresses, the conditional lethal nab2-21 allele was tested for increased sensitivity to various stress conditions by spotting serial dilutions of cells to plates containing the stress agent. Cold sensitive nab2-21 cells displayed an increased sensitivity to NaCl and H202, but not other agents (Figure 12). This result was consistent with the 3'-end processing defect of the stress response mRNAs identified in the cDNA library (Figure 11). Nab2p Regulates Poly(A) Tail Length in vitro

The effect of a nab2 mutation on in vivo poly(A) tail length was similar to that demonstrated for Pablp in vitro (Amrani et al., 1997; Minvielle-Sebastia et al., 1997). To determine if Nab2p was essential for 3'-end processing, in vitro polyadenylation

























Figure 11. Nab2p is required for poly(A) tail length control of some, but not all mRNAs in vivo. Poly(A) tail lengths for mRNAs identified in this screen are dependent on Nab2p. In vivo poly(A) tail lengths for several of the mRNAs identified in the poly(U) pool were analyzed by ligation-mediated RT-PCR. Template RNA was from NAB2 and nab2A pPAB 1 cells grown in YPD. nab2A pPAB 1 cells are described later, but show the hyperpolyadenylation defect in vivo. As a control, the poly(A) tail length of an mRNA not identified in this screen (CYC]) was also analyzed. CYCJ was chosen because it is frequently used to assay for defects in 3'end formation in vitro. CYCJ poly(A) tail length is not dependent on Nab2p.









CYCI







80-


PGKI



(A)n 9453-


DDR2


(A)n t 14681-


SEDI


(A)n _'


14053-


TPI1



(A)n _ 9074 -


























Figure 12. The conditional lethal nab2-21 allele shows increased sensitivity to NaCI and H202 stresses. Serial 10-fold dilutions of nab2-21 cells were spotted to plates containing stress agents. The plates were incubated at 24'C for 6 days.








0.5 M NaCI 1.0 M NaCI


NAB2 nab2-21


1.0 M Sorbitol


2.5 M Sorbitol


5% Ethanol


10% Ethanol


NAB2 nab2-21





NAB2 nab2-21


1.5 mM CuSO4


2.5 mM CuSO4


YPD 24 C


7.5 mM H202






77


assays were performed. Substrates used included both CYC1 and SED1, which were differentially affected in vivo during Nab2p loss. Interestingly, loss of, or mutations in Nab2p had no affect on the poly(A) tail length of either substrate (Figure 13). Since a whole cell extract is used in this assay, one possible explanation for not reproducing the polyadenylation defect in vitro is that a cytoplasmic factor may compensate for loss of Nab2p (Butler and Platt, 1988). It is also possible that Nab2p activity is lost during preparation of the extract. To determine if the abundant cytoplasmic poly(A) binding protein Pab 1 p was this compensating factor, Nab2p was added back to in vitro reactions using an extract devoid of Pablp. Due to the lack of Pablp, this extract normally produces long poly(A) tails in vitro (Minvielle-Sebastia et al., 1997). Multiple unsuccessful attempts were made at generating recombinant Nab2p in E. coli. Due to severe degradation and contamination with nucleases, full length Nab2p could not be purified in this manner. To obtain full-length protein, Nab2p was isolated from yeast cells by tandem affinity chromatography (Rigaut et al., 1999). Nab2p purification was performed by Keith Nykamp. A calmodulin binding peptide (CBP)/protein A fusion to the carboxy terminal end of Nab2p was generated in L4717 cells. A Tobacco Etch Virus (TEV) protease site is included between CBP and protein A, which allowed two successive rounds of purification. First the Nab2p fusion was bound to IgG Sepharose via protein A. Nab2p-CBP was eluted by cleavage using TEV protease. The Nab2pCBP fusion is re-purified on calmodulin affinity resin and eluted with EGTA. Purified Nab2p was added back to in vitro polyadenylation assays using a Pab lp deficient extract (YAS394). Recombinant Pabpl was included in a separate reaction for comparison and added rPablp was capable of inhibiting polyadenylation (Figure 14A). Poly(A) tail

























Figure 13. Loss of, or mutation to, Nab2p does not affect regulation of poly(A) tail length in vitro. 3'-end processing competent extracts from various nab2 cells were incubated with uniformly labeled RNA substrates, CYCi-pre and SED1-pre. eYe1-pre and SED I-pre correspond to regions in the 3'-UTR that contain all of the necessary cis-elements required for polyadenylation. Reaction products were separated on a denaturing polyacrylamide gel and visualized by autoradiography. (A) In vitro polyadenylation assay using CYCI-pre. (B) In vitro polyadenylation assay using SEDI-pre. The 70-90 nucleotide range for CYCJ is larger due to the smaller size of the CYCI (190 nt.) substrate compared to SEDJ (350nt).







A


B


CYCI


N


~Cl,


A70-9Q


A70-90 [


SEDI


Cl-N


v
C,, .


























Figure 14. Addition of purified Nab2p in vitro restores regulation of poly(A) tail length to a pablA extract. Either recombinant Pabip or purified Nab2p were added back to in vitro polyadenylation reactions using an extract prepared from pabiz cells (YAS394).
(A) Increasing amounts of rPAB i p were pre-incubated with a pablA extract for 15 minutes. Added rPab Ip inhibited polyadenylation and inhibition was concentration-dependent. Recombinant Pab Ip was a gift from Alan Sachs. (B) Nab2p was purified using tandem affinity chromatography. Increasing amounts of purified Nab2p were pre-incubated for 15 minutes with an extract devoid of Pabip. A mock Nab2p addition (0 ng) was treated identically. Addition of Nab2p to the polyadenylation reaction correlated with decreasing poly(A) tail length.









ngo


CYCI -pre


CYCI -pre


A


ng p <3


B


A200+


A200+ Ao


00






82


length was also reduced in the presence of purified Nab2p and the degree of shortening correlated with the amount of Nab2p added to the reaction (Figure 14B). This result is consistent with in vivo tail length defects seen in nab2 alleles and suggests that Nab2p is required for regulation of nuclear poly(A) tail length. It also implies that Pab 1 p-mediated regulation of poly(A) tail length in vitro may be an artifact of the preparation of wholecell extract.


Nucleocytoplasmic mRNA Export is Inhibited in nab2 Mutant Strains


Defects in mRNA export in yeast have been linked to poly(A) tail length increases of 20 nucleotides (Piper and Aamand, 1989). Upon mRNA export, poly(A) tails are trimmed by 20 nucleotides as a result of Pablp binding to the poly(A) tail and recruiting the poly(A) nuclease, PAN (Boeck et al., 1996; Brown et al., 1996). Poly(A) tail length increases during the loss of Nab2p are more dramatic, with poly(A) tails reaching lengths of greater than 200 nucleotides. To determine if the polyadenylation defect in yeast was coupled to a defect in mRNA export, poly(A)+ RNA localization was assayed using two conditional lethal nab2 alleles. The poly(A)+ RNA distribution was determined by fluorescent in situ hybridization with digoxigenin-labeled oligo (dT)50. Cells depleted for Nab2p as well as nab2-21 cells were analyzed. To deplete Nab2p, GAL::NAB2 cells were shifted to glucose for 0-8 hours. As early as 2 hours after shift to glucose, poly(A)+ RNA started to accumulate in the nuclei of cells (Figure 15A). Nuclear poly(A)+ RNA accumulation was evident in greater than 90% of the cells at 8 hours. Upon closer inspection, it was shown that poly(A)+ RNA was accumulating in foci with in the nucleus (Figure 1 5B). These foci were typically at the edge of the nucleus, in a

























Figure 15. Nab2p depletion leads to nuclear/nucleolar accumulation of poly(A)
RNA. NAB2 were grown in glucose or galactose media. GAL::NAB2 cells were grown in galactose and shifted to glucose containing media for the specified amount of time and the poly(A)+ RNA distribution was analyzed. (A) Fluorescent in situ hybridization (FISH) of poly(A)+ RNA distribution using digoxigenin-(dT)5o and FITC-conjugated anti-dig secondary mAb. DNA was detected with DAPI. (B) FISH localization of poly(A)+ RNA using deconvolution microscopy. Distribution of poly(A)+ RNA (green) is shown for GAL::NAB2 cells shifted to glucose for 2h. The nucleolus is adjacent to the bulk chromosomal DNA staining (blue). Nucleoli were localized using anti-Noplp mAbs (data not shown). Three nucleolar distributions are displayed (left panel, overall nucleolar; middle panel, two intra-nucleolar foci; right panel, a single focus at the nucleolar periphery). Bar, 2 gm.









A


poly(A)+RNA


NAB2
galactose




NAB2
glucose



GAL::NAB2
galactose


GAL::NAB2
glucose 2h




GAL::NAB2
glucose 8h


B


DNA


84






85


region characteristic of the nucleolus. To determine if the poly(A) RNA was nucleolar, the foci were co-localized using a monoclonal antibody against Noplp, a nucleolar protein (data not shown). It was determined that poly(A) RNA was accumulating in nucleoli during Nab2p depletion.

The cold sensitive nab2-21 allele also demonstrated inducible nuclear accumulation of poly(A)+ RNA. The poly(A)+ RNA distribution in nab2-21 cells at the permissive temperature was normal (Figure 16A). However, when cells were shifted to the non-permissive temperature of 14C, poly(A)+ RNA started to accumulate in nuclei. As with Nab2p depletion, poly(A)+ RNA accumulated in the nucleolus. Focal accumulation of poly(A)+ RNA, in comparison to the nucleolar protein Nop 1 p is shown (Figure 16B). Results from both conditional lethal nab2 alleles analyzed suggest that Nab2p is required for mRNA export.

Nucleolar accumulation of poly(A)+ RNA in nab2 alleles implied the possibility that nucleolar RNAs were polyadenylated. Evidence exists demonstrating polyadenylation of non-mRNAs, however, nucleolar RNAs analyzed during loss of Nab2p function failed to identify any polyadenylation (see Figure 9). Also, identification of hyperpolyadenylated RNAs in the cDNA screen did not reveal any non-mRNAs know to be polyadenylated (see Table 4). This strongly suggests that the focal accumulation of poly(A)+ RNA observed in nab2 cells results from nucleolar accumulation of hyperpolyadenylated mRNAs.


Messenger RNA 3'-End Formation and Nucleocytoplasmic Export can be Uncoupled in Yeast
Cleavage factors have been shown to associate with the caboxy-terminal domain of RNA polymerase II, enhancing 3 '-end cleavage and transcription termination

























Figure 16. Poly(A)+ RNA accumulates in the nucleolus at the non-permissive temperature in nab2-21 cells. nab2-21 cells were grown at a permissive temperature of 30'C and shifted to the non-permissive temperature, 14C for 2 hours. (A) The poly(A)+ RNA distribution was determined by fluorescent in situ hybridization using digoxigenin(dT)50 and anti-dig secondary mAb. DNA was visualized using DAPI. (B) The nucleolus was localized using a Nop lp specific mAb (right panel). Nucleolar poly(A)+ RNA is shown for comparison (left panel).














nab2-21


DAPI


nab2-21

oolv(A)+RNA Noplp


A


87


300C








140C/2h


B


140C/2h






88


(Birse et al., 1998). Correct 3'-end formation has also been demonstrated as a requirement for mRNA export in yeast (Long et al., 1995). However, it was not know if accurate regulation of poly(A) tail length was a pre-requisite for mRNA export. To try to uncouple the two phenotypes genetically, a high copy suppressor screen of a NAB2 deletion was performed. Conditional lethal GAL::NAB2 cells were transformed with a YEp 13 genomic library, generating approximately 106 Leu+ transformants. Transformed cells were plated to glucose containing media to deplete Nab2p (Figure 17). Cells that survived could potentially have received a genomic NAB2 fragment. The NAB2 gene from the plasmid library was slightly larger than NAB2 from the GAL::NAB2 strain. The size difference is due to an expansion at the 5' end of the gene, which results in seven additional Q3P repeats in the protein. This allowed identification of cells containing a NAB2 gene from the plasmid library. This eliminated all but one library plasmid. Sequence analysis identified a ten kilobase insert containing the full length PAB! gene, as well as a truncation of the 5' gene and the entire downstream gene of unknown fimction (Figure 18A).

To confirm that high copy PablI p expression was responsible for suppression, the PAB1 gene was PCR amplified from genomic DNA and cloned into YEpl3 to generate the plasmid, pPAB1. This plasmid was transformed into fresh GAL::NAB2 cells and plated to glucose media. The number of cells capable of growing on glucose was approximately the same as the transformation efficiency, while cells transformed with YEpl13 alone were unable to grow (Figure 18B). This suggested that the pPABl1 plasmid suppressed a NAB2 deletion. The level of Pablp was determined by immunoblot analysis. Pabl1p levels were moderately elevated (Figure 1 8C). Interestingly, a smaller

























Figure 17. Schematic representation of high-copy suppression of nab2A. Haploid cells (YRH201C) containing a chromosomal NAB2 deletion and the pGAL::NAB2 plasmid were grown on galactose containing media to express Nab2p. Cells were transformed with the YEp13 genomic library and plated to glucose containing media to repress Nab2p expression from the pGAL::NAB2 plasmid. This generated approximately 106 transformants. Transformants that could grow in the presence of glucose were screened to eliminate cells that received a genomic NAB2 fragment from the library. Isolated library plasmids that did not contain NAB2 were sequenced to identify the genes contained within the plasmid insert.














YEpl3
Genomic Library






Galactose













Glucose


Transform cells


-10 6 transformants


Screen transformants to eliminate genomic NAB2 containing isolates




Sequence to identify the insert


90


4AW
4W* 4WO -AW

9 4w



























Figure 18. The PABJ gene high copy suppresses a nab2 deletion. GAL::NAB2 cells grown in YPGal were transformed with a YEp 13 genomic library. From approximately 106 Leu+ transformants, 37 were able to grow under Nab2p repressive conditions. Cells were screened by PCR to eliminate library plasmids containing the NAB2 gene. (A) One cell, nab2A pHCS220, did not to contain the NAB2 gene. Sequence analysis identified a fragment containing the PAB1 gene. To confirm high copy suppression was dependent on PAB1, the PAB! gene was cloned into YEp13 to generate pPAB 1. Growth of nab2A pPAB1, and immunoblot analysis, on glucose confirmed that elevated Pabip levels were responsible for suppression by pHCS220. (B) Growth of various wild type NAB2 and nab2A strains carrying pHCS220 or pPAB1. (C) Immunoblot analysis of Pablp expression. Pab lp* is a 50 kDa fragment of PablI p.







92


A


IPABI


I YER166W !


B


nab2A pGAL::NA


NAB2



NAB2


nab2A pGAL::NA


Galactose


nab2A pHCS220


nab2A pPAB1 nab2A pPAB1 nab2A pHCS220


Glucose


CHDI


C


68


68

4329-


-Nab2p


-Pablp
-Pablp*


-Pub2p


I






93


Pablp* product was abundant in these cells. This form was approximately 50 kDa, similar to the reported nuclear PablI p (Sachs et al., 1986).

To determine which process Nab2p is required for, the poly(A)+ RNA tail length distribution and subcellular localization were assayed in the nab2A pPAB1 cell (YRH204). Although Pablp has been reported essential for regulation of tail length in vitro (Amrani et al., 1997; Minvielle-Sebastia et al., 1997), poly(A) tail length showed only a modest length (Figure 19A). This decrease was representative of the 20 nt cytoplasmic tail shortening by poly(A) nuclease (PAN) activities and might be expected if the export defect was resolved, but not the tail length defect. In situ hybridization with oligo (dT)50 revealed that the export defect was completely resolved by high-level expression of Pab lp (Figure 19B). This suggested two things. (i) Although Nab2p levels affect regulation of poly(A) tail length in vivo, regulation of poly(A) tail length is not essential. (ii) Nab2p is required for export of poly(A)+ RNA. How PablI p suppresses the export defect is yet to be determined but may imply a role for Pab lp in mRNA export.

High level Pablp suppression was most likely bypassing the requirement for Nab2p. To confirm that Pablp was a bypass suppressor of Nab2p, the pGAL::NAB2 plasmid was evicted from suppressor cells using 5-FOA toxicity to select against cell that carried the plasmid. This ensured that Pablp was suppressing the complete loss of Nab2p and not low-level Nab2p expression. High-level Pablp expression also suppressed the cold sensitive phenotype of nab2-21 cells, demonstrating that suppression was not allele-specific, another characteristic of bypass suppression (data not shown).

Pablp was also identified as a specific component of a Nab2p complex (unpublished results K. Nykamp et al.), possibly explaining the high copy suppression




Full Text

PAGE 1

POSTTRANSCRIPTIONAL REGULATION OF GENE EXPRESSION BY A NUCLEAR POLYADENYLATED RNA BINDING PROTEIN By RONALD EARL HECTOR A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2000

PAGE 2

This work is dedicated to my wife, Michelle, for loving me more than humanly possible.

PAGE 3

ACKNOWLEDGEMENTS I would like to thank my parents for giving me their continual love and support, and especially for teaching me that anything is possible. Without their guidance I would not be where I am. I thank my committee members, A1 Lewin, Henry Baker, Bert Flanegan, Carl Fledherr, and my outside examiner, Scott Butler, for their assistance. I want to extend a special thanks to John Aris for his willingness to discuss my research. My mentor, Maury Swanson, has also made this a challenging, but very enjoyable experience. I thank him for helping me to realize my potential. Working with the past and present members of the Swanson lab has been a wonderful experience, I couldn't ask for a better group of people to interact with daily. I also want to thank Joyce Conners and the rest of the administrative staff of the Department of Molecular Genetics and Microbiology for help with meeting all of the deadlines. My wife, Michelle Hector, deserves special mention. Along with giving her constant love and devotion, she has given me the most precious gift of all, a daughter. Ill

PAGE 4

TABLE OF CONTENTS ACKNOWLEDGEMENTS ABSTRACT vi INTRODUCTION 1 RNA Processing Events and Regulation of Gene Expression 4 RNA 5 Â’-End Cap Formation 4 Pre-mRNA Splicing and Alternative Splicing 5 Pre-mRNA 3 Â’-End Formation 6 Nucleocytoplasmic mRNA Export 11 Additional Posttranscriptional Modifications 1 3 Interaction Between RNA Processing Steps 15 Transcription 15 Pre-mRNA Splicing and 3 Â’-End Formation 17 mRNA Export 18 The HnRNP/RNA Complex is the Substrate for Nuclear RNA Processing Events 19 HnRNP Identification and Classification 22 Structure and Function of HnRNPs 22 Pre-mRNA Splicing 23 Pre-mRNA 3 Â’-End Formation 24 Other Functions of HnRNPs 24 Mechanisms for HnRNP Function 25 MATERIALS AND METHODS 26 Growth Conditions and Media 26 Cell Transformations 27 Yeast Genetic Manipulations 27 Nucleic Acid Isolation Procedures 28 DNA and RNA Blot Analysis 30 Yeast Total Cell Protein Isolation 31 Tandem Affinity Purification of Nab2p 31 In vitro 3 Â’-End Processing Assays 33 Indirect Cellular Immunofluorescence 35 In Situ Hybridization and Cellular Immunofluorescence 36 Yeast Two-Hybrid Screen 37 Determination of Poly(A) Tail Lengths 38 IV

PAGE 5

Isolation of Hyperpolyadenylated RNAs and Construction of a cDNA Library.. 40 High Copy Suppression Analysis of a nab2A Strain 41 Reverse Transcription-Polymerase Chain Reaction 42 RESULTS 44 Research Objectives 44 Factors That Interact With Nab2p are Involved in Multiple Aspects of RNA Processing 45 Pre-mRNA 3'-End Processing 47 Polyadenylation of mRNA is Regulated by Nuclear Poly(A) Tail Binding Proteins 50 All mRNA Polyadenylate Tails are not Regulated by Nab2p 59 Nab2p Regulates Poly(A) Tail Length in vitro 72 Nucleocytoplasmic mRNA Export is Inhibited in nab2 Mutant Strains 82 Messenger RNA 3 Â’-End Formation and Nucleocytoplasmic Export can be Uncoupled in Yeast 85 Pre-mRNA Splicing 96 DISCUSSION 106 Regulation of Polyadenylate Tail Length Requires Nab2p 106 How Does Pablp Compensate for the Loss of Nab2p? 109 Why is Nab2p Function Lost During Preparation of Extract? 110 Regulation of Polyadenylate Tail Length is not Essential Ill Nab2p-Dependent Regulation of Poly(A) Tail Length is Message Specific 112 The Yeast HnRNP Nab2p is Required for Nucleocytoplasmic Export of mRNA 1 13 Nuclear Functions of the Poly(A)-Binding Protein Pablp 113 Polyadenylated RNA in the Nucleolus 115 Nucleolar Function is Compromised in nab2 Strains 117 Roles for HnRNPs in Processing Stress Response mRNAs 118 Nab2p may Direct mRNPs to the Nuclear Pore 1 1 8 Limitations 122 Conclusions 123 APPENDIX OLIGONUCLEOTIDES, YEAST STRAINS AND PLASMIDS.... 125 REFFERENCES 130 BIOGRAPHICAL SKETCH 144 V

PAGE 6

Abstract of Dissertation Presented to the Graduate School Of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy POSTTRANSCRIPTIONAL REGULATION OF GENE EXPRESSION BY A NUCLEAR POLYADENYLATED RNA BINDING PROTEIN By Ronald Earl Hector December 2000 Chairman: Dr. Maurice S. Swanson Major Department: Molecular Genetics and Microbiology The polyadenylate tail is a common feature of most higher eukaryotic, and all yeast, messenger RNAs. Many of the functions attributed to the poly(A) tail are cytoplasmic (e.g. translation initiation and mRNA stability). While the poly(A) tail is generated in the nucleus, nuclear functions of the poly(A) tail are less well understood. The overall goal of this study was to investigate the role of the poly(A) tail in mRNA biogenesis and nucleocytoplasmic export. Cytoplasmic functions attributed to the poly(A) tail depend on the cytoplasmic poly(A) tail-binding protein Pablp (PABPl in metazoans). Pablp interaction with the poly(A) tail is essential, and much of our current understanding of cytoplasmic poly(A) tail metabolism has resulted from studies on Pablp and its associated proteins. To understand better the role of the poly(A) tail in nuclear pre-mRNA processing, we first identified Nab2p as a candidate nuclear poly(A) tail-binding protein. The powerful VI

PAGE 7

genetic tools available in yeast were then utilized to elucidate putative functions for the Nab2p-poly(A) tail complex in the regulation of gene expression at the posttranscriptional level. The identification of proteins that interact with Nab2p in vivo suggested unusual roles for this hnRNP in both regulation of mRNA poly(A) tail length and mRNA export. Genetic analysis using conditional lethal nab2 alleles confirmed roles for Nab2p in these two processes. Surprisingly, the appearance of long poly(A) tails did not affect cell viability since a nab2-21 cold-sensitive strain showed long poly(A) tails at both permissive and restrictive growth temperatures. Screening of a cDNA library generated using hyperpolyadenylated RNA indicated that only mRNAs carried long poly(A) tails. In vitro polyadenylation assays suggested that Nab2p might be directly required for regulating poly(A) tail length in the absence of Pablp. Moreover, analysis of the lengths of poly(A) tails of individual transcripts synthesized in vivo suggested preferential hyperpolyadenylation of stress-responsive mRNAs. Consistent with this latter result, the nab2-21 strain showed impaired growth under osmotic and oxidative stress conditions. Thus, Nab2p may play an important role in the stress response by regulating poly(A) tail lengths of stress response transcripts. Although long poly(A) tails were not deleterious to growth, loss of cell viability correlated with nuclear poly(A)^ accumulation in all nab2 mutants examined. Indeed, PABl was identified as a high copy suppressor of a nab2 null allele, and elevated levels of Pablp completely resolved the nuclear poly(A)^ RNA export block. These results suggest the hypothesis that formation of a ribonucleoprotein complex between the poly(A) tail and either Nab2p or Pablp is essential for mRNA export from the nucleus. Vll

PAGE 8

INTRODUCTION The primary and most abundant products of RNA polymerase II (RNA pol II) transcription are heterogeneous nuclear RNAs (hnRNAs) including pre-mRNAs (Weighardt et al., 1996). Transcription of hnRNA occurs in the nucleus. Multiple processing events convert the hnRNA into a functional mRNA, which is transported through the nuclear pore complex (NPC) to the cytoplasm for translation into protein. Processing events in mRNA biogenesis include 5 Â’-cap formation, pre-mRNA splicing, transcription termination, 3 Â’-end cleavage and polyadenylation, adenylate methylation, mRNA editing, and nucleocytoplasmic export (Figure 1) (Swanson, 1995; Weighardt et al., 1996). Each RNA processing step is a potential control point that the cell may utilize for regulating expression from a gene. RNA processing steps do not occur isolated from other events. Rather, RNA processing events are coordinately regulated, with many steps dependent on the previous and/or next step. This allows the identification of aberrant transcripts before they are exported to the cytoplasm, where translation might produce toxic by-products (Jacobson and Pelts, 1996). Heterogeneous nuclear ribonucleoproteins (hnRNPs) play vital roles at many, if not all levels of RNA processing (Weighardt et al., 1996). The importance of accurate and timely RNA processing is demonstrated by the number of human genetic disorders attributed to defects at many different levels of RNA processing (Antoniou, 1995; Higgs et al., 1983). 1

PAGE 9

Figure 1. Schematic representation of RNA processing events that occur during mRNA biogenesis. The first modification to the hnRNA is 5 Â’-cap formation. Capping typically occurs within 20-30 nucleotides of initiation. Pre-mRNA splicing of introns and 3 Â’-end formation complete the modifications, and the mRNA is transported to the cytoplasm for translation. mRNA editing is not depicted in this diagram. Many of the RNA processing events shown actually occur cotranscriptionally.

PAGE 10

3 GpppGli^ capped hnRNA pre-mRNA splicing GpppG[ 3'-end cleavage and polyadenylation GpppG[ ]aa. T mRNA export mRNA Nucleus Cytoplasm GpppG 1A4. translation GpppQÂ’

PAGE 11

4 RNA Processing Events and Regulation of Gene Expression RNA 5 Â’-End Cap Formation Eukaryotic mRNAs are structurally modified cotranscriptionally at their 5 Â’-end by the addition of a non-templated 7-methylguanylate (m G) via a 5Â’ to 5Â’ phosphoanhydride linkage (Shatkin, 1976). Addition of the cap occurs very soon after transcription initiation, with the majority of capping occurring between 20 to 30 nucleotides after initiation (Rasmussen and Lis, 1993; Salditt-Georgieff et al., 1980). This is undoubtedly facilitated by selective binding of the guanylyl transferase to the elongating RNA polymerase II (Cho et al., 1997; Yue et al., 1997). The cap participates in many RNA processing events. Protection of mRNA from 5Â’ exoribonucleases was one of the first fimctions attributed to capping (Furuichi et al., 1977; Shimotohno et al., 1977). The cap has also been shown to play a role in premRNA splicing. In the nucleus, the cap is bound by a cap-binding complex (CBC) composed of two proteins, CBC80 and CBC20 (Izaurralde et al., 1994; Ohno et al., 1990). It is through interactions with the CBC that the cap affects splicing, as immunodepletion of CBC80 from HeLa cell extracts inhibited in vitro splicing (Izaurralde et al., 1994). Capped pre-mRNAs injected into Xenopus oocytes are also processed more efficiently than uncapped precursors (Inoue et al., 1989). Nucleocytoplasmic export of mRNAs and U snRNAs is also facilitated by the presence of a 5Â’-cap (Jarmolowski et al., 1994), and a cap is required for translation initiation of most mRNAs (Le et al., 1997). Finally, both the cleavage and polyadenylation steps during 3 Â’-end formation are enhanced by the presence of a cap. Again, this is mediated by interaction with the CBC proteins (Cooke and Alwine, 1996; Flaherty et al., 1997).

PAGE 12

5 Pre-mRNA Splicing and Alternative Splicing Most higher eukaryotic genes contain intervening sequences, or introns, that must be removed from the pre-mRNA in order to produce an mRNA capable of translation into a functional protein. Surprisingly, introns comprise as much as 90% of the pre-mRNA sequence in higher eukaryotes. The number of introns found in a gene can exceed 50, with intron lengths extending past 3 million nucleotides (Kramer, 1995; Tollervey, 2000). Exons are generally much smaller in size, ranging from 1 0-400 nucleotides. Introns are removed from the pre-mRNA by a two-step reaction called splicing. The first step is a transesterification reaction initiated by nucleophilic attack of the 2Â’ hydroxyl of the branch point adenosine on the 3 Â’,5Â’ phosphodiester bond at the 5Â’ splice site. The first step generates the free 5 Â’ exon with the 3 Â’ exon still attached to the intron. The second step is a nucleophilic attack of the 3Â’ hydroxyl of the 5Â’ exon on the 3Â’ splice site, fusing the two exons and liberating the intron. Numerous components must come together in an orchestrated manner for splicing to occur. These components include both protein and RNA. Approximately 30-50 polypeptides have been shown to associate with the spliceosome during the splicing reaction (Gozani et al., 1994). A number of spliceosome-associated proteins have been identified as hnRNPs (Gil et al., 1991; Mayeda and Krainer, 1992). Another group of proteins essential for splicing is the SR (serine/arginine rich) protein family (Manley and Tacke, 1996). The SR family of splicing factors not only function as general splicing factors, but also influence alternative splice site selection. RNA sequences in the small nuclear RNAs (snRNAs) direct the assembly of the spliceosome to the exon/intron junctions via base pairing to the pre-mRNA. The snRNA U1 recognizes a conserved sequence at the 5Â’ exon/intron

PAGE 13

6 junction, while U2 base pairs to the branch point, consequently bulging out the branchpoint adenosine. Addition of the pre-assembled tri-snRNP U4/U6.U5 to the spliceosome is the next step. Extensive base pairing between U6 and U2 destabilizes the U6/U4 interaction, allowing the transesterification reactions to proceed. Intron splicing is an important source of diversity as well as control over the protein products produced. In higher eukaryotes, introns are spliced out in various patterns, called alternative splicing. The end result is multiple forms of a protein from one gene. Interestingly, very few genes (2-5%) in Saccharomyces cerevisiae have been shown or predicted to contain introns (Rymond and Rosbash, 1 992). Because of the low abundance of intron-containing genes, lack of SR proteins, and few identified yeast hnRNPs, it was generally believed that alternative splicing was not prevalent in yeast. However, recent investigation into the use of predicted splice sites in yeast has identified two alternatively spliced mRNAs, novel splice sites, and new introns (Davis et al., 2000). Pre-mRNA 3 Â’-End Formation The 3 Â’-end of most mRNAs in metazoans terminates in a non-templated polyadenylate tail. The only exceptions are the replication-dependent histone mRNAs from metazoans, which end in a conserved stem-loop structure (Dominski and Marzluff, 1999). Messenger RNA 3 Â’-end formation is a two-step process. The first step is posttranscriptional endonucleolytic cleavage of the mRNA. The second step is polyadenylation of the cleaved mRNA (Wahle and Keller, 1996). Similar to splicing, factors involved in the reaction are directed by sequence elements in the mRNA. Animal cells have four sequence elements that direct the cleavage and polyadenylation machinery to the correct site (Zhao et al., 1999). These include the U-rich auxiliary upstream

PAGE 14

7 enhancer (USE), a highly conserved positioning element (AAUAAA) located 10-30 nucleotides 5Â’ of the cleavage site, and a poly(A) site, typically after a cytosine (Figure 2 A). The final cis-element is the U/GU rich downstream element (DSE), usually less than 30 nucleotides 3Â’ of the cleavage site. Required sequence elements in S. cerevisiae are more degenerate than in higher eukaryotes and may or may not include a DSE (Figure 2B). The efficiency element (EE) is UA rich, and found 5 Â’ to the poly(A) site. While the sequence AAUAAA will work in yeast, the only requirement of the positioning element is that it is A-rich. Polyadenylation also often occurs after a cytosine as in animal cells, but a pyrimidine is all that is required. The lack of a DSE may be due to the close proximity of genes in yeast. The degeneracy of sequence elements may also facilitate termination of transcription before running into the downstream gene, possibly producing inhibitory antisense RNAs. Interestingly, a class of 3 Â’-end processing signals in yeast has been shown to function in both directions (Imiger et al., 1991). Also, mutation of the sequence elements in yeast does not completely abolish processing, but instead induces the use of cryptic polyadenylation sites (Duvel and Braus, 1999; Russo et al., 1993). In both mammalian and yeast cells, cleavage and polyadenylation requires numerous protein factors (Table 1). Many of the factors have been isolated biochemically by reconstitution of an in vitro 3 Â’-end processing reaction (Barabino et al., 1997; Bienroth et al., 1991; Jenny et al., 1994; Kessler et al., 1996; Lingner et al., 1991; Minvielle-Sebastia et al., 1997; Zhao et al., 1997). Unlike pre-mRNA splicing, an RNA component is not required. Cleavage during 3 Â’-end formation in mammalians requires five factors: cleavage factor I (CF Im), cleavage factor II (CF Ilm), poly(A) polymerase

PAGE 15

o • IM iS ss 'd 'o a fl 01 ) d ;> CO CO

PAGE 16

A. Mammalian 9 c o CO V C 3 o I o a o cd C/D D o
PAGE 17

10 (PAP), cleavage-stimulation factor (CstF), and cleavage/polyadenylation specific factor (CPSF). Polyadenylation requires three factors: PAP, CPSF, and the poly(A)-binding protein (PABP2). Yeast requires only three factors for cleavage. These include cleavage factor lA (CF lA), cleavage factor IB (CF IB), and cleavage factor II (CFII). Polyadenylation in yeast requires two of the cleavage factors, CF lA and CF IB, as well as PAP, polyadenylation factor I (PF 1), and the poly(A)-binding protein (Pah Ip). Even though much has been learned about the proteins involved and their interactions with sequence elements, not all of the protein components have been isolated. The endonuclease responsible for endonucleolytic cleavage of the RNA has not been identified in mammals or yeast. In mammalian cells, poly(A) tails are rapidly elongated to a final length of ~250 nucleotides in two distinct phases. First, polyadenylation proceeds in a distributive mode until 10-12 adenosines are added (Sheets and Wickens, 1989). Once a binding site for PABP2 is created, PABP2 associates with the tail/polyadenylation complex and stimulates processive poly(A) addition (Bienroth et al., 1993). This poly(A) binding protein, PABP2, is also believed to regulate the length of poly(A) addition by associating with, and altering the structure of, the poly(A) tail once it reaches 250 nucleotides in length. Polyadenylate tails in yeast are much shorter than in metazoan cells and average around 70-90 nucleotides in length (Groner and Phillips, 1975). A sequence homologue of PABP2 has not been identified in S. cerevisiae, so another protein and/or mechanism must exist. The cytoplasmic poly(A) tail-binding protein (Pablp) has been demonstrated to regulate poly(A) tail length in vivo and in vitro (Amrani et al., 1997; MinvielleSebastia et al., 1997; Sachs and Davis, 1989). In contrast to mammalian PABP2, Pablp

PAGE 18

11 added to an in vitro polyadenylation reaction appears to inhibit the processivity of PAP in a concentration-dependent manner (Minvielle-Sebastia et al., 1997; Zhelkovsky et al., 1998). Nucleocytoplasmic mRNA Export In eukaryotic cells the nuclear and cytoplasmic compartments are separated by a double-layered membrane called the nuclear envelope (NE). A major consequence of this division is that newly synthesized RNAs are not accessible to the translational machinery. The nuclear envelope is impenetrable to macromolecules, making it a formidable barrier to most cellular components. Transport of macromolecules across the nuclear membrane occurs through a complex structure called the nuclear pore complex (NPC) (Cullen, 2000). The average human cell nucleus contains approximately 4000 NPCs. However, the number of NPCs is largely dependent on the size of the nucleus and can range from less than one thousand to several million. The amount and rate of transport through NPCs is staggering (greater than 10° macromolecules/min) when one considers that all macromolecular transport is conducted bi-directionally through this structure (Ohno et al., 1998). Obviously, the ability to regulate transport through the NPC is advantageous to the cell, and many independent import and export pathways have been identified for different classes of protein and RNA (Cullen, 2000; Gorlich and Kutay, 1999; Rout et al., 1997; Saavedra et al., 1997; Stutz and Rosbash, 1998; Truant et al., 1998). Nuclear pore complexes are large, proteinaceous structures with a highly conserved architecture (Ryan and Wente, 2000). The molecular mass of the NPC is estimated around 1 25 MDa in vertebrates and 60 MDa in Saccharomyces cerevisiae. The

PAGE 19

12 nuclear pore complex is composed of 30 to 50 unique proteins called nucleoporins (Nups) (Fontoura et al., 1999; Rout and Blobel, 1993). These are assembled into a highly ordered structure with eightfold rotational symmetry. The NPC consists of many substructures including spokes and rings, around a central channel, that bridges the nuclear membrane. Extending out from both surfaces are fibrils. On the nuclear side, these fibrils are connected at their ends, forming a basket (Ryan and Wente, 2000). Determination of the structure of the NPC at increasing levels of resolution supports a receptor-mediated model of translocation. The receptor-mediated pathway involves transport adapters, or importins, which recognize and direct macromolecules to the NPC. The adapter for protein import is importin a. Importin a is responsible for recognizing the classical nuclear localization sequence (NLS). The import receptor, importin p, associates with the importin a/NLS complex and targets the NLS-containing protein to the nuclear pore. Some hnRNPs appear to have their own dedicated importin. Kapl04, in yeast, is essential for the nuclear accumulation of the yeast hnRNPs Nab2p and Nab4p (Aitchison et al., 1996). The directionality of translocation is driven by a GTP/GDP concentration gradient that is established across the nuclear membrane. GTPase activity is higher in the cytoplasm, resulting in a higher cytoplasmic concentration of RanGDP. RanGDP has a lower affinity for the importin ap complex, which allows its dissociation in the cjdoplasm. In the nucleus, RanGTP is the prevalent form. RanGTP associates with the incoming NLS-importin aP complex, causing release of the NLS-containing protein, while allowing export of the RanGTP-associated importins.

PAGE 20

13 Messenger RNA export is also mediated by adapter-receptor interaction. Export adapters have been identified in both metazoans and yeast. In yeast, Mex67p binds to, and directs, mRNA to the nuclear pore (Segref et al., 1997). This is accomplished by interaction of Mex67p with Yralp and Mtr2p, which binds the nucleoporin Nup85p (Santos-Rosa et al., 1998; Strasser and Hurt, 2000). The Mex67p/Mtr2p complex also binds to repeat sequences in multiple other nucleoporins (Straser et al., 2000). In reference to NLS-mediated protein import, Mex67p is considered the export adaptor, and Mtr2p the export receptor. It is not clear at this point however what RNA sequences, or structures, are required for Mex67p interaction, or how this interaction is regulated. Additional Posttranscriptional Modifications Base methylation is a frequent, but poorly understood modification that occurs in higher eukaryotes. Methylation at nitrogen 6 (N^) of adenylate residues is common in higher organisms (mammals), but less frequent in yeasts and slime molds. A very interesting aspect of methylation is that the majority of base methylation occurs in exons, not introns (Lavi et al., 1977). Preferential base methylation of ribosomal RNA is also observed, and it has been proposed that methylation protects the RNA that is maintained in the final product. However, studies using methylase inhibitors imply that methylation is required for nuclear RNA processing. Adenylate methylation has been found flanking introns, suggestive of a potential role in splicing. Treated cells have also been shown to accumulate intron-containing pre-mRNAs in the nucleus (Carroll et al., 1990). Editing of mRNA involves either the modification of specific nucleotides or the insertion of nucleotides to alter the coding capacity of an mRNA. RNA editing by uridine addition is fairly common in the mitochondria of the flagellate protozoa

PAGE 21

14 Leishmania, Trypanosoma, and Crithidia (Simpson and Shaw, 1989). In metazoans, RNA editing of mRNA is also used to create new alternative splice sites and alter codons (Rueter et al., 1999). RNA editing has been shown to be required for embryonic erythropoiesis (Wang et al., 2000) and generating antibody diversity by facilitating immunoglobin class switch recombination and somatic hypermutation (Longacre and Storb, 2000; Liber, 2000). Another example of altering the coding potential of an mRNA is RNA editing of the apolipoprotein B mRNA. In this case, the glutamine codon 2153 (CAA) is converted to a translation stop codon (UAA) by a cytidine deaminase. The result is the production of a truncated form of the protein (apoB48), which is required for dietary lipid absorption. The catalytic subunit of the apoB mRNA editing enzyme has been identified in tissues and cell lines that do not express the apoB mRNA (Hodges and Scott, 1992). Thus, editing in this fashion is likely to occur on other mRNAs. Two other cases of mRNA editing involve a glutamine (CAG) to arginine (CGG) in the glutamate-activated cation channel (GluRB) mRNA and U to C editing (CUC CCC) in the Wilms tumor susceptibility gene (WTI) (Sharma et al., 1994; Sommer et al., 1991). Editing of GluRB mRNA is an extremely efficient process. More than 99% of the GluRB mRNA is edited, which changes the gating and ion conductance of the receptor. Recently, editing was identified in the mRNA of the sheep oxytocin receptor, suggesting that mRNA editing may be more prevalent in regulating receptor function than previously thought (Feng et al., 2000).

PAGE 22

15 Interaction Between RNA Processing Steps It is clear that each step of RNA processing is interconnected with other events in the biogenesis of mRNA. Not only do posttranscriptional RNA processing events affect each other, they impact the transcriptional and translational machinery. Nucleocytoplasmic export of mRNA is also highly dependent on accurate processing of the htiRNA into mRNA (Proudfoot, 2000). Transcription Most RNA processing events are coupled to transcription in vivo. This is true for 5 Â’-capping, pre-mRNA splicing and 3 Â’-end formation. Coupling of these events can be attributed to binding of RNA processing factors, specifically to the phosphorylated form of the carboxy-terminal domain (CTD) of RNA polymerase II. During transcription initiation, the hypophosphorylated CTD of RNA pol II is primarily associated with transcription factors (TFs). The CTD of the elongating RNA pol II is highly phosphorylated upon promoter clearance, which releases many of the TFs involved in transcription initiation, also potentially freeing the CTD for loading of RNA processing factors. Both of the en 2 ymes responsible for 5 Â’-cap formation, the guanylyl transferase and methylase, have been shown to bind to the phosphorylated form of the CTD (Cho et al., 1997; McCracken et al., 1997). Capping has been shown to occur within the first 10 to 30 nucleotides, most likely facilitated by CTD-associated capping factors (Rasmussen and Lis, 1993; Salditt-Georgieff et al., 1980). Interestingly, many genes stall transcriptional elongation soon after initiation. One study of three independent transcripts showed that 5 Â’-capping was coincident with transcriptional stalling/pausing

PAGE 23

16 (Rasmussen and Lis, 1993). It is tempting to speculate that capping may be the determinant for switching transcriptional initiation to elongation. Splicing of introns from the pre-mRNA has been shown to occur cotranscriptionally in many instances (Bauren and Wieslander., 1994; Beyer and Osheim, 1988). Although it is unclear as to which of the numerous splicing factors associate with the CTD, it is clear that proteins with homology to splicing regulator proteins (SR proteins) bind the CTD (Kim et al., 1997; Yuryev et al., 1996). Specific SR proteins may also be pre-loaded in a promoter-dependent manner. For example, intron removal from an alternatively spliced fibronectin gene varied depending on the promoter used (Cramer et al., 1997). Transcription rates can also influence alternative splicing. Correctly positioned transcriptional pause sites allow splicing of an intron that is normally skipped (Roberts et al., 1998). Transcription is also coupled to 3 '-end formation at the level of transcriptional termination (Yonaha and Proudfoot, 2000). The first indication that transcription termination was dependent of 3 '-end formation came from mutational analysis of polyadenylation signals. It is well documented that in the absence of functional 3'-end processing signals, transcription fails to terminate at the correct site (Duvel and Braus, 1999; Greger et al., 2000; Proudfoot, 1989). In yeast, when transcription does terminate, either cryptic polyadenylation sites or the cleavage and polyadenylation signals of a downstream gene are utilized (Russo et al., 1993). Coupling of 3'-end cleavage to termination is achieved by the interaction of cleavage factors with the CTD. It has been demonstrated that CPSF is initially associated with TFIID, a general transcription factor. Whereas most TFs dissociate after promoter clearance and phosphorylation of the CTD,

PAGE 24

17 CPSF is transferred to the elongating RNA polymerase 11 (Dantonel et al., 1997). This factor is responsible for recognizing the consensus AAUAAA positioning element during 3'-end cleavage. Association with the elongating RNA pol II ensures that this sequence is displayed to CPSF immediately after it is generated. Coupling has also been demonstrated in yeast. Studies in S. cerevisiae demonstrated that only cleavage was coupled to transcription termination. Temperature-sensitive mutants in various cleavage factors failed to terminate at the non-permissive temperature, while polyadenylation factor mutants did not (Birse et al., 1998). Pre-mRNA Splicing and 3 Â’-End Formation Splicing has been shown to have an enhancing effect on 3'-end formation. Specifically, 3'-terminal intron splicing enhances the usage of a proximal poly(A) signal (Cooke and Alwine, 1996; Niwa et al., 1990). Coupling of splicing and 3'-end formation has also been shown to function in the reverse order. That is, mutations to poly(A) signals result in decreased efficiency of 3 '-terminal intron splicing, but not of distal splice sites (Niwa and Berget, 1991). This implies interactions between factors at the 3' splice site with cleavage factors, consistent with a model of exon definition, where exon boundaries are defined by processing factors/RNA-binding proteins. Splicing does not always facilitate the use of 3'-end formation signals. Splicing factors can also down regulate the use of a 3'-end processing site. The U1 snRNP has been shown to inhibit polyadenylation (Ashe et al., 1997). This is also seen by the failed recognition of polyadenylation sites that have been inserted into introns (Adami and Nevins, 1988). Unless splice sites are mutated, or weak to begin with, the poly(A) signal is overlooked. The poly(A) polymerase is also directly affected by the U1 snRNP A

PAGE 25

18 (UlA). Direct, physical interaction of a UlA dimer with PAP inhibits polyadenylation (Gunderson et al., 1994). This interaction is used to auto-regulate the amount of UlA produced by limiting the amount of its own mRNA. mRNA Export Nucleocytoplasmic export of mRNAs is coupled to the production of an exportable mRNP substrate. Accurate processing at all levels appears required to generate an exportable mRNA (Cullen, 2000). What constitutes an export-competent mRNP? How is the protein composition of an exportable mRNA different? What RNA processing events are coupled to export and how? The first export signal on an mRNA may be the presence of a 5'-cap. In Xenopus oocytes, capped mRNA substrates are exported more efficiently than non-capped controls (Hamm and Mattaj, 1990). Splicing is also facilitates mRNA export. Formation of the spliceosome on an mRNA has been shown to be inhibitory to export. This is possibly due to association of hnRNP C, a nonshuttling hnRNP, with the 3'-end of introns (Swanson and Dreyfuss, 1988). More recently, the process of splicing has been demonstrated to facilitate mRNA export. It was shown that spliced mRNPs (from an in vitro reaction) were exported rapidly and efficiently when injected into Xenopus oocytes. However, an mRNP lacking the intron was not (Luo and Reed, 1 999). The conclusion was that splicing of the mRNA directed the assembly of an mRNP specifically recognized by export factors. The protein component, Aly, specific to this mRNP was recently identified in metazoans (Zhou et al., 2000). The yeast homologue of Aly, is Yralp. Yralp interacts directly with Mex67p, a known mRNA export factor (Strasser and Hurt, 2000; Stutz et al., 2000). Another RNA binding protein, Y14, was found to preferentially associate with spliced mRNAs

PAGE 26

19 (Kataoka et al., 2000). TAP, the vertebrate homologue of Mex67p, was also present in the Y 1 4-containing hnRNP complex. This suggested that the complex was exportable. Accurate 3 Â’-end formation is also required for mRNA export. It was initially believed that the presence of a poly(A) tail was all that was required. When microinjected into oocytes, the presence of a poly(A) tail facilitates export. Later, in mammalian cells, it was shown that a poly(A) tail was essential for export (Huang and Carmichael, 1996). Surprisingly, this study also concluded that the process of polyadenylation, not just the presence of a 3 Â’-terminal poly(A) tail, is required for export. This suggests that cleavage and polyadenylation also generates an mRNP that is recognized as export-competent, although the specific factor(s) have not been identified. One possible conclusion is that nuclear processing events imprint the mRNA while in the nucleus (Figure 3). Sequences downstream of the cleavage site in mammalian genes have also been shown to bind to hnRNP C (Moore et al., 1988; Wilusz et al., 1990). Since hnRNP C does not leave the nucleus, this may also prohibit the export of an mRNA before it is cleaved and polyadenylated. The HnRNP/RNA Complex is the Substrate for Nuclear RNA Processing Events The substrate for RNA processing reactions is not naked RNA, but a complex between hnRNA and nuclear RNPs (hnRNPs). As soon as the hnRNA emerges from the RNA polymerase II it is recognized and bound by hnRNPs in a sequence specific manner to form the hnRNP complex. It is this complex of protein and RNA that is the substrate for all subsequent RNA processing reactions.

PAGE 27

Figure 3. Schematic representation of RNA processing events that generate an export-eompetent mRNP. The proteins Y14 and Aly were shown to associate with mRNAs that are spliced, suggesting that pre-mRNA splicing marks the mRNA by the addition of these proteins. TAP, the human homologue of the yeast export adapter Mex67p, is also present in Y 1 4-containing mRNPs. The process of 3 Â’-end formation has also been shown to facilitate mRNA export. However, imprinting factors such as Y14 and Aly have not been identified for 3 Â’-end formation.

PAGE 28

21 GpppGl splicing r

PAGE 29

22 HnRNP Identification and Classification HnRNPs were originally identified as proteins that associate with hnRNA, and are not stable components of other ribonucleoprotein complexes (RNPs) such as small nuclear RNPs (snRNPs) (Dreyfuss, 1993). The identification of hnRNPs has progressed from using co-sedimentation and UV-induced crosslinking to immunopurification using monoclonal antibodies (Dreyfuss et ah, 1984; Pinol-Roma et ah, 1988; Wilk et ah, 1985). Using these methods, more than 20 major proteins in hnRNP complexes, designated hnRNP A 1 to hnRNP U, were identified as well as numerous less abundant components. While the diversity of hnRNPs seen in vertebrates is lacking in other organisms, hnRNPs have been identified in numerous distant organisms including Xenopus, Drosophila, and Saccharomyces. Due to their intimate association with hnRNA, hnRNPs were originally speculated to function in mRNA biogenesis. Evidence has accumulated suggesting that hnRNPs play vital roles at many, if not all, levels of RNA processing (Weighardt et ah, 1996). Structure and Function of HnRNPs HnRNPs are very abundant proteins. The core hnRNPs (Al, A2, Bl, B2, Cl, C2) are as abundant as core histones (70-90 x 10® / HeLa cell) and more abundant than ribosomes (4 x 10® / HeLa cell). HnRNPs also contain highly conserved structural motifs required for RNA binding. These are the consensus sequence RNA binding domain (RBD or RRM), RGG box, and KH domain. The most prevalent structural motif is the RBD/RRM, also called the RNP motif This domain is often found in multiple copies in many pre-RNA binding proteins (Dreyfuss, 1993). The RGG box is a short region of 20 to 25 amino acids that contains several arginine-glycine-glycine (RGG) tripeptide

PAGE 30

23 repeats. RNA binding characteristics of the RGG box differ with respect to the protein that contains it. Some RGG box domains bind RNA without sequence preference (Ghisolfi et al., 1992). Others, like that in hnRNP U, are sequence specific. The K homology (KH) domain was originally identified in hnRNP K (Matunis et al., 1992; Siomi et al., 1993). This domain is also evolutionarily conserved and has been demonstrated to bind RNA in vitro. Pre-mRNA Splicing HnRNPs have been shown to function in many RNA processing events. Numerous hnRNPs have a role in pre-mRNA splicing and alternative splicing. Antibodies against hnRNPs Al or C1/C2 inhibit the 5'-cleavage reaction during splicing (Choi and Dreyfuss, 1984; Sierakowska et al., 1986). HnRNP Al is involved in the regulation of 5' splice site choice by activating use of distal 5' splice sites in a concentration dependent maimer (Mayeda and Krainer, 1992). It also appears that hnRNP A 1 is an important part of the cellular response to osmotic stress conditions. Under osmotic stress conditions, hnRNP Al is phosphorylated and accumulates in the cytoplasm. This correlates with a shift in the alternative splicing pattern of a reporter construct in vivo (van der Houven van Oordt et al., 2000). The polypyrimidine tract binding protein (PTB) has been identified as hnRNP I, and its presence regulates the use of 3' splice sites. A neurally enriched form of PTB was recently identified and is implicated in the regulation of tissue specific alternative splicing (Markovtsov et al., 2000). Splicing of the c-src neuron-specific N1 exon is also repressed in vitro by the addition of PTB (Chou et al., 2000). HnRNPs have also been identified in yeast (Wilson et al., 1994). Interestingly, although Nab4p resembles hnRNP Al (by comparison of

PAGE 31

24 structural motifs), yeast hnRNPs have not been demonstrated to be directly required for pre-mRNA splicing. Pre-mRNA 3 Â’-End Formation The process of 3'-end formation in metazoans does not appear dependent on hnRNPs. However, the yeast hnRNP Nab4p was identified as CF IB, a component of the cleavage and polyadenylation complex (Kessler et ah, 1997). Nab4p was also shown to regulate 3'-end cleavage site choice in vitro, much like hnRNP A1 concentrationdependent regulation of splice site choice (Minvielle-Sebastia et ah, 1998). Nab2p, another yeast hnRNP, is required for poly(A) tail length regulation and mRNA export in vivo (Anderson, 1995; Anderson et ah, 1993). Other Functions of HnRNPs HnRNPs also bind single-stranded DNA, making them potential transcriptional regulators. Binding of hnRNP K to the c-myc promoter in vitro has been shown to facilitate transcription (Michelotti et ah, 1996). Many hnRNPs have also been identified as shuttling proteins (Shyu and Wilkinson, 2000). Some have even been visualized traversing the nuclear pore, associated with mRNA (Alzhanova-Ericsson et ah, 1996; Sun et ah, 1998; Visa et ah, 1996). While suggestive of potential cytoplasmic functions, only in the past few years have hnRNPs been demonstrated to function in the cytoplasm. Translation is affected by three different hnRNPs under different circumstances. HnRNP A2 enhances the translation of a reporter mRNA containing a short, 21 nucleotide, cis element (Kwon et ah, 1999). Translation silencing, in some instances, is mediated by hnRNP K and El, via inhibition of 80S ribosome assembly (Ostareck et ah, 1997).

PAGE 32

25 Stability of mRNAs containing AU-rich elements (AREs) has been linked to hnRNP D. Binding of hnRNP D to the ARE correlates with the decreased stability of AREcontaining mRNAs (DeMaria et ah, 1997; Kiledjian et ah, 1997; Loflin et ah, 1999). A eytoplasmic role for Nab4p was also recently identified. Nab4p was shown to trigger decay of mRNAs with a premature stop codon via the nonsense-mediated decay (NMD) pathway in yeast (Gonzalez et ah, 2000). Mechanisms for HnRNP Function HnRNPs are thought to exert their functions in numerous ways. The RNA in an hnRNP complex is accessible to RNases, suggesting that hnRNPs promote the display of sequenees that would otherwise be hidden. These sequences may reeruit splicing components to facilitate pre-mRNA splicing. It is also possible that hnRNPs compete with other factors for RNA binding sites, negatively regulating the use of those sites. Examples of this are seen with hnRNP K and the inhibition of transcription from the neuronal nicotinic acetylcholine receptor promoter (Du et ah, 1998). HnRNPs have also been demonstrated to eontain RNA annealing activities. This may faeilitate the formation or destabilization of RNA structures that could serve as binding sites for other factors. It is also possible that some hnRNPs funetion to directly recruit specific RNA processing faetors, or stabilize complex formation on the RNA.

PAGE 33

MATERIALS AND METHODS Growth Conditions and Media Yeast cells were grown in either YPD, YPGal (1% Bacto-yeast extract (Fisher), 2% Bacto-peptone (Fisher), 2% dextrose (Fisher) or 2% galactose (Sigma, St. Louis, MO), 2% Difco-agar for plates), synthetic dextrose (SD), or S}mthetic galactose (SG) media (0.67% Bacto-yeast nitrogen base w/o amino acids, 2% dextrose or 2% galactose, 2% Difco-agar) supplemented with L-amino acids as needed (Rose et al., 1990). Prior to sporulation diploid cells were grown overnight on pre-sporulation plates (0.8% Bactoyeast extract, 0.003% Bacto-peptone, 10% dextrose). Cells were then transferred to sporulation plates (1% KOCH 3 , 0.025 mg/ml ZnOCHs) to induce spore formation. For liquid cultures, yeast strains were grown in a water bath at the specified temperature. Plasmid shuffling was accomplished by using 5-fluoro-orotic acid (5-FOA, Diagnostic Chem. Ltd.) to evict plasmids carrying URA3 (Sikorski and Boeke, 1991). All of the yeast strains used in this study are described in the appendix. Bacteria were cultured at 37°C in Luria-Bertani media (1% Bacto-tryptone, 0.5% Bacto-yeast extract, 1% NaCl, pH 7.5, 2% Difco-agar for plates) supplemented with 100 pg/ml ampicillin as required. Unless otherwise stated, all bacterial plasmids and yeast shuttle vectors were propagated in E. coli strain DH5a {supEAA Alac U169 [ct)80 /acZAM15] hsdRM recAl endAX gyrA96\ thi-\ relAl). 26

PAGE 34

27 Cell Transformations Yeast cell transformations were performed essentially as described (Ito et al., 1983). Yeast cells were grown to an OD6oo-0.5 in YPD or SD. Approximately 5 ODeoo units of cells per transformation were harvested by centrifugation at 1,500 x g for 5 minutes. Cells were washed once in 10ml of ice-cold sterile d2H20 and pelleted as before. The cell pellet was resuspended in 100 pi TE/0.1 M lithium acetate, 5 pg of denatured calf-thymus DNA, and 1 to 5 pg of plasmid DNA. To the cell-plasmid mixture, 600 pi of 40% PEG 3500 in TE/0.1 M lithium acetate was added. This mixture was incubated at room temperature for 30 minutes, rotating end over end. Cells were heat shocked at 42°C for 15 minutes and washed two times with sterile 1 M sorbitol. Cells were resuspended in 500 pi sterile 1 M sorbitol and 100 pi of cells was spread on SD plates. SD plates were supplemented to allow growth of cells that received the transforming DNA. Bacterial cells (DH5a) were made electro-competent for transformation as described previously (Sambrook et al., 1989). Transformations of E. coli were performed using a gene pulser (BioRad, Richmond, CA) according to the manufacturer’s instruction. Y east Genetic Manipulations All genetic manipulations were performed as previously described (Guthrie and Fink, 1991). Yeast cells were mated by patching haploid strains together on YPD, incubating at 24°C for 3 to 5 hours, and plating cells on media to select for diploids. Segregation analysis was done by digesting the spore wall for 10 to 30 minutes in 1.0 M sorbitol, 0.5 mg/ml Zymolyase 20T (Seikagaku Corporation, Tokyo, Japan). Digested

PAGE 35

28 asci were transferred to YPD plates for micromanipulation to separate individual spores. Dissected spores were allowed to germinate and form colonies at 24°C unless otherwise stated. Cells were replica plated onto SD plates to test for auxotrophic markers. Conditional lethal phenotypes were determined by replica plating at various temperatures or concentration of stress agents. Nucleic Acid Isolation Procedures Yeast genomic DNA was isolated from cells grown in YPD to OD6oo=l-3. Five milliliters of cells were pelleted by centrifugation at 1,250 x g for five minutes. Cells were resuspended in 0.5 ml of 1 M sorbitol, 100 pi 0.5 M EDTA, pH 8.0, 18 pi 1 M dithiothreitol (DTT, Gibco BRL, MD), and 50 pi of 5 mg/ml Zymolyase lOOT (Sekagaku Corp.) and incubated for 1 hour at 37°C. Spheroplasts were harvested by microcentrifugation at 3,000 x g for 1 minute. Spheroplasts were lysed by resuspension in 500 pi 50 mM Tris-HCl, pH 7.5, 20 mM EDTA, 1/10 volume 10% sodium dodecyl sulfate (SDS, Gibco BRL) and incubated at 65°C for 30 minutes, with periodic mixing. To remove cell debris, 200 ul of 5 M potassium acetate was added and incubated on ice for 20 minutes. Insoluble components were pelleted by microcentrifugation at 1 6,000 x g for 1 5 minutes at 4°C. The supernatant was transferred to a new microfuge tube and the DNA was precipitated by adding one volume of isopropanol and incubating at room temperature for 10 minutes. DNA was pelleted at 16,000 x g for 1 minute at room temperature, washed with 70% ethanol and dried in a SpeedVac (Sevant, Marietta, OH). The DNA was resuspended in 250 pi TE and treated with 5 pi of 10 mg/ml RNase A (Sigma) at 37°C for 1 hour. The lysate was extracted twice with phenol and genomic

PAGE 36

29 DNA was precipitated using 1/10 volume of 3 M sodium acetate (Fisher) and two volumes of ethanol. The DNA was recovered by centrifugation, washed, dried and resuspended in 1 00 pi TE. Plasmids were rescued from yeast using a previously described method (Strathem and Higgins, 1991) and DNA from crude lysates was purified using a Gene Clean kit (BIO 101, Vista, CA). Total RNA was isolated from yeast cells by extraction with 65°C acid equilibrated phenol as previously described (Guthrie and Fink, 1991). Cells were grown in the specified media to OD6oo=0.5-1.0 and harvested by centrifugation at 2,000 x g for 5 minutes at 4°C. After hot acid-phenol extraction, the total RNA was extracted twice with phenol and once with chloroformnsoamyl alcohol. RNA was precipitated using an equal volume of 4 M ammonium acetate and 2 volumes of ethanol. Pelleted RNA was resuspended in diethyl pjrocarbonate (DEPC, Sigma)-treated d2H20. Poly(A)’^ RNA was isolated from total RNA by selecting two times on oligo(dT)-cellulose (Gibco BRL or poly(U) Sephadex (Amersham-Pharmacia, Piscataway, NJ) as previously described (Cleaver et al., 1996). Poly(A)^ RNA was bound in binding buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.5% SDS, 0.5 M LiCl) for 30 minutes at room temperature with gentle mixing. After washing thoroughly with binding buffer, poly(A)^ enriched RNA was eluted with elution buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.05% SDS). When necessary, poly(A)^ RNA was concentrated using sec-Butanol (followed by two phenol extractions and one chloroformdsoamyl alcohol extraction) prior to precipitation with 1/10 volume of 3 M sodium acetate and 2 volumes of 100% ethanol. Poly(A)^ RNA

PAGE 37

30 was resuspended in DEPC-treated d2H20 and the concentration was determined spectrophotometrically by A26oDNA and RNA Blot Analysis Yeast genomic DNA (10-20 pg) was treated with restriction endonucleases, separated by agarose gel electrophoresis and transferred to a charged nylon membrane (Hybond Amersham Corp., Arlington Heights, IL) by capillary blotting (Sambrook et al., 1989). Yeast RNA samples were treated with dimethylsulfoxide (DMSO, Fisher)/glyoxal (Sigma or Alrdrich) fractionated on 1.21.6% agarose gels and transferred to a charged nylon membrane in 20X standard sodium citrate(SSC, 3 M NaCl, 0.3 M Na3C6H507*2H20, pH 7.0) (Sambrook et al., 1989). Hybridizations were performed in a hybridization oven (Robbins Scientific Corp., Sunnyvale, CA) at 42°C for oligo probes or 65°C or random prime labeled probes, for a minimum of 12 hours in hybridization solution (1% bovine serum albumin (BSA, Sigma), 1 mM EDTA, 25 mM Na2HP04 (Fisher), and 7% SDS). RNA blots were washed twice at room temperature in 2X SSC/0.1% SDS for 15 minutes, followed by at least two more washes in 0.2X SSC/0.1% SDS at a temperature 0-5°C below the hybridization temperature for 15 minutes each. Radio-labeled probes were prepared using a Random Prime Labeling kit (Gibco/BRL) and [a^•]-dCTP (3000 Ci/mmol, NEN™ Life Sciences, Boston, MA). Oligo DNA probes were 5 ’-end labeled using T4 polynucleotide kinase (Promega Corp., Madison, WI) and [y^^P]-ATP (3000 Ci/mmol, NEN™).

PAGE 38

31 Yeast Total Cell Protein Isolation Yeast eells were grown to OD6oo=0-5 to 1.0 and harvested by centrifugation. Cells were washed once with ice-cold sterile d2H20 and resuspended in 200 pi of icecold 10% trichloroacetic acid (TCA, Fisher). Acid washed glass beads were added to just below the meniscus. The glass bead mixture was vortexed four times for 1 5 seconds each with cooling on ice between vortexing. The cell lysate was removed and 200 pi of fresh 10% TCA was added to the glass beads and vortexed for 15 seconds. The wash was removed and added to the cell lysate. Precipitated cellular proteins were pelleted by centrifugation at 1 4,000 x g at 4°C for 1 0 minutes. The protein pellet was resuspended in Laemmli cocktail and neutralized with 1 .0 M Tris-base. Protein samples were boiled for 3 minutes prior to fractionation by SDS-PAGE. Tandem Affinity Purification of Nab2p The carboxy-terminus of Nab2p was tagged with a Calmodulin Binding Peptide (CBP) and the Staphylococcus aureus Protein A (ProtA) to generate Nab2p-TAP (YKN206 was generated by K. Nykamp). A Tobacco Etch Virus protease cleavage site was included between the CBP sequence and ProtA. This allowed for two successive rounds of purification. Homologous recombination was used to insert the fusion protein coding sequence at the 3 ’-end of the NAB2 gene in L4717 cells, using the TRPl gene for selection. Cells expressing only the TAP-Nab2p fusion were isolated (YKN206). To purify Nab2p-TAP from yeast cells, total protein extracts were prepared from YKN206 cells grown to mid-log phase at 30°C. Cells were harvested by centrifugation and resuspended in Buffer A-TAP (10 mM HEPES-K+, pH 7.9, 10 mM KCl, 1.5 mM MgCh,

PAGE 39

32 0.5 mM DTT) with protease inhibitors (0.5 mM PMSF, 2 mM Benzamidine, 1 pM Leupeptin, 2 pM Pepstatin, 4 pM Chymostatin, and 2.6 pM Aprotinin). Whole cell lysates, by French press, were cleared by centrifugation at 60,000 x g for 30 minutes at 4°C. This was followed by centrifugation of the supernatant at 130,000 x g for 90 minutes at 4°C. The supernatant was dialyzed against lOOOX volume of Buffer D-TAP (20 mM HEPES-K+, pH 7.9, 50 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, 20% glycerol) with protease inhibitors (0.5 mM PMSF, 2 mM Benzamidine) and stored at -80°C until purification. Nab2p-TAP was purified using the previously described tandem-affinity purification procedure (Rigaut et al., 1999). Protein extracts were incubated with IgGSepharose beads (Amersham-Pharmacia) at 4°C for 2 hours. The beads were washed with IPP150 Buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% NP40) followed by incubation with 1 ml of TEV Cleavage Buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.5 mM EDTA, 0.1% NP40, 1 mM DTT) and 100 units of TEV protease (Gibco BRL) at 16°C for 2 hours. Cleavage released Nab2p-TAP from the beads and the eluate was collected. Nab2p-TAP was re-purified on calmodulin affinity resin (Stratagene, La Jolla, CA) by incubation in Calmodulin Binding Buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM MgOAc, 1 mM imidazole, 2 mM CaCh, 0.1% NP40, 10 mM PMercaptoethanol (BME, Sigma) for 60 minutes at 4°C. Nab2p-TAP was eluted by addition of 800 pi of Calmodulin Elution Buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM MgOAc, 1 mM imidazole, 2 mM EGTA, 0.1% NP40, 10 mM PMercaptoethanol) .

PAGE 40

33 In vitro 3 ’-End Processing Assays In vitro polyadenylation reactions were performed using a homogeneously labeled precursor RNA. Unless otherwise stated, the substrate RNA used was pre-cleaved CYCl, transcribed from the p-G4CYCl-pre plasmid, linearized with Ndel. In vitro transcription reactions were performed in 50 pi reactions containing 1 pg pG4CYCl-pre, lx T7 transcription buffer (Promega), 2.0 mM DTT, 1 pi RNasin (Promega), 0.5 mM GpppG cap (Amersham Pharmacia), 0.5 mM each ATP, CTP and 0.02 mM GTP and UTP, 40 pCi [a^^P] UTP (NEN^“) and 15 units T7 RNA polymerase. The reaction was incubated at 37°C for 1 to 2 hours. Template DNA was digested with RQl RNase-free DNase (Promega) for 15 minutes at 37°C. The RNA was phenol extracted and precipitated in the presence of 10 pg of RNase-free glycogen. The labeled precursor RNA was gel purified as previously described (Sambrook et al., 1989). Cell extracts competent for 3 ’-end processing in vitro were prepared essentially as described (Butler and Platt, 1988; Butler et al., 1990). One liter of cells was grown in YPD + Ade to OD6 oo= 2-6, harvested and resuspended in 15 ml of Buffer S (1.0 M sorbitol (Sigma)/50 mM Tris-HCl, pH 7.8, 10 mM MgCb, 30 mM DTT) and incubated for 15 minutes at room temperature. Cells were harvested and resuspended in 1 5 ml of Buffer S with 40100 pi of 20 mg/ml Zymolyase lOOT (Seikagaku Corp., Tokyo, Japan). This mixture was incubated at 30°C with gentle shaking for 30-60 minutes, until greater than 90% of the cells were spheroplasted, as determined microscopically by cell lysis in 1% SDS. Spheroplasts were collected by centrifugation and gently resuspended in ice cold Buffer A (10 mM HEPES-K+, pH 7.0, 1.5 mM MgCb, 10 mM KCl, 0.5 mM DTT, 4 mM

PAGE 41

34 Pefabloc-SC) with lx PicW (1 M e-aminocaproic acid, 1 M p-aminobenzamidine, 1 mg/ml leupeptin, 2 mg/ml aprotinin, in d2H20) and lx PicD (0.5 M phenylmethylsufonyl fluoride (PMSF), 5 mg/ml pepstatin A, 1 mg/ml cymostatin, in DMSO). The resuspended spheroplasts were lysed on iee in a glass homogenizer (Wheaton, Millville, NJ) using 6 strokes with the tight pestle. The cell lysate was brought to 0.2 M KCl and stirred slowly on ice water for 30 minutes. The eell lysate was cleared first by centrifugation at 22,000 x g for 30 minutes at 4°C. This was followed by centrifugation at 145,000 X g for 60 minutes at 4°C in a Ti 70.1 rotor (Beckman). The whole eell extract was removed carefully to avoid the pellet and the top lipid layer. This was brought to 40% saturation with ammonium sulfate (0.226 g/ml). The ammonium sulfate was allowed to dissolve by stirring gently on ice water for 5 minutes, and then ineubated on ice for 20 minutes. The precipitated proteins were colleeted by centrifugation at 15,000 X g for 20 minutes at 4°C and typically resuspended in 0.5-1 ml of Buffer B (20 mM HEPES-K+, pH 7.0, 0.2 mM EDTA, 50 mM KCl, 20% glycerol, 0.5 mM DTT, 0.4 pM leupeptin, 0.7 pM pepstatin A, and 0. 1 M PMSF). The extract was dialyzed at 4°C against l liter of Buffer B, two times for 1.5-2 hours eaeh. The extracted was aliquoted, flash frozen in liquid nitrogen and stored at -80°C. In vitro polyadenylation reactions were performed in 25 pi using 2-3 pi of extraet, approximately 10 fmole of labeled precursor RNA (-300,000 cpm), 2 mM ATP, 20 mM creatine phosphate, 1 mM MgOCHs, 2% polyethylene glyeolgooo, 75 mM KOCH3, 1 mM DTT, and 1 U/pl RNasin (Promega) (final concentrations). Reactions were typically carried out at 30°C for 20-30 minutes and stopped by adding 1/10 volume of a stop buffer (2 mg/ml proteinase K (Roche Biomedical), 130 mM EDTA, 2.5% SDS) and incubated at 37°C for 30 minutes.

PAGE 42

35 Reactions were phenol extracted two times, chloroformhsoamyl alcohol extracted once and precipitated using ammonium acetate and 10 pg of RNase-ffee glycogen. The reaction products were resolved on denaturing 6% polyacrylamide (29: 1 acrylamide:bisacrylamide) gels followed by autoradiography. Indirect Cellular Immunofluorescence Subcellular localization of proteins was performed using the following method. Cells were grown to an OD6oo=0. 1-0.5 in YPD, unless otherwise stated. For each strain, 10% formaldehyde (freshly prepared from paraformaldehyde (EM grade. Polysciences, Warrington, PA) in 100 mM KH2PO4, pH 6.5) was added to a final concentration of 4% to 1.5 X 10* cells and incubated at room temperature with gentle rocking for 2 hours. Fixed cells were pelleted at 800 x g for 2.5 minutes at room temperature and washed twice in 25 ml of WBl (100 mM KH2PO4, pH 6.5) and once in 25 ml of WB2 (100 mM KH2PO4, pH 6.5, 1 .2 M sorbitol). Cells were pelleted as before, resuspended in 1 ml of SB (100 mM KH2PO4, pH 6.5, 1.2 M sorbitol, 30 mM PME) and 30 pi of 10 mg/ml Zymolyase lOOT in WB2 was added. Cells were incubated for 30-45 minutes until greater than 90% spheroplast formation was achieved. Spheroplasts were monitored by phase-contrast microscopy (400X magnification). Spheroplasts were collected by centrifugation at 2000 x g for 1 minute at room temperature and washed once with WB2. Cells were resuspended in 1 ml of WB2 and were adhered to polylysine-coated 1 0-well HTC Blue slides (Cel-Line Associated, Newfeildm NJ) for 10 minutes at 4°C using 10 pl/well. Slides were washed once in ice-cold PBS and sequentially incubated at -20°C in 100% methanol for 5 minutes and 100% acetone for 30 seconds. Slides were washed

PAGE 43

36 three times with PBS, incubated in 0.1% Triton X-100 (Sigma) in PBS and washed three more times in PBS. Slide wells were blocked by incubation with 10 |al of 3% BSA in PBS for 30 minutes at room temperature. Primary antibodies were diluted in 3% BSA in PBS and incubated at room temperature for 60 minutes. Antibodies were diluted as follows: 3F2(1:500), 101(1:5000), 3H1(1:500), 403(1:500), A66(l:500). Primary antibodies were detected using fluorescein or rhodamine-conjugated goat anti-mouse IgGl or Ig02a subclass-specific antibodies (Fisher) diluted 1:10 in 3% BSA in PBS. Secondary antibodies (10 pl/well) were incubated for 30 minutes at room temperature, washed tree times in ice-cold PBS followed by staining with 0.5 pg/ml 4Â’6-diamidino-2phenylindole (DAPI) and washed three more times in ice-cold PBS. Mounting media (1 mg/ml p-phenylenedianine (Sigma) in 90% glycerol) was applied and the slides were sealed with a coverslip and clear nail polish. Fluorescent images were obtained using a Nikon Optiphot-2 microscope equipped with a lOOX fluorescence/differential interference contrast (DIG) objective, or by digital microscopy as described previously (Wilson, 1996). In Situ Hybridization and Cellular Immunofluorescence The subcellular distribution of poly(A)^ RNA was examined by in situ hybridization of digoxigenin-labeled (dT)so (Amberg et al., 1992) using a modification of a protocol kindly provided by A. de Bruyn Kops and C. Guthrie (University of o California, San Francisco, CA). Cells were grown to OD6oo=0-5-1.0 and 1.5 X 10 cells were fixed, washed, digested, and washed again as for indirect cellular immunofluorescence, and resuspended in 0.5 ml WB2. Cells were adhered to polylysine-

PAGE 44

37 coated slide wells and treated with methanol and acetone as before. Treated slides were dried in a Speedvac (Savant) for 1 minute. Slides were prewarmed in a 37°C humidifier chamber. Hybridization solution was prepared using diethlpyrocarbonate-treated water and contained 10% dextran sulfate, 5X standard sodium citrate(SSC), IX Denhardt’s solution (0.2 mg/ml fieol type 400 (Sigma), 0.2 mg/ml polyvinylpyrrolidone (Sigma), BSA), 33% deionized formamide, 10 mM vanadyl ribonucleoside complex (Aldrich), 100 pg/ml denatured salmon sperm DNA, 200 pg/ml tRNA, 0.68 pg/ml digoxigeninlabeled (dT)so. Digoxigenin was conjugated to (dT) 5 o as described previously (Amberg et al., 1992). Hybridization was for 12-14 hours at 37°C followed by washes to remove excess probe as described previously (Amberg et al., 1992). Individual slide wells were sequentially incubated with 15 pi of the following solutions for 30 minutes at 37°C: (1) 3% BSA in PBS (antibody binding buffer); (2) anti-digoxigenin monoclonal antibody (IgGl sub-class, Boehringer-Mannheim) diluted 1:50 in AB; (3) fluorescein-conjugated goat anti -mouse IgGl subclass-speeific antibody (Southern Biotechnology Associated, Birmingham, AL) diluted 1:10 in AB. Finally, DNA was stained by treating cells with DAPI as described above. Following eaeh of these steps, slides were washed three times in iee-cold PBS. Slides were mounted and viewed as deseribed above. Yeast Two-Hybrid Screen Proteins that interacted with Nab2p in vivo were identified using the MATCHMAKER Two-Hybrid System, according to the manufacturer’s instruction (Clontech, Palo Alto, CA). The coding region of NAB2 was PCR amplified, and subeloned into EeoRI-BamHI digested pGBT9 to generate pNAB2.GBT9. This plasmid

PAGE 45

38 was transformed into the host yeast strain Y190 (Harper et ah, 1993) and the production of fusion protein was confirmed by immunoblot analysis using the monoclonal antibody 3F2. This cell was transformed with a yeast cDNA library, generously provided by John P. Aris (University of Florida, Gainesville, FL) or a human library (Clontech). Transformants that were His^ and P-galactosidase^ were retained for isolation by plasmid rescue. Interacting proteins were identified by sequencing the ends of the plasmid insert and comparison to the yeast genome using BLAST (NCBI). Determination of Poly(A) Tail Lengths Poly(A) tail length analysis was performed as described previously (MinvielleSebastia et ah, 1991). Total RNA (1 pg) was 3 ’-end labeled in a 30 pi reaction containing 50 mM HEPES pH 8.3, 5 pM ATP, 10 mM MgCl 2 , 3.3 mM DTT, 10% DMSO, 300 pg/ml acetylated BSA, 40 pCi of [^^P]pCp (NEN) and 20 U of T4 RNA ligase (New England Bio-labs, Beverly, MA) for 20 hours at 0°C. Non-poly(A) RNA was digested using 30 pg yeast tRNA, 80 U RNase Tl, 4 pg RNase A, 10 mM Tris-HCl pH 7.5, and 0.3 M NaCl in a final volume of 80 pi at 37 °C for 2 hours. The digestion was stopped by adding 20 pi of 130 mM EDTA pH7.4, 2.5% SDS, and 2 mg/ml proteinase K and incubated at 37°C for 30 minutes. The poly(A) tails were phenol extracted twice, chloroformfisoamyl alcohol extracted once and precipitated using ammonium acetate and 5 pg of RNase-ffee glycogen (Boerhinger Mannheim). Poly(A) tails were fractionated on a 8% denaturing polyacrylamide gel and visualized by autoradiography .

PAGE 46

39 Analysis of poly(A) tail length on specific RNAs was performed using two methods. First, 10-20 pg of total RNA was incubated with a DNA oligo complementary to the 3 ’-end of the ORF. This was incubated with RNase H with and without oligo (dT) in a 25 pi reaction containing 20 mM Tris-HCl, pH 7.5, 10 mM MgCH, 1 mM EOT A, 20 mM NaCl, 2 mM DTT, 60 pg/ml acetylated BSA, 800 ng mRNA specific oligo, 300 ng oligo (dT)i 2 -i 8 , at 37°C for 60 minutes. The digested RNA was fractionated on a 4% denaturing polyacrylamide gel. The urea was removed from the gel by washing in transfer buffer (10 mM Tris-OCH 3 , pH 7.8, 0.5 mM EDTA, 5 mM NaOCH 3 ) two times for 20 minutes. Fractionated RNAs were transferred to a charged nylon membrane using a semi-dry transfer apparatus following the manufacturer’s (Gibco-BRL) instruction. RNA blots were probed using a second DNA oligo complementary to the remaining 3’UTR. Ligation-mediated reverse transcription PCR (LM-RT-PCR) was also used to analyze mRNA specific poly(A) tail lengths. Poly(A)’^ digested with RNase-fi'ee DNase (RQl DNase, Promega) in a 25 pi reaction containing 1/5 volume 5X transcription buffer, 1 pi RQl DNase, 1 pi RNasin (40 U/pl, Promega), and 1 mM DTT. The reaction was incubated at 37°C for 30 minutes followed by two phenol extractions and one chloroform:isoamyl alcohol extraction. The RNA was precipitated using ammonium acetate, and resuspended in DEPC-treated d2H20 at a concentration of 1 pg/pl. The poly(A)’^ RNA was diluted to 1-10 ng in 5 pi of DEPC-treated d2H20 for cDNA synthesis. Poly(A)^ RNA was hybridized to 20 ng of 5’-phosphorylated p(dT)i 2 -ig (Gibco BRL) by incubating at 65°C for 10 minutes and transferring immediately to a 42°C water bath. Ligation was initiated by adding 13 pi of pre-warmed (42°C) reaction

PAGE 47

40 mix (4 fxl 5X Superscript II RT buffer, 2 pi O.I M DTT, 1 pi 40 mM dNTPs, 1 pi 10 mM ATP, 3 pi DEPC-treated d2H20, 1 pi T4 DNA Ligase (>10 U/pl), 1 pi RNasin) and incubating at 42°C for 30 minutes. While the reactions were at 42°C, 1 pi (200 ng) of oligo(dT) anchor [S'-GCGAGCTCCGCGGCCGCGTn] was added, vortexed, pulsed in a microfuge, and incubated at 12°C for 2 hours. Reverse transcription was started by transferring the ligation back to 42°C and adding 1 pi of Superscript II RT (200 U/pl, Gibco BRL) and incubating for 60 minutes. The reaction was stopped by heat inactivation at 65°C for 20 minutes. This was used directly for PCR amplification of the poly(A) tail. Amplifications were performed in a reaction volume of 25 pi (50 mM KCl, 20 mM Tris-HCl, pH 8.4, 1.5 mM MgCb, 0.2 mM each dNTP, 0.5 pM mRNA specific primer, 0.5 pM oligo(dT)-anchor, 1.0 U Taq. Polymerase, 0.5 pi PAT cDNA, 5-10 pCi [a^^P]-dATP and d2H20 to volume). Reaction products were fractionated on 6-8% denaturing polyacrylamide gels and visualized by autoradiography. Isolation of Hyperpolyadenylated RNAs and Construction of a cDNA Library Total RNA was isolated from 1.5 liters (3 x 500 ml cultures) of GAL::NAB2 cells shifted from YPGal to YPD for 16 hours. Cells were harvested by centrifugation at 1,500 X g for 5 minutes at 4°C and washed once with 40 ml of ice-cold d2H20. Cells were pelleted, resuspended in 36 ml of AE buffer (50 mM NaOCHa, pH 5.3, 10 mM EDTA) and aliquoted to four 50 ml conical tubes (9 ml each). To each of these, 1 ml of 10% SDS was added, followed by 15 ml of AE/phenol (68°C). This was vortexed briefly every 30 seconds for 5 minutes, cooled in a dry ice/ethanol bath, and phases separated by centrifugation at 3,000 x g for 5 minutes. The aqueous phase transferred to new tubes.

PAGE 48

41 extracted once more with 1 5 ml of AE/phenoI, and precipitated using sodium acetate and ethanol. Total RNA was collected by centrifugation at 14,000 x g for 15 minutes at 4°C and washed with 70% ethanol. Finally, the RNA was resuspended in 0.5 ml of DEPCtreated d 2 H 20 and extracted twice with phenol, once with chloroformnsoamyl alcohol, and re-precipitated. To isolate hyperpolyadenylated RNAs, total RNA was incubated with 1.0 g of poly(U) Sephadex in 20 ml BB70 buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.5% SDS, 0.5 M LiCl, 70% formamide) at room temperature for 60 minutes. The poly(U) Sephadex was washed 3 times with 10 ml BB70, 3 times with 10 ml BB, and RNAs were eluted with by 10 washes with 4 ml EB (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.05% SDS) for 5 minutes each at room temperature. Two 20 ml fractions were collected and the volume reduced no more than 10-fold using sec-butanol. The eluted RNA was phenol extracted twice and extracted with chloroformnsoamyl alcohol once. Aliquots of 400 |il/microfuge tube were precipitated using sodium acetate and ethanol in the presence of 0.5 pg RNase-free glycogen at -20°C for 16 hours. The RNA was pelleted at 16,000 x g for 60 minutes at 4°C, washed with 70% ethanol and resuspended in 15 pi total volume. The RNA concentration was quantified using a 50 pi cuvette and determining the A 26 oA cDNA library was prepared from this RNA using a kit from Stratagene, and following the manufacturer’s instruction. High Copy Suppression Analysis of a nab2A Strain YRH201C cells grown in YPGal were transformed using polyethylene glycol and lithium acetate with a YEpl3 genomic library (ATCC, Rockville, MD). Transformed

PAGE 49

42 cells were plated onto synthetic dextrose medium lacking uracil and leucine (SD-UraLeu). To determine the transformation effieiency, 1% of the transformation was plated onto synthetie galactose medium lacking uracil and leucine (SGal-Ura-Leu). This proeedure yielded approximately 10® Leu^ transformants, of whieh 37 were able to grow on YPD (Nab2p repressive eonditions). These eolonies were plated to SD-Ura-Leu and screened by whole eell PCR to eliminate library plasmids containing the NAB2 gene. The library plasmid pHSN220 was rescued using GENE Clean (BIO 101, Vista, CA) and the ends of the insert were sequeneed using primers MSS737 and MSS738. The sequence identified a 1 0 kb region that ineluded the PABl open reading frame. To confirm that growth complementation was dependent on the PABl gene, PABl was PCR amplified from L4717 genomic DNA using primers MSS744 and MSS745. This fragment, eontaining only the PABl gene, was cloned into YEpl3 to generate pP AB 1 . YRH20 1 C eells transformed with pPAB 1 were plated to SGal-Ura-Leu. Leu^ transformants were re-plated to SD-Ura-Leu to eonfirm high copy suppression by PABL The pGAL::NAB2 plasmid was also evieted by seleetion on 5-FOA, whieh demonstrated that high eopy PABl was able to compensate for the absenee of Nab2p. Reverse Transcription-Polymerase Chain Reaction Total RNA (12 pg) was DNase treated in a 20 pi reaetion eontaining lx T7 transcription buffer, 2 pi RNase-free DNase (Gibco-BRL), 1 pi RNasin (Promega), 2 pi 10 mM DTT, for 30 minutes at 37°C. The RNA was phenol extracted twice, extraeted with chloroformhsoamyl alcohol once and preeipitated using ammonium aeetate and ethanol. The RNA was resuspended in DEPC-treated d2H20 and 1 pi of 1 pg/pl oligo

PAGE 50

43 d(T) was added prior to incubation at 70°C for 10 minutes, followed by incubation on ice for 2 minutes. Reverse transcription was initiated by addition of 14 pi of RT-mix (4 pi 5x Superscript II buffer, 1 pi RNasin, 2 pi 100 mp DTT, 2 pi 1 OmM dNTPs, 3 pi DEPCtreated d2H20, 2 pi Superscript II reverse transcriptase) and incubated at 42°C for 60 minutes. The cDNA was phenol extracted twice, extracted with chloroformnsoamyl alcohol once, precipitated using sodium acetate and ethanol and resuspended in 10 pi d2H20. Polymerase chain reaction amplification was performed using primers complementary to sequence 5' and 3' of the suspected intron. Amplification products were analyzed by fi’actionation on a 1.2% agarose gel.

PAGE 51

RESULTS Research Objectives The polyadenylate tail has been demonstrated to play a major role in the metabolism of mRNA in the cytoplasm. Metabolism of mRNA is accomplished by interaction of the poly(A) tail with the cytoplasmic poly(A) binding protein Pablp. Pablp stimulates translation by recruiting the 60S ribosomal subunit (Sachs and Davis, 1989). Pablp also stabilizes mRNA by preventing 5 ’-decapping and degradation. Messenger RNA degradation is mediated by activation of a Pablp-dependent deadenylase activity during translation (Boeck et al., 1996; Brown et al., 1996). Nuclear functions of the poly(A) tail are much less clear. The requirement for a poly(A) tail in mRNA export is subject to dispute. Poly(A)‘ mRNAs injected into Xenopus oocytes are exported to the cytoplasm, suggesting that a poly(A) tail is not required (Fischer et al., 1994; Hamm and Mattaj, 1990). In contrast, using COS7 cells, it has been demonstrated that a poly(A) tail is required for export (Huang and Carmichael, 1996). Experimental results also suggest that the process of polyadenylation is required, as a templated 3'terminal poly(A) tract does not facilitate export (Huang and Carmichael, 1996). The presence of a poly(A) tail may also protect nuclear hnRNA from nucleases (Ford and Wilusz, 1 999). The overall goal of my research was to investigate the role of the poly(A) tail in pre-mRNA processing and nucleocytoplasmic mRNA export. This was achieved 44

PAGE 52

45 using yeast genetics to alter the structure of the RNP-RNA complexes that are the substrate for both processing and export. The yeast nuclear polyadenylated RNA-binding protein Nab2p was chosen for investigation due to its predominant nuclear localization, in vivo association with mRNA and high affinity for poly(A) RNA in vitro (Anderson et ah, 1993), compared to other RNA-binding proteins such as Nab4p and Pub Ip that demonstrate little or no poly(A)binding activity. These characteristics of Nab2p make it a potential functional PABP2 homologue. Factors That Interact With Nab2p are Involved in Multiple Aspects of RNA Processing Nab2p binding to the poly(A) tail may allow it to directly interact with the polyadenylation machinery, or possibly recruit other factors that inhibit elongation of the poly(A) tail and/or mediate mRNA export. Two alternative approaches were used to identify proteins that interact with Nab2p in vivo. A yeast two-hybrid screen using Nab2p as bait was performed with both yeast and human prey libraries. The nuclear poly(A) binding protein, PABP2, was identified from the human library, suggesting a role for Nab2p in poly(A) tail length regulation in yeast (Miller, 1998). Also supporting a role for Nab2p in 3 Â’-end formation was the identification of Nab2p in a two-hybrid screen for proteins that interact with Nab4p (Krecic, 1998). Nab4p was identified as CFIB, a component of the 3 Â’-end processing machinery required for selection of cleavage sites (Kessler et al., 1997; Minvielle-Sebastia et al., 1998). However, the proteins that showed the strongest interactions suggest that Nab2p might also be involved in other aspects of RNA processing (Table 2). These proteins have been reported to function in

PAGE 53

46 Table 2, Proteins interacting with Nab2p Human PABP2 hnRNPD Rab/hRIPl CUG-BPl Yeast Pablp Nab2p ^ Nab4p .... Cthlp Gar Ip Kapl04p Gcn3p Gfdlp Npl3p Ssel Human protein Function Source CUG-BPl polyadenylation, splicing (Miller, 1988) hnRNP D mRNA stability (Miller, 1988) PABP2 polyadenylation (Miller, 1988) Rab/hRipl RNA export (Miller, 1988) Yeast protein Cthlp unknown This study Cth2p unknown This study Garlp'^^^ RNA processing This study Gcn3p translational regulation (Uetz et ah, 2000) Gfdlp mRNA export (Uetz et ah, 2000) Kapl04p^^^ hnRNP nuclear import K. Nykamp, impublished Nab4p polyadenylation, cleavage site selection (Krecic, 1998) Npl3p mRNA export, pre-rRNA processing, protein import K. Nykamp, unpublished Pablp translation initiation, mRNA stability K. Nykamp, unpublished Sselp heat shock K. Nykamp, unpublished Genetic interaction Physical interaction

PAGE 54

47 mRNA export as well as mRNA 3'-end formation, nucleocytoplasmic mRNA export, premRNA splicing, and RNA stability. Biochemical isolation of a soluble Nab2p complex also identified factors involved in mRNA export and polyadenylation. A soluble Nab2p complex was isolated using tandem affinity tag chromatography (K. Nykamp, unpublished). Proteins identified in the Nab2p complex include Nab Ip, Pablp, Kapl04p, and Sselp. NAB 1 /NPL3/NOP3/MTR1 3 has been implicated in protein import, poly(A)^ RNA export, and pre-rRNA processing (Flach et ah, 1994; Lee et ah, 1996). Pabpl has been implicated in poly(A) tail length regulation in vitro (Amrani et ah, 1997; MinvielleSebastia et ah, 1997). Kapl04p is the import adapter, or karyopherin 13, which mediates nuclear import of Nab2p (Aitchison et ah, 1996). Sselp is an HspllO family member (Liu et ah, 1999). Interestingly, SSEI is also an extragenic suppressor of the toml-2 allele which is defective in nucleocytoplasmic transport of poly(A)'^ RNA (Duncan et ah, 2000; Utsugi et ah, 1999). These interactions support a role for Nab2p in both 3 Â’-end formation and mRNA nucleocytoplasmic export. However, they do not rule out the possibility that Nab2p is required for other RNA processing events, such as pre-mRNA splicing. Pre-mRNA 3'-End Processing The first question addressed was how poly(A) tail length control is achieved in yeast , in the absence of a PABP2 homologue. Nuclear poly(A) tail length regulation in yeast could occur by several mechanisms (Figure 4). These include: (1) regulation of poly(A) tail synthesis; (2) regulation of deadenylation after poly(A) tail synthesis; (3) competition between poly(A) addition and mRNA export. Regulation at the level of

PAGE 55

C/D • C/D (D -B a C/D Vm o o p: C/D ’'M • C/D p2 (D 3 4=1 4-> &£ U C/D U a (D CA cd g d M C/D •pN d o • ^ 'S cd c 3 g cd (D ^ O CA o Pm a o • ^ ' 4 -* cd i ^ E w

PAGE 56

49

PAGE 57

50 synthesis could utilize a functional PABP2 homologue to alter the structure of the poly(A) tail, or poly(A) polymerase activity may be directly modified. There is some indication that message-specific deadenylation occurs (Brown and Sachs, 1998) but it is unclear if this is a nuclear event. Also, message-specific deadenylation does not directly address control of nuclear tail length since deadenylation occurs after a maximal tail length of 70-90 nucleotides is reached. Competition between poly(A) addition and mRNA export is a possible, but unlikely mechanism. Most of the evidence does not support this mode of regulating poly(A) tail length. Poly(A) tail length does increase approximately 20 nucleotides when mRNA export is inhibited. However, this tail length increase is limited to 15-20 nucleotides and is believed to be due to the loss of cytoplasmic poly(A) trimming activity. As described below, regulation of poly(A) addition appears to be the predominant mechanism regulating tail length control in the nucleus. Polyadenylation of mRNA is Regulated by Nuclear Poly(A) Tail Binding Proteins In metazoans, length of the poly(A) tail in the nucleus is regulated by the poly(A) binding protein PABP2. PABP2 is believed to inhibit the poly(A) poljonerase by altering the poly(A) tail structure once the poly(A) tail reaches 200 to 250 nucleotides (Bienroth et al., 1993). In contrast, the mechanism for controlling nuclear polyadenylation in yeast is not yet clear. Although the cytoplasmic poly(A) binding protein Pablp has been implicated in this process in vitro, Pablp effects on tail length in vivo are much less dramatic, suggesting the presence of a complementing factor in vivo. Since a structural homologue of PABP2 does not exist in S. cerevisiae, poly(A) tail length control must occur using another factor and/or by a different mechanism. The yeast heterogeneous

PAGE 58

51 nuclear ribonucleoprotein, Nab2p, was previously identified as a nuclear poly(A)^ RNA binding protein capable of binding poly(A) RNA in vitro (Anderson et al., 1993). To determine if Nab2p was a nuclear poly(A) tail binding protein, cells were metabolically labeled using [^^SJmethionine and subject to UV cross-linking to covalently link labeled proteins to nucleic acid. Poly(A)^ RNA was isolated using oligo(dT) cellulose and digested with RNases A and Tl, leaving only poly(A) tracts. The poly(A) tails and associated proteins were re-isolated using oligo(dT) cellulose. The remaining labeled proteins were precipitated with TCA(trichloroacetic acid) after digesting the poly(A) RNA with nucleases. Nab2p and Pablp were immunoprecipitated from the pool of proteins, fractionated by SDS-PAGE(polyacrylamide gel electrophoresis), and visualized by fluorography. Nab2p levels associated with the poly(A) tail were approximately 5% of Pablp levels (Figure 5). This level is in agreement with the nuelear/cytoplasmic poly(A)Â’^ RNA distribution; approximately 90% of the poly(A)Â’^ RNA in a yeast cell is c}doplasmic (Groner and Phillips, 1975). Based on this, the amoxmt of Nab2p crosslinked was expected to be approximately 10% of Pablp. Since Nab2p is predominately nuclear, these results suggested that Nab2p is intimately associated with poly(A) tails in the nucleus. To determine if Nab2p was required for regulation of poly(A) tail length in yeast, conditional lethal nab2 alleles were analyzed. Nab2p was depleted in vivo using a derepressible/repressible GAL: :NAB2 allele. The GAL: :NAB2 allele was generated by placing the NAB2 gene under control of the GALl promoter. This was done in a haploid strain carrying a NAB2 chromosomal deletion. Cells survive on galactose containing media due to NAB 2 expression from the GAL1::NAB2 plasmid. When eells were shifted

PAGE 59

Figure 5. Nab2p is intimately associated with the poly(A) tail in vivo. Cellular protein was metabolieally labeled using [^^S]methionine and labeled proteins were eovalently linked to nucleic acid by UV irradiation. Poly(A) RNA-protein complexes were isolated by oligo(dT)-cellulose chromatography. Non-poly(A) RNA was digested with RNase A and Tl. The remaining poly(A) RNA, and covalently attached protein, was re-isolated using oligo(dT)-cellulose, and poly(A) RNA was digested with micrococcal nuclease. Nab2p and Pablp were immunoprecipitated using monoclonal antibodies 3F2 and IGl. Immunoprecipitated proteins were analyzed by SDS-PAGE and fluorography.

PAGE 60

53 \

PAGE 61

54 to glucose containing media, NAB2 expression was repressed and Nab2p levels decreased as the endogenous protein degraded (Figure 6B). Cells stopped growing because Nab2p is an essential protein (Figure 6A). Poly(A) tail length was monitored during Nab2p depletion by 3 ’-end labeling total RNA isolated at various times after shift to glucose. The labeled RNA was digested with RNases A and T1 to leave poly(A) tracts intact. Poly(A) tails were fractionated on an 8% polyacrylamide/urea gel and visualized by autoradiography. Loss of Nab2p correlated with increasing poly(A) tail length, implying that Nab2p was required regulation of nuclear poly(A) tail length (Figure 6C). Another conditional lethal nab2 allele was isolated by PCR mutagenesis (Anderson, 1995). The nab2-21 allele contains a deletion of seventh C3H motif and a partial deletion of the sixth C3H motif at the carboxy-terminal end (Figure 7A). This allele is cold sensitive at 14°C (Figure 7B). Analysis of poly(A) tail length in nab2-21 cells showed hyperpolyadenylation at both permissive and non-permissive temperatures (Figure 7C). The seven zinc finger-like C3H motifs in Nab2p were previously shown to be required for the in vitro poly(A) binding activity of Nab2p (Anderson et ah, 1993). Although there was no change in tail length during shift to the non-permissive temperature, the poly(A) tail defect in nab2-21 implies that Nab2p binding to the poly(A) tail in vivo is required for regulating poly(A) tail length. The constitutive poly(A) tail length defect also demonstrated that loss of regulation of poly(A) tail length is not lethal, suggesting that defects in polyadenylation may impact negatively on other RNA processing events. Alternatively, Nab2p could be required for two, independent, RNA processing events.

PAGE 62

Figure 6. Nab2p is required for regulation of poly(A) tail length in vivo. (A) Growth curve of NAB2 vs. GAL::NAB2 cells following shift into glucose containing media. (B) Immunoblot analysis of Nab2p in GAL: :NAB2 cells after shift into glucose. Nab2p was detected using the anti-Nab2p monoclonal antibody 3F2. The 60S ribosomal subunit protein, Pub2p, was included as a control for the amount of protein loaded per lane. Pub2p was detected using the monoclonal antibody 2B1. (C) Total RNA from NAB2 and GAL::NAB2 cells was isolated at various times after shift to glucose, 3 Â’-end labeled with [^^P]pCp, and digested with RNases A and Tl. The remaining poly(A) tails were resolved by polyacrylamide/urea gel electrophoresis. Indicated size markers are MspI fragments from pBR322.

PAGE 63

56 B GAL::NAB2 0 2 4 6 8 12 16 24 hr

PAGE 64

Figure 7. The conditional lethal nab2-21 allele affects poly(A) tail length in vivo. (A) Structural motifs of Nab2p and Nab2-21p are shown. Nab2-21p contains a deletion of the seventh and part of the sixth C 3 H motifs. (B) NAB2 and nab2-21 cells were spotted in a series of 10 fold dilutions and incubated at either the permissive or non-permissive temperature for 3 or 9 days respectively. (C) Bulk poly(A) tail length analysis of NAB 2 and nab2-21 eells grown at both permissive and non-permissive temperatures indieates a constitutive defeet in regulation of poly(A) tail length. Markers correspond to MspI cut pBR322 fragments.

PAGE 65

58 Nab2p Nab2-21p Q3P rgg C3H a V'* V'* mm m m aaaaa aaaaa aaaaa [ > • ^ • "Si • N V’* V** V*« <• i/** i/** , mm H H Hia 100 200 300 400 500 aa B NAB2 nab2-21 14“C 30°C 37°C

PAGE 66

59 All mRNA Polyadenylate Tails are not Regulated by Nab2p Analysis of polyadenylate tail length performed by 3 Â’-end labeling depicts only the distribution of poly(A) tail lengths in the cell and does not allow identification of the hyperpolyadenylated RNA. Since polyadenylation has been shown to occur on snRNAs, snoRNAs, and the RNA component of the telomerase enzyme, it was important to identify the hyperpolyadenylated RNA (Abou Elela and Ares, 1998; Chapon et al., 1997; van Hoof et al., 2000). To determine if mRNA was the affected RNA species, poly(A) tail lengths for several different mRNAs were analyzed. In the presence of RNase H, mRNA-specific DNA oligonucleotides were incubated with total RNA from wild type or nab2 mutant strains. This cleaves the RNA close to the 3 Â’-end allowing better resolution of the poly(A) tail. Reactions were also carried out with or without oligo (dT), to remove the poly(A) tail. The remaining RNA fragments were fractionated on a denaturing polyacrylamide gel and transferred to a charged nylon membrane. RNA blots were probed using 5 Â’-end labeled oligonucleotides complementary to the remaining 3Â’-UTR. This method was used to analyze poly(A) tail length for CYH2, RPS23, TPIl, and PGKl from various nab2 strains. For each case, poly(A) tail length analysis failed to detect specific mRNAs that were hyperpolyadenylated. Surprisingly, poly(A) tails for some mRNAs tested actually grew shorter with loss of Nab2p function (Figure 8). This shortening of poly(A) tails suggested two possibilities. First, deregulation of poly(A) tail length in nab2 mutants does not affect mRNAs. Second, not all mRNAs are regulated in the same manner. Thus, Nab2p may be required for regulating tail length of a subclass of mRNA. To determine between the two possibilities, two alternative approaches were

PAGE 67

Figure 8. Analysis mRNA specific poly(A) tail length does not reproduce the hyperpolyadenylation defect seen by bulk poly(A) tail analysis. Total RNA isolated from NAB2 and GAL::NAB2 cells at various times after shift to glucose containing media was incubated with a DNA oligo specific to the 3 Â’-end of the mRNA. RNase H was used to digest the RNA in the DNArRNA hybrid. In a separate control reaction, oligo(dT) was included to remove the poly(A) tail. The RNA was fractionated on a denaturing polyacrylamide gel and transferred to a charged nylon membrane. A 5 Â’-end labeled oligo, specific to the remaining 3Â’-UTR, was used to probe the blot. (A) Oligo-directed RNase H cleavage poly(A) tail analysis of CYH2 during Nab2p loss. (B) Poly(A) tail analysis of RPS23A during Nab2p loss. Two separate distributions of poly(A)^ RPS23A RNA are a result of two major 3 Â’-end cleavage sites utilized during 3 Â’-end formation. Results for TPIl and PGKl also showed no signs of hyperpolyadenylation (data not shown).

PAGE 68

61 A I NAB2 oligo dT + 0 0 8 CYH2 1 GAL::NAB2 + ____ 0 0 2 4 8 h YPD NAB2 oligo dT + 0 0 8 RPS23A 1 GAL::NAB2 0 0 2 4 8 h YPD

PAGE 69

62 used. First, multiple non-mRNA RNA polymerase II transcripts were analyzed for changes in polyadenylation status during loss of Nab2p function. Second, a screen was employed to identify RNAs affected in nab2 alleles. Small nucleolar RNAs were examined by RNA blot analysis for changes in transcript size, indicative of poly(A) addition. Multiple snoRNAs from different classes, as well as U2 snRNA and the RNA component of telomerase (TLCl), were analyzed (Table 3). Monocistronic and polycistronic snoRNAs were analyzed during Nab2p depletion. Monocistronic snoRNAs (snR9, snRlO, snRll, snR13) showed no difference compared to NAB 2 cells (Figure 9A). Polycistronic snoRNAs (snRSl and snR72) increased in abundance, but not in transcript length (Figure 9B). The intron residing snoRNA, snR39, showed increases in size, indicative of a potential processing defect during Nab2p depletion (Figure 9C). Defects in snR39 and U18 snoRNA maturation were also present in nab2 mutants (Figure 9D). However, none of the non-mRNA transcripts assayed showed signs of polyadenylation. Hyperpolyadenylated RNAs were identified by screening of a cDNA library created from Nab2p depleted cells. Long poly(A)Â’^ tailed RNAs were selected on poly(U) Sephadex in the presence of 70% formamide to destabilize RNAs with short poly(A) stretches, either internal or 3'-terminal. This procedure yielded a pool of poly(A)'^ RNA with tails ranging from 60 to >600 nucleotides (Figure 10). A cDNA library was constructed using this RNA pool, and approximately 100 open reading frames were identified (Table 4). Most of the open reading frames represented known mRNAs. A small percentage of clones isolated did not correspond to regions with known open reading frames and may represent unknown polyadenylated non-protein coding RNAs in

PAGE 70

Table 3. A large fraction of RNAs transcribed by RNA polymerase II are not mRNAs. Non-mRNA, RNA polymerase II transcripts are listed. Note, bolded transcripts have been analyzed for increased transcript length, indicative of a poly(A) tail. None of the transcripts tested were determined to be hyperpolyadenylated during Nab2p depletion. DBRl is the de-branching enzyme required for de-branching the intron-lariat produced during pre-mRNA splicing. RNTJ is an endonuclease required for processing numerous RNAs, including snoRNAs. TMG stands for tri-methyl guanosine.

PAGE 71

64 TABLE 3 . Non-mRNA RNA POLII Transcripts snoRNA -monocistronic (DBRl independent) -RNTl independent -TMG capped -H/ACA 3, 5, 8, 9, 10, 11, 30, 31-35, 37, 42, 46, 49, 189 -C/D U3a, U3b, 4, 13, 39b, 45, 50, 52, 56, 58, 60 62-66, 68, 69,71,79 -RNTl dependent -TMG minus -H/ACA 36, 43 (DBRl independent ?) -C/D 40, 47, 48 (RNTl dependent ?) -polycistronic (DBRl independent) -RNTl dependent -TMG minus -H/ACA -C/D -intronic (DBRl dependent) -RNTl independent -TMG minus -H/ACA -C/D snRNAs -U1,U2,U4, U5 TMG capped polyadenylation status unknown *U2 is extended and polyadenylated in Arnti strains none known U14, 41, 51, 53, 55, 57, 61, 67, 70, 72-78, 190 44 U18, U24, 38, 39, 54, 59 Others -TLCl -RNA component (template) for telomerase -TMG capped -box H/ACA like element at 3 Â’ end of hTR -poly(A)+ and poly(A)fractions -MRP -RNA component of the RNase MRP

PAGE 72

Figure 9. non-mRNAs are not polyadenylated in conditional lethal nab2 alleles. Total RNA was isolated from NAB2 and GAL::NAB2 cells at various times after shift to glucose and RNA blot analysis performed. (A) Monocistronic snoRNAs snR9, snRlO, snRll, and snR13. (B) Polycistronic snoRNAs snRSl and snR72. (C) Intronic snoRNAs snR39 and U18. (D) RNA blot analysis of snR39 and U18 intronic snoRNAs using total RNA isolated from various nab2 alleles. Note that none of the snoRNAs tested showed size increases indicative hyperpolyadenylation.

PAGE 73

66 A B I — NAB2—i rGAL::NAB2-i 0 2 4 0 2 4 hr rNAB2n gal glu GAL::NAB2 0 4 8 16 24 36 * •• -»nR9 **» -snRIO ^ ^ ^Hl
PAGE 74

Figure 10. Hyperpolyadenylated RNAs were identified by screening a cDNA library from Nab2p depleted cells. Poly(A) tail analysis of hyperpolyadenylated RNA. The total lane is poly(A)^ RNA isolated from GAL::NAB2 cells after Nab2p depletion. The poly(U) lane is poly(A)^ RNA similar to the total lane, but subject to isolation on poly(U)-Sephadex. A cDNA library was prepared using the poly(U) selected RNA and approximately 100 cDNA clones were analyzed by DNA sequencing. These clones encoded a variety of mRNAs but not other RNAs (U2 snRNA, snoRNAs, etc.) known to be polyadenylated under some conditions. A full listing of the cDNAs sequenced is located in Table 3.

PAGE 75

68

PAGE 76

TABLE 4 Gene name cDNAs isolated from Nab2p depleted cells Description of gene product 69 Amino acid metabolism AR04 GNPl MET 17 THR4 URA3 YFR055W 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase isoenzyme high affinity glutamine permease O-acetylhomoserine-O-acetylserine sulfhydralase threonine synthase orotodine-5' phosphate decarboxylase hypothetical ORF ; induced by MMS Cell wall / multi-drug resistance CHSl CWH41 FKSl MNN9 chitin synthase 1 ; cell wall maintenance glucosidase I; cell wall maintenance 1,3-beta-D-glucan synthase; cell wall maintenance may be the alpha1 ,6-mannose elongation enzyme; mutants are osmosensitive NCE102 PDR13 PMAl SCW4 SLT2 YCL068C YJR124C YKR104W protein translocation pleiotropic drug resistance (PDR); HSP70 family; cell stress plasma membrane proton ATPase soluble cell wall protein; cell wall maintenance suppressor of lyt2; cell stress; cell wall maintenance hypothetical ORF; 99% identity to BudSp over the first 190 aa hypothetical ORF ; Member of the multidrug-resistance family hypothetical ORF; Member of the ATP -binding cassette (ABC) superfamily Nuclear-cytoplasmic transport MTR2 NUP192 mRNA transport regulator Nuclear Pore protein of 1 92 kDa Mitochondrial functions ATP 2 SDH3 F(l)-F(0)-ATPase complex, beta subunit succinate dehydrogenase cytochrome b subunit Proteolysis HUL4 UBC13 APE3 ubiquitin ligase (E3); protein degradation ubiquitin conjugating enzyme; induced by MMS aminopeptidase yscIII Protein translation apparatus TEF2 X 2 TIFll X 2 translation initiation factor EF-1 translation initiation factor EF-1 A

PAGE 77

70 TABLE 4--continued Gene name Description of gene product Ribosomal RPLIB ribosomal protein L 1 B RPL8A ribosomal protein L8A RPLIJA ribosomal protein LI lA RPL14A ribosomal protein L14A; intron containing RPL15 ribosomal protein L 1 5 RPL20A ribosomal protein L20A RPL22B ribosomal protein L22B; intron containing RPL29 X 2 ribosomal protein L29 RPL30A ribosomal protein L30A; intron containing RPL32 ribosomal protein L32; intron containing RPL34A ribosomal protein L34A RPL38 ribosomal protein L38 RPL41A X 2 ribosomal protein L41A RPS2 ribosomal protein S2 RPS4A ribosomal protein S4A; intron containing RPS7A X 2 ribosomal protein S7A; intron containing RPSllA ribosomal protein SI lA; intron containing RPS13 ribosomal protein SI 3; intron containing RPS20 ribosomal protein S20 RPS23B X 2 ribosomal protein S23B; intron containing RPS25A ribosomal protein S25A RPS26B ribosomal protein S26B RNA proeessing SOFl small nuclear ribonucleoprotein involved in rRNA processing SESl serine-tRNA ligase YDL209C hypothetical ORF; RNA splicing ? Stress response proteins CUPl X 2 copper binding metallothionein; cell stress DDR2 DNA damage response HOR7x2 hyperosmolarity response SEDl X 2 cell surface glycoprotein, A1 and oxidative stresses STIl suppressor of lyt2, S/T kinase, cell wall defects, osmosensitive YHBl X 2 flavohemoglobin, may play a role against oxidative stress Carbohydrate metabolism EN02 enolase 2; 2-phosphogly cerate dehydratase TP 11 X 2 triosephosphate isomerase CIT2 citrate synthase; energy generation

PAGE 78

71 TABLE 4--continued Gene name Description of gene product Transcription ANCl transcription initiation factor TFIIF small subunit GCN4 transcriptional activator of amino acid biosynthetic genes GCR3 transcriptional activator of glycolytic genes HTAl histone H2A; cell stress Vesicular transport BETS TRAPP 1 8kDa component CLCl clathrin light chain SECS subunit of the Exocyst complex No classified ORF Intergenic (2) Unknown / miscellaneous SRP14 Signal recognition particle subunit, protein translocation STE2 alpha-factor pheromone receptor YAR027W hypothetical ORF YCL033C hypothetical ORF ; putative transcription regulator YDL072C hypothetical ORF YDL114W hypothetical ORF YDRIOIC hypothetical ORF YDR8419.12 YFR039C hypothetical ORF YGLIOIW hypothetical ORF YGLllOC hypothetical ORF YLR257W hypothetical ORF YKR051W hypothetical ORF YM9827.03C YNL119W hypothetical ORF; possibly involved in cytoplasmic ribosome function YOR205C hypothetical ORF YOR252W hypothetical ORF YPLllOC hypothetical ORF

PAGE 79

72 S. cerevisiae. Nab2p-dependent hyperpolyadenylation of RNAs identified in this sereen was eonfirmed using ligation-mediated RT-PCR. Tail length analysis demonstrated that not all RNAs respond to loss of Nab2p to the same order of magnitude (Figure 11). One elass of RNA shows tail length increases of up to 80 nucleotides, similar to what is seen by bulk tail labeling (SEDl, DDR2). Another class undergoes modest tail length increases up to 20 nucleotides (PGKl, TPIl, CYH2). CYCl was tested as a control RNA not identified in the screen. CYCl is also an RNA that is typically used for in vitro 3'-end formation assays. Interestingly, CYCl tail length was not affected by loss of Nab2p in vivo. These results suggest that Nab2p function is mRNA subclass specific. The mRNAs which demonstrated the largest change in poly(A) tail length during loss of Nab2p function corresponded to stress response genes, specifically, stress response genes that are induced in a non-HSE (heat-shock element) dependent manner. The stress response genes identified in the cDNA library are induced under osmotic and oxidative stress conditions. To determine if Nab2p was required during specific stresses, the conditional lethal nab 2 -21 allele was tested for increased sensitivity to various stress conditions by spotting serial dilutions of cells to plates containing the stress agent. Cold sensitive nab2-21 cells displayed an increased sensitivity to NaCl and H 2 O 2 , but not other agents (Figure 12). This result was consistent with the 3'-end processing defect of the stress response mRNAs identified in the cDNA library (Figure 11). Nab2p Regulates Poly(A) Tail Length in vitro The effect of a nab2 mutation on in vivo poly(A) tail length was similar to that demonstrated for Pablp in vitro (Amrani et al., 1997; Minvielle-Sebastia et al., 1997). To determine if Nab2p was essential for 3 Â’-end processing, in vitro polyadenylation

PAGE 80

cd O)
PAGE 81

CYC1 PGK1 DDR2 SED1 TP 11 74

PAGE 82

c/3 C O cd (U 00 c/3 ^ c/3 cd c/3 u ^ ^ . t2 fS ^ O U B ^ (N T3 CQ cd ^ CD ? 2 .S ^ £ .PN a »-H cd -4-* a o o c/3 c/3 -d H g 2 -C3 3 Q W) « 4-1 ^ o

PAGE 83

76 nab2-21

PAGE 84

77 assays were performed. Substrates used included both CYCl and SEDl, which were differentially affected in vivo during Nab2p loss. Interestingly, loss of, or mutations in Nab2p had no affect on the poly(A) tail length of either substrate (Figure 13). Since a whole cell extract is used in this assay, one possible explanation for not reproducing the polyadenylation defect in vitro is that a cytoplasmic factor may compensate for loss of Nab2p (Butler and Platt, 1988). It is also possible that Nab2p activity is lost during preparation of the extract. To determine if the abundant cytoplasmic poly(A) binding protein Pablp was this compensating factor, Nab2p was added back to in vitro reactions using an extract devoid of Pablp. Due to the lack of Pablp, this extract normally produces long poly(A) tails in vitro (Minvielle-Sebastia et ah, 1997). Multiple unsuccessful attempts were made at generating recombinant Nab2p in E. coli. Due to severe degradation and contamination with nucleases, full length Nab2p could not be purified in this manner. To obtain full-length protein, Nab2p was isolated from yeast cells by tandem affinity chromatography (Rigaut et ah, 1999). Nab2p purification was performed by Keith Nykamp. A calmodulin binding peptide (CBP)Zprotein A fusion to the carboxy terminal end of Nab2p was generated in L4717 cells. A Tobacco Etch Virus (TEV) protease site is included between CBP and protein A, which allowed two successive rounds of purification. First the Nab2p fusion was bound to IgG Sepharose via protein A. Nab2p-CBP was eluted by cleavage using TEV protease. The Nab2pCBP fusion is re-purified on calmodulin affinity resin and eluted with EGTA. Purified Nab2p was added back to in vitro polyadenylation assays using a Pablp deficient extract (YAS394). Recombinant Pabpl was included in a separate reaction for comparison and added rPablp was capable of inhibiting polyadenylation (Figure 14A). Poly(A) tail

PAGE 85

(D 4 -» (D cd o 9, 2 C8 u Ji C 3 C/D • »— • o " -a r' JTJ cd pD Jh ''' « .s
PAGE 86

CYC1 SED1

PAGE 87

a cd O o (D O cd u '4-> X c cd (DO G ' »-H C/) c /3 a o • ^ o cd (D ;-( a o fji QJ U O 'M V 3 Vn •s a fS pQ Cd o C •pN a o • pN *pN T3 T3 o 2m :3 &£ a . C (D Td cd "o Dh (D 6 a u ^ .5 ’Tj O c/3 C Cd Cd 4 -» Vh «+-( o 5 P o Ch o "O Qh ’T3 (D cd CIh 1 ? PU (D 'O Qh < •c -5 ^ P cd cd JH p c/3 X Cd 2 : ^ (73 PQ '5 ^ a T3 (D fc o o c o o cd (D Vh a o c/3 (D ^-» ^T) r-H <2 '4— » o cd Vx H-* X (D -C3 Q cd c/i C 4 :: ^ « !2 C ,0 Cd 5:3 'P (D Td T3 cd (D Ph CN -§ T3
PAGE 88

81 0 ) O) 0 + CL O * <

PAGE 89

82 length was also reduced in the presence of purified Nab2p and the degree of shortening correlated with the amount of Nab2p added to the reaction (Figure 14B). This result is consistent with in vivo tail length defects seen in nab2 alleles and suggests that Nab2p is required for regulation of nuclear poly(A) tail length. It also implies that Pablp-mediated regulation of poly(A) tail length in vitro may be an artifact of the preparation of wholecell extract. Nucleocytoplasmic mRNA Export is Inhibited in nab2 Mutant Strains Defects in mRNA export in yeast have been linked to poly(A) tail length increases of 20 nucleotides (Piper and Aamand, 1989). Upon mRNA export, poly(A) tails are trimmed by 20 nucleotides as a result of Pablp binding to the poly(A) tail and recruiting the poly(A) nuclease, PAN (Boeck et al., 1996; Brown et al., 1996). Poly(A) tail length increases during the loss of Nab2p are more dramatic, with poly(A) tails reaching lengths of greater than 200 nucleotides. To determine if the polyadenylation defect in yeast was coupled to a defect in mRNA export, poly(A)^ RNA localization was assayed using two conditional lethal nab2 alleles. The poly(A)^ RNA distribution was determined by fluorescent in situ hybridization with digoxigenin-labeled oligo (dT)so. Cells depleted for Nab2p as well as nab2-21 cells were analyzed. To deplete Nab2p, GAL::NAB2 cells were shifted to glucose for 0-8 hours. As early as 2 hours after shift to glucose, poly(A)^ RNA started to accumulate in the nuclei of cells (Figure 15 A). Nuclear poly(A)'^ RNA accumulation was evident in greater than 90% of the cells at 8 hours. Upon closer inspection, it was shown that poly(A)Â’^ RNA was accumulating in foci with in the nucleus (Figure 15B). These foci were typically at the edge of the nucleus, in a

PAGE 90

Figure 15. Nab2p depletion leads to nuclear/nucleolar accumulation of poly(A)^ RNA. NAB2 were grown in glucose or galactose media. GAL::NAB2 cells were grown in galactose and shifted to glucose containing media for the specified amount of time and the poly(A)Â’^ RNA distribution was analyzed. (A) Fluorescent in situ hybridization (FISH) of poly(A)Â’^ RNA distribution using digoxigenin-(dX) 5 o and FITC-conjugated anti-dig secondary mAh. DNA was detected with DAPI. (B) FISH localization of poly(A)Â’^ RNA using deconvolution microscopy. Distribution of poly(A)^ RNA (green) is shown for GAL::NAB2 cells shifted to glucose for 2h. The nucleolus is adjacent to the bulk chromosomal DNA staining (blue). Nucleoli were localized using anti-Noplp mAbs (data not shown). Three nucleolar distributions are displayed (left panel, overall nucleolar; middle panel, two intra-nucleolar foci; right panel, a single focus at the nucleolar periphery). Bar, 2 pm.

PAGE 91

84 NAB2 galactose NAB2 glucose GAL::NAB2 galactose GAL::NAB2 glucose 2h GAL::NAB2 glucose 8h poly(A)+RNA DNA

PAGE 92

85 region characteristic of the nucleolus. To determine if the poly(A)'^ RNA was nucleolar, the foci were co-localized using a monoclonal antibody against Nop Ip, a nucleolar protein (data not shown). It was determined that poly(A)^ RNA was accumulating in nucleoli during Nab2p depletion. The cold sensitive nab2-21 allele also demonstrated inducible nuclear accumulation of poly(A)'" RNA. The poly(A)^ RNA distribution in nab2-21 cells at the permissive temperature was normal (Figure 16A). However, when cells were shifted to the non-permissive temperature of 14°C, poly(A)^ RNA started to accumulate in nuclei. As with Nab2p depletion, poly(A)^ RNA accumulated in the nucleolus. Focal accumulation of poly(A)^ RNA, in comparison to the nucleolar protein Nop Ip is shown (Figure 16B). Results from both conditional lethal nab2 alleles analyzed suggest that Nab2p is required for mRNA export. Nucleolar accumulation of poly(A)^ RNA in nab2 alleles implied the possibility that nucleolar RNAs were polyadenylated. Evidence exists demonstrating polyadenylation of non-mRNAs, however, nucleolar RNAs analyzed during loss of Nab2p function failed to identify any polyadenylation (see Figure 9). Also, identification of hyperpolyadenylated RNAs in the cDNA screen did not reveal any non-mRNAs know to be polyadenylated (see Table 4). This strongly suggests that the focal accumulation of poly(A)^ RNA observed in nab2 cells results from nucleolar accumulation of hyperpolyadenylated mRNAs. Messenger RNA 3 ’-End Formation and Nucleocytoplasmic Export can be Uncoupled in Yeast Cleavage factors have been shown to associate with the caboxy-terminal domain of RNA polymerase II, enhancing 3 ’-end cleavage and transcription termination

PAGE 93

Figure 16. Poly(A)^ RNA accumulates in the nucleolus at the non-permissive temperature in nab2-21 cells. nab2-21 cells were grown at a permissive temperature of 30°C and shifted to the non-permissive temperature, 14°C for 2 hours. (A) The poly(A)^ RNA distribution was determined by fluorescent in situ hybridization using digoxigenin(dT) 5 o and anti-dig secondary mAb. DNA was visualized using DAPI. (B) The nucleolus was loealized using a Nop Ip speeifie mAb (right panel). Nueleolar poly(A)^ RNA is shown for comparison (left panel).

PAGE 94

87 nab2-21 30°C 1 4°C/2h poly(A)+ RNA DAPI nab2-21 poly(A)‘‘'RNA Nop1 p 14°C/2h

PAGE 95

88 (Birse et al., 1998). Correct 3 Â’-end formation has also been demonstrated as a requirement for mRNA export in yeast (Long et al., 1995). However, it was not know if accurate regulation of poly(A) tail length was a pre-requisite for mRNA export. To try to uncouple the two phenotypes genetically, a high copy suppressor screen of a NAB2 deletion was performed. Conditional lethal GAL:: NAB 2 cells were transformed with a YEpl3 genomic library, generating approximately 10^ Leu^ transformants. Transformed cells were plated to glucose containing media to deplete Nab2p (Figure 17). Cells that survived could potentially have received a genomic NAB2 fragment. The NAB2 gene from the plasmid library was slightly larger than NAB2 from the GAL::NAB2 strain. The size difference is due to an expansion at the 5Â’ end of the gene, which results in seven additional Q 3 P repeats in the protein. This allowed identification of cells containing a NAB2 gene from the plasmid library. This eliminated all but one library plasmid. Sequence analysis identified a ten kilobase insert containing the full length PABl gene, as well as a truncation of the 5Â’ gene and the entire downstream gene of unknown function (Figure 18A). To confirm that high copy Pah Ip expression was responsible for suppression, the PABl gene was PCR amplified from genomic DNA and cloned into YEpl3 to generate the plasmid, pPABl. This plasmid was transformed into fresh GAL::NAB2 cells and plated to glucose media. The number of cells capable of growing on glucose was approximately the same as the transformation efficiency, while cells transformed with YEpl3 alone were unable to grow (Figure 18B). This suggested that the pPABl plasmid suppressed a NAB 2 deletion. The level of Pablp was determined by immunoblot analysis. Pablp levels were moderately elevated (Figure 18C). Interestingly, a smaller

PAGE 96

Figure 17. Schematic representation of high-copy suppression of nab2A. Haploid cells (YRH201C) containing a chromosomal NAB 2 deletion and the pGAL::NAB2 plasmid were grown on galactose containing media to express Nab2p. Cells were transformed with the YEpl3 genomic library and plated to glueose eontaining media to repress Nab2p expression from the pGAL::NAB2 plasmid. This generated approximately 10^ treinsformants. Transformants that could grow in the presence of glucose were screened to eliminate cells that received a genomic NAB2 fragment from the library. Isolated library plasmids that did not contain NAB2 were sequenced to identify the genes contained within the plasmid insert.

PAGE 97

90 YEpl3 Genomic Library Transform cells T Galactose 1 0” transformants Glucose Screen transformants to eliminate genomic NAB2 containing isolates Sequence to identify the insert

PAGE 98

Figure 18. The PABl gene high copy suppresses a nab2 deletion. GAL: :NAB2 cells grown in YPGal were transformed with a YEpl3 genomic library. From approximately 10^ Leu"^ transformants, 37 were able to grow under Nab2p repressive conditions. Cells were screened by PCR to eliminate library plasmids containing the NAB2 gene. (A) One cell, nab2A. pHCS220, did not to contain the NAB2 gene. Sequence analysis identified a fragment containing the PABl gene. To confirm high copy suppression was dependent on PABl, the PABl gene was cloned into YEpl3 to generate pPABl. Growth of nab2A pPABl, and immunoblot analysis, on glucose confirmed that elevated Pablp levels were responsible for suppression by pHCS220. (B) Growth of various wild type NAB2 and nab2A strains carrying pHCS220 or pPABl. (C) Immunoblot analysis of Pablp expression. Pablp* is a 50 kDa fragment of Pablp.

PAGE 99

92 CHD1 PAB1 YER166W B Galactose nab2A pGAL::NAB2 nab2A PHCS220 NAB2 nab2A pPAB1 NAB2 nab2A pPAB1 nab2A pGAL::NAB2 nab2A pHCS220 68 ^ K O' 0 “ s f'' ...•A ^ v\ iiPiii -Nab2p -Pab1p -Pab1p* -Pub2p Glucose

PAGE 100

93 Pablp* product was abundant in these cells. This form was approximately 50 kDa, similar to the reported nuelear Pablp (Saehs et ah, 1986). To determine which process Nab2p is required for, the poly(A)^ RNA tail length distribution and subcellular localization were assayed in the nablA pPABl cell (YRH204). Although Pablp has been reported essential for regulation of tail length in vitro (Amrani et ah, 1997; Minvielle-Sebastia et ah, 1997), poly(A) tail length showed only a modest length (Figure 19 A). This decrease was representative of the 20 nt cytoplasmie tail shortening by poly(A) nuelease (PAN) activities and might be expeeted if the export defect was resolved, but not the tail length defeet. In situ hybridization with oligo (dT) 5 o revealed that the export defeet was completely resolved by high-level expression of Pablp (Figure 19B). This suggested two things, (i) Although Nab2p levels affeet regulation of poly(A) tail length in vivo, regulation of poly(A) tail length is not essential, (ii) Nab2p is required for export of poly(A)Â’^ RNA. How Pablp suppresses the export defeet is yet to be determined but may imply a role for Pablp in mRNA export. High level Pablp suppression was most likely bypassing the requirement for Nab2p. To confirm that Pablp was a bypass suppressor of Nab2p, the pGAL;;NAB2 plasmid was evieted from suppressor eells using 5-FOA toxieity to seleet against cell that carried the plasmid. This ensured that Pablp was suppressing the complete loss of Nab2p and not low-level Nab2p expression. High-level Pablp expression also suppressed the cold sensitive phenotype of nab2-21 cells, demonstrating that suppression was not allele-speeific, another charaeteristic of bypass suppression (data not shown). Pablp was also identified as a speeific eomponent of a Nab2p complex (unpublished results K. Nykamp et ah), possibly explaining the high eopy suppression

PAGE 101

Figure 19. High copy PABl fully suppresses the poly(A)^ RNA export defect but not the hyperpolyadenylation defect. (A) Bulk poly(A) tail length was analyzed in both nablA pHCS220 and nablA pPABl cells compare to GAL::NAB2 cells under Nab2p repressive and de-repressive conditions. Both the library plasmid and pPABl reduce poly(A) tail length approximately 20 nucleotides. (B) Poly(A)Â’^ RNA was localized by fluorescent in situ hybridization with digoxigenin-(dT) 5 o. High copy PABl was able to completely resolve the poly(A)^ RNA export defect in nab2A cells.

PAGE 102

95 201 180160147127110 9076670 ^ W // NAB2 nab2A PHCS220 nab2A pPAB1 poly(A)+ RNA DNA

PAGE 103

96 results. If Nab2p is required for Pablp to associate with the poly(A) tail in the nucleus, elevating the nuclear levels of Pablp would bypass the need for Nab2p in export. Another possibility is that naked poly(A) tails are not recognized as substrates for export and are retained in the nucleus. Elevated Pablp levels might result in an increased nuclear concentration of Pablp, allowing Pablp to coaEmask the poly(A) tail. To determine if Pablp was nuclear, Pablp was localized using both conventional immunofluorescence and deconvolution immunofluorescence microscopy. Both of these methods it was demonstrated that Pablp was expressed at elevated levels and was now also detectable in the nucleus (Figure 20). Pre-mRNA Splicing In metazoans 3 Â’-terminal exon splicing is enhanced by the presence of a functional polyadenylation signals (Dye and Proudfoot, 1999). It was possible that defects in 3'-end processing could result in aberrant pre-mRNA splicing. Alternatively, Nab2p could play a role in splicing, and defects in regulation of mRNA poly(A) tail length and nucleocytoplasmic export stem from a primary splicing defect. To determine if 3 Â’-end formation is coupled to pre-mRNA splicing in S. cerevisiae various intron containing mRNAs were analyzed during Nab2p depletion. Defects in pre-mRNA splicing were determined based on an increased pre-mRNA to mRNA ratio. Steady state analysis of ACTl and CYH2 pre-mRNA to mRNA levels were examined in NAB 2 and GAL::NAB2 cells after shift to glucose. As a control, ACTl transcripts were analyzed at the permissive and non-permissive temperatures in tsl26 cells, which contain a conditional

PAGE 104

Dh p CN o • fH p "o P > p 4-( o O o (D O d) Q D (D C/3 PQ P (D c/3 -4-> (D 13 4-* o o :z; d) c/3 d) cj 4—* o D 4-* (D P o O (73 ji X rP Vh bO o P o qp o P 1 a D c/3 Dh d) o s >> P Ph Dh d) c/3 -S P d) 4-4 Ph p T3 a d> P rP 4-> Dh o CZ3
PAGE 105

98 o QCsJ < CN Q CO O • • • • • m Q. < 2 o # CD t~ c E % ^ L • Pab1p

PAGE 106

99 lethal mutation of a splicing factor (Figure 21 A) (Lustig et al., 1986). Defects in splicing oiACTl and CYH2 mRNAs were not seen during Nab2p depletion (Figure 21B,C). Alternative splicing has recently been demonstrated to occur in yeast. Six alternatively spliced transcripts were identified for MTR2 (Davis et al., 2000). Since hnRNPs are known to function in alternative pre-mRNA splicing, it was possible that Nab2p is required for alternative splicing but dispensable for constitutive splicing of mRNAs such as ACTl and CYH2. To investigate the role of Nab2p in alternative splicing, MTR2 transcripts were examined during Nab2p depletion. Differences in alternative MTR2 transcripts were assayed by RT-PCR using primers 5’ and 3’ of the splice sites. There were no differences in the size or distribution of MTR2 transcripts produced during Nab2p depletion (Figure 22). Alternative splicing was also analyzed using the cold sensitive nab2-21 strain. The NAB2 and nab2-21 cells were analyzed at both 24°C and after shift to 14°C for 2 hours. Results from analysis of both MTR2 and SIMl splicing showed no change in splice site usage (Figure 23). RNA blot analysis of MTR2 and other spliced transcripts (RPL26B and RPS14A) confirmed this result (data not shown). Since all five mRNAs analyzed did not show alterations in splicing, it was concluded that Nab2p was not required for either constitutive or alternative pre-mRNA splicing.

PAGE 107

Figure 21. Nab2p is not required for pre-mRNA splicing of ACT 1 or CYH2. Total RNA was isolated from NAB2 and GAL::NAB2 cells at various times after shift into glucose containing media. The total RNA was fractionated by agarose gel electrophoresis and transferred to a charged nylon membrane. A random prime labeled probe was used to probe the RNA blots. The probe contained both intron and exon sequences to allow detection of the intron containing pre-mRNA. Pre-mRNAs tested did not accumulate with the Nab2p depletion. (A) Positive control for ACTl pre-mRNA splicing defect tsl36 is defective in splicing at the non-permissive temperature of 37°C. (B) RNA blot analysis of ACTl during Nab2p depletion. (C) RNA blot analysis of CYH2 during Nab2p depletion.

PAGE 108

101 B ts136 GAL::NAB2 pre-mRNA ACT1 0 2 4 6 8 h pre-mRNA ACT1 NAB2 GAL::NAB2 pre-mRNA CYH2 h

PAGE 109

Figure 22. Alternative splicing of MTR2 is not affected during Nab2p depletion. NAB2 and GAL::NAB2 cells were grown in galactose and shifted to glucose for 0, 30, 60, and 90 minutes and total RNA was isolated. Alternative MTR2 transcripts were analyzed by RT-PCR using primers 5' and 3' of the splice acceptor and donor sites. (A) Seven alternative transcripts are produced from the MTR2 gene. (B) RT-PCR analysis oiMTR2 mRNAs produced during Nab2p depletion.

PAGE 110

103 PCR from 1 ul of cDNA PCR from 4 ul of cDNA ir < 0 30 90 0 30 90 z: 1 1 1 II II II 1 1 C\J CM CM CM CM CM t 1 CQ CQ CQ CQ CQ CQ O s s s s s s E o C\J • • ^ CM • • CM • • • • V CM • . • • CM • • • CM • • « c O CQ -J o QQ O QQ O QQ o QQ o QQ 0) o 5 ^ o o o o 5 CD CD 2 CD CD CD CD CD minutes pre-mRNA 2-a 1-a, 2-b, 2-c 1-b, 1-c

PAGE 111

cd oo jU O O ;3 c 2 ”2 S H ^ *a ^ § Dh O o ^ W) .S "2 c/5 ^3 . cd C3 •5 Di h s s ^ « 6 cd a 2 fS 0 (D c« • 1-H C/5 o O bi!)

PAGE 112

105 CO o d) 0) Q Osl 1 CNJ •O Ct3 CM NAB2 CNJ ly >|001/\| ly >jOOl/\| ly >|00l/\| ly >|00l/\l VNQ OILUOU0O or E i 0) cr E C3Q o d) CD Q Csj 1 Cvj •Q Ct3 C 24 C>sJ QQ s CNJ ly >1001/\| ly >j001/\| ly >|ooiA| ly >|oo|AI O < 1 CNJ z q: 1 0 1 E CNJ d) 03 03 Lm I 1 1 Q-C\J T— T— \l // < VNQ OILUOU 09

PAGE 113

DISCUSSION The role of a polyadenylate tail in the cytoplasm is well established. A polyadenylated tail facilitates translation and stabilizes the mRNA. Degradation is also regulated by the poly(A) tail via recruitment of a Pablp-dependent poly(A) nuclease. Nuclear functions of the poly(A) tail are less clear. My research has demonstrated that the yeast hnRNP Nab2p is a nuclear poly(A) tail-binding protein. More importantly, I show that Nab2p is required for nucleocytoplasmic export of mRNA. The data reported here also suggest that Nab2p is required for regulation of poly(A) tail length in vivo, although this is not an essential function. I also present here evidence for a novel function of the cytoplasmic poly(A) tail-binding protein Pabpl in mRNA export. Regulation of Polyadenylate Tail Length Requires Nab2p Regulation of nuclear polyadenylate tail length in metazoans is mediated by the poly(A)-binding protein PABP2 (Wahle and Keller, 1996). Sequence homologues of PABP2 do not exist in S. cerevisiae, suggesting that control of poly(A) tail length occurs via the use of a novel nuclear poly(A)-binding protein and/or another mechanism. In yeast, the poly(A)-binding protein Pablp is required for regulation of poly(A) tail length in vitro (Amrani et al., 1997; Minvielle-Sebastia et al., 1997). However, cells are not impaired for regulation of poly(A) tail length in vivo. This finding suggests the presence of a compensating factor for Pablp in vivo, which is lost during preparation of 106

PAGE 114

107 the extract. I hypothesized that Nab2p is the compensating factor. Numerous lines of evidence support this hypothesis. All of the conditional lethal nab2 mutant alleles analyzed demonstrate defects in regulation of polyadenylate tail length in vivo, suggesting that polyadenylation is deregulated whenever Nab2p function is compromised. Also, poly(A) tail lengths seen in vivo in nab2 mutant stains are nearly identical to tail lengths produced in the absence of Pab 1 p in vitro (>200^ nucleotides). However, extracts made from nab2 mutant cells exhibit no defect in regulation of poly(A) tail length in vitro. If the effect of Nab2p on polyadenylation in vivo were indirect or secondary, via affecting the levels of 3'-end processing components, in vitro polyadenylation assays would show long poly(A) tails. However, all nab2 mutant extracts used in vitro generate normal poly(A) tails, suggesting that factors involved in 3 Â’-end processing were not affected. Based on this evidence it is likely that Nab2p directly affects regulation of poly(A) tail length in vivo. Regulation of polyadenylate tail length can occur by several different mechanisms. First, Nab2p binding to the poly(A) tail may limit nuclear poly(A) tail synthesis to 70-90 nucleotides. This could be accomplished either by altering the mRNP complex and/or making the 3 Â’ hydroxyl unavailable for poly(A) addition once a certain tail length is achieved. Nab2p could also directly modify the activity of the poly(A) polymerase, though the lack of any physical or genetic interaction argues against this mechanism. Alternatively, Nab2p could function at the level of poly(A) tail shortening. This possibility was intriguing since Nab2p does share structural similarity with the Drosophila protein clipper, a putative endoribonuclease (Bai and Tolias, 1996). However, preliminary results from in vitro deadenylation assays suggest that Nab2p is

PAGE 115

108 not a deadenylase. Rather, purified Nab2p proteeted the homogenously labeled poly(A) substrate, allowing very little, if any, deadenylation to oecur. I believe this evidence supports a role for Nab2p in limiting poly(A) tail length during synthesis, possibly by limiting access to the 3' hydroxyl. One possible explanation for failing to reproduce the tail length defect in vitro is that the presence of Pah Ip in extracts prepared from nab2 cells compensates for loss of Nab2p function. To determine if Nab2p was able to regulate poly(A) tail length, Nab2p was isolated from yeast cells and added back to an in vitro polyadenylation reaction using extracts from a pablA strain. The addition of Nab2p correlated with a decrease in the length of the synthesized poly(A) tail and tail length decreases were concentrationdependent. Since Nab2p intimately associates with the poly(A) tail in the nucleus, this result is consistent with a role for Nab2p in regulating nuclear poly(A) tail length. These results also imply that regulation of poly(A) tail length by Pablp in vitro may be an artifact of the cytoplasmic abundance of Pablp, together with poly(A) binding and PAN recruitment. In support of this conclusion, Pablp has been shown to inhibit in vitro poly(A) addition by the yeast poly(A) polymerase by competing for binding sites (Zhelkovsky et al., 1998). Another possibility is that Nab2p and Pablp have overlapping functions in regulation of poly(A) tail length. However, high copy suppression of a nab2A strain by Pablp does not resolve the poly(A) tail length defect, suggesting that elevated Pablp levels carmot compensate for Nab2p function in regulation of nuclear poly(A) tail length.

PAGE 116

109 How Does Pablp Compensate for the Loss of Nab2p? Pab 1 p-mediated regulation of poly(A) tail length in vitro is due to an inhibitory effect on the poly(A) polymerase. Pab 1 p was shown to inhibit the poly(A) polymerase in a concentration-dependent manner. This was demonstrated by adding increasing amounts of Pablp to an in vitro polyadenylation reaction using only the poly(A) polymerase and an oligo(A)i 2 template (Zhelkovsky et al., 1998). The addition of rPablp to in vitro reactions using Pablp-deficient extracts shows a similar pattern. That is, the distribution of poly(A) tails continues to decrease in size with increasing amounts of added Pablp (Minvielle-Sebastia et al., 1997). This mode of regulation is the opposite of what is seen with the metazoan poly(A)-binding protein PABP2. PABP2 stimulates processive poly(A) addition by the poly(A) polymerase (Bienroth et al., 1993). The effect of higher concentrations of added Nab2p on poly(A) tail length distribution was different compared to results seen with increasing amounts of Pablp. Addition of Nab2p at low concentrations slightly reduces the long poly(A) tails. At higher Nab2p concentrations, the poly(A) tail length distribution is brought back to the normal 60-90 nucleotides. Additional Nab2p does not continue to shift the poly(A) tail length distribution below 60-90 nucleotides (as with Pablp). This result suggests that Nab2p regulates poly(A) tail length by a mechanism more closely related to PABP2, acting as a molecular ruler and inhibiting polyadenylation in yeast only when poly(A) tails have reached 90 nucleotides. One concern regarding the addition of Nab2p is with respect to how Nab2p was purified. It can be argued that Nab2p isolated from S. cerevisiae may contain other factors that regulate tail length. Thus, Nab2p may not be directly involved. This

PAGE 117

110 argument is valid, since it was shown that other proteins do co-purify with Nab2p (K. Nykamp, unpublished). One of these proteins was identified as Pablp. Although Pablp levels were minor compared to Nab2p, immunoinhibition of Nab2p is required to confirm that regulation of poly(A) tail length is due to Nab2p and not a contaminating protein. Also, as previously mentioned, the change in poly(A) tail length was not characteristic of Pablp, suggesting that regulation is by a Pablp-independent mechanism. These results imply that Nab2p either regulates poly(A) tail length directly, or recruits/requires other factors. Why is Nab2p Function Lost During Preparation of Extract? The simplest explanation for loss of Nab2p activity in a wild type NAB 2 extract is that the effective concentration of Nab2p is too low. Very little Nab2p may be required in vivo for cells to survive. Some indication of the requirement for Nab2p is demonstrated by Nab2p depletion using the GAL::NAB2 strain. Cells continue to grow at normal rates until <5% of Nab2p remains. Since only 5-10% of the polyadenylated mRNA in a yeast cell is in the nucleus, the cellular concentration of Nab2p does not need to be nearly as high as it does for Pablp, which associates with cytoplasmic poly(A)^ RNA. The extracts for yeast polyadenylation assays are also whole-cell extracts, which further dilutes the Nab2p concentration . The fact that a whole-cell extract is used raises another issue. Nab2p may be post-translationally modified in the cytoplasm. Modification of Nab2p is seen under certain growth conditions. Interestingly, the modified form of Nab2p cannot be crosslinked to poly(A)^ RNA (data not shown), suggesting the inability of modified Nab2p to associate with poly(A)Â’^ RNA. Since Kapl04p is capable of dissociating Nab2p from single-stranded DNA (Aitchison et ah.

PAGE 118

Ill 1996), Kapl04p may associate with, and displace Nab2p from the poly(A) tail. Nab2p was shown to interact with Kapl04p in a two-hybrid screen (Truant et al., 1998). Kapl04p was also identified as a component of a Nab2p complex (K. Nykamp, unpublished). A Kapl04p-Nab2p interaction may prevent any functional Nab2p interaction with the RNA substrate in an in vitro polyadenylation reaction. Regulation of Polyadenylate Tail Length is not Essential Alterations of polyadenylate tail metabolism are not lethal to the cell. Deletion of either, or both, of the Pablp-dependent poly(A) nucleases results in poly(A) tail lengths that are ~20 nucleotides longer, with no apparent growth defect (Brown and Sachs, 1998). PABl can also be deleted, provided that mRNAs are stabilized either by decapping or exoribonuclease mutants. This originally suggested that precise control over poly(A) tail length is not essential. However, in vivo, Pablp and PAN (Pan2p/Pan3p) function at the level of deadenylation, after a poly(A) tail is accurately generated. Generation of a poly(A) tail is clearly required for cell growth. This is demonstrated by the identification of many 3'-processing factors as essential genes. My results show that deregulation of nuclear poly(A) tail synthesis is not lethal. Polyadenylate tail length analysis of nab2-21 cells showed that cells could survive at the permissive temperature, even though poly(A) tail lengths exceeded 120 nucleotides. Polyadenylate tail length also did not change during shift to the non-permissive temperature, suggesting that this defect was not responsible for the cessation of cell growth observed at the non-permissive temperature. High-copy suppression of a nab2A strain by Pablp also implied that the role of Nab2p in regulation of poly(A) tail length is not essential, since the poly(A) tail defect in suppressor cells was not resolved.

PAGE 119

112 Nab2p-Dependent Regulation of Poly(A) Tail Length is Message Specific Regulation of polyadenylate tail length is message specific at the level of deadenylation. Specific mRNA deadenylation is mediated hy the poly(A) nuclease (PAN) (Brown and Sachs, 1998). Initially, mRNAs receive a poly(A) tail of ~70 to 90 nucleotides and are then processed hy PAN to different lengths, depending on the mRNA. The data presented here demonstrate that nuclear poly(A) tail length depends on Nah2p, and is also mRNA specific. Ligation-mediated poly(A) tail (LM-PAT) analysis was used to confirm in vivo hyperpolyadenylation of specific mRNAs during Nah2p depletion. The data show that mRNA poly(A) tail lengths are not the same for all mRNAs during Nah2p depletion. Rather, poly(A) tail lengths vary dramatically depending on the mRNA. DDR2 and SEDl mRNAs received relatively long poly(A) tails (increases of >80^ nucleotides) when Nah2p was depleted. Polyadenylate tails on SEDl and DDR2 are representative of the poly(A) tail length seen hy 3 Â’-end labeling of total RNA during Nab2p depletion. Polyadenylate tails for TPIl, PGKl and CYH2 were modestly increased during Nab2p depletion (~ 10-20 nucleotides). A similar analysis of CYCl demonstrated no detectable change in poly(A) tail length during Nab2p depletion. Using an alternative method of poly(A) tail length analysis (oligo-directed RNase H cleavage), poly(A) tails for CYH2 were shown to decrease in length during Nab2p depletion. This is contradictory to the poly(A) tail length increase (~ 10-20 nucleotides) seen using LM-PAT. I believe the discrepancy is a result of two issues, (i) Ligationmediated RT-PCR is a highly sensitive assay for detecting small poly(A) tail length changes. The PCR step is performed using [a-^^P]-dATP to label the poly(A) tails. 32 Using [aP]-dATP results in preferential visualization of longer poly(A) tails due to

PAGE 120

113 incorporation of more radio-labeled nucleotide, (ii) Ligation mediated RT-PCR analysis is also less sensitive to levels of the mRNA, since the amount loaded in each lane is equalized base on counts. Longer poly(A) tails for CYH2 were not detected using oligodirected RNase H cleavage because of the small change in tail length, but mainly due to decreasing mRNA levels during Nab2p depletion. The Yeast HnRNP Nab2p is Required for Nucleocytoplasmic Export of mRNA The conditional lethal nab2 mutants analyzed in this study show defects in mRNA export. The distribution of polyadenylated RNA in nab2-21 cells is normal at the permissive temperature, while nuclear accumulation was evident at the non-permissive temperature. This suggested that cells stopped growing due to a problem with mRNA export. This conclusion was confirmed by high copy suppression analysis of a nab2 deletion. The poly(A)-binding protein Pablp was the only suppressor identified in this screen. High-level expression of Pablp in a nab2h strain completely resolved the poly(A)^ RNA export defect seen in these cells, but did not restore regulation of poly(A) tail length. Again, this suggests that Nab2p is required for mRNA export. Nuclear Functions of the Poly(A)-Binding Protein Pablp Pablp has been reported to function in both the cytoplasm and the nucleus. In the cytoplasm, Pablp associates with the poly(A) tail and protects the mRNA from 5Â’decapping by Dcplp (Caponigro and Parker, 1995). Pablp also protects the mRNA fi'om 3Â’ ^ 5Â’ degradation. The efficiency of translation initiation is increased by Pablpmediated recruitment of the 60S ribosomal subunit (Sachs and Davis, 1989). Translation of most mRNAs in S. cerevisiae is stimulated by the presence of a poly(A) tail (lizuka et

PAGE 121

114 al., 1994). Pablp interaction with the translation factor eIF4G is believed responsible for poly(A) tail/cap-dependent translation. Pablp only binds to elF4G when Pablp is also bound to a poly(A) tail (Tarun et al., 1997). Since eIF4G also binds the cap-binding protein eIF4E, the Pablp-elF4G interaction only stimulates translation of capped and polyadenylated mRNAs (Sachs and Varani, 2000; Tarun and Sachs, 1996; Tarun et al., 1997). It is possible that high copy suppression of a nablA strain by Pablp was a result of mRNA stabilization and increased translation. However, because the poly(A)^ RNA export defect was completely resolved, I favor an alternative nuclear function for Pablp. Pablp has been shown to be required for regulation of poly(A) tail length in vitro. However, conditional lethal pabl alleles and pablA strains do not show defects in regulation of poly(A) tail length of the magnitude seen in vitro. This suggests that Pablp is not essential for polyadenylation in vivo. This is consistent with my results, which demonstrated that polyadenylate tail lengths were only modestly reduced (~20 nucleotides) in nab2A pP AB 1 suppressor cells. The human poly(A)-binding protein PABPl has been shown to shuttle between the nucleus and cytoplasm (Afonina et al., 1998). Although supportive of a role in mRNA export, neither PABPl nor Pablp have been implicated in nucleocytoplasmic RNA transport. Interestingly, the pabl-53 strain has been reported to be impaired for the production of CUP 1 and HISS mRNAs, suggestive of a role for Pablp in nuclear mRNA metabolism (Morrissey et al., 1999). Resolution of the poly(A)^ RNA export defect in nab2A cells by high-level expression of Pablp implies a potential nuclear role for Pablp in mRNA export.

PAGE 122

115 Full-length Pablp levels were modestly increased in suppressor cells. The major fraction of Pablp in suppressor cells was due to a truncated, ~53 kDa form of Pablp (Pablp*). A 53 kDa form of Pablp was identified previously as the nuclear form of Pablp (Sachs et al., 1986; Sachs and Komberg, 1985). The 53 kDa form of Pablp is a carboxy-terminal truncation that does not contain the motifs required to recruit the poly(A) nuclease (PAN) (Brown and Sachs, 1998). Thus, Pablp* would not stimulate deadenylation. This may be of benefit to the cell, stabilizing the mRNA in the nucleus and possibly facilitating mRNA export. Polyadenylated RNA in the Nucleolus Interestingly, all nab2 mutants accumulate poly(A)^ RNA in the nucleolus. The significance of nucleolar accumulation of poly(A)Â’^ RNA is not clear. Most mutants defective in mRNA export show a diffuse nuclear accumulation of poly(A)^ RNA. This is true for ratl-1, rnal-1, and prp20-Hmtrl-l mutants. However, some mRNA trafficking mutants, mtr2, mtr4 and rrp6, show focal accumulation of poly(A)^ RNA (Kadowaki et al., 1994). Two alternative explanations can account for the nucleolar poly(A)Â’^ RNA accumulation, (i) Nucleolar RNAs are polyadenylated in nab2 cells, (ii) mRNA is normally routed through the nucleolus and is blocked in nab2 cells. Support for both of these possibilities exists. Mutants in rrp6 and mtr4 have also been demonstrated to polyadenylate specific snoRNAs (van Hoof et al., 2000). Since snoRNAs are mainly nucleolar, for mtr4 and rrp6 mutants, focal accumulation of poly(A)Â’^ RNA may be explained by the polyadenylation of nucleolar RNAs (van Hoof et al., 2000).

PAGE 123

116 Why are nucleolar RNAs (such as snoRNAs) polyadenylated? The RNA component (TLCl) of the telomerase enzyme is present in cells as both poly(A)' and poly(A)^ RNA. It was shown that poly(A)^ TLCl RNA is chased into a poly(A)' form (Chapon et al., 1997). Based on this result it is believed that TLCl is transcribed and initially polyadenylated, but the tail is removed during maturation. SnoRNAs that are monocistronic or polycistronic also start off as poly(A)^ RNAs, but are rapidly processed to their mature form. The snRNA U2 has been demonstrated to exist as a polyadenylated form when 3'-end cleavage by Rntlp is disabled (Abou Elela and Ares, 1998). Interestingly, polyadenylation isn't always coupled to transcription termination in yeast. Certain intron-residing snoRNAs were shown to undergo polyadenylation, only after cleavage by Rntlp (van Hoof et al., 2000). All of these data imply that polyadenylation is a normal part of non-mRNA biogenesis. Polyadenylation of RNAs in bacteria may provide some insight into the function of polyadenylation of small stable RNAs in yeast. Bacteria have been shown to polyadenylate up to 50%-80% of their mRNA, depending on the species (Steege, 2000). Many of the RNAs polyadenylated in bacteria end in a stable RNA-hairpin structure. Polyadenylation has been shown to stimulate degradation of the RNA by providing a single stranded region for bacterial exonucleases to initiate degradation (Blum et al., 1999). All mature snoRNAs are believed to end in RNA hairpin structures, which stabilize the snoRNA by preventing attack by 3'-^ 5' exonucleases. Polyadenylation of snoRNAs in yeast may also be required to stimulate degradation. Nab2p shares structural characteristics with the prospective RNA endonuclease clipper, making it a candidate for polyadenylation-mediated snoRNA degradation (Bai and Tolias, 1996). Nucleolar RNAs

PAGE 124

117 were analyzed for polyadenylation in nab2 mutants, but no evidence was found suggesting that non-mRNAs were polyadenylated. In fact, a cDNA library screen from Nab2p depleted cells revealed only mRNAs. None of the intron-containing mRNAs isolated are known hosts for snoRNAs either, further suggesting Nab2p-dependent hyperpolyadenylation does not affect snoRNAs. Alternatively, certain mRNAs have been localized to the nucleolus. The ASHl 3Â’-UTR accumulates in the nucleolus in mex67-5 cells at the non-permissive temperature (Brodsky and Silver, 2000). Since only mRNAs demonstrate hyperpolyadenylation during Nab2p depletion, the nucleolar accumulation of poly(A)^ RNA in nabl mutant cells is most likely a result of mRNA accumulation. Nucleolar Function is Compromised in nab2 Strains Although monocistronic and polycistronic snoRNAs showed no detectable processing defects in nab2 mutant cells, intron-residing snoRNAs were affected. Loss of Nab2p correlated with increased transcript sizes for the intron-residing snoRNAs snR39 and U18, as determined by RNA blot analysis. While the two snoRNAs did not appear to be polyadenylated, the detection, and size, of the larger forms was suggestive of a defect in processing the snoRNA from the liberated intron-lariat. Components of the exosome have been demonstrated to be required for maturation of various nucleolar RNAs including rRNA, snRNA, as well as snoRNAs. One possible explanation for the maturation defect is that the poly(A)^ RNA accumulating in the nucleolus has compromised the efficiency of snoRNA processing by the exosome. While my results

PAGE 125

118 are not suggestive of a direct role for Nab2p in intronic snoRNA maturation, it is interesting that only intron-residing snoRNAs were affected. Roles for HnRNPs in Processing Stress Response mRNAs Recently, hnRNPAl was identified as a potential regulator of the osmotic stress response in higher eukaryotes. Under osmotic stress conditions, hnRNP A1 is phosphorylated and accumulates in the cytoplasm (van der Houven van Oordt et al., 2000). Cytoplasmic accumulation of hnRNP Al also correlated with a shift in the alternative splicing pattern of a reporter construct. Message specific processing of mRNAs by PAN is hypothesized to regulate mRNA stability and translation, which are both dependent on the poly(A) tail. Nab2p-dependent regulation of poly(A) tails may also function in regulating gene expression. Interestingly, the mRNAs most affected by loss of Nab2p are mRNAs that code for proteins required for osmotic and oxidative stress responses. My research has also shown that nab2-21 cells exhibit an increased sensitivity to osmotic and oxidative stresses. Since Nab2p is essential for mRNA export, I believe the increased sensitivity of nab 221 cells to osmotic and oxidative stresses is a result of defects in the export of mRNAs specific for survival under these conditions. Nab2p May Direct mRNPs to the Nuclear Pore It is becoming clear that each step of RNA processing does not occur independently of other processing events. Rather, many RNA processing events occur simultaneously. Splicing has been demonstrated to occur cotranscriptionally, and 3Â’terminal exon splicing is coupled to, and enhanced by, 3 Â’-end cleavage and

PAGE 126

119 polyadenylation (Dye and Proudfoot, 1999). Cleavage of the mRNA during 3 Â’-end formation has been shown to stimulate transcription termination in yeast (Yonaha and Proudfoot, 2000). Failed 3 Â’-end formation produces elongated 3Â’UTRs, which are retained in the nucleus (Long et ah, 1995). The 5Â’-cap has also enhances 3Â’-end formation (Flaherty et ah, 1997). Although processing events can be separated and studied independently in vitro, each RNA processing step is coordinately regulated in vivo. This allows the detection and removal of incorrectly processed transcripts before they are exported to the cytoplasm where they could be translated into toxic protein products. How are RNA processing events coupled to each other in vivo? Most RNA processing events are coupled to transcription by association of processing factors with the carboxy-terminal domain of the elongating RNA polymerase II. However, a new mechanism is emerging. Recently, splicing was shown to generate an exportable mRNP. The splicing reaction alters the protein composition of the mRNP complex by incorporation of specific proteins only after splicing has been completed (Luo and Reed, 1999). In metazoans, two of these proteins (Y14 and Aly) have been identified (Kataoka et ah, 2000; Zhou et ah, 2000). The process of 3 Â’-end formation was also shown to facilitate mRNA export (Huang and Carmichael, 1996). This suggested that 3 Â’end formation might alter the protein composition of the 3 Â’-end processed mRNP, targeting it for export. One possible role of Nab2p is packaging of the 3 Â’-end of the mRNA following cleavage and polyadenylation. Nab2p may actively target mRNPs to the NPC by recruiting an export factor (Figure 24A). It is also possible that a naked poly(A) tail is

PAGE 127

Figure 24. Nab2p may package the 3'-end of mRNAs that are cleaved and polyadenylated. Similar to the role of Y14 and Aly in specifying the splicing history of an mRNP, Nab2p may associate only with mRNAs that are accurately 3'-end processed. In this model, only cleaved and polyadenylated Nab2p-containing mRNPs would be routed to the nuclear pore for export to the cytoplasm. (A) Nab2p is an export adaptor and recruits an export receptor (ER). (B) Nab2p binding to the poly(A) tail displaces a nuclear retention factor(s) (NRF).

PAGE 128

121 A Nucleus Cytoplasm B

PAGE 129

122 inhibitory to mRNA export. Thus, Nab2p would displace a nuclear retention factor (Figure 24B). The retention factor could be a novel RNA-binding protein or a known component of the 3'-end processing machinery. In this model, the Nab2p-mRNP would signal the completion of 3 Â’-end formation, allowing nucleocytoplasmic export of the mature mRNP. Consistent with this model, Nab2p was recently shown to accumulate at the nuclear pore with poly(A)^ RNA in toml mutant cells (Duncan et al., 2000). However, Nab2p did not co localize with a non-NPC associated sub-population of poly(A)^ RNA in mex67 mutant cells, suggesting that Nab2p may not be incorporated into the mRNP until the mRNP is ready for export. Limitations One limitation of this study was the lack of conditional lethal alleles. Multiple attempts were made to generate conditional lethal alleles using PCR-induced mutagenesis. However, I was unable to identify new nab2 mutant alleles. This limited the genetic analysis of NAB2 to using the two existing conditional lethal alleles. Unfortunately these alleles were not highly amenable to genetic analysis. The nab2-13 allele was not used due to temperature sensitivity at both low and elevated temperatures, as well as a decreased cellular concentration of Nab2p. The nab2-21 allele was useful for analyzing RNA processing defects. However, this allele is a truncation mutant. Unlike a point mutant, use of the nab2-21 allele to genetically identify potential physically interacting proteins was limited. This left the conditional null allele, which was used to identify Pah Ip as a high-copy suppressor. Another limitation of this study was the lack

PAGE 130

123 of recombinant Nab2p. New methods of recombinant protein production that do not require bacterial expression should be helpful in this area. Conclusions I have demonstrated here that the yeast hnRNP Nab2p is a nuclear polyadenylate tail binding protein required for both regulation of poly(A) tail length and nucleocytoplasmic export of mRNA. I have also shown that regulation of poly(A) tail length and mRNA export are not obligatorily coupled events in yeast. My research suggests that different hnRNPs are involved in processing of different classes of mRNA. Nab2p appears to be required for processing of mRNAs induced by the stress response. Interestingly, it appears that NAB2 is also up regulated during stress conditions. NAB2 mRNA is induced 5.6-fold by the DNA damaging agent methyl methane-sulfonate (MMS). The NAB2 gene also contains a proteasome-associated control element (PACE), which is an upstream transcriptional activating sequence found in the promoters of most of the proteasomal yeast genes, as well as a number of promoters of genes related to the ubiquitin-proteasome pathway. Alternative 3 Â’-end processing is fairly well documented in higher eukaryotes (Edwalds-Gilbert et al., 1997). Examples of alternative cleavage site usage also exist in yeast (Sparks et al., 1997). Demonstrating that regulation of poly(A) tail length in yeast is mRNA subclass specific adds another level of complexity to 3 Â’-end formation and changes the way we think about 3 Â’-end processing. Nab2p is the second yeast hnRNP demonstrated to function in 3 Â’-end processing. Since many aspects of 3 Â’-end processing appear to be conserved between mammalians and yeast, the identification of yeast

PAGE 131

124 hnRNPs as 3 Â’-end processing components suggests that metazoan hnRNPs will also be required for some aspect of 3 Â’-end formation. My research also questions the role of Pablp in regulation of nuclear poly(A) tail length. Since high level expression of Pablp did not resolve defects in poly(A) tail length, Pab 1 p either plays no role in regulation of nuclear poly(A) tail length, or Pablp and Nab2p have similar functions for different subclasses of mRNA. Finally, numerous observations suggest that the results of my research will be applicable to other organisms. First, Nab2p is similar to developmentally regulated metazoan proteins such as clipper. Nab2p also interacted with various human proteins in a two-hybrid screen. More importantly, functional information pertaining to Nab2p may advance our understanding of human genetic disorders that stem from defects in RNA processing.

PAGE 132

APPENDIX OLIGONUCLEOTIDES, YEAST STRAINS AND PLASMIDS DNA oligonucleotides used in this study MSS# Sequence 909 5'-GCTAACAAGGAAAAGAGAGCC 908 5'-GTTAAACCCCGATATTACACC 907 5' GCCACTCCAACAAATTGGCC 906 5'-AAGCTGTTGAAGCTTAATGCTCTATGTAATCAC CTAC 905 5Â’-GCCCAAGCTGCTAATGAACGTATGCATGTCTTG 904 5'-TTCATTAGCAGCTTGGGCACGACCAACGTATAA 903 5'-TAGTTCAGAGTCTGTCTTATCAGTAATATCAGCC 902 5'-AAACTGATAAGACAGACTCTGAACTAAATGGAG AAAA 90 1 5'-CATAGAGCATTAAGCTTCAACAGCTTTCACAGC 900 5'-CCGCTGCCGGTTAATGCTCTATGTAATCACCTAC 899 5'-CATAGAGCATTAACCGGCAGCGGCGGCG 892 5'-GCGCCCGGGGAGGTCATACTGTATGAAGCC 857 5'-GGGAATTCAACGGTGGTGTTTGACACATCC 846 5'-TCCTCCCACATCCGCTCTAACCG 845 5'-CCTACCAAGCACACTGTCGCCACC 844 5'-AGCTAGATTCGTCTCCAAGTTGGC 843 5'-GGTCGGTGGTGCTTCTTTGAAGCC 842 5'-CCCTTGTCGTCATGGTCGA 841 5'-ATCAGACTGACGTGCAAATCAT 840 5'-TCCCATCATAAACACGGACC 839 5'-GTAAGAAGCATTTCCACATGGG 826 5'-CTGAGGAGGGACTATTTAAGTGG 825 5'-CCGTTATACCACCATCTTTGTGGG 824 5'-CGTTATTAAACTACTTATTTTCGGTTACGTAG ATGAAATA 823 5'-CTCTGGGGCCTATAGATGGAATATCAAAGG 8 1 6 5'-ACAGTGGAGGTATGTCAGTAAAGGCTTATT 8 1 5 5'-AGTGGACTGTCTTTGTTGCGTAACTGACGA 8 1 0 5'-TGGCTTATGACGATGAGAA 809 5'-CAAACCCCATTATGAGTAAA 808 5'-TGCTGCTACTTCATCGCATCTTTGTATTTA 807 5'-CTCTTCAACCGTTGGGCCGTTGTCTGGTGC 806 5'-ATTGAAATGCATTCACAATATGGTAAGCCT 805 5'-AAAGATTATCTGCTTCATCA 804 5'-TGGGGCCTATAGATGGAATATCAAAGGGGA 803 5'-TCGTGGCAGTAAGCGGCGTT Name/Description 5'RPL6A-PROBE 3'MTR2-PROBE 5Â’MTR2-PROBE PAB1-3B PAB1(K296K297-AA)B PAB 1 (K296K297-AA)A PAB1-5B PAB 1-5 A PAB 1-3 A PAB1-2B PAB1-2A 5'Smal-PABl 5'SEDlpre(EcoRl) CYC 1 (PAT) APE3(PAT) CYH2(PAT) TPI1(PAT) SNR 190 SNR72 U18 SNR44 CWH41(PAT) SED1(PAT)#2 DDR2-PROBE(B) DDR2-CLEAVE(B) CWH41 -PROBE CWH41 -CLEAVE SSA4-3'RP SSA4-5'RP SSA4-PROBE SSA4-CLEAVE YFR055W-PROBE YFR055W-CLEAVE DDR2-PROBE DDR2-CLEAVE 125

PAGE 133

126 MSS# Sequence 794 5'-AGGAAAAAATTTTCGATTAAAATTACTTAA 793 5'-ACCGAGAGAAAATCATCGGAAAAATGTGGC 792 5'-GGAGAGCACATTAATAAGTTTGTATTAAAGA 79 1 5'-AAACGATACTGCTCAGGGCAATTTAGGGGC 78 1 5'-AAGAAAAAGAAGAATTAAATATAGCATATC 780 5Â’-GGCTTTGATAATCTTCTTTTTCTCTG 779 5'-GCCCCAGAGTAGTAAATTTGGTGC 778 5'-TCGTTTCATGTCTAGTCTCTTTAAAG 777 5'-ATTAGTGGAAGCTGAAACGCAAGG 776 5'-CAGGTTATTGAATTTTCCCATCTGG 775 5'-CTACACGCTTGCACATCTCAGAAG 774 5'-GATTGTGCTGGAAAAGTTTAAAGGG 757 5'-CACTGTCGCTAAGAAGTACGG 756 5'-GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT 755 5'-CGCTCGAGCAGCGGATAGCGC 745 5'GGGGGATCCCTGTTACGGTTGCTTTCCC 744 5 '-GGGTCTAGAAGGTC ATACTGTATGAAGCC 736 5'-TTCACGGTTACCGAAAGAACCACCTTGGAT 735 5'-TGTTACACGGCATTATCACTCAATGGTTTT 734 5'-ACCTTAATACCTTAACTCTC 73 1 5'-CACCGTGTGCATTCGAATTGTCTGC 730 5'-CATGGCAATTCCCGGGGATCTAGTATAGTC TATAGTCCGTG 727 5'-GTGCAAATCATTTGATGAGACGTTTTCTTC 726 5'-TTAAAGAGACCAATCTAGTACAGTGTGAAT 725 5'-CACATGAGGTGTAATCCATAACCGTGTAAG 724 5'-CAATGACTAGTCGAATATGTATTGGGATAC 7 1 9 5'-GGTGTCATAATCAACCAATCGTAAC 718 5'-CTACTCATCCTAGTCCTGTTGCTGC 7 1 7 5'-CATGGCAATTCCCGGGGATCGACAGCTTAT CATCGATAAGC 7 1 6 5'-CATGGTGGTCAGCTGGAATTCATTACGACC GAGATTCCC 7 1 5 5'-GATCCCCGGGAATTGCCATGTCAGTTCATT TCCGTATCTTG 7 1 4 5'-AATTCCAGCTGACCACCATGATGTCTCAAG AACAGTACACA 713 5'-AGCTTTGTCACCTTCCCC 7 1 2 5'-CTAAGTACTTACATAATAGGTAGAGGCCTA 711 5 '-CAAGTAACAAGCACATCGA 7 1 0 5'-CATATGTGATTTCACAATGCTACATAAGCG 709 5'-TAACTGGGCCCTTCACGT 708 5'-CCTAACGCAAACGACGAGCTTCACGTTCAG 707 5'-GGAGGATCCTACGACCTTTACCGGC 706 5'-GGCGAATTCCCATTTGGAAGAGGG 705 5'-AACCGGCTGCCAAAGTG 704 5Â’-GATGCGCTTAAGCGATCAATTCAACAACA Name/Description HOR7-PROBE HOR7-CLEAVE SEDl -PROBE SEDl -CLEAVE SESl(PAT) SCW4(PAT) DDR2(PAT) SEDl (PAT) TYIB(PAT) YFR039C(PAT) INTERGENIC(#43) INTERGENIC(#1 1) PGKl(PAT) 01igo(dT)-primer/anchor 3'-XH01-NAB2(+1831) 5'-BamHI-PABl 5'-XbaI-PAB 1 RPL6A(PROBE) RPL6A(PROBE)Int 2 RPL6A(CLEAVE) URA3-INT-3'(#2) URA3L-AD-B(#42) SNR72 SNR51 SNR44 SNR39 URA3-INT-3' URA3-INT-5' URA3-AD-B URA3-AD-A NAB2-AD-B NAB2-AD-A CTF8(CLEAVE) CTF8(PROBE) SFOl (CLEAVE) SFOl (PROBE) RPS33(CLEAVE) RPS331 (PROBE) 3'-CYH2(INTRON) 5Â’CHY2(INTRON) CYH2(CLEAVE) CYH2(PROBE)

PAGE 134

127 Y east strains DesignationGenotype Source yJA513 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 pNAB2A5(URA3) (Anderson, 1995) yJA515 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 pNAB2.19(77lP7) (Anderson, 1995) yJA517 MATa/a leu2A2/leu2A ura3-52/uraS-52 NAB2/nab2A::LEU2 pGAL::NAB2 (Anderson, 1995) yJA517-lC MATa leu2A2 ura3-52 nab2A::LEU2 pGAL::NAB2 (Anderson, 1995) yJA517-lD MATa leu2A2 uraS-52 NAB 2 (Anderson, 1995) yJA213 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 pNAB2-13(ri?P7) (Anderson, 1995) yJA219 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 pNAB2-19(77lP7) (Anderson, 1995) yJA220 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 pNAB2-20(77?P;) (Anderson, 1995) yJA221 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 pNAB2-21(77?/Â’;) (Anderson, 1995) yJA223 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 TRPl ::nab2-21 (This study) yJA224 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 pNAB2.42(ri?F7) (This study) yJA225 MATa leu2A2 his3A200 trpl-189 ura3-52 nab2A::LEU2 pNAB2.40(77?P/) (This study) L4717 MATa ade2 canl-100 his3-ll,15 leu2-3,112 trpl-1 ura3-l GAL+ (Minvielle-Sebastia, L.) L4718 MATa ade2 canl-100 his311,15 leu2-3,112 trpl-1 ura3-l GAL+ (Minvielle-Sebastia, L.) yRHlOO MATa/a ade2/ade2 canl-lOO/canl-100 his3-l 1,1 5/his3-l 1,15 leu2-3,l 12/leu2-3,l 12 trpl-1 /trpl-1 ura3-l/ura3-l (This study) yRHlOl MATa/a ade2/ade2 canl-lOO/canl-100 his3-l 1,1 5/his3-l 1,15 leu2-3,l 12/leu2-3,l 12 trpl-l/trpl-1 ura3-l/ura3-l NAB2/nab2A::HIS3 (This study) yRH201C MAT? ade2 canl-100 his311,15 leu2-3,112 trpl-1 ura3-l nab2A::HIS3 pGAL::NAB2 (This study)

PAGE 135

128 Yeast strains DesignationGenotype Source yRH202 MAT? ade2 canl-100 his3-Il,15 leu2-3,112 trpl-1 nab2A::HIS3 pGAL::NAB2 YEpl3 ura3-l (This study) yRH203 MAT? ade2 canl-100 his3-11.15 leu2-3,112 trpl-1 nab2A::HlS3 ipGAL\-A^AB2 pPABl ura3-l (This study) yRH204 MAT? ade2 canl-100 his3-ll,15 leu2-3,112 trpl-1 nab2A::HIS3 pPABl ura3-l (This study) yHCS220 MAT? ade2 canl-100 his3-ll,15 leu2-3,112 trpl-1 nab2A::HIS3 pGAL::NAB2 pHCS220 ura3-l (This study) yRH221 MAT? ade2 canl-100 his311,15 leu2-3,112 trpl-1 nab2A::HIS3 pnab2-21 ura3-l (This study) yRH222 MAT? ade2 canl-100 his3-ll,15 leu2-3,112 trpl-1 nab2A : :HIS3 pnab2-2 1 pP AB 1 ura3-l (This study) Plasmids Name Description pNAB2.15 pNAB2.19 pnab2-2 1 pGAL::NAB2 pNAB2-3B6 pPlD53 pG4-CYCl pG4-CYCl-pre Pvul/Nsil fragment (nt -496 to 1961), blunt-ended and subcloned into Smal cut pRS316 (Sikorski and Boeke, 1991) PvuI/Nsil fragment (nt -496 to 1961), blunt-ended and subcloned into Smal cut pRS314 (Sikorski and Boeke, 1991) EcoRI/SstI fragment generated by PCRinduced deletion (Anderson, 1995) cloned into EcoRI/SstI cut pRS314 (Sikorski and Boeke, 1991) Bglll/Sall fragment from pNAB2-3B6 subloned into BamHI/Sall cut pRD53 (gift of R.J. Deshaies, university of California, San Francisco, CA). NAB2 coding sequence, generated by PCR using primers MSS47 and MSS48, inserted into pSP72 cut with EcoRI/BamHI (include nt -29 to 1831) (Anderson, 1995) EcoRI/BamHI fragment containing the GAL 1,10 promoter region subcloned into Spel/BamHI cut pRS3 16 (Sikorski and Boeke, 1991) 237 nucleotideTaqI fragment from the 3Â’ UTR of CYCl cloned into the AccI site of pGEM4 (Promega) (pG4-CYCl was a gift of T. Platt, University of Rochester Medical Center, Rochester, NY) CYCl amplified by PCR with the 5Â’ primer (5'-CTCTAGACGATATCATGTAATT AGTT-3') and a 3' primer complementary to the poly(A) site (5Â’-GGAATTCCATAT CAAATATAAATAACGTTCTT-3'), Digested with Xbal/EcoRI and cloned into pGEM4 at the same sites (gift of Lionel Minvielle-Sebastia, Institut de Biochimie et Genetique Cellulaire, )

PAGE 136

129 Plasmids Name Description pSEDlpre SEDl 3'-UTR PCR amplified from L4717 genomic DNA using primers MSS857 and MSS , blunt-ended and cut with EcoRI and then subcloned into EcoRI/Smal cut pSP72 pHCS220 Plasmid isolated from a high-copy suppression screen of a nab2A, containing an ~10 Kb insert in YEpl3, encoding part of CHDl and all of PABl and YER166W pP AB 1 . 1 PABl amplified from L4717 genomic DNA using primers MSS and MSS, digested with Xbal/BamHI and subcloned into Xbal/BamHI cut YEpl3 pPABl.2 PABl amplified from L4717 genomic DNA using primers MSS and MSS, digested with Smal/BamHI and subcloned into Smal/BamHI cut YEp24 pNAB2-HIS3-K.O. BamHI/EcoRI HIS3 fragment from pJJ217 (Jones and Prakash, 1990 YEAST) bluntended and subcloned into AvrII/Ndel cut and blunt-ended pNAB2.52 pNAB2.52 EcoRI/BamHI fragment from pNAB2.19 subcloned into EcoRI/BamHI cut pSP73 (Promega)

PAGE 137

REFFERENCES Abou Elela, S., and Ares, M., Jr. (1998). Depletion of yeast RNase III blocks correct U2 3' end formation and results in polyadenylated but functional U2 snRNA, Embo J 77, 3738-46. Adami, G., and Nevins, J. R. (1988). Splice site selection dominates over poly(A) site choice in RNA production from complex adenovirus transcription units, Embo J 7, 210716. Afonina, E., Stauber, R., and Pavlakis, G. N. (1998). The human poly(A)-binding protein 1 shuttles between the nucleus and the cytoplasm, J Biol Chem 273, 13015-21. Aitchison, J. D., Blobel, G., and Rout, M. P. (1996). Kapl04p: a karyopherin involved in the nuclear transport of messenger RNA binding proteins. Science 274, 624-7. Alzhanova-Ericsson, A. T., Sun, X., Visa, N., Kiseleva, E., Wurtz, T., and Daneholt, B. (1996). A protein of the SR family of splicing factors binds extensively to exonic Balbiani ring pre-mRNA and accompanies the RNA from the gene to the nuclear pore. Genes Dev 10, 2881-93. Amberg, D. C., Goldstein, A. L., and Cole, C. N. (1992). Isolation and characterization of RATI: an essential gene of Saccharomyces cerevisiae required for the efficient nucleocytoplasmic trafficking of mRNA, Genes Dev 6, 1 173-89. Amrani, N., Minet, M., Le Gouar, M., Lacroute, F., and Wyers, F. (1997). Yeast Pabl interacts with Rnal5 and participates in the control of the poly(A) tail length in vitro. Mol Cell Biol 17, 3694-701. Anderson, J. T. (1995) Characterization of nuclear polyadenylated RNA-binding proteins from Saccharomyces cerevisiae. Doctor of Philosophy Dissertation, University of Florida College of Medicine, Gainesville, FL. Anderson, J. T., Wilson, S. M., Datar, K. V., and Swanson, M. S. (1993). NAB2: a yeast nuclear polyadenylated RNA-binding protein essential for cell viability. Mol Cell Biol 13, 2730-41. Antoniou, M. (1995). Clinical defects in pre-mRNA processing. In Pre-mRNA Processing, A. I. Lamond, ed. (Austin, TX, R.G. Landes Company), pp. 187-201. 130

PAGE 138

131 Ashe, M. P., Pearson, L. H., and Proudfoot, N. J. (1997). The HIV-1 5' LTR poly(A) site is inactivated by U1 snRNP interaction with the downstream major splice donor site, Embo J 16 , 5752-63. Bai, C., and Tolias, P. P. (1996). Cleavage of RNA hairpins mediated by a developmentally regulated CCCH zinc finger protein. Mol Cell Biol 16 , 6661-7. Barabino, S. M., Hubner, W., Jenny, A., Minvielle-Sebastia, L., and Keller, W. (1997). The 30-kD subunit of mammalian cleavage and polyadenylation specificity factor and its yeast homolog are RNA-binding zinc finger proteins. Genes Dev 11 , 1703-16. Bauren, G. and Wieslander, L. (1994). Splicing of balbiani ring 1 gene pre-mRNA occurs simultaneously with transcription. Cell 76 , 183-92. Beyer, A.L. and Osheim, Y.N. (1988). Splice site selection, rate of splicing, and alternative splicing on nascent transcripts. Genes Dev 2 , 754-65. Bienroth, S., Keller, W., and Wahle, E. (1993). Assembly of a processive messenger RNA polyadenylation complex, Embo J 12 , 585-94. Bienroth, S., Wahle, E., Suter-Crazzolara, C., and Keller, W. (1991). Purification of the cleavage and polyadenylation factor involved in the 3'-processing of messenger RNA precursors, J Biol Chem 266 , 19768-76. Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., and Proudfoot, N. J. (1998). Coupling termination of transcription to messenger RNA maturation in yeast. Science 250,298-301. Blum, E., Carpousis, A. J., and Higgins, C. F. (1999). Polyadenylation promotes degradation of 3'-structured RNA by the Escherichia coli mRNA degradosome in vitro, J Biol Chem 274 , 4009-16. Boeck, R., Tarun, S., Jr., Rieger, M., Deardorff, J. A., Muller-Auer, S., and Sachs, A. B. (1996). The yeast Pan2 protein is required for poly(A)-binding proteinstimulated poly(A)-nuclease activity, J Biol Chem 271 , 432-8. Brodsky, A. S., and Silver, P. A. (2000). Analysis of mRNA nuclear export in living cells reveals distinct pathways. Paper presented at: RNA 2000 The Fifth Annual Meeting of The RNA Society (Madison, WI). Brown, C. E., and Sachs, A. B. (1998). Poly(A) tail length control in Saccharomyces cerevisiae occurs by message-specific deadenylation. Mol Cell Biol 18 , 6548-59. Brown, C. E., Tarun, S. Z., Jr., Boeck, R., and Sachs, A. B. (1996). PAN3 encodes a subunit of the Pablp-dependent poly(A) nuclease in Saccharomyces cerevisiae. Mol Cell Biol 16 , 5744-53.

PAGE 139

132 Butler, J. S., and Platt, T. (1988). RNA processing generates the mature 3' end of yeast CYCl messenger RNA in vitro. Science 242 , 1270-4. Butler, J.S., Sadhale, P. P., and Platt, T. (1990). RNA processing in vitro produces mature 3' ends of a variety of Saccharomyces cerevisiae mRNAs, Mol Cell Biol 10 , 2599-605. Caponigro, G., and Parker, R. (1995). Multiple functions for the poly(A)-binding protein in mRNA decapping and deadenylation in yeast. Genes Dev 9 , 2421-32. Carroll, S.M., Narayan, P., and Rottman, F. M. (1990). N6-methyladenosine residues in an intron-specific region of prolactin pre-mRNA, Mol Cell Biol 10 , 4456-65. Chapon, C., Cech, T. R., and Zaug, A. J. (1997). Polyadenylation of telomerase RNA in budding yeast, Rna 3 , 1 337-5 1 . Cho, E. J., Takagi, T., Moore, C. R., and Buratowski, S. (1997). mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev 11 , 3319-26. Choi, Y. D. and Dreyfiiss, G. (1984). Monoclonal antibody characterization of the C proteins of heterogeneous nuclear ribonucleoprotein complexes in vertebrate cells, J Cell Biol 99 , 197-204. Chou, M.Y., Underwood, J. G., Nikolic, J., Luu, M. H., and Black, D. L. (2000). Multisite RNA binding and release of polypyrimidine tract binding protein during the regulation of c-src neural-specific splicing. Mol Cell 5 , 949-57. Cleaver, O. B., Patterson, K. D., and Kreig, P. A. (1996). Isolation of Poly(A)+ RNA. In A laboratory guide to RNA Isolation, analysis and synthesis, P. A. Kreig, ed. (New York, NY, John Wiley & Sons, Inc.), pp. 51-63. Conrad-Webb, H., and Butow, R. A. (1995). A polymerase switch in the synthesis of rRNA in Saccharomyces cerevisiae, Mol Cell Biol 15 , 2420-8. Cooke, C., and Alwine, J. C. (1996). The cap and the 3' splice site similarly affect polyadenylation efficiency. Mol Cell Biol 16 , 2579-84. Cramer, P., Pesce, C. G., Baralle, F. E., and Komblihtt, A. R. (1997). Functional association between promoter structure and transcript alternative splicing, Proc Natl Acad SciUS A94, 11456-60. Cullen, B. R. (2000a). Connections between the processing and nuclear export of mRNA: evidence for an export license?, Proc Natl Acad Sci U S A 97 , 4-6. Cullen, B. R. (2000b). Nuclear RNA export pathways. Mol Cell Biol 20 , 4181-7.

PAGE 140

133 Dantonel, J. C., Murthy, K. G., Manley, J. L., and Tora, L. (1997). Transcription factor TFIID recruits factor CPSF for formation of 3' end of mRNA, Nature 389 , 399-402. Davis, C. A., Grate, L., Spingola, M., and Ares, M., Jr. (2000). Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28 , 1700-6. DeMaria, C. T., Sun, Y., Wagner, B. J., Long, L., and Brewer, G. A. (1997). Structural determination in AUFl required for high affinity binding to A + U-rich elements. Nucleic Acids Symp Ser 36 , 12-4. Dominski, Z., and Marzluff, W. F. (1999). Formation of the 3' end of histone mRNA, Gene 2iP, 1-14. Dreyfuss, G., Choi, Y. D., and Adam, S. A. (1984). Characterization of heterogeneous nuclear RNA-protein complexes in vivo with monoclonal antibodies. Mol Cell Biol 4 , 1104-14. Dreyfuss, G., Matunis, M.J., Pinol-Roma, S., and Burd, C.G. (1993). hnRNP Proteins and the Biogenesis of mRNA. In Annu. Rev. Biochem., pp. 289-321. Du, Q., Melnikova, I. N., and Gardner, P. D. (1998). Differential effects of heterogeneous nuclear ribonucleoprotein K on Spland Sp3 -mediated transcriptional activation of a neuronal nicotinic acetylcholine receptor promoter, J Biol Chem 273 , 19877-83. Duncan, K., Umen, J. G., and Guthrie, C. (2000). A putative ubiquitin ligase required for efficient mRNA export differentially affects hnRNP transport, Curr Biol 10 , 687-96. Duvel, K., and Braus, G. H. (1999). Different positioning elements select poly(A) sites at the 3'-end of GCN4 mRNA in the yeast Saccharomyces cerevisiae. Nucleic Acids Res 27 , 4751-8. Dye, M. J., and Proudfoot, N. J. (1999). Terminal exon definition occurs cotranscriptionally and promotes termination of RNA polymerase II, Mol Cell 3 , 371-8. Feng, H. C., Bhave, M., and Fairclough, R. J. (2000). Regulation of oxytocin receptor gene expression in sheep: tissue specificity, multiple transcripts and mRNA editing, J Reprod Fertil 120 , 187-200. Fischer, U., Meyer, S., Teufel, M., Heckel, C., Luhrmann, R., and Rautmann, G. (1994). Evidence that HIV1 Rev directly promotes the nuclear export of unspliced RNA, Embo J 73,4105-12. Flach, J., Bossie, M., Vogel, J., Corbett, A., Jinks, T., Willins, D. A., and Silver, P. A. (1994). A yeast RNA-binding protein shuttles between the nucleus and the cytoplasm. Mol Cell Biol 14 , 8399-407.

PAGE 141

134 Flaherty, S. M., Fortes, P., Izaurralde, E., Mattaj, 1. W., and Gilmartin, G. M. (1997). Participation of the nuclear cap binding complex in pre-mRNA 3' processing, Proc Natl Acad Sci U S A 94, 11893-8. Fontoura, B. M., Blobel, G., and Matunis, M. J. (1999). A conserved biogenesis pathway for nucleoporins: proteolytic processing of a 1 86-kilodalton precursor generates Nup98 and the novel nucleoporin, Nup96, J Cell Biol 144 , 1097-1 12. Ford, L. P., and Wilusz, J. (1999). An in vitro system using HeLa cytoplasmic extracts that reproduces regulated mRNA stability, Methods 17 , 21-7. Furuichi, Y., LaFiandra, A., and Shatkin, A. J. (1977). 5'-Terminal structure and mRNA stability. Nature 266 , 235-9. Ghisolfi, L., Kharrat, A., Joseph, G., Amalric, F., and Erard, M. (1992). Concerted activities of the RNA recognition and the glycine-rich C-terminal domains of nucleolin are required for efficient complex formation with pre-ribosomal RNA, Eur J Biochem 209 , 541-8. Gil, A., Sharp, P. A., Jamison, S. F., and Garcia-Bianco, M. A. (1991). Characterization of cDNAs encoding the polypyrimidine tract-binding protein. Genes Dev 5 , 1224-36. Gonzalez, C. I., Ruiz-Echevarria, M. J., Vasudevan, S., Henry, M. F., and Peltz, S. W. (2000). The yeast hnRNP-like protein Hrpl/Nab4 marks a transcript for nonsensemediated mRNA decay. Mol Cell 5, 489-99. Gorlich, D., and Kutay, U. (1999). Transport between the cell nucleus and the cytoplasm, Annu Rev Cell Dev Biol 15 , 607-60. Gozani, O., Patton, J. G., and Reed, R. (1994). A novel set of spliceosome-associated proteins and the essential splicing factor PSF bind stably to pre-mRNA prior to catalytic step II of the splicing reaction, Embo J 13 , 3356 61 . Greger, I. H., Aranda, A., and Proudfoot, N. (2000). Balancing transcriptional interference and initiation on the GAL7 promoter of Saccharomyces cerevisiae, Proc Natl Acad Sci U S A 97 , 8415-20. Groner, B., and Phillips, S. L. (1975). Polyadenylate metabolism in the nuclei and cytoplasm of Saccharomyces cerevisiae, J Biol Chem 250 , 5640-6. Gunderson, S. I., Beyer, K., Martin, G., Keller, W., Boelens, W. C., and Mattaj, L. W. (1994). The human UlA snRNP protein regulates polyadenylation via a direct interaction with poly(A) polymerase. Cell 75, 531-41. Guthne, C., and Fink, G. R. (1991). Guide to Yeast Genetics and Molecular Biology. (San Diego, CA., Academic Press).

PAGE 142

135 Hanun, J., and Mattaj, I. W. (1990). Monomethylated cap structures facilitate RNA export from the nucleus, Cell 63 , 109-18. Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K., and Elledge, S. J. (1993). The p21 Cdk-interacting protein Cipl is a potent inhibitor of G1 cyclindependent kinases. Cell 75, 805-16. Higgs, D. R., Goodboum, S. E., Lamb, J., Clegg, J. B., Weatherall, D. J., and Proudfoot, N. J. (1983). Alpha-thalassemia caused by a polyadenylation signal mutation. Nature 306 , 398-400. Hodges, P., and Scott, J. (1992). Apolipoprotein B mRNA editing: a new tier for the control of gene expression, Trends Biochem Sci 1 7, 77-8 1 . Huang, Y., and Carmichael, G. C. (1996). Role of polyadenylation in nucleocytoplasmic transport of mRNA, Mol Cell Biol 16 , 1534-42. lizuka, N., Najita, L., Franzusoff, A., and Samow, P. (1994). Cap-dependent and capindependent translation by internal initiation of mRNAs in cell extracts prepared from Saccharomyces cerevisiae. Mol Cell Biol 14 , 7322-30. Inoue, K., Ohno, M., Sakamoto, H., and Shimura, Y. (1989). Effect of the cap structure on pre-mRNA splicing in Xenopus oocyte nuclei. Genes Dev 3 , 1472-9. Imiger, S., Egli, C. M., and Braus, G. H. (1991). Different classes of polyadenylation sites in the yeast Saccharomyces cerevisiae. Mol Cell Biol 11 , 3060-9. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983). Transformation of intact yeast cells treated with alkali cations, J Bacteriol 153 , 163-8. Izaurralde, E., Lewis, J., McGuigan, C., Jankowska, M., Darzynkiewicz, E., and Mattaj, I. W. (1994). A nuclear cap binding protein complex involved in pre-mRNA splicing. Cell 78 , 657-68. Jacobson, A., and Pelts, S. W. (1996). Interrelationship of the pathways of mRNA decay and translation in eukaryotic cells, Annu Rev Biochem 65 , 693-739. Jarmolowski, A., Boelens, W. C., Izaurralde, E., and Mattaj, I. W. (1994). Nuclear export of different classes of RNA is mediated by specific factors, J Cell Biol 124 , 627-35. Jenny, A., Hauri, H. P., and Keller, W. (1994). Characterization of cleavage and polyadenylation specificity factor and cloning of its 1 00-kilodalton subunit. Mol Cell Biol 74,8183-90.

PAGE 143

136 Kataoka, N., Yong, J., Kim, N. V., Wang, F., and Dreyfoss, G. (2000). Pre-mRNA splicing imprints mRNA in the nucleus with a novel RNA-binding protein that persists in the cytoplasm. Molecular Cell 6, 673-682. Kessler, M. M., Henry, M. F., Shen, E., Zhao, J., Gross, S., Silver, P. A., and Moore, C. L. (1997). Hrpl, a sequence-specific RNA-binding protein that shuttles between the nucleus and the cytoplasm, is required for mRNA 3'-end formation in yeast. Genes Dev II, 2545-56. Kessler, M. M., Zhao, J., and Moore, C. L. (1996). Purification of the Saccharomyces cerevisiae cleavage/polyadenylation factor I. Separation into two components that are required for both cleavage and polyadenylation of mRNA 3' ends, J Biol Chem 271, 27167-75. Kiledjian, M., DeMaria, C. T., Brewer, G., and Novick, K. (1997). Identification of AUF 1 (heterogeneous nuclear ribonucleoprotein D) as a component of the alpha-globin mRNA stability complex [published erratum appears in Mol Cell Biol 1997 Oct;17(10):6202], Mol Cell Biol 17, 4870-6. Kim, E., Du, L., Bregman, D. B., and Warren, S. L. (1997). Splicing factors associate with hyperphosphorylated RNA polymerase II in the absence of pre-mRNA, J Cell Biol 126, 19-28. Kramer, A. (1995). The biochemistry of pre-mRNA splicing. In Pre-mRNA Processing, A. I. Lamond, ed. (Austin, TX, R.G. Landes Companu), pp. 35-55. Krecic, A. M. (1998) Nuclear and cytoplasmic functions of a yeast heterogeneous nuclear ribonucleoprotein. Doctor of Philosophy Dissertation, University of Florida College of Medicine, Gainesville, FL. Kwon, S., Barbarese, E., and Carson, J. H. (1999). The cis-acting RNA trafficking signal from myelin basic protein mRNA and its cognate trans-acting ligand hnRNP A2 enhance cap-dependent translation, J Cell Biol 147, 247-56. Lavi, U., Femandez-Munoz, R., and Darnell, J. E., Jr. (1977). Content of N-6 methyl adenylic acid in heterogeneous nuclear and messenger RNA of HeLa cells. Nucleic Acids Res 4, 63-9. Le, H., Tanguay, R. L., Balasta, M. L., Wei, C. C., Browning, K. S., Metz, A. M., Goss, D. J., and Gallic, D. R. (1997). Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity, J Biol Chem 272, 16247-55. Lee, M. S., Henry, M., and Silver, P. A. (1996). A protein that shuttles between the nucleus and the cytoplasm is an important mediator of RNA export. Genes Dev 10, 123346.

PAGE 144

137 Liber, M. (2000). Antibody diversity: A link between switching and hypermutation, Curr Biol 10 , 798-800. Lingner, J., Radtke, I., Wahle, E., and Keller, W. (1991). Purification and characterization of poly(A) polymerase from Saccharomyces cerevisiae, J Biol Chem 266 , 8741-6. Loflin, P., Chen, C. Y., and Shyu, A. B. (1999). Unraveling a cytoplasmic role for hnRNP D in the in vivo mRNA destabilization directed by the AU-rich element. Genes Dev 73, 1884-97. Long, R. M., Elliott, D. J., Stutz, F., Rosbash, M., and Singer, R. H. (1995). Spatial consequences of defective processing of specific yeast mRNAs revealed by fluorescent in situ hybridization, Rna 1 , 1071-8. Longacre, A. and Storb, U. (2000). A novel cytidine deaminase affects antibody diversity. Cell 102 , 541-4. Luo, M. J., and Reed, R. (1999). Splicing is required for rapid and efficient mRNA export in metazoans, Proc Natl Acad Sci U S A 96 , 14937-42. Lustig, A. J., Lin, R. J., and Abelson, J. (1986). The yeast RNA gene products are essential for mRNA splicing in vitro. Cell 47 , 953-63. Manley, J. L., and Tacke, R. (1996). SR proteins and splicing control. Genes Dev 10 , 1569-79. Markovtsov, V., Nikolic, J. M., Goldman, J. A., Turck, C. W., Chou, M. Y., and Black, D. L. (2000). Cooperative assembly of an hnRNP complex induced by a tissue-specific homolog of polypyrimidine tract binding protein. Mol Cell Biol 20 , 7463-79. Matunis, M. J., Michael, W. M., and Dreyfuss, G. (1992). Characterization and primary structure of the poly(C)-binding heterogeneous nuclear ribonucleoprotein complex K protein. Mol Cell Biol 12 , 1 64-7 1 . Mayeda, A., and Krainer, A. R. (1992). Regulation of alternative pre-mRNA splicing by hnRNP A1 and splicing factor SF2, Cell 68 , 365-75. McCracken, S., Fong, N., Rosonina, E., Yankulov, K., Brothers, G., Siderovski, D., Hessel, A., Foster, S., Shuman, S., and Bentley, D. L. (1997). 5'-Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II, Genes Dev 11 , 3306-18. Michelotti, E. F., Michelotti, G. A., Aronsohn, A. I., and Levens, D. (1996). Heterogeneous nuclear ribonucleoprotein K is a transcription factor. Mol Cell Biol 16 , 2350-60.

PAGE 145

138 Miller, J. W. (1998) Human triplet repeat RNA-binding proteins: Involvement in mRNA biogenesis and genetic disease, Doctor of Philosophy Dissertation, University of Florida College of Medicine, Gainesville, FL. Minvielle-Sebastia, L., Beyer, K., Krecic, A. M., Hector, R. E., Swanson, M. S., and Keller, W. (1998). Control of cleavage site selection during mRNA 3' end formation by a yeast hnRNP, Embo ] 17 , 7454-68. Minvielle-Sebastia, L., Preker, P. J., Wiederkehr, T., Strahm, Y., and Keller, W. (1997). The major yeast poly(A)-binding protein is associated with cleavage factor lA and functions in premessenger RNA 3'-end formation, Proc Natl Acad Sci U S A 94 7897902. Minvielle-Sebastia, L., Winsor, B., Bonneaud, N., and Lacroute, F. (1991). Mutations in the yeast RNA 14 and RNA 15 genes result in an abnormal mRNA decay rate; sequence analysis reveals an RNA-binding domain in the RNA15 protein. Mol Cell Biol 11 , 307587. Moore, C. L., Chen, J., and Whoriskey, J. (1988). Two proteins crosslinked to RNA containing the adenovirus L3 poly(A) site require the AAUAAA sequence for binding, Embo J 7, 3159-69. Morrissey, J. P., Deardorff, J. A., Hebron, C., and Sachs, A. B. (1999). Decapping of stabilized, polyadenylated mRNA in yeast pabl mutants. Yeast 15 , 687-702. Niwa, M., and Berget, S. M. (1991). Mutation of the AAUAAA polyadenylation signal depresses in vitro splicing of proximal but not distal introns. Genes Dev 5, 2086-95. Niwa, M., Rose, S. D., and Berget, S. M. (1990). In vitro polyadenylation is stimulated by the presence of an upstream intron. Genes Dev 4 , 1552-9. Ohno, M., Fomerod, M., and Mattaj, I. W. (1998). Nucleocytoplasmic transport: the last 200 nanometers. Cell 92 , 327-36. Ohno, M., Kataoka, N., and Shimura, Y. (1990). A nuclear cap binding protein from HeLa cells. Nucleic Acids Res 18 , 6989-95. Ostareck, D. H., Ostareck-Lederer, A., Wilm, M., Thiele, B. J., Mann, M., and Hentze, M. W. (1997). mRNA silencing in erythroid differentiation: hnRNP K and hnRNP El regulate 15-lipoxygenase translation from the 3' end. Cell 89 , 597-606. Pinol-Roma, S., Choi, Y. D., Matunis, M. J., and Dreyfuss, G. (1988). Immunopurification of heterogeneous nuclear ribonucleoprotein particles reveals an assortment of RNA-binding proteins [published erratum appears in Genes Dev 1988 Apr;2(4):490, Genes Dev 2 , 215-27.

PAGE 146

139 Piper, P. W., and Aamand, J. L. (1989). Yeast mutation thought to arrest mRNA transport markedly inereases the length of the 3' poly(A) on polyadenylated RNA, J Mol Biol 208 , 697-700. Proudfoot, N. (2000). Connecting transcription to messenger RNA processing, Trends Biochem Sci 25 , 290-3. Proudfoot, N. J. (1989). How RNA polymerase II terminates transcription in higher eukaryotes. Trends Biochem Sci 14 , 105-10. Rasmussen, E. B., and Lis, J. T. (1993). In vivo transcriptional pausing and cap formation on three Drosophila heat shock genes, Proc Natl Acad Sci U S A 90 , 7923-7. Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. (1999). A generic protein purification method for protein complex characterization and proteome exploration, Nat Biotechnol 17 , 1030-2. Roberts, C. G., Gooding, C., Mak, H. Y., Proudfoot, N. J., Smith, C. W. (1998). Cotranscriptional commitment to alternative splice site selection. Nucleic Acids Res 26 , 5568-72. Rose, M. D., Winston, F., and Hieter, P. (1990). Methods in Yeast Genetics. A Laboratory Course Manual (Cold Spring Harbor, NY, Cold Spring Harbor Laboratory press). Rout, M. P., and Blobel, G. (1993). Isolation of the yeast nuclear pore complex, J Cell Biol 123 , 771-83. Rout, M. P., Blobel, G., and Aitchison, J. D. (1997). A distinct nuclear import pathway used by ribosomal proteins. Cell 89 , 715-25. Rueter, S.M., Dawson, T.R., and Emeson, R.B. (1999). Regulation of alternative splicing by RNA editing. Nature 399 , 75-80. Russo, P., Li, W. Z., Guo, Z., and Sherman, F. (1993). Signals that produce 3' termini in CYCl mRNA of the yeast Saccharomyces cerevisiae. Mol Cell Biol 13 , 7836-49. Ryan, K. J., and Wente, S. R. (2000). The nuclear pore complex: a protein machine bridging the nucleus and cytoplasm, Curr Opin Cell Biol 12 , 361-71. Rymond, B. C., and Rosbash, M. (1992). Yeast pre-mRNA splicing. In The molecular and cellular biology of the yeast Saccharomyces, E. W. Jones, J. R. Pringle, and J. R. Broach, eds. (Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press), pp. 143192.

PAGE 147

140 Saavedra, C. A., Hammell, C. M., Heath, C. V., and Cole, C. N. (1997). Yeast heat shock mRNAs are exported through a distinct pathway defined by Riplp, Genes Dev 11 , 284556. Sachs, A. B., Bond, M. W., and Komberg, R. D. (1986). A single gene from yeast for both nuclear and cytoplasmic polyadenylatebinding proteins: domain structure and expression. Cell 45 , 827-35. Sachs, A. B., and Davis, R. W. (1989). The poly(A) binding protein is required for poly(A) shortening and 60S ribosomal subunit-dependent translation initiation. Cell 58 , 857-67. Sachs, A. B., and Komberg, R. D. (1985). Nuclear polyadenylate-binding protein. Mol Cell Biol 5, 1993-6. Sachs, A. B., and Varani, G. (2000). Eukaryotic translation initiation: there are (at least) two sides to every story, Nat Stmct Biol 7, 356-61. Salditt-Georgieff, M., Harpold, M., Chen-Kiang, S., and Darnell, J. E., Jr. (1980a). The addition of 5' cap stmctures occurs early in hnRNA sjmthesis and prematurely terminated molecules are capped. Cell 19 , 69-78. Salditt-Georgieff, M., Harpold, M., Sawicki, S., Nevins, J., and Darnell, J. E., Jr. (1980b). Addition of poly(A) to nuclear RNA occurs soon after RNA synthesis, J Cell Biol 86 , 844-8. Sambrook, J., Fritsch, E., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press). Santos-Rosa, H., Moreno, H., Simos, G., Segref, A., Fahrenkrog, B., Pante, N., and Hurt, E. (1998). Nuclear mRNA export requires complex formation between Mex67p and Mtr2p at the nuclear pores. Mol Cell Biol 18 , 6826-38. Segref, A., Sharma, K., Doye, V., Hellwig, A., Huber, J., Luhrmann, R., and Hurt, E. (1997). Mex67p, a novel factor for nuclear mRNA export, binds to both poly(A)+ RNA and nuclear pores, Embo J 16 , 3256-71. Sharma, P. M., Bowman, M., Madden, S. L., Rauscher, F. J., 3rd, and Sukumar, S. (1994). RNA editing in the Wilms' tumor susceptibility gene, WTl, Genes Dev 8 , 72031. Shatkin, A. J. (1976). Capping of eukaryotic mRNAs, Cell 9 , 645-654. Sheets, M. D., and Wickens, M. (1989). Two phases in the addition of a poly(A) tail. Genes Dev 3, 1401-12.

PAGE 148

141 Shimotohno, K., Kodama, Y., Hashimoto, J., and Miura, K. I. (1977). Importance of 5'terminal blocking structure to stabilize mRNA in eukaryotic protein synthesis, Proc Natl Acad Sci U S A 74 , 2734-8. Shyu, A. B., and Wilkinson, M. F. (2000). The double lives of shuttling mRNA binding proteins. Cell 102 , 135-8. Sierakowska, H., Szer, W., Furdon, P. J., and Kole, R. (1986). Antibodies to hnRNP core proteins inhibit in vitro splicing of human beta-globin pre-mRNA, Nucleic Acids Res 14 , 5241-54. Sikorski, R. S., and Boeke, J. D. (1991). In vitro mutagenesis and plasmid shuffling: from eloned gene to mutant yeast. Methods Enzymol 194 , 302-18. Simpson, L., and Shaw, J. (1989). RNA editing and the mitoehondrial cryptogenes of kinetoplastid protozoa. Cell 57 , 355-66. Siomi, H., Matunis, M. J., Michael, W. M., and Dreyfliss, G. (1993). The pre-mRNA binding K protein contains a novel evolutionarily conserved motif, Nucleie Aeids Res 21 , 1193-8. Sommer, B., Kohler, M., Sprengel, R., and Seeburg, P. H. (1991). RNA editing in brain eontrols a determinant of ion flow in glutamategated channels. Cell 67 , 1 1-9. Steege, D. A. (2000). Emerging features of mRNA decay in bacteria, Rna 6 , 1 079-90. Straser, K., Basler, J., and Hurt, E. (2000). Binding of the Mex67p/Mtr2p Heterodimer to FXFG, GLFG, and FG Repeat Nucleoporins Is Essential for Nuelear mRNA Export, J Cell Biol 150 , 695-706. Strasser, K., and Hurt, E. (2000). Yralp, a conserved nuelear RNA-binding protein, interacts directly with Mex67p and is required for mRNA export, Embo 1 19 , 410-20. Strathem, J. N., and Higgins, D. R. (1991). Recovery of plasmids from yeast into Escherichia coli: shuttle vectors. Methods Enzymol 194 , 319-29. Stutz, F., Baehi, A., Doerks, T., Braun, I. C., Seraphin, B., Wilm, M., Bork, P., and Izaurralde, E. (2000). REF, an evolutionary conserved family of hnRNP-like proteins, internets with TAP/Mex67p and participates in mRNA nuclear export, Rna 6 , 638-50. Stutz, F., and Rosbash, M. (1998). Nuclear RNA export. Genes Dev 12 , 3303-19. Sun, X., Alzhanova-Ericsson, A. T., Visa, N., Aissouni, Y., Zhao, J., and Daneholt, B. (1998). The hrp23 protein in the balbiani ring pre-mRNP particles is released just before or at the binding of the partieles to the nuclear pore complex, J Cell Biol 142 , 1 181-93.

PAGE 149

142 Swanson, M. S. (1995). Functions of Nuclear Pre-mRNA/mRNA Binding Proteins. In Pre-mRNA Processing, A. I. Lamond, ed. (Austin, Texas, R.G. Landes Company), pp. 17-33. Swanson, M. S., and Dreyfuss, G. (1988). RNA binding specificity of hnRNP proteins: a subset bind to the 3' end of introns, Embo J 7, 3519-29. Tarun, S. Z., Jr., and Sachs, A. B. (1996). Association of the yeast poly(A) tail binding protein with translation initiation factor eIF-4G, Embo J 15, 7168-77. Tarun, S. Z., Jr., Wells, S. E., Deardorff, J. A., and Sachs, A. B. (1997). Translation initiation factor eIF4G mediates in vitro poly(A) taildependent translation, Proc Natl Acad Sci U S A 94, 9046-5 1 . Tollervey, D. and Caceres, J.F. (2000). RNA processing marches on. Cell 103, 703-709. Truant, R., Fridell, R. A., Benson, R. E., Bogerd, H., and Cullen, B. R. (1998). Identification and functional characterization of a novel nuclear localization signal present in the yeast Nab2 poly(A)^ RNA binding protein. Mol Cell Biol 18, 1449-58. Uetz, P., Giot, L., Cagney, G., Mansfield, T. A., Judson, R. S., Knight, J. R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., et al. (2000). A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature 403, 623-7. van der Houven van Oordt, W., Diaz-Meco, M. T., Lozano, J., Krainer, A. R., Moscat, J., and Caceres, J. F. (2000). The MKK(3/6)-p3 8-signaling cascade alters the subcellular distribution of hnRNP Al and modulates alternative splicing regulation, J Cell Biol 149, 307-16. van Hoof, A., Lennertz, P., and Parker, R. (2000). Yeast exosome mutants accumulate 3'extended polyadenylated forms of U4 small nuclear RNA and small nucleolar RNAs, Mol Cell Biol 20, 441-52. Visa, N., Alzhanova-Ericsson, A. T., Sun, X., Kiseleva, E., Bjorkroth, B., Wurtz, T., and Daneholt, B. (1996). A pre-mRNA-binding protein accompanies the RNA from the gene through the nuclear pores and into polysomes. Cell 84, 253-64. Wahle, E., and Keller, W. (1996). The biochemistry of polyadenylation. Trends Biochem Sci 21, 247-50. Wang, Q., Khillan, J., Gadue, P., and Nishikura, K. (2000). Requirement for the RNA editing deaminase ADARl gene for embryonic erythropoiesis. Science 290, 1765-8 Weighardt, F., Biamonti, G., and Riva, S. (1996). The roles of heterogeneous nuclear ribonucleoproteins (hnRNP) in RNA metabolism. Bioessays 18, 747-56.

PAGE 150

143 Wilk, H. E., Werr, H., Friedrich, D., Kiltz, H. H., and Schafer, K. P. (1985). The core proteins of 35S hnRNP complexes. Characterization of nine different species, Eur J Biochem 146 , 71-81. Wilson, S. M. (1996) Functional analysis of a heterogeneous nuclear ribonucleoprotein in vivo.. Doctor of Philosophy Dissertation, University of Florida College of Medicine Gainesville, FL. Wilson, S. M., Datar, K. V., Paddy, M. R., Swedlow, J. R., and Swanson, M. S. (1994). Characterization of nuclear polyadenylated RNA-binding proteins in Saccharomyces cerevisiae, J Cell Biol 127 , 1173-84. Wilusz, J., Shenk, T., Takagaki, Y., and Manley, J. L. (1990). A multicomponent complex is required for the AAUAAA-dependent crosslinking of a 64-kilodalton protein to polyadenylation substrates. Mol Cell Biol 10 , 1244-8. Yonaha, M., and Proudfoot, N. J. (2000). Transcriptional termination and coupled polyadenylation in vitro, Embo J 19 , 3770-7. Yue, Z., Maldonado, E., Pillutla, R., Cho, H., Reinberge, D., and Shatkin, A. J. (1997). Mammalian capping enzyme complements mutant Saccharomyces cerevisiae lacking mRNA guanylyltransferase and selectively binds the elongating for of RNA polymerase II., Proc Natl Acad Sci U S A 94 , 12898-12903. Yuryev, A., Patturajan, M., Litingtung, Y., Joshi, R. V., Gentile, C., Gebara, M., and Corden, J. L. ( 1 996). The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginine-rich proteins, Proc Natl Acad Sci U S A Pi 6975-80. Zhao, J., Hyman, L., and Moore, C. (1999). Formation of mRNA 3' ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis, Microbiol Mol Biol Rev 63 , 405-45. Zhao, J., Kessler, M. M., and Moore, C. L. (1997). Cleavage factor II of Saccharomyces cerevisiae contains homologues to subunits of the mammalian Cleavage/ polyadenylation specificity factor and exhibits sequence-specific, ATP-dependent interaction with precursor RNA, J Biol Chem 272 , 10831-8. Zhelkoysky, A., Helmling, S., and Moore, C. (1998). Processivity of the Saccharomyces cerevisiae poly(A) polymerase requires interactions at the carboxyl-terminal RNA binding domain. Mol Cell Biol 18 , 5942-51. Zhou, Z., Luo, M. J., Straesser, K., Katahira, J., Hurt, E., and Reed, R. (2000). The protein Aly links pre-messenger-RNA splicing to nuclear export in metazoans. Nature 407,401-5.

PAGE 151

BIOGRAPHICAL SKETCH Ronald E. Hector was bom in Amherst, Ohio, on April 26, 1 972, and raised in Vermilion, Ohio. He is the second oldest of four sons bom to Rick E. Hector and Nancy D. Hector. Ron attended Ohio University Russ College of Engineering and Technology from 1990-1995, where he received a Bachelor of Science degree in chemical engineering. During the latter part of his undergraduate studies, Ron also worked in Research and Development for E.I. du Pont de Nemours and Company at its Washington Works site in Parkersburg, WV. In August of 1 995, Ron married Michelle L. Boepple and moved to Gainesville, Florida, to start graduate school at the University of Florida College of Medicine in the Department of Molecular Genetics and Microbiology. On April 4, 2000, he and his wife were blessed with a baby girl named Elizabeth Marie. He completed his thesis under the guidance of Dr. Maurice S. Swanson, and received his doctorate in December 2000. 144

PAGE 152

I certify that I have read this study and that in my opinion it conforms to acceptable standard of scholarly presentation and is fully adequate, in scope quality, as a dissertation for the degree of Doctor of Philosophy. Maurice S. Swanson, Chair Associate Professor of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable standard of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Henry V. Baker Associate Professor of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable standard of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. James B. Flanegan(_y Professor and Chairman of Biochemistry and Molecular Biology I certify that I have read this study and that in my opinion it conforms to acceptable standard of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. 1 u 1 in R / Alfred $/ ) Professor of Molecular Genetics and Microbiology I certify that 1 have read this study and that in my opinion it conforms to acceptable standard of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. ^ ^ Carl M. Feldherr Professor of Anatomy and Cell Biology

PAGE 153

This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate School and was accepted as partial fulfillment of the degree of Doctor of Philosophy. December, 2000 Dean, College of Medicine Dean, Graduate School