Citation
Immune reaction following intoxication with Clostridium perfringens type A enterotoxin

Material Information

Title:
Immune reaction following intoxication with Clostridium perfringens type A enterotoxin
Creator:
Wallace, F. Morgan
Publication Date:
Language:
English
Physical Description:
x, 98 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Bile ( jstor )
Bile acids ( jstor )
Clostridium perfringens ( jstor )
Cytokines ( jstor )
Diseases ( jstor )
Enterotoxins ( jstor )
Mice ( jstor )
Sudden infant death syndrome ( jstor )
Superantigens ( jstor )
Toxins ( jstor )
Clostridium diseases ( lcsh )
Clostridium perfringens -- Toxicology ( lcsh )
Dissertations, Academic -- Food Science and Human Nutrition -- UF ( lcsh )
Food Science and Human Nutrition thesis, Ph.D ( lcsh )
Immunotoxicology ( lcsh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1999.
Bibliography:
Includes bibliographical references (leaves 85-97).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by F. Morgan Wallace.

Record Information

Source Institution:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
030368006 ( ALEPH )
42673435 ( OCLC )

Downloads

This item has the following downloads:


Full Text










IMMUNE REACTION FOLLOWING INTOXICATION WITH CLOSTRIDIUM
PERFRINGENS TYPE A ENTEROTOXIN














By

F. MORGAN WALLACE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1999

























This dissertation is dedicated to my supportive wife, Joy, my wonderful new son, Christopher, and to my parents, especially my mother who read to me when I was a child.














ACKNOWLEDGMENTS

I would like to acknowledge all the people who provided help, advice, and encouragement during this long and difficult process but that is not possible as to do so would take many, many pages. This is thus not anywhere near a complete list of the people to whom I owe so much. In particular I would thank Dr. James Lindsay for his unswerving loyalty and support. It has been a privilege working for him and his guidance has given me the confidence that I can head a productive research lab soon myself I would also like to thank Annette Mach for her help and feedback regarding all aspects of my work, especially for teaching me everything I know about tissue culture. She is a better lab manager than she will ever get credit for. I am also indebted to Dr. Lindsay's other graduate students during my time in his lab, especially Lisa Wojciechowski and Andreas Keller for their camaraderie and friendship. The members of my committee, Dr. Douglas Archer, Dr. Edward HotTffmann, Dr. Mark Tamplin, and Dr. Sean O'Keefe, have my sincerest gratitude. Of particular help were discussions with Dusty Penn about mice, Tcell receptors and MHC, and with Drs. Barbara Torres and Howard Johnson regarding superantigens. Finally, I would like to thank Walter Jones for his invaluable assistance with graphics.















TABLE OF CONTENTS
page


A C K N O W L E D G M E N T S .............................................................................................. iii

L IS T O F T A B L E S ........................................................................................................ v ii

L IST O F FIG U R E S ....................... ................................................. ............................. viii

A B S T R A C T ..... ......................................................... ............................... ........... . . ....... ix

IN TRO D U CTIO N ................................................................................. 1.........................

REVIEW OF THE LITERATURE ....................................................... .............4

The Genus Clostrilium ............. ....... ................................... 4
C lostridium perfringens ................. . .............................................. ...... 5
Isolation and Sporulation in the Laboratory .............................................. ...............7
C. perfringens Enterotoxin (CPE)..........................................................................7
C. perfringens in Food-borne Illness .................... ............... 8
Prevention of C. perfringens Food-borne Illness ............................................ 10
Genetics of CPE Expression...................... ................. 10
Sym ptom s of CPE Intoxication ............................................................................. 12
H um an Feeding Studies ..................................................................................... 13
M echanism s of Action of CPE ............................................................. ............... 13
Support for the Use of the Mouse Model. .............. ............... 15
V accine Possibilities ......................................................................................... 15
A ntigens and Superantigens .................................................................................. 16
CPE as a Superantigen ............................................................................... 18
Cytokines and the Inflammatory Immune Response ................................................ 18
C. perfringens and the Sudden Infant Death Syndrome ........................................ 21


AN INVESTIGATION OF THE PROPERTIES OF CLOSTRIDIUM
PERFRINGENS TYPE-A ENTEROTOXIN USING D-GALACTOSAMINE
A N D C Y C L O SP O R IN -A ........................................................................................ 24

In tro d u c tio n ............................................................... ........................................... 2 4
M aterials and M ethods....................... .............................................. .................. 26








R eagents ....... .. .......................................................................... . . . ...... 26
M ic e ........................................................................................ ...................... 2 6
Toxin Administration and Lethal Dose .............................. 27
Results ..................................................................................................... ............... 28
D iscussion ............. ................................................................ . . . . . . ..... 29

SERUM CYTOKINE LEVELS IN SWISS WEBSTER MICE EXPOSED IP
AND IG TO CPE AND IN VITRO CYTOKINE PRODUCTION OF A
MACROPHAGE CELL LINE EXPOSED TO CPE .............................. ...............36

Introduction.............. ................................................................... . . . . ...... 36
M aterials and M ethods ......................................................................................... 37
Reagents. ............ ........................................... 37
T issu e C u ltu re ............................. ................................................. ............... 3 7
Measurement of Cytokine Levels in vitro ........... ................38
M ic e ................................................................... .............................................. 3 8
Toxin A dm inistration ........................................................................ .............. 38
Blood Collection and Serum Isolation ...................... ................. 39
In vivo Cytokine Determ ination .......................................................... ............. 39
R esults................ ........................ ............................... 39
Cytokine levels in vitro ....... ............................................................................ 39
C ytokine levels in vivo ...... ............................................ ...... ............. 50
Discussion ............................................................... 50


ORGAN SPECIFIC TIME COURSE OF CYTOKINE MESSENGER RNA
RESPONSE FOLLOWING CLOSTRIDIUMPERFRINGENS TYPE A
EN TEROTO XIN IN TO X ICATIO N ....................................................................... 54
In tro d u c tio n ......................... ....................................... ..................................... 5 4
M aterials and M ethods .................................................................................. 54
Reagents ............................................... ............... 54
M ice ................................................................. 55
Toxin Administration .............. ................................ 55
Necropsy and Organ Harvesting. ....... ..................... 55
R N A Isolation .................. .......................................................... . 56
Reverse Transcription ............ ....................... 57
P C R R e a c tio n s ..................... .................................................. .......................... 5 7
Gel Electrophoresis. ........................... ...... ... 58
Visualization of PCR Products ........................ ................. 59
R e su lts . ................. ......... ... ... ........................ ................. ................. .................. 5 9
D isc u ssio n ........... ................. .......... ............. . .............................................. ...... 6 0

FECAL BILE ACIDS, NEOPTERIN, CLOSTRIDIUMPERFRINGENS AND
THE SUDDEN INFANT DEATH SYNDROME ................................ ..............70









Introduction .................. ..................... 70
M aterials and M ethods ........................................................................................... 72
Fecal and Urine Samples .......................................72
M icro b io lo g y .................................................................................................... 7 2
Enterotoxin Q uantitation ..................................................................................73
B ile A cid A n aly sis ............................................................................................ 73
Neopterin Analysis ............................................. 75
Results................................ ................................. 76
D iscussion .............................................................................................................. 78

CO N CLU SION S. .......... ........................................................................................ 81

R E F E R E N C E S ....................... ...................................................... ................................ 8 5

BIOGRAPHICAL SKETCH .................. ......................................................... 98














LIST OF TABLES


Table page 2.1 Typing of C. perfringens by toxins produced ..... ........... .. ................... 6

2.2 Sources and effects of the major proinflammatory cytokines................................ 23

3.1 Effect of D-galactosamine (D-gal) on CPE sensitivity for Swiss Webster mice........27

3.2 Effect of Cyclosporin A (CyA) on CPE sensitivity for Swiss Webster mice.............28

3.3 Effect ofD-galactosamine (D-gal) on CPE sensitivity for BALB/c mice..............29

3.4 Effect of Cyclosporin A (CyA) on CPE sensitivity for BALB/c mice......................30

5.1 C ytokine prim ers used for PC R ............. ..................... ................. .................... 6 1














LIST OF FIGURES


Figure page 3.1 Determination of Mouse Lethal Dose (MLD) for CPE Administered IP ..................30

3.2 Determination of Mouse Lethal Dose (MLD) for CPE Administered IG................. 31

4.1 Serum levels of IL-lc a following IP administration of CPE.. .... ................ 40

4.2 Serum levels of IL-2 following IP administration of CPE.................................... 41

4.3 Serum levels of IL-6 following IP administration of CPE ........................................ 42

4.4 Serum levels of IFN-;y following IP administration of CPE.................................. 43

4.5 Serum levels of TNF-ct following IP administration of CPE............... ...............44

4.6 Serum levels of IL-loa following IG administration of CPE ................................. 45

4.7 Serum levels of IL-2 following IG administration of CPE .......................................46

4.8 Serum levels of IL-6 following IG administration of CPE ....................................47

4.9 Serum levels of IFN-y following IG administration of CPE............... ................... 48

4.10 Serum levels of TNF-a following IG administration of CPE........................... 49

5.1 IL -l a m R N A evaluatio n ..................................... ............................... .............. 62

5.2 IL-2 m RN A evaluation ..................... ............................................ ......... . 63

5.3 IL -6 m R N A evaluation ............................................ ............................................ 64

5.4 IFN-y mRNA evaluation............. ............................. 65

viii









5.5 TNF-a m RN A evaluation ................................................................................... 66

5.6 RT-PCR evaluation of liver transcription .............................. 67

6.1 Chromatograms for (A) Standards (B) Representative fecal sample.................. 77

6.2 Total fecal bile acid levels .................................................................................... 77













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
IMMUNE REACTIONS FOLLOWING INTOXICATION WITH CLOSTRIDIUM PERFRINGENS TYPE ENTEROTOXIN

By

F. Morgan Wallace

May 1999
Chairman: James A. Lindsay
Major Department: Food Science and Human Nutrition
Many bacterial toxins have been found to interact with the immune system in a variety of ways. Some of these effects prove to be damaging to those exposed to these products. The bacterial pathogen Clostridium perfringens is the third leading cause of foodborne illness in the United States. The agent directly responsible for this illness is the Clostridiumn perfringens type A enterotoxin (CPE) which causes a profuse diarrheal illness frequently with symptoms of nausea that are usually self-limiting. Another illness which can be caused by this organism is the infectious diarrhea syndrome most often seen in institutionalized patients such as those in nursing homes. This illness is more protracted than the normal food poisoning and as it frequently strikes the debilitated (ill and/or elderly), it can cause death. It has been generally accepted that the ability of this toxin to cause pore formation in susceptible cells is the mechanism by which diarrhea and other effects of this toxin are caused; however, some bacterial toxins produce similar symptoms by interacting with the immune system. This research determined the effect of CPE upon the immune system using mice as a model system. Following administration of CPE there was a demonstrable interaction with the immune system which could be responsible for some of the symptoms in those affected by this toxin.

x














CHAPTER 1
INTRODUCTION

Clostridium perfriiigens type A enterotoxin (CPE) is the causative agent of the third most common cause of food-borne illness (FBI) in the United States, causing greater than 12% of reported cases of FBI. Symptoms of this FBI include a profuse diarrhea which, in severe cases, can be explosive, severe abdominal pain, and nausea. This illness is responsible for much suffering and an estimated economic cost of greater than $200 million in the USA and Canada. Studies have also implicated CPE in many cases of the Sudden Infant Death Syndrome (SIDS). Of the approximately 5,000 cases of SIDS in the USA per year, 50-80% are associated with high levels of CPE and C. peifringens spores in the bowel (Lindsay, 1996). Though a cause and effect relationship has not been conclusively proven, the finding of evidence of an immune activation in many cases of SIDS makes this a compelling hypothesis (Vege et al., 1995). Recent research (Bowness et al., 1992) indicated that CPE was a superantigen. Though this subsequently proved incorrect (Krakauer et al., 1997; Wallace et al., 1999), it did lead to additional investigation into the interaction of the immune system and CPE. Further research demonstrated a marked activation of the immune system in a murine model of CPE enteric illness, and suggests several additional avenues of research that may provide further insights into the nature of the FBI associated with CPE, as well as the ultimate causes of SIDS.










The responses of the immune system following exposure to bacterial products have been the subject of much recent research. The reason for this interest is that researchers are now coming to recognize a connection between the immune response and pathology associated with bacterial toxins. In light of this realization, the immune response to CPE was characterized in the mouse model and areas for further research were delineated. Also an investigation into some relevant aspects of SIDS was conducted evaluating whether altered fecal bile acid levels played a role in SIDS and whether neopterin, a product of activated macrophages, was present in increased amounts in SIDS victims. The specific objectives of this study were as follows:

1. To determine whether CPE was, as reported, a superantigen.

2. To determine the in vitro cytokine response of a macrophage cell line

following exposure to CPE.

3. To evaluate the serum cytokine response following intraperitoneal

administration of sublethal quantities of CPE in the mouse model of

human illness.

4. To evaluate the serum cytokine response following intragastric

administration of sublethal quantities of CPE in the mouse model of human illness, which would more closely resemble the human illness,

caused by CPE.

5. Following intragastric administration of sublethal quantities of CPE: to

determine the organs which are transcriptionally active in producing mRNA coding for cytokines, to determine the time course of this








3
response, and to compare this response with the serum cytokine response

in order to gain insight into the regulation of these responses.

6. To determine whether CPE is associated with altered levels of fecal bile

acids in SIDS victims.

7. To determine whether neopterin, a product of activated macrophages, is

present in higher levels in SIDS victims than it is in control infants in a

small preliminary study.

8. To determine new areas of research which will prove helpful in the

understanding of CPE intoxication.



The results of this work provide new insights into the response of the host following CPE intoxication. They also demonstrate similarities and differences between the responses observed and that seen following exposure to bacterial endotoxin (LPS) or the staphylococcal enterotoxins. The findings also suggest new avenues of research which will be helpful in further establishing the mechanism of pathogenicity of CPE.














CHAPTER 2
REVIEW OF THE LITERATURE


The Genus Clostridium

The clostridia are a diverse group of bacteria which are all anaerobic, rodshaped and Gram positive. The oxygen tolerance of the organisms varies widely, with some being highly sensitive while others are able to grow on the surface of agar medium incubated aerobically. Morphology of these organisms ranges from short coccoid rods to long filamentous rods. Most are motile with peritrichous flagella. Members of this Genus are ubiquitous with species being found in soil, fresh water, and ocean sediments frequently in the spore state. Though some species are thermophiles or psychrophiles, the vast majority of species are mesophiles. The 1984 Bergey's Manual of Systemic Bacteriology provides detailed comprehensive descriptions of 85 species of clostridia, of which only a handful are pathogenic to humans (Holt, 1984). Despite the relatively few pathogenic species, there is a great diversity of pathology caused by clostridia. The Manual of Clinical Microbiology (Onderdonk and Allen, 1995) describes three categories of disease produced by clostridia. First, are the noninvasive diseases in which toxins cause pathology. Second, are the invasive diseases in which tissue is damaged by an infectious process. Third, are the purulent diseases, which are caused by a mixed population of bacteria including clostridia growing in a closed space, usually the peritoneum.








5
Clostriditmni perfringens


Clostridium peifringens is a sporeforming, Gram positive obligately anaerobic aerotolerant bacterium that causes considerable morbidity and mortality both in humans and in veterinary populations. This bacterium occurs singly or in pairs with large variations in cell dimensions and morphology. C. perfringens is encapsulated, nonmotile, and capable of producing a wide array of protein exotoxins responsible for its pathogenesis. C. perfritigeis is believed to be the most common cause of bacterial illness in domestic livestock, causing disease in chickens, cows, and sheep, among others (Songer, 1996). It is grouped into five types (A-E) based on the classic classification scheme of Hobbs (see table 1.1) (Rood and Cole, 1991; Songer, 1996). This typing system uses the production of four toxins (at least 13 are produced) as its basis. All five types were thought to produce the alpha toxin, which is also a phospholipase C, however this now appears not to be the case as strains of C petfringens which do not produce this protein have been isolated (Lindsay, 1996). Typing of C. perfringens is performed with type-specific antisera. This procedure has been found to be 82% effective in determining a strain type (Murrell, 1989). Debate now exists as to whether this typing scheme should be revised taking into account the new molecular information and typing techniques developed regarding this organism (Lindsay, 1996). For those strains which defy typing by antisera, determination of bacteriocin sensitivity is an alternative method of evaluating strain type. In this procedure, blood agar media is plated with the strain to be typed. Bacteriocin is then added and zones of inhibition are then evaluated (Mahony et al., 1992). Another method to type C. perfringens is the evaluation of capsular








polysaccharide using instrumental techniques. This method as been suggested as a useful rapid technique for the evaluation of food-borne illness-producing isolates (Murrell, 1989).

Type A strains produce the appropriately named C perfringens type A enterotoxin (CPE), which is responsible for a self-limiting diarrheal illness in man. CPE is also likely involved in the pathogenesis of two other illnesses. One form, which appears in malnourished infants and is characterized by colonization and invasion of intestinal tissue, produces a severe and sometimes deadly ulceration of the small intestinal mucosa. The other illness characterized by colonization with C. perfringens type A is the so-called infectious diarrhea syndrome in which usually elderly, institutionalized patients sustain a protracted colonization with C. perfringens leading to a diarrhea of long term duration for which antibiotic therapy is warranted (Larson and Borriello, 1988).





Table 2.1 Typing of C perfringens by toxins produced (from Rood and Cole,

1991).

Toxin produced
C. perfringens 3 t >
type
A +++ - -
B + ++ + - + C + ++ - - +
D + - ++
E + - - + -








7
Isolation and Sporulation in the Laboratory

Solid media for isolating C. perfringens is both selective and differential. Selectivity is conferred by the addition of antibiotics to which this organism is particularly resistant. Trypticase Sulfite Neomycin Agar (TSN), one of the most widely used isolation media, contains neomycin sulfate and polymyxin sulfate as selective agents. Differential ability is conferred by ferrous citrate and sulfites; during growth of C. perfringens sulfite is reduced and precipitates as iron sulfide, producing black colonies. Other media rely on the ability of the vast majority of strains of C. perfringens to produce phospholipase which give zones of hydrolysis in lecithin containing media.

In vitro sporulation is strain dependent with some strains sporulating abundantly and others proving difficult to induce to sporulate (Labbe, 1989). The most common media used to induce sporulation is the media of Duncan and Strong (Duncan and Strong, 1968). This liquid media consists of 0.4% yeast extract, 1.5% proteose peptone, 0.4% soluble starch, 0.1% sodium thioglycolate, and 1.0% sodium phosphate. Strains which prove difficult to induce to sporulate are sometimes assisted in this activity by the addition of raffinose or methylxanthines which may influence nucleic acid metabolism (Labbe, 1989).



C. perfringens Enterotoxin (CPE)


CPE is a 35 kD monomeric acidic protein (pl=4.3). It is considered a sporulation associated protein in that synthesis is upregulated during sporulation. It is also produced in small amounts under some vegetative growth conditions (Goldner et al., 1986; Rood










and Cole, 1991). In vitro experiments have shown that CPE acts by compromising the integrity of the cell membrane, disrupting electrolyte gradients and eventually leading to disruption of macromolecular synthesis (McClane, 1994). In vivo studies with animal models have shown fluid and electrolyte loss into the lumen of the small bowel following introduction of CPE into ileal loops (McClane, 1996; Lindsay, 1996). The toxin is most active in the ileum (the last portion of the small bowel), with lower activity in the jejunum and duodenum, and with no apparent activity in the colon likely due to its receptor mediated mode of action. These experiments also demonstrated histopathology of the small intestine manifested as a desquamation of the villous enterocytes. This is in contrast to other bacterial enterotoxins, exemplified by cholera toxin, that cause secretory diarrhea with no histopathological damage.



C. perfrmgens in Food-borne Illness

Though food-borne illness (FBI) presumptively caused by C. perfringens and its associated enterotoxin had been described in the 19' century (Klein, 1895), it was not until the 1940s that a definitive association was made between C. perfringens and this FBI (McClung, 1945). Since then, it has been recognized as the third most common cause of FBI in the USA. It is important to note that though we refer to C. perfringens food-borne illness as an intoxication, in the strictest sense it is not. In contrast to other intoxications in which preformed toxin is ingested, CPE toxicosis is the direct result of the consumption of >107 vegetative cells which, upon encountering the harsh environment of the gastrointestinal tract, are induced to sporulate. The sporulation process may be accompanied by the production of large amounts of CPE. This










enterotoxin is active in the small bowel and symptoms develop 8-24 hours after the consumption of contaminated food. The illness usually resolves spontaneously within 12-24 hours.

C. perfringens has a number of characteristics which contribute to its importance as a food-poisoning organism. Although classified as an anaerobe, C. perfringens exhibits a tolerance to elevated oxygen levels that is not seen with many other anaerobic bacteria. The relative aerotolerance allows growth in foods such as raw ground beef which has a relatively high oxidation/reduction potential (Eh). Spores of C. perfringens are ubiquitous, being found in virtually all soils examined. Vegetative cells of C. perfringens are also frequently found at low levels in the intestinal tract of many healthy animals including humans (Collee, 1974). As a consequence of its widespread presence, approximately 50% of raw and frozen meat products have been found to be contaminated with this organism (Labbe, 1989). Though C. peifringens may be frequently isolated from the intestinal tract of fish, seafood products are rarely involved in food poisoning. A major characteristic of C. peifringens that contributes to its prevalence as an agent of food-borne disease is its extraordinarily rapid doubling time (McClane, 1996). Under ideal laboratory conditions, C. perfringens can exhibit a generation time as rapid as seven minutes. This short generation time is likely a factor in making CPE food-borne illness so common.



Prevention of C. perfringens Food-borne Disease

The widespread distribution of C. perfringens spores and their resistance to destruction likely make it impossible to eliminate them from the food supply. Meat and








10

poultry products are the most common vehicles for this FBI because of the incidence of C. perfringens in such foods and its nutritional requirements (Labbe, 1989). It has been reported that improper cooling procedures or holding temperatures are responsible for 97% of reported FBI caused by this organism (McClane, 1996). To reduce the incidence of C. perfringens associated FBI, foods should be kept at temperatures not conducive to growth, either through storage at temperatures above 600C or below 150C following preparation. Especially important is not allowing foods to remain at C. perfringens' ideal growth temperature of 43-470C. pH can also play a role in the prevention of C. perfringens growth. The pH range for growth of this organism is 5.0-8.3 but optimum growth occurs between 6.0 and 7.0.



Genetics of CPE Expression

CPE mRNA has an exceptionally long half-life of 58 minutes in sporulating cells (Labbe and Duncan, 1977). This is likely one reason for the very high expression of this protein during the sporulation process. The link of sporulation and CPE synthesis led to the hypothesis that CPE was a spore coat component (Frieben and Duncan, 1973). These workers used sporulation defective mutants of C. perfringens to study the production of CPE. Early stage spo0 sporulation mutants but not later stage spoV mutants proved defective in CPE production. Additional studies using immunolabeling and electron microscopy demonstrated that CPE was confined to the cytoplasm (Walker et al., 1975). Because of this work, the hypothesis that CPE was a structural component of the spore proved incorrect.








11
The complete CPE gene has been cloned and sequenced (Czeczulin et al., 1993) allowing much more detailed studies of the regulation of synthesis and genomic organization. The CPE mRNA has been determined to be transcribed as a monocistronic message with the origin of transcription located approximately 200 base pairs (BP) upstream of the CPE translation start site (Melville et al., 1997). The Escherichia coli transformant containing cpe was found to express low levels of CPE (apparently driven by a C. perfringens promoter) in amounts comparable to nonsporulating cultures of C. perfringens. Sporulating cultures of C. peifringens were found to produce vastly greater quantities of enterotoxin, suggesting that sporulation is not essential for CPE synthesis but does induce high-level synthesis (Czeczulin et al., 1993). The CPE gene has been shown to be contained on a mobile element, a transposon or lysogenized phage, which at least theoretically allows transfer of cpe between C. pefriingens strains (Canard et al., 1992). The location on a mobile element likely explains the presence of cpe in both chromosomal and plasmid locations. Though the reason is not known, all food poisoning isolates examined have cpe integrated into the chromosome. Veterinary isolates, in contrast, frequently have a plasmid-borne cpe gene (Cornillot et al., 1995). The significance of the facts that cpe appears to be contained in a mobile element and that there are different locations for the gene in human and veterinary pathogenic strains is not clear. Some type C strains of C. perfringens have also been found to carry the cpe gene, without any evidence that they can cause FBI in humans (Lindsay, 1996). Further work examining the relationship between environmental, veterinary, and human associated strains will hopefully provide a more complete understanding of the source of food-borne disease-causing strains of C. peifringens. Also of interest is the finding that some C.








12
perfringens type E strains possess a silent form of the cpe gene. Whether this gene is an ancestral prototype of cpe or is the result of a later insertional event made possible by the presence of cpe on a mobile genetic element is the subject of much debate (Lindsay, 1996). This finding is especially interesting in light of the recent discoveries of other silent toxin genes in other species of clostridia (Lindsay, 1996). The relationship between silent clostridial genes, mobile genetic elements, and pathogenesis is a subject awaiting further research.



Symptoms of CPE Intoxication

Symptoms of the FBI associated with CPE include nausea, intestinal cramps, and a diarrhea which can range from mild to extreme (often described as explosive). Symptoms are apparent 8-24 hours after infection and usually spontaneously resolve within 24 hours of onset (Labbe, 1989). Fatalities are rare and those that occur are usually in the very young, elderly, or immunocompromised. C. perfrinigens type A and CPE have also been implicated in a more aggressive diarrheal illness resulting from a more persistent colonization and overgrowth of the bowel than that which occurs in the typical FBI. This illness most frequently occurs in the elderly, often in long term care facilities such as nursing homes, and often following antibiotic therapy. It has a more protracted course than the FBI, lasting on average 11 days (Larson and Boriello, 1988). Blood in the stool may be evident along with severe abdominal pain. This disease is in some ways similar to that caused by C. difficile following antibiotic therapy.








13
Human Feeding Studies

In human volunteer feeding studies, sublethal levels of CPE administered intragastrically, produce symptoms typical of C. perfringens type A induced FBI (Skjelkvale and Uemura, 1977) including diarrhea and abdominal cramps with pain. These studies revealed that administration of 100 ng toxin / g body weight is sufficient to induce this response. Other studies revealed that 108 vegetative cells administered orally were required to induce illness in human volunteers (Duncan and Strong, 1969).



Mechanisms of Action of CPE

CPE disrupts the integrity of plasma membranes of susceptible cells and it is through this activity that this enterotoxin exerts its cytotoxic effects (McClane, 1994). Detailed studies of the biochemistry of this receptor-mediated phenomenon have been conducted in the laboratory of McClane. As pronase pretreatment of brush border membranes reduced binding of CPE, the receptor(s) is/are thought to be proteinacious (Wnek and McClane, 1986). A 50 kDa protein from rabbit brush border membrane was identified as the putative enterotoxin receptor (Wnek and McClane, 1986). A similar protein was found to bind CPE on Vero cells (African green monkey kidney cells) and it was further found that the CPE-receptor complex aggregates to form a 160 kDa complex. By simple subtraction (35 kDa CPE, 50 kDa receptor), it was concluded that the additional binding substance was an approximately 70 kDa protein (Wiekowski et al., 1994). Detailed models of CPE binding, insertion, and conformational changes of CPE and receptor have been proposed to account for the experimental results using cloned portions and mutated forms of the CPE molecule and various biochemical techniques








14
(McClane, 1996). It should, however, be noted that recently another team of researchers has cloned and sequenced a 22 kDa protein from Vero cells which appears to be the CPE receptor (Katahira et al., 1997). The results of their study satisfied most of a molecular version of Koch's postulates. First, cells expressing the receptor were sensitive to the cytotoxic effect of CPE while cells not expressing this protein were resistant to this effect. Second, the 22 kDa receptor was found to render resistant cells sensitive to the enterotoxin when expressed in them. The only remaining work which must be done to make their work complete is the inactivation of their receptor in a sensitive cell line and the demonstration that this line is no longer sensitive to the effects of CPE. Results also showed that CPE could not assemble into a complex unless it interacted with this receptor. The rigor of the work conducted by Katahira is impressive, however it contradicts the results of McClane. How the two groups' findings can be reconciled remains to be determined.

After binding and insertion, CPE directly induces cell membrane permeability changes (McDonel and McClane, 1979; McClane, 1994). Ion-generated membrane polarity is compromised by these changes leading to inhibition of DNA, RNA, and protein synthesis (Hulkower et al., 1989). It vivo these changes are thought to impair cellular metabolism and eventually lead to cell death. As sensitive cells in the small bowel epithelium (in particular villous enterocytes) die, histopathological alterations occur with associated fluid and electrolyte loss into the lumen of the bowel with resultant diarrhea.








15
Support for the Use of the Mouse Model

Mice are the most common animal species used to study infectious processes. The reasons for this are grounded in both pragmatism and good science. Pragmatically, mice are inexpensive to purchase and maintain. Of greater importance is that inbred mouse strains allow the use of many genetically identical mice reducing the diversity of responses to infectious agents and their toxins seen in normal populations. This makes results more reliable and reproducible. Also of major benefit to those studying immune system activities, the genetic regions associated with immune function in these mouse strains are well characterized. Studies involving CPE have been conducted in a wide range of animals including sheep, calves, monkeys, rabbits and mice (Weiss et al., 1966; Tsai and Reiman, 1975; Lindsay and Dennison, 1986). Mice were found to elicit similar responses to humans upon exposure to CPE (Tsai and Reiman, 1975; Lindsay and Dennison, 1986).



Vaccine Possibilities

Vaccination of animals to induce resistance to infection has proven very successful. Vaccine strains are typically multivalent, containing killed cells, inactivated toxins, or both (Songer, 1996). Though vaccination in animals to prevent illness caused by C. perfringens is common, it is doubtful that such a strategy will be feasible in humans. First, many veterinary illnesses caused by C. perfringens are fatal, particularly in young animals, and thus contribute to large economic losses. In humans, in contrast, the vast majority of those affected experience a spontaneous recovery with no apparent long term sequelae. Second, there appears to be no long term immunity conferred by








16
infection in humans after CPE food-borne disease, despite the fact that there is detectable antibody to CPE for several weeks following exposure (Skjelkvale and Uemura, 1977; Mietzner et al., 1992). This may make design of a vaccine for humans difficult.



Antigens and Superantigens

Normal antigens from extracellular sources are taken up by Antigen Presenting Cells (APCs) and are degraded intracellularly to polypeptide fragments which are then presented in the context of MHC Class-II to T-Cells whose T-Cell receptor (TCR). If the binding region of the TCR possesses the proper protein sequence to interact strongly with the presented antigen, events are induced which lead to activation of the T-cell. Superantigens, in contrast, bind directly to MHC class II without uptake and subsequent processing. In the context of MI-IC class II, these proteins bind noncovalently to the TCR. This interaction occurs outside the normal binding groove of the TCR in a region designated the V3 region (the variable region of the 03 chain of the TCR molecule). This interaction between MHC class II, superantigen, and TCR activates the T-cell to proliferate and produce cytokines just as a normal peptide antigen does. The difference between normal antigens and superantigens is the number of reacting cells. A normal peptide antigen can activate between 1 in 105 and I in 106 T-cells. Superantigens, on the other hand, can activate up to 1 in 4 T-cells. This is because of the limited number of V3 regions expressed by an individual. For example, there are approximately 25 different V3 regions in mice and approximately 60 in humans. As each superantigen normally binds to more than one V3 region it is obvious that a large fraction of the T-cell








17
population can become activated. Activating such a substantial number of T-cells can have extremely harmful effects. Normally when an individuals' immune system is challenged a balance is attained generating a vigorous immune response which will clear the invader but not one which is so great that harm to the organism results. In the short term, the signaling molecules of the immune system, the cytokines, can induce harm to the organism. Cytokines in excessive amounts have been implicated in a host of pathologic states including septic shock due to systemic exposure to endotoxin and the toxic shock syndrome from interaction with a staphylococcal exotoxin, toxic shock syndrome toxin-1 (TSST-1) (Miethke et al., 1993). In limited amounts these protein mediators perform valuable functions. They serve as chemotaxins, movement inhibitory factors, and activation signals for the mobile phagocytic cells of the immune system (Thomson, 1998; Mire-Sluis and Thorpe, 1998). They also induce maturation of cells leading to specific humoral immunity to invading pathogens (Thomson, 1998; Mire-Sluis and Thorpe, 1998). As such they are indispensable for healthy immune function (Thomson, 1998; Mire-Sluis and Thorpe, 1998). The D-galactosamine (D-gal) sensitized mouse model is frequently used to study the harmful (lethal) effects of an overproduction of cytokines (Meithke et al., 1993; Freudenberg et al., 1986). This system is used because mice are normally much more resistant to the effects of bacterial products than man. D-gal sensitization engenders a response in mice which renders them approximately as sensitive as man to the effects of these toxic substances.








18
CPE as a Superantigen

Recent work suggested that CPE was a superantigen selectively expanding the population of T-Cells bearing the TCR V3s 6.9 and 22 greatly and V3s 24, 21, 18, 5, and 6.1-6.5 to a lesser extent (Bowness et al., 1992). These results were exciting as they suggested that much of the observed pathology could be caused by mechanisms similar to those of the staphylococcal and streptococcal superantigenic enterotoxins. Though the work concluding that CPE was a superantigen proved incorrect (Krakauer et al., 1997; Wallace et al., 1999), it is possible that another contaminating protein produced by C perfringens is in fact a superantigen. To date no work has been conducted to test this hypothesis.



Cytokines and the Inflammatory Immune Response

Host proteins, specifically cytokines, control the functions that lead to non-specific host defenses and specific immunity following challenge by foreign substances. Recent research has examined the role of cytokines in the observed host response to bacterial toxins. As this work has progressed, it has become clear that many of these bacterial products which were originally studied to elucidate their cytopathic effects possess the ability to modulate the host defense systems. It is now recognized that this interaction, through the generation of pro- and anti-inflammatory cytokines, is frequently as important as their direct effects in the induction of host pathology. Bacteria and their toxins trigger the synthesis and release of cytokines, which can act in autocrine, paracrine, or endocrine fashion leading to the generation of an immune response. Once initiated, these responses can have deleterious as well as protective aspects. Besides








19
leading to clearance of infection and protection from future infection, there are negative aspects to these responses. Once initiated, the production of these potent mediators can generate a cascade of interactive cytokines; the host's response is amplified as cytokines induce synthesis of other cytokines. Taken to extreme, these responses elicit septic shock in response to Gram negative bacterial lipopolysaccharide or toxic shock in response to staphylococcal toxic shock syndrome toxin-1 (TSST-1), both of which can be lethal to the organism generating the response. Most times there is exposure to bacterial products these deleterious processes do not occur, as there are potent mechanisms for depressing cytokine networks as well. Examples of this regulatory pattern include: tumor necrosis factor-a (TNF) inducing susceptible cells to shed their TNF receptors and making these cells non-responsive to further stimulation by this cytokine, and interleukin-1 (IL-1) inducing synthesis of IL-1 receptor antagonist thus blocking the receptors for IL-1 and making susceptible cells anergic to the effects of additional IL-1 (Cavaillon, 1994). This is of critical importance, as the balance of positive and negative effector molecules appears critical in the outcome of the detrimental effects of inflammation such as shock. Several proinflammatory cytokines also act to induce anti-inflammatory cytokines thus regulating the intensity of the immune reaction.

The proinflammatory cytokines have been extensively studied in relation to their central role in the immune response to bacterial toxins and various infections: interferony (IFN-y), interleukins-1, -2, and -6 (IL-1, -2, -6), and TNF have been extensively studied (See Table 1 for a summary).

Briefly, IFN-y is produced by activated T-cells and NK cells and is one of the central components of the pro-inflammatory response. Known functions of this cytokine








20
include upregulation of MHC Class-II expression, and activation of macrophages. As is the case with many of the proinflammatory cytokines, IFN-y also induces antiinflammatory cytokines which serve to attenuate the immune response and limit selfinduced pathology.

IL-1 is a cytokine which is proving to be central in the outcome of infectious disease, particularly those of a bacterial nature. It is produced primarily by macrophages, monocytes, and Kipffer cells. Local effects of IL-1 are neutrophile chemotaxis and release of lipid-derived mediators. Systemic effects include fever, hypotension, induction of cytokine synthesis, and the induction of the acute phase response (Dinarello, 1992).

IL-2 is a product of activated T-cells only and is thus an excellent maker of T-cell function. The major function of IL-2 is the induction of a series of steps leading to the clonal expansion of antigen specific T-cells.

The principal cytokine stimulating the acute phase response during inflammation appears to be IL-6. It is produced primarily by macrophages and monocytes and also by cytokine stimulated epithelial and endothelial cells. This cytokine is of additional interest because of its role as an antagonist of TNF-ac. In some experimental models using the Dgal sensitized murine model of septic shock a protective role against TNF-a mediated mortality was shown for IL-6 (Barton and Jackson, 1993). This effect may be mediated through the acute phase proteins as turpentine (a known inducer of the acute phase response) pretreatment of D-gal sensitized mice offered protection from lethal shock. Though IL-6 is classified as a proinflammatory cytokine it is becoming increasingly clear that this cytokine serves an anti-inflammatory function as well.








21

TNF-a appears to be the central molecule inducing shock in the D-gal sensitized murine model of septic shock (Tracey and Cerami, 1993) satisfying a Koch's postulates test for a cause and effect relationship with this disease state. TNF is produced during septic shock, causes the syndrome when given to uninfected animals, and when neutralized in septic animals prevents pathology. TNF is the only cytokine so far determined to cause the entire spectrum of symptoms of septic shock including hemodynamic, metabolic, and pathological sequelae (Tracey and Cerami, 1993). Local effects of TNF during infection are of great benefit. Of particular importance is its role in the promotion of margination of leukocytes at the site of inflammation (Bemelmans et al., 1996).



C. perfrigens and the Sudden Infant Death Syndrome

The sudden infant death syndrome (SIDS) is defined as the "sudden death of an infant under one year of age that remains unexplained after a thorough case investigation, including performance of a complete autopsy, examination of the death scene and the review of the clinical history" by the National Institute of Child Health and Development (Willinger, 1989). It remains the leading cause of post-neonatal mortality in the United States despite recent large declines, from approximately 2/1000 live births a decade ago to approximately 1/1000 live births today (Scott et al., 1998). These declines are probably due to the campaign to encourage parents to avoid the prone sleeping position for their infants, which is a major risk factor for SIDS (Scott et al., 1998). Virtually every area which has been investigated in relation to SIDS has been found to have differences with control infants, whether in gross anatomy, neuroanatomy, biochemistry,








22
or microbiology. From this body of research it is beginning to appear likely that there are large numbers of abnormalities in SIDS infants and that many of them may combine to induce vulnerability in an infant. One of the most common features of SIDS infants is that >85% were ill in the two weeks prior to death and indeed findings on autopsy do provide some support for an infectious process occurring in SIDS (Krous, 1984; Beckwith, 1988). The Sudden Infant Death Syndrome has also been associated with C. perfringens and with CPE. 50-80% of SIDS victims and less than 10% of control infants have demonstrated elevated levels of C. peifringens spores and/or enterotoxin in their feces leading some to propose a role for CPE in this syndrome (Lindsay, 1996). This finding that the vast majority of SIDS infants have elevated levels of C. perfringens spores and CPE in their bowel is of interest and suggests that CPE may act as a final trigger in SIDS for an infant made vulnerable in a variety of ways (Wilkinson, 1991; Lindsay et al., 1993). IL-6 levels have been found to be elevated in the cerebrospinal fluid of SIDS infants which provides further support that there is an immune reaction occuring before death from SIDS (Vege et al., 1995). Agents which activate cells of the monocyte/macrophage lineage must be considered as inducers of this increased IL-6 level.
















Table 2.2 Sources and effects of the major proinflammatory cytokines.


Cytokine Major Source Effect IFN-y T-cells and NK cells -Antiviral and antiprotazoal activities
-Increased expression of MHC class II on macrophages and T-cells
-Activates macrophage tumoricidal activity
-Induces formation and release of TNF by macrophages
-Depending on environment either increases or decreases T suppressor cell activity IL-lx Monocytes, -Initiate acute phase reaction, fever induction
macrophages, -Through nitric oxide induces hypotension
Kipffer cells, glial -Induces nausea and vomiting
cells -Inhibits IL-6 production
IL-2 Activated T-helper -Clonal expansion of antigen specific T-cells
cells -Induces capillary leakage
IL-6 Monocytes, -Primary cytokine involved in acute phase induction
macrophages, -Induces proliferation of pluripotential hematopoietic
cytokine stimulated progenitor cells (in vitro)
endothelium and -Possibly involved in nerve cell function
epithelium -Stimulates secretion of adrenocorticotrophic hormone TNF-ac Monocytes, -Primes the immune response
macrophages, -Induces shock, tissue injury, hypotension, fever,
Kupffer cells gastrointestinal ischemia, capillary leakage, and anorexia
-Increased phagocytic activity of polymorphonuclear leukocytes
-Induces transmigration and chemotaxis of monocytes













CHAPTER 3
AN INVESTIGATION OF THE PROPERTIES OF CLOSTRIDIUM PERFRINGENS TYPE-A ENTEROTOXIN USING D-GALACTOSAMINE AND CYCLOSPORIN-A Introduction

In the investigation of the interaction of bacterial products and the host, agents which potentiate or abrogate the responses of certain components of the immune system are of great value. These agents were used to investigate the claim (Bowness et al., 1992) that the Clostridium peifringens type A enterotoxin (CPE) is a superantigen reacting strongly with V3 6.9 and 22 and weakly with V3s 24, 21, 18, 5, and 6.1-6.5. Were this claim true, CPE would interact with the immune system in a manner similar to that seen with the staphylococcal enterotoxins.

This series of experiments established the mouse lethal dose (MLD, which is a measure of biological activity) for intraperitoneal (IP) and intragastric (IG) administration of a preparation of CPE. Following this determination D-galactosamine (2-amino-2deoxy-D-galactose) (D-gal) sensitization was attempted followed by CPE administration. D-gal renders mice exquisitely sensitive to a range of bacterial toxins including Gramnegative bacterial lipopolysaccharide (LPS) and the staphylococcal superantigenic enterotoxins (Meithke et al., 1993; Freudenberg et al., 1986). The effects of D-gal on the lethal activity of LPS are an increase in sensitivity of up to 100,000 fold (Galanos et al., 1979). D-gal in investigations of the lethal effects of superantigens is of even greater importance as an investigatory tool. Normally mice are much more resistant to the








25
effects of superantigens than humans and do not succumb to the shock seen in humans unless first sensitized with this agent (Miethke et al., 1993). D-gal is a hepatotoxic chemical which, within 30 min of administration, induces the production of large amounts of UDP-galactosamine derivatives (Galanos et al., 1979). This depletes hepatic UTP which results in the cessation of synthesis of macromolecules. The effects of D-gal were thought to be confined to the liver with no damage produced in other organ systems but recent work indicates extensive apoptosis in the medullary pyramids in the kidneys of D-gal sensitized, LPS treated mice (Morikana et al., 1996). D-gal alone is not toxic and levels of up to 1 g D-gal / kg body weight do not induce any signs of injury (Galanos et al., 1979).

Cyclosporin-A (CyA) is another immunomodulatory compound which is of great use in the elucidation of the components of the immune system involved in host reactions. CyA is a fungal polypeptide with great immunosuppressive ability. It is used to prevent host rejection of transplanted organs in humans. Although its mechanism of action is not completely understood, it is generally accepted that CyA mediates its effects by interfering with T-cell activity, specifically the generation of cytokines (Nguyen et al., 1990; Meithke et al., 1992). Were T-cell mediated events implicated in the lethal events following CPE exposure, one would expect to see a protective effect from the administration of CyA before CPE challenge.








26
Materials and Methods

Reagents

CPE was obtained as a purified, freeze dried powder from Dr. Bruce McClane (University of Pittsburgh) on dry ice. Purity was determined through SDSpolyacrylamide gel electrophoresis with only one band visible following staining with Coomassie blue. Toxin was frozen in this form at -700C until use. Before administration toxin was resuspended in phosphate buffered saline-Tween 20 (PBS-Tw)(0.15 M NaCI, 0.01 M Na2HPO4, 0.01 M NaH2PO4, 0.2% Tween 20, pH 7.2). Protein concentration was determined by the method of Lowry et al. (195 1) with bovine serum albumin as a standard. From this determination, the solution was diluted to a final concentration of 1 jtg protein/jtl diluent with PBS-Tw.

D-gal was obtained from Sigma while CyA was a generous gift of Novartis (formerly Sandoz, East Hanover, NJ). For D-gal sensitization studies mice were injected intraperitoneally (IP) with various concentrations of CPE with or without four hour pretreatment with 40 mg D-gal in 100l PBS. D-gal in PBS was used as a control. For CyA studies, mice were injected IP with 400 jtg CyA in PBS 4 hr before IP injection of CPE. CyA in PBS was used as a control.



Mice

16.5 + 1.0 g male Swiss Webster (SW) mice or BALB/C mice for these studies were obtained through the Department of Animal Resources of the University of Florida from Harlan-Sprague Dawley (Indianapolis, IN). Department of Animal Resources personnel order, deliver, and care for the animals within the Food Science and Human








27
Nutrition Department Animal Facility as prescribed by the university of Florida IACUC. Animals were maintained on a 12 hr/12 hr light/dark cycle at 250C, six per cage and were examined daily by Animal Resources personnel who also change bedding and provide food ad libitum. Studies were performed in as humane a manner as possible with attention to preventing suffering on the part of the animals. Approval for all animal studies was granted by the University of Florida Animal Care and Use Committee (IACUC).



Toxin Administration and Mouse Lethal Dose (MLD)

For intraperitoneal (IP) administration one researcher held the mice in an inverted, fully extended position while another researcher measured toxin volume and performed the injection into the peritoneal cavity. Animals were administered CPE IP in the left side of the peritoneal cavity using a I ml Tuberculin syringe with a 26 gauge 10mm length needle. Injection volume, regardless of toxin amount was 100 pl. For intragastric (IG) administration (which was necessary to determine for work detailed in later chapters) mice were held in an inverted, fully extended position. Another researcher measured toxin volume (again 100pl) and used a Popper gastric ball head needle affixed to a 1 ml Tuberculin syringe to administer CPE directly into the stomach. After administration of toxin, animals were returned to their cages and monitored every 15 min. Within each experiment, mice were randomly chosen for group assignment. The time to death method of Spearman-Kerber (Zar, 1984) was used to determine the IP and IG mouse lethal doses (MLD) for CPE.








28
Results

Mice challenged either IP or IG with CPE in doses sufficient to cause an observable response exhibited the same symptoms. The first signs were an accelerated heart rate, a convex arched back, ruffled fur, opaque brownish eyes (vs. the normal bright red), immobility, accelerated shallow respiration, loss of appetite, and the social behavior of huddling together. Mice administered non-lethal doses of CPE (0.1 pg/g for SW mice challenged IP or 1.0 ptg/g for those challenged IG) recover from all symptoms within 6-8 hours. Mice administered higher non-lethal doses (0.5 -tg/g IP or 5 ptg/g IG) recovered between 12-16 hr after challenge. No long-term effects were observed for the 48 hours following recovery.

Figures 3.1 A and 3.1 B show that the MLD for SW mice administered CPE IP is approximately 0.75 gtg CPE / g body weight while the IG MLD is approximately ten fold higher at 7.5 pig CPE / g body weight.

Following determination of the MLD for CPE, experiments examining the effect of immunomodulatory agents on CPE toxicity were conducted. Data shown in Table 3.1 demonstrates that D-gal had no sensitizing effect for SW mice exposed IP to CPE. CyA had no protective effect in the Swiss White model system as shown in Table 3.2.

Following these results experiments to determine the MLD of CPE in BALB/c

mice were conducted. These experiments established an MLD of approximately 0.5 .g CPE / g body weight for IP administration (data not shown). The D-gal and CyA experiments were repeated using the BALB/c mouse model system. Again, no sensitization was demonstrated following D-gal pretreatment and no protection was








29
evident following pretreatment with CyA as is shown in Tables 3.3 and 3.4. Additionally CyA did not increase the time to death of mice administered lethal doses of CPE over control mice administered the same dose of toxin without CyA pretreatment. Results from experiments performed by Torres working with Johnson, Wallace, and Lindsay (Lindsay, 1996) showed that CPE did not behave as a superantigen with regard to its interaction with major histocompatibility complex (MHC). Using RAJI cells, which are a high MHC class II producing cell line, these researchers were not able to demonstrate any competition between radiolabeled CPE and a panel of known superantigens including the staphylococcal enterotoxins. In a second experiment they used a murine L-cell line which is a mouse cell line transfected to express human MHC class II (and mouse MIHC class I). In this experiment there was no increased binding to the L-cell line when compared to an untransfected control cell line. Both of these results are in conflict with the results which were expected if CPE did exhibit superantigenic properties.



Discussion

When this series of experiments was begun using SW mice, we were operating under the assumption that CPE was a superantigen (Bowness, 1992). After examining the results obtained in the D-gal sensitization and CyA protection studies, explanations that were still consistent with CPE being a superantigen were entertained. After further review of studies in mouse genetics, it was found that the SW strain of mice were missing part of the T-cell receptor (TCR) locus (Pullen et al., 1990). It then seemed possible that this strain of mice was missing the elements that would allow CPE to behave as a superantigen. It has been hypothesized that the deletion of portions of the TCR locus is















O] O D-l O
4.

C)
IP treatment:
2 3
U 0.1 gg CPE/g wt mouse n [0 0.5 gtg CPE/g wt mouse
- V 0.75 4g CPE/g wt mouse E0 1.0 pg CPE/g wt mouse E 2- 0 2.0 .g CPE/g wt mouse
O
'44



06


0 0.5 1 1.5 2 16 24 32 time (h)


Figure 3.1 Determination of Mouse Lethal Dose (MLD) for CPE Administered IP.




protective in mice allowing them to resist the effects of pathogens which possess superantigenic proteins (Pullen et al., 1990). BALB/c mice were found to possess the complete TCR locus and were thus chosen as experimental animals to repeat the D-gal and CyA studies. Initial results were encouraging with BALB/c mice exhibiting greater sensitivity to CPE than SW mice (MLD of 0.15 pg CPE / g mouse weight for BALB/c















4.*
E00
IG treatment:
> N 1.0 pig CPE/g wt mouse
2 3 EO 2.5 pg CPE/g wt mouse
=3g
(n V 5.0 pg CPE/g wt mouse
co * 7.5 pg CPE/g wt mouse
FO0 10 p.g CPEIg wt mouse
E
C '4
0 1
E



0 0.5 1 1.5 2 16 24 32 time (h)

Figure 3.2 Determination of Mouse Lethal Dose (MLD) for CPE Administered IG.



mice versus 0.5 pg CPE /g mouse weight for SW mice). Repeating the procedures using BALB/c mice however showed no sensitization with D-gal and no protection with CyA pretreatment. Other bacterial superantigens that have proved to be superantigenic in humans have proved to possess the same properties in mice. The possibility that CPE was different and only behaved as a superantigen in humans but not in mice was considered. Dr. Howard Johnson and Dr. Barbara Torres (University of Florida, Department of Microbiology and Cell Science) were then consulted based on their











Table 3.1.


Effect of D-galactosamine (D-gal) on CPE sensitivity for Swiss Webster mice.


Treatment Lethality (dead/total)

PBS 0/6 40 mg D-gal 0/6 750 ng CPE 6/6 375 ng CPE 0/6 188 ng CPE 0/6 750 ng CPE + 40 mg D-gal 6/6 375 ng CPE + 40 mg D-gal 0/6 188 ng CPE + 40 mg D-gal 0/6 10 lpg LPS 0/6 10 jtg LPS + 40 mg D-gal 6/6



Note: CPE weights are given in ng CPE / g mouse weight.



expertise in working with superantigens. Using tissue culture based studies to evaluate CPE interaction with human MHC class II, Johnson and Torres concluded that CPE did not behave as a superantigen in humans and the sensitization and protection studies had determined that CPE did not behave as a superantigen in the mouse. The above outlined results indicate that, contrary to the claim that CPE is a superantigen, it most assuredly is











Table 3.2 Effect of Cyclosporin A (CyA) on CPE sensitivity for Swiss Webster mice


Treatment Lethality (dead/total)

PBS 0/6 400 jig CyA 0/6 750 ng CPE 6/6 375 ng CPE 0/6 188 ng CPE 0/6 750 ng CPE + 400 pg CyA 6/6 375 ng CPE + 400 jig CyA 0/6 188 ng CPE + 400 jig CyA 0/6 10 tg LPS 0/6



Note: CPE weights are given in ng CPE / g mouse weight.





not. In vitro studies did, however, indicate that CPE activated cells of a macrophage lineage (Wallace et al., 1999). This result, combined with the symptoms of C. perfringens type A food-borne illness in both humans and in the mouse model, led us to believe that CPE may interact with the immune system to induce proinflammatory cytokines. As such, we undertook a series of experiments examining the serum cytokines









Table 3.3.


34
Effect of D-galactosamine (D-gal) on CPE sensitivity for

BALB/c mice.


Treatment Lethality (dead/total)

PBS 0/6 40 mg D-gal 0/6 500 ng CPE 6/6 250 ng CPE 2/6 125 ng CPE 0/6 500 ng CPE + 40 mg D-gal 6/6 250 ng CPE + 40 mg D-gal 1/6 125 ng CPE + 40 mg D-gal 0/6 10 pg LPS 0/6 10 pg LPS + 40 mg D-gal 6/6



Note: CPE weights are given in ng CPE / g mouse weight. generated following IP and IG challenge of mice with CPE using the SW model system as well as examining the in vitro cytokine response of a macrophage cell line following incubation with CPE. The results of these experiments are described in Chapter 4.








35
Table 3.4. Effect of Cyclosporin A (CyA) on CPE sensitivity for BALB/c mice.


Treatment Lethality (dead/total)

PBS 0/6 400 p.g CyA 0/6 500 ng CPE 6/6 250 ng CPE 0/6 125 ng CPE 0/6 500 ng CPE + 400 .tg CyA 6/6 250 ng CPE + 400 p.g CyA 1/6 125 ng CPE + 400 ptg CyA 0/6 10 pg LPS 0/6


Note: CPE weights are given in ng CPE / g mouse weight.














CHAPTER 4


SERUM CYTOKINE LEVELS IN SWISS WEBSTER MICE EXPOSED IP AND IG TO CPE AND IN VITRO CYTOKINE PRODUCTION OF A MACROPHAGE CELL LINE EXPOSED TO CPE

Introduction

Data from studies described in Chapter 3 determined that CPE was not a superantigen; however, CPE is nonetheless a bacterial exotoxin and many such products have been found to induce an immune response (Flegel et al., 1991; Misfeldt et al., 1990; Bhakdi et al., 1990). Previous work (Mach and Lindsay, 1997) had indicated that in vitro, the murine macrophage cell line J774A.1 I was activated to produce nitric oxide following exposure to CPE. Their work also documented a short-term (12-24 hour) mitogenic effect and a longer term (48 hours and greater) lethal effect. Lindsay, Torres, and Johnson had also documented a mitogenic effect in human peripheral blood mononuclear cells (PBMC) exposed to CPE (Lindsay, 1996; Wallace et al., 1999). These results suggested that there was an in vitro production of cytokines by the macrophage cell line previously used to demonstrate activation by CPE. The results also suggested an activation of cells of the macrophage/monocyte lineage would likely occur after in vivo challenge by CPE with concomitant production of cytokines. This chapter documents results showing that, indeed, the J774A. 1 cell line did produce cytokines following exposure to CPE, and mice challenged with CPE IG and IP did exhibit a cytokine response.








37
Materials and Methods

Reagents

Freeze dried CPE obtained from Dr. Bruce McClane, reconstituted, handled, and administered as described in Chapter 3. Reconstitution was performed the day of administration as CPE in solution loses biological activity even when stored at -700C. Biological activity was confirmed using the Vero cell cytotoxicity assay (Wallace et al., 1999). As before, protein concentration was determined by the method of Lowry et al., (1951) with bovine serum albumin as a standard. From this determination the solution was diluted to a final concentration of 1 p.g protein/pl diluent with PBS-Tw.



Tissue Culture

J774A.1 (ATCC TIB 67) macrophage cell line cultures were incubated as adherent monolayers in a humidified incubator in 5% CO2 at 370C using Sarstedt 75 cm2 flasks and modified Dulbecco's media (DMEM) containing 10% fetal bovine serum (FBS), 2 mM L-glutamine and 1 mM sodium pyruvate. When flasks were >80% confluent, cells were removed by gentle scraping, and transferred to sterile conical tubes and centrifuged at 200 x g for 5 min. The supernatant was removed and pellets combined in 10 ml of fresh DMEM. Approximately 105 cells were seeded/well, as determined by hemicytometer counts, into Sarstedt 24 well cluster dishes and incubated for 24 h. During this 24 h incubation/resuscitation, cell numbers do not change significantly from the initial inoculation. The medium was then removed, and the cells washed twice with 15 mM PBS, pH 7.0 to remove any residual FBS. Cells were incubated in 0.4 ml Earl's








38
balanced salts containing 0.28 mM phenol red (EBS-PR) without FBS, amino acids or vitamins.



Measurement of Cytokine Levels in vitro

J774A.1 cells were incubated with 10 [tg CPE/well and examined after 24 h. Supernatants were collected and levels of cytokines IFN-y, TNF-c, IL-ct, IL-2, and IL-6 were determined using commercially available ELISA kits obtained from Endogen (Cambridge, MA). Internal controls were always run with each cytokine test, the sensitivity of each test being <15 pg/ml. Results are means + SE (n=6) based on 105 cells/well. Cytokine levels were normalized to control wells run with all reagents except cytokine. Significance was calculated using the Student's t-test.



Mice

16.5 + 1.0 g male Swiss Webster (SW) mice for these studies were obtained through the Department of Animal Resources of the University of Florida from HarlanSprague Dawley. Department of Animal Resources personnel ordered, treated, and cared for these animals as described in Chapter 3.



Toxin Administration

Mice were administered toxin essentially as described in Chapter 3. Within each experiment, mice were randomly chosen for group assignment. Mice were given 0.6 pig CPE/g body weight in IP injection, or 4.5 jag CPE/g body weight in IG administration.








39

These toxin amounts were slightly below 0.5 MLD which has been found to elicit typical pathophysiological symptoms as described in Chapter 3 while not risking the possibility of death.



Blood Collection and Serum Isolation

At the times indicated, mice were anesthetized using chloroform. Following anesthesia whole blood was collected. Blood samples were allowed to clot at 40C for 2 h, and centrifuged at 200 x g to obtain serum. Serum samples were stored at -700C until cytokine determination.



In vivo Cytokine Determination

Levels of cytokines IFN-y, TNF-a, IL-lIx, IL-2, and IL-6 were determined using commercially available ELISA kits obtained from Endogen (Cambridge, MA). Internal controls were always run with each cytokine test, the sensitivity of each test being <15 pg/ml. Cytokine levels were normalized to control wells run with all reagents except cytokine. Data in ng/ml are reported as means + SE (if greater than 10% of the mean) in Figs 4.1-4.10.



Results

Cytokine levels in vitro

CPE was found to induce the synthesis of 5.8 + 0.02 pig/ml IFN-y; 4.5 + 0.01 .tg/ml TNF-c; 1.3 + 0.03 pg/ml IL-lIc; and 3.0 ptg/ml IL-6 in the macrophage cell line J774A. I following incubation with CPE. As expected no IL-2 was produced.











10

log
5
scale
4
3
2


1.0

0.9

0.8

0.7
E
L 0.6 Cl)
C linear 0.5 E 0.4

0.3

0.2

0.1

0

I I I I I I I
0 60 120 240 480 720 960 Time in Minutes


Figure 4.1 Serum levels of IL-Ia following IP administration of CPE.













log scale


21-


1.0

0.9


0.8


linear 0.5 -


0.4

0.3

0.2 -


I I I I


0 60 120 240


480


720


960


Time in Minutes


Figure 4.2 Serum levels of IL-2 following IP administration of CPE.


E




E Cl-


I I I














log
scale


2 1-


1.0

0.9

0.8

0.7 -


0.6 linear 0.5

0.4 0.3


0.2 0.1


0 -


I I I I I I I


0 60 120 240 480 720

Time in Minutes


Figure 4.3 Serum levels of IL-6 following IP administration of CPE.


E
s.
U) (I,
C

E
c,)


960













log
scale


2


1.01-


0.9 0.8


0.7

0.6


linear 0.5 -


0.4

0.3

0.2 -


0 -


I I


0 60120 240


480


720


960


Time in Minutes


Figure 4.4 Serum levels of IFN-y following IP administration of CPE.


E

I


E: C--


I I I


I I I I III














log scale


21-


linear 0.5 1-


0.4

0.3

0.2 -


0 -


I I I


I I I I


0 60120 240


480


720


960


Time in Minutes


Figure 4.5 Serum levels of TNF-ac following IP administration of CPE.


1.0

0.9

0.8

0.7

0.6 -


E


C
im


0)
E











10

log 7 scale 5
4
3
2


1.0

0.9

0.8

0.7
E
2 0.6linear 0.5"E 0.4C 0.30.2

0.1

0
IIIF I l l I I I I
0 60120 240 480 720 960 Time in Minutes


Figure 4.6 Serum levels of IL-la following IG administration of CPE.












10

log
scale 5
4
3
2


1.0

0.9

0.8

0.7
E
L- 0.6 (D
C/)
Linear 0.5 E 0.4 C 0.3

0.2

0.1

0
I I I I I I I

0 60120 240 480 720 960 Time in Minutes

Figure 4.7 Serum levels of IL-2 following IG administration of CPE.












10

log
scale 5
4
3 2


1.0

0.9

0.8

0.7
E
0.6
C,)
C linear 0.5

E 0.4 CY
0.3

0.2

0.1

0
I I I I I I
0 60 120 240 480 720 960 Time in Minutes

Figure 4.8 Serum levels of IL-6 following IG administration of CPE.












log scale


2)-


linear 0.5 -


0.41-


0 -


I I I


0 60 120 240


I I


480


Time in Minutes


Figure 4.9 Serum levels of IFN-y following IG administration of CPE.


E

.
:33


CD
C


720


960


1.0

0.9













log
scale


21-


0.8


0.7 0.6 linear 0.5

0.4


0.3 0.2


0
I I I I I I I


0 60 120 240 480 720

Time in Minutes


Figure 4.10 Serum levels of TNF-c following IG administration of CPE.


E
2

1) Cl)



0)
C


960


1.0 [

0.9










Cytokine levels in vivo

Figures 4.1-4.10 show the kinetics of cytokine induction after IP (Figs 4.1-4.5) and IG (Figs 4.6-4.10) administration of slightly less than 0.5 MLD. With one exception, all cytokine levels markedly increased within 0.5 h and peaked between 1-2 h. Maximum levels of IFN-y were maintained for 8 h for IP administration of toxin and 4 h for IG administration. Levels of IL-6 were maintained for 8 h, while IL-lc, and the very low levels of IL-2 peaked and fell to nearly baseline levels within 3-4 h. After an initial increase, TNF-ca levels fluctuated with a further increase after 4 h. This phenomenon was consistently detected in all animals without regard to route of administration (IP or IG). All cytokine levels were very low after 12 h and had returned to baseline levels by 16 h. Challenge by IP administration of CPE induced nearly 10 fold higher levels of ILla and IL-6, and 3 fold higher levels of TNF-c and IL-2 than by IG administration. Peak IFN-y levels were similar regardless of the mode of administration.



Discussion

Work published by other researchers documents an IL-6 response from human PBMC exposed to CPE, but no IL-1, TNF-oc, or IFN-y and no mitogenic response (Krakauer et al., 1997). The lack of a mitogenic response did not concern us greatly because their first evaluation of proliferation was at 48 hours which was, as previously described, long past the point of any observed proliferative effect, and indeed at a time when one would expect the toxic effect of CPE on sensitive cells to be manifested. The lack of an IL-1, TNF-cL, or IFN-y response was of greater interest, however, it is certainly








51
possible that the researchers missed the production of these cytokines based on the time points chosen for analysis just as they missed the proliferative effect. The levels of IL-1, IL-6, TNF-a, and IFN-y generated in response to CPE without sensitization were comparable in intensity to those induced by SEB, TSST-1, and LPS in D-gal sensitized mice (Meithke, 1993; Tateda, 1996). Cytokine levels were also faster in induction and more rapid in return to baseline levels than those observed following superantigen challenge. Further studies should be conducted to determine whether CyA-treated mice express TNF-ca following CPE challenge. In studies of superantigens, it has been found that inhibiting T-cell function with CyA can completely inhibit systemic TNF-ca production, implying that either T-cells produce TNF-x and/or they are involved in the process by which macrophages secrete this cytokine. In the case of CPE challenge, as it appears that macrophages are the principal target with no T-cell involvement, it is expected that CyA will have no effect on the production of TNF-a. As expected, since it is becoming increasingly apparent that CPE is not a superantigen, there was minimal IL-2 generated in response to CPE challenge. TSST-1 and SEB are powerful activators of cells of the macrophage lineage as well as of T-lymphocytes, which upon activation produce a host of inflammatory cytokines. Lipopolysaccharide induced endotoxic shock is primarily a macrophage/monocyte mediated phenomenon, wherein the generalized inflammatory process is attributable to the generation of a cascade of proinflammatory cytokines. Neither TSST-1, SEB, nor LPS are directly toxic to cells, in contrast to CPE which demonstrates a powerful cytotoxic effect in many cell types (Lindsay, 1996). The pathophysiological effects of CPE thus may be due to a combination of direct








52
cytotoxicity, as well as the generation of a proinflammatory response by the host. The results of this study demonstrate that a macrophage cell line is activated to produce cytokines in vitro. This work demonstrates results consistent with an activation of cells of the macrophage lineage in vivo as well. Based on the results of the in vivo studies, it is apparent, however, that T-cells are not activated to any significant extent following challenge with CPE.

The above outlined studies leave many unanswered questions regarding cytokine production. Additional studies regarding cytokine involvement are suggested by the results of this work some of which were performed and are described in Chapter 5. First, determining the organs of generation of an immune response following CPE intoxication are of interest as is the time-course of the transcriptional response of each affected organ (see Chapter 5). Second, the mediators which serve to down-regulate activity of proinflammatory cytokines should be examined as to transcription, protein expression, time course, and organs of origin. Mediators that regulate cytokine activity are of great interest, as the serum cytokine response observed does not necessarily tell the whole story. Serum cytokines are, in reality, the amount produced in excess of the amount which binds to cellular and soluble receptors. The serum cytokine measurements do not reflect cytokines which are cell associated, and though the manufacturers of the ELISA kits state that soluble receptor bound cytokines are detected quantitatively some researchers have found this claim to be inaccurate. Further studies which would be helpful in the interpretation of the state of immune activation of mice exposed to CPE are suggested. First soluble TNF-ca receptor (sTNF-acr) and second IL-2 receptor antagonist (IL-2ra), should be examined. sTNF-tr levels would be informative as TNFL sensitive








53
cells shed their TNF receptors in response to exposure to TNF. Serum levels of free cytokine are thus lowered relatively rapidly while the plasma levels of its receptor remain elevated long after exposure to a stimulatory agent. sTNF-ar levels therefore can often provide more information about the state of the immune system than cytokine levels. ILIra levels would be of interest as IL-I induces synthesis of this protein, and levels of ILIra remain elevated after IL-1 levels have declined. These systems serve a protective function by decreasing the chance that an inflammatory reaction will cause significant damage to the challenged host. The complexity of these interacting systems make interpretation of data solely obtained from measuring serum protein levels difficult. Additional work investigating these systems following CPE intoxication would therefore be of great importance.














CHAPTER 5
ORGAN SPECIFIC TIME COURSE OF CYTOKINE MESSENGER RNA RESPONSE
FOLLOWING CLOSTRIDIUMPERFRINGENS TYPE A ENTEROTOXIN INTOXICATION


Introduction

The reverse transcriptase polymerase chain reaction (rtPCR) provides a powerful tool to evaluate both the time course and the organ specificity of a transcriptional response. Chapter 4 describes the serum cytokine response to CPE. In order to gain more insight into the mechanisms of response to this toxin, RNA productions for the cytokines previously evaluated (IL-lc, IL-2, IL-6, IFN-y, and TNF-c) were examined by rtPCR. The organs examined in this manner were the spleen, liver, and small intestine.



Materials and Methods

Reagents

Freeze dried CPE, obtained from Dr. Bruce McClane, was reconstituted, handled, and administered as described in Chapter 3. Reconstitution was performed the day of administration as CPE in solution loses biological activity even when stored at -700C. As before protein concentration was determined by the method of Lowry, et al. (1951) with bovine serum albumin as a standard. From this determination the solution was diluted to a final concentration of 1 ptg protein/pl diluent with PBS-Tw.










Mice

16.5 + 1.0 g male Swiss Webster (SW) mice for these studies were obtained through the Department of Animal Resources of the University of Florida from HarlanSprague Dawley. Department of Animal Resources personnel ordered, treated, and cared for these animals as described in Chapter 3.



Toxin Administration

Mice were administered CPE essentially as described in Chapter 3. Within each experiment mice were randomly chosen for group assignment. Mice were given 4.5 tg CPE/g body weight in IG administration. This toxin amount is slightly below 0.5 MLD, and was guaranteed to elicit typical pathophysiological symptoms as described in Chapter

3 while not risking the possibility of death.



Necropsy and Organ Harvesting

At the times indicated animals were anesthetized using chloroform and sacrificed by cervical dislocation. Organs harvested included spleen, liver, and distal 5 cm of the small intestine. Organs were immediately placed into 3.0 ml of 40C TRIzol reagent (Gibco BRL) in 15 ml polypropylene tubes and homogenized using a Polytron (Brinkmann Instruments) for three bursts of 15 seconds each. This procedure ensured complete homogenization of all organs studied. Homogenates were stored at -700C until RNA extraction.










RNA Isolation


Six hundred pl of chloroform was added to 3.0 ml of Trizol:tissue homogenate. This mixture was vortexed to a milky pink color (approximately 15 sec) and allowed to sit at room temperature (250C) for 3 min. The sample was then centrifuged in a clinical centrifuge at 2000 x g for 60 min at 40C. The aqueous phase was transferred to a fresh 15 ml polypropylene tube. 2.0 ml -200C isopropyl alcohol was added. The mixture was centrifuged for 20 min in a clinical centrifuge at 40C at 2000 x g. The supernatant was removed and discarded. The pellet was washed once with 5.0 ml 75% ethanol (made from absolute ethanol plus diethylpyrocarbonate (DEPC) treated water) by gently vortexing and centrifuged as before. The supernatant was removed and discarded and the pellet allowed to air dry for 5 min in a laminar flow hood. RNA was redissolved in 250 il volumes of DEPC treated water and assayed for RNA concentration and purity by spectrophotometric measurement. RNA concentration was usually 0.7-1.0 plg RNA/ptl. If concentration was higher than 1.0 pg RNA/ll the solution was diluted further with DEPC treated water to 1.0 ptg RNA/pl. In the rare case that the concentration was lower than 0.7 ptg RNA/pl a proportionately larger volume of RNA solution (and correspondingly lower volume of water) was utilized during the reverse transcription reaction.









Reverse Transcription


A 20 l. total reaction volume was used for generating cDNA from the isolated total RNA. All reagents used were obtained from GibcoBRL. Total RNA (1.4-2.0 .g) was used in the reaction. To 2.0 pl RNA solution was added 1.0 pl oligo (dT)12-18 (containing 0.5 ptg) primer solution and 9.0 pl DEPC H20 on a -200C aluminum block. This mixture was heated to 700C for 10 min in a thermocycler (Perkin Elmer) to remove secondary structure from the RNA. The mix was quick chilled on an aluminum block at

-200C. To this was added a mix containing 4.0 pl 5X first strand buffer, 2.0 ptl 0.1 M dithiothreitol (to stabilize the reverse transcriptase), and 1.0 p.1 of a solution containing 10 mM of each deoxynucleotide triphosphate (dATP, dGTP, dCTP, and dTTP). Contents of each tube were gently mixed and incubated at 420C in the thermocycler. To each reaction tube 11tl (200 U) of Superscript II reverse transcriptase was added with gentle pipetting. This mixture was incubated at 420C for 50 min followed by an inactivation step of 15 min at 700C. The cDNA was stored at -200C until use.





PCR Reactions


Sequences for PCR primers were obtained from the lab of Dr. Ammon Peck (Department of Pathology, Immunology, and Lab Medicine, University of Florida) (see Table 5.1 for sequences and product lengths). Primer pairs were analyzed using OLIGO software and the National Library of Medicine database Genebank to ensure specificity and appropriateness. Products for all reactions were of the appropriate length as shown








58
by agarose gel electrophoresis. PCR primers for 3-Actin and the cytokines IL-la, IL-2, IL-6, IFN-y, and TNF-a were ordered form GibcoBRL and received in lyophylized, desalted form. They were resuspended in TE8 buffer to a concentration of 50pM. All PCR reactions were conducted using a GeneAmp PCR system 2400 (Perkin Elmer). Before any other PCR reactions were run, the reaction for 3-Actin was conducted and the product evaluated by gel electrophoresis to ensure that the RNA isolation and reverse transcription had been conducted successfully. The cycling profile performed was as follows: 35 cycles of [(1) denature 45 sec at 940C; (2) anneal 45 sec at 600C; (3) extend 2 min at 720C] followed by one final 7 min 720C extension step. Following evaluation of each cDNA in this manner 5 pl from each of 3 cDNAs from each time period were combined for each organ and PCR reactions were conducted using the same profile as was used for amplifying the segment for -Actin.





Gel Electrophoresis


Amplified PCR products were separated using 1.5 % agarose gels with 0.7 ig/ml ethidium bromide (see Figs 5.1-5.5 for results). Gels were run with TAE used as the running buffer. To each sample lane was added 10 ptl PCR product with 2 ptl loading dye (0.25% bromophenol blue, 40% sucrose). The last lane was loaded with 1 pA 100 bp DNA sizing ladder diluted with 8 pl water and 1.5 ptl loading dye. Gels were run for 55 min at 95 mV.









Visualization of PCR Products


Visualization of products separated by electrophoresis was performed using a UV transilluminator (Photodyne). Photographic images were produced and the results scanned as high resolution bit-maps.





Results

All reactions produced only one amplification product with the exception of the reaction for TNF-a which frequently produced several extra bands. Although a semiquantitative determination could be made (using two different PCR cycle numbers and visual grading) no additional information would have been obtained and considerably more reagents would have been utilized therefore a simple qualitative analysis was considered adequate.

Results of this work are shown in Figures 5.1-5.5 showing PCR products which are proportional to the relative transcriptional activity for the cytokine genes in question. Figure 5.6 shows a scan of the complete gel of PCR products from the evaluation of ILlax mRNA from liver.

IL-1 mRNA was generated primarily in the spleen with lesser amounts being produced by the liver and a transient transcription induced in the small intestine (see Fig

5.1).








60
As expected based on the prior work virtually no IL-2 mRNA was induced although there was a slight response seen from the spleen at times 60 and 120 min that did not reproduce well in the photographs of the gels (Fig 5.2).

The IL-6 transcriptional response was most pronounced in the liver but this response had ended long before the serum protein levels declined (see Fig 5.3).


Maximum serum levels of this cytokine were reached within 60 min and remained at maximum levels until the 8 h time point. Maximum mRNA levels were reached in the same time and then rapidly declined.

The most vigorous IFN-y transcription was seen in the small bowel with lesser amounts generated in the spleen and liver (Fig 5.4). Maximum serum protein levels peaked very rapidly (by the 60 min time point) and then declined very rapidly. The transcriptional response was induced rapidly reaching maximum intensity within 30 min however the transcriptional levels remained elevated throughout the time course examined remaining at maximum intensity even at the 8 h time point. Detectable TNF-a serum protein levels were relatively low throughout the course of the experiment with a slight amount seen which slowly declined throughout the experiment. Despite this paucity of detectable cytokine there was a vigorous transcriptional response for this cytokine (Fig 5.5), primarily in the liver but also in the spleen and bowel.



Discussion

Despite the fact that the serum levels of IL-lact had returned to undetectable levels by 8 hr after IG administration of toxin there was still a vigorous IL-la transcriptional









response in the spleen and the liver. The bowel demonstrated a transient response which was evident at only the 30 and 60 min time points. It is possible that there is a posttranscriptional regulation of this protein through the production of IL-1 receptor antagonist (siL-Ira) which binds to the IL-1 receptor, attenuating the inflammatory response.



Table 5.1. Cytokine primers used for PCR


Further experiments should examine both the serum protein levels of this cytokine receptor and the transcriptional response for the mRNA for slL-lra.

IL-2 mRNA was generated in only trace amounts by the spleen and mirrors the vanishingly small amounts of IL-2 detected in serum of CPE challenged mice. This


Cytokine Primer Sequence Product size

IL-li 3' Primer 5' CCTTCAGCAACACGGGCTGGTC 3'
5' Primer 5' ATGGCCAAAGTTCCTGACTTGTTT 3' 625 IL-2 3' Primer 5' GGCTTGTTGAGATGATGCTTTGACA 3'
5' Primer 5' ATGTACAGCATGCAGCTCGCATC 3' 502 IL-6 3' Primer 5' CACTAGGTTTGCCGAGTAGATCTC 3'
5' Primer 5' ATGAAGTTCCTCTCTGCAAGAGACT 3' 638 IFN-y 3' Primer 5' CGACTCCTTTTCCGCTTCCTGAG 3'
5' Primer 5' TGAACGCTACACACACTGCATCTTGG3' 460 TNF-ct 3' Primer 5' CCAAAGTAGACCTGCCCCGGACTC 3'
5' Primer 5' ATGAGCACAGAAAGCATGATCCGC 3' 692 3-ACTIN 3' Primer 5' CTCTTTGATGTCACGCACGATTTC 3'
5' Primer 5' GTGGGCCGCTCTAGGCACCAA 3' 540














Sp Li Bo


0 15 30 60 120 240 480 std

Time (min)


E



0)
_E

E


Figure 5.1 IL-la mRNA Evaluation


0.9

0.8

0.7

0.6

0.5

0.4 0.3


rtPCR evaluation of mRNA for IL- 1 a following IG administration of 0.5 MLD of CPE showing time course and organ specificity of transcription (above). Serum levels of IL- 1 a are also shown (right). Sp =Spleen Li=Liver Bo=Small Bowel MLD=Mouse Lethal Dose CPE=Clostridium perfringens type A enterotoxin


Serum IL-la


II, I I I I


060120 240


480


720


Time in Minutes














Sp



Li Bo


1.0

0.9 0.8 0.7 0.6

0.5

0.4 0.3

0.2


0 15 30 60 120 240 480 std

Time (min)


Figure 5.2 IL-2 mRNA Evaluation

rtPCR evaluation of mRNA for IL-2 following IG administration of 0.5 MLD of CPE showing time
course and organ specificity of transcription (above).
Serum levels of IL- 2 are also shown (right).
Sp =Spleen Li=Liver Bo=Small Bowel
MLD=Mouse Lethal Dose
CPE=Clostridium perfringens type A enterotoxin


0.1


a a 1 A .


0 60 120 240


Time in Minutes


Serum IL-2


480


720


960














Sp



Li Bo


1.0

0.9

0.8

0.7

0.6

0.5

0.4

0.3

0.2


0 15 30 60 120 240 480 std

Time (min)


Figure 5.3 IL-6 mnRNA Evaluation

rtPCR evaluation of mRNA for IL-6 following IG administration of 0.5 MLD of CPE showing time
course and organ specificity of transcription (above).
Serum levels of IL-6 are also shown (right).
Sp =Spleen Li=Liver Bo=Small Bowel
MLD=Mouse Lethal Dose
CPE=Clostridium perfringens type A enterotoxin


Serum IL-6


II I I I I a


0 60 120 240


480


720


Time in Minutes


960













Sp Li Bo


0 15 30 60 120 240 480 std

Time (min)


Figure 5.4 IFN-y mRNA Evaluation


rtPCR evaluation of mRNA for IFN-y following IG administration of 0.5 MLD of CPE showing time course and organ specificity of transcription (above). Serum levels of IFN-y are also shown (right). Sp =Spleen Li=Liver Bo=Small Bowel MLD=Mouse Lethal Dose CPE=Clostridium perfringens type A enterotoxin


1.0 0.9 0.8


Serum IFN-y


lI 2 1 I I I


0 60 120 240


480


960


Time in Minutes














Sp Li Bo


E






Eu 0--


0 15 30 60 120 240 480 std

Time (min)


Figure 5.5 TNF-a mRNA Evaluation


rtPCR evaluation of mRNA for TNF-cx following IG administration of 0.5 MLD of CPE showing time course and organ specificity of transcription (above). Serum levels of TNF-aot are also shown (right). Sp =Spleen Li=Liver Bo=Small Bowel MLD=Mouse Lethal Dose CPE=Clostridium perfringens type A enterotoxin


10

5
4
3
2 1.0 0.9


0 60 120 240


480


720


960


Time in Minutes


SSerum TNF-a















a I




m


i





.






-


































Figure 5.6 RT-PCR evaluation of liver transcription for IL-la.


result confirms that T-cells are not activated to any great extent in the murine model of CPE intoxication.

IL-6 transcription, unlike that for IL-Ia, had decreased long before any decrease in IL-6 serum protein was evident with a major decline between the 60 and 120 min time points. In contrast, serum protein levels of this cytokine did not begin to decline from their maximal amounts until after the 8 h time point. This indicates that likely the regulation of this cytokine following CPE intoxication is at the transcriptional level.








68

Transcription of IFN-y was most pronounced in the bowel with lesser amounts being produced by the spleen and liver. As with IL-la mRNA for IFN-y remained elevated after serum protein levels had returned to baseline levels indicating a posttranscriptional regulation of the activity of this cytokine.

TNF-a presents the most confusing picture of all with spleen, liver and bowel all being transcriptionally active for this cytokine. The liver is most transcriptionally active with regard to TNF-ax with lesser amounts but the same time course evident for the bowel. In contrast splenic production of TNF-ca mRNA is weak initially but increases throughout the timecourse of the experiment peaking at 4 h and remaining at that level at the 8 h time point. Compared with the relatively small amount of this cytokine seen in serum following CPE challenge the vigorous transcriptional response is of great interest. It is quite possible that shed TNF-a receptors are masking the true levels of serum protein. Because of this result it is important to evaluate the serum levels of soluble receptor for this cytokine in future work using the same experimental design as that utilized in Chapter 4, which may provide a more complete understanding of the kinetics of TNF-a expression in CPE intoxication.

These findings that the gut demonstrated cytokine gene transcription are in contrast to experiments modeling endotoxicosis. Work conducted to evaluate the gut as a source of cytokines during a porcine model of LPS exposure indicated that the gut was not a source of cytokines (Bathe, 1996). The work outlined here evaluated transcriptional activity which may not be a true indicator of protein production, while the endotoxemia model system evaluated actual protein production which does make direct comparisons








69

between these experiments impossible. Should later work provide evidence that cytokines are actually produced by the gut during CPE intoxication, then further studies investigating the difference in mechanisms between these two states would be warranted.














CHAPTER 6
FECAL BILE ACIDS, NEOPTERIN, CLOSTRIDIUMPERFRINGENS AND THE SUDDEN INFANT DEATH SYNDROME



Introduction

In humans, illness caused by the Clostridium perfringens enterotoxin (CPE) manifests itself in two ways. First and most common is the form caused by ingestion of large numbers (>107) of viable vegetative cells. These cells, under the stressful environment encountered in the gastrointestinal tract, are induced to sporulate with the associated production of enterotoxin. Symptoms begin 8-24 hours after eating contaminated food. The enterotoxin acts on the epithelium of the small intestine to induce a prolific non-bloody secretory diarrhea with desquamation of enterocytes primarily in the distal ileum. This illness resolves spontaneously within 12-24 hours of the onset of symptoms. The second and more aggressive illness is the Infectious Diarrhea Syndrome which occurs primarily in institutional settings (nursing homes, longterm care facilities).

Increased frequency and levels of C perfringens spores and CPE have been demonstrated to occur in the feces of victims of the Sudden Infant Death Syndrome (SIDS) and it has been proposed that the sporulation associated CPE could be at the least a contributing factor (if not the final trigger) in some cases of SIDS. Bile acids are known to induce sporulation of vegetative cells of C. perfringens (Heredia et al., 1991).








71

Total bile acid levels and individual bile acids were examined in SIDS cases to determine if increased levels were associated with SIDS.

In humans activation of the cellular branch of the immune system is accompanied by the release of neopterin (tetrahydrobiopterin). This effect is mediated through IFN-y. An increased neopterin level indicates endogenous interferon has been produced and therefore neopterin levels can be used as a measure of the activated state of the immune system. Neopterin has been shown to be involved in a variety of processes including the oxidative cleavage of ether lipids and the formation of nitric oxide radical from arginine (Fuchs et al., 1992). hi vitro studies utilizing a macrophage cell line have indicated that CPE induces a vigorous mitogenic and cytokine response. In vivo studies of cytokine production, as discussed in previous chapters, indicate that this response happens in macrophages of animals as well. As such, if CPE were involved in SIDS, one would expect to see increased levels of neopterin in SIDS victims. Neopterin levels remain elevated long after cytokine levels have decreased and are stable in urine post-mortem (Ambach et al., 1991). Neopterin levels are thus an ideal marker to study whether the cellular branch of the immune system has been activated in SIDS. While not indicative of a causal relationship between CPE and SIDS, elevated neopterin levels in SIDS victims would be suggestive of a link between the elevated levels of fecal C. perfringens spores and CPE found in SIDS victims and the immunological state of these infants. Conversely, a finding of no increased levels of neopterin in SIDS victims would suggest that the elevated levels of C. perfringens have no importance in the phenomenon of SIDS and are merely associated without being causal in nature.








72
Materials and Methods

Fecal and Urine Samples

Feces and urine were obtained from SIDS victims and from live controls. Feces from 18 SIDS victims (15 C. perfringeus positive and 3 C perfringens negative) and 10 control infants (5 C. perfringens positive and 5 C perfringens negative) were examined for bile acid content. The sex of the infant was not considered as a factor. Samples were stored at -20 oC until analysis. Samples for analysis were coded and analyzed in a blind fashion without knowledge as to which group they belonged. Fecal samples from live, healthy babies of matching age and environment who were born at term, were gaining weight normally, and were not taking medication or antibiotics were also examined. These infants were considered likely to give an accurate picture of the normal bile acid levels in feces. This matching methodology has been used previously in other SIDS studies as a means of comparison (Telford et al., 1989, Bettelheim et al., 1990; Lindsay et al., 1993).

Urine from 7 SIDS victims and two victims of traumatic death were obtained. Samples were collected by bladder puncture from the dead infants. Because neopterin is light sensitive samples were collected into either foil-covered plastic vials or into opaque brown plastic vials. Samples were stored at -70 oC until analysis.



Microbiology

The methodology of Lindsay et al. (1993) was used for microbiological analysis. C perfringens total viable counts (TVC) of vegetative cells were determined by pour plating of serially diluted fecal samples in duplicate on tryptone-sulfite-neomycin (TSN)








73

agar (BBL, Cockeysville, Md.) and incubating anaerobically at 45 C for 48 hours. TVC of spores were determined by heating a sample at 75 oC for 20 min before plating. TSN is a differential and selective media for C. perfringens with colonies of this organism having a characteristically black color. In this study a TVC of >10' for vegetative cells and >103 for spores was considered presumptive positive. Confirmation of C. perfringens spores was given with a positive ELISA result for CPE with levels of >lug toxin/g feces (Lindsay et al., 1993).



Enterotoxin Quantification

ELISA for CPE was performed. Briefly, fecal samples were diluted 1:10 with 0.1M phosphate buffer pH 6.7 containing 0.85% NaCI, incubated at 25 C for 20 min, then centrifuged at 20,000 g for 15 min at 4oC. The supernatant was collected and analyzed in triplicate in 96 well Immulon-2 plates. After sample incubation and washing, attachment of the primary antibody (rabbit anti-CPE) and secondary (goat anti-rabbit alkaline phosphatase conjugate) antibodies and washing the antigen-antibody complex was detected by the alkaline phosphatase reaction measured after 4 h at 405nm. This procedure was found to have a lower limit of 50 pg (Lindsay et al., 1993).





Bile Acid Analysis

Bile acid extraction and analysis was performed using a combination of published methods (Locket et al., 1989; Roda et al., 1992; Setchell et al., 1983). To 100 mg feces, 400 ul 0.01 N HCI was added in a 15 ml glass screw cap test tube and vortexed for five








74

min. 1.6 ml ethanol was added to the sample and vortexed briefly followed by sonication for 15 min. The sample was then capped tightly and refluxed at 100 oC for 15 min. The sample was cooled and centrifuged at 5000xg for 10 min. The supernatant was removed and retained. The pellet was resuspended by vortexing and then sonicating for 15 min in 2.0 ml 80% aqueous ethanol, capped, and refluxed for 15 min. The sample was again cooled and centrifuged as before and the supernatant removed and retained. The pellet was then resuspended in 50% chloroform/50% methanol by vortexing briefly and sonicating for 10 min. The solution was refluxed as before for 15 min and centrifuged as before. The supernatant was removed and retained. The pellet was scraped onto filter paper and washed with a small volume of 50% chloroform/50% methanol. All extracts were combined and taken to dryness under nitrogen at 42 oC.

The dried extract was resuspended in 1.0 ml 0.01 N HCI and sonicated for 10 min. Chloroform (2.0 ml) was added to extract unconjugated bile acids. The chloroform was removed and the sample dried under nitrogen at 42 oC. The aqueous phase was passed through an activated Bond-Elut cartridge of reversed phase octadecylsilane (Analtichem International, Harbor City, Ca), washed with 5 ml 0.1 N HCI, and then eluted with 2.0 ml methanol to remove conjugated bile acids. The chloroform and methanol fractions were dried together under nitrogen at 42 oC, and resuspended in 0.6 ml volume of the initial mobile phase. HPLC analysis was performed using a Perkin Elmer Series III Chromatograph equipped with a Nova-pac 3.9 x 300 mm C-18, 4 ptm particle size column. The column was kept at a constant 37 oC using a water jacket. The detector was an evaporative light scattering mass detector (ELSD II) (Varex Co. Burtonville, Md). A constant flow rate of 0.9 ml/min was used. The initial mobile phase was 65% (v/v)








75

aqueous methanol containing 15 mMi ammonium acetate adjusted to a pH of 5.4 + 0.1 with acetic acid. Fifteen min after injection of 200 pl of the resuspended extract, a 40 min convex gradient to 85% methanol with 15 mM ammonium acetate (pH 5.4 + 0.1) was run. This methodology gave good separation of each bile acid examined. The peaks for taurocholic acid (TCA), glycocholic acid (GCA), cholic acid (CA), deoxycholic acid (DCA), chenodeoxycholic acid (CDA), and lithocholic acid (LCA) were quantitated. The detection limit was < 10 nM for each bile acid, which is approximately 3 pg/100 mg feces. Two samples for each case were examined, and each sample was run in duplicate. Samples for each bile acid treated in this manner gave > 95% recovery. A standard curve was generated before each series of samples was run. Standards were obtained from Sigma Statistical analysis was performed using the Kruskal-Wallis test for nonparametric data.



Neopterin analysis

A neopterin standard was made by dissolving 10 mg crystalline neopterin in 800 ml distilled, deionized, milli-Q filtered water with gentle heating and constant stirring. The sample was cooled slowly to 25 oC, diluted to 1000 ml, aliquoted into 100 ml opaque containers, and stored at -70 oC until used.

Neopterin and creatinine concentrations were determined in one run in series by high-pressure liquid chromatography. Neopterin concentrations were normalized to creatinine concentrations to account for variations in urine density. All urine samples were diluted 100-fold in potassium phosphate buffer (15 mmol/L, pH 6.4) for analysis and 100 pl of this solution was injected for analysis. A Perkin-Elmer HPLC system with








76

a Supelcosil reversed phase LC-18 column (25 cm x 4.6 mm) with 5 pm bead size was used. Detectors included a Perkin-Elmer diode array detector for measurement of neopterin and a Dionex UV absorption detector for measurement of creatinine. Neopterin was detected by its native fluorescence with 353 nm excitation and 438 nm emmision. Assays were run at 25 oC using a 0.8 ml/min flow rate in an isocratic buffer of the same composition as the diluent used for diluting the urine samples (potassium phosphate buffer 15 mmol/L, pH 6.4).



Results

Examples of typical chromatograms for samples and standards are shown in Figure 5.1. Results for total fecal bile acids for the four categories (SIDS/CP+, SIDS/CP, Control/CP+, Control/CP-) are shown in Figure 5.2. The n value for SIDS CP/- is low which is simply a function of the small population of such SIDS victims. The mean values (p.tg/g feces) for the four categories are SIDS/CP+:310, SIDS/CP-:127, Control/CP+:, Control/CP-:304. These levels are similar to results obtained in a longitudinal study of total fecal bile acids in infants of various ages (Hammons et al., 1988). Comparisons between 1. SIDS CP+/- vs Control CP+/- data, and 2. SIDS CP+ plus Control/CP+ vs SIDS CP- plus Control/CP- showed no significant differences between the rank sums of total bile acids in either case. Analysis of individual bile acids using these comparisons and the same statistical procedures also indicated no significant differences. Taurine conjugates and glycine conjugates were rarely observed in detectable amounts. There was also no difference between total primary and total secondary bile acid excretion in SIDS vs controls, and CP+ vs CP- cases.

































45 6


Figure 6.1 Chromatograms for (A) Standards (B) Representative fecal sample.


1. Taurocholate 2. 4. Chenodeoxycholate 5.




- 1.200
uJ
. 1.000 800

600 400

200
I


Glycocholate Deoxycholate


3. Cholate
6. Lithocholate


SI- CI+ C/-


Figure 6.2 Total fecal bile acid levels. S/+ (SIDS/CP+), S/- (SIDS/CP-), C/+ (Control/CP+), C/- (Control/CP-)


12 3 45 6








78

Results of the neopterin study were inconclusive because of the small sample size, but suggestive. In seven studied cases of SIDS the urinary neopterin level (in pmol neopterin/mol creatinine) was 2208 + 574 (mean + S.D.). Two control infants demonstrated neopterin levels of 320 and 581.



Discussion

Despite considerable evidence of a role for C. perfringens in SIDS, the means whereby the organism sporulates and produces toxins in the gut is not completely understood. This is extremely important in understanding the etiology of SIDS because cause and effect relationships can be especially difficult to elucidate in these cases. Even a cursory review of the SIDS literature indicates that there are many detectable abnormalities in the SIDS population which makes ascertaining a correlation quite different from establishing causality. To cause enteric pathology, C. perfringens must sporulate and interestingly certain bile acids, including taurocholate, are known to stimulate sporulation (Floch et al., 1972; Hickey and Johnson, 1981; Phillips, 1986; Ushijima, 1986; Labbe, 1989). According to Gaull (1983) taurine is a conditionally essential amino acid which is essential during the first few months of life. The formation of cholate conjugates with taurine and glycine in the infant was suggested to be proportional to body weight and normally fully developed after several months. There is a sparing of infants from SIDS during the first month of life. It is interesting to speculate that this may be due to the lower levels of certain bile acids during this period being insufficient to trigger sporulation of C. perfiingens and production ofenterotoxin.








79

This study sought to determine whether fecal bile acid (and in particular taurine and glycine conjugate levels) concentrations could be responsible for the high levels of C. perfringens spores and CPE seen in many SIDS cases. The results obtained do not support the hypothesis that there is any connection. In fact significant taurine and glycine conjugate levels were not observed in any sample, SIDS or control. The vast majority of bile acids were unconjugated (possibly due to deconjugation of the bile acids following collection), with CA, CDA, and LCA predominating. This result is consistent with an earlier study in humans, where bile acids were artificially raised without any apparent difference in anaerobic flora (Williams et al., 1975). I vitro studies, however, have demonstrated a general inhibitory effect of elevated bile acid levels on growth, yet a stimulatory effect on sporulation and enterotoxin synthesis by C. perfringens. Why this effect should not be observed in vivo is not clear. The in vitro studies indicated that each bile acid (sodium cholate, sodium taurocholate, sodium glycochenodeoxycholate, and sodium chenodeoxycholate) inhibited growth to a different degree, while a mixture completely inhibited growth (Heredia et al., 1991). Other studies have shown that high concentrations of sodium taurocholate stimulated sporulation (Ushijima, 1986), however a similar effect in the above mentioned study was observed only at low but not high concentrations (Heredia et al., 1991). Another study, though, found no stimulatory effect of this salt on sporulation (Hickey and Johnson, 1981). Differences in the results of these studies have been suggested to perhaps be due to strains used and media employed (Heredia et al., 1991). Interestingly, sodium taurocholate is often incorporated into media for the selective recovery of clostridia (Wilson et al., 1982), while a sporulation media for C. perfringens containing ox bile has been reported (Phillips, 1982).








80

Excretion of C. perfringens spores and CPE within feces is an excellent indicator of both food poisoning and SIDS (Skjelkvale and Uemura, 1977; Lindsay et al., 1993), however fecal bile acid levels appear not to be correlated with either CP, CPE, or SIDS. Perhaps an examination of ileal bile acids would be more informative. Depressed levels of bile acids could prove to be a risk factor for C. peifringens colonization of the gut. Alternately, transiently increased levels of ileal bile acids may be an inducer of sporulation as was previously suggested. It thus appears that fecal bile acids per se cannot be associated with increased levels of C. perfringens spores and CPE.

The neopterin portion of this study was hampered by several complicating factors. First, the proportion of SIDS victims with urine in their bladders at the time of death was less than one half Second, within the last ten years, likely as a result of the campaign to place babies on their backs or sides to sleep, the SIDS incidence has fallen dramatically from a rate of almost 2 per 1000 live births in 1989 (Willinger, 1989) to approximatly 1 per 1000 live births today (Scott et al., 1998). Third, control infants who die of a noninfectious cause are extremely rare making obtaining proper controls a difficult task.

In this rather limited study neopterin levels far above those considered normal were seen in infants who had died of SIDS. These levels provide evidence that there is indeed an activation of the cell-mediated arm of the immune system, in particular cells of the monocyte/macrophage lineage, in SIDS. These results are consistent with the finding that infants succumbing to SIDS had elevated levels of IL-6 in their cerebrospinal fluid providing evidence of an activated immune system (Vege et al., 1995). A larger study of this phenomenon would thus appear warranted.














CHAPTER 7
CONCLUSIONS

In this work immune response to the Clostridium perfringens type A enterotoxin (CPE) was examined using the mouse model. Initially it was believed that CPE was a superantigen and would thus likely mediate its effects at least in part through T-cell activity. Though this was fotbund to not be true, work done in vitro indicated that it was a potent activator of macrophages (Wallace et al., 1999).

The cytokines levels examined in this work demonstrated that there was a strong pro-inflammatory response to the C. perfringens type A enterotoxin. The spectrum of cytokines induced mirrors closely the cytokine profile produced following LPS exposure. The cytokine protein response ends relatively rapidly when one compares this response with that obtained following challenge with either LPS or with a staphylococcal suparantigneic enterotoxin. This work utilized mice that were not sensitized with D-gal as are the mice in experiments involving the other toxins. It is certainly possible that the perturbation of the immune system by D-gal lengthens the response to bacterial toxins. Other researchers have used these sensitized mouse models since they more closely mimic the immune response observed in humans, as to concentration required to generate a pathophysiological response or type of response obtained (Miethke et al., 1993). To date no work has been performed in non-stimulated mice as to cytokine time course following exposure to either LPS or the staphylococcal enterotoxins. It should be considered that CPE interferes with macromolecular synthesis and viability in sensitive 81








82
cells including those of the monocyte/macrophage lineage (Wallace et al., 1999). As it appears from the work outlined here that the CPE induced proinflammatory response is primarily a result of these cells then it also is possible that synthesis of these cytokines is a self-limiting phenomenon.

The finding that the liver and bowel are transcriptionally active for cytokines during CPE intoxication is in agreement with previous results which found high binding to tissues from these organs (Keller, 1997).

Serum cytokines decline before CPE is eliminated from the body in the mouse model (Keller, 1997). Free CPE is still detectable in thymus, bowel, and heart 72 hours after IG administration of 0.5 MILD, the amount used in these studies. The inflammatory response is thus attenuated through as yet undetermined means. Three possibilities, not mutually exclusive, are suggested to explain this phenomenon. 1) Cytokine transcription is downregulated. This appears to be the case with IL-6 in which serum proteins remain elevated long after transcription of this cytokine has ceased. 2) Free cytokines are bound by soluble receptors. This appears likely in the case of IL-le as transcription of this cytokine remains high through the 8 h time point despite the fact that detectable serum protein levels begin to decline after the 4 h time point and have reached baseline levels by the 8 h determination. 3) Third, sensitive cells, including a macrophage cell line, show decreased viability following the initial mitogenic effect observed following CPE exposure. This lethal effect is almost assuredly the result of the pore-forming activity and subsequent inhibition of macromolecular synthesis demonstrated by this toxin. It thus appears likely that the inflammatory response generated by CPE is a self-limiting








83
phenomenon. There appear to be controls built into the cytokine expression system at both the transcriptional level as well as the protein expression level either through translational controls or through the synthesis or release of mediators which bind free cytokines. Also cells generating the response are killed after an initial period of heightened activity and thus would not contribute to further inflammatory activity (Wallace et al., 1999).

In conclusion, CPE has been found to generate an immune response which is of a type found to be similar to that observed following exposure to LPS and the staphylococcal enterotoxins. This response appears, when one examines transcription of mRNA for cytokines, to be the result of multiple organs including spleen, liver, and bowel. In the food-borne CPE intoxication this cytokine response could play a role in the accompanying nausea. In the infectious diarrhea syndrome there is a more protracted exposure to CPE. The greater tissue damage evident during this illness could in fact be due to resultant inflammatory processes mediated by cytokines. Clinical research investigating this possibility should be undertaken as should animal model studies. Additionally, if CPE is involved in the sudden infant death syndrome then this work could be of great value in proving this hypothesis. A role for bile acids in SIDS was not supported by this research. The cytokines examined and their profiles suggest that further research should be conducted on the phenomenon of SIDS examining products related to CPE exposure which persist after the initial rapid response. A large enough series of urine samples should be evaluated for neopterin levels to make an evaluation of








84
whether the heightened levels seen in our small preliminary study are present in those amounts in a larger and statistically significant group of SIDS victims.














REFERENCES


Ahtonen P, Lehtonen OP, Kero P, Eerola E, Hartiala K (1994) Clostridium perfringens in stool, intrapartum antibiotics and gastrointestinal signs in a neonatal intensive care unit. Acta Paediatr 83:389-390.

Ambach E, Tributsch W, Fuchs D, Reibnegger G, Henn R, Wachter H (1991) Postmortem evaluation of serum and urine neopterin concentrations J Forensic Sci 36:1089-1093.

Ando Y, Tsuzuki T, Sunagawa H, Oka S (1985) Heat resistance, spore germination, and enterotoxigenicity of Clostridium perfringens. Microbiol Immunol 29:317-326.

Baron S, Tyring SK, Fleischmann WR, Coppenhaver DH, Neisel DW, Klimpel GR, Stanton J, Hughes TK (1991) The interferons: mechanisms of action and clinical applications. JAMA 266:1375-1383.

Barton BE, Jackson JV (1993) Protective role of interleukin 6 in the lipopolysaccharidegalactosamine septic shock model. Infect Immun 61:1496-1499.

Bathe OF, Rudston-Brown B, Chow AWC, Phang PT (1996) Gut is not a source of cytokines in a porcine model of endotoxicosis Surgery 120:522-533.

Beagley KW, Elson CO (1992) Cells and cytokines in mucosal immunity and inflammation. Gastroenterol Clin N Am 12:347-366.

Beckwith JB (1988) Intrathoracic petechial hemorrhages: a clue to the mechanism of death in sudden infant death syndrome? Ann NY Acad Sci 533:37-47.

Bejarano MT, Masucci MG, Klein E (1986) Differential effect of Cyclosporin-A on the mixed-lymphocyte culture-induced proliferative and cytotoxic responses of Tlymphocytes with different cell densities. Cell Immunol 103:409-416.

Belardelli F (1995) Role of interferons and other cytokines in the regulation of the immune response. APMIS 103:161-179.

Bemelmans MHA, van Tits LJH, Buurman WA (1996) Tumor necrosis factor: function release and clearence. Crit Rev Immunol 16:1-11.










Bette M, Shafer VMKH, van Rooijen N, Weihe E, Fleischer B (1993) Distribution and kinetics of superantigen-induced cytokine gene expression in mouse spleen. J Exp Med 178:1531-1540.

Bettelheim LA, Goldwater PN, Dwyer BW, Bourne AJ, Smith DL (1990) Toxigenic Esherichia coli associated with SIDS. Scand J Infect Dis 22:467-476.

Bhakdi S, Muhly M, Korom S, Schmidt G (1990) Effects of Escherichia coli hemolysin of human monocytes. J Clin Invest 85:1746-1753.

Bowness P, Moss PAH, Tranter H, Bell JI, McMichael AJ (1992) Clostridium perfringens enterotoxin is a superantigen reactive with human T cell receptors V36.9 and V322. J Exp Med 176:893-896.

Brynskov J, Nielesen OH, Ahnfelt-Ronne 1, Bendtzen K (1992) Cytokines in inflammatory bowel disease. Scand J Gastroenterol 27:897-906.

Bunjes D, Hardt C, Rollinghoff M, Wagner H (1981) Cyclosporin A mediates immunosuppression of primary cytotoxic T cell responses by impairing the release of interleukin 1 and interleukin 2. Eur J Immunol 11:657-661.

Byard RW (1991) Possible mechanisms responsible of SIDS. J Pediatr Child Health 27:147-157.

Canard B, Saint-Joanis B, Cole ST (1992) Genomic diversity and organization of virulence genes in the pathogenic anaerobe Clostridium peifringens. Molc Microbiol 6:1421-1429.

Cavaillon JM (1994) Cytokines and macrophages. Biomed Pharmacother 48:445-453.

Cerami A (1992) Inflammatory cytokines. Clin Immunol Immunopath 62:S3-S10.

Cohen MC, Cohen S (1996) Cytokine Function: a study in biologic diversity. Am J Clin Pathol 105:589-598.

Collee JG (1974) Clostridium perfringens (C. welchii) in the human gastrointestinal tract. Soc Appl Bacteriol Symp Ser 3:205-219.

Collie RE, McClane BA (1998) Evidence that the enterotoxin gene can be episomal in Clostridium perfringens isolates associated with non-food-borne human gastrointestinal disease. J Clin Microbiol 36:30-36.

Cornillot E, Saint-Joanis B, Daube G, Granum PE, Canard B, Cole ST (1995) The enterotoxin gene (cpe) of Clostridium pefri igens can be chromosomal or plasmidborne. Molecular Microbiol 15:639-647.










Cox G, Gauldie J (1997) Interleukin-6. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 81-99.

Czeczulin JR, Hanna PC, McClane BA (1993) Cloning, nucleotide sequencing, and expression of the Clostridiumn perfringens enterotoxin gene in Eschericia coli. Infect Immun 61:3429-3439.

Dinarello CA (1992) Role of Interleukin-1 in infectious diseases. Immun Rev 127:119146.

Dugas B, Mossalayi MD, Damais C, Kolb J-P (1995) Nitric oxide production by human monocytes: evidence for a role of CD23. Immunol Today 16:574-579.

Duncan CL, Strong DH (1968) Improved medium for sporulation of Clostridium perfringens. Appl Microbiol 16:82-89.

Duncan CL, Strong DH (1969) Ileal loop fluid accumulation and production of diarrhea in rabbits by cell-free products of Clostridium perfritigens. J Bacteriol 100:86-94.

Eigler A, Sinha B, Hartmann G, Endres S (1997) Taming TNF: strategies to restrain this proinflammatory cytokine. Trends Immunol 18:.488-492.

Fantone JC (1997) Cytokines and neutrophiles: Neutrophile derived cytokines and the inflammatory response. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 373-380.

Farner NL, Hank JA, Sondel PM (1997) Interleukin-2: molecular and clinical aspects. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 29-40.

Ferrini S Moretta A, Biassoni R, Nicolin A, Moretta L (1986) Cyclosporin-A inhibits IL-2 production by all human T-cell clones having this function, independent of the T4/T8 phenotype or the coexpression of cytolytic activity. Clin Immunol Immunopathol 38:79-84.

Fisher NMM, Yousef IM (1973) Sex differences in the bile acid composition of human bile: studies in patients with and without gallstones. Can Med Assoc J 109:190-193.

Flegel WA, Muller F, Daubener W, Fischer HG, Hadding U, Northoff H (1991) Cytokine response by human monocytes to Clostridium difficile toxin A and toxin B. Infect Immun 59:3659-3666.

Floch MI-I, Binder HJ, Filburn BF, Gershengoren W (1972) The effect of bile acids on intestinal microflora. Amer J Clin Nut 25:1418-1426.










Fong Y, Tracey KJ, Moldawer LL, Hesse DG, Manogue KB, Kenney JS, Lee AT, Kuo GC, Allison AC, Lowry SF, Cerami A (1989) Antibodies to cachectin/tumor necrosis factor reduce interleukin 13 and interleukin 6 appearance during lethal bacteremia. J Exp Med 170:1627-1633.

Freudenberg MA, Keppler D, Galanos C (1986) Requirement for lipopolysaccharideresponsive macrophages in galactosamine-induced sensitization to endotoxin. Infect Immun 51:891-895.

Frieben WR, Duncan CL (1973) Homology between enterotoxin and spore structural protein Clostridium perfringens. Eur J Biochem 39:393-401.

Fuchs D, Weiss G, Reibnegger G, Wachter H (1992) The role of neopterin as a monitor of cellular immune activation in transplantation, inflammatory, infectious, and malignant diseases. Crit Rev Clin Lab Sci 29:307-341.

Galanos C, Freudenberg MA, Reutter W (1979) Galactosamine-induced sensitization to the lethal effects of endotoxin. Proc Natl Acad Sci (USA) 76:5939-5943.

Galanos C, Freudenberg MA (1993) Mechanisms of endotoxin shock and endotoxin hypersensativity. Immunobiol 187:346-356.

Garcia-Alvarado JS, Labbe RG, Rodriguez MA (1992) Sporulation and enterotoxin production by Clostridium perfringens Type A at 37 and 430C. App Environ Microbiol 58:1411-1414.

Gaull GE (1983) Taurine in human milk: growth modulator or conditionally essential amino acid? J Pediatr Gastroenterol 2:S266-S271.

George WL, Finegold SMN (1988) Clostridia in the human gastrointestinal flora. In:Finegold SM (ed) Closridia in gastrointestinal disease. Orlando: CRC Press, 1988:135.

Goldner SB, Solberg M, Jones S, Post LS (1986) Enterotoxin synthesis by nonsporulating cultures of Clostridiumn perfringens. Appi Env Microbiol 52:407-412.

Gorbach SL, Tabaqchali S (1969) Bacteria, bile and the small bowel. Gut 10:963-972.

Guyton AC (1987) Human physiology and mechanisms of disease. 4th ed. Philadelphia: Saunders WB pp 497-509.

Hammons JL, Jordan WE, Stewart RL, Taulbee JD, Berg RW (1988) Age and diet effects on fecal bile acids in infants. J Pediatr Gastroenterol 7:30-38.

Hatheway CL (1990) Toxigenic Clostridia. Clin Microbiol Rev 3:66-98.









Henderson B, Poole S, Wilson M (1996) Bacterial modulins: a novel class of virulence factors which cause host tissue pathology by inducing cytokine synthesis. Microbiol Rev 60:316-341.

Heredia NL, Labbe RG, Rodriguez MA, Garcia-Alvarado JS (1991) Growth, sporulation and enterotoxin production by Clostridium perfringens type A in the presence of human bile salts. FEMS Microbiol Lett 84:15-22.

Hickey CS, Johnson MG (1981) Effects of pH shifts, bile salts, and glucose on sporulation of Clostridium perfringens NCTC 8798. Appl Environ Microbiol 41:124-129.

Hirano T (1992) Interleukin-6 and its relation to inflammation and disease. Clin Immunol Immunopath 62:S60-S65.

Holdsworth RJ (1992) Fatal postoperative gastric necrosis caused by Clostridium perfringens. Eur J Surgery 158:447-449.

Holt JG (1984) Bergey's Manual of Systemic Bacteriology. 4tl ed. Williams and Wilkins, Baltimore, Md.

Hulkower KI, Wnek AP, McClane BA (1989) Evidence that alterations in small molecule permeability are involved in the Clostridcium perfringens type A enterotoxininduced inhibition of macromolecular synthesis in Vero cells. J Cell Physiol 140:498504.

Johnson S, Gerding DN (1997) Enterotoxemic infections. In Rood JI, McClane BA, Songer JG, Titball RW (eds) The Clostridia: molecular biology and pathogenesis. San Diego: Academic press, Inc. pp. 120-135.

Katahira J, Inoue N, Horiguchi Y, Matsuda M, Sugimoto N (1997) Molecular cloning and functional characterization of the receptor for Clostridium perfringens enterotoxin. J Cell Biol 136:1239-1247.

Keller AM (1997) Distribution and detection of Clostridium perfringens type A enterotoxin after intraperitoneal and intragastric administration using the murine model. Doctoral Thesis, University of Florida.

Klein E (1895) Uber einen pathgenen anaeroben Darmbacillus, Bacillus enteritidis sporogenes. Zentrabl Bakteriol Parasitenkd Infectionskr Hyg 18:737.

Kokai-Kun JF, McClane BA (1997a) The Clostridium perfringens enterotoxin. In: Rood JI, McClane BA, Songer JG, Titball RW (eds) The Clostridia: molecular biology and pathogenesis. San Diego: Academic press, Inc. pp. 325-357.










Kokai-Kun JF, McClane BA (1997b) Deletion analysis of the Clostridium perfrmgens enterotoxin. Infect Immun 65:1014-1022.

Krakauer, Fleischer B, Stevens DL, McClane BA, Stiles BG (1997) Clostridium perfringens enterotoxin lacks superantigenic activity but induces an 1L-6 response form human peripheral blood mononuclear cells. Infect Immun 65:3485-3488.

Krous HF (1984) The microscopic distribution of intrathoracic petechiae in sudden infant death syndrome. Arch Path Lab Med 108:77-79.

Labbe RG, Duncan CL (1977) Evidence for stable messenger ribonucleic acid during sporulation and enterotoxin synthesis by Clostridiumn perfringens type A. J Bacteriol 129:843-849.

Labbe RG, Nolan LL (1981) Stimulation of Clostridiiium perfringens enterotoxin formation by caffeine and theobromine. Infect Immun 34:50-54.

Labbe RG (1989) Clostridiumpeifringens. In: Doyle MP (ed) Food-borne bacterial pathogens. New York: Marcel Dekker, Inc., pp 192-234.

Larson HE, Borriello SP (1988) Infectious diarrhea due to Clostridium perfringens. J Infect Dis 157:390-391.

Lehmann V, Freudenberg MA, Galanos C (1987) Lethal toxicity of lipopolysaccharide and tumor necrosis factor in normal and d-galactosamine-treated mice. J Exp Med 165:657-663.

Lindsay JA (1996) Clostridiumn perfringens Type A enterotoxin (CPE): more than just explosive diarrhea. Crit Rev Microbiol 22:257-277.

Lindsay JA, Dennison JD (1986) Histopathological effect of Clostridiumn perfringens 86 enterotoxin on rabbit intestine. Curr Microbioll3:61-66.

Lindsay JA, Johnson HM, Wallace FM, Soos JMI (1994) Can superantigens trigger sudden infant death syndrome? Med Hypoth 43:81-85.

Lindsay JA, Mach AS, Wilkinson MA, Martin LM, Wallace FM, Keller AM, Wojciechowski LM (1993) Clostridium peifringens Type A cytotoxic-enterotoxin(s) as triggers for death in the sudden infant death syndrome: development of a toxico-infection hypothesis. Curr Microbiol 27:51-59.

Locket PL, Gallager DD (1989) An improved procedure for bile acid extraction and purification. Lipids 24:221-223.




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EZ8L26TNQ_EHUK9L INGEST_TIME 2015-04-14T18:33:36Z PACKAGE AA00030024_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


xml version 1.0 encoding UTF-8 standalone no
fcla fda yes
!-- Immune reaction following intoxication with Clostridium perfringens type A enterotoxin ( Book ) --
METS:mets OBJID AA00030024_00001
xmlns:METS http:www.loc.govMETS
xmlns:xlink http:www.w3.org1999xlink
xmlns:xsi http:www.w3.org2001XMLSchema-instance
xmlns:daitss http:www.fcla.edudlsmddaitss
xmlns:mods http:www.loc.govmodsv3
xmlns:sobekcm http:digital.uflib.ufl.edumetadatasobekcm
xmlns:lom http:digital.uflib.ufl.edumetadatasobekcm_lom
xsi:schemaLocation
http:www.loc.govstandardsmetsmets.xsd
http:www.fcla.edudlsmddaitssdaitss.xsd
http:www.loc.govmodsv3mods-3-4.xsd
http:digital.uflib.ufl.edumetadatasobekcmsobekcm.xsd
METS:metsHdr CREATEDATE 2015-04-09T15:10:02Z ID LASTMODDATE 2015-03-13T10:03:24Z RECORDSTATUS COMPLETE
METS:agent ROLE CREATOR TYPE ORGANIZATION
METS:name UF,University of Florida
OTHERTYPE SOFTWARE OTHER
Go UFDC - FDA Preparation Tool
INDIVIDUAL
UFAD\renner
METS:dmdSec DMD1
METS:mdWrap MDTYPE MODS MIMETYPE textxml LABEL Metadata
METS:xmlData
mods:mods
mods:accessCondition The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
mods:genre authority marcgt bibliography
non-fiction
mods:identifier ALEPH 030368006
OCLC 42673435
mods:language
mods:languageTerm text English
code iso639-2b eng
mods:location
mods:physicalLocation iuf
mods:name personal
mods:namePart Wallace, F. Morgan
given F. Morgan
family Wallace
mods:role
mods:roleTerm Main Entity
mods:note thesis Thesis (Ph.D.)--University of Florida, 1999.
bibliography Includes bibliographical references (leaves 85-97).
statement of responsibility by F. Morgan Wallace.
Typescript.
Vita.
mods:originInfo
mods:place
mods:placeTerm marccountry xx
mods:dateIssued marc 1999
point start 1999
mods:recordInfo
mods:recordIdentifier source sobekcm AA00030024_00001
mods:recordCreationDate 990709
mods:recordOrigin Imported from (ALEPH)030368006
mods:recordContentSource University of Florida
marcorg FUG
mods:languageOfCataloging
English
eng
mods:relatedItem original
mods:physicalDescription
mods:extent x, 98 leaves : ill. ; 29 cm.
mods:subject SUBJ650_1 lcsh
mods:topic Clostridium diseases
SUBJ650_2
Clostridium perfringens
Toxicology
SUBJ650_3
Immunotoxicology
SUBJ690_1
Food Science and Human Nutrition thesis, Ph.D
SUBJ690_2
Dissertations, Academic
Food Science and Human Nutrition
mods:geographic UF
mods:titleInfo
mods:title Immune reaction following intoxication with Clostridium perfringens type A enterotoxin
mods:typeOfResource text
DMD2
OTHERMDTYPE SOBEKCM SobekCM Custom
sobekcm:procParam
sobekcm:Aggregation ALL
UFIRG
UFIR
UFETD
IUF
VENDOR
VENDORIA
sobekcm:MainThumbnail immunereactionfo00wall_0000thm.jpg
sobekcm:Wordmark UFIR
UF
sobekcm:bibDesc
sobekcm:BibID AA00030024
sobekcm:VID 00001
sobekcm:EncodingLevel K
sobekcm:Source
sobekcm:statement UF University of Florida
METS:amdSec
METS:digiprovMD DIGIPROV1
DAITSS Archiving Information
daitss:daitss
daitss:AGREEMENT_INFO ACCOUNT PROJECT UFDC
METS:techMD TECH1
File Technical Details
sobekcm:FileInfo
sobekcm:File fileid JP21 width 2412 height 3282
JPEG1 630 857
JPEG2
JP22
JPEG3 859
JP23 3289
JPEG4 861
JP24 2408 3290
JPEG5
JP25 3285
JPEG6 860
JP26
JPEG7
JP27
JPEG8
JP28
JPEG9
JP29 2404 3278
JPEG10
JP210 3286
JPEG11
JP211 3277
JPEG12
JP212 3276
JPEG13
JP213 2400
JPEG14
JP214 3280
JPEG15
JP215 3273
JPEG16
JP216
JPEG17
JP217 3275
JPEG18 858
JP218 3269
JPEG19
JP219 3272
JPEG20 865
JP220 2396
JPEG21
JP221
JPEG22 864
JP222 3287
JPEG23
JP223
JPEG24 863
JP224 3283
JPEG25
JP225
JPEG26
JP226 3288
JPEG27
JP227 2392 3284
JPEG28
JP228
JPEG29 867
JP229
JPEG30
JP230
JPEG31 866
JP231
JPEG32
JP232
JPEG33
JP233
JPEG34
JP234 2388
JPEG35
JP235
JPEG36
JP236
JPEG37
JP237 3270
JPEG38
JP238
JPEG39
JP239 3271
JPEG40
JP240 3279
JPEG41
JP241
JPEG42
JP242 2384
JPEG43
JP243
JPEG44
JP244
JPEG45 869
JP245
JPEG46
JP246
JPEG47
JP247 3281
JPEG48
JP248
JPEG49 868
JP249 2380
JPEG50
JP250
JPEG51
JP251
JPEG52 871
JP252
JPEG53
JP253
JPEG54
JP254
JPEG55
JP255
JPEG56
JP256
JPEG57
JP257
JPEG58
JP258 2376
JPEG59
JP259
JPEG60
JP260
JPEG61 872
JP261
JPEG62
JP262
JPEG63 870
JP263
JPEG64
JP264
JPEG65
JP265
JPEG66
JP266
JPEG67
JP267 2372
JPEG68
JP268
JPEG69
JP269
JPEG70
JP270
JPEG71
JP271
JPEG72
JP272
JPEG73
JP273 3265
JPEG74
JP274 3267
JPEG75
JP275 3263
JPEG76
JP276
JPEG77 875
JP277 2368
JPEG78
JP278
JPEG79 873
JP279
JPEG80
JP280
JPEG81
JP281
JPEG82 876
JP282 3291
JPEG83
JP283
JPEG84
JP284
JPEG85
JP285
JPEG86 874
JP286
JPEG87
JP287 3293
JPEG88
JP288
JPEG89
JP289 2364
JPEG90
JP290
JPEG91
JP291
JPEG92
JP292
JPEG93
JP293
JPEG94
JP294
JPEG95
JP295
JPEG96
JP296 3274
JPEG97
JP297
JPEG98
JP298 2360
JPEG99
JP299
JPEG100
JP2100
JPEG101
JP2101
JPEG102
JP2102
JPEG103
JP2103
JPEG104
JP2104
JPEG105
JP2105
JPEG106
JP2106
JPEG107
JP2107 2356
JPEG108 882
JP2108 2340
JPEG109 883
JP2109
JPEG110 884
JP2110
METS:fileSec
METS:fileGrp USE archive
METS:file GROUPID G1 TIF1 imagetiff CHECKSUM 062408201abc95e57b97748afdd09611 CHECKSUMTYPE MD5 SIZE 23761292
METS:FLocat LOCTYPE OTHERLOCTYPE SYSTEM xlink:href immunereactionfo00wall_0000.tif
G2 TIF2 f34d7b4c16a10d2fcd47375e81eecd7c 23760712
immunereactionfo00wall_0001.tif
G3 TIF3 7403b002dde96917b0837ccf87e8fe01 23813668
immunereactionfo00wall_0002.tif
G4 TIF4 44e5398c36570a557f9ab0b41556f9ce 23780732
immunereactionfo00wall_0003.tif
G5 TIF5 d0cc0aa3118bb48162d4ef170f660e90 23745012
immunereactionfo00wall_0004.tif
G6 TIF6 85f270a3b4688f12cf2df1f653871dc6 23772440
immunereactionfo00wall_0005.tif
G7 TIF7 2b6dc9a727e43f35fab25c8b5f3e8b44 23743788
immunereactionfo00wall_0006.tif
G8 TIF8 a91e215cf32a19ec4acb1f90f8312567 23723056
immunereactionfo00wall_0007.tif
G9 TIF9 c24b497401f28291eec21df301a0263f 23653352
immunereactionfo00wall_0008.tif
G10 TIF10 392bc35f1374e58378718ce778bf3e1f 23714088
immunereactionfo00wall_0010.tif
G11 TIF11 56c2afbc3c3c44cd50afafde61878b0d 23648344
immunereactionfo00wall_0011.tif
G12 TIF12 2659703ed880e2965c88054529241ae4 23641036
immunereactionfo00wall_0012.tif
G13 TIF13 17ef022e8ff5abc53f40818a0580db54 23600856
immunereactionfo00wall_0013.tif
G14 TIF14 8a9ec3f785fb107f291f62a8f4f15d62 23630504
immunereactionfo00wall_0014.tif
G15 TIF15 9fa9ec575a21b5b6164f5655ed388cf2 23580560
immunereactionfo00wall_0015.tif
G16 TIF16 76a1a984001b1f88920495c327c4c395 23601600
immunereactionfo00wall_0016.tif
G17 TIF17 f017526ba0c6e3ba9b5661e37d63aa66 23594764
immunereactionfo00wall_0017.tif
G18 TIF18 880bbbec728fa7c7a088f55c973b33ce 23551952
immunereactionfo00wall_0018.tif
G19 TIF19 db741f68e5480e6b28385786020af5fe 23573440
immunereactionfo00wall_0019.tif
G20 TIF20 2313a3d309c832735bae0dad49578470 23656244
immunereactionfo00wall_0020.tif
G21 TIF21 e362cec7d5fb96ee6dd199b217cb4fcd 23656772
immunereactionfo00wall_0021.tif
G22 TIF22 8bffec270e99468c83433c3408dd8045 23641768
immunereactionfo00wall_0022.tif
G23 TIF23 16ca0cfa42e588bd603327b94cab95bc 23634828
immunereactionfo00wall_0023.tif
G24 TIF24 9ac7a6c70af2dd827d20771ff885596f 23613168
immunereactionfo00wall_0024.tif
G25 TIF25 e1f9fbe23ea1a737ad874c78c903274e 23656656
immunereactionfo00wall_0025.tif
G26 TIF26 b0bf80816fe09ea3424a45b0f1df8fd6 23649436
immunereactionfo00wall_0026.tif
G27 TIF27 f2d9aa623631deac3f81da7b03be116d 23581088
immunereactionfo00wall_0027.tif
G28 TIF28 dc3f4c73c6acf004e8738cd1ebef5f3e 23516584
immunereactionfo00wall_0028.tif
G29 TIF29 271e6b200148cf2a87629f12ac1121e7 23624516
immunereactionfo00wall_0029.tif
G30 TIF30 f6c320445db36b8f324b130c36a39af3 23581252
immunereactionfo00wall_0030.tif
G31 TIF31 0f59ff0ebca07310de0423a8c7497ad7 23610136
immunereactionfo00wall_0031.tif
G32 TIF32 a546ee7f8b5a61556be9c6005c14718f 23573492
immunereactionfo00wall_0032.tif
G33 TIF33 6f2f474473bba323e013f15d927bea82 23573060
immunereactionfo00wall_0033.tif
G34 TIF34 67d86c996617d226a534e148c0606f5f 23455472
immunereactionfo00wall_0034.tif
G35 TIF35 e4811ddb03cad8a456c17fd0bd188c8f 23534264
immunereactionfo00wall_0035.tif
G36 TIF36 f3753e5a303524fbdfbe094c02e59256 23484184
immunereactionfo00wall_0036.tif
G37 TIF37 3ca7f43792db700011e30cbe41eab0e6 23441328
immunereactionfo00wall_0037.tif
G38 TIF38 803d574cdc7fa914b455ff15776eac99 23441600
immunereactionfo00wall_0038.tif
G39 TIF39 6263cb61355b64546083d9a6f305285d 23448836
immunereactionfo00wall_0039.tif
G40 TIF40 0df31910bc7d0459844fbf0e4b0a6158 23504816
immunereactionfo00wall_0040.tif
G41 TIF41 16d0c034551194af972c11d2f85f073e 23505100
immunereactionfo00wall_0041.tif
G42 TIF42 b0f1ff1c28b196931f3cb63302f24eac 23465928
immunereactionfo00wall_0042.tif
G43 TIF43 4bf078fb81fe3af957207634e97ba120 23594836
immunereactionfo00wall_0043.tif
G44 TIF44 4daab632193b1e9fc12629f1b3ebb12a 23465548
immunereactionfo00wall_0044.tif
G45 TIF45 de8961a8eed222e635f8ce0722d2dfb8 23522072
immunereactionfo00wall_0045.tif
G46 TIF46 b8cb1ce30997b41406db038f55cc5720 23466072
immunereactionfo00wall_0046.tif
G47 TIF47 a12bd7f08cdd84aeffaef21f4d57675f 23480740
immunereactionfo00wall_0047.tif
G48 TIF48 6aae3f287f4c3127ff3ef352f360954d 23465936
immunereactionfo00wall_0048.tif
G49 TIF49 5f561435cbd405926ebcf52e413c8692 23426616
immunereactionfo00wall_0049.tif
G50 TIF50 3b5abb19887c5faef59375c37d75c330 23461212
immunereactionfo00wall_0050.tif
G51 TIF51 49d795a2b9490b406d5d126206e28b24 23453756
immunereactionfo00wall_0051.tif
G52 TIF52 ffd789ce14402b69b3af77ead1c9cded 23496948
immunereactionfo00wall_0052.tif
G53 TIF53 ca6205d9a685f9b6b3bab1bbf93e55af 23425428
immunereactionfo00wall_0053.tif
G54 TIF54 75758c57530bc898b62b2213897ed31e 23425140
immunereactionfo00wall_0054.tif
G55 TIF55 65d3731228030d46ce13eb40e9c55ef7 23432432
immunereactionfo00wall_0055.tif
G56 TIF56 d559082fa535731decbfb31e4910bca7 23425156
immunereactionfo00wall_0056.tif
G57 TIF57 ae663bda907e575b59e256f728101d15 23404036
immunereactionfo00wall_0057.tif
G58 TIF58 61080fb85321fcce08501f15fac8b4cd 23357600
immunereactionfo00wall_0058.tif
G59 TIF59 2f43004cbbb1468c78b6dd67c927e3f1 23335956
immunereactionfo00wall_0059.tif
G60 TIF60 4e3a22d720f0cfe2d453670d6447e111 23387784
immunereactionfo00wall_0060.tif
G61 TIF61 b185ddccffadfa5a4c769871bc7ef3e6 23459424
immunereactionfo00wall_0061.tif
G62 TIF62 b1f30faf6f6238f0cb08b35cb7cd90f3 23431128
immunereactionfo00wall_0062.tif
G63 TIF63 3e6ddc439960a349b7ac4b80053f28ce 23414788
immunereactionfo00wall_0063.tif
G64 TIF64 b61b125d596c96b36d6f6c4639d47400 23458152
immunereactionfo00wall_0064.tif
G65 TIF65 f860e8a5a99520e0ea8fe0f8f191c9ba 23415620
immunereactionfo00wall_0065.tif
G66 TIF66 75f0d10c405b6ff38c6d49f472e7bc77 23415748
immunereactionfo00wall_0066.tif
G67 TIF67 7040f9456f1aa01191101cefed81ff34 23376592
immunereactionfo00wall_0067.tif
G68 TIF68 27c875a53639c07723bae3d425803d56 23415996
immunereactionfo00wall_0068.tif
G69 TIF69 ff7d7c8aa0572acd1cc1c0b5c530491d 23290572
immunereactionfo00wall_0069.tif
G70 TIF70 e2591600b651a814cd659ea62aeca314 23284344
immunereactionfo00wall_0070.tif
G71 TIF71 c35eda4e981d7df6a8194acf63427b16 23291032
immunereactionfo00wall_0071.tif
G72 TIF72 b3fbd665c3ef6b437d2bc56820ce8410 23326868
immunereactionfo00wall_0072.tif
G73 TIF73 ac8ccf0f83552376d49ff9e20d17de98 23248380
immunereactionfo00wall_0073.tif
G74 TIF74 553ffb8253a5a0f6127f964cfefd45ec 23262872
immunereactionfo00wall_0074.tif
G75 TIF75 be194fe72f4fbf5879d9dea5f6cb4ed0 23234496
immunereactionfo00wall_0075.tif
G76 TIF76 a85f4116a3fd2f40a0d31154dd459787 23348188
immunereactionfo00wall_0076.tif
G77 TIF77 489fa352ae5782f9680adce2d5ecd4a9 23386048
immunereactionfo00wall_0077.tif
G78 TIF78 38bf4557277910c0b7d8ef1247154d2d 23372972
immunereactionfo00wall_0078.tif
G79 TIF79 1acfb40e0c38fa20c3d9b6f401550641 23334860
immunereactionfo00wall_0079.tif
G80 TIF80 85ef4355fb007e848dc68e89edfc2c97 23379668
immunereactionfo00wall_0080.tif
G81 TIF81 4e3cb08572411c68ce49b45e0f6f24ef 23380148
immunereactionfo00wall_0081.tif
G82 TIF82 0f4888a04c9828598b07dd693c1de2fe 23394076
immunereactionfo00wall_0082.tif
G83 TIF83 8822fdabdff833bcf5dd236d401f536e 23386948
immunereactionfo00wall_0083.tif
G84 TIF84 d482098fc9d71cc9040115ef2a6f6447 23373392
immunereactionfo00wall_0084.tif
G85 TIF85 8dd4af30ae940e233816907873cd4669 23337304
immunereactionfo00wall_0085.tif
G86 TIF86 b7588d23a41b7ed2d8b14c79d2833644 23351680
immunereactionfo00wall_0086.tif
G87 TIF87 80aed75041c7b6ac209a76e60fd916d2 23407108
immunereactionfo00wall_0087.tif
G88 TIF88 0a9e3912b998d3298b39af9d46dd6cfc 23344416
immunereactionfo00wall_0088.tif
G89 TIF89 8c66755d411762fdff65600b848054c8 23305324
immunereactionfo00wall_0089.tif
G90 TIF90 3d1279ad2231dc5b5541d2b611501c49 23241284
immunereactionfo00wall_0090.tif
G91 TIF91 c3fab0e67c8c53e558541d58afd82b5f 23297652
immunereactionfo00wall_0091.tif
G92 TIF92 816915b8cccb304fab74eadf5c320e0f 23297992
immunereactionfo00wall_0092.tif
G93 TIF93 43a1f70bc84e859c24f055d60c2028ca 23262484
immunereactionfo00wall_0093.tif
G94 TIF94 ef8a9ee60c285978d4adb15d90bae399 23295348
immunereactionfo00wall_0094.tif
G95 TIF95 63da4683a5bd733763f71768ed8ce8bc 23255188
immunereactionfo00wall_0095.tif
G96 TIF96 7658bc4d633c1c278767a73dea9e9987 23234312
immunereactionfo00wall_0096.tif
G97 TIF97 d417f88cdf956733486c0cfa1b9ba9ac 23227324
immunereactionfo00wall_0097.tif
G98 TIF98 ba9bcc1778caf484086877846689dca7 23188104
immunereactionfo00wall_0098.tif
G99 TIF99 f53c7c590fde5590046a280d6125f4c9 23298024
immunereactionfo00wall_0099.tif
G100 TIF100 5cc46b9e8c466d1e76f5f8cec84c79fc 23298164
immunereactionfo00wall_0100.tif
G101 TIF101 08ae1b72efc24557ca71678ec3f3dbdd 23230516
immunereactionfo00wall_0101.tif
G102 TIF102 e27bdb1feaca850d1cf8440efae5993b 23230620
immunereactionfo00wall_0102.tif
G103 TIF103 97e5940b46974a36d33c5a132ee447f1 23258732
immunereactionfo00wall_0103.tif
G104 TIF104 02f8c3814d5f437fd76c926eb39e315c 23258744
immunereactionfo00wall_0104.tif
G105 TIF105 59abeda43a501b2cd97812ef7a910a22 23258984
immunereactionfo00wall_0105.tif
G106 TIF106 4c1f0f1ddc5facbc497c6186ac4a7be7 23194876
immunereactionfo00wall_0106.tif
G107 TIF107 e21e7fc64875b28590ed158f7784d0e0 23147444
immunereactionfo00wall_0107.tif
G108 TIF108 7805acb03351e28331aa9769431d7c0f 23003616
immunereactionfo00wall_0108.tif
G109 TIF109 1cac879357d091b98aa69233f81f1991 23033000
immunereactionfo00wall_0109.tif
G110 TIF110 7c843a8b9fe9ca83a2f18da8f9b75ae3 23052836
immunereactionfo00wall_0110.tif
reference
imagejp2 9690c8a5743be2b266901453c49f52e3 177578
immunereactionfo00wall_0000.jp2
204355a7d3b9a533f2c33149a4c19313 81204
immunereactionfo00wall_0001.jp2
fa7c556fa3720221ccecb1e70885d328 516919
immunereactionfo00wall_0002.jp2
80c569849b8bbcba7d08c17953429bc6 556451
immunereactionfo00wall_0003.jp2
836d197d63e7da1ccdea7abf6fb12871 675307
immunereactionfo00wall_0004.jp2
3ebcbe25b11c1f7209abb33e79e0e938 234298
immunereactionfo00wall_0005.jp2
bcbf29df1eb39cc09bfbf36a08f4ac78 226849
immunereactionfo00wall_0006.jp2
42896d66d1b085f1bdad480012f0157f 418454
immunereactionfo00wall_0007.jp2
302bea0fe45bf90dcfcc7d7c6e990f39 113464
immunereactionfo00wall_0008.jp2
0065ec601d5e53c52bcc23b194f8a802 690102
immunereactionfo00wall_0010.jp2
43e59fc758c3b41da5e5624b554de04d 546354
immunereactionfo00wall_0011.jp2
21da7eab5fdf5c50ab6904761f0b38cc 545728
immunereactionfo00wall_0012.jp2
846b13a93fd631d5ad8374f7bb013d5e 353193
immunereactionfo00wall_0013.jp2
e4ab1d16d853dcfcefe896e161a5654d 526725
immunereactionfo00wall_0014.jp2
d8aed191c8543ac258b2ce2baa0dced4 654108
immunereactionfo00wall_0015.jp2
2d834d649c4d2d15e3b286ae3736b4b0 511921
immunereactionfo00wall_0016.jp2
6fd79ed394d7e9aa12274c9c1a196f27 600661
immunereactionfo00wall_0017.jp2
e914d97ba96e3a25d175dfbb21a0d6ea 647381
immunereactionfo00wall_0018.jp2
0377fca0799a7f347af6848c6963d64a 628395
immunereactionfo00wall_0019.jp2
c932379f40f98c3fa9983abf947cef23 608552
immunereactionfo00wall_0020.jp2
e089f7a94757268388e3f8ad71d1614d 760836
immunereactionfo00wall_0021.jp2
83a3e8029229eab4077104def73e020e 589179
immunereactionfo00wall_0022.jp2
a86333ebfca9b65068ca62ac3212d46f 632906
immunereactionfo00wall_0023.jp2
b7bd64eb72eaf8d10c4d01ad9141ff69 615757
immunereactionfo00wall_0024.jp2
06e57126bcb0394d3a43658062dbbd11 678847
immunereactionfo00wall_0025.jp2
59b04064a3aae709b190b0169243f104 676203
immunereactionfo00wall_0026.jp2
396b33c92ce7b10a3288278142253859 624923
immunereactionfo00wall_0027.jp2
61b47d3f10f81641e3274aaef5b75290 622822
immunereactionfo00wall_0028.jp2
1d2ba78e106604fa92c4dc781bdaee70 688321
immunereactionfo00wall_0029.jp2
b52bed9a0e10daeae18a3e21abe3280d 646130
immunereactionfo00wall_0030.jp2
3f2492ba2988c07ac10c80e392574d5b 658887
immunereactionfo00wall_0031.jp2
7b9f6831a142bdcdc9d48cfe0aa071cf 523079
immunereactionfo00wall_0032.jp2
5054bac66a328721707aaaa425dc3602 596608
immunereactionfo00wall_0033.jp2
bbc620ad04e2919d8fb24c368b1b2a7e 600609
immunereactionfo00wall_0034.jp2
7b098d298624c0661bf2b4bf370ac826 596109
immunereactionfo00wall_0035.jp2
b3a5ecf1c86734d2d2f992a84151fca2 582157
immunereactionfo00wall_0036.jp2
bf80591913f9b209ec0601332106f0c5 597344
immunereactionfo00wall_0037.jp2
a6664f9cd7c982ac1675568a88f8ffdc 613624
immunereactionfo00wall_0038.jp2
29b567402d106a2a62b940530d97d772 664593
immunereactionfo00wall_0039.jp2
40ff00c56d3b9af7bc3c487a8968f57a 362632
immunereactionfo00wall_0040.jp2
699f2196e8f2f5f069d2a32fa85c9f18 412753
immunereactionfo00wall_0041.jp2
c47832e995f265d8efbf2afcd8e6a172 501716
immunereactionfo00wall_0042.jp2
3b9a8ba748ee509533690d1a513df7af 492520
immunereactionfo00wall_0043.jp2
4e6368fa83a191a887a97a05ecd4f7af 438010
immunereactionfo00wall_0044.jp2
ee0369231ffd1a3464b88e5e4d40e6e8 291922
immunereactionfo00wall_0045.jp2
05d4adfd29a936c06c012671cc802bae 606279
immunereactionfo00wall_0046.jp2
e84965849ca2a359eb575c580f219002 585558
immunereactionfo00wall_0047.jp2
8c4520024976f69a304ef8e4d3e4e75d 530578
immunereactionfo00wall_0048.jp2
3e6c82df6d1273d3a9d54fdc1de2b058 510589
immunereactionfo00wall_0049.jp2
4740c50f4e2d12cd1f64d2ce42b731b7 179633
immunereactionfo00wall_0050.jp2
2a58a194c3509369ca8853019e2842a8 171368
immunereactionfo00wall_0051.jp2
3fe4eb03f1592b488ec36d178f93f7e8 178697
immunereactionfo00wall_0052.jp2
0ceaf3128085ec9d70eb0a2539c95eb6 184445
immunereactionfo00wall_0053.jp2
5d1553218b8971a37cef143b34b00db9 164187
immunereactionfo00wall_0054.jp2
1d9ba9080cc40a5fc55828107ffd2924 162272
immunereactionfo00wall_0055.jp2
afd948fe61c9426d9ea5988086390a81 161078
immunereactionfo00wall_0056.jp2
a22e9c1e85445c8083eb4e2dc8086eef 167194
immunereactionfo00wall_0057.jp2
289373804925d34bbffd406fcbd90f57 187521
immunereactionfo00wall_0058.jp2
4bd30f9a9e7a579a8913332681b2be92 158234
immunereactionfo00wall_0059.jp2
d91c8802989ad7e208999ccb34487aa1 629168
immunereactionfo00wall_0060.jp2
a1c03564c5fcdda8fbe00416257e9bef 745640
immunereactionfo00wall_0061.jp2
5ca0743c5f7f46e70ecaafc81726e8a8 740168
immunereactionfo00wall_0062.jp2
2253e623d4991819449a00366e2fdee5 336105
immunereactionfo00wall_0063.jp2
ada52643e48646b8534135869046eafb 477178
immunereactionfo00wall_0064.jp2
7182875608b053a66a249443a41d1178 483314
immunereactionfo00wall_0065.jp2
ce9dfa315d581941052468c375e885d2 511266
immunereactionfo00wall_0066.jp2
293d2095066bd0a99d2803dd7893c5a9 603422
immunereactionfo00wall_0067.jp2
036e311bf421f4acd4141747075edb19 546109
immunereactionfo00wall_0068.jp2
8405cef5c4108d6dc1f286f55265d026 428206
immunereactionfo00wall_0069.jp2
50397c676a76fff99aa0b043c78a4b7f 582702
immunereactionfo00wall_0070.jp2
6886b695befb0d9b1980b2d23a2b3d6a 610145
immunereactionfo00wall_0071.jp2
0509aa4db9927ae98c6541db01822aff 419153
immunereactionfo00wall_0072.jp2
813dd98df2885279b9bdf6badcded1ef 363987
immunereactionfo00wall_0073.jp2
eaafa6644ac77b81c691b450b9981699 387921
immunereactionfo00wall_0074.jp2
12b6c1611568b6c0e2d6b334adb5ac7d 407132
immunereactionfo00wall_0075.jp2
ddacfb783b881106f1f47716f07f6edb 392083
immunereactionfo00wall_0076.jp2
a488d599e86138f4965fae8acc5cd081 411762
immunereactionfo00wall_0077.jp2
ab51d58233ab4984958d817bd117869a 675940
immunereactionfo00wall_0078.jp2
37a71794083678ff94593833968a75b8 126057
immunereactionfo00wall_0079.jp2
a06c3ccfc11395196c08ca262b39ea40 544831
immunereactionfo00wall_0080.jp2
05f7691a3fd8af3e6d65310dc7fe94e8 709735
immunereactionfo00wall_0081.jp2
f4e7f7e40d8830f3e6c3c81b2a6e25a2 587551
immunereactionfo00wall_0082.jp2
c0c617eaa7c2cf662a5dc5d48dc2fee4 563663
immunereactionfo00wall_0083.jp2
6e4a85c78143ce76968c318cb55dd7a3 742932
immunereactionfo00wall_0084.jp2
e4947e02b4c3facefc3bf498b96e8433 624449
immunereactionfo00wall_0085.jp2
99208cca34c36748a0a6f7e875ea91e4 625050
immunereactionfo00wall_0086.jp2
6c9d2440f608489608ae51cc67344e7f 254245
immunereactionfo00wall_0087.jp2
36326423f5f5b65adfb8f2dd9279a87b 620825
immunereactionfo00wall_0088.jp2
650f41f21730d57010a1efe019a15e73 709158
immunereactionfo00wall_0089.jp2
12cf2d115903e71d0b9e445797c4448f 662789
immunereactionfo00wall_0090.jp2
99d0cdd4eea426acd8d364f05882c0fe 586067
immunereactionfo00wall_0091.jp2
c63f7b21f37d11a1384707aae20a395f 707695
immunereactionfo00wall_0092.jp2
e51f9388e4dbc51d92df460f66c25723 620731
immunereactionfo00wall_0093.jp2
ba72c06ef622597d41fb025d9152ff50 86228
immunereactionfo00wall_0094.jp2
d84de25179be4a5779da6498d3567dba 631451
immunereactionfo00wall_0095.jp2
021e1dd90b9bec14b8418972e4dc544e 744988
immunereactionfo00wall_0096.jp2
bcf40d2e862b1fd493bc55830cafc27f 757098
immunereactionfo00wall_0097.jp2
610a59fcb5b21a285718c135a0492a65 767382
immunereactionfo00wall_0098.jp2
7781d82dba30e95d5abfd572cec7d704 807524
immunereactionfo00wall_0099.jp2
cdb0e400a52ff5f90037378cc387aaa2 786734
immunereactionfo00wall_0100.jp2
bf1f46a56d135f11f602d3cd9451fdfb 774336
immunereactionfo00wall_0101.jp2
adacf51b78de395de1691f4a4b72f50e 809351
immunereactionfo00wall_0102.jp2
1368b33f064046cc03a725b907187b0f 865334
immunereactionfo00wall_0103.jp2
bb1b80295f369b7d12c37c4be1fb0815 805789
immunereactionfo00wall_0104.jp2
7125e87847ffcbfb815f5aa5fb08b9b4 808496
immunereactionfo00wall_0105.jp2
a1b76ded5cc30caad8fc9d0791698b7d 762906
immunereactionfo00wall_0106.jp2
14f3525298b8cff7b1ef105562bf0f40 463948
immunereactionfo00wall_0107.jp2
b7ad9a277dd9d08bd7c55aef261e791a 241478
immunereactionfo00wall_0108.jp2
0ba494dd3d5434109919b27f03bd615f 540427
immunereactionfo00wall_0109.jp2
41653748494c0f0f13f3bcf62a50acc2 277302
immunereactionfo00wall_0110.jp2
imagejpeg 14450df8bfb79748d85b367757b84625 43287
immunereactionfo00wall_0000.jpg
JPEG1.2 6183e0e3396458598b69dc1f7b1cdf1f 22444
immunereactionfo00wall_0000.QC.jpg
4161f884651574eeb8b363c8e922866a 26703
immunereactionfo00wall_0001.jpg
JPEG2.2 0e79768bd559eb9abb52b5e8aafac25f 16610
immunereactionfo00wall_0001.QC.jpg
bcfaca0692188b3613de89e38c2747e7 97932
immunereactionfo00wall_0002.jpg
JPEG3.2 2b6f16fe224ec26f20ec755ba58e82f4 46070
immunereactionfo00wall_0002.QC.jpg
9b301aace4931443362e5fb8504241ca 104759
immunereactionfo00wall_0003.jpg
JPEG4.2 3210ea932f0ff7595255bb55caa6cc9b 36412
immunereactionfo00wall_0003.QC.jpg
b3a0f01442f9b2d7d4e04786d7a22803 127606
immunereactionfo00wall_0004.jpg
JPEG5.2 95862ad6ece2b37ce944d799f0ddbd3e 41929
immunereactionfo00wall_0004.QC.jpg
32825367a5e3203caf76e42fd3235139 52509
immunereactionfo00wall_0005.jpg
JPEG6.2 99293220fafd517335e9c2260f2358f7 22343
immunereactionfo00wall_0005.QC.jpg
c7b248cf3d199a574e10b037a26cfa7f 52436
immunereactionfo00wall_0006.jpg
JPEG7.2 54150203f5ae646c12201e853097a5f9 23426
immunereactionfo00wall_0006.QC.jpg
ea942cff527cb4ab4e1ab255bd87e5af 84319
immunereactionfo00wall_0007.jpg
JPEG8.2 0b138781d8f3f7a6152575983a7c82d8 39895
immunereactionfo00wall_0007.QC.jpg
087bb713c59106a943ef2dcafb014c80 32577
immunereactionfo00wall_0008.jpg
JPEG9.2 7255f153b6eab08a6c7d4535c65b444b 19190
immunereactionfo00wall_0008.QC.jpg
05842f70df309c0dded8afd704d5dec0 120356
immunereactionfo00wall_0010.jpg
JPEG10.2 10ebc7a97b4b04a14ff11c46d06e69c2 49928
immunereactionfo00wall_0010.QC.jpg
2574c2218f795450011353945f5c8309 103041
immunereactionfo00wall_0011.jpg
JPEG11.2 5e1099b83815d32a0e91332ef48b36eb 43524
immunereactionfo00wall_0011.QC.jpg
da962cb1ec161d1ce10076e485fb4ce1 102962
immunereactionfo00wall_0012.jpg
JPEG12.2 5dccb6e738e0c742a59a313a730236e0 42030
immunereactionfo00wall_0012.QC.jpg
1516eae5ab37509d3154779e7ddc0762 70639
immunereactionfo00wall_0013.jpg
JPEG13.2 620bbcc13c2ae8a534480136c5a99597 32520
immunereactionfo00wall_0013.QC.jpg
b65891002bc12531530a3f08f2859dd0 99394
immunereactionfo00wall_0014.jpg
JPEG14.2 8912ab7835d07aad83a44b2a377cec47 42465
immunereactionfo00wall_0014.QC.jpg
6b24c128bd3bf26695ccd9a3988b4ddc 118716
immunereactionfo00wall_0015.jpg
JPEG15.2 bad5e5ce2d788e3f0b9e45028833b671 49310
immunereactionfo00wall_0015.QC.jpg
5509f8ba7a2462f3d9f269543ac4fa24 96161
immunereactionfo00wall_0016.jpg
JPEG16.2 2d8ac004f73ed703c4f10a0eedb810c7 39704
immunereactionfo00wall_0016.QC.jpg
c17cbcf1b9a1fe4524de1ea79e58159d 109552
immunereactionfo00wall_0017.jpg
JPEG17.2 3ac500adadb86c8aa67caed1f28b63f1 44351
immunereactionfo00wall_0017.QC.jpg
5979ebd398af30d16a487436dddbb786 117757
immunereactionfo00wall_0018.jpg
JPEG18.2 9b8efae21a81ba43ce37347f4f8682a6 51392
immunereactionfo00wall_0018.QC.jpg
1b47e36246b1eb5401ae32db3adf2593 112483
immunereactionfo00wall_0019.jpg
JPEG19.2 91809794dcf22cdbbf049a50517a9b14 46951
immunereactionfo00wall_0019.QC.jpg
2967a324d7cd46bf47fae81103050cab 111952
immunereactionfo00wall_0020.jpg
JPEG20.2 fc5bd906b974d63e8237e8e1c3fab531 45902
immunereactionfo00wall_0020.QC.jpg
9f4bfd1d25adb8ff6f09fbc45df5f93e 128380
immunereactionfo00wall_0021.jpg
JPEG21.2 f0ada02cf0f517ccc357e95b3b8dcc07 53010
immunereactionfo00wall_0021.QC.jpg
d729bf6b236cdca63f4c76747e1cf099 107858
immunereactionfo00wall_0022.jpg
JPEG22.2 3927ebe49067a9e568c4e088af429b18 43536
immunereactionfo00wall_0022.QC.jpg
982b7091e3d528db8b50a7c252082f7f 115904
immunereactionfo00wall_0023.jpg
JPEG23.2 b43bfe2f8fd139af55a392c506a689de 47012
immunereactionfo00wall_0023.QC.jpg
bcfd70f8fb62c7b752d610561dbb0a6b 112073
immunereactionfo00wall_0024.jpg
JPEG24.2 6839c4954c0f6ec283a6e449b026cecf 48873
immunereactionfo00wall_0024.QC.jpg
5f43d3a25d2c5b0c400ce04c869c7e3a 117544
immunereactionfo00wall_0025.jpg
JPEG25.2 775301c4cb8e315d9348e8c2c96f8b37 51501
immunereactionfo00wall_0025.QC.jpg
f59549f6ff778d17625b9f9099a58132 121654
immunereactionfo00wall_0026.jpg
JPEG26.2 0cd330c5a749cc942bbd93f045af8519 47876
immunereactionfo00wall_0026.QC.jpg
0eb4b2ec496665f779ac7bdd303a11c7 114602
immunereactionfo00wall_0027.jpg
JPEG27.2 ace636df505c5ce59b887ec6247089b0 47917
immunereactionfo00wall_0027.QC.jpg
48c06341c658d5654f9c296633971b7c 114732
immunereactionfo00wall_0028.jpg
JPEG28.2 c5800b7b8d603245d3c72162993dad3d 47140
immunereactionfo00wall_0028.QC.jpg
de89f1665a285c8a4764efa3de70c390 125304
immunereactionfo00wall_0029.jpg
JPEG29.2 a7a84a761083c967f3b9676ccf29bed5 52477
immunereactionfo00wall_0029.QC.jpg
e4b3307420b0f3c0a6ba5b3f93916c78 119503
immunereactionfo00wall_0030.jpg
JPEG30.2 b48b254ca782b90bae3ede83336e9c6b 47263
immunereactionfo00wall_0030.QC.jpg
b3c21fff6f3de16c99b30f9b813785b5 121988
immunereactionfo00wall_0031.jpg
JPEG31.2 0d0637efee324587d6c22a0dc0b6c5c0 52303
immunereactionfo00wall_0031.QC.jpg
9a2881cba005c32300f01d60560c0f08 99500
immunereactionfo00wall_0032.jpg
JPEG32.2 1a5401c69b7c90af259e3ae19770c1d6 41902
immunereactionfo00wall_0032.QC.jpg
5192b70123e973f8817d42899d9a0b47 100687
immunereactionfo00wall_0033.jpg
JPEG33.2 53eb9c8e74acfb9655f6e8420e6448cb 38531
immunereactionfo00wall_0033.QC.jpg
e37791946da61546a34fab8a069ffb28 112177
immunereactionfo00wall_0034.jpg
JPEG34.2 cf268b5ba5745bc9489db18d0b8a77b1 46876
immunereactionfo00wall_0034.QC.jpg
5cb864f641e68ed1d70165a8119c6806 107514
immunereactionfo00wall_0035.jpg
JPEG35.2 3e5bb540bcf1bbbc75ad3ba89ae41f12 44623
immunereactionfo00wall_0035.QC.jpg
900df70c9571bc62ab73887a0d090783 108843
immunereactionfo00wall_0036.jpg
JPEG36.2 64ac2f98468e1bab1991e17c69c4008f 47107
immunereactionfo00wall_0036.QC.jpg
b49ed5da042f4fa35f038b8e9e267b5e 109978
immunereactionfo00wall_0037.jpg
JPEG37.2 b064e97d9efb222ce8ebcaa74bf1e512 43690
immunereactionfo00wall_0037.QC.jpg
10279147b0a448ac92f538e5da072128 113975
immunereactionfo00wall_0038.jpg
JPEG38.2 599c0fcf4491f383b846b8acd2d87eb7 50184
immunereactionfo00wall_0038.QC.jpg
9f8badc3e13b2214d78f61f9c5fd8de4 121387
immunereactionfo00wall_0039.jpg
JPEG39.2 fba6b9326dc3127100353d7f14022436 50907
immunereactionfo00wall_0039.QC.jpg
e5c7d9c8ef758366b5c026c2c062d402 72238
immunereactionfo00wall_0040.jpg
JPEG40.2 6a8fc53a5dcc002f461a876b8b4b483d 35280
immunereactionfo00wall_0040.QC.jpg
cda7396691d8726bec1002424f480774 79272
immunereactionfo00wall_0041.jpg
JPEG41.2 b2e0f1c0faaf508f16ca2c453bcec2da 33736
immunereactionfo00wall_0041.QC.jpg
d7b7861943df8a317bee412c466e3ab1 82056
immunereactionfo00wall_0042.jpg
JPEG42.2 356f132b78fc68381f4ce25a156cd1ea 38745
immunereactionfo00wall_0042.QC.jpg
42f46e24f82ef48ec1c623cd7fe41a93 80486
immunereactionfo00wall_0043.jpg
JPEG43.2 8391d88c70c527f7bce5b716c09cbc1e 35837
immunereactionfo00wall_0043.QC.jpg
f0d06c02b364394c24b2846c594f1dfe 73836
immunereactionfo00wall_0044.jpg
JPEG44.2 7a766159938b5b454035da1c739fa883 35448
immunereactionfo00wall_0044.QC.jpg
2bcb089895285726cf8b5fc1f0d88144 57392
immunereactionfo00wall_0045.jpg
JPEG45.2 5221bd6231f7a8457e3df2446707a4d8 27587
immunereactionfo00wall_0045.QC.jpg
599c69398d5d2fa0e24b73c385a9152a 107827
immunereactionfo00wall_0046.jpg
JPEG46.2 984a4c3167dcf585708e9cf9bd38384d 45033
immunereactionfo00wall_0046.QC.jpg
10eada63cffac3b7e38a482244ba0698 108345
immunereactionfo00wall_0047.jpg
JPEG47.2 f13094a9935a1fc5d4ddf5d4b24b2a49 46326
immunereactionfo00wall_0047.QC.jpg
91ed5b9fdc6f4dd6c6fe6552a9928e40 93562
immunereactionfo00wall_0048.jpg
JPEG48.2 3b7e3c4bb04f2a9735d6fee57fd2a865 40394
immunereactionfo00wall_0048.QC.jpg
f451fa93d6b05047d92782c20eb1cbd7 92214
immunereactionfo00wall_0049.jpg
JPEG49.2 26b3521eb1b5f33b8b4a56bfaf91db70 40771
immunereactionfo00wall_0049.QC.jpg
499cf028cb1b7cdb89ce2ecdb95840e1 45867
immunereactionfo00wall_0050.jpg
JPEG50.2 fe449a1c2b4863858c50b70aedfcfae0 24231
immunereactionfo00wall_0050.QC.jpg
87785791224e85805eb2b137ca16f634 42625
immunereactionfo00wall_0051.jpg
JPEG51.2 3946c21ad78f77ec642abf7f7f4639c6 23222
immunereactionfo00wall_0051.QC.jpg
38ea4bb3c50406e3d9bbc39081294e2b 45862
immunereactionfo00wall_0052.jpg
JPEG52.2 2b069ce1dee77e5a3cdf2aeee4af88c7 26458
immunereactionfo00wall_0052.QC.jpg
f9e76a1f6c98044e04ec3b4662931bcc 45963
immunereactionfo00wall_0053.jpg
JPEG53.2 7dbdb345e50ef16d284b20dd90281b07 25823
immunereactionfo00wall_0053.QC.jpg
5c8ccbc4b943ca4dd49864ce15ca1d7f 42232
immunereactionfo00wall_0054.jpg
JPEG54.2 639b2b54feb6a163b1bc5c3ff36a6f34 22955
immunereactionfo00wall_0054.QC.jpg
df3c101511ee90863711ca0670ffe49a 42133
immunereactionfo00wall_0055.jpg
JPEG55.2 73e858297618ab45753847d949cb2fb4 24549
immunereactionfo00wall_0055.QC.jpg
7f646dfba44802f0fc3ca237fe4ad20f 41383
immunereactionfo00wall_0056.jpg
JPEG56.2 1f8ade1c951f5e4eb82feb07b9a676fc 24021
immunereactionfo00wall_0056.QC.jpg
8d4a97bc49f57f56d1f420bd129a5366 43202
immunereactionfo00wall_0057.jpg
JPEG57.2 a234521498229214b3acf41d91c07029 24681
immunereactionfo00wall_0057.QC.jpg
fa0fba1cf51c885239ead23a66491e42 45874
immunereactionfo00wall_0058.jpg
JPEG58.2 839dbb675b22d9c58d3812f8c5f429d9 25418
immunereactionfo00wall_0058.QC.jpg
2c85a228b7a886c38965484d827e33a7 41607
immunereactionfo00wall_0059.jpg
JPEG59.2 9867a1acafbfc0d78a93e07885a41831 23338
immunereactionfo00wall_0059.QC.jpg
cae7acb0b9023fd86ada1bdd8e2c3559 112697
immunereactionfo00wall_0060.jpg
JPEG60.2 fc25a42c993a7a8c34bb5e14de3f75c8 46000
immunereactionfo00wall_0060.QC.jpg
b9743e65d2650408a4ae6c4e3e45ebd0 128893
immunereactionfo00wall_0061.jpg
JPEG61.2 677f7c120a7ee0cd9ee146d5475f34ba 52558
immunereactionfo00wall_0061.QC.jpg
543fa1fbb602487ee0c3799e5726fe87 128460
immunereactionfo00wall_0062.jpg
JPEG62.2 d74f8f1a4cb219c2d5a64e22021ce2cc 52933
immunereactionfo00wall_0062.QC.jpg
85431e3ef0e5ca2768abaa0ba1cd3a51 69803
immunereactionfo00wall_0063.jpg
JPEG63.2 8207b1efb39ded811af5b701a06d4ab1 30384
immunereactionfo00wall_0063.QC.jpg
c413f4f97b67300664382ebd42c1b85c 93420
immunereactionfo00wall_0064.jpg
JPEG64.2 e97ce40a7f77ae9528da71d43fe89d31 39311
immunereactionfo00wall_0064.QC.jpg
cb1a7e85d4a904102624d770865a9367 91105
immunereactionfo00wall_0065.jpg
JPEG65.2 bb0261eb0c3d9d6b10b7562a71ae1a5f 40759
immunereactionfo00wall_0065.QC.jpg
e1e8e8ce0c28474c97355202bc5f6a23 98040
immunereactionfo00wall_0066.jpg
JPEG66.2 4b063b15a1b56e6f0598e871d0214760 45737
immunereactionfo00wall_0066.QC.jpg
7c27e834e6ef1b39a2d4ef23dec84b62 109362
immunereactionfo00wall_0067.jpg
JPEG67.2 8ead39cd3519ce13cbdc29f94ec74e7c 42136
immunereactionfo00wall_0067.QC.jpg
20fa3c52dc8006202de33ac86c680c93 104185
immunereactionfo00wall_0068.jpg
JPEG68.2 c66a05bd14b05707d8626b39c0f6e882 39876
immunereactionfo00wall_0068.QC.jpg
d88a3d45a8b5adb8166301367d392446 84000
immunereactionfo00wall_0069.jpg
JPEG69.2 ae9b340e4e4d5579d2177b498b2a4286 38806
immunereactionfo00wall_0069.QC.jpg
4a584331af52b7e957afd3951cdc4476 111733
immunereactionfo00wall_0070.jpg
JPEG70.2 7ce60852744e002ecb93a1d8fc04eaa5 48589
immunereactionfo00wall_0070.QC.jpg
fa6b04819c91c39e56f890ecb9dd2abb 111263
immunereactionfo00wall_0071.jpg
JPEG71.2 a424e3652d1c430fac130578c5508e5f 44191
immunereactionfo00wall_0071.QC.jpg
7ebe0d2941439d4b5073bded2e32dccb 77835
immunereactionfo00wall_0072.jpg
JPEG72.2 c1d325a51623d74de676110788e2b9ec 36121
immunereactionfo00wall_0072.QC.jpg
790cf32a1c53a61b992efe78506f74a8 70792
immunereactionfo00wall_0073.jpg
JPEG73.2 2981fbfc109a3237864ba61128500ef3 35151
immunereactionfo00wall_0073.QC.jpg
49c4fcff11a143d23a76794e4491c668 77930
immunereactionfo00wall_0074.jpg
JPEG74.2 ac4c1451972e012424925e0ee96438d9 37065
immunereactionfo00wall_0074.QC.jpg
58a4446d3370bfdde66eac94dba7e161 81030
immunereactionfo00wall_0075.jpg
JPEG75.2 0012fa4ec5d0cb72273b8b21baa26f5d 38079
immunereactionfo00wall_0075.QC.jpg
219dbc4608e74a497ac30b00e4c18555 75701
immunereactionfo00wall_0076.jpg
JPEG76.2 7a52c4e5b913090fc971195a1b1ba6e1 36874
immunereactionfo00wall_0076.QC.jpg
221ced10d88edc29b144b67c0c014691 76926
immunereactionfo00wall_0077.jpg
JPEG77.2 eba23e323191a107bc52ec7544cc3604 33465
immunereactionfo00wall_0077.QC.jpg
8d557ea1b7e2238b7d47cefacf66a0fc 118696
immunereactionfo00wall_0078.jpg
JPEG78.2 a3ea761f8024b1e33e3657da5bb48784 56311
immunereactionfo00wall_0078.QC.jpg
2bd9fab61cc29e0e49dab344b09dfbfa 33712
immunereactionfo00wall_0079.jpg
JPEG79.2 de2c400704ab81994496f0fc5a6f88a5 18424
immunereactionfo00wall_0079.QC.jpg
983ca8c0430eb176af7c26f8bda3f7a3 101450
immunereactionfo00wall_0080.jpg
JPEG80.2 8c5c679a36be03fed85435b8012d216c 41890
immunereactionfo00wall_0080.QC.jpg
7ba1745217f5e8fb3a16cec8402b9729 124568
immunereactionfo00wall_0081.jpg
JPEG81.2 ae2ee75380f7a73402f7ae02dd5f3afd 47945
immunereactionfo00wall_0081.QC.jpg
0da5bde29f582835c9787926454ff52e 110216
immunereactionfo00wall_0082.jpg
JPEG82.2 26275dd816539f328f0187912ecc4518 44391
immunereactionfo00wall_0082.QC.jpg
226d20bc9fc5c88333cc7b8efbdbd22a 106731
immunereactionfo00wall_0083.jpg
JPEG83.2 8c1ec90c939558cbed0bf53f849e0395 45237
immunereactionfo00wall_0083.QC.jpg
d9a678b2a7fe00c0709e59848493605c 133437
immunereactionfo00wall_0084.jpg
JPEG84.2 fea6ae67b68569c9c567fb0cd92c83c1 55703
immunereactionfo00wall_0084.QC.jpg
4e21e29ff266347755a3ff730bbd3b62 112020
immunereactionfo00wall_0085.jpg
JPEG85.2 bb205300e5b7f39284dad83c40dbfee4 42584
immunereactionfo00wall_0085.QC.jpg
f7526a8ca5e16b2e515fcdb631a42282 116533
immunereactionfo00wall_0086.jpg
JPEG86.2 49f02290e0652fb4223cb2895818b65c 44722
immunereactionfo00wall_0086.QC.jpg
8a05f5dc16e6d9d6c4dcc2aeed992c70 55804
immunereactionfo00wall_0087.jpg
JPEG87.2 8bdb75f259c684f555b187f832e58adf 28814
immunereactionfo00wall_0087.QC.jpg
1836128a8309d8a1fb69dbfcfd5ce4ea 113630
immunereactionfo00wall_0088.jpg
JPEG88.2 154ee1abaa010f0c639111ed291a3b78 46188
immunereactionfo00wall_0088.QC.jpg
3a08fd9cc362f81d410efd607e83ed46 131148
immunereactionfo00wall_0089.jpg
JPEG89.2 2afee8b99602963ecd4ad82b502ea3ce 51147
immunereactionfo00wall_0089.QC.jpg
e5e5bb2653857fa5ba6f6f9b93cbff6f 121973
immunereactionfo00wall_0090.jpg
JPEG90.2 608d775c291ee9236eaf30c13c07f3c1 52681
immunereactionfo00wall_0090.QC.jpg
22eb8454443591a3bbcfa16defb5e29c 109830
immunereactionfo00wall_0091.jpg
JPEG91.2 a6e6315c516f1ba1f09f9c487e489e83 46820
immunereactionfo00wall_0091.QC.jpg
b2c8c1cb03078a4054017e258d431ea5 124469
immunereactionfo00wall_0092.jpg
JPEG92.2 0fa2691503f586c671bd8ae565664637 44363
immunereactionfo00wall_0092.QC.jpg
31fdacf2bb1b80b1b4bec3c719b3a0e4 115879
immunereactionfo00wall_0093.jpg
JPEG93.2 7b1561598365ef9c5f744cba8818800f 46686
immunereactionfo00wall_0093.QC.jpg
e286fad3f1144352ffaa2e8e3d06b1a2 28059
immunereactionfo00wall_0094.jpg
JPEG94.2 e2d5b1aa8e3ca9d0785e023d9a89838e 16282
immunereactionfo00wall_0094.QC.jpg
005b09e23cfc36c4bb819197854ec177 119222
immunereactionfo00wall_0095.jpg
JPEG95.2 b96a298862bc56a0ab3572f2d11f2ecd 46892
immunereactionfo00wall_0095.QC.jpg
ae2a4df38dacc7f1ed979f2befef8338 138786
immunereactionfo00wall_0096.jpg
JPEG96.2 d674fdecc946662cb487f32419620e72 52994
immunereactionfo00wall_0096.QC.jpg
909de77af756596d205a458d8011f107 139245
immunereactionfo00wall_0097.jpg
JPEG97.2 88aa36444ace3299c02e51e8faca19cc 52344
immunereactionfo00wall_0097.QC.jpg
57a92725832a8b265a1276f5fdc7ec56 141285
immunereactionfo00wall_0098.jpg
JPEG98.2 7082df19342384fd748c9eee0c34405d 54713
immunereactionfo00wall_0098.QC.jpg
c0e37b18cb7ae951f0e60e86fb3de46b 138552
immunereactionfo00wall_0099.jpg
JPEG99.2 407562f6d53115f65653dd89695d632a 51792
immunereactionfo00wall_0099.QC.jpg
e2ef24a488d52d978b7d3ff82297d5e4 135731
immunereactionfo00wall_0100.jpg
JPEG100.2 9a94ad7dd9f50f3a6262be410369ec68 50480
immunereactionfo00wall_0100.QC.jpg
08b50e9ff1db8fd4edb7a43aaad6f2db 135343
immunereactionfo00wall_0101.jpg
JPEG101.2 e379190bb73d3ea36f296e41c26a2cc3 49542
immunereactionfo00wall_0101.QC.jpg
adb158c32b3256c649c17de3fab13d5d 141945
immunereactionfo00wall_0102.jpg
JPEG102.2 32411095130645d7a5d0e9cdeb076a9a 53188
immunereactionfo00wall_0102.QC.jpg
4725fa6e9392d5d7eb3d8a8da8916656 152055
immunereactionfo00wall_0103.jpg
JPEG103.2 4cbdf7bed23c982e8e6cabd5bfcdd6ec 55333
immunereactionfo00wall_0103.QC.jpg
2319f125f76a12b1f1361053d86c10f3 140858
immunereactionfo00wall_0104.jpg
JPEG104.2 1cc8e5cf1a34528ed4475ed73729fc81 54410
immunereactionfo00wall_0104.QC.jpg
b8d0b4a42564963b1b81aee1aba6b50f 141469
immunereactionfo00wall_0105.jpg
JPEG105.2 6a579c2074bc91a68126306ca0a9421f 53628
immunereactionfo00wall_0105.QC.jpg
83af1f9187296c2ad82e459df511b148 140461
immunereactionfo00wall_0106.jpg
JPEG106.2 3aaef874e80afbb7ecbccda45c37c601 53425
immunereactionfo00wall_0106.QC.jpg
b9ac80daa6728c630a549b26a109e536 92234
immunereactionfo00wall_0107.jpg
JPEG107.2 70ee67d2e2ce8d5a3477f004b88ec4ea 38524
immunereactionfo00wall_0107.QC.jpg
7f854c008b8dc55dafd3cb784eae5e72 54000
immunereactionfo00wall_0108.jpg
JPEG108.2 4241f0bf044687ae500f833754844256 23696
immunereactionfo00wall_0108.QC.jpg
bfba41ac99ebb01976f17bb2d30b8920 100068
immunereactionfo00wall_0109.jpg
JPEG109.2 048888be24598bf851330076c9b228ff 38844
immunereactionfo00wall_0109.QC.jpg
6df5bfa65aa4418a9ce81f9d4497b209 60967
immunereactionfo00wall_0110.jpg
JPEG110.2 304a2f80e3addd60392964ca2efe1807 26835
immunereactionfo00wall_0110.QC.jpg
THUMB1 imagejpeg-thumbnails a272c6cbedbc3e4f581305d0e7700c02 15313
immunereactionfo00wall_0000thm.jpg
THUMB2 7afb5c7121a2d62351a8cc0082258fc8 13463
immunereactionfo00wall_0001thm.jpg
THUMB3 d4747bbc67e405a34ad565cba0a204fd 21557
immunereactionfo00wall_0002thm.jpg
THUMB4 d2acdd6b140b9e338b40e2d232d2d754 19216
immunereactionfo00wall_0003thm.jpg
THUMB5 a57c416bcb4a4d801e8e68f8372679cf 20620
immunereactionfo00wall_0004thm.jpg
THUMB6 ac7b35a1dcdea588675c7210f5e6c775 15137
immunereactionfo00wall_0005thm.jpg
THUMB7 c83d40c6737349a7d00572ed74d7f967 16218
immunereactionfo00wall_0006thm.jpg
THUMB8 03a45eb69eee03d742d6a188ada8ef6f 19547
immunereactionfo00wall_0007thm.jpg
THUMB9 2b353ac023133baf92c6a3fc632a3d5e 14144
immunereactionfo00wall_0008thm.jpg
THUMB10 4188256309deef57762ede89e593e363 23911
immunereactionfo00wall_0010thm.jpg
THUMB11 856242a91c04ff680f9ecc3711282fbb 21799
immunereactionfo00wall_0011thm.jpg
THUMB12 605b0d80aa9bfaa152d51acbd94e2d06 21861
immunereactionfo00wall_0012thm.jpg
THUMB13 f1ef39ac446d155338a9ff856957ff82 18640
immunereactionfo00wall_0013thm.jpg
THUMB14 47410f7e2820e3bd655f21d0033217f3 21637
immunereactionfo00wall_0014thm.jpg
THUMB15 92a3f25ba10a02792a6979f52a5f2bb8 23411
immunereactionfo00wall_0015thm.jpg
THUMB16 a421d9d609c265efe33ad2e1ab7c1fb7 21152
immunereactionfo00wall_0016thm.jpg
THUMB17 8ef7753e5f35b9d0a26d24b7256c01a7 22499
immunereactionfo00wall_0017thm.jpg
THUMB18 67f8d3a8fabf81cf9b3c2561bb52e83a 23905
immunereactionfo00wall_0018thm.jpg
THUMB19 7112be6ca04c9b9aa97d03724e237fda 23133
immunereactionfo00wall_0019thm.jpg
THUMB20 6e50a711d48870b52527a651079bab20 22909
immunereactionfo00wall_0020thm.jpg
THUMB21 41dc2a3e31539f87f25ba12c84912080 25145
immunereactionfo00wall_0021thm.jpg
THUMB22 bc818f941f95a6ff9e8941b7adda08a4 22457
immunereactionfo00wall_0022thm.jpg
THUMB23 a82e3391f26c6063a6e558aea6d96e12 23498
immunereactionfo00wall_0023thm.jpg
THUMB24 e061449b9962519e03056ed3b7c49fbf 23538
immunereactionfo00wall_0024thm.jpg
THUMB25 9862d5518698e166ecc05ca35cd423fd 24455
immunereactionfo00wall_0025thm.jpg
THUMB26 b03eac2fbaf4eabe6c77fcf66e6f980b 24060
immunereactionfo00wall_0026thm.jpg
THUMB27 814abae37608f6760b0c033b64b139a6 23592
immunereactionfo00wall_0027thm.jpg
THUMB28 34c57363b01103dc9cc3a1e722957fd4 23773
immunereactionfo00wall_0028thm.jpg
THUMB29 45dac5f897c82eb0aca2eb9793df5c35 24952
immunereactionfo00wall_0029thm.jpg
THUMB30 83201e6071038197517f2122d0973ac1 24103
immunereactionfo00wall_0030thm.jpg
THUMB31 8b9104efedc5fc99a02fe8ca2af330c3 24786
immunereactionfo00wall_0031thm.jpg
THUMB32 1b445d1fc31bff8356a74c8817599b3b 21744
immunereactionfo00wall_0032thm.jpg
THUMB33 2efe14bc3a728fe44edf5f1a87b85bf2 20334
immunereactionfo00wall_0033thm.jpg
THUMB34 0ff88ec9136dccba1c1ef048387284b5 22574
immunereactionfo00wall_0034thm.jpg
THUMB35 b464101769f6b6d4b374adafd8140db1 22358
immunereactionfo00wall_0035thm.jpg
THUMB36 d3c2d56d6ff50cdbd5081659161f7c46 23329
immunereactionfo00wall_0036thm.jpg
THUMB37 ee8ce58824817a3d0c33cfd0f4955797 23178
immunereactionfo00wall_0037thm.jpg
THUMB38 624a0f983bae2e1b8287f83c3167cf08 23814
immunereactionfo00wall_0038thm.jpg
THUMB39 724fdd135f04a446eafc9efebe588fae 24595
immunereactionfo00wall_0039thm.jpg
THUMB40 aaf00d0aa8de0fe8fb087011bcc22b41 19440
immunereactionfo00wall_0040thm.jpg
THUMB41 30872d5b10d7c720f1b2ddba1d22b61e 20562
immunereactionfo00wall_0041thm.jpg
THUMB42 a872b605f3dee15ee5cb5e3a86659172 21200
immunereactionfo00wall_0042thm.jpg
THUMB43 c370d845cdc96dc565d184cc52e40d7a 21070
immunereactionfo00wall_0043thm.jpg
THUMB44 83669842a595f60f0c9180cd0899ba17 20195
immunereactionfo00wall_0044thm.jpg
THUMB45 0db713dfd2ad20121986f694048dbb64 17896
immunereactionfo00wall_0045thm.jpg
THUMB46 76be61e08c1294adc27734c89f3364ed 22451
immunereactionfo00wall_0046thm.jpg
THUMB47 20b0c66e17a85689ee4182a8381d3923 23247
immunereactionfo00wall_0047thm.jpg
THUMB48 1ea185f6e1455e496ad0b48483397db3 21748
immunereactionfo00wall_0048thm.jpg
THUMB49 d2daec00bbe12c81c6751d75c442c8b7 21634
immunereactionfo00wall_0049thm.jpg
THUMB50 6fb9dcc20ea3700d059ea1977fedcfe9 17345
immunereactionfo00wall_0050thm.jpg
THUMB51 0b6b1b4c4e29af0f44e2983c582f6e24 16590
immunereactionfo00wall_0051thm.jpg
THUMB52 0f17a281e422c6895f92e16b46ca2d46 17358
immunereactionfo00wall_0052thm.jpg
THUMB53 e026cde86f1970452efda0c70a5b75b0 17073
immunereactionfo00wall_0053thm.jpg
THUMB54 b0a66291720e21e844e9e677ba37af5c 16321
immunereactionfo00wall_0054thm.jpg
THUMB55 7d501ed0959be669696477793a706301 17046
immunereactionfo00wall_0055thm.jpg
THUMB56 66e05bec1381cd46821c445610daed7b 16169
immunereactionfo00wall_0056thm.jpg
THUMB57 6b3e714b4f72cab3ca2867fbf9d48530 16934
immunereactionfo00wall_0057thm.jpg
THUMB58 b916a2db1b95d36055b060ec2f9fe9dc 17288
immunereactionfo00wall_0058thm.jpg
THUMB59 dfe016e75782276d7b969136f5eb2a9f 16604
immunereactionfo00wall_0059thm.jpg
THUMB60 717106ebef2865b388d727123fe1db74 23716
immunereactionfo00wall_0060thm.jpg
THUMB61 a6c8d021c63830453b6a5359a0cb3518 24972
immunereactionfo00wall_0061thm.jpg
THUMB62 8da48c3be65fb782153d306c61978015 25017
immunereactionfo00wall_0062thm.jpg
THUMB63 2b91c844ffd07e526875a5f3ffbf0302 18312
immunereactionfo00wall_0063thm.jpg
THUMB64 777eb540ad01411ff17cc701f58956a6 20592
immunereactionfo00wall_0064thm.jpg
THUMB65 021303fb6ef87770f780244d8f3c89d7 21021
immunereactionfo00wall_0065thm.jpg
THUMB66 6e66598f4612c8c32d9361599a90ea59 21711
immunereactionfo00wall_0066thm.jpg
THUMB67 82b079569f78dc53d354ed06d546cd1b 22985
immunereactionfo00wall_0067thm.jpg
THUMB68 9bd46883c34bcfa38d592a67bf941676 22535
immunereactionfo00wall_0068thm.jpg
THUMB69 ecc08adc2c93e7ddcb6b94ab73bb1f95 20397
immunereactionfo00wall_0069thm.jpg
THUMB70 40fd129f835203e732045cad1d46c5cd 23110
immunereactionfo00wall_0070thm.jpg
THUMB71 e4141fb22c319ad7ed76ca456373ec88 21671
immunereactionfo00wall_0071thm.jpg
THUMB72 7424f38077176445d5f9b4d7e9234a00 21694
immunereactionfo00wall_0072thm.jpg
THUMB73 7711790b5eec1d37781c3c0506f092c0 20532
immunereactionfo00wall_0073thm.jpg
THUMB74 376edb75c14194a997aa02053299b813 21944
immunereactionfo00wall_0074thm.jpg
THUMB75 f8a51020ed2f1e8cf87cefc04c934b9e 22128
immunereactionfo00wall_0075thm.jpg
THUMB76 5b0afdb53f2b8fbd862ebd8e3b6d631e 21642
immunereactionfo00wall_0076thm.jpg
THUMB77 f524eb2c4ed371c5c36cb796bff6ac2b 18703
immunereactionfo00wall_0077thm.jpg
THUMB78 35d7621b7e7dc7e47e84679d290be29d 23830
immunereactionfo00wall_0078thm.jpg
THUMB79 c75573b4ae9a377e75a2a95cd4346274 14340
immunereactionfo00wall_0079thm.jpg
THUMB80 20d43e3f16600933f6709ed794b48313 21810
immunereactionfo00wall_0080thm.jpg
THUMB81 0bedd55777027c0d48a1a9974361e711 23930
immunereactionfo00wall_0081thm.jpg
THUMB82 fa87d9243ae233a069d72a36b7929117 22925
immunereactionfo00wall_0082thm.jpg
THUMB83 756547de359331565461bee2715601db 22580
immunereactionfo00wall_0083thm.jpg
THUMB84 9c663c15bb3cd3c01b7c08e4477afdf2 24780
immunereactionfo00wall_0084thm.jpg
THUMB85 4faea1151f89122ee8678152703d37cf 23033
immunereactionfo00wall_0085thm.jpg
THUMB86 22d2796cccfadec8f0dbdbca5a0bece9 23573
immunereactionfo00wall_0086thm.jpg
THUMB87 0bb74a0b4e5d8ab2bba0b394b74fc30b 18147
immunereactionfo00wall_0087thm.jpg
THUMB88 2a5f7c6cef0e5efc293a0eec0524d726 23128
immunereactionfo00wall_0088thm.jpg
THUMB89 b1aea238166281bca3382d198899b108 24211
immunereactionfo00wall_0089thm.jpg
THUMB90 a4dbb70ef8e3a8a9b38e410de3952cd6 23544
immunereactionfo00wall_0090thm.jpg
THUMB91 c226b7cc21cbca42442f3bd9ccfaf10f 22529
immunereactionfo00wall_0091thm.jpg
THUMB92 7324a9808140ea83bb29d4ae619ab13a 23746
immunereactionfo00wall_0092thm.jpg
THUMB93 4a42129c2bb6dcf763c8360977b5b731 23480
immunereactionfo00wall_0093thm.jpg
THUMB94 ddbe641786be5adca1757ce4971f6619 13836
immunereactionfo00wall_0094thm.jpg
THUMB95 6db27a3c45a55b0beb7fe39cafce272d 21704
immunereactionfo00wall_0095thm.jpg
THUMB96 0c7f0aa95ce39071940d802a419ef6d3 24042
immunereactionfo00wall_0096thm.jpg
THUMB97 9dfbcc045d3d14394a104817c99dd1b7 24016
immunereactionfo00wall_0097thm.jpg
THUMB98 87876ac0ffd205547e4820402d1e940c 23998
immunereactionfo00wall_0098thm.jpg
THUMB99 6db57d78bf6fa64320c155bd7f0a8f59 24041
immunereactionfo00wall_0099thm.jpg
THUMB100 f09dfef3d90d609873c7ddd6fdf8e29c 23885
immunereactionfo00wall_0100thm.jpg
THUMB101 e63a263346c2c6933aff9368f0f65cd1 23959
immunereactionfo00wall_0101thm.jpg
THUMB102 1db37bf3981bb53e563aa6ea4ca05cec 24336
immunereactionfo00wall_0102thm.jpg
THUMB103 df4a96854a81133800daa7d802b76dc1 23940
immunereactionfo00wall_0103thm.jpg
THUMB104 c21e335936a755f8140bbba09d9b96e1 24057
immunereactionfo00wall_0104thm.jpg
THUMB105 15544a393f55ee120013da943c6172f9 24661
immunereactionfo00wall_0105thm.jpg
THUMB106 9cb5cfd99c4b408f66fdf69c410ccf7d 23913
immunereactionfo00wall_0106thm.jpg
THUMB107 a5cf3e8dd1a786dd1ef835fa1a455b85 19491
immunereactionfo00wall_0107thm.jpg
THUMB108 b16a96c630ef1e25c3edc483641675b0 16561
immunereactionfo00wall_0108thm.jpg
THUMB109 86938b63af8254b7d1369eaffac4897c 20858
immunereactionfo00wall_0109thm.jpg
THUMB110 df81a8bf3847f6c17d41255aa55a9ef1 16793
immunereactionfo00wall_0110thm.jpg
PRO1 textx-pro 4adc57062ee74fc81f7ad5ae34b12173 8270
immunereactionfo00wall_0000.pro
PRO2 bb5627b497e8a1ac12ab625330f4317d 4672
immunereactionfo00wall_0001.pro
PRO3 7a2c8e0990a7017d1183400a6867d7cd 34873
immunereactionfo00wall_0002.pro
PRO4 6e102eb5b9b26cfc29230108e05614e6 65248
immunereactionfo00wall_0003.pro
PRO5 5f876b0ea49665760858c681a4f7541e 91217
immunereactionfo00wall_0004.pro
PRO6 027bc0d67d10cab96dc5c4650c4d34ac 27555
immunereactionfo00wall_0005.pro
PRO7 954f594914561ba3c122a84dcc844db4 17979
immunereactionfo00wall_0006.pro
PRO8 6b30aa8ffe83d87cb476742f8888593e 40739
immunereactionfo00wall_0007.pro
PRO9 47dd3a9473a22ae442bd904a5771f134 10983
immunereactionfo00wall_0008.pro
PRO10 41a7a7f9c1604d11563e6ef9ca58e698 46642
immunereactionfo00wall_0010.pro
PRO11 6b69b58a9d7258b5b161165f394597d3 39543
immunereactionfo00wall_0011.pro
PRO12 fa2b78743efccf9cfd1d09c2667dcffe 39476
immunereactionfo00wall_0012.pro
PRO13 2958db337d3d970cbb16fb82b8ec0491 24800
immunereactionfo00wall_0013.pro
PRO14 21971612055891e756c9846a522b4114 38264
immunereactionfo00wall_0014.pro
PRO15 00d4e5e2a0c0a4cfb2dcfa9de172d747 48971
immunereactionfo00wall_0015.pro
PRO16 7a1f7798710ffa38c2fa30d9714df43b 29787
immunereactionfo00wall_0016.pro
PRO17 44c4a4abff1a45cc86c5e2bed9afbf6a 43473
immunereactionfo00wall_0017.pro
PRO18 f73ec403e33a05cae72a07f4cb5bc9f8 48175
immunereactionfo00wall_0018.pro
PRO19 7295de631b000ca36fe90c5431593e5f 45472
immunereactionfo00wall_0019.pro
PRO20 b93d283d1c844e52feda9fc464b5b608 43288
immunereactionfo00wall_0020.pro
PRO21 011c78bb552d3987898ef137614cb239 52735
immunereactionfo00wall_0021.pro
PRO22 146b263a4ad615bd50c5796ce4acfa09 42798
immunereactionfo00wall_0022.pro
PRO23 0f7068ebb5c4af192a26d6f853f6f8a1 45980
immunereactionfo00wall_0023.pro
PRO24 0774159bc9f3d83643444f908e1bece5 44210
immunereactionfo00wall_0024.pro
PRO25 54ea03a91d9ab224cffe8a80d5b2f37d 45547
immunereactionfo00wall_0025.pro
PRO26 cb65e3a4d502c67d290ec959905236a2 46449
immunereactionfo00wall_0026.pro
PRO27 f0276fa64326944909ef998e89ecec84 44303
immunereactionfo00wall_0027.pro
PRO28 50c21bfddf57531961a188dd950d8771 46126
immunereactionfo00wall_0028.pro
PRO29 b112412e35636c240b1f674af9012696 51325
immunereactionfo00wall_0029.pro
PRO30 f3e73f6ec7c71650e4447bbe3dd2ad17 47171
immunereactionfo00wall_0030.pro
PRO31 be6823b9237b1827e6c158e3ee93b236 47430
immunereactionfo00wall_0031.pro
PRO32 259e05ac7f9a3607453f6b7575ba00f2 36340
immunereactionfo00wall_0032.pro
PRO33 619d46864ddad2885f56e1ab76037044 35080
immunereactionfo00wall_0033.pro
PRO34 d05ed5a9397c077fadb9d1e6b05b99bc 42070
immunereactionfo00wall_0034.pro
PRO35 0a291d9d38479528225b18e99b4b8e03 40167
immunereactionfo00wall_0035.pro
PRO36 d7a9fc82dd16584a3dc62562cad58c23 40474
immunereactionfo00wall_0036.pro
PRO37 aaa31e0e2e13f6854e3367babc26c030 43092
immunereactionfo00wall_0037.pro
PRO38 b74f5f88e174a10127759ea36763723b 43772
immunereactionfo00wall_0038.pro
PRO39 e9f3867ca251c648ba864df7566b2d9c 48305
immunereactionfo00wall_0039.pro
PRO40 01e79ebe2e2858ce2b4b2e334663cb77 19711
immunereactionfo00wall_0040.pro
PRO41 b850a73e6b3fc23ec7d8f81431c2c11e 23728
immunereactionfo00wall_0041.pro
PRO42 c03b40a183e482fd2156c94bfd03c03b 22405
immunereactionfo00wall_0042.pro
PRO43 ee92b26a93692fd769f084d719f0f99c 20854
immunereactionfo00wall_0043.pro
PRO44 78166a80c222571e46785dfc47b8a187 16881
immunereactionfo00wall_0044.pro
PRO45 3e02da9e1efe22b894576a19cf025526 9136
immunereactionfo00wall_0045.pro
PRO46 2f3c62ea80008913cc153bf6586b3304 38485
immunereactionfo00wall_0046.pro
PRO47 72b153f760a5c592bfe309a9c24f90bb 41332
immunereactionfo00wall_0047.pro
PRO48 4822def8c242d7d633737aa3748e5fc7 33875
immunereactionfo00wall_0048.pro
PRO49 3e2da6a5e73e3cb91c0b8f7b73bf4e05 33299
immunereactionfo00wall_0049.pro
PRO50 661b5a2ce222388b344a52feb23564e1 6681
immunereactionfo00wall_0050.pro
PRO51 8da4e3d50cfda6583fbaae427522bdb5 6214
immunereactionfo00wall_0051.pro
PRO52 a0c2da45c8f424efd3be86c275bbb1c7 6511
immunereactionfo00wall_0052.pro
PRO53 9146e8cd8a9175b3b22058756203c7d2 6420
immunereactionfo00wall_0053.pro
PRO54 11b685024d0dd7352b9453119987c5ae 6187
immunereactionfo00wall_0054.pro
PRO55 4174b7a6cd71f3c024b989c1167576d8 6228
immunereactionfo00wall_0055.pro
PRO56 f4ad7e589342e556a11485a4031c65c1 6449
immunereactionfo00wall_0056.pro
PRO57 4ce3841bf0811138feee9f7777b6311a 6472
immunereactionfo00wall_0057.pro
PRO58 f294d58137431a225618dad514984f00 6047
immunereactionfo00wall_0058.pro
PRO59 5e0f45aa5a08b6f841020b70e5d14123 6569
immunereactionfo00wall_0059.pro
PRO60 ead14da268600f566537698df171e63d 44432
immunereactionfo00wall_0060.pro
PRO61 34586b6c404b809043dfd0ba63dfd7ad 49996
immunereactionfo00wall_0061.pro
PRO62 3718f73a1b7ea2ab2e071d750a932b08 51394
immunereactionfo00wall_0062.pro
PRO63 0c8d23dafe5dbbba1c4b2937bd198a2f 23777
immunereactionfo00wall_0063.pro
PRO64 5ae804874b6a37ddbed779d8096d7b71 31790
immunereactionfo00wall_0064.pro
PRO65 864891c6142e1a727f6a047230b46ffb 33183
immunereactionfo00wall_0065.pro
PRO66 10bf979813f094d5b16886aeda196142 36157
immunereactionfo00wall_0066.pro
PRO67 ff5a9ca58eda825db18bc8a932908ae1 41146
immunereactionfo00wall_0067.pro
PRO68 b414e644922c1434a34e02d2727f586d 38088
immunereactionfo00wall_0068.pro
PRO69 ca509c2ecc8f7575a9f6b874448a2ced 29891
immunereactionfo00wall_0069.pro
PRO70 8fef456b0e09d449146c9d6a361d9d62 42342
immunereactionfo00wall_0070.pro
PRO71 31fc6eb968734867403048603ad739d1 34705
immunereactionfo00wall_0071.pro
PRO72 e97113df8e25cf1a871c90e1a3b0592c 13665
immunereactionfo00wall_0072.pro
PRO73 92a6695565c3c0c0fe5e37b1ebf3ce39 13302
immunereactionfo00wall_0073.pro
PRO74 c4f25aec8fa149ee917a0c3d43de7b32 13222
immunereactionfo00wall_0074.pro
PRO75 f88eade73ed8d1205f52851c6d1feabb 13359
immunereactionfo00wall_0075.pro
PRO76 4eccfcb3bfc479cde6fc07fa7419ad41 13026
immunereactionfo00wall_0076.pro
PRO77 4f4e3604e39981b72c1bb0da9773bd78 16809
immunereactionfo00wall_0077.pro
PRO78 988739c01231162e9c4bb79163915b40 48410
immunereactionfo00wall_0078.pro
PRO79 f1ae20ad9b504de3b171fdda7d5f2d54 7030
immunereactionfo00wall_0079.pro
PRO80 9178893a02d917a345e6e4f5b7922987 37518
immunereactionfo00wall_0080.pro
PRO81 d8b0c9c9b914f5807821104f98510619 48964
immunereactionfo00wall_0081.pro
PRO82 92ba0fe4170b328577f71b2b5bd7c771 42654
immunereactionfo00wall_0082.pro
PRO83 295d4b7e7aaa71db02bd0bd8b2f3dde9 40492
immunereactionfo00wall_0083.pro
PRO84 e53492bc9ab304b903adb014ad85fc7a 51278
immunereactionfo00wall_0084.pro
PRO85 e48403daa789a98f40d583a25188e814 45370
immunereactionfo00wall_0085.pro
PRO86 9baaf40dc76344d2cbd1f994fabf7267 45564
immunereactionfo00wall_0086.pro
PRO87 6e260c15c9dce9ce2bbf6c32d5923558 10883
immunereactionfo00wall_0087.pro
PRO88 d4566a840ed05610f37a5a002acd5d68 44808
immunereactionfo00wall_0088.pro
PRO89 6195c1804ab7fc684d199ea034fbe4ec 53344
immunereactionfo00wall_0089.pro
PRO90 2faa987f19c825980a6b2be358384338 49865
immunereactionfo00wall_0090.pro
PRO91 427fd110118f1cdfc90b3157f19146b1 43225
immunereactionfo00wall_0091.pro
PRO92 f0359b3b6667fa4bfbfc7d2c8744359c 48485
immunereactionfo00wall_0092.pro
PRO93 fa432a119c2edcb6f90b83623a842295 45828
immunereactionfo00wall_0093.pro
PRO94 dff9da1a5994476c01f2f95cd3ec9d0d 4531
immunereactionfo00wall_0094.pro
PRO95 5dea308f1cf968e4d2f9eee4d21f6971 47550
immunereactionfo00wall_0095.pro
PRO96 dd2cd113ba4bd516a920f032ed670a16 55301
immunereactionfo00wall_0096.pro
PRO97 b6d4b7ed5d72114d065798357c3c1e2d 57407
immunereactionfo00wall_0097.pro
PRO98 08c136507ad23827f37a3044f5fafa3a 56767
immunereactionfo00wall_0098.pro
PRO99 5e621b5d0f58ace4028b49095cdf5a8e 56852
immunereactionfo00wall_0099.pro
PRO100 9a20548a89ce9a76a7f49f003a588507 54322
immunereactionfo00wall_0100.pro
PRO101 1038903054735b4879531d013ddd44cd 55229
immunereactionfo00wall_0101.pro
PRO102 8fa5a3eb46cb46ebbed895c23b7cd024 57076
immunereactionfo00wall_0102.pro
PRO103 ae38b9a793dd3ebe3676aeb131b2d60a 61181
immunereactionfo00wall_0103.pro
PRO104 226af25f459df12ca9285a599aeaa38b 56911
immunereactionfo00wall_0104.pro
PRO105 faeb6ecc9ec49863849b0c13610a2133 56364
immunereactionfo00wall_0105.pro
PRO106 0fe55a9a3d4f5919ed6b4a3ba90d45d7 57595
immunereactionfo00wall_0106.pro
PRO107 4d9127fbcf66e053023bd6b41c7fafb5 33490
immunereactionfo00wall_0107.pro
PRO108 3a3e8da6a5e7bff702af65d28982db0f 14345
immunereactionfo00wall_0108.pro
PRO109 4bd4281b842f303ff662d7b484d5518d 31555
immunereactionfo00wall_0109.pro
PRO110 431d27f9cc06513afaeba21b3ec1bd82 14903
immunereactionfo00wall_0110.pro
TXT1 textplain 958d6dbd08318efbca25f3fa2efd6346 455
immunereactionfo00wall_0000.txt
TXT2 d50cad0fae27b7e366a6797cb077cfe2 216
immunereactionfo00wall_0001.txt
TXT3 5f8a8dadce7781d2ec0a1430fdd51e8a 1378
immunereactionfo00wall_0002.txt
TXT4 f2102f20f220fac0f977dcff49903b5d 3101
immunereactionfo00wall_0003.txt
TXT5 166d193aa58d273d94bca658aa89ef01 3871
immunereactionfo00wall_0004.txt
TXT6 af2de6780c7d7323370d63ae83cd5250 1314
immunereactionfo00wall_0005.txt
TXT7 5751f915ea4c0e8325d40b4608ac3b05 746
immunereactionfo00wall_0006.txt
TXT8 c5f476752fc21d88a74127b061e3cb49 1752
immunereactionfo00wall_0007.txt
TXT9 a9f632e7e496c9d29b9b6a3bd54ad6a6 435
immunereactionfo00wall_0008.txt
TXT10 01cea1b1cd9ee67bf9080dec113a802b 1974
immunereactionfo00wall_0010.txt
TXT11 9217b5c9bcf9f82c68a74662e8d1f109 1586
immunereactionfo00wall_0011.txt
TXT12 7152363620d0a6bb5e0acccea946e348 1658
immunereactionfo00wall_0012.txt
TXT13 e2702d7bba85afa7602faeb6af742999 1136
immunereactionfo00wall_0013.txt
TXT14 374c77177427887dd6a7e2d7c563ecf3 1563
immunereactionfo00wall_0014.txt
TXT15 b434eef828370e1275b3395e4777ca25 1931
immunereactionfo00wall_0015.txt
TXT16 d8f150a55c5dfb28f384c8cc4e95975c 1265
immunereactionfo00wall_0016.txt
TXT17 24a5aaac6ac069e4c46ef6ff66bbf978 1747
immunereactionfo00wall_0017.txt
TXT18 e4fe0bd4b6794804178b8dd023331e6c 1828
immunereactionfo00wall_0018.txt
TXT19 7b8fd75eb73993f176a74766ff7ec55d 1772
immunereactionfo00wall_0019.txt
TXT20 f40dd828903a8c00b5dba4d8921b0427 1723
immunereactionfo00wall_0020.txt
TXT21 d47087a8b7260e067fb5e6f73aefc053 2038
immunereactionfo00wall_0021.txt
TXT22 b50b54475d5994e9a534862e55a3fba7 1709
immunereactionfo00wall_0022.txt
TXT23 af18a917134a89eea9226e51a9cd65c1 1856
immunereactionfo00wall_0023.txt
TXT24 3211ee62c484de646eac8a148ca3dc15 1730
immunereactionfo00wall_0024.txt
TXT25 d4a3f625c8259f9cc9437d3a33e4a043 1836
immunereactionfo00wall_0025.txt
TXT26 2b7fa23009829eb55f60a32aab97fe20 1846
immunereactionfo00wall_0026.txt
TXT27 65a1cf2b0169a4184f192b04112d200f 1729
immunereactionfo00wall_0027.txt
TXT28 82273fc14637d9a3676771304c808f2e 1850
immunereactionfo00wall_0028.txt
TXT29 65ec1e038a7512250ed87064a40d82a2 1997
immunereactionfo00wall_0029.txt
TXT30 504062fff186d5530cbb4167b44d427f 1840
immunereactionfo00wall_0030.txt
TXT31 fb99f76a0913a407bf86d60e95550067 1865
immunereactionfo00wall_0031.txt
TXT32 ce68aaed1ff08d58ce750447a1cec784 1431
immunereactionfo00wall_0032.txt
TXT33 8b0b74299daa9eb9cbaf935be6c6b746 1687
immunereactionfo00wall_0033.txt
TXT34 7e4a14ff4928a1c39e73991ba6d92b1a 1642
immunereactionfo00wall_0034.txt
TXT35 9b9f622c6b1110fc139a645b12928d65 1587
immunereactionfo00wall_0035.txt
TXT36 e21a446281596724057ac5b05d8c9c0d 1633
immunereactionfo00wall_0036.txt
TXT37 ccdb4570f06c37da014f18e2b0089f4d 1690
immunereactionfo00wall_0037.txt
TXT38 41ed05be57b99866f438bb760517a4a7 1774
immunereactionfo00wall_0038.txt
TXT39 78781033eb387bfe533466ebe48d24ae 1913
immunereactionfo00wall_0039.txt
TXT40 5a3ab9fa8e19b62341a4a7303c4f3851 937
immunereactionfo00wall_0040.txt
TXT41 fbaa6fdeaa8a6259b24655779fd86e7d 1112
immunereactionfo00wall_0041.txt
TXT42 dc25f9fd6a0527ae4403a34031607135
immunereactionfo00wall_0042.txt
TXT43 ba8026f74d85646727dd3ea807ff2b77 816
immunereactionfo00wall_0043.txt
TXT44 2a7ed86dfb4856912e2e79b658c21c0e 717
immunereactionfo00wall_0044.txt
TXT45 8d0415a66829dd207ab429f5a30b8edc 416
immunereactionfo00wall_0045.txt
TXT46 1e81ccd57a4d2897ea2143096258534f 1515
immunereactionfo00wall_0046.txt
TXT47 5bc61d4a4d3145226ce7f9910e382062 1657
immunereactionfo00wall_0047.txt
TXT48 1e7adb738d33dabd82ce9b31e22db3a9 1364
immunereactionfo00wall_0048.txt
TXT49 c148f07445a29fd5814abe465e43503b 1389
immunereactionfo00wall_0049.txt
TXT50 eb4e8bf5f5e056dd9e8d0c802443336c 488
immunereactionfo00wall_0050.txt
TXT51 22e0e18b0b2c0f2b2a927f85b22069eb 297
immunereactionfo00wall_0051.txt
TXT52 4c605fa14c74a6381476a1c36e0ee3f4 337
immunereactionfo00wall_0052.txt
TXT53 c5a9ba7c27e3c8a5fa5827180de89d11 334
immunereactionfo00wall_0053.txt
TXT54 2021b5fe8f2ebc2860a0f5e116145d4f 335
immunereactionfo00wall_0054.txt
TXT55 568b37bbf262ead2ae124790c3650405 396
immunereactionfo00wall_0055.txt
TXT56 e217f195dd041df39791e06347325639 453
immunereactionfo00wall_0056.txt
TXT57 5335dd213f228880f9ac5da7f1997968 467
immunereactionfo00wall_0057.txt
TXT58 e508fb9ac2b6162883af0752f4718db0 282
immunereactionfo00wall_0058.txt
TXT59 2de08752f56c2a1691910cf527eddf57 331
immunereactionfo00wall_0059.txt
TXT60 e0b4529fb17b51b9598543c7a40494fd 1734
immunereactionfo00wall_0060.txt
TXT61 42239cde3c27471b1593d405618ea775 1929
immunereactionfo00wall_0061.txt
TXT62 aef3e8de65b2c67042c9d37726150817 1988
immunereactionfo00wall_0062.txt
TXT63 351e90b1cc4e0de682d4071aca591c2f 950
immunereactionfo00wall_0063.txt
TXT64 e54ae5cc384f2209690bd139ca6de866 1346
immunereactionfo00wall_0064.txt
TXT65 c6aeaa41f9300398766557ab8bfc165e 1299
immunereactionfo00wall_0065.txt
TXT66 d7405a7ff8755fb1e392ae0694e0887e 1393
immunereactionfo00wall_0066.txt
TXT67 ba2a846195cb2f0a89c62aea6c63ebff 1580
immunereactionfo00wall_0067.txt
TXT68 e128cb805ed4b967d0254816cc2811b9 1504
immunereactionfo00wall_0068.txt
TXT69 556ce5bded6cf98595300264a0043662 1228
immunereactionfo00wall_0069.txt
TXT70 cb633792f57842267623872b710d71e8 1742
immunereactionfo00wall_0070.txt
TXT71 1ca29b0182bebefb31fec69e3383950d 1403
immunereactionfo00wall_0071.txt
TXT72 fab60f20cf574ddfab4d45751e410865 615
immunereactionfo00wall_0072.txt
TXT73 a245e9f654f1664db8aa8388264d4168 687
immunereactionfo00wall_0073.txt
TXT74 8885f783aa661245cf527501631e63cd 691
immunereactionfo00wall_0074.txt
TXT75 653bfcb4b80735f7444c661a3b7a4292 550
immunereactionfo00wall_0075.txt
TXT76 172e3e804b12d4e0c2b74068bb3be4ae 680
immunereactionfo00wall_0076.txt
TXT77 1075bd4a86ad30509e4504259c3e62c1 682
immunereactionfo00wall_0077.txt
TXT78 8407b1b0be0389efb658421b4cbc450f 1894
immunereactionfo00wall_0078.txt
TXT79 f767d9f7b7d4bacb6e350944c033f360 316
immunereactionfo00wall_0079.txt
TXT80 65591b37d2215fedee9e63dde458ef7b 1514
immunereactionfo00wall_0080.txt
TXT81 606a0d061fb9aea6af3d77a51f5291ee 1912
immunereactionfo00wall_0081.txt
TXT82 fc56d29d4a454133bd21b699f415602f 1722
immunereactionfo00wall_0082.txt
TXT83 26e0b81f2d8d90cbf266b9d609486b57 1608
immunereactionfo00wall_0083.txt
TXT84 57f195a26ef1680c108e6f46122cd860 1984
immunereactionfo00wall_0084.txt
TXT85 f67bf137650dbc54c7890509b6f3834f 1773
immunereactionfo00wall_0085.txt
TXT86 2cf467f2e7e0a810cf19a809d06ca9d1 1812
immunereactionfo00wall_0086.txt
TXT87 994374aca6d05c3c80a213a3a6dcf9e9 519
immunereactionfo00wall_0087.txt
TXT88 ca4d5041505db76ba194ba2514b7d2d1 1789
immunereactionfo00wall_0088.txt
TXT89 516472b5911b1f77be49401c1b21a076 2059
immunereactionfo00wall_0089.txt
TXT90 62ffd736531a1688e1dde601e683c067 1954
immunereactionfo00wall_0090.txt
TXT91 7e8424f7d4bf96deeabdf34c7ea4f0a3
immunereactionfo00wall_0091.txt
TXT92 2921b7436b35277776d2d4619c4c5cb8
immunereactionfo00wall_0092.txt
TXT93 d9e15ef747eb0184a3d482567b03cca9 1790
immunereactionfo00wall_0093.txt
TXT94 6837f959adcb89c65fb5f1b9cd7f52d9 219
immunereactionfo00wall_0094.txt
TXT95 53ae2960e5341f189dcbc08bdafd3dd7 1864
immunereactionfo00wall_0095.txt
TXT96 6e03ac8863964fe5bf2aa908e64ce507 2114
immunereactionfo00wall_0096.txt
TXT97 9550d0162c9b3407e6733f5844ff5bc5 2200
immunereactionfo00wall_0097.txt
TXT98 956fcd5ad41a7440f7dcb5c978e39006 2171
immunereactionfo00wall_0098.txt
TXT99 b558053be24338f9f650f7bda370da04
immunereactionfo00wall_0099.txt
TXT100 b8479f70912a1f25071dccd5dec460b3 2080
immunereactionfo00wall_0100.txt
TXT101 c33c30266e98723daab34c9d9d08fcfe 2113
immunereactionfo00wall_0101.txt
TXT102 ac33c676139e34b19faa7051062aa45b 2186
immunereactionfo00wall_0102.txt
TXT103 3c34f612692d03bcdf31745cf5609253 2339
immunereactionfo00wall_0103.txt
TXT104 7f4cb48cb2ff24db0bf9c5341ce1cf61 2173
immunereactionfo00wall_0104.txt
TXT105 52549134e0b19055b60280e3ad1e0ba9 2157
immunereactionfo00wall_0105.txt
TXT106 e549ff814f4b99dd05ff4a808d8511e3 2202
immunereactionfo00wall_0106.txt
TXT107 f406311e4d6552815c05a9af20eeff28
immunereactionfo00wall_0107.txt
TXT108 0258e85a88dae526f1724556b3308800 595
immunereactionfo00wall_0108.txt
TXT109 48b81d54f483e5537be02f5b6af1aee4 1589
immunereactionfo00wall_0109.txt
TXT110 df3147e970bf48fae2d28f9cd799283a 693
immunereactionfo00wall_0110.txt
PDF1 applicationpdf 8a36b2299b9f1ff7f15ad0ac2954065a 3645136
immunereactionfo00wall.pdf
METS2 unknownx-mets f80d63c30e6fdaa1e326e698ff7eab88 122864
AA00030024_00001.mets
METS:structMap STRUCT1 physical
METS:div DMDID ADMID ORDER 0 main
PDIV1 1 Title Page
PAGE1 i
METS:fptr FILEID
PDIV2 2 Dedication
PAGE2 ii
PDIV3 Acknowledgments 3 Section
PAGE3 iii
PDIV4 4 Table Contents
PAGE4 iv
PAGE5 v
PAGE6 vi
PDIV5 5 List Tables
PAGE7 vii
PDIV6 6 Figures
PAGE8 viii
PAGE9 ix
PDIV7 7 Abstract
PAGE10 xi
PDIV8 Chapter 1. Introduction 8
PAGE11
PAGE12
PAGE13
PDIV9 2. Review the literature 9
PAGE14
PAGE15
PAGE16
PAGE17
PAGE18
PAGE19
PAGE20 10
PAGE21 11
PAGE22 12
PAGE23 13
PAGE24 14
PAGE25 15
PAGE26 16
PAGE27 17
PAGE28 18
PAGE29 19
PAGE30 20
PAGE31 21
PAGE32 22
PAGE33 23
PDIV10 3. An investigation properties type-A using D-galactosamine and cyclosporin-A
PAGE34 24
PAGE35 25
PAGE36 26
PAGE37 27
PAGE38 28
PAGE39 29
PAGE40 30
PAGE41 31
PAGE42 32
PAGE43 33
PAGE44 34
PAGE45 35
PDIV11 4. Serum cytokine levels in Swiss Webster mice exposed IP IG to CPE vitro production a macrophage cell line
PAGE46 36
PAGE47 37
PAGE48 38
PAGE49 39
PAGE50 40
PAGE51 41
PAGE52 42
PAGE53 43
PAGE54 44
PAGE55 45
PAGE56 46
PAGE57 47
PAGE58 48
PAGE59 49
PAGE60 50
PAGE61 51
PAGE62 52
PAGE63 53
PDIV12 5. Organ specific time course messenger RNA response
PAGE64 54
PAGE65 55
PAGE66 56
PAGE67 57
PAGE68 58
PAGE69 59
PAGE70 60
PAGE71 61
PAGE72 62
PAGE73 63
PAGE74 64
PAGE75 65
PAGE76 66
PAGE77 67
PAGE78 68
PAGE79 69
PDIV13 6. Fecal bile acids, neopterin, sudden infant death syndrome
PAGE80 70
PAGE81 71
PAGE82 72
PAGE83 73
PAGE84 74
PAGE85 75
PAGE86 76
PAGE87 77
PAGE88 78
PAGE89 79
PAGE90 80
PDIV14 7. Conclusions
PAGE91 81
PAGE92 82
PAGE93 83
PAGE94 84
PDIV15 References
PAGE95 85
PAGE96 86
PAGE97 87
PAGE98 88
PAGE99 89
PAGE100 90
PAGE101 91
PAGE102 92
PAGE103 93
PAGE104 94
PAGE105 95
PAGE106 96
PAGE107 97
PDIV16 Biographical sketch
PAGE108 98
PAGE109 99
PAGE110 100
STRUCT2 other
ODIV1 Main
FILES1
FILES2



PAGE 1

IMMUNE REACTION FOLLOWING INTOXICATION WITH CLOSTRIDIUM PERFRI N GENS TYPE A ENTEROTOXTN By F MORGAN WALLACE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1999

PAGE 2

This dissertation is dedicated to my supportive wife, Joy, my wonderful new son, Christopher, and to my parents, especially my mother who read to me when I was a child.

PAGE 3

ACKNOWLEDGMENTS I would like to acknowledge all the people who provided help, advice, and encouragement during this long and difficult process but that is not possible as to do so would take many, many pages. This is thus not anywhere near a complete list of the people to whom I owe so much. In particular I would thank Dr. James Lindsay for his unswerving loyalty and support. It has been a privilege working for him and his guidance has given me the confidence that I can head a productive research lab soon myself. I would also like to thank Annette Mach for her help and feedback regarding all aspects of my work, especially for teaching me everything I know about tissue culture. She is a better lab manager than she will ever get credit for. I am also indebted to Dr. Lindsay's other graduate students during my time in his lab, especially Lisa Wojciechowski and Andreas Keller for their camaraderie and friendship. The members of my committee, Dr. Douglas Archer, Dr. Edward Hoffmann, Dr. Mark Tamplin, and Dr. Sean O'Keefe, have my sincerest gratitude. Of particular help were discussions with Dusty Perm about mice, Tcell receptors and MHC, and with Drs. Barbara Torres and Howard Johnson regarding superantigens. Finally, I would like to thank Walter Jones for his invaluable assistance with graphics. iii

PAGE 4

TABLE OF CONTENTS page ACKNOWLEDGMENTS jji LIST OF TABLES vii LIST OF FIGURES viii ABSTRACT [ x INTRODUCTION 1 REVIEW OF THE LITERATURE 4 The Genus Clostridium 4 Clostridium perfringens 5 Isolation and Sporulation in the Laboratory 7 C. perfringens Enterotoxin (CPE) 7 C. perfringens in Food-borne Illness 8 Prevention of C. perfringens Food-borne Illness 10 Genetics of CPE Expression 10 Symptoms of CPE Intoxication 12 Human Feeding Studies 13 Mechanisms of Action of CPE 13 Support for the Use of the Mouse Model 15 Vaccine Possibilities 15 Antigens and Superantigens 16 CPE as a Superantigen 18 Cytokines and the Inflammatory Immune Response 18 C. perfringens and the Sudden Infant Death Syndrome 21 AN INVESTIGATION OF THE PROPERTIES OF CLOSTRIDIUM PERFRINGENS TYPE-A ENTEROTOXIN USING D-GALACTOSAMINE AND CYCLOSPORIN-A 24 Introduction 24 Materials and Methods 26 iv

PAGE 5

Reagents 26 Mice 26 Toxin Administration and Lethal Dose 27 Results 28 Discussion 29 SERUM CYTOKINE LEVELS IN SWISS WEBSTER MICE EXPOSED IP AND IG TO CPE AND IN VITRO CYTOKINE PRODUCTION OF A MACROPHAGE CELL LINE EXPOSED TO CPE 36 Introduction 36 Materials and Methods 37 Reagents 37 Tissue Culture 37 Measurement of Cytokine Levels in vitro 38 Mice 38 Toxin Administration 38 Blood Collection and Serum Isolation 39 In vivo Cytokine Determination 39 Results 39 Cytokine levels in vitro 39 Cytokine levels /'// vivo 50 Discussion 50 ORGAN SPECIFIC TIME COURSE OF CYTOKINE MESSENGER RNA RESPONSE FOLLOWING CLOSTRIDIUM PERFRINGENS TYPE A ENTEROTOXIN INTOXICATION 54 Introduction 54 Materials and Methods 54 Reagents 54 Mice 55 Toxin Administration 55 Necropsy and Organ Harvesting 55 RNA Isolation 56 Reverse Transcription 57 PCR Reactions 57 Gel Electrophoresis 58 Visualization of PCR Products 59 Results 59 Discussion 60 FECAL BILE ACIDS, NEOPTERIN, CLOSTRIDIUM PERFRINGENS AND THE SUDDEN INFANT DEATH SYNDROME 70 v

PAGE 6

Introduction 70 Materials and Methods 72 Fecal and Urine Samples 72 Microbiology 72 Enterotoxin Quantitation 73 Bile Acid Analysis 73 Neopterin Analysis 75 Results 76 Discussion 78 CONCLUSIONS 81 REFERENCES 85 BIOGRAPHICAL SKETCH 98 vi

PAGE 7

LIST OF TABLES Table page 2. 1 Typing of C. perfringem by toxins produced 6 2 .2 Sources and effects of the major proinflammatory cytokines 23 3. 1 Effect of D-galactosamine (D-gal) on CPE sensitivity for Swiss Webster mice 27 3 .2 Effect of Cyclosporin A (CyA) on CPE sensitivity for Swiss Webster mice 28 3.3 Effect of D-galactosamine (D-gal) on CPE sensitivity for BALB/c mice 29 3.4 Effect of Cyclosporin A (CyA) on CPE sensitivity for BALB/c mice 30 5.1 Cytokine primers used for PCR 61 vii

PAGE 8

LIST OF FIGURES Figure page 3 .1 Determination of Mouse Lethal Dose (MLD) for CPE Administered IP 30 3 .2 Determination of Mouse Lethal Dose (MLD) for CPE Administered IG 3 1 4.1 Serum levels of IL-la following IP administration of CPE 40 4.2 Serum levels of IL-2 following IP administration of CPE 41 4.3 Serum levels of IL-6 following IP administration of CPE 42 4.4 Serum levels of IFN-y following IP administration of CPE 43 4.5 Serum levels of TNP-a following IP administration of CPE 44 4.6 Serum levels of IL-la following IG administration of CPE 45 4.7 Serum levels of IL-2 following IG administration of CPE 46 4.8 Serum levels of IL-6 following IG administration of CPE 47 4.9 Serum levels of IFN-y following IG administration of CPE 48 4. 10 Serum levels of TNF-a following IG administration of CPE 49 5.1 IL-la mRNA evaluation 62 5.2 IL-2 mRNA evaluation 63 5.3 IL-6 mRNA evaluation 64 5.4 IFN-y mRNA evaluation 65 viii

PAGE 9

5 . 5 TNF-a mRNA evaluation 66 5.6 RT-PCR evaluation of liver transcription 67 6. 1 Chromatograms for (A) Standards (B) Representative fecal sample 77 6.2 Total fecal bile acid levels 77 ix

PAGE 10

5 . 5 TNF-a mRN A evaluation bb 5.6 RT-PCR evaluation of liver transcription 67 6. 1 Chromatograms for (A) Standards (B) Representative fecal sample 77 6.2 Total fecal bile acid levels 77 ix

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IMMUNE REACTIONS FOLLOWING INTOXICATION WITH CLOSTRIDIUM PERFRINGENS TYPE ENTEROTOXTN By F. Morgan Wallace May 1999 Chairman: James A. Lindsay Major Department: Food Science and Human Nutrition Many bacterial toxins have been found to interact with the immune system in a variety of ways. Some of these effects prove to be damaging to those exposed to these products. The bacterial pathogen Clostridium perfringens is the third leading cause of foodborne illness in the United States. The agent directly responsible for this illness is the Clostridium perfringens type A enterotoxin (CPE) which causes a profuse diarrheal illness frequently with symptoms of nausea that are usually self-limiting. Another illness which can be caused by this organism is the infectious diarrhea syndrome most often seen in institutionalized patients such as those in nursing homes. This illness is more protracted than the normal food poisoning and as it frequently strikes the debilitated (ill and/or elderly), it can cause death. It has been generally accepted that the ability of this toxin to cause pore formation in susceptible cells is the mechanism by which diarrhea and other effects of this toxin are caused; however, some bacterial toxins produce similar symptoms by interacting with the immune system. This research determined the effect of CPE upon the immune system using mice as a model system. Following administration of CPE there was a demonstrable interaction with the immune system which could be responsible for some of the symptoms in those affected by this toxin.

PAGE 12

CHAPTER 1 INTRODUCTION Clostridium perfnngens type A enterotoxin (CPE) is the causative agent of the third most common cause of food-borne illness (FBI) in the United States, causing greater than 12% of reported cases of FBI. Symptoms of this FBI include a profuse diarrhea which, in severe cases, can be explosive, severe abdominal pain, and nausea. This illness is responsible for much suffering and an estimated economic cost of greater than $200 million in the USA and Canada. Studies have also implicated CPE in many cases of the Sudden Infant Death Syndrome (S1DS). Of the approximately 5,000 cases of SIDS in the USA per year, 50-80% are associated with high levels of CPE and C. perfringens spores in the bowel (Lindsay, 1996). Though a cause and effect relationship has not been conclusively proven, the finding of evidence of an immune activation in many cases of SIDS makes this a compelling hypothesis (Vege et al., 1995). Recent research (Bowness et al., 1992) indicated that CPE was a superantigen. Though this subsequently proved incorrect (Krakauer et al., 1997; Wallace et al., 1999), it did lead to additional investigation into the interaction of the immune system and CPE. Further research demonstrated a marked activation of the immune system in a murine model of CPE enteric illness, and suggests several additional avenues of research that may provide further insights into the nature of the FBI associated with CPE, as well as the ultimate causes of SIDS. 1

PAGE 13

The responses of the immune system following exposure to bacterial products have been the subject of much recent research. The reason for this interest is that researchers are now coming to recognize a connection between the immune response and pathology associated with bacterial toxins. In light of this realization, the immune response to CPE was characterized in the mouse model and areas for further research were delineated. Also an investigation into some relevant aspects of SIDS was conducted evaluating whether altered fecal bile acid levels played a role in SIDS and whether neopterin, a product of activated macrophages, was present in increased amounts in SIDS victims. The specific objectives of this study were as follows: 1. To determine whether CPE was, as reported, a superantigen. 2. To determine the in vitro cytokine response of a macrophage cell line following exposure to CPE. 3. To evaluate the serum cytokine response following intraperitoneal administration of sublethal quantities of CPE in the mouse model of human illness. 4. To evaluate the serum cytokine response following intragastric administration of sublethal quantities of CPE in the mouse model of human illness, which would more closely resemble the human illness, caused by CPE. 5. Following intragastric administration of sublethal quantities of CPE: to determine the organs which are transcriptionally active in producing mRNA coding for cytokines, to determine the time course of this

PAGE 14

3 response, and to compare this response with the serum cytokine response in order to gain insight into the regulation of these responses. 6. To determine whether CPE is associated with altered levels of fecal bile acids in SIDS victims. 7. To determine whether neopterin, a product of activated macrophages, is present in higher levels in SIDS victims than it is in control infants in a small preliminary study. 8. To determine new areas of research which will prove helpful in the understanding of CPE intoxication. The results of this work provide new insights into the response of the host following CPE intoxication. They also demonstrate similarities and differences between the responses observed and that seen following exposure to bacterial endotoxin (LPS) or the staphylococcal enterotoxins. The findings also suggest new avenues of research which will be helpful in further establishing the mechanism of pathogenicity of CPE.

PAGE 15

CHAPTER 2 REVIEW OF THE LITERATURE The Genus Clostridium The Clostridia are a diverse group of bacteria which are all anaerobic, rodshaped and Gram positive. The oxygen tolerance of the organisms varies widely, with some being highly sensitive while others are able to grow on the surface of agar medium incubated aerobically. Morphology of these organisms ranges from short coccoid rods to long filamentous rods. Most are motile with peritrichous flagella. Members of this Genus are ubiquitous with species being found in soil, fresh water, and ocean sediments frequently in the spore state. Though some species are thermophiles or psychrophiles, the vast majority of species are mesophiles. The 1984 Bergey's Manual of Systemic Bacteriology provides detailed comprehensive descriptions of 85 species of Clostridia, of which only a handful are pathogenic to humans (Holt, 1984). Despite the relatively few pathogenic species, there is a great diversity of pathology caused by Clostridia. The Manual of Clinical Microbiology (Onderdonk and Allen, 1995) describes three categories of disease produced by Clostridia. First, are the noninvasive diseases in which toxins cause pathology. Second, are the invasive diseases in which tissue is damaged by an infectious process. Third, are the purulent diseases, which are caused by a mixed population of bacteria including Clostridia growing in a closed space, usually the peritoneum. 4

PAGE 16

5 Clostridium perfringens Clostridium perfringens is a sporeforming, Gram positive obligately anaerobic aerotolerant bacterium that causes considerable morbidity and mortality both in humans and in veterinary populations. This bacterium occurs singly or in pairs with large variations in cell dimensions and morphology. C. perfringens is encapsulated, nonmotile, and capable of producing a wide array of protein exotoxins responsible for its pathogenesis. C. perfringens is believed to be the most common cause of bacterial illness in domestic livestock, causing disease in chickens, cows, and sheep, among others (Songer, 1996). It is grouped into five types (A-E) based on the classic classification scheme of Hobbs (see table 1.1) (Rood and Cole, 1991; Songer, 1996). This typing system uses the production of four toxins (at least 13 are produced) as its basis. All five types were thought to produce the alpha toxin, which is also a phospholipase C, however this now appears not to be the case as strains of C. perfringens which do not produce this protein have been isolated (Lindsay, 1996). Typing of C. perfringens is performed with type-specific antisera. This procedure has been found to be 82% effective in determining a strain type (Murrell, 1989). Debate now exists as to whether this typing scheme should be revised taking into account the new molecular information and typing techniques developed regarding this organism (Lindsay, 1996). For those strains which defy typing by antisera, determination of bacteriocin sensitivity is an alternative method of evaluating strain type. In this procedure, blood agar media is plated with the strain to be typed. Bacteriocin is then added and zones of inhibition are then evaluated (Mahony et al., 1992). Another method to type C. perfringens is the evaluation of capsular

PAGE 17

6 polysaccharide using instrumental techniques. This method as been suggested as a useful rapid technique for the evaluation of food-borne illness-producing isolates (Murrell, 1989). Type A strains produce the appropriately named C. perfringens type A enterotoxin (CPE), which is responsible for a self-limiting diarrheal illness in man. CPE is also likely involved in the pathogenesis of two other illnesses. One form, which appears in malnourished infants and is characterized by colonization and invasion of intestinal tissue, produces a severe and sometimes deadly ulceration of the small intestinal mucosa. The other illness characterized by colonization with C. perfringens type A is the so-called infectious diarrhea syndrome in which usually elderly, institutionalized patients sustain a protracted colonization with C. perfringens leading to a diarrhea of long term duration for which antibiotic therapy is warranted (Larson and Bordello, 1988). Table 2.1 Typing of C. perfringens by toxins produced (from Rood and Cole, 1991). Toxin produced C. perfringens type a P e i 5 A +++ B + ++ + + C + ++ + D ++ E + +

PAGE 18

7 Isolation and Sporulation in the Laboratory Solid media for isolating C. perfringens is both selective and differential. Selectivity is conferred by the addition of antibiotics to which this organism is particularly resistant. Trypticase Sulfite Neomycin Agar (TSN), one of the most widely used isolation media, contains neomycin sulfate and polymyxin sulfate as selective agents. Differential ability is conferred by ferrous citrate and sulfites; during growth of C. perfringens sulfite is reduced and precipitates as iron sulfide, producing black colonies. Other media rely on the ability of the vast majority of strains of C. perfringens to produce phospholipase which give zones of hydrolysis in lecithin containing media. //; vitro sporulation is strain dependent with some strains sporulating abundantly and others proving difficult to induce to sporulate (Labbe, 1989). The most common media used to induce sporulation is the media of Duncan and Strong (Duncan and Strong, 1968). This liquid media consists of 0.4% yeast extract, 1.5% proteose peptone, 0.4% soluble starch, 0.1% sodium thioglycolate, and 1.0% sodium phosphate. Strains which prove difficult to induce to sporulate are sometimes assisted in this activity by the addition of raffinose or methylxanthines which may influence nucleic acid metabolism (Labbe, 1989). C. perfringens Enterotoxin (CPE) CPE is a 35 kD monomeric acidic protein (pl=4.3). It is considered a sporulation associated protein in that synthesis is upregulated during sporulation. It is also produced in small amounts under some vegetative growth conditions (Goldner et al., 1986; Rood

PAGE 19

8 and Cole, 1991). /// vitro experiments have shown that CPE acts by compromising the integrity of the cell membrane, disrupting electrolyte gradients and eventually leading to disruption of macromolecular synthesis (McClane, 1994). //; vivo studies with animal models have shown fluid and electrolyte loss into the lumen of the small bowel following introduction of CPE into ileal loops (McClane, 1996; Lindsay, 1996). The toxin is most active in the ileum (the last portion of the small bowel), with lower activity in the jejunum and duodenum, and with no apparent activity in the colon likely due to its receptor mediated mode of action. These experiments also demonstrated histopathology of the small intestine manifested as a desquamation of the villous enterocytes. This is in contrast to other bacterial enterotoxins, exemplified by cholera toxin, that cause secretory diarrhea with no histopathological damage. C. perfringens in Food-borne Illness Though food-borne illness (FBI) presumptively caused by C. perfringens and its associated enterotoxin had been described in the 19 th century (Klein, 1895), it was not until the 1940s that a definitive association was made between C. perfringens and this FBI (McClung, 1945). Since then, it has been recognized as the third most common cause of FBI in the USA. It is important to note that though we refer to C. perfringens food-borne illness as an intoxication, in the strictest sense it is not. In contrast to other intoxications in which preformed toxin is ingested, CPE toxicosis is the direct result of the consumption of >10 7 vegetative cells which, upon encountering the harsh environment of the gastrointestinal tract, are induced to sporulate. The sporulation process may be accompanied by the production of large amounts of CPE. This

PAGE 20

enterotoxin is active in the small bowel and symptoms develop 8-24 hours after the consumption of contaminated food. The illness usually resolves spontaneously within 12-24 hours. C. perfringem has a number of characteristics which contribute to its importance as a food-poisoning organism. Although classified as an anaerobe, C. perfringem exhibits a tolerance to elevated oxygen levels that is not seen with many other anaerobic bacteria. The relative aerotolerance allows growth in foods such as raw ground beef which has a relatively high oxidation/reduction potential (Eh). Spores of C. perfringem are ubiquitous, being found in virtually all soils examined. Vegetative cells of C. perfringem are also frequently found at low levels in the intestinal tract of many healthy animals including humans (Collee, 1974). As a consequence of its widespread presence, approximately 50% of raw and frozen meat products have been found to be contaminated with this organism (Labbe, 1989). Though C. perfringem may be frequently isolated from the intestinal tract of fish, seafood products are rarely involved in food poisoning. A major characteristic of C. perfringem that contributes to its prevalence as an agent of food-borne disease is its extraordinarily rapid doubling time (McClane, 1996). Under ideal laboratory conditions, C. perfringem can exhibit a generation time as rapid as seven minutes. This short generation time is likely a factor in making CPE food-borne illness so common. Prevention of C. perfringem Food-borne Disease The widespread distribution of C. perfringem spores and their resistance to destruction likely make it impossible to eliminate them from the food supply. Meat and

PAGE 21

10 poultry products are the most common vehicles for this FBI because of the incidence of C. perfringens in such foods and its nutritional requirements (Labbe, 1989). It has been reported that improper cooling procedures or holding temperatures are responsible for 97% of reported FBI caused by this organism (McClane, 1996). To reduce the incidence of C. perfringens associated FBI, foods should be kept at temperatures not conducive to growth, either through storage at temperatures above 60°C or below 15°C following preparation. Especially important is not allowing foods to remain at C. perfringens ' ideal growth temperature of 43-47°C. pH can also play a role in the prevention of C. perfringens growth. The pH range for growth of this organism is 5.0-8.3 but optimum growth occurs between 6.0 and 7.0. Genetics of CPE Expression CPE mRNA has an exceptionally long half-life of 58 minutes in sporulating cells (Labbe and Duncan, 1977). This is likely one reason for the very high expression of this protein during the sporulation process. The link of sporulation and CPE synthesis led to the hypothesis that CPE was a spore coat component (Frieben and Duncan, 1973). These workers used sporulation defective mutants of C. perfringens to study the production of CPE. Early stage spoO sporulation mutants but not later stage spoV mutants proved defective in CPE production. Additional studies using immunolabeling and electron microscopy demonstrated that CPE was confined to the cytoplasm (Walker et al., 1975). Because of this work, the hypothesis that CPE was a structural component of the spore proved incorrect.

PAGE 22

11 The complete CPE gene has been cloned and sequenced (Czeczulin et al., 1993) allowing much more detailed studies of the regulation of synthesis and genomic organization. The CPE mRNA has been determined to be transcribed as a monocistronic message with the origin of transcription located approximately 200 base pairs (BP) upstream of the CPE translation start site (Melville et al., 1997). The Escherichia coli transformant containing cpe was found to express low levels of CPE (apparently driven by a C. perfringens promoter) in amounts comparable to nonsporulating cultures of C. perfringens. Sporulating cultures of C. perfringens were found to produce vastly greater quantities of enterotoxin, suggesting that sporulation is not essential for CPE synthesis but does induce high-level synthesis (Czeczulin et al., 1993). The CPE gene has been shown to be contained on a mobile element, a transposon or lysogenized phage, which at least theoretically allows transfer of cpe between C. perfringens strains (Canard et al., 1992). The location on a mobile element likely explains the presence of cpe in both chromosomal and plasmid locations. Though the reason is not known, all food poisoning isolates examined have cpe integrated into the chromosome. Veterinary isolates, in contrast, frequently have a plasmid-borne cpe gene (Cornillot et al., 1995). The significance of the facts that cpe appears to be contained in a mobile element and that there are different locations for the gene in human and veterinary pathogenic strains is not clear. Some type C strains of C. perfringens have also been found to carry the cpe gene, without any evidence that they can cause FBI in humans (Lindsay, 1996). Further work examining the relationship between environmental, veterinary, and human associated strains will hopefully provide a more complete understanding of the source of food-borne disease-causing strains of C. perfringens. Also of interest is the finding that some C.

PAGE 23

12 perfringens type E strains possess a silent form of the cpe gene. Whether this gene is an ancestral prototype of cpe or is the result of a later insertional event made possible by the presence of cpe on a mobile genetic element is the subject of much debate (Lindsay, 1996). This finding is especially interesting in light of the recent discoveries of other silent toxin genes in other species of Clostridia (Lindsay, 1996). The relationship between silent clostridial genes, mobile genetic elements, and pathogenesis is a subject awaiting further research. Symptoms of CPE Intoxication Symptoms of the FBI associated with CPE include nausea, intestinal cramps, and a diarrhea which can range from mild to extreme (often described as explosive). Symptoms are apparent 8-24 hours after infection and usually spontaneously resolve within 24 hours of onset (Labbe, 1989). Fatalities are rare and those that occur are usually in the very young, elderly, or immunocompromised. C. perfringens type A and CPE have also been implicated in a more aggressive diarrheal illness resulting from a more persistent colonization and overgrowth of the bowel than that which occurs in the typical FBI. This illness most frequently occurs in the elderly, often in long term care facilities such as nursing homes, and often following antibiotic therapy. It has a more protracted course than the FBI, lasting on average 11 days (Larson and Boriello, 1988). Blood in the stool may be evident along with severe abdominal pain. This disease is in some ways similar to that caused by C. difficile following antibiotic therapy.

PAGE 24

13 Human Feeding Studies In human volunteer feeding studies, sublethal levels of CPE administered intragastrically, produce symptoms typical of C. perfringens type A induced FBI (Skjelkvale and Uemura, 1977) including diarrhea and abdominal cramps with pain. These studies revealed that administration of 100 ng toxin / g body weight is sufficient to induce this response. Other studies revealed that 10 s vegetative cells administered orally were required to induce illness in human volunteers (Duncan and Strong, 1969). Mechanisms of Action of CPE CPE disrupts the integrity of plasma membranes of susceptible cells and it is through this activity that this enterotoxin exerts its cytotoxic effects (McClane, 1994). Detailed studies of the biochemistry of this receptor-mediated phenomenon have been conducted in the laboratory of McClane. As pronase pretreatment of brush border membranes reduced binding of CPE, the receptor(s) is/are thought to be proteinacious (Wnek and McClane, 1986). A 50 kDa protein from rabbit brush border membrane was identified as the putative enterotoxin receptor (Wnek and McClane, 1986). A similar protein was found to bind CPE on Vero cells (African green monkey kidney cells) and it was further found that the CPE-receptor complex aggregates to form a 160 kDa complex. By simple subtraction (35 kDa CPE, 50 kDa receptor), it was concluded that the additional binding substance was an approximately 70 kDa protein (Wiekowski et al., 1994). Detailed models of CPE binding, insertion, and conformational changes of CPE and receptor have been proposed to account for the experimental results using cloned portions and mutated forms of the CPE molecule and various biochemical techniques

PAGE 25

14 (McClane, 1996). It should, however, be noted that recently another team of researchers has cloned and sequenced a 22 kDa protein from Vero cells which appears to be the CPE receptor (Katahira et al., 1997). The results of their study satisfied most of a molecular version of Koch's postulates. First, cells expressing the receptor were sensitive to the cytotoxic effect of CPE while cells not expressing this protein were resistant to this effect. Second, the 22 kDa receptor was found to render resistant cells sensitive to the enterotoxin when expressed in them. The only remaining work which must be done to make their work complete is the inactivation of their receptor in a sensitive cell line and the demonstration that this line is no longer sensitive to the effects of CPE. Results also showed that CPE could not assemble into a complex unless it interacted with this receptor. The rigor of the work conducted by Katahira is impressive, however it contradicts the results of McClane. How the two groups' findings can be reconciled remains to be determined. After binding and insertion, CPE directly induces cell membrane permeability changes (McDonel and McClane, 1979; McClane, 1994). Ion-generated membrane polarity is compromised by these changes leading to inhibition of DNA, RNA, and protein synthesis (Hulkower et al., 1989). In vivo these changes are thought to impair cellular metabolism and eventually lead to cell death. As sensitive cells in the small bowel epithelium (in particular villous enterocytes) die, histopathological alterations occur with associated fluid and electrolyte loss into the lumen of the bowel with resultant diarrhea.

PAGE 26

15 Support for the Use of the Mouse Model Mice are the most common animal species used to study infectious processes. The reasons for this are grounded in both pragmatism and good science. Pragmatically, mice are inexpensive to purchase and maintain. Of greater importance is that inbred mouse strains allow the use of many genetically identical mice reducing the diversity of responses to infectious agents and their toxins seen in normal populations. This makes results more reliable and reproducible. Also of major benefit to those studying immune system activities, the genetic regions associated with immune function in these mouse strains are well characterized. Studies involving CPE have been conducted in a wide range of animals including sheep, calves, monkeys, rabbits and mice (Weiss et al., 1966; Tsai and Reiman, 1975; Lindsay and Dennison, 1986). Mice were found to elicit similar responses to humans upon exposure to CPE (Tsai and Reiman, 1975; Lindsay and Dennison, 1986). Vaccine Possibilities Vaccination of animals to induce resistance to infection has proven very successful. Vaccine strains are typically multivalent, containing killed cells, inactivated toxins, or both (Songer, 1996). Though vaccination in animals to prevent illness caused by C. perfringens is common, it is doubtful that such a strategy will be feasible in humans. First, many veterinary illnesses caused by C. perfringens are fatal, particularly in young animals, and thus contribute to large economic losses. In humans, in contrast, the vast majority of those affected experience a spontaneous recovery with no apparent long term sequelae. Second, there appears to be no long term immunity conferred by

PAGE 27

16 infection in humans after CPE food-borne disease, despite the fact that there is detectable antibody to CPE for several weeks following exposure (Skjelkvale and Uemura, 1977; Mietzner et al., 1992). This may make design of a vaccine for humans difficult. Antigens and Superantigens Normal antigens from extracellular sources are taken up by Antigen Presenting Cells (APCs) and are degraded intracellularly to polypeptide fragments which are then presented in the context of MHC Class-II to T-Cells whose T-Cell receptor (TCR). If the binding region of the TCR possesses the proper protein sequence to interact strongly with the presented antigen, events are induced which lead to activation of the T-cell. Superantigens, in contrast, bind directly to MHC class II without uptake and subsequent processing. In the context of MHC class II, these proteins bind noncovalently to the TCR. This interaction occurs outside the normal binding groove of the TCR in a region designated the V(3 region (the variable region of the (3 chain of the TCR molecule). This interaction between MHC class II, superantigen, and TCR activates the T-cell to proliferate and produce cytokines just as a normal peptide antigen does. The difference between normal antigens and superantigens is the number of reacting cells. A normal peptide antigen can activate between 1 in 10 5 and 1 in 10 6 T-cells. Superantigens, on the other hand, can activate up to 1 in 4 T-cells. This is because of the limited number of VP regions expressed by an individual. For example, there are approximately 25 different V|3 regions in mice and approximately 60 in humans. As each superantigen normally binds to more than one VP region it is obvious that a large fraction of the T-cell

PAGE 28

17 population can become activated. Activating such a substantial number of T-cells can have extremely harmful effects. Normally when an individuals' immune system is challenged a balance is attained generating a vigorous immune response which will clear the invader but not one which is so great that harm to the organism results. In the short term, the signaling molecules of the immune system, the cytokines, can induce harm to the organism. Cytokines in excessive amounts have been implicated in a host of pathologic states including septic shock due to systemic exposure to endotoxin and the toxic shock syndrome from interaction with a staphylococcal exotoxin, toxic shock syndrome toxin-1 (TSST-1) (Miethke et al., 1993). In limited amounts these protein mediators perform valuable functions. They serve as chemotaxins, movement inhibitory factors, and activation signals for the mobile phagocytic cells of the immune system (Thomson, 1998; Mire-Sluis and Thorpe, 1998). They also induce maturation of cells leading to specific humoral immunity to invading pathogens (Thomson, 1998; Mire-Sluis and Thorpe, 1998). As such they are indispensable for healthy immune function (Thomson, 1998; Mire-Sluis and Thorpe, 1998). The D-galactosamine (D-gal) sensitized mouse model is frequently used to study the harmful (lethal) effects of an overproduction of cytokines (Meithke et al., 1993; Freudenberg et al., 1986). This system is used because mice are normally much more resistant to the effects of bacterial products than man. D-gal sensitization engenders a response in mice which renders them approximately as sensitive as man to the effects of these toxic substances.

PAGE 29

18 CPE as a Superantigen Recent work suggested that CPE was a superantigen selectively expanding the population of T-Cells bearing the TCR Vps 6.9 and 22 greatly and Vps 24, 21, 18, 5, and 6.1-6.5 to a lesser extent (Bowness et al., 1992). These results were exciting as they suggested that much of the observed pathology could be caused by mechanisms similar to those of the staphylococcal and streptococcal superantigenic enterotoxins. Though the work concluding that CPE was a superantigen proved incorrect (Krakauer et al., 1997; Wallace et al., 1999), it is possible that another contaminating protein produced by C. perfhngens is in fact a superantigen. To date no work has been conducted to test this hypothesis. Cytokines and the Inflammatory Immune Response Host proteins, specifically cytokines, control the functions that lead to non-specific host defenses and specific immunity following challenge by foreign substances. Recent research has examined the role of cytokines in the observed host response to bacterial toxins. As this work has progressed, it has become clear that many of these bacterial products which were originally studied to elucidate their cytopathic effects possess the ability to modulate the host defense systems. It is now recognized that this interaction, through the generation of proand anti-inflammatory cytokines, is frequently as important as their direct effects in the induction of host pathology. Bacteria and their toxins trigger the synthesis and release of cytokines, which can act in autocrine, paracrine, or endocrine fashion leading to the generation of an immune response. Once initiated, these responses can have deleterious as well as protective aspects. Besides

PAGE 30

19 leading to clearance of infection and protection from future infection, there are negative aspects to these responses. Once initiated, the production of these potent mediators can generate a cascade of interactive cytokines; the host's response is amplified as cytokines induce synthesis of other cytokines. Taken to extreme, these responses elicit septic shock in response to Gram negative bacterial lipopolysaccharide or toxic shock in response to staphylococcal toxic shock syndrome toxin1 (TSST-1), both of which can be lethal to the organism generating the response. Most times there is exposure to bacterial products these deleterious processes do not occur, as there are potent mechanisms for depressing cytokine networks as well. Examples of this regulatory pattern include: tumor necrosis factor-a (TNF) inducing susceptible cells to shed their TNF receptors and making these cells non-responsive to further stimulation by this cytokine, and interleukin-1 (IL-1) inducing synthesis of IL-1 receptor antagonist thus blocking the receptors for IL-1 and making susceptible cells anergic to the effects of additional IL-1 (Cavaillon, 1994). This is of critical importance, as the balance of positive and negative effector molecules appears critical in the outcome of the detrimental effects of inflammation such as shock. Several proinflammatory cytokines also act to induce anti-inflammatory cytokines thus regulating the intensity of the immune reaction. The proinflammatory cytokines have been extensively studied in relation to their central role in the immune response to bacterial toxins and various infections: interferonY (IFN-y), interleukins-1, -2, and -6 (IL-1, -2, -6), and TNF have been extensively studied (See Table 1 for a summary). Briefly, IFN-y is produced by activated T-cells and NK cells and is one of the central components of the pro-inflammatory response. Known functions of this cytokine

PAGE 31

20 include upregulation of MHC Class-II expression, and activation of macrophages. As is the case with many of the proinflammatory cytokines, IFN-y also induces antiinflammatory cytokines which serve to attenuate the immune response and limit selfinduced pathology. IL-1 is a cytokine which is proving to be central in the outcome of infectious disease, particularly those of a bacterial nature. It is produced primarily by macrophages, monocytes, and Kupffer cells. Local effects of IL-1 are neutrophile chemotaxis and release of lipid-derived mediators. Systemic effects include fever, hypotension, induction of cytokine synthesis, and the induction of the acute phase response (Dinarello, 1992). IL-2 is a product of activated T-cells only and is thus an excellent maker of T-cell function. The major function of IL-2 is the induction of a series of steps leading to the clonal expansion of antigen specific T-cells. The principal cytokine stimulating the acute phase response during inflammation appears to be IL-6. It is produced primarily by macrophages and monocytes and also by cytokine stimulated epithelial and endothelial cells. This cytokine is of additional interest because of its role as an antagonist of TNF-a. In some experimental models using the Dgal sensitized murine model of septic shock a protective role against TNF-a mediated mortality was shown for IL-6 (Barton and Jackson, 1993). This effect may be mediated through the acute phase proteins as turpentine (a known inducer of the acute phase response) pretreatment of D-gal sensitized mice offered protection from lethal shock. Though IL-6 is classified as a proinflammatory cytokine it is becoming increasingly clear that this cytokine serves an anti-inflammatory function as well.

PAGE 32

21 TNF-a appears to be the central molecule inducing shock in the D-gal sensitized murine model of septic shock (Tracey and Cerami, 1993) satisfying a Koch's postulates test for a cause and effect relationship with this disease state. TNF is produced during septic shock, causes the syndrome when given to uninfected animals, and when neutralized in septic animals prevents pathology. TNF is the only cytokine so far determined to cause the entire spectrum of symptoms of septic shock including hemodynamic, metabolic, and pathological sequelae (Tracey and Cerami, 1993). Local effects of TNF during infection are of great benefit. Of particular importance is its role in the promotion of margination of leukocytes at the site of inflammation (Bemelmans et al., 1996). C. perfrinsens and the Sudden Infant Death Syndrome The sudden infant death syndrome (SIDS) is defined as the "sudden death of an infant under one year of age that remains unexplained after a thorough case investigation, including performance of a complete autopsy, examination of the death scene and the review of the clinical history" by the National Institute of Child Health and Development (Willinger, 1989). It remains the leading cause of post-neonatal mortality in the United States despite recent large declines, from approximately 2/1000 live births a decade ago to approximately 1/1000 live births today (Scott et al., 1998). These declines are probably due to the campaign to encourage parents to avoid the prone sleeping position for their infants, which is a major risk factor for SIDS (Scott et al., 1998). Virtually every area which has been investigated in relation to SIDS has been found to have differences with control infants, whether in gross anatomy, neuroanatomy, biochemistry,

PAGE 33

22 or microbiology. From this body of research it is beginning to appear likely that there are large numbers of abnormalities in SIDS infants and that many of them may combine to induce vulnerability in an infant. One of the most common features of SIDS infants is that >85% were ill in the two weeks prior to death and indeed findings on autopsy do provide some support for an infectious process occurring in SIDS (Krous, 1984; Beckwith, 1988). The Sudden Infant Death Syndrome has also been associated with C. perfringens and with CPE. 50-80% of SIDS victims and less than 10% of control infants have demonstrated elevated levels of C. perfringens spores and/or enterotoxin in their feces leading some to propose a role for CPE in this syndrome (Lindsay, 1996). This finding that the vast majority of SIDS infants have elevated levels of C. perfringens spores and CPE in their bowel is of interest and suggests that CPE may act as a final trigger in SIDS for an infant made vulnerable in a variety of ways (Wilkinson, 1991; Lindsay et al., 1993). IL-6 levels have been found to be elevated in the cerebrospinal fluid of SIDS infants which provides further support that there is an immune reaction occuring before death from SIDS (Vege et al., 1995). Agents which activate cells of the monocyte/macrophage lineage must be considered as inducers of this increased IL-6 level.

PAGE 34

23 Table 2.2 Sources and effects of the major proinflammatory cytokines. Cytokine Major Source Effect IFN-y T-cells and NK cells -Antiviral and antiprotazoal activities -Increased expression of MHC class II on macrophages and T-cells -Activates macrophage tumoricidal activity -Induces formation and release of TNF by macrophages -Depending on environment either increases or decreases T suppressor cell activity IL-lot Monocytes, macrophages, Kupffer cells, glial cells -Initiate acute phase reaction, fever induction -Through nitric oxide induces hypotension -Induces nausea and vomiting -Inhibits IL-6 production IL-2 Activated T-helper cells -Clonal expansion of antigen specific T-cells -Induces capillary leakage IL-6 Monocytes, macrophages, cytokine stimulated endothelium and epithelium -Primary cytokine involved in acute phase induction -Induces proliferation of pluripotential hematopoietic progenitor cells (in vitro) -Possibly involved in nerve cell function -Stimulates secretion of adrenocorticotrophic hormone TNF-a Monocytes, macrophages, Kupffer cells -Primes the immune response -Induces shock, tissue injury, hypotension, fever, gastrointestinal ischemia, capillary leakage, and anorexia -Increased phagocytic activity of polymorphonuclear leukocytes -Induces transmigration and chemotaxis of monocytes

PAGE 35

CHAPTER 3 AN INVESTIGATION OF THE PROPERTIES OF CLOSTRIDIUM PERFRINGENS TYPE-A ENTEROTOXIN USING D-GALACTOSAMINE AND CYCLOSPORIN-A Introduction In the investigation of the interaction of bacterial products and the host, agents which potentiate or abrogate the responses of certain components of the immune system are of great value. These agents were used to investigate the claim (Bowness et al., 1992) that the Clostridium perfhngens type A enterotoxin (CPE) is a superantigen reacting strongly with V(3 6.9 and 22 and weakly with Vps 24, 21, 18, 5, and 6.1-6.5. Were this claim true, CPE would interact with the immune system in a manner similar to that seen with the staphylococcal enterotoxins. This series of experiments established the mouse lethal dose (MLD, which is a measure of biological activity) for intraperitoneal (IP) and intragastric (IG) administration of a preparation of CPE. Following this determination D-galactosamine (2-amino-2deoxy-D-galactose) (D-gal) sensitization was attempted followed by CPE administration. D-gal renders mice exquisitely sensitive to a range of bacterial toxins including Gramnegative bacterial lipopolysaccharide (LPS) and the staphylococcal superantigenic enterotoxins (Meithke et al., 1993; Freudenberg et al., 1986). The effects of D-gal on the lethal activity of LPS are an increase in sensitivity of up to 100,000 fold (Galanos et al., 1979). D-gal in investigations of the lethal effects of superantigens is of even greater importance as an investigatory tool. Normally mice are much more resistant to the 24

PAGE 36

25 effects of superantigens than humans and do not succumb to the shock seen in humans unless first sensitized with this agent (Miethke et al., 1993). D-gal is a hepatotoxic chemical which, within 30 min of administration, induces the production of large amounts of UDP-galactosamine derivatives (Galanos et al., 1979). This depletes hepatic UTP which results in the cessation of synthesis of macromolecules. The effects of D-gal were thought to be confined to the liver with no damage produced in other organ systems but recent work indicates extensive apoptosis in the medullary pyramids in the kidneys of D-gal sensitized, LPS treated mice (Morikana et al., 1996). D-gal alone is not toxic and levels of up to 1 g D-gal / kg body weight do not induce any signs of injury (Galanos et al., 1979). Cyclosporin-A (CyA) is another immunomodulatory compound which is of great use in the elucidation of the components of the immune system involved in host reactions. CyA is a fungal polypeptide with great immunosuppressive ability. It is used to prevent host rejection of transplanted organs in humans. Although its mechanism of action is not completely understood, it is generally accepted that CyA mediates its effects by interfering with T-cell activity, specifically the generation of cytokines (Nguyen et al., 1990; Meithke et al., 1992). Were T-cell mediated events implicated in the lethal events following CPE exposure, one would expect to see a protective effect from the administration of CyA before CPE challenge.

PAGE 37

26 Materials and Methods Reagents CPE was obtained as a purified, freeze dried powder from Dr. Bruce McClane (University of Pittsburgh) on dry ice. Purity was determined through SDSpolyacrylamide gel electrophoresis with only one band visible following staining with Coomassie blue. Toxin was frozen in this form at -70°C until use. Before administration toxin was resuspended in phosphate buffered saline-Tween 20 (PBS-Tw)(0.15 M NaCl, 0.01 M Na 2 HP04, 0.01 M NaH 2 P0 4 , 0.2% Tween 20, pH 7.2). Protein concentration was determined by the method of Lowry et al. (1951) with bovine serum albumin as a standard. From this determination, the solution was diluted to a final concentration of 1 ug protein/p.1 diluent with PBS-Tw. D-gal was obtained from Sigma while CyA was a generous gift of Novartis (formerly Sandoz, East Hanover, NJ). For D-gal sensitization studies mice were injected intraperitoneally (IP) with various concentrations of CPE with or without four hour pretreatment with 40 mg D-gal in lOOul PBS. D-gal in PBS was used as a control. For CyA studies, mice were injected IP with 400 ug CyA in PBS 4 hr before IP injection of CPE. CyA in PBS was used as a control. Mice 16.5 + 1.0 g male Swiss Webster (SW) mice or BALB/C mice for these studies were obtained through the Department of Animal Resources of the University of Florida from Harlan-Sprague Dawley (Indianapolis, IN). Department of Animal Resources personnel order, deliver, and care for the animals within the Food Science and Human

PAGE 38

27 Nutrition Department Animal Facility as prescribed by the university of Florida IACUC. Animals were maintained on a 12 hr/12 hr light/dark cycle at 25°C, six per cage and were examined daily by Animal Resources personnel who also change bedding and provide food ad libitum. Studies were performed in as humane a manner as possible with attention to preventing suffering on the part of the animals. Approval for all animal studies was granted by the University of Florida Animal Care and Use Committee (IACUC). Toxin Administration and Mouse Lethal Dose (MLD) For intraperitoneal (IP) administration one researcher held the mice in an inverted, fully extended position while another researcher measured toxin volume and performed the injection into the peritoneal cavity. Animals were administered CPE IP in the left side of the peritoneal cavity using a 1 ml Tuberculin syringe with a 26 gauge 10mm length needle. Injection volume, regardless of toxin amount was 100 ul For intragastric (IG) administration (which was necessary to determine for work detailed in later chapters) mice were held in an inverted, fully extended position. Another researcher measured toxin volume (again lOOu.1) and used a Popper gastric ball head needle affixed to a 1 ml Tuberculin syringe to administer CPE directly into the stomach. After administration of toxin, animals were returned to their cages and monitored every 15 min. Within each experiment, mice were randomly chosen for group assignment. The time to death method of Spearman-Kerber (Zar, 1984) was used to determine the IP and IG mouse lethal doses (MLD) for CPE.

PAGE 39

28 Results Mice challenged either IP or IG with CPE in doses sufficient to cause an observable response exhibited the same symptoms. The first signs were an accelerated heart rate, a convex arched back, ruffled fur, opaque brownish eyes (vs. the normal bright red), immobility, accelerated shallow respiration, loss of appetite, and the social behavior of huddling together. Mice administered non-lethal doses of CPE (0.1 ug/g for SW mice challenged IP or 1.0 ug/g for those challenged IG) recover from all symptoms within 6-8 hours. Mice administered higher non-lethal doses (0.5 ug/g IP or 5 ug/g IG) recovered between 12-16 hr after challenge. No long-term effects were observed for the 48 hours following recovery. Figures 3.1 A and 3. 1 B show that the MLD for SW mice administered CPE IP is approximately 0.75 ug CPE / g body weight while the IG MLD is approximately ten fold higher at 7.5 ug CPE / g body weight. Following determination of the MLD for CPE, experiments examining the effect of immunomodulatory agents on CPE toxicity were conducted. Data shown in Table 3.1 demonstrates that D-gal had no sensitizing effect for SW mice exposed IP to CPE. CyA had no protective effect in the Swiss White model system as shown in Table 3.2. Following these results experiments to determine the MLD of CPE in BALB/c mice were conducted. These experiments established an MLD of approximately 0.5 ug CPE / g body weight for IP administration (data not shown). The D-gal and CyA experiments were repeated using the BALB/c mouse model system. Again, no sensitization was demonstrated following D-gal pretreatment and no protection was

PAGE 40

29 evident following pretreatment with CyA as is shown in Tables 3.3 and 3.4. Additionally CyA did not increase the time to death of mice administered lethal doses of CPE over control mice administered the same dose of toxin without CyA pretreatment. Results from experiments performed by Torres working with Johnson, Wallace, and Lindsay (Lindsay, 1996) showed that CPE did not behave as a superantigen with regard to its interaction with major histocompatibility complex (MHC). Using RATI cells, which are a high MHC class II producing cell line, these researchers were not able to demonstrate any competition between radiolabeled CPE and a panel of known superantigens including the staphylococcal enterotoxins. In a second experiment they used a murine L-cell line which is a mouse cell line transfected to express human MHC class II (and mouse MHC class I). In this experiment there was no increased binding to the L-cell line when compared to an untransfected control cell line. Both of these results are in conflict with the results which were expected if CPE did exhibit superantigenic properties. Discussion When this series of experiments was begun using SW mice, we were operating under the assumption that CPE was a superantigen (Bowness, 1992). After examining the results obtained in the D-gal sensitization and CyA protection studies, explanations that were still consistent with CPE being a superantigen were entertained. After further review of studies in mouse genetics, it was found that the SW strain of mice were missing part of the T-cell receptor (TCR) locus (Pullen et al., 1990). It then seemed possible that this strain of mice was missing the elements that would allow CPE to behave as a superantigen. It has been hypothesized that the deletion of portions of the TCR locus is

PAGE 41

30 f 2 0 -O Q-c 0—0 0 . 6 — o IP treatment: 0.1 fig CPE/g wt mouse 0.5 [iq CPE/g wt mouse 0.75 ^g CPE/g wt mouse • 1 .0 ng CPE/g wt mouse O 2.0 (ig CPE/g wt mouse 1 — I — I — I — I — I — I — P^*T 0.5 1 1.5 2 16 24 32 time (h) Figure 3.1 Determination of Mouse Lethal Dose (MLD) for CPE Administered IP. protective in mice allowing them to resist the effects of pathogens which possess superantigenic proteins (Pullen et al., 1990). BALB/c mice were found to possess the complete TCR locus and were thus chosen as experimental animals to repeat the D-gal and CyA studies. Initial results were encouraging with BALB/c mice exhibiting greater sensitivity to CPE than SW mice (MLD of 0.15 ug CPE / g mouse weight for BALB/c

PAGE 42

31 > Z 3 cn m I 2 03 CD E c -o0 0.5 1 -a — Cr — ri — r 1.5 2 16 time (h) 24 IG treatment: 1 .0 |ag CPE/g wt mouse 2.5 ng CPE/g wt mouse T 5.0 ng CPE/g wt mouse • 7.5 ng CPE/g wt mouse O 10 tag CPE/g wt mouse r 32 Figure 3.2 Determination of Mouse Lethal Dose (MLD) for CPE Administered IG. mice versus 0.5 |ig CPE /g mouse weight for SW mice). Repeating the procedures using BALB/c mice however showed no sensitization with D-gal and no protection with CyA pretreatment. Other bacterial superantigens that have proved to be superantigenic in humans have proved to possess the same properties in mice. The possibility that CPE was different and only behaved as a superantigen in humans but not in mice was considered. Dr. Howard Johnson and Dr. Barbara Torres (University of Florida, Department of Microbiology and Cell Science) were then consulted based on their

PAGE 43

32 Table 3.1. Effect of D-galactosamine (D-gal) on CPE sensitivity for Swiss Webster mice Treatment Lethalitv (dead/total) PBS 0/6 40 mg D-gal 0/6 750 ng CPE 6/6 375 ng CPE 0/6 1 88 ng CPE 0/6 750 ng CPE + 40 mg D-gal 6/6 375 ng CPE + 40 mg D-gal 0/6 188 ng CPE + 40 mg D-gal 0/6 lOugLPS 0/6 10 |ag LPS + 40 mg D-gal 6/6 Note: CPE weights are given in ng CPE / g mouse weight. expertise in working with superantigens. Using tissue culture based studies to evaluate CPE interaction with human MHC class II, Johnson and Torres concluded that CPE did not behave as a superantigen in humans and the sensitization and protection studies had determined that CPE did not behave as a superantigen in the mouse. The above outlined results indicate that, contrary to the claim that CPE is a superantigen, it most assuredly is

PAGE 44

33 Table 3.2 Effect of Cyclosporin A (CyA) on CPE sensitivity for Swiss Webster mice Treatment Lethality (dead/total) PBS 0/6 400 u.g CyA U/O Ten /TUT /jO ng Crb o/o 375 ne CPE 0/6 188 ng CPE 0/6 750 ng CPE + 400 |ig CyA 6/6 375 ng CPE + 400 ug CyA 0/6 188 ng CPE + 400 ng CyA 0/6 10 ng LPS 0/6 Note: CPE weights are given in ng CPE / g mouse weight. not. In vitro studies did, however, indicate that CPE activated cells of a macrophage lineage (Wallace et al., 1999). This result, combined with the symptoms of C perfringens type A food-borne illness in both humans and in the mouse model, led us to believe that CPE may interact with the immune system to induce proinflammatory cytokines. As such, we undertook a series of experiments examining the serum cytokines

PAGE 45

Table 3.3. 34 Effect of D-galactosamine (D-gal) on CPE sensitivity for BALB/c mice Treatment Lethality (dead/total) PBS 0/6 40 mg D-gal 0/6 500 ng CPE 6/6 250 ng CPE 2/6 1 95 no TPF 0/6 500 ng CPE + 40 mg D-gal 6/6 250 ng CPE + 40 mg D-gal 1/6 125 ng CPE + 40 mg D-gal 0/6 10 fig LPS 0/6 10 (ig LPS + 40 mg D-gal 6/6 Note: CPE weights are given in ng CPE / g mouse weight. generated following IP and IG challenge of mice with CPE using the SW model system as well as examining the in vitro cytokine response of a macrophage cell line following incubation with CPE. The results of these experiments are described in Chapter 4.

PAGE 46

35 Table 3.4. Effect of Cyclosporin A (CyA) on CPE sensitivity for BALB/c mice Treatment Lethality (dead/total) PBS 0/6 400 ng CyA 0/6 500 ng CPE 6/6 250 ng CPE 0/6 125 ng CPE 0/6 500 ng CPE + 400 ng CyA 6/6 250 ng CPE + 400 ug CyA 1/6 125 ng CPE + 400 ug CyA 0/6 10 ^g LPS 0/6 Note: CPE weights are given in ng CPE / g mouse weight.

PAGE 47

CHAPTER 4 SERUM CYTOKINE LEVELS IN SWISS WEBSTER MICE EXPOSED IP AND IG TO CPE AND IN VITRO CYTOKINE PRODUCTION OF A MACROPHAGE CELL LINE EXPOSED TO CPE Introduction Data from studies described in Chapter 3 determined that CPE was not a superantigen; however, CPE is nonetheless a bacterial exotoxin and many such products have been found to induce an immune response (Flegel et al., 1991; Misfeldt et al., 1990; Bhakdi et al., 1990). Previous work (Mach and Lindsay, 1997) had indicated that in vitro, the murine macrophage cell line J774A. 1 was activated to produce nitric oxide following exposure to CPE. Their work also documented a short-term (12-24 hour) mitogenic effect and a longer term (48 hours and greater) lethal effect. Lindsay, Torres, and Johnson had also documented a mitogenic effect in human peripheral blood mononuclear cells (PBMC) exposed to CPE (Lindsay, 1996; Wallace et al., 1999). These results suggested that there was an in vitro production of cytokines by the macrophage cell line previously used to demonstrate activation by CPE. The results also suggested an activation of cells of the macrophage/monocyte lineage would likely occur after in vivo challenge by CPE with concomitant production of cytokines. This chapter documents results showing that, indeed, the J774A.1 cell line did produce cytokines following exposure to CPE, and mice challenged with CPE IG and IP did exhibit a cytokine response. 36

PAGE 48

37 Materials and Methods Reagents Freeze dried CPE obtained from Dr. Bruce McClane, reconstituted, handled, and administered as described in Chapter 3. Reconstitution was performed the day of administration as CPE in solution loses biological activity even when stored at -70°C. Biological activity was confirmed using the Vero cell cytotoxicity assay (Wallace et al., 1999). As before, protein concentration was determined by the method of Lowry et al., (1951) with bovine serum albumin as a standard. From this determination the solution was diluted to a final concentration of 1 u.g protein/(il diluent with PBS-Tw. Tissue Culture J774A.1 (ATCC TIB 67) macrophage cell line cultures were incubated as adherent monolayers in a humidified incubator in 5% CO2 at 37°C using Sarstedt 75 cm 2 flasks and modified Dulbecco's media (DMEM) containing 10% fetal bovine serum (FBS), 2 mM L-glutamine and 1 mM sodium pyruvate. When flasks were >80% confluent, cells were removed by gentle scraping, and transferred to sterile conical tubes and centrifuged at 200 x g for 5 min. The supernatant was removed and pellets combined in 10 ml of fresh DMEM. Approximately 10 5 cells were seeded/well, as determined by hemicytometer counts, into Sarstedt 24 well cluster dishes and incubated for 24 h. During this 24 h incubation/resuscitation, cell numbers do not change significantly from the initial inoculation. The medium was then removed, and the cells washed twice with 15 mM PBS, pH 7.0 to remove any residual FBS. Cells were incubated in 0.4 ml Earl's

PAGE 49

38 balanced salts containing 0.28 mM phenol red (EBS-PR) without FBS, amino acids or vitamins. Measurement of Cytokine Levels in vitro J774A.1 cells were incubated with 10 ug CPE/well and examined after 24 h. Supernatants were collected and levels of cytokines IFN-y, TNF-a, IL-la, IL-2, and EL-6 were determined using commercially available ELISA kits obtained from Endogen (Cambridge, MA). Internal controls were always run with each cytokine test, the sensitivity of each test being <15 pg/ml. Results are means ± SE (n=6) based on 10 5 cells/well. Cytokine levels were normalized to control wells run with all reagents except cytokine. Significance was calculated using the Student's /-test. Mice 16.5 + 1.0 g male Swiss Webster (SW) mice for these studies were obtained through the Department of Animal Resources of the University of Florida from HarlanSprague Dawley. Department of Animal Resources personnel ordered, treated, and cared for these animals as described in Chapter 3. Toxin Administration Mice were administered toxin essentially as described in Chapter 3. Within each experiment, mice were randomly chosen for group assignment. Mice were given 0.6 pig CPE/g body weight in IP injection, or 4.5 ug CPE/g body weight in IG administration.

PAGE 50

39 These toxin amounts were slightly below 0.5 MLD which has been found to elicit typical pathophysiological symptoms as described in Chapter 3 while not risking the possibility of death. Blood Collection and Serum Isolation At the times indicated, mice were anesthetized using chloroform. Following anesthesia whole blood was collected. Blood samples were allowed to clot at 4°C for 2 h, and centrifuged at 200 x g to obtain serum. Serum samples were stored at -70°C until cytokine determination. In vivo Cytokine Determination Levels of cytokines IFN-y, TNF-a, IL-la, IL-2, and IL-6 were determined using commercially available ELISA kits obtained from Endogen (Cambridge, MA). Internal controls were always run with each cytokine test, the sensitivity of each test being <15 pg/ml. Cytokine levels were normalized to control wells run with all reagents except cytokine. Data in ng/ml are reported as means ± SE (if greater than 10% of the mean) in Figs 4.1-4.10. Results Cytokine levels in vitro CPE was found to induce the synthesis of 5.8 ± 0.02 ug/ml IFN-y; 4.5 ± 0.01 ug/ml TNF-a; 1.3 ± 0.03 ug/ml IL-la; and 3.0 u.g/ml IL-6 in the macrophage cell line J774A. 1 following incubation with CPE. As expected no IL-2 was produced.

PAGE 51

40 I I 1 I I I l_ 0 60 120 240 480 720 960 Time in Minutes Figure 4.1 Serum levels of IL-la following IP administration of CPE.

PAGE 52

41 Figure 4.2 Serum levels of IL-2 following IP administration of CPE.

PAGE 53

42 Figure 4.3 Serum levels of IL-6 following IP administration of CPE.

PAGE 54

43 Figure 4.4 Serum levels of IFN-y following IP administration of CPE.

PAGE 55

44 Figure 4.5 Serum levels of TNF-a following IP administration of CPE.

PAGE 56

45 log scale 10 9 8 7 6 5 4 E =3 i_ CD (/) CD C 1.0 0.9 0.8 0.7 0.6 linear 0.5 0.4 0.3 0.2 0.1 i i i 0 60 120 240 480 720 Time in Minutes 960 Figure 4.6 Serum levels of IL-la following IG administration of CPE.

PAGE 57

46 log scale 10 7 6 5 4 3 2 E =5 CD if) 1.0 0.9 0.8 0.7 0.6 linear 0.5 E 0.4 0.3 0.2 0.1 I I I -A I 0 60 120 240 480 720 960 Time in Minutes Figure 4.7 Serum levels of IL-2 following IG administration of CPE.

PAGE 58

47 Figure 4.8 Serum levels of IL-6 following IG administration of CPE.

PAGE 59

48 log scale E 13 10 6 5 4 3 2 1.0 0.9 0.8 0.7 0.6 0 c linear o 5 C 0.4 0.3 0.2 0.1 0 0 60 120 240 480 720 Time in Minutes 960 Figure 4.9 Serum levels of IFN-y following IG administration of CPE.

PAGE 60

49 log scale 10 6 5 4 3 2 1.0 0.9 0.8 0.7 0.6 linear 0.5 E 0.4 0.3 0.2 0.1 V) D) C I I I 0 60 120 240 480 720 Time in Minutes 960 Figure 4.10 Serum levels of TNF-a following IG administration of CPE.

PAGE 61

50 Cytokine levels in vivo Figures 4.1-4.10 show the kinetics of cytokine induction after IP (Figs 4.1-4.5) and IG (Figs 4.6-4.10) administration of slightly less than 0.5 MLD. With one exception, all cytokine levels markedly increased within 0.5 h and peaked between 1-2 h. Maximum levels of EFN-y were maintained for 8 h for IP administration of toxin and 4 h for IG administration. Levels of IL-6 were maintained for 8 h, while IL-la, and the very low levels of IL-2 peaked and fell to nearly baseline levels within 3-4 h. After an initial increase, TNF-a levels fluctuated with a further increase after 4 h. This phenomenon was consistently detected in all animals without regard to route of administration (IP or IG). All cytokine levels were very low after 12 h and had returned to baseline levels by 16 h. Challenge by IP administration of CPE induced nearly 10 fold higher levels of ILla and IL-6, and 3 fold higher levels of TNF-a and IL-2 than by IG administration. Peak IFN-y levels were similar regardless of the mode of administration. Discussion Work published by other researchers documents an IL-6 response from human PBMC exposed to CPE, but no IL-1, TNF-a, or IFN-y and no mitogenic response (Krakauer et al., 1997). The lack of a mitogenic response did not concern us greatly because their first evaluation of proliferation was at 48 hours which was, as previously described, long past the point of any observed proliferative effect, and indeed at a time when one would expect the toxic effect of CPE on sensitive cells to be manifested. The lack of an IL-1, TNF-a, or IFN-y response was of greater interest, however, it is certainly

PAGE 62

51 possible that the researchers missed the production of these cytokines based on the time points chosen for analysis just as they missed the proliferative effect. The levels of IL-1, IL-6, TNF-a, and IFN-y generated in response to CPE without sensitization were comparable in intensity to those induced by SEB, TSST-1, and LPS in D-gal sensitized mice (Meithke, 1993; Tateda, 1996). Cytokine levels were also faster in induction and more rapid in return to baseline levels than those observed following superantigen challenge. Further studies should be conducted to determine whether CyA-treated mice express TNF-a following CPE challenge. In studies of superantigens, it has been found that inhibiting T-cell function with CyA can completely inhibit systemic TNF-a production, implying that either T-cells produce TNF-a and/or they are involved in the process by which macrophages secrete this cytokine. In the case of CPE challenge, as it appears that macrophages are the principal target with no T-cell involvement, it is expected that CyA will have no effect on the production of TNF-a. As expected, since it is becoming increasingly apparent that CPE is not a superantigen, there was minimal IL-2 generated in response to CPE challenge. TSST-1 and SEB are powerful activators of cells of the macrophage lineage as well as of T-lymphocytes, which upon activation produce a host of inflammatory cytokines. Lipopolysaccharide induced endotoxic shock is primarily a macrophage/monocyte mediated phenomenon, wherein the generalized inflammatory process is attributable to the generation of a cascade of proinflammatory cytokines. Neither TSST-1, SEB, nor LPS are directly toxic to cells, in contrast to CPE which demonstrates a powerful cytotoxic effect in many cell types (Lindsay, 1996). The pathophysiological effects of CPE thus may be due to a combination of direct

PAGE 63

52 cytotoxicity, as well as the generation of a proinflammatory response by the host. The results of this study demonstrate that a macrophage cell line is activated to produce cytokines in vitro. This work demonstrates results consistent with an activation of cells of the macrophage lineage in vivo as well. Based on the results of the in vivo studies, it is apparent, however, that T-cells are not activated to any significant extent following challenge with CPE. The above outlined studies leave many unanswered questions regarding cytokine production. Additional studies regarding cytokine involvement are suggested by the results of this work some of which were performed and are described in Chapter 5. First, determining the organs of generation of an immune response following CPE intoxication are of interest as is the time-course of the transcriptional response of each affected organ (see Chapter 5). Second, the mediators which serve to down-regulate activity of proinflammatory cytokines should be examined as to transcription, protein expression, time course, and organs of origin. Mediators that regulate cytokine activity are of great interest, as the serum cytokine response observed does not necessarily tell the whole story. Serum cytokines are, in reality, the amount produced in excess of the amount which binds to cellular and soluble receptors. The serum cytokine measurements do not reflect cytokines which are cell associated, and though the manufacturers of the ELISA kits state that soluble receptor bound cytokines are detected quantitatively some researchers have found this claim to be inaccurate. Further studies which would be helpful in the interpretation of the state of immune activation of mice exposed to CPE are suggested. First soluble TNF-ct receptor (sTNF-ar) and second IL-2 receptor antagonist (IL-2ra), should be examined. sTNF-ar levels would be informative as TNFa sensitive

PAGE 64

53 cells shed their TNF receptors in response to exposure to TNF. Serum levels of free cytokine are thus lowered relatively rapidly while the plasma levels of its receptor remain elevated long after exposure to a stimulatory agent. sTNF-otr levels therefore can often provide more information about the state of the immune system than cytokine levels. ILlra levels would be of interest as IL-1 induces synthesis of this protein, and levels of ILlra remain elevated after IL-1 levels have declined. These systems serve a protective function by decreasing the chance that an inflammatory reaction will cause significant damage to the challenged host. The complexity of these interacting systems make interpretation of data solely obtained from measuring serum protein levels difficult. Additional work investigating these systems following CPE intoxication would therefore be of great importance.

PAGE 65

CHAPTER 5 ORGAN SPECIFIC TIME COURSE OF CYTOKINE MESSENGER RNA RESPONSE FOLLOWING CLOSTRIDIUM PERFRINGENS TYPE A ENTEROTOXIN INTOXICATION Introduction The reverse transcriptase polymerase chain reaction (rtPCR) provides a powerful tool to evaluate both the time course and the organ specificity of a transcriptional response. Chapter 4 describes the serum cytokine response to CPE. In order to gain more insight into the mechanisms of response to this toxin, RNA productions for the cytokines previously evaluated (IL-la, IL-2, IL-6, IFN-y, and TNF-ot) were examined by rtPCR. The organs examined in this manner were the spleen, liver, and small intestine. Materials and Methods Reagents Freeze dried CPE, obtained from Dr. Bruce McClane, was reconstituted, handled, and administered as described in Chapter 3. Reconstitution was performed the day of administration as CPE in solution loses biological activity even when stored at -70°C. As before protein concentration was determined by the method of Lowry, et al. (1951) with bovine serum albumin as a standard. From this determination the solution was diluted to a final concentration of 1 ug protein/u.1 diluent with PBS-Tw. 54

PAGE 66

55 Mice 16.5 + 1.0 g male Swiss Webster (SW) mice for these studies were obtained through the Department of Animal Resources of the University of Florida from HarlanSprague Dawley. Department of Animal Resources personnel ordered, treated, and cared for these animals as described in Chapter 3. Toxin Administration Mice were administered CPE essentially as described in Chapter 3. Within each experiment mice were randomly chosen for group assignment. Mice were given 4.5 u,g CPE/g body weight in IG administration. This toxin amount is slightly below 0.5 MLD, and was guaranteed to elicit typical pathophysiological symptoms as described in Chapter 3 while not risking the possibility of death. Necropsy and Organ Harvesting At the times indicated animals were anesthetized using chloroform and sacrificed by cervical dislocation. Organs harvested included spleen, liver, and distal 5 cm of the small intestine. Organs were immediately placed into 3.0 ml of 4°C TRIzol reagent (Gibco BRL) in 15 ml polypropylene tubes and homogenized using a Polytron (Brinkmann Instruments) for three bursts of 15 seconds each. This procedure ensured complete homogenization of all organs studied. Homogenates were stored at -70°C until RNA extraction.

PAGE 67

56 RNA Isolation Six hundred ul of chloroform was added to 3.0 ml of Trizol:tissue homogenate. This mixture was vortexed to a milky pink color (approximately 15 sec) and allowed to sit at room temperature (25°C) for 3 min. The sample was then centrifuged in a clinical centrifuge at 2000 x g for 60 min at 4°C. The aqueous phase was transferred to a fresh 15 ml polypropylene tube. 2.0 ml -20°C isopropyl alcohol was added. The mixture was centrifuged for 20 min in a clinical centrifuge at 4°C at 2000 x g. The supernatant was removed and discarded. The pellet was washed once with 5.0 ml 75% ethanol (made from absolute ethanol plus diethyl pyrocarbonate (DEPC) treated water) by gently vortexing and centrifuged as before. The supernatant was removed and discarded and the pellet allowed to air dry for 5 min in a laminar flow hood. RNA was redissolved in 250 u.1 volumes of DEPC treated water and assayed for RNA concentration and purity by spectrophotometric measurement. RNA concentration was usually 0.7-1.0 ug RNA/ul If concentration was higher than 1.0 ug RNA/ul the solution was diluted further with DEPC treated water to 1.0 jag RNA/ul. In the rare case that the concentration was lower than 0.7 ug RNA/ul a proportionately larger volume of RNA solution (and correspondingly lower volume of water) was utilized during the reverse transcription reaction.

PAGE 68

57 Reverse Transcription A 20 ul total reaction volume was used for generating cDNA from the isolated total RNA. All reagents used were obtained from GibcoBRL. Total RNA (1.4-2.0 ug) was used in the reaction. To 2.0 ul RNA solution was added 1.0 ul oligo (dT)i2-i8 (containing 0.5 ug) primer solution and 9.0 DEPC H 2 0 on a -20°C aluminum block. This mixture was heated to 70°C for 10 min in a thermocycler (Perkin Elmer) to remove secondary structure from the RNA. The mix was quick chilled on an aluminum block at -20°C. To this was added a mix containing 4.0 ul 5X first strand buffer, 2.0 ul 0.1 M dithiothreitol (to stabilize the reverse transcriptase), and 1.0 ul of a solution containing 10 mM of each deoxynucleotide triphosphate (dATP, dGTP, dCTP, and dTTP). Contents of each tube were gently mixed and incubated at 42°C in the thermocycler. To each reaction tube lul (200 U) of Superscript II reverse transcriptase was added with gentle pipetting. This mixture was incubated at 42°C for 50 min followed by an inactivation step of 15 min at 70°C. The cDNA was stored at -20°C until use. PCR Reactions Sequences for PCR primers were obtained from the lab of Dr. Ammon Peck (Department of Pathology, Immunology, and Lab Medicine, University of Florida) (see Table 5.1 for sequences and product lengths). Primer pairs were analyzed using OLIGO software and the National Library of Medicine database Genebank to ensure specificity and appropriateness. Products for all reactions were of the appropriate length as shown

PAGE 69

58 by agarose gel electrophoresis. PCR primers for P-Actin and the cytokines IL-la, IL-2, IL-6, IFN-y, and TNF-a were ordered form GibcoBRL and received in lyophylized, desalted form. They were resuspended in TE8 buffer to a concentration of 50uM. All PCR reactions were conducted using a GeneAmp PCR system 2400 (Perkin Elmer). Before any other PCR reactions were run, the reaction for P-Actin was conducted and the product evaluated by gel electrophoresis to ensure that the RNA isolation and reverse transcription had been conducted successfully. The cycling profile performed was as follows: 35 cycles of [(1) denature 45 sec at 94°C; (2) anneal 45 sec at 60°C; (3) extend 2 min at 72°C] followed by one final 7 min 72 C extension step. Following evaluation of each cDNA in this manner 5 ul from each of 3 cDNAs from each time period were combined for each organ and PCR reactions were conducted using the same profile as was used for amplifying the segment for P-Actin. Gel Electrophoresis Amplified PCR products were separated using 1.5 % agarose gels with 0.7 ug/ml ethidium bromide (see Figs 5.1-5.5 for results). Gels were run with TAE used as the running buffer. To each sample lane was added 10 ul PCR product with 2 ul loading dye (0.25% bromophenol blue, 40% sucrose). The last lane was loaded with 1 ul 100 bp DNA sizing ladder diluted with 8 ul water and 1.5 ul loading dye. Gels were run for 55 min at 95 mV.

PAGE 70

59 Visualization of PCR Products Visualization of products separated by electrophoresis was performed using a UV transilluminator (Photodyne). Photographic images were produced and the results scanned as high resolution bit-maps. Results All reactions produced only one amplification product with the exception of the reaction for TNF-a which frequently produced several extra bands. Although a semiquantitative determination could be made (using two different PCR cycle numbers and visual grading) no additional information would have been obtained and considerably more reagents would have been utilized therefore a simple qualitative analysis was considered adequate. Results of this work are shown in Figures 5.1-5 .5 showing PCR products which are proportional to the relative transcriptional activity for the cytokine genes in question. Figure 5.6 shows a scan of the complete gel of PCR products from the evaluation of ILloc mRNA from liver. IL-1 mRNA was generated primarily in the spleen with lesser amounts being produced by the liver and a transient transcription induced in the small intestine (see Fig 5.1).

PAGE 71

60 As expected based on the prior work virtually no IL-2 mRNA was induced although there was a slight response seen from the spleen at times 60 and 120 min that did not reproduce well in the photographs of the gels (Fig 5.2). The EL-6 transcriptional response was most pronounced in the liver but this response had ended long before the serum protein levels declined (see Fig 5.3). Maximum serum levels of this cytokine were reached within 60 min and remained at maximum levels until the 8 h time point. Maximum mRNA levels were reached in the same time and then rapidly declined. The most vigorous IFN-y transcription was seen in the small bowel with lesser amounts generated in the spleen and liver (Fig 5.4). Maximum serum protein levels peaked very rapidly (by the 60 min time point) and then declined very rapidly. The transcriptional response was induced rapidly reaching maximum intensity within 30 min however the transcriptional levels remained elevated throughout the time course examined remaining at maximum intensity even at the 8 h time point. Detectable TNF-a serum protein levels were relatively low throughout the course of the experiment with a slight amount seen which slowly declined throughout the experiment. Despite this paucity of detectable cytokine there was a vigorous transcriptional response for this cytokine (Fig 5.5), primarily in the liver but also in the spleen and bowel. Discussion Despite the fact that the serum levels of IL-la had returned to undetectable levels by 8 hr after IG administration of toxin there was still a vigorous IL-la transcriptional

PAGE 72

61 response in the spleen and the liver. The bowel demonstrated a transient response which was evident at only the 30 and 60 min time points. It is possible that there is a posttranscriptional regulation of this protein through the production of IL-1 receptor antagonist (sIL-lra) which binds to the IL-1 receptor, attenuating the inflammatory response. Table 5.1. Cytokine primers used for PCR Cytokine Primer Sequence Product size (hi)) IL-1 a 3' Primer 5' Primer 5' CCTTCAGCAACACGGGCTGGTC 3' 5' ATGGCCAAAGTTCCTGACTTGTTT 3' 625 IL-2 3' Primer 5' Primer 5' GGCTTGTTGAGATGATGCTTTGACA 3' 5' ATGT AC AGC ATGC AGCTCGC ATC 3' 502 IL-6 3' Primer 5' Primer 5' CACTAGGTTTGCCGAGTAGATCTC 3' 5' ATGAAGTTCCTCTCTGCAAGAGACT 3' 638 IFN-y 3' Primer 5' Primer 5' CGACTCCTTTTCCGCTTCCTGAG 3' 5' TGAACGCTACACACACTGCATCTTGG 3' 460 TNF-a 3' Primer 5' Primer 5' CCAAAGTAGACCTGCCCCGGACTC 3' 5' ATG AGC AC AG A A AGC ATG ATCCGC 3' 692 p-ACTIN 3' Primer 5' Primer 5' CTCTTTGATGTCACGCACGATTTC 3' 5' GTGGGCCGCTCTAGGCACCAA 3' 540 Further experiments should examine both the serum protein levels of this cytokine receptor and the transcriptional response for the mRNA for sIL-lra. IL-2 mRNA was generated in only trace amounts by the spleen and mirrors the vanishingly small amounts of IL-2 detected in serum of CPE challenged mice. This

PAGE 73

62 LLU 1 ' 1 I I I 1 1 1 1 1 cpxoh-
PAGE 74

63 I -1 — s S3 SHill 1 1 1 I l_ _l_ _i_ _l_ _l_ I. 1 _l_ _i_ ocncof- CO CD m CO CM o d d d d d d d d d wruas ui | w/6u

PAGE 75

64 wruas u; |iu/6u 1*5 o 00 o O so s s o C2 s o 3 5 i -J it! s_ 3 5i

PAGE 76

65

PAGE 77

66

PAGE 78

67 Figure 5.6 RT-PCR evaluation of liver transcription for IL-la. result confirms that T-cells are not activated to any great extent in the murine model of CPE intoxication. IL-6 transcription, unlike that for IL-la, had decreased long before any decrease in IL-6 serum protein was evident with a major decline between the 60 and 120 min time points. In contrast, serum protein levels of this cytokine did not begin to decline from their maximal amounts until after the 8 h time point. This indicates that likely the regulation of this cytokine following CPE intoxication is at the transcriptional level.

PAGE 79

68 Transcription of IFN-y was most pronounced in the bowel with lesser amounts being produced by the spleen and liver. As with IL-la mRNA for IFN-y remained elevated after serum protein levels had returned to baseline levels indicating a posttranscriptional regulation of the activity of this cytokine. TNF-a presents the most confusing picture of all with spleen, liver and bowel all being transcriptionally active for this cytokine. The liver is most transcriptionally active with regard to TNF-a with lesser amounts but the same time course evident for the bowel. In contrast splenic production of TNF-a mRNA is weak initially but increases throughout the timecourse of the experiment peaking at 4 h and remaining at that level at the 8 h time point. Compared with the relatively small amount of this cytokine seen in serum following CPE challenge the vigorous transcriptional response is of great interest. It is quite possible that shed TNF-a receptors are masking the true levels of serum protein. Because of this result it is important to evaluate the serum levels of soluble receptor for this cytokine in future work using the same experimental design as that utilized in Chapter 4, which may provide a more complete understanding of the kinetics of TNF-a expression in CPE intoxication. These findings that the gut demonstrated cytokine gene transcription are in contrast to experiments modeling endotoxicosis. Work conducted to evaluate the gut as a source of cytokines during a porcine model of LPS exposure indicated that the gut was not a source of cytokines (Bathe, 1996). The work outlined here evaluated transcriptional activity which may not be a true indicator of protein production, while the endotoxemia model system evaluated actual protein production which does make direct comparisons

PAGE 80

69 between these experiments impossible. Should later work provide evidence that cytokines are actually produced by the gut during CPE intoxication, then further studies investigating the difference in mechanisms between these two states would be warranted.

PAGE 81

CHAPTER 6 FECAL BILE ACIDS, NEOPTERIN, CLOSTRIDIUM PERFRINGENS AND THE SUDDEN INFANT DEATH SYNDROME Introduction In humans, illness caused by the Clostridium perfhngens enterotoxin (CPE) manifests itself in two ways. First and most common is the form caused by ingestion of large numbers (>10 7 ) of viable vegetative cells. These cells, under the stressful environment encountered in the gastrointestinal tract, are induced to sporulate with the associated production of enterotoxin. Symptoms begin 8-24 hours after eating contaminated food. The enterotoxin acts on the epithelium of the small intestine to induce a prolific non-bloody secretory diarrhea with desquamation of enterocytes primarily in the distal ileum. This illness resolves spontaneously within 12-24 hours of the onset of symptoms. The second and more aggressive illness is the Infectious Diarrhea Syndrome which occurs primarily in institutional settings (nursing homes, longterm care facilities). Increased frequency and levels of C. perfhngens spores and CPE have been demonstrated to occur in the feces of victims of the Sudden Infant Death Syndrome (SIDS) and it has been proposed that the sporulation associated CPE could be at the least a contributing factor (if not the final trigger) in some cases of SIDS. Bile acids are known to induce sporulation of vegetative cells of C. perfhngens (Heredia et al., 1991). 70

PAGE 82

71 Total bile acid levels and individual bile acids were examined in SIDS cases to determine if increased levels were associated with SIDS. In humans activation of the cellular branch of the immune system is accompanied by the release of neopterin (tetrahydrobiopterin). This effect is mediated through IFN-y. An increased neopterin level indicates endogenous interferon has been produced and therefore neopterin levels can be used as a measure of the activated state of the immune system. Neopterin has been shown to be involved in a variety of processes including the oxidative cleavage of ether lipids and the formation of nitric oxide radical from arginine (Fuchs et al., 1992). /// vitro studies utilizing a macrophage cell line have indicated that CPE induces a vigorous mitogenic and cytokine response. /// vivo studies of cytokine production, as discussed in previous chapters, indicate that this response happens in macrophages of animals as well. As such, if CPE were involved in SIDS, one would expect to see increased levels of neopterin in SIDS victims. Neopterin levels remain elevated long after cytokine levels have decreased and are stable in urine post-mortem (Ambach et al., 1991). Neopterin levels are thus an ideal marker to study whether the cellular branch of the immune system has been activated in SIDS. While not indicative of a causal relationship between CPE and SIDS, elevated neopterin levels in SIDS victims would be suggestive of a link between the elevated levels of fecal C. perfringens spores and CPE found in SIDS victims and the immunological state of these infants. Conversely, a finding of no increased levels of neopterin in SIDS victims would suggest that the elevated levels of C. perfringens have no importance in the phenomenon of SIDS and are merely associated without being causal in nature.

PAGE 83

72 Materials and Methods Fecal and Urine Samples Feces and urine were obtained from SIDS victims and from live controls. Feces from 18 SIDS victims (15 C. perfringens positive and 3 C. perfringens negative) and 10 control infants (5 C. perfhngens positive and 5 C. perfringens negative) were examined for bile acid content. The sex of the infant was not considered as a factor. Samples were stored at -20 °C until analysis. Samples for analysis were coded and analyzed in a blind fashion without knowledge as to which group they belonged. Fecal samples from live, healthy babies of matching age and environment who were born at term, were gaining weight normally, and were not taking medication or antibiotics were also examined. These infants were considered likely to give an accurate picture of the normal bile acid levels in feces. This matching methodology has been used previously in other SIDS studies as a means of comparison (Telford et al., 1989; Bettelheim et al., 1990; Lindsay et al., 1993). Urine from 7 SIDS victims and two victims of traumatic death were obtained. Samples were collected by bladder puncture from the dead infants. Because neopterin is light sensitive samples were collected into either foil-covered plastic vials or into opaque brown plastic vials. Samples were stored at -70 °C until analysis. Microbiology The methodology of Lindsay et al. (1993) was used for microbiological analysis. C. perfringens total viable counts (TVC) of vegetative cells were determined by pour plating of serially diluted fecal samples in duplicate on tryptone-sulfite-neomycin (TSN)

PAGE 84

73 agar (BBL, Cockeysville, Md.) and incubating anaerobically at 45 °C for 48 hours. TVC of spores were determined by heating a sample at 75 °C for 20 min before plating. TSN is a differential and selective media for C. perfringens with colonies of this organism having a characteristically black color. In this study a TVC of >10 5 for vegetative cells and >10 3 for spores was considered presumptive positive. Confirmation of C. perfringens spores was given with a positive ELISA result for CPE with levels of > lug toxin/g feces (Lindsay et al., 1993). Enterotoxin Quantification ELISA for CPE was performed. Briefly, fecal samples were diluted 1:10 with 0.1M phosphate buffer pH 6.7 containing 0.85% NaCl, incubated at 25 °C for 20 min, then centrifuged at 20,000 g for 15 min at 4°C. The supernatant was collected and analyzed in triplicate in 96 well Immulon-2 plates. After sample incubation and washing, attachment of the primary antibody (rabbit anti-CPE) and secondary (goat anti-rabbit alkaline phosphatase conjugate) antibodies and washing the antigen-antibody complex was detected by the alkaline phosphatase reaction measured after 4 h at 405nm. This procedure was found to have a lower limit of 50 pg (Lindsay et al., 1993). Bile Acid Analysis Bile acid extraction and analysis was performed using a combination of published methods (Locket et al., 1989; Roda et al., 1992; Setchell et al., 1983). To 100 mg feces, 400 ul 0.01 N HC1 was added in a 15 ml glass screw cap test tube and vortexed for five

PAGE 85

74 min. 1.6 ml ethanol was added to the sample and vortexed briefly followed by sonication for 15 min. The sample was then capped tightly and refluxed at 100 °C for 15 min. The sample was cooled and centrifuged at 5000xg for 10 min. The supernatant was removed and retained. The pellet was resuspended by vortexing and then sonicating for 15 min in 2.0 ml 80% aqueous ethanol, capped, and refluxed for 15 min. The sample was again cooled and centrifuged as before and the supernatant removed and retained. The pellet was then resuspended in 50% chloroform/50% methanol by vortexing briefly and sonicating for 10 min. The solution was refluxed as before for 15 min and centrifuged as before. The supernatant was removed and retained. The pellet was scraped onto filter paper and washed with a small volume of 50% chloroform/50% methanol. All extracts were combined and taken to dryness under nitrogen at 42 °C. The dried extract was resuspended in 1.0 ml 0.01 N HC1 and sonicated for 10 min. Chloroform (2.0 ml) was added to extract unconjugated bile acids. The chloroform was removed and the sample dried under nitrogen at 42 °C. The aqueous phase was passed through an activated Bond-Elut cartridge of reversed phase octadecylsilane (Analtichem International, Harbor City, Ca), washed with 5 ml 0.1 N HC1, and then eluted with 2.0 ml methanol to remove conjugated bile acids. The chloroform and methanol fractions were dried together under nitrogen at 42 °C, and resuspended in 0.6 ml volume of the initial mobile phase. HPLC analysis was performed using a Perkin Elmer Series III Chromatograph equipped with a Nova-pac 3.9 x 300 mm C-18, 4 u,m particle size column. The column was kept at a constant 37 °C using a water jacket. The detector was an evaporative light scattering mass detector (ELSD II) (Varex Co. Burtonville, Md). A constant flow rate of 0.9 ml/min was used. The initial mobile phase was 65% (v/v)

PAGE 86

75 aqueous methanol containing 15 mM ammonium acetate adjusted to a pH of 5.4 + 0.1 with acetic acid. Fifteen min after injection of 200 ul of the resuspended extract, a 40 min convex gradient to 85% methanol with 15 mM ammonium acetate (pH 5.4 + 0.1) was run. This methodology gave good separation of each bile acid examined. The peaks for taurocholic acid (TCA), glycocholic acid (GCA), cholic acid (CA), deoxycholic acid (DCA), chenodeoxycholic acid (CDA), and lithocholic acid (LCA) were quantitated. The detection limit was < 10 nM for each bile acid, which is approximately 3 ug/100 mg feces. Two samples for each case were examined, and each sample was run in duplicate. Samples for each bile acid treated in this manner gave > 95% recovery. A standard curve was generated before each series of samples was run. Standards were obtained from Sigma Statistical analysis was performed using the Kruskal-Wallis test for nonparametric data. Neopterin analysis A neopterin standard was made by dissolving 10 mg crystalline neopterin in 800 ml distilled, deionized, milli-Q filtered water with gentle heating and constant stirring. The sample was cooled slowly to 25 °C, diluted to 1000 ml, aliquoted into 100 ml opaque containers, and stored at -70 °C until used. Neopterin and creatinine concentrations were determined in one run in series by high-pressure liquid chromatography. Neopterin concentrations were normalized to creatinine concentrations to account for variations in urine density. All urine samples were diluted 100-fold in potassium phosphate buffer (15 mmol/L, pH 6.4) for analysis and 100 \x\ of this solution was injected for analysis. A Perkin-Elmer HPLC system with

PAGE 87

76 a Supelcosil reversed phase LC-18 column (25 cm x 4.6 mm) with 5 [im bead size was used. Detectors included a Perkin-Elmer diode array detector for measurement of neopterin and a Dionex UV absorption detector for measurement of creatinine. Neopterin was detected by its native fluorescence with 353 nm excitation and 438 nm emmision. Assays were run at 25 °C using a 0.8 ml/min flow rate in an isocratic buffer of the same composition as the diluent used for diluting the urine samples (potassium phosphate buffer 15 mmol/L, pH 6.4). Results Examples of typical chromatograms for samples and standards are shown in Figure 5.1. Results for total fecal bile acids for the four categories (SIDS/CP+, SIDS/CP, Control/CP+, Control/CP-) are shown in Figure 5.2. The n value for SIDS CP/is low which is simply a function of the small population of such SIDS victims. The mean values (ug/g feces) for the four categories are SIDS/CP+:310, SIDS/CP-:127, Control/CP+:, Control/CP-: 3 04. These levels are similar to results obtained in a longitudinal study of total fecal bile acids in infants of various ages (Hammons et al., 1988). Comparisons between 1. SIDS CP+/vs Control CP+/data, and 2. SIDS CP+ plus Control/CP+ vs SIDS CPplus Control/CPshowed no significant differences between the rank sums of total bile acids in either case. Analysis of individual bile acids using these comparisons and the same statistical procedures also indicated no significant differences. Taurine conjugates and glycine conjugates were rarely observed in detectable amounts. There was also no difference between total primary and total secondary bile acid excretion in SIDS vs controls, and CP+ vs CPcases.

PAGE 88

77 A) B) 5 W S3 5 S I 9 99 12 3 45 6 45 6 Figure 6.1 Chromatograms for (A) Standards (B) Representative fecal sample. 1. Taurocholate 2. Glycocholate 3. Cholate 4. Chenodeoxycholate 5. Deoxycholate 6. Lithocholate LU 1.20Q 0 o lu 1.000 u. a =L o B in 600 c a o o 0 < LU 800 o ta 400 o o o u LU o U. o t 200 8 8 o 8 o o t— 1 o i o ' 0 S/+ S/C/+ aFigure 6.2 Total fecal bile acid levels. S/+ (SIDS/CP+), S/(SIDS/CP-), C/+ (Control/CP+), CI(Control/CP-)

PAGE 89

78 Results of the neopterin study were inconclusive because of the small sample size, but suggestive. In seven studied cases of SIDS the urinary neopterin level (in umol neopterin/mol creatinine) was 2208 ± 574 (mean + S.D.). Two control infants demonstrated neopterin levels of 320 and 581. Discussion Despite considerable evidence of a role for C. perfhngens in SIDS, the means whereby the organism sporulates and produces toxins in the gut is not completely understood. This is extremely important in understanding the etiology of SIDS because cause and effect relationships can be especially difficult to elucidate in these cases. Even a cursory review of the SIDS literature indicates that there are many detectable abnormalities in the SIDS population which makes ascertaining a correlation quite different from establishing causality. To cause enteric pathology, C. perfhngens must sporulate and interestingly certain bile acids, including taurocholate, are known to stimulate sporulation (Floch et al., 1972; Hickey and Johnson, 1981; Phillips, 1986; Ushijima, 1986; Labbe, 1989). According to Gaull (1983) taurine is a conditionally essential amino acid which is essential during the first few months of life. The formation of cholate conjugates with taurine and glycine in the infant was suggested to be proportional to body weight and normally fully developed after several months. There is a sparing of infants from SIDS during the first month of life. It is interesting to speculate that this may be due to the lower levels of certain bile acids during this period being insufficient to trigger sporulation of C. perfhngens and production of enterotoxin.

PAGE 90

79 This study sought to determine whether fecal bile acid (and in particular taurine and glycine conjugate levels) concentrations could be responsible for the high levels of C. perfringens spores and CPE seen in many SIDS cases. The results obtained do not support the hypothesis that there is any connection. In fact significant taurine and glycine conjugate levels were not observed in any sample, SIDS or control. The vast majority of bile acids were unconjugated (possibly due to deconjugation of the bile acids following collection), with CA, CDA, and LCA predominating. This result is consistent with an earlier study in humans, where bile acids were artificially raised without any apparent difference in anaerobic flora (Williams et al., 1975). In vitro studies, however, have demonstrated a general inhibitory effect of elevated bile acid levels on growth, yet a stimulatory effect on sporulation and enterotoxin synthesis by C. perfringens. Why this effect should not be observed in vivo is not clear. The in vitro studies indicated that each bile acid (sodium cholate, sodium taurocholate, sodium glycochenodeoxycholate, and sodium chenodeoxycholate) inhibited growth to a different degree, while a mixture completely inhibited growth (Heredia et al., 1991). Other studies have shown that high concentrations of sodium taurocholate stimulated sporulation (Ushijima, 1986), however a similar effect in the above mentioned study was observed only at low but not high concentrations (Heredia et al., 1991). Another study, though, found no stimulatory effect of this salt on sporulation (Hickey and Johnson, 1981). Differences in the results of these studies have been suggested to perhaps be due to strains used and media employed (Heredia et al., 1991). Interestingly, sodium taurocholate is often incorporated into media for the selective recovery of Clostridia (Wilson et al., 1982), while a sporulation media for C. perfringens containing ox bile has been reported (Phillips, 1982).

PAGE 91

80 Excretion of C. perfringens spores and CPE within feces is an excellent indicator of both food poisoning and SIDS (Skjelkvale and Uemura, 1977, Lindsay et al., 1993), however fecal bile acid levels appear not to be correlated with either CP, CPE, or SIDS. Perhaps an examination of ileal bile acids would be more informative. Depressed levels of bile acids could prove to be a risk factor for C. perfringens colonization of the gut. Alternately, transiently increased levels of ileal bile acids may be an inducer of sporulation as was previously suggested. It thus appears that fecal bile acids per se cannot be associated with increased levels of C. perfringens spores and CPE. The neopterin portion of this study was hampered by several complicating factors. First, the proportion of SIDS victims with urine in their bladders at the time of death was less than one half. Second, within the last ten years, likely as a result of the campaign to place babies on their backs or sides to sleep, the SIDS incidence has fallen dramatically from a rate of almost 2 per 1000 live births in 1989 (Willinger, 1989) to approximatly 1 per 1000 live births today (Scott et al., 1998). Third, control infants who die of a noninfectious cause are extremely rare making obtaining proper controls a difficult task. In this rather limited study neopterin levels far above those considered normal were seen in infants who had died of SIDS. These levels provide evidence that there is indeed an activation of the cell-mediated arm of the immune system, in particular cells of the monocyte/macrophage lineage, in SIDS. These results are consistent with the finding that infants succumbing to SIDS had elevated levels of IL-6 in their cerebrospinal fluid providing evidence of an activated immune system (Vege et al., 1995). A larger study of this phenomenon would thus appear warranted.

PAGE 92

CHAPTER 7 CONCLUSIONS In this work immune response to the Clostridium perfhngens type A enterotoxin (CPE) was examined using the mouse model. Initially it was believed that CPE was a superantigen and would thus likely mediate its effects at least in part through T-cell activity. Though this was found to not be true, work done in vitro indicated that it was a potent activator of macrophages (Wallace et al., 1999). The cytokines levels examined in this work demonstrated that there was a strong pro-inflammatory response to the C. perfhngens type A enterotoxin. The spectrum of cytokines induced mirrors closely the cytokine profile produced following LPS exposure. The cytokine protein response ends relatively rapidly when one compares this response with that obtained following challenge with either LPS or with a staphylococcal suparantigneic enterotoxin. This work utilized mice that were not sensitized with D-gal as are the mice in experiments involving the other toxins. It is certainly possible that the perturbation of the immune system by D-gal lengthens the response to bacterial toxins. Other researchers have used these sensitized mouse models since they more closely mimic the immune response observed in humans, as to concentration required to generate a pathophysiological response or type of response obtained (Miethke et al., 1993). To date no work has been performed in non-stimulated mice as to cytokine time course following exposure to either LPS or the staphylococcal enterotoxins. It should be considered that CPE interferes with macromolecular synthesis and viability in sensitive 81

PAGE 93

82 cells including those of the monocyte/macrophage lineage (Wallace et al., 1999). As it appears from the work outlined here that the CPE induced proinflammatory response is primarily a result of these cells then it also is possible that synthesis of these cytokines is a self-limiting phenomenon. The finding that the liver and bowel are transcriptionally active for cytokines during CPE intoxication is in agreement with previous results which found high binding to tissues from these organs (Keller, 1997). Serum cytokines decline before CPE is eliminated from the body in the mouse model (Keller, 1997). Free CPE is still detectable in thymus, bowel, and heart 72 hours after IG administration of 0.5 MLD, the amount used in these studies. The inflammatory response is thus attenuated through as yet undetermined means. Three possibilities, not mutually exclusive, are suggested to explain this phenomenon. 1) Cytokine transcription is downregulated. This appears to be the case with IL-6 in which serum proteins remain elevated long after transcription of this cytokine has ceased. 2) Free cytokines are bound by soluble receptors. This appears likely in the case of IL-la as transcription of this cytokine remains high through the 8 h time point despite the fact that detectable serum protein levels begin to decline after the 4 h time point and have reached baseline levels by the 8 h determination. 3) Third, sensitive cells, including a macrophage cell line, show decreased viability following the initial mitogenic effect observed following CPE exposure. This lethal effect is almost assuredly the result of the pore-forming activity and subsequent inhibition of macromolecular synthesis demonstrated by this toxin. It thus appears likely that the inflammatory response generated by CPE is a self-limiting

PAGE 94

83 phenomenon. There appear to be controls built into the cytokine expression system at both the transcriptional level as well as the protein expression level either through translational controls or through the synthesis or release of mediators which bind free cytokines. Also cells generating the response are killed after an initial period of heightened activity and thus would not contribute to further inflammatory activity (Wallace et al., 1999). In conclusion, CPE has been found to generate an immune response which is of a type found to be similar to that observed following exposure to LPS and the staphylococcal enterotoxins. This response appears, when one examines transcription of mPvNA for cytokines, to be the result of multiple organs including spleen, liver, and bowel. In the food-borne CPE intoxication this cytokine response could play a role in the accompanying nausea. In the infectious diarrhea syndrome there is a more protracted exposure to CPE. The greater tissue damage evident during this illness could in fact be due to resultant inflammatory processes mediated by cytokines. Clinical research investigating this possibility should be undertaken as should animal model studies. Additionally, if CPE is involved in the sudden infant death syndrome then this work could be of great value in proving this hypothesis. A role for bile acids in SIDS was not supported by this research. The cytokines examined and their profiles suggest that further research should be conducted on the phenomenon of SIDS examining products related to CPE exposure which persist after the initial rapid response. A large enough series of urine samples should be evaluated for neopterin levels to make an evaluation of

PAGE 95

84 whether the heightened levels seen in our small preliminary study are present in those amounts in a larger and statistically significant group of SIDS victims.

PAGE 96

85 REFERENCES Ahtonen P, Lehtonen OP, Kero P, Eerola E, Hartiala K (1994) Clostridium perfringem in stool, intrapartum antibiotics and gastrointestinal signs in a neonatal intensive care unit. Acta Paediatr 83:389-390. Ambach E, Tributsch W, Fuchs D, Reibnegger G, Henn R, Wachter H (1991) Postmortem evaluation of serum and urine neopterin concentrations J Forensic Sci 36:1089-1093. Ando Y, Tsuzuki T, Sunagawa H, Oka S (1985) Heat resistance, spore germination, and enterotoxigenicity of Clostridium perfringem. Microbiol Immunol 29:317-326. Baron S, Tyring SK, Fleischmann WR, Coppenhaver DH, Neisel DVV, Klimpel GR, Stanton J, Hughes TK (1991) The interferons: mechanisms of action and clinical applications. JAMA 266: 1 3751 383 . Barton BE, Jackson JV (1993) Protective role of interleukin 6 in the lipopolysaccharidegalactosamine septic shock model. Infect Immun 61: 1496-1499. Bathe OF, Rudston-Brown B, Chow AWC, Phang PT (1996) Gut is not a source of cytokines in a porcine model of endotoxicosis Surgery 120:522-533. Beagley KW, Elson CO (1992) Cells and cytokines in mucosal immunity and inflammation. Gastroenterol Clin N Am 12:347-366. Beckwith JB (1988) Intrathoracic petechial hemorrhages: a clue to the mechanism of death in sudden infant death syndrome 7 Ann NY Acad Sci 533:37-47. Bejarano MT, Masucci MG, Klein E (1986) Differential effect of Cyclosporin-A on the mixed-lymphocyte culture-induced proliferative and cytotoxic responses of Tlymphocytes with different cell densities. Cell Immunol 103:409-416. Belardelli F (1995) Role of interferons and other cytokines in the regulation of the immune response. APMIS 103:161-179. Bemelmans MHA, van Tits LJH, Buurman WA (1996) Tumor necrosis factor: function release and clearence. Crit Rev Immunol 16:1-11.

PAGE 97

86 Bette M, Shafer MKH, van Rooijen N, Weihe E, Fleischer B (1993) Distribution and kinetics of superantigen-induced cytokine gene expression in mouse spleen. J Exp Med 178:1531-1540. Bettelheim LA, Goldwater PN, Dwyer BW, Bourne AJ, Smith DL (1990) Toxigenic Esherichia coli associated with SIDS. Scand J Infect Dis 22:467-476. Bhakdi S, Muhly M, Korom S, Schmidt G (1990) Effects of Escherichia coli hemolysin of human monocytes. J Clin Invest 85:1746-1753. Bowness P, Moss PAH, Tranter H, Bell JI, McMichael AJ (1992) Clostridium perfringens enterotoxin is a superantigen reactive with human T cell receptors Vf36.9 and V(322. J Exp Med 176:893-896. Brynskov J, Nielesen OH, Ahnfelt-Ronne I, Bendtzen K (1992) Cytokines in inflammatory bowel disease. Scand J Gastroenterol 27:897-906. Bunjes D, Hardt C, Rollinghoff M, Wagner H (1981) Cyclosporin A mediates immunosuppression of primary cytotoxic T cell responses by impairing the release of interleukin 1 and interleukin 2. Eur J Immunol 1 1:657-661. Byard RW (1991) Possible mechanisms responsible of SIDS. J Pediatr Child Health 27:147-157. Canard B, Saint-Joanis B, Cole ST (1992) Genomic diversity and organization of virulence genes in the pathogenic anaerobe Clostridium perfringens. Mole Microbiol 6:1421-1429. CavaillonJM (1994) Cytokines and macrophages. Biomed Pharmacother 48:445-453. Cerami A (1992) Inflammatory cytokines. Clin Immunol Immunopath 62:S3-S10. Cohen MC, Cohen S (1996) Cytokine Function: a study in biologic diversity. Am J Clin Pathol 105:589-598. Collee JG (1974) Clostridium perfringens (C. welchii) in the human gastrointestinal tract. Soc Appl Bacteriol Symp Ser 3:205-219. Collie RE, McClane BA (1998) Evidence that the enterotoxin gene can be episomal in Clostridium perfringens isolates associated with non-food-borne human gastrointestinal disease. J Clin Microbiol 36:30-36. Cornillot E, Saint-Joanis B, Daube G, Granum PE, Canard B, Cole ST (1995) The enterotoxin gene (cpe) of Clostridium perfringens can be chromosomal or plasmidborne. Molecular Microbiol 15:639-647.

PAGE 98

87 Cox G, Gauldie J (1997) Interleukin-6. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 81-99. Czeczulin JR, Hanna PC, McClane BA (1993) Cloning, nucleotide sequencing, and expression of the Clostridium perfringens enterotoxin gene in Eschericia coli. Infect Immun 61:3429-3439. Dinarello CA (1992) Role of Interleukin-1 in infectious diseases. Immun Rev 127:1 19146. Dugas B, Mossalayi MD, Damais C, Kolb J-P (1995) Nitric oxide production by human monocytes: evidence for a role of CD23. Immunol Today 16:574-579. Duncan CL, Strong DH (1968) Improved medium for sporulation of Clostridium perfringens. Appl Microbiol 16:82-89. Duncan CL, Strong DH (1969) Ileal loop fluid accumulation and production of diarrhea in rabbits by cell-free products of Clostridium perfringens. J Bacteriol 100:86-94. Eigler A Sinha B, Hartmann G, Endres S (1997) Taming TNF: strategies to restrain this proinflammatory cytokine. Trends Immunol 18:488-492. Fantone JC (1997) Cytokines and neutrophiles: Neutrophile derived cytokines and the inflammatory response. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 373-380. Farner NL, Hank JA, Sondel PM (1997) Interleukin-2: molecular and clinical aspects. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 29-40. Ferrini S Moretta A, Biassoni R, Nicolin A, Moretta L (1986) Cyclosporin-A inhibits IL-2 production by all human T-cell clones having this function, independent of the T4/T8 phenotype or the coexpression of cytolytic activity. Clin Immunol Immunopathol 38:79-84. Fisher MM, Yousef IM (1973) Sex differences in the bile acid composition of human bile: studies in patients with and without gallstones. Can Med Assoc J 109:190-193. Flegel WA, Muller F, Daubener W, Fischer HG, Hadding U, Northoff H (1991) Cytokine response by human monocytes to Clostridium difficile toxin A and toxin B. Infect Immun 59:3659-3666. Floch MH, Binder HJ, Filburn BF, Gershengoren W (1972) The effect of bile acids on intestinal microflora. Amer J Clin Nut 25:1418-1426.

PAGE 99

88 Fong Y, Tracey KJ, Moldawer LL, Hesse DG, Manogue KB, Kenney JS, Lee AT, Kuo GC, Allison AC, Lowry SF, Cerami A (1989) Antibodies to cachectin/tumor necrosis factor reduce interleukin 1(3 and interleukin 6 appearance during lethal bacteremia. J Exp Med 170:1627-1633. Freudenberg MA Keppler D, Galanos C (1986) Requirement for lipopolysaccharideresponsive macrophages in galactosamine-induced sensitization to endotoxin. Infect Immun 51:891-895. Frieben WR, Duncan CL (1973) Homology between enterotoxin and spore structural protein Clostridium perfringens. Eur J Biochem 39:393-401 . Fuchs D, Weiss G, Reibnegger G, Wachter H (1992) The role of neopterin as a monitor of cellular immune activation in transplantation, inflammatory, infectious, and malignant diseases. Crit Rev Clin Lab Sci 29:307-341. Galanos C, Freudenberg MA, Reutter W (1979) Galactosamine-induced sensitization to the lethal effects of endotoxin. Proc Natl Acad Sci (USA) 76:5939-5943. Galanos C, Freudenberg MA (1993) Mechanisms of endotoxin shock and endotoxin hypersensativity. Immunobiol 187:346-356. GarciaAlvarado JS, Labbe RG, Rodriguez MA (1992) Sporulation and enterotoxin production by Clostridium perfringens Type A at 37 and 43°C. App Environ Microbiol 58:1411-1414. Gaull GE (1983) Taurine in human milk: growth modulator or conditionally essential amino acid 9 J Pediatr Gastroenterol 2:S266-S271. George WL, Finegold SM (1988) Clostridia in the human gastrointestinal flora. In:Finegold SM (ed) Closridia in gastrointestinal disease. Orlando: CRC Press, 1988:135. Goldner SB, Solberg M, Jones S, Post LS (1986) Enterotoxin synthesis by nonsporulating cultures of Clostridium perfringens. Appl Env Microbiol 52:407-412. Gorbach SL, Tabaqchali S (1969) Bacteria, bile and the small bowel. Gut 10:963-972. Guyton AC (1987) Human physiology and mechanisms of disease. 4 th ed. Philadelphia: Saunders WB pp 497-509. Hammons JL, Jordan WE, Stewart RL, Taulbee JD, Berg RW (1988) Age and diet effects on fecal bile acids in infants. J Pediatr Gastroenterol 7:30-38. HathewayCL (1990) Toxigenic Clostridia. Clin Microbiol Rev 3:66-98.

PAGE 100

89 Henderson B, Poole S, Wilson M (1996) Bacterial modulins: a novel class of virulence factors which cause host tissue pathology by inducing cytokine synthesis. Microbiol Rev 60:316-341. Heredia NL, Labbe RG, Rodriguez MA, GarciaAlvarado JS (1991) Growth, sporulation and enterotoxin production by Clostridium perfringens type A in the presence of human bile salts. FEMS Microbiol Lett 84:15-22. Hickey CS, Johnson MG (1981) Effects of pH shifts, bile salts, and glucose on sporulation of Clostridium perfringens NCTC 8798. Appl Environ Microbiol 41:124-129. Hirano T (1992) Interleukin-6 and its relation to inflammation and disease. Clin Immunol Immunopath 62:S60-S65. Holdsworth RJ (1992) Fatal postoperative gastric necrosis caused by Clostridium perfringens. Eur J Surgery 158:447-449. Holt JG (1984) Bergey's Manual of Systemic Bacteriology. 4 th ed. Williams and Wilkins, Baltimore, Md. Hulkower KI, Wnek AP, McClane BA (1989) Evidence that alterations in small molecule permeability are involved in the Clostridium perfringens type A enterotoxininduced inhibition of macromolecular synthesis in Vero cells. J Cell Physiol 140:498504. Johnson S, Gerding DN (1997) Enterotoxemic infections. In Rood JI, McClane BA Songer JG, Titball RW (eds) The Clostridia: molecular biology and pathogenesis. San Diego: Academic press, Inc. pp. 120-135. Katahira J, Inoue N, Horiguchi Y, Matsuda M, Sugimoto N (1997) Molecular cloning and functional characterization of the receptor for Clostridium perfringens enterotoxin. J Cell Biol 136:1239-1247. Keller AM (1997) Distribution and detection of Clostridium perfringens type A enterotoxin after intraperitoneal and intragastric administration using the murine model. Doctoral Thesis, University of Florida. Klein E (1895) Uber einen pathgenen anaeroben Darmbacillus, Bacillus enteritidis sporogenes. Zentrabl Bakteriol Parasitenkd Infectionskr Hyg 18:737. Kokai-Kun JF, McClane BA (1997a) The Clostridium perfringens enterotoxin. In: Rood JI, McClane BA Songer JG, Titball RW (eds) The Clostridia: molecular biology and pathogenesis. San Diego: Academic press, Inc. pp. 325-357.

PAGE 101

90 Kokai-Kun JF, McClane BA (1997b) Deletion analysis of the Clostridium perfringens enterotoxin. Infect Immun 65: 1014-1022. Krakauer, Fleischer B, Stevens DL, McClane BA, Stiles BG (1997) Clostridium perfringens enterotoxin lacks superantigenic activity but induces an H-6 response form human peripheral blood mononuclear cells. Infect Immun 65:3485-3488. Krous HF (1984) The microscopic distribution of intrathoracic petechiae in sudden infant death syndrome. Arch Path Lab Med 108:77-79. Labbe RG, Duncan CL (1977) Evidence for stable messenger ribonucleic acid during spoliation and enterotoxin synthesis by Clostridium perfringens type A. J Bacterid Labbe RG, Nolan LL ( 1 98 1 ) Stimulation of Clostridium perfringens enterotoxin tormation by caffeine and theobromine. Infect Immun 34:50-54. Labbe RG (1989) Clostridium perfringens. In: Doyle MP (ed) Food-borne bacterial pathogens. New York: Marcel Dekker, Inc., pp 192-234. Larson HE, Borriello SP (1988) Infectious diarrhea due to Clostridium perfrineens J Infect Dis 157:390-391. Lehmann V, Freudenberg MA, Galanos C (1987) Lethal toxicity of lipopolysaccharide and tumor necrosis factor in normal and d-galactosamine-treated mice J Exd Med 165:657-663. Lindsay JA (1996) Clostridium perfringens Type A enterotoxin (CPE) more than just explosive diarrhea. Crit Rev Microbiol 22:257-277. Lindsay J A, Dennison JD (1986) Histopathological effect of Clostridium perfringens 86 enterotoxin on rabbit intestine. Curr Microbiol 13:6 1-66. Lindsay JA Johnson HM, Wallace FM, Soos JM (1994) Can superantigens trigoer sudden infant death syndrome 7 Med Hypoth 43:81-85. Lindsay JA, Mach AS, Wilkinson MA, Martin LM, Wallace FM Keller AM Wojciechowski LM (1993) Clostridium perfringens Type A cytotoxic-enteroto'xin(s) as triggers for death in the sudden infant death syndrome: development of a toxico-infection hypothesis. Curr Microbiol 27:51-59. Locket PL, Gallager DD (1989) An improved procedure for bile acid extraction and purification. Lipids 24:221-223.

PAGE 102

91 Lowry OH, Rosenbrough NJ, Randall RJ (1951) Protein measurement with the folin reagent. JBiolChem 193:265-275. Mach AS, Lindsay JA (1994) Activation of Clostridium perfringens cytotoxic enterotoxin(s) in vivo and in vitro: role in triggers for sudden infant death Curr Microbiol 28:261-267. Mahony DE, Ahmed R, Jackson SG (1992) Multiple typing techniques applied to a Clostridium perfringens food poisoning outbreak. J Appl Bacteriol 72:309-3 14. Mannel D, Murray C, Risau W, Clauss M (1996) Tumor necrosis: factors and principles Immunol Today 17:254-256. Mantovani A Bussolino F, Inrona M (1997) Cytokine reulation of endothelial cell function: from the molecular level to the bedside. Trends Immunol 18:23 1-240. Marrack P, Blackman M, Kushnir E, Kappler J (1990) The toxicity of staphylococcal enterotoxin B is mediated by T cells. J Exp Med 171:455-464. Marshall JS, Bienenstock J, Perdue MH, Stanisz AM, Stead RH, Ernst PB (1989) Novel cellular interactions and networks involving the intestinal immune system and its microenvironment. APMIS 97:383-394. McClane BA (1994) Clostridium perfringens enterotoxin acts by producing small molecule permeability alterations in plasma membranes. Toxicol 87:43-67. McClane BA Hanna PC, Wnek AP (1988) Clostridium perfringens enterotoxin. Microbial Pathogenesis 4:3 17-323. McClane BA, McDonel JL (1979) The effects of Clostridium perfringens enterotoxin on morphology, viability, and macromolecular synthesis in Vero cells J Cell Physiol 99:191-200. McClane B A Wnek AP, Whitaker-Dowling P (1987) Interferon pretreatment enhances the sensitivity of Vero cells to Clostridium perfringens type A enterotoxin. Microbial Pathogenesis 3:195-206. McClane B A (1996) An overview of Clostridium perfringens enterotoxin Toxicon 34:1343-1355. McClung LS (1945) Human food poisoning due to growth of Clostridium perfringens (C. welchii) in freshly cooked chickens. J Bacteriol 50:229-231. McDonel JL (1980a) Binding of Clostridium perfringens [ 125 I] enterotoxin to rabbit intestinal cells. Biochemistry 19:4801-4808.

PAGE 103

92 McDonel JL (1980b) Mechanism of action of Clostridium perfringem enterotoxin Food Tech 12:91-95. McDonel JL, Asano T (1975) Analysis of unidirectional fluxes of sodium during diarrhea induced by Clostridium perfringem enterotoxin in the rat terminal ileum Infec Immun 11:526-529. McDonel JL, Duncan CL (1975) Histopathological effects of Clostridium perfringem enterotoxin in the rabbit ileum. Infect Immun 12: 1214-1218. McDonel JL, McClane BA (1979) Binding versus biological activity of Clostridium perfringem enterotoxin in vero cells. Biochem Biophys Res Commun 87:497-504. Meer RR, Songer JG, Park DL (1997) Human disease associated with Clostridium perfringem enterotoxin. Rev Environ Contam Toxicol 150:75-94. Melville SB, Collie RE, McClane BA (1997) Regulation of enterotoxin production in Clostridium perfringem. In Rood JI, McClane BA, Songer JG, Titball RW (eds) The Clostridia: molecular biology and pathogenesis. San Diego: Academic Press Inc dd 471-487. ' ' FF ' Miethke T, Wahl C, Heeg K, Echtenacher B, Krammer PH, Wagner H (1992) T cellmediated lethal shoke in mice by superantigen staphylococcal enterotoxin B: critical role of tumor necrosis factor. J Exp Med 175:91-98. Miethke T, Wahl C, Regele D, Gaus H, Heeg K, Wagner H (1993) Superantigen mediated shock: a cytokine release syndrome. Immunobiol 189:270-284. Mietzner RA, Kokai-Kun JF, Hanna PC, McClane BA (1992) A conjugated synthetic peptide corresponding to the C-terminal region of Clostridium perfringem type A enterotoxin elicits an enterotoxin neutralizing antibody response in mice Infect Immun 60:3947-3951. Mire-Sluis A Thorpe R (1998) Cytokines. Academic Press, San Diego, Ca. Misfeldt ML, Legaard PK, Howell SE, Fornella MH, LeGrand RD (1990) Induction of interleukin-1 from peritoneal macrophages by Pseudomonas aeruginosa exotoxin A Infect Immun 58:978-982. Miwatani T, Honda T, Arai S, Nakayama A (1978) Mode of lethal activity of Clostridium perfringem Type A enterotoxin. Japan J Med Sci Biol 3 1 :22 1 -223 Mondino A Khoruts A, Jenkins MK (1996) The anatomy of T-cell activation and tolerance. Proc Natl Acad Sci (USA) 93:2245-2252.

PAGE 104

93 Morikawa A, Sugiyama T, Kato Y, Koide N, Jiang G-Z, Takahashi K, Tamada Y, Yokochi T (1996) Apoptotic cell death in the response of D-galactosamine-sensitized mice to lipopolysaccharide as an experimental endotoxic shock model. Infect Immun 64:734-738. Morin MD, Hopkins WJ (1998) Treatment of mice with staphylococcal enterotoxin B enhances resolution of an induced Escherichia coli urinary tract infection and stimulates production of proinflammatory cytokines. Infect Immun 66:2466-2470. Munoz C, Misset B, Fitting K, Bleriot J-P, Cavaillon J-C, Cavaillon J-M (1991) Dissociation between plasma and monocyte-associated cytokines during sepsis. Eur J Immunol 21:2177-2184. Murrell WG (1989) Clostridium perfringens. In: Buckle K (ed) Food-borne microorganisms of public health significance. Sydney, Australia: AIFST, pp 209-232. Nagata K, Okamura H, Kunitoh, Uemura T (1997) Mitogenic activity of Clostridium perfringens enterotoxin in human periferal lymphocytes. J Vet Med Sci 59:5-7. Nakano M, Onzuka K, Yamasu H, Zhong WF, Nakano Y (1992) Protective effects of cytokines in murine salmonelosis. Microbial Infect 18:89-95. Nathan CF, Murray HW, Wiebe ME, Rubin BY (1983) Identification of interferon-y as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. J Exp Med 158:670-689. Newbould MJ, Malam J, Mclllmurray JM, Morris JA, Telford DR, Barson AJ (1989) Immunohistological localization of staphylococcal toxic shock syndrome toxin (TSST-1) antigen in sudden infant death syndrome. J Clin Pathol 42:935-939. Nguyen DT, Eskandari MK, DeForge LE, Raiford CL, Strieter RM, Kunkel SL, Remick DG (1990) Cyclosporin A modulation of tumor necrosis factor gene expression and effects in vitro and in vivo. J Immunol 144:3822-3828. Ohishi I, Yamamoto K, Sakaguchi G (1981) Evidence for intestinal absorption of Clostridium perfringens enterotoxin. FEMS microbiol Lett 12:369-372. Okewole PA, Itodo AE, Oyetunde IL, Chima JC, Irokanulo EA, Ocholi RA (1991) Clostridium perfringens Type A enterotoxemia in pigs: a report of five cases. Brit Vet J 147:484-485. Onderdonk AB, Allen SD (1995) Clostridium. In Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH (eds) Manual of Clinical Microbiology (6 th ed). Washington, D C. ASM Press pp. 574-586.

PAGE 105

94 Owens T, Renno T, Taupin V, Krakowski M (1994) Inflammatory cytokines in the brain: does the CNS shape immune responses? Immunol Today 15:566-571. Ozutsumi K, Sugimoto N, Matsuda M (1987) Clostridium perfringens Type A enterotoxin induces release of noradrenaline from the neurosecratory PC 12 cell line. BBRC 144:217-223. Palay DA, Cluff CW, Wentworth PA, Zeigler HK (1986) Cyclosporin inhibits macrophage-mediated antigen presentation. J Immun 136:4348-4353. Phillips KD (1986) A sporulation medium for Clostridium perfringens. Lett Appl Microbiol 3:77-79. PoussetF (1994) Cytokines as mediators in the central nervous system. Biomed Pharmacother 48:425-43 1 . Prud'homme GJ, Vanier LE (1993) Cyclosporin, tolerance, and autoimmunity. Clin Immunol Immunopath 66: 1 851 92. Pullen AM, Potts W, Wakeland EK, Kappler J, Marrack P (1990) Surprisingly uneven distribution of the T cell receptor V beta repertoire in wild mice. J Exp Med 171: 49-62. Roda A, Cerre C, Simoni P, Ploimeni C, Vaccari C, Pistillo A (1992) Determination of free and amidated bile acids by high-performance liquid chromatography with evaporative light scattering mass detection. J Lipid Res 33: 1393-1402. Rood JI, Cole ST (1991) Molecular genetics and pathogenesis of Clostridium perfringens. Microbiol Rev 55.621-648. Saito M (1990) Production of enterotoxin by Clostridium perfringens derived from humans, animals, foods, and the natural environment in Japan. J Food Prot 53:1 15-1 18. Samuel SC, Hancock P, Leigh DA (1991) An investigation into Clostridium perfringens enterotoxin-associated diarrhoea. J Hospital Infect 18:219-230. Scott CL, Iyasu S, Rowley D, Atrash HK (1998) Postneonatal mortality surveil lanceUnited States, 1980-1994. iVDVlWR 47(SS-2): 15-30. See RH, Kum WWS, Chang AH, Goh SH, Chow AW (1992) Induction of tumor necrosis factor and interleukin-1 by purified staphylococcal toxic shock syndrome toxin 1 requires the presence of both monocytes and T lymphocytes. Infec Immun 60:26122618. SenGC (1997) The interferons. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 199-208.

PAGE 106

95 Setchell KDR, Lawson AM, Tanida N, Sjovall J (1983) General methods for the analysis of metabolic profiles of bile acids and related compounds in feces. J Lipid Res 24:10851100. Shireman S, Klein E, McClane BA (1994) Clostridium perfringens Type A enterotoxin induces tissue damage and fluid accumulation in rabbit ileum. J Diarrhoeal Dis Res 12:200-207. Sivan Y, She G, Schonfeld T, Nitzan M, Nutman J (1992) Sudden infant death in the Tel Aviv and Petah districts. Israel J Med Sci 28:430-435. Skjelvale R, Tolleshaug H, Jarmund T (1980) Binding of enterotoxin from Clostridium perfringens type A to liver cells in vivo and in vitro. Acta Path Microbiol Scand Sect B 88:95-102. Skjelkvale R, Uemura T (1977) Experimental diarrhea in human volunteers following oral administration of Clostridium perfringens enterotoxin. J Appl Bacterid 46:281-286. SlazykWE, Speirto FW (1990) Liquid-chromatographic measurement of biopterin and neopterin in serum and urine. Clin Chem 36: 1364-1368. SongerJG (1996) Clostridial enteric diseases of domestic animals. Clin Microbiol Rev 9:216-234. Spooner CE, Markowitz NP, Saravolatz LD (1992) The role of tumor necrosis factor in sepsis. Clin Immunol Immunopath 62:S1 1-S17. Stark PL, Lee A (1982) Clostridia isolated form feces of infants during the first year of life. JPediatr 100:362-365. Sugii S, Horiguchi Y (1988) Identification and isolation of the binding substance for Clostridium perfringens enterotoxin on Vero cells. FEMS Microbiol Lett 52:85-90. Tadeda K, Matsumoto T, Miyazaki S, Yamaguchi K (1996) Lipopolysaccharideinduced lethality and cytokine production in aged mice. Infect Immun 64:769-774. Telford DR, Morris J A, Hughes P, Conway AR, Lee S, Barson AJ (1989) The nasopharyngeal flora in SIDS. J Infect 18:125-130. Thomson A (1998) The Cytokine Handbook (Third edition). Academic Press, San Diego, Ca. Timmerman CP, Mattsson E, Martinez-Martin L, deGraaf L, van Strijp JAG, Verbrugh HA, Fleer A (1993) Induction of release of tumor necrosis factor from human monocytes by staphlococci and staphylococcal peptidoglycans. Infec Immun 61:41674172.

PAGE 107

96 Tocci MJ, Schmidt JA (1997) Interleukin-l: structure and function. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 127. Todd ECD (1989) Preliminary estimates of costs of food-borne disease in the United States. J Food Prot 52:595-60 1 . Torres BA, Johnson HM (1994) Identification of an HIV-1 NEF peptide that binds to HLA class II antigens. Biochem Biophys Res Commun 200: 1059-1065. TraceyKJ (1997) Tumor necrosis factor. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York.: Marcel Dekker, Inc pp 223-239. Tracey KJ, Cerami A (1993) Tumor necrosis factor, other cytokines and disease. Annu Rev Cell Biol 9:3 17-343. Tsai C-C, Reimann HP (1975) Food poisoning signs in mice induced orally by Clostridium perfringens Type A enterotoxin. J Formosan Med Assoc 74:3 10-315. Ushijima T (1986) Glycocholic and taurocholic acids as potent sporulation stimulating agents of Clostridium perfringens. Medicin Biol (Japan) 1 13: 193-195. Vege A, Rognum T, Scott H, Aasen A, Saugstad O (1995) SIDS cases have increased levels of interleukin-6 in cerebrospinal fluid. Acta Paediatr 84: 193-196. VlahcevicZR, Bell CC, Buhac I, Farrar JT, Swell L (1970) Diminished bile acid pool size in patients with gallstones. Gastroenterol 59:165-173. Walker PD, Short JA, Roper G (1975) Location of antigens on ultrathin sections of sporeforming bacteria. In: Gerhardt RN, Costilow RN, Sadoff HL (eds) Spores IV American Society for Microbiology pp 572-579. Wallace FM, Mach AS, Keller AM, Lindsay JA (1999) Evidence for Clostridium perfringens enterotoxin (CPE) inducing a mitogenic and cytokine response in vitro and a cytokine reponse in vivo. Curr Microbiol (in press). Watkins JB, Szczepanik P, Gould JB, Klein A, Lester R (1975) Bile metabolism in the human premature infant. Gastroenterol 67:706-713. Weiss KF, Strong DH, Groom RA (1966) Mice and monkeys as assay animals for Clostridium perfringens food poisoning. Appl Microbiol 14:479-485. WewersMD (1997) Cytokines and macrophages. In: Remick DG, Frieland JS (eds) Cytokines in health and disease. New York: Marcel Dekker, Inc pp 339-355.

PAGE 108

97 Wieckowski EU, Wnek AP, McClane BA (1994) Evidence that an -50 kDa mammalian plasma membrane protein with receptor-like properties mediates the amphiphilicity of specifically bound Clostridium perfringens enterotoxin. J Biol Chem 269:10838-10848. Wilkinson MA (1991) The sudden infant death syndrome in Florida: an epidemiological, pathological, and microbiological study. Masters Thesis, University of Florida. Williams RC, Showalter R, Kern F (1975) /// vivo effects of bile salts and cholestyramine on intestinal anaerobic bacteria. Gastroenterol 69:483-491. WillingerM (1989) SIDS: a challenge. J NIH Res 1:73-80. Wilson KH, Kennedy MJ, Fekety FR (1982) Use of sodium taurocholate to enhance spore recovery on a medium selective for Clostridium difficile. J Clin Microbiol 15:443446. Wnek AP, McClane BA (1986) Comparison of receptors for Clostridium perfringens type A and cholera enterotoxins in isolated rabbit intestinal brush border membranes. Microbial Patho 1:89-100. Yachie A, Nobuhiko T, Ohta K, Uehara T, Fujita S-I, Miyawaki T, Taniguchi N (1992) Defective production of interleukin 6 in very small premature infants in response to bacterial pathogens. Infect Immun 60:749-753. Zar JH (1984) Biostatistical Analysis. Prentice-Hall, New York, NY.

PAGE 109

98 BIOGRAPHICAL SKETCH F. Morgan Wallace was born in Birmingham, Alabama. After a stint in the Army as a combat medic he studied in the Department of Microbiology and Cell Science at the University of Florida from which he received a degree in 1991. He then began work in the Department of Food Science and Human Nutrition as a doctoral student. Upon completion of his degree he plans to pursue a career in research on foodborne bacterial pathogens and host-pathogen interactions working for the United States Department of Agriculture.

PAGE 110

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, m scope and quality, as a dissertation for the degree of Doctor of Philosophy. imes A. Lindsay, Chair / ^Professor of Food Science and Human Nutrition I certify that 1 have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Dougla^ L. Archer, Cochair Professor of Food Science and Human Nutrition I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. n F. O'Keefe iT Sean Associate Professor of Food Science and Human Nutrition I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality^ as a dissertation for the degree of Doctor of Philosophy. Mark L. Tamplin Associate Professor of Food Science and Human Nutrition

PAGE 111

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality as a dissertation for the degree of Doctor of Philosophy. Edward Kk Hq Professor of Micr< and Cell Science biology This dissertation was submitted to the Graduate Faculty of the College of Agriculture and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. May, 1999 "Dean, College of Agriculture Dean, Graduate School