Citation
A Study on the isolation, localization and regulation of carbonic anhydrase, using the zebrafish and chicken retina as model systems

Material Information

Title:
A Study on the isolation, localization and regulation of carbonic anhydrase, using the zebrafish and chicken retina as model systems
Creator:
Peterson, Robert Earl, 1970-
Publication Date:
Language:
English
Physical Description:
x, 91 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Cells ( jstor )
Complementary DNA ( jstor )
Drosophila ( jstor )
Genomics ( jstor )
Introns ( jstor )
Neuroglia ( jstor )
Neurons ( jstor )
Retina ( jstor )
Sequencing ( jstor )
Vertebrates ( jstor )
Amino Acid Sequence ( mesh )
Base Sequence ( mesh )
Carbonic Anhydrases -- genetics ( mesh )
Carbonic Anhydrases -- isolation & purification ( mesh )
Carbonic Anhydrases -- physiology ( mesh )
Chickens ( mesh )
Department of Anatomy and Cell Biology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Anatomy and Cell Biology -- UF ( mesh )
Gene Expression Regulation ( mesh )
Molecular Sequence Data ( mesh )
Neuroglia -- chemistry ( mesh )
Research ( mesh )
Retina ( mesh )
Zebrafish ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Bibliography: leaves 75-90.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Robert Earl Peterson.

Record Information

Source Institution:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
029076158 ( ALEPH )
50917336 ( OCLC )

Downloads

This item has the following downloads:


Full Text









A STUDY ON THE ISOLATION, LOCALIZATION AND REGULATION OF
CARBONIC ANHYDRASE, USING THE ZEBRAFISH AND CHICKEN RETINA AS MODEL SYSTEMS












By

ROBERT EARL PETERSON


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY


UNIVERSITY OF FLORIDA








ACKNOWLEDGMENTS


I would like to acknowledge those who assisted me in my dissertation research. My mentor, Dr. Paul J. Linser, taught me nearly all the non-DNA-based techniques (and some of the DNA-based ones) I know. Dr. Chingkuang Tu performed carbonic anhydrase rate reactions. Dr. James M. Fadool and Dr. John Schetz gave me valuable troubleshooting advice for SDS-PAGE and Western blot analyses. Dr. Robert M. Greenberg, Dr. Sean M. Boyle, Dr. Gary J. LaFleur, and Dr. Michael C. Jeziorski aided me with protocols and advice during the cloning of zebrafish carbonic anhydrase. Dr. David Hewett-Emmett provided valuable assistance through many e-mail discussions concerning carbonic anhydrase phylogeny. The chicken promoter work presented was aided by protocols from Dr. Russell Buono. The zebrafish PAC clones used in this dissertation were isolated from a filtered array library that was the kind gift of Matthew Clark. All the figures and photos in this dissertation were produced by, fixed by, or discussed with Lynn Milstead and James Netherton.

Through my years at The Whitney Lab, there have been many people who have provided me with hours of scientific discussion. Dr. Robert Greenberg, Dr. W. Clay Smith, Dr. James M. Fadool, Dr. William R. Buzzi, Rana Lewis, and Luther Dunlap have all provided me with invaluable technical advice. I am greatly indebted to several "gradstudent-type" scientists who helped me along in my scientific and personal maturation through many late-night, coffee-laden discussions, they are: Dr. Sean Boyle, Dr. Gary LaFleur, and Dr. John Schetz (who only drinks Tab, but is still OK). My life outside the lab would have been largely impossible had it not been for the help of Billy Raulerson and Bob Birkett.

I would like to acknowledge and thank my committee for their patience and

guidance: Dr. William Dunn, Dr. Paul Hargrave, Dr. William Hauswirth, Dr. W. Clay Smith, and my mentor, Dr. Paul J. Linser. I would like to additionally thank Paul for his









tutelage and guidance through the years. I have long measured my progress against the yardstick of his knowledge. Along the same vein I must thank Dr. Roger McPherson, my undergraduate advisor at Clarion University of Pennsylvania, who supported me when my record didn't.

Lastly, I would like to thank those who are truly responsible for my being where I am, my family; William Earl Peterson, Jane Eleanor Peterson, William Haller Peterson, and Candace Denise Peterson. Through the years I have always been able to count on their love and support.














TABLE OF CONTENTS

PageACKNOWLEDGMENTS ...............................................................................................iiage

A B BR EVIA TION S ...................................................................................................vii

ABSTBREVIATIONS ............................................................................................................. i

ABSTGENERAL INT RODUCTION........ ........................................................................................ 1
GENERAL INTRODUCTION............................................................1.
Differentiation During Development ............................................................................... I
Glia and Neurons, the Functional Unit of the Nervous System.........................................2
Differentiation of Glia and Neurons from a Common Neuroglioblast...........................2
G lia Function .............................................................................................................. 7
The role of glia in axonal migration during late neural development.........................8
The function of glia in fully developed nervous tissue..............................................9
Introduction to Carbonic Anhydrase .............................................................................10
The Carbonic Anhydrase Gene Families .................................................................... 10
Functional Role of Carbonic Anhydrases ................................................................... 11
Carbonic anhydrase's physiological role ................................................................ 11
Function of carbonic anhydrase in the neural retina................................................ 11
Carbonic Anhydrase Gene Regulation........................................................................... 13
Hypothesis of this Research .......................................................................................... 14
CARBONIC ANHYDRASE PROTEIN ISOLATION, CDNA SEQUENCING, AND PHYLOGENY IN THE ZEBRAFISH..........................................................................16
Introduction and Data Summary ................................................................................... 16
M aterials and M ethods.................................................................................................. 17
Zebrafish Colony Maintenance.................................................................................. 17
Ygrification and Peptide Sequencing of Carbonic Anhydrase from Zebrafish.............. 18
O - Exchange K inetics........................................................................................... 19
Cloning of the Carbonic Anhydrase Homologue from Zebrafish ................................20
Sequencing the cDNA for Zebrafish Carbonic Anhydrase..........................................21
Isozyme Determination Through Sequence Analysis and Phylogeny ..........................21
N orthern Blot A nalysis.............................................................................................. 22
R esults...........................................................................................................................2 3
Carbonic Anhydrase Isolation and Protein Sequence .................................................23
Sequencing the cDNA for Zebrafish Carbonic Anhydrase..........................................26
N orthern Blot A nalysis.............................................................................................. 28
Isozyme Family Determination Through Sequence Analysis and Phylogeny...............29








Discussion ..................................................................................................................... 30
THE EXPRESSION PATTERN OF A ZEBRAFISH CARBONIC ANHYDRASE HOM OLOGUE IN THE RETIN A ............................................................................... 34
Introduction and Data Summ ary ................................................................................... 34
M aterials and M ethods.................................................................................................. 35
Zebrafish Colony M aintenance and Breeding.............................................................35
Gel Electrophoresis................................................................................................... 36
Tissue Processing and Im m unohistochem istry ........................................................... 37
Results...........................................................................................................................38
W estern Blot Analysis...............................................................................................38
Cellular Localization in the Retina.............................................................................38
Adult .....................................................................................................................39
M arginal zone .......................................................................................................41
Day 1 .....................................................................................................................41
Day 2.5..................................................................................................................42
Day 3.....................................................................................................................43
Day 3.5..................................................................................................................44
Discussion .....................................................................................................................44
ZEBRAFISH GENOMIC CLONE ISOLATION AND PARTIAL SEQUENCING AND INTRON/EXON BOUNDARY CLONING AND SEQUENCING...............................48
Introduction and Data Sum m ary ...................................................................................48
Prom oters in Gene Regulation...................................................................................48
M aterials and M ethods..................................................................................................51
Cloning CAH-Z Introns Through PCR ...................................................................... 51
Isolation of Zebrafish PAC Clones ............................................................................51
Promoter-Reporter Plasmid Construction and Purification.........................................53
Cell Culture of Retina Aggregates, Patched Lens Epithelium and Chicken Embryonic
Fibroblast Cells .........................................................................................................54
Transfection Procedure in Cell Cultures ....................................................................55
Tissue Fixation and Imm unohistochem istry ...............................................................56
Statistics ................................................................................................................... :57
Results........................................................................................................................... 57
Isolation of CAH-Z Genom ic Clones.........................................................................57
Intron Cloning by PCR..............................................................................................58
Comparative Analysis of CAH-Z Genomic Sequence ................................................59
Testing the Chig Constructs in Defined Cell Cultures ................................................ 60
Testing Mfiller-Cell Specific Expression in Retina Aggregate Cultures......................61
Discussion .....................................................................................................................62
GEN ERAL RESULTS AN D DISCU SSION ................................................................ 67

APPENDIX - GENOMIC SEQUENCE FROM J026 AND SUBCLONES B239 AND B 176 .............................................................................................................................71








BIBLIOGRAPHY .........................................................................................................75

BIOGRAPHICAL SKETCH .........................................................................................91








ABBREVIATIONS


BCL bootstrapping confidence levels CA carbonic anhydrase CA-I carbonic anhydrase I CAH-Z carbonic anhydrase homologue from zebrafish CEF chicken embryonic fibroblast CO2 carbon dioxide DCAH Drosophila melanogaster carbonic anhydrase homologue DNA deoxyribonucleic acid Endo-LC endoproteinase lysine C GPI glycosylphosphatidylinositol GS glutamine synthetase HCA human carbonic anhydrase HCO3" bicarbonate hpf, dpf hours (days) post-fertilization HNK-1 human natural killer 1 ilm inner limiting membrane inl inner nuclear layer IOP intraocular pressure ipl inner plexiform layer kDa, Da (kilo)Daltons MC Miller cell NMDA N-methyl-D-aspartate olm outer limiting membrane onl outer nuclear layer opl outer plexiform layer pCA plasmid containing carbonic anhydrase PLE patched lens epithelial RACE rapid amplification of cDNA ends RNA ribonucleic acid








SDS sodium dodecyl sulfate TBE Tris-Borate + EDTA buffer TSCA tiger shark carbonic anhydrase Pg microgram jiL microliter PM micrometer









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy



A STUDY ON THE ISOLATION, LOCALIZATION AND REGULATION OF
CARBONIC ANHYDRASE, USING THE ZEBRAFISH AND CHICKEN RETINA AS MODEL SYSTEMS

By

Robert Earl Peterson
May, 1998

Chairman: Dr. Paul J. Linser
Major Department: Department of Anatomy & Cell Biology

I am investigating carbonic anhydrase as a gene expressed specifically in Miller glial cells (MC). Carbonic anhydrase (CA) catalyzes the interconversion of CO2 to HCO3. A high-activity CA enzyme is found in the cytoplasm of all vertebrate MCs. Understanding the regulatory mechanisms necessary for MC-specific expression of CA might elucidate general mechanisms involved in glial cell differentiation.
Using CA-inhibitor-based affinity chromatography, a single protein was isolated. The protein was characterized by both direct peptide-sequence and enzymatic rate analyses as a high-activity carbonic anhydrase homologue (CAH-Z).
CAH-Z's cellular localization was determined using immunohistochemistry. A polyclonal antiserum, produced against purified CAH-Z, recognized a single band of 29,000 Daltons by Western blot analysis. The antiserum specifically stained the MCs in the adult retina. No CAH-Z staining was present during development until 72 hours postfertilization (hpf); expression at this time was found only in MCs. Thus, CAH-Z expression in the retina occurred only in the MCs. MC-differentiation was also followed using an additional marker, the HNK-1 carbohydrate epitope. HNK-1 staining was









observed as early as 48 hpf, and by 60 hpf was clearly present on radial cells. These same cells express the CAH-Z protein after 72 hpf.

A cDNA sequence was determined for CAH-Z. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used to clone the cDNA. Three sets of overlapping RTPCR reactions were carried out to clone the cDNA. The clones were sequenced and aligned to determine the cDNA sequence. Translating the cDNA resulted in an open reading frame of 260 amino acids that showed greater than 50% identity to vertebrate CAs. Phylogenetic analysis suggested that CAH-Z was a novel isoform; specifically, the results suggested that CAH-Z shared a common ancestor with the mammalian CA-I, CAII, and CA-Ill genes.

A genomic clone containing CAH-Z sequence was isolated using a PAC library. The clone was subcloned and two fragments of 5.0 and 2.3 kb were isolated. The preliminary sequence is presented.

As a preliminary test of the regulatory mechanisms responsible for MC-specific expression, a chicken CA-II promoter was tested for the ability to drive MC-specific expression in a retina culture system. The 1376 basepair proximal 5' promoter showed no MC-specificity.













CHAPTER 1
GENERAL INTRODUCTION


Differentiation During Development

The term development refers to the processes through which a single-celled zygote gives rise to an organism. The processes responsible generally take place during embryogenesis, although development continues during post-embryonic stages. Vertebrate embryogenesis can be divided into four phases; cleavage, gastrulation, neurulation, and organogenesis (Gilbert, 1994). During cleavage, the single-celled zygote divides into a number of smaller cells, called blastomeres. In gastrulation, cell rearrangements rearrange the blastomeres into three cell-layers; the ectoderm, the mesoderm and the endoderm. The ectoderm then involutes during neurulation to form the neural tube, from which all neural tissues will develop. During organogenesis, most cells differentiate from pluripotent blast cells into mature cell-types, giving rise to functional organs. Successful development results in a viable animal emerging into the world.

Organogenesis revolves around the transformation of pluripotent blast cells into terminally differentiated cells (Davidson, 1993; Davidson, 1990). One marker of terminal differentiation is the expression of cell-specific proteins. Which proteins are present, and how they interact with other molecules, defines the function of a cell. Whether a protein is present in only one cell-type, or in many cell-types, varies according to its regulation. A protein' s expression is regulated, in most cases, at the transcriptional level through a series of cis-regulatory elements. The cis-regulatory elements are DNA sequences that are bound by trans-acting transcription factors. Transcription factors activate or repress a gene's expression.









A "gene battery", as defined by Davidson, contains genes which are coordinately regulated (Arnone and Davidson, 1997). The gene's in a gene-battery can have many of the same transcription factors binding their cis-regulatory modules (Davidson, 1993). The binding of transcription factors to cis-regulatory modules regulates the correct up- and down-regulation of gene-batteries during development; the result of this regulation is celldifferentiation.

The process of cell-differentiation in neural glia is the focus of this dissertation. The neural retina contains both glia and neurons that sometimes differentiate from a common neuroglioblast (Cepko et al. 1996; Cepko, 1993; Fekete et al. 1994; Wetts and Fraser, 1988). The neural retina contains six neural cell types: photoreceptors (sensory neurons); amacrine neurons, horizontal neurons, and bipolar neurons (retinal interneurons); ganglion neurons (retinal, output inter-neurons); and the Miller cells (MC; primary glial cell). Vision is crucially dependent on the correct spatial placement and connection of glia and neurons in the retina. The fact that glia and neurons arise from a common precursor, and will function in a complementary manner, poses an interesting question that is central to the study of development. What forces a pluripotent blast cell to become only one of many possible mature cell-types?

Glia and Neurons, the Functional Unit of the Nervous System Differentiation of Glia and Neurons from a Common Neuroglioblast

Glia and neurons together comprise the functional unit of the nervous system. These two cell-types work together in a complementary fashion to process neural information correctly. Both glia and neurons can arise from a neuroglioblast in vertebrates and those invertebrates studied to date (Fredieu and Mahowald, 1989; Udolph et al. 1993; Bossing et al. 1996; Bossing and Technau, 1994; Soula et al. 1993; Leber et al. 1990; Galileo et al. 1990; Gray and Sanes, 1992; Gray et al. 1988; Wetts and Fraser, 1988; Wetts et al. 1989; Turner et al. 1990; Turner and Cepko, 1987; Holt et al. 1988).









Therefore, a mechanism exists which influences an undifferentiated neuroglioblast into one of the two fates. To understand what controls glial or neuronal differentiation, we must understand these mechanisms at the level of the cis-regulatory elements.

Development takes place through a cascade of regulation, beginning with maternal factors, which activate or repress zygotic genes and ending with cell-specific expression of peripheral genes. Drosophila melanogaster (Drosophila) has been a useful model for identifying high-level regulatory genes through mutation analysis. High-level regulatory genes are generally early-acting transcription factors involved in pattern formation or the differentiation of whole tissues through the regulation of other transcription factors (Gray et al. 1995). They do not, generally, regulate peripheral gene expression.

The expression of a single high-level gene can control glial cell differentiation in Drosophila. Glial cells in Drosophila play a critical role in axonal migration (Klambt and Goodman 1991). Mutant screens for axonal migration defects identified several genes (Jacobs 1993). One isolated mutant contained no glial cells; this mutant was named glial cells missing (gcm; Hosoya et al. 1995; Jones et al. 1995). The gcm gene encodes a transcription factor, which showed no homology to other known proteins, and that bound a unique DNA sequence (Schreiber et al. 1997). Two experimental results show that gcm is both necessary and sufficient for glia differentiation. The absence of gcm proteins, in the mutant fruit fly, resulted in a complete loss of glial cells in the CNS or PNS. Conversely, over- or misexpression of the gcm protein forced cells that normally become neurons to differentiate into glia. Thus, gcm appears to be necessary and sufficient for glial cell differentiation.
The next known step in glial differentiation occurs through two parallel pathways downstream of gcm. The one pathway involves two Ets-type transcription factors from the pointed locus (pntPl andpntP2), which are expressed in a coordinate fashion in all Drosophila CNS glial cells (Hummel et al. 1997; Klambt, 1993). The misexpression of pntPI in neurons forces them to express glial-cell genes. However, while the loss ofpnt









expression decreases the number of glial cells, it does not eliminate them. Therefore, whilepnt is necessary for the expression of some glial genes, it is not sufficient for glial differentiation. This suggests that pnt is downstream of gcm. The other pathway downstream of gcm compliments thepnt pathway and is controlled by the tramtrack (ttk) transcription factor (Giesen et al. 1997). The ttk transcription factor ttkp69 is a repressor found in all non-neuronal CNS cells (Badenhorst et al. 1996; Campos-Ortega, 1996; Harrison and Travers, 1990). Mutant ttk embryos contain 20% fewer lateral glial cells and their midline glia cannot migrate or differentiate properly. Cells that normally become neurons but misexpress ttk, on the other hand, have reduced neuronal marker expression. These experiments suggest ttk' s normal role is to block neuronal differentiation. That is, some cells that would normally differentiate into glia become neurons when ttk is removed. Mutants for eitherpnt or ttk do not disrupt expression of the other gene, and double mutants have an additive phenotypic effect, suggesting they are parallel pathways. It appears that gcm acts to up-regulates glial genes through pnt, and represses neural genes through ttk; a combination of these two pathways is necessary for glia development (Figure 1.1).

Several pieces of evidence suggest that gcm might function in vertebrates. A mammalian gcm homologue (Gcml) has recently been cloned and sequenced. At this point, no functional analysis has been reported. The Drosophila gcm protein binds a specific DNA sequence that is unique among transcription factors. Addition of this sequence to heterologous promoters resulted in activation of a reporter gene in a mammalian cell line (Schreiber et al 1997). A search of the mammalian DNA database shows the presence of this specific sequence. While these two pieces of data are circumstantial, given the conservation of other Drosophila pathways in various developmental processes (Marigo et al. 1996; Marigo and Tabin, 1996), it seems possible that the gcm pathway does exist in vertebrates, and that it could play a role in glia differentiation. However, even if gcm functions in vertebrates to begin glia differentiation,





5


neighboring glia with different morphology and differing functions must still diverge from the common pathway at some


Neuroblasts




Activation of glial cell master regulatory genes


Glial cell differentiation


Figure 1.1. Early Pathway of Glial Differentiation. A model for glial cell differentiation which suggests that gcm acts early on to up-regulate glial specific genes (pnt, repo) while also serving to down-regulate neuronal genes. This dual pathway favors glial cell differentiation while discouraging mistaken neuronal differentiation at the same time (Giesen et al. 1997). point (Giangrande, 1996). The early stages of glial differentiation in Drosophila have been described, but the mechanisms responsible for terminal differentiation remain unknown.

Studies of terminal differentiation often focus on a bottom-to-top analysis. Bottom-to-top analyses study the regulatory modules responsible for cell-specific expression of peripheral genes. Again, peripheral genes are generally non-transcription factors that play a part in the cell' s structure or function (e.g. ion channels, structural









proteins, and metabolic enzymes). The regulatory modules responsible for peripheral gene expression are best described in vertebrates, although some invertebrate peripheral genes are well-characterized (Kirchhamer et al. 1996). The specificity of a regulatory module can be tested in vitro using cell culture, or in vivo using transgenic animals. Several glia peripheral genes are now being tested in cell-culture systems and in transgenic mice (Blanchard et al. 1996; Edelman and Jones, 1997; Stankoff et al. 1996; Li et al. 1995). A detailed analysis of MC-specific genes is not nearly as complete as those performed with the crystallins. Only two genes have been studied in any detail during MC differentiation, the glial fibrilliary acidic protein, and the glutamine synthetase gene (Verderber et al. 1995; Li et al. 1995; Li et al. 1997). A more thoroughly studied system, the lens crystallins, will serve here as an example of this type of analysis.

Lens development relies on the high, preferential expression of the crystallins. The crystallin "gene-battery" encodes a number of proteins which are either unique to the lens, or which are recruited from other tasks to serve as crystallins (Cvekl and Piatigorsky, 1996; Wride, 1996). Crystallins are either ubiquitous across vertebrate species, or taxon specific (e.g. a-, 3-, and X- crystallins are found in all vertebrates, while 8-crystallin is found only in the bird and reptile lens Piatigorsky, 1989; Piatigorsky, 1993). The regulation of the crystallin gene-battery occurs mainly through small proximal 5' promoters (McDermott et al. 1997; Sax et al. 1997; Li et al. 1997; Gopal-Srivastava et al. 1996). Minimal promoters are identified using a homogeneous patched lens epithelial (PLE) cell-culture, followed by analysis in transgenic mice (Cvekl and Piatigorsky, 1996).

Dissection of the individual crystallin promoters suggests that high-level

transcription factors might play a role in their regulation (Gopal-Srivastava et al. 1996; Cvekl et al. 1995a; Cvekl et al. 1995b). In general, high-level transcription factors modulate other transcription factors that regulate peripheral gene expression. However, in the lens it appears that a transcription factor important for whole eye formation, Pax-6, plays a direct role in regulating crystallin expression.









The transcription factor Pax-6 contains a conserved-paired domain and a

homeodomain (Duncan et al. 1997; Holst et al. 1997). Pax-6 is essential for vertebrate and invertebrate eye development, as well as otolith development in an ascidian (Harris, 1997; Tomarev et al. 1997; Boncinelli, 1997; Glardon et al. 1997; Halder et al. 1995). The loss of Pax-6 expression results in mutated or missing eyes. Conversely, over-expression in Drosophila of Pax-6 from several sources (Drosophila, mouse, squid, and ascidian) causes ectopic eye structures. Pax-6 is necessary for eye development, and its ectopic expression results in eye formation (Gehring, 1996).

Studies of crystallin minimal promoters show that most, if not all, interact with

Pax-6 directly. Pax-6 up-regulates chicken and mouse a-crystallins and guinea pig taxonspecific crystallins (Cvekl and Piatigorsky, 1996; Gopal-Srivastava et al. 1996; Cvekl et al. 1995b). Pax-6 could also be responsible for repressing chicken J3-crystallin expression in cotransfection studies (McDermott et al. 1997; Duncan et al. 1996; Cvekl and Piatigorsky, 1996). Pax-6 plays a direct role in crystallin regulation, therefore, Pax-6 regulates the expression of peripheral genes as well as acting very early in the eye-development pathway.

The differentiation of MCs, at the regulatory module level, is relatively unstudied. Both the MCs expression of cell-specific markers and the cell's function in neural retina are well characterized (Newman and Reichenbach 1996; Linser et al. 1997a). Many intriguing questions remain to be answered concerning MC differentiation, including whether gcm regulates peripheral genes directly in Drosophila, and if it functions across the vertebrateinvertebrate divide as does Pax-6.

Glia Function

Glial cells are an integral part of neural networks. Originally described by Virchow (1846) as "kitt," or glue, without any apparent cell structure, glial cells are still generally thought of as "supporting cells." This bias in thinking of glia as structural and supporting









cells is not without historical basis in fact. Glia do play an important role in the nervous system architecture and in maintaining the extracellular microenviroment. However, they might also be involved in directly regulating neural synapses, and therefore, affecting the function of neural networks.

The role of glia in axonal migration during late neural development.

The glia play an integral role in neuronal maturation, specifically in axon

pathfinding and cell migration. Examples of glia-mediated axonal migration come from both invertebrate and vertebrate CNS and PNS. However, other factors do play a role in migration besides cell-cell adhesion with the glia, including the extracellular matrix (Galileo et al. 1992; Duband et al. 1991; Bronner-Fraser, 1993a; Bronner-Fraser, 1993b), secreted molecules (Cohen-Cory and Fraser, 1995; Cohen-Cory et al. 1996; McFarlane et al. 1995) and cell-cell interactions with other neurons (Yin et al. 1995; Wichterle et al. 1997).

Many immature neurons migrate along glial pathways from "germinal layers" to a "maturation layer" where they will function. A step-wise progression of cell-cell recognition, cell-cell adhesion, cell motility, and detachment from the glial cells must occur during migration. Glia function as a "template" for axonal migration in various tissues, including the vertebrate cerebellum (Rakic, 1971; Antonicek et al. 1987; Zheng et al. 1996; Komuro and Rakic, 1993; Gao et al. 1991), the vertebrate cortex (Fishell and Hatten, 1991; Stitt et al. 1991; Stitt and Hatten, 1990), newt spinal cord (Singer et al. 1979); neural retina (Silver and Rutishauser, 1984), and the Drosophila CNS (Jacobs and Goodman, 1989a; Jacobs and Goodman, 1989b; Gruberg et al. 1979b). The glial cells also play a role in defining the domains of the dendritic microcircuitry later in development (Crandall et al. 1990; Hutchins and Casagrande, 1990; Tolbert and Oland, 1990; Mission et al. 1991). The glial cells play a major role in the proper formation of nervous tissue architecture.








The function of glia in fully developed nervous tissue.

Perhaps the best-studied function of glial cells is the maintenance of the

extracellular microenvironment. In the neural retina, the MCs regulate many extracellular factors, including neurotransmitter recycling, and K and CO2 removal. Glutamate serves as the primary neurotransmitter in the retina. Glutamate released at synaptic connections must be quickly removed so that further signaling can occur, and so that prolonged signaling does not occur. Glutamate is recycled using proteins found in the MCs (Clark and Sokoloff, 1994). Also, in the MCs, are K+ channels that remove excess K from the extracellular environment through "siphoning." "K -siphoning" transports the ion from the extracellular space into the MCs through channels located in the plexiform layers (Karwoski et al. 1985). A concentration of K equal to that taken up in the plexiform layers, is expelled through the MC endfeet into the vitreous chamber (Newman, 1987). A similar process might occur with CO2. which is the major product of metabolism. While most tissues remove CO2 through the interspersed circulatory system, most retinas are avascular. The MCs are thought to compensate for this lack of an intra-retinal circulatory system by siphoning CO2 into the vitreous chamber (see "Carbonic Anhydrase in Tissue Function" below).

Glial cells respond to and influence neuronal signaling through calcium-mediated oscillations. Both brain- and retina-derived astrocytes generate Ca2+ waves that spread from cell to cell (Cornell-Bell et al. 1990; Cornell-Bell and Finkbeiner, 1991; Newman and Zahs, 1997). The Ca2+ waves in astrocytes can be started either by neuronal release of glutamate, or through experimental manipulation (e.g. photostimulation, mechanical stimulation, or chemical stimulation). The glial-carried Ca2+ waves can, in turn, affect neurons. Ca2+ waves pass through the glia; when a neuron is in contact with the glia its intracellular Ca2+ increases. There is evidence for this neuronal increase being caused either by unidirectional gap junctions from glia to neuron (Nedergaard et al. 1995), or by an (NMDA) receptor mediated pathway (Parpura et al. 1994). Increased neuronal Ca2









can influence cell movements, signal transduction, and gene expression (Gallin and Greenberg, 1995; Finkbeiner and Greenberg, 1997; Ginty, 1997). If glia mediate changes in neuronal Ca2+ levels, then they might mediate neuronal function. If they mediate neuronal signaling, then a new factor must be added to the current thinking on neural networks. Not only must neuronal connections be taken into consideration, but also the input from surrounding glial cells.

Introduction to Carbonic Anhydrase

The Carbonic Anhydrase Gene Families

The only proven physiological role for the carbonic anhydrases (CAs, EC 4.2.1.) is the reversible inter-conversion of CO2 to HCO3-. In the early 1920s, two groups simultaneously described CA activity (reviewed in, Davenport, 1984). Three gene families, the a,p, and X are now known to encode for CA' s. The high-activity CA isozymes (CAII, CA-IV, CA-V, CA-VII, and CAH-Z) convert CO2 to HCO3 at 250,000 - 1,400,000 molecules/sec, while other isozymes operate at a lower rate (Heck et al. 1996).

The proteins originally described as high- and low-activity carbonate dehydratases belong to the ax-family and are now known as CA-II and CA-I respectively. There are 10 sequenced vertebrate a-CA isozymes (CA-I through CA-IX, and CAH-Z; see HewettEmmett and Tashian, 1996 for a recent review of CA gene families). Almost all tissues contain CA activity in one or more cellular compartments (Sly and Hu, 1995). The cytoplasmic enzymes are CA-I, CA-II, CA-III, CA-VII, CA-VIII, and CAH-Z (Peterson et al. 1997; Sly and Hu, 1995), CA-IV is glycosylphosphatidylinositol-(GPI)-anchored to the plasma membrane (Wistrand and Knuuttila, 1989; Zhu and Sly, 1990), CA-V is found in the mitochondria (Nagao et al. 1994), CA-VI is a secreted enzyme (Fernley et al. 1989), and CA-IX is an integral membrane protein (Peles et al. 1995).
CA expression exhibits redundancy on several levels. The first level is the
presence of multiple CA isozymes within a given cellular compartment, for example CA-I









and CA-II within the red blood cell cytoplasm. The second level of redundancy lies in multiple isozymes expressed in a different cellular compartments by a single cell-type (Saarikoski and Kaila, 1992; Lynch et al. 1993; Dodgson et al. 1993; Dodgson, 1991). How multiple isozymes expressed by a single cell function in normal cell-physiological is the topic of the next section.

Functional Role of Carbonic Anhydrases


Carbonic anhydrase' s physiological role

The CA-II and CA-IV isozymes function in the same cell, along with other proteins such as the anion exchanger (AE), to control CO2/HC03- levels both intracellularly and intercellularly. The best-studied model of CO2/HCO3 control is the kidney intermediate tubule (Seki et al., 1996). Urine passing from the glomeruli into the descending tubule contains a large amount of HCO3-. The ascending tubule recycles HCO3- through a series of interactions involving CA-II, CA-IV and the AE. The lumenal HCO3 is converted to CO2 by the extracellular CA IV isozyme. The CO2 then diffuses across the tubule membrane into the cytoplasm of the cells, where a high concentration of the CA-II isozyme converts it back into HCO3-. AEs on the basolateral membrane transport the increased HCO3 into the extracellular space, where it is removed by the adjacent capillary system. Thus, while CA's function is always the interconversion of CO2 and HCO3, its association with other proteins results in a physiological role beyond its enzymatic one.

Function of carbonic anhydrase in the neural retina

The presence of a cytoplasmic CA, an AE, and a membrane-bound form of CA together in the retina, suggests a functional relationship comparable to that found in the kidney. A cytoplasmic CA is localized to the MCs, in all vertebrate species from lamprey to human (Linser and Moscona, 1981). Where the enzyme' s activity is known, the









enzyme present is a high-activity isozyme. The AE, which is responsible for transporting HCO3 into and out of the cell, is known through electrophysiological and immunohistochemical analyses to be present on MCs (Newman, 1996; Kobayashi et al. 1994). These analyses both suggest that the exchanger is preferentially localized to the basal end feet, which abut the vitreous chamber.

Several lines of evidence, both electrophysiological and histochemical suggest an extracellular CA in the retina. Newman has shown that treating isolated salamander MCs with benzolamide, which is weakly permeable, effects extracellular pH rectification. This effect correlates an extracellular CA with pH buffering (Newman, 1994). Wistrand and colleagues have shown a membrane-localized CA activity present in the retina using a histochemical technique on a line of CA-HI deficient mice (Ridderstrale et al. 1994). It is interesting to note that antibodies against rat CA-IV do not stain the retina, although nearby blood vessels are positive (Hageman et al. 1991). This raises the possibility that the extracellular CA is not CA-IV, but another isozyme.
pH control and bicarbonate homeostasis in the retina are partially the result of CA activity. Most vertebrate retinas are avascular, which precludes the most direct route for CO2 recycling. The MCs have been recruited to remove excess CO2 through "CO2 siphoning," which shares similar mechanisms with both "K' siphoning" and HC03removal from the kidney (Newman and Reichenbach, 1996; Newman, 1991). In "CO2 siphoning," extracellular CO2 is moved into the MCs either as CO2 or HCO3. Like in K siphoning, an equal concentration of HCO3is then released into the vitreous chamber through AEs present on the basal end feet (Newman, 1991). The mechanism for CO2 siphoning has not been described as well as for K+ siphoning.
CA also plays a role in maintaining the extracellular pH of the retina. Normal light-induced retinal activity results in a transient alkalization followed by sustained acidification (Borgula et al., 1989). The pH changes could significantly influence neuronal activity. For example, a decrease in pH of only 0.05 pH units, reduces synaptic









transmission between photoreceptors and second-order cells by up to 24% (Barnes et al., 1993). Neuronal activity depolarizes the MCs (due to increased extracellular K+), which activates its electrogenic Na'-HCO3- co-transporter. The action of the co-transporter acidifies the extracellular environment, thereby neutralizing activity-based alkalization (for review see Newman, 1996). CA's function in the neutralization is known through two sets of inhibitor studies. Newman (1994) shows that treatment of isolated MCs with the inhibitor benzolamide results in extracellular acidification rising by 269% of controls. The change in retinal pH due to the soluble inhibitors acetazolamide and methazolamide has also been tested in intact retinas (Borgula et al., 1989). The results showed that incubation with CA inhibitors results in a more acidic baseline pH and increases lightevoked changes in extracellular pH. Given the importance of extracellular pH for neural function, and the key role of CA in maintaining extracellular pH, perhaps it is not surprising that all vertebrate retinas maintain CA in their MCs.

Carbonic Anhydrase Gene Regulation
The CA-II gene promoter has been studied in numerous animals and tissues.

Putative cis-regulatory regions have been identified which could play a role in controlling expression. Several early studies showed that CA-II expression in immature erythrocyte cells and bone marrow was activated by thyroid hormone T3 binding to a vitamin D3 response element (Barettino et al. 1993; Pain et al. 1990). Buono and others (1992), showed that a 1.3 kb chicken CA-II promoter could drive reporter gene expression in cultured lens epithelial cells. Marino (1993) concluded that an Ap2-like element was essential for core promoter activity and that a cAMP response element was important for increases in transcription in NIH-3T3 cells. While specific regions were not identified for the induction, calcitonin (Zheng et al. 1994), pH increase (Brion et al. 1994), and tumor necrosis factor-alpha (Franz et al. 1994) all caused up-regulation of the CA-II gene. Shapiro and others (1987) showed that as little as 0.2 kb of human promoter caused high









levels of expression in murine Ltk- fibroblasts and HeLa cells. Similarly, a 0.25 kb promoter resulted in high reporter gene activity in NIH-3T3 and HepG2 cell-lines (Marino, 1993).

Unlike many other promoters studied, no CA-II promoter construct has driven cell-specific expression. In vitro analyses typically show high-levels of reporter gene expression both in cells that normally express CA-II, and in those serving as negative controls. Studies using transgenic mice report ectopic expression of reporter genes driven by CA-II promoters (Erickson et al. 1995; Erickson et al. 1990). Six lines of transgenic mice with mouse CA-II promoter regions of either 1.1 kb or 0.5 kb linked to a reporter gene did not drive tissue- or cell-specific expression. These mice did not express the reporter gene in kidney or lung, which normally express CA, and expression was found in an ectopic pattern in the cerebellum of one line. More recent studies using 10 kb of mouse CA-II promoter in tandem with human CA-II coding regions and some 3' gene sequence still did not promote cell-specific expression (Erickson et al. 1995). It appears that CA-II gene expression is not controlled through a simple set of interactions in the proximal 5' promoter.

Hypothesis of this Research

Our laboratory focuses on CA regulation in MCs. The hypothesis is that the

conserved expression of CA in vertebrate MCs is controlled through conserved regulatory mechanisms. My project revolves around using the zebrafish as a model system for testing CA regulation in vivo. We chose the zebrafish as an in vivo model system for several reasons. A basic advantage of the zebrafish is the ease and economy of keeping a colony, when compared to the mouse, the major vertebrate model for in vivo promoter analyses. The zebrafish female lays a clutch of z 100 eggs at least once a week. The eggs are externally fertilized and develop inside a transparent chorion. External fertilization and a transparent chorion allow injection of DNA constructs at the one-cell stage. The zebrafish









zygote will develop into a visual-feeding larvae by 4 days post-fertilization. Thus, the zebrafish zygote can be injected with DNA constructs after fertilization and then harvested for analysis 4 days later.

While the zebrafish is a useful model for promoter analyses in general, its

usefulness as a model for CA regulation is unknown. My work aims at answering the following three questions:

1) Does the zebrafish contain a high-activity CA?

2) If present, is the CA localized to the MCs?

3) Can zebrafish CA expression in MCs be regulated by a proximal 5' promoter?

These questions will be addressed in the following chapters. Chapter 2 will deal with the identification of a CA homologue from zebrafish (CAH-Z). Chapter 3 will show the expression pattern and cellular localization of CAH-Z. Chapter 4 will deal with both the isolation of genomic clones containing CAH-Z, and the testing of a homologous CA-II promoter system, which might provide insight into question number 3. Chapter 5 will summarize the results of each chapter in respect to this dissertation and this laboratories larger focus.













CHAPTER 2
CARBONIC ANHYDRASE PROTEIN ISOLATION, CDNA SEQUENCING, AND PHYLOGENY IN THE ZEBRAFISH


Introduction and Data Summary

This chapter will answer the question: Does the zebrafish contain a high-activity CA-II? There have been a number of studies in both lower vertebrates (Bergenhem and Carlsson, 1990) and invertebrates (Henry, 1988) to suggest the presence of cytoplasmic CA. In addition Rahim and others (1988) showed immunocytochemical localization of CA in teleost fish erythrocytes and gill epithelia. However, complete sequence data and kinetic characterization of an isolated CA exists only for birds and mammals. Thus, while there is almost surely a cytoplasmic CA in zebrafish, its properties are unknown.

In mammals there are three closely-related CA genes (CA-I, CA-II, CA-m)
located at a single locus, and a more distantly-related ancestral gene (CA-VII; Tashian et al., 1990; from this point on, all references to CA evolution will refer to the cytoplasmic enzymes, unless otherwise noted). The cytoplasmic a-CA's arose from gene duplications that have probably occurred over 600 million years (Hewett-Emmett and Tashian, 1996). An older hypothesis for cytoplasmic CA gene evolution proposed that a CA-II-like enzyme evolved early and gave rise to the other cytoplasmic isozymes through gene duplication (Hewett-Emmett et al. 1984). The data was based on a few mammalian sequences. Based on active site conservation, phylogeny, and rates of evolution, HewettEmmett and Tashian (1996) suggested that the CA-VII isozyme more closely resembled the ancestral enzyme. Both hypotheses supported the idea that CA-I, CA-II, and CA-Ml come from recent gene duplications, while CA-VII and CA-VIII underwent duplication much earlier (Tashian et al. 1983; Tashian et al. 1990; Hewett-Emmett and Tashian,









1996). Partial sequences from the fruit fly, nematode, and shark do not offer any insight into CA family evolution (Hewett-Emmett and Tashian, 1996; Bergenhem and Carlsson, 1990).

The CA-I, CA-HI, and CA-Ill genes remain closely linked to the same locus in mouse and humans (Venta et al. 1984; Beechey et al. 1990). Their chromosomal positioning, phylogeny, and sequence conservation suggest a recent duplication. However, very little has been learned about non-mammalian CA isozyme genes. The teleost should possess a more anciently derived form of CA, while not being so distant as that of the invertebrates or shark. A comparison of its activity and sequence might offer insights into the evolution, function, and regulation of the isozyme families.

I report here a carbonic anhydrase homologue from zebrafish (CAH-Z). Using affinity chromatography, I isolated a 29,000 Dalton protein from the zebrafish. Direct peptide sequence confirmed that it was a CA, while inhibition kinetics were used to characterize it as a high-activity CA. A cDNA sequence of 1537 bp was determined through RT-PCR of retinal RNA. An open reading frame encoding 260 amino acids was identical over the 48 amino acids determined through peptide sequencing. Based on activity and sequence similarity, the CAH-Z isozyme was clearly an a-CA. Phylogenetic analyses suggested that CAH-Z was a novel isozyme, which diverged after the branching of the CA-V and CA-VII genes and prior to the duplications that generated CA-I, CA-II, and CA-III. This data represents the most complete characterization of a teleost CA.

Materials and Methods

Zebrafish Colony Maintenance

Fish used for protein isolation were obtained from Felton Aquatics (Daytona
Beach, FL). Animals were cared for as described in "The Zebrafish Book" (Westerfield, 1995).








Purification and Peptide Sequencing of Carbonic Anhydrase from Zebrafish

The procedure for isolating CA from zebrafish was adapted from Osborne and

Tashian (1975). Zebrafish were placed on ice, decapitated, minced with a razor blade, and ground in a Polytron homogenizer for 1 min at high speed. This mixture was transferred to 30mL ultracentrifuge tubes and spun at 100,000X g for 2 hours in a Beckman ultracentrifuge to pellet insoluble proteins. The soluble proteins were combined with an equal volume of agarose-bound p-aminomethylbenzenesulfonamide (pAMBS; Sigma), pre-equilibrated with 0.2 M Tris-SO4 (pH 9.0). The slurry was mixed overnight at 4oC, and loaded into a chromatography column the following day. Approximately 15mL fractions were collected (Instrumentation Specialties Company). Bulk protein was removed by washing with 0.2 M Na2SO4/0.1 M Tris-SO4 (pH 9.0). Low affinity proteins were eluted with 0.2 M KI /0.1 M Tris-SO4 (pH 7.0). High-affinity CA was eluted with 0.2 M KCN/0.1 M Tris-SO4 (pH 9.0). Fractions were checked for the presence of a CA by placing 1.5 pL aliquots on nitrocellulose (MSI) and fixing with 0.1% fast green FCF stain (Sigma)/40% methanol, 10% acetic acid, 40% water. Blots were blocked and probed with an anti-chicken CA-II antiserum, followed by horseradish peroxidase linked goat anti-rabbit IgG (Jackson Immunoresearch Laboratories, Inc.; Jahn et al. 1984). The color reaction was performed by adding 60 mg of 4-chloro-l-naphthol (Sigma) to 20mL of cold methanol (Fisher), followed by addition of 80 mL of Tris-buffered saline (TBS) and 60tL of 30% H202 (Sigma); the reaction was stopped by washing with H20. Positive fractions were concentrated into H20 using an Amicon concentrator with a 10,000 Dalton molecular weight cutoff membrane (PMIO; Amicon, Inc.). The isolated protein' s concentration was determined using a Bio-Rad Bradford protein assay kit. The protein' s purity was assessed by analyzing -5ug using 5%-15% gradient SDS-PAGE (Laemmli, 1970), with visualization by silver staining (Wray et al. 1981).








Peptide sequencing was performed by the University of Florida' s Interdisciplinary Center for Biotechnology Research (U of F' s ICBR) Protein Chemistry Core Laboratory. The purified protein was separated using 10% Tris-Tricine SDS-PAGE (Schagger and von Jagow, 1987) and digested in situ with endoproteinase-lysine-C (U of F ICBR Protein Chemistry Core unpublished protocol). The digestion product was run on 15% TrisTricine SDS-PAGE and blotted in 10mM MES to Problott (Towbin et al. 1979). Peptide sequence was obtained through Edman degradation of CAH-Z directly from the membrane. Residues were identified through HPLC (automated gas-phase sequencing) with comparisons to known amino acids (Hunkapiller et al. 1984). 180 - Exchange Kinetics


At chemical equilibrium, the uncatalyzed and carbonic anhydrase-catalyzed exchange of 80 between CO2 and water was measured by membrane-inlet mass spectrometry. The depletion of 180 from CO2 occurs in the hydration-dehydration cycle as 180 appears in water and is greatly diluted by 160-containing water (Equation 1 below; B=Buffer). The exchange of 80 between 12C and 13C-labeled CO2 was also measured. This exchange occurs because the catalyzed dehydration labeled HCO3 results in a transitory labeling of the active site with 180 which then reacts with 13CO2 (Equation 2 below) (Silverman, 1982).
EZn8OH + BH + H20 a EZnOH2 + H2180o + B (Eq.1)
EZnOH2 + HCOO"0 :> EZn OH + H20 + CO2+ 13CO2 EZnOH2 + H 13COO"0- (Eq.2)
The slope of the plot of log (180 atomic fraction) vs. time gives a measure of the rate of interconversion of CO2 and HCO3- at chemical equilibrium, R, (Silverman, 1995). The inhibition of the zebrafish carbonic anhydrase by ethoxzolamide (EZA) was determined by measuring decreases in RI as inhibitor concentration increases. A








Henderson plot was constructed and the enzyme concentration and inhibition constant were obtained.

Cloning of the Carbonic Anhydrase Homologue from Zebrafish

All cloning strategies used total retina RNA isolated with an RNA-STAT 60 kit

(Chomczynski, 1993; Tel-Test, Inc.). Oligonucleotide primers were produced at the U of F' s ICBR DNA Synthesis Core. The specific primers were: PAL 62, ATYTTNGTMTTCCAMTG; PAL 63, TTYCAMGTNGAYTTY; PAL 74, TCGTGAACCAAGTTCCCTTGT; PAL 75, ACAAGGGAACTTGGTTCAGCA; PAL 76, CCAGGTGGACTTCGTTGA; PAL 77, TCAACGAAGTCCACCTGG; PAL 83, AGCATCAACACATCTCATCA; PAL 84, GATTTACATATCATATTTGTT; PA 140, GACTTCAGGCTAGCATCGAT; PA 141, CATCGATCCATGGGTCGAC; PA 142, GACTTCAGGCTAGCATCGATCCATGGGTCGAC; where N is G,A,T, and C; Y is C and T; M is A and C. Primers for 3' RACE (PA 140, PA 141, and PA 142) were a kind gift of Drs. Michael C. Jeziorski and Peter A.V. Anderson (Whitney Laboratory, University of Florida).
PCR reactions used standard conditions (50mM KC1, 10mM Tris-HC1, 0.1%
Triton X-100, 0.2mM each dNTP, 2.5mM MgCl2, 2.5U Taq DNA polymerase, and -20 pmol primer) with varying annealing temperatures (45oC-550C) and extension times (-~1 min/1000bp) for 25-35 cycles (Wang and Mark, 1990). RACE reactions were carried out according to the Gibco-BRL protocol. RT reactions used SuperScript II (Gibco-BRL) with accompanying transcription buffer and primers PAL 83 (5' RACE), PA 142 (3' RACE), or a mixture of random primers (Boehringer-Mannheim) (pCA-1 reaction). Remaining reagents for RACE reactions were obtained from a 5' RACE Reagent System kit (Gibco-BRL). PCR products were visualized by running an aliquot on a 1.0% agarose/0.5X TBE (0.045M Tris-borate, 0.001M EDTA) electrophoresis gels, stained with ethidium bromide. Positive products were removed from the gel by excision with a









razor blade and eluted from agarose bands using a Qiagen Qiaex II kit. Eluted DNA products were ligated into pGEM-T, using T4 DNA Ligase (Promega). Ligation reactions were used to transform JM 109 competent cells with subsequent selection on ampicillin plates (Sambrook et al. 1989).

Sequencing the cDNA for Zebrafish Carbonic Anhydrase

DNA samples were sequenced by the U of F' s ICBR DNA Sequencing Core

Laboratory. Sequencing was accomplished by employing the Taq DyeDeoxy Terminator (part number 401388) and the DyePrimer (part number 401386) Cycle Sequencing protocols developed by Applied Biosystems (a division of Perkin-Elmer Corp., Foster City, CA) using fluorescent-labeled dideoxynucleotides and primers, respectively. The labeled extension products were analyzed on an Applied Biosystems Model 373A DNA Sequencer.

Isozyme Determination Through Sequence Analysis and Phylogeny

RT-PCR products were arranged into a single cDNA sequence using the
PC/GENE sequence analysis program ASSEMGEL, and translated using TRANSL (Intelligenetics, Mountain View, CA). All sequences for comparisons in Fig. 2.6 and Fig. 2.7 were retrieved from protein databases using the Entrez program (National Center for Biotechnology Information, NCBI), except those for mouse CA-VII and Drosophila melanogaster which were copied from Hewett-Emmett and Tashian (1996). Abbreviations use species common name initial before isozyme name (i.e., human CA isozyme I = HCA-I), except Drosophila melanogaster CA (DCAH). Accession numbers are SWISS-PROT for all CA-I, CA-II, and CA-Ill isozymes, human CA-VIII, and sheep CA-VI. The shark CA accession number is from the PIR database and the remaining accession numbers are NCBI gi. The accession numbers are: human (Homo sapien) isozymes, HCA-I (P00915), HCA-II (P00918), HCA-III (P0745), HCA-IV (544725),









HCA-V (306483), HCA-VI (179732), HCA-VII (179967), and HCA-VIII (P35219); mouse isozymes (Mus musculus) MCA-I (P13634), MCA-II (P00920), MCA-III (P 16015), and MCA-VIII (50827); rat isozymes (Rattus norvegicus) RCA-V (522180) and (Sprague-Dawley) RCA-IV (1066838); chicken isozyme (Gallus domesticus) CCA-II (P07636); sheep isozyme (Ovis aries) SCA-VI (P08060); and TSCA (A60519).

Protein sequence was checked for CA similarity using the BLAST program

(NCBI; Altschul et al. 1990). Pairwise alignments used to produce the matrix in Fig. 2.6 were performed in AlignPlus (Version 2, available from S&E Software, P.O. Box 440, State Line, PA 17263, USA) using Global Alignment with parameters set to: mismatch = 2; open gap = 4; and, extend gap = 1. Percent identity was determined by dividing exact matches by length of reference sequence, except in the cases of MCA-VII and TSCA, which were divided by their total, shorter length. Protein phylogenies were produced using neighborjoining (NJ) with the MEGA program (Version 1.0, Kumar et al, 1993; obtained from the Institute of Molecular Evolutionary Genetics, The Pennsylvania State University, University Park, PA 16802, USA). Protein sequence alignments for constructing NJ trees were obtained from the CLUSTAL V program (Higgins et al. 1992), with improvement by eye. NJ trees were produced using complete deletion, with both uncorrected P-values and P-values corrected through Poisson distribution with 500 bootstrapping replicates.

Northern Blot Analysis

Northern blot analysis was performed on RNA from zebrafish tissues. Fish were anesthetized on ice and tissues were dissected in PBS. Freshly dissected tissues were immediately transferred to 4 mL tubes on ice until all dissections were complete. The samples were spun for 10 min at 3000 rpm at 40C in a tabletop centrifuge and excess liquid was removed. The weight of the remaining samples was determined and total RNA was isolated using RNAzol (Tel-Test, Inc.), following the manufacturers protocol for









isolated tissues. Total RNA concentration and purity was determined by measuring the O.D. at 260 and 280 nm on a Gene Quant II fixed-wavelength spectrophotometer (Pharmacia Biotech).

Approximately 10 [ig of each RNA and 7 pg of standard RNA (Boehringer

Mannheim) were run on a 1.1% agarose gel using the glyoxal method (Carmichael and McMaster, 1980). The gels were blotted to MagnaGraphTM (Micron Separations, Inc.) using a Turbo-Blotter apparatus following the manufacturer' s protocol (Schleicher & Schuell). The RNA was immobilized to the membrane by UV-irradiation (Sambrook et al, 1989). Blots were stored at -80oC until used.

RNA probes of CAH-Z were made using Sp6 and T7 polymerase and the plasmid pCA52 (Fig. 2.3). Unincorporated ribonucleotides were removed using a G-50 Sephadex Quick-Spin ColumnTM (Boehringer-Mannheim). Prehybridization and hybridization were carried out in: 50% formamide, 5X Denhardt' s solution (0.5% Ficoll, 0.5% polyvinylpyrrolidone, 0.5% serum albumin), 1% SDS, 5X SSPE, and 100 pg /mL denatured herring sperm DNA. Blots were prehybridized for 4-5 hours at 60'C and hybridization was carried out overnight at 60oC. The blot was then washed 3 times for 15 minutes at 65oC in IX SSPE/0.5% SDS, followed by two washes in 0.1X SSPE/0.5% SDS at 600C and 680C. The blots were exposed on X-Omat film (Kodak) at -800C.

Results

Carbonic Anhydrase Isolation and Protein Sequence

Affinity chromatography using the inhibitor pAMBS results in a one-step

purification of high-activity CA-II from mammalian red blood cell lysates (Osborne and Tashian, 1975). Using pAMBS for affinity chromatography of zebrafish soluble protein resulted in the elution of a single protein during the final wash (Fig. 2.1). When separated on SDS-PAGE, a single band migrated at approximately 29 kDa, which is consistent with cytoplasmic CA isozymes (Deutsch, 1987).









The protein was subjected to Endo-LC digestion to isolate internal fragments.

Two peptide fragments were isolated and sequenced using Edman degradation. From the two fragments a of 48 amino acid (AA) residues were determined (Fig. 2.4, underlined amino acid sequence). The sequence was found to be similar to cytoplasmic CA's when compared to the GenBank database using the BLAST program (data not shown).

1 2




102

69.3


45.8



28.7



Figure 2.1. SDS-PAGE analysis of isolated zebrafish CA. Approximately 1Ptg of zebrafish CA (lane 2) and 15pg of Mr. standards (lane 1) (BRL) were analyzed by 5%-15% gradient SDS-PAGE. Protein visualization was performed by silver-staining.

Characterizing Activity Through Rates of Inhibition

Carbonic anhydrases are inhibited by sulfonamides (Maren, 1967). The sulfonamides act as transition state analogs (Silverman, 1992). The sulfonamide inhibitors bind to CAs with different affinities based on the enzyme's tertiary structure, and at the most basic level, the amino acid sequence. The amino acid sequence determines their affinity because of key residues which are important for CO2 conversion and interactions with sulfonamides. The residues that are present in the high-activity enzymes result in stronger binding to sulfonamides, while those in low-activity CAs








This difference in binding and, hence, activity, can be represented by the inhibition constant (Ki). Thus, high-activity CAs have a higher affinity for sulfonamides and a lower Ki, typically in the nanomolar range.

To determine the activity of the isolated zebrafish protein, a known concentration of CAH-Z was titrated with the inhibitor ethoxzolamide (EZA; Fig. 2.2 A). The titration curve was linearized, and using a Henderson plot the data was linearized to determine the y-intercept, which gives the calculated Ki. The inhibition analysis resulted in a subnanomolar Ki for CAH-Z (Fig. 2.2 B). In addition to Ki, a single kcat reaction using stopflow analysis suggested that CAH-Z converts CO2 to HCO3 at a rate of -250,000 sec-1 (data not shown).



Inhibition Kinetics

1.0 [E]= 3.40 nM 4. Ki= 0.12 nM

<0.8 \.
< 0.6. \"
W \* *, 7
_ 0.4 4._ 7'.

I 0.2 1

0
2 4 6 8 10 0 0.2 0.4 0.6 0.8 1.0 [EZA] nM 1-i Figure 2.2. Inhibition kinetics of CAH-Z. (A) Titration of EZA was performed at 10.C at a standard enzyme concentration of 3.40 nM. The x-axis shows the concentration of ethoxzolamide, the y-axis (RI Relation) is a measure of the rate of interconversion of CO2 and HCO3" at chemical equilibrium. (B) The inhibition constant (Ki) was determined by linearization of relative activity values (over increasing concentrations of EZA) by a Henderson plot, where i = fraction of inhibition, and K = y-intercept.








Sequencing the cDNA for Zebrafish Carbonic Anhydrase

Total RNA from the retina was used for cDNA cloning. The only cytoplasmic CA in the retinas of birds and mammals is the CA-II isozyme (Linser and Moscona, 1984). We increased the chances of isolating message for the affinity-isolated, high-activity protein by using retina RNA. A RT-PCR strategy was used for the cloning of CAH-Z from zebrafish (Figure 2.3).
1 1 130 260 1537

- CA.19K (372-461)
- CA.26K (238-287)
pCA1 (C58-443)
pCA52, pCA56 (1410)
pCA311,pCA36, pCA38
(3"-1537)


Figure 2.3. CAH-Z cloning strategy. The sequences obtained through direct peptide sequencing are shown by the bars labeled CA-19K and CA-26K; the original RT-PCR product was determined from clone pCA-1; 5' RACE sequence was determined from clones pCA52, and pCA56; 3' RACE sequence was determined from clones pCA311, pCA36, and pCA38. The deduced ORF is identified by a shaded box and the length is given in italicized numbers above the box. The position of clones, relative to total message, is given in parentheses.

The cDNA for CAH-Z was cloned using RT-PCR of retina total RNA. The first set of primers were designed against the known peptide sequence. The 48 amino acids of peptide sequence were gathered from two fragments. When the two fragments were aligned with other CAs they were found to be separated by 28 amino acids (Fig. 2.4). A degenerate primer was made against each of the two fragments (PAL 62, PAL 63). These primers were used to amplify an 18 lbp product by RT-PCR. From the sequenced product, primers for rapid amplification of cDNA ends (RACE) reactions were produced (Frohman et al. 1988). These exact primers were used in concert with a poly-G primer (5' RACE), or a poly-T based, nested primers (3' -RACE). The final 3' -RACE reaction resulted in a single product, I 149bp in length minus the poly-A tail (Fig. 2.3). Two independent 5' -RACE products of 410 bp were cloned and sequenced (Fig. 2.3).










Sequencing of the PCR products and aligning of the different reaction products resulted in

a complete cDNA spanning 1537 bp (Fig. 2.4).




1 cacagttgttttagcatccaggttgtacaagtagaggaacacagcgaaaaccatttataa

M A H A W G Y G P A D G P E S W A E S
61 tcATGGCCCACGCTTGGGGATATGGACCAGCTGACGGGCCAGAGAGTTGGGCAGAAAGCT

F P I A N G P R Q S P I D I V P T Q A Q 121 TTCCTATTGCAAATGGACCCAGGCAGTCTCCCATTGATATCGTACCCACCCAAGCACAGC

H D P S L K H L K L K Y D P A T T K S I
181 ACGACCCTTCTCTGAAGCATCTCAAATTGAAGTATGACCCAGCCACCACCAAGAGCATCC

L N N G H S F Q V D F V D D D N S S T L
241 TTAATAATGGCCATTCATTCCAAGTGGACTTCGTTGATGACGACAACAGCTCAACTCTGG

A G G P I T G I Y R L R Q F H F H W G S
301 CTGGAGGTCCCATCACAGGGATATACAGGTTGAGACAGTTCCATTTCCATTGGGGAAGCA

S D D K G S E H T I A G T K F P C E L H 361 GTGATGACAAGGGATCCGAGCACACTATTGCTGGAACCAAGTTCCCTTGTGAGCTTCACC

L V H W N T K Y P N F G E A A S K P D G 421 TTGTTCACTGGAACACAAAGTACCCAAACTTTGGAGAAGCTGCCAGTAAGCCTGATGGCC

L A V V G V F L K I G A A N P R L Q K V 481 TTGCTGTGGTTGGAGTTTTTCTCAAGATCGGCGCTGCAAATCCAAGACTTCAGAAAGTTC

L D A L D D I K S K G R Q T T F A N F D 541 TAGATGCCCTTGATGACATCAAATCAAAGGGCAGACAGACTACATTTGCCAACTTTGATC

P K T L L P A S L D Y W T Y E G S L T T 601 CTAAAACCTTGCTGCCTGCCTCTCTGGACTACTGGACTTATGAGGGCTCTCTGACCACCC

P P L L E S V T W I V L K E P I S V S P
661 CTCCTCTGCTGGAGAGTGTCACCTGGATTGTTTTGAAGGAGCCGATCAGTGTTAGTCCTG

A Q M A K F R S L L F S S E G E T P C C
721 CTCAGATGGCTAAATTTCGCAGCCTGCTGTTCTCATCTGAAGGAGAAACACCTTGCTGCA

M V D N Y R P P Q P L K G R K V R A S F
781 TGGTTGACAACTACAGACCTCCTCAACCTCTCAAGGGACGCAAAGTTCGCGCTTCCTTCA

K
841 AGtaaaccccagaatcgatgccacttgccttctgattatggtgcttttgactggttgtta 901 ctgaaacatcacagtatttgttctcgatccaggcttttgcttacattgcagtactgataa 961 aggaaagttgaatctgatcttctaaaactgtctgcgtttgtcataaacgcccatgttatg 1021 attgctaaacatgagaaatagtatttcgagatgctaaaacagtggttagtttcctactat 1081 atcctgacgcttttatgtaaactggaaaaataaggagactgctttatttctagctcattt 1141 tttgactgcttcactttgcattttataggccattcttttagcctctgcagaattgcacta 1201 taattcatgttctacaataggaaaatcgtcaaggttttgtgtgggtttatggcaatgtgt 1261 gactgatgagatgtgttgatgctaatatacctgcaggaaagcacttatttacagcaatat





28

1321 gttgttgttttaaagtgattcctttttcatcaagaggaatatcaagggattatattttta 1381 aatcgtttatgagaatgttgaatcaagacctcctgccatagataatattatttagatatt 1441 tcagaataaatatttaattgagtagtgttgcaaacaaatatgatatgtaaatcagtatct 1501 attaagaattttatctgcaataaatgaatatatttt


Figure 2.4. CAH-Z nucleotide and deduced amino acid sequence. The total CAH-Z sequence as determined through total retinal RNA RT-PCR is shown. The predicted ORF is in capital letters with the deduced amino acid sequence shown above. Regions corresponding to direct protein sequence are underlined. A putative "strong" Kozak sequence (Kozak, 1991), and polyadenylation signal are in bold print.


Northern Blot Analysis


Total RNA from zebrafish tissues was probed for CAH-Z message using 32Plabeled RNA probes. The probes were made against the 5' most region of the CAH-Z cDNA using the pCA52 clone (Fig. 2.3). The retina was tested for CAH-Z message, while the gill served as a putative positive control due to the previous report on CA in teleost gill (Rahim, 1988). Both retina and gill contained an RNA of appropriate size, while the brain did not (Fig. 2.5). The band on Northern analysis was -1.6 kb, which is consistent with the cDNA sequence determined. This evidence suggested that the CAH-Z mRNA was present in the retina.
G B R1 R2


7.5 Figure 2.5 Northern blot analysis ofzebrafish
4.4 tissues. 10g of zebrafish gill (G), brain (B), and retina (R1 and R2) were separated on glyoxal
2.4 gel. An antisense riboprobe against CAH-Z (lanes B, G, and R1) bound to a single band at
1.4 -1.6 kilobases. A control, sense probe (lane R2) against CAH-Z did not show any signal.


0.24-









Isozyme Family Determination Through Sequence Analysis and Phylogeny


A matrix comparing CAH-Z, HCA-I, HCA-II, HCA-III, HCA-VII, and TSCA to other known cytoplasmic CAs was prepared (Fig. 2.6). The figure shows an individual isoform (e.g., human CA-I [HCA-I] or human CA-II [HCA-II]) on the y-axis, and a group of isoforms (e.g. CA-I, which is represented by human, mouse, and horse CA-Is) on the top x-axis. The numbers in each box represent the average percent identity between the individual isoform and the group of isoforms. The human CA-I, CA-II, CA-III, and CAVII were most similar to their own group (71%-95% identity), with high identity to the remaining isozymes (50%-60%). However, the CAH-Z protein was nearly equal in amino acid identity to the CA-I, CA-II, CA-III, CA-VII, and TSCA isozymes (57%-63% identity).


CAH-Z H CA-I H CA-II

HCA-II I H CA-VI I TSCA


Figure 2.6. Comparing single CA isozymes and the major cvtoplasmic isozyme families. A matrix shows the average exact identity between CAH-Z, HCA-I, HCA-II, HCA-VII, and TSCA (in vertical row) against several members of each isozyme class (in horizontal column). The isozymes used in each column were those listed in Materials and Methods, and found in Fig. 2.7. For each same-group analysis the human counterpart was omitted from consideration. The broken boxes under column CA-II take into account the difference between chicken CA-II and the other CA-IIs', with chicken identity being shown in the upper left. The shading is to call attention to the higher percent identity that each individual isoform has with its own isoform family.


6 0
100 61 63 57 60 52 43
57/
61 79 60 55 50 48 41
63 59 8 58 56 52 43
63
56 54 57 89 49 47 40
53/
60 51 56 51 95 50 42
57 55 52 52 51 42









Phylogenetic analysis was performed using the NJ method with uncorrected pdistance, and with data corrected for multiple hits through Poisson distribution. The pdistance refers to the proportion of different amino acids between two compared sequences. The Poisson-corrected distance estimates the number of amino acid substitutions per site assuming a Poisson distribution. The two trees share the same general topology (Fig. 2.7); they both show that the CAH-Z protein diverged from a node with CA-I, CA-II, and CA-Ill on its other branch. The major differences between these two trees lies in Bootstrapping Confidence Levels (BCLs), and the node preceding CAHZ divergence. Bootstrapping refers to the random sampling of data points (amino acids in this case) and the production of a resampled NJ tree. The BCLs refer to the percentage of times that an interior branch of the tree remains in the same general location, in respect to the rest of the tree. The BCLs for the trees shown were determined with 500 replicates; the branches with BCLs above 90 are significant.

Discussion

This chapter presents the identification of a carbonic anhydrase homologue from zebrafish (CAH-Z). I provide protein isolation, kinetic characterization of the isolated protein, primary structure analysis of the protein and cDNA, Northern blot analysis, and phylogeny for the conceptually translated CAH-Z protein.

The catalytic function of all CAs is the reversible interconversion of CO2 to HCO3-. Sulfonamides are transition-state analog inhibitors of CA, which prevent the conversion of CO2 to HCO3 and the converse reaction. The sulfonamide EZA has a K, ranging from the mM range (low activity isozymes) to the nM range (high activity isozymes). A 0.12 nM I, for zebrafish CA and a single k determination of 250,000 sec- at pH 8.5 justifies calling CAH-Z a "high-activity" CA (Heck et al. 1996).




























1 I I I 0 10 20 30


I III
0 10 20 30 40 50 60o Percent sites changed (Poisson corrected P-distance)


Figure 2.7. Phylogenetic analysis of CAH-Z and other at-CA isozymes. The phylogenetic trees were produced using either uncorrected P-values (A), or P-values corrected by Poissondistribution (B). Values shown are bootstrapping confidence levels for each branch. Abbreviations are: human (H), rat (R), mouse (M), sheep (S), equine (E), chicken (C), zebrafish (Z) and Drosophila (D).









Both the peptide sequence of purified CAH-Z, and the cDNA sequence from retinal RNA are identical over compared amino acids. The deduced ORF for cloned CAH-Z aligns exactly with the 48 amino acid residues determined through N-terminal sequencing of two peptide fragments. While there is a possibility that the isolated protein and CAH-Z are different CAs with exact identity over these 48 amino acids, it is more probable that they represent the same CA. When the CAH-Z 5' most sequence is used for Northern blot analysis of zebrafish tissues, the retina and gill contain reactive signal. In addition to the cloning from retina RNA, this data suggests that CAH-Z is localized to the neural retina in zebrafish.

A comparison of CAH-Z with other CAs suggests it is a novel isoform. Some degree of dissimilarity between CAH-Z and the major amniotic CA isozyme group to which it belongs might be expected. However, our data suggest that CAH-Z is not more similar to any one isozyme group, but is equally similar to all vertebrate cytoplasmic isozymes. A comparison of human CA-I, CA-II, and CA-Ill to other cytoplasmic CA' s shows higher identity for each isozyme to their fellow group members and lower identity to the related isozyme groups (Fig. 2.6). When compared at the sequence level to the other isozyme groups, it would appear that CAH-Z is a distinct isoform. Whether CAH-Z is species- or class-specific remains to be seen.

The relationship of CAH-Z to other CAs will prove important in considering MCspecific gene regulation in later chapters. The phylogeny determined suggests the CA-I, CA-II, and CA-Ill gene duplication occurred after the appearance of teleosts, 380 million years ago (Radinsky, 1987). These date agree with a molecular analysis of mouse CA-I and CA-II which places the time of divergence at 340-320 million years ago (Fraser and Curtis, 1986). The data support the conclusion that CAH-Z represents the derived form of CA-I, CA-II, and CA-Ill' s last common ancestor. This fact, along with the mammalian gene linkage, will provide discussion for gene regulation in Chapter 4.





33


The answer to the first question posed in Chapter 1, "Does the zebrafish contain a high-activity CA," is yes. CAH-Z represents a novel high-activity isoform from zebrafish. Whether other teleosts will contain a similar isozyme, and whether the teleosts will contain other isozymes such as CA-I, CA-Il, or CA-III remains to be seen.













CHAPTER 3
THE EXPRESSION PATTERN OF A ZEBRAFISH CARBONIC ANHYDRASE HOMOLOGUE IN THE RETINA


Introduction and Data Summary

This chapter answers the question: is CAH-Z localized to the Miller glial cells (MCs), as is CA-II in birds and mammals? The importance of CA in the MCs of other species would suggest that CAH-Z should be localized there in the MCs of the zebrafish as well. The presence of CAH-Z message in the retina using Northern analysis supports this statement, however, the protein could possibly be in another cell-type.

The function and architecture of the retina is well-conserved in vertebrates. The retinas of all species contain sensory cells (photoreceptors), interneurons (amacrine, horizontal, bipolar), output inter-neurons (ganglion) and a primary glial cell (MCs). The structure of the vertebrate retina features alternating laminae of cell bodies (nuclear layers) and cell processes (plexiform layers; Dowling, 1985). The MCs have a morphology that distinguishes them from neurons; they have a centralized cell body in the inner nuclear layer (inl), and are the only cells with processes extending from the vitreal side to the ventricular side of the retina. The MC process endfeet at the vitreal and ventricular borders form the inner limiting membrane (ilm) and outer limiting membrane (olm) (Cajal, 1892; Meller and Glees, 1965). Up to a dozen processes can extend into the inner plexiform layer (ipl) from a single MC. The number of processes varies from species to species. Additional processes - fewer in number - extend into the outer plexiform layer (opl). The glial processes allow close contact with the neurons and interneurons, which facilitates the MC's primary function of maintaining the extracellular microenvironment (Newman and Reichenbach, 1996 and references within).









Immunohistochemistry was used to determine CAH-Z's cellular localization within the retina, and to characterize the differentiation of the MCs. The localization was determined in the adult retina and during eye development (see Schmitt and Dowling, 1994, for overview of zebrafish eye development). In addition to the biochemical maturation of the MCs using CAH-Z as a marker, I also have described what appears to be the structural differentiation of the MCs earlier in development, using HNK-1 as a marker. The HNK-1 antibody recognizes a carbohydrate epitope, which is found on many glycoproteins, proteoglycans and glycolipids. It is thought to play a role in cell-adhesion and cell-cell signaling (Schachner and Martini, 1995; Rathjen et al. 1987; Kobayashi et al. 1997). It is found on many cell types in the retina, including the MCs in fish (Uusitalo and Kivela, 1994).

The results presented suggest that the zebrafish MCs differentiate structurally

before they do biochemically (by biochemical differentiation I refer to the appearance of proteins which are necessary for mature function). The HNK-1 antibody recognizes presumptive MCs as early as 48 hpf, and clearly stains radial cells at 60 hpf. No staining for CAH-Z is apparent at 60 hpf. The CAH-Z staining begins at 72 hpf in the central portion of the retina, and extends throughout the retina by 84 hpf, although at very low levels. The cells which express CAH-Z at 72 and 84 hpf also express HNK-1. In addition, analyses of the marginal zone, a dividing "embryonic-like" region of the adult retina, showed that cells co-stain with HNK-1 and CAH-Z. The data from the embryos, and the striking data from the marginal zone, suggest that the HNK-1 bearing radial cells are MCs, or become mature MCs in many, if not all, cases.

Materials and Methods

Zebrafish Colony Maintenance and Breeding

Animals were raised under natural lighting or using 12 hours light/12 hours dark cycles. The animals were fed twice a day with commercial flake food (TetraMin), except








before breeding, when they were fed artemia and flake food. Breedings were performed in a separate tank with fresh, aerated tap water. The ruby and wild-type AB strains were obtained from stocks maintained by Dr. John Dowling, Harvard University (Fadool et al. 1997). Some immunohistochemistry was performed on fish obtained from a local supply house, Felton Aquatics, Daytona Beach, FL. All fish were staged as hours or days postfertilization.

Gel Electrophoresis

Animals were anesthetized by chilling on ice and were then decapitated into TBS with sterile scissors. Tissues were dissected away from the dissociated heads and placed in sterile 1.5 ml microcentrifuge tubes on ice. The samples were spun in a Beckman microcentrifuge at top speed for 5 min. Excess liquid was removed and the samples were resuspended in 300 pL of H20 for sonication. Samples were sonicated until no tissue chunks were left, and insoluble material removed by centrifugation twice for 15 min. The supernatant was removed and the total protein content was determined using the Bradford method (Bio-Rad).
The protein samples were separated by 5%-15% gradient sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) using the buffer system of Laemmli (1970). Proteins were electroblotted to PVDF (Schleicher and Schuell, Inc.) for Western blot analysis (Towbin et al. 1979). Total protein was stained with Fast green in 5:1:5 (methanol: glacial acetic acid: water), followed by several washes in 5:1:5 alone.

Polyclonal antiserum against purified zebrafish carbonic anhydrase (pAbZ) was made in rabbits using previously described techniques (Linser and Perkins, 1987). The anti-zebrafish antisera: AI-J-29, A1-J-36 (first boost and bleeds), A2-J-15, and A2-J-22 (second boost and bleeds) were tested against zebrafish retina. The PVDF blot was blocked with Blotto (5% nonfat dry milk in TBST {TBS/0.1% Tween-20}) to minimize background signal. Primary antisera were diluted 1:50 in Blotto and incubated with blots









for 1 hour with shaking. Alkaline phosphatase-conjugated Affmi-Pure goat anti-rabbit IgG (H+L) secondary antibody (Jackson Immunochemicals, Inc.) was diluted 1:1000 in Blotto and incubated for 1 hour with shaking. The A2-J-22 antiserum had the highest specificity and titer against zebrafish tissues and was used for all immunohistochemistry analyses (Fig. 3.1). The HNK-1 monoclonal antibody used for immunohistochemistry was obtained from the American Type Culture Center (Denver, CO).

Tissue Processing and Immunohistochemistry

The adult retinas were harvested for cryosectioning into TBS and fixed
immediately on ice with 4% % paraformaldehyde/0.1 I M cacodylate buffer (pH 7.2). The retinas were fixed overnight at 4C and then washed with TBS. The retinas were placed in 30% sucrose in TBS overnight at 4oC. They were then mixed into O.C.T. compound (Tissue-Tek) and frozen for cryosections. Cryosections were cut at 20 uM.

Embryonic retinas were fixed in either 4% paraformaldehyde/0.1 M cacodylate buffer (pH 7.2), or Bouin' s fluid (75% saturated aqueous picric acid, 25% formalin, 5% glacial acetic acid) for two days at 4oC. Embryos were washed three times with TBS buffer and dehydrated through ascending concentrations of ethanol. I then incubated the tissues two times in xylene for 15 min, and two times in 68oC paraffin for 30 minutes. The embryos were then embedded in fresh paraffin, and sectioned at 6 uM or 8 uM. Blocks were cooled to 4oC before sectioning, which helped maintain the tissue' s structure during sectioning. Sections were spread on water-covered heated slides. After all sections were cut, the water was blotted off and the slides were heated for 30 minutes at 50'C. Before immunostaining the blocks were rehydrated through a standard series of xylene and descending ethanol baths.
Samples were blocked with 2% normal goat serum (NGS) in TBS for 30 min.
Monoclonal antibody supernatants were added directly to the slide without dilution (antiGS) or diluted 1:1 in TBS (HNK-1). Polyclonal antisera were diluted 1:50 into the









accompanying monoclonal antibody supernatant or 2% NGS/TBS. After the primary antibody incubation, slides were washed three times with TBS. Secondary antibodies were diluted 1:50 in 2% NGS/TBS (in all cases the secondary antibodies were fluoresceinconjugated goat anti-rabbit, [FITC-GAR] and Texas Red goat anti-mouse, [TR-GAM]; Jackson ImmunoResearch Laboratories, Inc.). All antibody reactions were allowed to incubate for at least 1 hour. Washes were as above, slides were mounted with 60% glycerol containing p-phenylenediamine and coverslipped.

Results

Western Blot Analysis

A polyclonal antiserum to zebrafish CA was used to probe protein extracts from gill, brain, and retina. The protein was separated on gradient SDS-PAGE, and then transferred to PVDF. pAbZ cross-reacted with proteins in retina, gill, and brain by Western blot analysis. The cross-reactive band migrated at 29 kD, the expected molecular weight of CAH-Z (Fig. 3.1; Deutsch, 1987). The appearance of CAH-Z protein in brain contradicts the absence of message in Northern analysis (Fig. 2.5). The only immunohistochemical staining seen with the antiserum is found in the blood vessels and not in the neural tissue itself (data not shown). The difference between message and protein presence might be explained by the stability of the protein in relation to the message in the blood vessels.

Cellular Localization in the Retina

Zebrafish larvae were collected at half-day increments from 1 day post-fertilization (1 dpf) through 4dpf. After processing, the retinas were examined for CAH-Z, GS, or HNK-1 staining. The time-points that show first or important expression patterns will be discussed. It needs to be noted that zebrafish embryos can be asynchronous by 4 hours by 2dpf, and that our fish were raised at 25oC instead of 28oC, which is the optimum









which is the optimum temperature (Schmitt and Dowling, 1996; Sandell et al. 1994a; Sandell et al. 1994b; Lynch et al. 1993).


1 2 3 4 5 6 7


kDa 27.5 18.9 -


8 9 10 11 12 13 14


Figure 3.1 Western blot analysis. Zebrafish tissues were separated on 5%-15% SDS-PAGE and transferred to PVDF. A) Total protein was visualized by staining with Fast Green. B) CAH-Z was visualized by incubation with several stocks of anti-CAH-Z polyclonal antiserum (pAbZ), a secondary incubation with alkaline phosphatase (AP)-GAR antiserum, and an AP-based, BCIP and NBT color reaction. The samples which were loaded and their total protein concentrations were: lanes 1,8 - 25 gg standards; lanes 2,9 25 gg each gill soluble protein; lanes 3,10 - 25 gg each brain soluble protein; 4-7, and 11-14
- 10 jg each retina soluble protein. The blot was cut into four sections and incubated with identical dilutions of four different pAbZ serums: lanes 8-11 with A2J22; lane 12 with A2J15; lane 13 with A1J30; and, lane 14 with A1J22.

Adult

Immunohistochemistry of adult zebrafish retina was performed to determine

which cells express CAH-Z. The adult showed a MC-specific staining pattern for CAH-Z

as determined by double-labeling with GS (Fig. 2). GS has previously been described as

glial-specific in many systems, including the retina of all vertebrates studied (Linser and

Moscona, 1981; Linser et al. 1985; Linser et al. 1997). The horizontal neurons of most


kDa 27.5


18.9-















PP PC OPL INL IPL GC NF


Figure 3.2. The expression pattern of GS, CAH-Z, and HNK-1 in the adult retina. A) A frozen section of an adult zebrafish retina stained with pAbZ against CAH-Z. B) The same frozen section as in A, only stained with an antibody against chicken GS. The asterisks mark regions where the staining patterns can be clearly seen to overlap one another. The regions of the retina are labeled in-between the two figures. C) A paraffin section of adult zebrafish retina showing the marginal zone stained with pAbZ. D) The same section as in C, only stained with the HNK-1 antibody. The open-headed arrow lies across the photoreceptor layer and points to the opl. The horizontal white arrows points to cells which are clealry stained by both pAbZ and the HNK-I antibody. The vertical gray arrows point to cells which are stained by HNK-1 but not by pAbZ, but which have the same general morphology. The abbreviations are: PP - photoreceptor outer processes; PC photoreceptor cells; OPL - outer plexiform layer; INL - inner nuclear layer; IPL - inner plexiform layer; GC - ganglion cell layer; NF - nerve fiber layer.









fish contain an immunodetectable CA (Linser, 1991). The staining in Figure 2, panels A and B overlaps exactly, and is not present in other neurons. Marginal zone

Most fish continue to grow throughout their lives; as a result of this, their retinas also continue to grow. Therefore, unlike a bird or mammal retina, which is mature by hatching or birth, the adult fish retina contains undifferentiated cells (Hagedorn and Femrnald 1992; Johns 1977). The undifferentiated cells lie in the most anterior region of the neural retina, known as the marginal growth zone (Johns, 1977). The marginal growth zone is a useful tool for dissecting developmental expression patterns. The most anterior portion is "embryonic" in nature, while several cells away the retina is fully differentiated (Wetts and Fraser, 1988; Godbout et al. 1996; Papalopulu and Kintner, 1996).

Examination of the most anterior cells show that they do not express CAH-Z or HNK-1 (Fig. 2, panels C and D). Moving posteriorly, the CAH-Z and HNK-1 expression patterns differ. The first CAH-Z staining appears in cells with typical MC morphology, that is a central soma with processes leading to the ilm and olmn (Fig. 2, panel C). These cells also express the HNK-1 epitope (Fig. 2, panel D). However, the HNK-1 signal can also be seen in cells more anteriorly which do not express CAH-Z. The more anterior HNK-1 positive cells have two processes stretching from the soma, one to the ilm and one to the olin, identical to the cells expressing CAH-Z. This suggests that they are the same cell-type at different stages of development. Farther from the marginal growth zone the morphology of these cells becomes more amorphous, presumably because the complex arrangement of processes forming the ipl and opl are developing. Day 1

At 24 hpfthe zebrafish retina and lens are obvious in our sections. No CA or HNK-1 (Fig. 3 panels A and B) immunoreactivity is evident. The skin can be seen to









clearly stain for CAH-Z at this time however. The staining in the HNK- I panel comes from non-specific interaction with the yolk. Day 2.5

At 60 hpf there is still no visible staining using the pAbZ antiserum (Fig. 3, panel C), even though skin and other tissues are stained (data not shown). However, clear staining of radial cells with the HNK- 1 antibody appears at 60 hpf (Fig. 3. panel D). The morphology of the HNK- I positive cells suggests that they might be glial cells (see Discussion).


Figure 3.3. CAH-Z (left column) and HNK-1 (right column) staining in 24 hpf and 604) hpf embryos.. A) A 24 hpf retina stained for pAbZ showing no immunofluorescence; B) Same section showing no HNK-1 present; C) 60 hpf retina stained with pAbZ showing no immunofluorescence in the retina, although the skin and blood vessels are clearly positive; D) Same section showing staining of "radial glia" with HNK-I. The arrows mark the length of the outer edges of the HNK-1 staining that coincides with the plexiform layers. The asterisks marks the overlying skin, which is stained by pAbZ but not HNK-1. L - lens.








Day 3

By 72 hpf the inl contains both CAH-Z and HNK-1 positive cells (Fig. 4, panels A

and B). The 72 hpf retina sections contain few cells expressing CAH-Z. These cells are

localized to the central protion of the retina in most cross-sections. Whether expression

first began in the "ventral patch" as described for photoreceptor cell differentiation was

not determined (Raymond et al. 1995). These sections contain CAH-Z staining in the




L!





I L
A


















Figure 3.4. CAH-Z (left column) and HNK-1 (right column) staining in 72 hpf and 84 hpf embryos. A) A 72 hpf retina stained for pAbZ showing a few cell bodies in the inl staining. B) The retina of a different animal, from the same clutch as that in A, stained with HNK-1. Staining is found in a MC-like pattern and might now also be present on other cell types. C) An 84 hpf retina stained by pAbZ showing a number of positive cells throughout the breadth of the retina. D) The retina of a different animal, from the same clutch as in C, stained with HNK-I. This section again clearly shows MC-like staining. The white arrows mark the breadth of the retina that is positive for the respective antigen. The open headed arrows in B point to possible different cell types; the left arrow points to a putative MC, while the right arrow points to a possible amacrine cell. L - lens.









centralized soma with little staining present in the processes. In this same fish, intense staining could be seen in skin and ear, in addition to other tissues, suggesting that the protein concentration in the MCs is very low at this time (data not shown).

The HNK-I staining is still present in cells with typical MC morphology.

However, in many sections it appears that perhaps the amacrine cells are also stained at this time. However, the MC processes wrap the neuronal somas and processes. The wrapping makes it hard to tell, with a membrane-bound antigen, which cell has the epitope on its surface.

Day 3.5

At 84 hpf there is CAH-Z present in cell somas and processes throughout the

central portion of the retina (Fig. 4, panels C and D). The intensity of CAH-Z staining in the retina is still very low, but serial sections show staining throughout the central portion of the retina. The HNK-1 staining is still clearly present at this timepoint.

Discussion
The first finding of note from this immunohistochemical study is that MCs

differentiate biochemically very near the third day after fertilization, according to the appearance of CAH-Z. This timing agrees with the data obtained from other species, in relationship to retinal differentiation. The appearance of MC-specific markers in birds and mammals occurs late in development (Linser and Moscona 1979; Linser et al. 1997). The MCs are among the last cells, or are the last cells, to biochemically differentiate in all retinas studied.
The appearance of cell-specific markers is described for several cell-types in the zebrafish retina. Ganglion cell axons can be stained by neurotrophin receptor antibodies by 35hpf (Sandell et al. 1994b), and by GABA antibodies as early as 48hpf (Sandell et al. 1994a). The photoreceptor cells (rods and cones) begin differentiating shortly after their final mitosis, which occurs at 48hpf. Biochemical markers of double-cones are present at









48h, and the adult mosaic pattern is present in the 54h-pf-embryo (Larison and BreMiller, 1990).
The zebrafish becomes a visual feeder by 4 dpf. Easter and Nicola (1997)
determined the visual acuity of the zebrafish using the optikokinetic response (OKR) as a measure. They found that the fish had a measurable OKR for the first time at 73 hpf, and that it increased to 100% response by 81 hpf. The cause of the improved OKR was not determined. The improved OKR could not be linked to an increase in the functional retina, either at the gross level or at the level of the photoreceptor outer segments. The improved OKR was suggested to result from strengthened extraocular muscles.

Improved OKR coincides with the biochemical maturation of the MCs; the

biochemical differentiation of the MCs might be one of many coincidental occurrences at 72 hpf. At 72 hpf CAH-Z is found only in the central most portion of the retina. At 84 hpf, when the OKR reaches 100% response, the expression has widened to the extent of the plexiform layers (defined by Easter and Nicola { 1997} as the limit of the functional retina). Thus, the biochemical maturation of the MCs appears to coincide with the appearance and improvement of the OKR.
The second finding of this chapter is the absence of CAH-Z in primitive
retinoblasts. A previous study from this laboratory showed a correlation between early CA-II expression and a large vitreous compartment, such as in the chicken eye (Linser and Plunkett, 1989). The swelling of the eye during morphogenesis occurs through an increase in intraocular pressure (lOP) (Coulumbre, 1956). lOP is generated indirectly through the action of CA-II and bicarbonate transport. Qualitatively, the mouse, which contains a much smaller vitreous chamber than the chicken, has much lower levels of CA-II. It would logically follow that the zebrafish - which has almost no vitreous chamber - would have little if any CA expressed during this time. This agrees with the absence of CAH-Z staining in retinoblasts at 24 hpf.









The developmental expression of the HNK-1 epitope is the third finding presented in this chapter. The adult retina of four previously studied fish species contains the HNK1 epitope in all the different layers (Uusitalo and Kivela, 1994). The MCs are one celltype that expresses HNK-1. We investigated the developmental expression of the HNK-1 epitope and found that it is first expressed in cells that later appear to differentiate into MCs. It is impossible to say from our analysis whether all HNK-1 positive cells become MCs, or whether it is only a subset. MC processes surround the soma and processes of other cells. This makes it difficult, with the membrane-bound HNK-1 epitope, to determine which cell is expressing the carbohydrate. It is clear from our double labeling experiments that biochemically immature MCs express HNK-1, and continue to do so through maturation. Whether the increase in staining seen in the mature retina is due to other cell-types, or more MC processes remains unknown. The HNK-1 epitope is the earliest known marker of zebrafish Miller glial cells.

The HNK-1 antibody recognizes a 3' -sulfated glucuronic acid. This epitope is

found in many developmentally relevant glycoproteins and proteoglycans (Schachner and Martini, 1995). Among the glycoproteins carrying the HNK-1 epitope are: three immunoglobulin superfamily adhesion molecules (the myelin-associated glycoprotein, neural-cell adhesion molecule, and LI); a glial-cell surface-linked ATP-degrading enzyme 5' nucleotidase; Tenascin-C and Tenascin-R; and, ependymin (Schachner and Martini, 1995; Kunemund et al., 1988).

The HNK-1 epitope appears to function during neural development both in cellcell adhesion and cell-substrate adhesion. When early postnatal mouse cerebellum cultures are incubated with antibodies against the HNK-1 epitope, a decrease in adhesion between neurons and astrocytes, and between astrocytes and astrocytes is seen (Kruse et al. 1985). Neurite outgrowth on poly-D-lysine or laminin is inhibited in microexplant cultures of postnatal mouse cerebellum when treated with monoclonal antibodies against the HNK-1 epitope, or excess ligand (3' -sulfated glucuronic acids Kunemund et al. 1988). Incubating









neural crest cells both in vivo and in vitro, with HNK-1 I antibody perturbs normal migration (Bronner-Fraser, 1987). The identification of integrins carrying the HNK- I epitope further implicates it in cell-substrate adhesion (Lallier et al. 1992; Lallier and Bronner-Fraser, 1992; Pesheva et al. 1987). These experiments suggest that the HNK-1 carbohydrate regulates early developmental processes by influencing cell adhesion. The appearance of HNK-1 on radial cells and mature MCs raises questions about a possible function in tissue lamination and neuronal guidance.

The zebrafish is a good model to study the MC-specific expression of CAH-Z. The zebrafish lacks CA expression in its retinoblasts, which is not true of birds and mammals. The background from these cells must be dealt with before performing promoter analyses in these systems. While this is not a major problem, the absence of CAH-Z from zebrafish retinoblasts is a definite advantage. A limitation of other fish systems is the appearance of CA in horizontal neurons. A large concentration of CA in the horizontal neurons is found in the elasmobranchs and the southern flounder (Linser et al. 1985). Other teleosts such as Fundulus heteroclitus express CA in horizontal neurons early in development, and then shut it off at later timepoints (Unpublished observation). The zebrafish retina contains no CAH-Z in its horizontal neurons at any time.

This study provides the answer to the second question raised in Chapter 1, If a high-activity CA is present, is the CA localized to the MCs? The answer is that the zebrafish CA, CAH-Z, is expressed only in MCs. The major aim of this project was to determine whether the zebrafish would be a good in vivo model for studying CA regulation in MCs. The data so far supports the use of the zebrafish.














CHAPTER 4
ZEBRAFISH GENOMIC CLONE ISOLATION AND PARTIAL SEQUENCING AND INTRON/EXON BOUNDARY CLONING AND SEQUENCING


Introduction and Data Summary

Promoters in Gene Regulation

The third question that this dissertation sought to answer was whether MC specific expression of CAH-Z was controlled through a proximal 5' promoter. The expression of many gene's is regulated through their 5' flanking sequence, which I am referring to as a proximal 5' promoter. This chapter presents the isolation of CAH-Z genomic clones that should contain the necessary regulatory modules for MC specific expression, including the proximal 5' promoter, the gene itself, and the 3' extragenic sequence. I also present a functional test of a chicken proximal 5' promoter, as a homologous test system.
The proximal 5' promoter is responsible for gene regulation in many systems studied (Cvekl and Piatigorsky 1996; Kirchhamer et al. 1996). The regulation is often times controlled through other regions, which can be found either upstream or downstream of the gene, or even in introns (Kirchhamer et al. 1996). The proximal promoter contains cis-regulatory elements that are bound by trans-acting transcription factors. Transcription factors are proteins that either interact with the basal transcription apparatus, other transcription factors, or the DNA alone. A group of cis-regulatory elements can work together in the form of a regulatory module. Regulatory modules can control spatial, temporal, or levels of expression.
In many promoters studied, the gene's expression pattern can be recapitulated using a promoter of several kilobases linked to a reporter gene (Davidson, 1993;









Davidson, 1991; Arnone and Davidson, 1997). As discussed in Chapter 1, the CA-II promoter is proving to be more complex than this. Cell-specific expression cannot be obtained even by using up to 10 kilobases of proximal 5' promoter, the first exon and intron (which contain highly conserved sequence) and 3' untranslated sequence (Erickson et al. 1995). CA-II is not expressed only in a single cell-type, or one tissue, or only during one stage of development. Instead, it is expressed in a cell-specific manner in almost all tissues, and during most stages of development. The expression of CA-II in many celltypes within many different tissues might require a more complex regulatory system.

The transgenic lines produced to test large genomic fragments for CA-II cellspecific expression were never examined for expression in the retina (Erickson et al 1995). Given the conservation of retinal structure in vertebrates and the conservation of CA expression in the MCs, it seemed possible that retinal expression might be controlled through a proximal 5' promoter.

To test whether a proximal 5' promoter could drive expression, I chose to study the chicken CA-II (CCA-II) promoter. This decision was based on the availability of a CCA-II proximal 5' promoter, and our laboratory' s hypothesis that the expression of CA in MCs is controlled by a conserved regulatory system. Specifically, we hypothesize that the regulatory modules responsible for MC-specific expression of CA are conserved in all vertebrates. Therefore, results obtained in one system can be directly applicable to another system.

The reasoning for our hypothesis is very straightforward. The general structure of all vertebrate retinas are well conserved: They contain alternating laminae of cell bodies and plexiform layers (in which the synaptic connections are made). A layer of sensory cells (rods and/or cones) is located on the ventricular border. The ganglion neurons, with their axons leading to the optic nerve head, are located most vitreally. The horizontal neurons, bipolar neurons, amacrine neurons, and MC soma are located centrally, with processes extending into the ipl and opl. The biochemical enzymes necessary for retina








function are also conserved between divergent species (Dowling, 1985). Given the importance of CA in maintaining the retinal microenvironment, we feel its conserved expression in MCs is critical. Furthermore, we suggest that it is probable that CA' s regulation is controlled in a conserved manner, rather than being "re-invented" several times.

The hypothesis that MC-specific CA expression is conserved in all vertebrates influenced me to begin studying chicken CA-II (CCA-II). A 5' CCA-II proximal 5' promoter had been previously isolated (Yoshihara et al. 1987), and shown to be active in patched lens epithelial cells (PLE) in vitro (Buono et al. 1992). I wished to ascertain whether this ~1.4 kb proximal 5' promoter could drive MC-specific expression of a reporter gene.

The work reported in this chapter is preliminary data, which could aid future

studies of CA regulation. Two interrelated sets of experiments are reported: the isolation of genomic sequences from the zebrafish, and the testing of a CCA-II proximal 5' promoter.
I have isolated a zebrafish PAC clone which contains ~200 kb of genomic DNA including the CAH-Z gene. Two fragments were isolated from the zebrafish PAC clone. These fragments have been partially sequenced. A fragment of -2.6 kb begins after the first intron and contains sequence in the 3' direction. The second fragment begins -400 bp 3' of the CAP site and extends in the 5' direction for -5 kb. Lastly, all but one intron/exon boundary have been isolated and sequenced using the conserved intron/exon boundaries of mammals.

The experiments using CCA-II proximal 5' promoter showed that it was not sufficient to drive MC-specific expression. I produced a reporter construct using the CCA-II promoter to drive green fluorescent protein (gfp) expression. This construct was able to drive gfp expression in the PLE cell-culture system. It also drove expression in chicken embryonic fibroblast (CEF) cell-cultures, which do not express CA-II. When








tested in retina aggregate cultures for MC-specificity, there was no increase over the control plasmid. The aberrant expression in neurons suggests regions necessary for neuronal suppression were missing.

Materials and Methods

Cloning CAH-Z Introns Through PCR

Intron positions were inferred from known intron/exon boundaries in mammalian CA genes (Fig. 4.3). PCR primers were designed to span each putative intron boundary. The primers used were PAL: 91 and 92 (Intron A), 93 and 94 (Intron B), 95 and 167 (Intron C), 97 and 98 (Intron D), 163 and 165 (Intron E). The sequences of the primers are: 91 (CGCTTGGGGATATGGACCAGC); 92 (AGCTTTCTGCCCAACTCTCTG); 93 (GTTGATGACGACAACAGCTCA); 94 (TGATGGGACCTCCAGCCAGAG); 95 (AGCCTGATGGACTTGCTGTGG); 97 (TGCCCTTGATGACATCAAATC); 98 (AAGTTGGCAAATGTAGTCTGT); 163 (GCTGGAACCAAGTTCCC); and 165 (GTGTTCCAGTGAACAAG); 167 (GTCTTGGATTTGCAGCG). The PCR reactions used standard conditions with the addition of Stratagene cloned Pfu. Because the intron lengths were unknown, the PCR reactions were allowed to extend at 72oC for 7 min during each cycle. Subcloning, sequencing, and alignments were performed as described in Chapter 2. Final intron sequences were joined to the cDNA sequence manually. Isolation of Zebrafish PAC Clones

A filtered array library of zebrafish PAC clones was obtained from the

Ressourcenzentrum im Deutschen Humangenomprojekt, Berlin-Charlottenburg, Germany for the isolation of CAH-Z genomic clones. The product of a PCR using PAL 94 and PAL 116 was used for screening. This PCR fragment carries the sequence for the 5' most region of the cloned cDNA. A Pharmacia Oligolabeling kit was used with at-32P dCTP and following the "Standard Protocol" to produce probe. Arrayed filters were screened









using a modified Church-Gilbert's Medium (0.5M Na2HPO4, 7% SDS, 1 mM EDTA) (Church and Gilbert, 1984). Filters were prehybridized at 65oC for one hour with three buffer changes, in a RubbermaidTM square container with rotation. Probe was added to fresh buffer and incubated with the filters at 65oC for 20 h. Filters were washed twice with 40 mM Na2HPO4, 1% SDS, 1 mM EDTA at 650C for 10 min and placed on X-ray film. The blots were left at -80oC for several days and then developed.

Positive cosmids were identified and shipped from the Ressourcenzentrum im
Deutschen Humangenomprojekt. The PAC clones were grown in LB/Kanamycin media overnight and isolated using a protocol for P1 bacteriophage (Pierce and Sternberg, 1992). The DNA was digested for 3 hours at 37oC with Hind III (GibcoBRL). The resulting fragments were separated on a 1.3% agarose/TBE gel, and transferred to MagnaGraph nylon backed membrane (MSI, Inc.). The transfer was performed using a Schleicher & Schuell Turbo-Blotter for 3 hours. The blots were placed in a preheated autoclave for 3 minutes to denature the DNA, which was then linked to the membrane using a Stratagene StratalinkerTM 1800 set on AutoCrosslink. The blots were screened using the same protocol as with the original filters. Positive band sizes were estimated from the blot.
The DNA was isolated from a new gel using a Qiagen Qiaex II DNA isolation kit. The DNA was ligated into pBluescript, which had been precut with Hind III and treated with shrimp alkaline phosphatase (USB). The ligation was carried out overnight at room temperature, and then transformed into JMI 09 competent cells. The cells were plated on LB/carb agar plates saturated with IPTG and X-Gal. Ten colonies were chosen from each plate and grown in 3 mL liquid cultures. Plasmid DNA was isolated using a Promega Wizard MiniPrep kit followed by digestion with Hind III. The Hind III fragments were separated on a 1.5% agarose gel, the DNA was transferred to MagnaGraph by Southern blot, and the blots were probed as before. Three positive clones from each set (representing the two isolated bands) were sequenced using 5S and standard dye-





53


terminator protocols. One colony from each set was then sent to the U ofF's DNA sequencing core for further sequencing.

Promoter-Reporter Plasmid Construction and Purification

For a control plasmid the UF2 adeno-associated virus (AAV) vector plasmid was used (Gottlieb and Muzyczka, 1988). This construct contains the cytomegalovirus promoter (CMV) driving gfp expression with extra cassettes added for increased expression and stability. The previously characterized chicken CA-II promoter was obtained from Dr. Jerry Dodgson, Michigan State University (Yoshihara et al. 1987). It was cloned into the UF2 vector after removal of the CMV promoter by digestion with Kpn I and Xba I. The UF2 CMV-less vector was treated by Klenow to blunt-end the terminals, and then incubated with shrimp alkaline phosphatase to prevent recircularization (USB, manufacturer's protocol). The CCA-II promoter fragment had Hind III sticky ends, which were removed by Klenow treatment. The promoter fragment was ligated into the UF2 vector to form the Chicken green (Chig) series of constructs Fig.
pTR-UF2

ME Poe4PTK neor




Chig-8

W SD: Poenhi PTK I neor pA2



Figure 4.1 Chig-8 and UF2 constructs. The UF2 construct was previously produced by The University of Florida's Viral Vector Core (Zolotukin et al. 1996). The Chig-8 construct was only different in the promoter that drives gfp expression (chicken CA-II vs. CMV). 4.1), and transformed into JM109 ultracompetent cells. Insertion orientation was determined by isolating the plasmid from twelve colonies and cutting with Pst I, which









gives an asynchronous cutting pattern. Construct Chig-8 was used as a positive test plasmid (correct promoter orientation), while Chig-1 was used for a negative test plasmid (reverse promoter orientation). Plasmid for transfection was isolated using a Qiagen Mega Kit. Concentration was determined using a GeneQuant II DNA calculator, all samples had an O.D. 260/280 of 1.8-1.9.

Cell Culture of Retina Aggregates, Patched Lens Epithelium and Chicken Embryonic Fibroblast Cells

Patched lens epithelium (PLE) cells were prepared as described (Overbeek et al. 1985). Lenses were removed from 12 day chicken embryos and placed in a 60 mm dish with 6 mL of prewarmed Ham' s F-10 media + 1% gentamicin. Lenses were transferred to filter paper wetted with Ham' s and rolled around to remove non-lens tissue. Groups of

6 lenses were placed in 3 mL of weakened IX trypsin and disrupted with forceps. Disrupted lens material was incubated at 37oC for 1.5 min and pipetted twice with a 5 mL pipette to further disrupt the tissue. They were then incubated an additional 1.5 min at 370C. Each group was transferred to a 15 mL tube with I mL of fetal calf serum and pelleted with gentle centrifugation. The supernatant was removed and the pellet was suspended in 6 mL of DMEM + 10% fetal calf serum + 1% gentamicin. Cells were seeded onto a 60 mm collagen coated dish and incubated at 37oC and 10% CO2. After 48 hours the media was changed, the cells were washed, and then transfected.

Chicken embryonic fibroblasts (CEF) were prepared from embryonic day 9 (e9)

chicken skin. Chicken skin was peeled off with watchmaker forceps and placed in calcium magnesium free medium. The skins were washed several times and then incubated in 3 mL of 0.3% ICN trypsin for 20 min at 370C in a 15 mL tube. The tube was then filled with Medium 199 + 10% fetal calf serum + Penicillin/Streptomycin (CM199) and placed on ice for several minutes. The tissue was spun down at 40C for 4 minutes at 1500 rpm in a Sorvall clinical centrifuge, washed once with 15 mL of CMI199 and then brought up in









5mL of CM199 for triturating. The tissue was triturated with a 3 mL transfer pipette until a milky solution was formed (approximately 25 times). The cells were diluted to 10 or 15 mL, further diluted 1:100, and counted on a hemocytometer. CEF cells were plated at a density of 175,000 cells/60mm on top of sterile plastic round coverslips. The cells were transfected 12 hours later, allowed to grow for 48 hours, and harvested.

Retina aggregates were made from e9 chicken retinas. The e9 retinas were

dissected free from other tissues in CMF, then spun at 1500 rpm for 3 minutes and washed IX with fresh CMF. As above, the tissue was dissociated by adding 3 mL of ICN 0.3% Trypsin/CMF and incubating at 37oC for 20 min. Then, 10 mL of CM199 was added and placed on ice for several minutes. The cells were spun down and the supernatant was removed. For dissociation, 5 mL of medium was added and triturated until no clumps remained, then an additional 10 mL of medium was added. The cells were counted on a hemocytometer and then transfected.

Transfection Procedure in Cell Cultures

Transfections of PLE and CEF cells were carried out as described (Overbeek et al. 1985). The same calcium phosphate precipitation-type transfection was used for retina aggregates as for PLE and CEF cells (except for the fact that retina cells were transfected in suspension). Approximately 45 million cells were placed in a 25 mL Erlenmeyer flask up to a volume of 2.0 mL with CM199. To this flask 1.0 mL of a total 2 mL calcium phosphate precipitation was added (see below). The flask was filled with 5% CO2 gas/air mixture and incubated as previously described for aggregate formation (Moscona, 1961, Linser and Moscona, 1979). The transfection was allowed to proceed for at least 8 hours and no more than 16 hours, at which time the aggregates were allowed to settle by gravity and were then washed with CMI 99. The cultures were continued for six days at 37oC at a rotation speed of 72 rpm, with fresh medium being exchanged every day.









The DNA calcium phosphate precipitates were prepared in -2 mL total reaction volumes. For retina transfections 50 pg or 5 [tg of plasmid DNA was used, while PLE and CEF cells all received 10 pg of plasmid DNA. The DNA was mixed with 2 mL of Hepes Buffered Saline (HBS) solution, pH 7.05. While vortexing the DNA-HBS solution, 2.0 M CaC12 was added to a final concentration of 125 mM. This solution was allowed to incubate at room temperature for 45 min. As mentioned above, 1 mL was used for retina aggregate cultures while CEF and PLE cultures received 2 mL. Tissue Fixation and Immunohistochemistry

CEF and PLE cells were plated onto plastic, round, cover slips. These coverslips were fixed in their wells with 4% paraformaldehyde/PBS for 1 hour at room temperature. These cells were washed several times, and mounted upside down on a drop of 60% glycerol. The gfp fluorescence was observed using an FITC epi-illumination filter arrangement.
Retina aggregate cultures were allowed to proceed until el5, at which time they were removed and fixed with 4% paraformaldehyde in PBS overnight at 4oC. The aggregates were fixed with 10 mL of paraformaldehyde solution after being spun down in a 15 mL tube. The tight-formed pellet was then gently pushed off the side by the force of expelled liquid through a transfer pipette. The pellet was washed 3X with PBS and placed in 30% sucrose/PBS overnight at 40C. The next day the sucrose-equilibrated pellet embedded through freezing in O.C.T. (Tissue-Tek) for frozen section. The aggregates were sectioned at 14 uM or 20 uM and placed on gelatin coated slides. The slides were kept at -800C at least overnight and usually for several days or more.
The aggregate sections were thawed in TBS with several solution changes over the course of a half-hour. The slides were then flooded with TBS/ 0.1% Triton-X 100/2% normal goat serum for at least a half-hour at 370C. The slides were incubated in anti-gfp polyclonal antiserum at a dilution of 1:100 (Clontech) in monoclonal antibody









supernatants against either chicken CA-II, or 2M6 (Linser et al. 1997a). Secondary antibodies were diluted 1:50 in 2% NGS/TBS and incubated on the slides for at least I hour (in all cases the secondary antibodies were goat anti-rabbit fluorescein isothiocyanate, FITC- GAR and goat anti-mouse Texas Red, TR- GAM; Jackson ImmunoResearch Laboratories, Inc.). Cells were viewed using FITC and Rhodamine optics and counted by manual comparison between the two signals. Statistics

For each transfection, 100 gfp positive cells were counted and determined to be: MC marker positive (i.e., 2M6 positive); MC marker negative, or ambiguous. The average percentage of positive cells from positive plus negative cells was determined. The data of several repetitions was used to determine the standard error of the mean. All data was entered and all calculations were performed, using Quattro Pro �.

Results

Isolation of CAH-Z Genomic Clones

A filtered array library ofzebrafish PAC clones was obtained and screened for CAH-Z. From the initial screening, six possible positives were identified. The positive PAC clones were obtained from the Resource Center of the German Human Genome Project. They were screened by Southern analysis of Hind III digested PAC DNA. Of the six clones, four were positive by Southern analysis. The PAC clones BUSMP706J0263Q3 (abbreviated J026) and BUSMP706H0163Q3 (abbreviated HO16) had the best banding pattern for the positive fragments' isolation. These two PAC clones were again digested and Southern blotted (Fig. 4.2). The bands were subcloned and named B I (upper band) and B2 (bottom band). After subcloning, transformation, and further probing by Southern blot analysis, plasmids B176 and B239 were chosen for sequence analysis. These plasmids contained the isolated bands in pBluescript. Both bands showed identity with CAH-Z









when sequenced. One end of the B 176 sequence is identical to the 5' most sequence of the CAH-Z cDNA, while the other end lies upstream of the gene. The B239 sequence begins inside the CAH- Z gene, after intron A and extends in the 3' direction.

123
23.1 e
9.4 * *
6.6.




2.3





Figure 4.2. Southern Blot of Zebrafish PAC clones J026 and H016. The PAC clones J026 (lane 2) and H016 (lane 3) were probed with the radiolabeled CAH-Z fragment PAL 94PAL 116. Lane 1 contained Lambda DNA digested with Hind III, the standards are in kilobases. The marks in each lane are duplicated from the nylon membrane, and they denote the presence of a distinct band.

Intron Cloning by PCR

The intron/exon boundaries for the cloned CA-I, CA-II, CA-Ill, and CA-VII genes are conserved (Hewett-Emmett and Tashian, 1996). CAH-Z introns were cloned by PCR across the presumptive intron/exon boundaries. The sequence was examined to determine where the intron/exon boundary would occur if conserved with the other isoforms. If there was an overlap of sequence on the 5' and 3' end of the introns, then the exact intron/exon boundary was determined using the AG-GT rule. The AG-GT rule refers to the fact that the first two and last two basepairs of the intron are often AG and GT respectively. When compared to the human isozyme genes, the zebrafish intron/exon boundaries are conserved (Fig. 4.3). The last intron, Intron F, was unable to be cloned, even though the boundary is completely conserved in all other vertebrate CAs. Whether









the intron is present and could not be cloned for technical reasons or is not present can only be speculated. However, with the completion of the CAH-Z genomic sequence, the presence or absence of Intron F should be made clear.


Sequence Intron A Intron B Intron C Intron D Intron E
1 1 0 0 0
HCA- I DKN/GPE NRS/VLK SAE/LHV LMK/VGE KTK/GKR HCA- II KHN/GPE DKA/VLK AAE/LHL FLK/VGS KTK/GKS HCA-III SHN/GPD DRS/MLR AAE/LHL FLK/IGH KTK/GKE HCA-VII QDD/GPS DRT/VVT PSE/LHL FLE/TGD RFK/GTK CAH-Z PAD/GPE NSS/TLA PCE/LHL FLK/IGA KSK/GRQ

Figure 4.3. Intronlexon boundaries for CAH-Z and the human cytoplasmic isozymes. The conceptually translated protein sequences around the known zebrafish introns are shown with the human isozymes for comparison. The intron/exon boundaries have been conserved in all the mammalian cytoplasmic families, and in the zebrafish isozyme. A "1" above the intron denotes that the intron begins after the first base of the next codon, while a "0" means that the intron begins in-between the two codons (Adapted from Hewett-Emmett and Tashian, 1996).

Comparative Analysis of CAH-Z Genomic Sequence


Combining the cDNA sequence together with the sequence from B 176, B239, and the intron sequences determined by PCR produced a large sequence section of the CAH-Z gene (Fig. 4.4). This sequence was used to search the database for possible areas of homology. A CAP site was found at -359, which was also the 5' -most end of the cDNA cloned through 5' -RACE (see Chapter 2). A TATA box was located at -389. Many "putative" transcription factor-binding sites were found by homology searches. However, these sequences are so plentiful, and so many appear to be completely unrelated, that they are useless without DNA-binding assays to back up their basic sequence homology.

The CAH-Z genomic sequence is being determined (see the Appendix). The

subclones B 176 and B239 are being sequenced from the pBluescript insertion site towards the center. At this time, both plasmids contain some unsequenced information. CAH-Z genomic sequence is also being gathered by direct sequencing of J026.










-4000 -400 +1 400 800 1200 1600 2000 2400 2800 3200 3600 4000 4400
I 1 1 1I 1I I1 I I1 I I ,1,'1'1'






Figure 4.4. Graphical Representation of CAH-Z genomic sequence. This cartoon features the genomic information thus far known. The tall green box (far left) represents the promoter region upstream of the CAP site; the interrupted short red bar that splits the green box represents the fact that the central portion of the promoter has not been sequenced. The tall black boxes represent exons 1-5. The short blue bars represent Intron A - Intron E. The tall red box (far right) represents sequence that is thus far represented only from cDNA analysis; Intron F, which is not yet cloned, should lie in this region if its intron/exon boundaries are conserved. The distance given is the total length of the CAH-Z cDNA at this point.

Testing the Chig Constructs in Defined Cell Cultures


It was first necessary to determine whether the new constructs were viable before performing experiments in the aggregate culture system. The CCA-II promoter had been previously described to drive chloramphenicol acetyltransferase expression in PLE cells (Buono et al. 1991). Along with the UF2 control plasmid, both Chig-8 (forward promoter, Fig. 4.1) and Chig-1 (backward promoter) were tested in these cells.

The results of transient transfection of these cells suggested the constructs were viable. Chig-8 transfected PLE cells showed expression of the gf protein as determined by viewing the fixed cells under epifluorescence (Fig. 4.5). In this case the native gf was visible under excitation and viewing through FITC fluoresence. No attempts were made to quantify this expression. As a positive control the UF2 vector was introduced into the PLE cells and the CMV driven g# was also visible with this technique. As a preliminary test of Chig-8's specificity, CEF cells were also transfected with UF2, Chig-8, and Chig-1. CEF cells do not normally express CA-II. Both UF2 and Chig-8 showed expression in the CEF cells. Therefore, it appears that the minimal promoter is capable of driving gfr









expression in PLE cells, but is unable to repress non-specific expression in CEF cells. The Chig-1 plasmid showed no gfj expression in either cell type (data not shown).























Figure 4.5 Chig-8 and UF2 in PLE and CEF cells. Ten gg of plasmid was transfected into either CEF cells (A,B) or PLE cells (C,D). A) UF2 in CEF cells; B) Chig-8 in CEF cells; C) UF2 in PLE cells; D) Chig-8 in PLE cells.

Testing Mtiller-Cell Specific Expression in Retina Aggregate Cultures


Retina aggregate cultures were used as a test system to determine whether the CCA-II promoter was capable of driving MC-specific, or selective, expression of a reporter gene. The UF2 plasmid was used as a positive control. Cell-type determination was made by double-labeling sections for gfp and 2M6, a marker of mature chick retina MCs (Linser et al. 1997a).








25

o n=10
0
k 2 0 .............................................. .........
CO
2n=3
C1 CL
C . 1 5 ..... .........
to CM

+
" 10 ................


5 - - - -.................




0
Chig-8 UF2

Figure 4.6. Miller cell specificity. gfp positive cells were randomly tested for co-expression of the MC marker 2M6. The averages of these cell counts were determined for two different constructs, Chig-8 and UF2, and the standard error of the mean was determined. The green, lower bars represent the averages, while the gray, upper bars represent the standard error of the mean.

These analyses suggest that the 1.3 kb chicken CA-II promoter is not sufficient for MC specific expression. Three repetitions of transfection and cell counts were done for UF2 and ten for Chig-8. The results (Fig. 4.6) show that CMV-driven g4-positive cells were MCs -13.3% of the time. In contrast the CA-II promoter-driven gf-positive cells were MCs -17% of the time. There is no statistically significant MC-selectivity caused by the CCA-II promoter.

Discussion

This chapter has focused on genomic elements of CA gene regulation in zebrafish and chicken. The zebrafish CAH-Z gene has been isolated and partially characterized. In the chicken, I show that a small (-1.4 kb) proximal 5' promoter drives reporter gene expression in a non-specific manner.









To begin studying the actual mechanisms regulating CAH-Z gene expression, I isolated CAH-Z genomic clones. Genomic clones were isolated from a PAC library that had an average insert size of 200 kb. The CAH-Z positive clone "J026" was digested with Hind III and two fragments were subcloned into a pBluescript vector. These fragments have been partially sequenced. J026 has also been partially sequenced in areas that B 176 and B239 do not cover.

The genomic sequence of CAH-Z was partially characterized. By comparing the CAH-Z cDNA and genomic sequence, I was able to elucidate the structure and sequence of Introns A, B, and C. When compared to the subcloned fragment's sequence, the PCR products used to determine the Intron/Exon boundaries contained some deletions. Thus, the lengths from Intron d and Intron E in Figure 4.4 are somewhat questionable. The continuing sequencing from J026 should clarify the intron structure of CAH-Z.
The subclone B 176 contained -5 kb of 5'-flanking sequence. Additional sequence 5' from B176 was obtained by directly sequencing of J026. When all the 5'-flanking sequence is run through BLAST, several regions show high identity (>90%) to a zebrafish bone morphogenetic protein 4 precursor (BMP4) gene (see Appendix for sequence; Hwang et al. 1997).The sequence for the zebrafish BMP and for the J026 clone do not completely overlap. Therefore, the identity between the two might represent a different form or a pseudogene. The presence of a BMP homologue upstream suggests all the putative 5'-flanking regulatory elements lie in-between the BMP and CAH-Z genes. The B 176 fragment contains all of this intervening DNA, the CAH-Z transcription start site, the translation start site, and a portion of the first exon. The B 176 fragment should be easily digested to remove everything before the translation start site, and then inserted into a reporter construct.
To test whether a CA minimal promoter can drive MC-specific expression of a

reporter gene, I investigated the chicken CA-II promoter. The experiments using a CCAII promoter are consistent with the in vitro and in vivo experiments of others, which show









a strong non-specific promoter function by the CA-II gene' s proximal cis-regulatory region. The expression in many different cell types, with a loss of specificity suggests that a regulatory module with repressive capability is missing from the tested promoters. One possible mechanism for the regulation of the CA-II gene would involve regulation from a distant element. Examples of distant regulation are present in many systems, including the Drosophila gene Ultrabithorax (Ubx) which has individual regulatory modules spread throughout a 70 kb gene (Barolo and Levine, 1997; Martin et al. 1995), and the welldescribed P3-globin locus control element (Baron, 1996).
GA
The human P-like globin gene locus is a cluster of five genes aligned, 5' -s-G 'A-P8P-3' (Paul et al. 1974; Jahn et al. 1980). These genes cover a distance of -60 kb, and are regulated in a coordinate fashion (Baron, 1996). For example, in erythropoeisis the yglobin gene is highly expressed in fetal liver while P3-globin expression is low. When erythropoeisis shifts to the bone marrow, the y-globin is downregulated, while P3-globin expression increases several fold (Harrison et al. 1988). The human P-globin gene has four local elements which are sufficient for tissue- and spatial-specific expression.
When constructs containing the local regulatory elements are introduced into transgenic mice they drive correct patterns of expression, however, the gene is not expressed at correct levels, and exhibits positional effects (Magram et al. 1985; Townes et al. 1985). A series of DNAase hypersensitive sites were identified which have been analyzed and found to contain the elements necessary for normal expression levels (Grosveld et al. 1987). The "Locus Control Region" (LCR) is a 6.5 kb module found -50 kb 5' of the P3-globin gene, which is able to promote the correct levels of expression in coordination with the proximal elements (Talbot et al. 1989). In vivo experiments have shown that the LCR and the proximal element region interact, and that transcription occurs only while the two module complex is formed (Wijgerde et al. 1995).

In addition to this evidence, other proximal cis-regulatory modules have been shown to play important roles as intermediates between distant modules and the basal









transcription apparatus. The sea urchin Endo- 16 gene contains several modules responsible for its expression (Yuh et al. 1996; Yuh and Davidson, 1996). The most proximal of these modules, Module A, mediates early expression in the vegetal plate by itself. However, it also functions through bound transcription factors to transmit the combined signals of all other modules to the BTA. The CA-II proximal 5' promoter might play a critical role in CA expression by interacting with a distant regulatory module

As mentioned, the CA-II proximal cis-regulatory module contains many putative transcription factor binding sites. The CA-II proximal cis-regulatory module from human, mouse, rat, and chicken contain a number of Sp 1 factor binding sites. Originally described as a sequence-specific transcription factor, the Spl protein is now thought to play a role in stabilizing the interaction of distant modules (Pascal and Tjian, 1991). The Spl protein is able to multimerize, and it is thought to bind like molecules from a different module, and thus allow the two modules to interact locally.

The CA genes, as shown in Chapter 2, have evolved from a common ancestor through a series of tandem duplications. These duplications have resulted in the three amniotic cytoplasmic genes (CA-I, CA-II, and CA-Ill) remaining closely associated with one another (Fig. 4.7 Edwards, 1990). This close association in humans and rodents was thought to be due to recent duplication, which is the most likely explanation. However, there also exists another possibility. If the regulation for the CA genes was not duplicated along with the genes themselves, then some key regulatory modules might have remained at their original locus, as with 0-globin. In this scenario, some CA-II regulatory control modules could be either upstream or downstream of the CA-I, or CA-Ill genes (Fig. 4.7). If this is true, then many kilobases of genomic DNA will have to be analyzed to determine the factors controlling regulation.
The zebrafish offers a distinct advantage over the bird or mammal for studying CA regulation. The zebrafish should contain only one CA gene, where the higher vertebrates contain three linked genes (this refers only to the CAs present in the cluster shown in Fig.





66


4.7 and not to the other isoform families). If the result of these duplications is longdistance regulation, then using an animal model with only one gene should bypass the problem of searching large areas of genomic DNA. In addition to the lack of duplication, the zebrafish presents another advantage, that of a small genome. Many fish have been shown to have smaller genomes than higher vertebrates (Hinegardner, 1968). Therefore, even if CAH-Z is controlled through a long-distance regulatory module, it should be significantly closer to the gene than in birds or mammals.



- 5 50----- 5
7654 32 1 lb la 12 3-67 12 3-6 7 CA 1 ---8okb- CA3 CA2 10 kb


Figure 4.7. Human CA gene locus. The human CA-I, CA-II, and CA-Ill genes are shown. The distances between the genes are given in relation to the scale bar. The exons are numbered above the boxes. The arrows give the direction of transcription.

The possibility that B 176 extends into the 3' region of the next gene upstream would suggest that all 5' regulatory modules are contained within the fragment. The presence of regulatory modules inside other genes has been described, but is rather rare in vertebrates (Kirchhamer et al. 1996). The 200 kb PAC clone should contain all the necessary regulatory elements necessary for MC-specific regulation of the CAH-Z gene.













CHAPTER 5
GENERAL RESULTS AND DISCUSSION


This laboratory studies the mechanisms of MC differentiation. One method of studying cell-differentiation is to understand the regulatory mechanisms responsible for cell-specific gene expression. The gene this laboratory focuses on is CA-HI, which is the only cytoplasmic CA isoform expressed in the neural retina, where it is localized to the MCs. The working hypothesis of the laboratory states that the regulation of CA-I expression in the MCs is conserved across all vertebrates. With that in mind, my project revolved around validating the zebrafish as a model for studying CA expression in the MCs. The results present suggest that the zebrafish is not only a valid model for studying the regulation of CA in MCs, but that it is the best available model.

This project sought to answer three questions concerning CA in zebrafish:

1) Does the zebrafish contain a high-activity CA? This question stems from the localization of CA-Il to MCs in the bird and mammal eye. CA-II is the highactivity isoform found in higher-vertebrates.

2) If a high-activity CA is present, is it found in the MCs, as is CA-I in birds and mammals? Previous reports from this laboratory have shown CA immunostaining in the horizontal cells of fish as well as in the MCs. When does expression begin during development, and in which cells is it present?

3) Can a proximal 5' promoter control MC-specific expression of the

zebrafish CA gene? This question begins to investigate how CA expression in the MCs is regulated.









I sought to isolate and characterize a high-activity CA from the zebrafish. I began by using inhibitor-based affinity chromatography. The standard method for isolating CAs is through affinity chromatography with pAMBS. Affinity chromatography of zebrafish total soluble protein results in the isolation of a single protein (Fig. 2.1). The single protein was characterized through both direct peptide-sequence and also through enzyme kinetic analyses. After cleavage with Endo-LC, two fragments were sequenced using Edman degradation. The direct peptide sequence shows that the protein is a CA (Fig. 2.4). This fact is confirmed by the protein's ability to converting CO2 to HCO3-. This activity could be inhibited by the sulfonamide EZA, and an inhibition constant was determined (Fig. 2.2). The inhibition constant suggests that the enzyme is a high-activity isoform. The cDNA sequence was determined through overlapping PCR (Fig. 2.3). Using retina RNA, the full-length sequence was determined and found to contain a 260 amino acid open reading frame. This reading frame matches the 48 amino acids of peptide sequence exactly (Fig. 2.4). Sequence comparisons and phylogenies suggest that the carbonic anhydrase homologue from zebrafish (CAH-Z) is novel. The CA-I, CA-II, and CA-III isoforms arose from recent gene duplication. The data I present (Fig. 2.7) supports the idea that the duplication occurred after the divergence of tetrapods and teleosts. Therefore, CAH-Z is novel in an evolutionary sense. The single gene present before the tetrapod divergence gave rise to multiple genes in the tetrapod lineage. CAH-Z represents one teleost version of the gene present at the tetrapod divergence. The results presented were conclusive evidence that a high-activity CA was present in the zebrafish.

Given the presence of a high-activity CA in zebrafish, the next set of experiments sought to answer where the protein is present in the zebrafish retina. A polyclonal antiserum was produced in rabbits against the purified CAH-Z protein. This antiserum recognizes a single band of 29 kDa on Western blots of soluble protein from zebrafish. The antiserum stains MCs in the adult retina. Double-labeling experiments using an antibody against the glial-specific protein glutamine synthetase, show that expression is









only in the MCs. Immunohistochemistry on early embryonic tissue sections show that no CAH-Z staining is present in undifferentiated retinoblasts and that staining does not occur until near the beginning of zebrafish functional vision (Easter and Nicola, 1997). The pattern of expression is coincident with the appearance of functional vision and an improvement in visual acuity. Analysis of the marginal zone, a region of mitotic activity and differentiation in the adult retina, shows that undifferentiated cells have no CAH-Z and that staining is only present in MCs. Double labeling with the HNK-1 antibody leads to the conclusion that the carbohydrate epitope is present on MCs. Interestingly, the epitope appears to be present before the expression of either CAH-Z or GS. These results suggest that the MCs are structurally differentiated before they complete biochemical differentiation. A biphasic pattern of differentiation might be explained by the dual role of glia. Early in development the glia of many tissues function as a scaffold or guide for cellmigration and/or axonal migration. The correct formation of the retinal layers or the production of the synaptic layers might require the presence of a glial scaffolding. Some of the biochemical functions of the glial cells might not be needed at this early time, and would only be required once the neurons have finished differentiation and begun transmitting signals. As mentioned, the onset of functional vision begins shortly after the onset of CAH-Z expression in glial cells and improves rapidly over the next 8-10 hours, during which time CAH-Z expression spreads throughout the retina. This is not meant to suggest that correct vision relies on the biochemical differentiation of the MCs, although such a point cannot be ruled out, but rather that the expression is coincident with improved vision, and is therefore not necessary before this time. The data presented shows that CAH-Z is MC-specific in the zebrafish retina.
The final phase of this project is aimed at studying a proximal 5' promoter in the zebrafish. These studies require the isolation of genomic clones which contain the proximal 5' promoter. The promoter was subcloned from an isolated PAC clone that contains the CAH-Z gene. The fragment contains the CAP site, transcription start site and









the beginning of the coding region on its 3' end, and ---4 kb of promoter on its 5' end. Additionally, the most 5' sequence from this fragment, and from direct sequencing of the J026 PAC clone suggests the presence of a BMP gene. If this is true, then the promoter should contain all the necessary information that will be found in the 5' direction.

The mechanisms responsible for the expression of the high-activity CA throughout the vertebrate body should prove a most interesting case of gene regulation. The studies that have been published in mouse suggest that regulation is not controlled through a simple proximal 5' promoter. The results presented in this dissertation also suggest that a small proximal 5' promoter of 1.4 kb also is not sufficient to drive correct retinal expression. Where are the elements necessary for cell-specific expression located? This question might be most easily answered using the zebrafish.













APPENDIX

GENOMIC SEQUENCE FROM J026 AND SUBCLONES B239 AND B176


The genomic sequence presented is a compilation of both J026 PAC sequence and subclones B239 and B 176 sequence. The portions of the sequence that represent exons (as determined by their identity to CAH-Z) are in blue and are numbered 1-1534. The blue sequence marked 412-1534 is cDNA sequence that has not been completed at the genomic level. The black sequence fragments in-between the blue exon sequences are introns, Intron A, Intron B and Intron C are completely sequenced. The sequence obtained from B 176 is marked by purple asterisks at the 5' end (in the first box of sequence) and the 3' end (in CAH-Z's Intron A). The sequence obtained from B239 is marked by green dollar signs at the 5' end (in CAH-Z's exon 2) and the 3' end (in CAHZ's last blue box). The poly-N tracts in both the region proceeding CAH-Z's first exon, and in Intron B are the central portions of B 176 and B239 that have not yet been sequenced. The intron sequences determined by PCR are not shown. I found deletions in the PCR sequences when comparing them to the direct sequence from J026. Thus, the intron sizes presented in Figure 4.4 should be considered estimates, although the intron/exon boundaries are assumed to be correct.

The sequence upstream of the cDNA start site (position 1) is assumed to contain the putative proximal 5' promoter. A putative TATA box is shown in larger, bold, underlined font. When the putative promoter sequence is run through BLAST, several regions with homology to bone morphogenetic protein 4 (BMP-4) from zebrafish are found (Hwang et al. 1997). These regions of homology are numbered, underlined, and shown in red. The identity between my sequence and the sequence in the database is









very high (greater than 90%), however, there are regions missing from the reported

sequence in my clone. This might suggest that there is a different BMP homologue

upstream of the CAH-Z gene and that only the conserved exons are aligning. The

presence of a BMP gene upstream suggests that the entire putative proximal 5' promoter

has been isolated and sequenced.


5' - CCATCCATGCATTGCTCTGTTTAGTGACATTTGGATTATAATCTATGCCAGGATTTAGAT TTTGCCAACCGGATACGCTCCATCACAAACCATCATTGTATTACGTTGTCACAACTTTAATTCC
AAGAAACAAACAGATAATATTAGAATTCATACTTTTTTTTTTTTTTTTTGCATTTTAATGTTTTA AAATGACACACATGCAAGATGCTTTAAAGCTGAAACAACAGTTTATGTTGTAAAAAATGTGAA TGTATATATTCTCAAAATGAGGTTGCTATGATTCAGTTAACATATAGCATGATAAAAAATATTA
TAATAATAATAATAATGTATACATAATATTTAATATTTTAATAATTTTAATAATAAAAATATTA ACAGTAAATTAATTCATTAGGTATTCTATACTAGCATCAATAATATTCTTTAACTTATATTATAC TTAACTTACTATACGCTCAAAAGCTTGGGGTCAAAAGGATTTTTCAGTGTTTTAAAAT*AAGCT TATCTTAAGCTATTATCACAAAGACTGCATTTATTTAATCAAAATACAGTACAAAGAGTAAAAA TGTGAAATGTTATAGCACGTTAAATAACTGATCAAAAGTAGTTTATCATTTAATTTATTCATTT
ATTCCAGTGATTTTAAAGATGAATTTTCAACTTACTCCAGTCTTAAGAGTCACATGATCCTTCA GAAATCACTCTAGTATTATTAATAATAATAATAATAATAATTATTATTATTATTACTATTATTAT ACAATGTAGACATACAATACAGTCAGTTAAATAACATTTTAATAAACACTTAACAATTTAACAA TTTGTTTTACATTTAATAAATGCCTCCTTGATGAACAGAATAGTTTTCTTTCAAGAAACACTGAC TAAAAGTTTTGACAGGTAGTGTACAGTTGAAGTCAGAATTATTAGCCCCCCTGTTTATTTTTTC CTTAATTTCTGTTTAACAAAGATATTTTTAACACATTTCTAATCATTAT

7381 -AGTTTTATTAACTAATTTCT'AACAACTGATTTATTTTATCCTTGCCATGA TGACAGTAAAAAATATTTGACTAGATATATTTCAAGACACTTCTATACAGCTA
AAAGTGACATTTAAAGGCTTAACTAGGTTAATTAGGTTAACTAGGCAGGT-7533

TAGGGTAATTAGGCAATTATTTGTATTTCTATGGTTTGTTCTTTCGAAAAAAAATT

7589-ATAGCTTAAAGGGGCTFGGTAAAATTGACATTAAAATGGTGTTTGAAAAT TAATAACTGCTTTTAGTCTAGCCAAAATAAAACAAATAAGACTTTCTCCAGAA GAAAAAATATGATCAGACATACTGTGAAAATTTCCTTGCTTTGTTAAACATCA
TTTGGGAAATATT-7757

AAAAAAAAGAAAAAGAAAAAAGGGGCTATAATTCTGACTTCAACTGTAAATAAAAAATGA AACAATCAAATACACATTGATTAATATTGCATAAAGTCTGAATTTGAACCCGCAATCATTCGTT TTACATTTCAGATCTTCTTTAACTCATTGGTGGAGTTTTGATTTCTTTGCCACTGTTGCCTATGG CTTGCTTGGTTGAGGTTTGTAGAGATGTGTTTCAGTGGACAGTGAAGCTGAATTAAACTGAACT ACAACAGTGACATTAATATTAAACAGCATTTTTAAATTAACTACAACTACGCCAGCATGTTATC ACAAATCTCTTGCCTGAAATGTTCTACATTCTGAAAAAAGAATTATGTTTTTTTTATTCTCCTTT TTGTCTATATGTAAAGCTGCTTTGCCAATCTACATTATATCAAGCACTATAAAAATACAGATGA GTTGAATTGAACTACTACAAACACTGGCAAGAGTTTTTAAACATGGTAAATAAATTTGGCAAA AAAAATACAATGTCAANNNNNNNTAAGAAAAAGAATTGACAAAACCTGGAACGTCATTAAC TAAATTTAAAACCTAGCTAGGCCTACATAAAAAGATGGGTCATTTTTGTATGTTTCCTTACTGT ATTGAGATTTTTTCAAATATACAAAGTTAAAAATGTAAATAAATAATAATTTTTCCACTTCGGC








CACCAGATGACAGCAACGCAAAGAGTTTAAATGACGTATATCACTCATCCATTGACATTTGCAG
GTGGTGATACCGCTATATACGATATTTTAAATATTGGAAATTCATTTATGACACAAAAACACAT TTTGGCCTTCACAAGTATAGGCTACAGTAAATGAAAACCTAGCCTATTTTCCTAATCAACAAGT GTTAAGCAAAAACTATTCAAAACAAAACATTGCACTCTTTTAAATGCATTTGTCAAGGATTTAA ACAACCAGCACGTATTTTGAGCTCTAGTAGTTCGAGTAAACAGGTTAAAATGTTTTATATAACA CCGACTAATCATAGTCGGCGCAGTGGCCCCTTTAAAAGAGCACTGCAGCTCTTCACAGAAAAG GTACCAGAAGATGTAGACCAAAAAACTGCGTCTGATTTTGTTTTCTTTTAGAAATATGAATCAA AACAACCTTCGAAATGACAAACTAAGCTACAAAATCAGTCATTGCGCAACAGAGATACTGTGT TGAGCCGCGCACACCATCACTCGTCCGTCCTGCGTTTCGACACAGCATCGCATAAGGACGAGG AAGGTCAAGAGAACATGCATCGCTGCCCGGATAAAGGACGGGTTTCTGAATCACCAGAGAAAG AAACCAATGGAGAGGTTTGTGATTCGAAGCAGAATCTTGAACGCCGGAAAACAGAGGAATGCC CGTTTCTCATCTGTTCTCCGGCGCTCGAGCATCTCTGAGCCGCATCAGCAAACCGAGCAGCGCG ATGGCCAGTGACCGGTGTTCTGGAGGTGCGATATTTTGATTAGTTGAAGACAAATGTCCTCTGA
CTAACTCCTCCTGTGCTGCCTGGAGAGCATGTGGCCAAACCCACTGGGCTGAGAGAGGGACCA GCACCAGGAGGGGAACTCTATATAAAGCCTGACATAGTTTGGGGGAATTAAG

1I-CAGCAGTTGTTTTAGCATCCAGGTTGTACAAGTAGAGGAACACAGCGAAA ACCA TTTATAATCATGGCTCACGCTTGGGGATATGGACCAGCTGACGG-97

TAAGATTAACTTTAMTGATATTAATGTTAATATTTKATAATGTATGTTTAATGTTTATTCTTAGT AGCTATAMTGTTTTATTCTTATTTTTTTAGGAGAAAAGCTGGAGCACTTATTTTAATATCTAAA ATAATTTACACGTAGCAGTAATTTATATTAAACAATGAAAT* GTTAATTTTACCTAAGGTTAGA GTCTTGTCTTAGAGTCTTTTACAAAAGCTTTTTGTCTTGTTTCCAGTCTAAATATCTAAAAATGT
TTAAATCAAGAAATATTTTCTACATAAGCAAAAAACAAACAGTTTTCAATTGTTTTTTTAAGTT ACTTTCTATAAGGAGAATATAACATTTTCAGTTGTTTTCTAAAATAAAAATTAAGCTAGCTTTT CTTTAACCAAGCAAAATAATCTGTCAATGCATAAAATACTCTTATTTCAAACTGAAAACAAAAT TACTTTACTACTACTTTTAAGTAAAATGTGCATTAAAAAATTGAAATGAATATGCTTAATTTAG AACAAAAGAAAAAAAAAAAGAAAGAAAGACAGACAGAAAAGAAAAACAGTGTTATGACTGAA
ACAACATGGATAAATTACTCTACAAAAACAAAAGTCACTTCTAAATGTAAAATCAGCTAAAAA GAGCTCCTGGAGGTAACAGCTGCMAATATCCACTTCTCACCGCCTACAATTTCTAACCTTGAAT TTTGCAAAGAATGTAAACGTGCATCTAGACACTGTGCTTTTATCTTCTTGCATTCAGCTTCTAAT CTATTTCTCCTGCTCATATCATTTCA

96-GGGCCAGAGAGTTGGGCAGA AAGCTTTCCTATTGCAAATGGACCCCAGG CAGTCTCCCATTGATATCGTACCCACCCAAGCACAGCACGACCCTTCTCTGAA GCATCTCAAATTGAAGTATGACCCAGCCACCACCAAGAGCATCCTTAATAATG GCCATTCATTCCAAGTGGATTTCGTTGATGACGACAACAGCTCAA-294

GTTAGTATACTGCACAATGCAAATGTTGGGCTCAATCTTAAAGAGACAGTTAACACAAAATTA AAACCCTACCATCATTTACTCTAACTTCACTCAAACCTAAACCCTTGACCATAAACTTTCATACT
GTTGTTTTTTTTTACTATGGATTTCAATGGCTACTGGTTTTCAGCATTCCTCAAGATATATTTAT GTTGAGTAGAAGACGATGTTTGAAACTACTTAAATGATGAGTAAATGTTAATATTTGGGTGATC
TTTCTCTTTACCATCTTAAGACATTCTCAAGAGACTTTATCAGGATGGTGGTTTGGCTACAGTG GACAATCATTGTTAGCATAATCATTGCCAAACATGCATAATTACAATTATACCACTGGACCCAC TGCAATGTTTGCAGATTGCAGAGTGCTAAAATGAAAATATGATATTTTTATTCATAAAACATGC AATAGTAGCTATATATATCCATGACTATATCTCATGACCTGTTTTTATCCATTCATTAATTAAAT
TTAGTTTTAAGTAGTCCATGGGTGGCTTCTCCTTGATCACTTTATCCTAGTCAGCAGNNNNNN NAAAAAAAAAAAAATTAACTATACATTTTAAATCCAGAAAAGACAACAATTTGTAAGCGGTCA
TAGTATATAATGTAATATACAGTTAACTGAAATTTTGAGATTTTTTTTTATGTGTATTTTTTATT AAAACATATTTGAATTATAAACTTGTTATTTTAAATTGTGCAACATTTGTATAATAATTTTTATT CAATACAAGCAACAACTATTACATATGTTTTGATTGTTTAAATGCATTTATACATGATATACAG








TTTTAACACATTTCCAATGACTAATGCTTTAGTGCTGCCTAAGGAACAGATGCATCATTTTTAT
AATTATTTGTGTGTGTGTAG

295-CTCTGGCTGGAGGTCCCATCACAGGGATATACAGGTTGAGACAGTTCCA TTTCCATGGGGTAGCAGTGATGACAAGGGATCCGAGCACACTATTGCTGGAA CCAAGTTCCCTTGTGAG-413

GTAATGAGAGTTTTTTTNNAATTCCCACTATAAAACAGCRGCAACCCTCATTCGGCTGCGCTGA GATTCAGGCCGTTCTAATTCTTGAACATCTCTCCATAATTATAGCTCACTGCTCATGAATATTCT TATGATGTTCTCTTATGAATTTGTAAATGCCCTCTTTTAAATGTGCCAAGATATTAAGTCCATTC AGTACTCCTACCGCATATACTGAATGTTTCATAATAACTATATGTCTCCTCCTTCTTA

412-AGCTT CACCTTGTTCACTGGAACACAAAGTACCCAAACTTTGGAGAAGC TGCCAGTAAGCCTGATGGCTTGCTGTGGTTGGAGTTrTCTCAAGATCGGCGC TGCAAATCCAAGACTTCAGAAAGTTCTAGATGCCCTTGATGACATCAAATCAA AGGGCAGACAGACTACATTTGCCAACTTTGATCCTAAAACCTTGCTGCCTGCC TCTCTGGACTACTGGACTTATGAGGGCTCTCTGACCACCCCTCCTCTGCTGGAG
AGTGTCACCTGGATTGTTTTGAAGGAGCCGATCAGTGTTAGTCCTGCTCAGAT GGCTAAATTTCGCAGCCTGCTGTTCTCATCTGAAGGAGAAACACCTTGCTGCA TGGTTGACAACTACAGACCTCCTCAACCTCTCAAGGGACGCAAAGTTCGCGCT TCCTTCAAGTAAACCCCAGAATCGATGCCACTTGCCTTCTGATTATGGTGCTTT TGACTGGTTGTACTGAAACATCACAGTATTTGTTCTCGATCCAGGCTTTTGCT
TACATTGCAGTACTGATAACAGGAAAGTTGAATCTGATCTTCTAAAACTGTCT GCGTTTGTCATAAACGCCAATGTTATGATTGCTAAACATGAGAAATAGTATTT CGAGATGCTAAAACAGTGGTTAGTTTCCTACTATATCCTGACGCTTTTATGTAA
ACTGGAAAAATAAGGAGACTGCTTTATTTCTAGCTCATTTTTTGACTGCTTCAC TTTGCATTTTATAGGCCATTCTTTTAGCCTCTGCAGAATTGCACTATAATTCAT GTTCTACAATAGGAAAATCGTCAAGGTTTTGTGTGGGTTTATGGCAATGTGTG ACTGATGAGATGTGTTGATGCTAATATACCTGCAGGAAAGCACTTATTTACAG
CAATATGTTGTTGTTTTAAAGTGATTCCTTTITCATCAAGAGGAATATCAAGGG ATTATATTTTTAAATCGTTTATGAGAATGTTGAATCAAGACCTCCTGCCATAGA TAATATTATTTAGATATTTCAGAATAAATATTTAATTGAGTAGTGTTGCAAACA AATATGATATGTAAATCAGTATCTATTAAGAATTTTATCTGCAATAAATGAATA
TATTTT-1534 - 3'











BIBLIOGRAPHY

Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J Mol. Biol. 215, 403-410.

Altshuller, Y., Copeland, N.G., Gilbert, D.J., Jenkins, N.A. and Frohman, M.A. (1996) Gcml, a mammalian homologue of Drosophila glial cells missing. FEBS Lett. 393, 201-204.

Antonicek, H., Persohn, E. and Schachner, M. (1987) Biochemical and functional characterization of a novel neuron-glia adhesion molecule that is involved in neuronal migration. J. Cell Biol. 104, 1587-1595.

Arnone, M.I. and Davidson, E.H. (1997) The hardwiring of development: organization and function of genomic regulatory systems. Development 124, 1851-1864.

Badenhorst, P., Harrison, S. and Travers, A. (1996) End of the line? Tramtrack and cell fate determination in Drosophila. Genes Cells 1, 707-716.

Barettino, D., Bugge, T.H., Bartunek, P., Vivanco Ruiz, M.D., Sonntag-Buck, V., Beug, H., Zenke, M. and Stunnenberg, H.G. (1993) Unliganded T3R, but not its oncogenic variant, v-erbA, suppresses RAR- dependent transactivation by titrating out RXR. EMBO J. 12, 1343-1354.

Barnes, S., Merchant, V., and Mahmud, F. (1993) Modulation of transmission gain by protons at the photoreceptor output synapse. Proc. Natl. Acad. Sci. (USA) 90, 10081-10085.

Barolo, S. and Levine, M. (1997) hairy mediates dominant repression in the Drosophila embryo. EMBOJ. 16,2883-2891.

Bayer, T.A. and Campos-Ortega, J.A. (1992) A transgene containing lacZ is expressed in primary sensory neurons in zebrafish. Development 115, 421-426.

Beechey, C., Tweedie, S., Spurr, N., Ball, S., Peters, J. and Edwards, Y. (1990) Mapping of mouse carbonic anhydrase-3, Car-3: another locus in the homologous region of mouse chromosome
3 and human chromosome 8. Genomics 6, 692-696.

Bergenhem, N. and Carlsson, U. (1990) Partial amino acid sequence of erythrocyte carbonic anhydrase from tiger shark. Comp. Biochem. Phylsiol. [B]. 95, 205-213.

Blanchard, A.D., Sinanan, A., Parmantier, E., Zwart, R., Broos, L., Meijer, D., Meier, C., Jessen, K.R. and Mirsky, R. (1996) Oct-6 (SCIP/Tst-1) is expressed in Schwann cell precursors, embryonic Schwann cells, and postnatal myelinating Schwann cells: comparison with Oct-1, Krox20, and Pax-3. J Neurosci. Res. 46, 630-640.

Boncinelli, E. (1997) Homeobox genes and disease. Curr. Opin. Genet. Dev. 7, 331-337.








Borgula, G.A., Karwoski, C.J., and Steinberg, R.H. (1989) Light-evoked changes in extracellular pH in frog retina. Vision Res. 29(9), 1069-1077.

Bossing, T., Udolph, G., Doe, C.Q. and Technau, G.M. (1996) The embryonic central nervous system lineages of Drosophila melanogaster. I. Neuroblast lineages derived from the ventral half of the neuroectoderm. Dev. Biol. 179, 41-64.

Bossing, T. and Technau, G.M. (1994) The fate of the CNS midline progenitors in Drosophila as revealed by a new method for single cell labelling. Development 120, 1895-1906.

Brion, L.P., Zavilowitz, B.J., Suarez, C. and Schwartz, G.J. (1994) Metabolic acidosis stimulates carbonic anhydrase activity in rabbit proximal tubule and medullary collecting duct. Am. J. Physiol. 266, F 185-95.

Bronner-Fraser, M. (1987) Perturbation of cranial neural crest migration by the HNK-I antibody. Dev. Biol. 123, 321-331.

Bronner-Fraser, M. (1993a) Environmental influences on neural crest cell migration. J. Neurobiol. 24, 233-247.

Bronner-Fraser, M. (1993b) Mechanisms of neural crest cell migration. Bioessavs 15, 221-230.

Buono, R.J., Linser, P.J., Cuthbertson, R.A. and Piatigorsky, J. (1992) Molecular analyses of carbonic anhydrase-II expression and regulation in the developing chicken lens. Dev. DVn. 194, 3342.

Buono, R.J. and Linser, P.J. (1992) Transient expression of RSVCAT in transgenic zebrafish made by electroporation. Mol. Mar. Biol. Biotechnol. 1, 271-275.

Cajal SR (1972) The structure of the retina (Translation of La Retine des Vertebres. 1933) SA Thorpe and M Glickstein (translators). Charles C. Thomas, Springfield, IL.

Campos-Ortega, J.A. (1996) Numb diverts notch pathway off the tramtrack. Neuron 17, 1-4.

Carmichael, G.G. and McMaster, G.K. (1980) The analysis of nucleic acids in gels using glyoxal and acridine orange. Methods Enzymol. 65, 380-391.

Cepko, C. (1993) Lineage versus environment in the embryonic retina [letter; comment]. Trends. Neurosci. 16, 96-7; discussion 98.

Cepko, C.L., Austin, C.P., Yang, X., Alexiades, M. and Ezzeddine, D. (1996) Cell fate determination in the vertebrate retina. Proc. Natl. Acad. Sci. U. S. A. 93, 589-595.

Chomczynski, P. (1993) A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 15, 532-4, 536-7.

Church, G.M. and Gilbert, W. (1984) Genomic sequencing. Proc. Natl. Acad. Sci. U S. A. 81, 1991-1995.










Clark, D.D. and L. Sokoloff (1994) in Basic Neurochemistry: Molecular, Cellular, and Medical Aspects, 5th Ed., edited by G.J. Siegel et al. Published by Raven Press, Ltd, New York.

Cohen-Cory, S., Escandon, E. and Fraser, S.E. (1996) The cellular patterns of BDNF and trkB expression suggest multiple roles for BDNF during Xenopus visual system development. Dev. Biol. 179, 102-115.

Cohen-Cory, S. and Fraser, S.E. (1995) Effects of brain-derived neurotrophic factor on optic axon branching and remodelling in vivo. Nature 378, 192-196.

Cornell-Bell, A.H., Finkbeiner, S.M., Cooper, M.S. and Smith, S.J. (1990) Glutamate induces calcium waves in cultured astrocytes: long-range glial signaling. Science 247, 470-473.

Cornell-Bell, A.H. and Finkbeiner, S.M. (1991) Ca2+ waves in astrocytes. Cell Calcium 12, 185204.

Crandall, J.E., Misson, J.P. and Butler, D. (1990) The development of radial glia and radial dendrites during barrel formation in mouse somatosensory cortex. Brain Res. Dev. Brain Res. 55, 87-94.

Cvekl, A., Kashanchi, F., Sax, C.M., Brady, J.N. and Piatigorsky, J. (1995a) Transcriptional regulation of the mouse alpha A-crystallin gene: activation dependent on a cyclic AMP-responsive element (DEl/CRE) and a Pax-6-binding site. Mol. Cell Biol. 15, 653-660.

Cvekl, A., Sax, C.M., Li, X., McDermott, J.B. and Piatigorsky, J. (1995b) Pax-6 and lens-specific transcription of the chicken delta 1-crystallin gene. Proc. NatI. Acad. Sci. U. S. A. 92, 4681-4685.

Cvekl, A. and Piatigorsky, J. (1996) Lens development and crystallin gene expression: many roles for Pax-6. Bioessays 18, 621-630.

Davenport, H.W. (1984) The early days of research on carbonic anhydrase. Ann. N.Y. Acad. Sci. 429, 4-9.

Davidson, E.H. (1990) How embryos work: a comparative view of diverse modes of cell fate specification. Development 108, 365-389.

Davidson, E.H. (1991) Spatial mechanisms of gene regulation in metazoan embryos. Development 113, 1-26.

Davidson, E.H. (1993) Later embryogenesis: regulatory circuitry in morphogenetic fields. Development 118, 665-690.

Deutsch, H.F. (1987) Carbonic anhydrases. Int. J. Biochem. 19, 101-113.

Dodgson, S.J. (1991) Why are there carbonic anhydrases in the liver? Biochem. Cell Biol. 69, 761-763.








Dodgson, S.J., Quistorff, B. and Ridderstrale, Y. (1993) Carbonic anhydrases in cytosol, nucleus, and membranes of rat liver. J AppL. Physiol. 75, 1186-1193.

Dowling, J.E. (1985). The retina: an approachable part of the brain. Harvard University Press, Cambridge, MA.

Duband, J.L., Dufour, S., Yamada, S.S., Yamada, K.M. and Thiery, J.P. (1991) Neural crest cell locomotion induced by antibodies to beta 1 integrins. A tool for studying the roles of substratum molecular avidity and density in migration. J. Cell Sci. 98, 517-532.

Duncan, M.K., Li, X., Ogino, H., Yasuda, K. and Piatigorsky, J. (1996) Developmental regulation of the chicken beta B 1-crystallin promoter in transgenic mice. Mech. Dev. 57, 79-89.

Duncan, M.K., Kos, L., Jenkins, N.A., Gilbert, D.J., Copeland, N.G. and Tomarev, S.I. (1997)
Eyes absent: a gene family found in several metazoan phyla. Mamm. Genome 8, 479-485.

Easter, S.S., Jr. and Nicola, G.N. (1996) The development of vision in the zebrafish (Danio rerio). Dev. Biol. 180, 646-663.

Edelman, G.M. and Jones, F.S. (1997) Gene regulation of cell adhesion molecules in neural morphogenesis. Acta Paediatr. SuppL. 422, 12-19.

Edwards, Y. (1990) Structure and expression of mammalian carbonic anhydrases. Biochem. Soc. Trans. 18, 171-175.

Erickson, R.P., Bevilacqua, A., Venta, P.J., Karolyi, J. and Tashian, R.E. (1990) Ectopic expression of chloramphenicol acetyltransferase (CAT) in the cerebellum in mice transgenic for a carbonic anhydrase II promoter-CAT construct that is without apparent phenotypic effect. Mol. Reprod. Dev. 27, 102-109.

Erickson, R.P., Grimes, J., Venta, P.J. and Tashian, R.E. (1995) Expression of carbonic anhydrase II (CA II) promoter-reporter fusion genes in multiple tissues of transgenic mice does not replicate normal patterns of expression indicating complexity of CA II regulation in vivo. Biochem. Genet. 33, 421-437.

Fadool, J.M., Brockerhoff, S.E., Hyatt, G.A. and Dowling, J.E. (1997) Mutations affecting eye morphology in the developing zebrafish (Danio rerio). Dev. Genet. 20, 288-295.

Fekete, D.M., Perez-Miguelsanz, J., Ryder, E.F. and Cepko, C.L. (1994) Clonal analysis in the chicken retina reveals tangential dispersion of clonally related cells. Dev. Biol. 166, 666-682.

Fernley, R.T., Wright, R.D. and Coghlan, J.P. (1988) Complete amino acid sequence of ovine salivary carbonic anhydrase. Biochemistry 27, 2815-2820.

Fernley, R.T., Wright, R.D. and Coghlan, J.P. (1991) Radioimmunoassay of carbonic anhydrase VI in saliva and sheep tissues. Biochem. J. 274, 313-316.








Finkbeiner, S. and Greenberg, M.E. (1997) Spatial features of calcium-regulated gene expression. Bioessavs 19, 657-660.

Fishell, G. and Hatten, M.E. (1991) Astrotactin provides a receptor system for CNS neuronal migration. Development 113, 755-765.

Franz, M.G., Winkler, B.C., Norman, J.G., Fabri, P.J. and Gower, W.R., Jr. (1994) Tumor
necrosis factor-alpha induces the expression of carbonic anhydrase II in pancreatic adenocarcinoma cells. Biochem. Biophys. Res. Commun. 205, 1815-1821.

Fraser, P.J. and Curtis, P.J. (1986) Molecular evolution of the carbonic anhydrase genes: calculation of divergence time for mouse carbonic anhydrase I and II. J Mol. Evol. 23, 294-299.

Fredieu, J.R. and Mahowald, A.P. (1989) Glial interactions with neurons during Drosophila embryogenesis. Development 106, 739-748.

Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. U. S. A. 85, 8998-9002.

Galileo, D.S., Gray, G.E., Owens, G.C., Majors, J. and Sanes, J.R. (1990) Neurons and glia arise from a common progenitor in chicken optic tectum: demonstration with two retroviruses and cell type-specific antibodies. Proc. Natl. Acad. Sci. U. S. A. 87, 458-462.

Galileo, D.S., Majors, J., Horwitz, A.F. and Sanes, J.R. (1992) Retrovirally introduced antisense integrin RNA inhibits neuroblast migration in vivo. Neuron 9, 1117-1131.

Gallin, W.J. and Greenberg, M.E. (1995) Calcium regulation of gene expression in neurons: the mode of entry matters. Curr. Opin. Neurobiol. 5, 367-374.

Gao, W.O., Heintz, N. and Hatten, M.E. (1991) Cerebellar granule cell neurogenesis is regulated by cell-cell interactions in vitro. Neuron 6, 705-715.

Gehring, W.J. (1996) The master control gene for morphogenesis and evolution of the eye. Genes Cells 1, 11-15.

Giangrande, A. (1996) Development and organization of glial cells in Drosophila melanogaster. Int. J. Dev. Biol. 40, 917-927.

Giesen, K., Hummel, T., Stollewerk, A., Harrison, S., Travers, A. and Klambt, C. (1997) Glial development in the Drosophila CNS requires concomitant activation of glial and repression of neuronal differentiation genes. Development 124, 2307-2316.

Gilbert, S.F. (1994). Developmental Biology, 4h Ed. Sinauer Associates, Inc. Sunderland, MA.

Ginty, D.D. (1997) Calcium regulation of gene expression: isn't that spatial? Neuron 18, 183-186.








Glardon, S., Callaerts, P., Halder, G. and Gehring, W.J. (1997) Conservation of Pax-6 in a lower chordate, the ascidian Phallusia mammillata. Development 124, 817-825.

Godbout, R., Packer, M., Poppema, S. and Dabbagh, L. (1996) Localization of cytosolic aldehyde dehydrogenase in the developing chick retina: in situ hybridization and immunohistochemical analyses. Dev. Dvn. 205, 319-331.

Gopal-Srivastava, R., Cvekl, A. and Piatigorsky, J. (1996) Pax-6 and alphaB-crystallin/small heat shock protein gene regulation in the murine lens. Interaction with the lens-specific regions, LSRI and LSR2. J. Biol. Chem. 271, 23029-23036.

Gottlieb, J. and Muzyczka, N. (1988) In vitro excision of adeno-associated virus DNA from recombinant plasmids: isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences. Mol. Cell Biol. 8, 2513-2522.

Gray, G.E., Glover, J.C., Majors, J. and Sanes, J.R (1988) Radial arrangement of clonally related cells in the chicken optic tectum: lineage analysis with a recombinant retrovirus. Proc. Natl. Acad. Sci. U. S. A. 85, 7356-7360.

Gray, G.E. and Sanes, J.R. (1992) Lineage of radial glia in the chicken optic tectum. Development 114, 271-283.

Gray, S., Cai, H., Barolo, S. and Levine, M. (1995) Transcriptional repression in the Drosophila embryo. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 349, 257-262.

Grosveld, F., van Assendelft, G.B., Greaves, D.R. and Kollias, G. (1987) Position-independent, high-level expression of the human beta-globin gene in transgenic mice. Cell 51, 975-985.

Gruberg, E.R., Kicliter, E., Newman, E.A., Kass, L. and Hartline, P.H. (1979) Connections of the tectum of the rattlesnake Crotalus viridis: an HRP study. J. Comp. Neurol. 188, 31-41.

Hagedorn, M., Fernald, R.D., (1992) Retinal growth and cell addition during embryuogenesis in the teleost Haplochromis burtoni. J. Comp. Neurol. 321, 193-208.

Hageman, G.S., Zhu, X.L., Waheed, A. and Sly, W.S. (1991) Localization of carbonic anhydrase IV in a specific capillary bed of the human eye. Proc. Natl. Acad. Sci. U. S. A. 88, 2716-2720.

Halder, G., Callaerts, P. and Gehring, W.J. (1995) Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila [see comments]. Science 267, 1788-1792.

Harris, W.A. (1997) Pax-6: where to be conserved is not conservative [comment]. Proc. Natl. Acad. Sci. U. S. A. 94, 2098-2100.

Harrison, P.R., Plumb, M., Frampton, J., Llewellyn, D., Chester, J., Chambers, I., MacLeod, K., Fleming, J., O'Prey, J. and Walker, M. (1988) Regulation of erythroid cell-specific gene expression during erythropoiesis. Br. J. Cancer Suppl. 9, 46-51.








Harrison, S.D. and Travers, A.A. (1990) The tramtrack gene encodes a Drosophila finger protein that interacts with the ftz transcriptional regulatory region and shows a novel embryonic expression pattern. EMBO J. 9, 207-216.

Heck, RW., Boriack-Sjodin, P.A., Qian, M., Tu, C., Christianson, D.W., Laipis, P.J. and Silverman, D.N. (1996) Structure-based design of an intramolecular proton transfer site in murine carbonic anhydrase V. Biochemistry 35, 11605-11611.

Henry, R.P. (1988) Subcellular distribution of carbonic anhydrase activity in the gills of the blue crab, Callinectes sapidus. J. Exp. Zool. 245, 1-8

Hewett-Emmett, D., Hopkins, P.J., Tashian, R.E. and Czelusniak, J. (1984) Origins and molecular evolution of the carbonic anhydrase isozymes. Ann. N. Y. Acad. Sci. 429, 338-358.

Hewett-Emmett, D. and Tashian, R.E. (1996) Functional diversity, conservation, and convergence in the evolution of the alpha-, beta-, and gamma-carbonic anhydrase gene families. Mol. Phylogenet. Evol. 5, 50-77.

Higgins, D.G., Bleasby, A.J. and Fuchs, R. (1992) CLUSTAL V: improved software for multiple sequence alignment. Comput. Appl. Biosci. 8, 189-191.

Hoist, B.D., Wang, Y., Jones, F.S. and Edelman, G.M. (1997) A binding site for Pax proteins regulates expression of the gene for the neural cell adhesion molecule in the embryonic spinal cord. Proc. Natl. Acad. Sci. U. S. A. 94, 1465-1470.

Holt, C.E., Bertsch, T.W., Ellis, H.M. and Harris, W.A. (1988) Cellular determination in the Xenopus retina is independent of lineage and birth date. Neuron 1, 15-26.

Hosoya, T., Takizawa, K., Nitta, K. and Hotta, Y. (1995) glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell 82, 1025-1036.

Hummel, T., Menne, T., Scholz, H., Granderath, S., Giesen, K. and Klambt, C. (1997) CNS midline development in Drosophila. Perspect. Dev. Neurobiol. 4, 357-368.

Hunkapiller, M.W., Strickler, J.E. and Wilson, K.J. (1984) Contemporary methodology for protein structure determination. Science 226, 304-311.

Hutchins, J.B. and Casagrande, V.A. (1990) Development of the lateral geniculate nucleus: interactions between retinal afferent, cytoarchitectonic, and glial cell process lamination in ferrets and tree shrews. J. Comp. Neurol. 298, 113-128.

Hwang, S.P., Tsou, M.F., Lin, Y.C. and Liu, C.H. (1997) The zebrafish BMP4 gene: sequence analysis and expression pattern during embryonic development. DNA Cell Biol. 16 (8), 1003-1011

Jacobs, J.R. (1993) Perturbed glial scaffold formation precedes axon tract malformation in Drosophila mutants. J. Neurobio. 24, 611-626








Jacobs, J.R. and Goodman, C.S. (1989a) Embryonic development of axon pathways in the Drosophila CNS. I. A glial scaffold appears before the first growth cones. J. Neurosci. 9, 24022411.

Jacobs, J.R. and Goodman, C.S. (1989b) Embryonic development of axon pathways in the Drosophila CNS. II. Behavior of pioneer growth cones. .. Neurosci. 9, 2412-2422.

Jahn, C.L., Hutchison, C.A., 3d, Phillips, S.J., Weaver, S., Haigwood, N.L., Voliva, C.F. and
Edgell, M.H. (1980) DNA sequence organization of the beta-globin complex in the BALB/c mouse. Cell 21, 159-168.

Johns, P.R. (1977) Growth of the adult goldfish eye. J. Comp. Neurol. 176, 343-358.

Jones, B.W., Fetter, R.D., Tear, G. and Goodman, C.S. (1995) glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell 82, 1013-1023.

Karwoski, C.J., Newman, E.A., Shimazaki, H. and Proenza, L.M. (1985) Light-evoked increases in extracellular K+ in the plexiform layers of amphibian retinas. J. Gen. Physiol. 86, 189-213.

Kirchhamer, C.V., Yuh, C.H. and Davidson, E.H. (1996) Modular cis-regulatory organization of developmentally expressed genes: two genes transcribed territorially in the sea urchin embryo, and additional examples. Proc. Natl. Acad. Sci. U S. A. 93, 9322-9328.

Klambt, C. (1993) The Drosophila gene pointed encodes two ETS-like proteins which are involved in the development of the midline glial cells. Development 117, 163-176.

Klambt, C and Goodman, C.S. (1991) The diversity and pattern of glia during axon pathway formation in the Drosophila embryo. Glia 4, 205-213

Kobayashi, S., Morgans, C.W., Casey, J.R. and Kopito, R.R. (1994) AE3 anion exchanger isoforms in the vertebrate retina: developmental regulation and differential expression in neurons and glia. J Neurosci. 14, 6266-6279.

Kobayashi, S., Vidal, I., Pena, J.D. and Hernandez, M.R. (1997) Expression of neural cell adhesion molecule (NCAM) characterizes a subpopulation of type 1 astrocytes in human optic nerve head. Glia 20, 262-273.

Komuro, H. and Rakic, P. (1993) Modulation of neuronal migration by NMDA receptors. Science 260, 95-97.

Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. .1. Biol. Chem. 266(30), 19867-19870.

Kruse, J., Keilhauer, G., Faissner, A., Timpl, R. and Schachner, M. (1985) The JI glycoprotein--a novel nervous system cell adhesion molecule of the L2/HNK-1 family. Nature 316, 146-148.

Kumar, S., Tamura, K., Nei, M. (1993) MEGA: molecular evolutionary genetic analysis, version
1.0. The Pennsylvania State Univeristy, University Park, PA 18602









Kunemund, V., Jungalwala, F.B., Fischer, G., Chou, D.K., Keilhauer, G. and Schachner, M. (1988) The L2/HNK-1 carbohydrate of neural cell adhesion molecules is involved in cell interactions. J. CellBiol. 106, 213-223.

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.

Lallier, T., Leblanc, G., Artinger, K.B. and Bronner-Fraser, M. (1992) Cranial and trunk neural crest cells use different mechanisms for attachment to extracellular matrices. Development 116, 531-541.

Lallier, T. and Bronner-Fraser, M. (1992) Alpha 1 beta 1 integrin on neural crest cells recognizes some laminin substrata in a Ca(2+)-independent manner. J. CellBiol. 119, 1335-1345.

Larison, K.D. and BreMiller, R. (1990) Early onset of phenotype and cell patterning in the embryonic zebrafish retina. Development 109, 567-576.

Leber, S.M., Breedlove, S.M. and Sanes, J.R. (1990) Lineage, arrangement, and death of clonally related motoneurons in chick spinal cord. J. Neurosci. 10, 2451-2462.

Li, Y.C., Beard, D., Hayes, S. and Young, A.P. (1995) A transcriptional enhancer of the glutamine synthetase gene that is selective for retinal Muller glial cells. J. Mol. Neurosci. 6, 169-183.

Li, Y.C., Hayes, S., Young, A.P. (1997) Steroid hormone receptors activate transcription in glial cells of intact retina but not in primary cultures of retinal glial cells. JMol Neurosci 8(2):145-158

Linser, P.J., Smith, K. and Angelides, K. (1985) A comparative analysis of glial and neuronal markers in the retina of fish: variable character of horizontal cells. J. Comp. Neurol. 237, 264-272.

Linser, P.J., Schlosshauer, B., Galileo, D.S., Buzzi, W.R and Lewis, R.C. (1997a) Late proliferation of retinal Muller cell progenitors facilitates preferential targeting with retroviral vectors in vitro. Dev. Genet. 20, 186-196.

Linser, P.J., Trapido-Rosenthal, H.G. and Orona, E. (1997b) Glutamine synthetase is a glialspecific marker in the olfactory regions of the lobster (Panulirus argus) nervous system. Glia 20, 275-283.

Linser, P. and A.A. Moscona (1979) Induction of gluatmine synthetase in embryonic neural retina: localization in Muller fibers and dependence on cell interactions. Proc. Natl. Acad. Sci. U.S.A. 76: 6476-6480.

Linser, P.J. and Moscona, A.A. (1981) Induction of glutamine synthetase in embryonic neural retina: its suppression by the gliatoxic agent alpha-aminoadipic acid. Brain Res. 227, 103-119.

Linser, P.J. and Moscona, A.A. (1984) The influence of neuronal-glial interactions on glia-specific gene expression in embryonic retina. Adv. Exp. Med. Biol. 181, 185-202.









Linser, P.J. and Perkins, M.S. (1987) Regulatory aspects of the in vitro development of retinal Muller glial cells. Cell Differ. 20, 189-196.

Linser, P.J. and Plunkett, J.A. (1989) A role for carbonic anhydrase in early eye morphogenesis. Invest. Ophthalmol. Vis. Sci. 30, 783-785.

Lynch, C.J., Hazen, S.A., Horetsky, R.L., Carter, N.D. and Dodgson, S.J. (1993) Differentiationdependent expression of carbonic anhydrase II and III in 3T3 adipocytes. Am. J. Physiol. 265, C234-43.

Magram, J., Chada, K. and Costantini, F. (1985) Developmental regulation of a cloned adult betaglobin gene in transgenic mice. Nature 315, 338-340.

Maren, T.H. (1967) The general physiology of reactions catalyzed by carbonic anhydrase and their inhibition by sulfonamides. Ann N. Y. Acad. Sci. 429, 568-579.

Marigo, V., Scott, M.P., Johnson, R.L., Goodrich, L.V. and Tabin, C.J. (1996) Conservation in hedgehog signaling: induction of a chicken patched homologue by Sonic hedgehog in the developing limb. Development 122, 1225-1233.

Marigo, V. and Tabin, C.J. (1996) Regulation of patched by sonic hedgehog in the developing neural tube. Proc. Natl. Acad. Sci. U. S. A. 93, 9346-9351.

Marino, L.R. (1993) Characterization of the mouse carbonic anhydrase II gene promoter. J Biol. Chem. 268, 7081-7089.

Martin, C.H., Mayeda, C.A., Davis, C.A., Ericsson, C.L., Knafels, J.D., Mathog, D.R., Celniker,
S.E., Lewis, E.B. and Palazzolo, M.J. (1995) Complete sequence of the bithorax complex of Drosophila. Proc. Natl. Acad. Sci. U. S. A. 92, 8398-8402.

Meller, K. and P. Glees (1965). The differentiation of neuroglia-Muller-cells in the retina of chick. Zeitschrift fur Zellforschung 66: 321-332.

McDermott, J.B., Cvekl, A. and Piatigorsky, J. (1997) A complex enhancer of the chicken beta A3/Al-crystallin gene depends on an AP-1-CRE element for activity. Invest. Ophthalmol. Vis. Sci. 38, 951-959.

McFarlane, S., McNeill, L. and Holt, C.E. (1995) FGF signaling and target recognition in the developing Xenopus visual system. Neuron 15, 1017-1028.

McGinnis, W. and Krumlauf, R. (1992) Homeobox genes and axial patterning. Cell 68, 283-302.

Mission, J.P., Takahashi, T. and Caviness, V.S., Jr. (1991) Ontogeny of radial and other astroglial cells in murine cerebral cortex. Glia 4, 138-148.

Moscona, A. (1961) Rotation-mediated histogenetic aggregation of dissociated cells: a quantifiable approach to cell interacions in vitro. Exp. Cell Res. 22: 455-475.








Nagao, Y., Srinivasan, M., Platero, J.S., Svendrowski, M., Waheed, A. and Sly, W.S. (1994) Mitochondrial carbonic anhydrase (isozyme V) in mouse and rat: cDNA cloning, expression, subcellular localization, processing, and tissue distribution. Proc. Natl. Acad. Sci. U. S. A. 91, 10330-10334.

Nedergaard, M., Cooper, A.J. and Goldman, S.A. (1995) Gap junctions are required for the propagation of spreading depression. . Neurobiol. 28, 433-444.

Newman, E. and Reichenbach, A. (1996) The Muller cell: a functional element of the retina. Trends. Neurosci. 19, 307-312.

Newman, E.A. (1987) Regulation of potassium levels by Muller cells in the vertebrate retina. Can. J. Physiol. Pharmacol. 65, 1028-1032.

Newman, E.A. (1991) Sodium-bicarbonate cotransport in retinal Muller (glial) cells of the salamander. J. Neurosci. 11, 3972-3983.

Newman, E.A. (1994) A physiological measure of carbonic anhydrase in Muller cells. Glia 11, 291-299.

Newman, E.A. (1996) Acid efflux from retinal glial cells generated by sodium bicarbonate cotransport. J. Neurosci. 16, 159-168.

Newman, E.A. and Zahs, K.R. (1997) Calcium waves in retinal glial cells. Science 275, 844-847.

Osborne, W.R. and Tashian, RE. (1975) An improved method for the purification of carbonic anhydrase isozymes by affinity chromatography. Anal. Biochem. 64, 297-303.

Overbeek, P.A., Chepelinsky, A.B., Khillan, J.S., Piatigorsky, J. and Westphal, H. (1985) Lensspecific expression and developmental regulation of the bacterial chloramphenicol acetyltransferase gene driven by the murine alpha A- crystallin promoter in transgenic mice. Proc. NatL. Acad. Sci. U. S. A. 82, 7815-7819.

Pain, B., Melet, F., Jurdic, P. and Samarut, J. (1990) The carbonic anhydrase II gene, a gene regulated by thyroid hormone and erythropoietin, is repressed by the v-erbA oncogene in erythrocytic cells. New Biol. 2, 284-294.

Papalopulu, N. and Kintner, C. (1996) A Xenopus gene, Xbr-1, defines a novel class of homeobox genes and is expressed in the dorsal ciliary margin of the eye. Dev. Biol. 174, 104-114.

Parpura, V., Basarsky, T.A., Liu, F., Jeftinija, K., Jeftinija, S. and Haydon, P.G. (1994) Glutamate-mediated astrocyte-neuron signaling [see comments]. Nature 369, 744-747.

Pascal, E., and Tjian, R. (1991) Different activation domains of Sp l govern formation of multimers and mediate transcriptional synergism. Genes Dev. 5, 1646-1656.

Peles, E., Nativ, M., Campbell, P.L., Sakurai, T., Martinez, R., Lev, S., Clary, D.O., Schilling, J., Barnea, G. and Plowman, G.D. (1995) The carbonic anhydrase domain of receptor tyrosine








phosphatase beta is a functional ligand for the axonal cell recognition molecule contactin. Cell 82, 251-260.

Pesheva, P., Horwitz, A.F. and Schachner, M. (1987) Integrin, the cell surface receptor for fibronectin and laminin, expresses the L2/HNK-1 and L3 carbohydrate structures shared by adhesion molecules. Neurosci. Lett. 83, 303-306.

Peterson, R.E., Tu, C. and Linser, P.J. (1997) Isolation and characterization of a carbonic anhydrase homologue from the zebrafish (Danio rerio). .1. Mol. Evol. 44, 432-439.

Piatigorsky, J. (1989) Lens crystallins and their genes: diversity and tissue-specific expression. FASEBJ. 3, 1933-1940.

Piatigorsky, J. (1993) Puzzle of crystallin diversity in eye lenses. Dev. Dvn. 196, 267-272.

Pierce, J.C. and Sternberg, N.L. (1992) Using bacteriophage P1 system to clone high molecular weight genomic DNA. Methods Enzymol. 216, 549-574.

Radinsky, L.B. (1987) The evolution of vertebrate design. University of Chicago Press, Chicago, p 188

Rahim, S.M., Delaunoy, J.-P., and Laurent, P. (1988) Identification and immunocytochemical localization of two different carbonic anhydrase isoenzymes in teleostean fish erythrocytes and gill epithelia. Histochemistry 89, 451-459.

Rakic, P. (1971) Neuron-glia relationship during granule cell migration in developing cerebellar cortex. A Golgi and electronmicroscopic study in Macacus Rhesus. J. Comp. Neurol. 141, 283312.

Rathjen, F.G., Wolff, J.M., Frank, R., Bonhoeffer, F. and Rutishauser, U. (1987) Membrane glycoproteins involved in neurite fasciculation. J. Cell Biol. 104, 343-353.

Raymond, P.A., Barthel, L.K., and Curran, G.A. (1995) Developmental patterning of rod and cone photoreceptors in embryonic zebrafish. . comp. Neurol. 359, 537-550.

Ridderstrale, Y., Wistrand, P.J. and Brechue, W.F. (1994) Membrane-associated CA activity in the eye of the CA II-deficient mouse. Invest. Ophthalmol. Vis. Sci. 35, 2577-2584.

Riddle, R.D., Johnson, R.L., Laufer, E. and Tabin, C. (1993) Sonic hedgehog mediates the polarizing activity of the ZPA. Cell 75, 1401-1416.

Saarikoski, J. and Kaila, K. (1992) Simultaneous measurement of intracellular and extracellular carbonic anhydrase activity in intact muscle fibres. Pflugers Arch. 421, 357-363.

Sandell, J.H., Martin, S.C. and Heinrich, G. (1994a) The development of GABA immunoreactivity in the retina of the zebrafish (Brachydanio rerio). J. Comp. Neurol. 345, 596-601.








Sandell, J.H., Martin, S.C. and Heinrich, G. (1994b) The development of neurotrophin receptor Trk immunoreactivity in the retina of the zebrafish (Brachydanio rerio). Brain Res. Dev. Brain Res. 81, 192-200.

Sambrook J., E.F. Fritsch, T. Maniatis (1989) Molecular cloning: a laboratory manual, 2nd Ed. Cold Spring Harbor laboratory Press. Cold Spring Harbor, NY.

Sax, C.M., Cvekl, A. and Piatigorsky, J. (1997) Transcriptional regulation of the mouse alpha Acrystallin gene: binding of USF to the -7/+5 region. Gene 185, 209-216.

Schachner, M. and Martini, R. (1995) Glycans and the modulation of neural-recognition molecule function. Trends. Neurosci. 18, 183-191.

Schagger, H. and von Jagow, G. (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166, 368-379.

Schmitt, E.A. and Dowling, J.E. (1994) Early eye morphogenesis in the zebrafish, Brachydanio rerio. J. Comp. Neurol. 344, 532-542.

Schmitt, E.A. and Dowling, J.E. (1996) Comparison of topographical patterns of ganglion and photoreceptor cell differentiation in the retina of the zebrafish, Danio rerio. J Comp. Neurol. 371, 222-234.

Schreiber, J., Sock, E. and Wegner, M. (1997) The regulator of early gliogenesis glial cells missing is a transcription factor with a novel type of DNA-binding domain. Proc. Natl. Acad. Sci. U. S. A. 94, 4739-4744.

Seki, G., Coppola, S., Yoshitomi, K., Burckhardt, B.C., Samarzija, I., Muller-Berger, S. and Fromter, E. (1996) On the mechanism of bicarbonate exit from renal proximal tubular cells. Kidnev Int. 49, 1671-1677.

Shapiro, L.H., Venta, P.J. and Tashian, R.E. (1987) Molecular analysis of G+C-rich upstream sequences regulating transcription of the human carbonic anhydrase II gene. Mol. Cell Biol. 7, 4589-4593.

Shih, J. and Fraser, S.E. (1995) Distribution of tissue progenitors within the shield region of the zebrafish gastrula. Development 121, 2755-2765.

Shih, J. and Fraser, S.E. (1996) Characterizing the zebrafish organizer: microsurgical analysis at the early-shield stage. Development 122, 1313-1322.

Silver, J. and Rutishauser, U. (1984) Guidance of optic axons in vivo by a preformed adhesive pathway on neuroepithelial endfeet. Dev. Biol. 106, 485-499.

Silverman, D.N. (1982) Carbonic anhydrase: oxygen-18 exchange catalyzed by an enzyme with rate- contributing proton-transfer steps. Methods Enzvmol. 87, 732-752.









Silverman, D.N. (1995) Proton transfer in carbonic anhydrase measured by equilibrium isotope exchange. Methods Enzymol. 249, 479-503.

Singer, M., Nordlander, R.H. and Egar, M. (1979) Axonal guidance during embryogenesis and regeneration in the spinal cord of the newt: the blueprint hypothesis of neuronal pathway patterning. .1. Comp. Neurol. 185, 1-21.

Sly, W.S. and Hu, P.Y. (1995) Human carbonic anhydrases and carbonic anhydrase deficiencies. Annu. Rev. Biochem. 64, 375-401.

Soula, C., Foulquier, F., Duprat, A.M. and Cochard, P. (1993) Lineage analysis of early neural plate cells: cells with purely neuronal fate coexist with bipotential neuroglial progenitors. Dev. Biol. 159, 196-207.

Stankoff, B., Demerens, C., Goujet-Zalc, C., Monge, M., Peyron, F., Mikoshiba, K., Zalc, B. and Lubetzki, C. (1996) Transcription of myelin basic protein promoted by regulatory elements in the proximal 5' sequence requires myelinogenesis. Mult. Scler. 2, 125-132.

Stitt, T.N., Gasser, U.E. and Hatten, M.E. (1991) Molecular mechanisms of glial-guided neuronal migration. Ann. N. Y. Acad. Sci. 633, 113-121.

Stitt, T.N. and Hatten, M.E. (1990) Antibodies that recognize astrotactin block granule neuron binding to astroglia. Neuron 5, 639-649.

Streisinger, G., Walker, C., Dower, N., Knauber, D. and Singer, F. (1981) Production of clones of homozygous diploid zebra fish (Brachydanio rerio). Nature 291, 293-296.

Stuart, G.W., McMurray, J.V. and Westerfield, M. (1988) Replication, integration and stable germ-line transmission of foreign sequences injected into early zebrafish embryos. Development 103,403-412.

Talbot, D., Collis, P., Antoniou, M., Vidal, M., Grosveld, F. and Greaves, D.R. (1989) A dominant control region from the human beta-globin locus conferring integration site-independent gene expression. Nature 338, 352-355.

Tashian, R.E., Hewett-Emmett, D. and Goodman, M. (1983) On the evolution and genetics of carbonic anhydrases I, II, and III. Isozymes. Curr. Top. Biol. Med. Res. 7, 79-100.

Tashian, R.E., Venta, P.J., Nicewander, P.H. and Hewett-Emmett, D. (1990) Evolution, structure, and expression of the carbonic anhydrase multigene family. Prog. Clin. Biol. Res. 344, 159-175.

Tolbert, L.P. and Oland, L.A. (1990) Glial cells form boundaries for developing insect olfactory glomeruli. Exp. Neurol. 109, 19-28.

Tomarev, S.I., Callaerts, P., Kos, L., Zinovieva, R., Halder, G., Gehring, W. and Piatigorsky, J. (1997) Squid Pax-6 and eye development [see comments]. Proc. Natl. Acad. Sci. U. S. A. 94, 2421-2426.








Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U. S. A. 76, 4350-4354.

Townes, T.M., Lingrel, J.B., Chen, H.Y., Brinster, R.L. and Palmiter, R.D. (1985) Erythroidspecific expression of human beta-globin genes in transgenic mice. EMBO J. 4, 1715-1723.

Turner, D.L., Snyder, E.Y. and Cepko, C.L. (1990) Lineage-independent determination of cell type in the embryonic mouse retina. Neuron 4, 833-845.

Turner, D.L. and Cepko, C.L. (1987) A common progenitor for neurons and glia persists in rat retina late in development. Nature 328, 131-136.

Udolph, G., Prokop, A., Bossing, T. and Technau, G.M. (1993) A common precursor for glia and neurons in the embryonic CNS of Drosophila gives rise to segment-specific lineage variants. Development 118, 765-775.

Uusitalo, M. and Kivela, T. (1994) Differential distribution of the HNK-1 carbohydrate epitope in the vertebrate retina. Curr. Eve Res. 13, 697-704.

Venta, P.J., Montgomery, J.C., Wiebauer, K., Hewett-Emmett, D. and Tashian, R.E. (1984) Organization of the mouse and human carbonic anhydrase II genes. Ann. N. Y. Acad. Sci. 429, 309-323.

Verderber, L., Johnson, W., Mucke, L., Sarthy, V. (1985) Differential regulation of a glial fibrilliary acidic protein - LacZ transgene in retinal astrocytes and Muller cells. Inves. Oph. & Vis. Sci. 36, 1137-1143.

Wang, A.M., and Mark, D. (1990) Quantitative PCR. PCR protocols: A guide to methods and applications. Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (eds) Academic Press, San Diego, CA pp 70-75.

Westerfield, M. (1995) The Zebrafish Book. A guide for the laboratory use of zebrafish (Brachydanio rerio). University of Oregon Press, Eugene

Wetts, R., Serbedzija, G.N. and Fraser, S.E. (1989) Cell lineage analysis reveals multipotent precursors in the ciliary margin of the frog retina. Dev. Biol. 136, 254-263.

Wetts, R. and Fraser, S.E. (1988) Multipotent precursors can give rise to all major cell types of the frog retina. Science 239, 1142-1145.

Wichterle, H., Garcia-Verdugo, J.M. and Alvarez-Buylla, A. (1997) Direct evidence for homotypic, glia-independent neuronal migration. Neuron 18, 779-791.

Wijgerde, M., Grosveld, F. and Fraser, P. (1995) Transcription complex stability and chromatin dynamics in vivo. Nature 377, 209-213.








Wistrand, P.J. and Knuuttila, K.G. (1989) Renal membrane-bound carbonic anhydrase. Purification and properties. Kidney Int. 35, 851-859.

Wray, W., Boulikas, T., Wray, V.P. and Hancock, R. (1981) Silver staining of proteins in polyacrylamide gels. Anal. Biochem. 118, 197-203.

Wride, M.A. (1996) Cellular and molecular features of lens differentiation: a review of recent advances. Differentiation. 61, 77-93.

Yin, X., Watanabe, M. and Rutishauser, U. (1995) Effect of polysialic acid on the behavior of retinal ganglion cell axons during growth into the optic tract and tectum. Development 121, 34393446.

Yoshihara, C.M., Lee, J.D. and Dodgson, J.B. (1987) The chicken carbonic anhydrase II gene: evidence for a recent shift in intron position. Nucleic. Acids. Res. 15, 753-770.

Yuh, C.H., Moore, J.G. and Davidson, E.H. (1996) Quantitative functional interrelations within the cis-regulatory system of the S. purpuratus Endol6 gene. Development 122, 4045-4056.

Yuh, C.H. and Davidson, E.H. (1996) Modular cis-regulatory organization of Endol6, a gutspecific gene of the sea urchin embryo. Development 122, 1069-1082.

Zheng, C., Heintz, N. and Hatten, M.E. (1996) CNS gene encoding astrotactin, which supports neuronal migration along glial fibers. Science 272, 417-419.

Zheng, M.H., Fan, Y., Wysocki, S., Wood, D.J. and Papadimitriou, J.M. (1994) Carbonic anhydrase II gene transcript in cultured osteoclasts from neonatal rats: effect of calcitonin. Cell Tissue Res. 276, 7-13.

Zhu, X.L. and Sly, W.S. (1990) Carbonic anhydrase IV from human lung. Purification, characterization, and comparison with membrane carbonic anhydrase from human kidney. J. Biol. Chem. 265, 8795-8801.

Zolotukhin, S., Potter, M., Hauswirth, W.W., Guy, J., Muzyczka, N. (1996) A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells. J Virol 70, 46464654




Full Text

PAGE 1

A STUDY ON THE ISOLATION, LOCALIZATION AND REGULATION OF CARBONIC ANHYDRASE, USING THE ZEBRAFISH AND CHICKEN RETINA AS MODEL SYSTEMS By ROBERT EARL PETERSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA

PAGE 2

ACKNOWLEDGMENTS I would like to acknowledge those who assisted me in my dissertation research. My mentor, Dr. Paul J. Linser, taught me nearly all the non-DNA-based techniques (and some of the DNA-based ones) I know. Dr. Chingkuang Tu performed carbonic anhydrase rate reactions. Dr. James M. Fadool and Dr. John Schetz gave me valuable troubleshooting advice for SDS-PAGE and Western blot analyses. Dr. Robert M. Greenberg, Dr. Sean M. Boyle, Dr. Gary J. LaFleur, and Dr. Michael C. Jeziorski aided me with protocols and advice during the cloning of zebrafish carbonic anhydrase. Dr. David Hewett-Emmett provided valuable assistance through many e-mail discussions concerning carbonic anhydrase phylogeny. The chicken promoter work presented was aided by protocols from Dr. Russell Buono. The zebrafish PAC clones used in this dissertation were isolated from a filtered array library that was the kind gift of Matthew Clark. All the figures and photos in this dissertation were produced by, fixed by, or discussed with Lynn Milstead and James Netherton. Through my years at The Whitney Lab, there have been many people who have provided me with hours of scientific discussion. Dr. Robert Greenberg, Dr. W. Clay Smith, Dr. James M. Fadool, Dr. William R. Buzzi, Rana Lewis, and Luther Dunlap have all provided me with invaluable technical advice. I am greatly indebted to several "gradstudent-type" scientists who helped me along in my scientific and personal maturation through many late-night, coffee-laden discussions, they are: Dr. Sean Boyle, Dr. Gary LaFleur, and Dr. John Schetz (who only drinks Tab, but is still OK). My life outside the lab would have been largely impossible had it not been for the help of Billy Raulerson and Bob Birkett. I would like to acknowledge and thank my committee for their patience and guidance: Dr. William Dunn, Dr. Paul Hargrave, Dr. William Hauswirth, Dr. W. Clay Smith, and my mentor, Dr. Paul J. Linser. I would like to additionally thank Paul for his

PAGE 3

tutelage and guidance through the years. I have long measured my progress against the yardstick of his knowledge. Along the same vein I must thank Dr. Roger McPherson, my undergraduate advisor at Clarion University of Pennsylvania, who supported me when my record didn't. Lastly, I would like to thank those who are truly responsible for my being where I am, my family; William Earl Peterson, Jane Eleanor Peterson, William Haller Peterson, and Candace Denise Peterson. Through the years I have always been able to count on their love and support. iii

PAGE 4

TABLE OF CONTENTS Page ACKNOWLEDGMENTS ii ABBREVIATIONS vii ABSTRACT ix GENERAL INTRODUCTION 1 Differentiation During Development 1 Glia and Neurons, the Functional Unit of the Nervous System 2 Differentiation of Glia and Neurons from a Common NeurogHoblast 2 Glia Function 7 The role of glia in axonal migration during late neural development 8 The function of gha in fully developed nervous tissue 9 Introduction to Carbonic Anhydrase 10 The Carbonic Anhydrase Gene Families 10 Functional Role of Carbonic Anhydrases 11 Carbonic anhydrase's physiological role 1 1 Function of carbonic anhydrase in the neural retina 1 1 Carbonic Anhydrase Gene Regulation 13 Hypothesis of this Research 14 CARBONIC ANHYDRASE PROTEIN ISOLATION, CDNA SEQUENCING, AND PHYLOGENY IN THE ZEBRAFISH 16 Introduction and Data Summary ..16 Materials and Methods 17 Zebrafish Colony Maintenance 17 l^fication and Peptide Sequencing of Carbonic Anhydrase from Zebrafish 18 O Exchange Kinetics 19 Cloning of the Carbonic Anhydrase Homologue from Zebrafish 20 Sequencing the cDNA for Zebrafish Carbonic Anhydrase 21 Isozyme Determination Through Sequence Analysis and Phylogeny 21 Northern Blot Analysis 22 Results 23 Carbonic Anhydrase Isolation and Protein Sequence 23 Sequencing the cDNA for Zebrafish Carbonic Anhydrase 26 Northern Blot Analysis 28 Isozyme Family Determination Through Sequence Analysis and Phylogeny 29 iv

PAGE 5

Discussion 30 THE EXPRESSION PATTERN OF A ZEBRAFISH CARBONIC ANHYDRASE HOMOLOGUE IN THE RETINA 34 Introduction and Data Summaiy 34 Materials and Methods 35 Zebrafish Colony Maintenance and Breeding 35 Gel Electrophoresis 36 Tissue Processmg and Immunohistochemistry 37 Results 38 Western Blot Analysis 38 Cellular Localization in the Retina 38 Adult 39 Marginal zone 41 Day 1 41 Day 2.5 42 Day 3 43 Day 3.5 44 Discussion 44 ZEBRAFISH GENOMIC CLONE ISOLATION AND PARTIAL SEQUENCING AND INTRON/EXON BOUNDARY CLONING AND SEQUENCING 48 Introduction and Data Summary 48 Promoters in Gene Regulation 48 Materials and Methods 51 Cloning CAH-Z Introns Through PCR 51 Isolation of Zebrafish PAC Clones 51 Promoter-Reporter Plasmid Construction and Purification 53 Cell Culture of Retina Aggregates, Patched Lens EpitheUum and Chicken Embryonic Fibroblast Cells 54 Transfection Procedure in Cell Cultures 55 Tissue Fixation and Immunohistochemistry 56 Statistics ;57 Results 57 Isolation of CAH-Z Genomic Clones 57 Intron Cloning by PCR 58 Comparative Analysis of CAH-Z Genomic Sequence 59 Testing the Chig Constructs in Defined Cell Cultures 60 Testing Miiller-Cell Specific Expression in Retina Aggregate Cultures 61 Discussion 62 GENERAL RESULTS AND DISCUSSION 67 APPENDIX GENOMIC SEQUENCE FROM J026 AND SUBCLONES B239 AND B176 71 V

PAGE 6

BIBLIOGRAPHY BIOGRAPHICAL SKETCH

PAGE 7

ABBREVIATIONS BCL bootstrapping confidence levels CA carbonic anhydrase CA-I carbonic anhydrase I CAH-Z carbonic anhydrase homologue from zebrafish CEF chicken embryonic fibroblast CO2 carbon dioxide DCAH Drosophila melanogaster carbonic anhydrase homologue DNA deoxyribonucleic acid Endo-LC endoproteinase lysine C GPI glycosylphosphatidylinositol GS glutamine synthetase HCA human carbonic anhydrase HCO3 bicarbonate hpf, dpf hours (days) post-fertilization HNK-1 human natural killer 1 ilm inner limiting membrane inl inner nuclear layer lOP intraocular pressure ipl inner plexiform layer kDa, Da (kilo)Daltons MC Muller cell NMDA A^methyl-D-aspartate olm outer limiting membrane onl outer nuclear layer opl outer plexiiorm layer pCA plasmid containing carbonic anhydrase PLE patched lens epithelial RACE rapid amplification of cDNA ends RNA ribonucleic acid vii

PAGE 8

SDS sodium dodecyl sulfate TBE Tris-Borate + EDTA buffer TSCA tiger shark carbonic anhydrase \xg microgram \iL microliter micrometer viii

PAGE 9

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy A STUDY ON THE ISOLATION, LOCALIZATION AND REGULATION OF CARBONIC ANHYDRASE, USING THE ZEBRAFISH AND CHICKEN RETINA AS MODEL SYSTEMS By Robert Earl Peterson May, 1998 Chairman: Dr. Paul J. Linser Major Department: Department of Anatomy & Cell Biology I am investigating carbonic anhydrase as a gene expressed specifically in Miiller glial cells (MC). Carbonic anhydrase (CA) catalyzes the interconversion of CO2 to HCO3". A high-activity CA enzyme is found in the cytoplasm of all vertebrate MCs. Understanding the regulatory mechanisms necessary for MC-specific expression of CA might elucidate general mechanisms involved in glial cell differentiation. Using CA-inhibitor-based affinity chromatography, a single protein was isolated. The protein was characterized by both direct peptide-sequence and enzymatic rate analyses as a high-activity carbonic anhydrase homologue (CAH-Z). CAH-Z's cellular localization was determined using immunohistochemistry. A polyclonal antiserum, produced against purified CAH-Z, recognized a single band of 29,000 Daltons by Western blot analysis. The antiserum specifically stained the MCs in the adult retina. No CAH-Z staining was present during development until 72 hours postfertilization (hpf); expression at this time was found only in MCs. Thus, CAH-Z expression in the retina occurred only in the MCs. MC-differentiation was also followed using an additional marker, the HNK-1 carbohydrate epitope. HNK-1 staining was ix

PAGE 10

observed as early as 48 hpf, and by 60 hpf was clearly present on radial cells. These same cells express the CAH-Z protein after 72 hpf. A cDNA sequence was determined for CAH-Z. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used to clone the cDNA. Three sets of overlapping RTPCR reactions were carried out to clone the cDNA. The clones were sequenced and aligned to determine the cDNA sequence. Translating the cDNA resulted in an open reading frame of 260 amino acids that showed greater than 50% identity to vertebrate CAs. Phylogenetic analysis suggested that CAH-Z was a novel isoform; specifically, the results suggested that CAH-Z shared a common ancestor with the mammalian CA-I, CAII, and CA-III genes. A genomic clone containing CAH-Z sequence was isolated using a PAC library. The clone was subcloned and two fragments of 5.0 and 2.3 kb were isolated. The preliminary sequence is presented. As a preliminary test of the regulatory mechanisms responsible for MC-specific expression, a chicken CA-II promoter was tested for the ability to drive MC-specific expression in a retina culture system. The 1376 basepair proximal 5' promoter showed no MC-specificity. X

PAGE 11

CHAPTER 1 GENERAL INTRODUCTION Differentiation During Development The term development refers to the processes through which a single-celled zygote gives rise to an organism. The processes responsible generally take place during embryogenesis, although development continues during post-embryonic stages. Vertebrate embryogenesis can be divided into four phases; cleavage, gastrulation, neurulation, and organogenesis (Gilbert, 1994). During cleavage, the single-celled zygote divides into a number of smaller cells, called blastomeres. In gastrulation, cell rearrangements rearrange the blastomeres into three cell-layers; the ectoderm, the mesoderm and the endoderm. The ectoderm then involutes during neurulation to form the neural tube, from which all neural tissues will develop. During organogenesis, most cells differentiate from pluripotent blast cells into mature cell-types, giving rise to functional organs. Successful development results in a viable animal emerging into the world. Organogenesis revolves around the transformation of pluripotent blast cells into terminally differentiated cells (Davidson, 1993; Davidson, 1990). One marker of terminal differentiation is the expression of cell-specific proteins. Which proteins are present, and how they interact with other molecules, defines the function of a cell. Whether a protein is present in only one cell-type, or in many cell-types, varies according to its regulation. A protein' s expression is regulated, in most cases, at the transcriptional level through a series of c/^'-regulatory elements. The cw-regulatory elements are DNA sequences that are bound by trans-acting transcription factors. Transcription factors activate or repress a gene' s expression. 1

PAGE 12

2 A "gene battery", as defined by Davidson, contains genes which are coordinately regulated (Amone and Davidson, 1997). The gene's in a gene-battery can have many of the same tt-anscription factors binding their cw-regulatory modules (Davidson, 1993). The binding of transcription factors to c/^'-regulatory modules regulates the correct upand down-regulation of gene-batteries during development; the result of this regulation is celldifferentiation. The process of cell-differentiation in neural glia is the focus of this dissertation. The neural retina contains both glia and neurons that sometimes differentiate from a common neuroglioblast (Cepko et al. 1996; Cepko, 1993; Fekete et al. 1994; Wetts and Fraser, 1988). The neural retina contains six neural cell types: photoreceptors (sensory neurons); amacrine neurons, horizontal neurons, and bipolar neurons (retinal intemeurons); ganglion neurons (retinal, output inter-neurons); and the Miiller cells (MC; primary glial cell). Vision is crucially dependent on the correct spatial placement and connection of glia and neurons in the retina. The fact that glia and neurons arise from a common precursor, and will function in a complementary manner, poses an interesting question that is central to the study of development. What forces a pluripotent blast cell to become only one of many possible mature cell-types? GUa and Neurons, the Functional Unit of the Nervous System Differentiation of Glia and Neurons from a Common Neuroglioblast GUa and neurons together comprise the functional unit of the nervous system. These two cell-types work together in a complementary fashion to process neural information correctly. Both glia and neurons can arise from a neuroglioblast in vertebrates and those invertebrates studied to date (Fredieu and Mahowald, 1989; Udolph et al. 1993; Bossmg et al. 1996; Bossing and Technau, 1994; Soula et al. 1993; Leber et al. 1990; Galileo et al. 1990; Gray and Sanes, 1992; Gray et al. 1988; Wetts and Fraser, 1988; Wetts et al. 1989; Turner et al. 1990; Turner and Cepko, 1987; Hoh et al. 1988).

PAGE 13

3 Therefore, a mechanism exists which influences an undifferentiated neurogHoblast into one of the two fates. To understand what controls glial or neuronal differentiation, we must understand these mechanisms at the level of the cw-regulatory elements. Development takes place through a cascade of regulation, begmning with maternal factors, which activate or repress zygotic genes and ending with cell-specific expression of peripheral genes. Drosophila melanogaster (Drosophila) has been a useful model for identifying high-level regulatory genes through mutation analysis. High-level regulatory genes are generally early-acting transcription factors involved in pattern formation or the differentiation of whole tissues through the regulation of other transcription factors (Gray et al. 1995). They do not, generally, regulate peripheral gene expression. The expression of a single high-level gene can control glial cell differentiation in Drosophila. Glial cells in Drosophila play a critical role in axonal migration (Klambt and Goodman 1991). Mutant screens for axonal migration defects identified several genes (Jacobs 1993). One isolated mutant contained no glial cells; this mutant was named glial cells missing {gem; Hosoya et al. 1995; Jones et al. 1995). The gem gene encodes a transcription factor, which showed no homology to other known proteins, and that bound a unique DNA sequence (Schreiber et al. 1 997). Two experimental results show that gem is both necessary and sufficient for glia differentiation. The absence of gem proteins, in the mutant fhiit fly, resuhed in a complete loss of glial cells in the CNS or PNS. Conversely, overor misexpression of the gem protein forced cells that normally become neurons to differentiate into glia. Thus, gem appears to be necessary and sufficient for glial cell differentiation. The next known step in glial differentiation occurs through two parallel pathways downstream of gem. The one pathway involves two Ets-type transcription factors from the pointed locus (pntPl and pnt?2), which are expressed in a coordinate fashion in all Drosophila CNS glial cells (Hummel et al. 1997; Klambt, 1993). The misexpression of pnt?\ in neurons forces them to express glial-cell genes. However, while the loss of pnt

PAGE 14

4 expression decreases the number of glial cells, it does not eliminate them. Therefore, while pnt is necessary for the expression of some glial genes, it is not sufficient for glial differentiation. This suggests that pnt is downstream of gem. The other pathway downstream of gem compliments the pnt pathway and is controlled by the tramtrack (ttk) transcription factor (Giesen et al. 1997). The transcription factor ttkp69 is a repressor found in all non-neuronal CNS cells (Badenhorst et al. 1996; Campos-Ortega, 1996; Harrison and Travers, 1990). Mutant embryos contain 20% fewer lateral glial cells and their midline glia cannot migrate or differentiate properly. Cells that normally become neurons but misexpress ttk, on the other hand, have reduced neuronal marker expression. These experiments suggest ttk' s normal role is to block neuronal differentiation. That is, some cells that would normally differentiate into glia become neurons when ttk is removed. Mutants for either pnt or ttk do not disrupt expression of the other gene, and double mutants have an additive phenotypic effect, suggesting they are parallel pathways. It appears that gem acts to up-regulates glial genes through pnt, and represses neural genes through ttk; a combination of these two pathways is necessary for glia development (Figure 1.1). Several pieces of evidence suggest that gem might function in vertebrates. A mammalian gem homologue (Gcml) has recently been cloned and sequenced. At this point, no functional analysis has been reported. The Drosophila gem protein binds a specific DNA sequence that is unique among transcription factors. Addition of this sequence to heterologous promoters resulted in activation of a reporter gene in a mammalian cell hne (Schreiber et al 1997). A search of the mammalian DNA database shows the presence of this specific sequence. While these two pieces of data are circumstantial, given the conservation of other Drosophila pathways in various developmental processes (Marigo et al. 1996; Marigo and Tabin, 1996), it seems possible that the gem pathway does exist in vertebrates, and that it could play a role in glia differentiation. However, even if gem functions in vertebrates to begin glia differentiation,

PAGE 15

5 neighboring glia with different morphology and differing functions must still diverge from the common pathway at some Figure 1.1. Early Pathway of Glial DifTerentiation. A model for glial cell differentiation which suggests that gem acts early on to up-regulate glial specific genes (pnt, repo) while also servmg to down-regulate neuronal genes. This dual pathway favors glial cell differentiation while discouraging mistaken neuronal differentiation at the same time (Giesen et al. 1997). point (Giangrande, 1996). The early stages of glial differentiation in Drosophila have been described, but the mechanisms responsible for terminal differentiation remain unknown. Studies of terminal differentiation often focus on a bottom-to-top analysis. Bottom-to-top analyses study the regulatory modules responsible for cell-specific expression of peripheral genes. Again, peripheral genes are generally non-transcription factors that play a part in the cell' s structure or function (e.g. ion channels, structural

PAGE 16

6 proteins, and metabolic enzymes). The regulatory modules responsible for peripheral gene expression are best described in vertebrates, although some invertebrate peripheral genes are well-characterized (Kirchhamer et al. 1 996). The specificity of a regulatory module can be tested in vitro using cell culture, or in vivo using transgenic animals. Several glia peripheral genes are now being tested in cell-culture systems and in transgenic mice (Blanchard et al. 1996; Edelman and Jones, 1997; Stankoff et al. 1996; Li et al. 1995). A detailed analysis of MC-specific genes is not nearly as complete as those performed with the crystallins . Only two genes have been studied in any detail during MC differentiation, the glial fibrilliary acidic protein, and the glutamine synthetase gene (Verderber et al. 1995; Li et al. 1995; Li et al. 1997). A more thoroughly studied system, the lens crystallins, will serve here as an example of this type of analysis. Lens development relies on the high, preferential expression of the crystallins. The crystallin "gene-battery" encodes a number of proteins which are either unique to the lens, or which are recruited from other tasks to serve as crystallins (Cvekl and Piatigorsky, 1996; Wride, 1996). Crystallins are either ubiquitous across vertebrate species, or taxon specific (e.g. a-, P-, and Xcrystalhns are found in all vertebrates, while 5-crystallin is found only in the bird and reptile lens Piatigorsky, 1989; Piatigorsky, 1993). The regulation of the crystallin gene-battery occurs mainly through small proximal 5' promoters (McDermott et al. 1997; Sax et al. 1997; Li et al. 1997; Gopal-Srivastava et al. 1996). Minimal promoters are identified using a homogeneous patched lens epithelial (PLE) cell-culture, followed by analysis in transgenic mice (Cvekl and Piatigorsky, 1996). Dissection of the individual crystallin promoters suggests that high-level transcription factors might play a role in their regulation (Gopal-Srivastava et al. 1996; Cvekl et al. 1995a; Cvekl et al. 1995b). In general, high-level transcription factors modulate other transcription factors that regulate peripheral gene expression. However, in the lens it appears that a transcription factor important for whole eye formation, Pax-6, plays a direa role in regulating crystallin expression.

PAGE 17

7 The transcription factor Pax-6 contains a conserved-paired domain and a homeodomain (Duncan et al. 1997; Hoist et al. 1997). Pax-6 is essential for vertebrate and invertebrate eye development, as well as otolith development in an ascidian (Harris, 1997; Tomarev et al. 1997; Boncinelli, 1997; Glardon et al. 1997; Haider et al. 1995). The loss of Pax-6 expression results in mutated or missing eyes. Conversely, over-expression in Drosophila of Pax-6 from several sources {Drosophila, mouse, squid, and ascidian) causes ectopic eye structures. Pax-6 is necessary for eye development, and its ectopic expression results in eye formation (Gehring, 1996). Studies of crystallin minimal promoters show that most, if not all, interact with Pax-6 directly. Pax-6 up-regulates chicken and mouse a-crystallins and guinea pig taxonspecific crystallins (Cvekl and Piatigorsky, 1996; Gopal-Srivastava et al. 1996; Cvekl et al. 1995b). Pax-6 could also be responsible for repressing chicken B-crystallin expression in cotransfection studies (McDermott et al. 1997; Duncan et al. 1996; Cvekl and Piatigorsky, 1996). Pax-6 plays a direct role in crystallin regulation, therefore, Pax-6 regulates the expression of peripheral genes as well as acting very early in the eye-development pathway. The differentiation of MCs, at the regulatory module level, is relatively imstudied. Both the MCs expression of cell-specific markers and the cell's function in neural retina are well characterized (Newman and Reichenbach 1996; Linser et al. 1997a). Many intriguing questions remain to be answered concerning MC differentiation, including whether gem regulates peripheral genes directly in Drosophila, and if it functions across the vertebrateinvertebrate divide as does Pax-6. Glia Function Glial cells are an integral part of neural networks. Originally described by Virchow (1846) as "kitt," or glue, without any apparent cell structure, glial cells are still generally thought of as "supporting cells." This bias in thinking of glia as structural and supporting

PAGE 18

8 cells is not without historical basis in fact. Glia do play an important role in the nervous system architecture and in maintaining the extracellular microenviroment. However, they might also be involved in directly regulating neural synapses, and therefore, affecting the function of neural networks. The role of glia in axonal migration during late neural development. The glia play an integral role in neuronal maturation, specifically in axon pathfinding and cell migration. Examples of glia-mediated axonal migration come fi-om both invertebrate and vertebrate CNS and PNS. However, other factors do play a role in migration besides cell-cell adhesion with the glia, including the extracellular matrix (Galileo et al. 1992; Duband et al. 1991; Bronner-Fraser, 1993a; Bronner-Fraser, 1993b), secreted molecules (Cohen-Cory and Fraser, 1995; Cohen-Cory et al. 1996; McFarlane et al. 1995) and cell-cell interactions with other neurons (Yin et al. 1995; Wichterle et al. 1997). Many immature neurons migrate along glial pathways from "germinal layers" to a "maturation layer" where they will function. A step-wise progression of cell-cell recognition, cell-cell adhesion, cell motiUty, and detachment from the glial cells must occur during migration. Glia function as a "template" for axonal migration in various tissues, including the vertebrate cerebellum (Rakic, 1971; Antonicek et al. 1987; Zheng et al. 1996; Komuro and Rakic, 1993; Gao et al. 1991), the vertebrate cortex (Fishell and Hatten, 1991; Stitt et al. 1991; Stitt and Hatten, 1990), newt spinal cord (Singer et al. 1979); neural retina (Silver and Rutishauser, 1984), and the Drosophila CNS (Jacobs and Goodman, 1989a; Jacobs and Goodman, 1989b; Gruberg et al. 1979b). The glial cells also play a role in defining the domains of the dendritic microcircuitry later in development (Crandall et al. 1990; Hutchins and Casagrande, 1990; Tolbert and Oland, 1990; Mission et al. 1991). The glial cells play a major role in the proper formation of nervous fissue architecture.

PAGE 19

9 The function of glia in fully developed nervous tissue. Perhaps the best-studied function of glial cells is the maintenance of the extracellular microenvironment. In the neural retina, the MCs regulate many extracellular factors, including neurotransmitter recycling, and and CO2 removal. Glutamate serves as the primary neurotransmitter in the retina. Glutamate released at synaptic connections must be quickly removed so that further signaling can occur, and so that prolonged signaling does not occur. Glutamate is recycled using proteins found in the MCs (Clark and Sokoloff, 1994). Also, in the MCs, are channels that remove excess K"^ from the extracellular environment through "siphoning." "K^-siphoning" transports the ion from the extracellular space into the MCs through channels located in the plexiform layers (Karwoski et al. 1985). A concentration of equal to that taken up in the plexiform layers, is expelled through the MC endfeet into the vitreous chamber (Newman, 1987). A similar process might occur with CO2. which is the major product of metabolism. While most tissues remove CO2 through the interspersed circulatory system, most retinas are avascular. The MCs are thought to compensate for this lack of an intra-retinal circulatory system by siphoning CO2 into the vitreous chamber (see "Carbonic Anhydrase in Tissue Function" below). Glial cells respond to and influence neuronal signaling through calcium-mediated oscillations. Both brainand retina-derived astrocytes generate Ca^" waves that spread from cell to cell (Cornell-Bell et al. 1990; Cornell-Bell and Finkbeiner, 1991; Newman and Zahs, 1997). The Ca^^ waves in astrocytes can be started either by neuronal release of glutamate, or through experimental manipulation (e.g. photostimulation, mechanical stimulation, or chemical stimulation). The glial-carried Ca^* waves can, in turn, affect neurons. Ca^"^ waves pass through the glia; when a neuron is in contact with the glia its intracellular Ca^^ increases. There is evidence for this neuronal increase being caused either by unidirectional gap junctions from glia to neuron (Nedergaard et al. 1995), or by an (NMD A) receptor mediated pathway (Parpura et al. 1994). Increased neuronal Ca^^

PAGE 20

10 can influence cell movements, signal transduction, and gene expression (Gallin and Greenberg, 1995; Finkbeiner and Greenberg, 1997; Ginty, 1997). If glia mediate changes in neuronal Ca^^ levels, then they might mediate neuronal function. If they mediate neuronal signaling, then a new factor must be added to the current thinking on neural networks. Not only must neuronal connections be taken into consideration, but also the input from surrounding glial cells. Introduction to Carbonic Anhydrase The Carbonic Anhydrase Gene Families The only proven physiological role for the carbonic anhydrases (CAs, EC 4.2.1.) is the reversible inter-conversion of CO2 to HCO3'. In the early 1920s, two groups simultaneously described CA activity (reviewed in, Davenport, 1984). Three gene families, the a,p, and x are now known to encode for CA' s. The high-activity CA isozymes (CAII, CA-IV, CA-V, CA-VII, and CAH-Z) convert CO2 to HCO?' at 250,000 1,400,000 molecules/sec, while other isozymes operate at a lower rate (Heck et al. 1996). The proteins originally described as highand low-activity carbonate dehydratases belong to the a-family and are now known as CA-II and CA-I respectively. There are 10 sequenced vertebrate a-CA isozymes (CA-I through CA-IX, and CAH-Z; see HewettEmmett and Tashian, 1996 for a recent review of CA gene famihes). Almost all tissues contain CA activity in one or more cellular compartments (Sly and Hu, 1995). The cytoplasmic enzymes are CA-I, CA-II, CA-III, CA-VII, CA-VIII, and CAH-Z (Peterson et al. 1997; Sly and Hu, 1995), CA-IV is glycosylphosphatidylinositol-(GPI)-anchored to the plasma membrane (Wistrand and Knuuttila, 1989; Zhu and Sly, 1990), CA-V is found in the mitochondria (Nagao et al. 1994), CA-VI is a secreted enzyme (Femley et al. 1989), and CA-IX is an integral membrane protein (Peles et al. 1995). CA expression exhibits redundancy on several levels. The first level is the presence of multiple CA isozymes within a given cellular compartment, for example CA-I

PAGE 21

11 and CA-II within the red blood cell cytoplasm. The second level of redundancy lies in multiple isozymes expressed in a different cellular compartments by a single cell-type (Saarikoski and Kaila, 1992; Lynch et al. 1993; Dodgson et al. 1993; Dodgson, 1991). How multiple isozymes expressed by a single cell function in normal cell-physiological is the topic of the next section. Functional Role of Carbonic Anhydrases Carbonic anhydrase' s physiological role The CA-II and CA-FV isozymes function in the same cell, along with other proteins such as the anion exchanger (AE), to control CO2/HCO?" levels both intracellularly and intercellularly. The best-studied model of CO2/HCO3 control is the kidney intermediate mbule (Seki et al., 1996). Urine passing from the glomeruH into the descending tubule contains a large amount of HCO3". The ascending tubule recycles HCO3" through a series of interactions involving CA-II, CA-FV and the AE. The lumenal HCO3' is converted to CO2 by the extracellular CA IV isozyme. The CO2 then diffuses across the tubule membrane into the cytoplasm of the cells, where a high concentration of the CA-II isozyme converts it back into HCO3'. AEs on the basolateral membrane transport the increased HCO3" into the extracellular space, where it is removed by the adjacent capillary system. Thus, while CA's fimction is always the interconversion of CO2 and HCO3", its association with other proteins results in a physiological role beyond its enzymatic one. Function of carbonic anhydrase in the neural retina The presence of a cytoplasmic CA, an AE, and a membrane-bound form of CA together in the retina, suggests a functional relationship comparable to that found in the kidney. A cytoplasmic CA is localized to the MCs, in all vertebrate species from lamprey to human (Linser and Moscona, 1981). Where the enzyme' s activity is known, the

PAGE 22

12 enzyme present is a high-activity isozyme. The AE, which is responsible for transporting HCO3 into and out of the cell, is known through electrophysiological and immunohistochemical analyses to be present on MCs (Newman, 1996; Kobayashi et al. 1994). These analyses both suggest that the exchanger is preferentially localized to the basal end feet, which abut the vitreous chamber. Several lines of evidence, both electrophysiological and histochemical suggest an extracellular CA in the retina. Nevraian has shown that treating isolated salamander MCs with benzolamide, which is weakly permeable, effects extracellular pH rectification. This effect correlates an extracellular CA with pH buffering (Newman, 1 994). Wistrand and colleagues have shown a membrane-localized CA activity present in the retina lising a histochemical technique on a line of CA-II deficient mice (Ridderstrale et al. 1994). It is interesting to note that antibodies against rat CA-FV do not stain the retina, although nearby blood vessels are positive (Hageman et al. 1991). This raises the possibility that the extracellular CA is not CA-IV, but another isozyme. pH control and bicarbonate homeostasis in the retina are partially the result of CA activity. Most vertebrate retinas are avascular, which precludes the most direct route for CO2 recycling. The MCs have been recruited to remove excess CO2 through "CO2 siphoning," which shares similar mechanisms with both "K^ siphoning" and HCO?' removal from the kidney (Newman and Reichenbach, 1996; Newman, 1991). In "CO2 siphoning," extracellular CO2 is moved into the MCs either as CO2 or HCO?". Like in K^siphoning, an equal concentration of HCOj is then released into the vitreous chamber through AEs present on the basal end feet (Newman, 1991). The mechanism for CO2 siphoning has not been described as well as for siphoning. CA also plays a role in maintaining the extracellular pH of the retina. Normal light-induced retinal activity results in a transient alkalization followed by sustained acidification (Borgula et al., 1989). The pH changes could significantly influence neuronal activity. For example, a decrease in pH of only 0.05 pH units, reduces synaptic

PAGE 23

13 transmission between photoreceptors and second-order cells by up to 24% (Barnes et al., 1993). Neuronal activity depolarizes the MCs (due to increased extracellular K+), which activates its electrogenic Na^-HCOs" co-transporter. The action of the co-transporter acidifies the extracellular environment, thereby neutralizing activity-based alkalization (for review see Newman, 1996). CA's function in the neutralization is known through two sets of inhibitor studies. Newman (1994) shows that treatment of isolated MCs with the inhibitor benzolamide results in extracellular acidification rising by 269% of controls. The change in retinal pH due to the soluble inhibitors acetazolamide and methazolamide has also been tested in intact retinas (Borgula et al., 1989). The results showed that mcubation with CA inhibitors results in a more acidic baseline pH and increases lightevoked changes in extracellular pH. Given the importance of extracellular pH for neural function, and the key role of CA in maintaining extracellular pH, perhaps it is not siuprising that all vertebrate retinas maintain CA in their MCs. Carbonic Anhydrase Gene Regulation The CA-II gene promoter has been studied in numerous animals and tissues. Putative cw-regulatory regions have been identified which could play a role in controlling expression. Several early studies showed that CA-II expression in immature erythrocyte cells and bone marrow was activated by thyroid hormone T3 binding to a vitamin D3 response element (Barettino et al. 1993; Pain et al. 1990). Buono and others (1992), showed that a 1 .3 kb chicken CA-II promoter could drive reporter gene expression in cultured lens epithelial cells. Marino (1993) concluded that an Ap2-like element was essential for core promoter activity and that a cAMP response element was important for increases in transcription in NIH-3T3 cells. While specific regions were not identified for the induction, calcitonin (Zheng et al. 1994), pH increase (Brion et al. 1994), and tumor necrosis factor-alpha (Franz et al. 1 994) all caused up-regulation of the CA-II gene. Shapiro and others (1987) showed that as little as 0.2 kb of human promoter caused high

PAGE 24

14 levels of expression in murine Ltkfibroblasts and HeLa cells. Similarly, a 0.25 kb promoter resulted in high reporter gene activity in NIH-3T3 and HepG2 cell-lines (Marino, 1993). Unlike many other promoters studied, no CA-II promoter construct has driven cell-specific expression. In vitro analyses typically show high-levels of reporter gene expression both in cells that normally express CA-II, and in those serving as negative controls. Studies using transgenic mice report ectopic expression of reporter genes driven by CA-II promoters (Erickson et al. 1995; Erickson et al. 1990). Six lines of transgenic mice with mouse CA-II promoter regions of either 1.1 kb or 0.5 kb linked to a reporter gene did not drive tissueor cell-specific expression. These mice did not express the reporter gene in kidney or lung, which normally express CA, and expression was foimd in an ectopic pattern in the cerebellum of one line. More recent studies using 10 kb of mouse CA-II promoter in tandem with human CA-II coding regions and some 3 ' gene sequence still did not promote cell-specific expression (Erickson et al. 1995). It appears that CA-II gene expression is not controlled through a simple set of interactions in the proximal 5' promoter. Hypothesis of this Research Otir laboratory focuses on CA regulation in MCs. The hypothesis is that the conserved expression of CA in vertebrate MCs is controlled through conserved regulatory mechanisms. My project revolves around using the zebrafish as a model system for testing CA regulation in vivo. We chose the zebrafish as an in vivo model system for several reasons. A basic advantage of the zebrafish is the ease and economy of keeping a colony, when compared to the mouse, the major vertebrate model for in vivo promoter analyses. The zebrafish female lays a clutch of = 100 eggs at least once a week. The eggs are externally fertilized and develop inside a transparent chorion. External fertilization and a transparent chorion allow injection of DNA constructs at the one-cell stage. The zebrafish

PAGE 25

15 zygote will develop into a visual-feeding larvae by 4 days post-fertilization. Thus, the zebrafish zygote can be injected with DNA constructs after fertilization and then harvested for analysis 4 days later. While the zebrafish is a useful model for promoter analyses in general, its usefutoess as a model for CA regulation is unknown. My work aims at answering the following three questions: 1) Does the zebrafish contain a high-activity CA? 2) If present, is the CA localized to the MCs? 3) Can zebrafish CA expression in MCs be regulated by a proximal 5' promoter? These questions will be addressed in the following chapters. Chapter 2 will deal with the identification of a CA homologue from zebrafish (CAH-Z). Chapter 3 will show the expression pattern and cellular localization of CAH-Z. Chapter 4 will deal with both the isolation of genomic clones containing CAH-Z, and the testing of a homologous CA-II promoter system, which might provide insight into question number 3. Chapter 5 will summarize the results of each chapter in respect to this dissertation and this laboratories larger focus.

PAGE 26

CHAPTER 2 CARBONIC ANHYDRASE PROTEIN ISOLATION, CDNA SEQUENCING, AND PHYLOGENY IN THE ZEBRAHSH Introduction and Data Summary This chapter will answer the question: Does the zebrafish contain a high-activity CA-n? There have been a number of studies in both lower vertebrates (Bergenhem and Carlsson, 1990) and invertebrates (Henry, 1988) to suggest the presence of cytoplasmic CA. In addition Rahim and others (1988) showed immunocytochemical localization of CA in teleost fish erythrocytes and gill epithelia. However, complete sequence data and kinetic characterization of an isolated CA exists only for birds and mammals. Thus, while there is almost surely a cytoplasmic CA in zebrafish, its properties are unknown. In mammals there are three closely-related CA genes (CA-I, CA-II, CA-III) located at a single locus, and a more distantly-related ancestral gene (CA-VII; Tashian et al., 1990; from this point on, all references to CA evolution will refer to the cytoplasmic enzymes, unless otherwise noted). The cytoplasmic a-CA's arose from gene duplications that have probably occurred over 600 million years (Hewett-Emmett and Tashian, 1996). An older hypothesis for cytoplasmic CA gene evolution proposed that a CA-H-like enzyme evolved early and gave rise to the other cytoplasmic isozymes through gene duplication (Hewett-Emmett et al. 1984). The data was based on a few mammalian sequences. Based on active site conservation, phylogeny, and rates of evolution, HewettEmmett and Tashian (1996) suggested that the CA-Vn isozyme more closely resembled the ancestral enzyme. Both hypotheses supported the idea that CA-I, CA-II, and CA-m come from recent gene duplications, while CA-Vn and CA-Vm underwent duplication much earlier (Tashian et al. 1983; Tashian et al. 1990; Hewett-Emmett and Tashian, 16

PAGE 27

17 1996). Partial sequences from the fruit fly, nematode, and shark do not offer any insight into CA family evolution (Hewett-Emmett and Tashian, 1996; Bergenhem and Carlsson, 1990). The CA-I, CA-II, and CA-III genes remain closely linked to the same locus in mouse and humans (Venta et al. 1984; Beechey et al. 1990). Their chromosomal positioning, phylogeny, and sequence conservation suggest a recent duplication. However, very little has been learned about non-mammalian CA isozyme genes. The teleost should possess a more anciently derived form of CA, while not being so distant as that of the invertebrates or shark. A comparison of its activity and sequence might offer insights into the evolution, function, and regulation of the isozyme families. I report here a carbonic anhydrase homologue from zebrafish (CAH-Z). Using affinity chromatography, I isolated a 29,000 Dalton protein from the zebrafish. Direct peptide sequence confirmed that it was a CA, while inhibition kinetics were used to characterize it as a high-activity CA. A cDNA sequence of 1537 bp was determined through RT-PCR of retinal RNA. An open reading frame encoding 260 amino acids was identical over the 48 amino acids determined through peptide sequencing. Based on activity and sequence similarity, the CAH-Z isozyme was clearly an a-CA. Phylogenetic analyses suggested that CAH-Z was a novel isozyme, which diverged after the branching of the CA-V and CA-VII genes and prior to the duplications that generated CA-I, CA-II, and CA-III. This data represents the most complete characterization of a teleost CA. Materials and Methods Zebrafish Colony Maintenance Fish used for protein isolation were obtained from Felton Aquatics (Daytona Beach, FL). Animals were cared for as described in "The Zebrafish Book" (Westerfield, 1995).

PAGE 28

18 Purification and Peptide Sequencing of Carbonic Anhvdrase from Zebrafish The procedure for isolating CA from zebrafish was adapted from Osborne and Tashian (1975). Zebrafish were placed on ice, decapitated, minced with a razor blade, and ground in a Polytron homogenizer for 1 min at high speed. This mixture was transferred to 30mL ultracentrifiige tubes and spun at 1 00,000X g for 2 hours in a Beckman ultracentrifuge to pellet insoluble proteins. The soluble proteins were combined with an equal volume of agarose-boimd p-aminomethylbenzenesulfonamide (pAMBS; Sigma), pre-equilibrated with 0.2 M Tris-S04 (pH 9.0). The slurry was mixed overnight at 4°C, and loaded into a chromatography column the following day. Approximately 15mL fractions were collected (Instrumentation Specialties Company). Bulk protein was removed by washing with 0.2 M Na2SO4/0.1 M Tris-S04 (pH 9.0). Low affinity proteins were eluted with 0.2 M KI /0. 1 M Tris-S04 (pH 7.0). High-affinity CA was eluted with 0.2 M KCN/0.1 M Tris-S04 (pH 9.0). Fractions were checked for the presence of a CA by placing 1 .5 |iL aliquots on nitrocellulose (MSI) and fixing with 0. 1 % fast green FCF stain (Sigma)/40% methanol, 10% acetic acid, 40% water. Blots were blocked and probed with an anti-chicken CA-II antiserum, followed by horseradish peroxidase linked goat anti-rabbit IgG (Jackson Immunoresearch Laboratories, Inc.; Jahn et al. 1984). The color reaction was performed by adding 60 mg of 4-chloro1 -naphthol (Sigma) to 20mL of cold methanol (Fisher), followed by addition of 80 mL of Tris-buffered saline (TBS) and 60nL of 30% H2O2 (Sigma); the reaction was stopped by washing with H2O. Positive fractions were concentrated into H2O using an Amicon concentrator with a 10,000 Dalton molecular weight cutoff membrane (PMIO; Amicon, Inc.). The isolated protein' s concentration was determined using a Bio-Rad Bradford protein assay kit. The protein' s pvuity was assessed by analyzing ~5ug using 5%-15% gradient SDS-PAGE (Laemmli, 1970), with visualization by silver staining (Wray et al. 1981).

PAGE 29

19 Peptide sequencing was performed by the University of Florida' s Interdisciplinary Center for Biotechnology Research (U of F' s ICBR) Protein Chemistry Core Laboratory. The purified protein was separated using 1 0% Tris-Tricine SDS-PAGE (Schagger and von Jagow, 1987) and digested in situ with endoproteinase-lysine-C (U of F ICBR Protein Chemistry Core unpublished protocol). The digestion product was run on 15% TrisTricine SDS-PAGE and blotted in lOmM MES to Problott (Towbin et al. 1979). Peptide sequence was obtained through Edman degradation of CAH-Z directly from the membrane. Residues were identified through HPLC (automated gas-phase sequencing) with comparisons to known amino acids (Hunkapiller et al. 1984). '^O Exchange Kinetics At chemical equilibrium, the uncatalyzed and carbonic anhydrase-catalyzed 18 exchange of O between CO2 and water was measured by membrane-inlet mass spectrometry. The depletion of O from CO2 occurs in the hydration-dehydration cycle 18 16 as O appears in water and is greatly diluted by 0-containing water (Equation 1 below; B=Buffer). The exchange of '^0 between '^C and ''C-labeled CO2 was also measured. This exchange occurs because the catalyzed dehydration labeled HCO3' results in a transitory labeling of the active site with '^O which then reacts with '''CO2 (Equation 2 below) (Silverman, 1982). EZn'^OH + BH + H2O EZnOH2 + H2"'0 + B (Eq.l) EZnOH2 + HCOO'^0 o EZn'^OH + H2O + C02+'-C02 o EZnOH2 + H^COO'^O (Eq.2) The slope of the plot of log ('^O atomic fraction) vs. time gives a measure of the rate of interconversion of CO2 and HCO3" at chemical equilibrium, R, (Silverman, 1995). The inhibition of the zebrafish carbonic anhydrase by ethoxzolamide (EZA) was determined by measuring decreases in Rj as inhibitor concentration increases. A

PAGE 30

20 Henderson plot was constructed and the enzyme concentration and inhibition constant were obtained. Cloning of the Carbonic Anhydrase Homologue from Zebrafish All cloning strategies used total retina RNA isolated with an RNA-STAT 60 kit (Chomczynski, 1993; Tel-Test, Inc.). Oligonucleotide primers were produced at the U of F' s ICBR DNA Synthesis Core. The specific primers were: PAL 62, ATYTTNGTMTTCCAMTG; PAL 63, TTYCAMGTNGAYTTY; PAL 74, TCGTGAACCAAGTTCCCTTGT; PAL 75, ACAAGGGAACTTGGTTCAGCA; PAL 76, CCAGGTGGACTTCGTTGA; PAL 77, TCAACGAAGTCCACCTGG; PAL 83, AGCATCAACACATCTCATCA; PAL 84, GATTTACATATCATATTTGTT; PA 140, GACTTCAGGCTAGCATCGAT; PA 141, CATCGATCCATGGGTCGAC; PA 142, GACTTCAGGCTAGCATCGATCCATGGGTCGAC; where N is G,A,T, and C; Y is C and T; M is A and C. Primers for 3' RACE (PA 140, PA 141, and PA 142) were a kind gift of Drs. Michael C. Jeziorski and Peter A.V. Anderson (Whitney Laboratory, University of Florida). PCR reactions used standard conditions (50mM KCl, lOmM Tris-HCl, 0.1% Triton X-lOO, 0.2mM each dNTP, 2.5mM MgCh, 2.5U Taq DNA polymerase , and -20 pmol primer) with varying annealing temperatures (45"C-55''C) and extension times (~1 min/lOOObp) for 25-35 cycles (Wang and Mark, 1990). RACE reactions were carried out according to the Gibco-BRL protocol. RT reactions used Superscript II (Gibco-BRL) with accompanying transcription buffer and primers PAL 83 (5' RACE), PA 142 (3' RACE), or a mixture of random primers (Boehringer-Mannheim) (pCA-1 reaction). Remaining reagents for RACE reactions were obtained from a 5' RACE Reagent System kit (Gibco-BRL). PCR products were visualized by running an ahquot on a 1 .0% agarose/0.5X TBE (0.045M Tris-borate, 0.00 IM EDTA) electrophoresis gels, stained with ethidium bromide. Positive products were removed from the gel by excision with a

PAGE 31

21 razor blade and eluted from agarose bands using a Qiagen Qiaex II kit. Eluted DNA products were ligated into pGEM-T, using T4 DNA Ligase (Promega). Ligation reactions were used to transform JM109 competent cells with subsequent selection on ampicillin plates (Sambrook et al. 1989). Sequencing the cDNA for Zebrafish Carbonic Anhydrase DNA samples were sequenced by the U of F' s ICBR DNA Sequencing Core Laboratory. Sequencing was accomplished by employing the Taq DyeDeoxy Terminator (part number 401388) and the DyePrimer (part number 401386) Cycle Sequencing protocols developed by Applied Biosystems (a division of Perkin-Elmer Corp., Foster City, CA) using fluorescent-labeled dideoxynucleotides and primers, respectively. The labeled extension products were analyzed on an Applied Biosystems Model 3 73 A DNA Sequencer. Isozyme Determination Through Sequence Analysis and Phylogeny RT-PCR products were arranged into a single cDNA sequence using the PC/GENE sequence analysis program ASSEMGEL, and translated using TRANSL (Intelligenetics, Mountain View, CA). All sequences for comparisons in Fig. 2.6 and Fig. 2.7 were retrieved from protein databases using the Entrez program (National Center for Biotechnology Information, NCBI), except those for mouse CA-VII and Drosophila melanogaster which were copied from Hewett-Emmett and Tashian ( 1 996). Abbreviations use species common name initial before isozyme name (i.e., human CA isozyme I = HCA-I), except Drosophila melanogaster CA (DCAH). Accession numbers are SWISS-PROT for all CA-I, CA-II, and CA-III isozymes, human CA-VIII, and sheep CA-VI. The shark CA accession number is from the PIR database and the remaining accession numbers are NCBI gi. The accession numbers are: human {Homo sapien) isozymes, HCA-I (P00915), HCA-II (P00918), HCA-III (P0745), HCA-IV (544725),

PAGE 32

22 HCA-V (306483), HCA-VI (179732), HCA-VII (179967), and HCA-VIII (P35219); mouse isozymes {Mus musculus) MCA-I (PI 3634), MCA-II (P00920), MCA-III (PI 60 15), and MCA-VIII (50827); rat isozymes (Rattus norvegicus) RCA-V (522180) and (Sprague-Dawley) RCA-IV (1066838); chicken isozyme {Galliis domesticus) CCA-II (P07636); sheep isozyme {Ovis aries) SCA-VI (P08060); and TSCA (A60519). Protein sequence was checked for CA similarity using the BLAST program (NCBI; Altschul et al. 1990). Pairwise alignments used to produce the matrix in Fig. 2.6 were performed in AlignPlus (Version 2, available from S&E Software, P.O. Box 440, State Line, PA 17263, USA) using Global Alignment with parameters set to: mismatch = 2; open gap = 4; and, extend gap = 1 . Percent identity was determined by dividing exact matches by length of reference sequence, except in the cases of MC A-VII and TSCA, which were divided by their total, shorter length. Protein phylogenies were produced using neighbor joining (NJ) with the MEGA program (Version 1.0, Kumar et al, 1993; obtained from the Institute of Molecular Evolutionary Genetics, The Pennsylvania State University, University Park, PA 16802, USA). Protein sequence alignments for constructing NJ trees were obtained from the CLUSTAL V program (Higgins et al. 1 992), with improvement by eye. NJ trees were produced using complete deletion, with both uncorrected P-values and P-values corrected through Poisson distribution with 500 bootstrapping replicates. Northern Blot Analysis Northern blot analysis was performed on RNA ft-om zebrafish tissues. Fish were anesthetized on ice and tissues were dissected in PBS. Freshly dissected tissues were immediately transferred to 4 mL tubes on ice until all dissections were complete. The samples were spun for 10 min at 3000 rpm at 4°C in a tabletop centrifuge and excess liquid was removed. The weight of the remaining samples was determined and total RNA was isolated using RNAzol (Tel-Test, Inc.), following the manufacturers protocol for

PAGE 33

23 isolated tissues. Total RNA concentration and purity was determined by measuring the O.D. at 260 and 280 nm on a Gene Quant II fixed-wavelength spectrophotometer (Pharmacia Biotech). Approximately 10 fig of each RNA and 7 |ig of standard RNA (Boehringer Marmheim) were run on a 1 . 1 % agarose gel using the glyoxal method (Carmichael and McMaster, 1980). The gels were blotted to MagnaGraph™ (Micron Separations, Inc.) using a Turbo-Blotter apparams following the manufacturer' s protocol (Schleicher & Schuell). The RNA was immobilized to the membrane by UV-irradiation (Sambrook et al, 1989). Blots were stored at -80"C until used. RNA probes of CAH-Z were made using Sp6 and T7 polymerase and the plasmid pCA52 (Fig. 2.3). Unincorporated ribonucleotides were removed using a G-50 Sephadex (Juick-Spin Columni^"^ (Boehringer-Mannheim). Prehybridization and hybridization were carried out in: 50% formamide, 5X Denhardt' s solution (0.5% Ficoll, 0.5% polyvinylpyrrolidone, 0.5% serum albumin), 1% SDS, 5X SSPE, and 100 ^g /mL denatured herring sperm DNA. Blots were prehybridized for 4-5 hours at 60"C and hybridization was carried out overnight at GOT. The blot was then washed 3 times for 15 minutes at 65°C in IX SSPE/0.5% SDS, followed by two washes in 0.1 X SSPE/0.5% SDS at 60"C and 68"C. The blots were exposed on X-Omat film (Kodak) at -80°C. Results Carbonic Anhydrase Isolation and Protein Sequence Affinity chromatography using the inhibitor pAMBS results in a one-step purification of high-activity CA-II ft-om mammahan red blood cell lysates (Osborne and Tashian, 1975). Using pAMBS for affinity chromatography of zebrafish soluble protein resulted in the elution of a single protein during the final wash (Fig. 2. 1 ). When separated on SDS-PAGE, a single band migrated at approximately 29 kDa, which is consistent with cytoplasmic CA isozymes (Deutsch, 1987).

PAGE 34

24 The protein was subjected to Endo-LC digestion to isolate internal tragments. Two peptide fragments were isolated and sequenced using Edman degradation. From the two fragments a of 48 amino acid (AA) residues were determined (Fig. 2.4, underlined amino acid sequence). The sequence was found to be similar to cytoplasmic CA's when compared to the GenBank database using the BLAST program (data not shown). 1 2 Figure 2.1. SDS-PAGE analysis of isolated zebrafish CA. Approximately l^g of zebrafish CA (lane 2) and 15^g of Mr. standards (lane 1) (BRL) were analyzed by 5%-15% gradient SDS-PAGE. Protein visualization was performed by silver-staining. Characterizing Activity Through Rates of Inhibition Carbonic anhydrases are inhibited by sulfonamides (Maren, 1967). The sulfonamides act as transition state analogs (Silverman, 1992). The sulfonamide inhibitors bind to CAs with different affinities based on the enzyme's tertiary structure, and at the most basic level, the amino acid sequence. The amino acid sequence determines their affinity because of key residues which are important for CO2 conversion and interactions with sulfonamides. The residues that are present in the high-activity enzymes result in stronger binding to sulfonamides, while those in low-activity CAs

PAGE 35

25 This difference in binding and, hence, activity, can be represented by the inhibition constant (Kj). Thus, high-activity CAs have a higher affinity for sulfonamides and a lower Ki, typically in the nanomolar range. To determine the activity of the isolated zebrafish protein, a known concentration of CAH-Z was titrated with the inhibitor ethoxzolamide (EZA; Fig. 2.2 A). The titration curve was linearized, and using a Henderson plot the data was linearized to determine the y-intercept, which gives the calculated Kj. The inhibition analysis resulted in a subnanomolar Ki for CAH-Z (Fig. 2.2 B). In addition to Ki, a single kcai reaction using stopflow analysis suggested that CAH-Z converts CO2 to HCO?' at a rate of -250,000 sec ' (data not shown). Inhibition Kinetics 1.0-^ *-* 0.8' > < 0.6' > CD 0.4. a: 0.2 0 [E] = 3.40 nM 3 2 1 8 10 Kj = 0.12nM 0.2 0.4 0.6 1 -i 0.8 1.0 2 4 6 [EZA] nM Figure 2.2. Inhibition kinetics of CAH-Z. (A) Titration of EZA was performed at 1 0"C at a standard enzyme concentration of 3.40 nM. The x-axis shows the concentration of ethoxzolamide, the y-axis (Rl Relation) is a measure of the rate of interconversion of CO2 and HCO3 at chemical equilibrium. (B) The inhibition constant (Kj) was determined by linearization of relative activity values (over increasing concentrations of EZA) by a Henderson plot, where i = fraction of mhibition, and Kj = y-intercept.

PAGE 36

26 Sequencing the cDNA for Zebrafish Carbonic Anhvdrase Total RNA from the retina was used for cDNA cloning. The only cytoplasmic CA in the retinas of birds and mammals is the CA-II isozyme (Linser and Moscona, 1984). We increased the chances of isolating message for the affinity-isolated, high-activity protein by using retina RNA. A RT-PCR strategy was used for the cloning of CAH-Z from zebrafish (Figure 2.3). 1 ; 139 260 1S37 I AAAAAA.. CA-19K (372461) CAr26K (238-287) . pCAl (258-443) — pGA52, pCA56 (1-410) .pCA31 1 , pGA36, pCA38 (3S9-1537) Figure 2.3. CAH-Z cloning strategy. The sequences obtained through direct peptide sequencing are shown by the bars labeled CA-19K and CA-26K; the original RT-PCR product was determuied from clone pCA-1; 5' RACE sequence was determined from clones pCA52, and pCA56; 3' RACE sequence was determined from clones pCA311, pCA36, and pCA38. The deduced ORE is identified by a shaded box and the length is given in italicized numbers above the box. The position of clones, relative to total message, is given in parentheses. The cDNA for CAH-Z was cloned using RT-PCR of retina total RNA. The first set of primers were designed against the known peptide sequence. The 48 amino acids of peptide sequence were gathered from two fragments. When the two fragments were aligned with other CAs they were found to be separated by 28 amino acids (Fig. 2.4). A degenerate primer was made against each of the two fragments (PAL 62, PAL 63). These primers were used to amplify an 1 8 Ibp product by RT-PCR. From the sequenced product, primers for rapid amplification of cDNA ends (RACE) reactions were produced (Frohman et al. 1988). These exact primers were used in concert with a poly-G primer (5' RACE), or a poly-T based, nested primers (3' -RACE). The final 3' -RACE reaction resulted in a single product, 1 149bp in length minus the poly-A tail (Fig. 2.3). Two independent 5' -RACE products of 410 bp were cloned and sequenced (Fig. 2.3).

PAGE 37

27 Sequencing of the PCR products and aligning of the different reaction products resulted in a complete cDNA spanning 1537 bp (Fig. 2.4). 1 cacagttgttttagcatccaggttgtacaagtagaggaacacagcgaaaaccatttataa MAHAWGYGPADGPESWAES 6 1 tcATGGCCCACGCTTGGGGATATGGACCAGCTGACGGGCCAGAGAGTTGGGCAGAAAGCT FPIANGPRQSPIDIVPTQAQ 121 TTCCTATTGCAAATGGACCCAGGCAGTCTCCCATTGATATCGTACCCACCCAAGCACAGC HDPSLKHLKLKYDPATTK S I 181 ACGACCCTTCTCTGAAGCATCTCAAATTGAAGTATGACCCAGCCACCACCAAGAGCATCC LNNGHSFQVDFVDDDN S S T L 241 TTAATAATGGCCATTCATTCCAAGTGGACTTCGTTGATGACGACAACAGCTCAACTCTGG AGGPITGIYRLRQFHFHWGS 3 01 CTGGAGGTCCCATCACAGGGATATACAGGTTGAGACAGTTCCATTTCCATTGGGGAAGCA S D D K GSEHTIAGTKFPCELH 3 61 GTGATGACAAGGGATCCGAGCACACTATTGCTGGAACCAAGTTCCCTTGTGAGCTTCACC LVHWNTKYPNFGEA A S K P D G 4 21 TTGTTCACTGGAACACAAAGTACCCAAACTTTGGAGAAGCTGCCAGTAAGCCTGATGGCC LAVVGVFLKIGAANPRLQKV 481 TTGCTGTGGTTGGAGTTTTTCTCAAGATCGGCGCTGCAAATCCAAGACTTCAGAAAGTTC LDALDDIKSKGRQTTFANFD 541 TAGATGCCCTTGATGACATCAAATCAAAGGGCAGACAGACTACATTTGCCAACTTTGATC PKTLLPASLDYWTYEGSLTT 6 01 CTAAAACCTTGCTGCCTGCCTCTCTGGACTACTGGACTTATGAGGGCTCTCTGACCACCC PPLLESVTWIVLKEPISVSP 661 CTCCTCTGCTGGAGAGTGTCACCTGGATTGTTTTGAAGGAGCCGATCAGTGTTAGTCCTG AQMAKFRSLLFSSEGETPCC 721 CTCAGATGGCTAAATTTCGCAGCCTGCTGTTCTCATCTGAAGGAGAAACACCTTGCTGCA MVDNYRPPQPLKGRKVRASF 781 TGGTTGACAACTACAGACCTCCTCAACCTCTCAAGGGACGCAAAGTTCGCGCTTCCTTCA K 841 AGtaaaccccagaatcgatgccacttgccttctgattatggtgcttttgactggttgtta 9 01 ctgaaacatcacagtatttgttctcgatccaggcttttgcttacattgcagtactgataa 961 aggaaagttgaatctgatcttctaaaactgtctgcgtttgtcataaacgcccatgttatg 1021 attgctaaacatgagaaatagtatttcgagatgctaaaacagtggttagtttcctactat 1081 atcctgacgcttttatgtaaactggaaaaataaggagactgctttatttctagctcattt 1141 tttgactgcttcactttgcattttataggccattcttttagcctctgcagaattgcacta 1201 taattcatgttctacaataggaaaatcgtcaaggttttgtgtgggtttatggcaatgtgt 1261 gactgatgagatgtgttgatgctaatatacctgcaggaaagcacttatttacagcaatat

PAGE 38

28 1321 gttgttgttttaaagtgattcctttttcatcaagaggaatatcaagggattatattttta 1381 aatcgtttatgagaatgttgaatcaagacctcctgccatagataatattatttagatatt 1441 tcagaataaatatttaattgagtagtgttgcaaacaaatatgatatgtaaatcagtatct 1501 attaagaattttatctgcaataaatgaatatatttt Figure 2.4. CAH-Z nucleotide and deduced amino acid sequence . The total CAH-Z sequence as determined through total retinal RNA RT-PCR is shown. The predicted ORF is in capital letters with the deduced amino acid sequence shown above. Regions corresponding to direct protein sequence are underlined. A putative "strong" Kozak sequence (Kozak, 1991), and polyadenylation signal are in bold print. Northern Blot Analysis Total RNA from zebrafish tissues was probed for CAH-Z message using ^^Plabeled RNA probes. The probes were made against the 5' most region of the CAH-Z cDNA using the pCA52 clone (Fig. 2.3). The retina was tested for CAH-Z message, while the gill served as a putative positive control due to the previous report on CA in teleost gill (Rahim, 1988). Both retina and gill contained an RNA of appropriate size, while the brain did not (Fig. 2.5). The band on Northern analysis was ~1 .6 kb, which is consistent with the cDNA sequence determined. This evidence suggested that the CAH-Z mRNA was present in the retina. G B R1 R2 7.5 4.4 2.4 1.4 0.24 Figure 2.5 Northern blot analysis of zebrafish tissues. lO^g of zebrafish gill (G), brain (B), and retina (Rl and R2) were separated on glyoxal gel. An antisense riboprobe against CAH-Z (lanes B, G, and Rl) bound to a single band at ~1.6 kilobases. A control, sense probe (lane R2) against CAH-Z did not show any signal.

PAGE 39

29 Isozyme Family Determination Through Sequence Analysis and Phylogeny A matrix comparing CAH-Z, HCA-I, HCA-II, HCA-III, HCA-VII, and TSCA to other known cytoplasmic CAs was prepared (Fig. 2.6). The figure shows an individual isoform (e.g., human CA-I [HCA-I] or hxmian CA-II [HCA-II]) on the y-axis, and a group of isoforms (e.g. CA-I, which is represented by human, mouse, and horse CA-Is) on the top X-axis. The numbers in each box represent the average percent identity between the individual isoform and the group of isoforms. The human CA-I, CA-II, CA-III, and CAVII were most similar to their own group (71%-95% identity), with high identity to the remaining isozymes (50%-60%). However, the CAH-Z protein was nearly equal in amino acid identity to the CA-I, CA-II, CA-III, CA-VH, and TSCA isozymes (57%-63% identity). cy cy' CAH-Z 100 61 6(l/ /63 57 60 52 43 HCA-I 61 79 57/ y6o 55 50 48 41 HCA-II 63 59 X 58 56 52 43 HCA-III 56 54 63/ 89 49 47 40 HCA-VII 60 51 53/ /36 51 95 50 42 TSCA 57 55 54/ /35 52 52 51 42 Figure 2.6. Comparing single CA isozymes and the major cytoplasmic isozyme families . A matrix shows the average exact identity between CAH-Z, HCA-I, HCA-II, HCA-VH, and TSCA (in vertical row) against several members of each isozyme class (in horizontal column). The isozymes used in each column were those listed in Materials and Methods, and found in Fig. 2.7. For each same-group analysis the human counterpart was omitted from consideration. The broken boxes under column CA-II take into account the difference between chicken CA-II and the other CA-IIs', with chicken identity being shown in the upper left. The shading is to call attention to the higher percent identity that each individual isoform has with its own isoform family.

PAGE 40

30 Phylogenetic analysis was performed using the NJ method with uncorrected pdistance, and with data corrected for multiple hits through Poisson distribution. The pdistance refers to the proportion of different amino acids between two compared sequences. The Poisson-corrected distance estimates the number of amino acid substitutions per site assuming a Poisson distribution. The two trees share the same general topology (Fig. 2.7); they both show that the CAH-Z protein diverged from a node with CA-I, CA-II, and CA-III on its other branch. The major differences between these two trees lies in Bootstrapping Confidence Levels (BCLs), and the node preceding CAHZ divergence. Bootstrapping refers to the random sampling of data points (amino acids in this case) and the production of a resampled NJ tree. The BCLs refer to the percentage of times that an interior branch of the tree remains in the same general location, in respect to the rest of the tree. The BCLs for the trees shown were determined with 500 replicates; the branches with BCLs above 90 are significant. Discussion This chapter presents the identification of a carbonic anhydrase homologue from zebrafish (CAH-Z). I provide protein isolation, kinetic characterization of the isolated protein, primary structure analysis of the protein and cDNA, Northern blot analysis, and phylogeny for the conceptually translated CAH-Z protein. The catalytic function of all CAs is the reversible interconversion of CO2 to HCO?". Sulfonamides are transition-state analog inhibitors of CA, which prevent the conversion of CO2 to HCO? and the converse reaction. The sulfonamide EZA has a Ki ranging from the mM range (low activity isozymes) to the nM range (high activity isozymes). A 0.12 nM Kj for zebrafish CA and a single k^a, determination of 250,000 sec"' at pH 8.5 justifies calling CAH-Z a "high-activity" CA (Heck et al. 1996).

PAGE 41

31 96 100 100 59 83 41 84 100 100 51 83 100 100 100 100 100 — HC'A-I — EC A-I — MCA-I MCA-II HCA-II -C'C'A-II ECA-III -MCA-III HCA-III CAH-Z HCA-VII — MCA-VII RC A-V HCA-V DCAH •HCA-VIII MC A-VIII RCA-IV -HCA-IVHCA-VI SCA-VI 96 10 20 Percent sites changed (Uncorrected P-distance) 78 1 90 100 69 91 31 59 100 100 — I — 10 99 65 100 100 100 30 HCA-I ECA-I — MCA-I -HCA-II MCA-II CCA-II 100 -CAH-Z 6P ^ ECA-III CA-III MCA-III RCA-V HCA-V HCA-VII •MCA-VII — DCAH -HCA-VIII MC A-VIII HCA-VI -SCA-VI RCA-IV HCA-IV 20 — I — 30 — I — 40 — I — 50 — I 60 Percent sites changed (Poisson corrected P-distance) Figure 2.7. Phylogenetic analysis of CAH-Z and other a-CA isozymes. The phylogenetic trees were produced using either uncorrected P-values (A), or P-values corrected by Poissondistribution (B). Values shown are bootstrapping confidence levels for each branch. Abbreviations are: human (H), rat (R), mouse (M), sheep (S), equine (E), chicken (C), zebrafish (Z) and Drosophila (D).

PAGE 42

32 Both the peptide sequence of purified CAH-Z, and the cDNA sequence from retinal RNA are identical over compared amino acids. The deduced ORF for cloned CAH-Z aligns exactly with the 48 amino acid residues determined through N-terminal sequencing of two peptide fragments. While there is a possibility that the isolated protein and CAH-Z are different CAs with exact identity over these 48 amino acids, it is more probable that they represent the same CA. When the CAH-Z 5' most sequence is used for Northern blot analysis of zebrafish tissues, the retina and gill contain reactive signal. In addition to the cloning from retina RNA, this data suggests that CAH-Z is localized to the neural retina in zebrafish. A comparison of CAH-Z with other CAs suggests it is a novel isoform. Some degree of dissimilarity between CAH-Z and the major amniotic CA isozyme group to which it belongs might be expected. However, our data suggest that CAH-Z is not more similar to any one isozyme group, but is equally similar to all vertebrate cytoplasmic isozymes. A comparison of human CA-I, CA-II, and CA-III to other cytoplasmic CA' s shows higher identity for each isozyme to their fellow group members and lower identity to the related isozyme groups (Fig. 2.6). When compared at the sequence level to the other isozyme groups, it would appear that CAH-Z is a distinct isoform. Whether CAH-Z is speciesor class-specific remains to be seen. The relationship of CAH-Z to other CAs will prove important in considering MCspecific gene regulation in later chapters. The phylogeny determined suggests the CA-I, CA-II, and CA-III gene duplication occurred after the appearance of teleosts, 380 million years ago (Radinsky, 1987). These date agree with a molecular analysis of mouse CA-I and CA-II which places the time of divergence at 340-320 million years ago (Fraser and Curtis, 1986). The data support the conclusion that CAH-Z represents the derived form of CA-I, CA-II, and CA-IIF s last common ancestor. This fact, along with the mammalian gene linkage, will provide discussion for gene regulation in Chapter 4.

PAGE 43

33 The answer to the first question posed in Chapter 1 , "Does the zebrafish contain a high-activity CA," is yes. CAH-Z represents a novel high-activity isoform from zebrafish. Whether other teleosts will contain a similar isozyme, and whether the teleosts will contain other isozymes such as CA-I, CA-II, or CA-III remains to be seen.

PAGE 44

CHAPTER 3 THE EXPRESSION PATTERN OF A ZEBRAHSH CARBONIC ANHYDRASE HOMOLOGUE IN THE RETINA Introduction and Data Summary This chapter answers the question: is CAH-Z localized to the Muller glial cells (MCs), as is CA-n in birds and mammals? The importance of CA in the MCs of other species would suggest that CAH-Z should be localized there in the MCs of the zebrafish as well. The presence of CAH-Z message in the retina using Northern analysis supports this statement, however, the protein could possibly be in another cell-type. The function and architecture of the retina is well-conserved in vertebrates. The retinas of all species contain sensory cells (photoreceptors), intemeurons (amacrine, horizontal, bipolar), output inter-neurons (ganglion) and a primary glial cell (MCs). The structure of the vertebrate retina features alternating laminae of cell bodies (nuclear layers) and cell processes (plexiform layers; Dowling, 1985). The MCs have a morphology that distinguishes them from neurons; they have a centralized cell body in the inner nuclear layer (inl), and are the only cells with processes extending from the vitreal side to the ventricular side of the retina. The MC process endfeet at the vitreal and ventricular borders form the inner limiting membrane (Urn) and outer limiting membrane (olm) (Cajal, 1892; Meller and Glees, 1965). Up to a dozen processes can extend into the inner plexiform layer (/>/) from a single MC. The number of processes varies from species to species. Additional processes fewer in number extend into the outer plexiform layer (opl). The glial processes allow close contact with the neurons and intemeurons, which facilitates the MCs primary function of maintaining the extracellular microenvironment (Newman and Reichenbach, 1996 and references within). 34

PAGE 45

35 Immunohistochemistiy was used to determine CAH-Z's cellular localization within the retina, and to characterize the differentiation of the MCs. The localization was determined in the adult retina and during eye development (see Schmitt and Dowling, 1994, for overview of zebrafish eye development). In addition to the biochemical maturation of the MCs using CAH-Z as a marker, I also have described what appears to be the structural differentiation of the MCs earlier in development, using HNK-1 as a marker. The HNK-1 antibody recognizes a carbohydrate epitope, which is found on many glycoproteins, proteoglycans and glycolipids. It is thought to play a role in cell-adhesion and cell-cell signaling (Schachner and Martini, 1995; Rathjen et al. 1987; Kobayashi et al. 1997). It is found on many cell types in the retina, including the MCs in fish (Uusitalo and Kivela, 1994). The results presented suggest that the zebrafish MCs differentiate structurally before they do biochemically (by biochemical differentiation I refer to the appearance of proteins which are necessary for mature fimction). The HNK-1 antibody recognizes presumptive MCs as early as 48 hpf, and clearly stains radial cells at 60 hpf. No staining for CAH-Z is apparent at 60 hpf. The CAH-Z staining begins at 72 hpf in the central portion of the retina, and extends throughout the retina by 84 hpf, although at very low levels. The cells which express CAH-Z at 72 and 84 hpf also express HNK-1 . In addition, analyses of the marginal zone, a dividing "embryonic-like" region of the adult retina, showed that cells co-stain with HNK-1 and CAH-Z. The data from the embryos, and the striking data from the marginal zone, suggest that the HNK-1 bearing radial cells are MCs, or become mature MCs in many, if not all, cases. Materials and Methods Zebrafish Colony Maintenance and Breeding Animals were raised under natural lighting or using 12 hours light/ 12 hours dark cycles. The animals were fed twice a day with commercial flake food (TetraMin), except

PAGE 46

36 before breeding, when they were fed artemia and flake food. Breedings were performed in a separate tank with fresh, aerated tap water. The ruby and wild-type AB strains were obtained from stocks maintained by Dr. John Dowling, Harvard University (Fadool et al. 1997). Some immunohistochemistry was performed on fish obtained from a local supply house, Felton Aquatics, Daytona Beach, FL. All fish were staged as hours or days postfertilization. Gel Electrophoresis Animals were anesthetized by chilling on ice and were then decapitated into TBS with sterile scissors. Tissues were dissected away from the dissociated heads and placed in sterile 1 .5 ml microcentrifuge tubes on ice. The samples were spun in a Beckman microcentrifuge at top speed for 5 min. Excess liquid was removed and the samples were resuspended in 300 |iL of H2O for sonication. Samples were sonicated until no tissue chunks were left, and insoluble material removed by centrifugation twice for 15 min. The supernatant was removed and the total protein content was determined using the Bradford method (Bio-Rad). The protein samples were separated by 5%-15% gradient sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) using the buffer system of Laemmli (1970). Proteins were electroblotted to PVDF (Schleicher and Schuell, Inc.) for Western blot analysis (Towbin et al. 1979). Total protein was stained with Fast green in 5: 1 :5 (methanol: glacial acetic acid: water), followed by several washes in 5:1 :5 alone. Polyclonal antiserum against purified zebrafish carbonic anhydrase (pAbZ) was made in rabbits using previously described techniques (Linser and Perkins, 1987). The anti-zebrafish antisera: Al-J-29, Al-J-36 (first boost and bleeds), A2-J-15, and A2-J-22 (second boost and bleeds) were tested against zebrafish retina. The PVDF blot was blocked with Blotto (5% nonfat dry milk in TBST {TBS/0. 1 % Tween-20}) to minimize background signal. Primary antisera were diluted 1 :50 in Blotto and incubated with blots

PAGE 47

37 for 1 hour with shaking. Alkaline phosphatase-conjugated Affini-Pure goat anti-rabbit IgG (H+L) secondary antibody (Jackson Immunochemicals, Inc.) was diluted 1 : 1000 in Blotto and incubated for 1 hour with shaking. The A2-J-22 antiserum had the highest specificity and titer against zebrafish tissues and was used for all immunohistochemistry analyses (Fig. 3.1). The HNK-1 monoclonal antibody used for unmunohistochemistry was obtained from the American Type Culture Center (Denver, CO). Tissue Processing and Immunohistochemistry The adult retinas were harvested for cryosectioning into TBS and fixed immediately on ice with 4% % paraformaldehyde/0. 1 M cacodylate buffer (pH 7.2). The retinas were fixed overnight at 4°C and then washed with TBS. The retinas were placed in 30% sucrose in TBS overnight at 4T. They were then mixed into O.C.T. compound (Tissue-Tek) and frozen for cryosections. Cryosections were cut at 20 uM. Embryonic retinas were fixed in either 4% paraformaldehyde/0. 1 M cacodylate buffer (pH 7.2), or Bouin' s fluid (75% saturated aqueous picric acid, 25% formalin, 5% glacial acetic acid) for two days at 4''C. Embryos were washed three times with TBS buffer and dehydrated through ascending concentrations of ethanol. I then incubated the tissues two times in xylene for 15 min, and two times in 68°C paraffm for 30 minutes. The embryos were then embedded in fresh paraffin, and sectioned at 6 uM or 8 uM. Blocks were cooled to 4°C before sectioning, which helped maintain the tissue' s structure during sectioning. Sections were spread on water-covered heated slides. After all sections were cut, the water was blotted off and the slides were heated for 30 minutes at 50"C. Before immunostaining the blocks were rehydrated through a standard series of xylene and descending ethanol baths. Samples were blocked with 2% normal goat serum (NGS) in TBS for 30 min. Monoclonal antibody supematants were added directly to the slide without dilution (antiGS) or diluted 1:1 in TBS (HNK-1). Polyclonal antisera were diluted 1:50 into the

PAGE 48

38 accompanying monoclonal antibody supernatant or 2% NGS/TBS. After the primary antibody incubation, slides were washed three times with TBS. Secondary antibodies were diluted 1 :50 in 2% NGS/TBS (in all cases the secondary antibodies were fluoresceinconjugated goat anti-rabbit, [FITC-GAR] and Texas Red goat anti-mouse, [TR-GAM]; Jackson ImmunoResearch Laboratories, Inc.). All antibody reactions were allowed to incubate for at least 1 hour. Washes were as above, slides were mounted with 60% glycerol containing p-phenylenediamine and coverslipped. Results Western Blot Analysis A polyclonal antiserum to zebrafish CA was used to probe protein extracts from gill, brain, and retina. The protein was separated on gradient SDS-PAGE, and then transferred to PVDF. pAbZ cross-reacted with proteins in retina, gill, and brain by Western blot analysis. The cross-reactive band migrated at 29 kD, the expected molecular weight of CAH-Z (Fig. 3.1; Deutsch, 1987). The appearance of CAH-Z protein in brain contradicts the absence of message in Northern analysis (Fig. 2.5). The only immunohistochemical staining seen vAih the antiserum is found in the blood vessels and not in the neural tissue itself (data not shown). The difference between message and protein presence might be explained by the stability of the protein in relation to the message in the blood vessels. Cellular Localization in the Retina Zebrafish larvae were collected at half-day increments from 1 day post-fertilization (Idpf) through 4dpf. After processing, the retinas were examined for CAH-Z, GS, or HNK-1 staining. The time-points that show first or important expression patterns will be discussed. It needs to be noted that zebrafish embryos can be asynchronous by 4 hours by 2dpf, and that our fish were raised at 25T instead of 28T, which is the optimum

PAGE 49

39 which is the optimum temperature (Schmitt and DowHng, 1996; Sandell et al. 1994a; Sandell et al. 1994b; Lynch et al. 1993). Figure 3.1 Western blot analysis. Zebraflsh tissues were separated on 5"/o-15% SDS-PAGE and transferred to PVDF. A) Total protein was visualized by staining with Fast Green. B) CAH-Z was visualized by incubation with several stocks of anti-CAH-Z polyclonal antiserum (pAbZ), a secondary incubation with alkaline phosphatase (AP)-GAR antiserum, and an AP-based, BCIP and NET color reaction. The samples which were loaded and their total protein concentrations were: lanes 1,8 25 |ag standards; lanes 2,9 25 |ig each gill soluble protein; lanes 3,10 25 |ig each brain soluble protein; 4-7, and 11-14 10 [ig each retina soluble protein. The blot was cut into four sections and incubated with identical dilutions of four different pAbZ serums: lanes 8-11 with A2J22; lane 12 with A2J15; lane 13 with A1J30; and, lane 14 with A1J22. Adult Immunohistochemistry of adult zebrafish retina was performed to determine which cells express CAH-Z. The adult showed a MC-specific staining pattern for CAH-Z as determined by double-labeling with GS (Fig. 2). GS has previously been described as glial-specific in many systems, including the retina of all vertebrates studied (Linser and Moscona, 1981; Linser et al. 1985; Linser et al. 1997). The horizontal neurons of most

PAGE 50

40 Figure 3.2. The expression pattern of GS, CAH-Z, and HNK-1 in tlie adult retina. A) A frozen section of an adult zebrafisli retina stained witli pAbZ against CAH-Z. B) Tlie same frozen section as in A, only stained witii an antibody against chicken GS. The asterisks mark regions where the staining patterns can be clearly seen to overlap one another. The regions of the retina are labeled in-between the two figures. C) A paraffin section of adult zebrafish retina showing the marginal zone stained with pAbZ. D) The same section as in C, only stained with the HNK-1 antibody. The open-headed arrow lies across the photoreceptor layer and points to the opi. The horizontal white arrows points to cells which are clealry stained by both pAbZ and the HNK-1 antibody. The vertical gray arrows point to cells which are stained by HNK-1 but not by pAbZ, but which have the same general morphology. The abbreviations are: PP photoreceptor outer processes; PC photoreceptor cells; OPL outer plexiform layer; INL inner nuclear layer; IPL inner plexiform layer; GC ganglion cell layer; NF nerve fiber layer.

PAGE 51

41 fish contain an immunodetectable CA (Linser, 1991). The staining in Figure 2, panels A and B overlaps exactly, and is not present in other neurons. Marginal zone Most fish continue to grow throughout their lives; as a result of this, their retinas also continue to grow. Therefore, unlike a bird or mammal retina, which is mature by hatching or birth, the adult fish retina contains undifferentiated cells (Hagedom and Femald 1992; Johns 1977). The undifferentiated cells lie in the most anterior region of the neural retina, known as the marginal grovv^ zone (Johns, 1 977). The marginal growth zone is a useful tool for dissecting developmental expression patterns. The most anterior portion is "embryonic" in nature, while several cells away the retina is fiilly differentiated (Wetts and Eraser, 1988; Godbout et al. 1996; Papalopulu and Kintner, 1996). Examination of the most anterior cells show that they do not express CAH-Z or HNK-1 (Fig. 2, panels C and D). Moving posteriorly, the CAH-Z and HNK-1 expression patterns differ. The first CAH-Z staining appears in cells with typical MC morphology, that is a central soma with processes leading to the ilm and ohn (Fig. 2, panel C). These cells also express the HNK-1 epitope (Fig. 2, panel D). However, the HNK-1 signal can also be seen in cells more anteriorly which do not express CAH-Z. The more anterior HNK-1 positive cells have two processes stretching from the soma, one to the ilm and one to the olm, identical to the cells expressing CAH-Z. This suggests that they are the same cell-type at different stages of development. Farther from the marginal growth zone the morphology of these cells becomes more amorphous, presumably because the complex arrangement of processes forming the ipl and opl are developing. Dav 1 At 24 hpf the zebrafish retina and lens are obvious in our sections. No CA or HNK-1 (Fig. 3 panels A and B) immunoreactivity is evident. The skin can be seen to

PAGE 52

42 clearly stain for CAH-Z at this time however. The staining in the HNK1 panel comes from non-specific interaction with the yolk. Day 2.5 At 60 hpf there is still no visible staining using the pAbZ antiserum (Fig. 3, panel C), even though skin and other tissues are stained (data not shown). However, clear staining of radial cells with the HNK-1 antibody appears at 60 hpf (Fig. 3. panel D). The morphology of the HNK-1 positive cells suggests that they might be glial cells (see Discussion). A . ; ."Si. . I L X Figure 3.3. CAH-Z (left column) and HNK-1 (right column) staining in 24 hpf and 6<) hpf embryos.. A) A 24 hpf retina stained for pAbZ showing no immunofluorescence; B) Same section showing no HNK-1 present; C) 60 hpf retina stained with pAbZ showing no immunofluorescence in the retina, although the skin and blood vessels are clearly positive; D) Same section showing staining of "radial glia" with HNK-1. The arrows mark the length of the outer edges of the HNK-1 staining that coincides with the plexiform layers. The asterisks marks the overlying skin, which is stained by pAbZ but not HNK-1. L lens.

PAGE 53

43 Day 3 By 72 hpf the inl contains both CAH-Z and HNK-1 positive cells (Fig. 4, panels A and B). The 72 hpf retina sections contain few cells expressing CAH-Z. These cells are localized to the central protion of the retina in most cross-sections. Whether expression first began in the "ventral patch" as described for photoreceptor cell differentiation was not determined (Raymond et al. 1995). These sections contain CAH-Z staining in the Figure 3.4. CAH-Z (left column) and HNK-1 (right column) staining in 72 hpf and 84 hpf embryos. A) A 72 hpf retina stained for pAbZ showing a few cell bodies in the inl staining. B) The retina of a different animal, from the same clutch as that in A, stained with HNK-1. Staining is found in a MC-like pattern and might now also be present on other cell types. C) An 84 hpf retina stained by pAbZ showing a number of positive cells throughout the breadth of the retina. D) The retina of a different animal, from the same clutch as in C, stained with HNK-1. This section again clearly shows MC-like staining. The white arrows mark the breadth of the retina that is positive for the respective antigen. The open headed arrows in B point to possible different cell types; the left arrow points to a putative MC, while the right arrow points to a possible amacrine cell. L lens.

PAGE 54

44 centralized soma with little staining present in the processes. In this same fish, intense staining could be seen in skin and ear, in addition to other tissues, suggesting that the protein concentration in the MCs is very low at this time (data not shown). The HNK-1 staining is still present in cells with typical MC morphology. However, in many sections it appears that perhaps the amacrine cells are also stained at this time. However, the MC processes wrap the neuronal somas and processes. The wrapping makes it hard to tell, with a membrane-bound antigen, which cell has the epitope on its surface. Day 3.5 At 84 hpf there is CAH-Z present in cell somas and processes throughout the central portion of the retina (Fig. 4, panels C and D). The intensity of CAH-Z staining in the retina is still very low, but serial sections show staining throughout the central portion of the retina. The HNK-1 staining is still clearly present at this timepoint. Discussion The first finding of note from this immunohistochemical study is that MCs differentiate biochemically very near the third day after fertilization, according to the appearance of CAH-Z. This timing agrees with the data obtained from other species, in relationship to retinal differentiation. The appearance of MC-specific markers in birds and mammals occurs late in development (Linser and Moscona 1979; Linser et al. 1997). The MCs are among the last cells, or are the last cells, to biochemically differentiate in all retinas studied. The appearance of cell-specific markers is described for several cell-types in the zebrafish retina. Ganglion cell axons can be stained by neurotrophin receptor antibodies by 35hpf (Sandell et al. 1994b), and by GABA antibodies as early as 48hpf (Sandell et al. 1994a). The photoreceptor cells (rods and cones) begin differentiating shortly after their final mitosis, which occurs at 48hpf Biochemical markers of double-cones are present at

PAGE 55

45 48h, and the adult mosaic pattern is present in the 54h-pf-embryo (Larison and BreMiller, 1990). The zebrafish becomes a visual feeder by 4 dpf. Easter and Nicola ( 1 997) determined the visual acuity of the zebrafish using the optikokinetic response (OKR) as a measure. They found that the fish had a measurable OKR for the first time at 73 hpf, and that it increased to 100% response by 81 hpf The cause of the improved OKR was not determined. The improved OKR could not be linked to an increase in the functional retina, either at the gross level or at the level of the photoreceptor outer segments. The improved OKR was suggested to result ft^om strengthened extraocular muscles. Improved OKR coincides with the biochemical maturafion of the MCs; the biochemical differentiation of the MCs might be one of many coincidental occurrences at 72 hpf At 72 hpf CAH-Z is found only in the central most portion of the retina. At 84 hpf, when the OKR reaches 100% response, the expression has widened to the extent of the plexiform layers (defined by Easter and Nicola { 1 997} as the Hmit of the functional retina). Thus, the biochemical maturation of the MCs appears to coincide with the appearance and improvement of the OKR. The second finding of this chapter is the absence of CAH-Z in primitive retinoblasts . A previous study fi-om this laboratory showed a correlation between early CA-II expression and a large vitreous compartment, such as in the chicken eye (Linser and Plunkett, 1989). The swelling of the eye during morphogenesis occurs through an increase in intraocular pressure (lOP) (Coulumbre, 1956). lOP is generated indirectly through the action of CA-II and bicarbonate transport. Qualitatively, the mouse, which contains a much smaller vitreous chamber than the chicken, has much lower levels of CA-II. It would logically follow that the zebrafish which has aknost no vitreous chamber would have little if any CA expressed during this time. This agrees with the absence of CAH-Z staining in retinoblasts at 24 hpf

PAGE 56

46 The developmental expression of the HNK-1 epitope is the third finding presented in this chapter. The adult retina of four previously studied fish species contains the HNK1 epitope in all the different layers (Uusitalo and Kivela, 1994). The MCs are one celltype that expresses HNK-1. We investigated the developmental expression of the HNK-1 epitope and found that it is first expressed in cells that later appear to differentiate into MCs. It is impossible to say from our analysis whether all HNK-1 positive cells become MCs, or whether it is only a subset. MC processes surround the soma and processes of other cells. This makes it difficult, with the membrane-bound HNK-1 epitope, to determine which cell is expressing the carbohydrate. It is clear from our double labeling experiments that biochemically immature MCs express HNK-1, and continue to do so through maturation. Whether the increase in staining seen in the mature retina is due to other cell-types, or more MC processes remains unknown. The HNK-1 epitope is the earliest known marker of zebrafish Miiller glial cells. The HNK-1 antibody recognizes a 3' -sulfated glucuronic acid. This epitope is found in many developmentally relevant glycoproteins and proteoglycans (Schachner and Martini, 1995). Among the glycoproteins carrying the HNK-1 epitope are: three immunoglobulin superfamily adhesion molecules (the myelin-associated glycoprotein, neural-cell adhesion molecule, and LI); a glial-cell surface-linked ATP-degrading enzyme 5' nucleotidase; Tenascin-C and Tenascin-R; and, ependymin (Schachner and Martini, 1995; Kunemund et al., 1988). The HNK-1 epitope appears to function during neural development both in cellcell adhesion and cell-substrate adhesion. When early postnatal mouse cerebellum cultures are incubated with antibodies against the HNK-1 epitope, a decrease in adhesion between neurons and astrocytes, and between astrocytes and astrocytes is seen (Kruse et al. 1985). Neurite outgrowth on poly-D-lysine or laminin is inhibited in microexplant cultures of postnatal mouse cerebellum when treated with monoclonal antibodies against the HNK-1 epitope, or excess ligand (3' -sulfated glucuronic acids Kunemund et al. 1988). Incubating

PAGE 57

47 neural crest cells both in vivo and in vitro, with HNK-1 antibody perturbs normal migration (Bronner-Fraser, 1987). The identification of integrins carrying the HNK-1 epitope further implicates it in cell-substrate adhesion (Lallier et al. 1992; Lallier and Bronner-Fraser, 1992; Pesheva et al. 1987). These experiments suggest that the HNK-1 carbohydrate regulates early developmental processes by influencing cell adhesion. The appearance of HNK-1 on radial cells and mature MCs raises questions about a possible function in tissue lamination and neuronal guidance. The zebrafish is a good model to study the MC-specific expression of CAH-Z. The zebrafish lacks CA expression in its retinoblasts, which is not true of birds and mammals. The background from these cells must be dealt with before performing promoter analyses in these systems. While this is not a major problem, the absence of CAH-Z from zebrafish retinoblasts is a definite advantage. A limitation of other fish systems is the appearance of CA in horizontal neurons. A large concentration of CA in the horizontal neurons is found in the elasmobranchs and the southern flounder (Linser et al. 1985). Other teleosts such as Fundulus heteroclitus express CA in horizontal neurons early in development, and then shut it off at later timepoints (Unpublished observation). The zebrafish retina contains no CAH-Z in its horizontal neurons at any time. This study provides the answer to the second question raised in Chapter 1 , If a high-activity CA is present, is the CA localized to the MCs? The answer is that the zebrafish CA, CAH-Z, is expressed only in MCs. The major aim of this project was to determme whether the zebrafish would be a good in vivo model for studying CA regulation in MCs. The data so far supports the use of the zebrafish.

PAGE 58

CHAPTER 4 ZEBRAFISH GENOMIC CLONE ISOLATION AND PARTIAL SEQUENCING AND INTRON/EXON BOUNDARY CLONING AND SEQUENCING Introduction and Data Summary Promoters in Gene Regulation The third question that this dissertation sought to answer was whether MC specific expression of CAH-Z was controlled through a proximal 5' promoter. The expression of many gene's is regulated through their 5' flanking sequence, which I am referring to as a proximal 5' promoter. This chapter presents the isolation of CAH-Z genomic clones that should contain the necessary regulatory modules for MC specific expression, including the proximal 5' promoter, the gene itself, and the 3' extragenic sequence. I also present a functional test of a chicken proximal 5' promoter, as a homologous test system. The proximal 5' promoter is responsible for gene regulation in many systems studied (Cvekl and Piatigorsky 1996; Kirchhamer et al. 1996). The regulation is often times controlled through other regions, which can be found either upstream or downstream of the gene, or even in introns (Kirchhamer et al. 1996). The proximal promoter contains c/.y-regulatory elements that are bound by /rany-acting transcription factors. Transcription factors are proteins that either interact with the basal transcription apparatus, other transcription factors, or the DNA alone. A group of cw-regulatory elements can work together in the form of a regulatory module. Regulatory modules can control spatial, temporal, or levels of expression. In many promoters studied, the gene's expression pattern can be recapitulated using a promoter of several kilobases linked to a reporter gene (Davidson, 1 993; 48

PAGE 59

49 Davidson, 1991; Amone and Davidson, 1997). As discussed in Chapter 1, the CA-II promoter is proving to be more complex than this. Cell-specific expression cannot be obtained even by using up to 10 kilobases of proximal 5' promoter, the first exon and intron (which contain highly conserved sequence) and 3' untranslated sequence (Erickson et al. 1995). CA-II is not expressed only in a single cell-type, or one tissue, or only during one stage of development. Instead, it is expressed in a cell-specific manner in abnost all tissues, and during most stages of development. The expression of CA-II in many celltypes within many different tissues might require a more complex regulatory system. The transgenic lines produced to test large genomic fragments for CA-II cellspecific expression were never examined for expression in the retina (Erickson et al 1 995). Given the conservation of retinal structure in vertebrates and the conservation of CA expression in the MCs, it seemed possible that retinal expression might be controlled through a proximal 5' promoter. To test whether a proximal 5' promoter could drive expression, I chose to study the chicken CA-II (CCA-II) promoter. This decision was based on the availability of a CCA-II proximal 5' promoter, and our laboratory' s hypothesis that the expression of CA in MCs is controlled by a conserved regulatory system. Specifically, we hypothesize that the regulatory modules responsible for MC-specific expression of CA are conserved in all vertebrates. Therefore, results obtained in one system can be directly applicable to another system. The reasoning for our hypothesis is very straightforward. The general structure of all vertebrate retinas are well conserved: They contain alternating laminae of cell bodies and plexiform layers (in which the synaptic connections are made). A layer of sensory cells (rods and/or cones) is located on the ventricular border. The ganglion neurons, with their axons leading to the optic nerve head, are located most vitreally. The horizontal neurons, bipolar neurons, amacrine neurons, and MC soma are located centrally, with processes extending into the ipl and opl. The biochemical enzymes necessary for retina

PAGE 60

50 function are also conserved between divergent species (Dowling, 1985). Given the importance of CA in maintaining the retinal microenvironment, we feel its conserved expression in MCs is critical. Furthermore, we suggest that it is probable that CA' s regulation is controlled in a conserved manner, rather than being "re-invented" several times. The hypothesis that MC-specific CA expression is conserved in all vertebrates influenced me to begin studying chicken CA-II (CCAII). A 5' CCA-II proximal 5' promoter had been previously isolated (Yoshihara et al. 1987), and shown to be active in patched lens epithehal cells (PLE) in vitro (Buono et al. 1992). I wished to ascertain whether this -1.4 kb proximal 5' promoter could drive MC-specific expression of a reporter gene. The work reported in this chapter is preliminary data, which could aid future studies of CA regulation. Two interrelated sets of experiments are reported: the isolation of genomic sequences from the zebrafish, and the testing of a CCA-II proximal 5' promoter. I have isolated a zebrafish PAC clone which contains -200 kb of genomic DNA including the CAH-Z gene. Two fragments were isolated from the zebrafish PAC clone. These fragments have been partially sequenced. A fragment of -2.6 kb begins after the first intron and contains sequence in the 3' direction. The second fragment begins -400 bp 3' ofthe CAP site and extends in the 5' direction for -5 kb. Lastly, all but one intron/exon boundary have been isolated and sequenced using the conserved introa^exon boundaries of mammals. The experiments using CCA-II proximal 5' promoter showed that it was not sufficient to drive MC-specific expression. I produced a reporter construct using the CCA-II promoter to drive green fluorescent protein {gfp) expression. This construct was able to drive gfp expression in the PLE cell-culture system. It also drove expression in chicken embryonic fibroblast (CEF) cell-cultures, which do not express CA-II. When

PAGE 61

51 tested in retina aggregate cultures for MC-specificity, there was no increase over the control plasmid. The aberrant expression in neurons suggests regions necessary for neuronal suppression were missing. Materials and Methods Cloning CAH-Z Introns Through PCR Intron positions were inferred from known intron/exon boundaries in mammaUan CA genes (Fig. 4.3). PCR primers were designed to span each putative intron boundary. The primers used were PAL: 91 and 92 (Intron A), 93 and 94 (Intron B), 95 and 167 (Intron C), 97 and 98 (Intron D), 163 and 165 (Intron E). The sequences of the primers are: 91 (CGCTTGGGGATATGGACCAGC); 92 (AGCTTTCTGCCCAACTCTCTG); 93 (GTTGATGACGACAACAGCTCA); 94 (TGATGGGACCTCCAGCCAGAG); 95 (AGCCTGATGGACTTGCTGTGG); 97 (TGCCCTTGATGACATCAAATC); 98 (AAGTTGGCAAATGTAGTCTGT); 163 (GCTGGAACCAAGTTCCC); and 165 (GTGTTCCAGTGAACAAG); 167 (GTCTTGGATTTGCAGCG). The PCR reactions used standard conditions with the addition of Stratagene cloned Pfu. Because the intron lengths were unknown, the PCR reactions were allowed to extend at 72°C for 7 min during each cycle. Subcloning, sequencing, and alignments were performed as described in Chapter 2. Final intron sequences were joined to the cDNA sequence manually. Isolation of Zebrafish PAC Clones A filtered array library of zebrafish PAC clones was obtained from the Ressourcenzentrum im Deutschen Humangenomprojekt, Beriin-Charlottenburg, Germany for the isolation of CAH-Z genomic clones. The product of a PCR using PAL 94 and PAL 1 1 6 was used for screening. This PCR fragment carries the sequence for the 5' most region of the cloned cDNA. A Pharmacia Oligolabeling kit was used with a-"P dCTP and following the "Standard Protocol" to produce probe. Arrayed filters were screened

PAGE 62

52 using a modified Church-Gilbert's Medium (0.5MNa2HPO4, 7% SDS, 1 mM EDTA) (Church and Gilbert, 1984). Filters were prehybridized at 65''C for one hour with three buffer changes, in a Rubbermaid''"^ square container with rotation. Probe was added to fresh buffer and incubated with the filters at 65°C for 20 h. Filters were washed twice with 40 mM Na2HP04, 1% SDS, 1 mM EDTA at 65°C for 10 min and placed on X-ray film. The blots were left at -80°C for several days and then developed. Positive cosmids were identified and shipped from the Ressourcenzentrum im Deutschen Humangenomprojekt. The PAC clones were grown in LB/Kanamycin media overnight and isolated using a protocol for PI bacteriophage (Pierce and Sternberg, 1992). The DNA was digested for 3 hours at 37°C with Hind III (GibcoBRL). The resulting fragments were separated on a 1 .3% agarose/TBE gel, and transferred to MagnaGraph nylon backed membrane (MSI, Inc.). The transfer was performed using a Schleicher & Schuell Turbo-Blotter for 3 hours. The blots were placed in a preheated autoclave for 3 minutes to denature the DNA, which was then Unked to the membrane using a Stratagene Stratalinker^M 1 800 set on AutoCrosslink. The blots were screened using the same protocol as with the original filters. Positive band sizes were estimated from the blot. The DNA was isolated from a new gel using a Qiagen Qiaex II DNA isolation kit. The DNA was ligated into pBluescript, which had been precut with Hind III and treated with shrimp alkaline phosphatase (USB). The ligation was carried out overnight at room temperature, and then transformed into JM109 competent cells. The cells were plated on LB/carb agar plates saturated with IPTG and X-Gal. Ten colonies were chosen from each plate and grown in 3 mL liquid cultures. Plasmid DNA was isolated using a Promega Wizard MiniPrep kit followed by digestion with Hind III. The Hind III fragments were separated on a 1 .5% agarose gel, the DNA was transferred to MagnaGraph by Southern blot, and the blots were probed as before. Three positive clones from each set (representing the two isolated bands) were sequenced using and standard dye-

PAGE 63

53 terminator protocols. One colony from each set was then sent to the U of F's DNA sequencing core for further sequencing. Promoter-Reporter Plasmid Construction and Purification For a control plasmid the UF2 adeno-associated virus (AAV) vector plasmid was used (Gottlieb and Muzyczka, 1988). This construct contains the cytomegalovirus promoter (CMV) driving gfp expression with extra cassettes added for increased expression and stability. The previously characterized chicken CA-II promoter was obtained from Dr. Jerry Dodgson, Michigan State University (Yoshihara et al. 1987). It was cloned into the UF2 vector after removal of the CMV promoter by digestion with Kpn I and Xba I. The UF2 CMV-less vector was treated by Klenow to blunt-end the terminals, and then incubated with shrimp alkaline phosphatase to prevent recircularization (USB, manufacturer's protocol). The CCA-II promoter fragment had Hind III sticky ends, which were removed by Klenow treatment. The promoter fragment was ligated into the UF2 vector to form the Chicken green (Chig) series of constructs Fig. PTR-UF2 TR SD/SAjHPIIJ PAl POenh Ptk neo'' pA2 TR Chig-8 TR POenh Ptk neo'' pA2 TR Figure 4.1 Chig-8 and UF2 constructs. The UF2 construct was previously produced by The University of Florida's Viral Vector Core (Zolotukin et al. 1996). The Chig-8 construct was only different in the promoter that drives gfp expression (chicken CA-II vs. CMV). 4.1), and transformed into JM109 ultracompetent cells. Insertion orientation was determined by isolating the plasmid from twelve colonies and cutting with Pst I, which

PAGE 64

54 gives an asynchronous cutting pattern. Construct Chig-8 was used as a positive test plasmid (correct promoter orientation), while Chig-1 was used for a negative test plasmid (reverse promoter orientation). Plasmid for transfection was isolated using a Qiagen Mega Kit. Concentration was determined using a GeneQuant II DNA calculator, all samples had an O.D. 260/280 of 1 .8-1 .9. Cell Culture of Retina Aggregates. Patched Lens Epithelium and Chicken Embryonic Fibroblast Cells Patched lens epithelium (PLE) cells were prepared as described (Overbeek et al. 1985). Lenses were removed from 12 day chicken embryos and placed in a 60 mm dish with 6 mL of prewarmed Ham' s F-10 media + 1% gentamicin. Lenses were transfened to filter paper wetted with Ham' s and rolled around to remove non-lens tissue. Groups of 6 lenses were placed in 3 mL of weakened IX trypsin and disrupted with forceps. Disrupted lens material was incubated at 37"C for 1 .5 min and pipetted twice with a 5 mL pipette to further disrupt the tissue. They were then incubated an additional 1 .5 min at 37°C. Each group was transferred to a 15 mL tube with 1 mL of fetal calf serum and pelleted with gentle centrifiigation. The supernatant was removed and the pellet was suspended in 6 mL of DMEM + 10% fetal calf serum + 1% gentamicin. Cells were seeded onto a 60 mm collagen coated dish and incubated at 37''C and 10% CO2. After 48 hours the media was changed, the cells were washed, and then transfected. Chicken embryonic fibroblasts (CEF) were prepared fi-om embryonic day 9 (e9) chicken skin. Chicken skin was peeled off with watchmaker forceps and placed in calcium magnesium fi-ee medium. The skins were washed several times and then incubated in 3 mL of 0.3% ICN trypsin for 20 min at 37°C in a 15 mL tube. The tube was then filled with Medium 199 + 10% fetal calf serum + Penicillin/Streptomycin (CM199) and placed on ice for several minutes. The tissue was spun down at 4''C for 4 minutes at 1500 rpm in a Sorvall cHnical centrifuge, washed once with 15 mL of CM 199 and then brought up in

PAGE 65

55 5mL of CM 199 for triturating. The tissue was triturated with a 3 mL transfer pipette until a milky solution was formed (approximately 25 times). The cells were diluted to 10 or 15 mL, further diluted 1 : 100, and counted on a hemocytometer. CEF cells were plated at a density of 175,000 cells/60mm on top of sterile plastic round coverslips. The cells were transfected 12 hours later, allowed to grow for 48 hours, and harvested. Retina aggregates were made from e9 chicken retinas. The e9 retinas were dissected free from other tissues in CMF, then spun at 1500 rpm for 3 minutes and washed IX with fresh CMF. As above, the tissue was dissociated by adding 3 mL of ICN 0.3% Trypsin/CMF and incubating at 37°C for 20 min. Then, 10 mL of CM199 was added and placed on ice for several minutes. The cells were spun down and the supernatant was removed. For dissociation, 5 mL of medium was added and triturated until no clumps remained, then an additional 1 0 mL of medium was added. The cells were counted on a hemocytometer and then transfected. Transfection Procedure in Cell Cultures Transfections of PLE and CEF cells were carried out as described (Overbeek et al. 1985). The same calcium phosphate precipitation-type transfection was used for retina aggregates as for PLE and CEF cells (except for the fact that retina cells were transfected in suspension). Approximately 45 miUion cells were placed in a 25 mL Erlenmeyer flask up to a volume of 2.0 mL with CM199. To this flask 1 .0 mL of a total 2 mL calcium phosphate precipitation was added (see below). The flask was filled with 5% CO2 gas/air mixture and incubated as previously described for aggregate formation (Moscona, 1961 , Linser and Moscona, 1979). The transfection was allowed to proceed for at least 8 hours and no more than 16 hours, at which time the aggregates were allowed to settle by gravity and were then washed with CM199. The cultures were continued for six days at 37"C at a rotation speed of 72 rpm, with fresh medium being exchanged every day.

PAGE 66

56 The DNA calcium phosphate precipitates were prepared in ~2 mL total reaction volumes. For retina transfections 50 fig or 5 |ig of plasmid DNA was used, while PLE and CEF cells all received 1 0 |ig of plasmid DNA. The DNA was mixed with 2 mL of Hepes Buffered Saline (HBS) solution, pH 7.05. While vortexing the DNA-HBS solution, 2.0 M CaCl2 was added to a final concentration of 125 mM. This solution was allowed to incubate at room temperature for 45 min. As mentioned above, 1 mL was used for retina aggregate cultures while CEF and PLE cultures received 2 mL. Tissue Fixation and Immunohistochemistry CEF and PLE cells were plated onto plastic, round, cover slips. These coverslips were fixed in their wells with 4% paraformaldehyde/PBS for 1 hour at room temperature. These cells were washed several times, and mounted upside down on a drop of 60% glycerol. The gfp fluorescence was observed using an FITC epi-illumination filter arrangement. Retina aggregate cultures were allowed to proceed until el 5, at which time they were removed and fixed with 4% paraformaldehyde in PBS overnight at 4''C. The aggregates were fixed with 10 mL of paraformaldehyde solution after being spun down in a 15 mL tube. The tight-formed pellet was then gently pushed off the side by the force of expelled liquid through a transfer pipette. The pellet was washed 3X with PBS and placed in 30% sucrose/PBS overnight at 4°C. The next day the sucrose-equilibrated pellet embedded through freezing in O.C.T. (Tissue-Tek) for ft-ozen section. The aggregates were sectioned at 14 uM or 20 uM and placed on gelatin coated slides. The slides were kept at -80°C at least overnight and usually for several days or more. The aggregate sections were thawed in TBS with several solution changes over the course of a half-hour. The slides were then flooded with TBS/ 0. 1 % Triton-X 1 00/ 2% normal goat serum for at least a half-hour at 1)TC. The slides were incubated in anti-g^ polyclonal antiserum at a dilution of 1 : 100 (Clontech) in monoclonal antibody

PAGE 67

57 supematants against either chicken CA-II, or 2M6 (Linser et al. 1997a). Secondary antibodies were diluted 1 :50 in 2% NGS/TBS and incubated on the slides for at least 1 hour (in all cases the secondary antibodies were goat anti-rabbit fluorescein isothiocyanate, FITCGAR and goat anti-mouse Texas Red, TRGAM; Jackson ImmunoResearch Laboratories, Inc.). Cells were viewed using FITC and Rhodamine optics and counted by manual comparison between the two signals. Statistics For each transfection, 1 00 gfp positive cells were counted and determined to be: MC marker positive (i.e., 2M6 positive); MC marker negative, or ambiguous. The average percentage of positive cells from positive plus negative cells was determined. The data of several repetitions was used to determine the standard error of the mean. All data was entered and all calculations were performed, using Quattro Pro ®. Results Isolation of CAH-Z Genomic Clones A filtered array library of zebrafish PAC clones was obtained and screened for CAH-Z. From the initial screening, six possible positives were identified. The positive PAC clones were obtained from the Resource Center of the German Human Genome Project. They were screened by Southern analysis of Hind III digested PAC DNA. Of the six clones, four were positive by Southern analysis. The PAC clones BUSMP706J0263Q3 (abbreviated J026) and BUSMP706H0163Q3 (abbreviated HO 16) had the best banding pattern for the positive fragments' isolation. These two PAC clones were again digested and Southern blotted (Fig. 4.2). The bands were subcloned and named B 1 (upper band) and B2 (bottom band). After subcloning, transformation, and further probing by Southern blot analysis, plasmids B 1 76 and B239 were chosen for sequence analysis. These plasmids contained the isolated bands in pBluescript. Both bands showed identity with CAH-Z

PAGE 68

58 when sequenced. One end of the B176 sequence is identical to the 5' most sequence of the CAH-Z cDNA, while the other end lies upstream of the gene. The B239 sequence begins inside the CAHZ gene, after intron A and extends in the 3 ' direction. 12 3 23.1 * 9.4 . 6.6 . Figure 4,2. Southern Blot of Zebrafish PAC clones J026 and HO 16. The PAC clones J026 (lane 2) and H016 (lane 3) were probed with the radiolabeled CAH-Z fragment PAL 94PAL 116. Lane 1 contained Lambda DNA digested with Hind III, the standards are in kilobases. The marks in each lane are duplicated from the nylon membrane, and they denote the presence of a distinct band. Intron Cloning by PGR The intron/exon boundaries for the cloned CA-I, CA-II, CA-III, and CA-VII genes are conserved (Hewett-Emmett and Tashian, 1996). CAH-Z introns were cloned by PCR across the presumptive intron/exon boundaries. The sequence was examined to determine where the intron/exon boundary would occur if conserved with the other isoforms. If there was an overlap of sequence on the 5' and 3' end of the introns, then the exact intron/exon boundary was determined using the AG-GT rule. The AG-GT rule refers to the fact that the first two and last two basepairs of the intron are often AG and GT respectively. When compared to the human isozyme genes, the zebrafish intron/exon boundaries are conserved (Fig. 4.3). The last intron, Intron F, was unable to be cloned, even though the boundary is completely conserved in all other vertebrate CAs. Whether

PAGE 69

59 the intron is present and could not be cloned for technical reasons or is not present can only be speculated. However, with the completion of the CAH-Z genomic sequence, the presence or absence of Intron F should be made clear. Sequence HCA-I HCA-II HCA-III HCA-VII CAH-Z Intron A 1 DKN/GPE KHN/GPE SHN/GPD QDD/GPS PAD/GPE Intron B 1 NRS/VLK DKA/VLK DRS/MLR DRT/WT NSS/TLA Intron C 0 SAE/LHV AAE/LHL AAE/LHL PSE/LHL PCE/LHL Intron D 0 LMK/VGE FLK/VGS FLK/IGH FLE/TGD FLK/IGA Intron E 0 KTK/GKR KTK/GKS KTK/GKE RFK/GTK KSK/GRQ Figure 4.3. Intron/exon boundaries for CAH-Z and the human cytoplasmic isozymes. The conceptually translated protein sequences around the known zebrafish introns are shown with the human isozymes for comparison. The intron/exon boundaries have been conserved m all the mammalian cytoplasmic families, and in the zebrafish isozyme. A "1" above the intron denotes that the intron begins after the first base of the next codon, while a "0" means that the mtron beguis in-between the two codons (Adapted from Hewett-Emmett and Tashian, 1996). Comparative Analysis of CAH-Z Genomic Sequence Combining the cDNA sequence together with the sequence from B176, B239, and the intron sequences determined by PCR produced a large sequence section of the CAH-Z gene (Fig. 4.4). This sequence was used to search the database for possible areas of homology. A CAP site was found at -359, which was also the 5' -most end of the cDNA cloned through 5' -RACE (see Chapter 2). A TATA box was located at -389. Many "putative" transcription factor-binding sites were found by homology searches. However, these sequences are so plentiful, and so many appear to be completely unrelated, that they are useless without DNA-binding assays to back up their basic sequence homology. The CAH-Z genomic sequence is being determined (see the Appendix). The subclones B176 and B239 are being sequenced from the pBluescript insertion site towards the center. At this time, both plasmids contain some unsequenced information. CAH-Z genomic sequence is also being gathered by direct sequencing of J026.

PAGE 70

60 -4000 -400 +1 400 800 1200 1600 2000 2400 2800 3200 3600 4000 4400 I HH \ 1 \ 1 \ \ 1 1 \ \ 1 L 1 Figure 4.4. Graphical Representation of CAH-Z genomic sequence. This cartoon features the genomic information thus far known. The tall green box (far left) represents the promoter region upstream of the CAP site; the interrupted short red bar that splits the green box represents the fact that the central portion of the promoter has not been sequenced. The tall black boxes represent exons 1-5. The short blue bars represent Intron A Intron E. The tall red box (far right) represents sequence that is thus far represented only from cDNA analysis; Intron F, which is not yet cloned, should lie in this region if its intron/exon boundaries are conserved. The distance given is the total length of the CAH-Z cDNA at this point. Testing the Chig Constructs in Defined Cell Cultures It was first necessary to determine w^hether the new constructs were viable before performing experiments in the aggregate culture system. The CCA-II promoter had been previously described to drive chloramphenicol acetyltransferase expression in PLE cells (Buono et al. 1991). Along with the UF2 control plasmid, both Chig-8 (forward promoter, Fig. 4.1) and Chig-1 (backward promoter) were tested in these cells. The results of transient transfection of these cells suggested the constructs were viable. Chig-8 transfected PLE cells showed expression of the protein as determined by viewing the fixed cells under epifluorescence (Fig. 4.5). In this case the native was visible under excitation and viewing through FITC fluoresence. No attempts were made to quantify this expression. As a positive control the UF2 vector was introduced into the PLE cells and the CMV driven was also visible with this technique. As a preliminary test of Chig-8's specificity, CEF cells were also transfected with UF2, Chig-8, and Chig-1. CEF cells do not normally express CA-II. Both UF2 and Chig-8 showed expression in the CEF cells. Therefore, it appears that the minimal promoter is capable of driving gfp

PAGE 71

61 expression in PLE cells, but is unable to repress non-specific expression in CEF cells. The Chig-1 plasmid showed no gfp expression in either cell type (data not shown). 1 «. • Figure 4.5 Chig-8 and Ur2 in PLE and CEF cells. Ten fig of plasmid was transfected into either CEF cells (A,B) or PLE cells (C,D). A) UF2 in CEF cells; B) Chig-8 in CEF cells; C) UF2 in PLE cells; D) Chig-8 in PLE cells. Testing Miiller-Cell Specific Expression in Retina Aggregate Cultures Retina aggregate cultures were used as a test system to determine whether the CCA-II promoter was capable of driving MC-specific, or selective, expression of a reporter gene. The UF2 plasmid was used as a positive control. Cell-type determination was made by double-labeling sections for gfjy and 2M6, a marker of mature chick retina MCs (Linseretal. 1997a).

PAGE 72

62 Chig-8 UF2 Figure 4.6. Muller cell specificity, gfp positive cells were randomly tested for co-expression of the MC marker 2M6. The averages of these cell counts were determined for two different constructs, Chig-8 and UF2, and the standard error of the mean was determined. The green, lower bars represent the averages, while the gray, upper bars represent the standard error of the mean. These analyses suggest that the 1 .3 kb chicken CA-II promoter is not sufficient for MC specific expression. Three repetitions of transfection and cell counts were done for UF2 and ten for Chig-8. The results (Fig. 4.6) show that CMV-driven g^-positive cells were MCs -13.3% of the time. In contrast the CA-II promoter-driven gj^-positive cells were MCs -17% of the time. There is no statistically significant MC-selectivity caused by the CCA-II promoter. Discussion This chapter has focused on genomic elements of CA gene regulation in zebrafish and chicken. The zebrafish CAH-Z gene has been isolated and partially characterized. In the chicken, I show that a small (-1 .4 kb) proximal 5' promoter drives reporter gene expression in a non-specific manner.

PAGE 73

63 To begin studying the actual mechanisms regulating CAH-Z gene expression, I isolated CAH-Z genomic clones. Genomic clones were isolated from a PAC library that had an average insert size of 200 kb. The CAH-Z positive clone "J026'" was digested with Hind III and two fragments were subcloned into a pBluescript vector. These fragments have been partially sequenced. J026 has also been partially sequenced in ai eas that B176 and B239 do not cover. The genomic sequence of CAH-Z was partially characterized. By comparing the CAH-Z cDNA and genomic sequence, I was able to elucidate the structure and sequence of Introns A, B, and C. When compared to the subcloned fragment's sequence, the PCR products used to determine the Intron/Exon boundaries contained some deletions. Thus, the lengths from Intron d and Intron E in Figure 4.4 are somewhat questionable. The continuing sequencing from J026 should clarify the intron structure of CAH-Z. The subclone B176 contained ~5 kb of 5'-flanking sequence. Additional sequence 5' from B176 was obtained by directly sequencing of J026. When all the 5'-flanking sequence is run through BLAST, several regions show high identity (>90%) to a zebrafish bone morphogenetic protein 4 precursor (BMP4) gene (see Appendix for sequence; Hwang et al. 1997).The sequence for the zebrafish BMP and for the J026 clone do not completely overlap. Therefore, the identity between the two might represent a different form or a pseudogene. The presence of a BMP homologue upstream suggests all the putative 5'-flanking regulatory elements lie in-between the BMP and CAH-Z genes. The B176 fragment contains all of this intervening DNA, the CAH-Z transcription start site, the translation start site, and a portion of the first exon. The Bl 76 fragment should be easily digested to remove everything before the translation start site, and then inserted into a reporter construct. To test whether a CA minimal promoter can drive MC-specific expression of a reporter gene, I investigated the chicken CA-II promoter. The experiments using a CCAII promoter are consistent with the in vitro and in vivo experiments of others, which show

PAGE 74

64 a strong non-specific promoter function by the CA-II gene' s proximal cw-regulatory region. The expression in many different cell types, with a loss of specificity suggests that a regulatory module with repressive capability is missing from the tested promoters. One possible mechanism for the regulation of the CA-II gene would involve regulation from a distant element. Examples of distant regulation are present in many systems, including the Drosophila gene Ultrabithorax (Ubx) which has individual regulatory modules spread throughout a 70 kb gene (Barolo and Levine, 1997; Martin et al. 1995), and the welldescribed P-globin locus control element (Baron, 1996). The human P-like globin gene locus is a cluster of five genes aligned, 5' -s-^yVSP-3' (Paul et al. 1974; Jahn et al. 1980). These genes cover a distance of -60 kb, and are regulated in a coordinate fashion (Baron, 1996). For example, in erythropoeisis the yglobin gene is highly expressed in fetal liver while P-globin expression is low. When erythropoeisis shifts to the bone marrow, the y-globin is doviTiregulated, while P-globin expression increases several fold (Harrison et al. 1988). The human P-globin gene has four local elements which are sufficient for tissueand spatial-specific expression. When constructs containing the local regulatory elements are introduced into transgenic mice they drive correct patterns of expression, however, the gene is not expressed at correct levels, and exhibits positional effects (Magram et al. 1985; Townes et al. 1985). A series of DNAase hypersensitive sites were identified which have been analyzed and found to contain the elements necessary for normal expression levels (Grosveld et al. 1987). The "Locus Control Region" (LCR) is a 6.5 kb module found -50 kb 5' of the P-globin gene, which is able to promote the correct levels of expression in coordination with the proximal elements (Talbot et al. 1989). In vivo experiments have shown that the LCR and the proximal element region interact, and that transcription occurs only while the two module complex is formed (Wijgerde et al. 1995). In addition to this evidence, other proximal cw-regulatory modules have been shown to play important roles as intermediates between distant modules and the basal

PAGE 75

transcription apparatus. The sea urchin Endo1 6 gene contains several modules responsible for its expression (Yuh et al. 1996; Yuh and Davidson, 1996). The most proximal of these modules, Module A, mediates early expression in the vegetal plate by itself. However, it also functions through bound transcription factors to transmit the combined signals of all other modules to the BTA. The CA-II proximal 5' promoter might play a critical role in CA expression by interacting with a distant regulatory module As mentioned, the CA-II proximal cw-regulatory module contains many putative transcription factor binding sites. The CA-II proximal cw-regulatory module fi-om human, mouse, rat, and chicken contain a number of Spl factor binding sites. Originally described as a sequence-specific transcription factor, the Spl protein is now thought to play a role in stabilizing the interaction of distant modules (Pascal and Tjian, 199 1). The Spl protein is able to multimerize, and it is thought to bind like molecules from a different module, and thus allow the two modules to interact locally. The CA genes, as shown in Chapter 2, have evolved from a common ancestor through a series of tandem duplications. These duplications have resulted in the three amniotic cytoplasmic genes (CA-I, CA-II, and CA-III) remaining closely associated with one another (Fig. 4.7 Edwards, 1990). This close association in humans and rodents was thought to be due to recent duplication, which is the most likely explanation. However, there also exists another possibility. If the regulation for the CA genes was not duplicated along with the genes themselves, then some key regulatory modules might have remained at their original locus, as with p-globin. In this scenario, some CA-II regulatory control modules could be either upstream or downstream of the CA-I, or CA-III genes (Fig. 4.7). If this is true, then many kilobases of genomic DNA will have to be analyzed to deteiTnine the factors controlling regulation. The zebrafish offers a distinct advantage over the bird or mammal for studying CA regulation. The zebrafish should contain only one CA gene, where the higher vertebrates contain three linked genes (this refers only to the CAs present in the cluster shown in Fig.

PAGE 76

66 4.7 and not to the other isoform famiUes). If the result of these duplications is longdistance regulation, then using an animal model with only one gene should bypass the problem of searching large areas of genomic DNA. In addition to the lack of duplication, the zebrafish presents another advantage, that of a small genome. Many fish have been shown to have smaller genomes than higher vertebrates (Hinegardner, 1968). Therefore, even if CAH-Z is controlled through a long-distance regulatory module, it should be significantly closer to the gene than in birds or mammals. 76 54 32 1 111! II I lb t: la 12 3-67 12 3-6 7 w nil t CA1 — 80 kb-^ CA3 CA2 10 kb Figure 4.7. Human CA gene locus. The human CA-I, CA-II, and CA-III genes are shown. The distances between the genes are given in relation to the scale bar. The exons are numbered above the boxes. The arrows give the direction of transcription. The possibility that Bl 76 extends into the 3' region of the next gene upstream would suggest that all 5' regulatory modules are contained within the fragment. The presence of regulatory modules inside other genes has been described, but is rather rare in vertebrates (Kirchhamer et al. 1 996). The 200 kb PAC clone should contain all the necessary regulatory elements necessary for MC-specific regulation of the CAH-Z gene.

PAGE 77

CHAPTER 5 GENERAL RESULTS AND DISCUSSION This laboratory studies the mechanisms of MC differentiation. One method of studying cell-differentiation is to understand the regulatory mechanisms responsible for cell-specific gene expression. The gene this laboratory focuses on is CA-II, which is the only cytoplasmic CA isoform expressed in the neural retina, where it is localized to the MCs. The working hypothesis of the laboratory states that the regulation of CA-II expression in the MCs is conserved across all vertebrates. With that in mind, my project revolved around validating the zebrafish as a model for studying CA expression in the MCs. The results present suggest that the zebrafish is not only a valid model for studying the regulation of CA in MCs, but that it is the best available model. This project sought to answer three questions concerning CA in zebrafish: 1) Does the zebrafish contain a high-activity CA? This question stems from the localization of CA-II to MCs in the bird and mammal eye. CA-II is the highactivity isoform found in higher-vertebrates. 2) If a high-activity CA is present, is it found in the MCs, as is CA-II in birds and mammals? Previous reports from this laboratory have shown CA immunostaining in the horizontal cells of fish as well as in the MCs. When does expression begin during development, and in which cells is it present? 3) Can a proximal 5' promoter control MC-specific expression of the zebrafish CA gene? This question begins to investigate how CA expression in the MCs is regulated. 67

PAGE 78

68 I sought to isolate and characterize a high-activity CA from the zebrafish. I began by using inhibitor-based affinity chromatography. The standard method for isolating CAs is through affinity chromatography with pAMBS. Affinity chromatography of zebrafish total soluble protein results in the isolation of a single protein (Fig. 2.1). The single protein was characterized through both direct peptide-sequence and also through enzyme kinetic analyses. After cleavage with Endo-LC, two fragments were sequenced using Edman degradation. The direct peptide sequence shows that the protein is a CA (Fig. 2.4). This fact is confirmed by the protein's ability to converting CO2 to HCO3 . This activity could be inhibited by the sulfonamide EZA, and an inhibition constant was determined (Fig. 2.2). The inhibition constant suggests that the enzyme is a high-activity isoform. The cDNA sequence was determined through overiapping PCR (Fig. 2.3). Using retina RNA, the full-length sequence was determined and found to contain a 260 amino acid open reading frame. This reading frame matches the 48 amino acids of peptide sequence exactly (Fig. 2.4). Sequence comparisons and phylogenies suggest that the carbonic anhydrase homologue from zebrafish (CAH-Z) is novel. The CA-I, CA-II, and CA-ni isoforms arose from recent gene duplication. The data I present (Fig. 2.7) supports the idea that the duplication occurred after the divergence of tetrapods and teleosts. Therefore, CAH-Z is novel in an evolutionary sense. The single gene present before the tetrapod divergence gave rise to multiple genes in the tetrapod lineage. CAH-Z represents one teleost version of the gene present at the tetrapod divergence. The results presented were conclusive evidence that a high-activity CA was present in the zebrafish. Given the presence of a high-activity CA in zebrafish, the next set of experiments sought to answer where the protein is present in the zebrafish retina. A polyclonal antiserum was produced in rabbits against the purified CAH-Z protein. This antiserum recognizes a single band of 29 kDa on Western blots of soluble protein from zebrafish. The antiserum stains MCs in the aduh retina. Double-labeling experiments using an antibody against the glial-specific protein glutamine synthetase, show that expression is

PAGE 79

69 only in the MCs. Immunohistochemistry on early embryonic tissue sections show that no CAH-Z staining is present in undifferentiated retinoblasts and that staining does not occur until near the beginning of zebrafish functional vision (Easter and Nicola, 1997). The pattern of expression is coincident with the appearance of functional vision and an improvement in visual acuity. Analysis of the marginal zone, a region of mitotic activity and differentiation in the adult retina, shows that undifferentiated cells have no CAH-Z and that staining is only present in MCs. Double labeling with the HNK-1 antibody leads to the conclusion that the carbohydrate epitope is present on MCs. Interestingly, the epitope appears to be present before the expression of either CAH-Z or GS. These resuhs suggest that the MCs are structurally differentiated before they complete biochemical differentiation. A biphasic pattern of differentiation might be explained by the dual role of glia. Early in development the glia of many tissues function as a scaffold or guide for cellmigration and/or axonal migration. The correct formation of the retinal layers or the production of the synaptic layers might require the presence of a glial scaffolding. Some of the biochemical functions of the ghal cells might not be needed at this early time, and would only be required once the neurons have finished differentiation and begun transmitting signals. As mentioned, the onset of functional vision begins shortly after the onset of CAH-Z expression in glial cells and improves rapidly over the next 8-10 hours, during which time CAH-Z expression spreads throughout the retina. This is not meant to suggest that correct vision relies on the biochemical differentiation of the MCs, although such a point cannot be ruled out, but rather that the expression is coincident with improved vision, and is therefore not necessary before this time. The data presented shows that CAH-Z is MC-specific in the zebrafish retina. The fmal phase of this project is aimed at studying a proximal 5' promoter in the zebrafish. These studies require the isolation of genomic clones which contain the proximal 5' promoter. The promoter was subcloned from an isolated PAC clone that contains the CAH-Z gene. The fragment contains the CAP site, transcription start site and

PAGE 80

70 the beginning of the coding region on its 3' end, and ~4 kb of promoter on its 5' end. Additionally, the most 5' sequence from this fragment, and from direct sequencing of the J026 PAC clone suggests the presence of a BMP gene. If this is true, then the promoter should contain all the necessary information that will be found in the 5' direction. The mechanisms responsible for the expression of the high-activity CA throughout the vertebrate body should prove a most interesting case of gene regulation. The studies that have been published in mouse suggest that regulation is not controlled through a simple proximal 5' promoter. The results presented in this dissertation also suggest that a small proximal 5' promoter of 1.4 kb also is not sufficient to drive correct retinal expression. Where are the elements necessary for cell-specific expression located? This question might be most easily answered using the zebrafish.

PAGE 81

71 APPENDIX GENOMIC SEQUENCE FROM J026 AND SUBCLONES B239 AND B 176 The genomic sequence presented is a compilation of both J026 PAC sequence and subclones B239 and B 176 sequence. The portions of the sequence that represent exons (as determined by their identity to CAH-Z) are in blue and are numbered 1-1534. The blue sequence marked 412-1534 is cDNA sequence that has not been completed at the genomic level. The black sequence fragments in-between the blue exon sequences are introns, Intron A, Intron B and Intron C are completely sequenced. The sequence obtained from B 176 is marked by purple asterisks at the 5' end (in the first box of sequence) and the 3' end (in CAH-Z's Intron A). The sequence obtained from B239 is marked by green dollar signs at the 5' end (in CAH-Z's exon 2) and the 3' end (in CAHZ's last blue box). The poly-N tracts in both the region proceeding CAH-Z's first exon, and in Intron B are the central portions of B 176 and B239 that have not yet been sequenced. The intron sequences determined by PCR are not shown. I found deletions in the PCR sequences when comparing them to the direct sequence from J026. Thus, the intron sizes presented in Figure 4.4 should be considered estimates, although the intron/exon boundaries are assumed to be correct. The sequence upstream of the cDNA start site (position 1) is assumed to contain the putative proximal 5' promoter. A putative TATA box is shown in larger, bold, underlined font. When the putative promoter sequence is run through BLAST, several regions with homology to bone morphogenetic protein 4 (BMP-4) from zebrafish are found (Hwang et al. 1997). These regions of homology are numbered, underlined, and shown in red. The identity between my sequence and the sequence in the database is

PAGE 82

72 very high (greater than 90%), however, there are regions missing from the reported sequence in my clone. This might suggest that there is a different BMP homologue upstream of the CAH-Z gene and that only the conserved exons are aligning. The presence of a BMP gene upstream suggests that the entire putative proximal 5' promoter has been isolated and sequenced. 5' CCATCCATGCATTGCTCTGTTTAGTGACATTTGGATTATAATCTATGCCAGGATTTAGAT TTTGCCAACCGGATACGCTCCATCACAAACCATCATTGTATTACGTTGTCACAACTTTAATTCC AAGAAACAAACAGATAATATTAGAATTCATACTTTTTTTTTTTTTTTTTGCATTTTAATGTTTTA AAATGACACACATGCAAGATGCTTTAAAGCTGAAACAACAGTTTATGTTGTAAAAAATGTGAA TGTATATATTCTCAAAATGAGGTTGCTATGATTCAGTTAACATATAGCATGATAAAAAATATTA TAATAATAATAATAATGTATACATAATATTTAATATTTTAATAATTTTAATAATAAAAATATTA ACAGTAAATTAATTCATTAGGTATTCTATACTAGCATCAATAATATTCTTTAACTTATATTATAC TTAACTTACTATACGCTCAAAAGCTTGGGGTCAAAAGGATTTTTCAGTGTTTTAAAAT*AAGCT TATCTTAAGCTATTATCACAAAGACTGCATTTATTTAATCAAAATACAGTACAAAGAGTAAAAA TGTGAAATGTTATAGCACGTTAAATAACTGATCAAAAGTAGTTTATCATTTAATTTATTCATTT ATTCCAGTGATTTTAAAGATGAATTTTCAACTTACTCCAGTCTTAAGAGTCACATGATCCTTCA GAAATCACTCTAGTATTATTAATAATAATAATAATAATAATTATTATTATTATTACTATTATTAT ACAATGTAGACATACAATACAGTCAGTTAAATAACATTTTAATAAACACTTAACAATTTAACAA TTTGTTTTACATTTAATAAATGCCTCCTTGATGAACAGAATAGTTTTCTTTCAAGAAACACTGAC TAAAAGTTTTGACAGGTAGTGTACAGTTGAAGTCAGAATTATTAGCCCCCCTGTTTATTTTTTC CTTAATTTCTGTTTAACAAAGATATTTTTAACACATTTCTAATCATTAT 738 1 -AGTTTTATTAACTAATTTCTAACAACTGATTTATTTTATCCTTGCCATGA TGACAGTAAAAAATATTTGACTAGATATATTTCAAGACACTTCTATACAGCTA AAAGTGACATTTAAAGGCTTAACTAGGTTAATTAGGTTAACTAGGCAGGT-7533 TAGGGTAATTAGGCAATTATTTGTATTTCTATGGTTTGTTCTTTCGAAAAAAAATT 7589-ATAGCTTAAAGGGGCTGGTAAAATTGACATTAAAATGGTGTTTGAAAAT TAATAACTGCTTTTAGTCTAGCCAAAATAAAACAAATAAGACTTTCTCCAGAA GAAAAAATATGATCAGACATACTGTGAAAATTTCCTTGCTTTGTTAAACATCA TTTGGGAAATATT-7757 AAAAAAAAGAAAAAGAAAAAAGGGGGGCTATAATTCTGACTTCAACTGTAAATAAAAAATGA AACAATCAAATACACATTGATTAATATTGCATAAAGTCTGAATTTGAACCCGCAATCATTCGTT TTACATTTCAGATCTTCTTTAACTCATTGGTGGAGTTTTGATTTCTTTGCCACTGTTGCCTATGG CTTGCTTGGTTGAGGTTTGTAGAGATGTGTTTCAGTGGACAGTGAAGCTGAATTAAACTGAACT ACAACAGTGACATTAATATTAAACAGCATTTTTAAATTAACTACAACTACGCCAGCATGTTATC ACAAATCTCTTGCCTGAAATGTTCTACATTCTGAAAAAAGAATTATGTTTTTTTTATTCTCCTTT TTGTCTATATGTAAAGCTGCTTTGCCAATCTACATTATATCAAGCACTATAAAAATACAGATGA GTTGAATTGAACTACTACAAACACTGGCAAGAGTTTTTAAACATGGTAAATAAATTTGGCAAA AAAAATACAATGTCAA NNNNNNN TAAGAAAAAGAATTGACAAAACCTGGAACGTCATTAAC taaatttaaaacctagctaggcctacataaaaagatgggtcatttttgtatgtttccttactgt attgagattttttcaaatatacaaagttaaaaatgtaaataaataataatttttccacttcggc

PAGE 83

73 CACCAGATGACAGCAACGCAAAGAGTTTAAATGACGTATATCACTCATCCATTGACATTTGCAG GTGGTGATACCGCTATATACGATATTTTAAATATTGGAAATTCATTTATGACACAAAAACACAT TTTGGCCTTCACAAGTATAGGCTACAGTAAATGAAAACCTAGCCTATTTTCCTAATCAACAAGT GTTAAGCAAAAACTATTCAAAACAAAACATTGCACTCTTTTAAATGCATTTGTCAAGGATTTAA ACAACCAGCACGTATTTTGAGCTCTAGTAGTTCGAGTAAACAGGTTAAAATGTTTTATATAACA CCGACTAATCATAGTCGGCGCAGTGGCCCCTTTAAAAGAGCACTGCAGCTCTTCACAGAAAAG GTACCAGAAGATGTAGACCAAAAAACTGCGTCTGATTTTGTTTTCTTTTAGAAATATGAATCAA AACAACCTTCGAAATGACAAACTAAGCTACAAAATCAGTCATTGCGCAACAGAGATACTGTGT TGAGCCGCGCACACCATCACTCGTCCGTCCTGCGTTTCGACACAGCATCGCATAAGGACGAGG AAGGTCAAGAGAACATGCATCGCTGCCCGGATAAAGGACGGGTTTCTGAATCACCAGAGAAAG AAACCAATGGAGAGGTTTGTGATTCGAAGCAGAATCTTGAACGCCGGAAAACAGAGGAATGCC CGTTTCTCATCTGTTCTCCGGCGCTCGAGCATCTCTGAGCCGCATCAGCAAACCGAGCAGCGCG ATGGCCAGTGACCGGTGTTCTGGAGGTGCGATATTTTGATTAGTTGAAGACAAATGTCCTCTGA CTAACTCCTCCTGTGCTGCCTGGAGAGCATGTGGCCAAACCCACTGGGCTGAGAGAGGGACCA GCACCAGGAGGGGAACTCTATATAAAGCCTGACATAGTTTGGGGGAATTAAG 1-CAGCAGTTGTTTTAGCATCCAGGTTGTACAAGTAGAGGAACACAGCGAAA ACCATTTATAATCATGGCTCACGCTTGGGGATATGGACCAGCTGACGG-97 TAAGATTAACTTTAMTGATATTAATGTTAATATTTKATAATGTATGTTTAATGTTTATTCTTAGT AGCTATAMTGTTTTATTCTTATTTTTTTAGGAGAAAAGCTGGAGCACTTATTTTAATATCTAAA at aatttac acgtagc agtaatttatattaaac aatgaaat " gttaattttacct aaggttaga gtcttgtcttagagtcttttacaaaagctttttgtcttgtttccagtctaaatatctaaaaatgt ttaaatcaagaaatattttctacataagcaaaaaacaaacagttttcaattgtttttttaagtt actttctataaggagaatataacattttcagttgttttctaaaataaaaattaagctagctttt ctttaaccaagcaaaataatctgtcaatgcataaaatactcttatttcaaactgaaaacaaaat tactttactactacttttaagtaaaatgtgcattaaaaaattgaaatgaatatgcttaatttag aacaaaagaaaaaaaaaaagaaagaaagacagacagaaaagaaaaacagtgttatgactgaa acaacatggataaattactctacaaaaacaaaagtcacttctaaatgtaaaatcagctaaaaa gagctcctggaggtaacagctgcmaatatccacttctcaccgcctacaatttctaaccttgaat tttgcaaagaatgtaaacgtgcatctagacactgtgcttttatcttcttgcattcagcttctaat ctatttctcctgctcatatcatttca 96-GGGCCAGAGAGTTGGGCAGA AAGCTTTCCTATTGCAAATGGACCCCAGG CAGTCTCCCATTGATATCGTACCCACCCAAGCACAGCACGACCCTTCTCTGAA GCATCTCAAATTGAAGTATGACCCAGCCACCACCAAGAGCATCCTTAATAATG GCCATTCATTCCAAGTGGATTTCGTTGATGACGACAACAGCTCAA-294 GTTAGTATACTGCACAATGCAAATGTTGGGCTCAATCTTAAAGAGACAGTTAACACAAAATTA AAACCCTACCATCATTTACTCTAACTTCACTCAAACCTAAACCCTTGACCATAAACTTTCATACT GTTGTTTTTTTTTACTATGGATTTCAATGGCTACTGGTTTTCAGCATTCCTCAAGATATATTTAT GTTGAGTAGAAGACGATGTTTGAAACTACTTAAATGATGAGTAAATGTTAATATTTGGGTGATC TTTCTCTTTACCATCTTAAGACATTCTCAAGAGACTTTATCAGGATGGTGGTTTGGCTACAGTG GACAATCATTGTTAGCATAATCATTGCCAAACATGCATAATTACAATTATACCACTGGACCCAC TGCAATGTTTGCAGATTGCAGAGTGCTAAAATGAAAATATGATATTTTTATTCATAAAACATGC AATAGTAGCTATATATATCCATGACTATATCTCATGACCTGTTTTTATCCATTCATTAATTAAAT TTAGTTTTAAGTAGTCCATGGGTGGCTTCTCCTTGATCACTTTATCCTAGTCAGCA GNNNNNN NAAAAAAAAAAAAATTAACTATACATTTTAAATCCAGAAAAGACAACAATTTGTAAGCGGTCA TAGTATATAATGTAATATACAGTTAACTGAAATTTTGAGATTTTTTTTTATGTGTATTTTTTATT AAAACATATTTGAATTATAAACTTGTTATTTTAAATTGTGCAACATTTGTATAATAATTTTTATT CAATACAAGCAACAACTATTACATATGTTTTGATTGTTTAAATGCATTTATACATGATATACAG

PAGE 84

74 TTTTAACACATTTCCAATGACTAATGCTTTAGTGCTGCCTAAGGAACAGATGCATCATTTTTAT AATTATTTGTGTGTGTGTAG 295^TCTGGCTGGAGGTCCCATCACAGGGATATACAGGTTGAGACAGTTCCA TTTCCATTGGGGTAGCAGTGATGACAAGGGATCCGAGCACACTATTGCTGGAA CC AAGTTCCCTTGTGAG-4 1 3 GTAATGAGAGTTTTTTTNNAATTCCCACTATAAAACAGCRGCAACCCTCATTCGGCTGCGCTGA GATTCAGGCCGTTCTAATTCTTGAACATCTCTCCATAATTATAGCTCACTGCTCATGAATATTCT TATGATGTTCTCTTATGAATTTGTAAATGCCCTCTTTTAAATGTGCCAAGATATTAAGTCCATTC AGTACTCCTACCGCATATACTGAATGTTTCATAATAACTATATGTCTCCTCCTTCTTA 4 1 2AGCTT C ACCTTGTTC ACTGGAAC AC AAAGT ACCC AAACTTTGGAG AAGC TGCCAGTAAGCCTGATGGCCTTGCTGTGGTTGGAGTTTTTCTCAAGATCGGCGC TGCAAATCCAAGACTTCAGAAAGTTCTAGATGCCCTTGATGACATCAAATCAA AGGGCAGACAGACTACATTTGCCAACTTTGATCCTAAAACCTTGCTGCCTGCC TCTCTGGACTACTGGACTTATGAGGGCTCTCTGACCACCCCTCCTCTGCTGGAG AGTGTCACCTGGATTGTTTTGAAGGAGCCGATCAGTGTTAGTCCTGCTCAGAT GGCTAAATTTCGCAGCCTGCTGTTCTCATCTGAAGGAGAAACACCTTGCTGCA TGGTTGACAACTACAGACCTCCTCAACCTCTCAAGGGACGCAAAGTTCGCGCT TCCTTCAAGTAAACCCCAGAATCGATGCCACTTGCCTTCTGATTATG GTGC TTT TGACTGGTTGTTACTGAAACATCACAGTATTTGTTCTCGATCCAGGCTTTTGCT TACATTGCAGTACTGATAACAGGAAAGTTGAATCTGATCTTCTAAAACTGTCT GCGTTTGTCATAAACGCCAATGTTATGATTGCTAAACATGAGAAATAGTATTT CGAGATGCTAAAACAGTGGTTAGTTTCCTACTATATCCTGACGCTTTTATGTAA ACTGGAAAAATAAGGAGACTGCTTTATTTCTAGCTCATTTTTTGACTGCTTCAC TTTGCATTTTATAGGCCATTCTTTTAGCCTCTGCAGAATTGCACTATAATTCAT GTTCTACAATAGGAAAATCGTCAAGGTTTTGTGTGGGTTTATGGCAATGTGTG ACTGATGAGATGTGTTGATGCTAATATACCTGCAGGAAAGCACTTATTTACAG CAATATGTTGTTGTTTTAAAGTGATTCCTTTTTCATCAAGAGGAATATCAAGGG ATTATATTTTTAAATCGTTTATGAGAATGTTGAATCAAGACCTCCTGCCATAGA TAATATTATTTAGATATTTCAGAATAAATATTTAATTGAGTAGTGTTGCAAACA AATATGATATGTAAATCAGTATCTATTAAGAATTTTATCTGCAATAAATGAATA TATTTT-1534 3'

PAGE 85

75 BIBLIOGRAPHY Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403-410. Altshuller, Y., Copeland, N.G., Gilbert, D.J., Jenkins, N.A. and Frohman, M.A. (1996) Gcml, a mammalian homologue of Drosophilag//a/ cells missing. FEBS Lett. 393, 201-204. Antonicek, H., Persohn, E. and Schachner, M. (1987) Biochemical and functional characterization of a novel neuron-glia adhesion molecule that is involved in neuronal migration. J. Cell Biol. 104, 1587-1595. Amone, M.I. and Davidson, E.H. (1997) The hardwiring of development: organization and function of genomic regulatory systems. Development 124, 1851-1864. Badenhorst, P., Harrison, S. and Travers, A. (1996) End of the line? Tramtrack and cell fate determination in Drosophila Genes Cells 1, 707-716. Barettino, D., Bugge, T.H., Bartunek, P., Vivanco Ruiz, M.D., Sonntag-Buck, V., Beug, H., Zenke, M. and Stunnenberg, H.G. (1993) Unliganded T3R but not its oncogenic variant, v-erbA, suppresses RARdependent transactivation by titrating out RXR. EMBOJ. 12, 1343-1354. Barnes, S., Merchant, V., and Mahmud, F. (1993) Modulation of transmission gain by protons at the photoreceptor output synapse. Proc. Natl. Acad. Sci. (USA) 90, 10081-10085. Barolo, S. and Levine, M. (1997) haiiy mediates dominant repression in the Drosophila embryo. EMBOJ. 16, 2m-2m. Bayer, T.A. and Campos-Ortega, J. A. (1992) A transgene containing lacZ is expressed in primary sensory neurons in zebrafish. Development 115, 421-426. Beechey, C, Tweedie, S., Spurr, N., Ball, S., Peters, J. and Edwards, Y. (1990) Mapping of mouse carbonic anhydrase-3, Car-3: another locus in the homologous region of mouse chromosome 3 and human chromosome 8. Genomics 6, 692-696. Bergenhem, N. and Carlsson, U. (1990) Partial amino acid sequence of erythrocyte carbonic anhydrase from tiger shark. Comp. Biochem. Physiol. [B]. 95, 205-213. Blanchard, A.D., Sinanan, A., Parmantier, E., Zwart, R, Broos, L., Meijer, D., Meier, C, lessen, K.R and Mirsky, R. (1996) Oct-6 (SCIP/Tst-1) is expressed in Schwann cell precursors, embryonic Schwann cells, and postnatal myelinating Schwann cells: comparison with Oct-1, Krox20, and Pax-3. J. Neurosci. Res. 46, 630-640. Boncinelli, E. (1997) Homeobox genes and disease. Curr. Opin. Genet. Dev. 7, 331-337.

PAGE 86

76 Borgula, G.A., Karwoski, C.J., and Steinberg, R.H. (1989) Light-evoked changes in extracellular pH in frog retina. Vision Res. 29(9), 1069-1077. Bossing, T., Udolph, G., Doe, C.Q. and Technau, G.M. (1996) The embryonic central nervous system lineages of Drosophila melanogaster. I. Neuroblast lineages derived from the ventral half of the neuroectoderm. Dev. Biol. 179, 41-64. Bossing, T. and Technau, G.M. (1994) The fate of the CNS midline progenitors in Drosophila as revealed by a new method for single cell labelling. Development 120, 1895-1906. Brion, L.P., Zavilowitz, B.J., Suarez, C. and Schwartz, G.J. (1994) Metabolic acidosis stimulates carbonic anhydrase activity in rabbit proximal tubule and medullary collecting duct. Am. J. Physiol. 266, F 185-95. Bronner-Fraser, M. (1987) Perturbation of cranial neural crest migration by the HNK-1 antibody. Dev. Biol. 123,321-331. Bronner-Fraser, M. (1993a) Environmental influences on neural crest cell migration. J. Neurobiol. 24, 233-247. Bronner-Fraser, M. (1993b) Mechanisms of neural crest cell migration. Bioessays 15, 221-230. Buono, R.J., Linser, P. J., Cuthbertson, R.A. and Piatigorsky, J. (1992) Molecular analyses of carbonic anhydrase-II expression and regulation in the developing chicken lens. Dev. Dyn. 194, 3342. Buono, R.J. and Linser, P.J. (1992) Transient expression of RSVCAT in transgenic zebrafish made by electroporation. Mol. Mar. Biol. Biotechnol. 1, 271-275. Cajal SR (1972) The stmcture of the retina (Translation of La Retine des Vertebres . 1933) SA Thorpe and M Glickstein (translators). Charles C. Thomas, Springfield, IL. Campos-Ortega, J.A. (1996) Numb diverts notch pathway off the tramtrack. Neuron 17, 1-4. Carmichael, G.G. and McMaster, G.K. (1980) The analysis of nucleic acids in gels using glyoxal and acridine orange. Methods Enzymol. 65, 380-391. Cepko, C. (1993) Lineage versus environment in the embryonic retina [letter; comment]. Trends. Neurosci. 16, 96-7; discussion 98. Cepko, C.L., Austin, CP., Yang, X., Alexiades, M. and Ezzeddine, D. (1996) Cell fate determination in the vertebrate retina. Proc. Natl. Acad. Sci. U. S. A. 93, 589-595. Chomczynski, P. (1993) A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 15, 532-4, 536-7. Church, G.M. and Gilbert, W. (1984) Genomic sequencing. Proc. Natl. Acad. Sci. U. S. A. 81, 1991-1995.

PAGE 87

77 Clark, D.D. and L. Sokoloff (1994) in Basic Neurochemistry: Molecular, Cellular, and Medical Aspects, 5* Ed., edited by G.J. Siegel et al. Published by Raven Press, Ltd, New York. Cohen-Cory, S., Escandon, E. and Eraser, S.E. (1996) The cellular patterns of BDNF and trkB expression suggest multiple roles for BDNF during Xenopus visual system development. Dev. Biol. 179, 102-115. Cohen-Cory, S. and Eraser, S.E. (1995) Effects of brain-derived neurotrophic factor on optic axon branching and remodelling in vivo. Nature 378, 192-196. Cornell-Bell, A.H., Finkbeiner, S.M., Cooper, M.S. and Smith, S.J. (1990) Glutamate induces calcium waves in cultured astrocytes: long-range glial signaling. Science 247, 470-473. Cornell-Bell, A.H. and Finkbeiner, S.M. (1991) Ca2+ waves in astrocytes. Cell Calcium 12, 185204. Crandall, J.E., Misson, J.P. and Butler, D. (1990) The development of radial glia and radial dendrites during barrel formation in mouse somatosensory cortex. Brain Res. Dev. Brain Res. 55, 87-94. Cvekl, A., Kashanchi, F., Sax, CM., Brady, J.N. and Piatigorsky, J. (1995a) Transcriptional regulation of the mouse alpha A-crystallin gene: activation dependent on a cyclic AMP-responsive element (DEl/CRE) and a Pax-6-binding site. Mol. Cell Biol. 15, 653-660. Cvekl, A., Sax, CM., Li, X., McDermott, J.B. and Piatigorsky, J. (1995b) Pax-6 and lens-specific transcription of the chicken delta 1-crystallin gene. Proc. Natl. Acad. Sci. U. S. A. 92, 4681-4685. Cvekl, A. and Piatigorsky, J. (1996) Lens development and crystallin gene expression: many roles for Pax-6. Bioessa\'s 18, 621-630. Davenport, H.W. (1984) The early days of research on carbonic anhydrase. A/;«. N. Y. Acad. Sci. 429, 4-9. Davidson, E.H. (1990) How embryos work: a comparative view of diverse modes of cell fate specification. Development 108, 365-389. Davidson, E.H. (1991) Spatial mechanisms of gene regulation in metazoan embryos. Development 113, 1-26. Davidson, E.H. (1993) Later embryogenesis: regulatory circuitry in morphogenetic fields. Development 118, 665-690. Deutsch, H.F. (1987) Carbonic anhydrases. Int. J. Biochem. 19, 101-1 13. Dodgson, S.J. (1991) Why are there carbonic anhydrases in the liver? Biochem. Cell Biol. 69, 761-763.

PAGE 88

78 Dodgson, S.J., Quistorff, B. and Ridderstrale, Y. (1993) Carbonic anhydrases in cytosol, nucleus, and membranes of rat liver. J. Appl. Physiol. 75, 1 186-1 193. Dowling, J.E. (1985). The retina: an approachable part of the brain. Harvard University Press, Cambridge, MA. Duband, J.L., Dufour, S., Yamada, S.S., Yamada, K.M. and Thiery, J.P. (1991) Neural crest cell locomotion induced by antibodies to beta 1 integrins. A tool for studying the roles of substratum molecular avidity and density in migration. J. Cell Sci. 98, 517-532. Duncan, M.K., Li, X., Ogino, H., Yasuda, K. and Piatigorsky, J. (1996) Developmental regulation of the chicken beta Bl-crystallin promoter in transgenic mice. Mech. Dev. 57, 79-89. Duncan, M.K., Kos, L., Jenkins, N.A., Gilbert, D.J., Copeland, N.G. and Tomarev, S.I. (1997) Eyes absent: a gene family found in several metazoan phyla. Mamm. Genome 8, 479-485. Easter, S.S., Jr. and Nicola, G.N. (1996) The development of vision in the zebrafish {Danio rerio). Dev. Biol. 180, 646-663. Edelman, G.M. and Jones, F.S. (1997) Gene regulation of cell adhesion molecules in neural morphogenesis. Acta Paediatr. Suppl. 422, 12-19. Edwards, Y. (1990) Structure and expression of mammalian carbonic anhydrases. Biochem. Soc. Trans. 18, 171-175. Erickson, R.P., Bevilacqua, A., Venta, P.J., Karolyi, J. and Tashian, R.E. (1990) Ectopic expression of chloramphenicol acetyltransferase (CAT) in the cerebellum in mice transgenic for a carbonic anhydrase II promoter-CAT construct that is without apparent phenotypic effect. Mol. Reprod. Dev. 27, 102-109. Erickson, R.P., Grimes, J., Venta, P.J. and Tashian, R.E. (1995) Expression of carbonic anhydrase II (CA II) promoter-reporter fusion genes in multiple tissues of transgenic mice does not replicate normal patterns of expression indicating complexity of CA II regulation in vivo. Biochem. Genet. 33,421-437. Fadool, J.M., Brockerhoff, S.E., Hyatt, G.A. and Dowling, J.E. (1997) Mutations affecting eye morphology in the developing zebrafish (Danio rerio). Dev. Genet. 20, 288-295. Fekete, D.M., Perez-Miguelsanz, J., Ryder, E.F. and Cepko, C.L. (1994) Clonal analysis in the chicken retina reveals tangential dispersion of clonally related cells. Dev. Biol. 166, 666-682. Femley, R.T., Wright, R.D. and Coghlan, J.P. (1988) Complete amino acid sequence of ovine salivary carbonic anhydrase. Biochemistry 11, 2815-2820. Femley, R.T., Wright, R.D. and Coghlan, J.P. (1991) Radioimmunoassay of carbonic anhydrase VI in saliva and sheep tissues. Biochem. J. 274, 3 13-316.

PAGE 89

79 Finkbeiner, S. and Greenberg, M.E. (1997) Spatial features of calcium-regulated gene expression. Bioessax's 19, 657-660. Fishell, G. and Hatten, M.E. (1991) Astrotactin provides a receptor system for CNS neuronal migration. Development 113, 755-765. Franz, M.G., Winkler, B.C., Norman, J.G., Fabri, P.J. and Gower, W.R., Jr. (1994) Tumor necrosis factor-alpha induces the expression of carbonic anhydrase II in pancreatic adenocarcinoma cells. Biochem. Biophys. Res. Commun. 205, 1815-1821. Fraser, P.J. and Curtis, P.J. (1986) Molecular evolution of the carbonic anhydrase genes: calculation of divergence time for mouse carbonic anhydrase I and II. J. Mol. Evol. 23, 294-299. Fredieu, J.R. and Mahowald, A.P. (1989) Glial interactions with neurons during Drosophila embryogenesis. Development 106, 739-748. Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Set. U. S. A. 85, 8998-9002. Galileo, D.S., Gray, G.E., Owens, G.C., Majors, J. and Sanes, J.R. (1990) Neurons and glia arise from a common progenitor in chicken optic tectum: demonstration with two retrovuaises and cell type-specific antibodies. Proc. Natl. Acad. Sci. U. S. A. 87, 458-462. Galileo, D.S., Majors, J., Horwitz, A.F. and Sanes, J.R. (1992) Retrovirally introduced antisense integrin RNA inhibits neuroblast migration in vivo. Neuron 9, 1 1 17-1 13 1. Gallin, W.J. and Greenberg, M.E. (1995) Calcium regulation of gene expression in neurons: the mode of entry matters. Curr. Opin. Neurobiol. 5, 367-374. Gao, W.O., Heintz, N. and Hatten, M.E. (1991) Cerebellar granule cell neurogenesis is regulated by cell-cell interactions in vitro. Neuron 6, 705-715. Gehring, W.J. (1996) The master control gene for morphogenesis and evolution of the eye. Genes Cells 1, 11-15. Giangrande, A. (1996) Development and organization of glial cells in Drosophila melanogaster. Int. J. Dev. Biol. 40,917-927. Giesen, K., Hummel, T., Stollewerk, A., Harrison, S., Travers, A. and Klambt, C. (1997) Glial development in the Drosophila CNS requires concomitant activation of glial and repression of neuronal differentiation genes. Development 124, 2307-23 16. Gilbert, S.F. (1994). Developmental Biologv . 4"' Ed. Sinauer Associates, Inc. Sunderland, MA. Ginty, D.D. (1997) Calcium regulation of gene expression: isn't that spatial? Neuron 18, 183-186.

PAGE 90

80 Glardon, S., Callaerts, P., Haider, G. and Gehring, W.J. (1997) Conservation of Pax-6 in a lower chordate, the ascidian Phallusia mammillata. Development 124, 817-825. Godbout, R., Packer, M., Poppema, S. and Dabbagh, L. (1996) Localization of cytosolic aldehyde dehydrogenase in the developing chick retina: in situ hybridization and immunohistochemical analyses. Dev. Dym. 205, 319-331. Gopal-Srivastava, R., Cvekl, A. and Piatigorsky, J. (1996) Pax-6 and alphaB-crystallin/small heat shock protein gene regulation in the murine lens. Interaction with the lens-specific regions, LSRl and LSR2. J. Biol. Chem. 271, 23029-23036. Gottlieb, J. and Muzyczka, N. (1988) In vitro excision of adeno-associated virus DNA from recombinant plasmids: isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences. Mol. Cell Biol. 8, 2513-2522. Gray, G.E., Glover, J.C., Majors, J. and Sanes, J.R. (1988) Radial arrangement of clonally related cells in the chicken optic tectum: lineage analysis with a recombinant retrovirus. Proc. Natl. Acad. Sci. U. S. A. 85, 7356-7360. Gray, G.E. and Sanes, J.R. (1992) Lineage of radial glia in the chicken optic tectum. Development 114,271-283. Gray, S., Cai, H., Barolo, S. and Levine, M. (1995) Transcriptional repression in the Drosophila embryo. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 349, 257-262. Grosveld, F., van Assendelft, G.B., Greaves, D.R. and Kollias, G. (1987) Position-independent, high-level expression of the human beta-globin gene in transgenic mice. Cell 51, 975-985. Gruberg, E.R., Kicliter, E., Newman, E.A., Kass, L. and Hartline, P.H. (1979) Connections of the tectum of the rattlesnake Crotalus viridis: an HRP study. J. Comp. Neurol. 188, 31-41. Hagedom, M., Femald, R.D., (1992) Retinal growth and cell addition during embrjoiogenesis in the teleost Haplochromis burtoni. J. Comp. Neurol. 321, 193-208. Hageman, G.S., Zhu, X.L., Waheed, A. and Sly, W.S. (1991) Localization of carbonic anhydrase IV in a specific capillary bed of the human eye. Proc. Natl. Acad. Sci. U. S. A. 88, 2716-2720. Haider, G., Callaerts, P. and Gehring, W.J. (1995) Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila [see comments]. Science 267, 1788-1792. Harris, W.A. (1997) Pax-6: where to be conserved is not conservative [comment]. Proc. Natl. Acad Sci. U. S. A. 94, 2098-2100. Harrison, P.R., Plumb, M., Frampton, J., Llewellyn, D., Chester, J., Chambers, I., MacLeod, K., Fleming, J., O'Prey, J. and Walker, M. (1988) Regulation of erythroid cell-specific gene expression during erythropoiesis. Br. J. Cancer Suppl. 9, 46-5 1 .

PAGE 91

81 Harrison, S.D. and Travers, A.A. (1990) The tramtrack gene encodes a Drosophila finger protein that interacts with the ftz transcriptional regulatory region and shows a novel embryonic expression pattern. £Af50y. 9,207-216. Heck, R.W., Boriack-Sjodin, P.A., Qian, M., Tu, C, Christianson, D.W., Laipis, P.J. and Silverman, D.N. (1996) Structure-based design of an intramolecular proton transfer site in murine carbonic anhydrase V. Biochemistry 35, 1 1605-1 161 1. Henry, R.P. (1988) Subcellular distribution of carbonic anhydrase activity in the gills of the blue crab, Callinectes sapidus. J. Exp. Zool. 245, 1-8 Hewett-Emmett, D., Hopkins, P.J., Tashian, R.E. and Czelusniak, J. (1984) Origins and molecular evolution of the carbonic anhydrase isozymes. Ann. N. Y. Acad. Sci. 429, 338-358. Hewett-Emmett, D. and Tashian, R.E. (1996) Functional diversity, conservation, and convergence in the evolution of the alpha-, beta-, and gamma-carbonic anhydrase gene families. Mol. Phylogenet. Evol. 5, 50-77. Higgins, D.G., Bleasby, A.J. and Fuchs, R. (1992) CLUSTAL V: improved software for multiple sequence alignment. Comput. Appl. Biosci. 8, 189-191. Hoist, B.D., Wang, Y., Jones, F.S. and Edelman, G.M. (1997) A binding site for Pax proteins regulates expression of the gene for the neural cell adhesion molecule in the embryonic spinal cord. Proc. Natl. Acad. Sci. U. S. A. 94, 1465-1470. Holt, C.E., Bertsch, T.W., Ellis, H.M. and Harris, W.A. (1988) Cellular determination in the Xenopiis retina is independent of lineage and birth date. Neuron 1, 15-26. Hosoya, T., Takizawa, K., Nitta, K. and Hotta, Y. (1995) glial cells missing: abinary switch between neuronal and glial determination in Drosophila. Cell 82, 1025-1036. Hummel, T., Menne, T., Scholz, H., Granderath, S., Giesen, K. and Klambt, C. (1997) CNS midline development in Drosophila Perspect. Dev. Neiirobiol. 4, 357-368. Hunkapiller, M.W., Strickler, J.E. and Wilson, K.J. (1984) Contemporary methodology for protein structure determination. Science 226, 304-3 11. Hutchins, J.B. and Casagrande, V.A. (1990) Development of the lateral geniculate nucleus: interactions between retinal afferent, cytoarchitectonic, and glial cell process lamination in ferrets and tree shrews. J. Comp. Neurol. 298, 113-128. Hwang, S.P., Tsou, M.F., Lin, Y.C. and Liu, C.H. (1997) The zebrafish BMP4 gene: sequence analysis and expression pattern during embryonic development. DNA Cell Biol. 16 (8), 100310 11 Jacobs, J.R. (1993) Perturbed glial scaffold formation precedes axon tract malformation in Drosophila mutants. J. Neurobio. 24, 61 1-626

PAGE 92

82 Jacobs, J.R. and Goodman, C.S. (1989a) Embryonic development of axon pathways in the Drosophila CNS. I. A glial scaffold appears before the first growth cones. J. Neurosci. 9, 24022411. Jacobs, J.R. and Goodman, C.S. (1989b) Embryonic development of axon pathways in the Drosophila CNS. II. Behavior of pioneer growth cones. J. Neurosci. 9, 2412-2422. Jahn, C.L., Hutchison, C.A., 3d, Phillips, S.J., Weaver, S., Haigwood, N.L., Voliva, C.F. and Edgell, M.H. (1980) DNA sequence organization of the beta-globin complex in the BALB/c mouse. Ce//21, 159-168. Johns, P.R. (1977) Growth of the adult goldfish eye. J. Comp. Neurol. 176, 343-358. Jones, B.W., Fetter, R.D., Tear, G. and Goodman, C.S. (1995) glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell 82, 1013-1023. Karwoski, C.J., Newman, E.A., Shimazaki, H. and Proenza, L.M. (1985) Light-evoked increases in extracellular K+ in the plexiform layers of amphibian retinas. J. Gen. Physiol 86, 1 89-2 1 3 . Kirchhamer, C.V., Yuh, C.H. and Davidson, E.H. (1996) Modular c«-regulatory organization of developmentally expressed genes: two genes transcribed territorially in the sea urchin embryo, and additional examples. Proc. Natl. Acad. Sci. U. S. A. 93, 9322-9328. Klambt, C. (1993) The Drosophila gene pointed encodes two ETS-like proteins which are involved in the development of the midline glial cells. Development 117, 163-176. Klambt, C and Goodman, C.S. (1991) The diversity and pattern of glia during axon pathway formation in the Drosophila embryo. Glia 4, 205-213 Kobayashi, S., Morgans, C.W., Casey, J.R. and Kopito, R.R. (1994) AE3 anion exchanger isoforms in the vertebrate retina: developmental regulation and differential expression in neurons and glia. J. Neurosci. 14, 6266-6279. Kobayashi, S., Vidal, I., Pena, J.D. and Hernandez, M.R. (1997) Expression of neural cell adhesion molecule (NCAM) characterizes a subpopulation of type 1 astrocytes in human optic nerve head. Glia 20, 262-273. Komuro, H. and Rakic, P. (1993) Modulation of neuronal migration by NMDA receptors. Science 260, 95-97. Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem. 266(30), 19867-19870. Kruse, J., Keilhauer, G., Faissner, A., Timpl, R. and Schachner, M. (1985) The Jl glycoprotein-a novel nervous system cell adhesion molecule of the L2/HNK-1 family. Nature 316, 146-148. Kumar, S., Tamura, K., Nei, M. (1993) MEGA: molecular evolutionary genetic analysis, version 1.0. The Pennsylvania State Univeristy, University Park, PA 18602

PAGE 93

83 Kunemund, V., Jungalwala, F.B., Fischer, G., Chou, D.K., Keilhauer, G. and Schachner, M. (1988) The L2/HNK-1 carbohydrate of neural cell adhesion molecules is involved in cell interactions. J. Cell Biol. 106,213-223. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 111, 680-685. Lallier, T., Leblanc, G., Artinger, K.B. and Bronner-Fraser, M. (1992) Cranial and trunk neural crest cells use different mechanisms for attachment to extracellular matrices. Development 116, 531-541. Lallier, T. and Bronner-Fraser, M. (1992) Alpha 1 beta 1 integrin on neural crest cells recognizes some laminin substrata in a Ca(2+)-independent manner. J. Cell Biol. 119, 1335-1345. Larison, K.D. and BreMiller, R. (1990) Early onset of phenotype and cell patterning in the embryonic zebrafish retina Development 109, 567-576. Leber, S.M., Breedlove, S.M. and Sanes, J.R. (1990) Lineage, arrangement, and death of clonally related motoneurons in chick spinal cord. J. Neurosci. 10, 2451-2462. Li, Y.C., Beard, D., Hayes, S. and Young, A.P. (1995) A transcriptional enhancer of the glutamine synthetase gene that is selective for retinal Muller glial cells. J. Mol. Neurosci. 6, 169-183. Li, Y.C., Hayes, S., Young, A.P. (1997) Steroid hormone receptors activate transcription in glial cells of intact retina but not in primary cultures of retinal glial cells. J Mol Neurosci 8(2): 145-158 Linser, P.J., Smith, K. and Angelides, K. (1985) A comparative analysis of glial and neuronal markers in the retina offish: variable character of horizontal cells. J. Comp. Neurol. 231, 264-272. Linser, P. J., Schlosshauer, B., Galileo, D.S., Buzzi, W.R. and Lewis, R.C. (1997a) Late proliferation of retinal Muller cell progenitors facilitates preferential targeting with retroviral vectors in vitro. Dev. Genet. 20, 186-196. Linser, P.J., TrapidoRosenthal, H.G. and Orona, E. (1997b) Glutamine synthetase is aglialspecific marker in the olfactory regions of the lobster (Panulirus argus) nervous system. Glia 20, 275-283. Linser, P. and A. A. Moscona (1979) Induction of gluatmine synthetase in embryonic neural retina: localization in Muller fibers and dependence on cell interactions. Proc. Natl. Acad. Sci. U.S.A. 76: 6476-6480. Linser, P.J. and Moscona, A.A. (1981) Induction of glutamine synthetase in embryonic neural retina: its suppression by the gliatoxic agent alpha-aminoadipic acid. Brain Res. 227, 103-1 19. Linser, P.J. and Moscona, A.A. (1984) The influence of neuronal-glial interactions on glia-specific gene expression in embryonic retina Adv. Exp. Med. Biol. 181, 185-202.

PAGE 94

84 Linser, P.J. and Perkins, M.S. (1987) Regulatory aspects of the in vitro development of retinal MuUer glial cells. Cell Differ. 20, 189-196. Linser, P.J. and Plunkett, J.A. (1989) A role for carbonic anhydrase in early eye morphogenesis. Invest. Ophthalmol. Vis. Sci. 30, 783-785. Lynch, C.J., Hazen, S.A., Horetsky, R.L., Carter, N.D. and Dodgson, S.J. (1993) Differentiationdependent expression of carbonic anhydrase II and III in 3T3 adipocytes. Am. J. Physiol. 265, C234-43. Magram, J., Chada, K. and Costantini, F. (1985) Developmental regulation of a cloned adult betaglobin gene in transgenic mice. Nature 315, 338-340. Maren, T.H. (1967) The general physiology of reactions catalyzed by carbonic anhydrase and their inhibition by sulfonamides. Ann N.Y. Acad. Sci. 429, 568-579. Marigo, v., Scott, M.P., Johnson, R.L., Goodrich, L.V. and Tabin, C.J. (1996) Conservation in hedgehog signaling: induction of a chicken patched homologue by Sonic hedgehog in the developing limb. Development 122, 1225-1233. Marigo, V. and Tabin, C.J. (1996) Regulation of patched by sonic hedgehog in the developing neural tube. Proc. Natl. Acad. Sci. U. S. A. 93, 9346-9351. Marino, L.R. (1993) Characterization of the mouse carbonic anhydrase II gene promoter. J. Biol. Chem. 268, 7081-7089. Martin, C.H., Mayeda, C.A., Davis, C.A., Ericsson, C.L., Knafels, J.D., Mathog, D.R., Celniker, S.E., Lewis, E.B. and Palazzolo, M.J. (1995) Complete sequence of the bithorax complex of Drosophila. Proc. Natl. Acad Sci. U. S. A. 92, 8398-8402. Meller, K. and P. Glees (1965). The differentiation of neuroglia-Muller-cells in the retina of chick. Zeitschrift fur Zellforschung 66: 321-332. McDermott, J.B., Cvekl, A. and Piatigorsky, J. (1997) A complex enhancer of the chicken beta A3/Al-crystallin gene depends on an AP-l-CRE element for activity. Invest. Ophthalmol. Vis. Sci. 38, 951-959. McFarlane, S., McNeill, L. and HoU, C.E. (1995) FGF signaling and target recognition in the developing Xenopus visual system. Neuron 15, 1017-1028. McGinnis, W. and Krumlauf, R. (1992) Homeobox genes and axial patterning. Cell 68, 283-302. Mission, J.P., Takahashi, T. and Caviness, V.S., Jr. (1991) Ontogeny of radial and other astroglial cells in murine cerebral cortex. Glia 4, 138-148. Moscona, A. (1961) Rotation-mediated histogenetic aggregation of dissociated cells: a quantifiable approach to cell interacions in vitro . Exp. Cell Res. 22: 455-475.

PAGE 95

85 Nagao, Y., Srinivasan, M., Platero, J.S., Svendrowski, M., Waheed, A. and Sly, W.S. (1994) Mitochondrial carbonic anhydrase (isozyme V) in mouse and rat: cDNA cloning, expression, subcellular localization, processing, and tissue distribution. Proc. Natl. Acad. Sci. U. S. A. 91, 10330-10334. Nedergaard, M., Cooper, A.J. and Goldman, S.A. (1995) Gap junctions are required for the propagation of spreading depression. J. Neurobiol. 28, 433-444. Newman, E. and Reichenbach, A. (1996) The Muller cell: a functional element of the retina. Trends. Neurosci. 19, 307-312. Newman, E.A. (1987) Regulation of potassium levels by Muller cells in the vertebrate retina Can. J. Physiol. Pharmacol. 65, 1028-1032. Newman, E.A. (1991) Sodium-bicarbonate cotransport in retinal Muller (glial) cells of the salamander. J. Neurosci. 11, 3972-3983. Newman, E.A. (1994) A physiological measure of carbonic anhydrase in Muller cells. Glia 11, 291-299. Newman, E.A. (1996) Acid efflux from retinal glial cells generated by sodium bicarbonate cotransport. J. Neurosci. 16, 159-168. Nevraian, E.A. and Zahs, K.R. (1997) Calcium waves in retinal glial cells. Science 275, 844-847. Osborne, W.R. and Tashian, R.E. (1975) An improved method for the purification of carbonic anhydrase isozymes by affinity chromatography. Anal. Biochem. 64, 297-303. Overbeek, P.A., Chepelinsky, A.B., Khillan, J.S., Piatigorsky, J. and Westphal, H. (1985) Lensspecific expression and developmental regulation of the bacterial chloramphenicol acetyltransferase gene driven by the murine alpha Acrystallin promoter in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 82, 7815-7819. Pain, B., Melet, F., Jurdic, P. and Samarut, J. (1990) The carbonic anhydrase II gene, a gene regulated by thyroid hormone and erythropoietin, is repressed by the v-erbA oncogene in erythrocytic cells. New Biol. 2, 284-294. Papalopulu, N. and Kintaer, C. (1996) A Xenopus gene, Xbr-1, defines a novel class of homeobox genes and is expressed in the dorsal ciliary margin of the eye. Dev. Biol. 174, 104-1 14. Parpura, V., Basarsky, T.A., Liu, F., Jeftinija, K., Jeftinija, S. and Haydon, P.G. (1994) Glutamate-mediated astrocyte-neuron signaling [see comments]. Nature 369, 744-747. Pascal, E., and Tjian, R. (1991) Different activation domains of Spl govern formation of multimers and mediate transcriptional synergism. Genes Dev. 5, 1646-1656. Peles, E., Nativ, M., Campbell, P.L., Sakurai, T., Martinez, R., Lev, S., Clary, D.O., Schilling, J., Bamea, G. and Plowman, G.D. (1995) The carbonic anhydrase domain of receptor tyrosine

PAGE 96

86 phosphatase beta is a functional hgand for the axonal cell recognition molecule contactin. Cell 82, 251-260. Pesheva, P., Horwitz, A.F. and Schachner, M. (1987) Integrin, the cell surface receptor for fibronectin and laminin, expresses the L2/HNK-1 and L3 carbohydrate structures shared by adhesion molecules. Neurosci. Lett. 83, 303-306. Peterson, R.E., Tu, C. and Linser, P.J. (1997) Isolation and characterization of a carbonic anhydrase homologue from the zebrafish (Danio rerio). J. Mol. Evol. 44, 432-439. Piatigorsky, J. (1989) Lens crystallins and their genes: diversity and tissue-specific expression. FASEBJ. 3, 1933-1940. Piatigorsky, J. (1993) Puzzle of crystallin diversity in eye lenses. Dev. Dyn. 196, 161-111. Pierce, J.C. and Sternberg, N.L. (1992) Using bacteriophage PI system to clone high molecular weight genomic DNA. Methods Enzymol. 216, 549-574. Radinsky, L.B. (1987) The evolution of vertebrate design. University of Chicago Press, Chicago, p 188 Rahim, S.M., Delaunoy, J.-P., and Laurent, P. (1988) Identification and immunocytochemical localization of two different carbonic anhydrase isoenzymes in teleostean fish erythrocytes and gill epithelia. Histochemistiy 89, 45 1-459. Rakic, P. (1971) Neuron-glia relationship during granule cell migration in developing cerebellar cortex. A Golgi and electronmicroscopic study in Macacus Rhesus. J. Comp. Neurol. 141, 283312. Rathjen, F.G., Wolff, J.M., Frank, R., Bonhoeffer, F. and Rutishauser, U. (1987) Membrane glycoproteins involved in neurite fasciculation. J. Cell Biol. 104, 343-353. Raymond, P.A., Barthel, L.K., and Curran, G.A. (1995) Developmental patterning of rod and cone photoreceptors in embryonic zebrafish. J. comp. Neurol. 359, 537-550. Ridderstrale, Y., Wistrand, P.J. and Brechue, W.F. (1994) Membrane-associated CA activity in the eye of the CA Il-deficient mouse. Invest. Ophthalmol. Vis. Sci. 35, 2577-2584. Riddle, RD., Johnson, R.L., Laufer, E. and Tabin, C. (1993) Sonic hedgehog mediates the polarizing activity of theZPA. Cell 75, 1401-1416. Saarikoski, J. and Kaila, K. (1992) Simuhaneous measurement of intracellular and extracellular carbonic anhydrase activity in intact muscle fibres. Pflugers Arch. 421, 357-363. Sandell, J.H., Martin, S.C. and Heinrich, G. (1994a) The development of GABA immunoreactivity in the retina of the zebrafish (Brachydanio rerio). J. Comp. Neurol. 345, 596-601.

PAGE 97

87 Sandell, J.H., Martin, S.C. and Heinrich, G. (1994b) The development of neurotrophin receptor Trk immunoreactivity in the retina of the zebrafish (Brachydanio rerio). Brain Res. Dev. Brain Res. 81, 192-200. Sambrook J., E.F. Fritsch, T. Maniatis (1989) Molecular cloning: a laboratory manual . 2"^ Ed. Cold Spring Harbor laboratory Press. Cold Spring Harbor, NY. Sax, CM., Cvekl, A. and Piatigorsky, J. (1997) Transcriptional regulation of the mouse alpha Acrystallin gene: binding of USF to the -7/+5 region. Gene 185, 209-216. Schachner, M. and Martini, R. (1995) Glycans and the modulation of neural-recognition molecule function. Trends. Neurosci. 18, 183-191. Schagger, H. and von Jagow, G. (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166, 368-379. Schmitt, E.A. and Dowling, J.E. (1994) Early eye morphogenesis in the zebrafish, Brachydanio rerio. J. Comp. Neurol. 344, 532-542. Schmitt, E.A. and Dowling, J.E. (1996) Comparison of topogr^hical patterns of ganglion and photoreceptor cell differentiation in the retina of the zebrafish, Danio rerio. J. Comp. Neurol. 371, 222-234. Schreiber, J., Sock, E. and Wegner, M. (1997) The regulator of early gliogenesis glial cells missing is a transcription factor with a novel type of DNA-binding domain. Proc. Natl. Acad. Sci. U. S. A. 94, 4739-4744. Seki, G., Coppola, S., Yoshitomi, K., Burckhardt, B.C., Samarzija, I., Muller-Berger, S. and Fromter, E. (1996) On the mechanism of bicarbonate exit from renal proximal tubular cells. Kidney Int. 49, 1671-1677. Shapiro, L.H., Venta, P.J. and Tashian, R.E. (1987) Molecular analysis of G+C-rich upstream sequences regulating transcription of the human carbonic anhydrase II gene. Mol. Cell Biol. 7, 4589-4593. Shih, J. and Eraser, S.E. (1995) Distribution of tissue progenitors within the shield region of the zebrafish gastrula. Development 121, 2755-2765. Shih, J. and Eraser, S.E. (1996) Characterizing the zebrafish organizer: microsurgical analysis at the early-shield stage. Development 122, 13 13-1322. Silver, J. and Rutishauser, U. (1984) Guidance of optic axons in vivo by a preformed adhesive pathway on neuroepithelial endfeet. Dev. Biol. 106, 485-499. Silverman, D.N. (1982) Carbonic anhydrase: oxygen18 exchange catalyzed by an enzyme with ratecontributing proton-transfer steps. Methods Enzymol. 87, 732-752.

PAGE 98

88 Silverman, D.N. (1995) Proton transfer in carbonic anhydrase measured by equilibrium isotope exchange. Methods Enzymol. 249, 479-503. Singer, M., Nordlander, R.H. and Egar, M. (1979) Axonal guidance during embryogenesis and regeneration in the spinal cord of the newt: the blueprint hypothesis of neuronal pathway patterning. J. Comp. Neurol. 185, 1-21. Sly, W.S. and Hu, P.Y. (1995) Human carbonic anhydrases and carbonic anhydrase deficiencies. Amu. Rev. Biochem. 64, 375-401. Soula, C, Foulquier, F., Duprat, A.M. and Cochard, P. (1993) Lineage analysis of early neural plate cells: cells with purely neuronal fate coexist with bipotential neuroglial progenitors. Dev. Biol. 159, 196-207. Stankoff, B., Demerens, C, Goujet-Zalc, C, Monge, M., Peyron, F., Mikoshiba, K., Zalc, B. and Lubetzki, C. (1996) Transcription of myelin basic protein promoted by regulatory elements in the proximal 5' sequence requires myelinogenesis. Mult. Scler. 2, 125-132. Stitt, T.N., Gasser, U.E. and Hatten, M.E. (1991) Molecular mechanisms of glial-guided neuronal migration. Ann. N. Y. Acad. Sci. 633, 113-121. Stitt, T.N. and Hatten, M.E. (1990) Antibodies that recognize astrotactin block granule neuron binding to astroglia Neuron 5, 639-649. Streisinger, G., Walker, C, Dower, N., Knauber, D. and Singer, F. (1981) Production of clones of homozygous diploid zebra fish (Brachydanio rerio). Nature 291, 293-296. Stuart, G.W., McMurray, J.V. and Westerfield, M. (1988) Replication, integration and stable germ-line transmission of foreign sequences injected into early zebrafish embryos. Development 103,403-412. Talbot, D., Collis, P., Antoniou, M., Vidal, M., Grosveld, F. and Greaves, D.R. (1989) A dominant control region from the human beta-globin locus conferring integration site-independent gene expression. Nature 338, 352-355. Tashian, R.E., Hewett-Emmett, D. and Goodman, M. (1983) On the evolution and genetics of carbonic anhydrases I, II, and III. Isozymes. Curr. Top. Biol. Med. Res. 7, 79-100. Tashian, R.E., Venta, P. J., Nicewander, P.H. and Hewett-Emmett, D. (1990) Evolution, structure, and expression of the carbonic anhydrase muhigene family. Prog. Clin. Biol. Res. 344, 159-175. Tolbert, L.P. and Oland, L.A. (1990) Glial cells form boundaries for developing insect olfactory glomeruli. Neurol. 109, 19-28. Tomarev, S.I., Callaerts, P., Kos, L., Zinovieva, R., Haider, G., Gehring, W. and Piatigorsky, J. (1997) Squid Pax-6 and eye development [see comments]. Proc. Natl. Acad. Sci. U. S. A. 94, 2421-2426.

PAGE 99

Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U. S. A. 76, 4350-4354. Townes, T.M., Lingrel, J.B., Chen, H.Y., Brinster, R.L. and Palmiter, R.D. (1985) Erythroidspecific expression of human beta-globin genes in transgenic mice. EMBOJ. 4, 1715-1723. Turner, D.L., Snyder, E.Y. and Cepko, C.L. (1990) Lineage-independent determination of cell type in the embryonic mouse retina Neuron 4, 833-845. Turner, D.L. and Cepko, C.L. (1987) A common progenitor for neurons and glia persists in rat retina late in development. Nature 328, 131-136. Udolph, G., Prokop, A., Bossing, T. and Technau, G.M. (1993) A common precursor for glia and neurons in the embryonic CNS of Drosophila gives rise to segment-specific lineage variants. Development 118, 765-775. Uusitalo, M. and Kivela, T. (1994) Differential distribution of the HNK-1 carbohydrate epitope in the vertebrate retina. Curr. Eye Res. 13, 697-704. Venta, P.J., Montgomery, J.C., Wiebauer, K., Hewett-Emmett, D. and Tashian, R.E. (1984) Organization of the mouse and human carbonic anhydrase II genes. Ann. N. Y. Acad. Sci. 429, 309-323. Verderber, L., Johnson, W., Mucke, L., Sarthy, V. (1985) Differential regulation of a glial fibrilliary acidic protein LacZ transgene in retinal astrocytes and Muller cells. Inves. Oph. & Vis. Sci. 36, 1137-1143. Wang, A.M., and Mark, D. (1990) Quantitative PCR. PCR protocols: A guide to methods and applications. Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (eds) Academic Press, San Diego, CA pp 70-75. Westerfield, M. (1995) The Zebrafish Book. A guide for the laboratory use of zebrafish (Brachydanio rerio). University of Oregon Press, Eugene Wetts, R., Serbedzija, G.N. and Eraser, S.E. (1989) Cell lineage analysis reveals multipotent precursors in the ciliary margin of the frog retina. Dev. Biol. 136, 254-263. Wetts, R. and Eraser, S.E. (1988) Multipotent precursors can give rise to all major cell types of the frog retina Science 239, 1 142-1 145. Wichterle, H., GarciaVerdugo, J.M. and Alvarez-Buylla A. (1997) Direct evidence for homotypic, glia-independent neuronal migration. Neuron 18, 779-791. Wijgerde, M., Grosveld, F. and Eraser, P. (1995) Transcription complex stability and chromatin dynamics in vivo. Nature 377, 209-213.

PAGE 100

90 Wistrand, P.J. and Knuuttila, K.G. (1989) Renal membrane-bound carbonic anhydrase. Purification and properties. Kidney Int. 35, 851-859. Wray, W., Boulikas, T., Wray, V.P. and Hancock, R. (1981) Silver staining of proteins in polyacrylamide gels. /l«a/. Biochem. 118, 197-203. Wride, M.A. (1996) Cellular and molecular features of lens differentiation: a review of recent advances. Differentiation. 61, 77-93. Yin, X., Watanabe, M. and Rutishauser, U. (1995) Effect of polysialic acid on the behavior of retinal ganglion cell axons during growth into the optic tract and tectum. Development 121, 34393446. Yoshihara, CM., Lee, J.D. and Dodgson, J.B. (1987) The chicken carbonic anhydrase II gene: evidence for a recent shift in intron position. Nucleic. Acids. Res. 15, 753-770. Yuh, C.H., Moore, J.G. and Davidson, E.H. (1996) Quantitative functional interrelations within the c«-regulatory system of the S. purpuratus Endol6 gene. Development 122, 4045-4056. Yuh, C.H. and Davidson, E.H. (1996) Modular cw-regulatory organization of Endo 16, a gutspecific gene of the sea urchin embryo. Development 122, 1069-1082. Zheng, C, Heintz, N. and Hatten, M.E. (1996) CNS gene encoding astrotactin, which supports neuronal migration along glial fibers. Science 272, 417-419. Zheng, M.H., Fan, Y., Wysocki, S., Wood, D.J. and Papadimitriou, J.M. (1994) Carbonic anhydrase II gene transcript in cultured osteoclasts from neonatal rats: effect of calcitonin. Cell Tissue Res. 276, 7-13. Zhu, X.L. and Sly, W.S. (1990) Carbonic anhydrase IV from human lung. Purification, characterization, and comparison with membrane carbonic anhydrase from human kidney. J. Biol. Chem. 265, 8795-8801. Zolotukhin, S., Potter, M., Hauswirth, W.W., Guy, J., Muzyczka, N. (1996) A "humanized" green fluorescent protein cDNA ad^ted for high-level expression in mammalian cells. J Virol 70, 46464654

PAGE 101

91 BIOGRAPHICAL SKETCH Robert E. Peterson was brought into this world on December 9, 1970 in Clearfield Pennsylvania, just a couple miles away from the Irvona Rod & Gun Club Hunting Camp. His parents, William Earl Peterson and Jane Eleanor Peterson raised him well, teaching hi m imortant lessons like being kind to others, shutting off lights when you leave a room, and opening doors for strangers. The remainder of Mr. Peterson' s family consisted of his older brother, William Haller, and his older sister, Candace Denise. Mr. Peterson resided in Irvona, Pennsylvania from the time of his birth until he left for college in 1988. In 1988 Mr. Peterson went away to college at Millersville University as an Economics major. After one semester he transferred to Clarion University to pursue his football career. After two years, four broken foot bones, and two economics classes, Mr. Peterson realized that perhaps Biology and not football or Economics was his true calling. Dr. Roger McPherson took Mr. PEterson on as a technician, a research assistant and as an advisee. Through his guidance, Mr. Peterson attended a summer internship in The Whitney Laboratory' s "Research Experience for Undergraduates". This experience shaped his decision to become a research scientist. Shortly after his return to Clarion University, Mr. Peterson applied for and was accepted to the graduate program at The University of Florida' s Department of Anatomy & Cell Biology, working with Dr. Paul J. Linser at The Whitney Laboratory. During his stay at The Whitney Laboratory, Mr. Peterson has come to embrace science as his career, surfing as his pastime, the marsh as his fiiend. The Lodge as his home, and Lucky LaRoux as his boon companion.

PAGE 102

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and Quality, as a dissertation for the degree of Doctor of Philosophy. \ William AHHauswirth Eminent Scholar of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. W. Clay Si/iith Assistant -scientist of Ophthalmology This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. May 1998 Dean, College of Medi^he Dean, Graduate School

PAGE 103

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quaUty, as a dissertation for the degree of Doctor of Philosophy. Paul J. Linser, Chair Associate Professor of Anatomy & Cell Biology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. William A. Dunn Associate Professor of Anatomy & Cell Biology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Paul Hargrave Eminent Scholar of Ophthalmology