Citation
Sampling and detection of trichodorid nematodes and tobacco rattle virus on corky-ringspot-affected potato tubers

Material Information

Title:
Sampling and detection of trichodorid nematodes and tobacco rattle virus on corky-ringspot-affected potato tubers
Creator:
Pérez, Enrique Ernesto
Publication Date:
Language:
English
Physical Description:
xii, 170 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Agricultural seasons ( jstor )
Crops ( jstor )
Growing seasons ( jstor )
Population density ( jstor )
Population estimates ( jstor )
Roundworms ( jstor )
Sample size ( jstor )
Soils ( jstor )
Symptomatology ( jstor )
Tubers ( jstor )
Dissertations, Academic -- Entomology and Nematology -- UF ( lcsh )
Entomology and Nematology thesis, Ph.D ( lcsh )
Nematode diseases of plants ( lcsh )
Potato ring rot ( lcsh )
Potatoes -- Diseases and pests ( lcsh )
City of Gainesville ( local )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1997.
Bibliography:
Includes bibliographical references (leaves 151-169).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Enrique Ernesto Perez.

Record Information

Source Institution:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
028637127 ( ALEPH )
39476480 ( OCLC )

Downloads

This item has the following downloads:


Full Text












SAMPLING AND DETECTION OF TRICHODORID NEMATODES AND TOBACCO
RATTLE VIRUS IN CORKY-RINGSPOTAFFECTED POTATO TUBERS






By

ENRIQUE ERNESTO PEREZ


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY


UNIVERSITY OF FLORIDA


1997















ACKNOWLEDGMENTS

I thank Dr. Robert McSorley, my committee cochair, for his excellent professional guidance. His suggestions always led me to discover new ways of thinking. He spent countless hours guiding me in the planning, analysis, and writing of my dissertation.

I especially thank Dr. D. Peter Weingartner, my

committee cochair, for financial support and professional guidance. He facilitated the resources and technical help to execute all the field experiments. I credit him for his enthusiasm and support in helping me to explore new ideas during the course of my research.

I acknowledge Dr. Don Dickson for his advice,

encouragement, and critical review of this dissertation. I thank Dr. Ramon Littell for his valuable guidance and criticism on my statistical studies. I am indebted to Dr. Nguyen Khuong for his professional help with nematode identification. I also thank Mr. Jay Harrison for his help in computer programming for data generated in my sampling experiments.









I am most grateful to Dr. Ernest Hiebert for his

professional guidance as a committee member and allowing me to use his facilities for the molecular virology work. I wish to express here my gratitude to Kris Beckham who selflessly taught and guided me through my virology work. She always took the necessary time to make sure that I learned techniques and procedures that were essential for my work. I would not have succeeded in many of my experiments without her professional help.


I am thankful to Dr. Grover Smart, Jr., graduate

coordinator, and Debbie Hall, secretary for the graduate office. Both went beyond the call of duty to make my stay at the University of Florida a most enjoyable one.


iii
















TABLE OF CONTENTS


ACKNOWLEDGMENTS ........................................ii

LIST OF TABLES ........................................vii

LIST OF FIGURES ........................................ix

ABSTRACT ...............................................xi

CHAPTERS

1 LITERATURE REVIEW ................................1

Economic Importance of Potato in Florida and
the United States ...........................1
Nematodes Affecting Potato in Northeast
Florida .....................................2
Biology and Agronomic Importance of
Trichodorid Nematodes .......................3
Biology and Agronomic Importance of Sting
Nematodes . .................................. 6
Vertical Distribution of Trichodorid
Nematodes in the Soil Profile ............... 9
Vertical Distribution of Belonolaimus spp.
in the Soil Profile ........................10
Abiotic Factors Affecting Population
Densities of Trichodorids and
Belonolaimus longicaudatus .................11
The Use of Chemicals to Control Plant
Parasitic Nematodes and Improve Tuber
Quality ....................................13
Management of Trichodorids and Belonolaimus
longicaudatus by Cultural Practices ........14










Sampling for Detection and Estimation of
Incidence and Severity of CRS-affected
Tubers .....................................16
Some Factors that Affect Nematode
Extraction .................................18
Relationship Between Crop Damage and
Nematode-Associated Diseases ...............20
Tobacco Rattle Virus: The Causal Agent of
Corky Ringspot on Potato ...................21
Methods of Transmission of Tobacco Rattle
Virus ......................................24
The Association Between Tobraviruses and
Trichodorids ...............................25
Retention of Tobacco Rattle Virus by
Trichodorid Nematodes ......................26
Criteria Used to Determine TrichodoridTransmitted Tobacco Rattle Virus ...........28
Characteristics of the Nucleotide Sequences
of Tobacco Rattle Virus Strains ............29
Detection of Tobacco Rattle Virus ............30
Objectives of Present Study ..................32



2 COMPETITION BETWEEN Paratrichodorus minor
AND Belonolaimus longicaudatus ON POTATO
AND CABBAGE ...................................34

Introduction .................................34
Materials and Methods ........................36
Results ......................................39
Discussion ...................................41



3 SEASONAL VARIATION OF Paratrichodorus minor
AND Belonolaimus longicaudatus IN SORGHUMSUDANGRASS ....................................55

Introduction .................................55
Materials and Methods ........................58
Results and Discussion .......................61

4 ESTIMATES OF SAMPLE SIZE FOR DETECTION AND
ESTIMATION OF INCIDENCE AND SEVERITY OF
CORKY-RINGSPOT-INFESTED POTATO ................71
Introduction .................................71










Materials and Methods ..........................74
Results ........................................ 79
Discussion .....................................81



5 EFFECT OF SOIL SUSPENSION METHOD ON NEMATODE
EXTRACTION WHEN USING THE CENTRIFUGALFLOTATION TECHNIQUE .............................99


Introduction ..........................
Materials and Methods .................
Results and Discussion ................


S99
101
102


6 CORRELATION BETWEEN Paratrichodorus minor
POPULATIONS AND CORKY RINGSPOT SYMPTOMS
ON POTATO ......................................107

Introduction ..................................107
Materials and Methods .........................109
Results ....................................... 112
Discussion ....................................116

7 DETECTION OF TOBACCO RATTLE VIRUS IN POTATO
TUBERS OBTAINED IN NORTHEAST FLORIDA BY
POLYMERASE CHAIN REACTION (PCR) AND
NONRADIOACTIVE TISSUE BLOT .....................121


Introduction .................
Materials and Methods ........
Results ......................
Discussion ...................

8 SUMMARY AND CONCLUSION ..........


121 124 131 137


................. 140


APPENDIX


IDENTIFICATION OF Trichodorus spp.
EXPERIMENTAL FIELD ..............



LIST OF REFERENCES .....................

BIOGRAPHICAL SKETCH ....................


FROM


THE
....�


........ 147


................. 151

................. 170












LIST OF TABLES


Table Page

2-1. Effect of crop, depth, and nematicide on numbers
of Belonolaimus longicaudatus per 100 cm of
soil, 1993-94 season. ........................... 45

2-2. Effect of crop, depth, and nematicide on numbers
of Belonolaimus longicaudatus per 100 cm of
soil, 1994-95 season. . ...........................47

2-3. Effect of crop, depth, and nematicide on numbers
of Paratrichodorus minor per 100 cm of soil,
1993-94 season. ................................. 49

2-4. Effect of crop, depth, and nematicide on numbers
of Paratrichodorus minor per 100 cm of soil,
1994-95 season. . .................................51

2-5. Number of Belonolaimus longicaudatus and
Paratrichodorus minor per 100 cm of soil
on potato and cabbage. ...........................53

2-6. Number of Belonolaimus longicaudatus and
Paratrichodorus minor per 100 cm of soil
in untreated plots on potato and cabbage ........ 54

3-1. Preceding crops, harvest dates of preceding
crops, sorghum planting dates, sorghum
varieties, soil sample dates, and sorghum
harvest dates. .................................. 60

3-2. Ratio between population densities at the end
of the growing season (Pf) and population
densities before planting (Pi) of Belonolaimus
longicaudatus and Paratrichodorus minor . ........66


vii









4-1. Binomial probability of detecting a corky
ringspot(CRS)-infected tuber in plots with
different incidences of the disease . ............89
3
5-1. Number of nematodes per 100 cm of soil recovered
by manual and mechanical suspension of the
soil subsamples. . ...............................105

6-1. Simple linear correlation coefficients between
mean external and internal incidence and
severity of corky ringspot tuber symptoms,
and Paratrichodorus minor numbers ..............113

6-2. Mean external and internal incidence and severity
of corky ringspot tuber symptoms, and
Paratrichodorus minor per 100 cm of
soil at planting. . ..............................114

6-3. Simple linear correlation coefficients between
mean external and internal incidence and
severity of corky ringspot tuber symptoms,
and Paratrichodorus minor numbers . .............115

7-1. Absorbance values (mean and range) of ELISA test
results from roots and tops of Nicotiana
tabacum, N. clevelandii, and Petunia hybrida
plants ......................................... 133


viii















LIST OF FIGURES


Figure Page

3
3-1. Nematode densities per 100 cm of soil on sorghumsudangrass in field A ...........................67

3-2. Nematode densities per 100 cm of soil on sorghumsudangrass in field B ...........................68

3-3. Total monthly precipitation at the Yelvington Farm
near Hastings, Florida during the sorghumsudangrass growing season .......................69

3-4. Average monthly soil temperatures at 10 cm deep
during the the sorghum-sudangrass growing
season. . .........................................70

4-la. Internal severity of corky ringspot in samples
of potato tubers. Relationship between the average of percentage of deviation from the
plot mean and the sample size . ..................90

4-1b. External severity of corky ringspot in samples
of potato tubers. Relationship between the average of percentage of deviation from the
plot mean and the sample size . ..................91

4-2a. Internal incidence of corky ringspot in samples
of potato tubers. Relationship between the average of percentage of deviation from the
plot mean and the sample size . ..................92

4-2b. External incidence of corky ringspot in samples
of potato tubers. Relationship between the average of percentage of deviation from the
plot mean and the sample size . ..................93









4-3a. Internal severity of corky ringspot in samples
of potato tubers. Relationship between the
average of standard error of the mean and the
sample size. . ....................................94

4-3b. External severity of corky ringspot in samples
of potato tubers. Relationship between the
average of standard error of the mean and the
sample size. .................................... 95

4-4a. Internal incidence of corky ringspot in samples
of potato tubers. Relationship between the
average of standard error of the mean and the
sample size. .................................... 96

4-4b. External incidence of corky ringspot in samples
of potato tubers. Relationship between the
average of standard error of the mean and the
sample size. . ....................................97

4-5. Relationship between external incidence and mean
internal severity. ...............................98

5-1. Mechanical suspension of the soil with a pressure
nozzle .........................................106

6-1. Monthly precipitation during the potato growing
seasons. ....................................... 120

7-1. Organization of a tobravirus genomic RNA-1 . .......134

7-2. Eight products after 22 cycles of PCR following
reverse transcription of nucleic acid
extracted from potato tubers with TRV-like
symptoms. . ......................................134

7-3. Tissue blot hybridization test from different
potato varieties. ...............................135

7-4. Nucleotide sequence of the RNA-1 16 kDa open
reading frame from the Florida tobacco
rattle virus isolate. ...........................136















Abstract of Dissertation Presented to the Graduate School of
the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


SAMPLING AND DETECTION OF TRICHODORID NEMATODES AND TOBACCO
RATTLE VIRUS ON CORKY-RINGSPOTAFFECTED POTATO TUBERS

By

Enrique Ernesto P6rez

December, 1997

Chair: Dr. Robert McSorley
Major Department: Entomology and Nematology


Florida potato (Solanum tuberosum) production has a great impact in the winter-spring potato market in the United States. Among the most important plant-parasitic nematodes affecting potato quality and yield in northeast Florida are Paratrichodorus minor and Belonolaimus longicaudatus. Yield losses are caused by B. longicaudatus, whereas P. minor is important as a vector of the tobacco rattle virus (TRV), resulting in the disease known as corky ringspot (CRS). The resurgence of P. minor after soil fumigation was investigated. Resurgence of P. minor









populations after soil fumigation was not associated with B. longicaudatus numbers. Relative abundance of B. longicaudatus and P. minor population densities in soil at 0-20 and 20-40 cm deep was determined. Numbers of B. longicaudatus and P. minor increased on summer cover crops of sorghum-sudangrass, but the increases varied with season.

A sample size of 20 potato tubers was found to be

adequate for estimating infection levels of CRS in tubers. Accuracy and precision of estimates of incidence and severity were dependent on the true mean incidence and severity of CRS-affected potato tubers in plots. There were significant associations between P. minor numbers and incidence or severity of CRS-affected potato tubers in plots.

Nematode-transmitted TRV was detected in bait plants by enzyme-linked immunosorbent assay. The virus also was detected by reverse transcription from a segment of the RNA1 followed by cDNA amplification by polymerase chain reaction. The 463-bp fragment was cloned, sequenced, and compared to sequences from a genebank database. A nonradioactive biotin-labeled probe was developed to detect TRV by tuber-tissue blotting.


xii















CHAPTER 1
LITERATURE REVIEW



Economic Importance of Potato in Florida and the United States

Potato (Solanum tuberosum L.) production in the United States in 1995 was 20.1 million metric tons (Lown, 1997). Potato is grown in all 50 states, and based on harvest time, the crop is divided into four seasonal groups. Almost 90% of the total production is harvested in the fall from September to November in 24 states. Spring and summer crop production are approximately the same size, and the winter production, the smallest, is harvested mostly in California and Florida from January into March. Northeast Florida (NEF) produces 272,160 metric tons of potatoes annually on 10,927 ha, which is 63% of the state's total hectarage (Anonymous, 1996). Value of Florida's total potato production, estimated at $84 million in 1995, ranks the state fourth nationally in the value of potato due to the high price of the winter and early spring production.









Nematodes Affecting Potato in Northeast Florida

There are 12 genera of plant-parasitic nematodes

commonly associated with potato in NEF (Weingartner et al., 1983). Among the most important are the trichodorid nematodes (Paratrichodorus minor (Colbran) Siddiqi and Trichodorus spp.), and Belonolaimus longicaudatus Rau. Yield losses are caused by B. longicaudatus, whereas trichodorid nematodes are important as vectors of the tobacco rattle virus (Walkinshaw et al., 1961). This virus causes the disease known as corky ringspot (CRS) in the United States and spraing in Europe. Depending upon the potato variety affected, symptoms are characterized by circular lesions on the surface of affected tubers and(or) necrosis in the tuber flesh, making tubers unmarketable (Weingartner et al., 1983). Walkinshaw et al. (1959) stated that deep growth cracks, distortion, suberization, and irregular shallow furrows of suberized tissue often occur on the tuber surface. Foliage symptoms are rare and occur as severe stunting of the leaves and stems, and yellow mottle in the leaves (Walkinshaw et al., 1961). Foliage symptoms have been observed in greenhouses when growing infected potato at temperatures between 16 and 24 C (Koespsell et









al., 1974). In Europe some strains of TRV cause bright yellow mosaic, arcs, and rings that may be confused with symptoms of other virus diseases such as aucuba mosaic or mop-top (Weingartner, 1981).



Biology and Agronomic Importance of Trichodorid Nematodes

Trichodorid species have a worldwide distribution, and are found most abundantly in sandy or sandy-loam soils (Perry and Rhoades, 1982a). The stubby-root nematode, Trichodorus christiei Allen was reported as being pathogenic on the roots of beets (Beta vulgaris L.), celery (Apium graveolens L.), and sweet corn (Zea mays L.) in the region of Sanford, Florida (Christie and Perry, 1951). Allen (1957) reported T. christiei associated with alfalfa (Medicago sativa L.), artichoke (Cynara scolymus L.), azalea (Rhododendron spp.), blueberry (Vaccinium corymbosum L.), boysenberry (Rubus hybrid L.), cotton (Gossypium hirsutum L.), grapevine (Vitis vinifera L.), onion (Allium cepa L.), peach (Prunus persica (L.) Batsch), persimmon (Diospyros kaki L.), bird-of-paradise (Strelitzia reginae Aiton), tomato (Lycopersicon esculentum Mill.), walnut (Juglans nigra L.), and wheat (Triticum aestivum L.). Excellent









hosts on which a tenfold increase in population occurred were oat (Avena sativa L.), tall fescue (Festuca arundinacea Schreb.), cabbage (Brassica oleracea L. var. capitata), turnip (Brassica rapa L.), mustard (Sinapis alba L.), winter vetch (Vicia villosa Roth), white clover (Trifolium repens L.), red clover (Trifolium pratense L.), tomato, and lettuce (Lactuca sativa L.) (Rohde and Jenkins, 1957b). The host range of trichodorid nematodes thus seems to be very wide; Perry and Rhoades (1982a) stated that almost any plant may be attacked by some species of trichodorids.

Trichodorid nematodes are ectoparasites. The first published document of ectoparasitism on nematode plant roots, was from Christie and Perry (1951). They described T. christiei feeding on bean roots (Phaseolus vulgaris L.). Nematodes move first through the loose cells of the root cap and later feed on the root end and primordial cells, which prevents further root elongation (Russell and Perry, 1966). Trichodorid nematodes most commonly attack epidermal cells, feeding only for a few minutes in each cell (Wyss, 1981). Hogger (1973) reported that T. christiei fed more on actively growing root tips than on the hairless or root hair region of tomato roots. Trichodorus christiei juveniles






5


were seen to embed half of their bodies in the root cap zone of wheat seedlings (Russell and Perry, 1966). Paratrichodorus minor caused browning, collapse of the epidermis, and cessation of growth when feeding on roots of eggplant (Solanum melongena L.) and wheat (Schilt and Cohn, 1975). Trichodorus christiei stunted vegetative growth and lateral roots on tomato plants 15 days after inoculation (Rohde and Jenkins, 1957b). In apple (Malus domestica Borkh.) trees, T. viruliferus congregated at the apical meristem, producing browning of the tissue (Pitcher, 1967).

A unique characteristic of these nematodes is the

production of a feeding tube, which is possibly used as a suction tool, and is probably initiated within the pharyngeal lumen (Wyss et al., 1979). The tube extends into the cell interior, and is anchored by a small plug of hardened secretions. Another peculiarity of trichodorids is the curved mural tooth, called an onchiostyle, with a solid tip and no knobs or flanges (Raski et al., 1969). Trichodorids are the only nematodes known to thrust their stylet during feeding, which helps salivation and digestion (Wyss, 1977).









The life cycle of T. christiei is shorter than most

plant-parasitic nematodes. The life cycle of T. christiei was completed in 16-17 days at 30 C (Rohde and Jenkins, 1957a), 17-18 days at 27 C, and 21-22 days at 22 C (Bird and Mai, 1967a). A first-stage juvenile hatches from the egg, commences to feed, and shortly thereafter, the nematode molts into a second-stage juvenile (Russell, 1962). Then it follows the general life cycle of other plant-parasitic nematodes with three more molts (Rohde and Jenkins, 1957a). Laboratory studies using apple tree seedlings kept between 15-20 C suggested that T. viruliferus has a life cycle of approximately 25 days and that a suitable food source is needed to promote reproduction (Pitcher and McNamara, 1970).



Biology and Aqronomic Importance of Sting Nematodes

The first report in the United States of the genus Belonolaimus was in 1949 from pine nurseries in Ocala, Florida (Steiner, 1949). Christie et al. (1952) reported B. gracilis Steiner pathogenic to celery, sweet corn, and strawberries (Fragaria ananassa Duch.). This nematode was later described as B. longicaudatus by Rau (1958).









The sting nematode is limited to soils with high sand content (> 80%) (Miller, 1972; Brodie 1976) and seems to reproduce best at soil temperatures of 25-30 C (Robbins and Barker, 1973). In Florida, this nematode has never been found in muck or marl soils (Christie, 1959). Belonolaimus longicaudatus is found in the southeastern United States from Virginia to Texas (Smart and Khuong, 1991). It also was reported in Arkansas (Riggs, 1961), Kansas (Dickerson et al., 1972), Missouri (Perry and Rhoades, 1982b), New Jersey (Myers, 1979), and California (Mundo-Ocampo et al., 1994). Robbins and Barker (1973) and Robbins and Hirschmann (1974) found host range and morphological differences between B. longicaudatus populations from Georgia and North Carolina.

Sting nematodes are ectoparasites and usually do not penetrate the roots except with their stylet (Perry and Rhoades, 1982), however there is one report that B. longicaudatus can be found occasionally inside roots (Christie et al., 1952). Root systems of plants infected with sting nematodes are stubby and coarse with dark lesions along the roots and root tips (Perry and Rhoades, 1982). Belonolaimus longicaudatus is highly virulent. Population densities as low as three nematodes per 100 g of soil at the









time of transplanting can result in significant yield loss in susceptible plants of collard (Brassica oleracea L. var. acephala), kale (Brassica oleracea L. var. acephala DC), and cauliflower (Brassica oleracea L. var. botrytis) (Khuong and Smart, 1975). Most vegetables and agronomic crops are seriously injured in many areas of Florida. The sting nematode causes important economic losses on numerous crops, but is especially troublesome in turfgrass (Perry and Rhoades, 1982b). Plants growing in fields infested with sting nematodes are often stunted and chlorotic and severe infestations of the nematode can cause plant death (Khuong and Smart, 1975).

The life cycle of B. longicaudatus is completed in 28 days under optimum conditions (Perry and Rhoades, 1982b). Eggs are laid adjacent to the feeding site, the nematode undergoes the first molt inside the egg and emerges as a second-stage juvenile (Perry and Rhoades, 1982b). Secondstage juveniles undergo three more molts and become adults. Reproduction is bisexual, and males comprise 40% of a typical population (Smart and Khuong, 1991).









Vertical Distribution of Trichodorid Nematodes in the Soil Profile

Knowledge of the vertical distribution of nematodes in the soil profile is essential for developing sampling protocols (Barker and Campbell, 1981). Time of the year, temperature, soil type, and moisture, were shown to have effects on the vertical distribution of nematodes in the soil (Brodie, 1976; Kable and Mai, 1968; McSorley and Dickson, 1990a; McSorley and Dickson, 1990b).

Several studies showed that trichodorid nematodes are most abundant at greater depths than many other plantparasitic nematodes. Brodie (1976) found highest densities of P. minor between 15-30 cm deep on soybean, and McSorley and Dickson (1990a) reported highest densities of P. minor on soybean between 15-45 cm deep. In a nursery of Sitka spruce (Picea sitchensis L.) trees, trichodorid densities were greatest between 30-39 cm deep (Boag, 1981). When more than one trichodorid species coexist, the species tend to occupy different ecological niches. In unfumigated plots, T. primitivus usually occurred more deeply than P. pachydermus in fallowed soil and under pine trees, but the species had similar depth distributions under a grass-clover cropping sequence (Alphey, 1985).









Vertical Distribution of Belonolaimus spp. in the Soil Profile

In soybean (Glycine max (L.) Merr.) plots, Belonolaimus longicaudatus was more abundant in soil at 0-30 cm than at 30-60 cm deep, and no sting nematodes were present below 60 cm deep (Brodie, 1976). In these plots, sand content was 88% between 0-30 cm, and less than 80% below 60 cm deep. McSorley and Dickson (1990a) reported highest densities of B. longicaudatus between 0-15 cm in deep sandy soil during most of the maize growing season. In the same study, the authors reported that the proportion of B. longicaudatus in soil 30-45 cm deep increased later in the season due to deeper penetration of the maize root system. In soybean fields, numbers of B. longicaudatus were higher in soil at 0-15 cm than at 15-30 cm deep at the beginning of growing season and densities became more evenly distributed as the season progressed (McSorley and Dickson, 1990b). Population densities of Belonolaimus sp. on maize increased in the top 30 cm of soil from planting to midseason (Todd, 1989; Todd, 1991). After midseason, population densities of Belonolaimus sp. only increased between 30-60 cm deep. The author suggested that this increase was probably due to root penetration or moisture fluctuations. Moisture and other









abiotic factors may not only affect vertical distribution of sting nematodes and other nematode species, but also may affect their abundance and limit their geographic distribution.



Abiotic Factors Affecting Population Densities of
Trichodorids and Belonolaimus longicaudatus

Toxicity trials with copper salt solutions in fixation dishes killed T. pachydermus. Soil irrigation with similar Cu concentration solutions did not affect T. pachydermus. This suggests that the adsorptive action of the soil inhibited the toxic effects of Cu (Hafkenscheid, 1971). Results from these experiments suggests the importance of using copper-free material for extraction of live trichodorids. In plots deficient in lime (pH 4.8-5.2), population densities of T. christiei increased; the authors suggested that the effect was possibly due to low pH or lack of calcium (Rodrfguez-Kdbana and Collins, 1979).

Soil compaction caused by tractor passes decreased numbers of T. primitivus by 25% in the top 21 cm of soil (Boag, 1985). Cultivation practices, such as rotary cultivation, reduced trichodorid populations by 15% (Boag, 1983).









Trichodorids seem to be sensitive to soil desiccation under laboratory conditions. Numbers of P. pachydermus and T. viruliferus decreased with decreasing soil moisture (Van Hoof, 1976). Transmission of TRV by trichodorids only occurred when the soil water content was at least 15%. This suggests that moisture affects feeding or mobility of trichodorids since trichodorid numbers were not greatly affected by moisture content in the soil (Cooper and Harrison, 1973).

Perry (1964) first showed the importance of temperature in the life cycle of B. longicaudatus. Reproduction was almost inhibited at 35 C, and population increases were greater at 29.4 C than at 26.7 C (Perry, 1964). Highest populations of B. longicaudatus were found when soil moisture content was from 10% to 20% (Brodie and Quattlebaum, 1970).

Soil texture affects trichodorid populations. Survival of P. minor in fallowed soil was best in sandy loam soils, followed by sand and clay soils (Schilt and Cohn, 1975). Population increase of T. minor on sudan-grass in greenhouse tests was greater in sandy loam soil than in silt clay loam or loam soil (Thomason, 1959).









The Use of Chemicals to Control Plant-Parasitic Nematodes and Improve Tuber Quality

In the late 1960s, the use of preplant fumigants such as 1,3-dichloropropene and 1,2-dichloropropane (DD), 1,3dichloropropene (1,3-D), and ethylene dibromide (EDB), became a common practice to increase potato tuber yield in NE Florida (Weingartner et al., 1993). Currently, the fumigants 1,3-D and metam-sodium are used as a costeffective chemical control for most nematodes that affect potato in northeast Florida. Although 1,3-D has controlled CRS in other parts of the world (Cooper and Thomas 1971; Livingston et al., 1976; Maas, 1975) and in the Pacific northwest (Williams et al., 1996), this practice has failed to control CRS and its trichodorid vectors in northeast Florida (Weingartner et al., 1975a; Weingartner et al., 1975b; Weingartner et al., 1976). Population densities of trichodorids in some pathosystems have been observed to rapidly increase or resurge following soil fumigation (Brodie, 1968; Perry, 1953; Rhoades, 1968), to levels exceeding those of untreated soils.

The use of 1,3-D at a rate of 56 L/ha applied in the row resulted in an increase of 13.6% in incidence of CRS when compared with untreated plots during a 5-year









experiment (Weingartner et al., 1983). The best control was achieved when the same rate of 1,3-D was combined with an at planting application of aldicarb applied at a rate of 3.4 kg a.i./ha. This treatment resulted in a 19.5% reduction in the incidence of CRS. Weingartner and Shumaker (1990c) also reported the lowest incidence of CRS in plots treated with 1,3-D applied at a rate of 56 L/ha with three chisels per row and combined with aldicarb applied at a rated of 3.4 kg a.i./ha. The use of oxamyl sprayed at planting at a rate of

3.4 kg a.i./ha plus three foliar applications of 1.1 kg a.i./ha, improved tuber quality by 53% on tobravirus-stubby root nematode infested fields (Weingartner et al., 1973).



Management of Trichodorids and Belonolaimus lonqicaudatus by Cultural Practices

Because of the potential restrictions in nematicide

use, more attention is being given to the possibilities of integrated control of nematodes, including crop rotation and other cropping sequences (Barker, 1991; Johnson and Feldmesser, 1987; McSorley and Gallaher, 1992; McSorley and Dickson, 1995; Sasser and Uzzell, 1991; Weingartner et al., 1991).









Most fields in northeast Florida (NEF) are planted to potato during the spring followed by sorghum-sudangrass hybrid (Sorghum bicolor (L.) Moench x S. arundinaceum (Desv.) Stapf var. sudanense (Stapf) Hitchc.) as a cover crop in the summer (Weingartner et al., 1993). Cabbage (Brassica oleracea L. var. capitata), although less important than potato, is another cash crop planted during the winter-spring season.

In cropping systems, the choice of crops that are

nonhost to some plant-parasitic nematodes can be used as a successful management strategy for improving yield of the next crop (Noe et al., 1991; Nusbaum and Ferris, 1973; Rhoades, 1976; Trivedi and Barker, 1986). Sorghum could be particularly beneficial in rotation systems involving vegetables crops where root-knot nematodes (Meloidogyne spp.) are the main nematode pathogens that are limiting to production (McSorley et al., 1986; McSorley and Gallaher, 1991). Furthermore, sorghum reduces erosion by wind and rain, increases organic matter content, and improves soil stability (McSorley et al., 1986; Myhre, 1957). However, P. minor and B. longicaudatus can increase on sorghum (McSorley and Gallaher, 1991; Rhoades, 1976; Rhoades, 1984), and large









population densities could affect the subsequent cabbage or potato crop (Rhoades, 1968; Weingartner et al., 1983).

Possible substitutes for sorghum-sudangrass are hairy indigo (Indigofera hirsuta L.), jointvetch (Aeschynomene americana L.), or velvetbean (Mucuna deeringiana (Bort.) Merr.). Hairy indigo and jointvetch were effective in maintaining low population densities of B. longicaudatus (Rhoades, 1976; Rhoades and Forbes, 1986). Growing hairy indigo in the summer reduced B. longicaudatus population densities and improved potato yield by 7.2%, but did not reduce severity of CRS on potato tubers (Weingartner et al., 1991).



Sampling for Detection and Estimation of Incidence and
Severity of CRS-affected Tubers

Incidence (percentage of affected tubers) and severity of CRS adversely affects the value of potato tubers (Weingartner and Shumaker, 1990a). The use of nematicides is a common practice in northeast Florida to lessen severity of infection and can reduce losses due to CRS by up to 25% (Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b). The potato chip industry, farmers, and researchers rely on the information obtained from potato tuber samples









to estimate incidence and severity of CRS on potato tubers (Weingartner et al., 1983; Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b). Since recommendation about entire potato fields or lots are based on observations of the samples, it is essential to understand the relationship between sample size and accuracy (exactness) and precision (variability) of the information in the sample. In the Pacific Northwest, CRS tuber injury in excess of 5% to 10% of the tubers sampled may result in rejection of an entire harvest (Williams et al., 1996).

The proportion of potato tubers in a sample affected by CRS is used to estimate the incidence of CRS in that field. Estimators, which are formulas or rules, are used to estimate parameters to make inferences and(or) decisions about a population (Mendenhall et al., 1990). In research studies (e.g. chemical trial tests or breeding programs), two parameters of interest are the percentage of potato tubers affected with CRS (incidence) and the extent to which each of those potato tubers is affected with CRS (severity).

A parameter estimator (e.g. sample mean x) is a random variable with a probability distribution called the sampling distribution of the estimator (Mendenhall et al., 1990).









Sampling distributions are used to determine precision and accuracy of an estimate, such as x (the sample mean), in estimating p (the true mean) of the entire population of CRS-affected tubers. Similarly the estimate S (sample

2
standard deviation) is used to estimate Y (the variance) The accuracy and precision of the information in the sample will set the reliability of the estimates x and S2.

Determination of sample size is crucial to secure a desired level of precision. Since confidence intervals decrease as the sample size increases, larger samples provide more precise information but incur higher costs (Freund and Wilson, 1993). The optimum sample size will be the one that provides the most precise information for a particular purpose at a minimum cost.



Some Factors that Affect Nematode Extraction

A critical step when determining numbers of nematodes in soil is the extraction method. Different methods have extraction efficiencies that range from 0% to 100% (McSorley, 1987; Viglierchio and Schmitt, 1983). Extraction efficiency within a method varies with operator, soil type, nematode genera, and other factors (McSorley and Parrado,









1987). The efficiency of a multi-step method can be increased by changing one or more of the steps of the method.

A common method for nematode extraction is the

centrifugal-flotation technique (Jenkins 1964), which is based on sieving of a soil suspension, followed by separation of nematodes by centrifugation. Extraction efficiency of B. longicaudatus in the centrifugal-flotation technique ranged from 27%-32% (McSorley and Frederick, 1991). McSorley and Parrado (1987) reported that mixing time of the soil in water had an effect on the relative number of nematodes entering suspension, and therefore affected extraction efficiency. Losses during this step were inversely related to suspension time and varied with nematode species and soil type. Losses could be reduced by mixing the sample into suspension for 60-90 minutes (McSorley and Parrado, 1987), and the use of soil mixing procedures were suggested to maximize break up of the soil aggregates.

The centrifugal-flotation technique is based on the

principle that the average density of the nematode is equal to, or lower than, the density of the solution (Viglierchio









and Yamashita, 1983). In their work, Viglierchio and Yamashita (1983) showed that flotation of nematodes and possible injury during extraction depends on solute density, solute osmotic pressure, and physiological properties of the nematode species.



Relationship Between Crop Damage and Nematode-Associated Diseases

Knowledge of the relationship between crop yield and population densities of plant-parasitic nematodes can be used as a tool to make accurate nematode management decisions (Ferris, 1974; Seinhorst, 1965). Nematode population densities at planting (Barker and Nusbaum, 1971) or at other times during the growing season (Ferris, 1974; Ferris and Noling, 1987; Mashela et al., 1991) can be correlated with yield. Since P. minor transmits the causal agent of CRS, it is possible that P. minor numbers could be correlated with incidence or severity of CRS on potato tubers.

Soil moisture may affect trichodorid populations

transmitting tobacco rattle virus to the potato corp. Cooke (1973) in England found a significant association between the prevalence of docking disorder in sugar beet in June,









caused by trichodorid-transmitted TRV, and rainfall in May. He suggested that this association was due to maximum trichodorid activity when soils were at or near field capacity. In Scotland, trichodorid densities in May were more associated with incidence of corky ringspot than trichodorid densities at harvest in August (Cooper and Thomas, 1971). Spraing incidence in Scotland was positively correlated with May rainfall, and it was most prevalent when the summer was wettest (Cooper and Harrison, 1973).



Tobacco Rattle Virus: The Causal Agent of Corky Ringspot on Potato

More than 400 plant species are susceptible to

infection with tobacco rattle virus, including cultivated and wild annuals, herbaceous perennials, and woody perennials (Harrison and Robinson, 1981). It is the plant virus with the widest known host range (Robinson and Harrison, 1989). Tobacco rattle virus has been found in many countries of Europe, in North America, Brazil, Japan, and New Zealand (Harrison and Robinson, 1981). Crops in which TRV causes disease include potato, corky ringspot in the United States and spraing in Europe in the tubers, stem mottle in the leaves (Robinson and Harrison, 1989), rattle









disease in tobacco (Nicotiana tabacum L.), mosaic in the leaves of lettuce (Lactuca sativa L.), mosaic in pepper (Capsicum annuum L.), notched-leaf in gladiolus (Gladiolus spp.), malaria in hyacinth (Eichhornia crassipes (Mart.) Solms), and color breaking and leaf distortion in tulip (Tulipa gesneriana L.) (Robinson and Harrison, 1989).

Tobacco rattle virus belongs to the tobravirus group and is naturally transmitted by Trichodorus spp. and Paratrichodorus spp. (Cooper and Thomas, 1970; Van Hoof et al., 1968; Walkinshaw and Larson, 1959). Tobravirus particles are of two predominant lengths, the longer particle of approximately 190 nm and the shorter one ranges from 45 to 115 nm, depending on the isolate (Harrison, 1970). Tobravirus particles stained with uranyl acetate appear in the electron microscope as rigid rods, 21 to 23 nm in diameter with a central hole 3.6 to 5.3 nm wide (Cooper and Mayo, 1972). Long particles have RNA of molecular weight 2.3 x 106 , and short particles have RNA of molecular weight 0.6-1.3 x 106 (Harrison, 1970). The short particles are usually two to five times more numerous than the long particles.









Lister (1968) reported the bipartite nature of the TRV particle and Harrison and Robinson (1978) divided the TRV isolates into two classes. The first class (M-type) produces two rod-shaped particles of different size. The larger particle (RNA-1) has approximately 7,000 nucleotides, and the shorter particle (RNA-2) ranges from 1,500 to 4,000 nucleotides. The short particle, RNA-2, encodes for the coat protein (Sanger, 1968). The second class (NM-type) lacks RNA-2 and therefore produces no nucleoprotein and exists as naked RNA in the host. Since RNA-1 encodes the replicase and the movement proteins that allows the virus to replicate and move sistemically in the plant, NM-type isolates can cause infection in plants and are very common in nature (Harrison and Robinson, 1982; Hamilton et al., 1987; MacFarlane et al., 1989). Recent studies showed that the formation of NM-type isolates by repeated mechanical transmissions could be caused by the lack of selection pressure for encapsidation needed in nematode transmission (Hernandez et al., 1996). Virus cultures obtained after several mechanical transfers showed high concentrations of defective interfering (DI) RNA that had lost the functional









coat protein gene. These DI RNAs outnumbered the RNAs-2 and became dominant in the virus culture giving rise to NM-type virus populations.



Methods of Transmission of Tobacco Rattle Virus

Tobacco rattle virus was transmitted from infected potato to tomato by grafting (Cadman and Harrison, 1959), and is more or less transmissible by inoculation with sap (Harrison and Robinson, 1981). Isolates of the NM type are poorly sap transmitted; however, transmission can be improved by grinding the infected tissue in the presence of phenol and using ethanol to precipitate and concentrate the RNA from the aqueous extract (Kubo et al., 1975). Seed transmission was detected in five out of 15 naturallyinfected weed species, and possibly plays a role in the spread of virus to new sites (Cooper and Harrison, 1973).

The most important means of transmission of TRV is by nematodes. Walkinshaw and Larson (1961) were the first in the United States to report transmission of TRV to tobacco plants by T. christiei populations from Hastings, Florida. Fields infected by nematode-transmitted TRV can be distinguished from infections caused by planting infected









plant material because of the clumped distribution of the former compared to the random distribution of the latter (Cremer and Schenk, 1967).

A complete feeding cycle of trichodorids is composed of the following phases: exploration, perforation, salivation, ingestion, and departure from the feeding site (Wyss, 1982). Exploration is performed by rubbing the lips against the cell wall over a short period of time, and is terminated when the strengthening rods of the pharyngeal wall contact the cell wall. The stylet is thrust at several times per second and the wall is perforated within a minute. After perforation, salivation begins and the stylet is thrust at a slower rate. Ingestion consists of slow thrusts into the accumulated cytoplasm. In each stylet retraction, the aggregated cytoplasm is removed and is consumed in less than half a minute (Wyss, 1982).



The Association Between Tobraviruses and Trichodorids

The association between TRV and trichodorids is relatively specific; P. pachydermus only acquired and transmitted TRV when the virus and nematode originated from the same locality (Van Hoof, 1968). Early assertions by Van









Hoof that TRV isolates were site specific were only partially true, since Ploeg et al. (1992) showed that specificity of transmission of P. pachydermus was serologically determined. Successful acquisition and transmission of TRV isolates belonging to the same serotype was accomplished by both P. pachydermus populations from the Netherlands and Scotland (Ploeg et al., 1992a). However, Ploeg et al. (1996), later showed a different scenario and demonstrated that P. teres could transmit two serologically distinct strains of TRV. Thus the serologic and geographic specificity between Paratrichodorus spp. and TRV isolates is not an universal phenomenon (Ploeg et al., 1992a; Ploeg et al., 1996). This was further documented with a report of Trichodorus viruliferus, T. primitivus, and T. cylindricus transmitting TRV isolates from the same serotype group (Ploeg et al., 1992b).



Retention of Tobacco Rattle Virus by Trichodorid Nematodes

Tobacco rattle virus particles lining the pharynx and

esophagus of P. pachydermus were observed for the first time by Taylor and Robertson (1970a). The first report explaining the mechanism of retention of virus particles and









its nematode vector was on nepoviruses. It was suggested that charged receptor sites from the nematode esophagus and charges on the coat protein of nepoviruses were involved in the retention of virus particles (Taylor and Robertson, 1970b).

Tobravirus have rod-shaped particles with coat proteins that assemble into aggregates comparable to those of tobacco mosaic virus (Gugerli, 1976). Mayo et al. (1993) hypothesized that the C-terminal of the capsid protein subunit could attach to the lining of the nematode esophagus. Legorburu et al. (1995), working with monoclonal antibodies, suggested that the C-terminal from the capsid protein of TRV was located on the surface of the particle and possibly exposed along its length. Later, Legorburu et al. (1996) confirmed this finding and stated that the Nterminal region of the protein also was exposed to the surface, whereas the central variable region was exposed to antibodies at one end. They observed different features in the C-terminals of virus groups with different modes of transmission, and stated "it is tempting to conclude that the C-terminal region of the protein may be involved in the transmission of TRV."









Pseudorecombinant TRV isolates constructed from RNA-2

that originated from nematode-nontransmissible isolates were not transmitted by trichodorids, but when the pseudorecombinats were constructed from RNA-2 of nematodetransmissible isolates, they were transmitted by trichodorids (Ploeg et al., 1993). From this experiment, the authors concluded that the factor determining vector transmissibility was located in RNA-2, and possibly that the coat protein was involved in the transmission process. In another series of experiments, however, replacement of the coat protein of a nematode non-transmissible tobravirus with that of another nematode-transmissible virus did not confer nematode transmissibility (MacFarlane et al., 1995). Therefore, factors in addition to the virus coat protein gene are responsible for nematode transmission. Hernandez et al. (1996) confirmed the finding of MacFarlane et al. (1995) by reporting that the 29.4 K gene in RNA-2 of TRV isolate PPK20 was essential for nematode transmissibility.



Criteria Used to Determine Trichodorid-Transmitted Tobacco Rattle Virus

Forty different associations have been reported between species of Trichodorus and Paratrichodorus and the









tobraviruses (Brown et. al., 1989). Trudgill et al. (1983) established the following prerequisites needed to state that a virus was nematode-transmitted: 1) the nematode and the virus must be fully identified and characterized, 2) bait plant tissue must be shown to be infected with the virus, 3) the nematode must be shown to be the only possible vector of the virus. When these criteria were applied, only 12 of 40 mentioned associations were supported by evidence (Brown et al., 1989). The TRV isolate from Hastings, Florida was shown to fulfill these criteria (Walkinshaw et al., 1961).



Characteristics of the Nucleotide Sequences of Tobacco Rattle Virus Strains

Nucleotide sequences of some European and Canadian TRV isolates have been published. The complete nucleotide sequence of RNA-1 of the spinach SYM isolate from England is known (Kurppa et al., 1981). Starting at position 2,291, the nucleotide sequence of the 3'-terminal 1,099 nucleotides of RNAs-1 and 2 of the tulip TRV isolate from the Netherlands were identical (Cornelissen et al., 1986). Similarly, the 3'-820 nucleotide sequence of RNAs 1 and 2 of the potato TRV isolate from the Netherlands was found to be identical (Angenent et al., 1989). The nucleotide sequence









of the RNA-1 16 K open reading frame from the Canadian (CAN) TRV isolate also is known (Kawchuk et al., 1997).

The 3'-terminal homologous sequence in TRV-RNAs 1 and 2 may play a role in encapsidation and(or) replication of the viral RNAs (Cornelissen et al., 1986). The fact that this homologous region can vary among different strains suggests that only part of this region, and not the whole region, is needed for one or both of these functions.



Detection of Tobacco Rattle Virus

Detection of TRV by serological tests of the

nonmultiplying-type (NM-type) isolates is impossible using this method because they lack a protein coat. Tobacco rattle virus isolates of the multiplying-type (M-type) were first separated into three serotypes (Harrison and Woods, 1966). Later Harrison and Robinson (1978) grouped serotypes I and II into one and named it serotype I-II, because of the existence of isolates with characteristics of both groups. Harrison et al.(1983) found that of 16 isolates of TRV from narcissus, only four reacted in ELISA and only six reacted in immunosorbent electron microscopy tests when using one antiserum. Samson et al. (1993) detected TRV in only a few









samples using ELISA or western blot in 39 tubers with corky ringspot-like symptoms.

The use of symptoms for diagnosis of CRS on potato tubers is helpful but unreliable. Corky ringspot-like symptoms on potato tubers can be caused by physiological disorders and by potato mop top virus (Calvert and Harrison, 1966), furthermore symptom expression is diverse among TRV strains (Harrison and Robinson, 1986; Robinson and Harrison, 1989).

The RNA-1 of all TRV share conserved nucleotide sequences (Robinson and Harrison, 1985). Thus, the conserved regions can be used as starting points to reproduce the sequences comprised between those regions. The polymerase chain reaction (PCR) is used as a diagnostic tool for viruses with conserved nucleotide sequences. Using the sequence from RNA-1 that codes for the 16 K protein, TRV has been detected by reverse transcription PCR in Nicotiana clevelandii Gray and Narcissus spp. (Robinson, 1992), and in potato tubers (Crosslin and Thomas, 1995; Kawchuk et al., 1997; Weidemann, 1995). Hence, cDNA probes that hybridize to regions of RNA-1 can detect isolates of TRV including NMtype isolates (Harrison and Robinson, 1982; Robinson, 1989).









One drawback of RNA dot-blot hybridization probes for use in potato tubers is that RNA requires complex and time consuming extraction methods (Robinson and Legorburu, 1988).



Objectives of Present Study

The objectives of the present study focused on the

plant-parasitic nematodes in the potato cropping system and on detection of CRS in potato tubers: to determine if resurgence of P. minor after soil fumigation is associated with reduction in numbers of B. longicaudatus; to investigate the vertical distribution of these two species in soil 0-20 and 20-40 cm deep on potato, cabbage, and sorghum-sudangrass; to describe the population changes of B. longicaudatus and P. minor during the sorghum-sudangrass growing season; to determine optimum sample size to detect the presence of CRS on potato tubers, and to determine sample sizes needed to estimate incidence and severity of CRS on potato tubers within given levels of accuracy and precision; to compare the effect of two methods of soil suspension in water (use of a water pressure nozzle vs. stirring soil suspension by hand) on nematode extraction efficiency when using the centrifugal-flotation technique;









and to correlate incidence or mean severity of CRS on potato tubers at harvest with P. minor population densities at different times during the potato growing season.

The following were objectives that focused on detection and characterization of tobacco rattle virus: to identify nematode-transmitted TRV by enzyme-linked-immunosorbent assay (ELISA); to detect TRV in potato tubers by reverse transcription and polymerase chain reaction (RT-PCR); to present the nucleotide sequence of the RNA-1 region of the Florida isolate that encodes for the 16 K protein (Harrison et al., 1987) and its relationship with isolates from Canada and Europe; and to develop a nonradioactive hybridization probe using tuber tissue for rapid detection of TRV.















CHAPTER 2
COMPETITION BETWEEN Paratrichodorus minor AND Belonolaimus longicaudatus ON POTATO AND CABBAGE



Introduction

Potato (Solanum tuberosum L.) production in northeast Florida has a great impact in the winter-spring potato market in the United States, with more than 10,000 ha grown annually (National Potato Council, 1990). Among the most important plant-parasitic nematodes affecting potato quality and yield in northeast Florida are the trichodorid nematode Paratrichodorus minor (Colbran) Siddiqi, and the sting nematode Belonolaimus longicaudatus Rau. The quality of potato tubers is affected by P. minor transmitting the tobacco rattle virus (Walkinshaw et al., 1961). This virus causes the disease known as corky ringspot (CRS) in the United States and spraing in Europe. Depending upon the potato variety affected, symptoms are characterized by circular lesions on the surface of affected tubers and(or) necrosis in the tuber flesh, making tubers unmarketable (Weingartner et al., 1983). Approximately one-third of the









potato farms in northeast Florida are affected by CRS (Weingartner and Shumaker, 1990).

The fumigants, 1,3-dichloropropene (1,3-D) and metam sodium, are used as a cost-effective chemical control for most nematodes that affect potato in northeast Florida. Although soil fumigation has controlled CRS in other parts of the world (Cooper and Thomas, 1971; Dallimore, 1972; Livingston et al., 1976; Maas, 1975), this practice has failed to control CRS and its trichodorid vectors in northeast Florida (Weingartner et al., 1975a; Weingartner et al., 1975b; Weingartner et al., 1976). Population densities of trichodorids in some pathosytems have been observed following soil fumigation to rapidly increase or resurge (Brodie, 1968; Perry, 1953; Rhoades, 1968), to levels exceeding those of unfumigated soils. It was noted in these earlier studies that B. longicaudatus occurred concomitantly with trichodorids. Furthermore, there seemed to be an association between lower numbers of B. longicaudatus and resurgence of trichodorids following soil fumigation, whereas trichodorid population densities seemed static in the presence of higher numbers of B. longicaudatus (Brodie, 1968; Perry, 1953; Rhoades, 1968). Based on these studies,









it was hypothesized that resurgence in numbers of trichodorids following soil fumigation was due in part to reduction in numbers of B. longicaudatus.

The objectives of this study were to determine if resurgence of trichodorids after soil fumigation was associated with reduction in numbers of B. longicaudatus after soil fumigation and also to investigate the distribution of these nematodes at different depths in soil.



Materials and Methods

Experiments were established during the 1993-94 and

1994-95 winter growing seasons at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Soil texture was 95% sand, 2% silt, 3% clay, and 1.4% organic matter at 0-20 cm deep, and 94% sand, 3.6% silt, 2.4% clay, and 1.2% organic matter at 20-40 cm; pH 5.5-6.0. The soil was naturally infested with P. minor and B. longicaudatus. Potato had been grown on the site during each winter and the sorghum-sudangrass hybrid (Sorghum bicolor (L.) Moench x S. arundinaceum (Desv.) Stapf var. sudanense (Stapf) Hitchc.)









had been monocultured during the summer after the potato season for at least 25 years. The potato var. Red LaSoda and cabbage (Brassica oleracea L. var. capitata) var. Bravo were planted manually on 21 December 1993 and 23 January in the 1993-94 and 1994-95 seasons, respectively, at a spacing of 15 cm between potato seed pieces or cabbage seedlings. The experimental design was a two-level split-plot with two nematicide treatments (fumigated with 1,3-D and unfumigated) as the whole plot factor arranged in a complete randomized block design, two crops (potato and cabbage) as the subplots, and two sampling depths (0-20 cm and 20-40 cm) as sub-sub-plots. All treatment combinations were replicated eight times. Experimental units consisted of one 10-m-long row. The fumigant 1,3-D was applied 32 cm deep in row with a single chisel at a rate 56 L/ha on 24 November 1993 and 16 December 1994. Standard practices for insect, disease management, and weed control were used (Hochmuth et al., 1996). The experimental area was fertilized at planting with 1,345 kg/ha of 10-10-10 of N-P-K and side-dressed with 560 kg/ha 45 days after planting with 14-2-12 of N-P-K. Plots were irrigated as needed (Rogers et al., 1975).









Nematode samples consisted of six cores (2.5 cm diam.) taken from each sub-sub plot 0-20 cm and 20-40 cm deep. Samples were taken on 23 November, 21 December, 21 January, 25 February, 21 March, 4 April, and 18 April in the 1993-94 season; and 22 November, 23 January, 27 February, 27 March, and 5 May in the 1994-95 season. The six cores were mixed manually and a 100-cm3 subsample was removed for nematode extraction. The subsamples were wet-sieved through 850-gm and 28-pm pore sieves. The material retained on the 28-gm sieve was processed by a centrifugal-flotation technique (Jenkins, 1964). The extracted nematodes were dispersed in water in a gridded counting dish, identified, and counted.

Data were subjected to analysis of variance for a twolevel split-plot design (Montgomery, 1991) using SAS (SAS Institute, Cary, NC). Mean numbers of B. longicaudatus and P. minor from unfumigated plots were compared within each crop between soil depths of 0-20 cm and 20-40 cm with a paired t-test. Mean numbers of B. longicaudatus in soil at 0-20 cm and P. minor at 20-40 cm were compared within each crop between nematicide-fumigated and unfumigated plots with a paired t-test. Simple linear correlation coefficients were calculated between numbers of B. longicaudatus and P.









minor from each sampling date at the same and opposite depths. Simple linear correlations also were calculated between numbers of B. longicaudatus and P. minor for all sampling dates within depth and crop.



Results

With the exception of 18 April in the 1993-94 season, numbers of B. longicaudatus were significantly different after nematicide fumigation on all sampling dates in the 1993-94 and 1994-95 seasons on potato and cabbage (Tables 21 and 2-2) (P < 0.05). The interaction between nematicide treatment and depth of sampling was significant on several dates in the 1993-94 season and all dates in the 1994-95 season (Tables 2-1 and 2-2) (P < 0.05). Since less than 21% of the population densitiesof B. longicaudatus were between 20-40 cm deep (Table 2-6), it is likely that the magnitud of the difference in B. longicaudatus numbers due to nematicide treatment was greater at 0-20 cm than at 20-40 cm deep. Numbers of P. minor were lower on potato after nematicide treatment in the 1993-94 and 1994-95 seasons except for the three last sampling dates in the 1993-94 season and on 5 May in the 1994-95 season (Table 2-5) (P < 0.05). With the









exception of the last three sampling dates in the 1993-94 season, numbers of P. minor were lower on cabbage after nematicide treatment (Table 2-5) (P < 0.05). In the 1994-95 season, numbers of P. minor were higher in cabbage plots fumigated with nematicide than in plots that were not fumigated (Table 2-5) (P < 0.05).

Belonolaimus longicaudatus numbers were higher in soil 0-20 cm deep on potato and cabbage in both seasons in the unfumigated plots (P < 0.05) with the exception of 21 March in the 1993-94 season on potato (Table 2-6). Belonolaimus longicaudatus numbers at 20-40 cm deep were low in both crops (<4.4 nematodes/100 cm of soil) (Table 2-6). Numbers of P. minor in the unfumigated plots were higher in soil 2040 cm deep on potato in both seasons (P < 0.05) except on 4 April and 18 April in the 1993-94 season (Table 2-6). Numbers of P. minor on cabbage were higher in soil at 20-40 cm than at 0-20 cm deep in both seasons in the unfumigated plots (Table 2-6) (P < 0.05). Except on 5 May 1995, P. minor numbers at 0-20 cm were low in both crops and both seasons (<7.1 nematodes/100 cm3 of soil) (Table 2-6).

Belonolaimus longicaudatus numbers were greater on

cabbage than on potato on 27 February and 27 March in the









1994-95 season (Tables 2-2 and 2-6) (P < 0.05). Paratrichodorus minor numbers were higher on cabbage than on potato on 25 February, 4 April, and 18 April in the 1993-94 season and on several sampling dates in the 1994-95 season (Tables 2-3 and 2-6) (P < 0.05).

Simple correlation coefficients between numbers of B. longicaudatus and P. minor measured either at 0-20 or 20-40 cm deep among all sampling dates were not significant (P > 0.05). Similarly, simple correlation coefficients between numbers of B. longicaudatus in soil 0-20 cm deep and numbers P. minor in soil 20-40 cm deep on the same sampling date were not significant and are not shown (P > 0.05).




Discussion

The greatest concentrations of B. longicaudatus and P. minor in this study occurred at different soil depths. Belonolaimus longicaudatus was most prevalent at 0-20 cm and P. minor at 20-40 cm. Nematicide treatment was effective in reducing densities of both species at both depths. Resurgence of P. minor after soil fumigation was observed on cabbage in the 1994-95 season but this phenomenon did not occur in potato during either season. Potato is considered









a good host only for B. longicaudatus, but cabbage is a good host for both B. longicaudatus and P. minor (Rhoades, 1968; Weingartner et al., 1983).

Increase in numbers of P. minor on cabbage but not on

potato suggests that P. minor resurges after soil fumigation in the presence of a suitable host. Since there were no significant correlations between P. minor and B. longicaudatus densities at the same depth or between densities at 0-20 and 20-40 cm deep, there was no evidence to suggest that resurgence of P. minor in this study was associated with lower numbers of B. longicaudatus after soil fumigation.

Our observations that population densities of B.

longicaudatus in potato and cabbage plots were greater in the upper 20 cm of soil than in deeper soil agrees in general with the findings of Brodie (1976) and McSorley and Dickson (1990a and 1990b), who found that this nematode was more abundant at soil depths of 0-30 cm than at 30-45 cm. Highest densities of P. minor in this study were detected 20-40 cm deep, which also agrees with reports from McSorley and Dickson (1990b) that this nematode is prevalent between 15-45 cm deep on soybean. Brodie (1976) found highest









densities of P. minor between 15-30 cm deep on soybean, and suggested that soil texture influenced the vertical distribution of P. minor as well as the distribution of other nematode genera. Since soil textures in these studies were similar at both depths, it is unlikely that the distribution of P. minor and B. longicaudatus at different depths was influenced by soil texture.

Resurgence of P. minor in the 1994-95 season on cabbage after soil fumigation confirmed previous studies (Perry, 1953; Rhoades, 1968). Populations of P. minor at planting were lower in the 1993-94 than in the 1994-95 season, and this could explain the lack of resurgence in the 1994-95 season. Weingartner et al. (1983) reported resurgence of P. minor on potato after soil fumigation due to migration from deeper soil.

Resurgence of P. minor occurred on cabbage even though correlation analyses failed to show association of P. minor with B. longicaudatus. Data from these experiments also suggest that these nematodes have a distinctive depth preference and population densities seemed to be independent of one another. These observations suggest that factors other than competition between P. minor and B. longicaudatus are responsible for resurgence of P. minor following soil






44


fumigation. It is possible that elimination and the resulting reduced competition of other organisms allows resurgence of P. minor. Additional experiments are needed to determine the effect of soil fumigation on other organisms that might affect populations densities of P. minor.








Table 2-1. Effect of crop, depth, and nematicide on numbers of Belonolaimus longicaudatus per 100 cm of soil. Mean squares (MS) and F-values (F) from analysis of variance for treatment main effects and treatment interactions; 1993-94 season.



23 November 21 December 21 January 25 February
SOV DF MS F MS F MS F MS F

Block (B) 7 161.21 32.69 7.52 19.78

Nem. (N) 1 - - 446.26 18.98** 297.56 29.68** 144.00 9.55**

Error a 7 36.75 23.51 10.02 15.07

Crop (C) 1 7.56 0.04 0.76 0.02 4.00 1.58 0.00 0

C x B 7 173.81 32.09 2.53 13.50

N x C 1 39.06 0.50 1.89 0.12 6.25 1.82 1.56 0.09

Error b 7 79.09 15.99 3.43 17.49

Depth (D) 1 5,929.00 62.20** 375.39 73.02** 264.06 65.58** 72.25 3.8

D x B 7 95.32 5.14 4.03 19.03

D x N 1 20.25 0.38 123.76 12.72** 175.56 29.84** 52.56 4.07

D x N x B 7 52.64 9.73 5.88 12.92

C x D 1 0.06 0.00 1.26 0.14 6.25 1.43 5.06 0.41

D x C x B 7 141.81 9.16 4.36 12.42

Nx C x D 1 60.06 1.33 8.26 1.06 4.00 0.56 16.00 0.95
Error c 7 45.03 7.80 7.18 16.79


*Significant (P < 0. Source of variation Nematicide


05), **significant (P < 0.


01) according to the analysis of variance.








Table 2-1. Effect of crop, depth, and nematicide on numbers of Belonolaimus longicaudatus per 100
3
cm of soil. Mean squares (MS) and F-values (F) from analysis of variance for treatment main effects and treatment interactions; 1993-94 season (Continued).


21 March 4 April 18 April
SOV DF MS F MS F MS F Block (B) 7 2.39 9.38 25.51 Nem. (N) 1 92.64 34.16** 72.25 9.63** 74.39 4.73 Error a 7 2.71 7.50 15.71 Crop (C) 1 19.14 2.44 7.56 3.17 11.39 1.44 C x B 7 7.85 2.38 7.93 N x C 1 11.39 4.04 0.25 0.04 87.89 3.33 Error b 7 2.82 7.14 26.35 Depth (D) 1 40.64 3.87** 189.06 58.33** 582.01 37.60** D x B 7 10.50 3.24 15.48 D x N 1 8.26 0.91 36.00 4.29 74.39 9.39* D x Nx B 7 9.12 8.39 7.93 C x D 1 0.76 0.11 10.56 3.12 3.51 0.55 D x C x B 7 6.98 3.38 6.41 N x C x D 1 5.64 1.16 0.00 0.00 62.01 2.44 Error c 7 4.85 2.46 25.41


*Significant (P < 0.05), **significant Source of variation Nematicide


(P s 0.01) according to the analysis of variance.








Table 2-2. Effect of crop, depth, and nematicide on numbers of Belonolaimus longicaudatus per 100 cm of soil. Mean squares (MS) and F-values (F) from analysis of variance for treatment main effects and treatment interactions; 1994-95 season.


22 November 23 January 27 February
SOV DF MS F MS F MS F Block (B) 7 13.01 14.75 29.20 Nem. (N) 1 - - 217.56 17.42** 576.00 19.76** Error a 7 30.91 12.49 29.14 Crop (C) 1 2.64 0.09 16.00 4.15 27.56 6.04* C x B 7 27.82 3.85 4.56 N x C 1 2.64 0.23 5.06 1.13 20.25 3.32 Error b 7 11.60 4.49 6.10 Depth (D) 1 1,251.39 108.84** 240.25 13.93** 600.25 26.81** D x B 7 11.50 17.25 22.39 D x N 1 19.14 0.86 150.06 9.34* 495.06 21.33** D x N x B 7 22.32 16.06 23.20 C x D 1 1.89 0.06 16.00 3.34 30.25 4.73 Dx C x B 7 29.93 4.78 6.39 N x C x D 1 5.64 0.34 7.56 1.03 22.56 0.14 Error c 7 16.46 7.34 8.28


*Significant (P < 0.05) Source of variation Nematicide


**significant


(P < 0.01) according to the analysis of variance.








Table 2-2. Effect of crop, depth, and nematicide on numbers of Belonolaimus longicaudatus per 100
3
cm of soil. Mean squares (MS) and F-values (F) from analysis of variance for treatment main
effects and treatment interactions; 1994-95 season (Continued).


27 Marc


SOV

Block (B)

Nem. (N) Error a

Crop (C) C x B Nx C Error b

Depth (D) Dx B D xN DxNx B

CxD D x Cx B Nx CxD Error c


MS

101.10

1,827.56 120.99 430.56 26.42 297.56 41.56 3,025.00 102.21 1,722.25 122.03 420.25 26.89 289.00 42.21


h -5 May F MS F 106.75

15.10** 3,335.06 11.49**

290.20

16.30** 612.56 4.87

125.78

7.16* 400.00 3.34 119.85

29.59** 6,480.25 63.69**

101.75

14.11** 2,425.56 9.42**

257.42

15.63** 315.06 2.33

135.28

6.85* 272.25 2.23

121.96


*Significant (P < 0.05), **signif fSource of variation VNematicide


icant (P < 0.01)


according to the


analysis of variance.








Table 2-3. Effect of crop, depth, and nematicide on numbers of Paratrichodorus minor per 100 cm of soil. Mean squares (MS) and F-values (F) from analysis of variance for treatment main effects and treatment interactions; 1993-94 season.



23 November 21 December 21 January 25 February

SOV' DF MS F MS F MS F MS F

Block (B) 7 236.57 159.61 151.21 9.81

Nem. (N) 1 56.25 0.17 1,156.00 10.99** 1,130.64 15.95** 60.06 4.20

Error a 7 336.25 105.14 70.89 14.31

Crop (C) 1 27.56 0.97 90.25 1.80 1.89 0.09 27.56 5.73*

C x B 7 28.42 50.25 21.64 4.81

N x C 1 1.56 0.13 9.00 0.26 9.76 0.15 1.56 0.74

Error b 7 12.42 34.36 65.94 2.09

Depth (D) 1 870.25 24.29** 742.56 7.55* 1,064.39 6.79* 90.25 90.25**

D x B 7 35.82 98.35 156.85 1.00

D x N 1 225.00 0.88 217.56 3.85 708.89 8.62* 20.25 2.25

D x N x B 7 257.14 56.56 82.21 9.00

C x D 1 7.56 0.14 0.06 0.00 5.64 0.17 1.00 0.36

D x C x B 7 55.28 47.49 32.32 2.75

N x C x D 1 76.56 1.23 45.56 2.09 0.76 0.01 1.00 0.31
Error c 7 63.13 21.78 88.87 3.17


*Significant (P < 0. Source of variation Nematicide


05), **significant


(P < 0.01) according to the analysis of variance.








Table 2-3. Effect of crop, of soil. Mean squares (MS) and treatment interactions;


depth, and nematicide on numbers of Paratrichodorus minor per 100 cm3 and F-values (F) from analysis of variance for treatment main effects 1993-94 season (Continued).


21 March 4 April 18 April

SOV DF MS F MS F MS F Block (B) 7 18.49 5.33 33.23 Nem. (N) 1 20.25 9.00* 21.39 2.02 23.76 1.81 Error a 7 2.25 10.60 13.12 Crop (C) 1 20.25 2.37 153.14 49.90** 284.76 6.34* C x B 7 8.53 3.07 44.90 N x C 1 18.06 8.19* 6.89 1.05 11.39 2.20 Error b 7 2.20 6.53 5.18 Depth (D) 1 60.06 6.73* 112.89 23.43** 0.01 0.00 Dx B 7 8.92 4.82 6.59 D x N 1 2.25 0.45 0.01 0.00 1.26 0.13 Dx Nx B 7 4.96 9.80 9.76 C x D 1 0.00 0.00 50.76 22.41** 5.64 1.05 D x C x B 7 2.14 2.26 5.35 N x C x D 1 3.06 0.62 0.01 0.00 0.76 0.07 Error c 7 4.92 7.51 11.12


*Significant (P < 0.05), **significant tSource of variation SNematicide


(P < 0.01) according to the analysis of variance.








Table 2-4. Effect of crop, depth, and nematicide on numbers of Paratrichodorus minor per 100 cm of soil. Mean squares (MS) and F-values (F) from analysis of variance for treatment main effects and treatment interactions; 1994-95 season.


22 November 23 January 27 February
SOV DF MS F MS F MS F Block (B) 7 54.57 62.67 43.18 Nem. (N) 1 293.26 3.49 121.00 2.11 1.26 0.09 Error a 7 84.01 57.32 13.80 Crop (C) 1 50.76 1.13 225.00 5.28* 34.51 2.64 C x B 7 45.08 42.61 13.05 N x C 1 15.01 0.15 370.56 7.96* 192.51 9.96** Error b 7 100.26 46.53 19.34 Depth (D) 1 1,097.26 21.63** 729.00 12.03** 862.89 17.46** D x B 7 50.73 60.61 49.43 D x N 1 26.26 0.40 52.56 1.13 0.01 0.00 D x N x B 7 65.09 46.67 18.12 C x D 1 21.39 0.81 150.06 3.23 43.89 4.15 D x C x B 7 26.50 46.45 10.57 N x C x D 1 34.51 0.51 225.00 4.54 135.14 6.67* Error c 7 67.69 49.60 20.25


*Significant (P < 0.05), Source of variation Nematicide


**significant


(P < 0.01)


according to the analysis of variance.








Table 2-4. Effect of crop, depth, and nematicide on numbers of Paratrichodorus minor per 100 cm of soil. Mean squares (MS) and F-values (F) from analysis of variance for treatment main effects and treatment interactions; 1994-95 season (Continued).


27 March 5 May
SOV DF MS F MS F Block (B) 7 254.68 274.89 Nem. (N) 1 199.51 1.77 1,580.06 6.06* Error a 7 112.59 260.63 Crop (C) 1 819.39 5.67* 14,884.00 58.95** C x B 7 144.46 252.50 N x C 1 1016.01 7.50* 770.06 2.08 Error b 7 135.51 369.49 Depth (D) 1 2013.76 15.92** 1,914.06 15.69** D x B 7 126.48 121.99 D x N 1 185.64 1.40 289.00 4.09 Dx Nx B 7 132.64 70.71 C x D 1 228.76 1.72 663.06 3.15 Dx C x B 7 133.19 210.56 N x C x D 1 695.64 5.16 42.25 0.26 Error c 7 134.93 162.25


*Significant (P < 0.05), **significant (P < 0.01) according to the Source of variation Nematicide


analysis of variance.








Table 2-5. Number of Belonolaimus longicaudatus per 100 cm of soil 0-20 cm deep and Paratrichodorus minor per 100 cm3 of soil 20-40 cm deep under fumigated (+) and unfumigated (-) plots with 1,3-D on potato and cabbage; 1993-94 and 1994-95 seasons.


Potato Cabbage B. longicaudatus P. minor B. longicaudatus P. minor

+ - + + + 1993-94
23 November 24.8 19.2 13.8 17.0 20.6 22.0 9.3 17.5 21 December 3.6* 10.6 4.8* 16.1 2.6* 11.7 1.6* 14.7 21 January 0.9* 9.6 1.4* 17.0 0.9* 7.4 2.9* 17.4 25 February 0.1* 6.3 1.5* 4.0 0.9* 4.1 2.5* 6.1 21 March 1.4* 4.8 3.1 3.2 0.7* 3.6 3.6 5.0 4 April 3.0* 6.5 1.0 1.5 1.4* 5.1 5.3 7.0 18 April 6.0 6.0 1.5 2.4 3.0* 11.6 4.5 6.6 1994-95
22 November 8.9 10.0 14.5 11.3 8.6 11.8 14.0 6.0 23 January 0.5* 6.0 4.3* 17.5 1.2* 9.2 6.1* 2.1 27 February 0.4* 9.6 6.1* 12.8 0.7* 14.6 9.4* 3.2 27 March 2.5* 15.0 5.0* 12.0 4.2* 33.8 30.0* 9.0 5 May 8.0* 25.6 10.1 4.5 9.5* 45.3 55.6* 21.4


*Significantly different from unfumigated (-) plots (P < 0.05), according to a paired t-test.








Table 2-6. Number of Belonolaimus longicaudatus per 100 cm of soil and Paratrichodorus minor per 100 cm3 of soil 0-20 cm and 20-40 cm deep in unfumigated plots on potato and cabbage; 1993-94 and 1994-95 seasons.


Potato Cabbage B. longicaudatus P. minor B. longicaudatus P. minor

0-20 cm 20-40 cm 0-20 cm 20-40 cm 0-20 cm 20-40 cm 0-20 cm 20-40 cm 1993-94

23 November 19.2 3.0* 7.4 17.0* 22.0 2.0* 4.9 17.5* 21 December 10.6 4.0* 7.4 16.1* 11.7 3.1* 2.5 14.7* 21 January 9.6 1.1* 3.0 17.0* 7.4 1.1* 1.7 17.3* 25 February 6.3 0.7* 1.2 4.0* 4.1 2.0* 2.1 6.1* 21 March 4.7 3.3 0.6 3.3* 3.6 0.5* 3.9 5.0

4 April 6.5 0.7* 1.2 1.5 5.1 1.0* 2.6 7.0* 18 April 6.0 0.3* 1.2 2.4 11.6 1.0* 7.1 6.6 1994-95
22 November 10.0 1.0* 1.7 11.3* 11.7 0.9* 1.6 6.0* 23 January 6.0 0.7* 2.1 17.5* 9.3 0.6* 0.4 2.1*

27 February 9.6 0.5* 0.9 12.7* 14.6 0.4* 0.5 3.3

27 March 15.0 0.3* 2.0 12.0* 33.8 0.4* 4 9.0* 5 May 25.6 1.7* 2.6 4.5* 45.3 4.4* 21.4 32.8*


*Significantly different from 0-20 cm depth (P < 0.05), according to a paired t-test.















CHAPTER 3
SEASONAL VARIATION OF Paratrichodorus minor AND Belonolaimus
longicaudatus IN SORGHUM-SUDANGRASS



Introduction

Most fields in northeast Florida (NEF) are planted to potato (Solanum tuberosum L.) during the spring followed by sorghum-sudangrass hybrid (Sorghum bicolor (L.) Moench x S. arundinaceum (Desv.) Stapf var. sudanense (Stapf) Hitchc.) as a cover crop in the summer (Weingartner et al., 1993). Cabbage (Brassica oleracea L. var. capitata L.), although less important than potato, is another cash crop planted during the winter-spring season. Among the most important plant-parasitic nematodes parasitizing potato and cabbage in NEF are Paratrichodorus minor (Colbran) Siddiqi, and Belonolaimus longicaudatus Rau (Rhoades, 1968; Weingartner et al., 1983).

Because of potential restrictions in nematicide use, more attention is being given to the possibility of integrated control including crop rotation and other










cropping sequences (Barker, 1991; Johnson and Feldmesser, 1987; Sasser and Uzzell, 1991). The choice of rotational crops that are nonhost to plant-parasitic nematodes can be used as a management strategy for improving yield of the following crop (Noe et al., 1991; Nusbaum and Ferris, 1973; Rhoades, 1976; Trivedi and Barker, 1986). Sorghum could be particularly beneficial in rotation systems involving vegetables crops where root-knot nematodes (Meloidogyne spp.) are the main nematodes limiting production (McSorley et al., 1986). Furthermore, sorghum reduces erosion by wind and rain, increases organic matter content, and improves soil stability (McSorley et al., 1986; Myhre, 1957). However, P. minor and B. longicaudatus reproduce readily on sorghum (Rhoades, 1976; Rhoades, 1984; McSorley and Gallaher, 1991) and could affect subsequent cabbage or potato crops (Rhoades, 1968; Weingartner et al., 1983).

When selecting cover crops, it is important to

understand the effect of those crops on nematode population dynamics. Knowledge of the population dynamics of nematodes on the cover crop and the optimum sample depth for an accurate detection are important. Nematodes move in soil water, and laboratory studies show that soil moisture










content has an effect on the abundance of Trichodorus spp. (Wallace, 1971; Mojtahedi et al., 1997; Harrison, 1975). Seasonal fluctuations and vertical distribution of P. minor and Pratylenchus spp. may be associated with variation in soil moisture (Brodie, 1976; Kable, 1968; Harrison, 1975). Soil temperatures also may have an effect on the vertical and seasonal distribution of P. minor and B. longicaudatus (Brodie, 1976).

Belonolaimus longicaudatus was predominantly found in the upper 30 cm of the soil profile on soybean (Glycine max

(L.) Merr.) and maize (Zea mays L.) (Brodie, 1976; McSorley and Dickson, 1990a; McSorley and Dickson, 1990b), whereas P. minor was more abundant on soybean at 15-45 cm deep (McSorley and Dickson, 1990a; Chapter 2). In a single season experiment, Harrison (1975) found P. minor to be more abundant in the upper 20 cm of soil from a field planted to sorghum-sudangrass. However, there are no reports of the depth distribution of B. longicaudatus on sorghumsudangrass. The objective of this research was to compare population changes of B. longicaudatus and P. minor in soil 0-20 cm and 20-40 cm deep on sorghum-sudangrass. Similarity









of trends between precipitation or soil temperature and population changes of B. longicaudatus and P. minor during the sorghum-sudangrass growing season were also examined.



Materials and Methods

Experiments were established from 1992 to 1996 in two different fields (about 500 m apart) at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Field A was designated as bed 12 (new land), and field B as bed 9 (old land). Soil texture in field A was 94.6% sand, 1% silt, 3% clay, and 1.4% organic matter; with pH 5.5-6.0. The soil was naturally infested with P. minor and B. longicaudatus. Sorghum-sudangrass hybrids had been used as cover crops during the summer months following the potato season for at least 25 years in field A and for the last 10 years in field B. In field A, each plot consisted of one 10-m-long row. In field B, each plot consisted of four 30.5-m-long rows 101 cm apart. Plots were irrigated as needed (Rogers et al., 1975).










In field A, soil samples consisted of six cores (2.5 cm diam.) taken 0-20 cm and 20-40 cm deep during the 1994 and 1995 sorghum-sudangrass seasons on different dates (Table 31). In field B soil samples consisted of 20-25 cores (2.5 cm diam.) taken 0-20 cm deep during the 1992, 1993, 1994, 1995, and 1996 sorghum-sudangrass seasons as summarized in Table 3-1. The cores were mixed manually and a 100-cm3 subsample was removed for nematode extraction. The subsamples were wet-sieved through 850-Am and 28-m pore sieves. The material retained on the 28-m sieve was processed by a centrifugal-flotation technique (Jenkins, 1964). The extracted nematodes were dispersed in water in a gridded counting dish, identified, and enumerated. The ratio between population densities at the end of the sorghum-sudangrass growing season (Pf) and preplant population densities (Pi) of P. minor and B. longicaudatus was calculated.

Rainfall and daily minimum and maximum soil

temperatures at 10 cm deep were recorded throughout the sorghum growing seasons at the University of Florida Hastings Research and Education Center weather station.









Table 3-1. Preceding crops, harvest dates of preceding crops, sorghum planting dates, sorghum varieties, soil sample dates, and sorghum harvest dates for the 1994 and 1995 seasons in field A, and for the 1992, 1993, 1994, 1995, and 1996 seasons in field B.


Field A Field B 1994 1995 1992 1993 1994 1995 1996 Previous Potato Potato- Potato Potato Potato Potato Potato
crop cabbage

Harvested 7 June 25 May 2 June 27 May 3 June 30 May 29 May

Sorghum 23 June 21 June 6 July 6 July 23 June 21 June 2 June
planted
Cover crops DeKalb DeKalb Grazer NL Sweettest DeKalb DeKalb DeKalb SX-17' SX-17t (sorghum) (sorghum) SX-17 SX-17t SX-17f

Soil 23 June 18 July 2 July 27 May 3 June 10 May 29 May samples 4 Aug. 18 Aug. 5 Aug. 4 Aug. 25 July 25 July 6 Aug.
30 Aug. 22 Sep. 4 Sep. 2 Nov. 6 Oct. 16 Oct. 7 Nov.
6 Oct.

Sorghum- 7 Oct. 16 Oct. 6 Oct. 4 Nov. 7 Oct. 16 Oct. 7 Nov.
sudangrass harvestedt


tSorghum-sudangrass was chopped and incorporated in the soil as a mulch. tSorghum-sudangrass variety.









Results and Discussion

Season Variation in Population Densities of P. minor

Field A. 1994 season: Paratrichodorus minor numbers were highest on 3 August in this season and population densities of P. minor were greater at 0-20 cm than at the 20-40 cm deep (Figure 3-la).

1995 season: With the exception of 18 July, population densities of P. minor were greater at 20-40 cm than at the 0-20 cm deep (Figure 3-1b).

During both seasons, populations densities of P. minor in soil from this field were highest in August. The ratio between population densities at the end of the sorghumsudangrass growing season and preplant population densities of P. minor before planting (Pf/Pi) was greater than 1.0 at both depths and in both seasons (Table 3-2).



Field B. Population densities of P. minor showed similar trends in the 1992 and 1996 sorghum-sudangrass growing seasons. Numbers peaked on 4 September in 1992 and on 6 August in 1996 and decreased toward the end of both seasons. During the 1993, 1994, and 1995 sorghum-sudangrass









growing seasons, P. minor numbers peaked at the end of the seasons between October and November (Figure 3-2a).

Paratrichodorus minor population densities increased

during the five sorghum-sudangrass growing seasons (Pf/Pi > 1.0) (Table 3-2), with highest population densities (61-108

3
P. minor/100 cm of soil) from August to November (Figure 32a).



Season Variation in Population Densities of B. lonqicaudatus

Field A. Highest numbers of B. longicaudatus occurred on 30 August and 18 August at both depths in the 1994 and 1995 seasons, respectively (Figures 3-1b and 3-Ic). With exception of the 20-40 cm depth in 1995, B. longicaudatus population densities increased during the 1994 and 1995 sorghum-sudangrass growing seasons (Table 3-2). During both seasons, population densities of B. longicaudatus were greater at the depth of 0-20 than at 20-40 cm (Figures 3-1b and 3-ic). Numbers of B. longicaudatus were, however, more evenly distributed at both depths during the 1995 than in the 1994 season (Figure 3-1d).









Field B. With the exception of the 1994 season, B.

longicaudatus numbers increased (Pf/Pi > 1.0) during all the sorghum-sudangrass growing seasons (Table 3-2). Belonolaimus longicaudatus numbers were lower (<10 nematodes/100 cm of soil) during the 1992, 1994, and 1995 sorghum-sudangrass growing seasons (Figure 3-2b) than during the 1993 and 1996 seasons. Population densities on sorghumsudangrass peaked from August to November in this field (Figure 3-2b).

Both P. minor and B. longicaudatus increased in

densities in fields A and B on sorghum-sudangrass. Highest population densities for both species were observed between the first week of August and the first week of November. Substantial numbers of B. longicaudatus and especially of P. minor were found at 20-40 cm deep in soil from field A. Sampling to a depth of 40 cm would provide a better estimation of the population densities of these nematodes.

Relative abundance of P. minor at the two depths was not consistent between seasons. During the 1994 season in site A, more than 50% of P. minor numbers were found in soil 0-20 cm deep, whereas in the following season, more than 50% of the population was found 20-40 cm deep. Although several









previous studies on the depth distribution of trichodorids report greatest numbers of nematodes at depths of 15-45 cm (McSorley and Dickson, 1990a; McSorley and Dickson, 1990b; Szczygiel and Hasior, 1972), others cite trichodorids as being more abundant in the top 20 cm of soil (Boag, 1981; Harrison, 1975). Our observations that the greatest number of B. longicaudatus were in the top 20 cm of soil agree with results of several other studies (McSorley and Dickson, 1990a; McSorley and Dickson, 1990b; Todd, 1989; Chapter 2).

Trends were inconsistent between population changes of B. longicaudatus or P. minor and total monthly rainfall (Figure 3-3) or mean monthly soil temperatures from the site during the sorghum-sudangrass growing season (Figure 3-4). The use of irrigation and other factors may have masked any effect of rainfall and temperature on nematode densities.

Paratrichodorus minor and B. longicaudatus may be sensitive to other factors in the soil besides rain and temperature, making population changes difficult to predict. Pasteuria spp. were observed parasitizing B. longicaudatus, which confirms previous reports of B. longicaudatus as host of Pasteuria spp. (Dickson et al., 1994; Giblin-Davis et al., 1990; Hewlett et al., 1994). Pasteuria spp. also might









affect P. minor populations, since P. minor has been cited as host of Pasteuria spp. in Florida (Birchfield and Antonopoulos, 1978). Metals such as Cu and Mn, and soil compaction were associated with changes in trichodorid population densities (Boag, 1985; Cooper, 1971). More research is needed to define other variables such as presence of biological antagonists, chemical composition of the soil, pH, soil compaction, density of root biomass, height of the water table, all of which may affect the seasonal variation of these nematodes in agricultural north Florida fields. Since P. minor and B. longicaudatus increased in the sorghum-sudangrass planting during the summer, other cover crops that may reduce population densities of these nematodes should be studied (McSorley and Gallaher, 1992). More cover crop options need to be offered to growers in this region.









Table 3-2. Ratio between population densities at the end of the sorghum-sudangrass growing season (Pf) and population densities before planting (Pi) for Belonolaimus longicaudatus (BL) and Paratrichodorus minor (PM) in soil 020 and 20-40 cm deep in field A and soil 0-20 cm deep in field B.



Pf/Pi

Field A Field B 0-20 cm 20-40 cm 0-20 cm Season BL PM BL PM BL PM 1992 - - - - 11.0 4.6 1993 - - - - 15.9 217.0 1994 1.7 7.3 16.0 2.2 0.2 3.6 1995 1.2 1.2 0.2 3.8 40.0 13.0 1996 - - - - 2.1 32.0
















. 30 30 02s
U 20 i1 10


5


0 6-19







12 -


74 7-19 8-3

Sample dates


8-18 92


0
30




S20


' 5 10 5-


-0- 21)c


25 4


7.19 8-3 8-18

Sample dates


0 .


7-4 7-19 8-3 8-18

Sample dates


9-2 9-17 10-2


9-2 9-17 10-2


Figure 3-1. Nematode densities/100 cm3 of soil at 0-20 and 20-40 cm deep on sorghum-sudangrass in field A. a) Paratrichodorus minor, 1994 season. b) P. minor, 1995 season. c) Belonolaimus longicaudatus, 1994 season, d) B. longicaudatus, 1995 season.


'--0 20 -'
-a- 20-40 cm i


P. minor 1994


74 7-19 8-3 8-18

Sample dates


B. longicaudatus 1994

- 0-- 20 cm
-20-40 cm


--0 -20 em
--20-40 em,


B. longicaudatus 1995


















120

a

loo P. minor



0
o
80
'4J
0
E
O
U ~--1*-1993

0 61994
-x- 19951
-+19961 060
20



ad






4-26 5-16 6-5 6-25 7-15 8-4 8-24 9-13 10-3 10-23 11-12

Sample dates
b
0















B. longicaudatus
1992













- 1993


19
- 0






























Sample dates


Figure 3-2. Nematode densities/100 cm3 of soil on sorghumsudangrass in field B, 1992, 1993, 1994, 1995, and 1996 seasons. 0a) Paratrichodorus minor b) Belonolaimus longicaudatus.
60


B. lSample dates




7 0

0







30
U
0
0

230




0
5- -0 64 61 - -9 83 818 92 91 02 1-7 1- 11








5-5ngas 5i2 fiel BI 741992,3 193 1991, 195, and 1996 season6




a) Paratrichodorus minor. b) Belonolaimus longicaudatus.










S1992 30 1993 0 1994 25 11995 ~ E 1996
U

20
0

.J
S15
-4

a4i 10


5
0




May June July August September October November

Figure 3-3. Total monthly precipitation at the Yelvington Farm, Hastings, Florida during the sorghum-sudangrass growing season: 1992, 1993, 1994, 1995, and 1996 seasons.














S.- -------.1994
- 1995 .. .. .. ... .... -x- -- 1995
S 25 + 1996


20
E

15
-r
0 U)
10



5


0
May June July August September October November



Figure 3-4. Average monthly soil temperatures at 10 cm deep during the sorghum-sudangrass growing season; 1992, 1993, 1994, and 1995 seasons.















CHAPTER 4
ESTIMATES OF SAMPLE SIZE FOR DETECTION AND ESTIMATION OF INCIDENCE AND SEVERITY OF CORKY-RINGSPOT-INFESTED POTATO




Introduction


Corky ringspot (CRS), caused by tobacco rattle virus, is an important disease found on one-third of the potato (Solanum tuberosum L.) farms in northeast Florida (Weingartner and Shumaker, 1990). Trichodorid nematodes transmit the virus (Walkinshaw et al., 1961) by feeding on healthy tubers (Van Hoof, 1964) after they acquire the virus, possibly from other infected hosts. Symptoms result in cosmetic damage, making the potato unmarketable (Weingartner et al., 1983). External and internal symptoms are usually, but not always, characterized by necrosis of the skin or flesh in the form of arcs or rings (Weingartner, 1981).

Economic losses due to CRS on potato depend on the

percentage of affected tubers (incidence) and the severity of infection (Weingartner and Shumaker, 1990a). The use of nematicides is a common practice in northeast Florida to









lessen severity of infection and can reduce losses due to CRS by up to 25% (Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b). The potato chip industry, farmers, and researchers rely on the information obtained from potato tuber samples to estimate incidence and severity of CRS on potato (Weingartner et al., 1983; Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b). Since decision making is based on information obtained from the samples, it is essential to understand the relationship between sample size and accuracy (exactness) and precision (variability) of the information in the sample. In the Pacific Northwest, an entire harvest may be rejected if potato tuber samples with 5% to 10% CRS symptoms are detected (Williams et al., 1996).

The proportion of potato tubers affected with CRS in

the sample is used to estimate the incidence of CRS in that field. Estimators, which are formulas or rules, are used to estimate parameters to make inferences and(or) decisions about a population (Mendenhall et al., 1990). In this study, the populations of interest are the percentage (incidence) of potato tubers affected with CRS and the extent to which each potato tuber is affected with CRS









(severity). Point estimators (e.g. a number such as the sample mean x) use information from random variables (e.g. number of potato tubers affected with CRS) contained in the sample. Therefore an estimate also is a random variable (or a statistic) with a probability distribution called the sampling distribution of the estimator (Mendenhall et al., 1990). Sampling distributions are used to determine precision and accuracy of an estimate, such as x, estimating p (the true mean) of the entire population of CRS-affected tubers. Similarly the estimate S2 (the sample variance) is used to estimate a2 (the variance). The accuracy and precision of the information in the sample will set the reliability of the estimates x and S2.

Determination of sample size is crucial to secure a desired level of precision. Since confidence intervals decrease as the sample size increases, larger samples provide more precise information, however, resulting in a greater work load creating higher costs (Freund and Wilson, 1993). Acceptable costs and sample size will vary depending upon the level of precision needed and nature of the study. The optimum sample size will be the one that provides the









most precise information for a particular purpose at a minimum cost.

The objective of this research was to estimate optimum sample size to detect the presence of CRS, and to determine sample sizes needed to estimate incidence and severity of CRS within given levels of accuracy and precision.



Materials and Methods

Experiments were established during two winter growing seasons from 1993 to 1995 at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Soil texture was 95% sand, 2% silt, 3% clay, and 1.4% organic matter; pH 5.56.0. The soil was naturally infested with the trichodorid nematode, P. minor (Colbran) Siddiqi, and had a history of problems with CRS. Potato had been grown on the site during each winter and a sorghum-sudangrass hybrid (Sorghum bicolor

(L.) Moench x S. arundinaceum (Desv.) Stapf var. sudanense (Stapf) Hitchc.) had been used as a cover crop during the summer after the potato season for approximately 25 years. The potato var. Red LaSoda was used in the study because









this variety exhibits typical external and internal tuber symptoms of CRS. Potato tubers were planted manually on 21 December 1993 for the 1993-94 season and 23 January 1995 for the 1994-95 season. Potato seed tubers were planted manually at a spacing of 15 cm in single-row, 10-m-long plots. The soil fumigant 1,3 dichloropropene (1,3-D) was applied 32 cm deep in row with a single chisel at a rate of 56 L/ha on 24 November 1993 and 16 December 1994 into selected plots, to give a total of eight treated plots and eight untreated plots. Standard practices for fertilizer application, weed control, and insect and disease management were used (Hochmuth et al., 1996). Plots were irrigated as needed (Rogers et al., 1975).

All potato tubers from each plot were harvested

mechanically on 7 June 1994 and 25 May 1995. Potato tubers were washed and graded to size and all the tubers (>3.0 cm diam.) harvested from each plot were counted. Individual potato tubers were examined for external and internal symptoms of CRS. External and internal incidence (e. g. proportion) of CRS was determined by dividing the number of potato tubers with symptoms by the total number of potato tubers per plot. In addition, internal and external









severity index values from 0 to 10 were assigned to each potato. Severity was assessed by cutting the potato into eight pieces and examining each piece for internal and external symptoms. Severity values from 0 to 8 equaled the number of potato pieces with symptoms, and then 9 = all pieces showing symptoms with 25% to 50% of the surface affected; 10 = all pieces with symptoms >50% of the surface necrotic.

A data set consisting of the total number of potato

tubers, internal and external presence of CRS symptoms, and internal and external severity index for all tuber from all plots, was created. This information was recorded from all potato tubers in every plot. Random potato tuber samples of different sizes were simulated from the data set for each plot using several SAS (SAS Institute, Cary, NC) procedures with the assistance of Mr. Jay Harrison from the Department of Statistics at the University of Florida. The following variables were used in the program for the simulation of each sample: plot number, total number of potato tubers from that plot, sample size (5, 7, 10, 12, 15, 17, 20, 22, 25, 27, 30, or 35 potato tubers), and an arbitrary number to be used as a starting point to generate a series of random









numbers equal to the sample size. These random numbers were used to select specific potato tubers from the data set, to generate a sample of the desired size. The sample mean (x) and standard error of the mean (Sx) were then calculated. Percentage of deviation from the true mean (g), calculated as [(x - p)/] x 100, and Sx of incidence (internal and external), and severity (internal and external) were estimated from each sample in a plot. The p of a plot was available for incidence (internal and external) and severity (internal and external) because the entire population of potato tubers from that plot had been examined. Each arbitrary sample size for a given plot was simulated 30 times. Averages of percentage of deviation from the mean (PDM) and Sx for each sample size in a given plot were calculated from the 30 simulations of a given sample size.

Thirty samples of potato tubers of size n were used to estimate g and a2. The samples yielded 30 random values of x and S (variance of the sample mean) with their own
x

probability distributions. The 30 random values x have a G2
normal distribution with mean p and variance -, and the 30
n









random values S3 have a chi-square distribution with n-1
x

degrees of freedom times a constant or K x X2n ,, provided we are sampling from a normal population with mean p and variance a (Mendenhall et al., 1990). Since x and - are

2
unbiased estimators of p and - respectively, the expected
n

a2
value of x is equal to p (E(x) = 4) and E(S') I n

Three plots representing maximum, minimum, and average incidence (internal and external) and severity (internal and external) values were selected for further analysis. These plots were selected to represent the entire range of possible values in our experiments. For each of these plots, the sample statistics percentage of deviation from the mean (PDM) and Sx were correlated with sample size. Power models of the form y = an-b were fit to the relationship between PDM or Sx and sample size.

Simple linear regression was calculated between true

external incidence and true mean internal severity from the 32 plots (16 plots per year x 2 years).

Binomial probabilities of detecting at least one potato tuber with CRS symptoms with a sample size of 20 potato









tubers were calculated for each plot (McSorley and Littell, 1993). The formula used was P(f) = p q(n-f) = 1 q ; where n =20, f = number of potato tubers with symptoms, p = fraction of potato tubers from the plot with symptoms, and q = 1 - p. For example, P(f) = 0.86, means that there is a probability of 86% of detecting an infected potato when taking a sample of size 20. The potato tubers with symptoms were assumed to be randomly distributed, which is more likely to happen once the potato tubers are harvested and put into bags.



Results

For a given plot, the relationship between the sample size (n) for mean severity (internal or external) and for incidence (internal or external) and deviation of the sample mean from the true mean p for that plot (y) was described by a negative power function of the form y = an-b (Figures 4la, 4-1b, 4-2a, and 4-2b).

Increasing the sample size for all these relationships

improved the accuracy (e.g. higher E( ( x - 1 / 1 ) x 100 ). The increase in accuracy was greater when estimating









the mean internal and external severity in plots with low true mean severity (e.g. p. 1.5) than in plots with higher true mean severity (e.g. p 3.8) (Figures 4-la and 4-1b).

Similarly, when estimating the mean internal and

external incidence of corky ringspot, accuracy increased at a greater rate with increasing sample size in plots with lower incidence (p. 0.5) than in plots with higher incidence (Figures 4-2a and 4-2b). For any true plot mean value (p) of incidence or severity, the increase in accuracy with sample size when estimating p diminished rapidly for sample sizes above 20 potato tubers.

The relationship between sample mean standard deviation


(S) and sample size was described by a negative power function of the form y = an-b , for mean internal and external severity (Figures 4-3a and 4-3b) and for internal and external incidence (Figures 4-4a and 4-4b).

When estimating mean severity (external or internal) the gain in precision (lower a ) with sample size was greater for plots with higher mean values (p a 1.5) than for those with lower mean values (p < 1.5). The gain in precision with increasing sample size was greater when estimating incidence (external or internal) for plots with









mean incidence values (i) closer to 0.5. The gain in precision diminished with sample size and became insignificant at sample sizes above 20 potato tubers regardless of the true mean g of the plot. The value of the exponent b decreased with the true mean g for each plot in all cases.

The relationship between external incidence and mean

2
internal severity was linear with r = 0.87 (P < 0.01) (Figure 4-5). Also the relationships between external incidence and mean external severity (y = 4.477z - 0.2967,

2
r = 0.93, P < 0.01), between internal incidence and mean

2
external severity (y = 4.654z - 0.4027, r = 0.96, P

0.01), and between internal incidence and mean internal severity (y = 5.1676z - 0.344, r2 = 0.91, P < 0.01), were linear.

The binomial probability of detecting an infected potato with a sample size of 20 (or any sample size) increased with increasing incidence values (Table 4-1).




Discussion

The relationship between percentage of deviation from the true mean p and sample size n, is represented by the








-b
fitted line y = an , where y is equal to the expected value of the absolute value of [(x - pJ)/p] x 100 and n is the sample size. Thus, E( ( x - / p ) x 100 ) = 100 x


E x-p)22 = 100 x 2x E [t


. Since the


(-)2
~2
expression 2 n is distributed approximately as a X()
O-/n

(Mendenhall et al., 1990), then E( ( x - pL / p ) x 100 ) =
j ,> 2 C-0.5 F(1) X I 0X C -'
100 x E x x n - 1(1) n2 x 100 x CV x ns, where



F is the incomplete gamma function. The value F(a) is

Sa-I x
equal to J e adx (Mendenhall et al., 1990). If a is an
0oP


integer, then F(a) = (a-i)!. Denoting the quantity F(1)2



as the constant (k), E( ( x - 1/ p ) x 100 ) = k x CV(%)
-0.5 -b
x n. In the fitted line y = an , the coefficient a = k x


CV(%), b = 0.5, and n = the sample size; then CV(%) - a
k
In the relationship between percentage of deviation

from true mean severity and sample size (equation y = 100 x









G- 0.5
- x k x n ), the coefficient a =k x CV%, decreases (less variation) with increasing values of pt (Figures 4-la and 4ib). Similarly, in the relationship between percentage of deviation from true mean incidence p and sample size,


(equation y = 100 x 2- ) x k x n-0s5), the coefficient a nP

from the fitted line decreases with increasing values of the true mean p of the proportion p (Figures 4-2a and 4-2b). Potato tuber samples from fields with high true mean values of incidence or severity would require smaller sample sizes than fields with low true mean values to achieve a certain level of accuracy.

The relationship between sample mean standard deviation and sample size is represented by the fitted line y = an-b,


where y is equal to expected value of S;. Thus, y = E(S;)


(n- 1)S2 2 (n- I) S2
= E 2 x. Since 2 is distributed
(n -1)n a

2
approximately asX _2, then E Sd = n 1) E X(2 =
(n(J v










______ 0 5 0.5
S x a x (n-1)- .x n-.s Using Sterlings formula




n -1
(Feller, 1968), the expression ! (n-1) 0.5 for large




sample sizes; therefore E(S ) = x n-.s. From the fitted

-b
line y = an-b, the coefficient a = a , and n = the sample size. The coefficient was higher (higher a) for plots with higher values of true mean t severity than for plots with lower g (Figures 4-3a and 4-3b), and highest for plots with true mean g incidence closer to 0.50 (Figures 4-4a and 44b). Thus, potato tuber samples from fields with high p severity and 10.5 - pI values would require smaller sample sizes than fields with low p severity and 10.5 - PI values to achieve a certain level of precision.

The absolute value of the exponent b decreased with the true mean g severity and as 0.5 - p increased (Figures 43a, 4-3b, 4-4a, and 4-4b). The deviation of Ib from the theoretical value 0.5 was due to the violation of the normality assumption and to small sample sizes. Using the









theoretical fitted line y = a x n-05 would overestimate Sx

particularly at low sample sizes. Possibly the population of infected potato tubers resembled more a normal distribution as g severity increased and as p was closer to

0.5.

The sample size commonly used in the northeast Florida potato production area for diagnosis and assessment of corky ringspot disease is 20 (D. P. Weingartner, pers. comm.). Gain in accuracy or precision when estimating incidence (external and internal) and severity (external and internal) decreased substantially beyond a sample size of 20 potato tubers for all the plots tested. A sample size increase from 5 to 10 potato tubers would increase accuracy and precision by 41%, whereas the same increase from 20 to 25 potato tubers would increase accuracy and precision only by 12%. Large increases in sample size would be needed to gain considerable accuracy or precision beyond a sample size 20. Sample sizes smaller than 20 (e.g. 15) would estimate mean severity with lower precision (higher a) in fields with high p. values than in fields with low p values. Conversely, in the relationship between accuracy of the estimate x and p., accuracy increased (lower PDM) with higher values of true









mean severity p for a given sample size. Sample sizes smaller than 20 (e.g. 15) would estimate mean incidence with lower precision (higher a ) for values of g (true proportion p) close to 0.5. Accuracy increased (lower PDM) with lower values of true mean incidence 9 for a given sample size. Ultimately, the optimum level of accuracy and precision will be determined by the objective of the sampling (e.g. chemical control tests, breeding for resistance, quarantine) (Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b) and the relationship between acceptable risks and sampling costs.

The probability of detecting the presence of CRS in

potato lots with a sample sizes of 20 potato tubers will be high (>97%) if the actual incidence in the field is higher than 16%. According to this experiment, 7 out of 32 plots had a fairly high probability ( 17%) of escaping detection. This probability could be brought to low levels by increasing the sample size. For example, in a plot with 8% of incidence, a sample size of 40 potato tubers would have only a 3% probability of missing detection. Of course bringing that probability to 0% would require sampling the whole population of all potato tubers in the plot. The









acceptable risk of missing detection will depend on the purpose of the sampling and the cost.

The binomial probabilities were based on the assumption that the infected potato tubers were randomly distributed due to harvesting, cleaning, and grading. This may not be the case for infected potato tubers that have not been harvested. Infected potato tubers in the field may likely have a spatial distribution similar to that of their nematode vector. Generally, nematodes follow a negative binomial distribution in the field (Anscombe, 1950). Since we assumed random distribution of the infected potato tubers, possibly the use of other formulas (e.g. negative binomial), would give a more accurate probability of detecting infected potato tubers in the field.

True incidence (external or internal) and true mean severity (external or internal) were highly correlated (r2 values from 0.87 to 0.96, P < 0.01). This explains why patterns in accuracy and precision for all these parameters showed similar shapes when related to sample size. External incidence and mean internal severity were highly associated in this potato variety. The regression equation y = 5.08z -









0.2031 ( 2 = 0.87) would allow us to estimate and predict internal severity (y) by knowing external incidence (z).

The results presented here can be used as tools to

develop sampling plans of a desired accuracy and precision for this potato variety. A sample size of 20 potato tubers would be a reasonable choice of sample size for detection and evaluation of CRS in chemical control tests. Beyond sample size 20, the increase in accuracy and precision levels off at most incidence and severity values, and the relationship between standard error of the mean and sample size fits closely the theoretical model y = a x n-o'5. Similar studies should be done using other commercial potato varieties and localities that may show different relationships between sample size and incidence or severity.




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EQXA8TC8L_A9EIOU INGEST_TIME 2015-04-16T21:21:51Z PACKAGE AA00029968_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

SAMPLING AND DETECTION OF TR I CHODOR I D NEMATODES AND TOBACCO RATTLE VIRUS IN CORKY-RINGSPOTAFFECTED POTATO TUBERS By ENRIQUE ERNESTO PEREZ A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA

PAGE 2

ACKNOWLEDGMENTS I thank Dr. Robert McSorley, my committee cochair, for his excellent professional guidance. His suggestions always led me to discover new ways of thinking. He spent countless hours guiding me in the planning, analysis, and writing of my dissertation. I especially thank Dr. D. Peter Weingartner, my committee cochair, for financial support and professional guidance. He facilitated the resources and technical help to execute all the field experiments. I credit him for his enthusiasm and support in helping me to explore new ideas during the course of my research. I acknowledge Dr. Don Dickson for his advice, encouragement, and critical review of this dissertation. I thank Dr. Ramon Lit tell for his valuable guidance and criticism on my statistical studies. I am indebted to Dr. Nguyen Khuong for his professional help with nematode identification. I also thank Mr. Jay Harrison for his help in computer programming for data generated in my sampling experiments . ii

PAGE 3

I am most grateful to Dr. Ernest Hiebert for his professional guidance as a committee member and allowing me to use his facilities for the molecular virology work. I wish to express here my gratitude to Kris Beckham who selflessly taught and guided me through my virology work. She always took the necessary time to make sure that I learned techniques and procedures that were essential for my work. I would not have succeeded in many of my experiments without her professional help. I am thankful to Dr. Grover Smart, Jr., graduate coordinator, and Debbie Hall, secretary for the graduate office. Both went beyond the call of duty to make my stay at the University of Florida a most enjoyable one.

PAGE 4

TABLE OF CONTENTS ACKNOWLEDGMENTS ii LIST OF TABLES vii LIST OF FIGURES ix ABSTRACT xi CHAPTERS 1 LITERATURE REVIEW 1 Economic Importance of Potato in Florida and the United States 1 Nematodes Affecting Potato in Northeast Florida 2 Biology and Agronomic Importance of Trichodorid Nematodes 3 Biology and Agronomic Importance of Sting Nematodes 6 Vertical Distribution of Trichodorid Nematodes in the Soil Profile 9 Vertical Distribution of Belonolaimus spp. in the Soil Profile 10 Abiotic Factors Affecting Population Densities of Trichodorids and Belonolaimus longicaudatus 11 The Use of Chemicals to Control Plant Parasitic Nematodes and Improve Tuber Quality 13 Management of Trichodorids and Belonolaimus longicaudatus by Cultural Practices 14 iv

PAGE 5

Sampling for Detection and Estimation of Incidence and Severity of CRS-affected Tubers 16 Some Factors that Affect Nematode Extraction 18 Relationship Between Crop Damage and Nematode-Associated Diseases 20 Tobacco Rattle Virus: The Causal Agent of Corky Ringspot on Potato 21 Methods of Transmission of Tobacco Rattle Virus 24 The Association Between Tobraviruses and Trichodorids 2 5 Retention of Tobacco Rattle Virus by Trichodorid Nematodes 26 Criteria Used to Determine TrichodoridTransmitted Tobacco Rattle Virus 28 Characteristics of the Nucleotide Sequences of Tobacco Rattle Virus Strains 29 Detection of Tobacco Rattle Virus 30 Objectives of Present Study 32 2 COMPETITION BETWEEN Paratrichodorus minor AND Belonolaimus longicaudatus ON POTATO AND CABBAGE 34 Introduction 34 Materials and Methods 36 Results 39 Discussion 41 3 SEASONAL VARIATION OF Paratrichodorus minor AND Belonolaimus longicaudatus IN SORGHUM SUDANGRASS 55 Introduction 55 Materials and Methods 58 Results and Discussion 61 4 ESTIMATES OF SAMPLE SIZE FOR DETECTION AND ESTIMATION OF INCIDENCE AND SEVERITY OF CORKY-RINGSPOTINFESTED POTATO 71 Introduction 71 v

PAGE 6

Materials and Methods Results Discussion 74 79 81 5 EFFECT OF SOIL SUSPENSION METHOD ON NEMATODE EXTRACTION WHEN USING THE CENTRIFUGALFLOTATION TECHNIQUE 99 Introduction 99 Materials and Methods 101 Results and Discussion 102 6 CORRELATION BETWEEN Paratrichodorus minor POPULATIONS AND CORKY RINGSPOT SYMPTOMS ON POTATO 107 Introduction 107 Materials and Methods 109 Results 112 Discussion 116 7 DETECTION OF TOBACCO RATTLE VIRUS IN POTATO TUBERS OBTAINED IN NORTHEAST FLORIDA BY POLYMERASE CHAIN REACTION (PCR) AND NONRADIOACTIVE TISSUE BLOT 121 Introduction 121 Materials and Methods 124 Results 131 Discussion 137 8 SUMMARY AND CONCLUSION 140 APPENDIX IDENTIFICATION OF Trichodorus spp . FROM THE EXPERIMENTAL FIELD 14 7 LIST OF REFERENCES 151 BIOGRAPHICAL SKETCH 170 vi

PAGE 7

LIST OF TABLES Table Page 2-1. Effect of crop, depth, and nematicide on numbers of Belonolaimus longicaudatus per 100 cm 3 of soil, 1993-94 season 45 2-2. Effect of crop, depth, and nematicide on numbers of Belonolaimus longicaudatus per 100 cm 3 of soil, 1994-95 season 47 2-3. Effect of crop, depth, and nematicide on numbers of Paratrichodorus minor per 100 cm 3 of soil, 199394 season 49 2-4. Effect of crop, depth, and nematicide on numbers of Paratrichodorus minor per 100 cm 3 of soil, 199495 season 51 2-5. Number of Belonolaimus longicaudatus and Paratrichodorus minor per 100 cm 3 of soil on potato and cabbage 53 26. Number of Belonolaimus longicaudatus and Paratrichodorus minor per 100 cm 3 of soil in untreated plots on potato and cabbage 54 31. Preceding crops, harvest dates of preceding crops, sorghum planting dates, sorghum varieties, soil sample dates, and sorghum harvest dates 60 3-2. Ratio between population densities at the end of the growing season (Pf) and population densities before planting (Pi) of Belonolaimus longicaudatus and Paratrichodorus minor 66 vii

PAGE 8

41. Binomial probability of detecting a corky ringspot (CRS) -infected tuber in plots with different incidences of the disease 89 51. Number of nematodes per 100 cm 3 of soil recovered by manual and mechanical suspension of the soil subsamples 105 61. Simple linear correlation coefficients between mean external and internal incidence and severity of corky ringspot tuber symptoms, and Para.tr ichodorus minor numbers 113 6-2. Mean external and internal incidence and severity of corky ringspot tuber symptoms, and Paratr ichodorus minor per 100 cm 3 of soil at planting 114 63. Simple linear correlation coefficients between mean external and internal incidence and severity of corky ringspot tuber symptoms, and Paratr ichodorus minor numbers 115 71. Absorbance values (mean and range) of EL ISA test results from roots and tops of Nicotiana tabacum, N. clevelandii , and Petunia hybrida plants 133 viii

PAGE 9

LIST OF FIGURES Figure Page 3-1. Nematode densities per 100 cm 3 of soil on sorghumsudangrass in field A 67 3-2. Nematode densities per 100 cm 3 of soil on sorghumsudangrass in field B 68 3-3. Total monthly precipitation at the Yelvington Farm near Hastings, Florida during the sorghumsudangrass growing season 69 34. Average monthly soil temperatures at 10 cm deep during the the sorghumsudangrass growing season 70 4 la. Internal severity of corky ringspot in samples of potato tubers. Relationship between the average of percentage of deviation from the plot mean and the sample size 90 4 -lb. External severity of corky ringspot in samples of potato tubers. Relationship between the average of percentage of deviation from the plot mean and the sample size 91 4 -2a. Internal incidence of corky ringspot in samples of potato tubers. Relationship between the average of percentage of deviation from the plot mean and the sample size 92 4 -2b. External incidence of corky ringspot in samples of potato tubers. Relationship between the average of percentage of deviation from the plot mean and the sample size 93 ix

PAGE 10

4 -3a. Internal severity of corky ringspot in samples of potato tubers. Relationship between the average of standard error of the mean and the sample size 94 4 -3b. External severity of corky ringspot in samples of potato tubers. Relationship between the average of standard error of the mean and the sample size 95 4 -4a. Internal incidence of corky ringspot in samples of potato tubers. Relationship between the average of standard error of the mean and the sample size 96 4 -4b. External incidence of corky ringspot in samples of potato tubers. Relationship between the average of standard error of the mean and the sample size 97 45. Relationship between external incidence and mean internal severity 98 51. Mechanical suspension of the soil with a pressure nozzle 106 61. Monthly precipitation during the potato growing seasons 120 71. Organization of a tobravirus genomic RNA-1 134 7-2. Eight products after 22 cycles of PCR following reverse transcription of nucleic acid extracted from potato tubers with TRV-like symptoms 134 7-3. Tissue blot hybridization test from different potato varieties 135 7-4. Nucleotide sequence of the RNA-1 16 kDa open reading frame from the Florida tobacco rattle virus isolate 136 x

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy SAMPLING AND DETECTION OF TRICHODORID NEMATODES AND TOBACCO RATTLE VIRUS ON CORKY-RINGSPOTAFFECTED POTATO TUBERS By Enrique Ernesto Perez December, 19 97 Chair: Dr. Robert McSorley Major Department: Entomology and Nematology Florida potato {Solanum tuberosum) production has a great impact in the winter-spring potato market in the United States. Among the most important plant -parasitic nematodes affecting potato quality and yield in northeast Florida are Paratrichodorus minor and Belonolaimus longicaudatus . Yield losses are caused by B . longicaudatus , whereas P. minor is important as a vector of the tobacco rattle virus (TRV) , resulting in the disease known as corky ringspot (CRS) . The resurgence of P. minor after soil fumigation was investigated. Resurgence of P. minor xi

PAGE 12

populations after soil fumigation was not associated with B. longicaudatus numbers. Relative abundance of B. longicaudatus and P. minor population densities in soil at 0-20 and 20-40 cm deep was determined. Numbers of B. longicaudatus and P. minor increased on summer cover crops of sorghumsudangrass , but the increases varied with season. A sample size of 20 potato tubers was found to be adequate for estimating infection levels of CRS in tubers. Accuracy and precision of estimates of incidence and severity were dependent on the true mean incidence and severity of CRS-affected potato tubers in plots. There were significant associations between P. minor numbers and incidence or severity of CRS-affected potato tubers in plots . Nematode-transmitted TRV was detected in bait plants by enzyme-linked immunosorbent assay. The virus also was detected by reverse transcription from a segment of the RNA1 followed by cDNA amplification by polymerase chain reaction. The 4 63 -bp fragment was cloned, sequenced, and compared to sequences from a genebank database. A nonradioactive biot inlabeled probe was developed to detect TRV by tubertissue blotting. xii

PAGE 13

CHAPTER 1 LITERATURE REVIEW Economic Importance of Potato in Florida and the United States Potato {Solarium tuberosum L.) production in the United States in 1995 was 20.1 million metric tons (Lown, 1997). Potato is grown in all 50 states, and based on harvest time, the crop is divided into four seasonal groups. Almost 90% of the total production is harvested in the fall from September to November in 24 states. Spring and summer crop production are approximately the same size, and the winter production, the smallest, is harvested mostly in California and Florida from January into March. Northeast Florida (NEF) produces 272,160 metric tons of potatoes annually on 10,927 ha, which is 63% of the state's total hectarage (Anonymous, 1996). Value of Florida's total potato production, estimated at $84 million in 1995, ranks the state fourth nationally in the value of potato due to the high price of the winter and early spring production. 1

PAGE 14

2 Nematodes Affecting Potato in Northeast Florida There are 12 genera of plant -parasitic nematodes commonly associated with potato in NEF (Weingartner et al . , 1983) . Among the most important are the trichodorid nematodes {Paratrichodorus minor (Colbran) Siddiqi and Trichodorus spp . ) , and Belonolaimus longicaudatus Rau . Yield losses are caused by B . longicaudatus , whereas trichodorid nematodes are important as vectors of the tobacco rattle virus (Walkinshaw et al . , 1961). This virus causes the disease known as corky ringspot (CRS) in the United States and spraing in Europe. Depending upon the potato variety affected, symptoms are characterized by circular lesions on the surface of affected tubers and (or) necrosis in the tuber flesh, making tubers unmarketable (Weingartner et al . , 1983). Walkinshaw et al . (1959) stated that deep growth cracks, distortion, suberization, and irregular shallow furrows of suberized tissue often occur on the tuber surface. Foliage symptoms are rare and occur as severe stunting of the leaves and stems, and yellow mottle in the leaves (Walkinshaw et al . , 1961). Foliage symptoms have been observed in greenhouses when growing infected potato at temperatures between 16 and 24 C (Koespsell et

PAGE 15

3 al . , 1974) . In Europe some strains of TRV cause bright yellow mosaic, arcs, and rings that may be confused with symptoms of other virus diseases such as aucuba mosaic or mop-top (Weingartner , 1981) . Biology and Agronomic Importance of Trichodorid Nematodes Trichodorid species have a worldwide distribution, and are found most abundantly in sandy or sandyloam soils (Perry and Rhoades, 1982a). The stubby-root nematode, Trichodorus christiei Allen was reported as being pathogenic on the roots of beets (Beta vulgaris L.), celery (Apium graveolens L.), and sweet corn {Zea mays L.) in the region of Sanford, Florida (Christie and Perry, 1951) . Allen (1957) reported T . christiei associated with alfalfa {Medicago sativa L . ) , artichoke {Cynara scolymus L . ) , azalea {Rhododendron spp . ) , blueberry {Vaccinium corymbosum L . ) , boysenberry {Rubus hybrid L . ) , cotton {Gossypium hirsutum L.), grapevine (Vitis vinifera L . ) , onion (Allium cepa L . ) , peach (Prunus persica (L.) Batsch) , persimmon {Diospyros kaki L.), bird-of -paradise {Strelitzia reginae Aiton) , tomato {Lycopersicon esculentum Mill.), walnut (Juglans nigra L . ) , and wheat (Triticum aestivum L . ) . Excellent

PAGE 16

hosts on which a tenfold increase in population occurred were oat (Avena sativa L.), tall fescue {Festuca arundinacea Schreb.), cabbage (Brassica oleracea L. var. capitata) , turnip (Brassica rapa L.), mustard {Sinapis alba L . ) , winter vetch {Vicia villosa Roth), white clover (Trifolium repens L.), red clover {Trifolium pratense L.), tomato, and lettuce (Lactuca sativa L.) (Rohde and Jenkins, 1957b). The host range of trichodorid nematodes thus seems to be very wide; Perry and Rhoades (1982a) stated that almost any plant may be attacked by some species of trichodorids . Trichodorid nematodes are ectoparasites. The first published document of ectoparasitism on nematode plant roots, was from Christie and Perry (1951) . They described T. christiei feeding on bean roots (Phaseolus vulgaris L.) . Nematodes move first through the loose cells of the root cap and later feed on the root end and primordial cells, which prevents further root elongation (Russell and Perry, 1966) . Trichodorid nematodes most commonly attack epidermal cells, feeding only for a few minutes in each cell (Wyss, 1981) . Hogger (1973) reported that T. christiei fed more on actively growing root tips than on the hairless or root hair region of tomato roots. Trichodorus christiei juveniles

PAGE 17

were seen to embed half of their bodies in the root cap zone of wheat seedlings (Russell and Perry, 1966) . Paratrichodorus minor caused browning, collapse of the epidermis, and cessation of growth when feeding on roots of eggplant {Solanum melongena L.) and wheat (Schilt and Cohn, 1975) . Trichodorus christiei stunted vegetative growth and lateral roots on tomato plants 15 days after inoculation (Rohde and Jenkins, 1957b) . In apple (Malus domestica Borkh.) trees, T. viruliferus congregated at the apical meristem, producing browning of the tissue (Pitcher, 1967) . A unique characteristic of these nematodes is the production of a feeding tube, which is possibly used as a suction tool, and is probably initiated within the pharyngeal lumen (Wyss et al . , 1979) . The tube extends into the cell interior, and is anchored by a small plug of hardened secretions. Another peculiarity of trichodorids is the curved mural tooth, called an onchiostyle, with a solid tip and no knobs or flanges (Raski et al . , 1969) . Trichodorids are the only nematodes known to thrust their stylet during feeding, which helps salivation and digestion (Wyss, 1977) .

PAGE 18

6 The life cycle of T. christiei is shorter than most plant-parasitic nematodes. The life cycle of T . christiei was completed in 16-17 days at 30 C (Rohde and Jenkins, 1957a) , 17-18 days at 27 C, and 21-22 days at 22 C (Bird and Mai, 1967a). A first-stage juvenile hatches from the egg, commences to feed, and shortly thereafter, the nematode molts into a second-stage juvenile (Russell, 1962) . Then it follows the general life cycle of other plant-parasitic nematodes with three more molts (Rohde and Jenkins, 1957a) . Laboratory studies using apple tree seedlings kept between 15-20 C suggested that T. viruliferus has a life cycle of approximately 25 days and that a suitable food source is needed to promote reproduction (Pitcher and McNamara, 1970) . Biology and Agronomic Importance of Sting Nematodes The first report in the United States of the genus Belonolaimus was in 1949 from pine nurseries in Ocala, Florida (Steiner, 1949). Christie et al . (1952) reported B . gracilis Steiner pathogenic to celery, sweet corn, and strawberries (Fragaria ananassa Duch.). This nematode was later described as B . longicaudatus by Rau (1958) .

PAGE 19

7 The sting nematode is limited to soils with high sand content (> 80%) (Miller, 1972; Brodie 1976) and seems to reproduce best at soil temperatures of 25-30 C (Robbins and Barker, 1973) . In Florida, this nematode has never been found in muck or marl soils (Christie, 1959) . Belonolaimus longicaudatus is found in the southeastern United States from Virginia to Texas (Smart and Khuong, 1991) . It also was reported in Arkansas (Riggs, 1961) , Kansas (Dickerson et al., 1972), Missouri (Perry and Rhoades, 1982b), New Jersey (Myers, 1979), and California (Mundo-Ocampo et al., 1994). Robbins and Barker (1973) and Robbins and Hirschmann (1974) found host range and morphological differences between B. longicaudatus populations from Georgia and North Carolina. Sting nematodes are ectoparasites and usually do not penetrate the roots except with their stylet (Perry and Rhoades, 1982) , however there is one report that B . longicaudatus can be found occasionally inside roots (Christie et al . , 1952). Root systems of plants infected with sting nematodes are stubby and coarse with dark lesions along the roots and root tips (Perry and Rhoades, 1982) . Belonolaimus longicaudatus is highly virulent. Population densities as low as three nematodes per 100 g of soil at the

PAGE 20

8 time of transplanting can result in significant yield loss in susceptible plants of collard (Brassica oleracea L . var . acephala) , kale {Brassica oleracea L. var. acephala DC) , and cauliflower {Brassica oleracea L. var. botrytis) (Khuong and Smart, 1975) . Most vegetables and agronomic crops are seriously injured in many areas of Florida. The sting nematode causes important economic losses on numerous crops, but is especially troublesome in turf grass (Perry and Rhoades, 1982b) . Plants growing in fields infested with sting nematodes are often stunted and chlorotic and severe infestations of the nematode can cause plant death (Khuong and Smart, 1975) . The life cycle of B . longicaudatus is completed in 28 days under optimum conditions (Perry and Rhoades, 1982b) . Eggs are laid adjacent to the feeding site, the nematode undergoes the first molt inside the egg and emerges as a second-stage juvenile (Perry and Rhoades, 1982b) . Secondstage juveniles undergo three more molts and become adults. Reproduction is bisexual, and males comprise 40% of a typical population (Smart and Khuong, 1991) .

PAGE 21

9 Vertical Distribution of Trichodorid Nematodes in the Soil Profile Knowledge of the vertical distribution of nematodes in the soil profile is essential for developing sampling protocols (Barker and Campbell, 1981) . Time of the year, temperature, soil type, and moisture, were shown to have effects on the vertical distribution of nematodes in the soil (Brodie, 1976; Kable and Mai, 1968; McSorley and Dickson, 1990a; McSorley and Dickson, 1990b) . Several studies showed that trichodorid nematodes are most abundant at greater depths than many other plant parasitic nematodes. Brodie (1976) found highest densities of P. minor between 15-30 cm deep on soybean, and McSorley and Dickson (1990a) reported highest densities of P. minor on soybean between 15-45 cm deep. In a nursery of Sitka spruce (Picea sitchensis L.) trees, trichodorid densities were greatest between 30-39 cm deep (Boag, 1981) . When more than one trichodorid species coexist, the species tend to occupy different ecological niches. In unfumigated plots, T. primitivus usually occurred more deeply than P. pachydermus in fallowed soil and under pine trees, but the species had similar depth distributions under a grass -clover cropping sequence (Alphey, 1985) .

PAGE 22

10 Vertical Distribution of Belonolaimus spp . in the Soil Profile In soybean (Glycine max (L.) Merr.) plots, Belonolaimus longicaudatus was more abundant in soil at 0-30 cm than at 30-60 cm deep, and no sting nematodes were present below 60 cm deep (Brodie, 1976) . In these plots, sand content was 88% between 0-30 cm, and less than 80% below 60 cm deep. McSorley and Dickson (1990a) reported highest densities of B. longicaudatus between 0-15 cm in deep sandy soil during most of the maize growing season. In the same study, the authors reported that the proportion of B. longicaudatus in soil 30-45 cm deep increased later in the season due to deeper penetration of the maize root system. In soybean fields, numbers of B. longicaudatus were higher in soil at 0-15 cm than at 15-3 0 cm deep at the beginning of growing season and densities became more evenly distributed as the season progressed (McSorley and Dickson, 1990b) . Population densities of Belonolaimus sp . on maize increased in the top 30 cm of soil from planting to midseason (Todd, 1989; Todd, 1991) . After midseason, population densities of Belonolaimus sp . only increased between 30-60 cm deep. The author suggested that this increase was probably due to root penetration or moisture fluctuations. Moisture and other

PAGE 23

abiotic factors may not only affect vertical distribution of sting nematodes and other nematode species, but also may affect their abundance and limit their geographic distribution . Abiotic Factors Affecting Population Densities of Trichodorids and Belonolaimus lonqicaudatus Toxicity trials with copper salt solutions in fixation dishes killed T. pachydermus . Soil irrigation with similar Cu concentration solutions did not affect T . pachydermus. This suggests that the adsorptive action of the soil inhibited the toxic effects of Cu (Haf kenscheid, 1971) . Results from these experiments suggests the importance of using copperfree material for extraction of live trichodorids. In plots deficient in lime (pH 4.8-5.2), population densities of T. christiei increased; the authors suggested that the effect was possibly due to low pH or lack of calcium (Rodriguez -Kabana and Collins, 1979) . Soil compaction caused by tractor passes decreased numbers of T. primitivus by 25% in the top 21 cm of soil (Boag, 1985) . Cultivation practices, such as rotary cultivation, reduced trichodorid populations by 15% (Boag, 1983) .

PAGE 24

12 Trichodorids seem to be sensitive to soil desiccation under laboratory conditions. Numbers of P. pachydermus and T. viruliferus decreased with decreasing soil moisture (Van Hoof, 1976) . Transmission of TRV by trichodorids only occurred when the soil water content was at least 15%. This suggests that moisture affects feeding or mobility of trichodorids since trichodorid numbers were not greatly affected by moisture content in the soil (Cooper and Harrison, 1973) . Perry (1964) first showed the importance of temperature in the life cycle of B. longicaudatus . Reproduction was almost inhibited at 3 5 C, and population increases were greater at 29.4 C than at 26.7 C (Perry, 1964). Highest populations of B . longicaudatus were found when soil moisture content was from 10% to 20% (Brodie and Quattlebaum, 1970) . Soil texture affects trichodorid populations. Survival of P. minor in fallowed soil was best in sandy loam soils, followed by sand and clay soils (Schilt and Cohn, 1975) . Population increase of T . minor on sudan-grass in greenhouse tests was greater in sandy loam soil than in silt clay loam or loam soil (Thomason, 1959) .

PAGE 25

13 The Use of Chemicals to Control Plant-Parasitic Nematodes and Improve Tuber Quality In the late 1960s, the use of preplant fumigants such as 1 , 3 -dichloropropene and 1 , 2 -dichloropropane (DD) , 1,3dichloropropene (1,3-D), and ethylene dibromide (EDB) , became a common practice to increase potato tuber yield in NE Florida (Weingartner et al . , 1993) . Currently, the fumigants 1,3-D and metam-sodium are used as a costeffective chemical control for most nematodes that affect potato in northeast Florida. Although 1,3-D has controlled CRS in other parts of the world (Cooper and Thomas 1971; Livingston et al . , 1976; Maas, 1975) and in the Pacific northwest (Williams et al . , 1996), this practice has failed to control CRS and its trichodorid vectors in northeast Florida (Weingartner et al . , 1975a; Weingartner et al . , 1975b; Weingartner et al . , 1976). Population densities of trichodorids in some pathosystems have been observed to rapidly increase or resurge following soil fumigation (Brodie, 1968; Perry, 1953; Rhoades, 1968), to levels exceeding those of untreated soils. The use of 1,3-D at a rate of 56 L/ha applied in the row resulted in an increase of 13.6% in incidence of CRS when compared with untreated plots during a 5 -year

PAGE 26

14 experiment (Weingartner et al . , 1983). The best control was achieved when the same rate of 1,3-D was combined with an at planting application of aldicarb applied at a rate of 3.4 kg a.i./ha. This treatment resulted in a 19.5% reduction in the incidence of CRS . Weingartner and Shumaker (1990c) also reported the lowest incidence of CRS in plots treated with 1,3-D applied at a rate of 56 L/ha with three chisels per row and combined with aldicarb applied at a rated of 3.4 kg a.i./ha. The use of oxamyl sprayed at planting at a rate of 3.4 kg a.i./ha plus three foliar applications of 1.1 kg a.i./ha, improved tuber quality by 53% on tobravirusstubby root nematode infested fields (Weingartner et al . , 1973). Management of Trichodorids and Belonolaimus loncricaudatus by Cultural Practices Because of the potential restrictions in nematicide use, more attention is being given to the possibilities of integrated control of nematodes, including crop rotation and other cropping sequences (Barker, 1991; Johnson and Feldmesser, 1987; McSorley and Gallaher, 1992; McSorley and Dickson, 1995; Sasser and Uzzell, 1991; Weingartner et al . , 1991) .

PAGE 27

15 Most fields in northeast Florida (NEF) are planted to potato during the spring followed by sorghumsudangrass hybrid {Sorghum bicolor (L.) Moench x S. arundinaceum (Desv.) Stapf var. sudanense (Stapf) Hitchc.) as a cover crop in the summer (Weingartner et al . , 1993) . Cabbage (Brassica oleracea L. var. capitata) , although less important than potato, is another cash crop planted during the winter-spring season. In cropping systems, the choice of crops that are nonhost to some plant-parasitic nematodes can be used as a successful management strategy for improving yield of the next crop (Noe et al . , 1991; Nusbaum and Ferris, 1973; Rhoades, 1976; Trivedi and Barker, 1986) . Sorghum could be particularly beneficial in rotation systems involving vegetables crops where root -knot nematodes (Meloidogyne spp.) are the main nematode pathogens that are limiting to production (McSorley et al . , 1986; McSorley and Gallaher, 1991) . Furthermore, sorghum reduces erosion by wind and rain, increases organic matter content, and improves soil stability (McSorley et al . , 1986; Myhre, 1957). However, P. minor and B. longicaudatus can increase on sorghum (McSorley and Gallaher, 1991; Rhoades, 1976; Rhoades, 1984), and large

PAGE 28

population densities could affect the subsequent cabbage or potato crop (Rhoades, 1968; Weingartner et al . , 1983). Possible substitutes for sorghumsudangrass are hairy indigo {Indigofera hirsuta L . ) , jointvetch (Aeschynomene americana L . ) , or velvetbean {Mucuna deeringiana (Bort.) Merr.) . Hairy indigo and jointvetch were effective in maintaining low population densities of B . longicaudatus (Rhoades, 1976; Rhoades and Forbes, 1986) . Growing hairy indigo in the summer reduced B . longicaudatus population densities and improved potato yield by 7.2%, but did not reduce severity of CRS on potato tubers (Weingartner et al . , 1991) . Sampling for Detection and Estimation of Incidence and Severity of CRS-affected Tubers Incidence (percentage of affected tubers) and severity of CRS adversely affects the value of potato tubers (Weingartner and Shumaker, 1990a) . The use of nematicides is a common practice in northeast Florida to lessen severity of infection and can reduce losses due to CRS by up to 25% (Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b) . The potato chip industry, farmers, and researchers rely on the information obtained from potato tuber samples

PAGE 29

17 to estimate incidence and severity of CRS on potato tubers (Weingartner et al . , 1983; Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b) . Since recommendation about entire potato fields or lots are based on observations of the samples, it is essential to understand the relationship between sample size and accuracy (exactness) and precision (variability) of the information in the sample. In the Pacific Northwest, CRS tuber injury in excess of 5% to 10% of the tubers sampled may result in rejection of an entire harvest (Williams et al . , 1996). The proportion of potato tubers in a sample affected by CRS is used to estimate the incidence of CRS in that field. Estimators, which are formulas or rules, are used to estimate parameters to make inferences and (or) decisions about a population (Mendenhall et al . , 1990). In research studies (e.g. chemical trial tests or breeding programs), two parameters of interest are the percentage of potato tubers affected with CRS (incidence) and the extent to which each of those potato tubers is affected with CRS (severity) . A parameter estimator (e.g. sample mean x) is a random variable with a probability distribution called the sampling distribution of the estimator (Mendenhall et al . , 1990).

PAGE 30

18 Sampling distributions are used to determine precision and accuracy of an estimate, such as x (the sample mean) , in estimating u (the true mean) of the entire population of CRS-affected tubers. Similarly the estimate S 2 (sample standard deviation) is used to estimate a 2 (the variance) . The accuracy and precision of the information in the sample will set the reliability of the estimates x and S 2 . Determination of sample size is crucial to secure a desired level of precision. Since confidence intervals decrease as the sample size increases, larger samples provide more precise information but incur higher costs (Freund and Wilson, 1993) . The optimum sample size will be the one that provides the most precise information for a particular purpose at a minimum cost. Some Factors that Affect Nematode Extraction A critical step when determining numbers of nematodes in soil is the extraction method. Different methods have extraction efficiencies that range from 0% to 100% (McSorley, 1987; Viglierchio and Schmitt, 1983) . Extraction efficiency within a method varies with operator, soil type, nematode genera, and other factors (McSorley and Parrado,

PAGE 31

1987) . The efficiency of a multi-step method can be increased by changing one or more of the steps of the method. A common method for nematode extraction is the centrifugal-flotation technique (Jenkins 1964), which is based on sieving of a soil suspension, followed by separation of nematodes by centrif ugation . Extraction efficiency of B . longicaudatus in the centrifugal-flotation technique ranged from 27%-32% (McSorley and Frederick, 1991) . McSorley and Parrado (1987) reported that mixing time of the soil in water had an effect on the relative number of nematodes entering suspension, and therefore affected extraction efficiency. Losses during this step were inversely related to suspension time and varied with nematode species and soil type. Losses could be reduced by mixing the sample into suspension for 60-90 minutes (McSorley and Parrado, 1987) , and the use of soil mixing procedures were suggested to maximize break up of the soil aggregates . The centrifugal-flotation technique is based on the principle that the average density of the nematode is equal to, or lower than, the density of the solution (Viglierchio

PAGE 32

20 and Yamashita, 1983) . In their work, Viglierchio and Yamashita (1983) showed that flotation of nematodes and possible injury during extraction depends on solute density, solute osmotic pressure, and physiological properties of the nematode species. Relationship Between Crop Damage and Nematode-Associated Diseases Knowledge of the relationship between crop yield and population densities of plant -parasitic nematodes can be used as a tool to make accurate nematode management decisions (Ferris, 1974; Seinhorst, 1965). Nematode population densities at planting (Barker and Nusbaum, 1971) or at other times during the growing season (Ferris, 1974; Ferris and Noling, 1987; Mashela et al . , 1991) can be correlated with yield. Since P. minor transmits the causal agent of CRS, it is possible that P. minor numbers could be correlated with incidence or severity of CRS on potato tubers . Soil moisture may affect trichodorid populations transmitting tobacco rattle virus to the potato corp. Cooke (1973) in England found a significant association between the prevalence of docking disorder in sugar beet in June,

PAGE 33

21 caused by trichodoridtransmitted TRV, and rainfall in May. He suggested that this association was due to maximum trichodorid activity when soils were at or near field capacity. In Scotland, trichodorid densities in May were more associated with incidence of corky ringspot than trichodorid densities at harvest in August (Cooper and Thomas, 1971) . Spraing incidence in Scotland was positively correlated with May rainfall, and it was most prevalent when the summer was wettest (Cooper and Harrison, 1973) . Tobacco Rattle Virus: The Causal Agent of Corky Ringspot on Potato More than 400 plant species are susceptible to infection with tobacco rattle virus, including cultivated and wild annuals, herbaceous perennials, and woody perennials (Harrison and Robinson, 1981) . It is the plant virus with the widest known host range (Robinson and Harrison, 1989) . Tobacco rattle virus has been found in many countries of Europe, in North America, Brazil, Japan, and New Zealand (Harrison and Robinson, 1981) . Crops in which TRV causes disease include potato, corky ringspot in the United States and spraing in Europe in the tubers, stem mottle in the leaves (Robinson and Harrison, 1989) , rattle

PAGE 34

disease in tobacco (Nicotiana tabacum L . ) , mosaic in the leaves of lettuce (Lactuca sativa L.), mosaic in pepper [Capsicum annuum L . ) , notched-leaf in gladiolus (Gladiolus spp.), malaria in hyacinth (Eichhornia crassipes (Mart.) Solms) , and color breaking and leaf distortion in tulip (Tulipa gesneriana L.) (Robinson and Harrison, 1989). Tobacco rattle virus belongs to the tobravirus group and is naturally transmitted by Trichodorus spp. and Paratrichodorus spp. (Cooper and Thomas, 1970; Van Hoof et al . , 1968; Walkinshaw and Larson, 1959) . Tobravirus particles are of two predominant lengths, the longer particle of approximately 190 nm and the shorter one ranges from 45 to 115 nm, depending on the isolate (Harrison, 1970) . Tobravirus particles stained with uranyl acetate appear in the electron microscope as rigid rods, 21 to 23 nm in diameter with a central hole 3.6 to 5.3 nm wide (Cooper and Mayo, 1972) . Long particles have RNA of molecular weight 2.3 x 10 6 , and short particles have RNA of molecular weight 0.6-1.3 x 10 6 (Harrison, 1970). The short particles are usually two to five times more numerous than the long particles .

PAGE 35

23 Lister (1968) reported the bipartite nature of the TRV particle and Harrison and Robinson (1978) divided the TRV isolates into two classes. The first class (M-type) produces two rod-shaped particles of different size. The larger particle (RNA-1) has approximately 7,000 nucleotides, and the shorter particle (RNA-2) ranges from 1,500 to 4,000 nucleotides. The short particle, RNA-2, encodes for the coat protein (Sanger, 1968) . The second class (NM-type) lacks RNA-2 and therefore produces no nucleoprotein and exists as naked RNA in the host. Since RNA-1 encodes the replicase and the movement proteins that allows the virus to replicate and move sistemically in the plant, NM-type isolates can cause infection in plants and are very common in nature (Harrison and Robinson, 1982; Hamilton et al . , 1987; MacFarlane et al . , 1989). Recent studies showed that the formation of NM-type isolates by repeated mechanical transmissions could be caused by the lack of selection pressure for encapsidation needed in nematode transmission (Hernandez et al . , 1996). Virus cultures obtained after several mechanical transfers showed high concentrations of defective interfering (DI) RNA that had lost the functional

PAGE 36

24 coat protein gene. These DI RNAs outnumbered the RNAs-2 and became dominant in the virus culture giving rise to NM-type virus populations. Methods of Transmission of Tobacco Rattle Virus Tobacco rattle virus was transmitted from infected potato to tomato by grafting (Cadman and Harrison, 1959) , and is more or less transmissible by inoculation with sap (Harrison and Robinson, 1981) . Isolates of the NM type are poorly sap transmitted; however, transmission can be improved by grinding the infected tissue in the presence of phenol and using ethanol to precipitate and concentrate the RNA from the aqueous extract (Kubo et al . , 1975). Seed transmission was detected in five out of 15 naturallyinfected weed species, and possibly plays a role in the spread of virus to new sites (Cooper and Harrison, 1973) . The most important means of transmission of TRV is by nematodes. Walkinshaw and Larson (1961) were the first in the United States to report transmission of TRV to tobacco plants by T . christiei populations from Hastings, Florida. Fields infected by nematodetransmitted TRV can be distinguished from infections caused by planting infected

PAGE 37

25 plant material because of the clumped distribution of the former compared to the random distribution of the latter (Cremer and Schenk, 1967) . A complete feeding cycle of trichodorids is composed of the following phases: exploration, perforation, salivation, ingestion, and departure from the feeding site (Wyss, 1982) . Exploration is performed by rubbing the lips against the cell wall over a short period of time, and is terminated when the strengthening rods of the pharyngeal wall contact the cell wall. The stylet is thrust at several times per second and the wall is perforated within a minute. After perforation, salivation begins and the stylet is thrust at a slower rate. Ingestion consists of slow thrusts into the accumulated cytoplasm. In each stylet retraction, the aggregated cytoplasm is removed and is consumed in less than half a minute (Wyss, 1982) . The Association Between Tobraviruses and Trichodorids The association between TRV and trichodorids is relatively specific; P. pachydermus only acquired and transmitted TRV when the virus and nematode originated from the same locality (Van Hoof, 1968) . Early assertions by Van

PAGE 38

Hoof that TRV isolates were site specific were only partially true, since Ploeg et al . (1992) showed that specificity of transmission of P. pachydermus was serologically determined. Successful acquisition and transmission of TRV isolates belonging to the same serotype was accomplished by both P. pachydermus populations from the Netherlands and Scotland (Ploeg et al . , 1992a). However, Ploeg et al . (1996), later showed a different scenario and demonstrated that P. teres could transmit two serologically distinct strains of TRV. Thus the serologic and geographic specificity between Paratrichodorus spp . and TRV isolates is not an universal phenomenon (Ploeg et al . , 1992a; Ploeg et al., 1996) . This was further documented with a report of Trichodorus viruliferus, T. primitivus, and T. cylindricus transmitting TRV isolates from the same serotype group (Ploeg et al . , 1992b) . Retention of Tobacco Rattle Virus by Trichodorid Nematodes Tobacco rattle virus particles lining the pharynx and esophagus of P. pachydermus were observed for the first time by Taylor and Robertson (1970a) . The first report explaining the mechanism of retention of virus particles and

PAGE 39

27 its nematode vector was on nepoviruses. It was suggested that charged receptor sites from the nematode esophagus and charges on the coat protein of nepoviruses were involved in the retention of virus particles (Taylor and Robertson, 1970b) . Tobravirus have rod-shaped particles with coat proteins that assemble into aggregates comparable to those of tobacco mosaic virus (Gugerli, 1976). Mayo et al . (1993) hypothesized that the C-terminal of the capsid protein subunit could attach to the lining of the nematode esophagus. Legorburu et al . (1995), working with monoclonal antibodies, suggested that the C-terminal from the capsid protein of TRV was located on the surface of the particle and possibly exposed along its length. Later, Legorburu et al. (1996) confirmed this finding and stated that the Nterminal region of the protein also was exposed to the surface, whereas the central variable region was exposed to antibodies at one end. They observed different features in the C-terminals of virus groups with different modes of transmission, and stated "it is tempting to conclude that the C-terminal region of the protein may be involved in the transmission of TRV."

PAGE 40

28 Pseudorecombinant TRV isolates constructed from RNA-2 that originated from nematode-nontransmissible isolates were not transmitted by trichodorids , but when the pseudorecombinats were constructed from RNA-2 of nematode transmissible isolates, they were transmitted by trichodorids (Ploeg et al . , 1993). From this experiment, the authors concluded that the factor determining vector transmissibility was located in RNA-2, and possibly that the coat protein was involved in the transmission process. In another series of experiments, however, replacement of the coat protein of a nematode nontransmissible tobravirus with that of another nematodetransmissible virus did not confer nematode transmissibility (MacFarlane et al . , 1995). Therefore, factors in addition to the virus coat protein gene are responsible for nematode transmission. Hernandez et al. (1996) confirmed the finding of MacFarlane et al . (1995) by reporting that the 29.4 K gene in RNA-2 of TRV isolate PPK20 was essential for nematode transmissibility. C riteria Used to Determine Trichodorid-Transmitted Tobacco Rattle Virus Forty different associations have been reported between species of Trichodorus and Paratrichodorus and the

PAGE 41

tobraviruses (Brown et . al . , 1989). Trudgill et al . (1983) established the following prerequisites needed to state that a virus was nematodetransmitted : 1) the nematode and the virus must be fully identified and characterized, 2) bait plant tissue must be shown to be infected with the virus, 3) the nematode must be shown to be the only possible vector of the virus. When these criteria were applied, only 12 of 40 mentioned associations were supported by evidence (Brown et al., 1989). The TRV isolate from Hastings, Florida was shown to fulfill these criteria (Walkinshaw et al . , 1961) . Characteristics of the Nucleotide Sequences of Tobacco Rattle Virus Strains Nucleotide sequences of some European and Canadian TRV isolates have been published. The complete nucleotide sequence of RNA-1 of the spinach SYM isolate from England is known (Kurppa et al . , 1981). Starting at position 2,291, the nucleotide sequence of the 3' -terminal 1,099 nucleotides of RNAs-1 and 2 of the tulip TRV isolate from the Netherlands were identical (Cornelissen et al . , 1986). Similarly, the 3' -820 nucleotide sequence of RNAs 1 and 2 of the potato TRV isolate from the Netherlands was found to be identical (Angenent et al . , 1989). The nucleotide sequence

PAGE 42

30 of the RNA-1 16 K open reading frame from the Canadian (CAN) TRV isolate also is known (Kawchuk et al . , 1997). The 3 '-terminal homologous sequence in TRV-RNAs 1 and 2 may play a role in encapsidat ion and (or) replication of the viral RNAs (Cornelissen et al . , 1986). The fact that this homologous region can vary among different strains suggests that only part of this region, and not the whole region, is needed for one or both of these functions. Detection of Tobacco Rattle Virus Detection of TRV by serological tests of the nonmultiplying-type (NM-type) isolates is impossible using this method because they lack a protein coat. Tobacco rattle virus isolates of the mult iplyingtype (M-type) were first separated into three serotypes (Harrison and Woods, 1966) . Later Harrison and Robinson (1978) grouped serotypes I and II into one and named it serotype I -II, because of the existence of isolates with characteristics of both groups. Harrison et al.(1983) found that of 16 isolates of TRV from narcissus, only four reacted in ELISA and only six reacted in immunosorbent electron microscopy tests when using one antiserum. Samson et al . (1993) detected TRV in only a few

PAGE 43

31 samples using ELISA or western blot in 3 9 tubers with corky ringspot -like symptoms. The use of symptoms for diagnosis of CRS on potato tubers is helpful but unreliable. Corky ringspot like symptoms on potato tubers can be caused by physiological disorders and by potato mop top virus (Calvert and Harrison, 1966), furthermore symptom expression is diverse among TRV strains (Harrison and Robinson, 1986; Robinson and Harrison, 1989) . The RNA-1 of all TRV share conserved nucleotide sequences (Robinson and Harrison, 198 5) . Thus, the conserved regions can be used as starting points to reproduce the sequences comprised between those regions . The polymerase chain reaction (PCR) is used as a diagnostic tool for viruses with conserved nucleotide sequences. Using the sequence from RNA-1 that codes for the 16 K protein, TRV has been detected by reverse transcription PCR in Nicotiana clevelandii Gray and Narcissus spp . (Robinson, 1992) , and in potato tubers (Crosslin and Thomas, 1995; Kawchuk et al . , 1997; Weidemann, 1995) . Hence, cDNA probes that hybridize to regions of RNA-1 can detect isolates of TRV including NMtype isolates (Harrison and Robinson, 1982; Robinson, 1989) .

PAGE 44

32 One drawback of RNA dot-blot hybridization probes for use in potato tubers is that RNA requires complex and time consuming extraction methods (Robinson and Legorburu, 1988) . Objectives of Present Study The objectives of the present study focused on the plant -parasitic nematodes in the potato cropping system and on detection of CRS in potato tubers: to determine if resurgence of P. minor after soil fumigation is associated with reduction in numbers of B. lon.gicauda.tus; to investigate the vertical distribution of these two species in soil 0-20 and 20-40 cm deep on potato, cabbage, and sorghumsudangrass; to describe the population changes of B. longicaudatus and P. minor during the sorghumsudangrass growing season; to determine optimum sample size to detect the presence of CRS on potato tubers, and to determine sample sizes needed to estimate incidence and severity of CRS on potato tubers within given levels of accuracy and precision; to compare the effect of two methods of soil suspension in water (use of a water pressure nozzle vs. stirring soil suspension by hand) on nematode extraction efficiency when using the centrifugal flotation technique;

PAGE 45

and to correlate incidence or mean severity of CRS on potato tubers at harvest with P. minor population densities at different times during the potato growing season. The following were objectives that focused on detection and characterization of tobacco rattle virus: to identify nematodetransmitted TRV by enzymelinkedimmunosorbent assay (ELISA) ; to detect TRV in potato tubers by reverse transcription and polymerase chain reaction (RT-PCR) ; to present the nucleotide sequence of the RNA-1 region of the Florida isolate that encodes for the 16 K protein (Harrison et al., 1987) and its relationship with isolates from Canada and Europe; and to develop a nonradioactive hybridization probe using tuber tissue for rapid detection of TRV.

PAGE 46

CHAPTER 2 COMPETITION BETWEEN Paratrichodorus minor AND Belonolaimus longicaudatus ON POTATO AND CABBAGE Introduction Potato (Solanum tuberosum L.) production in northeast Florida has a great impact in the winterspring potato market in the United States, with more than 10, 000 ha grown annually (National Potato Council, 1990) . Among the most important plant-parasitic nematodes affecting potato quality and yield in northeast Florida are the trichodorid nematode Paratrichodorus minor (Colbran) Siddiqi, and the sting nematode Belonolaimus longicaudatus Rau . The quality of potato tubers is affected by P. minor transmitting the tobacco rattle virus (Walkinshaw et al . , 1961). This virus causes the disease known as corky ringspot (CRS) in the United States and spraing in Europe . Depending upon the potato variety affected, symptoms are characterized by circular lesions on the surface of affected tubers and (or) necrosis in the tuber flesh, making tubers unmarketable (Weingartner et al . , 1983). Approximately one-third of the 34

PAGE 47

35 potato farms in northeast Florida are affected by CRS (Weingartner and Shumaker, 1990) . The fumigants, 1 , 3 -dichloropropene (1,3-D) and metam sodium, are used as a cost-effective chemical control for most nematodes that affect potato in northeast Florida. Although soil fumigation has controlled CRS in other parts of the world (Cooper and Thomas, 1971; Dallimore, 1972; Livingston et al . , 1976; Maas, 1975), this practice has failed to control CRS and its trichodorid vectors in northeast Florida (Weingartner et al . , 1975a; Weingartner et al., 1975b; Weingartner et al . , 1976). Population densities of trichodorids in some pathosytems have been observed following soil fumigation to rapidly increase or resurge (Brodie, 1968; Perry, 1953; Rhoades, 1968), to levels exceeding those of unfumigated soils. It was noted in these earlier studies that B. longicaudatus occurred concomitantly with trichodorids. Furthermore, there seemed to be an association between lower numbers of B. longicaudatus and resurgence of trichodorids following soil fumigation, whereas trichodorid population densities seemed static in the presence of higher numbers of B. longicaudatus (Brodie, 1968; Perry, 1953; Rhoades, 1968). Based on these studies,

PAGE 48

36 it was hypothesized that resurgence in numbers of trichodorids following soil fumigation was due in part to reduction in numbers of B. longicaudatus . The objectives of this study were to determine if resurgence of trichodorids after soil fumigation was associated with reduction in numbers of B. longicaudatus after soil fumigation and also to investigate the distribution of these nematodes at different depths in soil. Materials and Methods Experiments were established during the 1993-94 and 1994-95 winter growing seasons at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Soil texture was 95% sand, 2% silt, 3% clay, and 1.4% organic matter at 0-20 cm deep, and 94% sand, 3.6% silt, 2.4% clay, and 1.2% organic matter at 20-40 cm; pH 5.5-6.0. The soil was naturally infested with P. minor and B. longicaudatus . Potato had been grown on the site during each winter and the sorghumsudangrass hybrid {Sorghum bicolor (L.) Moench x S. arundinaceum (Desv.) Stapf var . sudanense (Stapf) Hitchc.)

PAGE 49

had been monocultured during the summer after the potato season for at least 25 years. The potato var . Red LaSoda and cabbage {Brassica oleracea L. var. capitata) var. Bravo were planted manually on 21 December 1993 and 23 January in the 1993-94 and 1994-95 seasons, respectively, at a spacing of 15 cm between potato seed pieces or cabbage seedlings. The experimental design was a twolevel split -plot with two nematicide treatments (fumigated with 1,3-D and unfumigated) as the whole plot factor arranged in a complete randomized block design, two crops (potato and cabbage) as the subplots, and two sampling depths (0-20 cm and 20-40 cm) as sub-sub-plots. All treatment combinations were replicated eight times. Experimental units consisted of one 10-m-long row. The fumigant 1,3-D was applied 32 cm deep in row with a single chisel at a rate 56 L/ha on 24 November 1993 and 16 December 1994. Standard practices for insect, disease management, and weed control were used (Hochmuth et al . , 1996) . The experimental area was fertilized at planting with 1,345 kg/ha of 10-10-10 of N-P-K and side-dressed with 560 kg/ha 45 days after planting with 14-2-12 of N-P-K. Plots were irrigated as needed (Rogers et al . , 1975).

PAGE 50

Nematode samples consisted of six cores (2.5 cm diam.) taken from each sub-sub plot 0-20 cm and 20-40 cm deep. Samples were taken on 23 November, 21 December, 21 January, 25 February, 21 March, 4 April, and 18 April in the 1993-94 season; and 22 November, 23 January, 27 February, 27 March, and 5 May in the 1994-95 season. The six cores were mixed manually and a 100-cm 3 subsample was removed for nematode extraction. The subsamples were wet-sieved through 850-fxm and 28-u.m pore sieves. The material retained on the 28-um sieve was processed by a centrifugal flotation technique (Jenkins, 1964) . The extracted nematodes were dispersed in water in a gridded counting dish, identified, and counted. Data were subjected to analysis of variance for a twolevel split-plot design (Montgomery, 1991) using SAS (SAS Institute, Cary, NC) . Mean numbers of B. longicaudatus and P. minor from unfumigated plots were compared within each crop between soil depths of 0-20 cm and 20-40 cm with a paired t-test. Mean numbers of B . longicaudatus in soil at 0-20 cm and P. minor at 20-40 cm were compared within each crop between nematicidefumigated and unfumigated plots with a paired t-test. Simple linear correlation coefficients were calculated between numbers of B. longicaudatus and P.

PAGE 51

minor from each sampling date at the same and opposite depths. Simple linear correlations also were calculated between numbers of B . longicaudatus and P. minor for all sampling dates within depth and crop. Results With the exception of 18 April in the 1993-94 season, numbers of B. longicaudatus were significantly different after nematicide fumigation on all sampling dates in the 1993-94 and 1994-95 seasons on potato and cabbage (Tables 21 and 2-2) (P < 0.05) . The interaction between nematicide treatment and depth of sampling was significant on several dates in the 1993-94 season and all dates in the 1994-95 season (Tables 2-1 and 2-2) (P < 0.05) . Since less than 21% of the population densitiesof B . longicaudatus were between 20-40 cm deep (Table 2-6) , it is likely that the magnitud of the difference in B . longicaudatus numbers due to nematicide treatment was greater at 0-20 cm than at 20-40 cm deep. Numbers of P. minor were lower on potato after nematicide treatment in the 1993-94 and 1994-95 seasons except for the three last sampling dates in the 1993-94 season and on 5 May in the 1994-95 season (Table 2-5) (P < 0.05). With the

PAGE 52

40 exception of the last three sampling dates in the 1993-94 season, numbers of P. minor were lower on cabbage after nematicide treatment (Table 2-5) (P < 0.05). In the 1994-95 season, numbers of P. minor were higher in cabbage plots fumigated with nematicide than in plots that were not fumigated (Table 2-5) (P < 0.05). Belonolaimus longicaudatus numbers were higher in soil 0-20 cm deep on potato and cabbage in both seasons in the unfumigated plots (P < 0.05) with the exception of 21 March in the 1993-94 season on potato (Table 2-6) . Belonolaimus longicaudatus numbers at 20-40 cm deep were low in both crops (<4.4 nematodes/100 cm 3 of soil) (Table 2-6). Numbers of P. minor in the unfumigated plots were higher in soil 2040 cm deep on potato in both seasons (P < 0.05) except on 4 April and 18 April in the 1993-94 season (Table 2-6) . Numbers of P. minor on cabbage were higher in soil at 20-40 cm than at 0-20 cm deep in both seasons in the unfumigated plots (Table 2-6) (P < 0.05). Except on 5 May 1995, P. minor numbers at 0-20 cm were low in both crops and both seasons (<7.1 nematodes/100 cm 3 of soil) (Table 2-6). Belonolaimus longicaudatus numbers were greater on cabbage than on potato on 27 February and 27 March in the

PAGE 53

4 1994-95 season (Tables 2-2 and 2-6) (P < 0.05). Paratrichodorus minor numbers were higher on cabbage than on potato on 25 February, 4 April, and 18 April in the 1993-94 season and on several sampling dates in the 1994-95 season (Tables 2-3 and 2-6) (P < 0.05) . Simple correlation coefficients between numbers of B. longicaudatus and P. minor measured either at 0-20 or 20-40 cm deep among all sampling dates were not significant (P > 0.05). Similarly, simple correlation coefficients between numbers of B . longicaudatus in soil 0-2 0 cm deep and numbers P. minor in soil 20-40 cm deep on the same sampling date were not significant and are not shown (P > 0.05) . Discussion The greatest concentrations of B. longicaudatus and P. minor in this study occurred at different soil depths. Belonolaimus longicaudatus was most prevalent at 0-20 cm and P. minor at 20-40 cm. Nematicide treatment was effective in reducing densities of both species at both depths. Resurgence of P. minor after soil fumigation was observed on cabbage in the 1994-95 season but this phenomenon did not occur in potato during either season. Potato is considered

PAGE 54

a good host only for B. longicaudatus , but cabbage is a good host for both B. longicaudatus and P. minor (Rhoades, 1968; Weingartner et al . , 1983). Increase in numbers of P. minor on cabbage but not on potato suggests that P. minor resurges after soil fumigation in the presence of a suitable host. Since there were no significant correlations between P. minor and B . longicaudatus densities at the same depth or between densities at 0-20 and 20-40 cm deep, there was no evidence to suggest that resurgence of P. minor in this study was associated with lower numbers of B. longicaudatus after soil fumigation . Our observations that population densities of B. longicaudatus in potato and cabbage plots were greater in the upper 20 cm of soil than in deeper soil agrees in general with the findings of Brodie (1976) and McSorley and Dickson (1990a and 1990b) , who found that this nematode was more abundant at soil depths of 0-30 cm than at 3 0-45 cm. Highest densities of P. minor in this study were detected 20-40 cm deep, which also agrees with reports from McSorley and Dickson (1990b) that this nematode is prevalent between 15-45 cm deep on soybean. Brodie (1976) found highest

PAGE 55

43 densities of P. minor between 15-30 cm deep on soybean, and suggested that soil texture influenced the vertical distribution of P. minor as well as the distribution of other nematode genera. Since soil textures in these studies were similar at both depths, it is unlikely that the distribution of P. minor and B . longicaudatus at different depths was influenced by soil texture. Resurgence of P. minor in the 1994-95 season on cabbage after soil fumigation confirmed previous studies (Perry, 1953; Rhoades, 1968) . Populations of P. minor at planting were lower in the 1993-94 than in the 1994-95 season, and this could explain the lack of resurgence in the 1994-95 season. Weingartner et al . (1983) reported resurgence of P. minor on potato after soil fumigation due to migration from deeper soil. Resurgence of P. minor occurred on cabbage even though correlation analyses failed to show association of P. minor with B . longicaudatus . Data from these experiments also suggest that these nematodes have a distinctive depth preference and population densities seemed to be independent of one another. These observations suggest that factors other than competition between P. minor and B. longicaudatus are responsible for resurgence of P. minor following soil

PAGE 56

fumigation. It is possible that elimination and the resulting reduced competition of other organisms allows resurgence of P. minor. Additional experiments are needed to determine the effect of soil fumigation on other organisms that might affect populations densities of P. minor.

PAGE 57

45 o o U & -H -U U 0) 4-1 4-1 w £ 4-1 td 0) • H 5 o *» W CO Ml -U ° s E MH U 0) > rd 3 h XI QJ LO CM > H d P a rd CN CM pL 03 Dl CQ > o LO H LO LO Q 00 Q CX\ as o O ro o O o CO o r» o o LD cn LO ro in CN LD CN O en t** o o LO LO «J< CN o LD Cn O ^i* O c> Cn LO o rn rH t> CN CTi CN CN m CN VD LD rH rH H rH H in H H H H * * * * * CO CO CN CO mi L0 LO co LO 00 in cn rH rH LO on H o CN LO CN CN CN o ro LO m LD ro 10 00 in LO o 00 LO LTi Q Q LO CN O o LO CO CN ro o rH E't"> o CN LD ro 1* LO in LD ^* P> Cn rH LO rCN CN H X * * CO CN CN CN CN LO cn o i — 1 O H o CO o O ro CN O H H rH en LO rH LO Cn en cn LD ro LO lo LO O LO CN LO rO co CTi ro rH r» [*• CN H CN 00 cn LO ro o CN H LO LO LO ro cn H en co r» rn <* CN ro rH rCN >* ro H * * t-H o o 00 O ro o LO CN ro O ro | Q — CN o o H LO o i — i LO LD rH lo en o CN in lo H LO m CN p* LO CO o o ro CN LO o 00 O o cn t-H | LD r^. CTi CN in o CN o H o in LO CO ro Ccn ffl CN in LO H rH H in rH r» H rH r» H rH rH r» rH p> > PQ PQ Q n 5 id O X) X X X u ,* sh a m u Sh Xi PQ 2 22 Q u U u u o 0 4-1 0 0 E u o X X u & X X X X X X u rH
PAGE 58

46 o o u 0) c fa ro ro o CTl Lf) i> ro ro ID 4H H ro f* co O CN 0 M ro CQ Lysi 00 H CO H co ro CO LO rH O CO CO ro rH H rH H MS ID CO f*. n 00 ro ro LD Q ro LD ID p** \n ** 582 LD ro CO ro ID the an CN x 4jl H H CO CN H CO CN CI p» ro CO CN o 0 fa co H o ro CN rH o 01 rH CO ro o 00 ro o tn g G •H LD •H r-l -H 4J a TS g < Sh 0 00 LT) O co CO Ln ^< CO o CO CD CO o CD 0 u CO CN LD LO ro CN rH O CN o ro LD ro o ^« o £ Co og f» CN o r~ CTl ro CD CO o ro o CN ac a CO ro H 0 rH to H rrj O CD * * CO * o fa CD rH rH CD d< S3 rH o 00 CTl rH rH v| CO i IT C CN ro o O H CL, m rS CO £ CO H rH CO H <^ LO CO CN o CD CN CD CO LD ant CN 00 m CD r» H CO ro 00 CO in CN rH [*• CO CO 00 s CM CTl u •H CQ CN CN rrH CN o o CO CTl o CD LD <3< g co rH rH rH CM o •H cti DF rH t~ rH rH rrH H r» rH t*> H f» i fill ra CQ * > P CQ CQ P G m •rH rc u X! X X X U *> 4-J O X U PQ U U X! CQ as 23 P u u U LD O g CO o O & 0 0 CD 0 e u 0 X X! u X X X X X u o E H CD u M u CD u at ca 22 w U u 23 w p Q p p u p a w v| CD 0 CO in o 13 £ m CQ 4-> u CD MH rrj g lm H U CD * Mh TJ " o *j CD CD 3 0 ? « u •H 4J (0 E CD S3

PAGE 59

o o 47 u a .5 id B id CD W Li 0 M to 3 'H US i-H 0 § V-i 0 00 u 0) rH 0 LM 111 u a 3 •H U m > U-H o 3 q a o i H id c id e 0 4-4 jd d) in C id c 111 5 3 ' «j CO P CD o u o 4J U id q re! , tO =1 S-l X! 0) r» CN > Sh tO a a? ro CN !h (1) a) > 0 CN CN fa w s fa co fa ca fa Q > O CO * * CN I — 1 ro ro • o • ro • CO ro l> rH CD CD • H *t • o rH CN CN o O CO VD m o CO 00 CD o LO oo CO CD CN O rH LD LO CN CN ro O CN CN ro m CN cn CO cr> i> O ID O CN LO ro o CO CN 00 CN rCN CN CN O CN CN ro CN CD m LO *f O r» o CD CO t>« H H rH H rH LO rH rH CN CN rH * ai ro CD CD ^ o CN CO co o ro l o o CO O O o o rH en rH rH CN o ro o CN 00 ro CO o ca CD CO CD CD rH LO H CO 00 00 CD ro l o CN [» CN rH CD rH O0 CN rH CTl LO CD H 1*1 CN H CN H rH CN CN rH rH rH [-» H t> rH rH rH rH CH r> m PQ Q £ S 5 to O X X X U H PD U rH m Q U U u u 0 04 0 4J o 0 e 0 X X u X X X X X X u rH 3) Sh u 0) u m 2 fa U u fa a a a Q U Q 2 w (U u a (0 •rH u fC > CO rH « G (0 OJ A o 4J CD q •H t) M 0 u u tO o o v| Oh 4J q tO u H LW rH Cn H n * LO O v| 4-) q tO u •H 4H •H q 00 o -H 4J tO •H rH tO a) M-l T3 0 -H U ai -h U 4J U aS 3 E o

PAGE 60

48 o o U ID fl 05 4J tC T5 IS O •H § 01 3 H (C M 0 a o M D cq 4-1 o DQ u CD 2 a o 0 4-1 CD U a rH id > 4-1 0 is ( _ 73 w CD >i H 03 r-l 4J 05 fl 0 E u O fr a o CO id oo ca H -d a W m 6 0 0 u CI) ixs 0 ffg 03 6 0) a (0 CN T5 3 CN •rH o 4-> u Q) fC £ M-i H U 0) (1) O LTI CO co 2 * • * •X X co co CN ro ro CO ro CD ro CN rH ro ro co CN CN rH CD in ID in O o CD co O m CN in in CN co in CD rCN in P« O CO f o CN CN CO in O in U3 ro O CM in o co co H CN l> in in CN rH O ro co H CM o H <* o in rH ro CN H CM ID rH <* rH H CM ro H CN rH ro VO CN -K -X -X •X * * X * • X -X o o CD H ro m rH ro H in rH CD CO in CD r~ 00 ^< in CD rH rH CM rH rH O m o in CO CN CD CD O H CN ro in 00 o H rH CO LTI 1» in in CM o CN CO o CN in CN rH CN o O vo rrH CM CN CN CN o CD oo CM O CO CM ro CN co o O c« cm CN CN CO rH rH CN H H <* CM rH ro H rH rH H H H f> rH rH > pq pq Q CQ 5 03 u X X X U ~> O X U PQ u in PQ S3 £3 Q u U rH co U 0 a 0 u o O E u 0 X X X X X X X X u rH CD u u d) u PQ S3 w u u S3 H Q Q Q Q u Q S3 w DQ •H CO >1 rH 03 fl 03 CD fl O fl -H TO u 0 o u 03 o o VI Ch 4-1 fl cd u -H CM -H c Cn •H DO •x in o o g v| * -2 > CD 4H Tj 0 -H -rt U «W CD -H 'd U 4-1 B Vh (C J 3 E 2 O (D ? CO S3 C 03 U

PAGE 61

49 ro a E u u u 0) o 4-1 o 4H H U 4H 00 0 rH (1) 03 2j H E 01 3 >i q rH n5 a 0 id a) E O -H Sh U 4-1 H 4-1 , (0 En E a) 0 a 03 03 0) 03 -a 3 a) a rH 03 m o3 > i cn En i ro cn 01 q en "0 3 H a w 03 0 s a M 0 u H 03 4J 4-1 0) U 0 >H 03 fC U 4J 0) V & JJ d) 03 sr; 4H •rH MH q H s a s H 03 in X) d) En in CN rH 03 3 q cn En En En En 2 En D > O C/3 CO rH O CN IC o o Ifl * in CTl O ro rin o ( 1 ro in 00 LD o t> rH CN H CN CTl m o H o O CTl VD 00 00 e'o\ o H H en in rcn u3 * in CN O 0\ in cn o cn CTl CTl ro o 1 A LI ) *o ro ro (N o o o in o o in o o CN o o o H H o cn H CN H ro * CN r~ H KD rH O CO O o LD cn rH CN 10 p> CO CO CN vo fl C00 10 00 CN in (N o 00 in o 00 ro 00 H r*> Cn o in in o CTl cn 00 CN in CO o o o H o P" ro o CN rH o H o m in o in 10 vo 00 VD H CN CN o ro in ro in in o in f<£> IT) in o o cn CN CO t> o in H m H o CTl in ro en H in >* <* CN rH rH P« CN H * * f[*• ro CT\ 00 ro Cn rH CN CO H CN O o O <* o o H CM [m in CN CN in CN o 00 ro in CN CN in in CN 00 o rH in CN in H V£> r» CO H CN O in in rin ro ro in ro CN CN H ro CN in in CN ro 00 CN CN H F> H r* H > H t> H H rrH r> m n Q 5 Q s 03 U £3 X X X O X U m U M X! PQ •z Q u u u CJ 0 0 4-) o o e u 0 X Sh ft X X X X X X rH rH QJ u rH u 0) CQ & a u u 2 Ed Q Q Q Q U Q as Ed 1 0) 2

PAGE 62

50 m CO 6 JJ u u cu O MH O UH H 0> CU -H ^ 6 0 4J c a •H (D 5 g co m 3 CU in U 0 4-) U O 0 4-1 •H O U 4J 2 o Sh > o CO r4 CU CO 3 a a o co >l • rH — CD 4J e o H in 0 w o •H U 4J — 1 — a cu o Pi co co (I) (0 X) 3 cu C! H ffl rci rtj > ^ I CTl J-) ro Q) G cn T3 cd H co CO 0 a 0 u -H CO 4-1 01 CJ 0 M rt5 m r4 4J 3 CU U 4-) fe CO G H 14-1 C w id 4-1 0) a s: me ro I at CN i — i 0) H CU O 4J r-H CO T3 y-i C h O > O CO co ro CD CN CN !— 1 m m ro m CM H m ro CN o CN 01 m C7> * O o 01 in CN co o CN o CD * ro CD co CN * * o CTl 01 CN ro in ro IT) CN CN O CN > PQ cd u U 0 0 £ u o rH cu u rJ. m 23 u o o ro in rCN o rH o o CN o o H o o CTl co H 01 CD CD in CD CN oi ro t— ( Q LO CN [ — r^ rH rH i_n o CD H CTl in in O rH NT , — 1 H K K * LD ro O rH O O ^ o O rH ro o CN O CN CN CTl ro 01 CN rH O CD CD rH H o CO LD CO CO O CO r» CN o in n co co CN O CTl o CN o H m rH * * oi ro LO o CN rH p» o CD CO CD O o O ro CO O CD CN in CD o CD CN in O CN O CTl CN oi o H O CTi CO CO CN O CO CN o CN ro rH CD ri-H rH rH rH rrH Q PQ 03 Q £1 X X X U m U >h x: m 55 Q u u u X X O 4J 0 U X X X X X X u u U cu u W Q o Q Q u Q w cu u 4J a u -H 14-1 -H r4 CC r* (U o U -rH 4-) m " H 0 CU S3

PAGE 63

51 n g u u u 0) o 4-1 o M-l H HI S-l a d) -H nS B 0 V q V e B U K) a (D M 0 U T3 0 u X) o 0 4-1 "H In ai u m c (h tO H Q( Sh Id > 0 4H Cfl 0 Sh 0) m H ri CO >i a rH id 0 cci 0) £ T3 0 H Sh u 4-1 H ij t id b E c Q) o n in i CTl 1 JJ -* a -a a\ a CTl id rH ft CO , ^ w 0 s U 0 u -H m 4-1 4H 0 0 as id Sh 11 u 0) a 4-1 •H 4H c W id -U v fl s (1) £ -U i id CN a; •H 0) O -U rH to rd 4-i E-i O T3 s 03 > in 03 Sh X! QJ ITCH > U 03 C 03 b CO CN En CO fa * * CTA CO CD o in r— O IX) o rH CD • o • CN • en trrH o * CD CO 10 o rH in H CTl ro rH CN in rH CN CO m o in ro 00 O rH 00 in rH CN ro H CO CO in rH O CN rH rrH rrH H X u o rH m en o — E5 (C U u 0 u sh w o u u m x u u X !h 0 Sh Sh W ft CU Q v| o o o ro CD CTl en o rH 4-) P> CN o ro in in CO a (0 o CD in H CO •«< ru in CN CD CN CN ro co •H 4-J •H a CD •H rH CrH rrH rCO K CQ CQ 0 X X X u in o CQ SB 2! Q CJ u u 0 o X X X X X X u u v| Q Q Q U Q z w Q4 V 03 •rH U (0 > 4H o CO >1 rH m a as cu 4-) O 4J Cn C H T) r4 o u u 03 c o •H 4-> as H * 4H T) " 0 -H :r1 u
PAGE 64

52 B u 09 -U u CD O 4-1 O 4-1 H <1) H c & 05 O 4J 4J co rrj a R o tl 0 0) u 4J Sh . o U 4-1 H Sh a) 4J U id c to -H 4-1 > 4-1 o n r4 d) CO "I CO 9 >i • c a o) O 3 3 0) E TS 0 h k U 4-1 a o u fa £ c ai 0 a M DO 0) (TS 0) a I— 1 03 id CTj > LT) 1 Ol fa 1 4-) 01 0 B CTi 9 rH a w W o s a u 0 u •H to 4-> 0) U 0 u id u 4-> p a) u & -U O CO * •x * x * in CO 01 LD O 01 o O rH N VD CO CN in ro o IT! H o Ol ^> m o o 10 01 uo Ol o rH in LT) 00 o LD o OI Q [ — Q c N li o o co CM o «* H cn O ro o CN CN CO CO in p> H CN co f« rH CM IT) CN CM m 01 H >J3 CN rH <* H H H * • + * cP" o CN o CN to cin cn rrH H in r> L0 rH in H co H 01 H o rH »* LD in CN 00 1*1 in vj< ID H H o p| O CN CO m CN en ro CN rH H CO rH H rH CN H H rH CN rH rH rH rrH rH H rH PrH H rCQ n p m 3 id U X X u A! m V U m S5 Q u o u 0 a o 4-1 0 o e 0 X r-l 04 X X X X X U rH S-l M 0 u CQ Z w u u S3 fa Q Q 0 Q u Q as -rH u ? 4-1 0 CQ •H CO >1 rH (8 C (0 5 I 2 0 -H CU -H U 4-) r4 rd 3 E . O
PAGE 65

53 X) 0) 4-) ft •H T3 g 03 M-l a 3 0 CU T3 03 £ + o — CN I Ti O 0) 4J 0 -H G to E O u u IS o «> M " <"> CD g rg LTI ° a » o ^ ° a * H cU °> . CU H U rr-j 1 0 H CM •H 3= 0) u CO r-H 03 -U £1 Sh 0 rd 03 rH a< a 0) 01 03 X! 43 rd U 0 JJ rd U o o 0< co U 03 T3 3 03 U H tn 3 0 M cq co 3 +J 03 TJ 3 03 U "H § r-H cq CTl I ro 0> CN o r> rH CD rH CD 00 CN CO 00 ro CN rH m in H H CTl ro en CN rH H H rH ro n P•* rH O O CD O H CN o rrH H rH CD LD r> CD CD CN m CTl rH CN rn X CD CTl X in CD n in o •X H X •X O X CD CTl H CN CN ro Ln ^< H CO CTl O fl in in CD X CD X CTl X CTl fX X o o CN CN rH H H rH H rH H CO X 00 X •X in rH o in in X ro •X rH X O rH m rH rH rH ro H H H CD in O H CN CD CD ro CTl O CTl CD oo in o ^ CO CD o o o CO CO CTl rH rH CU i CD i ry ar 03 3 rH Q) 3 Sh u rH -rH > U 3 X! Sh rH U 0 cu 03 CU 0) rH S3 Q b bi £ < ro rH rH in rH 00 CN CN CN CN CN rH o in in CN X X X X X •X * •X X CD CTl rH o o CTl in in o ro O o rH ro CD CO o o CN 00 U 0) ry ar nJ 3 cu 3 iH U > B 43 U 0 m CU 03 SB tii s Ma CN ro rCN CN CN CN in

PAGE 66

01 rd X! m u o rd o Pi 0 q Oh 3 4J rd T3 3 O H § In o to 3 n 3 o cq 6 u o i o CN O CN B u o 'I* I o CN B v o CN I O B u o I o CN o CN I o B u o I o CN U o CN I O * * * X X * X •X * LD rco H O o o rH m o CO ^5 £^ 1£) CN ro 0\ CN rH rH rH CO Cn LD C< H CTl rH r> CO rH CN rH rH rH ^ o r> co CN U3 CN CN r-< O r-t r-t •X o X O X rH * z. CO X * CO CO rH o co o o CM VD CO rin o CTi rH O H cn 1X1 U3 U3 in cn ^t< cn CM H ro U3 CO CO H cn ro in H H ro X * •X •X * ro in i* o in H rCN CN H H rH H r* rH (Tl o rH CN O CN CN * •X •X •X • O ts in ro H O o o rH O o VD o o 1JD cn in in o o u Sh ry >> U 1 QJ ar U a X! rH M > i XI &H 0 a) ro , ss Q Be 2 <
PAGE 67

CHAPTER 3 SEASONAL VARIATION OF Paratrichodorus minor AND Belonolaimus longicaudatus IN SORGHUM -SUDANGRASS Introduction Most fields in northeast Florida (NEF) are planted to potato (Solanum tuberosum L.) during the spring followed bysorghumsudangrass hybrid {Sorghum bicolor (L.) Moench x S. arundinaceum (Desv.) Stapf var. sudanense (Stapf) Hitchc . ) as a cover crop in the summer (Weingartner et al . , 1993) . Cabbage {Brassica oleracea L. var. capitata L.) , although less important than potato, is another cash crop planted during the winterspring season. Among the most important plant -parasitic nematodes parasitizing potato and cabbage in NEF are Paratrichodorus minor (Colbran) Siddiqi, and Belonolaimus longicaudatus Rau (Rhoades, 1968; Weingartner et al . , 1983) . Because of potential restrictions in nematicide use, more attention is being given to the possibility of integrated control including crop rotation and other 55

PAGE 68

56 cropping sequences (Barker, 1991; Johnson and Feldmesser, 1987; Sasser and Uzzell, 1991). The choice of rotational crops that are nonhost to plant -parasitic nematodes can be used as a management strategy for improving yield of the following crop (Noe et al . , 1991; Nusbaum and Ferris, 1973; Rhoades, 1976; Trivedi and Barker, 1986). Sorghum could be particularly beneficial in rotation systems involving vegetables crops where root -knot nematodes {Meloidogyne spp.) are the main nematodes limiting production (McSorley et al . , 1986) . Furthermore, sorghum reduces erosion by wind and rain, increases organic matter content, and improves soil stability (McSorley et al . , 1986; Myhre, 1957). However, P. minor and B . longicaudatus reproduce readily on sorghum (Rhoades, 1976; Rhoades, 1984; McSorley and Gallaher, 1991) and could affect subsequent cabbage or potato crops (Rhoades, 1968; Weingartner et al . , 1983). When selecting cover crops, it is important to understand the effect of those crops on nematode population dynamics. Knowledge of the population dynamics of nematodes on the cover crop and the optimum sample depth for an accurate detection are important. Nematodes move in soil water, and laboratory studies show that soil moisture

PAGE 69

content has an effect on the abundance of Trichodorus spp. (Wallace, 1971; Mojtahedi et al . , 1997; Harrison, 1975). Seasonal fluctuations and vertical distribution of P. minor and Pratylenchus spp. may be associated with variation in soil moisture (Brodie, 1976; Kable, 1968; Harrison, 1975). Soil temperatures also may have an effect on the vertical and seasonal distribution of P. minor and B. longicaudatus (Brodie, 1976) . Belonolaimus longicaudatus was predominantly found in the upper 30 cm of the soil profile on soybean (Glycine max (L.) Merr.) and maize (Zea mays L.) (Brodie, 1976; McSorley and Dickson, 1990a; McSorley and Dickson, 1990b) , whereas P. minor was more abundant on soybean at 15-45 cm deep (McSorley and Dickson, 1990a; Chapter 2) . In a single season experiment, Harrison (1975) found P. minor to be more abundant in the upper 20 cm of soil from a field planted to sorghumsudangrass . However, there are no reports of the depth distribution of B. longicaudatus on sorghumsudangrass. The objective of this research was to compare population changes of B . longicaudatus and P. minor in soil 0-20 cm and 20-40 cm deep on sorghumsudangrass . Similarity

PAGE 70

58 of trends between precipitation or soil temperature and population changes of B. longicaudatus and P. minor during the sorghumsudangrass growing season were also examined. Materials and Methods Experiments were established from 1992 to 1996 in two different fields (about 500 m apart) at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Field A was designated as bed 12 (new land) , and field B as bed 9 (old land) . Soil texture in field A was 94.6% sand, 1% silt, 3% clay, and 1.4% organic matter; with pH 5.5-6.0. The soil was naturally infested with P. minor and B . longicaudatus . Sorghumsudangrass hybrids had been used as cover crops during the summer months following the potato season for at least 25 years in field A and for the last 10 years in field B. In field A, each plot consisted of one 10-m-long row. In field B, each plot consisted of four 30.5-m-long rows 101 cm apart. Plots were irrigated as needed (Rogers et al . , 1975).

PAGE 71

59 In field A, soil samples consisted of six cores (2.5 cm diam.) taken 0-20 cm and 20-40 cm deep during the 1994 and 1995 sorghumsudangrass seasons on different dates (Table 31) . In field B soil samples consisted of 20-25 cores (2.5 cm diam.) taken 0-20 cm deep during the 1992, 1993, 1994, 1995, and 1996 sorghumsudangrass seasons as summarized in Table 3-1. The cores were mixed manually and a 100-cm J subsample was removed for nematode extraction. The subsamples were wet-sieved through 850-|am and 28-^lm pore sieves. The material retained on the 28-|Jm sieve was processed by a centrifugal-flotation technique (Jenkins, 1964) . The extracted nematodes were dispersed in water in a gridded counting dish, identified, and enumerated. The ratio between population densities at the end of the sorghumsudangrass growing season (Pf) and preplant population densities (Pi) of P. minor and B. longicaudatus was calculated. Rainfall and daily minimum and maximum soil temperatures at 10 cm deep were recorded throughout the sorghum growing seasons at the University of Florida Hastings Research and Education Center weather station.

PAGE 72

60 rH CD H < 0 H QJ -H ID 0 2 X! >i rH 4-) 4J ca 4-> (0 3 r-H C~OS 3 u U 0^ CO b 03 H s b o o H 4-1 X < 0 o H CD X O IT) ft m CM a co H (N H rH a) 0 QJ a CA 4-> rH r» Cfl tfl =S b (0 H H 4-) b « i 0 ro a) x A m CM a co 0 >i QJ XJ « >. jj rfl G rH rcC tn > > rfl £ 3 as h 2 0 0 4J b « i S3 S3 0 V X , >1 U b QJ O O r» * CO Oj CN CQ g e CN 0 0J >M >H 43 4J 2 rH QJ tJi rH CO 3 N lH 4-1 b b It) 0 0 in CO 04 CN C5 1 CD QJ in O tn >i s Ch 4J re! rfl 3 rH r(Tl as X) s b a) H H 4-> X) i O re! in H a) X U CN CN Q w qj O 2 X) CTl 4J 3 rH r05 3 b rfl rH H b « 1 0 ro QJ X ft r> CN a CO n a & CO uj r4 u E TS U 0 CO 3 CD -H > tn a QJ CD 0 U u 3 > r4 !h rc o rH 0 ft U EC co a, U CD rH a 3 4-) 3 b u b O LT) n (N it) to tn > 2 3 o CN CN >,.... rH tjl & 4J 3 3 CD U b rH CD a 3 a cd b <( co 00 00 CN H H CN QJ 3 3 b CN • tn tn 3 < o ^ ro CQ CD rH rH •H § O tO CO CO 4-1 u o > o S3 CJ o 4J u o 4-1 u o I E 3 43 a tn co U XS O 3 co co to * CO TS to cd U 4J tn co QJ > U aJ 43 X! r4 T3 rfl (0 C H > OS 43 u rH i CO CO rH 0 00 a> 43 4-> TS 0J 4-) rd O Oh U O 0 (3 •H d rrj 13 CD O 43 u CO a) S CQ CO rO U tn B res TS CD I I tn u o co >i 4-1 QJ •cH r4 a) > CO CO (0 U tn 3 CO TJ co i E 3 43 tn r4 o CO

PAGE 73

61 Results and Discussion Season Variation in Population Densities of P. minor Field A . 1994 season: Paratrichodorus minor numbers were highest on 3 August in this season and population densities of P. minor were greater at 0-20 cm than at the 20-40 cm deep (Figure 3-la) . 1995 season: With the exception of 18 July, population densities of P. minor were greater at 20-40 cm than at the 0-20 cm deep (Figure 3-lb) . During both seasons, populations densities of P. minor in soil from this field were highest in August. The ratio between population densities at the end of the sorghumsudangrass growing season and preplant population densities of P. minor before planting (Pf/Pi) was greater than 1 . 0 at both depths and in both seasons (Table 3-2) . Field B. Population densities of P. minor showed similar trends in the 1992 and 1996 sorghumsudangrass growing seasons. Numbers peaked on 4 September in 1992 and on 6 August in 1996 and decreased toward the end of both seasons. During the 1993, 1994, and 1995 sorghumsudangrass

PAGE 74

62 growing seasons, P. minor numbers peaked at the end of the seasons between October and November (Figure 3-2a) . Paratrichodorus minor population densities increased during the five sorghumsudangrass growing seasons (Pf/Pi > 1.0) (Table 3-2), with highest population densities (61-108 P. minor/100 cm 3 of soil) from August to November (Figure 32a) . Season Variation in Population Densities of B. lonqicaudatus Field A . Highest numbers of B . longicaudatus occurred on 3 0 August and 18 August at both depths in the 1994 and 1995 seasons, respectively (Figures 3-lb and 3-lc). With exception of the 20-40 cm depth in 1995, B. longicaudatus population densities increased during the 1994 and 1995 sorghumsudangrass growing seasons (Table 3-2) . During both seasons, population densities of B . longicaudatus were greater at the depth of 0-20 than at 2 0-40 cm (Figures 3-lb and 3-lc) . Numbers of B. longicaudatus were, however, more evenly distributed at both depths during the 1995 than in the 1994 season (Figure 3-ld) .

PAGE 75

63 Field B . With the exception of the 1994 season, B. longicaudatus numbers increased (Pf/Pi > 1.0) during all the sorghumsudangrass growing seasons (Table 3-2) . Belonolaimus longicaudatus numbers were lower (<10 nematodes/100 cm 3 of soil) during the 1992, 1994, and 1995 sorghumsudangrass growing seasons (Figure 3 -2b) than during the 1993 and 1996 seasons. Population densities on sorghumsudangrass peaked from August to November in this field (Figure 3-2b) . Both P. minor and B. longicaudatus increased in densities in fields A and B on sorghumsudangrass . Highest population densities for both species were observed between the first week of August and the first week of November. Substantial numbers of B . longicaudatus and especially of P. minor were found at 20-40 cm deep in soil from field A. Sampling to a depth of 4 0 cm would provide a better estimation of the population densities of these nematodes. Relative abundance of P. minor at the two depths was not consistent between seasons. During the 1994 season in site A, more than 50% of P. minor numbers were found in soil 0-20 cm deep, whereas in the following season, more than 50% of the population was found 20-4 0 cm deep. Although several

PAGE 76

previous studies on the depth distribution of trichodorids report greatest numbers of nematodes at depths of 15-45 cm (McSorley and Dickson, 1990a; McSorley and Dickson, 1990b; Szczygiel and Hasior, 1972) , others cite trichodorids as being more abundant in the top 20 cm of soil (Boag, 1981; Harrison, 1975) . Our observations that the greatest number of B. longicaudatus were in the top 20 cm of soil agree with results of several other studies (McSorley and Dickson, 19 90a; McSorley and Dickson, 19 9 0b; Todd, 198 9; Chapter 2) . Trends were inconsistent between population changes of B. longicaudatus or P. minor and total monthly rainfall (Figure 3-3) or mean monthly soil temperatures from the site during the sorghumsudangrass growing season (Figure 3-4) . The use of irrigation and other factors may have masked any effect of rainfall and temperature on nematode densities. Paratrichodorus minor and B. longicaudatus may be sensitive to other factors in the soil besides rain and temperature, making population changes difficult to predict. Pasteuria spp . were observed parasitizing B . longicaudatus, which confirms previous reports of B . longicaudatus as host of Pasteuria spp. (Dickson et al . , 1994; Giblin-Davis et al., 1990; Hewlett et al . , 1994). Pasteuria spp. also might

PAGE 77

affect P. minor populations, since P. minor has been cited as host of Pasteuria spp . in Florida (Birchfield and Antonopoulos, 1978) . Metals such as Cu and Mn, and soil compaction were associated with changes in trichodorid population densities (Boag, 1985; Cooper, 1971) . More research is needed to define other variables such as presence of biological antagonists, chemical composition of the soil, pH, soil compaction, density of root biomass, height of the water table, all of which may affect the seasonal variation of these nematodes in agricultural north Florida fields. Since P. minor and B. longicaudatus increased in the sorghumsudangrass planting during the summer, other cover crops that may reduce population densities of these nematodes should be studied (McSorley and Gallaher, 1992) . More cover crop options need to be offered to growers in this region.

PAGE 78

66 Table 3-2. Ratio between population densities at the end of the sorghumsudangrass growing season (Pf) and population densities before planting (Pi) for Belonolaimus longicaudatus (BL) and Paratrichodorus minor (PM) in soil 020 and 20-40 cm deep in field A and soil 0-20 cm deep in field B. Pf /Pi Field A Field B 0-20 cm 2 0-40 cm 0-20 cm Season BL PM BL PM BL PM 1992 11 . 0 4 6 1993 15 9 217 0 1994 1 7 7 3 16 0 2 .2 0 2 3 6 1995 1 2 1 2 0 2 3 .8 40 0 13 0 1996 2 1 32 0

PAGE 79

67 Xtos jo uia oOT/sspoaeiuajj XTOS JO 1113 00T/S3PO3BU13N f E U y * \ \ o\ \ \ CTl rH to -u 73 m 0 oq O * to w as tn a rd OQ HI M 0 0) ^ S o a 0 d a 0 u » dj CO e u o I o 4J •u CTl |i ts £ Is rH G M 23 US, s H 1 da IT-OS 30 ( uid 00T/sapo3EuiaN XTOS JO 00T/83PO3EUJSN CI CD 3 tn H 3 7S o H tn §

PAGE 80

120 minor 4-26 6-25 7-15 8-4 8-24 Sample dates 9-13 11-12 Figure 3-2 sudangrass a ) Para tri Nematode densities/100 cm 3 of soil on sorghumin field B, 1992, 1993, 1994, 1995, and 1996 seasons chodorus minor. b) Belonolaimus longicaudatus .

PAGE 81

Cn d H u TS 16 tj •H Ih o rH fa DQ 01 4J CO rH (TS c (C 6 r) rd id fa CTl ct\ £ H O Cn ^ a cr> •H CTl > H H h ro cn 0) cn Xi H JJ 4-> CN (C CTl CTl C rH O •H •• 4-1 C rc 0 4J CD -H fd a Q) -H CO U (U u >1 rH 4J a o B U o m i C -H 0 u Cn CO CO ro !h Cn C n5 T3 3 DQ l E Cn O w 0) 3 Cn cu H 43 fa 4-1

PAGE 82

70

PAGE 83

CHAPTER 4 ESTIMATES OF SAMPLE SIZE FOR DETECTION AND ESTIMATION OF INCIDENCE AND SEVERITY OF CORKY -RINGS POTINFESTED POTATO Introduction Corky ringspot (CRS) , caused by tobacco rattle virus, is an important disease found on one-third of the potato (Solanum tuberosum L.) farms in northeast Florida (Weingartner and Shumaker, 1990) . Trichodorid nematodes transmit the virus (Walkinshaw et al . , 1961) by feeding on healthy tubers (Van Hoof, 1964) after they acquire the virus, possibly from other infected hosts. Symptoms result in cosmetic damage, making the potato unmarketable (Weingartner et al . , 1983). External and internal symptoms are usually, but not always, characterized by necrosis of the skin or flesh in the form of arcs or rings (Weingartner 1981) . Economic losses due to CRS on potato depend on the percentage of affected tubers (incidence) and the severity of infection (Weingartner and Shumaker, 1990a) . The use of nematicides is a common practice in northeast Florida to 71

PAGE 84

72 lessen severity of infection and can reduce losses due to CRS by up to 25% (Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b) . The potato chip industry, farmers, and researchers rely on the information obtained from potato tuber samples to estimate incidence and severity of CRS on potato (Weingartner et al . , 1983; Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b) . Since decision making is based on information obtained from the samples, it is essential to understand the relationship between sample size and accuracy (exactness) and precision (variability) of the information in the sample. In the Pacific Northwest, an entire harvest may be rejected if potato tuber samples with 5% to 10% CRS symptoms are detected (Williams et al . , 1996). The proportion of potato tubers affected with CRS in the sample is used to estimate the incidence of CRS in that field. Estimators, which are formulas or rules, are used to estimate parameters to make inferences and (or) decisions about a population (Mendenhall et al . , 1990). In this study, the populations of interest are the percentage (incidence) of potato tubers affected with CRS and the extent to which each potato tuber is affected with CRS

PAGE 85

(severity). Point estimators (e.g. a number such as the sample mean x) use information from random variables (e.g. number of potato tubers affected with CRS) contained in the sample. Therefore an estimate also is a random variable (or a statistic) with a probability distribution called the sampling distribution of the estimator (Mendenhall et al . , 1990) . Sampling distributions are used to determine precision and accuracy of an estimate, such as x, estimating u (the true mean) of the entire population of CRS-affected tubers. Similarly the estimate S 2 (the sample variance) is used to estimate a 2 (the variance) . The accuracy and precision of the information in the sample will set the reliability of the estimates x and S 2 . Determination of sample size is crucial to secure a desired level of precision. Since confidence intervals decrease as the sample size increases, larger samples provide more precise information, however, resulting in a greater work load creating higher costs (Freund and Wilson, 1993) . Acceptable costs and sample size will vary depending upon the level of precision needed and nature of the study. The optimum sample size will be the one that provides the

PAGE 86

74 most precise information for a particular purpose at a minimum cost . The objective of this research was to estimate optimum sample size to detect the presence of CRS, and to determine sample sizes needed to estimate incidence and severity of CRS within given levels of accuracy and precision. Materials and Methods Experiments were established during two winter growing seasons from 1993 to 1995 at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Soil texture was 95% sand, 2% silt, 3% clay, and 1.4% organic matter; pH 5.56.0. The soil was naturally infested with the trichodorid nematode, P. minor (Colbran) Siddiqi, and had a history of problems with CRS. Potato had been grown on the site during each winter and a sorghumsudangrass hybrid {Sorghum bicolor (L.) Moench x S. arundinaceum (Desv.) Stapf var . sudanense (Stapf) Hitchc.) had been used as a cover crop during the summer after the potato season for approximately 25 years. The potato var. Red LaSoda was used in the study because

PAGE 87

75 this variety exhibits typical external and internal tuber symptoms of CRS . Potato tubers were planted manually on 21 December 1993 for the 1993-94 season and 23 January 1995 for the 1994-95 season. Potato seed tubers were planted manually at a spacing of 15 cm in single-row, 10 -mlong plots. The soil fumigant 1,3 dichloropropene (1,3-D) was applied 32 cm deep in row with a single chisel at a rate of 56 L/ha on 24 November 1993 and 16 December 1994 into selected plots, to give a total of eight treated plots and eight untreated plots. Standard practices for fertilizer application, weed control, and insect and disease management were used (Hochmuth et al . , 1996). Plots were irrigated as needed (Rogers et al . , 1975). All potato tubers from each plot were harvested mechanically on 7 June 1994 and 25 May 1995. Potato tubers were washed and graded to size and all the tubers (>3.0 cm diam.) harvested from each plot were counted. Individual potato tubers were examined for external and internal symptoms of CRS. External and internal incidence (e. g. proportion) of CRS was determined by dividing the number of potato tubers with symptoms by the total number of potato tubers per plot. In addition, internal and external

PAGE 88

76 severity index values from 0 to 10 were assigned to each potato. Severity was assessed by cutting the potato into eight pieces and examining each piece for internal and external symptoms. Severity values from 0 to 8 equaled the number of potato pieces with symptoms, and then 9 = all pieces showing symptoms with 25% to 50% of the surface affected; 10 = all pieces with symptoms >50% of the surface necrotic . A data set consisting of the total number of potato tubers, internal and external presence of CRS symptoms, and internal and external severity index for all tuber from all plots, was created. This information was recorded from all potato tubers in every plot . Random potato tuber samples of different sizes were simulated from the data set for each plot using several SAS^ (SAS Institute, Cary, NC) procedures with the assistance of Mr. Jay Harrison from the Department of Statistics at the University of Florida. The following variables were used in the program for the simulation of each sample: plot number, total number of potato tubers from that plot, sample size (5, 7, 10, 12, 15, 17, 20, 22, 25, 27, 30, or 35 potato tubers), and an arbitrary number to be used as a starting point to generate a series of random

PAGE 89

77 numbers equal to the sample size. These random numbers were used to select specific potato tubers from the data set, to generate a sample of the desired size. The sample mean (x) and standard error of the mean (S x ) were then calculated. Percentage of deviation from the true mean ((J.) , calculated as [ (x x 100, and S x of incidence (internal and external) , and severity (internal and external) were estimated from each sample in a plot. The W of a plot was available for incidence (internal and external) and severity (internal and external) because the entire population of potato tubers from that plot had been examined. Each arbitrary sample size for a given plot was simulated 30 times. Averages of percentage of deviation from the mean (PDM) and S x for each sample size in a given plot were calculated from the 30 simulations of a given sample size. Thirty samples of potato tubers of size n were used to estimate (i and a 2 . The samples yielded 3 0 random values of x and S~ (variance of the sample mean) with their own probability distributions. The 30 random values x have a a 2 normal distribution with mean u and variance — , and the 30 n

PAGE 90

78 random values S2 have a chisquare distribution with n-1 degrees of freedom times a constant or K x X 2 (n-i)/ provided we are sampling from a normal population with mean u and variance a 2 (Mendenhall et al . , 1990). Since x and Sare X unbiased estimators of u and — respectively, the expected n CT 2 value of x is equal to u (E(x) = u) and E ( S) = — . x n Three plots representing maximum, minimum, and average incidence (internal and external) and severity (internal and external) values were selected for further analysis. These plots were selected to represent the entire range of possible values in our experiments. For each of these plots, the sample statistics percentage of deviation from the mean (PDM) and were correlated with sample size. Power models of the form y = an~ b were fit to the relationship between PDM or and sample size. Simple linear regression was calculated between true external incidence and true mean internal severity from the 32 plots (16 plots per year x 2 years) . Binomial probabilities of detecting at least one potato tuber with CRS symptoms with a sample size of 20 potato

PAGE 91

79 tubers were calculated for each plot (McSorley and Littell, q ; where n = 2 0, f = number of potato tubers with symptoms, p = fraction of potato tubers from the plot with symptoms, and q = 1 -p. For example, P(f) = 0.86, means that there is a probability of 86% of detecting an infected potato when taking a sample of size 20. The potato tubers with symptoms were assumed to be randomly distributed, which is more likely to happen once the potato tubers are harvested and put into bags . Results For a given plot, the relationship between the sample size [n) for mean severity (internal or external) and for incidence (internal or external) and deviation of the sample mean from the true mean u for that plot (y) was described by a negative power function of the form y = an b (Figures 4la, 4-lb, 4-2a, and 4-2b) . Increasing the sample size for all these relationships improved the accuracy (e.g. higher E( ( | x u | / u ) x 1993) . The formula used was P(f) = £ (n-f) = 1 100 . The increase in accuracy was greater when estimating

PAGE 92

80 the mean internal and external severity in plots with low true mean severity (e.g. u < 1.5) than in plots with higher true mean severity (e.g. u > 3.8) (Figures 4-la and 4-lb) . Similarly, when estimating the mean internal and external incidence of corky ringspot, accuracy increased at a greater rate with increasing sample size in plots with lower incidence (a < 0.5) than in plots with higher incidence (Figures 4-2a and 4-2b) . For any true plot mean value (u) of incidence or severity, the increase in accuracy with sample size when estimating \x diminished rapidly for sample sizes above 20 potato tubers. The relationship between sample mean standard deviation ( S x ) an ^ sample size was described by a negative power function of the form y = an' b , for mean internal and external severity (Figures 4 -3a and 4 -3b) and for internal and external incidence (Figures 4 -4a and 4 -4b) . When estimating mean severity (external or internal) the gain in precision (lower a ) with sample size was greater for plots with higher mean values (u > 1.5) than for those with lower mean values (|4. < 1.5) . The gain in precision with increasing sample size was greater when estimating incidence (external or internal) for plots with

PAGE 93

81 mean incidence values (u) closer to 0.5. The gain in precision diminished with sample size and became insignificant at sample sizes above 20 potato tubers regardless of the true mean u of the plot. The value of the exponent b decreased with the true mean u for each plot in all cases. The relationship between external incidence and mean internal severity was linear with r 2 = 0.87 (P < 0.01) (Figure 4-5) . Also the relationships between external incidence and mean external severity (y = 4.477z 0.2967, r 2 = 0.93, P <. 0.01), between internal incidence and mean external severity (y = 4.654z 0.4027, r 2 = 0.96, P < 0.01), and between internal incidence and mean internal severity (y = 5.1676z 0.344, r = 0.91, P < 0.01), were linear . The binomial probability of detecting an infected potato with a sample size of 20 (or any sample size) increased with increasing incidence values (Table 4-1) . Discussion The relationship between percentage of deviation from the true mean u and sample size n, is represented by the

PAGE 94

fitted line y = an' , where y is equal to the expected value of the absolute value of [(x x 100 and n is the sample size. Thus, E( ( (1 | / H ) x 100 ) = 100 x V(*-m)V = 100 x a In rj — x E Since the express ion — 2 1S distributed approximately as a y, a In X(,) (Mendenhall et al . , 1990), then E( ( | x u | / u ) x 100 ) r(i) I 2 CT 100 x E^X(i) x — x „ I2J V2 0 . 5 x 100 x CVx n , where T is the incomplete gamma function. The value F(a) is a-l equal to \^e ^dx (Mendenhall et al . , 1990). If a is an 0 (3 r(i) integer, then T(a) = (a-l)!. Denoting the quantity —rpr V2 r \2J as the constant (k) , E( ( | x |u | / fi ) x 100 ) = k x CV(%) x n °' 5 . In the fitted line y = an" h , the coefficient a = x CV(%) , b = 0.5, and n = the sample size; then CV(%) = — . k In the relationship between percentage of deviation from true mean severity and sample size (equation y = 100 x

PAGE 95

83 -0.5 — x k x n ) , the coefficient a =k x CV% , decreases (less variation) with increasing values of u (Figures 4-la and 4lb) . Similarly, in the relationship between percentage of deviation from true mean incidence u and sample size, (equation y = 100 x 1 x k x n ) , the coefficient a 2 n P from the fitted line decreases with increasing values of the true mean u of the proportion p (Figures 4 -2a and 4-2b) . Potato tuber samples from fields with high true mean values of incidence or severity would require smaller sample sizes than fields with low true mean values to achieve a certain level of accuracy. The relationship between sample mean standard deviation and sample size is represented by the fitted line y = an' b , where y is equal to expected value of g. Thus, y = E^-) = E, (n-l) 2 s 2 X Un-\)n Since 2 is distributed a approximately as i ( 2 n _ 1} , then E(g-) = ° E ' \n-\)n (n-0

PAGE 96

84 x a x (n-1) -0 . 5 . x n -0 . 5 Using Sterlings formula (Feller, 1968) , the expression = (n-1) 0.5 for large sample sizes; therefore x n -0 . 5 From the fitted line y = an' , the coefficient a = a , and n = the sample size. The coefficient was higher (higher a) for plots with higher values of true mean u severity than for plots with lower u (Figures 4 -3a and 4 -3b) , and highest for plots with true mean (X incidence closer to 0.50 (Figures 4-4a and 44b) . Thus, potato tuber samples from fields with high u severity and |o . 5 p\ values would require smaller sample sizes than fields with low u severity and |o . 5 p\ values to achieve a certain level of precision. The absolute value of the exponent b decreased with the true mean u severity and as |o . 5 p\ increased (Figures 43a, 4-3b, 4-4a, and 4-4b) . The deviation of |b| from the theoretical value 0.5 was due to the violation of the normality assumption and to small sample sizes. Using the

PAGE 97

85 theoretical fitted line y = a x n~°' s would overestimate S' X particularly at low sample sizes. Possibly the population of infected potato tubers resembled more a normal distribution as u severity increased and as p was closer to 0.5. The sample size commonly used in the northeast Florida potato production area for diagnosis and assessment of corky ringspot disease is 20 (D. P. Weingartner, pers . comm.). Gain in accuracy or precision when estimating incidence (external and internal) and severity (external and internal) decreased substantially beyond a sample size of 20 potato tubers for all the plots tested. A sample size increase from 5 to 10 potato tubers would increase accuracy and precision by 41%, whereas the same increase from 20 to 25 potato tubers would increase accuracy and precision only by 12%. Large increases in sample size would be needed to gain considerable accuracy or precision beyond a sample size 20. Sample sizes smaller than 20 (e.g. 15) would estimate mean severity with lower precision (higher a ) in fields with high u values than in fields with low u values. Conversely, in the relationship between accuracy of the estimate x and u, accuracy increased (lower PDM) with higher values of true

PAGE 98

mean severity (i for a given sample size. Sample sizes smaller than 20 (e.g. 15) would estimate mean incidence with lower precision (higher a ) for values of (a (true proportion p) close to 0.5. Accuracy increased (lower PDM) with lower values of true mean incidence \i for a given sample size. Ultimately, the optimum level of accuracy and precision will be determined by the objective of the sampling (e.g. chemical control tests, breeding for resistance, quarantine) (Weingartner and Shumaker, 19 90a; Weingartner and Shumaker, 1990b) and the relationship between acceptable risks and sampling costs. The probability of detecting the presence of CRS in potato lots with a sample sizes of 20 potato tubers will be high (>97%) if the actual incidence in the field is higher than 16%. According to this experiment, 7 out of 32 plots had a fairly high probability (>17%) of escaping detection. This probability could be brought to low levels by increasing the sample size. For example, in a plot with 8% of incidence, a sample size of 4 0 potato tubers would have only a 3% probability of missing detection. Of course bringing that probability to 0% would require sampling the whole population of all potato tubers in the plot. The

PAGE 99

87 acceptable risk of missing detection will depend on the purpose of the sampling and the cost. The binomial probabilities were based on the assumption that the infected potato tubers were randomly distributed due to harvesting, cleaning, and grading. This may not be the case for infected potato tubers that have not been harvested. Infected potato tubers in the field may likely have a spatial distribution similar to that of their nematode vector. Generally, nematodes follow a negative binomial distribution in the field (Anscombe, 1950) . Since we assumed random distribution of the infected potato tubers, possibly the use of other formulas (e.g. negative binomial) , would give a more accurate probability of detecting infected potato tubers in the field. True incidence (external or internal) and true mean severity (external or internal) were highly correlated (r 2 values from 0.87 to 0.96, P < 0.01). This explains why patterns in accuracy and precision for all these parameters showed similar shapes when related to sample size. External incidence and mean internal severity were highly associated in this potato variety. The regression equation y = 5.08z -

PAGE 100

88 0.2031 (r = 0.87) would allow us to estimate and predict internal severity (y) by knowing external incidence (z) . The results presented here can be used as tools to develop sampling plans of a desired accuracy and precision for this potato variety. A sample size of 20 potato tubers would be a reasonable choice of sample size for detection and evaluation of CRS in chemical control tests. Beyond sample size 20, the increase in accuracy and precision levels off at most incidence and severity values, and the relationship between standard error of the mean and sample size fits closely the theoretical model y = a x n' 0 ' 5 . Similar studies should be done using other commercial potato varieties and localities that may show different relationships between sample size and incidence or severity.

PAGE 101

89 Table 4-1. Binomial probability of detecting a corky ringspot (CRS) -infected potato tuber in plots with different incidences of the disease in samples of 20 tubers. Plot No. of tubers Tubers Incidence P(f . t >o ) f number harvested with CRS (%) 1 307 9 2 . 93 0 .45 2 259 14 5 . 41 0 . 67 3 198 12 6 . 06 0 . 71 4 287 23 8 . 01 0 . 81 5 308 26 8 . 44 0 . 83 6 330 28 8 . 48 0 . 83 7 266 26 9 . 77 0 . 87 8 246 31 12 . 60 0 . 93 9 310 49 15 . 81 0 . 97 10 332 62 18 . 67 0 . 98 11 193 37 19 . 17 0 . 99 12 318 62 19 . 50 0 . 99 13 385 92 23 . 90 1 . 00 14 213 52 24 . 4 1 1 . 00 15 346 90 26 . 01 1 . 00 16 295 82 27 . 80 1 .00 17 203 58 28 . 57 1 . 00 18 367 115 31 . 34 1 . 00 19 371 117 31 . 54 1 .00 20 227 75 33 . 04 1 . 00 21 290 101 34 . 83 1 .00 22 198 74 37 .37 1 . 00 23 205 100 48 . 78 1 .00 24 204 101 49 . 51 1 . 00 25 216 121 56 . 02 1 . 00 26 169 101 59 . 76 1 . 00 27 221 134 60 . 63 1 . 00 28 163 108 66 .26 1 . 00 29 223 163 73 . 09 1 . 00 30 166 124 74 . 70 1 . 00 31 168 128 76 . 19 1 . 00 32 205 160 78 . 05 1 . 00 *f = number of symptomatic potato tubers, P{f > 0) = probability of detecting one or more symptomatic potato tubers .

PAGE 102

CO LD CD LO CM o T — n II ii a. It -1< o 4J rd 4-> CD 4-1 0 C O H -H rd CD T3 X O 4J w rd e J o T) 4-1 d) a d o H Jj (0 H > 0 a x3 cu 4J -U O P o CO CD CO Q) rH rd > C cd CD g 4-> c CD CD HH rd 4n CO o G 0) -H fjl rd 4-1 4J o c a •h a >h <4H -H >n o s Sh a> to o tn 4J u rd o u i — l cu a > rd CD X! 4J o >, 4-> •H U CD CD a> x CD > 4-> S-l 0 CD O CO XI <4— I CD CO rd 13 iC N ^ tO -H CD Pj 4-> O G -H M 4-) rH rd a • rH g rd CD rd rH en to i T3 • a CD CO rd ^ U 3 D C in X rd •h ^ 0) O £ rd u -H 4J 0 ^ O CD X! U CD X 4J 4-) a CD co CD a CD U (%) ueein anjirj eqrt uiojj uot^btasq

PAGE 103

91 3 * a -H QJ (0 a)

PAGE 104

92 00 CM o> CO d d d ii ii ii f3 o5 4-) s3 (3 a> o * in 4-> CU CU m b u 4-> " 4J 0) a o n rH o3 a co T3 o 0) (0 4J hH CD •H T3 CU V-l a; m-i B n o a) 4-1 a o o •H tO 4-) 11 nt ia rH -H a > B 0) rH is t) id CO 0 3 H 0 q 05 Q) CU 01 B oj 4J O 4J 0 a 4J co a CD Q) a o a -H in !h CU 4J a a .V 4-J Sh m o cu O 4-4 o cy 4-i CD -H 4H 03 TJ o u 0) 43 CU > 4-> U 03 -H CU n Tt O Q ri (1) 4J o s o |3 4-1 rH •h cu a 43 rH CU 03 a cu a -h m R 43 ^ CU CO 4-) 4-1 a c o H -H 0 4J 4H 03 • rH n3 1) (U CN N I -H CO CU CO CU U U rH P cu a & 43 B •H ? U Cu 4-) CO X ii cu T3 O 6 03 U -H 4J
PAGE 105

93 00 0) CD CD o o d II II n =L a O (0 4J cu « b O J-> CO a o cu aS ft -.H -d r— i O Q) CO X! T) n5 -u cu e o CU Pi 4H o o o Q cu CO 4-> rH cu as as rH -rl > a > e cu 0 tjl rH aJ ft ft j-> co C -u CD Q) C C U CO H U U U 0) CU ft M-l >, M-l ^ U-l -H ^ O T) O U CU 43 CD 4J dm IM id •H II 0 >H 3: CU cu > CO 0 as u rH a 0 CU 0) rH Tj d 0) ft O -H cu e O 3 CU a 4-1 a> rH H •iH (TS ft 4J a •H Sh CU u 0 ^1 CD CO M-l 0 4J cu X 0 W H CU JJ N (0 -H cu rH CO X! X! CU 4-> CN tK CU 1 rH 4-1 G i cu
PAGE 106

o CM <* vf o CM CO c\i CNJ II n II b t> b CD CO 00 in ii TT O ro in CM o CN N •H CO 0) rH Pi CO o m -U o d) d) H J3 E a 01 T3 to (CCD T3 <3 Sh o (C (13 0) D a; x: 4-) 4H O 4H o a o m co to C 4-1 •H O o u as U 0) > 4-1 O s c a o H -H 4-> (C • rH rO (U ro a; CQ l) rH > m QJ £ O rH a 4J 0) u 0) 4-1 4-1 i/i -H „• IJ 3 b q to II 4-) O >N rH Qa rH 0) 0) TJ uB9ui aq-j jo jojis p-iBptre^g d to iH r^ 3 0) Cn XI •H 9 b 4J SH 4J M O 14-1 id u •H 4J 1) M O 0) XJ 4->

PAGE 107

95 o T— o 3 sr CO CN II II ii 0 b b CO O) CN in s CO II d ll =$. 3. a. 0) in ro o CO in CM o CM 0) N -H m m a E 03 (0 o 4-> cd 4-1 o a us a a tc o m ns J a) CU CU rC 4J MH O 4H CO CU !h r-l 0 a n £ ^ to ts u cd TS C id QJ 4-1 cu CO CU u a cu r-i CO cu •H CU 4-> 4-1 O Q a •H 4-) O a 4J CO CO Cn •H o sh cu >, CJ1 r* o u O cu X! N 4J 4-) H C ^ cu cu cu > 3 CO cu XI CO cu i-H cd > c (0 s iJ o rH a -U c 0) u cu 14-1 m •rH T3 CI O X 4J — -H [_ — I CN ""XT'' ueein aq^ jo JOU9 pjiBptre^s 05 a CO 11 d •H 4J C rC O *S cu to rH 4-1 C a rH X 0 0 w •H CU T) 4J CU O 03 u E rH .a CU 4-1 rH CI 03 1 M U 0 •H 4H 4J cu to CU M in =i 11 QJ 0 tJi rQ N cu H H rC *u CO 4J

PAGE 108

96 CO O Tir> odd ii n n b b b en" cd rCO CD !h a) II 0) X! £ u JJ i-l U CD 0 0 n u 4-1 0 ID e 4J « 0 CO rH ft N rd -H u to •H 4J 0 cu (V w rH u m o e CD rd ,3 Ti CO 4-1 CD CtJ xs CD £ 4-1 rd 4J 0 a 4-) CQ 3 a CD CD CD rH e CQ CD i CD Sh rd ft 4-) CD Sh c 4-1 -H O CQ CD 4J a 0 0 •H u rH CQ u Cn CD 73 CD -H 4J 4-1 m 0 Q a rd 0 4-> • u CQ CQ CD 4-1 4-1 0 0 rH rd CD CD > u tn rd a CD U rd X) CD CD •H > £ U rd 4-) •H 0) 0 £1 rH rH 4-> ft rd a a 4-1 Sh CD CD a) CD 4-> 2s sh a 4-> CD M CD 4H XI 4H -H T3 m •H .3 i CQ 4-1 ueaui aqrj; jo long paeptiB-js CD -H *H 4.) 3 rd tn rH •H CD •H 5 . O Q rH ft X

PAGE 109

CT> O co in o II b 00 o n o JJ d) i-l N CO •H O CO -H 4J CD 0) rH 5-1 A! ft O 4-> £ (0 T3 (U O (0 4-> W a -u rfl c d> 1 CD .y en d) u ft 0) u co -H T3 a) 4-> 4-) O Q u o CJ CD > d> 0) XI U 4-> a CD G T) d) c X o W -H J-l (0 CO (U rH (0 > fO d) e o ft 41 ti d) 51 CD 4-1 4-1 -H Ti X! 4J •H m 10 Q 4-) 0 X A d) ft Pi a> d) • 5-1 d) to xi u u 3 d) Cn XI H 2 4-) rH bj 4J 4-1 0) 0 £

PAGE 110

•H -H Cn U

PAGE 111

CHAPTER 5 EFFECT OF SOIL SUSPENSION METHOD ON NEMATODE EXTRACTION WHEN USING THE CENTRIFUGALFLOTATION TECHNIQUE Introduction A critical step in determining numbers of nematodes in soil is the extraction method. Different methods have extraction efficiencies that range from 0% to 100% (McSorley, 1987) . Extraction efficiency within a method varies with operator, soil type, and nematode genera, among other factors (McSorley and Parrado, 1987) . The efficiency of a multi-step method can be increased by changing one or more of the steps of the method. Nematode extraction efficiency at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center at Hastings was higher than extraction efficiency from the laboratory at the University of Florida, Gainesville campus, when extracting nematodes from soil samples coming from the same site. The only difference between techniques used in both places was the way the soil subsample was being suspended in water.

PAGE 112

100 The objective of this experiment was to compare these two different methods for suspending the soil subsample before sieving when using the centrifugal flotation technique (Jenkins, 1964) . After collection of the sample, the first step in this technique is the suspension of the soil subsample in water. The second step is the sieving of the soil suspension, the third step is centrif ugation of the suspension in water, and the fourth step is resuspension of the pellet and centrifugation in sugar solution, resulting in flotation of the nematodes. Suspension of the soil in many laboratories is generally done with the use of water pressure. In the nematology laboratory at the University of Florida, Gainesville, the soil subsample is placed in a kitchen strainer (ca. 850 urn openings) and sprayed with water from a pressure nozzle (Figure 5-1) . Another way to suspend the soil subsample in water is by placing the soil in a bucket, adding water, followed by manual stirring of the suspension.

PAGE 113

101 Materials and Methods Sixteen soil samples (94.6% sand, 1% silt, 3% clay, and 1.4% organic matter) were collected from a field planted to potato and cabbage at the University of Florida, IFAS, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Each soil sample was thoroughly mixed, and paired subsamples of 100 cm 3 each were taken at random from each sample. Each subsample was either suspended in 1.7 L of water by spraying the soil placed in a kitchen strainer with water from a pressure nozzle or by stirring the soil solution by hand in a 2-L size bucket for 30 seconds followed by passing the suspension through a kitchen strainer. Except for the differences in procedure noted below, processing of each subsample was then completed by using the a centrifugalflotation technique (Jenkins, 1964) . The extraction of nematodes from the soil suspension before centrif ugation by two passages through a sieve with 4 5 -urn pore openings was replaced by one pass through a sieve with 38 -urn pore openings; and nematodes were recovered from the sucrose suspension by one passage through a sieve with 2 5 -urn openings as opposed to two passages. Nematodes extracted by

PAGE 114

102 using the methods were identified to genus and counted. The experimental design was a randomized complete block. Each soil sample was considered a block and the two extraction options were considered the treatments. Because the centrifuge used in the experiment could hold only eight subsamples, precaution was taken that in each run of the centrifuge, the two options within each sample were paired to avoid variation among different centrifuge runs. Counts were compared using analysis of variance. This experiment was repeated twice using soil from the same location. Results and Discussion Nematodes found at numbers higher than 20 nematodes/100 cm 3 of soil had a higher extraction rate when the subsample was stirred by hand (P < 0.05) (Table 1). Nematodes found at numbers lower than 20 nematodes/100 cm 3 of soil had the same recovery (P > 0.05) for both techniques (Table 5-1) . The most abundant genus (Criconemella spp.) showed the biggest difference in recovery; 53% to 93% more were recovered when the soil subsamples were stirred by hand. Mechanical processes, such as the use of a water pressure nozzle, supposedly allow less variation among

PAGE 115

103 operators and samples when suspending a soil sample in water (Byrd et al . , 1976). Such a technique also saves time, since passing through a coarse sieve and suspension of the soil is done simultaneously. The lower recovery of nematodes when using the pressurized nozzle may be due to the water force on the soil. Water force from the nozzle speeds the sedimentation of soil particles and nematodes, and quite possibly the smaller soil aggregates do not break up, or the sedimenting soil physically covers the nematodes. The manual action of swirling and the longer suspension time when stirring is done by hand may break up aggregates, facilitating the release of nematodes that might otherwise have been trapped in the soil aggregates. Also, nematodes in suspension may escape being covered during soil sedimentation. Another reason for lower extraction when using the nozzle might be explained by the effect on pellet formation. Soil pellets formed after the first centrif ugation were loose, with a higher amount of organic debris. The carrying force of the water increased the amount of organic debris passing through the strainer, producing a less-firm pellet. Pellets formed from soil suspensions stirred by hand were ,

PAGE 116

104 more firmly compacted, and thus more convenient to work with and less likely to produce losses during decantation. Nematode extraction from sandy soils (>90% sand) in northeast Florida fields is affected by the method by which a soil subsample is suspended in water. Since extraction of all nematodes was similar or greater when the soil was stirred manually, this option is preferable over suspension of the soil with a water pressure nozzle when using centrifugal flotation.

PAGE 117

105 rC 0 •H a a rj 0) B T3 a E dJ 4-) U ro 4-) X 0) o CQ IH O E u o o rH U CD Ck CQ CD CQ rH a) a o E 3 0) CQ rH 4H -H 0 0 CQ >H cu a) X! Xi E 4-1 S3 4H o • c H 0 1 -H ID CQ 0) 0) rH X! CQ 03 3 H CQ ro 4-> G CD E •H r4 a) D X w CM 4-> c
PAGE 118

106

PAGE 119

CHAPTER 6 CORRELATION BETWEEN Paratrichodorus minor POPULATIONS AND CORKY RINGS POT SYMPTOMS ON POTATO Introduction Paratrichodorus minor (Colbran) Siddiqi transmits the Tobacco Rattle Virus (Walkinshaw et al . , 1961) to potato (Solanum tuberosum L.), causing the disease known in the United States as corky ringspot (CRS) and spraing in Europe. External symptoms, usually but not always, are characterized by circular lesions on the epidermis of affected tubers; and internal symptoms frequently show as necrosis in the tuber flesh in the form of arcs or rings (Weingartner et al . , 1983) . Currently almost onethird of potato farms in northeast Florida are affected by CRS (Weingartner and Shumaker, 1990) . Economic losses of up to 25% are due to CRS-affected potato tubers (Weingartner and Shumaker, 1990a; Weingartner and Shumaker, 1990b) . Knowledge of the relationship between crop yield and population densities of plant-parasitic nematodes can be used as a tool to make 107

PAGE 120

108 accurate nematode management decisions (Ferris, 1974; Seinhorst, 1965) . Nematode population densities at planting (Barker and Nusbaum, 1971) or at other times during the growing season (Ferris, 1974; Ferris and Noling, 1987; Mashela et al . , 1991) can be negatively correlated with yield. Cooke (1973) in England found a significant association between the prevalence of docking disorder in sugar beet Beta vulgaris L.) in June, caused by trichodoridtransmitted TRV, and rainfall in May. In Scotland, the association between trichodorid numbers and spraing incidence was higher in May than at harvest (Cooper and Thomas, 1971) . Spraing incidence in Scotland was positively correlated with May rainfall, and it was most prevalent when the summer was wettest (Cooper and Harrison 1973) . Since P. minor transmits the causal agent of CRS, it is possible to correlate P. minor numbers with incidence or severity of CRS on potato tubers. The objective of this experiment was to correlate P. minor population densities at different times during the potato growing season and incidence or mean severity of CRS on potato tubers at harvest .

PAGE 121

109 Materials and Methods Experiments were established during two winter growing seasons from 1993 to 1995 at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Soil texture was 95% sand, 2% silt, 3% clay, and 1.4% organic matter; pH 5.56.0. The soil was naturally infested with the trichodorid nematode, P. minor, and had a long history of CRS on potato. Potato had been grown on the site during each winter and the sorghumsudangrass hybrid (Sorghum bicolor (L.) Moench x S. arundinaceum (Desv.) Stapf var. sudanense (Stapf) Hitchc.) had been used as a cover crop during the summer after the potato season for at least 25 years. The potato var. Red LaSoda was planted manually on 21 December 1993 for the 1993-94 season and 23 January 1995 for the 1994-95 at a rate of a potato seed piece every 15 cm. Sixteen plots were arranged in a completely randomized design. A plot was either not treated or treated with 56 L/ha of the soil fumigant 1 , 3 -dichloropropene applied 32 cm deep in row with a single chisel on 24 November 1993 and 16 December 1994, to give a total of eight treated plots and eight untreated

PAGE 122

110 plots. The single-row plots were 10 -m long. Standard practices for fertilizer application, and for insect, weed, and disease management were used (Hochmuth et al . , 1996). The crop was irrigated as needed (Rogers, et al . , 1975) . All potato tubers from a plot were harvested mechanically on 7 June 1994 and 25 May 1995. Following lifting, potato tubers were washed, graded, and classified by size. All the potato tubers from each plot (>3.0 cm diam.) were counted. Potato tubers were examined for external and internal symptoms of CRS and incidence (e. g. proportion) was determined by dividing the number of tubers with symptoms by the total number of potato tubers per plot. External and internal incidence of CRS were determined for each plot , and internal and external severity index values from 0 to 10 were assigned to each potato. Severity was assessed by cutting the potato into eight pieces and each piece was examined for internal and external symptoms. Severity values from 0 to 8 equaled the number of potato pieces with symptoms then, 9 = all pieces showing symptoms with 25% to 50% of the surface affected; 10 = all pieces with symptoms >50% of the surface necrotic. Mean severity for a plot was calculated by adding the severity index

PAGE 123

Ill values of each affected potato and dividing by the total number of potato tubers for that plot . Soil samples for nematode assays were taken 0-20 cm and 20-40 cm deep. Samples consisted of six cores (2.5 cm diam.) taken from each plot on 23 November, 21 December, 21 January, 2 5 February, 21 March, 4 April, and 18 April in the 1993-94 season; and 22 November, 23 January, 27 February, 27 March, and 5 May in the 1994-95 season. The six cores were mixed manually and a 100-cm 3 subsample was removed for nematode extraction. The subsamples were wet -sieved through 850-mn and 28-fim pore sieves. The material retained on the 28-^m sieve was processed by a centrifugal flotation technique (Jenkins, 1964) . The extracted nematodes were dispersed in water in a gridded counting dish, identified, and counted. Since numbers of P. minor are known to fluctuate between soil depths of 0-20 cm and 20-40 cm (McSorley and Dickson, 1990a; Harrison, 1975) , nematode counts from the two depths were added together and transformed with the formula y = ln(x+l), where x = P. minor/100 cm 3 of soil. Simple linear correlation coefficients were calculated between logtransformed numbers on each sampling date and

PAGE 124

incidence (external and internal) , or mean severity (internal and external) with the program Proc GLM from SAS (SAS Institute, Cary, NC) . Simple linear correlation was used because of simplicity of the model. Results 199394 Season: Most types of symptoms were correlated (P < 0.05) with logtransformed P. minor numbers, except on 21 March (Table 6-1) . Paratrichodorus minor density at planting (Pi) equaled 23 nematodes/100 cm 3 of soil (Table 62) . 199495 Season: All types of symptoms were correlated with log-transformed counts of P. minor (P < 0.01) only on 27 March (Table 6-3) . Pi equaled 16 nematodes/100 cm 3 of soil (Table 6-2) . Precipitation was high (17.3 cm) during the month following planting in the 1993-94 season. Precipitation was low (2.3 cm) following planting in the 1994-95 season (Figure 6-1) .

PAGE 125

113 m a u U ai CD 4-1 X! c P QJ •H u er 4-> 4H 01 0 M-l CJ H a CQ T3 oi Oi a 4J H H 05 u H c H rH rky ion to n -i-i r i fO E aj 1 1 | H 4J n 0 X 4-1 ai 4— ' ns rei qj Li in qj 4J r^ u n) u> Cn 0 1 — 1 rH CO 03 4J r; QJ G Lj M 4J 0) (1) 4-1 H -IJ re> u >— < •H -H 4-1 cn M-l H M H 01 res QJ 0 (D X! u um c M C 0 o •H H 4J 0 03 >, rH -U •H -H H G M CD CD 0 0 > CD u QJ is CO CO 0 QJ u T3 CO rH 0 0) rt ^ a C 0 cn H H ••H i rH QJ is ro 4J 4J cn 0) X res cn rH QJ rH H 03 E c C4 •H m DO CO a) T3 QJ E an at XI H QJ 1 u ra Cn VD E C QJ 0 -H QJ T5 4J rH rH •H U E Rj c 05 •H CD CD rH •H Cm r4 rt! (—1 l> oo H rH t— 1 j 1 -H < rH Q a m o rH CL, fO O CO -H co £ 0 a rH 0 I u CD to to to •X •x * X o H o in Q Q •X -X -x X •X X X [> cn CN LO u> O o o o O CN ro CN • CN * ro O o • O • o * * * X -x o CTi o ID LP) LTi t — J O • O • O X X X to X * X H H CD QJ » (L) U 4J >i 4J rC TJ r< T) C X CD CI) QJ X U 4-1 u c a a H C CO Jh QJ > >, 4-1 -H rH 0) > a; a) a) a) w -H H -h s to s: CO o o v| Cm 4-1 CJ CO CJ •H 4-1 -rl tn •H CO * X in o o v| CM 4J c (0 u -H 4-1 •H Cn -rlCO •X Cn a -H c cC rH a rH (U 4-1 MH CO CO >1 CO Q CO u 0) 4-1 u -rl 4J cfl E 0 4J CO 4H o o -H 4-1 o 04 o u 04 0) u c CU •H u a u QJ -§ d) 5 *J CD si 4-> 0 T3 QJ o\° o m u m o *h H 4-1 4J w o CJJ * »H in u 00 CN QJ c o ^ -U 0) •HO o S CO 4H u 3 CD o rH 4H 0 CO 4J CO 0) 3 a Q) CO 4H 'nj 01 0 > c -H o\° I? O LCI H £ A rH » Q) S CQ CQ O 4-1 © Oi -h g co O, >i 0) M U 2 r< . H (0 4J II 3 4-1 cj cn co -S 1 s CQ QJ CO E 0 0) o a o a 4J & rH CD 03 JJ 8^ 4-1 O -H H CQ TJ 0) QJ O 4J QJ U QJ "H 0) O (I'M 4H 0 CO 4J O CO 01 n 4.) o CO 0 (0 4j anH o (X HH 3 » 0 CO CD rH 3 4-1

PAGE 126

114 Table 6-2. Mean r external and internal incidence and severity of corky ringspot tuber symptoms, and Paratrichodorus minor/100 cm 3 of soil at planting (Pi) from all 16 plots, 1993-94 and 1994-95 seasons. Season Pi External Internal External Internal incidence 1 incidence severity* severity 199394 23.00 0.49 0.44 1.92 2.09 199495 16.00 0.19 0.20 0.51 0.80 r Mean from all potato tubers from 16 plots, including noninfested potato tubers. Incidence = proportion of symptomatic tubers. Potato tubers were cut into eight pieces, severity values from 0 to 8 equaled the number of potato pieces with symptoms, 9 = all pieces showing symptoms with 25% to 50% of the surface affected; 10 = all pieces with symptoms >50% of the surface necrotic.

PAGE 127

115 Table 6-3. Simple linear correlation coefficients between external incidence, internal incidence, mean external severity, or mean internal severity of corky ringspot tuber symptoms, and Paratrichodorus minor numbers (after log transformation) at different sampling dates, 1994-95 season. Corky ringspot 22 Nov . 23 Dec. 27 Feb. 27 Mar . 5 May symptoms 34 DAP • 62 DAP 100 DAP External incidence' 0 . 18 0 . 01 0 . 10 0 . 79** 0 .24 Internal incidence 0 .23 0 .27 0 . 28 0 . 77** 0 07 Mean external severity* 0 28 0 . 12 0 .20 0 . 80** 0 23 Mean internal severity 0 30 0 . 17 0 . 33 0 . 82** 0 19 *Significant (P < o .05) , **signif icant (P < o .01) . • Days after planting. 'incidence = proportion of symptomatic tubers. 'Potato tubers were cut into eight pieces, severity values from 0 to 8 equaled the number of potato pieces with symptoms, 9 = all pieces showing symptoms with 25% to 50% of the surface affected; 10 = all pieces with symptoms >50% of the surface necrotic.

PAGE 128

Discussion Data from this two-year experiment showed an association between P. minor numbers and external or internal incidence or severity of CRS . For a given date in a year, the correlation coefficients were similar for all the different types of symptoms. This was not surprising since previous analysis showed that both external or internal incidence and severity were highly associated (r 2 > 0.85) within a year (Chapter 4) . Significant correlation between nematode numbers and incidence or severity of CRS early in the .1993-94 season suggests that the virus can be transmitted during the first month of the potato growing season. Incidence and severity of CRS were lower in the 1994-95 than in the 1993-94 season. Beyond certain population densities, P. minor feeding on potato tubers might not produce corresponding proportional increases in incidence or severity of CRS. This may explain why correlation coefficients were higher in the 1994-95 than in the 1993-94 season. Potato was planted on 21 December in the 1993-94 season and rain was abundant in the following month of January (17.3 cm rain) . Potato was planted on 23 January in the

PAGE 129

117 1994-95 season. This month was dry (4.2 cm rain) and was followed by two months of low precipitation (Figure 6-1) . Although we did not measure soil moisture, the season 199394 probably had higher soil moisture than the 1994-95 season at the beginning of the growing season. Research studies in Scotland suggested that increases in spraing were associated with high rainfall at the beginning of the potato growing season. Trichodorid densities in May, when rains were high, were more associated with spraing incidence than trichodorid densities at harvest (Cooper and Thomas, 1971) . Highest incidence of spraing coincided with the wettest years during the period 1933-39 in Scotland (Cooper and Harrison, 1973) . Van Hoof (1976) showed that infection of tobacco leaves by trichodorid carrying TRV increased with increasing soil moisture due to enhanced movement of trichodorids in wet soils. Van Hoof (1964) stated that infection of potato tubers with TRV takes place only when trichodorids feed on developing tubers. Data in these experiments suggest that most of the transmission of TRV took place during the first 2 months after planting and continued throughout the potato growing season. In the current study, precipitation was high in 1993-94 season during the first month after planting

PAGE 130

118 when tubers are forming (Rowe, 1993). Increased nematode activity due to high soil moisture, and the presence of potato tubers susceptible to infection by TRV could explain the higher incidence of CRS during the 1993-94 season. Severity was always more highly associated with nematode numbers than incidence in both seasons except on 25 February in the 1993-94 season. The distribution of nematodes in the soil is generally aggregated (Anscombe, 1950) , and increase in nematode densities in the soil due to reproduction will probably occur in clusters. High nematode densities concentrated in certain areas increase the probability of a single potato plant being infected by more than one nematode, which would result in a higher severity of CRS. This may be the reason why increases in nematode numbers were more associated with severity than with incidence of CRS. The high level of sampling error used to estimate nematode populations (Ferris, 1984) and nematode losses during the extraction procedure (McSorley and Parrado, 1987) may limit the ability to obtain significant measures of association between nematode population densities and other dependent variables, accounting for some of the variability

PAGE 131

119 in the results obtained here. In spite of these difficulties, our results were consistent between seasons in that significant associations between P. minor densities and incidence or severity of CRS were obtained two months after planting in both years. This suggests that population densities of P. minor at two months after planting are correlated with incidence or severity of CRS. More research is needed on the time of the growing season during which the potato plant is susceptible to infection by TRV. Also, the development of methods to estimate the proportion of trichodorids carrying TRV in the field is essential. By improving time of sampling, a more accurate relationship between P. minor densities and incidence or severity of CRS could be established.

PAGE 132

120 CTl m i CTl q a 0 0 w 01 id id a) d) w w IB rsi CD CO •iH u 2 0) 0) d) Q O O CM CO CD CO CD CM 0 CO fd CQ Cn -H o u tn 0 4J (C jj 0 & a) tn -H u 0 H -U rG jj -H -H c U 0 CD CQ id Q4 cu CQ >•. iH LTI cti 1 a 0 CTl CTl H -a H c I m CD CTl 1 ro tT) CT\ H CTl

PAGE 133

CHAPTER 7 DETECTION OF TOBACCO RATTLE VIRUS IN POTATO TUBERS OBTAINED IN NORTHEAST FLORIDA BY POLYMERASE CHAIN REACTION (PCR) AND NONRADIOACTIVE TISSUE BLOT Introduction Tobacco rattle virus (TRV) , a plant virus with the widest known host range, has a worldwide distribution and infests more than 400 plant species (Robinson and Harrison, 1989). Potato (Solanum tuberosum L.), a high-value cash crop grown in northeast Florida, is susceptible to TRV infections. This virus causes the disease known as corky ringspot (CRS) on potato, and currently almost one-third of the potato farms in northeast Florida are affected with CRS (Weingartner et al . , 1983; Weingartner and Shumaker, 1990). External and internal symptoms are usually, but not always, characterized by necrosis of the skin or flesh in the form of arcs or rings (Weingartner, 1981) . Tobacco rattle virus belongs to the tobravirus genus and is naturally transmitted by the nematodes Trichodorus spp. and Para trichodorus spp. (Walkinshaw et al . , 1961, Van Hoof et al., 1968; Cooper and Thomas, 1970). Lister (1968) 121

PAGE 134

122 reported the bipartite nature of the TRV genome, and Harrison and Robinson (1978) divided the TRV isolates into two classes. The first class (M-type) produces two rodshaped particles of different sizes. The larger particle (RNA-1) consists of approximately 7,000 nucleotides, and the shorter one (RNA-2) ranges from 1,500 to 4,000 nucleotides. The short particle, RNA-2, encodes for the coat protein (Sanger, 1968) . The second class (NM-type) lacks RNA-2 and therefore produces no nucleoprotein . Since RNA-1 encodes the replicase and the protein for viral movement in the plant, NM-type isolates can cause infection in plants and are very common in nature (Harrison and Robinson, 1982; Hamilton et al . , 1987; MacFarlane et al . , 1989). Detection of the NM-type isolates by serological tests is impossible because they lack a protein coat. Also, due to the antigenic diversity of the M-type isolates (Harrison et al . , 1983), detection by serological tests in not consistent. The use of symptoms for diagnosis of CRS is helpful but in some instances unreliable. Corky ringspotlike symptoms on potato tubers can be caused by physiological disorders and by potato mop top virus (Calvert and Harrison, 1966) . Furthermore, symptom expression is

PAGE 135

123 diverse among TRV strains (Harrison and Robinson, 1986 ; Robinson and Harrison, 198 9) . The RNA-1 of all TRV strains share conserved nucleotide sequences (Robinson and Harrison, 1985) . Thus, the conserved regions can be used as starting points to reproduce the sequences comprised between those regions. The polymerase chain reaction (PCR) is used as a diagnostic tool for viruses with conserved nucleotide sequences, and TRV has been detected by PCR based methods in Nicotiana clevelandii Gray and Narcissus spp . (Robinson, 1992), and in potato tubers (Crosslin and Thomas, 1995; Weidemann, 1995; Kawchuk et al . , 1997). Dot-blot cDNA probes which hybridized to regions of RNA-1 were used to detect isolates of TRV including NM-type isolates (Robinson, 1989; Harrison and Robinson, 1982) . One drawback of RNA dot -blot hybridization probes for diagnostic use in potato is that RNA requires complex and time-consuming extraction methods (Robinson and Legorburu, 1988) . Tobacco rattle virus has been reported in the United States (Walkinshaw et al . , 1961, Weingartner et al . , 1983; Ayala and Allen, 1968) , and recently detected in potato tubers by PCR-based methods (Crosslin and Thomas, 1995) .

PAGE 136

However, nucleotide sequences of TRV from the United States have not been published. The objectives of this study were: to identify nematodetransmitted TRV by enzymelinked -immunosorbent assay (ELISA) , to detect TRV in potato tubers by reverse transcription and PCR (RT-PCR) , to present the nucleotide sequence of the RNA-1 region of the Florida isolate that encodes for the 16 K protein (Harrison et al . , 1987), to determine its relationship with isolates from Canada and Europe, and to develop a nonradioactive hybridization probe using tuber tissue for rapid detection of TRV. Materials and Methods Enzyme-linked Immunosorbent Assay (ELISA) Eighteen bait plants, Nicotiana tabacum L. var. Samsum, N. clevelandii, and Petunia hybrida Vilm. were planted in soil collected from fields naturally infested with Paratrichodorus minor (Colbran) Siddiqi and with a history of CRS. Nine plants of each of the three plants species, were kept in growth chambers at 2 0 and at 30 C for 21 days. Leaves and roots from plants showing virus-like symptoms were collected for ELISA tests. The antigen trapped

PAGE 137

125 indirect EL ISA (I-ELISA) technique was used (Yeh and Gonsalves, 1984) . Flat-bottom polystyrene microtiter plates (Cooke M 129 A, Dynatech Microelisa Systems, Plochingen, West Germany) were used. Sap extracts diluted 1:10 in extraction buffer containing 0.05 M sodium phosphate, 0.05 Tween 20, pH 9.6 (PBST) , was added and incubated at 37 C for 1 hour. TRV serum PVAS-820 (American Type Culture Collection, Rockville, MD) diluted 1:1000 in PBST containing 2% polyvinyl pyrrolidone 40 (PVP-40) and 0.2 ovalbumin, was added and incubated for 2 hours at 37 C. Alkaline phosphatase conjugated anti-rabbit globulin, diluted 1:2000 in PBST containing 2% PVP-40 and 0.2 ovalbumin was added and incubated for 2 hours at 37 C. Between each step, wells were given three 3 -minute washes with PBST buffer. Healthy sap and crude antiserum were used as controls. Optical densities at 405 nm were recorded after 15 minutes using a model EL 307 Bio-TEK EIA spectrophotometer. Nucleic Acid Extraction Source of infected tissue . Naturally infected potato tubers (var. Red LaSoda and Ontario) with symptoms suggestive of TRV infection, as well as control symptom-free

PAGE 138

126 tubers, were collected from fields at the University of Florida, Institute of Food and Agricultural Sciences, Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida. Tubers were stored at 10 C in the dark until tests were made . The method used for total RNA extraction was a modification of that described by Barker et al . (1993) . Tuber tissue was extracted by probing a core borer (4 mm diam.) 2 cm deep in and around symptomatic tissue. The potato tissue was placed in a mortar, frozen with liquid nitrogen, and ground to a fine powder in one ml of buffer (100 mM LiCl, 10 mM EDTA, 1% EDTA, 100 mM Tris, pH 8.0) . The extract was poured into a 1.5 -ml microcentrifuge tube and incubated at 65 C in a water bath for 15 minutes. The mixture was extracted successively with equal volumes of phenol/chloroform (1:1) and of chloroform. An equal volume of 4 M LiCl was added and kept overnight at 4 C. The mixture was centrifuged for 10 minutes and the pellet was dissolved in 250 uL of water. RNA was precipitated with two volumes of ethanol and 10" 1 volume of 3 M sodium acetate pH 5.2, then held at -70 C overnight before centrif ugation .

PAGE 139

127 The pellets were washed with 70% ethanol, dried, and then dissolved in 250 of water, and stored at -70 C until required . Reverse Transcription and Amplification The oligonucleotide primers were synthesized by the DNA Synthesis Laboratory of GIBCO BRL, Gaithersburg, MD. Primers A and B were identical to those used by Robinson (1992). Primer A had the sequence 5 ' -CAGTCTATACACAGAAACAGA3', complementary to residues 6555 to 6575 of TRV-SYM RNA-1 (Hamilton et al . , 1987) . Primer B had the sequence 5'GACGTGTGTACTCAAGGGTT 3 ' identical to residues 6113 to 6132 of TRV-SYM RNA-1 (Figure 1) . Synthesis cDNA was accomplished by mixing 5 uL of total RNA extract, 500 ng of primer A, and water to a total volume of 11 |UL. The mixture was heated at 70 C for 10 minutes and immediately chilled on ice. To this was added 1 |iL of Superscript II reverse transcriptase (GIBCO BRL, Gaithersburg, MD) , 4 ^L 5x firststrand buffer, and 2 uL of dNTP mixture (10 mM each) . The mixture was incubated at 37 C for 1 hour. Amplification by PCR was performed in a mixture of 2 \ih of the reverse transcription reaction mixture, 5 uL lOx PCR

PAGE 140

128 buffer (Promega Corp., Madison, WI), 25 mM MgCl 2 , 5 of dNTP mixture (2mM) , 1 jag of each primer A and B, and 2 \xL of Taq DNA polymerase after heating to 95 C for 5 minutes were added. Sterile water was added to a total volume of 50 \xh and the reaction mixture was overlaid with 75 }iL of mineral oil. Amplification was performed on a Biometra UNOThermoblock thermocycler (Whatman, Hillsboro, OR) using 22 cycles, each cycle consisting of 30 seconds at 94 C, 3 minutes at 58 C, and 2 minutes at 72 C. PCR products were separated by electrophoresis in 1% agarose gels in lx Trisacetate-EDTA and visualized by staining with 0.5 |iL/ml ethidium bromide . Cloning and Sequencing of the PCR Product The 463 -bp fragment (PCR product) was purified by electrophoresis on a 0.9% agarose gel. The fragment was ligated into the pGEM-T vector (Promega, Madison, WI) following the manufacturer's instruction manual. The ligated plasmid was used to transform competent cells of Escherichia coli DHa. Plasmid DNA was prepared by a standard miniprep alkali lysis (Sambrook et al . , 1989). After extraction, the DNA was cleaned by one extraction with

PAGE 141

equal volumes of phenol/chloroform (1:1) and one of chloroform, precipitated with two volumes of ethanol and 10 1 volume 3 M sodium acetate at -20 C for 1 hour before centrif ugat ion . The plasmid pellets were washed with 70% ethanol, dried and dissolved in 50 |UL of water. The 463 -bp insert was sequenced at the DNA Core Laboratory of the University of Florida's Interdisciplinary Center for Biotechnology Research. Sequencing was accomplished by employing the Taq DyeDeoxy Terminator (part number 401388) and the DyePrimer (part number 4013 86) Cycle Sequencing protocols developed by Applied Biosystems (a division of Perkin-Elmer Corp., Foster City, CA) using fluorescentlabeled dideoxynucleotides and primers, respectively. The labeled extension products were subjected to analysis on an Applied Biosystems Model 3 73 A DNA Sequencer. Computer Analysis The Blast program (Altschul et al . , 1990) was used to search the GeneBank databank for the homologous nucleotide sequences. Comparisons of the nucleotide sequence for the 16 K open reading frame (ORF) of the Florida TRV isolate were made with the potato "PLB isolate" from the Netherlands

PAGE 142

130 (Angenent et al . , 1989), the potato "PSG isolate" from the Netherlands (Cornelissen et al . , 1986), the spinach SYM (spinach yellow mottle) isolate from England (Kurppa et al . , 1981) , the tulip "TCM isolate" from the Netherlands (Cornelissen et al., 1986), and the potato CAN (Canadian) isolate from Canada (Kawchuk et al . , 1997) . Nonradioactive Tissue-Blot Hybridization Test samples were tissue from tubers showing CRS-like symptoms of the potato varieties Red LaSoda, Atlantic, and Sebago. Healthy tubers were used as controls. The 4 -mm diam. surface of the cylinder bases of tuber tissue were blotted into a BioBlot N-plus nylon membrane (Corning Costar Corp., Cambridge, MA) for 15 seconds. Complementary cDNA probes specific for the 16 K ORF of the Florida isolate were prepared from gel purified DNA amplified by PCR from the cloned PCR product in the pGEM-T vector. The 463 -bp fragment was biotinylated by random oc tamer primer following the manufacturer's instructions (Tropix, Bedford, MA). In an ependorf 1-jlL tube, 100 ng of DNA was mixed with 5 J4.L of lOx dNTP mixture, 20 ]xh of 2 . 5x RP reaction buffer, and sterile water to a volume of 50 )U.L. The mixture was

PAGE 143

131 incubated in a water bath at 37 C for 1 hour after adding 1 |J,L of Klenow enzyme . The membrane was incubated with the probe for 12 hours at 65 C, and hybridization detection was done using the Chemoluminescent Detection System for Biotin Labeled Probes (Tropix, Bedford, MA) . The probed membrane was exposed to x-ray film for 1.25 hour for visualization of the chemoluminescent signal. Results Elisa Absorbance values equal or greater than three times the healthy absorbance values were considered positive (Sutula et al., 1986) . Root and leaf samples of P. hybrida, N. tabacum, and N. clevelandii grown at 30 C did not react with the PVAS-820 serum. Root and leaf samples of P. hybrida, N. tabacum, and N. clevelandii grown at 20 C reacted differently with PVAS-820 serum (Table 7-1) . The number of positive samples varied with host and part of the plant sampled (root or leaf) .

PAGE 144

132 Detection of TRV by RT-PCR A PCR product of the RT-PCR amplification having the expected size (463 bp) was visualized in a gel by ethidium bromide staining from four potato tuber samples each of the varieties Red LaSoda and Ontario (Figure 7-2) . No products were observed from symptomfree tuber samples. Nonradioactive Tissue Blot A positive signal was detected when the membrane probed with four samples of each of the potato varieties Red LaSoda, and Sebago, and three samples of the var . Atlantic, with typical CRS-like symptoms, was exposed to x-ray film. No signal was observed where healthy tissue samples were spotted (Figure 7-3) . Computer Analysis Nucleotide sequence homology of the 16 K ORF between the FLA TRVisolate and the CAN, TCM, PLB, PSG, and SYM TRVisolates were 94%, 94%, 93%, 90%, and 90%, respectively. The sequence of the 16 K ORF of the FLA isolate is presented in Figure 7-4 .

PAGE 145

133 Table 7-1. Absorbance values (mean and range) of ELISA test results from leaves and roots of Nicotiana tabacum, N. clevelandii , and Petunia hybrida plants grown at 20 C. Absorbance Incidence' Mean Range Control* Nicotiana tajbacum Tops 0/9 0 316 0.298-0.326 0.335 Roots 3/9 1 200 1.111-1.315 0 . 100 N. clevelandii Tops 0/9 0 411 0.365-0.496 0.223 Roots 3/9 0 480 0.378-0.615 0 . 100 Petunia hybrida Tops 3/9 1 730 1.903-1.638 0 . 110 Roots 3/9 1 490 1.403-1.606 0 . 100 'Numerator is the number of positive samples, denominator is the number of samples tested. 'Mean absorbance values for uninfected plant tissue.

PAGE 146

134 AUG UGA UAA ORF 4 203 3763 5323 6113 \L6575 5' CAP ORF 1 134K ; ORF 2 194K 16K | ORF 3 29K Figure 7-1. Organization of showing the amplified region protein . a tobravirus genomic RNA-1, corresponding to the 16 K 1 2 3 4 567 8M 10 11 Figure 7-2. Eight products after 22 cycles of PCR following reverse transcription of nucleic acid extracted from potato tubers with TRV-like symptoms, var . Ontario (lanes 1-4), var. Red LaSoda (lanes 5-8) , nucleic acid extracted from healthy tuber, var. Red LaSoda (lane 10) , var. Ontario (lane 11) . Marker lane (M) is 1 kb DNA ladder (GIBCO BRL) . Arrowhead indicates the position of the TRV-specific 463 bp band .

PAGE 147

Figure 7-3. Tissue blot hybridization test. Potato tuber tissue from different varieties was spotted onto a membrane and probed with a biotin-labeled cDNA fragment. Healthytuber tissue: CI, var Atlantic; Fl , var Red LaSoda; II var Sebago. Infected tuber tissue: Al , A2 , Bl, B2 ; var Atlantic; Dl, D2 , El, E2 , var. Red LaSoda; Gl, G2 , HI, H2 , var Sebago .

PAGE 148

136 1 CAGTCTATACACAGAAACAGATAACAATTTAAAATAAAATCAAAAAGCAA 51 ACAACTGATCAATTCCGAAAGGAACATCATCTCTTAAAAATCTTTTTGGT 101 GTCCCAAAATCTTCTCTCTCTTTGAAAATTTTCTTAGAGGGTTTCGAATT 151 TCGAGACTTTTTAACCGTAGTAAATGCCTTTTCAGCTCGAACTCGTTCAA 201 TCTGTTTCCAGATTTCTCGATTTCTTGCTTCAAAGCGTTTACGACACTTT 251 TCAAGGTGACTACGGCCGCAACAATTATACACATCAAAAGTAAAATCGTT 301 AATAATAATACAGACAAACCATCCACAATTATTTTCCGCACACCTACGTG 351 TGACACCGACCATGTCAGCAACTTGCTTTCGCAACTTGTTAGCATGACCA 401 ATACTACACGTCTCATGACCAAGAACAGTGACTTCATTCACACAACCCTT 451 GAGTACACACGTC Figure 7-4. Nucleotide sequence of the RNA-1 16 K open reading frame from the Florida (FLA) tobacco rattle virus (TRV) isolate.

PAGE 149

Discussion Positive results from I-ELISA suggests that the FLA isolate is related to the Oregon strain. Harrison and Woods (1966) previously grouped the Oregon and the Florida strains in the same serotype group. ELISA test results were negative on all hosts grown at 3 0 C. Test results from hosts grown at 20 C were positive in root samples of one third of the sample tested. From only one host (P. hybrida) , one third of leaf samples reacted positively in ELISA tests. This findings suggests that the presence of virion particles (M-type) possibly depends on temperature, host, and movement of the virus in the plant. Robinson (1973) could not detect any infectious virus in leaves of N. clevelandii inoculated with TRV CAM strain and kept at 32 C. In the same study, number of lesions in leaves of Chenopodium amaranticolor Coster & Reyn. were greater in plants inoculated with sap of N. clevelandii kept at 20 than at 3 0 C. Walkinshaw and Larson (1959) , found that growing temperatures of 24 C of CRSinfected tubers facilitated systemic movement of the virus, whereas temperatures of 32 C almost inhibited virus movement . They also reported that

PAGE 150

138 infection and multiplication of TRV on N. tabacum var. Samsum was noticeably inhibited at temperatures above 24 C. Detection of cDNA of the expected size, 463 -bp, by RTPCR using specific primers provided evidence that TRV was the causal agent of the tuber necrosis in tubers exhibiting TRVlike symptoms and supported the I-ELISA results. The amount of cDNA amplified by PCR was higher from RNA extracted from samples taken in the necrotic lesions than from samples taken distant from the lesions. This observation indicated that virus concentration was greatest adjacent to the necrotic tissue. RT-PCR is sufficiently sensitive to detect TRV RNA from 10 ng of total nucleic acid extract from N. clevelandii (Robinson, 1992) , and 1 ug of total nucleic acid from potato tubers (Kawchuk et al . , 1997). Common characteristics of TRV are the antigenic diversity among strains (Robinson, 1992; Harrison et al . , 1983), and the occurrence of NM-type isolates in potato (Harrison and Robinson, 1982) . Since this method amplifies a segment from RNA1 , it should detect TRV in tubers infected with TRV NM-type and M-type in Florida with more sensitivity and accuracy than EL ISA tests. Robinson (1992) was able to detect five NM-type and eight M-

PAGE 151

type TRV European isolates from N. clevelandii leaves using this procedure. This PCR based method has proved to be verysensitive in a variety of hosts and TRV isolates (Crosslin and Thomas, 1995; Kawchuk et al . , 1997; Robinson, 1992; Weidemann, 1995) . Given the sensitivity of the method, it may be similarly robust to also detect TRV in viruliferous nematodes . The nonradioactive hybridization probe detected TRV from tubers exhibiting TRVlike symptoms from three different varieties. This method is faster than RT-PCR and may be equally reliable to detect M-type and MN-type isolates. Since total RNA extraction from potato tubers is not needed, more samples could be screened in considerably less time. This method is safer and it has a longer life (1 year) than radioactive probes. The main difficulty with this technique was the presence of unspecific background. However, x-ray pictures were clear enough to differentiate positive from negative reactions. Further refinement of this technique could permit pictures with reduced background interference, with the potential for use in detection of TRV in other hosts. In addition it may have use for detecting TRV in populations of trichodorids .

PAGE 152

CHAPTER 8 SUMMARY AND CONCLUSIONS Plots of either potato (Solanum tuberosum) or cabbage (Brassica oleracea var . capitata) , fumigated with 1 , 3 -dichloropropene or unf umigated, were used to determine if resurgence of Paratrichodorus minor is associated with the presence of Belonolaimus longicaudatus . Soil samples were taken in soil 0-20 cm and 20-40 cm deep from each of 32 plots before fumigation, at planting, and at monthly intervals after planting. In the 1994-95 season, P. minor was found at higher numbers at 2 0-40 cm deep (30 P. minor vs. IB. longicaudatus/ '100 cm 3 of soil) , whereas higher numbers of B . longicaudatus were found at 0-20 cm (34 B . longicaudatus vs. 2 P. minor/100 cm 3 of soil) . Numbers of P. minor were reduced after fumigation in potato, whereas numbers increased after fumigation in cabbage. Results from 1993-94 were similar to 1994-95 140

PAGE 153

141 in that the two nematodes also were separated by depth. Competition between these two species is limited in this system because their niches are separated vertically. Other experiments should be designed to determine if the absence of B. longicaudatus makes the plant more attractive for invasion and subsequent colonization by P. minor. Also, the effect of soil fumigation on other microorganisms and other factors that could affect resurgence P. minor populations should be examined. The population dynamics of Paratrichodorus minor and Belonolaimus longicaudatus were studied in sorghumsudangrass (Sorghum hi color x S. arundinaceum var. sudanense) during 5 years in one site and 2 years in another site. Sixteen plots were planted to sorghumsudangrass , and nematode samples were taken in soil 0-20 cm and 2 0-40 cm deep. Numbers of B . longicaudatus increased in sorghumsudangrass, and highest densities were generally found in soil 0-20 cm deep. Numbers of P. minor also increased in sorghumsudangrass, but the abundance at different depths was variable. More research is needed to define other variables that may affect the seasonal variation of P. minor and B . longicaudatus in agricultural fields such as presence

PAGE 154

142 of biological antagonists, chemical composition of the soil, pH, soil compaction, density of root biomass, and height of the water table. Other cover crops to reduce population densities of these nematodes should be investigated to offer more options to growers in northeast Florida. A computer program was developed to simulate random samples of potato tubers from fields infested with corky ringspot (CRS) . Sixteen potato plots were harvested, and incidence and severity of CRS was assessed for each potato in a plot . Inputs for the program were the total number of potato tubers from a plot, number of CRSinfested potato tubers (incidence) , and severity of CRS from each potato. Output consisted of sample mean and sample standard error of incidence and severity values for sample sizes of 5 , 7, 10, 12, 15, 17, 20, 22, 25, 27, 30, and 35 potato tubers. Measures of accuracy and precision for each sample size were estimated and discussed. The sample size required to detect the presence of CRS in a field also was determined using the binomial distribution. A sample size of 20 potato tubers is a reasonable choice for detection and evaluation of CRS symptoms on potato in chemical control tests . Beyond sample size 20, further increases in accuracy and precision level

PAGE 155

143 off at most incidence and severity values. Similar studies should be done using other commercial potato varieties and localities, which may result in different relationships between sample size and incidence or severity of corky ringspot . Nematode extraction with a centrifugal flotationtechnique depends on adequate suspension of the subsample in water. An experiment was designed to compare two techniques for suspending the soil subsample (stirring the soil in water by hand or mechanically with a high-pressure water nozzle) when using the centrifugal-flotation technique. Sets of 16 soil samples each were collected from a field previously planted to potato and cabbage in Hastings, Florida. Two subsamples of 100 cm 3 soil were taken from each sample, and each subsample was processed either by suspending the soil by mixing manually or by water pressure. Recovery numbers of Tylenchorhynchus sp . , Belonolaimus sp., and Criconemella spp . were higher when the soil was suspended by stirring the soil in water by hand. Recovery of Criconemella spp. was 53%-93% greater when the subsample was suspended in water by hand (P = 0.05) . The two techniques did not show any differences when nematodes were

PAGE 156

144 recovered in low (<20 nematodes/100 cm 3 of soil) numbers. Nematode extraction from sandy soils (>90% sand) in northeast Florida fields was greatly affected by the soil suspension method. Since extraction of all nematodes was similar or greater when the soil was stirred manually, this option is preferable over suspension of the soil with a water pressure nozzle when using the centrifugal flotation method . During two winter growing seasons from 1993 to 1995, 16 plots were planted to the potato var. Red LaSoda and arranged in a completely randomized design. All potato tubers from each plot were harvested, counted, and examined for external and internal incidence and severity of CRS . Soil samples for nematode assay were taken at monthly intervals from the same plots during the potato growing season. Simple linear correlation coefficients were calculated between nematode counts at each sampling date and incidence (external or internal) , or mean severity (internal or external) . Nematode counts were associated with incidence or severity of corky ringspot on potato tubers 2 months after planting during both seasons (P < 0.05) . During the 1993 winter growing season, rains during the

PAGE 157

145 first month after planting may have been responsible for increased incidence and severity of CRS by increasing nematode activity. These experiments suggested that incidence or severity of CRS is correlated to population densities of P. minor. More research is needed on the time during the growing season when the potato plant is susceptible to infection by TRV. Also, the development of methods to estimate the proportion of trichodorids carrying TRV in the field is essential. The answers to these questions could help establish more accurate relationships between P. minor densities and incidence or severity of CRS by improving time of sampling. Lack of specific diagnostic tests for CRS in northeast Fl orida prompted the development of specific probes to detect tobacco rattle virus in infected potato tubers. Nematode-transmitted TRV was detected in bait plants of Nicotiana tabacum var. Samsum, N. clevelandii, and Petunia hybrida by enzyme-linked immunosorbent assay (ELISA) . The virus also was detected by reverse transcription of RNA followed by amplification of the cDNA by polymerase chain reaction (PCR) . Primer A complementary to residues 6555 to 6575 and primer B identical to residues 6113 to 6132 of TRV-

PAGE 158

SYM RNA-1 were used. After amplification, the 463-bp fragment was cloned, sequenced, and compared to sequences of TRV isolates from Europe and Canada. Nucleotide sequence homology of the 16 kDa ORF between the FLA TRV-isolate and the CAN, TCM, PLB, PSG, and SYM TRV-isolates were 94%, 94%, 93%, 90%, and 90%, respectively. A nonradioactive biotinlabeled probe detected TRV by tuber tissue blotting. The nonradioactive hybridization tissue blot allows one to test samples in short periods of time. Refinement of this technique is needed to reduce background and improve clarity .

PAGE 159

APPENDIX IDENTIFICATION OF Trichodorus spp . FROM THE EXPERIMENTAL FIELD Introduction The experimental site at the University of Florida Research and Education Center, Yelvington Farm located 0.75 km east of Cowpen Branch Road near Hastings, Florida, had a history of infestation with Trichodorus sp . and Paratrichodorus sp . Harrison (1975) reported Paratrichodorus minor (Colbran) Siddiqi and Trichodorus proximus Allen from a site 500 m from where these nematode specimens where collected. For identification purposes, we collected 30 trichodorid females from bed 12 (new land) . No males could be found. The field has been planted to potato during the winterspring season followed by sorghumsudangrass hybrid (Sorghum bi col or (L.) Moench x S. arundinaceum (Desv.) Stapf var. sudanense (Stapf) Hitchc.) as a cover crop in the summer (Weingartner et al . , 1993) for at least 25 years. Nematodes were extracted using the centrifugal 147

PAGE 160

148 flotation method (Jenkins, 1964) . Morphometric studies were made in specimens fixed in triethanolamine and formaldehyde (40% formalin) (Courtney et al . , 1995). Measurements were taken from drawings made using a drawing tube. The morphometries and description of female specimens are presented here . Systematics Female Dimensions (average, minimum, and maximum of 3 0 specimens): Length 723 |lm (623-923 urn) ; width 37.2 ^im (28 47 urn); a = 19 . 7 ( 15 22 ) ; b 4 . 5 ( 4 6) (from 19 females) ; c = 43 (40 45) ; v = 54% (52% 58%) ; onchiostyle 37 (29 44 urn) . Description The excretory pore (visible in eight females) opened near the end of the esophagus. Esophageal glands overlapped the intestine. Body cuticle swollen when fixed. Transverse slit-shaped vulva. Vaginal sclerot izat ions small. No males were observed.

PAGE 161

149 Discussion In the literature, the following are synonyms of Paratrichodorus minor (Colbran, 1956) Siddiqi, 1974: Trichodorus minor, Colbran, 1956 Trichodorus christiei , Allen, 1957 Paratrichodorus christiei (Allen, 1957) Siddiqi, 1974 Trichodorus obesus , Razjivin and Pent on, 1975 All the morphometric data from our female specimens indicated that the species from the potato field site was P. minor. We found no males specimens as previously reported (Harrison, 1975) . All the specimens examined had the cuticle from moderately to extensively swollen. The degree of swelling of the body cuticle is used in diagnoses at the genera level of the subfamily Trichodorinae (Decraemer, 1989) . The genus Paratrichodorus has the body cuticle usually swollen in specimens heat killed or treated with acid fixative. In the genus Trichodorus the cuticle does not swell upon fixation. Body length, although not a reliable taxonomic character, corresponded to that of P. christiei females. Malek et al . (1965), showed that as temperature increases, the size of T.

PAGE 162

150 christiei decreases. The absence of males was another indication that there were no T. proximus in our population. Supposedly, males and females are in equal numbers in T. proximus populations (Decraemer, 1991) . Mean onchiostyle length from our specimens was similar to that of P. minor. This is the most frequently used criterion in the species diagnoses within Paratrichodorus (Decraemer, 1989) , and Bird and Mai (1968) reported that the onchiostyle length of P. christiei had the least variance of the measurable taxonomic features. There was no evidence of mixed trichodorid populations in our field. This disagreement with the previous report of a mixed population of trichodorid (Harrison, 1975) could be due to difference in location, or maybe there was a population change over time where one species dominated the other .

PAGE 163

LIST OF REFERENCES Allen, M. W. 1957. A review of the nematode genus Trichodorus with description of ten new species. Nematologica 2:32-62. Alphey, T. J. W. 1985. A study of spatial distribution and population dynamics of two sympatric species of trichodorid nematodes. Annals of Applied Biology 107:497-509. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410. Angenent, G. C. ( E. Posthumus, F. T. Brederode, and J. G. Bol . 1989. Genome structure of tobacco rattle virus strain PLB: Further evidence on the occurrence of RNA recombination among tobraviruses . Virology 171:271-274. Anonymous. 1996. 1996 Florida Agricultural Facts. Florida Department of Agriculture and Consumer Services, Tampa, Fl . Anscombe, F. J. 1950. Soil sampling for potato root eelworm cysts. Annals of Applied Biology 37:286-295. Barker, K. R. 1991. Rotation and cropping systems for nematode control: The North Carolina experienceIntroduction. Journal of Nematology 23:342-343. Barker, K. R., and C. L. Campbell. 1981. Sampling nematode populations. Pp. 281-301 in B . M. Zuckerman, and R. A. Rohde, eds. Plant Parasitic Nematodes, vol. III. New York: Academic Press. Barker, K. R., and C. J. Nusbaum. 1971. Diagnostic and advisory programs. Pp. 281-301 in B. M. Zuckerman, W. F. Mai, and R. A. Rohde eds. Plant Parasitic Nematodes, vol. I. New York: Academic Press. 151

PAGE 164

152 Barker, H., K. D. Webster, and B. Reavy. 1993. Detection of potato virus Y in potato tubers : A comparison of polymerase chain reaction and enzymelinked immunosorbent essay. Potato Research 36:13-20. Birchfield, W. , and A. A. Antonopoulos . 1978. Further observations on Duboscqia penetrans , a parasite of nematodes . Proceedings of the American Phytopathological Society 4 : 221-222 . Bird, G. W. , and W. F. Mai. 1967a. A numerical study of the growth and development of Trichodorus christiei . Canadian Journal of Zoology 46:109-114. Bird, G. W. , and W. F. Mai. 1967b. Factors influencing population densities of Trichodorus christiei. Phytopathology 57:1368-1371. Bird, G. W. , and W. F. Mai. 1968. Morphometric and allometric variations of Trichodorus christiei . Nematologica 13: 617-632. Boag, B. 1981. Observations on the population dynamics and vertical distribution of trichodorid nematodes in Scottish forest nursery. Annals of Applied Biology 98:463-569. Boag, B. 1983. Effect of rotary cultivation on plantparasitic nematodes. Crop Research 23:33-37. Boag, B. 1985. Effect of soil compaction on migratory plant-parasitic nematodes. Crop Research 25:63-67. Boyd, F. T., V. N. Schroder, and V. G. Perry. 1971. Interaction of nematodes and soil temperature on growth of three tropical grasses. Agronomy Journal 64:497-500. Brodie, B. B. 1968. Systemic pesticides for control of sting and stubby root nematodes on vegetables. Plant Disease Reporter 52:19-23. Brodie, B. B. 1976. Vertical distribution of three nematode species in relation to certain soil properties. Journal of Nematology 8:243-24 7.

PAGE 165

Brodie, B. B., and B. H. Quattlebaum. 1970. Vertical distribution and population fluctuations of three nematode species as correlated with soil temperature, moisture and texture. Phytopathology 60:1286 (Abstr.). Brown, D. J. F., A. T. Ploeg, and D. J. Robinson. 1989. A review of reported associations between Trichodorus and Para.tr ichodorus species (Nematode: Trichodoridae) and tobraviruses with a description of laboratory methods for examining virus transmission by trichodorids . Revue de Nematologie 12:235-241. Byrd, D. W., K. R. Barker, H. Ferris, C. J. Nusbaum, W. E. Griffin, R. H. Small, and C. A. Stone. 1976. Two semiautomatic elutriators for extracting nematodes and certain fungi from soil. Journal of Nematology 8:206-212. Cadman, C. H., and B. D. Ha rrison. 1959. Studies on the properties of soil-borne viruses of the tobacco-rattle type occurring in Scotland. Annals of Applied Biology 47:542556 . Calvert, E. C, and B. D. Harrison. 1966. Potato moptop: A soil-borne virus. Plant Pathology 15:134-139. Christie, J. R. 1959. Plant nematodes, their bionomics and control. Jacksonville, FL: H. & D. B. Drew Company. Christie, J. R. , A. N. Brooks, and V. G. Perry. 1952. The sting nematode, Belonolaimus gracilis , a parasite of major importance on strawberries, celery, and sweet corn in Florida. Phytopathology 432:173-176. Christie, J. R., and V. G. Perry. 1951. A root disease of plants caused by a nematode of the genus Trichodorus . Science 113:491-493. Cooke, D. A. 1973. The effect of plant -parasitic nematodes, rainfall and other factors on docking disorder of sugar beet. Plant Pathology 22:161-170. Cooper, J. I., and B. D. Harrison. 1973. The role of weed hosts and the distribution and activity of vector nematodes

PAGE 166

154 in ecology of tobacco rattle virus. Annals of Applied Biology 73 :53-66 . Cooper, J. I., and M. A. Mayo. 1972. Some properties of the particles of three tobravirus isolates. Journal of General Virology 16:285-297. Cooper, J. I., and P. R. Thomas. 1970. Trichodorus nanus, a vector of tobacco rattle virus in Scotland. Plant Pathology 19:197. Cooper, J. I., and P. R. Thomas. 1971. Chemical treatment of soil to prevent transmission of tobacco rattle virus to potato by Trichodorus spp. Annals of Applied Biology 69:2334 . Cornelissen, B. J. C, H. J. M. Linthorst, F. T. H. Brederode, and J. F. Bol . 1986. Analysis of the genome structure of tobacco rattle virus strain PSG. Nucleic Acids Research 14:2157-2169. Courtney, W. D., D. Polley, and V. L. Milles. 1995. TAF, an improved fixative in nematode technique. Plant Disease Reporter 39: 570-571. Cremer, M. G., and P. K. Schenk. 1967. Notched leaf in Gladiolus spp., caused by viruses of the tobacco rattle virus group. Netherlands Journal of Plant Pathology 73:3348 . Crosslin, J. M. , and P. E. Thomas. 1995. Detection of tobacco rattle virus in tubers exhibiting symptoms of corky ringspot by polymerase chain reaction. American Potato Journal 72:605-609. Dallimore, C. E. 1972. Control of corky ringspot in Russett Burbank potatoes by soil fumigation. American Potato Journal 49:366. Decraemer, W. 1989. Morphologic variability and value of the characters used for species identification in Paratrichodorus Siddiqi, 1974 (Nematoda: Trichodoridae ) . Nematologica 35:37:61.

PAGE 167

155 Decraemer, W. 1991. Stubby root and virus vector nematodes: Trichodorus, Paratrichodorus , Allotrichodorus , and Mono trichodorus . Pp. 587-625 in W. R. Nickle, ed. Manual of Agricultural Nematology. New York: Marcel Dekker. Dickerson, 0. J., W. G. Willis, F. J. Dainello, and J. C. Pain. 1972. The sting nematode, Belonolaimus long i cauda tus , in Kansas. Plant Disease Reporter 56:957. Dickson, D. W. , M. Oostendorp, R. M. Giblin-Davis , and D. J. Mitchell. 1994. Control of plant-parasitic nematodes by biological antagonists. Pp. 576-601 in D. Rosen, F. D. Bennett, and J. L. Capinera, eds . Pest Management in the Subtropics. Andover, U. K.: Intercept Ltd. Feller, W. 1968. An introduction to probability theory and its applications. New York: Wiley. Ferris, H. 1974. Correlation of tobacco yield, value, and root-knot index with earlyto-midseason, and postharvest Meloidogyne population densities. Journal of Nematology 6: 75-81 . Ferris, H., and J. W. Noling. 1987. Analysis and prediction as a basis for management decisions. Pp. 49-85 in R. H. Brown, and B. R. Kerry, eds. Principles and practice of nematode control in crops. New York: Academic Press . Freund R. J., and W. J. Wilson. 1993. Statistical methods. New York: Academic Press. Giblin-Davis, R. M., L. L. McDaniel, and F. G. Bilz. 1990. Isolates of the Pasteuria penetrans group from phytoparasitic nematodes in bermudagrass turf. Supplement to the Journal of Nematology 22:750-762. Gugerli, P. 1976. Different states of aggregation of tobacco rattle virus coat protein. Journal of General Virology 33:297-307. Hafkenscheid H. H. M. 1971. Influence of Cu ++ ions on Trichodorus pachydermus and extraction method to obtain active specimens. Nematologica 17:535-541.

PAGE 168

156 Hamilton, W. E. 0., M. Boccara, K. J. Robinson, and D. C. Baulcombe. 1987. The complete nucleotide sequence of tobacco rattle virus RNA-1. Journal of General Virology 68:2563-2575. Harrison B. D. 1970. Tobacco rattle virus. C . M . I . /A. A. B . Descriptions of plant viruses No 346. Slough, England: Commonwealth Agricultural Bureaux. Harrison, R. E. 1975. The corky ringspot disease of potatoes: Biology of Trichodorus christiei and Trichodorus proximus and evidence for existence of unstable tobacco rattle virus in corky ringspot -infected potatoes. Ph.D. Dissertation, University of Florida, Gainesville, FL. Harrison, B. D., and D. J. Robinson. 1978. The tobraviruses . Advances in Virus Research 23:25-77. Harrison, B. D., and D. J. Robinson. 1981. Tobraviruses. Pp. 515-540 in Handbook of plant virus infections: Comparative diagnosis. E. Kurstak, ed. New York: Elsevier North-Holland. Harrison, B. D., and D. J. Robinson. 1982. Genome reconstitution and nucleic acid hybridization as methods of identifying particle-deficient isolates of tobacco rattle virus in potato plants with stem-mottle disease. Journal of Virology Methods 5:255-265. Harrison, B. D. , and D. J. Robinson. 1986. Tobraviruses. Pp. 3 91-396 in The plant viruses. M. H. V. van Regenmortes, and H. Freaenckel, eds . New York: Plenum Press. Harrison, B. D., D. J. Robinson, W. P. Mowat, and G. H. Duncan. 1983. Comparison of nucleic acid hybridization and other tests for detecting tobacco rattle virus in narcissus plants and potato tubers. Annals of Applied Biology 102 : 331-338 . Harrison B. D., and R. D. Woods. 1966. Serotypes and particle dimensions of tobacco rattle viruses from Europe and America. Virology 28:610-620.

PAGE 169

Hernandez, C, J. E. Carette, D. J. F. Brown, and J. F. Bol . 1996. Serial passage of tobacco rattle virus under different selection conditions results in deletion of structural and nonstructural genes in RNA 2 . Journal of Virology 70:4933-4940. Hewlett, T. E., R. Cox, D. W. Dickson, and R. A. Dunn. 1994. Occurrence of Pasteuria spp . in Florida. Supplement to the Journal of Nematology 26:616-619. Hochmuth, G. J., D. N. Maynard, C. S. Vavrina, W. M. Stall, T. A. Kucharek, F. A. Johnson, and T. G. Taylor. 1996. Pp. 261-17 0 in G. J. Hochmuth, and D N. Maynard, eds . Vegetable production guide for Florida. Institute of Food and Agricultural Sciences. Gainesville, Fl . Hogger, CH. 1973. Preferred feeding site of Trichodorus christiei on tomato roots. Journal of Nematology 5228-229. Jenkins, W. R. 1964. A rapid centrifugal flotation technique for separating nematodes from soil. Plant Disease Reporter 48 : 692 . Johnson, A. W. , and J. Feldmesser. 1987. Nematicides-A historical review. Pp. 448-454 in Vistas on nematology: a commemoration of the twenty-fifth anniversary of the Society of Nematologists . J. A. Veech and D. W. Dickson, eds. Hyattsville, MD: Society of Nematologists. Jones, F. G. W. , D. W. Larbey, and D. M. Parrot. 196 9. The influence of soil structure and moisture on nematodes, especially Xiphinema, Long i dor us , Trichodorus and Heterodera spp. Soil Biology and Biochemistry 1:153-165. Kable, P. F., and W. F. Mai. 1968 Influence of soil moisture on Pratylenchus penetrans. Nematologica 14:101122 . Kawchuk, L. M . , D. R. Lynch, F. L. Leggett, R. J. Howard, and J. G. McDonald. 1997. Detection and characterization of a Canadian tobacco rattle virus isolate using a PCR-based assay. Canadian Journal of Plant Pathology 19:101-105.

PAGE 170

158 Khuong, N. B., and G. C. Smart, Jr. 1975. The effects of Belonolaimus longicaudatus on growth of collard, kale and cauliflower. Plant Disease Reporter 59:819-822. Koepsell, P. A., T. C. Allen, and H. J. Jensen. 1974. Tobacco rattle virus in Oregon potatoes. Extension Circular 844, Corvallis, OR: Oregon State University Extension Service . Kubo, S., B. D. Harrison, D. J. Robinson, and M. A. Mayo. 1975. Tobacco rattle virus in tobacco mesophyll protoplasts: Infection and virus multiplication. Journal of General Virology 27:293-304. Kurppa, A., A. T. Jones, B. D. Harrison, and K. W. Bailiss. 1981. Properties of spinach yellow mottle, a distinctive strain of tobacco rattle virus. Annals of Applied Biology 98 : 243-254 . Legorburu, F. J., D. J. Robinson, L. Torrance, and G. H. Duncan. 1995. Antigenic analysis of nematode -transmissible and nontransmissible isolates of tobacco rattle tobravirus using monoclonal antibodies. Journal of General Virology 76 : 1497-1501 . Legorburu, F. J... D. J. Robinson, L. Torrance, and G. H. Duncan. 1996. Features on the surface of the tobacco rattle tobravirus particle that are antigenic and sensitive to proteolytic digestion. Journal of General Virology 855859 . Lister, R. M. 1968. Possible relationships of virus specific products of infection by viruses of tobacco rattle virus type. Journal of General Virology 2:43:58. Livingston, C. H., R. Lambert, M. Kaufman, and K. Knutson. 1976. Effects of soil fumigation with Telone-C on the field inoculum potential of tobacco rattle virus and potato yields. American Potato Journal 53:81-86. Lown, C. (ed.) . 1997. The commodity research bureau year book. New York: John Wiley.

PAGE 171

Maas, P. W. T. 1975. Soil fumigation and crop rotation to control spraing disease in potatoes . Netherlands Journal of Plant Pathology 81:138-143. MacFarlane, S. A., and D. J. F. Brown. 1995. Sequence comparison of RNA2 of nematode-transmissible and nematode non-transmissible isolates of pea early-browning virus suggests that the gene encoding the 2 9 kDa protein may be involved in nematode transmission. Journal of General Virology 76:1299-1304. MacFarlane, S. A., D. J. F. Brown, and J. F. Bol . 19 95. The transmission by nematodes of tobraviruses is not determined exclusively by the virus coat protein. European Journal of Plant Pathology 101:535-53 9. MacFarlane, S. A., S. C. Taylor, D. I. King, G. Hughes, and J. W. Davies. 1989. Pea early browning virus RNA 1 encodes four polypeptides including a putative zinc-finger protein. Nucleic Acids Research 17:2245-2260. Malek, W. R., W. R. Jenkins, and E. M. Powers. 1965. Effect of temperature on growth and reproduction of Criconemoides curvatum and Trichodorus christiei. Nematologica 11:41 (Abstr.). Mashela, P., R. McSorley, L. W. Duncan, and R. A. Dunn. 1991. Correlation of Belonolaimus longicaudatus , Hoplolaimus galeatus , and soil texture with yield of alyceclover {Alysicarpus spp . ) . Nematropica 21:177-184. Mayo, M. A., K. M. Brierley, and B. A. Goodman. 1993. Developments in the understanding of the particle structure of tobraviruses. Biochimie 75:639-644. McSorley, R. 1982. Simulated sampling strategies for nematodes distributed according to a negative binomial model. Journal of Nematology 14:517-522. McSorley, R. 1987. Extraction of nematodes and sampling methods. Pp. 13-47 in Principles and practice of nematode control in crops. R. H. Brown and B. R. Kerry, eds . Sydney, Australia: Academic Press.

PAGE 172

160 McSorley, R., and D. W. Dickson. 1990a. Vertical distribution of plant -parasitic nematodes in sandy soil under maize. Plant and Soil 123:95-100. McSorley, R. , and D. W. Dickson. 1990b. Vertical distribution of plant -parasitic nematodes in sandy soil under soybean. Journal of Nematology 22:90-96. McSorley, R., and D. W. Dickson. 1995. Effect of tropical rotation crops on Meloidogyne incognita and other plant parasitic nematodes. Supplement to the Journal of Nematology 27:535-544. McSorley, R., and R. N. Gallaher. 1991. Managing plantparasitic nematodes in crop sequences. Proceedings of the Soil and Crop Science Society of Florida 51:25-27. McSorley, R. , and R. N. Gallaher. 1992. Comparison of nematode population densities on six summer crops at seven sites in north Florida. Supplement to the Journal of Nematology 23:673-677. McSorley R., M. L . Lamberts, J. L . , Parrado, and J. S. Reynolds. 1986. Reaction of sorghum cultivars and other cover crops to two races of Meloidogyne incognita . Soil and Crop Science Society of Florida Proceedings 46:14-16. McSorley, R., and R. C. Littell. 1993. Probability of detecting nematode infestations in quarantine samples. Nematropica 23:177-181. McSorley, R. , and J. L. Parrado. 1987. Nematode losses during sieving from two soil types. Nematropica 17:125-146. Mendenhall, W. , D. D. Wackerly, and R. L. Scheaffer. 1990. Mathematical statistics with applications. 4th ed. Boston, MA: PWS-Kent. Miller, L. I. 1972. The influence of soil texture on the survival of Belonolaimus longicaudatus . Phytopathology 62 : 670 (Abstr . ) . Mojtahedi, H., G. S. Santo, and C. R. Brown. 1997. Ecology of Paratrichodorus allius, a tobacco rattle virus vector,

PAGE 173

161 from the Pacific northwest. Journal of Nematology 26: in press (Abstr . ) . Montgomery, D. C. 1991. Design and analysis of experiments. 3rd ed. New York: John Wiley. Mundo-Ocampo, M. , J. 0. Becker, and J. Baldwin. 1994. Occurrence of Belonolaimus longicaudatus on bermudagrass in the Coachella Valley. Plant Disease 78:529. Myers, R. F. 1979. The sting nematode, Belonolaimus longicaudatus , from New Jersey. Plant Disease Reporter 63 -.156-151 . Myhre, D. L. Summer cover crops in potato production. 1957. Florida State Horticultural Society 70:104:106. National Potato Council. 1992. Potato statistical yearbook. Englewood, CO: National Potato Council. Noe, J. P., J. N. Sasser, and J. L . Imbriani . 1991. Maximizing potential of cropping systems for nematode management. Journal of Nematology 23:353-361. Nusbaum, C. J., and H. Ferris. 1973. The role of cropping systems in nematode population management. Annual Review of Phytopathology 11:423-44 0. Perry, V. G. 1953. Return of nematodes following fumigation of Florida soils. Proceeding of the Florida State Horticultural Society 77:233-237. Perry, V. G. 1964. Nematode host -parasite relationships. Florida Agricultural Experiment Station, Annual Report 1964:115-116. Gainesville, FL . Perry, V. G., and H. L . Rhoades . 1982a. The trichodorid nematodes. Pp. 183-186 in Nematology in the southeastern United States. R. D. Riggs, ed. Southern Cooperative Series Bulletin 276, Fayetteville , AR. Perry, V. G., and H. L. Rhoades. 1982b. The genus Belonolaimus. Pp. 144-14 9 in Nematology in the southeastern

PAGE 174

162 United States. R. D. Riggs, ed. Southern Cooperative Series Bulletin 276, Fayetteville , AR. Pitcher, R. S. 1967. The host -parasite relations and ecology of Trichodorus viruliferus on apple roots, as observed from an underground laboratory. Nematologica 13 : 547-557 . Pitcher, R. S., and D. G. McNamara . 1970. The effect of nutrition and season of year on the reproduction of Trichodorus viruliferus. Nematologica 16:99-106. Ploeg, A. T., D. J. F. Brown, and D. J. Robinson. 1992a. Acquisition and subsequent transmission of tobacco rattle virus by Paratrichodorus and Trichodorus nematode species. Netherlands Journal of Plant Pathology 98 291-300. Ploeg, A. T., D. J. F. Brown, and D. J. Robinson. 1992b. The association between species of Trichodorus and Paratrichodorus vector nematodes and serotypes of tobacco rattle tobravirus . Annals of Applied Biology 121:619-630. Ploeg, A. T., D. J. Robinson, and D. J. F. Brown. 1993. RNA-2 of tobacco rattle virus encodes the determinants of transmissibility by trichodorid nematodes. Journal of General Virology 74:1463-1466. Raski, D. J., N. 0. Jones, and D. R. Roggen. 1969. On the morphology and ultrastructure of the esophageal region of Trichodorus allius Jensen. Proceedings of the Helminthological Society of Washington 36:106-118. Rau, G. C. 1958. A new species of sting nematode. Proceedings of the Helminthological Society of Washington 25 : 95-98 . Rhoades, H. L. 1968. Re-establishment of Trichodorus christiei subsequent to soil fumigation in central Florida. Plant Disease Reporter 52:573-575. Rhoades, H. L . 1976. Effect of Indigofera hirsuta on Belonolaimus longicaudatus , Meloidogyne incognita, and M. javanica and subsequent crop yields. Plant Disease Reporter 60 :384-386 .

PAGE 175

163 Rhoades, H. L. 1984. Effects of fallowing, summer cover crops, and fenamiphos on nematode populations and yields in a cabbagefield corn rotation in Florida. Nematropica 14 : 131-138 . Rhoades, H. L . , and R. B. Forbes. 1986. Effects of fallow, cover crops, organic mulches, and fenamiphos on nematode populations, soil nutrients, and subsequent crop growth. Nematropica 16:141-151. Rhoades, H. L . , E. W. Holmes, and W. T. Scudder. 1962. A comparison of in-the-row and over-all soil fumigation for the control of plant nematodes. Proceeding of the Florida State Horticultural Society 75:125-129. Riggs, R. D. 1961. Sting nematode in Arkansas. Plant Disease Reporter 45:392. Robbins, R. T . , and K. R. Barker. 1973. Comparison of host range and reproduction among populations of Belonolaimus longicaudatus from North Carolina and Georgia. Plant Disease Reporter 57:500-554 Robbins, R. T., and H. Hirschmann. 1974. Variation among populations of Belonolaimus longicaudatus . Journal of Nematology 6:87-94. Robinson, D. J. 1973. Properties of two temperaturesensitive mutants of tobacco rattle virus. Journal of General Virology 21:499-506. Robinson, D. J. 1989. Tobacco rattle tobravirus : Variation among strains and detection by cDNA probes. EPPO Bulletin 19 : 619-623 . Robinson, D. J. 1992. Detection of tobacco rattle virus by reverse transcription and polymerase chain reaction. Journal of Virological Methods 40:57-66. Robinson, D. J., and B. D. Harrison. 1985. Unequal variation in the two genome parts of tobraviruses and evidence for the existence of three separate viruses. Journal of General Virology 66:171-176.

PAGE 176

164 Robinson, D. J., and B. D. Harrison. 1989. Tobacco rattle virus. CMI/AAB Description of Plant Viruses No 34 6. Slough, England: Commonwealth Agricultural Bureaux. Robinson, D. J., and F. J. Legorburu. 1988. Detection of tobacco rattle virus by spot hybridization. Annual Report of the Scottish Crop Research Institute for 1987:195-196. Dundee, Scotland. Rodriguez -Kabana, R. , and R. J. Collins. 1979. Relation of fertilizer treatments and cropping sequence to populations of two plant-parasitic nematode species. Nematropica 9:151166 . Rohde, R. A., and W. R. Jenkins. 1957a. Effect of temperature on the life cycle of the stubby-root nematodes. Phytopathology 47:29 (Abstr.). Rohde, R. A., and W. R. Jenkins. 1957b. Host range of a species of Trichodorus and its host -parasite relationships on tomatoes. Phytopathology 47: 2 95-298. Rogers, J. S., D. R. Hensel, and K. L. Campbell. 1975. Subsurface drainage and irrigation for potatoes. Soil and Crop Science Society of Florida Proceedings 34:16-17. Rowe, R. C. 1993. Potato health management: A holistic approach. Pp. 3-10 in R. C. Rowe, ed. Potato health management. St. Paul, MN: The American Phytopathological Society. Russell, C. C. 1962. The embryology and parasitic habit of Trichodorus christiei Allen with observations of predators. M.S. thesis, University of Florida, Gainesville, FL . Russell, C. C, and V. G. Perry. 1966. Parasitic habit of Trichodorus christiei on wheat. Phytopathology 56:357-358. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: A laboratory guide. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory.

PAGE 177

165 Samson, R. G., Allen T. C, and J. L. Whitworth. 1993. Evaluation of direct tissue blotting to detect potato viruses. American Potato Journal 70:257-265. Sanger, H. L. 1968. Characteristics of tobacco rattle virus. Evidence that its two particles are functionallydefective and mutually complementing. Molecular General Genetics 101:346-367. Sasser, J. N., and G. Uzzell. 1991. Control of soybean cyst nematode by crop rotation in combination with a nematicide. Journal of Nematology 23:344-347. Schilt, H. G., and E. Cohn. 1975. Pathogenicity and population increase of Paratrichodorus minor as influenced by environmental factors. Nematologica 21:71-80. Seinhorst, J. W. 1965. The relation between nematode density and damage to plants. Nematologica 11:137-154. Smart, G. C, Jr., and K. B. Nguyen. 1991. Sting and awl nematodes: Belonolaimus spp . and Dolichodorus spp . Pp. 587625 in Manual of agricultural nematology. W. R. Nickle, ed. New York: Marcel Dekker. Steiner, G. 1949. Plant nematodes the grower should know. Proceedings of the Soil Science Society of Florida 1942:121122 . Sutula, C. L . , J. M. Gillett, S. M. Morrissey, and D. C. Ramsdell. 1986. Interpreting ELISA data and establishing the positive-negative threshold. Plant Disease 70:722-726. Szczygiel, A., and M. Hasior. 1972. Vertical distribution of plant parasitic nematodes in the soil of strawberry plantations. Ekologia Polska 20:493-506. Taylor, C. E., and W. M. Robertson. 1970a. Sites of virus retention in the alimentary tract of the nematode vectors, Xiphinema diversicaudatum (Micol.) and X. index (Thorne and Allen). Annals of Applied Biology 66:375-380. Taylor, C. E., and W. M. Robertson. 1970b. Location of tobacco rattle virus in the nematode vector Trichodorus

PAGE 178

166 pachydermus Seinhorst. Journal of General Virology 6:179182 . Thomason, I. J. 1959. Influence of soil texture on development of the stubby-root nematode. Phytopathology 49 : 552 (Abstr . ) . Todd, T. C. 1989. Population dynamics and damage potential of Belonolaimus sp. on corn. Supplement to the Journal of Nematology 21:697-702. Todd, T. C. 1991. Effect of cropping regime on populations of Belonolaimus sp. and Pratylenchus scribneri in sandy soil. Supplement to the Journal of Nematology 23:646-651. Trivedi, P. C, and K. R. Barker. Management of nematodes by cultural practices. Nematropica 16:213-236. Trudgill, D. L., D . J. F. Brown, and D. G. McNamara. 1983. Methods and criteria for assessing the transmission of viruses by longidorid nematodes . Revue de Nematologie 6 : 133-141 . Van Hoof, H. A. 1964. Het tijdstip van infectie en veranderingen in de concentratie van ratelvirus (kringergheid) in de aardappelknol . Medelingen Landbouwhogeschool Opzoekingsster Staat, Gent 29:944-955. Van Hoof, H. A. 1968. Transmission of tobacco rattle virus by Trichodorus species. Nematologica 14:20-24. Van Hoof, H. A. 1976. The effect of soil moisture content on the activity of trichodorid nematodes. Nematologica 22 :260-264 . Van Hoof, H. A., D. Z. Maat , and J. W. Seinhorst. 1966. Viruses of the tobacco rattle virus group in Northern Italy: Their vectors and serological relationships. Netherlands Journal of Plant Pathology 72:253-258. Viglierchio, D. R., and R. V. Schmitt . 1983. On the methodology of nematode extraction from field samples: Comparison of methods for soil extraction. Journal of Nematology 15:450-454.

PAGE 179

167 Walkinshaw, C. G., Griffin, G. D., and R. H. Larson. 1961. Trichodorus christiei as a vector of potato corky ringspot (tobacco rattle virus). Phytopathology 51:806-808. Walkinshaw, C. G., and R. H. Larson. 1959. Corky ringspot of potato. Research Bulletin 217, University of Wisconsin, Madison, WI . Wallace, H. R. 1971. /Abiotic influence in the soil environment. Pp. 257-280 in B. M. Zuckerman, W. F. Mai, and R. A. Rode, eds . Plant parasitic nematodes. New York: Academic Press. Weidemann, H. L. 1995. Detection of tobacco rattle virus in potato tubers and roots by polymerase chain reaction (PCR) . Journal of Phytopathology 143:455-458. Weingartner, D. P. 1981. Tobacco rattle virus. Pp. 80-82 in W. J. Hooker, ed. Compendium of potato diseases. St. Paul, MN: American Phytopathological Society. Weingartner, D. P., R. McSorley, and R. W. Goth. 1993. Management strategies in potato for nematodes and soil-borne diseases in subtropical Florida. Nematropica 23:233-245. Weingartner, D. P., J. Meldrum, J. R. Shumaker, and L. Wallis, III. 1991. Influence of Indigofera hirsuta and Sorghum bicolor x S. arundinaceum var . sudanense on nematodes, corky ringspot disease, and potato yields in Florida. Nematropica 21:135 (Abstr.). Weingartner, D. P., and J. R. Shumaker. 1990a. Effects of soil fumigants and aldicarb on corky ringspot disease and trichodorid nematodes on potato. Supplement to the Journal of Nematology 22:665-671. Weingartner, D. P., and J. R. Shumaker. 1990b. Control of nematodes and soil-borne diseases in Florida potatoes with aldicarb and 1,3-D. Supplement to the Journal of Nematology 22 : 775-778 . Weingartner, D. P., and J. R. Shumaker. 1990c. Effects of soil fumigants and aldicarb on nematodes, tuber quality, and

PAGE 180

168 yield in potato. Supplement to the Journal of Nematology 22 : 767-774 . Weingartner, D. P., J. R. Shumaker, D. W. Dickson, and G. C. Smart, Jr. 1973. Improving the quality of potato tubers through the use of nematicides. Proceedings of the Soil Crop Science Society of Florida 33:68-72. Weingartner, D. P., J. R. Shumaker, and G. C. Smart, Jr. 1975a. Incidence of corky ringspot disease as affected by different fumigation rates, cultivars, and harvest dates. Proceedings of the Soil Crop Science Society of Florida 34 : 194-196 . Weingartner, D. P., J. R. Shumaker, and G. C. Smart, Jr. 1975b. Chemical control of corky ringspot disease on potatoes in Florida, U. S. A. Pp. 443-444 in Nematode vectors of plant viruses. F. Lambert i, Taylor C. E., and J. W. Seinhorst, eds . New York: Plenum Press. Weingartner, D. P., J. R. Shumaker, and G. C. Smart, Jr. 1983. Why soil fumigation fails to control potato corky ringspot disease in Florida. Plant Disease 67:130-134. Weingartner, D. P., J. R. Shumaker, G. C. Smart, Jr., and D. W. Dickson. 1976. A new nematode control program for potatoes in northeast Florida. Proceedings of the Florida State Horticultural Society 88:175-182. Williams, R. E., R. E. Ingham, and K. A. Rykbost . 1996. Control of corky ringspot disease in potatoes with Telone in the Pacific northwest: 1990-1994. Down to Earth 51:25-29. Wyss, U. 1977. Feeding processes of virus transmitting nematodes . Proceedings of the American Phytopathological Society 4 : 30-41 . Wyss, U. 1981. Ectoparasitic root nematodes: Feeding behavior and plant cell responses. Pp. 325-351 in Plant parasitic nematodes, vol. III. B. M. Zuckerman and R. A. Rohde, eds. New York: Academic Press.

PAGE 181

Wyss, U. behavior 644 . 1982. Virusand effect on transmitting root cells. nematodes : Feeding Plant Disease 66:639Wyss, U. , R. Jank-Ladwig, and H. Lehmann. 1979. On the formation and ultrastructure of feeding tubes produced by trichodorid nematodes. Nematologica 25:385-390. Yeh, S.-D., and D. Gonsalves. 1984. Purification and immunological analyses of cylindrical-inclusion protein induced by papaya ringspot virus and watermelon mosaic virus 1. Phytopathology 74:1273-1278.

PAGE 182

BIBLIOGRAPHICAL SKETCH Enrique E. Perez was born in Tucuman, Argentina. He entered the Universidad Nacional de Tucuman in April 1980 and completed his Bachelor of Science degree in agricultural engineering in December 1986. He worked for the government of Argentina from 1985 to 1990 and also worked part time for the private sector during those last three years . In January 1991 he started his Master of Science program in the Department of Plant Pathology at Clemson University working with nematodes on soybean. He started his Ph.D. program in the Department of Entomology and Nematology at the University of Florida in August 1993. He began working under the supervision of Drs . McSorley and Weingartner on nematode sampling and nematode virus interaction on potato. 170

PAGE 183

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Robert McSorley, Chair Professor of Entomology and Nematology D. Peter Weingartner, Cochair Professor of Plant Pathology Don W. Dickson Professor of Entomology and Nematology

PAGE 184

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. This dissertation was submitted to the Graduate Faculty of the College of Agriculture and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. Ernest Hiebert Professor of Plant Pathology Ramon Littell Professor of Statistics December, 1997 Dean, College of Agriculture Dean, Graduate School