Citation
Wolbachia symbiosis in the agriculturally important predatory mite Metaseiulus occidentalis

Material Information

Title:
Wolbachia symbiosis in the agriculturally important predatory mite Metaseiulus occidentalis
Creator:
Johanowicz, Denise L., 1968-
Publication Date:
Language:
English
Physical Description:
vi, 109 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Eggs ( jstor )
Female animals ( jstor )
Infections ( jstor )
Insects ( jstor )
Mites ( jstor )
Polymerase chain reaction ( jstor )
Predators ( jstor )
Sex ratio ( jstor )
Spiders ( jstor )
Wolbachia ( jstor )
Dissertations, Academic -- Entomology and Nematology -- UF ( lcsh )
Entomology and Nematology thesis, Ph.D ( lcsh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1997.
Bibliography:
Includes bibliographical references (leaves 97-108).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Denise L. Johanowicz.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
028629984 ( ALEPH )
38855543 ( OCLC )

Downloads

This item has the following downloads:


Full Text










WOLBACHIA SYMBIOSIS IN THE AGRICULTURALLY IMPORTANT
PREDATORY MITE METASEIULUS OCCIDENTALIS











By

DENISE L. JOHANOWICZ


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1997














ACKNOWLEDGMENTS


Thanks go to those who provided mites for my Wolbachia survey (D.

Wrensch, M. Jehele, B. Croft, E. Beers and S. Bruce-Oliver), to 0. Edwards and J. Presnail for providing technical assistance and general advice at the initiation of this project, to S. O'Neill for providing advice and Wolbachia 16S PCR primers, and to R. Giordano for providing valuable advice on the molecular study of Wolbachia in arthropods. The University of Florida Interdisciplinary Center for Biotechnology Research assisted with polymerase chain reaction primer synthesis and DNA sequencing. J. Harrison provided statistical advice.

I thank J. Allen, J. H. Frank, J. Dame, and J. Nation for their help during this project. Special thanks go to Ayyemperumal Jeyaprakash (Dr. Jey) for his patient efforts in teaching me molecular skills, but most of all, for teaching me how to be more patient myself. I am extremely grateful to Marjorie Hoy for opening my eyes to the fascinating world of mites, for sharing her ideas about Wolbachia, for her careful editing of my work, for her optimism, and for her high expectations. I also thank her for supporting this work with funds from the Davies, Fischer, and Eckes Endowment in Biological Control. Finally, I thank my mom, my dad, my two brothers Chris and Stevie, my grandparents, and my husband David Hei for their encouragement, support, and love.


ii














TABLE OF CONTENTS




page

ACKNOWLEDGMENTS...............................................................1i

A B S T R A C T ...............................................................................................................iii

CHAPTERS

1 IN TR O D U C TIO N ............................................................................................... 1

H isto rical S k etch ...................................................................................................1
W olbachia B iology ............................................................................................ 3
Wolbachia in the Predatory Mite Metasehulus occidentalis ......................... 7
R esearch G oals................................................................................................. 12

2 16S RIBOSOMAL DNA ANALYSIS OF WOLBACHIA FROM
TWO PHYTOSEIIDS (ACARI: PHYTOSEIIDAE) AND
THEIR PREY (ACARI: TETRANYCHIDAE)............................................15

In tro d u ction ..................................................................................................... . 15
Materials and Methods................................................................................. 18
R e su lts ...................................................................................................................2 2
D iscu ssio n ....................................................................................................... . 26

3 FURTHER GENETIC CHARACTERIZATION OF
WOLBACHIA USING PARTIAL FTSZ GENE
SE Q U E N C E S ................................................................................................. 33

In tro d u ction ................................................................................................... . 33
M eth o d s ................................................................................................................34
R e su lts ...................................................................................................................3 8
D iscu ssion ....................................................................................................... . 39

4 EXPERIMENTAL INDUCTION AND TERMINATION OF
NONRECIPROCAL REPRODUCTIVE
INCOMPATIBILITIES IN A PARAHAPLOID MITE............................43

In tro d u ction ................................................................................................... . 43
M eth o d s ................................................................................................................4 6
R e su lts ...................................................................................................................5 0
D iscu ssion ....................................................................................................... . 53


iii











5 WOLBACHIA INFECTION DYNAMICS IN
EXPERIMENTAL LABORATORY POPULATIONS OF
M ETA SEIU LU S O CCID EN TA LIS ............................................................. 62

Introduction .................................................................................................... 62
M ethods ................................................................................................................67
Results ...................................................................................................................72
D iscussion ........................................................................................................ 74

6 C O N C LU SIO N S ............................................................................................. 84

A PPEN D IX A ...................................................................................................... 91

A PPEN D IX B ........................................................................................................ 93

LIST O F REFER EN C ES...................................................................................... 97

BIO G RA PH IC A L SK ETC H .................................................................................109


iv














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

WOLBACHIA SYMBIOSIS IN THE AGRICULTURALLY IMPORTANT
PREDATORY MITE METASEIULUS OCCIDENTALIS By

Denise L. Johanowicz

December 1997

Chairman: Marjorie A. Hoy
Major Department: Entomology and Nematology

This study focused on detecting, describing, and evaluating the biological effects of Wolbachia endosymbionts in the predatory mite Metaseiulus occidentalis (Nesbitt) (Acari: Phytoseiidae). Wolbachia were found in adults and eggs of M. occidentalis using Wolbachia-specific polymerase chain reaction (PCR) primers which amplify the 16S ribosomal RNA and ftsZ genes. Wolbachia also were found in their prey, the two spotted spider mite Tetranychus urticae Koch (Acari: Tetranychidae). Wolbachia DNA from the two mite species was sequenced and compared. Parsimony analysis indicated the mite Wolbachia sequences were very similar to one another and to Wolbachia from insects. Wolbachia DNA could be transiently detected in the uninfected predatory mite Amblyseius reductus Wainstein (Acari: Phytoseiidae) after feeding on infected spider mites, indicating the infection status of any predatory arthropod's diet should be considered before using the PCR to detect Wolbachia.


v









In insects, Wolbachia causes nonreciprocal reproductive

incompatibilities in crosses between infected males and uninfected females; the reciprocal crosses are normal. Genetically similar populations of M. occidentalis differing in the presence of Wolbachia (due to heat-curing of one population) were crossed to assess the effects of the symbiont. Wolbachia did induce non-reciprocal incompatibilities in this parahaploid mite, evidenced by significantly fewer viable eggs, higher proportions of egg shriveling as compared to the reciprocal and control crosses, and no or few female progeny.

To determine whether the proportion of Wolbachia-infected M.

occidentalis in a polymorphic population would increase over time (because infected females can reproduce with both infected and uninfected males), three M. occidentalis populations were initiated with 10% infected and 90% cured mites and monitored for 12 generations. Wolbachia infection did not spread rapidly through the populations. Imperfect transmission rates and fitness costs were detected, which may prevent the rapid spread of Wolbachia. This suggests Wolbachia would not be useful as a "drive mechanism" for inserting useful genes into field populations of M. occidentalis.


vi














CHAPTER 1
INTRODUCTION


Historical Sketch


Wolbachia bacteria were first described from the gonadal tissues of the mosquito Culex pipiens L. in 1924 by Hertig and Wolbach; the type species is therefore named Wolbachia pipientis Hertig. Strange reproductive incompatibilities were later described in Culex pipiens mosquitoes by Ghelelovitch (1952) and Laven (1951). One type of incompatibility was nonreciprocal, meaning that crosses of males from population A with females of population B resulted in normal progeny, but crosses of males from population B with females from population A (the reciprocal cross) resulted in few viable progeny. The phenomenon was named "cytoplasmic incompatibility" (Laven 1959). In the 1970s Yen and Barr (1971) first correlated these nonreciprocal, cytoplasmic incompatibilities with the presence of Wolbachia endosymbionts. They found that when Wolbachia-infected males were treated with tetracycline (which is toxic to rickettsia-like microorganisms), they could reproduce successfully with uninfected females. Because Wolbachia's morphological characters are of limited value and Wolbachia are difficult to culture outside the host (Weiss and Moulder, 1984; O'Neill et al., 1992), their presence in other arthropods was merely speculative.


1






2


In 1992, Wolbachia-specific polymerase chain reaction (PCR) primers were developed (O'Neill et al., 1992). These primers were designed to be specific to Wolbachia, while at the same time general enough to amplify Wolbachia 16S ribosomal DNA from various insects. Reproductive anomalies associated with the presence of an unknown rickettsia could now be correlated with the presence of Wolbachia. For example, Wolbachia infection was confirmed in some California populations of Drosophila simulans Sturtevant (O'Neill et al., 1992). This symbiont was previously suspected to be the causative agent of nonreciprocal reproductive incompatibilities between geographical populations of this insect (Hoffmann et al., 1986). Because uninfected females are reproductively incompatible with infected males, and infected females can reproduce successfully with infected and uninfected males, infected females tend to have a reproductive advantage in polymorphic populations (Caspari and Watson, 1959; Turelli and Hoffmann, 1991). In fact, the D. simulans Wolbachia infection has spread within and among California populations (Turelli and Hoffmann, 1991; Turelli et al., 1992) since it was first documented in 1986 (Hoffmann et al., 1986). The increased proportion of infected individuals is presumably due to the reproductive advantage afforded to infected females (Turelli and Hoffmann, 1991). Several parameters determine the ability of Wolbachia to spread through a population, including the stability of infection as a function of maternal transmission frequency, fitness costs associated with infection, and the strength of incompatibility (Hoffmann et al., 1990; Turelli et al., 1992; Clancy and Hoffmann, 1997).






3


Efforts are under way to genetically engineer insects' mutualistic

endosymbionts to be refractory to disease agents like those causing malaria or Chagas' disease (Beard et al., 1993). These transformed arthropods need a way to replace the wild-type insects already present in the field population. The ability of Wolbachia to spread through a population, as documented in D. simulans, could be harnessed as mechanism to help drive a genetically altered symbiont through a population if it "hitchhikes" with the Wolbachia-infected cytoplasm (Caspari and Watson, 1959; Beard et al., 1993).




Wolbachia Biology


A fuller understanding of Wolbachia biology is necessary before it can be used successfully as a drive mechanism (Werren, 1997). What is known about these endosymbionts is that they are intracellular, rickettsial-like endosymbionts in the alpha-subdivision of the proteobacteria (purple bacteria) (for a review of the biology of this symbiont and the diversity of hosts it infects, see Werren, 1997). Wolbachia are transmitted through the egg cytoplasm, therefore transmitted solely by females. There was, however, one reported case of male transmission in laboratory populations of D. simulans (Hoffmann and Turelli, 1988). Wolbachia are sensitive to high temperatures (Stevens, 1989; Stouthamer et al., 1990; Girin and Bouletreau, 1995; Louis et al., 1993), and the antibiotics rifampin and tetracycline (Stouthamer et al., 1990a). The only success to date in culturing them outside the host has been in an Aedes albopictus (Skuse) cell line (O'Neill et al., 1995).






4


Because they cannot be studied using traditional microbiological techniques (Weiss and Moulder, 1984), the PCR and DNA sequencing has provided a major breakthrough in their study (O'Neill et al., 1992; Breeuwer et al., 1992; Rousset et al., 1992a; Stouthamer et al., 1993). The PCR allows the amplification of a specific region of Wolbaclija DNA more than a million-fold. The presence or absence of the symbiont then can be determined by visual detection of the expected size fragment of DNA in an ethidium bromidestained agarose gel under UV light. This amplification also yields ample DNA for sequencing and further description and characterization. DNA sequence analyses indicate a lack of concordance between the phylogenies of the symbiont and of the hosts, suggesting this symbiont might sometimes be transmitted horizontally from species to species (Rousset et al., 1992a; O'Neill et al., 1992). Recent studies using the PCR determined that 16% of all insect species examined are infected with Wolbachia (Werren et al., 1995a).

The effects of Wolbachia, for example the nonreciprocal reproductive incompatibilities detected in C. pipiens and D. simulans, are influenced by several factors. The strain of Wolbachia is important; some strains have been demonstrated to cause no reproductive alterations (Giordano et al., 1995). The phenotype of Wolbachia-mediated reproductive alterations also depends on the taxonomic status of the affected arthropod (Insecta, Arachnida, Isopoda) (see Werren, 1997), as well as the genetic system of the arthropod. It is important to consider arthropod genetic systems in order to better appreciate the diversity of Wolbachia's effects on reproduction.

Diplo-diploid arthropods produce both sexes from fertilized eggs, each sex carrying both the maternal and paternal sets of chromosomes






5


throughout their lives. In haplo-diploid arthropods, female progeny arise from fertilized eggs and are diploid, but the male progeny arise from unfertilized eggs and are haploid, carrying only the maternal set of chromosomes. Thelytoky is a genetic system in which virgin females produce diploid daughters parthenogenetically, rarely producing males. In a parahaploid genetic system, both sexes initially arise from fertilized (diploid) eggs, with both sets of chromosomes. However, one chromosome set is subsequently lost in males, and the adult male is haploid, producing sperm by a mitotic process.

When males of infected diplo-diploids mate with females lacking

Wolbachia, the paternal chromosome set becomes abnormal in the fertilized egg (Kose and Karr, 1995; O'Neill and Karr, 1990), resulting in the death of both male and female progeny (Hoffmann et al., 1986; Hsiao and Hsiao, 1985). The reciprocal cross is normal. Although the molecular mechanism of this incompatibility is not yet fully understood, it is speculated that Wolbachia somehow "imprints" or "modifies" the paternal set of chromosomes (Werren, 1997). If Wolbachia is present in the egg cytoplasm, it can "rescue" the paternal chromosomes so that they remain normal and produce the normal diploid sons and daughters. If no Wolbachia is present, there is no "rescue" and those paternal chromosome set becomes abnormal, leading to embryonic death.

This same mechanism may occur in haplo-diploid insects, but with different consequences. When infected haploid males mate with uninfected diploid females, the male (haploid) progeny remain normal, but the normally diploid female embryos become haploid due to abnormalities in the paternal set of chromosomes (Ryan and Saul, 1968; Reed and Werren,






6


1995). The resulting phenotype of Wolbachia-mediated incompatibilities in haplo-diploid species is a strongly male-biased sex ratio because of the loss of female progeny. The haploid female embryos may die, as in some strains of the two-spotted spider mite Tetranychus urticae Koch (Chelicerata: Arachnida) (Vala and Breeuwer, 1996), or the haploid female embryos can become males thereby increasing the total number of expected males, as in the jewel wasp Nasonia vitripennis Walker (Mandibulata: Insecta) (Breeuwer and Werren, 1990; Ryan and Saul, 1968).

Wolbachia also can cause bidirectional incompatibility in diplo-diploid species (O'Neill and Karr, 1990) and haplo-diploid species (Perrot-Minot et al., 1996). In this situation, two populations apparently host two different Wolbachia strains. The result is reciprocal incompatibility, where both interpopulation crosses are incompatible.

Wolbachia induces thelytoky in some hymenopteran species, such as Trichogramma (Stouthamer et al., 1990b) and Aphytis (Zchori-Fein et al., 1995). Wolbachia allows these females to produce diploid daughters parthenogenetically by causing what is termed by Stouthamer and Kazmer (1994) as "gamete duplication" early in the first mitotic division. This phenomenon is probably described more accurately as duplication of the chromosomes in the oocyte.

Wolbachia causes a typical diplo-diploid incompatibility phenotype in some isopods (Rousset et al., 1992b), as well as an unusual phenotype in the species Armadillium vulgare Latr. In this species, Wolbachia suppresses the androgenic gland in genetically male individuals, causing these male isopods to become functional females (Rigaud et al., 1991). It is likely that, with the






7


diversity of Wolbachia's effects on the arthropod taxa and genetic systems described to date, there may be more Wolbachia-mediated reproductive anomalies remaining to be described.

Wolbachia may have other important ecological and evolutionary

effects. Wolbachia-mediated reproductive isolation may be one mechanism that could allow sympatric speciation to occur (Laven, 1959; Werren, 1997). Wolbachia alters sex ratios and progeny survival and, as a consequence, may affect laboratory experiments and insect management in field programs. For example, incompatibilities may interfere with crosses conducted during hybridization studies, one method of determining species designations in some insects and phytoseiid mites (Croft, 1970; McMurtry et al., 1976; McMurtry, 1980; McMurtry and Badii, 1989). Studies on the mode of inheritance of pesticide resistance have been affected by cross incompatibilities (Hoy and Knop, 1981; Hoy and Standow, 1982). Wolbachia infection may have implications for mass rearing projects, especially if the bacteria have an influence on the quality of the natural enemies (Steiner, 1993) or affect the rate of population increase of the individuals being reared.



Wolbachia in the Predatory Mite, Metaseiulus occidentalis


The western predatory mite Metaseiulus (=Typhlodromus or

Galendromus) occidentalis (Nesbitt) is a useful natural enemy of Tetranychus species, including the two spotted spider mite, Tetranychus urticae. This predatory mite is used as a biological control agent in various crops in the western United States (Hoyt, 1969, Hoyt and Caltagirone, 1971), including






8


apples (Hoyt, 1969; Hoyt and Caltagirone, 1971), peaches (Hoyt and Caltagirone, 1971), grapes (Flaherty and Huffaker, 1970), and almonds (Hoy, 1985). Figure 1-1 shows an adult M. occidentalis feeding on an adult T. urticae. For lists of references on M. occidentalis and other phytoseiids, see Hoy (1982) and Kostiainen and Hoy (1996).

The effectiveness of M. occidentalis can be negatively affected by chemical sprays used to control insect pests occurring within the same agricultural ecosystem. Genetically improved strains of this predator that are resistant to various chemical pesticides have been developed (reviewed by Hoy, 1985) and utilized as part of integrated pest management programs to control spider mites (Hoy et al., 1982), already resistant to many of these chemicals. In addition, efforts are under way to develop recombinant DNA techniques to further improve these and other natural enemies for use in agriculture (Presnail and Hoy, 1992).

Details about the biology, behavior, ecology, and genetics of M.

occidentalis have been and remain important to better understand and improve this predator as a biological control agent in agriculture (Hoy, 1985). Of particular interest are biological characteristics which affect their rate of population increase in the field and in the rearing laboratory (Sabelis, 1985). Studies on the genetic system, mating behavior, sex ratio, and reproductive incompatibilities of M. occidentalis have yielded a great deal of information on the reproductive biology of these predators, while at the same time have raised several interesting questions.

Studies on the reproductive biology of the phytoseiids Phytoseiulus persimilis Athias-Henriot (Helle et al., 1978), Amblyseius bibiens Blommers






9


(Helle et al., 1978), and M. occidentalis (Hoy, 1979) revealed their unique genetic system called parahaploidy (also referred to as "pseudo-arrhenotoky" by Schulten (1985) to distinguish it from the similar system found in insects). Hoy (1979) found that in studies in which X-irradiated males were mated with unirradiated females, only sons were produced. Any sons produced were low in number and sterile, suggesting these males are derived from fertilized eggs, beginning life as a diploid, and later losing half of their chromosome set sometime during embryonic development (Hoy, 1979). Nelson-Rees et al. (1980) demonstrated cytologically that both male and female M. occidentalis are diploid at the beginning of embryonic development, but at the onset of the reductional division 24-48 hours after egg deposition, one of the sets becomes heterochromatinized and excluded from the nucleus. Studies on the inheritance of pesticide resistance in P. persimilis by Helle et al. (1978) and in M. occidentalis by Hoy and Standow (1982) and Roush and Plapp (1982) suggest the paternal set of chromosomes is lost, although recent use of RAPDPCR DNA markers suggests that some of the paternal genome may be retained in males of the phytoseiid Typhlodromus pyri Scheuten (PerrotMinnot and Navajas, 1995). More data are needed to verify whether this is true and to further clarify the mechanism of parahaploidy in these and other phytoseiids.

Sex allocation and the resultant sex ratios of phytoseiids have practical consequences for biological control and associated mass rearing projects (Sabelis, 1985). Amano and Chant (1978) suggest there is a characteristic sex ratio between 50 and 100 percent females for each phytoseiid species. These sex ratios differ between the species but are fairly consistent within species






10


(Sabelis, 1981). This consistency has been contradicted by others, who have reported intraspecific variation in several species. Croft (1970) detected sex ratio differences in the colonies and differences in crosses between colonies of M. occidentalis from Utah, California and Washington. Roush and Hoy (1981) found that a carbaryl resistant strain of M. occidentalis crossed with a susceptible colony produced progeny with sex ratios different from those of each strain mated inter se. The resistant strain had a higher sex ratio (more females) than the susceptible. McMurtry et al. (1976) found that the sex ratio varied in reciprocal crosses of geographical races of Amblyseius potentillae Garman. Variation in sex ratios of different geographical populations and colonies suggests a genetic component to sex ratio (Hoy, 1982). There have been correlations also between temperature and sex ratio (Dyer and Swift, 1979; Tanigoshi et al., 1975), relative humidity and sex ratio (Dyer and Swift, 1979), starvation and sex ratio (Tanigoshi et al., 1975), and mating duration and sex ratio (Schulten et al., 1978; Elbadry and Elbenhawy, 1968; Amano and Chant, 1978).

There also have been reports of partial reproductive incompatibilities between strains of the same phytoseiid species. Associated with these reproductive incompatibilities were shriveled eggs, low numbers of eggs, low survival of immature stages, and reduced fecundity in surviving F1 individuals (Croft, 1970; Hoy and Knop, 1981; Hoy and Standow, 1982; Hoy and Cave, 1988). Croft (1970) detected reciprocal reproductive incompatibilities (females from both of the two populations being crossed are incompatible with males from the different population) and nonreciprocal reproductive incompatibilities (females from only one of the two populations






11


being crossed are incompatible with males from the other population) in crosses of M. occidentalis from California, Utah, and Washington. When Hoy and Knop (1981) crossed a laboratory selected permethrin resistant strain of M. occidentalis with its original base colony, few eggs were produced and many were shriveled and failed to develop in one cross while the reciprocal cross was compatible. They also found that a partially permethrin resistant strain was nonreciprocally incompatible with its base colony after only one year of laboratory selections. Similar nonreciprocal reproductive incompatibilities were found in crosses with sulfur-resistant M. occidentalis (Hoy and Standow, 1982). In a later study, Hoy and Cave (1988) detected nonreciprocal partial reproductive incompatibilities between five other colonies of M. occidentalis. Other examples of nonreciprocal incompatibilities in phytoseiids were found in Typhlodromus annectens DeLeon (McMurtry and Badii, 1989) and in two populations of Arnblyseius addoensis van der Merwe and Ryke from South Africa (McMurtry, 1980).

The cause of the nonreciprocal reproductive incompatibilities was unknown in these phytoseiids. They were somewhat similar to the nonreciprocal incompatibilities previously described in the mosquito C. pipiens L. (Ghelelovitch, 1952; Laven, 1951), determined to have a cytoplasmic inheritance pattern (Laven, 1959). A cytoplasmic inheritance pattern is suspected when the nuclear genetic makeup of the hybrids is virtually the same, but the main difference is which mother's cytoplasm is present. An intracellular rickettsia-like microorganism was found by Hess and Hoy (1982) in M. occidentalis eggs and ovaries through light and electron microscopy. This observation, along with the nonreciprocal nature of the incompatiblities,






12


led Hoy and Cave (1988) to speculate that a cytoplasmic factor may be responsible for the observed reproductive aberrations seen in M. occidentalis, perhaps due to the presence of Wolbachia.

I decided to investigate Wolbachia in M. occidentalis because of this

predator's importance as a biological control agent, because it has a genetic system that has not yet been studied in relation to Wolbachia-mediated incompatibilities, and because of the potential to use Wolbachia as a drive mechanism in genetic improvement programs. In addition, this mite has been used as a model organism in past experimental ecological simulations, due to its rapid generation time and ease of rearing (Huffaker, 1958).



Research Goals


The first goal was to determine whether Wolbachia was present in M. occidentalis (Chapter 2). The PCR was used to detect this endosymbiont in various laboratory and field populations of M. occidentalis and its prey T. urticae. The amplified 16S rDNA was sequenced and comparisons were made between the Wolbachia sequences found in both predator and prey mites and the Wolbachia sequences from various insects. The final goal of Chapter 2 was to determine whether starvation could eliminate false positive PCR signals in predators fed on Wolbachia-infected prey.

Wolbachia 16S ribosomal DNA sequences from M. occidentalis and T. urticae were highly similar (Chapter 2). PCR primers have recently become available that amplify other Wolbachia genes, such as the ftsZ gene and the






13


surface protein gene. Attempts were made to further characterize Wolbachia in M. occidentalis and T. urticae by using these genes (Chapter 3).

Once Wolbachia were identified, correlations between the presence of Wolbachia and their influence on reproduction in M. occidentalis were investigated (Chapter 4). Genetically similar inbred lines, differing only in the presence or absence of Wolbachia, were crossed and evaluated to determine whether this symbiont is associated with nonreciprocal reproductive incompatibilities in crosses between infected males and heatcured females. The incompatibility phenotype would be a useful model of Wolbachia-induced reproductive alterations in a parahaploid arthropod.

To determine whether Wolbachia could spread through a polymorphic population due to the reproductive advantage afforded to infected females, laboratory populations initiated with 10% infected and 90% uninfected eggs were monitored for 12 generations. The stability of infection was also assessed by analysis of the control populations (Chapter 5).

Chapter 6 provides a general discussion of the results of my research. I will address what I have learned about Wolbachia, some implications of the results, and potential directions of future research.






14


Figure 1-1. An adult female western orchard predatory mite,
Metasejulus occidentalis, is pictured on the right, feeding on an adult twospotted spider mite, Tetranychus urticae.















CHAPTER 2
16S RIBOSOMAL DNA ANALYSIS OF WOLBACHIA FROM TWO
PHYTOSEIIDS (ACARI: PHYTOSEIIDAE) AND THEIR PREY (ACARI: TETRANYCHIDAE)

Introduction


Wolbachia are rickettsia-like microorganisms in the alpha subdivision of the proteobacteria, which are intracellular, maternally inherited, and found in the gonadal tissues of some insects. They were detected originally in the northern house mosquito, Culex pipiens L. (Hertig, 1936; Yen and Barr, 1971); the type species is named Wolbachia pipientis Hertig. Wolbachia has been reported to have negative (Stevens and Wade, 1990; Horjus and Stouthamer, 1995), zero (Moran and Bauman, 1994; Poinsot and Mer ot, 1997), or positive (Wade and Chang, 1995) effects on host fitness, so it remains unresolved whether Wolbachia symbionts are mutualists or parasites.

Wolbachia are associated with unidirectional and bidirectional

intraspecific mating incompatibilities in many insects (Yen and Barr, 1973; O'Neill and Karr, 1990; Breeuwer and Werren, 1990) and thelytoky in some parthenogenetic insects (Stouthamer et al., 1993). Infected females may have a reproductive advantage when other females in the population are not infected. Females with Wolbachia can produce viable progeny when mating with both infected and uninfected males. Uninfected females are partially incompatible with infected males and therefore produce fewer progeny than females infected with the same strain of Wolbachia, which can lead to the


15






16


elimination of uninfected individuals in the population over time. Bidirectional mating incompatibilities caused by Wolbachia infections may play a role in the sympatric speciation of arthropods through reproductive isolation (Laven, 1959).

The polymerase chain reaction (PCR) can be used to detect Wolbachia in insects when specific oligonucleotide sequences (primers) complementary to a portion of Wolbachia 16S ribosomal DNA (rDNA) are used (O'Neill et al., 1992). Visual detection of these amplified fragments can be made after gel electrophoresis and staining with ethidium bromide. The PCR products can be sequenced to confirm the identity and phylogenetic placement of the DNA. Often, 16S ribosomal DNA sequences are used to reconstruct bacterial phylogenies because they are highly conserved in prokaryotes (Woese, 1987). Wolbachia 16S rDNA sequences from various insect orders are available through the GenBank and European Molecular Biology Laboratories (EMBL) databases, including those from the Diptera (O'Neill et al., 1992; Rousset et al., 1992a), Hymenoptera (Breeuwer et al., 1992; Stouthamer et al., 1993), Coleoptera, and Lepidoptera (O'Neill et al., 1992).

The predatory mite Metaseiulus (=Typhlodromus or Galendromus)

occidentalis (Nesbitt) (Acari: Phytoseiidae) is a natural enemy of spider mites, including the two spotted spider mite, Tetranychus urticae Koch. M. occidentalis is used as a biological control agent in a variety of crops in the western United States (Hoyt, 1969; Hoyt and Caltagirone, 1971). Previous studies have been conducted on the cytogenetics of M. occidentalis (NelsonRees et al., 1980), and on rickettsia-like microorganisms (Hess and Hoy, 1982), which were found in eggs and ovaries of M. occidentalis. Furthermore,






17


observations of nonreciprocal partial reproductive incompatibilities between certain populations (Croft, 1970; Hoy and Knop, 1981; Hoy and Standow, 1982; Hoy and Cave, 1988) suggested the possibility of infection by Wolbachia. Previous studies (e. g., Overmeer and van Zon 1976; deBoer 1982) have also demonstrated that cytoplasmic incompatibilities occur in the two spotted spider mite, suggestive of Wolbachia infection.

One difficulty in detecting and subsequently sequencing Wolbachia DNA in M. occidentalis is that their prey could also contain Wolbachia. The pollen-feeding phytoseiid Amblyseius reductus Wainstein is not infected with Wolbachia (unpublished data) and therefore can be used to test whether false positive PCR signals caused by transient gut contents could be eliminated methodologically.

The goals of this study were to 1) conduct a survey by using the PCR to detect the presence of Wolbachia in several predator and prey populations, 2) determine whether the otherwise Wolbachia-free predator A. reductus becomes positive for Wolbachia as determined by the PCR after feeding on prey containing Wolbachia, 3) evaluate starvation as a method for eliminating false positive PCR signals in Wolbachia-free predators fed prey containing Wolbachia, and 4) to use parsimony analysis to compare the 16S rDNA sequences obtained to the Wolbachia sequences from various insects to confirm the identity of the DNA as Wolbachia 16S rDNA.






18


Materials and Methods


Colony Sources and Maintenance

A series of seven laboratory colonies (Table 2-1) of Metaseiulus

occidentalis (COS, Russian Select, Supermite, Hybrid Select, Ave-21, Pullman Blackberry, WA Select) maintained at the University of Florida and reared as previously described (Roush and Hoy, 1981; Hoy et al., 1982) were surveyed for the presence of Wolbachia by the PCR. One M. occidentalis laboratory colony from Oregon and one insectary colony from California were sampled immediately after they were received. Field-collected M. occidentalis from Washington apples and their prey, European red mite, Panonychus ulmi (Koch), were collected and subsequently reared on detached apple leaves in our laboratory for use in the PCR survey. The A. reductus used in the time course study were reared in the laboratory on a diet of cattail, Typha latifolia L. pollen, but will eat the two spotted spider mite, Tetranychus urticae if provided. A colony of two spotted spider mites was raised on pinto bean, Phaseolus vulgaris L., plants in a greenhouse at the University of FloridaGainesville and later used in the PCR survey. T. urticae were also obtained from a laboratory colony in Oregon, a laboratory colony from Ohio, and an insectary in California. A population of T. urticae and of the strawberry spider mite, T. turkestani Ugarov and Nikolski were collected from a field of cotton in California. The T. urticae and T. turkestani obtained from other sources were maintained on detached bean leaves in the laboratory.






19


DNA Extraction

All predators were starved between 4 and 8 h prior to DNA extractions, and mites from the newly acquired predatory mite colonies were tested before feeding on T. urticae from our laboratory. DNA from the Russian Select adult female M. occidentalis and the male T. urticae used for the PCR and subsequent direct sequencing was extracted by a modified version of the technique reported by Edwards and Hoy (1993). Fresh, not frozen, individual and pooled adults (5 mites) were macerated in 50 p. of a 5% Chelex (Bio-Rad, Hercules, CA) solution, heated to 56'C for 30 min (instead of 15 min), then to 95'C (instead of 100'C) for 8 min. The samples were centrifuged briefly and stored at -20' C before the PCR.

Some inconsistencies in results were noticed by using the Chelex

method, so the DNA from the eggs of COS M. occidentalis used for sequencing, as well as the DNA used for all other PCR surveys and experiments, was extracted as follows: DNA from eggs and adults was extracted by macerating

5 adult mites or 60 eggs in 25 p.1 of STE buffer (100 mM NaCl, 10 mM Tris, 1 mM EDTA pH = 8.0) and 1 ml of proteinase K (10 mg/ml) (O'Neill et al., 1992). Samples were macerated with a new glass pestle for each sample in a 1.5-ml Eppendorf tube. Pestles were made by flaming the tip of a pasteur pipette and bending it slightly to form a rounded end. The preparation was heated to 95'C for 8 min, briefly centrifuged, and used immediately for the PCR reactions.






20


Polymerase Chain Reaction Conditions

All reactions were run with the following conditions; 50 mM KCl, 10

mM Tris HCl, 2.5 mM MgCl2, 0.2 iM each primer, 200 gM each dNTP, and 0.8 units of Taq in a total volume of 25 pl. The initial 16S rDNA primers were provided by S. O'Neill (O'Neill et al., 1992), and subsequent primers were synthesized by the University of Florida DNA Synthesis Laboratory. The primers correspond to E. coli positions 76-99 forward (5'TTGTAGCCTGCTATGGTATAACT) and 1012-994 reverse (5'GAATAGGTATGATTTTCATGT), and produce a PCR product of ~ 900 bp. Reactions were cycled 40 times at 94'C for 30 s, 50'C for 30 s, and 72'C for 45 s followed by a 4 min extension period. The amount of template used varied according to species and life stage, but was usually 5 pl. Reagent negative controls were included in the reactions. Positive controls were Drosophila simulans Sturtevant DNA (supplied by R. Giordano, University of Illinois, Urbana) or dilutions of previously amplified DNA from M. occidentalis with Wolbachia-specific primers. The camel's-hair brush used to transfer the mites, the pinto bean leaves and roots, and the debris (exuviae, dead spider mites) in the predator colonies were tested by PCR for contaminating Wolbachia DNA. PCR products were electrophoresed in a 1.5% agarose gel in TBE/EtBr for 90 min at 60 mV, then photographed on a UV transilluminator.



Effects of Feeding Predators With Wolbachia-Positive Prey

A study was done to determine whether the otherwise Wolbachia-free A. reductus would become positive for Wolbachia by the PCR after feeding on T. urticae containing Wolbachia, or whether the positive PCR signal seen from






21


adult female M. occidentalis would disappear when removed from a T. urticae food source. Adult females of both species were fed a diet of T. urticae for at least 5 d and later placed in an arena without prey. The predators were then killed 0, 4, 8, 16, 24, and 48 h later by placing them into a -80'C freezer, where they were stored until their DNA was extracted for PCR analysis. If whole mites were frozen, preliminary tests indicated PCR amplification could be conducted with consistent results. The DNA from 5 mites was combined per replicate, and 5 replicates were done for each time point, with the exception of 3 replicates for A. reductus at 48 h after feeding. The DNA extractions and PCR reactions from 3 of the 5 replicates from all time periods were done on one day, the remaining 2 samples from each time period were analyzed on the following day. Negative controls were water and DNA from A. reductus never fed T. urticae. Drosophila simulans DNA was a positive control.



DNA Purification and Sequencing

The PCR product from one M. occidentalis female (Russian Select strain) starved for 8 h was reamplified and purified with a QIAquick Spin PCR Purification Kit (QIAGEN, Chatsworth, CA) for direct sequencing. Similarly, the PCR product from one male T. urticae was reamplified and purified for subsequent direct sequencing. The PCR product from 60 M. occidentalis eggs (COS strain) was also reamplified and purified. The reamplified egg DNA was purified by extracting the 900-bp band from an agarose gel by using a QlAquick Gel Extraction kit (QIAGEN). The PCR products were sequenced by the ICBR DNA Core Sequencing Facility at the University of Florida with an ABI 373a Automated Sequencer.






22


Phylogenetic Analysis

The 16S rDNA sequences from microorganisms, including Wolbachia, were aligned with the mite sequences by eye by using conserved areas as markers. Parsimony analyses with PHYLIP (Felsenstein, 1993) and MacClade (Madisson and Madisson, 1992) were used to compare our sequences with the other aligned sequences. Bacillus subtilis Cohn was used as an outgroup. Many reported Wolbachia sequences are shorter than those I sequenced; therefore a 625-bp sequence from the 5' end of the 16S rDNA gene (E. coli positions 100-773) was used in the phylogenetic analyses.



Heat Treatment

Temperatures >30'C administered for a few generations have been

reported to eliminate Wolbachia from some insects (Stevens, 1989; Stouthamer et al., 1990a). One colony of M. occidentalis (COS) was reared at 33'C for at least 6 generations to determine whether it is possible to decrease their Wolbachia to undetectable levels.

Results


DNA Extraction

Although DNA preparations with Chelex yielded some positive PCR signals, the STE preparation method (O'Neill et al., 1992) gave more consistent results, especially when the DNA preparation was used immediately after the extraction and was never frozen.






23


Polymerase Chain Reaction Assay

The survey of predator and prey populations indicates the 900-bp

Wolbachia-specific PCR product can be amplified from laboratory colonies of M. occidentalis and T. urticae, but not amplified from the field populations tested (Table 2-1). However, a field population of the other spider mite tested, T. turkestani, which was collected from the same cotton field containing an uninfected population of T. urticae, was positive. The European red mite, prey of the freshly collected field population of M. occidentalis tested, was also negative by the PCR. The laboratory colony of A. reductus remained uninfected during the course of the study. Negative controls, the camel's-hair brush, pinto bean material, and the debris were negative throughout the study. Some nonspecific PCR products were present in some reactions and excluded from analyses.

The PCR was performed on egg preparations of selected M. occidentalis strains to eliminate the possibility of false positive signals caused by adults feeding on positive T. urticae prey. When the adults were positive, the eggs were also positive (Table 2-1) (COS, Russian Select, Pullman Blackberry). Likewise, when the adults were negative, the eggs were negative (Supermite, Griggs Apple). Figure 2-1 (lanes 2--4) shows the PCR results from COS adults and eggs. The presence of Wolbachia from egg preparations suggests that Wolbachia are transovarially transmitted, not just present as gut contaminants from feeding on positive T. urticae. Transovarial transmission of the type B rickettsia-like microorganism in M. occidentalis was predicted previously because of their primary presence in the ovaries of adult females






24


(Hess and Hoy, 1982) and because of the presence of small microorganisms observed in egg squashes of M. occidentalis (Nelson-Rees et al., 1980).



Effects of Feeding Predators Infected Prey

A. reductus adult females fed T. urticae were positive for Wolbachia by the PCR in only one replicate of five when tested immediately after the predators were removed from positive prey. All the remaining samples were negative. Positive and negative controls indicated that the PCR reactions were reliable. In M. occidentalis, positive PCR signals were detected in all five samples tested 0 and 4 h after feeding, in four of the five samples 8, 12, and 24 h after feeding, and in three of the five samples 48 h after feeding. Figure 2-1 (lane 7) shows a positive PCR signal in A. reductus immediately after removal, but a negative reaction in A. reductus starved 4 h (lane 8). The positive signal from M. occidentalis removed from prey for 24 h (lane 3) indicates Wolbachia is likely an intrinsic symbiont of this predator.



Sequence and Phylogenetic Analyses

Sequence information between the two primer sites was obtained for

the eggs of M. occidentalis (COS strain) (849 bp), adult females of M. occidentalis (Russian Select strain) (850 bp), from 1 male T. urticae (840 bp) (GenBank accession numbers U44044, U44045, and U44046, respectively).

The Wolbachia sequences from the mites were similar to each other and to the Wolbachia from insects, but not to Wolbachia persica Suiter and Weiss from the fowl tick Argas persicits (Oken). Sequence similarities were calculated by aligning the sequences and dividing the number of similar






25


bases by the total number of bases. Previous estimates of sequence similarity (Johanowicz and Hoy, 1996) were underestimated due to the inclusion of missing or questionable DNA sequence information. There is 99.98% sequence similarity between the Wolbachia from the COS and Russian Select strains of M. occidentalis, 99.99% similarity between the Wolbachia sequences from the COS strain of M. occidentalis and its prey T. urticae, and 99.98% similarity between the Wolbachia sequences from the Russian Select strain of M. occidentalis and T. urticae. However, because the DNA was sequenced only once, the differences could be due to Taq polymerase errors, since the base differences were in conserved areas of the 16S rRNA gene.

Interestingly, the 16S rDNA from M. occidentalis and T. urticae were not more closely related to each other than they were to the type species Wolbachia pipientis from the northern house mosquito Culex pipiens L. There was 100% similarity between W. pipientis and Wolbachia from the COS strain of M. occidentalis eggs.

The molecular phylogeny (based on 625 bp from the 5' end of the gene) shows that the 3 mite sequences are within the insect Wolbachia clade, and in the same subgroup as the Wolbachia from C. pipiens (Figure 2-2). There were 396 informative characters used to determine the trees. There were 4 most parsimonious trees (treelength, 926; retention index, 0.76; consistency index,

0.73). The phylogenetic tree shown in Figure 2-2 is the consensus tree, constructed by collapsing the unresolved area of the tree into a region of soft polytomies (regions of ambiguous resolution) (Maddison, 1989), which is the subgroup containing the mite sequences. Thus, it is impossible to determine






26


which sequence in this subgroup is ancestral because of insufficient sequence information.



Heat Treatment

I was unable to detect a Wolbachia-specific PCR signal from a heattreated population of the COS strain of M. occidentalis (Figure 2-1, lane 5 ), which is normally positive. DNA extracted at the same time from 60 eggs of a colony (COS) not subjected to the heat treatment was positive (Figure 2-1, lane 4), as expected. These results provide further evidence of an intrinsic infection in M. occidentalis, since the T. urticae fed to these heat-treated mites were positive for Wolbachia.



Discussion


Based on the 16S rDNA analysis, the Wolbachia from M. occidentalis and T. urticae are related closely to Wolbachia from insects and not to Wolbachia persica, a microorganism found in the acarine Argas persicus (Suiter and Weiss, 1961). The primers were designed to specifically amplify W. pipientis, and because the 16S rDNA from W. persica and W. pipientis is so different (Weisburg et al., 1991), it was expected that the mite sequences would be related to Wolbachia from insects. However, it was surprising that, although there has been a long isolation between the Chelicerata (acarines) and the Mandibulata (insects) of ~550 million years (Manton, 1977), the Wolbachia 16S rDNA sequences from the 2 mite species are not more similar to each other than they are to that of the Wolbachia from the more distantly related insect C.






27


pipiens (Figure 2-2). While the Wolbachia from some closely related insect taxa grouped together, it is also the case that distantly related insects may have very similar Wolbachia. This lack of congruence between the evolutionary history of the arthropods and that of the Wolbachia suggests some horizontal transfer of Wolbachia between arthropod species may have occurred (Rousset et al., 1992b; O'Neill et al., 1992) in addition to vertical transmission. However, the mechanisms of such horizontal transfer have not been identified.

Wolbachia can be detected in otherwise Wolbachia-free A. reductus

immediately after feeding on infected prey; therefore studies with predatory arthropods must take into account the infection status of their prey. Starving the mites for at least 4 h appears to eliminate false positive signals caused by transient infection. Based on a model of M. occidentalis feeding on T. urticae (Fransz, 1974), I calculated that 80% of the gut contents are digested within 4 h, which may be enough to bring transient Wolbachia DNA concentrations to undetectable levels. I found that starving the mites too long decreases the amount of Wolbachia detectable by the PCR, which is consistent with past studies in which the density of various symbionts from the citrus mealybug Planococcus citri (Risso) is decreased when they are starved (Iaccarino and Tremblay, 1970). Symbiont number is increased in the Rocky Mountain wood tick, Dermacentor andersoni Stiles, after feeding (Burgdorfer et al., 1973).

Although both predator and prey contain intrinsic Wolbachia, differentiation between the two species' Wolbachia based on 16S rDNA information was not possible. The 16S rDNA region sequenced is useful for some levels of phylogenetics (Weisburg et al., 1989), but it does not allow for robust discrimination within the Wolbachia clade (O'Neill et al., 1992).






28


Analysis of the entire 16S rRNA gene or of other more variable genes may have allowed a better discrimination between Wolbachia from M. occidentalis, T. urticae, and insects. Sequence information from multiple clones of the 16S rDNA PCR products, or from both strands of the PCR product may have increased the accuracy of the estimates of the differences between the Wolbachia from M. occidentalis, T. uticae, and insects. However, a more accurate estimate of these differences is unlikely to change the conclusions of this study, because this region is so conserved (O'Neill et al., 1992), and thus does not allow for fine scale analysis of Wolbachia diversity (Werren, 1997).

Although all laboratory population of M. occidentalis, except one, were positive for Wolbachia by using a PCR assay, the field-collected population was not. It is possible that other field populations of M. occidentalis may be infected, but simply were not sampled. M. occidentalis populations in California almond orchards, pear orchards, and vineyards have been shown to vary in pesticide resistances (Hoy, 1985), and thus may represent partially isolated populations caused by a relatively low rate of dispersal. It also has been demonstrated that some subpopulations of Drosophila simulans are infected, whereas others are not (Hoffmann et al., 1986). High temperatures or naturally occurring antibiotics are possible reasons for these polymorphic populations (Hoffmann et al., 1990).

Although Wolbachia has been confirmed in several populations of M. occidentalis, and different populations of M. occidentalis are known to exhibit partial nonreciprocal mating incompatibilities, there is no direct evidence yet that the incompatibilities actually are caused by the Wolbachia. This information would be particularly interesting because of proposals to use






29


Wolbachia as a drive mechanism to insert a desired trait into a population (Beard et al., 1993). Postmating incompatibilities caused by Wolbachia may aid in releases of genetically improved strains in biological control programs (Caprio and Hoy, 1995), once more is learned about the role, impact, and spread of Wolbachia in arthropods, and especially in M. occidentalis.






30


Table 2-1. Wolbachia populations.


infection status of mite


Species / Strain Source a Positive (+) or
Negative (-)
PCR Results
egg adult

PREDATORS
Amblyseius reductus A -
Metaseiulus occidentalis
COSb A + +
Russian Select' A + +
Supermite A -
Hybrid Select A nt' +
Ave-21 A nt +
Pullman Blackberry A + +
WA- Select A nt +
Oregon Lab B nt +
Visalia C nt +
Griggs Apple D -

PREY
Tetranychus urticae
Florida laboratory A + +
Oregon laboratory B nt +
Ohio laboratory F nt +
Visalia Insectary C nt +
cotton field E nt
Tetranychus turkestani E nt +
Panonychus ulmi D nt
Heat treated M. A -
occidentalis


A= lab colony, Gainesville, FL; B= lab OR; C= insectary, Visalia, CA; D= field, cotton; F= lab colony, Columbus, OH;
b
eggs sequenced
C adult female sequenced d adult male sequenced e nt =not tested


colony, Corvallis, apple; E= field,






31


1 2 3 4 5 6 7 8 9


4-900 bp


Figure 2-1. Bands of the expected size, 900 bp, were amplified using Wolbachia-specific 16S rDNA primers. Lane 1, Molecular weight marker VI (Boehringer Mannheim, Germany); lane 2, M. occidentalis adult females immediately after feeding (frozen before extractions); lane 3, M. occidentalis females starved 24 h; lane 4, M. occidentalis eggs; lane 5, heat-treated M. occidentalis eggs; lane 6, T. urticae eggs; lane 7, A. reductus females fed spider mites tested immediately after feeding; lane 8, A. reductus females fed spider mites and starved for 4 h; lane 9, D. simulans positive control. Other nonspecific PCR products of much lower and higher molecular weights than expected using Wolbaclia-specific 16S primers were present in some samples.








32


N N
N N
N N N
N N
N N
N N
N N


N N
N N
N N
N N
N N
N N
'N


N N
N N
N N
N N
'N
N N
N N
N N N
N N N
N N
N N N
N N
N N
N N


Figure 2-2. Phylogenetic tree of the 16S rDNA 5' region (E. coli positions 100773) from various microorganisms by using parsimony analysis (informative characters, 396; treelength, 926; retention index, 0.76; consistency index, 0.73). The entire Wolbachia clade is drawn with solid lines. Pictured is a consensus tree; the branching pattern within the Wolbaciia subgroup containing the 3 mite species indicates soft polytomies in this region.


Bacillus subtilis Escherichia coli Wolbachia persica


Rickettsia ricketsii Ehrlichia canis Anaplas ma marginale Cowdria ruminatium Muscidifurax uniraptor Drosophila simila ns Rhinocyllus conicus Ephestia cautella AahN albopictuis Metaseiulus occidentalis
Russian Select Culex pipicus

Metaseinlus occidentalis
COS

Tetranychus urticae Trbol ii) m co) nfutsum n Trichogranuna pretiosun -


JU















CHAPTER 3
FURTHER GENETIC CHARACTERIZATION OF WOLBACHIA FROM METASEIULUS OCCIDENTALIS AND TETRANYCHUS URTICAE USING PARTIAL FTSZ GENE SEQUENCES



Introduction


Previous studies indicated Wolbachia endosymbionts are present in

both the predatory mite Metaseiulus (=Galendronus, Typhlodromus) occidentalis (Nesbitt) and its spider mite prey Tetranychus urticae Koch (Johanowicz and Hoy 1996; Chapter 2). A high degree of similarity between the Wolbachia 16S ribosomal DNA sequences from M. occidentalis and T. urticae (Johanowicz and Hoy 1996, Chapter 2) make it difficult to discriminate between the two types of Wolbachia in phylogenetic analyses. Additionally, PCR-based assays of predators using 16S primers are difficult to interpret because DNA extractions of adult predators may contain spider mite Wolbachia DNA as a gut contaminant (Chapter 2).

The Wolbachia ftsZ gene, important in prokaryotic cell division (deBoer et al., 1990), was unexpectedly discovered during screening of a Drosophila melanogaster genomic library (Holden et al., 1993). TheftsZ gene is reported to be more variable than the 16S rRNA gene and therefore may have more power to discriminate between Wolbachia strains (Werren et al., 1995b).

The purpose of this chapter was to amplify part of the ftsZ gene and to sequence it to further characterize the Wolbachia from both predator and prey


33






34


mites. If the sequence information from the ftsZ genes indicates variability exists between the predator and prey mite Wolbachia, PCR primers will be designed that specifically amplify only one of the two different Wolbachia. This would facilitate the PCR-based detection of Wolbachia in individual predators by allowing DNA extractions to occur from a single, unstarved adult predator rather than from a starved adult or groups of eggs.



Methods


Mite Maintenance and Sources

Metaseiulus occidentalis were maintained at the University of Florida and reared as previously described (Roush and Hoy, 1981; Hoy et al., 1982). Tetranychus urticae were raised on pinto bean, Phaseolus vulgaris, plants in a greenhouse at the University of Florida-Gainesville.



ftsZ PCR Primers

Primers were designed which amplify the Wolbachia bacterial septation gene, ftsZ. Preliminary PCR tests using two sets of primers designed by Werren et al. (1995b) did not amplify Wolbachia DNA from either M. occidentalis or T. urticae. Two new primers were designed from conserved regions of the Drosophila melanogaster Wolbachia ftsZ gene obtained from Genbank to amplify 310 bp of the gene from T. urticae. The primers used to amplify WolbachiaftsZ DNA from T. urticae are:forwardftsZ: 5'-AAA CCG TTC GGT TTT GAA GGT GTG CGC CGT AT, and reverse ftsZ: 5'-GCA CTA






35


ATT GCT CTA TCT TCT CCT TCT GCC. The expected size of the PCR product was approximately 310 base pairs (bp).

Two different, new primers were later designed to amplify a portion of theftsZ gene from M. occidentalis. These two new primers were designed from conserved areas outside the region that was amplified and cloned from T. urticae. This was done to reduce the risk of accidentally amplifying contaminating plasmid DNA from the cloned ftsZ gene fragments. The primers for the M. occidentalis experiment were designed to be specific to the B-group of Wolbachia, because 16S rDNA analyses placed the Wolbachia in M. occidentalis and T. urticae in that group (Johanowicz and Hoy, 1996; Chapter 2). Potential primers were designed by aligning WolbachiaftsZ sequences from 16 species obtained from Genbank and choosing 30 bp regions conserved only in the B-group Wolbachia. The best primers from those conserved regions were chosen based on minimizing their potential secondary structure, predicted by using MacDNASIS software (Hitachi Software). Secondary structure can interfere with priming efficiency (Saiki, 1989). The primers used to amplify the Wolbachia from M. occidentalis are:ftsZfl: 5'-TAC TGA CTG TTG GAG TTG TAA CTA AGC CGT, and ftsZrl: 5'-TGC CAG TTG CAA GAA CAG AAA CTC TAA CTC. The expected size of the PCR product was approximately 570 bp. The 570 bp fragment included the complete 310 bp region from T. urticae.



Polymerase Chain Reaction

M. occidentalis DNA was extracted in Chelex from 10 pooled females starved at least 8 hours prior to extraction to avoid amplifying spider mite






36


Wolbachia present as contaminants in the guts of these predators (Johanowicz and Hoy, 1996; Chapter 2). T. urticae DNA was extracted from individual females in Chelex as previously described, and the PCR product from three individuals was later pooled for cloning.

Cycling conditions were as follows: 1 tl template DNA, 50 mM KCl, 10 mM Tris HCl, 1.5 mM MgC2, 0.2 pM each primer (both the forward and reverse primers according to mite species), 200 gM each dNTP, and 0.8 units of Taq polymerase in a total volume of 25 tl. Reactions were cycled 35 times at 940 C for 30 sec, and 72'C for 60 sec. Because the primers were at least 30 bp long, their theoretical Tm was large enough so that a two-step PCR reaction using a 720 annealing and extension temperature was possible.



Cloning and Sequencing

The 310 bp fragment amplified and pooled from T. urticae was cloned (T-A overhang method; Mead et al., 1991) for subsequent sequencing. Four clones were sequenced. Three were identical except for one with 4 base substitutions. These base differences were not present in any other Wolbachia sequences published to date. These base differences produced a restriction enzyme recognition site specific to the enzyme AciI. Restriction digests by this enzyme of the remaining 40 clones did not indicate the site was present in any others, so it was not used in the analysis. The two 30 bp regions corresponding to the priming sites were excluded from analysis. If slight mismatches between the template and primers were initially present, the primers might still work, and the PCR product would reflect the primer






37


sequences rather than the original template sequences. This left 261 bp for subsequent analyses.

The 570 bp fragment amplified from the pooled sample of M. occidentalis was cloned (T-A overhang method; Mead et al., 1991) for subsequent sequencing. Four clones were sequenced. All four were identical except for 1 or 2 non-synonymous base differences in three of the clones, presumably due to Taq polymerase errors. These base differences were not present in any other Wolbachia sequences published to date and appeared in highly conserved areas of the ftsZ gene, so these clones were not used in subsequent analyses. The two 30 bp regions corresponding to the priming sites were excluded from analysis. This left 509 bp for subsequent analyses.



Sequence Analysis

Sequences were aligned with MacDNASIS. The sequence from T. urticae was compared to the sequence from M. occidentalis on the basis of sequence similarity. The 509 bp Wolbachia ftsZ sequence from M. occidentalis was used in subsequent parsimony analysis with an unreleased version of PAUP (with permission from the author; Swofford, 1997). With 26 Wolbachia sequences obtained from Genbank, PAUP's heuristic search algorithm with 100 bootstrap replicates (a resampling technique) was used to find the most parsimonious tree. This search method is appropriate when calculating phylogenies with large data sets (Swofford et al., 1996). A 50% consensus tree was calculated, meaning that the branching patterns which indicate an ancestry supported by at least 50% of the bootstrap replicates are kept as branches in the consensus tree. The unresolved areas, which do not support






38


any ancestral pattern due to insufficient sequence information, are collapsed into unbranched regions called 'soft polytomies' (Maddison, 1989). No appropriately related ftsZ sequences were available (for example, other rickettsia) as an outgroup, which helps the computer program calculate the phylogeny more accurately (Swofford et al., 1996). Therefore, I used a technique called 'midpoint rooting', which is an appropriate solution when no reasonable outgroups exist (Swofford et al., 1996).



Results


The 261 bp region of the ftsZ gene amplified from T. urticae was

identical to the same region of the ftsZ gene amplified and sequenced from M. occidentalis (Figure 3-1).

Parsimony analysis indicated the 509 bp sequence from M. occidentalis grouped within the B-group Wolbachia. The M. occidentalis sequence was near the sequence obtained from the house mosquito Culex pipiens L., as it was when the 16S ribosomal DNA analysis was conducted (Johanowicz and Hoy, 1996; Chapter 2). TheftsZ gene from M. occidentalis was 98.4% similar to the Wolbachia sequence from C. pipiens L., corresponding to 8 bp differences (16S rDNA studies indicated they were 100% similar) and was 99.4% similar to the sequence from the grain moth Ephestia cautella (Walker), corresponding to 3 bp differences (16S rDNA studies indicated a 99% similarity).

The 50% consensus tree shows the ftsZ sequence of Wolbachia from M. occidentalis is located in an unresolved area (Figure 3-1). Out of 509 characters (nucleotide bases), 62 were determined by PAUP to be 'parsimony






39


informative', meaning they provided the appropriate amount of variability to be useful in calculations of the phylogenetic estimates. The other bases were either completely identical in all taxa (447 bases) or displayed too much variation (16 bases) to be useful in the analysis. The tree-length was 129, which is a summation of the least number of base changes needed to explain the variations in DNA sequences. The consistency index was 0.64 and the retention index was 0.89. These indices give the relationship between the number of conceivable and observed base changes in the data set, and the closer the value is to one, the better the tree predicts the most likely evolutionary pattern (Maddison and Maddison, 1992).



Discussion


The 261 bp fragment of the WolbachiaftsZ gene obtained from both the predator and prey mites were identical. This ruled out the possibility of designing species-specific Wolbachia PCR primers for use on unstarved predator adults based on this sequence information.

The 509 bp portion of the WolbachiaftsZ gene used to compare M.

occidentalis with other arthropods did not provide more resolving power than the sequence information from the 16S rRNA gene (Figure 2-2 in Chapter 2). The 509 bp from the predator ftsZ sequence used in this phylogenetic analysis left regions of unresolved ambiguity in the subgroup where the M. occidentalis Wolbachia sequence was positioned, just as in the earlier 16S rDNA phylogeny.






40


Because the sequences from various arthropods within this unresolved area are quite similar, no conclusions can be drawn regarding the possibility of a horizontal transfer of Wolbachia between the predator and prey mites. Sequence information from the eggs of M. occidentalis might have confirmed that the DNA amplified from the starved adults was only from their own Wolbachia. However, upon realizing that the ftsZ region used was so conserved, no further sequencing was conducted. Sequence information from a more variable region of the ftsZ gene, perhaps from part of the noncoding region or a longer stretch of the coding region, may be needed to discriminate between the Wolbachia in M. occidentalis and T. urticae and assess the possibility of horizontal transfer of the symbiont between these ecologically-related species.

Taxonomically-distinct arthropods (Isopoda, Acari, Lepidoptera,

Orthoptera, Coleoptera, and Diptera) host Wolbachia strains with similar ftsZ gene sequences as shown in Figure 3-2. Unless horizontal transfer of Wolbachia has occurred between distinct arthropod species, the Wolbachia from these hosts are probably different strains with more genetic variability than can now be detected. Efforts are under way to sequence other genes in Wolbachia (Werren, 1997). Sequence information from other, more variable genes might more accurately determine the similarity of Wolbachia obtained from various arthropod species and populations.









41


pipiens occidentalis urticae

pipiens occidentalis urtLicae


C. pipiens M. occidentalis T. urticae

C. pipiens M. occidentalis T. urticae

C. pipiens M. occidentalis T. urticae


pipiens occidentalis urti cae

pipiens occidentalis urticae

pipiens occidentalis urticae

pipiens occidentalis urticae

pipiens occidentalis urticae

pipiens occidentalis urticae


C.
M.
T.

C.
M.
T.


453
CGGTTTTGAA CGGTTTTGAA ..........

AGTTGCAAAA AGTTGCAAAA AGTTGCAAAA

TTTAGAATTG TTTAGAATTG TTTAGAATTG

CGATAATGTT CGATAATGTT CGATAATGTT

TGCCAGGACT TGCCAGGACT TGCCAGGACT

GAGATGGGTA GAGATGGGTA GAGATGGGTA


GGTGTGCGAC GGTGTGCGAC ..........

ATACGTAGA T ATATG3TAGA C ATATGTAGAC

CTAACGAGAA CTAACGAGAA CTAACGAGAA

CTACATATTG CTACATATTG CTACATATTG

GATTAATCTT GATTAATCTT GATTAATCTT

AAGCAATGAT AAGCAATGAT AAGCAATGAT


GTATGCGCAT GTATGCGCAT .... GCGCAT

ACACTTATTG ACACTTATTG ACACTTATTG

AACTACATTT AACTACATTT AACTACATTT

GCATAAGAGG GCATAAGAGG GCATAAGAGG

GATTTTGCTG GATTTTGCTG GATTTTGCTG

TGGTACTGGA TGGTACTGGA TGGTACTGGA


TGCAGAGCTT TGCAGAGCTT TGCAGAGCTT

TCATTCCCAA TCATTCCCAA TCATTCCCAA

GCTGACGCAT GCTGACGCAT GCTGACGCAT

AGTAACTGAT AGTAACTGAT AGTAACTGAT

ATATAGAAAC ATATAGAAAC ATATAGAAAC

GAGGCAGAAG GAGGCAGAAG GAGGC .....


GGCAATTAGT GCTGCAGAGG CTGCGATATC TAATCCATTG CTTGACAATG GGCAATTAGT GCTGCAGAGG CTGCGATATC TAATCCATTA CTTGATAATG .......... .......... .......... .......... ..........

TATCAATGAA AGGTGCGCAA GGAATATTGA TTAATATTAC TGGTGGTGGA TATCAATGAA AGGTGCACAA GGAATATTGA TTAATATTAC TGGTGGTGGA
.......... .......... .......... .......... ..........

GATATGACTC TATTTGAAGT TGATTCTGCA GCAAATAGAG TGCGTGAAGA GATATGACTC TATTTGAAGT TGATTCTGCA GC CAATAGAG TGCGTGAAGA .......... .......... .......... .......... ..........

AGTGGATGAA AATGCAAATA TAATATTTGG TGC TACTTTT GATCAGGCGA AGTGGATGAA AATGCAAATA TAATATTTGG TGCCACTTTT GATCAGGCGA


TGGAAGGAA. TGGAGGGAA. ..........
962


Figure 3-1. Sequence alignment of a partial WolbachiaftsZ gene from Culex pipiens (the type species Wolbachia), Metasejulus occidentalis, and Tetranychus urticae. Bold italic print highlights the differences in nucleotide composition.


GGACTTGAAG GGACTTGAAG GGACTTGAAG

TCAAAATTTA TCAAAATTTA TCAAAATTTA

TTCAACTCGC TTCAACTCGC TTCAACTCGC

TTGATGATCA TTGATGATCA TTGATGATCA

AGTAATGAGT AGTAATGAGT AGTAATGAGT

GAGAAGATAG GAGAAGATAG


C.
M.
T.

C.
M.
T.

C.
M.
T.

C.
M.
T.

C.
M.
T.

C.
T.
T.







42


dLul


-111


Nasonia giraulti Hymenoptera Protocalliphora sp. Diptera Aedes albopictus Diptera Armadillium vulgare Isopoda Culex pipiens Diptera Ephestia cautella Lepidoptera Metaseiulus occidentalis Acari Gryllus pennsylvanicus Orthoptera Tribolium confiusum Coleoptera Nasonia vitripennis Hymenoptera Trichogramma cordubensis Hymenoptera Trichogranmma deion Hymenoptera Trichogramma brevicornis Hymenoptera Aramigus tesselatus Isopoda Sitophilus oryzae Coleoptera Encarsiaformosa Hymenoptera Tricopria drosophilae Hymenoptera Drosophila recens Diptera Anastrepha suspensa Diptera Aphytis yananensis Hymenoptera Cossonus sp. Coleoptera Drosophila sechellia Diptera Drosophila simulans Diptera Drosophila orientacea Diptera Muscidifurax uniraptor Hymenoptera Mellitobia sp. Hymenoptera


Figure 3-2. Consensus phylogenetic tree constructed from 509 bp of the WolbachiaftsZ gene. The sequence from M. occidentalis is situated in a region of unresolved ambiguity.


B- group Wolbachia


A- group Wolbachia















CHAPTER 4
EXPERIMENTAL INDUCTION AND TERMINATION OF
NONRECIPROCAL REPRODUCTIVE INCOMPATIBILITIES IN A PARAHAPLOID MITE

Introduction


Reproductive incompatibilities have been detected in various phytoseiid mites, including Metaseiulus (=Typhlodromus, Galendromus) occidentalis (Nesbitt), a biological control agent of the two spotted spider mite, Tetranychus urticae Koch. Associated with these intraspecific reproductive incompatibilities between different populations were shriveled eggs, low numbers of eggs, low survival of immature stages, and reduced fecundity in surviving F1 individuals (Croft, 1970; Hoy and Knop, 1981; Hoy and Standow, 1982; Hoy and Cave, 1988). Croft (1970) detected reciprocal reproductive incompatibilities (females from both of the two populations being crossed are incompatible with males from the different population) and nonreciprocal reproductive incompatibilities (females from only one of the two populations being crossed are incompatible with males from the other population) in crosses of M. occidentalis from California, Utah, and Washington. When Hoy and Knop (1981) crossed a laboratory selected permethrin-resistant strain of M. occidentalis with its original base colony, few eggs were produced and many were shriveled and failed to develop in one cross while the reciprocal cross was compatible. They also found that a partially permethrin-resistant strain was nonreciprocally incompatible with its base colony after only one


43






44


year of selections. Similar nonreciprocal reproductive incompatibilities were found in crosses with sulfur-resistant M. occidentalis (Hoy and Standow, 1982). In a later study, Hoy and Cave (1988) detected nonreciprocal partial reproductive incompatibilities between five colonies of M. occidentalis. Other examples of nonreciprocal incompatibilities in phytoseiids were found in Typhlodromus annectens DeLeon (McMurtry and Badii, 1989) and in two populations of Amblyseius addoensis van der Merwe and Ryke from South Africa (McMurtry, 1980).

Nonreciprocal reproductive incompatibilities are one of the effects

associated with the presence of Wolbachia endosymbionts in a diverse array of Arthropoda, including insects (Mandibulata: Insecta), isopods (Mandibulata: Crustacea) and spider mites (Chelicerata: Arachnida) (reviewed by Werren, 1997). These small, fastidious, rickettsia-like symbionts are located intracellularly in the infected arthropods and are maternally-inherited through the egg cytoplasm. Infected females can successfully reproduce when crossed with infected or non-infected males, but crosses between uninfected females and infected males yield various phenotypes associated with the incompatibility, which varies depending upon the genetic system of the species. The incompatibilities are expressed as reduced numbers of viable progeny (both sexes) in diplo-diploid insects (Laven, 1951; Yen and Barr, 1974; Hoffmann et al., 1986; Hsiao and Hsiao, 1985; Wade and Stevens, 1985; Giordano et al., 1995), reduced numbers of diploid females in haplodiploid insect parasitoids and an increased complement of haploid males (the females become haploid males) (Ryan and Saul, 1968; Breeuwer and Werren, 1990), and reduced numbers of females (with the normal complement of male






45


progeny) in some strains of the haplo-diploid spider mite Tetranychus urticae (Vala and Breeuwer, 1996). The cytogenetic mechanism by which Wolbachia affects embryonic development and sex ratio appears to involve either a loss of the paternally derived chromosomes or aberrations in the paternal pronuclei early in embryonic development (Werren, 1997).

Rickettsia-like microorganisms were detected in the eggs and ovaries of the phytoseiid mite M. occidentalis by transmission electron microscopy (Hess and Hoy, 1982), which led Hoy and Cave (1988) to conclude that some of the incompatibilities seen in previous studies might be microorganism-mediated. Molecular analyses with Wolbachia-specific 16S ribosomal DNA Polymerase Chain Reaction (PCR) primers indicated Wolbachia is present in many, but not all, of the M. occidentalis populations examined (Johanowicz and Hoy, 1996; Chapter 2). Phylogenetic analysis of the 16S ribosomal DNA (Johanowicz and Hoy, 1996; Chapter 2) indicated the Wolbachia in M. occidentalis are genetically similar to the Wolbachia found in the insect Cuiex pipiens L. and in the spider mite Tetranychus urticae. Although Wolbachia have been detected in mites (Johanowicz and Hoy, 1995; 1996; Chapter 2; Breeuwer and Jacobs, 1996; Tsagkarakou et al., 1996), relatively little is known about the biological effects of Wolbachia in parahaploid phytoseiids.

In insects (Arthropoda: Mandibulata: Insecta) and isopods

(Arthropoda: Mandibulata: Crustacea), the effects of Wolbachia have been reversed with antibiotic or heat treatments (Yen and Barr, 1973; Richardson et al., 1987; O'Neill, 1989; Breeuwer and Werren, 1990; Stouthamer et al., 1990b; Louis et al., 1993). Heat-treatment also reduced the presence of Wolbachia to






46


undetectable levels in M. occidentalis (Arthropoda: Chelicerata: Arachnida) (Johanowicz and Hoy, 1996; Chapter 2).

Crosses between infected and uninfected individuals are a standard technique used in studies of Wolbachia in insects (Werren, 1997). Crosses between inbred laboratory populations of M. occidentalis differing in the presence or absence of Wolbachia due to heat-treatment should allow a correlation between the presence of Wolbachia and nonreciprocal incompatibility. Using inbred lines of M. occidentalis reduces the effects of nuclear genetic differences that might cause premating incompatibilities which could confound measures of Wolbachia-mediated cytoplasmic incompatibility.

The objectives of this chapter were: 1) determine whether uninfected M. occidentalis females are incompatible with males containing Wolbachia, 2) determine whether compatibility between the infected males and cured females can be restored if the males are later cured, and 3) correlate any incompatibilities with the presence of Wolbachia.




Methods


Mite Maintenance and Sources

Metaseiulus occidentalis were maintained at the University of Florida

and reared as previously described (Roush and Hoy, 1981; Hoy et al., 1982). A colony of two spotted spider mites was raised on pinto bean, Phaseolus vulgaris L., plants in a greenhouse at the University of Florida-Gainesville. An inbred, isofemale line of M. occidentalis was initiated three months prior to the






47


study by isolating one gravid female, allowing her progeny to sib mate, removing one gravid female, and repeating this procedure for four generations at 24'C. M. occidentalis is tolerant of inbreeding (Hoy, 1977; BruceOliver and Hoy, 1990), and this procedure allowed reduction of differences in the nuclear genome as factors in the subsequent experiments. Two of the resulting gravid generation five (G5) females were used to initiate two new lines; one line (RT) was maintained at normal rearing temperatures (24'C) and the second line was held at 33'C for at least 8 generations (HT). Temperatures >30'C administered for a few generations reduce or eliminate Wolbachia in some insects (Stevens, 1989; Stouthamer et al., 1990a; Girin and Bouletreau, 1995; Louis et al., 1993).

A third colony (R-->H) was later initiated by removing 100 gravid females from the inbred RT line, allowing them to mate inter se while maintaining them at 33'C for at least 10 generations. This line was used to test whether compatibility could be restored between it and the original HT line.



Experiment 1: Tests for Incompatibilities

Crosses were conducted on 4.2 cm' pinto bean leaf discs on water

soaked cotton. The leaf discs were infested with all stages of spider mites as prey. Experiments were performed under constant light at 22-24'C and 4565% RH. M. occidentalis eggs or newly eclosed larvae were isolated on leaf discs with prey, allowed to mature to adults, and sexed. Single pairs of oneto two-day-old adult virgin females and males were introduced on the first of a series of four leaf discs, where they were allowed to mate and deposit their first eggs. The females then were moved to new leaf discs daily for a total of






48


four days. The location of the eggs was marked daily with India ink to make relocating them easier. The number of shriveled eggs, surviving progeny, and developmental stage of the progeny were recorded each day. The progeny sex ratio was determined by recording the sex of adult progeny.

Twelve single pair crosses (female x male) of each of the four crossing types were made: (HT x RT, RT x HT, HT x HT, and RT x RT) (Figure 3-1), for a total of 48 crosses. Females which never became gravid were excluded from analysis. Crosses which did not yield adults were excluded from the sex ratio analysis. Data were analyzed by one-way ANOVA and pairwise comparisons were made with Scheffe's procedure (StatView; Abacus Concepts, 1992) at alpha <0.05.



Experiment 2: Tests for Restored Compatibility

Methods were similar to those of the previous experiment, except

temperatures and relative humidities were between 23'-25'C and 50-70% RH. Because it was difficult to differentiate between shriveled predator eggs and partially-consumed spider mite eggs (Figure 4-2), the number of shriveled M. occidentalis eggs in the experiments may be underestimated.

The subpopulation of RT mites subjected to heat-treatment (R-->H) were crossed with both the HT and RT lines to determine whether incompatibilities between HT females and RT males would disappear when substituting R-->H males, and whether new incompatibilities would appear between R-->H females and males from its (RT) base colony. Twelve single pair crosses of each of the nine crossing types were made (HT x RT, RT x HT, RT x R-->H, R-->H x RT, R-->H x HT, HT x R-->H, HT x HT, RT x RT and R--






49


>H x R-->H) (Figure 4-1) which resulted in a total of 108 single pair crosses. Data were analyzed by one-way ANOVA and pairwise comparisons were made with Scheffe's procedure at alpha <0.05.



Infection Status

The PCR was used before the first experiment to test the infection status of the RT and HT lines with Wolbachia-specific PCR primers which amplify the 16S ribosomal DNA gene. PCR conditions were as previously described (Johanowicz and Hoy, 1996). DNA from five starved females was pooled for each PCR reaction in an effort to increase the amount of Wolbachia DNA and reduce false negatives due to possible low titers of this symbiont in these tiny (0.3 x 0.15 mm) mites. Three PCR reactions each were performed on the RT and HT lines.

Primers which amplify the ftsZ gene of Wolbachia were used to

evaluate the infection status of individual females after the second experiment was completed. Three primers were designed for a hemi-nested amplification to increase sensitivity and to be specific to B-group Wolbachia because 16S rDNA analyses place the Wolbachia in M. occidentalis in that group (Johanowicz and Hoy, 1996; Chapter 2). A-group specificftsZ primers did not amplify DNA in M. occidentalis (unpublished data). New primers were designed by aligning WolbachiaftsZ sequences obtained from Genbank and choosing areas conserved in B-group Wolbachia. The primers used were ftsZfl: 5'-TAC TGA CTG TTG GAG TTG TAA CTA AGC CGT, ftsZf2: 5'GGA GAA GAT AGG GCA ATT AGT GCT GCA GA, and ftsZrl: 5'-TGC CAG TTG CAA GAA CAG AAA CTC TAA CTC.






50


DNA was extracted from the eggs of single, isolated females by

allowing adult females to lay eggs for 3 days; the resultant 5-7 eggs were collected, pooled, and extracted in 25 tl Chelex (Johanowicz and Hoy, 1996). This procedure allowed estimates of the proportions of infected females without the risk of amplifying contaminating spider mite Wolbachia DNA from the digestive tract of the predators (Johanowicz and Hoy, 1996; Chapter 2). Eggs from 20 RT, 10 HT, and 10 R-->H females were tested.

Cycling conditions for the first round of amplification were as follows: 1 [l template DNA, 50 mM KCl, 10 mM Tris HCl, 1.5 mM MgCl2, 0.2 pM each primer (ftsZfl and ftsZrl), 200 gM each dNTP, and 0.8 units of Taq polymerase in a total volume of 25 jil. Reactions were cycled 35 times at 94'C for 30 sec, and 72'C for 60 sec. Cycling conditions for the second round of amplification were the same as above, except 1 gl of the previously amplified DNA was used as the template, and primers ftsZf2 and ftsZrl were used, producing a PCR product of approximately 250 bp. Reagent-negative controls were included in the reactions.




Results

Induction of Incompatibility

Nonreciprocal reproductive incompatibility was induced in crosses between the HT (cured) females and RT (infected) males. This cross resulted in reduced numbers of eggs/female/day (mean t s.d. = 0.2 0.2) compared to the reciprocal cross (2.0 0.8), and the maternal (2.0 0.4) and paternal control (1.7 0.8) crosses. Higher percentages of shriveled eggs (62.5% 51.7)






51


were produced compared to the reciprocal (1.4% 4.2), maternal (0%), and paternal control crosses (2.2% 7.0) (Table 4-1). Figure 4-2 illustrates the appearance of shriveled eggs. Only male progeny were produced in the incompatible crosses between HT females and RT males. Both males and females were produced in the reciprocal (RT x HT) and control crosses (Table 4-1).

The sex ratio in the RT x RT (infected) control crosses was more malebiased (62% males, Table 4-1) than expected (33% males) (Lee and Davis, 1968; Nagelkerke and Sabelis, 1991). Though there is a difference in sex ratio, there was not a statistically-significant difference in the number of eggs/ female/ day between the infected control crosses (1.7 0.8) and the uninfected control crosses (2.0 0.4).



Restoration of Compatibility

Incompatibilities similar to those observed in the first experiment (skewed sex ratio, shriveled eggs, reduced numbers of progeny) were detected in the crosses of HT females x RT males (Table 4-2). New incompatibilities were induced in the R-->H female x RT male crosses, as expected, with females producing reduced numbers of eggs/female/day (0.8

0.4), increased proportions of shriveled eggs/female/day (72.9% 32. 8), and no female progeny. The reciprocal crosses (RT female x R-->H male) produced a mean of 1.8 0.5 eggs/female/day, only 4.7% 6.1 of those eggs shriveled, and 52% of the adult progeny were females.

R-->H (cured) females crossed with HT (cured) males and the

reciprocal cross (HT female x R-->H male) were compatible, as expected






52


(Table 4-2). The mean number of eggs/female/day in the crosses was 2.8 0.2 and 2.6 0.4, respectively, and the mean percentage of shriveled eggs was

2.8% 6.6 and 1.7% 3.7, respectively. The compatibility of HT females with RT males was therefore restored in experiment two when the males were subsequently heat-treated (R->H) (Table 4-2). These results indicate the incompatibilities are due to a heat-sensitive cytoplasmic factor, and are not due to nuclear genetic differences.

As in experiment 1, the sex ratio in the RT x RT crosses was more malebiased (59% males) than expected (Table 4-2), so two crosses determined to be incompatible based on a compatibility index were excluded in an additional analysis. The compatibility index was calculated as: (the number of viable eggs + number of daughters - number of shriveled eggs) 10. Crosses were scored as compatible if the Compatibility Index was greater than 0.35 and incompatible (uninfected) when less than 0.35. The threshold value of 0.35 clearly separated the two types. The appearance of an unexpected incompatible cross could be due to imperfect maternal transmission of the Wolbachia to a daughter, which is known to happen in insects (Turelli et al., 1992). The percentage of males initially calculated as 59.4 22.3 changed to 50.4 10.9. This male-biased sex ratio is still higher than expected, but not significantly higher than the cured control crosses. However, as in the previous experiment (after eliminating the two unexpected "incompatible" crosses), the mean number of eggs/ female/ day in the infected (RT x RT) control crosses (2.06 0.4) was not significantly different than in the HT x HT (2.36 0.45) and R->H (2.35 0.68) uninfected control crosses at alpha < 0.05.






53


Infection Status

The initial PCR tests were in agreement with past studies (Johanowicz and Hoy, 1996; Chapter 2). All three pooled samples from mites held at 24'C

(RT) were positive for Wolbachia by the PCR, and the line reared at 33'C (HT) had undetectable amounts of Wolbachia in all three of the samples tested. The PCR assay withftsZ primers at the end of the second experiment indicated none of 10 HIT females were positive for Wolbachia as expected, none of 10 R-->H females were positive as expected, and 12 of 20 RT females were positive. Possible reasons why 8 of the 20 RT females were not positive include loss of the symbiont in some individuals over time due to laboratory rearing stresses (crowding and/or nutritional stresses affect Wolbachia density in Drosophila simulans (Sinkins et al., 1995a)), or low symbiont titers in the minute eggs of the individuals and subsequent failure of the PCR.



Discussion


These experiments demonstrate that the temperature at which M. occidentalis is reared can be used to induce or eliminate nonreciprocal reproductive incompatibility associated with the presence or absence of Wolbachia in M. occidentalis. Incompatibility was induced between HT (cured) females and RT (infected) males of an inbred line. Compatibility between the two lines was subsequently restored when the males from the roomtemperature line were heat treated (R-->H) and crossed with the HT females. The nonreciprocal nature of the incompatibilities and the ability to restore






54


compatibility indicates a heat-sensitive cytoplasmic agent is responsible for the observed results. One cytoplasmic difference associated with the incompatibility is the presence or absence of Wolbachia endosymbionts as assayed by the PCR. The PCR results indicate Wolbachia is present in the RT line and eliminated in the HT mites. Although there could be some other unknown cytoplasmic factor responsible for the observed results, the data are consistent with what is currently known about the effects of Wolbachia on reproductive incompatibilities in insects.

Wolbachia-mediated incompatibilities in arthropods have various

effects on progeny number and sex ratio based on the genetic system and the taxonomic group. M. occidentalis (Arachnida: Acari: Gamasida: Phytoseiidae) has a genetic system called parahaploidy (Hoy, 1979), which is sometimes termed pseudoarrhenotoky (Schulten, 1985). In parahaploidy, the embryos destined to become males are derived from fertilized eggs, but at the onset of the reductional division 24-48 hours after egg deposition, one set of chromosomes (most likely the paternal set) becomes heterochromatinized and excluded from the nucleus, producing a haploid male (Nelson-Rees et al., 1980). Female embryos remain diploid. The incompatibility phenotype resulted in reduced progeny production, as in diplo-diploid insects (e. g. Insecta: Diptera, Coleoptera), and skewed, highly male-biased sex ratios, as in haplo-diploid insects (e. g. Insecta: Hymenoptera) and the mite T. urticae (Arachnida: Acari: Actinedida: Tetranychidae).

Because Wolbachia-mediated incompatibilities cause the destruction of the paternal set of chromosomes in insects (Werren, 1997), and because adult males rather than females were produced in some of the crosses, these crosses






55


may provide further evidence that the paternal set of chromosomes is the set which is eliminated during the embryonic development of these parahaploid mites (Hoy, 1985). The reduced numbers of male progeny produced may be due to the effects of Wolbachia on the paternal set of chromosomes very early in development. Hoy (1979) found both the maternal and paternal sets are initially necessary for normal development in M. occidentalis males. The fertility of the few surviving male progeny is unknown.

The presence of incompatibilities, like those due to Wolbachia infection, have potentially interesting consequences for biological control programs. Some of the results are similar to those seen in previous hybridization studies where two phytoseiid populations were crossed to determine their species status (Croft, 1970; McMurtry et al., 1976; McMurtry, 1980; McMurtry and Badii, 1989). It may be important to consider whether Wolbachia-mediated or heat-induced incompatibilities occur when crossing mites from different origins or environmental conditions. Variations in presence, absence, or density of this symbiont have been detected in field populations of insects, perhaps due to naturally-occurring antibiotics (Hoffmann et al., 1990), high temperatures, or diapause (Perrot-Minnot et al., 1996). Wolbachia density may affect expression of incompatibility in some insects (Breeuwer and Werren, 1993, Sinkins et al., 1995a). Two PCR surveys for Wolbachia in phytoseiids found both infected and uninfected populations in the field and in the laboratory, (Breeuwer and Jacobs, 1996; Johanowicz and Hoy, 1996; Chapter 2), which could account for some of the previous reports of nonreciprocal incompatibilities in crosses between phytoseiid populations.






56


Despite extensive inbreeding for these experiments, the reproductive parameters (egg production, immature mortality) measured in the parental crosses appear normal. Previous studies by Hoy (1977) also found that this species is tolerant of inbreeding.

There was, however, a slight male-bias in the sex ratio of the RT parental control crosses (Tables 4-1 and 4-2). This could be due to the inclusion of a few unexpected incompatible control crosses in the analysis. Imperfect maternal transmission of the symbiont to the females used in the incompatible crosses may be responsible for the unexpected incompatibilities, as has been demonstrated in Drosophila simulans Sturtevant (Turelli et al., 1992). After removing those RT control crosses determined to be incompatible, the bias did not decline in the first experiment (both nearly 62% males), but it did decline in the second experiment, from approximately 60% males to slightly more than 50% males, which is still higher than expected. Following theoretical predictions by Hamilton (1967) and Nunney (1985) based on inbreeding potential and local mate competition, sex ratios should be female-biased as an adaptive response to low foundress density in a subdivided population structure. A subdivided population structure is common in phytoseiids which specialize in patchily distributed spider mites (Sabelis and Nagelkerke, 1993). Therefore, a female biased sex ratio is expected to occur in M. occidentalis. The sex ratio of M. occidentalis can be as high as 50% male in the laboratory (Lee and Davis, 1968), but is usually female-biased, with approximately 33% males (Bruce-Oliver and Hoy, 1990; Tanigoshi et al., 1975). Nagelkerke and Sabelis (1991) found similar female-






57


biased sex ratios of M. occidentalis when the mothers were isolated on their own leaf arenas.

The male-bias declined (60% -> 35%) after the RT line was subjected to heat (R-->H). This indicated a nuclear genetic component was not responsible for the bias. In addition, the bias was not due to the mothers having "precise control" of their progeny sex ratio as a response to prey and conspecific density, as observed by Nagelkerke and Sabelis (1991), because all of these crosses had similar prey density and other environmental conditions. Rather, a heat-sensitive cytoplasmic factor, most likely Wolbachia, is responsible for the reduced production of daughters in the infected mites. Fecundity losses associated with Wolbacila infection have been detected in insects (Hoffmann and Turelli, 1988), and these results suggest that in addition to the induction of nonreciprocal reproductive incompatibility, there also may be negative fitness costs due to Wolbachia infection in M. occidentalis.







58


Table 4-1. Experimental induction and termination of Wolbachia-mediated incompatibility in an inbred line of M. occidentalis by heat-treatment. One sub-population was reared normally at 25'C (RT) and one was reared at 33'C (HT). Same letters in a column following means are not significantly different at alpha <0.05 using Scheffe's procedure.


Cross No. crosses Mean Mean % Mean % No. crosses Mean no. Mean no. Mean
Type producing no. eggs eggs immature producing female male %
eggs/ total /day shriveled deaths adults progeny progeny males
Female no. crosses (s.d.) (s.d.) (s.d.) /cross /cross
x Male (s.d.) (s.d.)

Experimental Crosses
HTxRT* 8/11 0.2a 62.5a Oa 3 Oa 1.0a 100.Oa
(0.2) (51.7) - - -

RTxHT 9/10 2.Ob 1.4b 5.9ab 9 4.1b 3.7b 47.8bc
(0.8) (4.2) (9.6) (1.4) (1.4) (13.4)

Control Crosses
HTxHT 12/12 2.Ob Ob 5.2ab 12 4.6b 2.7ab 35.4b
(0.4) - (11.3) (1.7) (1.6) (20.6)

RTxRT 10/12 1.7b 2.2b 16.9b 10 2.6ab 3.8b 61.6c
(0.8) (7.03) (14.11) (1.5) (0.8) (17.1)

F-value 22.2** 14.5** 4.2 9.1** 4.9** 12.7**
expect incompatibilities
** one-way analysis of variance significantly different p<0.01







59


Table 4-2. Compatibility can be restored and new incompatibility can be induced by heat-treatment of M. occidentalis.

Cross No. crosses Mean Mean % Mean % No. crosses Mean no. Mean no. Mean Type producing no. eggs immature producing female male %
eggs/ total eggs/ shriveled deaths adults progeny progeny males
Female no. crosses day (s.d.) (s.d.) /cross /cross
x Male (s.d.) (s.d.) (s.d.)

Experimental Crosses
HTxRTa 10/11 0.9* 91.7* 0 2 0* 1.5 100.0*
(0.4) (18.0) - - (0.7)

RTxHT 12/12 2.0* 15.9* 17.2 12 3.3* 2.1 40.0*
(0.6) (26.8) (20.4) (2.0) (1.6) (30.9)

RTxR-H 10/10 1.8* 4.7* 7.0 10 3.4* 2.9 48.2*
(0.5) (6.1) (13.4) (1.6) (0.9) (11.5)

R-HxRTa 12/12 0.8* 72.9* 2.1 6 0* 1.3 100.0*
(0.4) (32.8) (7.2) 0 (0.5)

R-HxHT 10/10 2.8 2.8 13.2 10 5.4 4.0 44.4
(0.2) (6.6) (12.0) (2.3) (1.5) (19.2)

HTxR-Hb 11/11 2.6 1.7 7.7 11 5.5 4.0 42.0
(0.4) (3.7) (8.5) (1.5) (1.5) (11.5)


Control Crosses
HTxHT 12/12 2.4 0.8 10.6 12 4.5 3.8 45.4
(0.5) (7.9) (15.7) (1.5) (1.4) (9.8)

RTxRT 11/11 1.9 7.7 12.0 11 2.7 3.2 59.4
(0.6) (11.5) (13.0) (1.7) (0.9) (22.3)

R-HxR-H 12/12 2.4 0.00 20.5 11 5.5 2.9 37.6
(0.7) - (30.1) (2.2) (1.0) (22.3)

F-value 23.8** 47.9** 1.9 9.2** 4.7** 8.7**

* following mean indicates significant differences between reciprocal
crosses using Scheffe's procedure at alpha <0.05.
a/ expect incompatibilities
./ expect restoration of compatibility






60


E RT HT
female ..- female
RT HT
male male







.female male

RT HT




m~Ie f: malemmaee












Figure 4-1. Pattern of compatibility between populations: *-- - -, indicate crosses expected to be incompatible, *M indicate crosses expected to regain compatibility, and -. indicate compatible crosses. RT= mites
reared at room temperature (infected), HT= cured mites, R-->H = cured mites.






61


partially-consumed


0.1 mm


Figure 4-2. Normal and shriveled eggs of M. occidentalis. Normal T. urticae eggs and shriveled eggs after being partially consumed by M. occidentalis.


normal


Metaseiulus occidentalis
shriveled










Tetranychus urticae


normal
















CHAPTER 5
WOLBACHIA INFECTION DYNAMICS IN EXPERIMENTAL
LABORATORY POPULATIONS OF METASEIULUS OCCIDENTALIS Introduction


Wolbachia symbionts are responsible for numerous reproductive alterations in arthropods, including nonreciprocal reproductive incompatibilities between uninfected females and infected males (reviewed by Werren, 1997). When both infected and uninfected individuals are present in a population, these nonreciprocal incompatibilities translate into a selective advantage to infected females (Caspari and Watson, 1959; Turelli and Hoffmann, 1991). This is because infected females can reproduce normally with any male they encounter, while uninfected females mated with infected males produce few or no progeny.

Since Wolbachia is transovarially transmitted, the reproductive advantage of infected females theoretically acts to rapidly increase the prevalence of Wolbachia infected hosts in a population (Caspari and Watson, 1959; Fine, 1978; Hurst, 1991; Stevens and Wade, 1990; Hoffmann et al., 1990; Turelli and Hoffmann, 1991). Caspari and Watson (1959) developed a set of theoretical, analytical models describing the dynamics and equilibria of the "incompatibility factor", now known to be Wolbachia. They assumed total incompatibility between the proportion of males infected (designated by the letter "a") and the proportion of uninfected females ("b"), panmixis, a 1:1 sex


62






63


ratio, complete maternal transfer, and a fecundity benefit (S) was associated with the uninfected type (that is, a fecundity cost to those infected). Their equation to predict the prevalence of b (uninfected) females in the following generation b' is written as

. Sb2
b =
Sb2 + ab + a

which can be rewritten using the more common terms to describe the HardyWeinberg law (Roughgarden, 1979). Here, p,= proportion of infected individuals at time t, q, = 1 - p, = proportion of uninfected individuals at time t, and w is the fitness cost associated with infection (zv, < 1), and is written as

S w'p 2+wp,q, and p+q=1 (1)
wip,~2 + wip,q, + q,2

Note the lack of a "2pq" term in the denominator to describe the

frequency of the "hybrids" in a population, as is the case in Hardy-Weinberg equilibria when both hybrids are the same. In the case of Wolbachia-induced incompatiblities, one of the hybrids is inviable, and the other hybrid carries the Wolbachia.

Caspari and Watson's model predicts that if there is a fitness cost to infection then, using the form in equation (1), there are three equilibrium points (p*) for p, the frequency of Wolbachia infection. These are p*= (0, 1-v, 1). Zero and one are stable, attracting points, with the unstable threshold point, 1v, in between. If we start with p below 1-wv, then the system is attracted to zero frequency of Wolbachia infection; if we start with p above 1-v, the system is attracted to fixation of Wolbachia at frequency one.

Models by Fine (1979) and Hoffmann et al. (1990) expand on Caspari

and Watson's initial work with algebraically similar models, but include three






64


important parameters which affect the stable and unstable equilibria. One parameter is the proportional failure of a mother to transmit Wolbachia to her offspring (imperfect maternal transmission; p). The second is the proportion of progeny produced by the incompatible crosses relative to the compatible crosses, called "hatchability" (H). The third is the relative fitness of infected matings relative to uninfected matings (F), usually measured in terms of productivity (Hoffmann et al., 1990; Turelli and Hoffmann, 1995). In these models, one stable point is zero, and the other moves away from fixation, so both infected and uninfected individuals can coexist in a population if there is imperfect maternal transmission. The models by Fine (1979) and Hoffmann et al. (1990) also predict unstable frequencies, which would prevent Wolbachia from spreading through a population if it is sufficiently rare. The more elaborate model by Hoffmann et al. (1990), which takes into account a modified dynamical behavior due to inclusion of the additional parameters, predicts that

P,( -p)( - s) (2)
1 - sfp, - SIX pG - A, )- pshA (--s

where

sf= 1 - F; s,, = 1 - H; and p, = proportion of infected individuals. The equations describing the stable (p,) and unstable equilibria (p) are therefore

sf + sh+ (sf+ sh) -4(s + IF)s,(l -JF)
2s,,(I -pF)

and

s+ +s - ( s1 + s, ) -4(s1 + pF)sh(1 -uF) (4).
2s,(I - uF)






65


Again, the unstable frequencies are sensitive to the fitness costs of infection (Turelli and Hoffmann, 1995).

Laboratory studies have documented the "spread" of Wolbachia in

population cage studies (Hoffmann et al., 1990; Sinkins et al., 1995b). When an intermediate proportion of infected and uninfected D. simulans were placed in population cages, the proportion of Wolbachia-infected individuals increased rapidly within 5-10 generations to approximately 80-95% (Hoffmann et al., 1990). The spread of Wolbachia was also "accidentally" discovered in a study by Sinkins et al. (1995b). After microinjecting Wolbachiainfected D. simulans with a new strain of Wolbachia, they found that only 10% of the individuals in a population harbored the double infection. They subsequently monitored the fate of this double infection, and found it increased from an initial prevalence of 10% to over 90% in only 12 generations (Sinkins et al., 1995b).

Field studies have documented the increases of individuals infected with Wolbachia in natural D. simulans populations in California (Turelli and Hoffmann, 1991; 1995). These authors found that the proportion of infected individuals, first discovered in Southern California, has increased within various local populations to a stable frequency of approximately 0.94, and the proportion appears to be increasing to that level in other local populations. This stable equilibrium of 0.94 is similar to the frequency predicted by the theoretical models using the appropriate parameter values. In addition to the spread of infections within local populations, the infection is also spreading northward at approximately 100 km per year (Turelli and Hoffmann, 1991;






66


Turelli et al., 1992). Field studies indicated that one particular mitochondrial variant is spreading along with the Wolbachia by "hitchhiking" with the infected cytotype (Turelli et al., 1992).

Several studies are in progress to genetically engineer and improve arthropods, for example, to be refractory to disease agents such as malaria parasites (Beard et al., 1993). However, the success of any genetic control strategy that uses transgenes will depend on a mechanism which will favor the spread of the introduced genes through natural populations (Evans, 1993). The ability of Wolbachia and its associated cytoplasmic elements, like mitochondria or other symbionts, to spread through a population might be harnessed as a mechanism to "drive" desired traits through wild-type, natural populations. This could happen if the transgene "hitchhikes" with the infected cytoplasm (Curtis, 1992; Beard et al., 1993). However, the dynamics of Wolbachia are complex (Turelli, 1994, Prout, 1994), so data on the ability of Wolbachia to spread through populations are necessary to evaluate the feasibility of this mechanism in various arthropods.

Previous studies (Chapter 4) indicate Wolbachia in the predatory mite Metaseiulus occidentalis is associated with strong nonreciprocal reproductive incompatiblities between infected males and uninfected females. M. occidentalis has traditionally been used in ecological studies because of its rapid generation time and ease of rearing (e. g., Huffaker, 1958), and it is a subject of genetic improvement programs (Hoy, 1985; 1994). For these reasons, I chose to conduct an experiment to evaluate the potential of Wolbachia to spread through experimental laboratory populations of M. occidentalis.






67


This chapter reports the dynamics of Wolbachia infection in

polymorphic laboratory populations of M. occidentalis over 12 generations with a low initial infection frequency of 0.1. This low initial infection frequency was chosen because it is likely to provide an appropriate test of the theory under realistic situations. Because of difficulties in estimating absolute population densities (Proverbs, 1974; Caprio et al., 1991), and in mass rearing high quality arthropods inexpensively (Bush, 1979; Marroquin, 1985; Mueller-Beilschmidt and Hoy, 1987; Hoy et al., 1991; Hoy, 1994), the number of Wolbachia-infected arthropods released as part of any arthropod management project may not be more than 10% of the wild-type population in a given area.



Methods


Mite Maintenance and Sources

Metaseilis occidentalis were maintained at the University of Florida and reared as previously described (Roush and Hoy, 1981; Hoy et al., 1982). The two-spotted spider mites, Tetranychus urticae Koch, were raised on pinto bean, Phaseolus vulgaris L., plants in a greenhouse at the University of FloridaGainesville. Genetically similar infected and heat-cured M. occidentalis were used for the experiments. They were initiated one year prior to this experiment, initially for the experiments in Chapter 4, by isolating one gravid female, allowing her progeny to sib mate, removing one gravid female, and repeating this procedure for four generations at 24'C. Two of the resulting gravid generation five (G5) females were used to initiate two new lines; one line (RT) was maintained at normal rearing temperatures (24'C), and the






68


second line was held at 330C (HT). The presence of Wolbachia in at least 80% of the individuals from the RT line, and its absence in the HT line, was confirmed by PCR of theftsZ gene (Chapter 4) two months prior to this study.

Three replicate populations of the RT and HT lines were initiated at the start of this study by moving 100 eggs to new population cages. These populations were designated as RT- and HT- 1, 2, and 3. A third line was also initiated in triplicate for this study to assess the stability of heat-curing when the heat-treated mites are kept at normal rearing temperatures (H->R). In addition to these three control conditions, the "mixed" (polymorphic) experimental populations were initiated in triplicate with ten eggs from the infected RT population and 90 eggs from the HT (cured) populations.

The RT, H->R, and mixed populations remained at normal rearing temperatures for the duration of this experiment. Each population was subcultured every 3 weeks (to reduce crowding and fungal contamination) by moving 125 randomly-selected gravid females (of approximately 400) to a new population arena. The food sources of the predators were monitored to avoid contamination of the populations. In addition, the population arenas were housed separately in polypropylene boxes, lined on the inside with a thick, 4 cm-wide band of petroleum jelly to discourage movement in and out of the boxes.



Progeny Testing for Compatibility

An assay method called "progeny testing" has been used to estimate the proportions of infected individuals in a population (Hoffmann et al., 1990). These assays are conducted by introducing infected males to females of






69


unknown Wolbachia status, and the number of compatible test crosses is used to estimate the proportion of females infected with Wolbachia.

Alternatively, a Polymerase Chain Reaction (PCR) assay for Wolbachia infection can be used (O'Neill et al., 1992; Werren et al., 1995; Turelli and Hoffmann, 1995). A PCR-based assay has been demonstrated to be simpler and equally effective in predicting infection status in D. simulans (Turelli and Hoffmann, 1995). In M. occidentalis, a PCR-based assay can be problematic because of their small size and the possibility of false-positive signals from their diet of Wolbachia-infected spider mites (Johanowicz and Hoy, 1996; Chapter 2). A PCR- based assay for Wolbachia necessitates starving the mites before DNA extraction or collecting and combining eggs from individual females for subsequent DNA extractions and hemi-nested PCR reactions (Chapter 3). Previous studies also have indicated that the reliability of the PCR assay on these eggs may be questionable (Chapter 4), and that storage of DNA extractions reduced the sensitivity of the PCR (Chapter 2). I have therefore chosen to use a progeny testing bioassay, rather than a PCR assay, to determine the infection status of individual M. occidentalis.

To obtain the virgin individuals for the test crosses, eggs or newly

eclosed larvae from each of the colonies were isolated on leaf discs with prey, allowed to mature to adults, and sexed. To obtain adequate numbers of females for the test crosses, 50 eggs or larvae were isolated from each of the populations, with the exception of the RT populations. To obtain adequate numbers of young, virgin, infected males for the test crosses, 100 individuals were isolated from each of the three RT populations, and approximately 500






70


more were isolated from the RT base colonies. The RT base colonies were maintained under the same conditions as the other replicate populations.

Crosses were conducted on detached pinto bean leaves on water soaked cotton. The leaves were infested with all stages of spider mites as prey. Experiments were performed under constant light at 24-27'C and 4570% RH. Twenty, single-pair test crosses were initiated for each replicate (three replicates) of the four different populations (RT, HT, H->R, and mix), for a total of 240 crosses. Each test cross consisted of one randomly chosen RT (infected) male introduced to a randomly chosen female isolated from the various populations. They were allowed to mate, and the females were allowed to deposit eggs for a total of four days after they were determined to be gravid (signaling they have mated). The location of the newly-deposited eggs was marked daily with India ink to make relocating them easier. The number of shriveled and normal eggs, surviving progeny, and the progeny sex ratio was recorded daily. The experiment was repeated four times, at weeks 3, 6, 9, and 12, for a total of 960 test crosses. One week corresponds to one generation in M. occidentalis. Females which never became gravid, died, or disappeared were excluded from analysis.



Compatibility Index

Crosses were scored for the number of viable eggs, number of shriveled eggs, and sex ratio of resulting progeny. Incompatibility is associated with low numbers of viable eggs, a high degree of egg shriveling, and a strongly male-biased sex ratio (Chapter 4). A Compatibility Index was designed to include all three aspects of incompatibility when determining






71


infection status: (the number of viable eggs + number of daughters - number of shriveled eggs) + 10. Crosses were scored as compatible if the Compatibility Index was greater than 0.35, and incompatible when less than

0.35. The threshold value of 0.35 clearly separated the two types based on the results of the control crosses, and corresponded to one-fourth of the mean Compatibility Index value of the infected control crosses. The proportions of compatible crosses for each treatment type (RT, H->R, HT, mix) were evaluated by using a simple regression analysis to check for significant deviations of the slope from zero (StatView; Abacus Concepts, 1992). An increase in compatibility over 12 generations (spread of Wolbachia) would be accompanied by an increase in slope.



Parameter Estimates

Unexpected incompatibility between an "infected" female and an

"infected" male could mean that the Wolbachia was not efficiently transmitted to that female used in the cross. Likewise, unexpected compatibility between a "cured" female and "infected" male could mean that the Wolbachia was not efficiently transmitted to that male. To estimate the inefficiency of maternal transfer of Wolbachia (y) (proportional failure of transmission), I summed the number of "unexpected" compatible or incompatible control test crosses and divided by the total number of control test crosses.

To estimate of the hatchability "H" of the incompatible crosses relative to the compatible crosses, I divided the mean number of viable eggs produced by the incompatible (HT x RT and H->R x RT) crosses (H,) by the






72


mean number of viable eggs produced by the compatible (RT x RT) crosses

(H), so that H = H/He.



Results


Progeny Testing: Control and Experimental Populations

The proportion of compatible test crosses did not increase over time in the mixed populations, indicating Wolbachia infection did not increase in these populations (Table 5-1). Regression analysis of the proportion of compatible test crosses from the three replicates (mixed 1, 2, and 3) over 12 generations did not indicate a slope significantly different from zero (Figure 5-1). Although the pooled data indicate no increase in compatibility, the compatibility of the mixed-1 population did increase to 24% at week 12. However, an analysis of this population alone also did not yield a slope significantly different from zero. Additionally, an increase to 24% from an initial infection frequency of 10% would not be considered the "rapid" increase in Wolbachia infection that has been observed in other studies.

The proportion of compatible test crosses in the RT (infected) control populations (Table 5-1) did not decrease over time, as expected. A small proportion of the test crosses were unexpectedly incompatible (1 - proportion of compatible crosses; Table 5-1), perhaps indicating Wolbachia was not perfectly transmitted to the females used in those test crosses. A similar phenomenon was noted in Chapter 4. Compatibility did not significantly increase in the crosses between the heat-treated populations returned to normal rearing conditions (H->R), indicating curing by heat-treatment is stable under these






73


conditions. Regression analysis of the HT (cured) populations indicated the slope (0.001) was significantly different from zero, although the significance of this small increase in the proportion of compatible test crosses probably does not mean that Wolbachia was appearing in this heat-treated line, since it was kept at 33'C throughout the study.



Parameter Estimates

Table 5-1 reports the mean number of viable eggs per female per 4 days, mean number of shriveled eggs, and mean number of daughters produced for each replicate of each treatment throughout the study, as well as the proportion of the test crosses defined as compatible.

The occurrence of unexpected compatibility (e. g. HT x RT rep. 3, week 12) or incompatibility (e. g. RT x RT rep. 3, week 12) in the control crosses can be most easily explained by imperfect maternal transmission of Wolbachia (p > 0). There were 31 control crosses with "unexpected" compatibilities or incompatibilities out of 599 total control crosses (p = 0.05). This estimate of Wolbachia transmission inefficiency is within the range reported for insects (p = 0 - 0.1) (Werren, 1997).

The second parameter estimated in this experiment was hatchability

(H). Using the relative numbers of viable eggs as the measure, I estimated the hatchability (H/H) ratio of incompatible to crosses compatible crosses as 0.11. When substituting the relative number of viable daughters produced instead of viable eggs, this hatchability estimate decreases to 0.04. This dramatic decrease in daughter production in the incompatible cross was detected in previous studies (Chapter 4; Hoy and Knop, 1981; Hoy and Standow, 1982;






74


Hoy and Cave, 1988), and may reflect the effects of Wolbachia on the genetic system of M. occidentalis (parahaploidy). In parahaploidy, both male and female embryos are diploid, but the sons lose the paternal chromosomes during embryonic development (Hoy, 1979; Nelson-Rees et al., 1980). Since Wolbachia-induced incompatibilities modify the paternal set of chromosomes (Werren, 1997), the M. occidentalis sons may be less affected by this incompatibility mechanism relative to daughters, because their paternal set of chromosomes will be eliminated eventually anyway. Regardless of which estimate is considered, both indicate a strong incompatibility relative to other Wolbachia-host associations (Clancey and Hoffmann, 1997).



Discussion


The bioassays conducted to estimate changes in Wolbachia-infection frequency over twelve generations of M. occidentalis did not indicate a rapid increase when the initial infection frequency was 0.10. The following nonmutually exclusive reasons may explain why the Wolbachia infection failed to spread rapidly in these M. occidentalis populations.

Remating may be important in maintaining uninfected progeny and reducing the spread of Wolbachia in a population (Hoffmann et al., 1990). M. occidentalis females can mate multiple times (Hoy and Smilanick, 1979), which increases the chance that uninfected females will mate successfully with uninfected males within their reproductive life span.

Two assumptions inherent in the models describing the prevalence of Wolbachia in polymorphic populations are even (1:1) sex ratio and panmixis.






75


The "normal" sex ratio of M. occidentalis violates the assumption of a 1:1 sex ratio (Lee and Davis, 1968; Nagelkerke and Sabelis, 1991). The assumption of panmixis may also be violated, which could influence the spread of the symbiont (Hoffmann and Turelli 1988). M. occidentalis populations are not necessarily panmictic (Hoy, 1982). Non-random mating due to behavioral mating biases also has been documented in the laboratory (Hoy and Cave, 1988).

Previous studies conducted during genetic control programs of other arthropods determined that the assumptions of panmixis are often violated, and may interfere with implementation of the programs. Smith (1973) found that wild-type screwworm (Cochliomyia homnivorax Coquerel) females could discriminate between wild-type and sterile males. Additionally, Dieleman and Overmeer (1972) discovered that when incompatible male spider mites (T. urticae) were released into glasshouses in a program analogous to the sterile insect release method (SIRM), female spider mites preferred mating with compatible males rather than the incompatible males.

Perhaps the most important reason why Wolbachia did not increase in relative frequency in these experimental populations was that the initial infection frequency of 10% may be below an unstable equilibria frequency (='threshold frequency"). If an infection frequency is initiated below this unstable frequency, Wolbachia may be prevented from spreading, and may actually decline to zero (Turelli and Hoffmann, 1991).

When this study was first designed, the choice of an initial infection

frequency of 0.10 was influenced by a number of factors. For one, the results of Sinkins et al. (1995b) indicated that rapid "spread" can occur with an initial






76


frequency of just 10%. Secondly, the feasibility of releasing more than 10% of the absolute population density in an arthropod management program is questionable. Lastly, the fitness costs due to infection were initially interpreted in terms of "progeny production", as has been done for the other studies using diplo-diploid insects (Stevens and Wade, 1990; Hoffmann et al., 1990). The assumption was made that there were no relative fitness costs due to infection because the numbers of eggs produced in the infected vs. the uninfected control crosses conducted in Chapter 4 were not significantly different. With this in mind, Caspari and Watson (1959) predict that without fitness costs due to Wolbachia infection, Wolbachia will readily spread through a population, even at low initial frequencies.

In retrospect, the number of daughters produced, rather than total

progeny production, might be a more relevant measure of fecundity deficits. Studies in Chapter 4 indicate that there are significant differences in the number of daughters produced in the infected control crosses relative to the uninfected control crosses. Pooling the sex ratio data from control crosses in the two experiments in Chapter 4 allows an estimate of the relative fecundity (fitness) between infected (RT x RT) and uninfected (HT x HT, R->H x R->H) crosses. The mean number of daughters/female in the infected control crosses was 2.94 1.39 (after eliminating two incompatible crosses; see Chapter 4). The mean number of daughters/female in the uninfected control crosses was 4.86 1.79. Dividing the mean daughter production of the infected control crosses by the mean daughter production of the uninfected control crosses yields a relative fitness ("F") of 0.60 for infected crosses relative to uninfected crosses.






77


The unstable equilibrium is very sensitive to changes in fitness costs (Hoffmann et al., 1990). Under the simplest model of Caspari and Watson (1959), which assumes no progeny production by incompatible crosses and perfect maternal transmission rates, the "threshold frequency" equals the fecundity cost to infected females (Werren, 1997). If we assume there are no fitness costs due to Wolbachia infection in M. occidentalis based on viable egg production alone, Wolbachia could spread no matter how rare it is. If the fitness costs instead are measured in terms of relative daughter production (0.6), the "threshold frequency" would be 0.40 (1 - relative fitness "F") in order for the infection to spread. This may explain why Wolbachia did not spread in the polymorphic populations of M. occidentalis in which the initial frequency of infected mites was only 0.10.

Using the parameter estimates of u = 0.05, H = 0.11, and F =0.6 for M. occidentalis under laboratory conditions, the model of Hoffmann et al. (1990), predict an unstable equilibrium frequency of 0.50, meaning that at least 50% of the individuals needed to be infected in order for the infection to spread. Assuming no fitness costs to infection, the unstable equilibrium frequency is predicted to be 0.06, meaning that at least 6% of the individuals needed to be infected in order for the infection to spread. While the accuracy of this estimate is questionable due to violation of some assumptions, these theoretical models do provide us with hypotheses by which future experiments can be designed. Furthermore, they indicate that sex ratio may be important in determining fitness costs of Wolbachia infection in M. occidentalis, and perhaps in other parahaploid species.






78


The unstable equilibrium frequency of 0.50 for M. occidentalis is higher than the one calculated by Turelli and Hoffmann (1995) for D. simulans, which ranged between 0.08 (with no fitness costs) and 0.19 (if relative fitness was reduced to 0.95). However, other arthropod-Wolbachia associations may also require high initial infection threshold frequencies in order for the infection to rapidly spread through a population. Stevens and Wade (1990) report that, due to fitness costs associated with the symbiont, the initial infection frequency necessary to ensure the eventual spread of their Wolbachia strain through laboratory populations of Triboliurn confusum Duv. was 0.37. Clancey and Hoffmann (1997) report that, even with strong levels of incompatibility, Drosophila serrata transfected with a new strain of Wolbachia suffered enough fitness costs and had a low enough transmission efficiency that the threshold frequency would have to be approximately 0.44.

Because the required threshold frequencies can be quite high, it is proposed that stochastic events must occur in subpopulations (or "metapopulations") in order to allow the infection to exceed this unstable equilibrium frequency on a 'local' scale (Clancey and Hoffmann, 1997). These stochastic events could include drift, or founder effects (Rousset and Raymond, 1991); neighboring populations could also send out infected migrants above the threshold frequency (Turelli and Hoffmann, 1991). Phytoseiid mites like M. occidentalis are predators of patchily-distributed spider mite prey (Sabelis and Nagelkerke, 1993), and have a subdivided metapopulation structure in which founder effects are important (Caprio and Hoy, 1994). This might allow rare infections to increase to the threshold






79


frequency and eventually spread through larger populations of M. occidentalis.

Because evolution in arthropod host-Wolbachia associations is a

dynamic process, each association should be studied individually to assess the potential for Wolbachia to spread through specific populations. This is especially important if a genetic control program depends on the increase of Wolbachia-infected individuals relative to uninfected individuals as a gene spreading mechanism. Selection is expected to occur on both hosts (Turelli, 1994) and Wolbachia strains (Turelli, 1994; Prout, 1994). Selection on Wolbachia strains would tend to favor those with the highest transmission rates and lower fecundity costs (Turelli, 1994; Prout, 1994). Such strains could, as a correlated response, then evolve to cause lower levels of incompatibilities. Strains with these attributes have been detected in D. melanogaster (Hoffmann et al., 1994; Solignac et al., 1994), and even non-sterilizing strains have been found in D. mauritiana Tsacas and David (Giordano et al., 1995). The results of selection on hosts is more difficult to predict, but would tend to favor increased compatibility between infected males and uninfected females (Turelli, 1994).

Further investigation into the dynamics of Wolbachia infection in M.

occidentalis populations would help answer some of these questions raised in this study. The biology of M. occidentalis violates the assumptions of equal sex ratio and panmixis. Refinement of the relevant theoretical models to make them more appropriate for the biology of M. occidentalis might add more sophistication to the assessment of Wolbachia infection dynamics in this system. However, when sex ratio was used as the measure of relative fitness,






80


the models appeared to support the empirical evidence obtained. That the models did substantially predict the eventual outcome of this experiment supports the hypothesis that sex ratio is an appropriate measure of relative fitness in this study. Studies focusing on mating biases, remating potential, and metapopulation structure in laboratory colonies, and experiments conducted with higher initial infection frequencies, may provide more insight into the dynamics of Wolbachia infection in laboratory populations of M. occidentalis, as well as the importance of sex ratio in this arthropod hostsymbiont association.






81


Table 5-1. Rate of Wolbachia spread in laboratory populations of M. occidentalis over 12 generations evaluated by test crosses conducted at weeks 3, 6, 9, and 12. Males from infected populations were crossed with 20 test females from each of the control and experimental populations. The controls included three replicates each of infected (RT) females, heat-treated (HT) (uninfected) females, and heat-treated females subsequently reared at room temperature (H->R). Three replicate Mixed experimental populations were initiated with 10% infected eggs and 90% uninfected eggs.


No. gravid
females
/ no. Mean no./ female/ 4 d.
producing Proportion
Week adult Viable Shriveled Daughters compatible
Rep. no. daughters eggs (s.d.) eggs (s.d.) (s.d.) test crosses

Control crosses- RTfemale x RT male: Stability of infection "
1 3 18/14 8.0 (4.5) 0.7 (1.6) 4.7 (2.9) 0.77
6 12/12 9.5 (2.1) 0.1 (0.3) 5.8 (1.4) 0.92
9 12/12 8.7 (1.8) 0.2 (0.4) 5.6 (1.5) 1.00
12 18/18 10.8 (1.9) 0.1 (0.2) 7.0 (1.7) 1.00
.. ................ .. ................. . . .8 . . . . . 8 . . .. . . . . . . . . . . . . . . . .. . . . . . . . .. . .. . . . .. .. . . .. . . . .. . . ... . . . . . . . . . . . . . . ... . . . . . . . . . . . . . . .
2 3 18/17 8.9 (3.2) 0.7 (1.1) 5.1 (2.3) 0.88
6 13/13 9.1 (2.4) 0.8 (2.4) 5.1 (2.2) 1.00
9 12/12 9.6 (1.8) 0 (0) 5.4 (1.4) 1.00
12 14/10 8.2 (4.9) 0.5 (0.9) 5.1 (3.5) 0.63
3 3 19/18 8.0 (3.1) 0.3 (0.1) 4.9 (2.3) 0.89
6 17/17 10.2 (2.0) 0 (0) 6.4 (1.9) 1.00
9 14/12 8.3 (2.9) 0.3 (0.6) 4.5 (1.9) 0.86
12 13/11 11.8 (4.2) 0.1 (0.3) 7.7 (3.1) 0.85

Control crosses- H->R female x RT male: Stability of curing b
1 3 13/2 1.2 (1.7) 3.5 (1.8) 0.3 (0.9) 0.08
6 20/0 0.3 (0.7) 3.6 (1.9) 0 (0) 0
9 18/0 0.2 (0.4) 2.1 (2.2) 0 (0) 0
12 20/4 1.6 (1.4) 3.1 (1.7) 0.2 (0.4) 0
2 3 17/4 2.7 (2.6) 4.1 (2.6) 0.6 (1.7) 0.11
6 20/2 1.7 (2.2) 3.0 (2.2) 0.2 (0.5) 0
9 18/2 0.8 (1.2) 1.6 (1.5) 0.2 (0.7) 0.06
12 16/3 1.5 (1.6) 3.1 (2.5) 0.4 (1.0) 0.06
3 3 16/2 1.0 (1.3) 2.7 (1.9) 0.1 (0.3) 0
6 17/2 0.3 (0.8) 1.2 (2.3) 0.1 (0.3) 0
9 17/1 0.6 (0.8) 1.2 (1.8) 0.1 (0.2) 0
12 17/1 1.6 (2.4) 2.5 (2.7) 0.4 (1.8) 0.06






82


Table 5-1--continued

No. gravid
females
/ no. Mean no.! female/ 4 d.
producing Proportion
Week adult Viable Shriveled Daughters compatible
Rep. no. daughters eggs (s.d.) eggs (s.d.) (s.d.) test crosses

Control crosses- HTfemale x RT male: Stability of curing b
1 3 20/4 1.1 (1.3) 4.2 (2.3) 0.3 (0.7) 0
6 20/0 0.3 (0.7) 2.9 (1.8) 0 (0) 0
9 18/2 1.2 (2.4) 1.6 (1.9) 0.4 (1.4) 0.06
12 17/2 0.9 (1.4) 1.4 (1.2) 0.2 (0.5) 0.06
3 15/1 0.9 (1.4) 4.2 (2.5) 0.1 (0.3) 0
6 17/1 0.9 (2.0) 1.9 (2.1) 0.3 (1.3) 0.06
9 17/2 0.6 (0.9) 2.6 (1.9) 0.1 (0.3) 0
12 15/3 1.7 (2.5) 2.3 (2.2) 0.7 (1.6) 0.13

6 18/1 1.1 (1.3) 2.5 (2.1) 0.1 (0.5) 0
9 17/4 1.0 (1.2) 1.5 (1.5) 0.2 (0.4) 0
12 11/3 1.9 (2.7) 1.7 (1.8) 0.8 (2.1) 0.09

Experimental crosses- Mixed female x RT male: Changes in infection frequency c
1 3 16/3 1.6 (2.6) 2.8 (1.8) 0.7 (1.9) 0.06
6 18/0 0.1 (0.3) 3.3 (2.6) 0 (0) 0
9 18/4 1.6 (2.3) 2.8 (2.6) 0.7 (1.5) 0.17
12 17/5 2.7 (3.6) 2.5 (2.1) 1.5 (2.8) 0.24
2 3 15/6 3.6 (4.5) 1.9 (2.7) 1.9 (3.0) 0.33
6 16/0 0.1 (0.3) 2.7 (2.4) 0 (0) 0
9 16/1 0.9 (2.2) 0.9 (1.1) 0.4 (1.5) 0.06
12 19/2 1.4 (2.9) 1.4 (1.5) 0.7 (2.2) 0.11
3 3 16/4 2.9 (3.7) 2.8 (2.5) 0.8 (1.6) 0.25
6 17/4 2.1 (3.8) 1.3 (1.7) 1.4 (2.7) 0.24
9 17/4 1.9 (2.9) 1.2 (1.9) 0.8 (1.9) 0.18
12 16/2 1.0 (1.9) 2.1 (2.0) 0.3 (1.0) 0.06

A/ expect high proportions of compatible test crosses if infection is
stable
b/ expect low proportions of compatible test crosses if curing is stable c/ expect proportion of compatible test crosses to increase from week 3 to 12 if Wolbachia infection is spreading through the populations








83



1.0 1.0
0.8 Mixed 0.8

0.6 Y=0.232-.001X ; R2=0.101 0.6

0.4 0.4
0.2 4 0.2

0.0 0.0




1.0 1.0

0.8 .
(n 0.8
2 0.6 0.6
RT control (infected)
0.4 0.4

0.2 Y=0.982-0.001X; R2-0.07 0.2

0.0 0.0
CL E 0 C) 0
= 1.0 1.0
0 a
o 0.8 0.8
0.6 H ->R control (cured) 0.6
ca
a)
E 0.4 Y-0.025+0.000021X; R2-0.000015 0.4
0.2 0.2

0.0 0.0





1.0 1.0
0.8 0.8
0.6 HT control (cured) 0.6

0.4 Y=-0.04+.001X; R2=0.501 0.4

0.2 0.2

0.0 4 0.0


3 6 Week 9 12


Figure 5-1. Compatibility did not increase over time in the mixed populations initiated with 10% infected and 90% uninfected individuals over 12 generations. Circles indicate means of 3 replicate populations; bars indicate standard deviation.















CHAPTER 6
CONCLUSIONS

The study of Wolbachia symbiosis in M. occidentalis has been rewarding and interesting, even considering the inherent challenges of investigating an intracellular symbiont in a tiny predatory mite. The results of my research have advanced the basic understanding of this symbiosis. However, considerable work remains before the symbiosis is well understood, with numerous interesting questions remaining to be addressed.

When this research began, Wolbachia was suspected to be responsible for nonreciprocal reproductive incompatibilities between populations of M. occidentalis. This symbiont was previously described from insects, but not from mites. The use of molecular tools, including the PCR and DNA sequencing, allowed me to identify and characterize this symbiont of M. occidentalis in a way which was not possible before they were available.

While using these molecular tools to study the Wolbachia of M.

occidentalis, I discovered that the prey of this obligate predator, the twospotted spider mite T. urticae, was also infected. I then learned that research can be full of unexpected hurdles; for example, that Wolbachia DNA from the consumed spider mites could sometimes be detected by the PCR in uninfected predatory mites. This finding turned an already challenging molecular study into an even greater challenge. I needed to find a way to methodologically eliminate the amplification of spider mite DNA when


84






85


studying the predator's Wolbachia. This meant potentially risking the ability to reliably amplify the predator's intrinsic Wolbach ia, because starvation can reduce symbiont levels, and amplification from the minute eggs can be problematic. Besides the implications for my own research, the erroneous amplification of contaminating DNA from gut contents should be a consideration for anyone who studies Wolbachia in predatory arthropods.

It became apparent that the PCR did not always amplify the template

DNA present in a sample, even though "theoretically" it could amplify even a single molecule. Hemi-nested PCR and/or pooling of DNA samples was often necessary to get a PCR signal, and still these techniques occasionally failed. This difficulty of detecting minute amounts of Wolbachia in single tiny predators was another obstacle that needed to be addressed throughout this study.

In retrospect, more techniques should have been attempted to improve the sensitivity of the PCR. Lack of experience led me to assume that PCR amplification was straightforward for other research groups studying Wolbachia, and that the techniques used in my own lab to study mite DNA were adequate for symbiont DNA from the mites. I have realized this was not the case. When problems arose, these assumptions led me to question my technical abilities, rather than the techniques themselves. If I had accepted earlier that the study of Wolbachia in mites was inherently difficult, I might have attempted more techniques. For example, I might have tried different extraction techniques such as a CTAB protocol, or concentrated more efforts on improving the STE procedure (O'Neill et al., 1992, Chapter 2), which initially appeared to work more reliably than the Chelex method (Chapter 2).






86


Increasing the number of PCR cycles also might have been helpful, as has been recently recommended for reactions with low template concentrations (Rameckers et al., 1997). This experience taught me that when techniques do not work well, even "established" ones, alternative approaches should be explored.

In spite of these problems, interesting data resulted from this research. For one, the DNA sequences I examined from the 16S ribosomal RNA and ftsZ genes from the predator and prey were nearly identical to each other. Unexpectedly, the sequences from the mite Wolbachia were nearly identical to the Wolbachia from insects, including the type species Wolbachia pipientis from the mosquito Culex pipiens. Whether the Wolbachia from the mites are truly this similar to each other and to the symbionts from insects remains to be answered. The genes I used were too conserved to resolve this question.

Information on sequence variation would have been very useful in designing species-specific primers, so I could more easily eliminate false positives from the predator's gut contents. The possibility that this maternally-transmitted symbiont has been transferred horizontally between the two mite species also remains unanswered because of the lack of sequence variation. Perhaps a more variable portion of the ftsZ gene should have been studied, like the non-coding region, or even an entirely different gene. Information was available on the non-coding region of the ftsZ gene from an A-group Wolbachia from Drosophila melanogaster (Holden et al., 1993). Designing primers for that region which would be Wolbachia-specific and would work on the B-group Wolbachia from M. occidentalis and T. urticae would have been time consuming, but might have yielded useful information






87


on the genetic variation between Wolbachia sequences. Genetic information on this microorganism has been scarce, but continual advances are expected due to the exponential growth of Wolbachia research around the world and a new in vitro culturing system in a mosquito cell line (Werren, 1997).

In order to study the biological effects of Wolbachia infection, it is crucial to obtain a population without the symbionts with which infected individuals can be crossed or compared. In other studies, the insects cooperate by consuming antibiotic-laced artificial diet, honey, or water. In view of the difficulty in feeding antibiotics to these obligate predators, the ability to "cure" these mites by rearing them at high temperatures was an exciting option. This allowed me to determine the phenotype of Wolbachiainduced reproductive incompatibilities between infected males and uninfected females. Interestingly, the phenotype was a unique combination of reduced progeny production (as in diplo-diploids) and a skewed sex ratio (as in haplo-diploids) of the few, resulting progeny. However, one nagging question remains. Are correlations between the presence of Wolbachia and nonreciprocal incompatibilities just that? Is another, heat-sensitive cytoplasmic element the real cause of the incompatibilities? The evidence from this study, and studies with so many other arthropods, strongly suggests it is the Wolbachia. However, until a pure sample of Wolbachia can be successfully injected into uninfected mites, this possibility cannot be excluded. According to Koch's postulates, reinfection of the suspected microorganism is a necessary step in the assignment of cause and effect.

The crossing studies yielded another interesting and unexpected result. The infected control crosses tended to have a male-biased sex ratio, and the






88


uninfected crosses had a female-biased sex ratio. If this is a general phenomenon and not just a sampling error, it could have interesting and important implications for the population dynamics of this agriculturallyimportant mite by altering its intrinsic rate of increase.

The "infected" control crosses occasionally produced some

unexpected incompatible crosses. The efficiency of symbiont transmission from mother to progeny appears to be imperfect, due to unknown factors which could include crowding and nutritional stresses. Imperfect transmission or other reductions of symbiont titer might contribute to unexpected within-population incompatibilities if some females do not have enough Wolbachia to be compatible with an infected male. This underscores the importance of reducing colony crowding and other stresses when rearing large numbers of infected M. occidentalis or other natural enemies in biological control programs. Because Wolbachia or other symbioses have the potential to affect entomological projects in positive and negative ways, I believe that they should be an important consideration when addressing the biology of any arthropod. Symbioses transform an individual into a community, complete with a fascinating complexity of interactions we are only beginning to understand.

The results of the Wolbachia infection dynamics studies were some of the most surprising and important findings. In contrast to published theoretical predictions and empirical evidence that Wolbachia will spread rapidly through polymorphic populations, this did not occur in populations of M. occidentalis. There may be several, non-mutually exclusive reasons why this symbiont, which should have spread, did not. Perhaps it was because the






89


initial infection frequency of 10% was below a threshold which would allow the frequency to increase to a stable level. It would have been interesting to create some populations with a higher initial infection frequency than 10% and compare the outcomes. Another possible reason why Wolbachia did not rapidly spread through the populations could have been due to fitness costs associated with infection, like reduced female sex ratio compared to cured mites. Perhaps the females will mate multiple times if they detect they are producing shriveled eggs. This would increase the chances of uninfected females producing viable, uninfected offspring. This could then reduce the "spread" of infected individuals by maintaining the presence of more uninfected individuals in the population. Addressing these questions would not only contribute to our basic knowledge of M. occidentalis biology, but might have implications for those hoping to use Wolbachia as a "drive mechanism".

There are still many mysteries concerning the symbiotic relationship between Wolbachia and arthropod hosts. For example, recent investigations indicate Wolbachia infection is responsible for protecting a weevil from a parasitoid (Hsiao, 1996). This phenomenon could have widespread implications for the way scientists match pest biotypes with natural enemy biotypes in biological control programs. Ecological implications of this symbiosis are important in another biological control setting. There are plans to infect parasitoid wasps with Wolbachia so that they only produce daughters, since the ovipositing females are the "effective" natural enemies. While the relative number of ovipositing females could be increased this way,






90


there could be serious fitness effects due to infection, or detrimental consequences from the loss of genetic recombination (Crow, 1988).

I enjoyed answering some of the questions regarding Wolbachia

symbiosis in M. occidentalis, even considering the challenges inherent in this project. There are many interesting questions which remain. The following are three which would be most interesting to answer. First, it would be interesting to use a more variable Wolbachia gene to determine the differences between the symbionts from the predator and prey, and between mites and insects. Second, a detailed life table analysis would be important to more accurately determine any fitness costs of Wolbachia infection. Finally, investigating the females' responses to laying shriveled eggs after mating with incompatible, infected males would be important in understanding the dynamics of Wolbachia infection in polymorphic populations. The answers to these questions, in addition to those already answered in this research, will provide a better understanding of Wolbachia symbiosis in the agriculturallyimportant predatory mite Metaseiulus occidentalis and possibly other Wolbachia symbioses as well. The inevitable cascade of questions, answers, and more questions is one of the most important lessons learned during this project. It is one of the most frustrating, and well as one of the most exciting aspects of science.













APPENDIX A





SEQUENCE ALIGNMENT: WOLBACHIA 16S rDNA FROM C. PIPIENS,
M. OCCIDENTALIS (COS EGG AND ADULT RUSSIAN SELECT), AND ADULT T. URTICAE




E. coli 100


C. pipiens M. occidentalis M. occidentalis T. urticae


pipiens occidentalis occidentalis urticae



pipiens occidentalis occidentalis urticae



pipiens occidentalis occidentalis urticae


C. pipiens M. occidentalis M. occidentalis T. urticae



C. pipiens M. occidentalis M. occidentalis T. urticae


pipiens occidentalis occidentalis urticae


TAGTGGCAGA egg TAGTGGCAGA RS TAGTGGAAGA
TAGTGGCAGA


CGGGTGAGTA CGGGTGAGTA CGGGTGAGTA CGGGTGAGTA


ATGTATAGGA ATGTATAGGA ATGT??AGGA ATGTATAGGA


60 70 80
TAATTGTTGG AAACGACAAC TAATACCGTA egg TAATTGTTGG AAACGACAAC TAATACCGTA RS TAATTGTTGG AAACGACAAC TAATACCGTA
TAATTGTTGG AAACGACAAC TAATACCG?A


ATCTACCTAG ATCTACCTAG ATCTACCTAG ATCTACCTAG


90
TACGCCCTAC TACGCCCTAC TACGCCCTAC
TACGCCCTAC


TAGTACGGAA TAGTACGGAA TAGTACGGAA TAGTACGGAA

100
GGGGGAAAAA GGGGGAAAAA GGGGGAAAAA GGGGGAAAAA


110 120 130 140 150
TTTATTGCTA TTAGATGAGC CTATATTAGA TTAGCTAGTT GGTGGGGTAA egg TTTATTGCTA TTAGATGAGC CTATATTAGA TTAGCTAGTT GGTGGGGTAA
RS TTTATTGCTA TTAGATGAGC CTATATTAGA TTAGCTAGTT GGTGGGGTAA
TTTATTGCTA TTAGATGAGC CTATATTAGA TTAGCTAGTT GGTGGGGTAA

160 170 180 190 200
TAGCCTACCA AGGTAATGAT CTATAGCTGA TCTGAGAGGA TGATCAGCCA egg TAGCCTACCA AGGTAATGAT CTATAGCTGA TCTGAGAGGA TGATCAGCCA RS TAGCCTACCA AGGTAATGAT CTATAGCTGA TCTGAGAGGA TGATCAGCCA
TAGCCTACCA AGGTAATGAT CTATAGCTGA TCTGAGAGGA TGATCAGCCA

210 220 230 240 250
CACTGGAACT GAGATACGGT CCAGACTCCT ACGGGAGGCA GCAGTGGGGA egg CACTGGAACT GAGATACGGT CCAGACTCCT ACGGGAGGCA GCAGTGGGGA RS CACTGGAACT GAGATACGGT CCAGACTCCT ACGGGAGGCA GCAGTGGGGA
CACTGGAACT GAGATACGGT CCAGACTCCT ACGGGAGGCA GCAGTGGGGA


260 270 280
ATATTGGACA ATGGGCGAAA GCCTGATCCA egg ATATTGGACA ATGGGCGAAA GCCTGATCCA
RS ATATTGGACA ATGGGCGAAA GCCTGATCCA
ATATTGGACA ATGGGCGAAA GCCTGATCCA


310 320 33C
AAGGCCTTTG GGTTGTAAAG CTCTTTTAGT egg AAGGCCTTTG GGTTGTAAAG CTCTTTTAGT RS AAGGCCTTTG GGTTGTAAAG CTCTTTTAGT
AAGGCCTTTG GGTTGTAAAG CTCTTTTAGT


290
GCCATGCCGC GCCATGCCGC GCCATGCCGC GCCATGCCGC


340
GAGGAAGATA GAGGAAGATA GAGGAAGATA GAGGAAGATA


300
ATGAGTGAAG ATGAGTGAAG ATGAGTGAAG ATGAGTGAAG

350
ATGACGGTAC ATGACGGTAC ATGACGGTAC ATGACGGCAC


C. pipiens M. occidentalis M. occidentalis T. urticae


C. pipiens M. occidentalis egg M. occidentalis RS


360 370
TCACAGAAGA AGTCCTGGCT egg TCACAGAAGA AGTCCTGGCT RS TCACAGAAGA AGTCCTGGCT
TCACAGAAGA AGTCCTGGCT


410
AGAGGGCTAG AGAGGGCTAG AGAGGGCTAG


380 390 400
AACTCCGTGC CAGCAGCCGC GGTAATACGG AACTCCGTGC CAGCAGCCGC GGTAATACGG AACTCCGTGC CAGCAGCCGC GGTAATACGG AACTCCGCGC CAGCAGCCGC GGTAATACGG


420 430 440 450
CGTTATTCGG AATTATTGGG CGTAAAGGGC GCGTAGGCTG CGTTATTCGG AATTATTGGG CGTAAAGGGC GCGTAGGCTG CGTTATTCGG AATTATTGGC CGTAAAGGGC GCGTAGGCTG


91


C.
M.
M.
T.



C.
M.
M.
T.



C.
M.
M.
T.


C.
M.
M.
T.









92


T. urticae



C. pipiens M. occidentalis M. occidentalis T. urticae



C. pipiens M. occidentalis M. occidentalis T. urticae



C. pipiens M. occidentalis M. occidentalis T. urticae



C. pipiens M. occidentalis M. occidentalis T. urticae



C. pipiens M. occidentalis M. occidentalis T. urticae



C. pipiens M. occidentalis M. occidentalis T. urticae


C.
M.
M.
T.


pipiens occidentalis occidentalis urticae


AGAGGGCTAG CGTTATTCGG AATTATTGGG CGTAAAGGGC GCGTCGGCT?

460 470 480 490 500
GTTAATAAGT TAAAAGTGAA ATCCCGAGGC TTAACCTTGG AATTGCTTTT egg GTTAATAAGT TAAAAGTGAA ATCCCGAGGC TTAACCTTGG AATTGCTTTT RS GTTAATAAGT TAAAAGTGAA ATCCCGAGGC TTAACCTTGG AATTGCTTTT
?????????? ?AAAAGTGAA ATCCCGAGGC TTAACCTTGG AATTGCTTTT

510 520 530 540 550
AAAACTATTA ATCTAGAGAT TGAAAGAGGA TAGAGGAATT CCTGATGTAG egg AAAACTATTA ATCTAGAGAT TGAAAGAGGA TAGAGGAATT CCTGATGTAG RS AAAACTATTA ATCTAGAGAT TGAAAGAGGA TAGAGGAATT CCTGATGTAG
AAAACTATTA ATCTAGAGAT TGAAAGAGGA TAGAGGAATT CCTGATGTAG

560 570 580 590 600
AGGTAAAATT CGTAAATATT AGGAGGAACA CCAGTGGCGA AGGCGTCTAT egg AGGTAAAATT CGTAAATATT AGGAGGAACA CCAGTGGCGA AGGCGTCTAT RS AGGTAAAATT CGTAAATATT AGGAGGAACA CCAGTGGCGA AGGCGTCTAT
AGGTAAAATT CGTAAATATT AGGAGGAACA CCAGTGGCGA AGGCGTCTAT

610 620 630 640 650
CTGGTTCAAA TCTGACGCTG AAGCGCGAAG GCGTGGGGAG CAAACAGGAT egg CTGGTTCAAA TCTGACGCTG AAGCGCGAAG GCGTGGGGAG CAAACAGGAT RS CTGGTTCAAA TCTGACGCTG AAGCGCGAAG GCGTGGGGAG CAAACAGGAT
CTGGTTCAAA TCTGACGCTG AAGCGCGAAG GCGTGGGGAG CAAACAGGAT

660 670 680 690 700
TAGATACCCT GGTAGTCCAC GCTGTAAACG ATGAATGTTA AATATGGGGA egg TAGATACCCT GGTAGTCCAC GCTGTAAACG ATGAATGTTA AATATGGGGA RS TAGATACCCT GGTAGTCCAC GCTGTAAACG ATGAATGTTA AATATGGGGA
TAGATACCCT GGTAGTCCAC GCTGTAAACG ATGAATGTTA AATATGGGGA


710


720


GTTTACTTTC TGTATTACAG egg GTTTACTTTC TGTATTACAG
RS GTTTACTTTC TGTATTACAG
GTTTACTTTC TGTATTACAG

760 770
ACGGTCGCAA GATTAAAACT egg ACGGTCGCAA GATTAAAACT RS ACGGTCGCAA GATTAAAACT
ACGGTCGCAA GATTAAAACT


730


CTAACGCGTT CTAACGCGTT CTAACGCGTT CTAACGCGTT

780
CAAAGGAATT CAAAGGAATT CAAAGGAATT CAAAGGAATT


AAACATTC AAACATTC AAACATTC AAACATTC


740 750
CG CCTGGGGACT CG CCTGGGGACT CG CCTGGGGACT CG CCTGGGGACT


790


GACGGGGACC GACGGGGACC GACGGGGACC GACGGGGACC


800


CGCACAAGCG CGCACAAGCG CGCACAAGCG CGCACAAGCG


C. pipiens M. occidentalis M. occidentalis T. urticae


810 820
GTGGAGCATG TGGTTTAATT egg GTGGAGCATG TGGTTTAATT
RS GTGGAGCATG TGGTTTAATT
GTGGAGCATG TGGTTTAATT


830
CGATGCAACG CGATGCAACG CGATGCAACG CGATACAACG


840 850
CGAAAAACCT TACCACTTCT
CGAAAAACCT TACCACTTC. CGAAAACCTT ACCACTTCTT CGAAAAACCT TACCACTTCT


860
pipiens TG........
occidentalis egg ..........
occidentalis RS ..........
urticae TG........


C.
M.
M.
T.









93


APPENDIX B




SEQUENCE ALIGNMENT: WOLBACHIA 16S rDNA FOR PHYLOGENETIC ANALYSIS




E. coli position 100

M. _accidentalis_eggs T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
T. _urticae T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
M. _occidentalisRUSSIANSELECT T-AGTGGAAGACGGGTGAGTAATGT??AGGA-ATCTACCTAGTAGTACGG Muscidifuraxuniraptor T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
Culexpipiens T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
Aedesalbopictus T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
Ephestiacautella T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
Triboliumnconfusum T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
Drosophilasimulans T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
Trichogramma-pretiosum T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
Rhinocyllus-conicus T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG
Wolbachia-persica CGAGTGGCGGACGGGTGAGTAACGCGTAGGA-ATCTGCC?ATCTGAGGGG
Bacillussubtilis T-AGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGG
Escherichia coli CGAGTGGCGGACGGGTGAGTAATGTCTGGGA-AACTGCCTGATGGAGGGG
Cowdriaruminatium T-AGTGGCAGACGGGTGAGTAATGCGTAGGA-ATCTGCCTAGTAGTATGG
Ehrlichiacanis T-AGTGGCAGACGGGTGAGTAATGCGTAGGA-ATCTACCTAGTAGTACGG
Anaplasma-marginale T-AGTGGCAGACGGGTGAGTAATGCATAGGA-ATCTACCTAGTAGTATGG
Rickettsia-rickettsii T-AGTGGCAGACGGGTGAGTAACACGTGGGA-ATCTACCCATCAGTACGG

M._occidentalis-eggs AATAATTGTTGGAAACGACAACTAATACCGTATACG-------CCCTACG
T._urticae AATAATTGTTGGAAACGACAACTAATACCG?ATACG-------CCCTACG
M._occidentalisRUSSIANSELECT AATAATTGTTGGAAACGACAACTAATACCGTATACG-------CCCTACG Muscidifurax uniraptor AATAATTGTTGGAAACGGCAACTAATACCGTATAC?-------CCCTACG
Culexpipiens AATAATTGTTGGAAACGACAACTAATACCGTATACG-------CCCTACG
Aedes_albopictus AATAATTGTTGGAAACGGCAACTAATACCGTATACG-------CCCTACG
Ephestia-cautella AATAATTGTTGGAAACGGCAACTAATACCGTATAC?-------CCCTACG
Tribolium confusum GATAATTGTTGGAAACGACAACTAATACCGTATACG-------CCCTACG
Drosophila-simulans AATAATTGTTGGAAACGGCAACTAATACCGTATACG-------CCCTACG
Trichogramma-pretiosum AATAATTGTTGGAAACGGCAACTAATACCGTATACG-------CCCTATG
Rhinocyllusconicus AATAATTGTTGGAAACGGCAACTAATACCGTATACG-------CCCTACG
Wolbachia-persica GATACCAGTTGGAAACGACTGTTAATACCGCATAGT-------ATCTGTG
Bacillussubtilis GATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCAT
Escherichia coli GATAACTACTGGAAACGGTAGCTAATACCGCATAAC-------GTCGCAA
Cowdria_ruminatium AATAGCTATTAGAAATGATAGGTAATACTGTATAAT-------CCCTGCG
Ehrlichiacanis AATAGCCATTAGAAATGGTGGGTAATACTGTATAAT-------CCCCGAG
Anaplasma-marginale GATAGCCACTAGAAATGGTGGGTAATACTGTATAAT--------CCTGCG
Rickettsiarickettsii AATAACTTTTAGAAATAAAAGCTAATACCGTATATT-------C?CTGCG

M._occidentalis_eggs GGG--------GAAAAA--------TTTA------TTGCTATTAGATGAG
T. urticae GGG--------GAAAAA--------TTTA------TTGCTATTAGATGAG
M._occidentalisRUSSIANSELECT GGG--------GAAAAA--------TTTA------TTGCTATTAGATGAG
Muscidifuraxuniraptor GGG--------AAAAA---------TTTA------TTGCTATTAGATGAG
Culex-pipiens GGG--------GAAAAA--------TTTA------TTGCTATTAGATGAG
Aedesalbopictus GGG--------GAAAAA--------TTTA------TTGCTATTAGATGAG
Ephestia-cautella GGG--------GAAAAA--------TTTA------TTGCTATTAGATGAG
Tribolium-confusum GGG--------GAAAAA--------TTTA------TTGCTATCAGATGAG
Drosophilasimulans GGG--------AAAAAT---------TTA------TTGCTATTAGATGAG
Trichogrammapretiosum GGG--------GAAAAA--------TTTA------TTGCTATTAGATGAG
Rhinocyllus_conicus GGG--------GAAAGA--------TTTA------TTGCTATTAGATGAG
Wolbachia-persica GAT--------TAAAGGTAGC--T-TTCG-AGCTGTCGCAGATGGATGAG
Bacillus subtilis GGTTCAAACATAAAAGGTGGC----TTCG--GCTACCACTTACAGATGGA
Escherichia-coli GAC--------CAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTG
Cowdria-ruminatium GGG--------GAAAGA--------TTTA------TCGCTATTAGATGAG
Ehrlichia-canis GGG--------GAAAGA--------TTTA------TCGCTATTAGATAAG
Anaplasma-marginale GGG--------GAAAGA--------TTTA------TCGCTATTAGATGAG
Rickettsia rickettsii GAG--------GAAAGA--------TTTA------TCGCTGATGGATGA?









94


M._occidentaliseggs T. urticae M._occidentalisRUSSIANSELECT Muscidifurax uniraptor Culex-pipiens Aedes-albopictus Ephestiacautella Tribolium confusum Drosophilasimulans Trichogramma-pretiosum Rhinocyllus-conicus Wolbachia-persica Bacillussubtilis Escherichia-coli Cowdriaruminatium Ehrlichiacanis Anaplasma-marginale Rickettsiarickettsii

M._occidentalis_eggs T. urticae M. occidentalisRUSSIANSELECT Muscidifurax uniraptor Culex-pipiens Aedes-albopictus Ephestiacautella Tribolium confusum Drosophila-simulans Trichogramma-pretiosum Rhinocyllus-conicus Wolbachia-persica Bacillus subtilis Escherichiacoli Cowdria ruminatium Ehrlichiacanis Anaplasmajmarginale Rickettsiarickettsii

M. occidentaliseggs T. urticae M._occidentalisRUSSIANSELECT Muscidifurax uniraptor Culex-pipiens Aedesalbopictus Ephestiacautella Tribolium confusum Drosophilasimulans Trichogramma-pretiosum Rhinocyllus-conicus Wolbachia-persica Bacillussubtilis Escherichia coli Cowdriaruminatium Ehrlichia-canis Anaplasma marginale Rickettsia-rickettsii

M._occidentalis-eggs T. urticae M._occidentalisRUSSIANSELECT Muscidifuraxuniraptor Culex-pipiens Aedesalbopictus Ephestia_cautella Triboliumconfusum Drosophilasimulans Trichogrammapretiosum Rhinocyllusconicus Wolbachia-persica Bacillus subtilis Escherichiacoli Cowdria-ruminatium


CCTATATTAGATTAGCTAGTTGGTGGGGTAATAGCCTACCAAGGTAATGA CCTATATTAGATTAGCTAGTTGGTGGGGTAATAGCCTACCAAGGTAATGA CCTATATTAGATTAGCTAGTTGGTGGGGTAATAGCCTACCAAGGTAATGA CCTATATTAGATTAGCTAGTTG-TGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTGGGGTAATAGCCTACCAAGGTAATGA CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAAT?A CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTAAGGTAATGGCTTACCAAGGCAATGA CCTGCGTTGGATTAGCTAGTTGGTGGGGTAA?GGCCTACCAAGGCCACGA CCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGA CCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGA
-CCTACGTTAGATTAGCTAGTTGGTAAGGTAATGGCTTACCAAGGCAATGA CCTACGTTAGATTAGCTAGTTGGTGAGGTAATGGCTTACCAAGGCTATGA CCTATGTCAGATTAGCTAGTTGGTGGGGTAATGGCCTACCAAGGCGGTGA CCCGCGTCAGATTAGGTAGTTGGTGAGGTAATGGCTCACCAAGCCGACGA

TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG
TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG
TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG
TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCCATAGCTGATTTGAGAGGATGATCAGCCACATTGGGACTGAGACACGG
TGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGG TCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGG
TCTATAGCTGGTCTGAGAGGACGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGGTCTGAGAGGACGATCAGCCACACTGGAACTGAGATACGG TCTGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGG TCTGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGG

TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA
TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGG??G?CAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA
TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA CCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGGGAA CCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAA TCCAGACTCCTACGGGAG--AGCAGTGGGGAATATTGCACAATGGGCGCA
TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCA CCCAGACTC??ACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA

AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA
AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA A???TGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA A???TGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA
AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA ACCCTGATCCAGCAATGCCATGTGTGTGAAGAAGGCCTTAGGGTTGTAAA AGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAA AGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAA AGCCTGATCCAGCTATGCCGCGTGAGTGAAGAAGGCCTTCGGGTTGTAAA




Full Text

PAGE 1

WOLBACHIA SYMBIOSIS IN THE AGRICULTURALLY IMPORTANT PREDATORY MITE METASEIULUS OCCIDENTALIS By DENISE L. JOHANOWICZ A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA h 1997

PAGE 2

ACKNOWLEDGMENTS Thanks go to those who provided mites for my Wolbachia survey (D. Wrensch, M. Jehele, B. Croft, E. Beers and S. Bruce-Oliver), to O. Edwards and J. Presnail for providing technical assistance and general advice at the initiation of this project, to S. O'Neill for providing advice and Wolbachia 16S PCR primers, and to R. Giordano for providing valuable advice on the molecular study of Wolbachia in arthropods. The University of Florida Interdisciplinary Center for Biotechnology Research assisted with polymerase chain reaction primer synthesis and DNA sequencing. J. Harrison provided statistical advice. I thank J. Allen, J. H. Frank, J. Dame, and J. Nation for their help during this project. Special thanks go to Ayyemperumal Jeyaprakash (Dr. Jey) for his patient efforts in teaching me molecular skills, but most of all, for teaching me how to be more patient myself. I am extremely grateful to Marjorie Hoy for opening my eyes to the fascinating world of mites, for sharing her ideas about Wolbachia, for her careful editing of my work, for her optimism, and for her high expectations. I also thank her for supporting this work with funds from the Davies, Fischer, and Eckes Endowment in Biological Control. Finally, I thank my mom, my dad, my two brothers Chris and Stevie, my grandparents, and my husband David Hei for their encouragement, support, and love. ii

PAGE 3

TABLE OF CONTENTS page ACKNOWLEDGMENTS ii ABSTRACT iii CHAPTERS 1 INTRODUCTION 1 Historical Sketch 1 Wolbachia Biology 3 Wolbachia in the Predatory Mite Metaseiulus occidentalis 7 Research Goals 12 2 16S RIBOSOMAL DNA ANALYSIS OF WOLBACHIA FROM TWO PHYTOSEIIDS (ACARI: PHYTOSEIIDAE) AND THEIR PREY (ACARI: TETRANYCHIDAE) 15 Introduction 15 Materials and Methods 18 Results 22 Discussion 26 3 FURTHER GENETIC CHARACTERIZATION OF WOLBACHIA USING PARTIAL FTSZ GENE SEQUENCES 33 Introduction 33 Methods 34 Results 38 Discussion 39 4 EXPERIMENTAL INDUCTION AND TERMINATION OF NONRECIPROCAL REPRODUCTIVE INCOMPATIBILITIES IN A PARAHAPLOID MITE 43 Introduction 43 Methods 46 Results 50 Discussion 53 iii

PAGE 4

5 WOLBACHIA INFECTION DYNAMICS IN EXPERIMENTAL LABORATORY POPULATIONS OF METASEIULUS OCCIDENT ALIS 62 Introduction 62 Methods 67 Results 72 Discussion 74 6 CONCLUSIONS 84 APPENDIX A 91 APPENDIX B 93 LIST OF REFERENCES 97 BIOGRAPHICAL SKETCH 109 iv

PAGE 5

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy WOLBACHIA SYMBIOSIS IN THE AGRICULTURALLY IMPORTANT PREDATORY MITE METASEIULUS OCCIDENTALIS By Denise L. Johanowicz * December 1997 Chairman: Marjorie A. Hoy Major Department: Entomology and Nematology This study focused on detecting, describing, and evaluating the biological effects of Wolbachia endosymbionts in the predatory mite Metaseiiihis occidentalis (Nesbitt) (Acari: Phytoseiidae). Wolbachia were found in adults and eggs of M. occidentalis using Wo/bflc/iia-specific polymerase chain reaction (PCR) primers v^hich amplify the 16S ribosomal RNA and ftsZ genes. Wolbachia also were found in their prey, the two spotted spider mite Tetranychus urticae Koch (Acari: Tetranychidae). Wolbachia DNA from the two mite species was sequenced and compared. Parsimony analysis indicated the mite Wolbachia sequences were very similar to one another and to Wolbachia from insects. Wolbachia DNA could be transiently detected in the uninfected predatory mite Amblyseius reductus Wainstein (Acari: Phytoseiidae) after feeding on infected spider mites, indicating the infection status of any predatory arthropod's diet should be considered before using the PCR to detect Wolbachia. V

PAGE 6

In insects, Wolbachia causes nonreciprocal reproductive incompatibilities in crosses between infected males and uninfected females; the reciprocal crosses are normal. Genetically similar populations of M. occidentalis differing in the presence of Wolbachia (due to heat-curing of one population) were crossed to assess the effects of the symbiont. Wolbachia did induce non-reciprocal incompatibilities in this parahaploid mite, evidenced by significantly fewer viable eggs, higher proportions of egg shriveling as compared to the reciprocal and control crosses, and no or few female progeny. To determine whether the proportion of Wolbachia-infected M. occidentalis in a polymorphic population would increase over time (because infected females can reproduce with both infected and uninfected males), three M. occidentalis populations were initiated with 10% infected and 90% cured mites and monitored for 12 generations. Wolbachia infection did not spread rapidly through the populations. Imperfect transmission rates and fitness costs were detected, which may prevent the rapid spread of Wolbachia. This suggests Wolbachia would not be useful as a "drive mechanism" for inserting useful genes into field populations of M. occidentalis. vi

PAGE 7

CHAPTER 1 INTRODUCTION Historical Sketch Wolbachia bacteria were first described from the gonadal tissues of the mosquito Culex pipiens L. in 1924 by Hertig and Wolbach; the type species is therefore named Wolbachia pipientis Hertig. Strange reproductive incompatibihties were later described in Culex pipiens mosquitoes by Ghelelovitch (1952) and Laven (1951). One type of incompatibility was nonreciprocal, meaning that crosses of males from population A with females of population B resulted in normal progeny, but crosses of males from population B with females from population A (the reciprocal cross) resulted in few viable progeny. The phenomenon was named "cytoplasmic incompatibility" (Laven 1959). In the 1970s Yen and Barr (1971) first correlated these nonreciprocal, cytoplasmic incompatibilities with the presence of Wolbachia endosymbionts. They found that when Wo/foac^ la-infected males were treated with tetracycline (which is toxic to rickettsia-like microorganisms), they could reproduce successfully with uninfected females. Because Wolbachia' s morphological characters are of limited value and Wolbachia are difficult to culture outside the host (Weiss and Moulder, 1984; O'Neill et al, 1992), their presence in other arthropods was merely speculative. 1

PAGE 8

2 In 1992, Wolbachia-specihc polymerase chain reaction (PCR) primers were developed (O'Neill et ah, 1992). These primers were designed to be specific to Wolbachia, while at the same time general enough to amplify Wolbachia 16S ribosomal DNA from various insects. Reproductive anomalies associated with the presence of an unknown rickettsia could now be correlated with the presence of Wolbachia. For example, Wolbachia infection was confirmed in some California populations of Drosophila simulans Sturtevant (O'Neill et al, 1992). This symbiont was previously suspected to be the causative agent of nonreciprocal reproductive incompatibilities between geographical populations of this insect (Hoffmann et al., 1986). Because uninfected females are reproductively incompatible with infected males, and infected females can reproduce successfully with infected and uninfected males, infected females tend to have a reproductive advantage in polymorphic populations (Caspari and Watson, 1959; Turelli and Hoffmann, 1991) . In fact, the D. simulans Wolbachia infection has spread within and among California populations (Turelli and Hoffmann, 1991; Turelli et al., 1992) since it was first documented in 1986 (Hoffmann et al, 1986). The increased proportion of infected individuals is presumably due to the reproductive advantage afforded to infected females (Turelli and Hoffmann, 1991). Several parameters determine the ability of Wolbachia to spread through a population, including the stability of infection as a function of maternal transmission frequency, fitness costs associated with infection, and the strength of incompatibility (Hoffmann et al, 1990; Turelli et al, 1992; Clancy and Hoffmann, 1997).

PAGE 9

3 Efforts are under way to genetically engineer insects' mutualistic endosymbionts to be refractory to disease agents like those causing malaria or Chagas' disease (Beard et al, 1993). These transformed arthropods need a way to replace the wild-type insects already present in the field population. The ability of Wolbachia to spread through a population, as documented in D. simulans, could be harnessed as mechanism to help drive a genetically altered symbiont through a population if it "hitchhikes" with the Wolbachia-inf acted cytoplasm (Caspari and Watson, 1959; Beard et al, 1993). Wolbachia Biology A fuller understanding of Wolbachia biology is necessary before it can be used successfully as a drive mechanism (Werren, 1997). What is known about these endosymbionts is that they are intracellular, rickettsial-like endosymbionts in the alpha-subdivision of the proteobacteria (purple bacteria) (for a review of the biology of this symbiont and the diversity of hosts it infects, see Werren, 1997). Wolbachia are transmitted through the egg cytoplasm, therefore transmitted solely by females. There was, however, one reported case of male transmission in laboratory populations of D. simulans (Hoffmann and Turelli, 1988). Wolbachia are sensitive to high temperatures (Stevens, 1989; Stouthamer et al, 1990; Girin and Bouletreau, 1995; Louis et al, 1993), and the antibiotics rifampin and tetracycline (Stouthamer et al., 1990a). The only success to date in culturing them outside the host has been in an Aedes albopictus (Skuse) cell line (O'Neill et al, 1995).

PAGE 10

4 Because they cannot be studied using traditional microbiological techniques (Weiss and Moulder, 1984), the PCR and DNA sequencing has provided a major breakthrough in their study (O'Neill et al, 1992; Breeuwer et al, 1992; Rousset et al, 1992a; Stouthamer et al, 1993). The PCR allows the amplification of a specific region of Wolbachia DNA more than a millionfold. The presence or absence of the symbiont then can be determined by visual detection of the expected size fragment of DNA in an ethidium bromidestained agarose gel under UV light. This amplification also yields ample DNA for sequencing and further description and characterization. DNA sequence analyses indicate a lack of concordance between the phylogenies of the symbiont and of the hosts, suggesting this symbiont might sometimes be transmitted horizontally from species to species (Rousset et al, 1992a; O'Neill et al, 1992). Recent studies using the PCR determined that 16% of all insect species examined are infected with Wolbachia (Werren et al, 1995a). The effects of Wolbachia, for example the nonreciprocal reproductive incompatibilities detected in C. pipiens and D. simulans, are influenced by several factors. The strain of Wolbachia is important; some strains have been demonstrated to cause no reproductive alterations (Giordano et al, 1995). The phenotype of Wolbachia-mediated reproductive alterations also depends on the taxonomic status of the affected arthropod (Insecta, Arachnida, Isopoda) (see Werren, 1997), as well as the genetic system of the arthropod. It is important to consider arthropod genetic systems in order to better appreciate the diversity of Wolbachia's effects on reproduction. Diplo-diploid arthropods produce both sexes from fertilized eggs, each sex carrying both the maternal and paternal sets of chromosomes

PAGE 11

throughout their lives. In haplo-diploid arthropods, female progeny arise from fertilized eggs and are diploid, but the male progeny arise from unfertilized eggs and are haploid, carrying only the maternal set of chromosomes. Thelytoky is a genetic system in which virgin females produce diploid daughters parthenogenetically, rarely producing males. In a parahaploid genetic system, both sexes initially arise from fertilized (diploid) eggs, with both sets of chromosomes. However, one chromosome set is subsequently lost in males, and the adult male is haploid, producing sperm by a mitotic process. When males of infected diplo-diploids mate with females lacking Wolbachia, the paternal chromosome set becomes abnormal in the fertilized egg (Kose and Karr, 1995; O'Neill and Karr, 1990), resulting in the death of both male and female progeny (Hoffmann et al, 1986; Hsiao and Hsiao, 1985). The reciprocal cross is normal. Although the molecular mechanism of this incompatibility is not yet fully understood, it is speculated that Wolbachia somehow "imprints" or "modifies" the paternal set of chromosomes (Werren, 1997). If Wolbachia is present in the egg cytoplasm, it can "rescue" the paternal chromosomes so that they remain normal and produce the normal diploid sons and daughters. If no Wolbachia is present, there is no "rescue" and those paternal chromosome set becomes abnormal, leading to embryonic death. This same mechanism may occur in haplo-diploid insects, but with different consequences. When infected haploid males mate with uninfected diploid females, the male (haploid) progeny remain normal, but the normally diploid female embryos become haploid due to abnormalities in the paternal set of chromosomes (Ryan and Saul, 1968; Reed and Werren,

PAGE 12

1995). The resulting phenotype of Wolbachia-mediated incompatibilities in haplo-diploid species is a strongly male-biased sex ratio because of the loss of female progeny. The haploid female embryos may die, as in some strains of the two-spotted spider mite Tetranychiis urticae Koch (Chelicerata: Arachnida) (Vala and Breeuwer, 1996), or the haploid female embryos can become males thereby increasing the total number of expected males, as in the jewel wasp Nasonia vitripennis Walker (Mandibulata: Insecta) (Breeuwer and Werren, 1990; Ryan and Saul, 1968). Wolbachia also can cause bidirectional incompatibility in diplo-diploid species (O'Neill and Karr, 1990) and haplo-diploid species (Perrot-Minot et al, 1996). In this situation, two populations apparently host two different Wolbachia strains. The result is reciprocal incompatibility, where both interpopulation crosses are incompatible. Wolbachia induces thelytoky in some hymenopteran species, such as Trichogramma (Stouthamer et al, 1990b) and Aphytis (Zchori-Fein et al, 1995). Wolbachia allows these females to produce diploid daughters parthenogenetically by causing what is termed by Stouthamer and Kazmer (1994) as "gamete duplication" early in the first mitotic division. This phenomenon is probably described more accurately as duplication of the chromosomes in the oocyte. Wolbachia causes a typical diplo-diploid incompatibility phenotype in some isopods (Rousset et al., 1992b), as well as an unusual phenotype in the species Armadillium vulgare Latr. In this species, Wolbachia suppresses the androgenic gland in genetically male individuals, causing these male isopods to become functional females (Rigaud et al, 1991). It is hkely that, with the

PAGE 13

diversity of Wolbachia's effects on the arthropod taxa and genetic systems described to date, there may be more Wolbachia-mediated reproductive anomalies remaining to be described. Wolbachia may have other important ecological and evolutionary effects. Wolbachia-mediated reproductive isolation may be one mechanism that could allow sympatric speciation to occur (Laven, 1959; Werren, 1997). Wolbachia alters sex ratios and progeny survival and, as a consequence, may affect laboratory experiments and insect management in field programs. For example, incompatibilities may interfere with crosses conducted during hybridization studies, one method of determining species designations in some insects and phytoseiid mites (Croft, 1970; McMurtry et al., 1976; McMurtry, 1980; McMurtry and Badii, 1989). Studies on the mode of inheritance of pesticide resistance have been affected by cross incompatibilities (Hoy and Knop, 1981; Hoy and Standow, 1982). Wolbachia infection may have implications for mass rearing projects, especially if the bacteria have an influence on the quality of the natural enemies (Steiner, 1993) or affect the rate of population increase of the individuals being reared. Wolbachia in the Predatory Mite, Metaseiulus occidentalis The western predatory mite Metaseiulus {-Typhlodromus or Galendromus) occidentalis (Nesbitt) is a useful natural enemy of Tetranychus species, including the two spotted spider mite, Tetranychus urticae. This predatory mite is used as a biological control agent in various crops in the western United States (Hoyt, 1969, Hoyt and Caltagirone, 1971), including

PAGE 14

8 apples (Hoyt, 1969; Hoyt and Caltagirone, 1971), peaches (Hoyt and Caltagirone, 1971), grapes (Flaherty and Huffaker, 1970), and almonds (Hoy, 1985). Figure 1-1 shows an adult M. occidentalis feeding on an adult T. urticae. For lists of references on M. occidentalis and other phytoseiids, see Hoy (1982) and Kostiainen and Hoy (1996). The effectiveness of M. occidentalis can be negatively affected by chemical sprays used to control insect pests occurring within the same agricultural ecosystem. Genetically improved strains of this predator that are resistant to various chemical pesticides have been developed (reviewed by Hoy, 1985) and utilized as part of integrated pest management programs to control spider mites (Hoy et al, 1982), already resistant to many of these chemicals. In addition, efforts are under way to develop recombinant DNA techniques to further improve these and other natural enemies for use in agriculture (Presnail and Hoy, 1992). Details about the biology, behavior, ecology, and genetics of M. occidentalis have been and remain important to better understand and improve this predator as a biological control agent in agriculture (Hoy, 1985). Of particular interest are biological characteristics which affect their rate of population increase in the field and in the rearing laboratory (Sabelis, 1985). Studies on the genetic system, mating behavior, sex ratio, and reproductive incompatibilities of M. occidentalis have yielded a great deal of information on the reproductive biology of these predators, while at the same time have raised several interesting questions. Studies on the reproductive biology of the phytoseiids Phytoseiulus persimilis Athias-Henriot (Helle et al, 1978), Amblyseius bibiens Blommers

PAGE 15

(Helle et al, 1978), and M. occidentalis (Hoy, 1979) revealed their unique genetic system called parahaploidy (also referred to as "pseudo-arrhenotoky" by Schulten (1985) to distinguish it from the similar system found in insects). Hoy (1979) found that in studies in which X-irradiated males were mated with unirradiated females, only sons were produced. Any sons produced were low in number and sterile, suggesting these males are derived from fertilized eggs, beginning life as a diploid, and later losing half of their chromosome set sometime during embryonic development (Hoy, 1979). Nelson-Rees et al. (1980) demonstrated cytologically that both male and female M. occidentalis are diploid at the beginning of embryonic development, but at the onset of the reductional division 24-48 hours after egg deposition, one of the sets becomes heterochromatinized and excluded from the nucleus. Studies on the inheritance of pesticide resistance in P. persimilis by Helle et al. (1978) and in M. occidentalis by Hoy and Standow (1982) and Roush and Plapp (1982) suggest the paternal set of chromosomes is lost, although recent use of RAPDPCR DNA markers suggests that some of the paternal genome may be retained in males of the phytoseiid Typhlodronius pyri Scheuten (PerrotMinnot and Navajas, 1995). More data are needed to verify whether this is true and to further clarify the mechanism of parahaploidy in these and other phytoseiids. Sex allocation and the resultant sex ratios of phytoseiids have practical consequences for biological control and associated mass rearing projects (Sabelis, 1985). Amano and Chant (1978) suggest there is a characteristic sex ratio between 50 and 100 percent females for each phytoseiid species. These sex ratios differ between the species but are fairly consistent within species

PAGE 16

10 (Sabelis, 1981). This consistency has been contradicted by others, who have reported intraspecific variation in several species. Croft (1970) detected sex ratio differences in the colonies and differences in crosses between colonies of M. occidentalis from Utah, California and Washington. Roush and Hoy (1981) found that a carbaryl resistant strain of M. occidentalis crossed with a susceptible colony produced progeny with sex ratios different from those of each strain mated inter se. The resistant strain had a higher sex ratio (more females) than the susceptible. McMurtry et al. (1976) found that the sex ratio varied in reciprocal crosses of geographical races of Amblyseius potentillae Carman. Variation in sex ratios of different geographical populations and colonies suggests a genetic component to sex ratio (Hoy, 1982). There have been correlations also between temperature and sex ratio (Dyer and Swift, 1979; Tanigoshi et al, 1975), relative humidity and sex ratio (Dyer and Swift, 1979), starvation and sex ratio (Tanigoshi et al., 1975), and mating duration and sex ratio (Schulten et al, 1978; Elbadry and Elbenhawy, 1968; Amano and Chant, 1978). There also have been reports of partial reproductive incompatibilities between strains of the same phytoseiid species. Associated with these reproductive incompatibilities were shriveled eggs, low numbers of eggs, low survival of immature stages, and reduced fecundity in surviving Fi individuals (Croft, 1970; Hoy and Knop, 1981; Hoy and Standow, 1982; Hoy and Cave, 1988). Croft (1970) detected reciprocal reproductive incompatibilities (females from both of the two populations being crossed are incompatible with males from the different population) and nonreciprocal reproductive incompatibilities (females from only one of the two populations

PAGE 17

11 being crossed are incompatible with males from the other population) in crosses of M. occidentalis from California, Utah, and Washington. When Hoy and Knop (1981) crossed a laboratory selected permethrin resistant strain of M. occidentalis with its original base colony, few eggs were produced and many were shriveled and failed to develop in one cross while the reciprocal cross was compatible. They also found that a partially permethrin resistant strain was nonreciprocally incompatible with its base colony after only one year of laboratory selections. Similar nonreciprocal reproductive incompatibilities were found in crosses with sulfur-resistant M. occidentalis (Hoy and Standow, 1982). In a later study. Hoy and Cave (1988) detected nonreciprocal partial reproductive incompatibilities between five other colonies of M. occidentalis. Other examples of nonreciprocal incompatibilities in phytoseiids were found in Typhlodromus annectens DeLeon (McMurtry and Badii, 1989) and in two populations of Amblyseius addoensis van der Merwe and Ryke from South Africa (McMurtry, 1980). The cause of the nonreciprocal reproductive incompatibilities was unknown in these phytoseiids. They were somewhat similar to the nonreciprocal incompatibilities previously described in the mosquito C. pipiens L. (Ghelelovitch, 1952; Laven, 1951), determined to have a cytoplasmic inheritance pattern (Laven, 1959). A cytoplasmic inheritance pattern is suspected when the nuclear genetic makeup of the hybrids is virtually the same, but the main difference is which mother's cytoplasm is present. An intracellular rickettsia-like microorganism was found by Hess and Hoy (1982) in M. occidentalis eggs and ovaries through light and electron microscopy. This observation, along with the nonreciprocal nature of the incompatiblities.

PAGE 18

12 led Hoy and Cave (1988) to speculate that a cytoplasmic factor may be responsible for the observed reproductive aberrations seen in M. occidentalis, perhaps due to the presence of Wolbachia. I decided to investigate Wolbachia in M. occidentalis because of this predator's importance as a biological control agent, because it has a genetic system that has not yet been studied in relation to Wolbachia-mediated incompatibilities, and because of the potential to use Wolbachia as a drive mechanism in genetic improvement programs. In addition, this mite has been used as a model organism in past experimental ecological simulations, due to its rapid generation time and ease of rearing (Huffaker, 1958). Research Goals The first goal was to determine whether Wolbachia was present in M. occidentalis (Chapter 2). The PCR was used to detect this endosymbiont in various laboratory and field populations of M. occidentalis and its prey T. urticae. The amplified 16S rDNA was sequenced and comparisons were made between the Wolbachia sequences found in both predator and prey mites and the Wolbachia sequences from various insects. The final goal of Chapter 2 was to determine whether starvation could eliminate false positive PCR signals in predators fed on Wo/bflc/z za-infected prey. Wolbachia 16S ribosomal DNA sequences from M. occidentalis and T. urticae were highly similar (Chapter 2). PCR primers have recently become available that amplify other Wolbachia genes, such as the ftsZ gene and the

PAGE 19

13 surface protein gene. Attempts were made to further characterize Wolbachia in M. occidentalis and T. urticae by using these genes (Chapter 3). Once Wolbachia were identified, correlations between the presence of Wolbachia and their influence on reproduction in M. occidentalis were investigated (Chapter 4). Genetically similar inbred lines, differing only in the presence or absence of Wolbachia, were crossed and evaluated to determine whether this symbiont is associated with nonreciprocal reproductive incompatibilities in crosses between infected males and heatcured females. The incompatibility phenotype would be a useful model of Wolbachia-induced reproductive alterations in a parahaploid arthropod. To determine whether Wolbachia could spread through a polymorphic population due to the reproductive advantage afforded to infected females, laboratory populations initiated with 10% infected and 90% uninfected eggs were monitored for 12 generations. The stability of infection was also assessed by analysis of the control populations (Chapter 5). Chapter 6 provides a general discussion of the results of my research. I will address what I have learned about Wolbachia, some implications of the results, and potential directions of future research.

PAGE 20

Figure 1-1. An adult female western orchard predatory mite, Metaseiulus occidentalis , is pictured on the right, feeding on an adult twospotted spider mite, Tetranychus urticae.

PAGE 21

CHAPTER 2 16S RIBOSOMAL DNA ANALYSIS OF WOLBACHIA FROM TWO PHYTOSEIIDS (ACARI: PHYTOSEIIDAE) AND THEIR PREY (ACARI: TETRANYCHIDAE) Introduction Wolbachia are rickettsia-like microorganisms in the alpha subdivision of the proteobacteria, which are intracellular, maternally inherited, and found in the gonadal tissues of some insects. They were detected originally in the northern house mosquito, Ciilex pipiens L. (Hertig, 1936; Yen and Barr, 1971); the type species is named Wolbachia pipientis Hertig. Wolbachia has been reported to have negative (Stevens and Wade, 1990; Horjus and Stouthamer, 1995), zero (Moran and Bauman, 1994; Poinsot and Mer^ot, 1997), or positive (Wade and Chang, 1995) effects on host fitness, so it remains unresolved whether Wolbachia symbionts are mutualists or parasites. Wolbachia are associated with unidirectional and bidirectional intraspecific mating incompatibilities in many insects (Yen and Barr, 1973; O'Neill and Karr, 1990; Breeuwer and Werren, 1990) and thelytoky in some parthenogenetic insects (Stouthamer et ah, 1993). Infected females may have a reproductive advantage when other females in the population are not infected. Females with Wolbachia can produce viable progeny when mating with both infected and uninfected males. Uninfected females are partially incompatible with infected males and therefore produce fewer progeny than females infected with the same strain of Wolbachia, which can lead to the 15

PAGE 22

16 elimination of uninfected individuals in the population over time. Bidirectional mating incompatibilities caused by Wolbachia infections may play a role in the sympatric speciation of arthropods through reproductive isolation (Laven, 1959). The polymerase chain reaction (PGR) can be used to detect Wolbachia in insects when specific oligonucleotide sequences (primers) complementary to a portion of Wolbachia 16S ribosomal DNA (rDNA) are used (O'Neill et ah, 1992). Visual detection of these amplified fragments can be made after gel electrophoresis and staining with ethidium bromide. The PGR products can be sequenced to confirm the identity and phylogenetic placement of the DNA. Often, 16S ribosomal DNA sequences are used to reconstruct bacterial phylogenies because they are highly conserved in prokaryotes (Woese, 1987). Wolbachia 16S rDNA sequences from various insect orders are available through the GenBank and European Molecular Biology Laboratories (EMBL) databases, including those from the Diptera (O'Neill et al, 1992; Rousset et al, 1992a), Hymenoptera (Breeuwer et al, 1992; Stouthamer et al, 1993), Goleoptera, and Lepidoptera (O'Neill et al, 1992). The predatory mite Metaseiulus {=Typhlodromus or Galendromus) occidentalis (Nesbitt) (Acari: Phytoseiidae) is a natural enemy of spider mites, including the two spotted spider mite, Tetranychus urticae Koch. M. occidentalis is used as a biological control agent in a variety of crops in the western United States (Hoyt, 1969; Hoyt and Galtagirone, 1971). Previous studies have been conducted on the cytogenetics of M. occidentalis (NelsonRees et al, 1980), and on rickettsia-like microorganisms (Hess and Hoy, 1982), which were found in eggs and ovaries of M. occidentalis. Furthermore,

PAGE 23

17 observations of nonreciprocal partial reproductive incompatibilities between certain populations (Croft, 1970; Hoy and Knop, 1981; Hoy and Standow, 1982; Hoy and Cave, 1988) suggested the possibility of infection by Wolbachia. Previous studies (e. g., Overmeer and van Zon 1976; deBoer 1982) have also demonstrated that cytoplasmic incompatibilities occur in the two spotted spider mite, suggestive of Wolbachia infection. One difficulty in detecting and subsequently sequencing Wolbachia DNA in M. occidentalis is that their prey could also contain Wolbachia. The pollen-feeding phytoseiid Amblyseius reductus Wainstein is not infected with Wolbachia (unpublished data) and therefore can be used to test whether false positive PCR signals caused by transient gut contents could be eliminated methodologically. The goals of this study were to 1) conduct a survey by using the PCR to detect the presence of Wolbachia in several predator and prey populations, 2) determine whether the otherwise Wolbachia-free predator A. reductus becomes positive for Wolbachia as determined by the PCR after feeding on prey containing Wolbachia, 3) evaluate starvation as a method for eliminating false positive PCR signals in Wolbachia-free predators fed prey containing Wolbachia, and 4) to use parsimony analysis to compare the 16S rDNA sequences obtained to the Wolbachia sequences from various insects to confirm the identity of the DNA as Wolbachia 16S rDNA.

PAGE 24

18 Materials and Methods Colony Sources and Maintenance A series of seven laboratory colonies (Table 2-1) of Metaseiulus occidentalis (COS, Russian Select, Supermite, Hybrid Select, Ave-21, Pullman Blackberry, WA Select) niaintained at the University of Florida and reared as previously described (Roush and Hoy, 1981; Hoy et al, 1982) were surveyed for the presence of Wolbachia by the PCR. One M. occidentalis laboratory colony from Oregon and one insectary colony from California were sampled immediately after they were received. Field-collected M. occidentalis from Washington apples and their prey, European red mite, Panonychus ulmi (Koch), were collected and subsequently reared on detached apple leaves in our laboratory for use in the PCR survey. The A. reductus used in the time course study were reared in the laboratory on a diet of cattail, Typha latifolia L. pollen, but will eat the two spotted spider mite, Tetranychus iirticae if provided. A colony of two spotted spider mites was raised on pinto bean, Phaseolus vulgaris L., plants in a greenhouse at the University of FloridaGainesville and later used in the PCR survey. T. urticae were also obtained from a laboratory colony in Oregon, a laboratory colony from Ohio, and an insectary in California. A population of T. urticae and of the strawberry spider mite, T. turkestani Ugarov and Nikolski were collected from a field of cotton in California. The T. urticae and T. turkestani obtained from other sources were maintained on detached bean leaves in the laboratory.

PAGE 25

19 DNA Extraction All predators were starved between 4 and 8 h prior to DNA extractions, and mites from the newly acquired predatory mite colonies were tested before feeding on T. urticae from our laboratory. DNA from the Russian Select adult female M. occidentalis and the male T. urticae used for the PCR and subsequent direct sequencing was extracted by a modified version of the technique reported by Edwards and Hoy (1993). Fresh, not frozen, individual and pooled adults (5 mites) were macerated in 50 \i\ of a 5% Chelex (Bio-Rad, Hercules, CA) solution, heated to 56°C for 30 min (instead of 15 min), then to 95°C (instead of 100°C) for 8 min. The samples were centrifuged briefly and stored at -20° C before the PCR. Some inconsistencies in results were noticed by using the Chelex method, so the DNA from the eggs of COS M. occidentalis used for sequencing, as well as the DNA used for all other PCR surveys and experiments, was extracted as follows: DNA from eggs and adults was extracted by macerating 5 adult mites or 60 eggs in 25 |il of STE buffer (100 mM NaCl, 10 mM Tris, 1 mM EDTA pH = 8.0) and 1 ml of proteinase K (10 mg/ml) (O'Neill et al, 1992). Samples were macerated with a new glass pestle for each sample in a 1.5-ml Eppendorf tube. Pestles were made by flaming the tip of a pasteur pipette and bending it slightly to form a rounded end. The preparation was heated to 95°C for 8 min, briefly centrifuged, and used immediately for the PCR reactions.

PAGE 26

20 Polymerase Chain Reaction Conditions All reactions were run with the following conditions; 50 mM KCl, 10 mM Tris HCl, 2.5 mM MgClj, 0.2 |xM each primer, 200 |xM each dNTP, and 0.8 units of Taq in a total volume of 25 |il. The initial 16S rDNA primers were provided by S. O'Neill (O'Neill et ah, 1992), and subsequent primers were synthesized by the University of Florida DNA Synthesis Laboratory. The primers correspond to E. coli positions 76-99 forward (5'TTGTAGCCTGCTATGGTATAACT) and 1012-994 reverse (5'GAATAGGTATGATTTTCATGT), and produce a PGR product of ' 900 bp. Reactions were cycled 40 times at 94°C for 30 s, 50°C for 30 s, and 72°C for 45 s followed by a 4 min extension period. The amount of template used varied according to species and life stage, but was usually 5 Reagent negative controls were included in the reactions. Positive controls were Drosophila simulans Sturtevant DNA (supplied by R. Giordano, University of Illinois, Urbana) or dilutions of previously amplified DNA from M. occidentalis with Wolbachia-specific primers. The camel's-hair brush used to transfer the mites, the pinto bean leaves and roots, and the debris (exuviae, dead spider mites) in the predator colonies were tested by PGR for contaminating Wolbachia DNA. PGR products were electrophoresed in a 1.5% agarose gel in TBE/EtBr for 90 min at 60 mV, then photographed on a UV transilluminator. Effects of Feeding Predators With Wo/bac/ixfl-Positive Prey A study was done to determine whether the otherwise Wolbachia-hee A. reductus would become positive for Wolbachia by the PGR after feeding on T. urticae containing Wolbachia, or whether the positive PGR signal seen from

PAGE 27

21 adult female M. occidentalis would disappear when removed from a T. urticae food source. Adult females of both species were fed a diet of T. urticae for at least 5 d and later placed in an arena without prey. The predators were then killed 0, 4, 8, 16, 24, and 48 h later by placing them into a -80°C freezer, where they were stored until their DNA was extracted for PCR analysis. If whole mites were frozen, preliminary tests indicated PCR amplification could be conducted with consistent results. The DNA from 5 mites was combined per replicate, and 5 replicates were done for each time point, with the exception of 3 replicates for A. rediictus at 48 h after feeding. The DNA extractions and PCR reactions from 3 of the 5 replicates from all time periods were done on one day, the remaining 2 samples from each time period were analyzed on the following day. Negative controls were water and DNA from A. reductus never fed T. urticae. Drosophila simulans DNA was a positive control. DNA Purification and Sequencing The PCR product from one M. occidentalis female (Russian Select strain) starved for 8 h was reamplified and purified with a QIAquick Spin PCR Purification Kit (QIAGEN, Chatsworth, CA) for direct sequencing. Similarly, the PCR product from one male T. urticae was reamplified and purified for subsequent direct sequencing. The PCR product from 60 M. occidentalis eggs (COS strain) was also reamplified and purified. The reamplified egg DNA was purified by extracting the 900-bp band from an agarose gel by using a QIAquick Gel Extraction kit (QIAGEN). The PCR products were sequenced by the ICBR DNA Core Sequencing Facility at the University of Florida with an ABI 373a Automated Sequencer.

PAGE 28

22 Phylogenetic Analysis The 16S rDNA sequences from microorganisms, including Wolbachia, were aligned with the mite sequences by eye by using conserved areas as markers. Parsimony analyses with PHYLIP (Felsenstein, 1993) and MacClade (Madisson and Madisson, 1992) were used to compare our sequences with the other aligned sequences. Bacillus subtilis Cohn was used as an outgroup. Many reported Wolbachia sequences are shorter than those I sequenced; therefore a 625-bp sequence from the 5' end of the 16S rDNA gene (£. coli positions 100-773) was used in the phylogenetic analyses. Heat Treatment Temperatures >30°C administered for a few generations have been reported to eliminate Wolbachia from some insects (Stevens, 1989; Stouthamer et al, 1990a). One colony of M. occidentalis (COS) was reared at 33°C for at least 6 generations to determine whether it is possible to decrease their Wolbachia to undetectable levels. Results DNA Extraction Although DNA preparations with Chelex yielded some positive PGR signals, the STE preparation method (O'Neill et al, 1992) gave more consistent results, especially when the DNA preparation was used immediately after the extraction and was never frozen.

PAGE 29

23 Polymerase Chain Reaction Assay The survey of predator and prey populations indicates the 900-bp Wolbachia-specific PCR product can be amplified from laboratory colonies of M. occidentalis and T. urticae, but not amplified from the field populations tested (Table 2-1). However, a field population of the other spider mite tested, T. turkestani, which was collected from the same cotton field containing an uninfected population of T. urticae, was positive. The European red mite, prey of the freshly collected field population of M. occidentalis tested, was also negative by the PCR. The laboratory colony of A. reductus remained uninfected during the course of the study. Negative controls, the camel's-hair brush, pinto bean material, and the debris were negative throughout the study. Some nonspecific PCR products were present in some reactions and excluded from analyses. The PCR was performed on egg preparations of selected M. occidentalis strains to eliminate the possibility of false positive signals caused by adults feeding on positive T. urticae prey. When the adults were positive, the eggs were also positive (Table 2-1) (COS, Russian Select, Pullman Blackberry). Likewise, when the adults were negative, the eggs were negative (Supermite, Griggs Apple). Figure 2-1 (lanes 2-4) shows the PCR results from COS adults and eggs. The presence of Wolbachia from egg preparations suggests that Wolbachia are transovarially transmitted, not just present as gut contaminants from feeding on positive T. urticae. Transovarial transmission of the type B rickettsia-like microorganism in M. occidentalis was predicted previously because of their primary presence in the ovaries of adult females

PAGE 30

24 (Hess and Hoy, 1982) and because of the presence of small microorganisms observed in egg squashes of M. occidentalis (Nelson-Rees et al, 1980). Effects of Feeding Predators Infected Prey A. reductus adult females fed T. urticae were positive for Wolbachia by the PGR in only one replicate of five when tested immediately after the predators were removed from positive prey. All the remaining samples were negative. Positive and negative controls indicated that the PGR reactions were reliable. In M. occidentalis, positive PGR signals were detected in all five samples tested 0 and 4 h after feeding, in four of the five samples 8, 12, and 24 h after feeding, and in three of the five samples 48 h after feeding. Figure 2-1 (lane 7) shows a positive PGR signal in A. reductus immediately after removal, but a negative reaction in A. reductus starved 4 h (lane 8). The positive signal from M. occidentalis removed from prey for 24 h (lane 3) indicates Wolbachia is likely an intrinsic symbiont of this predator. Sequence and Phylogenetic Analyses Sequence information between the two primer sites was obtained for the eggs of M. occidentalis (COS strain) (849 bp), adult females of M. occidentalis (Russian Select strain) (850 bp), from 1 male T. urticae (840 bp) (GenBank accession numbers U44044, U44045, and U44046, respectively). The Wolbachia sequences from the mites were similar to each other and to the Wolbachia from insects, but not to Wolbachia persica Suiter and Weiss from the fowl tick Argas persicus (Oken). Sequence similarities were calculated by aligning the sequences and dividing the number of similar

PAGE 31

25 bases by the total number of bases. Previous estimates of sequence similarity (Johanowicz and Hoy, 1996) were underestimated due to the inclusion of missing or questionable DNA sequence information. There is 99.98% sequence similarity between the Wolbachia from the COS and Russian Select strains of M. Occident alis, 99.99% similarity between the Wolbachia sequences from the COS strain of M. occidentalis and its prey T. urticae, and 99.98% similarity between the Wolbachia sequences from the Russian Select strain of M. occidentalis and T. urticae. However, because the DNA was sequenced only once, the differences could be due to Taq polymerase errors, since the base differences were in conserved areas of the 16S rRNA gene. Interestingly, the 16S rDNA from M. occidentalis and T. urticae were not more closely related to each other than they were to the type species Wolbachia pipientis from the northern house mosquito Culex pipiens L. There was 100% similarity between W. pipientis and Wolbachia from the COS strain of M. occidentalis eggs. The molecular phylogeny (based on 625 bp from the 5' end of the gene) shows that the 3 mite sequences are within the insect Wolbachia clade, and in the same subgroup as the Wolbachia from C. pipiens (Figure 2-2). There were 396 informative characters used to determine the trees. There were 4* most parsimonious trees (treelength, 926; retention index, 0.76; consistency index, 0.73). The phylogenetic tree shown in Figure 2-2 is the consensus tree, constructed by collapsing the unresolved area of the tree into a region of soft polytomies (regions of ambiguous resolution) (Maddison, 1989), which is the subgroup containing the mite sequences. Thus, it is impossible to determine

PAGE 32

26 which sequence in this subgroup is ancestral because of insufficient sequence information. Heat Treatment I was unable to detect a Wolbachia-specific PCR signal from a heattreated population of the COS strain of M. occidentalis (Figure 2-1, lane 5 ), which is normally positive. DNA extracted at the same time from 60 eggs of a colony (COS) not subjected to the heat treatment was positive (Figure 2-1, lane 4), as expected. These results provide further evidence of an intrinsic infection in M. occidentalis, since the T. urticae fed to these heat-treated mites were positive for Wolbachia. Discussion Based on the 16S rDNA analysis, the Wolbachia from M. occidentalis and T. urticae are related closely to Wolbachia from insects and not to Wolbachia persica, a microorganism found in the acarine Argas persicus (Suiter and Weiss, 1961). The primers were designed to specifically amplify W. pipientis, and because the 16S rDNA from W. persica and W. pipientis is so different (Weisburg et al, 1991), it was expected that the mite sequences would be related to Wolbachia from insects. However, it was surprising that, although there has been a long isolation between the Chelicerata (acarines) and the Mandibulata (insects) of '550 million years (Manton, 1977), the Wolbachia 16S rDNA sequences from the 2 mite species are not more similar to each other than they are to that of the Wolbachia from the more distantly related insect C.

PAGE 33

27 pipiens (Figure 2-2). While the Wolbachia from some closely related insect taxa grouped together, it is also the case that distantly related insects may have very similar Wolbachia. This lack of congruence between the evolutionary history of the arthropods and that of the Wolbachia suggests some horizontal transfer of Wolbachia between arthropod species may have occurred (Rousset et al, 1992b; O'Neill et ah, 1992) in addition to vertical transmission. However, the mechanisms of such horizontal transfer have not been identified. Wolbachia can be detected in otherwise Wolbachta-free A. reductus immediately after feeding on infected prey; therefore studies with predatory arthropods must take into account the infection status of their prey. Starving the mites for at least 4 h appears to eliminate false positive signals caused by transient infection. Based on a model of M. occidentalis feeding on T. urticae (Fransz, 1974), I calculated that 80% of the gut contents are digested within 4 h, which may be enough to bring transient Wolbachia DNA concentrations to undetectable levels. I found that starving the mites too long decreases the amount of Wolbachia detectable by the PGR, which is consistent with past studies in which the density of various symbionts from the citrus mealybug Planococcus citri (Risso) is decreased when they are starved (laccarino and Tremblay, 1970). Symbiont number is increased in the Rocky Mountain wood tick, Dermacentor andersoni Stiles, after feeding (Burgdorfer et al, 1973). Although both predator and prey contain intrinsic Wolbachia, differentiation between the two species' Wolbachia based on 16S rDNA information was not possible. The 16S rDNA region sequenced is useful for some levels of phylogenetics (Weisburg et al, 1989), but it does not allow for robust discrimination within the Wolbachia clade (O'Neill et al, 1992).

PAGE 34

28 Analysis of the entire 16S rRNA gene or of other more variable genes may have allowed a better discrimination between Wolbachia from M. occidentalis , T. urticae, and insects. Sequence information from multiple clones of the 16S rDNA PCR products, or from both strands of the PGR product may have increased the accuracy of the estimates of the differences between the Wolbachia from M. occidentalis, T. uticae, and insects. However, a more accurate estimate of these differences is unlikely to change the conclusions of this study, because this region is so conserved (O'Neill et al., 1992), and thus does not allow for fine scale analysis of Wolbachia diversity (Werren, 1997). Although all laboratory population of M. occidentalis, except one, were positive for Wolbachia by using a PCR assay, the field-collected population was not. It is possible that other field populations of M. occidentalis may be infected, but simply were not sampled. M. occidentalis populations in California almond orchards, pear orchards, and vineyards have been shown to vary in pesticide resistances (Hoy, 1985), and thus may represent partially isolated populations caused by a relatively low rate of dispersal. It also has been demonstrated that some subpopulations of Drosophila simulans are infected, whereas others are not (Hoffmann et al, 1986). High temperatures or naturally occurring antibiotics are possible reasons for these polymorphic populations (Hoffmann et al, 1990). Although Wolbachia has been confirmed in several populations of M. occidentalis, and different populations of M. occidentalis are known to exhibit partial nonreciprocal mating incompatibilities, there is no direct evidence yet that the incompatibilities actually are caused by the Wolbachia. This information would be particularly interesting because of proposals to use

PAGE 35

29 Wolbachia as a drive mechanism to insert a desired trait into a population (Beard et al., 1993). Postmating incompatibilities caused by Wolbachia may aid in releases of genetically improved strains in biological control programs (Caprio and Hoy, 1995), once more is learned about the role, impact, and spread of Wolbachia in arthropods, and especially in M. Occident alis.

PAGE 36

30 Table 2-1. Wolbachia infection status of mite populations. Species / Strain Source Positive (+) or Negative (-) PGR Results egg adult PREDATORS Amblyseius reductus A Metaseiuliis occidentalis COS" A + + Russian Selecf A + + Supermite A Hybrid Select A nf + Ave-21 A nt + Pullman Blackberry A + + WASelect A nt + Oregon Lab B nt + Visalia C nt + Griggs Apple D PREY Tetranychus urticae Florida laboratory'* A + + Oregon laboratory B nt + Ohio laboratory F nt + Visalia Insectary G nt + cotton field E nt Tetranychus tiirkestani E nt + Panonychus ulmi D nt Heat treated M. A occidentalis ^ A= lab colony, Gainesville, FL; B= lab colony, Gorvallis, OR; G= insectary, Visalia, GA; D= field, apple; E= field, cotton; F= lab colony, Golumbus, OH; ^ eggs sequenced ^ adult female sequenced "* adult male sequenced ^ nt =not tested

PAGE 37

31 Figure 2-1. Bands of the expected size, 900 bp, were amplified using Wolbachia-specific 16S rDNA primers. Lane 1, Molecular weight marker VI (Boehringer Mannheim, Germany); lane 2, M. occidentalis adult females immediately after feeding (frozen before extractions); lane 3, M. occidentalis females starved 24 h; lane 4, M. occidentalis eggs; lane 5, heat-treated M. occidentalis eggs; lane 6, T. urticae eggs; lane 7, A. reductus females fed spider mites tested immediately after feeding; lane 8, A. reductus females fed spider mites and starved for 4 h; lane 9, D. simulans positive control. Other nonspecific PGR products of much lower and higher molecular weights than expected using Wo/bac/zzfl-specific 16S primers were present in some samples.

PAGE 38

CHAPTER 3 FURTHER GENETIC CHARACTERIZATION OF WOLBACHIA FROM METASEIULUS OCCIDENTALIS AND TETRANYCHUS URTICAE USING PARTIAL FTSZ GENE SEQUENCES Introduction Previous studies indicated Wolbachia endosymbionts are present in both the predatory mite Metaseiulus {=Galendromus, Typhlodromus) occidentalis (Nesbitt) and its spider mite prey Tetranychus urticae Koch (Johanowicz and Hoy 1996; Chapter 2). A high degree of similarity between the Wolbachia 16S ribosomal DNA sequences from M. occidentalis and T. urticae (Johanowicz and Hoy 1996, Chapter 2) make it difficult to discriminate between the two types of Wolbachia in phylogenetic analyses. Additionally, PCR-based assays of predators using 16S primers are difficult to interpret because DNA extractions of adult predators may contain spider mite Wolbachia DNA as a gut contaminant (Chapter 2). The Wolbachia ftsZ gene, important in prokaryotic cell division (deBoer et al, 1990), was unexpectedly discovered during screening of a Drosophila melanogaster genomic library (Holden et al, 1993). The/fsZ gene is reported to be more variable than the 16S rRNA gene and therefore may have more power to discriminate between Wolbachia strains (Werren et al, 1995b). The purpose of this chapter was to amplify part of the ftsZ gene and to sequence it to further characterize the Wolbachia from both predator and prey 33

PAGE 39

34 mites. If the sequence information from theftsZ genes indicates variability exists between the predator and prey mite Wolbachia, PCR primers will be designed that specifically amplify only one of the two different Wolbachia. This would facilitate the PCR-based detection of Wolbachia in individual predators by allowing DNA extractions to occur from a single, unstarved adult predator rather than from a starved adult or groups of eggs. Methods Mite Maintenance and Sources Metaseiulus occidentalis were maintained at the University of Florida and reared as previously described (Roush and Hoy, 1981; Hoy et al, 1982). Tetranychus urticae were raised on pinto bean, Phaseolus vulgaris, plants in a greenhouse at the University of Florida-Gainesville. ftsZ PCR Primers Primers were designed which amplify the Wolbachia bacterial septation gene, /fsZ. Preliminary PCR tests using two sets of primers designed by Werren et al. (1995b) did not amplify Wolbachia DNA from either M. occidentalis or T. urticae. Two new primers were designed from conserved regions of the Drosophila melanogaster Wolbachia ftsZ gene obtained from Genbank to amplify 310 bp of the gene from T. urticae. The primers used to amplify Wolbachia ftsZ DNA from T. urticae are: forward ftsZ: 5'AAA CCG TTC GGT TTT GAA GGT GTG CGC CGT AT, and reverse ftsZ: 5'-GCA CTA

PAGE 40

35 ATT GCT CTA TCT TCT CCT TCT GCC. The expected size of the PGR product was approximately 310 base pairs (bp). Two different, new primers were later designed to amplify a portion of the ftsZ gene from M. occidentalis. These two new primers were designed from conserved areas outside the region that was amplified and cloned from T. urticae. This was done to reduce the risk of accidentally amplifying contaminating plasmid DNA from the cloned ftsZ gene fragments. The primers for the M. occidentalis experiment were designed to be specific to the B-group of Wolbachia, because 16S rDNA analyses placed the Wolbachia in M. occidentalis and T. urticae in that group (Johanowicz and Hoy, 1996; Chapter 2). Potential primers were designed by aligning Wolbachia ftsZ sequences from 16 species obtained from Genbank and choosing 30 bp regions conserved only in the B-group Wolbachia. The best primers from those conserved regions were chosen based on minimizing their potential secondary structure, predicted by using MacDNASIS software (Hitachi Software). Secondary structure can interfere with priming efficiency (Saiki, 1989). The primers used to amplify the Wolbachia from M. occidentalis are: ftsZfl: 5'-TAC TGA CTG TTG GAG TTG TAA CTA AGC CGT, and ft sZrl: 5'-TGC GAG TTG CAA GAA CAG AAA CTG TAA CTG. The expected size of the PGR product was approximately 570 bp. The 570 bp fragment included the complete 310 bp region from T. urticae. Polymerase Chain Reaction M. occidentalis DNA was extracted in Chelex from 10 pooled females starved at least 8 hours prior to extraction to avoid amplifying spider mite

PAGE 41

36 Wolbachia present as contaminants in the guts of these predators (Johanowicz and Hoy, 1996; Chapter 2). T. urticae DNA was extracted from individual females in Chelex as previously described, and the PCR product from three individuals was later pooled for cloning. Cycling conditions were as follows: 1 |il template DNA, 50 mM KCl, 10 mM Tris HCl, 1.5 mM MgCb, 0.2 [iM each primer (both the forward and reverse primers according to mite species), 200 |iM each dNTP, and 0.8 units of Taq polymerase in a total volume of 25 |il. Reactions were cycled 35 times at 94° C for 30 sec, and 72°C for 60 sec. Because the primers were at least 30 bp long, their theoretical was large enough so that a two-step PCR reaction using a 72° annealing and extension temperature was possible. Cloning and Sequencing The 310 bp fragment amplified and pooled from T. urticae was cloned (T-A overhang method; Mead et al, 1991) for subsequent sequencing. Four clones were sequenced. Three were identical except for one with 4 base substitutions. These base differences were not present in any other Wolbachia sequences published to date. These base differences produced a restriction enzyme recognition site specific to the enzyme Acil. Restriction digests by this enzyme of the remaining 40 clones did not indicate the site was present in any others, so it was not used in the analysis. The two 30 bp regions corresponding to the priming sites were excluded from analysis. If slight mismatches between the template and primers were initially present, the primers might still work, and the PCR product would reflect the primer

PAGE 42

37 sequences rather than the original template sequences. This left 261 bp for subsequent analyses. The 570 bp fragment amplified from the pooled sample of M. occidentalis was cloned (T-A overhang method; Mead et al, 1991) for subsequent sequencing. Four clones were sequenced. All four were identical except for 1 or 2 non-synonymous base differences in three of the clones, presumably due to Taq polymerase errors. These base differences were not present in any other Wolbachia sequences published to date and appeared in highly conserved areas of the ftsZ gene, so these clones were not used in subsequent analyses. The two 30 bp regions corresponding to the priming sites were excluded from analysis. This left 509 bp for subsequent analyses. Sequence Analysis Sequences were aligned with MacDNASIS. The sequence from T. urticae was compared to the sequence from M. occidentalis on the basis of sequence similarity. The 509 bp Wolbachia ftsZ sequence from M. occidentalis was used in subsequent parsimony analysis with an unreleased version of PAUP (with permission from the author; Swofford, 1997). With 26 Wolbachia sequences obtained from Genbank, PAUP's heuristic search algorithm with 100 bootstrap replicates (a resampling technique) was used to find the most parsimonious tree. This search method is appropriate when calculating phylogenies with large data sets (Swofford et at., 1996). A 50% consensus tree was calculated, meaning that the branching patterns which indicate an ancestry supported by at least 50% of the bootstrap replicates are kept as branches in the consensus tree. The unresolved areas, which do not support

PAGE 43

38 any ancestral pattern due to insufficient sequence information, are collapsed into unbranched regions called 'soft polytomies' (Maddison, 1989). No appropriately related /fsZ sequences were available (for example, other rickettsia) as an outgroup, which helps the computer program calculate the phylogeny more accurately (Swofford et al., 1996). Therefore, I used a technique called 'midpoint rooting', which is an appropriate solution when no reasonable outgroups exist (Swofford et al, 1996). Results The 261 bp region of the ftsZ gene amplified from T. urticae was identical to the same region of the ftsZ gene amplified and sequenced from M. occidentalis (Figure 3-1). Parsimony analysis indicated the 509 bp sequence from M. occidentalis grouped within the B-group Wolbachia. The M. occidentalis sequence was near the sequence obtained from the house mosquito Culex pipiens L., as it was when the 16S ribosomal DNA analysis was conducted (Johanowicz and Hoy, 1996; Chapter 2). TheftsZ gene from M. occidentalis was 98.4% similar to the Wolbachia sequence from C. pipiens L., corresponding to 8 bp differences (16S rDNA studies indicated they were 100% similar) and was 99.4% similar to the sequence from the grain moth Ephestia cautella (Walker), corresponding to 3 bp differences (16S rDNA studies indicated a 99% similarity). The 50% consensus tree shows the ftsZ sequence of Wolbachia from M. occidentalis is located in an unresolved area (Figure 3-1). Out of 509 characters (nucleotide bases), 62 were determined by PAUP to be 'parsimony

PAGE 44

39 informative', meaning they provided the appropriate amount of variability to be useful in calculations of the phylogenetic estimates. The other bases were either completely identical in all taxa (447 bases) or displayed too much variation (16 bases) to be useful in the analysis. The tree-length was 129, which is a summation of the least number of base changes needed to explain the variations in DNA sequences. The consistency index was 0.64 and the retention index was 0.89. These indices give the relationship between the number of conceivable and observed base changes in the data set, and the closer the value is to one, the better the tree predicts the most likely evolutionary pattern (Maddison and Maddison, 1992). Discussion The 261 bp fragment of the Wolbachia ftsZ gene obtained from both the predator and prey mites were identical. This ruled out the possibility of designing species-specific Wolbachia PCR primers for use on unstarved predator adults based on this sequence information. The 509 bp portion of the Wolbachia ftsZ gene used to compare M. occidentalis with other arthropods did not provide more resolving power than the sequence information from the 16S rRNA gene (Figure 2-2 in Chapter 2). The 509 bp from the predator ftsZ sequence used in this phylogenetic analysis left regions of unresolved ambiguity in the subgroup where the M. occidentalis Wolbachia sequence was positioned, just as in the earlier 16S rDNA phylogeny.

PAGE 45

40 Because the sequences from various arthropods within this unresolved area are quite similar, no conclusions can be dravv^n regarding the possibility of a horizontal transfer of Wolbachia between the predator and prey mites. Sequence information from the eggs of M. occidentalis might have confirmed that the DNA amplified from the starved adults was only from their own Wolbachia. However, upon realizing that the ftsZ region used was so conserved, no further sequencing was conducted. Sequence information ? 1 from a more variable region of the ftsZ gene, perhaps from part of the noncoding region or a longer stretch of the coding region, may be needed to discriminate between the Wolbachia in M. occidentalis and T. urticae and assess the possibility of horizontal transfer of the symbiont between these ^ ecologically-related species. i Taxonomically-distinct arthropods (Isopoda, Acari, Lepidoptera, Orthoptera, Coleoptera, and Diptera) host Wolbachia strains with similar ftsZ gene sequences as shown in Figure 3-2. Unless horizontal transfer of Wolbachia has occurred between distinct arthropod species, the Wolbachia from these hosts are probably different strains with more genetic variability than can now be detected. Efforts are under way to sequence other genes in Wolbachia (Werren, 1997). Sequence information from other, more variable genes might more accurately determine the similarity of Wolbachia obtained from various arthropod species and populations. I 4

PAGE 46

41 C. pipiens M. occidental is T. urticae 453 CGGTTTTGAA GGTGTGCGAC GTATGCGCAT TGCAGAGCTT GGACTTGAAG CGGTTTTGAA GGTGTGCGAC GTATGCGCAT TGCAGAGCTT GGACTTGAAG GCGCAT TGCAGAGCTT GGACTTGAAG C. pipiens M. occidentalis T. urticae AGTTGCAAAA ATACGTAGAT ACACTTATTG TCATTCCCAA TCAAAATTTA AGTTGCAAAA ATATCTAGAC ACACTTATTG TCATTCCCAA TCAAAATTTA AGTTGCAAAA ATATGTAGAC ACACTTATTG TCATTCCCAA TCAAAATTTA C. pipiens M. occidentalis T. urticae TTTAGAATTG CTAACGAGAA AACTACATTT GCTGACGCAT TTCAACTCGC TTTAGAATTG CTAACGAGAA AACTACATTT GCTGACGCAT TTCAACTCGC TTTAGAATTG CTAACGAGAA AACTACATTT GCTGACGCAT TTCAACTCGC C. pipiens M. occidentalis T. urticae CGATAATGTT CTACATATTG GCATAAGAGG AGTAACTGAT TTGATGATCA CGATAATGTT CTACATATTG GCATAAGAGG AGTAACTGAT TTGATGATCA CGATAATGTT CTACATATTG GCATAAGAGG AGTAACTGAT TTGATGATCA C. pipiens M. occidentalis T. urticae TGCCAGGACT GATTAATCTT GATTTTGCTG ATATAGAAAC AGTAATGAGT TGCCAGGACT GATTAATCTT GATTTTGCTG ATATAGAAAC AGTAATGAGT TGCCAGGACT GATTAATCTT GATTTTGCTG ATATAGAAAC AGTAATGAGT C. pipiens M. occidentalis T. urticae GAGATGGGTA AAGCAATGAT TGGTACTGGA GAGGCAGAAG GAGAAGATAG GAGATGGGTA AAGCAATGAT TGGTACTGGA GAGGCAGAAG GAGAAGATAG GAGATGGGTA AAGCAATGAT TGGTACTGGA GAGGC C. pipiens M. occidentalis T. urticae GGCAATTAGT GCTGCAGAGG CTGCGATATC TAATCCATTG CTTGACAATG GGCAATTAGT GCTGCAGAGG CTGCGATATC TAATCCATTA CTTGATAATG C. pipiens M. occidentalis T. urticae TATCAATGAA AGGTGCOCAA GGAATATTGA TTAATATTAC TGGTGGTGGA TATCAATGAA AGGTGCACAA GGAATATTGA TTAATATTAC TGGTGGTGGA C. pipiens M. occidentalis T. urticae GATATGACTC TATTTGAAGT TGATTCTGCA GCAAATAGAG TGCGTGAAGA GATATGACTC TATTTGAAGT TGATTCTGCA GCCAATAGAG TGCGTGAAGA C. pipiens M. occidentalis T. urticae AGTGGATGAA AATGCAAATA TAATATTTGG TGC TACTTTT GATCAGGCGA AGTGGATGAA AATGCAAATA TAATATTTGG TGCCACTTTT GATCAGGCGA C. pipiens M. occidentalis T. urticae TGGAAGGAA . TGGAGGGAA. 962 Figure 3-1. Sequence alignment of a partial Wolbachia ftsZ gene from Ciilex pipiens (the type species Wolbachia), Metaseiulus occidentalis, and Tetranychus urticae. Bold italic print highlights the differences in nucleotide composition.

PAGE 47

42 Bgroup Wolbachia Agroup WoWachia Nasonia giraulti Hymenoptera Protocalliphora sp. Diptera Aedes albopictus Diptera Armadillium milgare Isopoda Culex pipiens Diptera Ephestia caiitella Lepidoptera Metaseiulus occidentalis Acnii Gryllus pennsylvanicus Orthoptera TriboHum confusum Coleoptera Nasonia vitripennis Hymenoptera Trichogramma cordubensis Hymenoptera Trkhogramma debn Hymenoptera Trichogramma brevicomis Hymenoptera Aramigus tesselatus Isopoda Sitophilus oryzae Coleoptera Encarsia fortwsa Hymenoptera Tricopria drosophilae Hymenoptera Drosophila recens Diptera Anastrepha suspensa Diptera Aphytis yananensis Hymenoptera Cossonus sp. Coleoptera Drosophila sechellia Diptera Drosophila simulans Diptera Drosophila orientacea Diptera Muscidifurax uniraptor Hymenoptera Mellitobia sp. Hymenoptera Figure 3-2. Consensus phylogenetic tree constructed from 509 bp of the Wolbachia ftsZ gene. The sequence from M. occidentalis is situated in a region of unresolved ambiguity.

PAGE 48

CHAPTER 4 EXPERIMENTAL INDUCTION AND TERMINATION OF NONRECIPROCAL REPRODUCTIVE INCOMPATIBILITIES IN A PARAHAPLOID MITE Introduction Reproductive incompatibilities have been detected in various phytoseiid mites, including Metaseiidus {=Typhlodromus, Galendromus) occidentalis (Nesbitt), a biological control agent of the two spotted spider mite, Tetranychus urticae Koch. Associated with these intraspecific reproductive incompatibilities between different populations were shriveled eggs, low numbers of eggs, low survival of immature stages, and reduced fecundity in surviving Fi individuals (Croft, 1970; Hoy and Knop, 1981; Hoy and Standow, 1982; Hoy and Cave, 1988). Croft (1970) detected reciprocal reproductive incompatibilities (females from both of the two populations being crossed are incompatible with males from the different population) and nonreciprocal reproductive incompatibilities (females from only one of the two populations being crossed are incompatible with males from the other population) in crosses of M. occidentalis from California, Utah, and Washington. When Hoy and Knop (1981) crossed a laboratory selected permethrin-resistant strain of M. occidentalis with its original base colony, few eggs were produced and many were shriveled and failed to develop in one cross while the reciprocal cross was compatible. They also found that a partially permethrin-resistant strain was nonreciprocally incompatible with its base colony after only one 43

PAGE 49

44 year of selections. Similar nonreciprocal reproductive incompatibilities were found in crosses with sulfur-resistant M. occidentalis (Hoy and Standow, 1982). In a later study, Hoy and Cave (1988) detected nonreciprocal partial reproductive incompatibilities between five colonies of M. occidentalis. Other examples of nonreciprocal incompatibilities in phytoseiids were found in Typhlodromiis annectens DeLeon (McMurtry and Badii, 1989) and in two populations of Amblyseius addoensis van der Merwe and Ryke from South Africa (McMurtry, 1980). Nonreciprocal reproductive incompatibilities are one of the effects associated with the presence of Wolbachia endosymbionts in a diverse array of Arthropoda, including insects (Mandibulata: Insecta), isopods (Mandibulata: Crustacea) and spider mites (Chelicerata: Arachnida) (reviewed by Werren, 1997). These small, fastidious, rickettsia-like symbionts are located intracellularly in the infected arthropods and are maternally-inherited through the egg cytoplasm. Infected females can successfully reproduce when crossed with infected or non-infected males, but crosses between uninfected females and infected males yield various phenotypes associated with the incompatibility, which varies depending upon the genetic system of the species. The incompatibilities are expressed as reduced numbers of viable progeny (both sexes) in diplo-diploid insects (Laven, 1951; Yen and Barr, 1974; Hoffmann et al, 1986; Hsiao and Hsiao, 1985; Wade and Stevens, 1985; Giordano et al, 1995), reduced numbers of diploid females in haplodiploid insect parasitoids and an increased complement of haploid males (the females become haploid males) (Ryan and Saul, 1968; Breeuwer and Werren, 1990), and reduced numbers of females (with the normal complement of male

PAGE 50

45 progeny) in some strains of the haplo-diploid spider mite Tetranychus urticae (Vala and Breeuwer, 1996). The cytogenetic mechanism by which Wolbachia affects embryonic development and sex ratio appears to involve either a loss of the paternally derived chromosomes or aberrations in the paternal pronuclei early in embryonic development (Werren, 1997). Rickettsia-like microorganisms w^ere detected in the eggs and ovaries of the phytoseiid mite M. occidentalis by transmission electron microscopy (Hess and Hoy, 1982), which led Hoy and Cave (1988) to conclude that some of the incompatibilities seen in previous studies might be microorganism-mediated. Molecular analyses with Wolbachia-specihc 16S ribosomal DNA Polymerase Chain Reaction (PCR) primers indicated Wolbachia is present in many, but not all, of the M. occidentalis populations examined (Johanowicz and Hoy, 1996; Chapter 2). Phylogenetic analysis of the 16S ribosomal DNA (Johanowicz and Hoy, 1996; Chapter 2) indicated the Wolbachia in M. occidentalis are genetically similar to the Wolbachia found in the insect Culex pipiens L. and in the spider mite Tetranychus urticae. Although Wolbachia have been detected in mites (Johanowicz and Hoy, 1995; 1996; Chapter 2; Breeuwer and Jacobs, 1996; Tsagkarakou et ah, 1996), relatively little is known about the biological effects of Wolbachia in parahaploid phytoseiids. In insects (Arthropoda: Mandibulata: Insecta) and isopods (Arthropoda: Mandibulata: Crustacea), the effects of Wolbachia have been reversed with antibiotic or heat treatments (Yen and Barr, 1973; Richardson et al, 1987; O'Neill, 1989; Breeuwer and Werren, 1990; Stouthamer et al, 1990b; Louis et al, 1993). Heat-treatment also reduced the presence of Wolbachia to

PAGE 51

46 undetectable levels in M. occidentalis (Arthropoda: Chelicerata: Arachnida) (Johanowicz and Hoy, 1996; Chapter 2). Crosses between infected and uninfected individuals are a standard technique used in studies of Wolbachia in insects (Werren, 1997). Crosses between inbred laboratory populations of M. occidentalis differing in the presence or absence of Wolbachia due to heat-treatment should allow a correlation between the presence of Wolbachia and nonreciprocal incompatibility. Using inbred lines of M. occidentalis reduces the effects of nuclear genetic differences that might cause premating incompatibilities which could confound measures of Wolbachia-mediated cytoplasmic incompatibility. The objectives of this chapter were: 1) determine whether uninfected M. occidentalis females are incompatible with males containing Wolbachia, 2) determine whether compatibility between the infected males and cured females can be restored if the males are later cured, and 3) correlate any incompatibilities with the presence of Wolbachia. Methods Mite Maintenance and Sources Metaseiulus occidentalis were maintained at the University of Florida and reared as previously described (Roush and Hoy, 1981; Hoy et al, 1982). A colony of two spotted spider mites was raised on pinto bean, Phaseolus vulgaris L., plants in a greenhouse at the University of Florida-Gainesville. An inbred, isofemale line of M. occidentalis was initiated three months prior to the

PAGE 52

47 study by isolating one gravid female, allowing her progeny to sib mate, removing one gravid female, and repeating this procedure for four generations at 24°C. M. occidentalis is tolerant of inbreeding (Hoy, 1977; BruceOliver and Hoy, 1990), and this procedure allowed reduction of differences in the nuclear genome as factors in the subsequent experiments. Two of the resulting gravid generation five (G5) females were used to initiate two new lines; one line (RT) was maintained at normal rearing temperatures (24°C) and the second line was held at 33°C for at least 8 generations (HT). Temperatures >30°C administered for a few generations reduce or eliminate Wolbachia in some insects (Stevens, 1989; Stouthamer et al, 1990a; Girin and Bouletreau, 1995; Louis et al, 1993). A third colony (R->H) was later initiated by removing 100 gravid females from the inbred RT line, allowing them to mate inter se while maintaining them at 33°C for at least 10 generations. This line was used to test whether compatibility could be restored between it and the original HT line. Experiment 1: Tests for Incompatibilities Crosses were conducted on 4.2 cm pinto bean leaf discs on water soaked cotton. The leaf discs were infested with all stages of spider mites as prey. Experiments were performed under constant light at 22-24°C and 4565% RH. M. occidentalis eggs or newly eclosed larvae were isolated on leaf discs with prey, allowed to mature to adults, and sexed. Single pairs of oneto two-day-old adult virgin females and males were introduced on the first of a series of four leaf discs, where they were allowed to mate and deposit their first eggs. The females then were moved to new leaf discs daily for a total of

PAGE 53

48 four days. The location of the eggs was marked daily with India ink to make relocating them easier. The number of shriveled eggs, surviving progeny, and developmental stage of the progeny were recorded each day. The progeny sex ratio was determined by recording the sex of adult progeny. Twelve single pair crosses (female x male) of each of the four crossing types were made: (HT x RT, RT x HT, HT x HT, and RT x RT) (Figure 3-1), for a total of 48 crosses. Females which never became gravid were excluded from analysis. Crosses which did not yield adults were excluded from the sex ratio analysis. Data were analyzed by one-way ANOVA and pairwise comparisons were made with Scheffe's procedure (StatView; Abacus Concepts, 1992) at alpha <0.05. Experiment 2: Tests for Restored Compatibility Methods were similar to those of the previous experiment, except temperatures and relative humidities were between 23°-25°C and 50-70% RH. Because it was difficult to differentiate between shriveled predator eggs and partially-consumed spider mite eggs (Figure 4-2), the number of shriveled M. occidentalis eggs in the experiments may be underestimated. The subpopulation of RT mites subjected to heat-treatment (R~>H) were crossed with both the HT and RT lines to determine whether incompatibilities between HT females and RT males would disappear when substituting R~>H males, and whether new incompatibilities would appear between R->H females and males from its (RT) base colony. Twelve single pair crosses of each of the nine crossing types were made (HT x RT, RT x HT, RT X R->H, R->H X RT, R->H x HT, HT x R->H, HT x HT, RT x RT and R-

PAGE 54

49 >H X R->H) (Figure 4-1) which resulted in a total of 108 single pair crosses. Data were analyzed by one-way ANOVA and pairwise comparisons were made with Scheffe's procedure at alpha <0.05. Infection Status The PCR was used before the first experiment to test the infection status of the RT and HT lines with Wolbachia-specihc PCR primers which amplify the 16S ribosomal DNA gene. PCR conditions were as previously described (Johanowicz and Hoy, 1996). DNA from five starved females was pooled for each PCR reaction in an effort to increase the amount of Wolbachia DNA and reduce false negatives due to possible low titers of this symbiont in these tiny (0.3 X 0.15 mm) mites. Three PCR reactions each were performed on the RT and HT lines. Primers which amplify the ftsZ gene of Wolbachia were used to evaluate the infection status of individual females after the second experiment was completed. Three primers were designed for a hemi-nested amplification to increase sensitivity and to be specific to B-group Wolbachia because 16S rDNA analyses place the Wolbachia inM. occidentalis in that group (Johanowicz and Hoy, 1996; Chapter 2). A-group specific /fsZ primers did not amplify DNA in M. occidentalis (unpublished data). New primers were designed by aligning Wolbachia ftsZ sequences obtained from Genbank and choosing areas conserved in B-group Wolbachia. The primers used were ftsZfl: 5'-TAC TGA CTG TTG GAG TTG TAA CTA AGC CGT,/fsZf2: 5'GGA GAA GAT AGG GCA ATT ACT GCT GCA GA, and ftsZrl: 5'-TGC CAG TTG CAA GAA CAG AAA CTC TAA CTC.

PAGE 55

50 DNA was extracted from the eggs of single, isolated females by allowing adult females to lay eggs for 3 days; the resultant 5-7 eggs were collected, pooled, and extracted in 25 |j.l Chelex (Johanowicz and Hoy, 1996). This procedure allowed estimates of the proportions of infected females without the risk of amplifying contaminating spider mite Wolbachia DNA from the digestive tract of the predators (Johanowicz and Hoy, 1996; Chapter 2). Eggs from 20 RT, 10 HT, and 10 R-->H females were tested. Cycling conditions for the first round of amplification were as follows: 1 ^il template DNA, 50 mM KCl, 10 mM Tris HCl, 1.5 mM MgCl2, 0.2 ^iM each primer (ftsZfl and/fsZrl), 200 \lM each dNTP, and 0.8 units of Taq polymerase in a total volume of 25 |j.l. Reactions were cycled 35 times at 94°C for 30 sec, and 72°C for 60 sec. Cycling conditions for the second round of amplification were the same as above, except 1 |il of the previously amplified DNA was used as the template, and primers ftsZfl and ftsZrl were used, producing a PCR product of approximately 250 bp. Reagent-negative controls were included in the reactions. Results Induction of Incompatibility Nonreciprocal reproductive incompatibility was induced in crosses between the HT (cured) females and RT (infected) males. This cross resulted in reduced numbers of eggs /female /day (mean ± s.d. = 0.2 ± 0.2) compared to the reciprocal cross (2.0 ± 0.8), and the maternal (2.0 ± 0.4) and paternal control (1.7 ± 0.8) crosses. Higher percentages of shriveled eggs (62.5% ± 51.7)

PAGE 56

51 were produced compared to the reciprocal (1.4% + 4.2), maternal (0%), and paternal control crosses (2.2% ± 7.0) (Table 4-1). Figure 4-2 illustrates the appearance of shriveled eggs. Only male progeny were produced in the incompatible crosses between HT females and RT males. Both males and females were produced in the reciprocal (RT x HT) and control crosses (Table 4-1). The sex ratio in the RT x RT (infected) control crosses was more malebiased (62% males, Table 4-1) than expected (33% males) (Lee and Davis, 1968; Nagelkerke and Sabelis, 1991). Though there is a difference in sex ratio, there was not a statistically-significant difference in the number of eggs/ female/ day between the infected control crosses (1.7 ± 0.8) and the uninfected control crosses (2.0 ± 0.4). Restoration of Compatibility Incompatibilities similar to those observed in the first experiment (skewed sex ratio, shriveled eggs, reduced numbers of progeny) were detected in the crosses of HT females x RT males (Table 4-2). New incompatibilities were induced in the R->H female x RT male crosses, as expected, with females producing reduced numbers of eggs/female/day (0.8 ± 0.4), increased proportions of shriveled eggs/female/day (72.9% ± 32. 8), and no female progeny. The reciprocal crosses (RT female x R~>H male) produced a mean of 1.8 ± 0.5 eggs/female/day, only 4.7% ± 6.1 of those eggs shriveled, and 52% of the adult progeny were females. R~>H (cured) females crossed with HT (cured) males and the reciprocal cross (HT female x R~>H male) were compatible, as expected

PAGE 57

52 (Table 4-2). The mean number of eggs/female/ day in the crosses was 2.8 ± 0.2 and 2.6 + 0.4, respectively, and the mean percentage of shriveled eggs was 2.8% ± 6.6 and 1.7% + 3.7, respectively. The compatibility of HT females with RT males was therefore restored in experiment two when the males were subsequently heat-treated (R->H) (Table 4-2). These results indicate the incompatibilities are due to a heat-sensitive cytoplasmic factor, and are not due to nuclear genetic differences. As in experiment 1, the sex ratio in the RT x RT crosses was more malebiased (59% males) than expected (Table 4-2), so two crosses determined to be incompatible based on a compatibility index were excluded in an additional analysis. The compatibility index was calculated as: (the number of viable eggs + number of daughters number of shriveled eggs) ^ 10. Crosses were scored as compatible if the Compatibility Index was greater than 0.35 and incompatible (uninfected) when less than 0.35. The threshold value of 0.35 clearly separated the two types. The appearance of an unexpected incompatible cross could be due to imperfect maternal transmission of the Wolbachia to a daughter, which is known to happen in insects (Turelli et al, 1992). The percentage of males initially calculated as 59.4 ± 22.3 changed to 50.4 ± 10.9. This male-biased sex ratio is still higher than expected, but not significantly higher than the cured control crosses. However, as in the previous experiment (after eliminating the two unexpected "incompatible" crosses), the mean number of eggs/ female/ day in the infected (RT x RT) control crosses (2.06 ± 0.4) was not significantly different than in the HT x HT (2.36 + 0.45) and R->H (2.35 ± 0.68) uninfected control crosses at alpha < 0.05.

PAGE 58

53 Infection Status The initial PCR tests were in agreement with past studies (Johanowicz and Hoy, 1996; Chapter 2). All three pooled samples from mites held at 24°C (RT) were positive for Wolbachia by the PCR, and the line reared at 33°C (HT) had undetectable amounts of Wolbachia in all three of the samples tested. The PCR assay with /^sZ primers at the end of the second experiment indicated none of 10 HT females were positive for Wolbachia as expected, none of 10 R— >H females were positive as expected, and 12 of 20 RT females were positive. Possible reasons why 8 of the 20 RT females were not positive include loss of the symbiont in some individuals over time due to laboratory rearing stresses (crowding and /or nutritional stresses affect Wolbachia density in Drosophila simiilans (Sinkins et al., 1995a)), or low symbiont titers in the minute eggs of the individuals and subsequent failure of the PCR. Discussion These experiments demonstrate that the temperature at which M. occidentalis is reared can be used to induce or eliminate nonreciprocal reproductive incompatibility associated with the presence or absence of Wolbachia in M. occidentalis. Incompatibility was induced between HT (cured) females and RT (infected) males of an inbred line. Compatibility between the two lines was subsequently restored when the males from the roomtemperature line were heat treated (R-->H) and crossed with the HT females. The nonreciprocal nature of the incompatibilities and the ability to restore

PAGE 59

54 compatibility indicates a heat-sensitive cytoplasmic agent is responsible for the observed results. One cytoplasmic difference associated with the incompatibility is the presence or absence of Wolbachia endosymbionts as assayed by the PCR. The PCR results indicate Wolbachia is present in the RT line and eliminated in the HT mites. Although there could be some other unknown cytoplasmic factor responsible for the observed results, the data are consistent with what is currently known about the effects of Wolbachia on reproductive incompatibilities in insects. Wolbachia-mediated incompatibilities in arthropods have various effects on progeny number and sex ratio based on the genetic system and the taxonomic group. M. occidentalis (Arachnida: Acari: Gamasida: Phytoseiidae) has a genetic system called parahaploidy (Hoy, 1979), which is sometimes termed pseudoarrhenotoky (Schulten, 1985). In parahaploidy, the embryos destined to become males are derived from fertilized eggs, but at the onset of the reductional division 24-48 hours after egg deposition, one set of chromosomes (most likely the paternal set) becomes heterochromatinized and excluded from the nucleus, producing a haploid male (Nelson-Rees et al, 1980). Female embryos remain diploid. The incompatibility phenotype resulted in reduced progeny production, as in diplo-diploid insects (e. g. Insecta: Diptera, Coleoptera), and skewed, highly male-biased sex ratios, as in haplo-diploid insects (e. g. Insecta: Hymenoptera) and the mite T. urticae (Arachnida: Acari: Actinedida: Tetranychidae). Because Wolbachia-mediated incompatibilities cause the destruction of the paternal set of chromosomes in insects (Werren, 1997), and because adult males rather than females were produced in some of the crosses, these crosses

PAGE 60

55 may provide further evidence that the paternal set of chromosomes is the set which is ehminated during the embryonic development of these parahaploid mites (Hoy, 1985). The reduced numbers of male progeny produced may be due to the effects of Wolbachia on the paternal set of chromosomes very early in development. Hoy (1979) found both the maternal and paternal sets are initially necessary for normal development in M. occidentalis males. The fertility of the few surviving male progeny is unknown. The presence of incompatibilities, like those due to Wolbachia infection, have potentially interesting consequences for biological control programs. Some of the results are similar to those seen in previous hybridization studies where two phytoseiid populations were crossed to determine their species status (Croft, 1970; McMurtry et al, 1976; McMurtry, 1980; McMurtry and Badii, 1989). It may be important to consider whether Wolbachia-mediated or heat-induced incompatibilities occur when crossing mites from different origins or environmental conditions. Variations in presence, absence, or density of this symbiont have been detected in field populations of insects, perhaps due to naturally-occurring antibiotics (Hoffmann et al, 1990), high temperatures, or diapause (Perrot-Minnot et al, 1996). Wolbachia density may affect expression of incompatibility in some insects (Breeuwer and Werren, 1993, Sinkins et al, 1995a). Two PGR surveys for Wolbachia in phytoseiids found both infected and uninfected populations in the field and in the laboratory, (Breeuwer and Jacobs, 1996; Johanowicz and Hoy, 1996; Chapter 2), which could account for some of the previous reports of nonreciprocal incompatibilities in crosses between phytoseiid populations.

PAGE 61

56 Despite extensive inbreeding for these experiments, the reproductive parameters (egg production, immature mortality) measured in the parental crosses appear normal. Previous studies by Hoy (1977) also found that this species is tolerant of inbreeding. There was, however, a slight male-bias in the sex ratio of the RT parental control crosses (Tables 4-1 and 4-2). This could be due to the inclusion of a few unexpected incompatible control crosses in the analysis. Imperfect maternal transmission of the symbiont to the females used in the incompatible crosses may be responsible for the unexpected incompatibilities, as has been demonstrated in Drosophila simulans Sturtevant (Turelli et al, 1992). After removing those RT control crosses determined to be incompatible, the bias did not decline in the first experiment (both nearly 62% males), but it did decline in the second experiment, from approximately 60% males to slightly more than 50% males, which is still higher than expected. Following theoretical predictions by Hamilton (1967) and Nunney (1985) based on inbreeding potential and local mate competition, sex ratios should be female-biased as an adaptive response to low foundress density in a subdivided population structure. A subdivided population structure is common in phytoseiids which specialize in patchily distributed spider mites (Sabelis and Nagelkerke, 1993). Therefore, a female biased sex ratio is expected to occur in M. occidentalis. The sex ratio of M. occidentalis can be as high as 50% male in the laboratory (Lee and Davis, 1968), but is usually female-biased, with approximately 33% males (Bruce-Oliver and Hoy, 1990; Tanigoshi et al, 1975). Nagelkerke and Sabelis (1991) found similar female-

PAGE 62

57 biased sex ratios of M. occidentalis when the mothers were isolated on their own leaf arenas. The male-bias declined (60% -> 35%) after the RT line was subjected to heat (R-->H). This indicated a nuclear genetic component was not responsible for the bias. In addition, the bias was not due to the mothers having "precise control" of their progeny sex ratio as a response to prey and conspecific density, as observed by Nagelkerke and Sabelis (1991), because all of these crosses had similar prey density and other environmental conditions. Rather, a heat-sensitive cytoplasmic factor, most likely Wolbachia, is responsible for the reduced production of daughters in the infected mites. Fecundity losses associated with Wolbachia infection have been detected in insects (Hoffmann and Turelli, 1988), and these results suggest that in addition to the induction of nonreciprocal reproductive incompatibility, there also may be negative fitness costs due to Wolbachia infection in M. occidentalis.

PAGE 63

58 Table 4-1. Experimental induction and termination of Wo/foflc/z/fl-mediated incompatibility in an inbred line of M. occidentalis by heat-treatment. One sub-population was reared normally at 25°C (RT) and one was reared at 33°C (HT). Same letters in a column following means are not significantly different at alpha <0.05 using Scheffe's procedure. Mean Mean % Mean % Mean no. Mean no. Mean TvDG DroduciriP' no. eggs eggs immature nroducinff female male /o eggs/ total / day shriveled deaths adults progeny progeny males Female no. crosses (s.d.) Cs d \o.u..) / r'Trvcc / L.1 L/oo X Male (s.d.) (s.d.) LLXuci iirlcrlLUL y^iUDjcj HTvRT* 8/11 0.2a 62.5a Oa 2 Oa 1.0a 100.0a (0.2) (51.7) RTxHT 9/10 2.0b 1.4b 5.9ab 9 4.1b 3.7b 47.8bc (0.8) (4.2) (9.6) (1.4) (1.4) (13.4) Control Crosses HTxHT 12/12 2.0b Ob 5.2ab 12 4.6b 2.7ab 35.4b (0.4) (11.3) (1.7) (1.6) (20.6) RTxRT 10/12 1.7b 2.2b 16.9b 10 2.6ab 3.8b 61.6c (0.8) (7.03) (14.11) (1.5) (0.8) (17.1) F-value 22 2** 14.5** 4.2 9.1** 4 9** 12.7** expect incompatibilities one-way analysis of variance significantly different p<0.01

PAGE 64

59 Table 4-2. Compatibility can be restored and new incompatibility can be induced by heat-treatment of M. occidentalis. Cross No. crosses Mean iviean /o ivican /o Lw. crosses ivicdn riu. IVltfall IIUIVlcdll Type producing no. eggs immature producing female male /o eggs/ total eggs/ shriveled deaths adults progeny progeny males Female no. crosses day (s.d.) (s.a.) 1 cross / cross X Male (s.d.) (s.d.) (s.d.) Experimental Crosses HTvRXa 10/11 0.9* 91.7* 0 2 1.5 100.0* (0.4) (18.0) (0.7) RTxHT 12/12 2.0* 15.9* 17.2 12 3.3* 2.1 40.0* (0.6) (26.8) (20.4) (2.0) (1.6) (30.9) RTxR-H 10/10 1.8* 4.7* 7.0 10 3.4* 2.9 48.2* (0.5) (6.1) (13.4) (1.6) (0.9) (11.5) R-HxRXa 12/12 0.8* 72.9* 2.1 6 0* 13 100.0* (0.4) (32.8) (7.2) 0 (0.5) R-HxHT 10/10 2.8 2.8 13.2 10 5.4 4.0 44.4 (0.2) (6.6) (12.0) (2.3) (1.5) (19.2) HTxR-RD 11/11 2.6 1.7 7.7 11 55 4.0 42.0 (3.7) (8.5) /-I r\ (1.5) (1.5) (11.5) Control Crosses HTxHT 12/12 2.4 0.8 10.6 12 4.5 3.8 45.4 (0.5) (7.9) (15.7) (1.5) (1.4) (9.8) RTxRT 11/11 1.9 7.7 12.0 11 2.7 3.2 59.4 (0.6) (11.5) (13.0) (1.7) (0.9) (22.3) R-HxR-H 12/12 2.4 0.00 20.5 11 5.5 2.9 37.6 (0.7) (30.1) (2.2) (1.0) (22.3) F-value 23.8** 47.9** 1.9 9.2** 4.7** 8.7** * following mean indicates significant differences between reciprocal crosses using Scheffe's procedure at alpha <0.05. s/ expect incompatibilities fc-/ expect restoration of compatibiHty

PAGE 65

60 Figure 4-1. Pattern of compatibility between populations: * indicate crosses expected to be incompatible, 4 indicate crosses expected to regain compatibility, and < indicate compatible crosses. RT= mites reared at room temperature (infected), HT = cured mites, R->H = cured mites.

PAGE 66

61 Metaseiulus occidentalis normal shriveled Tetranychus urticae normal partially-consumed 0.1 mm Figure 4-2. Normal and shriveled eggs of M. occidentalis. Normal T. urticae eggs and shriveled eggs after being partially consumed by M. occidentalis.

PAGE 67

CHAPTER 5 WOLBACHIA INFECTION DYNAMICS IN EXPERIMENTAL LABORATORY POPULATIONS OF METASEIULUS OCCIDENTALIS Introduction Wolbachia symbionts are responsible for numerous reproductive alterations in arthropods, including nonreciprocal reproductive incompatibilities between uninfected females and infected males (reviewed by Werren, 1997). When both infected and uninfected individuals are present in a population, these nonreciprocal incompatibilities translate into a selective advantage to infected females (Caspari and Watson, 1959; Turelli and Hoffmann, 1991). This is because infected females can reproduce normally with any male they encounter, while uninfected females mated with infected males produce few or no progeny. Since Wolbachia is transovarially transmitted, the reproductive advantage of infected females theoretically acts to rapidly increase the prevalence of Wolbachia infected hosts in a population (Caspari and Watson, 1959; Fine, 1978; Hurst, 1991; Stevens and Wade, 1990; Hoffmann et al, 1990; Turelli and Hoffmann, 1991). Caspari and Watson (1959) developed a set of theoretical, analytical models describing the dynamics and equilibria of the "incompatibility factor", now known to be Wolbachia. They assumed total incompatibility between the proportion of males infected (designated by the letter "a") and the proportion of uninfected females {"b"), panmixis, a 1:1 sex 62

PAGE 68

63 ratio, complete maternal transfer, and a fecundity benefit (S) was associated with the uninfected type (that is, a fecundity cost to those infected). Their equation to predict the prevalence of b (uninfected) females in the following generation b' is written as Z,<) = ^ Sb-+ab + a^ which can be rewritten using the more common terms to describe the HardyWeinberg law (Roughgarden, 1979). Here, p,proportion of infected individuals at time t, q^ = \-p^proportion of uninfected individuals at time t, and wis the fitness cost associated with infection (w, < 1), and is written as A., = "^^^ arid p + q = \ (1) Note the lack of a "2pq" term in the denominator to describe the frequency of the "hybrids" in a population, as is the case in Hardy-Weinberg equilibria when both hybrids are the same. In the case of YJolhachia-'mdnced incompatiblities, one of the hybrids is inviable, and the other hybrid carries the Wolbachia. Caspari and Watson's model predicts that if there is a fitness cost to infection then, using the form in equation (1), there are three equilibrium points (pV for p, the frequency of Wolbachia infection. These are p*= (0, 1-w, 1). Zero and one are stable, attracting points, with the unstable threshold point, 1w, in between. If we start with p below 1-w, then the system is attracted to zero frequency of Wolbachia infection; if we start with p above 1-w, the system is attracted to fixation of Wolbachia at frequency one. Models by Fine (1979) and Hoffmann et al. (1990) expand on Caspari and Watson's initial work with algebraically similar models, but include three

PAGE 69

64 important parameters which affect the stable and unstable equilibria. One parameter is the proportional failure of a mother to transmit Wolbachia to her offspring (imperfect maternal transmission; ^). The second is the proportion of progeny produced by the incompatible crosses relative to the compatible crosses, called "hatchability" (H). The third is the relative fitness of infected matings relative to uninfected matings (F), usually measured in terms of productivity (Hoffmann et ah, 1990; Turelli and Hoffmarm, 1995). In these models, one stable point is zero, and the other moves away from fixation, so both infected and uninfected individuals can coexist in a population if there is imperfect maternal transmission. The models by Fine (1979) and Hoffmann et al. (1990) also predict unstable frequencies, which would prevent Wolbachia from spreading through a population if it is sufficiently rare. The more elaborate model by Hoffmann et al. (1990), which takes into account a modified dynamical behavior due to inclusion of the additional parameters, predicts that (2) \-s^p,-s,p,{\p,)-^s,p, {\-Sf) where Sf 1 f ; s,, = 1 H; and proportion of infected individuals. The equations describing the stable {p^) and unstable equilibria {p^ are therefore " o n ,.L (3) and 2s^{\-^F)

PAGE 70

65 Again, the unstable frequencies are sensitive to the fitness costs of infection (Turein and Hoffmann, 1995). Laboratory studies have documented the "spread" of Wolbachia in population cage studies (Hoffmann et al, 1990; Sinkins et al, 1995b). When an intermediate proportion of infected and uninfected D. simulans were placed in population cages, the proportion of Wolbachia-iniected individuals increased rapidly within 5-10 generations to approximately 80-95% (Hoffmann et al, 1990). The spread of Wolbachia was also "accidentally" discovered in a study by Sinkins et al. (1995b). After microinjecting Wolbachiainfected D. simulans with a new strain of Wolbachia, they found that only 10% of the individuals in a population harbored the double infection. They subsequently monitored the fate of this double infection, and found it increased from an initial prevalence of 10% to over 90% in only 12 generations (Sinkins et al, 1995b). Field studies have documented the increases of individuals infected with Wolbachia in natural D. simulans populations in California (Turelli and Hoffmann, 1991; 1995). These authors found that the proportion of infected individuals, first discovered in Southern California, has increased within various local populations to a stable frequency of approximately 0.94, and the proportion appears to be increasing to that level in other local populations. This stable equilibrium of 0.94 is similar to the frequency predicted by the theoretical models using the appropriate parameter values. In addition to the spread of infections within local populations, the infection is also spreading northward at approximately 100 km per year (Turelli and Hoffmann, 1991;

PAGE 71

66 Turelli et al, 1992). Field studies indicated that one particular mitochondrial variant is spreading along with the Wolbachia by "hitchhiking" with the infected cytotype (Turelli et al, 1992). Several studies are in progress to genetically engineer and improve arthropods, for example, to be refractory to disease agents such as malaria parasites (Beard et ah, 1993). However, the success of any genetic control strategy that uses transgenes will depend on a mechanism which will favor the spread of the introduced genes through natural populations (Evans, 1993). The ability of Wolbachia and its associated cytoplasmic elements, like mitochondria or other symbionts, to spread through a population might be harnessed as a mechanism to "drive" desired traits through wild-type, natural populations. This could happen if the transgene "hitchhikes" with the infected cytoplasm (Curtis, 1992; Beard et al, 1993). However, the dynamics of Wolbachia are complex (Turelli, 1994, Prout, 1994), so data on the ability of Wolbachia to spread through populations are necessary to evaluate the feasibility of this mechanism in various arthropods. Previous studies (Chapter 4) indicate Wolbachia in the predatory mite Metaseiulus occidentalis is associated with strong nonreciprocal reproductive incompatiblities between infected males and uninfected females. M. occidentalis has traditionally been used in ecological studies because of its rapid generation time and ease of rearing (e. g., Huffaker, 1958), and it is a subject of genetic improvement programs (Hoy, 1985; 1994). For these reasons, I chose to conduct an experiment to evaluate the potential of Wolbachia to spread through experimental laboratory populations of M. occidentalis.

PAGE 72

67 This chapter reports the dynamics of Wolbachia infection in polymorphic laboratory populations of M. occidentalis over 12 generations with a low initial infection frequency of 0.1. This low initial infection frequency was chosen because it is likely to provide an appropriate test of the theory under realistic situations. Because of difficulties in estimating absolute population densities (Proverbs, 1974; Caprio et al, 1991), and in mass rearing high quality arthropods inexpensively (Bush, 1979; Marroquin, 1985; Mueller-Beilschmidt and Hoy, 1987; Hoy et al, 1991; Hoy, 1994), the number of Wo/bflc/z/fl-infected arthropods released as part of any arthropod management project may not be more than 10% of the wild-type population in a given area. Methods Mite Maintenance and Sources Metaseiulus occidentalis were maintained at the University of Florida and reared as previously described (Roush and Hoy, 1981; Hoy et al, 1982). The two-spotted spider mites, Tetranychus urticae Koch, were raised on pinto bean, Phaseolus vulgaris L., plants in a greenhouse at the University of FloridaGainesville. Genetically similar infected and heat-cured M. occidentalis were used for the experiments. They were initiated one year prior to this experiment, initially for the experiments in Chapter 4, by isolating one gravid female, allowing her progeny to sib mate, removing one gravid female, and repeating this procedure for four generations at 24°C. Two of the resulting gravid generation five (G5) females were used to initiate two new lines; one line (RT) was maintained at normal rearing temperatures (24°C), and the

PAGE 73

68 second line was held at 33°C (HT). The presence of Wolbachia in at least 80% of the individuals from the RT line, and its absence in the HT line, was confirmed by PCR of the/fsZ gene (Chapter 4) two months prior to this study. Three replicate populations of the RT and HT lines were initiated at the start of this study by moving 100 eggs to new population cages. These populations were designated as RTand HT1, 2, and 3. A third line was also initiated in triplicate for this study to assess the stability of heat-curing when the heat-treated mites are kept at normal rearing temperatures (H->R). In addition to these three control conditions, the "mixed" (polymorphic) experimental populations were initiated in triplicate with ten eggs from the infected RT population and 90 eggs from the HT (cured) populations. The RT, H->R, and mixed populations remained at normal rearing temperatures for the duration of this experiment. Each population was subcultured every 3 weeks (to reduce crowding and fungal contamination) by moving 125 randomly-selected gravid females (of approximately 400) to a new population arena. The food sources of the predators were monitored to avoid contamination of the populations. In addition, the population arenas were housed separately in polypropylene boxes, lined on the inside with a thick, 4 cm-wide band of petroleum jelly to discourage movement in and out of the boxes. Progeny Testing for Compatibility An assay method called "progeny testing" has been used to estimate the proportions of infected individuals in a population (Hoffmann et al, 1990). These assays are conducted by introducing infected males to females of

PAGE 74

69 unknown Wolbachia status, and the number of compatible test crosses is used to estimate the proportion of females infected with Wolbachia. Alternatively, a Polymerase Chain Reaction (PCR) assay for Wolbachia infection can be used (O'Neill et ai, 1992; Werren et al, 1995; Turelli and Hoffmann, 1995). A PCR-based assay has been demonstrated to be simpler and equally effective in predicting infection status in D. simulans (Turelli and Hoffmann, 1995). In M. occidentalis, a PCR-based assay can be problematic because of their small size and the possibility of false-positive signals from their diet of Wolbachia-infected spider mites (Johanowicz and Hoy, 1996; Chapter 2). A PCRbased assay for Wolbachia necessitates starving the mites before DNA extraction or collecting and combining eggs from individual females for subsequent DNA extractions and hemi-nested PCR reactions (Chapter 3). Previous studies also have indicated that the reliability of the PCR assay on these eggs may be questionable (Chapter 4), and that storage of DNA extractions reduced the sensitivity of the PCR (Chapter 2). I have therefore chosen to use a progeny testing bioassay, rather than a PCR assay, to determine the infection status of individual M. occidentalis. To obtain the virgin individuals for the test crosses, eggs or newly eclosed larvae from each of the colonies were isolated on leaf discs with prey, allowed to mature to adults, and sexed. To obtain adequate numbers of females for the test crosses, 50 eggs or larvae were isolated from each of the populations, with the exception of the RT populations. To obtain adequate numbers of young, virgin, infected males for the test crosses, 100 individuals were isolated from each of the three RT populations, and approximately 500

PAGE 75

70 more were isolated from the RT base colonies. The RT base colonies were maintained under the same conditions as the other replicate populations. Crosses were conducted on detached pinto bean leaves on water soaked cotton. The leaves were infested with all stages of spider mites as prey. Experiments were performed under constant light at 24-27°C and 4570% RH. Twenty, single-pair test crosses were initiated for each replicate (three replicates) of the four different populations (RT, HT, H->R, and mix), for a total of 240 crosses. Each test cross consisted of one randomly chosen RT (infected) male introduced to a randomly chosen female isolated from the various populations. They were allowed to mate, and the females were allowed to deposit eggs for a total of four days after they were determined to be gravid (signaling they have mated). The location of the newly-deposited eggs was marked daily with India ink to make relocating them easier. The number of shriveled and normal eggs, surviving progeny, and the progeny sex ratio was recorded daily. The experiment was repeated four times, at weeks 3, 6, 9, and 12, for a total of 960 test crosses. One week corresponds to one generation in M. occidentalis. Females which never became gravid, died, or disappeared were excluded from analysis. Compatibility Index Crosses were scored for the number of viable eggs, number of shriveled eggs, and sex ratio of resulting progeny. Incompatibility is associated with low numbers of viable eggs, a high degree of egg shriveling, and a strongly male-biased sex ratio (Chapter 4). A Compatibility Index was designed to include all three aspects of incompatibility when determining

PAGE 76

71 infection status: (the number of viable eggs + nunnber of daughters number of shriveled eggs) 10. Crosses were scored as compatible if the Compatibility Index was greater than 0.35, and incompatible when less than 0.35. The threshold value of 0.35 clearly separated the two types based on the results of the control crosses, and corresponded to one-fourth of the mean Compatibility Index value of the infected control crosses. The proportions of compatible crosses for each treatment type (RT, H->R, HT, mix) were evaluated by using a simple regression analysis to check for significant deviations of the slope from zero (StatView; Abacus Concepts, 1992). An increase in compatibility over 12 generations (spread of Wolbachia) would be accompanied by an increase in slope. Parameter Estimates Unexpected incompatibility between an "infected" female and an "infected" male could mean that the Wolbachia was not efficiently transmitted to that female used in the cross. Likewise, unexpected compatibility between a "cured" female and "infected" male could mean that the Wolbachia was not efficiently transmitted to that male. To estimate the inefficiency of maternal transfer of Wolbachia (ji) (proportional failure of transmission), I summed the number of "unexpected" compatible or incompatible control test crosses and divided by the total number of control test crosses. To estimate of the hatchability "H" of the incompatible crosses relative to the compatible crosses, I divided the mean number of viable eggs produced by the incompatible (HT x RT and H->R x RT) crosses (H,) by the

PAGE 77

72 mean number of viable eggs produced by the compatible (RT x RT) crosses {HX so that H = H/H^. Results Progeny Testing: Control and Experimental Populations The proportion of compatible test crosses did not increase over time in the mixed populations, indicating Wolbachia infection did not increase in these populations (Table 5-1). Regression analysis of the proportion of compatible test crosses from the three replicates (mixed 1, 2, and 3) over 12 generations did not indicate a slope significantly different from zero (Figure 5-1). Although the pooled data indicate no increase in compatibility, the compatibility of the mixed-1 population did increase to 24% at week 12. However, an analysis of this population alone also did not yield a slope significantly different from zero. Additionally, an increase to 24% from an initial infection frequency of 10% would not be considered the "rapid" increase in Wolbachia infection that has been observed in other studies. The proportion of compatible test crosses in the RT (infected) control populations (Table 5-1) did not decrease over time, as expected. A small proportion of the test crosses were unexpectedly incompatible (1 proportion of compatible crosses; Table 5-1), perhaps indicating Wolbachia was not perfectly transmitted to the females used in those test crosses. A similar phenomenon was noted in Chapter 4. Compatibility did not significantly increase in the crosses between the heat-treated populations returned to normal rearing conditions (H->R), indicating curing by heat-treatment is stable under these

PAGE 78

73 conditions. Regression analysis of the HT (cured) populations indicated the slope (0.001) was significantly different from zero, although the significance of this small increase in the proportion of compatible test crosses probably does not mean that Wolbachia was appearing in this heat-treated line, since it was kept at 33°C throughout the study. Parameter Estimates Table 5-1 reports the mean number of viable eggs per female per 4 days, mean number of shriveled eggs, and mean number of daughters produced for each replicate of each treatment throughout the study, as well as the proportion of the test crosses defined as compatible. The occurrence of unexpected compatibility (e. g. HT x RT rep. 3, week 12) or incompatibility (e. g. RT x RT rep. 3, week 12) in the control crosses can be most easily explained by imperfect maternal transmission of Wolbachia {ji > 0). There were 31 control crosses with "unexpected" compatibilities or incompatibilities out of 599 total control crosses {/J. = 0.05). This estimate of Wolbachia transmission inefficiency is within the range reported for insects {/J. = 0 0.1) (Werren, 1997). The second parameter estimated in this experiment was hatchability (H). Using the relative numbers of viable eggs as the measure, I estimated the hatchability (H/H.) ratio of incompatible to crosses compatible crosses as 0.11. When substituting the relative number of viable daughters produced instead of viable eggs, this hatchability estimate decreases to 0.04. This dramatic decrease in daughter production in the incompatible cross was detected in previous studies (Chapter 4; Hoy and Knop, 1981; Hoy and Standow, 1982;

PAGE 79

74 Hoy and Cave, 1988), and may reflect the effects of Wolbachia on the genetic system of M. occidentalis (parahaploidy). In parahaploidy, both male and female embryos are diploid, but the sons lose the paternal chromosomes during embryonic development (Hoy, 1979; Nelson-Rees et ah, 1980). Since ]Nolhachia-'md\xced incompatibilities modify the paternal set of chromosomes (Werren, 1997), the M. occidentalis sons may be less affected by this incompatibility mechanism relative to daughters, because their paternal set of chromosomes will be eliminated eventually anyway. Regardless of which estimate is considered, both indicate a strong incompatibility relative to other ]Nolhachia-h.osi associations (Clancey and Hoffmann, 1997). Discussion The bioassays conducted to estimate changes in Wo/fcflc/z/fl-infection frequency over twelve generations of M. occidentalis did not indicate a rapid increase when the initial infection frequency was 0.10. The following nonmutually exclusive reasons may explain why the Wolbachia infection failed to spread rapidly in these M. occidentalis populations. Remating may be important in maintaining uninfected progeny and reducing the spread of Wolbachia in a population (Hoffmann et al, 1990). M. occidentalis females can mate multiple times (Hoy and Smilanick, 1979), which increases the chance that uninfected females will mate successfully with uninfected males within their reproductive life span. Two assumptions inherent in the models describing the prevalence of Wolbachia in polymorphic populations are even (1:1) sex ratio and panmixis.

PAGE 80

75 The "normal" sex ratio of M. occidentalis violates the assumption of a 1:1 sex ratio (Lee and Davis, 1968; Nagelkerke and Sabelis, 1991). The assumption of panmixis may also be violated, which could influence the spread of the symbiont (Hoffmann and Turelli 1988). M. occidentalis populations are not necessarily panmictic (Hoy, 1982). Non-random mating due to behavioral mating biases also has been documented in the laboratory (Hoy and Cave, 1988). Previous studies conducted during genetic control programs of other arthropods determined that the assumptions of panmixis are often violated, and may interfere with implementation of the programs. Smith (1973) found that wild-type screwworm {Cochliomyia homnivorax Coquerel) females could discriminate between wild-type and sterile males. Additionally, Dieleman and Overmeer (1972) discovered that when incompatible male spider mites (T. urticae) were released into glasshouses in a program analogous to the sterile insect release method (SIRM), female spider mites preferred mating with compatible males rather than the incompatible males. Perhaps the most important reason why Wolbachia did not increase in relative frequency in these experimental populations was that the initial infection frequency of 10% may be below an unstable equilibria frequency (="threshold frequency"). If an infection frequency is initiated below this unstable frequency, Wolbachia may be prevented from spreading, and may actually decline to zero (Turelli and Hoffmann, 1991). When this study was first designed, the choice of an initial infection frequency of 0.10 was influenced by a number of factors. For one, the results of Sinkins et al. (1995b) indicated that rapid "spread" can occur with an initial

PAGE 81

76 frequency of just 10%. Secondly, the feasibility of releasing more than 10% of the absolute population density in an arthropod management program is questionable. Lastly, the fitness costs due to infection were initially interpreted in terms of "progeny production", as has been done for the other studies using diplo-diploid insects (Stevens and Wade, 1990; Hoffmann et al, 1990). The assumption was made that there were no relative fitness costs due to infection because the numbers of eggs produced in the infected vs. the uninfected control crosses conducted in Chapter 4 were not significantly different. With this in mind, Caspari and Watson (1959) predict that without fitness costs due to Wolbachia infection, Wolbachia will readily spread through a population, even at low initial frequencies. In retrospect, the number of daughters produced, rather than total progeny production, might be a more relevant measure of fecundity deficits. Studies in Chapter 4 indicate that there are significant differences in the number of daughters produced in the infected control crosses relative to the uninfected control crosses. Pooling the sex ratio data from control crosses in the two experiments in Chapter 4 allows an estimate of the relative fecundity (fitness) between infected (RT x RT) and uninfected (HT x HT, R->H x R->H) crosses. The mean number of daughters /female in the infected control crosses was 2.94 ± 1.39 (after eliminating two incompatible crosses; see Chapter 4). The mean number of daughters /female in the uninfected control crosses was 4.86 ± 1.79. Dividing the mean daughter production of the infected control crosses by the mean daughter production of the uninfected control crosses yields a relative fitness {"F") of 0.60 for infected crosses relative to uninfected crosses.

PAGE 82

77 The unstable equilibrium is very sensitive to changes in fitness costs (Hoffmann et al, 1990). Under the simplest model of Caspari and Watson (1959), which assumes no progeny production by incompatible crosses and perfect maternal transmission rates, the "threshold frequency" equals the fecundity cost to infected females (Werren, 1997). If we assume there are no fitness costs due to Wolbachia infection in M. occidentalis based on viable egg production alone, Wolbachia could spread no matter how rare it is. If the fitness costs instead are measured in terms of relative daughter production (0.6), the "threshold frequency" would be 0.40 (1 relative fitness "F") in order for the infection to spread. This may explain why Wolbachia did not spread in the polymorphic populations of M. occidentalis in which the initial frequency of infected mites was only 0.10. Using the parameter estimates of fi = 0.05, H = 0.11, and F =0.6 for M. occidentalis under laboratory conditions, the model of Hoffmann et al. (1990), predict an unstable equilibrium frequency of 0.50, meaning that at least 50% of the individuals needed to be infected in order for the infection to spread. Assuming no fitness costs to infection, the unstable equilibrium frequency is predicted to be 0.06, meaning that at least 6% of the individuals needed to be infected in order for the infection to spread. While the accuracy of this estimate is questionable due to violation of some assumptions, these theoretical models do provide us with hypotheses by which future experiments can be designed. Furthermore, they indicate that sex ratio may be important in determining fitness costs of Wolbachia infection in M. occidentalis, and perhaps in other parahaploid species.

PAGE 83

78 The unstable equilibrium frequency of 0.50 for M. occidentalis is higher than the one calculated by Turelli and Hoffmann (1995) for D. simiilans, which ranged between 0.08 (with no fitness costs) and 0.19 (if relative fitness was reduced to 0.95). However, other arthropod-Wolbachia associations may also require high initial infection threshold frequencies in order for the infection to rapidly spread through a population. Stevens and Wade (1990) report that, due to fitness costs associated with the symbiont, the initial infection frequency necessary to ensure the eventual spread of their Wolbachia strain through laboratory populations of Triboliim confusum Duv. was 0.37. Clancey and Hoffmann (1997) report that, even with strong levels of incompatibility, Drosophila serrata transfected with a new strain of Wolbachia suffered enough fitness costs and had a low enough transmission efficiency that the threshold frequency would have to be approximately 0.44. Because the required threshold frequencies can be quite high, it is proposed that stochastic events must occur in subpopulations (or "metapopulations") in order to allow the infection to exceed this unstable equilibrium frequency on a 'local' scale (Clancey and Hoffmann, 1997). These stochastic events could include drift, or founder effects (Rousset and Raymond, 1991); neighboring populations could also send out infected migrants above the threshold frequency (Turelli and Hoffmann, 1991). Phytoseiid mites like M. occidentalis are predators of patchily-distributed spider mite prey (Sabelis and Nagelkerke, 1993), and have a subdivided metapopulation structure in which founder effects are important (Caprio and Hoy, 1994). This might allow rare infections to increase to the threshold

PAGE 84

79 frequency and eventually spread through larger populations of M. occidentalis. Because evolution in arthropod host-Wolbachia associations is a dynamic process, each association should be studied individually to assess the potential for Wolbachia to spread through specific populations. This is especially important if a genetic control program depends on the increase of Wo/i^flc/izfl-infected individuals relative to uninfected individuals as a gene spreading mechanism. Selection is expected to occur on both hosts (Turelli, 1994) and Wolbachia strains (Turelli, 1994; Prout, 1994). Selection on Wolbachia strains would tend to favor those with the highest transmission rates and lower fecundity costs (Turelli, 1994; Prout, 1994). Such strains could, as a correlated response, then evolve to cause lower levels of incompatibilities. Strains with these attributes have been detected in D. melanogaster (Hoffmann et al., 1994; Solignac et al, 1994), and even non-sterilizing strains have been found in D. mauritiana Tsacas and David (Giordano et al., 1995). The results of selection on hosts is more difficult to predict, but would tend to favor increased compatibility between infected males and uninfected females (Turelli, 1994). Further investigation into the dynamics of Wolbachia infection in M. occidentalis populations would help answer some of these questions raised in this study. The biology of M. occidentalis violates the assumptions of equal sex ratio and panmixis. Refinement of the relevant theoretical models to make them more appropriate for the biology of M. occidentalis might add more sophistication to the assessment of Wolbachia infection dynamics in this system. However, when sex ratio was used as the measure of relative fitness.

PAGE 85

80 the models appeared to support the empirical evidence obtained. That the models did substantially predict the eventual outcome of this experiment supports the hypothesis that sex ratio is an appropriate measure of relative fitness in this study. Studies focusing on mating biases, remating potential, and metapopulation structure in laboratory colonies, and experiments conducted with higher initial infection frequencies, may provide more insight into the dynamics of Wolbachia infection in laboratory populations of M. occidentalis, as well as the importance of sex ratio in this arthropod hostsymbiont association.

PAGE 86

81 Table 5-1. Rate of Wolbachia spread in laboratory populations of M. occidentalis over 12 generations evaluated by test crosses conducted at weeks 3, 6, 9, and 12. Males from infected populations were crossed with 20 test females from each of the control and experimental populations. The controls included three replicates each of infected (RT) females, heat-treated (HT) (uninfected) females, and heat-treated females subsequently reared at room temperature (H->R). Three replicate Mixed experimental populations were initiated with 10% infected eggs and 90% uninfected eggs. No. gravid females / no. Mean no./ female/ 4 d. producing 1 ropomon Week adult Viable Shriveled Daughters compaiiDie Rep. no. daughters eggs (s.d.) eggs (s.d.) (s.d.) tet>t croobcb Control crossesRT female x RT male: Stability of infection " 1 3 18/14 8.0 (4.5) 0.7 (1.6) 4.7 (2.9) u.// 6 12/12 9.5 (2.1) 0.1 (0.3) 5.8 (1.4) 9 12/12 8.7 (1.8) 0.2 (0.4) 5.6 (1.5) 1 no 12 18/18 10.8 (1.9) 0.1 (0.2) 7.0 (1.7) 1 nn 2 3 18/17 8.9 (3.2) 0.7 (1.1) 5.1 (2.3) U.oo 6 13/13 9.1 (2.4) 0.8 (2.4) 5.1 (2.2) 1 on X .\J\J 9 12/12 9.6 (1.8) 0 (0) 5.4 (1.4) 1.00 12 14/10 8.2 (4.9) 0.5 (0.9) 5.1 (3.5) 0.63 3 3 19/18 8.0 (3.1) 0.3 (0.1) 4.9 (2.3) 0.89 6 17/17 10.2 (2.0) 0 (0) 6.4 (1.9) 1.00 9 14/12 8.3 (2.9) 0.3 (0.6) 4.5 (1.9) 0.86 12 13/11 11.8 (4.2) 0.1 (0.3) 7.7 (3.1) 0.85 Control ' crossesH->R female X RT male: Stability of curing ^ 1 3 13/2 1.2 (1.7) 3.5 (1.8) 0.3 (0.9) 0.08 6 20/0 0.3 (0.7) 3.6 (1.9) 0 (0) 0 9 18/0 0.2 (0.4) 2.1 (2.2) 0 (0) 0 12 20/4 1.6 (1.4) 3.1 (1.7) 0.2 (0.4) 0 2 3 17/4 2.7 (2.6) 4.1 (2.6) 0.6 (1.7) 0.11 6 20/2 1.7 (2.2) 3.0 (2.2) 0.2 (0.5) 0 9 18/2 0.8 (1.2) 1.6 (1.5) 0.2 (0.7) 0.06 12 16/3 1.5 (1.6) 3.1 (2.5) 0.4 (1.0) 0.06 3 3 16/2 1.0 (1.3) 2.7 (1.9) 0.1 (0.3) 0 6 17/2 0.3 (0.8) 1.2 (2.3) 0.1 (0.3) 0 9 17/1 0.6 (0.8) 1.2 (1.8) 0.1 (0.2) 0 12 17/1 1.6 (2.4) 2.5 (2.7) 0.4 (1.8) 0.06

PAGE 87

82 Table 5-l--continued No. gravid females / no. Mean no./ female/ 4 d. producing Proportion Week adult Viable Shriveled Daughters compatible Rep. no. daughters eggs (s.d.) eggs (s.d.) (s.d.) test crosses Control crossesHT female x RT male: Stability of curing 1 3 20/4 1.1 (1.3) 4.2 (2.3) 0.3 (0.7) 0 6 20/0 0.3 (0.7) 2.9 (1.8) 0 (0) 0 io/2 1.2 (2.4) 1.6 (1.9) 0.4 (1.4) 0.06 12 17/2 0.9 (1.4) 1.4 (1.2) 0.2 (0.5) 0.06 2 3 15/1 0.9 (1.4) 4.2 (2.5) 0.1 (0.3) 0 6 17/1 0.9 (2.0) 1.9 (2.1) 0.3 (1.3) 0.06 9 17/2 0.6 (0.9) 2.6 (1.9) 0.1 (0.3) 0 12 15/3 1.7 (2.5) 2.3 (2.2) 0.7 (1.6) 0.13 3 3 17/1 0.9 (0.8) 2.7 (1.9) 0.1 (0.3) 0 6 18/1 1.1 (1.3) 2.5 (2.1) 0.1 (0.5) 0 9 17/4 1.0 (1.2) 1.5 (1.5) 0.2 (0.4) 0 12 11/3 1.9 (2.7) 1.7 (1.8) 0.8 (2.1) 0.09 Experimental crossesMixed female x RT male: Changes in infection frequency " 1 3 16/3 1.6 (2.6) 2.8 (1.8) 0.7 (1.9) 0.06 6 18/0 0.1 (0.3) 3.3 (2.6) 0 (0) 0 9 18/4 1.6 (2.3) 2.8 (2.6) 0.7 (1.5) 0.17 12 17/5 2.7 (3.6) 2.5 (2.1) 1.5 (2.8) 0.24 2 3 15/6 3.6 (4.5) 1.9 (2.7) 1.9 (3.0) 0.33 6 16/0 0.1 (0.3) 2.7 (2.4) 0 (0) 0 9 16/1 0.9 (2.2) 0.9 (1.1) 0.4 (1.5) 0.06 12 19/2 1.4 (2.9) 1.4 (1.5) 0.7 (2.2) 0.11 3 3 16/4 2.9 (3.7) 2.8 (2.5) 0.8 (1.6) 0.25 6 17/4 2.1 (3.8) 1.3 (1.7) 1.4 (2.7) 0.24 9 17/4 1.9 (2.9) 1.2 (1.9) 0.8 (1.9) 0.18 12 16/2 1.0 (1.9) 2.1 (2.0) 0.3 (1.0) 0.06 a/ expect high proportions of compatible test crosses if infection is stable b/ expect low proportions of compatible test crosses if curing is stable c/ expect proportion of compatible test crosses to increase from week 3 to 12 if Wolbachia infection is spreading through the populations

PAGE 88

83 1 .0 0.8 0.6 0.4 0.2 0.0 Mixed Y=0.232-.001X; R2=0.101 1 .0 0.8 T > 0.6 0.4 RT control (infected) 0.2 Y=0.982-0.001X; r2=0.07 0.0 1 .0 0.8 0.6 0.4 0.2 0.0 f H — > R control (cured) Y=0 .02 5+0 .00 002 IX; R2=0.000015 1 .0 0.8 0.6 0.4 0.2 0.0 HT control (cured) Y=-0.04+.001X; R2=0.501 Week 12 Figure 5-1. Compatibility did not increase over time in the mixed populations initiated with 10% infected and 90% uninfected individuals over 12 generations. Circles indicate means of 3 replicate populations; bars indicate standard deviation.

PAGE 89

CHAPTER 6 CONCLUSIONS The study of Wolbachia symbiosis in M. occidentalis has been rewarding and interesting, even considering the inherent challenges of investigating an intracellular symbiont in a tiny predatory mite. The results of my research have advanced the basic understanding of this symbiosis. However, considerable work remains before the symbiosis is well understood, with numerous interesting questions remaining to be addressed. When this research began, Wolbachia was suspected to be responsible for nonreciprocal reproductive incompatibilities between populations of M. occidentalis. This symbiont was previously described from insects, but not from mites. The use of molecular tools, including the PCR and DNA sequencing, allowed me to identify and characterize this symbiont of M. occidentalis in a way which was not possible before they were available. While using these molecular tools to study the Wolbachia of M. occidentalis, I discovered that the prey of this obligate predator, the twospotted spider mite T. urticae, was also infected. I then learned that research can be full of unexpected hurdles; for example, that Wolbachia DNA from the consumed spider mites could sometimes be detected by the PCR in uninfected predatory mites. This finding turned an already challenging molecular study into an even greater challenge. I needed to find a way to methodologically ehminate the amplification of spider mite DNA when 84

PAGE 90

85 studying the predator's Wolbachia. This meant potentially risking the ability to reliably amplify the predator's intrinsic Wolbachia, because starvation can reduce symbiont levels, and amplification from the minute eggs can be problematic. Besides the implications for my own research, the erroneous amplification of contaminating DNA from gut contents should be a consideration for anyone who studies Wolbachia in predatory arthropods. It became apparent that the PCR did not always amplify the template DNA present in a sample, even though "theoretically" it could amplify even a single molecule. Hemi-nested PCR and /or pooling of DNA samples was often necessary to get a PCR signal, and still these techniques occasionally failed. This difficulty of detecting minute amounts of Wolbachia in single tiny predators was another obstacle that needed to be addressed throughout this study. In retrospect, more techniques should have been attempted to improve the sensitivity of the PCR. Lack of experience led me to assume that PCR amplification was straightforward for other research groups studying Wolbachia, and that the techniques used in my own lab to study mite DNA were adequate for symbiont DNA from the mites. I have realized this was not the case. When problems arose, these assumptions led me to question my technical abilities, rather than the techniques themselves. If I had accepted earlier that the study of Wolbachia in mites was inherently difficult, I might have attempted more techniques. For example, I might have tried different extraction techniques such as a CTAB protocol, or concentrated more efforts on improving the STE procedure (O'Neill et al, 1992, Chapter 2), which initially appeared to work more reliably than the Chelex method (Chapter 2).

PAGE 91

86 Increasing the number of PGR cycles also might have been helpful, as has been recently recommended for reactions with low template concentrations (Rameckers et ah, 1997). This experience taught me that when techniques do not work well, even "established" ones, alternative approaches should be explored. In spite of these problems, interesting data resulted from this research. For one, the DNA sequences I examined from the 16S ribosomal RNA and ftsZ genes from the predator and prey were nearly identical to each other. Unexpectedly, the sequences from the mite Wolbachia were nearly identical to the Wolbachia from insects, including the type species Wolbachia pipientis from the mosquito Culex pipiens. Whether the Wolbachia from the mites are truly this similar to each other and to the symbionts from insects remains to be answered. The genes I used were too conserved to resolve this question. Information on sequence variation would have been very useful in designing species-specific primers, so I could more easily eliminate false positives from the predator's gut contents. The possibility that this maternally-transmitted symbiont has been transferred horizontally between the two mite species also remains unanswered because of the lack of sequence variation. Perhaps a more variable portion of the ftsZ gene should have been studied, like the non-coding region, or even an entirely different gene. Information was available on the non-coding region of the /fsZ gene from an A-group Wolbachia from Drosophila melanogaster (Holden et al, 1993). Designing primers for that region which would be Wolbachia-specific and would work on the B-group Wolbachia from M. occidentalis and T. urticae would have been time consuming, but might have yielded useful information

PAGE 92

87 on the genetic variation between Wolbachia sequences. Genetic information on this microorganism has been scarce, but continual advances are expected due to the exponential growth of Wolbachia research around the world and a new in vitro culturing system in a mosquito cell line (Werren, 1997). In order to study the biological effects of Wolbachia infection, it is crucial to obtain a population without the symbionts with which infected individuals can be crossed or compared. In other studies, the insects cooperate by consuming antibiotic-laced artificial diet, honey, or water. In view of the difficulty in feeding antibiotics to these obligate predators, the ability to "cure" these mites by rearing them at high temperatures was an exciting option. This allowed me to determine the phenotype of Wolbachiainduced reproductive incompatibilities between infected males and uninfected females. Interestingly, the phenotype was a unique combination of reduced progeny production (as in diplo-diploids) and a skewed sex ratio (as in haplo-diploids) of the few, resulting progeny. However, one nagging question remains. Are correlations between the presence of Wolbachia and nonreciprocal incompatibilities just that? Is another, heat-sensitive cytoplasmic element the real cause of the incompatibilities? The evidence from this study, and studies with so many other arthropods, strongly suggests it is the Wolbachia. However, until a pure sample of Wolbachia can be successfully injected into uninfected mites, this possibility cannot be excluded. According to Koch's postulates, reinfection of the suspected microorganism is a necessary step in the assignment of cause and effect. The crossing studies yielded another interesting and unexpected result. The infected control crosses tended to have a male-biased sex ratio, and the

PAGE 93

88 uninfected crosses had a female-biased sex ratio. If this is a general phenomenon and not just a sampling error, it could have interesting and important implications for the population dynamics of this agriculturallyimportant mite by altering its intrinsic rate of increase. The "infected" control crosses occasionally produced some unexpected incompatible crosses. The efficiency of symbiont transmission from mother to progeny appears to be imperfect, due to unknown factors which could include crowding and nutritional stresses. Imperfect transmission or other reductions of symbiont titer might contribute to unexpected within-population incompatibilities if some females do not have enough Wolbachia to be compatible with an infected male. This underscores the importance of reducing colony crowding and other stresses when rearing large numbers of infected M. occidentalis or other natural enemies in biological control programs. Because Wolbachia or other symbioses have the potential to affect entomological projects in positive and negative ways, I believe that they should be an important consideration when addressing the biology of any arthropod. Symbioses transform an individual into a community, complete with a fascinating complexity of interactions we are only beginning to understand. The results of the Wolbachia infection dynamics studies were some of the most surprising and important findings. In contrast to published theoretical predictions and empirical evidence that Wolbachia will spread rapidly through polymorphic populations, this did not occur in populations of M. occidentalis. There may be several, non-mutually exclusive reasons why this symbiont, which should have spread, did not. Perhaps it was because the

PAGE 94

89 initial infection frequency of 10% was below a threshold which would allow the frequency to increase to a stable level. It would have been interesting to create some populations with a higher initial infection frequency than 10% and compare the outcomes. Another possible reason why Wolbachia did not rapidly spread through the populations could have been due to fitness costs associated with infection, like reduced female sex ratio compared to cured mites. Perhaps the females will mate multiple times if they detect they are producing shriveled eggs. This would increase the chances of uninfected females producing viable, uninfected offspring. This could then reduce the "spread" of infected individuals by maintaining the presence of more uninfected individuals in the population. Addressing these questions would not only contribute to our basic knowledge of M. occidentalis biology, but might have implications for those hoping to use Wolbachia as a "drive mechanism". There are still many mysteries concerning the symbiotic relationship between Wolbachia and arthropod hosts. For example, recent investigations indicate Wolbachia infection is responsible for protecting a weevil from a parasitoid (Hsiao, 1996). This phenomenon could have widespread implications for the way scientists match pest biotypes with natural enemy biotypes in biological control programs. Ecological implications of this symbiosis are important in another biological control setting. There are plans to infect parasitoid wasps with Wolbachia so that they only produce daughters, since the ovipositing females are the "effective" natural enemies. While the relative number of ovipositing females could be increased this way.

PAGE 95

90 there could be serious fitness effects due to infection, or detrimental consequences from the loss of genetic recombination (Crow, 1988). I enjoyed answering some of the questions regarding Wolbachia symbiosis in M. occidentalis, even considering the challenges inherent in this project. There are many interesting questions which remain. The following are three which would be most interesting to answer. First, it would be interesting to use a more variable Wolbachia gene to determine the differences between the symbionts from the predator and prey, and between mites and insects. Second, a detailed life table analysis would be important to more accurately determine any fitness costs of Wolbachia infection. Finally, investigating the females' responses to laying shriveled eggs after mating with incompatible, infected males would be important in understanding the dynamics of Wolbachia infection in polymorphic populations. The answers to these questions, in addition to those already answered in this research, will provide a better understanding of Wolbachia symbiosis in the agriculturallyimportant predatory mite Metaseiulus occidentalis and possibly other Wolbachia symbioses as well. The inevitable cascade of questions, answers, and more questions is one of the most important lessons learned during this project. It is one of the most frustrating, and well as one of the most exciting aspects of science.

PAGE 96

APPENDIX A SEQUENCE ALIGNMENT: WOLBACHIA 16S rDNA FROM C. PIPIENS, M. OCCIDENTALIS (COS EGG AND ADULT RUSSIAN SELECT), AND ADULT T. URTICAE E. coli 100 I C. pipiens TAGTGGCAGA CGGGTGAGTA ATGTATAGGA ATCTACCTAG TAGTACGGAA M. occidentalis egg TAGTGGCAGA CGGGTGAGTA ATGTATAGGA ATCTACCTAG TAGTACGGAA M. occidentalis RS TAGTGGAAGA CGGGTGAGTA ATGT??AGGA ATCTACCTAG TAGTACGGAA T. urticae TAGTGGCAGA CGGGTGAGTA ATGTATAGGA ATCTACCTAG TAGTACGGAA 60 70 80 90 100 C. pipiens TAATTGTTGG AAACGACAAC TAATACCGTA TACGCCCTAC GGGGGAAAAA M. occidentalis egg TAATTGTTGG AAACGACAAC TAATACCGTA TACGCCCTAC GGGGGAAAAA M. occidentalis RS TAATTGTTGG AAACGACAAC TAATACCGTA TACGCCCTAC GGGGGAAAAA T. urticae TAATTGTTGG AAACGACAAC TAATACCG7A TACGCCCTAC GGGGGAAAAA 110 120 130 140 150 C. pipiens TTTATTGCTA TTAGATGAGC CTATATTAGA TTAGCTAGTT GGTGGGGTAA M. occidentalis egg TTTATTGCTA TTAGATGAGC CTATATTAGA TTAGCTAGTT GGTGGGGTAA M. occidentalis RS TTTATTGCTA TTAGATGAGC CTATATTAGA TTAGCTAGTT GGTGGGGTAA T. urticae TTTATTGCTA TTAGATGAGC CTATATTAGA TTAGCTAGTT GGTGGGGTAA 160 170 180 190 200 C. pipiens TAGCCTACCA AGGTAATGAT CTATAGCTGA TCTGAGAGGA TGATCAGCCA M. occidentalis egg TAGCCTACCA AGGTAATGAT CTATAGCTGA TCTGAGAGGA TGATCAGCCA M. occidentalis RS TAGCCTACCA AGGTAATGAT CTATAGCTGA TCTGAGAGGA TGATCAGCCA T. urticae TAGCCTACCA AGGTAATGAT CTATAGCTGA TCTGAGAGGA TGATCAGCCA 210 220 230 240 250 C. pipiens CACTGGAACT GAGATACGGT CCAGACTCCT ACGGGAGGCA GCAGTGGGGA M. occidentalis egg CACTGGAACT GAGATACGGT CCAGACTCCT ACGGGAGGCA GCAGTGGGGA M. occidentalis RS CACTGGAACT GAGATACGGT CCAGACTCCT ACGGGAGGCA GCAGTGGGGA T. urticae CACTGGAACT GAGATACGGT CCAGACTCCT ACGGGAGGCA GCAGTGGGGA 260 270 280 290 300 C. pipiens ATATTGGACA ATGGGCGAAA GCCTGATCCA GCCATGCCGC ATGAGTGAAG M. occidentalis egg ATATTGGACA ATGGGCGAAA GCCTGATCCA GCCATGCCGC ATGAGTGAAG M. occidentalis RS ATATTGGACA ATGGGCGAAA GCCTGATCCA GCCATGCCGC ATGAGTGAAG T. urticae ATATTGGACA ATGGGCGAAA GCCTGATCCA GCCATGCCGC ATGAGTGAAG 310 320 330 340 350 C. pipiens AAGGCCTTTG GGTTGTAAAG CTCTTTTAGT GAGGAAGATA ATGACGGTAC M. occidentalis egg AAGGCCTTTG GGTTGTAAAG CTCTTTTAGT GAGGAAGATA ATGACGGTAC M. occidentalis RS AAGGCCTTTG GGTTGTAAAG CTCTTTTAGT GAGGAAGATA ATGACGGTAC T. urticae AAGGCCTTTG GGTTGTAAAG CTCTTTTAGT GAGGAAGATA ATGACGGCAC 360 370 380 390 400 C. pipiens TCACAGAAGA AGTCCTGGCT AACTCCGTGC CAGCAGCCGC GGTAATACGG M. occidentalis egg TCACAGAAGA AGTCCTGGCT AACTCCGTGC CAGCAGCCGC GGTAATACGG M. occidentalis RS TCACAGAAGA AGTCCTGGCT AACTCCGTGC CAGCAGCCGC GGTAATACGG T. urticae TCACAGAAGA AGTCCTGGCT AACTCCGCGC CAGCAGCCGC GGTAATACGG 410 420 430 440 450 C. pipiens AGAGGGCTAG CGTTATTCGG AATTATTGGG CGTAAAGGGC GCGTAGGCTG M. occidentalis egg AGAGGGCTAG CGTTATTCGG AATTATTGGG CGTAAAGGGC GCGTAGGCTG M. occidentalis RS AGAGGGCTAG CGTTATTCGG AATTATTGGG CGTAAAGGGC GCGTAGGCTG 91

PAGE 97

92 urticae AGAGGGCTAG CGTTATTCGG AATTATTGGG CGTAAAGGGC GCGTCGGCT? 460 470 480 490 500 C. pipiens GTTAATAAGT TAAAAGTGAA ATCCCGAGGC TTAACCTTGG AATTGCTTTT M. occidentalis egg GTTAATAAGT TAAAAGTGAA ATCCCGAGGC TTAACCTTGG AATTGCTTTT M. occidentalis RS GTTAATAAGT TAAAAGTGAA ATCCCGAGGC TTAACCTTGG AATTGCTTTT T. urticae ?????????? ?AAAAGTGAA ATCCCGAGGC TTAACCTTGG AATTGCTTTT 510 520 530 540 550 C. pipiens AAAACTATTA ATCTAGAGAT TGAAAGAGGA TAGAGGAATT CCTGATGTAG M. occidentalis egg AAAACTATTA ATCTAGAGAT TGAAAGAGGA TAGAGGAATT CCTGATGTAG M. occidentalis RS AAAACTATTA ATCTAGAGAT TGAAAGAGGA TAGAGGAATT CCTGATGTAG T. urticae AAAACTATTA ATCTAGAGAT TGAAAGAGGA TAGAGGAATT CCTGATGTAG 560 570 580 590 600 C. pipiens AGGTAAAATT CGTAAATATT AGGAGGAACA CCAGTGGCGA AGGCGTCTAT M. occidentalis egg AGGTAAAATT CGTAAATATT AGGAGGAACA CCAGTGGCGA AGGCGTCTAT M. occidentalis RS AGGTAAAATT CGTAAATATT AGGAGGAACA CCAGTGGCGA AGGCGTCTAT T. urticae AGGTAAAATT CGTAAATATT AGGAGGAACA CCAGTGGCGA AGGCGTCTAT 610 620 630 640 650 C. pipiens CTGGTTCAAA TCTGACGCTG AAGCGCGAAG GCGTGGGGAG CAAACAGGAT M. occidentalis egg CTGGTTCAAA TCTGACGCTG AAGCGCGAAG GCGTGGGGAG CAAACAGGAT M. occidentalis RS CTGGTTCAAA TCTGACGCTG AAGCGCGAAG GCGTGGGGAG CAAACAGGAT T. urticae CTGGTTCAAA TCTGACGCTG AAGCGCGAAG GCGTGGGGAG CAAACAGGAT 660 670 680 690 700 C. pipiens TAGATACCCT GGTAGTCCAC GCTGTAAACG ATGAATGTTA AATATGGGGA M. occidentalis egg TAGATACCCT GGTAGTCCAC GCTGTAAACG ATGAATGTTA AATATGGGGA M. occidentalis RS TAGATACCCT GGTAGTCCAC GCTGTAAACG ATGAATGTTA AATATGGGGA T. urticae TAGATACCCT GGTAGTCCAC GCTGTAAACG ATGAATGTTA AATATGGGGA 710 720 730 740 750 C. pipiens GTTTACTTTC TGTATTACAG CTAACGCGTT AAACATTCCG CCTGGGGACT M. occidentalis egg GTTTACTTTC TGTATTACAG CTAACGCGTT AAACATTCCG CCTGGGGACT M. occidentalis RS GTTTACTTTC TGTATTACAG CTAACGCGTT AAACATTCCG CCTGGGGACT T. urticae GTTTACTTTC TGTATTACAG CTAACGCGTT AAACATTCCG CCTGGGGACT 760 770 780 790 800 C. pipiens ACGGTCGCAA GATTAAAACT CAAAGGAATT GACGGGGACC CGCACAAGCG M. occidentalis egg ACGGTCGCAA GATTAAAACT CAAAGGAATT GACGGGGACC CGCACAAGCG M. occidentalis RS ACGGTCGCAA GATTAAAACT CAAAGGAATT GACGGGGACC CGCACAAGCG T. urticae ACGGTCGCAA GATTAAAACT CAAAGGAATT GACGGGGACC CGCACAAGCG 810 820 830 840 850 C. pipiens GTGGAGCATG TGGTTTAATT CGATGCAACG CGAAAAACCT TACCACTTCT M. occidentalis egg GTGGAGCATG TGGTTTAATT CGATGCAACG CGAAAAACCT TACCACTTC . M. occidentalis RS GTGGAGCATG TGGTTTAATT CGATGCAACG CGAAAACCTT ACCACTTCTT T. urticae GTGGAGCATG TGGTTTAATT CGATACAACG CGAAAAACCT TACCACTTCT 860 C. pipiens TG M. occidentalis egg M. occidentalis RS T. urticae TG

PAGE 98

93 APPENDIX B SEQUENCE ALIGNMENT: WOLBACHIA 16S rDNA FOR PHYLOGENETIC ANALYSIS M. _occidentalis_eggs T._urticae M._occidentalis_RUSSIAN_SELECT Muscidifurax_uniraptor Culex_pipiens Aedes_albopictus Ephestia_cautella Triboliuin_conf usum Drosophila_simulans Tr i chogr amma_pr e t i o sum Rhinocyllus_conicus Wolbachia_persica Bac i 1 lus_sub t i lis Escherichia_coli Cowdr ia_r umi na t iiim Ehrlichia_canis Anaplasma_inarginale Rickettsia rickettsii coli position 100 I T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGAAGACGGGTGAGTAATGT??AGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGTATAGGA-ATCTACCTAGTAGTACGG CGAGTGGCGGACGGGTGAGTAACGCGTAGGA-ATCTGCC7ATCTGAGGGG T-AGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGG CGAGTGGCGGACGGGTGAGTAATGTCTGGGA-AACTGCCTGATGGAGGGG T-AGTGGCAGACGGGTGAGTAATGCGTAGGA-ATCTGCCTAGTAGTATGG T-AGTGGCAGACGGGTGAGTAATGCGTAGGA-ATCTACCTAGTAGTACGG T-AGTGGCAGACGGGTGAGTAATGCATAGGA-ATCTACCTAGTAGTATGG T-AGTGGCAGACGGGTGAGTAACACGTGGGA-ATCTACCCATCAGTACGG M . _occidenta 1 i s_eggs T._urticae M._occidentalis_RUSSIAN_SELECT Muscidif urax_uniraptor Culex_pipiens Aedes_albopictus Ephestia_cautella Triboliuin_conf usum Drosophila_simulans Trichograirana_pretiosuin Rhinocyl lus_conicus Wolbachia_persica Bacillus_subtilis Escherichia_coli Cowdr i a_rumina t ium Ehrlichia_canis Anaplasma_marginale Rickettsia rickettsii AATAATTGTTGGAAACGAC AACTAATACCGTATACG CCCTACG AATAATTGTTGGAAACGACAACTAATACCG7ATACG CCCTACG AATAATTGTTGGAAACGACAACTAATACCGTATACG CCCTACG AATAATTGTTGGAAACGGC AACTAATACCGTATAC ? CCCTACG AATAATTGTTGGAAACGACAACTAATACCGTATACG CCCTACG AATAATTGTTGGAAACGGCAACTAATACCGTATACG CCCTACG AATAATTGTTGGAAACGGC AACTAATACCGTATAC ? CCCTACG GATAATTGTTGGAAACGACAACTAATACCGTATACG CCCTACG AATAATTGTTGGAAACGGCAACTAATACCGTATACG CCCTACG AATAATTGTTGGAAACGGCAACTAATACCGTATACG CCCTATG AATAATTGTTGGAAACGGCAACTAATACCGTATACG CCCTACG GATACCAGTTGGAAACGACTGTTAATACCGCATAGT ATCTGTG GATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCAT GATAACTACTGGAAACGGTAGCTAATACCGCATAAC GTCGCAA AATAGCTATTAGAAATGATAGGTAATACTGTATAAT CCCTGCG AATAGCCATTAGAAATGGTGGGTAATACTGTATAAT CCCCGAG GATAGCCACTAGAAATGGTGGGTAATACTGTATAAT CCTGCG AATAACTTTTAGAAATAAAAGCTAATACCGTATATT C? CTGCG M._occidentalis_eggs T._urticae M._occidentalis_RUSSIAN_SELECT Muse idifurax_unirap tor Culex_pipiens Aedes_albopictus Ephestia_cautella Triboliuin_conf usum Drosophila_s imulans Trichogramma_pretiosum Rhinocyllus_conicus Wolbachia_persica Bacillus_subtilis Escherichia_coli Cowdr ia_ruminat ium Ehrlichia_canis Anaplasma_marginale Rickettsia_rickettsii GGG GAAAAA TTTA TTGCTATT AGATGAG GGG GAAAAA TTTA TTGCTATT AG ATGAG GGG GAAAAA TTTA TTGCTATTAG ATGAG GGG AAAAA TTTA TTGCTATTAG ATGAG GGG GAAAAA TTTA TTGCTATTAG ATGAG GGG GAAAAA TTTA TTGCTATT AGATGAG GGG GAAAAA TTTA TTGCTATT AGATGAG GGG GAAAAA TTTA TTGCTATCAGATGAG GGG AAAAAT TTA TTGCTATTAGATGAG GGG GAAAAA TTTA TTGCTATTAGATGAG GGG GAAAGA TTTA TTGCTATTAGATGAG GAT TAAAGGTAGC — T TTCG AGCTGTCGCAGATGGATGAG GGTTCAAACATAAAAGGTGGC TTCG--GCTACCACTTACAGATGGA GAC CAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTG GGG GAAAGA TTTA TCGCTATT AG ATGAG GGG GAAAGA TTTA TCGCT ATTAGATAAG GGG GAAAGA TTTA TCGCTATT AGATGAG GAG GAAAGA TTTA TCGCTGATGGATGA ?

PAGE 99

94 M._occidentalis_eggs T._urticae M . _occ identa 1 is_RUSS IAN_SELECT Muscidifurax_uniraptor Culex_pipiens Aedes_albopictus Ephestia_cautella Tribolium_conf usum Drosophila_simulans Trichogramma_pretiosum Rhinocyllus_conicus Wolbachia_persica Bacillus_subtilis Escherichia_coli Cowdria_ruminatium Ehrlichia_canis Anaplasma_marginale Rickettsia_rickettsii M._occ identa lis_eggs T._urticae M._occidentalis_RUSSIAN_SELECT Muscidifurax_uniraptor Culex_pipiens Aedes_albopictus Ephestia_cautella Tr ibol iuin_conf usum Drosophila_simulans Trichogramma_pretiosuin Rhinocyl lus_conicus Wolbachia_persica Bacillus_subtilis Escher ichia_coli Cowdr ia_ruininatium Ehrlichia_canis Anaplasma_marginale Rickettsia_rickettsii M . _occidentalis_eggs T ._urticae M . _occ identa 1 i s_RUSS IAN_SELECT Muscidifurax_uniraptor Culex_pipiens Aedes_albopictus Ephestia_cautella Tribolitm_conf usum Drosophila_simulans Trichogramma_pretiosum Rhinocyl lus_conicus Wolbachia_persica Baci 1 lus_subti 1 is Escher ichia_coli Cowdr ia_ruminatium Ehr lichia_canis Anaplasma_marginale Rickettsia_rickettsii M . _occidentalis_eggs T ._urticae M._occidentalis_RUSSIAN_SELECT Muscidif urax_uniraptor Culex_pipiens Aede s_a 1 bop ictus Ephestia_cautella Tr ibol ium_conf usum Drosophila_simulans Tr i chogramina_pre t i osum Rhinocyl lus_conicus Wolbachia_persica Baci llus_subt ills Escher ichia_coli Cowdr ia_ruminatium CCTATATTAGATTAGCTAGTTGGTGGGGTAATAGCCTACCAAGGTAATGA CCTATATTAGATTAGCTAGTTGGTGGGGTAATAGCCTACCAAGGTAATGA CCTATATTAGATTAGCTAGTTGGTGGGGTAATAGCCTACCAAGGTAATGA CCTATATTAGATTAGCTAGTTG-TGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTGGGGTAATAGCCTACCAAGGTAATGA CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAAT7A CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTGGAGTAATAGCCTACCAAGGCAATGA CCTATATTAGATTAGCTAGTTGGTAAGGTAATGGCTTACCAAGGCAATGA CCTGCGTTGGATTAGCTAGTTGGTGGGGTAA ? GGCCTACCAAGGCCACGA CCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGA CCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGA CCTACGTTAGATTAGCTAGTTGGTAAGGTAATGGCTTACCAAGGCAATGA CCTACGTTAGATTAGCTAGTTGGTGAGGTAATGGCTTACCAAGGCTATGA CCTATGTCAGATTAGCTAGTTGGTGGGGTAATGGCCTACCAAGGCGGTGA CCCGCGTCAGATTAGGTAGTTGGTGAGGTAATGGCTCACCAAGCCGACGA TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGATCTGAGAGGATGATCAGCCACACTGGAACTGAGATACGG TCCATAGCTGATTTGAGAGGATGATCAGCCACATTGGGACTGAGACACGG TGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGG TCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGG TCTATAGCTGGTCTGAGAGGACGATCAGCCACACTGGAACTGAGATACGG TCTATAGCTGGTCTGAGAGGACGATCAGCCACACTGGAACTGAGATACGG TCTGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGG TCTGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGG TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGG??G?CAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA CCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGGGAA CCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAA TCCAGACTCCTACGGGAG--AGCAGTGGGGAATATTGCACAATGGGCGCA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCA CCCAGACTC??ACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA A? ? ?TGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA A? ? 7TGATCCAGCCATGCCGCATGAGTGAAGAAGCCTTTGGGTTGTAAA AGCCTGATCCAGCCATGCCGCATGAGTGAAGAAG-CCTTTGGGTTGTAAA ACCCTGATCCAGCAATGCCATGTGTGTGAAGAAGGCCTTAGGGTTGTAAA AGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAA AGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAA AGCCTGATCCAGCTATGCCGCGTGAGTGAAGAAGGCCTTCGGGTTGTAAA

PAGE 100

95 Ehrlichia_canis Anaplasma_marginale Rickettsia_r ickettsii AGCCTGATCCAGCTATGCCGCGTGAGTGAAGAAGGCCTTCGGGTTGTAAA AGCCTGATCCAGCTATGCCGCGTGAGTGAGGAAGGCCTTAGGGTTGTAAA AGCCTGATCCAGCAATACCGAGTGAGTGATGAAGGCCTTAGGGTTGTAAA M._occidentalis_eggs T ._urticae M._occidentalis_RUSSIAN_SELECT Muse idifurax_uni rap tor Culex_pipiens Aedes_albop ictus Ephestia_cautella Triboliuin_confusum Drosophila_simulans Trichogratrana_pretiosum Rhinocyllus_conicus Wolbachia_persica Bacillus_subtilis Escherichia_coli Cowdria_ruininatiuin Ehrlichia_canis Anaplasma_marginale Rickettsia_r ickettsii M . _occidentalis_eggs T._urticae M . _occ idental i s_RUSSIAN_SELECT Muscidif urax_uniraptor Culex_pipiens Aedes_albop ictus Ephestia_cautella Triboliuin_conf usum Drosophila_simulans Tr ichogramma_pret iosum Rhinocyllus_conicus Wolbachia_persica Baci llus_subtilis Escher ichia_coli Cowdr ia_ruininat ium Ehrlichia_canis Anaplasma_n>arginale Rickettsia_r ickettsii GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCTCTTTTAGTGAGGAAGA TAA TG GCCCTTTCGGTGAGGAAGA TAA TG GCACTTTAGT?GGGGAGGAA-AGCCTTGAGGTTAAT?GCCTTTAGGAATG GCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACCTTG GTACTTTCAGCGGGGAGGAA-GGGAGTAAAGTTAATACCTTTGCTCATTG ACTCTTTTAATAGGGAAGA TAA TG ACTCTTTCAATAGGGAAGA TAA TG ACTCTTTC AGT AGGGAAGA TAA TG GCTCTTTTAGCAAGGAAGA TAA TG ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGCACTCACAGAAGAAGTCCTGGCTAACTCCGC GCCGCGGT ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGTACT-ACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGT GCCGCGGT ACGTTACCC?AAGAATAAGCACCGGCTA?CTCCGTGCCAGCAGCCGCGGT ACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGT ACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGT ACGGTACCTATAGAAAAAGTCCCGGCAAACTCCGTGCCAGCAGCCGCGGT ACGGTACCTATAGAAGAAGTCCCGGCAAACTCTGTGCCAGCAGCCGCGGT ACGGTACCTACAGAAGAAGTCCCGGCAAACTCCGTGCCAGCAGCCGCGGT ACGTTACTTGCAGAAAAAGCCCCGGCTAACTCCGTGCCAGCAGCCGCGGT M . _occ idental is_eggs T ._urticae M . _occ identa 1 i s_RUSS I AN_SELECT Muscidif urax_uni rap tor Culex_pipiens Aedes_albop ictus Ephestia_cautella Tribolium_conf usum Drosophi la_simulans Trichogramina_pret iosum Rhinocyllus_conicus Wolbachia_persica Bacillus_subtilis Escher ichia_coli Cowdr ia_ruminat ium Ehrlichia_canis Anaplasma_marginale Rickettsia_r ickettsii AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGCCGTAAAGGGCGCG AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT — GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT--GGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCG AAT — GGACAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGAGCGCG AATACGGGGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGGGTCTG AATACGTAGGTGGCAAGCGTT ? TCCGGAATTATTGGGCGTAAAGGGCTCG AATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACG AATACGGAGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCACG AATACGGAGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCACG AATACGGAGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATG AAGACGGAGGGGGC ? AGCGTTGTTCGGAATTACTGGGCGTAAAGAGTGCG M . _occidentalis_eggs T . _urt icae M._occ identa lis_RUSSIAN_SELECT Muscidi f urax_uniraptor Culex_pipiens Aedes_albopictus Ephestia_cautella Triboliuin_conf usum Drosophi la_simulans Trichogramma_pret iosum Rhinocyllus_conicus TAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAAT TCGGCT ??????????? ? AAAAGTGAAATCCCGAGGCTTAACCTTGGAAT TAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAAT TAGGCGGATTAGTAAGTTAAAAGTGAGATCCCAAGGCTCAACCTTGGAAT TAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAAT TAGGCTGGTTAGTAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAAC TAGGCTGGTTAATAAGTTAAAAGTGAAATCCCAAGGCTCAACCTTGGAAT TAGGCGGATTAGTAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAAT TAGGCGGATTAGTAAGTTAAAAGTGAAATCCCAAGGCTCAACCTTGGAAT TAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAAT TAGGCTGGTTAGTAAGTTAAAAGTGAAATCCCAAAGCTCAACTTTGGAAT

PAGE 101

96 Wolbachia_persica Bacillus_subtilis Escherichia_coli Cowdr ia_ruminat ium Ehrlichia_canis Anaplasma_marginale Rickettsia_rickettsii M. _occidentalis_eggs T._urticae M._occidentalis_RUSSIAN_SELECT Muscidifurax_uniraptor Cu 1 ex_p ip i ens Aedes_albopictus Ephest ia_cautel la Tribolium_conf usum Drosophila_simulans Trichogramina_pretiosuiii Rhinocyllus_conicus Wolbachia_persica Bacillus_subtilis Escherichia_coli Cowdr ia_ruininat ium Ehrlichia_canis Anaplasma_marginale Rickettsia_ric)cettsii M . _occ idental is_eggs T._urticae M . _occ identa 1 i s_RUSS IAN_SELECT Muscidifurax_uniraptor Culex_pipiens Aedes_albopictus Ephestia_cautella Triboliiim_conf usirai Drosophila_simulans Tr ichogramina_pretiosuin Rhinocyllus_conicus Wolbachia_persica Bacillus_subtilis Escherichia_coli Cowdr ia_ruminat ium Ehrlichia_canis Anaplasma_marginale Rickettsia_rickettsii M . _occidentalis_eggs T . _urticae M . _occ idental i s_RUSS I AN_SELECT Muscidifurax_uniraptor Culex_pipiens Aedes_albopictus Ephes tia_cautel la Tr ibolium_conf usum Drosophila_simulans Trichogramma_pretiosum Rhinocyllus_conicus Wolbachia_persica Bacillus_subtilis Escherichia_coli Cowdr ia_ruininat ium Ehrlichia_canis Anaplasma_marginale Rickettsia_rickettsii TAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCAGGGCTC7ACCTTGGAAC CAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGG CAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAAC TAGGTGGACTAGTAAGTTAAAAGTGAAATACCAAAGCTCAACTTTGGAGC TAGGTGGACTAGTAAGTTAAAAGTGAAATACCAAAGCTTAACTTTGGAGC TAGGCGGTTTGGTAAGTTAAAGGTGAAATACCAGGGCTTAACCCTGGGGC TAGGCGGTTTAGTAAGTTGGAAGTGAAAGCCCGGGGCTTAACCTCG ? AAT TGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACTGCTAATCTAGAGATTGAGAGAGGATAGAGGAATTCCT TGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACTGCTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACGCTTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACTGCTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACTATTAGCCTAGAGATTGAAAGAGGATAGAGGAATTCCT TGCTTTTAAAACTGCTAACCTAGAGATTGAAACAGGATAGAGGAATTCCT TGCATTTGATACTGGCAAACTAGAGTACGGTAGAGGAATGGGGAATTTCT GTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCA TGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCA TGCTTTTAATACTGCTAGACTAGAGGTCGAGAGAGGATAGCGGAATTCCT GGCTTTTAATACTGCTAGACTAGAGGTCGAAAGAGGATAGCGGAATTCCT TGCTTTTAATACTGCAGGACTAGAGTCCGGAAGAGGATAGCGGAATTCCT TGCTTTCAAAACTACTAAT ? TAGAGTGTAGTAGGGGATGATGGAATTCCT GATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG GATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG GATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG AGTGTAGAGGTGAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG GATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG AGTGTAGAGGTGAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG AGTGTAGAGGTGAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG GATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG AGTGTAGAGGTGAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG GATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG AGTGTAGAGGTGAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGG GGTGTAGCGGTGAAATGCGTAGAGATCAGAAGGAACACCAATGGCGAAGG CGTGT ? GCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGG GGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGG AGTGTAGAGGTGAAATTCGTAGATATTAGGAGGAACACCGGTGGCGAAGG AGTGTAGAGGTGAAATTCGTAGATATTAGGAGGAACACCAGTGGCGAAGG AGTGTAGAGGTGAAATTCGTAGATATTAGGAGGAACACCAGTGGCGAAGG AGTGTAGAGGTGAAATTCTTAGATATTAGGAGGAACACCGGTGGCGAAGG CGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAGGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAGGCGCGAAGGCGTG CGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGG??TG CGTCTATCTGGTTCAAATCTGACGCTGAGGCGCGAAGGCGTG CAACATTCTGGACCGATACTGAC?CT?AGGGACGAAAGCGTG CGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGAAAGCGTG CGGCCCCCTGGACGAAGACTGACGCTCAGGTGCGAAAGCGTG CGGCTATCTGGCTCGATACTGACACTGAGGTGCGAAAGCGTG CGGCTATCTGGTTCGATACTGACACTGAGGTGCGAAAGCGTG CGGCTGTCTGGTCCGGTACTGACGCTGAGGTGCGAAAGCGTG CGGTCATCTGGGCTACCACTGACGCTGATGCACGAAAGCGTG

PAGE 102

LIST OF REFERENCES Amano, H., and D. A. Chant. 1978. Some factors affecting reproduction and sex ratio in two species of predacious mites, Phytoseiulus persimilis AthiasHenriot and Amblyseius andersoni (Chant) (Acarina: Phytoseiidae). Can. J. Zool. 56: 1593-1607. Beard, C. B., S. L. O'Neill, R. B. Tesh, F. F. Richards, and S. Aksoy. 1993. Modification of arthropod vector competence via symbiotic bacteria. Parasitol. Today 9: 179-183. Breeuwer, J. A. J., and G. Jacobs. 1996. Wolbachia: intracellular manipulators of mite reproduction. Exp. App. Acar. 20: 421-434. Breeuwer, J. A.J., R. Stouthamer, S. M. Barns, D. A. Pelletier, W. G. Weisburg, and J. H. Werren. 1992. Phylogeny of cytoplasmic incompatibility microorganisms in the parasitoid wasp genus Nasonia (Hymenoptera: Pteromalidae) based on 16S ribosomal DNA sequences. Insect Mol. Biol. 1:25-36. Breeuwer, J. A. J., and J. H. Werren. 1990. Microorganisms associated with chromosome destruction and reproductive isolation between two insect species. Nature 346: 558-560. Breeuwer, J. A. J., and J. H. Werren. 1993. Cytoplasmic incompatibility and bacterial density in Nasonia vitripennis. Genetics 135: 565-574. Bruce-Oliver, S. J., and M. A. Hoy. 1990. Effect of prey stage on life-table attributes of a genetically manipulated strain of Metaseiulus occidentalis (Acari: Phytoseiidae). Exp. App. Acar. 9: 201-217. Burgdorfer, W., L. P. Brinton, and L. E. Hughes. 1973. Isolation and characterization of symbiotes from the Rocky Mountain wood tick, Dermacentor andersoni. J. Invertebr. Path. 22: 424. Bush, G. 1979. Ecological genetics and quality control. In: M. A. Hoy and J. J. McKelvey, Jr., (eds). Genetics in Relation to Insect Management. The Rockefeller Foundation, New York, pp. 145-152. Caprio, M., and M. A. Hoy. 1994. Metapopulation dynamics affect resistance development in the predatory mite, Metaseiulus occidentalis (Acari: Phytoseiidae). J. Econ. Entomol. 87: 525-534. 97

PAGE 103

98 Caprio, M., and M. A. Hoy. 1995. Premating isolation in a simulation model generates frequency-dependent selection and alters establishment rates of resistant natural enemies. J. Econ. Entomol. 88: 205-212. Caprio, M., M. A. Hoy, and B. E. Tabashnik. 1991. Model for implementing a genetically improved strain of a parasitoid. Am. Entomol. 37: 232-239. Caspari E., and G. S. Watson. 1959. On the evolutionary importance of cytoplasmic sterility in mosquitoes. Evolution 13: 568-570. Chant, D. A., R. E. C. Hansell, and H. J. Rowell. 1977. An analysis of intraspecific morphological differences in two closely related species of Amblyseius Berlese using methods of numerical taxonomy (Acarina: Phytoseiidae). Can. Ent. 109: 1605-18. Chant, D. A., R. E. C. Hansell, and H. J. Rowell. 1978. A numerical taxonomic study of variation of Typhlodromus caudiglans Schuster (Acarina: Phytoseiidae). Can. J. Zool. 56: 55-65. Clancy, D. J., and A. A. Hoffmann. 1997. Behavior of Wolbachia endosymbionts from Drosophila simiilans in Drosophila serrata, a novel host. Am. Nat. 149:975-988. Croft, B. A. 1970. Comparative studies on 4 strains of Typhlodromus occidentalis (Acarina: Phytoseiidae) 1. Hybridization and reproductive isolation studies. Ann. Entomol. Soc. Amer. 63: 1558-63. Crow, 1988. The importance of recombination. In: R. E. Michod and B. R. Levin, (eds). The Evolution of Sex. Sinauer, Sunderland, MA, pp. 56-73. Curtis, C. F. 1992. Selfish genes in mosquitos. Nature 355: 511-515. DeBoer, P. A. J., W. R. Cook, and L. I. Rothfield. 1990. Bacterial cell division. Annu. Rev. Genet. 24: 249-274. de Boer, R. 1982. Nucleo-cytoplasmic interactions causing partial female sterility in the spider mite Tetranychus urticae (Acari: Tetranychidae). Genetica 58: 17-22. Dielman, J., and W. P. J. Overmeer. 1972. Preferential mating hampering the possibilty to apply a genetic control against a population of Tetranychus urticae Koch. Z. Angew. Entomol. 71: 156-161. Dyer, J. G., and F. C. Swift. 1979. Sex ratio in field populations of phytoseiid mites (Acarina: Phytoseiidae). Ann. Entomol. Soc. Amer. 72: 149-54.

PAGE 104

99 Edwards, O. R., and M. A. Hoy. 1993. Polymorphisms in two parasitoids detected using random amplified polymorphic DNA (RAPD) PGR. Biol. Control 3: 243-257. Elbadry, E. A., and E. M. Elbenhawy. 1968. Studies on the mating behavior of the predaceous mite, Amblyseius gossypi (Acarina: Phytoseiidae). Entomophaga 13: 159-62. Evans, E. 1993. Biotechnology: New Research Opportunities for the Control of Insects and Vectors, Rockefeller Foundation Report, New York. 107 pages. Felsenstein, J. 1993. PHYLIP (phylogeny inference package) version 3.5c. Department of Genetics, University of Washington, Seattle. Fine, P. E. 1978. On the dynamics of symbiote-dependent cytoplasmic incompatibility in culicine mosquitoes. J. Invert. Path. 30: 10-18. Flaherty, D. L., and G. B. Huffaker. 1970. Biological control of Pacific mites and Willamette mites in San Joaquin Valley vineyards: Part I. Role of Metaseiulus occidentalis. Part II. Influence of dispersion patterns of Metaseiuliis occidentalis. Hilgardia 40: 267-330. Fransz, H. G. 1974. The Functional Response to Prey Density in an Acarine System. Wageningen Gentre for Agricultural Publishing and Documentation, Wageningen, The Netherlands. 147 pages. Ghelelovitch, S. 1952. Sur le determinisme genetique de la sterilite dans le croisement entre differentes souches de Culex autogenicus Roubaud. G. R. Acad. Sci. Paris 24: 2386-2388. Giordano, R., S. L. O'Neill, and H. M. Robertson. 1995. Wolbachia infections and the expression of cytoplasmic incompatibility in Drosophila sechellia and D. mauritiana. Genetics 140: 1307-1317. Girin, G., and M. Bouletreau. 1995. Microorganism-associated variation in host infestation efficiency in a parasitoid wasp, Trichogramma bourarachae (Hymenoptera: Trichogrammatidae). Experientia 51: 398401. Hamilton, W. D. 1967. Extraordinary sex ratios. Science 156: 477-488. Helle, W., H. R. Bolland, R. van Arenkonk, R. deBoer, G. G. Schulten, and V. M. Russell. 1978. Genetic evidence for biparental males in haplodiploid predator mites (Acarina: Phytoseiidae). Genetica 48: 165-71. Hertig, M. 1936. The rickettsia Wolbachia pipientis (gen. et sp. n) and associated inclusions in the mosquito Culex pipiens. Parasitology 28: 453-486.

PAGE 105

100 Hess, R. T., and M. A. Hoy. 1982. Microorganisms associated with the spider mite predator Metaseiulus {=Typhlodromus) occidentalis: Electron microscope observations. J. Invertebr. Pathol. 40: 98-106. Hoffmann, A. A., D. J. Clancy, and E. Merton. 1994. Cytoplasmic incompatibility in Australian populations of Drosophila melanogaster. Genetics 126: 993-999. Hoffmann, A. A., and M. Turelli. 1988. Unidirectional incompatibility in Drosophila simulans: inheritance, geographic variation and fitness effects. Genetics 136:993-999. Hoffmann, A. A., M. Turelli, and L. G. Harshman. 1990. Factors affecting the distribution of cytoplasmic incompatibility in Drosophila simulans. Genetics 126: 933-948. Hoffmann, A. A., M. Turelli, and G. M. Simmons. 1986. Unidirectional incompatibility between populations of Drosophila simulans. Evolution 40: 692-701. Holden, P. R., J. F. Y. Brookfield, and P. Jones. 1993. Cloning and characterization of an ftsZ homologue from a bacterial symbiont of Drosophila melanogaster. Mol. Gen. Genet. 240: 213-220. Horjus, M. and R. Stouthamer. 1995. Does infection with thelytoky-causing Wolbachia in pre-adult and adult life stages influence the adult fecundity of Trichogramma deion and Muscidifurax uniraptorl Proc. Exper. Appl. Entomol. 6: 35-40. Hoy, M .A. 1977. Inbreeding in an arrhenotokous predator Metaseiulus occidentalis (Nesbitt) (Acari: Phytoseiidae). Int. J. Acar. 3:177-122. Hoy, M. A. 1979. Parahaploidy of the "arrhenotokous" predator, Metaseiulus occidentalis (Acarina: Phytoseiidae) demonstrated by X-irradiation of males. Ent. Exp. Appl. 26: 97-104. Hoy, M. A. 1982. Genetics and genetic improvement of the Phytoseiidae. In: M. A. Hoy (ed). Recent Advances in Knowledge of the Phytoseiidae. Univ. Calif. Pub. No. 3284, Berkeley, CA, pp. 72-89. Hoy, M. A. 1985. Recent advances in genetics and genetic improvement of the Phytoseiidae. Annu. Rev. Entomol. 30: 345-370. Hoy, M. A. 1994. Insect Molecular Genetics: An Introduction to Principles and Applications. Academic Press, San Diego, CA. 546 pages. Hoy, M. A., D. Castro, and D. Cahn. 1982. Two methods for large scale production of pesticide-resistant strains of the spider mite predator

PAGE 106

1^ 101 Metaseiulus occidentalis (Nesbitt) (Acarina, Phytoseiidae). Z. Ang. Ent. 94:1-9. . Hoy, M. A., and F. E. Cave. 1988. Premating and postmating isolation among populations of Metaseiulus occidentalis (Nesbitt) (Acarina: Phytoseiidae). Hilgardia 56: 1-20. Hoy, M. A., and N. F. Knop. 1981. Selection for and genetic analysis of permethrin resistance in Metaseiulus occidentalis: genetic improvement of a biological control agent. Ent. Exp. Appl. 30: 10-18. Hoy, M. A., R. M. Nowierski, M. W. Johnson, and J. L. Flexner. 1991. Issues and ethics in commercial releases of arthropod natural enemies. Am. Entomol. 37: 74-75. Hoy, M. A. and J. A. Smilanick. 1979. A sex pheremone produced by immature and adult females of the predatory mite, Metaseiulus occidentalis (Acarina: Phytoseiidae). Ent. Exp. Appl. 26: 291-300. Hoy, M. A., and K. A. Standow. 1982. Inheritance of resistance to sulfur in the spider mite predator Metaseiulus occidentalis. Ent. Exp. Appl. 31:316323. Hoyt, S. C. 1969. Population studies of five mite species on apple in Washington, pp. 117-133. In, Proceedings, 2nd International Congress Acarology. Sutton-Bonnington, England. Acad Kiado, Budapest. Hoyt, S. C, and L. E. Caltagirone. 1971. The developing programs of integrated control of pests in Washington and peaches in California, In C. B. Huf faker, (ed.). Biological Control. Plenum, New York, pp. 395-421. Hsiao, T. 1997. Studies of interactions between alfalfa weevil strains, Wolbachia endosymbionts, and parasitoids. In: W. O. C. Symondson and J. E. Liddell (eds). The Ecology of Agricultural Pests. Chapman and Hall, London, pp. 51-71. Hsiao, C, and T. H. Hsiao. 1985. Rickettsia as the cause of cytoplasmic incompatiblity in the alfalfa weevil. Hyper a postica. J. Invertebr. Path. 45: 244-246. Huffaker, C. B. 1958. Experimental studies on predation: dispersion factors and predator-prey oscilations. Hilgardia 27: 343-383. Hurst, L. D. 1991. The evolution of intrapopulational cytoplasmic incompatibility or when spite can be successful. J. Theor. Biol. 148: 269-277.

PAGE 107

102 laccarino, F. M., and E. Tremblay. 1970. Osservazioni ultrastrutturali suUa Endosimbiosi del Planococciis citri (Risso) (Homoptera: Coccoidea). Boll. Lab. Entomol. Agric. "F. Silvestri" Portici. 28: 35. Johanowicz, D. L., and M. A. Hoy. 1995. Molecular evidence for a Wolbachia endocytobiont in the predatory mite Metaseiiilus occidentalis. J. Cell. Biochem. 21A: 198. Johanowicz, D. L., and M. A. Hoy. 1996. Wolbachia in a predator-prey system: 16S ribosomal analysis of two phytoseiids (Acari: Phytoseiidae) and their prey (Acari: Tetranychidae). Ann. Entomol. Soc. Amer. 89: 435441. Kose, H., and T. L. Karr. 1995. Organization of Wolbachia pipientis in the Drosophila fertilized egg and embryo revealed by anti-Wolbachia monoclonal antibody. Mech. Dev. 51: 275-288. Kostiainen, T. S., and M. A. Hoy. 1996. The Phytoseiidae as Biological Control Agents of Pest Mites and Insects: a Bibliography. Monograph 17, Univ. Florida Inst. Food and Agric. Sci., Gainesville, Florida. 355 pages. Laven, H. 1951. Crossing experiments with Cu /ex strains. Evolution 5:370375. Laven, H. 1959. Speciation by cytoplasmic isolation in the Ciilex pipiens complex. Cold Spring Harb. Symp. Quant. Biol. 24: 166-173. Lee, M. S., and D. W. Davis. 1968. Life history and behavior of the predatory mite Typhlodromus occidentalis in Utah. Arm. Entomol. Soc. Amer. 61: 251-255. Louis, C, B. Pintereau, and L. Chapelle. 1993. Recherches sur I'origine de I'unisexualite: la thermotherapie elimine a la fois rickettsies et parthenogenese thelytoque chez un Trichogramme (Hym., Trichogrammatidae). C. R. Acad. Sci. Paris 136: 27-33. Maddison, W. P. 1989. Reconstructing character evolution on polytomous cladograms. Cladistics 5: 365-377. Maddison, W. P., and D. R. Maddison. 1992. MacClade, version 3. Sinauer, Sunderland, MA. Manton, S. M. 1977. The Arthropoda. Habits, Functional Morphology and Evolution. Clarendon, Oxford. 527 pages. Marroquin, R. 1985. Mass production of screwworms in Mexico, pp. 31-36, In: O. H. Graham (ed). Symposium on Eradication of the Screwzvorm from the United States and Mexico. Entomol. Soc. Amer. Misc. Pub. No. 62.

PAGE 108

103 McMurtry, J. A. 1980. Biosystematics of three taxa in the Amblyseius finlandicus group from South Africa with comparative life history studies (Acarina: Phytoseiidae). Int. J. Acar. 6: 147-156. McMurtry, J. A., and M. H. Badii. 1989. Reproductive compatibiUty in widely separated populations of three species of phytoseiid mites (Acari: Phytoseiidae). Pan-Pac. Entomol. 65: 397-402. McMurtry, J. A., D. L. Mahr, and H. G. Johnson. 1976. Geographic races in the predaceous mite, Amblyseius potentillae (Acarina: Phytoseiidae). Int. J. Acar. 2:23-28. Mead, D. A., N. K. Pey, C. Herrnstadt, R. A. Marcil, and L. M. Smith. 1991. A universal method for direct cloning of PGR amplified nucleic acid. Biotechnology 9: 657-663. Moran, N., and P. Baumann. 1994. The phylogenetics of cytoplasmically inherited microorganisms of arthropods. Trends Ecol. Evol. 9: 15-20. Mueller-Beilschmidt, D. and M. A. Hoy. 1987. Activity levels of genetically manipulated and wild strains of Metaseiulus occidentalis (Nesbitt) (Acarina: Phytoseiidae) compared as a method to assay quality. Hilgardia 55: 1-23. Nagelkerke, G. J., and M. W. Sabelis. 1991. Precise sex-ratio control in the pseudo-arrhenotokous phytoseiid mite Typhlodromus occidentalis Nesbitt. In: R. Schuster and P.W. Murphy (eds). The Acari. Reproduction, Development and Life-History Strategies. Ghapman and Hall, London, pp. 193-207. Nelson-Rees, W. A., M. A. Hoy, and R. T. Roush. 1980. Heterochromatinization, chromatin elimination and haploidization in the parahaploid mite Metaseiulus occidentalis (Nesbitt) (Acarina: Phytoseiidae). Ghromosoma 77: 263-276. Nunney, L. 1985. Female-biased sex ratios: individual or group selection? Evolution 39: 349-361. O'Neill, S. L. 1989. Gytoplasmic symbionts in Tribolium confusum. J. Inverteb. Path. 53: 132-134. O'Neill, S. L., R. Giordano, A. M. E. Golbert, T. L. Karr, and H. M. Robertson. 1992. 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc. Natl. Acad. Sci. U.S.A. 89: 2699-2702. O'Neill, S. L., and T. L. Karr. 1990. Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348: 178-180.

PAGE 109

104 O'Neill S. L., M. M. Pettigrew, T. G. Andreadis, and R. B. Tesh. 1995. An invitro system for culturing Wolbachia symbionts of arthropods. J. Cell. Biochem. 21A: 210. Overmeer, W. P. ]., and A. Q. van Zon. 1976. Partial reproductive incompatibility between populations of spider mites (Acarina: Tetranychidae). Ent. Exp. Appl. 20: 225-236. Perrot-Minnot, M-J., L. R. Guo, and J. H. Werren. 1996. Single and double infections with Wolbachia in the parasitic wasp Nasonia vitripennis: effects on compatiblitiy. Genetics 143: 961-972. Perrot-Minot, M-J., and M. Navajas. 1995. Biparental inheritance of RAPD markers in males of the pseudo-arrhenotokous mite Typhlodromus pyri. Genome 38:838-844. Poinsot, D., and H. Mergot. 1997. Wolbachia infection in Drosophila simiilans: Does the female host bear a physiological cost? Evolution 51: 180-186. Presnail, ]., and M. A. Hoy. 1992. Stable genetic transformation of a beneficial arthropod by microinjection. Proc. Nat. Acad. Sci. USA 89: 7732-7726. Prout, T. 1994. Some evolutionary possibilities for a microbe that causes incompatibility in its host. Evolution 48: 909-911. Proverbs, M. D. 1974. Ecology and sterile release programs, the measurement of relevant population processes before and during release and the assessment of results. In: R. Pal and M. J. Whitten (eds). Use of Genetics in Insect Control. Elsevier, Amsterdam, pp. 210-223. Ramekers, J., S. Hummel, and B. Herrmann. 1997. How many cycles does a PGR need? Determinations of cycle numbers depending on the number of targets and the reaction efficiency factor. Naturwissenschaften 84: 259-262. Reed, K. M., and J. H. Werren. 1995. Induction of paternal genome loss by the paternal sex ratio chromosome and cytoplasmic incompatibility bacteria (Wolbachia): a comparative study of early embryonic events. Mol. Reprod. Dev. 40: 408-418. Richardson, P. M., P. W. Holmes, and G. B. Saul. 1987. The effect of tetracycline on nonreciprocal cross incompatibility in Mormoniella [=Nasonia] vitripennis. J. Inverteb. Path. 50: 176-183. Rigaud, T., C. Souty-Grosset, R. Raimond, J. P. Mocquard, and P. Juchault. 1991. Feminizing endocytobiosis in the terrestrial crustacean Armadillium vulgare Latr. (Isopoda): recent aquisitions. Endocytobiosis Cell. Res. 7:259-273.

PAGE 110

105 Roughgarden, J. 1979. Theory of Population Genetics and Evolutionary Ecology: an Introduction. Macmillan, New York. Roush, R. T., and F. W. Plapp. 1982. Biochemical genetics of resistance to aryl carbamate insecticides in the predaceous mite, Metaseiulus occidentalis. J. Econ. Entomol. 75: 304-07. Roush, R. T., and M. A. Hoy. 1981. Laboratory, glasshouse and field studies of artifically selected carbaryl resistance in Metaseiulus occidentalis. J. Econ. Entomol. 74: 142-147. Rousset, F., D. Bouchon, B. Pintureau, P. Juchault, and M. Solignac. 1992b. Wolbachia endosymbionts responsible for various alterations of sexuality in arthropods. Proc. R. Soc. Lond. B. 250: 91-98. Rousset, F. and M. Raymond. 1991. Cytoplasmic incompatibility in insects: why sterilize females? Trends in Ecology and Evol. 6: 54-57. Rousset, F., D. Vautrin, and M. Solignac. 1992a. Molecular identification of Wolbachia, the agent of cytoplasmic incompatibility in Drosophila simulans, and variability in relation to host mitochondrial types. Proc. R. Soc. Lond. B 247: 163-168. Ryan, S. L., and G. B. Saul II, 1968. Post fertilization effect of incompatiblitiy factors in Mormoniella. Mol. Gen. Genet. 103: 29-36. Sabelis, M. W. 1981. Biological control of two-spotted spider mites using phytoseiid predators. Part 1. Modelling the predator prey interaction at the individual level. Agric. Res. Rept. 910 PUDOC. Wageningen, Netherlands. Sabelis, M. W. 1985. Reproduction and sex allocation. In: W. Helle and M. W. Sabelis (eds). Spider Mites Their Biology, Natural Enemies and Control Vll. Elsevier, Amsterdam, pp. 73-94. Sabelis, M. W. and C. J. Nagelkerke. 1993. Sex allocation and pseudoarrhenotoky in phytoseiid mites. In: D. L. Wrensch and M. A. Ebbert (eds). Evolution and Diversity of Sex Ratio in Insects and Mites. Chapman and Hall, New York, pp. 512-541. Saiki, R. K. 1989. The design and optimization of the PCR. In: H. A. Erlich (ed), PCR Technology: Principles and Applications for DNA Amplification. Stockton, New York, pp. 7-16. Schulten, G. G. M. 1985. Pseudo-arrhenotoky. In: W. Helle and M. W. Sabelis (eds). Spider Mites Their Biology, Natural Enemies and Contro VII. Elsevier, Amsterdam, pp. 67-71.

PAGE 111

106 Schulten, G. G. M., R. C. M. van Arendonk, V. M. Russell, and F. O. Roorda. 1978. Copulation, egg production, and sex-ratio in Phytoseiuliis persimilis and Amblyseius bibens (Acari: Phytoseiidae). Ent. Exp. Appl. 24: 145-153. Sinkins, S. P., H. R. Braig, and S. L. O'Neill. 1995a. Wolbachia pipientis: bacterial density and unidirectional cytoplasmic incompatibility between infected populations of Aedes albopictus. Exp. Parasit. 81: 284291. Sinkins, S., H. R. Braig, and S. L. O'Neill. 1995b. Wolbachia superinfections and the expression of cytoplasmic incompatibility. Proc. R. Soc. Lond. B 261: 325-330. Solignac, M., D. Vautrin, and F. Rousset. 1994. Widespread occurrence of the proteobacteria Wolbachia and partial cytoplasmic incompatibility in Drosophila melanogaster . C. R. Acad. Sci. 250: 461-470. Smith, R. H. 1973. Screwworm control. Science 182: 775. StatView, 1992. Abacus Concepts, Inc. Berkeley, CA. Steiner, M. Y. 1993. Quality control requirements for pest biological control agents. AECV93-R6. Alberta Environmental Centre, Vegreville, AB. 112 pages. Stevens, L. 1989. Environmental factors affecting reproductive incompatibility in flour beetles, genus Tribolium. J. Invertebr. Path. 53: 78-84. Stevens, L., and M. Wade. 1990. Cytoplasmically inherited reproductive incompatibility in Tribolium flour beeetles: the rate of spread and effect on population size. Genetics 124: 367-372. Stouthamer, R., J. A. J. Breeuwer, R. F. Luck, and J. H. Werren. 1993. Molecular identification of microorganisms associated with parthenogenesis. Nature 361: 66-68. Stouthamer, R., and D. J. Kazmer. 1994. Cytogenetics of microbe-associated parthenogenesis and its consequences for gene flow in Trichogramma wasps. Heredity 73: 317-327. Stouthamer, R., R. F. Luck, and W. D. Hamilton. 1990a. Antibiotics cause parthenogenetic Trichogramma (Hymentoptera/ Trichogrammatidae) to revert to sex. Proc. Natl. Acad. Sci. U.S.A. 87: 2424-2427. Stouthamer, R., J. D. Pinto, G. R. Platner, and R. F. Luck 1990b. Taxonomic status of thelytokous species of Trichogramma (Hymenoptera: Trichogrammatidae). Ann. Entomol. Soc. Amer. 83: 475-481.

PAGE 112

107 Suiter, E. C, and W. Weiss. 1961. Isolation of a rickettsia-like microorganism {Wolbachia persica sp. n.) from Argas persicus (Oken). J. Infect. Dis. 108: 95. Swofford, D. L., G. J. Olsen, P. J. Waddell, and D. M. Hillis. 1996. Phylogenetic inference. In: D. M. Hillis, C. Moritz, and B. K. Mable (eds). Molecular Systematics. Sinauer, Sunderland, MA, pp. 407-514. Tanigoshi, L. K., S. C. Hoyt, R. W. Browne, and J. A Logan. 1975. Influence of temperature on population increase of Metaseiulus occidentalis (Acarina: Phytoseiidae). Ann. Entomol. Soc. Amer. 68: 979-986. Tsagkarakou, A., T. Guillemaud, F. Rousset, and M. Navajas, 1996. Molecular identification of a Wolbachia endosymbiont in a Tetranychus urticae strain (Acari: Tetranychidae). Ins. Mol. Biol. 5: 217-221. Turelli, M. 1994. Evolution of incompatibility-inducing microbes and their hosts. Evolution 48: 1500-1513. Turelli, M., and A. A. Hoffmann. 1991. Rapid spread of an inherited incompatibility factor in California Drosophila. Nature 353: 440-442. Turelli, M., and A. A. Hoffmann. 1995. Cytoplasmic incompatibility in Drosophila simulans: Dynamics and parameter estimates from natural populations. Genetics 140: 1319-1338. Turelli, M., A. A. Hoffmann, and S. W. McKechnie. 1992. Dynamics of cytoplasmic incompatibility and mtDNA variation in natural Drosophila simulans populations. Genetics 132: 713-723. Wade, M., and N. Chang. 1995. Increased male fertility in Tribolium confusiim beetles after infection with the intracellular parasite Wolbachia. Nature 373: 72-74. Wade, M., and L. Stevens. 1985. Microorganism mediated reproductive isolation in flour beetles (Genus Tribolium). Science 227: 527-528. Weisburg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173: 697-703. Weisburg, W. G., M. E. Dobson, J. E. Samuel, G. A. Dasch, L. P. Mallavia, O. Baca, L. Mandelco, J. E. Sechrest, E. Weiss, and C. R. Woese. 1989. Phylogenetic diversity of the Rickettsiae. J. Bacteriol. 171: 4202-4206. Weiss, E., and J. W. Moulder. 1984. Order I. Rickettsiales Gieszczkiewicz. In: N. R. Kreig, J. G. Holt (eds), Bergey's Manual of Systematic Bacteriology, Vol. 1. Willians and Wilkins, Baltimore, pp. 687-729,

PAGE 113

108 Werren, J.H. 1997. Biology of Wolbachia. Annu. Rev. Entomol. 42: 587-609. Werren, J. H., L. Guo, and D. W. Windsor. 1995. Distribution of Wolbachia in neotropical arthropods. Proc. R. Soc. Lond. B 262: 147-204. Werren, J. H., W. Zhang, and L. R. Guo. 1995. Evolution and phylogeny of Wolbachia: reproductive parasites of arthropods. Proc. R. Soc. Lond. B 251: 55-71. White, M. J. D. 1973. Animal Cytology and Evolution. Cambridge University Press, Cambridge, 961 pp. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51: 221-271. Vala, P., and J. A. J. Breeuwer. 1996. Hybrid breakdown associated with Wolbachia induced cytoplasmic incompatibility in spider mites. Symbiosis 96! Meeting Abstract pp. 58. Yen, J. H., and A. R. Barr. 1971. New hypothesis on the cause of cytoplasmic incompatibility in Culex pipiens. Nature 232: 657-658. Yen, J. H., and A. R. Barr. 1973. The etiological agent of cytoplasmic incompatibility in Culex pipiens. J. Inverteb. Path. 22: 242-250. Yen, J. H., and A. R. Barr. 1974. Incompatibility in Culex pipiens. In: R. Pal and M.J. Whitten (eds). Use of Genetics in Insect Control. Elsevier, Amsterdam, pp. 97-118. Zchori-Fein, E., O. Faktor, M. Zeidan, Y. Gottlieb, H. Czosnek, and D. Rosen. 1995. Parthenogenesis-inducing microorganisms in Aphytis (Hymenoptera: Aphelinidae). Ins. Mol. Biol. 4: 173-178.

PAGE 114

BIOGRAPHICAL SKETCH Denise Louise Johanowicz was born 12 April 1968 in Los Angeles, California. She was raised in Kenosha, Wisconsin, where she attended St. Mary's Grade School and G. N. Tremper High School. She attended the University of Wisconsin-Madison where she majored in zoology, with a focus on environmental sciences, ethology, and ecology. She married David L. Hei in 1993. That same year she moved to Gainesville, Florida, to start a doctoral program in the Department of Entomology and Hematology at the University of Florida. She is a member of the Florida Entomological Society, the Acarological Society of America, the Entomological Society of America, Gamma Sigma Delta, and Sigma Xi. 109

PAGE 115

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Marjori^ A. Hoy, Chair rT Eminent Scholar of Entomology and Hematology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. J. Howard Frank Professor of Entomology and Hematology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. ^ JonVMlen VPr^fessor of Entomology and Hematology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Johr( pame Associate Professor of Veterinary Medicine

PAGE 116

This dissertation was submitted to the Graduate Faculty of the College of Agriculture and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. December 1997 ' Dean, College of Agriculture Dean, Graduate School