Citation
Genetics of the origin of replication of bovine mitochondrial DNA

Material Information

Title:
Genetics of the origin of replication of bovine mitochondrial DNA
Creator:
Olivo, Paul David, 1950-
Publication Date:
Language:
English
Physical Description:
vi, 84 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Cattle ( jstor )
DNA ( jstor )
Gels ( jstor )
Genomes ( jstor )
Genotypes ( jstor )
Mitochondria ( jstor )
Mitochondrial DNA ( jstor )
Molecules ( jstor )
Plasmids ( jstor )
Transfer RNA ( jstor )
DNA, Mitochondrial ( mesh )
Dissertations, Academic -- Immunology and Medical Microbiology -- UF ( mesh )
Immunology and Medical Microbiology thesis Ph.D ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida.
Bibliography:
Includes bibliographical references (leaves 76-83).
Additional Physical Form:
Also available online.
General Note:
Photocopy of typescript.
General Note:
Vita.
Statement of Responsibility:
by Paul David Olivo.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Paul David Olivo. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
08715103 ( OCLC )
028969060 ( ALEPH )

Downloads

This item has the following downloads:


Full Text














GENETICS OF THE ORIGIN OF REPLICATION
OF BOVINE MITOCHONDRIAL DNA






BY

PAUL DAVID OLIVO


A DISSERTATION PRESENTED TO THE GRADUATE COUNCIL
OF THE UNIVERSITY OF FLORIDA IN
PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY


UNIVERSITY OF FLORIDA


1982




- gle


This dissertation is dedicated to my wife, and best friend, Kathy.


~ ~.-
















ACKNOWLEDGMENTS


I offer my most sincere appreciation to Dr. William Hauswirth for all of his efforts on my behalf. I wish to thank him for offering me a position in his laboratory, and for all his encouragement and generosity. I have gained much from him as both my friend and mentor.

I also want to thank my committee members Drs.

Muzyczka, Laipis, Siden and Berns. I especially owe a debt of gratitude to Dr. Berns for all of his help and guidance.

My appreciation is also extended to all the facultyespecially Dr. Gifford, Dr. Shands and Dr. Small who offered me invaluable guidance and assistance.

Thank also to all the members of Dr. Hauswirth's

laboratory: Terri, Doug and especially Brian for his endless anecdotes. I am especially grateful to Kathy Brown for her tireless technical assistance. Many fellow graduate students deserve my thanks for making my graduate training thoroughly enjoyable, especially Jeffrey Ostrove an invaluable friend. Finally, thanks to my wife Kathy, for her unfailing support, for without her this work would not have been completed.


iii

















TABLE OF CONTENTS


Page


ACKNOWLEDGMENTS . . . . LIST OF FIGURES .. . . ABBREVIATIONS USED . . . ABSTRACT . . . . . .

CHAPTER I. INTRODUCTION . .


. . . . . . iii

. . . . . . v i


.viii


x

1


MtDNA Replication . .
Mitochondrial DNA Evolution .
MtDNA Inheritance . . .
Rationale . . . . .

CHAPTER II. MATERIALS AND METHODS

Anvimas ~


Ani als . . . . . . . . .
Isolation of mtDNA . . . . . .
Construction of mtDNA Recombinant Plasmids Isolation of Plasmid DNA . . . . . Rapid Isolation of Plasmid DNA . . . Restriction Enzymes . . . . .
Agarose Electrophoresis . . . . Southern Blotting . . . . . . .
Radiolabelling mtDNA.. . . . . .
Filter Hybridization and Autoradiography . Grustien-Hogness Blots . . . . . .
End-Labelling of mtDNA Fragments . . . Polyacrylamide Gel Electrophoresis . . Extraction of Restriction Fragments from the Acrylamide Gel . . . . . . ..
DNA Sequencing . . . . . . . .


3
6
9
10


. . . . . . 14


14 14 16 19 20 21 21 22 22 23 23 24 29

29 29


CHAPTER III. RESULTS . . . . . . . .

Sequence of the mtDNA D-Loop Region of H15
Holstein Cows . . . . . . . .
D-Loop Sequences of Other H15 Animals . .
Sequence of Clones of H1009B . . . . .
Summary of Holstein mtDNA Sequence Data . .


iv


. 31


31 38 42 45


. . . . .
. . . . .
. . . . .
. . . . .













D-Loop Region Sequence of a Holstein Cow Outside
the H15 Lineage . . . . . . . . 48
D-Loop Sequences of Cattle of Breeds Other Than
Holstein. ..... . . . . . . . 49
D-Loop Region Sequence Comparisons of Animals
of the'Order Artiodaclyla, Family Bovidae . 50
Mapping of D-Loop Strand of Bovine mtDNA . . 55

CHAPTER IV. DISCUSSION . . . . . . . . 63

Origin of mtDNA Variation . . . . . . 63
A Limited Numbr of Maternal Molecules Determine
the Mitochondrial Genotype . . . . . 66
Gene Conservation as a Possible Explanation of
D-Loop Sequence Variation Among Holstein Cows 67
Conclusion . . . . . . . . . . 73

APPENDIX . . . . . . . . . . . 74

REFERENCES . . . . . . . . . . . 76

BIOGRAPHICAL SKETCH . . . . . . . . . 84


v
















LIST OF FIGURES


Figure Pag

1. Maternal decendants of registered Holstein cow, H15 . . . . . . . . . 12

2. The restriction endonuclease map of mitochondrial DNA from Holstein cow H493 . 18

3. Autoradiograph of preparative 6% polyacrylamide gel . . . . . . . . . . 28

4. Genomic map of bovine mtDNA with cloned restriction fragments used in this study, indicated 33

5. Partial cleavage map and sequence strategy of the D-Loop region . . . . . . . 35

6. Sequence of the D-loop obtained from cloned DNA from Holstein cows H493, H634 and H1009B . 37

7. Schematic of sequence of URF-5 and D-loop of mtDNA from H15 animals and the sequence of
Anderson et al. (9) . . . . . . 40

8. Schematic of sequence of URF-5 and D-loop of mtDNA . . . . . . . . . . 44

9. Schematic of sequence of URF-5 and D-loop region of mtDNA . . . . . . . 47

10. Taxonomic tree of the Order Artiodaclyla . . 52 11. Sequence of middle of the D-loop of cow and
water buffalo mtDNA . . . . . . 54

12. Mapping of 3' termini of D-loop strands of
bovine mtDNA . . . . . . . . 58

13. Schematic of strategy for mapping 3' termini
of the D-loop . . . . . . . .60


vi









Figure Pa9


14. Nucleotide sequence of D-loop region of
bovine mtDNA with heavy strand origin of
replication (0H) and approximate points of
major 3' termini indicated (arrows) . . 62

15. Model fok gene conversion in the D-loop . . 71


vii

















ABBREVIATIONS USED


A adenine

BSA bovine serum albumin

bp base pair

C cytosine

Ci curie

cm centimeter

cpm counts per minute

dCTP deoxycytidine triphosphate

dGTP deixyguanidine triphosphate

dATP deoxyadenosine triphosphate

D-loop Displacement loop DNA deoxyribonucleic acid

E. coli Eschericha coli EDTA ethylenediaminetetraacetic acid

g Gravity

gms grams

G guanine

M molar

ma milliampere

mCi millicurie

mg milligrams


viii









ml milliliters

mM millimolar

mm millimeter

uCi microcurie

ug mic~rograms

ul microliter

um micromolar

mt mitochondria

mtDNA mitochondrial DNA

MSB mannitol, sucose buffer

ng nanograms
32
p phosphorus 32

RNA ribonucleic acid

RNase ribonuclease

rpm revolutions per minute

rRNA ribosomal ribonucleic acid

SDS sodium dodecyl sulfate

SSC standard saline citrate

tRNA transfer ribonucleic acid

V volts


ix
















Abstract of Dissertation Presented to the Graduate Council of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy


GENETICS OF THE ORIGIN OF REPLICATION
OF BOVINE MITOCHONDRIAL DNA

By

Paul Olivo

August, 1982

Chairman: William W. Hauswirth Major Department: Immunology and Medical Microbiology


The nucleotide sequence of the D-loop region of

mitochondrial DNA from maternally related Holstein cows was determined. First, four distinct mitochondrial genotypes have been identified. Second, the pattern of occurrence of these genotypes reveals multiple genotypic shifts. Third, the four genotypes have identical D-loop regions except at four bases, such that each genotype represents a different combination of base transitions at these four positions. The published bovine mtDNA sequence is also identical in the D-loop region except at these four positions, and thus is a fifth bovine genotype.

Marked intraspecies mitochondrial DNA polymorphism is thought to be related to strict maternal inheritance which leads to maternally isolated gene pools within a breeding population. However, our finding-of mtDNA polymorphism


x









within a maternal lineage demonstrates that some mitochondrial DNA variation is independent of strict maternal inheritance.

Furthermore, one genotypic shift has occurred in only two generations and is consistent with a mitochondrial genotype being determined by a limited number of maternal mitochondria DNA molecules. Thus, it is clear that rapid genotypic shifts make some very specific demands upon the molecular mechanism of mitochondrial DNA inheritance. A model, based upon mitochondrial DNA amplification during oogenesis, is discussed.

Finally, the origin of the differences in the D-loop region, among the genotypes we have identified, is not easily explained by a mutational mechanism. Multiple mutational events at the same position in a relatively short time are extremely improbable. A gene conversion model, based upon D-loop mapping studies and the sequence data, is proposed to explain how some of these genotypes may have arisen.


xi
















CHAPTER I

INTRODUCTION



Mitochondria, the energy producing organelles of the

cell, are present in the cytoplasm of all aerobic eukaryotic cells. The mitochondrion contains an inner and outer membrane, its own protein synthesizing machinery, and its own genetic information. It has been proposed that mitochondria may have arisen by endosymbiosis of a primitive eubacteria into a primitive eukaryote (for a critical review see 1).

Since the discovery of mtDNA (2), investigators have recognized the utility of the mitochondrial genome as a model system for understanding gene organization and control in eukaryotic organisms. Much effort has concentrated on the yeast system in which genetic markers have greatly facilitated the analysis of the mitochondrial genome (for review see 3). Much recent work has concentrated on mammalian mtDNA (for review see 4,5). Advances in DNA analysis (restriction enzymes, DNA cloning, and nucleotide sequencing, etc.) have in many ways compensated for the lack of genetic information about animal mitochondria.


1





2


MtDNA of Protista, fungi, plants, and animals, though functionally conservative, exhibits a high degree of variability in size, structure and gene organization (for review see 6). However, the mtDNA of all animal cells is very uniform in these features. Animal mtDNA is a supercoiled, circular, duplex molecule of about 10 daltons

(6). The mitochondrial genome codes for 12S and 16S RNA of the mitochondrial ribosome, twenty-two transfer RNA's and thirteen coding regions (5 of which are genes for enzymes of oxidative phosphorylation, and 8 of which are designated unidentified reading frames (URF's) pending identification

(7)). Only one non-coding region exists in the mitochondrial genome: the region between the phenylalanine tRNA and the proline tRNA genes which contains the origin of replication. The vast majority of mitochondrial proteins are coded in the nucleus, and there exists a tightly regulated interaction between the nuclear and mitochondrial genomes.

Tremendous advances have been made toward our

understanding of the animal mitochondrial genome. The entire nucleotide sequence of the mouse (8), human (7) and bovine (9) mtDNA molecules has been determined, and they display a striking degree of similarity in size and genetic organization, but a marked degree of divergence in sequence (see below). The mammalian mitochondrial genome displays a remarkable degree of compactness (7). Unlike nuclear DNA and yeast mtDNA, there are very few intergenic nucleotides





3


and no intragenic sequences (7). The tRNA genes are all interspersed between the coding regions, and the mRNA's rRNA's, and tRNA's all appear to be the product of precise endonucleolytic cleavage of large transcripts by a process whereby tRNA genes presumably serve as processing signals

(10).

The mammalian mitochondrial genome also exhibits

several other uniqub features. The mitochondrial genetic code differs from the "universal" genetic code in that UGA codes for tryptophan rather than termination, AUA for methionine and initiation rather than isoleucine, and AGA and AGG for termination rather than arginine (11). In addition many codon families exist in which a single amino acid is specified regardless of the third base.in the codon (e.g., CUN = Leu, GUN = Val, UCN = Ser, etc.) Furthermore, mitochondrial tRNA's are unusual in that they do not contain certain structural features found in all other tRNA's

studied (12).



MtDNA Replication

MtDNA exhibits a unique mechanism of replication in which the two DNA strands have distinct origins of replication (13). Replication begins at the heavy strand (H-strand) origin, and light strand (L-strand) synthesis does not begin until the H-strand has been elongated two-thirds around the molecule. A high proportion of isolated mtDNA molecules contain a third strand of DNA (14).





4


These are replicative intermediates in which the newly synthesized H-strand (7S DNA) displaces a segment of parental DNA creating a triple-stranded structure (Displacement loop or D-Loop). This 7S DNA has been shown to exist as families of discrete lengths with human 75 mtDNA exhibiting 5' heterogeneity (15,16) and mouse mtDNA having both 5' and 3' heterogeneity (17). Robberson and Clayton

(18) have shown that as many as 80% of mtDNA molecules in mouse L cells contain D-Loops. In vitro labelling of mtDNA has shown that this newly synthesized segment is rapidly displaced and resynthesized, and that very few D-Loop molecules are fully elongated (19). Why is D-Loop synthesis arrested at certain points and what signals allow for elongation? Clayton has proposed a template stop signal hypothesis based upon a 15 nucleotide consensus sequence which occurs in both the human and mouse D-Loop region (17). Confirmation of this concept awaits analysis in other species (see results). The prevalence of D-Loop structures among mtDNA molecules may relate to transcriptional control, since the putative promotor of transcription resides in the D-Loop region (20). It is also possible that the process of making and remaking D-Loops allows for more precise control of mtDNA replication, i.e., at the level of elongation rather than initiation.

Recently, protein or protein-membrane fragments have been observed associated with the origin of replication of HeLa cell mtDNA (21). However, the enzymes involved in





5


mtDNA replication have not yet been fully characterized. Kalf and Ch'ih first purified DNA polymerase from rat liver mitochondria (22). More recent work has shown the DNA polymerase isolated from mitochondria to be polymerase (23,24). No ther enzymes of mtDNA replication have been characterized, although enzymes such as a ligase, an RNA primase, an endonuclease and a topoisomerase are presumably involved in the replication of closed circular DNA molecules.

Little is known about the cell biology of mtDNA

replication. The relationship between mtDNA replication and mitochondrial proliferation is not understood. Bogenhagen and Clayton has shown that mtDNA replication is not cell cycle controlled, although the number of mtDNA molecules in dividing tissue culture cells is relatively constant (24). One interesting observation is that some mtDNA molecules can undergo a second round of replication while other molecules have not replicated at all (24). Finally, the tell-tale observation that there is a significant amplification of the number of mitochondria during both xenopus (25) and murine

(26) oogenesis may offer clues to the control signals involved in mtDNA replication and mitochondrial proliferation.

Many unanswered questions remain regarding the control of mtDNA replication. It is clear that the development of an in vitro replication system for mtDNA is needed. Also, structure-function comparisons of mtDNA, particularly in the D-Loop region, between more closely related species will





6


offer further insight into how mtDNA replication is regulated.



mitochondrial DNA Evolution

Mitochon'dria are involved in very important cellular functions and the mitochondrial genome is tightly packed with functional genes. One would therefore expect mtDNA evolution to be highly restricted due to functional constraints. Many studies, however, support the idea that mtDNA is evolving much more rapidly than single copy DNA (27-45). Restriction enzyme digest comparisons of mtDNA from various species have shown a marked degree of interspecific as well as intraspecific variation (28-31,35,36). Nucleotide sequencing studies have shown that single base substitutions account for much of the variation (46). However, intraspecific length polymorphism, mapping in the D-Loop region, has also been observed (38). Comparisons between the nucleotide sequence of the mouse

(8), human (7), and bovine (9) mtDNA molecules demonstrate the rapid primary sequence divergence in mammalian mtDNA. In addition the size difference among these three mtDNA molecules is mostly due to length differences in the D-Loop region.

The reasons for the high evolutionary rate of mtDNA are probably multifold. Sequence comparisons of various functional regions of the mitochondrial genome offer some insight into possible mechanisms (46). Certain regions of





7


the mitochondrial genome appear to be highly conserved. Dawid (27) has shown by DNA homology studies that although the mtDNA from two species of Xenopus differs in 20-30% of their total sequences, those regions coding for ribosomal RNA are nearl'y identical. Direct sequence comparisons have confirmed a high degree of homology in ribosomal genes between related and unrelated species (7,8,9).

Transfer RNA gnes appear to be the fastest evolving genes, possibly because they are free of some of the functional constraints that operate on nuclear and bacterial tRNA genes (46). Protein coding regions exhibit a high degree of neutral third base changes, and thus mitochondrial codon usage contributes to rapid base substitution.

The D-Loop region appears to one of the least conserved regions of the mitochondrial genome. Upholt and Dawid (38) compared sheep and goat mtDNA in the D-Loop region by heteroduplex analysis, and concluded that the D-Loop contains both conserved and unconserved sequences. Walberg and Clayton (47) have compared the nucleotide sequences of the human and mouse D-Loop region. They found a high degree of divergence especially at the 5' ends, but they also noted several highly conserved regions, the largest of which was as conserved as ribosomal RNA genes. Anderson et al. (9) have made similar observations in comparing the human and bovine D-Loop sequences. The implication is that parts of the D-Loop cannot tolerate change because their sequences are important for certain functions (e.g., binding to DNA or





8


RNA polymerases or other DNA binding proteins). Other regions of the D-Loop, however, may be involved in functions which do not depend upon a specific nucleotide sequence. Alternatively the species-specific nature of certain regions of the D-Loop'might relate to an interaction with the nuclear genome. Thus coevolution between the nuclear and mitochondrial genomes might explain the observed evolutionary leaps.

There is suggestive evidence for a high mutation rate in mtDNA (28,48). Mitochondria have been shown to lack certain repair functions (49), and polymerase is possibly the most error-prone DNA polymerase (50). Thus, a high rate of mtDNA turnover, coupled with an error-prone replication system, and poor editing functions, could result in a high mutation rate. Furthermore, mtDNA are possibly exposed to mutagenic oxidation products, and chemical carcinogens have been suggested to be preferentially associated with mtDNA

(51). Therefore, a high rate of mutational events and a high fixation rate are probably both operating to explain the high evolutionary rate of mtDNA.

It is clear that the mitochondrial genome is an

excellent system with which to study the molecular basis of evolution. However, sequence comparisons between highly divergent species such as human, mouse and bovine suffer from a saturation effect whereby multiple substitutions at the same position mask the true rate of change (28). Therefore, to precisely analyze the dynamics of the





9


substitution process, more closely related animals must be compared. Brown et al. has begun this by sequencing regions of mtDNA from great apes with divergence times of less than

ten million years (46).

However, the bulk of the present work deals with an

even more precisely defined system with which to study the phenomenon of mtDNA variation. This work presents an analysis of the mtDUA of a maternal lineage of Holstein cows with a carefully recorded pedigree. We have asked the question: What is the shortest time span over which variation can be observed in mtDNA?



MtDNA Inheritance

The transmission genetics of the mitochondrial genome of animals is poorly understood. Several studies (33,34,42,52,53,54) strongly support strict maternal inheritance, and no evidence for a paternal effect has been reported. The intraspecific polymorphism exhibited by the mammalian mtDNA is thought by some workers to be related to strict maternal inheritance, because it leads to maternally isolated mitochondrial gene pools within a breeding population. However, our laboratory has reported (55) a restriction site polymorphism within a single maternal Holstein lineage (see further discussion below). This variation, occurring between such closely related individuals over such a short time span, poses a problem of how mtDNA is inherited. Specifically, it is not clear how





10


the mitochondrial genotype can vary so rapidly in the face of the high ploidy of the mitochondrial genome. Given 1-4 x 103 mtDNA molecules per cell (56), the possibility of individual variants arising and becoming the predominant genotype is cnceptually difficult, especially over short time spans. The present work reports the results of a more detailed genetic analysis of this maternal lineage which we expect will offer ihsight into the molecular mechanism of mtDNA inheritance.



Rationale

Previous work (55) has shown that the mtDNA of five

animals within a maternal lineage of Holstein cows had one more Hae III site than the mtDNA of all other animals analyzed in this lineage. Figure 1 shows the pedigree of this maternal lineage, the H15 lineage. Nucleotide sequence analysis of this region determined that the loss of the Hae III site is uniformly due to a cytosine to thymidine base transition at nucleotide position 12792 (Anderson et al. numbering system, reference 9). This point mutation occurs within an open reading frame (URF-5) at the third position of a glycine codon and, therefore, is a neutral mutation.

The pattern of occurrence of the two types of mtDNA in this lineage argued against a mutational origin for this difference, since multiple, identical, but independent



























Figure 1.


Maternal descendants of registered Holstein cow, H15. The number refers to the barn number. H before the number indicates the animal is a Holstein. B after the number indicates the animal is a bull. An asterisk indicates the animal is alive. A circle indicates animals whose mtDNA has an additional Hae III site (i.e. a C at position 12792). A square indicates animals lacking this Hae III site. All other animals are dead and unanalyzed.































-H67-i


-H166 -H250


- H119 4-H194 H243


-H195-H244


-H155 H212 -H273


H496
H367
LH549* H892*
LH 549" 4
H804*


H569*- H816*- H974*
*
11333 H1501

H1391 H1493 H1624

H854*
H579* 1731 H869*
H934*

H319 -3

H466-H610 H949B


-H292-H347 1455 H713*

H904*
H394* 4
{1919B


H443 19B H776*-H916*
H634 H846* H847*


-H90 H136 H249 H393 H818* 11512
*
-H152-H259 -H303- H576 H1009B

H709*


12


H15 -





13


mutations would have to have occurred. A more likely hypothesis, which we proposed, was that at least two mtDNA genotypes existed within this lineage. This is the hypothesis upon which the present work was predicated. We decided to laok for other differences in the mtDNA of animals in the H15 lineage which might be linked to the Hae III difference. We chose to sequence the D-Loop region since, as mentioned&above, it has been shown to be one of the least conserved regions of the mitochondrial genome of animals. This work presents comparisons of the nucleotide sequence of the D-Loop region of many animals within the H15 lineage as well as several other animals outside this lineage. The results described below have broad implications toward our understanding of how mtDNA variation is generated, and how the mitochondrial genome is inherited.

















CHAPTER II

MATERIALS AND METHODS



Animals

All animals used in this study were maintained at the

University of Florida Dairy Research Unit (DRU) under closed genetic conditions. All Holstein cows or bull calves were registered with the Holstein-Freisian Association of America. With the exception of the founding maternal ancestor, H15, all animals in the H15 maternal lineage were born, bred and maintained at the DRU. Holstein H15 (registration number 3797669) was born October 3, 1953, and purchased on February 15, 1955. She has since given rise to 56 female descendants at the DRU, which comprise the current H15 maternal lineage (Fig. 1). Complete health, reproduction, and genetic records are available for all animals.



Isolation of mtDNA

Mitochondria were isolated from liver or brain tissue by homogenization followed by differential centrifugation. The mitochondria were then lysed with SDS and subjected to Cesium chloride-Ethidium bromide density gradient centrifugation to isolate the mtDNA (57).


14





15


For experiments analyzing the 7S DNA of the D-Loop, fresh brain tissue was used. An entire bovine brain (approx. 300 grams) was minced with an electric knife in

1 ml/gm MSB-Ca++ (0.21 M Mannitol, 0.07 M Sucrose, 0.05 M Tris-HCl pH 7.5, 0.003 M CaCl2). The chopped tissue was strained through gauze and homogenized in a ground glass 40 ml homogenizer. It was then subjected to five strokes through a dounce hotogenizer. Sodium EDTA was added to a final concentration of 10 mM and the homogenate was centrifuged at 700 g for 5 minutes. The supernatant was saved and again centrifuged at 700 g. The supernatant was then centrifuged at 20,000 g for 20 minutes and the crude mitochondrial pellet was resuspended in MSB-EDTA and centrifuged again at 20,000 g for 20 minutes. The mitochondrial pellet was resuspended in 0.1 M NaCl, 0.05 M Tris-HCl pH 7.5, 10 mM EDTA, lysed with 1% SDS, and immediately subjected to Cesium-chloride-Ethidium bromide buoyant density centrifugation at 160,000 g for 72 hours. The form I band, visualized under ultraviolet light, was collected and the ethidium bromide was removed by extraction with N-butanol saturated with 5 M NaCl followed by ethanol precipitation to desalt and concentrate the sample. An aliquot was checked for purity by electrophoresis on 1% agarose and staining with ethidium bromide.





16


Construction of mtDNA Recombinant Plasmids

Many of the mtDNA clones used in this study were

isolated by Dr. M.J. Van de Walle, Mr. G.S. Michaels and Ms. K.B. Brown. The plasmids pBR322 and pACYC184 (58) were the cloning v-ctors used. The plasmid pBR322 has a single Pst I site in the ampicillin resistance gene and a single Bam HI site in the tetracycline resistance gene. The plasmid pACYC184 hay a single Eco RI site in the chloramplenical resistance gene. MtDNA is cut twice by Pst I, and three times each by Bam HI and Eco RI (Fig. 2).

For cloning Pst I mtDNA fragments, Pst I cleaved

purified mtDNA and Pst I cleaved pBR322 DNA (treated with 1 unit of Bacterial Alkaline Phosphatase for 15 minutes at 37C followed by phenol and ether extraction) were mixed in approximately equimolar ratios. In vitro ligation was done overnight at 4C in 1 mM ATP, 1 mM DTT, 10 mM Tris-HC1 pH

7.4, with 1-5 units of T4 ligase. The ligated DNA was then transfected into E. coli strain HB101 using the procedure of Kuschner (59), except that the cells had been frozen and were thawed just prior to transfection as described by Morrison (60). The transfected culture was then plated onto agar containing tetracycline (20 ug/ml). Tetracycline resistant (TetR) colonies were replicated onto agar containing ampicillin (100 ug/ml). Tetr, amps colonies were then screened for the presence of mtDNA sequences by hybridization of a 32P-labelled mtDNA probe to bacterial lysates immobilized on nitrocellulose filters (61) and



























Figure 2. The restriction endonuclease map of
mitochondrial DNA from Holstein cow
11493. The maximum error in map
positions is 0.3 map units (57).






18


HhaI Bst E II
AvaI Eco RI HhaI Hpa I
S qc I Hha Z
X bal XbaI
95,6 0.0 25 91J 93.4 99.2 6.4 98 HpaI
12.9
Hpa I 998 .9 Bom H I
Kpn I
Hha I 83.1
Hin DII 81.3 92 P I
BgL 81.1.
79.0 20.1 Aval
Sa I Z _76.3
24.8 Xbal
Xba I
HpaI 72.6
72.4 27.9
69.7 Bam HI
Eco RI- 6 9.2 31.3
Hin D 1 31.3 Kpn I
Xba I

62.7 36.7
62.2 37.9
Hpa I 61.8 39L3 Hha I
Pst I 454 41.4 Bgl I
Xba I 51.0 48.8 Eco R I

\X Hin D II
a --Xho I
Hpa I Bam HIAa I





19


identified by autoradiography. Plasmid DNA isolated from positive colonies was then screened by restriction enzyme analysis and electrophoresis of the fragments on 1% agarose. In some cases, the agarose gels were blotted onto nitrocellulose (62) and hybridized to 32P-labelled mtDNA followed by autoradiography. The same basic protocol was used to clone Bam HI mtDNA fragments into pBR322, and Eco RI fragments into pACYC184, except tht Bam HI clones were screened for ampicillin resistance and tetracycline sensitivity and Eco RI clones were screened for tetracycline resistance and chloramphenical sensitivity.



Isolation of Plasmid DNA

Recombinant plasmid DNA containing mtDNA was isolated from one liter cultures by a modification of the method of Guerry et al. (63). Cultures were grown at 37C in Luria broth containing the appropriate antibiotic to a Klett unit of 90-110, and then preferential replication of plasmid DNA was induced by the addition of chloramphenicol (170 ug/ml) to the medium. Cultures were then grown an additional 16-20 hours. The cells were then pelleted at 1000 g, washed with cold 10 mM NaCl and resuspended in 6 ml 0.9% Glucose, 20 mM MEDTA, 20 mM Tris-HCl pH 8.0. Fresh lysozyme (2 mg/ml) was added and the cells were kept on ice 30 minutes. Then 12 ml of 0.8% NaOH, 1% SDS was added while gently mixing to lyse the cells. Nine milliliters 3 M Potassium Acetate, pH 4.8, was added and the solutions mixed





20


well by inversion. The precipitate was pelleted at 15,000 rpm for 30 minutes and the supernatant saved. Ten milliliters 30% Polyethylene Glycol 6000 was added (final concentration 7.5%) and the solution was mixed by inversion. The mixture ws kept on ice for 2 hours to precipitate the plasmid DNA. The precipitate was centrifuged at 600 g for

5 minutes. After discarding the supernatant the white pellet was resuspenaed in 2 ml 50 mM Tris-HC1 pH 8.0, 1 mM EDTA and treated with RNase (20 ug/ml) for 30 minutes at 37C. The solution was then diluted to 10 ml with 50 mM Tris-HCl pH 7.4 and phenol extracted twice, chloroform extracted once and then precipitated with 25 ml ethanol at

-70C for 1 hour. The precipitate was then pelleted at 10,000 rpm for 1 hour, vacuum dried and resuspended in 2 ml 25 mM Tris-HCl pH 7.4, 100 mM NaCl, and 1 mM EDTA. The plasmid DNA was further purified by Acrydine-yellow chromatography (64).



Rapid Isolation of Plasmid DNA

Cells from a 50 ml culture were pelleted and

resuspended in 100 ul 0.9% Glucose, 20 mM EDTA, 20 mM Tris-HCl, pH 8.0 in a 1.5 ml microfuge tube. The cells were treated with lysozyme as described above, and lysed with 200 ul 0.8% NaOH, 1% SDS after the addition of 1 ul Diethylpyrocarbonate (DEPC). One hundred fifty ul of 3 M Potassium Acetate was added and the mixture kept at 4C for

2 hours. The precipitate was pelleted in a microfuge for





21


10 minutes and the supernate transferred to another microfuge tube. The DNA was then precipitated by the addition of 1 ml of ethanol. After 10 minutes at -70C the DNA was pelleted in a microfuge for 10 minutes and the pellet vacuum dried.- The pellet was resuspended in 100 ul 10 mM Tris-HCl pH 7.4, 5 mM EDTA, phenol-chloroform extracted twice, chloroform extracted once, brought to 250 ul with 0.3 m Na Acetate and precipitated with 700 ul ethanol at

-70C for 10 minutes. After pelleting in the microfuge, the DNA (20-30 ug) was ready for cleavage with restriction enzymes and end-labelling with large fragment of E. coli Polymerase I for eventual sequencing.



Restriction Enzymes

All restriction enzymes were purchased from Bethesda

Research Laboratories (BRL), or from Biolabs, Inc. Digests were carried out in 20 mM Tris-HCl pH 7.5, 100 mM KCl, 1 mM DTT, 0.1 mg/ml gelatin, 7 mM MgCl2 using 0.2-1.0 units of enzyme per ug of DNA at a DNA concentration of approximately 100 ug/ml, for 1-4 hours at 37C.



Agarose Electrophoresis

Restriction digests of plasmid and mtDNA were analyzed by electrophoresis in 1% Agarose gels (6 x 6 x 0.5 cm) in a horizontal apparatus for 1-4 hours at 100-200 V (100-200 mA). The electrophoresis buffer contained 50 mM Tris-HCl, 20 mM Na Acetate, 18 mM NaCl, pH 8.2.





22


Southern Blotting

DNA electrophoresed into 1% agarose was transferred to nitrocellulose by a procedure modified from Southern (62). The DNA was denatured in situ by immersion in 1 M KOH for 30 minutes followed by neutralization by the addition of 1 M Tris-IIC1, pH 7.0, for 40-60 minutes or until the pH was stable at 7.0. The gel was soaked for 45 minutes in

6 x SSC, pH 7.4 and'placed beneath a nitrocellulose filter cut to the size of the gel. After blotting overnight with absorbant paper to transfer the DNA to the filter, the filter was washed in 2 x SSC and baked for 2 hours at 80C in a vacuum oven.



Radiolabelling mtDNA

MtDNA or cloned mtDNA was labelled with 32P-dCTP

(specific activity 400 Ci/mMole, Amersham Corp., Arlington Heights, Ill.) by a modification of the procedure of Rigby et al. (65). One-half to one ug of DNA was incubated in 50 mM Tris-HCl pH 7.4, 5 mM MgCl2, 10 mM 2-ME, 10 ug B5A, 0.2 mM each of dGTP, dATP and dTTP, 20 mCi -32P-dCTP ( 400 Ci/mM), 1 ng pancreatic DNase (Worthington) 1 unit of E. coli DNA polymerase I (BRL) in a total volume of 100 ul for 4 hours at 15C. The reaction was stopped by the addition of 10 mM EDTA, 20 ug tRNA (Sigma), and 200 ul 0.3 M Na Acetate. The unincorporated 32P-dCTP was removed by two cycles of ethanol precipitation of the DNA or by passing the DNA over a G-50 Sephadex (Pharmacia) column (0.5 x 5 cm) in





23


2 x SSC. Specific activities of 1-5 x 10 cpm/ug DNA were obtained.



Filter Hybridization and Autoradiography

Hybridiz'ation of the radioactive mtDNA fragments

transferred to nitrocellulose was done by a modification of the method of Denhardt (66). The nitrocellulose filters were pre-hybridized'in 6 x SSC, 0.08% ficoll, 0.08% polyvinylpyrolidine, 0.02% BSA, in a 100 ml volume for

6 hours at 68C. The filters were then hybridized in the same solution plus tRNA (50 ug/ml) to a 32P-labelled mtDNA probe (10 ng/ml) (denatured by boiling 10 minutes and quick-chilling on ice) for 16-24 hours at 68C. Following the hybridization the filters were washed at room temperature in the prehybridization solution for one hour, in 0.1 M KPO for one hour, in 1 x SSC 0.6% SDS twice for one hour each time, and finally rinsed in 1 x SSC. The filters were dried at 80C in a vacuum oven and exposed to XAR-5 Kodak X-Ray film in a light tight cassette for 1-3d at

-70C.



Grunstein-Hogness Blots

Bacterial colonies were screened for the presence of mtDNA by a modification of the Grunstein-Hogness procedure

(61). The filter was then soaked in 0.5 N NaOH for

7 minutes, equilibrated in 1 M Tris-HCl pH 7.4 for 1 minute, and then in fresh 1 M Tris-HCl, pH 7.4 for 5 minutes. The





24


filter was soaked in 1.5 Pi NaCl, 0.5 M Tris-HC1, pH 7.4, for

5 minutes and then dried on a vacuum manifold. The filter was then treated with Proteinase K (Sigma) (2 mg/ml) in

1 x SSC for 20 minutes at room temperature and then rinsed in 1 x SSC. ~The filter was dried under a lamp until chalk white and then dipped in chloroform for 2 minutes and dried. After soaking in 2 x SSC for 2 minutes the filter was dried for 2 hours at 80C-in a vacuum oven. The filter was then hybridized with a 32P-labelled probe as described above.



End-Labelling of mtDNA Fragments

MtDNA restriction fragments were end-labelled for sequencing purposes by one of three procedures.



1. 5' end-labelling with T4 Polynucleatide kinase (PNK)

and 32P dATP

Polyacrylaminde gel purified fragments were treated for

15 minutes at 37C with 1 unit of Bacterial

Alkaline Phosphatase in 50 mM Tris-HCl pH 8.0. They

were then phenol extracted, ethanol precipitated, dried

and resuspended in 20 mM Tris-HCl pH 7.6, 1 mM

spermidine, 0.1 mM EDTA, 10 mM MgCl2, 5 mM DTT and

20 units of PNK in a volume of 20 ul. This reaction

mixture was added to vacuum dried 100 uCi
32P-dATP (410 Ci/mM, Amersham Arlington Heights,

Ill.), and incubated for 30 minutes at 37C. The

reaction was stopped by the addition of 1 ul of 0.5 m





25


EDTA, 200 ul 2.5 M NH4 Acetate, 1 ul tRNA (20 mg/ml)

and then the DNA precipitated with 700 ul of ethanol at

-70C for 10 minutes.

2. 3' end-Labelling with Terminal Deoxynucleotydyltransferse (Tdt)

Purified mtDNA restriction fragments were 3 endlabelled with Tdt according to the method of Tu and

Cohen (67). The DNA was added to 100 uCi of Cordycepin 5' triphosphate [ 32P] (3000 Ci/mM Amersham) in a 20 ul

reaction volume containing 25 mM Tris, pH 7.0, 100 mM

Potassium cacodylate, 1.0 M CoCl2, and 0.2 mM DTT.

After adding 12 units of Tdt (BRL) the mixture was incubated at 37C for 30 minutes and the reaction

stopped by the addition of 2 ul 0.5 M EDTA, 200 ul NH4

Acetate, 2 ul tRNA (10 mg/ml). The DNA was then

precipitated with 700 ul of ethanol at -70 for

10 minutes.



3. 3' end-labelling with large fragment of E. coli

Polymerase I

Restriction fragments were incubated in 50 ul 20 mM

Tris-HCl pH 7.4, 7 mM MgCl2, 100 mM KCl, 1 mM DTT,

100 ug/ml gelatin with 50-100 uCi 32P-d-GTP

(3000 Ci/mM) for Bam HI or Hae III sites. After adding

2 units of Large Fragment Pol I (BRL) the reaction was

left at room temperature for no more than 5 minutes and





26


stopped by addition of 2 ul 0.5 M EDTA, and heated to

60C for 10 minutes. After adding 200 ul 0.3 M Na

Acetate, the labelled DNA was ethanol precipitated at

-70C for 10 minutes.

Following end-labelling by any of the aboye protocols, the strands of the fragment, labelled at both ends (either both 3' or both 5' ends) were separated by incubation in

0.1 N NaOH for 10 minutes at room temperature or the fragment cut with a second restriction enzyme. The products were then separated by electrophoresis on a 6% polyacrylamide gel (16 cm x 40 cm x 3 mM) at 200 V (20-40 m A) for 12-16 hours. The gel was then exposed to cronex 4 X-Ray film (Dupont) for 1-4 hours.

Many of the sequences presented in this work were done from cloned mtDNA insolated by the rapid isolation method described above. A typical protocol was to restrict the DNA of a 50 ml culture of an Eco RI A clone with Bam HI, and Bgl II. These fragments were then labelled with -32P-GTP and large fragment of E. coli Polymerase I. These 3' end-labelled fragments were then cleaved with Hpa I, Pst I and Cfo I, and then run on a 6% polyacrylamide preparative gel, and analyzed by autoradiography. As Figure 3 shows this yielded three well separated bands, two D-loop region fragments, Bam HI-Hpa I and Bam HI-Pst I, and one URF-5 fragment, Bgl II-Cfo I, which were ready for sequencing (see below).




























Figure 3.


Autoradiograph of preparative 6% polyacrylamide gel. Plasmid DNA from a 50 ml culture of clone 22-1 (an Eco RIA clone of the mtDNA from H624) was restricted with Bam HI and Bgl II, 3' end-lileled with large fragment of Pol I and P-GTP, and then restricted with Hpa I, Pst I and Cfo I. This gives three well separated bands. A. Bam HIHpa I. B. Bam HI-Pst I. C. Bgl IICfo I. Bands A and B are fragments in the D-loop region. Band C is a fragment which is in the URF-5 gene.





28


22-1




29


Polyacrylamide Gel Electrophoresis

Restriction fragments were isolated by electrophoresis on 6% polyacrylamide gels (16 cm x 40 cm x 3 mM) in a 50 mM Tris pH 8.3 0. M Borate, 1 mM EDTA (TBE buffer) at 200 V (20-30 m A) 12-16 hours. After electrophoresis, 32P-labelled fragments were visualized by autoradiography. Unlabelled fragments were stained with Ethidium bromide (2 ug/ml) and visualized under ultraviolet light.



Extraction of Restriction Fragments from the Acrylamide Gel

Restriction fragments were cut out of the acrylamide

gel with a scalpel, and extracted by crushing the gel with a glass rod followed by incubation for 12 hours at 37C in 0.5 M Ammonium acetate, 10 mM Magnesium acetate, 0.1% SDS and 5 ug/ml tRNA (the tRNA was omitted if the fragment was later to be labelled with PNK). The solution was then passed over siliconized glass wool to retain the gel and allow collection of the eluted DNA. The DNA was then precipitated several times with ethanol at -70C.



DNA Sequencing

All sequencing was done according to the method of Maxam and Gilbert (68). Purified end-labelled fragments were divided into five aliquots and subjected to the base modification reactions using dimethylsulfate (for Guanine), hydrazine (for cytosine and thymidine) hydrazine in 1.5 M NaCl (for cytosine only), Sodium hydroxide (for adenosine





30



cytosine), and pyridinium formate (for adenosine and quanine). Base displacement and strand scission reactions were done with 0.1 M Piperidine. The products of the sequencing reactions were analyzed by electrophoresis on 8, 12 or 20% polyacrylamide 7M urea gels (16 cm X 40 cm x

0.3 mm, or 32 cm x 40 cm x 0.3 mm, or 32 cm x 80 cm x

0.3 mm), followed by autoradiography at -20C with either Cronex 4 X-Ray film' (Dupont) or Xar-5 X-Ray film (Kodak).
















CHAPTER III

RESULTS



Sequence of the mtDNA D-Loop Region of H15 Holstein Cows

All sequences presented, unless stated otherwise, were determined from cloned DNA and are Light Strand sequences. Clones which contained D-Loop region sequences included Pst I A clones, Bam HI A clones, Bam HI C clones and Eco RI A clones (Figure 4). Almost all 912 nucleotides between the Proline and Phenylalanine tRNA genes were determined from cloned DNA of three animals, H493 an Ls animal, and H634-and H1009B, LL animals (Figure 1). Figure 5 shows the restriction enzyme sites used for sequencing and the direction sequenced. Figure 6 shows the actual nucleotide sequence of the D-Loop region as determined from cloned mtDNA of these animals. Our sequence is virtually identical to the sequence of Anderson et al. (9) except for four transitions at position 16074, 16079, 16231 and 16250 using the numbering system of Anderson et al. (9) which will be used throughout this work. The sequence of clones of H493 differs from the sequence of clones of H634 and H1009B at all four of these positions, but the sequence of each animal differs from the sequence of Anderson et al. (9) at only


31



























Figure 4. Genomic map of bovine mtDNA with cloned
restriction fragments used in this
study, indicated.




33


URF L rR N4


Pst Fo ~

Bam












(D



























Figure 5. Partial cleavage map and sequence
strategy of the D-Loop region.
Endonuclease sites employed during
sequencing are shown. The arrows
indicate the direction and length of
the fragments sequenced. The solid
circles indicate 5' end-labeled
fragments. All others were 3' end-labeled. The scale below
indicates base pairs.




35


u, i -0 !O L


-1! ( 1Clone


11-2 11-3

91-1

91-2 a---es- 91-3
95-85
--- 95-3
95-87
--95-13
95- P


-< 22-1
-- 87-A
24-7
-4--- M24
35-3 35-H 43-5 M43

- 33-1
709F 32-8 9A-1 576G 86-1 90-1 78-7 80-17 94-4 WB-1 WB-17


200


400 600 800


i I




























Figure 6. Sequence of the D-loop obtained from
cloned DNA from Hostein cows H493, H634
and H1009B. The L-strand sequence
(5'-31) is shown. The numbering system
is from Anderson et al. (9). At
positions 16074, 16078, 16231 and
16250 both of the bases noted from
different animals are shown (see text).






Pst I Pro tRNA
AAGA CAAGGAAGAAACTGCAGTCTCACCATCAACCCCCAAAGCTGAAGTTCTATTTAAACTATTCCCAACACTATTAATATAGTTCCATAAATACAAAGAGCCT 15810

TATCAGTATTAAAT TTATCAAAAATCCCAATAACTCAACACAGAATTTGCACCCTAACCAAATATTACAAACACCACTAGCTAACATAACACGCCCATACACAGACCA 15910

CAGAATGAATTACCTACGCAAGGGGTAATGTACATAACATTAATGTAATAAAGACATAATATGTATATAGTACATTAAATTATATGCCCCATGCATATAAGCAAGTAC 160 10

Ton G
ATGACCTCTATAGCAGTACATAATACATA AATTTGACTGCACATAGTACATTATGTCAA6 CATTCTTGATAGTATATCTATTATATATTCCTTACCATTAGAT

Bam HI
CACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACCCGCTAGGCAGGGATCCCTCTTCTCGCTCCGGGCCCATAAA CGTGGGGGTCGCTATCCAATGAATTTTAC
16210 C G

CAGGCATCTGGTTCTTTCTTCAGGGCCATCTCATCTAAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGGACTAATGGCTAATCAGCCCATGCTCACACA 16310 1 10

TAACTGTGCTGTCATACATTTGGTATTTTTTTATTTTGGGGGATGCTTGGACTCAGCTATGGCCGTCAAAGGCCCTGACCCGGAGCATCTATTGTAGCTGGACTTAAC'
110

TGCATCTTGAGCACCAGCATAATGATAAGCATGGACATTACAGTCAATGGTCACAGGACATAAATTATATTATATACCCCCCCTTCATAAAAATTTCCCCCTTAAATA 210

TCTACCACCACTTTTAACAGACTTTTCCCTAGATACTTATTTAAATTTTTCACGCTTTCAATACTCAATTTAGCACTCCAAACAAAGTCAATATATAAACGCAGGCCC 310 t
Hpa I
CCCCCCCC GTTGATGTAGCTTAACCCAAAGCAAGGCACTGAAAATGCCTAGATGAGTCTCCCAACTCCATAAAC IATAGGTTTGGTCCCAGCCTTCCTGTTAACTC
Phe tRNA 410 12s r.RNA


D-LOOP TEMPLATE STRAND (5' ->3')





38


two of the four positions (Figure 7). The pattern of occurrence and significance of these base transitions is discussed below.

Anderson et al. (9) compared the human and bovine

D-Loop region nucleotide sequence and confirmed the previous observation of the marked divergence in this stretch of DNA in the mammalian mitochondrial genome. They did note, however, eleven blocks of homology mainly confined to the region of the 7S DNA, i.e. in the middle of the D-Loop region. All four of the differences we have observed occur in the middle of the D-Loop region, within the confines of the 7S DNA which we have mapped (see results below). Three of the differences are in conserved blocks (H, I and E, see 9), but only two are bases conserved between human and cow. The importance of the specific positions involved, if any, is unclear, but the fact that the differences all occur within the region of the 7S DNA may be an important observation (see discussion below).



D-Loop Sequences of Other H15 Animals

Figure 1 shows the pedigree of the H15 maternal lineage of Holstein cows. As mentioned previously, it had been shown (55) that animals within the lineage fall into two types, those whose mtDNA has a C at base 12792 in URF-5 (L
s
animals) and those whose mtDNA has a T at base 12792 in URF-5 (LL animals). In comparing the nucleotide sequence of




























Figure 7.


Schematic of sequence of URF-5 and D-loop of mtDNA from H15 animals and the sequence of Anderson et al. (9).
1. H634 and H1009B. 2. Sequence of Anderson et al. 3. H493. Lines indicate identity. D-loop region sequenced is shown in Figure 5. a, b, c, d, e, positions 12792, 16074, 16079, 160231, and 160250, respectively.










URF-5


D-LOOP


- T -T- G T-A





- C T--A C -A 2






-C C-A C -G- 3


b c d


40


a


e





41


the D-Loop region of H493 (an Ls animal) with H634 (an LL animal), four nucleotide differences were observed at the positions noted in Figure 6. These sequences were multiply determined from three independent clones of H493 (11-1, 11-2, 11-3) and six clones of H634 (95-3, 95-6, 95-13, 95-85, 95-87 and 95-P). The sequence of all clones from one animal was identified. In other words, the mtDNA of these two animals differed not only at position 12792 in URF-5, but at four other bases several thousand bases away in the D-Loop region (Figure 7). This, in effect, proves that H493 and H634 had mtDNA of two separate genotypes. This also supports the idea that Ls and LL represented two genotypes within the H15 lineage. Alternatively, many genotypes which fall into two classes, Ls and LL, could exist in the lineage.

To distinguish between these two possibilities, the D-Loop region was sequenced across the stretch of DNA containing the four differences from cloned DNA from seven other LL animals and four other Ls animals. All seven LL animals' (H496, H501, H737B, H997B, H512, H576 and H709, see Figure 1) D-Loop region sequences were identical to each other and to H634. That is, all had a T at position 12792 in URF-5 (H709 was not sequenced in this region but did not have the Hae III site and is presumed to also have a T here) as well as the same four bases as H634 and H1009B at positions 16074, 16079, 16231 and 16250 and all other bases





42


sequenced in this region. Therefore, we have identified an LL genotype represented in all nine LL animals analyzed.

The situation with regard to the Ls animals is more complicated. Two animals, H624, the daughter of H493 and H393, had the identical sequence to H493 in the D-Loop region. However, as Figure 8 shows, H455 and H949B each had a different combination of bases at the four critical positions in the D-Loop (16074, 16079, 16231 and 16250) at which all LL animals differ from H493. No other base differences were noted among these animals. Thus, at least three LS genotypes have been documented within the H15 maternal lineage.

The uniqueness of these observations necessitated

ruling out an artifact of cloning. Therefore, the D-Loop region was sequenced from mtDNA isolated from liver tissue of H455. The sequence derived is identical to the sequence of the clone of H455 (24-7) in a region which spans the four variable positions (16974, 16079, 16231 and 16250). This result, plus the fact that all clones from one animal are the same (for one exception see below), supports the concept that the differences we observe do represent various genotypes, and are not artifacts of the cloning process.



Sequence of Clones of H1009B

One clone (91-3) of H1009B, an LL animal, has a D-Loop region sequence which is identical to all other LL D-Loop




























Figure 8.


Schematic of sequence of URF-5 and D-loop of mtDNA. Lines indicate identity. D-loop regions sequenced are shown in Figure 5. a, b, c, d, e,: positions 12792, 16074, 16079, 16231, and 16250, respectively. 1. H496, H501, H737B, H997B, H512, H576, H709, H634 and H1009B. 2. H455.
3. Sequence of Anderson et al. 4. H949B. 5. H493, H624, and H393.
6. J49 (Jersey) and H992B (Guernsey).












URF-5


D-LOOP


-T-T-G


--C T-A-- C1T-A -- CCT-A


TAT -A-2 C -A -. 3 C --- G-- 4


C G- 5



6


b c d


44


a


e





45


sequences (Figure 7). However, two other clones (91-1 and 91-2) of H1009B differ from all other LL sequences by a C to T transition at position 16295 (Figure 9). This represents the only difference between clones derived from one animal relorted in this work. Two types of mtDNA molecules, differing by one base in the D-Loop region, appear to have been cloned from one animal. Of course, analysis of many mote clones of H1009B as well as sequence of tissue mtDNA is necessary to confirm this result. However, if it holds up, this observation is direct evidence for heterozygosity of the mtDNA of the somatic cells of H1009B.



Summary of Holstein mtDNA Sequence Data

Figure 8 shows a comparison of all the sequences of

mtDNA of Holstein cows described in this work. Below is a summary of the data on the H15 lineage.

1. Clones of nine LL animals (whose mtDNA has a T at

position 12792 in URF-5) have the same D-Loop region

sequence at least over the bases sequenced (Figure 8).

2. Clones of Ls animals (whose mtDNA as a C at position

12792 in URF-5) exhibited three types of D-Loop

sequences characterized by identical sequences except

for various combinations of transitions at position

16074, 16078, 16231, and 16250 (Figure 8). At all

other bases the Ls sequences were the same as the LL




























Figure 9. Schematic of sequence of URF-5 and
D-loop region of mtDNA. 1. H1009B
clone 91-3 and all other L animals (see Text). 2. H1009B clones D1-1 and 91-2.
a, b, c, d, e,: positions 12792, 16074,
16079, 16231, 16250 and 16295,
respectively.





















URF-5


D-LOOP


- T T G T A- C- T gT G T A T -2


e f


47


b c


a


d





48


sequences, but no Ls D-Loop had the same four bases at the four critical positions as the LL D-Loop sequence.

3. Two clones (91-1, 91-2) of H1009B had a single base

difference (C to T transition) in the D-Loop at

position 16295 which distinguished it from one other clone (91-3) of 111009B as well as all other LL and Ls

animals.

4. Among all the $15 D-Loop sequences, four positions

(16074, 16079, 16231 and 16250) appear to be variable and all other bases sequenced are uniformly constant

(except for the one clonal difference noted above). 5. Of the sixteen possible combinations of these four

bases (24 assuming transitions only) four have been

observed and the sequence of Anderson et al. (9)

represents a fifth.

6. All mtDNA sequence differences between cows are base

transitions.



D-Loop Region Sequence of a Holstein
Cow Outside the H15 Lineage

H567 has no common ancester with H15 for over one

hundred years. The mtDNA of this animal is Ls according to its Hae III restriction pattern (55) and thus had to have a C at position 12792 in URF-5. The D-Loop region of the mtDNA of this animal was sequenced from both cloned DNA and liver tissue mtDNA (Figure 5). The D-Loop sequence of H567 is identical to H455, an L5 animal in the H15 lineage





49


(Figure 8). This result suggests that at least one of the genotypes found in the H15 lineage may exist outside the lineage. Of course other differences in bases not sequenced may exist. However, if this does represent the same genotype, theh this genotype, and probably other genotypes in the H15 lineage, existed prior to the start of the lineage.



D-Loop Sequences of Cattle of Breeds Other Than Holstein

A limited number of bases were sequenced from cloned mt DNA of animals of other cattle breeds. Figure 8 shows the D-Loop sequences of cloned mtDNA from a Jersey (J49, clone 94-4), a Guernsey (H992B, clone 78-7) and an Angus (704, clone 80-17). The Jersey and Guernsey sequences are identical in the approximately two hundred bases sequenced, and they are identical to H455 of the H15 lineage. The Angus sequence differs from the Jersey and Guernsey sequences only at one position, a T to C transition at base 16042. This difference may reflect a more distant ancestry of Angus cattle (beef cattle) with the Holstein, Jersey and Guernsey cattle (dairy cattle). Further sequencing of the mtDNA of these other breeds in the D-Loop especially across base pair 16231 and 16250 needs to be done to delineate how these breeds' mtDNA relates to Holstein mtDNA. However, the identity of the bases sequenced from these breeds with a Holstein sequence suggests that at least some of the mtDNA





50


genotypes may have existed prior to the domestication of cattle.



D-Loop Region Sequence Comparisons of Animals
of the Order Artiodaclyla, Family Bovidae

Figure 10 shows a taxonomic tree of the order

Artiodactyla with the Bovidae Family expanded. It is shown to emphasize the utility of this order for the study of mtDNA evolution. It is one of the largest orders of mammals, and there are four genera of Bovidae: Syncerus, Bubalus, Bison and Bos, all of which have a common ancester with Bos tenrus (European cattle) within ten million years

(69). There is some controversy but Sinclair (69) believes that the fossil, biochemical, and behavioral evidence favors a closer relationship between Syncerus (African Buffalo)-and Bubalus (Asian Water Buffalo) than either buffalo has with Bison and Bos. He estimates a five to six million year divergence between these buffalo and Bos and Bison, whereas Bos and Bison diverged from each other two to three million years ago. There are many extant species of each of these genera, particularly in the genus, Bos. DNA sequence comparisons of the mtDNA from these animals will enable us to place the D-Loop variation we observe in Bos taurus in an evolutionary perspective. Figure 11 shows a partial D-Loop sequence of Bubalus arnee (Water Buffalo) aligned with the Holstein cow sequence. The region sequenced spans the four variable positions in the cow. A total of 35 sequence



























Figure 10. Taxonomic tree of the Order
Artiodaclyla (from reference 70).








SUBORDER INFRAORDER SUPERFAMILY


FAMI LY


SUBFAMILY


GENUS SPECIES CO(~Y


SUIDAE
-NONRUMINATIA SUOIDEA (OLD WORLD PIGS)
TAYASSUIDAE
ANTHRACOTHERIOIDEA HIPPOPOTAMIDAE

-TYLOPODA CAMELIDAE
(CAMELS & LLAMAS)


rTRAGULINA TRAGULIDAE
(CHEVROTAINS)


-RUMINANTIA-


-PECORA


-CERVIDAE (DEER)

-GIRAFFIDAE

-BOVIDAE

-ANTILOCAPRIDAE


-SYNCERUS AFRICAN
BUFFALO


ARNEE WATER
BUBALUS BUFFALO
DEPRESSICORNIS
CEPHALOPHINAE GAURUS
-NEOTRAGINAE JAVANICUS
-TRAGELOPHINAE BOS AVI
SALNELI
EBOVIDAE TAURUS OX
-ALCELAPHINAE DOMESTIC
-HIPPOTRAGINAE -INDICUS-OX
-REDUNCINAE DOMESTIC
-ANTILOPINI INUTUS- YAK
-CAPRINAE BISON AMERICAN
(SHEEP & GOATS) ISON BUFFALO
-SAIGINAE NASUS EUROPEAN
BUFFALO


ORDER


RT IODACTYL (EVEN-TOED UNGULATES)


u,


GENUS SPECIES COMTN



























Figure 11. Sequence of middle of the D-loop of cow
and water buffalo mtDNA. Numbering system is from Anderson et al. (9).




54


16boy /4o 7l
1 1
ATGACCTCTATAGCAGTACATAATACATATAATTATTGACTGTACATAG COW

---N--A-GC--GAT-----------G--------------------TC---------- WB



TACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTT COw

C---T--A---------C----------------------------------C---- WB


ACCATTAGATCACCGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC COW

--------------------------------------------------------WB


GCTAGGCAGGGATCCCTCTTCTCGCTCCGGGCCCATAAACCGTGGGGGT COW TTC----------------------------------------GT--TAT--------- WB
btr
CGCTATCCAATGAATTTTACCAGGCATCTGGTTCTTTCTTCAGGGCCAT COW

A------ TT-------------A----------------------------------- WB


CTCATCTAAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGG COW

-------------TC--T----------------------------------------- WB


ACTAATGGCTAATCAGCCCATGCTCACACATAACTGTGCTGTCATACAT cow

--------T------------------------------------------------- WB


TTGGTATTTTTTTATTTGGGGGATGCTTGGACTCAGCTATGGCCGTCAA COW

---------------------------------------------------------- WB


AGGCCCTGACCCGGAGCATCTATTGTAGCTGGACTTAAC COW

-------------------------------------------_- WB





55


differences (one deletion, two insertions, eleven transversions, and twenty-one transitions) were noted out of a total of 401 bases sequenced in this region of the D-Loop. This represents an 8.6% sequence divergence as compared to the 10% divergence seen between these animals in the cytochrome b gene (K. Brown, personal communication). Thus, these results are consistent with a 1.9% change in sequence per million years divergence for a pair of species, assuming an approximately five million year divergence between water buffalo and cow (69). Unfortunately, no other D-Loop region sequence comparisons between closely related species have been done. It appears though, that this region is not more variable than the rest of the genome, and is probably more conserved. This is in line with D-Loop comparisons between more distantly related species, i.e. human-cow (9) and mouse-human (46) comparisons. This observation is important to our interpretation of the origin of the variability we observe in this region among Holstein cows (see discussion

below).



Mapping of D-Loop Strand of Bovine mtDNA

It has been shown that newly synthesized D-Loop strands in animal mtDNA exist as families of species specific discrete lengths (15,16,17). Human mtDNA D-Loop strands show 5' heterogeneity but only one 3' termination point

(15). Mouse D-Loops have four 3' termination points, one of which has two 5' starting points (17). We mapped the D-Loop





56


strand of bovine mtDNA. By 3' end-labelling closed circular mtDNA isolated from fresh brain tissue only the D-Loop strand will be labelled. Such a reaction reveals three major bands on a 4% Acrylamide, 7 M Urea gel (Figure 12, lane A). Themajor bands are approximately 440, 490 and 535 base pairs in length. We mapped the 3' termini of the D-Loop strands as shown in Figure 13. Lane B of Figure 12 reveals 3 major bands following annealing of the 3'-labeled D-Loop strand to its complementary strand and cleavage with Sau 3A. The bands are 200, 250 and 295 base pairs in length, and thus the differences in length correspond to the length differences in the uncleaved strands and the heterogeneity appears to be totally due to 3' heterogeneity 5' labelling needs to be done however to rule out any minor 5' heterogeneity. The minor bands in lane A, Figure 12 may in fact represent 5' heterogeneity. The minor bands in lane B, Figure 12 are probably the result of 3' microheterogeneity as seen by Doba et al. (17). Mapping of the 5' end of the D-Loop strand (i.e. the heavy strand origin or OH) can be determined from the difference between the uncleaved and cleaved 3' labelled D-Loop strands (lanes A and B respectively, in Figure 12). Figure 14 shows the approximate heavy strands origin as well as the 3' termini indicated on the actual sequence. It is noteworthy that the four variable bases described above lie within the D-Loop strand (Figure 14, arrows).



























Figure 12.


Mapping of 3' termini of D-loop strands of bovine mtDNA. D-loop strands from F95m I mt DNA were labeled with Tdt and [ p] codycepin and analyzed by 4% Polyacrylaminde-7M Urea electroIoresis and autoradiography. Lane A, [ p] Cordycepin labeled Form I mt DNA showing three major D-loop strand species; Lane B, 3'-end-labeled D-loop strands hybridized with 3' end labeled complementary single stranded cloned DNA, then cut with San 3A (jge Figure 13 for protocol); Lane C, [ p] cordycepin labelled Hae II fragments of pBR322 as size markers. Sizes are in base pairs.





58


B C



622 422, 429 370










227




8B



























Figure 13.


Schematic of strategy for mapping 3' termini of the D-loop. 3' end-labeling of the D-loop strands was according to Tu and Cohen (67). The complementary strand to which the D-loop strands were annealed was a Bam-Pst fragment from cloned mt DNA which was 3' end-labeled at the Bam HI site wiSI large fragment of Polymerase I and p-GTP and then isolated by strand separation on a 6% Polyacrylamide non-denaturing gel (see materials and methods).




60


MAPPING OF 3' TERMINI OF THE D-LOOP


90aC


5' 3'


O


Anneal at 68 Cin 1M NaCl overnight


'4,


Cut with Sau 3A or Rsa I


7M Urea, 4% Acrylamide Denaturing Gel
or
7M Urea, 20% Acrylamide Sequencing Gel


3' 32P


5'


--


3' end-labelling
with Tdt and
32P-cordycepin 5' 3'


32P



























Figure 14.


Nucleotide sequence of D-loop region of bovine mtDNA with heavy strand origin of replication (O ) and approximate points of major 3 termini indicated (arrows). The four variable bases among the Holstein cows are indicated (see text).






PstI Pro tRNA
A(CLCAACCAAGAAACTCCAGTCTCACCATCAACCCCCAAACCTCAAGTTCTATTTAAACTATTCCC)AACACTATTAATATAGTTCCATAAATACAAACACCCT

TA TCAGTA TTAAAT TTATCAAAAA TCCCAATAACTCAACACAGAATTTGCACCCTAACCAAATATTACAAACACCACTACCTAACATAACACCCCCA TACACA CACCA 15910

CACAA TCAA TTACCTACGCAAGGGGTAATGTACATAACATTAATGTAATAAAGACATAATATGTATATAGTACATTAAATTATATGCCCCATCCATA TAACCAA CTAC 160 10

ATCACCTCTATACCACTACATAATACATA AATTGTTGACTGCACATAGTACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTTACCATTAGAT C A 110
Ba__m HI
CACGACCTTAATTACCATGCCGCGTGAAACCAGCAACCCGCTAGGCAGGGATCCCTCTTCTCGCTCCCGCCCCATAAA CTGGCGGTCGCTATCCAATGAATTTTAC
16210

CAGCCATCTCGTTCTTTCTTCACGGCCATCTCATCTAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGGACTAATGGCTAATCAGCCCATCCTCACACA
16310 .I 10
< HTAACTGTCCTGTCATACATTTCCTATTTTTTTATTTTGGCGGATGCTTGGACTCACCTATGGCCGTCAAAGGCCCTGACCCCGAGCATCTATTGTACCTCGACTTAAC'
I10

TCCATCTTGAGCACCAGCATAATGATAAGCATCGACATTACAGTCAATCGTCACAGGACATAAATTATATTATATACCCCCCCTTCATAAAAATTTCCCCCTTAAATA 210

TCTACCACCACTTTTAACAGACTTTTCCCTAGATACTTATTTAAATTTTTCACGCTTTCAATACTCAATTTAGCACTCCAAACAAAGTCAATATATAAACGCACGCCC
310 Hpa I
CCCCCCCCi-TTGATCTAGCTTAACCCAAAGCAACGCACTGAAAATGCCCTAGATGAGTCTCCCAACTCCATAAAC IATAGGTTTCGTCCCAGCCTTCCTGTI'AACTC
Phe tRNA 410 ""L 2s r.RNA


D-LOOP TEMPLATE STRAND
















CHAPTER IV

DISCUSSION



Several unique observations have been presented. First multiple mitochondrial genotypes have been identified within a maternal lineage of Holstein cows. Second, the pattern of occurrence of these genotypes within the lineage suggests a mechanism of mtDNA inheritance which allows for rapid genotypic shift. Finally, the variability among the genotypes in the D-Loop region exists as various combinations of transitions at four bases with identity at all other bases sequenced.



Origin of mtDNA Variation

It has been proposed that the intraspecific variability of mtDNA is related to strict maternal inheritance of the mitochondrial genome (38). This mode of inheritance can lead to maternally isolated gene pools within a breeding population. Thus, if a variant mtDNA molecule arises in a female germ line cell, that mtDNA molecule can go on to predominate in that female's progeny. However, the new mitochondrial genotype is totally isolated from the remaining female lines within the species. It is easy,


63





64


therefore, to see how strict maternal inheritance maintains any variation in mtDNA that might arise within a female member of a species. The evidence for maternal inheritance is strong (33,35,42,52,53,54), and there is no reason to dispute its cbntribution to the phenomenon of intraspecific variation. However, this concept is not necessarily contradictory to our observation of mtDNA variation within a maternal lineage. MtDNA variation between maternally related animals may, in fact, represent another level of polymorphism of mtDNA within a species.

The major question that needs to be dealt with in understanding mtDNA variation is: how does a variant molecule become the predominant type of mtDNA within an organism? The conceptual difficulty lies, of course, with the high ploidy of the micochondrial genome, i.e. 1-4 x 103 genome copies per cell (56). Birky (71,72) has dealt with this issue in the yeast system in which a random segregation model appears to adequately fit the data. Given a sufficient number of cell generations there is a finite probability that a mutant can become the predominant genotype. Of course, if the mutant offers a selective advantage to the organism (e.g. antibiotic resistance) the number of generations it would take to establish the mutant would be reduced. Certainly though, not all mtDNA mutants which become fixed have a selective advantage. Otherwise the rate of mtDNA evolution would be much slower than the observed rate.





65


In trying to fit a random segregation model to animal mtDNA, there are several problems with which we must deal. From the time a mutant arises, until the time it becomes the predominant genotype, heterozygosity at a significant level must exist. Significant heterozygosity has not been observed in the mtDNA from an individual animal (29), though we have observed minor amounts of heterozygosity in the somatic cells of an'individual animal (T.L. Armstrong, personal communication). It could be argued that the gradual shift from one genotype to another, which a random segregation model predicts, only occurs in germ line cells, and not in somatic cells. However, if this process (i.e. gradual shift from one genotype to another by random segregation during cell division) takes more than one animal generation, by what mechanism can oocyte heterozygosity be maintained in the presence of somatic cell homozygosity? Hauswirth and Laipis (73) estimate that it would take at least twenty animal generations for a mixed population of mtDNA molcules to become a pure population, assuming 50 mtDNA molecules per oocyte (lower limit) and 100 germ cell generations (upper limit) and no selective advantage. We observe four genotypic shifts in the 1115 lineage (Figure 1), one of which occurred in only two generations. It is difficult to explain these data based upon multiple mutational events followed by random segregation, over so short a time span, unless a significant, but inapparent, selective advantage existed.




66


Two potential sources of mtDNA variation within this

lineage are paternal mitochondria and some kind of effect of nuclear genes. We have not analyzed the paternal mitochondrial genotypes, but the frequency of genotypic shifts which We observe is not consistent with the total lack of a paternal effect seen in matings in other animals (33,35,42,52,53,54). An effect of maternal nuclear genes is an interesting possibility which cannot be ruled out at present.



A Limited Number of Maternal Molecules
Determine the Mitochondrial Genotype

We observe one of the H15 lineage mitochondrial

genotypes outside the lineage (H567 has the same sequence as H455). It is likely, therefore, that at least some of the H15 genotypes existed prior to the start of the H15 lineage. This possibility allows us to postulate that some of the animals within the lineage are heterozygous for some of the genotypes. If an animal (e.g. H333 in Figure 1) were heterozygous for at least two genotypes, one need only postulate that a minor genotype somehow became the predominant genotype in only two generations. The logical conclusion of this is that the mitochondrial genotype of the progeny is the product of a limited number of maternal mtDNA molecules by a process of clonal expansion of the minor genotype. This is a much more attractive hypothesis than having to propose that at least five mutational events occurred and were fixed in only two generations.





67


The clonal expansion hypothesis is supported by the observation that the number of mitochondria is amplified during mammalian oocyte development. Mature mouse oocytes contain 100-1000 times as much mtDNA as a somatic cell (25) and about a 1~0 fold increase occurs in bovine oocytes (G.S. Michaels, personal communication). All one needs to postulate is that a limited number of mtDNA template molecules fuel the mplification process. It is easy to envision, by this mechanism, how a shift in the mitochondrial genotype could occur in a short time (e.g. one generation), if the minor genotype was chosen as the template molecule. Admittedly, it is difficult to conceive how a molecule that represents 5% or less of the total number could replicate and be amplified at the total expense of a molecule that represents 95% of the total. However, if the amplification of the minor genotype occurred only in that area of the oocyte destined to become germ cells (the germinal plasm, see 74), then the genotype in the germ cells of the offspring would differ from the maternal genotype. Then the somatic cells of the product of fertilization of those germ cells would display a mitochondrial genotype different from their maternal grandparent, and a genotypic shift in two generations would be observed.



Gene Conversion as a Possible Explanation of D-Loop
Sequence Variation Among Holstein Cows

By whatever mechanism it occurs, mtDNA variation within a maternal lineage of cows represents another level of





68


mtDNA intraspecies polymorphism. Yet another level of polymorphism, and another mechanism for generating it, is suggested by our D-Loop sequence data. Figure 9 shows the mitochondrial genotypes we have observed in the H15 lineage as well as the sequence of Anderson et al. (9). However one interprets the pattern of occurrence of these genotypes in the H15 lineage, the ultimate origin of the genotypes must lie in a series of mutational events throughout the course of bovine evolution. In analyzing the various genotypes, it is impossible to generate all the genotypes by a stepwise mutational process, starting with either any of the observed genotypes, or any of a number of theoretical combinations of these five base transitions, without changing one of the bases twice. Thus, a strictly mutational process demands that one of the bases change twice during the time many other bases have not changed at all. This would suggest that one or all of these four bases is hypermutable. Alternatively, some of the bases that appear as unchanged could have mutated and then back mutated. This argument would propose that there is nothing especially hypervariable about these four bases in the D-Loop, but that this whole region of the D-Loop is hypervariable. Our Water Buffalo sequence data discredit this argument. The rate of divergence in this region is slightly less than the average rate of divergence of mtDNA. Furthermore, four base differences between cows in a region of approximately nine hundred bases would represent about 200,000 years of Bos





69


mtDNA evolution (i.e. (4/900 1.9%) x 106 years). Perhaps this is not unreasonable if one realizes that during cattle domestication, new breeding stocks were continuously being formed by introducing non-domesticated maternal animals, with no recenit ancestor to domestic cattle, into the breeding populations (75). Therefore, it would appear that the region in which the four bases occur cannot be called hypervariable, and that the identity of a base between cows truly reflects the absence of a mutation.

We are thus forced to.return to the problem of how one or more bases could change twice while other bases remain unchanged. Random mutation with hypervariability at certain bases, due to a lack of functional constraints, cannot be easily dismissed. There is no reason that a relatively conserved region could not have mutational hotspots.

A more interesting explanation of the D-Loop variation is suggested by the mechanism of mtDNA replication. Figure 15 illustrates the proposed model. It has been shown that newly synthesized D-Loop strands are constantly being synthesized, lost, and resynthesized, and that they are very rarely fully elongated (19). Therefore, assuming a germ line cell is heterozygous for two genotypes, it is conceivable that a newly synthesized D-Loop strand, from a molecule of one genotype, could be displaced and invade the closed circular molecule of another genotype at its homologous region (i.e. the D-Loop region). A D-Loop for



























Figure 15.


Model for Gene Conversion in the D-loop. L bovine mitochondrial genotype with a C at position 12792 in URF-5. L genotype with a T at position 92792 in URF-5. Bases shown correspond to the bases indicated in Figure 8.








L


L


D-Loop Di spl acement


Strand
InvasioQn


Mismatch Repair


71


14


G AC









C


o





72


structure would be created with four mismatched bases (see Figure 15). These mismatched bases could then be recognized, excised randomly on either strand, and then repaired by a mechanism analogous to that described for both E. col and mammalian cells (76). The product of this process would then be identical to the recipient parental molecule except within the D-Loop, where the sequence would be a hybrid between the two genotypes at the four bases where the two genotypes differ. Of course, this same process could operate when the genotypes differed at only some of the four bases and also, the product of such a process could regenerate the parental genotype.

This gene conversion model has several attractive

features. First, it is not without plausibility; there were at least several genome copies per mitochandrion (56), there is evidence that mitochondria fuse (77), and recently heterozygous mitochondria have been described (78). Second, strand invasion is a well studied phenomenon (79) and D-Loop strands could conceivably be present in physiologically significant amounts to allow such a process to occur. Third, mismatch repair is believed to be a mechanism for repairing DNA synthesis error and thus associated with the replication complex (76). Fourth, this model, in addition to explaining the variability we observe in the D-Loop, would also help explain the significant conservation noted in this region of the D-Loop. As mentioned aboye, the middle of the D-Loop is as conserved as ribosomal genes





73


between highly divergent species such as human and cow (9) and human and mouse (47). Gene conversion, involving the D-Loop strand, would preserve conservation of this region. Finally, this model circumvents the necessity of postulating hypermutatioi at these four bases. Of course, mutation had to generate the differences originally, but five simple mutations (one in URF-5 and four in D-Loop) plus a series of gene conversion evehts, could generate all the combinations we have observed, plus any other theoretical combinations which may appear in future studies.



Conclusion

Our data suggest that the well described phenomena of rapid mtDNA evolution and significant intraspecies polymorphism are closely tied to the molecular mechanism of mtDNA inheritance. We believe that this mechanism allows for rapid genotypic shifts in mtDNA, and thus, can lead to mtDNA polymorphism among maternally related individuals. Finally, a gene conversion model best explains the variability we observe in the region of the mtDNA origin of replication.

















APPENDIX

ANIMALS AND CLONES USED


Breed/Lineage

Holstein/H15

",

"

"

"

"


"

"


Animal

H493

I






H1009B

"n


Clone

11-1 11-2 11-2 11-3 91-1 91-2 91-3 95-P 95-3 95-6 95-13 95-85 95-87 22-1 86-1 35H 35-3 24-7 33-1 9A-1


74


Vector/mt Fragment

pBR322/Pst I A pACYC 184/Eco RI A pBR322/Pst I A





pACYC 184/Eco RI-A PBR322/Bam HI C










PACYC 184/Eco RI A





PBR322/Bam HI A PACYC 184/Eco Rl A

"u "u


"


H634

"n


"n


H624 H501 H949B


H455 H496 H737B


IN THIS STUDY





75


"

Holstein/H15

"






Holstein/H3 Guernsey/L214 Angus/ Jersey/59UF



N/A


N/A


90-1 32-8 576G 709F 87A 43-5 78-17 80-17 94-4



WB-1 WB-17


H997B H512 H576 H709 H393 H567 H992B 70H J49 water buffalo


pBR322/Bam HI C










pBR322/Bam HI D pBR322/Bam HI C + D


"l

















REFERENCES


1. Gray, M.W., and W. Ford Doolittle. 1982. Has the endosymbiosis hypothesis been proven? Microb.
Rev. 46(1):1-42.

2. Nass, M.M.D. 1966. The circularity of mitochondrial DNA. Proc. Nat. Acad. Sci., U.S.A. 56:1215-1222.

3. Saccone, C., and A.M. Kroom (eds.). 1976. The Genetic Function of Mitochondrial DNA. North Holland Pub.
Co. Amsterdam.

4. Attardi, G. 1981. Organization and expression of the mammalian mitochondrial genome: a lesson in
economy: I. Trends Biochem. Sci. 6:86-89.

5. Attardi, G. 1981. Organization and expression of the mammalian mitochondrial genome: a lesson in
economy: II. Trends Biochem. Sci. 6:100-103.6. Gray, M.W. 1982. Mitochondrial genome diversity and the evolution of mitochondrial DNA. Can. J.
Biochem. 60:157-171.

7. Anderson, S., A.T. Bankier, B.G. Barrell, M.H.L.
de Bruijn, A.R. Coulson, J. Cronin, I.C. Epeson,
D.P. Nierlick, B.A. Roe, F. Sanges, P.H. Schreier,
A.J.H. Smith, R. Staden, and I.G. Young. 1981.
Sequence and organization of the human
mitochondrial genome. Nature 290:457-465.

8. Bibb, M.J., R.A. Van Etten, C.T. Wright, M.W. Walberg, and D.A. Clayton. 1981. Sequence and gene
organization of mouse mitochondrial DNA. Cell
26:167-180.

9. Anderson, S., M.H.L. de Bruijn, A.R. Coulson, I.C.
Epeson, F. Sanger, and I.G. Young. 1982. The complete sequence of bovine mitochondrial DNA:
Conserved features of the mammalian mitochondrial
genome. J. Mol. Biol. 156:683-717.

10. Ojala, D., J. Montaya, and G. Attardi. 1981. tRNA
punctuation model of RNA processing in human
mitochondrial. Nature 290:470-474.


76





77


11. Barrell, B.G., S. Anderson, A.T. Bankier, M.H.L. de
Bruijn, E. Chen, A.R. Coulson, J. Drouin, I.C.
Epeson, D.P. Kierlick, B. Roe, F. Sanger, P.H.
Schreier, A.J.H. Smith, R. Staden, and I.G. Young.
1980. Different pattern of codon recognition by mammalian mitochondrial tRNAs. Proc. Nat. Acad.
Sci. U.S.A. 77:3164-3166.

12. de Bruijn, M.H.L., P.H. Schreier, I.C. Epeson, B.G.
Barrell, E.Y. Chen, P.W. Armstrong, J.F.H. Wong, and B.A. Roe. 1980. A mammalian mitochondrial
serine tRNA lacking the "dihydrouridine" loop and
stem. Nucleic Acids Res. 8:5213-5222.

13. Berk, A.J., and D.A. Clayton. 1974. Mechanism of
Mitochondrial DNA Replication in L-cells:
asynchronous repliation of strands, segregation of
circular daughter molecules, aspects of topology
and turnover of initiation sequence. J. Mol.
Biol. 86:801-824.

14. Kasamatsu, H., and Vinograd. 1974. Replication of
circular DNA in eubaryotic cells. Ann. Rev.
Biochem. 43:695-720.

15. Billum, A.M., and D.A. Clayton. 1978.
Displacement-loop replication initiation sequence in animal mitochondrial DNA exists as a family-of
discrete lengths. Proc. Nat. Acad. Sci. U.S.A.
75:677-681.

16. Brown, W.M., J. Shine, and H. Goodman, 1978. Human
mitochondrial DNA: Analysis of 7S DNA from the
origin of replication. Proc. Nat. Acad. Sci.
U.S.A. 75:735-739.

17. Doda, J.N., C.T. Wright, and D.A. Clayton. 1981.
Elongation of displacement-loop strands in human
and mouse mitochondrial DNA is arrested near
specific template sequences. 78:6116-6120.

18. Robberson, D.L., and D.A. Clayton. 1972. Replication
of mitochondrial DNA in mouse L-cells and their
thymidine kinase-derivatives: displacement replication on a covalently-closed circular
template. Proc. Nat. Acad. Sci.U.S.A.
69:3810-3814.

19. Bogenhagen, D., and D.A. Clayton. 1978. Mechanism of
mitochondrial DNA replication in mouse L-cells:
Kinetics of synthesis and turnover of the
initiation sequence. J. Mol. Biol. 119:49-68.





78


20. Battey, J., and D.A. Clayton. 1978. The transcription
map of mouse mitochondrial DNA. Cell 14:143-156.

21. De Francesco, L., and G. Attardi. 1981. In situ
photochemical crosslinking of HeLa cell
mitochondrial DNA by a psoralen derivative reveals a protected region near the origin of replication.
Nuc. Acids. Res. 9:6017-30.

22. Kalf, G.F., and S.S. Ch'ih. 1968. Purification and
properties of DNA polymerase from rat liver
mitochondria. J. Biol. Chem. 18:4904.

23. Bertazzoni. E., A.I. Scovassi, and G.M. Brun. 1977.
Chick-embtyo DNA polymerase. Eur. J. Biochem
81:237-248.

24. Bogenhagen, D., and D.A. Clayton. 1977. Mouse L-cell
mitochondrial DNA are selected randomly for replication throughout the cell cycle. Cell
11:719-727.

25. Chase, J.W., and I.B. Dawid. 1972. Biogenesis of
mitochondria during xenopus laevis development.
Dev. Biol. 27:504-518.

26. Piko, L., and L. Matsumoto. 1976. Number of
mitochondria and some properties of mitochondrial
DNA in the mouse egg. Dev. Biol. 49:1-10.

27. Dawid, I.B. 1972. Evolution of mitochondrial DNA
sequences in Xenopus. Dev. Biol. 29:139=151.

28. Brown, W.M., M. George, and A.C. Wilson. 1979. Rapid
evolution of animal mitochondrial DNA. Proc. Nat.
Acad. Sci. U.S.A. 76:1967-1971.

29. Potter, S.S., J.E. Newbold, C.A. Hutchinson, III, and
M.H. Edgell. 1975. Specific cleavage analysis of
a mammalian mitochondrial DNA. Proc. Nat. Acad.
Sci. U.S.A. 72:4496-4500.

30. Francisco, J.F., and M.V. Simpson. 1977. The
occurrence of two types of mitochondrial DNA rat
populations as detected by Eco RI endonuclease
analysis. FEBS. Lett. 79:291-294.

31. Buzzo, K., D.C. Fouts, and D.R. Wolstenholme. 1978.
Eco RI cleavage site variants of mitochondrial DNA molecules from rats. Proc. Nat. Acad. Sci. U.S.A.
75:909-913.





79


32. Ramirez, J.L., and I.B. Daniel. 1978. Mapping of
mitochondrial DNA in Xenopus laevis and Xenopus barealis: The positions of ribosomal genes and
D-loops. J. Mol. Biol. 119:133-146.

33. Hayashi, J.L., H. Uanekawa, O. Gotoh, J. Motohashi, and
U. Tagashira. 1978. Two different molecular
types of rate mitochondrial DNAs. Biochem.
Biophys. Res. Comm. 81:871-877.

34. Kroon, A.M., W.M. deVas, and H. Bakker. 1978. The
heterogeneity of rat-liver mitochondrial DNA.
Biochem. Biophys. Acta. 519:269-273.

35. Shah, D.M., and C.H. Langley. 1979. Inter- and
intraspecific variation in restriction maps of
Drosophila mitochondrial DNAs. Nature
281:696-699.

36. Brown, W.M. 1980. Polymorphism in mitochondrial DNA
of humans as revealed by restriction endonuclease
analysis. Proc. Nat. Acad. Sci. U.S.A.
77:3605-3609.

37. Nass, M.M.D. 1981. Restriction Endonuclease analysis
of mitochondrial DNA from virus-transformed, tumor
and control cells ofhuman, hamster and avian
origin. Biochem. Biophys. Acta. 655:210-220.

38. Upholt, W.B., and I.B. Dawid. 1977. Mapping of
mitochondrial DNA of individual sheep and goats.
Rapid evolution in the D-loop. Cell. 11:571-583.

39. Hayashi, J.I., O. Gotoh, and Y. Togashira. 1981.
Length Polymorphisms of Restriction Fragments of
Rat Mitochondrial DNAs. Biochem. Biophys. Res.
Comm. 98:936-941.

40. Brown, G.G., and M.V. Simpson. 1981. Intra- and
interspecific variation of the mitochondrial
Genome in Rattus norvegicus and Rattus rattus:
Restriction enzyme analysis of variant
mitochondrial DNA molecules and genetics,
Genetics, 97:125-143.

41. Goodard, J.M., J.N. Masters, S.S. Jones, W.D. Ashworth,
and D.R. Wolstenholme. 1981. Nucleotide sequence
variants of Rattus norvegicus mitochondrial DNA.
Chromosma. 82:592-609.





80


42. Avise, J.C., R.A. Lansman, and R.O. Shade. 1979. The
use of restriction endonucleases to measure
mitochondrial DNA sequence relatedness in natural
populations. I. Population structure and
evolution in the genus Peromyscus. Genetics
92:279-295.

43. Ferris, S.D., R.D. Sage, and A.C. Wilson. 1982.
Evidence from mt DNA sequences that common
laboratory strains of inbred mice are descended
from a single female. Nature 295:163-165.

44. King, B.O., R.O. Glade, and R.A. Lansman. 1981. The
use of restriction endonucleases to compare
mitochondrial DNA sequences in Mus musculus: A
detailed restriction map of mitochondrial DNA from
mouse L Cells. Plasmid. 5:313-328.

45. Hauswirth, W.W., and P.J. Laipis. 1982. Variation in
bovine mitochondrial DNAs between maternally
related animals. In Mitochondrial Genes, eds.
Slonimski, P. Borst, P. and Attardi, G., Cold
Spring Harbor, New York, N.Y. in press.

46. Brown, W.M., E.M. Prager, A. Wang, and A.C. Wilson.
1982. Mitochondrial DNA sequences of primates:
tempo and mode of evolution of mitochondrial DNA.
J. Mol. Evol. in press.

47. Walberg, M.W., and D. A. Clayton, 1981. Sequences and
properties of the human KB cell and mouse L-cell D-loop regions of mitochondrial DNA. Nucl. Acids
Res. 9:5411-5421.

48. Brown, W.M. 1981. Mechanisms of evolution in animal
mitochondrial DNA. Annals N.Y. Acad. Sci.
361:119-134.

49. Clayton, D.A., J.N. Doda, and E.C. Friedberg. 1974.
The absence of a Pyrimidine dimer repair mechanism
in mammalian mitochondria. Proc. Nat. Acad. Sci.
71:2777-2781.

50. Kunkel, T.A., and L.A. Loeb. 1981. Fidelity of
mammalian DNA polymerases. Science 213:765-767.

51. Allen, J.A., and M.M. Coombs. 1980. Covalent binding
of polycyclic aromatic compounds to mitochondrial
and nuclear DNA. Nature 287:244-245.

52. Francisco, J.F., G.G. Brown, and M.V. Simpson. 1979.
Further studies on types A and B rat mtDNAs:
Cleavage maps and evidence for cytoplasmic inheritance in mammals.. Plasmid 2:426-436.





81


53. Hutchinson, C.A., III, J.E. Newbold, S.S. Potter, and
M.H. Edgell. 1974. Maternal inheritance of
mammalian mitochondrial DNA. Nature 251:536-638.

54. Giles, R.E., H. Blanc, H.M. Cann, and D.C. Wallace.
1980. Maternal inheritance of human mitochondrial
DNA. Proc. Nat. Acad. Sci. 77:6715-6719.

55. Hauswirth, W.W., C.J. Wilconx, and P.J. Laipis. 1982.
Nucleotide sequence variation in mitochondrial DNA
from bovine liver. J. Dairy Sci. in press.

56. Bogenhagen, D., and D.A. Clayton. 1974. The number of
mitochondrial DNA genomes in mouse L and human He
La cells.' Quantitative isolation of mitochondrial
DNA. J. Biol. Chem. 249(4):7991-7995.

57. Laipis, P.J., W.W. Hauswirth, T.W. O'Brien, and G.S.
Michaels. 1979. A physical map of bovine
mitochondrial DNA from a single cow. Biochem.
Biophys. Acta. 565:22-32.

58. Chang, A.C.Y., and S.N. Cohen. 1978. Construction and
characterization of DNA cloning vehicles derived from the P15 cryptic miniplasmid. J. Bacteriol.
134:1141-1149.

59. Kushner, S.R. 1978. Bacterial transformation. In.
Proceedings of the International Symposium on Genetic Engineering. Elseview, North Holland,
Amsterdam, Biomedical Press.

60. Morrison, D.A. 1979. Transformation and preservation
of competent bacterial cells by freezing. Meth. in
Enzymol. 68:326-331.

61. Grunstein, M., and D.S. Hogness. 1975. Colony
hybridization: A method for the isolation of
cloned DNAs that contain a specific gene. Proc.
Nat. Acad. Sci. 72:3961-396.

62. Southern, E.M. 1975. Detection of specific sequences
among DNA fragments separated by gel
electrophoresis. J. Mol. Biol. 98:503-517.

63. Guerry, P., D.J. LeBlanc, and S. Falkow. 1973.
General method for the isolation of plasmid DNA.
J. Bact. 116:1064-10.

64. Bunenann, H., and W. Muller. 1978. Base specific
fractionation of double stranded DNA: affinity
chromatography on a novel type of absorbant.
Nucl. Acid. Res. 5:1059-1074.





82


65. Rigby, P.W., M. Dieckmann, C. Rhodes, and P. Berg.
1977. Labelling DNA to high specific activity in
vitro by Nick-translation with DNA polymerase I.
J. Mol. Biol. 113:237-251.

66. Denhardt, D.T. 1966. A membrane-filter technique for
the detection of complementary DNA. Biochem.
Biophys. Res. Comm. 23:641-646.

67. Tu, C.D., as9 S. Cohen. 1980. 3' End-labelling of DNA
with [ P] cordycepin-5-triphosphate. Gene
10:177-183.

68. Maxam, A.M., and W. Gilbert. 1980. Sequencing
end-labelled DNA with base specific chemical
cleavages. Meth. Enzymol. 65:499-560.

69. Sinclair, A.R.E. 1977. The African Buffalo. Univ.
Chicago Press, Chicago, Ill.

70. Grzinek, B. 1972. Animal Life Encyclopedia. Van
Nostrand Rienhold. New York, N.Y.

71. Birky, C.W., Jr. 1973. On the origin of mitochondrial
mutants: Evidence for intracellular selection of
mitochondria in the origin of antibiotic-resistant
cells in yeast. Genetics 74:421-432.

72. Birky, C.W. 1978. Transmission genetics of
mitochondria and chloroplasts. Ann. Rev. Gen.
12:471-512.

73. Hauswirth, W.W., and P.J. Laipis. 1982. Mitochondrial
DNA polymorphism in a maternal lineage of holstein
cows. Proc. Nat. Acad. Sci. in press.

74. Eddy, E.M. 1975. Germ Plasm and the differentiation
of the germ cell line. Int. Rev. Cyt. 43:229-275.

75. Friend, J.B. 1978. Cattle of the World. Blanford
Press, Dorset, England.

76. Radding, C.M. 1978. Genetic Recombination. Ann. Rev.
Biochem. 47:847-880.

77. Honda, S.I., T. Hongladaron, and S.G. Wildman. 1964.
Characteristic movement of organelles in streaming
cytoplasm of plant cells. In Primitive Motile
Systems in Cell Biology, eds. Allen, R.D. and
Kamiya, N. 485-509 Academic Press, New York, N.Y.





83



78. Oliver, N.A., and D.C. Wallace. 1982. Assignment of
two mitochondrial synthesized polypeptides to
human mitochondrial DNA and their use in the study of intracellular mitochondrial interactions. Mol.
and Cell Biol. 2(l):30-41.

79. Beattie, K.L., R.C. Wiegand, and C.M. Radding. 1977.
Uptake of homologous single-stranded fragments by
superhelical DNA. J. Mol. Biol. 116:783-803.

















BIOGRAPHICAL SKETCH



Paul David Olivo, the fourth of eleven children of S. William and Jane C. Olivo, was born on August 30, 1950, in Boston, Massachusetts. He attended St. Francis Xavier High School in Concord, Mass., from 1964-1968. He attended Villanova University from 1968 to 1970 and in 1972, received a Bachelor of Arts in anthropology from the George Washington University. In 1974 he began graduate studies at the University of Florida in the Department of Immunology and Medical Microbiology. In June 1981 he received an M.D. degree from the University of Florida College of Medicine.

Upon completion of graduate school, he will enter a Residency training program in Internal Medicine at the University of Wisconsin, Madison, Wisconsin.


84









I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.





illiam W. Hauswirth, Ph D., Chairman
Associate Professor of Immunology and Medical Microbiology







I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.





d c olas Muzyczka, P .
Assistant Professor of Immunology
and Medical Microbiology







I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.





enineth I. Berns, M. ., Ph.D. Professor of Immunology and Medical licrobiology









I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.





Edward J. Siden, Ph.D.
Assistant Professor of Immunology and Medical Microbiology




I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.





Philip J. fay is, Ph Associate r fessor of Biochemistry and Molecular Biology





This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate Council, and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy.

August, 1982



D an, College of Medicine





Dean for raduate Studies and Research





















































































UNIVERSITY OF FLORIDA 3 1262 08554 7866




Full Text
77
11. Barrell, B.G., S. Anderson, A.T. Bankier, M.H.L. de
Bruijn, E. Chen, A.R. Coulson, J. Drouin, I.C.
Epeson, D.P. Kierlick, B. Roe, F. Sanger, P.H.
Schreier, A.J.H. Smith, R. Staden, and I.G. Young.
1980. Different pattern of codon recognition by
mammalian mitochondrial tRNAs. Proc. Nat. Acad.
Sci. U.S.A. 7J7:3164-3166-
12. de Bruijn, M.H.L., P.H. Schreier, I.C. Epeson, B.G.
Barrell, E.Y. Chen, P.W. Armstrong, J.F.H. Wong,
and B.A. Roe. 1980. A mammalian mitochondrial
serine tRNA lacking the "dihydrouridine" loop and
stem. Nucleic Acids Res. 8.: 5213-5222.
13. Berk, A.J., and D.A. Clayton. 1974. Mechanism of
Mitochondrial DNA Replication in L-cells:
asynchronous repliation of strands, segregation of
circular daughter molecules, aspects of topology
and turnover of initiation sequence. J. Mol.
Biol. 8^:801-824.
14. Kasamatsu, H., and Vinograd. 1974. Replication of
circular DNA in eubaryotic cells. Ann. Rev.
Biochem. 43:695-720.
15. Billum, A.M., and D.A. Clayton. 1978.
Displacement-loop replication initiation sequence
in animal mitochondrial DNA exists as a family-of
discrete lengths. Proc. Nat. Acad. Sci. U.S.A.
75:677-681.
16. Brown, W.M., J. Shine, and H. Goodman, 1978. Human
mitochondrial DNA: Analysis of 7S DNA from the
origin of replication. Proc. Nat. Acad. Sci.
U.S.A. 75:735-739.
17. Doda, J.N., C.T. Wright, and D.A. Clayton. 1981.
Elongation of displacement-loop strands in human
and mouse mitochondrial DNA is arrested near
specific template sequences. 78:6116-6120.
18. Robberson, D.L., and D.A. Clayton. 1972. Replication
of mitochondrial DNA in mouse L-cells and their
thymidine kinase-derivatives: displacement
replication on a covalently-closed circular
template. Proc. Nat. Acad. Sci.U.S.A.
69:3810-3814.
Bogenhagen, D., and D.A. Clayton. 1978. Mechanism of
mitochondrial DNA replication in mouse L-cells:
Kinetics of synthesis and turnover of the
initiation sequence. J. Mol. Biol. 119:49-68.
19.


URF-5
D-LOOP
T-^ T-G T A- i
.A'
-C^ T-A T A 2
C-^ TA C A 3
-C^ T- G C G 4
-C-^ c-A C G5
6


Figure 1. Maternal descendants of registered
Holstein cow, H15. The number refers to
the barn number. H before the number
indicates the animal is a Holstein. B
after the number indicates the animal is
a bull. An asterisk indicates the
animal is alive. A circle indicates
animals whose mtDNA has an additional
Hae III site (i.e. a C at position
12792). A square indicates animals
lacking this Hae III site. All other
animals are dead and unanalyzed.


81
53. Hutchinson, C.A., III, J.E. Newbold, S.S. Potter, and
M.H. Edgell. 1974. Maternal inheritance of
mammalian mitochondrial DNA. Nature 25_1: 536-638 .
54. Giles, R.E., H. Blanc, H.M. Cann, and D.C. Wallace.
1980. Maternal inheritance of human mitochondrial
DNA. Proc. Nat. Acad. Sci. 72:6715-6719.
55. Hauswirth, W.W., C.J. Wilconx, and P.J. Laipis. 1982.
Nucleotide sequence variation in mitochondrial DNA
from bovine liver. J. Dairy Sci. in press.
56. Bogenhagen, D., and D.A. Clayton. 1974. The number of
mitochondrial DNA genomes in mouse L and human He
La cells.* Quantitative isolation of mitochondrial
DNA. J. Biol. Chem. 249 (4): 7991-7995.
57.Laipis, P.J., W.W. Hauswirth, T.W. O'Brien, and G.S.
Michaels. 1979. A physical map of bovine
mitochondrial DNA from a single cow. Biochem.
Biophys. Acta. 565:22-32.
58.Chang, A.C.Y., and S.N. Cohen. 1978. Construction and
characterization of DNA cloning vehicles derived
from the P15 cryptic miniplasmid. J. Bacteriol.
134:1141-1149.
59. Kushner, S.R. 1978. Bacterial transformation. In-.
Proceedings of the International Symposium on
Genetic Engineering. Elseview, North Holland,
Amsterdam, Biomedical Press.
60. Morrison, D.A. 1979. Transformation and preservation
of competent bacterial cells by freezing. Meth. in
Enzymol. 68:326-331.
61. Grunstein, M., and D.S. Hogness. 1975. Colony
hybridization: A method for the isolation of
cloned DNAs that contain a specific gene. Proc.
Nat. Acad. Sci. 72:3961-396.
62. Southern, E.M. 1975. Detection of specific sequences
among DNA fragments separated by gel
electrophoresis. J. Mol. Biol. 98:503-517.
63. Guerry, P., D.J. LeBlanc, and S. Falkow. 1973.
General method for the isolation of plasmid DNA.
J. Bact. 116:1064-10.
64.Bunenann, H., and W. Muller. 1978. Base specific
fractionation of double stranded DNA: affinity
chromatography on a novel type of absorbant.
Nucl. Acid. Res. 5:1059-1074.


25
EDTA, 200 ul 2.5 M NH4 Acetate, 1 ul tRNA (20 mg/ml)
and then the DNA precipitated with 700 ul of ethanol at
-70C for 10 minutes.
2. 31 end-Labelling with Terminal Deoxynucleotydyl-
transferase (Tdt)
Purified mtDNA restriction fragments were 3 end-
labelled with Tdt according to the method of Tu and
Cohen (67). The DNA was added to 100 uCi of Cordycepin
32
5' triphosphate [ P] (3000 Ci/mM Amersnam) in a 20 ul
reaction volume containing 25 mM Tris, pH 7.0, 100 mil
Potassium cacodylate, 1.0 M CoCl^, and 0.2 mM DTT.
After adding 12 units of Tdt (BRL) the mixture was
incubated at 37C for 30 minutes and the reaction
stopped by the addition of 2 ul 0.5 M EDTA, 200 ul NH^
Acetate, 2 ul tRNA (10 mg/ml). The DNA was then
precipitated with 700 ul of ethanol at -70 for
10 minutes.
3. 3' end-labelling with large fragment of E. coli
Polymerase I
Restriction fragments were incubated in 50 ul 20 mM
Tris-HCl pH 7.4, 7 mM MgCl2, 100 mM KC1, 1 mM DTT,
100 ug/ml gelatin with 50-100 uCi 22P-d-GTP
(3000 Ci/mM) for Bam HI or Hae III sites. After adding
2 units of Large Fragment Pol I (BRL) the reaction was
left at room temperature for no more than 5 minutes and


Page
D-Loop Region Sequence of a Holstein Cow Outside
the H15 Lineage 48
D-Loop Sequences of Cattle of Breeds Other Than
Holstein 49
D-Loop Region Sequence Comparisons of Animals
of the'Order Artiodaclyla, Family Bovidae ... 50
Mapping of D-Loop Strand of Bovine mtDNA 55
CHAPTER IV. DISCUSSION 63
Origin of mtDNA Variation 63
A Limited Number of Maternal Molecules Determine
the Mitochondrial Genotype 66
Gene Conservation as a Possible Explanation of
D-Loop Sequence Variation Among Holstein Cows 67
Conclusion 73
APPENDIX 74
REFERENCES 76
BIOGRAPHICAL SKETCH 84
v


60
MAPPING OF 3' TERMINI OF THE D-LOOP
*
*
I
Cut with Sau 3A or Rsa I
*
1
7M Urea, 4% Acrylamide Denaturing Gel
or
7M Urea, 20% Acrylamide Sequencing Gel


Abstract of Dissertation Presented to the Graduate Council
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
GENETICS OF THE ORIGIN OF REPLICATION
OF BOVINE MITOCHONDRIAL DNA

By
Paul Olivo
August, 1982
Chairman: William W. Hauswirth
Major Department: Immunology and Medical Microbiology
The nucleotide sequence of the D-loop region of
mitochondrial DNA from maternally related Holstein cows was
determined. First, four distinct mitochondrial genotypes
have been identified. Second, the pattern of occurrence of
these genotypes reveals multiple genotypic shifts. Third,
the four genotypes have identical D-loop regions except at
four bases, such that each genotype represents a different
combination of base transitions at these four positions.
The published bovine mtDNA sequence is also identical in the
D-loop region except at these four positions, and thus is a
fifth bovine genotype.
Marked intraspecies mitochondrial DNA polymorphism is
thought to be related to strict maternal inheritance which
leads to maternally isolated gene pools within a breeding
population. However, our finding-of mtDNA polymorphism
x


Figure 5. Partial cleavage map and sequence
strategy of the D-Loop region.
Endonuclease sites employed during
sequencing are shown. The arrows
indicate the direction and length of
the fragments sequenced. The solid
circles indicate 5' end-labeled
fragments. All others were 3
end-labeled. The scale below
indicates base pairs.
I


55
differences (one deletion, two insertions, eleven
transversions, and twenty-one transitions) were noted out of
a total of 401 bases sequenced in this region of the D-Loop.
This represents an 8.6% sequence divergence as compared to
the 10% divergence seen between these animals in the
cytochrome b gene (K. Brown, personal communication). Thus,
these results are consistent with a 1.9% change in sequence
per million years divergence for a pair of species, assuming
an approximately five million year divergence between water
buffalo and cow (69) Unfortunately, no other D-Loop region
sequence comparisons between closely related species have
been done. It appears though, that this region is not more
variable than the rest of the genome, and is probably more
conserved. This is in line with D-Loop comparisons between
more distantly related species, i.e. human-cow (9) and
mouse-human (46) comparisons. This observation is important
to our interpretation of the origin of the variability we
observe in this region among Holstein cows (see discussion
below).
Mapping of D-Loop Strand of Bovine mtDNA
It has been shown that newly synthesized D-Loop strands
in animal mtDNA exist as families of species specific
discrete lengths (15,16,17). Human mtDNA D-Loop strands
show 5' heterogeneity but only one 3' termination point
(15). Mouse D-Loops have four 3' termination points, one of
which has two 5' starting points (17). We mapped the D-Loop


TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS iii
LIST OF FIGURES vi
ABBREVIATIONS USED viii
ABSTRACT x
CHAPTER I. INTRODUCTION 1
MtDNA Replication 3
Mitochondrial DNA Evolution 6
MtDNA Inheritance 9
Rationale 10
CHAPTER II. MATERIALS AND METHODS -14
Animals 14
Isolation of mtDNA 14
Construction of mtDNA Recombinant Plasmids .... 16
Isolation of Plasmid DNA 19
Rapid Isolation of Plasmid DNA 20
Restriction Enzymes 21
Agarose Electrophoresis 21
Southern Blotting 22
Radiolabelling mtDNA 22
Filter Hybridization and Autoradiography 23
Grustien-Hogness Blots 23
End-Labelling of mtDNA Fragments 24
Polyacrylamide Gel Electrophoresis 29
Extraction of Restriction Fragments from the
Acrylamide Gel 29
DNA Sequencing 29
CHAPTER III. RESULTS 31
Sequence of the mtDNA D-Loop Region of HI5
Holstein Cows 31
D-Loop Sequences of Other H15 Animals 38
Sequence of Clones of H1009B 42
Summary of Holstein mtDNA Sequence Data 45
IV


83
78. Oliver, N.A., and D.C. Wallace. 1982. Assignment of
two mitochondrial synthesized polypeptides to
human mitochondrial DNA and their use in the study
of intracellular mitochondrial interactions. Mol.
and Cell Biol. 2^(1):30-41.
79. Beattie, K.L., R.C. Wiegand, and C.M. Radding. 1977.
Uptake of homologous single-stranded fragments by
superhelical DNA. J. Mol. Biol. 116:783-803.


80
42. Avise, J.C., R.A. Lansman, and R.O. Shade. 1979. The
use of restriction endonucleases to measure
mitochondrial DNA sequence relatedness in natural
populations. I. Population structure and
evolution in the genus Peromyscus. Genetics
92:279-295.
43. Ferris, S.D., R.D. Sage, and A.C. Wilson. 1982.
Evi'dence from mt DNA sequences that common
laboratory strains of inbred mice are descended
from a single female. Nature 295:163-165.
44. King, B.O., R.O. Glade, and R.A. Lansman. 1981. The
use of restriction endonucleases to compare
mitochondrial DNA sequences in Mus musculus: A
detailed restriction map of mitochondrial DNA from
mouse L Cells. Plasmid. _5: 313-328.
45. Hauswirth, W.W., and P.J. Laipis. 1982. Variation in
bovine mitochondrial DNAs between maternally
related animals. In Mitochondrial Genes, eds.
Slonimski, P. Borst, P. and Attardi, G., Cold
Spring Harbor, New York, N.Y. in press.
46. Brown, W.M., E.M. Prager, A. Wang, and A.C. Wilson.
1982. Mitochondrial DNA sequences of primates:
tempo and mode of evolution of mitochondrial DNA.
J. Mol. Evol. in press.
47. Walberg, M.W., and D. A. Clayton, 1981. Sequences and
properties of the human KB cell and mouse L-cell
D-loop regions of mitochondrial DNA. Nucl. Acids
Res. 9_: 5411-5421.
48. Brown, W.M. 1981. Mechanisms of evolution in animal
mitochondrial DNA. Annals N.Y. Acad. Sci.
361:119-134.
49. Clayton, D.A., J.N. Doda, and E.C. Friedberg. 1974.
The absence of a Pyrimidine dimer repair mechanism
in mammalian mitochondria. Proc. Nat. Acad. Sci.
21:2777-2781.
50. Kunkel, T.A., and L.A. Loeb. 1981. Fidelity of
mammalian DNA polymerases. Science 213:765-767.
51. Allen, J.A., and M.M. Coombs. 1980. Covalent binding
of polycyclic aromatic compounds to mitochondrial
and nuclear DNA. Nature 287:244-245.
Francisco, J.F., G.G. Brown, and M.V. Simpson. 1979.
Further studies on types A and B rat mtDNAs:
Cleavage maps and evidence for cytoplasmic
inheritance in mammals. Plasmid 2:426-436.
52.


48
sequences, but no Lg D-Loop had the same four bases at
the four critical positions as the LL D-Loop sequence.
3. Two clones (91-1, 91-2) of H1009B had a single base
difference (C to T transition) in the D-Loop at
position" 16295 which distinguished it from one other
clone (91-3) of H1009B as well as all other LT and L
Li s
animals.
4. Among all the 615 D-Loop sequences, four positions
(16074, 16079, 16231 and 16250) appear to be variable
and all other bases sequenced are uniformly constant
(except for the one clonal difference noted above).
5. Of the sixteen possible combinations of these four
4
bases (2 assuming transitions only) four have been
observed and the sequence of Anderson et al. (9)
represents a fifth.
6. All mtDNA sequence differences between cows are base
transitions.
D-Loop Region Sequence of a Holstein
Cow Outside the H15 Lineage
H567 has no common ancester with H15 for over one
hundred years. The mtDNA of this animal is L according to
s
its Hae III restriction pattern (55) and thus had to have a
C at position 12792 in URF-5. The D-Loop region of the
mtDNA of this animal was sequenced from both cloned DNA and
liver tissue mtDNA (Figure 5). The D-Loop sequence of H567
is identical to H455, an L^ animal in the H15 lineage


66
Two potential sources of mtDNA variation within this
lineage are paternal mitochondria and some kind of effect of
nuclear genes. We have not analyzed the paternal
mitochondrial genotypes, but the frequency of genotypic
shifts which "We observe is not consistent with the total
lack of a paternal effect seen in matings in other animals
(33,35,42,52,53,54). An effect of maternal nuclear genes is
an interesting possibility which cannot be ruled out at
present.
A Limited Number of Maternal Molecules
Determine the Mitochondrial Genotype
We observe one of the HI5 lineage mitochondrial
genotypes outside the lineage (H567 has the same sequence as
H455). It is likely, therefore, that at least some of the
H15 genotypes existed prior to the start of the H15 lineage.
This possibility allows us to postulate that some of the
animals within the lineage are heterozygous for some of the
genotypes. If an animal (e.g. H333 in Figure 1) were
heterozygous for at least two genotypes, one need only
postulate that a minor genotype somehow became the
predominant genotype in only two generations. The logical
conclusion of this is that the mitochondrial genotype of the
progeny is the product of a limited number of maternal mtDNA
molecules by a process of clonal expansion of the minor
genotype. This is a much more attractive hypothesis than
having to propose that at least five mutational events
occurred and were fixed in only two generations.


24
filter was soaked in 1.5 M NaCI, 0.5 M Tris-HCl, pH 7.4, for
5 minutes and then dried on a vacuum manifold. The filter
was then treated with Proteinase K (Sigma) (2 mg/ml) in
1 x SSC for 20 minutes at room temperature and then rinsed
in 1 x SSC. "The filter was dried under a lamp until chalk
white and then dipped in chloroform for 2 minutes and dried.
After soaking in 2 x SSC for 2 minutes the filter was dried
for 2 hours at 80C in a vacuum oven. The filter was then
32
hybridized with a P-labelled probe as described above.
End-Labelling of mtDNA Fragments
MtDNA restriction fragments were end-labelled for
sequencing purposes by one of three procedures.
1. 5' end-labelling with T^ Polynucleatide kinase (PNK)
and 32P dATP
Polyacrylaminde gel purified fragments were treated for
15 minutes at 37C with 1 unit of Bacterial
Alkaline Phosphatase in 50 mM Tris-HCl pH 8.0. They
were then phenol extracted, ethanol precipitated, dried
and resuspended in 20 mM Tris-HCl pH 7.6, 1 mM
spermidine, 0.1 mM EDTA, 10 mM MgCl2, 5 mM DTT and
20 units of PNK in a volume of 20 ul. This reaction
mixture was added to vacuum dried 100 uCi
32
P-dATP (410 Ci/mM, Amersham Arlington Heights,
Ill.), and incubated for 30 minutes at 37C. The
reaction was stopped by the addition of 1 ul of 0.5 m


54
IfeoTV ¡o 71
ATGACCTCTATAGCAGTACATAATACATATAATTATTGACTGTACATAG
COW
A-GCGAT G TC-
WB
TACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTT
COW
CTA C C
WB
ACCATTAGATCACCGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC
COW
C G
WB
/
GCTAGGCAGGGATCCCTCTTCTCGCTCCGGGCCCATAAACCGTGGGGGT
COW
TTC GTTAT
WB
lbi.SC
CGCTATCCAATGAATTTTACCAGGCATCTGGTTCTTTCTTCAGGGCCAT
COW
A TT- A- -
WB
CTCATCTAAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGG
COW
TCT -
WB
ACTAATGGCTAATCAGCCCATGCTCACACATAACTGTGCTGTCATACAT
COW
T
WB
TTGGTATTTTTTTATTTGGGGGATGCTTGGACTCAGCTATGGCCGTCAA
COW
WB
AGGCCCTGACCCGGAGCATCTATTGTAGCTGGACTTAAC
COW
WB


CHAPTER I
INTRODUCTION
Mitochondria, the energy producing organelles of the
cell, are present in the cytoplasm of all aerobic eukaryotic
cells. The mitochondrion contains an inner and outer
membrane, its own protein synthesizing machinery, and its
own genetic information. It has been proposed that
mitochondria may have arisen by endosymbiosis of a primitive
eubacteria into a primitive eukaryote (for a critical review
see 1) .
Since the discovery of mtDNA (2), investigators have
recognized the utility of the mitochondrial genome as a
model system for understanding gene organization and control
in eukaryotic organisms. Much effort has concentrated on
the yeast system in which genetic markers have greatly
facilitated the analysis of the mitochondrial genome (for
review see 3). Much recent work has concentrated on
mammalian mtDNA (for review see 4,5). Advances in DNA
analysis (restriction enzymes, DNA cloning, and nucleotide
sequencing, etc.) have in many ways compensated for the lack
of genetic information about animal mitochondria.
1


Figure 6.
Sequence of the D-loop obtained from
cloned DNA from Hostein cows H493, H634
and H1009B. The L-strand sequence
(5'-3') is shown. The numbering system
is from Anderson et al. (9). At
positions 16074, 16078, 16231 and
16250 both of the bases noted from
different animals are shown (see text).


ABBREVIATIONS USED
A
adenine
BSA
bovine serum albumin
bp
base pair
C
cytosine
Ci
curie
cm
centimeter
cpm
counts per minute
dCTP
deoxycytidine triphosphate
dGTP
deixyguanidine triphosphate
dATP
deoxyadenosine triphosphate
D-loop
Displacement loop
DNA
deoxyribonucleic acid
E. coli
Eschericha coli
EDTA
ethylenediaminetetraacetic acid
g
Gravity
gms
grams
G
guanine
M
molar
ma
milliampere
mCi
millicurie
mg
milligrams
viii


URF-5
D-LOOP
*
-T-^ T-G
-C-\ T-A C A 2
C-A C G 3
a
b
c
d
e


26
stopped by addition of 2 ul 0.5 M EDTA, and heated to
60C for 10 minutes. After adding 200 ul 0.3 M Na
Acetate, the labelled DNA was ethanol precipitated at
-70C for 10 minutes.
Following end-labelling by any of the above protocols,
the strands of the fragment, labelled at both ends (either
both 3' or both 5' ends) were separated by incubation in
0.1 N NaOH for 10 minutes at room temperature or the
fragment cut with a second restriction enzyme. The products
were then separated by electrophoresis on a 6%
polyacrylamide gel (16 cm x 40 cm x 3 mM) at 200 V (20-40 m
A) for 12-16 hours. The gel was then exposed to cronex 4
X-Ray film (Dupont) for 1-4 hours.
Many of the sequences presented in this work were done
from cloned mtDNA insolated by the rapid isolation method
described above. A typical protocol was to restrict the DNA
of a 50 ml culture of an Eco RI A clone with Bam HI, and
32
Bgl II. These fragments were then labelled with P-GTP
and large fragment of E. coli Polymerase I. These 3'
end-labelled fragments were then cleaved with Hpa I, Pst I
and Cfo I, and then run on a 6% polyacrylamide preparative
gel, and analyzed by autoradiography. As Figure 3 shows
this yielded three well separated bands, two D-loop region
fragments, Bam HI-Hpa I and Bam HI-Pst I, and one URF-5
fragment, Bgl II-Cfo I, which were ready for sequencing (see
below).


I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Tilliam W.
Chairman
Associate Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Nicholas Muzyczka, Ph Assistant Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
^enneth I. Berns, M.). Ph.D.
Professor of Immunology and Medical
Microbiology


Figure 10.
Taxonomic tree of the Order
Artiodaclyla (from reference 70).


73
between highly divergent species such as human and cow (9)
and human and mouse (47) Gene conversion, involving the
D-Loop strand, would preserve conservation of this region.
Finally, this model circumvents the necessity of postulating
hypermutation at these four bases. Of course, mutation had
to generate the differences originally, but five simple
mutations (one in URF-5 and four in D-Loop) plus a series of
gene conversion evehts, could generate all the combinations
we have observed, plus any other theoretical combinations
which may appear in future studies.

Conclusion
Our data suggest that the well described phenomena of
rapid mtDNA evolution and significant intraspecies
polymorphism are closely tied to the molecular mechanism of
mtDNA inheritance. We believe that this mechanism allows
for rapid genotypic shifts in mtDNA, and thus, can lead to
mtDNA polymorphism among maternally related individuals.
Finally, a gene conversion model best explains the
variability we observe in the region of the mtDNA origin of
replication.


Figure 12. Mapping of 3' termini of D-loop strands
of bovine mtDNA. D-loop strands from
Fpjpn I mt DNA were labeled with Tdt and
p] codycepin and analyzed by 4%
Polyacrylaminde-7M Urea electrophoresis
and autoradiography. Lane A, [ p]
Cordycepin labeled Form I mt DNA
showing three major D-loop strand
species; Lane B, 3'-end-labeled D-loop
strands hybridized with 3' end labeled
complementary single stranded cloned
DNA, then cut with San 3A (^e Figure
13 for protocol); Lane C, [J p]
cordycepin labelled Hae II fragments of
pBR322 as size markers. Sizes are in
base pairs.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EDKMMLILN_DZASTX INGEST_TIME 2015-03-27T18:28:22Z PACKAGE AA00029771_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Edward J. Siden, Ph.D.
Assistant Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
This dissertation was submitted to the Graduate Faculty of
the College of Medicine and to the Graduate Council, and was
accepted as partial fulfillment of the requirements for the
degree of Doctor of Philosophy.
August, 1982
Dean for graduate Studies and
Research


4
These are replicative intermediates in which the newly
synthesized H-strand (7S DNA) displaces a segment of
parental DNA creating a triple-stranded structure
(Displacement loop or D-Loop). This 7S DNA has been shown
to exist as families of discrete lengths with human 7S mtDNA
exhibiting 5' heterogeneity (15,16) and mouse mtDNA having
both 5' and 3' heterogeneity (17). Robberson and Clayton
(18) have shown that as many as 80% of mtDNA molecules in
mouse L cells contain D-Loops. In vitro labelling of mtDNA
has shown that this newly synthesized segment is rapidly
displaced and resynthesized, and that very few D-Loop
molecules are fully elongated (19). Why is D-Loop synthesis
arrested at certain points and what signals allow for
elongation? Clayton has proposed a template stop signal
hypothesis based upon a 15 nucleotide consensus sequence
which occurs in both the human and mouse D-Loop region (17).
Confirmation of this concept awaits analysis in other
species (see results). The prevalence of D-Loop structures
among mtDNA molecules may relate to transcriptional control,
since the putative promotor of transcription resides in the
D-Loop region (20) It is also possible that the process of
making and remaking D-Loops allows for more precise control
of mtDNA replication, i.e., at the level of elongation
rather than initiation.
Recently, protein or protein-membrane fragments have
been observed associated with the origin of replication of
HeLa cell mtDNA (21). However, the enzymes involved in


23
7
2 x SSC. Specific activities of 1-5 x 10 cpra/ug DNA were
obtained.
Filter Hybridization and Autoradiography
Hybridization of the radioactive mtDNA fragments
transferred to nitrocellulose was done by a modification of
the method of Denhardt (66). The nitrocellulose filters
were pre-hybridized*in 6 x SSC, 0.08% ficoll, 0.08%
polyvinylpyrolidine, 0.02% BSA, in a 100 ml volume for
6 hours at 68C. The filters were then hybridized in the
32
same solution plus tRNA (50 ug/ml) to a P-labelled mtDNA
probe (10 ng/ml) (denatured by boiling 10 minutes and
quick-chilling on ice) for 16-24 hours at 68C. Following
the hybridization the filters were washed at room
temperature in the prehybridization solution for one hour,
in 0.1 M KPO^ for one hour, in 1 x SSC 0.6% SDS twice for
one hour each time, and finally rinsed in 1 x SSC. The
filters were dried at 80C in a vacuum oven and exposed to
XAR-5 Kodak X-Ray film in a light tight cassette for l-3d at
-70 C.
Grunstein-Hogness Blots
Bacterial colonies were screened for the presence of
mtDNA by a modification of the Grunstein-Hogness procedure
(61). The filter was then soaked in 0.5 N NaOH for
7 minutes, equilibrated in 1 M Tris-HCl pH 7.4 for 1 minute,
and then in fresh 1 M Tris-HCl, pH 7.4 for 5 minutes. The


45
sequences (Figure 7). However, two other clones (91-1 and
91-2) of H1009B differ from all other sequences by a
C to T transition at position 16295 (Figure 9). This
represents the only difference between clones derived from
one animal reported in this work. Two types of mtDNA
molecules, differing by one base in the D-Loop region,
appear to have been cloned from one animal. Of course,
analysis of many mote clones of H1009B as well as sequence
of tissue mtDNA is necessary to confirm this result.
However, if it holds up, this observation is direct evidence
for heterozygosity of the mtDNA of the somatic cells of
H1009B.
Summary of Holstein mtDNA Sequence Data
Figure 8 shows a comparison of all the sequences of
mtDNA of Holstein cows described in this work. Below is a
summary of the data on the H15 lineage.
1. Clones of nine LL animals (whose mtDNA has a T at
position 12792 in URF-5) have the same D-Loop region
sequence at least over the bases sequenced (Figure 8).
2. Clones of Lg animals (whose mtDNA as a C at position
12792 in URF-5) exhibited three types of D-Loop
sequences characterized by identical sequences except
for various combinations of transitions at position
16074, 16078, 16231, and 16250 (Figure 8). At all
other bases the L sequences were the same as the L
S Xj


This dissertation is
dedicated to my wife,
and best friend, Kathy.


Figure 8. Schematic of sequence of URF-5 and
D-loop of mtDNA. Lines indicate
identity. D-loop regions sequenced are
shown in Figure 5. a, b, c, d, e,:
positions 12792, 16074, 16079, 16231,
and 16250, respectively. 1. H496,
H501, H737B, H997B, H512, H576, H709,
H634 and H1009B. 2. H455.
3. Sequence of Anderson et al. 4.
H949B. 5. H493, H624, and H393.
6. J49 (Jersey) and H992B (Guernsey).


Figure 13. Schematic of strategy for mapping 3'
termini of the D-loop. 3' end-labeling
of the D-loop strands was according to
Tu and Cohen (67). The complementary
strand to which the D-loop strands were
annealed was a Bam-Pst fragment from
cloned mt DNA which was 3' end-labeled
at the Bam HI site wii^h large fragment
of Polymerase I and p-GTP and then
isolated by strand separation on a
6% Polyacrylamide non-denaturing gel
(see materials and methods).


75
H997B
II
90-1
II
H512
Holstein/H15
32-8
II
H576
II
576G
II
H709
II
709F
II
H393
II
87A
II
H567
Holstein/H3
43-5
pBR322/Bam HI C
H992B
Guernsey/L214
78-17
II
7 OH
Angus/
80-17
II
J49
Jersey/59UF
94-4
II
water
buffalo
N/A
WB-1
pBR322/Bam HI D -
If
N/A
WB-17
pBR322/Bam HI C + D


47
URF-5
D-LOOP'
~ T^ T G T A C-i
a
T A T-2
d e f


42
sequenced in this region. Therefore, we have identified an
Ll genotype represented in all nine animals analyzed.
The situation with regard to the Lg animals is more
complicated. Two animals, H624, the daughter of H493 and
H393, had the' identical sequence to H493 in the D-Loop
region. However, as Figure 8 shows, H455 and H949B each had
a different combination of bases at the four critical
positions in the D-Loop (16074, 16079, 16231 and 16250) at
which all animals differ from H493. No other base
differences were noted among these animals. Thus, at least
three Lg genotypes have been documented within the H15
maternal lineage.
The uniqueness of these observations necessitated
ruling out an artifact of cloning. Therefore, the D-Loop
region was sequenced from mtDNA isolated from liver tissue
of H455. The sequence derived is identical to the sequence
of the clone of H455 (24-7) in a region which spans the four
variable positions (16974, 16079, 16231 and 16250). This
result, plus the fact that all clones from one animal are
the same (for one exception see below), supports the concept
that the differences we observe do represent various
genotypes, and are not artifacts of the cloning process.
Sequence of Clones of H1009B
One clone (91-3) of H1009B, an animal, has a D-Loop
region sequence which is identical to all other LT D-Loop
j


Figure 2. The restriction endonuclease map of
mitochondrial DNA from Holstein cow
H493. The maximum error in map
positions is 0.3 map units (57).


CO /
CYT B


ml
milliliters
mM
millimolar
mm
millimeter
uCi
microcurie
ug
micrograms
ul
microliter
um
micromolar
mt
mitochondria
mtDNA
mitochondrial DNA
MSB
mannitol, sucose buffer
ng
nanograms
32
P
phosphorus 32
RNA
ribonucleic acid
RNase
ribonuclease
rpm
revolutions per minute
rRNA
ribosomal ribonucleic acid
SDS
sodium dodecyl sulfate
SSC
standard saline citrate
tRNA
transfer ribonucleic acid
V
volts
IX


82
65. Rigby, P.W., M. Dieckmann, C. Rhodes, and P. Berg.
1977. Labelling DNA to high specific activity in
vitro by Nick-translation with DNA polymerase I.
J. Mol. Biol. 113:237-251.
66. Denhardt, D.T. 1966. A membrane-filter technique for
the detection of complementary DNA. Biochem.
Biophys. Res. Comm. 23:641-646.
67. Tu, C.D., ai^ S. Cohen. 1980. 3' End-labelling of DNA
with i ZP] cordycepin-5-triphosphate. Gene
10:177-183.
68. Maxam, A.M., and W. Gilbert. 1980. Sequencing
end-labelled DNA with base specific chemical
cleavages. Meth. Enzymol. 65:499-560.
69. Sinclair, A.R.E. 1977. The African Buffalo. Univ.
Chicago Press, Chicago, Ill.
70. Grzinek, B. 1972. Animal Life Encyclopedia. Van
Nostrand Rienhold. New York, N.Y.
71. Birky, C.W., Jr. 1973. On the origin of mitochondrial
mutants: Evidence for intracellular selection of
mitochondria in the origin of antibiotic-resistant
cells in yeast. Genetics 74:421-432.
72. Birky, C.W. 1978. Transmission genetics of
mitochondria and chloroplasts. Ann. Rev. Gen.
12:471-512.
73. Hauswirth, W.W., and P.J. Laipis. 1982. Mitochondrial
DNA polymorphism in a maternal lineage of holstein
cows. Proc. Nat. Acad. Sci. in press.
74. Eddy, E.M. 1975. Germ Plasm and the differentiation
of the germ cell line. Int. Rev. Cyt. 43:229-275.
75. Friend, J.B. 1978. Cattle of the World. Blanford
Press, Dorset, England.
76. Radding, C.M. 1978. Genetic Recombination. Ann. Rev.
Biochem. 47:847-880.
77. Honda, S.I., T. Hongladaron, and S.G. Wildman. 1964.
Characteristic movement of organelles in streaming
cytoplasm of plant cells. In Primitive Motile
Systems in Cell Biology, eds. Allen, R.D. and
Kamiya, N. 485-509 Academic Press, New York, N.Y.


12
H15
LH709*


15
For experiments analyzing the 7S DNA of the D-Loop,
fresh brain tissue was used. An entire bovine brain
(approx. 300 grams) was minced with an electric knife in
1 ml/gm MSB-Ca++ (0.21 M Mannitol, 0.07 M Sucrose, 0.05 M
Tris-HCl pH 7.5, 0.003 M CaC^) The chopped tissue was
strained through gauze and homogenized in a ground glass
40 ml homogenizer. It was then subjected to five strokes
through a dounce hoinogenizer. Sodium EDTA was added to a
final concentration of 10 mM and the homogenate was
centrifuged at 700 g for 5 minutes. The supernatant was
saved and again centrifuged at 700 g. The supernatant was
then centrifuged at 20,000 g for 20 minutes and the crude
mitochondrial pellet was resuspended in MSB-EDTA and
centrifuged again at 20,000 g for 20 minutes. The
mitochondrial pellet was resuspended in 0.1 M NaCl, 0.05 M
Tris-HCl pH 7.5, 10 mM EDTA, lysed with 1% SDS, and
immediately subjected to Cesium-chloride-Ethidium bromide
buoyant density centrifugation at 160,000 g for 72 hours.
The form I band, visualized under ultraviolet light, was
collected and the ethidium bromide was removed by extraction
with N-butanol saturated with 5 M NaCl followed by ethanol
precipitation to desalt and concentrate the sample. An
aliquot was checked for purity by electrophoresis on 1%
agarose and staining with ethidium bromide.


CHAPTER III
RESULTS
Sequence of the mtDNA D-Loop Region of H15 Holstein Cows
All sequences presented, unless stated otherwise, were
determined from cloned DNA and are Light Strand sequences.
Clones which contained D-Loop region sequences included
Pst I A clones, Bam HI A clones, Bam HI C clones and Eco RI
A clones (Figure 4). Almost all 912 nucleotides between the
Proline and Phenylalanine tRNA genes were determined from
cloned DNA of three animals, H493 an Lg animal, and H634-and
H1009B, L^ animals (Figure 1). Figure 5 shows the
restriction enzyme sites used for sequencing and the
direction sequenced. Figure 6 shows the actual nucleotide
sequence of the D-Loop region as determined from cloned
mtDNA of these animals. Our sequence is virtually identical
to the sequence of Anderson et al. (9) except for four
transitions at position 16074, 16079, 16231 and 16250 using
the numbering system of Anderson et al. (9) which will be
used throughout this work. The sequence of clones of H493
differs from the sequence of clones of H634 and H1009B at
all four of these positions, but the sequence of each animal
differs from the sequence of Anderson et al. (9) at only
31


ORDER
SUBORDER INFRAORDER SUPERFAMILY FAMILY
SUBFAMILY
GENUS SPECIES CQMON
-TYLOPODA-
ARTIODACTYL
(even-toed
ungulates)
rNONRUMINATIA-
-SUOIDEA-
rSUIDAE
(OLD WORLD pigs)
TAYASSUIDAE
-ANTHRACOTHERIOIDEA HIPPOPOTAMIDAE
v
rTRAGULINA-
RUMINANTIA-
lPECORA-
- CAMELIDAE
(CAMELS & LLAMAS)
-TRAGULIDAE
(CHEVROTAINS)
rCERVIDAE
(deer)
GIRAFFIDAE
BOVIDAE
-ANTILOCAPRIDAE
r-ARNEE
PBUBALUsJ
rCEPHALOPHINAE
-NEOTRAGINAE
-TRAGELOPHINAE
BOVIDAE
-ALCELAPHINAE
-HIPPOTRAGINAE
-REDUNCINAE
-ANTI LOPINI
-CAPRINAE LnicnM
(SHEEP & GOATS)^1S0N
lSAIGINAE
rSYNCERUS
-AFRICAN
BUFFALO
WATER
BUFFALO
-BOS-
LDEPRESSICORNIS
rGAURUS
-JAVANICUS
-SALIVE LI
-TAURUS OX
DOMESTIC
-INDI CUS-OX
DOMESTIC
L-INimJS-
rBISON -
YAK
AMERICAN
BUFFALO
-BONASUS EUROPEAN
BUFFALO


78
20. Battey, J. and D.A. Clayton. 1978. The transcription
map of mouse mitochondrial DNA. Cell 14;143-156.
21. De Francesco, L., and G. Attardi. 1981. In situ
photochemical crosslinking of HeLa cell
mitochondrial DNA by a psoralen derivative reveals
a protected region near the origin of replication.
Nuc. Acids. Res. 9^:6017-30.
22. Kalf, G.F., and S.S. Ch'ih. 1968. Purification and
properties of DNA polymerase from rat liver
mitochondria. J. Biol. Chem. 18:4904.
23. Bertazzoni. E., A.I. Scovassi, and G.M. Brun. 1977.
Chick-embtyo DNA polymerase. Eur. J. Biochem
8_1: 237-248.
24. Bogenhagen, D., and D.A. Clayton. 1977. Mouse L-cell
mitochondrial DNA are selected randomly for
replication throughout the cell cycle. Cell
11:719-727.
25. Chase, J.W., and I.B. Dawid. 1972. Biogenesis of
mitochondria during xenopus laevis development.
Dev. Biol. 27:504-518.
26. Piko, L., and L. Matsumoto. 1976. Number of
mitochondria and some properties of mitochondrial
DNA in the mouse egg. Dev. Biol. 49:1-10.
27. Dawid, I.B. 1972. Evolution of mitochondrial DNA
sequences in Xenopus. Dev. Biol. 29:139=151.
28. Brown, W.M., M. George, and A.C. Wilson. 1979. Rapid
evolution of animal mitochondrial DNA. Proc. Nat.
Acad. Sci. U.S.A. 76:1967-1971.
29. Potter, S.S., J.E. Newbold, C.A. Hutchinson, III, and
M.H. Edgell. 1975. Specific cleavage analysis of
a mammalian mitochondrial DNA. Proc. Nat. Acad.
Sci. U.S.A. 72:4496-4500.
30. Francisco, J.F., and M.V. Simpson. 1977. The
occurrence of two types of mitochondrial DNA rat
populations as detected by Eco RI endonuclease
analysis. FEBS. Lett. 79:291-294.
Buzzo, K., D.C. Fouts, and D.R. Wolstenholme. 1978.
Eco RI cleavage site variants of mitochondrial DNA
molecules from rats. Proc. Nat. Acad. Sci. U.S.A.
75:909-913.
31.


79
32. Ramirez, J.L., and I.B. Daniel. 1978. Mapping of
mitochondrial DNA in Xenopus laevis and Xenopus
barealis: The positions of ribosomal genes and
D-loops. J. Mol. Biol. 119:133-146.
33. Hayashi, J.L., H. Uanekawa, 0. Gotoh, J. Motohashi, and
U. Tagashira. 1978. Two different molecular
types of rate mitochondrial DNAs. Biochem.
BiOphys. Res. Comm. 81;871-877.
34. Kroon, A.M., W.M. deVas, and H. Bakker. 1978. The
heterogeneity of rat-liver mitochondrial DNA.
Biochem. Biophys. Acta. 519:269-273.
35. Shah, D.M., and C.H. Langley. 1979. Inter- and
intraspecific variation in restriction maps of
Drosophila mitochondrial DNAs. Nature
281:696-699.
36. Brown, W.M. 1980. Polymorphism in mitochondrial DNA
of humans as revealed by restriction endonuclease
analysis. Proc. Nat. Acad. Sci. U.S.A.
77:3605-3609.
37. Nass, M.M.D. 1981. Restriction Endonuclease analysis
of mitochondrial DNA from virus-transformed, tumor
and control cells ofhuman, hamster and avian
origin. Biochem. Biophys. Acta. 655:210-220. -
38. Upholt, W.B., and I.B. Dawid. 1977. Mapping of
mitochondrial DNA of individual sheep and goats.
Rapid evolution in the D-loop. Cell. 11:571-583.
39. Hayashi, J.I., 0. Gotoh, and Y. Togashira. 1981.
Length Polymorphisms of Restriction Fragments of
Rat Mitochondrial DNAs. Biochem. Biophys. Res.
Comm. 98:936-941.
40. Brown, G.G., and M.V. Simpson. 1981. Intra- and
interspecific variation of the mitochondrial
Genome in Rattus norvegicus and Rattus rattus:
Restriction enzyme analysis of variant
mitochondrial DNA molecules and genetics,
Genetics, 97:125-143.
41. Goodard, J.M., J.N. Masters, S.S. Jones, W.D. Ashworth,
and D.R. Wolstenholme. 1981. Nucleotide sequence
variants of Rattus norvegicus mitochondrial DNA.
Chromosma. 82:592-609.


38
two of the four positions (Figure 7). The pattern of
occurrence and significance of these base transitions is
discussed below.
Anderson et al. (9) compared the human and bovine
D-Loop region nucleotide sequence and confirmed the previous
observation of the marked divergence in this stretch of DNA
in the mammalian mitochondrial genome. They did note,
however, eleven blocks of homology mainly confined to the
region of the 7S DNA, i.e. in the middle of the D-Loop
region. All four of the differences we have observed occur
in the middle of the D-Loop region, within the confines of
the 7S DNA which we have mapped (see results below). Three
of the differences are in conserved blocks (H, I and E,
see 9), but only two are bases conserved between human and
cow. The importance of the specific positions involved, if
any, is unclear, but the fact that the differences all occur
within the region of the 7S DNA may be an important
observation (see discussion below).
D-Loop Sequences of Other H15 Animals
Figure 1 shows the pedigree of the H15 maternal lineage
of Holstein cows. As mentioned previously, it had been
shown (55) that animals within the lineage fall into two
types, those whose mtDNA has a C at base 12792 in URF-5 (L
s
animals) and those whose mtDNA has a T at base 12792 in
URF-5 (L^ animals). In comparing the nucleotide sequence of


67
The clonal expansion hypothesis is supported by the
observation that the number of mitochondria is amplified
during mammalian oocyte development. Mature mouse oocytes
contain 100-1000 times as much mtDNA as a somatic cell (25)
and about a fDO fold increase occurs in bovine oocytes (G.S.
Michaels, personal communication). All one needs to
postulate is that a limited number of mtDNA template
molecules fuel the amplification process. It is easy to
envision, by this mechanism, how a shift in the
mitochondrial genotype could occur in a short time (e.g. one
generation), if the minor genotype was chosen as the
template molecule. Admittedly, it is difficult to conceive
how a molecule that represents 5% or less of the total
number could replicate and be amplified at the total expense
of a molecule that represents 95% of the total. However, if
the amplification of the minor genotype occurred only in
that area of the oocyte destined to become germ cells (the
germinal plasm, see 74), then the genotype in the germ cells
of the offspring would differ from the maternal genotype.
Then the somatic cells of the product of fertilization of
those germ cells would display a mitochondrial genotype
different from their maternal grandparent, and a genotypic
shift in two generations would be observed.
Gene Conversion as a Possible Explanation of D-Loop
Sequence Variation Among Holstein Cows
By whatever mechanism it occurs, mtDNA variation within
a maternal lineage of cows represents another level of


Pst I
Pro t RNA
<-
AAGACjTCAAGGAAGAAACTGCAGTCTCACCATCAACCCCCAAAGCTGAAGTTCTATTTAAACTATTCCCljGAACACTATTAATATAGTTCCATAAATACAAAGAGCCT
15810
TATCAGTATTAAATTTATCAAAAATCCCAATAACTCAACACAGAATTTGCACCCTAACCAAATATTACAAACACCACTAGCTAACATAACACGCCCATACACAGACCA
15910
CAGAATGAATTACCTACGCAAGGGGTAATGTACATAACATTAATGTAATAAAGACATAATATGTATATAGTACATTAAATTATATGCCCCATGCATATAAGCAAGTAC
160 10
T G
ATGACCTCTATAGCAGTACATAATACATA AATT TTGACTGCACATAGTACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTTACCATTAGAT
C A I1T 161 10
Bam HI _
cacgagcttaattaccatgccgcgtgaaaccagcaacccgctggcagc/gatccctcttctcgctccgggcccataaa cgtgggggtcgctatccaatgaattttac
,62,o C G
CAGGCATCTGGTTCTTTCTTCAGGGCCATCTCATCTAAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGGACTAATGGCTAATCAGCCCATGCTCACACA
16310 I 10
TAACTGTGCTGTCATACATTTGGTATTTTTTTATTTTGGGGGATGCTTGGACTCAGCTATGGCCGTCAAAGGCCCTGACCCGGAGCATCTATTGTAGCTGGACTTAAC'
110
TGCATCTTGAGCACCAGCATAATGATAAGCATGGACATTACAGTCAATGGTCACAGGACATAAATTATATTATATACCCCCCCTTCATAAAAATTTCCCCCTTAAATA
21 0
TCTACCACCACTTTTAACAGACTTTTCCCTAGATACTTATTTAAATTTTTCACGCTTTCAATACTCAATTTAGCACTCCAAACAAAGTCAATATATAAACGCAGCCCC
' 310 t u T
Hpa I
CCCCCCCCC^TTGATGTAGCTTAACCCAAAGCAAGGCACTGAAAATGCCTAGATGAGTCTCCCAACTCCATAAAC/jcATAGGTTTGGTCCCAGCCTTCCTGT^AACTC
PhetRNA 4,0 I2s r.RNA
D-LOOP TEMPLATE STRAND
(5 >3)
U)


13
mutations would have to have occurred. A more likely
hypothesis, which we proposed, was that at least two mtDNA
genotypes existed within this lineage. This is the
hypothesis upon which the present work was predicated. We
decided to look for other differences in the mtDNA of
animals in the H15 lineage which might be linked to the
Hae III difference. We chose to sequence the D-Loop region
since, as mentioned*above, it has been shown to be one of
the least conserved regions of the mitochondrial genome of
animals. This work presents comparisons of the nucleotide
sequence of the D-Loop region of many animals within the H15
lineage as well as several other animals outside this
lineage. The results described below have broad
implications toward our understanding of how mtDNA variation
is generated, and how the mitochondrial genome is inherited.


28


72
structure would be created with four mismatched bases (see
Figure 15). These mismatched bases could then be
recognized, excised randomly on either strand, and then
repaired by a mechanism analogous to that described for both
E. coli and mammalian cells (76). The product of this
process would then be identical to the recipient parental
molecule except within the D-Loop, where the sequence would
a
be a hybrid between the two genotypes at the four bases
where the two genotypes differ. Of course, this same
process could operate when the genotypes differed at only
some of the four bases and also, the product of such a
process could regenerate the parental genotype.
This gene conversion model has several attractive
features. First, it is not without plausibility; there were
at least several genome copies per mitochandrion (56), there
is evidence that mitochondria fuse (77) and recently
heterozygous mitochondria have been described (78). Second,
strand invasion is a well studied phenomenon (79) and D-Loop
strands could conceivably be present in physiologically
significant amounts to allow such a process to occur.
Third, mismatch repair is believed to be a mechanism for
repairing DNA synthesis error and thus associated with the
replication complex (76). Fourth, this model, in addition
#
to explaining the variability we observe in the D-Loop,
would also help explain the significant conservation noted
in this region of the D-Loop. As mentioned above, the
middle of the D-Loop is as conserved as ribosomal genes


22
Southern Blotting
DNA electrophoresed into 1% agarose was transferred to
nitrocellulose by a procedure modified from Southern (62).
The DNA was denatured in situ by immersion in 1 M KOH for
30 minutes followed by neutralization by the addition of 1 M
Tris-HCl, pH 7.0, for 40-60 minutes or until the pH was
stable at 7.0. The gel was soaked for 45 minutes in
6 x SSC, pH 7.4 and*placed beneath a nitrocellulose filter
cut to the size of the gel. After blotting overnight with
absorbant paper to transfer the DNA to the filter, the
filter was washed in 2 x SSC and baked for 2 hours at 80C
in a vacuum oven.
Radiolabelling mtDNA
MtDNA or cloned mtDNA was labelled with 32P-dCTP
(specific activity 400 Ci/mMole, Amersham Corp., Arlington
Heights, Ill.) by a modification of the procedure of Rigby
et al. (65). One-half to one ug of DNA was incubated in 50
mM Tris-HCl pH 7.4, 5 mM MgCl2, 10 mM 2-ME, 10 ug B5A,
0.2 mM each of dGTP, dATP and dTTP, 20 mCi -32P-dCTP
( 400 Ci/mM), 1 ng pancreatic DNase (Worthington) 1 unit of
E. coli DNA polymerase I (BRL) in a total volume of 100 ul
for 4 hours at 15C. The reaction was stopped by the
addition of 10 mM EDTA, 20 ug tRNA (Sigma), and 200 ul 0.3 M
3 2
Na Acetate. The unincorporated P-dCTP was removed by two
cycles of ethanol precipitation of the DNA or by passing the
DNA over a G-50 Sephadex (Pharmacia) column (0.5 x 5 cm) in


64
therefore, to see how strict maternal inheritance maintains
any variation in mtDNA that might arise within a female
member of a species. The evidence for maternal inheritance
is strong (33,35,42,52,53,54), and there is no reason to
dispute its contribution to the phenomenon of intraspecific
variation. However, this concept is not necessarily
contradictory to our observation of mtDNA variation within a
maternal lineage. MtDNA variation between maternally
related animals may, in fact, represent another level of
polymorphism of mtDNA within a species.
The major question that needs to be dealt with in
understanding mtDNA variation is: how does a variant
molecule become the predominant type of mtDNA within an
organism? The conceptual difficulty lies, of course, with
' 3
the high ploidy of the micochondrial genome, i.e. 1-4 x 10
genome copies per cell (56). Birky (71,72) has dealt with
this issue in the yeast system in which a random segregation
model appears to adequately fit the data. Given a
sufficient number of cell generations there is a finite
probability that a mutant can become the predominant
genotype. Of course, if the mutant offers a selective
advantage to the organism (e.g. antibiotic resistance) the
number of generations it would take to establish the mutant
would be reduced. Certainly though, not all mtDNA mutants
which become fixed have a selective advantage. Otherwise
the rate of mtDNA evolution would be much slower than the
observed rate.


BIOGRAPHICAL SKETCH
Paul David Olivo, the fourth of eleven children of S.
William and Jane C. Olivo, was born on August 30, 1950, in
*
Boston, Massachusetts. He attended St. Francis Xavier High
School in Concord, Mass., from 1964-1968. He attended
Villanova University from 1968 to 1970 and in 1972, received
a Bachelor of Arts in anthropology from the George
Washington University. In 1974 he began graduate studies at
the University of Florida in the Department of Immunology
and Medical Microbiology. In June 1981 he received an M-.D.
degree from the University of Florida College of Medicine.
Upon completion of graduate school, he will enter a
Residency training program in Internal Medicine at the
University of Wisconsin, Madison, Wisconsin.
84


8
RNA polymerases or other DNA binding proteins). Other
regions of the D-Loop, however, may be involved in functions
which do not depend upon a specific nucleotide sequence.
Alternatively the species-specific nature of certain regions
of the D-Loop' might relate to an interaction with the
nuclear genome. Thus coevolution between the nuclear and
mitochondrial genomes might explain the observed
evolutionary leaps.*
There is suggestive evidence for a high mutation rate
in mtDNA (28,48). Mitochondria have been shown to lack
certain repair functions (49) and polymerase is possibly
the most error-prone DNA polymerase (50). Thus, a high rate
of mtDNA turnover, coupled with an error-prone replication
system, and poor editing functions, could result in a high
mutation rate. Furthermore, mtDNA are possibly exposed to
mutagenic oxidation products, and chemical carcinogens have
been suggested to be preferentially associated with mtDNA
(51). Therefore, a high rate of mutational events and a
high fixation rate are probably both operating to explain
the high evolutionary rate of mtDNA.
It is clear that the mitochondrial genome is an
excellent system with which to study the molecular basis of
evolution. However, sequence comparisons between highly
divergent species such as human, mouse and bovine suffer
from a saturation effect whereby multiple substitutions at
the same position mask the true rate of change (28).
Therefore, to precisely analyze the dynamics of the


Pst I
35
5
->
Clone
11-1
11-1
11-2
11-3
>- >- 5 <
*
>-
<
91-1
91-1
91-2
91-3
95-85
95-3
95-87
95-13
95-P
- 22-1
-6 87-A
* 5*
24-7 -
M24
35-3
35-H
43-5
M43
<
*-
<
<-
<
<-
-K-
33-1
709F
32-8
9A-1
576G
86-1
90-1
78-7
80-17
94-4
WB-1
WB-17
200
400
600
800


UNIVERSITY OF FLORIDA
l m ni inn i'" n c
3 1262 08554 7866


APPENDIX
ANIMALS AND
CLONES USED IN
THIS STUDY
Animal
Breed/Lineage
Clone
Vector/mt Fragment
H493
Holstein/H15
11-1
pBR322/Pst I A
II
II
11-2
II
II
II
11-2
pACYC 184/Eco RI A
II
II
11-3
pBR322/Pst I A
H1009B
II
91-1
II
II
II
91-2
II
II
II
91-3
pACYC 184/Eco RI A
H634
II
95-P
II
II
II
95-3
PBR322/Bam HI C
II
II
95-6
II
II
II
95-13
II
II
II
95-85
II
II
II
95-87
II
H624
II
22-1
PACYC 184/Eco RI A
H501
II
86-1
II
H949B
II
35H
II
II
II
35-3
PBR322/Bam HI A
H455
II
24-7
PACYC 184/Eco RI A
H496
II
33-1
II
H737B
II
9A-1
It
74


71
Ls
C


19
identified by autoradiography. Plasmid DNA isolated from
positive colonies was then screened by restriction enzyme
analysis and electrophoresis of the fragments on 1% agarose.
In some cases, the agarose gels were blotted onto
. 32
nitrocellulose (62) and hybridized to P-labelled mtDNA
followed by autoradiography. The same basic protocol was
used to clone Bam HI mtDNA fragments into pBR322, and Eco RI
fragments into pACYtl84, except tht Bam HI clones were
screened for ampicillin resistance and tetracycline
sensitivity and Eco RI clones were screened for tetracycline
resistance and chloramphenical sensitivity.
Isolation of Plasmid DNA
Recombinant plasmid DNA containing mtDNA was isolated
from one liter cultures by a modification of the method of
Guerry et al. (63). Cultures were grown at 37C in Luria
broth containing the appropriate antibiotic to a Klett unit
of 90-110, and then preferential replication of plasmid DNA
was induced by the addition of chloramphenicol (170 ug/ml)
to the medium. Cultures were then grown an additional
16-20 hours. The cells were then pelleted at 1000 g, washed
with cold 10 mM NaCl and resuspended in 6 ml 0.9% Glucose,
20 mM MEDTA, 20 mM Tris-HCl pH 8.0. Fresh lysozyme
(2 mg/ml) was added and the cells were kept on ice
30 minutes. Then 12 ml of 0.8% NaOH, 1% SDS was added while
gently mixing to lyse the cells. Nine milliliters 3 M
Potassium Acetate, pH 4.8, was added and the solutions mixed


65
In trying to fit a random segregation model to animal
mtDNA, there are several problems with which we must deal.
From the time a mutant arises, until the time it becomes the
predominant genotype, heterozygosity at a significant level
must exist. "Significant heterozygosity has not been
observed in the mtDNA from an individual animal (29), though
we have observed minor amounts of heterozygosity in the
somatic cells of an*individual animal (T.L. Armstrong,
personal communication). It could be argued that the
gradual shift from one genotype to another, which a random
segregation model predicts, only occurs in germ line cells,
and not in somatic cells. However, if this process (i.e.
gradual shift from one genotype to another by random
segregation during cell division) takes more than one animal
generation, by what mechanism can oocyte heterozygosity be
maintained in the presence of somatic cell homozygosity?
Hauswirth and Laipis (73) estimate that it would take at
least twenty animal generations for a mixed population of
mtDNA molcules to become a pure population, assuming
50 mtDNA molecules per oocyte (lower limit) and 100 germ
cell generations (upper limit) and no selective advantage.
We observe four genotypic shifts in the H15 lineage
(Figure 1), one of which occurred in only two generations.
It is difficult to explain these data based upon multiple
mutational events followed by random segregation, over so
short a time span, unless a significant, but inapparent,
selective advantage existed.


Figure 7. Schematic of sequence of URF-5 and
D-loop of mtDNA from H15 animals and
the sequence of Anderson et al. (9).
1. H634 and H1009B. 2. Sequence of
Anderson et al. 3. H493. Lines
indicate identity. D-loop region
sequenced is shown in Figure 5. a, b,
c, d, e, positions 12792, 16074, 16079,
160231, and 160250, respectively.


21
10 minutes and the supernate transferred to another
microfuge tube. The DNA was then precipitated by the addi
tion of 1 ml of ethanol. After 10 minutes at -70C the DNA
was pelleted in a microfuge for 10 minutes and the pellet
vacuum dried.' The pellet was resuspended in 100 ul 10 mM
Tris-HCl pH 7.4, 5 mM EDTA, phenol-chloroform extracted
twice, chloroform extracted once, brought to 250 ul with
0.3 m Na Acetate and precipitated with 700 ul ethanol at
-70C for 10 minutes. After pelleting in the microfuge, the
DNA (20-30 ug) was ready for cleavage with restriction
enzymes and end-labelling with large fragment of E. coli
Polymerase I for eventual sequencing.
Restriction Enzymes
All restriction enzymes were purchased from Bethesda
Research Laboratories (BRL), or from Biolabs, Inc. Digests
were carried out in 20 mM Tris-HCl pH 7.5, 100 mM KC1, 1 mM
DTT, 0.1 mg/ml gelatin, 7 mM MgC^ using 0.2-1.0 units of
enzyme per ug of DNA at a DNA concentration of approximately
100 ug/ml, for 1-4 hours at 37C.
Agarose Electrophoresis
Restriction digests of plasmid and mtDNA were analyzed
by electrophoresis in 1% Agarose gels (6 x 6 x 0.5 cm) in a
horizontal apparatus for 1-4 hours at 100-200 V
(100-200 mA) The electrophoresis buffer contained 50 mM
Tris-HCl, 20 mM Na Acetate, 18 mM NaCl, pH 8.2.


Figure 11. Sequence of middle of the D-loop of cow
and water buffalo mtDNA. Numbering
system is from Anderson et al. (9).


10
the mitochondrial genotype can vary so rapidly in the face
of the high ploidy of the mitochondrial genome. Given
3
1-4 x 10 mtDNA molecules per cell (56) the possibility of
individual variants arising and becoming the predominant
genotype is conceptually difficult, especially over short
time spans. The present work reports the results of a more
detailed genetic analysis of this maternal lineage which we
expect will offer iftsight into the molecular mechanism of
mtDNA inheritance.
Rationale
Previous work (55) has shown that the mtDNA of five
animals within a maternal lineage of Holstein cows had one
more Hae III site than the mtDNA of all other animals
analyzed in this lineage. Figure 1 shows the pedigree of
this maternal lineage, the H15 lineage. Nucleotide sequence
analysis of this region determined that the loss of the
Hae III site is uniformly due to a cytosine to thymidine
base transition at nucleotide position 12792 (Anderson et
al. numbering system, reference 9). This point mutation
occurs within an open reading frame (URF-5) at the third
position of a glycine codon and, therefore, is a neutral
mutation.
The pattern of occurrence of the two types of mtDNA in
this lineage argued against a mutational origin for this
difference, since multiple, identical, but independent


41
the D-Loop region of H493 (an L animal) with H634 (an L
S Li
animal), four nucleotide differences were observed at the
positions noted in Figure 6. These sequences were multiply
determined from three independent clones of H493 (11-1,
11-2, 11-3) a"nd six clones of H634 (95-3, 95-6, 95-13,
95-85, 95-87 and 95-P). The sequence of all clones from one
animal was identified. In other words, the mtDNA of these
two animals differed not only at position 12792 in URF-5,
but at four other bases several thousand bases away in the
D-Loop region (Figure 7). This, in effect, proves that H493
and H634 had mtDNA of two separate genotypes. This also
supports the idea that L and LT represented two genotypes
within the HI5 lineage. Alternatively, many genotypes which
fall into two classes, L and L could exist in the
S ^
lineage.
To distinguish between these two possibilities, the
D-Loop region was sequenced across the stretch of DNA
containing the four differences from cloned DNA from seven
other Lt animals and four other L animals. All seven LT
animals' (H496, H501, H737B, H997B, H512, H576 and H709, see
Figure 1) D-Loop region sequences were identical to each
other and to H634. That is, all had a T at position 12792
in URF-5 (H709 was not sequenced in this region but did not
have the Hae III site and is presumed to also have a T here)
as well as the same four bases as H634 and H1009B at
positions 16074, 16079, 16231 and 16250 and all other bases


56
strand of bovine mtDNA. By 3' end-labelling closed circular
mtDNA isolated from fresh brain tissue only the D-Loop
strand will be labelled. Such a reaction reveals three
major bands on a 4% Acrylamide, 7 M Urea gel (Figure 12,
lane A). The" major bands are approximately 440, 490 and 535
base pairs in length. We mapped the 3' termini of the
D-Loop strands as shown in Figure 13. Lane B of Figure 12
reveals 3 major bands following annealing of the 3'-labeled
D-Loop strand to its complementary strand and cleavage with
Sau 3A. The bands are 200, 250 and 295 base pairs in
length, and thus the differences in length correspond to the
length differences in the uncleaved strands and the
heterogeneity appears to be totally due to 3' heterogeneity
5' labelling needs to be done however to rule out any minor
5' heterogeneity. The minor bands in lane A, Figure 12 may
in fact represent 5' heterogeneity. The minor bands in lane
B, Figure 12 are probably the result of 3'
microheterogeneity as seen by Doba et al. (17). Mapping of
the 5' end of the D-Loop strand (i.e. the heavy strand
origin or C>H) can be determined from the difference between
the uncleaved and cleaved 3' labelled D-Loop strands (lanes
A and B respectively, in Figure 12). Figure 14 shows the
approximate heavy strands origin as well as the 3' termini
indicated on the actual sequence. It is noteworthy that the
four variable bases described above lie within the D-Loop
strand (Figure 14, arrows).


68
mtDNA intraspecies polymorphism. Yet another level of
polymorphism, and another mechanism for generating it, is
suggested by our D-Loop sequence data. Figure 9 shows the
mitochondrial genotypes we have observed in the H15 lineage
as well as the sequence of Anderson et al. (9). However one
interprets the pattern of occurrence of these genotypes in
the H15 lineage, the ultimate origin of the genotypes must
lie in a series of mutational events throughout the course
of bovine evolution. In analyzing the various genotypes, it
is impossible to generate all the genotypes by a stepwise
mutational process, starting with either any of the observed
genotypes, or any of a number of theoretical combinations of
these five base transitions, without changing one of the
bases twice. Thus, a strictly mutational process demands
that one of the bases change twice during the time many
other bases have not changed at all. This would suggest
that one or all of these four bases is hypermutable.
Alternatively, some of the bases that appear as unchanged
could have mutated and then back mutated. This argument
would propose that there is nothing especially hypervariable
about these four bases in the D-Loop, but that this whole
region of the D-Loop is hypervariable. Our Water Buffalo
sequence data discredit this argument. The rate of
divergence in this region is slightly less than the average
rate of divergence of mtDNA. Furthermore, four base
differences between cows in a region of approximately nine
hundred bases would represent about 200,000 years of Bos


CHAPTER II
MATERIALS AND METHODS
Animals
A
All animals used in this study were maintained at the
University of Florida Dairy Research Unit (DRU) under closed
genetic conditions. All Holstein cows or bull calves were
registered with the Holstein-Freisian Association of
America. With the exception of the founding maternal
ancestor, H15, all animals in the H15 maternal lineage were
born, bred and maintained at the DRU. Holstein H15
(registration number 3797669) was born October 3, 1953, and
purchased on February 15, 1955. She has since given rise to
56 female descendants at the DRU, which comprise the current
H15 maternal lineage (Fig. 1). Complete health,
reproduction, and genetic records are available for all
animals.
Isolation of mtDNA
Mitochondria were isolated from liver or brain tissue
by homogenization followed by differential centrifugation.
The mitochondria were then lysed with SDS and subjected to
Cesium chloride-Ethidium bromide density gradient
centrifugation to isolate the mtDNA (57).
14


ACKNOWLEDGMENTS
I offer my most sincere appreciation to Dr. William
Hauswirth for all of his efforts on my behalf. I wish to
*
thank him for offering me a position in his laboratory, and
for all his encouragement and generosity. I have gained
much from him as both my friend and mentor.
I also want to thank my committee members Drs.
Muzyczka, Laipis, Siden and Berns. I especially owe a debt
of gratitude to Dr. Berns for all of his help and guidance.
My appreciation is also extended to all the faculty^
especially Dr. Gifford, Dr. Shands and Dr. Small who offered
me invaluable guidance and assistance.
Thank also to all the members of Dr. Hauswirth's
laboratory: Terri, Doug and especially Brian for his endless
anecdotes. I am especially grateful to Kathy Brown for her
tireless technical assistance. Many fellow graduate
students deserve my thanks for making my graduate training
thoroughly enjoyable, especially Jeffrey Ostrove an
invaluable friend. Finally, thanks to my wife Kathy, for
her unfailing support, for without her this work would not
have been completed.
in


2
MtDNA of Protista, fungi, plants, and animals, though
functionally conservative, exhibits a high degree of
variability in size, structure and gene organization (for
review see 6). However, the mtDNA of all animal cells is
very uniform in these features. Animal mtDNA is a
7
supercoiled, circular, duplex molecule of about 10 daltons
(6). The mitochondrial genome codes for 12S and 16S RNA of
*
the mitochondrial ribosome, twenty-two transfer RNA's and
thirteen coding regions (5 of which are genes for enzymes of
oxidative phosphorylation, and 8 of which are designated
unidentified reading frames (URF's) pending identification
(7)). Only one non-coding region exists in the
mitochondrial genome: the region between the phenylalanine
tRNA and the proline tRNA genes which contains the origin of
replication. The vast majority of mitochondrial proteins
are coded in the nucleus, and there exists a tightly
regulated interaction between the nuclear and mitochondrial
genomes.
Tremendous advances have been made toward our
understanding of the animal mitochondrial genome. The
entire nucleotide sequence of the mouse (8), human (7) and
bovine (9) mtDNA molecules has been determined, and they
display a striking degree of similarity in size and genetic
organization, but a marked degree of divergence in sequence
(see below). The mammalian mitochondrial genome displays a
remarkable degree of compactness (7). Unlike nuclear DNA
and yeast mtDNA, there are very few intergenic nucleotides


9
substitution process, more closely related animals must be
compared. Brown et al. has begun this by sequencing regions
of mtDNA from great apes with divergence times of less than
ten million years (46) .
However,' the bulk of the present work deals with an
even more precisely defined system with which to study the
phenomenon of mtDNA variation. This work presents an
analysis of the mtDfJA of a maternal lineage of Holstein cows
with a carefully recorded pedigree. We have asked the
question: What is the shortest time span over which
variation can be observed in mtDNA?
MtDNA Inheritance
The transmission genetics of the mitochondrial genome
of animals is poorly understood. Several studies
(33,34,42,52,53,54) strongly support strict maternal
inheritance, and no evidence for a paternal effect has been
reported. The intraspecific polymorphism exhibited by the
mammalian mtDNA is thought by some workers to be related to
strict maternal inheritance, because it leads to maternally
isolated mitochondrial gene pools within a breeding
population. However, our laboratory has reported (55) a
restriction site polymorphism within a single maternal
Holstein lineage (see further discussion below). This
variation, occurring between such closely related
individuals over such a short time span, poses a problem of
how mtDNA is inherited. Specifically, it is not clear how


CHAPTER IV
DISCUSSION
Several unique observations have been presented. First
multiple mitochondrial genotypes have been identified within
a maternal lineage of Holstein cows. Second, the pattern of
occurrence of these genotypes within the lineage suggests a
mechanism of mtDNA inheritance which allows for rapid
genotypic shift. Finally, the variability among the
genotypes in the D-Loop region exists as various
combinations of transitions at four bases with identity at
all other bases sequenced.
Origin of mtDNA Variation
It has been proposed that the intraspecific variability
of mtDNA is related to strict maternal inheritance of the
mitochondrial genome (38). This mode of inheritance can
lead to maternally isolated gene pools within a breeding
population. Thus, if a variant mtDNA molecule arises in a
female germ line cell, that mtDNA molecule can go on to
predominate in that female's progeny. However, the new
mitochondrial genotype is totally isolated from the
remaining female lines within the species. It is easy,
63


within a maternal lineage demonstrates that some
mitochondrial DNA variation is independent of strict
maternal inheritance.
Furthermore, one genotypic shift has occurred in only
two generations and is consistent with a mitochondrial
genotype being determined by a limited number of maternal
mitochondria DNA molecules. Thus, it is clear that rapid
*
genotypic shifts make some very specific demands upon the
molecular mechanism of mitochondrial DNA inheritance. A
model, based upon mitochondrial DNA amplification during
oogenesis, is discussed.
Finally, the origin of the differences in the D-loop
region, among the genotypes we have identified, is not
easily explained by a mutational mechanism. Multiple
mutational events at the same position in a relatively short
time are extremely improbable. A gene conversion model,
based upon D-loop mapping studies and the sequence data, is
proposed to explain how some of these genotypes may have
arisen.
xi


Figure Page
14. Nucleotide sequence of D-loop region of
bovine mtDNA with heavy strand origin of
replication (0H) and approximate points of
major 3' termini indicated (arrows) 62
15. Model fot gene conversion in the D-loop .... 71
vii


49
(Figure 8). This result suggests that at least one of the
genotypes found in the H15 lineage may exist outside the
lineage. Of course other differences in bases not sequenced
may exist. However, if this does represent the same
genotype, thet this genotype, and probably other genotypes
in the H15 lineage, existed prior to the start of the
lineage.
*
D-Loop Sequences of Cattle of Breeds Other Than Holstein
A limited number of bases were sequenced from cloned mt
DNA of animals of other cattle breeds. Figure 8 shows the
D-Loop sequences of cloned mtDNA from a Jersey (J49, clone
94-4), a Guernsey (H992B, clone 78-7) and an Angus (704,
clone 80-17). The Jersey and Guernsey sequences are
identical in the approximately two hundred bases sequenced,
and they are identical to H455 of the H15 lineage. The
Angus sequence differs from the Jersey and Guernsey
sequences only at one position, a T to C transition at base
16042. This difference may reflect a more distant ancestry
of Angus cattle (beef cattle) with the Holstein, Jersey and
Guernsey cattle (dairy cattle). Further sequencing of the
mtDNA of these other breeds in the D-Loop especially across
base pair 16231 and 16250 needs to be done to delineate how
these breeds' mtDNA relates to Holstein mtDNA. However, the
identity of the bases sequenced from these breeds with a
Holstein sequence suggests that at least some of the mtDNA


Pst I
P ro t R N A
-<
AACAqrCAACCAACAAACTCCACTCTCACCATCAACCCCCAAACCTCAACTTCTATTTAAACTATTCCC'lteAACACTATTAATATACTTCCATAAATACAAACACCCT
ijc/
l i
TATCACTATTAAATTTATCAAAAATCCCAATAACTCAACACAGAATTTGCACCCTAACCAAATATTACAAACACCACTAGCTAACATAACACGCCCATACACACACCA
|
CACAATGAATTACCTACGCAAGGCGTAATGTACATAACATTAATGTAATAAAGACATAATATGTATATAGTACATTAAATTATATGCCCCATGCATATAAGCAACTAC
160 10
T G v *
ATCACCTCTATACCAGTACATAATACATA AATT TTGACTGCACATAGTACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTTACCATTACAT
C A ,6, ,0
Bam HI T A
CACCACCTTAATTACCATCCCCCGTCAAACCAGCAACCCGCTAGGCAGGJGATCCCTCTTCTCGCTCCCCCCCCATAAA CGTCGGCGTCCCTATCCA TGAATTTTAC
C G
r 621 0
I
CACCCATCTCGTTCTTTCTTCACGGCCATCTCATCTAAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGGACTAATGCCTAATCACCCCATCCTCACACA
16310 I 10
Oh
TAACTGTCCTCTCATACATTTCGTATTTTTTTATTTTGGCGGATGCTTGGACTCAGCTATGGCCCTCAAAGGCCCTGACCCCGACCATCTATTGTACCTCGACTTAAC
110
TCCATCTTGAGCACCAGCATAATGATAAGCATGGACATTACAGTCAATGGTCACAGGACATAAATTATATTATATACCCCCCCTTCATAAAAATTTCCCCCTTAAATA
210
TCTACCACCACTTTTAACAGACTTTTCCCTAGATACTTATTTAAATTTTTCACGCTTTCAATACTCAATTTAGCACTCCAAACAAAGTCAATATATAAACCCACCCCC
31 0 u T
T H|?aI
CCCCCCCCCjGTTGATCTAGCTTAACCCAAAGCAAGGCACTGAAAATGCCTAGATGAGTCTCCCAACTCCATAAACWCATAGGTTTGGTCCCACCCTTCCTGTTAACTC
4,0 12s r.RNA
>.
Phe tRNA
D-LOOP TEMPLATE STRAND
tsj


58


3
and no intragenic sequences (7). The tRNA genes are all
interspersed between the coding regions, and the mRNA's
rRNA's, and tRNA's all appear to be the product of precise
endonucleolytic cleavage of large transcripts by a process
whereby tRNA "genes presumably serve as processing signals
(10) .
The mammalian mitochondrial genome also exhibits
several other unique features. The mitochondrial genetic
code differs from the "universal" genetic code in that UGA
codes for tryptophan rather than termination, AUA for
methionine and initiation rather than isoleucine, and AGA
and AGG for termination rather than arginine (11). In
addition many codon families exist in which a single amino
acid is specified regardless of the third base.in the codon
(e.g., CUN = Leu, GUN = Val, UCN = Ser, etc.) Furthermore,
mitochondrial tRNA's are unusual in that they do not contain
certain structural features found in all other tRNA's
studied (12).
MtDNA Replication
MtDNA exhibits a unique mechanism of replication in
which the two DNA strands have distinct origins of
replication (13). Replication begins at the heavy strand
(H-strand) origin, and light strand (L-strand) synthesis
does not begin until the H-strand has been elongated
two-thirds around the molecule. A high proportion of
isolated mtDNA molecules contain a third strand of DNA (14).


Figure 3. Autoradiograph of preparative 6%
polyacrylamide gel. Plasmid DNA from a
50 ml culture of clone 22-1 (an Eco RIA
clone of the mtDNA from H624) was
restricted with Bam HI and Bgl II, 3'
end-labeled with large fragment of Pol I
and P-GTP, and then restricted with
Hpa I, Pst I and Cfo I. This gives
three well separated bands. A. Bam HI-
Hpa I. B. Bam HI-Pst I. C. Bgl II-
Cfo I. Bands A and B are fragments in
the D-loop region. Band C is a fragment
which is in the URF-5 gene.


Figure 9. Schematic of sequence of URF-5 and
D-loop region of mtDNA. 1. H1009B
clone 91-3 and all other L animals (see
Text). 2. H1009B clones yl-1 and 91-2.
a, b, c, d, e,: positions 12792, 16074,
16079, 16231, 16250 and 16295,
respectively.


5
mtDNA replication have not yet been fully characterized.
Kalf and Ch'ih first purified DNA polymerase from rat liver
mitochondria (2 2) More recent work has shown the DNA
polymerase isolated from mitochondria to be polymerase
(23,24). No 'other enzymes of mtDNA replication have been
characterized, although enzymes such as a ligase, an RNA
primase, an endonuclease and a topoisomerase are presumably
involved in the replication of closed circular DNA
molecules.
Little is known about the cell biology of mtDNA
replication. The relationship between mtDNA replication and
mitochondrial proliferation is not understood. Bogenhagen
and Clayton has shown that mtDNA replication is not cell
cycle controlled, although the number of mtDNA molecules in
dividing tissue culture cells is relatively constant (24).
One interesting observation is that some mtDNA molecules can
undergo a second round of replication while other molecules
have not replicated at all (24). Finally, the tell-tale
observation that there is a significant amplification of the
number of mitochondria during both xenopus (25) and murine
(26) oogenesis may offer clues to the control signals
involved in mtDNA replication and mitochondrial
proliferation.
Many unanswered questions remain regarding the control
of mtDNA replication. It is clear that the development of
an in vitro replication system for mtDNA is needed. Also,
structure-function comparisons of mtDNA, particularly in the
D-Loop region, between more closely related species will


50
genotypes may have existed prior to the domestication of
cattle.
D-Loop Region Sequence Comparisons of Animals
of the Order Artiodaclyla, Family Bovidae
Figure 10 shows a taxonomic tree of the order
Artiodactyla with the Bovidae Family expanded. It is shown
to emphasize the utility of this order for the study of
*
mtDNA evolution. It is one of the largest orders of
mammals, and there are four genera of Bovidae: Syncerus,
Bubalus, Bison and Bos, all of which have a common ancester
with Bos tenrus (European cattle) within ten million years
(69). There is some controversy but Sinclair (69) believes
that the fossil, biochemical, and behavioral evidence favors
a closer relationship between Syncerus (African Buffalo)-and
Bubalus (Asian Water Buffalo) than either buffalo has with
Bison and Bos. He estimates a five to six million year
divergence between these buffalo and Bos and Bison, whereas
Bos and Bison diverged from each other two to three million
years ago. There are many extant species of each of these
genera, particularly in the genus, Bos. DNA sequence
comparisons of the mtDNA from these animals will enable us
to place the D-Loop variation we observe in Bos taurus in an
evolutionary perspective. Figure 11 shows a partial D-Loop
sequence of Bubalus arnee (Water Buffalo) aligned with the
Holstein cow sequence. The region sequenced spans the four
variable positions in the cow. A total of 35 sequence


Figure 15. Model for Gene Conversion in the
D-loop. L bovine mitochondrial
genotype with a C at position 12792 in
URF-5. L genotype with a T at
position T2792 in URF-5. Bases shown
correspond to the bases indicated in
Figure 8.


69
mtDNA evolution (i.e. (4/900 1.9%) x 106 years). Perhaps
this is not unreasonable if one realizes that during cattle
domestication, new breeding stocks were continuously being
formed by introducing non-domesticated maternal animals,
with no recent ancestor to domestic cattle, into the
breeding populations (75). Therefore, it would appear that
the region in which the four bases occur cannot be called
hypervariable, and that the identity of a base between cows
truly reflects the absence of a mutation.
We are thus forced to.return to the problem of how one
or more bases could change twice while other bases remain
unchanged. Random mutation with hypervariability at certain
bases, due to a lack of functional constraints, cannot be
easily dismissed. There is no reason that a relatively
conserved region could not have mutational hotspots.
A more interesting explanation of the D-Loop variation
is suggested by the mechanism of mtDNA replication.
Figure 15 illustrates the proposed model. It has been shown
that newly synthesized D-Loop strands are constantly being
synthesized, lost, and resynthesized, and that they are very
rarely fully elongated (19). Therefore, assuming a germ
line cell is heterozygous for two genotypes, it is
conceivable that a newly synthesized D-Loop strand, from a
molecule of one genotype, could be displaced and invade the
closed circular molecule of another genotype at its
homologous region (i.e. the D-Loop region). A D-Loop for


6
offer further insight into how mtDNA replication is
regulated.
Mitochondrial DNA Evolution
Mitochondria are involved in very important cellular
functions and the mitochondrial genome is tightly packed
with functional genes. One would therefore expect mtDNA
evolution to be highly restricted due to functional
constraints. Many studies, however, support the idea that
mtDNA is evolving much more rapidly than single copy DNA
(27-45). Restriction enzyme digest comparisons of mtDNA
from various species have shown a marked degree of
interspecific as well as intraspecific variation
(28-31,35,36). Nucleotide sequencing studies have shown
that single base substitutions account for much of the
variation (46). However, intraspecific length polymorphism,
mapping in the D-Loop region, has also been observed (38).
Comparisons between the nucleotide sequence of the mouse
(8), human (7), and bovine (9) mtDNA molecules demonstrate
the rapid primary sequence divergence in mammalian mtDNA.
In addition the size difference among these three mtDNA
molecules is mostly due to length differences in the D-Loop
region.
The reasons for the high evolutionary rate of mtDNA are
probably multifold. Sequence comparisons of various
functional regions of the mitochondrial genome offer some
insight into possible mechanisms (46). Certain regions of


i
Figure 14. Nucleotide sequence of D-loop region of
bovine mtDNA with heavy strand origin
of replication (0) and approximate
points of major 3^ termini indicated
(arrows). The four variable bases
among the Holstein cows are indicated
(see text).
)


7
the mitochondrial genome appear to be highly conserved.
Dawid (27) has shown by DNA homology studies that although
the mtDNA from two species of Xenopus differs in 20-30% of
their total sequences, those regions coding for ribosomal
RNA are nearly identical. Direct sequence comparisons have
confirmed a high degree of homology in ribosomal genes
between related and unrelated species (7,8,9).
Transfer RNA genes appear to be the fastest evolving
genes, possibly because they are free of some of the
functional constraints that operate on nuclear and bacterial
tRNA genes (46). Protein coding regions exhibit a high
degree of neutral third base changes, and thus mitochondrial
codon usage contributes to rapid base substitution.
The D-Loop region appears to one of the least conserved
regions of the mitochondrial genome. Upholt and Dawid (38)
compared sheep and goat mtDNA in the D-Loop region by
heteroduplex analysis, and concluded that the D-Loop
contains both conserved and unconserved sequences. Walberg
and Clayton (47) have compared the nucleotide sequences of
the human and mouse D-Loop region. They found a high degree
of divergence especially at the 5' ends, but they also noted
several highly conserved regions, the largest of which was
as conserved as ribosomal RNA genes. Anderson et al. (9)
have made similar observations in comparing the human and
bovine D-Loop sequences. The implication is that parts of
the D-Loop cannot tolerate change because their sequences
are important for certain functions (e.g., binding to DNA or


29
Polyacrylamide Gel Electrophoresis
Restriction fragments were isolated by electrophoresis
on 6% polyacrylamide gels (16 cm x 40 cm x 3 mM) in a 50 mM
Tris pH 8.3 0. M Borate, 1 mM EDTA (TBE buffer) at 200 V
(20-30 m A) 12-16 hours. After electrophoresis,
32
P-labelled fragments were visualized by autoradiography.
Unlabelled fragments were stained with Ethidium bromide
(2 ug/ml) and visualized under ultraviolet light.
Extraction of Restriction Fragments from the Acrylamide Gel
Restriction fragments were cut out of the acrylamide
gel with a scalpel, and extracted by crushing the gel with a
glass rod followed by incubation for 12 hours at 37C in
0.5 M Ammonium acetate, 10 mM Magnesium acetate, 0.1% SDS
and 5 ug/ml tRNA (the tRNA was omitted if the fragment was
later to be labelled with PNK). The solution was then
passed over siliconized glass wool to retain the gel and
allow collection of the eluted DNA. The DNA was then
precipitated several times with ethanol at -70C.
DNA Sequencing
All sequencing was done according to the method of
Maxam and Gilbert (68). Purified end-labelled fragments
were divided into five aliquots and subjected to the base
modification reactions using dimethylsulfate (for Guanine),
hydrazine (for cytosine and thymidine) hydrazine in 1.5 M
NaCl (for cytosine only), Sodium hydroxide (for adenosine


Figure 4. Genomic map of bovine mtDNA with cloned
restriction fragments used in this
study, indicated.


REFERENCES
1. Gray, M.W., and W. Ford Doolittle. 1982. Has the
endosymbiosis hypothesis been proven? Microb.
Rev. 46(1):1-42.
2. Nass, M.M.D. 1966. The circularity of mitochondrial
DNA. Proc. Nat. Acad. Sci., U.S.A. 56;1215-1222.
3. Saccone, C., and A.M. Kroom (eds.). 1976. The Genetic
Function of Mitochondrial DNA. North Holland Pub.
Co., Amsterdam.
4. Attardi, G. 1981. Organization and expression of the
mammalian mitochondrial genome: a lesson in
economy: I. Trends Biochem. Sci. 6^: 86-89.
5. Attardi, G. 1981. Organization and expression of the
mammalian mitochondrial genome: a lesson in
economy: II. Trends Biochem. Sci. 6^: 100-103.-
6. Gray, M.W. 1982. Mitochondrial genome diversity and
the evolution of mitochondrial DNA. Can. J.
Biochem. 60:157-171.
7. Anderson, S., A.T. Bankier, B.G. Barrell, M.H.L.
de Bruijn, A.R. Coulson, J. Cronin, I.C. Epeson,
D.P. Nierlick, B.A. Roe, F. Sanges, P.H. Schreier,
A.J.H. Smith, R. Staden, and I.G. Young. 1981.
Sequence and organization of the human
mitochondrial genome. Nature 290:457-465.
8. Bibb, M.J., R.A. Van Etten, C.T. Wright, M.W. Walberg,
and D.A. Clayton. 1981. Sequence and gene
organization of mouse mitochondrial DNA. Cell
26:167-180.
9. Anderson, S., M.H.L. de Bruijn, A.R. Coulson, I.C.
Epeson, F. Sanger, and I.G. Young. 1982. The
complete sequence of bovine mitochondrial DNA:
Conserved features of the mammalian mitochondrial
genome. J. Mol. Biol. 156:683-717.
10.Ojala, D., J. Montaya, and G. Attardi. 1981. tRNA
punctuation model of RNA processing in human
mitochondrial. Nature 290:470-474.
76


30
cytosine), and pyridinium formate (for adenosine and
quanine). Base displacement and strand scission reactions
were done with 0.1 M Piperidine. The products of the
sequencing reactions were analyzed by electrophoresis on 8,
12 or 20% polyacrylamide 7M urea gels (16 cm X 40 cm x
0.3 mm, or 32 cmx 40 cmx 0.3 mm, or 32 cmx 80 cmx
0.3 mm), followed by autoradiography at -20C with either
Cronex 4 X-Ray film* (Dupont) or Xar-5 X-Ray film (Kodak).


LIST OF FIGURES
Figure Page
1. Maternal decendants of registered Holstein
cow, H15 12
*
2. The restriction endonuclease map of
mitochondrial DNA from Holstein cow H493 ... 18
3. Autoradiograph of preparative 6% polyacrylamide
gel 28
4. Genomic map of bovine mtDNA with cloned restric
tion fragments used in this study, indicated 33
5. Partial cleavage map and sequence strategy of
the D-Loop region 35
6. Sequence of the D-loop obtained from cloned DNA
from Holstein cows H493, H634 and H1009B ... 37
7. Schematic of sequence of URF-5 and D-loop of
mtDNA from H15 animals and the sequence of
Anderson et al. (9) 40
8. Schematic of sequence of URF-5 and D-loop of
mtDNA 44
9. Schematic of sequence of URF-5 and D-loop
region of mtDNA 47
10. Taxonomic tree of the Order Artiodaclyla .... 52
11. Sequence of middle of the D-loop of cow and
water buffalo mtDNA 54
12. Mapping of 3' termini of D-loop strands of
bovine mtDNA 58
13. Schematic of strategy for mapping 3' termini
of the D-loop 60
vi


GENETICS OF THE ORIGIN OF REPLICATION
OF BOVINE MITOCHONDRIAL DNA
BY
PAUL DAVID OLIVO
A DISSERTATION PRESENTED TO THE GRADUATE COUNCIL
OF THE UNIVERSITY OF FLORIDA IN
PARTIAL
FOR THE
FULFILLMENT OF THE REQUIREMENTS
DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1982

This dissertation is
dedicated to my wife,
and best friend, Kathy.

ACKNOWLEDGMENTS
I offer my most sincere appreciation to Dr. William
Hauswirth for all of his efforts on my behalf. I wish to
*
thank him for offering me a position in his laboratory, and
for all his encouragement and generosity. I have gained
much from him as both my friend and mentor.
I also want to thank my committee members Drs.
Muzyczka, Laipis, Siden and Berns. I especially owe a debt
of gratitude to Dr. Berns for all of his help and guidance.
My appreciation is also extended to all the faculty^
especially Dr. Gifford, Dr. Shands and Dr. Small who offered
me invaluable guidance and assistance.
Thank also to all the members of Dr. Hauswirth's
laboratory: Terri, Doug and especially Brian for his endless
anecdotes. I am especially grateful to Kathy Brown for her
tireless technical assistance. Many fellow graduate
students deserve my thanks for making my graduate training
thoroughly enjoyable, especially Jeffrey Ostrove an
invaluable friend. Finally, thanks to my wife Kathy, for
her unfailing support, for without her this work would not
have been completed.
in

TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS iii
LIST OF FIGURES vi
ABBREVIATIONS USED viii
ABSTRACT x
CHAPTER I. INTRODUCTION 1
MtDNA Replication 3
Mitochondrial DNA Evolution 6
MtDNA Inheritance 9
Rationale 10
CHAPTER II. MATERIALS AND METHODS -14
Animals 14
Isolation of mtDNA 14
Construction of mtDNA Recombinant Plasmids .... 16
Isolation of Plasmid DNA 19
Rapid Isolation of Plasmid DNA 20
Restriction Enzymes 21
Agarose Electrophoresis 21
Southern Blotting 22
Radiolabelling mtDNA 22
Filter Hybridization and Autoradiography 23
Grustien-Hogness Blots 23
End-Labelling of mtDNA Fragments 24
Polyacrylamide Gel Electrophoresis 29
Extraction of Restriction Fragments from the
Acrylamide Gel 29
DNA Sequencing 29
CHAPTER III. RESULTS 31
Sequence of the mtDNA D-Loop Region of HI5
Holstein Cows 31
D-Loop Sequences of Other H15 Animals 38
Sequence of Clones of H1009B 42
Summary of Holstein mtDNA Sequence Data 45
IV

Page
D-Loop Region Sequence of a Holstein Cow Outside
the H15 Lineage 48
D-Loop Sequences of Cattle of Breeds Other Than
Holstein 49
D-Loop Region Sequence Comparisons of Animals
of the'Order Artiodaclyla, Family Bovidae ... 50
Mapping of D-Loop Strand of Bovine mtDNA 55
CHAPTER IV. DISCUSSION 63
Origin of mtDNA Variation 63
A Limited Number of Maternal Molecules Determine
the Mitochondrial Genotype 66
Gene Conservation as a Possible Explanation of
D-Loop Sequence Variation Among Holstein Cows 67
Conclusion 73
APPENDIX 74
REFERENCES 76
BIOGRAPHICAL SKETCH 84
v

LIST OF FIGURES
Figure Page
1. Maternal decendants of registered Holstein
cow, H15 12
*
2. The restriction endonuclease map of
mitochondrial DNA from Holstein cow H493 ... 18
3. Autoradiograph of preparative 6% polyacrylamide
gel 28
4. Genomic map of bovine mtDNA with cloned restric
tion fragments used in this study, indicated 33
5. Partial cleavage map and sequence strategy of
the D-Loop region 35
6. Sequence of the D-loop obtained from cloned DNA
from Holstein cows H493, H634 and H1009B ... 37
7. Schematic of sequence of URF-5 and D-loop of
mtDNA from H15 animals and the sequence of
Anderson et al. (9) 40
8. Schematic of sequence of URF-5 and D-loop of
mtDNA 44
9. Schematic of sequence of URF-5 and D-loop
region of mtDNA 47
10. Taxonomic tree of the Order Artiodaclyla .... 52
11. Sequence of middle of the D-loop of cow and
water buffalo mtDNA 54
12. Mapping of 3' termini of D-loop strands of
bovine mtDNA 58
13. Schematic of strategy for mapping 3' termini
of the D-loop 60
vi

Figure Page
14. Nucleotide sequence of D-loop region of
bovine mtDNA with heavy strand origin of
replication (0H) and approximate points of
major 3' termini indicated (arrows) 62
15. Model fot gene conversion in the D-loop .... 71
vii

ABBREVIATIONS USED
A
adenine
BSA
bovine serum albumin
bp
base pair
C
cytosine
Ci
curie
cm
centimeter
cpm
counts per minute
dCTP
deoxycytidine triphosphate
dGTP
deixyguanidine triphosphate
dATP
deoxyadenosine triphosphate
D-loop
Displacement loop
DNA
deoxyribonucleic acid
E. coli
Eschericha coli
EDTA
ethylenediaminetetraacetic acid
g
Gravity
gms
grams
G
guanine
M
molar
ma
milliampere
mCi
millicurie
mg
milligrams
viii

ml
milliliters
mM
millimolar
mm
millimeter
uCi
microcurie
ug
micrograms
ul
microliter
um
micromolar
mt
mitochondria
mtDNA
mitochondrial DNA
MSB
mannitol, sucose buffer
ng
nanograms
32
P
phosphorus 32
RNA
ribonucleic acid
RNase
ribonuclease
rpm
revolutions per minute
rRNA
ribosomal ribonucleic acid
SDS
sodium dodecyl sulfate
SSC
standard saline citrate
tRNA
transfer ribonucleic acid
V
volts
IX

Abstract of Dissertation Presented to the Graduate Council
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
GENETICS OF THE ORIGIN OF REPLICATION
OF BOVINE MITOCHONDRIAL DNA

By
Paul Olivo
August, 1982
Chairman: William W. Hauswirth
Major Department: Immunology and Medical Microbiology
The nucleotide sequence of the D-loop region of
mitochondrial DNA from maternally related Holstein cows was
determined. First, four distinct mitochondrial genotypes
have been identified. Second, the pattern of occurrence of
these genotypes reveals multiple genotypic shifts. Third,
the four genotypes have identical D-loop regions except at
four bases, such that each genotype represents a different
combination of base transitions at these four positions.
The published bovine mtDNA sequence is also identical in the
D-loop region except at these four positions, and thus is a
fifth bovine genotype.
Marked intraspecies mitochondrial DNA polymorphism is
thought to be related to strict maternal inheritance which
leads to maternally isolated gene pools within a breeding
population. However, our finding-of mtDNA polymorphism
x

within a maternal lineage demonstrates that some
mitochondrial DNA variation is independent of strict
maternal inheritance.
Furthermore, one genotypic shift has occurred in only
two generations and is consistent with a mitochondrial
genotype being determined by a limited number of maternal
mitochondria DNA molecules. Thus, it is clear that rapid
*
genotypic shifts make some very specific demands upon the
molecular mechanism of mitochondrial DNA inheritance. A
model, based upon mitochondrial DNA amplification during
oogenesis, is discussed.
Finally, the origin of the differences in the D-loop
region, among the genotypes we have identified, is not
easily explained by a mutational mechanism. Multiple
mutational events at the same position in a relatively short
time are extremely improbable. A gene conversion model,
based upon D-loop mapping studies and the sequence data, is
proposed to explain how some of these genotypes may have
arisen.
xi

CHAPTER I
INTRODUCTION
Mitochondria, the energy producing organelles of the
cell, are present in the cytoplasm of all aerobic eukaryotic
cells. The mitochondrion contains an inner and outer
membrane, its own protein synthesizing machinery, and its
own genetic information. It has been proposed that
mitochondria may have arisen by endosymbiosis of a primitive
eubacteria into a primitive eukaryote (for a critical review
see 1) .
Since the discovery of mtDNA (2), investigators have
recognized the utility of the mitochondrial genome as a
model system for understanding gene organization and control
in eukaryotic organisms. Much effort has concentrated on
the yeast system in which genetic markers have greatly
facilitated the analysis of the mitochondrial genome (for
review see 3). Much recent work has concentrated on
mammalian mtDNA (for review see 4,5). Advances in DNA
analysis (restriction enzymes, DNA cloning, and nucleotide
sequencing, etc.) have in many ways compensated for the lack
of genetic information about animal mitochondria.
1

2
MtDNA of Protista, fungi, plants, and animals, though
functionally conservative, exhibits a high degree of
variability in size, structure and gene organization (for
review see 6). However, the mtDNA of all animal cells is
very uniform in these features. Animal mtDNA is a
7
supercoiled, circular, duplex molecule of about 10 daltons
(6). The mitochondrial genome codes for 12S and 16S RNA of
*
the mitochondrial ribosome, twenty-two transfer RNA's and
thirteen coding regions (5 of which are genes for enzymes of
oxidative phosphorylation, and 8 of which are designated
unidentified reading frames (URF's) pending identification
(7)). Only one non-coding region exists in the
mitochondrial genome: the region between the phenylalanine
tRNA and the proline tRNA genes which contains the origin of
replication. The vast majority of mitochondrial proteins
are coded in the nucleus, and there exists a tightly
regulated interaction between the nuclear and mitochondrial
genomes.
Tremendous advances have been made toward our
understanding of the animal mitochondrial genome. The
entire nucleotide sequence of the mouse (8), human (7) and
bovine (9) mtDNA molecules has been determined, and they
display a striking degree of similarity in size and genetic
organization, but a marked degree of divergence in sequence
(see below). The mammalian mitochondrial genome displays a
remarkable degree of compactness (7). Unlike nuclear DNA
and yeast mtDNA, there are very few intergenic nucleotides

3
and no intragenic sequences (7). The tRNA genes are all
interspersed between the coding regions, and the mRNA's
rRNA's, and tRNA's all appear to be the product of precise
endonucleolytic cleavage of large transcripts by a process
whereby tRNA "genes presumably serve as processing signals
(10) .
The mammalian mitochondrial genome also exhibits
several other unique features. The mitochondrial genetic
code differs from the "universal" genetic code in that UGA
codes for tryptophan rather than termination, AUA for
methionine and initiation rather than isoleucine, and AGA
and AGG for termination rather than arginine (11). In
addition many codon families exist in which a single amino
acid is specified regardless of the third base.in the codon
(e.g., CUN = Leu, GUN = Val, UCN = Ser, etc.) Furthermore,
mitochondrial tRNA's are unusual in that they do not contain
certain structural features found in all other tRNA's
studied (12).
MtDNA Replication
MtDNA exhibits a unique mechanism of replication in
which the two DNA strands have distinct origins of
replication (13). Replication begins at the heavy strand
(H-strand) origin, and light strand (L-strand) synthesis
does not begin until the H-strand has been elongated
two-thirds around the molecule. A high proportion of
isolated mtDNA molecules contain a third strand of DNA (14).

4
These are replicative intermediates in which the newly
synthesized H-strand (7S DNA) displaces a segment of
parental DNA creating a triple-stranded structure
(Displacement loop or D-Loop). This 7S DNA has been shown
to exist as families of discrete lengths with human 7S mtDNA
exhibiting 5' heterogeneity (15,16) and mouse mtDNA having
both 5' and 3' heterogeneity (17). Robberson and Clayton
(18) have shown that as many as 80% of mtDNA molecules in
mouse L cells contain D-Loops. In vitro labelling of mtDNA
has shown that this newly synthesized segment is rapidly
displaced and resynthesized, and that very few D-Loop
molecules are fully elongated (19). Why is D-Loop synthesis
arrested at certain points and what signals allow for
elongation? Clayton has proposed a template stop signal
hypothesis based upon a 15 nucleotide consensus sequence
which occurs in both the human and mouse D-Loop region (17).
Confirmation of this concept awaits analysis in other
species (see results). The prevalence of D-Loop structures
among mtDNA molecules may relate to transcriptional control,
since the putative promotor of transcription resides in the
D-Loop region (20) It is also possible that the process of
making and remaking D-Loops allows for more precise control
of mtDNA replication, i.e., at the level of elongation
rather than initiation.
Recently, protein or protein-membrane fragments have
been observed associated with the origin of replication of
HeLa cell mtDNA (21). However, the enzymes involved in

5
mtDNA replication have not yet been fully characterized.
Kalf and Ch'ih first purified DNA polymerase from rat liver
mitochondria (2 2) More recent work has shown the DNA
polymerase isolated from mitochondria to be polymerase
(23,24). No 'other enzymes of mtDNA replication have been
characterized, although enzymes such as a ligase, an RNA
primase, an endonuclease and a topoisomerase are presumably
involved in the replication of closed circular DNA
molecules.
Little is known about the cell biology of mtDNA
replication. The relationship between mtDNA replication and
mitochondrial proliferation is not understood. Bogenhagen
and Clayton has shown that mtDNA replication is not cell
cycle controlled, although the number of mtDNA molecules in
dividing tissue culture cells is relatively constant (24).
One interesting observation is that some mtDNA molecules can
undergo a second round of replication while other molecules
have not replicated at all (24). Finally, the tell-tale
observation that there is a significant amplification of the
number of mitochondria during both xenopus (25) and murine
(26) oogenesis may offer clues to the control signals
involved in mtDNA replication and mitochondrial
proliferation.
Many unanswered questions remain regarding the control
of mtDNA replication. It is clear that the development of
an in vitro replication system for mtDNA is needed. Also,
structure-function comparisons of mtDNA, particularly in the
D-Loop region, between more closely related species will

6
offer further insight into how mtDNA replication is
regulated.
Mitochondrial DNA Evolution
Mitochondria are involved in very important cellular
functions and the mitochondrial genome is tightly packed
with functional genes. One would therefore expect mtDNA
evolution to be highly restricted due to functional
constraints. Many studies, however, support the idea that
mtDNA is evolving much more rapidly than single copy DNA
(27-45). Restriction enzyme digest comparisons of mtDNA
from various species have shown a marked degree of
interspecific as well as intraspecific variation
(28-31,35,36). Nucleotide sequencing studies have shown
that single base substitutions account for much of the
variation (46). However, intraspecific length polymorphism,
mapping in the D-Loop region, has also been observed (38).
Comparisons between the nucleotide sequence of the mouse
(8), human (7), and bovine (9) mtDNA molecules demonstrate
the rapid primary sequence divergence in mammalian mtDNA.
In addition the size difference among these three mtDNA
molecules is mostly due to length differences in the D-Loop
region.
The reasons for the high evolutionary rate of mtDNA are
probably multifold. Sequence comparisons of various
functional regions of the mitochondrial genome offer some
insight into possible mechanisms (46). Certain regions of

7
the mitochondrial genome appear to be highly conserved.
Dawid (27) has shown by DNA homology studies that although
the mtDNA from two species of Xenopus differs in 20-30% of
their total sequences, those regions coding for ribosomal
RNA are nearly identical. Direct sequence comparisons have
confirmed a high degree of homology in ribosomal genes
between related and unrelated species (7,8,9).
Transfer RNA genes appear to be the fastest evolving
genes, possibly because they are free of some of the
functional constraints that operate on nuclear and bacterial
tRNA genes (46). Protein coding regions exhibit a high
degree of neutral third base changes, and thus mitochondrial
codon usage contributes to rapid base substitution.
The D-Loop region appears to one of the least conserved
regions of the mitochondrial genome. Upholt and Dawid (38)
compared sheep and goat mtDNA in the D-Loop region by
heteroduplex analysis, and concluded that the D-Loop
contains both conserved and unconserved sequences. Walberg
and Clayton (47) have compared the nucleotide sequences of
the human and mouse D-Loop region. They found a high degree
of divergence especially at the 5' ends, but they also noted
several highly conserved regions, the largest of which was
as conserved as ribosomal RNA genes. Anderson et al. (9)
have made similar observations in comparing the human and
bovine D-Loop sequences. The implication is that parts of
the D-Loop cannot tolerate change because their sequences
are important for certain functions (e.g., binding to DNA or

8
RNA polymerases or other DNA binding proteins). Other
regions of the D-Loop, however, may be involved in functions
which do not depend upon a specific nucleotide sequence.
Alternatively the species-specific nature of certain regions
of the D-Loop' might relate to an interaction with the
nuclear genome. Thus coevolution between the nuclear and
mitochondrial genomes might explain the observed
evolutionary leaps.*
There is suggestive evidence for a high mutation rate
in mtDNA (28,48). Mitochondria have been shown to lack
certain repair functions (49) and polymerase is possibly
the most error-prone DNA polymerase (50). Thus, a high rate
of mtDNA turnover, coupled with an error-prone replication
system, and poor editing functions, could result in a high
mutation rate. Furthermore, mtDNA are possibly exposed to
mutagenic oxidation products, and chemical carcinogens have
been suggested to be preferentially associated with mtDNA
(51). Therefore, a high rate of mutational events and a
high fixation rate are probably both operating to explain
the high evolutionary rate of mtDNA.
It is clear that the mitochondrial genome is an
excellent system with which to study the molecular basis of
evolution. However, sequence comparisons between highly
divergent species such as human, mouse and bovine suffer
from a saturation effect whereby multiple substitutions at
the same position mask the true rate of change (28).
Therefore, to precisely analyze the dynamics of the

9
substitution process, more closely related animals must be
compared. Brown et al. has begun this by sequencing regions
of mtDNA from great apes with divergence times of less than
ten million years (46) .
However,' the bulk of the present work deals with an
even more precisely defined system with which to study the
phenomenon of mtDNA variation. This work presents an
analysis of the mtDfJA of a maternal lineage of Holstein cows
with a carefully recorded pedigree. We have asked the
question: What is the shortest time span over which
variation can be observed in mtDNA?
MtDNA Inheritance
The transmission genetics of the mitochondrial genome
of animals is poorly understood. Several studies
(33,34,42,52,53,54) strongly support strict maternal
inheritance, and no evidence for a paternal effect has been
reported. The intraspecific polymorphism exhibited by the
mammalian mtDNA is thought by some workers to be related to
strict maternal inheritance, because it leads to maternally
isolated mitochondrial gene pools within a breeding
population. However, our laboratory has reported (55) a
restriction site polymorphism within a single maternal
Holstein lineage (see further discussion below). This
variation, occurring between such closely related
individuals over such a short time span, poses a problem of
how mtDNA is inherited. Specifically, it is not clear how

10
the mitochondrial genotype can vary so rapidly in the face
of the high ploidy of the mitochondrial genome. Given
3
1-4 x 10 mtDNA molecules per cell (56) the possibility of
individual variants arising and becoming the predominant
genotype is conceptually difficult, especially over short
time spans. The present work reports the results of a more
detailed genetic analysis of this maternal lineage which we
expect will offer iftsight into the molecular mechanism of
mtDNA inheritance.
Rationale
Previous work (55) has shown that the mtDNA of five
animals within a maternal lineage of Holstein cows had one
more Hae III site than the mtDNA of all other animals
analyzed in this lineage. Figure 1 shows the pedigree of
this maternal lineage, the H15 lineage. Nucleotide sequence
analysis of this region determined that the loss of the
Hae III site is uniformly due to a cytosine to thymidine
base transition at nucleotide position 12792 (Anderson et
al. numbering system, reference 9). This point mutation
occurs within an open reading frame (URF-5) at the third
position of a glycine codon and, therefore, is a neutral
mutation.
The pattern of occurrence of the two types of mtDNA in
this lineage argued against a mutational origin for this
difference, since multiple, identical, but independent

Figure 1. Maternal descendants of registered
Holstein cow, H15. The number refers to
the barn number. H before the number
indicates the animal is a Holstein. B
after the number indicates the animal is
a bull. An asterisk indicates the
animal is alive. A circle indicates
animals whose mtDNA has an additional
Hae III site (i.e. a C at position
12792). A square indicates animals
lacking this Hae III site. All other
animals are dead and unanalyzed.

12
H15
LH709*

13
mutations would have to have occurred. A more likely
hypothesis, which we proposed, was that at least two mtDNA
genotypes existed within this lineage. This is the
hypothesis upon which the present work was predicated. We
decided to look for other differences in the mtDNA of
animals in the H15 lineage which might be linked to the
Hae III difference. We chose to sequence the D-Loop region
since, as mentioned*above, it has been shown to be one of
the least conserved regions of the mitochondrial genome of
animals. This work presents comparisons of the nucleotide
sequence of the D-Loop region of many animals within the H15
lineage as well as several other animals outside this
lineage. The results described below have broad
implications toward our understanding of how mtDNA variation
is generated, and how the mitochondrial genome is inherited.

CHAPTER II
MATERIALS AND METHODS
Animals
A
All animals used in this study were maintained at the
University of Florida Dairy Research Unit (DRU) under closed
genetic conditions. All Holstein cows or bull calves were
registered with the Holstein-Freisian Association of
America. With the exception of the founding maternal
ancestor, H15, all animals in the H15 maternal lineage were
born, bred and maintained at the DRU. Holstein H15
(registration number 3797669) was born October 3, 1953, and
purchased on February 15, 1955. She has since given rise to
56 female descendants at the DRU, which comprise the current
H15 maternal lineage (Fig. 1). Complete health,
reproduction, and genetic records are available for all
animals.
Isolation of mtDNA
Mitochondria were isolated from liver or brain tissue
by homogenization followed by differential centrifugation.
The mitochondria were then lysed with SDS and subjected to
Cesium chloride-Ethidium bromide density gradient
centrifugation to isolate the mtDNA (57).
14

15
For experiments analyzing the 7S DNA of the D-Loop,
fresh brain tissue was used. An entire bovine brain
(approx. 300 grams) was minced with an electric knife in
1 ml/gm MSB-Ca++ (0.21 M Mannitol, 0.07 M Sucrose, 0.05 M
Tris-HCl pH 7.5, 0.003 M CaC^) The chopped tissue was
strained through gauze and homogenized in a ground glass
40 ml homogenizer. It was then subjected to five strokes
through a dounce hoinogenizer. Sodium EDTA was added to a
final concentration of 10 mM and the homogenate was
centrifuged at 700 g for 5 minutes. The supernatant was
saved and again centrifuged at 700 g. The supernatant was
then centrifuged at 20,000 g for 20 minutes and the crude
mitochondrial pellet was resuspended in MSB-EDTA and
centrifuged again at 20,000 g for 20 minutes. The
mitochondrial pellet was resuspended in 0.1 M NaCl, 0.05 M
Tris-HCl pH 7.5, 10 mM EDTA, lysed with 1% SDS, and
immediately subjected to Cesium-chloride-Ethidium bromide
buoyant density centrifugation at 160,000 g for 72 hours.
The form I band, visualized under ultraviolet light, was
collected and the ethidium bromide was removed by extraction
with N-butanol saturated with 5 M NaCl followed by ethanol
precipitation to desalt and concentrate the sample. An
aliquot was checked for purity by electrophoresis on 1%
agarose and staining with ethidium bromide.

16
Construction of mtDNA Recombinant Plasmids
Many of the mtDNA clones used in this study were
isolated by Dr. M.J. Van de Walle, Mr. G.S. Michaels and
Ms. K.B. Brown. The plasmids pBR322 and pACYC184 (58) were
the cloning vfectors used. The plasmid pBR322 has a single
Pst I site in the ampicillin resistance gene and a single
Bam HI site in the tetracycline resistance gene. The
plasmid pACYC184 ha a single Eco RI site in the
chloramplenical resistance gene. MtDNA is cut twice by
Pst I, and three times each by Bam HI and Eco RI (Fig. 2).
For cloning Pst I mtDNA fragments, Pst I cleaved
purified mtDNA and Pst I cleaved pBR322 DNA (treated with
1 unit of Bacterial Alkaline Phosphatase for 15 minutes at
37C followed by phenol and ether extraction) were mixed in
approximately equimolar ratios. In vitro ligation was done
overnight at 4C in 1 mM ATP, 1 mM DTT, 10 mM Tris-HCl pH
7.4, with 1-5 units of T^ ligase. The ligated DNA was then
transfected into E. coli strain HB101 using the procedure of
Kuschner (59) except that the cells had been frozen and
were thawed just prior to transfection as described by
Morrison (60). The transfected culture was then plated onto
agar containing tetracycline (20 ug/ml). Tetracycline
resistant (Tet ) colonies were replicated onto agar
containing ampicillin (100 ug/ml). Tetr, ampS colonies were
then screened for the presence of mtDNA sequences by
32
hybridization of a P-labelled mtDNA probe to bacterial
lysates immobilized on nitrocellulose filters (61) and

Figure 2. The restriction endonuclease map of
mitochondrial DNA from Holstein cow
H493. The maximum error in map
positions is 0.3 map units (57).

18

19
identified by autoradiography. Plasmid DNA isolated from
positive colonies was then screened by restriction enzyme
analysis and electrophoresis of the fragments on 1% agarose.
In some cases, the agarose gels were blotted onto
. 32
nitrocellulose (62) and hybridized to P-labelled mtDNA
followed by autoradiography. The same basic protocol was
used to clone Bam HI mtDNA fragments into pBR322, and Eco RI
fragments into pACYtl84, except tht Bam HI clones were
screened for ampicillin resistance and tetracycline
sensitivity and Eco RI clones were screened for tetracycline
resistance and chloramphenical sensitivity.
Isolation of Plasmid DNA
Recombinant plasmid DNA containing mtDNA was isolated
from one liter cultures by a modification of the method of
Guerry et al. (63). Cultures were grown at 37C in Luria
broth containing the appropriate antibiotic to a Klett unit
of 90-110, and then preferential replication of plasmid DNA
was induced by the addition of chloramphenicol (170 ug/ml)
to the medium. Cultures were then grown an additional
16-20 hours. The cells were then pelleted at 1000 g, washed
with cold 10 mM NaCl and resuspended in 6 ml 0.9% Glucose,
20 mM MEDTA, 20 mM Tris-HCl pH 8.0. Fresh lysozyme
(2 mg/ml) was added and the cells were kept on ice
30 minutes. Then 12 ml of 0.8% NaOH, 1% SDS was added while
gently mixing to lyse the cells. Nine milliliters 3 M
Potassium Acetate, pH 4.8, was added and the solutions mixed

20
well by inversion. The precipitate was pelleted at
15,000 rpm for 30 minutes and the supernatant saved. Ten
milliliters 30% Polyethylene Glycol 6000 was added (final
concentration 7.5%) and the solution was mixed by inversion.
The mixture was kept on ice for 2 hours to precipitate the
plasmid DNA. The precipitate was centrifuged at 600 g for
5 minutes. After discarding the supernatant the white
pellet was resuspended in 2 ml 50 mM Tris-HCl pH 8.0, 1 mM
EDTA and treated with RNase (20 ug/ml) for 30 minutes at
37C. The solution was then diluted to 10 ml with 50 mM
Tris-HCl pH 7.4 and phenol extracted twice, chloroform
extracted once and then precipitated with 25 ml ethanol at
-70C for 1 hour. The precipitate was then pelleted at
10,000 rpm for 1 hour, vacuum dried and resuspended in 2 ml
25 mM Tris-HCl pH 7.4, 100 mM NaCl, and 1 mM EDTA. The
plasmid DNA was further purified by Acrydine-yellow
chromatography (64).
Rapid Isolation of Plasmid DNA
Cells from a 50 ml culture were pelleted and
resuspended in 100 ul 0.9% Glucose, 20 mM EDTA, 20 mM
Tris-HCl, pH 8.0 in a 1.5 ml microfuge tube. The cells were
treated with lysozyme as described above, and lysed with
200 ul 0.8% NaOH, 1% SDS after the addition of 1 ul
Diethylpyrocarbonate (DEPC). One hundred fifty ul of 3 M
Potassium Acetate was added and the mixture kept at 4C for
2 hours. The precipitate was pelleted in a microfuge for

21
10 minutes and the supernate transferred to another
microfuge tube. The DNA was then precipitated by the addi
tion of 1 ml of ethanol. After 10 minutes at -70C the DNA
was pelleted in a microfuge for 10 minutes and the pellet
vacuum dried.' The pellet was resuspended in 100 ul 10 mM
Tris-HCl pH 7.4, 5 mM EDTA, phenol-chloroform extracted
twice, chloroform extracted once, brought to 250 ul with
0.3 m Na Acetate and precipitated with 700 ul ethanol at
-70C for 10 minutes. After pelleting in the microfuge, the
DNA (20-30 ug) was ready for cleavage with restriction
enzymes and end-labelling with large fragment of E. coli
Polymerase I for eventual sequencing.
Restriction Enzymes
All restriction enzymes were purchased from Bethesda
Research Laboratories (BRL), or from Biolabs, Inc. Digests
were carried out in 20 mM Tris-HCl pH 7.5, 100 mM KC1, 1 mM
DTT, 0.1 mg/ml gelatin, 7 mM MgC^ using 0.2-1.0 units of
enzyme per ug of DNA at a DNA concentration of approximately
100 ug/ml, for 1-4 hours at 37C.
Agarose Electrophoresis
Restriction digests of plasmid and mtDNA were analyzed
by electrophoresis in 1% Agarose gels (6 x 6 x 0.5 cm) in a
horizontal apparatus for 1-4 hours at 100-200 V
(100-200 mA) The electrophoresis buffer contained 50 mM
Tris-HCl, 20 mM Na Acetate, 18 mM NaCl, pH 8.2.

22
Southern Blotting
DNA electrophoresed into 1% agarose was transferred to
nitrocellulose by a procedure modified from Southern (62).
The DNA was denatured in situ by immersion in 1 M KOH for
30 minutes followed by neutralization by the addition of 1 M
Tris-HCl, pH 7.0, for 40-60 minutes or until the pH was
stable at 7.0. The gel was soaked for 45 minutes in
6 x SSC, pH 7.4 and*placed beneath a nitrocellulose filter
cut to the size of the gel. After blotting overnight with
absorbant paper to transfer the DNA to the filter, the
filter was washed in 2 x SSC and baked for 2 hours at 80C
in a vacuum oven.
Radiolabelling mtDNA
MtDNA or cloned mtDNA was labelled with 32P-dCTP
(specific activity 400 Ci/mMole, Amersham Corp., Arlington
Heights, Ill.) by a modification of the procedure of Rigby
et al. (65). One-half to one ug of DNA was incubated in 50
mM Tris-HCl pH 7.4, 5 mM MgCl2, 10 mM 2-ME, 10 ug B5A,
0.2 mM each of dGTP, dATP and dTTP, 20 mCi -32P-dCTP
( 400 Ci/mM), 1 ng pancreatic DNase (Worthington) 1 unit of
E. coli DNA polymerase I (BRL) in a total volume of 100 ul
for 4 hours at 15C. The reaction was stopped by the
addition of 10 mM EDTA, 20 ug tRNA (Sigma), and 200 ul 0.3 M
3 2
Na Acetate. The unincorporated P-dCTP was removed by two
cycles of ethanol precipitation of the DNA or by passing the
DNA over a G-50 Sephadex (Pharmacia) column (0.5 x 5 cm) in

23
7
2 x SSC. Specific activities of 1-5 x 10 cpra/ug DNA were
obtained.
Filter Hybridization and Autoradiography
Hybridization of the radioactive mtDNA fragments
transferred to nitrocellulose was done by a modification of
the method of Denhardt (66). The nitrocellulose filters
were pre-hybridized*in 6 x SSC, 0.08% ficoll, 0.08%
polyvinylpyrolidine, 0.02% BSA, in a 100 ml volume for
6 hours at 68C. The filters were then hybridized in the
32
same solution plus tRNA (50 ug/ml) to a P-labelled mtDNA
probe (10 ng/ml) (denatured by boiling 10 minutes and
quick-chilling on ice) for 16-24 hours at 68C. Following
the hybridization the filters were washed at room
temperature in the prehybridization solution for one hour,
in 0.1 M KPO^ for one hour, in 1 x SSC 0.6% SDS twice for
one hour each time, and finally rinsed in 1 x SSC. The
filters were dried at 80C in a vacuum oven and exposed to
XAR-5 Kodak X-Ray film in a light tight cassette for l-3d at
-70 C.
Grunstein-Hogness Blots
Bacterial colonies were screened for the presence of
mtDNA by a modification of the Grunstein-Hogness procedure
(61). The filter was then soaked in 0.5 N NaOH for
7 minutes, equilibrated in 1 M Tris-HCl pH 7.4 for 1 minute,
and then in fresh 1 M Tris-HCl, pH 7.4 for 5 minutes. The

24
filter was soaked in 1.5 M NaCI, 0.5 M Tris-HCl, pH 7.4, for
5 minutes and then dried on a vacuum manifold. The filter
was then treated with Proteinase K (Sigma) (2 mg/ml) in
1 x SSC for 20 minutes at room temperature and then rinsed
in 1 x SSC. "The filter was dried under a lamp until chalk
white and then dipped in chloroform for 2 minutes and dried.
After soaking in 2 x SSC for 2 minutes the filter was dried
for 2 hours at 80C in a vacuum oven. The filter was then
32
hybridized with a P-labelled probe as described above.
End-Labelling of mtDNA Fragments
MtDNA restriction fragments were end-labelled for
sequencing purposes by one of three procedures.
1. 5' end-labelling with T^ Polynucleatide kinase (PNK)
and 32P dATP
Polyacrylaminde gel purified fragments were treated for
15 minutes at 37C with 1 unit of Bacterial
Alkaline Phosphatase in 50 mM Tris-HCl pH 8.0. They
were then phenol extracted, ethanol precipitated, dried
and resuspended in 20 mM Tris-HCl pH 7.6, 1 mM
spermidine, 0.1 mM EDTA, 10 mM MgCl2, 5 mM DTT and
20 units of PNK in a volume of 20 ul. This reaction
mixture was added to vacuum dried 100 uCi
32
P-dATP (410 Ci/mM, Amersham Arlington Heights,
Ill.), and incubated for 30 minutes at 37C. The
reaction was stopped by the addition of 1 ul of 0.5 m

25
EDTA, 200 ul 2.5 M NH4 Acetate, 1 ul tRNA (20 mg/ml)
and then the DNA precipitated with 700 ul of ethanol at
-70C for 10 minutes.
2. 31 end-Labelling with Terminal Deoxynucleotydyl-
transferase (Tdt)
Purified mtDNA restriction fragments were 3 end-
labelled with Tdt according to the method of Tu and
Cohen (67). The DNA was added to 100 uCi of Cordycepin
32
5' triphosphate [ P] (3000 Ci/mM Amersnam) in a 20 ul
reaction volume containing 25 mM Tris, pH 7.0, 100 mil
Potassium cacodylate, 1.0 M CoCl^, and 0.2 mM DTT.
After adding 12 units of Tdt (BRL) the mixture was
incubated at 37C for 30 minutes and the reaction
stopped by the addition of 2 ul 0.5 M EDTA, 200 ul NH^
Acetate, 2 ul tRNA (10 mg/ml). The DNA was then
precipitated with 700 ul of ethanol at -70 for
10 minutes.
3. 3' end-labelling with large fragment of E. coli
Polymerase I
Restriction fragments were incubated in 50 ul 20 mM
Tris-HCl pH 7.4, 7 mM MgCl2, 100 mM KC1, 1 mM DTT,
100 ug/ml gelatin with 50-100 uCi 22P-d-GTP
(3000 Ci/mM) for Bam HI or Hae III sites. After adding
2 units of Large Fragment Pol I (BRL) the reaction was
left at room temperature for no more than 5 minutes and

26
stopped by addition of 2 ul 0.5 M EDTA, and heated to
60C for 10 minutes. After adding 200 ul 0.3 M Na
Acetate, the labelled DNA was ethanol precipitated at
-70C for 10 minutes.
Following end-labelling by any of the above protocols,
the strands of the fragment, labelled at both ends (either
both 3' or both 5' ends) were separated by incubation in
0.1 N NaOH for 10 minutes at room temperature or the
fragment cut with a second restriction enzyme. The products
were then separated by electrophoresis on a 6%
polyacrylamide gel (16 cm x 40 cm x 3 mM) at 200 V (20-40 m
A) for 12-16 hours. The gel was then exposed to cronex 4
X-Ray film (Dupont) for 1-4 hours.
Many of the sequences presented in this work were done
from cloned mtDNA insolated by the rapid isolation method
described above. A typical protocol was to restrict the DNA
of a 50 ml culture of an Eco RI A clone with Bam HI, and
32
Bgl II. These fragments were then labelled with P-GTP
and large fragment of E. coli Polymerase I. These 3'
end-labelled fragments were then cleaved with Hpa I, Pst I
and Cfo I, and then run on a 6% polyacrylamide preparative
gel, and analyzed by autoradiography. As Figure 3 shows
this yielded three well separated bands, two D-loop region
fragments, Bam HI-Hpa I and Bam HI-Pst I, and one URF-5
fragment, Bgl II-Cfo I, which were ready for sequencing (see
below).

Figure 3. Autoradiograph of preparative 6%
polyacrylamide gel. Plasmid DNA from a
50 ml culture of clone 22-1 (an Eco RIA
clone of the mtDNA from H624) was
restricted with Bam HI and Bgl II, 3'
end-labeled with large fragment of Pol I
and P-GTP, and then restricted with
Hpa I, Pst I and Cfo I. This gives
three well separated bands. A. Bam HI-
Hpa I. B. Bam HI-Pst I. C. Bgl II-
Cfo I. Bands A and B are fragments in
the D-loop region. Band C is a fragment
which is in the URF-5 gene.

28

29
Polyacrylamide Gel Electrophoresis
Restriction fragments were isolated by electrophoresis
on 6% polyacrylamide gels (16 cm x 40 cm x 3 mM) in a 50 mM
Tris pH 8.3 0. M Borate, 1 mM EDTA (TBE buffer) at 200 V
(20-30 m A) 12-16 hours. After electrophoresis,
32
P-labelled fragments were visualized by autoradiography.
Unlabelled fragments were stained with Ethidium bromide
(2 ug/ml) and visualized under ultraviolet light.
Extraction of Restriction Fragments from the Acrylamide Gel
Restriction fragments were cut out of the acrylamide
gel with a scalpel, and extracted by crushing the gel with a
glass rod followed by incubation for 12 hours at 37C in
0.5 M Ammonium acetate, 10 mM Magnesium acetate, 0.1% SDS
and 5 ug/ml tRNA (the tRNA was omitted if the fragment was
later to be labelled with PNK). The solution was then
passed over siliconized glass wool to retain the gel and
allow collection of the eluted DNA. The DNA was then
precipitated several times with ethanol at -70C.
DNA Sequencing
All sequencing was done according to the method of
Maxam and Gilbert (68). Purified end-labelled fragments
were divided into five aliquots and subjected to the base
modification reactions using dimethylsulfate (for Guanine),
hydrazine (for cytosine and thymidine) hydrazine in 1.5 M
NaCl (for cytosine only), Sodium hydroxide (for adenosine

30
cytosine), and pyridinium formate (for adenosine and
quanine). Base displacement and strand scission reactions
were done with 0.1 M Piperidine. The products of the
sequencing reactions were analyzed by electrophoresis on 8,
12 or 20% polyacrylamide 7M urea gels (16 cm X 40 cm x
0.3 mm, or 32 cmx 40 cmx 0.3 mm, or 32 cmx 80 cmx
0.3 mm), followed by autoradiography at -20C with either
Cronex 4 X-Ray film* (Dupont) or Xar-5 X-Ray film (Kodak).

CHAPTER III
RESULTS
Sequence of the mtDNA D-Loop Region of H15 Holstein Cows
All sequences presented, unless stated otherwise, were
determined from cloned DNA and are Light Strand sequences.
Clones which contained D-Loop region sequences included
Pst I A clones, Bam HI A clones, Bam HI C clones and Eco RI
A clones (Figure 4). Almost all 912 nucleotides between the
Proline and Phenylalanine tRNA genes were determined from
cloned DNA of three animals, H493 an Lg animal, and H634-and
H1009B, L^ animals (Figure 1). Figure 5 shows the
restriction enzyme sites used for sequencing and the
direction sequenced. Figure 6 shows the actual nucleotide
sequence of the D-Loop region as determined from cloned
mtDNA of these animals. Our sequence is virtually identical
to the sequence of Anderson et al. (9) except for four
transitions at position 16074, 16079, 16231 and 16250 using
the numbering system of Anderson et al. (9) which will be
used throughout this work. The sequence of clones of H493
differs from the sequence of clones of H634 and H1009B at
all four of these positions, but the sequence of each animal
differs from the sequence of Anderson et al. (9) at only
31

Figure 4. Genomic map of bovine mtDNA with cloned
restriction fragments used in this
study, indicated.

CO /
CYT B

Figure 5. Partial cleavage map and sequence
strategy of the D-Loop region.
Endonuclease sites employed during
sequencing are shown. The arrows
indicate the direction and length of
the fragments sequenced. The solid
circles indicate 5' end-labeled
fragments. All others were 3
end-labeled. The scale below
indicates base pairs.
I

Pst I
35
5
->
Clone
11-1
11-1
11-2
11-3
>- >- 5 <
*
>-
<
91-1
91-1
91-2
91-3
95-85
95-3
95-87
95-13
95-P
- 22-1
-6 87-A
* 5*
24-7 -
M24
35-3
35-H
43-5
M43
<
*-
<
<-
<
<-
-K-
33-1
709F
32-8
9A-1
576G
86-1
90-1
78-7
80-17
94-4
WB-1
WB-17
200
400
600
800

Figure 6.
Sequence of the D-loop obtained from
cloned DNA from Hostein cows H493, H634
and H1009B. The L-strand sequence
(5'-3') is shown. The numbering system
is from Anderson et al. (9). At
positions 16074, 16078, 16231 and
16250 both of the bases noted from
different animals are shown (see text).

Pst I
Pro t RNA
<-
AAGACjTCAAGGAAGAAACTGCAGTCTCACCATCAACCCCCAAAGCTGAAGTTCTATTTAAACTATTCCCljGAACACTATTAATATAGTTCCATAAATACAAAGAGCCT
15810
TATCAGTATTAAATTTATCAAAAATCCCAATAACTCAACACAGAATTTGCACCCTAACCAAATATTACAAACACCACTAGCTAACATAACACGCCCATACACAGACCA
15910
CAGAATGAATTACCTACGCAAGGGGTAATGTACATAACATTAATGTAATAAAGACATAATATGTATATAGTACATTAAATTATATGCCCCATGCATATAAGCAAGTAC
160 10
T G
ATGACCTCTATAGCAGTACATAATACATA AATT TTGACTGCACATAGTACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTTACCATTAGAT
C A I1T 161 10
Bam HI _
cacgagcttaattaccatgccgcgtgaaaccagcaacccgctggcagc/gatccctcttctcgctccgggcccataaa cgtgggggtcgctatccaatgaattttac
,62,o C G
CAGGCATCTGGTTCTTTCTTCAGGGCCATCTCATCTAAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGGACTAATGGCTAATCAGCCCATGCTCACACA
16310 I 10
TAACTGTGCTGTCATACATTTGGTATTTTTTTATTTTGGGGGATGCTTGGACTCAGCTATGGCCGTCAAAGGCCCTGACCCGGAGCATCTATTGTAGCTGGACTTAAC'
110
TGCATCTTGAGCACCAGCATAATGATAAGCATGGACATTACAGTCAATGGTCACAGGACATAAATTATATTATATACCCCCCCTTCATAAAAATTTCCCCCTTAAATA
21 0
TCTACCACCACTTTTAACAGACTTTTCCCTAGATACTTATTTAAATTTTTCACGCTTTCAATACTCAATTTAGCACTCCAAACAAAGTCAATATATAAACGCAGCCCC
' 310 t u T
Hpa I
CCCCCCCCC^TTGATGTAGCTTAACCCAAAGCAAGGCACTGAAAATGCCTAGATGAGTCTCCCAACTCCATAAAC/jcATAGGTTTGGTCCCAGCCTTCCTGT^AACTC
PhetRNA 4,0 I2s r.RNA
D-LOOP TEMPLATE STRAND
(5 >3)
U)

38
two of the four positions (Figure 7). The pattern of
occurrence and significance of these base transitions is
discussed below.
Anderson et al. (9) compared the human and bovine
D-Loop region nucleotide sequence and confirmed the previous
observation of the marked divergence in this stretch of DNA
in the mammalian mitochondrial genome. They did note,
however, eleven blocks of homology mainly confined to the
region of the 7S DNA, i.e. in the middle of the D-Loop
region. All four of the differences we have observed occur
in the middle of the D-Loop region, within the confines of
the 7S DNA which we have mapped (see results below). Three
of the differences are in conserved blocks (H, I and E,
see 9), but only two are bases conserved between human and
cow. The importance of the specific positions involved, if
any, is unclear, but the fact that the differences all occur
within the region of the 7S DNA may be an important
observation (see discussion below).
D-Loop Sequences of Other H15 Animals
Figure 1 shows the pedigree of the H15 maternal lineage
of Holstein cows. As mentioned previously, it had been
shown (55) that animals within the lineage fall into two
types, those whose mtDNA has a C at base 12792 in URF-5 (L
s
animals) and those whose mtDNA has a T at base 12792 in
URF-5 (L^ animals). In comparing the nucleotide sequence of

Figure 7. Schematic of sequence of URF-5 and
D-loop of mtDNA from H15 animals and
the sequence of Anderson et al. (9).
1. H634 and H1009B. 2. Sequence of
Anderson et al. 3. H493. Lines
indicate identity. D-loop region
sequenced is shown in Figure 5. a, b,
c, d, e, positions 12792, 16074, 16079,
160231, and 160250, respectively.

URF-5
D-LOOP
*
-T-^ T-G
-C-\ T-A C A 2
C-A C G 3
a
b
c
d
e

41
the D-Loop region of H493 (an L animal) with H634 (an L
S Li
animal), four nucleotide differences were observed at the
positions noted in Figure 6. These sequences were multiply
determined from three independent clones of H493 (11-1,
11-2, 11-3) a"nd six clones of H634 (95-3, 95-6, 95-13,
95-85, 95-87 and 95-P). The sequence of all clones from one
animal was identified. In other words, the mtDNA of these
two animals differed not only at position 12792 in URF-5,
but at four other bases several thousand bases away in the
D-Loop region (Figure 7). This, in effect, proves that H493
and H634 had mtDNA of two separate genotypes. This also
supports the idea that L and LT represented two genotypes
within the HI5 lineage. Alternatively, many genotypes which
fall into two classes, L and L could exist in the
S ^
lineage.
To distinguish between these two possibilities, the
D-Loop region was sequenced across the stretch of DNA
containing the four differences from cloned DNA from seven
other Lt animals and four other L animals. All seven LT
animals' (H496, H501, H737B, H997B, H512, H576 and H709, see
Figure 1) D-Loop region sequences were identical to each
other and to H634. That is, all had a T at position 12792
in URF-5 (H709 was not sequenced in this region but did not
have the Hae III site and is presumed to also have a T here)
as well as the same four bases as H634 and H1009B at
positions 16074, 16079, 16231 and 16250 and all other bases

42
sequenced in this region. Therefore, we have identified an
Ll genotype represented in all nine animals analyzed.
The situation with regard to the Lg animals is more
complicated. Two animals, H624, the daughter of H493 and
H393, had the' identical sequence to H493 in the D-Loop
region. However, as Figure 8 shows, H455 and H949B each had
a different combination of bases at the four critical
positions in the D-Loop (16074, 16079, 16231 and 16250) at
which all animals differ from H493. No other base
differences were noted among these animals. Thus, at least
three Lg genotypes have been documented within the H15
maternal lineage.
The uniqueness of these observations necessitated
ruling out an artifact of cloning. Therefore, the D-Loop
region was sequenced from mtDNA isolated from liver tissue
of H455. The sequence derived is identical to the sequence
of the clone of H455 (24-7) in a region which spans the four
variable positions (16974, 16079, 16231 and 16250). This
result, plus the fact that all clones from one animal are
the same (for one exception see below), supports the concept
that the differences we observe do represent various
genotypes, and are not artifacts of the cloning process.
Sequence of Clones of H1009B
One clone (91-3) of H1009B, an animal, has a D-Loop
region sequence which is identical to all other LT D-Loop
j

Figure 8. Schematic of sequence of URF-5 and
D-loop of mtDNA. Lines indicate
identity. D-loop regions sequenced are
shown in Figure 5. a, b, c, d, e,:
positions 12792, 16074, 16079, 16231,
and 16250, respectively. 1. H496,
H501, H737B, H997B, H512, H576, H709,
H634 and H1009B. 2. H455.
3. Sequence of Anderson et al. 4.
H949B. 5. H493, H624, and H393.
6. J49 (Jersey) and H992B (Guernsey).

URF-5
D-LOOP
T-^ T-G T A- i
.A'
-C^ T-A T A 2
C-^ TA C A 3
-C^ T- G C G 4
-C-^ c-A C G5
6

45
sequences (Figure 7). However, two other clones (91-1 and
91-2) of H1009B differ from all other sequences by a
C to T transition at position 16295 (Figure 9). This
represents the only difference between clones derived from
one animal reported in this work. Two types of mtDNA
molecules, differing by one base in the D-Loop region,
appear to have been cloned from one animal. Of course,
analysis of many mote clones of H1009B as well as sequence
of tissue mtDNA is necessary to confirm this result.
However, if it holds up, this observation is direct evidence
for heterozygosity of the mtDNA of the somatic cells of
H1009B.
Summary of Holstein mtDNA Sequence Data
Figure 8 shows a comparison of all the sequences of
mtDNA of Holstein cows described in this work. Below is a
summary of the data on the H15 lineage.
1. Clones of nine LL animals (whose mtDNA has a T at
position 12792 in URF-5) have the same D-Loop region
sequence at least over the bases sequenced (Figure 8).
2. Clones of Lg animals (whose mtDNA as a C at position
12792 in URF-5) exhibited three types of D-Loop
sequences characterized by identical sequences except
for various combinations of transitions at position
16074, 16078, 16231, and 16250 (Figure 8). At all
other bases the L sequences were the same as the L
S Xj

Figure 9. Schematic of sequence of URF-5 and
D-loop region of mtDNA. 1. H1009B
clone 91-3 and all other L animals (see
Text). 2. H1009B clones yl-1 and 91-2.
a, b, c, d, e,: positions 12792, 16074,
16079, 16231, 16250 and 16295,
respectively.

47
URF-5
D-LOOP'
~ T^ T G T A C-i
a
T A T-2
d e f

48
sequences, but no Lg D-Loop had the same four bases at
the four critical positions as the LL D-Loop sequence.
3. Two clones (91-1, 91-2) of H1009B had a single base
difference (C to T transition) in the D-Loop at
position" 16295 which distinguished it from one other
clone (91-3) of H1009B as well as all other LT and L
Li s
animals.
4. Among all the 615 D-Loop sequences, four positions
(16074, 16079, 16231 and 16250) appear to be variable
and all other bases sequenced are uniformly constant
(except for the one clonal difference noted above).
5. Of the sixteen possible combinations of these four
4
bases (2 assuming transitions only) four have been
observed and the sequence of Anderson et al. (9)
represents a fifth.
6. All mtDNA sequence differences between cows are base
transitions.
D-Loop Region Sequence of a Holstein
Cow Outside the H15 Lineage
H567 has no common ancester with H15 for over one
hundred years. The mtDNA of this animal is L according to
s
its Hae III restriction pattern (55) and thus had to have a
C at position 12792 in URF-5. The D-Loop region of the
mtDNA of this animal was sequenced from both cloned DNA and
liver tissue mtDNA (Figure 5). The D-Loop sequence of H567
is identical to H455, an L^ animal in the H15 lineage

49
(Figure 8). This result suggests that at least one of the
genotypes found in the H15 lineage may exist outside the
lineage. Of course other differences in bases not sequenced
may exist. However, if this does represent the same
genotype, thet this genotype, and probably other genotypes
in the H15 lineage, existed prior to the start of the
lineage.
*
D-Loop Sequences of Cattle of Breeds Other Than Holstein
A limited number of bases were sequenced from cloned mt
DNA of animals of other cattle breeds. Figure 8 shows the
D-Loop sequences of cloned mtDNA from a Jersey (J49, clone
94-4), a Guernsey (H992B, clone 78-7) and an Angus (704,
clone 80-17). The Jersey and Guernsey sequences are
identical in the approximately two hundred bases sequenced,
and they are identical to H455 of the H15 lineage. The
Angus sequence differs from the Jersey and Guernsey
sequences only at one position, a T to C transition at base
16042. This difference may reflect a more distant ancestry
of Angus cattle (beef cattle) with the Holstein, Jersey and
Guernsey cattle (dairy cattle). Further sequencing of the
mtDNA of these other breeds in the D-Loop especially across
base pair 16231 and 16250 needs to be done to delineate how
these breeds' mtDNA relates to Holstein mtDNA. However, the
identity of the bases sequenced from these breeds with a
Holstein sequence suggests that at least some of the mtDNA

50
genotypes may have existed prior to the domestication of
cattle.
D-Loop Region Sequence Comparisons of Animals
of the Order Artiodaclyla, Family Bovidae
Figure 10 shows a taxonomic tree of the order
Artiodactyla with the Bovidae Family expanded. It is shown
to emphasize the utility of this order for the study of
*
mtDNA evolution. It is one of the largest orders of
mammals, and there are four genera of Bovidae: Syncerus,
Bubalus, Bison and Bos, all of which have a common ancester
with Bos tenrus (European cattle) within ten million years
(69). There is some controversy but Sinclair (69) believes
that the fossil, biochemical, and behavioral evidence favors
a closer relationship between Syncerus (African Buffalo)-and
Bubalus (Asian Water Buffalo) than either buffalo has with
Bison and Bos. He estimates a five to six million year
divergence between these buffalo and Bos and Bison, whereas
Bos and Bison diverged from each other two to three million
years ago. There are many extant species of each of these
genera, particularly in the genus, Bos. DNA sequence
comparisons of the mtDNA from these animals will enable us
to place the D-Loop variation we observe in Bos taurus in an
evolutionary perspective. Figure 11 shows a partial D-Loop
sequence of Bubalus arnee (Water Buffalo) aligned with the
Holstein cow sequence. The region sequenced spans the four
variable positions in the cow. A total of 35 sequence

Figure 10.
Taxonomic tree of the Order
Artiodaclyla (from reference 70).

ORDER
SUBORDER INFRAORDER SUPERFAMILY FAMILY
SUBFAMILY
GENUS SPECIES CQMON
-TYLOPODA-
ARTIODACTYL
(even-toed
ungulates)
rNONRUMINATIA-
-SUOIDEA-
rSUIDAE
(OLD WORLD pigs)
TAYASSUIDAE
-ANTHRACOTHERIOIDEA HIPPOPOTAMIDAE
v
rTRAGULINA-
RUMINANTIA-
lPECORA-
- CAMELIDAE
(CAMELS & LLAMAS)
-TRAGULIDAE
(CHEVROTAINS)
rCERVIDAE
(deer)
GIRAFFIDAE
BOVIDAE
-ANTILOCAPRIDAE
r-ARNEE
PBUBALUsJ
rCEPHALOPHINAE
-NEOTRAGINAE
-TRAGELOPHINAE
BOVIDAE
-ALCELAPHINAE
-HIPPOTRAGINAE
-REDUNCINAE
-ANTI LOPINI
-CAPRINAE LnicnM
(SHEEP & GOATS)^1S0N
lSAIGINAE
rSYNCERUS
-AFRICAN
BUFFALO
WATER
BUFFALO
-BOS-
LDEPRESSICORNIS
rGAURUS
-JAVANICUS
-SALIVE LI
-TAURUS OX
DOMESTIC
-INDI CUS-OX
DOMESTIC
L-INimJS-
rBISON -
YAK
AMERICAN
BUFFALO
-BONASUS EUROPEAN
BUFFALO

Figure 11. Sequence of middle of the D-loop of cow
and water buffalo mtDNA. Numbering
system is from Anderson et al. (9).

54
IfeoTV ¡o 71
ATGACCTCTATAGCAGTACATAATACATATAATTATTGACTGTACATAG
COW
A-GCGAT G TC-
WB
TACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTT
COW
CTA C C
WB
ACCATTAGATCACCGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC
COW
C G
WB
/
GCTAGGCAGGGATCCCTCTTCTCGCTCCGGGCCCATAAACCGTGGGGGT
COW
TTC GTTAT
WB
lbi.SC
CGCTATCCAATGAATTTTACCAGGCATCTGGTTCTTTCTTCAGGGCCAT
COW
A TT- A- -
WB
CTCATCTAAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGG
COW
TCT -
WB
ACTAATGGCTAATCAGCCCATGCTCACACATAACTGTGCTGTCATACAT
COW
T
WB
TTGGTATTTTTTTATTTGGGGGATGCTTGGACTCAGCTATGGCCGTCAA
COW
WB
AGGCCCTGACCCGGAGCATCTATTGTAGCTGGACTTAAC
COW
WB

55
differences (one deletion, two insertions, eleven
transversions, and twenty-one transitions) were noted out of
a total of 401 bases sequenced in this region of the D-Loop.
This represents an 8.6% sequence divergence as compared to
the 10% divergence seen between these animals in the
cytochrome b gene (K. Brown, personal communication). Thus,
these results are consistent with a 1.9% change in sequence
per million years divergence for a pair of species, assuming
an approximately five million year divergence between water
buffalo and cow (69) Unfortunately, no other D-Loop region
sequence comparisons between closely related species have
been done. It appears though, that this region is not more
variable than the rest of the genome, and is probably more
conserved. This is in line with D-Loop comparisons between
more distantly related species, i.e. human-cow (9) and
mouse-human (46) comparisons. This observation is important
to our interpretation of the origin of the variability we
observe in this region among Holstein cows (see discussion
below).
Mapping of D-Loop Strand of Bovine mtDNA
It has been shown that newly synthesized D-Loop strands
in animal mtDNA exist as families of species specific
discrete lengths (15,16,17). Human mtDNA D-Loop strands
show 5' heterogeneity but only one 3' termination point
(15). Mouse D-Loops have four 3' termination points, one of
which has two 5' starting points (17). We mapped the D-Loop

56
strand of bovine mtDNA. By 3' end-labelling closed circular
mtDNA isolated from fresh brain tissue only the D-Loop
strand will be labelled. Such a reaction reveals three
major bands on a 4% Acrylamide, 7 M Urea gel (Figure 12,
lane A). The" major bands are approximately 440, 490 and 535
base pairs in length. We mapped the 3' termini of the
D-Loop strands as shown in Figure 13. Lane B of Figure 12
reveals 3 major bands following annealing of the 3'-labeled
D-Loop strand to its complementary strand and cleavage with
Sau 3A. The bands are 200, 250 and 295 base pairs in
length, and thus the differences in length correspond to the
length differences in the uncleaved strands and the
heterogeneity appears to be totally due to 3' heterogeneity
5' labelling needs to be done however to rule out any minor
5' heterogeneity. The minor bands in lane A, Figure 12 may
in fact represent 5' heterogeneity. The minor bands in lane
B, Figure 12 are probably the result of 3'
microheterogeneity as seen by Doba et al. (17). Mapping of
the 5' end of the D-Loop strand (i.e. the heavy strand
origin or C>H) can be determined from the difference between
the uncleaved and cleaved 3' labelled D-Loop strands (lanes
A and B respectively, in Figure 12). Figure 14 shows the
approximate heavy strands origin as well as the 3' termini
indicated on the actual sequence. It is noteworthy that the
four variable bases described above lie within the D-Loop
strand (Figure 14, arrows).

Figure 12. Mapping of 3' termini of D-loop strands
of bovine mtDNA. D-loop strands from
Fpjpn I mt DNA were labeled with Tdt and
p] codycepin and analyzed by 4%
Polyacrylaminde-7M Urea electrophoresis
and autoradiography. Lane A, [ p]
Cordycepin labeled Form I mt DNA
showing three major D-loop strand
species; Lane B, 3'-end-labeled D-loop
strands hybridized with 3' end labeled
complementary single stranded cloned
DNA, then cut with San 3A (^e Figure
13 for protocol); Lane C, [J p]
cordycepin labelled Hae II fragments of
pBR322 as size markers. Sizes are in
base pairs.

58

Figure 13. Schematic of strategy for mapping 3'
termini of the D-loop. 3' end-labeling
of the D-loop strands was according to
Tu and Cohen (67). The complementary
strand to which the D-loop strands were
annealed was a Bam-Pst fragment from
cloned mt DNA which was 3' end-labeled
at the Bam HI site wii^h large fragment
of Polymerase I and p-GTP and then
isolated by strand separation on a
6% Polyacrylamide non-denaturing gel
(see materials and methods).

60
MAPPING OF 3' TERMINI OF THE D-LOOP
*
*
I
Cut with Sau 3A or Rsa I
*
1
7M Urea, 4% Acrylamide Denaturing Gel
or
7M Urea, 20% Acrylamide Sequencing Gel

i
Figure 14. Nucleotide sequence of D-loop region of
bovine mtDNA with heavy strand origin
of replication (0) and approximate
points of major 3^ termini indicated
(arrows). The four variable bases
among the Holstein cows are indicated
(see text).
)

Pst I
P ro t R N A
-<
AACAqrCAACCAACAAACTCCACTCTCACCATCAACCCCCAAACCTCAACTTCTATTTAAACTATTCCC'lteAACACTATTAATATACTTCCATAAATACAAACACCCT
ijc/
l i
TATCACTATTAAATTTATCAAAAATCCCAATAACTCAACACAGAATTTGCACCCTAACCAAATATTACAAACACCACTAGCTAACATAACACGCCCATACACACACCA
|
CACAATGAATTACCTACGCAAGGCGTAATGTACATAACATTAATGTAATAAAGACATAATATGTATATAGTACATTAAATTATATGCCCCATGCATATAAGCAACTAC
160 10
T G v *
ATCACCTCTATACCAGTACATAATACATA AATT TTGACTGCACATAGTACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTTACCATTACAT
C A ,6, ,0
Bam HI T A
CACCACCTTAATTACCATCCCCCGTCAAACCAGCAACCCGCTAGGCAGGJGATCCCTCTTCTCGCTCCCCCCCCATAAA CGTCGGCGTCCCTATCCA TGAATTTTAC
C G
r 621 0
I
CACCCATCTCGTTCTTTCTTCACGGCCATCTCATCTAAAACGGTCCATTCTTTCCTCTTAAATAAGACATCTCGATGGACTAATGCCTAATCACCCCATCCTCACACA
16310 I 10
Oh
TAACTGTCCTCTCATACATTTCGTATTTTTTTATTTTGGCGGATGCTTGGACTCAGCTATGGCCCTCAAAGGCCCTGACCCCGACCATCTATTGTACCTCGACTTAAC
110
TCCATCTTGAGCACCAGCATAATGATAAGCATGGACATTACAGTCAATGGTCACAGGACATAAATTATATTATATACCCCCCCTTCATAAAAATTTCCCCCTTAAATA
210
TCTACCACCACTTTTAACAGACTTTTCCCTAGATACTTATTTAAATTTTTCACGCTTTCAATACTCAATTTAGCACTCCAAACAAAGTCAATATATAAACCCACCCCC
31 0 u T
T H|?aI
CCCCCCCCCjGTTGATCTAGCTTAACCCAAAGCAAGGCACTGAAAATGCCTAGATGAGTCTCCCAACTCCATAAACWCATAGGTTTGGTCCCACCCTTCCTGTTAACTC
4,0 12s r.RNA
>.
Phe tRNA
D-LOOP TEMPLATE STRAND
tsj

CHAPTER IV
DISCUSSION
Several unique observations have been presented. First
multiple mitochondrial genotypes have been identified within
a maternal lineage of Holstein cows. Second, the pattern of
occurrence of these genotypes within the lineage suggests a
mechanism of mtDNA inheritance which allows for rapid
genotypic shift. Finally, the variability among the
genotypes in the D-Loop region exists as various
combinations of transitions at four bases with identity at
all other bases sequenced.
Origin of mtDNA Variation
It has been proposed that the intraspecific variability
of mtDNA is related to strict maternal inheritance of the
mitochondrial genome (38). This mode of inheritance can
lead to maternally isolated gene pools within a breeding
population. Thus, if a variant mtDNA molecule arises in a
female germ line cell, that mtDNA molecule can go on to
predominate in that female's progeny. However, the new
mitochondrial genotype is totally isolated from the
remaining female lines within the species. It is easy,
63

64
therefore, to see how strict maternal inheritance maintains
any variation in mtDNA that might arise within a female
member of a species. The evidence for maternal inheritance
is strong (33,35,42,52,53,54), and there is no reason to
dispute its contribution to the phenomenon of intraspecific
variation. However, this concept is not necessarily
contradictory to our observation of mtDNA variation within a
maternal lineage. MtDNA variation between maternally
related animals may, in fact, represent another level of
polymorphism of mtDNA within a species.
The major question that needs to be dealt with in
understanding mtDNA variation is: how does a variant
molecule become the predominant type of mtDNA within an
organism? The conceptual difficulty lies, of course, with
' 3
the high ploidy of the micochondrial genome, i.e. 1-4 x 10
genome copies per cell (56). Birky (71,72) has dealt with
this issue in the yeast system in which a random segregation
model appears to adequately fit the data. Given a
sufficient number of cell generations there is a finite
probability that a mutant can become the predominant
genotype. Of course, if the mutant offers a selective
advantage to the organism (e.g. antibiotic resistance) the
number of generations it would take to establish the mutant
would be reduced. Certainly though, not all mtDNA mutants
which become fixed have a selective advantage. Otherwise
the rate of mtDNA evolution would be much slower than the
observed rate.

65
In trying to fit a random segregation model to animal
mtDNA, there are several problems with which we must deal.
From the time a mutant arises, until the time it becomes the
predominant genotype, heterozygosity at a significant level
must exist. "Significant heterozygosity has not been
observed in the mtDNA from an individual animal (29), though
we have observed minor amounts of heterozygosity in the
somatic cells of an*individual animal (T.L. Armstrong,
personal communication). It could be argued that the
gradual shift from one genotype to another, which a random
segregation model predicts, only occurs in germ line cells,
and not in somatic cells. However, if this process (i.e.
gradual shift from one genotype to another by random
segregation during cell division) takes more than one animal
generation, by what mechanism can oocyte heterozygosity be
maintained in the presence of somatic cell homozygosity?
Hauswirth and Laipis (73) estimate that it would take at
least twenty animal generations for a mixed population of
mtDNA molcules to become a pure population, assuming
50 mtDNA molecules per oocyte (lower limit) and 100 germ
cell generations (upper limit) and no selective advantage.
We observe four genotypic shifts in the H15 lineage
(Figure 1), one of which occurred in only two generations.
It is difficult to explain these data based upon multiple
mutational events followed by random segregation, over so
short a time span, unless a significant, but inapparent,
selective advantage existed.

66
Two potential sources of mtDNA variation within this
lineage are paternal mitochondria and some kind of effect of
nuclear genes. We have not analyzed the paternal
mitochondrial genotypes, but the frequency of genotypic
shifts which "We observe is not consistent with the total
lack of a paternal effect seen in matings in other animals
(33,35,42,52,53,54). An effect of maternal nuclear genes is
an interesting possibility which cannot be ruled out at
present.
A Limited Number of Maternal Molecules
Determine the Mitochondrial Genotype
We observe one of the HI5 lineage mitochondrial
genotypes outside the lineage (H567 has the same sequence as
H455). It is likely, therefore, that at least some of the
H15 genotypes existed prior to the start of the H15 lineage.
This possibility allows us to postulate that some of the
animals within the lineage are heterozygous for some of the
genotypes. If an animal (e.g. H333 in Figure 1) were
heterozygous for at least two genotypes, one need only
postulate that a minor genotype somehow became the
predominant genotype in only two generations. The logical
conclusion of this is that the mitochondrial genotype of the
progeny is the product of a limited number of maternal mtDNA
molecules by a process of clonal expansion of the minor
genotype. This is a much more attractive hypothesis than
having to propose that at least five mutational events
occurred and were fixed in only two generations.

67
The clonal expansion hypothesis is supported by the
observation that the number of mitochondria is amplified
during mammalian oocyte development. Mature mouse oocytes
contain 100-1000 times as much mtDNA as a somatic cell (25)
and about a fDO fold increase occurs in bovine oocytes (G.S.
Michaels, personal communication). All one needs to
postulate is that a limited number of mtDNA template
molecules fuel the amplification process. It is easy to
envision, by this mechanism, how a shift in the
mitochondrial genotype could occur in a short time (e.g. one
generation), if the minor genotype was chosen as the
template molecule. Admittedly, it is difficult to conceive
how a molecule that represents 5% or less of the total
number could replicate and be amplified at the total expense
of a molecule that represents 95% of the total. However, if
the amplification of the minor genotype occurred only in
that area of the oocyte destined to become germ cells (the
germinal plasm, see 74), then the genotype in the germ cells
of the offspring would differ from the maternal genotype.
Then the somatic cells of the product of fertilization of
those germ cells would display a mitochondrial genotype
different from their maternal grandparent, and a genotypic
shift in two generations would be observed.
Gene Conversion as a Possible Explanation of D-Loop
Sequence Variation Among Holstein Cows
By whatever mechanism it occurs, mtDNA variation within
a maternal lineage of cows represents another level of

68
mtDNA intraspecies polymorphism. Yet another level of
polymorphism, and another mechanism for generating it, is
suggested by our D-Loop sequence data. Figure 9 shows the
mitochondrial genotypes we have observed in the H15 lineage
as well as the sequence of Anderson et al. (9). However one
interprets the pattern of occurrence of these genotypes in
the H15 lineage, the ultimate origin of the genotypes must
lie in a series of mutational events throughout the course
of bovine evolution. In analyzing the various genotypes, it
is impossible to generate all the genotypes by a stepwise
mutational process, starting with either any of the observed
genotypes, or any of a number of theoretical combinations of
these five base transitions, without changing one of the
bases twice. Thus, a strictly mutational process demands
that one of the bases change twice during the time many
other bases have not changed at all. This would suggest
that one or all of these four bases is hypermutable.
Alternatively, some of the bases that appear as unchanged
could have mutated and then back mutated. This argument
would propose that there is nothing especially hypervariable
about these four bases in the D-Loop, but that this whole
region of the D-Loop is hypervariable. Our Water Buffalo
sequence data discredit this argument. The rate of
divergence in this region is slightly less than the average
rate of divergence of mtDNA. Furthermore, four base
differences between cows in a region of approximately nine
hundred bases would represent about 200,000 years of Bos

69
mtDNA evolution (i.e. (4/900 1.9%) x 106 years). Perhaps
this is not unreasonable if one realizes that during cattle
domestication, new breeding stocks were continuously being
formed by introducing non-domesticated maternal animals,
with no recent ancestor to domestic cattle, into the
breeding populations (75). Therefore, it would appear that
the region in which the four bases occur cannot be called
hypervariable, and that the identity of a base between cows
truly reflects the absence of a mutation.
We are thus forced to.return to the problem of how one
or more bases could change twice while other bases remain
unchanged. Random mutation with hypervariability at certain
bases, due to a lack of functional constraints, cannot be
easily dismissed. There is no reason that a relatively
conserved region could not have mutational hotspots.
A more interesting explanation of the D-Loop variation
is suggested by the mechanism of mtDNA replication.
Figure 15 illustrates the proposed model. It has been shown
that newly synthesized D-Loop strands are constantly being
synthesized, lost, and resynthesized, and that they are very
rarely fully elongated (19). Therefore, assuming a germ
line cell is heterozygous for two genotypes, it is
conceivable that a newly synthesized D-Loop strand, from a
molecule of one genotype, could be displaced and invade the
closed circular molecule of another genotype at its
homologous region (i.e. the D-Loop region). A D-Loop for

Figure 15. Model for Gene Conversion in the
D-loop. L bovine mitochondrial
genotype with a C at position 12792 in
URF-5. L genotype with a T at
position T2792 in URF-5. Bases shown
correspond to the bases indicated in
Figure 8.

71
Ls
C

72
structure would be created with four mismatched bases (see
Figure 15). These mismatched bases could then be
recognized, excised randomly on either strand, and then
repaired by a mechanism analogous to that described for both
E. coli and mammalian cells (76). The product of this
process would then be identical to the recipient parental
molecule except within the D-Loop, where the sequence would
a
be a hybrid between the two genotypes at the four bases
where the two genotypes differ. Of course, this same
process could operate when the genotypes differed at only
some of the four bases and also, the product of such a
process could regenerate the parental genotype.
This gene conversion model has several attractive
features. First, it is not without plausibility; there were
at least several genome copies per mitochandrion (56), there
is evidence that mitochondria fuse (77) and recently
heterozygous mitochondria have been described (78). Second,
strand invasion is a well studied phenomenon (79) and D-Loop
strands could conceivably be present in physiologically
significant amounts to allow such a process to occur.
Third, mismatch repair is believed to be a mechanism for
repairing DNA synthesis error and thus associated with the
replication complex (76). Fourth, this model, in addition
#
to explaining the variability we observe in the D-Loop,
would also help explain the significant conservation noted
in this region of the D-Loop. As mentioned above, the
middle of the D-Loop is as conserved as ribosomal genes

73
between highly divergent species such as human and cow (9)
and human and mouse (47) Gene conversion, involving the
D-Loop strand, would preserve conservation of this region.
Finally, this model circumvents the necessity of postulating
hypermutation at these four bases. Of course, mutation had
to generate the differences originally, but five simple
mutations (one in URF-5 and four in D-Loop) plus a series of
gene conversion evehts, could generate all the combinations
we have observed, plus any other theoretical combinations
which may appear in future studies.

Conclusion
Our data suggest that the well described phenomena of
rapid mtDNA evolution and significant intraspecies
polymorphism are closely tied to the molecular mechanism of
mtDNA inheritance. We believe that this mechanism allows
for rapid genotypic shifts in mtDNA, and thus, can lead to
mtDNA polymorphism among maternally related individuals.
Finally, a gene conversion model best explains the
variability we observe in the region of the mtDNA origin of
replication.

APPENDIX
ANIMALS AND
CLONES USED IN
THIS STUDY
Animal
Breed/Lineage
Clone
Vector/mt Fragment
H493
Holstein/H15
11-1
pBR322/Pst I A
II
II
11-2
II
II
II
11-2
pACYC 184/Eco RI A
II
II
11-3
pBR322/Pst I A
H1009B
II
91-1
II
II
II
91-2
II
II
II
91-3
pACYC 184/Eco RI A
H634
II
95-P
II
II
II
95-3
PBR322/Bam HI C
II
II
95-6
II
II
II
95-13
II
II
II
95-85
II
II
II
95-87
II
H624
II
22-1
PACYC 184/Eco RI A
H501
II
86-1
II
H949B
II
35H
II
II
II
35-3
PBR322/Bam HI A
H455
II
24-7
PACYC 184/Eco RI A
H496
II
33-1
II
H737B
II
9A-1
It
74

75
H997B
II
90-1
II
H512
Holstein/H15
32-8
II
H576
II
576G
II
H709
II
709F
II
H393
II
87A
II
H567
Holstein/H3
43-5
pBR322/Bam HI C
H992B
Guernsey/L214
78-17
II
7 OH
Angus/
80-17
II
J49
Jersey/59UF
94-4
II
water
buffalo
N/A
WB-1
pBR322/Bam HI D -
If
N/A
WB-17
pBR322/Bam HI C + D

REFERENCES
1. Gray, M.W., and W. Ford Doolittle. 1982. Has the
endosymbiosis hypothesis been proven? Microb.
Rev. 46(1):1-42.
2. Nass, M.M.D. 1966. The circularity of mitochondrial
DNA. Proc. Nat. Acad. Sci., U.S.A. 56;1215-1222.
3. Saccone, C., and A.M. Kroom (eds.). 1976. The Genetic
Function of Mitochondrial DNA. North Holland Pub.
Co., Amsterdam.
4. Attardi, G. 1981. Organization and expression of the
mammalian mitochondrial genome: a lesson in
economy: I. Trends Biochem. Sci. 6^: 86-89.
5. Attardi, G. 1981. Organization and expression of the
mammalian mitochondrial genome: a lesson in
economy: II. Trends Biochem. Sci. 6^: 100-103.-
6. Gray, M.W. 1982. Mitochondrial genome diversity and
the evolution of mitochondrial DNA. Can. J.
Biochem. 60:157-171.
7. Anderson, S., A.T. Bankier, B.G. Barrell, M.H.L.
de Bruijn, A.R. Coulson, J. Cronin, I.C. Epeson,
D.P. Nierlick, B.A. Roe, F. Sanges, P.H. Schreier,
A.J.H. Smith, R. Staden, and I.G. Young. 1981.
Sequence and organization of the human
mitochondrial genome. Nature 290:457-465.
8. Bibb, M.J., R.A. Van Etten, C.T. Wright, M.W. Walberg,
and D.A. Clayton. 1981. Sequence and gene
organization of mouse mitochondrial DNA. Cell
26:167-180.
9. Anderson, S., M.H.L. de Bruijn, A.R. Coulson, I.C.
Epeson, F. Sanger, and I.G. Young. 1982. The
complete sequence of bovine mitochondrial DNA:
Conserved features of the mammalian mitochondrial
genome. J. Mol. Biol. 156:683-717.
10.Ojala, D., J. Montaya, and G. Attardi. 1981. tRNA
punctuation model of RNA processing in human
mitochondrial. Nature 290:470-474.
76

77
11. Barrell, B.G., S. Anderson, A.T. Bankier, M.H.L. de
Bruijn, E. Chen, A.R. Coulson, J. Drouin, I.C.
Epeson, D.P. Kierlick, B. Roe, F. Sanger, P.H.
Schreier, A.J.H. Smith, R. Staden, and I.G. Young.
1980. Different pattern of codon recognition by
mammalian mitochondrial tRNAs. Proc. Nat. Acad.
Sci. U.S.A. 7J7:3164-3166-
12. de Bruijn, M.H.L., P.H. Schreier, I.C. Epeson, B.G.
Barrell, E.Y. Chen, P.W. Armstrong, J.F.H. Wong,
and B.A. Roe. 1980. A mammalian mitochondrial
serine tRNA lacking the "dihydrouridine" loop and
stem. Nucleic Acids Res. 8.: 5213-5222.
13. Berk, A.J., and D.A. Clayton. 1974. Mechanism of
Mitochondrial DNA Replication in L-cells:
asynchronous repliation of strands, segregation of
circular daughter molecules, aspects of topology
and turnover of initiation sequence. J. Mol.
Biol. 8^:801-824.
14. Kasamatsu, H., and Vinograd. 1974. Replication of
circular DNA in eubaryotic cells. Ann. Rev.
Biochem. 43:695-720.
15. Billum, A.M., and D.A. Clayton. 1978.
Displacement-loop replication initiation sequence
in animal mitochondrial DNA exists as a family-of
discrete lengths. Proc. Nat. Acad. Sci. U.S.A.
75:677-681.
16. Brown, W.M., J. Shine, and H. Goodman, 1978. Human
mitochondrial DNA: Analysis of 7S DNA from the
origin of replication. Proc. Nat. Acad. Sci.
U.S.A. 75:735-739.
17. Doda, J.N., C.T. Wright, and D.A. Clayton. 1981.
Elongation of displacement-loop strands in human
and mouse mitochondrial DNA is arrested near
specific template sequences. 78:6116-6120.
18. Robberson, D.L., and D.A. Clayton. 1972. Replication
of mitochondrial DNA in mouse L-cells and their
thymidine kinase-derivatives: displacement
replication on a covalently-closed circular
template. Proc. Nat. Acad. Sci.U.S.A.
69:3810-3814.
Bogenhagen, D., and D.A. Clayton. 1978. Mechanism of
mitochondrial DNA replication in mouse L-cells:
Kinetics of synthesis and turnover of the
initiation sequence. J. Mol. Biol. 119:49-68.
19.

78
20. Battey, J. and D.A. Clayton. 1978. The transcription
map of mouse mitochondrial DNA. Cell 14;143-156.
21. De Francesco, L., and G. Attardi. 1981. In situ
photochemical crosslinking of HeLa cell
mitochondrial DNA by a psoralen derivative reveals
a protected region near the origin of replication.
Nuc. Acids. Res. 9^:6017-30.
22. Kalf, G.F., and S.S. Ch'ih. 1968. Purification and
properties of DNA polymerase from rat liver
mitochondria. J. Biol. Chem. 18:4904.
23. Bertazzoni. E., A.I. Scovassi, and G.M. Brun. 1977.
Chick-embtyo DNA polymerase. Eur. J. Biochem
8_1: 237-248.
24. Bogenhagen, D., and D.A. Clayton. 1977. Mouse L-cell
mitochondrial DNA are selected randomly for
replication throughout the cell cycle. Cell
11:719-727.
25. Chase, J.W., and I.B. Dawid. 1972. Biogenesis of
mitochondria during xenopus laevis development.
Dev. Biol. 27:504-518.
26. Piko, L., and L. Matsumoto. 1976. Number of
mitochondria and some properties of mitochondrial
DNA in the mouse egg. Dev. Biol. 49:1-10.
27. Dawid, I.B. 1972. Evolution of mitochondrial DNA
sequences in Xenopus. Dev. Biol. 29:139=151.
28. Brown, W.M., M. George, and A.C. Wilson. 1979. Rapid
evolution of animal mitochondrial DNA. Proc. Nat.
Acad. Sci. U.S.A. 76:1967-1971.
29. Potter, S.S., J.E. Newbold, C.A. Hutchinson, III, and
M.H. Edgell. 1975. Specific cleavage analysis of
a mammalian mitochondrial DNA. Proc. Nat. Acad.
Sci. U.S.A. 72:4496-4500.
30. Francisco, J.F., and M.V. Simpson. 1977. The
occurrence of two types of mitochondrial DNA rat
populations as detected by Eco RI endonuclease
analysis. FEBS. Lett. 79:291-294.
Buzzo, K., D.C. Fouts, and D.R. Wolstenholme. 1978.
Eco RI cleavage site variants of mitochondrial DNA
molecules from rats. Proc. Nat. Acad. Sci. U.S.A.
75:909-913.
31.

79
32. Ramirez, J.L., and I.B. Daniel. 1978. Mapping of
mitochondrial DNA in Xenopus laevis and Xenopus
barealis: The positions of ribosomal genes and
D-loops. J. Mol. Biol. 119:133-146.
33. Hayashi, J.L., H. Uanekawa, 0. Gotoh, J. Motohashi, and
U. Tagashira. 1978. Two different molecular
types of rate mitochondrial DNAs. Biochem.
BiOphys. Res. Comm. 81;871-877.
34. Kroon, A.M., W.M. deVas, and H. Bakker. 1978. The
heterogeneity of rat-liver mitochondrial DNA.
Biochem. Biophys. Acta. 519:269-273.
35. Shah, D.M., and C.H. Langley. 1979. Inter- and
intraspecific variation in restriction maps of
Drosophila mitochondrial DNAs. Nature
281:696-699.
36. Brown, W.M. 1980. Polymorphism in mitochondrial DNA
of humans as revealed by restriction endonuclease
analysis. Proc. Nat. Acad. Sci. U.S.A.
77:3605-3609.
37. Nass, M.M.D. 1981. Restriction Endonuclease analysis
of mitochondrial DNA from virus-transformed, tumor
and control cells ofhuman, hamster and avian
origin. Biochem. Biophys. Acta. 655:210-220. -
38. Upholt, W.B., and I.B. Dawid. 1977. Mapping of
mitochondrial DNA of individual sheep and goats.
Rapid evolution in the D-loop. Cell. 11:571-583.
39. Hayashi, J.I., 0. Gotoh, and Y. Togashira. 1981.
Length Polymorphisms of Restriction Fragments of
Rat Mitochondrial DNAs. Biochem. Biophys. Res.
Comm. 98:936-941.
40. Brown, G.G., and M.V. Simpson. 1981. Intra- and
interspecific variation of the mitochondrial
Genome in Rattus norvegicus and Rattus rattus:
Restriction enzyme analysis of variant
mitochondrial DNA molecules and genetics,
Genetics, 97:125-143.
41. Goodard, J.M., J.N. Masters, S.S. Jones, W.D. Ashworth,
and D.R. Wolstenholme. 1981. Nucleotide sequence
variants of Rattus norvegicus mitochondrial DNA.
Chromosma. 82:592-609.

80
42. Avise, J.C., R.A. Lansman, and R.O. Shade. 1979. The
use of restriction endonucleases to measure
mitochondrial DNA sequence relatedness in natural
populations. I. Population structure and
evolution in the genus Peromyscus. Genetics
92:279-295.
43. Ferris, S.D., R.D. Sage, and A.C. Wilson. 1982.
Evi'dence from mt DNA sequences that common
laboratory strains of inbred mice are descended
from a single female. Nature 295:163-165.
44. King, B.O., R.O. Glade, and R.A. Lansman. 1981. The
use of restriction endonucleases to compare
mitochondrial DNA sequences in Mus musculus: A
detailed restriction map of mitochondrial DNA from
mouse L Cells. Plasmid. _5: 313-328.
45. Hauswirth, W.W., and P.J. Laipis. 1982. Variation in
bovine mitochondrial DNAs between maternally
related animals. In Mitochondrial Genes, eds.
Slonimski, P. Borst, P. and Attardi, G., Cold
Spring Harbor, New York, N.Y. in press.
46. Brown, W.M., E.M. Prager, A. Wang, and A.C. Wilson.
1982. Mitochondrial DNA sequences of primates:
tempo and mode of evolution of mitochondrial DNA.
J. Mol. Evol. in press.
47. Walberg, M.W., and D. A. Clayton, 1981. Sequences and
properties of the human KB cell and mouse L-cell
D-loop regions of mitochondrial DNA. Nucl. Acids
Res. 9_: 5411-5421.
48. Brown, W.M. 1981. Mechanisms of evolution in animal
mitochondrial DNA. Annals N.Y. Acad. Sci.
361:119-134.
49. Clayton, D.A., J.N. Doda, and E.C. Friedberg. 1974.
The absence of a Pyrimidine dimer repair mechanism
in mammalian mitochondria. Proc. Nat. Acad. Sci.
21:2777-2781.
50. Kunkel, T.A., and L.A. Loeb. 1981. Fidelity of
mammalian DNA polymerases. Science 213:765-767.
51. Allen, J.A., and M.M. Coombs. 1980. Covalent binding
of polycyclic aromatic compounds to mitochondrial
and nuclear DNA. Nature 287:244-245.
Francisco, J.F., G.G. Brown, and M.V. Simpson. 1979.
Further studies on types A and B rat mtDNAs:
Cleavage maps and evidence for cytoplasmic
inheritance in mammals. Plasmid 2:426-436.
52.

81
53. Hutchinson, C.A., III, J.E. Newbold, S.S. Potter, and
M.H. Edgell. 1974. Maternal inheritance of
mammalian mitochondrial DNA. Nature 25_1: 536-638 .
54. Giles, R.E., H. Blanc, H.M. Cann, and D.C. Wallace.
1980. Maternal inheritance of human mitochondrial
DNA. Proc. Nat. Acad. Sci. 72:6715-6719.
55. Hauswirth, W.W., C.J. Wilconx, and P.J. Laipis. 1982.
Nucleotide sequence variation in mitochondrial DNA
from bovine liver. J. Dairy Sci. in press.
56. Bogenhagen, D., and D.A. Clayton. 1974. The number of
mitochondrial DNA genomes in mouse L and human He
La cells.* Quantitative isolation of mitochondrial
DNA. J. Biol. Chem. 249 (4): 7991-7995.
57.Laipis, P.J., W.W. Hauswirth, T.W. O'Brien, and G.S.
Michaels. 1979. A physical map of bovine
mitochondrial DNA from a single cow. Biochem.
Biophys. Acta. 565:22-32.
58.Chang, A.C.Y., and S.N. Cohen. 1978. Construction and
characterization of DNA cloning vehicles derived
from the P15 cryptic miniplasmid. J. Bacteriol.
134:1141-1149.
59. Kushner, S.R. 1978. Bacterial transformation. In-.
Proceedings of the International Symposium on
Genetic Engineering. Elseview, North Holland,
Amsterdam, Biomedical Press.
60. Morrison, D.A. 1979. Transformation and preservation
of competent bacterial cells by freezing. Meth. in
Enzymol. 68:326-331.
61. Grunstein, M., and D.S. Hogness. 1975. Colony
hybridization: A method for the isolation of
cloned DNAs that contain a specific gene. Proc.
Nat. Acad. Sci. 72:3961-396.
62. Southern, E.M. 1975. Detection of specific sequences
among DNA fragments separated by gel
electrophoresis. J. Mol. Biol. 98:503-517.
63. Guerry, P., D.J. LeBlanc, and S. Falkow. 1973.
General method for the isolation of plasmid DNA.
J. Bact. 116:1064-10.
64.Bunenann, H., and W. Muller. 1978. Base specific
fractionation of double stranded DNA: affinity
chromatography on a novel type of absorbant.
Nucl. Acid. Res. 5:1059-1074.

82
65. Rigby, P.W., M. Dieckmann, C. Rhodes, and P. Berg.
1977. Labelling DNA to high specific activity in
vitro by Nick-translation with DNA polymerase I.
J. Mol. Biol. 113:237-251.
66. Denhardt, D.T. 1966. A membrane-filter technique for
the detection of complementary DNA. Biochem.
Biophys. Res. Comm. 23:641-646.
67. Tu, C.D., ai^ S. Cohen. 1980. 3' End-labelling of DNA
with i ZP] cordycepin-5-triphosphate. Gene
10:177-183.
68. Maxam, A.M., and W. Gilbert. 1980. Sequencing
end-labelled DNA with base specific chemical
cleavages. Meth. Enzymol. 65:499-560.
69. Sinclair, A.R.E. 1977. The African Buffalo. Univ.
Chicago Press, Chicago, Ill.
70. Grzinek, B. 1972. Animal Life Encyclopedia. Van
Nostrand Rienhold. New York, N.Y.
71. Birky, C.W., Jr. 1973. On the origin of mitochondrial
mutants: Evidence for intracellular selection of
mitochondria in the origin of antibiotic-resistant
cells in yeast. Genetics 74:421-432.
72. Birky, C.W. 1978. Transmission genetics of
mitochondria and chloroplasts. Ann. Rev. Gen.
12:471-512.
73. Hauswirth, W.W., and P.J. Laipis. 1982. Mitochondrial
DNA polymorphism in a maternal lineage of holstein
cows. Proc. Nat. Acad. Sci. in press.
74. Eddy, E.M. 1975. Germ Plasm and the differentiation
of the germ cell line. Int. Rev. Cyt. 43:229-275.
75. Friend, J.B. 1978. Cattle of the World. Blanford
Press, Dorset, England.
76. Radding, C.M. 1978. Genetic Recombination. Ann. Rev.
Biochem. 47:847-880.
77. Honda, S.I., T. Hongladaron, and S.G. Wildman. 1964.
Characteristic movement of organelles in streaming
cytoplasm of plant cells. In Primitive Motile
Systems in Cell Biology, eds. Allen, R.D. and
Kamiya, N. 485-509 Academic Press, New York, N.Y.

83
78. Oliver, N.A., and D.C. Wallace. 1982. Assignment of
two mitochondrial synthesized polypeptides to
human mitochondrial DNA and their use in the study
of intracellular mitochondrial interactions. Mol.
and Cell Biol. 2^(1):30-41.
79. Beattie, K.L., R.C. Wiegand, and C.M. Radding. 1977.
Uptake of homologous single-stranded fragments by
superhelical DNA. J. Mol. Biol. 116:783-803.

BIOGRAPHICAL SKETCH
Paul David Olivo, the fourth of eleven children of S.
William and Jane C. Olivo, was born on August 30, 1950, in
*
Boston, Massachusetts. He attended St. Francis Xavier High
School in Concord, Mass., from 1964-1968. He attended
Villanova University from 1968 to 1970 and in 1972, received
a Bachelor of Arts in anthropology from the George
Washington University. In 1974 he began graduate studies at
the University of Florida in the Department of Immunology
and Medical Microbiology. In June 1981 he received an M-.D.
degree from the University of Florida College of Medicine.
Upon completion of graduate school, he will enter a
Residency training program in Internal Medicine at the
University of Wisconsin, Madison, Wisconsin.
84

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Tilliam W.
Chairman
Associate Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Nicholas Muzyczka, Ph Assistant Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
^enneth I. Berns, M.). Ph.D.
Professor of Immunology and Medical
Microbiology

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Edward J. Siden, Ph.D.
Assistant Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
This dissertation was submitted to the Graduate Faculty of
the College of Medicine and to the Graduate Council, and was
accepted as partial fulfillment of the requirements for the
degree of Doctor of Philosophy.
August, 1982
Dean for graduate Studies and
Research

UNIVERSITY OF FLORIDA
l m ni inn i'" n c
3 1262 08554 7866



16
Construction of mtDNA Recombinant Plasmids
Many of the mtDNA clones used in this study were
isolated by Dr. M.J. Van de Walle, Mr. G.S. Michaels and
Ms. K.B. Brown. The plasmids pBR322 and pACYC184 (58) were
the cloning vfectors used. The plasmid pBR322 has a single
Pst I site in the ampicillin resistance gene and a single
Bam HI site in the tetracycline resistance gene. The
plasmid pACYC184 ha a single Eco RI site in the
chloramplenical resistance gene. MtDNA is cut twice by
Pst I, and three times each by Bam HI and Eco RI (Fig. 2).
For cloning Pst I mtDNA fragments, Pst I cleaved
purified mtDNA and Pst I cleaved pBR322 DNA (treated with
1 unit of Bacterial Alkaline Phosphatase for 15 minutes at
37C followed by phenol and ether extraction) were mixed in
approximately equimolar ratios. In vitro ligation was done
overnight at 4C in 1 mM ATP, 1 mM DTT, 10 mM Tris-HCl pH
7.4, with 1-5 units of T^ ligase. The ligated DNA was then
transfected into E. coli strain HB101 using the procedure of
Kuschner (59) except that the cells had been frozen and
were thawed just prior to transfection as described by
Morrison (60). The transfected culture was then plated onto
agar containing tetracycline (20 ug/ml). Tetracycline
resistant (Tet ) colonies were replicated onto agar
containing ampicillin (100 ug/ml). Tetr, ampS colonies were
then screened for the presence of mtDNA sequences by
32
hybridization of a P-labelled mtDNA probe to bacterial
lysates immobilized on nitrocellulose filters (61) and


18


20
well by inversion. The precipitate was pelleted at
15,000 rpm for 30 minutes and the supernatant saved. Ten
milliliters 30% Polyethylene Glycol 6000 was added (final
concentration 7.5%) and the solution was mixed by inversion.
The mixture was kept on ice for 2 hours to precipitate the
plasmid DNA. The precipitate was centrifuged at 600 g for
5 minutes. After discarding the supernatant the white
pellet was resuspended in 2 ml 50 mM Tris-HCl pH 8.0, 1 mM
EDTA and treated with RNase (20 ug/ml) for 30 minutes at
37C. The solution was then diluted to 10 ml with 50 mM
Tris-HCl pH 7.4 and phenol extracted twice, chloroform
extracted once and then precipitated with 25 ml ethanol at
-70C for 1 hour. The precipitate was then pelleted at
10,000 rpm for 1 hour, vacuum dried and resuspended in 2 ml
25 mM Tris-HCl pH 7.4, 100 mM NaCl, and 1 mM EDTA. The
plasmid DNA was further purified by Acrydine-yellow
chromatography (64).
Rapid Isolation of Plasmid DNA
Cells from a 50 ml culture were pelleted and
resuspended in 100 ul 0.9% Glucose, 20 mM EDTA, 20 mM
Tris-HCl, pH 8.0 in a 1.5 ml microfuge tube. The cells were
treated with lysozyme as described above, and lysed with
200 ul 0.8% NaOH, 1% SDS after the addition of 1 ul
Diethylpyrocarbonate (DEPC). One hundred fifty ul of 3 M
Potassium Acetate was added and the mixture kept at 4C for
2 hours. The precipitate was pelleted in a microfuge for


GENETICS OF THE ORIGIN OF REPLICATION
OF BOVINE MITOCHONDRIAL DNA
BY
PAUL DAVID OLIVO
A DISSERTATION PRESENTED TO THE GRADUATE COUNCIL
OF THE UNIVERSITY OF FLORIDA IN
PARTIAL
FOR THE
FULFILLMENT OF THE REQUIREMENTS
DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1982