Citation
Heat-shock genes of the mosquito Anopheles albimanus Wiedemann

Material Information

Title:
Heat-shock genes of the mosquito Anopheles albimanus Wiedemann
Creator:
Benedict, Mark Q., 1951-
Publication Date:
Language:
English
Physical Description:
vi, 127 leaves : ill., photos ; 28 cm.

Subjects

Subjects / Keywords:
Drosophila ( jstor )
Genes ( jstor )
Genetic loci ( jstor )
Heat shock proteins ( jstor )
Larvae ( jstor )
Mortality ( jstor )
Nucleotide sequences ( jstor )
Promoter regions ( jstor )
RNA ( jstor )
Shock heating ( jstor )
Dissertations, Academic -- Entomology and Nematology -- UF ( lcsh )
Entomology and Nematology thesis Ph. D ( lcsh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1990.
Bibliography:
Includes bibliographical references (leaves 116-126).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Mark Q. Benedict.

Record Information

Source Institution:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
023959221 ( ALEPH )
23245309 ( OCLC )

Downloads

This item has the following downloads:


Full Text










HEAT-SHOCK GENES OF THE MOSQUITO ANOPHELES ALBIMANUS WIEDEMANN















By

MARK Q. BENEDICT


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY


UNIVERSITY OF FLORIDA


OF r'1071A LIBRARIES


1990














ACKNOWLEDGEMENTS


My appreciation is extended to Claudia Sutton for the D.

melanogaster Hsp70 clones and to Janet Peterson for the Hsp83 clone. I thankfully recognize the Interdisciplinary Committee for Biotechnology Research (ICBR) of the University of Florida for support of the VAX computer, sequence analysis software, and DNA synthesis facilities. I particularly thank Vivian Chang for software trouble-shooting, and Dr. Phil Laipis for valuable PC DNA sequence software. The Multiple Sequence Editor developed at the Massachusetts Institute of Technology was invaluable. Thanks also go to Sharon Mitchell for the A. albimanus lambda genomic library, and Bob Wickham for assistance writing the BASIC program WEIGHTS. Lastly, I am grateful to the guidance of my committee for helpful discussions and criticism, especially Jack Seawright and Andrew Cockburn.


ii















TABLE OF CONTENTS

paae

ACKNOWLEDGEMENTS................................................... ii

ABSTRACT........................................................... v

CHAPTERS

1 HEAT SHOCK GENES.......................................... 1

Introduction........................................... 1
Discovery of Heat Shock Genes.......................... 2
Heat Shock Proteins in Drosophila melanogaster......... 2
Transcriptional and Translational Control
During Heat Shock.................................... 5
The Functions of Heat Shock Genes...................... 6
Heat Shock in Non-Drosophilids......................... 8

2 HEAT-SHOCK MORTALITY AND INDUCED THERMOTOLERANCE

Introduction........................................... 10
Materials and Methods.................................. 11
Heat Shocks...................................... 11
Data Analysis.................................... 12
Results and Discussion................................. 13
Heat Shock Mortality in Relation to Rearing Temperature............................ 13
Preshock-Induced Heat-Tolerance Experiments...... 13

3 ORGANIZATION, LOCATION, AND EXPRESSION OF THE
70 AND 83 KILODALTON HEAT SHOCK GENES IN THE
MOSQUITO ANOPHELES ALBIMANUS

Introduction........................................... 23
Materials and Methods.................................. 24
General Molecular Methods........................ 24
Isolation and Subcloning Mosquito Heat-Shock Genes............................... 25
Transcript Analysis.............................. 26
In situ Hybridization to Polytene Chromosomes.... 28 DNA Sequencing................................... 28


iii









Results and Discussion................................. 32
Isolation and Mapping the Mosquito Hsp70 and Hsp83 Genes.......................... 32
Southern Analysis of Mosquito
Hsp70 and Hsp83 Genes.......................... 33
In Situ Hybridizations........................... 36
Transcript Analysis.............................. 37
DNA Sequence of p70a and p70b.................... 40
Primer Extension................................. 42

4 COMPARISON OF THE DROSOPHILA MELANOGASTER AND
ANOPHELES ALBIMANUS HSP70 GENE FAMILIES

Introduction........................................... 92
Materials and Methods.................................. 93
Results and Discussion................................. 94

5 CONCLUSIONS............................................... 114

REFERENCES CITED....................................................116

BIOGRAPHICAL SKETCH................................................ 127


iv














Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy HEAT-SHOCK GENES OF THE MOSQUITO ANOPHELES ALBIMANUS WIEDEMANN

By

Mark Q. Benedict

August, 1990

Chairman: Dr. Jack A. Seawright
Major Department: Entomology and Nematology
Clones of the Hsp70 and Hsp83 genes of the malaria vector

Anopheles albimanus Wiedemann were isolated from a genomic DNA library. The Hsp70 genes occur at two loci on chromosome 2R. Each locus contains a pair of divergently-oriented uninterrupted reading frames. Transcription start sites were determined by primer extension. Maximal transcription was observed when larvae were heat shocked at 40'C and was 150- to 350-fold above the level of nonshocked larvae. The size of the transcripts determined by northern analysis is consistent with genes encoding 70 kiloDalton (kDa) proteins. The DNA sequences of all of the interstitial and protein-coding regions present were determined and compared to one another, and to the Drosophila melanogaster Hsp70 genes. The nucleotide and predicted protein sequences were 74% and 82% identical to D. melanogaster respectively. Compared to D. melanogaster, mosquito, the regulatory heat-shock elements in the promoters were found to be more numerous, and to more closely match the published consensus.


v









Phylogenetic analysis of the mosquito heat-shock genes

demonstrates that they are homologous to the D. melanogaster Hsp70 genes and not to the Hsp7O-like cognate genes. As in D. melanogaster, the Hsp70 genes of A. albimanus have undergone concerted evolution within each locus, and to a lesser degree, between loci. The mosquito Hsp70 genes are a more divergent family in all regions sequenced than the D. melanogaster family.

The restriction map of a clone containing two Hsp83 genes was determined. The clone hybridized to only one chromosomal locus on chromosome 3L. The clone contains a palindrome, two regions of which hybridize both to cDNA probes and to a D. melanogaster Hsp83 probe. Transcripts were found to be present at moderate levels in nonshocked larvae and were induced only several-fold at 37'C. The size of the transcript is consistent with a gene encoding a 83 kDa protein.

Temperature effects on larval survival were investigated. Larvae were exposed to 30 min. heat shocks at various temperatures. Almost no mortality was observed at 400C, but was complete at 430C. Larval thermotolerance could be induced by a 30 min. exposure to 370C.


vi















CHAPTER 1
HEAT-SHOCK GENES


Introduction



All organisms face environmental stresses that threaten their homeostasis and therefore, survival. It is logical that they have developed genetic systems that respond in biologically appropriate ways.

Genes that respond to stress have only recently been identified and their functions studied. The heat-shock genes fall into this general class called stress-response genes (Atkinson and Walden, 1985)(Pardue et al., 1989). They are distinguished by their inducibility upon temperature elevation or sequence similarity with such genes.

The heat-shock response can be summarized as rapid, reversible, heat-induced synthesis of a small, specific set of proteins and concurrent repression of synthesis of almost all other proteins. Similar heat-shock responses are ubiquitous in animals, plants and microorganisms and have been thoroughly reviewed (Ashburner and Bonner, 1979)(Schlesinger et al., 1982)(Craig, 1985)(Lindquist, 1986) (Lindquist and Craig, 1988). The most extensive work has been done in Drosophila melanogaster due to the ease of manipulation and wealth of genetic information available.


1








2
Discovery of Heat-Shock Genes



In 1962, the first observations were published which hinted that heat-inducible genes existed. Ritossa (1962) noted that certain regions of the polytene chromosomes of Drosophila bucksii puffed rapidly and transcribed RNA at a higher rate when exposed to temperature shocks, dinitrophenol (DNP), or sodium salicylate treatment, but returned to their normal form when the treatments were removed. Thereafter, it was shown that in D. melanogaster a specific set of proteins appears upon heat shock (Tissieres et al. 1974), a fact beautifully confirmed and extended by Lindquist (1980).

The ability of DNP and sodium salicylate to induce a heat-shock response in D. bucksii showed that heat was not the only inducer. For animals, numerous classes of inducers of the heat-shock response were discovered: oxidizing agents, transition series metals, amino acid analogs, steroid hormones, wounding, and recovery from hypoxia. Other classes of inducers and specific effects have been compiled (Nover, 1984).



Heat-Shock Proteins in Drosophila melanogaster


Regardless of the organism, the heat-shock proteins (HSPs) are classified into three groups according to their molecular weight: the 90, 70, and 20 kiloDalton (kDa) groups (Pardue, 1988).

In D. melanogaster, the major HSPs are HSP83 (90kDa class), HSP70 and HSP68 (70 kDa), and the small heat-shock proteins, HSP27, HSP26, HSP23, and HSP22 (all 20 kDa class). Not all are induced to the same







3


level or in the same tissues, nor is the maximal induction temperature the same. As an introduction to the various patterns of expression, I will present an overview of expression of the three major groups of D. melanogaster heat-shock proteins

The Hsp70 genes have been studied most extensively since their transcripts and proteins are the most abundant. Most D. melanogaster strains contain five copies of this gene per haploid genome (IshHorowicz et al., 1979)(Mirault, et al., 1979), and these are believed to be coordinately expressed. Hsp70 transcription occurs at low levels at normal rearing temperatures (250C), is induced only slightly at 33"C, and increases 100- to 1000-fold within minutes at the optimal induction temperature of 37.50C. Translation commences within 5 minutes, and after 1 hour, the heat-shock proteins represent 90% of the total protein synthesized (Lindquist, 1980). Hsp70 genes are expressed in most tissues of the larva and adult with the exception of the brain and the post-meiotic cells of the testes (Bonner et al., 1984).

In contrast, the Hsp83 gene (one copy per haploid genome (Hackett and Lis, 1983)) is transcribed at moderate levels in flies grown at normal temperatures, is transcribed at a several-fold higher rate at 33350C, and is repressed at 37-380C (Lindquist, 1980). The tissuespecific distribution of the protein also differs from that of HSP70. It is generally expressed at moderate levels and in high concentration in ovaries (Mason et al., 1984). This is the only D. melanogaster heatshock gene that contains an intron (Hackett and Lis, 1983), the splicing of which is related to its repression at high temperatures (Yost and Lindquist, 1986).







4


The 20 kDa class of heat-shock genes display yet another variety

of regulation. They are transcribed variably, depending on the stage of development (Mason et al., 1984), are moderately induced by heat shock but are also induced by ecdysone (Ireland et al., 1982) (Morganelli et al., 1985).

In addition to the above genes that are recognized as the genuine D. melanogaster heat-shock genes, other heat-shock-related genes have been identified on the basis of either heat-shock inducibility or sequence similarity. The essential hsromega genes are inducible and located at a major chromosome puff (93D) but may not be translated. Rather, the functional product seems to be the RNAs (Hovemann et al., 1986)(Bendena et al., 1989). Unlike the true Hsp70 genes, the Hsp70 cognate genes contain introns, but show no heat inducibility (Craig et al., 1983). The alpha-beta sequences show heat-inducible transcription but are not translated and probably have no essential function (Craig, 1985).

All of the above true heat-shock genes are located at chromosomal loci which demonstrate heat-inducible puffing. Puffing is generally correlated with increased rates of transcription, and this has been shown specifically for the heat-shock genes (Ritossa, 1962)(Tissieres et al., 1974)(Compton and McCarthy, 1978). Consistent with the changing pattern of transcription during heat shock, RNA Polymerase II accumulates in bands that show heat-induced puffing but not at other loci (Bonner, 1981).

Specific DNA sequences of heat-shock genes are sufficient to initiate puffs. When hybrid genes containing Hsp70 promoters are integrated in the chromosomes of D. melanogaster, new puffs and







5


transcripts appear at the loci where the hybrid genes are located (Lis et al., 1983)(Bonner et al., 1984)(Dudler and Travers, 1984).


Transcriptional and Translational Control During Heat Shock


At elevated temperatures, the heat-shock genes are transcribed and translated at higher rates. However, the expression of almost all other genes is reduced (Tissieres et al., 1974). This has been attributed to both transcriptional and translational controls (reviewed in Bienz and Pelham, (1987)). Previously synthesized transcripts from non-heat-shock genes are not translated during shock, but they are not degraded and are translatable when the cell returns to its normal temperature (Storti et al., 1980). An exception to suppression of expression that has been noted is the histone genes of D. melanogaster (Spadoro et al., 1986).

The unique factors that are necessary for preferential

transcription of heat-shock genes are found in their DNA sequence. Pelham (1982) first identified regulatory regions in the Hsp70 promoter that are necessary for heat-induced transcription. These 14 base pair DNA sequences, called heat-shock elements (HSE), have been found in the promoters of all heat-inducible genes, and the regulatory mechanism of heat-shock genes appears to be highly conserved across the animal kingdom (Pelham, 1985)(Bienz and Pelham, 1987). HSEs are the binding sites for the trimeric heat-shock transcription factor (HSTF or HSF), that is necessary to induce transcription (Parker and Topol, 1984)(Shuey and Parker, 1986)(Perisic et al., 1989). It is present under non-shock conditions and is believed to be activated by phosphorylation (Zimarino and Wu, 1987)(Sorger and Pelham, 1988).







6


The ease with which dramatic changes in transcription and

translation of heat-shock genes can be induced has made them a model system for understanding eukaryotic gene regulation (Pelham, 1985)(Bienz and Pelham, 1987). Also, the conserved nature of Hsp70 transcription induction has been of tremendous benefit to studies of hybrid gene expression. This promoter is the most commonly used for expression of hybrid gene constructs in Drosophila and other insects ( e.g. betagalactosidase (Lis et al., 1983) chloramphenicol acetyl transferase (DiNocera and Dawid, 1983), and alcohol dehydrogenase (Bonner et al., 1984)).

Translational control of heat-shock gene expression allows

preferential translation of heat-shock transcripts over those produced under non-shock conditions. Like transcription, this discrimination is a DNA sequence-specific effect and will be discussed in Chapter 3.


The Functions of Heat-Shock Genes


A traditional approach to understanding the functions of heatshock genes is the isolation of mutations altering or eliminating their expression. The fact that deletion mutants for the D. melanogaster Hsp70 genes are lethal in early embryos or larvae under nonshock conditions demonstrates that they have essential functions unrelated to the high level of expression observed when induced (Ish-Horowicz, et al., 1977). Other searches for D. melanogaster heat-shock expression mutants have resulted in isolation of mutations in unrelated genes that cause synthesis of abnormal proteins, e.g. actin, which induce the







7


normal heat-shock response but are not heat-shock mutations per se (Hiromi et al., 1986)(Parker-Thornburg and Bonner, 1987).

True heat-shock gene mutations that demonstrate the vital function of these genes have been successfully isolated in Escherichia coli and yeast. Deletions reducing expression of the E. coli GroE heat-shock genes prevent growth at normal temperatures, and DnaK (a 70 kDa-group protein) is necessary for heat-shock tolerance (Kusukawa and Yura, 1988). Similarly, mutations of the Saccharomyces cerevissiae heat-shock factor which regulates heat-inducible transcription are lethal (Sorger and Pelham, 1988).

The appearance and regulation of heat-shock transcripts and

proteins was a well-developed area long before the function of heatshock proteins was opened to study at the biochemical level. Early naive suggestions were made that heat-shock proteins somehow prevent or protect against heat-induced protein denaturation and consequent loss of activity. This has proven to be very close to the functions demonstrated by evidence collected in the past few years. HSP60 has a role in mitochondria in maintaining imported proteins in a translocation and assembly-competent form (Cheng et al. 1989)(Ostermann et al., 1989)(Hartl and Neupert, 1990). Cell export of proteins in E. coli is facilitated by HSP70- and HSP60-like proteins, presumably due to facilitated folding (Phillips and Silhavy, 1990). A protein similar to HSP70 is involved in transport competence of proteins destined for degradation in rat lysosomes (Chiang et al., 1989).

A related but more universal function is indicated by studies of the association of HSP70 with newly-synthesized proteins by Beckmann et al. (1990). If these authors are correct, all protein folding may occur







8

not simply as a consequence of its primary amino acid sequence, but as a result of an intimate association with this heat-shock protein. Due to repeated observations of facilitated trafficking and folding as a result of association with heat-shock proteins, the heat-shock proteins are considered "molecular chaperons" or "chaperonins."

Given the deleterious effects of heat-shock mutations on normal and heat-stress growth, and their recently discovered importance in protein folding and translocation, it is not surprising that the appearance of heat-shock proteins and increases in thermotolerance are correlated. Stephanou et al. (1983a) positively correlated heat-shock protein synthesis with increased survival of D. melanogaster that had been genetically selected for heat tolerance. The mediterranean fruitfly, Ceratitis capitata, showed increased survival at normallylethal temperatures if heat-shock protein synthesis was induced by a sublethal heat shock prior to high temperature exposure (Stephanou et al., 1983b)(Stephanou, 1987). Similarly in yeast, exposure of cultures to elevated temperatures before a usually-lethal exposure increased survival and was correlated with increased synthesis of heat-shock proteins (McAlister and Finkelstein, 1980).



Heat-Shock in Non-Drosophilids


Heat shock has been investigated very little in insects besides

Drosophila spp. Many studies have been done in Chironomus (e.g. Vincent and Tanguay (1979), and Barettino et al. (1982)), and a few in Sarcophaga bul7ata (Bultmann, 1986a)(Bultmann, 1986b).







9

Studies of heat-shock-related phenomena in mosquitos are primarily of hybrid gene expression controlled by D. melanogaster Hsp70 promoters in Aedes albopictus cell cultures (Berger et al., 1985)(Durbin and Fallon, 1985)(Fallon, 1986)(Gerenday et al., 1989) or in one case in genetically transformed Anopheles gambiae (Miller et al., 1987). Endogenous mosquito heat-shock proteins have been studied only in A. albopictus cell cultures (Carvalho and Rebello, 1987)(Carvalho and Freitas, 1988)(Gerenday et al., 1989)(Tatem and Stollar, 1989).

Narang et al. (1985) determined the restriction pattern of Anopheles albimanus Wiedemann genomic digests probed with D. melanogaster Hsp70 clones. Beside this investigation, no insect heat-shock genes outside of Drosophila spp. have been studied at the level of gene organization, nucleic acid or protein sequence.

As a first step to understanding the function, structure and expression of heat-shock genes of the malaria vector A. albimanus, I have undertaken experiments regarding three areas of heat shock related to mosquito biology and genetic manipulation: the effect of heat shock on mosquito survival, the structure and expression of the Hsp70 and Hsp83 genes, and the relationship of the mosquito heat-shock genes to those of Drosophila spp..














CHAPTER 2
HEAT-SHOCK MORTALITY AND INDUCED THERMOTOLERANCE



Introduction


Heat-induced thermotolerance has been observed in numerous Diptera, e.g. Drosophila melanogaster (Alahiotis and Stephanou, 1982)(Berger and Woodward, 1983)(Singh and Lakhotia, 1988), Chironomus striatipennis (Nath and Lakhotia, 1989), and Ceratitis capitata (Stephanou et al., 1983b). Generally this is demonstrated by exposing insects to a relatively mild heat shock before exposure to temperatures in the lethal range. Alternatively, insects are reared at various temperatures before the lethal exposure. The results of both types of experiments are consistent with increased survival as a consequence of previous exposure to elevated temperatures.

In this study, similar experiments were conducted for the tropical mosquito Anopheles albimanus. Specifically, I asked at what temperature does heat-induced mortality occur, how broad is the range, and is it affected by the rearing temperature or prior exposure to sublethal heat shock, and do more extreme sublethal heat shocks produce greater thermotolerance?


10







11


Materials and Methods


Heat Shocks

Heat-shock mortality in relation to rearing temperature. A. albimanus larvae from the USDA-Insects Affecting Man and Animals Research Laboratory main colony were reared at 25.0 or 30.0*C ( 0.50C) from egg hatch to the fourth instar on a diet of 2 parts of TetraMin Baby-E Fish Food (Tm) to 1 part brewers yeast (Benedict et al., 1979). One hundred mid to late 4th stage larvae were counted into each of six treatment containers consisting of 100 ml plastic beakers, the bottom of which had been cut off and replaced with fine plastic screen. These were transferred to identical foam ice chests containing approximately 5 liters of municipal supply water adjusted to 37.0, 38.5, 40.0, 41.5 and 43.0*C for the 25.00C rearing tests, or 38.5, 40.0, 41.5 43.0*C, and 44.50C for the 30.0% rearing test. Controls for the heat-lethality tests were larvae counted and handled the same as the heat-treated larvae, but transferred to identical chests filled with 25.0*C or 30.0*C water, depending on the original rearing temperature. The temperature in these chests was maintained within 0.50C by stirring the water, and adding warm water every five to ten minutes. Larvae were held at the different temperatures for 30 minutes and then transferred back to water

at 25.0 or 30.00C for 30 minutes, at the end of which time, dead larvae were counted. These experiments were repeated three times.

Heat-shock mortality in relation to a brief sublethal heat shock.

All larvae for these tests were handled the same as those above and were reared at 250C. Sublethal heat shocks were administered at 28.0, 33.0, or 37.0C for 30 minutes. The control was similar but transferred to







12


25.0*C. Each of these temperature groups contained five groups of 100 larvae. At the end of the heat-treatment period, the larvae were transferred back to 25.0*C for 30 minutes. One beaker from each of the groups was transferred to 25.0, 40.0, 41.5, 43.0, or 44.5*C. They were held there for 30 min. and then once again transferred back to 25.0C for 30 minutes, at the end of which time dead larvae were counted. These experiments were repeated three times.


Data Analysis

All mortality data were transformed by an angular transformation, the arcsin of the square root of the percent mortality. Analysis of variance (ANOVA) and Duncan's Multiple Range Test were used to compare the transformed mortalities using the SAS procedure ANOVA. The main effects of the rearing temperature experiments were replicate, rearing temperature, and lethal-range temperature. Only the temperatures that were used to treat both the 25.0 and 30.0C larvae (38.5, 40.0, 41.5, and 43.0%) were used for statistical comparisons. For the second set of experiments, the main effects considered were replicate, preshock temperature, and lethal-range temperature. Transformed mortalities of

larvae reared at 25.0C in the first set of experiments and controls in the second set that were mock preshocked at 25.0C were compared using the SAS procedure TTEST. The significance level for all statistics was

0.05.







13


Results and Discussion



Heat-Shock Mortality in Relation to Rearing Temperature

A set of experiments was designed to determine larval mortality at various temperatures and whether tolerance to these temperatures could be increased by rearing larvae at a higher temperature. Two rearing temperatures, 25.0 and 30.00C, were chosen. These temperatures promote high survival and reasonable development times. A graphical representation of the mortality data is shown in Figure 2-1. Table 2-1 shows the raw data, and Tables 2-2 and 2-3 show the ANOVA statistics and statistically significant subgroups by Duncan analysis.

Larvae reared at 25.0C were killed in significantly higher

numbers than those reared at 30.00C. This demonstrates that raising the rearing temperature can decrease sensitivity to heat, and that mortality occurs in a very narrow temperature range from 40.0 to 43.0*C.

Mortality was not significantly different at 38.5C from that at 40.0% (Table 2-3). Significant differences occurred between the first

and second replicates among 25.0C-reared larvae (replicates 1-3) Replicate tests of larvae reared at 300C were not significantly different (replicates 4-6). Replicate variation is probably due to uncontrolled variables affecting the very narrow response range. No control mortality occurred in these or the following experiments. Preshock-Induced Heat-Tolerance Experiments.

The second set of experiments determined the effect of a brief sublethal heat shock on heat sensitivity. The sublethal shock temperatures chosen were based on the results of the first sets of experiments above. No mortality had been observed at 37.0C, so extreme







14

shocks were administered at this temperature, moderate shocks at 33.0'C, and mild shocks at 28.0"C. The raw mortality data is graphed in Figure 2-2. Table 2-4 shows the raw data and Tables 2-5 and 2-6, the ANOVA statistics and Duncan groupings.

Larvae preshocked at 37.0C were significantly more resistant to heat-killing than those shocked at 28% or controls. The 28.0 and 33.0% groups show a trend toward decreased sensitivity which might have been statistically significant, if the variability had been lower (Tables 2-4 and 2-6).

Larvae were reared at 25.0*C and heat treated similarly in the

first and second experiments allowing comparison of the mortality. This comparison would allow detection of significant temporal changes in the heat sensitivity of the larvae. This would also reveal effects of handling differences between the first and second experiments. Those possibilities were not realized, because the amount of heat-caused mortality in the 25.0C group of the first experiments, and the 25.0C controls of the second set, were not significantly different (T test, Prob. > F' = 0.94). However, once again in the second set of experiments, statistically significant differences were observed between the first and third replicates probably for the same reasons suggested above.

These experiments show that not only does rearing larvae at higher temperatures increase their resistance to heat-killing, but a relatively

brief 30 minute exposure to 37.0C also increases their heat resistance. Some thermotolerance can probably be induced by the slightest of temperature elevations, however, in these experiments, the resolution is limited by replicate variation due to uncontrolled variables.







15


These observations of inducible thermotolerance after a brief

shock, or as a result of different rearing temperatures, are similar to those made in D. melanogaster (Alahiotis and Stephanou, 1982)(Berger and Woodward, 1983)(Singh and Lakhotia, 1988), C. striatipennis (Nath and Lakhotia, 1989), and C. capitata (Stephanou et al., 1983b). The lethal temperature range that I have observed is also similar to that seen in the above references, although direct comparisons are difficult to make due to differences in the treatment methods and periods after treatment at which lethality was determined. In the experiments reported here, additional delayed mortality might have occurred among larvae that were counted as survivors.

What is the physiological basis for thermotolerance? Although thermotolerance is undoubtedly complex, increased thermotolerance is positively correlated with increased synthesis of heat-shock proteins (reviewed by Craig, 1985). For example, D. melanogaster genetic strains have been selected for cold or warm rearing conditions (Stephanou et al., 1983a)(Alahiotis and Stephanou, 1982). The cold-selected strain is more sensitive than the warm-selected to heat-killing when reared similarly. The sensitive strain produces lower levels of heat-shock proteins than does the insensitive. Other experiments have shown that this genetic effect can be simulated merely by rearing the same strain at two temperatures (Singh and Lakhotia, 1988). Cold-reared D. melanogaster are more sensitive to heat killing than those reared warmer. Similarly, C. capitata that have been preshocked, have higher levels of heat-shock proteins and thermotolerance than larvae not shocked (Stephanou et al., 1983b). The onset of thermotolerance in D. melanogaster embryos occurs at gastrulation, the same stage at which







16


they are able to synthesize heat-shock proteins (Bergh and Arking, 1984). Finally, when D. melanogaster cells are treated with ecdysone, which is known to induce synthesis of the small heat-shock proteins, thermotolerance increases (Berger and Woodward, 1983)(Berger, 1984). Likewise, immature stages of whole animals have greater thermotolerance during periods of higher ecdysone titer.

These experiments, though suggestive, are not as conclusive as

data from Escherichia coli and yeast showing that deletion mutants for heat-shock protein genes are unable to grow at elevated, or sometimes even normal temperatures, but can grow at reduced temperatures (Craig, 1985).

Seasonal variation in the levels of heat-shock protein synthesis probably occurs in mosquitos. This has been observed in natural populations of C. striatipennis (Nath and Lakhotia, 1989). These authors observed seasonal and temperature-related variation in chromosome puffing and in heat-shock protein inducibility. Heat-shock induction of puffs and proteins was greater in larvae that were laboratory-reared at a constant temperature than in those that had been exposed to warmer natural conditions and were already synthesizing heat-shock proteins. The field-collected larvae were also less sensitive to heat killing than the constant-temperature laboratory reared larvae.

Thermoprotection is a common necessity for mosquitos, particularly tropical larvae breeding in exposed sites where daily and seasonal temperature fluctuations occur. These experiments demonstrate that mechanisms exist in A. albimanus to increase its survival under variable temperature conditions.













D

El


LI


VIN A
-


/

/

/


/ /

-iN


L 1


42


43


44


Temperature (*C)


25 C E



Figure 2-1. Results of Rearing-Temperature Experiments. temperatures are plotted against lethal-range temperature.
mortality for larvae reared at 25.0 or 30.00C respectively


30 C /\



The numbers of larvae killed when reared at two
The dotted and dashed lines represent average


'-3


100 80


70



a)
CU

Co


60



40


20



0


36


37


-M
A1


38


39


40


41


45
































41


42


Temperature (0C)


25'C Shock


280C Shock


330C Shock


370C Shock


Figure 2-2. Results of Preshock Experiments. The numbers of larvae killed when preshocked at two temperatures are plotted against lethal-range temperature. The broken lines are average values for the preshock temperatures indicated in the legend.


100 80


60


40

-j
20 0


40


AA


D ---------77


43


H_







19

Table 2-1.
Number of Larvae Killed in
Rearing-Temperature Experiments


Treatment Temperature (0 C, + 0.5) Rearing Temp. Rep. 25.0 30.0 37.0 38.5a 40.0 41.5 43.0 44.5 25.0 1 0 NDb 0 1 9 93 100 ND

25.0 2 0 ND 0 0 5 39 100 ND

25.0 3 0 ND 0 0 10 80 100 ND

average 0 0 0.3 8 70.7 100

30.0 4 ND 0 0 0 0 9 96 100

30.0 5 ND 0 ND 0 0 15 100 100

30.0 6 ND 0 ND 0 0 2 100 100

average 0 0 0 0 8.7 98.7 100

a Only data under the underlined temperatures were used for ANOVA. b ND indicates experiment not done.







20

Table 2-2.
ANOVA Statistics for Rearing-Temperature Experiments


Source Df SS F value Prob. > F

Model 9 31,615 79.59 0.0001

Error 14 618

R2 = 0.98

Dependent Variables Df SS F value Prob. > F

Lethal Temperature 3 28,183 212.59 0.0001

Replicate 5 1,894 378.77 0.0007

Rearing Temperature 1 1,575 35.65 0.0001




Table 2-3.
Duncan's Multiple Range Test Grouping for
Rearing Temperature Experiments


Effect

Lethal Temperature 38.5 40.0 41.5 43.0

Grouping' ---------- ---- ---Replicate lb 3b 2b 5c 6c 4c

Grouping -------I I-------I
---------------- I------- -----------Rearing Temperature 25.0 30.0

Grouping ---- ----------------------------------------a Continuous bars join variables with the same Duncan grouping. b These groups reared at 25*C.


* These replicates reared at 300C.







21

Table 2-4.
Number of Larvae Killed in
Preshock-Induced Heat-Tolerance Experiments


Treatment Temp. (*C, + 0.5) Preshock Temp. Replicate 25.0 40.0 41.5 43.0

25.0 1 0 12 25 100
25.0 2 0 0 68 95
25.0 3 0 0 8 90

average 0 4 33.7 95

28.0 1 0 22 14 100
28.0 2 NDa 3 23 93
28.0 3 0 0 12 94

average 0 8.3 16.3 95.7

33.0 1 0 4 8 96
33.0 2 0 1 13 92
33.0 3 0 0 5 90

average 0 1.7 8.7 92.7

37.0 1 0 2 3 81
37.0 2 0 0 7 83
37.0 3 0 0 6 84

average 0 0.7 5.3 82.7


a Not Done







22


Table 2-5.
ANOVA Statistics for
Preshock-Induced Heat-Tolerance Experiments


Source Df SS F value Prob. > F

Model 7 32,198 73.88 0.0001

Error 28 1,743

R2 = 0.95

Dependent Variables Df SS F value Prob. > F

Lethal Temperature 2 30,599 245.73 0.0001

Replicate 2 615 307.86 0.0145

Preshock Temperature 3 983 327.70 0.0053







Table 2-6.
Duncan's Multiple Range Test Grouping for Preshock-Induced Heat-Tolerance Experiments


Effect

Lethal Temperature 40.0 41.5 43.0

Groupinga

Replicate 1 2 3

Grouping -------I
---------------I---I------------------Preshock Temperature 25.0 28.0 33.0 37.0

Grouping --------------I
----i--u---- jin---------r --ps ---------- ------sn g g

a Continuous bars join groups with the same Duncan grouping.














CHAPTER 3
ORGANIZATION, LOCATION, AND EXPRESSION
OF THE HSP70 AND HSP83 HEAT-SHOCK GENES IN THE MOSQUITO ANOPHELES ALBIMANUS


Introduction


Numerous strategies have been presented to modify and control

agriculturally and medically important insects by both traditional and molecular genetic means (e.g. Cockburn et al., 1984, Kirschbaum, 1985). Molecular efforts to modify mosquitos thus far have concentrated on methods of genetic transformation (Miller et al., 1987)(McGrane et al., 1988)(Morris et al., 1989) and appropriate transformation markers, e.g. (Berger et al., 1985)(Durbin and Fallon, 1985). The effort of isolating and characterizing novel endogenous promoters to drive expression of hybrid genes has been given little attention, due in part to general success expressing genes under the control of the Drosophila melanogaster Hsp70 promoter in other animals: monkey (Pelham, 1982), mouse (Corces et al., 1981), and sea urchin (McMahon et al., 1984).

To date, the Drosophila melanogaster Hsp70 promoter has been used as the inducible promoter for all hybrid gene expression in mosquitos (Berger et al., 1985)(Durbin and Fallon, 1985)(Fallon, 1986)(Miller et al., 1987)(McGrane et al., 1988)(Morris et al., 1989)(Gerenday et al., 1989). The Hsp70 promoter has effectively increased chloramphenicol acetyl transferase (CAT) synthesis 30-fold (Berger et al., 1985) and


23







24

G418 resistance similarly (Miller et al., 1987), although in the latter case low level constitutive expression was observed. These levels of induction of hybrid genes are similar to those observed in D. melanogaster.

Although the D. melanogaster Hsp70 promoter has been adequate for hybrid gene expression in mosquitos, endogenous heat shock promoters might possess differences that would make them superior. These advantages could be either in reduction of the temperatures required to obtain satisfactory expression, the constitutive level of expression, or tissue specificity. Therefore, it is reasonable to study the structure and expression of endogenous heat shock genes to find distinguishing characteristics that suggest their use as an alternative in genetic modification of insects. Additionally, features that are shared with D. melanogaster may reveal unrecognized functional elements which will lead to a better understanding of the regulation of these genes.

Two D. melanogaster genes, Hsp70 and Hsp83, were used as probes to screen a genomic library of the mosquito Anopheles albimanus Wiedemann for homologous genes. These mosquito genes were characterized and evaluated to investigate the potential of mosquito heat-shock promoters for hybrid-gene expression.



Materials and Methods


General Molecular Methods

Gels were 0.5-1.2% agarose (Sigma) buffered and run in IX TBE (0.089 M Tris-borate, 0.089 M boric acid, 2 mM EDTA) at < 5.5 v/cm. Fragments were sized using lambda Hind III or 1 kilobase pair (kbp)







25


ladder fragment standards from Bethesda Research Laboratories (BRL).

Plasmids were prepared by the boiling method (Holmes and Quigley, 1981) or by a modification of the alkaline-lysis method of Birnboim and Doly (1979) and cesium chloride purification. The method of Cockburn and Seawright (1988) was used to prepare insect genomic DNA. Standard methods were used for restriction analysis of plasmid and genomic DNA (Maniatis et al., 1982) except restriction enzymes were used in excess of the manufacturers' recommendations (BRL). RNA and DNA were quantified by UV Abs260.

Prior to hybridization, nitrocellulose filters were baked for 1/2

to 2 hr. at 80C under vacuum and prehybridized in 5X SSPE (20X SSPE is 3.6M NaCl, 0.2M NaH2PO4 pH 7.4, 20mM EDTA pH 7,4), 0.1% SDS and 1% nonfat dry milk (NFDM). The heterologous D. melanogaster probes were hybridized to nitrocellulose lifts of mosquito-library plaques and Southern transfers at 650 C in 5X SSPE, 0.1% SDS, and 1% NFDM. Prehybridizations and hybridizations with homologous probes were performed at 560 C in 5X SSPE, 0.1% SDS, 1% NFDM and 25% formamide.

All films used for autoradiography were Kodak X-AR (Tm) with Kodak X-Omatic Regular (Tm) intensifying screens. The Escherichia coli DH5alpha strain was the host for all plasmids. Bacteria were grown on Luria-Bertani culture medium with 50 ug/ml ampicillin selection.


Isolation and Subcloning Mosquito Heat-Shock Genes

A partial-digest Sau 3A library of genomic DNA from the mosquito A. albimanus was constructed in bacteriophage EMBL3 (S. Mitchell) and cultured in a P2 lysogen, host strain P2392, to select against nonrecombinant phage. This library was screened with nick-translated heat-







26


shock probes for the D. melanogaster 70 and 83 kDa heat-shock-protein genes: plasmid probe aDm2.13 contains the conserved amino-terminal coding region of the D. melanogaster Hsp70 gene (Claudia Sutton, personal communication), and clone pPW244 contains the entire Hsp83 gene (Holmgren et al., 1979). Positively-hybridizing clones were purified, and preliminary restriction maps were constructed by analysis of fragments separated by agarose gel electrophoresis. Restriction fragments that hybridized to the D. melanogaster clones were identified by Southern hybridization (Maniatis et al., 1982), subcloned into puc19, and restriction mapped to higher resolution.


Transcript Analysis

Larval mosquitos were reared at 250C according to the method of Benedict et al. (1979). For heat shocks, 4th stage larvae were transferred to 100ml plastic beakers, the bottom of which had been replaced with fine screen. These were suspended in water for 30 minutes in all experiments. Water baths at 40*C were used except where noted. Nonshocked larvae were maintained at 250C.

Total RNA was prepared from 4th stage larvae by a guanidinium

thiocyanate-phenol method (Chomczynski, 1987). Oligo-dT cellulose (BRL) was used to isolate polyadenylated RNA (Maniatis et al., 1982). For northern analysis, RNAs and 1kb ladder DNA size standards were glyoxalated and run on 1.0% agarose gels in 0.01 M NaPO4 buffer at <5.5 V/cm (Maniatis et al., 1982). Prehybridizations and hybridizations were

at 550C in 5X SSPE, 25% deionized formamide, 200ug/ml salmon sperm DNA,

0.1% SDS, and 5X Denhardt's reagent.







27

Dot blots were used to quantify the relative heat-shock transcript levels under normal and heat-shock conditions. The blots consisted of 5ug of total RNA bound to nitrocellulose filters, and probed with nicktranslated clone p70a.16. To determine the total amount of RNA in each dot, duplicate dot blots were probed with an A. albimanus ribosomal DNA probe. Exposed autoradiograms were quantified by densitometry using a cutoff of 0.02 absorbance units/mm2 as the minimum peak value integrated. This value was also used to calculate relative absorbances when no peak was detected.

Before subcloning into plasmids, cDNA probes were used to

determine the regions of the lambda clones which might be transcribed. cDNA probes were prepared by annealing oligo-dT primers (BRL) to total RNA and extending the primers with cloned M-MLV reverse transcriptase (BRL). Prehybridization, hybridization and autoradiography were the same as for Southern analysis.

Primer extension was used to determine the transcription start

sites. Oligonucleotides based on putative leader sequences were 5' endlabeled with 32P (6000 Ci/mMol, New England Nuclear, NEN) using T4 kinase (BRL). End-labeled oligonucleotides were annealed to

complementary RNAs at 50'C for 5 hr in 1X hybridization buffer (5X is 2 M NaCl, 0.2 M PIPES (pH 6.5), and 5 mM EDTA), and extended with cloned M-MLV reverse transcriptase. The extension products were resolved on 6% denaturing sequencing gels. Sequence standards for the extension experiments were chain-terminated sequencing reactions of the mosquito Hsp70 clones using approximately 5 X 106 dpm of the same end-labeled primers.







28


In situ Hybridization to Polytene Chromosomes

In situ hybridizations to polytene chromosomes were performed by a method (Johnson-Schlitz and Lim, 1987) which has been modified for mosquito polytene chromosomes by S.E. Mitchell (personal communication). Briefly, salivary chromosomes from middle to late 4th stage larvae were dissected in 45% acetic acid, transferred to 1:2:3 (lactic acid: water: glacial acetic acid respectively) and squashed under siliconized coverslips. The slides were refrigerated overnight and then frozen at

-70*C. While still frozen, the coverslips were removed and the slides were transferred to absolute ethanol at -200C, and allowed to warm to room temperature. The slides were then dried, acetylated, denatured in 70 mM NaOH for 1 minute, and hybridized to nick-translated biotinylated DNAs (bio-21-dUTP, Clontech) labeled according to the nick-translation kit recommendations (BRL). Hybridization was detected with streptavidin/alkaline phosphatase (Clontech) using the substrates NBT and BCIP. Chromosomes were counter-stained with Giemsa for about three minutes and observed by phase-contrast microscopy. Band designations were made using the standard polytene chromosome map (Keppler et al., 1973).


DNA Sequencing

The subcloning strategies were designed to eliminate the transfer of deleted fragments to new vectors and to allow use of the standard M13/pUC-universal and T7/T3-alpha-reverse priming sites flanking the multiple cloning site of pUC19.

Deletions for sequencing p70a were made by the Kilo-sequencing method of Barnes (Barnes, 1983) as follows: supercoiled plasmids were







29


nicked with Dnase I, the nick widened with Exonuclease III, and the resulting single-stranded DNA digested with Bal 31. The unique lefthand Sal I site in the polylinker was digested, the ends filled using cloned Klenow fragment of DNA Polymerase I (Klenow)(International Biotechnologies Inc., IBI), and the deletion-bearing plasmids religated. Additional sequence was obtained from p70a.16 with a custom primer, CGTTGAAGTAGGCTG (position 1621, Figure 3-12) based on its sequence, and to extend the 3' ends of the p70a open reading frames (ORFs) with two other primers based on their sequence: GCAGCCAAGGAT (positions 596 and 4498), and CGGAGAAGGAAGAGTACGAGCACCAAATGC (positions 285 and 4790). (All DNA sequences throughout this paper will be shown 5-prime (5') to 3prime (3')).

Subclone p70a.dl was a product of the deletion subcloning for sequence analysis of p70a (Figure 3-3). It was utilized in in situ hybridizations as a clone-specific probe.

Subclones for sequencing the other A. albimanus Hsp70 clone (p70b) were made by cutting the plasmid at the unique Mlu I site in the center of the insert, digesting bi-directionally with Exonuclease III, and removing aliquots at 90 second intervals. The single-stranded DNA was then digested with S1 nuclease. The remaining right-hand portion of the sequence was removed by digesting the unique Hind III site in the multiple cloning site, and the ends were filled using Klenow before ligation at a dilute concentration. Bacteria were transformed by standard methods (Hanahan, 1983) and screened for appropriately sized plasmids. Additional sequence was obtained by sequencing the parent plasmid (p70b) and a subcloned fragment, p70b.5.







30

Sequencing reactions were performed on boiling-method preparations of 2-5 ug of plasmid DNA prepared from 2ml overnight grow-ups. Plasmids were alkali-denatured for primer annealing. Sequenase version 1.0 or

2.0 (Tm, U.S. Biochemical Corp.) was used for chain-termination sequencing (Sanger, 1977) with manufacturer-supplied reaction solutions and procedures. Reaction products were labeled with 3S dATP (5000Ci/mMol, NEN) in buffers containing Mg". Alternatively Mn" was added to increase readability close to the primer for primer extension standards (Tabor and Richardson, 1989). Most sequencing reactions were run on 0.2-0.9 mm wedge gels (4% acrylamide (19:1 linear to bis, LKB), 8M Urea, IX TBE) at 55'C, 1750 volts on an LKB Macrophor (Tm), Sequigen (Tm, BioRad), or user-built electrophoresis unit. All gels were rinsed for 10 min. in 10% acetic acid before drying in a forced-air oven at 80'C. Gels run on the Macrophor were bonded to the running plate, but others were transferred to filter paper for drying and autoradiography. Sequence analysis was done on the Genetics Computer Group (GCG) Software Package (Devereux, 1984) version 6.1, and the Multiple Sequence Editor (Massachusetts Institute of Technology) both running on a MicroVAX II computer. DNA sequences came from Genbank version 60 (June, 1989) or European Molecular Biology Laboratory version 19 (May, 1989) databases.

Dot plot comparisons to identify sequences shared by mosquitos and D. melanogaster were done using the computer program D3HOM (Fristensky, 1984). For mosquito/mosquito comparisons, the homology range was 10 bases and the minimum homology displayed was 60%. For mosquito/D. melanogaster comparisons, the homology range was three and the minimum homology displayed was 80%. In both cases the scale factor was 0.95. These parameters were empirically determined.







31


Heat shock element (HSE) consensus sequences were identified by computer analysis using the consensus of Pelham (Pelham, 1982) with equal weights for all positions, the weighting scheme and definition of Xaio and Lis (1988), and the frequencies of Amin et al. (1988) (Figure 3-1). I wrote a BASIC program WEIGHTS to scan and assign scores to nucleotide sequences based on a user-defined weight matrix (Figure 3-2). The program uses a sliding-window approach similar to many databasesearching and dot plot programs. In this case, a window of the sequence in question is compared nucleotide-by-nucleotide with the weight-matrix values and the sum becomes the score of that window. The window is then advanced to the next position one nucleotide down and the process repeated. The score obtained represents the degree of match to the matrix sequence with provision for unequally weighting each position in the matrix sequence. The program is suitable for scoring any ungapped sequence of up to 50 nucleotides for which nucleotide frequency data is available such as TATA boxes and cap sites (Bucher and Trifonov, 1986), translation start sites (Cavener, 1987) and polyadenylation sites (Birnstiel, 1985). The program also calculates the average score and standard deviation. It is available from the author in BASIC language or compiled.

Dinucleotide frequency chi-square analysis was performed using the procedure FREQ in the SAS software package.







32


Results and Discussion


Isolation and Mapping the Mosquito Hsp70 and Hsp83 Genes

Of 50,000 EMBL3 clones screened, two hybridized to the D.

melanogaster Hsp70 probe and were given the names 70a and 70b. The haploid genome size of anopheline mosquitos is about 2 X 108 bp (Rao and Rai, 1987) and the average insert size in the library is expected to be 15,000 bp. Therefore, assuming random representation of sequences, the probability of missing a single-copy gene in this screen was 0.02. The two pUC19 subclones p70a and p70b (from lamda 70a and 70b respectively) did not overlap and were presumed to represent different loci. The restriction map of each clone has an axis of symmetry (Figures 3-3 and 3-4). This axis in p70a is flanked by 2.5 kbp of sequence with identical six-base restriction sites (as determined by restriction mapping) and in p70b by 2.2 kbp of moderately-conserved restriction sites. As the sequence data presented below will show, each clone contains two Hsp70-similar genes in this palindrome; p70a has two entire genes, and p70b has one entire gene and 80% of the coding region of a second gene, the remainder of which was deleted in the original cloning.

One subclone from each of the two candidate Hsp70 mosquito

subclones p70a and p70b was isolated for probing genomic Southerns. The p70a left-hand central 1.2 kbp Eco RI/Bgl II fragment was transferred to the Eco RI/Bam HI-digested plasmid vector pIBI30 (IBI) as clone p70a.16 (Figure 3-3). Sequence data will show that this sequence contains 0.7 kbp of highly conserved coding sequence and 0.5 kbp of nonconserved upstream leader and promoter region. The central 0.7 kbp Xba I fragment of p70b was cloned into the Xba I site of pIBI30 to create p70b.5







33

(Figure 3-4). This fragment contains only regulatory sequences and does not cross-hybridize with p70a.

Of 34,000 clones screened with the Hsp83 gene of D. melanogaster (pPW244), one positive clone was identified, subcloned into puc19 as p83a and mapped (Figure 3-5). The probability of missing a single-copy gene in this screen was 0.10. Two regions of p83a hybridize both to the Drosophila Hsp83 probe and to radiolabeled heat shock cDNA (Figure 3-9). These data are consistent with two genes, a pseudogene(s), or a single gene containing an intron.

One subclone of p83a was isolated to probe genomic Southern

transfers by cloning a 1.7 kbp Xba I/Bg7 II fragment into the Xba I/Bam HI site of pIBI30. This clone includes regions of p83a to which both the D. melanogaster Hsp83 (data not shown) and mosquito heat-shock cDNA probes hybridized (Figures 3-5 and 3-9).


Southern Analysis of Mosquito Hsp70 and Hsp83 Genes

In order to determine the number of genes homologous to each of these clones and to reveal potential cloning artifacts, the subclones were used as probes of genomic Southern blots. Additional genes would appear as unexpected fragments, and cloning artifacts would be detected by the absence of fragments predicted from the restriction digests of the cloned probes.

Filters of restricted genomic DNA were probed with the p70bspecific subclone p70b.5 (the axial Xba I fragment of p70b) (Figure 36). A single major band appears in each lane: Nsi I, a band of 6.5 kbp, placing a second Nsi I site asymmetrically just outside the cloned portion of the left gene; Mlu I, a 5.4 kbp band, indicating another







34


Hlu I site is symmetrically located in the genome in the uncloned portion of the left gene; Eco RI, the 2.7 kbp central Eco RI fragment of p70b; and Xba I, the 0.7 kbp fragment corresponding to the probe p70b.5. These data indicate that there is one copy of the p70b sequence in the genome.

Similar digests were probed with p70a.16 (Figure 3-6). This

subclone hybridizes to the coding and noncoding regions of the parent plasmid p70a, but less intensely to p70b due to coding and noncoding sequence divergence, and not at all to the axial Xba I fragment of p70b. These digests are interpreted as follows: Nsi I, the 6.5 kbp band is from 70b, the more intense 4.4 kbp band is the predicted central Nsi I fragment of p70a, and the 3.3 kbp band is of unknown origin; Mlu I, the 5.4 kbp fragment is from 70b, and the intense 7.0 kbp fragment is from 70a (the predominant mosquito allele has an internal Mlu I site not present in p70a); Xba I, one faint band is the 4.0 kbp band expected from the right gene of p70b.7 and either the 6.0 kbp fragment or the upper band in the complex around 3.0 kbp may represent the left gene. If the central Xba I site of p70a is not present in all alleles, then

3.0 and 4.5 kbp fragments would result when it is present, and a fragment of 7.1 kbp when it is absent. The sixth fragment is unexplained. Preliminary Southern analysis of individual mosquitos shows that Xba I fragment polymorphism does exist (data not shown). Although the p70a.16 hybridizations are confounded by crosshybridization, p70a is probably a single copy in the A. albimanus genome and occurs in the form cloned or as close variants.

The genomic DNA fragments bearing Hsp70 genes that were detected here are not consistent with those tentatively identified by Narang et







35


al. (1985). Specifically, the sizes of the Hind III and Eco RI fragments that they determined by probing genomic Southerns with D. melanogaster probes are not the same as in the sequences I have studied. This may be due to mosquito strain differences.

I cannot be certain that other Hsp70-related genes such as the

Hsp68 (Holmgren et al.,1979) and Hsc70 heat shock cognate genes (Ingolia and Craig, 1982)(Craig et al., 1983) are not present since the hybridization conditions used were stringent. Data presented below from in situ hybridizations will clarify the organization of the Hsp70 and Hsp83 genes.

Restricted genomic DNA probed with p83a.13 confirms the accuracy of the restriction map of this clone (Figure 3-6). p83a.13 crosshybridizes with the 2.2 kbp Xba I/Bgl II fragment of p83a.1 (data not shown) so p83a also contains two regions of similar sequence. The digests in Figure 3-6 can be interpreted as follows: Xba I; two bands of

3.0 and 3.25 kbp are the cross-hybridizing central Xba I fragment and the p83a.13 fragment that extends to an Xba I site just outside the right-hand plasmid cloning site; Nsi I, the cross-hybridizing 6.5 kbp left-hand fragment expected and a second 5.8 kbp fragment extending to an Nsi I site to the right of the cloning site; Hind III, one prominent band of 6.3 kbp is present so equidistant sites must be located on either side of the single site in p83a, or a second very large fragment was not resolved on this gel; Bgl II, a single band of 5.1 kbp is the expected central fragment containing both the cross-hybridizing regions. These data, together with transcript analysis discussed below, reveal that the sequences present in this clone are palindromic with an axis roughly centered on the single Hind III site. The restriction-site







36


conservation is not high enough to allow one to ascribe equivalence to particular sites in either half.


In Situ Hybridizations

As described in the previous section, two distinct pairs of Hsp70 clones were found in the genomic library. However, some fragments in the genomic Southern hybridizations could not clearly be identified with the clones isolated, so the exact number of loci containing Hsp70 genes was unclear.

To clarify this situation, probes were selected for in situ

hybridizations to polytene chromosomes to define the number of locations of these genes. Clone p70a.16 was expected to hybridize to all Hsp70 loci, but to the p70a locus most intensely. Two clone-specific plasmids, p70a.dl and p70b.5, were used to distinguish their respective loci.

Hybridization of p70a.16 to the polytene chromosomes occurred at two loci on the right arm of chromosome 2 in most complements; a strong signal was seen in the proximal bands of region 13C and a weaker signal in the proximal band of IC (Figure 3-7). Although hybridization could not be seen clearly in both bands in all chromosome complements of each individual, both loci did show signal in most complements.

p70a and p70b were tentatively assigned to 13C and 11C

respectively. This was confirmed by subsequent probing of the salivary polytene chromosomes with the clone-specific probes p70a.dl and p70b.5. Clone p70a.dl hybridized only to IC and p70b.5 only to 13C, conclusively showing that clone p70a is derived from locus 13C and p70b from 11C. This genomic organization of two pairs of genes in divergent







37


orientation on the same chromosome arm is therefore the same as that observed in most Drosophila spp. (Leigh-Brown and Ish-Horowicz, 1981).

Clone p83a hybridized to a single locus, the distal band of 40A, on the left arm of chromosome 3 (Figure 3-7). A single site of hybridization is consistent with the Southern hybridizations and shows the A. albimanus Hsp83 gene(s) is located at a unique locus as in D. melanogaster (Holmgren et al., 1979).


Transcript Analysis

Northern analysis. The mosquito Hsp70 and Hsp83 clones were

isolated in this study by an approach independent of transcription or induction under heat shock. Therefore, RNAs were analyzed to determine the sizes of the transcripts which hybridize to the clones isolated, and their relative abundance under normal and heat-shock conditions. For this purpose, gel electrophoresis was performed for northern analysis.

Northern analysis of total and polyadenylated RNA shows that RNAs that hybridize to the p70a and p70b probes are polyadenylated and strongly induced upon heat shock (Figure 3-8). The filters of total heat-shock RNAs probed with p70a, p70b or p83a give size estimates of

2.6 kb for the Hsp70 transcripts and of 3.0 kb for the Hsp83. Sequence analysis of p70a and p70b (see below) predicts transcripts of 2.1 bp before polyadenylation which is consistent with the size of the RNA detected here. These sizes are also consistent with RNAs encoding proteins of 70 and 83 kDa.

cDNA-probinq of lambda clones. Southern hybridization of

restricted lambda clones probed with cDNAs from heat-shocked larvae identified sequences that hybridize to abundant mRNAs. These







38

preliminary analyses were done using RNA from larvae shocked at 37C for 30 minutes, using the induction temperature that is optimal for D. melanogaster Hsp70.

When restriction digests of lambda clones 70a and 70b were probed with cDNAs made from either nonshocked or heat-shocked larvae, fragments were detected that are consistent with the regions believed to be transcribed based on sequence analysis (Figure 3-9). This also demonstrated that these genes are transcribed at a low level until heatshock induction. The first four lanes in the left hand panel show that the 9.4 kbp Hind III/Sal I fragments of 70a and 70b contain all of the sequences complementary to abundant RNAs during heat shock. Only faintly-hybridizing bands were observed when digests of 70a or 70b were probed with nonshock cDNA. The Xho I/Sal I digest of 70a yields hybridizing fragments of 2.5 kbp, the left-hand fragment which extends slightly into the downstream end of the coding region, and a larger 9.4 kbp fragment which is the downstream end of the right-hand gene and flanking DNA. The failure of either the central or internal Xho I fragments to hybridize indicates that the polyA-primed cDNA extensions generally terminated before these regions were reached. The Xho I digest of 70a gives three hybridizing fragments, some of which appeared to be due to a partial digest and were not interpretable. Only one 70b fragment is detected in the Xho I or Xho I/Sal I digests, representing the 3' end of the right gene. No fragment from the left gene is detectable since only the 3' ends of the genes are labeled, and this part of the left gene was not cloned.

Clone 83a contains sequences that hybridize to abundant RNAs in

both normal and heat-shocked larvae (Figure 3-9). Only one hybridizing







39


band is seen in the Bam HI/Sal I and Sal I digests: the Sal I fragment subcloned into p83a. The insert contains no Bam HI sites. In the Hind III/Sal I digest, the 5.3 and 3.5 kbp fragments are the left and right fragments of the Sal I fragment subcloned into p83a. Two major regions of 83a hybridize to the cDNA probes (Figure 3-5) confirming that p83a contains two regions with similar sequences, as would be expected based on the cross-hybridization of p83a.13 to the other p83a Xba I/Bgl II fragment, and the hybridization pattern of the Drosophila Hsp83 probe.

The filters of Figure 3-9 were probed with aliquots of the same cDNA probe, washed similarly, and the films were exposed for the same amount of time. Therefore, comparisons of the signals suggest that the Hsp83 genes are normally transcribed at moderately high levels relative to the Hsp70 clones, and are induced only slightly at 37*C. The Hsp7O clones have much lower levels of nonshock transcription, and show lower induction at 370C than Hsp83.

Dot blots of total RNA. In order to determine the effect of

various temperatures on Hsp70 transcript levels, dot-blot analysis was performed by hybridizing one of the mosquito Hsp70 subclones, p70a.16, to total RNA.

Maximal expression was observed at 40'C, rather than at 37*C as in Drosophila (Figure 3-10). Heat-shock transcript levels at 400C ranged from 15 to 335 times higher than controls (avg. = 143). The temperature at which the highest transcript levels was observed is similar to that of Aedes albopictus (Gerenday, 1989)(Berger et al., 1985) and Plodia cells in culture (Berger et al., 1985). No RNA isolations were done







40


using larvae shocked at 43C since mortality was observed at that temperature.

Once I had determined that maximal induction occurred at 40*C,

experiments were conducted to determine the relative transcript levels over time: before, during, and after a 30 minute heat shock. Dot blots of total RNA probed with p70a.16 showed that transcripts increase 140to 520-fold (average = 320) and peak within 15 minutes of heat shock (Figure 3-10). They then gradually decrease, but transcripts are still easily detectable 21/2 hours after the shock ends. The average transcript level at 30 minutes is 275 times that of controls, which is similar to the induction observed in the temperature dot-blot experiments above. Since p70a.16 hybridizes to both pairs of Hsp70 genes, the induction measured is a composite of RNAs transcribed from all four genes. I collected no data that clearly indicate the relative contribution of the four genes present. However, I have observed consistently stronger signals from p70a in northern and cDNA analysis.

The results of the primer-extension experiments will be discussed following the DNA sequence data.


DNA Sequence of p70a and p70b

The DNA sequences of p70a and p70b were determined for the

putative coding and promoter regions of both pairs of genes, except for the C-terminal end of the left gene of p70b which was truncated in the clone. The major features of p70a and p70b sequences are listed in Table 3-1. Each plasmid contains two large divergently oriented open reading frames (ORFs) (Figures 3-3, 3-4, 3-12 and 3-13). The right- and







41

left-hand ORFs and conserved upstream regions will be referred to as the right and left genes.

DNA sequence of p70a genes. The p70a transcription start sites and putative translation start and stop codons predict open reading frames of 1923 bp for both genes and mRNAs with untranslated leaders of 222 and 231 bp for the left and right genes respectively. Only 515 bp separate the transcription start sites. The region between the TATA boxes is slightly A+T-rich (55%) though not as greatly so as the spacer region of the D. melanogaster Hsp70 genes (Torok and Karch, 1980). This is close to the average composition of 58% A+T for A. albimanus determined by A. F. Cockburn (personal communication) and indicates that although unusually high A+T content is seen in the D. melanogaster Hsp70 spacer, the mosquito spacer has average composition. There is remarkable sequence similarity between the two genes from 150 bp upstream of the TATA boxes to the distal ends of the ORFs, although there are insertion/deletions, particularly in the untranslated leaders (Figure 3-14 and 3-15). In contrast to the promoter and transcribed regions, the left and right genes have no obvious sequence conservation downstream of the translation stop codons (to be discussed in Chapter 4).

I observed 26 nucleotide differences between the 1923 bases of the protein-coding regions of the left and right genes: 1, 0, and 25 at the first, second and third positions of codons (18 transitions, 8 transversions). The predicted amino acid sequences differ by one conservative substitution at residue 562; aspartic vs. glutamic acid. The predicted molecular weights of the left and right gene-encoded proteins are 70,251 and 70,237 Daltons (Da).







42


Several large palindromic regions occur in the spacer region

centered around bases 2394 and 2724. These consist of, or are adjacent to the heat-shock-element (HSE) arrays just upstream of the TATA boxes (discussed further below). One palindrome of 23 bases surrounds the Bgl II site at 2516 off the central axis toward the left gene.


Primer extension.

DNA sequence information alone is of relatively little value for identifying regulatory regions unless the transcribed regions are known precisely. For our purposes particularly, the 5' end of the transcripts should be mapped since sequences necessary for heat shock induction are found upstream to, and in this region. Primer extension involves annealing a radiolabeled DNA primer to RNA which provides an initiation site for cDNA synthesis from 3' to 5' along the RNA. The RNA serves as a template for this enzyme-directed synthesis until the end 5' end is reached. The resulting cDNA fragment is analyzed on sequencing gels using DNA sequencing reactions as sequence and size standards.

Primer-extension experiments on total RNAs were used to map the

transcription start sites of the Hsp70 genes. Minor sequence divergence in p70a allowed synthesis of right- and left-gene-specific 20-mers with three mismatches: TCTGATACACTGATTACTTA and TCTAATGCACTGATTACTTG (positions 2934 and 2161 respectively, Figure 3-12). The specificity of these was confirmed by using them as primers to sequence p70a which contains both annealing sites. Since no leader-sequence differences downstream of the suspected transcription initiation site were available to distinguish the right from the left genes of p70b, a synthetic 25-mer







43


primer (TTATACGCTTTCTGATGCAACAATT) was used to map the transcripts of both (positions 1573 and 2639, Figure 3-13).

Primer-extension experiments mapped the transcription start sites of p70a to bases 2290 and 2805 (Figure 3-16), 31 bases from the first bases of the TATA boxes. Identification of these start sites accords well with predictions based on the D. melanogaster start sites and typical distances from the TATA box (Bucher and Trifonov, 1986). No bands were observed in the nonshock RNA control lanes.

The primer chosen for p70b hybridizes to both genes of that clone, so the products of this experiment could have originated from one or both of the genes. However, since the sequence of the pair is the same for about 250 bp flanking this site, it is likely that they are transcribed similarly. Two pairs of bands were observed. The more prominent ones correspond to initiation sites at bases 1687 and 1690 for the left gene, and at 2522 and 2525 for the right gene. Since the putative TATA box is repetitive (TATATAAA in Fig 3-17), and a tandem repeat of GTCGTC is found at the transcription start (Figure 3-15), transcription may initiate in both positions, within 29 or 32 bp from the TATA box. This determination again fits well with comparison of similar sequences of D. melanogaster and TATA box predictions.

An unusual sequence observed in the p70a untranslated leaders.

The untranslated leader sequences contain a curious sequence of 51 bases completely devoid of thymidines beginning 4 bases after the transcription start sites (Figure 3-17). The major recognizable pattern is seven tandem repeats of CAAG which can be generalized to C-A/G-A-G/A. The same pattern is found to a limited extent in a similar location in three D. melanogaster genes known to be preferentially transcribed and







44

translated during heat shock: Hsp70 (McGarry and Lindquist, 1985), Hsp22 (Hultmark et al., 1986), and other D. melanogaster heat shock genes (Figure 3-17). It is not found in other insect genes or the Hsp83 gene which are not efficiently transcribed and preferentially translated under heat shock (compiled by Hultmark et al. (1986)).

Could this motif represent the DNA sequence responsible for

preferential translation, and to a lesser extent efficient transcription of these genes during heat shock? Undefined sequences in the first 30 bases of the leader are known to be necessary for efficient heat-shock transcription and preferential translation of Hsp22 (Hultmark et al., 1986), and Hsp70 (McGarry and Lindquist, 1985) and are sufficient to confer this quality on D. melanogaster YP1 (Kraus et al., 1988) and Adh transcripts (Klemenz et al. 1985). However, only a very loose consensus sequence has been identified.

What mechanisms might account for the supposed transcriptional and translational functions of this sequence? In D. melanogaster Hsp70 genes, RNA Polymerase II (Pol II) is known to be transcriptionally engaged near the 5' end of the RNA in nonshocked cells with an approximately 25-base nascent mRNA synthesized, but elongation is prevented by some unknown mechanism until heat shock occurs (Perisic et al., 1989). Perhaps some transcription factor binds to a conserved sequence in this region to regulate transcription. Alternatively, capping of mRNA may regulate translatability and transcript stability differently under heat shock and normal conditions. Maroto and Sierra (Maroto and Sierra, 1988) have shown that cap analogues inhibit the translation of normal D. melanogaster mRNAs and Hsp83 transcripts but not other heat-shock transcripts. Sequences near the start of heat-







45


shock transcripts may either interfere with normal capping or bind factors which allow preferential translation of heat-shock transcripts during shock.

The CAAG sequence is absent from the p70b transcription start sites. It is also not present in D. melanogaster Hsp70 clone B8 (Ingolia et al., 1980). Perhaps greater variation exists in the expression of different copies of Hsp70 genes than has previously been supposed. The sequence variation in this region might confer differential expression controls upon the Hsp70 genes which expands the repertoire of stress response, and the presence or absence of repeats of the above sequence motif may be responsible.

DNA sequence of p70b genes. Clone p70b contains two ORFs of 1506 and 1923 bp, in divergent orientation like those of p70a (Figures 3-4 and 3-13). The cloning site truncates the left gene at amino acid 502, but the right gene is complete, and would encode a peptide of 641 amino acids and molecular weight 70,153 Da. The TATA boxes are separated by a spacer which is 60% A+T.

Comparison of the sequences of the two genes revealed a singlebase deletion in the right gene. This deletion, which was unequivocally identified in two independently obtained deletion subclones of p70b at position 3419, would alter the translation frame and cause termination at codon 262. This deletion might exist only in the parent clones, or it may be the native genomic form. Since no other features of this sequence suggest it is a pseudogene, I have tentatively inserted an "N" into the deletion to restore the reading frame for sequence and evolutionary analysis. The "N" is inserted in the third position of a codon and does not affect the predicted amino acid.







46


A cloning artifact was identified by sequencing through the lefthand Sal I subcloning site. Rather than the desired Sal I insertion on the left end, the insert was added 3' to the Sph I 5' "G" in the pUC19 multiple cloning site (MCS), thus preserving the MCS Pst I site. It is highly improbable that the multiple cloning site would have been recreated by the insert so a cloning artifact is almost certain. All of the sequences involved in this artifact are vector sequences and do not affect conclusions about the Hsp70 insert sequence.

The right and left transcription start sites are separated by 831 bp which is 316 bp more than in p70a. The length of the nontranslated leader of both genes is either 181 or 184 bp depending on the transcription start site used (discussed below).

The divergent genes of p70b are more similar to one another than the p70a pair. The untranslated leaders are identical and the promoters have more extensive regions of sequence similarity upstream of the TATA box; about 250 bp rather than 150 bp as in p70a (Figure 3-14). In the 1506 bp of protein-coding DNA compared between the left and right genes, there are only two differences out of 1506: both are third position changes and are silent.

Sequence comparisons between D70a, D70b and D. melanogaster Hsp70 genes. The p70a and p70b genes share conserved sequences with each other and with the D. melanogaster Hsp70 genes at the translation start site (Figure 3-15). Similar sequences are found in most eukaryotic genes (Cavener, 1987). The protein-coding regions are similar as are the sequences at, and immediately upstream of the TATA boxes. However, the untranslated leaders are very dissimilar.








47

A codon usage table was generated for the A. albimanus Hsp70 genes and listed parallel to usage for the D. melanogaster Hsp70 (Table 3-2). Visual inspection indicates differences between A. albimanus and D. melanogaster usage for threonine, serine, leucine, and proline. This information will serve as an aid to codon selection for future mosquito synthetic gene construction.

A dinucleotide frequency table was generated for the mosquito protein-coding regions, putative untranslated mRNA-encoding leader sequences, and spacers between TATA boxes (Table 3-3). The distributions all deviated significantly from expected values (chisquare test, P < 0.001, 9 degrees of freedom). GG, CC, and TA pairs were consistently under-represented; GA and TC were over-represented, the latter especially so in coding regions. Inconsistencies between dinucleotide frequencies of different types of sequences compared were observed for GT pairs which are frequent in the spacer and coding regions but relatively infrequent in both leaders.

Protein-binding CT DNA sequences of p70a and D70b. Gilmour et al. (1989) have identified regions of the Hsp70, Hsp26, and His3 (D. melanogaster Histone-3) promoters that bind a protein that is supposed to have a role in assembling and maintaining transcriptional complexes in transcriptional preparedness. This protein binds to regions of alternating C and T within approximately 200 bases upstream of the TATA box. A similar if not identical protein binds to the partially complementary sequence C/A-G-A-G-A-G-A-G-C in the D. melanogaster Ultrabithorax promoter (Biggin and Tjian, 1988). In the p70a interstitial region, no extensive CT repeats occur although three small regions around 2350, 2477, and 2527 are similar. However, the sequences







48

of the D. melanogaster protein-binding regions are so variable that one cannot rule out functionally equivalent sequences in this clone. Sequences resembling the CT protein-binding regions do occur in p70b upstream of the TATA box around 1910, extensively at 2300, and also at 2450 and 2390. However, the significance of these, if any, is unknown.

Promoters of the p70a and p70b genes. Heat-shock elements are

essential regulatory sequences found upstream of the transcription start sites of heat-inducible genes (reviewed by Pelham (1985)). Two sets of HSE within 100 bases of the TATA box are necessary for heat inducibility. Pelham (1982) originally defined the HSE as the 14 base palindrome CTNGAANNTTCNAG by deletion analysis of hybrid constructs in monkey COS cells. Xiao and Lis (1988) have redefined the HSE as overlapping 10 bp sequences of NTTCNNGAAN. This work was corroborated by Amin et al. (1988) using Hsp70/LacZ fusions to transfect D. melanogaster cells. These definitions, though arrived at by different means, all overlap, i.e. are circular permutations.

On the basis of these definitions, potential HSEs were identified in the promoter sequences of p70a and p70b using the program WEIGHTS. Figures 3-14 and 3-18 compare the mosquito and D. melanogaster promoters and indicate the high-scoring HSE-like regions. The locations of the mosquito HSEs are similar to that observed in the D. melanogaster Hsp70 and other heat-shock genes (Pelham, 1985). However, the mosquito HSE are more numerous and match the consensus more closely than those of D. melanogaster. Scanning sequences with the Xiao and Lis matrix contributed little additional information.

Might mosquito Hsp70 promoters be superior to those of D. melanogaster for the expression of hybrid genes in mosquitos?







49


Drosophila Hsp70 promoters are clearly inducible in whole mosquitos (Miller et al., 1987) and mosquito cell cultures (Durbin and Fallon, 1985) (Berger et al., 1985), but mosquito promoters are potentially superior in several ways. First, the mosquito Hsp70 promoters might be induced to a higher rate of transcription than the commonly used D. melanogaster Hsp70 promoter. This would make it possible to obtain better discrimination with genetic markers, and achieve higher recovery of transformed individuals. Additionally, adequate transcript levels might be obtained by shocking with lower temperatures so that less stress would result to the insect. My analysis of mosquito heat shock promoter sequences suggests they may indeed be stronger promoters based on sequence composition (Xiao and Lis, 1988) and numbers of HSE (Kraus et al., 1988).

A second set of possible improvements relate to the temporal and tissue-specific induction of mosquito heat-shock promoters. Heat shock promoters that contain very abundant HSE have been identified whose expression is modulated in tissue- and developmentally-specific ways by other promoter sequences. These other sequences may not be apparent, nor conserved in other genera, e.g. the ecdysone response of the small heat-shock genes (Ireland et al., 1982)(Simon and Lis, 1987) and tissuespecificity of Hsp83 of D. melanogaster (Xiao and Lis, 1989). Though ubiquitous expression is the rule using a D. melanogaster Hsp7O promoter, tissue-specific exceptions are observed (Bonner et al., 1984), and mosquito Hsp70 promoters may differ advantageously by being either more or less specific.

A third characteristic of the mosquito promoters which might be exploited is the divergent orientation of the genes. The presence of







50


this arrangement in both mosquitos and Drosophila spp., whether due to convergence or conservation, suggests that it has functional significance. The function may be to promote conversion within the gene pair (Leigh-Brown and Ish-Horowicz, 1981) (to be discussed further in Chapter 4), or the divergent arrangement may allow HSE to act simultaneously on two different genes. There is precedent for bidirectional regulation of genes from common HSEs in Dictyostelium (Zuker et al., 1984) and for Caenorhabditis elegans heat shock promoters in mouse cells (Kay et al., 1986). The extremely close proximity of the HSE arrays of the two divergent gene pairs, particularly of p70a, may promote cooperativity between DNA-binding proteins that affect both transcription units simultaneously. In contrast, the D. melanogaster Hsp70 promoters in use for hybrid gene expression are single upstream arrays, derived in fact from loci at which the genes are in tandem repeats, unlike Hsp70 genes in most Drosophila species.

Another possible advantage of maintaining the divergent

orientation might be to exclude regulatory proteins from interfering with proper expression. For example, the D. melanogaster Hsp83 promoter contains regions upstream of the TATA box-proximal HSE that are responsible for tissue and temporal-specific expression. If these are deleted, regulation is similar to Hsp70 (Xiao and Lis, 1989).

One might object that no improvement would be made in gene

expression by using promoters with HSE at a distance of greater than 100 bp since HSE beyond that distance are not considered to be necessary to induce the heat-shock response in transgenic animals (Pelham, 1982)(Corces and Pellicer, 1984). However, HSE do occur beyond that distance both in Drosophila and A. albimanus (Figures 3-14 and 3-18) and








51


have been shown to be important in regulation of the small heat shock protein genes (Simon and Lis, 1987).

It is possible to address the functional significance of the divergent orientation using either D. melanogaster or A. albimanus symmetrical promoter regions to control the expression of two different divergently transcribed reporter genes. Constructs such as this could be altered by varying the distance separating the genes, mutating one half, or creating absolute symmetry without an intervening diverged region. These hybrid genes could then be transfected into cultured cells, assayed by transient expression, or introduced into Drosophila by P-element transformation (Rubin and Spradling, 1982). Variable results due to chromosomal location would tend to affect each reporter similarly, but could be controlled further by comparing different transformed lines carrying the same construct. Reporter differences could be controlled by placing either gene in both positions relative to the asymmetries of the promoter. These experiments have the potential to reveal subtle effects on Hsp70 promoter activity that have been overshadowed by the large effects due to the HSE.

The mosquito heat shock promoters that I have isolated have potential for improving hybrid gene expression. The considerations above clearly dictate that this will be resolved only by experimentation.









HSE Matrix (Xiao and Lis, 1988)
G A T C U Y


0
0
0
0
0
0
40
0
0
0


0
0
0
0
0 15
0 36
41 11


11
41 36
0 15
0
0
0
0
0


0
0
0
40
0
0
0
0
0
0


Pos

1
2
3
4
5
6
7
8
9 10





Pos


0
0
0
0
0
0
0
0
0
0


1982)
U


0
0
0
0
0
0
0
0
0
0


Y


0
0
0 10
0
0
0
0
0
0
0
0
0 10


0 0 10
0 10 0
0 0 0
0 0 0
10 0 0
10 0 0
0 0 0
0 0 0
0 10 0
0 10 0
0 0 10
0 0 0
10 0 0
0 0 0


0 0
0 0
0 0
0 0
0 0
0 0
0 0
0 0
0 0
0 0
0 0
0 0
0 0
0 0


Figure 3-1. HSE Scoring Matrices For Use in the Program WEIGHTS. The upper matrix is from Xiao and Lis (1988). Only scores above 200 were saved. The lower matrix is based on the general consensus of Pelham (1982) using a score cutoff of 70. In the latter matrix, each position is weighted equally. The third matrix of Amin et al. (1988) is based on nucleotide frequencies in a 38 bp region of recognized heat shock promoters from several species. The minimum score saved in that analysis was 1100. Weighting tables for sequence analysis by WEIGHTS should be created as text files in the form shown above. Fractional values may be used as well.


52


HSE Matrix (Pelham, G A T C


1
2
3
4
5
6
7
8
9 10 11
12
13
14







53


HSE Weight Matrix (Amin et al.,1988) Pos G A T C U Y

1 0 0 0 0 0 0
2 20 46 19 16 0 0
3 0 0 0 0 0 0
4 0 0 0 0 0 0
5 0 0 0 0 0 0
6 0 0 0 0 0 0
7 26 19 39 16 0 0
8 10 13 6 71 0 0
9 0 0 0 0 0 0
10 19 39 10 32 0 0
11 87 0 10 3 0 0
12 3 81 3 13 0 0
13 3 84 13 0 0 0
14 0 0 0 0 0 0
15 0 0 0 0 0 0
16 6 7 68 19 0 0
17 10 6 81 3 0 0
18 0 3 0 97 0 0
19 36 6 39 19 0 0
20 26 45 3 26 0 0
21 90 0 0 10 0 0
22 6 84 3 7 0 0
23 26 64 0 10 0 0
24 0 0 0 0 0 0
25 39 16 19 26 0 0
26 6 3 81 10 0 0
27 10 10 74 6 0 0
28 7 3 0 90 0 0
29 19 10 45 26 0 0
30 0 0 0 0 0 0
31 39 19 19 23 0 0
32 0 0 0 0 0 0
33 0 0 0 0 0 0
34 0 0 0 0 0 0
35 0 0 0 0 0 0
36 0 0 0 0 0 0
37 32 13 39 16 0 0
38 29 7 19 45 0 0


Figure 3-1--continued.










10 KEY OFF: CLS 20 DS = 5020 30 DWR = 50 40 DWC = 6 50 DIM SCORE(DS) 60 DIM SEQ$(DS) 70 DIM WGT(50, 6) 80 Z = 0

100 INPUT "ENTER WEIGHT TABLE 110 OPEN QFM$ FOR INPUT AS #2 120 IF EOF(2) THEN GOTO 300 130 LINE INPUT #2, TITLE$ 140 IF EOF(2) GOTO 300 150 LINE INPUT #2, LETRS$ 160 IF EOF(2) GOTO 300 170 LINE INPUT #2, DASH$ 180 IF EOF(2) GOTO 300 190 PRINT TITLE$ 200 PRINT LETRS$ 210 PRINT DASH$ 220 IF EOF(2) GOTO 300 230 Z = Z + 1 240 LINE INPUT #2, REC$ 250 PRINT REC$


'Dimensions length of sequence array
'Weight array length
'Weight array width
'Dimensions the score output array
'Dimensions the sequence array
'Dimensions the weight array


FILE NAME: ", QFM$


FOR X = 1 TO WGT(Z, X) = NEXT X GOTO 220
Y = 0
PRINT


DWC
VAL(MID$(REC$,


(X * 6) + 1, 4))


INPUT "ENTER SEQUENCE FILE NAME : ", FLN$ INPUT "ENTER SCORE OUTPUT FILE NAME : ", OFN$ INPUT "WHAT IS THE MINIMUM SCORE YOU WANT SAVED? : ", MN PRINT ""
OPEN FLN$ FOR INPUT AS #1 IF EOF(1) GOTO 450 LINE INPUT #1, REC$ E = LEN(REC$) FOR X = 1 TO E Y = Y + 1 SEQ$(Y) = MID$(REC$, X, 1) NEXT X
GOTO 370
A = Y + 1 - Z


Figure 3-2. WEIGHTS. The program WEIGHTS was written in Quick Basic (Tm Microsoft) and was designed to score windows of DNA sequence relative to a user-defined weight matrix. Input files should consist only of the DNA sequence in a text file and the weight matrix file should be formatted exactly as the examples in Figure 3-1.


54


260 270
280 290 300 310 320 330
340 350 360 370 380 390
400 410 420 430 440 450








55


B = Z - 1 FOR NUC = 1 TO A FOR ROW = 0 TO B C = NUC + ROW D = ROW + 1 IF INSTR("Gg", SEQ$(C)) > IF INSTR("Aa", SEQ$(C)) > IF INSTR("Tt", SEQ$(C)) > IF INSTR("Cc", SEQ$(C)) > IF INSTR("AaGg", SEQ$(C)) IF INSTR("CcTt", SEQ$(C)) NEXT ROW
NEXT NUC


460 470 480 490 500 510 520 530
540 550 560 570 580


THEN SCORE(NUC) = THEN SCORE(NUC) = THEN SCORE(NUC) = THEN SCORE(NUC) = 0 THEN SCORE(NUC) 0 THEN SCORE(NUC)


SCORE(NUC)+WGT(D, 1) SCORE(NUC)+WGT(D, 2) SCORE(NUC)+WGT(D, 3) SCORE(NUC)+WGT(D, 4) = SCORE(NUC)+WGT(D, 5) = SCORE(NUC)+WGT(D, 6)


OPEN OFN$ FOR APPEND AS #3 PRINT "Sequence output file: "; OFN$ PRINT "Sequence filename: "; FLN$ PRINT ""
PRINT "Weighting table used: "; QFM$ PRINT "Minimum score saved "; MN PRINT "Number of nucleotides examine PRINT ""
PRINT "POSITION SCORE"
PRINT "-------------------"
PRINT #3, "Sequence output file: "; PRINT #3, "Sequence filename: "; FLN PRINT #3,
PRINT #3, "Weighting table used: "; PRINT #3, "Minimum score saved "; M PRINT #3, "Number of nucleotides exa PRINT #3, ""
PRINT #3, "POSITION SCORE"
PRINT #3, "-------------------"
FOR Q = 1 TO A
TOT = TOT + SCORE(Q) IF SCORE(Q) >= MN THEN PRINT Q, SCOR NEXT Q
AVG = TOT / A
FOR Q = 1 TO A
SUM = SUM + ((SCORE(Q) - AVG) A 2) NEXT Q
STDEV = SQR(SUM / (A - 1)) PRINT #3, "------------------"
PRINT #3, "Average score value "; A PRINT "Average score value "; AVG PRINT #3, "Score standard deviation PRINT "Score standard deviation "; PRINT #3, "End of scano


d: ";


Y


590 600 610 620 630
640 650 660 670 680 690 700 710 720
730
740 750 760 770 780 790 800 810 820 830
840 850 860 870 880 890 900 910 920


Figure 3-2--continued.


0
0
0
0


)FN$ QFM$ nined: "; Y





E(Q): PRINT #3, Q, SCORE(Q)






G

"; STDEV STDEV


.








56


930 PRINT 940 PRINT 950 PRINT


"End of scan." #3, #3,


960 CLOSE 970 SYSTEM


I


Figure 3-2--continued.








H Ba


lambda 70a


R Ba SS

L


p70a


p7Oa. 16


S Xb N RPX B CXR
r7 I 1 I 1.11 1. 11


B


RXC B


Left ORF TATA Right ORF


(N ) P X N (M B B


1 kbp


Figure 3-3. Restriction Maps of p70a and Lambda Clone, 70a. The locations of TATA boxes are indicated, and the extent and direction of the open reading frames are shown by arrows. The bars beneath the p70a sequence indicate the extent of DNA sequence data. The left and right arms of the lambda vector are marked L and R. The left end of p70a.dl is approximated. Enzymes are abbreviated as follows: B-Bgl II, Ba-Bam HI, C-Cla I, H-Hind III, M-Mlu I, N-Nsi I, P-Pst I, R-Eco RI, S-Sal I, X-Xho I, Xb-Xba I, (M), the Mlu I site in mosquito DNA that is not present in this clone. Enzymes that do not digest the p70a insert are Bam HI, Bc! I, Kpn I and Bst EII.


U,
-.1


S

R


p70a.dl R H








S






P P C X
B
S B R


/5'


H


XS I I


X R I I


S


lambda 70b


p70b.5
fxxx Xb Xb


X C P P
BX
R B 11111 1 1


MBa X Bs NBa II I I I I


Left ORF TATA Right ORF


1 kbp


Figure 3-4. Restriction Maps of p70b and Lambda Clone 70b. The locations of TATA boxes are indicated, and the extent and direction of the open reading frames are shown by arrows. The bars beneath the p70b sequence indicate the extent of DNA sequence data. The left and right arms of the lambda vector are marked L and R. Enzymes are abbreviated as follows: B-Bg1 II, Ba-Bam HI, Bs-Bst E2, C-Cla I, H-Hind III, M-Mlu I, N-Nsi I, P-Pst I, R-Eco RI, S-Sal I, X-Xho I, Xb-Xba I. Kpn I and Bcl I do not digest the p70b insert.


X


S

R


p7Ob


Xb


XH


Z-j







S

L


p83a

S N


S


S


lambda 83a


B


S

R


p83a. 13


K


Xb


K


Bs


Xb
H


NXb


II


K


B


SH


pPW244 I -cDNA


I I
1kbp




Figure 3-5. Restriction Maps of p83a and Lambda Clone 83a. The left and right arms of the lambda vector are marked L and R. Regions that hybridized to either heat shock cDNA probes or pPW244 are indicated by bars under the map. Enzymes are abbreviated as follows: B-Bgl II, H-Hind III, K-Kpn I, N-Nsi I, P-Pst I, S-Sal I, Xb-Xba I. Enzymes that do not digest the p83a insert are Eco RI, Bam HI, Xho I, Sal I, Bcl I, and Mlu I.


ZI-1


-.. . .. . .











p7Ob.5

N M R X


m -


p79a.16
N M R X


p83 a.13

X NH B


23.1

9.4
6.6
4.4


2.3
2.0-


as-


0.6-


Figure 3-6. Southern Hybridizations of Restricted Genomic panel) or p83a.13 (right panel). Enzymes are as follows: and X-Xba I.


DNA. DNAs were probed with p70b.5, p70a.16 (left B-Bgl II, H-Hind III, M-Mlu I, N-Nsi I, R-Eco RI,
0


23.
A.
44-







61


Figure 3-7. In Situ Hybridizations. Biotinylated probes were hybridized to the salivary-gland polytene chromosomes of A. albimanus. Panels and probes used: A and B, p70a.16 which cross-hybridizes to p70a and p70b and in the chromosomes to both 11C and 13C; C and D, p70a.dl which is p70a-specific hybridizes only to one locus 13C; E, p70b.5 is p70b-specific and hybridizes only to 11C; F and G, probed with p83a which hybridizes only to 40A.


13C

11C -11C





-




-3 13C

40A








A40A
I lo . *1~ '















6,1085,0904,0723054

2,0361,6361,018-


N HS (B) N HS


,H.


MS


p7Oa


Tot
HS N


pA+
HS N


p70b


Tot
HS N


pA+
HS N


Figure 3-8. Heat Shock Northerns. Each lane in the left-hand panel contained 5 ug of total RNA from larvae not shocked (N), or heat-shocked at 40'C for 30 minutes (HS), probed with nick-translated plasmids: A, p70a; B, p70b; C, p83a. The size standard was glyoxalated 1 kbp ladder. (The blemish on the blot between the lanes of p70b-probed RNA is not an RNA band). The right panel compares lanes of 5 ug total RNA or 1 ug polyadenylated RNA from larvae not shocked (N), or heat-shocked at 40"C for 30 minutes (HS). Probes for the right-hand panel are shown above the appropriate lanes.


I


a)~
t.J















70a 70b
H H S H S H






Sum


N R R S R S R


-H SIN-


23.1
9.4
6.6
4.4

2.3
2.0





0.6-


70a
x
S x


70b
x
x S


-~ 9.


70b
Xb S Xb


23.1

9.4
6.6

4.4



2.3
2.0





0.6-


HS N
Ba H R Xb - X
SS S S H R S S S Xb S X


Figure 3-9. cDNA-Probed Lambda Clones. Restricted lambda clones 70a, 70b, and 83a were probed with cDNAs made from larvae shocked at 37*C for 30 minutes (HS) or nonshocked (N). These indicate the relatively low level of hsp70 transcription under non-shock conditions and slight induction of the Hsp83 upon shock. All filters were probed with aliquots of the same probe and exposed for 41 hr. Restriction enzymes used are H-Hind III, R-Eco RI, S-Sal I, X-Xho I, and Xb-Xba I. These filters were from preliminary experiments to define the RNA-hybridizing regions and to confirm that these clones contained heat-inducible genes before further subcloning. The shock temperatures chosen were thus based on D. melanogaster.


23.1
9.4
6.6
4.4

2.3
2.





0.64


mm is.


I


I


I
































25 28 31 34 37 40

Temperature C


0


0


0



+ a
0

0
U


15 30 45 60


Shock Period


90 120 150


Minutes


Figure 3-10. RNA Profiles. Relative induction of p70a.16-hybridizing transcripts upon heat shock for 30 minutes at various temperatures (upper graph) or over time (lower graph). Methods for obtaining the values are discussed in Materials and Methods.


350


64


E
E




E
(1)
C CU
0 .0


a)


300 250

200 ~ 150 100 50 -


0


g


500


400


E

C)
C
0 .0
a, a) >U


Replicate 1 Replicate 2 o Replicate 3 Average


Replicate 1 Replicate 2 Replicate 3 Average


-8
180


300 200 100


0


0


I


600







65


Table 3-1.
Features of p70a and p70b Clones


p70a p70b

Left Gene Right Gene Left Gene Right Gene

ORFa 2068-146 3037-4959 1506-1 2706-4628

TATA Box 2321-2315 2773-2779 1719-1712 2493-2500

Transc. Start 2290 2805 1687,1690 2522,2525

Transl. Start 2068 3037 1506 2706

PolyA Signalb 19-14 ? ? 4636


aDistances listed indicate the position on the sequence in Figures 3-12 and 3-13 and are listed numerically according to the putative direction of transcription.
bPolyadenylation sites should be considered tentative. cQuestion marks indicate no clear polyadenylation sites were observed.







66


TATTTGGTTAACATTTATTAACATTCGCTGATAATATATCATACTGATGGCAACATTATG
1 ---------+---------+----------+----------+----------+----------+ 60

Eco RI
AGCCCATAATTTATCATGAATTCATCTAGTCTTAGAGTCTTTGTTAATCTTCTCTCCTAG
61 ---------+---------+----------+----------+----------+----------+ 120


TTTAAAGTTGGCTGAACATTGATATTTAGTCCACCTCTTCCACCGTCGGTCCCGTCCTTC
121 ---------+----------+----------+----------+----------+----------+ 180
EndAspValGluGluValThrProGlyThrArgGly

CGCCGAATCCTCCAGCTTGCTGTCCACAGCTGGTTGGTTGCGGACCACCAGCCGCTTGCT
181 ---------+---------+----------+----------+----------+----------+ 240
GlyPheGlyGlyAlaGInGlnGlyCysSerThrProGlnProGlyGlyAlaAlaGlnGln

Pst I
GATGCAGTTTGGTCATGATGGGACTGCAGACCCGCGACAACTCTTGCATTTGGTGCTCGT
241 ---------+----------+----------+----------+----------+----------+ 300
HisLeuLysThrMetIleProSerCysValArgSerLeuGluGInMetGlnHisGluTyr


ACTCTTCCTTTTCCGCCATTGTGTTGCCATCGATCCATCGCAGAGTCTCGTCGCATCGAT
301 ---------+---------+----------+----------+----------+----------+ 360
GluGluLysGIuAlaMetThrAsnGlyAspIleTrpArgLeuThrGluAspCysArgAsp


CCTGCACCGTTCTGCGATCGGCTTCGCTGAGTTTGCTCGATCCTTCTCCGTCCAGGGATT
361 ---------+----------+----------+----------+----------+----------+ 420
GInValThrArgArgAspAlaGluSerLeuLysSerSerGlyGluGlyAspLeuSerGIn

Xho I
GTTTCAGGTTGAAGCAGTATGCCTCGAGCTGATTGCGTGCGGCAATGGCCTCTCGCTGCT
421 ---------+---------+----------+----------+----------+----------+ 480
LysLeuAsnPheCysTyrAlaGluLeuGInAsnArgAlaAlalleAlaGluArgGlnLys


TCTCATCCTCCTCGCGGTACTTTTCGGCCTCCGATACCATTCGATCGATGTCGGCCTGCG
481 ---------+---------+----------+----------+----------+----------+ 540
GluAspGluGluArgTyrLysGluAlaGluSerValMetArgAspIleAspAlaGlnSer


ATAGGCGACCTTTATCGTTCTTGATCGTGATATICITCTCTTTTCCGCTGCTCTTATCCT
541 ------------------+----------+----------+----------+----------+ 600
LeuArgGlyLysAspAsnLysIleThrIleAsnLysGluLysGlySerSerLysAspLys


Figure 3-12. DNA Sequence of p70a Right and Left Genes and Spacer Region. Restriction sites mapped and shown in Figure 3-3 are underlined as are the TATA boxes and transcription start sites. The sequence begins with the transcribed strand of the left gene. Heat-shockelement-like sequences are shaded and are underlined where they overlap.







67


TGGCTGCGACGTTCAGGATTCCGTTTGCGTCCAGATCGAAAGTCACCTCGATCTGCGGTA
601 ---------+---------+----------+----------+----------+----------+ 660
AlaAlaValAsnLeuIleGlyAsnAlaAspLeuAspPheThrValGluIleGlnProVal


CACCACGTGGGGCCGGCGGGATGCCCGAGAGGTCGAACTGTCCCAAAAGATTGTTGTCCT
661 ---------+---------+----------+----------+----------+----------+ 720
GlyArgProAlaProProIleGlySerLeuAspPheGlnGlyLeuLeuAsnAsnAspLys


TGGTCATGGCTCGCTCTCCTTCGAATACCTGGATCGAGACTCCGGGCTGGTTGTCGGCGT
721 ------------------+----------+----------+----------+----------+ 780
ThrMetAlaArgGluGlyGluPheValGlnIleSerValGlyProGlnAsnAspAlaTyr

Bgl II
ACGTCGAGAAGATCTTCGTCTGTTTGCAAGGAATGCGCGAGTTGCGTTCAATCAGCTTCG
781 ---------+----------+----------+----------+----------+----------+ 840
ThrSerPhelleLysThrGlnLysCysProIleArgSerAsnArgGluIleLeuLysThr


TCATCACACCTCCGGCCGTCTCGATGCCAAGCGACAATGGAGCGACATCCACCAGCAGCA
841 ---------+---------+----------+----------+----------+----------+ 900
MetValGlyGlyAlaThrGlulleGlyLeuSerLeuProAlaValAspValLeuLeuVal


CGTCCTGAATCTTGTCATCCTTGTCGCCGCTAAGGATGGCCGCTTGCACCGCAGCACCGT
901 ---------+----------+----------+----------+----------+----------+ 960
AspGlnIleLysAspAspLysAspGlySerLeuIleAlaAlaGlnValAlaAlaGlyTyr


ATGCTACCGCTTCGTCCGGGTTGATCGAAAGGTTCAACGACTTTCCAGCGAAGAAGTTCT
961 ---------+---------+----------+----------+----------+----------+ 1020
AlaValAlaGluAspProAsnIleSerLeuAsnLeuSerLysGlyAlaPhePheAsnGln


GCAACAGGGACTGCACCTTCGGTATGCGAGTTGAGCCTCCTACCAGGACGATATCGTGAA
1021 ---------+----------+----------+----------+----------+----------+ 1080
LeuLeuSerGlnValLysProIleArgThrSerGlyGlyValLeuValIleAspHisIle


TGGAGCTCTTATCCATCTTCGCATCGGACAGAGCCTTCTCCACCGGCTGCAACGTCGAAC
1081 ---------+----------+----------+----------+----------+----------+ 1140
SerSerLysAspMetLysAlaAspSerLeuAlaLysGluValProGlnLeuThrSerArg

Cla I
GGAACAGGTCCGAGCATAGCTCCTCGAATCGTGCCCGGCTGATCTTCGTGTAATAATCGA
1141 ---------+----------+----------+----------+----------+----------+ 1200
PheLeuAspSerCysLeuGluGluPheArgAlaArgSerlleLysThrTyrTyrAspIle


Figure 3-12--continued.







68


Xho I
TGCCATCCATCAGGGCGTCAATCTCGATCGTTGCTTCCGTGCTCGAGGACAACGTGCGCT
1201 ---------+----------+----------+----------+----------+----------+ 1260
GlyAspMetLeuAlaAspIleGluIleThrAlaGluThrSerSerSerLeuThrArgLys


TTGCCCGTTCACATGCCGTTCTCAAACGCCGCAGGGCTCGGGCATTCTTCGACAGATCCT
1261 ---------+----------+----------+----------+----------+----------+ 1320
AlaArgGluCysAlaThrArgLeuArgArgLeuAlaArgAlaAsnLysSerLeuAspLys

Eco RI
TCTTGAATTTCCGTTTGAATTCCTCCACGAAGTGAGCCACCATCCGGTTGTCAAAGTCTT
1321 ---------+----------+----------+----------+----------+----------+ 1380
LysPheLysArgLysPheGluGluValPheHisAlaValMetArgAsnAspPheAspGlu


CGCCTCCTAGATGAGTGTCTCCAGCAGTAGCACGCACTTCGAACAGCGATCCCTCGTCGA
1381 ---------+----------+----------+----------+----------+----------+ 1440
GlyGlyLeuHisThrAspGlyAlaThrAlaArgValGluPheLeuSerGlyGluAspIle


TCGTCAGGATGGAAACGTCGAAGGTTCCGCCACCCAGATCGAAGATCAGCACGTTCCGTT
1441 ---------+----------+----------+----------+----------+----------+ 1500
ThrLeulleSerValAspPheThrGlyGlyGlyLeuAspPheIleLeuValAsnArgGlu


CTCCCTTCAGGTTCTTATCCAAGCCGTACGCCAGAGCTGCCGCCGTCGGTTCGTTGATGA
1501 ---------+----------+----------+----------+----------+----------+ 1560
GlyLysLeuAsnLysAspLeuGlyTyrAlaLeuAlaAlaAlaThrProGluAsnIleIle


TGCGCATCACATTCAAGCCAGCGATGGCTCCAGCATCCTTTGTGGCCTGTCGCTGACTGT
1561 ---------+----------+----------+----------+----------+----------+ 1620
ArgMetValAsnLeuGlyAlaIleAlaGlyAlaAspLysThrAlaGlnArgGlnSerAsp


CGTTGAAGTAGGCTGGTACTGTGATGACTGCATTTTTCACTGACTGTCCCAAGTAGGCTT
1621 ---------+----------+----------+----------+----------+----------+ 1680
AsnPheTyrAlaProValThrIleValAlaAsnLysValSerGlnGlyLeuTyrAlaGlu


CGGCGGTTTCCTTCATCTTCGTCAGGACCATTGAACTGATTTCCTCGGGGGCAAAGGTTT
1681 ---------+----------+----------+----------+----------+----------+ 1740
AlaThrGluLysMetLysThrLeuValMetSerSerIleGluGluProAlaPheThrLys


TGCGCTCGCCCTTGAACTCGACACGGATCTTGGGTTTGCCGCAATCGTTCACCACCGTGA
1741----------+----------+----------+----------+----------+----------+ 1800
ArgGluGlyLysPheGluValArgIleLysProLysGlyCysAspAsnValValThrPhe


Figure 3-12--continued.








69


ATGGCCAGTGCTTCATATCGGCCTGGATCTTCGGATCATCGAATTTGCGTCCAATCAACC
1801 ---------+----------+----------+----------+----------+----------+ 1860
ProTrpHisLysMetAspAlaGlnIleLysProAspAspPheLysArgGlylleLeuArg


GCTTGGCATCGAATACCGTGTTGGTCGGATTCATGGCCACCTGGTTCTTGGCTGCATCTC
1861 ---------+----------+----------+----------+----------+----------+ 1920
LysAlaAspPheValThrAsnThrProAsnMetAlaValGlnAsnLysAlaAlaAspGly


CGATGAGCCGCTCCGTGTCCGAAAAGGCAACGTAGCTCGGTGTTGTTCGGTTGCCCTGGT
1921 ---------+----------+----------+----------+----------+----------+ 1980
IleLeuArgGluThrAspSerPheAlaValTyrSerProThrThrArgAsnGlyGlnAsp


CGTTTGCGATGATCTCCACCTTTCCATGCTGGAACACACCCACGCACGAGTACGTGGTGC
1981 ---------+----------+----------+----------+----------+----------+ 2040
AsnAlaIleIleGluValLysGlyHisGlnPheValGlyValCysSerTyrThrThrGly

Start Codon
CCAGGTCAATTCCAATTGCAGACGGCATTCTGTGTTTGTTGCTCTCGATGTTTTCTCTCA
2041 ---------+----------+----------+----------+----------+----------+ 2100
LeuAspIleGlyIleAlaSerProMet


GAAATCTCGATAATACTTCACTTGTTGCACTTGAAACTGTGTGTTGTAACTGATTCACTT
2101 ---------+----------+----------+----------+----------+----------+ 2160


TCTAATGCACTGATTACTTGACTTTTATCTCTCTTGGTGATAAGGGATTCTATCTTTCGT
2161 ---------+----------+----------+----------+----------+----------+ 2220


ATCTTCACGTGTTAGCTTCGCGCCGTTCTTGGCTCTCTTGCTTGCTTGTTCGCTTGTTTG
2221 ---------+----------+----------+----------+----------+----------+ 2280

Transcription Start TATA Box
TGTTCAACTGACAGTGGCTGCTCGAACTGCTCGGTTTATATGAAACCACTTGCATTCM
2281 ---------+----------+----------+----------+----------+----------+ 2340

Palindrome <-------------------$d.TCG ATTCTGCTCGATGCGAGT
2341 ---------+---------+----------+---------+---------+----------+ 2400


AGAATGTCCCTAGCAGCTGCGCCTTTGCTGTCTTGCGTGCGO TGGW.rC..fTTTCA
2401 ---------+----------+----------+------------------------------+ 2460


Figure 3-12--continued.








70


Palindrome<--------Bgl II-CAAGAAAGTTTCGTAGAGATGAAAGACCACTGGATEATTGTG-GGATTCTTGTAGATCTAG
2461 ---------+----------+----------+----------+----------+----------+ 2520


ACAATCTGTCATCATAAATATGGTTGGCCATACGTTGTTAATGTAACGCTCTCTGGW. m
2521 ---------+----------+----------+----------+----------+----------- 2580


TAAC$TCCTTGCAACAGCCGTTCGCATCACCACAGAACTTTTCCCGAAACCAATCATCAC
2581 ---------+----------+----------+----------+----------+----------+ 2640

ACGCAAGACAGTTGGGCCGC~iTC(||T|| ACGGGTATCGAGCAGAATTTAGAGCTCT
2641 ---------+----------+----------+----------+----------+----------+ 2700

<----------------------------> Palindrome
T $$3 H |.'tAATCACTTCAEg|K M gfmATlMMA
2701 ---------+----------+----------+----------+----------+----------+ 2760

TATA Box Transcription Start
GCAAGTGGTTTCATATAAAAGCGAGCAGTTCGAGCAGCCACCGTCAGTTGAACACAAACA
2761----------+---------+---------+---------+---------+---------+ 2820


AGCGAACAAGCAAGCAAGAGAGCCAAGAACGGCGC GAAACTAACAC GTGAAGATACGAAA
2821----------+---------+---------+---------+---------+---------+ 2880


GATAGAATC CCTTATCAC CAAGAGAGATAAAAGTTAAGTAATCAGTGTATCAGAAAGTGA
2881 ---------+----------+----------+----------+----------+----------+ 2940


ATCAGTTACACAAAGTCAGTTGCGACAAGTGAAGTATTATCGAGATTTCGAGAG
2941 ---------+----------+----------+----------+----------+----------+ 3000

Start Codon
AAAATATCGAGACCAAGTTAGAGCAACAAACACGAATGCCGTCTGCAATCGGAATGAC
3001 --------+----------+----------+----------+----------+----------+ 3060
MetProSerAl aIleGlyIleAsp

CTGGGAACCACGTACTCGTGCGTGGGTGGTTCCAGCATGGAAGGTGGAGATCATCGCA
3061 --------+----------+----------+----------+----------+----------+ 3120
LeuGlyThrThrTyrSerCysValGlyValPheGlnHisGlyLysValGluIleIleAla


AACGACCAGGGCAACCGAACAACGCCGAGCTACGTGCCTTTTCGGACACGGAGCGCCTC
3121 --------+----------+----------+----------+----------+----------+ 3180
AsnAspGlnGlyAsnArghrlhrProserlyrValA]aPheSerAsplhrGluArgLeu


Figure 3-12--continued.








71


ATCGGAGATGCAGCCAAGAACCAGGTGGCCATGAATCCGACCAACACGGTGTTTGATGCC
3181 ---------+----------+----------+----------+----------+----------+ 3240
IleGlyAspAlaAlaLysAsnGlnValAlaMetAsnProThrAsnThrValPheAspAla


AAGCGGCTGATTGGACGAAAATTCGATGATCCGAAGATCCAGGCCGATATGAAGCACTGG
3241 ---------+----------+----------+----------+----------+----------+ 3300
LysArgLeuIleGlyArgLysPheAspAspProLysIleGlnAlaAspMetLysHisTrp


CCATTCACGGTGGTGAACGATTGCGGCAAACCCAAGATCCGCGTCGAGTTCAAGGGCGAG
3301 ---------+----------+----------+----------+----------+----------+ 3360
ProPheThrValValAsnAspCysGlyLysProLysIleArgValGluPheLysGlyGlu


CGCAAAACCTTTGCCCCCGAGGAAATCAGTTCAATGGTCCTGACGAAGATGAAGGAAACC
3361 ---------+----------+----------+----------+----------+----------+ 3420
ArgLysThrPheAlaProGluGluIleSerSerMetValLeuThrLysMetLysGluThr


GCCGAAGCCTACTTGGGACAGTCAGTGAAAAATGCAGTCATCACAGTACCAGCCTACTTC
3421 ---------+----------+----------+----------+----------+----------+ 3480
AlaGluAlaTyrLeuGlyGlnSerValLysAsnAlaValIleThrValProAlaTyrPhe


AACGACAGTCAGCGACAGGCCACAAAGGATGCTGGAGCCATCGCTGGCTTGAATGTGATG
3481 ---------+----------+----------+----------+----------+----------+ 3540
AsnAspSerGlnArgGlnAlaThrLysAspAlaGlyAlaIleAlaGlyLeuAsnValMet


CGCATCATCAACGAACCGACGGCGGCAGCTCTGGCGTACGGCTTGGATAAGAACCTGAAG
3541 ---------+----------+----------+----------+----------+----------+ 3600
ArgIlelleAsnGluProThrAlaAlaAlaLeuAlaTyrGlyLeuAspLysAsnLeuLys


GGAGAACGGAACGTGCTGATCTTCGATCTGGGTGGCGGAACCTTCGACGTTTCCATCCTG
3601 ---------+----------+----------+----------+----------+----------+ 3660
GlyGluArgAsnValLeuIlePheAspLeuGlyGlyGlyThrPheAspValSerIleLeu


ACGATCGACGAGGGATCGCTGTTCGAAGTGCGTGCTACTGCTGGAGACACTCATCTAGGA
3661 ---------+----------+----------+----------+----------+----------+ 3720
ThrIleAspGluGlySerLeuPheGluValArgAlaThrAlaGlyAspThrHisLeuGly

EcoRI
GGCGAAGACTTTGACAACCGGATGGTGGCTCACTTCGTGGAGGAATTCAAACGGAAATTC
3721 ---------+----------+----------+----------+----------+----------+ 3780
GlyGluAspPheAspAsnArgMetValAlaHisPheValGluGluPheLysArgLysPhe


Figure 3-12--continued.








72


AAGAAGGATCTGTCGAAGAATGCCCGAGCCCTGCGGCGTTTGAGAACGGCATGTGAACGG
3781 ---------+----------+----------+----------+----------+----------+ 3840
LysLysAspLeuSerLysAsnAlaArgAlaLeuArgArgLeuArgThrAlaCysGIuArg

Xho I
GCAAAGCGCACGTTGTCCTCGAGCACGGAAGCAACGATCGAGATTGACGCCCTGATGGAT
3841 ---------+----------+----------+----------+----------+----------+ 3900
AlaLysArgThrLeuSerSerSerThrGluAlaThrIleGluIleAspAlaLeuMetAsp

Cla I
GGCATCGATTATTACACGAAGATCAGCCGGGCACGATTCGAGGAGCTATGCTCGGACCTG
3901 ---------+----------+----------+----------+----------+----------+ 3960
GlyIleAspTyrTyrThrLysIleSerArgAlaArgPheGluGluLeuCysSerAspLeu


TTCCGTTCGACGTTGCAGCCGGTGGAGAAGGCTCTGTCCGATGCGAAGATGGATAAGAGC
3961 ---------+----------+----------+----------+----------+----------+ 4020
PheArgSerThrLeuGlnProValGluLysAlaLeuSerAspAlaLysMetAspLysSer


TCCATTCACGATATCGTCCTGGTAGGAGGCTCAACTCGCATACCGAAGGTGCAGTCCCTG
4021 ---------+----------+----------+----------+----------+----------+ 4080
SerIleHisAspIleValLeuValGlyGlySerThrArgIleProLysValGinSerLeu


TTGCAGAACTTCTTCGCTGGAAAGTCGTTGAACCTTTCGATCAACCCGGACGAAGCGGTA
4081 ---------+----------+----------+----------+----------+----------+ 4140
LeuGlnAsnPhePheAlaGlyLysSerLeuAsnLeuSerIleAsnProAspGluAlaVal


GCATACGGTGCTGCGGTGCAAGCGGCCATCCTTAGCGGCGACAAGGATGACAAGATTCAG
4141 ---------+----------+----------+----------+----------+----------+ 4200
AlaTyrGlyAlaAlaValGlnAlaAlaIleLeuSerGlyAspLysAspAspLysIleGln


GACGTGCTGCTGGTGGATGTCGCTCCATTGTCGCTTGGAATCGAGACGGCCGGAGGTGTG
4201 ---------+----------+----------+----------+----------+----------+ 4260
AspValLeuLeuValAspValAlaProLeuSerLeuGlylleGluThrAlaGlyGlyVal

Bgl II
ATGACAAAGCTGATTGAACGCAACTCGCGCATTCCTTGCAAACAGACGAAGATCTTCTCG
4261 ---------+----------+----------+----------+----------+----------+ 4320
MetThrLysLeuIleGluArgAsnSerArgIleProCysLysGjnThrLysIlePheSer


ACATACGCCGACAACCAGCCCGGAGTCTCGATCCAGGTGTTCGAAGGAGAGCGAGCCATG
4321----------+----------+----------+----------+----------+----------+ 4380
ThrTyrAlaAspAsnGlnProGlyValSerIleGlnValPheGluGlyGluArgAlaMet


Figure 3-12--continued.







73


ACCAAGGACAACAATCTTTTGGGACAGTTCGACCTCTCGGGCATTCCGCCGGCCCCACGT
4381 ---------+----------+----------+----------+----------+----------+ 4440
ThrLysAspAsnAsnLeuLeuGlyGlnPheAspLeuSerGlyIleProProAlaProArg


GGTGTACCGCAGATCGAGGTAACTTTCGATCTGGACGCAAACGGAATCCTGAACGTGGCA
4441 ---------+----------+----------+----------+----------+----------+ 4500
GlyValProGlnIleGluValThrPheAspLeuAspAlaAsnGlyIleLeuAsnValAla


GCCAAGGATAAGAGCAGCGGAAAGGAGAAGAACATCACGATCAAAAACGATAAAGGTCGC
4501 ---------+----------+----------+----------+----------+----------+ 4560
AlaLysAspLysSerSerGlyLysGluLysAsnIleThrIleLysAsnAspLysGlyArg


CTATCGCAGGCCGACATCGATCGAATGGTATCGGAGGCCGAAAAGTACCGCGAGGAGGAT
4561 ---------+----------+----------+----------+----------+----------+ 4620
LeuSerGlnAlaAspIleAspArgMetValSerGluAlaGluLysTyrArgGluGluAsp

Xho I
GAGAAGCAGCGAGAGGCCATTGCCGCACGCAATCAGCTCGAGGCATACTGCTTCAACCTG
4621 ---------+----------+----------+----------+----------+----------+ 4680
GluLysGlnArgGluAlaIleAlaAlaArgAsnGlnLeuGluAlaTyrCysPheAsnLeu


AAACAATCCCTGGACGGAGAAGGATCGAGCAAACTCAGCGATGCCGATCGCAGAACGGTT
4681 ---------+----------+----------+----------+----------+----------+ 4740
LysGlnSerLeuAspGlyGluGlySerSerLysLeuSerAspAlaAspArgArgThrVal


CAAGATCGATGCGACGAGACTCTGCGGTGGATCGATGGCAACACTATGGCGGAGAAGGAA
4741 ---------+----------+----------+----------+----------+----------+ 4800
GlnAspArgCysAspGluThrLeuArgTrpIleAspGlyAsnThrMetAlaGluLysGlu

Pst I
GAGTACGAGCACCAAATGCAAGAGTTGTCNCGGGTCTGCAGTCCCATCATGACCAAACTG
4801 ---------+----------+----------+----------+----------+----------+ 4860
GluTyrGluHisGlnMetGlnGluLeuSerArgValCysSerProIleMetThrLysLeu


CATCAGCAAGCGGCTGGTGGTCCGCAACCAACCAGCTGTGGACAGCAAGCTGGAGGATTC
4861 ---------+----------+----------+----------+----------+----------+ 4920
HisGlnGlnAlaAlaGlyGlyProGlnProThrSerCysGlyGlnGlnAlaGlyGlyPhe

Nsi I
GGCGGAAGGACGGGACCGACGGTGGAAGAGGTGGATTAAAGATAACAATTGAAGATGCAT
4921 ---------+----------+----------+----------+----------+----------+ 4980
GlyGlyArgThrGlyProThrValGluGluValAspEnd


Figure 3-12--continued.








74


TTCCATGGCTTAACCAGAAACAACTGTCGATAGTGAA
4981 ---------+----------+----------+-------- 5017


Figure 3-12--continued.







75


Sau 3A Cloning Site
GATCGTGATATTCTTCTCCTTTCCGGTGCTCTTCTCCTTAGCTGCCACGTTCAGGATTCC
1 ---------+---------+----------+----------+----------+----------+ 60
IleThrIleAsnLysGluLysGlyThrSerLysGluLysAlaAlaValAsnLeuIleGly

Bst EII
GTTGGCATCCAGATCGAAGGTCACCTCGATCTGTGGCACACCACGTGGAGCCGGGGGAAT
61 ------------------+----------+----------+----------+----------+ 120
AsnAlaAspLeuAspPheThrValGluIleGlnProValGlyArgProAlaProProIle


GCCCGAGAGGTCAAACTGTCCCAGAAGATTGTTGTCCTTGGTCATGGCTCGTTCTCCCTC
121 ---------+---------+----------+----------+----------+----------+ 180
GlySerLeuAspPheGlnGlyLeuLeuAsnAsnAspLysThrMetAlaArgGluGlyGlu

Bgl II
GAACACCTGGATCGAAACGCCGGGCTGGTTGTCGGCGTATGTCGAGAAGATCTGCGTCTG
181 ---------+---------+----------+----------+----------+----------+ 240
PheValGlnIleSerValGlyProGInAsnAspAlaTyrThrSerPhelleGInThrGln


TTTGCACGGAATGCGCGAGTTGCGCTCAATCAGCTTCGTCATCACACCTCCGGCCGTCTC
241 ------------------+----------+----------+----------+----------+ 300
LysCysProIleArgSerAsnArgGluIleLeuLysThrMetValGlyGlyAlaThrGlu


AATTCCAAGCGACAATGGAGCGACATCCACTAGCAGTACGTCTTGAATCTTATCGTCCTT
301 ---------+---------+----------+----------+----------+----------+ 360
IleGlyLeuSerLeuProAlaValAspValLeuLeuValAspGlnIleLysAspAspLys


GTCTCCGCTGAGGATGGCCGCCTGTACCGCTGCACCGTAAGCCACGGCCTCATCCGGATT
361 ------------------+----------+----------+----------+----------+ 420
AspGlySerLeuIleAlaAlaGInValAlaAlaGlyTyrAlaValAlaGluAspProAsn

Pst I
GATCGAAAGGTTCAGAGACTTTCCAGCGAAAAAGTTCTGCAGCAAGGACTGCACCTTCGG
421 ---------+---------+----------+----------+----------+----------+ 480
IleSerLeuAsnLeuSerLysGlyAlaPhePheAsnGlnLeuLeuSerGlnValLysPro


GATGCGTGTGGAGCCTCCTACCAGGACGATATCGTGAATGGAGCTCTTATCCATCTTCGC
481 ---------+---------+----------+----------+----------+----------+ 540
IleArgThrSerGlyGlyValLeuValIleAspHisIleSerSerLysAspMetLysAla



Figure 3-13. DNA Sequence of p70b. The sequence of the p70b left gene from the cloning site and the entire right gene are shown. Restriction sites shown on the map (Figure 3-4) are indicated as are TATA boxes, transcription starts and predicted proteins. Heat-shock-element-like sequences are shaded and underlined where they overlap.







76


Pst I
ATCGGACAGAGCCTTTTCCACTGGCTGCAGCGTCGAACGGAACAAGTCAGAACACAGCTC
541 ---------+---------+----------+----------+----------+----------+ 600
AspSerLeuAlaLysGIuValProGlnLeuThrSerArgPheLeuAspSerCysLeuGlu

Cla I
CTCGAATCGTGCCCGGCTGATCTTCGTGTAATAATCGATGCCATCCATCAGGGCGTCAAT
601 ---------+---------+----------+----------+----------+----------+ 660
GluPheArgAlaArgSerIleLysThrTyrTyrAspIleGlyAspMetLeuAlaAspIle

Xho I
CTCGATCGTTGCCTCCGTGCTCGAGGACAGTGTGCGCTTCGCCCTCTCGCATGCCGTTCT
661 ---------+----------+----------+----------+----------+----------+ 720
GluIleThrAlaGluThrSerSerSerLeuThrArgLysAlaArgGluCysAlaThrArg

Eco RI
CAAACGACGCAGAGCGCGAGCGTTCTTCGACAGATCCTTCTTGTGCTTTCGTTTGAATTC
721 ---------+----------+----------+----------+----------+----------+ 780
LeuArgArgLeuAlaArgAlaAsnLysSerLeuAspLysLysHisLysArgLysPheGlu


TTCCACGAAGTGGCCCACCATTCGGTTATCGAAGTCTTCGCCTCCCAAATGAGTATCTCC
781 ---------+---------+----------+----------+----------+----------+ 840
GluValPheHisGlyValMetArgAsnAspPheAspGluGlyGlyLeuHisThrAspGly


GGCCGTGGATCGTACCTCAAACAGTGATCCCTCGTCGATCGTCAGAATGGACACGTCGAA
841 ---------+---------+----------+----------+----------+----------+ 900
AlaThrSerArgValGluPheLeuSerGlyGluAspIleThrLeuIleSerValAspPhe


GGTGCCGCCTCCCAGATCGAAGATCAGAACATTGCGTTCTCCCTTTAGGTTCTTATCCAA
901 ---------+---------+----------+----------+----------+----------+ 960
ThrGlyGlyGlyLeuAspPheIleLeuValAsnArgGluGlyLysLeuAsnLysAspLeu


GCCATACGCCAGAGCTGCTGCCGTCGGTTCGTTGATGATGCGCATCACATTCAGTCCAGC
961 ---------+---------+----------+----------+----------+----------+ 1020
GlyTyrAlaLeuAlaAlaAlaThrProGluAsnIleIleArgMetValAsnLeuGlyAla


GATGGCTCCAGCATCCTTTGTGGCCTGTCGCTGGCTGTCGTTGAAGTAGGCTGGTACTGT
1021 ---------+----------+----------+----------+----------+----------+ 1080
IleAlaGlyAlaAspLysThrAlaGInArgGlnSerAspAsnPheTyrAlaProValThr


GATGACTGCATTTTTTACTGACTGGCCCAGGTAGGCTTCGGCGGTTTCCTTCATCTTCGT
1081 ---------+---------+----------+----------+----------+----------+ 1140
IleValAlaAsnLysValSerGInGlyLeuTyrAlaGluAlaThrGluLysMetLysThr


Figure 3-13--continued.







77


CAGCACCATCGAACTGATTTCCTCCGGGGCAAAGGTTTTGCGCTCGCCCTTGAACTCGAC
1141 ---------+----------+----------+----------+----------+----------+ 1200
LeuValMetSerSerIleGluGluProAlaPheThrLysArgGluGlyLysPheGluVal


GCGGATCTTGGGCTTACCACCGTCATTTACCACCGTGAATGGCCAGTGCTTCATATCGGC
1201 ---------+----------+----------+----------+----------+----------+ 1260
ArgIleLysProLysGlyGlyAspAsnValValThrPheProTrpHisLysMetAspAla


TTGGATCTTCGGATCGTCGAATTTGCGTCCAATCAGTCGCTTGGCATCGAACACCGTGTT
1261 ---------+----------+----------+----------+----------+----------+ 1320
GlnIleLysProAspAspPheLysArgGlyIleLeuArgLysAlaAspPheValThrAsn


AGTCGGATTCATGGCCACTTGGTTCTTGGCTGCATCTCCGATGAGTCGCTCAGTGTCCGA
1321 ---------+----------+----------+----------+----------+----------+ 1380
ThrProAsnMetAlaValGlnAsnLysAlaAlaAspGlyIleLeuArgGluThrAspSer


GAACGCAACGTAGCTCGGTGTCGTTCGGTTGCCCTGGTCGTTTGCGATGATCTCCACCTT
1381 ---------+----------+----------+----------+----------+----------+ 1440
PheAlaValTyrSerProThrThrArgAsnGlyGlnAspAsnAlaIleIleGluValLys


TCCATGCTGGAACACACCAACGCAGGAGTACGTGGTGCCCAGATCGATTCCGATTGCCGA
1441 ---------+----------+----------+----------+----------+----------+ 1500
GlyHisGlnPheValGlyValCysSerTyrThrThrGlyLeuAsplleGlyIleAlaSer

Start Codon
AGGCATTCTGTGTCTCTGTGGTTCAACTTCGATGAATATGCTTTCTCAAATCACTCAAAC
1501 ---------+---------+----------+----------+----------+----------+ 1560
ProMet

TGGTGTGCACAATTATACGCTTTCTGATGCAACAATTGATTCACTCTGGTCACTGCTTGT
1561 ---------+----------+----------+----------+----------+----------+ 1620


TACTTTGAAACACTTTATTTTTCACGTGTTTGCACTTGTTACTCTCAGCTCGCTCAGATT
1621 ---------+----------+----------+----------+----------+----------+ 1680

Transcription Starts TATA Box Xba I
CAAATTGACGACAGCTGCTCGAACGGACCGGTTTATATACCACACCACTCGATTTCTAA
1681 ---------+----------+----------+----------+----------+---------- 1740


AGG1TCJAGC CAGCTCTCCGCTAGGCTACTCGAACGCGATGAGGGAGATTGT
1741 ---------+----------+----------+----------+----------+----------+ 1800


Figure 3-13--continued.







78

ATGCCGCGTTC.TGAAA11ETC-C-CGTACGAATCATCAAAGCGGACCCGGCTATITTTAG
1801 ---------+------------------+----------+----------+----------+ 1860


CCAATCGCGTGCGTGATGATAAA ACCAGQAATTcC'GAtAGGAGAGAGAGTGAGGTG
1861 ---------+----------+----------+----------+----------+----------+ 1920


GACAAAAAATGTGTTTGCTTTTGAAAGTGTTTATTCCTCTTAACTTTTAACAACATTAAA
1921 ---------+----------+----------+----------+----------+----------+ 1980


AGAATGCTGGATTTAATTTAACAGAATACATTTTCAACAAAGCAGCTTGTAGGTCACAAT
1981 ---------+----------+----------+----------+----------+----------+ 2040


GCGTTTATTATTATGATAAAGTGCATATAGTTAAGGAAAGCTATTAGAAAGGAATATTAA
2041 ---------+----------+----------+----------+----------+----------+ 2100


TTTTATTGCACCTCAAGTTTGCGTAGGCTAACAATTGTTAGAATTATTTAAATTTGATTT
2101 ---------+----------+----------+----------+----------+----------+ 2160


TAATAATATTTTGTTCACAACTTGCCCTGAAAAATTGATTTGAATGATCGTAAAATTTAT
2161 ---------+----------+----------+----------+----------+----------+ 2220


AAAACTGTTATTGAATAATCCGTTACGAGTTATGCGGAATAAATTAATAAATCAACATTC
2221 ---------+----------+----------+----------+----------+----------+ 2280


AGTTATGTCCCTCCTCGCTCGCTCTCCTCTGMJQCACg(ATTCTGCGitQMCATCACGC
2281 ---------+----------+----------+---------+----------+----------+ 2340


ACGCGATTGGCTTAAAAATAGCCGGGTCCGCTTTGATGATTCGTACGAAATC
2341 ---------+----------+----------+----------+----------+----------+ 2400


GAATGCGGCATACAATCTCCCTCATCGCGTTCGAGTAGCCTAGCGGAGAGCTT-t'GAA
2401 ---------+----------+----------+----------+----------+----------+ 2460

Xba I TATA Box
TGCTCGAACC IAGAAATCGAGTGGTGTGGTATATAAACCGGTCCGTTCGAGCAGCTG
2461 ---------+----------+----------+----------+----------+----------+ 2520

Transcription Starts
TCGTCAATTTGAATCTGAGCGAGCTGAGAGTAACAAGTGCAAACACGTGAAAAATAAAGT
2521 ---------+----------+----------+----------+----------+----------+ 2580


Figure 3-13--continued.







79


GTTTCAAAGTAACAAGCAGTGACCAGAGTGAATCAATTGTTGCATCAGAAAGCGTATAAT
2581 ---------+----------+----------+----------+----------+----------+ 2640


TGTGCACACCAGTTTGAGTGATTTGAGAAAGCATATTCATCGAAGTTGAACCACAGAGAC
2641 ---------+----------+----------+----------+----------+----------+ 2700

Start Codon
ACAGAATGCCTTCGGCAATCGGAATCGATCTGGGCACCACGTACTCCTGCGTTGGTGTGT
2701 ---------+----------+----------+----------+----------+----------+ 2760
MetProSerAlaIleGlyIleAspLeuGlyThrThrTyrSerCysValGlyValPhe


TCCAGCATGGAAAGGTGGAGATCATCGCAAACGACCAGGGCAACCGAACGACACCGAGCT
2761 ---------+----------+----------+----------+----------+----------+ 2820
GlnHisGlyLysValGluIleIleAlaAsnAspGlnGlyAsnArgThrThrProSerTyr


ACGTTGCGTTCTCGGACACTGAGCGACTCATCGGAGATGCAGCCAAGAACCAAGTGGCCA
2821 ---------+---------+----------+----------+----------+----------+ 2880
ValAlaPheSerAspThrGluArgLeuIleGlyAspAlaAlaLysAsnGlnValAlaMet


TGAATCCGACTAACACGGTGTTCGATGCCAAGCGACTGATTGGACGCAAATTCGACGATC
2881 ---------+----------+----------+----------+----------+----------+ 2940
AsnProThrAsnThrValPheAspAlaLysArgLeuIleGlyArgLysPheAspAspPro


CGAAGATCCAAGCCGATATGAAGCACTGGCCATTCACGGTGGTAAATGACGGTGGTAAGC
2941 ---------+----------+----------+----------+----------+----------+ 3000
LysIleGlnAlaAspMetLysHisTrpProPheThrValValAsnAspGlyGlyLysPro


CCAAGATCCGCGTCGAGTTCAAGGGCGAGCGCAAAACCTTTGCCCCGGAGGAAATCAGTT
3001 ---------+----------+----------+----------+----------+----------+ 3060
LysIleArgValGluPheLysGlyGluArgLysThrPheAlaProGluGlulleSerSer


CGATGGTGCTGACGAAGATGAAGGAAACCGCCGAAGCCTACCTGGGCCAGTCAGTAAAAA
3061 ---------+----------+----------+----------+----------+----------+ 3120
MetValLeuThrLysMetLysGluThrAlaGluAlaTyrLeuGlyGInSerValLysAsn


ATGCAGTCATCACAGTACCAGCCTACTTCAACGACAGCCAGCGACAGGCCACAAAGGATG
3121 ---------+----------+----------+----------+----------+----------+ 3180
AlaVaIlleThrValProAlaTyrPheAsnAspSerGlnArgGlnAlaThrLysAspAla


Table 3-13--continued.







80


CTGGAGCCATCGCTGGACTGAATGTGATGCGCATCATCAACGAACCGACGGCAGCAGCTC
3181 ---------+----------+----------+----------+----------+----------+ 3240
GlyAlalleAlaGlyLeuAsnValMetArgIleIleAsnGluProThrAlaAlaAlaLeu


TGGCGTATGGCTTGGATAAGAACCTAAAGGGAGAACGCAATGTTCTGATCTTCGATCTGG
3241 ---------+----------+----------+----------+----------+----------+ 3300
AlaTyrGlyLeuAspLysAsnLeuLysGlyGluArgAsnValLeuIlePheAspLeuGly


GAGGCGGCACCTTCGACGTGTCCATTCTGACGATCGACGAGGGATCACTGTTTGAGGTAC
3301 ---------+----------+----------+----------+----------+----------+ 3360
GlyGlyThrPheAspValSerIleLeuThrIleAspGluGlySerLeuPheGluValArg


GATCCACGGCCGGAGATACTCATTTGGGAGGCGAAGACTTCGATAACCGAATGGTGGGNC
3361 ---------+----------+----------+----------+----------+----------+ 3420
SerThrAlaGlyAspThrHisLeuGlyGlyGluAspPheAspAsnArgMetValGlyHis

Eco RI
ACTTCGTGGAAGAATTCAAACGAAAGCACAAGAAGGATCTGTCGAAGAACGCTCGCGCTC
3421 ---------+----------+----------+----------+----------+----------+ 3480
PheValGluGluPheLysArgLysHisLysLysAspLeuSerLysAsnAlaArgAlaLeu

Xho I
TGCGTCGTTTGAGAACGGCATGCGAGAGGGCGAAGCGCACACTGTCCTCGAGCACGGAGG
3481 ---------+----------+----------+----------+----------+----------+ 3540
ArgArgLeuArgThrAlaCysGIuArgAlaLysArgThrLeuSerSerSerThrGluAla

Cla I
CAACGATCGAAATTGACGCCCTGATGGATGGCATCGATTATTACACGAAGATCAGCCGGG
3541 ---------+----------+----------+----------+----------+----------+ 3600
ThrIleGluIleAspAlaLeuMetAspGlyIleAspTyrTyrThrLysIleSerArgAla

Pst I
CACGATTCGAGGAGCTGTGTTCTGACTTGTTCCGTTCGACGCTGCAGCCAGTGGAAAAGG
3601 ---------+----------+----------+----------+----------+----------+ 3660
ArgPheGluGluLeuCysSerAspLeuPheArgSerThrLeuGlnProValGluLysAla


CTCTGTCCGATGCGAAGATGGATAAGAGCTCCATTCACGATATCGTCCTGGTAGGAGGGT
3661 ---------+----------+----------+----------+----------+----------+ 3720
LeuSerAspAlaLysMetAspLysSerSerIleHisAspIleValLeuValGlyGlySer

Pst I
CCACACGCATCCCGAAGGTGCAGTCCTTGCTGCAGAACTTTTTCGCTGGAAAGTCTCTGA
3721 ---------+----------+----------+----------+----------+----------+ 3780
ThrArgIleProLysValGlnSerLeuLeuGlnAsnPhePheAlaGlyLysSerLeuAsn


Figure 3-13--continued.








81


ACCTTTCGATCAATCCGGATGAGGCCGTGGCTTACGGTGCAGCGGTACAGGCGGCCATCC
3781 ---------+---------+----------+----------+----------+----------+ 3840
LeuSerIleAsnProAspGluAlaValAlaTyrGlyAlaAlaValGlnAlaAlaIleLeu


TCAGCGGAGACAAGGACGATAAGATTCAAGACGTACTGCTAGTGGATGTCGCTCCATTGT
3841 ---------+----------+----------+----------+----------+----------+ 3900
SerGlyAspLysAspAspLysIleGInAspValLeuLeuValAspValAlaProLeuSer


CGCTTGGAATTGAGACGGCCGGAGGTGTGATGACGAAGCTGATTGAGCGCAACTCGCGCA
3901 ---------+----------+----------+----------+----------+----------+ 3960
LeuGlyIleGluThrAlaGlyGlyValMetThrLysLeuIleGluArgAsnSerArgIle

Bgl II
TTCCGTGCAAACAGACGCAGATCTTCTCGACATACGCCGACAACCAGCCCGGCGTTTCGA
3961 ---------+----------+----------+----------+----------+----------+ 4020
ProCysLysGlnThrGlnIlePheSerThrTyrAlaAspAsnGlnProGlyValSerIle


TCCAGGTGTTCGAGGGAGAACGAGCCATGACCAAGGACAACAATCTTCTGGGACAGTTTG
4021 ---------+----------+----------+----------+----------+----------+ 4080
GlnValPheGluGlyGluArgAlaMetThrLysAspAsnAsnLeuLeuGlyGlnPheAsp

Bst EII
ACCTCTCGGGCATTCCCCCGGCTCCACGTGGTGTGCCACAGATCGAGGTGACCTTCGATC
4081 ---------+----------+----------+----------+----------+----------+ 4140
LeuSerGlyIleProProAlaProArgGlyValProGlnIleGluValThrPheAspLeu


TGGATGCCAACGGAATCCTGAACGTGGCAGCTAAGGAGAAGAGCACCGGAAAGGAGAAGA
4141 ---------+----------+----------+----------+----------+----------+ 4200
AspAlaAsnGlyIleLeuAsnValAlaAlaLysGIuLysSerThrGlyLysGluLysAsn


ATATCACGATCAAGAACGACAAGGGTCGCCTATCGCAGGCCGATATCGATCGAATGGTGT
4201 ---------+----------+----------+----------+----------+----------+ 4260
IleThrIleLysAsnAspLysGlyArgLeuSerGlnAlaAspIleAspArgMetValSer


CGGAAGCTGAGAAGTTCCGCGAGGAGGATGAGAAGCAACGCGAACGCATCTCTGCCCGCA
4261 ---------+----------+----------+----------+----------+----------+ 4320
GluAlaGluLysPheArgGluGluAspGluLysGInArgGluArgIleSerAlaArgAsn

Xho I
ATCAGCTCGAGGCTTACTGCTTCAACCTGAAACAGTCGCTGGACGGCGAAGGAGCGAGTA
4321 ---------+----------+----------+----------+----------+----------+ 4380
GlnLeuGluAlaTyrCysPheAsnLeuLysGlnSerLeuAspGlyGluGlyAlaSerLys


Figure 3-13--continued.








82


AACTCAGCGATGCCGATCGCAAGACAGTGCAGGATCGATGCGAAGAGACTCTGCGATGGA
4381 ---------+----------+----------+----------+----------+----------+ 4440
LeuSerAspAlaAspArgLysThrValGInAspArgCysGluGluThrLeuArgTrpIle


TCGACGGCAACACAATGGCCGATAAGGAGGAGTTCGAGCACAAGATGCAAGAGCTAACGA
4441 ---------+----------+----------+----------+----------+----------+ 4500
AGCTGCCGTTGTGTTACCGGCTATTCCTCCTCAAGCTCGTGTTCTACGTTCTCGATTGCT
AspGlyAsnThrMetAlaAspLysGluGluPheGluHisLysMetGlnGluLeuThrLys


AGGCATGCAGCCCCATCATGACGAAACTGCACCAGCAGGCAGCTGGCGGGCCCTCGCCAA
4501 ---------+----------+----------+----------+----------+----------+ 4560
AlaCysSerProIleMetThrLysLeuHisGlnGlnAlaAlaGlyGlyProSerProSer


GCAGTTGCGCACAGCAAGCTGGAGGATTTGGAGGAAGGACGGGTCCGACAGTGGAAGAAG
4561 ---------+----------+----------+----------+----------+----------+ 4620
SerCysAlaGInGlnAlaGlyGlyPheGlyGlyArgThrGlyProThrValGluGluVal

Putative Polyadenylation Signal
TGGATTAAGGAGTAGAAATAACGGAGATTTATAATTGATTCGAAGAGGATGGCATTGACT
4621 ---------+----------+----------+----------+----------+----------+ 4680
AspEnd


GAATATGATTACTCATATAGTATGTTCCTATG
4681 ----------+----------+----------+-- 4712


Figure 3-13--continued.









87C GGTAGGTCATTTGTTTGGCAGMNAGAAAACTCGAGAAATTTCTCTGGCCGTTATTCGTTATTCTCTCTTTTCTTTTTGGGTCTCTCCCTCTCTGCACTAA 87A C.CGA.G.........C. ...................... .....................A...G..T.A................T

p70a L GTGGTCTTTCATCTCTACGAAACTTTCTTGTGAAA CAGAAATTTCCACGCACGCAAGACAGCAAAGGCGCAGCTGCTAGGGACATTCTACTCGCATCG p70a R AGCCGT.CG....A.C..AG......TCCC-.......---..---..T.A............TTGG.C...---- - C. ,G...... T....

p70b L TCTCCTCTCGCACATTCTTGCGTTTTCCATCATCACGCACGCGATTGGC-TAAAAATAGCCGGGTCCGCTTTGATGATTCGTACGCGAGAAATTTCCAGA p70b R ....... ...................T .........................
--- - -- - ------- --------------I ------I ------------- -------220 -130


Conserved HSE and TATA Box Region
CTCG-A--TTC--GAA----AG-G------TATA-A
87C TGCTCTCTCACTCTGTCACACAGTAAACGGCATACTGCTCTCGTTGGTTCGAGAGAGCGCGC.,..A.TG.. .GC.. .AA-G..C.CCGGAG...A.TA
87A ..................G............CT..AT.......C....................... ... .............

p70a L AGCAGAATCTCGA--------------CATTTCAACAGATTCTC-GAACTGT. ...T.CT..TT..TGCA..T.GTTTCA...A.AC
p70a R ........T.A..GCTCTTCAAGCAGATTCGAGAA... C................ ........ .................... G

p70b L ACGCGGCATACAATCTCCCTCATCGCGTTCGAG--TAGCCTAGCGGAGAGCTGTGGAAAGTG....ACC...TA ...ATCG..T.GTGTGG....T.AA
p70b R . ..................................................................
----|--------|---------|----------- ---------------------120 -30




Figure 3-14. Heat-Shock Promoter Alignment. Shown are: the nucleotide sequence alignment of two D. melanogaster Hsp7O (87C Gene 1 and 87A Distal), and the A. albimanus Hsp70 left- and right-gene promoters upstream of the TATA box (L and R respectively). HSE and TATA boxes are shaded. HSE are underlined where they overlap. A region of conserved sequence is shown above the alignment. Numbering is relative to the
transcription start sites shared by the p70a and p70b genes with the start being 0, and negative numbers are upstream. Dashes indicate deletions and dots, bases shared with the sequence on the line above.









84


87C 87A


p70a, L p70a, R

p70b, L P70b, R


Translation Start
ACACA-AATG
TGAATACTTTCAACAAG-- -TTACCGAGAAAGAAGAACTC.....C....
.................TCG....... ........C.

ATTTCTGAGAGAAAACATCG----------AGAGCAACAA...G....
................ .AGACCAAGTT...............G.

GTGATTTGAGAAAGCATATTCATCGAAGTTGAACCCAGAG.....G.... .............................................G ....


-----I------I ------I ------I ------ I---40 -30 -20 -10 0


















Figure 3-15. Translation Start Alignment. Alignment of two D. melanogaster Hsp70 (87C Gene 1 and 87A Distal) and the A. albimanus Hsp70 p70a and p70b left (L) and right (R) sequences upstream of the ATG start codon (underlined) is shown. A region of conserved sequence is shown above the alignment. Numbering is relative to the translation start site. Dashes indicate deletions and dots show bases shared by the sequence in the line above.


















N HS G A T C


B


N HS G A T C


C


N HS G A T C


- i


CA A
W T G


SAC C A


S.


CA
TT A CA


Figure 3-16. Primer-Extension Experiments. Primer-extension experiments mapped the 5' end of the Hsp70 transcripts. Sequences of the predicted 5' ends of the DNA-complementary RNAs are indicated from top to bottom. Panel A shows the products of the p70b-specific primer, and panels B and C those of the right and left genes of p70a.


00


A


CGT

C; A CAA TT
T
GAA


M6


S







I
U







86


A.

Consensus (5 out of 6) AgTT-AAat-aAA-Aa-C-AAg-Ga-AACA
Predominant (>3 out of 6) AGTTCAAATCAAA-AATCAAAGTGAAAACA


Hsp22 ........AA..CC..A.C..C..CT....
Hsp23 .... G..T .....A.GC.....C..T....
Hsp26 ..A..G... TC..A..T.G.GCA.TG....
Hsp27 ... CT... CTG..A..TTG.. .GC... CGT
Hsp68 .T..G.........C.GT.............
Hsp70 . .....T.....C..G..........C...

Hsp83 AGTCTTGAAAAAAATTTCGTACGGTGTGCG




B.
CAAACAAGC-AA
B8 AGCGACAAT---------------------AACACGTCGCTAAGCGAAAGCTAAGCAAATA
87C ...-A..A.TCAATTCAAACAAGCAAAGTG...............................
87A ...-T..........................A... .G.....--...G......C.

p70a,L ACTGTCAGTTGAACACAAACAAGCGAACAAGCAAGCAAGAGAGCCAAGAACGGCGCGAAGC p70a,R ..C..C ..................................................... A.

p70b L GTCGTCAATTTGAATCTGAGCGAGCTGAGAGTAACAAGTGCAAACACGTGAAAAATAAAGT p70b R .. ..... ....................................................


0 10 20 30 40 50



Figure 3-15. Transcription Start Alignments. A. The consensus and predominant nucleotides in the transcription start regions of six D. melanogaster heat-shock genes are shown. One position is a tie for "C" or "A" (hypenated in the predominant sequence line). The sequences and alignment are from Hackett and Lis (1983). In contrast, I have shown the sequence of Hsp83 which is not preferentially translated under heat shock. B. Alignment of three D. melanogaster Hsp70 genes (B8 Clone, 87C Gene 1 and 87A Distal) and the A. albimanus Hsp70 p70a and p70b left
(L) and right (R) promoters downstream of the TATA box. A region of sequence shared by the p70a, 87C and 87A genes is shown above the alignment. Note that clone B8 has a deletion of this region and p70b is not similar. The p70a sequence consisting of repeats of C-A/G-A-G/A is shown in bold type. Numbering is relative to the transcription start sites shared by the p70a and p70b genes with the start being 1, negative numbers are upstream, and positive downstream.








Table 3-2.
Codon Frequency and Occurrence


Amino Acid Codon


Gly
Gly Gly
Gly

Glu Glu
Asp Asp

Val Val Val Val

Ala Ala Ala
Ala

Arg Arg Ser Ser


GGG GGA GGT GGC

GAG GAA GAT GAC

GTG GTA GTT GTC

GCG GCA GCT GCC

AGG AGA AGT AGC


p70aa
---------------n n/1000 Pb


0
27
8
14

26.5 18 26
22.5

22.5
6.5
2.5 7.5

8
14 12
25

1
2
3
10


0
42.16 12.49 21.86

41.38 28.10
40.60 35.13

35.13 10.15 3.91 11.71

12.49 21.86
18.74 39.03

1.56 3.13
4.69 15.62


0
0.55 0.16 0.29

0.60
0.41 0.54 0.47

0.58 0.17 0.07
0.20

0.14 0.24 0.20
0.42

0.03 0.05 0.08 0.25


p70b, Right
------------.
n n/1000


2
25
8
14

28 17 29
19

23
7
4
4

7
14 15 23

2
1
3
10


3.13 39.06 12.50 21.88

43.75 26.56
45.31 29.69

35.94 10.94 6.25 6.25

10.94 21.88
23.44 34.38

3.13 1.56
4.69 15.63


87C and 87A'


P n n/1000 P


0.04 0.51 0.16 0.29

0.62 0.38 0.60
0.40

0.61 0.18 0.11 0.11

0.12
0.24 0.26 0.38

0.06 0.03 0.07
0.24


1.5 19.5 9.5
24

40.5
7
8.5 37

22.5
4.5
3
10

8.5
12
13.5 25.5

2
4
2
10


2.34 30.33 14.78 37.33

62.99 10.89 13.22 57.54

34.99 7.01
4.67 15.56

13.22 18.66
21.00
39.66

3.12 6.22 3.11 15.55


0.03 0.36 0.18
0.44

0.86 0.15 0.19 0.81

0.56
0.12
0.08 0.25

0.15
0.20
0.23
0.43

0.06
0.12
0.06 0.28


aAverage of two genes.


b Proportion of a particular amino acid using the codon.








Table 3-2.-- continued


Amino Acid Codon


Lys Lys Asn
Asn

Met
Ile Ile
Ile

Thr Thr
Thr Thr

Trp End Cys Cys

End End Tyr Tyr

Leu
Leu Phe
Phe


AAG AAA AAT AAC

ATG ATA
ATT ATC

ACG
ACA ACT ACC

TGG TGA TGT TGC

TAG TAA
TAT TAC

TTG
TTA TTT TTC


p70a


p70b, Right


---------------- ---------------n n/1000 P n n/1000 P


34 12
6.5 21.5

15
1
9 30

20.5
5
5.5
8

2
0
2
7

0
1
1
11

11.5
0
3.5 21.5


53.09 18.74 10.15 33.57

23.42 1.56
14.05 46.84

32.01 7.81 8.59
12.49

3.13 0.00 3.13 10.93

0.00 1.56 1.56 17.18

17.96 0.00
5.47 33.57


0.74 0.26 0.23 0.77

1.00 0.03
0.22
0.75

0.53 0.13
0.14 0.21

1.00 0.00
0.22 0.78

0.00 1.00 0.08 0.92

0.25 0.00
0.14 0.86


40
8
9 19

15
0
9 31

20
9
4
7

2
0
1
7

0
1
2
8

6
0
5
21


62.50 12.50
14.06 29.69

23.44 0.00
14.06 48.44

31.25
14.06 6.25
10.94

3.13 0.00 1.56
10.94

0.00 1.56 3.13 12.50

9.38 0.00 7.81 32.81


0.83 0.17 0.32 0.68

1.00 0.00
0.22
0.77

0.50
0.22 0.10 0.17

1.00 0.00 0.13 0.88

0.00 1.00
0.20 0.80

0.13 0.00 0.19 0.81


87C and 87A
---------------n n/1000 P


41
5
7.5 25.5

12.5 1.5
8 27

9.5
8
4.5 19

2
0
1
6

0
1
3.5 12.5

7
0
6
15.5


63.77 7.78 11.67 39.66

19.44 2.34 12.44 41.99

14.78
12.44 7.00 29.55

3.12 0.00 1.56 9.33

0.00 1.56
5.45 19.44

10.89 0.00
9.34 24.11


0.89 0.11 0.23 0.77

1.00 0.05
0.22 0.74

0.23
0.20
0.11
0.46

1.00 0.00 0.15 0.86

0.00 1.00
0.22
0.78

0.15 0.00 0.28 0.72








Table 3-2.--continued


Amino Acid Codon


Ser Ser
Ser Ser

Arg Arg Arg Arg

Gln Gln
His His

Leu Leu Leu Leu

Pro
Pro Pro Pro


TCG
TCA
TCT TCC

CGG CGA
CGT CGC

CAG CAA CAT CAC

CTG CTA
CTT CTC

CCG CCA CCT CCC


p70a
---------------n n/1000 P


17.5
3
1
6

9
9
4.5 11.5

21.5 7.5
3
4

24.5
3
4
4

13
5
1
4


27.32
4.69 1.56 9.37

14.05 14.05 7.03 17.96

33.57 11.71
4.69 6.25

38.25
4.69 6.25 6.25

20.30 7.81 1.56 6.25


0.44 0.08 0.03 0.15

0.24 0.24 0.13 0.31

0.74 0.26
0.43 0.57

0.52 0.06 0.09 0.09

0.57
0.22
0.04 0.17


p70b, Right


87C and 87A


n n/1000 P n n/1000 P


16
2
3
8

1
12
4 16

22
6
2
6

29
4
3
5

10
7
1
5


25.00 3.13
4.69 12.50

1.56 18.75 6.25 25.00

34.38 9.38 3.13 9.38

45.31 6.25
4.69 7.81

15.63
10.94 1.56 7.81


0.38 0.05 0.07 0.19

0.03 0.33 0.11
0.44

0.79
0.21
0.25 0.75

0.62 0.09 0.06 0.11

0.43 0.30
0.04 0.22


3.5
1
4
15.5

2.5
4
2
20.5

22
3
3
8

22.5
3
2
13.5

4
5
6
9.5


5.45 1.56 6.23
24.10

3.89 6.22 3.12 31.88

34.22 4.67 4.67 12.44

34.99 4.67 3.12
21.00

6.22 7.78
9.34 14.78


0.10 0.03
0.12
0.44

0.07
0.12 0.06 0.59

0.88
0.12 0.27
0.73

0.47 0.06
0.04 0.29

0.17
0.21 0.25 0.39


00
kD








Table 3-3.
Nucleotide and Dinucleotide Frequency in
Mosquito Heat-Shock Genes


Nontranslated
Spacer Between TATA Boxes Leader Sequences Coding Regions
-------------------- ------------------------ -----------------------p70a p70b p70a,Right p70b,Right p70a,Right p70b,Right
------------------------------------------------------------------Nucleotide n % n % n % n % n % n %
----------------------------------------------------------------------------G 102 22 162 21 49 21 42 23 576 30 571 30
A 125 28 230 30 102 44 70 38 514 27 516 27
T 125 28 235 30 39 17 43 23 348 18 350 18
C 102 22 147 19 42 18 30 16 484 25 485 25

Dinuc. n n n no n n n nobs np nabs nXP
----------------------------------------------------------------------------GG 15 23 25 34 1 10 0 10 145 173 137 170
GA 37 28 54 48 27 22 19 16 204 154 206 153
GT 25 28 38 49 13 8 15 10 83 104 79 104
GC 25 23 44 31 8 9 8 7 144 145 148 144
AG 31 28 45 48 32 22 21 16 137 154 148 153
AA 38 34 83 69 37 45 25 27 145 138 136 139
AT 31 34 69 70 13 17 12 16 110 93 111 94
AC 25 28 32 44 19 19 11 11 121 130 120 130
TG 33 28 48 49 7 8 16 10 129 104 125 104
TA 16 34 53 70 13 17 6 16 32 93 36 94
TT 37 34 88 72 10 7 13 10 69 63 68 64
TC 38 28 46 45 9 7 8 7 118 88 121 88
CG 23 23 43 31 9 9 5 7 165 145 161 144
CA 33 28 39 44 25 19 20 11 132 130 137 130
CT 32 28 40 45 3 7 2 7 86 88 92 88
CC 14 23 25 28 5 8 3 5 100 122 95 123
0










91


p70a, R


EIE p70a, L


1300 1200


1300
1200


1300
1200


-200


-150


-100


-50


p70b, R


p70b, L


87A




87C TATA


Amin HSE Region


Pelham HSE


Figure 3-18. HSE Distribution. Spatial and quantitative distribution of scores indicating the match of sequences to two different weighted criteria for heat-shock elements. Scores and positions for matches above 1100 (for Amin et al.(1988)) are indicated by the heights of the bars and positions. Only scores in the 200 bp upstream of the TATA box are shown. R and L indicate the right and left genes of p70a and p70b. The 87A and 87C sequences are the same as those in Figure 3-14. Scoring matrices and the scoring program WEIGHTS are included in Figures 3-1 and 3-2.


13001200-


Ez= E zm mm I


Esa
ers


Egg
Emo


Ia E a














CHAPTER 4
COMPARISON OF THE DROSOPHILA MELANOGASTER AND
ANOPHELES ALBIMANUS HSP70 GENE FAMILIES


Introduction


The Hsp70 genes of Anopheles albimanus and Drosophila melanogaster are members of families comprised of at least four genes in the mosquito and five or more in D. melanogaster (Ish-Horowicz et al., 1979). In addition, the D. melanogaster family includes Hsp70 cognate genes (Hscl, Hsc2, Hsc4) which have similar sequences, but unlike the Hsp7O genes, contain introns and are not heat inducible (Ingolia and Craig, 1982)(Craig et al., 1983). Another member, the Drosophila Hsp68, is closely related to the D. melanogaster Hsp70 gene, and is heat inducible, but is expressed at much lower levels (Holmgren et al., 1979).

In this study, the four mosquito genes have been isolated in two clones p70a and p70b, each of which contains a pair of Hsp70 genes in divergent orientation (Chapter 3). These are located at two loci on the same chromosome arm, about 20 centiMorgans apart. In most species of Drosophila, the Hsp70 genes also occur in two divergently transcribed pairs at two loci (4 genes), but are very tightly linked (Leigh-Brown and Ish-Horowicz, 1981).


92







93

The similar structure and sequence of the mosquito and Drosophila Hsp70 genes suggests homology. However, it is possible that the divergent gene arrangements are due to convergent evolution, and that the mosquito genes actually have a closer relationship to the D. melanogaster cognates. In this chapter, this possibility will be tested using the available DNA sequences.

A second area considered will be the genetic mechanisms that

account for the concerted evolution of the Hsp70 genes. Extremely high similarity of the members of the D. melanogaster Hsp70 gene family suggests that concerted evolution has occurred. The proposed mechanism, gene conversion, is believed to occur within, and less frequently between, loci (Leigh-Brown and Ish-Horowicz, 1981). The mosquito Hsp70 DNA sequences reported in Chapter 3 are similar and provide another opportunity to determine whether concerted evolution is occurring among the mosquito sequences, and if so, whether gene conversion is an adequate explanation.



Materials and Methods


DNA Sequences. DNA sequences of the mosquito Hsp70 clones p70a

and p70b are from Chapter 3. D. melanogaster Hsp70 gene sequences from locus 87A (distal) and 87C (distal gene 1) are from various sources (Ingolia et al., 1980)(Torok and Karch, 1980)(Karch et al., 1981) as assembled in Genbank version 60 files DROHSP7A2 and DROHSP7D1 respectively. The D. melanogaster Hscl cognate sequences and D. simulans sequences are from Ingolia and Craig (1982). D. melanogaster cognate genes Hsc2 and Hsc4 are from Craig et al. (1983).








94


Sequence manipulations were done on the Genetics Computer Group (GCG) Software Package (Devereux, 1984). version 6.1, and the Multiple Sequence Editor (Massachusetts Institute of Technology) both running on a MicroVAX II computer. Most alignments were visual but the carboxyl end of the Hsp70 genes were aligned using the GCG program BESTFIT.

Sequence Comparisons. Dot-plot comparisons were done using the computer program D3HOM (Fristensky, 1984). For mosquito/mosquito comparisons, the homology range was 10 bases and the minimum homology displayed was 60%. For mosquito/D. melanogaster comparisons, the homology range was 3 and the minimum homology displayed was 80%. In both cases the scale factor was 0.95. Additional dot-plot comparisons were done using the GCG programs COMPARE and DOTPLOT (Maizel and Lenk, 1981). The window size for those comparisons was 21 and the stringency 14.

Nucleotide divergence was determined using the GCG program DISTANCES. Amino acid divergence was calculated using DISTANCES considering identity only. Parsimony analysis of DNA sequences was performed using the computer program Phylogenetic Analysis Using Parsimony (PAUP) version 2.4.1 (Swofford and Maddison, 1987).



Results and Discussion


The mosquito clones p70a and p70b each contain two genes and are derived from two loosely linked loci. The D. melanogaster Hsp70 genes are located at two very tightly linked loci. Comparison of these sequences in all permutations permits detection of regions of similarity that might indicate their phylogenetic relationships and functionally




Full Text

PAGE 1

HEAT-SHOCK GENES OF THE MOSQUITO ANOPHELES ALBIMANUS WIEDEMANN .1 -J. By MARK Q. BENEDICT A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA uniVERSlTY OF FLORIDA LIBRARIES 1990

PAGE 2

ACKNOWLEDGEMENTS My appreciation is extended to Claudia Sutton for the D. melanogaster Hsp70 clones and to Janet Peterson for the Hsp83 clone. I thankfully recognize the Interdisciplinary Committee for Biotechnology Research (ICBR) of the University of Florida for support of the VAX computer, sequence analysis software, and DNA synthesis facilities. I particularly thank Vivian Chang for software trouble-shooting, and Dr. Phil Laipis for valuable PC DNA sequence software. The Multiple Sequence Editor developed at the Massachusetts Institute of Technology was invaluable. Thanks also go to Sharon Mitchell for the A. albimanus lambda genomic library, and Bob Wickham for assistance writing the BASIC program WEIGHTS. Lastly, I am grateful to the guidance of my committee for helpful discussions and criticism, especially Jack Seawright and Andrew Cockburn. ii

PAGE 3

TABLE OF CONTENTS fiage ACKNOWLEDGEMENTS ii ABSTRACT v CHAPTERS 1 HEAT SHOCK GENES 1 Introduction 1 Discovery of Heat Shock Genes 2 Heat Shock Proteins in Drosophila melanogaster 2 Transcriptional and Translational Control During Heat Shock 5 The Functions of Heat Shock Genes 6 Heat Shock in Non-Drosophil ids 8 2 HEAT-SHOCK MORTALITY AND INDUCED THERMOTOLERANCE Introduction 10 Materials and Methods 11 Heat Shocks 11 Data Analysis 12 Results and Discussion 13 Heat Shock Mortality in Relation to Rearing Temperature 13 Preshock-Induced Heat-Tolerance Experiments 13 3 ORGANIZATION, LOCATION, AND EXPRESSION OF THE 70 AND 83 KILODALTON HEAT SHOCK GENES IN THE MOSQUITO ANOPHELES ALBIMANUS Introduction 23 Materials and Methods 24 General Molecular Methods 24 Isolation and Subcloning Mosquito Heat-Shock Genes 25 Transcript Analysis 26 In situ Hybridization to Polytene Chromosomes 28 DNA Sequencing 28 iii

PAGE 4

Results and Discussion 32 Isolation and Mapping the Mosquito Hsp70 and Hsp83 Genes 32 Southern Analysis of Mosquito Hsp70 and Hsp83 Genes 33 In Situ Hybridizations 36 Transcript Analysis 37 DNA Sequence of p70a and p70b 40 Primer Extension 42 4 COMPARISON OF THE DROSOPHILA MELANOGASTER AND ANOPHELES ALBIMANUS HSP70 GENE FAMILIES Introduction 92 Materials and Methods 93 Results and Discussion 94 5 CONCLUSIONS 114 . REFERENCES CITED 116 BIOGRAPHICAL SKETCH 127 iv

PAGE 5

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy HEAT-SHOCK GENES OF THE MOSQUITO ANOPHELES ALBIMANUS WIEDEMANN By Mark Q. Benedict August, 1990 Chairman: Dr. Jack A. Seawright Major Department: Entomology and Nematology Clones of the Hsp70 and Hsp83 genes of the malaria vector Anopheles albimanus Wiedemann were isolated from a genomic DNA library. The Hsp70 genes occur at two loci on chromosome 2R. Each locus contains a pair of divergently-oriented uninterrupted reading frames. Transcription start sites were determined by primer extension. Maximal transcription was observed when larvae were heat shocked at 40°C and was 150to 350-fold above the level of nonshocked larvae. The size of the transcripts determined by northern analysis is consistent with genes encoding 70 kiloDalton (kDa) proteins. The DNA sequences of all of the interstitial and protein-coding regions present were determined and compared to one another, and to the Drosophila mel anogaster Hsp70 genes. The nucleotide and predicted protein sequences were 74% and 82% identical to D. melanogaster respectively. Compared to D. mel anogaster, mosquito, the regulatory heat-shock elements in the promoters were found to be more numerous, and to more closely match the published consensus.

PAGE 6

Phylogenetic analysis of the mosquito heat-shock genes demonstrates that they are homologous to the D. melanogaster Hsp70 genes and not to the //sp/O-like cognate genes. As in D. melanogaster, the Hsp70 genes of A. albimanus have undergone concerted evolution within each locus, and to a lesser degree, between loci. The mosquito Hsp70 genes are a more divergent family in all regions sequenced than the D. mel anogaster family. The restriction map of a clone containing two Hsp83 genes was determined. The clone hybridized to only one chromosomal locus on chromosome 3L. The clone contains a palindrome, two regions of which hybridize both to cDNA probes and to a D. melanogaster Hsp83 probe. Transcripts were found to be present at moderate levels in nonshocked larvae and were induced only several -fold at 37°C. The size of the transcript is consistent with a gene encoding a 83 kDa protein. Temperature effects on larval survival were investigated. Larvae were exposed to 30 min. heat shocks at various temperatures. Almost no mortality was observed at 40°C, but was complete at 43°C. Larval thermotolerance could be induced by a 30 min. exposure to 37°C. vi

PAGE 7

CHAPTER 1 HEAT-SHOCK GENES Introduction All organisms face environmental stresses that threaten their homeostasis and therefore, survival. It is logical that they have developed genetic systems that respond in biologically appropriate ways. Genes that respond to stress have only recently been identified and their functions studied. The heat-shock genes fall into this general class called stress-response genes (Atkinson and Walden, 1985)(Pardue et a/., 1989). They are distinguished by their inducibility upon temperature elevation or sequence similarity with such genes. The heat-shock response can be summarized as rapid, reversible, heat-induced synthesis of a small, specific set of proteins and concurrent repression of synthesis of almost all other proteins. Similar heat-shock responses are ubiquitous in animals, plants and microorganisms and have been thoroughly reviewed (Ashburner and Bonner, 1979)(Schlesinger et a/., 1982)(Craig, 1985) (Lindqui st, 1986) (Lindquist and Craig, 1988). The most extensive work has been done in Drosophila mel anogaster due to the ease of manipulation and wealth of genetic information available. 1

PAGE 8

Discovery of Heat-Shock Genes 2 In 1962, the first observations were published which hinted that heat-inducible genes existed. Ritossa (1962) noted that certain regions of the polytene chromosomes of Drosophila bucksii puffed rapidly and transcribed RNA at a higher rate when exposed to temperature shocks, dinitrophenol (DNP), or sodium salicylate treatment, but returned to their normal form when the treatments were removed. Thereafter, it was shown that in D. melanogaster a specific set of proteins appears upon heat shock (Tissieres et a/. 1974), a fact beautifully confirmed and extended by Lindquist (1980). The ability of DNP and sodium salicylate to induce a heat-shock response in D. bucksii showed that heat was not the only inducer. For animals, numerous classes of inducers of the heat-shock response were discovered: oxidizing agents, transition series metals, amino acid analogs, steroid hormones, wounding, and recovery from hypoxia. Other classes of inducers and specific effects have been compiled (Mover, 1984). Heat-Shock Proteins in Drosophila melanogaster Regardless of the organism, the heat-shock proteins (HSPs) are classified into three groups according to their molecular weight: the 90, 70, and 20 kiloDalton (kDa) groups (Pardue, 1988). In D. melanogaster, the major HSPs are HSP83 (90kDa class), HSP70 and HSP68 (70 kDa), and the small heat-shock proteins, HSP27, HSP26, HSP23, and HSP22 (all 20 kDa class). Not all are induced to the same

PAGE 9

3 level or in the same tissues, nor is the maximal induction temperature the same. As an introduction to the various patterns of expression, I will present an overview of expression of the three major groups of D. meTanogaster heat-shock proteins The Hsp70 genes have been studied most extensively since their transcripts and proteins are the most abundant. Most D. melanogaster strains contain five copies of this gene per haploid genome (IshHorowicz et al., 1979) (Mirault, et a/., 1979), and these are believed to be coordinately expressed. Hsp70 transcription occurs at low levels at normal rearing temperatures (25°C), is induced only slightly at 33°C, and increases 100to 1000-fold within minutes at the optimal induction temperature of 37.5°C. Translation commences within 5 minutes, and after 1 hour, the heat-shock proteins represent 90% of the total protein synthesized (Lindquist, 1980). Hsp70 genes are expressed in most tissues of the larva and adult with the exception of the brain and the post-meiotic cells of the testes (Bonner et al., 1984). In contrast, the Hsp83 gene (one copy per haploid genome (Hackett and Lis, 1983)) is transcribed at moderate levels in flies grown at normal temperatures, is transcribed at a several -fold higher rate at 3335°C, and is repressed at 37-38°C (Lindquist, 1980). The tissuespecific distribution of the protein also differs from that of HSP70. It is generally expressed at moderate levels and in high concentration in ovaries (Mason et a/., 1984). This is the only D. melanogaster heatshock gene that contains an intron (Hackett and Lis, 1983), the splicing of which is related to its repression at high temperatures (Yost and Lindquist, 1985).

PAGE 10

4 The 20 kDa class of heat-shock genes display yet another variety of regulation. They are transcribed variably, depending on the stage of development (Mason et a/., 1984), are moderately induced by heat shock but are also induced by ecdysone (Ireland et al., 1982) (Morganelli et a/., 1985). In addition to the above genes that are recognized as the genuine D. melanogaster heat-shock genes, other heat-shock-related genes have been identified on the basis of either heat-shock inducibility or sequence similarity. The essential hsromega genes are inducible and located at a major chromosome puff (93D) but may not be translated. Rather, the functional product seems to be the RNAs (Hovemann et a/., 1986) (Bendena et a/., 1989). Unlike the true Hsp70 genes, the Hsp70 cognate genes contain introns, but show no heat inducibility (Craig et al., 1983). The alpha-beta sequences show heat-inducible transcription but are not translated and probably have no essential function (Craig, 1985). All of the above true heat-shock genes are located at chromosomal loci which demonstrate heat-inducible puffing. Puffing is generally correlated with increased rates of transcription, and this has been shown specifically for the heat-shock genes (Ritossa, 1962) (Tissieres et al., 1974) (Compton and McCarthy, 1978). Consistent with the changing pattern of transcription during heat shock, RNA Polymerase II accumulates in bands that show heat-induced puffing but not at other loci (Bonner, 1981). Specific DNA sequences of heat-shock genes are sufficient to initiate puffs. When hybrid genes containing Hsp70 promoters are integrated in the chromosomes of D. melanogaster, new puffs and

PAGE 11

5 transcripts appear at the loci where the hybrid genes are located (Lis et al., 1983) (Bonner et a/., 1984)(Dudler and Travers, 1984). Transcriptional and Translational Control Purina Heat Shock At elevated temperatures, the heat-shock genes are transcribed and translated at higher rates. However, the expression of almost all other genes is reduced (Tissieres et al., 1974). This has been attributed to both transcriptional and translational controls (reviewed in Bienz and Pelham, (1987)). Previously synthesized transcripts from non-heat-shock genes are not translated during shock, but they are not degraded and are translatable when the cell returns to its normal temperature (Storti et al., 1980). An exception to suppression of expression that has been noted is the histone genes of D. mel anogaster (Spadoro et al., 1986). The unique factors that are necessary for preferential transcription of heat-shock genes are found in their DNA sequence. Pelham (1982) first identified regulatory regions in the Hsp70 promoter that are necessary for heat-induced transcription. These 14 base pair DNA sequences, called heat-shock elements (HSE), have been found in the promoters of all heatinducible genes, and the regulatory mechanism of heat-shock genes appears to be highly conserved across the animal kingdom (Pelham, 1985) (Bienz and Pelham, 1987). HSEs are the binding sites for the trimeric heat-shock transcription factor (HSTF or HSF), that is necessary to induce transcription (Parker and Topol , 1984)(Shuey and Parker, 1986)(Perisic et al., 1989). It is present under non-shock conditions and is believed to be activated by phosphorylation (Zimarino and Wu, 1987)(Sorger and Pelham, 1988).

PAGE 12

The ease with which dramatic changes in transcription and translation of heat-shock genes can be induced has made them a model system for understanding eukaryotic gene regulation (Pelham, 1985){Bienz and Pelham, 1987). Also, the conserved nature of Hsp70 transcription induction has been of tremendous benefit to studies of hybrid gene expression. This promoter is the most commonly used for expression of hybrid gene constructs in DrosophiTa and other insects ( e.g. betagalactosidase (Lis et a/., 1983) chloramphenicol acetyl transferase (DiNocera and Dawid, 1983), and alcohol dehydrogenase (Bonner et al., 1984)). • ' ''"^ Translational control of heat-shock gene expression allows preferential translation of heat-shock transcripts over those produced under non-shock conditions. Like transcription, this discrimination is a DNA sequence-specific effect and will be discussed in Chapter 3. The Functions of Heat-Shock Genes A traditional approach to understanding the functions of heatshock genes is the isolation of mutations altering or eliminating their expression. The fact that deletion mutants for the D. melanogaster Hsp/O genes are lethal in early embryos or larvae under nonshock conditions demonstrates that they have essential functions unrelated to the high level of expression observed when induced (Ish-Horowicz, et al., 1977). Other searches for D. melanogaster heat-shock expression mutants have resulted in isolation of mutations in unrelated genes that cause synthesis of abnormal proteins, e.g. actin, which induce the

PAGE 13

normal heat-shock response but are not heat-shock mutations per se (Hiromi et al., 1986) (Parker-Thornburg and Bonner, 1987). True heat-shock gene mutations that demonstrate the vital function of these genes have been successfully isolated in Escherichia coli and yeast. Deletions reducing expression of the f. coli GroE heat-shock genes prevent growth at normal temperatures, and DnaK (a 70 kDa-group protein) is necessary for heat-shock tolerance (Kusukawa and Yura, 1988) . Similarly, mutations of the Saccharomyces cerevissiae heat-shock factor which regulates heat-inducible transcription are lethal (Sorger and Pel ham, 1988). The appearance and regulation of heat-shock transcripts and proteins was a well -developed area long before the function of heatshock proteins was opened to study at the biochemical level. Early naive suggestions were made that heat-shock proteins somehow prevent or protect against heat-induced protein denaturation and consequent loss of activity. This has proven to be very close to the functions demonstrated by evidence collected in the past few years. HSP60 has a role in mitochondria in maintaining imported proteins in a translocation and assembly-competent form (Cheng et a/. 1989) (Ostermann et al., 1989) (Hartl and Neupert, 1990). Cell export of proteins in E. coli is facilitated by HSP70and HSP60-like proteins, presumably due to facilitated folding (Phillips and Silhavy, 1990). A protein similar to HSP70 is involved in transport competence of proteins destined for degradation in rat lysosomes (Chiang et al., 1989). A related but more universal function is indicated by studies of the association of HSP70 with newly-synthesized proteins by Beckmann et al. (1990). If these authors are correct, all protein folding may occur

PAGE 14

8 not simply as a consequence of its primary amino acid sequence, but as a result of an intimate association with this heat-shock protein. Due to repeated observations of facilitated trafficking and folding as a result of association with heat-shock proteins, the heat-shock proteins are considered "molecular chaperons" or "chaperonins. " Given the deleterious effects of heat-shock mutations on normal and heat-stress growth, and their recently discovered importance in protein folding and translocation, it is not surprising that the appearance of heat-shock proteins and increases in thermotolerance are correlated. Stephanou et a7. (1983a) positively correlated heat-shock protein synthesis with increased survival of D. mel anogaster that had been genetically selected for heat tolerance. The mediterranean fruitfly, Ceratitis capitata, showed increased survival at normallylethal temperatures if heat-shock protein synthesis was induced by a sublethal heat shock prior to high temperature exposure (Stephanou et al., 1983b) (Stephanou, 1987). Similarly in yeast, exposure of cultures to elevated temperatures before a usually-lethal exposure increased survival and was correlated with increased synthesis of heat-shock proteins (McAlister and Finkel stein, 1980). Heat-Shock in Non-Drosophi1 ids Heat shock has been investigated very little in insects besides Drosophila spp. Many studies have been done in Chironomus (e.g. Vincent and Tanguay (1979), and Barettino et a7. (1982)), and a few in Sarcophaga bullata (Bultmann, 1986a) (Bultmann, 1986b).

PAGE 15

studies of heat-shock-related phenomena in mosquitos are primarily of hybrid gene expression controlled by D. melanogaster Hsp70 promoters in Aedes albopictus cell cultures (Berger et al., 1985)(Durbin and Fallon, 1985) (Fallon, 1986) (Gerenday et a/., 1989) or in one case in genetically transformed Anopheles gambiae (Miller et a/., 1987). Endogenous mosquito heat-shock proteins have been studied only in A. albopictus cell cultures (Carvalho and Rebello, 1987) (Carvalho and Freitas, 1988) (Gerenday et a/., 1989)(Tatem and Stollar, 1989). Narang et al . (1985) determined the restriction pattern of Anopheles albimanus Wiedemann genomic digests probed with D. melanogaster Hsp70 clones. Beside this investigation, no insect heat-shock genes outside of Drosophila spp. have been studied at the level of gene organization, nucleic acid or protein sequence. As a first step to understanding the function, structure and expression of heat-shock genes of the malaria vector A. albimanus, I have undertaken experiments regarding three areas of heat shock related to mosquito biology and genetic manipulation: the effect of heat shock on mosquito survival, the structure and expression of the Hsp70 and Hsp83 genes, and the relationship of the mosquito heat-shock genes to those of Drosophila spp..

PAGE 16

CHAPTER 2 HEAT-SHOCK MORTALITY AND INDUCED THERMOTOLERANCE ' ' Introduction Heat-induced thermotolerance has been observed in numerous Diptera, e.g. DrosophiTa mel anogaster (Alahiotis and Stephanou, 1982)(Berger and Woodward, 1983) (Singh and Lakhotia, 1988), Chironomus stn'atipennis (Nath and Lakhotia, 1989), and Ceratitis capitata (Stephanou et a/., 1983b). Generally this is demonstrated by exposing insects to a relatively mild heat shock before exposure to temperatures in the lethal range. Alternatively, insects are reared at various temperatures before the lethal exposure. The results of both types of experiments are consistent with increased survival as a consequence of previous exposure to elevated temperatures. In this study, similar experiments were conducted for the tropical mosquito Anopheles albimanus. Specifically, I asked at what temperature does heat-induced mortality occur, how broad is the range, and is it affected by the rearing temperature or prior exposure to sublethal heat shock, and do more extreme sublethal heat shocks produce greater thermotolerance? 10

PAGE 17

11 Materials and Methods Heat Shocks Heat-shock mortality in relation to rearing temperature. A. aTbimanus larvae from the USDA-Insects Affecting Man and Animals Research Laboratory main colony were reared at 25.0 or 30.0°C (+ 0.5°C) from egg hatch to the fourth instar on a diet of 2 parts of TetraMin Baby-E Fish Food (Tm) to 1 part brewers yeast (Benedict et a/., 1979). One hundred mid to late 4th stage larvae were counted into each of six treatment containers consisting of 100 ml plastic beakers, the bottom of which had been cut off and replaced with fine plastic screen. These were transferred to identical foam ice chests containing approximately 5 liters of municipal supply water adjusted to 37.0, 38.5, 40.0, 41.5 and 43.0°C for the 25.0°C rearing tests, or 38.5, 40.0, 41.5 43.0°C, and 44.5°C for the 30.0°C rearing test. Controls for the heat-lethality tests were larvae counted and handled the same as the heat-treated larvae, but transferred to identical chests filled with 25.0°C or 30.0°C water, depending on the original rearing temperature. The temperature in these chests was maintained within 0.5°C by stirring the water, and adding warm water every five to ten minutes. Larvae were held at the different temperatures for 30 minutes and then transferred back to water at 25.0 or 30.0°C for 30 minutes, at the end of which time, dead larvae were counted. These experiments were repeated three times. Heat-shock mortality in relation to a brief sublethal heat shock. All larvae for these tests were handled the same as those above and were reared at 25°C. Sublethal heat shocks were administered at 28.0, 33.0, or 37.0°C for 30 minutes. The control was similar but transferred to

PAGE 18

12 25.0°C. Each of these temperature groups contained five groups of 100 larvae. At the end of the heat-treatment period, the larvae were transferred back to 25.0°C for 30 minutes. One beaker from each of the groups was transferred to 25.0, 40.0, 41.5, 43.0, or 44.5°C. They were held there for 30 min. and then once again transferred back to 25.0°C for 30 minutes, at the end of which time dead larvae were counted. These experiments were repeated three times. Data Analysis All mortality data were transformed by an angular transformation, the arcsin of the square root of the percent mortality. Analysis of variance (ANOVA) and Duncan's Multiple Range Test were used to compare the transformed mortalities using the SAS procedure ANOVA. The main effects of the rearing temperature experiments were replicate, rearing temperature, and lethal -range temperature. Only the temperatures that were used to treat both the 25.0 and 30.0°C larvae (38.5, 40.0, 41.5, and 43.0°C) were used for statistical comparisons. For the second set of experiments, the main effects considered were replicate, preshock temperature, and lethal -range temperature. Transformed mortalities of larvae reared at 25.0°C in the first set of experiments and controls in the second set that were mock preshocked at 25.0°C were compared using the SAS procedure TTEST. The significance level for all statistics was 0.05.

PAGE 19

13 Results and Discussion Heat-Shock Mortality in Relation to Rearing Temperature A set of experiments was designed to determine larval mortality at various temperatures and whether tolerance to these temperatures could be increased by rearing larvae at a higher temperature. Two rearing temperatures, 25.0 and 30.0°C, were chosen. These temperatures promote high survival and reasonable development times. A graphical representation of the mortality data is shown in Figure 2-1. Table 2-1 shows the raw data, and Tables 2-2 and 2-3 show the ANOVA statistics and statistically significant subgroups by Duncan analysis. Larvae reared at 25.0°C were killed in significantly higher numbers than those reared at 30.0°C. This demonstrates that raising the rearing temperature can decrease sensitivity to heat, and that mortality occurs in a very narrow temperature range from 40.0 to 43.0°C. Mortality was not significantly different at 38.5°C from that at 40.0°C (Table 2-3). Significant differences occurred between the first and second replicates among 25.0°C-reared larvae (replicates 1-3) . Replicate tests of larvae reared at 30°C were not significantly different (replicates 4-6). Replicate variation is probably due to uncontrolled variables affecting the very narrow response range. No control mortality occurred in these or the following experiments. PreshockInduced Heat-Tolerance Experiments. The second set of experiments determined the effect of a brief sublethal heat shock on heat sensitivity. The sublethal shock temperatures chosen were based on the results of the first sets of experiments above. No mortality had been observed at 37.0°C, so extreme

PAGE 20

14 shocks were administered at this temperature, moderate shocks at 33.0°C, and mild shocks at 28.0°C. The raw mortality data is graphed in Figure 2-2. Table 2-4 shows the raw data and Tables 2-5 and 2-6, the ANOVA statistics and Duncan groupings. Larvae preshocked at 37.0°C were significantly more resistant to heat-killing than those shocked at 28°C or controls. The 28.0 and 33.0°C groups show a trend toward decreased sensitivity which might have been statistically significant, if the variability had been lower (Tables 2-4 and 2-6). Larvae were reared at 25.0°C and heat treated similarly in the first and second experiments allowing comparison of the mortality. This comparison would allow detection of significant temporal changes in the heat sensitivity of the larvae. This would also reveal effects of handling differences between the first and second experiments. Those possibilities were not realized, because the amount of heat-caused mortality in the 25.0°C group of the first experiments, and the 25.0°C controls of the second set, were not significantly different (T test, Prob. > F' = 0.94). However, once again in the second set of experiments, statistically significant differences were observed between the first and third replicates probably for the same reasons suggested above. These experiments show that not only does rearing larvae at higher temperatures increase their resistance to heat-killing, but a relatively brief 30 minute exposure to 37.0°C also increases their heat resistance. Some thermotolerance can probably be induced by the slightest of temperature elevations, however, in these experiments, the resolution is limited by replicate variation due to uncontrolled variables.

PAGE 21

15 These observations of inducible thermotolerance after a brief shock, or as a result of different rearing temperatures, are similar to those made in D. melanogaster (Alahiotis and Stephanou, 1982)(Berger and Woodward, 1983) (Singh and Lakhotia, 1988), C. striatipennis (Nath and Lakhotia, 1989), and C. capitata (Stephanou et a/., 1983b). The lethal temperature range that I have observed is also similar to that seen in the above references, although direct comparisons are difficult to make due to differences in the treatment methods and periods after treatment at which lethality was determined. In the experiments reported here, additional delayed mortality might have occurred among larvae that were counted as survivors. What is the physiological basis for thermotolerance? Although thermotolerance is undoubtedly complex, increased thermotolerance is positively correlated with increased synthesis of heat-shock proteins (reviewed by Craig, 1985). For example, D. melanogaster genetic strains have been selected for cold or warm rearing conditions (Stephanou et a/., 1983a)(Alahiotis and Stephanou, 1982). The cold-selected strain is more sensitive than the warm-selected to heat-killing when reared similarly. The sensitive strain produces lower levels of heat-shock proteins than does the insensitive. Other experiments have shown that this genetic effect can be simulated merely by rearing the same strain at two temperatures (Singh and Lakhotia, 1988). Cold-reared D. melanogaster are more sensitive to heat killing than those reared warmer. Similarly, C. capitata that have been preshocked, have higher levels of heat-shock proteins and thermotolerance than larvae not shocked (Stephanou et a/., 1983b). The onset of thermotolerance in D. melanogaster embryos occurs at gastrulation, the same stage at which

PAGE 22

16 they are able to synthesize heat-shock proteins (Bergh and Arking, 1984) . Finally, when D. melanogaster cells are treated with ecdysone, which is known to induce synthesis of the small heat-shock proteins, thermotolerance increases (Berger and Woodward, 1983) (Berger, 1984). Likewise, immature stages of whole animals have greater thermotolerance during periods of higher ecdysone titer. These experiments, though suggestive, are not as conclusive as data from Escherichia coli and yeast showing that deletion mutants for heat-shock protein genes are unable to grow at elevated, or sometimes even normal temperatures, but can grow at reduced temperatures (Craig, 1985) . Seasonal variation in the levels of heat-shock protein synthesis probably occurs in mosquitos. This has been observed in natural populations of C. striatipennis (Nath and Lakhotia, 1989). These authors observed seasonal and temperature-related variation in chromosome puffing and in heat-shock protein inducibil ity. Heat-shock induction of puffs and proteins was greater in larvae that were laboratory-reared at a constant temperature than in those that had been exposed to warmer natural conditions and were already synthesizing heat-shock proteins. The field-collected larvae were also less sensitive to heat killing than the constant-temperature laboratory reared larvae. Thermoprotection is a common necessity for mosquitos, particularly tropical larvae breeding in exposed sites where daily and seasonal temperature fluctuations occur. These experiments demonstrate that mechanisms exist in A. albimanus to increase its survival under variable temperature conditions.

PAGE 23

17 o <\ CD o v_ 13 o CO 15 i_ CD Q. E 0 H o C\J o 0) 2 01 +-> to i~ M o to > T3 0) <-> ic tO 0) i(U t. c o. 0) 0) i2 XJ 0) c •r— •r^ -o (U nj > s-o -o c o o (/) i~ +-> o E -O 3 c a> 1— P8||!>i 8BAJBn l> •-> c 0) so E 0) 0) g-Q. i «^ Q.-t-> j_ X LlJ Sis'-* CTo (U C O s~ to ' 3 Jo +J 1 CO (0 s'« s E (U o 0) t— in 1 +J CVI o> to c C •)-> -.to to to (U re a> a: iT3 <0 0) 0) o -(-> &M CO o tu •-> 1— 3 S00 0) ro (U St— Qc: to i~ (A O r— « 1 3 >, CSJ ••-> +-> 10 -r0) J1— t. 3 0.-M ai E s(U o

PAGE 24

18 C3' o o s \ s • V s s s . V \ \ . \ \ s '\ \ ^ \ i \ \ I : 1 \ i; 1 V i; <1 CO o o CO o CO o o CVJ PSIIIW SBAJBT -K^ o 0 to 0 Q_ E 0 u o CO o o CO 8 i CO© O r o I CO I CO 8 i co<] 00 CVJ 2C , 8 i com O I lO i CM 01 t. o o •-> (0 3 TJ « U 0) O C7> ^ CO 00 i_ 0) O) S> Qn> C 0) (U ^ fO 2 i~ i^ f— 3 (O C S0) 0) Q. ^ E 1— • 0) T3 +-> c 0) C ITJ o> 0) sE 1 0) 0) ^ J= a.-i-> <-> X cu UJ 1 — c O 00 "O o c 0) ^ •>4-> 00 n} rO a> CD U o o c O -M +-> 00 00 O O) +-> r— srQ. 3 3 +-> 00 O) (0 scc: (Tj 0) Q. OO E . 1 3 CM •-> ^ ra o 0) i~ o i0) ^ 3 a. 00 O) E a.

PAGE 25

19 Table 2-1. Number of Larvae Killed in Rearing-Temperature Experiments Treatment Temperature (° c, ± 0.5) Rearing Temp. Rep. 25.0 3/ .yj oO . 0 41.5 43.0 44.5 25.0 1 0 nu n u 1 1 q 93 100 ND 25.0 2 0 ND 0 0 5 39 100 ND 25.0 3 0 ND 0 0 10 80 100 ND average 0 0 0.3 8 70.7 100 30.0 4 ND 0 0 0 0 9 96 100 30.0 5 ND 0 ND 0 0 15 100 100 30.0 6 ND 0 ND 0 0 2 100 100 average 0 0 0 0 8.7 98.7 100 " Only data under the underlined temperatures were used for ANOVA. ^ ND indicates experiment not done.

PAGE 26

Table 2-2. ANOVA Statistics for Rearing-Temperature Experiments Source Df SS F value Prob. > F Model 9 31,615 79.59 0.0001 Error 14 618 = 0.98 Dependent Variables Df SS F value Prob. > F Lethal Temperature 3 28,183 212.59 0.0001 Replicate 5 1,894 378.77 0.0007 Rearing Temperature 1 1,575 35.65 0.0001 Table 2-3. Duncan's Multiple Range Test Grouping for Rearing Temperature Experiments Effect Lethal Temperature 38.5 40.0 41.5 43.0 Grouping^ 1 — "11 — 1 Repl icate 3b 2" 5' 6= 4° Grouping 1— -,:!-!T-Ti -, Rearing Temperature 25.0 30.0 Grouping I-— 1 1— -1 Continuous bars join variables with the same Duncan grouping. ^ These groups reared at 25°C. " These replicates reared at 30°C.

PAGE 27

Table 2-4. Number of Larvae Killed in PreshockInduced Heat-Tolerance Experiments Treatment Temp. (°C, + 0.5) Preshock Temp. Repl icate 25.0 40.0 41.5 43.0 25.0 1 0 12 25 100 25.0 2 0 0 68 95 25.0 3 0 0 8 90 average 0 4 33.7 95 28.0 1 0 22 14 100 28.0 2 ND^ 3 23 93 28.0 3 0 0 12 94 average 0 ft o 8.3 16.3 95.7 33.0 1 0 4 8 96 33.0 2 0 1 13 92 33.0 3 0 0 5 90 average 0 1.7 8.7 92.7 37.0 1 0 2 3 81 37.0 2 0 0 7 83 37.0 3 0 0 6 84 average 0 0.7 5.3 82.7 ' Not Done

PAGE 28

Table 2-5. ANOVA Statistics for PreshockInduced Heat-Tolerance Experiments Source Df SS F value Prob. > F Model 7 32,198 73.88 0.0001 Error 28 1,743 = 0.95 Dependent Variables Df SS F value Prob. > F Lethal Temperature 2 30,599 245.73 0.0001 Replicate 2 615 307.86 0.0145 Preshock Temperature 3 983 327.70 0.0053 Table 2-6. Duncan's Multiple Range Test Grouping for PreshockInduced Heat-Tolerance Experiments Effect Lethal Temperature 40.0 41.5 43.0 Grouping^ 1— -1 1— -1 1— -1 Repl icate 1 2 3 Grouping 1 --I Preshock Temperature 25.0 28.0 33.0 37.0 Grouping I— * Continuous bars join groups with the same Duncan grouping.

PAGE 29

CHAPTER 3 ORGANIZATION, LOCATION, AND EXPRESSION OF THE HSP70 AND HSP83 HEAT-SHOCK GENES IN THE MOSQUITO ANOPHELES ALBIMANUS t .V Introduction Numerous strategies have been presented to modify and control agriculturally and medically important insects by both traditional and molecular genetic means (e.g. Cockburn et a/., 1984, Kirschbaum, 1985). Molecular efforts to modify mosquitos thus far have concentrated on methods of genetic transformation (Miller et a/., 1987) (McGrane et a/., 1988) (Morris et a/., 1989) and appropriate transformation markers, e.g. (Berger et a/., 1985)(Durbin and Fallon, 1985). The effort of isolating and characterizing novel endogenous promoters to drive expression of hybrid genes has been given little attention, due in part to general success expressing genes under the control of the Drosophi'la melanogaster Hsp70 promoter in other animals: monkey (Pelham, 1982), mouse (Corces et a/., 1981), and sea urchin (McMahon et al., 1984). To date, the Drosophi'la mel anogaster Hsp70 promoter has been used as the inducible promoter for all hybrid gene expression in mosquitos (Berger et a1., 1985)(Durbin and Fallon, 1985) (Fallon, 1986) (Miller et a/., 1987)(McGrane et a/., 1988)(Morris et a/., 1989) (Gerenday et a/., 1989) . The Hsp70 promoter has effectively increased chloramphenicol acetyl transferase (CAT) synthesis 30-fold (Berger et al., 1985) and 23

PAGE 30

24 G418 resistance similarly (Miller et al., 1987), although in the latter case low level constitutive expression was observed. These levels of induction of hybrid genes are similar to those observed in D. melanogaster. Although the D. melanogaster Hsp70 promoter has been adequate for hybrid gene expression in mosquitos, endogenous heat shock promoters might possess differences that would make them superior. These advantages could be either in reduction of the temperatures required to obtain satisfactory expression, the constitutive level of expression, or tissue specificity. Therefore, it is reasonable to study the structure and expression of endogenous heat shock genes to find distinguishing characteristics that suggest their use as an alternative in genetic modification of insects. Additionally, features that are shared with D. melanogaster may reveal unrecognized functional elements which will lead to a better understanding of the regulation of these genes. Two D. melanogaster genes, Hsp70 and Hsp83, were used as probes to screen a genomic library of the mosquito Anopheles albimanus Wiedemann for homologous genes. These mosquito genes were characterized and evaluated to investigate the potential of mosquito heat-shock promoters for hybrid-gene expression. Materials and Methods General Molecular Methods Gels were 0.5-1.2% agarose (Sigma) buffered and run in IX TBE (0.089 M Tris-borate, 0.089 M boric acid, 2 mM EDTA) at < 5.5 v/cm. Fragments were sized using lambda Hind III or 1 kilobase pair (kbp)

PAGE 31

ladder fragment standards from Bethesda Research Laboratories (BRL). Plasmids were prepared by the boiling method (Holmes and Quigley, 1981) or by a modification of the alkaline-lysis method of Birnboim and Doly (1979) and cesium chloride purification. The method of Cockburn and Seawright (1988) was used to prepare insect genomic DNA. Standard methods were used for restriction analysis of plasmid and genomic DNA (Maniatis et a/., 1982) except restriction enzymes were used in excess of the manufacturers' recommendations (BRL). RNA and DNA were quantified by UV AbSggoPrior to hybridization, nitrocellulose filters were baked for 1/2 to 2 hr. at 80°C under vacuum and prehybridized in 5X SSPE (20X SSPE is 3.6M NaCl, 0.2M NaHzPO, pH 7.4, 20mM EDTA pH 7,4), 0.1% SDS and 1% nonfat dry milk (NFDM). The heterologous D. mel anogaster probes were hybridized to nitrocellulose lifts of mosquito-library plaques and Southern transfers at 65° C in 5X SSPE, 0.1% SDS, and 1% NFDM. Prehybridizations and hybridizations with homologous probes were performed at 56° C in 5X SSPE, 0.1% SDS, 1% NFDM and 25% formamide. All films used for autoradiography were Kodak X-AR (Tm) with Kodak X-Omatic Regular (Tm) intensifying screens. The Escherichia coli DH5alpha strain was the host for all plasmids. Bacteria were grown on Luria-Bertani culture medium with 50 ug/ml ampicillin selection. Isolation and Subcloning Mosquito Heat-Shock Genes A partial -digest Sau 3A library of genomic DNA from the mosquito A. albimanus was constructed in bacteriophage EMBL3 (S. Mitchell) and cultured in a P2 lysogen, host strain P2392, to select against nonrecombinant phage. This library was screened with nick-translated heat-

PAGE 32

26 shock probes for the D. mel anogaster 70 and 83 kDa heat-shock-protein genes: plasmid probe aDm2.13 contains the conserved amino-terminal coding region of the D. meTanogaster Hsp70 gene (Claudia Sutton, personal communication), and clone pPW244 contains the entire Hsp83 gene (Holmgren et al., 1979). Positively-hybridizing clones were purified, and preliminary restriction maps were constructed by analysis of fragments separated by agarose gel electrophoresis. Restriction fragments that hybridized to the D. mel anogaster clones were identified by Southern hybridization (Maniatis et a/., 1982), subcloned into pucl9, and restriction mapped to higher resolution. Transcript Analysis Larval mosquitos were reared at 25°C according to the method of Benedict et al . (1979). For heat shocks, 4th stage larvae were transferred to 100ml plastic beakers, the bottom of which had been replaced with fine screen. These were suspended in water for 30 minutes in all experiments. Water baths at 40°C were used except where noted. Nonshocked larvae were maintained at 25°C. Total RNA was prepared from 4th stage larvae by a guanidinium thiocyanate-phenol method (Chomczynski , 1987). Oligo-dT cellulose (BRL) was used to isolate polyadenylated RNA (Maniatis et al., 1982). For northern analysis, RNAs and Ikb ladder DNA size standards were glyoxalated and run on 1.0% agarose gels in 0.01 M NaPO^ buffer at <5.5 V/cm (Maniatis et a/., 1982). Prehybridizations and hybridizations were at 55°C in 5X SSPE, 25% deionized formamide, 200ug/ml salmon sperm DNA, 0.1% SDS, and 5X Denhardt's reagent.

PAGE 33

27 Dot blots were used to quantify the relative heat-shock transcript levels under normal and heat-shock conditions. The blots consisted of 5ug of total RNA bound to nitrocellulose filters, and probed with nicktranslated clone p70a.l6. To determine the total amount of RNA in each dot, duplicate dot blots were probed with an ^. aTbimanus ribosomal DNA probe. Exposed autoradiograms were quantified by densitometry using a cutoff of 0.02 absorbance units/mm^ as the minimum peak value integrated. This value was also used to calculate relative absorbances when no peak was detected. Before subcloning into plasmids, cDNA probes were used to determine the regions of the lambda clones which might be transcribed. cDNA probes were prepared by annealing oligo-dT primers (BRL) to total RNA and extending the primers with cloned M-MLV reverse transcriptase (BRL). Prehybridization, hybridization and autoradiography were the same as for Southern analysis. Primer extension was used to determine the transcription start sites. Oligonucleotides based on putative leader sequences were 5' endlabeled with ^^P (6000 Ci/mMol, New England Nuclear, NEN) using T4 kinase (BRL). End-labeled oligonucleotides were annealed to complementary RNAs at 50°C for 5 hr in IX hybridization buffer (5X is 2 M NaCl, 0.2 M PIPES (pH 6.5), and 5 mM EDTA), and extended with cloned M-MLV reverse transcriptase. The extension products were resolved on 6% denaturing sequencing gels. Sequence standards for the extension experiments were chain-terminated sequencing reactions of the mosquito Hsp70 clones using approximately 5 X 10^ dpm of the same end-labeled primers.

PAGE 34

In situ Hybridization to Polvtene Chromosomes In situ hybridizations to polytene chromosomes were performed by a method (Johnson-Schl itz and Lim, 1987) which has been modified for mosquito polytene chromosomes by S.E. Mitchell (personal communication). Briefly, salivary chromosomes from middle to late 4th stage larvae were dissected in 45% acetic acid, transferred to 1:2:3 (lactic acid: water: glacial acetic acid respectively) and squashed under siliconized coverslips. The slides were refrigerated overnight and then frozen at -70°C. While still frozen, the coverslips were removed and the slides were transferred to absolute ethanol at -20°C, and allowed to warm to room temperature. The slides were then dried, acetyl ated, denatured in 70 mM NaOH for 1 minute, and hybridized to nick-translated biotinylated DNAs (bio-21-dUTP, Clontech) labeled according to the nick-translation kit recommendations (BRL). Hybridization was detected with streptavidin/alkaline phosphatase (Clontech) using the substrates NBT and BCIP. Chromosomes were counter-stained with Giemsa for about three minutes and observed by phase-contrast microscopy. Band designations were made using the standard polytene chromosome map (Keppler et a1., 1973). DNA Sequencing The subcloning strategies were designed to eliminate the transfer of deleted fragments to new vectors and to allow use of the standard M13/pUC-universal and T7/T3-alpha-reverse priming sites flanking the multiple cloning site of pUC19. Deletions for sequencing p70a were made by the Kilo-sequencing method of Barnes (Barnes, 1983) as follows: supercoiled plasmids were

PAGE 35

29 nicked with Dnase I, the nick widened with Exonuclease III, and the resulting single-stranded DNA digested with Bal 31. The unique lefthand Sa7 I site in the polyl inker was digested, the ends filled using cloned Klenow fragment of DNA Polymerase I (Kl enow) (International Biotechnologies Inc., IBI), and the deletion-bearing plasmids religated. Additional sequence was obtained from p70a.l6 with a custom primer, CGTTGAAGTAGGCTG (position 1621, Figure 3-12) based on its sequence, and to extend the 3' ends of the p70a open reading frames (ORFs) with two other primers based on their sequence: GCAGCCAAGGAT (positions 596 and 4498), and CGGAGAAGGAAGAGTACGAGCACCAAATGC (positions 285 and 4790). (All DNA sequences throughout this paper will be shown 5-prime (5') to 3prime (3')). Subclone p70a.dl was a product of the deletion subcloning for sequence analysis of p70a (Figure 3-3). It was utilized in in situ hybridizations as a clone-specific probe. Subclones for sequencing the other A. albimanus Hsp70 clone (p70b) were made by cutting the plasmid at the unique Mlu I site in the center of the insert, digesting bi-directionally with Exonuclease III, and removing aliquots at 90 second intervals. The single-stranded DNA was then digested with SI nuclease. The remaining right-hand portion of the sequence was removed by digesting the unique Hind III site in the multiple cloning site, and the ends were filled using Klenow before ligation at a dilute concentration. Bacteria were transformed by standard methods (Hanahan, 1983) and screened for appropriately sized plasmids. Additional sequence was obtained by sequencing the parent plasmid (p70b) and a subcloned fragment, p70b.5.

PAGE 36

30 Sequencing reactions were performed on boiling-method preparations of 2-5 ug of plasmid DNA prepared from 2ml overnight grow-ups. Plasmids were alkali -denatured for primer annealing. Sequenase version 1.0 or 2.0 (Tm, U.S. Biochemical Corp.) was used for chain-termination sequencing (Sanger, 1977) with manufacturer-supplied reaction solutions and procedures. Reaction products were labeled with ^^S dATP (5000Ci/mMol , NEN) in buffers containing Mg^. Alternatively Mn^ was added to increase readability close to the primer for primer extension standards (Tabor and Richardson, 1989). Most sequencing reactions were run on 0.2-0.9 mm wedge gels (4% acrylamide (19:1 linear to bis, LKB), 8M Urea, IX TBE) at 55°C, 1750 volts on an LKB Macrophor (Tm) , Sequigen (Tm, BioRad), or user-built electrophoresis unit. All gels were rinsed for 10 min. in 10% acetic acid before drying in a forced-air oven at 80°C. Gels run on the Macrophor were bonded to the running plate, but others were transferred to filter paper for drying and autoradiography. Sequence analysis was done on the Genetics Computer Group (GCG) Software Package (Devereux, 1984) version 6.1, and the Multiple Sequence Editor (Massachusetts Institute of Technology) both running on a MicroVAX II computer. DNA sequences came from Genbank version 60 (June, 1989) or European Molecular Biology Laboratory version 19 (May, 1989) databases. Dot plot comparisons to identify sequences shared by mosquitos and D. meTanogaster were done using the computer program D3H0M (Fristensky, 1984). For mosquito/mosquito comparisons, the homology range was 10 bases and the minimum homology displayed was 60%. For mosquito/D. melanogaster comparisons, the homology range was three and the minimum homology displayed was 80%. In both cases the scale factor was 0.95. These parameters were empirically determined.

PAGE 37

31 Heat shock element (HSE) consensus sequences were identified by computer analysis using the consensus of Pelham (Pelham, 1982) with equal weights for all positions, the weighting scheme and definition of Xaio and Lis (1988), and the frequencies of Amin et al . (1988) (Figure 3-1). I wrote a BASIC program WEIGHTS to scan and assign scores to nucleotide sequences based on a user-defined weight matrix (Figure 3-2). The program uses a si iding-window approach similar to many databasesearching and dot plot programs. In this case, a window of the sequence in question is compared nucleotide-by-nucleotide with the weight-matrix values and the sum becomes the score of that window. The window is then advanced to the next position one nucleotide down and the process repeated. The score obtained represents the degree of match to the matrix sequence with provision for unequally weighting each position in the matrix sequence. The program is suitable for scoring any ungapped sequence of up to 50 nucleotides for which nucleotide frequency data is available such as TATA boxes and cap sites (Bucher and Trifonov, 1986), translation start sites (Cavener, 1987) and polyadenylation sites (Birnstiel, 1985). The program also calculates the average score and standard deviation. It is available from the author in BASIC language or compiled. Dinucleotide frequency chi-square analysis was performed using the procedure FREQ in the SAS software package.

PAGE 38

32 Results and Discussion Isolation and Mapping the Mosquito Hsp70 and Hsp83 Genes Of 50,000 EMBL3 clones screened, two hybridized to the D. mel anogaster Hsp70 probe and were given the names 70a and 70b. The haploid genome size of anopheline mosquitos is about 2 X 10® bp (Rao and Rai, 1987) and the average insert size in the library is expected to be 15,000 bp. Therefore, assuming random representation of sequences, the probability of missing a single-copy gene in this screen was 0.02. The two pUC19 subclones p70a and p70b (from lamda 70a and 70b respectively) did not overlap and were presumed to represent different loci. The restriction map of each clone has an axis of symmetry (Figures 3-3 and 3-4). This axis in p70a is flanked by 2.5 kbp of sequence with identical six-base restriction sites (as determined by restriction mapping) and in p70b by 2.2 kbp of moderately-conserved restriction sites. As the sequence data presented below will show, each clone contains two Wsp/O-similar genes in this palindrome; p70a has two entire genes, and p70b has one entire gene and 80% of the coding region of a second gene, the remainder of which was deleted in the original cloning. One subclone from each of the two candidate Hsp70 mosquito subclones p70a and p70b was isolated for probing genomic Southerns. The p70a left-hand central 1.2 kbp Eco Rl/Bgl II fragment was transferred to the Eco Rl/Bam Hl-digested plasmid vector pIBI30 (IBI) as clone p70a.l6 (Figure 3-3). Sequence data will show that this sequence contains 0.7 kbp of highly conserved coding sequence and 0.5 kbp of nonconserved upstream leader and promoter region. The central 0.7 kbp Xba I fragment of p70b was cloned into the Xba I site of pIBI30 to create p70b.5

PAGE 39

33 (Figure 3-4). This fragment contains only regulatory sequences and does not cross-hybridize with p70a. Of 34,000 clones screened with the H5p83 gene of D. mel anogaster (pPW244), one positive clone was identified, subcloned into pucl9 as p83a and mapped (Figure 3-5). The probability of missing a single-copy gene in this screen was 0.10. Two regions of p83a hybridize both to the Drosophila Hsp83 probe and to radiolabeled heat shock cDNA (Figure 3-9). These data are consistent with two genes, a pseudogene(s) , or a single gene containing an intron. One subclone of p83a was isolated to probe genomic Southern transfers by cloning a 1.7 kbp Xba l/Bgl II fragment into the Xba l/Bam HI site of pIBI30. This clone includes regions of p83a to which both the D. melanogaster Hsp83 (data not shown) and mosquito heat-shock cDNA probes hybridized (Figures 3-5 and 3-9). Southern Analysis of Moscuito Hsd70 and HsdSS Genes In order to determine the number of genes homologous to each of these clones and to reveal potential cloning artifacts, the subclones were used as probes of genomic Southern blots. Additional genes would appear as unexpected fragments, and cloning artifacts would be detected by the absence of fragments predicted from the restriction digests of the cloned probes. Filters of restricted genomic DNA were probed with the p70bspecific subclone p70b.5 (the axial Xba I fragment of p70b) (Figure 36). A single major band appears in each lane: Nsi I, a band of 6.5 kbp, placing a second Nsi I site asymmetrically just outside the cloned portion of the left gene; Hlu I, a 5.4 kbp band, indicating another

PAGE 40

34 Mlu I site is symmetrically located in the genome in the uncloned portion of the left gene; Eco RI, the 2.7 kbp central Eco RI fragment of p70b; and Xba I, the 0.7 kbp fragment corresponding to the probe p70b.5. These data indicate that there is one copy of the p70b sequence in the genome. ' . Similar digests were probed with p70a.l6 (Figure 3-6). This subclone hybridizes to the coding and noncoding regions of the parent plasmid p70a, but less intensely to p70b due to coding and noncoding sequence divergence, and not at all to the axial Xba I fragment of p70b. These digests are interpreted as follows: Nsi I, the 6.5 kbp band is from 70b, the more intense 4.4 kbp band is the predicted central Nsi I fragment of p70a, and the 3.3 kbp band is of unknown origin; MTu I, the 5.4 kbp fragment is from 70b, and the intense 7.0 kbp fragment is from 70a (the predominant mosquito allele has an internal Mlu I site not present in p70a); Xba I, one faint band is the 4.0 kbp band expected from the right gene of p70b.7 and either the 6.0 kbp fragment or the upper band in the complex around 3.0 kbp may represent the left gene. If the central Xba I site of p70a is not present in all alleles, then 3.0 and 4.5 kbp fragments would result when it is present, and a fragment of 7.1 kbp when it is absent. The sixth fragment is unexplained. Preliminary Southern analysis of individual mosquitos shows that Xba I fragment polymorphism does exist (data not shown). Although the p70a.l6 hybridizations are confounded by crosshybridization, p70a is probably a single copy in the A. albimanus genome and occurs in the form cloned or as close variants. The genomic DNA fragments bearing Hsp70 genes that were detected here are not consistent with those tentatively identified by Narang et

PAGE 41

35 al. (1985). Specifically, the sizes of the Hind III and Eco RI fragments that they determined by probing genomic Southerns with D. melanogaster probes are not the same as in the sequences I have studied. This may be due to mosquito strain differences. I cannot be certain that other //sp/Orelated genes such as the Hsp68 (Holmgren et a/., 1979) and Hsc70 heat shock cognate genes (Ingolia and Craig, 1982) (Craig et a/., 1983) are not present since the hybridization conditions used were stringent. Data presented below from in situ hybridizations will clarify the organization of the Hsp70 and Hsp83 genes. Restricted genomic DNA probed with p83a.l3 confirms the accuracy of the restriction map of this clone (Figure 3-6). p83a.l3 crosshybridizes with the 2.2 kbp Xba l/Bgl II fragment of p83a.l (data not shown) so p83a also contains two regions of similar sequence. The digests in Figure 3-6 can be interpreted as follows: Xba I; two bands of 3.0 and 3.25 kbp are the cross-hybridizing central Xba I fragment and the p83a.l3 fragment that extends to an Xba I site just outside the right-hand plasmid cloning site; Nsi I, the cross-hybridizing 6.5 kbp left-hand fragment expected and a second 5.8 kbp fragment extending to an Nsi I site to the right of the cloning site; Hind III, one prominent band of 6.3 kbp is present so equidistant sites must be located on either side of the single site in p83a, or a second very large fragment was not resolved on this gel; Bgl II, a single band of 5.1 kbp is the expected central fragment containing both the cross-hybridizing regions. These data, together with transcript analysis discussed below, reveal that the sequences present in this clone are palindromic with an axis roughly centered on the single Hind III site. The restriction-site

PAGE 42

conservation is not high enough to allow one to ascribe equivalence to particular sites in either half. In Situ Hybridizations As described in the previous section, two distinct pairs of Hsp70 clones were found in the genomic library. However, some fragments in the genomic Southern hybridizations could not clearly be identified with the clones isolated, so the exact number of loci containing Hsp70 genes was unclear. To clarify this situation, probes were selected for in situ hybridizations to polytene chromosomes to define the number of locations of these genes. Clone p70a.l6 was expected to hybridize to all Hsp70 loci, but to the p70a locus most intensely. Two clone-specific plasmids, p70a.dl and p70b.5, were used to distinguish their respective loci . Hybridization of p70a.l6 to the polytene chromosomes occurred at two loci on the right arm of chromosome 2 in most complements; a strong signal was seen in the proximal bands of region 13C and a weaker signal in the proximal band of IIC (Figure 3-7). Although hybridization could not be seen clearly in both bands in all chromosome complements of each individual, both loci did show signal in most complements. p70a and p70b were tentatively assigned to 13C and IIC respectively. This was confirmed by subsequent probing of the salivary polytene chromosomes with the clone-specific probes p70a.dl and p70b.5. Clone p70a.dl hybridized only to IIC and p70b.5 only to 13C, conclusively showing that clone p70a is derived from locus 13C and p70b from lie. This genomic organization of two pairs of genes in divergent

PAGE 43

37 orientation on the same chromosome arm is therefore the same as that observed in most Drosophila spp, (Leigh-Brown and Ish-Horowicz, 1981). Clone p83a hybridized to a single locus, the distal band of 40A, on the left arm of chromosome 3 (Figure 3-7). A single site of hybridization is consistent with the Southern hybridizations and shows the A. albimanus Hsp83 gene(s) is located at a unique locus as in D. melanogaster (Holmgren et a7., 1979). Transcript Analysis Northern analysis . The mosquito Hsp70 and Hsp83 clones were isolated in this study by an approach independent of transcription or induction under heat shock. Therefore, RNAs were analyzed to determine the sizes of the transcripts which hybridize to the clones isolated, and their relative abundance under normal and heat-shock conditions. For this purpose, gel electrophoresis was performed for northern analysis. Northern analysis of total and polyadenylated RNA shows that RNAs that hybridize to the p70a and p70b probes are polyadenylated and strongly induced upon heat shock (Figure 3-8). The filters of total heat-shock RNAs probed with p70a, p70b or p83a give size estimates of 2.6 kb for the Hsp70 transcripts and of 3.0 kb for the Hsp83. Sequence analysis of p70a and p70b (see below) predicts transcripts of 2.1 bp before polyadenylation which is consistent with the size of the RNA detected here. These sizes are also consistent with RNAs encoding proteins of 70 and 83 kDa. cDNA-probinq of lambda clones . Southern hybridization of restricted lambda clones probed with cDNAs from heat-shocked larvae identified sequences that hybridize to abundant mRNAs. These

PAGE 44

38 preliminary analyses were done using RNA from larvae shocked at 37°C for 30 minutes, using the induction temperature that is optimal for D. melanogaster Hsp70. When restriction digests of lambda clones 70a and 70b were probed with cDNAs made from either nonshocked or heat-shocked larvae, fragments were detected that are consistent with the regions believed to be transcribed based on sequence analysis (Figure 3-9). This also demonstrated that these genes are transcribed at a low level until heatshock induction. The first four lanes in the left hand panel show that the 9.4 kbp Hind Ill/Sal I fragments of 70a and 70b contain all of the sequences complementary to abundant RNAs during heat shock. Only faintly-hybridizing bands were observed when digests of 70a or 70b were probed with nonshock cDNA. The Xho l/Sal I digest of 70a yields hybridizing fragments of 2.5 kbp, the left-hand fragment which extends slightly into the downstream end of the coding region, and a larger 9.4 kbp fragment which is the downstream end of the right-hand gene and flanking DNA. The failure of either the central or internal Xho I fragments to hybridize indicates that the polyA-primed cDNA extensions generally terminated before these regions were reached. The Xho I digest of 70a gives three hybridizing fragments, some of which appeared to be due to a partial digest and were not interpretable. Only one 70b fragment is detected in the Xho I or Xho l/Sal I digests, representing the 3' end of the right gene. No fragment from the left gene is detectable since only the 3' ends of the genes are labeled, and this part of the left gene was not cloned. Clone 83a contains sequences that hybridize to abundant RNAs in both normal and heat-shocked larvae (Figure 3-9). Only one hybridizing

PAGE 45

band is seen in the Bam Hl/Sa/ I and Sa/ I digests: the Sal I fragment subcloned into p83a. The insert contains no Bam HI sites. In the Hind lU/Sal I digest, the 5.3 and 3.5 kbp fragments are the left and right fragments of the Sal I fragment subcloned into p83a. Two major regions of 83a hybridize to the cDNA probes (Figure 3-5) confirming that p83a contains two regions with similar sequences, as would be expected based on the cross-hybridization of p83a.l3 to the other p83a Xba l/Bgl II fragment, and the hybridization pattern of the Drosophila Hsp83 probe. The filters of Figure 3-9 were probed with aliquots of the same cDNA probe, washed similarly, and the films were exposed for the same amount of time. Therefore, comparisons of the signals suggest that the Hsp83 genes are normally transcribed at moderately high levels relative to the Hsp70 clones, and are induced only slightly at 37°C. The Hsp70 clones have much lower levels of nonshock transcription, and show lower induction at 37°C than Hsp83. Dot blots of total RNA . In order to determine the effect of various temperatures on Hsp70 transcript levels, dot-blot analysis was performed by hybridizing one of the mosquito Hsp70 subclones, p70a.l6, to total RNA. Maximal expression was observed at 40°C, rather than at 37°C as in Drosophila (Figure 3-10). Heat-shock transcript levels at 40°C ranged from 15 to 335 times higher than controls (avg. = 143), The temperature at which the highest transcript levels was observed is similar to that of Aedes albopictus (Gerenday, 1989)(Berger et a/., 1985) and Plodia cells in culture (Berger et a/., 1985). No RNA isolations were done

PAGE 46

40 using larvae shocked at 43°C since mortality was observed at that temperature. Once I had determined that maximal induction occurred at 40°C, experiments were conducted to determine the relative transcript levels over time: before, during, and after a 30 minute heat shock. Dot blots of total RNA probed with p70a.l6 showed that transcripts increase 140to 520-fold (average = 320) and peak within 15 minutes of heat shock (Figure 3-10). They then gradually decrease, but transcripts are still easily detectable 2V2 hours after the shock ends. The average transcript level at 30 minutes is 275 times that of controls, which is similar to the induction observed in the temperature dot-blot experiments above. Since p70a.l6 hybridizes to both pairs of Hsp70 genes, the induction measured is a composite of RNAs transcribed from all four genes. I collected no data that clearly indicate the relative contribution of the four genes present. However, I have observed consistently stronger signals from p70a in northern and cDNA analysis. The results of the primer-extension experiments will be discussed following the DNA sequence data. DNA Sequence of p70a and D70b The DNA sequences of p70a and p70b were determined for the putative coding and promoter regions of both pairs of genes, except for the C-terminal end of the left gene of p70b which was truncated in the clone. The major features of p70a and p70b sequences are listed in Table 3-1. Each plasmid contains two large divergently oriented open reading frames (ORFs) (Figures 3-3, 3-4, 3-12 and 3-13). The rightand

PAGE 47

41 left-hand ORFs and conserved upstream regions will be referred to as the right and left genes. DNA sequence of p70a genes . The p70a transcription start sites and putative translation start and stop codons predict open reading frames of 1923 bp for both genes and mRNAs with untranslated leaders of 222 and 231 bp for the left and right genes respectively. Only 515 bp separate the transcription start sites. The region between the TATA boxes is slightly A+T-rich (55%) though not as greatly so as the spacer region of the D. melanogaster Hsp70 genes (Torok and Karch, 1980). This is close to the average composition of 58% A+T for A. albimanus determined by A. F. Cockburn (personal communication) and indicates that although unusually high A+T content is seen in the D. melanogaster Hsp70 spacer, the mosquito spacer has average composition. There is remarkable sequence similarity between the two genes from 150 bp upstream of the TATA boxes to the distal ends of the ORFs, although there are insertion/deletions, particularly in the untranslated leaders (Figure 3-14 and 3-15). In contrast to the promoter and transcribed regions, the left and right genes have no obvious sequence conservation downstream of the translation stop codons (to be discussed in Chapter 4). I observed 26 nucleotide differences between the 1923 bases of the protein-coding regions of the left and right genes: 1, 0, and 25 at the first, second and third positions of codons (18 transitions, 8 transversions) . The predicted amino acid sequences differ by one conservative substitution at residue 562; aspartic vs. glutamic acid. The predicted molecular weights of the left and right gene-encoded proteins are 70,251 and 70,237 Daltons (Da).

PAGE 48

42 Several large palindromic regions occur in the spacer region centered around bases 2394 and 2724. These consist of, or are adjacent to the heat-shock-element (HSE) arrays just upstream of the TATA boxes (discussed further below). One palindrome of 23 bases surrounds the Bgl II site at 2516 off the central axis toward the left gene. Primer extension . DNA sequence information alone is of relatively little value for identifying regulatory regions unless the transcribed regions are known precisely. For our purposes particularly, the 5' end of the transcripts should be mapped since sequences necessary for heat shock induction are found upstream to, and in this region. Primer extension involves annealing a radiolabeled DNA primer to RNA which provides an initiation site for cDNA synthesis from 3' to 5' along the RNA. The RNA serves as a template for this enzyme-directed synthesis until the end 5' end is reached. The resulting cDNA fragment is analyzed on sequencing gels using DNA sequencing reactions as sequence and size standards. Primer-extension experiments on total RNAs were used to map the transcription start sites of the Hsp70 genes. Minor sequence divergence in p70a allowed synthesis of rightand left-gene-specific 20-mers with three mismatches: TCTGATACACTGATTACTTA and TCTAATGCACTGATTACTTG (positions 2934 and 2161 respectively, Figure 3-12). The specificity of these was confirmed by using them as primers to sequence p70a which contains both annealing sites. Since no leader-sequence differences downstream of the suspected transcription initiation site were available to distinguish the right from the left genes of p70b, a synthetic 25-mer

PAGE 49

43 primer (TTATACGCTTTCTGATGCAACAATT) was used to map the transcripts of both (positions 1573 and 2639, Figure 3-13). Primer-extension experiments mapped the transcription start sites of p70a to bases 2290 and 2805 (Figure 3-16), 31 bases from the first bases of the TATA boxes. Identification of these start sites accords well with predictions based on the D. melanogaster start sites and typical distances from the TATA box (Bucher and Trifonov, 1986). No bands were observed in the nonshock RNA control lanes. The primer chosen for p70b hybridizes to both genes of that clone, so the products of this experiment could have originated from one or both of the genes. However, since the sequence of the pair is the same for about 250 bp flanking this site, it is likely that they are transcribed similarly. Two pairs of bands were observed. The more prominent ones correspond to initiation sites at bases 1687 and 1690 for the left gene, and at 2522 and 2525 for the right gene. Since the putative TATA box is repetitive (TATATAAA in Fig 3-17), and a tandem repeat of GTCGTC is found at the transcription start (Figure 3-15), transcription may initiate in both positions, within 29 or 32 bp from the TATA box. This determination again fits well with comparison of similar sequences of D. melanogaster and TATA box predictions. An unusual s eouence observed in the D70a untranslated leaders . The untranslated leader sequences contain a curious sequence of 51 bases completely devoid of thymidines beginning 4 bases after the transcription start sites (Figure 3-17). The major recognizable pattern is seven tandem repeats of CAAG which can be generalized to C-A/G-A-G/A. The same pattern is found to a limited extent in a similar location in three D. melanogaster genes known to be preferentially transcribed and

PAGE 50

44 translated during heat shock: Hsp70 (McGarry and Lindquist, 1985), Hsp22 (Hultmark et a/., 1986), and other D. melanogaster heat shock genes (Figure 3-17). It is not found in other insect genes or the Hsp83 gene which are not efficiently transcribed and preferentially translated under heat shock (compiled by Hultmark et al . (1986)). Could this motif represent the DNA sequence responsible for preferential translation, and to a lesser extent efficient transcription of these genes during heat shock? Undefined sequences in the first 30 bases of the leader are known to be necessary for efficient heat-shock transcription and preferential translation of Hsp22 (Hultmark et a/., 1986), and Hsp70 (McGarry and Lindquist, 1985) and are sufficient to confer this quality on D. melanogaster YPl (Kraus et al., 1988) and Adh transcripts (Klemenz et a/. 1985). However, only a very loose consensus sequence has been identified. What mechanisms might account for the supposed transcriptional and translational functions of this sequence? In D. melanogaster Hsp70 genes, RNA Polymerase II (Pol II) is known to be transcriptionally engaged near the 5' end of the RNA in nonshocked cells with an approximately 25-base nascent mRNA synthesized, but elongation is prevented by some unknown mechanism until heat shock occurs (Peri sic et al., 1989). Perhaps some transcription factor binds to a conserved sequence in this region to regulate transcription. Alternatively, capping of mRNA may regulate translatabil ity and transcript stability differently under heat shock and normal conditions. Maroto and Sierra (Maroto and Sierra, 1988) have shown that cap analogues inhibit the translation of normal D. melanogaster mRNAs and Hsp83 transcripts but not other heat-shock transcripts. Sequences near the start of heat-

PAGE 51

shock transcripts may either interfere with normal capping or bind factors which allow preferential translation of heat-shock transcripts during shock. The CAAG sequence is absent from the p70b transcription start sites. It is also not present in D. meTanogaster Hsp70 clone B8 (Ingolia et al . , 1980). Perhaps greater variation exists in the expression of different copies of Hsp70 genes than has previously been supposed. The sequence variation in this region might confer differential expression controls upon the Hsp70 genes which expands the repertoire of stress response, and the presence or absence of repeats of the above sequence motif may be responsible. DNA sequence of p70b genes . Clone p70b contains two ORFs of 1506 and 1923 bp, in divergent orientation like those of p70a (Figures 3-4 and 3-13). The cloning site truncates the left gene at amino acid 502, but the right gene is complete, and would encode a peptide of 641 amino acids and molecular weight 70,153 Da. The TATA boxes are separated by a spacer which is 60% A+T. Comparison of the sequences of the two genes revealed a singlebase deletion in the right gene. This deletion, which was unequivocally identified in two independently obtained deletion subclones of p70b at position 3419, would alter the translation frame and cause termination at codon 262. This deletion might exist only in the parent clones, or it may be the native genomic form. Since no other features of this sequence suggest it is a pseudogene, I have tentatively inserted an "N" into the deletion to restore the reading frame for sequence and evolutionary analysis. The "N" is inserted in the third position of a codon and does not affect the predicted amino acid.

PAGE 52

A cloning artifact was identified by sequencing through the lefthand Sal I subcloning site. Rather than the desired Sal I insertion on the left end, the insert was added 3' to the Sph I 5' "G" in the pUC19 multiple cloning site (MCS), thus preserving the MCS Pst I site. It is highly improbable that the multiple cloning site would have been recreated by the insert so a cloning artifact is almost certain. All of the sequences involved in this artifact are vector sequences and do not affect conclusions about the Hsp70 insert sequence. The right and left transcription start sites are separated by 831 bp which is 316 bp more than in p70a. The length of the nontranslated leader of both genes is either 181 or 184 bp depending on the transcription start site used (discussed below). The divergent genes of p70b are more similar to one another than the p70a pair. The untranslated leaders are identical and the promoters have more extensive regions of sequence similarity upstream of the TATA box; about 250 bp rather than 150 bp as in p70a (Figure 3-14). In the 1506 bp of protein-coding DNA compared between the left and right genes, there are only two differences out of 1506: both are third position changes and are silent. Sequence comp arisons between D70a, p70b and D. mel anog aster Hsp70 genes. The p70a and p70b genes share conserved sequences with each other and with the D. melanogaster Hsp70 genes at the translation start site (Figure 3-15). Similar sequences are found in most eukaryotic genes (Cavener, 1987). The protein-coding regions are similar as are the sequences at, and immediately upstream of the TATA boxes. However, the untranslated leaders are very dissimilar.

PAGE 53

47 A codon usage table was generated for the A. albi'manus Hsp70 genes and listed parallel to usage for the D. meTanogaster Hsp70 (Table 3-2). Visual inspection indicates differences between A. albimanus and D. mel anogaster usage for threonine, serine, leucine, and proline. This information will serve as an aid to codon selection for future mosquito synthetic gene construction. A dinucleotide frequency table was generated for the mosquito protein-coding regions, putative untranslated mRNA-encoding leader sequences, and spacers between TATA boxes (Table 3-3). The distributions all deviated significantly from expected values (chisquare test, P < 0.001, 9 degrees of freedom). GG, CC, and TA pairs were consistently under-represented; GA and TC were over-represented, the latter especially so in coding regions. Inconsistencies between dinucleotide frequencies of different types of sequences compared were observed for GT pairs which are frequent in the spacer and coding regions but relatively infrequent in both leaders. Protein-binding CT DNA secuences of D70a and D70b . Gilmour et al . (1989) have identified regions of the Hsp70, Hsp26, and His3 {D. mel anogaster Histone-3) promoters that bind a protein that is supposed to have a role in assembling and maintaining transcriptional complexes in transcriptional preparedness. This protein binds to regions of alternating C and T within approximately 200 bases upstream of the TATA box. A similar if not identical protein binds to the partially complementary sequence C/A-G-A-G-A-G-A-G-C in the D. mel anogaster Ultrabithorax promoter (Biggin and Tjian, 1988). In the p70a interstitial region, no extensive CT repeats occur although three small regions around 2350, 2477, and 2527 are similar. However, the sequences

PAGE 54

48 of the D. melanogaster protein-binding regions are so variable that one cannot rule out functionally equivalent sequences in this clone. Sequences resembling the CT protein-binding regions do occur in p70b upstream of the TATA box around 1910, extensively at 2300, and also at 2450 and 2390. However, the significance of these, if any, is unknown. Promoters of the p70a and p70b genes . Heat-shock elements are essential regulatory sequences found upstream of the transcription start sites of heat-inducible genes (reviewed by Pelham (1985)). Two sets of HSE within 100 bases of the TATA box are necessary for heat inducibil ity. Pelham (1982) originally defined the HSE as the 14 base palindrome CTNGAANNTTCNAG by deletion analysis of hybrid constructs in monkey COS cells. Xiao and Lis (1988) have redefined the HSE as overlapping 10 bp sequences of NTTCNNGAAN. This work was corroborated by Amin et al . (1988) using Hsp70/LacZ fusions to transfect D. melanogaster cells. These definitions, though arrived at by different means, all overlap, i.e. are circular permutations. On the basis of these definitions, potential HSEs were identified in the promoter sequences of p70a and p70b using the program WEIGHTS. Figures 3-14 and 3-18 compare the mosquito and D. melanogaster promoters and indicate the high-scoring HSE-like regions. The locations of the mosquito HSEs are similar to that observed in the D. melanogaster Hsp70 and other heat-shock genes (Pelham, 1985). However, the mosquito HSE are more numerous and match the consensus more closely than those of D. melanogaster. Scanning sequences with the Xiao and Lis matrix contributed little additional information. Might mosquito Hsp70 promoters be superior to those of D. melanogaster for the expression of hybrid genes in mosquitos?

PAGE 55

Drosophila Hsp70 promoters are clearly inducible in whole mosquitos (Miller et a/., 1987) and mosquito cell cultures (Durbin and Fallon, 1985) (Berger et a?., 1985), but mosquito promoters are potentially superior in several ways. First, the mosquito Hsp70 promoters might be induced to a higher rate of transcription than the commonly used D. melanogaster Hsp70 promoter. This would make it possible to obtain better discrimination with genetic markers, and achieve higher recovery of transformed individuals. Additionally, adequate transcript levels might be obtained by shocking with lower temperatures so that less stress would result to the insect. My analysis of mosquito heat shock promoter sequences suggests they may indeed be stronger promoters based on sequence composition (Xiao and Lis, 1988) and numbers of HSE (Kraus et a?., 1988). A second set of possible improvements relate to the temporal and tissue-specific induction of mosquito heat-shock promoters. Heat shock promoters that contain very abundant HSE have been identified whose expression is modulated in tissueand developmentally-specific ways by other promoter sequences. These other sequences may not be apparent, nor conserved in other genera, e.g. the ecdysone response of the small heat-shock genes (Ireland et a1., 1982)(Simon and Lis, 1987) and tissuespecificity of Hsp83 of D. melanogaster (Xiao and Lis, 1989). Though ubiquitous expression is the rule using a D. melanogaster HspJO promoter, tissue-specific exceptions are observed (Bonner et a/., 1984), and mosquito HspJO promoters may differ advantageously by being either more or less specific. A third characteristic of the mosquito promoters which might be exploited is the divergent orientation of the genes. The presence of

PAGE 56

50 this arrangement in both mosquitos and DrosophiTa spp., whether due to convergence or conservation, suggests that it has functional significance. The function may be to promote conversion within the gene pair (Leigh-Brown and Ish-Horowicz, 1981) (to be discussed further in Chapter 4), or the divergent arrangement may allow HSE to act simultaneously on two different genes. There is precedent for bidirectional regulation of genes from common HSEs in Dictyostelium (Zuker et a/., 1984) and for Caenorhabditis elegans heat shock promoters in mouse cells (Kay et a/., 1986). The extremely close proximity of the HSE arrays of the two divergent gene pairs, particularly of p70a, may promote cooperativity between DNA-binding proteins that affect both transcription units simultaneously. In contrast, the D. melanogaster Hsp70 promoters in use for hybrid gene expression are single upstream arrays, derived in fact from loci at which the genes are in tandem repeats, unlike Hsp70 genes in most Drosophila species. Another possible advantage of maintaining the divergent orientation might be to exclude regulatory proteins from interfering with proper expression. For example, the D. melanogaster Hsp83 promoter contains regions upstream of the TATA box-proximal HSE that are responsible for tissue and temporal -specif ic expression. If these are deleted, regulation is similar to Hsp70 (Xiao and Lis, 1989). One might object that no improvement would be made in gene expression by using promoters with HSE at a distance of greater than 100 bp since HSE beyond that distance are not considered to be necessary to induce the heat-shock response in transgenic animals (Pelham, 1982)(Corces and Pellicer, 1984). However, HSE do occur beyond that distance both in Drosophila and A. albimanus (Figures 3-14 and 3-18) and

PAGE 57

51 have been shown to be important in regulation of the small heat shock protein genes (Simon and Lis, 1987). It is possible to address the functional significance of the divergent orientation using either D. mel anogaster or A. albimanus symmetrical promoter regions to control the expression of two different divergently transcribed reporter genes. Constructs such as this could be altered by varying the distance separating the genes, mutating one half, or creating absolute symmetry without an intervening diverged region. These hybrid genes could then be transfected into cultured cells, assayed by transient expression, or introduced into Drosophila by P-element transformation (Rubin and Spradling, 1982). Variable results due to chromosomal location would tend to affect each reporter similarly, but could be controlled further by comparing different transformed lines carrying the same construct. Reporter differences could be controlled by placing either gene in both positions relative to the asymmetries of the promoter. These experiments have the potential to reveal subtle effects on Hsp70 promoter activity that have been overshadowed by the large effects due to the HSE. The mosquito heat shock promoters that I have isolated have potential for improving hybrid gene expression. The considerations above clearly dictate that this will be resolved only by experimentation.

PAGE 58

nol. rla LI 1 A (Xiao and Lis, 1988) r u o T 1 r \^ II Y U 1 1 X 0 n 1 1 J. 1 n \J u u c HI n u u u n n 36 0 0 0 4 0 0 0 40 0 0 5 0 0 15 0 0 0 6 0 15 0 0 0 0 7 40 0 0 0 0 0 8 0 36 0 0 0 0 9 0 41 0 0 10 0 11 0 0 0 0 HSE Matrix f Dal k ^re 1 naiii, Pnc G A T r II V U T 1 1 0 0 0 1 n u u 2 0 0 10 u u u 3 0 0 0 n U u u 4 10 0 0 n u n n u u 5 0 10 0 n u n n 6 0 10 0 u u 7 0 0 0 0 n n 8 0 0 0 0 0 0 9 0 0 10 0 0 0 10 0 0 10 0 0 0 11 0 0 0 10 0 0 12 0 0 0 0 0 0 13 0 10 0 0 0 0 14 10 0 0 0 0 0 Figure 3-1. HSE Scoring Matrices For Use in the Program WEIGHTS. The upper matrix is from Xiao and Lis (1988). Only scores above 200 were saved. The lower matrix is based on the general consensus of Pelham (1982) using a score cutoff of 70. In the latter matrix, each position IS weighted equally. The third matrix of Amin et al . (1988) is based on nucleotide frequencies in a 38 bp region of recognized heat shock promoters from several species. The minimum score saved in that analysis was 1100. Weighting tables for sequence analysis by WEIGHTS should be created as text files in the form shown above. Fractional values may be used as well.

PAGE 59

HSE Weight Matrix (Amin et al.,1988) roi r u A M T 1 r II u Y I 1 n u 0 U n u ft u ft u ft u HO 1 Q X o ft u ft <9 n u n u ft u ft ft u n VI A f n u n u n u ft u ft u ft u C 9 0 n u ft u ft ft u u g V n n V ft u ft u ft u n \i 7 1 Q 07 X D ft u ft u o o 1 fl C D / X ft u n u Q 7 n n u ft u ft u ft u ft u 10 1 Q I u ft ft u 1 1 o / n 1 n "J ft u ft w 3 P1 0 1 •3 O X J ft u ft u o J OH ft u ft u ft u Id n U ft U ft u ft u ft u 1 n \j u ft U ft u ft 1 A c o 7 DO 1 Q X? ft u 1 7 1 n 0 OX o ft n u 1ft n u •3 ft U 07 ft A u 1Q oo C o "30 07 1 Q ft ft u ?0 •tO a 0 £0 ft ft ?1 £. 1 ft u ft u X u ft u ft u fid OH o o 7 ft u ft u 23 26 gd OH ft u X u ft ft u ?4 ct n u n ft u ft u ft u ft u 25 Ig X o X 7 ft u ft u 26 -J OX X u ft u ft u 27 10 1 0 7d / H u ft u ft 28 7 •J ft u ft u ft u 29 1 7 X o H3 ft u ft u 30 0 0 ft u ft u ft u ft u 31 39 19 19 23 0 0 32 0 0 0 0 0 0 33 0 0 0 0 0 0 34 0 0 0 0 0 0 35 0 0 0 0 0 0 36 0 0 0 0 0 0 37 32 13 39 16 0 0 38 29 7 19 45 0 0 Figure 3-l--continued.

PAGE 60

10 KEY OFF: CLS 20 DS = 5020 'Dimensions length of sequence array 'Weight array length 'Weight array width 'Dimensions the score output array 'Dimensions the sequence array 'Dimensions the weight array 30 DWR = 50 40 DWC = 6 50 DIM SCORE(DS) 60 DIM SEQ$(DS) 70 DIM WGT(50, 6) 80 Z = 0 100 INPUT "ENTER WEIGHT TABLE FILE NAME: ", QFM$ 110 OPEN QFM$ FOR INPUT AS #2 120 IF E0F(2) THEN GOTO 300 130 LINE INPUT #2, TITLES 140 IF E0F(2) GOTO 300 150 LINE INPUT #2, LETRS$ 160 IF E0F(2) GOTO 300 170 LINE INPUT #2, DASH$ 180 IF E0F(2) GOTO 300 190 PRINT TITLES 200 PRINT LETRSS 210 PRINT DASH$ 220 IF E0F(2) GOTO 300 230 Z = Z + 1 240 LINE INPUT #2, REC$ 250 PRINT REC$ 260 FOR X = 1 TO DWC 270 WGT(Z, X) = VAL(MID$(REC$, (X * 6) + 1, 4)) 280 NEXT X 290 GOTO 220 300 Y = 0 310 PRINT "" 320 INPUT "ENTER SEQUENCE FILE NAME : ", FLN$ 330 INPUT "ENTER SCORE OUTPUT FILE NAME : ", OFN$ 340 INPUT "WHAT IS THE MINIMUM SCORE YOU WANT SAVED? : ", MN 350 PRINT 360 OPEN FLN$ FOR INPUT AS #1 370 IF EOF(l) GOTO 450 380 LINE INPUT #1, REC$ 390 E = LEN(REC$) 400 FOR X = 1 TO E 410 Y = Y + 1 420 SEQ$(Y) = MID$(REC$, X, 1) 430 NEXT X 440 GOTO 370 450 A = Y + 1 Z Figure 3-2. WEIGHTS. The program WEIGHTS was written in Quick Basic (Tm Microsoft) and was designed to score windows of DNA sequence relative to a user-defined weight matrix. Input files should consist only of the DNA sequence in a text file and the weight matrix file should be formatted exactly as the examples in Figure 3-1

PAGE 61

55 460 B = Z 470 FOR NUC 480 FOR ROW 490 C = NUC 500 D = ROW 1 TO A 0 TO B ROW 1 510 IF INSTRC'Gg", 520 IF INSTRC'Aa", 530 IF INSTRC'Tt", 540 IF INSTRC'Cc", 550 IF INSTRC'AaGg* 560 IF INSTRC'CcTt' 570 NEXT ROW 580 NEXT NUC SEQ$(C)) SEQ${C)) SEq$(C)) SEQ${C)) , SEq$(C)) , SEQ$(C)) 0 THEN SCORE(NUC) = 0 THEN SCORE(NUC) = 0 THEN SCORE(NUC) = 0 THEN SCORE(NUC) = > 0 THEN SCORE(NUC) > 0 THEN SCORE(NUC) SCORE{NUC)+WGT(D, 1) SCORE(NUC)+WGT(D, 2) SCORE(NUC)+WGT(D, 3) SCORE(NUC)+WGT(D, 4) = SCORE(NUC)+WGT(D, 5) = SCORE(NUC)+WGT(D, 6) "; OFN$ FLN$ "; QFM$ ; MN 590 OPEN OFN$ FOR APPEND AS #3 600 PRINT "Sequence output file: 610 PRINT "Sequence filename: "; 620 PRINT "" 630 PRINT "Weighting table used: 640 PRINT "Minimum score saved ' 650 PRINT "Number of nucleotides examined 660 PRINT "" 670 PRINT "POSITION SCORE" 680 PRINT " " 690 PRINT #3, "Sequence output file "Sequence filename: " "; OFN$ FLN$ 700 PRINT #3, 710 PRINT #3, 720 PRINT #3, "Weighting table used: "; QFM$ "Minimum score saved "; MN "Number of nucleotides examined; II II 730 PRINT #3, 740 PRINT #3, 750 PRINT #3, 760 PRINT #3, 770 PRINT #3, 780 FOR Q = 1 790 TOT = TOT 'POSITION SCORE' TO A + SCORE(Q) 800 IF SCORE(Q) >= MN THEN PRINT Q, SCORE(Q) 810 NEXT q 820 AVG = TOT / A 830 FOR Q = 1 TO A 840 SUM = SUM + {{SCORE(q) AVG) ^ 2) 850 NEXT Q 860 STDEV = SqR(SUM / (A 1)) 870 PRINT #3, " " 880 PRINT #3, "Average score value "; AVG 890 PRINT "Average score value "; AVG 900 PRINT #3, "Score standard deviation "; STDEV 910 PRINT "Score standard deviation "; STDEV 920 PRINT #3, "End of scan." PRINT #3, q, SCORE(q) Figure 3-2--continued.

PAGE 62

930 PRINT "End of scan. 940 PRINT #3, "" 950 PRINT #3, 960 CLOSE 970 SYSTEM Figure 3-2--continued.

PAGE 63

57 CO CO m CD— ^ 03 DC — CL CD — CD g— z Q. X m 0_ X z DC co03 O 03 D n E 03 — CD — CD X a. DC X CO O Q. CO A O •4—1 be O -a 0} o CO . t— I +J I— I n) c a: -1O) I/) O E flS _I 1—1 •I— O "O 1^ c a.^ o) OQ •1Je 4-> O) nj nj -1E QQ O) s^ O >— ^ fO +-> I— fcO > QQ +J <: JI ^ sI— <0 ro QQ ^ 0) -Q "o z: 00 i4_ XI — c: 0 cu E •• •-01 I— r— X •— 1 <0 c o o O 0)1 — 00 !-> O i>? (O 2 <41 O) O O 14^ J= O SO 01 X +J 1— J(O (O V) +J Q) E T3 I— 1 00 ^ >> 0) 0) I — ^ (O -l-> o nj -C •>c -»-> -1s-c xj • s ^ > I <0 O Ol Q) X •<-> O ^ •>io 00 ijd jz ^ 1-1 Q) "O (O O Q) SC "-^ T3 c ns (O o) r— CO •«-> ro I (O O O) 400 ^ E O) 00 )-> nj oj 1 — O) •> OSE •— 1 00 E ^ N ^ -o -o • C ITJ (T3 • ro 0) +-> n) O) o o >> IM o c Q. O. o o +J O • O U fO •1O) -l-> o 5SC 1^ CO •>c 100 -r00 Q. 00 T3 +-> >~a> X '4^ +j QC XJ a> o I o CO _c c: •> 00 — I 4-> 4-> OJ 1 — I »— I — I CO 0) a> •-> I— 1 !-> 4J 4-» i*m +j O) X <0 O) "O ^ 00 SO) O 1— C +-> OQ
PAGE 64

58 X CEX 03X 7 / X n o Q. n X CO m m ml n O 03 "O n E CO XCQcQ — D. lO o X n X X o CL m — mcoO) u • -o c Qt: « 3 -O O) —I •-> ^ <0 O TJ •.ca.^ -D SC (U (O •-^ E +-> O) O) &^ s«-»-)« « (/) 0) SO) c o X 0) +-> o ^ u l/> > (— <0 (0 < ^ TJ I— J3 O) E 4^ . -r— ^ o -a A o cr o 0) V Q. o 00 •-> 1 •r— S o +-> 4-> o Mo » S+J 0) J3 1 X ^ I/) o o a>cQ CQ ^ ^ ••O » 1— 1 C 0) sc c to fo S >— 1 o m V) •-> Qq c o E 0) <« <« »0 r— CO T3 i^ (4(U ' B ea cni— i-i 1 c •.r-. ^ c n) (0 Qq I 1 ^ S(W CO X o c 0) 0) • • >— 1 Q. Q. O O c 2 o l*QJ O -C O 0) O X Qo !-> O +-> 1 u O ro t/1 0) »-> -rsSC > +-> •1O) 0) •— < 0) X XI Qc: -o 0) ^ o C ro U x: (U 1 ••->•<-> sq: CO O) X «J SO) u lA I— I E »-> >> <0 N Q. C I LU Q.

PAGE 65

59 COWCO (d CO 00 a CD s s s n X z CO CO CO CO a n E 03 m ^71 / z CD — X o >, +-> ^ HO U <0 I— 1 a> TD n. > Q) 1 r-. -•-> a. u to to CQ X3 U ^ -I-! E -O •-' « C r— -I«0 i-~ < z Q o QL Q. O evj o •IO) i^ o T5 SC O. •!-> Z *4Q 0) U O) u ^ o I— ^ ro Q) 00 -c (U i~ C (U o ^ •— •-> <_> > 00 Q. o ^ 1-1 -. e I— I (Q I— I QQ o C •-' a: I o ^ o I— I (1) •— " sto CTl+J CQ SI O) GO (/) (/) IT) S CO O CO I— Q. O 0) (O -t-> +-> -1(XJ "O > -M O) o sc -Q O <« T3 CO CO CO^ Q. to o jz ito (-> (0 ^ (/> +j Q. CO (/> (O C O) CO S O E 0) ••>> E C Ol M >> O O) C N o: Lu c sa: a. • M to >—> CO -o E (DC I lO -O SX I O) (U ro ^ "O SC >-H O) (« 3 SE K-r 3 CO
PAGE 66

CO (0 CO 00 Q. ffi X J CO CM o>«o ^ If COO to CI ce. — o o 1—1 I O r-. 1—1 a. I o T3 QJ ^ O I— I Q. D J-i^ 0) % a: «t Z I— I X ID I o 3 B. I s C 0) 4-> S(/) rtJ a: (/) , N 00 c r— •fO) TJ C •(O sa. C -rO) w sz +-> CO =» I— I o • to <0 CO 00 • VO CO O 43 irX cn c •Im c LiQ. (O

PAGE 67

61 Figure 3-7. In Situ Hybridizations. Biotinylated probes were hybridized to the salivary-gland polytene chromosomes of A. albimanus. Panels and probes used: A and B, p70a.l6 which cross-hybridizes to p70a and p70b and in the chromosomes to both IIC and 13C; C and D, p70a.dl which is p70a-specific hybridizes only to one locus 13C; E, p70b.5 is p70b-specific and hybridizes only to IIC; F and G, probed with p83a which hybridizes only to 40A.

PAGE 68

62 o a + < Q. •2 (0 (0 (U (I) n3 ^ > O •-» >1^ <« cs. O ^ (-> O) QJ (/I 3 +J 3 n, O in c in is x: 4"= "O ^ •>— Q 00 I «^ •S.tJ r— O) r1 01 (O jj -IQ) 0) -3 -O i~ ^ o CO . , X cu o C T3 O to (V i00 XI -i^ Q. (O U Q. o CO 00 . as O o o O 00 s00 0) +-> o o o 00 <0 M (-> o C O) > ro 00 S•-m c i— X < o (U a: o -c ^ s(— "o Ma> SO) o ^ <: CO • o z <0 I. QC .— ^CO Q. Ol Z 00 I TJ C Q> <0 O +J Q. "D -r^ ns Q) O Q.f— T3 , >, c o •-<+c 3 CO) >).C cn+J c I— cn Fo »
PAGE 69

X t z cn xco X 1 < X • ml X !>• X Crt I 1 III no CVJ CM b «0) S. O iO O >, « (/) <4^ • +-> a> -»-> > u 0) a> •Io o) o) c 4J CO O +J -r•!Ol o. (u Cn O <400 -C O C o) O (U E C n3 (/I O "O (X> O l*c • (U C Q 2 O u c 00 O S00 XJ O Q) 0) "O 00 Q, ^ (44_> c O) (U ^ 0> 1 — O 00 C (1 "O *»— I — t9 O O f— 0) H s. TJ 00 •-> O) -T-r^ (O C +-> «_,-0 O -Q E 0) o c Ji00 00 O Q. I •!O sa, o ^ 4J +j O) X c o 00 3 J.: E o O) C "O O 00 Q£ O (/) c a> c x: (O o i00 O) +J 3 • o C -> I— I -o o c o ^ i00 o o so (D 3 3 CT-i^J CTi— I Q) U E C •.1o («-*-> O r— r— ^ — I « •!— nj m 0> 00 M to C O "O Q.^ 1 •!0) O) a» -e(-> 00 NJ ^ S-.I— _ 00 •— I •!a. ^ c -o Qc s. I 00 (T) O) ^ CD <: sJO o >, c Z o o ^ 0(0 i_ Lij I c: <-> > Ci Q. I — I Q> 3 1 E 2 >— I ^ 00 CO O »41— 1 +J so 00 s_ sr— tt) c: c ^ 3 O) 0) -•->-•>•!-> CJiTJ > I— a; 4s•rrO 0) -rI a» 3 •JE «— t*3: "O 4-

PAGE 70

64 350 300 250 * Replicate 1 B Replicate 2 o Replicate 3 ^ Average Temperature C Figure 3-10. RNA Profiles. Relative induction of p70a. 16-hybridizing transcripts upon heat shock for 30 minutes at various temperatures (upper graph) or over time (lower graph). Methods for obtaining the values are discussed in Materials and Methods.

PAGE 71

65 Table 3-1. Features of p70a and p70b Clones p70a p70b Left Gene Right Gene Left Gene Right Gene ORF^ 2068-146 3037-4959 1506-1 2706-4628 TATA Box 2321-2315 2773-2779 1719-1712 2493-2500 Transc. Start 2290 2805 1687,1690 2522,2525 Transl . Start 2068 3037 1506 2706 PolyA Signal*" 19-14 ?" ? 4636 "Distances listed indicate the position on the sequence in Figures 3-12 and 3-13 and are listed numerically according to the putative direction of transcription. ''Polyadenylation sites should be considered tentative. •"Question marks indicate no clear polyadenylation sites were observed.

PAGE 72

66 TATTTGGTTAACATTTATTAACATTCGCTGATAATATATCATACTGATGGCAACATTATG 1 + + + ^ ^ ^ gQ Eco RI AGCCCATAATTTATCATGAAIICATCTAGTCTTAGAGTCTTTGTTAATCTTCTCTCCTAG 61 + + + + ^ ^ J20 TTTAAAGTTGGCTGAACATTGATATTTAGTCCACCTCTTCCACCGTCGGTCCCGTCCTTC 121 + + + ^ ^ ^ jQO EndAspVal Gl uGl uVal ThrProGlyThrArgGly CGCCGAATCCTCCAGCTTGCTGTCCACAGCTGGTTGGTTGCGGACCACCAGCCGCTTGCT ^ . 181 + + + + + ^ 240 GlyPheGlyGlyAlaGlnGlnGlyCysSerThrProGlnProGlyGlyAlaAlaGlnGln Pst I , ' . GATGCAGTTTGGTCATGATGGGACIGCAGACCCGCGACAACTCTTGCATTTGGTGCTCGT 241 + + + + ^ 300 Hi sLeuLysThrMet II eProSerCysVal ArgSerLeuGl uGl nMetGl nHi sGl uTyr ACTCTTCCTTTTCCGCCATTGTGTTGCCATCGATCCATCGCAGAGTCTCGTCGCATCGAT 301 + + ^ ^ _^_ ^ Gl uGl uLysGl uAl aMetThrAsnGlyAspIl eTrpArgLeuThrGl uAspCysArgAsp CCTGCACCGTTCTGCGATCGGCTTCGCTGAGTTTGCTCGATCCTTCTCCGTCCAGGGATT 361 + + ^ ^ _^ ^ GlnValThrArgArgAspAlaGluSerLeuLysSerSerGlyGluGlyAspLeuSerGln Xho I GTTTCAGGTTGAAGCAGTATGCCICGAGCTGATTGCGTGCGGCAATGGCCTCTCGCTGCT 421 + + ^ ^ ^ ^ LysLeuAsnPheCysTyrAl aGl uLeuGl nAsnArgAl aAl all eAl aGl uArgGl nLys TCTCATCCTCCTCGCGGTACTTTTCGGCCTCCGATACCATTCGATCGATGTCGGCCTGCG 481 + + + ^ ^ ^ Gl uAspGl uGl uArgTyrLysGl uAl aGl uSerValMetArgAspIl eAspAl aGl nSer ATAGGCGACCTTTATCGTTCTTGATCGTGATATTCTTCTCTTTTCCGCTGCTCTTATCCT 541 + + + ^ ^ ^ LeuArgGlyLysAspAsnLysIleThrlleAsnLysGluLysGlySerSerLysAspLys Figure 3-12 DNA Sequence of p70a Right and Left Genes and Spacer af^rn\ho^lS''^'°" sites mapped and shown in Figure 3-3 are underlined as are the TATA boxes and transcription start sites. The sequence begins with the transcribed strand of the left gene. Heat-shock element-like sequences are shaded and are underlined where they overlap.

PAGE 73

67 TGGCTGCGACGTTCAGGATTCCGTTTGCGTCCAGATCGAAAGTCACCTCGATCTGCGGTA 601 + + + + + + 660 Al aAl aVal AsnLeull eGlyAsnAl aAspLeuAspPheThrVal Gl ull eGl nProVal CACCACGTGGGGCCGGCGGGATGCCCGAGAGGTCGAACTGTCCCAAAAGATTGTTGTCCT 661 -+ + + + +--.+ 720 GlyArgProAl aProProIl eGlySerLeuAspPheGl nGlyLeuLeuAsnAsnAspLys TGGTCATGGCTCGCTCTCCTTCGAATACCTGGATCGAGACTCCGGGCTGGTTGTCGGCGT 721 + + + + ^ ^ 780 ThrMetAl aArgGl uGlyGl uPheVal 61 nil eSerVal GlyProGl nAsnAspAl aTyr Bgl II ACGTCGAGAAGAICITCGTCTGTTTGCAAGGAATGCGCGAGTTGCGTTCAATCAGCTTCG 781 + + + ^ ^ ^ g^Q ThrSerPhelleLysThrGlnLysCysProIleArgSerAsnArgGluIleLeuLysThr TCATCACACCTCCGGCCGTCTCGATGCCAAGCGACAATGGAGCGACATCCACCAGCAGCA 841 + + + + ^ ^ goo MetVal GlyGlyAl aThrGl ull eGlyLeuSerLeuProAl aVal AspVal LeuLeuVal CGTCCTGAATCTTGTCATCCTTGTCGCCGCTAAGGATGGCCGCTTGCACCGCAGCACCGT 901 + + + ^ ^ ^ ggO AspGl nil eLysAspAspLysAspGlySerLeuIl eAl aAl aGl nVal Al aAl aGlyTyr ATGCTACCGCTTCGTCCGGGTTGATCGAAAGGTTCAACGACTTTCCAGCGAAGAAGTTCT 961 + + + ^ ^ ^ J020 Al aVal Al aGl uAspProAsnll eSerLeuAsnLeuSerLysGlyAl aPhePheAsnGl n GCAACAGGGACTGCACCTTCGGTATGCGAGTTGAGCCTCCTACCAGGACGATATCGTGAA 1021 ---------+ + + ^ ^ ^ JQgQ LeuLeuSerGl nVal LysProIl eArgThrSerGlyGly Val LeuValll eAspHi sll e TGGAGCTCTTATCCATCTTCGCATCGGACAGAGCCTTCTCCACCGGCTGCAACGTCGAAC 1081 + + + ^ ^ ^ jj^Q SerSerLysAspMetLysAl aAspSerLeuAl aLysGl uVal ProGl nLeuThrSerArg GGAACAGGTCCGAGCATAGCTCCTCGAATCGTGCCCGGCTGATCTTCGTGTAATA ATCGA 1141 + + + ^ ^ 3— -jJ200 PheLeuAspSerCysLeuGl uGl uPheArgAl aArgSerll eLysThrTyrTyrAspIl e Figure 3-12--continued.

PAGE 74

68 Xho I TGCCATCCATCAGGGCGTCAATCTCGATCGTTGCTTCCGTG CTCGAG GACAACGTGCGCT 1201 + + + + + + 1260 GlyAspMetLeuAl aAspI 1 eGl ull eThrAl aGl uThrSerSerSerLeuThrArgLys TTGCCCGTTCACATGCCGTTCTCAAACGCCGCAGGGCTCGGGCATTCTTCGACAGATCCT 1261 +---+-+ + + + 1320 Al aArgGl uCysAl aThrArgLeuArgArgLeuAl aArgAl aAsnLysSerLeuAspLys Eco RI TCTTGAATTTCCGTTT GAATTC CTCCACGAAGTGAGCCACCATCCGGTTGTCAAAGTCTT 1321 + + + + + + 1380 LysPheLysArgLysPheGl uGl uVal PheHi sAl aVal MetArgAsnAspPheAspGl u CGCCTCCTAGATGAGTGTCTCCAGCAGTAGCACGCACTTCGAACAGCGATCCCTCGTCGA 1381 + + +. ...+ + + 1440 GlyGlyLeuHi sThrAspGlyAl aThrAl aArgVal Gl uPheLeuSerGlyGl uAspIl e TCGTCAGGATGGAAACGTCGAAGGTTCCGCCACCCAGATCGAAGATCAGCACGTTCCGTT 1441 --+ + --+ + + + 1500 ThrLeuIleSerValAspPheThrGlyGlyGlyLeuAspPhelleLeuValAsnArgGlu CTCCCTTCAGGTTCTTATCCAAGCCGTACGCCAGAGCTGCCGCCGTCGGTTCGTTGATGA 1501 + + + + + + 1550 GlyLysLeuAsnLysAspLeuGlyTyrAlaLeuAlaAlaAlaThrProGluAsnllelle TGCGCATCACATTCAAGCCAGCGATGGCTCCAGCATCCTTTGTGGCCTGTCGCTGACTGT 1561 + + + +. ^ 1520 ArgMetVal AsnLeuGlyAl all eAl aGlyAl aAspLysThrAl aGl nArgGl nSerAsp CGTTGAAGTAGGCTGGTACTGTGATGACTGCATTTTTCACTGACTGTCCCAAGTAGGCTT 1621 + + + + + + 1680 AsnPheTyrAl aProVal Thrll eVal Al aAsnLysVal SerGl nGlyLeuTyrAl aGl u CGGCGGTTTCCTTCATCTTCGTCAGGACCATTGAACTGATTTCCTCGGGGGCAAAGGTTT 1681 + + + + + ^ 1740 Al aThrGl uLysMetLysThrLeuVal MetSerSerll eGl uGl uProAl aPheThrLys TGCGCTCGCCCTTGAACTCGACACGGATCTTGGGTTTGCCGCAATCGTTCACCACCGTGA 17^1 --+ +--+ + +--+ 1800 ArgGluGlyLysPheGluValArglleLysProLysGlyCysAspAsnValValThrPhe Figure 3-12--continued.

PAGE 75

69 ATGGCCAGTGCTTCATATCGGCCTGGATCTTCGGATCATCGAATTTGCGTCCAATCAACC 1801 + + + + + + 1860 ProTrpHisLysMetAspAl aGlnlleLysProAspAspPheLysArgGlylleLeuArg GCTTGGCATCGAATACCGTGTTGGTCGGATTCATGGCCACCTGGTTCTTGGCTGCATCTC 1861 + + --+ + -+ + 1920 LysAl aAspPheVal ThrAsnThrProAsnMetAl aVal G1 nAsnLysAl aAl aAspGly CGATGAGCCGCTCCGTGTCCGAAAAGGCAACGTAGCTCGGTGTTGTTCGGTTGCCCTGGT 1921 + + + + +... + 1980 I 1 eLeuArgGl uThrAspSerPheAl aVal TyrSerProThrThrArgAsnGl yGl nAsp CGTTTGCGATGATCTCCACCTTTCCATGCTGGAACACACCCACGCACGAGTACGTGGTGC 1981 -+ + + + +--+ 2040 AsnAl all ell eGl uVal LysGlyHi sGl nPheVal GlyVal CysSerTyrThrThrGly Start Codon CCAGGTCAATTCCAATTGCAGACGGCAITCTGTGTTTGTTGCTCTCGATGTTTTCTCTCA 2041 + + + + +-+ 2100 LeuAspIl eGlyll eAl aSerProMet GAAATCTCGATAATACTTCACTTGTTGCACTTGAAACTGTGTGTTGTAACTGATTCACTT 2101 + + + +. + + 2160 TCTAATGCACTGATTACTTGACTTTTATCTCTCTTGGTGATAAG6GATTCTATCTTTCGT 2161 + + + + -+ + 2220 ATCTTCACGTGTTAGCTTCGCGCCGTTCTTGGCTCTCTTGCTTGCTTGTTCGCTTGTTTG 2221 --+ + + + + + 2280 Transcription Start TATA Box TGTTCAACTGACAGTGGCTGCTCGAACTGCTCGGTIIIAWGAAACCACTTGCATTlii 2281 + + --+ + + ..r:+ 2340 Pal indrome < GAAAGTACGMACAGTTMmWGCIlGAMTGATCGAGATTCTGCTCGA 2341 + + + + ^ 2400 > AGAATGTCCCTAGCAGCTGCGCCTTTGCTGTCTTGCGTGCGGT86AAATTTCTGSTTTCA 2401 + +---+ +— — -+.--......+ 2460 Figure 3-12--continued.

PAGE 76

70 Palindrome< Bgl II-CAAGAAAGTTTCGTAGAGATGAMGACCACTGGAATCATGTGSGATTCTTGT A6ATCT AG 2461 + + --+ + + --+ 2520 > ACAATCTGTCATCATAAATATGGTTGGCCATACGTTGTTAATGTAACGCTCTCTGGAAAC 2521 + --+ +-+ + + 2580 TAACTSCCTTGCAACAGCCGTTCGCATCACCACAGAACTTTTCCCGAAACCAATCATCAC 2581 +---+ -+ + + + 2640 X ACGCAAGACAGTTGGGCCGCllCGGACGTtCTACGGGTATCGAGCAGAATTTAGAGCTCT 2641 + ++ + -+ + 2700 J < ^ < -> Palindrome 2701 — + +.-.:.....+... . + .+ 2760 . / TATA Box Transcription Start GCAAGTGGTTTCAIAIMMGCGAGCAGTTCGAGCAGCCACCGTCAGTTGAACACAAACA 2761 ++ + + + + 2820 AGCGAACAAGCAAGCAAGAGAGCCAAGAACGGCGCGAAACTAACACGTGAAGATACGAAA 2821 + + + + + + 2880 GATAGAATCCCTTATCACCAAGAGAGATAAAAGTTAAGTAATCAGTGTATCAGAAAGTGA 2881 + + + + ...+... .+ 2940 ATCAGTTACAACACACAGTTTCAAGTGCGACAAGTGAAGTATTATCGAGATTTCTGAGAG 2941 + + ++ + + 3000 Start Codon AAAATATCGAGACCAAGTTAGAGCAACAAACACAGAAIGCCGTCTGCAATCGGAATTGAC 3001 + +-+ + + + 3060 MetProSerAlalleGlylleAsp CTGGGAACCACGTACTCGTGCGTGGGTGTGTTCCAGCATGGAAAGGTGGAGATCATCGCA 3061 +--+ + + ^ ^ 3J20 LeuGlyThrThrTyrSerCysVal GlyVal PheGl nHi sGlyLysVal Gl ull ell eAl a AACGACCAGGGCAACCGAACAACGCCGAGCTACGTTGCCTTTTCGGACACGGAGCGCCTC 3121 + + + ^ ^ ^ 3jgQ AsnAspGl pGlyAsnArgThrThrProSerTyrVal Al aPheSerAspThrGl uArgLeu Figure 3-12--continued.

PAGE 77

71 ATCGGAGATGCAGCCAAGAACCAGGTGGCCATGAATCCGACCAACACGGTGTTTGATGCC 3181 + + ++-+ + 3240 II eGlyAspAl aAl aLysAsnGl nVal Al aMetAsnProThrAsnThrVal PheAspAl a AAGCGGCTGATTGGACGAAAATTCGATGATCCGAAGATCCAGGCCGATATGAAGCACTGG 3241 + + + + +-+ 3300 LysArgLeuIl eGlyArgLysPheAspAspProLys II eGl nAl aAspMetLysHi sTrp CCATTCACGGTGGTGAACGATTGCGGCAAACCCAAGATCCGCGTCGAGTTCAAGGGCGAG 3301 + + + + + + 3360 ProPheThrValValAsnAspCysGlyLysProLysIleArgValGluPheLysGlyGlu CGCAAAACCTTTGCCCCCGAGGAAATCAGTTCAATGGTCCTGACGAAGATGAAGGAAACC 3361 +---+ + + + + 3420 ArgLysThrPheAl aProGl uGl u II eSerSerMetVal LeuThrLysMetLysGl uThr GCCGAAGCCTACTTGGGACAGTCAGTGAAAAATGCAGTCATCACAGTACCAGCCTACTTC 3421 + + + + +-+ 3480 Al aGl uAl aTyrLeuGlyGl nSerVal LysAsnAl aVal II eThrVal ProAl aTyrPhe AACGACAGTCAGCGACAGGCCACAAAGGATGCTGGAGCCATCGCTGGCTTGAATGTGATG 3481 + +.. ..+ + + + 3540 AsnAspSerGl nArgGl nAl aThrLysAspAl aGlyAl all eAl aGlyLeuAsnValMet CGCATCATCAACGAACCGACGGCGGCAGCTCTGGCGTACGGCTTGGATAAGAACCTGAAG 3541 + + +-+ + + 3600 Argil ell eAsnGl uProThrAl aAl aAl aLeuAl aTyrGlyLeuAspLysAsnLeuLys GGAGAACGGAACGTGCTGATCTTCGATCTGGGTGGCGGAACCTTCGACGTTTCCATCCTG 3601 + + + + + + 3660 GlyGluArgAsnValLeuIlePheAspLeuGlyGlyGlyThrPheAspValSerlleLeu ACGATCGACGAGGGATCGCTGTTCGAAGTGCGTGCTACTGCTGGAGACACTCATCTAGGA 3661 + + + + + + 3720 Thrll eAspGl uGlySerLeuPheGl uVal ArgAl aThrAl aGlyAspThrHi sLeuGly EcoRl GGCGAAGACTTTGACAACCGGATGGTGGCTCACTTCGTGGAG GAATTC AAACGGAAATTC 3721 + + + + ^. ^ 37QQ GlyGl uAspPheAspAsnArgMetVal Al aHi sPheVal Gl uGl uPheLysArgLysPhe Figure 3-12--continued.

PAGE 78

72 AAGAAGGATCTGTCGAAGAATGCCCGAGCCCTGCGGCGTTTGAGAACGGCATGTGAACGG 3781 + ---+ --+ --+ + + 3840 LysLysAspLeuSerLysAsnAl aArgAl aLeuArgArgLeuArgThrAl aCysGl uArg Xho I GCAAAGCGCACGTTGTC CTCGAG CACGGAAGCAACGATCGAGATTGACGCCCTGATGGAT 3841 -+ + + + + + 3900 Al aLysArgThrLeuSerSerSerThrGl uAl aThrll eGl ull eAspAl aLeuMetAsp C/a I GGC ATCGAT TATTACACGAAGATCAGCCGGGCACGATTCGAGGAGCTATGCTCGGACCTG 3901 + +--+ + + + 3960 GlylleAspTyrTyrThrLysIleSerArgAl aArgPheGluGluLeuCysSerAspLeu TTCCGTTCGACGTTGCAGCCGGTGGAGAAGGCTCTGTCCGATGCGAAGATGGATAAGAGC 3961 + + + +--+ + 4020 PheArgSerThrLeuGl nProVal Gl uLysAl aLeuSerAspAl aLysMetAspLysSer TCCATTCAC6ATATCGTCCTGGTAGGAGGCTCAACTCGCATACCGAAGGTGCAGTCCCTG 4021 + + + + ++ 4080 Serll eHi sAspIl eVal LeuVal GlyGlySerThrArgll eProLysVal Gl nSerLeu TTGCAGAACTTCTTCGCTGGAAAGTCGTTGAACCTTTCGATCAACCCGGACGAAGCGGTA 4081 + + +---+---+.+ 4140 LeuGl nAsnPhePheAl aGlyLysSerLeuAsnLeuSerll eAsnProAspGl uAl aVal GCATACGGTGCTGCGGTGCAAGCGGCCATCCTTAGCGGCGACAAGGATGACAAGATTCAG 4141 + + + + ---+ + 4200 Al aTyrGlyAl aAl aVal Gl nAl aAl all eLeuSerGlyAspLysAspAspLys II eGl n GACGTGCTGCTGGTGGATGTCGCTCCATTGTCGCTTGGAATCGAGACGGCCGGAGGTGTG 4201 + + + + + + 4260 AspVal LeuLeuVal AspVal Al aProLeuSerLeuGlyll eGl uThrAl aGlyGlyVal Bgl II ATGACAAAGCTGATTGAACGCAACTCGCGCATTCCTTGCAAACAGACGA AGATCT TCTC6 4261 + +-+ + +. + 4320 MetThrLysLeulleGluArgAsnSerArglleProCysLysGlnThrLysIlePheSer ACATACGCCGACAACCAGCCCGGAGTCTCGATCCAGGTGTTCGAAGGAGAGCGAGCCATG +--+ + + + + 4380 ThrTyrAl aAspAsnGl nProGlyVal Serll eGl nVal PheGl uGlyGl uArgAl aMet Figure 3-12--continued,

PAGE 79

73 ACCAAGGACAACAATCTTTTGGGACAGTTCGACCTCTCGGGCATTCCGCCGGCCCCACGT 4381 + + + + ++ 4440 ThrLysAspAsnAsnLeuLeuGlyGlnPheAspLeuSerGlylleProProAlaProArg GGTGTACCGCAGATCGAGGTAACTTTCGATCTGGACGCAAACGGAATCCTGAACGTGGCA 4441 +---+ + --+ + + 4500 GlyVal ProGl nil eGl uVal ThrPheAspLeuAspAl aAsnGlyll eLeuAsnVal Al a GCCAAGGATAAGAGCAGCGGAAAGGAGAAGAACATCACGATCAAAAACGATAAAGGTCGC 4501 + + + +. + 4550 AlaLysAspLysSerSerGlyLysGluLysAsnlleThrlleLysAsnAspLysGlyArg CTATCGCA6GCCGACATCGATCGAATGGTATCG6AGGCCGAAAAGTACCGCGAGGAGGAT 4561 + + ...+ + + 4520 LeuSerGl nAl aAspIl eAspArgMetVal SerGl uAl aGl uLysTyrArgGl uGl uAsp Xho I GAGAAGCAGCGAGAGGCCATTGCCGCACGCAATCAGCICGAGGCATACTGCTTCAACCTG 4621 + + + + + ^ 4580 Gl uLysGl nArgGl uAl all eAl aAl aArgAsnGl nLeuGl uAl aTyrCysPheAsnLeu AAACAATCCCTGGACGGAGAAGGATCGAGCAAACTCAGCGATGCCGATCGCAGAACGGTT 4681 + + + + ^ ^ 4740 LysGlnSerLeuAspGlyGluGlySerSerLysLeuSerAspAl aAspArgArgThrVal CAAGATCGATGCGACGAGACTCTGCGGTGGATCGATGGCAACACTATGGCGGAGAAGGAA 4741 ---+ + ++ + + 4800 GlnAspArgCysAspGluThrLeuArgTrpIleAspGlyAsnThrMetAlaGluLysGlu Pst I GAGTACGAGCACCAAATGCAAGAGTTGTCNCGGGTCI6CAGTCCCATCATGACCAAACTG 4801 + + + + + ^ 4850 Gl uTyrGl uHi sGl nMetGl nGl uLeuSerArgVal CysSerProIl eMetThrLysLeu CATCAGCAAGCGGCTGGTGGTCCGCAACCAACCAGCTGTGGACAGCAAGCTGGAGGATTC 4861 + +-+ + 4920 Hi sGl nGl nAl aAl aGlyGlyProGl nProThrSerCysGlyGl nGl nAl aGlyGlyPhe GGC6GAAGGACGGGACCGACGGTGGAAGAGGTGGATTAAAGATAACAATTGAAG ATGCAT 4^21 + + + + + ^ 4980 GlyGlyArgThrGlyProThrVal Gl uGl uVal AspEnd Figure 3-12--continued.

PAGE 80

74 TTCCATGGCTTAACCAGAAACAACTGTCGATAGTGAA 4981 + + .-+ 5017 Figure 3-12--continued.

PAGE 81

75 Sau 3A Cloning Site GAICGTGATATTCTTCTCCTTTCCGGTGCTCTTCTCCTTAGCTGCCACGTTCAGGATTCC 1 + + ^ ^ ^ ^ gQ IleThrlleAsnLysGluLysGlyThrSerLysGluLysAl aAlaValAsnLeuIleGly Bst EI I GTTGGCATCCAGATCGAAGGTXACCTCGATCTGTGGCACACCACGTGGAGCCGGGGGAAT ^1 "-" + + + + + + 120 AsnAl aAspLeuAspPheThrVal Gl ull eGl nProVal GlyArgProAl aProProIl e GCCCGAGAGGTCAAACTGTCCCAGAAGATTGTTGTCCTTGGTCATGGCTCGTTCTCCCTC 121 + + + ^ ^ ^ G lySerLeuAspPheGl nGlyLeuLeuAsnAsnAspLysThrMetAl aArgGl uGlyGl u Bgl II 6AACACCTGGATCGAAACGCCGGGCTGGTTGTCGGCGTATGTCGAG AAGATCT GCGTCTG 181 + + ^ ^ ^ ^ 240 PheVal Gl nil eSerVal GlyProGl nAsnAspAl aTyrThrSerPhell eGl nThrGl n TTTGCACGGAATGCGCGAGTTGCGCTCAATCAGCTTCGTCATCACACCTCCGGCCGTCTC 241 + + + + ^_ LysCysProIleArgSerAsnArgGluIleLeuLysThrMetValGlyGlyAlaThrGlu AATTCCAAGCGACAATGGAGCGACATCCACTAGCAGTACGTCTTGAATCTTATCGTCCTT + ^. ^ _^ ^ II eGlyLeuSerLeuProAl aVal AspVal LeuLeuVal AspGl nil eLysAspAspLys GTCTCCGCTGAGGATGGCCGCCTGTACCGCTGCACCGTAAGCCACGGCCTCATCCGGATT 351 + + + ^ ^ ^ AspGlySerLeuIl eAl aAl aGl nVal Al aAl aGlyTyrAl aVal Al aGl uAspProAsn Pst I 421 ^^I^'^^^^J^^^'^^'^^^CTTTCCAGCGAAAAAGTTCIGCAGCAAGGACTGCACCTTCGG IleSerLeuAsnLeuSerLysGlyAlaPhePheAsnGlnLeuLeuSerGlnValLysPro GATGCGTGTGGAGCCTCCTACCAGGACGATATCGTGAATGGAGCTCTTATCCATCTTCGC 'toi 1.j 1 _j ^ IleArgThrSerGlyGlyValLeuVallleAspHisIleSerSerLysAspMetLysAla ^^.r^K ?* •^'^^ Sequence of p70b. The sequence of the p70b left qene from the cloning site and the entire right gene are shown Restriction sites shown on the map (Figure 3-4) are indicated as a?e TATA boJes transcription starts and predicted proteins. Heat shock-element ?ikP sequences are shaded and underlined where they overlap

PAGE 82

Pst I ATCGGACAGAGCCTTTTCCACTGG CTGCAG CGTCGAACGGAACAAGTCAGAACACAGCTC 541 + .+ + ^ ^ 500 AspSerLeuAl aLysGl uVal ProGl nLeuThrSerArgPheLeuAspSerCysLeuGl u Cla I CTCGAATCGTGCCCG6CTGATCTTCGTGTAATA ATCGAT GCCATCCATCAGGGCGTCAAT 601 + + + +-+ + 660 GluPheArgAl aArgSerlleLysThrTyrTyrAspIleGlyAspMetLeuAl aAspIle Xho I CTCGATCGTTGCCTCCGTGCICGAGGACAGTGTGCGCTTCGCCCTCTCGCATGCCGTTCT 661 + + + + + -+ 720 Gl ull eThrAl aGl uThrSerSerSerLeuThrArgLysAl aArgGl uCysAl aThrArg Eco RI CAAACGACGCAGAGCGCGAGCGTTCTTCGACAGATCCTTCTTGTGCTTTCGTTT GAATTC 721 + + + + + + 780 LeuArgArgLeuAl aArgAl aAsnLysSerLeuAspLysLysHi sLysArgLysPheGl u TTCCACGAAGTGGCCCACCATTCGGTTATCGAAGTCTTC6CCTCCCAAATGAGTATCTCC 781 + +.. .+ + + ^ 840 Gl uVal PheHi sGlyValMetArgAsnAspPheAspGl uGlyGlyLeuHi sThrAspGly GGCCGTGGATCGTACCTCAAACAGTGATCCCTCGTCGATCGTCAGAATGGACACGTCGAA 841 + + + + + + 900 Al aThrSerArgVal Gl uPheLeuSerGlyGl uAspIl eThrLeuIl eSerVal AspPhe GGTGCCGCCTCCCAGATCGAAGATCAGAACATTGCGTTCTCCCTTTAGGTTCTTATCCAA 901 + + + + + + 950 ThrGlyGlyGlyLeuAspPhelleLeuValAsnArgGluGlyLysLeuAsnLysAspLeu 6CCATACGCCAGAGCTGCTGCCGTCGGTTCGTTGATGATGCGCATCACATTCAGTCCAGC 951 + + ^ ^ ^ ^ JQ20 GlyTyrAl aLeuAl aAl aAl aThrProGl uAsnll elleArgMetVal AsnLeuGlyAl a GATGGCTCCAGCATCCTTTGTGGCCTGTCGCTGGCTGTCGTTGAAGTAGGCTGGTACTGT 1021 + + + + + ^ J080 11 eAl aGlyAl aAspLysThrAl aGl nArgGl nSerAspAsnPheTyrAl aProVal Thr GATGACTGCATTTTTTACTGACTGGCCCAGGTAGGCTTCGGCGGTTTCCTTCATCTTCGT + + ^ ^ ^ ^ 11 eVal Al aAsnLysVal SerGl nGlyLeuTyrAl aGl uAl aThrGl uLysMetLysThr Figure 3-13--continued.

PAGE 83

CAGCACCATCGAACTGATTTCCTCCGGGGCAAAGGTTTTGCGCTCGCCCTTGAACTCGAC 1141 + + +-+ +.. + 1200 LeuValMetSerSerll eGl uGl uProAl aPheThrLysArgGl uGlyLysPheGl uVal GCGGATCTTGGGCTTACCACCGTCATTTACCACCGTGAATGGCCAGTGCTTCATATCGGC 1201 + + + + + + 1260 Argil eLysProLysGlyGlyAspAsnVal ValThrPheProTrpHi sLysMetAspAl a TTGGATCTTCGGATCGTCGAATTTGCGTCCAATCAGTCGCTTGGCATCGAACACCGTGTT 1261 + + + + + ^ 1320 GlnlleLysProAspAspPheLysArgGlylleLeuArgLysAl aAspPheValThrAsn AGTCGGATTCATGGCCACTTGGTTCTTGGCTGCATCTCCGATGAGTCGCTCAGTGTCCGA 1321 + + + + ^ ^ 13gQ ThrProAsnMetAl aVal Gl nAsnLysAl aAl aAspGly II eLeuArgGl uThrAspSer GAACGCAACGTAGCTCGGTGTCGTTCGGTTGCCCTGGTCGTTTGCGATGATCTCCACCTT 1381 + + + + + ^ 144Q PheAl aValTyrSerProThrThrArgAsnGlyGl nAspAsnAl all ell eGl uVal Lys TCCATGCTGGAACACACCAACGCAGGAGTACGTGGTGCCCAGATCGATTCCGATTGCCGA + + ^ ^ ^ ^ GlyHi sGl nPheVal GlyVal CysSerTyrThrThrGlyLeuAspIl eGlyll eAl aSer Start Codon AGGCAITCTGTGTCTCTGTGGTTCAACTTCGATGAATATGCTTTCTCAAATCACTCAAAC d""-;'""' + + + 1560 ProMet TGGTGTGCACAATTATACGCTTTCTGATGCAACAATTGATTCACTCTGGTCACTGCTTGT 1561 + + + + ^ ^ jg20 ^^^"^^^CACTTTATTTTTCACGTGTTTGCACTTGTTACTCTCAGCTCGCTCAGATT — + + — -+ ++ + 1680 Transcription Starts TATA Box Xba I CAAATTGACGACAGCTGCTCGAACGGACCGGIIIAIAIACCACACCACTCGATT TCTACA 1681 + + ^ ^ ^....jrrrr; 1740 BIJeMCACinCCAgAGCTCTCCGCTAGGCTACTCGAACGCGATGAGGGAGA i/ni + ^ ^ ^ ^ ^ 1800 Figure 3-13-continued.

PAGE 84

78 ATGCCGCGTTCTefiMATTTCTCeCGTACGAATCATCAAAGCGGACCCGGCTATTTTTAG 1801 + + + + + ^ I860 CCAATCGCGTGCGTGATGATGGAAAACGCMGAATGTGCGAGAGGAGAGAGAGTGAGGTG 1861 + + + + + + 1920 GACAAAAAATGTGTTTGCTTTTGAAAGTGTTTATTCCTCTTAACTTTTAACAACATTAAA 1921 + -+ + . + iggQ AGAATGCTGGATTTAATTTAACAGAATACATTTTCAACAAAGCAGCTTGTAGGTCACAAT 1981 + + + +_ 2040 GCGTTTATTATTATGATAAAGTGCATATAGTTAAGGAAAGCTATTAGAAAGGAATATTAA 2041 + + + + ^ 2100 oin, '•""•"'"'ATTGCACCTCAAGTTTGCGTAGGCTAACAATTGTTAGAATTATTTAAATTTGATTT 2101 + ^ ^ 2160 TAATAATATTTTGTTCACAACTTGCCCTGAAAAATTGATTTGAATGATCGTAAAATTTAT 2161 + + ^ ^ ^ 2220 AAAACTGTTATTGAATAATCCGTTACGAGTTATGCGGAATAAATTAATAAATCAACATTC 2221 + + + + _^_ ^ 2280 00O1 ^^™GTCCCTCCTCGCTCGCTCTCCTCTC6CACATTCII£CGTTTTCCATCATCACGC ^^^1 " + -— + + ---+ +-+ 2340 ACGCGATTGGCTTAAAAATAGCCGGGTCCGCTTTGATGATTCGTACGC6A
PAGE 85

79 GTTTCAAAGTAACAAGCAGTGACCAGAGTGAATCAATTGTTGCATCAGAAAGCGTATAAT 2581 + + + + + + 2640 TGTGCACACCAGTTTGAGTGATTTGAGAAAGCATATTCATCGAAGTTGAACCACAGAGAC 2641 + + + + + + 2700 Start Codon ACAGAAIGCCTTCGGCAATCGGAATCGATCTGGGCACCACGTACTCCTGCGTTGGTGTGT 2701 + + + + + ^ 2760 MetProSerAl all eGly I 1 eAspLeuGl yThrThrTyrSerCysVal GlyVal Phe TCCAGCATGGAAAGGTGGAGATCATCGCAAACGACCAGGGCAACCGAACGACACCGAGCT + + ^ ^ ^ ^ 2j G I nHi sGlyLysVal Gl ull ell eAl aAsnAspGl nGlyAsnArgThrThrProSerTyr ACGTTGCGTTCTCGGACACTGAGCGACTCATCGGAGATGCAGCCAAGAACCAAGTGGCCA 2821 + + 4. ^ ^ ^ 2880 Val Al aPheSerAspThrGl uArgLeu II eGlyAspAl aAl aLysAsnGl nVal Al aMet 0001 ^^^^"^^^^A^TAACACGGTGTTCGATGCCAAGCGACTGATTGGACGCAAATTCGACGATC 2881 + + + + ^ ^ 2940 AsnProThrAsnThrVal PheAspAl aLysArgLeuIl eGlyArgLysPheAspAspPro CGAAGATCCAAGCCGATATGAAGCACTGGCCATTCACGGTGGTAAATGACGGTGGTAAGC 2941 + ^ ^ ^ ^ _ LysIleGlnAl aAspMetLysHisTrpProPheThrValValAsnAspGlyGlyLysPro CCAAGATCCGCGTCGAGTTCAAGGGCGAGCGCAAAACCTTTGCCCCGGAGGAAATCAGTT + ^ ^ ^ ^ ^ Lys n eArgVal Gl uPheLysGlyGl uArgLysThrPheAl aProGl uGl uI1 eSerSer CGATGGTGCTGACGAAGATGAAGGAAACCGCCGAAGCCTACCTGGGCCAGTCAGTAAAAA 3061 + + + ^ ^ ^ 2120 MetVal LeuThrLysMetLysGl uThrAl aGl uAl aTyrLeuGlyGl nSerVal LysAsn ATGCAGTCATCACAGTACCAGCCTACTTCAACGACAGCCAGCGACAGGCCACAAAGGATG dl^l + ^ ^ ^ ^ _ ^ ^^^^ Al aVal II eThrVal ProAl aTyrPheAsnAspSerGl nArgGl nAl aThrLysAspAl a Table 3-13--continued.

PAGE 86

80 CTGGAGCCATCGCTGGACTGAATGTGATGCGCATCATCAACGAACCGACGGCAGCAGCTC 3181 + + +.. _+ + 3240 Gl yAl a 1 1 eAl aGl y LeuAsn Val Met Arg 1 1 e 1 1 eAsnGl uProThrAl aAl aAl aLeu TGGCGTATGGCTTGGATAAGAACCTAAAGGGAGAACGCAATGTTCTGATCTTCGATCTGG 3241 + + + + + + 3300 Al aTyrGlyLeuAspLysAsnLeuLysGlyGl uArgAsnVal Leull ePheAspLeuGly GAGGCGGCACCTTCGACGTGTCCATTCTGACGATCGACGAGGGATCACTGTTTGAGGTAC 3301 + + + + ^ ^ 33g0 GlyGlyThrPheAspValSerlleLeuThrlleAspGluGlySerLeuPheGluValArg GATCCACGGCCGGAGATACTCATTTGGGAGGCGAAGACTTCGATAACC6AATGGTGGGNC 3361 + + + + + + 3420 SerThrAl aGlyAspThrHi sLeuGlyGlyGl uAspPheAspAsnArgMetVal GlyHi s Eco RI ACTTCGTGGAAGAAIICAAACGAAAGCACAAGAAGGATCTGTCGAAGAACGCTCGCGCTC 3421 + + + + _^_ ^ 3^gQ PheVal Gl uGl uPheLysArgLysHi sLysLysAspLeuSerLysAsnAl aArgAl aLeu Xho I TGCGTCGTTTGAGAACGGCATGCGAGAGGGCGAAGCGCACACTGTC CTCGAG CACGGAGG 3481 + + + + + ^ 3540 ArgArgLeuArgThrAl aCysGl uArgAl aLysArgThrLeuSerSerSerThrGl uAl a C7a I CAACGATCGAAATTGACGCCCTGATGGATGGCATXGAITATTACACGAAGATCAGCCGGG 3541 + + ^ ^ ^ ^ 2600 Thrll eGl ull eAspAl aLeuMetAspGlyll eAspTyrTyrThrLysIl eSerArgAl a Pst I CACGATTCGAGGAGCTGTGTTCTGACTTGTTCCGTTCGACGCIGCAGCCAGTGGAAAAGG 3501 + + + ^ ^ ^ 3ggQ ArgPheGl uGl uLeuCysSerAspLeuPheArgSerThrLeuGl nProVal Gl uLysAl a CTCTGTCCGATGCGAAGATGGATAAGAGCTCCATTCACGATATCGTCCTGGTAGGAGGGT 3651 ---------+ + + _^. ^ ^ 3720 LeuSerAspAlaLysMetAspLysSerSerlleHisAspIleValLeuValGlyGlySer Pst I CCACACGCATCCCGAAGGTGCAGTCCTTGCIGCAGAACTTTTTCGCTGGAAAGTCTCTGA ^'21 + + + + ^ ^ 3780 ThrArgll eProLysVal Gl nSerLeuLeuGl nAsnPhePheAl aGlyLysSerLeuAsn Figure 3-13--continued.

PAGE 87

81 ACCTTTCGATCAATCCGGATGAGGCCGTGGCTTACGGTGCAGCGGTACAGGCGGCCATCC 3781 +--+--+ + + + 3840 LeuSerll eAsnProAspGl uAl aVal Al aTyrGlyAl aAl aVal Gl nAl aAl all eLeu TCAGCGGAGACAAGGACGATAAGATTCAAGACGTACTGCTAGTGGATGTCGCTCCATTGT 3841 + +-+ + + + 3900 SerGlyAspLysAspAspLysIleGlnAspValLeuLeuValAspValAlaProLeuSer CGCTTGGAATTGAGACGGCCGGAGGTGTGATGACGAAGCTGATTGAGCGCAACTCGCGCA 3901 + + + + +... + 3960 LeuGlyll eGl uThrAl aGlyGlyValMetThrLysLeuIl eGl uArgAsnSerArgll e Bgl II TTCC6TGCAAACAGACGCAGAICITCTCGACATACGCCGACAACCAGCCCGGCGTTTCGA 3961 + +--+... + + + 4020 ProCysLysGl nThrGl n II ePheSerThrTyrAl aAspAsnGl nProGl yVal Ser II e TCCAGGTGTTCGAGGGAGAACGAGCCATGACCAAGGACAACAATCTTCTGGGACAGTTTG 4021 + + + + +-+ 4080 Gl nVal PheGl uGlyGl uArgAl aMetThrLysAspAsnAsnLeuLeuGlyGl nPheAsp Bst EII ACCTCTCGGGCATTCCCCCGGCTCCACGTGGTGTGCCACAGATCGA GGTGACC TTCGATC 4081 + + + +__.+ + 4140 LeuSerGlyll eProProAl aProArgGlyVal ProGl nil eGl uVal ThrPheAspLeu TGGATGCCAACGGAATCCTGAACGTGGCAGCTAAGGAGAAGAGCACCGGAAAGGAGAAGA 4141 + + _^ ^ ^ 4200 AspAl aAsnGlylleLeuAsnVal Al aAl aLysGl uLysSerThrGlyLysGl uLysAsn ATATCACGATCAAGAACGACAAGGGTCGCCTATCGCAGGCCGATATCGATCGAATGGTGT 4201 + + + + + + 4260 II eThrll eLysAsnAspLysGlyArgLeuSerGl nAl aAspIl eAspArgMetVal Ser CGGAAGCTGAGAAGTTCCGCGAGGAGGATGAGAAGCAACGCGAACGCATCTCTGCCCGCA 4261 + + + + +-.. + 4320 Gl uAl aGl ULysPheArgGl uGl uAspGl uLysGl nArgGl uArgll eSerAl aArgAsn Xho I ATCAGCICGAGGCTTACTGCTTCAACCTGAAACAGTCGCTGGACGGCGAAGGAGCGAGTA 4321 + + + ^ ^ ^ 43gQ Gl nLeuGl uAl aTyrCysPheAsnLeuLysGl nSerLeuAspGlyGl uGlyAl aSerLys Figure 3-13--continued.

PAGE 88

AACTCAGCGATGCCGATCGCAAGACAGTGCAGGATCGATGCGAAGAGACTCTGCGATGGA 4381 + + + + + + 4440 LeuSerAspAl aAspArgLysThrVal Gl nAspArgCysGl uGl uThrLeuArgTrpIl e TCGACGGCAACACAATGGCCGATAAGGAGGAGTTCGAGCACAAGATGCAAGAGCTAACGA 4441 + + + + + + 4500 AGCTGCCGTTGTGTTACCGGCTATTCCTCCTCAAGCTCGTGTTCTACGTTCTCGATTGCT AspGlyAsnThrMetAl aAspLysGl uGl uPheGl uHi sLysMetGl nGl uLeuThrLys AGGCATGCAGCCCCATCATGACGAAACTGCACCAGCAGGCAGCTGGCGGGCCCTCGCCAA 4501 + + + ^ ^ ^ ^5gQ Al aCysSerProIl eMetThrLysLeuHi sGl nGl nAl aAl aGlyGlyProSerProSer GCAGTTGCGCACAGCAAGCTGGAGGATTTGGAGGAAGGACGGGTCCGACAGTGGAAGAAG 4561 + + + + ^ ^ 4g2o SerCysAl aGl nGl nAl aGlyGlyPheGlyGlyArgThrGlyProThrVal Gl uGl uVal Putative Polyadenylation Signal TGGATTAAGGAGTAGAAAIMCGGAGATTTATAATTGATTCGAAGAGGATGGCATTGACT 4621 ---------+ + + + -+ + 4680 AspEnd GAATATGATTACTCATATAGTATGTTCCTATG 4681 + + .+.. 4712 Figure 3-13--continued.

PAGE 89

83 I— I o < <_> ts I— <_) I— o I— o o o \— o < I— • I— C3 e3 I— I— ts o <: I— I— I— I— I— I O I I— I O I I— 1 hI < I o o CD «3l o CD I— t5 < • I— C3 tS <_) tS • hI— CO C3 CJ C3 O I— C3 C3 «C -J Q£ O O 1— 1— Hh<-> * H* 1 >— •* ft <5 o o 4HO 1— 1 o o CM CJ 1 CJ h— • 1 1 O 1— o -ro 0 * LlJ <: O 31 CJ • t» T3 »— * S-<* o) I 1— o • i CJ o • t 1— 1— • t CJ CJ • « CD 1— • m <: • CD 0) ••-> S0) o O) ^ s0 2 (U &o ^ Q.-0 +-» E • c •> o O) I— •>Q) J3 a> S-»-> > ro 1 -O 1— +-> 0) O f C 0) <« c C7I 3 S~ C7)-'+->•!0)1— C S~ (U (/) c Q) J-IQ) E -O <0 T3 ^ C C C +-> (Q LlJ C (O •>CO -rC I— I :e so (TJ -M Q) O It(1) 0) (U • E C7> U O I— -o C O) 0) Ci TD 3 fx »0 O) (O (/)!-> +-> ^ c s. (U 0) (T) SE -M nj c (/> +-> Dl

X (0 -M -^ O 3 3 «0 ^ 4-> "O C «t 4-) •OJ 0) •IC o e >— -Q 0} Z3 cr 0) (/) 0) ^ (— > MO) O ^ -o ^ c •• +-> C (O Q> (/> 0) (O 0)0) STD C (/) « 00 O O ^ c 3: x: r>. S 00 « VIc o +-> >i ro "O CO 1— O) • •!OJ U 4J Q > _ <0 TJ C O C o) (O 3 o. O" CO O) 0) c Q. 00 ^ O 00 4-) •!O) T3 4J S. O) >) O) > ^ r— S0) 0) T3 T3 O) "O «0 0) ~ C JOi O (O +-> U ^ (TJ CO O 0) «t +J E O C 00 0) Dl •I-o I— c f -M <0 «t SJCO "J 3; I — (O (o a» , <:-»-> Q ^ ^ O) 10 0) f w +j . c • • CO Q. O E ^ «0 <4(O •!»0 •— " 0> O I — -i-i O) > O SO. SCO C E t. CO 0) I — ^ 0) O O Q. tqj sCO 3 3 e +-> >> c O CO 0) (O 0) •>. ca.^ ssiJC5 3 +-> +j (o

PAGE 90

84 Translation Start ACACA-AATG 87C TGAATACTTTCAACAAG-TTACCGAGAAAGAAGAACTC C . ~ 87A TCG -c.... p70a, L ATTTCTGAGAGAAAACATCG AGAGCAACAA G P70a. R T....AGACCAAGTT G....* p70b , L GTGATTTGAGAAAGCATATTCATCGAAGTTGAACCCAGAG G P70b, R Q -40 -30 -20 -10 Figure 3-15. Translation Start Alignment. Alignment of two D '"elanogaster Hsp70 (87C Gene 1 and 87A Distal) and She J albimanus mr? ? odon'7 nSlSf-^'Jl I'' ''''' ('^^ se uences upstream 0? ? e ATG start codon (underlined) is shown. A region of conserved seauence i<: s an : tT ' :.hl:'"?'-. is'relative to'the tr t o ' sZenll'V. tSe'fine^Sbov"!^ '^^^'^"^ '''' ''^^ ^^-^ ^^-^^

PAGE 91

85 O o o < »» » I M If '•1 -J" < < O < tOl Ol IQ. c Q. •-> a; o CT a> s•«-> o a> «*«44-> O T3 ^40 0)0 C -*-> O) (O O) ^ -IO IT) T3 -C C ••-> 0) •.-C O ••-> 0) s-o D <0 C O) <« O. VI 0.c£ QQ i O) -t-> SC C <0 <0 O) ••-> Q. E c •IO) T3 JE C 0) 0) (« Q.I— X Q. O) E SO 0) CUE 0 I ••-< (/) z c o O) u +-> OJ • f c -o +-> (4•Io o $-rO) "O 00 Q. 0) -M X SO UJ O. 3 C O) O 0 x: •I+J Q. c (4a> (U o f •-> +-> X 00 uj 0) oo • ox sc o 0)0)^ . E 3 00 (O •IO" o sQ) <: a. 00 Q. • • c o VO 00 (O t-H +J Q. •(-> o> <0 +-> <+•1I. O Q>

PAGE 92

86 A. Consensus (5 out of 6) AgTT-AAat-aAA-Aa-C-AAg-Ga-AACA Predominant {>3 out of 6) AGTTCAAAT CAAA-AATCAAA GTGAAAACA H sp22 A A • bCC* bAwC* •C* •CT* • • • Hsp23 ....G..T A.GC C..T.... Hsp26 . .A. .G. . .TC. .A. .T.G.GCA.TG Hsp27 . . .CT. . .CTG. .A. .TTG. . .GC. . .CGT Hsp68 .T..G CGT Hsp/O .A T C..G C... Hsp83 AGTCTTGAAAAAAATTTCGTACGGTGTGCG B. CAAACAAGC-AA B8 AGCGACAAT AACACGTCGCTAAGCGAAAGCTAAGCAAATA 87C ... -A. .A.TCAATTCAAACAAGCAAAGTG 87A A....G....-G C. p70a , L ACTGTCAGTTGAACACAAACAAGCGAACAAGCAAGCAAGAGAGCCAAGAACGGCGCGAAGC p70a,R ..C..C A. p70b L GTCGTCAATTTGAATCTGAGCGAGCTGAGAGTAACAAGTGCAAACACGTGAAAAATAAAGT p70b R ..C..C 10 20 30 40 50 Figure 3-15. Transcription Start Alignments. A. The consensus and predominant nucleotides in the transcription start regions of six D. melanogaster heat-shock genes are shown. One position is a tie for "C" or "A" (hypenated in the predominant sequence line). The sequences and alignment are from Hackett and Lis (1983). In contrast, 1 have shown the sequence of Hsp83 which is not preferentially translated under heat shock. B. Alignment of three D. melanogaster Hsp70 genes (B8 Clone, 87C Gene 1 and 87A Distal) and the A. albimanus Hsp70 p70a and p70b left (L) and right (R) promoters downstream of the TATA box. A region of sequence shared by the p70a, 87C and 87A genes is shown above the alignment. Note that clone B8 has a deletion of this region and p70b is not similar. The p70a sequence consisting of repeats of C-A/G-A-G/A is shown in bold type. Numbering is relative to the transcription start sites shared by the p70a and p70b genes with the start being 1, negative numbers are upstream, and positive downstream.

PAGE 93

87 0) (J c 0) I. 3 u u o CM "O c CO (0 o >> o [o c 0) h3 o0) su_ c o 00 c «J o 00 o o o o Q. O o o o Q. X) a. o o o c o -o o o o i o 5*o CO >— I «jlo in CT» I— I 00 —I —I 00 (£> cvj 00 ir> in .— I o cj LO o CO CO —I CM CM ^ lO CVI VO 00 o ^ o c\j o o o o ^ CO 00 CO CO CO ^ CO CM o ^ CO •— I CO LO in in — I cn I— I CM I— I lO CM o in I— I CM o o o o CO lO O 00 •— I o in 00 CO CT> CM I— I CO I— I CM CM in 00 ^ CM in to cn in 1—1 CM o o o o CTl lO l-H ^ 00 O CM CM 1— I "dI— I CNJ o r-. 00 CM CD < h<_) iD (J3 (J3 (SS CJ CS C3 C9 o e? c3 o o o o cr> CT> CM ^ cn 00 CM in o o o o CT> o to in o o o o CM VO O lO CM UD O VO CM O CO lo 1— 1 1— I in o 1-^ 00 CO CM 00 o o lo CO lo ^ ^ ^ m CO .—I in in CM ^ CO o CM 1— I -H 00 — • ^ CO 00 •— I CT> 1— I •— I CM CO in CO CM CO in 1— I 1—1 CM CM ^ lO 00 1—1 CM CM CO o o o o in VO »— I CT» 1^ in CO VO o o o o in in cn cn CM CM o o o o ^ 00 ^ 00 CT> 00 ^ CO CO to m cy> ^ CM ^ CM 00 o< o> CM 1—1 CM 1—1 O ^ ^ 1^ lo ^ m ^ in o lo lo CO 1—1 CO r-^ ^ ^ CM 00 1^ 1^ o m 1— I o CM o 1— I CO ^ 1—1 CM CM CO «3in CO 1— I 1— I CVJ ^ ^ O CM 1—1 CM CM ^ o o o o 00 O O CO CO 1—1 VO 1—1 oooo oooo CO m 1—1 1—1 »— 1 1— I o> CT» VO ^ CO CO t~O 1—1 00 o in ^ CM ^ CO in VO 00 VO CM CM 1—1 CM CM O < I— o < < < < C3 C3 O O =3 3 O. Q. r— 1 — V/) I— I CM .—I CO 00 ^ CM m 1—1 1—1 CM C3 < I— O oooo oooo CM CM 1—1 m 1—1 CM 1-1 m CO VO CO m CM ^ CM o VO CO ^ O O O CM oooo CO VO en CO 1— I m VO VO CO — I ^ m CM 1—1 CO o CO m 00 m O O O CM oooo VO CO en CM m I— I VO VO nS trs (TS CIS I — p — p — fO «t 5 5 5 — I CO ^ m •—I CM CO o ts 0 • c o T3 O U 0) +-> c (/) 3 "O O o c 'i snj 3 U CO •M 0) S. c (TS 0) Q. o> <0 o <4+-> o c o o (U +-> cn s. (0 o sCL o > a.

PAGE 94

88 •o 0) o o CM I CO a> ^» ja 00 o 00 o O. o t — Q. O o o o o o o o o c o o o (_> o i o 00 ^ csj r^. O in CM ^ o o c\j r». CO o •— » vo CSJ CSJ I— I ^ O O LT) UD O O — I 00 o o evj 00 o o CM r~. LO O 00 CM — I o CM r»» o o o o r-« 00 vo r-» vo vo I o o o ^ Ti^ CT^ ^ CO ^ CT» o o o o 00 ^ O If) ^ o ir> o o o CM o lo CO •— I o ir> CO o ^ o o o lo LO «ao in ^ ^ o o o o o> o ^ — I 00 O CO — < CO •— I o> lo I— I CO in in 1— c in 1^ in ^ CM CO 1^ CM 00 00 t— I CO CTl CM CM I— I CM 1—1 00 ^ CM o o CM O O CM * CM r*. cy> I— I ^ CM in in CT> 00 ^ CT> o CM o m CM i— I i— I CO O •— I CT> CM O i— I lO O O CO 00 O O 1— I 00 o ^ in cn in in O i-H CO CM o o o o O O CM 00 o o ^ 1— I CM in o to in CO o in in o lo ^ o o o ^ O lO ^ ^ o o ^ o o o o in UD in TjCM O CM o> •-• o o o CO o vo «!» ^ o in en o — I o o O VD CO o o in — I m o o o o 00 O 1—1 i— I CO O 00 00 CM CM ^ 0> lO 1—1 -—I CM o CO CTt o^ ^ .—I to CO CM CM r«~ CO o ^ 00 CM »— I TJm o cn 1— I 1—1 CO O CO CM LO o o CM 1— ( T*lO o CO 1—1 1—1 o r-^ CM CO CO ^ 1—1 LO ^ 1— I CM CO o ^ o CM o 1— I r>. O O CM 00 O O CM 1^ O ^ CO CM O 1—1 CM 00 O O 00 CM o o o o> CTi o r>. CM CO VO O LO r-H CM in o ^ lo CM o ^ 00 o o o o cn ^ in ^ 1— I o o o CM i£> in •«*^ in o 00 o o o o 1 — It — i O — I o o O LO lO 00 o in LO 1— I o o o o lO o r*. r-^ cn o «ain CO 00 o m 1— I i2 CO LO m • ^ CM • 1— I CO ID CM C3 < <: < > >i lO c/) — I — I «C «t CO 1— I ^avo CM I— I ^ LO 1— I cn o I— I CO C3 < I— O I— I— I— t— «t < <: < )-> O) O) O) 3EI ' — ' 1 t — I CM 00 CM CO 1—1 in LO o LO in 00 CM tn < (— o o o o o < <: < < ssssCO o CO o CM o CM t3 < I— <_> C3 tS CJ 00 00 I— LU O O o 1— I .— I r-. O i-H 1— I 1— I t3 <: I— <_> <:<<:< r>. o LO CO 1—1 CO in lo LO 1— I o CO 1—1 1—1 CM C3
PAGE 95

orocvj^ i».cMiooi ooe\jr~.ro to ^ UJ<— lo cNj r~CO r-. m>— iio^dCO vo CO — I ^ ^ CVJ ^ TiCO •— I U3 CTi CVJ CO CO I— I CO CVl I— I in in CO I— I ^ ir> CM ^ esj o CM CM CO CO 00 CM LT) IT) CM CO CM CO CVJ 1— I LO ^ LO lO CTV CO LO t-^ cy> CO o O t— I CO CO -—1 ^ o CO •— I <<* CTl I— I LO LD CVJ CM r-~ CVJ a> vo — I vo o O I— I CO o ^ CVJ ^ CO O CVJ oooo oooo oooo oooo oooo O CO CTl o O I— I vo LO vo LO LO O LO 1^ CM O 00 00 CO 00 •— itocn^ CO CO •— I CO CO CVJ vo 00 CO ^ vo •— I vo LO 00 LOCO^CM f-HOOVOLO CM I— I I— I CM ^ CT> CO en CO LO vo ^ 1^ LO O •— I t->. vo CM CO 00 •— I CM Tivo CVJ vo CVJ vo — < 1 — 1 I — I CVJ CTl ^ CO LO CVJ O 1^ I— I lO ^ 00 CO LO "3O O r-l oooo ^ ^ CO I— I CM CM f— I CO oooo Tivo CO CM ^ LO oooo CM vo CTl CTl LO O O O oooo r~. CM LO CM O I— I oooo CM en vo r~~. CO vo to CO LO LO CO vo O O O CTl r-^ I— I CTl LO LO vo CM LO CT) LO LO CM vo CM CM o I— I vo LO CO 00 LO CVJ 1^ ^ I — I CTl CVJ CO .— I Tjvo 1— 1 1— I 1— I CO •— < 00 ^ vo vo CO o •— I vo CM LO CO 1— I vo LO LO CTl CTl KjI— I LO LO >— I CO ^ CM LO "1*CO ^ ^ CM CO LO f— I ^ o «t I— c_> o < I— o CJ3 ssss<<:<<£ C C (O 00 C3 C3 n: :r 3 3 3 =S 0)0)0 0) oooo ssssa. a. a. cl.

PAGE 96

90 2? e o CO Q) CD U 00 J3 cJ#i »0 o o 1 cr o T3 I ^ JZ , 1 <^ 1 1 ! -Q ! (V a: I ' c •r" 1 o on 1 o ^ 1 o (O 1 O 1 1^ 1 O. 1 4-> 1 ^ 1 1 (/) O 1 (U 1 (J O. 1 c* 0) 1 oo +-> 1 i_ O) 1 a: 1 (0 ^ 1 0) <0 1 _J O I t-«. 1 ^ (/) Q> 1 X 1 o QQ J3 1 < O 1 1— 1^ 1 >J I— I CM I— I VD O to r>. — I in 00 m m CO ^ o 00 in CO CVJ I— I CVJ «^ ^ 00 ^ 1^ i— < ^ 00 in un CO ^ CO 00 CO vo CSJ CO CM — I CO o CO o ^ r>«. ^ CO >— I ^ r-. oo CM T*.— I — ( CTi cj cn CM ^ o CO ^ — I o o CT> CM CO CO f— I CM O LD t-~U5 CO CO ^ •— I CM CM .—I CM 00 00 CM CM CM CM CM CM m in CM O CM CM o &i oco^^cocrv^o^^Ttoo^oooco t^ino^incoc7>coocTivDOO«i-cooocM r».ioCTioooovoi— loininoOi-Hi— ir»«cMin coor^^^co-— icMCMcovocMvocoCTicn f-H CM 1— li— li— 1<— li— 1<— I 1— !•— Ii— I co^^in^oocoo^cocoooinooocvj r>.ino^incoa>cooa»iooo^cooocM in «cf "tf-t^inoi— io>CMCT>coineMvoo ^OCO^CO^riCMCMCOlOi— IICCOOOO l-H CM 00 »— < i-H i-H I — I I — t 1 — I I— I i-H I— I I — t i-H I— I 1 — ( I — i CNJ f-H I— I 1 — ( I — ( r— H f— I OCT^inoO'— 'incMi— iiovocoooinocMco I— li— I CM CM f—t t-H I-H I-H CM .a o c J3 O c O «t I— O ocMOOCT>cMint~^o>oor-»r«»t^o^o»r^oo I CM CM ^ I— I I— I I-H ,-H -Ht~^cooocMt^cocT»r~~coocTiCTiinrom CM I-H CO CO I-H r— I I— If— I CM ^OOCTIi-HOOCTtO^CTlOCMini— i^mco co^^co^vot^^^r^r^^co^^cM in^oo^incoo%cMcococoiocoo>oin cMinco^^ooioco^inoo^^co^cM cooooocooo^«a-oooo^^oocoooooco CMCMCMCMCMCOCOCSJCMCOCOCMCMCMCMCM int^inini-Hoo>— iincovohooocococM^ — ICOCMCSJCOCOCOCMCOi— ICOCOCMCOCOi— I t3<:i— Ot3<:i— Ot300<_)

PAGE 97

1300120013001200 1300-1 1200 91 p70a, R p70a, L p70b, R 1300-1 1200 13001200 1300 1200 mmm mmm -200 -150 mmm p70b, L mmm -100 -50 87A m 87C TATA Amin HSE Region Pelham HSE Figure 3-18. HSE Distribution. Spatial and quantitative distribution of scores indicating the match of sequences to two different weighted criteria for heat-shock elements. Scores and positions for matches above 1100 (for Amin et a7.{1988)) are indicated by the heights of the bars and positions. Only scores in the 200 bp upstream of the TATA box are shown. R and L indicate the right and left genes of p70a and p70b. The 87A and 87C sequences are the same as those in Figure 3-14. Scoring matrices and the scoring program WEIGHTS are included in Figures 3-1 and 3 ~ 2 •

PAGE 98

CHAPTER 4 COMPARISON OF THE DROSOPHILA MELANOGASTER AND ANOPHELES ALBIHANUS HSP70 GENE FAMILIES Introduction The Hsp70 genes of Anopheles albimanus and Drosophila melanogaster are members of families comprised of at least four genes in the mosquito and five or more in D. melanogaster (Ish-Horowicz et a/., 1979). In addition, the D. melanogaster family includes Hsp70 cognate genes {Hscl, Hsc2, Hsc4) which have similar sequences, but unlike the Hsp70 genes, contain introns and are not heat inducible (Ingolia and Craig, 1982) (Craig et a/., 1983). Another member, the Drosophila HspSS, is closely related to the D. melanogaster Hsp70 gene, and is heat inducible, but is expressed at much lower levels (Holmgren et al., 1979). In this study, the four mosquito genes have been isolated in two clones p70a and p70b, each of which contains a pair of Hsp70 genes in divergent orientation (Chapter 3). These are located at two loci on the same chromosome arm, about 20 centiMorgans apart. In most species of Drosophila, the Hsp70 genes also occur in two divergently transcribed pairs at two loci (4 genes), but are very tightly linked (Leigh-Brown and Ish-Horowicz, 1981). 92 I 1

PAGE 99

93 The similar structure and sequence of the mosquito and DrosophiTa Hsp70 genes suggests homology. However, it is possible that the divergent gene arrangements are due to convergent evolution, and that the mosquito genes actually have a closer relationship to the D. meTanogaster cognates. In this chapter, this possibility will be tested using the available DNA sequences. A second area considered will be the genetic mechanisms that account for the concerted evolution of the Hsp70 genes. Extremely high similarity of the members of the D. melanogaster Hsp70 gene family suggests that concerted evolution has occurred. The proposed mechanism, gene conversion, is believed to occur within, and less frequently between, loci (Leigh-Brown and Ish-Horowicz, 1981). The mosquito //sp7(? DNA sequences reported in Chapter 3 are similar and provide another opportunity to determine whether concerted evolution is occurring among the mosquito sequences, and if so, whether gene conversion is an adequate explanation. Materials and Methods DNA Sequences . DNA sequences of the mosquito Hsp70 clones p70a and p70b are from Chapter 3. D. melanogaster Hsp70 gene sequences from locus 87A (distal) and 87C (distal gene 1) are from various sources (Ingolia et a/., 1980)(Torok and Karch, 1980)(Karch et a/., 1981) as assembled in Genbank version 60 files DROHSP7A2 and DR0HSP7D1 respectively. The D. melanogaster Hscl cognate sequences and D. simulans sequences are from Ingolia and Craig (1982). D. melanogaster cognate genes Hsc2 and Hsc4 are from Craig et a/. (1983).

PAGE 100

Sequence manipulations were done on the Genetics Computer Group (GCG) Software Package (Devereux, 1984). version 6.1, and the Multiple Sequence Editor (Massachusetts Institute of Technology) both running on a MicroVAX II computer. Most alignments were visual but the carboxyl end of the Hsp70 genes were aligned using the GCG program BESTFIT. Sequence Comparisons . Dot-plot comparisons were done using the computer program D3H0M (Fristensky, 1984). For mosquito/mosquito comparisons, the homology range was 10 bases and the minimum homology displayed was 60%. For mosquito/D. melanogaster comparisons, the homology range was 3 and the minimum homology displayed was 80%. In both cases the scale factor was 0.95. Additional dot-plot comparisons were done using the GCG programs COMPARE and DOTPLOT (Maizel and Lenk, 1981). The window size for those comparisons was 21 and the stringency 14. Nucleotide divergence was determined using the GCG program DISTANCES. Amino acid divergence was calculated using DISTANCES considering identity only. Parsimony analysis of DNA sequences was performed using the computer program Phylogenetic Analysis Using Parsimony (PAUP) version 2.4.1 (Swofford and Maddison, 1987). Results and Discussion The mosquito clones p70a and p70b each contain two genes and are derived from two loosely linked loci. The D. melanogaster Hsp/O genes are located at two very tightly linked loci. Comparison of these sequences in all permutations permits detection of regions of similarity that might indicate their phylogenetic relationships and functionally

PAGE 101

conserved regions. Protein -coding DNA sequences were easily aligned so that base-for-base comparisons could be made. However, for other more highly diverged sequences, dot-plot comparisons were used since this method allows the detection of repeated, rearranged, or gapped sequences that might be missed using a base-for-base comparison method. Moscuito Gen es are similar within loci, but much less so between locL. The protein-coding regions of the pairs of divergently transcribed genes of p70a are 98.9% similar at the nucleic-acid level, and can be aligned without gaps (Table 4-1). This similarity extends to the untranslated leaders and 150 bp upstream of the TATA box as well (Figure 4-1). Likewise, the p70b pair are 99.9% similar in the protein coding regions. The untranslated leaders are identical, and the 250 bp upstream of the TATA box are very similar. When the p70a protein-coding regions are compared with those of p70b, high similarity exists, although it is lower than that observed in the intralocus comparisons (Table 4-1). Sequences upstream of the coding regions have very little similarity. Dot-plot comparison of these sequences show that the similarity is limited to a small region around, and upstream of the TATA box. These comparisons demonstrate that the pairs of genes within loci are more similar to one another than to those of the other locus. The degree of similarity of the p70b pair is greater than the p70a pair in all regions compared. The fact that the limited regions of similarity occur in the regulatory regions of p70a and p70b suggest that those regions that are shared might be a result of functional constraints rather than a common recent ancestor or information exchange.

PAGE 102

96 In contrast, the D. melanoaaster genes are similar not only within, but between loci . The nucleic-acid distance matrix and dot-plot comparisons show that the 87C distal gene 1 and 87A distal gene are highly similar not only within the coding regions but for approximately 300 bases upstream of the TATA box. Similar comparisons have been reported and the evolution of that gene family has been discussed extensively (Artavanis-Tsakonas et a/., 1979)(Moran et a/,, 1979) (IshHorowicz et a/., 1979){Ish-Horowicz and Pinchin, 1980) (Leigh-Brown and Ish-Horowicz, 1981) (Mason et al . , 1982). A close relationship of all of the members of the D. melanogaster Hsp/O gene family has been observed. This is in contrast to the interlocus differences of the A. albimanus genes which appear almost totally unrelated outside of the proteincoding regions. The A. albimanus Hsp70 genes share features with those of D. mel anopaster . Particularly: the heat-shock-element arrays, long untranslated leaders, divergent transcription arrangement, and intronless structure. The nucleic-acid-sequence similarity is about 75%, and the predicted protein-sequence identity is 82%. Nevertheless, dot-plot comparisons of regions upstream of the protein-coding regions reveal no extensive regions of sequence similarity (data not shown). Note also, although A. albimanus and D. melanogaster are both Diptera, the predicted Hsp70 protein sequences are as dissimilar as those of the nematode C. elegans from chicken (Table 42). Although Hsp70 genes are generally well conserved, surprisingly high divergence has occurred between A. albimanus and D. melanogaster. Parsimony analysis of the //so/O-like gene family . Relatively high nucleotide and protein sequence divergence suggests that in spite of

PAGE 103

apparent homology, the D. melanogaster Hsp70 genes may not be the closest mosquito relatives, but that the mosquito genes might be more closely related to the D. melanogaster cognate genes. Proliferation and divergence of the dipteran //sp70-like gene family may have occurred prior, or subsequent to, nematocera-brachycera divergence. The availability of limited sequence data for the protein coding regions of the cognate genes of D. melanogaster and D. simulans permits this possibility to be examined. In order to determine the relationship of the mosquito Hsp70 genes to the family of D. melanogaster and D. simulans genes, Wagner trees representing the most parsimonious reconstruction of the gene phylogenies were constructed using PAUP. The algorithm attempts to reconstruct ancestral gene sequences, and their relationships, by minimizing the number of changes that would be required to account for the extant genes, in this case, using nucleotide sequences. By this f means a gene phylogeny is inferred (Swofford and Maddison, 1987) (Fitch, 1977). The gene phylogeny is based on the nucleic acid sequence of 306 nucleotides of the amino terminus of the protein-coding regions of two D. melanogaster Hsp70 genes and three cognates, a D. simulans cognate, and four A. albimanus HspJO genes (Figure 4-4). These are the first 306 bases of all but the cognates. The first three codons of those genes are deleted for maximal alignment (Ingolia and Craig, 1982). The tree demonstrates that the genes most closely related to the A. albimanus Hsp70 genes are the D. melanogaster Hsp70 genes. Therefore, the A. albimanus genes are probably most immediately derived from a common Hsp70 ancestor and not of the cognates. Similarly, the

PAGE 104

close relationship of the D. simuTans cognate to Hscl of D. melanogaster, shows the probable homology of this pair. This phylogeny also confirms that concerted evolution is occurring in the heat shock gene family of the mosquito in a similar fashion to that observed in D. melanogaster. This is evident since the pairs of A. albimanus Hsp70 genes cluster away from all Drosophila sequences. Furthermore, the branch lengths that separate the members of pairs of genes are small relative to those that separate pairs from one another or from the nearest D. melanogaster cluster. This indicates that concerted evolution is occurring at two levels: species, A. albimanus vs. D. melanogaster; and locus, p70a vs. p70b. The analysis also shows that the p70b genes are more closely related than the p70a genes to the D. melanogaster Hsp70 genes. This is not indicated by simply examining the nucleotide divergence, but is clarified by the parsimony analysis. Has a restriction si te been conserved for 2QQMY? Among Drosophila spp., Hsp70 genes are highly conserved so that restriction map comparisons are possible for phylogenetic analysis. Particular significance has been attached to sites of one restriction enzyme, Xba I, in confirming the Hsp70 phylogeny (Leigh-Brown and Ish-Horowicz, 1981). A pair of Xba I sites are highly conserved in the intergenic promoter regions of the D. melanogaster, mauritiana, and simulans genes, but not in teisseri, yakuba, or erecta. Examination of the restriction map of the A. albimanus genes of p70b shows that the central Xba I sites are in similar locations. Recall that the genes of this clone also cluster closer to the D. melanogaster genes in parsimony analysis. Are these restriction sites conserved due simply to common ancestry, or is there an additional

PAGE 105

99 reason for their occurrence in similar locations? The latter is certainly the case since these sites occur in heat-shock elements that have functional significance in the regulation of the heat-shock genes. Heat shock elements (CTNGAANTTCNAG) frequently overlap by four bases. This results in the sequence CTNGAANTT CNAG AANTTCNAG (overlap underlined). The four overlapping bases, and one flanking on either side constitute five of the six bases of an Xba I site, TCTAGA. Xba I sites do occur with high frequency in most HSE. For example, of 26 HSE (included in 468 bases) compiled in one source (Pelham, 1985), there were eight Xba I sites and eleven more sites that only differed by one base. Therefore, Xba I sites should be considered with caution in phylogenetic analysis. Gene conversion in A. albimanus Hsp70 genes . Like most Drosophila spp., A. albimanus contains two pairs of Hsp70 genes in divergent orientation. Concerted evolution of the genes within each clone is certain since the left and right genes are similar to one another not only in positions under potentially strong selection such as first and second positions of codons, but also in the third positions, in the nontranscribed leaders, and in the promoter regions as well. There are several explanations for how this high sequence similarity could arise. First, the pairs may be the result of duplication events recent enough that little divergence has occurred between the pairs. However, the presence of 2 pairs of Hsp70 genes in all Drosophila spp. examined suggests that this gene number and general arrangement predates nematocera-brachycera divergence. If true, in the absence of some postdivergence homogenizing mechanism, divergence within loci would be as great as that observed between loci or between species.

PAGE 106

100 Second, the observed sequence homogeneity could occur by gene conversion within loci utilizing the palindromic nature of these sequences (Leigh-Brown and Ish-Horowicz, 1981). The gene conversion model is at odds though with observations regarding p70a. A conversion model predicts that once conversion initiates, it will proceed unidirectionally until termination of the event regardless of the function of the sequences between the initiation and termination sites. Selection will then preserve conversion events that are selectively advantageous. The divergently transcribed pair of Hsp70 genes at the 87A locus of D. mel anogaster have sequence similarity extending about 200 bases downstream of the translation stop signal indicating that conversion events have terminated or initiated beyond the end of translation. However, if gene conversion were occurring at the mosquito p70a locus, why does sequence similarity disappear immediately after the translation stop signal, yet a few bases away, the sequence is identical (Figure 4-4)? This means that: 1. this conversion event initiated or terminated precisely at the translation stop codon, 2. there is extremely strong codon usage selection, or 3. there is selection against conversion extending downstream beyond the translation stop, none of which seems likely. Another alternative is that conversion will not extend beyond well -paired regions of DNA and that once sequence divergence becomes sufficient at the 3' ends, a barrier exists to conversion extension. Third, occasional snapback structures might occur within DNA molecules annealing the similar sequences of both genes of a pair. Mismatches could then be corrected by a general DNA mismatch repair

PAGE 107

101 mechanism. This would provide an opportunity for intergenic sequence exchange and allow homogenization of the sequences. Gene conversion is suspected for Drosophila spp. genes not only within, but also less frequently, between loci. The A. albimanus p70a and p70b untranslated leaders and promoter sequences have retained no clear homology and so are unlike the equivalent D. melanogaster sequences which are highly similar to each other (Figure 4-1, plots C and D). Thus there is no evidence that frequent interlocus conversion is occurring between the p70a and p70b loci. This absence of interlocus gene conversion in A. albimanus may be a result of the greater distance separating the genes. The A. albimanus genes are more closely related to one another at the nucleotide and amino acid levels than to the D. melanogaster genes, but this may be due to parallel evolution of the genes at the two A. albimanus loci rather than interlocus gene conversion.

PAGE 108

102 X •f— S+-> «/» (J 3 C c O 3 L. Z Ql +J C 1 "«* to •— 1 CT> 00 O O VO 1 r*^ CT> 00 o> o r-o. 1 O O O O O »— 1 1 1 1-4 o Lo o 1 uLn CT> LT) o 1 ^ ^ O O 1 r-CTi 00 o 1 o o o o ^ 1 CO o 1-. o 1 CT\ fff\ ' (*j \^ j2 1 Tjm en o o ^ 1 h** o> o Q. 1 o o O •— 1 cs 1 CO vo o ' 00 1^ o 1 to t~o O ro 1 r-o r~o. 1 o O •— 1 <: 00 1 LO O 1 Ch o r-J CM 1 in o CT> o e O —1 cj o o r-. o 00 o o r— 1 0) c c 0) o» +-> l-> 0) 1 oe: (S XI

PAGE 109

103 X s+-> TO U i o o c a: Q. o «_> 00 <: 00 1 — LO c 00>i— IVOO O^VOlDi— lOOmCD CSJ> 00 ^ o po in ^ csj CM CO o I — r--. r-r-. 00 00 o o o o o o o •— I lo o r-o o o ^ LO o in in o CM CO CM CM o r-t-^ r~cn o o o o o O T— I vo o lo ^ o ^ in I— I CO o CM CO CM CM o r-^ r-~ r-. r-. o o o o o ^ 00 CO o cvj CO o I— I CT> o 00 t--o o o O o ^ cn o CM CM o 00 00 o O O 1— I c 1 CO o 1 CM O ^ CVJ 1 O u ' 00 o 1 O —1 c 1 o <0 1 o 1 o 3 o IT >— icvjco^mior^-oo D1

PAGE 110

104 mB|u eozd I OiV I J L— \ \ \ \ ® JZ m 0) to a o) Q) ^ C: 4-> -rC +-> C7>^ (0 ss• +-> ^ O) (/) 00 ^ l/l O -O (U 3 o 1^ o ^ s o Q. C Q. OJ I— to -a Q) J2 C T3 ^ C Srt> -a)oo O C n3 U C7> a. o -t-> c c to a. Q.T^ nj Q) O) -I13 +-> D10 OJ Ol'O
Q>Q)0 SQ) > > C 00 O to 0) ^ •!-t0) (/) O ^ TJ t/) 01 c > C (O Q. +J +J Oi O) SC 00 (O •-> O) 3 +-> •> o) •a> X CT O O) X SO) -(-> a> 2 O) C7> 3 00 O -M O ^ 00 O) >, >, C 0) 00 0) ^ «-> t — (Q f C C -IO) S +-»OO"'•>0)+-> rtJ -C -c l4+J 00 I— +J 00 Q. O O -r-r<0 O 0) x: X E I— to oos.Dia)-'-a)Ojo C •••>00 ^ -t^ ^ O -O 100 Q 00 -*-> o) a)
-C CJi C 500 C S-I»-> O -1(O O) (O (O 00 c Q. X I— C O 01 c E o+j-ra)-<->'^ o O J3 <4E -i-> •.O Q» •X +-> e 00 «t 1— UJ 1/1 i. Ml — lO . O) 0 r— (— O 1— • +J C Q. r~. +J +-> c • o 1 Q.-t-> SO 00 U +J • -Iro o > O — «-r— •+-> 00 O "flOQ OO C O 3 +J .,+J o s^ o (Of00J=O003i — r— O OJ+J-i C «-> C 00 (U -t-> 1— 01 E C 1 — O 00 •!0 T3 4-> Z C V. itE C ^ (« Ol O •!-> 6(o CO SCU •!4-> 00 00 o +-> •— I S_ • fO +-> QC CVJ O O) tJl O Q. •"O 1^ ^ O .— 3 2 C 00 -M C Q. 00 c -o -o +-> >-~ -t-) oo (OC-tJccxjqjo-M •<4fo E xj o 1 2 Q) -O rto <: c • sca. »-> 00 m 00 1 — OJ coo X ••00 +J »-> 00 3 01 «c C 00 C> St -> i\ o • • e O Q. O I— 00 >,-.~. I — «o C 00 c (J -Q Q-^C'O'oajcoc'— O) 1^ ^ O •>Q) ttt V.^ ti) >-> >CTCT) 0

  • (TJ O) S•T to E • c ss• >moo-i1 O JS. J«0 •»->-(-> E O) QJr-. (/) .».+J (0-1to C SQj C OO Q.I — 3 00 <0 3eoaja>3cr ^ CD "DCOCT00a)U •i-.oa>XQ)o^x >-i-C3UO)
    PAGE 111

    105

    PAGE 112

    o I— <: < U3 I— <: o as <: o o CJ3 t— I— o o (— O o < <: C3 C3 <_> o I— I— <_) o o < o I— o o o o o CD CJ3 CJ O I— I— O <_) o o o c_) o o (_) o o < 1-^ C3 CJ C3 CJ3 I— O o 00 o o o LD o o CO o CM 00 3 C3 CJ CJ «t o o c TJ (U 0) 3 c +-> O) T3 SC (0 TJ 00 • a> 00 c -o 0) o +-> O tt) l\ z CJ. 00 "O ^ c (4O (/> 00 (W u sc crz: CO c O) O TJ •IQ) -U -t-> O -r(U u U (U C »0 "O 00 CU 0) c u C •rO) 1— 3 < o0) (/) •4-> 0> C JC 0) ••-> o I— 00 o (U • U 3 >, C O t— O) 00 O) 3 > o•O) • -)-> 00 c o • 00 (\J (O O) I c oo OJ O) 00 t3 1— CJl o> •fC •Ll<0 S-

    PAGE 113

    107 C3 • CD < O I < O o o et O C3 O 5 o o < • o I— • I— • CD <: I— CD CD O < $ O o <: o o • • • CD • • • • • < • • • • • ^ O O O O • • • • • • • • «t CD • 1— _j a: _j Qc: r-~. Q} ^ •^r*^ r-^ ^

    PAGE 114

    108 QO Lio 00 > o 00 >_J a 00 00 00 CO 00 <£<>>> • '-' t— > >>OH 00 00 00 2 > a. • H t3 CJ *t ix: i^: < • I— o :i fO -Q << I— a. «t < 00 00 >^ la: Q£ o «t t— C3 o I— Q. oe: QC o CJ9 >L>' I— I — I I— I I— I • • • • • • • • • • • • 00 ^ CL. 00 .0 o CNJ o o 00 o o o Lf) o o CO o vt 0) 1-^ Hj o tj Q. Q.00 00 o o a: lO c : . — . _ --^ E CO OlTa O CT> 4-> (Q (4— (/I 0) c O) •o Jc +-> 0) TJ SO fO 4-> V) o 0) •<-> u o c E Q) 3 SCT O » o >o (71 (—>»-> Q. O) I— . V) 0) -a c w Ci. c O) 0) a: 01 3 0.40 E 4) O u o o -Mi. C •I<0 OJ LU »0 3 ^ cn croo o c: ^ •o < — (/>'-. c o) a> (O N u € E c c 3 O) Q) • •>3 Q 00 0-a 0) O) c 00 nj . — . +-> CO C C CO 0) O) CT> (U S~ -H +-> fO o — O -11*S. ^ • CO m c c •>«» •eQ> r— O «W O < l>>. +J CO 3 • to C >, a 00 r— Q. O) «o o > a c: • • -rc: Q) (o -!-> e o 0) 3 CT) iQ. Cn-Q O 3 co

    PAGE 115

    C3 CO CO CO oo Q LjJ LU UJ LxJ 00 U• • Q >>1— 1 • • • • • • • • • • • • o • o • CO C3 • • eye • 1 1 • • Li_ O O • • • • • • • • • • • _i s :e • • • • • • • < • • • • oo oo • ' Q • • • • . . 00 1 • —1 • • LU • • • • • • * • 1 . . • 1 • o t—t * * • • . • 1 • o> 1— • • • • 00 00 • ' < • • • • . . oo 1 • UJ • • • • cyo• ' • 1— • • • • o oo cy 1 • oo • • • • • (/) • • • • • 1 • 00 • • • • • 1 • _i • • • • • 1 • t— • • • • • 1 — o on • ' • • UJ • • ' • 00 * < • • • • ^ '.oil • • • 1 UJ • . • • . Q • • • o • • >• • • • • a: • • • • • • • • « ^ • • • • . . CD • • Li• • • • • • • • * • • (jj • • Lij . . • • • • • • • • o • • • • in U• • <: < I ; ; • • • • • • • . . a: • • > < cs • • • • • • • • ' • q: • • 1 1 . • • —I • • • • • • • • Q • • • • • • • • • U• • • • • • • • — o Q • • • • • • • • • ^ UJ • . • • • • CSJ C3 • • • • • • • • CJ • • _I • • • • I I • • I • • • • • • • • • 1— • • • • • . • • • Q • • o • • < • • — o 1— • • • CO 00 • • • CSJ >ai Ofi UJ • • u. • • • • • • • • • • '. —1 _l 1 , H1 l-H CJ3 lA I/) 3 CO! t/) _Q ^ <0 (J <0 COOO^-iE t_> Q. Q.00 00 ><: > LlJ O Q. 00 00 00 ^ < < 3= 3: Ll_ O-OO 00 00 00 00 00 o oc 00 CO a. cr CO a: a O 00 — I 00 oo 00 00 < < 00 CO oo 00 oo oo o(J3 CJ3 < 00 oo o oo Q) ^ c V> ea ^ r"" no O fO c O o (_) . • • ^ 3 <_> Q. Q.00 00 «o o 3:

    PAGE 116

    UJ • • • o 1— t • • • cr • • • . o Q_ . . . • > • • • • C3 • • • • Q£ • • . Q. • • • < • • • * IPP • * • • • • • o o • • • 00 • • • • _l • • • 1— • Q • • • LU LU u_ . . . LU • • • • 1 • • • • o — ' ' ' 00 ^ • • • Q . • . • • • • 1— • • • • • • • • • • • LU • • • CJ • • • — o LU . • . >",',' ' • ^ > Ll_ U. • cy • • • • • • • • • -J > • >— 1 >— 1 • 1— « • ) — • — o Qr • • • 1— • in ^ . . . • ^ • • 1-^ 1-^ • 0.000 o 1-^ • »-H • • • • • 1-^ 1— * • • \— 1— h(— • 3y CO C/) O O CO • q; • • • • • — o 1—4 LU LU LLi LjJ • ^ it • • • • h' ' ' < < • • > • • • • C3 • • • • o • • • • < • • • • (— • • • — o LU • • • • ro t— ( • • • _j • ^ o • • • — 1 • 1 • • • • 00 • • • • _j . . . • Q. • • . . . . Q . . . — o _l _j _]>*>> > 1 1 • _i • Q > > > > 1 • cy ' • ' • > > • 1 — 1 1 — t 1 — 1 1— 1 > > LU • • • (/) O O U3 C3 — o ^ Q Q . • i-H Q • • Ocy t3 • • • t/> 1 • • s: z: 1^ • • • <: • • • : • • qOOOO . LU ^ Ixi Q Q£ q; LU 00 • • o o <: CO crcy—i > > > I— I— CO oc • z — I i > 00 . . o-i^ Q Q LU 00 00 Q ^ LU LU • • • • . . a LU Ci3 LU o oo 00 C3 00 • • <£ Z — I — " o. . . ^ • «t . . . • O" • . • • 00 cy >o o ; ^ ^ JLU <. C9 00 C300 M >— I I— 1 > LU LU o o ce: < «t 00 a o z cy , cy cy Q LU • LU ^ O LU . Z ^ i
    PAGE 117

    Ill > • • • • — o UJ • • • • UJ • • • • • 1-^ > > > > a. • • • • o • • • • 00 o • • • <: z o . QC QC >>. . OO CJ . . • 00 — o u. 1 cy • • u; 1 q: 1 o • vo 1 < 1 Ixi < 1 > Qo1 < > ts o, o ' • tD 1 O ' • 1 — o ->-•• 1 . . >>1— 00 ! • o 1 1— I • t/i Q . > 1— 1 Q. • • • • — o 00 • CO < . z z > 1 . • • •
    PAGE 118

    o MO M 3 E « d 3 I IT) CVJ o w X 1^ 00 e E d o CO J3 i3 o o a. a. o E d 03 O Ql (O o a. 112 +J >> o O 1— c +-> C o s0) D — V O o c 1— ^ 0) > +J c •14X o +J O 0) o c +-> 0) -l-> >> q: <0 ^+-> Si !-> o» C (0 o (U *-> s• 0>T3 o (1> 0) O S1— •1CO l\ sQ. 0) T3 0) »0 ^4C O) X 3: c ^ 0) +-> •1>> !-> io Q. O) c •>• (U T3 C O O) -l-> to I— V) 0) ^ O. (« -1f U O CO -•-> 0) CO C O ^ o «4•(-> +-> o u o +-> "D (1) (U (/) 0) 0) ^ •1Jro $1— •, 3 ro f— CT Q. CO • n> 0) 0) 0) sC SCO -d -1fO o > 0) 0) nj C Dl cn ST3 O C C CO (U E (B (TJ -l-> •1^ ^ «/) o o « CtO (U &a. o z s. OJ >> T3 r— . (1) . •14-> CO c •.-Ed) C (O O -M >> c o U CO 1— o u CO O. 0) CO O ^ +-> CO a> B «t +-> CO jC !-> • c 0) -r^ > a> 1 (J •1c ^ CO -r(-> -t0) ^ 4C •1J» -rc o u^ X •rO

    PAGE 119

    113 C3 C3 < I— < O o ts I— < u ej <_) I Qi C O) ^ ^ (/) (TJ fO coo o r>. 1^ O CL Q. 0) o • • 0> (0 C o o +-> O. O Q. (J 3 o o. ca. o ^ (/) 4-> Q) 00 O c o CT) O •J.-(-> o O 00 +J C C 00 fO SX —I -t-> Q) (U 00 -M f a> ^ +-> o CT C •>!-> ,<4C r— 4(O 0) -r00 "O •t-) •MO S0) O) (U 1— s^ (U o ^ +-> +J 00 O o c Or" oo O •O 00 "O c -o o O) (U *4O -U O 2 (-> o +-> 4J c +-> r— Q> 00 <: 2 a. +-> 3 a> • Si «-> »-> 00 C >, 3 O) (-> •>-) E •.c sc o> m 00 o) «aQ) »-> 0) •-> (U S-D 3 +J •CT nj 00 •1^ cu U-t-> GQ

    PAGE 120

    CHAPTER 5 CONCLUSIONS The combined data of Southern and in situ hybridizations indicate that the clones isolated represent the entire set of Hsp70 and Hsp83 genes of the mosquito A. albimanus. The A. albimanus Hsp70 genes share many induction and organization characteristics with the Drosophila spp. homologues yet have important differences. This is observed particularly in the temperature at which induction is maximal, the diversity of the leader and promoter regions, and the quality and abundance of heat shock elements. A productive pursuit might be to determine whether the observed diversity results in a variety of temporal, tissue-specific, and heat-related transcription patterns. Such information could easily be obtained by taking advantage of the dissimilar leader sequences. The number and quality of HSE in the Hsp70 promoters suggest that they may provide superior expression of hybrid genes in mosquitos. However, whether the Hsp70 promoters will prove to be useful for genetic engineering will be determined only by testing hybrid genes in cultured cells or transformed insects. These analyses indicate that the A. albimanus and D. melanogaster Hsp70 genes are true homologues. The available evidence indicates that the A. albimanus genes are undergoing intrabut not interlocus gene 114

    PAGE 121

    115 conversion. The A. albimanus Hsp70 genes are more diverse than those of D. melanogaster although the general organization is similar to that of most Drosophila spp. The data collected here also provide an additional opportunity to test the gene conversion model of concerted evolution and have revealed a novel manifestation of high specificity in the extent. I have demonstrated that thermotolerance can be induced by heat shock. However, the temperature at which induction of the mosquito Hsp70 genes occurs suggests that they are not responsible for the induced thermotolerance observed in those experiments. This is consistent with observations that the small heat shock proteins are probably responsible for increased thermotolerance in D. melanogaster (Berger and Woodward, 1983). The preliminary information regarding the Hsp83 gene(s) indicate that this locus is more complex than that of D. melanogaster in that it contains two //sp83-similar sequences. It will be interesting to determine whether the mosquito gene contains introns and whether this affects the expression of this gene at high temperatures. The transcription data collected are very preliminary. However, the availability of the clones that I have isolated will allow further characterization with relatively little effort.

    PAGE 122

    REFERENCES CITED Alahiotis, S. N., & Stephanou, G. (1982). Temperature adaptation of Drosophila populations. The heat shock proteins system. Comparative Biochemistry and Physiology, 73B{3), 529-533. Amin, J., Ananthan, J., & Voellmy, R. (1988). Key features of heat shock regulatory elements. Molecular and Cellular Biology, 819), 3761-3769. ^ Artavanis-Tsakonas, S., Schedl , P., Mirault, M. -E., Moran, L., & Lis, J. (1979). Genes for the 70K dalton heat shock protein in two cloned D. melanogaster DNA segments. Cell, 17, 9-18. Ashburner, M., & Bonner, J. J. (1979). The induction of gene activity in Drosophila by heat shock. Cell, 17, 241-254. Atkinson, B. G., & Walden, D. B. (Eds.). (1985). Changes in eukaryotic gene expression in response to environmental stress. Orlando: Academic Press. Barettino, D., Morcillo, G., & Diez, J. -L. (1982). Induction of heat-shock Balbiani rings after RNA synthesis inhibition in polytene chromosomes of Chironomus thummi . Chromosoma, 87, 507-517 . Barnes, W. M., & Bevan M. (1983). Kilo-sequencing: An ordered strategy for rapid DNA sequence data acquisition. Nucleic Acids Research, 11, 349-368. Beckmann, R. P. Mizzen, L. A., & Welch, W. J. (1990). Interaction of Hsp70 with newly synthesized proteins: Implications for protein folding and assembly. Science, 248, 850-854. Bendena, W G-, Fini M. E., Garbe, J. C, Kidder, G. M., Lakhotia, S. C., & Pardue, M. L. (1989). Hsromega: A different sort of heat shock locus. In Pardue, M. L., Feramisco, J. R., & Lindquist, S. (tds.). Stress-induced proteins (pp. 3-14). New York: Alan R. Liss Inc. Benedict, M Q. Seawright, J. A., Anthony, E. W., & Avery, S. W. (1979) Ebony, a semidominant lethal mutant in the mosquito iTi^ft\^\il Inn""^^' ^^"^^'^^ ^our/7a7 of Genetics and Cytology, J^-'jV^J, 193-200. 116

    PAGE 123

    117 Berger, E. M. (1984). The regulation and function of small heat-shock protein synthesis. Developmental Genetics, 4, 255-265. Berger, E. M., Marino, G., & Torrey, D. (1985). Expression of Drosophila hsp70-CAT hybrid gene in Aedes cells induced by heat shock. Somatic Cell and Molecular Genetics, ii(4), 371-377. Berger, E. M., & Woodward, M. P. (1983). Small heat shock proteins in Drosophila may confer thermal tolerance. Experimental Cell Research, 147, 437-442. Bergh, S., & Arking, R. (1984). Developmental profile of the heat shock response in early embryos of Drosophila. The Journal of Experimental Zoology, 231, 379-391. Bienz, M. (1984). Xenopus hspJO genes are constitutively expressed in injected oocytes. The EMBO Journal, 3, 2477-2483. Bienz, M., & Pelham, H. R. B. (1987). Mechanisms of heat-shock gene activation in higher eukaryotes. Advances in Genetics, 24, 31-72. Biggin, M. D., & Tjian, R. (1988). Transcription factors that activate the Ultrabithorax promoter in developmental ly staged extracts. Cell, 53, 699-711. Birnboim, H. C, & Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant bacterial DNA. Nucleic Acids Research, 7, 1513. Birnstiel, M. L., Busslinger, M., & Stub, K. (1985). Transcription termination and 3' processing: The end is in site! Cell, 41, Bonner, J. J. (1981). Induction of Drosophila heat-shock puffs in isolated polytene nuclei. Developmental Biology, 86, 409-418. Bonner J J Parks, C, Parker-Thornburg, J., Mortin, M. A., & Pelham, H. R. B. (1984). The use of promoter fusions in Drosophila genetics: Isolation of mutations affecting the heat shock response. Cell, 37, 979-991. Bucher, P., & Trifonov, E. N. (1986). Compilation and analysis of ^'i/o^r*^'^ promoter sequences. Nucleic Acids Research, i4(24), 10009-10026. Bultmann, H. (1986a). Heat shock responses in polytene foot pad cells of Sarcophaga bullata. Chromosoma, 93, 347-357. Bultmann, H. (1986b). Induction of a heat shock puff by hypoxia in S3 358^66°^ ''^'^ chromosomes of Sarcophaga bullata. Chromosoma,

    PAGE 124

    118 Carvalho, M. G. C, & Rebello, M. A. (1987). Induction of heat shock proteins during the growth of Aedes albopictus cells. Insect Biochemistry, i7(l), 199-206. Carvalho, M. G. C. , & Freitas, M. S. (1988). Effect of continuous heat stress on cell growth and protein synthesis in Aedes albopictus. Journal of Cellular Physiology, 137, 455-461. Cavener, D. R. (1987). Comparison of the consensus flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Research, J5(4), 1353-1361. Cheng, M. Y., Hartl , F.-U., Martin, J., Pollock, R. A., Kalousek, F., Neupert, W., Hallberg, E. M., Hallberg, R. L., & Norwich, A. L. (1989). Mitochondrial heat-shock protein HSP60 is essential for assembly of proteins imported into yeast mitochondria. Nature, 337, 620-625. Chiang, H.-L., Terlecky, S. R., Plant, C. P., & Dice, J. F. (1989). A role for a 70-kilodalton heat shock protein in lysosomal degradation of intercellular proteins. Science, 246, 382-385. Cockburn, A. F., Howells, A. J., & Whitten, M. J. (1984). Recombinant DNA technology and genetic control of pest insects. Biotechnology and Genetic Engineering Reviews, 2, 69-99. Cockburn, A. F., & Seawright, J. A. (1988). Techniques for mitochondrial DNA analysis of anopheline mosquitoes. Journal of the American Mosquito Association, 2, 261-265. Compton, J. L., & McCarthy, B. J. (1978). Induction of the Drosophila heat shock response in isolated polytene nuclei. Cell, 14, 191-201. Corces, V., Pellicer, A., Axel, R., & Meselson, M. (1981). Integration, transcription, and control of a Drosophila heat shock gene in mouse cells. Proceedings of the National Academy of Sciences U.S.A., 78{n), 7083-7042. Corces, V., & Pellicer, A. (1984). Identification of sequences involved in the transcriptional control of a Drosophila heat-shock gene. The Journal of Biological Chemistry, 259 {22), 14812-14817. Craig, E. A. (1985). The heat shock response. CRC Critical Reviews in Biochemistry, 18{3), 239-280. Craig, E. A. Ingolia, T. D., & Manseau, L. J. (1983). Expression of Drosophila heat-shock cognate genes during heat shock and development. Developmental Biology, 99, 418-426. Devereux, J., Haeberli, P., & Smithies, 0. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research, 12{\), 387-395.

    PAGE 125

    119 DiNocera, P. P., & Dawid, I. B. (1983). Transient expression of genes introduced into cultured cells of Drosophila. Proceedings of the National Academy of Sciences U.S.A., 80, 7095-7098. Dudler, R., & Travers, A. A. (Sept. 1984). Upstream elements necessary for optimal function of the hsp70 promoter in transformed flies. Cell, 38, 391-398. Durbin, J. E., & Fallon, A. M. (1985). Transient expression of the chloramphenicol acetyl transferase gene in cultured mosquito cells. Gene, 36, 173-178. Fallon, A. M. (1986). Factors affecting polybrene-mediated transfection of cultured Aedes albopictus (mosquito) cells. Experimental Cell Research, 166{Z), 335-342. Fitch, W. M. (1977). On the problem of discovering the most parsimonious tree. American Naturalist, 111, 223-257. Fristensky, B., Lis, J., & Wu, R. (1984). Portable microcomputer software for nucleotide sequence analysis. Nucleic Acids Research, 10{ZO), 6451-6463. Gerenday, A., Park, Y. J., Lan, Q., & Fallon, A. M. (1989). Expression of a heat-inducible gene in transfected mosquito cells. Insect . Biochemistry, 19{7), 679-686. Gilmour, D. S., Thomas, G. H., & Elgin, S. C. R. (1989). Drosophila nuclear proteins bind to regions of alternating C and T residues in gene promoters. Science, 245, 1487-1490. Hackett, R. W., & Lis, J. T. (1983). Localization of the hsp83 transcript within a 3293 nucleotide sequence from the 63B heat shock locus of D. mel anogaster. Nucleic Acids Research, ii (20), 7011-7030. ' Hanahan, D. (1983). Studies on transformation of E.coli with plasmids. Journal of Molecular Biology, 166, 557-580. Hartl, F.-U., & Neupert, W. (1990). Protein sorting to mitochondria: Evolutionary conservations of folding and assembly. Science, 247, 930-938. Hiromi, Y., Okamoto, H., Gehring, W. J., & Hotta, Y. (1986). Germline transformation with Drosophila mutant actin genes induces constitutive expression of heat shock genes. Cell, 44, 293-301. Holmes, D. S., & Quigley, M. (1981). A rapid boiling method for the preparation of bacterial plasmids. Analytical Biochemistry, 114, Holmgren R Livak, K., Morimoto, R., Freund, R., & Meselson, M. (1979) Studies of cloned sequences from four Drosophila heat shock loci. Cell, 18, 1359-1370.

    PAGE 126

    120 Hovemann, B., Walldorf, U., & Ryseck, R.-P. (1986). Heat-shock locus 93D of Drosophila melanogaster: An RNA with limited coding capacity accumulates precursor transcripts after heat shock. Molecular and General Genetics, 204, 334-340. Hultmark, D., Klemenz, R., & Gehring, W. J. (1986). Translational and transcriptional control elements in the untranslated leader of the heat-shock gene hsp22. Cell, 44, 429-438. Hunt, C, & Morimoto, R. I. (1985). Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70. Proceedings of the National Academy of Sciences U.S.A., 82, 6455-6459. Ingolia, T. D., & Craig, E. A. (1982). Drosophila gene related to the major heat shockinduced gene is transcribed at normal temperatures and not induced by heat shock. Proceedings of the National Academy of Science U.S.A., 79, 525-529. Ingolia, T. D., Craig, E. A., & McCarthy, B. J. (1980). Sequence of three copies of the gene for the major Drosophila heat shock induced protein and their flanking regions. Cell, 21, 669-679. Ireland, R. C, Berger, E., Sirotkin, K., Yund, M. A., Osterbur, D., & Fristrom, J. (1982). Ecdysterone induces the transcription of four heat-shock genes in Drosophila S3 cells and imaginal discs. Developmental Biology, 93, 498-507. Ish-Horowicz, D., Holden, J. J., & Gehring, W. G. (1977). Deletions of two heat-activated loci in Drosophila melanogaster and their effects of heat-induced protein synthesis. Cell, 12, 643-652. Ish-Horowicz, D., & Pinchin, S. M. (1980). Genomic organization of the 87A7 and 87C1 heatinduced loci of Drosophila melanogaster. Journal of Molecular Biology, 142, 231-245. Ish-Horowicz, D., Pinchin, S. M., Schedl , P., Artavanis-Tsakonas, & Mirault, M. -E. (1979). Genetic and molecular analysis of the 87A7 and 87C1 heat-inducible loci of D. melanogaster. Cell, 18, 1351-1358. Johnson-Schlitz, D., & Lim, J. K. (1987). Cytogenetics of notch mutations arising in the unstable X chromosome Uc of Drosophila melanogaster. Genetics, 115, 701-709. Karch, P., Torok, I., & Tissieres, A. (1981). Extensive regions of homology in front of the two hsp70 heat shock variant genes in Drosophila melanogaster. Journal of Molecular Biology, 148, 219-230.

    PAGE 127

    121 Kay, R. J., Boissy, R. J., Russnak, R. H., & Candido, E. P. M. (1986). Efficient transcription of a Caenorhabditis elegans heat shock gene pair in mouse fibroblasts is dependent on multiple promoter elements which can function bidirectionally. Molecular and Cellular Biology, 6(9), 3134-3143. Keppler, W. J., Kitzmiller, J. B., & Rabbani, M. G. (1973). The salivary gland chromosomes of Anopheles albimanus. Mosquito News, 33, 42-49. Kirschbaum, J. B. (1985). Potential implication of genetic engineering and other biotechnologies to insect control. Annual Review of Entomology, 30, 51-70. Klemenz, R., Hultmark, D., & Gehring, W. J. (1985). Selective translation of heat shock mRNA in Drosophila mel anogaster depends on sequence information in the leader. The EMBO Journal, 4{B), 2053-2060. Kraus, K. W., Lee, Y., Lis, J. T., & Wolfner, M. F. (1988). Sex-specific control of Drosophila mel anogaster yolk protein 1 gene expression is limited to transcription. Molecular and Cellular Biology, 8(11), 4756-4764. Kusukawa, N., & Yura, T. (1988). Heat shock protein groE of E.coli: Key protective roles against thermal stress. Genes and Development, 2, 874-882. Leigh-Brown, A. J., & Ish-Horowicz, D. (1981). Evolution of the 87C and 87C heat-shock loci in Drosophila. Nature, 290, 677-682. Lindquist, S. (1980). Varying patterns of protein synthesis in Drosophila during heat shock: Implications for regulation. Developmental Biology, 77, 463-479. Lindquist, S. (1986). The heat-shock response. Annual Review of Biochemistry, 55, 1151-1191. Lindquist, S., & Craig, E. A. (1988). The heat-shock proteins. Annual Review of Genetics, 22, 631-677. Lis, J. T., Simon, J. A., & Sutton, C. A. (1983). New heat shock puffs and beta-galactosidase activity resulting from transformation of Drosophila with an Hsp70-lacZ hybrid gene. Cell, 35, 403-410. Maizel, J. V., & Lenk, R. P. (1981). Enhanced graphic matrix analysis of nucleic acid and protein sequences. Proceedings of the National Academy of Sciences U.S.A., 75(12), 7665-7669. Maniatis, T., Fritsch, E. F., & Sambrook, J. (Eds.). (1982). Molecular cloning: A laboratory manual . U.S.A.: Cold Spring Harbor Laboratory.

    PAGE 128

    122 Maroto, F. G., & Sierra, J. M. (1988). Translational control in heat -shocked Drosophila embryos. The Journal of Biological Chemistry, 263(30), 15720-15725. Mason, P. J., Hall, M. C, & Gausz, J. (1984). The expression of heat shock genes during normal development in Drosophila mel anogaster . Molecular and General Genetics, 194, 73-78. Mason, P. J., Torok, E., Kiss, I., Karch, F., & Udvardy, A. (1982). Evolutionary implications of a complex pattern of DNA sequence homology extending far upstream of the hsp70 genes at loci 87a7 and 87cl in Drosophila mel anogaster. Journal of Molecular Biology, 156, 21-35. McAlister, L., & Finkelstein, D. B. (1980). Heat shock proteins and thermal resistance in yeast. Biochemical and Biophysical Research Communications, 93(3), 819-824. McGarry, T. J., & Lindquist, S. (1985). The preferential translation of Drosophila HSP70 mRNA requires sequences in the untranslated leader. Cell, 42, 903-911. McGrane, V., Carlson, J. 0., Miller, B. R., & Beaty, B. J. (1988). Microinjection of DNA into Aedes triseriatus ova and detection of integration. American Journal of Tropical Medicine and Hygiene, 39(5), 502-510. McMahon, A. P., Novak, T. J., Britten, R. J., & Davidson, E. H. (1984). Inducible expression of a cloned heat shock fusion gene in sea urchin embryos. Proceedings of the National Academy of Sciences U.S.A., 81, 7490-7494. Miller, L. H., Sakai, R. K., Romans, P., Gwadz, R. W., Kantoff, P., & Coon, H. G. (1987). Stable integration and expression of a bacterial gene in the mosquito Anopheles gambiae. Science, 237, 779-781. Mirault, M.-E., Goldschmidt-Clermont, M., Artavanis-Tsakonas, S., & Schedl, P. (1979). Organization of the multiple genes for the 70,000-dalton heat-shock protein in Drosophila mel anogaster . Genetics, 76(10), 5254-5258. Moran, L., Mirault, M.-E., Tissieres, A., Schedl, P. , Artavanis-Tsakonas, S., & Gehring, W. J. (1979). Physical map of two D. melanogaster DNA segments containing sequences coding for the 70,000 dalton heat shock protein. Cell, 17, 1-8. Morganelli, C. M., Berger, E. M., & Pelham, H. R. B. (1985). Transcription of Drosophila small hsp-tk hybrid genes is induced by heat shock and by ecdysterone in transfected Drosophila cells. Proceedings of the National Academy of Sciences U.S.A., 82, 5865-5869.

    PAGE 129

    123 Morimoto, R. I., Hunt, C, Huang, S.-Y., Berg, K. L., & Banerji, S. S. (1986). Organization, nucleotide sequence and transcription of the chicken HSP70 gene. Journal of Biological Chemistry, 261, 12692-12699. Morris, A. C, Eggleston, P., & Cratnpton, J. M. (1989). Genetic transformation of the mosquito Aedes aegypti by microinjection of DNA. Medical and Veterinary Entomology, 3, 1-7. Narang, S. J., Seawright, J. A., & Benedict, M. Q. (1985). Analysis of Southern blot hybridization profiles of heat shock genes from genomic digests of Anopheles albimanus (Dipterarcul icidae) . Genetics, 110, s97. Nath, B. B., & Lakhotia, S. C. (1989). Heat-shock response in a tropical Chironomus: Seasonal variation in response and the effect of developmental stage and tissue type on heat shock protein synthesis. Genome, 32(4), 676-686. Mover, L. (Ed.). (1984). The heat shock response of eukaryotic cells. New York: Springer-Verl ag Ostermann, J., Horwich, A. L., Neupert, W., & Hartl , F. U. (1989). Protein folding in mitochondria requires complex formation with HSP60 and ATP hydrolysis. Nature, 341, 125-130. Pardue, M. L. (1988). The heat shock response in biology and human disease: A meeting review. Genes and Development, 2, 783-785. Pardue, M. L., Feramisco, J. R., & Lindquist, S. (Eds.). (1989). Stress-induced proteins. New York: Alan R. Liss, Inc. Parker, C. S., & Topol, J. (1984). A Drosophila RNA polymerase II transcription factor binds to the regulatory site of an HSP70 gene. Cell, 37, 273-283. Parker-Thornburg, J., & Bonner, J. J. (1987). Mutations that induce the heat shock response of Drosophila. Cell , 51, 763-772. Pelham, H. R. B. (1982). A regulatory upstream promoter element in the Drosophila HSP70 heat -shock gene. Cell, 30, 517-528. Pelham, H. (1985). Activation of heat-shock genes in eukaryotes. Trends in Genetics, 1, 31-35. Perisic, 0., Xiao, H., & Lis, J. T. (1989). Stable binding of Drosophila heat shock factor to head-to-head and tail -to-tail repeats of a conserved 5 bp recognition unit. Cell, 59, 797-806. Phillips, G. J., & Silhavy, T. J. (1990). Heat-shock proteins DnaK and GroEL facilitate export of LacZ hybrid proteins in E. coli. Nature, 344, 882-884.

    PAGE 130

    124 Rao, P. N., & Rai, K. S. (1987). Comparative karyotypes and chromosomal evolution in some genera of nematocerous (Diptera: Nematocera) families. Annals of the Entomological Society of America, 80(3) 322-332. Ritossa, F. (1962). A new puffing pattern induced by temperature shock and DNP in Drosophila. Experientia, J8(12), 571-573. Rubin, G. M., & Spradling, A. C. (1982). Genetic transformation of Drosophila with transposable element vectors. Science, 218, 348-353. Sanger, F., Nicklen, S., & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences U.S.A., 74, 5463-5467. Schlesinger, M. J., Ashburner, M., & Tissieres, A. (Eds.). (1982). Heat shock from bacteria to man. U.S.A.: Cold Spring Harbor Laboratory Shuey, D. J., & Parker, C. S. (1986). Binding of Drosophila heat-shock gene transcription factor to the hsp70 promoter: Evidence for symmetric and dynamic interactions. The Journal of Biological Chemistry, 261 {17), 7934-7940. Simon, J. A., & Lis, J. T. (1987). A germline transformation analysis reveals flexibility in the organization of heat shock consensus elements. Nucleic Acids Research, 15{7), 2971-2988. Singh, A. K., & Lakhotia, S. C. (1988). Effect of low-temperature rearing on heat shock protein synthesis and heat sensitivity in Drosophila mel anogaster . Developmental Genetics, 9, 193-201. Snutch, T. P., Heschl, M. F. P., & Baillie, D. L. (1988). The Caenorhabditis elegans hspJO gene family: A molecular genetic characterization. Gene, 64, 241-255. Sorger, P. K., & Pel ham, H. R. B. (1988). Yeast heat shock factor is an essential DNA-binding protein that exhibits temperature-dependent phosphorylation. Cell, 54, 855-864. Spadoro, J. P., Copertino, D. W., & Stausbaugh, L. D. (1986). Differential expression of histone sequences in Drosophila following heat shock. Developmental Genetics, 7, 133-148. Stephanou, G. (1987). On the control of heat shock protein synthesis in Drosophila melanogaster and Ceratitis capitata. Insect Biochemistry, i7(4), 597-602. Stephanou, G., Alahiotis, S. N., Christodoulou, C, & Marmaras, V. J. (1983a). Adaptation of Drosophila to temperature: Heat-shock proteins and survival in Drosophila melanogaster. Developmental Genetics, 34, 299-308.

    PAGE 131

    Stephanou, G., S. N. Alahiotis, Marmaras, V. J., & Christodoulou, C. (1983b). Heat shock response in Ceratitis capitata. Comparative Biochemistry and Physiology, 74B{3), 425-432. Storti, R. v., Scott, M. P., Rich, A., & Pardue, M. L. (1980). Translational control of protein synthesis in response to heat shock in D. melanogaster cells. Cell, 22, 825-834. Swofford, D. L., & Maddison, W. P. (1987). Reconstructing ancestral character states under Wagner parsimony. Mathematical Biosciences, 87, 199-229. Tabor, S, & Richardson, C. C. (1989). Effect of manganese ions on the incorporation of dideoxynucleotides by bacteriophage T7 DNA polymerase and Escherichia coli DNA polymerase I. Proceedings of the National Academy of Sciences U.S.A., 80, 4076-4080. Tatem, J., & Stollar, V. (1989). Effect of sindbis virus infection on induction of heat shock proteins in Aedes albopictus cells. Journal of Virology, 63(2), 992-996. Tissieres, A., Mitchell, H. K., & Tracy, U. M. (1974). Protein synthesis in salivary glands of Drosophila melanogaster: Relation to chromosome puffs. Journal of Molecular Biology, 84, 389-398. Torok, I., & Karch, F. (1980). Nucleotide sequences of heat shock activated genes in Drosophila mel anogaster. I. Sequences in the regions of the 5' and 3' ends of the hspJO genes in the hybrid plasmid 56H8. Nucleic Acids Research, 8(14), 3105-3123. Vincent, M., & Tanguay, R. M. (1979). Heat-shock induced proteins present in the cell nucleus of Chironomus tentans salivary gland. Nature, 281, 501-503. Xiao, H., & Lis, J. T. (1988). Germline transformation used to define key features of heat-shock response elements. Science, 239, 1139-1142. Xiao, H., & Lis, J. T. (1989). Heat shock and developmental regulation of the Drosophila melanogaster hsp83 gene. Molecular and Cellular Biology, 5(4), 1746-1753. Yost, H. J., & Lindquist, S. (1986). RNA splicing is interrupted by heat shock and is rescued by heat shock protein synthesis. Cell, 45, 185-193. Zimarino, V., & Wu, C. (1987). Induction of sequence-specific binding of Drosophila heat shock activator protein without protein synthesis. Nature, 327, 727-730.

    PAGE 132

    Zuker, C, Cappello, J., Lodish, H. F., George, P., & Chung, S. (1984). Dictyostelium transposable element DIRS-1 has 350-base-pair inverted terminal repeats that contain a heat shock promoter. Proceedings of the National Academy of Sciences U.S.A., 81, 2660-2664.

    PAGE 133

    BIOGRAPHICAL SKETCH I was born in Cushing, Oklahoma, December 30, 1951. After spending three years there, and two in El Dorado, Kansas, I moved with my family of seven to Hattiesburg, Mississippi. I received my highschool diploma there in 1969. For the next 3 V2 years, I attended the University of Southern Mississippi, during which time I was married. In 1973, my family relocated to Gainesville, Florida, where I attended the University of Florida. I received a B.S. in 1975 with a major in zoology, emphasizing invertebrates. For the next 10 years, I was employed as a research technician at the USDA Insects Affecting Man and Animals Research Laboratory in Gainesville. My responsibilities were related to the genetics of anopheline mosquitos. In 1986, while still employed by USDA, I began my doctoral research program on the heat-shock genes of the mosquito A. albimanus. My current plans are to continue my education in a post-doctoral appointment at the Center for Insect Science in Tucson, Arizona. 127

    PAGE 134

    J I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. ack A. SeawrightT Professor of Entomology a Nematology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. 'ArlTdrew F. Cockburn Assistant Professor of Entomology and Nematology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. H. Glenn Hall Assistant Professor of Entomology and Nematology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Carmine A. Lanciani Professor of Zoology This dissertation was submitted to the Graduate Faculty of the College of Agriculture and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. August, 1990 <. c7>*^ Dean, -College of AgricwTJiljre Dean, Graduate School


    xml version 1.0 encoding UTF-8
    REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
    INGEST IEID ECRCUE2HY_ZKRIKN INGEST_TIME 2015-04-13T20:40:48Z PACKAGE AA00029888_00001
    AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
    FILES