Citation
Comparative analysis of microsporidia of fire ants, Solenopsis richteri and S. invicta

Material Information

Title:
Comparative analysis of microsporidia of fire ants, Solenopsis richteri and S. invicta
Creator:
Moser, Bettina Angela, 1961-
Publication Date:
Language:
English
Physical Description:
xiv, 126 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
DNA ( jstor )
Fatty acids ( jstor )
Fire ants ( jstor )
Gels ( jstor )
Microsporidia ( jstor )
Polymerase chain reaction ( jstor )
rRNA genes ( jstor )
Sequencing ( jstor )
Species ( jstor )
Thelohania ( jstor )
Dissertations, Academic -- Entomology and Nematology -- UF
Entomology and Nematology thesis, Ph. D
Solenopsis invicta -- Physiology ( lcsh )
Solenopsis richteri -- Physiology ( lcsh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1995.
Bibliography:
Includes bibliographical references (leaves 112-125).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Bettina A. Moser.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
022272933 ( ALEPH )
34345360 ( OCLC )

Downloads

This item has the following downloads:


Full Text












COMPARATIVE ANALYSIS OF MICROSPORIDIA OF FIRE ANTS, SOLENOPSIS RICHTERI AND S. INVICTA















By


BETTINA A. MOSER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA 1995


UN! VRSITY OF FLORLDA LIBRARIES




























To my dear family and friends




























Iucundi Acti Labores



























0 Son of Spirit!

My first counsel is this: Possess a pure, kindly and radiant heart, that thine may be a

sovereignty ancient, imperishable

and everlasting.


Bahd'u'lUdh The Hidden Words



























Go to the ant, thou sluggard; consider her way and be wise:

Which having no guide, overseer, or ruler,

Provideth her meat in the summer,

And gathereth her food in the harvest.


The Holy Bible

Proverbs 6,6
















ACKNOWLEDGMENTS


I wish to thank the members of my supervisory committee, Drs. John Gander, James Kimbrough, Philip Koehler, and James Maruniak, for their guidance and advice throughout the course of my degree program. I am especially indebted to my chairman, Dr. Richard Patterson, and cochairman, Dr. James Becnel, for their continued assistance and support. I was the last student of Dr. Patterson and the first student of Dr. Becnel. Drs. Becnel, Maruniak, and Patterson graciously provided me with laboratory space and equipment to conduct my research. Sincere appreciation is due to Dr. James Nation, Nancy Hodge, and David Milne who kindly shared their knowledge on gaschromatographic techniques.

I will always remember the friendship and stimulating conversations with fellow students and researchers Jaw-Ching Liu, Rejane Moares, Alejandra Garcia-Canedo, and Dr. Ayyamperumal Jeyaprakash. I also want to thank all my other friends inside and outside the department for the good times and moral support. Warm thanks go to Myrna Litchfield, who ceaselessly helped with bureaucratic paper work. I am very grateful to my family, who provided never-failing support.

I have deep appreciation for the many pleasant things in Gainesville which made my stay enjoyable and gave me strength to carry on. I have everlasting memories of the beautiful sun, springs, and trees. The ultimate source of strength, perseverance, and courage, however, I derive from my faith in God.


V










TABLE OF CONTENT



ACKNOWLEDGMENTS ...................................................................................... v

LIST OF TABLES.............................................. viii

LIST OF FIGURES ............................................................................ ..........-. IX

LIST OF ABBREVIATIONS.............................................................................. .. xi

ABSTRACT ...................................................................................... ........Xiii

CHAPTER

I TAXONOMIC PROBLEMS OF FIRE ANT MICROSPORIDIA

Synopsis.............................................................................................. 1

II MORPHOLOGICAL CHARACTERIZATION OF MICROSPORIDIA
FROM SOLENOPSIS INVICTA AND S. RICHTERI

Introduction ...................................................................................... .4
Materials and Methods ........................................................................ 9
R esults ............................................................................................. . 12
D iscussion ........................................................................................... 26

III FATTY ACID METHYL ESTER ANALYSIS IN MICROSPORIDIA:
EVALUATION OF A NEW TOOL FOR IDENTIFICATION

Introduction ......................................................................................... 30
Materials and Methods ........................................................................ 34
R esults .............................................................................................. 38
D iscussion .......................................................................................... 41

IV COMPARATIVE MOLECULAR CHARACTERIZATION OF
MICROSPORIDIA FROM SOUTH AMERICAN FIRE ANTS

Introduction ........................................................................................ 49
Materials and Methods ....................................................................... 54
R esults .............................................................................................. 66
D iscussion .......................................................................................... 82


Ai









V SUMMARY AND DIRECTION OF FUTURE RESEARCH

Synopsis.............................................................................................. 93

APPEND IX .................................................................................................................. 95

REFEREN CES ........................................................................................................... 112

BIOG RA PHICA L SK ETCH ...................................................................................... 126


vii

















LIST OF TABLES

Table pRgM

3.1. Fatty acids (%) in three microsporidian species from one aquatic and two terrestrial insect hosts ...............................................................................40

4.1. List of sequencing primers used...................................................................... 63

4.2. Pairwise distances between taxa ..................................................................... 83


viii

















LIST OF FIGURES


Figure pge

2.1. Gas chromatograph traces of 5. invicta and S. richteri hydrocarbons .............. 13

2.2. Light micrograph of dissected S. richteri gaster with spore cysts of Vairimorpha sp. and Thelohania sp. x18 ........................................................ 15

2.3. Light micrograph of dissected 5. richteri gaster with spore cysts of Vairimorpha sp. and Thelohanih sp. x46........................................................ 15

2.4. Light micrograph of Thelohania sp. partial cyst with meiospores and free
spores. x750................................................................................................. 17

2.5. Light micrograph of Vairimorpha sp. cyst with free spores and meiospores.
x2 10 ................................................................................................................... 19

2.6. Light micrograph of Vairimorpha sp. cyst with free spores and meiospores.
x750...................................................................................................................19

2.7. Light micrograph of meiospore octets of Thelohania sp. and Vairimorpha sp.
x7 50 ...................................................................................................................2 0

2.8. Light micrograph of Thelohania sp. and Vairimorpha sp. free spores and
m eiospores. x750 .......................................................................................... 20

2.9. Electron micrograph of Thelohania sp. meiospore. x37,500 ...........................22

2.10. Electron micrograph of Thelohania sp. spore wall and polar filament.
x 150,000 ...................................................................................................... . 22

2.11. Electron micrograph of T. solenopsae meiospore. x37,500 ............................22

2.12. Electron micrograph of T. solenopsae spore wall and polar filament.
x150,000........................................................................................................ 22

2.13. Electron micrograph of Thelohania sp. free spore. x30,000........................... 23


ix











2.14. Electron micrograph of Vairimorph sp. meiospore. x18,000......................... 25

2.15. Electron micrograph of Vairimorpha sp. meiospore spore wall and polar
filam ent. x120,000......................................................................................... 25

3.1. Gas chromatograms of FAME standards. .......................................................42

3.2. FAME chromatograms of Thelohania sp. and V. necatrix ............................... 43

3.3. FAME chromatograms of N. alger in two different insect hosts................... 44

3.4. Three major fatty acids of three species of microsporidia................................ 45

4.1. PCR products of the 16S rRNA gene of four microsporidian species ..............68

4.2. Cloned pTZ 19R Construct ............................................................................. 69

4.3. Restriction profiles of 16S rRNA gene PCR products of three microsporidian
species. ......................................................................................................... 70

4.4. Multiple sequence alignment of the rRNA gene sequences of 19 species of
m icrosporidia................................................................................................. 72

4.5. Phylogenetic tree (3,511 steps) of the 19 species of microsporidia with
Q lam blia as the outgroup............................................................................. 84

4.6. Bootstrap analysis (100 replicates) of the phylogenetic tree. ...........................85


x















LIST OF ABBREVIATIONS


ASP Ammonium persulfate

BSA Bovine serum albumine

Clustal Software program for multiple alignment of sequences

DNA Deoxyribonucleic acid

EDTA Ethylenediaminetetraacetate

FAME Fatty acid methyl ester

GAP Software program to make optimal alignment between two sequences by
inserting gaps to maximize the number of matches GC Gas chromatography

GCG Genetics Computer Group

GC-MS Gas chromatography- mass spectrometry

GTE Glucose,Tris, EDTA buffer

LB Luria-Bertani

MAP Software program to display both strands of a DNA sequence with a
restriction map shown above the sequence MIDI Microbial ID Inc.

MIS Microbial Identification System

PAUP Phylogenetic analysis using parsimony

PCR Polymerase chain reaction

PEG Polyethyleneglycol

PileUp Software program for multiple alignment of sequences

pTZ 19R Bacterial plasmid

RFLP Restriction fragment length polymorphism


xi









rDNA RNA rRNA tRNA SDS S.O.C.

SSC STE TAE

TB TBE TE

TEM TEMED

Tris USDA-ARS

X-Gal


ribosomal RNA gene Ribonucleic acid ribosomal RNA transfer RNA Sodium dodecyl sulfate Superoptimal catabolite (bacterial medium) Standard saline citrate Sodium chloride, Tris, EDTA buffer Tris-acetate, EDTA buffer Terrific broth Tris-borate, EDTA buffer Tris, EDTA buffer Transmission electron microscopy N, N, N', N' tetramethylethylenediamine Tris(hydroxymethyl)aminomethane United States Department of Agriculture-Animal Research Service 5-Bromo-4-chloro-3-indolyl- -D-galactoside


xii















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy


COMPARATIVE ANALYSIS OF MICROSPORIDIA OF FIRE ANTS, SOLENOPSIS RICHTERI AND S. INVICTA

By

Bettina A. Moser

December, 1995

Chairman: Dr. Richard S. Patterson
Major Department: Entomology and Nematology

Two dimorphic microsporidia, Thelohania sp. and Vairimorpha sp., occur

simultaneously in the black imported fire ant, Solenopsis richteri, in parts of Argentina and are considered as biological control agents of S. invicta in the United States. On the lightmicroscopic level, they are indistinguishable from T. solenopsae and V. invictae, described from Brazilian S. invicta. Two questions arise: Are Vairimorpha sp. and Thelohania sp. different phenotypes of the same species? Are Thelohania sp. and Vairimorpha sp. conspecific with T. solenopsae and V. invictae, respectively?

Morphological analysis revealed that spore dimensions and ultrastructures of Thelohani sp. and Vairimorpha sp. are comparable to those of I. solenopsae and Y. invictae, respectively. The application of FAME profiles for the identification of microsporidia was assessed for the first time, using spores of Thelohania sp., Nosema algere, and Vairimorpha necatrix. Even though the three species had qualitatively and quantitatively different FAME profiles, this method was unsuitable for characterization of


xiii










the remaining fire ant microsporidia because of (1) influence of host insect on FAME profile and (2) requirement of large sample sizes (lxi09 spores) for FAME analysis.

PCR products of the 16S rRNA gene of Thelohani sp. and T. solenopsae were the same at 1,400 bp as compared to that of Vairimorpha sp. at ~ 1,300 bp. Y. invictae could not be included in the genotypic analysis because of sample size limitations. Restriction analysis of the PCR products with several enzymes differentiated Vairimorpha sp. from Thelohania sp. and T. solenopsae which were not separable from each other. Sequence analysis of the 16S rRNA gene of I. solenopsa Thelohani sp., and Vairimorpha sp. showed that the two Thelohania species have a very high sequence similarity amongst each other (> 99%). Vairimorph sp. has a 63% sequence similarity with T. solenopsae and Thelohania sp.

In conclusion, the available phenotypic and genotypic data support the hypothesis that Thelohania sp. and Vairimorpha sp. are not different phenotypes of the same species but separate species. Thelohani sp. and T. solenopsae appear to be conspecific and probably represent two subspecies. V. invictae and Vairimorpha sp. appear indistinguishable morphologically but await genotypic analysis.


xiv















CHAPTER I
TAXONOMIC PROBLEMS OF FIRE ANT MICROSPORIDIA


Synlopsis

The red imported fire ant, Solenopsis invicta, is a major agricultural and urban pest in the southeastern United States (Stimac and Alves 1994; Patterson 1990; Adams 1986). Despite extensive primarily chemical control efforts, it is firmly established in the southeastern United States (Stimac and Alves 1994). Nest density of red imported fire ants is much higher in the United States than in its native South America, and S. invicta constitutes a much larger fraction of the ant community in the US than in South America (Porter et al. 1992). The very successful colonization of the southeastern US by S. invicta may be in part attributed to the fact that it faces virtually no natural biological control in the US (Buren et al. 1978, 1983). Natural enemies of fire ants are extremely rare in the US but abundant in South America (Jouvenaz 1983; Stimac and Alves 1994).

In an effort to find a good biological control agent for S. invicta in the US, several surveys for natural enemies have been conducted in South America (summarized by Jouvenaz 1983; Stimac and Alves 1994). The microsporidium Thelohania solenopsae is the first specific pathogen described from the red imported fire ant, S. invica in Brazil (Allen and Buren 1974). Subsequently, another microsporidium, Vairimorpha invictae, was detected in S. invicta in Brazil (Jouvenaz and Ellis 1986). Briano (1993) reported a high incidence of infection of the black imported fire ant S. richteri from Argentina with T. solenopsae-like and V. invictae-like microsporidia, hereforth called Thelohania sp. and Vairimorpha sp. Thelohania sp. and Vairimorpha sp. may occur in dual infections in the


1






2


same individual ant. The infections appear to weaken the ant colonies and reduce total numbers of ants significantly (Briano 1993; R.S. Patterson, personal communication).

Solenopsis richteri and S. invicta were considered to be different color morphs of one species, S. saevissima richteri Forel (Wilson 1951) until Buren (1972) described invic, and 5. richteri as separate species. Solenopsis invicta interbreeds successfully with S. richteri in areas of the US where their ranges overlap, and taxonomy of the two ant species is still not resolved (Vander Meer and Lofgren 1986). The microsporidia found in the Argentinean S. richteri could be introduced into the US as biological control agents after several taxonomic and ecological studies are completed.

The research presented here will address the following taxonomic questions: Are Thelohania sp. and Vairimorpha sp. two different phenotypes of the same species or are they indeed different species? Are T. solenopsae and Thelohania sp. and V. invicta and Vairimorpha sp., respectively, conspecific or are they separate species?

Traditionally, microsporidian taxonomy and classification has been based on spore morphology, life cycles and host specificities. Characterization based solely upon simple morphology can result in misleading classification, because spores of different microsporidian species may appear to be phenotypically identical. For example, two species of microsporidia, Encephalitozoon hellem and E. cuniculi, isolated from AIDS patients, can be differentiated using biochemical and immunological tests, but not by fine structure or development (Didier et al. 1991). Furthermore, one species may have several different spore phenotypes, depending on host and life stage. Microsporidia requiring an intermediate host express distinct spore phenotypes in the intermediate and definite hosts (Andreadis 1985; Becnel 1992; Sweeney et al. 1985), whereas those which develop in only one host may also be heterosporous (Becnel et al. 1989). Environmental factors, such as temperature, can affect the expression of different spore phenotypes (Jouvenaz and Lofgren 1984). Incomplete understanding of the often complex life cycles involving






3


several hosts, and spore types, also hampers experimental transmission of many species in the laboratory.

Molecular techniques, including polymerase chain reaction (PCR), restriction

fragment length polymorphism (RFLP), and sequence alignment of the small 16S rRNA subunit, are being developed for microsporidian species identification and phylogenetic construction (Baker et al. 1995, Baker et al. 1994; Weiss et al. 1994; Vossbrinck et al. 1993). Additional methodologies, including spore protein profiles (Didier et al. 1991; Irby et al. 1986; Jahn et al. 1986; Langley et al. 1987; Street 1976), serological assays (Canning 1988; Didier et al. 1991; Niederkorn et al. 1980; Oien and Ragsdale 1992), and flow cytometry (Amigo et al.1994) have been used to aid in classification, although to a limited extent.

In this study, a multiphasic approach was used to compare the micrososporidia from S. richteri to each other and to those from S. invicta. Methods used included light microscopic and ultrastructural observations of the spores (chapter II), and amplification, sequencing, and sequence comparison of the 16S rRNA genes (chapter IV). In addition, the use of spore fatty acid profiles was investigated for the first time as a character in identification (chapter III).















CHAPTER II
MORPHOLOGICAL CHARACTERIZATION OF MICROSPORIDIA FROM SOLENOPSIS INVICTA AND S. RICHTERI


Introduction


Fire ants belong to the genus Solenopsis. Six species -- four native and two

introduced -- and two hybrids occur in North America. Solenopsis geminata (Fabricius), S. xyloni (MacCook), S. amblychila Wheeler, and S. aurea Wheeler are native species and found in the southern states (Trager 1991). As indicated in their names, the black imported fire ant, 5. richteri Forel, and red imported fire ant, S. invicta Buren, are not native to this country but were introduced from South America. Two hybrid forms, S. xyloni x geminata and S. richteri x invicta, occur as well in the United States (Trager 1991).

Solenopsis invicta is common in the southwestern region of Brazil (Pantanal, a large flood plain of the head waters of the Paraguay river) westward through Rhondonia and southward along the Paraguay River through Bolivia to the northern border of Argentina with Paraguay and Uruguay (Buren et al. 1974). Solenopsis richteri is prevalent in the more temperate southern states of Brazil, Uruguay and Argentina. Lofgren (1986) summarizes in great detail the early history of imported fire ants in the United States. Briefly, S. richteri was introduced into Mobile, Alabama, around 1918 (Creighton 1930) and is now established in areas of northeastern Mississippi and northwestern Alabama. The red imported fire ant, S. invicta, reached Mobile, Alabama, in the 1940s (Wilson and Eads 1949) and subsequently spread throughout the southeastern states displacing a. richte everywhere except in pockets of northeastern Mississippi and northwestern Alabama. Originally, a. invicta and a. richteri were considered different color morphs of


4






5


the same species, S. saevissima richteri Forel (Wilson 1951). Buren (1972) was the first one to describe S. invicta as a separate species. S. invicta and S. richteri interbreed in areas of Alabama, Mississippi, and Georgia where their ranges overlap (Ross et al. 1987; Vander Meer and Lofgren 1988). Since the two species mate and are successful at producing viable hybrids, the validity of S. invicta as a separate species is questionable but recognized as such until further investigations (Vander Meer and Lofgren 1988). Imported fire ants are considered agricultural and urban pests in the United States and represent a human health risk. They are generally no problem in South America (Stimac and Alves 1994; Patterson 1993; Adams 1986).

Imported fire ant populations occur at relatively low levels in their South American homelands. Fire ant mound densities are much higher in the US than in Brazil, and fire ants constitute a much larger fraction of the ant community in the US (Porter et al. 1992). Reasons for this could be lack of predators, pathogens, and competitors of imported fire ants in the US (Buren et al. 1978; 1983). Stimac and Alves (1994) present a summary on red imported fire ant ecology in their homelands and the US. Further summaries can be found in Lofgren and Vander Meer's book on fire ants and leaf-cutting ants (1986).

Only a few surveys for pathogens of fire ants in the United States have been

conducted. Jouvenaz et al. (1977) have used a screening method sufficiently sensitive to detect low levels of microsporidian and fungal infections but not bacteria and viruses. They find no pathogens in S. richteri; in 5. invica they detect very low levels of a benign, unidentified yeast infection, and only 1 in 1007 colonies has an unidentified microsporidian disease. This microsporidium is found in low levels in S. geminata (Fabricius) colonies. Subsequently, Jouvenaz and Hazard (1978) described Bureneila dimorpha a new microsporidian genus and species, from S. geminata and created a new family. Beckham and Bilimoria (1982) examined samples of 113 ant species including S. invicta from western Texas for the presence of fungi, occluded viruses, microsporidia, and nematodes and found resting spores of Entomophthora sp. on only one specimen of Pheidole






6


bicarina vinelandica Forel. No parasites or pathogens are found in fire ants. Jouvenaz and Kimbrough (1991) described an endoparasitic fungus, Myrmecomyces amellisa gen.nov., sp. nov., from Solenopsis quincecuspis Forel, collected in Buenos Aires Province, Argentina, and 5. invicta, collected in Florida. Gross pathology, histopathology, or changes in host behavior are not observed but parasitized hosts appear to succumb more readily to stress. Two fungi, Conidiobolus sp. and Metarhizium anisopliae, were observed by Sanchez-Pefia and Thorvilson (1992) on S. invicta queens collected in Texas. Of the adult queens and workers, and worker larvae assayed against conidial showers of Conidiobolus sp., only the worker larvae die. Metarhizium anisopliae kills challenged alate workers.

The sparse occurrence of natural enemies of imported fire ants in the United States is a good example of the introduction of an insect into another country without its predators, parasites and pathogens. A parallel situation occurred with the gypsy moth, Lymantria dispar. This insect was introduced into the United States from Europe where it has numerous natural enemies which are lacking in the United States (Howard and Fiske 1911). With regard to pathogens, one major group of pathogens, the microsporidia, have been identified as significant mortality factors in Eurasian gypsy moth populations but they have not been recorded from gypsy moths in North America (Jeffords et al. 1989). Microsporidia isolated from European L. dispar are evaluated as biocontrol agents for the US populations (Maddox et al. 1992).

Numerous reports on natural enemies of S. richteri and S. invicta in their

homelands Argentina, Brazil, and Uruguay include microsporidia, fungi, nematodes, parasitic wasps and flies and are summarized by Stimac and Alves (1993) and Jouvenaz (1983). Documented parasites include Orasema wasps (Heraty et al. 1993), the straw itch mite Pyemotes tritici (Thorvilson et al. 1987), an unidentified phorid fly (Wojcik et al. 1987), the phorid Pseudacteon obtusus (Williams and Banks 1987), the nematode Tetradonema solenopsis (Nickle and Jouvenaz 1987), and unidentified nematodes






7


(Jouvenaz and Wojcik 1990). Pathogens include a virus, neogregarines, microsporidia, a bacterium (Jouvenaz 1983) and the entomopathogenic fungi Beauveria, Metarhizium and Paecilomyces (Stimac et al. 1987). Recently, a high incidence of infection of S. richteri with Thelohania solenopsae-like and Vairimorpha invictae-like microsporidia, hereforth called Thelohania sp. and Vairimorpha sp., was reported from Argentina (Briano 1993). He found that in areas where the microsporidia are present the density of fire ant mounds is significantly lower than in uninfected areas. These microsporidia are currently being evaluated as potential biological control agents for imported fire ants in the United States.

Thelohania solenopsae, the first specific pathogen known from fire ants, was first reported by Allen and Buren (1974) from S. invicta in Brazil. They detected spore cysts formed from enlarged fat body cells in the gasters of alcohol-preserved workers. Giemsastained smears of fat body tissue of live workers show octonucleate sporonts that produce eight spores enclosed in a sporophorous vesicle. Based on this characteristic they identified it as a species of the genus Thelohani Henneguy but they did not give it a species name. The genus Thelohania was defined by Henneguy and Thl6ohan (1892) as having spores of only one developmental sequence, which produces octospores enclosed in a sporophorous vesicle or interfacial envelope. Knell and Allen (1977) described Thelohania sp. from live S. invicta workers and brood in Brazil as a new species, T. solenopsae. Meronts (vegetative stages) are found in fat body of larvae, pupae and queen ovaries (Knell and Allen 1977). Sporonts occur in late pupae, workers, males and queens. Spores occur only in adults. Knell and Allen (1977) discovered that T. solenopsae is dimorphic producing both bacilliform binucleate free spores and pyriform uninucleate octospores in the same individuals. This makes it the only dimorphic member of the genus Thelohani However, the type species, T. giardia, which has not been carefully studied (Hazard and Oldacre 1975), may also be dimorphic.

Allen and Silveira-Guido (1974) also found Thelohania sp. in workers of S. richteri in Montevideo, Uruguay and Las Flores, Argentina and from a Solenopsis sp. in






8


Montevideo. They speculated, based on their knowledge of S. invicj and its microsporidian parasites, that the ant populations are regulated naturally by the microsporidia. It is unclear whether T. solenopsae is one species or a complex of sibling species of microsporidia (Jouvenaz 1986) since it has been detected in more than a dozen described or undescribed Solenopsis spp. in South America (Jouvenaz 1983).

The dimorphic V. invictae has been reported from 5. invicta collected in Brazil by Jouvenaz and Ellis (1986). Vegetative stages are found in larvae and pupae, free spores in pupae and adults, and octospores in adults. The genus Vairimorpha was created by Pilley (1976) to include dimorphic species with disporous and octosporous sporogony in the same individual.

The classification of T. solenopsae and V. invicta may have to be revised

(Jouvenaz and Ellis 1986). Knell and Allen (1977) placed T. solenopsae in the family Thelohaniidae because it meets all the family criteria. It produces octospores and sporoblasts by endogenous budding, and it secretes metabolic products retained by the sporophorous vesicle. They placed it in the genus Thelohania because of its isofilar polar filament. Two genera of Thelohaniidae at that time, Amblyospora and Parathelohania, produce both octospores and free spores, but free spores arise from plasmodia (4-40 spores per plasmodium, multisporous sporogony) (Hazard and Oldacre 1975). The free spores of T. solenopsae, however, arise from diplokaryotic sporonts (disporous sporogony) which is characteristic of Vairimorpha. Jouvenaz and Hazard (1978) created the family Burenellidae for species having two sporogonic sequences, one producing free spores from disporous sporogony, and the other producing meiospores from octonucleate sporonts. Species of Burenellidae also develop tubules within the sporophorous vesicle during sporulation, they do not secrete granules as do those of the Thelohaniidae. The genera Burenella, Vairimorpha, Evlachovai and Pilosporella are included in Burenellidae (Sprague et al. 1992). It appears that T. solenopsae does not quite fit into the family Thelohaniidae because it produces free spores from disporous sporonts and not from






9


plasmodia. Furthermore, the species of this family are common parasites of a variety of aquatic and semiaquatic animals. Thelohania solenopsae does not quite fit into the Burenellidae either, because it does secrete granules during octosporous sporulation.

Based on light microscopic observations, Thelohania sp. and Vairimorpha sp. from Argentine S .richteri appear to be identical to T. solenopsae and Y. invictae from Brazilian S. invicta. The objective of this study was to compare light- and ultrastructural features of Argentine Thelohania sp. and Vairimorpha sp. and Brazilian I. solenopsae and Y. invictae.

Infected S. invicta and S. richteri were collected by R.S. Patterson and J. Briano in Brazil and Argentina. Identity of the ants from which the microsporidia were isolated for all experiments was confirmed by determination of cuticular hydrocarbon components with gas chromatography (GC). Both S. invicta and S. richteri have signature cuticular hydrocarbon profiles which clearly define the two species (Vander Meer and Lofgren 1988; Nelson et al. 1980).


Materials And Methods



Collection and Processing of Ants


Thelohania sp. and Vairimorpha sp. were obtained from S. richteri adults collected by R. S. Patterson and J. Briano in the area of Saladillo, Buenos Aires province, 180 km SW of Buenos Aires in Argentina. R. S. Patterson and J. Briano also collected S. invicta infected with T. solenopsae and V. invictae in the area of Cuiaba, Brazil. The ants were transported back to Gainesville, Florida, in artificial ant nests modified from Williams (1989). To make a 'nest', powdered dental labstone (roughly 250 g) and tapwater were thoroughly mixed to get a thick liquid paste. The labstone paste was then poured into the bottom of a large petri dish (150 x 25 mm) and allowed to harden. Prior to use it was saturated with water to maintain a high relative humidity inside the petri plate. A small






10


test tube filled with 1 M aqueous sucrose solution and plugged with cotton gauze was secured inside the petri dish lid. For transport, the ants were confined within the modified petri dish with the lid taped securely to the bottom. On their arrival to Gainesville, the ants were either frozen at -70'C to purify the spores later or processed immediately.

Some colonies of infected S. richteri were maintained over several months in the laboratory. For rearing of the ant colonies, big trays (95 x 78 x 28 cm) were coated with Fluon on the inside walls to prevent ants from escaping. Each tray had one artificial ant nest, the construction of which is described in detail by Williams (1989). In principle, the ant nest was like the one described above except that a small petri dish (100 x 10 mm) with four small holes in the bottom, containing a sponge and Tygon tubing inserted in a U-shape through two holes in the top of the small petri-dish, was placed into the large petri dish. The lab stone was poured into the larger dish, leaving only the tubing exposed. The purpose of the small dish with the sponge was to act as water reservoir to keep the ant nest humid. One colony was placed in each tray. Food consisted of frozen crickets, honey agar, 1 M aqueous sucrose and water. The rearing temperature was about 23*C. Poor collection conditions in Brazil yielded only very few S. invicta; thus no colonies of S. invicta could be established in the laboratory. Thelohania solenopsae, Thelohani sp. and Vairimorpha sp. but no V. invictae could be isolated from the available specimens.


Ant Identification

To extract cuticular hydrocarbons, five worker ants, frozen at -20C until analysis, were soaked in 1 mL of hexane in small vials for 2 h. The total lipid extract was passed through a short column (3 cm long x 0.5 cm in diameter) of silicic acid (60-200 mesh, J.T. Baker, Philadelphia, Pa.) in a Pasteur pipette (Carlson and Bolten 1984). To make a column, a little glass wool was stuffed into a Pasteur pipette and the silica gel poured on top of it. The hydrocarbons were eluted from the mini-column with 3 mL of hexane,






11


concentrated to dryness with nitrogen gas, and redissolved in 20 gL of hexane for GC analysis (Carlson and Brenner 1988). Oxygenated compounds, if present, remained on the column.

Gas chromatography analyses of hydrocarbons were conducted using a 5890 series II Hewlett Packard gas chromatograph with a flame ionization detector. The column oven was fitted with a 30 m x 032 mm i.d. x 0.25 pm film thickness fused silica capillary column of DB-1. Following a cool-on column injection of 1 pL at 630C, the oven temperature was raised to 230"C at 25*C/min, and then to a final temperature of 320'C at 7"C/min. The temperature was held at 320*C for 15 min. The carrier gas was hydrogen. The data were processed by HP Chemstation, version 1.0 software.


Phase Contrast Microscopy

Diagnosis of infection was made by examining wet mounts of fat body tissue of adults by phase contrast microscopy. Different body parts were examined for infection (head, thorax, gaster). Fresh samples of Thelohania sp. and Vairimorpha sp. were used for spore measurements with a calibrated Vickers image-splitting micrometer.


Transmission Electron Microscopy


Spore cysts of Thelohania sp., Vairimorpha sp., and T. solenopsae were dissected from adult worker ant gasters in 2.5% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH

7.4) containing 0.1% CaCl2. After 30 min, the hardened cysts were transferred to fresh

2.5% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) containing 0.1% CaCl2 and fixed for 2-4 h at room temperature. They were postfixed in 1% aqueous OsO4 (osmium tetroxide) (w/v) for 2 h at room temperature, dehydrated through an ascending ethanol and acetone series and embedded in Epon-Araldite plastic (Mollenhauer 1964). Tissue blocks were thick-sectioned with a glass knife, and thin-sectioned with a diamond knife on






12


a Sorvall ultramicrotome. Thin-sections were stained with methanolic uranyl acetate (50% methanol, 1% uranyl acetate) followed by lead citrate (Reynolds 1963). They were and photographed at an accelerating voltage of 75 kV with a Hitachi H-600 electron microscope.


Results



Ant Identification

Identification of the ants as either S. invicta or S. richteri was confirmed by their

respective cuticular hydrocarbon profiles (Figure 2.1). In 5. invicta, hydrocarbons with 28 and 29 carbons in the backbone of the molecules predominate whereas in S. richteri hydrocarbons with 24, 25, and 26 carbons in the backbone of the molecules predominate (Nelson et al. 1980).


Light Microscopy

Spores of Thelohania sp. and Vairimorpha sp. are found only in pupae and adults, not in the larval stages, of the ants. Workers, queens and males can be infected. The microsporidia seem to parasitize fat body cells which hypertrophy into spore-filled cysts. Dual infections with Thelohania sp. and Vairimorpha sp. in the same individual may occur. Thelohania sp. and T. solenopsa cause the development of comparatively large cysts while a Vairimorpha infection produces tiny cysts (Figure 2.2, Figure 2.3). The infection may be very heavy 25 Thelohania sp. cysts and 14 Vairimorpha sp. cysts were counted from one major _. richteri worker! The infection produced symptoms not readily observed with a loss of coordination and slow movement of the diseased ants. Both Thelohania sp. and Vairimorpha sp. were dimorphic with uninucleate meiospores in groups of eight and binucleate free spores.






13


S. invicta














11 12 13 14 15 16
Retention Time (min)


S. richteri


11 12 13 14 15 16
Retention Time (min)


Figure 2.1. Gas chromatographic traces of S. invica and S. richteri hydrocarbons. Ant lipids were extracted with hexane. The total lipid extracts were passed through short columns of silicic acid (3 cm long x 0.5 cm diameter) in Pasteur pipettes. The hydrocarbons were eluted from the columns with hexane in the void volume. They were analyzed with a 5890 series II Hewlett Packard gas chromatograph fitted with a fused silica capillary column of DB-1. A flame ionization detector was used.


~2)


U


-,JA
































Figure 2.2. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. (VC) and Thelohania sp. (TC). x18.
Figure 2.3. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. (VC) and Thelohania sp. (TC). x46.






15


44






16


Thelohania sp. was apparently confined to fat body tissue of ant gasters. Both uninucleate meiospores and binucleate free spores developed simultaneously in the same cysts. Octets of meiospores were enclosed into a persistent sporophorous vesicle (henceforth referred to as an interfacial envelope). Free spores were not enclosed in a membrane (Figure 2.4). Octospores are pyriform in shape and measure 2.32 0.14 x 4.10 0.31 pm (n=33). Free spores are elongate oval in shape and measure 2.83 0.30 x 5.71

0.55 pm (n=21). Free spores were exceedingly rare (usually less than 1%).

Vairimorpha sp. spores were observed from tissues within the head, thorax and

gaster of S. richteri. In the gaster, fat body tissue was parasitized; the nature of the tissue in the thorax and head was unclear. Only mature free spores were found in pupae; both spore types occurred in the same cysts in adults (Figure 2.5). Similar to Thelohania sp., octets of meiospores were enclosed in interfacial envelopes, but the free spores were not enclosed in a membrane (Figure 2.6). Vairimorpha sp. spores are much larger than those of Thelohania sp. Octospores were ovoid and very slightly narrower at the anterior pole and measure 4.31 0.25 x 6.45 0.61 pm (n=33). Free spores were elongate bacilliform and measure 3.11 0.19 x 10.76 0.48 pm (n=34). Figure 2.7 shows Vairimorpha sp. and Thelohania sp. meiospores, Figure 2.8 all four spore types in the same field of view.


Transmission Electron Microscopy


Thelohania sp. meiospores were pyriform in sagittal section with the posterior end more broadly rounded than the anterior end. They were uninucleate with a lamellar polaroplast anteriorly and vacuole posteriorly. Polyribosomes border the nucleus. The polar filament was isofilar with 10-12 coils. The coils were arranged either uniform or irregular. The spore wall, composed of exospore and endospore, was relatively thin and undulating (Figures 2.9, 2.10). The polar filament consisted of several layers with





17


Figure 2.4. Light micrograph of Thelohania sp. partial cyst (TC) with meiospores
(MS) and free spores (FS). x750.
































Figures 2.5. Light micrograph of Vairimorpha sp. cyst with free spores (FS) and
meiospores (MS). x210.
Figure 2.6. Light micrograph of Vairimorpha sp. cyst with free spores (FS) and
meiospores (MS). x750.








19


U






21


electron-dense outer layers and inner core separated by an electron-transparent zone (Figure 2.10). The exospore consisted of several layers and was about 1/5 the thickness of the electron-transparent endospore (Figure 2.10). Thelohania solenopsae meiospores looked similar to Thelohania sp. meiospores (Figure 2.11, 2.12).

Thelohania sp. free spores were ovoid in sagittal section. They were diplokaryotic with polyribosomes bordering the nuclei and a posterior vacuole. The polar filament was isofilar with 15 coils. It was composed of several layers. The spore wall was relatively thin and smooth with electron-dense exospore and electron-transparent endospore (Figure

2.13).

Vairimorpha sp. meiospores were pyriform in sagittal section. The most striking feature was the presence of an exceedingly thick smooth spore wall with a relatively thin electron-dense exospore and a very thick electron-transparent endospore (Figure 2.14). The polar filament was isofilar with 11-13 coils; the anterior polaroplast was lamellar (Figure 2.14). The exospore consisted of several layers and was about 1/9 the thickness of the endospore (Figure 2.15). The polar filament also consisted of several electrondense and electron-transparent layers (Figure 2.15). The electron-transparent layer surrounding the electron-dense core was much thicker in Vairimorpha sp. than in Thelohania sp. Conversely, the electron-dense core was much smaller in Vairimorpha sp. than in Thelohania sp. Vairimorpha sp. free spores were very long and bacilliform in sagittal section. The polar filament was isofilar with 26 coils. The polaroplast was lamellate. Since processing of these microsporidia for TEM is extremely difficult, good quality micrographs of the Vairimorpha sp. free spores could not be presented here.





22


E X E X -+ 0

E N--E N







-P F

104'
PF\




2.9







PF EN PF
E N
EX 210 EX 2.12


Figure 2.9. Electron micrograph of Thelohania sp. meiospore. x37,500.
Figure 2.10. Electron micrograph of Thelohania sp. spore wall and polar filament.
x150,000.
Figure 2.11. Electron micrograph of T. solenopsa meiospore. x37,500.
Figure 2.12. Electron micrograph of solenosae spore wall and polar filament.
Endospore (EN), exospore (EX), polar filament (PF). x150,000.






23


I


PF '\


2.13


Figure 2.13. Electron micrograph of Thelohani sp. free spore; polar filament
(PF), exospore (EX), endospore (EN). x30,000.


































Figure 2.14. Electron micrograph of Vairimorpha sp. meiospore. x18,000. Figure 2.15. Electron micrograph of Vairimorpha sp. meiospore spore wall and polar
filament. x120,000. Endospore (EN), exospore (EX), polar filament (PF).





25


4 0
















*PF 214


EX(

E N


PF


EX


215






26


Discussion

Based on the morphological evidence Thelohania sp./T. solenopsae and

Vairimorph sp./V. invictae appear to be conspecific. Vairimorpha sp. and Thelohanij sp. are very distinct from each other at the light-microscopic and ultrastructural level in both size and morphology. Thelohania sp. and Vairimorpha sp. are very similar to T. solenopsae and V. invictae, respectively, with regard to tissue specificity, and light and ultrastructural microscopy.

To determine whether Vairimorpha sp. and Thelohania sp. are different phenotypes of the same species, the possibilities of heterosporous microsporidia (Sweeney et al 1985; Becnel et al. 1989) and phenotypic plasticity must be considered. Even though Mitchell and Cali (1993) did not observe temperature-related differences in the ultrastructure of V. necatrix, there are reports of environmentally induced phenotype variation. Burenella dimorpha, a microsporidian parasite of S. geminata, for example, shows temperaturedependent spore dimorphism (Jouvenaz and Lofgren 1984). They demonstrated inhibition of octospore development at relatively low (20'C) and high temperatures (30'C). Temperature-dependent spore dimorphism has been demonstrated for other microsporidia as well (Maddox and Sprenkel 1978). This means that Vairimorpha sp. and Thelohania sp., even though ultrastructurally distinct, could be different phenotypes (expressed in different environmental conditions) of the same species.

Spore measurements of Thelohania sp. meiospores and free spores are about 1 gm larger than the previously published measurements of T. solenopsae by Knell and Allen (1977). This difference in spore dimensions could be due to a different technique to read the scale in the ocular micrometer (used for spore measurements) or to environmentally induced size variation due to temperature or host. For example, temperature regulated spore length of Vairimorpha sp. 696 (Sedlacek et al. 1985). Spores were significantly longer at 19C (5.9 pm) than at 320C (4.7 gm). Mean spore size of the same species of






20


Figure 2.7. Light micrograph of meiospore octets of Thelohania sp. (TM) and
Vairimorpha sp. (VM). x750.
Figure 2.8. Light micrograph of Thelohania sp. and Vairimorpha sp. free spores (TF, VF)
and meiospores (TM, VM). x750.






27


microsporidia may also vary significantly with host species (Brooks and Cranford 1972). They found that spores of Nosema heliothidis are significantly shorter in Heliothis zM larvae than in its hymenopterous parasite Campoletis sonorensis (Brooks and Cranford 1972). Spore dimensions of Vairimorpha sp. meiospores and free spores are almost identical to the previously published dimensions of V. invicta (Jouvenaz and Ellis 1986). Furthermore, meiospore and free spore ultrastructure of Thelohania sp. and Vairimorpha sp. are very similar to those of T. solenopsae (Knell and Allen 1977) and invictae (Jouvenaz and Ellis 1986), respectively.

Meiospore ultrastructures of Thelohania sp. and I. solenopsae are characterized by a thin, undulating exospore, relatively thin endospore, lamellar polaroplast, and isofilar polar filament. Meiospore ultrastructures of Vairimorpha sp. and V. invictae are characterized by a very thick smooth spore wall with relatively thin exospore and very thick endospore, lamellar polaroplast, and isofilar polar filament. Differences were observed, however, in number of coils and arrangement of the coils of the polar filament. The number of turns of the polar filament, arrangement of the coils and number of broad and narrow coils of the meiospores may be used in distinguishing closely related species (Hazard and Oldacrel975). For example, Andreadis (1994) was able to distinguish six new species of the genus Amblyospora based upon distinct differences in the number of turns of the polar filament, arrangement of the coils and number of broad and narrow coils of the polar filament. Garcia and Becnel (1994) also utilized numerical ratio of broad and narrow coils, and arrangement of these coils as useful taxonomic characters to describe eight new species of microsporidia of the genera Amblyospora and Parathelohania from Argentine mosquitoes.

It was very difficult to quantify polar filament arrangement and number of coils in an adequate number of spores of Thelohanig sp., I. solenopsa and Vairimorpha sp. because sample preparation for TEM was very difficult (see below). Based on the material available, Thelohania sp.meiospores showed both uniform and irregular






28


arrangement of the coils of the polar filament but T. solenopsae meiospores had a uniform arrangement of coils of the polar filament. Thelohania sp. had between 10-12 coils whereas T. solenopsae had between 9-11 coils. Free spore ultrastructure, except for number of coils of the polar filament, of Thelohani sp. was similar to that of T. solenopsae published by Knell and Allen (1977). The single Thelohanii sp. free spore observed in this study had 15 coils whereas Knell and Allen (1977) report 9-11 coils. Coils of the polar filament are arranged irregularly in both Vairimorpha sp. and V. invictae (Jouvenaz and Ellis 1986) but the number of turns was between 11-13 in Vairimorpha sp. and 9 in V. invictae. Free spores of Vairimorpha sp. and V. invictae are similar in structure and number of turns of the polar filament (24-26 coils in V. invictae and ~ 26 coils in Vairimorpha sp.).

Furthermore, no data are available on host specificities of T. solenopsae,

V. invictae, Thelohania sp. and Vairimorpha sp. Andreadis (1994) and Garcia and Becnel (1994), in utilizing features of the polar filament as a distinguishing character to describe new species, placed great weight on the fact that the microsporidian species are all from different mosquito hosts (which do not interbreed). In other words, microsporidian species, that are ultrastructurally nearly identical except for characteristics of the polar filament, probably could not be differentiated easily from each other if they would coinfect the same host. It is not known whether Thelohania sp. and Vairimorpha sp. from S. richteri can infect S. invicta (the host of T. solenopsae and V. invictae) and vice versa. To complicate the matter further, it is not even clear whether S. richteri and 5. invicta are two distinct species (Vander Meer and Lofgren 1988). Thus, the observations on differences in polar filament features did not provide a good taxonomic character to separate the fire ant microsporidia from each other because of (1) inadequate sample sizes and (2) lack of knowledge of host specificities.

Another problem that complicates comparing microsporidia at the ultrastructural level, involves sample preparation for TEM. It is a technical challenge to get good spore






29


infiltration of the imported fire ant microsporidia for tissue fixation and embedding into plastic. Because masses of spores occur in cysts, it is nearly impossible to get good infiltration of spores towards the interior of the cyst. Most importantly, the spore walls present a nearly impenetrable barrier to fixatives and plastics (J. Becnel, personal communication). Vairimorpha sp. and V. invictae meiospores am especially challenging because of their very thick spore walls. The obtainable ultrastructure of the fire ant microsporidian spores thus does not result in the same quality of resolution available from some other species of microsporidia such as those parasitizing aquatic insects which are (for unknown reasons) easier to prepare for TEM.

In conclusion, ultrastructural evidence indicates that Thelohania sp. and

T. solenopsae appear to be the same species. Ultrastructural evidence also indicates that Vairimorpha sp. and V. invicta are conspecific. It is premature, though, to draw a conclusion based solely on morphological characteristics because there are examples of microsporidia that are distinct species based on biochemical and immunological tests but indistinguishable at the light- and ultrastructural level (Didier et al. 1991). Differences in number and arrangement of coils of the polar filament presently cannot be used as good taxonomic characters because of problems of quantification and unresolved host specificities. Vairimorpha sp. and Thelohania sp. are very different from each other at the gross morphological and ultrastructural level, but because of the occurrence of heterosporous microsporidia and phenotypic plasticity more evidence is needed to resolve the question whether they are different phenotypes of the same species.















CHAPTER III
FATLY ACID METHYL ESTER ANALYSIS IN MICROSPORIDIA: EVALUATION OF A NEW TOOL FOR IDENTIFICATION


Introduction



Literature Review


This literature review will highlight several significant developments in the use of fatty acid analysis as a tool for rapid identification and taxonomy of microorganisms. A comprehensive review on gas chromatographic analyses of fatty acids in bacteria and other microorganisms, using capillary columns, was written by Welch (1991). Asselineau (1962) provided an overview of the early work on bacterial lipids performed by open, packed glass columns. O'Leary (1975) reviewed microbial lipids and their role in taxonomy, phylogeny, and identification of bacteria. Supplementary references may be obtained from a number of books on microbial chemotaxonomy and lipids (Goodfellow and O'Donnell 1994; Ratledge and Wilkinson 1988; Goodfellow and Minnikin 1985).

Lipid composition, especially fatty acid composition, has been an important

criterion in determining taxonomic relationships among bacteria (Shaw 1974). Analysis of fatty acid methyl esters (FAMEs) for identification, first applied to bacteria, is now a routine practice for anaerobic and aerobic bacteria (Dees et al. 1975; Moss et al. 1974; Moss 1981; Sasser 1990a). FAME analysis has recently been applied to the taxonomy and identification of yeasts (Kock 1988; Sasser 1990c) and glomalean endomycorrhizal fungi (Jabaji-Hare 1988; Bentivenga and Morton 1994; Graham et al. 1995). A recent publication by Van der Westhuizen et al. (1994) reports on FAME profiles in Chytridiomycota, Zygomycota, and Deuteromycotina.


30






31


James and Martin (1952) first reported on the application of gas-liquid partition chromatography to the separation and micro-estimation of volatile fatty acids. This method was successfully used by Abel et al. (1963) to analyze fatty acids of eleven bacteria. They demonstrated qualitative and quantitative fatty acid profile differences among selected families in the class Schizomycetes, and quantitative differences among five selected genera of the family Enterobacteriaceae. Furthermore, they found that media components and growth stage influence bacterial fatty acid composition. Their studies established the potential usefulness of cellular fatty acid analysis in bacterial taxonomy, and laid the foundation for further investigations. For example, Yamakawa and Ueta (1964) used gas chromatography to determine fatty acid and monosaccharide compositions of whole bacterial cells of seven species of Neisseria. Other early studies were concerned with various aspects of culture conditions that influenced fatty acid composition of Escherichia coli, such as temperature and growth media (Marr and Ingraham 1962; Knivett and Cullen 1965). A wealth of literature exists on the influence of nonstandardized growth conditions on the fatty acid composition of organisms. Recent research has been undertaken to determine the effect of culture age on FAME profiles of lactic acid bacteria (Decallone et al. 1991). Effects of growth temperature on FAME profiles of Bacillus subtilis and B. megaterium (Suutari and Laakso 1992) and culture media on FAME profiles of B. anthracis and B. cereus (Lawrence et al. 1991) have been reported. In addition to bacteria, studies on FAME profiles of yeasts including several Candid species, Torulopsis glabrata, and Cryptococcus neoformans (Marumo and Aoki 1990) and Mortierella alpina (Shimizu et al. 1991) are available.

The source of fatty acids in microbial cells is lipid. Lipids are substances of

biological origin that are soluble in organic solvents such as chloroform and ether but only sparingly soluble in water (Voet and Voet 1990). Fats, oils, fat-soluble vitamins such as A, D, E, and K, and some hormones are lipids. Fatty acids are carboxylic acids having hydrocarbon backbones ranging from 1-30 carbons in length. They are rarely found as






32


free acids in the cell but, rather, occur as esters of glycerol. Some free fatty acids are toxic to living cells (Wood 1988). The fatty acids present in microbial lipids are generally of four types: straight-chain or saturated, mono- or polyunsaturated, branched-chain (predominantly iso and anteiso), and substituted fatty acids. The latter group includes cyclopropane, hydroxy, and alcohol moieties (Schweizer 1988).

Palmitic acid (16:0) is highly conserved in prokaryotes (Welch 1991). Branchedchain and cyclopropane fatty acids characterize many gram-positive and gram-negative bacteria, but are not found in eukaryotic microorganisms. Polyunsaturated fatty acids, found in higher organisms, are not biosynthesized by aerobic bacteria (Welch 1991). Hydroxy acids are typical of gram-negative, but not gram-positive bacteria. Mycolic acids are representative of the Actinomycetes. Strict anaerobes and archaebacteria synthesize plasmalogens (ether-linked lipids). An excellent summary on the distribution of fatty acids among major taxonomic groups is given by Kerwin (1994). Additional information on fatty acids characteristic of different microorganism can be found in Welch (1991) and Ratledge (1988). Fungal fatty acids are discussed by Van der Westhuizen et al. (1994) and Losel (1988).

Several technical advances have simplified the use of cellular fatty acid analysis as a diagnostic tool while increasing accuracy and precision. Generally, gas-liquid chromatography (G-LC) of FAMEs had been done on glass columns of variable lengths with internal diameters from 2-4 mm, and packed with polar or nonpolar stationary phase material (Moss 1981). Packed columns enable larger sample volumes to be assayed, but do not separate all of the types of substituted acids biosynthesized by bacteria. For example, hydroxy acids appear as 'shoulder peaks' on the leading or tailing edge of other peaks on a chromatogram of a packed column, and cis/trans isomers of some acids with the same carbon chain length may appear as one peak or will not be resolved at the base line (Moss et al. 1980; Moss 1981). The introduction of flexible fused silica glass capillary columns with internal diameters of 0.2 mm and wall-coated, rather than packed stationary






33


phases enables increased resolution of fatty acids. Hydroxy acids and most structural isomers appear as sharp, symmetrical, well resolved peaks when fused silica capillary columns are used (Moss et al. 1980).

Other developments include the modification of a fatty acid extraction method to obviate the use of hazardous diethylether (Moss et al. 1974; Moss 1981). An esterification protocol was modified to improve total fatty acid recovery as well as reduce hydroxy acid tailing and cyclopropane acid degradation (Miller 1982). Finally, computerized data reduction programs facilitate rapid analysis of large data sets (Aston 1977; Eerola 1988; Sasser 1990a).

A commercial, microbial identification system based on FAME profile analysis, the Microbial ID Inc. (MIDI) automated Microbial Identification System (MIS), has been developed (Sasser 1990a). MIDI has created data bases of FAME profiles for identification of aerobic and anaerobic bacteria, including actinomycetes, yeasts and other fungi (Sasser 1990b; 1990c). Stead et al. (1992) assessed the MIDI system by comparing FAME profiles of 773 strains of plant pathogenic bacteria representing 25 taxa and related saprophytic bacteria. They found that the confidence of correct identification is very high at the genus and species levels, but lower at the subspecies and pathovar levels. Jarvis and Tighe (1994) found that the MIDI system correctly identifies recognized species of Rhizobium with high accuracy.

This study assessed for the first time the application of FAME profiles for the identification of microsporidia, represented by three species of three genera. Due to sample size limitations, only Thelohania sp. of the fire ant microsporidia could be included; inadequate spore material was available of Vairimorpha sp. and T. solenopsae.






34


Materials and Methods



Test organisms

Three genera were selected for fatty acid analysis: Vairimorpha, Nosem, and Thelohania. Vairimorpha necatrix was obtained from J.V. Maddox, Illinois Natural History Survey, and propagated in the corn earworm, Helicoverpa zea. Nosem algerae, provided by A.H. Undeen, USDA-ARS, Gainesville, was augmented in H. zea and the common malaria mosquito, Anopheles quadrimaculatus. Thelohania sp. was harvested from field-collected Argentine fire ants, S. richteri, courtesy of R.S. Patterson and J. Briano.


Spore Propagation of N. algerae in H. zea


Four-day-old H. zea larvae were starved individually for 24 h, then 20 pL of an aqueous suspension of 1x107 N. algerae spores/mL was added to each. After an additional 24 h, the larvae were placed separately on a pinto bean diet, and maintained at 29*C. Spores were purified from adult H. zea.


Spore Propagation of V. necatrix in H. zea


Five-day-old H. zea larvae were exposed to 10 pL of Ix106 V. necatri spores/mL each and raised separately on pinto bean diet at 290C. Spores were harvested from last instar H. zea larvae.


Spore propagation of N. algerae in A. quadrimaculatus

Approximately 1000 mosquito eggs were hatched in 100 mL water, thereafter

called infusion water, containing 13 mg of a 1:1 mix of dried, powdered liver and brewer's yeast. After 24 h, this infusion was enriched with 30 mg of alfalfa powder, and the larvae






35


were exposed to 1x105 spores of N. algerae One day post-exposure, the larvae were transferred to 8x38x50 cm rearing pans containing 900 mg powdered alfalfa in 3 L deionized water. After two days, 900 mg of a 1:1 mix of liver:brewer's yeast was added; thereafter, in 2-3 day intervals until pupation, 900 mg of a 1:1:1 mix of liver: brewer's yeast: hog chow was added. Pupae were picked daily, transferred to small cups, and held for emergence in aluminum C-frame cages covered with tube gauze. Cotton balls saturated with 10% aqueous solution of sucrose were added (Anthony et al. 1978). Spores were harvested from adult mosquitoes 3-5 days post-emergence.


Spore Harvest and Purification


Last-instar H. zea larvae infected with V. necatrix were surface-sterilized in 70% ethanol. Fat bodies were removed without lacerating gut tissues, placed into deionized water, ground in a glass tissue grinder, and filtered through cotton. Adult H. zea moths infected with N. algerae were rinsed in water and, after wing removal, triturated in a Tekmar Tissumizer in deionized water. The resulting suspensions were filtered through a cotton plug in a glass syringe. The crude V. necatrix and N. algerae spore preparations were further purified by a deionized water wash and differential centrifugation on a continuous Ludox gradient (Undeen and Alger 1971).

Adult infected mosquitoes were immobilized by chilling at -20'C for about 3 min, removed with an aspirator connected to a vacuum pump, and homogenized in a small amount of deionized water in a Waring blender. The resulting suspension was strained through a cotton plug in a syringe to remove large body parts. Further purification was achieved by a deionized water wash and differential centrifugation on a continuous Ludox gradient.

Adult worker ants of richteri infected with Tielohania sp. were triturated in a Tekmar Tissumizer in 'ant homogenizing buffer' (0.1% SDS, 10 mM Tris-HCl pH 7.5,






36


1 mM EDTA). The suspension was strained through cotton and centrifuged in deionized water. The pellet was incubated for 10 min at 40*C in 10 pg/mL proteinase K and 1/4 vol of interfacial envelope disruption buffer (4% SDS, 25 mM EDTA, 50 mM Tris-HCl pH 7.5), followed by differential centrifugation on a Ludox gradient. All spore preparations were further cleaned by centrifugation on a 100% Percoll gradient, and repeatedly washed in deionized water, prior to fatty acid analysis.


Fatty acid extraction and analysis


Spore preparations used for fatty acid analysis were examined with a phase

contrast compound microscope prior to extraction to check for bacterial contaminants. Approximately 1x109 spores in aqueous suspension were pipetted into a 13x100 mm glass test tube and stored overnight at 4'C to allow the spores to settle. Prior to extraction, spore samples of N. algerae from the two insect hosts were rinsed with 0.1% SDS to remove externally attached host lipids. Analysis of the SDS rinsate indicated that no fatty acids, from 9-20 carbons in length, were present. The next day, the supernatant was withdrawn carefully and esterification of fatty acids was accomplished using the method of Miller (1982). Approximately 1x109 spores were pipetted into a 13x100 mm culture tube and stored overnight at 4"C to allow the spores to settle. The next day, the supernatant was withdrawn carefully and 1 mL of 15% NaOH in 50% methanol was added. The tube was capped, and fatty acids were saponified at 100"C for 30 min. Upon cooling, 2 mL of 6 N HCl in 50% MeOH were added, the tube was recapped and heated at 80'C for 10 min to methylate the fatty acids. Fatty acid methyl esters (FAME) were solvent-extracted from the aqueous phase with 1.25 mL of hexane:methyl-tert-butyl ether (1:1; v/v). The organic phase was washed with 3 mL of 1.2% aqueous NaOH and transferred to a gas chromatograph (GC) vial. To determine the number of microsporidia required for fatty acid analysis, a range of different numbers of spores (3.3x108-2.lx109) was extracted.






37


Although fewer numbers of spores could be extracted and derivatized, a sample size of 1x109 spores is recommended to provide sufficient area count.

Fatty acid methyl ester extracts were analyzed by the Microbial ID System (MIDI) (Sasser 1990b), which consists of a computer-linked Hewlett Packard 5890 gas-liquid chromatograph fitted with an Ultra 2 fused silica capillary column (25 m x 0.2 mm i.d. x 0.33 pm film thickness; crosslinked 5% phenyl methyl silicone). Following a 1/100 split injection of 2 gL at 250*C, the oven temperature was increased 50C/min from 170'C to a final temperature of 270*C; hydrogen was used as the carrier gas. After flame-ionization, FAME peaks were quantified by a Hewlett Packard 3392 integrator and expressed as percentages of the total FAME profiles. Data were stored in the MIDI computer for subsequent comparison and statistical analyses. Prior to and between every ten-sample analyses, a calibration standard mixture consisting of the 12 straight-chain carbon acids from C9 to C20, plus five hydroxy acids, was injected. The resulting retention time and quantitative data served as quality control indicators to ensure good column performance and peak matching by the MIDI system. Periodically, Stenotrophomonas maltophilia, a bacterium whose FAME profile is well characterized, was used as a positive control to ensure reproducibility among different extraction batches.

Representative samples were further characterized by coupled GC-mass

spectrometry (GC-MS). Aliquots of the microsporidian FAME mixtures and two FAME standards (MIDI Calibration Standard Mix from 9-20 C; Applied Science Division Standard with saturated and unsaturated C18) were analyzed by a Perkin Elmer 8420 GC interfaced with a Finnigan Ion Trap Detector (ITD, Model 6210), with INCOS data collection software and a 80286 computer. The GC-MS was fitted with a 25 m x 0.25 mm i.d. DB-1 fused silica capillary column. The injection of 1 pL was in a splitless mode, followed with a purge flow of helium after 30 sec. The carrier gas was helium with a flow rate of 25 cm/sec (Nation et al. 1992). The initial temperature of the column was 60*C;






38


after sample injection, the temperature was programmed to 150*C at 30*C/min, then raised to 220'C at 5*C/min and held for a total running time of 100 min.

Mass spectrometry and comparison of the resulting peaks to the MIDI calibration standard mix and peak library were employed to confirm the identity of the major acids detected in the microsporidia.


Data analysis

Fatty acid methyl esters of the samples were named by comparing their retention times to those of the calibration standard (a mixture of straight-chain saturated fatty acids from 9-20 carbons in length including 5 hydroxy acids). Retention time data from the calibration mixture were converted to Equivalent Chain Length (ECL) data for fatty acid naming. Thus, the ECL value for each compound to be analyzed was computed, and the compounds were named based on comparisons to the standards as well as the ECL of acids stored in the MIDI peak library (142 peaks total) (Sasser 1990b).

A library was created from the microsporidia FAME profiles, and relationships among samples were analyzed with Principal Component Analysis. Measurements of variability and clustering among the profiles were portrayed by plotting the percentages of the three major fatty acids on a 3-D graph.

Statistical analysis of the fatty acid data was performed with an analysis of variance (ANOVA) followed by a Tukey's mean separation test to compare the means of each fatty acid among the microsporidian species tested (SAS Institute 1989).


Results

Three acids, palmitic (16:0), oleic (18:1 i 9 cis), and two closely-eluting peaks

denoted as Summed Feature 6 (18:2 ( 6,9 cis/18:0 anteiso) comprise 60% or more of the total FAME profiles of V. necatrix, N. algerae and Thelohania sp. FAME profiles were






39


qualitatively and quantitatively distinct for the three species. Myristic acid (14:0) and 20:1 m 9 cis were present at low levels in all of the N. algerae and Thelohania sp. samples. However, these acids were not detected in V. necatrix (Table 3.1). Quantitative differences include significantly lower levels of palnitic acid (16:0) in Thelohani sp. than the other two species (p
Host influence on FAME profiles of the spores was tested by producing N. algera in two different insects: the corn earworm, H. zea and mosquito, A. quadrimaculatus. Three closely-eluting 18:1 cis-trans isomers, combined as Summed Feature 7 (18:1 0 7 cis/18:1 w 9 trans/18:1 U3 12 trans), and arachidonic acid (20:4 0 6,9,12,15 cis), were detected in N. agerae isolated from mosquito at 6.3% and 4.1%, respectively (Table 3.1). Neither acid, however, was present in N. algerae from corn earworm. Furthermore, the percentages of three other acids varied according to host.











Table 3.1. Fatty Acids (%) in Three Microsporidian Species from One Aquatic and Two Terrestrial Insect Hosts


Nosema algerae Vairimorpha necatrix Thelohania sp.

Fatty Acida A. quadrimaculatus H. zea H. zea S. richteri

n=7 n=7 n=5 n=7

14:0 2.8+0.2d Be 2.2+0.1 C 0.0 D 4.7+0.2 A
16:117cis 11.4+0.8 A 2.0+0.1 C 1.4+0.2 C 4.2+0.7 B

16:0 34.5 +0.6 A 34.1 +0.5 A 31.2 +1.5 A 22.7 +1.0 B

Summed Feature 6b 13.4 +0.8 B 25.4 +0.8 A 28.4 +2.2 A 17.4 +1.3 B
18:1(9cis 16.5 +0.3 C 20.5 +1.8 BC 29.6 +2.9 A 26.0 +2.1 AB

Summed Feature 7 6.3 +0.5 A 0.0 B 0.0 B 0.2 +0.2 B

18:0 4.7 +0.2 BC 9.4+0.2 A 6.5 +0.9 B 4.1 +0.6 C
20:406,9,12,15cis 4.1 + 0.3 A 0.0 B 0.0 B 2.7 +0.6 A

20:1m9cis 1.8 +0.4 BC 2.6 +0.1 B 0.0 C 6.3 +0.8 A


aNumber of carbon atoms in fatty acid:number of double bonds per acid bSummed Feature 6 identified as 18:206,9cis/18:0 anteiso by the MIDI peak library cSummed Feature 7 identified as 18:1M7cis/(9trans/W12trans by the MIDI peak library dStandard errror of the mean

eArithmetic means in a row followed by a different letter are significantly different from each other


C






41


In N. algerae from corn earworm, levels of 16:1 (1 7 cis (palmitoleic acid), 18:2 E3 6,9 cis/18:0 anteiso (Summed Feature 6), and 18:0 (stearic acid) were 2.0%, 25.4% and

9.4%, respectively. Percentages of those acids in N. algerae isolated from mosquito, 11.4%, 13.4%, and 4.7%, were significantly different (p
0.05).

Based on mass spectral information, the major FAMEs present in the

microsporidia tested (14:0, 16:0, 16:1 C3 7 cis, 18:0, 18:1 3 9 cis, 18:2 U3 6,9 cis) could be confirmed. Chromatograms of the FAME standards and the microsporidia are presented in Figures 3.1-3.3. The chromatograms were obtained from samples characterized by coupled GC-MS. With this system, the C20 fatty acids could not be detected.

Principal Component Analysis of the three major acids was used to graphically

portray the clustering of the three species (Figure 3.4). Thelohania sp. was separated from the other species because of its low percentage of 16:0. Nosema algerae and V. necatrix both had larger percentages of 16:0, but V. necatrix also had a high percentage of 18:1 to

9 cis, which distinguished it from N. algerae.

Host insect affected the clustering of N. algerae. Lower levels of Summed

Feature 6 were detected in N. algerae from mosquito than N. algerae from corn earworm. Variability in the FAME profiles of the individual samples was lowest in N. algerac from mosquito (Table 3.1, Figure 3.4). Comparison of analyses of fresh and stored spore samples (storage at 4'C for 3 months, or -70'C for 1 month, of N. algerae and Thelohania sp., respectively) showed that storage did not alter the FAME profiles (data not shown).


Discussion

Fatty acid methyl ester profile analyses of microsporidia have not been reported previously. The three microsporidian species analyzed in this study can be differentiated






42


FAME Standard Microbial ID, Inc.


C16:0 C15:0 i


2000


C 17:0


C18:0


3000 4000


C18:3
C18:2 C18:1

C 18:0


1000 2000 3000


4000


FAME Standard Applied Sciences


5000 6000


Retention Time (sec)







Figure 3.1. Gas chromatograms of FAME standards. Standards were analyzed with a computer-linked Perkin Elmer 8420 GC interfaced with a Finnigan Ion Trap Detector with INCOS data collection software.


2 14


3


6


100




0


5


1: C9:0 2: Cl0:O 3: CI1:0 4: C12:0 5: C13:0 6: C14:0


MimI .. .


1000


C19:0
A


5000


100.




0
0.






43


Thelohania sp.


C16:0





C 14:0

C16:1


1000


C18:1


C18:21


C18:0
L


2000 3000 4000 5000


C16:0 C18:2


I .


V. necatnx


C18:1 C18:0


1000 2000 3000 4000 5000 6000
Retention Time (sec)


Figure 3.2. FAME chromatograms of Thelohania sp. and V. necatrix. Fatty acids were saponified, methylated, solvent-extracted, base-washed and analyzed by a computerlinked Hewlett-Packard 5890 gas-liquid chromatograph and a computer-linked Perkin Elmer 8420 GC interfaced with a Finnigan Ion Trap Detector with INCOS data collection software.


100



0 0.
0


100



0 0* 0, ,


I






44


C16:0


C14:0


C16:1


-*1.


C18:2



C


I


H. zea


18:1


C18:0


1000 2000 3000 4000 5000 6000


C16:0 C16:1


C14:0


1000


A. quadrimaculatus


C 18:1 C18:2
C18:0


2000 3000 4000 5000 6000


Retention Tune (sec)




Figure 3.3. FAME chromatograms of N. algerae in two different insect hosts.
Fatty acids were saponified, methylated, solvent-extracted, base-washed and analyzed by a computer-linked Hewlett-Packard 5890 gas-liquid chromatograph and a computer-linked Perkin Elmer 8420 GC interfaced with a Finnigan Ion Trap Detector with INCOS data collection software.


100






P ,


100


0


0


Lhk


A 1 S! 11 A! I . I .-T--r- I I I 1







45


































02
................









. .. ..




S16:0 1



S.n necatrx A N. algerae CEW V N. algerae mos. 0 Thelohania sp.






Figure 3.4. Three major fatty acids of three species of microsporidia.
Measurements of variability and clustering among the profiles were portrayed by plotting the percentages of the three major fatty acids on a 3-D graph. CEW = corn earworm, mos. = mosquito.






46


by a combination of qualitative and quantitative FAME profile characteristics (Table 3.1, Figure 3.4). Three acids, palmitic (16:0), Summed Feature 6 (18:2 (a 6,9 cis/18:0 anteiso) and oleic (18:1RD 9 cis) were present in large percentages in all microsporidian samples analyzed. Palmitic acid is ubiquitous; it is present in all organisms (M. Sasser, personal communication). Oleic acid is present in many bacterial human pathogens, phytopathogens, as well as vesicular-arbuscular mycorrhizae. Examples include gram positive bacilli and mycobacteria (Welch 1991; Portaels et al. 1993), the plant pathogens Erwinia amylovora, E. carotovora, Burkholderia solanacearum (formerly Pseudomonas solanacearum), and P. syringae (Sasser 1990a), and the mycorrhiza Gigaspora rose (Bentivenga and Morton 1995). A comprehensive list of fatty acids characteristic of a wide variety of organisms has been published (Kerwin 1994).

Fluctuations in FAME profiles were especially evident in V. necatrix and the

Thelohania sp. For example, three unnamed fatty acids were detected in several, but not all, Thelohania sp. samples. These acids could be typical of developing spores (physiological age differences of spores), or representative of the organism. The microsporidian life cycle has two distinct phases: merogony (or schizogony) and sporogony. Vegetative stages called meronts (or schizonts) develop into sporonts, and finally into mature spores (Sprague et al. 1992). Preliminary experiments indicated that FAME profiles of immature spores were qualitatively and quantitatively different from profiles of mature spores of the same species (data not shown). Density gradient centrifugation of microsporidian spores may not always result in the complete separation of immature and mature spores. Spore bands with predominantly mature spores may therefore contain immature spores (and vice versa), rendering spore samples not completely homogeneous, which may add variability to the FAME profiles.

A variety of environmental factors, including age, culture medium, pH, and growth temperature have been shown to affect FAME profiles of bacteria (Lechevalier 1989; Decallonne et al. 1991; Shimizu et al. 1991; Stead et al. 1992) and fungi (Marumo and






47


Aoki 1990; Van der Westhuizen et al. 1994). FAME profiles of other types of organisms may also be influenced by environmental, physiological, and developmental changes; for example, diet and development strongly influence profiles of insects (Stanley-Samuelson et al. 1988). In bacteria, stability of the FA composition is achieved through growth under standardized conditions in vitro. FA stability is optimal in bacteria growing at the late log or early stationary growth phase (Sasser 1990b). Nosema algerae had a qualitatively and quantitatively distinct profile, depending on the host (Table 3.1, Figure 3.1). Host influence on FAME profiles of microsporidia may render fatty acid analysis unsuitable as a tool for microsporidian identification unless culture conditions for all microsporidia can be standardized (in vitro culture in either cell-free media or in cell lines). In vitro culture of certain microsporidian species has been accomplished (Kurtti et al. 1994, Undeen 1975).

Conversely, spores of several species of glomalean fungi yielded reproducible FAME profiles despite being grown in association with different host plants and with contaminating microorganisms present (Graham et al. 1995). Glomalean endomycorrhizal fungi are similar to many microsporidia in that they cannot be cultured without their hosts; each form obligate symbiotic relationships with the roots of many plant species. Taxonomy of glomalean fungi is currently based on spore morphology. This is similar to microsporidia where assessment of diversity using only morphological characters is difficult because of inadequately defined characters, and ambiguous distinction between morphologically similar species (Morton and Benny 1990; Morton 1993). Molecular and biochemical characters are needed to supplement the morphological data.

Host influence on the FAME profile of microsporidia is one problem that needs to be solved by standardizing culture conditions. Another problem is the requirement of a large number of spores for fatty acid extraction. The large sample size of roughly lx109 spores for fatty acid extraction makes FAME analysis not practical for many microsporidia because of in vivo and in vitro culture limitations. However, Welch (1991) pointed out






48


that the fatty acid extraction process could be scaled down to accommodate for smaller sample sizes.

More studies with additional microsporidian species from a variety of

environmental conditions (e.g. different animal host) are needed to determine fatty acids characteristic for the microsporidia, and to assess qualitative and quantitative aspects of FAME analysis as a discriminant tool in identification. Microsporidian culture conditions should be standardized, and sample size requirements reduced. The compilation of microsporidian FAME profiles will enable statistical comparisons, using the MIDI pattern recognition software. By comparing profiles of well-characterized reference microsporidia, the utility of FAME analysis as a taxonomic tool for the identification of microsporidia could be evaluated.















CHAPTER IV
COMPARATIVE MOLECULAR CHARACTERIZATION OF MICROSPORIDIA FROM SOUTH AMERICAN FIRE ANTS


Introduction



Literature Review


Molecular structures and sequences generally are better indicators of evolutionary relationships than classical phenotypes. Thus, the basis for the definition of taxa has progressively shifted from the organismal to the cellular to the molecular level (Woese et al. 1990). Zuckerkandl and Pauling (1965) first discussed the role of 'informational macromolecules', molecules that carry the genetic information or an extensive translation thereof (DNA, RNA, proteins), as potentially the most informative taxonomic characters and not just one type of characters among other, equivalent types. They viewed the genetic information encoded in these molecules as documents of the evolutionary history of organisms and proposed to use these molecules in creating a molecular phylogeny.

Microorganisms frequently lack distinctive morphological, developmental, and nutritional characteristics that could be used in systematic analysis (Lane et al. 1985). It was thus a group of bacteriologists, under the direction of C. Woese, who produced the first comprehensive phylogeny of prokaryotes (indeed of life on earth) based on 16S rRNA partial sequences (Woese et al. 1977; Fox et al. 1980). Their studies revealed that instead of two major kingdoms -prokaryotes and eukaryotes-, living systems could be divided into three major evolutionary lineages: archaebacteria, eubacteria, and eukaryotes.


49






50


Each of the primary kingdoms has its particular form of rRNA. Strong 16S rRNA sequence signatures, i.e. positions in the molecule that have a highly conserved or invariant composition in one kingdom, but a different (highly conserved) composition in one or both of the others, define and distinguish the three urkingdoms (Woese 1987). Analysis of the sequence of the small subunit rRNA gene of E. coli revealed that 'universally conserved' elements (short sequences that appear to be conserved in all organisms) are distributed along the entire length of the E. coli 16S rDNA. Similar sequence analyses of small subunit RNA genes from a diverse group of organisms confirmed this observation and identified the existence of 'kingdom-specific' conserved elements (sequences that are conserved only in the eubacteria, archaebacteria, or eukaryotes, respectively) (Sogin and Gunderson 1987). There is a clear tendency for universally conserved nucleotides to fall in unpaired regions of the rDNA. (Gutell et al. 1985).

Increasingly, systematics of organisms is based on sequences, structures, and relationships of molecules, with phenotypic and biochemical properties being used to support these findings (Sogin and Gunderson 1987; Woese et al. 1990). For largely historical and practical reasons, most systematic research has focused on a small subset of genes, especially nuclear rRNA and mitochondrial rRNA and protein-encoding genes. RNA sequencing was feasible before DNA sequencing. Mitochondrial DNA occurs in multiple copies in the cell and is relatively easy to manipulate (Brower and de Salle 1994). Apart from historical and practical considerations, ribosomal genes are particularly well suited for defining evolutionary and systematic relationships because they are universally distributed and functionally homologous in all known organisms (Olsen et al. 1986; Hillis and Dixon 1991). Generally, there are three rRNAs in prokaryotes and four nuclear rRNAs in eukaryotes. The RNAs of bacteria are 5S (- 120 nucleotides), 16S (~ 1500 nucleotides), and 23S (- 2900 nucleotides). The nuclear RNAs of eukaryotes are 5S,

5.8S (- 160 nucleotides), 18S (- 1800 nucleotides), and 28S (> 4000 nucleotides) (Hillis






51


and Dixon 1991). Mitochondria and chloroplasts code for their own rRNAs ranging from 12S to 21S in mitochondria and 5S to 23S in chloroplasts.

The larger rRNAs can be used over a wide range of phylogenetic distances, from the full span of the universal tree to distinction among species within the same genus. This is due to the fact that ribosomal sequences have both highly conserved and variable regions (Olsen and Woese 1993). Different regions of the rDNA repeat unit evolve at very different rates. The most studied rRNA is the small subunit nuclear gene, 16S/18S rRNA. It has been studied most extensively because of its size and because regions of it are among the slowest evolving sequences found throughout living organisms. The slow rate of change permits the construction of many nearly universal primers. The large subunit (23S/28S) nuclear rRNA gene is larger and shows more variation in rates of evolution of its different domains than does the small subunit. The 5.8S and 5S genes are also conserved, but the shortness of the sequence greatly restricts phylogenetic usefulness. Furthermore, the larger rRNAs provide sufficient sequence information to permit statistically significant comparisons (Olsen et al. 1986).

Typically, several hundred tandemly repeated copies of rRNA genes (rDNAs)

exist in a eukaryote nuclear genome. A transcription unit consists of a linear arrangement of three genes (coding for 18S, 5.8S, and 28S rRNA) which are separated by two internal transcribed spacers. An external transcribed spacer is located upstream of the 18S gene. The transcribed spacers contain signals for processing the rRNA transcripts. Adjacent copies of the rDNA repeat units are separated by nontranscribed spacers. In prokaryotes there are one to several copies of the rRNA genes, and the genes may be organized into a single operon (in which they are usually separated by the tRNA gene), or they may be dispersed throughout the genome. The gene for the 5S rRNA is closely associated with the other rRNA genes in many prokaryotes but is found elsewhere in the nuclear genome of most eukaryotes (Hillis and Dixon 1991).






52


The multiple copies of nuclear rRNA genes do not evolve independently but in concert (Arnheim 1983). In other words, each copy of an rRNA array is usually very similar to the other copies within individuals and species, although differences among species accumulate rapidly in parts of the array. The differences among arrays within individuals are mostly length variation in the nontranscribed spacer. The low level of heterogeneity at about 0.1% of the nucleotide positions (Mylvaganam and Dennis 1992) among rDNA within individuals (and throughout species) indicates that the multiple copies are homogenized (concerted evolution). The number of rDNA repeats, though, is known to vary widely among individuals within species that have been studied (Hillis and Dixon 1991). Exceptions to concerted evolution have been reported. For example, in the archaebacterium Haloarcula marismortui which has two nonadjacent rRNA operons, the 16S rRNA genes within the two operons differ in about 5% of the nucleotide sequence (Mylvaganam and Dennis 1992). The number of rRNA genes varies from seven in E. COi, to between 100 and 200 in lower eukaryotes, to several hundred in higher eukaryotes. Estimates of copies of the 18S-28S gene for different organisms include, for example, 150-250 in Drosophila melanogaster, 200-280 in humans, 100-140 in Saccharomyces cerevisiae, and 450 in Xenopus laevis (Lewin 1994; Gerbi 1985).

The mitochondrial rRNA genes develop much more rapidly than the nuclear rRNA genes. The spacer regions of rDNA arrays have been used less frequently for phylogenetic studies; variation in spacer regions has been used to identify species or strains, to study hybridization, and as markers in population genetics studies (Hillis and Dixon 1991).

Microsporidia are peculiar eukaryotes that lack mitochondria, peroxisomes and a 'typical' Golgi apparatus (Canning 1988). They have ribosomes with prokaryotic properties. Ishihara and Hayashi (1968) determined that ribosomes of Nosema bombycis have a sedimentation coefficient of 70S like bacteria and blue-green algae and not of 80S like the eukaryotes. The ribosomal subunits have sedimentation coefficients of 50S and 30S (typical of prokaryotes), and not of 40S and 60S (typical of eukaryotes). The small






53


and large ribosomal subunits in turn, as determined for Thelohania maenadis and Inodosporus sp., contain 16S and 23S RNA like prokaryotes and not 18S and 28S RNA like eukaryotes (Curgy et al. 1980).

Furthermore, as shown by Vossbrinck and Woese (1986), the microsporidium Vairimorpha necatrix does not have a 5.8S rRNA. The 5.8S rRNA is a nearly universal eukaryotic characteristic. It has no size counterpart among prokaryotes although its sequence is homologous with the first 150 or so 5' nucleotides of the prokaryotic 23S rRNA. As in prokaryotes, V. necatrix has a large subunit rRNA (23S) whose 5' region corresponds to the 5.8S rRNA. Because of the unusual molecular and cytological characteristics of microsporidia, Vossbrinck et al. (1987) sequenced the 16S rRNA of V. necatri to clarify the phylogenetic position of microsporidia. The V. necatri 16S rRNA sequence is far shorter than a typical eukaryotic (18 S) small subunit rRNA and, at only 1,244 nucleotides, even appreciably shorter than its prokaryotic (16S) counterpart (E. coli small subunit rRNA is about 1,500 nucleotides long). They found little overall homology between V. necatri 16S rRNA sequence and those of other eukaryotes and concluded that the lineage leading to microsporidia branches very early from that leading to other eukaryotes. It is hypothesized that some of the organisms unique features may signify a split from other eukaryotes very early in time. Kawakami et al. (1992) made yet another unusual observation: Analysis of primary and secondary structure of the 5S rRNA and rDNA of N. bombycis reveals a typical eukaryotic structure.

The objective of this study was to evaluate the taxonomic relationship of

Vairimorpha sp., Thelohania sp., and T. solenopsae to each other based on their 16S rRNA gene sequences. The 16S rRNA genes (nuclear) of T. solenopsae, Tbelohania sp., and Vairimorpha sp. were amplified by PCR, analyzed with restriction fragment length polymorphism (RFLP), and sequenced to gain information on the characteristics of these genes. The molecular data were used as information to evaluate the taxonomic position of the species studied. In addition, the 16S rRNA gene of Agmasoma penaei (Overstreet






54


1973) was amplified and sequenced. We wanted to have a 16S rRNA gene sequence of another Thelohania species to compare to the fire ant Thelohania species. The type species of the genus Thelohania is T. giardi which is found in decapods. It was described at the end of the last century (Sprague et al. 1992), and no further studies have been done with it since. Neither samples of I. giardi nor any 16S rRNA gene sequences of other Thelohania species are available to compare to those of the fire ant Thelohani species. Assuming that A. penaei, formerly called I. penaei, is closely related to the type species of the genus Thelohania, T. giardi, we chose A. penaei as a species to compare to the two Thelohania species. Both species have octosporous sporulating sequences and infect shrimp. Agmasom penaei was moved from the genus Thelohanih to its own genus, Agmasoma, because its polar filament is anisofilar (Hazard and Oldacre 1975).


Materials and Methods



Collection of Test Organisms


Thelohania sp., Vairimorpha sp., and T. solenopsae were collected from S. richteri and S. invicta respectively (chapter II). Thelohania penaei, now named A. penai, was collected and stored in water at 4*C by R. M. Overstreet from an overwintering white shrimp, Penaeus setiferus, in a laboratory mud-substratum pond in Ocean Spring, Mississippi, on 4-12-1991.


Spore Harvest and Purification


Vairimorpha sp. spores were purified from S. richteri adults that died during the trip from Buenos Aires to Gainesville immediately upon arrival at Gainesville. The ants were ground in homogenizing buffer (10 mM Tris-HCI pH 7.5, 1 mM ethylenediaminetetraacetate (EDTA), 0.1% SDS) in a Tekmar tissuemizer and filtered through cotton to






55


remove large body parts. The resulting crude spore suspension was further purified by differential centrifugation on a continuous Ludox (DuPont) gradient (Undeen and Alger 1971). The spores were stored at 4C in Tris-EDTA (TE), pH 8.0 or distilled water until DNA was extracted.

To collect Thelohania sp. spores from S. richteri and I. solenopsae spores from S. invica, fat body cysts were dissected out of the abdomens of 25-30 infected adult workers which had been frozen at -70*C, and collected on ice in 0.1% SDS in 1.5 mL microfuge tubes. The spores were washed twice by centrifugation in deionized water, counted with a hemocytometer and stored in deionized water at 4*C until DNA was extracted. The infection level with V. invicta was so low that spores could not be purified and used in the analysis. Samples of T. penaei were obtained as an aqueous suspension from R. M. Overstreet.


DNA Extraction From Microsporidia

A DNA extraction procedure suggested by M. D. Baker and C. R. Vossbrinck (University of Illinois, Urbana, IL; personal communication) was employed. A range of spores (1x105 1x108) was pelleted in 0.5 mL microfuge tubes by centrifugation at 10,000 g for 1 min and resuspended in 200 pL of sodium chlorideiTris/EDTA (STE) buffer (100 mM NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA). Approximately 200 pL 0.1 mm diameter siliconized glass beads was added to the spore suspension, and the mix was shaken in a mini beadbeater (Biospec) at low speed for 20 sec to break the spores and release their genomic DNA. Immediately after breaking the spores, the homogenate was heated at 95"C for 5 min to inactivate DNA degrading enzymes and centrifuged for 5 min at 10,000 g. The supernatant was removed, frozen solid, thawed and centrifuged again at 10,000 g for 5 min. The supernatant containing the DNA was used for PCR immediately or stored at -20'C for later PCR analysis.






56


PCR Of Microsporidian DNA

The 16S rRNA gene segment was amplified from the microsporidia genomic DNA by PCR using primers designed from the 5' and 3' regions. The DNA sequences for the forward and reverse primers were kindly provided by C. R Vossbrinck and M. D. Baker (personal communication). Restriction sites were incorporated into the sequences at the 5' ends to allow subsequent cloning of the PCR product. The forward primer 18f had a different restriction site sequence incorporated at the 5' end depending on whether Thelohanij sp., T. solenopsae, and A. penaei or Vairimorpha sp. DNA was amplified. The forward primer JM27/18f (5'-TTTGAATTCCACCAGGTTGATTCTGCC-3') was designed to contain an EcoRI site (GAATTC). Another forward primer, RP6/18f (5'-AAGGTACCAGGTTGATrCTGCCTGACG-3') was designed to contain a KpnI site (GGTACC). JM27/18f was used for Thelohania sp., I. solenopsae, and A. penaei DNA amplification. RP6/18f was used to amplify Vairimorpha sp. DNA. The reverse primer 1492r (5'-YTTGGATCCGGTTACCTTGTTACGACIT-3') was the same for all amplifications, and it was designed to contain a BamHI site (GGATCC). Primers 18f and 1492r can be used to amplify the 16S rRNA gene of most microsporidia. Primer 18f (5'-CACCAGGTTGATTCTGCC-3') is located on nucleotides 1-18, primer 1492r (5'-GGTTACCTTGTTACGACTT-3') on nucleotides 1117-1098 on the V. necai 16S rDNA sequence. The sequence 5'-CAGGTrGATTCTGCC-3' of the 18f primer mismatches in two positions with a homologous sequence of primer 18e (5'-CTGGTTGATCCTGCCAGT-3') that can be used to amplify the 18S rRNA gene of many eukaryotes (Sogin and Gunderson 1987; Hillis and Dixon 1991) and prokaryotes (Elwood et al. 1985). The sequence 5'-GGTTACCTTGTTACGACTT-3' of primer 1492r is 100% homologous to Escherichia coli 16S rDNA.

PCR amplification was optimized for each new DNA template by testing 1, 5, and 10 pL (10 pL had less than 10 ng of DNA; determined by gel electrophoresis) of the






57


crude DNA preparation with two MgCl2 concentrations (1.5 mM and 2.5 mM) and two primer concentrations (4 and 8 pM) in 25 pL reaction volumes. Based on the optimizations, standard conditions for PCR were as follows: Each 50 pL reaction contained 1 pL of microsporidia genomic DNA (<< 10 ng), 4 pM of each primer (forward and reverse), 0.2 mM of each dNTP (Boehringer Mannheim), DNA polymerase and the appropriate buffer. Either 1.6 U of Taq DNA polymerase (Boehringer Mannheim) or 0.6 U of PrimezymeTm DNA polymerase (Biometra) were used. The Taq DNA polymerase lx reaction buffer contained 10 mM Tris-HCI, 50 mM KC, and 2.5 mM MgCl2. The PrimezymeTm DNA polymerase lx reaction buffer contained 10 mM Tris-HCl, 50 mM KCl, 0.1% Triton X-100, and 2.5 mM MgCl2. The reactions were overlaid with either 100 pL sterile glycerol or 50 pL Chill-out 14Tm Liquid Wax (MJ Research). The reactions were carried out in an MJ Research thermocycler using the temperature profile: 94"C for 5 min, then 94*C for 1 min, 520C for 1 min, and 72C for 1 min for 35 cycles. A final extension step of 72C for 15 min was done after 35 cycles. A 5 pL aliquot from each reaction together with 5 pL of lx loading dye (5% glycerol, 5 mM EDTA, 0.05% bromphenol blue) was electrophoresed on a 0.8% Seakem LE agarose gel in Tris-acetate buffer (TAE; 40 mM Tris-acetate, 1 mM EDTA, pH 8.0). Ethidium bromide (EtBr) at a concentration of 0.25 pg/mL was incorporated into the gel and electrophoresis buffer to stain and visualize the DNA by UV transillumination. PCR products from three reactions were pooled and purified with the QlAquick PCR Purification Kit (QIAGEN) by following the manufacturer's instructions, eluted in sterile, distilled water or TE pH 8.0 (10 mM Tris, 4 mM EDTA) and stored at -20'C. For cloning and restriction digests, elution in TE buffer, pH 8.0, was suitable. The DNA concentration of the purified PCR product was determined by electrophoresing an aliquot with a standard of lambda (k) bacteriophage DNA cut with HindIII (X/HindIII cut DNA) and comparing the intensity of the ethidium bromide stained bands to each other.






58


Cloning of the 16S rRNA Gene

PCR products of Thelohania sp., Vairimorpha sp. and T. solenopsae were cloned into the plasmid pTZ 19R vector (Pharmacia) by transforming _E. coli JM109 cells using the following protocol.

Pretreatment of PCR Product: The PCR products were digested with Proteinase K (50 pg/mL) in 10 mM Tris-HCI, 5 mM EDTA, and 0.5% SDS to remove the Taq DNA polymerase bound to the DNA (Crowe et al. 1991). The Proteinase K digestion was carried out at 37*C for 30 min and then treated at 800C for 10 min to heat inactivate the enzyme. The Proteinase K treated PCR product was cleaned using the QIAquick PCR Purification Kit (QIAGEN). To check the recovery rate, a 2 pL aliquot was fractionated on a gel and the concentration estimated by comparing it with a known amount of V/HindII cut DNA as described earlier.

Restriction Enzyme Digest: Thelohania sp. and T. solenopsae PCR products were double digested with EcoRI and BamHI (New England Biolabs) to create sticky ends for cloning. For the digest, 48 pL of amplified DNA (or 2-3 pg), 1 pL of each enzyme (20 U/pL), and 5.5 pL of the appropriate lOx restriction buffer (manufacturer's instructions) were mixed and incubated at 37"C for 4 h. Simultaneously, the plasmid DNA, pTZ 19R (1 pg/10 pL) was double digested to create compatible sticky ends. Vairimorpha sp. PCR products were digested sequentially with KpnI and BamHI (New England Biolabs) to create sticky ends using the appropriate buffers according to the manufacturer's instructions. For the restriction digest, 48 pL of amplified DNA, 1 pL of KpnI (15 U/pL), 0.5 pL bovine serum albumine (BSA), and 5 pL of lOx restriction buffer were incubated at 37*C for 2 h. The enzyme was heat-inactivated at 70'C for 10 min, followed by the addition of 1 pL of BamHI (20 U/pL), 5 pL of lOx restriction buffer and incubation for another 2 h at 37*C. Plasmid pTZ 19R DNA was digested with KpnI and BamHI at the same time to create compatible sticky ends. Digested PCR products were






59


purified using the QlAquick PCR Purification Kit as described earlier and eluted in 50 pL sterile, distilled water.

The plasmid DNA was purified from SeaPlaque agarose. The digested plasmid

DNA was loaded onto a 0.8% SeaPlaque agarose gel and electrophoresed to separate the 3 kb plasmid fragment from the 1.3 kb insert. The fragment was cut out, melted at 68TC for 30 min and diluted with agarose diluent (200 mM NaCL, 20 mM Tris-HCl, pH 8.0,

2 mM EDTA) to at least 0.3% agarose concentration (Maruniak et al. 1984). The DNA was then phenol and ether extracted (3x each) and ethanol precipitated (1/2 vol of 7.5 M ammonium acetate and 2 vol of 100% EtOH, incubation on ice for 10 min, centrifugation at 10,000 g for 10 min, wash with 70% EtOH, vacuum dry). The resulting pellet was dissolved in 20 pL of distilled water.

Ligation: A 1:3 ratio in moles of vector:PCR product DNA was used (Bethesda Research Laboratories 1979). Specifically, 200 ng of pTZ 19R DNA and 250 ng of PCR product DNA were ligated to each other in a 40 pL reaction with 1 pL T4 DNA ligase (1 U/pL) and 4 plL lOx reaction buffer (New England Biolabs) at room temperature overnight in the dark (modified from manufacturer's protocol).

Transformation of E. coli JM109 Competent Cells: To inactivate the T4 DNA ligase and enhance transformation, the ligation mix was heat-treated at 650C for 10 min. A 50 pL aliquot of E. coli JM109 competent cells was thawed on ice, and 1 or 5 PL aliquots of ligated DNA were gently mixed with the cells. The cells were sequentially incubated on ice for 30 min, heat shocked at 370C for 30 sec, and cooled on ice for 2 min. Then, 0.95 mL of room-temperature superoptimal catabolite (S.O.C.; BRL personal communication) media was added, and the cells were grown at 37C and 225 rpm for 1 h. A 100 pL aliquot was plated on Luria-Bertani (LB) agar media supplemented with 5Bromo-4-chloro-3-indolyl- -D-galactoside (X-Gal; 20 pg/mL) and ampicillin (100 pg/mL) and incubated for 16 h at 370C. Ampicillin-resistant clear colonies were






60


selected as potential clones and picked off the plates for further analysis (Bethesda Research Laboratories Life Technologies, Inc. transformation protocol).

Dot Blot to Confirm Clones: All clear colonies that grew on the X-Gal and ampicillin enriched LB plate were streaked in a grid pattern on a fresh LB plate supplemented with 100 pg/mL ampicillin and incubated over night at 37"C for 16 h to develop E. coli transformant colonies. For hybridization, a nylon membrane (Zeta Probe) was cut (10 cm x 15 cm) and dots, 1 cm apart from each other, were marked on it with a soft pencil. A tooth-pick head full of each numbered E. .cli transformant colony was suspended in 10 pL LB broth and 1 pL of that suspension spotted on a marked area. To denature the bacterial DNA, the membrane was sequentially immersed in 0.5 M NaOH/ 1.5 M NaCl for 30 sec, 0.5 M Tris-HCl pH 8.0/1.5 M NaCl for 5 min, and 6x standard saline citrate (SSC) for 5 min. The membrane was wrapped in Whatman Blot paper and baked at 80*C for 2 h. Prehybridization, hybridization, and washes were done in a Mini Hybridization Oven OV3 (Biometra). The membrane was prehybridized for 4-6 h at 68*C in 6x SSC, 0.5% SDS, 5x Denhardt's solution, 0.01 M EDTA, and 100 pg/mL denatured herring sperm DNA (Sambrook et al. 1989). To make the probe, 1 gg PCR product was labelled with 32P-dATP using a nick translation kit (USB Nick Translation Protocol). The membrane was hybridized for 16 h at 68*C in hybridization buffer (6x SSC, 0.5% SDS, 5x Denhardt's solution, 0.01 M EDTA) containing the nick translated PCR-amplified 16S rRNA gene of the microsporidian species to be tested. The membrane was washed twice in 2x SSC and 0.5% SDS at 68*C for 2 h each and heat-sealed in a plastic bag. It was exposed to an x-ray film overnight at -70'C.

Glycerol Stock from Positive Clones: The clones that showed strong hybridization to the probe (positive clones) were picked from the LB plate and grown in 3 mL terrific broth (TB) containing 35 pg/mL ampicillin overnight at 37"C and 225 rpm. The next day, 850 gL of the cell suspension was added to 150 gL of sterile glycerol to make a 15% glycerol stock and stored at -70*C. To grow up glycerol stocks for plasmid purification,






61


10 iL of glycerol stock was added to 3 mL TB containing 35 pg/mL ampicillin and grown overnight at 37C and 225 rpm.

Plasmid DNA Purification: The alkaline lysis method combined with DNA

precipitation by polyethylene glycol (PEG) was used to purify the plasmid DNA carrying the cloned DNA from E. coli transformants (Nicoletti and Condorelli 1993). E. _li transformant cells were suspended in 200 pL glucose/Tris/EDTA (GTE) buffer (50 mM Glucose, 25 mM Tris pH 8.0, 10 mM EDTA pH 8.0) and lysed with 300 pL of 0.2 N NaOH/1% SDS for 5 min on ice. Chromosomal DNA was precipitated with 300 pL of

3.0 M potassium acetate (KOAc), pH 4.8 for 5 min on ice. After centrifugation, the supernatant was collected and treated with RNAse A (20 pg/mL) for 20 min at 37*C. After two chloroform extractions to remove proteins and residual chromosomal DNA, the plasmid DNA was ethanol and PEG precipitated (PEG precipitation: dissolve DNA pellet in 32 gL distilled H20, add 8 gL 4 M NaCl and mix, add 40 gL 13% PEG8ow, incubate on ice for 1 h, centrifuge at 4*C and 10,000 g for 15 min.) The resulting DNA pellet was resuspended in sterile distilled water. To confirm the presence of the 16S rRNA gene insert, the hybrid plasmid was digested with the appropriate restriction enzymes, and the size of the insert was compared to the purified PCR product and linearized PTZ 19R plasmid DNA by separating on a gel.


Restriction Fragment Length Polymorphisms of the 16S rDNA


Several enzymes were tested on Thelohani sp., I. solenopsae, and

Vairimorpha sp.: Sau3A (4U/pL), HhaI (20U/pL), HaeIII (8U/pL), AciI (5U/pL), and a double-digest of HincII (8U/pL) and HindIII (20U/pL) (New England Biolabs). Digests were performed in 20 pL volumes using 12 pL of PCR product (~ 700 ng), 0.5 pL of each enzyme, 2 pL of the specific lOx restriction buffer (manufacturer's instructions), and

5.5 pL of deionized H20. The reaction mixes were incubated at 37*C for 2 h. The






62


restricted DNA samples were electrophoresed with 2 pL of lOx loading dye (50% glycerol, 50 mM EDTA, 0.5% bromphenol blue) on a 3% Nusieve GTG/1% Seakem LE agarose gel.


Sequencing of the 16S rDNA

Purified PCR products of Thelohania sp. Vairimorpha sp., and A. penaei, eluted in sterile, distilled water, were used as sequencing templates. The sequence of the PCR products was completed by redundant sequencing of both strands. Hybrid plasmid DNA, carrying the cloned T. solenopsa rDNA, in sterile, distilled water was used for sequencing. The consensus sequence was obtained by redundant sequencing of both strands of three clones.

Sequencing was completed by using three primers in each direction. The

sequences of the primers are listed in Table 4.1. Sequences for RP7/530f, RP9/1061f, RP8/1047r, and RP10/530r primers were obtained from C. R. Vossbrinck and M. D. Baker (personal communication).

The following primers were used for Thelohania sp.: JM27/18f, RP7/530f, RP9/1061f, RP4/1492r, RP8/1047r, and RPlO/530r. The primers used to sequence T. solenopsae were M13f, RP7/530f, RP12f, M13r, RP8/1047r, and RPlO/530r. Primers used to sequence the Vairimorpha 16S rRNA gene were identical to the ones used for Thelohania sp., except that RP6/18f was used instead of JM27/18f. Primer RP9/1061f was replaced with RP1 if to sequence the A. penaei 16S rRNA gene, and all the other primers were the same as in Thelohania sp.

Both manual and automated DNA sequencing methods were employed. Manual cycle sequencing was performed by the dideoxynucleotide chain termination sequencing method (Sanger et al. 1977) using the fmoll" sequencing kit (Promega). For each set of sequencing reactions, 2 pL of each d/ddNTP mix (either d/ddATP, d/ddTTP, d/ddCTP or






63


d/ddGTP) were pipetted into a 0.5 mL microfuge tubes. Then 500 fmol of template DNA (either plasmid template or PCR product), 4 pmol of primer, 6 pCi [a-"S]dATP, 5 l of fmolR 5x sequencing buffer (250 mM Tris-HCl, pH 9.0, 10 mM MgCl2), and sterile distilled water were combined to a final volume of 16 pL, and 1 pL of sequencing grade Taq DNA polymerase (5U/pL) was added to the primer/template mix. Four pL of the enzyme/primer/template mix were added to each d/ddNTP mix. The reactions were overlaid with 20 piL of Chill-out 14Tm Liquid Wax (MJ Research), placed in a MJ thermal cycler preheated to 94*C, and subjected to the following temperature profile: 94"C for

2 min, then 94*C for 30 sec, 420C for 30 sec, 70*C for 1 min (30 cycles). They were

Table 4.1. List of Sequencing Primers Used


Forward Primer


JM27/18f

RP6/18f RP7/530f

RP9/1061f RP11f RP12f M13f (-20)


Reverse Primer

RP4/1492r RP8/1047r RP10/530r Ml3r (-24)


Nucleotide Sequence of Primer (5'-3')


TTT GAA TYC CAC CAG GTT GAT TCT GCC AAG GTA CAA GGT TGA TTC TGC CTG ACG

GTG CCA GC(AC) GCC GCG G

GGT GGT GCA TGG CCG GGT CGT TGT AAA CTC

GGA GTG GAT TAT ACG G GTA AAA CGA CGG CCA GT


TFT GGA TCC GGT TAC CTT GTT ACG ACT T

AAC GGC CAT GCA CCA C

CCG CGG C(GT)G CTG GCA C

AAC AGC TAT GAC CAT G






64


cooled to 4*C until the sequencing reactions were stopped by addition of 3 iL of fmolR sequencing stop solution (10 mM NaOH, 95% formamide, 0.05% bromphenol blue,

0.05% xylene cyanole) to each tube.

Immediately before loading the reactions on a sequencing gel, they were heated at 700C for 2 min. The products (3.5 ptL per lane) were run on a 8%, 19:1 acrylamide: bisacrylamide gel at 1800 V. After fixing (30 min in a solution of 5% acetic acid and 15% EtOH) and drying in a gel dryer on Whatman 3MM paper (1 h at 80'C), the gel was exposed to Kodak diagnostic x-ray film at -70'C (United States Biochemical Sequencing Support Service; DNA Sequencing Guide).

Automated sequencing was done by the DNA Sequencing Core Laboratory of the University of Florida's Interdisciplinary Center for Biotechnology Research. Sequencing was accomplished by employing the Taq DyeDeoxy Terminator (part number 401388) Cycle Sequencing protocol developed by Applied Biosystems (a division of Perkin-Elmer Corp., Foster City, CA) using fluorescent-labeled dideoxynucleotides. The labeled extension products were analyzed on an Applied Biosystems Model 373A DNA Sequencer.


Sequence Data Analysis


Analysis of the 16S rRNA gene sequences was done using the Genetics Computer Group (GCG) Sequence Analysis Software Package (Devereux et al. 1987) and Phylogenetic Analysis Using Parsimony (PAUP) version 3.1.1 (Swofford 1993). To confirm the RFLP digests, enzyme restriction maps with the enzymes tested in the RFLP digests were created for each of the three fire ant microsporidia with MAP.

Ribosomal gene sequences of microsporidia from a variety of host organisms including insects (Hymenoptera, Lepidoptera), fish and humans and the protozooan Giardi lamblia, used as outgroup, were obtained from GenBank (G. lamblia, Sogin et al.






65


1989; Ameson michaelis, Zhu et al. 1993; Endoreticulatus schubergi, Ichthyosporidium sp., Nosema bombycis, Encephalitozoon hellem Baker et al. 1995; Pleistophora sp., Glugea atherinae, N. corneum, DaSilva et al. unpublished, direct submission 1994; Encephalitozoon cuniculi, Zhu et al. 1993; Enterocytozoon bieneusi, Zhu et al. 1993; Septata intestinalis, Visvesvara et al. 1995; N. apia, Malone et al. 1994; N. trichoplusiae, Pieniazek et al. unpublished, direct submission 1994; N. vespula, Ninham unpublished, direct submission 1994; V. necatrix, Vossbrinck et al. 1987). Giardia lamblia was chosen as an outgroup because, like microsporidia, it is a primitive eukaryote with a 16S like rRNA. It has two nuclei and lacks mitochondria, a normal endoplasmatic reticulum or Golgi. In a multikingdom tree based on rDNA sequences, Q. lamblia represents the earliest diverging lineage in the eukaryotic line of descent. Its branching is followed by Y. necatrix (Sogin et al. 1989).

A multiple sequence alignment of those sequences together with the sequences of Vairimorpha sp., Thelohania sp., I. solenopsae, and A. penaei was performed with the programs PileUp and Clustal (Genetics Computer Group, Inc., Madison, Wisconsin). The multiple sequence alignment file was analyzed with PAUP. A distance matrix was created, and the heuristic option of PAUP was used to find the optimal phylogenetic tree. A phylogenetic tree illustrates the evolutionary relationships among a group of organisms (Li and Graur 1991). A bootstrap analysis was performed to place confidence estimates on the groups contained in the optimal tree.

A distance matrix shows a pairwise comparison of all the taxa. Absolute distances could also be called absolute differences and are shown in the lower triangle of the table. Absolute distances give the numbers of nucleotides that differ between two sequences. However, a change from one state (i.e. nucleotide) to another at a particular position is counted only if that position is not missing for either of the taxa. Mean distances (given in upper triangle) are calculated by dividing the absolute distance by the total number of characters that are not missing for either taxon and thus represent the percent nucleotide






66


difference between two taxa. Mean distances are more meaningful when some taxa have much higher proportions of missing data than others (PAUP 3.1 User's manual).

The phylogenetic tree was constructed based on the principle of maximum

parsimony or minimal evolution. Maximum parsimony involves the identification of a tree that requires the smallest numbers of evolutionary changes to explain the differences observed among the taxa under study (Li and Graur 1991). In molecular phylogeny the maximum parsimony method should be called a character-state method (Li and Graur 1991) because character states are used and the shortest pathway leading to these character states is chosen as the phylogenetic tree. The heuristic option is a search using a heuristic or approximate algorithm. It was chosen because the microsporidian data set was fairly large (20 taxa) and the heuristic search generally provides the fastest way to find optimal trees.


Results



Spore Harvest

Dissection of 25-30 infected adult ants yielded about 1x107-1x108 spores which amounts to approximately 3x105-3x106 spores per ant. When cysts were collected in deionized water they stuck to the side of the plastic tubes which the addition of SDS prevented.


PCR of Microsporidian DNA

It was found, that with each template tested, all three DNA concentrations (1, 5, and 10 pL of crude DNA preparation with a concentration of less than 10 ng in 10 pL) were amplified and that the 4 pM primer concentration worked as well as the 8 pM primer






67


concentration. The MgCl2 concentration was the crucial factor; 2.5 mM MgCl2 gave more consistent amplification results than 1.5 mM.

For DNA extraction and PCR, 1x107-1x108 spores were sufficient. If DNA extraction and PCR were performed with 1x105 or 1x106 spores (using the same procedures as for the larger spore samples), no PCR product was obtained. A size difference existed between the amplified DNA fragments from Thelohania sp. and T. solenopsae (- 1400 bp) to Vairimorpha sp. and A. penaei (- 1300 bp) (Figure 4.1).


Cloning of the 16S rRNA Gene


Figure 4.2 presents a sketch on how the PCR products of T. solenopsae and Thelohania sp. were cloned into the pTZ 19R plasmid DNA. The cloned construct of Vairimorpha sp. was similar except that KpnI was used instead of EcoRI to create sticky ends of the plasmid and PCR product DNA. The cloning procedure did not result in any clones if the PCR products were not pretreated with Proteinase K (results not shown). Proteinase K treatment was necessary to improve cloning efficiency.


Restriction Fragment Length Polymorphism of the 16S rDNA


Figure 4.3 shows three restriction cuts (Sau3A, HhaI and HaeIII) for

Thelohania sp., T. solenopsae, and Vairimorpha sp. The restriction patterns for each enzyme showed differences among Vairimorpha sp. and the two Thelohanij species, but the latter two species had identical restriction profiles. As detected by gel electrophoresis, the two Thelohania species had two restriction sites each for Sau3A and HhaI, and four restriction sites for HaelII. The fragment sizes were roughly 750, 500, and 200 bp when cut with Sau3A; 760, 350, and 300 bp when cut with HhaI; and 750, 420, 180, 60, and 50 bp when cut with HaeIII. Vairimorpha sp. had one restriction site for Sau3A (fragments






68


MW


EI MW


2036 1636 -


-o go du -0


1018


Figure 4.1. PCR products of the 16S rRNA gene of four microsporidian species. Photograph of crude PCR products following gel electrophoresis. PCR was carried out as described in the 'Methods' section. Approximately 300 ng (- 30 ng/ gL) of each PCR product was electrophoresed with 1 pL of lOx loading dye (50% glycerol, 50 mM EDTA, 0.5% bromphenol blue) on a 0.8% Seakem LE agarose gel in Tris-acetate buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.0). A standards, )/HindIII cut DNA (200 ng) was included to determine the molecular sizes of the PCR products.


IPF" - '- M






69


BamHI UNIVERSAL
SEQUENCING PRIMER
.- TGACCGGCAGCAAAATG
AACAGCTATGACCATG.....G GATCC PCR G AATTCAC GTCGTT TAC
T TGTCGATACTGGTAC.....CCTAG G PRODUCT CTTAA GTGACCGGCAGCAAAATG AACAGCTATGACCATG
REVERSE EcoRI
SEQUENCING PRIMER






pTZ 19R
(2860 bp)



Figure 4.2. Cloned pTZ 19R Construct. The cloning procedure is described in detail in the 'Methods' section and in the appendix.



of approximately 700 and 650 bp), three restriction sites for HhaI (fragments of approximately 470, 300, 280, and 250 bp) and four restriction sites for HaeIII (fragments of about 460, 350, 300, and 170, and 30 bp).

Of the other enzymes tested (results not shown), the double digest with HincI and HindIll separated Vairimorpha from the two Thelohania species which in turn had identical profiles. AciI cut the species tested into many small fragments resulting in smears. Analysis of the completed sequences with MAP revealed that the Thelohania species each had nine restriction sites for AciI. Vairimorpha sp. had twelve restriction sites for AciI. The MAP analysis also showed that it did not have HincI restriction sites as opposed to the Thelohania species.






70


Sau3A
MW 1 2 3


Hha 1
1 2 3


HaeIII
1 2 3 MW





600


--m


220 201
154 134


- 100


1: Thelohania sp.


2: T. solenopsae


3: Vairimorpha sp.


Figure 4.3. Restriction profiles of 16S rRNA gene PCR products of three microsporidian species. Photograph of restricted PCR products following gel electrophoresis. About 700 ng of crude PCR product of each species was digested for 2 h at 37"C with either Sau3A, HhaI, or HaeIllI in a 20 pL reaction volume. The samples were electrophoresed with 2 pL of lOx loading dye (50% glycerol, 50 mM EDTA, 0.5% bromphenol blue) on a 3% NuSieve GTG/1% Seakem LE agarose gel in Tris-acetate buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.0). Two standards, X/HindIII cut DNA (200 ng) and a 1 kb DNA marker (200 ng), were included as molecular weight markers.
1 = Thelohania sp., 2 = T. solenopsae, 3 = Vairimorpha sp.


1018


517/506
396
344 298






71


Sequencing of the 16S rDNA


The PCR primers 18f and 1492r were not suitable as sequencing primers for cycle sequencing with the fmolff sequencing kit because of problems with the sequencing reactions. Mike Baker (University of Illinois, Urbana, II, personal communication) also was unable to use the PCR primers for cycle sequencing. He designed slightly modified sequencing primers which were moved several bases into the sequence of the PCR products. We did not design new primers because the PCR primers 18f and 1492r could be used as sequencing primers for automated sequencing by the DNA Sequencing Core Laboratory of the University of Florida's Interdisciplinary Center for Biotechnology Research (ICBR). Differences in experimental procedures likely account for this observation.

The 5' nucleotide of RP9/1061f mismatched with the 16S rDNA sequence of Thelohania sp. as determined by (1) failed sequencing reactions and (2) subsequent sequence comparison with the complementary strand of Thelohania sp. It did work to sequence the T. solenopsae (even though it also mismatched at the same position) but not the Thelohania sp. 16S rRNA gene in which it was replaced with RP12f.

The cloned PCR product DNA of T. solenopsae was used as sequencing template, and the sequence of the entire PCR product (1,382 bp) was obtained since sequencing primers located adjacent to the multiple cloning site were employed. PCR products of Thelohania sp., Vairimorpha sp., and A. penaei were sequenced directly. The sequenced fragments represented the majority of the PCR products (except the extreme 5' and 3' ends). The sizes of the sequenced fragments were 1,130 bp (Thelohania sp.), 1,252 bp (Vairimorpha sp.), and 1,260 bp (A. penaei). A multiple alignment of the sequences together with ribosomal gene sequences from other microsporidia is presented in Figure

4.4. Regions conserved throughout all the taxa aligned are identified by '*'.









72


1
Thelohania op. T. solenopeae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopae
N. boinbycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha up.
A. michaelis



Thelohania op. T. solenopsa.
N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penasi G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis


60


--------------------------------------------------------------------CACCAGGTTGATTCTGCCTGACGTAG-ACGCTATACTCTAAGATTAACCC
---------- CACCAGGTTGATTCTIGCCTGACGTAG-ACGCTATACTCTAAGATTAACCC
--------------------ATTCTGCCTGACGTAG-ACGCTATTCCCTAAGATTAACCC
----------CACCAGGTTGATTCTGCCTGACGTAG-ACGCTATTCCCTAAGATrAACCC
-----------------------------GACGTAG-ACGCTATTCCCTAAGATTGGCCC
-------------------- ATTCTGCCTGACGTGG-A TGCTATTCTCTGGGGCTAAGCC
----------CACCAGGTTGATTCTGCCTGACGTGG-ATGCTATTCTCTGGGACTAAGCC
----------CACCAGGTTGATTCTGCCTGACGTGG-AGGCTATTCTCTGGGGCTAAGCC
----------CACCAGGTTGATTCTGCCTGACGTAG-ACGCTAGTCTCTGAGATTAAGCC
---------- CACCAGGTTGATTCTGCCTGACGTAG-ACGCTAGTCTCTGAGATTAAGCC
----------CACCAGGTTGATTCTGCCTGACGTAG-ATGCTAGTCTCTAAGATTAAGCC
----------CACCAGGTTGATTCTGCCTGACGTAG-ATECTAGTCTCTGAGATTAAGCC
---------------------------------------------------------------------CACCAGGTTGATTCTGCCTGACGTGG-ATGCTAGTCTCATAGGTTAAGCC
---------- CACCAGGTTiGATTCT(CCTGACGTGG-ATGCTAGTCTCTAAAGTTAAGCC
-------- ----------------- ------------------------------------------------GGTTGATTCTGCCTGACGTAGAACGCTAGTCTCACAGATTCAGCC


61 120
----------------------------------------------------------- T
-----------------------------------------------------ATAACAT
ATGCATITATTGAATA----TAAAGA----------------------AAAGACGAACAG
ATGCATGTTTATTGAATA----TAAAGA--------------------AAAGACGAACAG
ATGCATIGTTTTTGATA--------- TGG--------------------AAAAATGGACTG
ATCATGTTTTTGACAT---------TTG----------------------AAAAATGGACTG
ATGCATGTTTTTGACGTACTATGTACTG--------------------AAAGATGGACTG
ATGCATGTTTATGAAGCCTTTATGGGGG--------------------ATTGACGGACGG
ATGCATGTTGATGAA--CCTTGTGGGGG--------------------ATTGACGGACGG
ATGCATGCTTGTGAACTCTTTGTGGGGG--------------------ATTAGCGGACGG
ATGCATGTCTATGAAA-C------------------------------AAGGACGAACAG
ATGCATGTCTATGGAA-C----------------------------------AAGGACGAACAG
ATCATGTTTCCGCAATC------------------------------AGGGACGAATAG
ATGCATGTCAGTGAAGCC-TTACGGTGG--------------------AACGGCGAACGG
----------------------------------- ---- ------------------ATGCATGTCCAAGCGAAGCGTAAGTGGAGCGGCGCA-- -AGGCTCAGTAACGGGCGAGTA ATGATGTCTAAGCAAAGCGTAAGTCGAGCGGCAC ---- AGGCTCAGTAACGGGCGAATA
----------------------------------- ------------------------ATGCAAGTAGTATGTATG------------------------------TAATACACAATGG


121 180
AATCTACATAAA!IGATAACCTTGTCA-- -AGATAAGGCTAATACAGTAAAGANTGTAGA AATCTACATAAATGGATAACCTTGTCA--- AGATAAGGCTAATACAGTAAAGATGTTAGA CTCAGTAACTCTTATTTGATTTGATGTA--TTAGGATTCTAACTATGTTAAATTATAG-G CTCAGTAACTCTTATTTGATTTGATGTA--TTrAGGATTCTAACTATGTTAAATTATAG-G CTCAGTAATACTCACTTTATTTAATGTATTAAATTAGTATAACTGCGTTAAAGTIGTAGCA CTCAGTAATACTCACTATTTTATGTA-CATTTGAAACTAACTACGTTAAAGTGTAG-A CTCAGTAATACTCACTTTATTTGATGTACCTTAT--ACATAACTACGTTAAAGTGTAGCCTCAGTGATAGTACGATGATTTGATTGGGAGCCTGGATGTAACTGGGAAACTGCAG-G CTCAGTGATAGTACGATGATTTGGTTGGCGGGAGAGCTGTAACTGCGGGAAACTGICAG-G CTCAGTGATAGCACGATGATTTGTTTGCGGGAGAGCAGTACTGCGGGAAACTGCAG-A CTCAGTAAAACTGCGATGATTCAGTCTGTCTGTCAAGA-TAACCACGCGAAAGTGTGG-C CTCAGTAAAACTGCGATGATTCAGTCTGTCTGTCAAGA-TAACCACGCGAAAGTGTGG-C CTCAGTAAAACTGCGATGATTTAGTCTGGCTGTGTAGA-TAACTACGTGfAAAATGTAG-C CTCAGTAATGTTGCGGTAATTTGGTCTCTGTGTGTAAACTAACCACGGTAACCTGTGG-C
------------ACTTTTAACTAACCT-TTTGTACTAA-TAATTAAGGGAAACTGTAA-T
TTTGATCTCCTAGAGTGGATATCCTCTGTAACCGGAGGGCA--AAACACAAGATCAGCGA TTTAATCTCCTCGAGTGGATATCCTCTGTAACCGGAGGGCA--AAACACAGGACGTGCAG
----------GGCGTACGGCTCAGT------AGGACAGGGAAATCTAGCCACGAAGGAGGA
CTCAGTATCG--AGTATAGCTTTGCTCTCCAAGATGATACTTTCAGGAAACAGAAA-A








73


Thelohania op. T. molenopsae
N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op.
A. michaelis



Thelohania op. T. solenopeae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaoi G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopsae
N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha sp. A. michaelis


181 240
A -------------GCATGAAAGCGGAGCATCAATGTAGCGTTGGTTTCTGACCTATCAG
A-------------GCATGAAAGCGGAGCATCATTGTAGGATTGGTCTGACCTATCAG
TAA--------------------------- CAATAATACAATAAGAATAAGATCTATCAG
TAA---------------------------CAATAATACAATAAGAATAAGATCTATCAG
TAA---------------------------GACATATACAGTAAGAGTGAGACCTATCAG
TAA---------------------------GATGTGTACAGTAAGAGTGAGACCTATCAG
TAA---------------------------CATATGTACAGTAAGAGTGAGACCTATCAG
TAAGTTCTGGGGGTGGTAGTTTGTAGCTACTGCGTACCGAGTAAGTTGTAGGCCTATCAG TA-------GGGGGCTAGGAGTGTTTTTGACACGAGCCAAGTAAGTTGTAGGCCTATCAG TA-------------GTGGTCTGCCCCTGTGGGTTGGCAAGTAAGTTGTGGGCCTATCAG
TAAG--------------------------AGGGGACAGAACAAGACGCAGGACTATCAG
TAAG--------------------------AGGGGACAGAACAAGACGCAGGACTATCAG
TAAG--------------------------GGAAGGCAGAATAAGACGCAGGACTATCAG
TAAA--------------------------AGCGG--AGAATAAGGCGCAACCCTATCAG
TAAA--------------------------AATCATGAGGATGTGAGGTAGACCTATTAG
TTGACGA--- GGTCGTTCGTTTAACGAATAGTGTAGGAGAGTAAGAAGCCATCCCATCAG TTGTATAA-GGATTGTTCGTTTAAC-ATTAGTGGGGGAGAGTAAGACGCCAGTCCATCAG TAACCA------CGGTAAGCTGTGGCTAAAACGAGCGTGGGTIGAGTTCTOGCCTATCAG TAAAGCATCTATCTTCTAAAGTTTTTTAGAGGAGAGGAGAAGAAG-CACTCACCTATCAG


241 300
TTAGTATGTTTTAAGGGAGAACATAGACTATGACGGGTAACGGGGGATGCACGTCTGA TTAGTAPTGTT TAAGGGAGAACATAGACTATGACGGGTAACGGGGGATGCACGTCTGA TTAGTTGTTAAGGTAATGGCTTAACAAGACTATGACGGATAACGGTATTACTITTAATA
TTAGTTGTTAAGGTAATGGCTTAACAAGACTATGACGGATAACGGTAITACTTTGTAATA CTAGTTGTTAAGGTAATGCTTAACAAGGCAATGACGGGTAACGGTATTACTTTTAATA
CTAGTTGTTAAGGTAATIGGCTTAACAAGGCAGTACGGGTAACGGTATTrACTTTGTAATA CTAGTTGTTAAGGTAATGCTTAACAAGGCAATAACGGGTAACGGTATACTTTGTAATA CTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGGGAGACGGGGGATCAGGGTTTGA CTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGGGAGACGGGGGATCGGGGTTA CTGGTAGTTAGGGTAATGGCCTAACTAGGCGCAGACGGGATACGGGGGATCAGGGTTGG TTAGTTGGTAGTGTAATGGACTACCAAGACGGTGACGGTTGACGGGGAATGAGGGTTCTA
TTAGTTGTAGTGTAATGGACTACCAAGACGGTGACGGTTGACGGGGAATGAGGGrCTA TTwAGTTGGTAGTGTAATGGACTACCAAGACAGTGACGGTTGACGGGAAATTrAGGGTTTT
CTTG GTAGTTAAAGGACTACCAAGGCCATGACGGGTAACGGGAAATCAGGGTTTGA CTAGTTGGTTGTGTAAAGGACTACCAAGGCTATAATGGGTAACGGAGATTTAGTGATCGA TTAGTAAGTAGGGTAAGGGCCTACTTAGACGAAGACGGGT-ACGGGGAATTATCGTTTGA TTAGTAAGTAGGGTAAGGGCCTACTTAGACGAATACGGAT-ACGGGGAATTATCGTTTGA
CTAGTCGGTACGGTAAGGGCGTACCGAGGCAATAACGGGTAACGGGGAATCGGGGrCGA TrAGTAGGTATGGTAAGGGCATACCTAGACGAAGACGGGT-ACGGGGAAGGCAACTTCGA
* ** **** ** ** * ** ****

301 360
TACCGGAGAGGAAGCCTT--AGAAACCGCTT--TCACGTC-CAAGGATGGCAGCAGGCGC TACCGGAGAGGAAGCCTT--AGAAACCGCTT--TCACGTC-CAAGGATGGCAGCAGGCGC
rCCGGAGAAGGAGCCTG--AGAGATTGCT-TACTAAGTCATAAGGATTGCAGCAGGGGC TTCCGGAGAAGGAGCCTG--AGAGATTGC--TACTAAGTC-TAAGGATTGCAGCAGGGGC TTCCGGAGAAGGAGCCTG--AGAGACGGC--TACTAAGTC-TAAGGATTGCAGCAGGGGC TTCCGGAGAAGGAGCCTG--AGAGACGGC--TACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTG--AGAGACGGC--TACTAAGTC-TAAGGATTGCAGCAGGGGC rCCGGAGAGGGAGCCTG--AGAGATGGCT--ACTACGTC-CAAGGATGGCAGCAGGCGC TTCCGGAGAGGGAGCCTG--AGAGATGGCT--ACTACGTC-CAAGGATGGCAGCAGGCGC TTCCGGAGAAGGAGCCTG--AGAGATGGCT--ACTACGTC-CAAGGACGGCAGCAGGCGC TACCGGAGAGGGAGCCTG--AGAGATAGCT--CCCACGTC-CAAGGACGGCAGCAGGCGC TACCGGAGAGGGAGCCTG--AGAGATAGCT--CCCACGTC-CAAGGACGGCAGCAGGCGC TACCGGAGAGGGAGCCTG--AGAGATTGCT--CCCACGTC-CAAGGACGGCAGCAGGCGC TTCCGGAGAGGGAGCCTG--AGAGATGGCT--CCCACGTC-CAAGGACGGCAGCAGGCGC AACCGGAGATGGAAGCTG--AGAAACGGTT--CCAATGTC-CAAGGATAGCAGCAGGCGC TTCCGGAGAGGGAGCCTG--AGAGACGGCT--ACCAGGTC-CAAGGACAGCAGCAGGCGC TrCCGGAGAGGGAGCCTG--AGAGACGGCT--ACCGGGTC-CAAGGACAACAGCAGGCGC TTCCGGAGAGGAAGCCTG--AGAAACGGCT--ACCACGTC-CAAGGAAGGCAGCAGGCGC TTCCGGAGAGGGCGCCTT-TAGAGATGGCG--ACCAGTTC-TAAGGAGTGCAGCAGGCTC
******* ** *** ** **** ***









74


Thelohania op. T. solenopsae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaoi G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopue. N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penasi G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania up. 1. solenopoae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi :. penaei G. atherinae Ichthyosporidium sp. Vairimorpha up. A. michaelis


361 420
GAAACTTAC--CCAATTATT-GTATTGATAGAGGTAGTTATGACGCATGTTAAGATTTTA GAAACTTAC--CCAATTATT-GTATTGATAGAGGTAGTTATGACGCATGTTAAGATTTTA GAAACTTGA-CCTATG-ATA--TTAT-ATTGAGGCAGTTATGAGTAGTATTTTATAATTA GAAACTTGA-CCTATG-ATA--TTAT-ATTGAGGCAGTTATGAGTAGTATTTTATAATTA GAAACTNA-CCTATGGAT--TTTA--TCTGAGGCAGTTATGGGAAGTAATATTCTATTG
GAAACTTPA-CCTATGGAT--TTTA--TCTGAGGCAGTTATG\GGAAGTAATATTATATTG GAAACTN'A-CCTATGGAT--ATTA--TCTGAGGCAGTTATGGGAAGTAACAT--AGTTG GAAACTTG3--CCTAATCCT-TATT--- GGGGAGGCGGTTATGAGAAGTAAGATGTT ---GAAACTIG--CCTAATCCT--- TT--- GGGGAGGCGGTTATGAGAAGTGAG-ITT---GAAACITG--CCTAATCCT--- TT-- -GGGGAGGCGGTTATAGAAGTGAT3GTGTGCGA GAAAATTG--CCCACTGTT- -- T--G-GAGGAGGCAGTTATGAGACGTGAGAAAGAGTGC GAAAATTG--CCCACTGTT--- T--G-GAGGAGGCAGTTATGAGACGTGAGAAAGAGTGC GAAAATTG--CCCACTCTT--- T--G-CAGGAGGCAGTTATGAGACGTGAAGATGAGTAT GAAACTTG--TCCACTCCT--- TACG-GGGGAGACAGTCATGAGACGTGAGTATAAGACC GAAAATTG--CACACTCTT--- TAAT-GGGGATGCAGTTATGAGGTATGACAGAAAGGGT GAAAATACCGCAGCCTG---- CATTCAGGGCGGTAGTAAGGAGACGTGAAAACAATGTG GAAAATTACCGCAGCCTG----CATTCAGGTCGGTAGTAAGGAGACGTGTAAACGATGTG GGAAATTAC--CCACTTG ---- GAGGACCAGAGGTACTATGGGGCGTAAAGATGAGAAA GAAACTTA--CCGAATTATAGAATA-----GAGGTAGTGATGGAAACGTTTATATAGAAA


421 480
AATTFAAACTTCATTAAAGATAGA--TAAGCGACTGGAGGGCAAG-TCTGGTGCCAGCAG AATTGAAACTTCATTAAAGATGGT--TAAGCGACTGGAGGGCAAG-TCTGGTCCCAGCAG TTGTAGTATTTAAGTACATATTACAAGATAAATCGGAGGGCAA-ATCGAGTGCCAGCAG TTGTAGTATTGTAAGTACATATTACAAGATAAATCGGAGGGCAA-ATCGAGTGCCAGCAG TT-TCATATTGTAAAAGTATATGAGGTGATTAATTGAGGGCAA-ATCAAGTGCCAGCAG TT-TCATATTTAAAAGTATATGAGGT3ATTAATTGAGGGCAA-ATCAAGTGCCAGCAG TT-TCACATTAAACGTATGTGAGCAGATTAATTGGAGGGCAA-ATCGAGTGCCAGCAG
-TAGCA-----AGTATAAATTTGTTGTGATTTACTGGAGGGCAAG-TCGGGTGCCAGCAG
-TTTCG-----AGTGTAAAGGAGTCGAGATTGATTGAGGGCAAG-TCGGGTGCCAGCAG GTGCAA-----AGGGAATGGCTATTGTTGTATGTTGGAGGGCAAGCTCGGGTF0CCAGCAG TTGGTA-----AAGAGAAGCAGGAG------AATTGGAGGGCAAG-TTTGGTGCCAGCAG
TT-GTA-----AAGAGAAGCAGGAG------AATTGGAGGGCAAG-TTGTGCCAGCAG
CTTGTA-----AAGAGGGATAGGAG------AATTGGAGGGCAAG-TTTG FCCAGCAG
TGAGTG-----TAAAGACCTTAGGGTGAAGCAATTGGAGGGCAAGCTTGGTGCCAGCAG TATCAA-----TAAATAAGATGACGTAAAGCTATTAGAGGGAAAG-TTTGGTGCCAGCAG CGGGCA--------AAAAACGCACTAGAT---ACAGGAGGACAAG-ACTGGTGCCAGCAC
CAGGTA--------AAGAATGCACTGTAT---ACAGGAGGACAAG-ACTGCTGCCAGCAC
AGTGTA -------- -AAAAGCTTTTTGAATGCGACTGGAGGGCAAG- TCTGGTGCCAGCAG TACTGGTAAAGCAAGTA--------------TTAfAACTGAGGAAAGCTGGTGCCAGCAG


481 540
CCGCGGTAATTCCAGCTCCAGTAGTGCATAT-----ACATCFTAGTTAGAAAGTTTGT CCGCGGTAATTCCAGCTCCAGTAGTGCATAT-----ACATFGC FTAGTTAGAAAGTTT CCGCGGTAATACTTGTTCCGATAGTGTGTATG--ATGATT'GAT3CAGTTAAAAAGTCTGT CCGCGGTAATACTTGTTCCGATAGTGTGTATG--ATGATTGATGCAGTTAAAAAGTCTGT CCGCGGTAATACTTGTTCCAAGAGTGTGTATG--ATGATTGATGCAGTTAAAAAGTCCGT
CCGCGGTAATACTTGTTCCAAGAGTGTGTATIG--AL\ATTGATGCAGTAAAAAGTCCGT CCGCGGTAATACTTCTTCCAAGAGTGTGTATG--ATGATTGATGCAGTTAAAAAGTCCGT CCGCGGTAATACCTGCTCCAGTAGTGTCTATIG--GTGAATGCTGCAGTTAAAAFGTCCGT CCGCGGTAATACCTGCTCCAATAGTGTCTATG--GTGAAGCTFCAGTTAAAAAGTCCGT CCGCGGTTAATTGAATCCTGCCAATTGGGTTG--ATGGATGFCT3CCGTTAAAATGTCCGT CCGCGGTAATACCGACTCCAAGAGTGTGTATG--AGAGATGCTGCAGTTAAAAAGTCCGT CCGCGGTAATACCGACTCCAAGAGTGTGTATG--AGAGATGCTGCAGTTAAAAAGTCCGT CCGCGGTAATACCGACTCCAAGAGTGTGTATG--AGAGATGCTGCAGTTAAAAAGTCCGT CCGCGGTAACTCCAACTCCAAGAGTGTCTATG--GTGGATGCTGCAGTTAAAGGGTCCGT CCGCGGTAATACCAACTCTAAGAGTCTCTATG--CGAGTTGCTFCAGTTAAAAAGTCCGT CCGCGGTAATACCAGCTCCTGGAGTGTCTATGATAT'GATIYCCAGTTAAAGAGTTCGT CCGCTGTAATACCAGCTCCTGGAGTGTCTATG--ATGATTGCTGCAGTTAAAGCGTTCGT
CCGCGGTAATTCCAGCTCCAGGAGCTTCTGTGTGA--GTTGCTGCGGTTAAAAAGTGCGT CCGCGGTAATACTTGCTCCAGGAGCTTATTCG ---- ATATGTTGCGGTTAAAACGTCCGT
**** ** ** ** **** *** *








75


Thelohania op. T. solenopeae
N. bombycis N. trichoplusia
V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopeae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha up. A. michaelis



Thelohania up. T. solenopsae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penasi G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis


541 600
AGCCAGTTTATGGATT-GTTTTTGATAATAGTTATTCTCCAAAAGAGCTAATTTTAACTA AGCCAGTTTATGGATT-GTTTTTGATAATAGTTATTCTCCAAAAGAGCTAATTTTAACTA AGTTT-A-T--------------------------------------------------AGTTT-AT----------------------------------------------------AGTTT-ATA--------------------------------------------------AGTTT-ATA--------------------------------------------------AGTTT-ATT---------------------------------------------------AGTTG-TTTGTATGT-----CTTTTGAGTGT TAATGGrTTAGTGGATGTAG-TTT AGTCT-TTTGTATGT-----CTTTGTTTCGGGGATTATGTCCTGAT'GTGGATGTAA-GAG AGTCT-GTTGTGTATG-TC-T TGTGTGATGTTGGT TGTGTGGATGTAGTGAT AGTCG-TGGAGACG----------GAAAGAGAG--GCGGAGCCTCTTTAGAT------AGTCG-TGGAGACG----------GAAAGAGAG--GCGGAGCCTCTTTGAGAT------AGTCA-TAGAAGGG----------CAAAGAGAGAT3CGAGGTCTCACAGTGCG------AGTCG-TGAATGCA--------A ATGTCGTTTrCAATAGCGATGAGTTTIxCTA-AGTC--TTTPrACGTA--------ATTAAAAATGAATATCAAGTTTCATATTTTTACGTTT AGTCGAAGEGTTATA-ACGGTGTAACAGGCCrCTCTCAAGGAGGGTTATGCGCCGTGA AGTCGAACCGGGTTGA-ATTGCGTGACAGTCAGACTCTCAAGGTGTGATGAGCGCTGTGA AGTCG--GGGAGCAGG-CCAGCAGAAAAGGTGGGGAATCACGCCTAGCATAGTGCAGGAA AGTCGCGGCTEIGGA--- CTGACCTGTAATCTATTTGGTCAACAGATAGATAGGGGCAGTA


601 660
ATTCATAA--- AAATAGAAGCGGATGAAGGTAATTGTATTCACCAGCAAGAGGTAAAATT ATTCATAA--- AAATAGAAGCGGATGAAGGTAATTGTATTCACCAGCAAGAGGTAAAATT TTAT---------AATAAGGATTGTAAGGTATACTGTATGGTTAGGAGAGAGATGAAATG
TTAT---------AATAAGCATTGTAAGGTATACTGTATGGTTAGGAGAGAGATGAAATG TT-T---------AAGAAGCAATATGAGGTTACTGTATAGTTGGGAGAGAGATGAAATG TT-T---------AAGAAGCAATATGAGGTGTACTGTATAGTTGGGAGAAAGATGAAATG AT-T---------AAGAAGCAATATGAGGTGTACTGTATAGTTGGGAGAGAGATGAAATG TATT---------GTAGCAGAGGACGAGGGGCACTGGATAGTTGGGCGAGGGGTGAAATA GTTT---------G--GCAGAGGACGAGGGGCACCGGATAGTTGGGCGAGGGGTGAAATA
GTGT---------GTGGCAGAGGACGAGGGGCACTGGATAGTTPGGCGAGAGGTGAAATG GCTCT--------GGAGAAGCCAACAGGGGGCACAGTATACCAGGGCGAGAGATGAAATG GCTCT--------GGAGAAGCCAACAGGGGGCACAGTATACCAGGGCGAGAGATGAAATG ATGAT--------GGAGGAGCCGATGGGGAACATAGTATACCAGGGCGAGAGATGAAATG ATGTT--------TGCGGAACGGATAGGGAGTGTAGTATAGACTGGCGAAGAATGAAATC ATA----------TATGAGACGGATTGGGAGCATAGTATAACTGGGTTAAGAATGAAATC TTCCATIGG--- AATAAGGAGCGTTTAGGGGCCAGGTATrAAGCGACGAGGGGTGAAATC TTCTGGGG--- AATAAGGAGTCTTTAGGGGCCAGGGTATAAACGGCAAGCGGTAAATIG
--CTGGGA--- CCTAGGGACCGGAGAGGGGCAACCTAATTCTTGGGCGAGGGGTGAAAAC GCAAGTTG ---- GAAAAGAGCAATTTrGTGTCAGCTAATGGTATGGGGAGGGGTAAAGTC


661 720
TGATGAC-CT3GTGAGGACATTCAGAGGCGAAAGCGATTIGCCTAGTACATTTTTGAT --TGATGAC-CTGGTGAGGACATTCCGAGGCGAAAGCGATTICCTAGTACGTTTTTGAT--TGLATAACCCTAAC-TGGATGAACAGAAGCGAAAGCTGTATACTTAAATGTAT'rATTA--TGATAACCCTAAC-TGGATGAACAGAAGCGAAAGCTGTATACTTAAATGTATTATTA--TGACGACCCLNAC-TGGACGAACAGAAGCGAAAGCTGTACACTTGTATGTAT'TT --TAACGACCCTGAC-TGGACGAACAGAAGCGAAAGCTGTACACThITATGTATTTTTT--TGACGACCCTGAC-TGACGAACTGAAGCGAAAGCTLTACACTTGTAGTATTTTT--CGAAGACCCTGAC-TG1GACGAAGAGAAGCGAAGGCTGTGTTCTTGGACTTTTGTGT- -CGAAGACCCTGAC-TGGACGGACAGAAGCGAAGGCTGTGCTCTTGGACTTATGTGAC--CGAAGACCCTGAC-TGGACGAGCGGAAG--- AGGCTGTICTCTTIGGACTAATGTTGTTGC CCAAGACCCCTGG-TGGACTG\AGCGAGGCGAAAGCGGTGCTCTTGTGGGTGTTCGGT--CCAAGACCCCTGG-TGGACTGAGCGAGGCGAAAGCGGTGCTCTTGTGGTGTTCGGT--CCAAGACCCCTGG-TGGACTGAGCGAGGCGAAGGCGATGTTCTTIGTAGGCA'TCGGT--TCAAGACCCAGTT-TGGACTAACGGAGGCGAAGGCGACACTCTAGACGTATCTT1AG--TCACTACCCTAGT-TGGACTATCAGAAGCGAAAGCGATGCTCTAATACGTACTTTTA--TGGTGACTCGCTTA-GGAGCAACAGAGGCGAAAGCGCYGCCAGGAGCGAATCCGAT --TGTTGACCCGTTTATGGAGCGACAGAGGCGAAAG-GCTGGCCAGGGGCAAATCCGAT --TGCTIGACCCTGAGA-GGAGGAACAGAGGCGAAGGCGGTTGTCCGGGACGGGTCTGAC --TGAGGATCCTG--CAGGAGGAGCAAAGGCGTAAGCACTGACAAAGATTGATTCTGITr---








76


Thelohania op. T. solenopeas N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha up. A. inichaelis



Thelohania op. T. oolenopea. N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellemn S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania up. T. solenopsae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis
E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis


721 780
GGTAAAGAACGTAAGCCGGAGGATCAAAGATGATTAGATACCGTTGTAGTTCCGGCCGTA GGTAAAGAACGTAAGCCGGAGGATCAAAGATGATTAGATACCGTTGTAGTTCCGGCCGTA GAACAAGGACGTAAGCTAGAGGATCGAAGATGATTAGATACCATTGTAGTTCTAGCAGTA GAACAAGGACGTAAGCTAGAGGATCGAAGATGATTAGATACCATTGTAGTTCTAGCAGTA GAACAAGGACGTAAGCTGGAGGAGCGAAGATGATTAGATACCATTGTAGTTCCAGCAGTA GAACAAGGACGTAAGCTGGAGGAGCGAAGATGATTAGATACCATTGTAGTTCCAGCAGTA GAACAAGGACGTAAGCTGGAGGATCGAAGATGATPTAGATACCATTGTAGTTCCAGCAGTA GATGAAGGACGAAGGCTAGAGGATCGAAATCGATTAGATACCGTTTTAGTTCTAGCAGTA GATGAAGGACGAAGGCTAGAGGATCGAAATCGATTAGATACCGTTTTAGT'TCTAGCAGTA GATGAAGGACGAAGGCTAGAGGATCGAAAACGATTAGATACCGTTTTAGT'rCTAGCAGTA GATCAAGGACGAAGGCTGGAGGATCGAAAGTGATTAGATACCGCTGTAGTTCCAGCAGTA GATCAAGGACGAAGGCTGGAGGATCGAAAGTGATTAGATACCGCTGTAGTTCCACCAGTA GATCAAGGACGAAGGCTGGAGTATCGAAAGTGATTAGATACCGCAGTAGTTCCAGCAGTA GATCAAGGACGAAGGCAGGAGTATCGAAAGTGATTAGACACCGCTGTAGTTCCTGCAGTA GATAAAGGACGAAGGCTAGAGTAGCGAAAGGGATTAGATACCCCTGTAGTTCTAGCAGTA GATAAAGGACGTAGGCTAGAGGATCGAAGACGATTAGAGACCGTTGTAGTTCTAGCAGTA GATAAAGGACGTAGGCTAGAGGATCGAAGACGATTAGAGACCGTTGTAGTTCTAGCAGTA GATCAAGTACGTGAGCAGGAGGATCAAAGACGATTAGACACCGTCGTAGTTCCTGCAGTA GATCAAGGACAGAGGCTAGAGGATCGAATACGATTAGATACCGTAGTAGTTCTAGCAGTG
* *** ** ** *** * ** ******* *** ****** ** **

781 840
AAITATGCCAACTTGCA-TTTTGTTATT--- TATACAAGGAGCATAGAGAAATTAAGAGT AATATGCCAACTTGCA-TCTTGTTATT--- TATACAAGGAGCATAGAGAAATTAAGAGT AACTATIGTTGAACCATAGATATATTTG--- ATATATATTTATGTAGAGAAATTAAGATT AACTATIGTTGAATCATAGATATATTTTG---ATATATATTTATGTAGAGAAATTAAGATT AACTATICCGACGATIGTGATATGATATT--- AATTGTATTAGATG\ATAGAAATTT-GAGT AACTATGCCGACGATGTGATATGATATA--- TTTTGTATTACATAATAGAAATTA-GAGT AACTATGCCGACGATGTGATATGAGAT-----GTTGTATTACATTATAGAAATTA-GAGT AACGATGCCGACTGGACG-GGACTGTT-----TTAGTTGTCCGAGAGAAATCTTAAGT AACGATGCCGACTGGACG-GGACT-AT-----ATAGTTGTGCATAGAAATCTTIAGT AACGATGCCGACTGGACG-GGTCAGTG-----TGTG --- GCCATGAGAAATCTTGAGT AAAGATGCCGACATGC--TCGG--- TG-----GCAACACGGGGCGGGGAGAAATCTTAGA AAAGATGCCGACATGC--TCGG--- TG-----GCAACACGGGGCAGGGAGAAATCTTAGA AAAGATGCCGACATGC--TCAT--- TG-----GACACAGTGGGCAGGGAGAAATCTTAGA AACTATGCCGACAGCCTGTGTG--- -----AGAATACGTGGGCGGGAGAAATCrTAGT AACTATGCCGACAGAATGTTAGATATA ----- TTTCTAGTGTTCAAGGGAAACCTTAAGT AACGATGCCGATACCGTGGTGCG---------GATACGCGACGCGGAAGAGAAATCGAGT AACAATGCCGATGTTGTGGTGCC---------GTAACG-GACGCAAAAGAGAAATCTAGT AACGATGCCGACGGGGCAGCAGG--------GGAACTTGTTGCCTGAGGGAAACCA-AGT ACCGATGATGATTTTGCCTTATGCAAT---------------------AGAGAAATCAAAAT


841 900
TTTGGGCTCTAGGGATAGTAATCCGGCAACGGACAAACTTAAA--GAAATTNGGCGGAAG TTTGGCTCTAGGGATAGTAATCCGGCAACGGACAAAC'TTAAA--GAAATIGCGGAAG ATATTGACTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAAGTGACGGAAG ATATTGACTCTGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAATTGACGGAAG TTTTTGGCTCTGGGGATAGTATGATCGCAAGAGAAAATTAAA--GAAATTGACGGAAG TTTTGGCTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAATTGACGGAAG
TOTTGCTCTGGGGATAGTATGATCGCAAGATTAAAATTAAA--GAAATTGACGGAAG ATTGGGTTCGGGGATAGTAGCTCGCAAGAGTGAAACTTGAA--GAGAITGACGGAAG ATGTGGGTTCTGGGATAGTATGCTCGCAAGAGTGAAACTTGAA--GAGATTGACGGAAG ATGCGGGTTCTGGGGATAGTATGCTCGCAAGAGTGAAACTTGAA--GAGATTGACGGAAG GTTCGGGCTCTGGGATAGTATGCTCGCAAGGG AAAATTAAA--GAAATTGACGGAGC GTTCGGGCTCTGGGGATAGTATGCTCGCAAGGGTGAAAATTAAA--GAAATTGACGGAGC GTTCGGGCTCTGGGGATAGTATGCTCGCAAGGGTGAAAATTAAA--GAAATTGACGGAGC GTTCGGGCTCTGGGGATAGTACGCTCGCAAGGGTGAAACTTAAAGCGAAATTEACGGAAG
GATCGGGCTCGGAGAGTATGCTCGCAAGTGAAAATTAAA-CGAAATTIGACGGAGT
--- AGGGCCCTGGGGAGAGTACACGCGCAAGCGAGAAATTTAAAG-GAAATTGACGGAAG
----AGGGCCCTGGGGAGAGTACACGCGCAA-CAGGAAATTTAAAG-GAAATTGACGGAAG
GTACGGGCTCCGGGGATAGTACGGGCGCAAGCTAAACTTrAAA--GAAATTGACGGAAG A--- GATCTCCGGGGAGTACATGCGCACAGGAACTTAA---------GAATTGACGGAAG
**** ** *******








77


Thelohania op. T. solenopsa. N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaoi G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopeae
N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penasi G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopsae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis


901 960
GACACCACAAGGAGTGGATTATACGGCTTAATTTGACTCAACGCGGGAAAACTTACCAGG
GACACCACAAGGAGTGGATTATACGGCTTAATTTGACTCAACGCGGGAAAACITTACCAGG AATACCACAAGGAGTGGATTGTGCGGCTTAATTTACTCAACCCGGGGTAATTTACCAGG AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGGGGTAATTTACCAGG AATACCAGAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGTAACTTACCAAT
AATACCACAAGGAGTGGATTGTGCGGCITTAATTTGACTCAACGCGAGGTAACTTACCAAT AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGTAACTTACCAAT GACACCACAAGGAGTGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGT
GACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGT GACACCACAAGGCGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGC TACACCACAAGGAGTGGATTGTGCGGCTrAATTTGACTCAACGCGAGGAAGCTTACCAGG TACACCACAAGGAGTGGATTGTGCGGCTTAATTTACTCAACGCGAGGAAGCTTACCAGG
TACACCACAAGGAGTGGATTGTGCGGCrrAATTTGACTCAACGCGAGGAAACTTACCAGG GACACTACCAGGAGTGGATTGTIGCTGCTrAATTTAACTCAACGCGGGAAAACrTACCAGG TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAATTTTACCAGG AACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGACAGCTTACCAGG
AACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGACACCTTACCGGG GACACCACAAGGAGTGGAGTGTGCGGGTTAATTTGACTCAACGCGGGACAACTTACCGGG CTAGCCACAAGGGTGATTGTGCGGCTTAATTTGACTCAAAGCGGAAAAGCTTACCAAG


961 1020
GCCTATG1TATAAGAGAAAGTTAACATTGTATG-------TATACTTGATTrGTACTTTGAG GCCTATGTATAAGAGAAAGTTAACATTGTATG-------TATACTTGATTGTACTTTGAG TATAA----------------CATGGTATAATATTT---------------ATCATGATAG
TATAA----------------CATGATATAATATTT---------------ATCATGATAG
ATT-----------------TTATTCAGAGAAGATTTC--GATC-TGAGAATGATAATAG
ATTTT--------------ATTATTTTGAGACGATTTTT--AATC-AGAGAATGATAATAG
ATTTT--------------ATTGTTCTGCGAGGATAT ---- GATC-TGAGGATGATAATAG
TCTIA--------------AGTGAGTGTGAGAGTGTT ACAT-GAT-GCTTACGGCGG
TCTGA---------------AGCGGGCAGGAGAACG--AGGACGG-GAT-GCGCGCGGCGG
TCGA----------------AGGAATCCTGTGAGGCATGGCAT-TG--GCATGCGGCGG
GCCAA----------------GTGCTGTGGAGAAAG----------GAGCAGGACAGAAG
GCCAA----------------GTGCTGTGGAGAAAG----------GAGCAGTACAGAAG
GCCAA----------------GTATTGTGTAGAAAC----------GAGCAATACAGGAG
GTCAA----------------GTCATTCGTTGATCG---AATACGTOAGAATGGCAGGAG
GCTGA----------------ATATATTTGAGATG --- AATACATGAAATATATTTGAG
CCCGACGGCCGGACGAGTGTTGTACACGATAGGTCGA-------------------AGAG
CCC-ACGGCCACACGAGTGTGACACACGATA-GCCGA-------------------GGAG
GCAGGCGACGAGAAGCGAAGGATGATGAAGAGATTC --- ACAGACTGATGCGTCGCGTG
CTTATrTATTCAACGA--GTATTTATCCGAGAGTA--------------------AAATG


1021 1080
TOGTCATGG-CCGTTTTCAACACGTOGGGTACTTGTCAGGTTTrATTCCGGTAACGTGT TGGTGCATGG-CCGTTCAACACGTGGGGTGACTTGTCAGGTTATTCCGGTAACGTGT TGGTGCATGG-CCGTTTCCAATGGATGCTGTGAAGT-AATGATTAATTTCAACAAGATGT
TGGTGCATGG-CCGTTTCCAATGGATGCTGTGAAGT-AATGATTAATTTCAACAAGATGT TGGTGCATGG-CCGTTTTCAATGGATGCTGTGAAGT-TTIATTAATTTCACCAAGACGT TGGTGCATGG-CCGTTTTCAATGGATGCTGTGAAGT-TTTGATTAATTTCAACAAGACGT TGGTGCATGG-CCGTTCAATGGATGCTGTGAAGT- TTATTAATTTCAACAAGACGT TGGTGCATGG-CCGTTTTAAATGGATGGCGTGAGCT-TTGGATTAAGTTACGTAAGATGT TGGTGCATGG-CCGTAAATGGATGGCGTGAGCT-TTGATTAAGT'CCGTAAGATGT TGGTGCATGG-GCCTTTTAAATGGATGGCGTGA-CT-TTGTCTTAAGTTYCGTAAGATGT TGGTGCATGG-TCGGAAATTGATGGGATGACT-TGGCCTAAATGGCTGAATGAGT TGGTCATGG-TCGTTGGAAATTGATGGGATGACTIT-TGGCCTTAAATGGCTGAATGAGT TGGTGCATG-TCGTTGGAAATTGATGGGATGACTT-TGACCTTAAATGGTTGAATGAGT
TGGTGCATGG-CCGTTGGAAATTGATGGGGCGACCT-rTAGCTTAAATGCTTAAACCAGT TGGTGCATGG-TCGTTGTAAACTCATGGATTGATCT-TAAGTTCAACGCTAAAAGGGT
TOGTGCATGG-CCGTrAACGACGAGTGAGGTGACTT-TTGGTTAAATCCGGGAAGTAGT TGGTGCATGGCCCGrrAACGACAAGTGA-GTGATCT-TTGGTTAAGTCCGTAAATTAGT TGGTGCATGG-CCGTTTAACACGTGGGGTGACTTGTCAGGTTAAATCCGATAACGCGT GTGTGCATGG-CCGTTCCTAACACATGGAGTGATTTTGTGATTAACCTTCCGTAATCTT
******** ** ** *








78


Thelohania op. T. solenopsae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op.
T. solenopsae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaoi G. atherinae Ichthyosporidiuin sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopsae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha up. A. michaelis


1081 1140
GATGTGCAGTATGC ---- AACTAAT3TTGTGAGACTTCTTGCGGTAAGC-- -TTGATGAA GATGCAGTATGCAACTAACTAATGTTGTGAGACTTCTTGCGGTAAGC--- TGATGAA GAGACCCTCATTTAGACAGATGTAGTG----------ATACA----------TATGAAGG
GAGACCCTCATTTAGACAGATGTAGTG----------ATACA----------TATGAAGG
GAGACCCPTTATTAATAGACAGACAC----------AATCAGTG-------TAGGAAGG
GAGACCCTTTTATT-ATAGACAGACAC----------AATCAGTG-------TAGGAAGG
GAGACCCT ---- TTATTAGACTGACAC----------TA~TTAGTG-------TAGGAAGG
GAGACCCT--TTTTGACTGTGCTCTA------------ TGGGGCA--------AGGGAGG
GAGACCC---- TTTGACAGTGCTCTT------------- TGGGGCA--------AGGGAGG
GAGACCC----TTTGACGGTGTTCTA-------------CGAAGCA--------A-GGAGG
GAGATC--- TTTGGACATG--TTCCC--------------ACAGGAA------CAGGAAGG
GAGATC---TTTGGACATG--TTCCC--------------AC-GGAA------CAGGAAGG
GAGATCT--TTTGGACATG--TTCCG-------------CAC-GGAA------CAGGAAGG
GAGACCT--CCTTGACAGG--TG\TTC-------------TGTAACA-------CAGGAGGG
GAGACTT--TCATAAACAGCTATCTA--------------ACAGGTA------GAGGAAGG
GAGACCCCTACCGAAAGGGACAGGTGC----------CGAAAGCA-------CAGGAAGG
GAGACCC-- -CAGCAAAGGACAGGTGC----------GCAAAGCA-------CAGGAAGG
GAGACCCTGTGTAGATGGAAATA-CGACGGGACATGGCAAGTGT--------CAGGAAGA GTAAATC--CTCATAATAGCTTGTTTGA-----------------------AAAGAACAA


1141 1200
GAGGCGCTATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCTGCACGTGTAATACAGT GAGGCGCTATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCTGCACGTGTAATACAGT AGAGGATTAAAACAGGTCCGTTATGCCCTAAGATAATCTGGGCACGCGCAATACAAT AGAGGATTAAAACAGGTCCGTTATGCCCTAAGATAATCTGGGTTCACGCGCAATACAAT AAAGGATTAAAACAGGTCCGTTATGCCCTCAGACATTTTGGGCTGCACGCGCAATACAAT AAAGGATTAAAACAGGTCCGTTATGCCCTCAGACATTTTGGGCTGCACGCGCAATACAAT AAAGGACTAAAACAGGTCAGTTATGCCCTCTGACATTTTGNGGCAGCACGCGCAATACAAT AATGGAACAGAACAGGTCCGTTATGCCCTGAGATGAAGCGGGCGGCACGCGCACTACGAT AATGGAACAGAACAGGTCCGTrATGCCCTGAGATGAAGCGGGCGGCACGCGCACTACGAT GATGGAAGAGAACAGGTCCGTTATGCCCTGAGATGAGGCGGGCTCACGCGCAACTAGAT
-GGAGGCTATAACAGATCAGAGATGCCCTTAGATGCCCTGGGCTGCACGCGCAATACAAT
-GGAGGCTATAACAGATCAGAGATGCCCTTAGATGCCCTGGCTGCACGCGCAATACAAT AAAAGGCTATAACAGATCCGAGATGCCCTCAGATGCCCTGGGCTGCACGCGCAATACAAT TGGAGGCTATAACAGGTCCGTGATGCCCTTAGATATCCTGGGCAGCAAGCGCAATACAAT GGAAGGCGATAACAGATCCGTGATGrCCCTCAGATGTCCTGGGCTGCACGCGCAATACATT AAGGGTCAAGAACAGGTCAGT3ATGJCCCTCAGATGGTCTGGGCTGCACGCGCACTACAGT ATGGGTCAAGGACAGGTCAGTATCCCTTAGATGGTCCGGGCTGCACGCGCACTACAGT GCGGGTCGATAACAGGTCTGTGATGCCCGCAGATGTTCCGGGCGCCACGCGCACTACATT TTCGAGCAAGAACAGGTCAGTGATGTCCTTTGATAGCTTGGGCTGCACGCGCAATACAAT
**** ** *** ** ** *** ** * *

1201 1260
GGGTATTTCAATATAATAGGA-GTAAArTTACCCGAGACAGGGATCATGCTTTGTAAG GGGTATrTCAATATTTAATAGAA-GTAAATTTACCCGAGACAGGGATCATGCTTGTAAG AAT-ATTTG-ATAT-----TATA-------------------AGGGATAATATAATGTAAG
AAT-ATTTG-ATAT-----TATA------------------AGGGATAATATAATGTAAG
AGATATAT-AATC------TTTA-------------------TGGGATAATATTTTGTAAG
AGATATAT-AATC------TTTA------------------ TGGGATAATATTTTGTAAG
AGA-CTTT-AATC------TTTA------------------rLXGGATAATATTTTGTAAG
AGATGCCT-----------------ATGTGGGCTACTGTGA-GGGATGAAGCTGTGTAAT
AGATGGCG-----------------AGGGAGCCTGCTGTA-GGGATGAAGCTGTGTAAT
AGATGGCG-----------------CTTCTGCCTGCTGAGGGGATGAAGCTGTGTAAG
AGCACGTA-GACG------TACAGAACAACACGTGCT-GAGGTGGACTGTGCTCTGCAAG AGCACGTA-GACG------TAGAGAACAACACGTGCT-GAGGTGGACTGTGCTCTGCAAG AGCAGGTA-GAGA------GAGAGACAGGAAGGTGCT-CAGATGGACTATGTCTGTAAG ATCTCTTC-AGTA------GACAAAGTGATTTGAGAT-GAGTAGGATCTACGTTTGTAAA ATGTATAT-TTCT------TATAAATAGATACTACATATTGGGGAATTGACTTTTGTAAA GGTCATAG--AAATGAAACGATAGAATTAAAGATGATCGAGAGGGAATOAGCTTTGTAAG GGTCGCCG--AAATTTAGATATAGAGCTAAAGGCGATCGAGAGGGAATGAGCTTTGGAAG GGACGGCG--ATATATGAAAAT--GAGGAGCCGTCCGTGTTGGGATTACGCTTGTAAT =TTATGT-------------------AGTAAGATATAGATAGGGATTGAGGGCTGAAAG
** ** **








79


Thelohania op. T. solenopeae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopsae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis



Thelohania op. T. solenopeae N. bombycis N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis


1261 1320
AAG--------------------------------------------------------AAG--------------------------------------------------------ATATATTTGAACATGGAATTGCTAGTAAA=TT-ATTTAATAAGTAGAATTGAATGAGTC ATATAT AACATGGAATTGCTAGTAAATTT-ATTTAATAAGTAGAATTGAATGAGTC
AGATATGAACTTGGAATTGCTAGTAAATTT-ATAAATAAGTAGAATGAATGTGTC AGATATTTAACTTGGAATTGCTAGTAAATTTT-ATAAATAAGTAGAATTGAATGTGTC AGATATGAACTTGGAATTGCTAGTAAATTTT-ATTAAATAAGTAGAATTGAATGTGTC GGGCTTCTGAACGTGGAATTCCTAGTAAGAATG-ATTGAACAAGTTATTTTGAATGTr\TC GGGCTTCTGAACGTGGAATTCCTAGTAATAACG-ATTGAACAAGTTGTTTTGAATGGGTC GGGCTTCTGAACGTGGAATTCCTAGTAATAGCG-GCTGACGAAGCTGCTTAATGTGTC GGGCACACGAAAGAGGAATTCCTAGTAAGCGCC CATCACCAGTGGGCGTTGAATCAGTC GGGCACACGAAAGAGGAATTCCTAGTAAGCGCC-CATCACCAGTGGGCGTTGAATCAGTC GCACATACGAAAGAGGAATTCCTAGTAAGTGTG-TATCAACAATGGATATTGAATAAGTC TACGTAGTGAATAAGGAATTCCTAGTAACGGTG-CCTCATCAAGGCATGGTiGAATGTGTC TAAGTCATGAACTTGGAATTCCTAGTAATAATG-ATTCATCAAGTCATTGTGAATGTGTC AGGCTCAGGAACGAGGAATTGCTAGTAATCGCGGACTCATTAAGACGCGATGAATACGTC AGGCTCAGGAACGTGGAATTGCTAGTAATCGCGGACTCATTAAGACGCGATGAATACGTC TGCGTCATGAACGTGGAATTCCTAGTAGT-GGGCAGTCATTAACTGCACGCGAATGAGTC CG-CTCATGAACACGGAATAGCTAGTAA-CGTGAG1TCAATATACGGCGATGAATATGTC


1321


1380
------------


-------- ---------------------------------------------------CCTGTTCTTTACACACCGCCCGTCGCTATCTAAGATGGTATTATCTATGA ---- ACAA CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGGTATTATCTATGA- --- ACAA CCTETTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATAGTGTT'T\A- --- AATT CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATATGTTGTGA ---- AATT CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATGTGTGTGA ---- AATT CCTGTCCTTTGTACACACCGCCCGTCGCTATCTAAGATGAC ---- GCAGTGG- --- ACGA CCTGTCCTTCTACACACCGCCCGTCGCTATCTAAGATOAC ---- GCAGTGG ---- ACGA CCTGTCCTTTGTACACACCGCCCGTCGCTATCTAAGATGAC----GCACTGGA ---ACGA CCTGTAGCTTGTACACACCGTCCGTCACTATCTCAGATG-T- ---- TTTTCGGG--- ATGA CCTGTAGCTTGTACACACCGTCCGTCACTATCTCAGATG-T---- TTTrCGGG--- ATGA CCTGTAGCTTGTACACACCGCCCGTCACTATCTCAGATG-T--- -TTTCAGG---ATGA CCTGTTCTTTGTACACACCGCCCGTCACTATTTCAGATG-G---- TCATAGGG---ATGA CCTGTAGCTTGTACACACCGCCCGTCACTGTCTCAGATG-G---- TTGATGAG---ATGCCTGTTCTTTGTACACACCGCCCGTCGTTATCGAAGATGGAGTCAGGCGCGA--ACAAGCCTGTTCTT3TACACACCGCCCGTCGTTATCGAATACGGTGCTCGGCGCGA--GCAAGG CCTGTTCTTTGTACACACCGCCCGTCGTTATCTAAGATGGA- -- AGTGCGGA--TGAGGT CCTGTTCTTTTACACACCGCCCGTCGTTATCGAAGATGGAGTGATTTTTAG-TCAATT


1381


1440
--------------- -- -


------------------- ------------------- ------------- -ATTTATA--- AAGTGAATAGATAGTACTAGATCTGATATAAGTCGTAACATGGTTGCTGT ATTTATA--- AAGTGAATAGATAGTACTAGATCTGATATAAGTCGTAACATGGTTGCTGT AGTGAAAACTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT AGTGAAAACTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGTGCAAGCTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT AGATTGAGAGGTCTGAGTCTTTCGTGTTAGATAAGATATAAGTCGTAACATGGCTGCTGT AGATTGGAAGGTCTGAGTCCTTCGTGTTAGATAAGATATAAGTCGTAACATGGCTGCT AGATCGGAAGGTCTGAGTCCTGAGTGTTAGATAAGATATAAGTCGTAACAAGGTAA---AGAGTCTAGGCTCTGAATAACGGAAAGTAGATAAGATGTAAGTCGTAACATGGTTGCTGT AGAGTCCAGGCTCTGAATAACGGAAAGTAGATAAGATGTAAGTCGTAGCAAGGTTGCGGT AGAGTCCAGGCTCTGAATAATGAAAAGTAGATAAGATGTAAGTCGTAACATIGGTTGCTGT AGAGCTTCGGCTCTGAATATCTATGGCTAGATAAAGTACAAGTCGTAACAAGGTTTCAGT
----------------------------------___ -- ----_ _- ___---- CGAGAGCGAGTGAGTGCAGGATTCTAGATGTGATACAAGTCGTAACATGGTTGCTGT TGAAATCACTGAGCGAGCGCAAGGTACCGGATCTGATACAAGTCGTAACAAGGTAGCTGT CGGTACGGCCGGACGAATCTGTGCTTGTAGATTGGATACAA ------------------ATAATTGGCTACTTGAATGAGTTATTCTAAAACCGGTACAAGTCGTAACAAGGCTACGGT









80


Thelohania op. T. solenopsa. N. bombycis
N. trichoplusia V. necatrix N. vespulae N. apis E. hellem S. intestinalis E. cuniculi Pleistophora sp. E. schubergi N. corneum E. bieneusi
A. penaei G. atherinae Ichthyosporidium sp. Vairimorpha op. A. michaelis


1441


1466
----------


------------------------TGGAGAACCATTAGCAGGATCATAA TGGAGAACCATTAGCAGGATCATAA TGGAGAACCATTAGCAGGATCATAA TGGAGAACCATTAGCAGGATCATAA
------------------------TGGAGAACCATTAGCAGGATCATAA TGGAGAACCATTAGCAGGATCATAA
------------------------TGG ---------------------CGGTGAACCATTAGCAGGATCATAA TGG---------------------TGGAGAACCATTAGCAGGATCATAA T-----------------------TGG ---------------------AGGAGAACCATTAGCAGGATCATAA
------------------------TGAAGAATCAGCAGTAGGATTAGCG


Figure 4.4. Multiple sequence alignment of the rRNA gene sequences of 19

species of microsporidia. Alignment of the sequences was done with the programs PileUp and CLUSTAL W (1.4). Names of microspridian species typed in bold indicate sequences obtained by the author. Dashes indicate gaps that were introduced to maintain alignments. Conserved regions are identified by '*'.






81


Sequence Data Analysis


For data analysis, about 70 bp were excluded at the 5' and 3' ends of the A. penaei sequence because of sequence uncertainties. The multiple sequence alignment (Figure

4.4) shows moderately variable regions in the 5'-end half and highly conserved stretches (denoted with '*') in the 3'-end half of the sequence. The distance matrix shown in Table

4.2 presents the mean distances between taxa, providing a comparison of the relative similarity between any two taxa. The ribosomal gene sequence of the protozoan

-. lamblia (Sogin et al. 1991) was included as an outgroup. Mean distances and branching patterns of the phylogenetic tree (Figure 4.5) clearly showed that Thelohania sp. and I. solenopsae were very closely related (mean distance Thelohania sp./T. solenopsae = 0.008). A mean distance of 0.008 means 0.8 % sequence difference or 99.2 % sequence similarity. They were not closely related to any of the other microsporidia including the hymenopteran microsporidia N. Wi and N. vespula (mean distance Thelohania sp./N. apis = 0.370, T. solenopsae/ N.apis = 0.376, Thelohania sp./N. vespula = 0.374, T. solenopsae /N. vespul = 0.378). They were also quite different from Vairimorpha sp. which can occur in dual infections together with Thelohania sp. in S. richteri (mean distance Thelohania sp./Vairimorpha sp. = 0.368, T. solenopsae/ Vairimorpha sp. = 0.367).The sequence of A. penaei, which was chosen as a close representative of the type species of the genus Thelohania, has a mean distance of 0.378 to Thelohania sp. and 0.366 to T. solenopsae. Vairimorpha sp. also was not closely related to any of the other microsporidia including Y. necatrix, the type species of the genus Vairimorpha (mean distance Vairimorpha sp./Y. necatrix = 0.366).

Based on the branching pattern of the phylogenetic tree (Figure 4.5),

Vairimorpha sp. diverged first from the common ancestor, followed by the two Thelohania species which diverged after Vairimorpha sp. but before the other microsporidia included in the analysis. The phylogenetic tree also showed that Vairimorpha. sp. did not group






82


with V. necatrix and the two Thelohania species did not group with A. penaei. In fact, Vairimorpha sp. and the two Thelohania species did not group closely with any of the other microsporidia. These findings were supported by the bootstrap analysis of the most parsimonious tree (Figure 4.6). A phylogenetic analysis of the other microsporidia to each other has been published (Baker et al. 1995).


Discussion

Molecular differences between species can be of great utility in diagnosing closely related forms, even where morphological or other traditional markers have failed or are ambiguous (Avise 1994). The results of the 16S rRNA gene sequence analyses indicated that Thelohania sp. and Vairimorpha sp. were two distinct species in two different genera. Furthermore, Thelohania sp. and T. solenopsae were the same species or two subspecies of the same species. Vairimorpha sp. did not belong into the genus Vairimorpha and the placement of the two Thelohania species and A. penaei into different genera is probably justified.

To draw meaningful conclusions based on comparative sequence analyses, guidelines to delineate different generea and species are needed. What percentage sequence similarity determines whether two species belong to the same genus or are the same species? Hartskeerl et al. (1993) proposed 16S rRNA gene sequence similarity levels of 70% and 90% respectively, to delineate species in different genera or the same genus. He also compared two isolates of E. bineusi-like microsporidia, believed to be different species based on site of collection (small intestine vs. maxillary sinus mucosa in humans), and found a 99% sequence similarity of the 16S rRNA genes. From these results he concluded that the two isolates are the same species. In the present study, 16S rDNA PCR product sizes, RFLPs, and sequence comparison of Thelohania sp. and Vairimorpha sp., the two microsporidia which may coinfect the same host, indicated that











Table 4.2. Pairwise distances between taxa


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

1 .3K. sp. 0.008 0.387 0.384 0.373 0.374 0.370 0.398 0.403 0.425 0.376 0.373 0.366 0.380 0.378 0.377 0.390 0.368 0.432 0.499
2 Mg. I. 9 0.388 0.385 0.380 0.380 0.376 0.401 0.408 0.426 0.374 0.371 0.366 0.381 0.373 0.381 0.396 0.367 0.434 0.504
3 Nu. ham. 359 364 0.004 0.161 0.160 0.170 0.291 0.285 0.341 0.338 0.336 0.328 0.346 0.347 0.362 0.372 0.394 0.384 0.505
4 Nuj. ri. 356 361 5 0.158 0.157 0.167 0.290 0.284 0.338 0.338 0.336 0.328 0.344 0.345 0.362 0.372 0.391 0.382 0.506
5 Yai. M. 351 361 194 191 0.028 0.050 0.277 0.281 0.322 0.321 0.322 0.315 0.333 0.325 0.354 0.363 0.366 0.375 0.491
6 No. yfl. 352 361 195 192 34 0.045 0.277 0.281 0.319 0.320 0.319 0.310 0.329 0.320 0.357 0.365 0.368 0.380 0.489
7 Ng.d 345 354 198 195 59 54 0.291 0.293 0.328 0.324 0.329 0.318 0.339 0.328 0.366 0.382 0.368 0.382 0.496
8 E 396 403 345 344 331 332 338 0.089 0.152 0.313 0.311 0.314 0.317 0.352 0.370 0.372 0.373 0.418 0.458
9 S i. jng. 398 407 338 337 333 336 338 114 0.151 0.305 0.303 0.310 0.315 0.358 0.357 0.359 0.368 0.412 0.444
10 E. =im. 421 426 396 393 373 374 378 189 189 0.334 0.335 0.332 0.339 0.381 0.379 0.377 0.383 0.423 0.450
11 FIg. sp. 362 364 394 394 371 373 369 375 366 399 0.007 0.106 0.238 0.302 0.320 0.336 0.373 0.379 0.438
12 End. sh. 358 360 398 398 379 379 374 379 369 399 9 0.106 0.239 0.300 0.325 0.331 0.375 0.379 0.439
13 NU. 01. 354 358 383 383 365 363 363 377 373 398 131 130 0.246 0.292 0.339 0.356 0.383 0.394 0.462
14 En. ih. 375 379 417 415 399 398 395 398 395 417 293 298 304 0.286 0.339 0.357 0.358 0.398 0.438
15 Agm. n. 370 367 355 353 336 331 337 381 384 410 323 320 313 313 0.374 0.392 0.372 0.415 0.486
16 (Im. &. 383 391 423 423 411 419 421 457 439 464 383 388 407 415 398 0.116 0.354 0.339 0.464
17 h. sp. 392 402 442 442 429 435 439 467 449 461 402 402 427 445 416 153 0.367 0.359 0.471 18 Yai. sp. 375 376 412 409 389 391 388 420 411 428 407 408 419 398 400 409 422 0.428 0.390
19 Am. mi. 418 424 438 436 427 435 421 508 496 499 436 444 455 473 423 414 446 471 0.520
20 fia.jam. 522 532 611 612 593 596 583 583 564 561 533 543 565 557 529 608 626 466 650


Species are as follows: 1, Thelohania sp.; 2,1T. sol=nosa=: 3, Nosema hombhcis (L3911 1*); 4, N. trihcplusiae (U09282); 5, Vairimorpba neamrix (Y00266); 6, N. vespua (Ul 1074); 7, N. apil (X73894); 8, Encepbaitozoon hellem (L19070); 9, SeZa&a inlestinalis (U09929); 10, E.. cimiculi (Z19563); 11, PleistopMora sp. (Ul0342); 12, Endoreticulatus schubergi (L39109); 13, N. corneum (U11046); 14, Enterocytzoon bieneusi (LO7123); 15, Agmasgoma Dcoai; 16, Gluge atherinae (15987); 17, Ichthyorsidium sp. (L39110); 18 Vairimorpha sp.; 19, Ameson michaelis (L15741); 20, Giardia Iamblia (M54878). Numbers above diagonal: mean distances (adjusted for missing data); numbers below diagonal: absolute distances.
(GenBank accession number)


co






84


-- E


Figure 4.5. Phylogenetic tree (3,511 steps) based upon the 16S rDNA sequences of the 19 species of microsporidia aligned in Figure 4.4. Giardia lambli was used as the outgroup. The tree, presented as a cladogram, was generated using the heuristic option of PAUP. Species, whose sequences were obtained by the author, are marked with '*'.


Thejoheia sp. Thdohania solowpsae Nosema bombycis Nosema fridopluliae Vainrnorpha necafrir Nosema wspula Nosema apis Encephalitozoon hellem S- a taiis

Encphkio7Aon cu icuh Pleistophora sp. Endoreticulae* schubjgi Noema cornewn Enterocytozoon bienewi Agmaomapael* Glugea atherinae Ichthyvporidium sp. Ameson michaelis Vairmorpha sp. Giantia lambliae






85


Bootstrap 100 Thelohana sp. *

Telohania solenopsae 100 Nosema bombycis
Nosema trichoplusiae 100 96 Vabrlmoqha necatr

100 Nosema vespula
61 q Nosema apis
100
90 Encephalftozoon hellem

100 Septata intestinalis

Encephalitozoon cuniculi 100 Pleistophora sp.
100 Endoreticulates schubeigi
65 gNosema coreneu .2 78 Enterocytozoon beneusi

Agmasoma penaei Glugea atherinae 97 Ichthyosporidu sp.
Ameson michaelis Vairimorpha sp. Giardia lambliae


Figure 4.6. Bootstrap analysis (100 replicates) of the phylogenetic tree presented in Figure 4.5. Numbers on the tree indicate the percentage of bootstrap replicates which contained that topology. Bootstrap analysis was performed with PAUP. Species, whose sequences were obtained by the author, are marked with '*'.




Full Text
119
Marumo, K. and Akoi, Y. 1990. Discriminant analysis of cellular fatty acids of Candida
species, Torulopsis glabrata. and Crvptococcus neoformans determined by gas-liquid
chromatography. J. Clin. Microbiol. 28,1509-1513.
Maruniak, J.E., Brown, S.E., and Knudson, D.L. 1984. Physical maps of SfMNPV
baculovirus DNA and its genomic variants. Virology 136, 221-234.
McGrath, C. F., Moss, C. W., and Burchard, R. P. 1990. Effect of temperature shifts on
gliding motility, adhesion, and fatty acid composition of Cvtophaga sp. strain U67.
I. Bacteriol. 172, 1978-1982.
MIDI. 1993. Yeast/actinomycetes/fungi data base. MIDI, Inc., Newark, DE.
Miller, L.T. 1982. Single derivatization method for routine analysis of bacterial whole
cell fatty acid methyl esters, including hydroxy acids. J. din. Microbiol. 16, 584-
586.
Mitchell, M.J., and Cali, A. 1993. Ultrastructural study of the development of
Vairimorpha necatrix (Kramer, 1965) (Protozoa, Microsporida) in larvae of the com
earworm, Heliothis zea (Boddie) (Lepidoptera, Noctuidae) with emphasis on
sporogony. J. Euk. Microbiol. 40. 701-710.
Mollenhauer, H.H. 1964. Plastic embedding mixtures for use in electron microscopy.
Stain Technol. 111-114.
Morton, J.B. 1993. Problems and solutions for the integration of glomalean taxonomy,
systematic biology and the study of endomycorrhizal phenomena. Mvcorrhiza 2,
97-109.
Morton, J. B. and Benny, G.L. 1990. Revised classification of arbuscular mycorrhizal
fungi (Zygomycetes): a new order, Glomales, two new suborders, Glomineae and
Gigasporinae and two new families, Acaulosporaceae and Gigasporaceae, with an
emendation of Glomaceae. Mvcotaxon 37, 471-491.
Moss, C.W. 1981. Gas-liquid chromatography as an analytical tool in microbiology.
J. Chromat. 13, 337-347.
Moss, C.W., Dees, S.B., and Guerrant, G.O. 1980. Gas-liquid chromatography of
bacterial fatty acids with a fused-silica capillary column. J. Clin. Microbiol. 12,
127-130.
Moss, C.W., Lambert, M.A., and Merwin, W.H. 1974. Comparison of rapid methods for
analysis of bacterial fatty acids. Appl. Microbiol. 28, 80-85.


51
and Dixon 1991). Mitochondria and chloroplasts code for their own rRNAs ranging from
12S to 21S in mitochondria and 5S to 23S in chloroplasts.
The larger rRNAs can be used over a wide range of phylogenetic distances, from
the full span of the universal tree to distinction among species within the same genus. This
is due to the fact that ribosomal sequences have both highly conserved and variable
regions (Olsen and Woese 1993). Different regions of the rDNA repeat unit evolve at
very different rates. The most studied rRNA is the small subunit nuclear gene, 16S/18S
rRNA. It has been studied most extensively because of its size and because regions of it
are among the slowest evolving sequences found throughout living organisms. The slow
rate of change permits the construction of many nearly universal primers. The large
subunit (23S/28S) nuclear rRNA gene is larger and shows more variation in rates of
evolution of its different domains than does the small subunit. The 5.8S and 5S genes are
also conserved, but the shortness of the sequence greatly restricts phylogenetic usefulness.
Furthermore, the larger rRNAs provide sufficient sequence information to permit
statistically significant comparisons (Olsen et al. 1986).
Typically, several hundred tandemly repeated copies of rRNA genes (rDNAs)
exist in a eukaryote nuclear genome. A transcription unit consists of a linear arrangement
of three genes (coding for 18S, 5.8S, and 28S rRNA) which are separated by two internal
transcribed spacers. An external transcribed spacer is located upstream of the 18S gene.
The transcribed spacers contain signals for processing the rRNA transcripts. Adjacent
copies of the rDNA repeat units are separated by nontranscribed spacers. In prokaryotes
there are one to several copies of the rRNA genes, and the genes may be organized into a
single operon (in which they are usually separated by the tRNA gene), or they may be
dispersed throughout the genome. The gene for the 5S rRNA is closely associated with
the other rRNA genes in many prokaryotes but is found elsewhere in the nuclear genome
of most eukaryotes (Hillis and Dixon 1991).


42
C18:3
Retention Time (sec)
Figure 3.1. Gas chromatograms of FAME standards. Standards were analyzed
with a computer-linked Perkin Elmer 8420 GC interfaced with a Finnigan Ion Trap
Detector with INCOS data collection software.




88
supported by inclusion of other available characters such as morphology, host and tissue
specificity, biochemical profiles and available classification schemes.
PCR product size and RFLPs of Thelohania sp. and T. solenopsae were identical
for the enzymes tested, and sequence comparison showed 99.2% identity (or a mean
distance of 0.008) between the two microsporidia. According to Hartskeerl et al. (1993),
the high sequence similarity would place them in the same species. The sequence analyses
data in conjunction with light microscopic and ultrastructural studies of the spore
morphology indeed support the hypothesis that Thelohania sp. and T. solenopsae may be
the same species or two closely related subspecies. Similarly, Pleistophora sp. and
E. schubergi. two microsporidia infecting Lepidoptera, have a very small 16S rDNA
sequence difference (mean distance = 0.007), and Pleistophora sp. should be reclassified as
an Endoreticulatus sp. (Baker et al. 1995). Joseph Maddox suggests (personal
communication) to consider Pleistophora sp. and E. schubergi as intraspecific variants of
one species, E. schubergi. because they are indistinguishable based on tissue specificity
(both are midgut parasites), ultrastructure and almost identical 16S rDNA sequences.
In contrast, E. hellem and E. cuniculi. also indistinguishable by ultrastructure and
development, have a 16S rDNA sequence mean distance of 0.152 (Table 4.2). It should
be noted that Baker et al. (1995) published a mean distance of 0.066 between E. hellem
and E. cuniculi. This difference is due to the fact, that Baker et al. (1995) excluded parts
of the 16S rDNA sequences in their analysis. They analyzed only those characters which
they could align unambiguously. The mean distance of 0.152 supports the classification of
E. hellem and E. cuniculi as two separate species (even though they are indistinguishable
by fine strucure and development) as shown by Didier et al. (1993) with immunological
and biochemical tests.
The two respective host ants of T. solenopsae and Thelohania sp., £ invicta and
£. richteri, are also very closely related, and it is still debated whether they represent color
morphs of one species or two separate species (Vander Meer and Lofgren 1988). To


90
Even though multiple copies of nuclear rRNA genes do not evolve independently
but in concert (Amheim 1983) there may be a low level of heterogeneity at about 0.1% of
the nucleotide positions among rDNA within individuals and throughout species
(Mylvaganam and Dennis 1992). Again, this low level of heterogeneity is not important
when comparing dissimilar sequences but gains importance in the comparison of very
closely related sequences. Since PCR products of Thelohania sp., Vairimorpha sp. and
A. penaei were sequenced directly, no conclusions about intraindividual or intraspecific
variation can be drawn. Sequence data of three clones of the 16S rRNA gene of
T. solenopsae showed a very low level of heterogeneity (about 0.1%), but this is not
reflective of intraindividual or intraspecific variation. Cloning of the PCR product selects
single molecules which may harbor nucleotide misincorporations due to the error rate of
the DNA polymerase. Intraindividual and intraspecific variation of microsporidia need to
be investigated in further studies. Intraindividual variation of the multiple copies of the
16S rRNA gene would require cloning of the PCR product of single spore isolates. In an
initial study to research intraspecific variation of fire ant microsporidia, 16S rDNA
sequences of the same microsporidian species, Thelohania sp., isolated from different
S. richteri ant colonies, could be compared. The different isolates could be regarded as
different individuals of the same species. The advantage of working with Thelohania sp.
instead of Vairimorpha sp. or T. solenopsae is that we have plenty of material available of
Thelohania sp.but not the other species.
Yet another consideration is that two species may still not be the same species
even if they have an identical 16S rDNA sequence (which does represent but a small
portion of the genome) (J. J. Becnel, personal communication). It is prudent to confirm
results found by sequence comparison of one gene with sequence comparisons of another
gene. Studies on sequence comparisons of another gene such as the 23S rRNA gene or
internal spacer (Vossbrinck et al. 1993) to corroborate results from sequence comparisons
of the 16S rDNA gene should be initiated. The cytochrome c gene (Woese 1987) which is


CHAPTER V
SUMMARY AND DIRECTION OF FUTURE RESEARCH
Synopsis
Comparative phenotypic (light microscopic and ultrastructural features) and
genotypic (sequence comparison of the 16S rRNA genes) analyses of the fire ant
microsporidia support the following conclusions:
(1) Vairimorpha sp. and Thelohania sp. are distinct species in separate genera and
not mere different phenotypes of the same species. (2) Thelohania sp. and T. solenopsae
are either two subspecies of the same species or conspecific. Cross-infectivity in field
situations needs to be demonstrated, however, to make this conclusion biologically
meaningful. In other words, infection and completion of the infection cycle of £ invicta
with Thelohania sp. from S. richteri. and of S. richteri with T. solenopsae from S. invicta
must be achieved. (3) Vairimorpha sp. does not belong in the genus Vairimorpha.
Additional evidence to corroborate conspecificity could focus on comparative
sequence analysis of another gene (perhaps the 23S rRNA gene or the cytochrome c
gene). Since microsporidia do not have mitochondria and virtually nothing is known
about their metabolic pathways, the presence of a cytochrome c gene must first be
demonstrated.
Qualitative and quantitative FAME profile differences were detected in the
different microsporidian species but the host insect did influence the FAME profile of a
microsporidium. Improved methodology could render FAME analysis as a useful
taxonomic character. Future experiments could include standardization of microsporidian
growth through the development of in vitro culture techniques. Furthermore, the sample
93


113
Baker, M.D., Vossbrinck, C.R., Maddox, J.V., and Undeen, A.H. 1994. Phylogenetic
relationships among Vairimorpha and Nosema species (Microspora) based on
ribosomal RNA sequence data. J, Invert. Path. 64, 100-106.
Barnes, W.M. 1994. PCR amplification of up to 35-kb DNA with high fidelity and high
yield from bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216-2220.
Beckham, R.D., and Bilimoria, S.L. 1982. A survey for microorganism associated with
ants in western Texas. Southwest. Entomol. 7, 225-229.
Becnel, J. 1992. Horizontal transmission and subsequent development of Amblvospora
ralifnmica (Microsporida: Amblyosporidae) in the intermediate and definite hosts.
Pis. Aquat. Org. 13, 17-28.
Becnel, J.J., Sprague, V., Fukuda, T. and Hazard, E.I. 1989. Development of Edhazardia
aedis (Kudo, 1930) n. gen., n. comb. (Microsporida: Amblyosporidae) in the
mosquito Aedes aegypti (L.) (Dptera: Culicidae). _J. Protozool. 36,119-130.
Bentivenga, S. P., and Morton, J. B. 1994. Stability and heritability of fatty acid methyl
ester profiles of glomalean endomycorrhizal fungi. Mvcol. Res. 98, 1419-1426.
Bethesda Research Laboratories. 1979. Ligation. Theory and Practice Part II. Focus
2, 2-3.
Briano, J. 1993. Effect of a microsporidian disease on field populations of the black
imported fire ant Solenopsis richteri (Hymenoptera: Formicidae) in Argentina. M.S.
thesis, University of Florida, Gainesville, FI.
Brooks, W.M. and Cranford, J.D. 1972. Microsporidioses of the hymenopterous
parasites, Campoletis sonorensis and Cardiochiles nigriceps. larval parasites of
Heliothis species. J. Invert. Pathol. 20, 77-94.
Brower, A.V.Z., and DeSalle, R. 1994. Practical and theoretical considerations for
choice of a DNA sequence region in insect molecular systematics, with a short
review of published studies using nuclear gene regions. Ann. Entomol. Soc. Am. 87,
702-716.
Burn, W.F. 1972. Revisionary study on the taxonomy of the imported fire ants.
J. Georgia Entomol. Soc. 7, 1-27.
Burn, W.F. 1983. Artificial fauna replacement for imported fire ant control. FI.
Entomol. 66, 93-100.
Buren, W.F., Allen, G.E., Whitcomb, W.H., Lennartz, F.E., and Williams, R. N. 1974.
Zoogeography of the imported fire ants. J. N.Y. Entomol. Soc. 82, 113-124.


22
Figure 2.9. Electron micrograph of Thelohania sp. meiospore. x37,500.
Figure 2.10. Electron micrograph of Thelohania sp. spore wall and polar filament
xl50,000.
Figure 2.11. Electron micrograph of T. solenopsae meiospore. x37,500.
Figure 2.12. Electron micrograph of T. solenopsae spore wall and polar filament
Endospore (EN), exospore (EX), polar filament (PF). xl50,000.


25
215


102
Incubate cells for 30 sec. at 37C; do not shake.
Place on ice for 2 min.
Add 0.95 mL of room temperature S.O.C. medium and mix gently.
S.O.C. medium (per 1 liter diH20): 2% bacto-tryptone (w/v), 0.5% bacto-
yeast extract (w/v), 0.05% NaCl (w/v), 2.5 mM KC1; adjust to pH 7.0 with
5 N NaOH, autoclave, let cool to ~ 60C and add 20 mL of sterile solution
of 1 M glucose (20 mM glucose final cone.); just before use, add 5 mL of
sterile solution of 2 M MgCl2.(10 mM MgCl2 final cone.).
Grow cells at 225 rpm and 37C for 1 h.
Spread 100-200 pi of the cell suspension on LB plates.
LB media: 1% bacto-tryptone (w/v), 0.5% bacto-yeast extract (w/v), 1%
NaCl (w/v).
10 LB plates: Autoclave 100 mL of LB media + 1.5 g agar (bacto) in a
500 mL flask. When still pretty warm, add 100 pL of X-Gal (20 mg/mL
stock) which gives a final cone, of 20 flg/mL and 4 mL of ampicillin (2.5
mg/mL stock) which gives a final cone, of 100 pg/mL of ampicillin. Then
pour ten plates.
Keep remaining cell suspension at 4C overnight
If no colonies grew on plate after one night, concentrate cells of remaining cell
suspension by centrifugation for 5 sec. Resuspend in 100 pi of medium.
Remove 10- and 1- pi aliquots and add 100 pi of medium to them. Plate out these
dilutions and the remaining 90 pi.
Incubate overnight at 37C. The ampicillin-resistant white colonies carry the
plasmid with ligated DNA.
Controls: Plate out cells transformed with (a) uncut plasmid, (b) double-digested
plasmid, (c) double-digested plasmid ligated to PCR product DNA.
E. coli colony hybridization; dot blots
Day 1
1.Plate E. CQ transformants from LB plates (amp+, X-gal+) onto LB plates (amp+)
with numbered grid lines. Incubate over night at 37C for 16 h.
Day 2
1. Use a soft pencil and spot a Hybond-N nylon membrane 1 cm apart, 10 spots per row.
Resuspend a toothpick head full of E. coli transformants in 10 pL LB broth and spot
lpL of cell suspension onto the markings of the membrane.
2. Immerse the membrane in 0.5 M NaOH/1.5 M NaCl solution for 30 sec. Make sure
the membrane is completely immersed in the solution.
3. Transfer the membrane to 0.5 M Tris-HCl, pH 8.0/1.5 M NaCl solution and immerse
for 5 min.
4. Transfer membrane to 6x SSC and immerse for 5 min.
20x SSC: Dissolve 175.3 g of NaCl and 88.2 g of sodium citrate in 800
mL of H20. Adjust to pH 7.0 with 10 N HC1. Aliquot and autoclave.


63
d/ddGTP) were pipetted into a 0.5 mL microfuge tubes. Then 500 fmol of template DNA
(either plasmid template or PCR product), 4 pmol of primer, 6 qCi [a-35S]dATP, 5 |i.L of
fmolR 5x sequencing buffer (250 mM Tris-HCl, pH 9.0, 10 mM MgCL), and sterile
distilled water were combined to a final volume of 16 (iL, and 1 (iL of sequencing grade
Taq DNA polymerase (5U/|iL) was added to the primer/template mix. Four p.L of the
enzyme/primer/template mix were added to each d/ddNTP mix. The reactions were
overlaid with 20 pL of Chill-out 14 Liquid Wax (MJ Research), placed in a MJ thermal
cycler preheated to 94C, and subjected to the following temperature profile: 94C for
2 min, then 94C for 30 sec, 42C for 30 sec, 70C for 1 min (30 cycles). They were
Table 4.1. List of Sequencing Primers Used
Forward Primer
Nucleotide Sequence of Primer (5-3)
JM27/18f
TTT GAA TTC CAC CAG GTT GAT TCT GCC
RP6/18
AAG GTA CAA GGT TGA TTC TGC CTG ACG
RP7/530f
GTG CCA GC(AC) GCC GCG G
RP9/1061f
GGT GGT GCA TGG CCG
RPllf
GGT CGT TGT AAA CTC
RP12f
GGA GTG GAT TAT ACG G
M13f (-20)
GTA AAA CGA CGG CCA GT
Reverse Primer
RP4/1492r
TTT GGA TCC GGT TAC CTT GTT ACG ACT T
RP8/1047r
AAC GGC CAT GCA CCA C
RP10/530r
CCG CGG C(GT)G CTG GCA C
M13r (-24)
AAC AGC TAT GAC CAT G


Table 4.2. Pairwise distances between taxa
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
1
The, sp.
.
0.008
0.387
0.384
0.373
0.374
0.370
0.398
0.403
0.425
0.376
0.373
0.366
0.380
0.378
0.377
0.390
0.368
0.432
0.499
2
The, sol.
9
-
0.388
0.385
0.380
0.380
0.376
0.401
0.408
0.426
0.374
0.371
0.366
0.381
0.373
0.381
0.396
0.367
0.434
0.504
3
Nos, bom.
359
364
-
0.004
0.161
0.160
0.170
0.291
0.285
0.341
0.338
0.336
0.328
0.346
0.347
0.362
0.372
0.394
0.384
0.505
4
Nos, &.
356
361
5
-
0.158
0.157
0.167
0.290
0.284
0.338
0.338
0.336
0.328
0.344
0.345
0.362
0.372
0.391
0.382
0.506
5
Vai. nec.
351
361
194
191
-
0.028
0.050
0.277
0.281
0.322
0.321
0.322
0.315
0.333
0.325
0.354
0.363
0.366
0.375
0.491
6
Nos, ves.
352
361
195
192
34
-
0.045
0.277
0.281
0.319
0.320
0.319
0.310
0.329
0.320
0.357
0.365
0.368
0.380
0.489
7
Nos, api.
345
354
198
195
59
54
-
0.291
0.293
0.328
0.324
0.329
0.318
0.339
0.328
0.366
0.382
0.368
0.382
0.496
8
Ene, hel.
396
403
345
344
331
332
338
-
0.089
0.152
0.313
0.311
0.314
0.317
0.352
0.370
0.372
0.373
0.418
0.458
9
Sep, jst.
398
407
338
337
333
336
338
114
-
0.151
0.305
0.303
0.310
0.315
0.358
0.357
0.359
0.368
0.412
0.444
10
Enc. cun.
421
426
396
393
373
374
378
189
189
-
0.334
0.335
0.332
0.339
0.381
0.379
0.377
0.383
0.423
0.450
11
Pie, sp.
362
364
394
394
371
373
369
375
366
399
-
0.007
0.106
0.238
0.302
0.320
0.336
0.373
0.379
0.438
12
End, sch.
358
360
398
398
379
379
374
379
369
399
9
-
0.106
0.239
0.300
0.325
0.331
0.375
0.379
0.439
13
Nos, cor.
354
358
383
383
365
363
363
377
373
398
131
130
-
0.246
0.292
0.339
0.356
0.383
0.394
0.462
14
Ent. bie.
375
379
417
415
399
398
395
398
395
417
293
298
304
-
0.286
0.339
0.357
0.358
0.398
0.438
15
Aem. pen.
370
367
355
353
336
331
337
381
384
410
323
320
313
313
-
0.374
0.392
0.372
0.415
0.486
16
Glu. alh.
383
391
423
423
411
419
421
457
439
464
383
388
407
415
398
-
0.116
0.354
0.339
0.464
17
Ich. sp.
392
402
442
442
429
435
439
467
449
461
402
402
427
445
416
153
_
0.367
0.359
0.471
18
Vai. sp.
375
376
412
409
389
391
388
420
411
428
407
408
419
398
400
409
422
.
0.428
0.390
19
Arne, mic.
418
424
438
436
427
435
421
508
496
499
436
444
455
473
423
414
446
471
0.520
20
Gia. lam.
522
532
611
612
593
596
583
583
564
561
533
543
565
557
529
608
626
466
650
Species are as follows: 1, Thelohania sp.; 2, X solenopsae: 3, Nosema bombvcis (L39111*); 4, N- trichoplusiae (U09282); 5, Vairimorpha necatrix (Y00266); 6,
. vespula (U11074); 7, N- apis. (X73894); 8, Encephalitozoon hellem (L19070); 9, Sepatata intestinalis (U09929); 10, £. cuniculi (Z19563); 11, Pleistonhora sp.
(U10342); 1Z Endoreticulatus schubergj (L39109): 13. N. comeum (U11046): 14. Enterocvtozoon bieneusi (L071231:15. Aemasomapenaei: 16. Glugea athennae
(15987); 17, Ichthvosporidium sp. (L39110); 18 Vairimorpha sp.; 19, Ameson michaelis (L15741); 20, Giardia lamblia (M54878). Numbers above diagonal: mean
distances (adjusted for missing data); numbers below diagonal: absolute distances.
* (GenBank accession number)


115
Embley, T.M., Finlay, B.J., Thomas, R.H., and Dyal, P.L. 1992. TheuseofrRNA
sequences and fluorescent probes to investigate the phylogenetic positions of the
anaerobic ciliate Metopus palaeformis and its archaeobacterial endosymbionL
J. Qen. Microbiol. 138, 1479-1487.
Fowler, J.L., and Reeves, E.L. 1974. Spore dimorphism in a microsporidian isolate.
I. Protozool. 21, 538-542.
Fox, G.E., Stackebrandt, E., Hespell, R.B., Gibson, J., Maniloff, J., Dyer, T.A., Wolfe,
R.S., Balch, W.E., Tanner, R.S., Magrum, J.L., Zablen, L.B., Blakemore, R., Gupta,
R., Bonen, L., Lewis, B.J., Stahl, D.A., Luehrsen, K.R., Chen, K.N., and Woese,
C.R. 1980. The phylogeny of prokaryotes. Science 209,457-463.
Garcia, J.J., and Becnel, JJ. 1994. Eight new species of microsporidia (Microspora)
from Argentine mosquitoes (Diptera: Culicidae). J. Invert. Pathol. 64, 243-252.
Gerbi, S.A. 1985. Evolution of ribosomal RNA. In Molecular evolutionary genetics
(MacIntyre, R.J. ed.), pp. 419-517. Plenum Press, New York.
Goodfellow, M., and ODonnell, A.G. (eds.). 1994. Chemical methods in prokaryotic
systematics. John Wiley and Sons, Chichester.
Goodfellow, M., and Minnikin, D.E. (eds.). 1985. Chemical methods in bacterial
systems. Academic Press, London.
Graham, J.H., Hodge, N.C., and Morton, J. 1995. Fatty acid methyl ester profiles for the
characterization of glomalean fungi and their endomycorrhizae. Appl. Environm.
Microbiol. 61, 58-64.
Gutell, R.R., Weiser, B., Woese, C.R., and Noller, H.F. 1985. Comparative anatomy of
16S-like ribosomal RNA. Progr. Nucleic Acid Res. Mol. Biol. 32, 155-216.
Hartskeerl, R.A., Schuitema, A.R.J., van Gool, T., and Terpstra, WJ. 1993. Genetic
evidence for the occurrence of extra-intestinal Enterocvtozoon bieneusi infections.
Nucleic Acids Res. 21, 4150.
Hazard, E.I., and Oldacre, S.W. 1975. Revision of Microsporida (Protozoa) close to
Thelohania. with description of one new family, eight new genera, and thirteen new
species. Tech. Bull. No. 1530, United States Department of Agriculture,
Agricultural Research Service
Henneguy, F., and Thlohan, P. 1892. Myxosporidies parasites des muscles chez
quelques crustacs dcapodes. Ann. Microgr. 4, 617-641.


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Richard S. Patterson, Chairman
Professor of Entomology and Nematology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy
Jades J. Beci>el, Cochairman
Assistant Professor of Entomology and
Nematology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
John/Gander
Professor of Microbiolgy and Cell Science
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
es Kimbrough
rofessor of Plant Pat
ology
)
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Philip Ko
Professor of Entomology and Nematology


CHAPTER II
MORPHOLOGICAL CHARACTERIZATION OF MICROSPORIDIA FROM
SOLENOPSIS INVICTA AND S. RICHTERI
Introduction
Fire ants belong to the genus Solenopsis. Six species four native and two
introduced and two hybrids occur in North America. Solenopsis geminata (Fabricis),
S. xvloni (MacCook), S. amblvchila Wheeler, and S. aurea Wheeler are native species and
found in the southern states (Trager 1991). As indicated in their names, the black
imported fire ant, S. richteri Forel, and red imported fire ant, S. invicta Burn, are not
native to this country but were introduced from South America. Two hybrid forms,
S. xvloni x geminata and S. richteri x invicta, occur as well in the United States (Trager
1991).
Solenopsis invicta is common in the southwestern region of Brazil (Pantanal, a
large flood plain of the head waters of the Paraguay river) westward through Rhondonia
and southward along the Paraguay River through Bolivia to the northern border of
Argentina with Paraguay and Uruguay (Burn et al. 1974). Solenopsis richteri is prevalent
in the more temperate southern states of Brazil, Uruguay and Argentina. Lofgren (1986)
summarizes in great detail the early history of imported fire ants in the United States.
Briefly, S. richteri was introduced into Mobile, Alabama, around 1918 (Creighton 1930)
and is now established in areas of northeastern Mississippi and northwestern Alabama.
The red imported fire ant, S. invicta, reached Mobile, Alabama, in the 1940s (Wilson and
Eads 1949) and subsequently spread throughout the southeastern states displacing
£ richteri everywhere except in pockets of northeastern Mississippi and northwestern
Alabama. Originally, £. invicta and £. richteri were considered different color morphs of
4


% 18:1
45
V. necatrix A N. algerae CEW N. algerae mos. #Thelohania sp.
Figure 3.4. Three major fatty acids of three species of microsporidia.
Measurements of variability and clustering among the profdes were portrayed by plotting
the percentages of the three major fatty acids on a 3-D graph. CEW = com earworm,
mos. = mosquito.


77
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrlx
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schuberqi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schuberqi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha ap.
A. michaelis
901 960
GACACCACAAGGAGTGGATTATACGGCTTAATTTGACTCAACGCGGGAAAACTTACCAGG
GACACCACAAGGAGTGGATTATACGGCTTAATTTGACTCAACGCGGGAAAACTTACCAGG
AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACCCGGGGTAATTTACCAGG
AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGGGGTAATTTACCAGG
AATACCAGAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGTAACTTACCAAT
AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGTAACTTACCAAT
AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGTAACTTACCAAT
GACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGT
GACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGT
GACACCACAAGGCGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGC
TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAAGCTTACCAGG
TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAAGCTTACCAGG
TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAAACTTACCAGG
GACACTACCAGGAGTGGATTGTGCTGCTTAATTTAACTCAACGCGGGAAAACTTACCAGG
TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAATTTTACCAGG
AACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGACAGCTTACCAGG
sp. AACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGACACCTTACCGGG
GACACCACAAGGAGTGGAGTGTGCGGGTTAATTTGACTCAACGCGGGACAACTTACCGGG
CTAGCCACAAGGGTTGGATTGTGCGGCTTAATTTGACTCAAAGCGGAAAAGCTTACCAAG
* ic h
sp.
961 1020
GCCTATGTATAAGAGAAAGTTAACATTGTATG TATACTTGATTGTACTTTGAG
GCCTATGTATAAGAGAAAGTTAACATTGTATG TATACTTGATTGTACTTTGAG
TATAA CATGGTATAATATTTT ATCATGATAG
TATAA CATGATATAATATTTT ATCATGATAG
ATT TTATTC AGAGAAGATTTTCGATC-TGAGAATGATAATAG
ATTTT ATTATTTTGAGACGATTTTTAATC AGAGAATGATAATAG
ATTTT ATTGTTCTGCGAGGATAT GATC-TGAGGATGATAATAG
TCTGA AGTGAGTGTGAGAGTGTTTTTACAT-GAT-GCTTACGGCGG
TCTGA AGCGGGCAGGAGAACGAGGACGG-GAT-GCGCGCGGCGG
TCTGA AGGAATGCCTGTGAGGCATGGCAT-TGGCATGCGGCGG
GCCAA GTGCTGTGGAGAAAG GAGCAGGACAGAAG
GCCAA GTGCTGTGGAGAAAG GAGCAGTACAGAAG
GCCAA GTATTGTGTAGAAAC GAGCAATACAGGAG
GTCAA GTCATTCGTTGATCG AATACGTGAGAATGGCAGGAG
GCTGA ATATATTTGAGATTG AATACATGAAATATATTTGAG
CCCGACGGCCGGACGAGTGTTGTACACGATAGGTCGA AGAG
CCC-ACGGCCACACGAGTGTGACACACGATA-GCCGA GGAG
GCAGGCGACGAGAAGCGAAGGATGATGAAGAGATTC ACAGACTGATTGCGTCGCGTG
CTTATTTATTCAACGA- -GTATTTATCCGAGAGTA AAATG
1021 1080
TGGTGCATGG-CCGTTTTCAACACGTGGGGTGACTTGTCAGGTTTATTCCGGTAACGTGT
TGGTGCATGG-CCGTTTTCAACACGTGGGGTGACTTGTCAGGTTTATTCCGGTAACGTGT
TGGTGCATGG-CCGTTTCCAATGGATGCTGTGAAGT-AATGATTAATTTCAACAAGATGT
TGGTGCATGG-CCGTTTCCAATGGATGCTGTGAAGT-AATGATTAATTTCAACAAGATGT
TGGTGCATGG-CCGTTTTCAATGGATGCTGTGAAGT-TTTGATTAATTTCACCAAGACGT
TGGTGCATGG-CCGTTTTCAATGGATGCTGTGAAGT-TTTGATTAATTTCAACAAGACGT
TGGTGCATGG-CCGTTTTCAATGGATGCTGTGAAGT- TTTGATTAATTTCAACAAGACGT
TGGTGCATGG-CCGTTTTAAATGGATGGCGTGAGCT-TTGGATTAAGTTACGTAAGATGT
TGGTGCATGG-CCGTTTGAAATGGATGGCGTGAGCT-TTGGATTAAGTTGCGTAAGATGT
TGGTGCATGG-GCCTTTTAAATGGATGGCGTGA-CT-TTGTCTTAAGTTGCGTAAGATGT
TGGTGCATGG-TCGTTGGAAATTGATGGGATGACTT-TGGCCTTAAATGGCTGAATGAGT
TGGTGCATGG-TCGTTGGAAATTGATGGGATGACTT-TGGCCTTAAATGGCTGAATGAGT
TGGTGCATGG-TCGTTGGAAATTGATGGGATGACTT-TGACCTTAAATGGTTGAATGAGT
TGGTGCATGG-CCGTTGGAAATTGATGGGGCGACCT-TTAGCTTAAATGCTTAAACCAGT
TGGTGCATGG-TCGTTGTAAACTCATGGATTGATCT-TAAGTTCAACTGCTAAAATGGGT
TGGTGCATGG-CCGTTAACGACGAGTGAGGTGACTT-TTGGGTTAAATCCGGGAAGTAGT
sp. TGGTGCATGGCCCGTTAACGACAAGTGA-GTGATCT-TTGGGTTAAGTCCGTAAATTAGT
TGGTGCATGG-CCGTTTTTAACACGTGGGGTGACTTGTCAGGTTAAATCCGATAACGCGT
GTGTGCATGG-CCGTTCCTAACACATGGAGTGATTTTGTGATTAACCTTCCGTAATCTGT
******** ** ** ** ** **


29
infiltration of the imported fire ant microsporidia for tissue fixation and embedding into
plastic. Because masses of spores occur in cysts, it is nearly impossible to get good
infiltration of spores towards the interior of the cyst. Most importantly, the spore walls
present a nearly impenetrable barrier to fixatives and plastics (J. Becnel, personal
communication). Vairimorpha sp. and V. invictae meiospores are especially challenging
because of their very thick spore walls. The obtainable ultrastructure of the fire ant
microsporidian spores thus does not result in the same quality of resolution available from
some other species of microsporidia such as those parasitizing aquatic insects which are
(for unknown reasons) easier to prepare for TEM.
In conclusion, ultrastructural evidence indicates that Thelohania sp. and
T. solenopsae appear to be the same species. Ultrastructural evidence also indicates that
Vairimorpha sp. and V. invicta are conspecific. It is premature, though, to draw a
conclusion based solely on morphological characteristics because there are examples of
microsporidia that are distinct species based on biochemical and immunological tests but
indistinguishable at the light- and ultrastructural level (Didier et al. 1991). Differences in
number and arrangement of coils of the polar filament presently cannot be used as good
taxonomic characters because of problems of quantification and unresolved host
specificities. Vairimorpha sp. and Thelohania sp. are very different from each other at the
gross morphological and ultrastructural level, but because of the occurrence of
heterosporous microsporidia and phenotypic plasticity more evidence is needed to resolve
the question whether they are different phenotypes of the same species.


26
Discussion
Based on the morphological evidence Thelohania sp./T. solenopsae and
Vairimorpha sp./V. invictae appear to be conspecific. Vairimoipha sp. and Thelohania sp.
are very distinct from each other at the light-microscopic and ultrastructural level in both
size and morphology. Thelohania sp. and Vairimorpha sp. are very similar to T.
solenopsae and V. invictae. respectively, with regard to tissue specificity, and light and
ultrastructural microscopy.
To determine whether Vairimorpha sp. and Thelohania sp. are different phenotypes
of the same species, the possibilities of heterosporous microsporidia (Sweeney et al 1985;
Becnel et al. 1989) and phenotypic plasticity must be considered. Even though Mitchell
and Cali (1993) did not observe temperature-related differences in the ultrastructure of
V. necatrix. there are reports of environmentally induced phenotype variation. Burenella
dimorpha. a microsporidian parasite of S. geminata. for example, shows temperature-
dependent spore dimorphism (Jouvenaz and Lofgren 1984). They demonstrated inhibition
of octospore development at relatively low (20C) and high temperatures (30C).
Temperature-dependent spore dimorphism has been demonstrated for other microsporidia
as well (Maddox and Sprenkel 1978). This means that Vairimorpha sp. and
Thelohania sp., even though ultrastructurally distinct, could be different phenotypes
(expressed in different environmental conditions) of the same species.
Spore measurements of Thelohania sp. meiospores and free spores are about 1 pm
larger than the previously published measurements of T. solenopsae by Knell and Allen
(1977). This difference in spore dimensions could be due to a different technique to read
the scale in the ocular micrometer (used for spore measurements) or to environmentally
induced size variation due to temperature or host For example, temperature regulated
spore length of Vairimorpha sp. 696 (Sedlacek et al. 1985). Spores were significantly
longer at 19C (5.9 pm) than at 32C (4.7 |im). Mean spore size of the same species of


11
concentrated to dryness with nitrogen gas, and redissolved in 20 (lL of hexane for GC
analysis (Carlson and Brenner 1988). Oxygenated compounds, if present, remained on the
column.
Gas chromatography analyses of hydrocarbons were conducted using a 5890
series II Hewlett Packard gas chromatograph with a flame ionization detector. The
column oven was fitted with a 30 m x 032 mm i.d. x 0.25 |im film thickness fused silica
capillary column of DB-1. Following a cool-on column injection of 1 jlL at 63C, the
oven temperature was raised to 230C at 25C/min, and then to a final temperature of
320C at 7C/min. The temperature was held at 320C for 15 min. The carrier gas was
hydrogen. The data were processed by HP Chemstation, version 1.0 software.
Phase Contrast Microscopy
Diagnosis of infection was made by examining wet mounts of fat body tissue of
adults by phase contrast microscopy. Different body parts were examined for infection
(head, thorax, gaster). Fresh samples of Thelohania sp. and Vairimorpha sp. were used
for spore measurements with a calibrated Vickers image-splitting micrometer.
Transmission Electron Microscopy
Spore cysts of Thelohania sp., Vairimorpha sp., and T. solenopsae were dissected
from adult worker ant gasters in 2.5% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH
7.4) containing 0.1% CaCh. After 30 min, the hardened cysts were transferred to fresh
2.5% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) containing 0.1% CaCl2 and
fixed for 2-4 h at room temperature. They were postfixed in 1% aqueous Os04 (osmium
tetroxide) (w/v) for 2 h at room temperature, dehydrated through an ascending ethanol
and acetone series and embedded in Epon-Araldite plastic (Mollenhauer 1964). Tissue
blocks were thick-sectioned with a glass knife, and thin-sectioned with a diamond knife on


68
MW
p,
(A
x:
e
o
S
c
I
P<
(A
CS
o
13
rt
CA
|
C>
c

o
CA
Hl
c
c
u
p
MW
2036
1636
1018
Figure 4.1. PCR products of the 16S rRNA gene of four microsporidian species.
Photograph of crude PCR products following gel electrophoresis. PCR was carried out as
described in the Methods section. Approximately 300 ng (~ 30 ng/ |iL) of each PCR
product was electrophoresed with 1 pL of lOx loading dye (50% glycerol, 50 mM EDTA,
0.5% bromphenol blue) on a 0.8% Seakem LE agarose gel in Tris-acetate buffer (40 mM
Tris-acetate, 1 mM EDTA, pH 8.0). A standards, X/Hindl cut DNA (200 ng) was
included to determine the molecular sizes of the PCR products.


5
the same species, S. saevissima richteri Forel (Wilson 1951). Burn (1972) was the first
one to describe S. invicta as a separate species. £. invicta and £. richteri interbreed in
areas of Alabama, Mississippi, and Georgia where their ranges overlap (Ross et al. 1987;
Vander Meer and Lofgren 1988). Since the two species mate and are successful at
producing viable hybrids, the validity of S. invicta as a separate species is questionable but
recognized as such until further investigations (Vander Meer and Lofgren 1988).
Imported fire ants are considered agricultural and urban pests in the United States and
represent a human health risk. They are generally no problem in South America (Stimac
and Alves 1994; Patterson 1993; Adams 1986).
Imported fire ant populations occur at relatively low levels in their South American
homelands. Fire ant mound densities are much higher in the US than in Brazil, and fire
ants constitute a much larger fraction of the ant community in the US (Porter et al. 1992).
Reasons for this could be lack of predators, pathogens, and competitors of imported fire
ants in the US (Burn et al. 1978; 1983). Stimac and Alves (1994) present a summary on
red imported fire ant ecology in their homelands and the US. Further summaries can be
found in Lofgren and Vander Meers book on fire ants and leaf-cutting ants (1986).
Only a few surveys for pathogens of fire ants in the United States have been
conducted. Jouvenaz et al. (1977) have used a screening method sufficiently sensitive to
detect low levels of microsporidian and fungal infections but not bacteria and viruses.
They find no pathogens in £. richteri: in S. invicta they detect very low levels of a benign,
unidentified yeast infection, and only 1 in 1007 colonies has an unidentified microsporidian
disease. This microsporidium is found in low levels in £. geminata (Fabricis) colonies.
Subsequently, Jouvenaz and Hazard (1978) described Burenella dimorpha a new
microsporidian genus and species, from S. geminata and created a new family. Beckham
and Bilimoria (1982) examined samples of 113 ant species including S. invicta from
western Texas for the presence of fungi, occluded viruses, microsporidia, and nematodes
and found resting spores of Entomophthora sp. on only one specimen of Pheidole


55
remove large body parts. The resulting crude spore suspension was further purified by
differential centrifugation on a continuous Ludox (DuPont) gradient (Undeen and Alger
1971). The spores were stored at 4C in Tris-EDTA (TE), pH 8.0 or distilled water until
DNA was extracted.
To collect Thelohania sp. spores from S. richteri and T. solenopsae spores from
S. invicta, fat body cysts were dissected out of the abdomens of 25-30 infected adult
workers which had been frozen at -70C, and collected on ice in 0.1% SDS in 1.5 mL
microfuge tubes. The spores were washed twice by centrifugation in deionized water,
counted with a hemocytometer and stored in deionized water at 4C until DNA was
extracted. The infection level with V. invicta was so low that spores could not be purified
and used in the analysis. Samples of T. penaei were obtained as an aqueous suspension
from R. M. Overstreet.
DNA Extraction From Microsporidia
A DNA extraction procedure suggested by M. D. Baker and C. R. Vossbrinck
(University of Illinois, Urbana, IL; personal communication) was employed. A range of
spores (1x10s 1x10s) was pelleted in 0.5 mL microfuge tubes by centrifugation at 10,000
g for 1 min and resuspended in 200 pL of sodium chloride/Tris/EDTA (STE) buffer (100
mM NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA). Approximately 200 pL 0.1 mm
diameter siliconized glass beads was added to the spore suspension, and the mix was
shaken in a mini beadbeater (Biospec) at low speed for 20 sec to break the spores and
release their genomic DNA. Immediately after breaking the spores, the homogenate was
heated at 95C for 5 min to inactivate DNA degrading enzymes and centrifuged for 5 min
at 10,000 g. The supernatant was removed, frozen solid, thawed and centrifuged again at
10,000 g for 5 min. The supernatant containing the DNA was used for PCR immediately
or stored at -20C for later PCR analysis.


APPENDIX
Cuticular hydrocarbon analysis of Solenopsis richteri and S. invicta
1. Soak five worker ants, frozen at -20C until analysis, in 1 mL of hexane in small vials
for 2 h to extract lipids.
2. Separate hydrocarbons from the extracted lipids with chromatography on mini
columns containing 3 cm of silica gel (60-200 mesh, J.T. Baker, Philadelphia, Pa.)
packed into disposable Pasteur pipettes (Carlson and Bolten 1984). To make a
column, stuff a little glass wool into a Pasteur pipette and pour silica gel on top of it.
3. Elute hydrocarbons from the mini-column with 3 mL of hexane, concentrate them to
dryness with nitrogen gas, and redissolve them in 20 pL of hexane for GC analysis
(Carlson and Brenner 1988).
4. Analyze hydrocarbons with a 5890 series II Hewlett Packard gas chromatograph
with flame ionization detector fitted with a 30 m x 032 mm i.d. x 0.25 |im film
thickness fused silica capillary column of DB-1.
5. Following a cool-on column injection of 1 pL at 63C, raise oven temperature to
230C at 25C/min, and then to a final temperature of 320C at 7C/min. Hold
temperature at 320C for 15 min. The carrier gas was hydrogen.
6. Process data by HP Chemstation, version 1.0 software.
Per os infection of com earworm. Helicoverpa zea with Vairimorpha necatrix
1. Sprinkle com earworm eggs on pinto bean diet in 50 well flats, keep them in the
insectary at 23C with a photo period of 16 h light/8 h dark. Secure flats with clear
plastic foil and solid metal or plastic sheet to prevent larvae from escaping.
2. After approximately 5 days, discard all but one healthy larva from each well. Add 10
pL of 1x10^ spores/mL to the diet of each larva.
3. Harvest the spores from last-instar larvae.
Per os infection of H. zea with Nosema algerae
1. Sprinkle com earworm eggs on pinto bean diet in 50 well flats, keep them in the
insectary at 23C with a photo period of 16 h light/8 h dark.
2. Pick 4-5 day old H. zea larvae and starve them individually in small plastic cups for
24 h.
3. After 24 h, add 20 pi of 1x10^ spores/mL deionized water to each cup.
4. Expose the larvae for 24 h to the spore suspension.
95


121
Pilley, B.M. 1976. A new genus, Vairimorpha (Protozoa: Microsporida), for Nosema
necatrix Kramer 1965: Pathogenicity and life cycle in Spodoptera exempta
(Lepidoptera: Noctuidae). J. Invert. Pathol. 28,177-183.
Portaels, R, Dawson, D J., Larrson, L. and Rigouts, L. 1993. Biochemical properties and
fatty acid composition of Mycobacterium haemophilum: Study of 16 isolates from
Australian patients. J. Clinic. Microbiol. 31, 26-30.
Porter, S.D., Fowler, H.G., and Mackay, W.P. 1992. Fire ant mound densities in the
United States and Brazil (Hymenoptera: Formicidae). I. Econ. Entomol. 85,
1154-1161.
Ratledge, C., and Wilkinson, S.G. (eds.). 1988. Microbial lipids, vol. 1. Academic
Press, London.
Ratledge, C., and Wilkinson, S.G. (eds.). 1989. Microbial lipids, vol. 2. Academic
Press, London.
Reynolds, E.S. 1963. The use of lead citrate at high pH as an electron opaque stain in
electron microscopy. I. Cell Biol. 17, 208-212.
Ross, K.G., Vargo, E.L., and Fletcher, D.J.C. 1987. Comparative biochemical genetics
of three fire ant species in North America, with special reference to the two social
forms of Solenopsis invicta (Hymenoptera: Formicidae). Evolution 41. 979-990.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning: A laboratory
manual. Cold Spring Harbor Laboratory Press.
Sanchez-Pea, S.R., and Thorvilson, H.G. 1992. Two fungi infecting red imported fire
ant founding queens from Texas. Southwest. Entomol. 17,181-182.
Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA sequencing with chain
terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467.
SAS Institute. 1989. SAS/STAT users guide, version 6,4th edition. SAS Institute,
Cary, N.C.
Sasser, M. 1990a. Identification of bacteria through fatty acid analysis. In Methods in
Phytobacteriology, (Klement, Z., Rudolf, K., and Sands, D., eds), pp. 199-204.
Akademiai Kiado, Budapest
Sasser, M. 1990b. Identification of bacteria by gas chromatography of cellular fatty
acids. Technical Note 101. MIDI, Newark, DE.


104
2.Wrap the membrane in Saran wrap, tape it to a blot paper and expose an x-ray film
overnight at -70C. Develop the film and identify the correct positively hybridizing E.
coli transformants.
Grow bacterial clones in Terrific Broth (TBl
1. With a sterile bacteriological loop, pick one transformant (white) bacterial colony
from the LB plate and add to 3 mL TB broth + 120 pL ampicillin (2.5 mg/mL stock).
TB broth (per 1 liter diH20): 1.2% bacto-tryptone (w/v), 2.4% bacto-
yeast extract (w/v), 0.4% glycerol (v/v); autoclave and add 100 mL of
sterile solution of 0.17 M KH2PO4 and 0.72 MK2HPO4.
2. Grow the cells over night at 225 rpm and 37C.
Glycerol stock from bacterial clones
1. To prepare 15% glycerol stock for long-term storage at -70C, add 850 pL of cell
suspension to 150 pL of ice-cold, sterile glycerol. Glycerol is already aliquotted into
microfuge tubes. Keep microfuge tubes on ice.
2. Mix well and store at -70C.
Grow up glvcerol stock
1. Add 10 pL of glycerol stock to 3 mL TB broth + 120 pL ampicillin (2.5 mg/mL
stock).
2. Grow the cells over night at 225 rpm and 37C.
3. Purify plasmid DNA the following day.
Purification of plasmid DNA from E. coli
1. Pellet 1.5 mL of culture for 1 min at 12,000 rpm in a microcentrifuge. Remove the
supernatant. (A total of 4.5 mL of culture can be spun down into one tube).
2. Resuspend the pellet in 200 pL of GTE (50 mM glucose, 25 mM Tris-HCl, pH 8.0,
10 mM EDTA, pH 8.0) buffer by pipetting up and down.
3. Add 300 pL of 0.2 N NaOH/1% SDS (make fresh each time) buffer, mix by tube
inversion, and incubate on ice for 5 min.
4. Add 300 pL of 3.0 M KOAC, pH 4.8, mix by tube inversion, and incubate on ice for
5 min.
5. Centrifuge the tube for 10 min at 12,000 rpm in a microcentrifuge tube at room
temperature and transfer supernatant (approximately 700 pL) to a clean tube.
Centrifuge the supernatant again for 10 min and transfer to a clean tube.
6. Add RNAase A (10 mg/mL stock) to a final concentration of 20 pg/mL. Incubate at
37C for 20 min.


75
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
541 600
AGCCAGTTTATGGATT-GTTTTTGATAATAGTTATTCTCCAAAAGAGCTAATTTTAACTA
AGCCAGTTTATGGATT-GTTTTTGATAATAGTTATTCTCCAAAAGAGCTAATTTTAACTA
AGTTT-A-T
AGTTT-ATT
AGTTT-ATA
AGTTT-ATA
AGTTT-ATT
AGTTG- TTTGTATGT CTTTTGAGTGATGTTTATGGTTTTTAGTGGATGTAG TTT
AGTCT- TTTGTATGT CTTTGTTTGGGGGATTATGTCCTGATGTGGATGTAA-GAG
AGTCT-GTTGTGTATG TC TTTGTGTGTGATGTTTGTGGTTGTGTGTGGATGTAGTGAT
AGTCG- TGGAGACG GAAAGAGAG- -GCGGAGCCTCTTTGAGAT
AGTCG-TGGAGACG GAAAGAGAGGCGGAGCCTCTTTGAGAT
AGTCA-TAGAAGGG CAAAGAGAGATGCGAGGTCTCACAGTGCG
AGTCG- TGAATGCA ATTAAATGTCGTTGTTCAATAGCGATGAGTTTGCTA--
AGTCTTTACGTA ATTAAAAATGAATGATCAAGTTTCATATTTTTACGTTT
AGTCGAAGTGGTTATA-ACGGTGTAACAGGCCTTCTCTCAAGGAGGGTTATGCGCCGTGA
sp. AGTCGAACCGGGTTGA-ATTGCGTGACAGTCAGACTCTCAAGGTGTGATGAGCGCTGTGA
AGTCGGGGAGCAGG-CCAGCAGAAAAGGTGGGGAATCACGCCTAGCATAGTGCAGGAA
AGTCGCGGCTGGGA CTGACCTGTAATCTATTTGGTCAACAGATAGATAGGGGCAGTA
*
601 660
ATTCATAA AAATAGAAGCGGATGAAGGTAATTGTATTCACCAGCAAGAGGTAAAATT
ATTCATAA AAATAGAAGCGGATGAAGGTAATTGTATTCACCAGCAAGAGGTAAAATT
TTAT AATAAGGATTGTAAGGTATACTGTATGGTTAGGAGAGAGATGAAATG
TTAT AATAAGCATTGTAAGGTATACTGTATGGTTAGGAGAGAGATGAAATG
TT-T AAGAAGCAATATGAGGTGTACTGTATAGTTGGGAGAGAGATGAAATG
TT-T AAGAAGCAATATGAGGTGTACTGTATAGTTGGGAGAAAGATGAAATG
AT-T AAGAAGCAATATGAGGTGTACTGTATAGTTGGGAGAGAGATGAAATG
TATT GTAGCAGAGGACGAGGGGCACTGGATAGTTGGGCGAGGGGTGAAATA
GTTT G--GCAGAGGACGAGGGGCACCGGATAGTTGGGCGAGGGGTGAAATA
GTGT GTGGCAGAGGACGAGGGGCACTGGATAGTTGGGCGAGAGGTGAAATG
GCTCT GGAGAAGCCAACAGGGGGCACAGTATACCAGGGCGAGAGATGAAATG
GCTCT GGAGAAGCCAACAGGGGGCACAGTATACCAGGGCGAGAGATGAAATG
ATGAT GGAGGAGCCGATGGGGAACATAGTATACCAGGGCGAGAGATGAAATG
ATGTT TGCGGAACGGATAGGGAGTGTAGTATAGACTGGCGAAGAATGAAATC
ATA TATGAGACGGATTGGGAGCATAGTATAACTGGGTTAAGAATGAAATC
TTCCATGG AATAAGGAGCGTTTAGGGGCCAGGTTATTAAGCGACGAGGGGTGAAATC
sp. TTCTGGGG AATAAGGAGTGTTTAGGGGCCAGGGTATTAAACGGCAAGCGGTGAAATG
CTGGGA CCTAGGGACCGGAGAGGGGCAACCTAATTCTTGGGCGAGGGGTGAAAAC
GCAAGTTG GAAAAGAGCAATTTGGTGTCAGCTAATGGTATGGGGAGGGGTAAAGTC
** **
661 720
TGATGAC-CTGGTGAGGACATTCAGAGGCGAAAGCGATTGCCTAGTACATTTTTGAT
TGATGAC CTGGTGAGGACATTCCGAGGCGAAAGCGATTGCCTAGTACGTTTTTGAT
TGATAACCCTAAC-TGGATGAACAGAAGCGAAAGCTGTATACTTAAATGTATTATTA
TGATAACCCTAAC-TGGATGAACAGAAGCGAAAGCTGTATACTTAAATGTATTATTA
TGACGACCCTGAC-TGGACGAACAGAAGCGAAAGCTGTACACTTGTATGTATTTTTT
TAACGACCCTGAC-TGGACGAACAGAAGCGAAAGCTGTACACTTGTATGTATTTTTT
TGACGACCCTGAC-TGGACGAACTGAAGCGAAAGCTGTACACTTGTATGTATTTTTT
CGAAGACCCTGAC-TGGACGAAGAGAAGCGAAGGCTGTGTTCTTGGACTTTTGTGGT
CGAAGACCCTGAC-TGGACGGACAGAAGCGAAGGCTGTGCTCTTGGACTTATGTGAC
CGAAGACCCTGAC-TGGACGAGCGGAAG AGGCTGTGCTCTTGGACTAATGTTGTTGC
CCAAGACCCCTGG-TGGACTGAGCGAGGCGAAAGCGGTGCTCTTGTGGGTGTTCGGT
CCAAGACCCCTGG-TGGACTGAGCGAGGCGAAAGCGGTGCTCTTGTGGGTGTTCGGT
CCAAGACCCCTGG-TGGACTGAGCGAGGCGAAGGCGATGTTCTTGTAGGCATTCGGT
TCAAGACCCAGTT-TGGACTAACGGAGGCGAAGGCGACACTCTTAGACGTATCTTAG
TCACTACCCTAGT-TGGACTATCAGAAGCGAAAGCGATGCTCTAATACGTACTTTTA
TGGTGACTCGCTTA-GGAGCAACAGAGGCGAAAGCGCTGGCCAGGAGCGAATCCGAT
sp. TGTTGACCCGTTTATGGAGCGACAGAGGCGAAAG-GCTGGCCAGGGGCAAATCCGAT
TGCTGACCCTGAGA-GGAGGAACAGAGGCGAAGGCGGTTGTCCGGGACGGGTCTGAC
TGAGGATC C TGCAGGAGGAGCAAAGGCGTAAGCACTGACAAAGATTGATTCTGTT
*** *


103
5. Wrap the membrane in Whatman blot paper and bake at 80C for 2 h under vacuum.
Store the membrane in drawer.
Day 3
1. Place membrane in hybridization tube and wet it in 5 mL of 6x SSC. Discard 6x SSC.
2. Add prehybridization solution at 10 mL per 10 cm2 of membrane. Rotate in
hybridization chamber for 4-6 h at 68C.
Prehybridization/Hybridization solution (100 mL)
200 pL EDTA (0.5 M)
35 mL of 20% SDS
50 mL Na2HP04 pH 7 (1 M)
15 mL H20
3. Nick translate PCR product DNA.
PCR product DNA (~40 ng/pL)
TE
lOx Nick buffer*
100 pM dNTP
32P-dCTP-3000
DNAase
DNA Pol I (5U/pL)
*0.5 M Tris-HCl, pH 7.2, 0.1 M MgS04, 1 mM dithiothreitol, 500 pg
bovine serum albumine (BSA).
Incubate at 15C for 45 min. Mix the probe with 1 mL TE and pass over a Sephadex-
50 packed column. Reject the first 0.5 mL flowthrough and collect the rest in a sterile
glass tube. Add 2 mL TE to the column after the probe got into the column and
collect the flowthrough. Boil the probe by placing the glass tube in a boiling water
bath for 3 min and mix with ~ 5 mL hybridization solution before adding to the
membrane.
4. Remove prehybridization buffer and hybridize the membrane in 10 mL hybridization
buffer containing the radioactive probe for 16 h at 68C.
3 pL
10 pL
3 pL
1 pL each
5 pL (50 pQ)
3 pL (1 mg/mL)
3 pL
Day 4
1. Wash the membrane with washing solution 12 times in ~50 mL fluid at 68C for 1 h
each. Then wash membrane wish washing solution II2 times in ~50 mL fluid at 68C
for 1 h each.
Washing solution I (5% SDS cone.; per liter)
2 mL EDTA (0.5 M)
40 mL Na2P04 pH 7.2 (1 M)
250 mL 20% SDS
708 mL H20
Washing solution II (1% SDS; per liter)
2 mL EDTA (0.5 M)
40 mL Na2P04 pH 7.2 (1 M)
50 mL 20% SDS
908 mL H20


62
restricted DNA samples were electrophoresed with 2 pL of lOx loading dye (50%
glycerol, 50 mM EDTA, 0.5% bromphenol blue) on a 3% Nusieve GTG/1% Seakem LE
agarose gel.
Sequencing of the 16S rDNA
Purified PCR products of Thelohania sp. Vairimoipha sp., and A. penaei. eluted in
sterile, distilled water, were used as sequencing templates. The sequence of the PCR
products was completed by redundant sequencing of both strands. Hybrid plasmid DNA,
carrying the cloned T. solenopsae rDNA, in sterile, distilled water was used for
sequencing. The consensus sequence was obtained by redundant sequencing of both
strands of three clones.
Sequencing was completed by using three primers in each direction. The
sequences of the primers are listed in Table 4.1. Sequences for RP7/530f, RP9/1061f,
RP8/1047r, and RP10/530r primers were obtained from C. R. Vossbrinck and M. D.
Baker (personal communication).
The following primers were used for Thelohania sp.: JM27/18f, RP7/530f,
RP9/1061f, RP4/1492r, RP8/1047r, and RP10/530r. The primers used to sequence
J. solenopsae were M13f, RP7/530f, RP12f, M13r, RP8/1047r, and RP10/530r. Primers
used to sequence the Vairimorpha 16S rRNA gene were identical to the ones used for
Thelohania sp., except that RP6/18f was used instead of JM27/18f. Primer RP9/1061f
was replaced with RPllf to sequence the A. penaei 16S rRNA gene, and all the other
primers were the same as in Thelohania sp.
Both manual and automated DNA sequencing methods were employed. Manual
cycle sequencing was performed by the dideoxynucleotide chain termination sequencing
method (Sanger et al. 1977) using the fmol sequencing kit (Promega). For each set of
sequencing reactions, 2 (iL of each d/ddNTP mix (either d/ddATP, d/ddTTP, d/ddCTP or


Table 3.1. Fatty Acids (%) in Three Microsporidian Species from One Aquatic and Two Terrestrial Insect Hosts
Nosema algerae Vairimorpha necatrix Thelohania sp.
Fatty Acida
A. quadrimaculatus
n=7
H. zea
n=7
H. zea
n=5
S. richteri
n=7
14:0
2.8 0.2d
Be
2.2 0.1
C
0.0
D
4.7 0.2
A
16:1qj7Cs
11.4 0.8
A
2.0 0.1
c
1.4 0.2
C
4.2 0.7
B
16:0
34.5 0.6
A
34.1 0.5
A
31.2 1.5
A
22.7 1.0
B
Summed Feature 6b
13.4 0.8
B
25.4 0.8
A
28.4 2.2
A
17.4 1.3
B
18:1qj9Cs
16.5 0.3
C
20.5 1.8
BC
29.6 2.9
A
26.0 2.1
AB
c
Summed Feature 7
6.3 0.5
A
0.0
B
0.0
B
0.2 0.2
B
18:0
4.7 0.2
BC
9.4 0.2
A
6.5 0.9
B
4.1 0.6
C
20:4GJ6,9,12,15cis
4.1 0.3
A
0.0
B
0.0
B
2.7 0.6
A
20:l(jj9cis
1.8 0.4
BC
2.6 0.1
B
0.0
C
6.3 0.8
A
^Number of carbon atoms in fatty acid:number of double bonds per acid
Summed Feature 6 identified as 18:2(36,9^5/18:0 anteiso by the MIDI peak library
Q
Summed Feature 7 identified as 18:1 (¡jycis/^qtrans/^ j2trans by the MIDI peak library
^Standard errror of the mean
Arithmetic means in a row followed by a different letter are significantly different from each other


107
7. After gel polymerization, remove sharkstooth comb and rinse the unit briefly in water
to remove the crystallized urea. Mount the gel unit on the electrophoresis apparatus.
8. Make 1,500 mL of 1 x TBE, pour 1 x TBE into the buffer tank of one glass plate and
the buffer tank at the bottom.
9. Rinse the space between the two glass plates and polymerized gel very well with a
syringe filled with buffer to remove bits of urea. Insert the sharkstooth comb with
the teeth pointing into the gel.
10. Rinse the bottom of the gel unit (standing in the buffer tank filled with buffer) to
remove any trapped air bubbles (which would affect the flow of current).
11. Pre-run the gel at 1,800 V for at least 30 min to heat the gel.
12. Heat the sequencing reactions to 70C for 2 min just prior to loading them onto the
gel. With a flat pipette tip, load 3.5 pL of each reaction into one of the wells formed
by the sharkstooth comb.
13. Run the gel for 3 h at 1,800 V, then load another round of sequencing reactions and
run for an additional 3 h. Repeat one more time.
14. Turn off the power, pour out the buffer (collect the buffer from the bottom tank in a
receptacle for radioactive waste), and disassemble the unit Pull the glass plate with
the buffer tank away from the other plate; the gel should stick to the other plate.
Remove the spacers.
15. Fix the gel (still supported by the other glass plate) in 5% acetic acid, 15% EtOH for
30 min.
16. Lift the gel (supported by the glass plate) from the fixing solution, drain off residual
liquid and blot it onto a sheet of Whatman 3MM paper. Put it onto a gel dryer and
cover it with a piece of Saran wrap, making sure no bubbles form between the gel
and the Saran wrap. Dry it under vacuum for 1 h at 80C. Collect the radioactive
fixing solution in a proper container.
17. Expose the gel to Kodak diagnostic x-ray film at -70C for 2-3 d.


85
Bootstrap
. Thelohania sp. *
Thelohania solenopsae *
Nosema bombycis
. Nosema trichoplusiae
Vairimorpha necatrix
Nosema vespula
Nosema apis
Encephalitozoon hellem
. Septata intestinalis
Encephalitozoon cuniculi
Pleistophora sp.
.Endoreticulates schubergi
Nosema comeum
Enterocytozoon bieneusi
Agmasoma penaei *
Glugea atherinae
Ichthyosporidium sp.
.Ameson michaelis
. Vairimorpha sp. *
Giardia lambliae
Figure 4.6. Bootstrap analysis (100 replicates) of the phylogenetic tree presented
in Figure 4.5. Numbers on the tree indicate the percentage of bootstrap replicates which
contained that topology. Bootstrap analysis was performed with PAUP. Species, whose
sequences were obtained by the author, are marked with


82
with V. necatrix and the two Thelohania species did not group with A. penaei. In fact,
Vairimorpha sp. and the two Thelohania species did not group closely with any of the
other microsporidia. These findings were supported by the bootstrap analysis of the most
parsimonious tree (Figure 4.6). A phylogenetic analysis of the other microsporidia to each
other has been published (Baker et al. 1995).
Discussion
Molecular differences between species can be of great utility in diagnosing closely
related forms, even where morphological or other traditional markers have failed or are
ambiguous (Avise 1994). The results of the 16S rRNA gene sequence analyses indicated
that Thelohania sp. and Vairimorpha sp. were two distinct species in two different genera.
Furthermore, Thelohania sp. and T. solenopsae were the same species or two subspecies
of the same species. Vairimorpha sp. did not belong into the genus Vairimorpha and the
placement of the two Thelohania species and A. penaei into different genera is probably
justified.
To draw meaningful conclusions based on comparative sequence analyses,
guidelines to delineate different generea and species are needed. What percentage
sequence similarity determines whether two species belong to the same genus or are the
same species? Hartskeerl et al. (1993) proposed 16S rRNA gene sequence similarity
levels of 70% and 90% respectively, to delineate species in different genera or the same
genus. He also compared two isolates of E. bineusi-like microsporidia, believed to be
different species based on site of collection (small intestine vs. maxillary sinus mucosa in
humans), and found a 99% sequence similarity of the 16S rRNA genes. From these
results he concluded that the two isolates are the same species. In the present study, 16S
rDNA PCR product sizes, RFLPs, and sequence comparison of Thelohania sp. and
Vairimorpha sp., the two microsporidia which may coinfect the same host, indicated that


94
size presently required for FAME analysis (lxlO9 spores) could be reduced by scaling
down the extraction and derivatization procedure. Also, FAME profiles of a wide variety
of microsporidian genera and species should be determined to look for signature fatty
acids that would be present only in one genus (or species).


Ill
Partial 16S rRNA sequence of A. penaei
1
ACTTTTAACT
aaccttttgt
ACTAATAATT
AAGGGAAACT
GTAATTAAAA
51
ATCATGAGGA
TGTGAGGTAG
ACCTATTAGC
TAGTTGGTTG
TGTAAAGGAC
101
TACCAAGGCT
ATAATGGGTA
ACGGAGATTT
AGTGATCGAA
ACCGGAGATG
151
GAAGCTGAGA
AACGGTTCCA
ATGTCCAAGG
ATAGCAGCAG
GCGCGAAAAT
201
TGCACACTCT
TTAATGGGGA
TGCAGTTATG
AGGTATGACA
GAAAGGGTTA
251
TCAATAAATA
AGATGACGTA
AAGCTATTAG
AGGGAAAGTT
TGGTGCCAGC
301
AGCCGCGGTA
ATACCAACTC
TAAGAGTCTC
TATGCGAGTT
GCTGCAGTTA
351
AAAAGTCCGT
AGTCTTTACG
TAATTAAAAA
TGAATGATCA
AGTTTCATAT
401
TTTTACGTTT
ATATATGAGA
CGGATTGGGA
GCATAGTATA
ACTGGGTTAA
451
GAATGAAATC
TCACTACCCT
AGTTGGACTA
TCAGAAGCGA
AAGCGATGCT
501
CTAATACGTA
CTTTTAGATA
AAGGACGAAG
GCTAGAGTAG
CGAAAGGGAT
551
TAGATACCCC
TGTAGTTCTA
GCAGTAAACT
ATGCCGACAG
AATGTTAGAT
601
ATATTTCTAG
TGTTCAAGGG
AAACCTTAAG
TGATCGGGCT
CTGGGGAGAG
651
TATGCTCGCA
AGTGTGAAAA
TTAAACGAAA
TTGACGGAGT
TACACCACAA
701
GGAGTGGATT
GTGCGGCTTA
ATTTGACTCA
ACGCGAGGAA
TTTTACCAGG
751
GCTGAATATA
TTTGAGATTG
AATACATGAA
ATATATTTGA
GTGGTGCATG
801
GTCGTTGTAA
ACTCATGGAT
TGATCTTAAG
TTCAACTGCT
AAAATGGGTG
851
AGACTTTCAT
AAACAGCTAT
CTAACAGGTA
GAGGAAGGGG
AAGGCGATAA
901
CAGATCCGTG
ATGCCCTCAG
ATGTCCTGGG
CTGCACGCGC
AATACATTAT
951
GTATATTTCT
TATAAATAGA
TACTACATAT
TGGGGAATTG
ACTTTTGTAA
1001
ATAAGTCATG
AACTTGGAAT
TCCTAGTAAT
AATGATTCAT
CAAGTCATTG
1051
TGAATGTGTC
CCTGTAGCTT
GTACACACCG
CCCGTCACTG
TCTCAGATGG
1101
TTGATGAGAT
G


Iucundi Acti Labores


9
plasmodia. Furthermore, the species of this family are common parasites of a variety of
aquatic and semiaquatic animals. Thelohania solenopsae does not quite fit into the
Burenellidae either, because it does secrete granules during octosporous sporulation.
Based on light microscopic observations, Thelohania sp. and Vairimorpha sp. from
Argentine £ .richteri appear to be identical to T. solenopsae and V. invictae from Brazilian
S. invicta. The objective of this study was to compare light- and ultrastructural features of
Argentine Thelohania sp. and Vairimorpha sp. and Brazilian T. solenopsae and V. invictae.
Infected £. invicta and S. richteri were collected by R.S. Patterson and J. Briano in
Brazil and Argentina. Identity of the ants from which the microsporidia were isolated for
all experiments was confirmed by determination of cuticular hydrocarbon components
with gas chromatography (GC). Both £. invicta and S. richteri have signature cuticular
hydrocarbon profiles which clearly define the two species (Vander Meer and Lofgren
1988; Nelson et al. 1980).
Materials And Methods
Collection and Processing of Ants
Thelohania sp. and Vairimorpha sp. were obtained from £. richteri adults collected
by R. S. Patterson and J. Briano in the area of Saladillo, Buenos Aires province, 180 km
SW of Buenos Aires in Argentina. R. S. Patterson and J. Briano also collected £. invicta
infected with T. solenopsae and V. invictae in the area of Cuiaba, Brazil. The ants were
transported back to Gainesville, Florida, in artificial ant nests modified from Williams
(1989). To make a nest, powdered dental labstone (roughly 250 g) and tapwater were
thoroughly mixed to get a thick liquid paste. The labstone paste was then poured into the
bottom of a large petri dish (150 x 25 mm) and allowed to harden. Prior to use it was
saturated with water to maintain a high relative humidity inside the petri plate. A small


91
frequently used in eukaryotes, may also be present in microsporidia and could be used for
additional sequence analyses.
The phylogenetic tree (Figure 4.5) in this study is similar to the tree published by
Baker et al. (1995) except that in our analysis, V. oncoperae and a different
Vairimorpha sp., used by Baker, were not included. In addition to the species whose
sequences were obtained by the author, we also included G.atherinae in the analysis.
Baker et al. (1995) found four groups: The Ichthyosporidium group (comprised of
A. michaelis. Vavraia oncoperae and Ichthyosporidium sp.), the Encephalitozoon group
(comprised of E. hellem. E. cuniculi and S. intestinalis). the Vairimorpha/Nosema group
(comprised of N. apis, N. vespula (also called Nosema sp.), N. trichoplusiae. N. bombvcis.
V. necatrix and Vairimorpha sp.) and the Endoreticulates group (E. schubergi.
E. bieneusi. N. comeum and Pleistophora sp.). The Vairimorpha sp. in Bakers study is
not the same Vairimorpha sp. used in this study. It was isolated and identified from the
gypsy moth Lvmantria dispar by J. Maddox while the one in the present study was found
in the black imported fire ant £. richteri.
We obtained the same groups in our phylogenetic tree. Glugea atherinae was
placed in the Ichthyosporidium group (bootstrap value of 97%). Agmasoma penaei was
placed in the Endoreticulates group (bootstrap value of 78%). In addition, we found two
new taxon groups, one comprised of the two Thelohania species (bootstrap value of
100%) and one comprised of Vairimorpha sp. More species need to be analysed however,
to support the validity of these two groups. The tree branching pattern (Figure 4.5) and
the mean distance between Vairimorpha sp. and V. necatrix of 0.366 showed that
Vairimorpha sp. is unrelated to the true Vairimorpha.
The study of Baker et al. (1995) also supports the need to rearrange the current
microsporidian classification. They determined, based on mean distance and branching
pattern of the phylogenetic tree, that N. corneum is not a true Nosema species (Figure
4.5) but more closely related to E. schubergi.. They reported that the 16S rRNA gene


79
Thelohanla ap.
T. solenopsae
N. bombycis
N. trlchoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cunlculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusl
A. penael
G. atherinae
Ichthyosporidium sp.
Valrlmorpha sp.
A. michaelis
1261 1320
AAG
AAG
ATATATTTGAACATGGAATTGCTAGTAAATTTT-ATTTAATAAGTAGAATTGAATGAGTC
atatatttgaacatggaattgctagtaaatttt-atttaataagtagaattgaatgagtc
AGATA TTTGAACTTGGAATTGCTAGTAAATTTT-ATTAAATAAGTAGAATTGAATGTGTC
AGATATTTGAACTTGGAATTGCTAGTAAATTTT-ATTAAATAAGTAGAATTGAATGTGTC
AGATATTTGAACTTGGAATTGCTAGTAAATTTT-ATTAAATAAGTAGAATTGAATGTGTC
GGGCTTCTGAACGTGGAATTCCTAGTAAGAATG-ATTGAACAAGTTATTTTGAATGTGTC
GGGCTTCTGAACGTGGAATTCCTAGTAATAACG-ATTGAACAAGTTGTTTTGAATGGGTC
GGGCTTCTGAACGTGGAATTCCTAGTAATAGCG-GCTGACGAAGCTGCTTTGAATGTGTC
GGGCACACGAAAGAGGAATTCCTAGTAAGCGCC-CATCACCAGTGGGCGTTGAATCAGTC
GGGCACACGAAAGAGGAATTCCTAGTAAGCGCC-CATCACCAGTGGGCGTTGAATCAGTC
GCACATACGAAAGAGGAATTCCTAGTAAGTGTG-TATCAACAATGGATATTGAATAAGTC
TACGTAGTGAATAAGGAATTCCTAGTAACGGTG-CCTCATCAAGGCATGGTGAATGTGTC
TAAGTCATGAACTTGGAATTCCTAGTAATAATG-ATTCATCAAGTCATTGTGAATGTGTC
AGGCTCAGGAACGAGGAATTGCTAGTAATCGCGGACTCATTAAGACGCGATGAATACGTC
AGGCTCAGGAACGTGGAATTGCTAGTAATCGCGGACTCATTAAGACGCGATGAATACGTC
TGCGTCATGAACGTGGAATTCCTAGTAGT-GGGCAGTCATTAACTGCACGCGAATGAGTC
CG-CTCATGAACACGGAATAGCTAGTAA-CGTGAGTTCAATATACGGCGATGAATATGTC
Thelohanla sp.
T. solenopsae
N. bombycls
N. trlchoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium sp.
Valrlmorpha sp.
A. michaelis
1321
1380
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGGTATTATCTATGA ACAA
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGGTATTATCTATGA ACAA
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATGTGTTGTGA AATT
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATATGTTGTGA AATT
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATGTGTTGTGA AATT
CCTGTCCTTTGTACACACCGCCCGTCGCTATCTAAGATGAC GCAGTGG ACGA
CCTGTCCTTTGTACACACCGCCCGTCGCTATCTAAGATGAC GCAGTGG ACGA
CCTGTCCTTTGTACACACCGCCCGTCGCTATCTAAGATGAC GCACTGGA ACGA
CCTGTAGCTTGTACACACCGTCCGTCACTATCTCAGATG-T TTTTCGGG ATGA
CCTGTAGCTTGTACACACCGTCCGTCACTATCTCAGATG-T TTTTCGGG ATGA
CCTGTAGCTTGTACACACCGCCCGTCACTATCTCAGATG-T TTTTCAGG ATGA
CCTGTTCTTTGTACACACCGCCCGTCACTATTTCAGATG-G TCATAGGG ATGA
CCTGTAGCTTGTACACACCGCCCGTCACTGTCTCAGATG-G TTGATGAG ATG-
CCTGTTCTTTGTACACACCGCCCGTCGTTATCGAAGATGGAGTCAGGCGCGAACAAG-
CCTGTTCTTTGTACACACCGCCCGTCGTTATCGAATACGGTGCTCGGCGCGAGCAAGG
CCTGTTCTTTGTACACACCGCCCGTCGTTATCTAAGATGGA AGTGCGGATGAGGT
CCTGTTCTTTGTACACACCGCCCGTCGTTATCGAAGATGGAGTGATTTTTGAG-TCAATT
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium sp.
Valrlmorpha sp.
A. michaelis
1381
1440
ATTTATA AAGTGAATAGATAGTACTAGATCTGATATAAGTCGTAACATGGTTGCTGT
ATTTATA AAGTGAATAGATAGTACTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGTGAAAACTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGTGAAAACTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGTGCAAGCTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGATTGAGAGGTCTGAGTCTTTCGTGTTAGATAAGATATAAGTCGTAACATGGCTGCTGT
AGATTGGAAGGTCTGAGTCCTTCGTGTTAGATAAGATATAAGTCGTAACATGGCTGCTGT
AGATCGGAAGGTCTGAGTCCTGAGTGTTAGATAAGATATAAGTCGTAACAAGGTAA
AGAGTCTAGGCTCTGAATAACGGAAAGTAGATAAGATGTAAGTCGTAACATGGTTGCTGT
AGAGTCCAGGCTCTGAATAACGGAAAGTAGATAAGATGTAAGTCGTAGCAAGGTTGCGGT
AGAGTCCAGGCTCTGAATAATGAAAAGTAGATAAGATGTAAGTCGTAACATGGTTGCTGT
AGAGCTTCGGCTCTGAATATCTATGGCTAGATAAAGTACAAGTCGTAACAAGGTTTCAGT
CGAGAGCGAGTGAGTGCAGGATTCTAGATGTGATACAAGTCGTAACATGGTTGCTGT
TGAAATCACTGAGCGAGCGCAAGGTACCGGATCTGATACAAGTCGTAACAAGGTAGCTGT
CGGTACGGCCGGACGAATCTGTGCTTGTAGATTGGATACAA
ATAATTGGCTACTTGAATGAGTTATTCTAAAACCGGTACAAGTCGTAACAAGGCTACGGT


REFERENCES
Abel, K., deSchmertzing H and Peterson, J. I. 1963. Classification of microorganisms
by analysis of chemical composition. I. Feasibility of utilizing gas chromatography.
J. Bacteriol. 85, 1039-1044.
Adams. C.T. 1986. Agricultural and medical impact of the imported fire ants. In Fire
ants and leaf-cutting ants. Biology and management, (Lofgren, C.S, and Vander
Meer, R.K. eds.), pp. 36-47. Westview Press, Boulder.
Allen, G.E., and Burn, W.F. 1974. Microsporidan and fungal diseases of Solenopsis
invicta Burn in Brazil. J. N.Y. Entomol. Soc. 82, 125-130.
Amigo, J.M., Garcia, M.P., Comas, J., Salvado, H. and Vivares, C.P. 1994.
Comparative study of microsporidian spores by flow cytometric analysis. J. Euk.
Microbiol. 41, 210-214.
Andreadis, T.G. 1985. Experimental transmission of a microsporidian pathogen from
mosquito to an alternate copepod host. Proc. Nat. Acad. Sci. USA 82, 5574-5577.
Andreadis, T.G. 1994. Ultrastructural characterization of meiospores of six new species
of Amblvospora (Microsporida: Amblyosporidae) from northern Aedes (Diptera:
Culicidae) mosquitoes. J. Euk. Microbiol. 41, 147-154.
Anthony, D.W., Lotzkar, M.D., and Avery, S.W. 1978. Fecundity and longevity of
Anopheles albimanus exposed at each larval instar to spores of Nosema algerae.
Mosquito News 38. 116-121.
Amheim, N. 1983. Concerted evolution of multigene families. In Evolution of genes
and proteins (Nei, M., and Koehn, R.K. eds.), pp. 38-61. Sinauer Associates Inc.
Publishers, Sunderland, Massachusetts.
Asselineau, J. 1962. The bacterial lipids. Holden-Day, Inc. Publishers, San Francisco.
Aston, J.W. 1977. Computer processing of fatty acid analysis data. J. Chromat. 131,
121-130.
Avise, J.C. 1994. Molecular markers, natural history and evolution. Chapman and
Hall, New York.
Baker, M.D., Vossbrinck, C.R., Didier, E.S., Maddox, J.V., and Shadduck, J. 1995.
Small subunit ribosomal DNA phylogeny of various microsporidia with emphasis on
AIDS related forms. J. Euk. Microbiol. 42, 564-570.
112


123
Stimac, J.L., Alves, S.B., and Camargo, M.T.V. 1987. Suscetibilidade de Solenopsis spp.
a differentes espcies de fungos entomopatognicos. An. Soc. Entomol. Brasil 16,
377-387.
Stimac, J.L., and Alves, S.B. 1994. Ecology and biological control of fine ants. InPest
management in the subtropics. Biological control a Florida perspective, (Rosen,
D., Bennett, F.D., and Capinera, J.L. eds), pp. 353-380. Intercept Limited,
Andover.
Streett, D.A. 1976. Analysis of microsporidian spore proteins by electrophoresis on SDS
polyacrylamide gels: Taxonomic considerations. Proc. Int. Colloq. Invertebr.
Pathol. 1, 361-362.
Sweeney, A.W., Graham, M.F. and Hazard, E.I. 1985. Intermediate host for an
Amblvospora sp. (Microspora) infecting the mosquito Culex annulirostris. I. Invert.
Path. 46, 98-102.
Swofford, D.L. 1993. PAUP: Phylogenetic analysis using parsimony, version 3.1.1.
Illinois Natural History Survey, Champaign, IL.
Suutari, M. and Laakso, S. 1992. Unsaturated and branched-chain fatty acids in
temperature adaptation of Bacillus subtilis and Bacillus megaterium. Biochim.
Biophys. Acta 1126,119-124.
Thorvilson, H.G., and Phillips Jr., S.A. 1987. The straw itch mite. Pvemotes tritici
(Acari: Pyemotidae), as a biological control agent of red imported fire ants,
Solenopsis invicta (Hymenoptera: Formicidae). Fla. Entomol. 70. 439-444.
Trager, J.C. 1991. A revision of the fire ants. Solenopsis geminata group (Hymenoptera:
Formicidae: Myrmicinae). J. N.Y. Entomol Soc. 99, 141-198.
Undeen, A.H. 1975. Growth of Nosema algerae in pig kidney cell cultures. J. Protozool.
22,107-110.
Undeen, A.H., Alger, N.E. 1971. A density gradient method for fractionating
microsporidian spores. X Invert. Path. 18, 419-420.
Vander Meer, R.K., and Lofgren, C.S. 1988. Use of chemical characters in defining
populations of fire ants, Solenopsis saevissima complex, (Hymenoptera:
Formicidae). Fla. Entomol. 71, 323-332.
Van der Westhuizen, J. P. J., Kock, J. F. L., and Botes, P. J. 1994. The distribution of
the 053- and 056-series of cellular long-chain fatty acids in fungi. Svst. Appl.
Microbiol. 17, 327-345.


31
James and Martin (1952) first reported on the application of gas-liquid partition
chromatography to the separation and micro-estimation of volatile fatty acids. This
method was successfully used by Abel et al. (1963) to analyze fatty acids of eleven
bacteria. They demonstrated qualitative and quantitative fatty acid profile differences
among selected families in the class Schizomycetes, and quantitative differences among
five selected genera of the family Enterobacteriaceae. Furthermore, they found that media
components and growth stage influence bacterial fatty acid composition. Their studies
established the potential usefulness of cellular fatty acid analysis in bacterial taxonomy,
and laid the foundation for further investigations. For example, Yamakawa and Ueta
(1964) used gas chromatography to determine fatty acid and monosaccharide
compositions of whole bacterial cells of seven species of Neisseria. Other early studies
were concerned with various aspects of culture conditions that influenced fatty acid
composition of Escherichia coli. such as temperature and growth media (Marr and
Ingraham 1962; Knivett and Cullen 1965). A wealth of literature exists on the influence of
nonstandardized growth conditions on the fatty acid composition of organisms. Recent
research has been undertaken to determine the effect of culture age on FAME profiles of
lactic acid bacteria (Decallone et al. 1991). Effects of growth temperature on FAME
profiles of Bacillus subtilis and B. megaterium (Suutari and Laakso 1992) and culture
media on FAME profiles of B. anthracis and B. cereus (Lawrence et al. 1991) have been
reported. In addition to bacteria, studies on FAME profiles of yeasts including several
Candida species, Torulopsis glabrata. and Crvptococcus neoformans (Marumo and Aoki
1990) and Mortierella alpina (Shimizu et al. 1991) are available.
The source of fatty acids in microbial cells is lipid. Lipids are substances of
biological origin that are soluble in organic solvents such as chloroform and ether but only
sparingly soluble in water (Voet and Voet 1990). Fats, oils, fat-soluble vitamins such as
A, D, E, and K, and some hormones are lipids. Fatty acids are carboxylic acids having
hydrocarbon backbones ranging from 1-30 carbons in length. They are rarely found as


rDNA
ribosomal RNA gene
RNA
Ribonucleic acid
rRNA
ribosomal RNA
tRNA
transfer RNA
SDS
Sodium dodecyl sulfate
S.O.C.
Superoptimal catabolite (bacterial medium)
SSC
Standard saline citrate
STE
Sodium chloride, Tris, EDTA buffer
TAE
Tris-acetate, EDTA buffer
TB
Terrific broth
TBE
Tris-borate, EDTA buffer
TE
Tris, EDTA buffer
TEM
Transmission electron microscopy
TEMED
N, N, N\ N tetramethylethylenediamine
Tris
Tris(hydroxymethyl)aminome thane
USDA-ARS
United States Department of Agriculture-Animal Research Service
X-Gal
5-Bromo-4-chloro-3-indolyl-p-D-galactoside
xii


39
qualitatively and quantitatively distinct for the three species. Myristic acid (14:0) and 20:1
03 9 cis were present at low levels in all of the N. algerae and Thelohania sp. samples.
However, these acids were not detected in V. necatrix (Table 3.1). Quantitative
differences include significantly lower levels of palmitic acid (16:0) in Thelohania sp. than
the other two species (p of myristic acid (14:0) and 20:1 03 9 cis in Thelohania sp. than N. algerae (p d.f. = 3,22; a= 0.05 ). Oleic acid (18:1 03 9 cis) was present at significantly higher
amounts in V. necatrix than in N. algerae (p Three fatty acids not present in the MIDI Microbial Identification System (MIS) peak
library index were found in several Thelohania sp. samples (Table 3.1). Similar instances
of unnamed fatty acids have also been reported in recent studies on vesicular-arbuscular
mycorrhizae (N.C. Hodge, personal communication). The three unnamed acids comprised
16.3 9.8% of the total FAME profiles in Thelohania sp. samples. The acids eluted from
the MIDI system's capillary column at 9.5, 11.9, and 12.5 minutes and had calculated
chain lengths of 15.6, 17.0, and 17.4 carbons, respectively. Structural determination of
the unnamed acids would be best confirmed using ancillary GC-mass spectrometry and
nuclear magnetic resonance techniques.
Host influence on FAME profiles of the spores was tested by producing N. algerae
in two different insects: the corn earworm, H. zea and mosquito, A. quadrimaculatus.
Three closely-eluting 18:1 cis-trans isomers, combined as Summed Feature 7 (18:1 G3 7
cis/18:l 03 9 trans/18:l 03 12 trans), and arachidonic acid (20:4 03 6,9,12,15 cis), were
detected in N. algerae isolated from mosquito at 6.3% and 4.1%, respectively (Table 3.1).
Neither acid, however, was present in N. algerae from com earworm. Furthermore, the
percentages of three other acids varied according to host.


7
(Jouvenaz and Wojcik 1990). Pathogens include a virus, neogregarines, microsporidia, a
bacterium (Jouvenaz 1983) and the entomopathogenic fungi Beauveria, Metarhizium and
Paecilomvces (Stimac et al. 1987). Recently, a high incidence of infection of £ richteri
with Thelohania solenopsae-like and Vairimorpha invictae-like microsporidia, hereforth
called Thelohania sp. and Vairimoipha sp., was reported from Argentina (Briano 1993).
He found that in areas where the microsporidia are present the density of fire ant mounds
is significantly lower than in uninfected areas. These microsporidia are currently being
evaluated as potential biological control agents for imported fire ants in the United States.
Thelohania solenopsae. the first specific pathogen known from fire ants, was first
reported by Allen and Burn (1974) from £. invicta in Brazil. They detected spore cysts
formed from enlarged fat body cells in the gasters of alcohol-preserved workers. Giemsa-
stained smears of fat body tissue of live workers show octonucleate sporonts that produce
eight spores enclosed in a sporophorous vesicle. Based on this characteristic they
identified it as a species of the genus Thelohania Henneguy but they did not give it a
species name. The genus Thelohania was defined by Henneguy and Thlohan (1892) as
having spores of only one developmental sequence, which produces octospores enclosed
in a sporophorous vesicle or interfacial envelope. Knell and Allen (1977) described
Thelohania sp. from live S. invicta workers and brood in Brazil as a new species,
T. solenopsae. Meronts (vegetative stages) are found in fat body of larvae, pupae and
queen ovaries (Knell and Allen 1977). Sporonts occur in late pupae, workers, males and
queens. Spores occur only in adults. Knell and Allen (1977) discovered that
T. solenopsae is dimorphic producing both bacilliform binucleate free spores and pyriform
uninucleate octospores in the same individuals. This makes it the only dimorphic member
of the genus Thelohania. However, the type species, T. giardia. which has not been
carefully studied (Hazard and Oldacre 1975), may also be dimorphic.
Allen and Silveira-Guido (1974) also found Thelohania sp. in workers of £. richteri
in Montevideo, Uruguay and Las Flores, Argentina and from a Solenopsis sp. in


98
Fattv acid methyl ester (FAME-) extraction of microsporidia
1. Pipette 1x10^ spores into a 13x100 mm culture tube and store overnight at 4C to
allow the spores to settle.
2. The next day, carefully withdraw the supernatant. Add 1 mL of 15% NaOH in 50%
methanol, seal tube, and saponify fatty acids at 100C for 30 min.
3. Upon cooling, add 2 mL of 6 N HC1 in 50% MeOH, recap tube, heat at 80C for 10
min to methylate the fatty acids.
4. Solvent-extract fatty acid methyl esters (FAME) from the aqueous phase with 1.25
mL of hexane:methyl-tert-butyl ether (1:1; v/v).
5. Wash organic phase with 3 mL of 1.2% aqueous NaOH and transfer to a gas
chromatograph (GC) vial.
Fatty acid methyl ester (FAME-) analysis with gas chromatography (GC)
1. Analyze FAME with a Hewlett Packard 5890 gas-liquid chromatograph fitted with
an Ultra 2 fused silica capillary column (25 m x 0.2 mm i.d. x 0.33 pm film thickness)
coated with 5% phenyl methyl silicone.
2. Inject 1 pL of FAME sample. Raise temperature from 170C to 270C in 5C/min
increments using hydrogen as the carrier gas. After flame-ionization, measure
FAME peaks by a Hewlett Packard 3392 integrator and express as percentages of
the total FAME profiles.
Analysis of FAME mixtures by coupled gas chromatography mass spectrometry (GC-
MS)
1. Analyze aliquots of the FAME mixtures on a Perkin Elmer 8420 GC interfaced with
a Finnigan Ion Trap Detector (ITD, Model 6210), with INCOS data collection
software and a 80286 computer. The GC-MS was fitted with a 25 m x 0.25 mm i.d.
DB-1 fused silica capillary column.
2. Inject 1 pL samples in a splitless mode followed with a purge flow of helium after 30
sec. The carrier gas was helium with a flow rate of 25 cm/sec. The initial
temperature of the column was 60C, and following injection the temperature was
programmed to 150C at 30C/min, then programmed to 220C at 5C/min, and held
for a total running time of 100 min.
Transmission electron microscopy
Fixation:
1. Dissect specimen in 2.5% glutaraldhyde.
After 5 minutes or so, specimen can be cut into smaller pieces.
2. Transfer pieces to fresh glutaraldhyde and fix for total of 2.5 hours.


64
cooled to 4C until the sequencing reactions were stopped by addition of 3 flL of fmolR
sequencing stop solution (10 mM NaOH, 95% formamide, 0.05% bromphenol blue,
0.05% xylene cyanole) to each tube.
Immediately before loading the reactions on a sequencing gel, they were heated at
70C for 2 min. The products (3.5 (J.L per lane) were run on a 8%, 19:1 acrylamide:
bisacrylamide gel at 1800 V. After fixing (30 min in a solution of 5% acetic acid and 15%
EtOH) and drying in a gel dryer on Whatman 3MM paper (1 h at 80C), the gel was
exposed to Kodak diagnostic x-ray film at -70C (United States Biochemical Sequencing
Support Service; DNA Sequencing Guide).
Automated sequencing was done by the DNA Sequencing Core Laboratory of the
University of Floridas Interdisciplinary Center for Biotechnology Research. Sequencing
was accomplished by employing the Taq DyeDeoxy Terminator (part number 401388)
Cycle Sequencing protocol developed by Applied Biosystems (a division of Perkin-Elmer
Corp., Foster City, CA) using fluorescent-labeled dideoxynucleotides. The labeled
extension products were analyzed on an Applied Biosystems Model 373A DNA
Sequencer.
Sequence Data Analysis
Analysis of the 16S rRNA gene sequences was done using the Genetics Computer
Group (GCG) Sequence Analysis Software Package (Devereux et al. 1987) and
Phylogenetic Analysis Using Parsimony (PAUP) version 3.1.1 (Swofford 1993). To
confirm the RFLP digests, enzyme restriction maps with the enzymes tested in the RFLP
digests were created for each of the three fire ant microsporidia with MAP.
Ribosomal gene sequences of microsporidia from a variety of host organisms
including insects (Hymenoptera, Lepidoptera), fish and humans and the protozooan
Giardia lamblia, used as outgroup, were obtained from GenBank (G. lamblia. Sogin et al.


28
arrangement of the coils of the polar filament but T. solenopsae meiospores had a uniform
arrangement of coils of the polar filament. Thelohania sp. had between 10-12 coils
whereas T. solenopsae had between 9-11 coils. Free spore ultrastructure, except for
number of coils of the polar filament, of Thelohania sp. was similar to that of
T. solenopsae published by Knell and Allen (1977). The single Thelohania sp. free spore
observed in this study had 15 coils whereas Knell and Allen (1977) report 9-11 coils.
Coils of the polar filament are arranged irregularly in both Vairimorpha sp. and V. invictae
(Jouvenaz and Ellis 1986) but the number of turns was between 11-13 in Vairimorpha sp.
and ~ 9 in V. invictae. Free spores of Vairimorpha sp. and V. invictae are similar in
structure and number of turns of the polar filament (24-26 coils in V. invictae and ~ 26
coils in Vairimorpha sp.).
Furthermore, no data are available on host specificities of T. solenopsae.
V. invictae. Thelohania sp. and Vairimorpha sp. Andreadis (1994) and Garcia and Becnel
(1994), in utilizing features of the polar filament as a distinguishing character to describe
new species, placed great weight on the fact that the microsporidian species are all from
different mosquito hosts (which do not interbreed). In other words, microsporidian
species, that are ultrastructurally nearly identical except for characteristics of the polar
filament, probably could not be differentiated easily from each other if they would coinfect
the same host. It is not known whether Thelohania sp. and Vairimorpha sp. from
S. richteri can infect S. invicta (the host of T. solenopsae and V. invictae) and vice versa.
To complicate the matter further, it is not even clear whether S. richteri and S. invicta are
two distinct species (Vander Meer and Lofgren 1988). Thus, the observations on
differences in polar filament features did not provide a good taxonomic character to
separate the fire ant microsporidia from each other because of (1) inadequate sample sizes
and (2) lack of knowledge of host specificities.
Another problem that complicates comparing microsporidia at the ultrastructural
level, involves sample preparation for TEM. It is a technical challenge to get good spore


44
C16:0
100
o'

m
a
a
m
V
o
g
2
C16:0
C16:l
C14:0
A. quadrimaculatus
C18:1
C 18:2
infill i
rrH-
C18:0
11A11
1000
2000
3000
4000
rft!
5000
6000
Retention Time (sec)
Figure 3.3. FAME chromatograms of N. algerae in two different insect hosts.
Fatty acids were saponified, methylated, solvent-extracted, base-washed and analyzed by a
computer-linked Hewlett-Packard 5890 gas-liquid chromatograph and a computer-linked
Perkin Elmer 8420 GC interfaced with a Finnigan Ion Trap Detector with INCOS data
collection software.


120
Mylvaganam, S., and Dennis, P.P. 1992. Sequence heterogeneity between the two genes
encoding 16S rRNA from the halophilic archaebacterium Haloarcula marismortui.
Genetics 130, 399-410.
Nation, J.L., Sanford, M.T. and Milne, K. 1992. Cuticular hydrocarbons from Varroa
jacobsoni. Exp. Appl. Acarol. 16, 331-344.
Nelson, D.R., Fatland, C.L., Howard, R.W., McDaniel, C.A., and Blomquist, G.J. 1980.
Re-analysis of the cuticular methylalkanes of Solenopsis invicta and S. richteri.
Insect Biochem. 10,409-418.
Nickle, W.R., and Jouvenaz, D.P. 1987. Tetradonema solenopsis n. sp. (Nematoda:
Tetradonematidae) parasitic on the red imported fire ant Solenopsis invicta Burn
from Brazil. J. Nematol. 19,311-313.
Nicoletti, V.G., and Condorelli, D.F. 1993. Optimized PEG method for rapid plasmid
DNA purification: High yield from midi-prep. BioTechniques 14. 535-536.
Niederkom, J.Y., Shadduck, J.A. and Weidner, E. 1980. Antigenic cross-reactivity
among different microsporidian spores as determined by immunofluorescence.
J. Parasitol. 66, 675-677.
Nordin, G.L., and Maddox, J.V. 1974. Microsporidia of the fall webworm, Hvphantria
cunea. I. Identification, distribution, and comparison of Nosema sp. with similar
Nosema spp. from other Lepidoptera. J. Invert. Pathol. 24, 1-13.
Oien, C.T. and Ragsdale, D.W. 1992. A species-specific enzyme-linked
immunoabsorbent assay for Nosema fumacalis (Microspora: Nosematidae).
J. Invert. Path. 60, 84-88.
OLeary, W.M. 1975. The chemistry of microbial lipids. Critic. Rev. Microbiol. 4,
41-63.
Olsen, G.J., Lane, D.J., Giovannoni, S J., and Pace, N.R. 1986. Microbial ecology and
evolution: A ribosomal RNA approach. Ann. Rev. Microbiol. 40, 337-65.
Olsen, G.J., and Woese, C.R. 1993. Ribosomal RNA: A key to phylogeny. FASEB 7,
113-123.
Overstreet, R.M. 1973. Parasites of some penaeid shrimps with emphasis on reared
hosts. Aquaculture 2.105-140.
Patterson, R.S. 1993. Biological control of introduced ant species. In Exotic ants:
Biology, impact, and control of introduced species, (Williams, D.F. ed.), pp. 293-
307. Boulder, Westview Press.


32
free acids in the cell but, rather, occur as esters of glycerol. Some free fatty acids are
toxic to living cells (Wood 1988). The fatty acids present in microbial lipids are generally
of four types: straight-chain or saturated, mono- or polyunsaturated, branched-chain
(predominantly iso and anteiso), and substituted fatty acids. The latter group includes
cyclopropane, hydroxy, and alcohol moieties (Schweizer 1988).
Palmitic acid (16:0) is highly conserved in prokaryotes (Welch 1991). Branched-
chain and cyclopropane fatty acids characterize many gram-positive and gram-negative
bacteria, but are not found in eukaryotic microorganisms. Polyunsaturated fatty acids,
found in higher organisms, are not biosynthesized by aerobic bacteria (Welch 1991).
Hydroxy acids are typical of gram-negative, but not gram-positive bacteria. Mycolic acids
are representative of the Actinomycetes. Strict anaerobes and archaebacteria synthesize
plasmalogens (ether-linked lipids). An excellent summary on the distribution of fatty acids
among major taxonomic groups is given by Kerwin (1994). Additional information on
fatty acids characteristic of different microorganism can be found in Welch (1991) and
Ratledge (1988). Fungal fatty acids are discussed by Van der Westhuizen et al. (1994)
and Losel (1988).
Several technical advances have simplified the use of cellular fatty acid analysis as
a diagnostic tool while increasing accuracy and precision. Generally, gas-liquid
chromatography (G-LC) of FAMEs had been done on glass columns of variable lengths
with internal diameters from 2-4 mm, and packed with polar or nonpolar stationary phase
material (Moss 1981). Packed columns enable larger sample volumes to be assayed, but
do not separate all of the types of substituted acids biosynthesized by bacteria. For
example, hydroxy acids appear as shoulder peaks on the leading or tailing edge of other
peaks on a chromatogram of a packed column, and cis/trans isomers of some acids with
the same carbon chain length may appear as one peak or will not be resolved at the base
line (Moss et al. 1980; Moss 1981). The introduction of flexible fused silica glass capillary
columns with internal diameters of 0.2 mm and wall-coated, rather than packed stationary


87
Thelohania species with A. penaei also indicated that A. penaei and the two Thelohania
species belonged different genera. The sequence of A- penaei is presently the only
sequence available of a microsporidium close to Thelohania. Generally, other studies also
agree with Hartskeerls et al. (1993) suggestion of the 70% and 90% cutoff for different
genera and different species within the same genus. For example, E. cuniculi shares about
72% sequence similarity with V. necatrix (Schuitema et al. 1993). Vossbrinck et al.
(1993) find a 90% sequence similarity between V. necatrix and V. lvmantriae and 77%
sequence similarity between E. cuniculi and E. hellem in regions of the small and large
subunit rDNA and the internal spacer. These data, even though quite different from each
other, fall within the 70-90% range for different species within the same genus.
On the other hand, sequence similarities of S. intestinalis and E. cuniculi or
E. hellem are 77% and 73% respectively (Weiss et a. 1994), which according to Weiss et
al. (1994) supports placement of these species into different genera which would not be in
accordance with Hartskeerls et al. (1993) proposed rule. However, Hartskeerl et al.
(1993) and Baker et al. (1995) suggested to reclassify £. intestinalis as E. intestinalis based
on reanalysis of the 16S rDNA sequences. They find sequence similarities of about 90%
(Hartskeerl et al. 1993) and 94% (Baker et al. 1995) between S. intestinalis and both
species of E. hellem and E. cuniculi (Note: The mean distances for S. intestinalis/
E. hellem and £. intestinalis/E. cuniculi (Table 4.2) are 0.089 and 0.151 (that is
£ intestinalis/E. hellem and £. intestinalis/E. cuniculi have 91% and 85% sequence
similarities). The slight discrepancy of the results reported in this study and the results
published previously is probably because not exactly the same regions of the 16S rDNA
were aligned and analyzed).
Looking at the available data, one must keep in mind that molecular taxonomy is
most convincing when supported concordantly by multiple lines of evidence (Avise 1994).
Placement of microsporidia into different genera or species based on a certain percentage
sequence similarity is subjective and, because of lack of clear-cut sexual stages, should be


71
Sequencing of the 16S rDNA
The PCR primers 18f and 1492r were not suitable as sequencing primers for cycle
sequencing with the fmol sequencing kit because of problems with the sequencing
reactions. Mike Baker (University of Illinois, Urbana, II, personal communication) also
was unable to use the PCR primers for cycle sequencing. He designed slightly modified
sequencing primers which were moved several bases into the sequence of the PCR
products. We did not design new primers because the PCR primers 18f and 1492r could
be used as sequencing primers for automated sequencing by the DNA Sequencing Core
Laboratory of the University of Floridas Interdisciplinary Center for Biotechnology
Research (ICBR). Differences in experimental procedures likely account for this
observation.
The 5 nucleotide of RP9/1061f mismatched with the 16S rDNA sequence of
Thelohania sp. as determined by (1) failed sequencing reactions and (2) subsequent
sequence comparison with the complementary strand of Thelohania sp. It did work to
sequence the T. solenopsae (even though it also mismatched at the same position) but not
the Thelohania sp. 16S rRNA gene in which it was replaced with RP12f.
The cloned PCR product DNA of T. solenopsae was used as sequencing template,
and the sequence of the entire PCR product (1,382 bp) was obtained since sequencing
primers located adjacent to the multiple cloning site were employed. PCR products of
Thelohania sp., Vairimorpha sp., and A. penaei were sequenced directly. The sequenced
fragments represented the majority of the PCR products (except the extreme 5 and 3
ends). The sizes of the sequenced fragments were 1,130 bp (Thelohania sp.), 1,252 bp
(Vairimorpha sp.), and 1,260 bp (A. penaei-). A multiple alignment of the sequences
together with ribosomal gene sequences from other microsporidia is presented in Figure
4.4. Regions conserved throughout all the taxa aligned are identified by


57
crude DNA preparation with two MgCk concentrations (1.5 mM and 2.5 mM) and two
primer concentrations (4 and 8 pM) in 25 pL reaction volumes. Based on the
optimizations, standard conditions for PCR were as follows: Each 50 pL reaction
contained 1 pL of microsporidia genomic DNA ( 10 ng), 4 pM of each primer (forward
and reverse), 0.2 mM of each dNTP (Boehringer Mannheim), DNA polymerase and the
appropriate buffer. Either 1.6 U of Taq DNA polymerase (Boehringer Mannheim) or 0.6
U of Primezyme DNA polymerase (Biometra) were used. The Taq DNA polymerase lx
reaction buffer contained 10 mM Tris-HCl, 50 mM KC1, and 2.5 mM MgCU. The
Primezyme DNA polymerase lx reaction buffer contained 10 mM Tris-HCl,
50 mM KC1, 0.1% Triton X-100, and 2.5 mM MgCl2. The reactions were overlaid with
either 100 pL sterile glycerol or 50 pL Chill-out 14 Liquid Wax (MJ Research). The
reactions were carried out in an MJ Research thermocycler using the temperature profile:
94C for 5 min, then 94C for 1 min, 52C for 1 min, and 72C for 1 min for 35 cycles. A
final extension step of 72C for 15 min was done after 35 cycles. A 5 pL aliquot from
each reaction together with 5 pL of lx loading dye (5% glycerol, 5 mM EDTA, 0.05%
bromphenol blue) was electrophoresed on a 0.8% Seakem LE agarose gel in Tris-acetate
buffer (TAE; 40 mM Tris-acetate, 1 mM EDTA, pH 8.0). Ethidium bromide (EtBr) at a
concentration of 0.25 pg/mL was incorporated into the gel and electrophoresis buffer to
stain and visualize the DNA by UV transillumination. PCR products from three reactions
were pooled and purified with the QIAquick PCR Purification Kit (QIAGEN) by
following the manufacturers instructions, eluted in sterile, distilled water or TE pH 8.0
(10 mM Tris, 4 mM EDTA) and stored at -20C. For cloning and restriction digests,
elution in TE buffer, pH 8.0, was suitable. The DNA concentration of the purified PCR
product was determined by electrophoresing an aliquot with a standard of lambda (X)
bacteriophage DNA cut with Hindlll (k/HindUl cut DNA) and comparing the intensity of
the ethidium bromide stained bands to each other.


CHAPTER IV
COMPARATIVE MOLECULAR CHARACTERIZATION OF MICROSPORIDIA
FROM SOUTH AMERICAN FIRE ANTS
Introduction
Literature Review
Molecular structures and sequences generally are better indicators of evolutionary
relationships than classical phenotypes. Thus, the basis for the definition of taxa has
progressively shifted from the organismal to the cellular to the molecular level (Woese et
al. 1990). Zuckerkandl and Pauling (1965) first discussed the role of informational
macromolecules, molecules that carry the genetic information or an extensive translation
thereof (DNA, RNA, proteins), as potentially the most informative taxonomic characters
and not just one type of characters among other, equivalent types. They viewed the
genetic information encoded in these molecules as documents of the evolutionary history
of organisms and proposed to use these molecules in creating a molecular phylogeny.
Microorganisms frequently lack distinctive morphological, developmental, and
nutritional characteristics that could be used in systematic analysis (Lane et al. 1985). It
was thus a group of bacteriologists, under the direction of C. Woese, who produced the
first comprehensive phylogeny of prokaryotes (indeed of life on earth) based on 16S
rRNA partial sequences (Woese et al. 1977; Fox et al. 1980). Their studies revealed that
instead of two major kingdoms -prokaryotes and eukaryotes-, living systems could be
divided into three major evolutionary lineages: archaebacteria, eubacteria, and eukaryotes.
49


92
sequence of N. comeum has only 72% sequence similarity with N. bombvcis. It has a
93% sequence similarity with E. schubergi.
In conclusion, the sequence analyses data in conjuction with other information
such as ultrastructure and tissue specificity of the fire ant microsporidia support the
hypotheses that (1) Thelohania sp. and Vairimorpha sp. are two distinct species in two
different genera and not mere phenotypes of the same species, (2) Thelohania sp. and
T. solenopsae are the same species or two subspecies of the same species,
(3) Vairimorpha sp. does not belong into the genus Vairimorpha and (4) A. penaei and the
two Thelohania species are separate genera. Data on cross-infectivity of Thelohania sp.
and T. solenopsae in their respective hosts are needed however, to draw a biologically
meaningful final conclusion.


CHAPTER HI
FATTY ACID METHYL ESTER ANALYSIS IN MICROSPORIDIA: EVALUATION
OF A NEW TOOL FOR IDENTIFICATION
Introduction
Literature Review
This literature review will highlight several significant developments in the use of
fatty acid analysis as a tool for rapid identification and taxonomy of microorganisms. A
comprehensive review on gas chromatographic analyses of fatty acids in bacteria and other
microorganisms, using capillary columns, was written by Welch (1991). Asselineau
(1962) provided an overview of the early work on bacterial lipids performed by open,
packed glass columns. OLeary (1975) reviewed microbial lipids and their role in
taxonomy, phylogeny, and identification of bacteria. Supplementary references may be
obtained from a number of books on microbial chemotaxonomy and lipids (Goodfellow
and ODonnell 1994; Ratledge and Wilkinson 1988; Goodfellow and Minnikin 1985).
Lipid composition, especially fatty acid composition, has been an important
criterion in determining taxonomic relationships among bacteria (Shaw 1974). Analysis of
fatty acid methyl esters (FAMEs) for identification, first applied to bacteria, is now a
routine practice for anaerobic and aerobic bacteria (Dees et al. 1975; Moss et al. 1974;
Moss 1981; Sasser 1990a). FAME analysis has recently been applied to the taxonomy and
identification of yeasts (Kock 1988; Sasser 1990c) and glomalean endomycorrhizal fungi
(Jabaji-Hare 1988; Bentivenga and Morton 1994; Graham et al. 1995). A recent
publication by Van der Westhuizen et al. (1994) reports on FAME profiles in
Chytridiomycota, Zygomycota, and Deuteromycotina.
30


10
test tube filled with 1 M aqueous sucrose solution and plugged with cotton gauze was
secured inside the petri dish lid. For transport, the ants were confined within the modified
petri dish with the lid taped securely to the bottom. On their arrival to Gainesville, the
ants were either frozen at -70C to purify the spores later or processed immediately.
Some colonies of infected S. richteri were maintained over several months in the
laboratory. For rearing of the ant colonies, big trays (95 x 78 x 28 cm) were coated with
Fluon on the inside walls to prevent ants from escaping. Each tray had one artificial ant
nest, the construction of which is described in detail by Williams (1989). In principle, the
ant nest was like the one described above except that a small petri dish (100 x 10 mm)
with four small holes in the bottom, containing a sponge and Tygon tubing inserted in a
U-shape through two holes in the top of the small petri-dish, was placed into the large
petri dish. The lab stone was poured into the larger dish, leaving only the tubing exposed.
The purpose of the small dish with the sponge was to act as water reservoir to keep the
ant nest humid. One colony was placed in each tray. Food consisted of frozen crickets,
honey agar, 1 M aqueous sucrose and water. The rearing temperature was about 23C.
Poor collection conditions in Brazil yielded only very few £. invicta: thus no colonies of
£. invicta could be established in the laboratory. Thelohania solenopsae. Thelohania sp.
and Vairimorpha sp. but no V. invictae could be isolated from the available specimens.
Ant Identification
To extract cuticular hydrocarbons, five worker ants, frozen at -20C until analysis,
were soaked in 1 mL of hexane in small vials for 2 h. The total lipid extract was passed
through a short column (3 cm long x 0.5 cm in diameter) of silicic acid (60-200 mesh, J.T.
Baker, Philadelphia, Pa.) in a Pasteur pipette (Carlson and Bolten 1984). To make a
column, a little glass wool was stuffed into a Pasteur pipette and the silica gel poured on
top of it. The hydrocarbons were eluted from the mini-column with 3 mL of hexane,


BIOGRAPHICAL SKETCH
Bettina Angela Moser was bom on 4 September 1961 in Landstuhl/Pfalz, then
West-Germany. Following graduation from the Burggymnasium Kaiserslautern, 1980,
she studied Cultures of the Middle East at the Universitt des Saarlandes in
Saarbrcken from 1980-82. She then went to the Freie Universitt in Berlin where she
majored in biology and Persian language. She received the Vordiplom (equivalent of
B.S.) in biology in 1984.
In 1986 she came to the University of Florida as a non-degree graduate exchange
student for one year and took courses in the Entomology and Nematology Department.
She decided to stay and pursue her M.S. in that department which was awarded in 1989.
After two years as a research assistant working on insect-pathogenic fungi, she started her
Ph.D. project on microsporidia pathogenic to imported fire ants under the direction of
Drs. Richard Patterson and James Becnel.
126


38
after sample injection, the temperature was programmed to 150C at 30C/min, then
raised to 220C at 5C/min and held for a total running time of 100 min.
Mass spectrometry and comparison of the resulting peaks to the MIDI calibration
standard mix and peak library were employed to confirm the identity of the major acids
detected in the microsporidia.
Data analysis
Fatty acid methyl esters of the samples were named by comparing their retention
times to those of the calibration standard (a mixture of straight-chain saturated fatty acids
from 9-20 carbons in length including 5 hydroxy acids). Retention time data from the
calibration mixture were converted to Equivalent Chain Length (ECL) data for fatty acid
naming. Thus, the ECL value for each compound to be analyzed was computed, and the
compounds were named based on comparisons to the standards as well as the ECL of
acids stored in the MIDI peak library (142 peaks total) (Sasser 1990b).
A library was created from the microsporidia FAME profiles, and relationships
among samples were analyzed with Principal Component Analysis. Measurements of
variability and clustering among the profiles were portrayed by plotting the percentages of
the three major fatty acids on a 3-D graph.
Statistical analysis of the fatty acid data was performed with an analysis of variance
(ANOVA) followed by a Tukeys mean separation test to compare the means of each fatty
acid among the microsporidian species tested (SAS Institute 1989).
Results
Three acids, palmitic (16:0), oleic (18:1 05 9 cis), and two closely-eluting peaks
denoted as Summed Feature 6 (18:2 03 6,9 cis/18:0 anteiso) comprise 60% or more of the
total FAME profiles of V. necatrix. N. algerae and Thelohania sp. FAME profiles were


21
electron-dense outer layers and inner core separated by an electron-transparent zone
(Figure 2.10). The exospore consisted of several layers and was about 1/5 the thickness
of the electron-transparent endospore (Figure 2.10). Thelohania solenopsae meiospores
looked similar to Thelohania sp. meiospores (Figure 2.11, 2.12).
Thelohania sp. free spores were ovoid in sagittal section. They were diplokaryotic
with polyribosomes bordering the nuclei and a posterior vacuole. The polar filament was
isofilar with 15 coils. It was composed of several layers. The spore wall was relatively
thin and smooth with electron-dense exospore and electron-transparent endospore (Figure
2.13).
Vairimorpha sp. meiospores were pyriform in sagittal section. The most striking
feature was the presence of an exceedingly thick smooth spore wall with a relatively thin
electron-dense exospore and a very thick electron-transparent endospore (Figure 2.14).
The polar filament was isofilar with 11-13 coils; the anterior polaroplast was lamellar
(Figure 2.14). The exospore consisted of several layers and was about 1/9 the thickness
of the endospore (Figure 2.15). The polar filament also consisted of several electron-
dense and electron-transparent layers (Figure 2.15). The electron-transparent layer
surrounding the electron-dense core was much thicker in Vairimorpha sp. than in
Thelohania sp. Conversely, the electron-dense core was much smaller in Vairimorpha sp.
than in Thelohania sp. Vairimorpha sp. free spores were very long and bacilliform in
sagittal section. The polar filament was isofilar with ~ 26 coils. The polaroplast was
lamellate. Since processing of these microsporidia for TEM is extremely difficult, good
quality micrographs of the Vairimorpha sp. free spores could not be presented here.


23
Figure 2.13. Electron micrograph of Thelohania sp. free spore; polar filament
(PF), exospore (EX), endospore (EN). x30,000.


COMPARATIVE ANALYSIS OF MICROSPORIDIA OF FIRE ANTS, SOLENOPSIS
RICHTERI AND S. INVICTA
By
BETTINA A. MOSER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1995
UNIVERSITY OF FLORIDA LIBRARIES

To my dear family and friends

Iucundi Acti Labores

O Son of Spirit!
My first counsel is this: Possess a pure,
kindly and radiant heart, that thine may be a
sovereignty ancient, imperishable
and everlasting.
Bahullh
The Hidden Words

Go to the ant, thou sluggard; consider her way and be wise:
Which having no guide, overseer, or ruler,
Provideth her meat in the summer,
And gathereth her food in the harvest.
The Holy Bible
Proverbs 6,6

ACKNOWLEDGMENTS
I wish to thank the members of my supervisory committee, Drs. John Gander,
James Kimbrough, Philip Koehler, and James Maruniak, for their guidance and advice
throughout the course of my degree program. I am especially indebted to my chairman,
Dr. Richard Patterson, and cochairman, Dr. James Becnel, for their continued assistance
and support. I was the last student of Dr. Patterson and the first student of Dr. Becnel.
Drs. Becnel, Maruniak, and Patterson graciously provided me with laboratory space and
equipment to conduct my research. Sincere appreciation is due to Dr. James Nation,
Nancy Hodge, and David Milne who kindly shared their knowledge on gas-
chromatographic techniques.
I will always remember the friendship and stimulating conversations with fellow
students and researchers Jaw-Ching Liu, Rejane Moars, Alejandra Garcia-Canedo, and
Dr. Ayyamperumal Jeyaprakash. I also want to thank all my other friends inside and
outside the department for the good times and moral support. Warm thanks go to Myma
Litchfield, who ceaselessly helped with bureaucratic paper work. I am very grateful to
my family, who provided never-failing support
I have deep appreciation for the many pleasant things in Gainesville which made
my stay enjoyable and gave me strength to carry on. I have everlasting memories of the
beautiful sun, springs, and trees. The ultimate source of strength, perseverance, and
courage, however, I derive from my faith in God.

TABLE OF CONTENT
page
ACKNOWLEDGMENTS v
LIST OF TABLES viii
LIST OF FIGURES ix
LIST OF ABBREVIATIONS xi
ABSTRACT xiii
CHAPTER
I TAXONOMIC PROBLEMS OF FIRE ANT MICROSPORIDIA
Synopsis 1
II MORPHOLOGICAL CHARACTERIZATION OF MICROSPORIDIA
FROM SOLENOPSIS INVICTA AND S. RICHTERI
Introduction 4
Materials and Methods 9
Results 12
Discussion 26
III FATTY ACID METHYL ESTER ANALYSIS IN MICROSPORIDIA:
EVALUATION OF A NEW TOOL FOR IDENTIFICATION
Introduction 30
Materials and Methods 34
Results 38
Discussion 41
IV COMPARATIVE MOLECULAR CHARACTERIZATION OF
MICROSPORIDIA FROM SOUTH AMERICAN FIRE ANTS
Introduction 49
Materials and Methods 54
Results 66
Discussion 82
vi

V SUMMARY AND DIRECTION OF FUTURE RESEARCH
Synopsis 93
APPENDIX 95
REFERENCES 112
BIOGRAPHICAL SKETCH 126
vii

LIST OF TABLES
Table page
3.1. Fatty acids (%) in three microsporidian species from one aquatic and
two terrestrial insect hosts 40
4.1. List of sequencing primers used 63
4.2. Pairwise distances between taxa 83
viii

LIST OF FIGURES
Figure page
2.1. Gas chromatograph traces of £. invicta and S. richteri hydrocarbons 13
2.2. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. and Thelohania sp. xl8 15
2.3. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. and Thelohania sp. x46 15
2.4. Light micrograph of Thelohania sp. partial cyst with meiospores and free
spores. x750 17
2.5. Light micrograph of Vairimorpha sp. cyst with free spores and meiospores.
x210 19
2.6. Light micrograph of Vairimorpha sp. cyst with free spores and meiospores.
x750 19
2.7. Light micrograph of meiospore octets of Thelohania sp. and Vairimorpha sp.
x750 20
2.8. Light micrograph of Thelohania sp. and Vairimorpha sp. free spores and
meiospores. x750 20
2.9. Electron micrograph of Thelohania sp. meiospore. x37,500 22
2.10. Electron micrograph of Thelohania sp. spore wall and polar filament
xl50,000 22
2.11. Electron micrograph of T. solenopsae meiospore. x37,500 22
2.12. Electron micrograph of T. solenopsae spore wall and polar filament
xl50,000 22
2.13. Electron micrograph of Thelohania sp. free spore. x30,000 23
IX

25
2.14. Electron micrograph of Vairimorpha sp. meiospore. xl8,000
2.15. Electron micrograph of Vairimorpha sp. meiospore spore wall and polar
filament xl20,000 25
3.1. Gas chromatograms of FAME standards 42
3.2. FAME chromatograms of Thelohania sp. and V. necatrix 43
3.3. FAME chromatograms of N. algerae in two different insect hosts 44
3.4. Three major fatty acids of three species of microsporidia 45
4.1. PCR products of the 16S rRNA gene of four microsporidian species 68
4.2. Cloned pTZ 19R Construct 69
4.3. Restriction profiles of 16S rRNA gene PCR products of three microsporidian
species 70
4.4. Multiple sequence alignment of the rRNA gene sequences of 19 species of
microsporidia 72
4.5. Phylogenetic tree (3,511 steps) of the 19 species of microsporidia with
G. lamblia as the outgroup 84
4.6. Bootstrap analysis (100 replicates) of the phylogenetic tree 85
x

LIST OF ABBREVIATIONS
ASP
Ammonium persulfate
BSA
Bovine serum albumine
Clustal
Software program for multiple alignment of sequences
DNA
Deoxyribonucleic acid
EDTA
Ethylenediaminetetraacetate
FAME
Fatty acid methyl ester
GAP
Software program to make optimal alignment between two sequences by
inserting gaps to maximize the number of matches
GC
Gas chromatography
GCG
Genetics Computer Group
GC-MS
Gas chromatography- mass spectrometry
GTE
Glucose,Tris, EDTA buffer
LB
Luria-Bertani
MAP
Software program to display both strands of a DNA sequence with a
restriction map shown above the sequence
MIDI
Microbial ID Inc.
MIS
Microbial Identification System
PAUP
Phylogenetic analysis using parsimony
PCR
Polymerase chain reaction
PEG
Polyethyleneglycol
PUeUp
Software program for multiple alignment of sequences
pTZ 19R
Bacterial plasmid
RFLP
Restriction fragment length polymorphism
xi

rDNA
ribosomal RNA gene
RNA
Ribonucleic acid
rRNA
ribosomal RNA
tRNA
transfer RNA
SDS
Sodium dodecyl sulfate
S.O.C.
Superoptimal catabolite (bacterial medium)
SSC
Standard saline citrate
STE
Sodium chloride, Tris, EDTA buffer
TAE
Tris-acetate, EDTA buffer
TB
Terrific broth
TBE
Tris-borate, EDTA buffer
TE
Tris, EDTA buffer
TEM
Transmission electron microscopy
TEMED
N, N, N\ N tetramethylethylenediamine
Tris
Tris(hydroxymethyl)aminome thane
USDA-ARS
United States Department of Agriculture-Animal Research Service
X-Gal
5-Bromo-4-chloro-3-indolyl-p-D-galactoside
xii

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of
Doctor of Philosophy
COMPARATIVE ANALYSIS OF MICROSPORIDIA OF FIRE ANTS, SOLENOPSIS
RICHTERI AND S. INVICTA
By
Bettina A. Moser
December, 1995
Chairman: Dr. Richard S. Patterson
Major Department: Entomology and Nematology
Two dimorphic microsporidia, Thelohania sp. and Vairimorpha sp., occur
simultaneously in the black imported fire ant, Solenopsis richteri. in parts of Argentina and
are considered as biological control agents of S. invicta in the United States. On the light-
microscopic level, they are indistinguishable from T. solenopsae and V. invictae. described
from Brazilian £. invicta. Two questions arise: Are Vairimorpha sp. and Thelohania sp.
different phenotypes of the same species? Are Thelohania sp. and Vairimorpha sp.
conspecific with T. solenopsae and V. invictae. respectively?
Morphological analysis revealed that spore dimensions and ultrastructures of
Thelohania sp. and Vairimorpha sp. are comparable to those of T. solenopsae and V.
invictae. respectively. The application of FAME profiles for the identification of
microsporidia was assessed for the first time, using spores of Thelohania sp., Nosema
algerae. and Vairimorpha necatrix. Even though the three species had qualitatively and
quantitatively different FAME profiles, this method was unsuitable for characterization of
xiii

the remaining fire ant microsporidia because of (1) influence of host insect on FAME
profile and (2) requirement of large sample sizes (lxlO9 spores) for FAME analysis.
PCR products of the 16S rRNA gene of Thelohania sp. and T. solenopsae were
the same at ~ 1,400 bp as compared to that of Vairimorpha sp. at ~ 1,300 bp. V. invictae
could not be included in the genotypic analysis because of sample size limitations.
Restriction analysis of the PCR products with several enzymes differentiated Vairimorpha
sp. from Thelohania sp. and T. solenopsae which were not separable from each other.
Sequence analysis of the 16S rRNA gene of T. solenopsae. Thelohania sp., and
Vairimorpha sp. showed that the two Thelohania species have a very high sequence
similarity amongst each other (> 99%). Vairimorpha sp. has a 63% sequence similarity
with T. solenopsae and Thelohania sp.
In conclusion, the available phenotypic and genotypic data support the hypothesis
that Thelohania sp. and Vairimorpha sp. are not different phenotypes of the same species
but separate species. Thelohania sp. and T. solenopsae appear to be conspecific and
probably represent two subspecies. V. invictae and Vairimorpha sp. appear
indistinguishable morphologically but await genotypic analysis.
xiv

CHAPTER I
TAXONOMIC PROBLEMS OF FIRE ANT MICROSPORIDIA
Synopsis
The red imported fire ant, Solenopsis invicta, is a major agricultural and urban pest
in the southeastern United States (Stimac and Alves 1994; Patterson 1990; Adams 1986).
Despite extensive primarily chemical control efforts, it is firmly established in the
r
southeastern United States (Stimac and Alves 1994). Nest density of red imported fire
ants is much higher in the United States than in its native South America, and S. invicta
constitutes a much larger fraction of the ant community in the US than in South America
(Porter et al. 1992). The very successful colonization of the southeastern US by £. invicta
may be in part attributed to the fact that it faces virtually no natural biological control in
the US (Burn et al. 1978, 1983). Natural enemies of fire ants are extremely rare in the
US but abundant in South America (Jouvenaz 1983; Stimac and Alves 1994).
In an effort to find a good biological control agent for £. invicta in the US, several
surveys for natural enemies have been conducted in South America (summarized by
Jouvenaz 1983; Stimac and Alves 1994). The microsporidium Thelohania solenopsae is
the first specific pathogen described from the red imported fire ant, S. invicta in Brazil
(Allen and Burn 1974). Subsequently, another microsporidium, Vairimorpha invictae.
was detected in S. invicta in Brazil (Jouvenaz and Ellis 1986). Briano (1993) reported a
high incidence of infection of the black imported fire ant richteri from Argentina with
T. solenopsae-like and V. invictae-like microsporidia, hereforth called Thelohania sp. and
Vairimorpha sp. Thelohania sp. and Vairimorpha sp. may occur in dual infections in the
1

2
same individual ant. The infections appear to weaken the ant colonies and reduce total
numbers of ants significantly (Briano 1993; R.S. Patterson, personal communication).
Solenopsis richteri and £. invicta were considered to be different color morphs of
one species, S. saevissima richteri Forel (Wilson 1951) until Burn (1972) described
S. invicta and S. richteri as separate species. Solenopsis invicta interbreeds successfully
with £. richteri in areas of the US where their ranges overlap, and taxonomy of the two
ant species is still not resolved (Vander Meer and Lofgren 1986). The microsporidia
found in the Argentinean S. richteri could be introduced into the US as biological control
agents after several taxonomic and ecological studies are completed.
The research presented here will address the following taxonomic questions: Are
Thelohania sp. and Vairimorpha sp. two different phenotypes of the same species or are
they indeed different species? Are T. solenopsae and Thelohania sp. and V. invicta and
Vairimorpha sp., respectively, conspecific or are they separate species?
Traditionally, microsporidian taxonomy and classification has been based on spore
morphology, life cycles and host specificities. Characterization based solely upon simple
morphology can result in misleading classification, because spores of different
microsporidian species may appear to be phenotypically identical. For example, two
species of microsporidia, Encephalitozoon hellem and E. cuniculi. isolated from AIDS
patients, can be differentiated using biochemical and immunological tests, but not by fine
structure or development (Didier et al. 1991). Furthermore, one species may have several
different spore phenotypes, depending on host and life stage. Microsporidia requiring an
intermediate host express distinct spore phenotypes in the intermediate and definite hosts
(Andreadis 1985; Becnel 1992; Sweeney et al. 1985), whereas those which develop in
only one host may also be heterosporous (Becnel et al. 1989). Environmental factors,
such as temperature, can affect the expression of different spore phenotypes (Jouvenaz
and Lofgren 1984). Incomplete understanding of the often complex life cycles involving

3
several hosts, and spore types, also hampers experimental transmission of many species in
the laboratory.
Molecular techniques, including polymerase chain reaction (PCR), restriction
fragment length polymorphism (RFLP), and sequence alignment of the small 16S rRNA
subunit, are being developed for microsporidian species identification and phylogenetic
construction (Baker et al. 1995, Baker et al. 1994; Weiss et al. 1994; Vossbrinck et al.
1993). Additional methodologies, including spore protein profiles (Didier et al. 1991; Irby
et al. 1986; Jahn et al. 1986; Langley et al. 1987; Street 1976), serological assays
(Canning 1988; Didier et al. 1991; Niederkom et al. 1980; Oien and Ragsdale 1992), and
flow cytometry (Amigo et al.1994) have been used to aid in classification, although to a
limited extent
In this study, a multiphasic approach was used to compare the micrososporidia
from S. richteri to each other and to those from £. invicta. Methods used included light
microscopic and ultrastructural observations of the spores (chapter II), and amplification,
sequencing, and sequence comparison of the 16S rRNA genes (chapter IV). In addition,
the use of spore fatty acid profiles was investigated for the first time as a character in
identification (chapter III).

CHAPTER II
MORPHOLOGICAL CHARACTERIZATION OF MICROSPORIDIA FROM
SOLENOPSIS INVICTA AND S. RICHTERI
Introduction
Fire ants belong to the genus Solenopsis. Six species four native and two
introduced and two hybrids occur in North America. Solenopsis geminata (Fabricis),
S. xvloni (MacCook), S. amblvchila Wheeler, and S. aurea Wheeler are native species and
found in the southern states (Trager 1991). As indicated in their names, the black
imported fire ant, S. richteri Forel, and red imported fire ant, S. invicta Burn, are not
native to this country but were introduced from South America. Two hybrid forms,
S. xvloni x geminata and S. richteri x invicta, occur as well in the United States (Trager
1991).
Solenopsis invicta is common in the southwestern region of Brazil (Pantanal, a
large flood plain of the head waters of the Paraguay river) westward through Rhondonia
and southward along the Paraguay River through Bolivia to the northern border of
Argentina with Paraguay and Uruguay (Burn et al. 1974). Solenopsis richteri is prevalent
in the more temperate southern states of Brazil, Uruguay and Argentina. Lofgren (1986)
summarizes in great detail the early history of imported fire ants in the United States.
Briefly, S. richteri was introduced into Mobile, Alabama, around 1918 (Creighton 1930)
and is now established in areas of northeastern Mississippi and northwestern Alabama.
The red imported fire ant, S. invicta, reached Mobile, Alabama, in the 1940s (Wilson and
Eads 1949) and subsequently spread throughout the southeastern states displacing
£ richteri everywhere except in pockets of northeastern Mississippi and northwestern
Alabama. Originally, £. invicta and £. richteri were considered different color morphs of
4

5
the same species, S. saevissima richteri Forel (Wilson 1951). Burn (1972) was the first
one to describe S. invicta as a separate species. £. invicta and £. richteri interbreed in
areas of Alabama, Mississippi, and Georgia where their ranges overlap (Ross et al. 1987;
Vander Meer and Lofgren 1988). Since the two species mate and are successful at
producing viable hybrids, the validity of S. invicta as a separate species is questionable but
recognized as such until further investigations (Vander Meer and Lofgren 1988).
Imported fire ants are considered agricultural and urban pests in the United States and
represent a human health risk. They are generally no problem in South America (Stimac
and Alves 1994; Patterson 1993; Adams 1986).
Imported fire ant populations occur at relatively low levels in their South American
homelands. Fire ant mound densities are much higher in the US than in Brazil, and fire
ants constitute a much larger fraction of the ant community in the US (Porter et al. 1992).
Reasons for this could be lack of predators, pathogens, and competitors of imported fire
ants in the US (Burn et al. 1978; 1983). Stimac and Alves (1994) present a summary on
red imported fire ant ecology in their homelands and the US. Further summaries can be
found in Lofgren and Vander Meers book on fire ants and leaf-cutting ants (1986).
Only a few surveys for pathogens of fire ants in the United States have been
conducted. Jouvenaz et al. (1977) have used a screening method sufficiently sensitive to
detect low levels of microsporidian and fungal infections but not bacteria and viruses.
They find no pathogens in £. richteri: in S. invicta they detect very low levels of a benign,
unidentified yeast infection, and only 1 in 1007 colonies has an unidentified microsporidian
disease. This microsporidium is found in low levels in £. geminata (Fabricis) colonies.
Subsequently, Jouvenaz and Hazard (1978) described Burenella dimorpha a new
microsporidian genus and species, from S. geminata and created a new family. Beckham
and Bilimoria (1982) examined samples of 113 ant species including S. invicta from
western Texas for the presence of fungi, occluded viruses, microsporidia, and nematodes
and found resting spores of Entomophthora sp. on only one specimen of Pheidole

6
bicarinata vinelandica Forel. No parasites or pathogens are found in fire ants. Jouvenaz
and Kimbrough (1991) described an endoparasitic fungus, Myrmecomyces annellisae
gen.nov., sp. nov., from Solenopsis quincecuspis Forel, collected in Buenos Aires
Province, Argentina, and £. invicta, collected in Florida. Gross pathology, histopathology,
or changes in host behavior are not observed but parasitized hosts appear to succumb
more readily to stress. Two fungi, Conidiobolus sp. and Metarhizium anisopliae. were
observed by Sanchez-Pea and Thorvilson (1992) on £. invicta queens collected in Texas.
Of the adult queens and workers, and worker larvae assayed against conidial showers of
Conidiobolus sp., only the worker larvae die. Metarhizium anisopliae kills challenged
alate workers.
The sparse occurrence of natural enemies of imported fire ants in the United States
is a good example of the introduction of an insect into another country without its
predators, parasites and pathogens. A parallel situation occurred with the gypsy moth,
Lyman tria dispar. This insect was introduced into the United States from Europe where it
has numerous natural enemies which are lacking in the United States (Howard and Fiske
1911). With regard to pathogens, one major group of pathogens, the microsporidia, have
been identified as significant mortality factors in Eurasian gypsy moth populations but they
have not been recorded from gypsy moths in North America (Jeffords et al. 1989).
Microsporidia isolated from European L. dispar are evaluated as biocontrol agents for the
US populations (Maddox et al. 1992).
Numerous reports on natural enemies of S. richteri and £. invicta in their
homelands Argentina, Brazil, and Uruguay include microsporidia, fungi, nematodes,
parasitic wasps and flies and are summarized by Stimac and Alves (1993) and Jouvenaz
(1983). Documented parasites include Orasema wasps (Heraty et al. 1993), the straw itch
mite Pyemotes tritici (Thorvilson et al. 1987), an unidentified phorid fly (Wojcik et al.
1987), the phorid Pseudacteon obtusus (Williams and Banks 1987), the nematode
Tetradonema solenopsis (Nickle and Jouvenaz 1987), and unidentified nematodes

7
(Jouvenaz and Wojcik 1990). Pathogens include a virus, neogregarines, microsporidia, a
bacterium (Jouvenaz 1983) and the entomopathogenic fungi Beauveria, Metarhizium and
Paecilomvces (Stimac et al. 1987). Recently, a high incidence of infection of £ richteri
with Thelohania solenopsae-like and Vairimorpha invictae-like microsporidia, hereforth
called Thelohania sp. and Vairimoipha sp., was reported from Argentina (Briano 1993).
He found that in areas where the microsporidia are present the density of fire ant mounds
is significantly lower than in uninfected areas. These microsporidia are currently being
evaluated as potential biological control agents for imported fire ants in the United States.
Thelohania solenopsae. the first specific pathogen known from fire ants, was first
reported by Allen and Burn (1974) from £. invicta in Brazil. They detected spore cysts
formed from enlarged fat body cells in the gasters of alcohol-preserved workers. Giemsa-
stained smears of fat body tissue of live workers show octonucleate sporonts that produce
eight spores enclosed in a sporophorous vesicle. Based on this characteristic they
identified it as a species of the genus Thelohania Henneguy but they did not give it a
species name. The genus Thelohania was defined by Henneguy and Thlohan (1892) as
having spores of only one developmental sequence, which produces octospores enclosed
in a sporophorous vesicle or interfacial envelope. Knell and Allen (1977) described
Thelohania sp. from live S. invicta workers and brood in Brazil as a new species,
T. solenopsae. Meronts (vegetative stages) are found in fat body of larvae, pupae and
queen ovaries (Knell and Allen 1977). Sporonts occur in late pupae, workers, males and
queens. Spores occur only in adults. Knell and Allen (1977) discovered that
T. solenopsae is dimorphic producing both bacilliform binucleate free spores and pyriform
uninucleate octospores in the same individuals. This makes it the only dimorphic member
of the genus Thelohania. However, the type species, T. giardia. which has not been
carefully studied (Hazard and Oldacre 1975), may also be dimorphic.
Allen and Silveira-Guido (1974) also found Thelohania sp. in workers of £. richteri
in Montevideo, Uruguay and Las Flores, Argentina and from a Solenopsis sp. in

8
Montevideo. They speculated, based on their knowledge of S. invicta and its
microsporidian parasites, that the ant populations are regulated naturally by the
microsporidia. It is unclear whether T. solenopsae is one species or a complex of sibling
species of microsporidia (Jouvenaz 1986) since it has been detected in more than a dozen
described or undescribed Solenopsis spp. in South America (Jouvenaz 1983).
The dimorphic V. invictae has been reported from £. invicta collected in Brazil by
Jouvenaz and Ellis (1986). Vegetative stages are found in larvae and pupae, free spores in
pupae and adults, and octospores in adults. The genus Vairimorpha was created by Pilley
(1976) to include dimorphic species with disporous and octosporous sporogony in the
same individual.
The classification of T. solenopsae and V. invicta may have to be revised
(Jouvenaz and Ellis 1986). Knell and Allen (1977) placed T. solenopsae in the family
Thelohaniidae because it meets all the family criteria. It produces octospores and
sporoblasts by endogenous budding, and it secretes metabolic products retained by the
sporophorous vesicle. They placed it in the genus Thelohania because of its isofilar polar
filament. Two genera of Thelohaniidae at that time, Amblvospora and Parathelohania.
produce both octospores and free spores, but free spores arise from plasmodia (4-40
spores per plasmodium, multisporous sporogony) (Hazard and Oldacre 1975). The free
spores of T. solenopsae. however, arise from diplokaryotic sporonts (disporous
sporogony) which is characteristic of Vairimorpha. Jouvenaz and Hazard (1978) created
the family Burenellidae for species having two sporogonic sequences, one producing free
spores from disporous sporogony, and the other producing meiospores from octonucleate
sporonts. Species of Burenellidae also develop tubules within the sporophorous vesicle
during sporulation, they do not secrete granules as do those of the Thelohaniidae. The
genera Burenella. Vairimorpha. Evlachovaia. and Pilosporella are included in Burenellidae
(Sprague et al. 1992). It appears that T. solenopsae does not quite fit into the family
Thelohaniidae because it produces free spores from disporous sporonts and not from

9
plasmodia. Furthermore, the species of this family are common parasites of a variety of
aquatic and semiaquatic animals. Thelohania solenopsae does not quite fit into the
Burenellidae either, because it does secrete granules during octosporous sporulation.
Based on light microscopic observations, Thelohania sp. and Vairimorpha sp. from
Argentine £ .richteri appear to be identical to T. solenopsae and V. invictae from Brazilian
S. invicta. The objective of this study was to compare light- and ultrastructural features of
Argentine Thelohania sp. and Vairimorpha sp. and Brazilian T. solenopsae and V. invictae.
Infected £. invicta and S. richteri were collected by R.S. Patterson and J. Briano in
Brazil and Argentina. Identity of the ants from which the microsporidia were isolated for
all experiments was confirmed by determination of cuticular hydrocarbon components
with gas chromatography (GC). Both £. invicta and S. richteri have signature cuticular
hydrocarbon profiles which clearly define the two species (Vander Meer and Lofgren
1988; Nelson et al. 1980).
Materials And Methods
Collection and Processing of Ants
Thelohania sp. and Vairimorpha sp. were obtained from £. richteri adults collected
by R. S. Patterson and J. Briano in the area of Saladillo, Buenos Aires province, 180 km
SW of Buenos Aires in Argentina. R. S. Patterson and J. Briano also collected £. invicta
infected with T. solenopsae and V. invictae in the area of Cuiaba, Brazil. The ants were
transported back to Gainesville, Florida, in artificial ant nests modified from Williams
(1989). To make a nest, powdered dental labstone (roughly 250 g) and tapwater were
thoroughly mixed to get a thick liquid paste. The labstone paste was then poured into the
bottom of a large petri dish (150 x 25 mm) and allowed to harden. Prior to use it was
saturated with water to maintain a high relative humidity inside the petri plate. A small

10
test tube filled with 1 M aqueous sucrose solution and plugged with cotton gauze was
secured inside the petri dish lid. For transport, the ants were confined within the modified
petri dish with the lid taped securely to the bottom. On their arrival to Gainesville, the
ants were either frozen at -70C to purify the spores later or processed immediately.
Some colonies of infected S. richteri were maintained over several months in the
laboratory. For rearing of the ant colonies, big trays (95 x 78 x 28 cm) were coated with
Fluon on the inside walls to prevent ants from escaping. Each tray had one artificial ant
nest, the construction of which is described in detail by Williams (1989). In principle, the
ant nest was like the one described above except that a small petri dish (100 x 10 mm)
with four small holes in the bottom, containing a sponge and Tygon tubing inserted in a
U-shape through two holes in the top of the small petri-dish, was placed into the large
petri dish. The lab stone was poured into the larger dish, leaving only the tubing exposed.
The purpose of the small dish with the sponge was to act as water reservoir to keep the
ant nest humid. One colony was placed in each tray. Food consisted of frozen crickets,
honey agar, 1 M aqueous sucrose and water. The rearing temperature was about 23C.
Poor collection conditions in Brazil yielded only very few £. invicta: thus no colonies of
£. invicta could be established in the laboratory. Thelohania solenopsae. Thelohania sp.
and Vairimorpha sp. but no V. invictae could be isolated from the available specimens.
Ant Identification
To extract cuticular hydrocarbons, five worker ants, frozen at -20C until analysis,
were soaked in 1 mL of hexane in small vials for 2 h. The total lipid extract was passed
through a short column (3 cm long x 0.5 cm in diameter) of silicic acid (60-200 mesh, J.T.
Baker, Philadelphia, Pa.) in a Pasteur pipette (Carlson and Bolten 1984). To make a
column, a little glass wool was stuffed into a Pasteur pipette and the silica gel poured on
top of it. The hydrocarbons were eluted from the mini-column with 3 mL of hexane,

11
concentrated to dryness with nitrogen gas, and redissolved in 20 (lL of hexane for GC
analysis (Carlson and Brenner 1988). Oxygenated compounds, if present, remained on the
column.
Gas chromatography analyses of hydrocarbons were conducted using a 5890
series II Hewlett Packard gas chromatograph with a flame ionization detector. The
column oven was fitted with a 30 m x 032 mm i.d. x 0.25 |im film thickness fused silica
capillary column of DB-1. Following a cool-on column injection of 1 jlL at 63C, the
oven temperature was raised to 230C at 25C/min, and then to a final temperature of
320C at 7C/min. The temperature was held at 320C for 15 min. The carrier gas was
hydrogen. The data were processed by HP Chemstation, version 1.0 software.
Phase Contrast Microscopy
Diagnosis of infection was made by examining wet mounts of fat body tissue of
adults by phase contrast microscopy. Different body parts were examined for infection
(head, thorax, gaster). Fresh samples of Thelohania sp. and Vairimorpha sp. were used
for spore measurements with a calibrated Vickers image-splitting micrometer.
Transmission Electron Microscopy
Spore cysts of Thelohania sp., Vairimorpha sp., and T. solenopsae were dissected
from adult worker ant gasters in 2.5% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH
7.4) containing 0.1% CaCh. After 30 min, the hardened cysts were transferred to fresh
2.5% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) containing 0.1% CaCl2 and
fixed for 2-4 h at room temperature. They were postfixed in 1% aqueous Os04 (osmium
tetroxide) (w/v) for 2 h at room temperature, dehydrated through an ascending ethanol
and acetone series and embedded in Epon-Araldite plastic (Mollenhauer 1964). Tissue
blocks were thick-sectioned with a glass knife, and thin-sectioned with a diamond knife on

12
a Sorvall ultramicrotome. Thin-sections were stained with methanolic uranyl acetate
(50% methanol, 1% uranyl acetate) followed by lead citrate (Reynolds 1963). They were
and photographed at an accelerating voltage of 75 kV with a Hitachi H-600 electron
microscope.
Results
Ant Identification
Identification of the ants as either £. invicta or £. richteri was confirmed by their
respective cuticular hydrocarbon profiles (Figure 2.1). In S. invicta, hydrocarbons with 28
and 29 carbons in the backbone of the molecules predominate whereas in £. richteri
hydrocarbons with 24, 25, and 26 carbons in the backbone of the molecules predominate
(Nelson etal. 1980).
Light Microscopy
Spores of Thelohania sp. and Vairimorpha sp. are found only in pupae and adults,
not in the larval stages, of the ants. Workers, queens and males can be infected. The
microsporidia seem to parasitize fat body cells which hypertrophy into spore-filled cysts.
Dual infections with Thelohania sp. and Vairimorpha sp. in the same individual may occur.
Thelohania sp. and T. solenopsae cause the development of comparatively large cysts
while a Vairimorpha infection produces tiny cysts (Figure 2.2, Figure 2.3). The infection
may be very heavy 25 Thelohania sp. cysts and 14 Vairimorpha sp. cysts were counted
from one major £. richteri worker! The infection produced symptoms not readily
observed with a loss of coordination and slow movement of the diseased ants. Both
Thelohania sp. and Vairimorpha sp. were dimorphic with uninucleate meiospores in
groups of eight and binucleate free spores.

13
S. invicta
11 12 13 14 15 16
Retention Time (min)
Retention Time (min)
c
a
c
>
I

Figure 2.1. Gas chromatographic traces of £. invicta and £. richteri hydrocarbons.
Ant lipids were extracted with hexane. The total lipid extracts were passed through short
columns of silicic acid (3 cm long x 0.5 cm diameter) in Pasteur pipettes. The
hydrocarbons were eluted from the columns with hexane in the void volume. They were
analyzed with a 5890 series II Hewlett Packard gas chromatograph fitted with a fused
silica capillary column of DB-1. A flame ionization detector was used.

Figure 2.2. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. (VC) and Thelohania sp. (TC). xl8.
Figure 2.3. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. (VC) and Thelohania sp. (TC). x46.


16
Thelohania sp. was apparently confined to fat body tissue of ant gasters. Both
uninucleate meiospores and binucleate free spores developed simultaneously in the same
cysts. Octets of meiospores were enclosed into a persistent sporophorous vesicle
(henceforth referred to as an interfacial envelope). Free spores were not enclosed in a
membrane (Figure 2.4). Octospores are pyriform in shape and measure 2.32 0.14 x 4.10
0.31 |im (n=33). Free spores are elongate oval in shape and measure 2.83 0.30 x 5.71
0.55 |im (n=21). Free spores were exceedingly rare (usually less than 1%).
Vairimorpha sp. spores were observed from tissues within the head, thorax and
gaster of S. richteri. In the gaster, fat body tissue was parasitized; the nature of the tissue
in the thorax and head was unclear. Only mature free spores were found in pupae; both
spore types occurred in the same cysts in adults (Figure 2.5). Similar to Thelohania sp.,
octets of meiospores were enclosed in interfacial envelopes, but the free spores were not
enclosed in a membrane (Figure 2.6). Vairimorpha sp. spores are much larger than those
of Thelohania sp. Octospores were ovoid and very slightly narrower at the anterior pole
and measure 4.31 0.25 x 6.45 0.61 |im (n=33). Free spores were elongate bacilliform
and measure 3.11 0.19 x 10.76 0.48 Jim (n=34). Figure 2.7 shows Vairimorpha sp.
and Thelohania sp. meiospores, Figure 2.8 all four spore types in the same field of view.
Transmission Electron Microscopy
Thelohania sp. meiospores were pyriform in sagittal section with the posterior end
more broadly rounded than the anterior end. They were uninucleate with a lamellar
polaroplast anteriorly and vacuole posteriorly. Polyribosomes border the nucleus. The
polar filament was isofilar with 10-12 coils. The coils were arranged either uniform or
irregular. The spore wall, composed of exospore and endospore, was relatively thin and
undulating (Figures 2.9, 2.10). The polar filament consisted of several layers with

17
Figure 2.4. Light micrograph of Thelohania sp. partial cyst (TC) with meiospores
(MS) and free spores (FS). x750.

Figures 2.5. Light micrograph of Vairimorpha sp. cyst with free spores (FS) and
meiospores (MS). x210.
Figure 2.6. Light micrograph of Vairimorpha sp. cyst with free spores (FS) and
meiospores (MS). x750.

19

21
electron-dense outer layers and inner core separated by an electron-transparent zone
(Figure 2.10). The exospore consisted of several layers and was about 1/5 the thickness
of the electron-transparent endospore (Figure 2.10). Thelohania solenopsae meiospores
looked similar to Thelohania sp. meiospores (Figure 2.11, 2.12).
Thelohania sp. free spores were ovoid in sagittal section. They were diplokaryotic
with polyribosomes bordering the nuclei and a posterior vacuole. The polar filament was
isofilar with 15 coils. It was composed of several layers. The spore wall was relatively
thin and smooth with electron-dense exospore and electron-transparent endospore (Figure
2.13).
Vairimorpha sp. meiospores were pyriform in sagittal section. The most striking
feature was the presence of an exceedingly thick smooth spore wall with a relatively thin
electron-dense exospore and a very thick electron-transparent endospore (Figure 2.14).
The polar filament was isofilar with 11-13 coils; the anterior polaroplast was lamellar
(Figure 2.14). The exospore consisted of several layers and was about 1/9 the thickness
of the endospore (Figure 2.15). The polar filament also consisted of several electron-
dense and electron-transparent layers (Figure 2.15). The electron-transparent layer
surrounding the electron-dense core was much thicker in Vairimorpha sp. than in
Thelohania sp. Conversely, the electron-dense core was much smaller in Vairimorpha sp.
than in Thelohania sp. Vairimorpha sp. free spores were very long and bacilliform in
sagittal section. The polar filament was isofilar with ~ 26 coils. The polaroplast was
lamellate. Since processing of these microsporidia for TEM is extremely difficult, good
quality micrographs of the Vairimorpha sp. free spores could not be presented here.

22
Figure 2.9. Electron micrograph of Thelohania sp. meiospore. x37,500.
Figure 2.10. Electron micrograph of Thelohania sp. spore wall and polar filament
xl50,000.
Figure 2.11. Electron micrograph of T. solenopsae meiospore. x37,500.
Figure 2.12. Electron micrograph of T. solenopsae spore wall and polar filament
Endospore (EN), exospore (EX), polar filament (PF). xl50,000.

23
Figure 2.13. Electron micrograph of Thelohania sp. free spore; polar filament
(PF), exospore (EX), endospore (EN). x30,000.

Figure 2.14. Electron micrograph of Vairimorpha sp. meiospore. xl8,000.
Figure 2.15. Electron micrograph of Vairimorpha sp. meiospore spore wall and polar
filament, x 120,000. Endospore (EN), exospore (EX), polar filament (PF).

25
215

26
Discussion
Based on the morphological evidence Thelohania sp./T. solenopsae and
Vairimorpha sp./V. invictae appear to be conspecific. Vairimoipha sp. and Thelohania sp.
are very distinct from each other at the light-microscopic and ultrastructural level in both
size and morphology. Thelohania sp. and Vairimorpha sp. are very similar to T.
solenopsae and V. invictae. respectively, with regard to tissue specificity, and light and
ultrastructural microscopy.
To determine whether Vairimorpha sp. and Thelohania sp. are different phenotypes
of the same species, the possibilities of heterosporous microsporidia (Sweeney et al 1985;
Becnel et al. 1989) and phenotypic plasticity must be considered. Even though Mitchell
and Cali (1993) did not observe temperature-related differences in the ultrastructure of
V. necatrix. there are reports of environmentally induced phenotype variation. Burenella
dimorpha. a microsporidian parasite of S. geminata. for example, shows temperature-
dependent spore dimorphism (Jouvenaz and Lofgren 1984). They demonstrated inhibition
of octospore development at relatively low (20C) and high temperatures (30C).
Temperature-dependent spore dimorphism has been demonstrated for other microsporidia
as well (Maddox and Sprenkel 1978). This means that Vairimorpha sp. and
Thelohania sp., even though ultrastructurally distinct, could be different phenotypes
(expressed in different environmental conditions) of the same species.
Spore measurements of Thelohania sp. meiospores and free spores are about 1 pm
larger than the previously published measurements of T. solenopsae by Knell and Allen
(1977). This difference in spore dimensions could be due to a different technique to read
the scale in the ocular micrometer (used for spore measurements) or to environmentally
induced size variation due to temperature or host For example, temperature regulated
spore length of Vairimorpha sp. 696 (Sedlacek et al. 1985). Spores were significantly
longer at 19C (5.9 pm) than at 32C (4.7 |im). Mean spore size of the same species of

20
Figure 2.7. Light micrograph of meiospore octets ofThelohania sp. (TM) and
Vairimorpha sp. (VM). x750.
Figure 2.8. Light micrograph ofThelohania sp. and Vairimorpha sp. free spores (TF, VF)
and meiospores (TM, VM). x750.

27
microsporidia may also vary significantly with host species (Brooks and Cranford 1972).
They found that spores of Nosema heliothidis are significantly shorter in Heliothis zea
larvae than in its hymenopterous parasite Campoletis sonorensis (Brooks and Cranford
1972). Spore dimensions of Vairimorpha sp. meiospores and free spores are almost
identical to the previously published dimensions of V. invictae (Jouvenaz and Ellis 1986).
Furthermore, meiospore and free spore ultrastructure of Thelohania sp. and Vairimorpha
sp. are very similar to those of T. solenopsae (Knell and Allen 1977) and
V. invictae (Jouvenaz and Ellis 1986), respectively.
Meiospore ultrastructures of Thelohania sp. and T. solenopsae are characterized
by a thin, undulating exospore, relatively thin endospore, lamellar polaroplast, and isofilar
polar filament. Meiospore ultrastructures of Vairimorpha sp. and V. invictae are
characterized by a very thick smooth spore wall with relatively thin exospore and very
thick endospore, lamellar polaroplast, and isofilar polar filament Differences were
observed, however, in number of coils and arrangement of the coils of the polar filament
The number of turns of the polar filament, arrangement of the coils and number of broad
and narrow coils of the meiospores may be used in distinguishing closely related species
(Hazard and 01dacrel975). For example, Andreadis (1994) was able to distinguish six
new species of the genus Amblvospora based upon distinct differences in the number of
turns of the polar filament, arrangement of the coils and number of broad and narrow coils
of the polar filament. Garcia and Becnel (1994) also utilized numerical ratio of broad and
narrow coils, and arrangement of these coils as useful taxonomic characters to describe
eight new species of microsporidia of the genera Amblvospora and Parathelohania from
Argentine mosquitoes.
It was very difficult to quantify polar filament arrangement and number of coils in
an adequate number of spores of Thelohania sp., T. solenopsae and Vairimorpha sp.
because sample preparation for TEM was very difficult (see below). Based on the
material available, Thelohania sp.meiospores showed both uniform and irregular

28
arrangement of the coils of the polar filament but T. solenopsae meiospores had a uniform
arrangement of coils of the polar filament. Thelohania sp. had between 10-12 coils
whereas T. solenopsae had between 9-11 coils. Free spore ultrastructure, except for
number of coils of the polar filament, of Thelohania sp. was similar to that of
T. solenopsae published by Knell and Allen (1977). The single Thelohania sp. free spore
observed in this study had 15 coils whereas Knell and Allen (1977) report 9-11 coils.
Coils of the polar filament are arranged irregularly in both Vairimorpha sp. and V. invictae
(Jouvenaz and Ellis 1986) but the number of turns was between 11-13 in Vairimorpha sp.
and ~ 9 in V. invictae. Free spores of Vairimorpha sp. and V. invictae are similar in
structure and number of turns of the polar filament (24-26 coils in V. invictae and ~ 26
coils in Vairimorpha sp.).
Furthermore, no data are available on host specificities of T. solenopsae.
V. invictae. Thelohania sp. and Vairimorpha sp. Andreadis (1994) and Garcia and Becnel
(1994), in utilizing features of the polar filament as a distinguishing character to describe
new species, placed great weight on the fact that the microsporidian species are all from
different mosquito hosts (which do not interbreed). In other words, microsporidian
species, that are ultrastructurally nearly identical except for characteristics of the polar
filament, probably could not be differentiated easily from each other if they would coinfect
the same host. It is not known whether Thelohania sp. and Vairimorpha sp. from
S. richteri can infect S. invicta (the host of T. solenopsae and V. invictae) and vice versa.
To complicate the matter further, it is not even clear whether S. richteri and S. invicta are
two distinct species (Vander Meer and Lofgren 1988). Thus, the observations on
differences in polar filament features did not provide a good taxonomic character to
separate the fire ant microsporidia from each other because of (1) inadequate sample sizes
and (2) lack of knowledge of host specificities.
Another problem that complicates comparing microsporidia at the ultrastructural
level, involves sample preparation for TEM. It is a technical challenge to get good spore

29
infiltration of the imported fire ant microsporidia for tissue fixation and embedding into
plastic. Because masses of spores occur in cysts, it is nearly impossible to get good
infiltration of spores towards the interior of the cyst. Most importantly, the spore walls
present a nearly impenetrable barrier to fixatives and plastics (J. Becnel, personal
communication). Vairimorpha sp. and V. invictae meiospores are especially challenging
because of their very thick spore walls. The obtainable ultrastructure of the fire ant
microsporidian spores thus does not result in the same quality of resolution available from
some other species of microsporidia such as those parasitizing aquatic insects which are
(for unknown reasons) easier to prepare for TEM.
In conclusion, ultrastructural evidence indicates that Thelohania sp. and
T. solenopsae appear to be the same species. Ultrastructural evidence also indicates that
Vairimorpha sp. and V. invicta are conspecific. It is premature, though, to draw a
conclusion based solely on morphological characteristics because there are examples of
microsporidia that are distinct species based on biochemical and immunological tests but
indistinguishable at the light- and ultrastructural level (Didier et al. 1991). Differences in
number and arrangement of coils of the polar filament presently cannot be used as good
taxonomic characters because of problems of quantification and unresolved host
specificities. Vairimorpha sp. and Thelohania sp. are very different from each other at the
gross morphological and ultrastructural level, but because of the occurrence of
heterosporous microsporidia and phenotypic plasticity more evidence is needed to resolve
the question whether they are different phenotypes of the same species.

CHAPTER HI
FATTY ACID METHYL ESTER ANALYSIS IN MICROSPORIDIA: EVALUATION
OF A NEW TOOL FOR IDENTIFICATION
Introduction
Literature Review
This literature review will highlight several significant developments in the use of
fatty acid analysis as a tool for rapid identification and taxonomy of microorganisms. A
comprehensive review on gas chromatographic analyses of fatty acids in bacteria and other
microorganisms, using capillary columns, was written by Welch (1991). Asselineau
(1962) provided an overview of the early work on bacterial lipids performed by open,
packed glass columns. OLeary (1975) reviewed microbial lipids and their role in
taxonomy, phylogeny, and identification of bacteria. Supplementary references may be
obtained from a number of books on microbial chemotaxonomy and lipids (Goodfellow
and ODonnell 1994; Ratledge and Wilkinson 1988; Goodfellow and Minnikin 1985).
Lipid composition, especially fatty acid composition, has been an important
criterion in determining taxonomic relationships among bacteria (Shaw 1974). Analysis of
fatty acid methyl esters (FAMEs) for identification, first applied to bacteria, is now a
routine practice for anaerobic and aerobic bacteria (Dees et al. 1975; Moss et al. 1974;
Moss 1981; Sasser 1990a). FAME analysis has recently been applied to the taxonomy and
identification of yeasts (Kock 1988; Sasser 1990c) and glomalean endomycorrhizal fungi
(Jabaji-Hare 1988; Bentivenga and Morton 1994; Graham et al. 1995). A recent
publication by Van der Westhuizen et al. (1994) reports on FAME profiles in
Chytridiomycota, Zygomycota, and Deuteromycotina.
30

31
James and Martin (1952) first reported on the application of gas-liquid partition
chromatography to the separation and micro-estimation of volatile fatty acids. This
method was successfully used by Abel et al. (1963) to analyze fatty acids of eleven
bacteria. They demonstrated qualitative and quantitative fatty acid profile differences
among selected families in the class Schizomycetes, and quantitative differences among
five selected genera of the family Enterobacteriaceae. Furthermore, they found that media
components and growth stage influence bacterial fatty acid composition. Their studies
established the potential usefulness of cellular fatty acid analysis in bacterial taxonomy,
and laid the foundation for further investigations. For example, Yamakawa and Ueta
(1964) used gas chromatography to determine fatty acid and monosaccharide
compositions of whole bacterial cells of seven species of Neisseria. Other early studies
were concerned with various aspects of culture conditions that influenced fatty acid
composition of Escherichia coli. such as temperature and growth media (Marr and
Ingraham 1962; Knivett and Cullen 1965). A wealth of literature exists on the influence of
nonstandardized growth conditions on the fatty acid composition of organisms. Recent
research has been undertaken to determine the effect of culture age on FAME profiles of
lactic acid bacteria (Decallone et al. 1991). Effects of growth temperature on FAME
profiles of Bacillus subtilis and B. megaterium (Suutari and Laakso 1992) and culture
media on FAME profiles of B. anthracis and B. cereus (Lawrence et al. 1991) have been
reported. In addition to bacteria, studies on FAME profiles of yeasts including several
Candida species, Torulopsis glabrata. and Crvptococcus neoformans (Marumo and Aoki
1990) and Mortierella alpina (Shimizu et al. 1991) are available.
The source of fatty acids in microbial cells is lipid. Lipids are substances of
biological origin that are soluble in organic solvents such as chloroform and ether but only
sparingly soluble in water (Voet and Voet 1990). Fats, oils, fat-soluble vitamins such as
A, D, E, and K, and some hormones are lipids. Fatty acids are carboxylic acids having
hydrocarbon backbones ranging from 1-30 carbons in length. They are rarely found as

32
free acids in the cell but, rather, occur as esters of glycerol. Some free fatty acids are
toxic to living cells (Wood 1988). The fatty acids present in microbial lipids are generally
of four types: straight-chain or saturated, mono- or polyunsaturated, branched-chain
(predominantly iso and anteiso), and substituted fatty acids. The latter group includes
cyclopropane, hydroxy, and alcohol moieties (Schweizer 1988).
Palmitic acid (16:0) is highly conserved in prokaryotes (Welch 1991). Branched-
chain and cyclopropane fatty acids characterize many gram-positive and gram-negative
bacteria, but are not found in eukaryotic microorganisms. Polyunsaturated fatty acids,
found in higher organisms, are not biosynthesized by aerobic bacteria (Welch 1991).
Hydroxy acids are typical of gram-negative, but not gram-positive bacteria. Mycolic acids
are representative of the Actinomycetes. Strict anaerobes and archaebacteria synthesize
plasmalogens (ether-linked lipids). An excellent summary on the distribution of fatty acids
among major taxonomic groups is given by Kerwin (1994). Additional information on
fatty acids characteristic of different microorganism can be found in Welch (1991) and
Ratledge (1988). Fungal fatty acids are discussed by Van der Westhuizen et al. (1994)
and Losel (1988).
Several technical advances have simplified the use of cellular fatty acid analysis as
a diagnostic tool while increasing accuracy and precision. Generally, gas-liquid
chromatography (G-LC) of FAMEs had been done on glass columns of variable lengths
with internal diameters from 2-4 mm, and packed with polar or nonpolar stationary phase
material (Moss 1981). Packed columns enable larger sample volumes to be assayed, but
do not separate all of the types of substituted acids biosynthesized by bacteria. For
example, hydroxy acids appear as shoulder peaks on the leading or tailing edge of other
peaks on a chromatogram of a packed column, and cis/trans isomers of some acids with
the same carbon chain length may appear as one peak or will not be resolved at the base
line (Moss et al. 1980; Moss 1981). The introduction of flexible fused silica glass capillary
columns with internal diameters of 0.2 mm and wall-coated, rather than packed stationary

33
phases enables increased resolution of fatty acids. Hydroxy acids and most structural
isomers appear as sharp, symmetrical, well resolved peaks when fused silica capillary
columns are used (Moss et al. 1980).
Other developments include the modification of a fatty acid extraction method to
obviate the use of hazardous diethylether (Moss et al. 1974; Moss 1981). An
esterification protocol was modified to improve total fatty acid recovery as well as reduce
hydroxy acid tailing and cyclopropane acid degradation (Miller 1982). Finally,
computerized data reduction programs facilitate rapid analysis of large data sets (Aston
1977; Eerola 1988; Sasser 1990a).
A commercial, microbial identification system based on FAME profile analysis, the
Microbial ID Inc. (MIDI) automated Microbial Identification System (MIS), has been
developed (Sasser 1990a). MIDI has created data bases of FAME profiles for
identification of aerobic and anaerobic bacteria, including actinomycetes, yeasts and other
fungi (Sasser 1990b; 1990c). Stead et al. (1992) assessed the MIDI system by comparing
FAME profiles of 773 strains of plant pathogenic bacteria representing 25 taxa and related
saprophytic bacteria. They found that the confidence of correct identification is very high
at the genus and species levels, but lower at the subspecies and pathovar levels. Jarvis and
Tighe (1994) found that the MIDI system correctly identifies recognized species of
Rhizobium with high accuracy.
This study assessed for the first time the application of FAME profiles for the
identification of microsporidia, represented by three species of three genera. Due to
sample size limitations, only Thelohania sp. of the fire ant microsporidia could be included;
inadequate spore material was available of Vairimorpha sp. and T. solenopsae.

34
Materials and Methods
Test organisms
Three genera were selected for fatty acid analysis: Vairimorpha, Nosema, and
Thelohania. Vairimorpha necatrix was obtained from J.V. Maddox, Illinois Natural
History Survey, and propagated in the corn earworm, Helicoverpa zea. Nosema algerae,
provided by A.H. Undeen, USDA-ARS, Gainesville, was augmented in H. zea and the
common malaria mosquito, Anopheles quadrimaculatus. Thelohania sp. was harvested
from field-collected Argentine fire ants, S. richteri. courtesy of R.S. Patterson and J.
Briano.
Spore Propagation of N. algerae in H. zea
Four-day-old H. zea larvae were starved individually for 24 h, then 20 (J.L of an
aqueous suspension of lxlO7 N. algerae spores/mL was added to each. After an
additional 24 h, the larvae were placed separately on a pinto bean diet, and maintained at
29C. Spores were purified from adult H. zea.
Spore Propagation of V. necatrix in H. zea
Five-day-old H. zea larvae were exposed to 10 pL of lxlO6 V. necatrix spores/mL
each and raised separately on pinto bean diet at 29C. Spores were harvested from last
instar H. zea larvae.
Spore propagation of N. algerae in A, quadrimaculatus
Approximately 1000 mosquito eggs were hatched in 100 mL water, thereafter
called infusion water, containing 13 mg of a 1:1 mix of dried, powdered liver and brewers
yeast After 24 h, this infusion was enriched with 30 mg of alfalfa powder, and the larvae

35
were exposed to lxlO5 spores of N. algerae One day post-exposure, the larvae were
transferred to 8x38x50 cm rearing pans containing 900 mg powdered alfalfa in 3 L
deionized water. After two days, 900 mg of a 1:1 mix of liver:brewer's yeast was added;
thereafter, in 2-3 day intervals until pupation, 900 mg of a 1:1:1 mix of liver: brewer's
yeast: hog chow was added. Pupae were picked daily, transferred to small cups, and held
for emergence in aluminum C-frame cages covered with tube gauze. Cotton balls
saturated with 10% aqueous solution of sucrose were added (Anthony et al. 1978).
Spores were harvested from adult mosquitoes 3-5 days post-emergence.
Spore Harvest and Purification
Last-instar H. zea larvae infected with V. necatrix were surface-sterilized in 70%
ethanol. Fat bodies were removed without lacerating gut tissues, placed into deionized
water, ground in a glass tissue grinder, and filtered through cotton. Adult H. zea moths
infected with N. algerae were rinsed in water and, after wing removal, triturated in a
Tekmar Tissumizer in deionized water. The resulting suspensions were filtered through a
cotton plug in a glass syringe. The crude V. necatrix and N. algerae spore preparations
were further purified by a deionized water wash and differential centrifugation on a
continuous Ludox gradient (Undeen and Alger 1971).
Adult infected mosquitoes were immobilized by chilling at -20C for about 3 min,
removed with an aspirator connected to a vacuum pump, and homogenized in a small
amount of deionized water in a Waring blender. The resulting suspension was strained
through a cotton plug in a syringe to remove large body parts. Further purification was
achieved by a deionized water wash and differential centrifugation on a continuous Ludox
gradient
Adult worker ants of £. richteri infected with Thelohania sp. were triturated in a
Tekmar Tissumizer in 'ant homogenizing buffer' (0.1% SDS, 10 mM Tris-HCl pH 7.5,

36
1 mM EDTA). The suspension was strained through cotton and centrifuged in deionized
water. The pellet was incubated for 10 min at 40C in 10 |!g/mL proteinase K and 1/4 vol
of interfacial envelope disruption buffer (4% SDS, 25 mM EDTA, 50 mM Tris-HCl pH
7.5), followed by differential centrifugation on a Ludox gradient. All spore preparations
were further cleaned by centrifugation on a 100% Percoll gradient, and repeatedly washed
in deionized water, prior to fatty acid analysis.
Fatty acid extraction and analysis
Spore preparations used for fatty acid analysis were examined with a phase
contrast compound microscope prior to extraction to check for bacterial contaminants.
Approximately lxl09 spores in aqueous suspension were pipetted into a 13x100 mm glass
test tube and stored overnight at 4C to allow the spores to settle. Prior to extraction,
spore samples of N. algerae from the two insect hosts were rinsed with 0.1% SDS to
remove externally attached host lipids. Analysis of the SDS rinsate indicated that no fatty
acids, from 9-20 carbons in length, were present. The next day, the supernatant was
withdrawn carefully and esterification of fatty acids was accomplished using the method of
Miller (1982). Approximately lxlO9 spores were pipetted into a 13x100 mm culture tube
and stored overnight at 4C to allow the spores to settle. The next day, the supernatant
was withdrawn carefully and 1 mL of 15% NaOH in 50% methanol was added. The tube
was capped, and fatty acids were saponified at 100C for 30 min. Upon cooling, 2 mL of
6 N HC1 in 50% MeOH were added, the tube was recapped and heated at 80C for 10 min
to methylate the fatty acids. Fatty acid methyl esters (FAME) were solvent-extracted
from the aqueous phase with 1.25 mL of hexane:methyl-tert-butyl ether (1:1; v/v). The
organic phase was washed with 3 mL of 1.2% aqueous NaOH and transferred to a gas
chromatograph (GC) vial. To determine the number of microsporidia required for fatty
acid analysis, a range of different numbers of spores (3.3xl08-2.1xl09) was extracted.

37
Although fewer numbers of spores could be extracted and derivatized, a sample size of
lxlO9 spores is recommended to provide sufficient area count
Fatty acid methyl ester extracts were analyzed by the Microbial ID System (MIDI)
(Sasser 1990b), which consists of a computer-linked Hewlett Packard 5890 gas-liquid
chromatograph fitted with an Ultra 2 fused silica capillary column (25 m x 0.2 mm i.d. x
0.33 pm film thickness; crosslinked 5% phenyl methyl silicone). Following a 1/100 split
injection of 2 pL at 250C, the oven temperature was increased 5C/min from 170C to a
final temperature of 270C; hydrogen was used as the carrier gas. After flame-ionization,
FAME peaks were quantified by a Hewlett Packard 3392 integrator and expressed as
percentages of the total FAME profiles. Data were stored in the MIDI computer for
subsequent comparison and statistical analyses. Prior to and between every ten-sample
analyses, a calibration standard mixture consisting of the 12 straight-chain carbon acids
from C9 to C20, plus five hydroxy acids, was injected. The resulting retention time and
quantitative data served as quality control indicators to ensure good column performance
and peak matching by the MIDI system. Periodically, Stenotrophomonas maltophilia. a
bacterium whose FAME profile is well characterized, was used as a positive control to
ensure reproducibility among different extraction batches.
Representative samples were further characterized by coupled GC-mass
spectrometry (GC-MS). Aliquots of the microsporidian FAME mixtures and two FAME
standards (MIDI Calibration Standard Mix from 9-20 C; Applied Science Division
Standard with saturated and unsaturated Cl8) were analyzed by a Perkin Elmer 8420 GC
interfaced with a Finnigan Ion Trap Detector (ITD, Model 6210), with INCOS data
collection software and a 80286 computer. The GC-MS was fitted with a 25 m x 0.25
mm i.d. DB-1 fused silica capillary column. The injection of 1 jiL was in a splitless mode,
followed with a purge flow of helium after 30 sec. The carrier gas was helium with a flow
rate of 25 cm/sec (Nation et al. 1992). The initial temperature of the column was 60C;

38
after sample injection, the temperature was programmed to 150C at 30C/min, then
raised to 220C at 5C/min and held for a total running time of 100 min.
Mass spectrometry and comparison of the resulting peaks to the MIDI calibration
standard mix and peak library were employed to confirm the identity of the major acids
detected in the microsporidia.
Data analysis
Fatty acid methyl esters of the samples were named by comparing their retention
times to those of the calibration standard (a mixture of straight-chain saturated fatty acids
from 9-20 carbons in length including 5 hydroxy acids). Retention time data from the
calibration mixture were converted to Equivalent Chain Length (ECL) data for fatty acid
naming. Thus, the ECL value for each compound to be analyzed was computed, and the
compounds were named based on comparisons to the standards as well as the ECL of
acids stored in the MIDI peak library (142 peaks total) (Sasser 1990b).
A library was created from the microsporidia FAME profiles, and relationships
among samples were analyzed with Principal Component Analysis. Measurements of
variability and clustering among the profiles were portrayed by plotting the percentages of
the three major fatty acids on a 3-D graph.
Statistical analysis of the fatty acid data was performed with an analysis of variance
(ANOVA) followed by a Tukeys mean separation test to compare the means of each fatty
acid among the microsporidian species tested (SAS Institute 1989).
Results
Three acids, palmitic (16:0), oleic (18:1 05 9 cis), and two closely-eluting peaks
denoted as Summed Feature 6 (18:2 03 6,9 cis/18:0 anteiso) comprise 60% or more of the
total FAME profiles of V. necatrix. N. algerae and Thelohania sp. FAME profiles were

39
qualitatively and quantitatively distinct for the three species. Myristic acid (14:0) and 20:1
03 9 cis were present at low levels in all of the N. algerae and Thelohania sp. samples.
However, these acids were not detected in V. necatrix (Table 3.1). Quantitative
differences include significantly lower levels of palmitic acid (16:0) in Thelohania sp. than
the other two species (p of myristic acid (14:0) and 20:1 03 9 cis in Thelohania sp. than N. algerae (p d.f. = 3,22; a= 0.05 ). Oleic acid (18:1 03 9 cis) was present at significantly higher
amounts in V. necatrix than in N. algerae (p Three fatty acids not present in the MIDI Microbial Identification System (MIS) peak
library index were found in several Thelohania sp. samples (Table 3.1). Similar instances
of unnamed fatty acids have also been reported in recent studies on vesicular-arbuscular
mycorrhizae (N.C. Hodge, personal communication). The three unnamed acids comprised
16.3 9.8% of the total FAME profiles in Thelohania sp. samples. The acids eluted from
the MIDI system's capillary column at 9.5, 11.9, and 12.5 minutes and had calculated
chain lengths of 15.6, 17.0, and 17.4 carbons, respectively. Structural determination of
the unnamed acids would be best confirmed using ancillary GC-mass spectrometry and
nuclear magnetic resonance techniques.
Host influence on FAME profiles of the spores was tested by producing N. algerae
in two different insects: the corn earworm, H. zea and mosquito, A. quadrimaculatus.
Three closely-eluting 18:1 cis-trans isomers, combined as Summed Feature 7 (18:1 G3 7
cis/18:l 03 9 trans/18:l 03 12 trans), and arachidonic acid (20:4 03 6,9,12,15 cis), were
detected in N. algerae isolated from mosquito at 6.3% and 4.1%, respectively (Table 3.1).
Neither acid, however, was present in N. algerae from com earworm. Furthermore, the
percentages of three other acids varied according to host.

Table 3.1. Fatty Acids (%) in Three Microsporidian Species from One Aquatic and Two Terrestrial Insect Hosts
Nosema algerae Vairimorpha necatrix Thelohania sp.
Fatty Acida
A. quadrimaculatus
n=7
H. zea
n=7
H. zea
n=5
S. richteri
n=7
14:0
2.8 0.2d
Be
2.2 0.1
C
0.0
D
4.7 0.2
A
16:1qj7Cs
11.4 0.8
A
2.0 0.1
c
1.4 0.2
C
4.2 0.7
B
16:0
34.5 0.6
A
34.1 0.5
A
31.2 1.5
A
22.7 1.0
B
Summed Feature 6b
13.4 0.8
B
25.4 0.8
A
28.4 2.2
A
17.4 1.3
B
18:1qj9Cs
16.5 0.3
C
20.5 1.8
BC
29.6 2.9
A
26.0 2.1
AB
c
Summed Feature 7
6.3 0.5
A
0.0
B
0.0
B
0.2 0.2
B
18:0
4.7 0.2
BC
9.4 0.2
A
6.5 0.9
B
4.1 0.6
C
20:4GJ6,9,12,15cis
4.1 0.3
A
0.0
B
0.0
B
2.7 0.6
A
20:l(jj9cis
1.8 0.4
BC
2.6 0.1
B
0.0
C
6.3 0.8
A
^Number of carbon atoms in fatty acid:number of double bonds per acid
Summed Feature 6 identified as 18:2(36,9^5/18:0 anteiso by the MIDI peak library
Q
Summed Feature 7 identified as 18:1 (¡jycis/^qtrans/^ j2trans by the MIDI peak library
^Standard errror of the mean
Arithmetic means in a row followed by a different letter are significantly different from each other

41
In N. algerae from com earworm, levels of 16:1 05 7 cis (palmitoleic acid), 18:2 05
6,9 cis/18:0 anteiso (Summed Feature 6), and 18:0 (stearic acid) were 2.0%, 25.4% and
9.4%, respectively. Percentages of those acids in N. algerae isolated from mosquito,
11.4%, 13.4%, and 4.7%, were significantly different (p 0.05).
Based on mass spectral information, the major FAMEs present in the
microsporidia tested (14:0, 16:0, 16:1 05 7 cis, 18:0, 18:1 05 9 cis, 18:2 05 6,9 cis) could be
confirmed. Chromatograms of the FAME standards and the microsporidia are presented
in Figures 3.1-3.3. The chromatograms were obtained from samples characterized by
coupled GC-MS. With this system, the C20 fatty acids could not be detected.
Principal Component Analysis of the three major acids was used to graphically
portray the clustering of the three species (Figure 3.4). Thelohania sp. was separated from
the other species because of its low percentage of 16:0. Nosema algerae and V. necatrix
both had larger percentages of 16:0, but V. necatrix also had a high percentage of 18:1 G5
9 cis, which distinguished it from N. algerae.
Host insect affected the clustering of N. algerae. Lower levels of Summed
Feature 6 were detected in N. algerae from mosquito than N. algerae from com earworm.
Variability in the FAME profiles of the individual samples was lowest in N. algerae from
mosquito (Table 3.1, Figure 3.4). Comparison of analyses of fresh and stored spore
samples (storage at 4C for 3 months, or -70C for 1 month, of N. algerae and Thelohania
sp., respectively) showed that storage did not alter the FAME profiles (data not shown).
Discussion
Fatty acid methyl ester profile analyses of microsporidia have not been reported
previously. The three microsporidian species analyzed in this study can be differentiated

42
C18:3
Retention Time (sec)
Figure 3.1. Gas chromatograms of FAME standards. Standards were analyzed
with a computer-linked Perkin Elmer 8420 GC interfaced with a Finnigan Ion Trap
Detector with INCOS data collection software.

43
Thelohania sp.
C16:0 C18:1
C16:0 C18:2 V. necatrix
Retention Time (sec)
Figure 3.2. FAME chromatograms of Thelohania sp. and V. necatrix. Fatty acids
were saponified, methylated, solvent-extracted, base-washed and analyzed by a computer-
linked Hewlett-Packard 5890 gas-liquid chromatograph and a computer-linked Perkin
Elmer 8420 GC interfaced with a Finnigan Ion Trap Detector with INCOS data collection
software.

44
C16:0
100
o'

m
a
a
m
V
o
g
2
C16:0
C16:l
C14:0
A. quadrimaculatus
C18:1
C 18:2
infill i
rrH-
C18:0
11A11
1000
2000
3000
4000
rft!
5000
6000
Retention Time (sec)
Figure 3.3. FAME chromatograms of N. algerae in two different insect hosts.
Fatty acids were saponified, methylated, solvent-extracted, base-washed and analyzed by a
computer-linked Hewlett-Packard 5890 gas-liquid chromatograph and a computer-linked
Perkin Elmer 8420 GC interfaced with a Finnigan Ion Trap Detector with INCOS data
collection software.

% 18:1
45
V. necatrix A N. algerae CEW N. algerae mos. #Thelohania sp.
Figure 3.4. Three major fatty acids of three species of microsporidia.
Measurements of variability and clustering among the profdes were portrayed by plotting
the percentages of the three major fatty acids on a 3-D graph. CEW = com earworm,
mos. = mosquito.

46
by a combination of qualitative and quantitative FAME profile characteristics
(Table 3.1, Figure 3.4). Three acids, palmitic (16:0), Summed Feature 6 (18:2 G5 6,9
cis/18:0 anteiso) and oleic (18:lC3 9 cis) were present in large percentages in all
microsporidian samples analyzed. Palmitic acid is ubiquitous; it is present in all organisms
(M. Sasser, personal communication). Oleic acid is present in many bacterial human
pathogens, phytopathogens, as well as vesicular-arbuscular mycorrhizae. Examples
include gram positive bacilli and mycobacteria (Welch 1991; Portaels et al. 1993), the
plant pathogens Erwinia amvlovora. E. carotovora. Burkholderia solanacearum (formerly
Pseudomonas solanacearum). and P. svringae (Sasser 1990a), and the mycorrhiza
Gigaspora rosea (Bentivenga and Morton 1995). A comprehensive list of fatty acids
characteristic of a wide variety of organisms has been published (Kerwin 1994).
Fluctuations in FAME profiles were especially evident in V. necatrix and the
Thelohania sp. For example, three unnamed fatty acids were detected in several, but not
all, Thelohania sp. samples. These acids could be typical of developing spores
(physiological age differences of spores), or representative of the organism. The
microsporidian life cycle has two distinct phases: merogony (or schizogony) and
sporogony. Vegetative stages called meronts (or schizonts) develop into sporonts, and
finally into mature spores (Sprague et al. 1992). Preliminary experiments indicated that
FAME profiles of immature spores were qualitatively and quantitatively different from
profiles of mature spores of the same species (data not shown). Density gradient
centrifugation of microsporidian spores may not always result in the complete separation
of immature and mature spores. Spore bands with predominantly mature spores may
therefore contain immature spores (and vice versa), rendering spore samples not
completely homogeneous, which may add variability to the FAME profiles.
A variety of environmental factors, including age, culture medium, pH, and growth
temperature have been shown to affect FAME profiles of bacteria (Lechevalier 1989;
Decallonne et al. 1991; Shimizu et al. 1991; Stead et al. 1992) and fungi (Marumo and

47
Aoki 1990; Van der Westhuizen et al. 1994). FAME profiles of other types of organisms
may also be influenced by environmental, physiological, and developmental changes; for
example, diet and development strongly influence profiles of insects (Stanley-Samuelson et
al. 1988). In bacteria, stability of the FA composition is achieved through growth under
standardized conditions in vitro. FA stability is optimal in bacteria growing at the late log
or early stationary growth phase (Sasser 1990b). Nosema algerae had a qualitatively and
quantitatively distinct profile, depending on the host (Table 3.1, Figure 3.1). Host
influence on FAME profiles of microsporidia may render fatty acid analysis unsuitable as a
tool for microsporidian identification unless culture conditions for all microsporidia can be
standardized (in vitro culture in either cell-free media or in cell lines). In vitro culture of
certain microsporidian species has been accomplished (Kurtti et al. 1994, Undeen 1975).
Conversely, spores of several species of glomalean fungi yielded reproducible
FAME profiles despite being grown in association with different host plants and with
contaminating microorganisms present (Graham et al. 1995). Glomalean endomycorrhizal
fungi are similar to many microsporidia in that they cannot be cultured without their hosts;
each form obligate symbiotic relationships with the roots of many plant species.
Taxonomy of glomalean fungi is currently based on spore morphology. This is similar to
microsporidia where assessment of diversity using only morphological characters is
difficult because of inadequately defined characters, and ambiguous distinction between
morphologically similar species (Morton and Benny 1990; Morton 1993). Molecular and
biochemical characters are needed to supplement the morphological data.
Host influence on the FAME profile of microsporidia is one problem that needs to
be solved by standardizing culture conditions. Another problem is the requirement of a
large number of spores for fatty acid extraction. The large sample size of roughly lxlO9
spores for fatty acid extraction makes FAME analysis not practical for many microsporidia
because of m vivo and in vitro culture limitations. However, Welch (1991) pointed out

48
that the fatty acid extraction process could be scaled down to accommodate for smaller
sample sizes.
More studies with additional microsporidian species from a variety of
environmental conditions (e.g. different animal host) are needed to determine fatty acids
characteristic for the microsporidia, and to assess qualitative and quantitative aspects of
FAME analysis as a discriminant tool in identification. Microsporidian culture conditions
should be standardized, and sample size requirements reduced. The compilation of
microsporidian FAME profiles will enable statistical comparisons, using the MIDI pattern
recognition software. By comparing profiles of well-characterized reference
microsporidia, the utility of FAME analysis as a taxonomic tool for the identification of
microsporidia could be evaluated.

CHAPTER IV
COMPARATIVE MOLECULAR CHARACTERIZATION OF MICROSPORIDIA
FROM SOUTH AMERICAN FIRE ANTS
Introduction
Literature Review
Molecular structures and sequences generally are better indicators of evolutionary
relationships than classical phenotypes. Thus, the basis for the definition of taxa has
progressively shifted from the organismal to the cellular to the molecular level (Woese et
al. 1990). Zuckerkandl and Pauling (1965) first discussed the role of informational
macromolecules, molecules that carry the genetic information or an extensive translation
thereof (DNA, RNA, proteins), as potentially the most informative taxonomic characters
and not just one type of characters among other, equivalent types. They viewed the
genetic information encoded in these molecules as documents of the evolutionary history
of organisms and proposed to use these molecules in creating a molecular phylogeny.
Microorganisms frequently lack distinctive morphological, developmental, and
nutritional characteristics that could be used in systematic analysis (Lane et al. 1985). It
was thus a group of bacteriologists, under the direction of C. Woese, who produced the
first comprehensive phylogeny of prokaryotes (indeed of life on earth) based on 16S
rRNA partial sequences (Woese et al. 1977; Fox et al. 1980). Their studies revealed that
instead of two major kingdoms -prokaryotes and eukaryotes-, living systems could be
divided into three major evolutionary lineages: archaebacteria, eubacteria, and eukaryotes.
49

50
Each of the primary kingdoms has its particular form of rRNA. Strong 16S rRNA
sequence signatures, i.e. positions in the molecule that have a highly conserved or
invariant composition in one kingdom, but a different (highly conserved) composition in
one or both of the others, define and distinguish the three urkingdoms (Woese 1987).
Analysis of the sequence of the small subunit rRNA gene of E. coli revealed that
'universally conserved' elements (short sequences that appear to be conserved in all
organisms) are distributed along the entire length of the E. coli 16S rDNA. Similar
sequence analyses of small subunit RNA genes from a diverse group of organisms
confirmed this observation and identified the existence of 'kingdom-specific' conserved
elements (sequences that are conserved only in the eubacteria, archaebacteria, or
eukaryotes, respectively) (Sogin and Gunderson 1987). There is a clear tendency for
universally conserved nucleotides to fall in unpaired regions of the rDNA. (Gutell et al.
1985).
Increasingly, systematics of organisms is based on sequences, structures, and
relationships of molecules, with phenotypic and biochemical properties being used to
support these findings (Sogin and Gunderson 1987; Woese et al. 1990). For largely
historical and practical reasons, most systematic research has focused on a small subset of
genes, especially nuclear rRNA and mitochondrial rRNA and protein-encoding genes.
RNA sequencing was feasible before DNA sequencing. Mitochondrial DNA occurs in
multiple copies in the cell and is relatively easy to manipulate (Brower and de Salle 1994).
Apart from historical and practical considerations, ribosomal genes are particularly well
suited for defining evolutionary and systematic relationships because they are universally
distributed and functionally homologous in all known organisms ( Olsen et al. 1986; Hillis
and Dixon 1991). Generally, there are three rRNAs in prokaryotes and four nuclear
rRNAs in eukaryotes. The RNAs of bacteria are 5S (~ 120 nucleotides), 16S (~ 1500
nucleotides), and 23S (~ 2900 nucleotides). The nuclear RNAs of eukaryotes are 5S,
5.8S (~ 160 nucleotides), 18S (~ 1800 nucleotides), and 28S (> 4000 nucleotides) (Hillis

51
and Dixon 1991). Mitochondria and chloroplasts code for their own rRNAs ranging from
12S to 21S in mitochondria and 5S to 23S in chloroplasts.
The larger rRNAs can be used over a wide range of phylogenetic distances, from
the full span of the universal tree to distinction among species within the same genus. This
is due to the fact that ribosomal sequences have both highly conserved and variable
regions (Olsen and Woese 1993). Different regions of the rDNA repeat unit evolve at
very different rates. The most studied rRNA is the small subunit nuclear gene, 16S/18S
rRNA. It has been studied most extensively because of its size and because regions of it
are among the slowest evolving sequences found throughout living organisms. The slow
rate of change permits the construction of many nearly universal primers. The large
subunit (23S/28S) nuclear rRNA gene is larger and shows more variation in rates of
evolution of its different domains than does the small subunit. The 5.8S and 5S genes are
also conserved, but the shortness of the sequence greatly restricts phylogenetic usefulness.
Furthermore, the larger rRNAs provide sufficient sequence information to permit
statistically significant comparisons (Olsen et al. 1986).
Typically, several hundred tandemly repeated copies of rRNA genes (rDNAs)
exist in a eukaryote nuclear genome. A transcription unit consists of a linear arrangement
of three genes (coding for 18S, 5.8S, and 28S rRNA) which are separated by two internal
transcribed spacers. An external transcribed spacer is located upstream of the 18S gene.
The transcribed spacers contain signals for processing the rRNA transcripts. Adjacent
copies of the rDNA repeat units are separated by nontranscribed spacers. In prokaryotes
there are one to several copies of the rRNA genes, and the genes may be organized into a
single operon (in which they are usually separated by the tRNA gene), or they may be
dispersed throughout the genome. The gene for the 5S rRNA is closely associated with
the other rRNA genes in many prokaryotes but is found elsewhere in the nuclear genome
of most eukaryotes (Hillis and Dixon 1991).

52
The multiple copies of nuclear rRNA genes do not evolve independently but in
concert (Amheim 1983). In other words, each copy of an rRNA array is usually very
similar to the other copies within individuals and species, although differences among
species accumulate rapidly in parts of the array. The differences among arrays within
individuals are mostly length variation in the nontranscribed spacer. The low level of
heterogeneity at about 0.1% of the nucleotide positions (Mylvaganam and Dennis 1992)
among rDNA within individuals (and throughout species) indicates that the multiple copies
are homogenized (concerted evolution). The number of rDNA repeats, though, is known
to vary widely among individuals within species that have been studied (Hillis and Dixon
1991). Exceptions to concerted evolution have been reported. For example, in the
archaebacterium Haloarcula marismortui which has two nonadjacent rRNA operons, the
16S rRNA genes within the two operons differ in about 5% of the nucleotide sequence
(Mylvaganam and Dennis 1992). The number of rRNA genes varies from seven in E. coli.
to between 100 and 200 in lower eukaryotes, to several hundred in higher eukaryotes.
Estimates of copies of the 18S-28S gene for different organisms include, for example,
150-250 in Drosophila melanogaster. 200-280 in humans, 100-140 in Saccharomvces
cerevisiae. and 450 in Xenopus laevis (Lewin 1994; Gerbi 1985).
The mitochondrial rRNA genes develop much more rapidly than the nuclear rRNA
genes. The spacer regions of rDNA arrays have been used less frequently for phylogenetic
studies; variation in spacer regions has been used to identify species or strains, to study
hybridization, and as markers in population genetics studies (Hillis and Dixon 1991).
Microsporidia are peculiar eukaryotes that lack mitochondria, peroxisomes and a
'typical' Golgi apparatus (Canning 1988). They have ribosomes with prokaryotic
properties. Ishihara and Hayashi (1968) determined that ribosomes of Nosema bombycis
have a sedimentation coefficient of 70S like bacteria and blue-green algae and not of 80S
like the eukaryotes. The ribosomal subunits have sedimentation coefficients of 50S and
30S (typical of prokaryotes), and not of 40S and 60S (typical of eukaryotes). The small

53
and large ribosomal subunits in turn, as determined for Thelohania maenadis and
Inodosporus sp., contain 16S and 23S RNA like prokaryotes and not 18S and 28S RNA
like eukaryotes (Curgy et al. 1980).
Furthermore, as shown by Vossbrinck and Woese (1986), the microsporidium
Vairimorpha necatrix does not have a 5.8S rRNA. The 5.8S rRNA is a nearly universal
eukaryotic characteristic. It has no size counterpart among prokaryotes although its
sequence is homologous with the first 150 or so 5 nucleotides of the prokaryotic 23S
rRNA. As in prokaryotes, V. necatrix has a large subunit rRNA (23S) whose 5 region
corresponds to the 5.8S rRNA. Because of the unusual molecular and cytological
characteristics of microsporidia, Vossbrinck et al. (1987) sequenced the 16S rRNA of V.
necatrix to clarify the phylogenetic position of microsporidia. The V. necatrix 16S rRNA
sequence is far shorter than a typical eukaryotic (18 S) small subunit rRNA and, at only
1,244 nucleotides, even appreciably shorter than its prokaryotic (16S) counterpart (E. coli
small subunit rRNA is about 1,500 nucleotides long). They found little overall homology
between V. necatrix 16S rRNA sequence and those of other eukaryotes and concluded
that the lineage leading to microsporidia branches very early from that leading to other
eukaryotes. It is hypothesized that some of the organisms unique features may signify a
split from other eukaryotes very early in time. Kawakami et al. (1992) made yet another
unusual observation: Analysis of primary and secondary structure of the 5S rRNA and
rDNA of N. bombvcis reveals a typical eukaryotic structure.
The objective of this study was to evaluate the taxonomic relationship of
Vairimorpha sp., Thelohania sp., and T. solenopsae to each other based on their 16S
rRNA gene sequences. The 16S rRNA genes (nuclear) of T. solenopsae. Thelohania sp.,
and Vairimorpha sp. were amplified by PCR, analyzed with restriction fragment length
polymorphism (RFLP), and sequenced to gain information on the characteristics of these
genes. The molecular data were used as information to evaluate the taxonomic position of
the species studied. In addition, the 16S rRNA gene of Agmasoma penaei (Overstreet

54
1973) was amplified and sequenced. We wanted to have a 16S rRNA gene sequence of
another Thelohania species to compare to the fire ant Thelohania species. The type
species of the genus Thelohania is T. giardi which is found in decapods. It was described
at the end of the last century (Sprague et al. 1992), and no further studies have been done
with it since. Neither samples of T. giardi nor any 16S rRNA gene sequences of other
Thelohania species are available to compare to those of the fire ant Thelohania species.
Assuming that A. penad, formerly called T. penad, is closely related to the type species of
the genus Thelohania. T. giardi. we chose A. penaei as a species to compare to the two
Thelohania species. Both species have octosporous sporulating sequences and infect
shrimp. Agmasoma penaei was moved from the genus Thelohania to its own genus,
Agmasoma. because its polar filament is anisofilar (Hazard and Oldacre 1975).
Materials and Methods
Collection of Test Organisms
Thelohania sp., Vairimorpha sp., and T. solenopsae were collected from £. richteri
and S. invicta respectively (chapter II). Thelohania penaei. now named A. penaei. was
collected and stored in water at 4C by R. M. Overstreet from an overwintering white
shrimp, Penaeus setiferus. in a laboratory mud-substratum pond in Ocean Spring,
Mississippi, on 4-12-1991.
Spore Harvest and Purification
Vairimorpha sp. spores were purified from S. richteri adults that died during the
trip from Buenos Aires to Gainesville immediately upon arrival at Gainesville. The ants
were ground in homogenizing buffer (10 mM Tris-HCl pH 7.5,1 mM ethylenediamine-
tetraacetate (EDTA), 0.1% SDS) in a Tekmar tissuemizer and filtered through cotton to

55
remove large body parts. The resulting crude spore suspension was further purified by
differential centrifugation on a continuous Ludox (DuPont) gradient (Undeen and Alger
1971). The spores were stored at 4C in Tris-EDTA (TE), pH 8.0 or distilled water until
DNA was extracted.
To collect Thelohania sp. spores from S. richteri and T. solenopsae spores from
S. invicta, fat body cysts were dissected out of the abdomens of 25-30 infected adult
workers which had been frozen at -70C, and collected on ice in 0.1% SDS in 1.5 mL
microfuge tubes. The spores were washed twice by centrifugation in deionized water,
counted with a hemocytometer and stored in deionized water at 4C until DNA was
extracted. The infection level with V. invicta was so low that spores could not be purified
and used in the analysis. Samples of T. penaei were obtained as an aqueous suspension
from R. M. Overstreet.
DNA Extraction From Microsporidia
A DNA extraction procedure suggested by M. D. Baker and C. R. Vossbrinck
(University of Illinois, Urbana, IL; personal communication) was employed. A range of
spores (1x10s 1x10s) was pelleted in 0.5 mL microfuge tubes by centrifugation at 10,000
g for 1 min and resuspended in 200 pL of sodium chloride/Tris/EDTA (STE) buffer (100
mM NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA). Approximately 200 pL 0.1 mm
diameter siliconized glass beads was added to the spore suspension, and the mix was
shaken in a mini beadbeater (Biospec) at low speed for 20 sec to break the spores and
release their genomic DNA. Immediately after breaking the spores, the homogenate was
heated at 95C for 5 min to inactivate DNA degrading enzymes and centrifuged for 5 min
at 10,000 g. The supernatant was removed, frozen solid, thawed and centrifuged again at
10,000 g for 5 min. The supernatant containing the DNA was used for PCR immediately
or stored at -20C for later PCR analysis.

56
PCR Of Microsporidian DNA
The 16S rRNA gene segment was amplified from the microsporidia genomic DNA
by PCR using primers designed from the 5 and 3 regions. The DNA sequences for the
forward and reverse primers were kindly provided by C. R Vossbrinck and M. D. Baker
(personal communication). Restriction sites were incorporated into the sequences at the
5 ends to allow subsequent cloning of the PCR product The forward primer 18f had a
different restriction site sequence incorporated at the 5 end depending on whether
Thelohania sp., T. solenopsae. and A. penaei or Vairimoipha sp. DNA was amplified. The
forward primer JM27/18f (5 -TTTGAATTCCACCAGGTTGATTCTGCC-3 ) was
designed to contain an EcoBl site (GAATTC). Another forward primer, RP6/18f
(5-AAGGTACCAGGTTGATTCTGCCTGACG-3) was designed to contain a Kpnl site
(GGTACC). JM27/18f was used for Thelohania sp., T. solenopsae. and A. penaei DNA
amplification. RP6/18f was used to amplify Vairimorpha sp. DNA. The reverse primer
1492r (5-TTTGGATCCGGTTACCTTGTTACGACTT-3) was the same for all
amplifications, and it was designed to contain a BamHl site (GGATCC). Primers 18f and
1492r can be used to amplify the 16S rRNA gene of most microsporidia. Primer 18f
(5-CACCAGGTTGATTCTGCC-3) is located on nucleotides 1-18, primer 1492r
(5-GGTTACCTTGTTACGACTT-3) on nucleotides 1117-1098 on the V. necatrix 16S
rDNA sequence. The sequence 5-CAGGTTGATTCTGCC-3 of the 18f primer
mismatches in two positions with a homologous sequence of primer 18e
(5-CTGGTTGATCCTGCCAGT-3) that can be used to amplify the 18S rRNA gene of
many eukaryotes (Sogin and Gunderson 1987; Hillis and Dixon 1991) and prokaryotes
(Elwoodetal. 1985). The sequence 5-GGTTACCTTGTTACGACTT-3of primer
1492r is 100% homologous to Escherichia coli 16S rDNA.
PCR amplification was optimized for each new DNA template by testing 1, 5, and
10 pL (10 pL had less than 10 ng of DNA; determined by gel electrophoresis) of the

57
crude DNA preparation with two MgCk concentrations (1.5 mM and 2.5 mM) and two
primer concentrations (4 and 8 pM) in 25 pL reaction volumes. Based on the
optimizations, standard conditions for PCR were as follows: Each 50 pL reaction
contained 1 pL of microsporidia genomic DNA ( 10 ng), 4 pM of each primer (forward
and reverse), 0.2 mM of each dNTP (Boehringer Mannheim), DNA polymerase and the
appropriate buffer. Either 1.6 U of Taq DNA polymerase (Boehringer Mannheim) or 0.6
U of Primezyme DNA polymerase (Biometra) were used. The Taq DNA polymerase lx
reaction buffer contained 10 mM Tris-HCl, 50 mM KC1, and 2.5 mM MgCU. The
Primezyme DNA polymerase lx reaction buffer contained 10 mM Tris-HCl,
50 mM KC1, 0.1% Triton X-100, and 2.5 mM MgCl2. The reactions were overlaid with
either 100 pL sterile glycerol or 50 pL Chill-out 14 Liquid Wax (MJ Research). The
reactions were carried out in an MJ Research thermocycler using the temperature profile:
94C for 5 min, then 94C for 1 min, 52C for 1 min, and 72C for 1 min for 35 cycles. A
final extension step of 72C for 15 min was done after 35 cycles. A 5 pL aliquot from
each reaction together with 5 pL of lx loading dye (5% glycerol, 5 mM EDTA, 0.05%
bromphenol blue) was electrophoresed on a 0.8% Seakem LE agarose gel in Tris-acetate
buffer (TAE; 40 mM Tris-acetate, 1 mM EDTA, pH 8.0). Ethidium bromide (EtBr) at a
concentration of 0.25 pg/mL was incorporated into the gel and electrophoresis buffer to
stain and visualize the DNA by UV transillumination. PCR products from three reactions
were pooled and purified with the QIAquick PCR Purification Kit (QIAGEN) by
following the manufacturers instructions, eluted in sterile, distilled water or TE pH 8.0
(10 mM Tris, 4 mM EDTA) and stored at -20C. For cloning and restriction digests,
elution in TE buffer, pH 8.0, was suitable. The DNA concentration of the purified PCR
product was determined by electrophoresing an aliquot with a standard of lambda (X)
bacteriophage DNA cut with Hindlll (k/HindUl cut DNA) and comparing the intensity of
the ethidium bromide stained bands to each other.

58
Cloning of the 16S rRNA Gene
PCR products of Thelohania sp., Vairimorpha sp. and T. solenopsae were cloned
into the plasmid pTZ 19R vector (Pharmacia) by transforming E. coU JM109 cells using
the following protocol.
Pretreatment of PCR Product: The PCR products were digested with Proteinase
K (50 pg/mL) in 10 mM Tris-HCl, 5 mM EDTA, and 0.5% SDS to remove the Taq DNA
polymerase bound to the DNA (Crowe et al. 1991). The Proteinase K digestion was
carried out at 37C for 30 min and then treated at 80C for 10 min to heat inactivate the
enzyme. The Proteinase K treated PCR product was cleaned using the QIAquick PCR
Purification Kit (QLAGEN). To check the recovery rate, a 2 pL aliquot was fractionated
on a gel and the concentration estimated by comparing it with a known amount of
X/Hindlll cut DNA as described earlier.
Restriction Enzyme Digest: Thelohania sp. and T. solenopsae PCR products were
double digested with EcoRI and BamHI (New England Biolabs) to create sticky ends for
cloning. For the digest, 48 pL of amplified DNA (or 2-3 pg), 1 pL of each enzyme
(20 U/pL), and 5.5 pL of the appropriate lOx restriction buffer (manufacturers
instructions) were mixed and incubated at 37C for 4 h. Simultaneously, the plasmid
DNA, pTZ 19R (1 pg/10 pL) was double digested to create compatible sticky ends.
Vairimorpha sp. PCR products were digested sequentially with Kpnl and BamHI (New
England Biolabs) to create sticky ends using the appropriate buffers according to the
manufacturers instructions. For the restriction digest, 48 pL of amplified DNA, 1 pL of
Kpnl (15 U/pL), 0.5 pL bovine serum albumine (BSA), and 5 pL of lOx restriction buffer
were incubated at 37C for 2 h. The enzyme was heat-inactivated at 70C for 10 min,
followed by the addition of 1 pL of BamHI (20 U/pL), 5 pL of lOx restriction buffer and
incubation for another 2 h at 37C. Plasmid pTZ 19R DNA was digested with Kpnl and
BamHI at the same time to create compatible sticky ends. Digested PCR products were

59
purified using the QIAquick PCR Purification Kit as described earlier and eluted in 50 pL
sterile, distilled water.
The plasmid DNA was purified from SeaPlaque agarose. The digested plasmid
DNA was loaded onto a 0.8% SeaPlaque agarose gel and electrophoresed to separate the
3 kb plasmid fragment from the 1.3 kb insert. The fragment was cut out, melted at 68C
for 30 min and diluted with agarose diluent (200 mM NaCl, 20 mM Tris-HCl, pH 8.0,
2 mM EDTA) to at least 0.3% agarose concentration (Maruniak et al. 1984). The DNA
was then phenol and ether extracted (3x each) and ethanol precipitated (1/2 vol of 7.5 M
ammonium acetate and 2 vol of 100% EtOH, incubation on ice for 10 min, centrifugation
at 10,000 g for 10 min, wash with 70% EtOH, vacuum dry). The resulting pellet was
dissolved in 20 pL of distilled water.
Ligation: A 1:3 ratio in moles of vector:PCR product DNA was used (Bethesda
Research Laboratories 1979). Specifically, 200 ng of pTZ 19R DNA and 250 ng of PCR
product DNA were ligated to each other in a 40 pL reaction with 1 pL T4 DNA ligase
(1 U/pL) and 4 pL lOx reaction buffer (New England Biolabs) at room temperature
overnight in the dark (modified from manufacturers protocol).
Transformation of E. coli JM109 Competent Cells: To inactivate the T4 DNA
ligase and enhance transformation, the ligation mix was heat-treated at 65C for 10 min.
A 50 pL aliquot of E. coli JM109 competent cells was thawed on ice, and 1 or 5 pL
aliquots of ligated DNA were gently mixed with the cells. The cells were sequentially
incubated on ice for 30 min, heat shocked at 37C for 30 sec, and cooled on ice for 2 min.
Then, 0.95 mL of room-temperature superoptimal catabolite (S.O.C.; BRL personal
communication) media was added, and the cells were grown at 37C and 225 rpm for 1 h.
A 100 pL aliquot was plated on Luria-Bertani (LB) agar media supplemented with 5-
Bromo-4-chloro-3-indolyl-|3-D-galactoside (X-Gal; 20 pg/mL) and ampicillin
(100 pg/mL) and incubated for 16 h at 37C. Ampicillin-resistant clear colonies were

60
selected as potential clones and picked off the plates for further analysis (Bethesda
Research Laboratories Life Technologies, Inc. transformation protocol).
Dot Blot to Confirm Clones: All clear colonies that grew on the X-Gal and
ampicillin enriched LB plate were streaked in a grid pattern on a fresh LB plate
supplemented with 100 pg/mL ampicillin and incubated over night at 37C for 16 h to
develop E. coli transformant colonies. For hybridization, a nylon membrane (Zeta Probe)
was cut (10 cm x 15 cm) and dots, 1 cm apart from each other, were marked on it with a
soft pencil. A tooth-pick head full of each numbered E. coh transformant colony was
suspended in 10 pL LB broth and 1 pL of that suspension spotted on a marked area. To
denature the bacterial DNA, the membrane was sequentially immersed in 0.5 M NaOH/
1.5 M NaCl for 30 sec, 0.5 M Tris-HCl pH 8.0/1.5 M NaCl for 5 min, and 6x standard
saline citrate (SSC) for 5 min. The membrane was wrapped in Whatman Blot paper and
baked at 80C for 2 h. Prehybridization, hybridization, and washes were done in a Mini
Hybridization Oven OV3 (Biometra). The membrane was prehybridized for 4-6 h at 68C
in 6x SSC, 0.5% SDS, 5x Denhardts solution, 0.01 M EDTA, and 100 pg/mL denatured
herring sperm DNA (Sambrook et al. 1989). To make the probe, 1 pg PCR product was
labelled with 32P-dATP using a nick translation kit (USB Nick Translation Protocol). The
membrane was hybridized for 16 h at 68C in hybridization buffer (6x SSC, 0.5% SDS, 5x
Denhardts solution, 0.01 M EDTA) containing the nick translated PCR-amplified 16S
rRNA gene of the microsporidian species to be tested. The membrane was washed twice
in 2x SSC and 0.5% SDS at 68C for 2 h each and heat-sealed in a plastic bag. It was
exposed to an x-ray film overnight at -70C.
Glycerol Stock from Positive Clones: The clones that showed strong hybridization
to the probe (positive clones) were picked from the LB plate and grown in 3 mL terrific
broth (TB) containing 35 pg/mL ampicillin overnight at 37C and 225 ipm. The next day,
850 pL of the cell suspension was added to 150 pL of sterile glycerol to make a 15%
glycerol stock and stored at -70C. To grow up glycerol stocks for plasmid purification,

61
10 (iL of glycerol stock was added to 3 mL TB containing 35 pg/mL ampicillin and grown
overnight at 37C and 225 rpm.
Plasmid DNA Purification: The alkaline lysis method combined with DNA
precipitation by polyethylene glycol (PEG) was used to purify the plasmid DNA carrying
the cloned DNA from E. coU transformants (Nicoletti and Condorelli 1993). E. coli
transformant cells were suspended in 200 pL glucose/Tris/EDTA (GTE) buffer (50 mM
Glucose, 25 mM Tris pH 8.0,10 mM EDTA pH 8.0) and lysed with 300 pL of 0.2 N
NaOH/1% SDS for 5 min on ice. Chromosomal DNA was precipitated with 300 |lL of
3.0 M potassium acetate (KOAc), pH 4.8 for 5 min on ice. After centrifugation, the
supernatant was collected and treated with RNAse A (20 |lg/mL) for 20 min at 37C.
After two chloroform extractions to remove proteins and residual chromosomal DNA, the
plasmid DNA was ethanol and PEG precipitated (PEG precipitation: dissolve DNA pellet
in 32 (iL distilled H20, add 8 pL 4 M NaCl and mix, add 40 pL 13% PEGgooo, incubate on
ice for 1 h, centrifuge at 4C and 10,000 g for 15 min.) The resulting DNA pellet was
resuspended in sterile distilled water. To confirm the presence of the 16S rRNA gene
insert, the hybrid plasmid was digested with the appropriate restriction enzymes, and the
size of the insert was compared to the purified PCR product and linearized PTZ 19R
plasmid DNA by separating on a gel.
Restriction Fragment Length Polymorphisms of the 16S rDNA
Several enzymes were tested on Thelohania sp., T. solenopsae. and
Vairimorpha sp.: Sau3A (4U/pL), Hhal (20U/pL), HaeIII (8U/pL), Acil (5U/pL), and a
double-digest of Hindi (8U/pL) and Hindlll (20U/pL) (New England Biolabs). Digests
were performed in 20 pL volumes using 12 pL of PCR product (~ 700 ng), 0.5 pL of
each enzyme, 2 pL of the specific lOx restriction buffer (manufacturers instructions), and
5.5 pL of deionized H20. The reaction mixes were incubated at 37C for 2 h. The

62
restricted DNA samples were electrophoresed with 2 pL of lOx loading dye (50%
glycerol, 50 mM EDTA, 0.5% bromphenol blue) on a 3% Nusieve GTG/1% Seakem LE
agarose gel.
Sequencing of the 16S rDNA
Purified PCR products of Thelohania sp. Vairimoipha sp., and A. penaei. eluted in
sterile, distilled water, were used as sequencing templates. The sequence of the PCR
products was completed by redundant sequencing of both strands. Hybrid plasmid DNA,
carrying the cloned T. solenopsae rDNA, in sterile, distilled water was used for
sequencing. The consensus sequence was obtained by redundant sequencing of both
strands of three clones.
Sequencing was completed by using three primers in each direction. The
sequences of the primers are listed in Table 4.1. Sequences for RP7/530f, RP9/1061f,
RP8/1047r, and RP10/530r primers were obtained from C. R. Vossbrinck and M. D.
Baker (personal communication).
The following primers were used for Thelohania sp.: JM27/18f, RP7/530f,
RP9/1061f, RP4/1492r, RP8/1047r, and RP10/530r. The primers used to sequence
J. solenopsae were M13f, RP7/530f, RP12f, M13r, RP8/1047r, and RP10/530r. Primers
used to sequence the Vairimorpha 16S rRNA gene were identical to the ones used for
Thelohania sp., except that RP6/18f was used instead of JM27/18f. Primer RP9/1061f
was replaced with RPllf to sequence the A. penaei 16S rRNA gene, and all the other
primers were the same as in Thelohania sp.
Both manual and automated DNA sequencing methods were employed. Manual
cycle sequencing was performed by the dideoxynucleotide chain termination sequencing
method (Sanger et al. 1977) using the fmol sequencing kit (Promega). For each set of
sequencing reactions, 2 (iL of each d/ddNTP mix (either d/ddATP, d/ddTTP, d/ddCTP or

63
d/ddGTP) were pipetted into a 0.5 mL microfuge tubes. Then 500 fmol of template DNA
(either plasmid template or PCR product), 4 pmol of primer, 6 qCi [a-35S]dATP, 5 |i.L of
fmolR 5x sequencing buffer (250 mM Tris-HCl, pH 9.0, 10 mM MgCL), and sterile
distilled water were combined to a final volume of 16 (iL, and 1 (iL of sequencing grade
Taq DNA polymerase (5U/|iL) was added to the primer/template mix. Four p.L of the
enzyme/primer/template mix were added to each d/ddNTP mix. The reactions were
overlaid with 20 pL of Chill-out 14 Liquid Wax (MJ Research), placed in a MJ thermal
cycler preheated to 94C, and subjected to the following temperature profile: 94C for
2 min, then 94C for 30 sec, 42C for 30 sec, 70C for 1 min (30 cycles). They were
Table 4.1. List of Sequencing Primers Used
Forward Primer
Nucleotide Sequence of Primer (5-3)
JM27/18f
TTT GAA TTC CAC CAG GTT GAT TCT GCC
RP6/18
AAG GTA CAA GGT TGA TTC TGC CTG ACG
RP7/530f
GTG CCA GC(AC) GCC GCG G
RP9/1061f
GGT GGT GCA TGG CCG
RPllf
GGT CGT TGT AAA CTC
RP12f
GGA GTG GAT TAT ACG G
M13f (-20)
GTA AAA CGA CGG CCA GT
Reverse Primer
RP4/1492r
TTT GGA TCC GGT TAC CTT GTT ACG ACT T
RP8/1047r
AAC GGC CAT GCA CCA C
RP10/530r
CCG CGG C(GT)G CTG GCA C
M13r (-24)
AAC AGC TAT GAC CAT G

64
cooled to 4C until the sequencing reactions were stopped by addition of 3 flL of fmolR
sequencing stop solution (10 mM NaOH, 95% formamide, 0.05% bromphenol blue,
0.05% xylene cyanole) to each tube.
Immediately before loading the reactions on a sequencing gel, they were heated at
70C for 2 min. The products (3.5 (J.L per lane) were run on a 8%, 19:1 acrylamide:
bisacrylamide gel at 1800 V. After fixing (30 min in a solution of 5% acetic acid and 15%
EtOH) and drying in a gel dryer on Whatman 3MM paper (1 h at 80C), the gel was
exposed to Kodak diagnostic x-ray film at -70C (United States Biochemical Sequencing
Support Service; DNA Sequencing Guide).
Automated sequencing was done by the DNA Sequencing Core Laboratory of the
University of Floridas Interdisciplinary Center for Biotechnology Research. Sequencing
was accomplished by employing the Taq DyeDeoxy Terminator (part number 401388)
Cycle Sequencing protocol developed by Applied Biosystems (a division of Perkin-Elmer
Corp., Foster City, CA) using fluorescent-labeled dideoxynucleotides. The labeled
extension products were analyzed on an Applied Biosystems Model 373A DNA
Sequencer.
Sequence Data Analysis
Analysis of the 16S rRNA gene sequences was done using the Genetics Computer
Group (GCG) Sequence Analysis Software Package (Devereux et al. 1987) and
Phylogenetic Analysis Using Parsimony (PAUP) version 3.1.1 (Swofford 1993). To
confirm the RFLP digests, enzyme restriction maps with the enzymes tested in the RFLP
digests were created for each of the three fire ant microsporidia with MAP.
Ribosomal gene sequences of microsporidia from a variety of host organisms
including insects (Hymenoptera, Lepidoptera), fish and humans and the protozooan
Giardia lamblia, used as outgroup, were obtained from GenBank (G. lamblia. Sogin et al.

65
1989; Ameson michaelis. Zhu et al. 1993; Endoreticulatus schubergi.
Ichthyosporidium sp., Nosema bombycis. Encephalitozoon hellem Baker et al. 1995;
Pleistophora sp., Glugea atherinae. N. comeum. DaSilva et al. unpublished, direct
submission 1994; Encephalitozoon cuniculi. Zhu et al. 1993; Enterocvtozoon bieneusi.
Zhu et al. 1993; Sep tata intestinalis. Visvesvara et al. 1995; N. apis. Malone et al. 1994;
N. trichoplusiae. Pieniazek et al. unpublished, direct submission 1994; N. vespula. Ninham
unpublished, direct submission 1994; V. necatrix. Vossbrinck et al. 1987). Giardia lamblia
was chosen as an outgroup because, like microsporidia, it is a primitive eukaryote with a
16S like rRNA. It has two nuclei and lacks mitochondria, a normal endoplasmatic
reticulum or Golgi. In a multikingdom tree based on rDNA sequences, G- lamblia
represents the earliest diverging lineage in the eukaryotic line of descent Its branching is
followed by V. necatrix (Sogin et al. 1989).
A multiple sequence alignment of those sequences together with the sequences of
Vairimorpha sp., Thelohania sp., T. solenopsae. and A. penaei was performed with the
programs PileUp and Clustal (Genetics Computer Group, Inc., Madison, Wisconsin). The
multiple sequence alignment file was analyzed with PAUP. A distance matrix was created,
and the heuristic option of PAUP was used to find the optimal phylogenetic tree. A
phylogenetic tree illustrates the evolutionary relationships among a group of organisms (Li
and Graur 1991). A bootstrap analysis was performed to place confidence estimates on
the groups contained in the optimal tree.
A distance matrix shows a pairwise comparison of all the taxa. Absolute distances
could also be called absolute differences and are shown in the lower triangle of the table.
Absolute distances give the numbers of nucleotides that differ between two sequences.
However, a change from one state (i.e. nucleotide) to another at a particular position is
counted only if that position is not missing for either of the taxa. Mean distances (given in
upper triangle) are calculated by dividing the absolute distance by the total number of
characters that are not missing for either taxon and thus represent the percent nucleotide

66
difference between two taxa. Mean distances are more meaningful when some tax a have
much higher proportions of missing data than others (PAUP 3.1 Users manual).
The phylogenetic tree was constructed based on the principle of maximum
parsimony or minimal evolution. Maximum parsimony involves the identification of a tree
that requires the smallest numbers of evolutionary changes to explain the differences
observed among the taxa under study (Li and Graur 1991). In molecular phylogeny the
maximum parsimony method should be called a character-state method (Li and Graur
1991) because character states are used and the shortest pathway leading to these
character states is chosen as the phylogenetic tree. The heuristic option is a search using a
heuristic or approximate algorithm. It was chosen because the microsporidian data set
was fairly large (20 taxa) and the heuristic search generally provides the fastest way to find
optimal trees.
Results
Spore Harvest
Dissection of 25-30 infected adult ants yielded about Ixl07-lxl08 spores which
amounts to approximately 3xl05-3xl06 spores per ant. When cysts were collected in
deionized water they stuck to the side of the plastic tubes which the addition of SDS
prevented.
PCR of Microsporidian DNA
It was found, that with each template tested, all three DNA concentrations (1, 5,
and 10 pL of crude DNA preparation with a concentration of less than 10 ng in 10 pL)
were amplified and that the 4 pM primer concentration worked as well as the 8 pM primer

67
concentration. The MgC^ concentration was the crucial factor; 2.5 mM MgC^ gave more
consistent amplification results than 1.5 mM.
For DNA extraction and PCR, Ixl07-lxl08 spores were sufficient. If DNA
extraction and PCR were performed with 1x10s or lxlO6 spores (using the same
procedures as for the larger spore samples), no PCR product was obtained. A size
difference existed between the amplified DNA fragments from Thelohania sp. and
T. solenopsae (~ 1400 bp) to Vairimorpha sp. and A. penaei (~ 1300 bp) (Figure 4.1).
Cloning of the 16S rRNA Gene
Figure 4.2 presents a sketch on how the PCR products of T. solenopsae and
Thelohania sp. were cloned into the pTZ 19R plasmid DNA. The cloned construct of
Vairimorpha sp. was similar except that Kpnl was used instead of EcoRl to create sticky
ends of the plasmid and PCR product DNA. The cloning procedure did not result in any
clones if the PCR products were not pretreated with Proteinase K (results not shown).
Proteinase K treatment was necessary to improve cloning efficiency.
Restriction Fragment Length Polymorphism of the 16S rDNA
Figure 4.3 shows three restriction cuts (Sau3A, Hhal and HaellT) for
Thelohania sp., T. solenopsae. and Vairimorpha sp. The restriction patterns for each
enzyme showed differences among Vairimorpha sp. and the two Thelohania species, but
the latter two species had identical restriction profiles. As detected by gel electrophoresis,
the two Thelohania species had two restriction sites each for Sau3A and Hhal, and four
restriction sites for HaeIII. The fragment sizes were roughly 750, 500, and 200 bp when
cut with Sau3A; 760, 350, and 300 bp when cut with Hhal; and 750, 420, 180, 60, and 50
bp when cut with Hae III. Vairimorpha sp. had one restriction site for Sau3A (fragments

68
MW
p,
(A
x:
e
o
S
c
I
P<
(A
CS
o
13
rt
CA
|
C>
c

o
CA
Hl
c
c
u
p
MW
2036
1636
1018
Figure 4.1. PCR products of the 16S rRNA gene of four microsporidian species.
Photograph of crude PCR products following gel electrophoresis. PCR was carried out as
described in the Methods section. Approximately 300 ng (~ 30 ng/ |iL) of each PCR
product was electrophoresed with 1 pL of lOx loading dye (50% glycerol, 50 mM EDTA,
0.5% bromphenol blue) on a 0.8% Seakem LE agarose gel in Tris-acetate buffer (40 mM
Tris-acetate, 1 mM EDTA, pH 8.0). A standards, X/Hindl cut DNA (200 ng) was
included to determine the molecular sizes of the PCR products.

69
BamHI
AACAGCTATGACCATG G 1GATCC PCR
T TGTCGATACTGGTAC CCTAG |G PRODUCT
AACAGCTATGACCATG **
REVERSE
SEQUENCING PRIMER
UNIVERSAL
SEQUENCING PRIMER
TGACCGGCAGCAAAATG
AATTCACTGGCCGTCGTT TTAC
CTTAAl GTGACCGGCAGCAAAATG
EcoRI
Figure 4.2. Cloned pTZ 19R Construct. The cloning procedure is described in
detail in the Methods section and in the appendix.
of approximately 700 and 650 bp), three restriction sites for Hhal (fragments of
approximately 470, 300, 280, and 250 bp) and four restriction sites for HaeIII (fragments
of about 460, 350, 300, and 170, and 30 bp).
Of the other enzymes tested (results not shown), the double digest with Hincll and
HindlU separated Vairimorpha from the two Thelohania species which in turn had
identical profiles. Acil cut the species tested into many small fragments resulting in
smears. Analysis of the completed sequences with MAP revealed that the Thelohania
species each had nine restriction sites for Acil. Vairimorpha sp. had twelve restriction
sites for Acil. The MAP analysis also showed that it did not have Hincll restriction sites
as opposed to the Thelohania species.

70
Sau3A
MW 1 2 3
Hhal
1 2 3
//adll
1 2 3 MW
1018
517/506
396
344
298
220
201
154
134
600
100
1: Thelohania sp. 2: T. solenopsae 3: Vairimorpha sp.
Figure 4.3. Restriction profiles of 16S rRNA gene PCR products of three
microsporidian species. Photograph of restricted PCR products following gel
electrophoresis. About 700 ng of crude PCR product of each species was digested for 2 h
at 37C with either Sau3A, Hhal, or HaelII in a 20 |iL reaction volume. The samples
were electrophoresed with 2 (J.L of lOx loading dye (50% glycerol, 50 mM EDTA, 0.5%
bromphenol blue) on a 3% NuSieve GTG/1% Seakem LE agarose gel in Tris-acetate
buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.0). Two standards, X/HindlU cut DNA
(200 ng) and a 1 kb DNA marker (200 ng), were included as molecular weight markers.
1 = Thelohania sp., 2 = T. solenopsae. 3 = Vairimorpha sp.

71
Sequencing of the 16S rDNA
The PCR primers 18f and 1492r were not suitable as sequencing primers for cycle
sequencing with the fmol sequencing kit because of problems with the sequencing
reactions. Mike Baker (University of Illinois, Urbana, II, personal communication) also
was unable to use the PCR primers for cycle sequencing. He designed slightly modified
sequencing primers which were moved several bases into the sequence of the PCR
products. We did not design new primers because the PCR primers 18f and 1492r could
be used as sequencing primers for automated sequencing by the DNA Sequencing Core
Laboratory of the University of Floridas Interdisciplinary Center for Biotechnology
Research (ICBR). Differences in experimental procedures likely account for this
observation.
The 5 nucleotide of RP9/1061f mismatched with the 16S rDNA sequence of
Thelohania sp. as determined by (1) failed sequencing reactions and (2) subsequent
sequence comparison with the complementary strand of Thelohania sp. It did work to
sequence the T. solenopsae (even though it also mismatched at the same position) but not
the Thelohania sp. 16S rRNA gene in which it was replaced with RP12f.
The cloned PCR product DNA of T. solenopsae was used as sequencing template,
and the sequence of the entire PCR product (1,382 bp) was obtained since sequencing
primers located adjacent to the multiple cloning site were employed. PCR products of
Thelohania sp., Vairimorpha sp., and A. penaei were sequenced directly. The sequenced
fragments represented the majority of the PCR products (except the extreme 5 and 3
ends). The sizes of the sequenced fragments were 1,130 bp (Thelohania sp.), 1,252 bp
(Vairimorpha sp.), and 1,260 bp (A. penaei-). A multiple alignment of the sequences
together with ribosomal gene sequences from other microsporidia is presented in Figure
4.4. Regions conserved throughout all the taxa aligned are identified by

72
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha ap.
A. michaelis
Thelohanla ap.
T. aolenopaae
N. bombycls
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla ap.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
1
60
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTATACTCTAAGATTAACCC
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTATACTCTAAGATTAACCC
ATTCTGCCTGACGTAG-ACGCTATTCCCTAAGATTAACCC
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTATTCCCTAAGATTAACCC
GACGTAG-ACGCTATTCCCTAAGATTGGCCC
ATTCTGCCTGACGTGG-ATGCTATTCTCTGGGGCTAAGCC
CACCAGGTTGATTCTGCCTGACGTGG-ATGCTATTCTCTGGGACTAAGCC
CACCAGGTTGATTCTGCCTGACGTGG-AGGCTATTCTCTGGGGCTAAGCC
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTAGTCTCTGAGATTAAGCC
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTAGTCTCTGAGATTAAGCC
CACCAGGTTGATTCTGCCTGACGTAG-ATGCTAGTCTCTAAGATTAAGCC
CACCAGGTTGATTCTGCCTGACGTAG-ATGCTAGTCTCTGAGATTAAGCC
CACCAGGTTGATTCTGCCTGACGTGG-ATGCTAGTCTCATAGGTTAAGCC
CACCAGGTTGATTCTGCCTGACGTGG-ATGCTAGTCTCTAAAGTTAAGCC
GGTTGATTCTGCCTGACGTAGAACGCTAGTCTCACAGATTCAGCC
61
ATGCATGTTTATTGAATA TAAAGA-
ATGCATGTTTATTGAATA TAAAGA-
ATGCATGTTTTTGATA TGG-
ATGCATGTTTTTGACAT TTG-
ATGCATGTTTTTGACGTACTATGTACTG
ATGCATGTTTATGAAGCCTTTATGGGGG-
ATGCATGTTGATGAA- -CCTTGTGGGGG-
ATGCATGCTTGTGAACTCTTTGTGGGGG-
ATGCATGTCTATGAAA-C
ATGCATGTCTATGGAA-C
ATGCATGTTTCCGCAATC
ATGCATGTCAGTGAAGCC-TTACGGTGG-
120
T
ATAACAT
AAAGACGAACAG
AAAGACGAACAG
AAAAATGGACTG
-AAAAATGGACTG
AAAGATGGACTG
-ATTGACGGACGG
-ATTGACGGACGG
-ATTAGCGGACGG
AAGGACGAACAG
-AAGGACGAACAG
AGGGACGAATAG
AACGGCGAACGG
ATGCATGTGCAAGCGAAGCGTAAGTGGAGCGGCGCA AGGCTCAGTAACGGGCGAGTA
sp. ATGGATGTCTAAGCAAAGCGTAAGTCGAGCGGCAC AGGCTCAGTAACGGGCGAATA
ATGCAAGTAGTATGTATG TAATACACAATGG
121 180
AATCTACATAAATGGATAACCTTGTCA AGATAAGGCTAATACAGTAAAGATGTTAGA
AATCTACATAAATGGATAACCTTGTCA AGATAAGGCTAATACAGTAAAGATGTTAGA
CTCAGTAACTCTTATTTGATTTGATGTA--TTAGGATTCTAACTATGTTAAATTATAG-G
CTCAGTAACTCTTATTTGATTTGATGTA--TTAGGATTCTAACTATGTTAAATTATAG-G
CTCAGTAATACTCACTTTATTTAATGTATTAAATTAGTATAACTGCGTTAAAGTGTAGCA
CTCAGTAATACTCACTTTATTTTATGTA-CATTTGAAACTAACTACGTTAAAGTGTAG-A
CTCAGTAATACTCACTTTATTTGATGTACCTTAT--ACATAACTACGTTAAAGTGTAGC-
CTCAGTGATAGTACGATGATTTGATTGGGAGCCTGGATGTAACTGTGGGAAACTGCAG-G
CTCAGTGATAGTACGATGATTTGGTTGGCGGGAGAGCTGTAACTGCGGGAAACTGCAG-G
CTCAGTGATAGCACGATGATTTGTTTGCGGGATGAGCAGTAGCTGCGGGAAACTGCAG-A
CTCAGTAAAACTGCGATGATTCAGTCTGTCTGTCAAGA-TAACCACGCGAAAGTGTGG-C
CTCAGTAAAACTGCGATGATTCAGTCTGTCTGTCAAGA-TAACCACGCGAAAGTGTGG-C
CTCAGTAAAACTGCGATGATTTAGTCTGGCTGTGTAGA-TAACTACGTGAAAATGTAG-C
CTCAGTAATGTTGCGGTAATTTGGTCTCTGTGTGTAAACTAACCACGGTAACCTGTGG-C
ACTTTTAACTAACCT- TTTGTACTAA-TAATTAAGGGAAACTGTAA-T
TTTGATCTCCTAGAGTGGATATCCTCTGTAACCGGAGGGCAAAACACAAGATGAGCGA
sp. TTTAATCTCCTCGAGTGGATATCCTCTGTAACCGGAGGGCAAAACACAGGACGTGCAG
GGCGTACGGCTCAGT AGGACAGGGAAATCTAGCCACGAAGGAGGA
CTCAGTATCG--AGTATAGCTTTGCTCTCCAAGATGTGATACTTTCAGGAAACAGAAA-A

73
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrlx
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cuniculi
Plelstophora sp.
E. schubergi
N. corneum
E. bleneusl
A. penael
G. atherinae
Ichthyosporidlum
Valrlmorpha sp.
A. mlchaelis
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrlx
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cuniculi
Plelstophora sp.
E. schubergi
N. corneum
E. bleneusi
A. penael
G. atherinae
Ichthyosporidlum
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Plelstophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidlum
Valrlmorpha sp.
A. michaells
181 240
A GCATGAAAGCGGAGCATCAATGTAGCGTTGGTTTCTGACCTATCAG
A GCATGAAAGCGGAGCATCATTGTAGGATTGGTTTCTGACCTATCAG
TAA CAATAATACAATAAGAATAAGATCTATCAG
TAA CAATAATACAATAAGAATAAGATCTATCAG
TAA GACATATACAGTAAGAGTGAGACCTATCAG
TAA GATGTGTACAGTAAGAGTGAGACCTATCAG
TAA CATATGTACAGTAAGAGTGAGACCTATCAG
TAAGTTCTGGGGGTGGTAGTTTGTAGCTACTGCGTACCGAGTAAGTTGTAGGCCTATCAG
TA GGGGGCTAGGAGTGTTTTTGACACGAGCCAAGTAAGTTGTAGGCCTATCAG
TA GTGGTCTGCCCCTGTGGGTTGGCAAGTAAGTTGTGGGCCTATCAG
TAAG AGGGGACAGAACAAGACGCAGGACTATCAG
TAAG AGGGGACAGAACAAGACGCAGGACTATCAG
TAAG GGAAGGCAGAATAAGACGCAGGACTATCAG
TAAA AGCGG- -AGAATAAGGCGCAACCCTATCAG
TAAA AATCATGAGGATGTGAGGTAGACCTATTAG
TTGACGA GGTCGTTCGTTTAACGAATAGTGTAGGAGAGTAAGAAGCCATCCCATCAG
sp. TTGTATAA-GGATTGTTCGTTTAAC-ATTAGTGGGGGAGAGTAAGACGCCAGTCCATCAG
TAACCA CGGTAAGCTGTGGCTAAAACGAGCGTGGGTGAGTTCTTGGCCTATCAG
TAAAGCATCTATCTTCTAAAGTTTTTTAGAGGAGAGGAGAAGAAG-CACTCACCTATCAG
* ** **
241 300
TTAGTATGTTTTGTAAGGGAGAACATAGACTATGACGGGTAACGGGGGATGCACGTCTGA
TTAGTATGTTTTGTAAGGGAGAACATAGACTATGACGGGTAACGGGGGATGCACGTCTGA
TTAGTTGTTAAGGTAATGGCTTAACAAGACTATGACGGATAACGGTATTACTTTGTAATA
TTAGTTGTTAAGGTAATGGCTTAACAAGACTATGACGGATAACGGTATTACTTTGTAATA
CTAGTTGTTAAGGTAATGGCTTAACAAGGCAATGACGGGTAACGGTATTACTTTGTAATA
CTAGTTGTTAAGGTAATGGCTTAACAAGGCAGTGACGGGTAACGGTATTACTTTGTAATA
CTAGTTGTTAAGGTAATGGCTTAACAAGGCAATAACGGGTAACGGTATTACTTTGTAATA
CTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGGGAGACGGGGGATCAGGGTTTGA
CTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGGGAGACGGGGGATCGGGGTTTGA
CTGGTAGTTAGGGTAATGGCCTAACTAGGCGCAGACGGGATACGGGGGATCAGGGTTTGG
TTAGTTGGTAGTGTAATGGACTACCAAGACGGTGACGGTTGACGGGGAATGAGGGTTCTA
TTAGTTGGTAGTGTAATGGACTACCAAGACGGTGACGGTTGACGGGGAATGAGGGTTCTA
TTAGTTGGTAGTGTAATGGACTACCAAGACAGTGACGGTTGACGGGAAATTAGGGTTTTG
CTTGTTGGTAGTGTAAAGGACTACCAAGGCCATGACGGGTAACGGGAAATCAGGGTTTGA
CTAGTTGGTTGTGTAAAGGACTACCAAGGCTATAATGGGTAACGGAGATTTAGTGATCGA
TTAGTAAGTAGGGTAAGGGCCTACTTAGACGAAGACGGGT-ACGGGGAATTATCGTTTGA
sp. TTAGTAAGTAGGGTAAGGGCCTACTTAGACGAATACGGAT-ACGGGGAATTATCGTTTGA
CTAGTCGGTACGGTAAGGGCGTACCGAGGCAATAACGGGTAACGGGGAATCGGGGTTCGA
TTAGTAGGTATGGTAAGGGCATACCTAGACGAAGACGGGT-ACGGGGAAGGCAACTTCGA
* ** **** ** ** ** ****
301 360
TACCGGAGAGGAAGCCTTAGAAACCGCTTTCACGTC C AAGGATGGCAGCAGGCGC
TACCGGAGAGGAAGCCTT--AGAAACCGCTTTCACGTC-CAAGGATGGCAGCAGGCGC
TTCCGGAGAAGGAGCCTG- AGAGATTGCT- TACTAAGTCATAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTGAGAGATTGCTACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTGAGAGACGGCTACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTGAGAGACGGCTACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTG--AGAGACGGC--TACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAGGGAGCCTGAGAGATGGCTACTACGTC-CAAGGATGGCAGCAGGCGC
TTCCGGAGAGGGAGCCTGAGAGATGGCTACTACGTC-CAAGGATGGCAGCAGGCGC
TTCCGGAGAAGGAGCCTG--AGAGATGGCTACTACGTC-CAAGGACGGCAGCAGGCGC
TACCGGAGAGGGAGCCTGAGAGATAGCTCCCACGTC-CAAGGACGGCAGCAGGCGC
TACCGGAGAGGGAGCCTGAGAGATAGCTCCCACGTC-CAAGGACGGCAGCAGGCGC
TACCGGAGAGGGAGCCTGAGAGATTGCTCCCACGTC-CAAGGACGGCAGCAGGCGC
TTCCGGAGAGGGAGCCTGAGAGATGGCTCCCACGTC-CAAGGACGGCAGCAGGCGC
AACCGGAGATGGAAGCTGAGAAACGGTTCCAATGTC-CAAGGATAGCAGCAGGCGC
TTCCGGAGAGGGAGCCTGAGAGACGGCT--ACCAGGTC-CAAGGACAGCAGCAGGCGC
sp. TTCCGGAGAGGGAGCCTGAGAGACGGCT--ACCGGGTC-CAAGGACAACAGCAGGCGC
TTCCGGAGAGGAAGCCTGAGAAACGGCTACCACGTC CAAGGAAGGCAGCAGGCGC
TTCCGGAGAGGGCGCCTT-TAGAGATGGCGACCAGTTC-TAAGGAGTCCAGCAGGCTC
******* ** **, ** ***** ******* *

74
Thelohanla sp.
T. solenopsae
N. bombycls
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaells
361 420
GAAACTTACCCAATTATT-GTATTGATAGAGGTAGTTATGACGCATGTTAAGATTTTA
GAAACTTAC--CCAATTATT-GTATTGATAGAGGTAGTTATGACGCATGTTAAGATTTTA
GAAACTTGA-CCTATG-ATA--TTAT-ATTGAGGCAGTTATGAGTAGTATTTTATAATTA
GAAACTTGA-CCTATG-ATATTAT-ATTGAGGCAGTTATGAGTAGTATTTTATAATTA
GAAACTTGA-CCTATGGATTTTATCTGAGGCAGTTATGGGAAGTAATATTCTATTG
GAAACTTGA-CCTATGGATTTTATCTGAGGCAGTTATGGGAAGTAATATTATATTG
GAAACTTGA-CCTATGGATATTATCTGAGGCAGTTATGGGAAGTAACAT--AGTTG
GAAACTTGCCTAATCCT-TATT GGGGAGGCGGTTATGAGAAGTAAGATGTT
GAAACTTGCCTAATCCT TT GGGGAGGCGGTTATGAGAAGTGAG-TTTT
GAAACTTG CCTAATCCT TT GGGGAGGCGGTTATGAGAAGTGATGGTGTGCGA
GAAAATTG- CCCACTGTT T- -G-GAGGAGGCAGTTATGAGACGTGAGAAAGAGTGC
GAAAATTG- CCCACTGTT T- -G-GAGGAGGCAGTTATGAGACGTGAGAAAGAGTGC
GAAAATTGCCCACTCTT TG- CAGGAGGCAGTTATGAGACGTGAAGATGAGTAT
GAAACTTGTCCACTCCT TACG-GGGGAGACAGTCATGAGACGTGAGTATAAGACC
GAAAATTG- CAC ACTCTT TAAT-GGGGATGCAGTTATGAGGTATGACAGAAAGGGT
GAAAATTACCGCAGCCTG CATTCAGGGCGGTAGTAAGGAGACGTGAAAACAATGTG
sp GAAAATTACCGCAGCCTG CATTCAGGTCGGTAGTAAGGAGACGTGTAAACGATGTG
GGAAATTACCCACTTG GAGGACCAGAGGTAGTTATGGGGCGTAAAGATGAGAAA
GAAACTTA- -CCGAATTATAGAATA GAGGTAGTGATGGAAACGTTTATATAGAAA
* ** ** ** *
421 480
AATTGAAACTTCATTAAAGATAGATAAGCGACTGGAGGGCAAG-TCTGGTGCCAGCAG
AATTGAAACTTCATTAAAGATGGTTAAGCGACTGGAGGGCAAG-TCTGGTGCCAGCAG
TTGTAGTATTGTAAGTACATATTACAAGATAAATCGGAGGGCAA-ATCGAGTGCCAGCAG
TTGTAGTATTGTAAGTACATATTACAAGATAAATCGGAGGGCAA-ATCGAGTGCCAGCAG
TT-TCATATTGTAAAAGTATATGAGGTGATTAATTGGAGGGCAA-ATCAAGTGCCAGCAG
TT-TCATATTTTAAAAGTATATGAGGTGATTAATTGGAGGGCAA-ATCAAGTGCCAGCAG
TT-TCACATTTTAAACGTATGTGAGCAGATTAATTGGAGGGCAA-ATCGAGTGCCAGCAG
-TAGCA AGTATAAATTTGTTGTGATTTACTGGAGGGCAAG-TCGGGTGCCAGCAG
-TTTCG AGTGTAAAGGAGTCGAGATTGATTGGAGGGCAAG-TCGGGTGCCAGCAG
GTGCAA AGGGAATGGCTATTGTTGTATGTTGGAGGGCAAGCTCGGGTGCCAGCAG
TTGGTA AAGAGAAGCAGGAG AATTGGAGGGC AAG- TTTGGTGC CAGCAG
TT-GTA AAGAGAAGCAGGAG AATTGGAGGGCAAG- TTTGGTGCCAGCAG
CTTGTA AAGAGGGATAGGAG AATTGGAGGGCAAG-TTTGGTGCCAGCAG
TGAGTG TAAAGACCTTAGGGTGAAGCAATTGGAGGGCAAGCTTTGGTGCCAGCAG
TATCAA TAAATAAGATGACGTAAAGCTATTAGAGGGAAAG-TTTGGTGCCAGCAG
CGGGCA AAAAACGCACTAGAT ACAGGAGGACAAG-ACTGGTGCCAGCAC
sp. CAGGTA AAGAATGCACTGTAT ACAGGAGGACAAG-ACTGGTGCCAGCAC
AGTGTA AAAAGCTTTTTGAATGCGACTGGAGGGCAAG-TCTGGTGCCAGCAG
TACTGGTAAAGCAAGTA TTATTAACTGAGGAAAGCTGGTGCCAGCAG
it 1t + it It *
481 540
CCGCGGTAATTCCAGCTCCAGTAGTGCATAT ACATGCTGTAGTTAGAAAGTTTGT
CCGCGGTAATTCCAGCTCCAGTAGTGCATAT ACATGCTGTAGTTAGAAAGTTTGT
CCGCGGTAATACTTGTTCCGATAGTGTGTATGATGATTGATGCAGTTAAAAAGTCTGT
CCGCGGTAATACTTGTTCCGATAGTGTGTATGATGATTGATGCAGTTAAAAAGTCTGT
CCGCGGTAATACTTGTTCCAAGAGTGTGTATGATGATTGATGCAGTTAAAAAGTCCGT
CCGCGGTAATACTTGTTCCAAGAGTGTGTATGATGATTGATGCAGTTAAAAAGTCCGT
CCGCGGTAATACTTGTTCCAAGAGTGTGTATGATGATTGATGCAGTTAAAAAGTCCGT
CCGCGGTAATACCTGCTCCAGTAGTGTCTATGGTGAATGCTGCAGTTAAAATGTCCGT
CCGCGGTAATACCTGCTCCAATAGTGTCTATGGTGAATGCTGCAGTTAAAAAGTCCGT
CCGCGGTTAATTGAATCCTGCCAATTGGGTTGATGGATGCTGCCGTTAAAATGTCCGT
CCGCGGTAATACCGACTCCAAGAGTGTGTATGAGAGATGCTGCAGTTAAAAAGTCCGT
CCGCGGTAATACCGACTCCAAGAGTGTGTATGAGAGATGCTGCAGTTAAAAAGTCCGT
CCGCGGTAATACCGACTCCAAGAGTGTGTATGAGAGATGCTGCAGTTAAAAAGTCCGT
CCGCGGTAACTCCAACTCCAAGAGTGTCTATGGTGGATGCTGCAGTTAAAGGGTCCGT
CCGCGGTAATACCAACTCTAAGAGTCTCTATGCGAGTTGCTGCAGTTAAAAAGTCCGT
CCGCGGTAATACCAGCTCCTGGAGTGTCTATGATATGATTGCTGCAGTTAAAGAGTTCGT
sp. CCGCTGTAATACCAGCTCCTGGAGTGTCTATG--ATGATTGCTGCAGTTAAAGCGTTCGT
CCGCGGTAATTCCAGCTCCAGGAGCTTCTGTGTGAGTTGCTGCGGTTAAAAAGTGCGT
CCGCGGTAATACTTGCTCCAGGAGCTTATTCG ATATGTTGCGGTTAAAACGTCCGT
**** ** ** **
it


75
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
541 600
AGCCAGTTTATGGATT-GTTTTTGATAATAGTTATTCTCCAAAAGAGCTAATTTTAACTA
AGCCAGTTTATGGATT-GTTTTTGATAATAGTTATTCTCCAAAAGAGCTAATTTTAACTA
AGTTT-A-T
AGTTT-ATT
AGTTT-ATA
AGTTT-ATA
AGTTT-ATT
AGTTG- TTTGTATGT CTTTTGAGTGATGTTTATGGTTTTTAGTGGATGTAG TTT
AGTCT- TTTGTATGT CTTTGTTTGGGGGATTATGTCCTGATGTGGATGTAA-GAG
AGTCT-GTTGTGTATG TC TTTGTGTGTGATGTTTGTGGTTGTGTGTGGATGTAGTGAT
AGTCG- TGGAGACG GAAAGAGAG- -GCGGAGCCTCTTTGAGAT
AGTCG-TGGAGACG GAAAGAGAGGCGGAGCCTCTTTGAGAT
AGTCA-TAGAAGGG CAAAGAGAGATGCGAGGTCTCACAGTGCG
AGTCG- TGAATGCA ATTAAATGTCGTTGTTCAATAGCGATGAGTTTGCTA--
AGTCTTTACGTA ATTAAAAATGAATGATCAAGTTTCATATTTTTACGTTT
AGTCGAAGTGGTTATA-ACGGTGTAACAGGCCTTCTCTCAAGGAGGGTTATGCGCCGTGA
sp. AGTCGAACCGGGTTGA-ATTGCGTGACAGTCAGACTCTCAAGGTGTGATGAGCGCTGTGA
AGTCGGGGAGCAGG-CCAGCAGAAAAGGTGGGGAATCACGCCTAGCATAGTGCAGGAA
AGTCGCGGCTGGGA CTGACCTGTAATCTATTTGGTCAACAGATAGATAGGGGCAGTA
*
601 660
ATTCATAA AAATAGAAGCGGATGAAGGTAATTGTATTCACCAGCAAGAGGTAAAATT
ATTCATAA AAATAGAAGCGGATGAAGGTAATTGTATTCACCAGCAAGAGGTAAAATT
TTAT AATAAGGATTGTAAGGTATACTGTATGGTTAGGAGAGAGATGAAATG
TTAT AATAAGCATTGTAAGGTATACTGTATGGTTAGGAGAGAGATGAAATG
TT-T AAGAAGCAATATGAGGTGTACTGTATAGTTGGGAGAGAGATGAAATG
TT-T AAGAAGCAATATGAGGTGTACTGTATAGTTGGGAGAAAGATGAAATG
AT-T AAGAAGCAATATGAGGTGTACTGTATAGTTGGGAGAGAGATGAAATG
TATT GTAGCAGAGGACGAGGGGCACTGGATAGTTGGGCGAGGGGTGAAATA
GTTT G--GCAGAGGACGAGGGGCACCGGATAGTTGGGCGAGGGGTGAAATA
GTGT GTGGCAGAGGACGAGGGGCACTGGATAGTTGGGCGAGAGGTGAAATG
GCTCT GGAGAAGCCAACAGGGGGCACAGTATACCAGGGCGAGAGATGAAATG
GCTCT GGAGAAGCCAACAGGGGGCACAGTATACCAGGGCGAGAGATGAAATG
ATGAT GGAGGAGCCGATGGGGAACATAGTATACCAGGGCGAGAGATGAAATG
ATGTT TGCGGAACGGATAGGGAGTGTAGTATAGACTGGCGAAGAATGAAATC
ATA TATGAGACGGATTGGGAGCATAGTATAACTGGGTTAAGAATGAAATC
TTCCATGG AATAAGGAGCGTTTAGGGGCCAGGTTATTAAGCGACGAGGGGTGAAATC
sp. TTCTGGGG AATAAGGAGTGTTTAGGGGCCAGGGTATTAAACGGCAAGCGGTGAAATG
CTGGGA CCTAGGGACCGGAGAGGGGCAACCTAATTCTTGGGCGAGGGGTGAAAAC
GCAAGTTG GAAAAGAGCAATTTGGTGTCAGCTAATGGTATGGGGAGGGGTAAAGTC
** **
661 720
TGATGAC-CTGGTGAGGACATTCAGAGGCGAAAGCGATTGCCTAGTACATTTTTGAT
TGATGAC CTGGTGAGGACATTCCGAGGCGAAAGCGATTGCCTAGTACGTTTTTGAT
TGATAACCCTAAC-TGGATGAACAGAAGCGAAAGCTGTATACTTAAATGTATTATTA
TGATAACCCTAAC-TGGATGAACAGAAGCGAAAGCTGTATACTTAAATGTATTATTA
TGACGACCCTGAC-TGGACGAACAGAAGCGAAAGCTGTACACTTGTATGTATTTTTT
TAACGACCCTGAC-TGGACGAACAGAAGCGAAAGCTGTACACTTGTATGTATTTTTT
TGACGACCCTGAC-TGGACGAACTGAAGCGAAAGCTGTACACTTGTATGTATTTTTT
CGAAGACCCTGAC-TGGACGAAGAGAAGCGAAGGCTGTGTTCTTGGACTTTTGTGGT
CGAAGACCCTGAC-TGGACGGACAGAAGCGAAGGCTGTGCTCTTGGACTTATGTGAC
CGAAGACCCTGAC-TGGACGAGCGGAAG AGGCTGTGCTCTTGGACTAATGTTGTTGC
CCAAGACCCCTGG-TGGACTGAGCGAGGCGAAAGCGGTGCTCTTGTGGGTGTTCGGT
CCAAGACCCCTGG-TGGACTGAGCGAGGCGAAAGCGGTGCTCTTGTGGGTGTTCGGT
CCAAGACCCCTGG-TGGACTGAGCGAGGCGAAGGCGATGTTCTTGTAGGCATTCGGT
TCAAGACCCAGTT-TGGACTAACGGAGGCGAAGGCGACACTCTTAGACGTATCTTAG
TCACTACCCTAGT-TGGACTATCAGAAGCGAAAGCGATGCTCTAATACGTACTTTTA
TGGTGACTCGCTTA-GGAGCAACAGAGGCGAAAGCGCTGGCCAGGAGCGAATCCGAT
sp. TGTTGACCCGTTTATGGAGCGACAGAGGCGAAAG-GCTGGCCAGGGGCAAATCCGAT
TGCTGACCCTGAGA-GGAGGAACAGAGGCGAAGGCGGTTGTCCGGGACGGGTCTGAC
TGAGGATC C TGCAGGAGGAGCAAAGGCGTAAGCACTGACAAAGATTGATTCTGTT
*** *

76
Thelohanla sp.
T. aolenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
721 780
GGTAAAGAACGTAAGCCGGAGGATCAAAGATGATTAGATACCGTTGTAGTTCCGGCCGTA
GGTAAAGAACGTAAGCCGGAGGATCAAAGATGATTAGATACCGTTGTAGTTCCGGCCGTA
GAACAAGGACGTAAGCTAGAGGATCGAAGATGATTAGATACCATTGTAGTTCTAGCAGTA
GAACAAGGACGTAAGCTAGAGGATCGAAGATGATTAGATACCATTGTAGTTCTAGCAGTA
GAACAAGGACGTAAGCTGGAGGAGCGAAGATGATTAGATACCATTGTAGTTCCAGCAGTA
GAACAAGGACGTAAGCTGGAGGAGCGAAGATGATTAGATACCATTGTAGTTCCAGCAGTA
GAACAAGGACGTAAGCTGGAGGATCGAAGATGATTAGATACCATTGTAGTTCCAGCAGTA
GATGAAGGACGAAGGCTAGAGGATCGAAATCGATTAGATACCGTTTTAGTTCTAGCAGTA
GATGAAGGACGAAGGCTAGAGGATCGAAATCGATTAGATACCGTTTTAGTTCTAGCAGTA
GATGAAGGACGAAGGCTAGAGGATCGAAAACGATTAGATACCGTTTTAGTTCTAGCAGTA
GATCAAGGACGAAGGCTGGAGGATCGAAAGTGATTAGATACCGCTGTAGTTCCAGCAGTA
GATCAAGGACGAAGGCTGGAGGATCGAAAGTGATTAGATACCGCTGTAGTTCCAGCAGTA
GATCAAGGACGAAGGCTGGAGTATCGAAAGTGATTAGATACCGCAGTAGTTCCAGCAGTA
GATCAAGGACGAAGGCAGGAGTATCGAAAGTGATTAGACACCGCTGTAGTTCCTGCAGTA
GATAAAGGACGAAGGCTAGAGTAGCGAAAGGGATTAGATACCCCTGTAGTTCTAGCAGTA
GATAAAGGACGTAGGCTAGAGGATCGAAGACGATTAGAGACCGTTGTAGTTCTAGCAGTA
sp. GATAAAGGACGTAGGCTAGAGGATCGAAGACGATTAGAGACCGTTGTAGTTCTAGCAGTA
GATCAAGTACGTGAGCAGGAGGATCAAAGACGATTAGACACCGTCGTAGTTCCTGCAGTA
GATCAAGGACAGAGGCTAGAGGATCGAATACGATTAGATACCGTAGTAGTTCTAGCAGTG
* *** ** ******* *** ****** *
sp.
781 840
AATTATGCCAACTTGCA- TTTTGTTATT TATACAAGGAGCATAGAGAAATTAAGAGT
AATTATGCCAACTTGCA-TCTTGTTATT TATACAAGGAGCATAGAGAAATTAAGAGT
AACTATGTTGAACCATAGATATATTTTG ATATATATTTATGTAGAGAAATTAAGATT
AACTATGTTGAATCATAGATATATTTTG ATATATATTTATGTAGAGAAATTAAGATT
AACTATGCCGACGATGTGATATGATATT AATTGTATTAGATGATAGAAATTT-GAGT
AACTATGCCGACGATGTGATATGATATA TTTTGTATTACATAATAGAAATTA- GAGT
AACTATGCCGACGATGTGATATGAGAT GTTGTATTACATTATAGAAATTA-GAGT
AACGATGCCGACTGGACG-GGACTGTT TTAGTGTTGTCCGAGAGAAATCTTAAGT
AACGATGCCGACTGGACG-GGACT-AT ATAGTGTTGTGCATGAGAAATCTTGAGT
AACGATGCCGACTGGACG-GGTCAGTG TGTG TTGCCATGAGAAATCTTGAGT
AAAGATGCCGACATGCTCGG TG GCAACACGGGGCGGGGAGAAATCTTAGA
AAAGATGCCGACATGC -TCGG TG GCAACACGGGGCAGGGAGAAATCTTAGA
AAAGATGCCGACATGCTCAT TG GACACAGTGGGCAGGGAGAAATCTTAGA
AACTATGCCGACAGCCTGTGTG TG AGAATACGTGGGCGGGAGAAATCTTAGT
AACTATGCCGACAGAATGTTAGATATA TTTCTAGTGTTCAAGGGAAACCTTAAGT
AACGATGCCGATACCGTGGTGCG GATACGCGACGCGGAAGAGAAATCGAGT
AACAATGCCGATGTTGTGGTGCC GTAACG-GACGCAAAAGAGAAATCTAGT
AACGATGCCGACGGGGCAGCAGG GGAACTTGTTGCCTGAGGGAAACCA-AGT
ACCGATGATGATTTTGCCTTATGCAAT AGAGAAATCAAAAT
*
*
841 900
TTTTGGGCTCTAGGGATAGTAATCCGGCAACGGACAAACTTAAAGAAATTGGCGGAAG
TTTTGGGCTCTAGGGATAGTAATCCGGCAACGGACAAACTTAAAGAAATTGGCGGAAG
ATATTGACTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAAGAAAGTGACGGAAG
ATATTGACTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAATTGACGGAAG
TTTTTGGCTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAATTGACGGAAG
TTTTTGGCTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAATTGACGGAAG
TTTTTGGCTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAAGAAATTGACGGAAG
ATGTGGGTTCTGGGGATAGTATGCTCGCAAGAGTGAAACTTGAAGAGATTGACGGAAG
ATGTGGGTTCTGGGGATAGTATGCTCGCAAGAGTGAAACTTGAAGAGATTGACGGAAG
ATGCGGGTTCTGGGGATAGTATGCTCGCAAGAGTGAAACTTGAA--GAGATTGACGGAAG
GTTCGGGCTCTGGGGATAGTATGCTCGCAAGGGTGAAAATTAAA--GAAATTGACGGAGC
GTTCGGGCTCTGGGGATAGTATGCTCGCAAGGGTGAAAATTAAAGAAATTGACGGAGC
GTTCGGGCTCTGGGGATAGTATGCTCGCAAGGGTGAAAATTAAA--GAAATTGACGGAGC
GTTCGGGCTCTGGGGATAGTACGCTCGCAAGGGTGAAACTTAAAGCGAAATTGACGGAAG
GATCGGGCTCTGGGGAGAGTATGCTCGCAAGTGTGAAAATTAAA-CGAAATTGACGGAGT
AGGGCCCTGGGGAGAGTACACGCGCAAGCGAGAAATTTAAAG-GAAATTGACGGAAG
sp. AGGGCCCTGGGGAGAGTACACGCGCAA-CAGGAAATTTAAAG-GAAATTGACGGAAG
GTACGGGCTCCGGGGATAGTACGGGCGCAAGCTTGAAACTTAAA--GAAATTGACGGAAG
A GATCTCCGGGGAGTACATGCGCACAGGAACTTAA GAATTGACGGAAG
* ** ***** ** ****

77
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrlx
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schuberqi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schuberqi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha ap.
A. michaelis
901 960
GACACCACAAGGAGTGGATTATACGGCTTAATTTGACTCAACGCGGGAAAACTTACCAGG
GACACCACAAGGAGTGGATTATACGGCTTAATTTGACTCAACGCGGGAAAACTTACCAGG
AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACCCGGGGTAATTTACCAGG
AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGGGGTAATTTACCAGG
AATACCAGAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGTAACTTACCAAT
AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGTAACTTACCAAT
AATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGTAACTTACCAAT
GACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGT
GACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGT
GACACCACAAGGCGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGGCAACTTACCGGC
TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAAGCTTACCAGG
TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAAGCTTACCAGG
TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAAACTTACCAGG
GACACTACCAGGAGTGGATTGTGCTGCTTAATTTAACTCAACGCGGGAAAACTTACCAGG
TACACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCGAGGAATTTTACCAGG
AACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGACAGCTTACCAGG
sp. AACACCACAAGGAGTGGAGTGTGCGGCTTAATTTGACTCAACGCGGGACACCTTACCGGG
GACACCACAAGGAGTGGAGTGTGCGGGTTAATTTGACTCAACGCGGGACAACTTACCGGG
CTAGCCACAAGGGTTGGATTGTGCGGCTTAATTTGACTCAAAGCGGAAAAGCTTACCAAG
* ic h
sp.
961 1020
GCCTATGTATAAGAGAAAGTTAACATTGTATG TATACTTGATTGTACTTTGAG
GCCTATGTATAAGAGAAAGTTAACATTGTATG TATACTTGATTGTACTTTGAG
TATAA CATGGTATAATATTTT ATCATGATAG
TATAA CATGATATAATATTTT ATCATGATAG
ATT TTATTC AGAGAAGATTTTCGATC-TGAGAATGATAATAG
ATTTT ATTATTTTGAGACGATTTTTAATC AGAGAATGATAATAG
ATTTT ATTGTTCTGCGAGGATAT GATC-TGAGGATGATAATAG
TCTGA AGTGAGTGTGAGAGTGTTTTTACAT-GAT-GCTTACGGCGG
TCTGA AGCGGGCAGGAGAACGAGGACGG-GAT-GCGCGCGGCGG
TCTGA AGGAATGCCTGTGAGGCATGGCAT-TGGCATGCGGCGG
GCCAA GTGCTGTGGAGAAAG GAGCAGGACAGAAG
GCCAA GTGCTGTGGAGAAAG GAGCAGTACAGAAG
GCCAA GTATTGTGTAGAAAC GAGCAATACAGGAG
GTCAA GTCATTCGTTGATCG AATACGTGAGAATGGCAGGAG
GCTGA ATATATTTGAGATTG AATACATGAAATATATTTGAG
CCCGACGGCCGGACGAGTGTTGTACACGATAGGTCGA AGAG
CCC-ACGGCCACACGAGTGTGACACACGATA-GCCGA GGAG
GCAGGCGACGAGAAGCGAAGGATGATGAAGAGATTC ACAGACTGATTGCGTCGCGTG
CTTATTTATTCAACGA- -GTATTTATCCGAGAGTA AAATG
1021 1080
TGGTGCATGG-CCGTTTTCAACACGTGGGGTGACTTGTCAGGTTTATTCCGGTAACGTGT
TGGTGCATGG-CCGTTTTCAACACGTGGGGTGACTTGTCAGGTTTATTCCGGTAACGTGT
TGGTGCATGG-CCGTTTCCAATGGATGCTGTGAAGT-AATGATTAATTTCAACAAGATGT
TGGTGCATGG-CCGTTTCCAATGGATGCTGTGAAGT-AATGATTAATTTCAACAAGATGT
TGGTGCATGG-CCGTTTTCAATGGATGCTGTGAAGT-TTTGATTAATTTCACCAAGACGT
TGGTGCATGG-CCGTTTTCAATGGATGCTGTGAAGT-TTTGATTAATTTCAACAAGACGT
TGGTGCATGG-CCGTTTTCAATGGATGCTGTGAAGT- TTTGATTAATTTCAACAAGACGT
TGGTGCATGG-CCGTTTTAAATGGATGGCGTGAGCT-TTGGATTAAGTTACGTAAGATGT
TGGTGCATGG-CCGTTTGAAATGGATGGCGTGAGCT-TTGGATTAAGTTGCGTAAGATGT
TGGTGCATGG-GCCTTTTAAATGGATGGCGTGA-CT-TTGTCTTAAGTTGCGTAAGATGT
TGGTGCATGG-TCGTTGGAAATTGATGGGATGACTT-TGGCCTTAAATGGCTGAATGAGT
TGGTGCATGG-TCGTTGGAAATTGATGGGATGACTT-TGGCCTTAAATGGCTGAATGAGT
TGGTGCATGG-TCGTTGGAAATTGATGGGATGACTT-TGACCTTAAATGGTTGAATGAGT
TGGTGCATGG-CCGTTGGAAATTGATGGGGCGACCT-TTAGCTTAAATGCTTAAACCAGT
TGGTGCATGG-TCGTTGTAAACTCATGGATTGATCT-TAAGTTCAACTGCTAAAATGGGT
TGGTGCATGG-CCGTTAACGACGAGTGAGGTGACTT-TTGGGTTAAATCCGGGAAGTAGT
sp. TGGTGCATGGCCCGTTAACGACAAGTGA-GTGATCT-TTGGGTTAAGTCCGTAAATTAGT
TGGTGCATGG-CCGTTTTTAACACGTGGGGTGACTTGTCAGGTTAAATCCGATAACGCGT
GTGTGCATGG-CCGTTCCTAACACATGGAGTGATTTTGTGATTAACCTTCCGTAATCTGT
******** ** ** ** ** **

78
Thelohanla sp.
T. aolenopsae
N. bombycls
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cunlculi
Plelstophora sp.
E. schubergl
N. corneum
E. bleneusl
A. penael
G. atherlnae
Ichthyosporldlum sp.
Valrimorpha sp.
A. michaelis
1081 1140
GATGTGCAGTATGC AACTAATGTTGTGAGACTTCTTGCGGTAAGC TTGATGAA
GATGTGCAGTATGCAACTAACTAATGTTGTGAGACTTCTTGCGGTAAGC TTGATGAA
GAGACCCTCATTTAGACAGATGTAGTG ATACA TATGAAGG
GAGACCCTCATTTAGACAGATGTAGTG ATACA TATGAAGG
GAGACCCTTTTATTAATAGACAGACAC AATCAGTG TAGGAAGG
GAGACCCTTTTATT-ATAGACAGACAC AATCAGTG TAGGAAGG
GAGACCCT TTATTAGACTGACAC TATTAGTG TAGGAAGG
GAGACCCT- -TTTTGACTGTGCTCTA TGGGGCA AGGGAGG
GAGACCC TTTGACAGTGCTCTT TGGGGCA AGGGAGG
GAGACCC TTTGACGGTGTTCTA CGAAGCA A-GGAGG
GAGATC TTTGGACATG- TTCCC ACAGGAA CAGGAAGG
GAGATC TTTGGACATG--TTCCC AC-GGAA CAGGAAGG
GAGATCT- -TTTGGACATG- -TTCCG CAC-GGAA CAGGAAGG
GAGACCT- -CCTTGACAGG- TGTTC TGTAACA CAGGAGGG
GAGACTT-- TCATAAACAGCTATCTA ACAGGTA GAGGAAGG
GAGACCCCTACCGAAAGGGACAGGTGC CGAAAGCA CAGGAAGG
GAGACCC C AGC AAAGGAC AGGTGC GCAAAGCA CAGGAAGG
GAGACCCTGTGTAGATGGAAATA-CGACGGGACATGGCAAGTGT CAGGAAGA
GTAAATCCTCATAATAGCTTGTTTGA AAAGAACAA
Thelohanla sp.
T. aolenopsae
N. bombycls
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cunlculi
Plelstophora sp.
E. schubergl
N. corneum
E. bleneusl
A. penael
G. atherlnae
Ichthyosporldium sp.
Valrlmorpha sp.
A. michaelis
1141 1200
GAGGCGCTATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCTGCACGTGTAATACAGT
GAGGCGCTATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCTGCACGTGTAATACAGT
AGAGGATTAAAACAGGTCCGTTATGCCCTAAGATAATCTGGGTTGCACGCGCAATACAAT
AGAGGATTAAAACAGGTCCGTTATGCCCTAAGATAATCTGGGTTGCACGCGCAATACAAT
AAAGGATTAAAACAGGTCCGTTATGCCCTCAGACATTTTGGGCTGCACGCGCAATACAAT
AAAGGATTAAAACAGGTCCGTTATGCCCTCAGACATTTTGGGCTGCACGCGCAATACAAT
AAAGGACTAAAACAGGTCAGTTATGCCCTCTGACATTTTGGGCAGCACGCGCAATACAAT
AATGGAACAGAACAGGTCCGTTATGCCCTGAGATGAAGCGGGCGGCACGCGCACTACGAT
AATGGAACAGAACAGGTCCGTTATGCCCTGAGATGAAGCGGGCGGCACGCGCACTACGAT
GATGGAAGAGAACAGGTCCGTTATGCCCTGAGATGAGGCGGGCTGCACGCGCAACTAGAT
-GGAGGCTATAACAGATCAGAGATGCCCTTAGATGCCCTGGGCTGCACGCGCAATACAAT
-GGAGGCTATAACAGATCAGAGATGCCCTTAGATGCCCTGGGCTGCACGCGCAATACAAT
AAAAGGCTATAACAGATCCGAGATGCCCTCAGATGCCCTGGGCTGCACGCGCAATACAAT
TGGAGGCTATAACAGGTCCGTGATGCCCTTAGATATCCTGGGCAGCAAGCGCAATACAAT
GGAAGGCGATAACAGATCCGTGATGCCCTCAGATGTCCTGGGCTGCACGCGCAATACATT
AAGGGTCAAGAACAGGTCAGTGATGCCCTCAGATGGTCTGGGCTGCACGCGCACTACAGT
ATGGGTCAAGGACAGGTCAGTGATGCCCTTAGATGGTCCGGGCTGCACGCGCACTACAGT
GCGGGTCGATAACAGGTCTGTGATGCCCGCAGATGTTCCGGGCGCCACGCGCACTACATT
TTCGAGCAAGAACAGGTCAGTGATGTCCTTTGATAGCTTGGGCTGCACGCGCAATACAAT
* **** ** *** ** ** *
Thelohanla sp.
T. aolenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cunlculi
Plelstophora sp.
E. schubergl
N. corneum
E. bleneusl
A. penael
G. atherlnae
Ichthyosporldlum sp.
Valrlmorpha sp.
A. michaelis
1201 1260
GGGTATTTCAATATTTAATAGGA-GTAAATTTACCCGAGACAGGGATCATGCTTTGTAAG
GGGTATTTCAATATTTAATAGAA-GTAAATTTACCCGAGACAGGGATCATGCTTTGTAAG
AAT-ATTTG-ATAT TATA AGGGATAATATAATGTAAG
AAT-ATTTG-ATAT TATA AGGGATAATATAATGTAAG
AGATATAT-AATC TTTA TGGGATAATATTTTGTAAG
AGATATAT-AATC TTTA TGGGATAATATTTTGTAAG
AGA-CTTT-AATC TTTA TGGGATAATATTTTGTAAG
AGATGCCT ATGTGGGCTACTGTGA-GGGATGAAGCTGTGTAAT
AGATGGCG AGGGAGCCTGCTGTGA-GGGATGAAGCTGTGTAAT
AGATGGCG CTTCTGCCTGCTGTGAGGGGATGAAGCTGTGTAAG
AGCACGTA-GACG TACAGAACAACACGTGCT-GAGGTGGACTGTGCTCTGCAAG
AGCACGTA-GACG TAGAGAACAACACGTGCT-GAGGTGGACTGTGCTCTGCAAG
AGCAGGTA-GAGA GAGAGACAGGAAGGTGCT-CAGATGGACTATGTGCTGTAAG
ATCTCTTC AGTA GACAAAGTGATTTGAGAT-GAGTAGGATCTACGTTTGTAAA
ATGTATAT-TTCT TATAAATAGATACTACATATTGGGGAATTGACTTTTGTAAA
GGTCATAGAAATGAAACGATAGAATTAAAGATGATCGAGAGGGAATGAGCTTTGTAAG
GGTCGCCGAAATTTAGATATAGAGCTAAAGGCGATCGAGAGGGAATGAGCTTTGGAAG
GGACGGCGATATATGAAAATGAGGAGCCGTCCGTGGTTGGGATTGACGCTTGTAAT
TTTTATGT AGTAAGATATAGATAGGGATTGAGGGCTGAAAG
** **

79
Thelohanla ap.
T. solenopsae
N. bombycis
N. trlchoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cunlculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusl
A. penael
G. atherinae
Ichthyosporidium sp.
Valrlmorpha sp.
A. michaelis
1261 1320
AAG
AAG
ATATATTTGAACATGGAATTGCTAGTAAATTTT-ATTTAATAAGTAGAATTGAATGAGTC
atatatttgaacatggaattgctagtaaatttt-atttaataagtagaattgaatgagtc
AGATA TTTGAACTTGGAATTGCTAGTAAATTTT-ATTAAATAAGTAGAATTGAATGTGTC
AGATATTTGAACTTGGAATTGCTAGTAAATTTT-ATTAAATAAGTAGAATTGAATGTGTC
AGATATTTGAACTTGGAATTGCTAGTAAATTTT-ATTAAATAAGTAGAATTGAATGTGTC
GGGCTTCTGAACGTGGAATTCCTAGTAAGAATG-ATTGAACAAGTTATTTTGAATGTGTC
GGGCTTCTGAACGTGGAATTCCTAGTAATAACG-ATTGAACAAGTTGTTTTGAATGGGTC
GGGCTTCTGAACGTGGAATTCCTAGTAATAGCG-GCTGACGAAGCTGCTTTGAATGTGTC
GGGCACACGAAAGAGGAATTCCTAGTAAGCGCC-CATCACCAGTGGGCGTTGAATCAGTC
GGGCACACGAAAGAGGAATTCCTAGTAAGCGCC-CATCACCAGTGGGCGTTGAATCAGTC
GCACATACGAAAGAGGAATTCCTAGTAAGTGTG-TATCAACAATGGATATTGAATAAGTC
TACGTAGTGAATAAGGAATTCCTAGTAACGGTG-CCTCATCAAGGCATGGTGAATGTGTC
TAAGTCATGAACTTGGAATTCCTAGTAATAATG-ATTCATCAAGTCATTGTGAATGTGTC
AGGCTCAGGAACGAGGAATTGCTAGTAATCGCGGACTCATTAAGACGCGATGAATACGTC
AGGCTCAGGAACGTGGAATTGCTAGTAATCGCGGACTCATTAAGACGCGATGAATACGTC
TGCGTCATGAACGTGGAATTCCTAGTAGT-GGGCAGTCATTAACTGCACGCGAATGAGTC
CG-CTCATGAACACGGAATAGCTAGTAA-CGTGAGTTCAATATACGGCGATGAATATGTC
Thelohanla sp.
T. solenopsae
N. bombycls
N. trlchoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium sp.
Valrlmorpha sp.
A. michaelis
1321
1380
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGGTATTATCTATGA ACAA
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGGTATTATCTATGA ACAA
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATGTGTTGTGA AATT
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATATGTTGTGA AATT
CCTGTTCTTTGTACACACCGCCCGTCGCTATCTAAGATGATATGTGTTGTGA AATT
CCTGTCCTTTGTACACACCGCCCGTCGCTATCTAAGATGAC GCAGTGG ACGA
CCTGTCCTTTGTACACACCGCCCGTCGCTATCTAAGATGAC GCAGTGG ACGA
CCTGTCCTTTGTACACACCGCCCGTCGCTATCTAAGATGAC GCACTGGA ACGA
CCTGTAGCTTGTACACACCGTCCGTCACTATCTCAGATG-T TTTTCGGG ATGA
CCTGTAGCTTGTACACACCGTCCGTCACTATCTCAGATG-T TTTTCGGG ATGA
CCTGTAGCTTGTACACACCGCCCGTCACTATCTCAGATG-T TTTTCAGG ATGA
CCTGTTCTTTGTACACACCGCCCGTCACTATTTCAGATG-G TCATAGGG ATGA
CCTGTAGCTTGTACACACCGCCCGTCACTGTCTCAGATG-G TTGATGAG ATG-
CCTGTTCTTTGTACACACCGCCCGTCGTTATCGAAGATGGAGTCAGGCGCGAACAAG-
CCTGTTCTTTGTACACACCGCCCGTCGTTATCGAATACGGTGCTCGGCGCGAGCAAGG
CCTGTTCTTTGTACACACCGCCCGTCGTTATCTAAGATGGA AGTGCGGATGAGGT
CCTGTTCTTTGTACACACCGCCCGTCGTTATCGAAGATGGAGTGATTTTTGAG-TCAATT
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium sp.
Valrlmorpha sp.
A. michaelis
1381
1440
ATTTATA AAGTGAATAGATAGTACTAGATCTGATATAAGTCGTAACATGGTTGCTGT
ATTTATA AAGTGAATAGATAGTACTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGTGAAAACTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGTGAAAACTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGTGCAAGCTACTTGAACAATATGTATTAGATCTGATATAAGTCGTAACATGGTTGCTGT
AGATTGAGAGGTCTGAGTCTTTCGTGTTAGATAAGATATAAGTCGTAACATGGCTGCTGT
AGATTGGAAGGTCTGAGTCCTTCGTGTTAGATAAGATATAAGTCGTAACATGGCTGCTGT
AGATCGGAAGGTCTGAGTCCTGAGTGTTAGATAAGATATAAGTCGTAACAAGGTAA
AGAGTCTAGGCTCTGAATAACGGAAAGTAGATAAGATGTAAGTCGTAACATGGTTGCTGT
AGAGTCCAGGCTCTGAATAACGGAAAGTAGATAAGATGTAAGTCGTAGCAAGGTTGCGGT
AGAGTCCAGGCTCTGAATAATGAAAAGTAGATAAGATGTAAGTCGTAACATGGTTGCTGT
AGAGCTTCGGCTCTGAATATCTATGGCTAGATAAAGTACAAGTCGTAACAAGGTTTCAGT
CGAGAGCGAGTGAGTGCAGGATTCTAGATGTGATACAAGTCGTAACATGGTTGCTGT
TGAAATCACTGAGCGAGCGCAAGGTACCGGATCTGATACAAGTCGTAACAAGGTAGCTGT
CGGTACGGCCGGACGAATCTGTGCTTGTAGATTGGATACAA
ATAATTGGCTACTTGAATGAGTTATTCTAAAACCGGTACAAGTCGTAACAAGGCTACGGT

80
Thelohanla sp.
T. solenopsaa
N. bombycis
N. trlchoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cuniculi
Plelstophora sp.
E. schubergi
N. corneum
E. bleneusi
A. penael
G. atherinae
Ichthyosporldlum sp.
Valrlmorpha sp.
A. michaells
1441
1466
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGG
CGGTGAACCATTAGCAGGATCATAA
TGG
TGGAGAACCATTAGCAGGATCATAA
TGG
AGGAGAACCATTAGCAGGATCATAA
TGAAGAATCAGCAGTAGGATTAGCG
Figure 4.4. Multiple sequence alignment of the rRNA gene sequences of 19
species of microsporidia. Alignment of the sequences was done with the programs PileUp
and CLUSTAL W (1.4). Names of microspridian species typed in bold indicate sequences
obtained by the author. Dashes indicate gaps that were introduced to maintain alignments.
Conserved regions are identified by

81
Sequence Data Analysis
For data analysis, about 70 bp were excluded at the 5 and 3 ends of the A. penaei
sequence because of sequence uncertainties. The multiple sequence alignment (Figure
4.4) shows moderately variable regions in the 5-end half and highly conserved stretches
(denoted with *) in the 3-end half of the sequence. The distance matrix shown in Table
4.2 presents the mean distances between taxa, providing a comparison of the relative
similarity between any two taxa. The ribosomal gene sequence of the protozoan
£}. lamblia (Sogin et al. 1991) was included as an outgroup. Mean distances and
branching patterns of the phylogenetic tree (Figure 4.5) clearly showed that Thelohania sp.
and T. solenopsae were very closely related (mean distance Thelohania sp./T. solenopsae
= 0.008). A mean distance of 0.008 means 0.8 % sequence difference or 99.2 % sequence
similarity. They were not closely related to any of the other microsporidia including the
hymenopteran microsporidia N. apis and N. vespula (mean distance Thelohania sp./N. apis
= 0.370, T. solenopsae/ N.apis = 0.376, Thelohania sp./N. vespula = 0.374, T. solenopsae
/N. vespula = 0.378). They were also quite different from Vairimorpha sp. which can
occur in dual infections together with Thelohania sp. in S. richteri (mean distance
Thelohania sp./Vairimorpha sp. = 0.368, T. solenopsae/ Vairimoipha sp. = 0.367).The
sequence of A- penaei. which was chosen as a close representative of the type species of
the genus Thelohania. has a mean distance of 0.378 to Thelohania sp. and 0.366 to
T. solenopsae. Vairimorpha sp. also was not closely related to any of the other
microsporidia including V. necatrix. the type species of the genus Vairimorpha (mean
distance Vairimorpha sp./V. necatrix = 0.366).
Based on the branching pattern of the phylogenetic tree (Figure 4.5),
Vairimorpha sp. diverged first from the common ancestor, followed by the two Thelohania
species which diverged after Vairimorpha sp. but before the other microsporidia included
in the analysis. The phylogenetic tree also showed that Vairimorpha. sp. did not group

82
with V. necatrix and the two Thelohania species did not group with A. penaei. In fact,
Vairimorpha sp. and the two Thelohania species did not group closely with any of the
other microsporidia. These findings were supported by the bootstrap analysis of the most
parsimonious tree (Figure 4.6). A phylogenetic analysis of the other microsporidia to each
other has been published (Baker et al. 1995).
Discussion
Molecular differences between species can be of great utility in diagnosing closely
related forms, even where morphological or other traditional markers have failed or are
ambiguous (Avise 1994). The results of the 16S rRNA gene sequence analyses indicated
that Thelohania sp. and Vairimorpha sp. were two distinct species in two different genera.
Furthermore, Thelohania sp. and T. solenopsae were the same species or two subspecies
of the same species. Vairimorpha sp. did not belong into the genus Vairimorpha and the
placement of the two Thelohania species and A. penaei into different genera is probably
justified.
To draw meaningful conclusions based on comparative sequence analyses,
guidelines to delineate different generea and species are needed. What percentage
sequence similarity determines whether two species belong to the same genus or are the
same species? Hartskeerl et al. (1993) proposed 16S rRNA gene sequence similarity
levels of 70% and 90% respectively, to delineate species in different genera or the same
genus. He also compared two isolates of E. bineusi-like microsporidia, believed to be
different species based on site of collection (small intestine vs. maxillary sinus mucosa in
humans), and found a 99% sequence similarity of the 16S rRNA genes. From these
results he concluded that the two isolates are the same species. In the present study, 16S
rDNA PCR product sizes, RFLPs, and sequence comparison of Thelohania sp. and
Vairimorpha sp., the two microsporidia which may coinfect the same host, indicated that

Table 4.2. Pairwise distances between taxa
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
1
The, sp.
.
0.008
0.387
0.384
0.373
0.374
0.370
0.398
0.403
0.425
0.376
0.373
0.366
0.380
0.378
0.377
0.390
0.368
0.432
0.499
2
The, sol.
9
-
0.388
0.385
0.380
0.380
0.376
0.401
0.408
0.426
0.374
0.371
0.366
0.381
0.373
0.381
0.396
0.367
0.434
0.504
3
Nos, bom.
359
364
-
0.004
0.161
0.160
0.170
0.291
0.285
0.341
0.338
0.336
0.328
0.346
0.347
0.362
0.372
0.394
0.384
0.505
4
Nos, &.
356
361
5
-
0.158
0.157
0.167
0.290
0.284
0.338
0.338
0.336
0.328
0.344
0.345
0.362
0.372
0.391
0.382
0.506
5
Vai. nec.
351
361
194
191
-
0.028
0.050
0.277
0.281
0.322
0.321
0.322
0.315
0.333
0.325
0.354
0.363
0.366
0.375
0.491
6
Nos, ves.
352
361
195
192
34
-
0.045
0.277
0.281
0.319
0.320
0.319
0.310
0.329
0.320
0.357
0.365
0.368
0.380
0.489
7
Nos, api.
345
354
198
195
59
54
-
0.291
0.293
0.328
0.324
0.329
0.318
0.339
0.328
0.366
0.382
0.368
0.382
0.496
8
Ene, hel.
396
403
345
344
331
332
338
-
0.089
0.152
0.313
0.311
0.314
0.317
0.352
0.370
0.372
0.373
0.418
0.458
9
Sep, jst.
398
407
338
337
333
336
338
114
-
0.151
0.305
0.303
0.310
0.315
0.358
0.357
0.359
0.368
0.412
0.444
10
Enc. cun.
421
426
396
393
373
374
378
189
189
-
0.334
0.335
0.332
0.339
0.381
0.379
0.377
0.383
0.423
0.450
11
Pie, sp.
362
364
394
394
371
373
369
375
366
399
-
0.007
0.106
0.238
0.302
0.320
0.336
0.373
0.379
0.438
12
End, sch.
358
360
398
398
379
379
374
379
369
399
9
-
0.106
0.239
0.300
0.325
0.331
0.375
0.379
0.439
13
Nos, cor.
354
358
383
383
365
363
363
377
373
398
131
130
-
0.246
0.292
0.339
0.356
0.383
0.394
0.462
14
Ent. bie.
375
379
417
415
399
398
395
398
395
417
293
298
304
-
0.286
0.339
0.357
0.358
0.398
0.438
15
Aem. pen.
370
367
355
353
336
331
337
381
384
410
323
320
313
313
-
0.374
0.392
0.372
0.415
0.486
16
Glu. alh.
383
391
423
423
411
419
421
457
439
464
383
388
407
415
398
-
0.116
0.354
0.339
0.464
17
Ich. sp.
392
402
442
442
429
435
439
467
449
461
402
402
427
445
416
153
_
0.367
0.359
0.471
18
Vai. sp.
375
376
412
409
389
391
388
420
411
428
407
408
419
398
400
409
422
.
0.428
0.390
19
Arne, mic.
418
424
438
436
427
435
421
508
496
499
436
444
455
473
423
414
446
471
0.520
20
Gia. lam.
522
532
611
612
593
596
583
583
564
561
533
543
565
557
529
608
626
466
650
Species are as follows: 1, Thelohania sp.; 2, X solenopsae: 3, Nosema bombvcis (L39111*); 4, N- trichoplusiae (U09282); 5, Vairimorpha necatrix (Y00266); 6,
. vespula (U11074); 7, N- apis. (X73894); 8, Encephalitozoon hellem (L19070); 9, Sepatata intestinalis (U09929); 10, £. cuniculi (Z19563); 11, Pleistonhora sp.
(U10342); 1Z Endoreticulatus schubergj (L39109): 13. N. comeum (U11046): 14. Enterocvtozoon bieneusi (L071231:15. Aemasomapenaei: 16. Glugea athennae
(15987); 17, Ichthvosporidium sp. (L39110); 18 Vairimorpha sp.; 19, Ameson michaelis (L15741); 20, Giardia lamblia (M54878). Numbers above diagonal: mean
distances (adjusted for missing data); numbers below diagonal: absolute distances.
* (GenBank accession number)

84
Thelohania sp. *
Thelohania solenopsae *
Nosema bombycis
Nosema trichoplusiae
Vairimorpha necatrix
Nosema vespula
Nosema apis
Encephaliiozoon hellem
Sep tata intesiinalis
Encephalitozoon cuniculi
Pleistophora sp.
Endoreticulates schubergi
Nosema comeum
Enterocytozoon bieneusi
Agmasoma penad *
Glugea atherinae
Ichthyosporidium sp.
Ameson michaelis
Vairimorpha sp. *
Giardia lambliae
Figure 4.5. Phylogenetic tree (3,511 steps) based upon the 16S rDNA sequences
of the 19 species of microsporidia aligned in Figure 4.4. Giardia lamblia was used as the
outgroup. The tree, presented as a cladogram, was generated using the heuristic option of
PAUP. Species, whose sequences were obtained by the author, are marked with

85
Bootstrap
. Thelohania sp. *
Thelohania solenopsae *
Nosema bombycis
. Nosema trichoplusiae
Vairimorpha necatrix
Nosema vespula
Nosema apis
Encephalitozoon hellem
. Septata intestinalis
Encephalitozoon cuniculi
Pleistophora sp.
.Endoreticulates schubergi
Nosema comeum
Enterocytozoon bieneusi
Agmasoma penaei *
Glugea atherinae
Ichthyosporidium sp.
.Ameson michaelis
. Vairimorpha sp. *
Giardia lambliae
Figure 4.6. Bootstrap analysis (100 replicates) of the phylogenetic tree presented
in Figure 4.5. Numbers on the tree indicate the percentage of bootstrap replicates which
contained that topology. Bootstrap analysis was performed with PAUP. Species, whose
sequences were obtained by the author, are marked with

86
their small subunit ribosomal gene sequences were very different The PCR 1400 bp
product of Thelohania sp. was roughly 100 bp larger than the PCR product of
Vairimorpha sp. In addition, Vairimorpha sp. 16S rDNA had different restriction patterns
than Thelohania sp. for several enzymes tested. Sequence comparison of the 16S rDNAs
revealed a sequence similarity of 63.2% (or mean distance of 0.368) between the two
microsporidia. These data, supported by Haartkeerls et al. (1993) guideline of
percentage sequence similarity for different genera, uphold the hypothesis that Thelohania
sp. and Vairimorpha sp. represented two species in two different genera and not two
phenotypes of the same species.
Even though spores of Vairimorpha sp. and Thelohania sp. were distinct at the
light microscopic and ultrastructural level, they could have been different phenotypes of
the same species. Many microsporidian species have more than one spore type such as the
dimoiphic genera Vairimorpha and Parathelohania (Sprague et al. 1992). Vairimorpha
necatrix. for example, was initially described as two species, Nosema necatrix and
Thelohania diazoma (Kramer 1965) because of its two morphologically distinct spore
types. Later it was recognized that V. necatrix is a dimorphic species (Maddox 1966;
Fowler and Reeves 1974; Pilley 1976). Another example of a polymorphic
microsporidium is given by Becnel (1992) who described the heterosporous Amblvospora
califomica with three moiphologically and functionally distinctive spore types.
Vairimoipha necatrix. the type of the genus Vairimorpha. shared ~ 63% sequence
similarity with Vairimorpha sp. which was indicative that Vairimorpha sp. may not belong
in the genus Vairimorpha. Other data such as ultrastructure of the spores support this
hypothesis. Both spore types of Vairimorpha sp. are ultrastructurally distinct from
Y- necatrix. For example, free spores of V. necatrix (Mitchell and Cali 1993) and
Vairimorpha sp. differ in the arrangement of the polar filament and polaroplast structure,
and meiospores of the two species differ in thickness of exospore and endospore.
Different sized 16S rDNA PCR products and a sequence similarity of -63% of the

87
Thelohania species with A. penaei also indicated that A. penaei and the two Thelohania
species belonged different genera. The sequence of A- penaei is presently the only
sequence available of a microsporidium close to Thelohania. Generally, other studies also
agree with Hartskeerls et al. (1993) suggestion of the 70% and 90% cutoff for different
genera and different species within the same genus. For example, E. cuniculi shares about
72% sequence similarity with V. necatrix (Schuitema et al. 1993). Vossbrinck et al.
(1993) find a 90% sequence similarity between V. necatrix and V. lvmantriae and 77%
sequence similarity between E. cuniculi and E. hellem in regions of the small and large
subunit rDNA and the internal spacer. These data, even though quite different from each
other, fall within the 70-90% range for different species within the same genus.
On the other hand, sequence similarities of S. intestinalis and E. cuniculi or
E. hellem are 77% and 73% respectively (Weiss et a. 1994), which according to Weiss et
al. (1994) supports placement of these species into different genera which would not be in
accordance with Hartskeerls et al. (1993) proposed rule. However, Hartskeerl et al.
(1993) and Baker et al. (1995) suggested to reclassify £. intestinalis as E. intestinalis based
on reanalysis of the 16S rDNA sequences. They find sequence similarities of about 90%
(Hartskeerl et al. 1993) and 94% (Baker et al. 1995) between S. intestinalis and both
species of E. hellem and E. cuniculi (Note: The mean distances for S. intestinalis/
E. hellem and £. intestinalis/E. cuniculi (Table 4.2) are 0.089 and 0.151 (that is
£ intestinalis/E. hellem and £. intestinalis/E. cuniculi have 91% and 85% sequence
similarities). The slight discrepancy of the results reported in this study and the results
published previously is probably because not exactly the same regions of the 16S rDNA
were aligned and analyzed).
Looking at the available data, one must keep in mind that molecular taxonomy is
most convincing when supported concordantly by multiple lines of evidence (Avise 1994).
Placement of microsporidia into different genera or species based on a certain percentage
sequence similarity is subjective and, because of lack of clear-cut sexual stages, should be

88
supported by inclusion of other available characters such as morphology, host and tissue
specificity, biochemical profiles and available classification schemes.
PCR product size and RFLPs of Thelohania sp. and T. solenopsae were identical
for the enzymes tested, and sequence comparison showed 99.2% identity (or a mean
distance of 0.008) between the two microsporidia. According to Hartskeerl et al. (1993),
the high sequence similarity would place them in the same species. The sequence analyses
data in conjunction with light microscopic and ultrastructural studies of the spore
morphology indeed support the hypothesis that Thelohania sp. and T. solenopsae may be
the same species or two closely related subspecies. Similarly, Pleistophora sp. and
E. schubergi. two microsporidia infecting Lepidoptera, have a very small 16S rDNA
sequence difference (mean distance = 0.007), and Pleistophora sp. should be reclassified as
an Endoreticulatus sp. (Baker et al. 1995). Joseph Maddox suggests (personal
communication) to consider Pleistophora sp. and E. schubergi as intraspecific variants of
one species, E. schubergi. because they are indistinguishable based on tissue specificity
(both are midgut parasites), ultrastructure and almost identical 16S rDNA sequences.
In contrast, E. hellem and E. cuniculi. also indistinguishable by ultrastructure and
development, have a 16S rDNA sequence mean distance of 0.152 (Table 4.2). It should
be noted that Baker et al. (1995) published a mean distance of 0.066 between E. hellem
and E. cuniculi. This difference is due to the fact, that Baker et al. (1995) excluded parts
of the 16S rDNA sequences in their analysis. They analyzed only those characters which
they could align unambiguously. The mean distance of 0.152 supports the classification of
E. hellem and E. cuniculi as two separate species (even though they are indistinguishable
by fine strucure and development) as shown by Didier et al. (1993) with immunological
and biochemical tests.
The two respective host ants of T. solenopsae and Thelohania sp., £ invicta and
£. richteri, are also very closely related, and it is still debated whether they represent color
morphs of one species or two separate species (Vander Meer and Lofgren 1988). To

89
make a final determination on whether T. solenopsae and Thelohania sp. are conspecific,
crucial data on the life cycles and host specificities of these microsporidia are still needed.
For example, can Thelohania sp. infect £. invicta and T. solenopsae infect £. richteri
(cross-infectivity), and can the infection cycle be completed successfully? As trivial a
question this may seem, so far it is not even possible to infect S. invicta with T. solenopsae
and S. richteri with Thelohania sp. under laboratory or field conditions (data not shown;
R.S. Patterson personal communication).
The following example illustrates why it is important to have data on cross-
infectivity under natural conditions with the two Thelohania species in support of the
sequence analysis data. Nosema bombycis and N. trichoplusiae have almost identical 16S
rDNA sequences (mean distance = 0.004). They belong to a group of indistinguishable
Nosema species infecting Lepidoptera (Nordin and Maddox 1974). However, even
though N. trichoplusiae and N. bombycis have very similar life cycles, ultrastructural
characteristics, and 16S rDNA sequences, J. Maddox (personal communication) proposes
to treat them as two different species because cross-infectivity (possible in the laboratory)
between their hosts has not been demonstrated under natural conditions.
When comparing closely related sequences, one must also be aware of possible
sources of variation which include (1) error rate of DNA polymerase during PCR and
sequencing reaction (Barnes 1994), (2) variation among the different copies of the 16S
rRNA gene, and (3) intraspecific variation (Li and Graur 1991). The error rate (or
number of mutations per base per cycle) of Taq DNA polymerase is about 25x1o-6
(Boehringer Mannheim Biochemica Bulletin No. 3 1995). The error frequency of
Primezyme DNA polymerase is less than 80x10"* (Biometra Catalog 1994). This fact is
not important when sequence differences are big, but it is more important when sequence
differences are very small. To compensate for fidelity problems of the DNA polymerases,
both strands were sequenced at least three times.

90
Even though multiple copies of nuclear rRNA genes do not evolve independently
but in concert (Amheim 1983) there may be a low level of heterogeneity at about 0.1% of
the nucleotide positions among rDNA within individuals and throughout species
(Mylvaganam and Dennis 1992). Again, this low level of heterogeneity is not important
when comparing dissimilar sequences but gains importance in the comparison of very
closely related sequences. Since PCR products of Thelohania sp., Vairimorpha sp. and
A. penaei were sequenced directly, no conclusions about intraindividual or intraspecific
variation can be drawn. Sequence data of three clones of the 16S rRNA gene of
T. solenopsae showed a very low level of heterogeneity (about 0.1%), but this is not
reflective of intraindividual or intraspecific variation. Cloning of the PCR product selects
single molecules which may harbor nucleotide misincorporations due to the error rate of
the DNA polymerase. Intraindividual and intraspecific variation of microsporidia need to
be investigated in further studies. Intraindividual variation of the multiple copies of the
16S rRNA gene would require cloning of the PCR product of single spore isolates. In an
initial study to research intraspecific variation of fire ant microsporidia, 16S rDNA
sequences of the same microsporidian species, Thelohania sp., isolated from different
S. richteri ant colonies, could be compared. The different isolates could be regarded as
different individuals of the same species. The advantage of working with Thelohania sp.
instead of Vairimorpha sp. or T. solenopsae is that we have plenty of material available of
Thelohania sp.but not the other species.
Yet another consideration is that two species may still not be the same species
even if they have an identical 16S rDNA sequence (which does represent but a small
portion of the genome) (J. J. Becnel, personal communication). It is prudent to confirm
results found by sequence comparison of one gene with sequence comparisons of another
gene. Studies on sequence comparisons of another gene such as the 23S rRNA gene or
internal spacer (Vossbrinck et al. 1993) to corroborate results from sequence comparisons
of the 16S rDNA gene should be initiated. The cytochrome c gene (Woese 1987) which is

91
frequently used in eukaryotes, may also be present in microsporidia and could be used for
additional sequence analyses.
The phylogenetic tree (Figure 4.5) in this study is similar to the tree published by
Baker et al. (1995) except that in our analysis, V. oncoperae and a different
Vairimorpha sp., used by Baker, were not included. In addition to the species whose
sequences were obtained by the author, we also included G.atherinae in the analysis.
Baker et al. (1995) found four groups: The Ichthyosporidium group (comprised of
A. michaelis. Vavraia oncoperae and Ichthyosporidium sp.), the Encephalitozoon group
(comprised of E. hellem. E. cuniculi and S. intestinalis). the Vairimorpha/Nosema group
(comprised of N. apis, N. vespula (also called Nosema sp.), N. trichoplusiae. N. bombvcis.
V. necatrix and Vairimorpha sp.) and the Endoreticulates group (E. schubergi.
E. bieneusi. N. comeum and Pleistophora sp.). The Vairimorpha sp. in Bakers study is
not the same Vairimorpha sp. used in this study. It was isolated and identified from the
gypsy moth Lvmantria dispar by J. Maddox while the one in the present study was found
in the black imported fire ant £. richteri.
We obtained the same groups in our phylogenetic tree. Glugea atherinae was
placed in the Ichthyosporidium group (bootstrap value of 97%). Agmasoma penaei was
placed in the Endoreticulates group (bootstrap value of 78%). In addition, we found two
new taxon groups, one comprised of the two Thelohania species (bootstrap value of
100%) and one comprised of Vairimorpha sp. More species need to be analysed however,
to support the validity of these two groups. The tree branching pattern (Figure 4.5) and
the mean distance between Vairimorpha sp. and V. necatrix of 0.366 showed that
Vairimorpha sp. is unrelated to the true Vairimorpha.
The study of Baker et al. (1995) also supports the need to rearrange the current
microsporidian classification. They determined, based on mean distance and branching
pattern of the phylogenetic tree, that N. corneum is not a true Nosema species (Figure
4.5) but more closely related to E. schubergi.. They reported that the 16S rRNA gene

92
sequence of N. comeum has only 72% sequence similarity with N. bombvcis. It has a
93% sequence similarity with E. schubergi.
In conclusion, the sequence analyses data in conjuction with other information
such as ultrastructure and tissue specificity of the fire ant microsporidia support the
hypotheses that (1) Thelohania sp. and Vairimorpha sp. are two distinct species in two
different genera and not mere phenotypes of the same species, (2) Thelohania sp. and
T. solenopsae are the same species or two subspecies of the same species,
(3) Vairimorpha sp. does not belong into the genus Vairimorpha and (4) A. penaei and the
two Thelohania species are separate genera. Data on cross-infectivity of Thelohania sp.
and T. solenopsae in their respective hosts are needed however, to draw a biologically
meaningful final conclusion.

CHAPTER V
SUMMARY AND DIRECTION OF FUTURE RESEARCH
Synopsis
Comparative phenotypic (light microscopic and ultrastructural features) and
genotypic (sequence comparison of the 16S rRNA genes) analyses of the fire ant
microsporidia support the following conclusions:
(1) Vairimorpha sp. and Thelohania sp. are distinct species in separate genera and
not mere different phenotypes of the same species. (2) Thelohania sp. and T. solenopsae
are either two subspecies of the same species or conspecific. Cross-infectivity in field
situations needs to be demonstrated, however, to make this conclusion biologically
meaningful. In other words, infection and completion of the infection cycle of £ invicta
with Thelohania sp. from S. richteri. and of S. richteri with T. solenopsae from S. invicta
must be achieved. (3) Vairimorpha sp. does not belong in the genus Vairimorpha.
Additional evidence to corroborate conspecificity could focus on comparative
sequence analysis of another gene (perhaps the 23S rRNA gene or the cytochrome c
gene). Since microsporidia do not have mitochondria and virtually nothing is known
about their metabolic pathways, the presence of a cytochrome c gene must first be
demonstrated.
Qualitative and quantitative FAME profile differences were detected in the
different microsporidian species but the host insect did influence the FAME profile of a
microsporidium. Improved methodology could render FAME analysis as a useful
taxonomic character. Future experiments could include standardization of microsporidian
growth through the development of in vitro culture techniques. Furthermore, the sample
93

94
size presently required for FAME analysis (lxlO9 spores) could be reduced by scaling
down the extraction and derivatization procedure. Also, FAME profiles of a wide variety
of microsporidian genera and species should be determined to look for signature fatty
acids that would be present only in one genus (or species).

APPENDIX
Cuticular hydrocarbon analysis of Solenopsis richteri and S. invicta
1. Soak five worker ants, frozen at -20C until analysis, in 1 mL of hexane in small vials
for 2 h to extract lipids.
2. Separate hydrocarbons from the extracted lipids with chromatography on mini
columns containing 3 cm of silica gel (60-200 mesh, J.T. Baker, Philadelphia, Pa.)
packed into disposable Pasteur pipettes (Carlson and Bolten 1984). To make a
column, stuff a little glass wool into a Pasteur pipette and pour silica gel on top of it.
3. Elute hydrocarbons from the mini-column with 3 mL of hexane, concentrate them to
dryness with nitrogen gas, and redissolve them in 20 pL of hexane for GC analysis
(Carlson and Brenner 1988).
4. Analyze hydrocarbons with a 5890 series II Hewlett Packard gas chromatograph
with flame ionization detector fitted with a 30 m x 032 mm i.d. x 0.25 |im film
thickness fused silica capillary column of DB-1.
5. Following a cool-on column injection of 1 pL at 63C, raise oven temperature to
230C at 25C/min, and then to a final temperature of 320C at 7C/min. Hold
temperature at 320C for 15 min. The carrier gas was hydrogen.
6. Process data by HP Chemstation, version 1.0 software.
Per os infection of com earworm. Helicoverpa zea with Vairimorpha necatrix
1. Sprinkle com earworm eggs on pinto bean diet in 50 well flats, keep them in the
insectary at 23C with a photo period of 16 h light/8 h dark. Secure flats with clear
plastic foil and solid metal or plastic sheet to prevent larvae from escaping.
2. After approximately 5 days, discard all but one healthy larva from each well. Add 10
pL of 1x10^ spores/mL to the diet of each larva.
3. Harvest the spores from last-instar larvae.
Per os infection of H. zea with Nosema algerae
1. Sprinkle com earworm eggs on pinto bean diet in 50 well flats, keep them in the
insectary at 23C with a photo period of 16 h light/8 h dark.
2. Pick 4-5 day old H. zea larvae and starve them individually in small plastic cups for
24 h.
3. After 24 h, add 20 pi of 1x10^ spores/mL deionized water to each cup.
4. Expose the larvae for 24 h to the spore suspension.
95

96
5. Place larvae on pinto bean diet (one larva/well); secure flat with clear plastic foil and
solid sheet of metal or plastic to prevent larvae from escaping.
6. Harvest the spores from adult moths.
Per os infection of Anopheles quadrimaculatus with N. algerae
1. Sprinkle 1000 mosquito eggs onto 100 mL infusion water and keep in insectary at
23C with a photoperiod of 16 h light/8 h dark. Infusion water consists of a 0.015%
powdered liver: brewer's yeast (1:1) suspension.
2. After 24 h, make slurry with ground alfalfa; pour into 150 mL container. Add 1x10^
spores in aqueous suspension and the neonate larvae in 100 mL hatching water. The
final concentration of the alfalfa suspension should be 0.03 %.
3. After 24 h, make alfalfa slurry for 3 L water. Pour slurry into big rearing pan, add
mosquito larvae and 3 L of deionized water. The final concentration of the alfalfa
suspension should be 0.03%.
4. Check after 48 h if larvae need to be fed (1 g of powdered livenbrewers yeast (1:1)
in slurry).
5. After additional 48-72 h feed larvae with 2 g of powdered liver:brewer's yeast:hog
chow (40% protein) (1:1:1) mix in slurry.
6. Feed again after 24-48 h with 1 g of powdered liver: brewer's yeast: hog chow (40%
protein) (1:1:1) mix slurry.
7. When larvae start pupating pick pupae daily into small cups and keep in mesh cages
until emergence. Add cotton balls saturated with 10 % dextrose to maintain adults.
8. Harvest the spores from the adult mosquitoes 3-5 days post-emergence.
Purification of V. necatrix from H. zea
1. Establish continuous density gradient with Ludox (a colloid of 40% silica in NaOH
solution, pH 9.8 and specific gravity p of 1.303) using gradient mixer. Load 15 mL
of Ludox in one chamber and 15 mL of deionized H2O in the other chamber; a
magnetic stirrer in the Ludox chamber mixes the diluent with the Ludox. A plastic
hose drains the Ludox chamber into a 30 mL centrifuge tube (Undeen and Alger
1971).
2. Surface-sterilize last-instar infected larvae in 70% ethanol and cut open in a
dissecting dish.
3. Remove fat bodies without lacerating gut tissues, place in deionized water and grind
in glass tissue grinder.
4. Strain resulting suspension through cotton plug in glass syringe to remove large body
parts.
5. Centrifuge at 4,080 g in swinging-bucket head rotor (Sorvall S 34 centrifuge) for 15
min.
6. Discard supernatant and wash pellet once in deionized H2O. Resuspend pellet in ~
500 pL of deionized H2O.
7. Layer suspension on continuous Ludox gradient

97
8. Centrifuge at 16,320 g for 30 min in swinging-bucket head rotor.
9. Draw off the bands with Pasteur pipette, examine samples under microscope to
confirm identity of purified organisms.
10. Wash spores twice in deionized H2O to remove Ludox. Store in deionized H2O at
4C.
Purification of N, algerae from H. zea
1. Establish continuous density gradient with Ludox (a colloid of 40% silica in NaOH
solution, pH 9.8 and specific gravity p of 1.303) using gradient mixer.
2. Rinse adult infected moths in water, clip off wings, and triturate in Tekmar
Tissumizer in deionized water.
3. Strain through cotton plug in glass syringe to remove large body parts.
4. Follow steps 5-10 of V. necatrix purification protocol.
Purification of N. algerae from A. quadrimaculatus
1. Establish continuous density gradient with Ludox (a colloid of 40% silica in NaOH
solution, pH 9.8 and specific gravity p of 1.303) using gradient mixer.
2. Immobilize adult infected mosquitoes by chilling them at -20C for about 3 min.
Aspirate them with an aspirator connected to a vacuum pump.
3. Homogenize the mosquitoes with a small amount of deionized water in a Waring
blender.
4. Strain resulting suspension through cotton plug in glass syringe to remove large body
parts.
5. Follow steps 5-10 of V. necatrix purification protocol.
Purification of Thelohania sp. from S. richteri
1. Establish continuous density gradient with Ludox (a colloid of 40% silica in NaOH
solution, pH 9.8 and specific gravity p of 1.303) using gradient mixer.
2. Homogenize infected ants with Tekmar Tissumizer in ant homogenizing buffer (0.1 %
SDS, 10 mM Tris-HCl, pH 7.5, 1 mM EDTA).
3. Strain through cotton plug to remove large body parts.
4. Centrifuge at 4,080 g in swinging-bucket head rotor (Sorvall S 34 centrifuge) for 15
min.
5. Discard supernatant and wash pellet once in deionized H2O.
6. Incubate pellet in 10 pg/mL proteinase K and 1/4 volume of pansporoblastic
membrane disruption buffer (4% SDS, 25 mM EDTA, 50 mM Tris-HCl, pH 7.5) for
10 min at 40C.
7. Follow steps 7-10 of V. necatrix purification protocol.

98
Fattv acid methyl ester (FAME-) extraction of microsporidia
1. Pipette 1x10^ spores into a 13x100 mm culture tube and store overnight at 4C to
allow the spores to settle.
2. The next day, carefully withdraw the supernatant. Add 1 mL of 15% NaOH in 50%
methanol, seal tube, and saponify fatty acids at 100C for 30 min.
3. Upon cooling, add 2 mL of 6 N HC1 in 50% MeOH, recap tube, heat at 80C for 10
min to methylate the fatty acids.
4. Solvent-extract fatty acid methyl esters (FAME) from the aqueous phase with 1.25
mL of hexane:methyl-tert-butyl ether (1:1; v/v).
5. Wash organic phase with 3 mL of 1.2% aqueous NaOH and transfer to a gas
chromatograph (GC) vial.
Fatty acid methyl ester (FAME-) analysis with gas chromatography (GC)
1. Analyze FAME with a Hewlett Packard 5890 gas-liquid chromatograph fitted with
an Ultra 2 fused silica capillary column (25 m x 0.2 mm i.d. x 0.33 pm film thickness)
coated with 5% phenyl methyl silicone.
2. Inject 1 pL of FAME sample. Raise temperature from 170C to 270C in 5C/min
increments using hydrogen as the carrier gas. After flame-ionization, measure
FAME peaks by a Hewlett Packard 3392 integrator and express as percentages of
the total FAME profiles.
Analysis of FAME mixtures by coupled gas chromatography mass spectrometry (GC-
MS)
1. Analyze aliquots of the FAME mixtures on a Perkin Elmer 8420 GC interfaced with
a Finnigan Ion Trap Detector (ITD, Model 6210), with INCOS data collection
software and a 80286 computer. The GC-MS was fitted with a 25 m x 0.25 mm i.d.
DB-1 fused silica capillary column.
2. Inject 1 pL samples in a splitless mode followed with a purge flow of helium after 30
sec. The carrier gas was helium with a flow rate of 25 cm/sec. The initial
temperature of the column was 60C, and following injection the temperature was
programmed to 150C at 30C/min, then programmed to 220C at 5C/min, and held
for a total running time of 100 min.
Transmission electron microscopy
Fixation:
1. Dissect specimen in 2.5% glutaraldhyde.
After 5 minutes or so, specimen can be cut into smaller pieces.
2. Transfer pieces to fresh glutaraldhyde and fix for total of 2.5 hours.

99
3. Wash in 0.1 M cacodylate buffer (pH 7.2 7.3) 3 times at 15 minutes each (for a
total of 45 minutes).
4. Postfix in 1.0% osmium tetroxide (pH 7.5) for 1 hour 45 min. to 2 hours.
5. Double distilled washes 3 times at 15 minutes each (for a total of 45 minutes).
6. Begin dehydration or for extended storage use sucrose buffer.
Dehydration:
1. 10% ETOH 10 minutes
2. 30% ETOH 10 minutes
3. 50% ETOH 10 minutes
4. 70% ETOH 10 minutes
5. 80% ETOH 10 minutes
6. 90% ETOH 10 minutes
7. 95% ETOH-10 minutes
8. 100% ETOH 15 minutes
9. 100% ETOH 15 minutes
10. 100% Acetone -15 minutes
11. 100% Acetone 15 minutes
Put specimen into plastic dilutions.
Infiltration and Embedding:
1. 25% resin: 75% absolute acetone overnight
2. 50% resin: 50% absolute acetone 4 hours
3. 75% resin: 25% absolute acetone 4 hours
4. Pure resin overnight
5. Pure resin (change vials) all day (6 hours)*
*For better infiltration, especially for spores, extend the specimen in pure resin for
another day (overnight) or over the weekend. Embed as usual.
6. Embed in Beem capsules which have dried at least 24 hours in a 60C oven. Make
sure to include label with block number when embedding. Leave in oven overnight
7. Remove the embedded blocks next morning and let them cool off before cutting out
blocks.
8. Blocks are now ready for thick-and thin-sectioning.
9. Stain thin section with methanolic uranyl acetate (50% methanol, 1% uranyl acetate)
for five min. Rinse grids in deionized H20, blot dry and stain with lead citrate
(Reynolds 1963) for 5 min. To stain, immerse the grids into droplets of lead citrate.
Blot dry.

100
PCR protocol
1.For one 25 pL reaction, prepare master mix in a sterile, 0.5 mL microfuge tube. To
prevent carry-over contamination, use plugged cotton tips.
lOx buffer* 2.50 pL
lOx nucleotide mix (2 mM dATP/dGTP/d 1" 1 P/dCTP 2.50 pL
primer 1 (4 pmol/pL) 1.00 pL
primer 2 (4 pmol/pL) 1.00 pL
sterile distilled (sd) H20 7.84 pL
DNA Ta^Pol 0.8 U/reaction 0.16 pL
or Primezyme DNA pol. 0.3 U/reaction 0.16 pL
*7a<7Pol lOx reaction buffer: 100 mM Tris-HCl, 500 mM KC1, and 25 mM
MgCl2. Primezyme DNA polymerase lOx reaction buffer: 100 mM
Tris-HCl, 500 mM KC1, 1% Triton X-100, and 25 mM MgCl2
Add the enzyme after the master mix has been heated for 5 min.
Final volume of master mix is 15 pL. Keep the master mix on ice.
2. To another sterile 0.5 mL microfuge tube, add DNA template in a volume of 10 pL.
Overlay with either 100 pL sterile glycerol or 50 pL Chill-out 14 Liquid Wax (MJ
Research). Heat template and master mix in heating block to 94C for 5 min. Add
DNA polymerase to master mix and vortex. Add 15 pL of master mix to template.
Start temperature cycling (1 min at 94C, 1 min at 52C, 1 min at 72C for 35 cycles
followed by a final extension step of 72C for 15 min).
3. Mix 5 pL aliquot of PCR product with 5 pL of lx loading dye (lOx loading dye:
50% glycerol, 50 mM EDTA, 0.5% bromophenol blue) and electrophorese on a
0.8% Seakem LE agarose gel in lx Tris-acetate running buffer (TAE; 40 mM Tris-
acetate, pH 8.0, 1 mM EDTA, pH 8.0).
4. Purify PCR products with the QIAquick PCR Purification Kit (QIAGEN), elute in
sdH20 or TE (10 mM Tris-HCl, pH 8.0,4 mM EDTA, pH 8.0) and store at -20C.
QIAquick PCR purification:
Add 5 vol (e.g. 500 pL ) of buffer PB to 1 vol (e.g. 100 pL) of PCR
reaction and mix. Place a QIAquick spin column into a 2 mL collection
tube and load the sample. Centrifuge 30-60 sec at maximum speed. Drain
flowthrough fraction from collection tube and place QIAquick column back
in the same tube. To wash, add 750 pL of buffer PE to column and
centrifuge 30-60 sec. Drain buffer PE flowthrough from existing tube and
spin column again to remove residual buffer PE. Place column in a clean
1.5 mL microfuge tube. To elute DNA, add 50 pL of 10 mM Tris-HCl,
pH 8.0 or 50 pL of sdH20 to column and centrifuge for 30-60 sec.
Cloning of PCR product
1. Clean PCR product (has restriction sites added to ends) on Qiaquick PCR
purification column. Use 100 pL of crude PCR product. Elute bound DNA from
column with 50 pL of TE (10 mM Tris-HCl, pH 8.0, 4 mM EDTA, pH 8.0).

101
2 Load aliquot on gel to check recovery rate.
3. Add equal amount (= 50 pL) of 20 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% SDS
to column-purified PCR product.
4. Add proteinase K (stock of 5 mg/mL) to final concentration of 5 pg/100 pL.
Incubate at 37C for 30 min.
5. Clean on Qiagen column, load aliquot to check recovery rate.
6. Double-digest with the appropriate restriction enzymes (New England Biolabs) to
create overhanging ends.
48.0 pL DNA in TE, pH 8.0
1.0 pL of each restriction enzyme
5.5 pL of lOx restriction buffer (New England Biolabs)
Incubate at 37C for 4 h.
For restriction enzyme digest of PCR products use BamWl (20 U/yL) and Kpnl (15
U/yL) to digest Vairimorpha PCR products (sequential digest because of different
buffer -low salt followed by high salt- requirements), use BamHl (20 U/yL) and
EcoRI (20 U/yL) to digest Thelohania PCR products (double digest).
Note: Double-digest the plasmid DNA (pTZ 19R) at the same time and purify (can
use Qiagen column or SeaPlaque agarose purification).
7. Clean double-digested DNA on Qiagen column and load aliquot on gel to check
recovery and digestion.
8. Controls to see if digestion worked:
Electrophorese 1.0 yL aliquot of 100 ng/yL uncut plasmid
Electrophorese 2.0 yL aliquots of plasmid digested with either enzyme. Include 1 kb
bacteriophage lambda (A.) DNA ladder (BRL Life Technologies. Inc.).
9. Ligation of PCR product to plasmid DNA:
17.0 yL DNA suspension
2.0 yL lOx ligation buffer
1.0 yL T4 ligase (400 U/yL) (New England Biolabs)
Note: Use a 1:3 mole ratio of vector (pTZ 19R) to PCR product in ligation mix.
For example: If using 200 ng DNA of a 2.9 kb plasmid, how much PCR product
(1.2 kb) DNA should be used? 200 ng plasmid DNA/2.9 kb = ? ng PCR product
DNA/1.2 kb x 3
Ligate at room temperature for 4 h in the dark; then store at 4C.
Control: Ligate digested PCR product DNA to each other (not into plasmid). Run
gel; expect to see ladder of bands if digestion and ligation worked well; will see only
primer-dimers if digestion and/or ligation didn't work.
10. Transformation of E. coli JM109 competent cells (have the F episome which allows
them to be infected by M13 to produce single-stranded DNA):
Heat the ligation mix at 65C for 10 min to inactivate enzyme and enhance
transformation
Put ice bucket with ice into the hood.
Remove 50 yl aliquots of competent cells from -70C freezer, thaw on ice.
Add 1 and 5 yl of DNA ligation reaction directly to the cells, moving the pipette
through cells while dispensing.
Incubate cells on ice for 30 min.

102
Incubate cells for 30 sec. at 37C; do not shake.
Place on ice for 2 min.
Add 0.95 mL of room temperature S.O.C. medium and mix gently.
S.O.C. medium (per 1 liter diH20): 2% bacto-tryptone (w/v), 0.5% bacto-
yeast extract (w/v), 0.05% NaCl (w/v), 2.5 mM KC1; adjust to pH 7.0 with
5 N NaOH, autoclave, let cool to ~ 60C and add 20 mL of sterile solution
of 1 M glucose (20 mM glucose final cone.); just before use, add 5 mL of
sterile solution of 2 M MgCl2.(10 mM MgCl2 final cone.).
Grow cells at 225 rpm and 37C for 1 h.
Spread 100-200 pi of the cell suspension on LB plates.
LB media: 1% bacto-tryptone (w/v), 0.5% bacto-yeast extract (w/v), 1%
NaCl (w/v).
10 LB plates: Autoclave 100 mL of LB media + 1.5 g agar (bacto) in a
500 mL flask. When still pretty warm, add 100 pL of X-Gal (20 mg/mL
stock) which gives a final cone, of 20 flg/mL and 4 mL of ampicillin (2.5
mg/mL stock) which gives a final cone, of 100 pg/mL of ampicillin. Then
pour ten plates.
Keep remaining cell suspension at 4C overnight
If no colonies grew on plate after one night, concentrate cells of remaining cell
suspension by centrifugation for 5 sec. Resuspend in 100 pi of medium.
Remove 10- and 1- pi aliquots and add 100 pi of medium to them. Plate out these
dilutions and the remaining 90 pi.
Incubate overnight at 37C. The ampicillin-resistant white colonies carry the
plasmid with ligated DNA.
Controls: Plate out cells transformed with (a) uncut plasmid, (b) double-digested
plasmid, (c) double-digested plasmid ligated to PCR product DNA.
E. coli colony hybridization; dot blots
Day 1
1.Plate E. CQ transformants from LB plates (amp+, X-gal+) onto LB plates (amp+)
with numbered grid lines. Incubate over night at 37C for 16 h.
Day 2
1. Use a soft pencil and spot a Hybond-N nylon membrane 1 cm apart, 10 spots per row.
Resuspend a toothpick head full of E. coli transformants in 10 pL LB broth and spot
lpL of cell suspension onto the markings of the membrane.
2. Immerse the membrane in 0.5 M NaOH/1.5 M NaCl solution for 30 sec. Make sure
the membrane is completely immersed in the solution.
3. Transfer the membrane to 0.5 M Tris-HCl, pH 8.0/1.5 M NaCl solution and immerse
for 5 min.
4. Transfer membrane to 6x SSC and immerse for 5 min.
20x SSC: Dissolve 175.3 g of NaCl and 88.2 g of sodium citrate in 800
mL of H20. Adjust to pH 7.0 with 10 N HC1. Aliquot and autoclave.

103
5. Wrap the membrane in Whatman blot paper and bake at 80C for 2 h under vacuum.
Store the membrane in drawer.
Day 3
1. Place membrane in hybridization tube and wet it in 5 mL of 6x SSC. Discard 6x SSC.
2. Add prehybridization solution at 10 mL per 10 cm2 of membrane. Rotate in
hybridization chamber for 4-6 h at 68C.
Prehybridization/Hybridization solution (100 mL)
200 pL EDTA (0.5 M)
35 mL of 20% SDS
50 mL Na2HP04 pH 7 (1 M)
15 mL H20
3. Nick translate PCR product DNA.
PCR product DNA (~40 ng/pL)
TE
lOx Nick buffer*
100 pM dNTP
32P-dCTP-3000
DNAase
DNA Pol I (5U/pL)
*0.5 M Tris-HCl, pH 7.2, 0.1 M MgS04, 1 mM dithiothreitol, 500 pg
bovine serum albumine (BSA).
Incubate at 15C for 45 min. Mix the probe with 1 mL TE and pass over a Sephadex-
50 packed column. Reject the first 0.5 mL flowthrough and collect the rest in a sterile
glass tube. Add 2 mL TE to the column after the probe got into the column and
collect the flowthrough. Boil the probe by placing the glass tube in a boiling water
bath for 3 min and mix with ~ 5 mL hybridization solution before adding to the
membrane.
4. Remove prehybridization buffer and hybridize the membrane in 10 mL hybridization
buffer containing the radioactive probe for 16 h at 68C.
3 pL
10 pL
3 pL
1 pL each
5 pL (50 pQ)
3 pL (1 mg/mL)
3 pL
Day 4
1. Wash the membrane with washing solution 12 times in ~50 mL fluid at 68C for 1 h
each. Then wash membrane wish washing solution II2 times in ~50 mL fluid at 68C
for 1 h each.
Washing solution I (5% SDS cone.; per liter)
2 mL EDTA (0.5 M)
40 mL Na2P04 pH 7.2 (1 M)
250 mL 20% SDS
708 mL H20
Washing solution II (1% SDS; per liter)
2 mL EDTA (0.5 M)
40 mL Na2P04 pH 7.2 (1 M)
50 mL 20% SDS
908 mL H20

104
2.Wrap the membrane in Saran wrap, tape it to a blot paper and expose an x-ray film
overnight at -70C. Develop the film and identify the correct positively hybridizing E.
coli transformants.
Grow bacterial clones in Terrific Broth (TBl
1. With a sterile bacteriological loop, pick one transformant (white) bacterial colony
from the LB plate and add to 3 mL TB broth + 120 pL ampicillin (2.5 mg/mL stock).
TB broth (per 1 liter diH20): 1.2% bacto-tryptone (w/v), 2.4% bacto-
yeast extract (w/v), 0.4% glycerol (v/v); autoclave and add 100 mL of
sterile solution of 0.17 M KH2PO4 and 0.72 MK2HPO4.
2. Grow the cells over night at 225 rpm and 37C.
Glycerol stock from bacterial clones
1. To prepare 15% glycerol stock for long-term storage at -70C, add 850 pL of cell
suspension to 150 pL of ice-cold, sterile glycerol. Glycerol is already aliquotted into
microfuge tubes. Keep microfuge tubes on ice.
2. Mix well and store at -70C.
Grow up glvcerol stock
1. Add 10 pL of glycerol stock to 3 mL TB broth + 120 pL ampicillin (2.5 mg/mL
stock).
2. Grow the cells over night at 225 rpm and 37C.
3. Purify plasmid DNA the following day.
Purification of plasmid DNA from E. coli
1. Pellet 1.5 mL of culture for 1 min at 12,000 rpm in a microcentrifuge. Remove the
supernatant. (A total of 4.5 mL of culture can be spun down into one tube).
2. Resuspend the pellet in 200 pL of GTE (50 mM glucose, 25 mM Tris-HCl, pH 8.0,
10 mM EDTA, pH 8.0) buffer by pipetting up and down.
3. Add 300 pL of 0.2 N NaOH/1% SDS (make fresh each time) buffer, mix by tube
inversion, and incubate on ice for 5 min.
4. Add 300 pL of 3.0 M KOAC, pH 4.8, mix by tube inversion, and incubate on ice for
5 min.
5. Centrifuge the tube for 10 min at 12,000 rpm in a microcentrifuge tube at room
temperature and transfer supernatant (approximately 700 pL) to a clean tube.
Centrifuge the supernatant again for 10 min and transfer to a clean tube.
6. Add RNAase A (10 mg/mL stock) to a final concentration of 20 pg/mL. Incubate at
37C for 20 min.

105
7. Do two CHCI3 extraction using 400 (J.L per extraction. (The tube capacity is too
small to use an equal volume of CHC13 but 1/2 vol works fine). Mix the phases by
tube inversion. Centrifuge the tube for 1 min and remove the aqueous phase to a
clean tube.
8. Precipitate the DNA by adding an equal vol of 100% isopropanol (~ 700 }iL), pellet
the DNA by centrifugation at 12,000 rpm for 15 min at room temperature, and
remove the supernatant. Wash the pellet with 500 |iL of 70% ethanol by inverting
tube several times, then dry pellet briefly (5 min) under vacuum.
9. Dissolve the pellet in 32 |iL diH20, and sequentially add 8.0 (iL 4 M NaCl, mix, and
40 flL 13% PEGgooo. Mix well and incubate on ice for 1 h.
10. Centrifuge the tube at 12,000 ipm for 15 min at 4C. Carefully remove the
supernatant. The pellet will be translucent at this point and hard to see which is why
a fixed angle rotor is preferable to a horizontal rotor. Rinse the pellet with 500 (J.L of
70% ethanol.
11. Dry the pellet under vacuum for 5 min and resuspend the DNA in 20 |lL of deionized
H20.
SeaPlaque agarose purification
1. Electrophorese digested plasmid DNA on 0.8% SeaPlaque agarose; include 1 kb X
DNA ladder (BRL Life Technologies. Inc.) and X bacteriophage DNA cut with
Hindlll (X/HindlU cut DNA).
2. Cut out the band of interest.
3. Melt the slice of agarose containing the band of interest at 65C for 30 min; warm
agarose diluent (0.2 M NaCl, 0.02 M Tris-HCl, pH 7.5, 0.002 M EDTA) at same
time.
4. Dilute the molten slice to at least 0.3% agarose concentration with diluent and keep
at 65oC for another 5 min.
5. Extract plasmid DNA 3 times with warm Tris-HCl saturated phenol, pH 7.0 (37C).
6. 3 times ether extraction; evaporate ether on heating pad.
7. Ethanol precipitation:
Add 1 (J.L of 1 |ig/|iL t-RNA
Add 1/2 vol of 7.5 M ammonium acetate and 2 vol of 100% EtOH
Keep on ice for 10 min (to overnight)
Centrifuge for 10-20 min
Wash pellet with 500 |iL of 70% EtOH
Dry under vacuum
Dissolve pellet in 20 \xL of sdH20 and heat at 56C for 10 min.
Cycle sequencing of PCR product or plasmid DNA
Use fmol sequencing kit from Promega and follow the instructions.

106
1.
2.
3.
4.
5.
Purify PCR product with Qiagen PCR purification column; elute DNA with sterile,
distilled water
Label four 0.5 mL microfuge tubes (G,A,T,C) for each set of sequencing reactions.
Add 2 (J.L of the appropriate d/ddNTP mix to each tube.
For the sequencing reaction pipette:
template:
primer:
[a-35S]dATP:
500 fmol
4pmol
6 (J.Q (~1 (iL)
5x sequencing buffer
(250 mM Tris-HCl, pH 9.0, 10 mM MgCl2)
Taq DNA polymerase
sdH2Q
5 pL
1 pL (5U/pL)
to a total reaction
volume of 16 pL.
Aliquot 4 pL of template/primer/polymerase mix into each of the d/ddNTP mix
tubes.
Place tubes in PCR machine preheated to 95C and cycle 30 times through following
temperature profile:
2 min
30 sec
30 sec
1 min
95C
95C
42C
70C
6. Stop reaction by adding 3 pL of fmol Sequencing Stop Solution to each tube.
Polyacrylamide sequencing gel
1. For a 21 cm x 42 cm, 8% acrylamide sequencing gel, mix 33.6 g urea, 7.0 mL of lOx
TBE (0.9 M Tris-borate, pH 8.3, 0.02 M EDTA, pH 8.0), 10.5 mL of 40% 19:1
acrylamide:bis-acrylamide, and diH20 up to 70 mL. Dissolve the reagents on a
heating/stirring plate at low heat
2. While the reagents are dissolving, clean the glass plates of the sequencing unit (BIO
RAD Sequi-Gen very well with a paste of detergent. Rinse glass plates in diH20
and 70% EtOH. Dry them well, assemble sequencing gel unit and place into a
casting tray. (Periodically, apply a few drops of Rainex to the plate with the buffer
tank to prevent the gel from sticking to it).
3. Vacuum-filtrate the sequencing gel solution through a Whatman #3 filter paper and
degas it.
4. To pour the base, measure 30 mL of the gel solution, add 375 pL of 10% ammonium
persulfate (APS) and 80 pL of 100% N, N, N\ N tetramethylethylenediamine
(TEMED), mix and pour rapidly. The gel will polymerize in about 1 min.
5. To pour the gel between the plates, use the remaining gel solution (40 mL), add 280
pL of APS and 10 pL of TEMED, mix well and pipette between the two glass
plates. Be careful not to get any bubbles.
6. Clamp a sharkstooth comb in inverted position (Teeth pointing away from the gel)
between the glass plates and let gel polymerize (about 1 h).

107
7. After gel polymerization, remove sharkstooth comb and rinse the unit briefly in water
to remove the crystallized urea. Mount the gel unit on the electrophoresis apparatus.
8. Make 1,500 mL of 1 x TBE, pour 1 x TBE into the buffer tank of one glass plate and
the buffer tank at the bottom.
9. Rinse the space between the two glass plates and polymerized gel very well with a
syringe filled with buffer to remove bits of urea. Insert the sharkstooth comb with
the teeth pointing into the gel.
10. Rinse the bottom of the gel unit (standing in the buffer tank filled with buffer) to
remove any trapped air bubbles (which would affect the flow of current).
11. Pre-run the gel at 1,800 V for at least 30 min to heat the gel.
12. Heat the sequencing reactions to 70C for 2 min just prior to loading them onto the
gel. With a flat pipette tip, load 3.5 pL of each reaction into one of the wells formed
by the sharkstooth comb.
13. Run the gel for 3 h at 1,800 V, then load another round of sequencing reactions and
run for an additional 3 h. Repeat one more time.
14. Turn off the power, pour out the buffer (collect the buffer from the bottom tank in a
receptacle for radioactive waste), and disassemble the unit Pull the glass plate with
the buffer tank away from the other plate; the gel should stick to the other plate.
Remove the spacers.
15. Fix the gel (still supported by the other glass plate) in 5% acetic acid, 15% EtOH for
30 min.
16. Lift the gel (supported by the glass plate) from the fixing solution, drain off residual
liquid and blot it onto a sheet of Whatman 3MM paper. Put it onto a gel dryer and
cover it with a piece of Saran wrap, making sure no bubbles form between the gel
and the Saran wrap. Dry it under vacuum for 1 h at 80C. Collect the radioactive
fixing solution in a proper container.
17. Expose the gel to Kodak diagnostic x-ray film at -70C for 2-3 d.

108
16S rRNA gene sequence of T. solenopsae
1
GAATTCCACC
AGGTTGATTC
TGCCTGGTAT
GTGTGCTAGC
GTCAAGGATT
51
TAGCCATGCA
TGCTTACGAA
CCCACGTGGG
GAGTGGCGGA
TAGCTCAGTA
101
ATACAGTTAT
AACATAATCT
ACATAAATGG
ATAACCTTGT
CAAGATAAGG
151
CTAATACAGT
AAAGATGTTA
GAAGCATGAA
AGCGGAGCAT
CATTGTAGGA
201
TTGGTTTCTG
ACCTATCAGT
TAGTATGTTT
TGTAAGGGAG
AACATAGACT
251
ATGACGGGTA
ACGGGGGATG
CACGTCTGAT
ACCGGAGAGG
AAGCCTTAGA
301
AACCGCTTTC
ACGTCCAAGG
ATGGCAGCAG
GCGCGAAACT
TACCCAATTA
351
TTGTATTGAT
AGAGGTAGTT
ATGACGCATG
TTAAGATTTT
AAATTGAAAC
401
TTCATTAAAG
ATGGTTAAGC
GACTGGAGGG
CAAGTCTGGT
GCCAGCAGCC
451
GCGGTAATTC
CAGCTCCAGT
AGTGCATATA
CATGCTGTAG
TTAGAAAGTT
501
TGTAGCCAGT
TTATGGATTG
TTTTTGATAA
TAGTTATTCT
CCAAAAGAGC
551
TAATTTTAAC
TAATTCATAA
AAATAGAAGC
GGATGAAGGT
AATTGTATTC
601
ACCAGCAAGA
GGTAAAATTT
GATGACCTGG
TGAGGACATT
CCGAGGCGAA
651
AGCGATTGCC
TAGTACGTTT
TTGATGGTAA
AGAACGTAAG
CCGGAGGATC
701
AAAGATGATT
AGATACCGTT
GTAGTTCCGG
CCGTAAATTA
TGCCAACTTG
751
CATCTTGTTA
TTTATACAAG
GAGCATAGAG
AAATTAAGAG
TTTTTGGGCT
801
CTAGGGATAG
TAATCCGGCA
ACGGACAAAC
TTAAAGAAAT
TGGCGGAAGG
851
ACACCACAAG
GAGTGGATTA
TACGGCTTAA
TTTGACTCAA
CGCGGGAAAA
901
CTTACCAGGG
CCTATGTATA
AGAGAAAGTT
AACATTGTAT
GTATACTTGA
951
TTGTACTTTG
AGTGGTGCAT
GGCCGTTTTC
AACACGTGGG
GTGACTTGTC
1001
AGGTTTATTC
CGGTAACGTG
TGATGTGCAG
TATGCAACTA
ACTAATGTTG
1051
TGAGACTTCT
TGCGGTAAGC
TTGATGAAGA
GGCGCTATAA
CAGGTCAGTG
1101
ATGCCCTTAG
ATGTTCTGGG
CTGCACGTGT
AATACAGTGG
GTATTTCAAT
1151
ATTTAATAGA
AGTAAATTTA
CCCGAGACAG
GGATCATGCT
TTGTAAGAAG
1201
CTTGTGAACA
TGGAATTCCT
AGTAATCGCT
GCTCACTAAG
TAACGATGAA
1251
TAAGTCCCTG
TTCTTTGCAC
ACACCGCCCG
TCGCTATCTG
AGATGGATGA
1301
CTTTATAAAG
ATGCTGCTGT
GAAGAGGCAT
TTGTGTAAGG
TCAACTAGAT
1351
TAGATATAAG
TCGTAACAAG
GTAACCGGAT
CC

109
Partial 16S rRNA gene sequence of Thelohania sp.
1
CGAACCCATG
TGGGGAGTGG
CGGATAGCTC
AGTAATACAG
TTATAACATA
51
ATCTACATAA
ATGGATAACC
TTGTCAAGAT
AAGGCTAATA
CAGTAAAGAT
101
GTTAGAAGCA
TGAAAGCGGA
GCATCAATGT
AGCGTTGGTT
TCTGACCTAT
151
CAGTTAGTAT
GTTTTGTAAG
GGAGAACATA
GACTATGACG
GGTAACGGGG
201
GATGCACGTC
TGATACCGGA
GAGGAAGCCT
TAGAAACCGC
TTTCACGTCC
251
AAGGATGGCA
GCAGGCGCGA
AACTTACCCA
ATTATTGTAT
TGATAGAGGT
301
AGTTATGACG
CATGTTAAGA
TTTTAAATTG
AAACTTCATT
AAAGATAGAT
351
AAGCGACTGG
AGGGCAAGTC
TGGTGCCAGC
AGCCGCGGTA
ATTCCAGCTC
401
CAGTAGTGCA
TATACATGCT
GTAGTTAGAA
AGTTTGTAGC
CAGTTTATGG
451
ATTGTTTTTG
ATAATAGTTA
TTCTCCAAAA
GAGCTAATTT
TAACTAATTC
501
ATAAAAATAG
AAGCGGATGA
AGGTAATTGT
ATTCACCAGC
AAGAGGTAAA
551
ATTTGATGAC
CTGGTGAGGA
CATTCAGAGG
CGAAAGCGAT
TGCCTAGTAC
601
ATTTTTGATG
GTAAAGAACG
TAAGCCGGAG
GATCAAAGAT
GATTAGATAC
651
CGTTGTAGTT
CCGGCCGTAA
ATTATGCCAA
CTTGCATTTT
GTTATTTATA
701
CAAGGAGCAT
AGAGAAATTA
AGAGTTTTTG
GGCTCTAGGG
ATAGTAATCC
751
GGCAACGGAC
AAACTTAAAG
AAATTGGCGG
AAGGACACCA
CAAGGAGTGG
801
ATTATACGGC
TTAATTTGAC
TCAACGCGGG
AAAACTTACC
AGGGCCTATG
851
TATAAGAGAA
AGTTAACATT
GTATGTATAC
TTGATTGTAC
TTTGAGTGGT
901
GCATGGCCGT
TTTCAACACG
TGGGGTGACT
TGTCAGGTTT
ATTCCGGTAA
951
CGTGTGATGT
GCAGTATGCA
ACTAATGTTG
TGAGACTTCT
TGCGGTAAGC
1001
TTGATGAAGA
GGCGCTATAA
CAGGTCAGTG
ATGCCCTTAG
ATGTTCTGGG
1051
CTGCACGTGT
AATACAGTGG
GTATTTCAAT
ATTTAATAGG
AGTAAATTTA
1101
CCCGAGACAG
GGATCATGCT
TTGTAAGAAG

110
Parti al 16S rRNA gene sequence of Vairimorpha sp.
1
TCAGAGATTA
AGCCATGCAA
GCCAGCGAAG
ATTACGGAGC
GGCGTACGGC
51
TCAGTAGGAC
AGGGAAATCT
AGCCACGAAG
GAGGATAACC
ACGGTAAGCT
101
GTGGCTAAAA
CGAGCGTGGG
TGAGTTCTTG
GCCTATCAGC
TAGTCGGTAC
151
GGTAAGGGCG
TACCGAGGCA
ATAACGGGTA
ACGGGGAATC
GGGGTTCGAT
201
TCCGGAGAGG
AAGCCTGAGA
AACGGCTACC
ACGTCCAAGG
AAGGCAGCAG
251
GCGCGGAAAT
TACCCACTTG
GAGGACCAGA
GGTAGTTATG
GGGCGTAAAG
301
ATGAGAAAAG
TGTAAAAAGC
TTTTTGAATG
CGACTGGAGG
GCAAGTCTGG
351
TGCCAGCAGC
CGCGGTAATT
CCAGCTCCAG
GAGCTTCTGT
GTGAGTTGCT
401
GCGGTTAAAA
AGTGCGTAGT
CGGGGAGCAG
GCCAGCAGAA
AAGGTGGGGA
451
ATCACGCCTA
GCATAGTGCA
GGAACTGGGA
CCTAGGGACC
GGAGAGGGGC
501
AACCTAATTC
TTGGGCGAGG
GGTGAAAACT
GCTGACCCTG
AGAGGAGGAA
551
CAGAGGCGAA
GGCGGTTGTC
CGGGACGGGT
CTGACGATCA
AGTACGTGAG
601
CAGGAGGATC
AAAGACGATT
AGACACCGTC
GTAGTTCCTG
CAGTAAACGA
651
TGCCGACGGG
GCAGCAGGGG
aacttgttgc
CTGAGGGAAA
CCAAGTGTAC
701
GGGCTCCGGG
GATAGTACGG
GCGCAAGCTT
GAAACTTAAA
GAAATTGACG
751
GAAGGACACC
ACAAGGAGTG
GAGTGTGCGG
GTTAATTTGA
CTCAACGCGG
801
GACAACTTAC
CGGGGCAGGC
GACGAGAAGC
GAAGGATGAT
GAAGAGATTC
851
ACAGACTGAT
TGCGTCGCGT
GTGGTGCATG
gccgttttta
ACACGTGGGG
901
TGACTTGTCA
GGTTAAATCC
GATAACGCGT
GAGACCCTGT
GTAGATGGAA
951
ATACGACGGG
ACATGGCAAG
TGTCAGGAAG
AGCGGGTCGA
TAACAGGTCT
1001
GTGATGCCCG
CAGATGTTCC
GGGCGCCACG
CGCACTACAT
TGGACGGCGA
1051
TATATGAAAA
TGAGGAGCCG
TCCGTGGTTG
GGATTGACGC
TTGTAATTGC
1101
GTCATGAACG
TGGAATTCCT
AGTAGTGGGC
AGTCATTAAC
TGCACGCGAA
1151
TGAGTCCCTG
TTCTTTGTAC
ACACCGCCCG
TCGTTATCTA
AGATGGAAGT
1201
GCGGATGAGG
TCGGTACGGC
CGGACGAATC
TGTGCTTGTA
GATTGGATAC
1251 AA

Ill
Partial 16S rRNA sequence of A. penaei
1
ACTTTTAACT
aaccttttgt
ACTAATAATT
AAGGGAAACT
GTAATTAAAA
51
ATCATGAGGA
TGTGAGGTAG
ACCTATTAGC
TAGTTGGTTG
TGTAAAGGAC
101
TACCAAGGCT
ATAATGGGTA
ACGGAGATTT
AGTGATCGAA
ACCGGAGATG
151
GAAGCTGAGA
AACGGTTCCA
ATGTCCAAGG
ATAGCAGCAG
GCGCGAAAAT
201
TGCACACTCT
TTAATGGGGA
TGCAGTTATG
AGGTATGACA
GAAAGGGTTA
251
TCAATAAATA
AGATGACGTA
AAGCTATTAG
AGGGAAAGTT
TGGTGCCAGC
301
AGCCGCGGTA
ATACCAACTC
TAAGAGTCTC
TATGCGAGTT
GCTGCAGTTA
351
AAAAGTCCGT
AGTCTTTACG
TAATTAAAAA
TGAATGATCA
AGTTTCATAT
401
TTTTACGTTT
ATATATGAGA
CGGATTGGGA
GCATAGTATA
ACTGGGTTAA
451
GAATGAAATC
TCACTACCCT
AGTTGGACTA
TCAGAAGCGA
AAGCGATGCT
501
CTAATACGTA
CTTTTAGATA
AAGGACGAAG
GCTAGAGTAG
CGAAAGGGAT
551
TAGATACCCC
TGTAGTTCTA
GCAGTAAACT
ATGCCGACAG
AATGTTAGAT
601
ATATTTCTAG
TGTTCAAGGG
AAACCTTAAG
TGATCGGGCT
CTGGGGAGAG
651
TATGCTCGCA
AGTGTGAAAA
TTAAACGAAA
TTGACGGAGT
TACACCACAA
701
GGAGTGGATT
GTGCGGCTTA
ATTTGACTCA
ACGCGAGGAA
TTTTACCAGG
751
GCTGAATATA
TTTGAGATTG
AATACATGAA
ATATATTTGA
GTGGTGCATG
801
GTCGTTGTAA
ACTCATGGAT
TGATCTTAAG
TTCAACTGCT
AAAATGGGTG
851
AGACTTTCAT
AAACAGCTAT
CTAACAGGTA
GAGGAAGGGG
AAGGCGATAA
901
CAGATCCGTG
ATGCCCTCAG
ATGTCCTGGG
CTGCACGCGC
AATACATTAT
951
GTATATTTCT
TATAAATAGA
TACTACATAT
TGGGGAATTG
ACTTTTGTAA
1001
ATAAGTCATG
AACTTGGAAT
TCCTAGTAAT
AATGATTCAT
CAAGTCATTG
1051
TGAATGTGTC
CCTGTAGCTT
GTACACACCG
CCCGTCACTG
TCTCAGATGG
1101
TTGATGAGAT
G

REFERENCES
Abel, K., deSchmertzing H and Peterson, J. I. 1963. Classification of microorganisms
by analysis of chemical composition. I. Feasibility of utilizing gas chromatography.
J. Bacteriol. 85, 1039-1044.
Adams. C.T. 1986. Agricultural and medical impact of the imported fire ants. In Fire
ants and leaf-cutting ants. Biology and management, (Lofgren, C.S, and Vander
Meer, R.K. eds.), pp. 36-47. Westview Press, Boulder.
Allen, G.E., and Burn, W.F. 1974. Microsporidan and fungal diseases of Solenopsis
invicta Burn in Brazil. J. N.Y. Entomol. Soc. 82, 125-130.
Amigo, J.M., Garcia, M.P., Comas, J., Salvado, H. and Vivares, C.P. 1994.
Comparative study of microsporidian spores by flow cytometric analysis. J. Euk.
Microbiol. 41, 210-214.
Andreadis, T.G. 1985. Experimental transmission of a microsporidian pathogen from
mosquito to an alternate copepod host. Proc. Nat. Acad. Sci. USA 82, 5574-5577.
Andreadis, T.G. 1994. Ultrastructural characterization of meiospores of six new species
of Amblvospora (Microsporida: Amblyosporidae) from northern Aedes (Diptera:
Culicidae) mosquitoes. J. Euk. Microbiol. 41, 147-154.
Anthony, D.W., Lotzkar, M.D., and Avery, S.W. 1978. Fecundity and longevity of
Anopheles albimanus exposed at each larval instar to spores of Nosema algerae.
Mosquito News 38. 116-121.
Amheim, N. 1983. Concerted evolution of multigene families. In Evolution of genes
and proteins (Nei, M., and Koehn, R.K. eds.), pp. 38-61. Sinauer Associates Inc.
Publishers, Sunderland, Massachusetts.
Asselineau, J. 1962. The bacterial lipids. Holden-Day, Inc. Publishers, San Francisco.
Aston, J.W. 1977. Computer processing of fatty acid analysis data. J. Chromat. 131,
121-130.
Avise, J.C. 1994. Molecular markers, natural history and evolution. Chapman and
Hall, New York.
Baker, M.D., Vossbrinck, C.R., Didier, E.S., Maddox, J.V., and Shadduck, J. 1995.
Small subunit ribosomal DNA phylogeny of various microsporidia with emphasis on
AIDS related forms. J. Euk. Microbiol. 42, 564-570.
112

113
Baker, M.D., Vossbrinck, C.R., Maddox, J.V., and Undeen, A.H. 1994. Phylogenetic
relationships among Vairimorpha and Nosema species (Microspora) based on
ribosomal RNA sequence data. J, Invert. Path. 64, 100-106.
Barnes, W.M. 1994. PCR amplification of up to 35-kb DNA with high fidelity and high
yield from bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216-2220.
Beckham, R.D., and Bilimoria, S.L. 1982. A survey for microorganism associated with
ants in western Texas. Southwest. Entomol. 7, 225-229.
Becnel, J. 1992. Horizontal transmission and subsequent development of Amblvospora
ralifnmica (Microsporida: Amblyosporidae) in the intermediate and definite hosts.
Pis. Aquat. Org. 13, 17-28.
Becnel, J.J., Sprague, V., Fukuda, T. and Hazard, E.I. 1989. Development of Edhazardia
aedis (Kudo, 1930) n. gen., n. comb. (Microsporida: Amblyosporidae) in the
mosquito Aedes aegypti (L.) (Dptera: Culicidae). _J. Protozool. 36,119-130.
Bentivenga, S. P., and Morton, J. B. 1994. Stability and heritability of fatty acid methyl
ester profiles of glomalean endomycorrhizal fungi. Mvcol. Res. 98, 1419-1426.
Bethesda Research Laboratories. 1979. Ligation. Theory and Practice Part II. Focus
2, 2-3.
Briano, J. 1993. Effect of a microsporidian disease on field populations of the black
imported fire ant Solenopsis richteri (Hymenoptera: Formicidae) in Argentina. M.S.
thesis, University of Florida, Gainesville, FI.
Brooks, W.M. and Cranford, J.D. 1972. Microsporidioses of the hymenopterous
parasites, Campoletis sonorensis and Cardiochiles nigriceps. larval parasites of
Heliothis species. J. Invert. Pathol. 20, 77-94.
Brower, A.V.Z., and DeSalle, R. 1994. Practical and theoretical considerations for
choice of a DNA sequence region in insect molecular systematics, with a short
review of published studies using nuclear gene regions. Ann. Entomol. Soc. Am. 87,
702-716.
Burn, W.F. 1972. Revisionary study on the taxonomy of the imported fire ants.
J. Georgia Entomol. Soc. 7, 1-27.
Burn, W.F. 1983. Artificial fauna replacement for imported fire ant control. FI.
Entomol. 66, 93-100.
Buren, W.F., Allen, G.E., Whitcomb, W.H., Lennartz, F.E., and Williams, R. N. 1974.
Zoogeography of the imported fire ants. J. N.Y. Entomol. Soc. 82, 113-124.

114
Buren, W.F., Allen, G.E., and Williams, R.N. 1978. Approaches toward possible pest
management of the imported fire ants. Bull. Entomol. Soc. Am. 24, 418-421.
Canning, E.U. 1988. Nuclear division and chromosome cycle in microsporidia.
BioSvstems 21, 333-340.
Carlson, D.A., and Bolten, A.B. 1984. Identification of Africanized and European honey
bees, using extracted hydrocarbons. Bull. Entomol. Soc. Am. 30, 32-35.
Carlson, D.A., and Brenner, RJ. 1988. Hydrocarbon-based discrimination of three North
American Blattella cockroach species (Orthoptera: Blattellidae) using gas
chromatography. Ann. Entomol. Soc. Am. 81, 711-723.
Creighton, W.S. 1930. The New World species of the genus Solenopsis (Hymenoptera:
Formicidae). Proc. Am. Acad. Arts Sci. 66, 39-151.
Crowe, J.S., Cooper, HJ, Smith, M.A., Sims, M.J., Parker, D., and Gewert, D. 1991.
Improved cloning efficiency of polymerase chain reaction (PCR) products after
proteinase K digestion. Nucleid Acid Research 19, 184.
Curgy, J.J., Vavra, J., and Vivares, C. 1980. Presence of ribosomal RNAs with
prokaryotic properties in microsporidia, eukaryotic organisms. Biol. Cellulaire 38,
49-52.
Decallonne, J., Delmee, M., Wauthoz, P., El Lioui, M., and Lambert, R. 1991. A rapid
procedure for the identification of lactic acid bacteria based on the gas
chromatographic analysis of the cellular fatty acids. J. Food Protection 54, 217-224.
Dees, S.B., and Moss, C.W. 1975. Cellular fatty acids of Alcali genes and Pseudomonas
species isolated from clinical specimens. J. Clin. Microbiol. 1, 414-419.
Devereux, J., Haeberli, P., and Marquess, P. 1987. Genetics Computer Group Sequence
Analysis Software Package, version 5. University of Wisconsin, Madison, WI.
Didier, P.J., Didier, E.S., Orenstein, J.M. and Shadduck, J.A. 1991. Fine structure of a
new human microsporidian, Encephalitozoon hellem. in culture. J. Protozool. 38,
502-507.
Eerola, E., and Lehtonen, O. 1988. Optimal data processing procedure for automatic
bacterial identification by gas-liquid chromatography of cellular fatty acids. J. Clin.
Microbiol. 26, 1745-1753.
Elwood, H.J., Olsen, G.J., and Sogin, M.L. 1985. The small subunit ribosomal RNA
gene sequences from the hypotrichous ciliates Oxytricha nova and Stylonvchia
pustulata. Mol. Biol. Evol. 2, 399-410.

115
Embley, T.M., Finlay, B.J., Thomas, R.H., and Dyal, P.L. 1992. TheuseofrRNA
sequences and fluorescent probes to investigate the phylogenetic positions of the
anaerobic ciliate Metopus palaeformis and its archaeobacterial endosymbionL
J. Qen. Microbiol. 138, 1479-1487.
Fowler, J.L., and Reeves, E.L. 1974. Spore dimorphism in a microsporidian isolate.
I. Protozool. 21, 538-542.
Fox, G.E., Stackebrandt, E., Hespell, R.B., Gibson, J., Maniloff, J., Dyer, T.A., Wolfe,
R.S., Balch, W.E., Tanner, R.S., Magrum, J.L., Zablen, L.B., Blakemore, R., Gupta,
R., Bonen, L., Lewis, B.J., Stahl, D.A., Luehrsen, K.R., Chen, K.N., and Woese,
C.R. 1980. The phylogeny of prokaryotes. Science 209,457-463.
Garcia, J.J., and Becnel, JJ. 1994. Eight new species of microsporidia (Microspora)
from Argentine mosquitoes (Diptera: Culicidae). J. Invert. Pathol. 64, 243-252.
Gerbi, S.A. 1985. Evolution of ribosomal RNA. In Molecular evolutionary genetics
(MacIntyre, R.J. ed.), pp. 419-517. Plenum Press, New York.
Goodfellow, M., and ODonnell, A.G. (eds.). 1994. Chemical methods in prokaryotic
systematics. John Wiley and Sons, Chichester.
Goodfellow, M., and Minnikin, D.E. (eds.). 1985. Chemical methods in bacterial
systems. Academic Press, London.
Graham, J.H., Hodge, N.C., and Morton, J. 1995. Fatty acid methyl ester profiles for the
characterization of glomalean fungi and their endomycorrhizae. Appl. Environm.
Microbiol. 61, 58-64.
Gutell, R.R., Weiser, B., Woese, C.R., and Noller, H.F. 1985. Comparative anatomy of
16S-like ribosomal RNA. Progr. Nucleic Acid Res. Mol. Biol. 32, 155-216.
Hartskeerl, R.A., Schuitema, A.R.J., van Gool, T., and Terpstra, WJ. 1993. Genetic
evidence for the occurrence of extra-intestinal Enterocvtozoon bieneusi infections.
Nucleic Acids Res. 21, 4150.
Hazard, E.I., and Oldacre, S.W. 1975. Revision of Microsporida (Protozoa) close to
Thelohania. with description of one new family, eight new genera, and thirteen new
species. Tech. Bull. No. 1530, United States Department of Agriculture,
Agricultural Research Service
Henneguy, F., and Thlohan, P. 1892. Myxosporidies parasites des muscles chez
quelques crustacs dcapodes. Ann. Microgr. 4, 617-641.

116
Heraty, J.M., Wojcik, D.P., and Jouvenaz, D.P. 1993. Species of Qrasema parasitic on
the Solenopsis saevissima-complex in South America (Hymenoptera: Eucharitidae,
Formicidae). J. Hvm. Res. 2, 169-182.
Hillis, D.M., and Dixon, M.T. 1991. Ribosomal DNA: Molecular evolution and
phylogenetic inference. Quart. Rev. Biol. 66, 411-453.
Howard, L.O., and Fiske, W.F. 1911. The importation into the United States of the
parasites of the gypsy moth and the brown-tail moth. U.S. Dept. Agrie. Bur.
Entomol. Bull. 91.
Irby, W.S., Huang, Y.S., Kawanishi, C.Y. and Brooks, W.M. 1986. Immunoblot analysis
of exospore polypeptides from some entomophilic microsporidia. J. Protozool. 33,
14-20.
Ishihara, R., and Hayashi, Y. 1968. Some properties of ribosomes from the sporoplasm
of Nosema bombycis. J. Invert. Pathol. 11. 377-385.
Jabaji-Hare, S. 1988. Lipid and fatty acid profiles of some vesicular-arbuscular
mycorrhizal fungi: contribution to taxonomy. Mvcologia 80, 622-629.
Jahn, G.C., Hall, D.W. and Zam, S.G. 1986. A comparison of the life cycles of two
Amblvospora (Microspora: Amblyosporidae) in the mosquitoes Culex salinarius
Coquillett and Culex tarsalis CoquilletL J. Ha. Anti-Mosqu. Ass. 57, 24-27.
James, A.T. and Martin, A.J.P. 1952. Gas-liquid partition chromatography: The
separation and microestimation of volatile fatty acids from formic acid to dodecanoic
acid. Biochem. J. 50, 679-690.
Jarvis, B.D.W., Tighe, S.W. 1994. Rapid identification of Rhizobium species based on
cellular fatty acid analysis. Plant and Soil 161,31-41.
Jeffords, M.R., Maddox, J.V., McManus, M.L., Webb, R.E., and Wieber, A. 1989.
Evaluation of the overwintering success of two European microsporidia
inoculatively released into gypsy moth populations in Maryland. J. Invert. Pathol.
53,235-240.
Jouvenaz, D.P. 1983. Natural enemies of fire ants. Ha. Entomol. 66, 111-121.
Jouvenaz, D.P. 1986. Diseases of fire ants: Problems and opportunities. In Fire ants
and leaf-cutting ants. Biology and management, (Lofgren, C.S, and Vander Meer,
R.K. eds.), pp. 327-338. Westview Press, Boulder.
Jouvenaz, D.P, Allen, G.E., Banks, W.A., and Wojcik, D.P. 1977. A survey for
pathogens of fire ants, Solenopsis spp., in the Southeastern United States. Ha.
Entomol. 60,275-279.

117
Jouvenaz, D.P., and Ellis, E.A. 1986. Vairimorpha invictae n.sp. (Microspora:
Microsporida), a parasite of the red imported fire ant, Solenopsis invicta Burn
(Hymenoptera: Formicidae). J. Protozool. 33,457-461.
Jouvenaz, D.P., and Hazard, E.I. 1978. New family, genus, and species of microsporidia
(Protozoa: Microsporida) from the tropical fire ant, Solenopsis geminata (Fabricius)
(Insecta: Formicidae). J. Protozool. 25, 24-29.
Jouvenaz, D.P, and Kimbrough, J.W. 1991. Myrmecomvces annellisae gen. nov sp.
nov. (Deuteromycotina: Hyphomycetes), an endoparasitic fungus of fire ants,
Solenopsis spp. (Hymenoptera: Formicidae). Mvcol. Res. 95, 1395-1401.
Jouvenaz, D.P. and Lofgren, C.S. 1984. Temperature-dependent spore dimorphism in
Burenella dimorpha (Microspora: Microsporida). J. Protozool. 31. 175-177.
Jouvenaz, D.P., and Wojcik, D.P. 1990. Parasitic nematode observed in the fire ant,
Solenopsis richteri. in Argentina. Fla- Entomol. 73, 674-675.
Kawakami, Y., Inoue, T., Kikuchi, M., Takayanagi, M., Sunairi, M., Ando, T., and
Ishihara, R. 1992. Primary and secondary structures of 5S ribosomal RNA of
Nosema bombycis (Nosematidae:, Microsporidia). J. Serie. Sci. Jpn. 61, 321-327.
Kerwin, J.L. 1994. Evolution of structure and function of fatty acids and their
metabolites. In Isopentenoids and Other Natural Products, Evolution and
Function (Nes, D.W., ed.), pp. 163-201. American Chemical Society, Washington,
DC.
Knell, J.D., and Allen, G.E. 1977. Light and electron microscope study of Thelohania
solenopsae n. sp. (Microsporida: Protozoa) in the red imported fire ant, Solenopsis
invicta. J. Invert. Pathol. 29, 192-200.
Knivett, V.A., and Cullen, J. 1965. Some factors affecting cyclopropane acid formation
in Escherichia coli. Biochem. J. 96.771-776.
Kock, J.L.F. 1988. Chemotaxonomy of yeasts. S. A. J. Sci. 84,735-740.
Kramer, J.P. 1965. Nosema necatrix. sp. n. and Thelohania diazoma sp. n.,
microsporidians from the armyworm Pseudaletia unipunctata (Haworth). J. Invert.
Pathol. 7, 117-121.
Kurtti, T.J., Ross, S.E., Liu, Y., and Munderloh, U.G. In vitro developmental biology and
spore production in Nosema fumacalis (Microspora: Nosematidae). J. Invert.
Pathol. 63, 188-196.

118
Lane, D.J., Pace, B., Olsen, G., Stahl, D.A., Sogin, M.L., and Pace, N.R. 1985. Rapid
determination of 16S ribosomal RNA sequences for phylogenetic analysis. Proc.
Natl. Acad. Sri. USA 82, 6955-6959.
Langley, R.C., Cali, A. and Somberg, E.W. 1987. Two-dimensional electrophoretic
analysis of spore proteins of the microsporidia. I. Parasitol. 73, 910-918.
Lawrence, D., Heitefuss, S., and Seifert, H. S. H. 1991. Differentiation of Bacillus
anthracis from Bacillus cereus by gas chromatographic whole-cell fatty acid analysis.
I Qm. Microbiol. 29, 1508-1512.
Lechevalier, M.P. 1989. Lipids in bacterial taxonomy. In CRC practical handbook of
microbiology, (O'Leary, W. Ed.), pp. 455-515. CRC Press, Boca Raton.
Lewin, B. 1994. Genes V. Oxford University Press, Oxford.
Li, W.-H., and Graur, D. 1991. Fundamentals of molecular evolution. Sinauer
Associates, Inc. Publishers, Sunderland, Massachusetts.
Lofgren, C.S. 1986. History of imported fire ants in the United States. In Fire ants and
leaf-cutting ants. Biology and management, (Lofgren, C.S,and Vander Meer, R.K.
eds.), pp. 36-47. Westview Press, Boulder.
Losel, D.M. 1988. Fungal lipids. In Microbial lipids, vol. 1, (Ratledge, C., and
Wilkinson, S.G. eds.). Academic Press, London.
Maddox, J.V. 1966. Studies on a microsporidioisis of the armyworm Psendaletia
unipunctata (Haworth). Ph.D. Thesis. University of Illinois, Urbana, DI.
Maddox, J.V., McManus, M.L., Jeffords, M.R., and Webb, R.E. 1992. Exotic insect
pathogens as classical biological control agents with an emphasis on regulatory
considerations. In Selection criteria and ecological consequences of importing
natural enemies, (Kauffman, W.C., and Nechols, J.E. eds.). Thomas Say
Publications.
Maddox, J.V., and Sprenkel, R.K. 1978. Some enigmatic microsporidia of the genus
Nosema. Mise. Publ. Entorno!. Soc. Am. 11: 65-84.
Malone, L.A., Broadwell, A.H., Mclcor, C.A., Linridge, E.T., and Ninham, J. Ribosomal
genes of two microsporidian species, Nosema apis and Vavraia oncoperae are very
variable. I. Invert. Pathol. 64, 151-152.
Marr, A.G., and Ingraham, J.L. 1962. Effect of temperature on the composition of fatty
acids in Escherichia coli. J. Bacteriol. 84, 1260-1267.

119
Marumo, K. and Akoi, Y. 1990. Discriminant analysis of cellular fatty acids of Candida
species, Torulopsis glabrata. and Crvptococcus neoformans determined by gas-liquid
chromatography. J. Clin. Microbiol. 28,1509-1513.
Maruniak, J.E., Brown, S.E., and Knudson, D.L. 1984. Physical maps of SfMNPV
baculovirus DNA and its genomic variants. Virology 136, 221-234.
McGrath, C. F., Moss, C. W., and Burchard, R. P. 1990. Effect of temperature shifts on
gliding motility, adhesion, and fatty acid composition of Cvtophaga sp. strain U67.
I. Bacteriol. 172, 1978-1982.
MIDI. 1993. Yeast/actinomycetes/fungi data base. MIDI, Inc., Newark, DE.
Miller, L.T. 1982. Single derivatization method for routine analysis of bacterial whole
cell fatty acid methyl esters, including hydroxy acids. J. din. Microbiol. 16, 584-
586.
Mitchell, M.J., and Cali, A. 1993. Ultrastructural study of the development of
Vairimorpha necatrix (Kramer, 1965) (Protozoa, Microsporida) in larvae of the com
earworm, Heliothis zea (Boddie) (Lepidoptera, Noctuidae) with emphasis on
sporogony. J. Euk. Microbiol. 40. 701-710.
Mollenhauer, H.H. 1964. Plastic embedding mixtures for use in electron microscopy.
Stain Technol. 111-114.
Morton, J.B. 1993. Problems and solutions for the integration of glomalean taxonomy,
systematic biology and the study of endomycorrhizal phenomena. Mvcorrhiza 2,
97-109.
Morton, J. B. and Benny, G.L. 1990. Revised classification of arbuscular mycorrhizal
fungi (Zygomycetes): a new order, Glomales, two new suborders, Glomineae and
Gigasporinae and two new families, Acaulosporaceae and Gigasporaceae, with an
emendation of Glomaceae. Mvcotaxon 37, 471-491.
Moss, C.W. 1981. Gas-liquid chromatography as an analytical tool in microbiology.
J. Chromat. 13, 337-347.
Moss, C.W., Dees, S.B., and Guerrant, G.O. 1980. Gas-liquid chromatography of
bacterial fatty acids with a fused-silica capillary column. J. Clin. Microbiol. 12,
127-130.
Moss, C.W., Lambert, M.A., and Merwin, W.H. 1974. Comparison of rapid methods for
analysis of bacterial fatty acids. Appl. Microbiol. 28, 80-85.

120
Mylvaganam, S., and Dennis, P.P. 1992. Sequence heterogeneity between the two genes
encoding 16S rRNA from the halophilic archaebacterium Haloarcula marismortui.
Genetics 130, 399-410.
Nation, J.L., Sanford, M.T. and Milne, K. 1992. Cuticular hydrocarbons from Varroa
jacobsoni. Exp. Appl. Acarol. 16, 331-344.
Nelson, D.R., Fatland, C.L., Howard, R.W., McDaniel, C.A., and Blomquist, G.J. 1980.
Re-analysis of the cuticular methylalkanes of Solenopsis invicta and S. richteri.
Insect Biochem. 10,409-418.
Nickle, W.R., and Jouvenaz, D.P. 1987. Tetradonema solenopsis n. sp. (Nematoda:
Tetradonematidae) parasitic on the red imported fire ant Solenopsis invicta Burn
from Brazil. J. Nematol. 19,311-313.
Nicoletti, V.G., and Condorelli, D.F. 1993. Optimized PEG method for rapid plasmid
DNA purification: High yield from midi-prep. BioTechniques 14. 535-536.
Niederkom, J.Y., Shadduck, J.A. and Weidner, E. 1980. Antigenic cross-reactivity
among different microsporidian spores as determined by immunofluorescence.
J. Parasitol. 66, 675-677.
Nordin, G.L., and Maddox, J.V. 1974. Microsporidia of the fall webworm, Hvphantria
cunea. I. Identification, distribution, and comparison of Nosema sp. with similar
Nosema spp. from other Lepidoptera. J. Invert. Pathol. 24, 1-13.
Oien, C.T. and Ragsdale, D.W. 1992. A species-specific enzyme-linked
immunoabsorbent assay for Nosema fumacalis (Microspora: Nosematidae).
J. Invert. Path. 60, 84-88.
OLeary, W.M. 1975. The chemistry of microbial lipids. Critic. Rev. Microbiol. 4,
41-63.
Olsen, G.J., Lane, D.J., Giovannoni, S J., and Pace, N.R. 1986. Microbial ecology and
evolution: A ribosomal RNA approach. Ann. Rev. Microbiol. 40, 337-65.
Olsen, G.J., and Woese, C.R. 1993. Ribosomal RNA: A key to phylogeny. FASEB 7,
113-123.
Overstreet, R.M. 1973. Parasites of some penaeid shrimps with emphasis on reared
hosts. Aquaculture 2.105-140.
Patterson, R.S. 1993. Biological control of introduced ant species. In Exotic ants:
Biology, impact, and control of introduced species, (Williams, D.F. ed.), pp. 293-
307. Boulder, Westview Press.

121
Pilley, B.M. 1976. A new genus, Vairimorpha (Protozoa: Microsporida), for Nosema
necatrix Kramer 1965: Pathogenicity and life cycle in Spodoptera exempta
(Lepidoptera: Noctuidae). J. Invert. Pathol. 28,177-183.
Portaels, R, Dawson, D J., Larrson, L. and Rigouts, L. 1993. Biochemical properties and
fatty acid composition of Mycobacterium haemophilum: Study of 16 isolates from
Australian patients. J. Clinic. Microbiol. 31, 26-30.
Porter, S.D., Fowler, H.G., and Mackay, W.P. 1992. Fire ant mound densities in the
United States and Brazil (Hymenoptera: Formicidae). I. Econ. Entomol. 85,
1154-1161.
Ratledge, C., and Wilkinson, S.G. (eds.). 1988. Microbial lipids, vol. 1. Academic
Press, London.
Ratledge, C., and Wilkinson, S.G. (eds.). 1989. Microbial lipids, vol. 2. Academic
Press, London.
Reynolds, E.S. 1963. The use of lead citrate at high pH as an electron opaque stain in
electron microscopy. I. Cell Biol. 17, 208-212.
Ross, K.G., Vargo, E.L., and Fletcher, D.J.C. 1987. Comparative biochemical genetics
of three fire ant species in North America, with special reference to the two social
forms of Solenopsis invicta (Hymenoptera: Formicidae). Evolution 41. 979-990.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning: A laboratory
manual. Cold Spring Harbor Laboratory Press.
Sanchez-Pea, S.R., and Thorvilson, H.G. 1992. Two fungi infecting red imported fire
ant founding queens from Texas. Southwest. Entomol. 17,181-182.
Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA sequencing with chain
terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467.
SAS Institute. 1989. SAS/STAT users guide, version 6,4th edition. SAS Institute,
Cary, N.C.
Sasser, M. 1990a. Identification of bacteria through fatty acid analysis. In Methods in
Phytobacteriology, (Klement, Z., Rudolf, K., and Sands, D., eds), pp. 199-204.
Akademiai Kiado, Budapest
Sasser, M. 1990b. Identification of bacteria by gas chromatography of cellular fatty
acids. Technical Note 101. MIDI, Newark, DE.

122
Sasser, M. 1990c. Tracking a strain using the microbial identification system.
Technical Note 102. MIDI, Newark, DE.
Schuitema, A.R.J., Hartskeerl, R.A., van Gool, T., Laxminarayan, R., and Terpstra, W.J.
1993. Application of the polymerase chain reaction for the diagnosis of
microsporidiosis. AIDS 7 (suppl. 3), S57-S61.
Schweizer, E. 1988. Biosynthesis of fatty acids and related compounds. In Microbial
lipids, vol. 2, (Ratledge, C., and Wilkinson, S.G. eds). Academic Press, London.
Sedlacek, J.D., Dintenfass, L.P., Nordin, G.L., and Ajlan, A.A. 1985. Effects of
temperature and dosage on Vairimorpha sp. 696 spore morphometries, spore yield,
and tissue specificity in Heliothis virescens. J. Invert. Pathol. 46, 320-324.
Shaw, N. 1974. Lipid composition as a guide to the classification of bacteria. Adv. Appl.
Microbiol. 17,63-108.
Shimizu, S., Akimoto, K., Shinmen, Y., and Kawashima, H. 1991. Sesamin is a potent
and specific inhibitor of A5 desaturase in polyunsaturated fatty acid biosynthesis.
Lipids 26. 512-516.
So, R.B., Ladha, J.K., and Young, J.P.W. 1994. Photosynthetic symbionts of
Aeschvnomene spp. form a cluster with Bradyrhizobia on the basis of fatty acid and
ribosomal RNA analyses. Ini. J. Svst. Bacteriol. 44, 392-403.
Sogin, M.L., and Gunderson, J.H. 1987. Structural diversity of eukaryotic small subunit
ribosomal RNAs. Annals N.Y. Acad. Sci. Endocytobiologv III 503,125-139.
Sogin, M.L., Gunderson, J.H., Elwood, H.J., Alonso, R.A., and Peattie, D.A. 1989.
Phylogenetic meaning of the kingdom concept: An unusual ribosomal RNA from
Giardia lamblia. Science 243, 75-77.
Sprague, V., Becnel, J.J. and Hazard, E.I. 1992. Taxonomy of phylum microspora.
Critic. Rev. Microbiol. 18, 285-395.
Stanley-Samuelson, D.W., Jurenka, R.A., Cripps, C, Blomquist, G.J. and de Renobales,
M. 1988. Fatty acids in insects: Composition, metabolism, and biological
significance. Arch. Insect Biochem. Physiol. 9, 1-33.
Stead, D. E., Sellwood, J. E., Wilson, J., and Viney, I. 1992. Evaluation of a commercial
microbial identification system based on fatty acid profiles for rapid, accurate
identification of plant pathogenic bacteria. J. Appl. Bacteriol. 72, 315-321.

123
Stimac, J.L., Alves, S.B., and Camargo, M.T.V. 1987. Suscetibilidade de Solenopsis spp.
a differentes espcies de fungos entomopatognicos. An. Soc. Entomol. Brasil 16,
377-387.
Stimac, J.L., and Alves, S.B. 1994. Ecology and biological control of fine ants. InPest
management in the subtropics. Biological control a Florida perspective, (Rosen,
D., Bennett, F.D., and Capinera, J.L. eds), pp. 353-380. Intercept Limited,
Andover.
Streett, D.A. 1976. Analysis of microsporidian spore proteins by electrophoresis on SDS
polyacrylamide gels: Taxonomic considerations. Proc. Int. Colloq. Invertebr.
Pathol. 1, 361-362.
Sweeney, A.W., Graham, M.F. and Hazard, E.I. 1985. Intermediate host for an
Amblvospora sp. (Microspora) infecting the mosquito Culex annulirostris. I. Invert.
Path. 46, 98-102.
Swofford, D.L. 1993. PAUP: Phylogenetic analysis using parsimony, version 3.1.1.
Illinois Natural History Survey, Champaign, IL.
Suutari, M. and Laakso, S. 1992. Unsaturated and branched-chain fatty acids in
temperature adaptation of Bacillus subtilis and Bacillus megaterium. Biochim.
Biophys. Acta 1126,119-124.
Thorvilson, H.G., and Phillips Jr., S.A. 1987. The straw itch mite. Pvemotes tritici
(Acari: Pyemotidae), as a biological control agent of red imported fire ants,
Solenopsis invicta (Hymenoptera: Formicidae). Fla. Entomol. 70. 439-444.
Trager, J.C. 1991. A revision of the fire ants. Solenopsis geminata group (Hymenoptera:
Formicidae: Myrmicinae). J. N.Y. Entomol Soc. 99, 141-198.
Undeen, A.H. 1975. Growth of Nosema algerae in pig kidney cell cultures. J. Protozool.
22,107-110.
Undeen, A.H., Alger, N.E. 1971. A density gradient method for fractionating
microsporidian spores. X Invert. Path. 18, 419-420.
Vander Meer, R.K., and Lofgren, C.S. 1988. Use of chemical characters in defining
populations of fire ants, Solenopsis saevissima complex, (Hymenoptera:
Formicidae). Fla. Entomol. 71, 323-332.
Van der Westhuizen, J. P. J., Kock, J. F. L., and Botes, P. J. 1994. The distribution of
the 053- and 056-series of cellular long-chain fatty acids in fungi. Svst. Appl.
Microbiol. 17, 327-345.

124
Visvesvara, G.S., da Silva, A.J., Croppo, G.P., Pieniazek, N.J., Leitch, G J., Ferguson, D.,
de Moura, H., Wallace, S., Slemenda, S.B., Tyrrel, L, Moore, D.F., and Meador, J.
1995. In vitro culture and serological and molecular identification of Septata
intestinalis isolated from urine of a patient with AIDS. J. Gin. Microbiol. 33,
930-936.
Voet, D., and Voet, J.G. 1990. Biochemistry. John Wiley and Sons, New York.
Vossbrinck, C.R., Maddox, J.V., Friedman, S., Debrunner-Vossbrinck, B.A., and Woese,
C.R. 1987. Ribosomal RNA sequence suggests microsporidia are extremely ancient
eukaryotes. Nature 326. 411-414.
Vossbrinck, C.R., Baker, M.D., Didier, E.S., Debrunner-Vossbrinck, B.A., and Shadduck,
J.A. 1993. Ribosomal DNA sequences of Encephalitozoon hellem and
Encephalitozoon cuniculi: Species identification and phylogenetic construction.
J. Euk. Microbiol. 40, 354-362.
Weiss, L.M., Zhu, X., Cali, A., Tanowitz and Wittner, M. 1994. Utility of
microsporidian rRNA in diagnosis and phylogeny: A review. Folia Parasitol. 41,
81-90.
Welch, D.F. 1991. Applications of cellular fatty acid analysis. Clinic. Microbiol. Rev. 4,
422-438.
Williams, D.F. 1989. An improved artificial nest for laboratory rearing of the imported
fire ant Solenopsis invicta ('Hymenoptera: Formicidae). Fla. Entomol. 72. 705-707.
Williams, D.F., and Banks, W.A. 1987. Pseudacteon obtusus (Diptera: Phoridae)
attacking Solenopsis invicta (Hymenoptera: Formicidae) in Brazil. Psyche 94, 9-13.
Wilson, E.O. 1951. Variation and adaptation in the imported fire ant Evolution 5.
68-79.
Wilson, E.O., and Eads, J.H. 1949. A report on the imported fire ant, Solenopsis
saevissima var. richteri Forel in Alabama. Ala. Dept. Conserv. Spec. Rep.
Woese, C.R. 1987. Bacterial evolution. Microbiol. Rev. 51. 221-271.
Woese, C.R., and Fox, G.E. 1977. Phylogenetic structure of the prokaryotic domain:
The primary kingdoms. Proc. Natl. Acad. Sci. USA 74, 5088-5090.
Woese, C.R., Kandler, O., and Wheelis, M.L. 1990. Towards a natural system of
organisms: Proposal for the domains archaea, bacteria, and eucarya. Proc. Natl.
Acad. Sci- USA 87, 4576-4579.

125
Wojcik, D., Jouvenaz, P., and Lofgren, C.S. 1987. First report of a parasitic fly (Dptera:
Phoridae) from a red imported fire ant (Solenopsis invicta) alate female
(Hymenoptera: Formicidae). Fla. Entomol. 70. 181-182.
Wood, B.J.B. 1988. Lipids of algae and protozoa, in Microbial lipids, vol. 1,
(Ratledge, G, and Wilkinson, S.G. eds.). Academic Press, London.
Yamakawa, T., and Ueta, N. 1964. Gas chromatographic studies of microbial
components. I. Carbohydrate and fatty acid constitution of Neisseria. Japan. J.
Exp. Med. 34, 361-374.
Zhu, X., Wittner, M., Tanowitz, H.B., Cali, A., and Weiss, L.M. 1993. Nucleotide
sequence of the small ribosomal RNA of Encephalitozoon cuniculi. Nucleic Acids
Res. 21. 1315.
Zhu, X., Wittner, M., Tanowitz, H.B., Cali, A., and Weiss, L.M. 1993. Nucleotide
sequence of the small subunit rDNA of Ameson michaelis. Nucleic Acids Res. 21,
3895.
Zhu, X., Wittner, M., Tanowitz, H.B., Kotler, D., Cali, A., and Weiss, L.M. 1993. Small
subunit rRNA sequence of Enterocvtozoon bieneusi and its potential diagnostic role
with use of the polymerase chain reaction. J. Infect. Pis. 168, 1570-1575.
Zuckerkandl, E., and Pauling, L. 1965. Molecules as documents of evolutionary history.
J. Theoret. Biol. 8, 357-366.

BIOGRAPHICAL SKETCH
Bettina Angela Moser was bom on 4 September 1961 in Landstuhl/Pfalz, then
West-Germany. Following graduation from the Burggymnasium Kaiserslautern, 1980,
she studied Cultures of the Middle East at the Universitt des Saarlandes in
Saarbrcken from 1980-82. She then went to the Freie Universitt in Berlin where she
majored in biology and Persian language. She received the Vordiplom (equivalent of
B.S.) in biology in 1984.
In 1986 she came to the University of Florida as a non-degree graduate exchange
student for one year and took courses in the Entomology and Nematology Department.
She decided to stay and pursue her M.S. in that department which was awarded in 1989.
After two years as a research assistant working on insect-pathogenic fungi, she started her
Ph.D. project on microsporidia pathogenic to imported fire ants under the direction of
Drs. Richard Patterson and James Becnel.
126

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Richard S. Patterson, Chairman
Professor of Entomology and Nematology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy
Jades J. Beci>el, Cochairman
Assistant Professor of Entomology and
Nematology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
John/Gander
Professor of Microbiolgy and Cell Science
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
es Kimbrough
rofessor of Plant Pat
ology
)
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Philip Ko
Professor of Entomology and Nematology

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
mijes M;
Janijbs Maruniak
Associate Professor of Entomology and
Nematology
This dissertation was submitted to the Graduate Faculty of the College of
Agriculture and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.
December, 1995 X-
Dean, College of Agriculture
Dean, Graduate School



35
were exposed to lxlO5 spores of N. algerae One day post-exposure, the larvae were
transferred to 8x38x50 cm rearing pans containing 900 mg powdered alfalfa in 3 L
deionized water. After two days, 900 mg of a 1:1 mix of liver:brewer's yeast was added;
thereafter, in 2-3 day intervals until pupation, 900 mg of a 1:1:1 mix of liver: brewer's
yeast: hog chow was added. Pupae were picked daily, transferred to small cups, and held
for emergence in aluminum C-frame cages covered with tube gauze. Cotton balls
saturated with 10% aqueous solution of sucrose were added (Anthony et al. 1978).
Spores were harvested from adult mosquitoes 3-5 days post-emergence.
Spore Harvest and Purification
Last-instar H. zea larvae infected with V. necatrix were surface-sterilized in 70%
ethanol. Fat bodies were removed without lacerating gut tissues, placed into deionized
water, ground in a glass tissue grinder, and filtered through cotton. Adult H. zea moths
infected with N. algerae were rinsed in water and, after wing removal, triturated in a
Tekmar Tissumizer in deionized water. The resulting suspensions were filtered through a
cotton plug in a glass syringe. The crude V. necatrix and N. algerae spore preparations
were further purified by a deionized water wash and differential centrifugation on a
continuous Ludox gradient (Undeen and Alger 1971).
Adult infected mosquitoes were immobilized by chilling at -20C for about 3 min,
removed with an aspirator connected to a vacuum pump, and homogenized in a small
amount of deionized water in a Waring blender. The resulting suspension was strained
through a cotton plug in a syringe to remove large body parts. Further purification was
achieved by a deionized water wash and differential centrifugation on a continuous Ludox
gradient
Adult worker ants of £. richteri infected with Thelohania sp. were triturated in a
Tekmar Tissumizer in 'ant homogenizing buffer' (0.1% SDS, 10 mM Tris-HCl pH 7.5,


ACKNOWLEDGMENTS
I wish to thank the members of my supervisory committee, Drs. John Gander,
James Kimbrough, Philip Koehler, and James Maruniak, for their guidance and advice
throughout the course of my degree program. I am especially indebted to my chairman,
Dr. Richard Patterson, and cochairman, Dr. James Becnel, for their continued assistance
and support. I was the last student of Dr. Patterson and the first student of Dr. Becnel.
Drs. Becnel, Maruniak, and Patterson graciously provided me with laboratory space and
equipment to conduct my research. Sincere appreciation is due to Dr. James Nation,
Nancy Hodge, and David Milne who kindly shared their knowledge on gas-
chromatographic techniques.
I will always remember the friendship and stimulating conversations with fellow
students and researchers Jaw-Ching Liu, Rejane Moars, Alejandra Garcia-Canedo, and
Dr. Ayyamperumal Jeyaprakash. I also want to thank all my other friends inside and
outside the department for the good times and moral support. Warm thanks go to Myma
Litchfield, who ceaselessly helped with bureaucratic paper work. I am very grateful to
my family, who provided never-failing support
I have deep appreciation for the many pleasant things in Gainesville which made
my stay enjoyable and gave me strength to carry on. I have everlasting memories of the
beautiful sun, springs, and trees. The ultimate source of strength, perseverance, and
courage, however, I derive from my faith in God.


20
Figure 2.7. Light micrograph of meiospore octets ofThelohania sp. (TM) and
Vairimorpha sp. (VM). x750.
Figure 2.8. Light micrograph ofThelohania sp. and Vairimorpha sp. free spores (TF, VF)
and meiospores (TM, VM). x750.


Figure 2.2. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. (VC) and Thelohania sp. (TC). xl8.
Figure 2.3. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. (VC) and Thelohania sp. (TC). x46.


99
3. Wash in 0.1 M cacodylate buffer (pH 7.2 7.3) 3 times at 15 minutes each (for a
total of 45 minutes).
4. Postfix in 1.0% osmium tetroxide (pH 7.5) for 1 hour 45 min. to 2 hours.
5. Double distilled washes 3 times at 15 minutes each (for a total of 45 minutes).
6. Begin dehydration or for extended storage use sucrose buffer.
Dehydration:
1. 10% ETOH 10 minutes
2. 30% ETOH 10 minutes
3. 50% ETOH 10 minutes
4. 70% ETOH 10 minutes
5. 80% ETOH 10 minutes
6. 90% ETOH 10 minutes
7. 95% ETOH-10 minutes
8. 100% ETOH 15 minutes
9. 100% ETOH 15 minutes
10. 100% Acetone -15 minutes
11. 100% Acetone 15 minutes
Put specimen into plastic dilutions.
Infiltration and Embedding:
1. 25% resin: 75% absolute acetone overnight
2. 50% resin: 50% absolute acetone 4 hours
3. 75% resin: 25% absolute acetone 4 hours
4. Pure resin overnight
5. Pure resin (change vials) all day (6 hours)*
*For better infiltration, especially for spores, extend the specimen in pure resin for
another day (overnight) or over the weekend. Embed as usual.
6. Embed in Beem capsules which have dried at least 24 hours in a 60C oven. Make
sure to include label with block number when embedding. Leave in oven overnight
7. Remove the embedded blocks next morning and let them cool off before cutting out
blocks.
8. Blocks are now ready for thick-and thin-sectioning.
9. Stain thin section with methanolic uranyl acetate (50% methanol, 1% uranyl acetate)
for five min. Rinse grids in deionized H20, blot dry and stain with lead citrate
(Reynolds 1963) for 5 min. To stain, immerse the grids into droplets of lead citrate.
Blot dry.


17
Figure 2.4. Light micrograph of Thelohania sp. partial cyst (TC) with meiospores
(MS) and free spores (FS). x750.


65
1989; Ameson michaelis. Zhu et al. 1993; Endoreticulatus schubergi.
Ichthyosporidium sp., Nosema bombycis. Encephalitozoon hellem Baker et al. 1995;
Pleistophora sp., Glugea atherinae. N. comeum. DaSilva et al. unpublished, direct
submission 1994; Encephalitozoon cuniculi. Zhu et al. 1993; Enterocvtozoon bieneusi.
Zhu et al. 1993; Sep tata intestinalis. Visvesvara et al. 1995; N. apis. Malone et al. 1994;
N. trichoplusiae. Pieniazek et al. unpublished, direct submission 1994; N. vespula. Ninham
unpublished, direct submission 1994; V. necatrix. Vossbrinck et al. 1987). Giardia lamblia
was chosen as an outgroup because, like microsporidia, it is a primitive eukaryote with a
16S like rRNA. It has two nuclei and lacks mitochondria, a normal endoplasmatic
reticulum or Golgi. In a multikingdom tree based on rDNA sequences, G- lamblia
represents the earliest diverging lineage in the eukaryotic line of descent Its branching is
followed by V. necatrix (Sogin et al. 1989).
A multiple sequence alignment of those sequences together with the sequences of
Vairimorpha sp., Thelohania sp., T. solenopsae. and A. penaei was performed with the
programs PileUp and Clustal (Genetics Computer Group, Inc., Madison, Wisconsin). The
multiple sequence alignment file was analyzed with PAUP. A distance matrix was created,
and the heuristic option of PAUP was used to find the optimal phylogenetic tree. A
phylogenetic tree illustrates the evolutionary relationships among a group of organisms (Li
and Graur 1991). A bootstrap analysis was performed to place confidence estimates on
the groups contained in the optimal tree.
A distance matrix shows a pairwise comparison of all the taxa. Absolute distances
could also be called absolute differences and are shown in the lower triangle of the table.
Absolute distances give the numbers of nucleotides that differ between two sequences.
However, a change from one state (i.e. nucleotide) to another at a particular position is
counted only if that position is not missing for either of the taxa. Mean distances (given in
upper triangle) are calculated by dividing the absolute distance by the total number of
characters that are not missing for either taxon and thus represent the percent nucleotide


41
In N. algerae from com earworm, levels of 16:1 05 7 cis (palmitoleic acid), 18:2 05
6,9 cis/18:0 anteiso (Summed Feature 6), and 18:0 (stearic acid) were 2.0%, 25.4% and
9.4%, respectively. Percentages of those acids in N. algerae isolated from mosquito,
11.4%, 13.4%, and 4.7%, were significantly different (p 0.05).
Based on mass spectral information, the major FAMEs present in the
microsporidia tested (14:0, 16:0, 16:1 05 7 cis, 18:0, 18:1 05 9 cis, 18:2 05 6,9 cis) could be
confirmed. Chromatograms of the FAME standards and the microsporidia are presented
in Figures 3.1-3.3. The chromatograms were obtained from samples characterized by
coupled GC-MS. With this system, the C20 fatty acids could not be detected.
Principal Component Analysis of the three major acids was used to graphically
portray the clustering of the three species (Figure 3.4). Thelohania sp. was separated from
the other species because of its low percentage of 16:0. Nosema algerae and V. necatrix
both had larger percentages of 16:0, but V. necatrix also had a high percentage of 18:1 G5
9 cis, which distinguished it from N. algerae.
Host insect affected the clustering of N. algerae. Lower levels of Summed
Feature 6 were detected in N. algerae from mosquito than N. algerae from com earworm.
Variability in the FAME profiles of the individual samples was lowest in N. algerae from
mosquito (Table 3.1, Figure 3.4). Comparison of analyses of fresh and stored spore
samples (storage at 4C for 3 months, or -70C for 1 month, of N. algerae and Thelohania
sp., respectively) showed that storage did not alter the FAME profiles (data not shown).
Discussion
Fatty acid methyl ester profile analyses of microsporidia have not been reported
previously. The three microsporidian species analyzed in this study can be differentiated


110
Parti al 16S rRNA gene sequence of Vairimorpha sp.
1
TCAGAGATTA
AGCCATGCAA
GCCAGCGAAG
ATTACGGAGC
GGCGTACGGC
51
TCAGTAGGAC
AGGGAAATCT
AGCCACGAAG
GAGGATAACC
ACGGTAAGCT
101
GTGGCTAAAA
CGAGCGTGGG
TGAGTTCTTG
GCCTATCAGC
TAGTCGGTAC
151
GGTAAGGGCG
TACCGAGGCA
ATAACGGGTA
ACGGGGAATC
GGGGTTCGAT
201
TCCGGAGAGG
AAGCCTGAGA
AACGGCTACC
ACGTCCAAGG
AAGGCAGCAG
251
GCGCGGAAAT
TACCCACTTG
GAGGACCAGA
GGTAGTTATG
GGGCGTAAAG
301
ATGAGAAAAG
TGTAAAAAGC
TTTTTGAATG
CGACTGGAGG
GCAAGTCTGG
351
TGCCAGCAGC
CGCGGTAATT
CCAGCTCCAG
GAGCTTCTGT
GTGAGTTGCT
401
GCGGTTAAAA
AGTGCGTAGT
CGGGGAGCAG
GCCAGCAGAA
AAGGTGGGGA
451
ATCACGCCTA
GCATAGTGCA
GGAACTGGGA
CCTAGGGACC
GGAGAGGGGC
501
AACCTAATTC
TTGGGCGAGG
GGTGAAAACT
GCTGACCCTG
AGAGGAGGAA
551
CAGAGGCGAA
GGCGGTTGTC
CGGGACGGGT
CTGACGATCA
AGTACGTGAG
601
CAGGAGGATC
AAAGACGATT
AGACACCGTC
GTAGTTCCTG
CAGTAAACGA
651
TGCCGACGGG
GCAGCAGGGG
aacttgttgc
CTGAGGGAAA
CCAAGTGTAC
701
GGGCTCCGGG
GATAGTACGG
GCGCAAGCTT
GAAACTTAAA
GAAATTGACG
751
GAAGGACACC
ACAAGGAGTG
GAGTGTGCGG
GTTAATTTGA
CTCAACGCGG
801
GACAACTTAC
CGGGGCAGGC
GACGAGAAGC
GAAGGATGAT
GAAGAGATTC
851
ACAGACTGAT
TGCGTCGCGT
GTGGTGCATG
gccgttttta
ACACGTGGGG
901
TGACTTGTCA
GGTTAAATCC
GATAACGCGT
GAGACCCTGT
GTAGATGGAA
951
ATACGACGGG
ACATGGCAAG
TGTCAGGAAG
AGCGGGTCGA
TAACAGGTCT
1001
GTGATGCCCG
CAGATGTTCC
GGGCGCCACG
CGCACTACAT
TGGACGGCGA
1051
TATATGAAAA
TGAGGAGCCG
TCCGTGGTTG
GGATTGACGC
TTGTAATTGC
1101
GTCATGAACG
TGGAATTCCT
AGTAGTGGGC
AGTCATTAAC
TGCACGCGAA
1151
TGAGTCCCTG
TTCTTTGTAC
ACACCGCCCG
TCGTTATCTA
AGATGGAAGT
1201
GCGGATGAGG
TCGGTACGGC
CGGACGAATC
TGTGCTTGTA
GATTGGATAC
1251 AA


72
Thelohanla sp.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha ap.
A. michaelis
Thelohanla ap.
T. aolenopaae
N. bombycls
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla ap.
T. aolenopaae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
1
60
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTATACTCTAAGATTAACCC
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTATACTCTAAGATTAACCC
ATTCTGCCTGACGTAG-ACGCTATTCCCTAAGATTAACCC
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTATTCCCTAAGATTAACCC
GACGTAG-ACGCTATTCCCTAAGATTGGCCC
ATTCTGCCTGACGTGG-ATGCTATTCTCTGGGGCTAAGCC
CACCAGGTTGATTCTGCCTGACGTGG-ATGCTATTCTCTGGGACTAAGCC
CACCAGGTTGATTCTGCCTGACGTGG-AGGCTATTCTCTGGGGCTAAGCC
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTAGTCTCTGAGATTAAGCC
CACCAGGTTGATTCTGCCTGACGTAG-ACGCTAGTCTCTGAGATTAAGCC
CACCAGGTTGATTCTGCCTGACGTAG-ATGCTAGTCTCTAAGATTAAGCC
CACCAGGTTGATTCTGCCTGACGTAG-ATGCTAGTCTCTGAGATTAAGCC
CACCAGGTTGATTCTGCCTGACGTGG-ATGCTAGTCTCATAGGTTAAGCC
CACCAGGTTGATTCTGCCTGACGTGG-ATGCTAGTCTCTAAAGTTAAGCC
GGTTGATTCTGCCTGACGTAGAACGCTAGTCTCACAGATTCAGCC
61
ATGCATGTTTATTGAATA TAAAGA-
ATGCATGTTTATTGAATA TAAAGA-
ATGCATGTTTTTGATA TGG-
ATGCATGTTTTTGACAT TTG-
ATGCATGTTTTTGACGTACTATGTACTG
ATGCATGTTTATGAAGCCTTTATGGGGG-
ATGCATGTTGATGAA- -CCTTGTGGGGG-
ATGCATGCTTGTGAACTCTTTGTGGGGG-
ATGCATGTCTATGAAA-C
ATGCATGTCTATGGAA-C
ATGCATGTTTCCGCAATC
ATGCATGTCAGTGAAGCC-TTACGGTGG-
120
T
ATAACAT
AAAGACGAACAG
AAAGACGAACAG
AAAAATGGACTG
-AAAAATGGACTG
AAAGATGGACTG
-ATTGACGGACGG
-ATTGACGGACGG
-ATTAGCGGACGG
AAGGACGAACAG
-AAGGACGAACAG
AGGGACGAATAG
AACGGCGAACGG
ATGCATGTGCAAGCGAAGCGTAAGTGGAGCGGCGCA AGGCTCAGTAACGGGCGAGTA
sp. ATGGATGTCTAAGCAAAGCGTAAGTCGAGCGGCAC AGGCTCAGTAACGGGCGAATA
ATGCAAGTAGTATGTATG TAATACACAATGG
121 180
AATCTACATAAATGGATAACCTTGTCA AGATAAGGCTAATACAGTAAAGATGTTAGA
AATCTACATAAATGGATAACCTTGTCA AGATAAGGCTAATACAGTAAAGATGTTAGA
CTCAGTAACTCTTATTTGATTTGATGTA--TTAGGATTCTAACTATGTTAAATTATAG-G
CTCAGTAACTCTTATTTGATTTGATGTA--TTAGGATTCTAACTATGTTAAATTATAG-G
CTCAGTAATACTCACTTTATTTAATGTATTAAATTAGTATAACTGCGTTAAAGTGTAGCA
CTCAGTAATACTCACTTTATTTTATGTA-CATTTGAAACTAACTACGTTAAAGTGTAG-A
CTCAGTAATACTCACTTTATTTGATGTACCTTAT--ACATAACTACGTTAAAGTGTAGC-
CTCAGTGATAGTACGATGATTTGATTGGGAGCCTGGATGTAACTGTGGGAAACTGCAG-G
CTCAGTGATAGTACGATGATTTGGTTGGCGGGAGAGCTGTAACTGCGGGAAACTGCAG-G
CTCAGTGATAGCACGATGATTTGTTTGCGGGATGAGCAGTAGCTGCGGGAAACTGCAG-A
CTCAGTAAAACTGCGATGATTCAGTCTGTCTGTCAAGA-TAACCACGCGAAAGTGTGG-C
CTCAGTAAAACTGCGATGATTCAGTCTGTCTGTCAAGA-TAACCACGCGAAAGTGTGG-C
CTCAGTAAAACTGCGATGATTTAGTCTGGCTGTGTAGA-TAACTACGTGAAAATGTAG-C
CTCAGTAATGTTGCGGTAATTTGGTCTCTGTGTGTAAACTAACCACGGTAACCTGTGG-C
ACTTTTAACTAACCT- TTTGTACTAA-TAATTAAGGGAAACTGTAA-T
TTTGATCTCCTAGAGTGGATATCCTCTGTAACCGGAGGGCAAAACACAAGATGAGCGA
sp. TTTAATCTCCTCGAGTGGATATCCTCTGTAACCGGAGGGCAAAACACAGGACGTGCAG
GGCGTACGGCTCAGT AGGACAGGGAAATCTAGCCACGAAGGAGGA
CTCAGTATCG--AGTATAGCTTTGCTCTCCAAGATGTGATACTTTCAGGAAACAGAAA-A


46
by a combination of qualitative and quantitative FAME profile characteristics
(Table 3.1, Figure 3.4). Three acids, palmitic (16:0), Summed Feature 6 (18:2 G5 6,9
cis/18:0 anteiso) and oleic (18:lC3 9 cis) were present in large percentages in all
microsporidian samples analyzed. Palmitic acid is ubiquitous; it is present in all organisms
(M. Sasser, personal communication). Oleic acid is present in many bacterial human
pathogens, phytopathogens, as well as vesicular-arbuscular mycorrhizae. Examples
include gram positive bacilli and mycobacteria (Welch 1991; Portaels et al. 1993), the
plant pathogens Erwinia amvlovora. E. carotovora. Burkholderia solanacearum (formerly
Pseudomonas solanacearum). and P. svringae (Sasser 1990a), and the mycorrhiza
Gigaspora rosea (Bentivenga and Morton 1995). A comprehensive list of fatty acids
characteristic of a wide variety of organisms has been published (Kerwin 1994).
Fluctuations in FAME profiles were especially evident in V. necatrix and the
Thelohania sp. For example, three unnamed fatty acids were detected in several, but not
all, Thelohania sp. samples. These acids could be typical of developing spores
(physiological age differences of spores), or representative of the organism. The
microsporidian life cycle has two distinct phases: merogony (or schizogony) and
sporogony. Vegetative stages called meronts (or schizonts) develop into sporonts, and
finally into mature spores (Sprague et al. 1992). Preliminary experiments indicated that
FAME profiles of immature spores were qualitatively and quantitatively different from
profiles of mature spores of the same species (data not shown). Density gradient
centrifugation of microsporidian spores may not always result in the complete separation
of immature and mature spores. Spore bands with predominantly mature spores may
therefore contain immature spores (and vice versa), rendering spore samples not
completely homogeneous, which may add variability to the FAME profiles.
A variety of environmental factors, including age, culture medium, pH, and growth
temperature have been shown to affect FAME profiles of bacteria (Lechevalier 1989;
Decallonne et al. 1991; Shimizu et al. 1991; Stead et al. 1992) and fungi (Marumo and


105
7. Do two CHCI3 extraction using 400 (J.L per extraction. (The tube capacity is too
small to use an equal volume of CHC13 but 1/2 vol works fine). Mix the phases by
tube inversion. Centrifuge the tube for 1 min and remove the aqueous phase to a
clean tube.
8. Precipitate the DNA by adding an equal vol of 100% isopropanol (~ 700 }iL), pellet
the DNA by centrifugation at 12,000 rpm for 15 min at room temperature, and
remove the supernatant. Wash the pellet with 500 |iL of 70% ethanol by inverting
tube several times, then dry pellet briefly (5 min) under vacuum.
9. Dissolve the pellet in 32 |iL diH20, and sequentially add 8.0 (iL 4 M NaCl, mix, and
40 flL 13% PEGgooo. Mix well and incubate on ice for 1 h.
10. Centrifuge the tube at 12,000 ipm for 15 min at 4C. Carefully remove the
supernatant. The pellet will be translucent at this point and hard to see which is why
a fixed angle rotor is preferable to a horizontal rotor. Rinse the pellet with 500 (J.L of
70% ethanol.
11. Dry the pellet under vacuum for 5 min and resuspend the DNA in 20 |lL of deionized
H20.
SeaPlaque agarose purification
1. Electrophorese digested plasmid DNA on 0.8% SeaPlaque agarose; include 1 kb X
DNA ladder (BRL Life Technologies. Inc.) and X bacteriophage DNA cut with
Hindlll (X/HindlU cut DNA).
2. Cut out the band of interest.
3. Melt the slice of agarose containing the band of interest at 65C for 30 min; warm
agarose diluent (0.2 M NaCl, 0.02 M Tris-HCl, pH 7.5, 0.002 M EDTA) at same
time.
4. Dilute the molten slice to at least 0.3% agarose concentration with diluent and keep
at 65oC for another 5 min.
5. Extract plasmid DNA 3 times with warm Tris-HCl saturated phenol, pH 7.0 (37C).
6. 3 times ether extraction; evaporate ether on heating pad.
7. Ethanol precipitation:
Add 1 (J.L of 1 |ig/|iL t-RNA
Add 1/2 vol of 7.5 M ammonium acetate and 2 vol of 100% EtOH
Keep on ice for 10 min (to overnight)
Centrifuge for 10-20 min
Wash pellet with 500 |iL of 70% EtOH
Dry under vacuum
Dissolve pellet in 20 \xL of sdH20 and heat at 56C for 10 min.
Cycle sequencing of PCR product or plasmid DNA
Use fmol sequencing kit from Promega and follow the instructions.


118
Lane, D.J., Pace, B., Olsen, G., Stahl, D.A., Sogin, M.L., and Pace, N.R. 1985. Rapid
determination of 16S ribosomal RNA sequences for phylogenetic analysis. Proc.
Natl. Acad. Sri. USA 82, 6955-6959.
Langley, R.C., Cali, A. and Somberg, E.W. 1987. Two-dimensional electrophoretic
analysis of spore proteins of the microsporidia. I. Parasitol. 73, 910-918.
Lawrence, D., Heitefuss, S., and Seifert, H. S. H. 1991. Differentiation of Bacillus
anthracis from Bacillus cereus by gas chromatographic whole-cell fatty acid analysis.
I Qm. Microbiol. 29, 1508-1512.
Lechevalier, M.P. 1989. Lipids in bacterial taxonomy. In CRC practical handbook of
microbiology, (O'Leary, W. Ed.), pp. 455-515. CRC Press, Boca Raton.
Lewin, B. 1994. Genes V. Oxford University Press, Oxford.
Li, W.-H., and Graur, D. 1991. Fundamentals of molecular evolution. Sinauer
Associates, Inc. Publishers, Sunderland, Massachusetts.
Lofgren, C.S. 1986. History of imported fire ants in the United States. In Fire ants and
leaf-cutting ants. Biology and management, (Lofgren, C.S,and Vander Meer, R.K.
eds.), pp. 36-47. Westview Press, Boulder.
Losel, D.M. 1988. Fungal lipids. In Microbial lipids, vol. 1, (Ratledge, C., and
Wilkinson, S.G. eds.). Academic Press, London.
Maddox, J.V. 1966. Studies on a microsporidioisis of the armyworm Psendaletia
unipunctata (Haworth). Ph.D. Thesis. University of Illinois, Urbana, DI.
Maddox, J.V., McManus, M.L., Jeffords, M.R., and Webb, R.E. 1992. Exotic insect
pathogens as classical biological control agents with an emphasis on regulatory
considerations. In Selection criteria and ecological consequences of importing
natural enemies, (Kauffman, W.C., and Nechols, J.E. eds.). Thomas Say
Publications.
Maddox, J.V., and Sprenkel, R.K. 1978. Some enigmatic microsporidia of the genus
Nosema. Mise. Publ. Entorno!. Soc. Am. 11: 65-84.
Malone, L.A., Broadwell, A.H., Mclcor, C.A., Linridge, E.T., and Ninham, J. Ribosomal
genes of two microsporidian species, Nosema apis and Vavraia oncoperae are very
variable. I. Invert. Pathol. 64, 151-152.
Marr, A.G., and Ingraham, J.L. 1962. Effect of temperature on the composition of fatty
acids in Escherichia coli. J. Bacteriol. 84, 1260-1267.


80
Thelohanla sp.
T. solenopsaa
N. bombycis
N. trlchoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cuniculi
Plelstophora sp.
E. schubergi
N. corneum
E. bleneusi
A. penael
G. atherinae
Ichthyosporldlum sp.
Valrlmorpha sp.
A. michaells
1441
1466
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGGAGAACCATTAGCAGGATCATAA
TGG
CGGTGAACCATTAGCAGGATCATAA
TGG
TGGAGAACCATTAGCAGGATCATAA
TGG
AGGAGAACCATTAGCAGGATCATAA
TGAAGAATCAGCAGTAGGATTAGCG
Figure 4.4. Multiple sequence alignment of the rRNA gene sequences of 19
species of microsporidia. Alignment of the sequences was done with the programs PileUp
and CLUSTAL W (1.4). Names of microspridian species typed in bold indicate sequences
obtained by the author. Dashes indicate gaps that were introduced to maintain alignments.
Conserved regions are identified by


60
selected as potential clones and picked off the plates for further analysis (Bethesda
Research Laboratories Life Technologies, Inc. transformation protocol).
Dot Blot to Confirm Clones: All clear colonies that grew on the X-Gal and
ampicillin enriched LB plate were streaked in a grid pattern on a fresh LB plate
supplemented with 100 pg/mL ampicillin and incubated over night at 37C for 16 h to
develop E. coli transformant colonies. For hybridization, a nylon membrane (Zeta Probe)
was cut (10 cm x 15 cm) and dots, 1 cm apart from each other, were marked on it with a
soft pencil. A tooth-pick head full of each numbered E. coh transformant colony was
suspended in 10 pL LB broth and 1 pL of that suspension spotted on a marked area. To
denature the bacterial DNA, the membrane was sequentially immersed in 0.5 M NaOH/
1.5 M NaCl for 30 sec, 0.5 M Tris-HCl pH 8.0/1.5 M NaCl for 5 min, and 6x standard
saline citrate (SSC) for 5 min. The membrane was wrapped in Whatman Blot paper and
baked at 80C for 2 h. Prehybridization, hybridization, and washes were done in a Mini
Hybridization Oven OV3 (Biometra). The membrane was prehybridized for 4-6 h at 68C
in 6x SSC, 0.5% SDS, 5x Denhardts solution, 0.01 M EDTA, and 100 pg/mL denatured
herring sperm DNA (Sambrook et al. 1989). To make the probe, 1 pg PCR product was
labelled with 32P-dATP using a nick translation kit (USB Nick Translation Protocol). The
membrane was hybridized for 16 h at 68C in hybridization buffer (6x SSC, 0.5% SDS, 5x
Denhardts solution, 0.01 M EDTA) containing the nick translated PCR-amplified 16S
rRNA gene of the microsporidian species to be tested. The membrane was washed twice
in 2x SSC and 0.5% SDS at 68C for 2 h each and heat-sealed in a plastic bag. It was
exposed to an x-ray film overnight at -70C.
Glycerol Stock from Positive Clones: The clones that showed strong hybridization
to the probe (positive clones) were picked from the LB plate and grown in 3 mL terrific
broth (TB) containing 35 pg/mL ampicillin overnight at 37C and 225 ipm. The next day,
850 pL of the cell suspension was added to 150 pL of sterile glycerol to make a 15%
glycerol stock and stored at -70C. To grow up glycerol stocks for plasmid purification,


74
Thelohanla sp.
T. solenopsae
N. bombycls
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaells
361 420
GAAACTTACCCAATTATT-GTATTGATAGAGGTAGTTATGACGCATGTTAAGATTTTA
GAAACTTAC--CCAATTATT-GTATTGATAGAGGTAGTTATGACGCATGTTAAGATTTTA
GAAACTTGA-CCTATG-ATA--TTAT-ATTGAGGCAGTTATGAGTAGTATTTTATAATTA
GAAACTTGA-CCTATG-ATATTAT-ATTGAGGCAGTTATGAGTAGTATTTTATAATTA
GAAACTTGA-CCTATGGATTTTATCTGAGGCAGTTATGGGAAGTAATATTCTATTG
GAAACTTGA-CCTATGGATTTTATCTGAGGCAGTTATGGGAAGTAATATTATATTG
GAAACTTGA-CCTATGGATATTATCTGAGGCAGTTATGGGAAGTAACAT--AGTTG
GAAACTTGCCTAATCCT-TATT GGGGAGGCGGTTATGAGAAGTAAGATGTT
GAAACTTGCCTAATCCT TT GGGGAGGCGGTTATGAGAAGTGAG-TTTT
GAAACTTG CCTAATCCT TT GGGGAGGCGGTTATGAGAAGTGATGGTGTGCGA
GAAAATTG- CCCACTGTT T- -G-GAGGAGGCAGTTATGAGACGTGAGAAAGAGTGC
GAAAATTG- CCCACTGTT T- -G-GAGGAGGCAGTTATGAGACGTGAGAAAGAGTGC
GAAAATTGCCCACTCTT TG- CAGGAGGCAGTTATGAGACGTGAAGATGAGTAT
GAAACTTGTCCACTCCT TACG-GGGGAGACAGTCATGAGACGTGAGTATAAGACC
GAAAATTG- CAC ACTCTT TAAT-GGGGATGCAGTTATGAGGTATGACAGAAAGGGT
GAAAATTACCGCAGCCTG CATTCAGGGCGGTAGTAAGGAGACGTGAAAACAATGTG
sp GAAAATTACCGCAGCCTG CATTCAGGTCGGTAGTAAGGAGACGTGTAAACGATGTG
GGAAATTACCCACTTG GAGGACCAGAGGTAGTTATGGGGCGTAAAGATGAGAAA
GAAACTTA- -CCGAATTATAGAATA GAGGTAGTGATGGAAACGTTTATATAGAAA
* ** ** ** *
421 480
AATTGAAACTTCATTAAAGATAGATAAGCGACTGGAGGGCAAG-TCTGGTGCCAGCAG
AATTGAAACTTCATTAAAGATGGTTAAGCGACTGGAGGGCAAG-TCTGGTGCCAGCAG
TTGTAGTATTGTAAGTACATATTACAAGATAAATCGGAGGGCAA-ATCGAGTGCCAGCAG
TTGTAGTATTGTAAGTACATATTACAAGATAAATCGGAGGGCAA-ATCGAGTGCCAGCAG
TT-TCATATTGTAAAAGTATATGAGGTGATTAATTGGAGGGCAA-ATCAAGTGCCAGCAG
TT-TCATATTTTAAAAGTATATGAGGTGATTAATTGGAGGGCAA-ATCAAGTGCCAGCAG
TT-TCACATTTTAAACGTATGTGAGCAGATTAATTGGAGGGCAA-ATCGAGTGCCAGCAG
-TAGCA AGTATAAATTTGTTGTGATTTACTGGAGGGCAAG-TCGGGTGCCAGCAG
-TTTCG AGTGTAAAGGAGTCGAGATTGATTGGAGGGCAAG-TCGGGTGCCAGCAG
GTGCAA AGGGAATGGCTATTGTTGTATGTTGGAGGGCAAGCTCGGGTGCCAGCAG
TTGGTA AAGAGAAGCAGGAG AATTGGAGGGC AAG- TTTGGTGC CAGCAG
TT-GTA AAGAGAAGCAGGAG AATTGGAGGGCAAG- TTTGGTGCCAGCAG
CTTGTA AAGAGGGATAGGAG AATTGGAGGGCAAG-TTTGGTGCCAGCAG
TGAGTG TAAAGACCTTAGGGTGAAGCAATTGGAGGGCAAGCTTTGGTGCCAGCAG
TATCAA TAAATAAGATGACGTAAAGCTATTAGAGGGAAAG-TTTGGTGCCAGCAG
CGGGCA AAAAACGCACTAGAT ACAGGAGGACAAG-ACTGGTGCCAGCAC
sp. CAGGTA AAGAATGCACTGTAT ACAGGAGGACAAG-ACTGGTGCCAGCAC
AGTGTA AAAAGCTTTTTGAATGCGACTGGAGGGCAAG-TCTGGTGCCAGCAG
TACTGGTAAAGCAAGTA TTATTAACTGAGGAAAGCTGGTGCCAGCAG
it 1t + it It *
481 540
CCGCGGTAATTCCAGCTCCAGTAGTGCATAT ACATGCTGTAGTTAGAAAGTTTGT
CCGCGGTAATTCCAGCTCCAGTAGTGCATAT ACATGCTGTAGTTAGAAAGTTTGT
CCGCGGTAATACTTGTTCCGATAGTGTGTATGATGATTGATGCAGTTAAAAAGTCTGT
CCGCGGTAATACTTGTTCCGATAGTGTGTATGATGATTGATGCAGTTAAAAAGTCTGT
CCGCGGTAATACTTGTTCCAAGAGTGTGTATGATGATTGATGCAGTTAAAAAGTCCGT
CCGCGGTAATACTTGTTCCAAGAGTGTGTATGATGATTGATGCAGTTAAAAAGTCCGT
CCGCGGTAATACTTGTTCCAAGAGTGTGTATGATGATTGATGCAGTTAAAAAGTCCGT
CCGCGGTAATACCTGCTCCAGTAGTGTCTATGGTGAATGCTGCAGTTAAAATGTCCGT
CCGCGGTAATACCTGCTCCAATAGTGTCTATGGTGAATGCTGCAGTTAAAAAGTCCGT
CCGCGGTTAATTGAATCCTGCCAATTGGGTTGATGGATGCTGCCGTTAAAATGTCCGT
CCGCGGTAATACCGACTCCAAGAGTGTGTATGAGAGATGCTGCAGTTAAAAAGTCCGT
CCGCGGTAATACCGACTCCAAGAGTGTGTATGAGAGATGCTGCAGTTAAAAAGTCCGT
CCGCGGTAATACCGACTCCAAGAGTGTGTATGAGAGATGCTGCAGTTAAAAAGTCCGT
CCGCGGTAACTCCAACTCCAAGAGTGTCTATGGTGGATGCTGCAGTTAAAGGGTCCGT
CCGCGGTAATACCAACTCTAAGAGTCTCTATGCGAGTTGCTGCAGTTAAAAAGTCCGT
CCGCGGTAATACCAGCTCCTGGAGTGTCTATGATATGATTGCTGCAGTTAAAGAGTTCGT
sp. CCGCTGTAATACCAGCTCCTGGAGTGTCTATG--ATGATTGCTGCAGTTAAAGCGTTCGT
CCGCGGTAATTCCAGCTCCAGGAGCTTCTGTGTGAGTTGCTGCGGTTAAAAAGTGCGT
CCGCGGTAATACTTGCTCCAGGAGCTTATTCG ATATGTTGCGGTTAAAACGTCCGT
**** ** ** **
it



109
Partial 16S rRNA gene sequence of Thelohania sp.
1
CGAACCCATG
TGGGGAGTGG
CGGATAGCTC
AGTAATACAG
TTATAACATA
51
ATCTACATAA
ATGGATAACC
TTGTCAAGAT
AAGGCTAATA
CAGTAAAGAT
101
GTTAGAAGCA
TGAAAGCGGA
GCATCAATGT
AGCGTTGGTT
TCTGACCTAT
151
CAGTTAGTAT
GTTTTGTAAG
GGAGAACATA
GACTATGACG
GGTAACGGGG
201
GATGCACGTC
TGATACCGGA
GAGGAAGCCT
TAGAAACCGC
TTTCACGTCC
251
AAGGATGGCA
GCAGGCGCGA
AACTTACCCA
ATTATTGTAT
TGATAGAGGT
301
AGTTATGACG
CATGTTAAGA
TTTTAAATTG
AAACTTCATT
AAAGATAGAT
351
AAGCGACTGG
AGGGCAAGTC
TGGTGCCAGC
AGCCGCGGTA
ATTCCAGCTC
401
CAGTAGTGCA
TATACATGCT
GTAGTTAGAA
AGTTTGTAGC
CAGTTTATGG
451
ATTGTTTTTG
ATAATAGTTA
TTCTCCAAAA
GAGCTAATTT
TAACTAATTC
501
ATAAAAATAG
AAGCGGATGA
AGGTAATTGT
ATTCACCAGC
AAGAGGTAAA
551
ATTTGATGAC
CTGGTGAGGA
CATTCAGAGG
CGAAAGCGAT
TGCCTAGTAC
601
ATTTTTGATG
GTAAAGAACG
TAAGCCGGAG
GATCAAAGAT
GATTAGATAC
651
CGTTGTAGTT
CCGGCCGTAA
ATTATGCCAA
CTTGCATTTT
GTTATTTATA
701
CAAGGAGCAT
AGAGAAATTA
AGAGTTTTTG
GGCTCTAGGG
ATAGTAATCC
751
GGCAACGGAC
AAACTTAAAG
AAATTGGCGG
AAGGACACCA
CAAGGAGTGG
801
ATTATACGGC
TTAATTTGAC
TCAACGCGGG
AAAACTTACC
AGGGCCTATG
851
TATAAGAGAA
AGTTAACATT
GTATGTATAC
TTGATTGTAC
TTTGAGTGGT
901
GCATGGCCGT
TTTCAACACG
TGGGGTGACT
TGTCAGGTTT
ATTCCGGTAA
951
CGTGTGATGT
GCAGTATGCA
ACTAATGTTG
TGAGACTTCT
TGCGGTAAGC
1001
TTGATGAAGA
GGCGCTATAA
CAGGTCAGTG
ATGCCCTTAG
ATGTTCTGGG
1051
CTGCACGTGT
AATACAGTGG
GTATTTCAAT
ATTTAATAGG
AGTAAATTTA
1101
CCCGAGACAG
GGATCATGCT
TTGTAAGAAG


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ESTQCNPQZ_3KJRGN INGEST_TIME 2015-04-16T21:52:02Z PACKAGE AA00029833_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


76
Thelohanla sp.
T. aolenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. aolenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestinalis
E. cuniculi
Pleistophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidium
Valrlmorpha sp.
A. michaelis
721 780
GGTAAAGAACGTAAGCCGGAGGATCAAAGATGATTAGATACCGTTGTAGTTCCGGCCGTA
GGTAAAGAACGTAAGCCGGAGGATCAAAGATGATTAGATACCGTTGTAGTTCCGGCCGTA
GAACAAGGACGTAAGCTAGAGGATCGAAGATGATTAGATACCATTGTAGTTCTAGCAGTA
GAACAAGGACGTAAGCTAGAGGATCGAAGATGATTAGATACCATTGTAGTTCTAGCAGTA
GAACAAGGACGTAAGCTGGAGGAGCGAAGATGATTAGATACCATTGTAGTTCCAGCAGTA
GAACAAGGACGTAAGCTGGAGGAGCGAAGATGATTAGATACCATTGTAGTTCCAGCAGTA
GAACAAGGACGTAAGCTGGAGGATCGAAGATGATTAGATACCATTGTAGTTCCAGCAGTA
GATGAAGGACGAAGGCTAGAGGATCGAAATCGATTAGATACCGTTTTAGTTCTAGCAGTA
GATGAAGGACGAAGGCTAGAGGATCGAAATCGATTAGATACCGTTTTAGTTCTAGCAGTA
GATGAAGGACGAAGGCTAGAGGATCGAAAACGATTAGATACCGTTTTAGTTCTAGCAGTA
GATCAAGGACGAAGGCTGGAGGATCGAAAGTGATTAGATACCGCTGTAGTTCCAGCAGTA
GATCAAGGACGAAGGCTGGAGGATCGAAAGTGATTAGATACCGCTGTAGTTCCAGCAGTA
GATCAAGGACGAAGGCTGGAGTATCGAAAGTGATTAGATACCGCAGTAGTTCCAGCAGTA
GATCAAGGACGAAGGCAGGAGTATCGAAAGTGATTAGACACCGCTGTAGTTCCTGCAGTA
GATAAAGGACGAAGGCTAGAGTAGCGAAAGGGATTAGATACCCCTGTAGTTCTAGCAGTA
GATAAAGGACGTAGGCTAGAGGATCGAAGACGATTAGAGACCGTTGTAGTTCTAGCAGTA
sp. GATAAAGGACGTAGGCTAGAGGATCGAAGACGATTAGAGACCGTTGTAGTTCTAGCAGTA
GATCAAGTACGTGAGCAGGAGGATCAAAGACGATTAGACACCGTCGTAGTTCCTGCAGTA
GATCAAGGACAGAGGCTAGAGGATCGAATACGATTAGATACCGTAGTAGTTCTAGCAGTG
* *** ** ******* *** ****** *
sp.
781 840
AATTATGCCAACTTGCA- TTTTGTTATT TATACAAGGAGCATAGAGAAATTAAGAGT
AATTATGCCAACTTGCA-TCTTGTTATT TATACAAGGAGCATAGAGAAATTAAGAGT
AACTATGTTGAACCATAGATATATTTTG ATATATATTTATGTAGAGAAATTAAGATT
AACTATGTTGAATCATAGATATATTTTG ATATATATTTATGTAGAGAAATTAAGATT
AACTATGCCGACGATGTGATATGATATT AATTGTATTAGATGATAGAAATTT-GAGT
AACTATGCCGACGATGTGATATGATATA TTTTGTATTACATAATAGAAATTA- GAGT
AACTATGCCGACGATGTGATATGAGAT GTTGTATTACATTATAGAAATTA-GAGT
AACGATGCCGACTGGACG-GGACTGTT TTAGTGTTGTCCGAGAGAAATCTTAAGT
AACGATGCCGACTGGACG-GGACT-AT ATAGTGTTGTGCATGAGAAATCTTGAGT
AACGATGCCGACTGGACG-GGTCAGTG TGTG TTGCCATGAGAAATCTTGAGT
AAAGATGCCGACATGCTCGG TG GCAACACGGGGCGGGGAGAAATCTTAGA
AAAGATGCCGACATGC -TCGG TG GCAACACGGGGCAGGGAGAAATCTTAGA
AAAGATGCCGACATGCTCAT TG GACACAGTGGGCAGGGAGAAATCTTAGA
AACTATGCCGACAGCCTGTGTG TG AGAATACGTGGGCGGGAGAAATCTTAGT
AACTATGCCGACAGAATGTTAGATATA TTTCTAGTGTTCAAGGGAAACCTTAAGT
AACGATGCCGATACCGTGGTGCG GATACGCGACGCGGAAGAGAAATCGAGT
AACAATGCCGATGTTGTGGTGCC GTAACG-GACGCAAAAGAGAAATCTAGT
AACGATGCCGACGGGGCAGCAGG GGAACTTGTTGCCTGAGGGAAACCA-AGT
ACCGATGATGATTTTGCCTTATGCAAT AGAGAAATCAAAAT
*
*
841 900
TTTTGGGCTCTAGGGATAGTAATCCGGCAACGGACAAACTTAAAGAAATTGGCGGAAG
TTTTGGGCTCTAGGGATAGTAATCCGGCAACGGACAAACTTAAAGAAATTGGCGGAAG
ATATTGACTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAAGAAAGTGACGGAAG
ATATTGACTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAATTGACGGAAG
TTTTTGGCTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAATTGACGGAAG
TTTTTGGCTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAA--GAAATTGACGGAAG
TTTTTGGCTCTGGGGATAGTATGATCGCAAGATTGAAAATTAAAGAAATTGACGGAAG
ATGTGGGTTCTGGGGATAGTATGCTCGCAAGAGTGAAACTTGAAGAGATTGACGGAAG
ATGTGGGTTCTGGGGATAGTATGCTCGCAAGAGTGAAACTTGAAGAGATTGACGGAAG
ATGCGGGTTCTGGGGATAGTATGCTCGCAAGAGTGAAACTTGAA--GAGATTGACGGAAG
GTTCGGGCTCTGGGGATAGTATGCTCGCAAGGGTGAAAATTAAA--GAAATTGACGGAGC
GTTCGGGCTCTGGGGATAGTATGCTCGCAAGGGTGAAAATTAAAGAAATTGACGGAGC
GTTCGGGCTCTGGGGATAGTATGCTCGCAAGGGTGAAAATTAAA--GAAATTGACGGAGC
GTTCGGGCTCTGGGGATAGTACGCTCGCAAGGGTGAAACTTAAAGCGAAATTGACGGAAG
GATCGGGCTCTGGGGAGAGTATGCTCGCAAGTGTGAAAATTAAA-CGAAATTGACGGAGT
AGGGCCCTGGGGAGAGTACACGCGCAAGCGAGAAATTTAAAG-GAAATTGACGGAAG
sp. AGGGCCCTGGGGAGAGTACACGCGCAA-CAGGAAATTTAAAG-GAAATTGACGGAAG
GTACGGGCTCCGGGGATAGTACGGGCGCAAGCTTGAAACTTAAA--GAAATTGACGGAAG
A GATCTCCGGGGAGTACATGCGCACAGGAACTTAA GAATTGACGGAAG
* ** ***** ** ****


84
Thelohania sp. *
Thelohania solenopsae *
Nosema bombycis
Nosema trichoplusiae
Vairimorpha necatrix
Nosema vespula
Nosema apis
Encephaliiozoon hellem
Sep tata intesiinalis
Encephalitozoon cuniculi
Pleistophora sp.
Endoreticulates schubergi
Nosema comeum
Enterocytozoon bieneusi
Agmasoma penad *
Glugea atherinae
Ichthyosporidium sp.
Ameson michaelis
Vairimorpha sp. *
Giardia lambliae
Figure 4.5. Phylogenetic tree (3,511 steps) based upon the 16S rDNA sequences
of the 19 species of microsporidia aligned in Figure 4.4. Giardia lamblia was used as the
outgroup. The tree, presented as a cladogram, was generated using the heuristic option of
PAUP. Species, whose sequences were obtained by the author, are marked with


96
5. Place larvae on pinto bean diet (one larva/well); secure flat with clear plastic foil and
solid sheet of metal or plastic to prevent larvae from escaping.
6. Harvest the spores from adult moths.
Per os infection of Anopheles quadrimaculatus with N. algerae
1. Sprinkle 1000 mosquito eggs onto 100 mL infusion water and keep in insectary at
23C with a photoperiod of 16 h light/8 h dark. Infusion water consists of a 0.015%
powdered liver: brewer's yeast (1:1) suspension.
2. After 24 h, make slurry with ground alfalfa; pour into 150 mL container. Add 1x10^
spores in aqueous suspension and the neonate larvae in 100 mL hatching water. The
final concentration of the alfalfa suspension should be 0.03 %.
3. After 24 h, make alfalfa slurry for 3 L water. Pour slurry into big rearing pan, add
mosquito larvae and 3 L of deionized water. The final concentration of the alfalfa
suspension should be 0.03%.
4. Check after 48 h if larvae need to be fed (1 g of powdered livenbrewers yeast (1:1)
in slurry).
5. After additional 48-72 h feed larvae with 2 g of powdered liver:brewer's yeast:hog
chow (40% protein) (1:1:1) mix in slurry.
6. Feed again after 24-48 h with 1 g of powdered liver: brewer's yeast: hog chow (40%
protein) (1:1:1) mix slurry.
7. When larvae start pupating pick pupae daily into small cups and keep in mesh cages
until emergence. Add cotton balls saturated with 10 % dextrose to maintain adults.
8. Harvest the spores from the adult mosquitoes 3-5 days post-emergence.
Purification of V. necatrix from H. zea
1. Establish continuous density gradient with Ludox (a colloid of 40% silica in NaOH
solution, pH 9.8 and specific gravity p of 1.303) using gradient mixer. Load 15 mL
of Ludox in one chamber and 15 mL of deionized H2O in the other chamber; a
magnetic stirrer in the Ludox chamber mixes the diluent with the Ludox. A plastic
hose drains the Ludox chamber into a 30 mL centrifuge tube (Undeen and Alger
1971).
2. Surface-sterilize last-instar infected larvae in 70% ethanol and cut open in a
dissecting dish.
3. Remove fat bodies without lacerating gut tissues, place in deionized water and grind
in glass tissue grinder.
4. Strain resulting suspension through cotton plug in glass syringe to remove large body
parts.
5. Centrifuge at 4,080 g in swinging-bucket head rotor (Sorvall S 34 centrifuge) for 15
min.
6. Discard supernatant and wash pellet once in deionized H2O. Resuspend pellet in ~
500 pL of deionized H2O.
7. Layer suspension on continuous Ludox gradient


66
difference between two taxa. Mean distances are more meaningful when some tax a have
much higher proportions of missing data than others (PAUP 3.1 Users manual).
The phylogenetic tree was constructed based on the principle of maximum
parsimony or minimal evolution. Maximum parsimony involves the identification of a tree
that requires the smallest numbers of evolutionary changes to explain the differences
observed among the taxa under study (Li and Graur 1991). In molecular phylogeny the
maximum parsimony method should be called a character-state method (Li and Graur
1991) because character states are used and the shortest pathway leading to these
character states is chosen as the phylogenetic tree. The heuristic option is a search using a
heuristic or approximate algorithm. It was chosen because the microsporidian data set
was fairly large (20 taxa) and the heuristic search generally provides the fastest way to find
optimal trees.
Results
Spore Harvest
Dissection of 25-30 infected adult ants yielded about Ixl07-lxl08 spores which
amounts to approximately 3xl05-3xl06 spores per ant. When cysts were collected in
deionized water they stuck to the side of the plastic tubes which the addition of SDS
prevented.
PCR of Microsporidian DNA
It was found, that with each template tested, all three DNA concentrations (1, 5,
and 10 pL of crude DNA preparation with a concentration of less than 10 ng in 10 pL)
were amplified and that the 4 pM primer concentration worked as well as the 8 pM primer


6
bicarinata vinelandica Forel. No parasites or pathogens are found in fire ants. Jouvenaz
and Kimbrough (1991) described an endoparasitic fungus, Myrmecomyces annellisae
gen.nov., sp. nov., from Solenopsis quincecuspis Forel, collected in Buenos Aires
Province, Argentina, and £. invicta, collected in Florida. Gross pathology, histopathology,
or changes in host behavior are not observed but parasitized hosts appear to succumb
more readily to stress. Two fungi, Conidiobolus sp. and Metarhizium anisopliae. were
observed by Sanchez-Pea and Thorvilson (1992) on £. invicta queens collected in Texas.
Of the adult queens and workers, and worker larvae assayed against conidial showers of
Conidiobolus sp., only the worker larvae die. Metarhizium anisopliae kills challenged
alate workers.
The sparse occurrence of natural enemies of imported fire ants in the United States
is a good example of the introduction of an insect into another country without its
predators, parasites and pathogens. A parallel situation occurred with the gypsy moth,
Lyman tria dispar. This insect was introduced into the United States from Europe where it
has numerous natural enemies which are lacking in the United States (Howard and Fiske
1911). With regard to pathogens, one major group of pathogens, the microsporidia, have
been identified as significant mortality factors in Eurasian gypsy moth populations but they
have not been recorded from gypsy moths in North America (Jeffords et al. 1989).
Microsporidia isolated from European L. dispar are evaluated as biocontrol agents for the
US populations (Maddox et al. 1992).
Numerous reports on natural enemies of S. richteri and £. invicta in their
homelands Argentina, Brazil, and Uruguay include microsporidia, fungi, nematodes,
parasitic wasps and flies and are summarized by Stimac and Alves (1993) and Jouvenaz
(1983). Documented parasites include Orasema wasps (Heraty et al. 1993), the straw itch
mite Pyemotes tritici (Thorvilson et al. 1987), an unidentified phorid fly (Wojcik et al.
1987), the phorid Pseudacteon obtusus (Williams and Banks 1987), the nematode
Tetradonema solenopsis (Nickle and Jouvenaz 1987), and unidentified nematodes


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of
Doctor of Philosophy
COMPARATIVE ANALYSIS OF MICROSPORIDIA OF FIRE ANTS, SOLENOPSIS
RICHTERI AND S. INVICTA
By
Bettina A. Moser
December, 1995
Chairman: Dr. Richard S. Patterson
Major Department: Entomology and Nematology
Two dimorphic microsporidia, Thelohania sp. and Vairimorpha sp., occur
simultaneously in the black imported fire ant, Solenopsis richteri. in parts of Argentina and
are considered as biological control agents of S. invicta in the United States. On the light-
microscopic level, they are indistinguishable from T. solenopsae and V. invictae. described
from Brazilian £. invicta. Two questions arise: Are Vairimorpha sp. and Thelohania sp.
different phenotypes of the same species? Are Thelohania sp. and Vairimorpha sp.
conspecific with T. solenopsae and V. invictae. respectively?
Morphological analysis revealed that spore dimensions and ultrastructures of
Thelohania sp. and Vairimorpha sp. are comparable to those of T. solenopsae and V.
invictae. respectively. The application of FAME profiles for the identification of
microsporidia was assessed for the first time, using spores of Thelohania sp., Nosema
algerae. and Vairimorpha necatrix. Even though the three species had qualitatively and
quantitatively different FAME profiles, this method was unsuitable for characterization of
xiii


V SUMMARY AND DIRECTION OF FUTURE RESEARCH
Synopsis 93
APPENDIX 95
REFERENCES 112
BIOGRAPHICAL SKETCH 126
vii


116
Heraty, J.M., Wojcik, D.P., and Jouvenaz, D.P. 1993. Species of Qrasema parasitic on
the Solenopsis saevissima-complex in South America (Hymenoptera: Eucharitidae,
Formicidae). J. Hvm. Res. 2, 169-182.
Hillis, D.M., and Dixon, M.T. 1991. Ribosomal DNA: Molecular evolution and
phylogenetic inference. Quart. Rev. Biol. 66, 411-453.
Howard, L.O., and Fiske, W.F. 1911. The importation into the United States of the
parasites of the gypsy moth and the brown-tail moth. U.S. Dept. Agrie. Bur.
Entomol. Bull. 91.
Irby, W.S., Huang, Y.S., Kawanishi, C.Y. and Brooks, W.M. 1986. Immunoblot analysis
of exospore polypeptides from some entomophilic microsporidia. J. Protozool. 33,
14-20.
Ishihara, R., and Hayashi, Y. 1968. Some properties of ribosomes from the sporoplasm
of Nosema bombycis. J. Invert. Pathol. 11. 377-385.
Jabaji-Hare, S. 1988. Lipid and fatty acid profiles of some vesicular-arbuscular
mycorrhizal fungi: contribution to taxonomy. Mvcologia 80, 622-629.
Jahn, G.C., Hall, D.W. and Zam, S.G. 1986. A comparison of the life cycles of two
Amblvospora (Microspora: Amblyosporidae) in the mosquitoes Culex salinarius
Coquillett and Culex tarsalis CoquilletL J. Ha. Anti-Mosqu. Ass. 57, 24-27.
James, A.T. and Martin, A.J.P. 1952. Gas-liquid partition chromatography: The
separation and microestimation of volatile fatty acids from formic acid to dodecanoic
acid. Biochem. J. 50, 679-690.
Jarvis, B.D.W., Tighe, S.W. 1994. Rapid identification of Rhizobium species based on
cellular fatty acid analysis. Plant and Soil 161,31-41.
Jeffords, M.R., Maddox, J.V., McManus, M.L., Webb, R.E., and Wieber, A. 1989.
Evaluation of the overwintering success of two European microsporidia
inoculatively released into gypsy moth populations in Maryland. J. Invert. Pathol.
53,235-240.
Jouvenaz, D.P. 1983. Natural enemies of fire ants. Ha. Entomol. 66, 111-121.
Jouvenaz, D.P. 1986. Diseases of fire ants: Problems and opportunities. In Fire ants
and leaf-cutting ants. Biology and management, (Lofgren, C.S, and Vander Meer,
R.K. eds.), pp. 327-338. Westview Press, Boulder.
Jouvenaz, D.P, Allen, G.E., Banks, W.A., and Wojcik, D.P. 1977. A survey for
pathogens of fire ants, Solenopsis spp., in the Southeastern United States. Ha.
Entomol. 60,275-279.


56
PCR Of Microsporidian DNA
The 16S rRNA gene segment was amplified from the microsporidia genomic DNA
by PCR using primers designed from the 5 and 3 regions. The DNA sequences for the
forward and reverse primers were kindly provided by C. R Vossbrinck and M. D. Baker
(personal communication). Restriction sites were incorporated into the sequences at the
5 ends to allow subsequent cloning of the PCR product The forward primer 18f had a
different restriction site sequence incorporated at the 5 end depending on whether
Thelohania sp., T. solenopsae. and A. penaei or Vairimoipha sp. DNA was amplified. The
forward primer JM27/18f (5 -TTTGAATTCCACCAGGTTGATTCTGCC-3 ) was
designed to contain an EcoBl site (GAATTC). Another forward primer, RP6/18f
(5-AAGGTACCAGGTTGATTCTGCCTGACG-3) was designed to contain a Kpnl site
(GGTACC). JM27/18f was used for Thelohania sp., T. solenopsae. and A. penaei DNA
amplification. RP6/18f was used to amplify Vairimorpha sp. DNA. The reverse primer
1492r (5-TTTGGATCCGGTTACCTTGTTACGACTT-3) was the same for all
amplifications, and it was designed to contain a BamHl site (GGATCC). Primers 18f and
1492r can be used to amplify the 16S rRNA gene of most microsporidia. Primer 18f
(5-CACCAGGTTGATTCTGCC-3) is located on nucleotides 1-18, primer 1492r
(5-GGTTACCTTGTTACGACTT-3) on nucleotides 1117-1098 on the V. necatrix 16S
rDNA sequence. The sequence 5-CAGGTTGATTCTGCC-3 of the 18f primer
mismatches in two positions with a homologous sequence of primer 18e
(5-CTGGTTGATCCTGCCAGT-3) that can be used to amplify the 18S rRNA gene of
many eukaryotes (Sogin and Gunderson 1987; Hillis and Dixon 1991) and prokaryotes
(Elwoodetal. 1985). The sequence 5-GGTTACCTTGTTACGACTT-3of primer
1492r is 100% homologous to Escherichia coli 16S rDNA.
PCR amplification was optimized for each new DNA template by testing 1, 5, and
10 pL (10 pL had less than 10 ng of DNA; determined by gel electrophoresis) of the


25
2.14. Electron micrograph of Vairimorpha sp. meiospore. xl8,000
2.15. Electron micrograph of Vairimorpha sp. meiospore spore wall and polar
filament xl20,000 25
3.1. Gas chromatograms of FAME standards 42
3.2. FAME chromatograms of Thelohania sp. and V. necatrix 43
3.3. FAME chromatograms of N. algerae in two different insect hosts 44
3.4. Three major fatty acids of three species of microsporidia 45
4.1. PCR products of the 16S rRNA gene of four microsporidian species 68
4.2. Cloned pTZ 19R Construct 69
4.3. Restriction profiles of 16S rRNA gene PCR products of three microsporidian
species 70
4.4. Multiple sequence alignment of the rRNA gene sequences of 19 species of
microsporidia 72
4.5. Phylogenetic tree (3,511 steps) of the 19 species of microsporidia with
G. lamblia as the outgroup 84
4.6. Bootstrap analysis (100 replicates) of the phylogenetic tree 85
x


43
Thelohania sp.
C16:0 C18:1
C16:0 C18:2 V. necatrix
Retention Time (sec)
Figure 3.2. FAME chromatograms of Thelohania sp. and V. necatrix. Fatty acids
were saponified, methylated, solvent-extracted, base-washed and analyzed by a computer-
linked Hewlett-Packard 5890 gas-liquid chromatograph and a computer-linked Perkin
Elmer 8420 GC interfaced with a Finnigan Ion Trap Detector with INCOS data collection
software.


O Son of Spirit!
My first counsel is this: Possess a pure,
kindly and radiant heart, that thine may be a
sovereignty ancient, imperishable
and everlasting.
Bahullh
The Hidden Words


12
a Sorvall ultramicrotome. Thin-sections were stained with methanolic uranyl acetate
(50% methanol, 1% uranyl acetate) followed by lead citrate (Reynolds 1963). They were
and photographed at an accelerating voltage of 75 kV with a Hitachi H-600 electron
microscope.
Results
Ant Identification
Identification of the ants as either £. invicta or £. richteri was confirmed by their
respective cuticular hydrocarbon profiles (Figure 2.1). In S. invicta, hydrocarbons with 28
and 29 carbons in the backbone of the molecules predominate whereas in £. richteri
hydrocarbons with 24, 25, and 26 carbons in the backbone of the molecules predominate
(Nelson etal. 1980).
Light Microscopy
Spores of Thelohania sp. and Vairimorpha sp. are found only in pupae and adults,
not in the larval stages, of the ants. Workers, queens and males can be infected. The
microsporidia seem to parasitize fat body cells which hypertrophy into spore-filled cysts.
Dual infections with Thelohania sp. and Vairimorpha sp. in the same individual may occur.
Thelohania sp. and T. solenopsae cause the development of comparatively large cysts
while a Vairimorpha infection produces tiny cysts (Figure 2.2, Figure 2.3). The infection
may be very heavy 25 Thelohania sp. cysts and 14 Vairimorpha sp. cysts were counted
from one major £. richteri worker! The infection produced symptoms not readily
observed with a loss of coordination and slow movement of the diseased ants. Both
Thelohania sp. and Vairimorpha sp. were dimorphic with uninucleate meiospores in
groups of eight and binucleate free spores.


13
S. invicta
11 12 13 14 15 16
Retention Time (min)
Retention Time (min)
c
a
c
>
I

Figure 2.1. Gas chromatographic traces of £. invicta and £. richteri hydrocarbons.
Ant lipids were extracted with hexane. The total lipid extracts were passed through short
columns of silicic acid (3 cm long x 0.5 cm diameter) in Pasteur pipettes. The
hydrocarbons were eluted from the columns with hexane in the void volume. They were
analyzed with a 5890 series II Hewlett Packard gas chromatograph fitted with a fused
silica capillary column of DB-1. A flame ionization detector was used.


117
Jouvenaz, D.P., and Ellis, E.A. 1986. Vairimorpha invictae n.sp. (Microspora:
Microsporida), a parasite of the red imported fire ant, Solenopsis invicta Burn
(Hymenoptera: Formicidae). J. Protozool. 33,457-461.
Jouvenaz, D.P., and Hazard, E.I. 1978. New family, genus, and species of microsporidia
(Protozoa: Microsporida) from the tropical fire ant, Solenopsis geminata (Fabricius)
(Insecta: Formicidae). J. Protozool. 25, 24-29.
Jouvenaz, D.P, and Kimbrough, J.W. 1991. Myrmecomvces annellisae gen. nov sp.
nov. (Deuteromycotina: Hyphomycetes), an endoparasitic fungus of fire ants,
Solenopsis spp. (Hymenoptera: Formicidae). Mvcol. Res. 95, 1395-1401.
Jouvenaz, D.P. and Lofgren, C.S. 1984. Temperature-dependent spore dimorphism in
Burenella dimorpha (Microspora: Microsporida). J. Protozool. 31. 175-177.
Jouvenaz, D.P., and Wojcik, D.P. 1990. Parasitic nematode observed in the fire ant,
Solenopsis richteri. in Argentina. Fla- Entomol. 73, 674-675.
Kawakami, Y., Inoue, T., Kikuchi, M., Takayanagi, M., Sunairi, M., Ando, T., and
Ishihara, R. 1992. Primary and secondary structures of 5S ribosomal RNA of
Nosema bombycis (Nosematidae:, Microsporidia). J. Serie. Sci. Jpn. 61, 321-327.
Kerwin, J.L. 1994. Evolution of structure and function of fatty acids and their
metabolites. In Isopentenoids and Other Natural Products, Evolution and
Function (Nes, D.W., ed.), pp. 163-201. American Chemical Society, Washington,
DC.
Knell, J.D., and Allen, G.E. 1977. Light and electron microscope study of Thelohania
solenopsae n. sp. (Microsporida: Protozoa) in the red imported fire ant, Solenopsis
invicta. J. Invert. Pathol. 29, 192-200.
Knivett, V.A., and Cullen, J. 1965. Some factors affecting cyclopropane acid formation
in Escherichia coli. Biochem. J. 96.771-776.
Kock, J.L.F. 1988. Chemotaxonomy of yeasts. S. A. J. Sci. 84,735-740.
Kramer, J.P. 1965. Nosema necatrix. sp. n. and Thelohania diazoma sp. n.,
microsporidians from the armyworm Pseudaletia unipunctata (Haworth). J. Invert.
Pathol. 7, 117-121.
Kurtti, T.J., Ross, S.E., Liu, Y., and Munderloh, U.G. In vitro developmental biology and
spore production in Nosema fumacalis (Microspora: Nosematidae). J. Invert.
Pathol. 63, 188-196.


the remaining fire ant microsporidia because of (1) influence of host insect on FAME
profile and (2) requirement of large sample sizes (lxlO9 spores) for FAME analysis.
PCR products of the 16S rRNA gene of Thelohania sp. and T. solenopsae were
the same at ~ 1,400 bp as compared to that of Vairimorpha sp. at ~ 1,300 bp. V. invictae
could not be included in the genotypic analysis because of sample size limitations.
Restriction analysis of the PCR products with several enzymes differentiated Vairimorpha
sp. from Thelohania sp. and T. solenopsae which were not separable from each other.
Sequence analysis of the 16S rRNA gene of T. solenopsae. Thelohania sp., and
Vairimorpha sp. showed that the two Thelohania species have a very high sequence
similarity amongst each other (> 99%). Vairimorpha sp. has a 63% sequence similarity
with T. solenopsae and Thelohania sp.
In conclusion, the available phenotypic and genotypic data support the hypothesis
that Thelohania sp. and Vairimorpha sp. are not different phenotypes of the same species
but separate species. Thelohania sp. and T. solenopsae appear to be conspecific and
probably represent two subspecies. V. invictae and Vairimorpha sp. appear
indistinguishable morphologically but await genotypic analysis.
xiv


27
microsporidia may also vary significantly with host species (Brooks and Cranford 1972).
They found that spores of Nosema heliothidis are significantly shorter in Heliothis zea
larvae than in its hymenopterous parasite Campoletis sonorensis (Brooks and Cranford
1972). Spore dimensions of Vairimorpha sp. meiospores and free spores are almost
identical to the previously published dimensions of V. invictae (Jouvenaz and Ellis 1986).
Furthermore, meiospore and free spore ultrastructure of Thelohania sp. and Vairimorpha
sp. are very similar to those of T. solenopsae (Knell and Allen 1977) and
V. invictae (Jouvenaz and Ellis 1986), respectively.
Meiospore ultrastructures of Thelohania sp. and T. solenopsae are characterized
by a thin, undulating exospore, relatively thin endospore, lamellar polaroplast, and isofilar
polar filament. Meiospore ultrastructures of Vairimorpha sp. and V. invictae are
characterized by a very thick smooth spore wall with relatively thin exospore and very
thick endospore, lamellar polaroplast, and isofilar polar filament Differences were
observed, however, in number of coils and arrangement of the coils of the polar filament
The number of turns of the polar filament, arrangement of the coils and number of broad
and narrow coils of the meiospores may be used in distinguishing closely related species
(Hazard and 01dacrel975). For example, Andreadis (1994) was able to distinguish six
new species of the genus Amblvospora based upon distinct differences in the number of
turns of the polar filament, arrangement of the coils and number of broad and narrow coils
of the polar filament. Garcia and Becnel (1994) also utilized numerical ratio of broad and
narrow coils, and arrangement of these coils as useful taxonomic characters to describe
eight new species of microsporidia of the genera Amblvospora and Parathelohania from
Argentine mosquitoes.
It was very difficult to quantify polar filament arrangement and number of coils in
an adequate number of spores of Thelohania sp., T. solenopsae and Vairimorpha sp.
because sample preparation for TEM was very difficult (see below). Based on the
material available, Thelohania sp.meiospores showed both uniform and irregular


LIST OF ABBREVIATIONS
ASP
Ammonium persulfate
BSA
Bovine serum albumine
Clustal
Software program for multiple alignment of sequences
DNA
Deoxyribonucleic acid
EDTA
Ethylenediaminetetraacetate
FAME
Fatty acid methyl ester
GAP
Software program to make optimal alignment between two sequences by
inserting gaps to maximize the number of matches
GC
Gas chromatography
GCG
Genetics Computer Group
GC-MS
Gas chromatography- mass spectrometry
GTE
Glucose,Tris, EDTA buffer
LB
Luria-Bertani
MAP
Software program to display both strands of a DNA sequence with a
restriction map shown above the sequence
MIDI
Microbial ID Inc.
MIS
Microbial Identification System
PAUP
Phylogenetic analysis using parsimony
PCR
Polymerase chain reaction
PEG
Polyethyleneglycol
PUeUp
Software program for multiple alignment of sequences
pTZ 19R
Bacterial plasmid
RFLP
Restriction fragment length polymorphism
xi


124
Visvesvara, G.S., da Silva, A.J., Croppo, G.P., Pieniazek, N.J., Leitch, G J., Ferguson, D.,
de Moura, H., Wallace, S., Slemenda, S.B., Tyrrel, L, Moore, D.F., and Meador, J.
1995. In vitro culture and serological and molecular identification of Septata
intestinalis isolated from urine of a patient with AIDS. J. Gin. Microbiol. 33,
930-936.
Voet, D., and Voet, J.G. 1990. Biochemistry. John Wiley and Sons, New York.
Vossbrinck, C.R., Maddox, J.V., Friedman, S., Debrunner-Vossbrinck, B.A., and Woese,
C.R. 1987. Ribosomal RNA sequence suggests microsporidia are extremely ancient
eukaryotes. Nature 326. 411-414.
Vossbrinck, C.R., Baker, M.D., Didier, E.S., Debrunner-Vossbrinck, B.A., and Shadduck,
J.A. 1993. Ribosomal DNA sequences of Encephalitozoon hellem and
Encephalitozoon cuniculi: Species identification and phylogenetic construction.
J. Euk. Microbiol. 40, 354-362.
Weiss, L.M., Zhu, X., Cali, A., Tanowitz and Wittner, M. 1994. Utility of
microsporidian rRNA in diagnosis and phylogeny: A review. Folia Parasitol. 41,
81-90.
Welch, D.F. 1991. Applications of cellular fatty acid analysis. Clinic. Microbiol. Rev. 4,
422-438.
Williams, D.F. 1989. An improved artificial nest for laboratory rearing of the imported
fire ant Solenopsis invicta ('Hymenoptera: Formicidae). Fla. Entomol. 72. 705-707.
Williams, D.F., and Banks, W.A. 1987. Pseudacteon obtusus (Diptera: Phoridae)
attacking Solenopsis invicta (Hymenoptera: Formicidae) in Brazil. Psyche 94, 9-13.
Wilson, E.O. 1951. Variation and adaptation in the imported fire ant Evolution 5.
68-79.
Wilson, E.O., and Eads, J.H. 1949. A report on the imported fire ant, Solenopsis
saevissima var. richteri Forel in Alabama. Ala. Dept. Conserv. Spec. Rep.
Woese, C.R. 1987. Bacterial evolution. Microbiol. Rev. 51. 221-271.
Woese, C.R., and Fox, G.E. 1977. Phylogenetic structure of the prokaryotic domain:
The primary kingdoms. Proc. Natl. Acad. Sci. USA 74, 5088-5090.
Woese, C.R., Kandler, O., and Wheelis, M.L. 1990. Towards a natural system of
organisms: Proposal for the domains archaea, bacteria, and eucarya. Proc. Natl.
Acad. Sci- USA 87, 4576-4579.


58
Cloning of the 16S rRNA Gene
PCR products of Thelohania sp., Vairimorpha sp. and T. solenopsae were cloned
into the plasmid pTZ 19R vector (Pharmacia) by transforming E. coU JM109 cells using
the following protocol.
Pretreatment of PCR Product: The PCR products were digested with Proteinase
K (50 pg/mL) in 10 mM Tris-HCl, 5 mM EDTA, and 0.5% SDS to remove the Taq DNA
polymerase bound to the DNA (Crowe et al. 1991). The Proteinase K digestion was
carried out at 37C for 30 min and then treated at 80C for 10 min to heat inactivate the
enzyme. The Proteinase K treated PCR product was cleaned using the QIAquick PCR
Purification Kit (QLAGEN). To check the recovery rate, a 2 pL aliquot was fractionated
on a gel and the concentration estimated by comparing it with a known amount of
X/Hindlll cut DNA as described earlier.
Restriction Enzyme Digest: Thelohania sp. and T. solenopsae PCR products were
double digested with EcoRI and BamHI (New England Biolabs) to create sticky ends for
cloning. For the digest, 48 pL of amplified DNA (or 2-3 pg), 1 pL of each enzyme
(20 U/pL), and 5.5 pL of the appropriate lOx restriction buffer (manufacturers
instructions) were mixed and incubated at 37C for 4 h. Simultaneously, the plasmid
DNA, pTZ 19R (1 pg/10 pL) was double digested to create compatible sticky ends.
Vairimorpha sp. PCR products were digested sequentially with Kpnl and BamHI (New
England Biolabs) to create sticky ends using the appropriate buffers according to the
manufacturers instructions. For the restriction digest, 48 pL of amplified DNA, 1 pL of
Kpnl (15 U/pL), 0.5 pL bovine serum albumine (BSA), and 5 pL of lOx restriction buffer
were incubated at 37C for 2 h. The enzyme was heat-inactivated at 70C for 10 min,
followed by the addition of 1 pL of BamHI (20 U/pL), 5 pL of lOx restriction buffer and
incubation for another 2 h at 37C. Plasmid pTZ 19R DNA was digested with Kpnl and
BamHI at the same time to create compatible sticky ends. Digested PCR products were


48
that the fatty acid extraction process could be scaled down to accommodate for smaller
sample sizes.
More studies with additional microsporidian species from a variety of
environmental conditions (e.g. different animal host) are needed to determine fatty acids
characteristic for the microsporidia, and to assess qualitative and quantitative aspects of
FAME analysis as a discriminant tool in identification. Microsporidian culture conditions
should be standardized, and sample size requirements reduced. The compilation of
microsporidian FAME profiles will enable statistical comparisons, using the MIDI pattern
recognition software. By comparing profiles of well-characterized reference
microsporidia, the utility of FAME analysis as a taxonomic tool for the identification of
microsporidia could be evaluated.


52
The multiple copies of nuclear rRNA genes do not evolve independently but in
concert (Amheim 1983). In other words, each copy of an rRNA array is usually very
similar to the other copies within individuals and species, although differences among
species accumulate rapidly in parts of the array. The differences among arrays within
individuals are mostly length variation in the nontranscribed spacer. The low level of
heterogeneity at about 0.1% of the nucleotide positions (Mylvaganam and Dennis 1992)
among rDNA within individuals (and throughout species) indicates that the multiple copies
are homogenized (concerted evolution). The number of rDNA repeats, though, is known
to vary widely among individuals within species that have been studied (Hillis and Dixon
1991). Exceptions to concerted evolution have been reported. For example, in the
archaebacterium Haloarcula marismortui which has two nonadjacent rRNA operons, the
16S rRNA genes within the two operons differ in about 5% of the nucleotide sequence
(Mylvaganam and Dennis 1992). The number of rRNA genes varies from seven in E. coli.
to between 100 and 200 in lower eukaryotes, to several hundred in higher eukaryotes.
Estimates of copies of the 18S-28S gene for different organisms include, for example,
150-250 in Drosophila melanogaster. 200-280 in humans, 100-140 in Saccharomvces
cerevisiae. and 450 in Xenopus laevis (Lewin 1994; Gerbi 1985).
The mitochondrial rRNA genes develop much more rapidly than the nuclear rRNA
genes. The spacer regions of rDNA arrays have been used less frequently for phylogenetic
studies; variation in spacer regions has been used to identify species or strains, to study
hybridization, and as markers in population genetics studies (Hillis and Dixon 1991).
Microsporidia are peculiar eukaryotes that lack mitochondria, peroxisomes and a
'typical' Golgi apparatus (Canning 1988). They have ribosomes with prokaryotic
properties. Ishihara and Hayashi (1968) determined that ribosomes of Nosema bombycis
have a sedimentation coefficient of 70S like bacteria and blue-green algae and not of 80S
like the eukaryotes. The ribosomal subunits have sedimentation coefficients of 50S and
30S (typical of prokaryotes), and not of 40S and 60S (typical of eukaryotes). The small


47
Aoki 1990; Van der Westhuizen et al. 1994). FAME profiles of other types of organisms
may also be influenced by environmental, physiological, and developmental changes; for
example, diet and development strongly influence profiles of insects (Stanley-Samuelson et
al. 1988). In bacteria, stability of the FA composition is achieved through growth under
standardized conditions in vitro. FA stability is optimal in bacteria growing at the late log
or early stationary growth phase (Sasser 1990b). Nosema algerae had a qualitatively and
quantitatively distinct profile, depending on the host (Table 3.1, Figure 3.1). Host
influence on FAME profiles of microsporidia may render fatty acid analysis unsuitable as a
tool for microsporidian identification unless culture conditions for all microsporidia can be
standardized (in vitro culture in either cell-free media or in cell lines). In vitro culture of
certain microsporidian species has been accomplished (Kurtti et al. 1994, Undeen 1975).
Conversely, spores of several species of glomalean fungi yielded reproducible
FAME profiles despite being grown in association with different host plants and with
contaminating microorganisms present (Graham et al. 1995). Glomalean endomycorrhizal
fungi are similar to many microsporidia in that they cannot be cultured without their hosts;
each form obligate symbiotic relationships with the roots of many plant species.
Taxonomy of glomalean fungi is currently based on spore morphology. This is similar to
microsporidia where assessment of diversity using only morphological characters is
difficult because of inadequately defined characters, and ambiguous distinction between
morphologically similar species (Morton and Benny 1990; Morton 1993). Molecular and
biochemical characters are needed to supplement the morphological data.
Host influence on the FAME profile of microsporidia is one problem that needs to
be solved by standardizing culture conditions. Another problem is the requirement of a
large number of spores for fatty acid extraction. The large sample size of roughly lxlO9
spores for fatty acid extraction makes FAME analysis not practical for many microsporidia
because of m vivo and in vitro culture limitations. However, Welch (1991) pointed out


125
Wojcik, D., Jouvenaz, P., and Lofgren, C.S. 1987. First report of a parasitic fly (Dptera:
Phoridae) from a red imported fire ant (Solenopsis invicta) alate female
(Hymenoptera: Formicidae). Fla. Entomol. 70. 181-182.
Wood, B.J.B. 1988. Lipids of algae and protozoa, in Microbial lipids, vol. 1,
(Ratledge, G, and Wilkinson, S.G. eds.). Academic Press, London.
Yamakawa, T., and Ueta, N. 1964. Gas chromatographic studies of microbial
components. I. Carbohydrate and fatty acid constitution of Neisseria. Japan. J.
Exp. Med. 34, 361-374.
Zhu, X., Wittner, M., Tanowitz, H.B., Cali, A., and Weiss, L.M. 1993. Nucleotide
sequence of the small ribosomal RNA of Encephalitozoon cuniculi. Nucleic Acids
Res. 21. 1315.
Zhu, X., Wittner, M., Tanowitz, H.B., Cali, A., and Weiss, L.M. 1993. Nucleotide
sequence of the small subunit rDNA of Ameson michaelis. Nucleic Acids Res. 21,
3895.
Zhu, X., Wittner, M., Tanowitz, H.B., Kotler, D., Cali, A., and Weiss, L.M. 1993. Small
subunit rRNA sequence of Enterocvtozoon bieneusi and its potential diagnostic role
with use of the polymerase chain reaction. J. Infect. Pis. 168, 1570-1575.
Zuckerkandl, E., and Pauling, L. 1965. Molecules as documents of evolutionary history.
J. Theoret. Biol. 8, 357-366.


8
Montevideo. They speculated, based on their knowledge of S. invicta and its
microsporidian parasites, that the ant populations are regulated naturally by the
microsporidia. It is unclear whether T. solenopsae is one species or a complex of sibling
species of microsporidia (Jouvenaz 1986) since it has been detected in more than a dozen
described or undescribed Solenopsis spp. in South America (Jouvenaz 1983).
The dimorphic V. invictae has been reported from £. invicta collected in Brazil by
Jouvenaz and Ellis (1986). Vegetative stages are found in larvae and pupae, free spores in
pupae and adults, and octospores in adults. The genus Vairimorpha was created by Pilley
(1976) to include dimorphic species with disporous and octosporous sporogony in the
same individual.
The classification of T. solenopsae and V. invicta may have to be revised
(Jouvenaz and Ellis 1986). Knell and Allen (1977) placed T. solenopsae in the family
Thelohaniidae because it meets all the family criteria. It produces octospores and
sporoblasts by endogenous budding, and it secretes metabolic products retained by the
sporophorous vesicle. They placed it in the genus Thelohania because of its isofilar polar
filament. Two genera of Thelohaniidae at that time, Amblvospora and Parathelohania.
produce both octospores and free spores, but free spores arise from plasmodia (4-40
spores per plasmodium, multisporous sporogony) (Hazard and Oldacre 1975). The free
spores of T. solenopsae. however, arise from diplokaryotic sporonts (disporous
sporogony) which is characteristic of Vairimorpha. Jouvenaz and Hazard (1978) created
the family Burenellidae for species having two sporogonic sequences, one producing free
spores from disporous sporogony, and the other producing meiospores from octonucleate
sporonts. Species of Burenellidae also develop tubules within the sporophorous vesicle
during sporulation, they do not secrete granules as do those of the Thelohaniidae. The
genera Burenella. Vairimorpha. Evlachovaia. and Pilosporella are included in Burenellidae
(Sprague et al. 1992). It appears that T. solenopsae does not quite fit into the family
Thelohaniidae because it produces free spores from disporous sporonts and not from


36
1 mM EDTA). The suspension was strained through cotton and centrifuged in deionized
water. The pellet was incubated for 10 min at 40C in 10 |!g/mL proteinase K and 1/4 vol
of interfacial envelope disruption buffer (4% SDS, 25 mM EDTA, 50 mM Tris-HCl pH
7.5), followed by differential centrifugation on a Ludox gradient. All spore preparations
were further cleaned by centrifugation on a 100% Percoll gradient, and repeatedly washed
in deionized water, prior to fatty acid analysis.
Fatty acid extraction and analysis
Spore preparations used for fatty acid analysis were examined with a phase
contrast compound microscope prior to extraction to check for bacterial contaminants.
Approximately lxl09 spores in aqueous suspension were pipetted into a 13x100 mm glass
test tube and stored overnight at 4C to allow the spores to settle. Prior to extraction,
spore samples of N. algerae from the two insect hosts were rinsed with 0.1% SDS to
remove externally attached host lipids. Analysis of the SDS rinsate indicated that no fatty
acids, from 9-20 carbons in length, were present. The next day, the supernatant was
withdrawn carefully and esterification of fatty acids was accomplished using the method of
Miller (1982). Approximately lxlO9 spores were pipetted into a 13x100 mm culture tube
and stored overnight at 4C to allow the spores to settle. The next day, the supernatant
was withdrawn carefully and 1 mL of 15% NaOH in 50% methanol was added. The tube
was capped, and fatty acids were saponified at 100C for 30 min. Upon cooling, 2 mL of
6 N HC1 in 50% MeOH were added, the tube was recapped and heated at 80C for 10 min
to methylate the fatty acids. Fatty acid methyl esters (FAME) were solvent-extracted
from the aqueous phase with 1.25 mL of hexane:methyl-tert-butyl ether (1:1; v/v). The
organic phase was washed with 3 mL of 1.2% aqueous NaOH and transferred to a gas
chromatograph (GC) vial. To determine the number of microsporidia required for fatty
acid analysis, a range of different numbers of spores (3.3xl08-2.1xl09) was extracted.


108
16S rRNA gene sequence of T. solenopsae
1
GAATTCCACC
AGGTTGATTC
TGCCTGGTAT
GTGTGCTAGC
GTCAAGGATT
51
TAGCCATGCA
TGCTTACGAA
CCCACGTGGG
GAGTGGCGGA
TAGCTCAGTA
101
ATACAGTTAT
AACATAATCT
ACATAAATGG
ATAACCTTGT
CAAGATAAGG
151
CTAATACAGT
AAAGATGTTA
GAAGCATGAA
AGCGGAGCAT
CATTGTAGGA
201
TTGGTTTCTG
ACCTATCAGT
TAGTATGTTT
TGTAAGGGAG
AACATAGACT
251
ATGACGGGTA
ACGGGGGATG
CACGTCTGAT
ACCGGAGAGG
AAGCCTTAGA
301
AACCGCTTTC
ACGTCCAAGG
ATGGCAGCAG
GCGCGAAACT
TACCCAATTA
351
TTGTATTGAT
AGAGGTAGTT
ATGACGCATG
TTAAGATTTT
AAATTGAAAC
401
TTCATTAAAG
ATGGTTAAGC
GACTGGAGGG
CAAGTCTGGT
GCCAGCAGCC
451
GCGGTAATTC
CAGCTCCAGT
AGTGCATATA
CATGCTGTAG
TTAGAAAGTT
501
TGTAGCCAGT
TTATGGATTG
TTTTTGATAA
TAGTTATTCT
CCAAAAGAGC
551
TAATTTTAAC
TAATTCATAA
AAATAGAAGC
GGATGAAGGT
AATTGTATTC
601
ACCAGCAAGA
GGTAAAATTT
GATGACCTGG
TGAGGACATT
CCGAGGCGAA
651
AGCGATTGCC
TAGTACGTTT
TTGATGGTAA
AGAACGTAAG
CCGGAGGATC
701
AAAGATGATT
AGATACCGTT
GTAGTTCCGG
CCGTAAATTA
TGCCAACTTG
751
CATCTTGTTA
TTTATACAAG
GAGCATAGAG
AAATTAAGAG
TTTTTGGGCT
801
CTAGGGATAG
TAATCCGGCA
ACGGACAAAC
TTAAAGAAAT
TGGCGGAAGG
851
ACACCACAAG
GAGTGGATTA
TACGGCTTAA
TTTGACTCAA
CGCGGGAAAA
901
CTTACCAGGG
CCTATGTATA
AGAGAAAGTT
AACATTGTAT
GTATACTTGA
951
TTGTACTTTG
AGTGGTGCAT
GGCCGTTTTC
AACACGTGGG
GTGACTTGTC
1001
AGGTTTATTC
CGGTAACGTG
TGATGTGCAG
TATGCAACTA
ACTAATGTTG
1051
TGAGACTTCT
TGCGGTAAGC
TTGATGAAGA
GGCGCTATAA
CAGGTCAGTG
1101
ATGCCCTTAG
ATGTTCTGGG
CTGCACGTGT
AATACAGTGG
GTATTTCAAT
1151
ATTTAATAGA
AGTAAATTTA
CCCGAGACAG
GGATCATGCT
TTGTAAGAAG
1201
CTTGTGAACA
TGGAATTCCT
AGTAATCGCT
GCTCACTAAG
TAACGATGAA
1251
TAAGTCCCTG
TTCTTTGCAC
ACACCGCCCG
TCGCTATCTG
AGATGGATGA
1301
CTTTATAAAG
ATGCTGCTGT
GAAGAGGCAT
TTGTGTAAGG
TCAACTAGAT
1351
TAGATATAAG
TCGTAACAAG
GTAACCGGAT
CC


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
mijes M;
Janijbs Maruniak
Associate Professor of Entomology and
Nematology
This dissertation was submitted to the Graduate Faculty of the College of
Agriculture and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.
December, 1995 X-
Dean, College of Agriculture
Dean, Graduate School


89
make a final determination on whether T. solenopsae and Thelohania sp. are conspecific,
crucial data on the life cycles and host specificities of these microsporidia are still needed.
For example, can Thelohania sp. infect £. invicta and T. solenopsae infect £. richteri
(cross-infectivity), and can the infection cycle be completed successfully? As trivial a
question this may seem, so far it is not even possible to infect S. invicta with T. solenopsae
and S. richteri with Thelohania sp. under laboratory or field conditions (data not shown;
R.S. Patterson personal communication).
The following example illustrates why it is important to have data on cross-
infectivity under natural conditions with the two Thelohania species in support of the
sequence analysis data. Nosema bombycis and N. trichoplusiae have almost identical 16S
rDNA sequences (mean distance = 0.004). They belong to a group of indistinguishable
Nosema species infecting Lepidoptera (Nordin and Maddox 1974). However, even
though N. trichoplusiae and N. bombycis have very similar life cycles, ultrastructural
characteristics, and 16S rDNA sequences, J. Maddox (personal communication) proposes
to treat them as two different species because cross-infectivity (possible in the laboratory)
between their hosts has not been demonstrated under natural conditions.
When comparing closely related sequences, one must also be aware of possible
sources of variation which include (1) error rate of DNA polymerase during PCR and
sequencing reaction (Barnes 1994), (2) variation among the different copies of the 16S
rRNA gene, and (3) intraspecific variation (Li and Graur 1991). The error rate (or
number of mutations per base per cycle) of Taq DNA polymerase is about 25x1o-6
(Boehringer Mannheim Biochemica Bulletin No. 3 1995). The error frequency of
Primezyme DNA polymerase is less than 80x10"* (Biometra Catalog 1994). This fact is
not important when sequence differences are big, but it is more important when sequence
differences are very small. To compensate for fidelity problems of the DNA polymerases,
both strands were sequenced at least three times.


81
Sequence Data Analysis
For data analysis, about 70 bp were excluded at the 5 and 3 ends of the A. penaei
sequence because of sequence uncertainties. The multiple sequence alignment (Figure
4.4) shows moderately variable regions in the 5-end half and highly conserved stretches
(denoted with *) in the 3-end half of the sequence. The distance matrix shown in Table
4.2 presents the mean distances between taxa, providing a comparison of the relative
similarity between any two taxa. The ribosomal gene sequence of the protozoan
£}. lamblia (Sogin et al. 1991) was included as an outgroup. Mean distances and
branching patterns of the phylogenetic tree (Figure 4.5) clearly showed that Thelohania sp.
and T. solenopsae were very closely related (mean distance Thelohania sp./T. solenopsae
= 0.008). A mean distance of 0.008 means 0.8 % sequence difference or 99.2 % sequence
similarity. They were not closely related to any of the other microsporidia including the
hymenopteran microsporidia N. apis and N. vespula (mean distance Thelohania sp./N. apis
= 0.370, T. solenopsae/ N.apis = 0.376, Thelohania sp./N. vespula = 0.374, T. solenopsae
/N. vespula = 0.378). They were also quite different from Vairimorpha sp. which can
occur in dual infections together with Thelohania sp. in S. richteri (mean distance
Thelohania sp./Vairimorpha sp. = 0.368, T. solenopsae/ Vairimoipha sp. = 0.367).The
sequence of A- penaei. which was chosen as a close representative of the type species of
the genus Thelohania. has a mean distance of 0.378 to Thelohania sp. and 0.366 to
T. solenopsae. Vairimorpha sp. also was not closely related to any of the other
microsporidia including V. necatrix. the type species of the genus Vairimorpha (mean
distance Vairimorpha sp./V. necatrix = 0.366).
Based on the branching pattern of the phylogenetic tree (Figure 4.5),
Vairimorpha sp. diverged first from the common ancestor, followed by the two Thelohania
species which diverged after Vairimorpha sp. but before the other microsporidia included
in the analysis. The phylogenetic tree also showed that Vairimorpha. sp. did not group


69
BamHI
AACAGCTATGACCATG G 1GATCC PCR
T TGTCGATACTGGTAC CCTAG |G PRODUCT
AACAGCTATGACCATG **
REVERSE
SEQUENCING PRIMER
UNIVERSAL
SEQUENCING PRIMER
TGACCGGCAGCAAAATG
AATTCACTGGCCGTCGTT TTAC
CTTAAl GTGACCGGCAGCAAAATG
EcoRI
Figure 4.2. Cloned pTZ 19R Construct. The cloning procedure is described in
detail in the Methods section and in the appendix.
of approximately 700 and 650 bp), three restriction sites for Hhal (fragments of
approximately 470, 300, 280, and 250 bp) and four restriction sites for HaeIII (fragments
of about 460, 350, 300, and 170, and 30 bp).
Of the other enzymes tested (results not shown), the double digest with Hincll and
HindlU separated Vairimorpha from the two Thelohania species which in turn had
identical profiles. Acil cut the species tested into many small fragments resulting in
smears. Analysis of the completed sequences with MAP revealed that the Thelohania
species each had nine restriction sites for Acil. Vairimorpha sp. had twelve restriction
sites for Acil. The MAP analysis also showed that it did not have Hincll restriction sites
as opposed to the Thelohania species.


106
1.
2.
3.
4.
5.
Purify PCR product with Qiagen PCR purification column; elute DNA with sterile,
distilled water
Label four 0.5 mL microfuge tubes (G,A,T,C) for each set of sequencing reactions.
Add 2 (J.L of the appropriate d/ddNTP mix to each tube.
For the sequencing reaction pipette:
template:
primer:
[a-35S]dATP:
500 fmol
4pmol
6 (J.Q (~1 (iL)
5x sequencing buffer
(250 mM Tris-HCl, pH 9.0, 10 mM MgCl2)
Taq DNA polymerase
sdH2Q
5 pL
1 pL (5U/pL)
to a total reaction
volume of 16 pL.
Aliquot 4 pL of template/primer/polymerase mix into each of the d/ddNTP mix
tubes.
Place tubes in PCR machine preheated to 95C and cycle 30 times through following
temperature profile:
2 min
30 sec
30 sec
1 min
95C
95C
42C
70C
6. Stop reaction by adding 3 pL of fmol Sequencing Stop Solution to each tube.
Polyacrylamide sequencing gel
1. For a 21 cm x 42 cm, 8% acrylamide sequencing gel, mix 33.6 g urea, 7.0 mL of lOx
TBE (0.9 M Tris-borate, pH 8.3, 0.02 M EDTA, pH 8.0), 10.5 mL of 40% 19:1
acrylamide:bis-acrylamide, and diH20 up to 70 mL. Dissolve the reagents on a
heating/stirring plate at low heat
2. While the reagents are dissolving, clean the glass plates of the sequencing unit (BIO
RAD Sequi-Gen very well with a paste of detergent. Rinse glass plates in diH20
and 70% EtOH. Dry them well, assemble sequencing gel unit and place into a
casting tray. (Periodically, apply a few drops of Rainex to the plate with the buffer
tank to prevent the gel from sticking to it).
3. Vacuum-filtrate the sequencing gel solution through a Whatman #3 filter paper and
degas it.
4. To pour the base, measure 30 mL of the gel solution, add 375 pL of 10% ammonium
persulfate (APS) and 80 pL of 100% N, N, N\ N tetramethylethylenediamine
(TEMED), mix and pour rapidly. The gel will polymerize in about 1 min.
5. To pour the gel between the plates, use the remaining gel solution (40 mL), add 280
pL of APS and 10 pL of TEMED, mix well and pipette between the two glass
plates. Be careful not to get any bubbles.
6. Clamp a sharkstooth comb in inverted position (Teeth pointing away from the gel)
between the glass plates and let gel polymerize (about 1 h).


37
Although fewer numbers of spores could be extracted and derivatized, a sample size of
lxlO9 spores is recommended to provide sufficient area count
Fatty acid methyl ester extracts were analyzed by the Microbial ID System (MIDI)
(Sasser 1990b), which consists of a computer-linked Hewlett Packard 5890 gas-liquid
chromatograph fitted with an Ultra 2 fused silica capillary column (25 m x 0.2 mm i.d. x
0.33 pm film thickness; crosslinked 5% phenyl methyl silicone). Following a 1/100 split
injection of 2 pL at 250C, the oven temperature was increased 5C/min from 170C to a
final temperature of 270C; hydrogen was used as the carrier gas. After flame-ionization,
FAME peaks were quantified by a Hewlett Packard 3392 integrator and expressed as
percentages of the total FAME profiles. Data were stored in the MIDI computer for
subsequent comparison and statistical analyses. Prior to and between every ten-sample
analyses, a calibration standard mixture consisting of the 12 straight-chain carbon acids
from C9 to C20, plus five hydroxy acids, was injected. The resulting retention time and
quantitative data served as quality control indicators to ensure good column performance
and peak matching by the MIDI system. Periodically, Stenotrophomonas maltophilia. a
bacterium whose FAME profile is well characterized, was used as a positive control to
ensure reproducibility among different extraction batches.
Representative samples were further characterized by coupled GC-mass
spectrometry (GC-MS). Aliquots of the microsporidian FAME mixtures and two FAME
standards (MIDI Calibration Standard Mix from 9-20 C; Applied Science Division
Standard with saturated and unsaturated Cl8) were analyzed by a Perkin Elmer 8420 GC
interfaced with a Finnigan Ion Trap Detector (ITD, Model 6210), with INCOS data
collection software and a 80286 computer. The GC-MS was fitted with a 25 m x 0.25
mm i.d. DB-1 fused silica capillary column. The injection of 1 jiL was in a splitless mode,
followed with a purge flow of helium after 30 sec. The carrier gas was helium with a flow
rate of 25 cm/sec (Nation et al. 1992). The initial temperature of the column was 60C;


59
purified using the QIAquick PCR Purification Kit as described earlier and eluted in 50 pL
sterile, distilled water.
The plasmid DNA was purified from SeaPlaque agarose. The digested plasmid
DNA was loaded onto a 0.8% SeaPlaque agarose gel and electrophoresed to separate the
3 kb plasmid fragment from the 1.3 kb insert. The fragment was cut out, melted at 68C
for 30 min and diluted with agarose diluent (200 mM NaCl, 20 mM Tris-HCl, pH 8.0,
2 mM EDTA) to at least 0.3% agarose concentration (Maruniak et al. 1984). The DNA
was then phenol and ether extracted (3x each) and ethanol precipitated (1/2 vol of 7.5 M
ammonium acetate and 2 vol of 100% EtOH, incubation on ice for 10 min, centrifugation
at 10,000 g for 10 min, wash with 70% EtOH, vacuum dry). The resulting pellet was
dissolved in 20 pL of distilled water.
Ligation: A 1:3 ratio in moles of vector:PCR product DNA was used (Bethesda
Research Laboratories 1979). Specifically, 200 ng of pTZ 19R DNA and 250 ng of PCR
product DNA were ligated to each other in a 40 pL reaction with 1 pL T4 DNA ligase
(1 U/pL) and 4 pL lOx reaction buffer (New England Biolabs) at room temperature
overnight in the dark (modified from manufacturers protocol).
Transformation of E. coli JM109 Competent Cells: To inactivate the T4 DNA
ligase and enhance transformation, the ligation mix was heat-treated at 65C for 10 min.
A 50 pL aliquot of E. coli JM109 competent cells was thawed on ice, and 1 or 5 pL
aliquots of ligated DNA were gently mixed with the cells. The cells were sequentially
incubated on ice for 30 min, heat shocked at 37C for 30 sec, and cooled on ice for 2 min.
Then, 0.95 mL of room-temperature superoptimal catabolite (S.O.C.; BRL personal
communication) media was added, and the cells were grown at 37C and 225 rpm for 1 h.
A 100 pL aliquot was plated on Luria-Bertani (LB) agar media supplemented with 5-
Bromo-4-chloro-3-indolyl-|3-D-galactoside (X-Gal; 20 pg/mL) and ampicillin
(100 pg/mL) and incubated for 16 h at 37C. Ampicillin-resistant clear colonies were


LIST OF FIGURES
Figure page
2.1. Gas chromatograph traces of £. invicta and S. richteri hydrocarbons 13
2.2. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. and Thelohania sp. xl8 15
2.3. Light micrograph of dissected S. richteri gaster with spore cysts of
Vairimorpha sp. and Thelohania sp. x46 15
2.4. Light micrograph of Thelohania sp. partial cyst with meiospores and free
spores. x750 17
2.5. Light micrograph of Vairimorpha sp. cyst with free spores and meiospores.
x210 19
2.6. Light micrograph of Vairimorpha sp. cyst with free spores and meiospores.
x750 19
2.7. Light micrograph of meiospore octets of Thelohania sp. and Vairimorpha sp.
x750 20
2.8. Light micrograph of Thelohania sp. and Vairimorpha sp. free spores and
meiospores. x750 20
2.9. Electron micrograph of Thelohania sp. meiospore. x37,500 22
2.10. Electron micrograph of Thelohania sp. spore wall and polar filament
xl50,000 22
2.11. Electron micrograph of T. solenopsae meiospore. x37,500 22
2.12. Electron micrograph of T. solenopsae spore wall and polar filament
xl50,000 22
2.13. Electron micrograph of Thelohania sp. free spore. x30,000 23
IX


Figure 2.14. Electron micrograph of Vairimorpha sp. meiospore. xl8,000.
Figure 2.15. Electron micrograph of Vairimorpha sp. meiospore spore wall and polar
filament, x 120,000. Endospore (EN), exospore (EX), polar filament (PF).


33
phases enables increased resolution of fatty acids. Hydroxy acids and most structural
isomers appear as sharp, symmetrical, well resolved peaks when fused silica capillary
columns are used (Moss et al. 1980).
Other developments include the modification of a fatty acid extraction method to
obviate the use of hazardous diethylether (Moss et al. 1974; Moss 1981). An
esterification protocol was modified to improve total fatty acid recovery as well as reduce
hydroxy acid tailing and cyclopropane acid degradation (Miller 1982). Finally,
computerized data reduction programs facilitate rapid analysis of large data sets (Aston
1977; Eerola 1988; Sasser 1990a).
A commercial, microbial identification system based on FAME profile analysis, the
Microbial ID Inc. (MIDI) automated Microbial Identification System (MIS), has been
developed (Sasser 1990a). MIDI has created data bases of FAME profiles for
identification of aerobic and anaerobic bacteria, including actinomycetes, yeasts and other
fungi (Sasser 1990b; 1990c). Stead et al. (1992) assessed the MIDI system by comparing
FAME profiles of 773 strains of plant pathogenic bacteria representing 25 taxa and related
saprophytic bacteria. They found that the confidence of correct identification is very high
at the genus and species levels, but lower at the subspecies and pathovar levels. Jarvis and
Tighe (1994) found that the MIDI system correctly identifies recognized species of
Rhizobium with high accuracy.
This study assessed for the first time the application of FAME profiles for the
identification of microsporidia, represented by three species of three genera. Due to
sample size limitations, only Thelohania sp. of the fire ant microsporidia could be included;
inadequate spore material was available of Vairimorpha sp. and T. solenopsae.


114
Buren, W.F., Allen, G.E., and Williams, R.N. 1978. Approaches toward possible pest
management of the imported fire ants. Bull. Entomol. Soc. Am. 24, 418-421.
Canning, E.U. 1988. Nuclear division and chromosome cycle in microsporidia.
BioSvstems 21, 333-340.
Carlson, D.A., and Bolten, A.B. 1984. Identification of Africanized and European honey
bees, using extracted hydrocarbons. Bull. Entomol. Soc. Am. 30, 32-35.
Carlson, D.A., and Brenner, RJ. 1988. Hydrocarbon-based discrimination of three North
American Blattella cockroach species (Orthoptera: Blattellidae) using gas
chromatography. Ann. Entomol. Soc. Am. 81, 711-723.
Creighton, W.S. 1930. The New World species of the genus Solenopsis (Hymenoptera:
Formicidae). Proc. Am. Acad. Arts Sci. 66, 39-151.
Crowe, J.S., Cooper, HJ, Smith, M.A., Sims, M.J., Parker, D., and Gewert, D. 1991.
Improved cloning efficiency of polymerase chain reaction (PCR) products after
proteinase K digestion. Nucleid Acid Research 19, 184.
Curgy, J.J., Vavra, J., and Vivares, C. 1980. Presence of ribosomal RNAs with
prokaryotic properties in microsporidia, eukaryotic organisms. Biol. Cellulaire 38,
49-52.
Decallonne, J., Delmee, M., Wauthoz, P., El Lioui, M., and Lambert, R. 1991. A rapid
procedure for the identification of lactic acid bacteria based on the gas
chromatographic analysis of the cellular fatty acids. J. Food Protection 54, 217-224.
Dees, S.B., and Moss, C.W. 1975. Cellular fatty acids of Alcali genes and Pseudomonas
species isolated from clinical specimens. J. Clin. Microbiol. 1, 414-419.
Devereux, J., Haeberli, P., and Marquess, P. 1987. Genetics Computer Group Sequence
Analysis Software Package, version 5. University of Wisconsin, Madison, WI.
Didier, P.J., Didier, E.S., Orenstein, J.M. and Shadduck, J.A. 1991. Fine structure of a
new human microsporidian, Encephalitozoon hellem. in culture. J. Protozool. 38,
502-507.
Eerola, E., and Lehtonen, O. 1988. Optimal data processing procedure for automatic
bacterial identification by gas-liquid chromatography of cellular fatty acids. J. Clin.
Microbiol. 26, 1745-1753.
Elwood, H.J., Olsen, G.J., and Sogin, M.L. 1985. The small subunit ribosomal RNA
gene sequences from the hypotrichous ciliates Oxytricha nova and Stylonvchia
pustulata. Mol. Biol. Evol. 2, 399-410.


101
2 Load aliquot on gel to check recovery rate.
3. Add equal amount (= 50 pL) of 20 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% SDS
to column-purified PCR product.
4. Add proteinase K (stock of 5 mg/mL) to final concentration of 5 pg/100 pL.
Incubate at 37C for 30 min.
5. Clean on Qiagen column, load aliquot to check recovery rate.
6. Double-digest with the appropriate restriction enzymes (New England Biolabs) to
create overhanging ends.
48.0 pL DNA in TE, pH 8.0
1.0 pL of each restriction enzyme
5.5 pL of lOx restriction buffer (New England Biolabs)
Incubate at 37C for 4 h.
For restriction enzyme digest of PCR products use BamWl (20 U/yL) and Kpnl (15
U/yL) to digest Vairimorpha PCR products (sequential digest because of different
buffer -low salt followed by high salt- requirements), use BamHl (20 U/yL) and
EcoRI (20 U/yL) to digest Thelohania PCR products (double digest).
Note: Double-digest the plasmid DNA (pTZ 19R) at the same time and purify (can
use Qiagen column or SeaPlaque agarose purification).
7. Clean double-digested DNA on Qiagen column and load aliquot on gel to check
recovery and digestion.
8. Controls to see if digestion worked:
Electrophorese 1.0 yL aliquot of 100 ng/yL uncut plasmid
Electrophorese 2.0 yL aliquots of plasmid digested with either enzyme. Include 1 kb
bacteriophage lambda (A.) DNA ladder (BRL Life Technologies. Inc.).
9. Ligation of PCR product to plasmid DNA:
17.0 yL DNA suspension
2.0 yL lOx ligation buffer
1.0 yL T4 ligase (400 U/yL) (New England Biolabs)
Note: Use a 1:3 mole ratio of vector (pTZ 19R) to PCR product in ligation mix.
For example: If using 200 ng DNA of a 2.9 kb plasmid, how much PCR product
(1.2 kb) DNA should be used? 200 ng plasmid DNA/2.9 kb = ? ng PCR product
DNA/1.2 kb x 3
Ligate at room temperature for 4 h in the dark; then store at 4C.
Control: Ligate digested PCR product DNA to each other (not into plasmid). Run
gel; expect to see ladder of bands if digestion and ligation worked well; will see only
primer-dimers if digestion and/or ligation didn't work.
10. Transformation of E. coli JM109 competent cells (have the F episome which allows
them to be infected by M13 to produce single-stranded DNA):
Heat the ligation mix at 65C for 10 min to inactivate enzyme and enhance
transformation
Put ice bucket with ice into the hood.
Remove 50 yl aliquots of competent cells from -70C freezer, thaw on ice.
Add 1 and 5 yl of DNA ligation reaction directly to the cells, moving the pipette
through cells while dispensing.
Incubate cells on ice for 30 min.


16
Thelohania sp. was apparently confined to fat body tissue of ant gasters. Both
uninucleate meiospores and binucleate free spores developed simultaneously in the same
cysts. Octets of meiospores were enclosed into a persistent sporophorous vesicle
(henceforth referred to as an interfacial envelope). Free spores were not enclosed in a
membrane (Figure 2.4). Octospores are pyriform in shape and measure 2.32 0.14 x 4.10
0.31 |im (n=33). Free spores are elongate oval in shape and measure 2.83 0.30 x 5.71
0.55 |im (n=21). Free spores were exceedingly rare (usually less than 1%).
Vairimorpha sp. spores were observed from tissues within the head, thorax and
gaster of S. richteri. In the gaster, fat body tissue was parasitized; the nature of the tissue
in the thorax and head was unclear. Only mature free spores were found in pupae; both
spore types occurred in the same cysts in adults (Figure 2.5). Similar to Thelohania sp.,
octets of meiospores were enclosed in interfacial envelopes, but the free spores were not
enclosed in a membrane (Figure 2.6). Vairimorpha sp. spores are much larger than those
of Thelohania sp. Octospores were ovoid and very slightly narrower at the anterior pole
and measure 4.31 0.25 x 6.45 0.61 |im (n=33). Free spores were elongate bacilliform
and measure 3.11 0.19 x 10.76 0.48 Jim (n=34). Figure 2.7 shows Vairimorpha sp.
and Thelohania sp. meiospores, Figure 2.8 all four spore types in the same field of view.
Transmission Electron Microscopy
Thelohania sp. meiospores were pyriform in sagittal section with the posterior end
more broadly rounded than the anterior end. They were uninucleate with a lamellar
polaroplast anteriorly and vacuole posteriorly. Polyribosomes border the nucleus. The
polar filament was isofilar with 10-12 coils. The coils were arranged either uniform or
irregular. The spore wall, composed of exospore and endospore, was relatively thin and
undulating (Figures 2.9, 2.10). The polar filament consisted of several layers with


CHAPTER I
TAXONOMIC PROBLEMS OF FIRE ANT MICROSPORIDIA
Synopsis
The red imported fire ant, Solenopsis invicta, is a major agricultural and urban pest
in the southeastern United States (Stimac and Alves 1994; Patterson 1990; Adams 1986).
Despite extensive primarily chemical control efforts, it is firmly established in the
r
southeastern United States (Stimac and Alves 1994). Nest density of red imported fire
ants is much higher in the United States than in its native South America, and S. invicta
constitutes a much larger fraction of the ant community in the US than in South America
(Porter et al. 1992). The very successful colonization of the southeastern US by £. invicta
may be in part attributed to the fact that it faces virtually no natural biological control in
the US (Burn et al. 1978, 1983). Natural enemies of fire ants are extremely rare in the
US but abundant in South America (Jouvenaz 1983; Stimac and Alves 1994).
In an effort to find a good biological control agent for £. invicta in the US, several
surveys for natural enemies have been conducted in South America (summarized by
Jouvenaz 1983; Stimac and Alves 1994). The microsporidium Thelohania solenopsae is
the first specific pathogen described from the red imported fire ant, S. invicta in Brazil
(Allen and Burn 1974). Subsequently, another microsporidium, Vairimorpha invictae.
was detected in S. invicta in Brazil (Jouvenaz and Ellis 1986). Briano (1993) reported a
high incidence of infection of the black imported fire ant richteri from Argentina with
T. solenopsae-like and V. invictae-like microsporidia, hereforth called Thelohania sp. and
Vairimorpha sp. Thelohania sp. and Vairimorpha sp. may occur in dual infections in the
1


70
Sau3A
MW 1 2 3
Hhal
1 2 3
//adll
1 2 3 MW
1018
517/506
396
344
298
220
201
154
134
600
100
1: Thelohania sp. 2: T. solenopsae 3: Vairimorpha sp.
Figure 4.3. Restriction profiles of 16S rRNA gene PCR products of three
microsporidian species. Photograph of restricted PCR products following gel
electrophoresis. About 700 ng of crude PCR product of each species was digested for 2 h
at 37C with either Sau3A, Hhal, or HaelII in a 20 |iL reaction volume. The samples
were electrophoresed with 2 (J.L of lOx loading dye (50% glycerol, 50 mM EDTA, 0.5%
bromphenol blue) on a 3% NuSieve GTG/1% Seakem LE agarose gel in Tris-acetate
buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.0). Two standards, X/HindlU cut DNA
(200 ng) and a 1 kb DNA marker (200 ng), were included as molecular weight markers.
1 = Thelohania sp., 2 = T. solenopsae. 3 = Vairimorpha sp.


97
8. Centrifuge at 16,320 g for 30 min in swinging-bucket head rotor.
9. Draw off the bands with Pasteur pipette, examine samples under microscope to
confirm identity of purified organisms.
10. Wash spores twice in deionized H2O to remove Ludox. Store in deionized H2O at
4C.
Purification of N, algerae from H. zea
1. Establish continuous density gradient with Ludox (a colloid of 40% silica in NaOH
solution, pH 9.8 and specific gravity p of 1.303) using gradient mixer.
2. Rinse adult infected moths in water, clip off wings, and triturate in Tekmar
Tissumizer in deionized water.
3. Strain through cotton plug in glass syringe to remove large body parts.
4. Follow steps 5-10 of V. necatrix purification protocol.
Purification of N. algerae from A. quadrimaculatus
1. Establish continuous density gradient with Ludox (a colloid of 40% silica in NaOH
solution, pH 9.8 and specific gravity p of 1.303) using gradient mixer.
2. Immobilize adult infected mosquitoes by chilling them at -20C for about 3 min.
Aspirate them with an aspirator connected to a vacuum pump.
3. Homogenize the mosquitoes with a small amount of deionized water in a Waring
blender.
4. Strain resulting suspension through cotton plug in glass syringe to remove large body
parts.
5. Follow steps 5-10 of V. necatrix purification protocol.
Purification of Thelohania sp. from S. richteri
1. Establish continuous density gradient with Ludox (a colloid of 40% silica in NaOH
solution, pH 9.8 and specific gravity p of 1.303) using gradient mixer.
2. Homogenize infected ants with Tekmar Tissumizer in ant homogenizing buffer (0.1 %
SDS, 10 mM Tris-HCl, pH 7.5, 1 mM EDTA).
3. Strain through cotton plug to remove large body parts.
4. Centrifuge at 4,080 g in swinging-bucket head rotor (Sorvall S 34 centrifuge) for 15
min.
5. Discard supernatant and wash pellet once in deionized H2O.
6. Incubate pellet in 10 pg/mL proteinase K and 1/4 volume of pansporoblastic
membrane disruption buffer (4% SDS, 25 mM EDTA, 50 mM Tris-HCl, pH 7.5) for
10 min at 40C.
7. Follow steps 7-10 of V. necatrix purification protocol.


50
Each of the primary kingdoms has its particular form of rRNA. Strong 16S rRNA
sequence signatures, i.e. positions in the molecule that have a highly conserved or
invariant composition in one kingdom, but a different (highly conserved) composition in
one or both of the others, define and distinguish the three urkingdoms (Woese 1987).
Analysis of the sequence of the small subunit rRNA gene of E. coli revealed that
'universally conserved' elements (short sequences that appear to be conserved in all
organisms) are distributed along the entire length of the E. coli 16S rDNA. Similar
sequence analyses of small subunit RNA genes from a diverse group of organisms
confirmed this observation and identified the existence of 'kingdom-specific' conserved
elements (sequences that are conserved only in the eubacteria, archaebacteria, or
eukaryotes, respectively) (Sogin and Gunderson 1987). There is a clear tendency for
universally conserved nucleotides to fall in unpaired regions of the rDNA. (Gutell et al.
1985).
Increasingly, systematics of organisms is based on sequences, structures, and
relationships of molecules, with phenotypic and biochemical properties being used to
support these findings (Sogin and Gunderson 1987; Woese et al. 1990). For largely
historical and practical reasons, most systematic research has focused on a small subset of
genes, especially nuclear rRNA and mitochondrial rRNA and protein-encoding genes.
RNA sequencing was feasible before DNA sequencing. Mitochondrial DNA occurs in
multiple copies in the cell and is relatively easy to manipulate (Brower and de Salle 1994).
Apart from historical and practical considerations, ribosomal genes are particularly well
suited for defining evolutionary and systematic relationships because they are universally
distributed and functionally homologous in all known organisms ( Olsen et al. 1986; Hillis
and Dixon 1991). Generally, there are three rRNAs in prokaryotes and four nuclear
rRNAs in eukaryotes. The RNAs of bacteria are 5S (~ 120 nucleotides), 16S (~ 1500
nucleotides), and 23S (~ 2900 nucleotides). The nuclear RNAs of eukaryotes are 5S,
5.8S (~ 160 nucleotides), 18S (~ 1800 nucleotides), and 28S (> 4000 nucleotides) (Hillis


2
same individual ant. The infections appear to weaken the ant colonies and reduce total
numbers of ants significantly (Briano 1993; R.S. Patterson, personal communication).
Solenopsis richteri and £. invicta were considered to be different color morphs of
one species, S. saevissima richteri Forel (Wilson 1951) until Burn (1972) described
S. invicta and S. richteri as separate species. Solenopsis invicta interbreeds successfully
with £. richteri in areas of the US where their ranges overlap, and taxonomy of the two
ant species is still not resolved (Vander Meer and Lofgren 1986). The microsporidia
found in the Argentinean S. richteri could be introduced into the US as biological control
agents after several taxonomic and ecological studies are completed.
The research presented here will address the following taxonomic questions: Are
Thelohania sp. and Vairimorpha sp. two different phenotypes of the same species or are
they indeed different species? Are T. solenopsae and Thelohania sp. and V. invicta and
Vairimorpha sp., respectively, conspecific or are they separate species?
Traditionally, microsporidian taxonomy and classification has been based on spore
morphology, life cycles and host specificities. Characterization based solely upon simple
morphology can result in misleading classification, because spores of different
microsporidian species may appear to be phenotypically identical. For example, two
species of microsporidia, Encephalitozoon hellem and E. cuniculi. isolated from AIDS
patients, can be differentiated using biochemical and immunological tests, but not by fine
structure or development (Didier et al. 1991). Furthermore, one species may have several
different spore phenotypes, depending on host and life stage. Microsporidia requiring an
intermediate host express distinct spore phenotypes in the intermediate and definite hosts
(Andreadis 1985; Becnel 1992; Sweeney et al. 1985), whereas those which develop in
only one host may also be heterosporous (Becnel et al. 1989). Environmental factors,
such as temperature, can affect the expression of different spore phenotypes (Jouvenaz
and Lofgren 1984). Incomplete understanding of the often complex life cycles involving


Go to the ant, thou sluggard; consider her way and be wise:
Which having no guide, overseer, or ruler,
Provideth her meat in the summer,
And gathereth her food in the harvest.
The Holy Bible
Proverbs 6,6


LIST OF TABLES
Table page
3.1. Fatty acids (%) in three microsporidian species from one aquatic and
two terrestrial insect hosts 40
4.1. List of sequencing primers used 63
4.2. Pairwise distances between taxa 83
viii


53
and large ribosomal subunits in turn, as determined for Thelohania maenadis and
Inodosporus sp., contain 16S and 23S RNA like prokaryotes and not 18S and 28S RNA
like eukaryotes (Curgy et al. 1980).
Furthermore, as shown by Vossbrinck and Woese (1986), the microsporidium
Vairimorpha necatrix does not have a 5.8S rRNA. The 5.8S rRNA is a nearly universal
eukaryotic characteristic. It has no size counterpart among prokaryotes although its
sequence is homologous with the first 150 or so 5 nucleotides of the prokaryotic 23S
rRNA. As in prokaryotes, V. necatrix has a large subunit rRNA (23S) whose 5 region
corresponds to the 5.8S rRNA. Because of the unusual molecular and cytological
characteristics of microsporidia, Vossbrinck et al. (1987) sequenced the 16S rRNA of V.
necatrix to clarify the phylogenetic position of microsporidia. The V. necatrix 16S rRNA
sequence is far shorter than a typical eukaryotic (18 S) small subunit rRNA and, at only
1,244 nucleotides, even appreciably shorter than its prokaryotic (16S) counterpart (E. coli
small subunit rRNA is about 1,500 nucleotides long). They found little overall homology
between V. necatrix 16S rRNA sequence and those of other eukaryotes and concluded
that the lineage leading to microsporidia branches very early from that leading to other
eukaryotes. It is hypothesized that some of the organisms unique features may signify a
split from other eukaryotes very early in time. Kawakami et al. (1992) made yet another
unusual observation: Analysis of primary and secondary structure of the 5S rRNA and
rDNA of N. bombvcis reveals a typical eukaryotic structure.
The objective of this study was to evaluate the taxonomic relationship of
Vairimorpha sp., Thelohania sp., and T. solenopsae to each other based on their 16S
rRNA gene sequences. The 16S rRNA genes (nuclear) of T. solenopsae. Thelohania sp.,
and Vairimorpha sp. were amplified by PCR, analyzed with restriction fragment length
polymorphism (RFLP), and sequenced to gain information on the characteristics of these
genes. The molecular data were used as information to evaluate the taxonomic position of
the species studied. In addition, the 16S rRNA gene of Agmasoma penaei (Overstreet


100
PCR protocol
1.For one 25 pL reaction, prepare master mix in a sterile, 0.5 mL microfuge tube. To
prevent carry-over contamination, use plugged cotton tips.
lOx buffer* 2.50 pL
lOx nucleotide mix (2 mM dATP/dGTP/d 1" 1 P/dCTP 2.50 pL
primer 1 (4 pmol/pL) 1.00 pL
primer 2 (4 pmol/pL) 1.00 pL
sterile distilled (sd) H20 7.84 pL
DNA Ta^Pol 0.8 U/reaction 0.16 pL
or Primezyme DNA pol. 0.3 U/reaction 0.16 pL
*7a<7Pol lOx reaction buffer: 100 mM Tris-HCl, 500 mM KC1, and 25 mM
MgCl2. Primezyme DNA polymerase lOx reaction buffer: 100 mM
Tris-HCl, 500 mM KC1, 1% Triton X-100, and 25 mM MgCl2
Add the enzyme after the master mix has been heated for 5 min.
Final volume of master mix is 15 pL. Keep the master mix on ice.
2. To another sterile 0.5 mL microfuge tube, add DNA template in a volume of 10 pL.
Overlay with either 100 pL sterile glycerol or 50 pL Chill-out 14 Liquid Wax (MJ
Research). Heat template and master mix in heating block to 94C for 5 min. Add
DNA polymerase to master mix and vortex. Add 15 pL of master mix to template.
Start temperature cycling (1 min at 94C, 1 min at 52C, 1 min at 72C for 35 cycles
followed by a final extension step of 72C for 15 min).
3. Mix 5 pL aliquot of PCR product with 5 pL of lx loading dye (lOx loading dye:
50% glycerol, 50 mM EDTA, 0.5% bromophenol blue) and electrophorese on a
0.8% Seakem LE agarose gel in lx Tris-acetate running buffer (TAE; 40 mM Tris-
acetate, pH 8.0, 1 mM EDTA, pH 8.0).
4. Purify PCR products with the QIAquick PCR Purification Kit (QIAGEN), elute in
sdH20 or TE (10 mM Tris-HCl, pH 8.0,4 mM EDTA, pH 8.0) and store at -20C.
QIAquick PCR purification:
Add 5 vol (e.g. 500 pL ) of buffer PB to 1 vol (e.g. 100 pL) of PCR
reaction and mix. Place a QIAquick spin column into a 2 mL collection
tube and load the sample. Centrifuge 30-60 sec at maximum speed. Drain
flowthrough fraction from collection tube and place QIAquick column back
in the same tube. To wash, add 750 pL of buffer PE to column and
centrifuge 30-60 sec. Drain buffer PE flowthrough from existing tube and
spin column again to remove residual buffer PE. Place column in a clean
1.5 mL microfuge tube. To elute DNA, add 50 pL of 10 mM Tris-HCl,
pH 8.0 or 50 pL of sdH20 to column and centrifuge for 30-60 sec.
Cloning of PCR product
1. Clean PCR product (has restriction sites added to ends) on Qiaquick PCR
purification column. Use 100 pL of crude PCR product. Elute bound DNA from
column with 50 pL of TE (10 mM Tris-HCl, pH 8.0, 4 mM EDTA, pH 8.0).


67
concentration. The MgC^ concentration was the crucial factor; 2.5 mM MgC^ gave more
consistent amplification results than 1.5 mM.
For DNA extraction and PCR, Ixl07-lxl08 spores were sufficient. If DNA
extraction and PCR were performed with 1x10s or lxlO6 spores (using the same
procedures as for the larger spore samples), no PCR product was obtained. A size
difference existed between the amplified DNA fragments from Thelohania sp. and
T. solenopsae (~ 1400 bp) to Vairimorpha sp. and A. penaei (~ 1300 bp) (Figure 4.1).
Cloning of the 16S rRNA Gene
Figure 4.2 presents a sketch on how the PCR products of T. solenopsae and
Thelohania sp. were cloned into the pTZ 19R plasmid DNA. The cloned construct of
Vairimorpha sp. was similar except that Kpnl was used instead of EcoRl to create sticky
ends of the plasmid and PCR product DNA. The cloning procedure did not result in any
clones if the PCR products were not pretreated with Proteinase K (results not shown).
Proteinase K treatment was necessary to improve cloning efficiency.
Restriction Fragment Length Polymorphism of the 16S rDNA
Figure 4.3 shows three restriction cuts (Sau3A, Hhal and HaellT) for
Thelohania sp., T. solenopsae. and Vairimorpha sp. The restriction patterns for each
enzyme showed differences among Vairimorpha sp. and the two Thelohania species, but
the latter two species had identical restriction profiles. As detected by gel electrophoresis,
the two Thelohania species had two restriction sites each for Sau3A and Hhal, and four
restriction sites for HaeIII. The fragment sizes were roughly 750, 500, and 200 bp when
cut with Sau3A; 760, 350, and 300 bp when cut with Hhal; and 750, 420, 180, 60, and 50
bp when cut with Hae III. Vairimorpha sp. had one restriction site for Sau3A (fragments


86
their small subunit ribosomal gene sequences were very different The PCR 1400 bp
product of Thelohania sp. was roughly 100 bp larger than the PCR product of
Vairimorpha sp. In addition, Vairimorpha sp. 16S rDNA had different restriction patterns
than Thelohania sp. for several enzymes tested. Sequence comparison of the 16S rDNAs
revealed a sequence similarity of 63.2% (or mean distance of 0.368) between the two
microsporidia. These data, supported by Haartkeerls et al. (1993) guideline of
percentage sequence similarity for different genera, uphold the hypothesis that Thelohania
sp. and Vairimorpha sp. represented two species in two different genera and not two
phenotypes of the same species.
Even though spores of Vairimorpha sp. and Thelohania sp. were distinct at the
light microscopic and ultrastructural level, they could have been different phenotypes of
the same species. Many microsporidian species have more than one spore type such as the
dimoiphic genera Vairimorpha and Parathelohania (Sprague et al. 1992). Vairimorpha
necatrix. for example, was initially described as two species, Nosema necatrix and
Thelohania diazoma (Kramer 1965) because of its two morphologically distinct spore
types. Later it was recognized that V. necatrix is a dimorphic species (Maddox 1966;
Fowler and Reeves 1974; Pilley 1976). Another example of a polymorphic
microsporidium is given by Becnel (1992) who described the heterosporous Amblvospora
califomica with three moiphologically and functionally distinctive spore types.
Vairimoipha necatrix. the type of the genus Vairimorpha. shared ~ 63% sequence
similarity with Vairimorpha sp. which was indicative that Vairimorpha sp. may not belong
in the genus Vairimorpha. Other data such as ultrastructure of the spores support this
hypothesis. Both spore types of Vairimorpha sp. are ultrastructurally distinct from
Y- necatrix. For example, free spores of V. necatrix (Mitchell and Cali 1993) and
Vairimorpha sp. differ in the arrangement of the polar filament and polaroplast structure,
and meiospores of the two species differ in thickness of exospore and endospore.
Different sized 16S rDNA PCR products and a sequence similarity of -63% of the


78
Thelohanla sp.
T. aolenopsae
N. bombycls
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cunlculi
Plelstophora sp.
E. schubergl
N. corneum
E. bleneusl
A. penael
G. atherlnae
Ichthyosporldlum sp.
Valrimorpha sp.
A. michaelis
1081 1140
GATGTGCAGTATGC AACTAATGTTGTGAGACTTCTTGCGGTAAGC TTGATGAA
GATGTGCAGTATGCAACTAACTAATGTTGTGAGACTTCTTGCGGTAAGC TTGATGAA
GAGACCCTCATTTAGACAGATGTAGTG ATACA TATGAAGG
GAGACCCTCATTTAGACAGATGTAGTG ATACA TATGAAGG
GAGACCCTTTTATTAATAGACAGACAC AATCAGTG TAGGAAGG
GAGACCCTTTTATT-ATAGACAGACAC AATCAGTG TAGGAAGG
GAGACCCT TTATTAGACTGACAC TATTAGTG TAGGAAGG
GAGACCCT- -TTTTGACTGTGCTCTA TGGGGCA AGGGAGG
GAGACCC TTTGACAGTGCTCTT TGGGGCA AGGGAGG
GAGACCC TTTGACGGTGTTCTA CGAAGCA A-GGAGG
GAGATC TTTGGACATG- TTCCC ACAGGAA CAGGAAGG
GAGATC TTTGGACATG--TTCCC AC-GGAA CAGGAAGG
GAGATCT- -TTTGGACATG- -TTCCG CAC-GGAA CAGGAAGG
GAGACCT- -CCTTGACAGG- TGTTC TGTAACA CAGGAGGG
GAGACTT-- TCATAAACAGCTATCTA ACAGGTA GAGGAAGG
GAGACCCCTACCGAAAGGGACAGGTGC CGAAAGCA CAGGAAGG
GAGACCC C AGC AAAGGAC AGGTGC GCAAAGCA CAGGAAGG
GAGACCCTGTGTAGATGGAAATA-CGACGGGACATGGCAAGTGT CAGGAAGA
GTAAATCCTCATAATAGCTTGTTTGA AAAGAACAA
Thelohanla sp.
T. aolenopsae
N. bombycls
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cunlculi
Plelstophora sp.
E. schubergl
N. corneum
E. bleneusl
A. penael
G. atherlnae
Ichthyosporldium sp.
Valrlmorpha sp.
A. michaelis
1141 1200
GAGGCGCTATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCTGCACGTGTAATACAGT
GAGGCGCTATAACAGGTCAGTGATGCCCTTAGATGTTCTGGGCTGCACGTGTAATACAGT
AGAGGATTAAAACAGGTCCGTTATGCCCTAAGATAATCTGGGTTGCACGCGCAATACAAT
AGAGGATTAAAACAGGTCCGTTATGCCCTAAGATAATCTGGGTTGCACGCGCAATACAAT
AAAGGATTAAAACAGGTCCGTTATGCCCTCAGACATTTTGGGCTGCACGCGCAATACAAT
AAAGGATTAAAACAGGTCCGTTATGCCCTCAGACATTTTGGGCTGCACGCGCAATACAAT
AAAGGACTAAAACAGGTCAGTTATGCCCTCTGACATTTTGGGCAGCACGCGCAATACAAT
AATGGAACAGAACAGGTCCGTTATGCCCTGAGATGAAGCGGGCGGCACGCGCACTACGAT
AATGGAACAGAACAGGTCCGTTATGCCCTGAGATGAAGCGGGCGGCACGCGCACTACGAT
GATGGAAGAGAACAGGTCCGTTATGCCCTGAGATGAGGCGGGCTGCACGCGCAACTAGAT
-GGAGGCTATAACAGATCAGAGATGCCCTTAGATGCCCTGGGCTGCACGCGCAATACAAT
-GGAGGCTATAACAGATCAGAGATGCCCTTAGATGCCCTGGGCTGCACGCGCAATACAAT
AAAAGGCTATAACAGATCCGAGATGCCCTCAGATGCCCTGGGCTGCACGCGCAATACAAT
TGGAGGCTATAACAGGTCCGTGATGCCCTTAGATATCCTGGGCAGCAAGCGCAATACAAT
GGAAGGCGATAACAGATCCGTGATGCCCTCAGATGTCCTGGGCTGCACGCGCAATACATT
AAGGGTCAAGAACAGGTCAGTGATGCCCTCAGATGGTCTGGGCTGCACGCGCACTACAGT
ATGGGTCAAGGACAGGTCAGTGATGCCCTTAGATGGTCCGGGCTGCACGCGCACTACAGT
GCGGGTCGATAACAGGTCTGTGATGCCCGCAGATGTTCCGGGCGCCACGCGCACTACATT
TTCGAGCAAGAACAGGTCAGTGATGTCCTTTGATAGCTTGGGCTGCACGCGCAATACAAT
* **** ** *** ** ** *
Thelohanla sp.
T. aolenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cunlculi
Plelstophora sp.
E. schubergl
N. corneum
E. bleneusl
A. penael
G. atherlnae
Ichthyosporldlum sp.
Valrlmorpha sp.
A. michaelis
1201 1260
GGGTATTTCAATATTTAATAGGA-GTAAATTTACCCGAGACAGGGATCATGCTTTGTAAG
GGGTATTTCAATATTTAATAGAA-GTAAATTTACCCGAGACAGGGATCATGCTTTGTAAG
AAT-ATTTG-ATAT TATA AGGGATAATATAATGTAAG
AAT-ATTTG-ATAT TATA AGGGATAATATAATGTAAG
AGATATAT-AATC TTTA TGGGATAATATTTTGTAAG
AGATATAT-AATC TTTA TGGGATAATATTTTGTAAG
AGA-CTTT-AATC TTTA TGGGATAATATTTTGTAAG
AGATGCCT ATGTGGGCTACTGTGA-GGGATGAAGCTGTGTAAT
AGATGGCG AGGGAGCCTGCTGTGA-GGGATGAAGCTGTGTAAT
AGATGGCG CTTCTGCCTGCTGTGAGGGGATGAAGCTGTGTAAG
AGCACGTA-GACG TACAGAACAACACGTGCT-GAGGTGGACTGTGCTCTGCAAG
AGCACGTA-GACG TAGAGAACAACACGTGCT-GAGGTGGACTGTGCTCTGCAAG
AGCAGGTA-GAGA GAGAGACAGGAAGGTGCT-CAGATGGACTATGTGCTGTAAG
ATCTCTTC AGTA GACAAAGTGATTTGAGAT-GAGTAGGATCTACGTTTGTAAA
ATGTATAT-TTCT TATAAATAGATACTACATATTGGGGAATTGACTTTTGTAAA
GGTCATAGAAATGAAACGATAGAATTAAAGATGATCGAGAGGGAATGAGCTTTGTAAG
GGTCGCCGAAATTTAGATATAGAGCTAAAGGCGATCGAGAGGGAATGAGCTTTGGAAG
GGACGGCGATATATGAAAATGAGGAGCCGTCCGTGGTTGGGATTGACGCTTGTAAT
TTTTATGT AGTAAGATATAGATAGGGATTGAGGGCTGAAAG
** **


COMPARATIVE ANALYSIS OF MICROSPORIDIA OF FIRE ANTS, SOLENOPSIS
RICHTERI AND S. INVICTA
By
BETTINA A. MOSER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1995
UNIVERSITY OF FLORIDA LIBRARIES


19


61
10 (iL of glycerol stock was added to 3 mL TB containing 35 pg/mL ampicillin and grown
overnight at 37C and 225 rpm.
Plasmid DNA Purification: The alkaline lysis method combined with DNA
precipitation by polyethylene glycol (PEG) was used to purify the plasmid DNA carrying
the cloned DNA from E. coU transformants (Nicoletti and Condorelli 1993). E. coli
transformant cells were suspended in 200 pL glucose/Tris/EDTA (GTE) buffer (50 mM
Glucose, 25 mM Tris pH 8.0,10 mM EDTA pH 8.0) and lysed with 300 pL of 0.2 N
NaOH/1% SDS for 5 min on ice. Chromosomal DNA was precipitated with 300 |lL of
3.0 M potassium acetate (KOAc), pH 4.8 for 5 min on ice. After centrifugation, the
supernatant was collected and treated with RNAse A (20 |lg/mL) for 20 min at 37C.
After two chloroform extractions to remove proteins and residual chromosomal DNA, the
plasmid DNA was ethanol and PEG precipitated (PEG precipitation: dissolve DNA pellet
in 32 (iL distilled H20, add 8 pL 4 M NaCl and mix, add 40 pL 13% PEGgooo, incubate on
ice for 1 h, centrifuge at 4C and 10,000 g for 15 min.) The resulting DNA pellet was
resuspended in sterile distilled water. To confirm the presence of the 16S rRNA gene
insert, the hybrid plasmid was digested with the appropriate restriction enzymes, and the
size of the insert was compared to the purified PCR product and linearized PTZ 19R
plasmid DNA by separating on a gel.
Restriction Fragment Length Polymorphisms of the 16S rDNA
Several enzymes were tested on Thelohania sp., T. solenopsae. and
Vairimorpha sp.: Sau3A (4U/pL), Hhal (20U/pL), HaeIII (8U/pL), Acil (5U/pL), and a
double-digest of Hindi (8U/pL) and Hindlll (20U/pL) (New England Biolabs). Digests
were performed in 20 pL volumes using 12 pL of PCR product (~ 700 ng), 0.5 pL of
each enzyme, 2 pL of the specific lOx restriction buffer (manufacturers instructions), and
5.5 pL of deionized H20. The reaction mixes were incubated at 37C for 2 h. The


TABLE OF CONTENT
page
ACKNOWLEDGMENTS v
LIST OF TABLES viii
LIST OF FIGURES ix
LIST OF ABBREVIATIONS xi
ABSTRACT xiii
CHAPTER
I TAXONOMIC PROBLEMS OF FIRE ANT MICROSPORIDIA
Synopsis 1
II MORPHOLOGICAL CHARACTERIZATION OF MICROSPORIDIA
FROM SOLENOPSIS INVICTA AND S. RICHTERI
Introduction 4
Materials and Methods 9
Results 12
Discussion 26
III FATTY ACID METHYL ESTER ANALYSIS IN MICROSPORIDIA:
EVALUATION OF A NEW TOOL FOR IDENTIFICATION
Introduction 30
Materials and Methods 34
Results 38
Discussion 41
IV COMPARATIVE MOLECULAR CHARACTERIZATION OF
MICROSPORIDIA FROM SOUTH AMERICAN FIRE ANTS
Introduction 49
Materials and Methods 54
Results 66
Discussion 82
vi


To my dear family and friends


122
Sasser, M. 1990c. Tracking a strain using the microbial identification system.
Technical Note 102. MIDI, Newark, DE.
Schuitema, A.R.J., Hartskeerl, R.A., van Gool, T., Laxminarayan, R., and Terpstra, W.J.
1993. Application of the polymerase chain reaction for the diagnosis of
microsporidiosis. AIDS 7 (suppl. 3), S57-S61.
Schweizer, E. 1988. Biosynthesis of fatty acids and related compounds. In Microbial
lipids, vol. 2, (Ratledge, C., and Wilkinson, S.G. eds). Academic Press, London.
Sedlacek, J.D., Dintenfass, L.P., Nordin, G.L., and Ajlan, A.A. 1985. Effects of
temperature and dosage on Vairimorpha sp. 696 spore morphometries, spore yield,
and tissue specificity in Heliothis virescens. J. Invert. Pathol. 46, 320-324.
Shaw, N. 1974. Lipid composition as a guide to the classification of bacteria. Adv. Appl.
Microbiol. 17,63-108.
Shimizu, S., Akimoto, K., Shinmen, Y., and Kawashima, H. 1991. Sesamin is a potent
and specific inhibitor of A5 desaturase in polyunsaturated fatty acid biosynthesis.
Lipids 26. 512-516.
So, R.B., Ladha, J.K., and Young, J.P.W. 1994. Photosynthetic symbionts of
Aeschvnomene spp. form a cluster with Bradyrhizobia on the basis of fatty acid and
ribosomal RNA analyses. Ini. J. Svst. Bacteriol. 44, 392-403.
Sogin, M.L., and Gunderson, J.H. 1987. Structural diversity of eukaryotic small subunit
ribosomal RNAs. Annals N.Y. Acad. Sci. Endocytobiologv III 503,125-139.
Sogin, M.L., Gunderson, J.H., Elwood, H.J., Alonso, R.A., and Peattie, D.A. 1989.
Phylogenetic meaning of the kingdom concept: An unusual ribosomal RNA from
Giardia lamblia. Science 243, 75-77.
Sprague, V., Becnel, J.J. and Hazard, E.I. 1992. Taxonomy of phylum microspora.
Critic. Rev. Microbiol. 18, 285-395.
Stanley-Samuelson, D.W., Jurenka, R.A., Cripps, C, Blomquist, G.J. and de Renobales,
M. 1988. Fatty acids in insects: Composition, metabolism, and biological
significance. Arch. Insect Biochem. Physiol. 9, 1-33.
Stead, D. E., Sellwood, J. E., Wilson, J., and Viney, I. 1992. Evaluation of a commercial
microbial identification system based on fatty acid profiles for rapid, accurate
identification of plant pathogenic bacteria. J. Appl. Bacteriol. 72, 315-321.


3
several hosts, and spore types, also hampers experimental transmission of many species in
the laboratory.
Molecular techniques, including polymerase chain reaction (PCR), restriction
fragment length polymorphism (RFLP), and sequence alignment of the small 16S rRNA
subunit, are being developed for microsporidian species identification and phylogenetic
construction (Baker et al. 1995, Baker et al. 1994; Weiss et al. 1994; Vossbrinck et al.
1993). Additional methodologies, including spore protein profiles (Didier et al. 1991; Irby
et al. 1986; Jahn et al. 1986; Langley et al. 1987; Street 1976), serological assays
(Canning 1988; Didier et al. 1991; Niederkom et al. 1980; Oien and Ragsdale 1992), and
flow cytometry (Amigo et al.1994) have been used to aid in classification, although to a
limited extent
In this study, a multiphasic approach was used to compare the micrososporidia
from S. richteri to each other and to those from £. invicta. Methods used included light
microscopic and ultrastructural observations of the spores (chapter II), and amplification,
sequencing, and sequence comparison of the 16S rRNA genes (chapter IV). In addition,
the use of spore fatty acid profiles was investigated for the first time as a character in
identification (chapter III).


54
1973) was amplified and sequenced. We wanted to have a 16S rRNA gene sequence of
another Thelohania species to compare to the fire ant Thelohania species. The type
species of the genus Thelohania is T. giardi which is found in decapods. It was described
at the end of the last century (Sprague et al. 1992), and no further studies have been done
with it since. Neither samples of T. giardi nor any 16S rRNA gene sequences of other
Thelohania species are available to compare to those of the fire ant Thelohania species.
Assuming that A. penad, formerly called T. penad, is closely related to the type species of
the genus Thelohania. T. giardi. we chose A. penaei as a species to compare to the two
Thelohania species. Both species have octosporous sporulating sequences and infect
shrimp. Agmasoma penaei was moved from the genus Thelohania to its own genus,
Agmasoma. because its polar filament is anisofilar (Hazard and Oldacre 1975).
Materials and Methods
Collection of Test Organisms
Thelohania sp., Vairimorpha sp., and T. solenopsae were collected from £. richteri
and S. invicta respectively (chapter II). Thelohania penaei. now named A. penaei. was
collected and stored in water at 4C by R. M. Overstreet from an overwintering white
shrimp, Penaeus setiferus. in a laboratory mud-substratum pond in Ocean Spring,
Mississippi, on 4-12-1991.
Spore Harvest and Purification
Vairimorpha sp. spores were purified from S. richteri adults that died during the
trip from Buenos Aires to Gainesville immediately upon arrival at Gainesville. The ants
were ground in homogenizing buffer (10 mM Tris-HCl pH 7.5,1 mM ethylenediamine-
tetraacetate (EDTA), 0.1% SDS) in a Tekmar tissuemizer and filtered through cotton to


73
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrlx
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cuniculi
Plelstophora sp.
E. schubergi
N. corneum
E. bleneusl
A. penael
G. atherinae
Ichthyosporidlum
Valrlmorpha sp.
A. mlchaelis
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrlx
N. vespulae
N. apis
E. hellem
S. Intestlnalls
E. cuniculi
Plelstophora sp.
E. schubergi
N. corneum
E. bleneusi
A. penael
G. atherinae
Ichthyosporidlum
Valrlmorpha sp.
A. michaelis
Thelohanla sp.
T. solenopsae
N. bombycis
N. trichoplusia
V. necatrix
N. vespulae
N. apis
E. hellem
S. intestinalis
E. cuniculi
Plelstophora sp.
E. schubergi
N. corneum
E. bieneusi
A. penael
G. atherinae
Ichthyosporidlum
Valrlmorpha sp.
A. michaells
181 240
A GCATGAAAGCGGAGCATCAATGTAGCGTTGGTTTCTGACCTATCAG
A GCATGAAAGCGGAGCATCATTGTAGGATTGGTTTCTGACCTATCAG
TAA CAATAATACAATAAGAATAAGATCTATCAG
TAA CAATAATACAATAAGAATAAGATCTATCAG
TAA GACATATACAGTAAGAGTGAGACCTATCAG
TAA GATGTGTACAGTAAGAGTGAGACCTATCAG
TAA CATATGTACAGTAAGAGTGAGACCTATCAG
TAAGTTCTGGGGGTGGTAGTTTGTAGCTACTGCGTACCGAGTAAGTTGTAGGCCTATCAG
TA GGGGGCTAGGAGTGTTTTTGACACGAGCCAAGTAAGTTGTAGGCCTATCAG
TA GTGGTCTGCCCCTGTGGGTTGGCAAGTAAGTTGTGGGCCTATCAG
TAAG AGGGGACAGAACAAGACGCAGGACTATCAG
TAAG AGGGGACAGAACAAGACGCAGGACTATCAG
TAAG GGAAGGCAGAATAAGACGCAGGACTATCAG
TAAA AGCGG- -AGAATAAGGCGCAACCCTATCAG
TAAA AATCATGAGGATGTGAGGTAGACCTATTAG
TTGACGA GGTCGTTCGTTTAACGAATAGTGTAGGAGAGTAAGAAGCCATCCCATCAG
sp. TTGTATAA-GGATTGTTCGTTTAAC-ATTAGTGGGGGAGAGTAAGACGCCAGTCCATCAG
TAACCA CGGTAAGCTGTGGCTAAAACGAGCGTGGGTGAGTTCTTGGCCTATCAG
TAAAGCATCTATCTTCTAAAGTTTTTTAGAGGAGAGGAGAAGAAG-CACTCACCTATCAG
* ** **
241 300
TTAGTATGTTTTGTAAGGGAGAACATAGACTATGACGGGTAACGGGGGATGCACGTCTGA
TTAGTATGTTTTGTAAGGGAGAACATAGACTATGACGGGTAACGGGGGATGCACGTCTGA
TTAGTTGTTAAGGTAATGGCTTAACAAGACTATGACGGATAACGGTATTACTTTGTAATA
TTAGTTGTTAAGGTAATGGCTTAACAAGACTATGACGGATAACGGTATTACTTTGTAATA
CTAGTTGTTAAGGTAATGGCTTAACAAGGCAATGACGGGTAACGGTATTACTTTGTAATA
CTAGTTGTTAAGGTAATGGCTTAACAAGGCAGTGACGGGTAACGGTATTACTTTGTAATA
CTAGTTGTTAAGGTAATGGCTTAACAAGGCAATAACGGGTAACGGTATTACTTTGTAATA
CTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGGGAGACGGGGGATCAGGGTTTGA
CTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGGGAGACGGGGGATCGGGGTTTGA
CTGGTAGTTAGGGTAATGGCCTAACTAGGCGCAGACGGGATACGGGGGATCAGGGTTTGG
TTAGTTGGTAGTGTAATGGACTACCAAGACGGTGACGGTTGACGGGGAATGAGGGTTCTA
TTAGTTGGTAGTGTAATGGACTACCAAGACGGTGACGGTTGACGGGGAATGAGGGTTCTA
TTAGTTGGTAGTGTAATGGACTACCAAGACAGTGACGGTTGACGGGAAATTAGGGTTTTG
CTTGTTGGTAGTGTAAAGGACTACCAAGGCCATGACGGGTAACGGGAAATCAGGGTTTGA
CTAGTTGGTTGTGTAAAGGACTACCAAGGCTATAATGGGTAACGGAGATTTAGTGATCGA
TTAGTAAGTAGGGTAAGGGCCTACTTAGACGAAGACGGGT-ACGGGGAATTATCGTTTGA
sp. TTAGTAAGTAGGGTAAGGGCCTACTTAGACGAATACGGAT-ACGGGGAATTATCGTTTGA
CTAGTCGGTACGGTAAGGGCGTACCGAGGCAATAACGGGTAACGGGGAATCGGGGTTCGA
TTAGTAGGTATGGTAAGGGCATACCTAGACGAAGACGGGT-ACGGGGAAGGCAACTTCGA
* ** **** ** ** ** ****
301 360
TACCGGAGAGGAAGCCTTAGAAACCGCTTTCACGTC C AAGGATGGCAGCAGGCGC
TACCGGAGAGGAAGCCTT--AGAAACCGCTTTCACGTC-CAAGGATGGCAGCAGGCGC
TTCCGGAGAAGGAGCCTG- AGAGATTGCT- TACTAAGTCATAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTGAGAGATTGCTACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTGAGAGACGGCTACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTGAGAGACGGCTACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAAGGAGCCTG--AGAGACGGC--TACTAAGTC-TAAGGATTGCAGCAGGGGC
TTCCGGAGAGGGAGCCTGAGAGATGGCTACTACGTC-CAAGGATGGCAGCAGGCGC
TTCCGGAGAGGGAGCCTGAGAGATGGCTACTACGTC-CAAGGATGGCAGCAGGCGC
TTCCGGAGAAGGAGCCTG--AGAGATGGCTACTACGTC-CAAGGACGGCAGCAGGCGC
TACCGGAGAGGGAGCCTGAGAGATAGCTCCCACGTC-CAAGGACGGCAGCAGGCGC
TACCGGAGAGGGAGCCTGAGAGATAGCTCCCACGTC-CAAGGACGGCAGCAGGCGC
TACCGGAGAGGGAGCCTGAGAGATTGCTCCCACGTC-CAAGGACGGCAGCAGGCGC
TTCCGGAGAGGGAGCCTGAGAGATGGCTCCCACGTC-CAAGGACGGCAGCAGGCGC
AACCGGAGATGGAAGCTGAGAAACGGTTCCAATGTC-CAAGGATAGCAGCAGGCGC
TTCCGGAGAGGGAGCCTGAGAGACGGCT--ACCAGGTC-CAAGGACAGCAGCAGGCGC
sp. TTCCGGAGAGGGAGCCTGAGAGACGGCT--ACCGGGTC-CAAGGACAACAGCAGGCGC
TTCCGGAGAGGAAGCCTGAGAAACGGCTACCACGTC CAAGGAAGGCAGCAGGCGC
TTCCGGAGAGGGCGCCTT-TAGAGATGGCGACCAGTTC-TAAGGAGTCCAGCAGGCTC
******* ** **, ** ***** ******* *


34
Materials and Methods
Test organisms
Three genera were selected for fatty acid analysis: Vairimorpha, Nosema, and
Thelohania. Vairimorpha necatrix was obtained from J.V. Maddox, Illinois Natural
History Survey, and propagated in the corn earworm, Helicoverpa zea. Nosema algerae,
provided by A.H. Undeen, USDA-ARS, Gainesville, was augmented in H. zea and the
common malaria mosquito, Anopheles quadrimaculatus. Thelohania sp. was harvested
from field-collected Argentine fire ants, S. richteri. courtesy of R.S. Patterson and J.
Briano.
Spore Propagation of N. algerae in H. zea
Four-day-old H. zea larvae were starved individually for 24 h, then 20 (J.L of an
aqueous suspension of lxlO7 N. algerae spores/mL was added to each. After an
additional 24 h, the larvae were placed separately on a pinto bean diet, and maintained at
29C. Spores were purified from adult H. zea.
Spore Propagation of V. necatrix in H. zea
Five-day-old H. zea larvae were exposed to 10 pL of lxlO6 V. necatrix spores/mL
each and raised separately on pinto bean diet at 29C. Spores were harvested from last
instar H. zea larvae.
Spore propagation of N. algerae in A, quadrimaculatus
Approximately 1000 mosquito eggs were hatched in 100 mL water, thereafter
called infusion water, containing 13 mg of a 1:1 mix of dried, powdered liver and brewers
yeast After 24 h, this infusion was enriched with 30 mg of alfalfa powder, and the larvae


Figures 2.5. Light micrograph of Vairimorpha sp. cyst with free spores (FS) and
meiospores (MS). x210.
Figure 2.6. Light micrograph of Vairimorpha sp. cyst with free spores (FS) and
meiospores (MS). x750.