Citation
Characterization of the DNA-binding activity of the Saccharomyces cerevisiae transcriptional activator Gcr1p

Material Information

Title:
Characterization of the DNA-binding activity of the Saccharomyces cerevisiae transcriptional activator Gcr1p
Creator:
Huie, Michael Andrew, 1963-
Publication Date:
Language:
English
Physical Description:
ix, 138 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Binding sites ( jstor )
DNA ( jstor )
Gels ( jstor )
Genes ( jstor )
Oligonucleotides ( jstor )
Plasmids ( jstor )
RNA ( jstor )
Saccharomyces cerevisiae ( jstor )
Yeasts ( jstor )
Binding Sites -- physiology ( mesh )
DNA-Binding Proteins -- chemistry ( mesh )
Department of Immunology and Medical Microbiology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Immunology and Medical Microbiology -- UF ( mesh )
Genes, Regulator ( mesh )
Saccharomyces cerevisiae ( mesh )
Trans-Activation (Genetics) -- genetics ( mesh )
Trans-Activation (Genetics) -- physiology ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1994.
Bibliography:
Includes bibliographical references (leaves 114-137).
Additional Physical Form:
Also available online.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Michael Andrew Huie.

Record Information

Source Institution:
University of Florida
Rights Management:
Copyright Michael Andrew Huie. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
50683386 ( OCLC )
028489058 ( ALEPH )

Downloads

This item has the following downloads:


Full Text












CHARACTERIZATION OF THE DNA-BINDING ACTIVITY OF THE
SACCHAROMYCES CEREVISIAE TRANSCRIPTIONAL ACTIVATOR GCR1P














BY

MICHAEL ANDREW HUIE




















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY















ACKNOWLEDGMENTS

I would first like to thank my parents for their encouragement and support throughout the course of my training. I am especially indebted to my mentor, Henry V. Baker, for his patience, and for providing me with an excellent training and a stimulating work environment The members of my committee, Daniel J. Driscoll, Richard W. Moyer, and Thomas P. Yang, are thanked for their invaluable insights. John Olson, Michael Brooks, Michael Waters, Jeff Smerage, Lucia Eisner, Carolyn Drazinic, Ed Scott, Clive Stanway, Jeff Harris, Mary-Catherine Bowman, Jim Anderson, Rob Nicholls, Gerry Shaw, Maurice Swanson, Jace Dienhart, William Hausworth, Al Lewin, Paul Gulig, Cecila Lopez, Didi Gravenstein, and Andy Wilcox are thanked for uncountable hours of discussion related to this work and for technical assistance and advice. This work is dedicated to Matt Memolo, who died during the course of the writing. He is thanked for his inspiring conversations and for his example of how to live life.
















TABLE OF CONTENTS


ACKNOWLEDGMENTS .......... ............ .. ii
LIST OF TABLES ............v


LIST OF FIGURES .. ............... ...... ......... vl

ABSTRACT .............. .. .. .. V* lll
INTRODUCTION ........... . . .. . .... 1

Basal Transcriptional Machinery and TFIID ........ 4 Activators, Coactivators, and Adaptors ........... 7
History of Fermentation in Yeast ................ 11
Coordinate Regulation of Glycolysis in
Saccharomyces cerevisiae .................... 18
Gcrlp .... 18 Gcr2p .. ......... .............. ***20
Rap lp ....... .. ........ .................21
Abflp .... ... ... .... .... ... 23
Reblp .. ...... ...................... 25
Gcrlp as a DNA-Binding Protein .................... 26

MATERIALS AND METHODS ...... .... ... ....... 27

Bacterial Strains ... ...... .. ... 27
Media and Growth Conditions ... ... ....... .... 27
Transformations ....... .... ... . .. .. 27
Induction of Mal ::GCRI Gene Fusions ............. 27
Purification of MBP-Gcrlp Fusion Proteins ........ 28 Nucleic Acid Manipulations .... .............. 30
DNA Precipitation .. . ....... . 30
Purification of DNA Fragments and
Oligonucleotides ............................ 31
Radio-Labeling of DNA Fragments .. ...... 31 Polyacrylamide Gel Electrophoresis ......... 34 Determination of DNA Concentrations ......... 35
Generation of Double Strand DNA
Oligonucleotides ................... ......... 35
DNA Sequencing .. ... .. .. ... .. 36
Plasmid Construction ............... 37
In Vitro Transcription ................... ....... 42
In Vitro Translation ....... ... ... 43













Titration ofDNA-Binding Activity ................ 46
Calculation of Equilibrium Binding Constant .... 46 RESULTS 47


Gcrlp Expressed in E. coli or Rabbit Reticulocyte
Lysate Binds to DNA .. .. .... .... .... 48
The DNA-Binding Domain of Gcrlp Resides within
the Carboxy-Terminal 154 Amino Acid
Residues ... .......... 52
DNaselI Footprint Analysis ................ 57
Identification of a Consensus Gcrlp Binding
Sequence .... .. .. ...... ......... 65
The Gcrlp-DNA Nucleoprotein Complex .. ........... 68
The DNA-binding affinity of the
GCR1 binding domain .. ......... .... 68
Specificity of the Gcrlp DNA-Binding
Domain 77
Bending of DNA in the Gcrlp-DNA Nucleoprotein
complex .. ... .... ........ ....... 81
DISCUSSION .. ...... .... .. ............. 89

The DNA-Binding Domain of Gcrlp .................. 92
A DNA Consensus Sequence for Gcrip .... ....... 95
The Binding Affinity of the Gcrip
DNA-Binding Domain .......................... 97
The Bending of DNA by Raplp and Gcrlp ............ 106
The Significance of Adjacent Raplp and Gcrlp
Binding Sites in the UAS of the Glycolytic
Genes ........ ... 108
Conc lusions ..... .... .. .... ....... .... 113

REFERENCES .. ... .... 115

BIOGRAPHICAL SKETCH .... ... 139
















LIST OF TABLES
Table aSe
1. Oligonucleotides .................. ........... 32

2 Plasmids . . .. .... . .. ....... 38

3 Oligonucleotides containing CTTCC sequences .... 40

4 DNA-Binding Affinity of Select
Transcriptional Activators ....... ..... 99

















LIST OF FIGURES


Figure RaGe

1. Comparison of DNA-binding activity of Gcrl
and hybrid MBP-Gcrlp fusion protein ......... 51

2 Templets used to generate carboxy-terminal
deletions of Gcrlp .... .. ... ........ 53

3 Carboxy-terminal truncation polypeptides of
Gcrlp ....................................... 55

4 DNA-binding activity of Gcrlp carboxyterminal deletion polypeptides .............. 56

5 malE GCR1 gene fusions .............. 58

6 DNA-binding activity of MBP-Gcrlp hybrid
proteins ........ ...... 60

7 Summary of data mapping the Gcrlp DNA-binding
domain .. . . .. .... .. ... 61

8 Gcrlp DNA-binding domain protects the CTTCC
sequence motif in UAS TP; .................... 64

9 Gcrlp DNA-binding domain binds to CTTCC
sequence elements found in front of other
glycolyt ic genes .. ... . . .... .... 67

10. Titration of Gcrlp DNA-binding activity ........ 72 11ii. Determination of Gcrlp DNA-binding domain binding affinity .. 75 12. Graphical representation of binding affinity ... 76 13. Competition experiment using specific c omp et.itor .. ..... .. . .. . . . 78

14. Competition experiment using non-specific compe t i tor .. .......... .... 79


















17. Schematic of probe used in circular
permutation assay .... .............. .. 85

18. DNA is bent in the Raplp-DNA nucleoprotein
complex .. ...... .... .... . .... 86

19. DNA is bent in the Gcrlp-DNA nucleoprotein
complex .. ......................... 87

20 SAPS analysis of Gcrlp .......... 94
















Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF THE DNA-BINDING ACTIVITY OF THE
SACCHAROMYCES CEREVISIAE TRANSCRIPTIONAL ACTIVATOR GCR1P By

Michael Andrew Huie

August 1994

Chairman: Henry V. Baker, Ph.D. Major Department: Immunology and Medical Microbiology

The enzymes of the glycolytic pathway constitute

approximately 50 percent of the soluble proteins of the yeast Saccharomyces cerevisiae. Deletion of the gene encoding the transcriptional activator Gcrlp results in a 20-fold reduction of these enzymes. This study presents a biochemical analysis of the DNA-binding activity of Gcrlp. The DNAbinding domain of Gcrip is mapped to the carboxy-terminal 154 amino acids of the polypeptide. DNase I protection studies presented here show that the Gcrip DNA-binding domain protects a region of the upstream activating sequence of TPI1 harboring the CTTCC sequence motif. This sequence has been shown by genetic methods to be important for high-level gene expression of a number of the glycolytic enzymes. By DNA band-shift assays it is shown that the Gcrlp DNA-binding
















ENOI, PYKl, and ADHI. From these experiments a consensus Gcrlp-binding site is derived which is 5'-(T/A)N(T/C)N(G/A) NC(T/A)TCC(T/A)N(T/A)(T/A)(TG)-3' The apparent dissociation constant of the Gcr1p DNA-binding domain with the sequence 5'-TTTCAGCTTCCTCTAT-3' is 2 9x10-10M. However, only a 33-fold difference is observed between the ability of specific competitor and random DNA to inhibit formation of the nucleoprotein complexes between Gcrip and this binding site. Circular permutation DNA band-shift assays are used to show that the Gcrlp-DNA nucleoprotein complexes contains bent DNA. The implications of these findings, in terms of the combinatorial interactions that occur at upstream activating sequences of GCR1-dependent genes, are discussed.
















INTRODUCTION



We can, first, describe an organism with concepts
men have developed through contact with living
beings over the millennia. In that case, we speak of living, organic function, metabolism, breathing,
healing, etc Or else we can inquire into causal
processes. Then we use the language of physics
and chemistry, study chemical or electrical processes,
and assume, apparently with great success, that the
laws of physics and chemistry, or more generally the
laws of quantum theory, are fully applicable to living organisms. These two ways of looking at
things are contradictory. For in the first case we assume that an event is determined by the purpose it
serves, by its goal In the second case we believe
that an event is determined by its immediate
predecessor. It seems most unlikely that both
approaches should have led to the same result by
pure chance. In fact, they complement each other,
and, as we have long since realized, both are correct
precisely because there is such a thing as life.
Biology thus has no need to ask which of the two
viewpoints is the more correct, but only how nature managed to arrange things so that the two should fit
together


Niels Bohr (in Heisenberg, p. 110)



The regulation of gene expression in space and time is

foundational to the generation of structural and functional

diversity in living systems It is in regulation that the

abstract information content of DNA is made manifest and

interactive with the environment Using the working metaphor
ofth gne- code as 1h lagug oflft *a










2

syntax. Because as in language this allows unlimited arrangement of a finite set to generate creativity and innovation, an understanding of these rules will lead to an insight of life currently unavailable

It has been pointed out long ago (Mayr, 1970; Britten

and Davidson, 1969) that most structural genes do not differ greatly between simple single-cellular organisms and their more sophisticated mammalian brethren. The tremendous difference in complexity between the two forms of life seems to be due chiefly to the emergence of algorithms able to generate new biological structures with novel function. In fact, analysis of the rates of mutation, using either neutral or selection theory, suggest that mutations are insufficient to drive saltatory speciation unless they affect regulatory genes (King and Wilson, 1975; Delbroick, 1975; Gould, 1977; Jacob, 1977) Stated by the neo-Darwinian evolutionist Ernst Mayr

The fact that the macromolecules of most important
structural genes have remained so similar, from
bacteria to the highest organism, can be much better
understood if we ascribe to the regulatory genes a
major role in evolution. Since they strongly affect
the viability of the individual they will be major
targets of natural selection... The day will come when much of population genetics will have to be
rewritten in terms of the interaction between
regulator and structural genes (Mayr, 1970, p.183)

Indeed, developmental biology, molecular genetics, cellular










3

converging on two central phenomena, namely, signal transmission and differential gene expression (Levine, 1989)

The physical structure of DNA and proteins places

constraints on the available mechanisms of transcriptional regulation, and this is seen in the strong evolutionary conservation of many aspects of the transcriptional machinery (Guarente and Bermingham-McDonogh, 1992). This provides a tremendous advantage in the research of eukaryotic gene regulation because many processes can be dissected in the yeast Saccharomyces cerevisiae, using the powerful methods available for the study of this organism. Not surprisingly many recent advances have come from the study of S. cerevisae.

In the complicated area of the regulation and initiation of transcription by RNA polymerase II, a large number of observations and experiments have lead to a heuristic model. Many components involved in promoter specific activation, the basal transcriptional machinery, chromatin structure, and nuclear scaffold have recently been cloned and sequenced. Biochemical and genetic analysis has revealed relationships and interactions among these factors (reviewed in Gasser and Laemmli,1987; Workman and Buchman, 1993). Factors involved in communication between activation domains and the basal transcriptional machinery have been isolated (Dynlacht et









4


a specific system, that of glycolytic gene expression in S. cerevisiae.

Basal Transcriotional Machinery and TFIID

Transcriptional Factor IID (TFIID) has long been believed to be the key link between promoter-specific activation and RNA polymerase II basal initiation machinery. TFIID is not a single protein but a large (>700 Kd) complex (Pugh and Tjian, 1990; Dynlacht et al., 1991) which elutes at 0.6-1.0 M KCl from a phosphocellulose column of human tissue culture cells (Matsui et al.,1980; Samuels et al., 1982; Davison et al. 1983). Reconstitution experiments had revealed that TFIID is the only component capable of sequence-specific DNA binding (Sawadogo and Roeder, 1985; VanDyke et al.,1989; Davison et al., 1983). Largely due to this observation and similar reconstitution experiments (Buratowski et al., 1988), TFIID was proposed to be the first factor to bind DNA with the aid of TFIIA (Reinberg et al., 1987) and TFIIJ (Cortes et al., 1992) and then to recruit the other basal machinery (TFII,-B,-E,-F,-G, and RNA polymerase II) (reviewed in Saltzman and Weinmann, 1989; Roeder, 1991). Additionally, in vitro the stable association of TFIID with the TATA box is slow (Reinberg and Roeder, 1987; Schmidt et al., 1989; Hahn et al., 1989; Lieberman et al., 1991) From these observations the association of TFIID with the TATA box
is - believe to be the- C 2 -~ irst an r li s









5

machinery, thus stimulating transcription (reviewed in Ptashne, 1988 and Ptashne and Gann, 1990). This is not the only view put forward, however. Lin and Green (1991) have proposed that binding of TFIIB represents the rate limiting step that is enhanced by activators The possibility that different activators target different steps in assembly is certainly reasonable (Mitchell and Tjian, 1989; Hawley, 1991)

Characterization of TFIID had remained limited due to the fact that it is difficult to purify in large yield and due to its instability. Recently, however, it was found that yeast TFIID was functionally interchangeable with human TFIID (Buratowski et al., 1988; Cavallini et al 1988). Easier purification of the yeast factor was followed by molecular cloning of the TATA-binding protein (TBP) component of the complex, in yeast (Hahn et al., 1989; Eisenmann et al., 1989; Horikoshi et al., 1989; Schmidt et al., 1989; Cavallini et al ., 1989). In yeast the 29 Kd TBP appears to be the major and perhaps single component of TFIID. Cloning of TBP from human (Peterson et al., 1990; Hoffmann et al., 1990) and other species (Fikes et al., 1990; Hoey et al, 1990; Gasch et al., 1990; Haass et al, 1992; Kao et al., 1990; Tamura et al., 1991; Muhich et al., 1990; Ganster et al., 1991; Wong et al., 1992) soon followed due to the remarkably high degree of
hmlog nof 18 Q rn rn aci priar sqn nr th carboxyl-












revealed that TBP is a relatively small protein varying amongst species between 22-39 Kd. The amino acids in the carboxy-terminus of TBP are 75-85% identical in all eukaryote TBP sequences currently known (Ganster et al., 1993; McAndrew et al, 1993) This region, called the C-terminal core domain, contains two repeats of 66-67 amino acids separated by a highly basic region. The structure of TBP from Arabidopsis thaliana has been determined by X-ray diffraction crystallography to a resolution of 2 6 A (Nikolov et al., 1992). The protein folds into two symmetrical and topologically identical domains each derived from one of the repeats (Nikolov et al., 1992; Rigby, 1993). The presumed DNA binding surface is a curved, anti-parallel S-sheet resembling a "saddle." Computer modeling revealed that DNA would fit nicely into the concave surface of the saddle (Nikolov et al., 1992; Rigby, 1993) When bound to DNA the convex surface of the saddle is able to interact with other transcriptional factors. Mutations in TBP that affect DNA binding map to the concave region, while mutations that affect the ability of TBP to interact with other proteins map to the convex surface (Rigby, 1993)

The cloning of TBP along with the cloning of the major

components of TFIIB (Malik et al. 1991), TFIIE (Peterson et al., 1991; Ohkuma et al 1991; Sumimoto et al., 1991), and












specific initiation (Comai et al., 1991; Schultz et al., 1992; White et al., 1992).

Act ivators, Coactivators, and Adaptors

Sequence-specific transcriptional factors are comprised of two critical and separable domains a DNA-binding domain and an activation domain. This organization was first demonstrated by Brent and Ptashne (1985) in the "domainswapping" experiments with LexA and Gal4p. When the DNAbinding domain of LexA was fused with the activation domain of Gal4p, transcriptional activation occurred through a LexAbinding site. Even more dramatic, the DNA-binding, ligandbinding, and activation domains of the estrogen and glucocorticoid receptors could be swapped to produce an estrogen responsive glucocorticoid receptor (Green and Chambon, 1987); or the ligand binding and activation domain of the glucocorticoid receptor could be fused to Gal4p to produce hormonal dependent activation at a Gal4p-binding site (Hollenberg and Evans, 1988) This flexibility with which domains can be swapped has been one of the many surprises in the study of transcriptional activating proteins.

Another surprise was that often the secondary structure of these domains are not pre-folded but are formed and stabilized upon ligand interaction. Although the DNA-binding domains often have well defined motifs, ligand binding often
conriutet thei stbliy Fo exmpe the DN-bndn












domain apparently wraps around the DNA helix upon binding. A similar occurrence is also seen in the N-terminal arm of the lambda repressor which is disordered in the free protein but wraps around the 'back side' of the DNA helix when bound (Jordan and Pabo, 1988)

Activation domains appear to become structured upon interaction with other molecules. By selecting for activation from random E. coli genom ic sequences Ma and Ptashne (1987) showed that a high density of negative charges, rather than well-defined amino acid sequences, was the major determinant of an activation domain in yeast. This type of activation domain has been termed an "acid blob" or "negative noodle" and has been proposed to be disorganized (Sigler 1988), an alpha helix (Irwin and Ptashne, 1987), or a beta sheet (Leuther et al., 1993; Van Hoy et al., 1993) Polypeptides of the acidic activation domain of Gal4p and Gcn4p have been shown to form beta sheets by circular dichroism spectroscopy (Van Hoy et al., 1993) and by genetic studies (Leuther et al., 1993) However, the active form of the activation domain may change with additional protein interactions (Hahn, 1993)

Another type of activation domain has been described and also displays a "disorganized" structure. Deletion analysis has revealed that the most potent activation domain of Spl
rnnta n 2 er r nt gl d ve n m ry few cha am rni no












(Mitchell and Tjian, 1989) Besides the glutamine content there is no other obvious sequence homologies between these interchangeable domains Finally, a third type of activation domain, mapped in CTF/NFl, is proline-rich (Mermod et al., 1989)

Various models have been proposed for how activation domains work. The models emphasize contact between the activation domain and TFIID or RNA polymerase II For example, the negative noodle activation domain has been proposed (Sigler, 1988; Allison et al., 1988) to interact with the carboxy terminal domain (CTD) repeat of the large subunit of RNA polymerase II A general feature of the large subunit of eukaryotic RNA polymerase II is the multiple repeat of the Tyr-Ser-Pro-Thr-Ser-Pro-Ser heptapeptide in the carboxyl terminus. In yeast this is repeated 26 times (Allison et al., 1985); in mouse, 52 times (Corden et al., 1985). Except for proline, which is believed to stabilize a unique secondary structure, nearly all the amino acid side chains in the heptapeptide are hydrophilic. This domain is believed to be fully exposed to solvent projecting out of the remaining globular folded polypeptide. According to the acid blob/negative noodle model, interactions between the carboxylates of the noodle and the hydroxyl groups of the CTD and other promoter binding proteins facilitate transc:riptionl io py b a n in bg o










10

An alternative explanation of the role of acidic

residues in activation domains has been proposed (Leuther et al., 1993) in which the acidic residues function to make the hydrophobic residues more accessible to interact with other factors. According to this hypothesis positive as well as negative charged amino acids can function in activation domains, and the hydrophobic residues are more important in making contacts with other proteins. Detailed mutagenesis studies of some acidic activation domains support this proposal (Cress and Triezenberg, 1991; Hardwick et al., 1992; Regier et al., 1993; Leuther et al., 1993)

The idea that these different types of activation

domains all interact directly with TBP seemed unlikely, and indeed, after the cloning of TBP, various investigators reported that this protein alone could not replace the TFIID fraction in transcriptional activation by Spl or CTF (Pough and Tjian, 1990; Peterson et al., 1990), NTF1 (Dynlacht et al., 1991), or USF (Hoffmann et al., 1990). Furthermore, these activators apparently do not stimulate binding of TBP to the TATA- box by direct interaction. Proteins that carry out this function have been termed coactivators or adaptors/ mediators (reviewed in Lewin, 1990; Martin 1991;and Greenblatt, 1991) A large number of polypeptides can be coimmunoprecipitated with antibodies to TBP and are referred
to a T a f o ( et a










11

1992) and RNA polymerase III TAFs (Buratowski and Zhou, 1992; Kassavetis et al., 1992) have been isolated. These, apparently species specific, proteins are believed to be part of the heterogenous TFIID complex.

By deletion analysis some of these adaptor domains have already been mapped. For example, the acidic activator Gal4p-VP16 is able to activate transcription in a heat-treated TFIID deficient HeLa nuclear extract when supplemented with recombinant human TBP. However, a amino-terminally truncated molecule of human TBP cannot support the activation in heat treated HeLa nuclear extract (Peterson et al., 1990) Also, by genetic methods several putative adaptors have been isolated in yeast (Berger et al., 1992)

History of Fermentation in Yeast

Recent studies on the regulation of the glycolytic

enzyme genes in yeast suggest candidates for activators and adaptors. I will first review the history of the study of fermentation in yeast since it is intimately associated with the history of modern biology. Then I will outline current factors imputed in transcriptional regulation of the glycolytic genes. In the discussion I will present a model based on current knowledge.

The brewing of beer is the largest biotechnological










12

civilization, dating to 2,500 BC, written in the Sumerian and Akkadian languages describe an established profession of alcohol fermentation 3,500 years earlier. Assyrian writings dating to 2,000 BC list beer as a commodity on Noah's Ark. The Bible explicitly mentions Noah's knowledge of fermentation and his use of alcohol. (Genesis 9:20-21 Noah was the first tiller of the soil. He planted a vineyard; and he drank of the wine, and became drunk, and lay uncovered in his tent.) The daughters of Lott (Genesis 20:30-37) found creative use for alcohol Egyptian writings from the Fourth Dynasty, circa 2,500 BC, describe the process of malting barley and its fermentation. Man's knowledge of these techniques clearly preceded his acquisition of written language. The effects of the products of fermentation, principally ethanol, undoubtedly influenced the perceptions and analysis of many of the unknown artists and religious charismatics of the antediluvian past. Anthropological studies reveal that all cultures independently learned early to ferment fruits and grains to produce alcohol.

The scientific study of fermentation by yeast has

spanned many centuries and has been associated with and attributed with changes in fundamental beliefs in modern biology. Indeed, historians tell us that the study of fermentation in yeast underlies the birth of chemistry, bio chemst, admcoilg Fuon 96 olr 92









13

phlogiston theory of combustion, were the first to outline a theory of fermentation in the early modern period (for an excellent review, see Fruton, 1972). They attributed an internal motion to the "ferment." Contact of quiescent substances by the ferment then caused them to undergo decay. A similar view was also put forth by Isaac Newton (1730), in his book Opticks, where he describes the interaction of ferments as an example of the force of gravity.

Lavoisier, the founder of modern chemistry, extinguished the phlogiston theory with his work describing oxygen. But it is in Lavoisler writings on fermentation, not oxygen, where he outlines his theory of conservation of matter:

Nothing is created either in the operation of art or of
nature, and the principle may be formulated that in every
process there is an equal quantity of matter before and after the reaction, that the quality and the quantity of
the principles are the same and that there are only changes
or modifications. (in Fruton,1972, p. 39)


Lavoisier, and later Gay-Lassic (1810), used fermentation to demonstrate this 'conservation of matter.' This 'law,' in its form modified by Einstein, remains a foundation of modern chemistry and physics. Although the phlogiston theory of combustion was abandoned, Lavoisier was largely responsible for sustaining the 'purely chemical' theory of fermentation that dominated the scientific opinion during his day.

In 1779, the French Academy of Science offered the prize
nf nne ilogrm of gold to anyo whnno could ean the










14

ferments from those that undergo fermentation?' Offering this prize reflected not only the importance of this unsolved problem, and its relation to commerce, but the fact that beginning around the nineteenth century chemical explanations for biological phenomena became a major preoccupation of leading scientists (Fruton, 1972). A debate ensued as to whether vitalistic or organismic notions, beyond materialism and reductionism, had to be evoked to account for fermentation. The prize was never awarded, and was withdrawn in 1804 because of lack of funds.

In 1838, the same period that Schleiden and Schwann

(1839) were outlining the cell theory, Cagniard de Latour published an article entitled Memoir on Vinous Fermentation (translated in Williams and Steffens, 1978) in which he argued that fermentation was the result of the 'vital activity' of yeast 'cells.' Although Leeuwenhoek, in 1680, described multiplying budding cells in the deposit formed in beer fermentation, it is important to remember that during this time, fermentation was still believed to be a chemical (that is, not vitalistic or organismic) process, and that yeast sediment was not believed to be cellular life, but an albuminoid. Cagniard de Latour discovered that yeast sediment was composed of cells and that fermentation was associated with these cells being alive and dividing
SCa-nard-Latour 1838 e als ime il rcnize th










15

that the microscope has been used to study the
phenomena upon which it depends. This essay, as one
can judge by the researches which I have just
mentioned, will be useful since it has furnished a number of new observations from which the principal results that can be drawn are: i, that beer yeast,
this ferment which is in such use and which, for this reason, should be examined very closely, is a mass of
little globular bodies capable of reproducing themselves, and thus organized beings, and not a simple organic or chemical substance as has been supposed;
2, that these bodies seem to belong to the vegetable
kingdom and regenerate themselves in two different
ways, and 3, that they seem to act on a solution of
sugar only so long as they are in the vital state:
from which it can be concluded that it is very
probably by some effect of their vegetation that they
are able to disengage carbon dioxide from this
solution and convert the solution into a spirituous
liquor. I would like to remark, further, that yeast, considered as an organized matter, perhaps merits the
attention of physiologists in this sense: 1, that it
can be born and develop in certain circumstances with great rapidity even in the middle of carbonic acid as
in the brewers' barrels; 2, that its mode of
reproduction presents particularities of a kind which have not been observed in other microscopical products
composed of isolated globules and 3, that it does not
die by very considerable refrigeration nor by
deprivation of water. (in Williams and Steffens,
1978,p. 446)


Cagniard de Latour's work was confirmed by Theodore

Schwann (1838), yet it still was attacked and dismissed by

many of the scientists of the day who maintained

institutional power, such as Berzelius, Liebig, and Wohler.

This group of prominent scientists were chemist who had

succeeded at synthesizing bio-organic compounds and found the

notion of 'vital forces' as somewhat superstitious. 'It is

not,' said Liebig, 'because it is organized that the beer










16

Pasteur, who was held in respect among chemists,

supported the work of Cagniard de Latour and Schwann, and was

instrumental in countering the opposition of the chemists,

and in bolstering the concept of vitalism in biology. Said

Pasteur

My present and most fixed opinion regarding the
nature of alcoholic fermentation is this: I believe
that there is never any alcoholic fermentation without there being simultaneously the organization, development, and multiplication of the globules,or at least
the pursued, continued life of globules that are
already present The totality of the results in this article seem to me to be in complete opposition to the
opinions of Liebig and Wohler. (in Kornberg,1989, p. 33)


Pasteur strongly supported an ideology vitalism and held that

life processes are not reducible to the laws of physics and

chemistry

Pasteur's 'fixed opinion' was shown to be false when

Eduard Buchner made the following observations in 1897:

If one mixes 1,000 grams of brewer's yeast with an
equal weight of sand and then grinds the mixture, the
mass becomes moist and pliable. Now if 100 grams
of water are added, and the paste, wrapped in cheesecloth, is gradually subjected to 400-500
atmospheres of pressure in a hydraulic press, one
obtains about 500 milliliters of 'press juice'; to
remove any residual unbroken cells, the press juice is passed through a paper filter The final solution
contains a collection of substances derived from the
cell interior. The 'cell extract' obtained in this
way is a clear, slightly yellow liquid with a pleasant
yeast smell. (in Kornberg, 1989, p. 34)

When Buchner added sugar to this solution in an effort to

preserve it, he noticed that bubbles of gas appeared within










17

yeast .' Buchner received the Nobel Prize in Chemistry ten years later for his discovery, which is often cited as the origin of biochemistry. In his autobiography Willstatter, Buchner's teacher, said 'This will bring him fame, even though he has no chemical talent.' (in Willstatter, 1949)

Studies of Pasteur's records revealed that he had

prepared cell-free yeast juices and attempted to carry out fermentation with the juice before Buchner's discovery. Unfortunately, he had used a strain of yeast which contained a labile form of invertase which did not survive the extraction procedure. He did not observe cell-free fermentation (Kornberg, 1989)

Early work on the purification of enzymes then ensued.

Although this early work was criticized on the ground that it was 'unphysiological to separate enzymes from cell,' investigators persevered and the conception of enzymes changed from a vague property in certain preparations to definite chemical substances, and finally by the 1930s to specific proteins (Fruton, 1972) The work of Harden, Neuberg, Embden, Meyerhof, and Warburg showed that zymase was a complex mixture of a dozen separate enzymes.

In the latter half of the twentieth century, after the revolution in molecular biology, the genes coding for the enzymes of the glycolytic pathway were cloned and the study
oftranscriptiona regulation ote e ensue










18

Coordinate Regulation of Givcolvsis in Saccharomvces cerevisiae

In Saccharomnyces cerevisiae the enzymes of the

glycolytic pathway are among the most highly expressed genes, constituting between 30-60 percent of the total soluble protein when grown in the presence of glucose (Hess et al., 1969; Fraenkel, 1982). The demonstration (Holland and Holland, 1978) that the most abundant mRNA species in the yeast code for glycolytic enzymes suggested that this is largely due to high-level transcription of the corresponding genes. High-level expression of heterologous genes under glycolytic-gene promoters (Bitter and Egan, 1984; 1988; Bitter et al., 1987) further demonstrated that the glycolytic gene promoters are among the strongest known.

A number of trans- and cis-acting elements have been discovered to be important for the coordinate high-level expression of the glycolytic genes. The trans-factors include Gcrip, Gcr2p, and Raplp/Grflp/Tuflp (hereafter referred to as Rapip) Additionally the factors GAL11/SPT13 (referred to as Gallp), Abflp/Taflp/Sufp/Gflp/SBF-B (now designated Abflp) and Reblp/Grf2p/QBP/Y (hereafter referred to as Reblp) are believed to play a role in high-level expression of some of the genes. I will review these factors here. A model of how these factors may work together will be presented in the Discussion.










19

1981). This gene was named GCRI1 for Glycolysis Regulation. The gcrl mutant has a severe growth defect when glucose is present in the medium. This growth defect is presumably due to the fact that aerobic respiration is repressed in Saccharomyces cerevisiae when glucose is present, as part of the global phenomenon known as glucose repression. When glucose is present a large number of genes involved in the metabolism of alternate carbon sources are repressed. Genetic analysis has identified a large number of genes involved in this regulatory process, involving multiple steps and branches regulating subsets of glucose-repressible genes (for a recent review see Trumbly, 1992) Since the gcrl mutant produces the glycolytic enzymes in reduced amounts it grows poorly in the presence of glucose. It does, however, grow adequately on non-carbohydrate carbon sources, and if glucose is added a noticeable induction of most of the glycolytic enzymes is observed (Clifton and Fraenkel, 1981; Baker, 1986). GCR1 has been cloned by complementation (Kawasaki and Fraenkel, 1982), mapped to chromosome XVI (referred to as the sit3 mutant in Arndt et al., 1989, and Devlin et al., 1991), and sequenced (Baker, 1986; Holland et al., 1987) revealing an open reading frame coding for a protein of 844 amino acids The low codon bias of -0.00086 according to the rules of Bennetzen and Hall (1982) suggested
,a th e rs es i l amuns an this was 4 r *.t r.










20

gcrl-1 mutant strain DFY67 (Holland et al., 1987). Sequence analysis suggested that a possible helix-turn-helix (H-T-H) motif is present in the carboxyl terminal region of the protein (Baker, 1986). H-T-H motifs are associated with DNAbinding activity. Gcrip was shown to posses DNA-binding activity when it was demonstrated that the Gcrlp product translated in rabbit reticulocyte lysate formed a nucleoprotein complex with a DNA fragment isolated from the upstream activation sequence element of TPII (Baker, 1991).

Gcrip was shown to bind a fragment of DNA from the TPI1 promoter which contained a CTTCC pentamer but was unable to bind a related fragment in which the CTTCC sequence was changed to CAACC (Baker, 1991) The CTTCC sequence element had long been noted to be present in the promoters of glycolytic genes (Ogden et al., 1986) By site-directed mutagenesis or deletion analysis CTTCC sequence elements were shown to be important for high-level expression of the genes encoding phosphoglycerate kinase (Chambers et al., 1988), enolase and pyruvate kinase (Buchman et al., 1988), and triose phosphate isomerase (Scott and Baker, 1993) Bitter et al. (1991) defined a sequence, GPE, which had a CTTCC sequence element at its core in upstream activation sequences.

Gcr2D










21

1990). The GCR2 gene was cloned by complementation and shown to be distinct from GCR1. Although the effects on glycolytic gene expression are similar in the gcrl and gcr2 mutants, the gcr2 mutant does not have as severe of a growth defect as gcrl mutants when grown on glucose at 30 C (Uemura and Fraenkel, 1990).

The role of Gcr2p in glycolytic gene expression is

currently under investigation. Like Gcrlp, Gcr2p appears to exert its effects at the transcriptional level, as measured by Northern analysis (Uemura and Fraenkel, 1990) Gcr2p does not appear to interact directly with the CTTCC sequence element In vivo footprinting experiments demonstrate protection of the CTTCC sequence elements in UASTPI in the gcr2 mutant (Scott and Baker, 1992). In the gcrl mutant these sequences are not protected (Huie et al., 1991; Scott and Baker,1993). A clue to the function of Gcr2p in glycolytic gene expression was provided by genetic studies (Uemura and Jugami,1992) based on the method of Fields and Song (1988). A GAL4 ::GCR1 gene fusion containing the activation domain of GAL4 and amino acids 68-844 of Gcrlp can complement a gcr2 mutant. Furthermore, a RAP1 :GCR2 gene fusion which carries the DNA binding domain of Raplp can partially complement a gcrl mutant. These observations have led to the suggestion that Gcrlp and Gcr2p function together as an activation










22

The RAP1 product is expressed at levels greater than 4,000 molecules per cell (Buchman et al., 1988) and has pleiotropic actions. It is capable of either activation or repression of transcription depending on the context of its binding site (Shore and Nasmyth, 1987). For example, Rapip acts as a silencer at the mating-type locus by interacting with the HMR(E) element (Shore et al., 1987) Rapip acts as an activator of ribosomal protein genes in cells in exponential growth by interacting with the rpg-box found upstream of the ribosomal protein genes (reviewed in Warner, 1989). It is also involved in stringent control of ribosomal protein transcription under conditions of amino acid starvation (Moehle and Hinnebusch, 1991). Rapip binds to telomeres (Buchman et al., 1988; Longtine et al., 1989) and is involved with their maintenance and length regulation (Lustig et al., 1990; Conrad et al., 1990). Interestingly, Sussel and Shore (1991) showed that two of these three functions can be separated by genetic methods. They were able to distinguish Silencing/Telomere function from activation function. A DNAbinding domain (Henry et al., 1990) and activation and derepression domains (Hardy et al., 1992) have been mapped within the Raplp protein.

A role for Rapip in the activation of the glycolytic

genes has been demonstrated for a number of genes including
TInrl (Sot e. a. 1 flflC 'n l, n90l 1DH3 B te et al., 19 1 ,G










23

Santangelo, 1990) Furthermore, putative Rapip-binding sites can be identified in the 5' region of other genes in the glycolytic pathway (Huie et al., 1992; and discussion) Rapip appears to undergo phosphorylation which may influence its binding at the UAS,,;; (Tsang et al., 1990) This post-translational modification has been suggested (Tsang et al., 1990) to be responsible for the glucose induction of PGK (Chambers et al 1989)

The mechanism of action of Rapip is currently unknown. Although Rapip binding sites are necessary for high-level expression of glycolytic genes, they are unable to convey high-level expression of reporter genes by themselves (Stanway et al., 1989). Protein-protein interactions with the putative coactivator GAL11/SPT13 has been proposed (Nishizawa et al, 1990; Fassler and Winston, 1989; Stanway et al., 1993), and the mapping of an activation domain in Raplp to 66 amino acids with a net negative charge of -12 (Hardy et al., 1992) also supports a coactivation model (Baker, 1991). Alternatively, Rapip has been proposed to alter chromatin structure providing access to DNA by other activator proteins (Devlin et al., 1991; Sentenac and Vignais, 1987) Finally, Scott and Baker (1993) have proposed that Raplp facilitates binding of Gcrlp by either a protein-protein interactions or by altering the topology of










24

transcriptional activation and initiation of DNA replication. Binding sites for Raplp and Abflip are both found at HMR(E). Abflp binds to the promoters of the ribosomal-protein genes encoding L2A and L2B (Seta et al., 1990). Abflp binds to the B3 element (Marahrens and Stillman, 1992) of the autonomously replicating sequences (ARS) and is important for initiation of replication. Replacement of the Abflp-binding site with a Raplp-binding site can restore high-level ARS activity (Marahrens and Stillman, 1992) The binding sites for these factors can also be exchanged in a gene transcribed br RNA polymerase II an Abflp-binding site can replace a Rapip-binding site in the ILV1 gene (Remacle and Holmberg, 1992). A functional Abflp-binding site is found in the UAS of PGK and PYK (Chambers et al., 1990).

The similarity of function of Raplp and Abflp is matched by an homology of 40% conserved amino acid over 60% of the primary sequence between the two proteins (Diffley and Stillman, 1989) This has lead to a model of action of these two proteins (Diffley and Stillman, 1989) The repressed state of HMR involves the formation of chromatin structure similar to that of heterochromatin (Nasmyth, 1982) Heterochromatin is located in the periphery of the nucleus associated with the nuclear lamina. The SIR4 gene is also required for silencing (Rine and Herskowitz,1987) The
presence of a,, nlmina doai in then Sir; protein,, suget










25

been shown to purify with the nuclear scaffold (Cardenas et al, 1990), as do ARS sequences (Amati and Gasser, 1988).

Reble

REBI is an essential gene in Saccharomyces cerevisiae

encoding a highly hydrophilic protein of 809 amino acids (Ju et al., 1990) The protein was originally isolated as a factor binding to the rRNA enhancer (Morrow et al., 1989 and 1990), but now appears to play a more global role in transcription. It is likely to be identical (Ju et al., 1990) to the proteins Y (Fedor et al., 1988), Grf2p (Chasman et al, 1990), and QBP (Brandl1 and Struhl, 1990) The Reblp consensus binding site is present upstream of a number of genes transcribed by RNA polymerase II, including the highly expressed glycolytic genes PYK (Chasman et al., 1990), TPI1 (Scott and Baker, 1993), TDH3 (Bitter et al., 1991) and ENO1 (Machida et al., 189). The exact role of Rebip in the expression of genes transcribed br RNA polymerase II is currently unknown; however, it has been shown to effect chromatin structure (Fedor et al., 1988), and although Reblpbinding sites have little effect on activation by themselves, they do potentiate nearby activators (Chasman et al., 1990; Holmberg and Remacle, personal communication) This synergistic effect is strongly distance dependent This observation has lead to the suggestion that Reblp exerts its










26

GcrlD as a DNA-Bindina Protein

The experiments presented in this study were designed to characterize several basic properties of the DNA-binding activity of Gcrlp. Since Gcrlp is a transcriptional activator it should adhere to the modular nature of this class of proteins. The experiments described in this study set out to determine whether Gcrip does have a modular design and a DNA binding domain. Deletion analysis of Gcrip was used to address this point Experiments also were designed to determine if the Gcrip DNA-binding domain binds to DNA in a sequence specific manner and to define a consensus sequence to which it binds. This was studied by DNase I footprinting and DNA band-shift assays. Whether the CTTCC core sequence is sufficient to convey DNA binding, or if surrounding base pairs are important in the ligand interaction was also addressed in this study by DNA band-shift assays. Determination of affinity and specificity of binding by Gcrip to a consensus sequence is presented. Finally, since many DNA-binding proteins have been shown to distort DNA when bound, Gcrlp was also assayed for this activity. The implications of the findings in this study are discussed in the context of the combinatorial nature of interactions of factors important for glycolytic gene expression.
















MATERIAL AND METHODS



Bacterial Strains

E. coli strains used in this study were MC1061 (hsdR,

mcrB, araD139, A[araABC-leu] 7679, AlacX74, galU, galK, rpsL, thi) (Casadaban and Cohen, 1980); DH5 a (#80dlacZAM15, A[lacZYA-argF]U1 69, deoR, recAl1, hsdRl 7, supE44, thi-1, hyrA96, relAl) (Hanahan, 1983) ; and, TB1 (ara A[lac ZYApro AB] rpsL [#80dlacZAM15] hsdR) (Johnston et al., 1986) .

Media and Growth Conditions

E. coli strains used in this study were grown at 37 C in L broth (5 g yeast extract, 10 g tryptone, and 8 g NaCI per liter) with vigorous shaking. Strains harboring plasmids were grown in L broth containing 100 pg/ml ampicillin.

Transformations

E. coli strains MC1061 and TB1 were transformed with

plasmid DNA by the low pH method of Enea et al. (1975) E. coli strain DH5 a was transformed by the manufacturers recommended method (GIBCO BRL)

Induction of malE::GCRI Gene Fusions

E. coli strain TB1, harboring plasmids encoding

malE::GCRI gene fusions, was used for the production of
hybtrir, rflln-1 Mrl 'oly ve.A 5 m .l cultr ir- n 2 liter










28

a final concentration of 2 mM to induce expression of the malE::GCR1 fusions genes The cultures were then grown an additional 2 hours at 37 C, following which time they were harvested by centrifugation (4000 x g for 10 min at 4 C) The supernatant was discarded and the wet weight of the pellet was determined. The cells were suspended in 3 ml TEN lysis buffer (50 mM Tris [pH 8.0], 1 mM EDTA, 50 mM NaCI1) per gram (pellet [wet weight]). The bacteria were lysed by passage through a French pressure cell at 20,000 ib/in2 by the method of Clifton et al. (1978). Cellular debris was removed by centrifugation at 17,000 x g for 20 min at 4 C. The supernatant, containing the soluble cellular protein, was recovered for further use. Protein extracts prepared in this manner typically had a protein concentrations that ranged from 0.068 to 0.2 mg/ml, as determined by the method of Bradford (1976)

Purification of MBP-GCR1 Fusion Protein

The Maltose-binding moiety of the hybrid MBP-Gcrlp(690844) fusion protein was utilized to purify the fusion protein by affinity chromatography over an amylose column. The amylose column was prepared in the following manner. A 15 ml slurry of amylose resin was allowed to settle in a 2 5 x 10 cm column. The height of the packed resin was 1 cm giving a total bed volume of 7 cm3 The column was then washed with
appoxmael coum voue (2 ml)










29

yield a final volume of 400 ml. The diluted lysate was loaded onto the amylose column at the rate of 1 ml/min. Following the addition of the crude lysate to the column, the column was washed with 3 column volumes of column buffer containing 0.25% Tween 20. The column was then washed with 6 column volumes column buffer without Tween 20. The hybrid MBP-GCR1(690-844) fusion protein was then eluted from the column by passing 10 nM maltose over the column in column buffer. The fusion protein was collected in 3 ml aliquots. Typically 15 fractions were collected.

Aliquots of 20 ~il of each fraction were subjected to

SDS-PAGE to identify fractions containing fusion protein. 20 l1 aliquots of each fraction were electrophoresed through a 10% SDS-PAGE. The resulting gel was stained with coomassie blue to visualize the protein. Typically fusion protein appeared across fractions 2 through 7 Fractions containing the fusion protein were pooled and concentrated by ultrafiltration through a low-adsorption, hydrophilic, [YM] membrane with a 30 kiloDalton size exclusion using a Centriprep-30 concentrator (Amicon) according to the manufacture's specifications. Pooled fractions were added to the Centriprep-30 concentrator and centrifuged for 5 min at 2600 rpm (5000 x g) in a Jouan CRF412 swinging-bucket benchtop centrifuge. The filtrate was decanted and the










30

saved by storage at -70 C. A typical protein concentrations of such a prep was 0.35 mg/ml.

Nucleic Acid Manipulations

Standard techniques used throughout the course of this study are described in common reference manuals (Ausubel et al., 1989; Sambrook et al., 1989). Deviations from standard techniques are noted and described. DNA PreciDitation

Prior to ethanol precipitation ammonium acetate was

added to the DNA solutions to a final concentration or 2 5 M. This was accomplished by adding an equal volume of 5 M ammonium acetate. The resulting volume was noted and then

2 5 volumes of absolute ethanol was added, mixed, and placed at -70 Cfor 10 min. Following which time the samples were centrifuged in a microcentrifuge at 12,000 x g at room temperature for 20 to 30 min. After centrifugation the supernatant was discarded and the pellet washed with 1 ml 70% ethanol. The resulting mixture was then centrifuged for 5 min at 12,000 x g in a microcentifuge at room temperature. Again the supernatant was discarded and then the pellet was dried in vacuum with a Speed Vac Concentrator (Savant Instruments Inc. ).

In situations were DNA was to be treated with

polynucleotide kinase, ammonium acetate was avoided. In
ths case DN wa prc-ae by ajsigsluinta










31

of ethanol. Samples were cooled, centrifuged, and dried as described above.

Purification of DNA Fraaments and Oliaonucleotides

Oligo-nucleotides used in this study were initially

synthesized on an Applied Biosystems 380B DNA synthesizer by the University of Florida Interdisciplinary Center for Biotechnology Research. The sequence of the oligonucleotides used are listed in Table 1. In some cases oligonucleotides were purified by 10% PAGE. After DNA was visualized by ethidium bromide staining, gel slices were incubated at 37 C overnight in 3 volumes of 0.5 M ammonium acetate, 1 mM EDTA, and then precipitated the next morning by the addition of 2 5 volumes ethanol and centrifugation.

DNA was purified from acrylamide gels by transfer to DEAE paper. The excised gel was embedded in 0. 8% agarose gel. Current was applied at constant voltage of 100 V and the DNA was run into NA45 DEAE cellulose paper (pre soaked for 10 min in 10 mM EDTA pH 7 6; then 5 min in 0.5 M NaOH, followed by several rapid washes in ddH20). The DNA was freed from the paper by incubating the paper in Hi-Salt NET Buffer (1 mM NaCI, 0.1 mM EDTA, 20 mM Tris [pH 8.0]) for 1 hour at 65 C, phenol extracted, ethanol precipitated, and resuspended in TE pH 7 5.

Radio-labeling DNA Fragments











32

Table 1. 01igonucleotides




Namei Sequence

HB01 5' -ATGTGTGGAATTGTGAGCGG-3' HBO9 5' -GGCATGCCAACATGTATGGGTTCCAAGCTTG- 3 HB10 5' -CAAGCTTGGAACCCATACATGTTGGCATGCC- 3 HB39 5' -GCTAAGCTTAGCTTCCTCTATTGATGGCATGCC-3' HB40 5' -GGCATGCCATCAATAGAGGAAGCTAAGCTTAGC-3 HB57 5 -GACGAATTCTGCAGGGCCCGAN25GCCAAGCTTAGCATGCACGGCC-3' HB58 5' -CGTGCATGCTAAGCTTG-3' HB59 5'-CGAATTCTGCAGGGC- 3'

HB61 5' -GGAAGCTTGACTTTTCAGCTTCCTCTATTGATGGCATGCGGATCCGC- 3 HB62 5' -GGAAGCTTGACTTCCTGTCTTCCTATTGATTGCGCATGCGGATCCGC-3' HB63 5' -GGAAGCTTACAATATGGACTTCCTCTTTTCTGGGCATGCGGATCCGC-3' HB64 5'-GGAAGCTTCTAATCCGAGCTTCCACTAGGATAGGCATGCGGATCCGC-3' HB65 5' -GGAAGCTTAGACATCGGGCTTCCACAATTTTCGGCATGCGGATCCGC-3' HB66 5' -GGAAGC TTTTCTGGCATCCAGTTTTTAATGCATGCGGATCCGC-3' HB7 6 5' -GGAAGCTTCTTTTTTACTCTTCCAGATT7TCTCGCATGCGGATCCGC-3 HB77 5' -GGAAGCTTTCCCCTCTTTCTTCCTCTAGGGTGTGCATGCGGATCCGC- 3 HB79R 5' -GGAAGCTTTGGTGCAGGGCTTCCTCAGGTAGACGCATGCGGATCCGC- 3 '










33

Most DNA fragments used for probes in experiments were labeled by first digesting the fragment with restriction endonucleases which produce protruding 5' ends The overhang was then filled in and labeled by using the large fragment of E. coli DNA polymerase I in the presence of R32P dATP (3,000 mCi/mM) The reaction was carried out in the restriction digest reaction mixture, after digestion, by adding dNTPs (minus dATP) at 10-3M. One to six units of the large fragment of E. coli DNA polymerase was then added and the reaction was allowed to proceed at 37 C for 30 min. Probes were then purified by 6% PAGE as described below.

In some cases probes were labeled using polynucleotide kinase. In these cases this was accomplished by first treating the DNA fragments with 0.1 U of bacterial alkaline phosphatase for 30 min at 60 C in BAP buffer (50 mM Tris [pH

8 .0], 1 mM ZnC12). The reaction mixture was then treated with Proteinase K (25 Gig) for 30 min at 37 C followed by two phenol extractions. The sample was then ethanol precipitated. The pellet was resuspended in polynucleotide kinase buffer (50 mM Tris [pH 7 6], 1 mM MgC12, 5 mM DTT, 0.1 mM spermidine, 0.1 mM EDTA) with 200 pCi of y32P ATP and 20 U of T4 polynucleotide kinase. The reaction was allowed to proceed for 1 hour at 37 C. Probes were then purified by 6% PAGE as described above.










34

Polvacrylamide Gel Electroohoresis

Various types of polyacrylamide gels electrophoresis (PAGE) were used throughout the course of this study. Nondenaturing PAGE was used for separation and purification of DNA and for band shift assays. The percentage and ratio of acrylamide to N,N'-methylenebisacrylamide (bis) was determined by the particular use of the gel. For purification of DNA, generally 6% or 8% gels with 30:1 acrylamide:bis ratio polymerized in TBE buffer (0.1 M Tris [pH 7.5], 0.1 M Boric Acid, 10 mM EDTA) were used. Running buffer was 1 x TBE. Gels were run at constant voltage, usually 1-8 V/cm.

For band shift assays, 5-10% non-denaturing gels with 82 6:1 acrylamide:bis polymerized in 0.5 x TBE buffer were commonly used. Running buffer was 0.5 x TBE. In cases were GCR1 was translated in rabbit reticulocyte lysate, TE (10 mM Tris [pH 7 5], 1 mM EDTA) gels produced better resolution. These gels ranged between 5-10% with a acrylamide:bis ratio of 82 1 and were polymerized in TE buffer. Running buffer was TE with recirculation. Band shift gels were pre-run for at least 1.5 hours at 100 volts.

For DNA sequencing and DNase I footprinting, denaturing gels containing 7 M urea were used. An acrylamide:bis ratio of 30:1 was polymerized in 0 5 x TBE buffer. These gels were










35

Determination of DNA Concentrations

DNA concentration were determined by spectrophotometry in a Beckman DU-70 spectrophotometer outfitted with a micro cell using 260 = 1.3 x 104 M- (per mole bp) as described in Fried and Crothers (1981)

Generation of Double Strand DNA Oliconucleotides

Double-stranded oligonucleotides were generated by three different methods. The most common protocol was by the method of Oliphant et al (1987) as modified by Scott (1992) Single-stranded oligonucleotides were synthesized (University of Florida Interdisciplinary Center for Biotechnology Research) with the desired sequence flanked by restriction sites. The restriction site at the 3' end was contained in a larger (usually 8-10 base pair) palindrome by the addition of G and C residues. The oligonucleotides were heated in 10 gL of 3x Buffer (30 mM Tris [pH 7.5], 150 mM NaC1, 30 mM MgCI2, 15 mM DTT, 0.1 mg/ml) at 37 C for 60 mins. to allow the 3' ends to self-anneal. The solution was then diluted to 30 gL with the addition of 9 5 gL of ddH20 and 7.5 gL of dNTPs (103M) and the 3'-ends were extended with the addition of 2 pL (10 units) of the large fragment of E. coli DNA polymerase I. The double-stranded extension products were then gel purified after 8% polyacrylamide (40:1.3 Acrylamide/Bis) gel electrophoresis (PAGE), digested with appropriate restriction










36

In some instances oligonucleotides were made doublestranded by directly annealing equimolar concentrations of complementary oligonucleotides. Hybridization of the oligonucleotides was determined spectrophotometrically by measuring the change in the hypochromatic shift (Bloomfield et al., 1974; Eisenberg and Crothers, 1979) Fifty micrograms of each oligonucleotides were mixed, heated to 100 C for 5 min, and then allowed to slow cool to ambient temperature. This method was used to generate doublestranded oligonucleotides from HB09/HB10, and from HB39/HB40 (see Baker, 1991)

Finally, some oligonucleotides were made double-stranded by annealing a smaller primer to a longer template oligonucleotide and extending with dNTPs (10-3 M) in the presence of the large fragment of E. coli DNA polymerase I at 37 C for 30 min using 3x Buffer (described above). This method allowed incorporation of the polymerase chain reaction (PCR) for re-amplification of the template oligonucleotide by using an additional smaller primer. PCR cycle temperatures and times were as follows: denaturation, 94 C for 50 sec; annealing, 50 C for 40 sec; and extension, 72 C for 35 sec. This method was used to generate double-stranded oligonucleotides from HB57, HB58, and HB59. DNA Sequencina









37

prepared from 10 ml cultures of E. coli by the alkaline lysis method (Birnboim and Doley, 1979; Ish-Horowwicz and Burke, 1981) they were further purified by resuspending the total precipitated DNA from the preparation in 128 gL ddH20. Then 32 pL of 4 M NaCI and 160 JiL of 13% polyethylene glycol-8000 (PEG) were added and the solLtion was mixed well. The solution was incubated on ice for exactly 20 mins. and then microcentrifuged for 10 mins. at room temperature. The pellet was washed with 70% ethanol and then dried under vacuum. The pellet was resuspended in 75 gL of TE pH 7 5. 25 gL of this solution was then used in the sequencing method described by U.S. Biochemicals.

Plasmid Construction

The plasmids used in this study are listed in Table 2 A number of plasmids which contain CTTCC sequence elements were constructed. Plasmid pUC66 contains sequence from UASTPI, from positions -317 to -327 This region harbors two GCR1-binding sites and a RAPi-binding site (Scott, 1992) Plasmid pUC66 was constructed by cloning the HindIII-SphI fragment from plasmid pES119 (Scott, 1992) into the HindIlSphI sites of pUC18.

Plasmids pUCT61-pUCT79 contain CTTCC sequence elements from a number of glycolytic and translational machinery genes. The number of the plasmid refers to the HB











38

Table 2. Plasmids

Plasmid Comments

pHB66 GCRI structural gene cloned downstream of SP6 promoter (Baker, 1991) in plasmid pSPl9 pSP56RT RAP1 structual gene cloned downstream of SP6 promoter (Chambers et al, 1987) in plasmid pSP19 pMH2 PstI-SalI fragment of GCRI structural gene cloned into PstI-SalI sites of pSP18 pMAL-GCR1(690-844) malE-GCRI1(690-844) fusion gene under tac promoter in pMAL-c

pMAL-GCR1(783-844) malE-GCR1(783-844) fusion gene under tac promoter in pMAL-c

pCD1 malE-GCR1(1-844) fusion gene under tac promoter in pMAL-c

pCD2 malE-GCR1(277-844) fusion gene under tac promoter in pMAL-c

pCD3 malE-GCR1(422-844) fusion gene under tac promoter in pMAL-c

pCD5 malE-GCRI(706-844) fusion gene under tac promoter in pMAL-c

pUCT61 CTTCC sequence element from TPII cloned into HindIllBamHI site of pUC18

pUCT62 CTTCC sequence element from PGKI cloned into HindllBamHI site of pUC18


pUCT63 CTTCC sequence element from ADHI cloned into HindIIIBamHI site of pUC18


pUCT64 CTTCC sequence element from ENOI cloned into HindIIIBamHI site of pUC18











39

Table 2. Plasmids (cont.)

Plasmid Comments

pUCT66 CATCC sequence element from TPI1 cloned into HindIIIBamHI site of pUC18


pUCT76 CTTCC sequence element from TEF1 cloned into HindIIIBamHI site of pUC18


pUCT77 CTTCC sequence element from TEFI cloned into HindIIIBamHI site of pUC18


pUCT79 CTTCC sequence element from CRY1 cloned into HindllBamHI site of pUC18


pUC66 UASTPII cloned into HindIII-SphI site of pUC18 pCY4 Circular permutation assay vector (Prentki et al., 1987)

pCY66 UASTPII cloned into SmaI-BglII site of pCY4










40




Table 3. Oligonucleotides containing CTTCC sequences Olionucleotide Sequence

LINKER agcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgatt

UASTPI agcttAGCTTCCTCTATTGATGTTACACCTGGACACCCCTTTTCTGGCATCCAGTTgcat TPI11 agcttGACTTTTCAGCTTCCTCTATTGATGgcatgcggatccccgggtaccgagctcgatt TPI12 agcttt-TTTTCTGGCATCCAGTTTTTAATgcatgcggatccccgggtaccgagctcgatt PGK agcttGACTTCCTGTCTTCCTATTGATTGCgcatgcggatccccgggtaccgagctcgatt ENO1 agcttCTAATCCGAGCTTCCACTAGGATAGgcatgcggatccccgggtaccgagctcgatt PYK agcttAGACATCGGGCTTCCACAATTTTCGgcatgcggatccccgggtaccgagctcgatt ADHI1 agcttACAATATGGACTTCCTCTTTTCTGGgcatgcggatccccgggtaccgagctcgatt










41

sites of pUC18. The inserts of these plasmids, used for radiolabeled DNA probes in bands shift assays, are listed in Table 3.

A series of malE::GCRI gene fusions which carry various deletions of the 5' end of the GCR1 structural gene were prepared by cloning Gcrlp coding sequences into the plasmid pMAL-c (Guan et al., 1987; Maina et al., 1988) The plasmid pMAL-c express the malE gene, which encodes the E. coli maltose binding protein (MBP), under control of the E. coli tac promoter (Amann et al. 1983) A polyl1inker site is located in the malE structural gene and allows in-frame insertion of DNA fragments to construct fusion proteins under a strong inducible promoter. Plasmid pMAL-GCR1(690-844), which encodes a maltose binding protein (MBP)-Gcrlp fusion protein containing amino acids 690-844 of Gcrlp, was created by cloning the HaeIII-XbaI fragment from plasmid pMH2 into the StuI-XbaI sites of plasmid pMAL-c. Plasmid pMH2 contains the PstI-SalI genomic fragment of the GCR1 structural gene cloned into the PstI-SalI sites of plasmid pSPl8.

Plasmid pMAL-GCR1(783-844) was created as follows: Plasmid pMAL-GCR1(690-844) was cleaved with Ppmul. The resulting overhang was filled in with dNTPs and the large fragment of E. coli polymerase I After phenol extraction and ethanol precipitation the DNA was then cleaved with










42

Plasmids pCD1, pCD2, pCD3, and pCD5 were kindly provided by Carolyn M. Drazinic. These plasmids code for additional 5'-GCR1 deletions fused in frame with MBP. They contain the following amino acids residues of GCR1: pCD1, MBP-GCR1(1844); pCD2, MBP-GCR1(277-844); pCD3, MBP-GCR1(422-844); pCD5, MBP-GCR1(706-844)

In Vitro TranscriDtion

Plasmid pHB66 (Baker, 1991) contains the GCR1 structural gene (from an AflII restriction site located 136 bp 5' to the translational start site to a BclI site located 661 bp 3' to the translational termination site) cloned downstream of the SP6 promoter in the plasmid pSP19. This plasmid was linearized with various restriction enzymes. After complete digestion was confirmed by agarose gel electrophoresis, the DNA was phenol extracted, ethanol precipitated, and resuspended in TE. For a translation template for RAP1 the plasmid pSP56RT (Chambers et al., 1989) was linearized by cleavages with the restriction endonuclease XbaI, and was prepared in a similar manner.

Five micrograms of linearized DNA was used as a template in transcription reactions carried out in the presence of the cap analog m7G(5' ) ppp(5 ) G using a kit from Promega, under the following reaction conditions: 40 mM Tris [pH 7 5], 6 mM MgC12, 2 mM spermidine, 10 mM NaCI, 10 mM DTT, 0.1 mg/ml BSA,
1 mM AT, TP UTP 0. mM GTP 0 5 mM G-ad50Uo










43

extracted, ethanol precipitated, and then resuspended in 20 pL of ddH20 and stored at -70 C.

In vitro Translation

In vitro-derived transcripts were translate in a rabbit reticulocyte lysate system in the presence of L[35S]methionine by using a kit obtained from Promega. Two microliters of substrate RNA (prepared as described above) was incubated with 18 gL of nuclease treated rabbit reticulocyte lysate, 4 gL ddH20, 1 gL RNasin (50 U), 0 5 gL 1 mM amino acid mixture (minus methionine), and 2 .0 L of [35S]methionine. The amount of Gcrlp produced in the rabbit reticulocyte lysates was estimated by determining the amount of [35S]-methionine incorporated into trichloroacetic acidprecipitable material One microliter of the lysate was incubated with 50 gL of 0.1 N NaOH at 37 C for 15 min and then added to 1 ml of 10% TCA and placed on ice for 30 min. Samples were then vacuum filter through filter paper, and washed with 1 ml of 10% TCA. Filters were then added to 5 ml of scintillation fluid and counted. Typical in vitro translation reactions yielded approximately 2.4 ng of GCR1 per L of rabbit reticulocyte lysate. The translation products were analyzed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE), and the radiolabeled proteins were visualized by autoradiography at
70 C andn r c ith km c w standard










44

method of Pfeifer et al. (1987). A 234 bp DNA fragment from the UASTPI was generated by cleavage of the plasmid pES37 (Scott, 1992) with the restriction endonucleases HindIII and SphI This fragment was then radiolabeled only at the HindIII end by filling in with the large fragment of E.coli DNA polymerase I in the presence of (32P dATP. The DNA probe was isolated from the plasmid by 8% PAGE. After visualization of the ethidium bromide stained gel by long wave UV, the area of the gel containing the DNA probe was excised, and the DNA extracted from the gel by the DEAE paper method as described above.

Nucleoprotein complexes were allowed to form under

standard band-shift reaction conditions in a total volume of 20 pL, and then various amounts of DNase I (0.2 to 0.5 U) were added. The reaction mixture was incubated at ambient temperature for 2 min. The reaction was stopped by the addition of an equal volume of stop solution (50% glycerol,

0. 25 M EDTA [pH 8.0]). The resulting mixture was immediately loaded onto a native 5% polyacrylamide (49.4:0. 6) 0.5 x TBE gel. Free and complexed DNA were detected by autoradiography of the wet gel. Bound DNA from both the upper and lower complexes was cut out of the gel and eluted from the gel by either soaking overnight at 37 C in 500 mM ammonium acetate-i1 mM EDTA or by the DEAE paper method described above. The










45

gel. Depending on the experiment 10-20,000 counts/min were loaded per lane.

DNA Ba nd-Shift Assays

Protein-DNA complexes were studied using modifications

of the procedures of Fried and Crothers (1981) and Garner and Revzin (1981). The binding reactions were incubated for 20 minutes in a 20 gL volume at ambient temperature in binding buffer composed of 12 mM HEPES (pH 7 5), 60 mM KC1, 5 mM MgC12, 4 mM Tris, 0.6 mM EDTA, 0.6 mM DTT, 10% glycerol, and 0.3 pg/iL BSA. In some cases poly (dI/dC) was used as a nonspecific competitor at 0. 26 gg/gL. In some case doublestranded oligonucleotides were used as competitor. Competitors were diluted and added as a constant volume per reaction mixture. Protein extracts used in experiments were diluted with binding buffer. Components were added in the following order: binding buffer, competitor, probe, protein. In qualitative experiments, the amount of DNA added was based upon disintegrations/min, usually between 10-20,000 counts/min Depending upon the experiment, gels varied between 5-10% polyacrylamide. Buffers were either TE (0.1 M Tris [pH 7 5], 5 mM EDTA) or 0.5 TBE (0.05 M Tris [pH 7 5],

0.05 M Boric Acid, 5 mM EDTA) In the case of TE the running buffer (10 mM Tris [pH 7 5], 1 mM EDTA) was recirculated. All gels were pre-run for at least 1.5 hours at 100 volts.
-aoe wee onid o th runn -e Afte al samle










46

Titration of DNA-Bind ing Activity

DNA-binding activity of MBP-Gcrlp(690-844) was

determined by band shift assay using the approach of Riggs et al. (1970) and Chadwick et al. (1970) A constant amount of purified MBP-Gcrlp(690-844) fusion protein was titrated with increasing amounts of radiolabeled DNA containing a Gcrlpbinding site. Free and bound complexes were then separated by a standard band shift assay. The amount of DNA used was accurately determined by spectrophotometry. The amount of DNA that was shifted was determined by using phosphoImager analysis (Molecular Dynamics). Thus, the amount of DNA in the shifted complex was determined by comparison to a standard curve of known concentrations of DNA. From this analysis the amount of DNA retained at plateau is a measure of total concentration of active protein in terms of DNA concentration.

Calculation of Equilibrium Binding Constant

DNA-binding affinity was determined by band shift assay using the analysis of Riggs et al. (1970) and Chadwick et al. (1970) A known amount of DNA was radiolabeled and allowed to bind to varying concentrations of active MBP-Gcrlp. Free DNA was separated from nucleoprotein complexes by native gel electrophoresis. Gels were dried to Whatman paper and then counts were determined by use of a PhospholImager (Molecular
D nam cs) By olin DNA cocnrtin beo-teet-a















RESULTS

The world is a construct of our sensations, perceptions, memories. It is convenient to regard it as existing objectively on its own. But it certainly
does not become manifest by its mere existence.
Erwin Schrodinger (p.1)


Previous experiments had suggested that the product of GCR1 interacts directly with the CTTCC sequence element (Baker, 1991). In those experiments, RNA was translated in vitro to make the Gcrlp protein in rabbit reticulocyte lysates. The lysate was used in band shift assays with DNA fragments containing the CTTCC sequence element Additionally, when anti-Gcrlp antibody was included in the reaction mixture a supershift was observed (Baker, 1991) These experiments strongly supported the view that Gcrlp is a DNA-binding protein; however, alternative models could not totally be excluded. For example, since CTTCC sequence elements had been described in the promoters of higher eukaroytes it was possible that the Gcrlp could associated with and modify another factor in the lysate stimulating a protein complex which included Gcrlp to bind to UASTPI DNA. For example, the product of the retinoblastoma gene displays DNA-binding activity when complexed to the factor EF2
IChttnden et al. 193, R ea 192,Ou al.,










48

binding activity of the complex. If this were the case, then Gcrlp would be included in the complex--based on the supershift experiments. This study set out to confirm that Gcrlp interacts directly with DNA in a sequence-specific manner.

GcrlD Expressed in E. coil or Rabbit Reticulocvte Lvsate Binds to DNA

Throughout the course of this study Gcrip, synthesized in vitro from rabbit reticulocyte lysates and MBP-Gcrlp fusion protein, expressed in E. coli, were used to characterize the DNA binding activity of Gcrlp.

MBP-Gcrlp full-length fusion protein was produced in E. coli strain TB1 harboring a plasmid encoding for a malE::GCR1(I1-844) gene fusions under the tac promoter. The fusion protein was induced in E. coli by the addition of 2 mM IPTG during the log phase of growth. Cell were then lysed by passage through a French Pressure cell. Protein extracts were analyzed by SDS-PAGE stained with Coomassie blue (data not shown) Protein concentration, pre-determined by the method of Bradford (1976), ranged from 0.068 to 0.2 mg/ml. The amount of extract used in band shift assays varied depending on the preparation. Typically between 3 and 15 microliters were used in band shift assays. The volume used was determined by titrating DNA-binding activity. It was noted that if extracts were used immediately less volume was










49

presumably due to instability of full-length Gcrlp in the extracts

The DNA probe used for the band-shift assay was the upstream activating sequence (UAS) of the gene encoding triose-phosphate isomerase (TPI1). Plasmid pES119 (Scott, 1992) containing the UASTPII, was digested with the restriction endonucleases SphI and HindIII liberating a 60 base pair fragment containing UASTPi from positions -377 to 327 relative to the start of translation. The fragment was then radiolabeled at the HindIII site.

As seen in Figure 1, both Gcrip synthesized in vitro and the full length MBP-Gcrlp fusion protein were able to form nucleoprotein complexes with DNA carrying UASTPI. The position of the nucleoprotein complexes observed with the fusion protein migrate more slowly than the complexes observed with rabbit reticulocyte lysate containing Gcrlp (Figure 1) This difference is presumably due to the increase in molecular weight of the nucleoprotein complex due to the presence of the maltose binding moiety of the fusion protein. This is consistent with the notion that Gcrlp interacts directly with UASTPII The appearance of two shifted bands in the band shift assay with Gcrlp and its derivatives was routinely observed and had been noted previously (Baker, 1991). It has also recently been shown






















Figure 1. Comparison of DNA-binding activity of Gcrip and hybrid MBP-Gcrlp fusion protein. DNA band-shift assays were carried out with a radiolabeled fragment of DNA carrying UASTPII (see Table 3 for sequence) The radiolabeled DNA was incubated in binding buffer with protein extract indicated above the lanes as described in Material and Methods. Fragment alone, radiolabeled DNA fragment; No RNA RRL, 5 il of untreated rabbit reticulocyte lysate (RRL); Gcrip RRL, 5 p1 of rabbit reticulocyte lysate containing in vitro synthesized Gcrlp; E. coli/pMAL-cRl Uninduced, 1 p1 of an extract of a E. coli culture harboring plasmid pMAL-cR1; E. coli/pMAL-cR1 Induced, 1 p.l1 of an extract of a E. coli culture harboring plasmid pMAL-cR1 which had been induced with IPTG 2 h prior to harvest; E. coli/pMAL-Gcrlp(1-844) Uninduced, 1 p1 of an extract of a E. coli culture harboring plasmid pMAL-Gcrlp (1-844) (numbers in parentheses denote amino acid residues of Gcrlp present in the expressed polypeptide, see Table 2.); E. coli/pMAL-Gcrlp (1-844) Induced, 1 p1 of an extract of a E. coli culture harboring plasmid pMAL-Gcrlp (1-844) which had been induced with IPTG 2 h prior to harvest; f, free unbound probe.















-4.








Frag. alone

NO RNA RRL

I i GOcrlp RRL E. coli/pMAL-cR1 Uninduced E. coli/pMAL-cR Induced E.coli/pMAL-Gcrlp(-844) U SE. coli/pMAL-Gcrlp (1-844)










52

untranslated rabbit reticulocyte lysates, E. coli extracts prepared from uninduced and induced cultures of strains carrying the parent plasmid, pMAL-cR1, and extracts prepared from uninduced cultures of E. coli strains carrying the malE :GCRI gene fusion.
The DNA-Bindinag Domain of GerlD Reside s within t he CarboxvTerminal 154 Amino Acid Residues

To map the DNA-binding domain of Gcrip a series of DNA

band-shift experiments with truncated versions of Gcrlp were performed. Carboxy-terminal truncations of Gcrlp were synthesized in vitro. Plasmid pHB66 was linearized with a series of restriction endonucleases that cleaved within the GCR1 structural gene as shown in Figure 2 The linearized constructs were then used as templates for in vitro RNA synthesis, and run off transcripts were translated in vitro using rabbit reticulocyte lysates. Production of polypeptides of the desired molecular mass was confirmed by SDSPAGE and autoradiography (Figure 3) The rabbit reticulocyte lysates were then used in a series of band-shift experiments to determine which, if any, of the truncated fusion-proteins had DNA-binding activity. Figure 4 shows that only full length Gcrlp had binding activity. This suggested that the DNA-binding domain resided in the carboxy terminus of the polypeptide.
To test this possibility, a similar set of experiments









GCRI
SP6 ATG TAA I I I I I Hindlll Scal Sphl Haelll Sall






1-690




1-594



1-431



1-229

Figure 2. Templates used to generate carboxy-terminal deletions of Gcrlp. A schematic representation of the GCR1 structuaral gene cloned downstream of the SP6 promoter is displayed. Digestion of the construct with the vari enzymes shown produce RNA templates coding for polypeptides of the length display below (numbers refer to amino acids residues of Gcrlp).
























Figure 3 Carboxy-terminal truncation polypeptides of Gcrip. Autoradiography of a 10% SDS-polyacrylamide gel electrophoresis of polypeptides produced by in vitro translation of the RNA templates (displayed in Figure 2) using rabbit reticulocyte lysate (RRL). Polypeptides were translated in vitro in the presence of 35S-methionine. The numbers correspond to amino acids residues of Gcrlp. Molecular weight standards, in kiloDaltons, are as follows: myosin H-chain, 200,000; phosphorylase b, 97,000; bovine serum albumen 68,000; ovalbumin, 43,000; carbonic anhydrase, 29,000; (-lactoglobulin, 18,000










II)
Lt?
U1












( 76sP- T ) dT1os








?ttI (o69P8-T7) dT:IDD
.ii














i t it t 1
Iwa V ONoo





oo0 a 0 0 0 oo0 0 o 0 0
0 O OO O C o 0r o 0 0
o N cc,,, ,,,,,,,
















o o
(N
d I ~ o O ............... .........................................
... ........... .. .. .. ... .. .... .. ........ ..












'~0

00.'ZS
*HME-4 .144-a ~Ihr1 r 5.


rlQ ~t4.



S .HC U,

U
I' x

rI~j'~I uTdZDD 0

(T~~-T) dTJDO (,3w~r
U
(~6ST) dTJZD 4-i


-r
(06Th1) GTJDD
U) (C
I
Tad (vta-r) cITJDD 4~4rtjr~


~fl{X5 VN~ ON kG
54-C
*r4Q c 9UOT2 ~1O~

U r4



~Q4(~cn rd4J '4- H~ ~


I
0(11

cu't
It
*H N-H
*'~'
Q4u2 55W



-HO>,I t1r4~










57

were provided by Carolyn Drazinic. These plasmids contain subgenic portions of GCR1 fused in-frame to malE in the fusion vector pMAL-cRl (see Figure 5) E. coli lysates from induced strains harboring the malE::GCRI gene fusions were prepared. Production of MBP-Gcrlp hybrid polypeptide of the desired molecular mass was confirmed by SDS-PAGE and the fusion-protein visualized by coomassie blue staining (data not shown). In general, there was an inverse correlation between the size of the fusion polypeptide and the amount of material observed. E. coli lysates containing hybrid MBPGcrlp polypeptide were then tested in DNA-band-shift assays (Figure 6). All constructs that carried the carboxy-terminal 154 amino acid residues of Gcrlp were able to bind to the upstream activating sequence of TPII. Whereas lysates from strains expressing fusion protein carrying the carboxyterminal 138 amino acids of Gcrlp were unable to bind the DNA fragment used in the study.

A summary of the mapping data is shown in Figure 7. From these results it was concluded that the DNA-binding domain of Gcrlp resides somewhere within the carboxy-terminal 154 amino acids of Gcrlp.

DNase I Footprin t Analysis of UAS!

To establish that Gcrlp indeed bound to the CTTCC

sequence element, in vitro DNase I footprinting experiments









CO
cc
un






MBP-Gcrlp










i .... ... I











Figure 5. malE::GCR1 gene fusions products. A schematic representation of the Gcr: polypeptides used in the amino-terminal deletion studies. The stippled lines indic maltose-binding protein moiety carried in the fusion proteins. Numbers indicate ami
residues of Gcrlp conatained in the fusion proteins










59

















Figure 6. DNA-binding activity of MBP-Gcrlp hybrid proteins. A DNA band-shift assay using a Gcrlp amino-terminal deletion series of hybrid MBP-Gcrlp fusion proteins is displayed. One microliter of an extract of the induced E. coli culture, indicated above each lane, was added to the standard bandshift reaction mixture, as described in the legend to Figure
1.






















Frag. alone pMAL cR1 pMAL-Gcrlp (1pMAL-Gcrp (27 pMAL-Gcr lp (42 pMAL-Gcrp (69 pMAL-Gcrlp (70 pMAL-Gcrlp (78














Region
of
Gcrlp GCR1 1-844

1-690

1-594

1-431

1-229




MBP-Gcrlp

.. 1-844

, ,. .... ..... .... .... 277 -844

422-844

.............. 690-844

..........._ _ ..7 0 6 -8 4 4

.................... 7 8 3 8 4 4





Figure 7. Summary of data mapping the Gcrlp DNA-binding domain. The figure is a schematic represent of the Gcr1p polypeptides used in the mapping study and summary of results obtained. Solid lines repr regions of Gcrlp carried in the polypeptide. The stippled lines indicate maltose-binding protein moi carried in the fusion protein.










62

quantity. The stability of the MBP-Gcrlp(690-844) protein also allowed for its purification. The fusion protein was purified as described in Material and Methods. A 234 basepair DNA fragment from the UASTPI1 was generated by cleavage of the plasmid pES37 (Scott, 1992) with the restriction endonucleases SphI and HindIII. The fragment was radiolabeled at the HindIII site. Nucleoprotein complexes were allowed to form under standard band shift reaction conditions after which DNase I was added to the mixture. Reactions were terminated by inhibiting DNase I with high concentrations of EDTA, and then the samples were immediately run into a non-denaturing acrylamide gel. Complexes were identified by autoradiography and purified from the gel. The nicked DNA was then transferred to DEAE paper using electrophoresis. DNA was eluted with high-salt buffer and then isolated by phenol extraction and ethanol precipitation. The DNA was then denatured and run on a sequencing gel. A DNA fragment incubated without protein was digested with DNase I to generate a control ladder. Figure 8 shows the results of the DNase I protection studies using purified MBPGcrlp(690-844) fusion-protein. Two areas of protection were observed: one clear area of protection centered over the CTTCC motif and another area of partial protection centered over the related sequence CATCC. Edward Scott has shown that

























Figure 8. Gcrlp DNA-binding domain protects the CTTCC sequence motif and a related sequence element, CATCC, in UASTPz from DNase I cleavage. Analysis of UASTPII was carried out with purified MBP-Gcrlp(690-844) and a radiolabeled 234bp fragment carrying the UAS of TPII. Lanes T, G, C, and A, are the products of the dideoxy sequencing reactions of M13mpl8 and serve as molecular weight standards; lanes 1 and 4, free fragment treated with DNase I; lane 2, nucleoprotein complex treated with 0.2 U of DNase I, as described in Material and Methods; lane 3, nucleoprotein complex treated with 0.5 U DN ase I. The sequences of protected areas are denoted on the right. The exact extent of the area protected over the CTTCC sequence element could not be determined because of lack of bands in the control lanes (lanes 1 and 4); therefore, two 5' boundaries are indicated on the figure.







LO






to
aIllS VOOLV3013l *C- iViOiOOflOSVOIIOVDVVi" ,9


dJ





|i I 5il il S i i t

o t:.t~:) ii ; J

t-~lH m i !W it i I 4 ,
a3 C~~~li;;~3 33;~~ 43P)I; r 4i
mae aa Is )dsil13tb a










65

Identification of a Consensus GCrlo DNA Bindina Seouence

Before this study, demonstration of the DNA-binding

activity of Gcrlp had utilized only DNA carrying sequence from the TPII UAS element. In an effort to define a consensus Gcrlp-binding site, DNA was synthesized with the putative Gcrlp-binding sites found in front of a number of other genes encoding glycolytic enzymes, namely PGKI1, ENO1, PYKI, and ADH1. These sequences were chosen for the following reasons. There are three CTTCC sequence elements important for expression of PGKI (Chambers et al., 1988). One of these elements was arbitrarily chosen for study. The CTTCC elements from ENOI and PYKI were chosen because there is genetic evidence that shows they are important determinants of their respective UAS elements (Buchman et al., 1988). It was predicted that the CTTCC element found adjacent to the RAP1-binding site in the ADHI promoter would likely bind GOcrip; therefore it was tested it for its ability to bind Gcrlp. In addition, the two putative Gcrlpbinding sites in UASTPI (determined from the DNase I footprinting experiments) were tested individually.

01igonucleotides were synthesized which carried 25

nucleotides from the genes of interest with the CTTCC motif under study located at the center of each oligonucleotide. Table 3 shows the sequence of the oligonucleotides used as










66

sequence listed in Table 3 has recently been shown to be protected in wild-type strains and deprotected in a gcrl null mutant by in vivo footprinting (Stanway et al.,1994). The oligonucleotides were then tested for their ability to interact with the DNA-binding domain of Gcrlp in a series of DNA-band-shift assays. As a negative control the polylinker from pUC18 was used in the band shift assays. The results of the band shift assays are shown in Figure 9 The appearance of shifted bands were not detected when the polylinker from pUC18 was used as probe. On the other hand, each of the putative Gcrlp-binding sites gave rise to the appearance of shifted bands, thus providing evidence that Gcrlp is capable of interacting with these sequences. Additionally, the UAS of CYCI, which does not contain a CTTCC sequence element and is not under control of GCRI, also did not form a nucleoprotein complex with Gcrlp (data not shown)

The expression of the genes encoding elongation factor EF-la (TEF1 and TEF2) and ribosomal protein 59 (CRY1) is reduced two- to four-fold in gcrl mutant strains (Santangelo and Tornow, 1990). Potential Gcrlp-binding sites were identified located in the 5' noncoding region of these genes. A model was entertained that Gcrlp played a direct role in expression of these genes at the transcriptional level Therefore, oligonucleotides which carried 25 nucleotides
cot Snn th TC oi fo h ee ofitretwr







LINKER UASTP TP TPI2 PGK ENOI PYK ADHL

I- I- +1 I- +1 I- +iI +11 +1 I- +1 I- +1










U
















f.-*




Figure 9. Gcrlp DNA-binding domain binds to CTPCC sequence elements found in front c glycolytic genes. DNA band-shift analysis was carried out with purified MBP-Gcrip (6 and the radiolabeled oligonucleotides listed in Table 3. The absence (-) and presenc on 10 ng of MBP-Gcrlp fusion protein in the DNA band-shift assay are indicated above lane.










68

DNA with greater affinity than the polylinker of pUC18 (data not shown)

From the results of the band-shift experiments the following consensus DNA-binding sequence for Gcrip was derived (see Discussion)

(T/A)N(T/C)N(G/A)N C (T/A) T C C (T/A)N(T/A) (T/A) (T/G)

The Gcrln-DNA NucleoDrotein Comolex

Having defined the DNA-binding domain of Gcrlp, and a

consensus DNA-binding site which it recognizes, I set out to characterize the affinity and specificity of the Gcrlp interaction with its binding site. Historically, it had been very difficult to demonstrate that Gcrlp was a DNA-binding protein. During the period between sequencing of the gene (Baker, 1986) and the demonstration of the binding activity of it product (Baker, 1991) many laboratories had attempted to demonstrate Gcrlp DNA-binding activity, yet failed. It was therefore reasoned that Gcrlp may have a low affinity for its DNA site, and that it may be facilitated to bind DNA by other proteins. To test this I measured the binding affinity of Gcrlp for its target site. The DNA-binding affinity of the Gcrlp-binding domain

Experience working with the Gcrlp protein revealed that the full-length protein is very unstable. This seems to be the case whether the product is translated in vitro in rabbit
-riculocyte lyateL r whehe it- s epsedi










69

immediately. This rapid decrease in activity made it extremely difficult to use full-length Gcrlp in experiments were the active protein concentration needs to be accurately known, or in experiments in which the protein must be of a fixed concentration over time. However, truncated MBP-Gcrlp fusion-proteins including the Gcrlp DNA-binding domain has proven to be very stable, especially when stored at high concentration. I do not detect a noticeable loss of activity over months of storage at -70 C. This allowed me to measure the binding affinity of the DNA-binding domain. Fusionproteins have been used to measure the DNA binding affinity of other proteins (Desplan et al., 1985; Johnson and Herskorwitz, 1985; Giese et al., 1991).

A single Gcrlp-binding site from the UAS of the triosephosphate isomerase gene was used in these experiments. The site is listed as TPII in Table 3, and, as mentioned above, it has been shown to be protected in a GCR1-dependent manner in vivo (Huie et al., 1992; Scott, 1992). The concentration of the radiolabeled, gel-purified probe was determined by spectrophotometry

Purified hybrid MBP-Gcrlp(690-844) fusion protein was

used for these experiments. Active protein concentration was determined by the methods described by Riggs et al. (1970) and Chadwick et al. (1970), except that band-shift assays










70

solution of protein was 0.35 pg/pL as determined by the method of Bradford (1976). After complexes were allowed to form, the reaction mixtures were run into a 0.5 x TBE 5% native PAGE. The gels were dried on the Whatman paper, and then the separated radiolabeled DNA was quantitated with a PhospholImager (Molecular Dynamics). The fraction of DNA shifted by protein was determined. At saturating conditions, all of the active protein was bound to the DNA. Since the concentration and specific activity of the DNA in the complex was known, the concentration of the complex was determined by quantitating the amount of DNA complexed. The active protein concentration therefore was expressed in DNA equivalents per volume (see Chadwick et al., 1970). A typical experiment is shown in Figure 10. In two independent experiments the active protein concentration of the stock was determined to be 1 x 10-6 M. The active fraction was approximated to be 16% of the total protein concentration.

Pilot experiments were performed to estimate the

dissociation constant of DNA-binding domain of Gcrlp from its recognition site. With the protein activity known, an arbitrary small concentration of DNA was held constant at 1.2 x 10-10 M and increasing concentrations of the protein were added. The concentration at which one-half of the DNA was bound was used to estimate the binding affinity. The






























Figure 10 Titration of Gcrlp DNA-binding activity. The concentration of active MBP-Gcrlp(690-844) fusion-protein was determined by titrating increasing concentrations of radiolabeled oligonucleotide carrying a single Gcrlp-binding site (probe TPI1, listed in Table 3.) with a constant amount of MBP-Gcrlp(690-844) A typical experiment is shown here. As the amount of DNA was increased all of the active protein appeared in the bound DNA (shifted) fraction. The amount of DNA at plateau was determined by comparison to DNA standards using a PhospholImager (Molecular Dynamics). Active protein concentrations were thus expressed in DNA equivalents (see Chadwick et al ., 1970) .













~-.2
Cas
I) "



s
......................as


ai ..a
..
....i,,,,,''' '.Su... ,iiii~~~~~~~~i ........
asiii .... ,,,,ii ,,,
'a.

ai~iii ii~!!iiij p,,,,,,









73

different experiments. Under these condition the Kd could easily be determined by the amount of active protein needed to occupy half the DNA binding sites (see Riggs et al., 1970 and Johnson et al., 1979) This follows from the fact that starting with the equations,

protein-DNA <-> proteinfree + DNAfree,

Kd = [proteinfree] [DNAfree] / [protein-DNA] and,

DNAto tai = DNAfree + DNAbound

it can be shown that,

Kd = [prOtein]1/2 1/2[DNAtotal]

where [protein]1/2 is the concentration of protein when [DNAfree] equals [DNAbound] (Riggs et al., 1970). Therefore when [DNAtotal] is much less than Kd the [protein]1/2 gives a good estimate of the Kd.

A typical titration experiment is shown in Figure 11. A graphical representation of the date is displayed in Figure 12. Following the example of Letovsky and Dynan (1989), the total shifted complexes were considered bound complexes and were combined in determining the Kd Quantitatively, the assay was essentially treated as a filter binding experiment (see Letovsky and Dynan, 1989). From these experiments the calculated apparent Kd of the Gcrlp DNA-binding domain with
it reonto sitwa 2 9 x I-A M.


























Figure 11. Determination of Gcrlp DNA-binding domain binding affinity. A single Gcrlp binding site (probe TPI1 in Table 3.) was radiolabelled and held at a concentration of 1.9x1011M. Increasing amounts of purified MBP-Gcrlp(6900-844) fusion-protein were incubated with the DNA probe. Samples were run into a 5 percent non-denaturing fel as described in Material and Methods. Numbers above the lanes represents the concentration of the DNA-binding activiy.











75






MBP-Gcrlp x M

en ~0 en '0 LA r4 11 0

a a a a 'to -.
0 0 0 0 r4 r4 ('4 (lfl ~0 i-I ('4 ('4 ('4

saC 90 0 *t a.










76





0.9 0.8 0.7 0.6

0.5

0.4 0.3 0.2

0.1 0.0.
0.0x100 5.0x10-10 1.0x10-9 1.5x10-9 2.0x10-9 2.5x10-9 3.0x10-9





Figure 12. Graphical representation of binding affinity.
The ratio of DNAbound/DNAtotal is plotted against increaseing concentration of MBP-Gcrlp(690-844). Quantitation of data from Figure 11. was achieved by the use of a phospolImager (Molecular Dynamics) The appearant Kd of the MBP-Gcrlp-DNA interaction corresponds to the concentration of active
protein when DNAbound/DNAtota1 is 0.5 (Riggs et al., 1970)










77

complexes were in the higher bands (data not shown) Specificity of the Gcrlp DNA-Binding Domain

The results of the binding affinity studies showed that Gcrip had a higher affinity for DNA than had been expected. Since nonspecific DNA-binding appeared to occur at less than 100-fold of the measured Kd, this suggested that the difficulty in demonstrating DNA-binding activity may have been due to a low specificity of binding. Specificity of binding is defined as the ratio of binding to a known binding site compared to binding to a random sequence of DNA (Affolter et al., 1990; Giese et al., 1991; Ferrari et al., 1992). Most assays for Gcrip binding did not use purified Gcrlp (Baker, personal communication) and therefore poly dI/dC DNA was used as an competitor of nonspecific binding. It was possible, that if Gcrlp had a low specificity, this could mask the binding of Gcrip. To test this I next set out to determine the specificity of binding of the Gcrlp DNAbinding domain to its recognition site.

To measure the specificity of Gcrip for its highaffinity binding site in UASTPII a series of competition experiments were performed. Competition experiments were performed with either specific DNA containing a known Gcrlpbinding site, or nonspecific DNA containing random DNA. The specific competitor, containing a Gcrip-binding site, was









78








1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17


































Figure 13. Competition experiment using specific competitor. DNA band-shift experiments were performed as described in Material and Methods. Radiolabeled DNA probe and purified MBP-Gerlp(690-844) were held constant and increasing amounts of specific competitor were added to mixtures.













0~
N r4

to
~r4I S-i
05.400 4JQ)a'4-J
*rlJJt.O*r4 4J RI-ti

0.
v-I
Or400

'-4 ~ti

(N -barn-H 4+-I ~r-4~4+.J H~4 r4
o ore o r-4 WCOWU) Q4W*H Q~ cOtoQ-' 02 o I r4 CW$444
0.

02
cDwreJ~)

0
020 0

N

U)
(0
r4~ v4~ 02 $0) Z W~QW In
04 $-i xcntoo
Cr-4.r4

O~.QVw

*rj.H(dCQ)
*r4W0 eq ~r~c~X
04 -H

r4
Oj-3 (I) U'4-4 CO
*1-1
_______ ..CWU
'U
4twI O~OU)
rA'U.Crlt C U) 'C


cpaj


4-I *HZCWW VZ4Qf~fl~3









80

1.00
1 .O 0


0.80 e'




0.60



.00.40



0.20


0O OO
0.00
0.01 0.1 1 10 100 1000 competitor (ng)


Figure 15. Graphical representation of competition experiments. Amount of competitor added (in nanograms) is depicted on horizontal axis. Specific competitor is represented by open circles; non-specific competitor is represented by closed circles Vertical axis is ratio of DNA shifted with competitor against no competitor.










81

experiment is shown in Figure 13. An increasing amount of unlabeled competitor DNA containing a known Gcrlp-binding site was incubated with fixed concentrations of radiolabeled DNA and fusion-protein. In Figure 14 an increasing amount of unlabelled DNA containing random sequence was used as competitor. A graphical representation of these experiments is presented in Figure 15. From these experiments the difference in the amount of competitor necessary for competition of one-half binding is approximately 33-fold. Bending of DNA in the Gcrlp-DNA Nucleoprotein Complex

Over the last few years a growing number of regulatory

proteins which bind to DNA have been shown to induce bending of DNA. X-ray crystallographic data clearly reveals that the physical structure of DNA is contorted when bound to some of the best characterized transcriptional factors For example, as determined by 3 angstrom resolution, the catabolite activator protein (CAP) induces a 90 degree bend in DNA by forming two 40 degree kinks around the dimeric protein (Schultz et al., 1991) An increasing body of literature has revealed that DNA bending plays an important role in transcriptional regulation, as well as control of replication (Williams et al., 1988; Doepsel and Khan, 1986; Zahn and Blattner, 1985; Mukherjee et al., 1985; Ryder et al., 1986; Snyder et al., 1986) and recombination (Better et al., 1982)

Protein-induced DNA bending can be detected easily by









82


1991). The technique, called comparative electrophoresis circular permutation assay, exploits the finding that when a protein is bound to DNA the shape of the DNA affects the mobility of the nucleoprotein complex to a large degree in nondenaturing gel electrophoresis (Wu and Crothers, 1984) The strategy is illustrated in Figure 16 By varying the position of the DNA-binding site along a DNA fragment of constant length, differing shapes of the nucleoprotein can form with corresponding degrees of electrophoretic mobilities This is usually achieved by cloning the DNAbinding sequence into the middle of a tandem dimer containing multiple restriction sites in a specially design vector. After cleaving with the different enzymes, fragments of equal size but with the binding site in different positions are prepared as probes for DNA band-shift assays

As mentioned earlier, known Gcrlp- and Rapl-binding sites are juxtaposed in the UAS of the glycolytic genes Raplp has been shown to bend its DNA recognition site in the UAS of the rpg-1 gene (Vignais and Sentenac, 1989). In vivo Edward Scott has shown that the Rapip-binding site is occupied in the absence of Gcrlp (Huie et al., 1992: Scott and Baker, 1993) Therefore, it was reasoned that the DNAbinding site recognized by Gcrip in vivo may be in a bent state. If this is the case, then the true substrate for Gcrlp-binding may in fact be bent DNA. Kahn and Crothers



















w
a) hi't m lIP F~lIOW~H V~
narto C (~1 CV 0 d -~~1 P- Ii ~k K ~1 ht~ Ij CD ri 0~
0 (~ C)
Cl) ~ ~O ct 0 ~
CD ~':rv- ~) :50 o>
CD (DO V)~Q :, fl Ct
0* ft t~ (~ K t C. (A
* 0 Q' F' ~ C) (~I
- tu) 1) Ci K
Li n ~c m :i C)
ft ~i :r to a c: .4 .0 H t5 0 t3 CD rD I' z
C
(In CD U' CYd~ 5 C) I 0.
-4 C1 F" H
F F 04 o~ a
* C) ~< F" CD &-0
At C' (YG .0+1 ~)
ii (0 ~< CD N C CD '1 C) ) 0 Oh '~ >1 C) k 3 C) C)
'2 C) (I) rt
I I**-~* [*~. U)
I 2 :..) Cl)
jt :s C) F''*. Cr { I (5 ~() (5 ft rrj :
(0 1) :, 0'
a) Q. < 0'
I If) CD C) (I) C) Ct) (A d) LI) 2 (1) Ci 0. U)
Ci C 0
K C) Qj (I Q ~
(-j tQ ~ 0'
~) C) *
0' K (5 in K 2
(I) (A rt Ct I 0'
(0 CD rr~} r' <2 0.
Ci C "(V CD 0' U) CD
H (V (1 113 00 (1 [~ H Ct) try
2 H C) Z t) ::, [..J.
0 '~> ~ (0 A
C) C) 2 ct Cr
(II (). H 13' U t)
(3 C) Cr (N CD Z 0 0' 2 r! F > It U' r-4
3 ; rt C) ~ I
(1) vO C) C) *- 0 H 0 H :3 0- I (V :7)
(A (V ~ U Oti 0)
0 F-~ 0 U' 0
(V Ft (B ~1 CD F~ Ij ;t ~ F ft -j H
0' m a .n C) (3
0 CD C ,t~ rt U, V*>
(v5Ctr1H.0
(OW CD

N H
r'r0
CD CD
a ri (A










84

is bent DNA, then it can be detected by the circular permutation assay.

I set out to test first if Raplp also bends DNA when bound to its binding-site in the UAS of a glycolytic gene. Raplp was translated in rabbit reticulocyte lysates and incubated with radiolabeled DNA from UASTpII (a schematic of the probe is shown in Figure 17.) under standard band-shift assay conditions Samples were then run on a 5% TE nondenaturing PAGE which had been pre-run for 1 5 hours. Results are shown in Figure 18 When the Raplp-binding site is located in the middle of the DNA fragment (restriction endonucleases EcoRV and NheI) the mobility is decreased relative to the fragments containing the Raplp-binding site at the ends of the fragments (restriction endonucleases EcoRI and BamHI) This result is consistent with Rapip-inducing DNA bending.

The purified MBP-Gcrlp(690-844) fusion protein was used to assay if the Gcrplp DNA-binding domain bends DNA in the nucleoprotein complex. Protein was incubated with radiolabeled DNA under standard DNA band-shift assay conditions. Samples were then run into a 10% nondenaturing

0.5 x TBE PAG which had been pre-run for 1 5 hours The results are shown in Figure 19 When the Gcrlp-binding site is located in the middle of the fragment (restriction endonucleases EcoRV and NheI) the mobility is decreased











LC)




EcoRI HindUI EcoRV Nhel BamiHI EcoRI HindU] EcoRV Nhel

I I I I I. rrnI I I I






4 I rrr






























Figure 17. Schematic representation of the probes used in the circular permutation assay. The box represents the DNA fragment cloned into vector pCY4. Hatched segement represents sequence corresponding to the UAS of TPII (see Table 3.). Digestion with the indicated enzymes produce
fragment of the same molecular weight with the UAS of TPI1 in varying positions. Arrow head
signifies the center of the probe.










86



EcoRI HindIII EcoRV Nhel BamH1
RAP :- +1 i +i I +1 I- +1 I +

























f






Figure 18. DNA is bent in the Raplp-DNA nucleoprotein complex. Circular permutation assay was performed as described in
Material and Methods. Schematic of the DNA probes used in this assay is shown in Figure 17. Two microliters of Rapip polypeptide translated in rabbit reliculocyte lysates were incubated with radiolabed probes and then run into a 5 per cent non-denaturing polyacrlamide gel. (+) represents addition of Raplp; (-), absence of Rapip. f, free probe. Enzymes listed above lanes indicates probes shown in Figure 17.











87



EcoR1 HindIII EcoRV Nhel BamH1
MBP-Gcrlp:I- + I +I I +I I- +












....... .... *.....ii i ii ii i ~ ~ i iiiii
::. . . .




















Figure 19. DNA is bent in the Gcrlp-DNA nucleoprotein complex. Circular permutation assay was performed as described in Material and Methods. Schematic of the DNA probes used in this assay is shown in Figure 17. One
lil:iIB"la:























microliters of purified MBP-Gcrlp(690-844) fusion-protein were incubated with radiolabed probes and then run into a 5 per cent non-denaturing polyacr1amide gel. (+) represents addition of MBP-Gerlp(690-844); (-) absence of MBP-Gerlp (690-844). f, free probe. Enzymes listed above lanes
n- ,nwntr n -r n *
- -r. 1.











88

that Gcrlp does indeed contort the DNA when bound, or that bent DNA is a more favorable target for Gcrlp (see Discussion)















DISCUSSION



For skepticism is this that an unknown quantity,
some x, can explain everything. But when everything
is explained through an x which is not explained, then in toto nothing is explained, nothing at all.
If this is not skepticism, then it is superstition.

Seren Kierkegaard (p.251)

Since Copernicus man has been rolling from the
center toward x.

Friedrick Nietzsche (p.8)



The enzymes of the glycolytic pathway constitute

approximately 30-60 percent of the soluble cellular proteins in Saccharomyces cerevisiae (Hess et al., 1969 and Fraenkel, 1982). The observation that the most abundant mRNA species in this organism code for glycolytic enzymes (Holland and Holland, 1978), and the demonstration of high-level expression of heterologous genes using glycolytic gene promoters (Bitter and Egan, 1984; 1988; Bitter et al., 1987) revealed that these promoters are among the most powerful known in any species The promoters of the glycolytic genes have been exploited commercially to manufacture recombinant human erythropoietin and recombinant hepatitis B viral antigens (Bitter and Egan, 1984; 1988; Bitter et al., 1987)

The upstream activating sequence, UAS, elements of many










90

common theme has emerged. A growing number of factors, including Reblp, Raplp, Abflp, Gcrlp, Gcr2p, and Galllp, appear to be the first proteins to assemble at these UAS elements, effect chromatin structure, and activate transcription (see Scott and Baker, 1993)

Of the DNA-binding proteins known to bind in the UAS

elements of glycolytic genes, the binding of Raplp and Gcrlp appears to be crucial for UAS activity. A role of Gcrlp in glycolytic gene expression was first shown when mutations were isolated in GCRI1 which resulted in a 20-fold reduction in the expression of most of the glycolytic enzymes genes (Clifton et al., 1978) Baker (1991) showed that full-length Gerip translated in vitro binds to the CTTCC sequence element in the UAS of TPII. Mutations in CTTCC sequence elements in the UASs of the genes TPI1 (Scott and Baker, 1993), TDH3 (Bitter et al., 1991), PGK (Chambers et al., 1988), ENOl, and PYK (Buchman et al., 1988) impaired the ability of the UAS elements to drive expression of reporter genes

RAP1 is an essential gene (Shore and Nasmyth, 1987) with pleiotropic functions Raplp is known to act as both an activator and repressor of transcription (Shore and Nasmyth, 1987), and it plays a role in the maintenance of telomeric structure (Buchman et al., 1988; Longtine et al., 1989; Lustig et al ., 1990; Conrad et al., 1990) A role for Rapip in the activation of glycolytic gene expression was first









91

the UAS elements of TPII (Scott et al., 1990), TDH3 (Bitter et al., 1991), PGKI (Chambers et al.,1989) ENO1 (Machida et al., 1989; Brindle et al., 1990), EN02 (Brindle et al., 1990), PYKI1 (McNeil et al., 1990), PDCI (Butler et al., 1990), and ADHI (Tornow and Santangelo, 1990) has shown that Raplp-binding is essential for full activity of these UASs. In each case mutation of the Raplp-binding site reduced expression more than ten-fold. It has additionally been shown that the Raplp-binding site from PGK alone is unable to confer UAS activity to a test promoter (Stanway et al., 1989). Thus, whereas both Gcrlp and RapIp DNA-binding sites are required for high-level glycolytic gene expression, neither site alone is sufficient for high-level expression.

The experiments in this study demonstrate conclusively

that Gcrlp is a DNA-binding protein, and that Gcrip interacts with the CTTCC sequence element directly. Additionally a Gcrlp consensus-sequence is approximated, and an initial characterization of the DNA-protein interaction is presented. Although this study focused mainly on Gcrlp, the results bear strongly on how Gcrlp and Rapip interact, and how they exert a synergistic effect at the UAS of the glycolytic genes. One feature appears to be common to all of the glycolytic gene promoters regulated by GCR1: the finding of adjacent Gcrlpand Raplp-DNA-binding sites (Huie et al., 1992). The implications of the adjacent binding sites will be discussed




Full Text
65
Identification of a Consensus Gcrlp DNA Binding Sequence
Before this study, demonstration of the DNA-binding
activity of Gcrlp had utilized only DNA carrying sequence
from the TPI1 UAS element. In an effort to define a
consensus Gcrlp-binding site, DNA was synthesized with the
putative Gcrlp-binding sites found in front of a number of
other genes encoding glycolytic enzymes, namely PGK1, EN01,
PYK1, and ADH1. These sequences were chosen for the
following reasons. There are three CTTCC sequence elements
important for expression of PGK1 (Chambers et al., 1988).
One of these elements was arbitrarily chosen for study. The
CTTCC elements from EN01 and PYK1 were chosen because there
is genetic evidence that shows they are important
determinants of their respective UAS elements (Buchman et
al., 1988). It was predicted that the CTTCC element found
adjacent to the RAPl-binding site in the ADH1 promoter would
likely bind Gcrlp; therefore it was tested it for its
ability to bind Gcrlp. In addition, the two putative Gcrlp-
binding sites in UAStpi (determined from the DNase I
footprinting experiments) were tested individually.
Oligonucleotides were synthesized which carried 25
nucleotides from the genes of interest with the CTTCC motif
under study located at the center of each oligonucleotide.
Table 3 shows the sequence of the oligonucleotides used as
probes in this study. Due to the relative positions of the
elements in UASPGX, the oligonucleotide carrying the PGK
sequence contained two CTTCC sequence elements. The CTTCC
sequence that is displayed in enlarged type from the PGK1


90
common theme has emerged. A growing number of factors,
including Reblp, Raplp, Abflp, Gcrlp, Gcr2p, and Galllp,
appear to be the first proteins to assemble at these UAS
elements, effect chromatin structure, and activate
transcription (see Scott and Baker, 1993) .
Of the DNA-binding proteins known to bind in the UAS
elements of glycolytic genes, the binding of Raplp and Gcrlp
appears to be crucial for UAS activity. A role of Gcrlp in
glycolytic gene expression was first shown when mutations
were isolated in GCR1 which resulted in a 20-fold reduction
in the expression of most of the glycolytic enzymes genes
(Clifton et al., 1978). Baker (1991) showed that full-length
Gcrlp translated in vitro binds to the CTTCC sequence element
in the UAS of TPI1. Mutations in CTTCC sequence elements in
the UASs of the genes TPI1 (Scott and Baker, 1993), TDH3
(Bitter et al., 1991), PGK (Chambers et al., 1988), ENOl, and
PYK (Buchman et al., 1988) impaired the ability of the UAS
elements to drive expression of reporter genes.
RAP1 is an essential gene (Shore and Nasmyth, 1987) with
pleiotropic functions. Raplp is known to act as both an
activator and repressor of transcription (Shore and Nasmyth,
1987), and it plays a role in the maintenance of telomeric
structure (Buchman et al. 1988; Longtine et al., 1989;
Lustig et al., 1990; Conrad et al., 1990). A role for Raplp
in the activation of glycolytic gene expression was first
suggested when Raplp DNA-binding sites were noted in the 5'
noncoding region of many glycolytic genes (Capieux et al.,
1989) Mutation-analyses of the Raplp DNA-binding sites in


97
bend (Williams et al., 1988 ; Eckdahl and Anderson, 1987;
Snyder et al., 1986).
These points are reviewed to underscore the fact that
proteins can recognize DNA without directly interacting with
the bases. This type of recognition has been referred to as
"indirect readout" (Otwinowski et al., 1988) or analogue
recognition (Drew and Travers, 1985; Travers, 1989). For
example, the trp repressor, as determined by X-ray
crystallography, binds to its site by contacting the
phosphate-backbone, without contacting any base-pair directly
(Otwinowski et al. 1988) It has been observed that the H-
T-H motif identified in the primary sequence of GCR1 most
closely resembles the H-T-H of the trp repressor (Baker,
personal communication). If Gcrlp binds in such a manner,
the primary DNA sequence of the consensus site may not
accurately reflect the true determinants of binding.
However, G residues are protected from methylation by DMS
(Huie et al., 1991) which suggests a very close association
between Gcrlp and the N7 position of those G residues.
The Binding Affinity of the Gcrlp DNA-Bindina Domain
Using a band shift assay with purified fusion-protein
containing the DNA-binding domain of Gcrlp it was here shown
in vitro that the Gcrlp DNA-binding domain binds with a
relatively high affinity (Kd = 2.9 x 10'10 M) to one of the
sites it recognizes in vivo. Objections may be raised to the
fact that these studies were performed with fusion-protein
and that only the DNA-binding domain and not the full-length
Gcrlp polypeptide was used. Unfortunately, the instability


38
Table 2. Plasmids
Plasmid
Comments
pHB66
(Baker, 1991)
GCRl structural gene cloned downstream of SP6 promoter
in plasmid pSP19
PSP56RT
(Chambers et al, 1987)
RAP1 structual gene cloned downstream of SP6 promoter
in plasmid pSP19
pMH2
Pstl-Sall fragment of GCRl structural gene cloned into
Pstl-Sall sites of pSP18
pMAL-GCRl(690-844)
malE-GCRl(690-844) fusion gene under tac promoter in
pMAL-c
pMAL-GCRl(783-844)
malE-GCRl(783-844) fusion gene under tac promoter in
pMAL-c
pCDl
malE-GCRl{1-844) fusion gene under tac promoter in
pMAL-c
pCD2
malE-GCRl(277-844) fusion gene under tac promoter in
pMAL-c
pCD3
malE-GCRl(422-844) fusion gene under tac promoter in
pMAL-c
pCD5
malE-GCRl(706-844) fusion gene under tac promoter in
pMAL-c
pUCT61
CTTCC sequence element from TPI1 cloned into Hindlll-
BamHI site of pUC18
pUCT62
CTTCC sequence element from PGK1 cloned into Hindlll-
BamHI site of pUC18
pUCT63
CTTCC sequence element from ADH1 cloned into Hindlll-
BamH.1 site of pUC18
pUCT64
CTTCC sequence element from ENOl cloned into HindIII-
BamHI site of pUC18
pUCT65
CTTCC sequence element from PYK1 cloned into Hindlll-
BamHI site of pUC18


17
yeast.' Buchner received the Nobel Prize in Chemistry ten
years later for his discovery, which is often cited as the
origin of biochemistry. In his autobiography Willstatter,
Buchner's teacher, said 'This will bring him fame, even
though he has no chemical talent.' (in Willstatter, 1949)
Studies of Pasteur's records revealed that he had
prepared cell-free yeast juices and attempted to carry out
fermentation with the juice before Buchner's discovery.
Unfortunately, he had used a strain of yeast which contained
a labile form of invertase which did not survive the
extraction procedure. He did not observe cell-free
fermentation (Kornberg, 1989).
Early work on the purification of enzymes then ensued.
Although this early work was criticized on the ground that it
was 'unphysiological to separate enzymes from cell,'
investigators persevered and the conception of enzymes
changed from a vague property in certain preparations to
definite chemical substances, and finally by the 1930s to
specific proteins (Fruton, 1972). The work of Harden,
Neuberg, Embden, Meyerhof, and Warburg showed that zymase was
a complex mixture of a dozen separate enzymes.
In the latter half of the twentieth century, after the
revolution in molecular biology, the genes coding for the
enzymes of the glycolytic pathway were cloned and the study
of transcriptional regulation of these gene ensued.


14
ferments from those that undergo fermentation?' Offering
this prize reflected not only the importance of this unsolved
problem, and its relation to commerce, but the fact that
beginning around the nineteenth century chemical explanations
for biological phenomena became a major preoccupation of
leading scientists (Fruton, 1972). A debate ensued as to
whether vitalistic or organismic notions, beyond materialism
and reductionism, had to be evoked to account for
fermentation. The prize was never awarded, and was withdrawn
in 1804 because of lack of funds.
In 1838, the same period that Schleiden and Schwann
(1839) were outlining the cell theory, Cagniard de Latour
published an article entitled Memoir on Vinous Fermentation
(translated in Williams and Steffens, 1978) in which he
argued that fermentation was the result of the 'vital
activity' of yeast 'cells.' Although Leeuwenhoek, in 1680,
described multiplying budding cells in the deposit formed in
beer fermentation, it is important to remember that during
this time, fermentation was still believed to be a chemical
(that is, not vitalistic or organismic) process, and that
yeast sediment was not believed to be cellular life, but an
albuminoid. Cagniard de Latour discovered that yeast
sediment was composed of cells and that fermentation was
associated with these cells being alive and dividing
(Cagniard-Latour 1838). He also immediately recognized the
importance of these new cellular organisms as a research
tool, as shown in the concluding remarks of his paper:
I have looked at the principal works which treat
vinous fermentation and in none of them have I seen


121
Garner, M.M. and Revzin, A. (1981). A gel electrophoresis
method for quantifying the binding of proteins to specific
DNA regions: applications to components of Escherichia colii
lactose operon regulatory system. Nucleic Acids Res. 9,
3037-3060.
Gasch, A., Hoffmann, A., Horikoshi, M. Roeder, R.G., and
Chua, N-H. (1990). Arabidopsis thaliana contains two genes
for TFIID. Nature 346, 390-394.
Gasser, S.M. and Laemmli, U.K. (1986). Cohabitation of
acaffold binding regions with upstream/enhancer elements of
three developmentally regulated genes. Cell 46, 521-530.
Gasser, S.M. and Laemmli, U.K. (1987). A glimpse at
chromosomal order. Trends Gens. 3, 16-22.
Gay-Lassie, J.L. (1810). Extrait d'un memoire surla
fermentation. Ann. Chim 76, 245-259.
Giese, K. Amsterdam, A., and Gosschedl, R. (1991). DNA-
binding properties of the HMG domain of the lymphoid-specific
transcriptional regulator LEF-1. Genes Dev. 5,2567-2578.
Gill, G. Pascal, E., Tseng, Z., and Tjian, R. (1994). A
glutamine-rich hydrophobic patch in transcription factor Spl
contacts the dTAFIIlO component of the Drosophila TFIID
complex and mediates transcriptional activation. Proc. Natl.
Acad. Sci. USA 91, 192-196.
Gill, G. and Ptashne, M. (1988). Negative effect of the
transcriptional activator GAL4. Nature 33 4, 721-724.
Goodman, S.D. and Nash, H.A. (1989). Functional replacement
of a protein-induced bend in a DNA recombination site. Nature
341, 251-254.
Goodrich, J. Hoey, T., Thut, C., Admon, A., and Tjian, R.
(1993). Drosophila TAFII40 interacts with both a VP16
activation domain and the basal transcription factor TFIIB.
Cell 75, 519-530.
Gould, S.J. (1977). Ontogeny and phylogeny (Cambridge,
Massachusetts: Harvard University Press).
Green, S. and Chambn, P. (1987). Oestradiol induction of a
glucocorticoid-responsive gene by a chimaeric receptor.
Nature 325, 75-78.
Greenblatt, J. (1991a). Roles of TFIID in transcriptional
initiation by RNA polymerase II. Cell 66, 1067-1070.
Greenblatt, J. (1991b). RNA polymerase-associated
transcription factors. Trends Gens. 16, 408-411.


Figure 3. Carboxy-terminal truncation polypeptides of Gcrlp.
Autoradiography of a 10% SDS-polyacrylamide gel
electrophoresis of polypeptides produced by in vitro
translation of the RNA templates (displayed in Figure 2)
using rabbit reticulocyte lysate (RRL). Polypeptides were
translated in vitro in the presence of 35S-methionine. The
numbers correspond to amino acids residues of Gcrlp.
Molecular weight standards, in kiloDaltons, are as follows:
myosin H-chain, 200,000; phosphorylase b, 97,000; bovine
serum albumen 68,000; ovalbumin, 43,000; carbonic anhydrase,
29,000; P-lactoglobulin, 18,000.


MwwMumwn
w w
voa>u>tOoto---*-oooo
oo en o
^ w h i tovDO>uvocn ej o
W OI X dxjoo-daw


82
1991) The technique, called comparative electrophoresis
circular permutation assay, exploits the finding that when a
protein is bound to DNA the shape of the DNA affects the
mobility of the nucleoprotein complex to a large degree in
nondenaturing gel electrophoresis (Wu and Crothers, 1984).
The strategy is illustrated in Figure 16. By varying the
position of the DNA-binding site along a DNA fragment of
constant length, differing shapes of the nucleoprotein can
form with corresponding degrees of electrophoretic
mobilities. This is usually achieved by cloning the DNA-
binding sequence into the middle of a tandem dimer containing
multiple restriction sites in a specially design vector.
After cleaving with the different enzymes, fragments of equal
size but with the binding site in different positions are
prepared as probes for DNA band-shift assays.
As mentioned earlier, known Gcrlp- and Rapl-binding
sites are juxtaposed in the UAS of the glycolytic genes.
Raplp has been shown to bend its DNA recognition site in the
UAS of the rpg-1 gene (Vignais and Sentenac, 1989) In vivo
Edward Scott has shown that the Raplp-binding site is
occupied in the absence of Gcrlp (Huie et al., 1992; Scott
and Baker, 1993) Therefore, it was reasoned that the DNA-
binding site recognized by Gcrlp in vivo may be in a bent
state. If this is the case, then the true substrate for
Gcrlp-binding may in fact be bent DNA. Kahn and Crothers
(1992) have shown that the affinity of CAP for bent DNA is
200-fold greater than for linear DNA. If the target of Gcrlp


m
CO
EcoRl HindQI
EcoRV Nhel
BamHl EcoRl HindlH
ft=EZZ2rH
EcoRV Nhel
I
r I///J
T
1 YJ/.A
1ZZZT
CZZEZZ
T
d ..LV/J J
Figure 17. Schematic representation of the probes used in the circular permutation assay. The
box represents the DNA fragment cloned into vector pCY4. Hatched segement represents sequence
corresponding to the UAS of TPI1 (see Table 3.). Digestion with the indicated enzymes produce
fragment of the same molecular weight with the UAS of TPI1 in varying positions. Arrow head
signifies the center of the probe.
BamHl


22
The RAPl product is expressed at levels greater than 4,000
molecules per cell (Buchman et al. 1988) and has pleiotropic
actions. It is capable of either activation or repression of
transcription depending on the context of its binding site
(Shore and Nasmyth, 1987). For example, Raplp acts as a
silencer at the mating-type locus by interacting with the
HMR(E) element (Shore et al., 1987). Raplp acts as an
activator of ribosomal protein genes in cells in exponential
growth by interacting with the rpg-box found upstream of the
ribosomal protein genes (reviewed in Warner, 1989). It is
also involved in stringent control of ribosomal protein
transcription under conditions of amino acid starvation
(Moehle and Hinnebusch, 1991). Raplp binds to telomeres
(Buchman et al., 1988; Longtine et al., 1989) and is involved
with their maintenance and length regulation (Lustig et al.,
1990; Conrad et al., 1990). Interestingly, Sussel and Shore
(1991) showed that two of these three functions can be
separated by genetic methods. They were able to distinguish
Silencing/Telomere function from activation function. A DNA-
binding domain (Henry et al., 1990) and activation and
derepression domains (Hardy et al., 1992) have been mapped
within the Raplp protein.
A role for Raplp in the activation of the glycolytic
genes has been demonstrated for a number of genes including
TPI1 (Scott et al., 1990), TDH3 (Bitter et al. 1991), PGK
(Chambers et al., 1989), ENOl (Machida et al., 1989; Brindle
et al., 1990), EN02 (Brindle et al., 1990), PYK (McNeil et
al., 1990), PDC1 (Butler et al., 1990), and ADH1 (Tornow and


Frag, alone
pMAL cRl
pMAL-Gcrlp(1-844)
pMAL-Gcrlp(277-844)
pMAL-Gcrlp(422-844)
pMAL-Gcrlp(690-844)
pMAL-Gcrlp(706-844)
pMAL-Gcrlp(783-844)


Ill
since DNase I recognizes a vary narrow range (Drew and
Travers, 1985; Suck and Oefner, 1986; Lahm and Suck, 1991).
This is consistent with the idea that Raplp-induced bending
of DNA affects nearby DNA binding sites for other proteins.
Evidence also exist, however, for a direct Raplp-Gcrlp
interaction. Tornow et al. (1993) showed that the GCR1 gene
product could be co-immunoprecipitated with Raplp when the
two proteins were epitope tagged. These results suggest a
protein-protein interaction occurs between Raplp and Gcrlp.
The role of the DNA-binding domain in the function of
Gcrlp was recently called into question. Tornow et al.
(1993) interpreted experiments from their laboratory to
suggest that the DNA-binding domain of Gcrlp may be
dispensable for transcriptional activation activity. This
was intriguing because previous experiments had suggested
that the DNA-binding domain of the fushi tarazu polypeptide
(a homeodomain) could be deleted and that the truncated
protein could still alter gene expression, presumably without
binding directly to DNA (Fitzpatrick et al., 1992).
Tornow et al. complemented a gcrl mutant with plasmids
containing 3'-deletions of the GCR1 structural gene and noted
the appearance of large colonies after ten days of growth on
minimal medium containing glucose. However, these authors did
not show that the ability to complement the gcrl growth
defect was linked to the plasmids encoding the truncated
forms of Gcrlp. This control is essential because second-
site pseudorevertants of the gcrl mutant can appear as large
colonies. Drazinic et al. (1994), in an attempt to verify


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E2NH7747P_D1HXYY INGEST_TIME 2015-03-25T19:19:26Z PACKAGE AA00029764_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


CO
in
MBP-Gcrlp
9
1-844
277-844
422-844
690-844
706-844
783-844
Figure 5. malE::GCRl gene fusions products. A schematic representation of the Gcrlp
polypeptides used in the amino-terminal deletion studies. The stippled lines indicate
maltose-binding protein moiety carried in the fusion proteins. Numbers indicate amino acid
residues of Gcrlp conatained in the fusion proteins


9
(Mitchell and Tjian, 1989). Besides the glutamine content
there is no other obvious sequence homologies between these
interchangeable domains. Finally, a third type of activation
domain, mapped in CTF/NF1, is proline-rich (Mermod et al.,
1989) .
Various models have been proposed for how activation
domains work. The models emphasize contact between the
activation domain and TFIID or RNA polymerase II. For
example, the negative noodle activation domain has been
proposed (Sigler, 1988; Allison et al., 1988) to interact
with the carboxy terminal domain (CTD) repeat of the large
subunit of RNA polymerase II. A general feature of the large
subunit of eukaryotic RNA polymerase II is the multiple
repeat of the Tyr-Ser-Pro-Thr-Ser-Pro-Ser heptapeptide in the
carboxyl terminus. In yeast this is repeated 26 times
(Allison et al., 1985); in mouse, 52 times (Corden et al.,
1985). Except for proline, which is believed to stabilize a
unique secondary structure, nearly all the amino acid side
chains in the heptapeptide are hydrophilic. This domain is
believed to be fully exposed to solvent projecting out of the
remaining globular folded polypeptide. According to the acid
blob/negative noodle model, interactions between the
carboxylates of the noodle and the hydroxyl groups of the CTD
and other promoter binding proteins facilitate trans
criptional initiation, possibly by aiding in binding of RNA
polymerase II to DNA (Suzuki, 1990). TFIID interacts with
the CTD repeats implying that its presence is necessary in
this model (Sharp, 1992).


24
transcriptional activation and initiation of DNA replication.
Binding sites for Raplp and Abflp are both found at HMR(E).
Abflp binds to the promoters of the ribosomal-protein genes
encoding L2A and L2B (Seta et al.( 1990). Abflp binds to
the B3 element (Marahrens and Stillman, 1992) of the
autonomously replicating sequences (ARS) and is important for
initiation of replication. Replacement of the Abflp-binding
site with a Raplp-binding site can restore high-level ARS
activity (Marahrens and Stillman, 1992). The binding sites
for these factors can also be exchanged in a gene transcribed
br RNA polymerase II: an Abf lp-binding site can replace a
Raplp-binding site in the ILV1 gene (Remade and Holmberg,
1992). A functional Abf lp-binding site is found in the UAS of
PGK and PYK1 (Chambers et al., 1990).
The similarity of function of Raplp and Abflp is matched
by an homology of 4 0% conserved amino acid over 60% of the
primary sequence between the two proteins (Diffley and
Stillman, 1989). This has lead to a model of action of these
two proteins (Diffley and Stillman, 1989). The repressed
state of HMR involves the formation of chromatin structure
similar to that of heterochromatin (Nasmyth, 1982).
Heterochromatin is located in the periphery of the nucleus
associated with the nuclear lamina. The SIR4 gene is also
required for silencing (Rine and Herskowitz,1987). The
presence of a lamina domain in the Sir4p protein suggests
that Raplp and Abflp may play a role in altering chromatin
structure by interacting with the nuclear scaffold (Marshall
et al, 1987; Diffley and Stillman, 1989). Indeed Raplp has


80
Figure 15. Graphical representation of competition
experiments. Amount of competitor added (in nanograms) is
depicted on horizontal axis. Specific competitor is
represented by open circles; non-specific competitor is
represented by closed circles. Vertical axis is ratio of DNA
shifted with competitor against no competitor.


11
1992) and RNA polymerase III TAFs (Buratowski and Zhou, 1992;
Kassavetis et al., 1992) have been isolated. These,
apparently species specific, proteins are believed to be part
of the heterogenous TFIID complex.
By deletion analysis some of these adaptor domains have
already been mapped. For example, the acidic activator
Gal4p-VP16 is able to activate transcription in a
heat-treated TFIID deficient HeLa nuclear extract when
supplemented with recombinant human TBP. However, a
amino-terminally truncated molecule of human TBP cannot
support the activation in heat treated HeLa nuclear extract
(Peterson et al., 1990). Also, by genetic methods several
putative adaptors have been isolated in yeast (Berger et al.,
1992).
History of Fermentation in Yeast
Recent studies on the regulation of the glycolytic
enzyme genes in yeast suggest candidates for activators and
adaptors. I will first review the history of the study of
fermentation in yeast since it is intimately associated with
the history of modern biology. Then I will outline current
factors imputed in transcriptional regulation of the
glycolytic genes. In the discussion I will present a model
based on current knowledge.
The brewing of beer is the largest biotechnological
industry in the world producing commercially each year 1011
liters of beer (Oliver, 1991). The earliest known remains of
human writing include descriptions of alcohol production by
fermentation. Clay tablet found from the earliest


115
Berger, S.L., Cress, W.D., Cress, A., Triezenberg, S.J., and
Guarente, L. (1990). Selective inhibition of activated but
not basal transcription by the acidic activation domain of
VP16: evidence for transcriptional adaptors. Cell 61,
1199-1208.
Berger, S., Pina, B., Silverman, G. Marcus, G. Agapite, J.,
Regier, J. Treizenberg, S., and Guarente, L. (1992). Genetic
isolation of ADA2: a potential transcriptional adaptor
required for function of certain acidic activation domains.
Cell 70, 251-266.
Biednenkapp, H., Borgmeyer, U. Sippel, A.E., and Klempnauer,
K-H. (1988). Viral myb oncogene encodes a sequence-specific
DNA-binding activity. Nature 335, 835-837.
Bitter, G.A., Chang, K.K.H., and Egan, K.M. (1991). A multi-
component upstream activation sequence of the Saccharomyces
cerevisiae glyceraldehyde-3-phosphate dehydrogenase gene
promoter. Mol. Gen. Genet. 231, 22-32.
Bitter, G.A. and Egan, K. (1984). Expression of heterologous
genes in Saccharomyces cerevisiae from vectors utilizing the
glyceraldehyde-3-phosphate dehydrogenase gene promoter. Gene
32, 263-274.
Bitter, G.A. and Egan, K. (1988). Expression of heterologous
genes in S. cerevisiae from vectors utilizing the
glyceraldehyde-3-phosphate dehydrogenase gene promoter. Gene
69,193-207.
Bitter, G.A., Egan, K.M., Koski, R.A., Jones, M.O., Elliott,
S.G., and Giffin J.C. (1987). Expression and secretion
vectors for yeast. Methods Enzymol 153, 516-544.
Bonnefoy, E. and Rouviere-Yaniv, J. (1991). HU and IHF, two
homologous histone-like proteins of Escherichia coli, form
different protein-DNA complexes with short DNA fragments.
EMBO J. 10, 687-696.
Braceo, L. Kotlarz, D. Kolb, A., Diekmann, S., and Buc, H.
(1989). Synthetic curved DNA sequences can act as
transcriptional activators in Escherichia coli. EMBO J. 8,
4289-4296.
Bradford, M.M. (1976). A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal. Biochem. 72, 248-254.
Brandi, C.J. and Struhl, K. (1990). A nucleosome-positioning
sequence is required for GCN4 to activate transcription in
the absence of a TATA element. Mol. Cell. Biol. 10,
4256-4265.


132
Sanger, F. Nicklen, S., and Coulson, A. (1977). DNA
sequencing with chain-terminating inhibitors. Proc. Natl.
Acad. Sci. USA 74, 5463-5467.
Santangelo, G.M. and Tornow, J. (1990). Efficient
transcription of the glycolytic gene ADHl and three
translational component genes requires the GCRl product,
which can act through TUF/GRF/RAP binding sites. Mol. Cell.
Biol. 10, 859-862.
Sauer, R., Jordan, S., and Pabo, C. (1990). Lambda repressor:
a model system for understanding protein-DNA interactions.
Adv. Protein Chem. 40, 1-61.
Sawadogo, M. (1990). RNA polymerase B (II) and general
transcription factors. Annu. Rev. Biochem. 59, 711-754.
Sawadogo, M. and Roeder, R.B. (1985). Interaction of a
gene-specific transcription factor with the Adenovirus major
late promoter upstream of the TATA box region. Cell 43,
165-175.
Schauer, M. Chalepakis, G., Willmann, T. and Beato, M.
(1989). Binding of hormone accelaerates the kinetics of
glucocorticoid and progesteron receptor binding to DNA.
Schmidt, M.C., Kao, C.C., Pei, R. and Berk, A.J. (1989).
Yeast TATA-box transcription factor gene. Poc. Natl. Acad,
sci. USA 86, 7785-7789.
Schmidt, M.C., Zhou, Q. and Berk, A.J. (1989). Spl activates
transcription without enhancing DNA-binding activity of the
TATA box factor. Mol. Cell. Biol. 9, 3299-3307.
Schrodinger, E. (1959). Mind and Matter. (Cambridge:
Cambridge University Press).
Schroth, G.P., Cook, G.R., Bradbury, E.M., and Gottesfeld,
J.M. (1989). Transcription factor IIIA induced bending of the
Xenopus somatic 5S gene promoter. Nature 340, 487-488.
Schultz, M.C., Reeder, R., and Hahn, S. (1992). Variants of
the TATA-binding protein can distinguih subsets of RNA
plymerase I, II, and III promoters. Cell 69, 697-702.
Schultz, S.C., Shields, G.C., and Steitz, T.A. (1991).
Crystal structure of a CAP-DNA complex: the DNA is bent by
90. Science 253, 1001-1007.
Schwann, T. (1838). Vorlaufige Milteilung, betreffend Versuch
uber die Weingarung und Faulnis. Ann. Phys. 41, 184-193.
Schwann, T. (1839). Mikroskopische Untersuchungen. (Berlin
Sander) .


I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosphy.
^
Henry V. Baker, Chair
Associate Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of
Philosphy.
Richard W. Moyer/
Professor of Immji
mblogy and
Medical MicrobiV
)l/ogy
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of/~'Doctr of Philosphy.
2 ..
Thomas P. Yang
Associate Professo
and Molecular Biol
iochemistry
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree
hilosphy,
Daniel Driscoll
Assistant Professor of Immunology
and Medical Microbiology


RESULTS
The world is a construct of our sensations, percep
tions, memories. It is convenient to regard it as
existing objectively on its own. But it certainly
does not become manifest by its mere existence.
Erwin Schrodinger (p.l)
Previous experiments had suggested that the product of
GCRl interacts directly with the CTTCC sequence element
(Baker, 1991). In those experiments, RNA was translated in
vitro to make the Gcrlp protein in rabbit reticulocyte
lysates. The lysate was used in band shift assays with DNA
fragments containing the CTTCC sequence element.
Additionally, when anti-Gcrlp antibody was included in the
reaction mixture a supershift was observed (Baker, 1991).
These experiments strongly supported the view that Gcrlp is
DNA-binding protein; however, alternative models could not
totally be excluded. For example, since CTTCC sequence
elements had been described in the promoters of higher
eukaroytes it was possible that the Gcrlp could associated
with and modify another factor in the lysate stimulating a
protein complex which included Gcrlp to bind to UASTPi DNA.
For example, the product of the retinoblastoma gene displays
DNA-binding activity when complexed to the factor EF2
(Chittenden et al., 1993; Ray et al., 1992; Ouellette et al.
1992). Alternatively, it could be argued that the GCRl gene
product allosterically modified another protein unleashing


56
a
a
a
a
a
pi
Pi
Pi
pi
Pi
Pi
DC
PC
Pi
Pi
, ,
O
1
cn
0)
(T\
ro
oq
c
a
00
UD
LD
CN
o
cx;
|
1
1
1
1
ii
Pi
x1
\1
*1
\1
rH
' '
'
a
'

Q
&
a
a
tn
Ph
X1
rH
tt
*i
u
U
u
Sh
u
u
o
u
u
V
o
u
tu
s
O
o

o
o
U
Figure 4. DNA-binding activity of Gcrlp carboxy-terminal deletion
polypeptides. A typical DNA band-shift assay using the in vitro
synthesized Gcrlp carboxy-terminal deletion series is shown. The
numbers in parentheses denote the amino acid residues of Gcrlp
expressed in the rabbit reticulocyte lysates (RRL). Five
microliters of each rabbit reticulocyte lysate was used in the
assays.


110
is six orders of magnitude. In addition to this high degree
of specificity, Raplp is expressed in high abundance in the
cell. Its level has been estimated to be 4,000 molecules/
genome (Buchman et al., 1988). Since Raplp has an extremely
high specificity and is expressed at high levels, it has been
argued that all Raplp-binding sites should be occupied in
actively growing cells (Vignais et al 1990) Thus, Raplp
should bind its site in the absence of Gcrlp.
From in vivo footprint analysis it is known that the
Raplp-binding site in the U AS Tpii is protected in the absence
of the GCR1 gene product (Huie et al 1992; Scott, 1992;
Scott and Baker, 1993) A safe conclusion from this data is
that the GCR1 product is not necessary for Raplp binding at
its site in UAS tp 11 iti vivo. On the other hand, using
temperature sensitive rapl mutants, Jeff Smerage (Baker,
personal communication) has preliminary evidence from in vivo
footprinting experiments that Raplp binding is required for
Gcrlp binding at UAStpii- This implies that Gcrlp binds to
its DNA-binding site only in the presence of Raplp bound at
an adjacent site.
All these observations are consistent with the view that
the role of Raplp is to facilitate the binding of Gcrlp to
its binding site, and that Gcrlp then provides an activation
domain. What might be the possible mechanism whereby Raplp
carries out this facilitation? The observation of "skewing"
of protection of the RAP1 site seen in in vitro DNase I
footprinting experiments implies that a structural change
near the Raplp-binding site is occurring in the minor groove


30
saved by storage at -70 C. A typical protein concentrations
of such a prep was 0.35 mg/ml.
Nucleic Acid Manipulations
Standard techniques used throughout the course of this
study are described in common reference manuals (Ausubel et
al., 1989; Sambrook et al., 1989). Deviations from standard
techniques are noted and described.
DNA Precipitation
Prior to ethanol precipitation ammonium acetate was
added to the DNA solutions to a final concentration or 2.5 M.
This was accomplished by adding an equal volume of 5 M
ammonium acetate. The resulting volume was noted and then
2.5 volumes of absolute ethanol was added, mixed, and placed
at -70 C for 10 min. Following which time the samples were
centrifuged in a microcentrifuge at 12,000 x g at room
temperature for 20 to 30 min. After centrifugation the
supernatant was discarded and the pellet washed with 1 ml 70%
ethanol. The resulting mixture was then centrifuged for 5
min at 12,000 x g in a microcentifuge at room temperature.
Again the supernatant was discarded and then the pellet was
dried in vacuum with a Speed Vac Concentrator (Savant
Instruments Inc.) .
In situations were DNA was to be treated with
polynucleotide kinase, ammonium acetate was avoided. In
these cases DNA was precipitated by adjusting solution to 0.3
M sodium acetate (pH 5.5). Typically 1/10 volume of 3 M
sodium acetate was added followed by addition of 2.5 volumes


102
to bend DNA upon binding (Giese et al., 1992; Ferrari et al.,
1992) .
The low specificity, seen in many transcriptional
activators, can be contrasted with the properties observed in
some transcriptional repressors. The X repressor binds to
its specific operator sequences with affinities as high as
10-13 M and binds to specific DNA with a 500,000-fold higher
affinity than to nonspecific DNA (Sauer et al. 1990; Frankel
and Kim, 1991). Since it is specificity that is more
important for assembling transcriptional complexes, a number
of implications can be drawn from questions that arise from
the finding of transcriptional activators which have a
relatively high affinity for DNA and yet a low specificity.
An immediate question arises as to how proteins with a
low specificity find their DNA-binding sites in their
genomes. This is a serious question which cannot be
dismissed with a flippant reference to skepticism. Possible
models are testable and may provide clues as to how other
proteins acting at UASs, which do not posses activation
domains, exert their effects. It is worth reviewing at this
point possible mechanism by which proteins with low
specificity can find their binding sites in vivo.
One possible mechanism is simply by high-level
expression of the protein. This has been proposed to be the
manner in which integration host factor (IHF) finds its site
(Giese, 1991). Although IHF is a sequence-specific DNA-
binding protein (Craig and Nash, 1984), it also binds to
nonspecific DNA (Bonnefoy and Rouviere-Yaniv, 1991) IHF is


46
Titration of DNA-Bindina Activity
DNA-binding activity of MBP-Gcrlp(690-844) was
determined by band shift assay using the approach of Riggs et
al. (1970) and Chadwick et al. (1970). A constant amount of
purified MBP-Gcrlp(690-844) fusion protein was titrated with
increasing amounts of radiolabeled DNA containing a Gcrlp-
binding site. Free and bound complexes were then separated
by a standard band shift assay. The amount of DNA used was
accurately determined by spectrophotometry. The amount of
DNA that was shifted was determined by using phospholmager
analysis (Molecular Dynamics). Thus, the amount of DNA in
the shifted complex was determined by comparison to a
standard curve of known concentrations of DNA. From this
analysis the amount of DNA retained at plateau is a measure
of total concentration of active protein in terms of DNA
concentration.
Calculation of Equilibrium Binding Constant
DNA-binding affinity was determined by band shift assay
using the analysis of Riggs et al. (197 0) and Chadwick et al.
(1970). A known amount of DNA was radiolabeled and allowed
to bind to varying concentrations of active MBP-Gcrlp. Free
DNA was separated from nucleoprotein complexes by native gel
electrophoresis. Gels were dried to Whatman paper and then
counts were determined by use of a Phospholmager (Molecular
Dynamics). By holding DNA concentrations below the estimated
Kd (determined from pilot experiments), the apparent Kd could
be determined by the amount of protein added when the counts
of free DNA equalled the counts in the nucleoprotein complex.


107
be represented as follows:
1. DNAt <-> DNAbent k;
2 DNAbent + Gcrlp <-> Gcrlp-DNA k2
3. kt = k: k2
If DNAoenc is the true binding substrate (i.e. has a higher
affinity) for Gcrlp then the equilibrium constant of equation
1. will determine the effective concentration of the DNA-
ligand for Gcrlp. Factors that enhance the formation of
DNAber,-. would then enhance the formation of the Gcrlp-DNA
complex. This concept of DNA bending facilitating binding of
protein has been compared (Kahn and Crothers, 1992) to the
improved binding of unwinding ligands to supercoiled DNA
(Davidson, 1972).
A protein which may enhance reaction 1. presented above
is Raplp. Raplp has been shown to bend DNA upon binding to
the rpg box (Raplp-binding site) from the UAS of rpg-1
(Vignais and Sentenac, 1989) Here I have shown that Raplp
also bends DNA when bound to its recognition site in the UAS
of TPI1. If Gcrlp binds with greater affinity to bent DNA,
then Raplp ability to bend DNA in and around the Gcrlp
binding site may enhance the binding of Gcrlp. This
mechanism for Raplp was proposed by the authors who
originally showed that Raplp bends DNA to account for its
functional versatility (Vignais and Sentenac, 1989). These
authors also demonstrated that proteolytic fragments of
Raplp, which retained only the DNA-binding domain, were
unable to bend DNA. It is possible that deletions of Raplp
which cannot bend DNA could effect Gcrlp binding if bending


76
Figure 12. Graphical representation of binding affinity.
The ratio of DNAbound/DNAtotai is plotted against increaseing
concentration of MBP-Gcrlp(690-844) Quantitation of data
from Figure 11. was achieved by the use of a phospolmager
(Molecular Dynamics). The appearant Kd of the MBP-Gcrlp-DNA
interaction corresponds to the concentration of active
protein when DNAbound/DNAtota! is 0.5 (Riggs et al., 1970).


137
Willett, C., Gelfman, C., and Holland, M. (1993). A complex
regulatory element from the yeast gene EN02 modulates GCR1-
dependent transciptional activation. Mol. Cell. Biol. 13,
2623-2633 .
Williams, J.S., Eckdahl, T.T., and Anderson, J.N. (1988).
Bent DNA functions as a replication enhancer in Saccharomyces
cerevisiae. Mol. Cell. Biol. 8, 2763-2768.
Williams, L.P. and Steffens, H.J. (1978). The History of
Science in Western Civilization. Washington D.C.: University
Press of America.
Willis, T. (1659). Dr. Willis' Practic of Physick (translated
by S. Pordage). (London: Dring, Harper and Leigh).
Wills, C. (1990). Regulation of sugar and ethanol metabolism
in Saccharomyces cerevisiae. Crit. Rev. Biochem. Mol. Biol.
25, 245-280.
Wobbe, C.R. and Struhl, K. (1990). Yeast and human
TATA-binding proteins have nearly identical DNA sequence
requirements for transcription in vitro. Mol. Cell. Biol. 10,
3859-3867.
Wong, J.M., Liu, F. and Bateman, E. (1992). Cloning and
expression of the Acanthamoeba castellana gene encoding
trancription factor TFIID. Gene 117, 91-97.
Workman, J.L. and Buchman, A.R. (1993). Multiple functions of
nucleosomes and regulatory factors in transcription. Trens.
Biochem. Sci. 18, 90-95.
Wu, H-M. and Crothers, D.M. (1984). The locus of
sequence-directed and protein-induced DNA bending. Nature
308, 509-513.
Yokomori, K. Chen, J., Admon, A., Zhou, S., and Tjian, R.
(1993). Molecular cloning and characterization of dTAFH30
alpha and dTAFII30 beta: two small subunits of Drosophila
TFIID. Genes Dev. 7, 2587-2597.
Zhang, X., Zhou, Y. Ebright, Y., and Ebright, R. (1992).
Catabolite gene activator protein (CAP) is not an "acidic
activating region' transcription activator protein.
Negatively charged amino aids of CAP that are solvent-
accessible in the CAP-DNA complex play no role in
transcription activation at the lac promoter. J. Biol. Chem.
267, 8136-8139.
Zinkel, S.S. and Crothers, D.M. (1991). Catabolite activator
protein-induced DNA bending in transcription initiation. J.
Mol. Biol. 219, 201-215.


119
Desplan, C., Theis, J. and O'Farrell, P.H. (1985). The
Drosophila development gene, engrailed, encodes a sequence-
specific DNA binding activity. Science 318, 630-635.
Devlin, C., Tice-Baldwin, K., Shore, D., and Arndt, K.T.
(1991). RAP1 is required for BAS1/BAS2- and GCN4-dependent
transcription of the yeast HIS4 gene. Mol. Cell. Biol. 11,
3642-3651.
Diffley, J.F.X. and Stillman, B. (1989). Similarity between
the transcriptional silencer binding proteins ABF1 and RAPl.
Science 246, 1034-1038.
Drazinic, C.M., Lopez, M.C., and Baker H.V. (1994). Native
Gcrlp requires a functional CT-box to mediate GCRl-dependent
gene expression. Submitted.
Drew, H.R. and Travers, A.A. (1985). Structural junctions in
DNA: the influence of flanking sequence on nuclease
digestion specificities. Nucleic Acids Res. 13, 4445-4467.
Dynan, W.S. (1989). Modularity in promoters and enhancers.
Cell 58, 1-4.
Dynlacht, B.D., Hoey, T. and Tjian, R. (1991). Isolation of
coactivators associated with the TATA-binding protein that
mediate transcriptional activation. Cell 66, 563-576.
Eckdahl, T.T. and Anderson, J.N. (1990). Conserved DNA
structures in origins or replication. Nucleic Acids Res. 18,
1609-1612 .
Eisenmann, D.M., Dollard, C., and Winston, F. (1989). SPT15,
the gene encoding the yeast TATA binding factor TFIID, is
required for normal transcription initiation in vivo. Cell
58, 1183-1191.
Fassler, J.S. and Winston, F. (1989). The Saccharomyces
cerevisiae SPT13/GALll gene has both positive and negative
regulatory roles in transcription. Mol. Cell. Biol. 9,
5602-5609 .
Fedor, M.J., Le, N.F., and Kornberg, R.D. (1988).
Statistical positioning of nucleosomes by specific
protein-binding to an upstream activating sequence in yeast.
J. Mol. Biol. 204, 109-127.
Felsenfeld, G. (1992). Chromatin as an essential part of the
transcriptional mechanism. Nature 355, 219-224.
Ferrari, S., Harley, V.R., Pontiggia, A., Goodfellow, P.N.,
Lovell-Badge, R. and Bianchi, M. (1992). SRY, like HMG1,
recognizes sharp angles in DNA. EMBO J. 11, 4497-4506.


CHARACTERIZATION OF THE DNA-BINDING ACTIVITY OF THE
SACCHAROMYCES CEREVISIAE TRANSCRIPTIONAL ACTIVATOR GCR1P
V\A^l
BY
MICHAEL ANDREW HUIE
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1994

ACKNOWLEDGMENTS
I would first like to thank my parents for their
encouragement and support throughout the course of my
training. I am especially indebted to my mentor, Henry V.
Baker, for his patience, and for providing me with an ex
cellent training and a stimulating work environment. The
members of my committee, Daniel J. Driscoll, Richard W.
Moyer, and Thomas P. Yang, are thanked for their invaluable
insights. John Olson, Michael Brooks, Michael Waters, Jeff
Smerage, Lucia Eisner, Carolyn Drazinic, Ed Scott, Clive
Stanway, Jeff Harris, Mary-Catherine Bowman, Jim Anderson,
Rob Nicholls, Gerry Shaw, Maurice Swanson, Jace Dienhart,
William Hausworth, Al Lewin, Paul Gulig, Cecila Lopez, Didi
Gravenstein, and Andy Wilcox are thanked for uncountable
hours of discussion related to this work and for technical
assistance and advice. This work is dedicated to Matt
Memolo, who died during the course of the writing. He is
thanked for his inspiring conversations and for his example
of how to live life.

TABLE OF CONTENTS
page,
ACKNOWLEDGMENTS ii
LIST OF TABLES v
LIST OF FIGURES vi
ABSTRACT viii
INTRODUCTION 1
Basal Transcriptional Machinery and TFIID 4
Activators, Coactivators, and Adaptors 7
History of Fermentation in Yeast 11
Coordinate Regulation of Glycolysis in
Saccharomyces cerevisiae 18
Gcrlp 18
Gcr2p 20
Raplp 21
Abflp 23
Reblp 25
Gcrlp as a DNA-Binding Protein 26
MATERIALS AND METHODS 27
Bacterial Strains 27
Media and Growth Conditions 27
Transformations 27
Induction of Mal::GCRl Gene Fusions 27
Purification of MBP-Gcrlp Fusion Proteins 28
Nucleic Acid Manipulations 30
DNA Precipitation 30
Purification of DNA Fragments and
Oligonucleotides 31
Radio-Labeling of DNA Fragments 31
Polyacrylamide Gel Electrophoresis 34
Determination of DNA Concentrations 35
Generation of Double Strand DNA
Oligonucleotides 35
DNA Sequencing 36
Plasmid Construction 37
In Vitro Transcription 42
In Vitro Translation 43
In Vitro DNase I Protection Assays 44
DNA Band-Shift Assays 45
iii

Titration of DNA-Binding Activity 46
Calculation of Equilibrium Binding Constant 46
RESULTS 47
Gcrlp Expressed in E. coli or Rabbit Reticulocyte
Lysate Binds to DNA 48
The DNA-Binding Domain of Gcrlp Resides within
the Carboxy-Terminal 154 Amino Acid
Residues 52
DNasel Footprint Analysis 57
Identification of a Consensus Gcrlp Binding
Sequence 65
The Gcrlp-DNA Nucleoprotein Complex 68
The DNA-binding affinity of the
GCR1 binding domain 68
Specificity of the Gcrlp DNA-Binding
Domain 77
Bending of DNA in the Gcrlp-DNA Nucleoprotein
complex 81
DISCUSSION 89
The DNA-Binding Domain of Gcrlp 92
A DNA Consensus Sequence for Gcrlp 95
The Binding Affinity of the Gcrlp
DNA-Binding Domain 97
The Bending of DNA by Raplp and Gcrlp 106
The Significance of Adjacent Raplp and Gcrlp
Binding Sites in the UAS of the Glycolytic
Genes 108
Conclusions 113
REFERENCES 115
BIOGRAPHICAL SKETCH 139
IV

LIST OF TABLES
Table
1. Oligonucleotides 32
2. Plasmids 38
3. Oligonucleotides containing CTTCC sequences 40
4. DNA-Binding Affinity of Select
Transcriptional Activators 99
v

LIST OF FIGURES
Figure page
1. Comparison of DNA-binding activity of Gcrl
and hybrid MBP-Gcrlp fusion protein 51
2. Templets used to generate carboxy-terminal
deletions of Gcrlp 53
3. Carboxy-terminal truncation polypeptides of
Gcrlp 55
4 DNA-binding activity of Gcrlp carboxy-
terminal deletion polypeptides 56
5. malE::GCRl gene fusions 58
6. DNA-binding activity of MBP-Gcrlp hybrid
proteins 60
7. Summary of data mapping the Gcrlp DNA-binding
domain 61
8. Gcrlp DNA-binding domain protects the CTTCC
sequence motif in UASTPi; 64
9. Gcrlp DNA-binding domain binds to CTTCC
sequence elements found in front of other
glycolytic genes 67
10. Titration of Gcrlp DNA-binding activity 72
11. Determination of Gcrlp DNA-binding domain binding
affinity 75
12. Graphical representation of binding affinity ... 76
13. Competition experiment using specific
competitor 78
14. Competition experiment using non-specific
competitor 79
15. Graphical representation of competition
experiments 80
16. Circular permutation assay 83
v 1

17. Schematic of probe used in circular
permutation assay 85
18. DNA is bent in the Raplp-DNA nucleoprotein
complex 86
19. DNA is bent in the Gcrlp-DNA nucleoprotein
complex 87
20. SAPS analysis of Gcrlp 94
vii

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF THE DNA-BINDING ACTIVITY OF THE
SACCHAROMYCES CEREVISIAE TRANSCRIPTIONAL ACTIVATOR GCR1P
By
Michael Andrew Huie
August 1994
Chairman: Henry V. Baker, Ph.D.
Major Department: Immunology and Medical Microbiology
The enzymes of the glycolytic pathway constitute
approximately 50 percent of the soluble proteins of the yeast
Saccharomyces cerevisiae. Deletion of the gene encoding the
transcriptional activator Gcrlp results in a 20-fold
reduction of these enzymes. This study presents a biochemical
analysis of the DNA-binding activity of Gcrlp. The DNA-
binding domain of Gcrlp is mapped to the carboxy-terminal 154
amino acids of the polypeptide. DNase I protection studies
presented here show that the Gcrlp DNA-binding domain
protects a region of the upstream activating sequence of TPI1
harboring the CTTCC sequence motif. This sequence has been
shown by genetic methods to be important for high-level gene
expression of a number of the glycolytic enzymes. By DNA
band-shift assays it is shown that the Gcrlp DNA-binding
domain also forms nucleoprotein complexes with CTTCC sequence
elements found in the upstream activating sequences of PGK1,
vi i i

ENOI, PYK1, and ADH1. From these experiments a consensus
Gcrlp-binding site is derived which is 5'-(T/A)N(T/C)N(G/A)
NC(T/A)TCC(T/A)N(T/A) (T/A) (T/G)- 3'. The apparent dissociation
constant of the Gcrlp DNA-binding domain with the sequence
5'-TTTCAGCTTCCTCTAT-3' is 2.9xlO-iM. However, only a 33-fold
difference is observed between the ability of specific
competitor and random DNA to inhibit formation of the
nucleoprotein complexes between Gcrlp and this binding site.
Circular permutation DNA band-shift assays are used to show
that the Gcrlp-DNA nucleoprotein complexes contains bent DNA.
The implications of these findings, in terms of the
combinatorial interactions that occur at upstream activating
sequences of GCR1-dependent genes, are discussed.
IX

INTRODUCTION
We can, first, describe an organism with concepts
men have developed through contact with living
beings over the millennia. In that case, we speak
of living, organic function, metabolism, breathing,
healing, etc. Or else we can inquire into causal
processes. Then we use the language of physics
and chemistry, study chemical or electrical processes,
and assume, apparently with great success, that the
laws of physics and chemistry, or more generally the
laws of quantum theory, are fully applicable to
living organisms. These two ways of looking at
things are contradictory. For in the first case we
assume that an event is determined by the purpose it
serves, by its goal. In the second case we believe
that an event is determined by its immediate
predecessor. It seems most unlikely that both
approaches should have led to the same result by
pure chance. In fact, they complement each other,
and, as we have long since realized, both are correct
precisely because there is such a thing as life.
Biology thus has no need to ask which of the two
viewpoints is the more correct, but only how nature
managed to arrange things so that the two should fit
together.
Niels Bohr (in Heisenberg, p. 110)
The regulation of gene expression in space and time is
foundational to the generation of structural and functional
diversity in living systems. It is in regulation that the
abstract information content of DNA is made manifest and
interactive with the environment. Using the working metaphor
of the genetic code as the language of life, to a large
degree the alphabet has been determined. The next challenge
in molecular biology is the determination of the operational
1

2
syntax. Because as in language this allows unlimited
arrangement of a finite set to generate creativity and
innovation, an understanding of these rules will lead to an
insight of life currently unavailable.
It has been pointed out long ago (Mayr, 1970; Britten
and Davidson, 1969) that most structural genes do not differ
greatly between simple single-cellular organisms and their
more sophisticated mammalian brethren. The tremendous
difference in complexity between the two forms of life seems
to be due chiefly to the emergence of algorithms able to
generate new biological structures with novel function. In
fact, analysis of the rates of mutation, using either neutral
or selection theory, suggest that mutations are insufficient
to drive saltatory speciation unless they affect regulatory
genes (King and Wilson, 1975; Delbrck, 1975; Gould, 1977;
Jacob, 1977). Stated by the neo-Darwinian evolutionist Ernst
May r:
The fact that the macromolecules of most important
structural genes have remained so similar, from
bacteria to the highest organism, can be much better
understood if we ascribe to the regulatory genes a
major role in evolution. Since they strongly affect
the viability of the individual they will be major
targets of natural selection... The day will come
when much of population genetics will have to be
rewritten in terms of the interaction between
regulator and structural genes. (Mayr, 1970, p.183)
Indeed, developmental biology, molecular genetics, cellular
biology, evolutionary biology, and physical biochemistry have
been converging toward a unified theory in recent years. As
stated recently in an editorial justifying the existence of a
new journal: Virtually all of the biological sciences are

3
converging on two central phenomena, namely, signal
transmission and differential gene expression (Levine, 1989).
The physical structure of DNA and proteins places
constraints on the available mechanisms of transcriptional
regulation, and this is seen in the strong evolutionary
conservation of many aspects of the transcriptional machinery
(Guarente and Bermingham-McDonogh, 1992). This provides a
tremendous advantage in the research of eukaryotic gene
regulation because many processes can be dissected in the
yeast Saccharomyces cerevisiae, using the powerful methods
available for the study of this organism. Not surprisingly
many recent advances have come from the study of S.
cerevisiae.
In the complicated area of the regulation and initiation
of transcription by RNA polymerase II, a large number of
observations and experiments have lead to a heuristic model.
Many components involved in promoter specific activation, the
basal transcriptional machinery, chromatin structure, and
nuclear scaffold have recently been cloned and sequenced.
Biochemical and genetic analysis has revealed relationships
and interactions among these factors (reviewed in Gasser and
Laemmli,1987; Workman and Buchman, 1993). Factors involved
in communication between activation domains and the basal
transcriptional machinery have been isolated (Dynlacht et
al.,1991; Berger et al.,1990 and 1992; Flanagan et al.,
1991). I will present a current view of transcriptional
activation based on recent information and then relate it to

4
a specific system, that of glycolytic gene expression in S.
cerevisie.
Basal Transcriptional Machinery and TFIID
Transcriptional Factor IID (TFIID) has long been
believed to be the key link between promoter-specific
activation and RNA polymerase II basal initiation machinery.
TFIID is not a single protein but a large (>700 Kd) complex
(Pugh and Tjian, 1990; Dynlacht et al., 1991) which elutes at
0.6-1.0 M KC1 from a phosphocellulose column of human tissue
culture cells (Matsui et al.,1980; Samuels et al., 1982;
Davison et al., 1983). Reconstitution experiments had
revealed that TFIID is the only component capable of
sequence-specific DNA binding (Sawadogo and Roeder, 1985;
VanDyke et al.,1989; Davison et al., 1983). Largely due to
this observation and similar reconstitution experiments
(Buratowski et al., 1988), TFIID was proposed to be the first
factor to bind DNA with the aid of TFIIA (Reinberg et al.,
1987) and TFIIJ (Cortes et al., 1992 ) and then to recruit the
other basal machinery (TFII,-B,-E,-F,-G, and RNA polymerase
II) (reviewed in Saltzman and Weinmann, 1989; Roeder, 1991).
Additionally, in vitro the stable association of TFIID with
the TATA box is slow (Reinberg and Roeder, 1987; Schmidt et
al., 1989; Hahn et al. 1989; Lieberman et al., 1991). From
these observations the association of TFIID with the TATA box
is believed to be the first and rate limiting step in
transcription initiation. Presumably, promoter-specific
activators speed up or stabilize TFIID interaction with the
TATA box thereby allowing recruitment of the other basal

5
machinery, thus stimulating transcription (reviewed in
Ptashne, 1988 and Ptashne and Gann, 1990). This is not the
only view put forward, however. Lin and Green (1991) have
proposed that binding of TFIIB represents the rate limiting
step that is enhanced by activators. The possibility that
different activators target different steps in assembly is
certainly reasonable (Mitchell and Tjian, 1989; Hawley,
1991) .
Characterization of TFIID had remained limited due to
the fact that it is difficult to purify in large yield and
due to its instability. Recently, however, it was found that
yeast TFIID was functionally interchangeable with human TFIID
(Buratowski et al., 1988; Cavallini et al., 1988). Easier
purification of the yeast factor was followed by molecular
cloning of the TATA-binding protein (TBP) component of the
complex, in yeast (Hahn et al. 1989; Eisenmann et al., 1989;
Horikoshi et al., 1989; Schmidt et al., 1989; Cavallini et
al. 1989). In yeast the 29 Kd TBP appears to be the major
and perhaps single component of TFIID. Cloning of TBP from
human (Peterson et al. 1990; Hoffmann et al., 1990) and
other species (Fikes et al., 1990; Hoey et al., 1990 ; Gasch
et al. 1990; Haass et al., 1992; Kao et al., 1990; Tamura et
al., 1991; Muhich et al., 1990; Ganster et al. 1991; Wong et
al., 1992) soon followed due to the remarkably high degree of
homology of 180 amino acid primary sequence at the carboxyl-
terminus of the protein.
TBP is composed of a conserved carboxy-terminal domain
and a divergent amino-terminal domain. Sequence analysis

6
revealed that TBP is a relatively small protein varying
amongst species between 22-39 Kd. The amino acids in the
carboxy-terminus of TBP are 75-85% identical in all eukaryote
TBP sequences currently known (Ganster et al. 1993; McAndrew
et al, 1993). This region, called the C-terminal core
domain, contains two repeats of 66-67 amino acids separated
by a highly basic region. The structure of TBP from
Arabidopsis Chaliana has been determined by X-ray diffraction
crystallography to a resolution of 2.6 (Nikolov et al.,
1992). The protein folds into two symmetrical and
topologically identical domains each derived from one of the
repeats (Nikolov et al., 1992; Rigby, 1993). The presumed
DNA binding surface is a curved, anti-parallel E-sheet
resembling a "saddle." Computer modeling revealed that DNA
would fit nicely into the concave surface of the saddle
(Nikolov et al., 1992; Rigby, 1993). When bound to DNA the
convex surface of the saddle is able to interact with other
transcriptional factors. Mutations in TBP that affect DNA
binding map to the concave region, while mutations that
affect the ability of TBP to interact with other proteins map
to the convex surface (Rigby, 1993).
The cloning of TBP along with the cloning of the major
components of TFIIB (Malik et al., 1991), TFIIE (Peterson et
al., 1991; Ohkuma et al., 1991; Sumimoto et al., 1991), and
TFIIF/RAP7 0/RAP30 (Aso et al. 1992; Finkelstein et al.,
1992) has allowed studies of the interaction between these
factors and activators to ensue. Recently, it has been shown
that TBP is also required by RNA polymerases -I and -III for

7
specific initiation (Comai et al., 1991; Schultz et al.,
1992; White et al., 1992).
Activators, Coactivators, and Adaptors.
Sequence-specific transcriptional factors are comprised
of two critical and separable domains; a DNA-binding domain
and an activation domain. This organization was first
demonstrated by Brent and Ptashne (1985) in the "domain
swapping" experiments with LexA and Gal4p. When the DNA-
binding domain of LexA was fused with the activation domain
of Gal4p, transcriptional activation occurred through a LexA-
binding site. Even more dramatic, the DNA-binding, ligand
binding, and activation domains of the estrogen and
glucocorticoid receptors could be swapped to produce an
estrogen responsive glucocorticoid receptor (Green and
Chambn, 1987); or the ligand binding and activation domain
of the glucocorticoid receptor could be fused to Gal4p to
produce hormonal dependent activation at a Gal4p-binding site
(Hollenberg and Evans, 1988). This flexibility with which
domains can be swapped has been one of the many surprises in
the study of transcriptional activating proteins.
Another surprise was that often the secondary structure
of these domains are not pre-folded but are formed and
stabilized upon ligand interaction. Although the DNA-binding
domains often have well defined motifs, ligand binding often
contributes to their stability. For example, the DNA-binding
domain of Gcn4p undergoes a coil to helix transition upon
binding to its operator site (Weiss et al., 1990; Talanian et
al., 1990; O'Neil et al., 1990). This loosely structured

8
domain apparently wraps around the DNA helix upon binding. A
similar occurrence is also seen in the N-terminal arm of the
lambda repressor which is disordered in the free protein but
wraps around the 'back side1 of the DNA helix when bound
(Jordan and Pabo, 1988).
Activation domains appear to become structured upon
interaction with other molecules. By selecting for
activation from random E. coli genomic sequences Ma and
Ptashne (1987) showed that a high density of negative
charges, rather than well-defined amino acid sequences, was
the major determinant of an activation domain in yeast. This
type of activation domain has been termed an "acid blob" or
"negative noodle" and has been proposed to be disorganized
(Sigler 1988), an alpha helix (Irwin and Ptashne, 1987), or a
beta sheet (Leuther et al., 1993 ; Van Hoy et al., 1993).
Polypeptides of the acidic activation domain of Gal4p and
Gcn4p have been shown to form beta sheets by circular
dichroism spectroscopy (Van Hoy et al., 1993) and by genetic
studies (Leuther et al., 1993). However, the active form of
the activation domain may change with additional protein
interactions (Hahn, 1993).
Another type of activation domain has been described and
also displays a "disorganized" structure. Deletion analysis
has revealed that the most potent activation domain of Spl
contains ~25 percent glutamine and very few charged amino
acids (Courey and Tjian, 1988). Furthermore, a glutamine-
rich stretch of 145 amino acids from Antennapedia can
substitute for this activation domain in a swap experiment

9
(Mitchell and Tjian, 1989). Besides the glutamine content
there is no other obvious sequence homologies between these
interchangeable domains. Finally, a third type of activation
domain, mapped in CTF/NF1, is proline-rich (Mermod et al.,
1989) .
Various models have been proposed for how activation
domains work. The models emphasize contact between the
activation domain and TFIID or RNA polymerase II. For
example, the negative noodle activation domain has been
proposed (Sigler, 1988; Allison et al., 1988) to interact
with the carboxy terminal domain (CTD) repeat of the large
subunit of RNA polymerase II. A general feature of the large
subunit of eukaryotic RNA polymerase II is the multiple
repeat of the Tyr-Ser-Pro-Thr-Ser-Pro-Ser heptapeptide in the
carboxyl terminus. In yeast this is repeated 26 times
(Allison et al., 1985); in mouse, 52 times (Corden et al.,
1985). Except for proline, which is believed to stabilize a
unique secondary structure, nearly all the amino acid side
chains in the heptapeptide are hydrophilic. This domain is
believed to be fully exposed to solvent projecting out of the
remaining globular folded polypeptide. According to the acid
blob/negative noodle model, interactions between the
carboxylates of the noodle and the hydroxyl groups of the CTD
and other promoter binding proteins facilitate trans
criptional initiation, possibly by aiding in binding of RNA
polymerase II to DNA (Suzuki, 1990). TFIID interacts with
the CTD repeats implying that its presence is necessary in
this model (Sharp, 1992).

10
An alternative explanation of the role of acidic
residues in activation domains has been proposed (Leuther et
al., 1993) in which the acidic residues function to make the
hydrophobic residues more accessible to interact with other
factors. According to this hypothesis positive as well as
negative charged amino acids can function in activation
domains, and the hydrophobic residues are more important in
making contacts with other proteins. Detailed mutagenesis
studies of some acidic activation domains support this
proposal (Cress and Triezenberg, 1991; Hardwick et al., 1992;
Regier et al., 1993; Leuther et al., 1993).
The idea that these different types of activation
domains all interact directly with TBP seemed unlikely, and
indeed, after the cloning of TBP, various investigators
reported that this protein alone could not replace the TFIID
fraction in transcriptional activation by Spl or CTF (Pough
and Tjian, 1990; Peterson et al., 1990), NTF1 (Dynlacht et
al., 1991), or USF (Hoffmann et al., 1990). Furthermore,
these activators apparently do not stimulate binding of TBP
to the TATA- box by direct interaction. Proteins that carry
out this function have been termed coactivators or adaptors/
mediators (reviewed in Lewin, 1990; Martin 1991;and
Greenblatt, 1991). A large number of polypeptides can be
coimmunoprecipitated with antibodies to TBP and are referred
to as TAFs (for TBP associated factors) (Dynlacht et al. ,
1991). Recently, by biochemical and genetic methods, a
number of RNA polymerase II TAFs (Taggart et al., 1992;
Ganster et al., 1993; Eisenmann et al., 1992; Koleske et al.,

11
1992) and RNA polymerase III TAFs (Buratowski and Zhou, 1992;
Kassavetis et al., 1992) have been isolated. These,
apparently species specific, proteins are believed to be part
of the heterogenous TFIID complex.
By deletion analysis some of these adaptor domains have
already been mapped. For example, the acidic activator
Gal4p-VP16 is able to activate transcription in a
heat-treated TFIID deficient HeLa nuclear extract when
supplemented with recombinant human TBP. However, a
amino-terminally truncated molecule of human TBP cannot
support the activation in heat treated HeLa nuclear extract
(Peterson et al., 1990). Also, by genetic methods several
putative adaptors have been isolated in yeast (Berger et al.,
1992).
History of Fermentation in Yeast
Recent studies on the regulation of the glycolytic
enzyme genes in yeast suggest candidates for activators and
adaptors. I will first review the history of the study of
fermentation in yeast since it is intimately associated with
the history of modern biology. Then I will outline current
factors imputed in transcriptional regulation of the
glycolytic genes. In the discussion I will present a model
based on current knowledge.
The brewing of beer is the largest biotechnological
industry in the world producing commercially each year 1011
liters of beer (Oliver, 1991). The earliest known remains of
human writing include descriptions of alcohol production by
fermentation. Clay tablet found from the earliest

12
civilization, dating to 2,500 BC, written in the Sumerian and
Akkadian languages describe an established profession of
alcohol fermentation 3,500 years earlier. Assyrian writings
dating to 2,000 BC list beer as a commodity on Noah's Ark.
The Bible explicitly mentions Noah's knowledge of
fermentation and his use of alcohol. (Genesis 9:20-21: Noah
was the first tiller of the soil. He planted a vineyard; and
he drank of the wine, and became drunk, and lay uncovered in
his tent.) The daughters of Lott (Genesis 20:30-37) found
creative use for alcohol. Egyptian writings from the Fourth
Dynasty, circa 2,500 BC, describe the process of malting
barley and its fermentation. Man's knowledge of these
techniques clearly preceded his acquisition of written
language. The effects of the products of fermentation,
principally ethanol, undoubtedly influenced the perceptions
and analysis of many of the unknown artists and religious
charismatics of the antediluvian past. Anthropological
studies reveal that all cultures independently learned early
to ferment fruits and grains to produce alcohol.
The scientific study of fermentation by yeast has
spanned many centuries and has been associated with and
attributed with changes in fundamental beliefs in modern
biology. Indeed, historians tell us that the study of
fermentation in yeast underlies the birth of chemistry,
biochemistry, and microbiology (Fruton, 1976; Kohler, 1972).
Speculation on the nature of fermentation was advanced by
some of history's most notable scientists.
Willis (1659) and Stahl (1697), founders of the

13
phlogiston theory of combustion, were the first to outline a
theory of fermentation in the early modern period (for an
excellent review, see Fruton, 1972). They attributed an
internal motion to the "ferment.' Contact of quiescent
substances by the ferment then caused them to undergo decay.
A similar view was also put forth by Isaac Newton (1730), in
his book Opticks, where he describes the interaction of
ferments as an example of the force of gravity.
Lavoisier, the founder of modern chemistry, extinguished
the phlogiston theory with his work describing oxygen. But
it is in Lavoisier writings on fermentation, not oxygen,
where he outlines his theory of conservation of matter:
Nothing is created either in the operation of art or of
nature, and the principle may be formulated that in every
process there is an equal quantity of matter before and
after the reaction, that the quality and the quantity of
the principles are the same and that there are only changes
or modifications, (in Fruton,1972, p. 39)
Lavoisier, and later Gay-Lassie (1810), used fermentation to
demonstrate this 'conservation of matter.' This 'law,' in
its form modified by Einstein, remains a foundation of modern
chemistry and physics. Although the phlogiston theory of
combustion was abandoned, Lavoisier was largely responsible
for sustaining the 'purely chemical' theory of fermentation
that dominated the scientific opinion during his day.
In 1779, the French Academy of Science offered the prize
of one kilogram of gold to anyone who could explain the
nature of alcoholic fermentation (Fruton, 1972). The
question was stated as, 'What are the characteristics which
distinguish vegetable and animal substance that act as

14
ferments from those that undergo fermentation?' Offering
this prize reflected not only the importance of this unsolved
problem, and its relation to commerce, but the fact that
beginning around the nineteenth century chemical explanations
for biological phenomena became a major preoccupation of
leading scientists (Fruton, 1972). A debate ensued as to
whether vitalistic or organismic notions, beyond materialism
and reductionism, had to be evoked to account for
fermentation. The prize was never awarded, and was withdrawn
in 1804 because of lack of funds.
In 1838, the same period that Schleiden and Schwann
(1839) were outlining the cell theory, Cagniard de Latour
published an article entitled Memoir on Vinous Fermentation
(translated in Williams and Steffens, 1978) in which he
argued that fermentation was the result of the 'vital
activity' of yeast 'cells.' Although Leeuwenhoek, in 1680,
described multiplying budding cells in the deposit formed in
beer fermentation, it is important to remember that during
this time, fermentation was still believed to be a chemical
(that is, not vitalistic or organismic) process, and that
yeast sediment was not believed to be cellular life, but an
albuminoid. Cagniard de Latour discovered that yeast
sediment was composed of cells and that fermentation was
associated with these cells being alive and dividing
(Cagniard-Latour 1838). He also immediately recognized the
importance of these new cellular organisms as a research
tool, as shown in the concluding remarks of his paper:
I have looked at the principal works which treat
vinous fermentation and in none of them have I seen

15
that the microscope has been used to study the
phenomena upon which it depends. This essay, as one
can judge by the researches which I have just
mentioned, will be useful since it has furnished a
number of new observations from which the principal
results that can be drawn are: 1, that beer yeast,
this ferment which is in such use and which, for this
reason, should be examined very closely, is a mass of
little globular bodies capable of reproducing them
selves, and thus organized beings, and not a simple
organic or chemical substance as has been supposed;
2, that these bodies seem to belong to the vegetable
kingdom and regenerate themselves in two different
ways, and 3, that they seem to act on a solution of
sugar only so long as they are in the vital state:
from which it can be concluded that it is very
probably by some effect of their vegetation that they
are able to disengage carbon dioxide from this
solution and convert the solution into a spirituous
liquor. I would like to remark, further, that yeast,
considered as an organized matter, perhaps merits the
attention of physiologists in this sense: 1, that it
can be born and develop in certain circumstances with
great rapidity even in the middle of carbonic acid as
in the brewers' barrels; 2, that its mode of
reproduction presents particularities of a kind which
have not been observed in other microscopical products
composed of isolated globules and 3, that it does not
die by very considerable refrigeration nor by
deprivation of water, (in Williams and Steffens,
1978,p. 446)
Cagniard de Latour's work was confirmed by Theodore
Schwann (1838), yet it still was attacked and dismissed by
many of the scientists of the day who maintained
institutional power, such as Berzelius, Liebig, and Wohler.
This group of prominent scientists were chemist who had
succeeded at synthesizing bio-organic compounds and found the
notion of 'vital forces' as somewhat superstitious. 'It is
not,' said Liebig, 'because it is organized that the beer
yeast is active, but because it has been in contact with the
air. It is the dead portion of the yeast, which has been
alive and is in process of alteration, that acts on the
sugar.' (in Pasteur Valler-Radot, 1957)

16
Pasteur, who was held in respect among chemists,
supported the work of Cagniard de Latour and Schwann, and was
instrumental in countering the opposition of the chemists,
and in bolstering the concept of vitalism in biology. Said
Pasteur:
My present and most fixed opinion regarding the
nature of alcoholic fermentation is this: I believe
that there is never any alcoholic fermentation without
there being simultaneously the organization, develop
ment, and multiplication of the globules, or at least
the pursued, continued life of globules that are
already present. The totality of the results in this
article seem to me to be in complete opposition to the
opinions of Liebig and Wohler, (in Kornberg,1989, p. 33)
Pasteur strongly supported an ideology vitalism and held that
life processes are not reducible to the laws of physics and
chemistry.
Pasteur's 'fixed opinion' was shown to be false when
Eduard Buchner made the following observations in 1897:
If one mixes 1,000 grams of brewer's yeast with an
equal weight of sand and then grinds the mixture, the
mass becomes moist and pliable. Now if 100 grams
of water are added, and the paste, wrapped in
cheesecloth, is gradually subjected to 400-500
atmospheres of pressure in a hydraulic press, one
obtains about 500 milliliters of 'press juice'; to
remove any residual unbroken cells, the press juice
is passed through a paper filter. The final solution
contains a collection of substances derived from the
cell interior. The 'cell extract' obtained in this
way is a clear, slightly yellow liquid with a pleasant
yeast smell, (in Kornberg, 1989, p. 34)
When Buchner added sugar to this solution in an effort to
preserve it, he noticed that bubbles of gas appeared within
minutes. He repeated his experiments and concluded that
fermentation was possible outside of the yeast cell. Buchner
believed that the reaction was catalyzed by a single enzyme
and named the substance zymase. The word enzyme means 'in

17
yeast.' Buchner received the Nobel Prize in Chemistry ten
years later for his discovery, which is often cited as the
origin of biochemistry. In his autobiography Willstatter,
Buchner's teacher, said 'This will bring him fame, even
though he has no chemical talent.' (in Willstatter, 1949)
Studies of Pasteur's records revealed that he had
prepared cell-free yeast juices and attempted to carry out
fermentation with the juice before Buchner's discovery.
Unfortunately, he had used a strain of yeast which contained
a labile form of invertase which did not survive the
extraction procedure. He did not observe cell-free
fermentation (Kornberg, 1989).
Early work on the purification of enzymes then ensued.
Although this early work was criticized on the ground that it
was 'unphysiological to separate enzymes from cell,'
investigators persevered and the conception of enzymes
changed from a vague property in certain preparations to
definite chemical substances, and finally by the 1930s to
specific proteins (Fruton, 1972). The work of Harden,
Neuberg, Embden, Meyerhof, and Warburg showed that zymase was
a complex mixture of a dozen separate enzymes.
In the latter half of the twentieth century, after the
revolution in molecular biology, the genes coding for the
enzymes of the glycolytic pathway were cloned and the study
of transcriptional regulation of these gene ensued.

18
Coordinate Regulation of Glycolysis in
Saccharomvces cerevisiae
In Saccharomyces cerevisiae the enzymes of the
glycolytic pathway are among the most highly expressed genes,
constituting between 30-60 percent of the total soluble
protein when grown in the presence of glucose (Hess et al.,
1969; Fraenkel, 1982). The demonstration (Holland and
Holland, 1978) that the most abundant mRNA species in the
yeast code for glycolytic enzymes suggested that this is
largely due to high-level transcription of the corresponding
genes. High-level expression of heterologous genes under
glycolytic-gene promoters (Bitter and Egan, 1984; 1988;
Bitter et al., 1987) further demonstrated that the glycolytic
gene promoters are among the strongest known.
A number of trans- and cis-acting elements have been
discovered to be important for the coordinate high-level
expression of the glycolytic genes. The trans-factors
include Gcrlp, Gcr2p, and Raplp/Grflp/Tuflp (hereafter
referred to as Raplp). Additionally the factors GAL11/SPT13
(referred to as Galllp), Abflp/Taflp/Sufp/Gflp/SBF-B (now
designated Abflp) and Reblp/Grf2p/QBP/Y (hereafter referred
to as Reblp) are believed to play a role in high-level
expression of some of the genes. I will review these factors
here. A model of how these factors may work together will be
presented in the Discussion.
It was observed in 1978 that mutation in a single gene
can causes a dramatic decrease in expression of most of the
glycolytic genes (Clifton et al., 1978; Clifton and Fraenkel,

19
1981) This gene was named GCR1 for Glycolysis Regulation.
The gcrl mutant has a severe growth defect when glucose is
present in the medium. This growth defect is presumably due
to the fact that aerobic respiration is repressed in
Saccharomyces cerevisiae when glucose is present, as part of
the global phenomenon known as glucose repression. When
glucose is present a large number of genes involved in the
metabolism of alternate carbon sources are repressed.
Genetic analysis has identified a large number of genes
involved in this regulatory process, involving multiple steps
and branches regulating subsets of glucose-repressible genes
(for a recent review see Trumbly, 1992). Since the gcrl
mutant produces the glycolytic enzymes in reduced amounts it
grows poorly in the presence of glucose. It does, however,
grow adequately on non-carbohydrate carbon sources, and if
glucose is added a noticeable induction of most of the
glycolytic enzymes is observed (Clifton and Fraenkel, 1981;
Baker, 1986). GCR1 has been cloned by complementation
(Kawasaki and Fraenkel, 1982), mapped to chromosome XVI
(referred to as the sit3 mutant in Arndt et al. 1989, and
Devlin et al., 1991), and sequenced (Baker, 1986; Holland et
al., 1987) revealing an open reading frame coding for a
protein of 844 amino acids. The low codon bias of -0.00086
according to the rules of Bennetzen and Hall (1982) suggested
that the gene is expressed in low amounts, and this was
confirmed by Northern analysis (Baker, 1986). A single base
pair insertion at codon 304 causing a frame-shift mutation is
apparently responsible for the phenotype associated with the

20
gcrl-1 mutant strain DFY67 (Holland et al., 1987). Sequence
analysis suggested that a possible helix-turn-helix (H-T-H)
motif is present in the carboxyl terminal region of the
protein (Baker, 1986). H-T-H motifs are associated with DNA-
binding activity. Gcrlp was shown to posses DNA-binding
activity when it was demonstrated that the Gcrlp product
translated in rabbit reticulocyte lysate formed a nucleo-
protein complex with a DNA fragment isolated from the
upstream activation sequence element of TPIl (Baker, 1991).
Gcrlp was shown to bind a fragment of DNA from the TPIl
promoter which contained a CTTCC pentamer but was unable to
bind a related fragment in which the CTTCC sequence was
changed to CAACC (Baker, 1991). The CTTCC sequence element
had long been noted to be present in the promoters of
glycolytic genes (Ogden et al., 1986). By site-directed
mutagenesis or deletion analysis CTTCC sequence elements were
shown to be important for high-level expression of the genes
encoding phosphoglycerate kinase (Chambers et al., 1988),
enolase and pyruvate kinase (Buchman et al., 1988), and
trise phosphate isomerase (Scott and Baker, 1993). Bitter
et al. (1991) defined a sequence, GPE, which had a CTTCC
sequence element at its core in upstream activation
sequences.
Gpr2p
Mutation or deletion in the GCR2 locus also produces a
profound effect on expression of the glycolytic genes. gcr2
mutants were isolated during a screen for mutants affecting
expression of a ENOl: : lacZ gene fusion (Uemura and Fraenkel,

21
1990) The GCR2 gene was cloned by complementation and shown
to be distinct from GCR1. Although the effects on glycolytic
gene expression are similar in the gcrl and gcr2 mutants, the
gcr2 mutant does not have as severe of a growth defect as
gcrl mutants when grown on glucose at 30 C (Uemura and
Fraenkel, 1990).
The role of Gcr2p in glycolytic gene expression is
currently under investigation. Like Gcrlp, Gcr2p appears to
exert its effects at the transcriptional level, as measured
by Northern analysis (Uemura and Fraenkel, 1990). Gcr2p does
not appear to interact directly with the CTTCC sequence
element. In vivo footprinting experiments demonstrate
protection of the CTTCC sequence elements in UASTPI in the
gcr2 mutant (Scott and Baker, 1992). In the gcrl mutant these
sequences are not protected (Huie et al., 1991; Scott and
Baker, 1993 ). A clue to the function of Gcr2p in glycolytic
gene expression was provided by genetic studies (Uemura and
Jugami,1992) based on the method of Fields and Song (1988).
A GAL4::GCR1 gene fusion containing the activation domain of
GAL4 and amino acids 68-844 of Gcrlp can complement a gcr2
mutant. Furthermore, a RAP1::GCR2 gene fusion which carries
the DNA binding domain of Raplp can partially complement a
gcrl mutant. These observations have led to the suggestion
that Gcrlp and Gcr2p function together as an activation
complex (Uemura and Jigami, 1992).
Rapio
RAP1, for repressor/activator protein, is an essential
gene (Shore and Nasmyth, 1987) whose product binds to DNA.

22
The RAPl product is expressed at levels greater than 4,000
molecules per cell (Buchman et al. 1988) and has pleiotropic
actions. It is capable of either activation or repression of
transcription depending on the context of its binding site
(Shore and Nasmyth, 1987). For example, Raplp acts as a
silencer at the mating-type locus by interacting with the
HMR(E) element (Shore et al., 1987). Raplp acts as an
activator of ribosomal protein genes in cells in exponential
growth by interacting with the rpg-box found upstream of the
ribosomal protein genes (reviewed in Warner, 1989). It is
also involved in stringent control of ribosomal protein
transcription under conditions of amino acid starvation
(Moehle and Hinnebusch, 1991). Raplp binds to telomeres
(Buchman et al., 1988; Longtine et al., 1989) and is involved
with their maintenance and length regulation (Lustig et al.,
1990; Conrad et al., 1990). Interestingly, Sussel and Shore
(1991) showed that two of these three functions can be
separated by genetic methods. They were able to distinguish
Silencing/Telomere function from activation function. A DNA-
binding domain (Henry et al., 1990) and activation and
derepression domains (Hardy et al., 1992) have been mapped
within the Raplp protein.
A role for Raplp in the activation of the glycolytic
genes has been demonstrated for a number of genes including
TPI1 (Scott et al., 1990), TDH3 (Bitter et al. 1991), PGK
(Chambers et al., 1989), ENOl (Machida et al., 1989; Brindle
et al., 1990), EN02 (Brindle et al., 1990), PYK (McNeil et
al., 1990), PDC1 (Butler et al., 1990), and ADH1 (Tornow and

23
Santangelo, 1990). Furthermore, putative Raplp-binding sites
can be identified in the 5' region of other genes in the
glycolytic pathway (Huie et al. 1992; and discussion).
Raplp appears to undergo phosphorylation which may influence
its binding at the UASFCth- (Tsang et al., 1990). This
post-translational modification has been suggested (Tsang et
al., 1990) to be responsible for the glucose induction of PGK
(Chambers et al., 1989).
The mechanism of action of Raplp is currently unknown.
Although Raplp binding sites are necessary for high-level
expression of glycolytic genes, they are unable to convey
high-level expression of reporter genes by themselves
(Stanway et al., 1989). Protein-protein interactions with
the putative coactivator GAL11/SPT13 has been proposed
(Nishizawa et al. 1990; Fassler and Winston, 1989; Stanway
et al., 1993), and the mapping of an activation domain in
Raplp to 66 amino acids with a net negative charge of -12
(Hardy et al., 1992) also supports a coactivation model
(Baker, 1991). Alternatively, Raplp has been proposed to
alter chromatin structure providing access to DNA by other
activator proteins (Devlin et al., 1991; Sentenac and
Vignais, 1987). Finally, Scott and Baker (1993) have
proposed that Raplp facilitates binding of Gcrlp by either a
protein-protein interactions or by altering the topology of
the DNA to which Gcrlp binds.
Abf lp
Abflp (for ARS binding factor), like Raplp, is also
involved in multiple cellular functions including

24
transcriptional activation and initiation of DNA replication.
Binding sites for Raplp and Abflp are both found at HMR(E).
Abflp binds to the promoters of the ribosomal-protein genes
encoding L2A and L2B (Seta et al.( 1990). Abflp binds to
the B3 element (Marahrens and Stillman, 1992) of the
autonomously replicating sequences (ARS) and is important for
initiation of replication. Replacement of the Abflp-binding
site with a Raplp-binding site can restore high-level ARS
activity (Marahrens and Stillman, 1992). The binding sites
for these factors can also be exchanged in a gene transcribed
br RNA polymerase II: an Abf lp-binding site can replace a
Raplp-binding site in the ILV1 gene (Remade and Holmberg,
1992). A functional Abf lp-binding site is found in the UAS of
PGK and PYK1 (Chambers et al., 1990).
The similarity of function of Raplp and Abflp is matched
by an homology of 4 0% conserved amino acid over 60% of the
primary sequence between the two proteins (Diffley and
Stillman, 1989). This has lead to a model of action of these
two proteins (Diffley and Stillman, 1989). The repressed
state of HMR involves the formation of chromatin structure
similar to that of heterochromatin (Nasmyth, 1982).
Heterochromatin is located in the periphery of the nucleus
associated with the nuclear lamina. The SIR4 gene is also
required for silencing (Rine and Herskowitz,1987). The
presence of a lamina domain in the Sir4p protein suggests
that Raplp and Abflp may play a role in altering chromatin
structure by interacting with the nuclear scaffold (Marshall
et al, 1987; Diffley and Stillman, 1989). Indeed Raplp has

25
been shown to purify with the nuclear scaffold (Cardenas et
al, 1990), as do ARS sequences (Amati and Gasser, 1988).
Re.bija
REBl is an essential gene in Saccharomyces cerevisiae
encoding a highly hydrophilic protein of 809 amino acids (Ju
et al., 1990). The protein was originally isolated as a
factor binding to the rRNA enhancer (Morrow et al., 1989 and
1990), but now appears to play a more global role in
transcription. It is likely to be identical (Ju et al.,
1990) to the proteins Y (Fedor et al., 1988), Grf2p (Chasman
et al, 1990), and QBP (Brandi and Struhl, 1990). The Reblp
consensus binding site is present upstream of a number of
genes transcribed by RNA polymerase II, including the highly
expressed glycolytic genes PYK (Chasman et al., 1990), TPI1
(Scott and Baker, 1993), TDH3 (Bitter et al., 1991) and ENOl
(Machida et al., 189). The exact role of Reblp in the
expression of genes transcribed br RNA polymerase II is
currently unknown; however, it has been shown to effect
chromatin structure (Fedor et al., 1988), and although Reblp-
binding sites have little effect on activation by themselves,
they do potentiate nearby activators (Chasman et al., 1990;
Holmberg and Remade, personal communication) This
synergistic effect is strongly distance dependent. This
observation has lead to the suggestion that Reblp exerts its
effect by clearing chromatin of nucleosomes, or other
obstacles, allowing activators easier access to bind their
sites (Kornberg and Lorch, 1991).

26
Gcrlp as a DNA-Binding Protein
The experiments presented in this study were designed to
characterize several basic properties of the DNA-binding
activity of Gcrlp. Since Gcrlp is a transcriptional
activator it should adhere to the modular nature of this
class of proteins. The experiments described in this study
set out to determine whether Gcrlp does have a modular design
and a DNA binding domain. Deletion analysis of Gcrlp was used
to address this point. Experiments also were designed to
determine if the Gcrlp DNA-binding domain binds to DNA in a
sequence specific manner and to define a consensus sequence
to which it binds. This was studied by DNase I footprinting
and DNA band-shift assays. Whether the CTTCC core sequence is
sufficient to convey DNA binding, or if surrounding base
pairs are important in the ligand interaction was also
addressed in this study by DNA band-shift assays.
Determination of affinity and specificity of binding by Gcrlp
to a consensus sequence is presented. Finally, since many
DNA-binding proteins have been shown to distort DNA when
bound, Gcrlp was also assayed for this activity. The
implications of the findings in this study are discussed in
the context of the combinatorial nature of interactions of
factors important for glycolytic gene expression.

MATERIAL AND METHODS
Bacterial Strana
E. coli strains used in this study were MC1061 (hsdR,
mcrB, araDl39, A[araABC-leu] 7679, AlacX74, galu, galK, rpsL,
thi) (Casadaban and Cohen, 1980); DH5a [ A [ lacZYA-argF] U169, deoR, recAl, hsdRl7, supE44, thi-1,
hyrA96, relAl) (Hanahan, 1983); and, TBl (ara A[lac ZYApro
AB] rpsL [tp80dlacZAMl5], hsdR) (Johnston et al., 1986).
Media and Growth Conditions
E. coli strains used in this study were grown at 37 C in
L broth (5 g yeast extract, 10 g tryptone, and 8 g NaCl per
liter) with vigorous shaking. Strains harboring plasmids
were grown in L broth containing 100 |lg/ml ampicillin.
Transformations
E. coli strains MC1061 and TBl were transformed with
plasmid DNA by the low pH method of Enea et al. (1975). E.
coli strain DH5a was transformed by the manufacturers
recommended method (GIBCO BRL) .
Induction of malE::GCRl Gene Fusions
E. coli strain TBl, harboring plasmids encoding
malE: :GCR1 gene fusions, was used for the production of
hybrid MBP-Gcrlp polypeptide. 500 ml cultures in 2 liter
shake flasks were grown to an optical density of 0.5 (A60o)
Then isopropyl-S-D-thiogalactopyranoside (IPTG) was added to
27

28
a final concentration of 2 mM to induce expression of the
malE::GCRl fusions genes. The cultures were then grown an
additional 2 hours at 37 C, following which time they were
harvested by centrifugation (4000 x g for 10 min at 4 C).
The supernatant was discarded and the wet weight of the
pellet was determined. The cells were suspended in 3 ml TEN
lysis buffer (50 mM Tris [pH 8.0], 1 mM EDTA, 50 mM NaCl) per
gram (pellet [wet weight] ) The bacteria were lysed by
passage through a French pressure cell at 20,000 lb/in2 by
the method of Clifton et al. (1978). Cellular debris was
removed by centrifugation at 17,000 x g for 20 min at 4 C.
The supernatant, containing the soluble cellular protein, was
recovered for further use. Protein extracts prepared in this
manner typically had a protein concentrations that ranged
from 0.068 to 0.2 mg/ml, as determined by the method of
Bradford (197 6).
Purification of MBP-GCR1 Fusion Protein
The Maltose-binding moiety of the hybrid MBP-Gcrlp(690-
844) fusion protein was utilized to purify the fusion protein
by affinity chromatography over an amylose column. The
amylose column was prepared in the following manner. A 15 ml
slurry of amylose resin was allowed to settle in a 2.5 x 10
cm column. The height of the packed resin was 1 cm giving a
total bed volume of 7 cm3. The column was then washed with
approximately 3 column volumes (25 ml).
Crude cellular lysates prepared as described above were
diluted 1:5 with column buffer (10 mM phosphate, 0.5 M NaCl,
1 mM azide, 1 mM DTT, 1 mM EGTA) containing 0.25% Tween 20 to

29
yield a final volume of 400 ml. The diluted lysate was
loaded onto the amylose column at the rate of 1 ml/min.
Following the addition of the crude lysate to the column, the
column was washed with 3 column volumes of column buffer
containing 0.25% Tween 20. The column was then washed with 6
column volumes column buffer without Tween 20. The hybrid
MBP-GCRl(690-844) fusion protein was then eluted from the
column by passing 10 nM maltose over the column in column
buffer. The fusion protein was collected in 3 ml aliquots.
Typically 15 fractions were collected.
Aliquots of 20 H-l of each fraction were subjected to
SDS-PAGE to identify fractions containing fusion protein. 20
^1 aliquots of each fraction were electrophoresed through a
10% SDS-PAGE. The resulting gel was stained with coomassie
blue to visualize the protein. Typically fusion protein
appeared across fractions 2 through 7. Fractions containing
the fusion protein were pooled and concentrated by
ultrafiltration through a low-adsorption, hydrophilic, [YM]
membrane with a 30 kiloDalton size exclusion using a
Centriprep-30 concentrator (Amicon) according to the
manufacture's specifications. Pooled fractions were added to
the Centriprep-30 concentrator and centrifuged for 5 min at
2600 rpm (5000 x g) in a Jouan CRF412 swinging-bucket
benchtop centrifuge. The filtrate was decanted and the
sample was centrifuged a second time for 10 min at 2600 rpm.
The final volume was approximately 1 ml. This sock solution
was confirmed by running 2 |IL into 10% SDS-PAGE and protein
visualized by staining with coomassie blue. Samples were

30
saved by storage at -70 C. A typical protein concentrations
of such a prep was 0.35 mg/ml.
Nucleic Acid Manipulations
Standard techniques used throughout the course of this
study are described in common reference manuals (Ausubel et
al., 1989; Sambrook et al., 1989). Deviations from standard
techniques are noted and described.
DNA Precipitation
Prior to ethanol precipitation ammonium acetate was
added to the DNA solutions to a final concentration or 2.5 M.
This was accomplished by adding an equal volume of 5 M
ammonium acetate. The resulting volume was noted and then
2.5 volumes of absolute ethanol was added, mixed, and placed
at -70 C for 10 min. Following which time the samples were
centrifuged in a microcentrifuge at 12,000 x g at room
temperature for 20 to 30 min. After centrifugation the
supernatant was discarded and the pellet washed with 1 ml 70%
ethanol. The resulting mixture was then centrifuged for 5
min at 12,000 x g in a microcentifuge at room temperature.
Again the supernatant was discarded and then the pellet was
dried in vacuum with a Speed Vac Concentrator (Savant
Instruments Inc.) .
In situations were DNA was to be treated with
polynucleotide kinase, ammonium acetate was avoided. In
these cases DNA was precipitated by adjusting solution to 0.3
M sodium acetate (pH 5.5). Typically 1/10 volume of 3 M
sodium acetate was added followed by addition of 2.5 volumes

31
of ethanol. Samples were cooled, centrifuged, and dried as
described above.
Purification of DNA Fragments and Oligonucleotides
Oligo-nucleotides used in this study were initially
synthesized on an Applied Biosystems 380B DNA synthesizer by
the University of Florida Interdisciplinary Center for
Biotechnology Research. The sequence of the oligonucleotides
used are listed in Table 1. In some cases oligonucleotides
were purified by 10% PAGE. After DNA was visualized by
ethidium bromide staining, gel slices were incubated at 37 C
overnight in 3 volumes of 0.5 M ammonium acetate, 1 mM EDTA,
and then precipitated the next morning by the addition of 2.5
volumes ethanol and centrifugation.
DNA was purified from acrylamide gels by transfer to
DEAE paper. The excised gel was embedded in 0.8% agarose
gel. Current was applied at constant voltage of 100 V and
the DNA was run into NA4 5 DEAE cellulose paper (pre soaked
for 10 min in 10 mM EDTA pH 7.6; then 5 min in 0.5 M NaOH,
followed by several rapid washes in ddH20) The DNA was freed
from the paper by incubating the paper in Hi-Salt NET Buffer
(1 mM NaCl, 0.1 mM EDTA, 20 mM Tris [pH 8.0]) for 1 hour at
65 C, phenol extracted, ethanol precipitated, and resuspended
in TE pH 7.5.
Radio-labelina DNA Fragments
Probes were prepared by either of two methods: filling
in with the large fragment of E. coli DNA polymerase I or end
labeling with polynucleotide kinase.

Table 1. Oligonucleotides
Name
HB01
HB09
HB10
HB39
HB40
HB57
HB58
HB59
HB61
HB62
HB63
HB64
HB65
HB66
HB7 6
HB77
HB79R
Sequence
5 ATGTGTGGAATTGTGAGCGG 3 '
5 -GGCATGCCAACATGTATGGGTTCCAAGCTTG-3'
5'-CAAGCTTGGAACCCATACATGTTGGCATGCC-3'
5 -GCTAAGCTTAGCTTCCTCTATTGATGGC ATGCC 3 '
5'-GGCATGCCATCAATAGAGGAAGCTAAGCTTAGC-3'
5 -GACGAATTCTGCAGGGCCCGAN25GCCAAGCTTAGCATGCACGGCC-3 '
5'-CGTGCATGCTAAGCTTG-3'
5'-CGAATTCTGCAGGGC-3'
5 -GGAAGCTTGACTTTTCAGCTTCCTCTATTGATGGCATGCGGATCCGC 3
5 -GGAAGCTTGACTTCCTGTCTTCCTATTGATTGCGCATGCGGATCCGC-3
5 -GGAAGCTTACAATATGGACTTCCTCTTTTCTGGGCATGCGGATCCGC 3
5 -GGAAGCTTCTAATCCGAGCTTCCACTAGGATAGGCATGCGGATCCGC-3
5 -GGAAGCTTAGACATCGGGCTTCCACAATTTTCGGCATGCGGATCCGC- 3
5 -GGAAGCTTTTTTCTGGCATCCAGTTTTTAATGCATGCGGATCCGC-3 '
5 -GGAAGCTTCTTTTTTACTCTTCCAGATTTTCTCGCATGCGGATCCGC 3
5 GGAAGCTTTCCCCTCTTTCTTCCTCTAGGGTGTGCATGCGGATCCGC-3
5 -GGAAGCTTTGGTGCAGGGCTTCCTCAGGTAGACGCATGCGGATCCGC 3

33
Most DNA fragments used for probes in experiments were
labeled by first digesting the fragment with restriction
endonucleases which produce protruding 5' ends. The overhang
was then filled in and labeled by using the large fragment of
E. coli DNA polymerase I in the presence of a32P dATP (3,000
mCi/mM). The reaction was carried out in the restriction
digest reaction mixture, after digestion, by adding dNTPs
(minus dATP) at 10-3M. One to six units of the large fragment
of E. coli DNA polymerase was then added and the reaction was
allowed to proceed at 37 C for 30 min. Probes were then
purified by 6% PAGE as described below.
In some cases probes were labeled using polynucleotide
kinase. In these cases this was accomplished by first
treating the DNA fragments with 0.1 U of bacterial alkaline
phosphatase for 30 min at 60 C in BAP buffer (50 mM Tris [pH
8.0], 1 mM ZnCl2). The reaction mixture was then treated with
Proteinase K (25 (ig) for 30 min at 37 C followed by two
phenol extractions. The sample was then ethanol precipitated.
The pellet was resuspended in polynucleotide kinase buffer
(50 mM Tris [pH 7.6], 1 mM MgC12, 5 mM DTT, 0.1 mM
spermidine, 0.1 mM EDTA) with 200 |i.Ci of y32P atp and 20 U of
T4 polynucleotide kinase. The reaction was allowed to
proceed for 1 hour at 37 C. Probes were then purified by 6%
PAGE as described above.
Disintegrations/min were determined by suspending 1 |IL
in 5 ml of ddH20 and measuring Cerenkov radiation occurring in
the solution and wall of the scintillation vial (Jelley,
1958) with a scintillation counter.

34
Polyacrylamide Gel Electrophoresis
Various types of polyacrylamide gels electrophoresis
(PAGE) were used throughout the course of this study.
Nondenaturing PAGE was used for separation and purification
of DNA and for band shift assays. The percentage and ratio
of acrylamide to N,N'-methylenebisacrylamide (bis) was
determined by the particular use of the gel. For
purification of DNA, generally 6% or 8% gels with 30:1
acrylamide:bis ratio polymerized in TBE buffer (0.1 M Tris
[pH 7.5], 0.1 M Boric Acid, 10 mM EDTA) were used. Running
buffer was 1 x TBE. Gels were run at constant voltage,
usually 1-8 V/cm.
For band shift assays, 5-10% non-denaturing gels with
82.6:1 acrylamide:bis polymerized in 0.5 x TBE buffer were
commonly used. Running buffer was 0.5 x TBE. In cases were
GCRl was translated in rabbit reticulocyte lysate, TE (10 mM
Tris [pH 7.5], 1 mM EDTA) gels produced better resolution.
These gels ranged between 5-10% with a acrylamide:bis ratio
of 82:1 and were polymerized in TE buffer. Running buffer
was TE with recirculation. Band shift gels were pre-run for
at least 1.5 hours at 100 volts.
For DNA sequencing and DNase I footprinting, denaturing
gels containing 7 M urea were used. An acrylamide:bis ratio
of 30:1 was polymerized in 0.5 x TBE buffer. These gels were
pre-run for at least 30 min at 1500 volts.
For separation of proteins 10% SDS-PAGE were used
containing 0.1% SDS. The 3% stacking and 10% resolving gels
contained 37.5:1 acrylamide:bis.

35
Determination of DNA Concentrations
DNA concentration were determined by spectrophotometry
in a Beckman DU-70 spectrophotometer outfitted with a micro
cell using e26o = 1.3 x 104 M-1 (per mole bp) as described in
Fried and Crothers (1981).
Generation of Double Strand DNA Oligonucleotides
Double-stranded oligonucleotides were generated by three
different methods. The most common protocol was by the
method of Oliphant et al. (1987) as modified by Scott (1992).
Single-stranded oligonucleotides were synthesized (University
of Florida Interdisciplinary Center for Biotechnology
Research) with the desired sequence flanked by restriction
sites. The restriction site at the 3' end was contained in a
larger (usually 8-10 base pair) palindrome by the addition of
G and C residues. The oligonucleotides were heated in 10 (IL
of 3x Buffer (30 mM Tris [pH 7.5], 150 mM NaCl, 30 mM MgCl2,
15 mM DTT, 0.1 mg/ml) at 37 C for 60 mins, to allow the 3'
ends to self-anneal. The solution was then diluted to 30 |IL
with the addition of 9.5 |i.L of ddH20 and 7.5 of dNTPs (10-
3M) and the 3'-ends were extended with the addition of 2 ^.L
(10 units) of the large fragment of E. coli DNA polymerase
I. The double-stranded extension products were then gel
purified after 8% polyacrylamide (40:1.3 Acrylamide/Bis) gel
electrophoresis (PAGE), digested with appropriate restriction
enzymes, and cloned into the polylinker region of pUC18 or
pUC19 (Messing, 1983). This method was used to generate
double-stranded oligonucleotides from HB61, HB62, HB63, HB64,
HB65, HB66, HB76, HB77, and HB79.

36
In some instances oligonucleotides were made double-
stranded by directly annealing equimolar concentrations of
complementary oligonucleotides. Hybridization of the
oligonucleotides was determined spectrophotometrically by
measuring the change in the hypochromatic shift (Bloomfield
et al., 1974; Eisenberg and Crothers, 1979). Fifty
micrograms of each oligonucleotides were mixed, heated to 100
C for 5 min, and then allowed to slow cool to ambient
temperature. This method was used to generate double-
stranded oligonucleotides from HB09/HB10, and from HB39/HB40
(see Baker, 1991).
Finally, some oligonucleotides were made double-stranded
by annealing a smaller primer to a longer template
oligonucleotide and extending with dNTPs (lO-3 M) in the
presence of the large fragment of E. coli DNA polymerase I at
37 C for 30 min using 3x Buffer (described above) This
method allowed incorporation of the polymerase chain reaction
(PCR) for re-amplification of the template oligonucleotide by
using an additional smaller primer. PCR cycle temperatures
and times were as follows: denaturation, 94 C for 50 sec;
annealing, 50 C for 40 sec; and extension, 72 C for 35 sec.
This method was used to generate double-stranded
oligonucleotides from HB57, HB58, and HB59.
DNA Sequencing
DNA sequencing was carried out by the dideoxy chain
termination method of Sanger (1977) as modified by U.S.
Biochemicals (Cleveland, Ohio) utilizing the Sequenase
enzyme, with the following addition: After plasmids were

37
prepared from 10 ml cultures of E. coli by the alkaline lysis
method (Birnboim and Doley, 1979; Ish-Horowwicz and Burke,
1981) they were further purified by resuspending the total
precipitated DNA from the preparation in 12 8 p.L ddH20. Then
32 |IL of 4 M NaCl and 160 |iL, of 13% polyethylene glycol-8000
(PEG) were added and the solution was mixed well. The
solution was incubated on ice for exactly 20 mins, and then
microcentrifuged for 10 mins, at room temperature. The
pellet was washed with 70% ethanol and then dried under
vacuum. The pellet was resuspended in 75 |iL of TE pH 7.5.
2 5 |1L of this solution was then used in the sequencing method
described by U.S. Biochemicals.
Plasmid Construction
The plasmids used in this study are listed in Table 2.
A number of plasmids which contain CTTCC sequence elements
were constructed. Plasmid pUC66 contains sequence from
UASypj, from positions -317 to -327. This region harbors two
GCRl-binding sites and a RAPl-binding site (Scott, 1992).
Plasmid pUC66 was constructed by cloning the Hindlll-SphI
fragment from plasmid pES119 (Scott, 1992) into the Hindlll-
Sphl sites of pUC18.
Plasmids pUCT61-pUCT79 contain CTTCC sequence elements
from a number of glycolytic and translational machinery
genes. The number of the plasmid refers to the HB
oligonucleotide from which the insert was derived (sequences
are listed in Table 1). After the oligonucleotides were made
double-stranded (described above) 5 |ig of DNA was digested
with Hindlll and BamHI and cloned into the Hindlll-BamHl

38
Table 2. Plasmids
Plasmid
Comments
pHB66
(Baker, 1991)
GCRl structural gene cloned downstream of SP6 promoter
in plasmid pSP19
PSP56RT
(Chambers et al, 1987)
RAP1 structual gene cloned downstream of SP6 promoter
in plasmid pSP19
pMH2
Pstl-Sall fragment of GCRl structural gene cloned into
Pstl-Sall sites of pSP18
pMAL-GCRl(690-844)
malE-GCRl(690-844) fusion gene under tac promoter in
pMAL-c
pMAL-GCRl(783-844)
malE-GCRl(783-844) fusion gene under tac promoter in
pMAL-c
pCDl
malE-GCRl{1-844) fusion gene under tac promoter in
pMAL-c
pCD2
malE-GCRl(277-844) fusion gene under tac promoter in
pMAL-c
pCD3
malE-GCRl(422-844) fusion gene under tac promoter in
pMAL-c
pCD5
malE-GCRl(706-844) fusion gene under tac promoter in
pMAL-c
pUCT61
CTTCC sequence element from TPI1 cloned into Hindlll-
BamHI site of pUC18
pUCT62
CTTCC sequence element from PGK1 cloned into Hindlll-
BamHI site of pUC18
pUCT63
CTTCC sequence element from ADH1 cloned into Hindlll-
BamH.1 site of pUC18
pUCT64
CTTCC sequence element from ENOl cloned into HindIII-
BamHI site of pUC18
pUCT65
CTTCC sequence element from PYK1 cloned into Hindlll-
BamHI site of pUC18

39
Table 2. Plasmids (cont.)
Fibroid Comments
pUCT66
CATCC
sequence element
from
TPI1
cloned
into
Hindlll-
BamHI
site of pUC18
pUCT76
CTTCC
sequence element
from
TEF1
cloned
into
Hindlll-
BamHI
site of pUC18
pUCT77
CTTCC
sequence element
from
TEF1
cloned
into
Hindlll-
BamHI
site of pUC18
pUCT79
CTTCC
sequence element
from
CRY1
cloned
into
HindIII-
BamHI
site of pUC18
pUC66 UASypjj cloned into Hindlll-SphI site of pUC18
pCY4 Circular permutation assay vector
(Prentki et al., 1987)
pCY66 VAStpi1 cloned into Smal-Bglll site of pCY4

40
Table 3. Oligonucleotides containing CTTCC sequences
Oligonucleotide Sequence
LINKER
agcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgatt
UASTPI
agcttAGCTTCCTCTATTGATGTTACACCTGGACACCCCTTTTCTGGCATCCAGTTgcat
TPIlx
agcttGACTTTTCAGCTTCCTCTATTGATGgcatgcggatccccgggtaccgagctcgatt
TPI12
agcttt-TTTTCTGGCATCCAGTTTTTAATgcatgcggatccccgggtaccgagctcgatt
PGK
agcttGACTTCCTGTCTTCCTATTGATTGCgcatgcggatccccgggtaccgagctcgatt
ENOl
agcttCTAATCCGAGCTTCCACTAGGATAGgcatgcggatccccgggtaccgagctcgatt
PYK
agcttAGACATCGGGCTTCCACAATTTTCGgcatgcggatccccgggtaccgagctcgatt
ADH1
agcttACAATATGGACTTCCTCTTTTCTGGgcatgcggatccccgggtaccgagctcgatt

41
sites of pUC18. The inserts of these plasmids, used for
radiolabeled DNA probes in bands shift assays, are listed in
Table 3.
A series of malE::GCRl gene fusions which carry various
deletions of the 5' end of the GCR1 structural gene were
prepared by cloning Gcrlp coding sequences into the plasmid
pMAL-c (Guan et al., 1987; Maina et al., 1988). The plasmid
pMAL-c express the malE gene, which encodes the E. coli
maltose binding protein (MBP), under control of the E. coli
tac promoter (Amann et al., 1983). A polylinker site is
located in the malE structural gene and allows in-frame
insertion of DNA fragments to construct fusion proteins under
a strong inducible promoter. Plasmid pMAL-GCRl(690-844),
which encodes a maltose binding protein (MBP)-Gcrlp fusion
protein containing amino acids 690-844 of Gcrlp, was created
by cloning the Haelll-Xbal fragment from plasmid pMH2 into
the Stul-Xbal sites of plasmid pMAL-c. Plasmid pMH2 contains
the Pstl-Sall genomic fragment of the GCR1 structural gene
cloned into the Pstl-Sall sites of plasmid pSP18.
Plasmid pMAL-GCRl(7 83-844) was created as follows:
Plasmid pMAL-GCRl(690-844) was cleaved with PpmuI. The
resulting overhang was filled in with dNTPs and the large
fragment of E. coli polymerase I. After phenol extraction
and ethanol precipitation the DNA was then cleaved with
Hindlll. The Ppmul-Hindlll fragment was isolated by 8% PAGE
and then cloned in-frame into the Stul-Hindlll sites of
pMAL-c.

42
Plasmids pCDl, pCD2, pCD3, and pCD5 were kindly provided
by Carolyn M. Drazinic. These plasmids code for additional
5'-GCR1 deletions fused in frame with MBP. They contain the
following amino acids residues of GCR1: pCDl, MBP-GCR1(1-
844); pCD2, MBP-GCRl(277-844 ) ; pCD3, MBP-GCR1(422-844) ; pCD5,
MBP-GCR1(706-844).
In Vitro Transcription
Plasmid pHB66 (Baker, 1991) contains the GCR1 structural
gene (from an AflII restriction site located 136 bp 5' to the
translational start site to a Bel I site located 661 bp 3' to
the translational termination site) cloned downstream of the
SP6 promoter in the plasmid pSP19. This plasmid was
linearized with various restriction enzymes. After complete
digestion was confirmed by agarose gel electrophoresis, the
DNA was phenol extracted, ethanol precipitated, and
resuspended in TE. For a translation template for RAP1 the
plasmid pSP56RT (Chambers et al., 1989) was linearized by
cleavages with the restriction endonuclease XbaI, and was
prepared in a similar manner.
Five micrograms of linearized DNA was used as a template
in transcription reactions carried out in the presence of the
cap analog m7G(5')ppp(5')G using a kit from Promega, under the
following reaction conditions: 40 mM Tris [pH 7.5], 6 mM
MgCl2, 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 0.1 mg/ml BSA,
1 mM ATP, CTP, UTP, 0.1 mM GTP, 0.5 mM GpppG and 50 U or
RNasin. After transcription reactions were incubated with
SP6 RNA polymerase at 37 C for 60 min, the samples were
treated with DNase I for 15 min., phenol/chloroform

43
extracted, ethanol precipitated, and then resuspended in 20
|iL of ddH20 and stored at -70 C.
In vitro Translation
In vitro-derived transcripts were translate in a rabbit
reticulocyte lysate system in the presence of L-
[35S] methionine by using a kit obtained from Promega. Two
microliters of substrate RNA (prepared as described above)
was incubated with 18 H.L of nuclease treated rabbit
reticulocyte lysate, 4 |j.L ddH20, 1 HL RNasin (50 U) 0.5 ^.L 1
mM amino acid mixture (minus methionine), and 2.0 p.L of
[35S]methionine. The amount of Gcrlp produced in the rabbit
reticulocyte lysates was estimated by determining the amount
of [35S]-methionine incorporated into trichloroacetic acid-
precipitable material. One microliter of the lysate was
incubated with 50 ^.L of 0.1 N NaOH at 37 C for 15 min and
then added to 1 ml of 10% TCA and placed on ice for 30 min.
Samples were then vacuum filter through filter paper, and
washed with 1 ml of 10% TCA. Filters were then added to 5 ml
of scintillation fluid and counted. Typical in vitro
translation reactions yielded approximately 2.4 ng of GCR1
per |iL of rabbit reticulocyte lysate. The translation
products were analyzed by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE), and the
radiolabeled proteins were visualized by autoradiography at -
70 C and compared with known molecular weight standards.
In Vitro DNase I Protection Assays
GCR1 binding sites in the UASTPI were determined by
DNase I footprints, carried out by a modification of the

44
method of Pfeifer et al. (1987). A 234 bp DNA fragment from
the UAStpj was generated by cleavage of the plasmid pES37
(Scott, 1992) with the restriction endonucleases Hindlll and
SphI. This fragment was then radiolabeled only at the
Hindlll end by filling in with the large fragment of E.coli
DNA polymerase I in the presence of a32P dATP. The DNA probe
was isolated from the plasmid by 8% PAGE. After
visualization of the ethidium bromide stained gel by long
wave UV, the area of the gel containing the DNA probe was
excised, and the DNA extracted from the gel by the DEAE paper
method as described above.
Nucleoprotein complexes were allowed to form under
standard band-shift reaction conditions in a total volume of
20 )i.L, and then various amounts of DNase I (0.2 to 0.5 U)
were added. The reaction mixture was incubated at ambient
temperature for 2 min. The reaction was stopped by the
addition of an equal volume of stop solution (50% glycerol,
0.25 M EDTA [pH 8.0]). The resulting mixture was immediately
loaded onto a native 5% polyacrylamide (49.4:0.6) 0.5 x TBE
gel. Free and complexed DNA were detected by autoradiography
of the wet gel. Bound DNA from both the upper and lower
complexes was cut out of the gel and eluted from the gel by
either soaking overnight at 37 C in 500 mM ammonium acetate-1
mM EDTA or by the DEAE paper method described above. The
eluted DNA was then precipitated, washed with 70% ethanol,
suspended in 10 [iL of loading buffer (95% Formamide, 20 mM
EDTA, 0.05% Bromophenol Blue, and 0.05% Xylene Cyanol FF) ,
boiled for 5 min, and loaded onto a denaturing sequencing

45
gel. Depending on the experiment 10-20,000 counts/min were
loaded per lane.
DNA Band-Shift Assays
Protein-DNA complexes were studied using modifications
of the procedures of Fried and Crothers (1981) and Garner and
Revzin (1981). The binding reactions were incubated for 20
minutes in a 20 (1L volume at ambient temperature in binding
buffer composed of 12 mM HEPES (pH 7.5), 60 mM KCl, 5 mM
MgCl2, 4 mM Tris, 0.6 mM EDTA, 0.6 mM DTT, 10% glycerol, and
0.3 ng/|iL BSA. In some cases poly (dl/dC) was used as a non
specific competitor at 0.2 6 In some case double-
stranded oligonucleotides were used as competitor.
Competitors were diluted and added as a constant volume per
reaction mixture. Protein extracts used in experiments were
diluted with binding buffer. Components were added in the
following order: binding buffer, competitor, probe, protein.
In qualitative experiments, the amount of DNA added was based
upon disintegrations/min, usually between 10-20,000
counts/min. Depending upon the experiment, gels varied
between 5-10% polyacrylamide. Buffers were either TE (0.1 M
Tris [pH 7.5], 5 mM EDTA) or 0.5 TBE (0.05 M Tris [pH 7.5],
0.05 M Boric Acid, 5 mM EDTA). In the case of TE the running
buffer (10 mM Tris [pH 7.5], 1 mM EDTA) was recirculated.
All gels were pre-run for at least 1.5 hours at 100 volts.
Samples were applied to the running gel. After all samples
were loaded the voltage was increased to 150 volts and the
gels were run until the adequate separation desired (based on
pilot experiments).

46
Titration of DNA-Bindina Activity
DNA-binding activity of MBP-Gcrlp(690-844) was
determined by band shift assay using the approach of Riggs et
al. (1970) and Chadwick et al. (1970). A constant amount of
purified MBP-Gcrlp(690-844) fusion protein was titrated with
increasing amounts of radiolabeled DNA containing a Gcrlp-
binding site. Free and bound complexes were then separated
by a standard band shift assay. The amount of DNA used was
accurately determined by spectrophotometry. The amount of
DNA that was shifted was determined by using phospholmager
analysis (Molecular Dynamics). Thus, the amount of DNA in
the shifted complex was determined by comparison to a
standard curve of known concentrations of DNA. From this
analysis the amount of DNA retained at plateau is a measure
of total concentration of active protein in terms of DNA
concentration.
Calculation of Equilibrium Binding Constant
DNA-binding affinity was determined by band shift assay
using the analysis of Riggs et al. (197 0) and Chadwick et al.
(1970). A known amount of DNA was radiolabeled and allowed
to bind to varying concentrations of active MBP-Gcrlp. Free
DNA was separated from nucleoprotein complexes by native gel
electrophoresis. Gels were dried to Whatman paper and then
counts were determined by use of a Phospholmager (Molecular
Dynamics). By holding DNA concentrations below the estimated
Kd (determined from pilot experiments), the apparent Kd could
be determined by the amount of protein added when the counts
of free DNA equalled the counts in the nucleoprotein complex.

RESULTS
The world is a construct of our sensations, percep
tions, memories. It is convenient to regard it as
existing objectively on its own. But it certainly
does not become manifest by its mere existence.
Erwin Schrodinger (p.l)
Previous experiments had suggested that the product of
GCRl interacts directly with the CTTCC sequence element
(Baker, 1991). In those experiments, RNA was translated in
vitro to make the Gcrlp protein in rabbit reticulocyte
lysates. The lysate was used in band shift assays with DNA
fragments containing the CTTCC sequence element.
Additionally, when anti-Gcrlp antibody was included in the
reaction mixture a supershift was observed (Baker, 1991).
These experiments strongly supported the view that Gcrlp is
DNA-binding protein; however, alternative models could not
totally be excluded. For example, since CTTCC sequence
elements had been described in the promoters of higher
eukaroytes it was possible that the Gcrlp could associated
with and modify another factor in the lysate stimulating a
protein complex which included Gcrlp to bind to UASTPi DNA.
For example, the product of the retinoblastoma gene displays
DNA-binding activity when complexed to the factor EF2
(Chittenden et al., 1993; Ray et al., 1992; Ouellette et al.
1992). Alternatively, it could be argued that the GCRl gene
product allosterically modified another protein unleashing

48
binding activity of the complex. If this were the case, then
Gcrlp would be included in the complex--based on the
supershift experiments. This study set out to confirm that
Gcrlp interacts directly with DNA in a sequence-specific
manner.
Gcrlp Expressed in E, coil or Rabbit Reticulocyte
Lvsate Binds to DNA
Throughout the course of this study Gcrlp, synthesized
in vitro from rabbit reticulocyte lysates and MBP-Gcrlp
fusion protein, expressed in E. coli, were used to
characterize the DNA binding activity of Gcrlp.
MBP-Gcrlp full-length fusion protein was produced in E.
coli strain TB1 harboring a plasmid encoding for a
malE::GCR1(1-844) gene fusions under the tac promoter. The
fusion protein was induced in E. coli by the addition of 2 mM
IPTG during the log phase of growth. Cell were then lysed by
passage through a French Pressure cell. Protein extracts
were analyzed by SDS-PAGE stained with Coomassie blue (data
not shown). Protein concentration, pre-determined by the
method of Bradford (1976), ranged from 0.068 to 0.2 mg/ml.
The amount of extract used in band shift assays varied
depending on the preparation. Typically between 3 and 15
microliters were used in band shift assays. The volume used
was determined by titrating DNA-binding activity. It was
noted that if extracts were used immediately less volume was
necessary to detect binding. If extract was used after
overnight storage at -20 C then a larger volume was necessary
for detectable activity (data not shown). This was

49
presumably due to instability of full-length Gcrlp in the
extracts.
The DNA probe used for the band-shift assay was the
upstream activating sequence (UAS) of the gene encoding
triose-phosphate isomerase (TPI1). Plasmid pES119 (Scott,
1992) containing the UASTPJi, was digested with the
restriction endonucleases Sphl and Hindlll liberating a 60
base pair fragment containing UASTPx from positions -377 to -
327 relative to the start of translation. The fragment was
then radiolabeled at the Hindlll site.
As seen in Figure 1, both Gcrlp synthesized in vitro and
the full length MBP-Gcrlp fusion protein were able to form
nucleoprotein complexes with DNA carrying UASTPIi. The
position of the nucleoprotein complexes observed with the
fusion protein migrate more slowly than the complexes
observed with rabbit reticulocyte lysate containing Gcrlp
(Figure 1) This difference is presumably due to the
increase in molecular weight of the nucleoprotein complex due
to the presence of the maltose binding moiety of the fusion
protein. This is consistent with the notion that Gcrlp
interacts directly with UASTPJI. The appearance of two
shifted bands in the band shift assay with Gcrlp and its
derivatives was routinely observed and had been noted
previously (Baker, 1991) It has also recently been shown
that Gcrlp synthesized in yeast also results in two shifted
complexes in the band shift assay (Willett et al., 1993).
The reason for two bands is currently unknown. Figure 1 also
shows that no nucleoprotein complexes were observed with

Figure 1. Comparison of DNA-binding activity of Gcrlp and
hybrid MBP-Gcrlp fusion protein. DNA band-shift assays were
carried out with a radiolabeled fragment of DNA carrying
UASt-pu (see Table 3. for sequence). The radiolabeled DNA was
incubated in binding buffer with protein extract indicated
above the lanes as described in Material and Methods.
Fragment alone, radiolabeled DNA fragment; No RNA RRL, 5 nl
of untreated rabbit reticulocyte lysate (RRL); Gcrlp RRL, 5
p.1 of rabbit reticulocyte lysate containing in vitro
synthesized Gcrlp; E. coli/pMAL-cRl Uninduced, 1 M-l of an
extract of a E. coli culture harboring plasmid pMAL-cRl; E.
col i /pMAL-cRl Induced, 1 |il of an extract of a E. coli
culture harboring plasmid pMAL-cRl which had been induced
with IPTG 2 h prior to harvest; E. coIi/pMAL-Gcrlp (1-844)
Uninduced, 1 |il of an extract of a E. coli culture harboring
plasmid pMAL-Gcrlp(1-844) (numbers in parentheses denote
amino acid residues of Gcrlp present in the expressed
polypeptide, see Table 2.); E. coli/pMAL-Gcrlp (1-844)
Induced, 1 ^.1 of an extract of a E. coli culture harboring
plasmid pMAL-Gcrlp(1-844) which had been induced with IPTG 2
h prior to harvest; f, free unbound probe.

I
Frag, alone
NO RNA RRL
Gcrlp RRL
£.coli/pMAL-cRl Uninduced
E.coli/pMAL-cRl Induced
E. coli/pMAL-Gcrlp(1-844) Uninduced
E. coli/pMAL-Gcrlp(1-844) Induced

52
untranslated rabbit reticulocyte lysates, E. coli extracts
prepared from uninduced and induced cultures of strains
carrying the parent plasmid, pMAL-cRl, and extracts prepared
from uninduced cultures of E. coli strains carrying the
malE::GCR1 gene fusion.
The DNA-Bindino Domain of Gcrlp Resides within the Carboxv-
Terminal 154 Amino Acid Residues
To map the DNA-binding domain of Gcrlp a series of DNA
band-shift experiments with truncated versions of Gcrlp were
performed. Carboxy-terminal truncations of Gcrlp were
synthesized in vitro. Plasmid pHB66 was linearized with a
series of restriction endonucleases that cleaved within the
GCRl structural gene as shown in Figure 2. The linearized
constructs were then used as templates for in vitro RNA
synthesis, and run off transcripts were translated in vitro
using rabbit reticulocyte lysates. Production of poly
peptides of the desired molecular mass was confirmed by SDS-
PAGE and autoradiography (Figure 3). The rabbit reticulocyte
lysates were then used in a series of band-shift experiments
to determine which, if any, of the truncated fusion-proteins
had DNA-binding activity. Figure 4 shows that only full
length Gcrlp had binding activity. This suggested that the
DNA-binding domain resided in the carboxy terminus of the
polypeptide.
To test this possibility, a similar set of experiments
with an amino-terminal deletion series was carried out. For
these experiments, plasmids pCDl, pCD2, pCD3, and pCD5
(coding for various gene fusions--see Material and Methods)

GCR1
I i
Hindlll Seal
I I
Sphl Haelll
TAA
Sail
1 -844
1 -890
1-594
1 -431
1-229
Figure 2. Templates used to generate carboxy-terminal deletions of Gcrlp.
A schematic representation of the GCRl structuaral gene cloned downstream
of the SP6 promoter is displayed. Digestion of the construct with the various
enzymes shown produce RNA templates coding for polypeptides of the length
display below (numbers refer to amino acids residues of Gcrlp).

Figure 3. Carboxy-terminal truncation polypeptides of Gcrlp.
Autoradiography of a 10% SDS-polyacrylamide gel
electrophoresis of polypeptides produced by in vitro
translation of the RNA templates (displayed in Figure 2)
using rabbit reticulocyte lysate (RRL). Polypeptides were
translated in vitro in the presence of 35S-methionine. The
numbers correspond to amino acids residues of Gcrlp.
Molecular weight standards, in kiloDaltons, are as follows:
myosin H-chain, 200,000; phosphorylase b, 97,000; bovine
serum albumen 68,000; ovalbumin, 43,000; carbonic anhydrase,
29,000; P-lactoglobulin, 18,000.

43,000
68,000
to
U3 o
"J O
tt O
O o
NO RNA
RRL
Gcrlp
(1-844)
RRL
Gcrlp
(1-690)
RRL
Gcrlp
(1-594)
RRL
Gcrlp
(1-431)
RRL
Gcrlp
(1-229)
RRL
Ul
cn

56
a
a
a
a
a
pi
Pi
Pi
pi
Pi
Pi
DC
PC
Pi
Pi
, ,
O
1
cn
0)
(T\
ro
oq
c
a
00
UD
LD
CN
o
cx;
|
1
1
1
1
ii
Pi
x1
\1
*1
\1
rH
' '
'
a
'

Q
&
a
a
tn
Ph
X1
rH
tt
*i
u
U
u
Sh
u
u
o
u
u
V
o
u
tu
s
O
o

o
o
U
Figure 4. DNA-binding activity of Gcrlp carboxy-terminal deletion
polypeptides. A typical DNA band-shift assay using the in vitro
synthesized Gcrlp carboxy-terminal deletion series is shown. The
numbers in parentheses denote the amino acid residues of Gcrlp
expressed in the rabbit reticulocyte lysates (RRL). Five
microliters of each rabbit reticulocyte lysate was used in the
assays.

57
were provided by Carolyn Drazinic. These plasmids contain
subgenic portions of GCR1 fused in-frame to malE in the
fusion vector pMAL-cRl (see Figure 5) E. coli lysates from
induced strains harboring the malE::GCRl gene fusions were
prepared. Production of MBP-Gcrlp hybrid polypeptide of the
desired molecular mass was confirmed by SDS-PAGE and the
fusion-protein visualized by coomassie blue staining (data
not shown). In general, there was an inverse correlation
between the size of the fusion polypeptide and the amount of
material observed. E. coli lysates containing hybrid MBP-
Gcrlp polypeptide were then tested in DNA-band-shift assays
(Figure 6). All constructs that carried the carboxy-terminal
154 amino acid residues of Gcrlp were able to bind to the
upstream activating sequence of TPIl. Whereas lysates from
strains expressing fusion protein carrying the carboxy-
terminal 138 amino acids of Gcrlp were unable to bind the DNA
fragment used in the study.
A summary of the mapping data is shown in Figure 7.
From these results it was concluded that the DNA-binding
domain of Gcrlp resides somewhere within the carboxy-terminal
154 amino acids of Gcrlp.
DNase I Footprint Analysis of UASrpr
To establish that Gcrlp indeed bound to the CTTCC
sequence element, in vitro DNase I footprinting experiments
were performed. For these experiments purified preparations
of the smallest fusion protein which retained DNA-binding
activity, MBP-Gcrlp(690-844), were used. The smaller fusion
proteins were more stable and could be produced in larger

CO
in
MBP-Gcrlp
9
1-844
277-844
422-844
690-844
706-844
783-844
Figure 5. malE::GCRl gene fusions products. A schematic representation of the Gcrlp
polypeptides used in the amino-terminal deletion studies. The stippled lines indicate
maltose-binding protein moiety carried in the fusion proteins. Numbers indicate amino acid
residues of Gcrlp conatained in the fusion proteins

59
Figure 6. DNA-binding activity of MBP-Gcrlp hybrid proteins.
A DNA band-shift assay using a Gcrlp amino-terminal deletion
series of hybrid MBP-Gcrlp fusion proteins is displayed. One
microliter of an extract of the induced E. coli culture,
indicated above each lane, was added to the standard band-
shift reaction mixture, as described in the legend to Figure
1.

Frag, alone
pMAL cRl
pMAL-Gcrlp(1-844)
pMAL-Gcrlp(277-844)
pMAL-Gcrlp(422-844)
pMAL-Gcrlp(690-844)
pMAL-Gcrlp(706-844)
pMAL-Gcrlp(783-844)

Gcrlp
Region DNA
of binding
GCR1 activity
1-844
1-690
1-594
1-431
1-229
MBP-Gcrlp
1-844
277-844
422-844
690-844
706-844
783-844
+
+
+
+
Figure 7. Summary of data mapping the Gcrlp DNA-binding domain. The figure is a schematic representation
of the Gcrlp polypeptides used in the mapping study and summary of results obtained. Solid lines represent
regions of Gcrlp carried in the polypeptide. The stippled lines indicate maltose-binding protein moiety
carried in the fusion protein.

62
quantity. The stability of the MBP-Gcrlp(690-844) protein
also allowed for its purification. The fusion protein was
purified as described in Material and Methods. A 234 base-
pair DNA fragment from the UASTPI1 was generated by cleavage
of the plasmid pES37 (Scott, 1992) with the restriction
endonucleases SphI and HinduI. The fragment was
radiolabeled at the Hindlll site. Nucleoprotein complexes
were allowed to form under standard band shift reaction
conditions after which DNase I was added to the mixture.
Reactions were terminated by inhibiting DNase I with high
concentrations of EDTA, and then the samples were immediately
run into a non-denaturing acrylamide gel. Complexes were
identified by autoradiography and purified from the gel. The
nicked DNA was then transferred to DEAE paper using
electrophoresis. DNA was eluted with high-salt buffer and
then isolated by phenol extraction and ethanol precipitation.
The DNA was then denatured and run on a sequencing gel. A
DNA fragment incubated without protein was digested with
DNase I to generate a control ladder. Figure 8 shows the
results of the DNase I protection studies using purified MBP-
Gcrlp ( 690-844 ) fusion-protein. Two areas of protection were
observed: one clear area of protection centered over the
CTTCC motif and another area of partial protection centered
over the related sequence CATCC. Edward Scott has shown that
both of these sequences are protected in vivo in a GCR1-
dependent manner by in vivo G methylation protection
experiments (Huie et al., 1992; Scott, 1992; Scott and Baker,
1993 ) .

Figure 8. Gcrlp DNA-binding domain protects the CTTCC
sequence motif and a related sequence element, CATCC, in
UAS tpii from DNase I cleavage. Analysis of UASTPI_¡ was carried
out with purified MBP-Gcrlp (690-844) and a radiolabeled 234-
bp fragment carrying the UAS of TPI1. Lanes T, G, C, and A,
are the products of the dideoxy sequencing reactions of
Ml3mpl8 and serve as molecular weight standards; lanes 1 and
4, free fragment treated with DNase I; lane 2, nucleoprotein
complex treated with 0.2 U of DNase I, as described in
Material and Methods; lane 3, nucleoprotein complex treated
with 0.5 U DN ase I. The sequences of protected areas are
denoted on the right. The exact extent of the area protected
over the CTTCC sequence element could not be determined
because of lack of bands in the control lanes (lanes 1 and
4); therefore, two 5' boundaries are indicated on the figure.

VO
.C-1110V001V0091011- .9 1V101001109V011110V9VV1- ,9
)
I
)) 1
U. i i
** M
j ni mi j m
0hk n ttt i i m 4
-mmm \\m n mn
t MHBlffiia I in HHli mi<| t
i m>B i
' I
it ti 11
II ft
I) )fc ft
i I I
I I
< i
I I I
i I
II ti |i I
# |i ( #
M (
ll II §1 I I
4
|

65
Identification of a Consensus Gcrlp DNA Binding Sequence
Before this study, demonstration of the DNA-binding
activity of Gcrlp had utilized only DNA carrying sequence
from the TPI1 UAS element. In an effort to define a
consensus Gcrlp-binding site, DNA was synthesized with the
putative Gcrlp-binding sites found in front of a number of
other genes encoding glycolytic enzymes, namely PGK1, EN01,
PYK1, and ADH1. These sequences were chosen for the
following reasons. There are three CTTCC sequence elements
important for expression of PGK1 (Chambers et al., 1988).
One of these elements was arbitrarily chosen for study. The
CTTCC elements from EN01 and PYK1 were chosen because there
is genetic evidence that shows they are important
determinants of their respective UAS elements (Buchman et
al., 1988). It was predicted that the CTTCC element found
adjacent to the RAPl-binding site in the ADH1 promoter would
likely bind Gcrlp; therefore it was tested it for its
ability to bind Gcrlp. In addition, the two putative Gcrlp-
binding sites in UAStpi (determined from the DNase I
footprinting experiments) were tested individually.
Oligonucleotides were synthesized which carried 25
nucleotides from the genes of interest with the CTTCC motif
under study located at the center of each oligonucleotide.
Table 3 shows the sequence of the oligonucleotides used as
probes in this study. Due to the relative positions of the
elements in UASPGX, the oligonucleotide carrying the PGK
sequence contained two CTTCC sequence elements. The CTTCC
sequence that is displayed in enlarged type from the PGK1

66
sequence listed in Table 3 has recently been shown to be
protected in wild-type strains and deprotected in a gcrl null
mutant by in vivo footprinting (Stanway et al.,1994). The
oligonucleotides were then tested for their ability to
interact with the DNA-binding domain of Gcrlp in a series of
DNA-band-shift assays. As a negative control the polylinker
from pUCl8 was used in the band shift assays. The results of
the band shift assays are shown in Figure 9. The appearance
of shifted bands were not detected when the polylinker from
pUC18 was used as probe. On the other hand, each of the
putative Gcrlp-binding sites gave rise to the appearance of
shifted bands, thus providing evidence that Gcrlp is capable
of interacting with these sequences. Additionally, the UAS
of CYC1, which does not contain a CTTCC sequence element and
is not under control of GCR1, also did not form a nucleo-
protein complex with Gcrlp (data not shown).
The expression of the genes encoding elongation factor
EF-la (TEF1 and TEF2) and ribosomal protein 59 (CRYl) is
reduced two- to four-fold in gcrl mutant strains (Santangelo
and Tornow, 1990). Potential Gcrlp-binding sites were
identified located in the 5' noncoding region of these genes.
A model was entertained that Gcrlp played a direct role in
expression of these genes at the transcriptional level.
Therefore, oligonucleotides which carried 25 nucleotides
containing the CTTCC motif from the genes of interest were
synthesized. These oligonucleotides were also tested by DNA-
band-shif t assay for their ability to interact with the DNA-
binding domain of Gcrlp. None of the oligonucleotides bound

LINKER UAStpj TP\ TP I PGK ENOI PYK ADH1
n 71 n 71 r 71 n Tin 71 r 71 r 71 n 71
I k I I V
M
Figure 9. Gcrlp DNA-binding domain binds to CTTCC sequence elements found in front of other
glycolytic genes. DNA band-shift analysis was carried out with purified MBP-Gcrlp (690-844)
and the radiolabeled oligonucleotides listed in Table 3. The absence (-) and presence ( + )
on 10 ng of MBP-Gcrlp fusion protein in the DNA band-shift assay are indicated above each
lane.
CTl

68
DNA with greater affinity than the polylinker of pUC18 (data
not shown).
From the results of the band-shift experiments the
following consensus DNA-binding sequence for Gcrlp was
derived (see Discussion):
(T/A)N(T/C)N(G/A)N C (T/A) T C C (T/A)N(T/A) (T/A) (T/G)
The Gcrlp-DNA Nucleoprotein Complex
Having defined the DNA-binding domain of Gcrlp, and a
consensus DNA-binding site which it recognizes, I set out to
characterize the affinity and specificity of the Gcrlp
interaction with its binding site. Historically, it had been
very difficult to demonstrate that Gcrlp was a DNA-binding
protein. During the period between sequencing of the gene
(Baker, 1986) and the demonstration of the binding activity
of it product (Baker, 1991) many laboratories had attempted
to demonstrate Gcrlp DNA-binding activity, yet failed. It
was therefore reasoned that Gcrlp may have a low affinity for
its DNA site, and that it may be facilitated to bind DNA by
other proteins. To test this I measured the binding affinity
of Gcrlp for its target site.
The DNA-binding affinity of the Gcrlp-binding domain
Experience working with the Gcrlp protein revealed that
the full-length protein is very unstable. This seems to be
the case whether the product is translated in vitro in rabbit
reticulocyte lysate or whether it is expressed in E. coli.
Full-length in vitro translated product must be used
immediately for detectable activity. Similarly, the full
length MBP-Gcrlp(1-844) fusion-protein must be used

69
immediately. This rapid decrease in activity made it
extremely difficult to use full-length Gcrlp in experiments
were the active protein concentration needs to be accurately
known, or in experiments in which the protein must be of a
fixed concentration over time. However, truncated MBP-Gcrlp
fusion-proteins including the Gcrlp DNA-binding domain has
proven to be very stable, especially when stored at high
concentration. I do not detect a noticeable loss of activity
over months of storage at -70 C. This allowed me to measure
the binding affinity of the DNA-binding domain. Fusion-
proteins have been used to measure the DNA binding affinity
of other proteins (Desplan et al., 1985; Johnson and
Herskorwitz, 1985; Giese et al., 1991).
A single Gcrlp-binding site from the UAS of the triose-
phosphate isomerase gene was used in these experiments. The
site is listed as TPIx in Table 3, and, as mentioned above, it
has been shown to be protected in a GCRl-dependent manner in
vivo (Huie et al., 1992; Scott, 1992). The concentration of
the radiolabeled, gel-purified probe was determined by
spectrophotometry.
Purified hybrid MBP-Gcrlp(690-844) fusion protein was
used for these experiments. Active protein concentration was
determined by the methods described by Riggs et al. (1970)
and Chadwick et al. (1970), except that band-shift assays
were used instead of DNA filter-binding assays. The protein
concentration was held constant, using 1 (iL of a 1:1000
dilution of the stock solution, and increasing amounts of
radiolabeled DNA was added. The concentration of the stock

70
solution of protein was 0.35 |ig/|i.L as determined by the
method of Bradford (1976). After complexes were allowed to
form, the reaction mixtures were run into a 0.5 x TBE 5%
native PAGE. The gels were dried on the Whatman paper, and
then the separated radiolabeled DNA was quantitated with a
Phospholmager (Molecular Dynamics). The fraction of DNA
shifted by protein was determined. At saturating conditions,
all of the active protein was bound to the DNA. Since the
concentration and specific activity of the DNA in the complex
was known, the concentration of the complex was determined by
quantitating the amount of DNA complexed. The active protein
concentration therefore was expressed in DNA equivalents per
volume (see Chadwick et al., 1970). A typical experiment is
shown in Figure 10. In two independent experiments the
active protein concentration of the stock was determined to
be 1 x 10~6 M. The active fraction was approximated to be 16%
of the total protein concentration.
Pilot experiments were performed to estimate the
dissociation constant of DNA-binding domain of Gcrlp from its
recognition site. With the protein activity known, an
arbitrary small concentration of DNA was held constant at 1.2
x 10-10 M and increasing concentrations of the protein were
added. The concentration at which one-half of the DNA was
bound was used to estimate the binding affinity. The
dissociation constant was estimated to be in the 10*10 M
range. Therefore, the DNA concentration was maintained below
this approximated dissociation constant. DNA concentrations
of 6.3 x 10~12 M, 1.9 x 10'11 M, and 5.5 x 1C)-11 M were used in

Figure 10. Titration of Gcrlp DNA-binding activity. The
concentration of active MBP-Gcrlp(690-844) fusion-protein was
determined by titrating increasing concentrations of radio-
labeled oligonucleotide carrying a single Gcrlp-binding site
(probe TPIlf listed in Table 3.) with a constant amount of
MBP-Gcrlp(690-844) A typical experiment is shown here. As
the amount of DNA was increased all of the active protein
appeared in the bound DNA (shifted) fraction. The amount of
DNA at plateau was determined by comparison to DNA standards
using a Phospholmager (Molecular Dynamics). Active protein
concentrations were thus expressed in DNA equivalents (see
Chadwick et al., 1970).

72

73
different experiments. Under these condition the Kd could
easily be determined by the amount of active protein needed
to occupy half the DNA binding sites (see Riggs et al.( 1970
and Johnson et al., 1979). This follows from the fact that
starting with the equations,
protein-DNA <-> proteinfree + DNAfree,
Kd = [proteinfree] [DNAfree] / [protein-DNA]
and,
DNA^otai DNAfree + DNAdound
it can be shown that,
Kd = [protein] i/2 1/2 [DNAcocal]
where [protein] 1/2 is the concentration of protein when
[DNAfree] equals [DNAbound] (Riggs et al., 1970). Therefore
when [DNAforai] is much less than Kd the [protein] 1/2 gives a
good estimate of the Kd.
A typical titration experiment is shown in Figure 11. A
graphical representation of the date is displayed in Figure
12. Following the example of Letovsky and Dynan (1989), the
total shifted complexes were considered bound complexes and
were combined in determining the Kd. Quantitatively, the
assay was essentially treated as a filter binding experiment
(see Letovsky and Dynan, 1989) From these experiments the
calculated apparent Kd of the Gcrlp DNA-binding domain with
its recognition site was 2.9 x 10~10 M.
At higher protein concentration additional bands
appeared with decreased electrophoretic mobility (Figure 11,
lanes 15-19) At concentrations above 20 nM all the

Figure 11. Determination of Gcrlp DNA-binding domain binding
affinity. A single Gcrlp binding site (probe TPIX in Table
3.) was radiolabelled and held at a concentration of 1.9x10-
iiM. Increasing amounts of purified MBP-Gcrlp(6900-844)
fusion-protein were incubated with the DNA probe. Samples
were run into a 5 percent non-denaturing fel as described in
Material and Methods. Numbers above the lanes represents the
concentration of the DNA-binding activiy.

MwwMumwn
w w
voa>u>tOoto---*-oooo
oo en o
^ w h i tovDO>uvocn ej o
W OI X dxjoo-daw

76
Figure 12. Graphical representation of binding affinity.
The ratio of DNAbound/DNAtotai is plotted against increaseing
concentration of MBP-Gcrlp(690-844) Quantitation of data
from Figure 11. was achieved by the use of a phospolmager
(Molecular Dynamics). The appearant Kd of the MBP-Gcrlp-DNA
interaction corresponds to the concentration of active
protein when DNAbound/DNAtota! is 0.5 (Riggs et al., 1970).

77
complexes were in the higher bands (data not shown).
Specificity of the Gcrlp DNA-Binding Domain
The results of the binding affinity studies showed that
Gcrlp had a higher affinity for DNA than had been expected.
Since nonspecific DNA-binding appeared to occur at less than
100-fold of the measured Kd, this suggested that the
difficulty in demonstrating DNA-binding activity may have
been due to a low specificity of binding. Specificity of
binding is defined as the ratio of binding to a known binding
site compared to binding to a random sequence of DNA
(Affolter et al., 1990; Giese et al., 1991; Ferrari et al.f
1992). Most assays for Gcrlp binding did not use purified
Gcrlp (Baker, personal communication) and therefore poly
dl/dC DNA was used as an competitor of nonspecific binding.
It was possible, that if Gcrlp had a low specificity, this
could mask the binding of Gcrlp. To test this I next set out
to determine the specificity of binding of the Gcrlp DNA-
binding domain to its recognition site.
To measure the specificity of Gcrlp for its high-
affinity binding site in UAS^pj-j a series of competition
experiments were performed. Competition experiments were
performed with either specific DNA containing a known Gcrlp-
binding site, or nonspecific DNA containing random DNA. The
specific competitor, containing a Gcrlp-binding site, was
made by annealing the complementary oligonucleotides HB39 and
HB40 (see Table 1) The nonspecific competitor was made by
extending oligonucleotide HB57 with HB58 (see Table 1). This
DNA contained a random sequence at its core. A typical

78
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
UMUWk.
f y. ft ft
Figure 13. Competition experiment using specific competitor.
DNA band-shift experiments were performed as described in Material
and Methods. Radiolabeled DNA probe and purified MBP-Gcrlp(690-844)
were held constant and increasing amounts of specific competitor
were added to mixtures.

79
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
Figure 14. Competition experiment using non-specific competitor.
DNA band-shift experiments were performed as described in Material
and Methods. Radiolabeled DNA probe and purified MBP-Gcrlp(690-844)
were held constant and increasing amounts of specific competitor
were added to mixtures.

80
Figure 15. Graphical representation of competition
experiments. Amount of competitor added (in nanograms) is
depicted on horizontal axis. Specific competitor is
represented by open circles; non-specific competitor is
represented by closed circles. Vertical axis is ratio of DNA
shifted with competitor against no competitor.

81
experiment is shown in Figure 13. An increasing amount of
unlabeled competitor DNA containing a known Gcrlp-binding
site was incubated with fixed concentrations of radiolabeled
DNA and fusion-protein. In Figure 14 an increasing amount of
unlabelled DNA containing random sequence was used as
competitor. A graphical representation of these experiments
is presented in Figure 15. From these experiments the
difference in the amount of competitor necessary for
competition of one-half binding is approximately 33-fold.
Bending of DNA in the Gcrlp-DNA Nucleoprotein Complex
Over the last few years a growing number of regulatory
proteins which bind to DNA have been shown to induce bending
of DNA. X-ray crystallographic data clearly reveals that the
physical structure of DNA is contorted when bound to some of
the best characterized transcriptional factors. For example,
as determined by 3 angstrom resolution, the catabolite
activator protein (CAP) induces a 90 degree bend in DNA by
forming two 40 degree kinks around the dimeric protein
(Schultz et al., 1991) An increasing body of literature has
revealed that DNA bending plays an important role in
transcriptional regulation, as well as control of replication
(Williams et al., 1988; Doepsel and Khan, 1986; Zahn and
Blattner, 1985; Mukherjee et al., 1985; Ryder et al., 1986;
Snyder et al., 1986) and recombination (Better et al., 1982).
Protein-induced DNA bending can be detected easily by
polyacrylamide gel electrophoresis (Calladine et al., 1991),
and a technique to detect, map, and measure the extent of
bending has been developed (reviewed in Crothers et al. ,

82
1991) The technique, called comparative electrophoresis
circular permutation assay, exploits the finding that when a
protein is bound to DNA the shape of the DNA affects the
mobility of the nucleoprotein complex to a large degree in
nondenaturing gel electrophoresis (Wu and Crothers, 1984).
The strategy is illustrated in Figure 16. By varying the
position of the DNA-binding site along a DNA fragment of
constant length, differing shapes of the nucleoprotein can
form with corresponding degrees of electrophoretic
mobilities. This is usually achieved by cloning the DNA-
binding sequence into the middle of a tandem dimer containing
multiple restriction sites in a specially design vector.
After cleaving with the different enzymes, fragments of equal
size but with the binding site in different positions are
prepared as probes for DNA band-shift assays.
As mentioned earlier, known Gcrlp- and Rapl-binding
sites are juxtaposed in the UAS of the glycolytic genes.
Raplp has been shown to bend its DNA recognition site in the
UAS of the rpg-1 gene (Vignais and Sentenac, 1989) In vivo
Edward Scott has shown that the Raplp-binding site is
occupied in the absence of Gcrlp (Huie et al., 1992; Scott
and Baker, 1993) Therefore, it was reasoned that the DNA-
binding site recognized by Gcrlp in vivo may be in a bent
state. If this is the case, then the true substrate for
Gcrlp-binding may in fact be bent DNA. Kahn and Crothers
(1992) have shown that the affinity of CAP for bent DNA is
200-fold greater than for linear DNA. If the target of Gcrlp

83
B
Figure 16. Circular permutaticr. assay for determination of DNA bending
A) A cloned tandem dimer is cleaved with a series of restriction enzymes
generating probes of equal length but with varing DNA-binding site
postitions. B) When a protein binds to a site in the middle of the
fragment, producing a bend in tr.e center, the DNA is contorted to a lower
electrophoretic mobility form. When a protein binds to a site near the
end of the fragment, the DNA is less cotcrted producing a fragment with
higher electrophoretic mobility (Figure based or. Crothers et al, 1991 and
Prentki et al., 1987).

84
is bent DNA, then it can be detected by the circular
permutation assay.
I set out to test first if Raplp also bends DNA when
bound to its binding-site in the UAS of a glycolytic gene.
Raplp was translated in rabbit reticulocyte lysates and
incubated with radiolabeled DNA from UASTpii (a schematic of
the probe is shown in Figure 17.) under standard band-shift
assay conditions. Samples were then run on a 5% TE non
denaturing PAGE which had been pre-run for 1.5 hours.
Results are shown in Figure 18. When the Raplp-binding site
is located in the middle of the DNA fragment (restriction
endonucleases EcoRV and Nhel) the mobility is decreased
relative to the fragments containing the Raplp-binding site
at the ends of the fragments (restriction endonucleases EcoRI
and BamHI) This result is consistent with Raplp-inducing
DNA bending.
The purified MBP-Gcrlp(690-844) fusion protein was used
to assay if the Gcrplp DNA-binding domain bends DNA in the
nucleoprotein complex. Protein was incubated with
radiolabeled DNA under standard DNA band-shift assay
conditions. Samples were then run into a 10% nondenaturing
0.5 x TBE PAG which had been pre-run for 1.5 hours. The
results are shown in Figure 19. When the Gcrlp-binding site
is located in the middle of the fragment (restriction
endonucleases EcoRV and Nhel) the mobility is decreased
relative to the fragments containing the Gcrlp-binding site
at the ends of the fragments (restriction endonucleases EcoRI
and BamHI). These results are consistent with the notion

m
CO
EcoRl HindQI
EcoRV Nhel
BamHl EcoRl HindlH
ft=EZZ2rH
EcoRV Nhel
I
r I///J
T
1 YJ/.A
1ZZZT
CZZEZZ
T
d ..LV/J J
Figure 17. Schematic representation of the probes used in the circular permutation assay. The
box represents the DNA fragment cloned into vector pCY4. Hatched segement represents sequence
corresponding to the UAS of TPI1 (see Table 3.). Digestion with the indicated enzymes produce
fragment of the same molecular weight with the UAS of TPI1 in varying positions. Arrow head
signifies the center of the probe.
BamHl

86
FcoRl HindIII EcoRV Nhe 1 BamHl
rapi: r- n rn rn rn r:
Figure 18. DNA is bent in the Raplp-DNA nucleoprotein complex.
Circular permutation assay was performed as described in
Material and Methods. Schematic of the DNA probes used in
this assay is shown in Figure 17. Two microliters of Raplp
polypeptide translated in rabbit reliculocyte lysates were
incubated with radiolabed probes and then run into a 5 per
cent non-denaturing polyacrlamide gel. (+) represents addition
of Raplp; (-) absence of Raplp. f, free probe. Enzymes
listed above lanes indicates probes shown in Figure 17.

87
EcoRl Hindi 11 EcoRV Nhel BairiHl
MBP-Gcrip: r-n n i +1 n~ i +1
Figure 19. DNA is bent in the Gcrlp-DNA nucleoprotein
complex. Circular permutation assay was performed as
described in Material and Methods. Schematic of the DNA
probes used in this assay is shown in Figure 17. One
microliters of purified MBP-Gcrip(690-844) fusion-protein
were incubated with radiolabed probes and then run into a 5
per cent non-denaturing polyacrlamide gel. (+) represents
addition of MBP-Gcrip(690-844); (-), absence of MBP-Gcrip
(690-844). f, free probe. Enzymes listed above lanes
indicates probes shown in Figure 17.

88
that Gcrlp does indeed contort the DNA when bound, or that
bent DNA is a more favorable target for Gcrlp (see
Discussion).

DISCUSSION
For skepticism is this: that an unknown quantity,
some x, can explain everything. But when everything
is explained through an x which is not explained,
then in toto nothing is explained, nothing at all.
If this is not skepticism, then it is superstition.
Soren Kierkegaard (p.251)
Since Copernicus man has been rolling from the
center toward x.
Friedrick Nietzsche (p.8)
The enzymes of the glycolytic pathway constitute
approximately 30-60 percent of the soluble cellular proteins
in Saccharomyces cerevisiae (Hess et al., 1969 and Fraenkel,
1982) The observation that the most abundant mRNA species in
this organism code for glycolytic enzymes (Holland and
Holland, 1978), and the demonstration of high-level
expression of heterologous genes using glycolytic gene
promoters (Bitter and Egan, 1984 ; 1988; Bitter et al. 1987)
revealed that these promoters are among the most powerful
known in any species. The promoters of the glycolytic genes
have been exploited commercially to manufacture recombinant
human erythropoietin and recombinant hepatitis B viral
antigens (Bitter and Egan, 1984; 1988; Bitter et al., 1987).
The upstream activating sequence, UAS, elements of many
glycolytic enzyme genes have been studied in detail and a
89

90
common theme has emerged. A growing number of factors,
including Reblp, Raplp, Abflp, Gcrlp, Gcr2p, and Galllp,
appear to be the first proteins to assemble at these UAS
elements, effect chromatin structure, and activate
transcription (see Scott and Baker, 1993) .
Of the DNA-binding proteins known to bind in the UAS
elements of glycolytic genes, the binding of Raplp and Gcrlp
appears to be crucial for UAS activity. A role of Gcrlp in
glycolytic gene expression was first shown when mutations
were isolated in GCR1 which resulted in a 20-fold reduction
in the expression of most of the glycolytic enzymes genes
(Clifton et al., 1978). Baker (1991) showed that full-length
Gcrlp translated in vitro binds to the CTTCC sequence element
in the UAS of TPI1. Mutations in CTTCC sequence elements in
the UASs of the genes TPI1 (Scott and Baker, 1993), TDH3
(Bitter et al., 1991), PGK (Chambers et al., 1988), ENOl, and
PYK (Buchman et al., 1988) impaired the ability of the UAS
elements to drive expression of reporter genes.
RAP1 is an essential gene (Shore and Nasmyth, 1987) with
pleiotropic functions. Raplp is known to act as both an
activator and repressor of transcription (Shore and Nasmyth,
1987), and it plays a role in the maintenance of telomeric
structure (Buchman et al. 1988; Longtine et al., 1989;
Lustig et al., 1990; Conrad et al., 1990). A role for Raplp
in the activation of glycolytic gene expression was first
suggested when Raplp DNA-binding sites were noted in the 5'
noncoding region of many glycolytic genes (Capieux et al.,
1989) Mutation-analyses of the Raplp DNA-binding sites in

91
the UAS elements of TPI1 (Scott et al., 1990), TDH3 (Bitter
et al., 1991), PGK1 (Chambers et al.,1989), ENOl (Machida et
al., 1989; Brindle et al., 1990), EN02 (Brindle et al.,
1990), PYK1 (McNeil et al., 1990), PDC1 (Butler et al.,
1990), and ADH1 (Tornow and Santangelo, 1990) has shown that
Raplp-binding is essential for full activity of these UASs.
In each case mutation of the Raplp-binding site reduced
expression more than ten-fold. It has additionally been
shown that the Raplp-binding site from PGK alone is unable to
confer UAS activity to a test promoter (Stanway et al.,
1989). Thus, whereas both Gcrlp and Raplp DNA-binding sites
are required for high-level glycolytic gene expression,
neither site alone is sufficient for high-level expression.
The experiments in this study demonstrate conclusively
that Gcrlp is a DNA-binding protein, and that Gcrlp interacts
with the CTTCC sequence element directly. Additionally a
Gcrlp consensus-sequence is approximated, and an initial
characterization of the DNA-protein interaction is presented.
Although this study focused mainly on Gcrlp, the results bear
strongly on how Gcrlp and Raplp interact, and how they exert
a synergistic effect at the UAS of the glycolytic genes. One
feature appears to be common to all of the glycolytic gene
promoters regulated by GCR1: the finding of adjacent Gcrlp-
and Raplp-DNA-binding sites (Huie et al., 1992). The
implications of the adjacent binding sites will be discussed
in the context of the findings of this study.

92
The DNA-binding Domain of GcrLo
Two lines of evidence identify a DNA-binding domain in
the carboxy-terminus of Gcrlp. First, carboxy-terminus
truncations of Gcrlp abolish DNA binding. Second, all
fusion-proteins containing the carboxy-terminal 154 amino
acid residues of Gcrlp retained sequence-specific DNA-binding
activity. Additionally, the MBP-Gcrlp (690-844) fusion-
protein--containing the carboxy-terminal 154 amino acid
residues--protected from in vitro DNasel digestion CT-boxes
which are protected in a GCR1 -dependent manner in vivo (Huie
et al., 1992) .
It had been previously suggested, on the basis of DNA
sequence analysis, that the carboxy-terminus of Gcrlp may
contain a DNA-binding domain since a possible helix-turn-
helix (H-T-H) motif was identified at amino acids 784 to 803
(Baker, 1986). The H-T-H structure forms the basis of a DNA-
binding domain in a superfamily of DNA-binding proteins
(Harrison and Aggarwal, 1990). The Gcrlp fusion-proteins
that contained amino acids 706 to 844 and amino acids 784 to
844 failed to bind DNA even though they contained the
putative H-T-H. This negative result does not exclude the H-
T-H motif from forming the core of the actual DNA-binding
domain, as smaller deletions could have disrupted the domain.
In an effort to compare the Gcrlp DNA-binding domain to
other proteins, sequence analysis was performed on the entire
protein with particular attention paid to the carboxy
terminus. Comparison against updated databases using the
algorithms BLAZE (Smith and Waterman, 1992), BLAST (Altschul

93
et al, 1990), and FASTA (Pearson and Lipman, 1988) [with a
Ktup of 1 for increased sensitivity (Pearson, 1991)],
uncovered no obvious homology to other known DNA-binding
proteins.
A number of sequence-specific DNA-binding proteins which
recognizes a centrally located 5'-GGAA-3' core (which is
complementary to 5'-TTCC-3') contain the ets-domain (Karim et
al., 1990). The primary amino acid sequence of the Gcrlp
DNA-binding domain displays no obvious homology to this class
of proteins. Although there are a tyrosine and two
tryptophan residues spaced 15 and 18 amino acids apart
similar to PU.l, a member of the ets family of proteins,
Gcrlp lacks the highly-conserved amino-acid residues
characteristic of the ets-family of proteins.
Although sequence analysis failed to identify other
proteins that contain a potential Gcrlp DNA-binding domain,
the algorithm of Karlin and Brendel (1992)--Statistical
Analysis of Protein Sequences (SAPS)--performed on the entire
Gcrlp amino acid sequence correctly predicted a DNA-binding
domain in the region of Gcrlp to where it was functionally
mapped (see Figure 20) This algorithm scores amino acids
based on their frequency in known DNA-binding domains. So,
although the Gcrlp DNA-binding domain does not show obvious
homology to known DNA-binding domains, the amino acids
residues present in the domain are well represented in known
DNA-binding domains.
Although no obvious homologies were found with known
DNA-binding proteins, when the DNA sequence coding for this

94
Figure 20. SAPS analysis of Gcrlp. The algorithm of Karlin
and Brendeal (1992) performed on the entire Gcrlp amino acid
sequence predicted a DNA-binding domain in the carboxy-
terminal region of Gcrlp. Numbers on the vertical axis
represent Ei, the excursion score. Numbers on the horizontal
axis represents the amino acid residues of Gcrlp. A
significance threshold of 5% corresponds to an EA score of 26.
The carboxy-terminal region of Gcrlp has a significantly high
Ei score. This region corresponds to the of DNA-binding
activity mapped in this study. The amino acid matrix
presented in Karlin and Brendel (1992), with a yeast codon
bias, was used to calculate Ei for this analysis.

95
region was used as a probe to screen a genomic DNA from a
variety of organisms from yeast to humans, homologous
sequence could be detected by low stringency hybridization
(Huie and Baker, unpublished observations) Thus, homologous
Gcrlp DNA-binding domains may not yet have been cloned and
reported.
A dna Consensus Sequence £or.,-£.cxlp_.Ein.ding
In this study it was shown that Gcrlp can interact
directly with the CTTCC sequence elements found in the
upstream regions of TPI1, PGK, EN01, PYK, and ADH1. From
these experiments a degenerate consensus Gcrlp-binding site
was formulated:
(T/A)N(T/C)N(G/A)N C (T/A) T C C T/A)N (T/A) (T/A) (T/G)
The extent of the proposed consensus Gcrlp-binding site (16
nucleotides) was chosen on the basis of the area of
protection observed in the in vitro DNase I footprinting
study. This sequence is in good agreement with the GPE (for
£RF1 [RAP1] site Eotentiator Element) motif recently defined
by Bitter et al. (1991) as:
G(A/Q (ft/T)-.T-C-g (A/T)
The GPE motif, found adjacent to Raplp-binding sites in
glycolytic genes has no UAS activity by itself, but
potentiated the activation effects of a Raplp-binding site
when placed next to it either upstream or downstream and in
either orientation (Bitter et al., 1991). Bitter et al.
(1991) concluded that Raplp-binding sites and GPE are
responsible for the majority of activation potential of the
UAS of TDH3 and suggested that GPE represented a binding site

96
for a protein. From the studies presented here, it is almost
certain that GPE sites are Gcrlp-binding sites.
From the consensus Gcrlp-binding site listed above it
was predicted (Huie et al., 1992) that Gcrlp would bind at
position -451, relative to the start codon, in the UAS of
EN02. This site has recently been shown to bind Gcrlp in
vitro (Willett et al 1993) .
It is appreciated that Gcrlp may interact with sequences
which contain several mismatches to the proposed consensus
sequence. In fact, it is likely that such cases will be
found, since this consensus is base on a limited set of
binding sites. Additionally, the true binding site in vivo
may be affected by other proteins bound at adjacent sites
(see below) or by the topology of the DNA in and around the
Gcrlp-binding site. For example, the CTTCC sequence is often
centered between a cluster of T and A residues spaced by 10
base-pairs (see, in particular, the sequence of TPIli, TPI12,
and ADH1 listed in Table 3) Runs of three or four A/Ts
regularly spaced at 10 bp (one helical turn) are associated
with intrinsically bent DNA (Wu and Crothers, 1984 ).
Sequences involved in nuclear matrix attachment have patterns
characteristic of intrinsically bent DNA (Anderson, 1986) .
This is worth noting since Raplp purifies with the nuclear
matrix (Cardenas et al. 1990) and since all known Gcrlp-
binding sites are adjacent to Raplp-oinding sites (see
below) Similarly, the B element of the ARS sequence, to
which Abflp binds, has been shown to have a strong intrinsic

97
bend (Williams et al., 1988 ; Eckdahl and Anderson, 1987;
Snyder et al., 1986).
These points are reviewed to underscore the fact that
proteins can recognize DNA without directly interacting with
the bases. This type of recognition has been referred to as
"indirect readout" (Otwinowski et al., 1988) or analogue
recognition (Drew and Travers, 1985; Travers, 1989). For
example, the trp repressor, as determined by X-ray
crystallography, binds to its site by contacting the
phosphate-backbone, without contacting any base-pair directly
(Otwinowski et al. 1988) It has been observed that the H-
T-H motif identified in the primary sequence of GCR1 most
closely resembles the H-T-H of the trp repressor (Baker,
personal communication). If Gcrlp binds in such a manner,
the primary DNA sequence of the consensus site may not
accurately reflect the true determinants of binding.
However, G residues are protected from methylation by DMS
(Huie et al., 1991) which suggests a very close association
between Gcrlp and the N7 position of those G residues.
The Binding Affinity of the Gcrlp DNA-Bindina Domain
Using a band shift assay with purified fusion-protein
containing the DNA-binding domain of Gcrlp it was here shown
in vitro that the Gcrlp DNA-binding domain binds with a
relatively high affinity (Kd = 2.9 x 10'10 M) to one of the
sites it recognizes in vivo. Objections may be raised to the
fact that these studies were performed with fusion-protein
and that only the DNA-binding domain and not the full-length
Gcrlp polypeptide was used. Unfortunately, the instability

98
of full-length Gcrlp makes the full-length polypeptide
difficult to use for these types of measurements. As
mentioned in the introduction, transcriptional activators
often contain "disorganized" structures, such as exposed
hydrophobic residues, which undergo an induced-fit with other
factors when they interact (reviewed in Frankel and Kim,
1991) This disorganized structure makes transcriptional
activators very sensitive to proteases. Full-length Gcrlp
seems to be unstable whether translated in rabbit
reticulocyte lysate or manufactured in E. coli.
However, due to the modular nature of transcriptional
activators, many structural questions can still be addressed
and have been addressed by studying the discrete domains.
For example, the RNA-binding affinity of a short peptide that
contains the RNA-binding domain of the HIV tat protein gives
the same measurements as with the intact protein (Calnan et
al. 1991; Dingwall et al., 1990). The DNA binding-domain of
LEF-1 expressed as a peptide or a GST-LEF-1 fusion protein,
containing only the DNA-binding domain, gives similar binding
affinities (Giese, 1991). Nevertheless, the binding affinity
from the studies presented here must be understood in the
context of studying the DNA-binding domain, and not the full-
length protein.
The binding affinity of the DNA-binding domain of Gcrlp
falls into the middle of a range of affinities described for
known DNA-binding domains of transcriptional activators. A
few factors are listed in Table 4. for comparison.

99
Table 4. DNA-Binding Affinity of
Select Transcriptional Activators
factor
reference
CAP
3 x 10-9
(Liu-Johnson
et al., 1986)
Antennapedia
1 2 x 10-9
(Affolter et
al., 1990;
Corsetti et al. 1992)
Spl
5.3
x 10--c
(Letovsky
and Dynan, 1989)
Raplp
1.3
x 10 -i -
(Vignais et al., 1990)
NF-1
2.1
x 10 -11
(Eberly et
al., 1985)
ft z
2.5
x 10-ii
(Florence
et al., 1991)
HSTF
4 x
10-12
(de Vries
and Koogh-
Schuuring,
1973)

100
Vignais et al. (1990) measured the apparent Kd of Raplp
for its optimal binding site at 1.3 :< 10-1: M. Comparing this
value with that of Gcrlp gives good agreement with band shift
data from other studies (Baker, 1991; Huie and Baker,
unpublished data) where it was estimated that 50-fold more
full-length Gcrlp had to be added, compared to Raplp, to see
the same degree of DNA-binding of a labeled fragment
containing both binding sites.
In the DNase I footprint assay presented in this study
(Figure 8), only two specific regions in a 234 bp fragment
were protected from DNase I digestion. The regions are
identical to genetically defined cis-elements responsible for
high-level expression of TPI1 (Scott and Baker, 1993) .
Furthermore, Edward Scott demonstrated in vivo that these
sequences are protected in wild-type strains and deprotected
in gcrl mutant strains (Huie et al., 1992; Scott, 1992; Scott
and Baker, 1993) .
One unanticipated result of this study was the
relatively high-affinity but modestly low-specificity of the
interaction of the Gcrlp DNA-binding domain with DNA when
measured in vitro. Other lines of evidence also support the
notion that Gcrlp has a low specificity for its specific
binding site. Preliminary results using a PCR-based
oligonucleotide selection and amplification technique
suggests that the Gcrlp DNA-binding domain is very poor at
enriching for highly specific sites (Esiner and Baker,
unpublished data). Theoretical considerations (Irvine et
al., 1991) of the technique are consistent with the

101
observations found from experiments (Huie and Eisner,
unpublished observation) that Gcrlp has a low specificity.
The low specificity was unanticipated because even though
Gcrlp is expressed in low amounts in the cell, its sites at
UAST?:1 seem to be fully occupied in vivo (Scott and Baker,
1993; Scott and Baker, unpublished data) .
In this respect, the Gcrlp DNA-binding domain can be
added to a growing list of transcriptional factors that
posses a high affinity for DNA, yet a low specificity of
interaction with their specific binding sites. Other
characterized transcription factors with these properties are
found in humans, mice, insects, and bacteria. For example,
the homeodomain of Antennapedia from Drosophila has a high
affinity for DNA, but displays a specificity of less than
100-fold (Affolter et al. 1990). As measured by kinetic
studies, the glucocorticoid receptor complex with its DNA
binding site displays only about a 10-fold difference in
affinity for specific verse nonspecific DNA (Schauer et al.,
1989). The transcriptional activator LEF-1, which binds to
the T-cell receptor enhancer, has a measured dissociation
constant of 10'9 M, yet a specificity of only 20-40 fold
(Giese, 1991) The mammalian sex-determining gene, SRY, also
encodes for a DNA-binding protein with a very low specificity
(Nasrin et al., 1991; Harley et al., 1992). All of these
proteins, despite the low specificity, demonstrate clear
areas of protection in DNase I footprinting studies. In
addition, many of these proteins, like Gcrlp, have been shown

102
to bend DNA upon binding (Giese et al., 1992; Ferrari et al.,
1992) .
The low specificity, seen in many transcriptional
activators, can be contrasted with the properties observed in
some transcriptional repressors. The X repressor binds to
its specific operator sequences with affinities as high as
10-13 M and binds to specific DNA with a 500,000-fold higher
affinity than to nonspecific DNA (Sauer et al. 1990; Frankel
and Kim, 1991). Since it is specificity that is more
important for assembling transcriptional complexes, a number
of implications can be drawn from questions that arise from
the finding of transcriptional activators which have a
relatively high affinity for DNA and yet a low specificity.
An immediate question arises as to how proteins with a
low specificity find their DNA-binding sites in their
genomes. This is a serious question which cannot be
dismissed with a flippant reference to skepticism. Possible
models are testable and may provide clues as to how other
proteins acting at UASs, which do not posses activation
domains, exert their effects. It is worth reviewing at this
point possible mechanism by which proteins with low
specificity can find their binding sites in vivo.
One possible mechanism is simply by high-level
expression of the protein. This has been proposed to be the
manner in which integration host factor (IHF) finds its site
(Giese, 1991). Although IHF is a sequence-specific DNA-
binding protein (Craig and Nash, 1984), it also binds to
nonspecific DNA (Bonnefoy and Rouviere-Yaniv, 1991) IHF is

103
estimated (Giese et al., 1991) to be in high abundance in the
cell (20,000 molecules per cell), and this may drive the
factor to its site by mass action. IHF plays many different
roles in the cell (reviewed in Friedman, 1988), but it is
believed, fundamentally, to be a structural or 'archi
tectural' protein. This mechanism of high-level expression
is probably not the mechanism used by transcriptional
activators. A transcriptional activator with a low
specificity may not be tolerated well by the cell when
expressed at a high level. In fact many, if not most,
transcriptional factors are toxic to their host when
expressed at high levels. Presumably this is due to either
nonspecific binding or squelching of auxiliary transcription
factors (Gill and Ptashne, 1988) Full-length Gcrlp in fact
seems to be toxic when expressed at high levels in yeast
(Holt and Baker, unpublished observation) .
Another way in which proteins with low specificity can
find their binding sites is by interacting with other
proteins. According to this view, the Ka for a specific site
would be decreased by a cooperative interaction with another
DNA-binding protein (Giese et al., 1991). The in vivo
binding site would then consist of a nucleoprotein complex.
The other DNA-binding protein (s) would presumably have a
stronger DNA-binding affinity and specificity and bind to its
site(s) first. This complex would then facilitate the
binding of the protein with a low specificity through a
protein-protein interaction. This mechanism has been
proposed for the facilitation of the factor OTF-1 by Spl

104
(Janson and Pettersson, 1990) Using band-shift assays these
authors demonstrated a 10-fold increase in affinity of OTF-1
to its site in the presence of Spl when an Spl site was
adjacent to an OTF-1 site. Furthermore, OTF-1 binding was
decreased when a 15 bp segment was inserted between the Spl
and OTF-1 binding sites (Janson and Pettersson, 1990) In
perhaps a more classic example, the A. repressor has been
shown to facilitate the binding of another repressor to a
lower affinity site by a protein-protein interaction
(Hochschild and Ptashne, 1986) .
An alternative mechanism, which does not exclude the one
mentioned above, is one in which the specificity of a
protein-DNA interaction is increased by another protein
modifying the DNA topology. Wu and Crothers (1984) suggested
that protein induced bending of DNA can facilitate additional
protein-DNA interactions. In this scenario, the DNA sequence
is contorted making a more favorable binding site and thus
increasing the affinity. This contortion could be caused by
the binding of a protein to an adjacent site which then
distorts the DNA making a more favorable binding site for the
protein with low specificity; or alternatively, a primary DNA
sequence could alter the adjacent binding site to produce a
more favorable site. An example of the former mechanism was
proposed (Flashner and Gralla, 1988) for the stimulation of
CAP binding to lac DNA by HU the major histone like protein
of E coli. For an example of the latter mechanism, it has
been shown that the affinity of CAP for its binding site is
increased 200-fold when it is located on an intrinsically

105
bent piece of DNA (Kahn and Crothers, 1992) Likewise, IHF
has also been shown to have a greater affinity for curved DNA
(Bonnefoy and Rouviere-Yaniv, 1991). This mechanism, in which
a protein contorts a nearby site, was proposed for the
functional versatility of Raplp when it was first noted that
Raplp bends DNA (Vignais and Sentenac, 1989).
A third mechanism in which specificity could be
increased would be due to modification of the DNA-binding
protein. For example, the binding of sequence-specific
transcription factors to DNA can be affected either
positively or negatively by phosphorylation (reviewed in
Hunter and Karin, 1992). Examples of negative regulation
include the products of c-myb and c-jun in which
phosphorylation decreases the protein's DNA-binding affinity
(Luscher et al., 1990; Boyle et al., 1991). Myb binds to
several characterized Myb-response-elements (MRE) with
varying affinities. Phosphorylation of Myb completely
inhibits binding to the MREs with low affinities, but is not
very efficient at inhibiting Myb binding to MREs with high
binding affinity, thus in effect increasing the specificity
(Luscher et al., 1990). The factor SRF, on the other hand,
increases its affinity for DNA when phosphorylated at serine
residues (Janknecht et al., 1992; Maris et al., 1992) This
is presumably due to a conformational change of the protein
when phosphorylated (Marak and Pryuses, 1991).
In the final analysis, transcription complexes are held
together by multiple cooperative interactions, even if some
individual interactions are of low specificity. As Frankel

106
and Kim (1991) have pointed out, it would be difficult to
dissociate or regulate the activity of a transcription
complex if every component had an exceedingly high affinity
or specificity for every other component; and furthermore,
extremely tight or specific interactions might interfere with
the combinatorial use of factors by many promoters (see
Dynan, 1989) Ribosomes have been suggested as an apt analogy
to the assembly of transcription complexes (Frankel and Kim,
1991) In general, both systems are complex macromolecular
assembles, millions of kiloDaltons in size, built upon
multiple cooperative protein-protein and protein-nucleic acid
interactions of varying affinities and specificities. Only
when the entire complex is assembled is the true specificity
of the system revealed. Individual interactions with modest
specificity seems to be inherent to designs of systems with
such complexity--with cooperativity resulting largely from
entropic factors (Creighton, 1983).
The Bending of DNA by Raplp and Gcrlp
It has been pointed out (Kerppola and Curran, 1991) that
the circular permutation assay cannot distinguish between
static DNA bends or other alterations, such as triple helix
formation. This caveat is included with the term DNA "bend"
when referring to the patterns of electrophoretic mobility
observed in this study. With this in mind, it was shown here
that Gcrlp bends DNA upon binding to it. It is important to
note here that this distortion of DNA represents a
thermodynamic barrier which if reduced would presumably
facilitate binding (see Kahn and Crothers, 1992). This can

107
be represented as follows:
1. DNAt <-> DNAbent k;
2 DNAbent + Gcrlp <-> Gcrlp-DNA k2
3. kt = k: k2
If DNAoenc is the true binding substrate (i.e. has a higher
affinity) for Gcrlp then the equilibrium constant of equation
1. will determine the effective concentration of the DNA-
ligand for Gcrlp. Factors that enhance the formation of
DNAber,-. would then enhance the formation of the Gcrlp-DNA
complex. This concept of DNA bending facilitating binding of
protein has been compared (Kahn and Crothers, 1992) to the
improved binding of unwinding ligands to supercoiled DNA
(Davidson, 1972).
A protein which may enhance reaction 1. presented above
is Raplp. Raplp has been shown to bend DNA upon binding to
the rpg box (Raplp-binding site) from the UAS of rpg-1
(Vignais and Sentenac, 1989) Here I have shown that Raplp
also bends DNA when bound to its recognition site in the UAS
of TPI1. If Gcrlp binds with greater affinity to bent DNA,
then Raplp ability to bend DNA in and around the Gcrlp
binding site may enhance the binding of Gcrlp. This
mechanism for Raplp was proposed by the authors who
originally showed that Raplp bends DNA to account for its
functional versatility (Vignais and Sentenac, 1989). These
authors also demonstrated that proteolytic fragments of
Raplp, which retained only the DNA-binding domain, were
unable to bend DNA. It is possible that deletions of Raplp
which cannot bend DNA could effect Gcrlp binding if bending

108
of DNA plays a significant role in facilitating the binding
of Gcrlp.
The Significance of Adjacent Raplp and GcrlP Binding Sites in
the UAS of the Glycolytic Genes
Given the findings that Gcrlp has a low specificity of
interaction with its specific DNA sites as measured in vitro,
that Gcrlp either recognizes bent DNA or bends DNA upon
binding, and the models discussed above, what can we surmise
about the role of the other factors which have DNA binding
sites in the UASs of the glycolytic genes and which are also
required for high-level expression of the corresponding
genes ?
Due to the low specificity of Gcrlp interaction with its
binding sites, the concept of facilitation most likely can
explain the findings. The factor that most likely would play
a role in facilitating the binding of Gcrlp to its sites is
Raplp. A number of observations that support this view will
be reviewed at this point.
The first observation is the relationship between Raplp-
and Gcrlp-binding sites in the UAS of the glycolytic genes
which are dependent upon GCR1 for full expression. All known
Gcrlp-binding sites (Willett et al., 1993; Huie et al., 1992;
and this study) are found next to Raplp-binding sites.
Furthermore, putative Gcrlp-binding sites in the UAS of the
GCR1 dependent glycolytic genes reveal adjacent Raplp-binding
sites. The presence of a Raplp-binding site near putative
Gcrlp-binding sites in the glycolytic genes raises the
possibility that either a direct interaction between these
two proteins occurs or that Raplp affects the structure of

109
the DNA is such a way to increase Gcrlp-binding at its site.
However, in the Ty2 retrotransposon UAS and enhancer, several
Gcrlp-sites have been mapped which do not have adjacent
Raplp-sites (Turek, 1994). DNA-binding protein sites are
adjacent to the Gcrlp-sites, but the identiy of the proteins
are currently unknown.
A second point to consider is that for the genes TDH3
(Bitter et al., 1991), PGK1 (Chambers et al. 1990), and ADH1
(Tornow et al., 1993) a Gcrlp-binding sites by itself is
unable to convey UAS activity. However, Baker and Scott
(1993) have shown that if a lexA binding domain is tethered
to full-length Gcrlp, activation of a lex operator::GAL1:lacZ
reporter can be observed. This activation occurs in the
absence of a Raplp- binding site (Scott and Baker, 1993).
This demonstrates that Gcrlp can activate transcription in
the absence of Raplp if bound to DNA. This result was
recently confirmed by other investigators (Tornow et al.,
1993) That Gcrlp can activate transcription when bound to
DNA through a lex operator is consistent with the notion that
the role of Raplp is to facilitate binding of Gcrlp and that
Gcrlp contains an activation domain.
A third point: Raplp is an abundant sequence specific
DNA-binding protein in yeast which is known to bind to its
sites with a very high degree of specificity. Vignais et al.
(1990) measured the apparent K of Raplp for its optimal
binding site and for nonspecific DNA. These values were
found to be 1.3 x 10*'-- M and 8.7 x 10~ M respectively. Thus,
the specificity of Raplp binding to its site verse random DNA

110
is six orders of magnitude. In addition to this high degree
of specificity, Raplp is expressed in high abundance in the
cell. Its level has been estimated to be 4,000 molecules/
genome (Buchman et al., 1988). Since Raplp has an extremely
high specificity and is expressed at high levels, it has been
argued that all Raplp-binding sites should be occupied in
actively growing cells (Vignais et al 1990) Thus, Raplp
should bind its site in the absence of Gcrlp.
From in vivo footprint analysis it is known that the
Raplp-binding site in the U AS Tpii is protected in the absence
of the GCR1 gene product (Huie et al 1992; Scott, 1992;
Scott and Baker, 1993) A safe conclusion from this data is
that the GCR1 product is not necessary for Raplp binding at
its site in UAS tp 11 iti vivo. On the other hand, using
temperature sensitive rapl mutants, Jeff Smerage (Baker,
personal communication) has preliminary evidence from in vivo
footprinting experiments that Raplp binding is required for
Gcrlp binding at UAStpii- This implies that Gcrlp binds to
its DNA-binding site only in the presence of Raplp bound at
an adjacent site.
All these observations are consistent with the view that
the role of Raplp is to facilitate the binding of Gcrlp to
its binding site, and that Gcrlp then provides an activation
domain. What might be the possible mechanism whereby Raplp
carries out this facilitation? The observation of "skewing"
of protection of the RAP1 site seen in in vitro DNase I
footprinting experiments implies that a structural change
near the Raplp-binding site is occurring in the minor groove

Ill
since DNase I recognizes a vary narrow range (Drew and
Travers, 1985; Suck and Oefner, 1986; Lahm and Suck, 1991).
This is consistent with the idea that Raplp-induced bending
of DNA affects nearby DNA binding sites for other proteins.
Evidence also exist, however, for a direct Raplp-Gcrlp
interaction. Tornow et al. (1993) showed that the GCR1 gene
product could be co-immunoprecipitated with Raplp when the
two proteins were epitope tagged. These results suggest a
protein-protein interaction occurs between Raplp and Gcrlp.
The role of the DNA-binding domain in the function of
Gcrlp was recently called into question. Tornow et al.
(1993) interpreted experiments from their laboratory to
suggest that the DNA-binding domain of Gcrlp may be
dispensable for transcriptional activation activity. This
was intriguing because previous experiments had suggested
that the DNA-binding domain of the fushi tarazu polypeptide
(a homeodomain) could be deleted and that the truncated
protein could still alter gene expression, presumably without
binding directly to DNA (Fitzpatrick et al., 1992).
Tornow et al. complemented a gcrl mutant with plasmids
containing 3'-deletions of the GCR1 structural gene and noted
the appearance of large colonies after ten days of growth on
minimal medium containing glucose. However, these authors did
not show that the ability to complement the gcrl growth
defect was linked to the plasmids encoding the truncated
forms of Gcrlp. This control is essential because second-
site pseudorevertants of the gcrl mutant can appear as large
colonies. Drazinic et al. (1994), in an attempt to verify

112
this observation, have shown that a plasmid containing a 3'-
deletion of GCR1 introduced into the gcrl mutant strain HBY4
(which contains a deletion of the entire GCR1 structural
gene) were incapable of complementing the slow-growth
phenotype. These experiments, which were done under
conditions to select for retained plasmids, failed to confirm
the results of Tornow et al. (1994) Only the full length
GCR1 construct was capable of complementing HBY4. These
result suggest that Tornow et al. (1994 ) were selecting
second-site pseudorevertants of the gcrl mutant.
Tornow et al. (1994) also suggested that Gcrlp exerts
its affects through Raplp-binding site. However, a number of
different laboratories have shown that mutations of CTTCC
elements (Gcrlp-binding sites) results in severely reduced
expresssion of the cooresponding gene (Bitter et al., 1991;
Buchman et al., 1988; Chambers et al. 1988; Scott and Baker,
1993; Willet et al. 1993). Furthermore, Drazinic et al.
(1994 ) have shown by in vivo footprinting that mutations in
both Gcrlp-binding sites within UASrpu which reduce
expression of the cognate gene by 67-fold do not affect the
occupancy state of the adjacent Raplp-binding site. If Gcrlp
was recruited to the UAS element soley by protein-protein
interactions with Raplp, then one would not expect mutations
in the Gcrlp-binding sites to affect expression of the
cognate gene. The Data taken as a whole supports an
interdependency between Raplp and Gcrlp binding site at
glycolytic enzyme gene UAS elements in mediating GCR1-
dependent gene expression.

113
Conc.l.u signs
The experiments described in this study demonstrate that
Gcrlp possesses a modular DNA-binding domain, located in the
carboxy-terminal 154 amino acids, that binds in a sequence
specific manner to the consensus sequence 5' (T/A)N(T/C)N
(G/A)NC(T/A)TCC(T/A)N(T/A)(T/A)(T/G)-3' with a high affinity
(Kd =2.9 x 10_10M), but low specificity. The DNA is
contorted when bound in the Gcrlp-DNA nucleoprotein complex.
The consensus sequence derived from the study of Gcrlp DNA-
binding corresponds to known cis-element demonstrated by
genetic methods to be important for GCR1 dependent
transcription. The results are consistent with the proposal
that additional proteins are important for facilitation of
Gcrlp binding and activation at the glycolytic gene upstream
activating sequences.

114
REFERENCES
Affolter, M. Percival-Smith, A., Muller, M., and Leupin W.
(1990). DNA binding properties of the purified Antennapedia
homeodomain. Poc. Natl. Acad. sci. USA 87, 4093-4097.
Allison, L.A., Moyle, M., Shales, M., and Ingles, C.J.
(1985). Extensive homology among the largest subunits of
eukaryotic and prokaryotic RNA polymerases. Cell 42, 599-610.
Allison, L.A., Wong, J.K-C., Fitzpatrick, V.D., Moyle, M.,
and Ingles, C.J. (1988). The C-terminal domain of the largest
subunit of RNA polymerase II of Saccharomyces cerevisiae,
Drosophila melanogaster, and mammals: a conserved structure
with an essential function. Mol. Cell. Biol. 8, 321-329.
Amann, E., Brosius, J., and Ptashne, M. (1983). Vectors
bearing a hybrid trp-lac promoter useful for regulated
expression of cloned genes in Escherichia coli. Gene 25,
167-178 .
Amati, B.B. and Gasser, S.M. (1988). Chromosomal ARS and CEN
elements bind specifically to the yeast nuclear scaffold.
Cell 54, 967-978.
Anderson, J.N. (1986). Detection, sequence patterns and
function of unusual DNA structures. Nucleic Acids Res. 14,
8513-8533 .
Arndt, K.T., Styles, C.A., and Fink, G.R. (1989). A
suppressor of a HIS4 transcriptional defect encodes a protein
with homology to the catalytic subunit of protein
phosphatase. Cell 56, 527-537.
Aso, T., Vasavada, H.A., Kawaguchi, T. Germino, F.J.,
Ganguly, S., Kitajima, s., Weissman, S.M., and Yasukochi, Y.
(1992). Characterization of cDNA for the large subunit of the
transcription initiation factor TFIIF. Nature 355, 461-464.
Ausubel, F.M., Brent, R. Kingston, R.E., Moore, D.D.,
Seidman, J.G., Smith, J.A., and Struhl, K. (1989). Current
Protocols in Molecular Biology (New York, New York: Greene
Publishing Associates and Wiley-Interscience).
Baker, H.V. (1986). Glycolytic gene expression in
Saccharomyces cerevisiae: nucleotide sequence of GCRl, null
mutations, and evidence for expression. Mol. Cell. Biol. 6,
3774-3784 .
Baker, H.V. (1991). GCRl of Saccharomyces cerevisiae encodes
a DNA binding protein whose binding is abolished by mutations
in the CTTCC sequence motif. Poc. Natl. Acad. sci. USA 88,
9443-9447.
Bennetzen, J.L. and Hall, B.D. (1982). Codon selection in
yeast. J. Biol. Chem. 257, 3026-3031.

115
Berger, S.L., Cress, W.D., Cress, A., Triezenberg, S.J., and
Guarente, L. (1990). Selective inhibition of activated but
not basal transcription by the acidic activation domain of
VP16: evidence for transcriptional adaptors. Cell 61,
1199-1208.
Berger, S., Pina, B., Silverman, G. Marcus, G. Agapite, J.,
Regier, J. Treizenberg, S., and Guarente, L. (1992). Genetic
isolation of ADA2: a potential transcriptional adaptor
required for function of certain acidic activation domains.
Cell 70, 251-266.
Biednenkapp, H., Borgmeyer, U. Sippel, A.E., and Klempnauer,
K-H. (1988). Viral myb oncogene encodes a sequence-specific
DNA-binding activity. Nature 335, 835-837.
Bitter, G.A., Chang, K.K.H., and Egan, K.M. (1991). A multi-
component upstream activation sequence of the Saccharomyces
cerevisiae glyceraldehyde-3-phosphate dehydrogenase gene
promoter. Mol. Gen. Genet. 231, 22-32.
Bitter, G.A. and Egan, K. (1984). Expression of heterologous
genes in Saccharomyces cerevisiae from vectors utilizing the
glyceraldehyde-3-phosphate dehydrogenase gene promoter. Gene
32, 263-274.
Bitter, G.A. and Egan, K. (1988). Expression of heterologous
genes in S. cerevisiae from vectors utilizing the
glyceraldehyde-3-phosphate dehydrogenase gene promoter. Gene
69,193-207.
Bitter, G.A., Egan, K.M., Koski, R.A., Jones, M.O., Elliott,
S.G., and Giffin J.C. (1987). Expression and secretion
vectors for yeast. Methods Enzymol 153, 516-544.
Bonnefoy, E. and Rouviere-Yaniv, J. (1991). HU and IHF, two
homologous histone-like proteins of Escherichia coli, form
different protein-DNA complexes with short DNA fragments.
EMBO J. 10, 687-696.
Braceo, L. Kotlarz, D. Kolb, A., Diekmann, S., and Buc, H.
(1989). Synthetic curved DNA sequences can act as
transcriptional activators in Escherichia coli. EMBO J. 8,
4289-4296.
Bradford, M.M. (1976). A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal. Biochem. 72, 248-254.
Brandi, C.J. and Struhl, K. (1990). A nucleosome-positioning
sequence is required for GCN4 to activate transcription in
the absence of a TATA element. Mol. Cell. Biol. 10,
4256-4265.

116
Brent, R. and Ptashne, M. (1985). A eukaryotic
transcriptional activator bearing the DNA specificity of a
prokaryotic repressor. Cell 43, 729-736.
Brindle, P.K., Holland, J.P., Willett, C.E., Innis, M.A., and
Holland, M.J. (1990). Multiple factors bind the upstream
activation sites of the yeast enolase genes ENOl and EN02:
ABFl protein, like repressor activator protein RAPl, binds
cis-acting sequences which modulate repression or activation
of transcription. Mol. Cell. Biol. 10, 4872-4895.
Britten, R. J. and Davidson, E.H. (1969) Gene regulation for
higher cells: a theory. Science 165, 349-358.
Bucher, P. (1990). Weight matrix descriptions of four
eukaryotic RNA polymerase II promoter elements derived from
502 unrelated promoter sequences. J. Mol. Biol. 212, 563-578.
Buchman, A., Kimmerley, W.J., Rie, J. and Kornberg, R.D.
(1988). Two DNA-binding factors recognize specific sequences
at silencers, upstream activating sequences, autonomously
replicating sequences, and telomeres in Saccharomyces
cerevisiae. Mol. Cell. Biol. 8, 210-225.
Buchman, A., Le, N.F., and Kornberg, R.D. (1988).
Connections between transcriptional activators, silencers,
and telomeres as revealed by functional analysis of a yeast
DNA-binding protein. Mol. Cell. Biol. 8, 5086-5099.
Buratowski, S., Hahn, S., Sharp, P.A., and Guarente, L.
(1988). Function of a yeast TATA element-binding protein in a
mammalian transcription system. Nature 334, 37-42.
Butler, G., Dawes, I.W., and McConnell, D.J. (1990). TUF
factor binds to the upstream region of the pyruvate
decarboxylase structural gene (PDC1) of Saccharomyece
cerevisiae. Mol. Gen. Genet. 223, 449-456.
Cagniard-Latour (1938). Memoire sur la fermentation vineuse.
Ann. Chim 68, 206-223.
Calladine, C.R., Collis, C.M., Drew, H.R., and Mott, M.R.
(1991). A study of electrophoretic mobility of DNA in agarose
and polyacrylamide gels. J. Mol. Biol. 221, 981-1005.
Capieux, E., Vignais, M.L., Sentenac, A., and Goffeau, A.
(1989). The yeast H+-ATPase gene is controlled by the promoter
binding factor TUF. J. Biol. Chem. 264, 7437-7446.
Cardenas, M.E., LaRoche, T.L., and Gasser, S.M. (1990). The
composition and morphology of the yeast nuclear scaffolds. J.
Cell Sci. 96, 439-450.
Carey, J. (1991). Gel retardation. Meth. Enzymol. 208,
103-117 .

Casadaban, M.J. and Cohen, S.N. (1980). Analysis of gene
control signals by DNA fusion and coloning in Escherichia
coli. J. Mol. Biol. 138, 179-207.
117
Cavallini, B., Huet, J. Plassat, J-L., Sentenac, A., Egly,
J-M., and Chambn, P. (1988). A yeast activity can substitute
for the HeLa cell TATA box factor. Nature 334, 77-80.
Chadwick, P. Pirrotta, V., Steinberg, R. Hopkins, N. and
Ptashne, M. (1970). The lambda and 434 phage repressors. Cold
Spring Harbor Symposia on Quantitative Biology XXXV, 283-294.
Chambers, A., Stanway, C. Kingsman, A.J., and Kingsman, S.M.
(1988). The UAS of the yeast PGK gene is composed of multiple
functional elements. Nucleic Acids Res. 16, 8245-8260.
Chambers, A., Stanway, C., Tsang, J.S.H., Henry, Y. ,
Kingsman, A.J., and Kingsman, S.M. (1990). ARS binding factor
1 binds adjacent to RAPl at the UASs of the yeast glycolytic
genes PGK and PYK. Nucleic Acids Res. 18, 5393-5399.
Chambers, A., Tsang, J.S.H., Stanway, C., Kingsman, A.J., and
Kingsman, S.M. (1989). Transcriptional control of the
Saccharomyces cerevisiae PGK gene by RAPl. Mol. Cell. Biol.
9, 5516-5524.
Chasman, D.I., Le, N.F., Buchman, A., LaPointe, J.W., Lorch,
Y. and Kornberg, R.D. (1990). A yeast protein that
influences the chromatin structure of UASG and functions as a
powerful auxiliary gene activator. Genes Dev. 4, 503-514.
Chittenden, T. Livingston, D.M., and Kaelin Jr, W.G. (1991).
The T/ElA-binding domain of the Retinoblastoma product can
interact selectively with a sequence-specific DNA-binding
protein. Cell 65, 1073-1082.
Clifton, D. and Fraenkel, D.G. (1981) The gcrl (glycolysis
regulation) mutation of Saccharomyces cerevisiae. J. Biol.
Chem. 256, 13074-13078.
Clifton, D., Weinstock, D., and Fraenkel, D.G. (1978).
Glycolysis mutants of Saccharomyces cerevisiae. Genetics 88,
1-11.
Cohen, R., Holland, J.P., Yokoi, T. and Holland, M.J.
(1986). Identification of a regulatory region that mediates
glucose-dependent induction of the Saccharomyces cerevisiae
enolase gene EN02 Mol. Cell. Biol. 6, 2287-2297.
Cohen, R. Yokoi, T., Holland, J.P., Pepper, A.E., and
Holland, M.J. (1987). Transcription of the constitutively
expressed yeast enolase gene ENOl is mediated by positive and
negative cis-acting regulatory sequences. Mol. Cell. Biol. 7,
2753-2761.

118
Colgan, J. and Manley, J.L. (1992) TFIID can be rate
limiting in vivo for TATA-containing, but not TATA-lacking,
RNA polymerase II promoters. Genes Dev. 6, 304-315.
Comai, L., taese, N. and Tjian, R. (1992). The TATA-binding
protein and associated factors are integral components of the
RNA polymerase I transcription factor, SL1. Cell 68, 965-976.
Conrad, M.N., Wright, J.H., Wolf, A.J., and Zakian, V.A.
(1990). RAP1 protein interacts with yeast telomeres in vivo:
overproduction alters telomere structure and decreases
chromosome stability. Cell 63, 739-750.
Corden, J.L., Caden, D.L., Ahearn Jr, J.M., and Dahmus, M.E.
(1985). A unique structure at the carboxyl terminus of the
largest subunit of eukaryotic RNA polymerase II. Poc. Natl.
Acad. Sci. USA 82, 7934-7938.
Corsetti, M. Briata, P., Sanseverino, L. Daga, A., Airoldi,
I., Simeon, A., Palmisano, G. Angelini, C., Boncinelli, E.,
and Corte, G. (1992). Differential DNA binding protperties of
three human homeodomain proteins. Nucleic Acids Res. 20,
4465-4472.
Cortes, P., Flores, 0., and Reinberg, D. (1992). Factors
involved in specific transcription by mammalian RNA
polymerase II: purification and analysis of transcription
factor IIA and identification of transcription factor IIJ.
Mol. Cell. Biol. 12, 413-421.
Courey, A. and Tjian, R. (1988). Analysis of Spl in vivo
reveals multiple transcriptional domains including a novel
glutamine-rich activation motif. Cell 55, 887-898.
Craig, N. and Nash, H. (1984). E. coli integration host
factor binds to specific sites in DNA. Cell 39, 707-716.
Cress, A, and Triezenberg, S. (1991). Critical structural
elements of the VP16 transriptional activation domain.
Science 251, 87-90.
Crothers, D.M., Gartenberg, M.R., and Shrader, T.E. (1991).
DNA bending in protein-DNA complexes. Meth. Enzymol. 208,
118-146.
Davison, B.L., Egly, J-M., Mulvihill, E.R., and Chambn, P.
(1983). Formation of stable preinitiation complexes between
eukaryotic class B transcription factors and promoter
sequences. Nature 301, 680-686.
Delbrck, M. (1975) Mind from matter? An essay on
evolutionary epistemology (Carlton, Victoria: Blackwell
Scientific Publications).

119
Desplan, C., Theis, J. and O'Farrell, P.H. (1985). The
Drosophila development gene, engrailed, encodes a sequence-
specific DNA binding activity. Science 318, 630-635.
Devlin, C., Tice-Baldwin, K., Shore, D., and Arndt, K.T.
(1991). RAP1 is required for BAS1/BAS2- and GCN4-dependent
transcription of the yeast HIS4 gene. Mol. Cell. Biol. 11,
3642-3651.
Diffley, J.F.X. and Stillman, B. (1989). Similarity between
the transcriptional silencer binding proteins ABF1 and RAPl.
Science 246, 1034-1038.
Drazinic, C.M., Lopez, M.C., and Baker H.V. (1994). Native
Gcrlp requires a functional CT-box to mediate GCRl-dependent
gene expression. Submitted.
Drew, H.R. and Travers, A.A. (1985). Structural junctions in
DNA: the influence of flanking sequence on nuclease
digestion specificities. Nucleic Acids Res. 13, 4445-4467.
Dynan, W.S. (1989). Modularity in promoters and enhancers.
Cell 58, 1-4.
Dynlacht, B.D., Hoey, T. and Tjian, R. (1991). Isolation of
coactivators associated with the TATA-binding protein that
mediate transcriptional activation. Cell 66, 563-576.
Eckdahl, T.T. and Anderson, J.N. (1990). Conserved DNA
structures in origins or replication. Nucleic Acids Res. 18,
1609-1612 .
Eisenmann, D.M., Dollard, C., and Winston, F. (1989). SPT15,
the gene encoding the yeast TATA binding factor TFIID, is
required for normal transcription initiation in vivo. Cell
58, 1183-1191.
Fassler, J.S. and Winston, F. (1989). The Saccharomyces
cerevisiae SPT13/GALll gene has both positive and negative
regulatory roles in transcription. Mol. Cell. Biol. 9,
5602-5609 .
Fedor, M.J., Le, N.F., and Kornberg, R.D. (1988).
Statistical positioning of nucleosomes by specific
protein-binding to an upstream activating sequence in yeast.
J. Mol. Biol. 204, 109-127.
Felsenfeld, G. (1992). Chromatin as an essential part of the
transcriptional mechanism. Nature 355, 219-224.
Ferrari, S., Harley, V.R., Pontiggia, A., Goodfellow, P.N.,
Lovell-Badge, R. and Bianchi, M. (1992). SRY, like HMG1,
recognizes sharp angles in DNA. EMBO J. 11, 4497-4506.

120
Fields, S. and Song, O-K. (1989). A novel genetic system to
detect protein-protein interactions. Nature 340, 245-246.
Fikes, J.D., Becker, D.M., Winston, F. and Guarente, L.
(1990). Striking conservation of TFIID in Schizosaccharomyces
pombe and Saccharomyces cerevisiae. Nature 346, 291-294.
Finkelstein, A., Kostrab, C.F., Li, J., Chavez, D.P., Wang,
B.Q., Fang, S.M., Greenblatt, J. and Burton, Z.F. (1992). A
cDNA encoding RAP74, a general initiation factor for
transcription by RNA polymerase II. Nature 355, 464-467.
Fitzpatrick, V. Percival-Smith, A., Ingles, C. and Krause,
H. (1992). Homeodomain-independent activity of the fushi
tarazu polypeptide in Drosophila embryos. Nature 356, 610-
612 .
Flanagan, P.M., Kelleher III, R.J., Sayre, M.H., Tschochner,
H., and Kornberg, R.D. (1991). A mediator required for
activation of RNA polymerase II transcription in vitro.
Nature 350, 436-438.
Flashner, Y. and Gralla, J. (1988). DNA dynamic flexibility
and protein recognition: differential stimulation by
bacterial histone-like protein HU. Cell 54, 713-721.
Florence, B., Handrow, R. and Laughon, A. (1991). DNA-
binding specificity of the fushi tarazu homeodomain. Mol.
Cell. Biol. 11, 3613-3623.
Fraenkel, D.G. (1982). Carbohydrate metabolism. In The
Molecular Biology of the yeast Saccharomyces cerevisiae:
Metabolism and Gene Expression. J.N. Strathern, E.W. Jones,
and J.R. Borach, eds. (Cold Spring Harbor, New York: Cold
Spring Harbor Laboratory Press), pp. 1-37.
Frankel, A.D. and Kim, P.S. (1991). Modular structure of
transcription factors: implications for gene regulation. Cell
65, 717-719.
Fried, M. and Crothers, D.M. (1981). Equilibria and kinetics
of lac repressor-operator interactions by polyacrylamide gel
electrophoresis. Nucleic Acids Res. 9,6505-6525.
Fruton, J.S. (1972). Molecules and Life. (Wiley, New York).
Fruton, J.s. (1976). The emergence of biochemistry. Science
192, 327-334.
Ganster R.W., Shen W. and Schmidt, M.C. (1991). Isolation of
STD1, a high-copy-number suppressor of a dominant negative
mutation in the yeast TATA-binding protein. Mol. Cell. Biol.
13,3650-3659 .

121
Garner, M.M. and Revzin, A. (1981). A gel electrophoresis
method for quantifying the binding of proteins to specific
DNA regions: applications to components of Escherichia colii
lactose operon regulatory system. Nucleic Acids Res. 9,
3037-3060.
Gasch, A., Hoffmann, A., Horikoshi, M. Roeder, R.G., and
Chua, N-H. (1990). Arabidopsis thaliana contains two genes
for TFIID. Nature 346, 390-394.
Gasser, S.M. and Laemmli, U.K. (1986). Cohabitation of
acaffold binding regions with upstream/enhancer elements of
three developmentally regulated genes. Cell 46, 521-530.
Gasser, S.M. and Laemmli, U.K. (1987). A glimpse at
chromosomal order. Trends Gens. 3, 16-22.
Gay-Lassie, J.L. (1810). Extrait d'un memoire surla
fermentation. Ann. Chim 76, 245-259.
Giese, K. Amsterdam, A., and Gosschedl, R. (1991). DNA-
binding properties of the HMG domain of the lymphoid-specific
transcriptional regulator LEF-1. Genes Dev. 5,2567-2578.
Gill, G. Pascal, E., Tseng, Z., and Tjian, R. (1994). A
glutamine-rich hydrophobic patch in transcription factor Spl
contacts the dTAFIIlO component of the Drosophila TFIID
complex and mediates transcriptional activation. Proc. Natl.
Acad. Sci. USA 91, 192-196.
Gill, G. and Ptashne, M. (1988). Negative effect of the
transcriptional activator GAL4. Nature 33 4, 721-724.
Goodman, S.D. and Nash, H.A. (1989). Functional replacement
of a protein-induced bend in a DNA recombination site. Nature
341, 251-254.
Goodrich, J. Hoey, T., Thut, C., Admon, A., and Tjian, R.
(1993). Drosophila TAFII40 interacts with both a VP16
activation domain and the basal transcription factor TFIIB.
Cell 75, 519-530.
Gould, S.J. (1977). Ontogeny and phylogeny (Cambridge,
Massachusetts: Harvard University Press).
Green, S. and Chambn, P. (1987). Oestradiol induction of a
glucocorticoid-responsive gene by a chimaeric receptor.
Nature 325, 75-78.
Greenblatt, J. (1991a). Roles of TFIID in transcriptional
initiation by RNA polymerase II. Cell 66, 1067-1070.
Greenblatt, J. (1991b). RNA polymerase-associated
transcription factors. Trends Gens. 16, 408-411.

122
Guarente, L. (1988). UASs and enhancers: common mechanism of
transcriptional activation in yeast and mammals. Cell 52,
303-305.
Guarente, L. and Bermingham-McDonogh, 0. (1992). Conservation
and evolution of transcriptional mechanism in eukaryotes.
Trends Gens. 8, 27-32.
Haass, M.M. and Feix, G. (1992). Two different cDNAs encoding
TFIID proteins of maize. FEBS Lett. 301, 294-298.
Hahn, S., Buratowski, S., Sharp, P.A., and Guarente, L.
(1989). Isolation of the gene encoding the yeast TATA binding
protein TFIID: a gene identical to the SPT15 suppressor of
Ty element insertions. Cell 58, 1173-1181.
Hahn, S. (1993). Efficiency in activation. Science 363, 672-
673 .
Hanahan, D. (1983). Studies on transformation of Escherichia
eolia with plasmids. J. Mol. Biol. 166, 557-580.
Hardy, C.F.J., Balderes, D., and Shore, D. (1992). Dissection
of a carboxy-terminal region of the yeast regulatory protein
RAPl with effects on both transcriptional activation and
silencing. Mol. Cell. Biol. 12, 1209-1217.
Harley, V. Jackson, D., Hextall, P., Hawkins, J. Berkovitz,
G. Sockanathan, S., Lovell-Badge, R. and Goodfellow, P.N.
(1992). DNA binding activity of recombinant SRY from normal
males and XY females. Science 255, 453-456.
Harrison, S. and Aggarwal, A. (1990). DNA recognition by
proteins with the helix-turn-helix motif. Annu. Rev. Biochem.
59, 933-969.
Hawley, D. (1991). Transcriptional activation: enter TFIIB.
Trends Biol. Sci. 16, 317-318.
Heisenberg, W. (1971). Physics and Beyond. (New York: Harper
and Row Publishers).
Henry, Y.A., Chambers, A., Tsang, J.S.H., Kingsman, A.J., and
Kingsman, S.M. (1990). Characterization of the DNA binding
domain of the yeast RAPl protein. Nucleic Acids Res. 18,
2617-2623 .
Hess, B., Bioteux, A., and Kruger, J. (1969). Cooperation of
glycolytic enzymes. Adv. Enzyme Regl. 7, 149-169.
Himmelfarb, H.J., Pearlberg, J., Last, D.H., and Ptashne, M.
(1990) GAL11P: a yeast mutation that potentiates the effect
of weak GAL4-derived activators. Cell 63, 1299-1309.
Hochschild, A. and Ptashne, M. (1986) Cooperative binding of
lambda repressors to sites separated by intergral turns of
the DNA helix. Cell 44, 681-687.

123
Hoey, T. Dynlacht, B.D. Peterson, M.G., Pugh, B.F., and
Tjian, R. (1990). Isolation and characterization of the
Drosophila gene encoding the TATA box binding protein, TFIID.
Cell 61, 1179-1186.
Hoffmann, A., Sinn, E., Yamamoto, T. Wang, J. Roy, A.,
Horikoshi, M. and Roeder, R.G. (1990). Highly conserved core
domain and unique N terminus with presumptive regulatory
motifs in a human TATA factor (TFIID). Nature 346, 387-390.
Hofmann, J.F-X., Laroche, T. Brand, A.H., and Gasser, S.M.
(1989). RAP-1 loop formation is necessary for DNA loop
formation in vitro at the silent mating type locus HML. Cell
57, 725-737.
Holland, M.J., and Holland, J.P. (1978). Isolation and
identification of yeast messenger ribonucleic acids coding
for enolase, glyceraldehyde-3-phosphate dehydrogenase, and
phosphoglycerate kinase. Biochemistry 17, 4900-4907.
Holland, M.J., Yokoi, T. Holland, J.P., Myambo, K., and
Innis, M.A. (1987). The GCR1 gene encodes a positive
transcriptional regulator of the enolase and
glyceraldehyde-3-phosphate dehydrogenase gene families in
Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 813-820.
Hollenberg, S.M. and Evans, R.M. (1988). Multiple and
cooperative Trans-activation domains of the human
glucocorticoid receptor. Cell 55, 899-906.
Hope, I.A. and Struhl, K. (1987). GCN4, eukaryotic
transcriptional activator protein, binds as a diamer to
target DNA. EMBO J. 6, 2781-2784.
Horikoshi, M. Bertuccioli, C., Takada, R. Wang, J.,
Yamamoto, T., and Roeder, R.G. (1992). Transcription factor
TFIID induces DNA bending upon binding to the TATA element.
Poc. Natl. Acad. sci. USA 89, 1060-1064.
Horikoshi, M. Wang, C.K., Fujii, H. Cromlish, J.A., Weil,
P.A., and Roeder, R.G. (1989). Cloning and structure of a
yeast gene encoding a general transcription initiation factor
TFIID that binds to the TATA box. Nature 341, 299-303.
Huet, J., Cottrelle, P., Cool, M. Vignais, M.L., Thiele, D.,
Marck, C., Buhler, J-M., Sentenac, A., and Fromageot, P.
(1985). A general upstream binding factor for genes of the
yeast translational apparatus. EMBO J. 4, 3539-3547.
Huie, M.A., Scott, E.W., Drazinic, C.M., Lopez, M.C.,
Hornstra, I.K., Yang, T.P., and Baker, H.V. (1992).
Characterization of the DNA-binding activity of GCR1: in
vivo evidence for two GCRl-binding sites in the upstream
activating sequence of TPI of Saccharomyces cerevisiae. Mol.
Cell. Biol. 12. 2690-2700.

124
Irvine, D. Tuerk, C., and Gold, L. (1991). Systematic
evolution of ligand by exponential enrichment with integrated
optimization by non-linear analysis. J. Mol. Biol. 222,
739-761.
Irwin, N. and Ptashne, M. (1987) Mutants of the catabolite
activator protein of Escherichia coli that are specifically
deficient in the gene-activation function. Poc. Natl. Acad,
sci. USA 84, 8315-8319.
Jacob, F. (1977). Evolution and tinkering. Science 196, 1161.
Janknecht, R. Hipskind, R., Houthaeve, T. Nordheim, A., and
Stunnenberg, H. (1992). Identification of multiple SRF N-
terminal phosphoryation sites affecting DNA binding
properties. EMBO J. 11,1045-1054.
Janson, L. and Pettersson, U. (1990). Cooperative
interactions between transcription factors Spl and OTF-1.
Proc. Natl. Acad. Sci. USA 87, 4732-4736.
Jantzen, H., Chow, A., King, D. and Tjian, R. (1992).
Multiple domains of the RNA polymerase I activator hUBF
interact with the TATA-binding protein complex hSLl to
mediate transcription. Genes Dev. 6, 1950-1963.
Jordan, S. and Pabo, C.O. (1988). Structure of the lambda
complex at 2.5A resolution: details of the
repressor-operator interactions. Science 242, 893-907.
Ju, Q. Morrow, B.E., and Warner, J.R. (1990). REBl, a yeast
DNA-binding protein with many targets, is essential for
growth and bears some resemblance to the oncogene myb. Mol.
Cell. Biol. 10, 5226-5234.
Kahn, J. and Crothers, D. (1992). Protein-induced bending and
DNA cyclization. Proc. Natl. Acad. Sci. USA 89, 6343-6347.
Kahn, J. and Crothers, D. (1994). Cetection of localized DNA
flexibility. Nature 368, 163-166.
Kakidani, H. and Ptashne, M. (1987). GAL4 activates gene
expression in mammalian cells. Cell 52, 161-167.
Kao, C.C., Lieberman, P.M., Schmidt, M.C., Zhou, Q. Pei, R. ,
and Berk, A.J. (1990). Cloning of a transcriptionally active
human TATA binding factor. Science 248, 1646-1650.
Karim, F.D., Urness, L.D., Thummel, C.S., Klemsz, M.J.,
McKercher, S.R., Celada, A., VanBeveren, C., Maki, R.A. ,
Gunther, C.V., Nye, J.A., and Graves, B.J. (1990). The
ETS-domain: a new DNA-binding motif that recognizes a
purine-rich core DNA sequence. Genes Dev. 4, 1451-1453.

125
Karlin, S. and Brendel, V. (1992). Chance and statistical
significance in protein DNA sequence analysis. Science 257,
39-49.
Kassavetis, G.A., Bartholomew, B., Blanco, J.A., Johnson,
T.E., and Geiduschek, E.P. (1991). Two essential components
of the Saccharomyces cerevisiae transcription factor TFIIB:
transcription and DNA-binding properties. Poc. Natl. Acad,
sci. USA 88, 7308-7312.
Kawasaki, G. and Fraenkel, D.G. (1982). Cloning of yeast
glycolysis genes by complementation. Biochem. Biophys. Res.
Commun. 108, 1107-1112.
Kelleher III, R.J., Flanagan, P.M., Chasman, D.I.,
Ponticelli, A.S, Struhl, K., and Kornberg, R.D. (1992). Yeast
and human TFlIDs are interchangeable for the response to
acidic transcriptional activators in vitro. Genes Dev. 6,
296-303 .
Kerppola, T.K. and Curran, T. (1991). DNA bending by Fos and
Jun: the flexible hinge model. Science 254, 1210-1214.
Kierkegaard, S. (1975). Journals and Papers, (translated by
H.V. Hong and E.H. Hong) Bloomington: Indiana University
Press.
Kim J., Nikolov, D. and Burley, S. (1993). Co-crystal
structure of TBP recognizing the minor groove of a TATA
element. Nature 365, 520-527.
Kim, J., Zwieb, C., Wu, C., and Adhy, S. (1989). Bending of
DNA by gene-regulatory proteins: construction and use of a
DNA bending vector. Gene 85, 15-23.
Kimmerley, W.J., Buchman, A., Kornberg, R.D., and Rie, J.
(1988). Roles of two DNA-binding factors in replication,
segregation and transcriptional repression mediated by a
yeast silencer. EMBO J. 7, 2241-2253.
King, M.C. and Wilson, A.C. (1975). Evolution on two levels
in human and chimpanzee. Science 188, 107-116.
Kohler, R.E. (1972). The Enzyme Theory and the Origin of
Biochemistry. (Philadelphia, W.B. Saunders).
Kornberg, A. (1989). For the Love of Enzymes. (Cambridge,
Mass) .
Kornberg, R.D. and Lorch, Y. (1991). Irresistible force meets
immovable object: transcription and the nucleosome. Cell 67,
833-836.
Lahm, A. and Suck, D. (1991) DNasel-induced DNA
conformation. 2A structure of a DNasel-octamer complex. J.
Mol. Biol. 222, 645-667.

126
Lavoisier, A.I. (1789). Elements of Chemistry, translated by
R. Kerr (Creech. Edinburgh) .
Leidig, F., Shepard, A.R., Zhang, W. Stelter, A., Cattini,
P.A., Baxter, J.D., and Eberhardt, N.L. (1992). Thyroid
hormone responsiveness in human growth hormone-related genes.
J. Biol. Chem. 267, 913-921.
Letovsky, J. and Dynan, W.S. (1989). Measurement of the
binding of transcription factor Spl to a single GC box
recognition sequence. Nucleic Acids Res. 13, 2639-2653.
Leuther, K.K., Salmern, J.M., and Johnston, S.A. (1993).
Genetic evidence that an activation domain of GAL4 does not
require acidity and may form a (3 sheet. Cell 72, 575-585.
Levine, A.S. (1989). A new reductionism and a new journal.
New Biol. 1, 1-2.
Lewin, B. (1990). Commitment and activation at pol II
promoters: a tail of protein-protein interactions. Cell 61,
1161-1164 .
Lieberman, P.M., Schmidt, M.C., Kao, C.C., and Berk, A.J.
(1991) Two distinct domains in the yeast transcription
factor IID and evidence for a TATA box-induced conformational
change. Mol. Cell. Biol. 11, 63-74.
Lin, Y-S. and Green, M.R. (1991). Mechanism of action of an
acidic transcriptional activation vitro. Cell 64, 971-981.
Longtine, M.S., Wilson, N.M., Petracek, M.E., and Berman, J.
(1989). A yeast telomere binding activity binds to two
related telomere sequence motifs and is indistinguishable
from RAPl. Curr. Genet. 16, 225-239.
Luscher, B. Christenson, E., Litchfield, D.W., Krebs, E.G.,
and Eisenman, R.N. (1990). Myb DNA binding inhibited by
phosphorylation at a site deleted during oncogenic
activation. Science 344, 517-522.
Lustig, A.J., Kurtz, S., and Shore, D. (1990). Involvement of
the silencer and UAS binding protein RAPl in regulation of
telomere length. Science 250, 549-553.
Ma, J. and Ptashne, M. (1987a) A new class of yeast
transcriptional activators. Cell 51, 113-119.
Ma, J. and Ptashne, M. (1987b). Deletion analysis of GAL4
defines two transcriptional activating segments. Cell 48,
847-853 .

127
Machida, M. Jigami, Y. and Tanaka, H. (1989). Purification
and characterization of a nuclear factor which binds
specifically to the upstream activation sequence of
Saccharomyces cerevisiae enolase 1 gene. Eur. J. Biochem.
184, 305-311.
Malik, S., Hisatake, K. Sumimoto, H. Horikoshi, M. and
Roeder, R.G. (1991). Sequence of general transcription factor
TFIIB and relationships to other initiation factors. Poc.
Natl. Acad. sci. USA 88, 9553-9557.
Marahrens, Y. and Stillman, B. (1992). A yeast chromosomal
origin of DNA replication defined by multiple functional
elements. Science 255, 817-823.
Marshall, M. Mahoney, D., Rose, A., Hicks, J.B., and Broach,
J.R. (1987). Functional domains of SIR4, a gene required for
position effect regulation in Saccharomyces cerevisiae. Mol.
Cell. Biol. 7, 4441-4452.
Martin, K.J. (1991) The interactions of transcription
factors and their adaptors, coactivators and accessory
proteins. BioEssays 13, 499-503.
Matsui, T. Segall, J., Weil, P.A., and Roeder, R.G. (1980).
Multiple factors required for accurate initiation of
transcription by purified RNA polymerase II. J. Biol. Chem.
255, 11992-11996.
Mayr, E. (1970). Population, Species, and Evolution
(Cambridge, Massachusetts: Harvard University Press).
McNeil, J.B., Dykshoorn, P. Huy, J.N., and Small, S. (1990).
The DNA-binding protein RAP1 is required for efficient
transcriptional activation of the yeast PYK glycolytic gene.
Curr. Genet. 18, 405-412.
Mermod, N. O'Neill, E.A., Kelly, T.J., and Tjian, R. (1989).
The proline-rich transcriptional activator of CTF/NF-1 is
distinct from the replication and DNA binding domain. Cell
58, 741-753.
Messing, J. New M13 vectors for cloning. (1983). Methods
Enzymol. 101, 20-78.
Meyers, R. and Sharp, P. (1993). TATA-binding protein and
asociated factors in polymerase II and polymerase III
transcription. Mol. Cell. Biol. 13, 7953-7960.
Mitchell, P.J. and Tjian, R. (1989). Transcriptional
regulation in mammalian cells by sequence-specific DNA
binding proteins. Science 245, 371-378.

128
Moehle, C.M. and Hinnebusch, A.G. (1991). Association of RAPl
binding sites with stringent control of ribosomal protein
gene transcription in Saccharomyces cerevisiae. Mol. Cell.
Biol. 11, 2723-2735.
Morrow, B.E., Johnson, S.P., and Warner, J.R. (1989).
Proteins that bind to the yeast rDNA enhancer. J. Biol. Chem.
264, 9061-9068.
Morrow, B.E., Ju, Q. and Warner, J.R. (1990). Purification
and characterization of the yeast rDNA binding protein REBl.
J. Biol. Chem. 265, 20778-20783.
Morse, R.H. (1992). Transcribed chromatin. Trends Biol. Sci.
17, 23-26.
Muhich, M.L., Iida, C.T., Horikoshi, M. Roeder, R. and
Parker, C.S. (1990) cDNA clone encoding Drosophila
transcription factor TFIID. Poc. Natl. Acad. sci. USA
87, 9148-9152 .
Nasmyth, K.A. (1982). The regulation of yeast mating-type
chromatin structure by SIR: an action at a distance
affecting both transcription and transposition. Cell 30,
567-578 .
Nelson, H.B. and Laughon, A. (1990). The DNA binding
specificity of the Drosophila fushi tarazu protein: a
possible role for DNA bending in homeodomain recognition. New
Biol. 2, 171-178.
Newton, I. (1718). Opticks: or a Treatis of the Reflections,
Refractions, Inflections and Colours of Light. (Innys,
London).
Nietzsche, F. (1967). The Will to Power, (translated by W.
Kaufmann) New York: Random House.
Nikolov, D. Hu, S. Lin, J. Gasch, A., Hoffmann, A.
Horikoshi, M. Chua, N. Roeder, R. and Burley, S. (1992).
Crystal structure of TFIID TATA-box binding protein. Nature
360, 40-46.
Nishizawa, M. Araki, R., and Teranishi, Y. (1989).
Identification of an upstream activating sequence and an
upstream repressible sequence of the pyruvate kinase gene of
the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 9,
442-451.
Nishizawa, M. Suzuki, Y., Nogi, Y., Matsumoto, K., and
Fukasawa, T. (1990). Yeast Galll protein mediates the
transcriptional activation signal of two different
transacting factors, Gal4 and general regulatory factor
I/repressor/activator site binding protein 1/translation
upstream factor. Poc. Natl. Acad. sci. USA 87, 5373-5377.

129
Ogden, J.E., Stanway, C., Kim, S., Mellor, J., Kingsman,
A.J., and Kingsman, S.M. (1986). Efficient expression of the
Saccharomyces cerevisiae PGK gene depends on an upstream
activating sequence but does not require TATA sequences. Mol.
Cell. Biol. 6, 4334-4343.
Ohkuma, Y. Sumimoto, H., Hoffmann, A., Shimasaki, S.,
Horikoshi, M., and Roeder, R.G. (1991). Structural motifs and
potential homologies in the large subunit of human general
transcription factor TFIIE. Nature 354, 398-401.
Oliphant, A.R. and Struhl, K. (1987). The use of
random-sequence oligonucleotides for determining consensus
sequences. Meth. Enzymol. 155, 568-582.
Oliphant, A.R. and Struhl, K. (1988). Defining the consensus
sequence of E. coli promoter elements by random selection.
Nucleic Acids Res. 16, 7673-7683.
Oliphant, A.R., Brandi, C.J., and Struhl, K. (1989). Defining
the sequence specificity of DNA-binding proteins by selecting
binding sites from random-sequence oligonucleotides:
analysis of yeast GCN4 protein. Mol. Cell. Biol. 9,
2944-2949.
Oliver, S.G. (1991). Classical yeast biotechnology.
Biotechnology Handbooks 4, 213-243.
O'Neil, K.T., Hoess, R.H., and DeGrado, W.F. (1990). Design
of DNA-binding peptides based on the leucine zipper motif.
Science 249, 774-778.
Ouellette, M. Chen, J. wright, W. and Shay, J. (1992).
Complexes containing the retinoblastoma gne product recognize
different DNA motifs related to the E2F binding site.
Oncogene 7, 1075-1081.
Pavlovic, B. and Horz, W. (1988). The chromatin structure at
the promoter of a glyceraldehyde phosphate dehydrogenase gene
from Saccharomyces cerevisiae reflects its functional state.
Mol. Cell. Biol. 8, 5513-5520.
Pearson, W.R. (1990). Rapid and sensitive sequence comparison
with FASTP and FASTA. Meth. Enzymol. 183, 63-98.
Pearson, W.R. (1991). Searching protein sequence libraries:
comparison of the sensitivity and selectivity of the
Smith-Waterman and FASTA algorithms. Genomics 11, 635-650.
Pearson, W.R. and Lipman, D.J. (1988). improved tools for
biological sequence comparison. Poc. Natl. Acad. sci. USA 85,
2444-2448.
Prez-Martn, J. and Espinosa, M. (1991) The RepA repressor
can act as a transcriptional activator by inducing DNA bends.
EMBO J. 10, 1375-1382.

130
Peterson, M.G., Inostroza, J. Maxon, M.E., Flores, 0.,
Admon, A., Reinberg, D. and Tjian, R. (1991). Structure and
functional properties of human general transcription factor
HE. Nature 354, 369-373.
Peterson, M.G., Taese, N. Pugh, B.F., and Tjian, R. (1990).
Functional domains and upstream activation properties of
cloned human TATA binding protein. Science 248, 1625-1630.
Pfeifer, K. Arcangioli, B., and Guarente, L. (1987). Yeast
HAPl activator competes with the factor RC2 for binding to
the upstream activation site USA1 of the CYC1 gene. Cell 49,
9-18.
Polaczek, P. (1990). Bending of the origin of replication of
E. coli by binding of IHF at a specific site. New Biol. 2,
265-271.
Pollock, R. and Treisman, R. (1990). A sensitive method for
the determination of protein-DNA binding specificities.
Nucleic Acids Res. 18, 6197-6204.
Prentki, P., Chandler, M. and Galas, D.J. (1987).
Escherichia coli integration host factor bends the DNA at the
ends of IS1 and in an insertion hotspot with multiple IHF
binding sites. EMBO J. 6, 2479-2487.
Prentki, P., Pham, M-H., and Galas, D.J. (1987). Plasmid
permutation vectors to monitor DNA bending. Nucleic Acids
Res. 15, 10060.
Ptashne, M. (1988). How eukaryotic transcriptional activators
work. Nature 335, 683-689.
Ptashne, M. and Gann, A.F. (1990). Activators and targets.
Nature 346, 329-331.
Pugh, B.F. and Tjian, R. (1990). Mechanism of transcriptional
activation by Spl: evidence for coactivators. Cell 61,
1187-1197.
Pugh, B.F. and Tjian, R. (1992). Diverse transcriptional
functions of the multisubunit eukaryotic TFIID complex. J.
Biol. Chem. 267, 679-682.
Reinberg, D., Horikoshi, M. and Roeder, R.G. (1987). Factors
involved in specific transcription in mammalian RNA
polymerase II. functional analysis of initiation factors IIA
and identification of a new factor operating at sequences
downstream of the initiation site. J. Biol. Chem. 262,
3322-3330.
Reinberg, D. and Roeder, R.G. (1987). Factors involved in
specific transcription by mammalian RNA polymerase II.
Transcription factor IIS stimulates elongation of RNA chains.
J. Biol. Chem. 262, 3331-3337.

131
Remade, J. and Holmberg, S. (1992). A REBl-binding site is
required for GCN4-independent ILV1 basal level transcription
and can be functionally replaced by an ABFl-binding site.
Mol. Cell. Biol. 12, 5516-5526.
Rhode, P.R., Sweder, K.S., Oegema, K.F., and Campbell, J.L.
(1989). The gene encoding ARS-binding factor I is essential
for the viability of yeast. Genes Dev. 3, 1926-1939.
Rigby, R. (1993). Three in one and one in three: it all
depends on TBP. Cell 72, 7-10.
Riggs, A.D., Suzuki, H., Bourgeois, S. (1970). lac repressor-
operator interactions. J. Mol. Biol.48, 67-83.
Riggs, P.D. (1990). Expression and purification of
maltose-binding protein fusions. In Current protocols in
molecular biology. F.M. Ausubel, R.E. Brent, and R.P. Perry,
eds. (New York, New York: Green Publishing Associates and
Wiley Interscience),
Rie, J. and Herskowitz, I. (1987). Four genes responsible
for position effect on expression from HML and HMR in
Saccharomyces cerevisiae. Genetics 116, 9-22.
Roeder, R.G. (1991). The complexities of eukaryotic
transcription initiation: regulation of preinitiation
complex assembly. Trends Gens. 16, 402-408.
Rose, M.D., Winston, F., and Hieter, P. (1990). Methods in
Yeast Genetics (Cold Spring Harbor, New York: Cold Spring
Harbor Laboratory Press).
Ruppert, S., Wang, E., and Tjian, R. (1993). Cloning and
expression of human TAFII250: a TBP-associated factor
implicated in cell-cylcle regulation. Nature. 362, 175-179.
Ryder, K., Silver, S., DeLucia, A., Fanning, E., and
Tegtmeyer, P. (1986). An altered DNA conformation in origin
region I is a determinant for the binding of SV40 large T
antigen. Cell 44, 719-725.
Saltzman, A.G. and Weinmann, R. (1989). Promoter specificity
and modulation of RNA polymerase II transcription. FASEB J.
3, 1723-1733.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989).
Molecular Cloning (Cold Spring Harbor, New York: Cold Spring
Harbor Laboratory Press).
Samuels, M., Fire, A., and Sharp, P.A. (1982). Separation and
characterization of factors mediating accurate transcription
by RNA polymerase II. J. Biol. Chem. 257, 14419-14427.

132
Sanger, F. Nicklen, S., and Coulson, A. (1977). DNA
sequencing with chain-terminating inhibitors. Proc. Natl.
Acad. Sci. USA 74, 5463-5467.
Santangelo, G.M. and Tornow, J. (1990). Efficient
transcription of the glycolytic gene ADHl and three
translational component genes requires the GCRl product,
which can act through TUF/GRF/RAP binding sites. Mol. Cell.
Biol. 10, 859-862.
Sauer, R., Jordan, S., and Pabo, C. (1990). Lambda repressor:
a model system for understanding protein-DNA interactions.
Adv. Protein Chem. 40, 1-61.
Sawadogo, M. (1990). RNA polymerase B (II) and general
transcription factors. Annu. Rev. Biochem. 59, 711-754.
Sawadogo, M. and Roeder, R.B. (1985). Interaction of a
gene-specific transcription factor with the Adenovirus major
late promoter upstream of the TATA box region. Cell 43,
165-175.
Schauer, M. Chalepakis, G., Willmann, T. and Beato, M.
(1989). Binding of hormone accelaerates the kinetics of
glucocorticoid and progesteron receptor binding to DNA.
Schmidt, M.C., Kao, C.C., Pei, R. and Berk, A.J. (1989).
Yeast TATA-box transcription factor gene. Poc. Natl. Acad,
sci. USA 86, 7785-7789.
Schmidt, M.C., Zhou, Q. and Berk, A.J. (1989). Spl activates
transcription without enhancing DNA-binding activity of the
TATA box factor. Mol. Cell. Biol. 9, 3299-3307.
Schrodinger, E. (1959). Mind and Matter. (Cambridge:
Cambridge University Press).
Schroth, G.P., Cook, G.R., Bradbury, E.M., and Gottesfeld,
J.M. (1989). Transcription factor IIIA induced bending of the
Xenopus somatic 5S gene promoter. Nature 340, 487-488.
Schultz, M.C., Reeder, R., and Hahn, S. (1992). Variants of
the TATA-binding protein can distinguih subsets of RNA
plymerase I, II, and III promoters. Cell 69, 697-702.
Schultz, S.C., Shields, G.C., and Steitz, T.A. (1991).
Crystal structure of a CAP-DNA complex: the DNA is bent by
90. Science 253, 1001-1007.
Schwann, T. (1838). Vorlaufige Milteilung, betreffend Versuch
uber die Weingarung und Faulnis. Ann. Phys. 41, 184-193.
Schwann, T. (1839). Mikroskopische Untersuchungen. (Berlin
Sander) .

133
Scott, E.W. (1992). Expression of the TPI gene of
Saccharomyces cerevisiae is controlled by a single complex
upstream activating sequence containing binding sites for
three trans-acting factors: REB1, RAP1, and GCR1. Ph.D.
dissertation, University of Florida.
Scott, E.W. and Baker, H.V. (1993).Concerted action of the
transcriptional activators REB1, RAP1, and GCR1 in the high-
level expression of the glycolytic gene TPI. Mol. Cell. Biol.
13, 543-550.
Scott, E.W., Allison, H.E., and Baker, H.V. (1990).
Characterization of TPI gene expression in isogeneic
wild-type and gcrl-deletion mutant strains of Saccharomyces
cerevisiae. Nucleic Acids Res. 18, 7099-7107.
Seta, F.D., Ciafre, S-A., Marck, C., Santoro, B., Presutti,
C., Sentenac, A., and Bozzoni, I. (1990). The ABF1 factor is
the transcriptional activator of the L2 ribosomal protein
gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 10,
2437-2441.
Sharp, P.A. (1992). TATA-binding protein is a classless
factor. Cell 68, 819-821.
Sherman, F. Fink, G.R., and Hicks, J.B. (1986). Methods in
Yeast Genetics (Cold Spring Harbor, New York: Cold Spring
Harbor Laboratory Press).
Shore, D. and Nasmyth, K. (1987). Purification and cloning of
a DNA binding protein from yeast that binds to both silencer
and activator elements. Cell 51, 721-732.
Shore, D. Stillman, D.J., Brand, A.H., and Nasmyth, K.
(1987). Identification of silencer binding proteins from
yeast: possible roles in SIR control and DNA replication.
EMBO J. 6, 461-467.
Sigler, P.B. (1988). Acid blobs and negative noodles. Nature
333, 210-212.
Singer, V.L., Wobbe, C.R., and Struhl, K. (1990). A wide
variety of DNA sequences can functionally replace a yeast
TATA element for transcriptional activation. Genes Dev. 3,
636-645.
Snyder, U.K., Thompson, J.F., and Landy, A. (1989). Phasing
of protein-induced DNA bends in a recombination complex.
Nature 341, 255-257.
Stahl, G.E. (1697). Zymotechnie fundamentalis order
allgemeine Grund-erkamtuis der Gahrungs-kunst. (Frankfurt and
Liepzig).

134
Stanway C.A. Chambers, A., Kingsman A.J., and Kingsman, S.M.
(1987). Characterization of the transcriptional potency of
sub-elements of the UAS of the yeast PGY mini-promoter.
Nucleic Acids Res. 17, 9205-9218.
Stanway, C., Mellor, J. Ogden, J.E., Kingsman, A.J., and
Kingsman, S.M. (1987). The UAS of the yeast PGK gene contains
functionally distinct domains. Nucleic Acids Res. 15,
6855-6873 .
Stanway, C.A., Sowden, M.P., Wilson, L.E., Kingsman A.J., and
Kingsman, S.M. (1987). Efficient activation of transcription
in yeast by the BPV1 E2 protein. Nucleic Acids Res. 17, 2187-
2196.
Stanway, C.A., Chambers, A., Kingsman, A., and Kingsman, S.
(1989). Characterization of the transcriptional potency of
sub-elements of the UAS of the yeast PGK gene in a PGK mini
promoter [published erratum appears in Nucleic Acid Res. 25,
10526]. Nucleic Acids Res. 25,9205-9218.
Stanway, C.A., Gibbs, J.M., Kearsey, S.E., Lopez, M.C., and
Baker, H.V. (1994). The yeast co-activator GAL11 positively
influences transcription of the phosphoglycerate kinase gene,
but only when RAP1 is bound to its upstream activation
sequence. Mol. Gen. Genet.243, 207-214.
Struhl, K. (1985). Naturally occurring poly(dA-dT) sequences
are upstream promoter elements for constitutive transcription
in yeast. Poc. Natl. Acad. sci. USA 82, 8419-8423.
Struhl, K. (1987). Promoters, activator proteins, and the
mechanism of transcriptional initiation in yeast. Cell 49,
295-297 .
Suck, D. Lahm, A., and Oefner, C. (1988). Structure refined
to 2A of a nicked DNA octanucleotide complex with DNasel.
Nature 332, 464-468.
Suck, D. and Oefner, C. (1986). Structure of DNasel at 2.0A
resolution suggests a mechanism for binding to and cutting
DNA. Nature 321, 620-625.
Sumimoto, H., Ohkuma, Y. Sinn, E. Kato, H., Shimasaki, S.,
Horikoshi, M. and Roeder, R.G. (1991). Conserved sequence
motifs in the small subunit of human general transcription
factor TFIIE. Nature 354, 401-404.
Sussel, L. and Shore, D. (1991). Separation of
transcriptional activation and silencing functions of the
RAPl-encoded repressor/activator protein 1: isolation of
viable mutants affecting both silencing and telomere length.
Poc. Natl. Acad. sci. USA 88, 7749-7753.

135
Suzuki, M. (1990). The heptad repeat in the largest subunit
of RNA polymerase II binds by intercalating into DNA. Nature
344, 562-565.
Sweder, K.S., Rhode, P.R., and Campbell, J.L. (1988).
Purification and characterization of proteins that bind to
yeast ARSs. J. Biol. Chem. 263, 17270-17277.
Synder, M. Buchman, A.R., and Davis, R. (1986). Bent DNA at
a yeast autonomously replicating sequence. Nature 324, 87-89.
Sypes, M. and Gilmour, D. (1994). Protein/DNA crosslinking of
a TFIID complex reveals novel interactins downstream of the
transcription start. Nucleic Acids Res. 22, 807-814.
Taggart, A., Fisher, T. and Pugh, B. (1992). The TATA-
binding protein and associated factors are components of pol
III transcription factor TFIIIB. Cell 71, 1015-1028.
Talanian, R.V., McKnight, C.J., and Kim, P.S. (1990).
Sequence-specific DNA binding by a short peptide diamer.
Science 249, 769-771.
Tamura, T., Sumita, K. Fujino, I., Aoyama, A. Horikoshi, M.
Hoffmann, A. Roeder, R.G., Muramatsu, M. and Mikoshiba, K.
(1991). Striking homology of the 'variable' N-terminal as
well as the 'conserved core' domains of the mouse and human
TATA-factors (TFIID). Nucleic Acids Res. 19, 3861-3865.
Tornow, J. and Santangelo, G.M. (1990). Efficient expression
of the Saccharomyces cerevisiae glycolytic gene ADH1 is
dependent upon a cis-acting regulatory element (UASRPG) found
initially in genes encoding ribosomal proteins. Gene 90,
79-85.
Tornow, J., Xiao Z. Wei, G., and Santangelo, G.M. (1993).
GCR1, a transcriptional activator in Saccharomyces
cerevisiae, complexes with RAP1 and can function without its
DNA binding domain. EMBO J. 12, 2431-2437.
Travers, A.A. (1989). DNA conformation and protein binding.
Annu. Rev. Biochem. 58, 427-452.
Trumbly, R.J. (1992). Glucose repression in the yeast
Saccharomyces cerevisiae. Molecular Microbiology 6, 15-21.
Tsang, J.S.H., Henry, Y. Chambers, A., Kingsman, A.J., and
Kingsman, S.M. (1990). Phosphorylation influences the binding
of the yeast RAPl protein to the upstream activating sequence
of the PGK gene. Nucleic Acids Res. 18, 7331-7337.
Trkel, S. (1994). Transcriptional Regulation of Yeast
Retrotransposon Ty2-917. Ph.D. dissertation, University of
Maryland.

Uemura, H. and Fraenkel, D.G. (1990). gcr2, a new mutation
affecting glycolytic gene expression in Saccharomyces
cerevisiae. Mol. Cell. Biol. 10, 6389-6396.
136
Uemura, H. and Jigami, Y. (1992). Role of GCR2 in
transcriptional activation of yeast glycolytic genes. Mol.
Cell. Biol. 12, 3834-3842.
VanDyke, M.W. and Sawadogo, M. (1990). DNA-binding and
transcriptional properties of human transcription factor
TFIID after mild proteolysis. Mol. Cell. Biol. 10, 3415-3420.
VanHolde, K.E., Lohr, D.E., and Robert, C. (1992). What
happens to nucleosomes during transcription? J. Biol. Chem.
267, 2837-2840.
Van Hoy, M., Leuther, K.K., Kodadek, T. and Johnston, S.A.
(1993). The acidic activation domains of the GCN4 and GAL4
proteins are not alpha helical but form beta sheets. Cell. 72,
587-594.
Vignais, M.L., Huet, J., Buhler, J-M, and Sentenac, A.
(1990) Contacts between the factor TUF and RPG sequences. J.
Biol. Chem. 265, 14669-14674.
Vignais, M.L. and Sentenac, A. (1989). Asymmetric DNA bending
induced by the yeast multifunctional factor TUF. J. Biol.
Chem. 264, 8463-8466.
Vignais, M.L., Woudt, L.P., Wassenaar, G.M., Mager, W.H.,
Sentenac, A., and Planta, R.J. (1987). Specific binding of
TUF factor to upstream activation sites of yeast ribosomal
protein genes. EMBO J. 6, 1451-1457.
Warner, J.R. (1989). Synthesis of ribosomes in Saccharomyces
cerevisiae. Micro. Rev. 53, 256-271.
Weinzierl, R. Ruppert, S., Dynlacht, B., Taese, N. and
Tjian, R. (1993). Cloning and expression of Drosophila
TAFII60 and human TAFII70 reveal conserved interactions with
other subunits of TFIID. EMBO J. 12, 5303-5309.
Weiss, M.A., Ellenberger, T., Wobbe, C.R., Lee, J.P.,
Harrison, S.C., and Struhl, K. (1990). Folding transition in
the DNA-binding domain of GCN4 on specific binding to DNA.
Nature 347, 575-578.
White, R. and Jackson, S. (1992). Mechanism of TATA-binding
protein recruitment to a TATA-less class III promoter. Cell
71, 1041-1053.
White, R., Jackson, S., and Rigby, P. (1992). A role for the
TATA-box-binding protein component of the transcription
factor I ID complex as a general RNA polymerase III
transcipton factor. Poc. Natl. Acad. sci. USA 89,1949-1953.

137
Willett, C., Gelfman, C., and Holland, M. (1993). A complex
regulatory element from the yeast gene EN02 modulates GCR1-
dependent transciptional activation. Mol. Cell. Biol. 13,
2623-2633 .
Williams, J.S., Eckdahl, T.T., and Anderson, J.N. (1988).
Bent DNA functions as a replication enhancer in Saccharomyces
cerevisiae. Mol. Cell. Biol. 8, 2763-2768.
Williams, L.P. and Steffens, H.J. (1978). The History of
Science in Western Civilization. Washington D.C.: University
Press of America.
Willis, T. (1659). Dr. Willis' Practic of Physick (translated
by S. Pordage). (London: Dring, Harper and Leigh).
Wills, C. (1990). Regulation of sugar and ethanol metabolism
in Saccharomyces cerevisiae. Crit. Rev. Biochem. Mol. Biol.
25, 245-280.
Wobbe, C.R. and Struhl, K. (1990). Yeast and human
TATA-binding proteins have nearly identical DNA sequence
requirements for transcription in vitro. Mol. Cell. Biol. 10,
3859-3867.
Wong, J.M., Liu, F. and Bateman, E. (1992). Cloning and
expression of the Acanthamoeba castellana gene encoding
trancription factor TFIID. Gene 117, 91-97.
Workman, J.L. and Buchman, A.R. (1993). Multiple functions of
nucleosomes and regulatory factors in transcription. Trens.
Biochem. Sci. 18, 90-95.
Wu, H-M. and Crothers, D.M. (1984). The locus of
sequence-directed and protein-induced DNA bending. Nature
308, 509-513.
Yokomori, K. Chen, J., Admon, A., Zhou, S., and Tjian, R.
(1993). Molecular cloning and characterization of dTAFH30
alpha and dTAFII30 beta: two small subunits of Drosophila
TFIID. Genes Dev. 7, 2587-2597.
Zhang, X., Zhou, Y. Ebright, Y., and Ebright, R. (1992).
Catabolite gene activator protein (CAP) is not an "acidic
activating region' transcription activator protein.
Negatively charged amino aids of CAP that are solvent-
accessible in the CAP-DNA complex play no role in
transcription activation at the lac promoter. J. Biol. Chem.
267, 8136-8139.
Zinkel, S.S. and Crothers, D.M. (1991). Catabolite activator
protein-induced DNA bending in transcription initiation. J.
Mol. Biol. 219, 201-215.

BIOGRAPHICAL SKETCH
Michael Andrew Huie was born in 1963 in Munich to
Douglas T. Huie and Ingrid A.Huie. He attended college at
Columbia University in New York where he recieved an A.B.
degree in molecular biology in 1985. He studied medicine at
the University of Florida, recieving an M.D.degree in 1993.
He also recieved internship training at the University of
Florida between 1993 and 1994. He plans to further his
training studying dermatology at the University of
California, San Francisco begining in 1994.
138

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosphy.
^
Henry V. Baker, Chair
Associate Professor of Immunology
and Medical Microbiology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of
Philosphy.
Richard W. Moyer/
Professor of Immji
mblogy and
Medical MicrobiV
)l/ogy
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of/~'Doctr of Philosphy.
2 ..
Thomas P. Yang
Associate Professo
and Molecular Biol
iochemistry
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree
hilosphy,
Daniel Driscoll
Assistant Professor of Immunology
and Medical Microbiology

This dissertation was submitted to the Graduate Faculty
of the College of Medicine and to the Graduate School and was
accepted as partial fulfillment of the requirements for the
degree of Doctor of Philosophy.
Dean, College of Medicine
Dean, Graduate School

UNIVERSITY OF FLORIDA
3 1262 08554 8161



93
et al, 1990), and FASTA (Pearson and Lipman, 1988) [with a
Ktup of 1 for increased sensitivity (Pearson, 1991)],
uncovered no obvious homology to other known DNA-binding
proteins.
A number of sequence-specific DNA-binding proteins which
recognizes a centrally located 5'-GGAA-3' core (which is
complementary to 5'-TTCC-3') contain the ets-domain (Karim et
al., 1990). The primary amino acid sequence of the Gcrlp
DNA-binding domain displays no obvious homology to this class
of proteins. Although there are a tyrosine and two
tryptophan residues spaced 15 and 18 amino acids apart
similar to PU.l, a member of the ets family of proteins,
Gcrlp lacks the highly-conserved amino-acid residues
characteristic of the ets-family of proteins.
Although sequence analysis failed to identify other
proteins that contain a potential Gcrlp DNA-binding domain,
the algorithm of Karlin and Brendel (1992)--Statistical
Analysis of Protein Sequences (SAPS)--performed on the entire
Gcrlp amino acid sequence correctly predicted a DNA-binding
domain in the region of Gcrlp to where it was functionally
mapped (see Figure 20) This algorithm scores amino acids
based on their frequency in known DNA-binding domains. So,
although the Gcrlp DNA-binding domain does not show obvious
homology to known DNA-binding domains, the amino acids
residues present in the domain are well represented in known
DNA-binding domains.
Although no obvious homologies were found with known
DNA-binding proteins, when the DNA sequence coding for this


48
binding activity of the complex. If this were the case, then
Gcrlp would be included in the complex--based on the
supershift experiments. This study set out to confirm that
Gcrlp interacts directly with DNA in a sequence-specific
manner.
Gcrlp Expressed in E, coil or Rabbit Reticulocyte
Lvsate Binds to DNA
Throughout the course of this study Gcrlp, synthesized
in vitro from rabbit reticulocyte lysates and MBP-Gcrlp
fusion protein, expressed in E. coli, were used to
characterize the DNA binding activity of Gcrlp.
MBP-Gcrlp full-length fusion protein was produced in E.
coli strain TB1 harboring a plasmid encoding for a
malE::GCR1(1-844) gene fusions under the tac promoter. The
fusion protein was induced in E. coli by the addition of 2 mM
IPTG during the log phase of growth. Cell were then lysed by
passage through a French Pressure cell. Protein extracts
were analyzed by SDS-PAGE stained with Coomassie blue (data
not shown). Protein concentration, pre-determined by the
method of Bradford (1976), ranged from 0.068 to 0.2 mg/ml.
The amount of extract used in band shift assays varied
depending on the preparation. Typically between 3 and 15
microliters were used in band shift assays. The volume used
was determined by titrating DNA-binding activity. It was
noted that if extracts were used immediately less volume was
necessary to detect binding. If extract was used after
overnight storage at -20 C then a larger volume was necessary
for detectable activity (data not shown). This was


GCR1
I i
Hindlll Seal
I I
Sphl Haelll
TAA
Sail
1 -844
1 -890
1-594
1 -431
1-229
Figure 2. Templates used to generate carboxy-terminal deletions of Gcrlp.
A schematic representation of the GCRl structuaral gene cloned downstream
of the SP6 promoter is displayed. Digestion of the construct with the various
enzymes shown produce RNA templates coding for polypeptides of the length
display below (numbers refer to amino acids residues of Gcrlp).


114
REFERENCES
Affolter, M. Percival-Smith, A., Muller, M., and Leupin W.
(1990). DNA binding properties of the purified Antennapedia
homeodomain. Poc. Natl. Acad. sci. USA 87, 4093-4097.
Allison, L.A., Moyle, M., Shales, M., and Ingles, C.J.
(1985). Extensive homology among the largest subunits of
eukaryotic and prokaryotic RNA polymerases. Cell 42, 599-610.
Allison, L.A., Wong, J.K-C., Fitzpatrick, V.D., Moyle, M.,
and Ingles, C.J. (1988). The C-terminal domain of the largest
subunit of RNA polymerase II of Saccharomyces cerevisiae,
Drosophila melanogaster, and mammals: a conserved structure
with an essential function. Mol. Cell. Biol. 8, 321-329.
Amann, E., Brosius, J., and Ptashne, M. (1983). Vectors
bearing a hybrid trp-lac promoter useful for regulated
expression of cloned genes in Escherichia coli. Gene 25,
167-178 .
Amati, B.B. and Gasser, S.M. (1988). Chromosomal ARS and CEN
elements bind specifically to the yeast nuclear scaffold.
Cell 54, 967-978.
Anderson, J.N. (1986). Detection, sequence patterns and
function of unusual DNA structures. Nucleic Acids Res. 14,
8513-8533 .
Arndt, K.T., Styles, C.A., and Fink, G.R. (1989). A
suppressor of a HIS4 transcriptional defect encodes a protein
with homology to the catalytic subunit of protein
phosphatase. Cell 56, 527-537.
Aso, T., Vasavada, H.A., Kawaguchi, T. Germino, F.J.,
Ganguly, S., Kitajima, s., Weissman, S.M., and Yasukochi, Y.
(1992). Characterization of cDNA for the large subunit of the
transcription initiation factor TFIIF. Nature 355, 461-464.
Ausubel, F.M., Brent, R. Kingston, R.E., Moore, D.D.,
Seidman, J.G., Smith, J.A., and Struhl, K. (1989). Current
Protocols in Molecular Biology (New York, New York: Greene
Publishing Associates and Wiley-Interscience).
Baker, H.V. (1986). Glycolytic gene expression in
Saccharomyces cerevisiae: nucleotide sequence of GCRl, null
mutations, and evidence for expression. Mol. Cell. Biol. 6,
3774-3784 .
Baker, H.V. (1991). GCRl of Saccharomyces cerevisiae encodes
a DNA binding protein whose binding is abolished by mutations
in the CTTCC sequence motif. Poc. Natl. Acad. sci. USA 88,
9443-9447.
Bennetzen, J.L. and Hall, B.D. (1982). Codon selection in
yeast. J. Biol. Chem. 257, 3026-3031.


20
gcrl-1 mutant strain DFY67 (Holland et al., 1987). Sequence
analysis suggested that a possible helix-turn-helix (H-T-H)
motif is present in the carboxyl terminal region of the
protein (Baker, 1986). H-T-H motifs are associated with DNA-
binding activity. Gcrlp was shown to posses DNA-binding
activity when it was demonstrated that the Gcrlp product
translated in rabbit reticulocyte lysate formed a nucleo-
protein complex with a DNA fragment isolated from the
upstream activation sequence element of TPIl (Baker, 1991).
Gcrlp was shown to bind a fragment of DNA from the TPIl
promoter which contained a CTTCC pentamer but was unable to
bind a related fragment in which the CTTCC sequence was
changed to CAACC (Baker, 1991). The CTTCC sequence element
had long been noted to be present in the promoters of
glycolytic genes (Ogden et al., 1986). By site-directed
mutagenesis or deletion analysis CTTCC sequence elements were
shown to be important for high-level expression of the genes
encoding phosphoglycerate kinase (Chambers et al., 1988),
enolase and pyruvate kinase (Buchman et al., 1988), and
trise phosphate isomerase (Scott and Baker, 1993). Bitter
et al. (1991) defined a sequence, GPE, which had a CTTCC
sequence element at its core in upstream activation
sequences.
Gpr2p
Mutation or deletion in the GCR2 locus also produces a
profound effect on expression of the glycolytic genes. gcr2
mutants were isolated during a screen for mutants affecting
expression of a ENOl: : lacZ gene fusion (Uemura and Fraenkel,


UNIVERSITY OF FLORIDA
3 1262 08554 8161


Figure 10. Titration of Gcrlp DNA-binding activity. The
concentration of active MBP-Gcrlp(690-844) fusion-protein was
determined by titrating increasing concentrations of radio-
labeled oligonucleotide carrying a single Gcrlp-binding site
(probe TPIlf listed in Table 3.) with a constant amount of
MBP-Gcrlp(690-844) A typical experiment is shown here. As
the amount of DNA was increased all of the active protein
appeared in the bound DNA (shifted) fraction. The amount of
DNA at plateau was determined by comparison to DNA standards
using a Phospholmager (Molecular Dynamics). Active protein
concentrations were thus expressed in DNA equivalents (see
Chadwick et al., 1970).


28
a final concentration of 2 mM to induce expression of the
malE::GCRl fusions genes. The cultures were then grown an
additional 2 hours at 37 C, following which time they were
harvested by centrifugation (4000 x g for 10 min at 4 C).
The supernatant was discarded and the wet weight of the
pellet was determined. The cells were suspended in 3 ml TEN
lysis buffer (50 mM Tris [pH 8.0], 1 mM EDTA, 50 mM NaCl) per
gram (pellet [wet weight] ) The bacteria were lysed by
passage through a French pressure cell at 20,000 lb/in2 by
the method of Clifton et al. (1978). Cellular debris was
removed by centrifugation at 17,000 x g for 20 min at 4 C.
The supernatant, containing the soluble cellular protein, was
recovered for further use. Protein extracts prepared in this
manner typically had a protein concentrations that ranged
from 0.068 to 0.2 mg/ml, as determined by the method of
Bradford (197 6).
Purification of MBP-GCR1 Fusion Protein
The Maltose-binding moiety of the hybrid MBP-Gcrlp(690-
844) fusion protein was utilized to purify the fusion protein
by affinity chromatography over an amylose column. The
amylose column was prepared in the following manner. A 15 ml
slurry of amylose resin was allowed to settle in a 2.5 x 10
cm column. The height of the packed resin was 1 cm giving a
total bed volume of 7 cm3. The column was then washed with
approximately 3 column volumes (25 ml).
Crude cellular lysates prepared as described above were
diluted 1:5 with column buffer (10 mM phosphate, 0.5 M NaCl,
1 mM azide, 1 mM DTT, 1 mM EGTA) containing 0.25% Tween 20 to


7
specific initiation (Comai et al., 1991; Schultz et al.,
1992; White et al., 1992).
Activators, Coactivators, and Adaptors.
Sequence-specific transcriptional factors are comprised
of two critical and separable domains; a DNA-binding domain
and an activation domain. This organization was first
demonstrated by Brent and Ptashne (1985) in the "domain
swapping" experiments with LexA and Gal4p. When the DNA-
binding domain of LexA was fused with the activation domain
of Gal4p, transcriptional activation occurred through a LexA-
binding site. Even more dramatic, the DNA-binding, ligand
binding, and activation domains of the estrogen and
glucocorticoid receptors could be swapped to produce an
estrogen responsive glucocorticoid receptor (Green and
Chambn, 1987); or the ligand binding and activation domain
of the glucocorticoid receptor could be fused to Gal4p to
produce hormonal dependent activation at a Gal4p-binding site
(Hollenberg and Evans, 1988). This flexibility with which
domains can be swapped has been one of the many surprises in
the study of transcriptional activating proteins.
Another surprise was that often the secondary structure
of these domains are not pre-folded but are formed and
stabilized upon ligand interaction. Although the DNA-binding
domains often have well defined motifs, ligand binding often
contributes to their stability. For example, the DNA-binding
domain of Gcn4p undergoes a coil to helix transition upon
binding to its operator site (Weiss et al., 1990; Talanian et
al., 1990; O'Neil et al., 1990). This loosely structured


43,000
68,000
to
U3 o
"J O
tt O
O o
NO RNA
RRL
Gcrlp
(1-844)
RRL
Gcrlp
(1-690)
RRL
Gcrlp
(1-594)
RRL
Gcrlp
(1-431)
RRL
Gcrlp
(1-229)
RRL
Ul
cn


112
this observation, have shown that a plasmid containing a 3'-
deletion of GCR1 introduced into the gcrl mutant strain HBY4
(which contains a deletion of the entire GCR1 structural
gene) were incapable of complementing the slow-growth
phenotype. These experiments, which were done under
conditions to select for retained plasmids, failed to confirm
the results of Tornow et al. (1994) Only the full length
GCR1 construct was capable of complementing HBY4. These
result suggest that Tornow et al. (1994 ) were selecting
second-site pseudorevertants of the gcrl mutant.
Tornow et al. (1994) also suggested that Gcrlp exerts
its affects through Raplp-binding site. However, a number of
different laboratories have shown that mutations of CTTCC
elements (Gcrlp-binding sites) results in severely reduced
expresssion of the cooresponding gene (Bitter et al., 1991;
Buchman et al., 1988; Chambers et al. 1988; Scott and Baker,
1993; Willet et al. 1993). Furthermore, Drazinic et al.
(1994 ) have shown by in vivo footprinting that mutations in
both Gcrlp-binding sites within UASrpu which reduce
expression of the cognate gene by 67-fold do not affect the
occupancy state of the adjacent Raplp-binding site. If Gcrlp
was recruited to the UAS element soley by protein-protein
interactions with Raplp, then one would not expect mutations
in the Gcrlp-binding sites to affect expression of the
cognate gene. The Data taken as a whole supports an
interdependency between Raplp and Gcrlp binding site at
glycolytic enzyme gene UAS elements in mediating GCR1-
dependent gene expression.


129
Ogden, J.E., Stanway, C., Kim, S., Mellor, J., Kingsman,
A.J., and Kingsman, S.M. (1986). Efficient expression of the
Saccharomyces cerevisiae PGK gene depends on an upstream
activating sequence but does not require TATA sequences. Mol.
Cell. Biol. 6, 4334-4343.
Ohkuma, Y. Sumimoto, H., Hoffmann, A., Shimasaki, S.,
Horikoshi, M., and Roeder, R.G. (1991). Structural motifs and
potential homologies in the large subunit of human general
transcription factor TFIIE. Nature 354, 398-401.
Oliphant, A.R. and Struhl, K. (1987). The use of
random-sequence oligonucleotides for determining consensus
sequences. Meth. Enzymol. 155, 568-582.
Oliphant, A.R. and Struhl, K. (1988). Defining the consensus
sequence of E. coli promoter elements by random selection.
Nucleic Acids Res. 16, 7673-7683.
Oliphant, A.R., Brandi, C.J., and Struhl, K. (1989). Defining
the sequence specificity of DNA-binding proteins by selecting
binding sites from random-sequence oligonucleotides:
analysis of yeast GCN4 protein. Mol. Cell. Biol. 9,
2944-2949.
Oliver, S.G. (1991). Classical yeast biotechnology.
Biotechnology Handbooks 4, 213-243.
O'Neil, K.T., Hoess, R.H., and DeGrado, W.F. (1990). Design
of DNA-binding peptides based on the leucine zipper motif.
Science 249, 774-778.
Ouellette, M. Chen, J. wright, W. and Shay, J. (1992).
Complexes containing the retinoblastoma gne product recognize
different DNA motifs related to the E2F binding site.
Oncogene 7, 1075-1081.
Pavlovic, B. and Horz, W. (1988). The chromatin structure at
the promoter of a glyceraldehyde phosphate dehydrogenase gene
from Saccharomyces cerevisiae reflects its functional state.
Mol. Cell. Biol. 8, 5513-5520.
Pearson, W.R. (1990). Rapid and sensitive sequence comparison
with FASTP and FASTA. Meth. Enzymol. 183, 63-98.
Pearson, W.R. (1991). Searching protein sequence libraries:
comparison of the sensitivity and selectivity of the
Smith-Waterman and FASTA algorithms. Genomics 11, 635-650.
Pearson, W.R. and Lipman, D.J. (1988). improved tools for
biological sequence comparison. Poc. Natl. Acad. sci. USA 85,
2444-2448.
Prez-Martn, J. and Espinosa, M. (1991) The RepA repressor
can act as a transcriptional activator by inducing DNA bends.
EMBO J. 10, 1375-1382.


41
sites of pUC18. The inserts of these plasmids, used for
radiolabeled DNA probes in bands shift assays, are listed in
Table 3.
A series of malE::GCRl gene fusions which carry various
deletions of the 5' end of the GCR1 structural gene were
prepared by cloning Gcrlp coding sequences into the plasmid
pMAL-c (Guan et al., 1987; Maina et al., 1988). The plasmid
pMAL-c express the malE gene, which encodes the E. coli
maltose binding protein (MBP), under control of the E. coli
tac promoter (Amann et al., 1983). A polylinker site is
located in the malE structural gene and allows in-frame
insertion of DNA fragments to construct fusion proteins under
a strong inducible promoter. Plasmid pMAL-GCRl(690-844),
which encodes a maltose binding protein (MBP)-Gcrlp fusion
protein containing amino acids 690-844 of Gcrlp, was created
by cloning the Haelll-Xbal fragment from plasmid pMH2 into
the Stul-Xbal sites of plasmid pMAL-c. Plasmid pMH2 contains
the Pstl-Sall genomic fragment of the GCR1 structural gene
cloned into the Pstl-Sall sites of plasmid pSP18.
Plasmid pMAL-GCRl(7 83-844) was created as follows:
Plasmid pMAL-GCRl(690-844) was cleaved with PpmuI. The
resulting overhang was filled in with dNTPs and the large
fragment of E. coli polymerase I. After phenol extraction
and ethanol precipitation the DNA was then cleaved with
Hindlll. The Ppmul-Hindlll fragment was isolated by 8% PAGE
and then cloned in-frame into the Stul-Hindlll sites of
pMAL-c.


113
Conc.l.u signs
The experiments described in this study demonstrate that
Gcrlp possesses a modular DNA-binding domain, located in the
carboxy-terminal 154 amino acids, that binds in a sequence
specific manner to the consensus sequence 5' (T/A)N(T/C)N
(G/A)NC(T/A)TCC(T/A)N(T/A)(T/A)(T/G)-3' with a high affinity
(Kd =2.9 x 10_10M), but low specificity. The DNA is
contorted when bound in the Gcrlp-DNA nucleoprotein complex.
The consensus sequence derived from the study of Gcrlp DNA-
binding corresponds to known cis-element demonstrated by
genetic methods to be important for GCR1 dependent
transcription. The results are consistent with the proposal
that additional proteins are important for facilitation of
Gcrlp binding and activation at the glycolytic gene upstream
activating sequences.


103
estimated (Giese et al., 1991) to be in high abundance in the
cell (20,000 molecules per cell), and this may drive the
factor to its site by mass action. IHF plays many different
roles in the cell (reviewed in Friedman, 1988), but it is
believed, fundamentally, to be a structural or 'archi
tectural' protein. This mechanism of high-level expression
is probably not the mechanism used by transcriptional
activators. A transcriptional activator with a low
specificity may not be tolerated well by the cell when
expressed at a high level. In fact many, if not most,
transcriptional factors are toxic to their host when
expressed at high levels. Presumably this is due to either
nonspecific binding or squelching of auxiliary transcription
factors (Gill and Ptashne, 1988) Full-length Gcrlp in fact
seems to be toxic when expressed at high levels in yeast
(Holt and Baker, unpublished observation) .
Another way in which proteins with low specificity can
find their binding sites is by interacting with other
proteins. According to this view, the Ka for a specific site
would be decreased by a cooperative interaction with another
DNA-binding protein (Giese et al., 1991). The in vivo
binding site would then consist of a nucleoprotein complex.
The other DNA-binding protein (s) would presumably have a
stronger DNA-binding affinity and specificity and bind to its
site(s) first. This complex would then facilitate the
binding of the protein with a low specificity through a
protein-protein interaction. This mechanism has been
proposed for the facilitation of the factor OTF-1 by Spl


6
revealed that TBP is a relatively small protein varying
amongst species between 22-39 Kd. The amino acids in the
carboxy-terminus of TBP are 75-85% identical in all eukaryote
TBP sequences currently known (Ganster et al. 1993; McAndrew
et al, 1993). This region, called the C-terminal core
domain, contains two repeats of 66-67 amino acids separated
by a highly basic region. The structure of TBP from
Arabidopsis Chaliana has been determined by X-ray diffraction
crystallography to a resolution of 2.6 (Nikolov et al.,
1992). The protein folds into two symmetrical and
topologically identical domains each derived from one of the
repeats (Nikolov et al., 1992; Rigby, 1993). The presumed
DNA binding surface is a curved, anti-parallel E-sheet
resembling a "saddle." Computer modeling revealed that DNA
would fit nicely into the concave surface of the saddle
(Nikolov et al., 1992; Rigby, 1993). When bound to DNA the
convex surface of the saddle is able to interact with other
transcriptional factors. Mutations in TBP that affect DNA
binding map to the concave region, while mutations that
affect the ability of TBP to interact with other proteins map
to the convex surface (Rigby, 1993).
The cloning of TBP along with the cloning of the major
components of TFIIB (Malik et al., 1991), TFIIE (Peterson et
al., 1991; Ohkuma et al., 1991; Sumimoto et al., 1991), and
TFIIF/RAP7 0/RAP30 (Aso et al. 1992; Finkelstein et al.,
1992) has allowed studies of the interaction between these
factors and activators to ensue. Recently, it has been shown
that TBP is also required by RNA polymerases -I and -III for


42
Plasmids pCDl, pCD2, pCD3, and pCD5 were kindly provided
by Carolyn M. Drazinic. These plasmids code for additional
5'-GCR1 deletions fused in frame with MBP. They contain the
following amino acids residues of GCR1: pCDl, MBP-GCR1(1-
844); pCD2, MBP-GCRl(277-844 ) ; pCD3, MBP-GCR1(422-844) ; pCD5,
MBP-GCR1(706-844).
In Vitro Transcription
Plasmid pHB66 (Baker, 1991) contains the GCR1 structural
gene (from an AflII restriction site located 136 bp 5' to the
translational start site to a Bel I site located 661 bp 3' to
the translational termination site) cloned downstream of the
SP6 promoter in the plasmid pSP19. This plasmid was
linearized with various restriction enzymes. After complete
digestion was confirmed by agarose gel electrophoresis, the
DNA was phenol extracted, ethanol precipitated, and
resuspended in TE. For a translation template for RAP1 the
plasmid pSP56RT (Chambers et al., 1989) was linearized by
cleavages with the restriction endonuclease XbaI, and was
prepared in a similar manner.
Five micrograms of linearized DNA was used as a template
in transcription reactions carried out in the presence of the
cap analog m7G(5')ppp(5')G using a kit from Promega, under the
following reaction conditions: 40 mM Tris [pH 7.5], 6 mM
MgCl2, 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 0.1 mg/ml BSA,
1 mM ATP, CTP, UTP, 0.1 mM GTP, 0.5 mM GpppG and 50 U or
RNasin. After transcription reactions were incubated with
SP6 RNA polymerase at 37 C for 60 min, the samples were
treated with DNase I for 15 min., phenol/chloroform


122
Guarente, L. (1988). UASs and enhancers: common mechanism of
transcriptional activation in yeast and mammals. Cell 52,
303-305.
Guarente, L. and Bermingham-McDonogh, 0. (1992). Conservation
and evolution of transcriptional mechanism in eukaryotes.
Trends Gens. 8, 27-32.
Haass, M.M. and Feix, G. (1992). Two different cDNAs encoding
TFIID proteins of maize. FEBS Lett. 301, 294-298.
Hahn, S., Buratowski, S., Sharp, P.A., and Guarente, L.
(1989). Isolation of the gene encoding the yeast TATA binding
protein TFIID: a gene identical to the SPT15 suppressor of
Ty element insertions. Cell 58, 1173-1181.
Hahn, S. (1993). Efficiency in activation. Science 363, 672-
673 .
Hanahan, D. (1983). Studies on transformation of Escherichia
eolia with plasmids. J. Mol. Biol. 166, 557-580.
Hardy, C.F.J., Balderes, D., and Shore, D. (1992). Dissection
of a carboxy-terminal region of the yeast regulatory protein
RAPl with effects on both transcriptional activation and
silencing. Mol. Cell. Biol. 12, 1209-1217.
Harley, V. Jackson, D., Hextall, P., Hawkins, J. Berkovitz,
G. Sockanathan, S., Lovell-Badge, R. and Goodfellow, P.N.
(1992). DNA binding activity of recombinant SRY from normal
males and XY females. Science 255, 453-456.
Harrison, S. and Aggarwal, A. (1990). DNA recognition by
proteins with the helix-turn-helix motif. Annu. Rev. Biochem.
59, 933-969.
Hawley, D. (1991). Transcriptional activation: enter TFIIB.
Trends Biol. Sci. 16, 317-318.
Heisenberg, W. (1971). Physics and Beyond. (New York: Harper
and Row Publishers).
Henry, Y.A., Chambers, A., Tsang, J.S.H., Kingsman, A.J., and
Kingsman, S.M. (1990). Characterization of the DNA binding
domain of the yeast RAPl protein. Nucleic Acids Res. 18,
2617-2623 .
Hess, B., Bioteux, A., and Kruger, J. (1969). Cooperation of
glycolytic enzymes. Adv. Enzyme Regl. 7, 149-169.
Himmelfarb, H.J., Pearlberg, J., Last, D.H., and Ptashne, M.
(1990) GAL11P: a yeast mutation that potentiates the effect
of weak GAL4-derived activators. Cell 63, 1299-1309.
Hochschild, A. and Ptashne, M. (1986) Cooperative binding of
lambda repressors to sites separated by intergral turns of
the DNA helix. Cell 44, 681-687.


CHARACTERIZATION OF THE DNA-BINDING ACTIVITY OF THE
SACCHAROMYCES CEREVISIAE TRANSCRIPTIONAL ACTIVATOR GCR1P
V\A^l
BY
MICHAEL ANDREW HUIE
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1994


5
machinery, thus stimulating transcription (reviewed in
Ptashne, 1988 and Ptashne and Gann, 1990). This is not the
only view put forward, however. Lin and Green (1991) have
proposed that binding of TFIIB represents the rate limiting
step that is enhanced by activators. The possibility that
different activators target different steps in assembly is
certainly reasonable (Mitchell and Tjian, 1989; Hawley,
1991) .
Characterization of TFIID had remained limited due to
the fact that it is difficult to purify in large yield and
due to its instability. Recently, however, it was found that
yeast TFIID was functionally interchangeable with human TFIID
(Buratowski et al., 1988; Cavallini et al., 1988). Easier
purification of the yeast factor was followed by molecular
cloning of the TATA-binding protein (TBP) component of the
complex, in yeast (Hahn et al. 1989; Eisenmann et al., 1989;
Horikoshi et al., 1989; Schmidt et al., 1989; Cavallini et
al. 1989). In yeast the 29 Kd TBP appears to be the major
and perhaps single component of TFIID. Cloning of TBP from
human (Peterson et al. 1990; Hoffmann et al., 1990) and
other species (Fikes et al., 1990; Hoey et al., 1990 ; Gasch
et al. 1990; Haass et al., 1992; Kao et al., 1990; Tamura et
al., 1991; Muhich et al., 1990; Ganster et al. 1991; Wong et
al., 1992) soon followed due to the remarkably high degree of
homology of 180 amino acid primary sequence at the carboxyl-
terminus of the protein.
TBP is composed of a conserved carboxy-terminal domain
and a divergent amino-terminal domain. Sequence analysis


LIST OF TABLES
Table
1. Oligonucleotides 32
2. Plasmids 38
3. Oligonucleotides containing CTTCC sequences 40
4. DNA-Binding Affinity of Select
Transcriptional Activators 99
v


39
Table 2. Plasmids (cont.)
Fibroid Comments
pUCT66
CATCC
sequence element
from
TPI1
cloned
into
Hindlll-
BamHI
site of pUC18
pUCT76
CTTCC
sequence element
from
TEF1
cloned
into
Hindlll-
BamHI
site of pUC18
pUCT77
CTTCC
sequence element
from
TEF1
cloned
into
Hindlll-
BamHI
site of pUC18
pUCT79
CTTCC
sequence element
from
CRY1
cloned
into
HindIII-
BamHI
site of pUC18
pUC66 UASypjj cloned into Hindlll-SphI site of pUC18
pCY4 Circular permutation assay vector
(Prentki et al., 1987)
pCY66 VAStpi1 cloned into Smal-Bglll site of pCY4


29
yield a final volume of 400 ml. The diluted lysate was
loaded onto the amylose column at the rate of 1 ml/min.
Following the addition of the crude lysate to the column, the
column was washed with 3 column volumes of column buffer
containing 0.25% Tween 20. The column was then washed with 6
column volumes column buffer without Tween 20. The hybrid
MBP-GCRl(690-844) fusion protein was then eluted from the
column by passing 10 nM maltose over the column in column
buffer. The fusion protein was collected in 3 ml aliquots.
Typically 15 fractions were collected.
Aliquots of 20 H-l of each fraction were subjected to
SDS-PAGE to identify fractions containing fusion protein. 20
^1 aliquots of each fraction were electrophoresed through a
10% SDS-PAGE. The resulting gel was stained with coomassie
blue to visualize the protein. Typically fusion protein
appeared across fractions 2 through 7. Fractions containing
the fusion protein were pooled and concentrated by
ultrafiltration through a low-adsorption, hydrophilic, [YM]
membrane with a 30 kiloDalton size exclusion using a
Centriprep-30 concentrator (Amicon) according to the
manufacture's specifications. Pooled fractions were added to
the Centriprep-30 concentrator and centrifuged for 5 min at
2600 rpm (5000 x g) in a Jouan CRF412 swinging-bucket
benchtop centrifuge. The filtrate was decanted and the
sample was centrifuged a second time for 10 min at 2600 rpm.
The final volume was approximately 1 ml. This sock solution
was confirmed by running 2 |IL into 10% SDS-PAGE and protein
visualized by staining with coomassie blue. Samples were


4
a specific system, that of glycolytic gene expression in S.
cerevisie.
Basal Transcriptional Machinery and TFIID
Transcriptional Factor IID (TFIID) has long been
believed to be the key link between promoter-specific
activation and RNA polymerase II basal initiation machinery.
TFIID is not a single protein but a large (>700 Kd) complex
(Pugh and Tjian, 1990; Dynlacht et al., 1991) which elutes at
0.6-1.0 M KC1 from a phosphocellulose column of human tissue
culture cells (Matsui et al.,1980; Samuels et al., 1982;
Davison et al., 1983). Reconstitution experiments had
revealed that TFIID is the only component capable of
sequence-specific DNA binding (Sawadogo and Roeder, 1985;
VanDyke et al.,1989; Davison et al., 1983). Largely due to
this observation and similar reconstitution experiments
(Buratowski et al., 1988), TFIID was proposed to be the first
factor to bind DNA with the aid of TFIIA (Reinberg et al.,
1987) and TFIIJ (Cortes et al., 1992 ) and then to recruit the
other basal machinery (TFII,-B,-E,-F,-G, and RNA polymerase
II) (reviewed in Saltzman and Weinmann, 1989; Roeder, 1991).
Additionally, in vitro the stable association of TFIID with
the TATA box is slow (Reinberg and Roeder, 1987; Schmidt et
al., 1989; Hahn et al. 1989; Lieberman et al., 1991). From
these observations the association of TFIID with the TATA box
is believed to be the first and rate limiting step in
transcription initiation. Presumably, promoter-specific
activators speed up or stabilize TFIID interaction with the
TATA box thereby allowing recruitment of the other basal


94
Figure 20. SAPS analysis of Gcrlp. The algorithm of Karlin
and Brendeal (1992) performed on the entire Gcrlp amino acid
sequence predicted a DNA-binding domain in the carboxy-
terminal region of Gcrlp. Numbers on the vertical axis
represent Ei, the excursion score. Numbers on the horizontal
axis represents the amino acid residues of Gcrlp. A
significance threshold of 5% corresponds to an EA score of 26.
The carboxy-terminal region of Gcrlp has a significantly high
Ei score. This region corresponds to the of DNA-binding
activity mapped in this study. The amino acid matrix
presented in Karlin and Brendel (1992), with a yeast codon
bias, was used to calculate Ei for this analysis.


73
different experiments. Under these condition the Kd could
easily be determined by the amount of active protein needed
to occupy half the DNA binding sites (see Riggs et al.( 1970
and Johnson et al., 1979). This follows from the fact that
starting with the equations,
protein-DNA <-> proteinfree + DNAfree,
Kd = [proteinfree] [DNAfree] / [protein-DNA]
and,
DNA^otai DNAfree + DNAdound
it can be shown that,
Kd = [protein] i/2 1/2 [DNAcocal]
where [protein] 1/2 is the concentration of protein when
[DNAfree] equals [DNAbound] (Riggs et al., 1970). Therefore
when [DNAforai] is much less than Kd the [protein] 1/2 gives a
good estimate of the Kd.
A typical titration experiment is shown in Figure 11. A
graphical representation of the date is displayed in Figure
12. Following the example of Letovsky and Dynan (1989), the
total shifted complexes were considered bound complexes and
were combined in determining the Kd. Quantitatively, the
assay was essentially treated as a filter binding experiment
(see Letovsky and Dynan, 1989) From these experiments the
calculated apparent Kd of the Gcrlp DNA-binding domain with
its recognition site was 2.9 x 10~10 M.
At higher protein concentration additional bands
appeared with decreased electrophoretic mobility (Figure 11,
lanes 15-19) At concentrations above 20 nM all the


MATERIAL AND METHODS
Bacterial Strana
E. coli strains used in this study were MC1061 (hsdR,
mcrB, araDl39, A[araABC-leu] 7679, AlacX74, galu, galK, rpsL,
thi) (Casadaban and Cohen, 1980); DH5a [ A [ lacZYA-argF] U169, deoR, recAl, hsdRl7, supE44, thi-1,
hyrA96, relAl) (Hanahan, 1983); and, TBl (ara A[lac ZYApro
AB] rpsL [tp80dlacZAMl5], hsdR) (Johnston et al., 1986).
Media and Growth Conditions
E. coli strains used in this study were grown at 37 C in
L broth (5 g yeast extract, 10 g tryptone, and 8 g NaCl per
liter) with vigorous shaking. Strains harboring plasmids
were grown in L broth containing 100 |lg/ml ampicillin.
Transformations
E. coli strains MC1061 and TBl were transformed with
plasmid DNA by the low pH method of Enea et al. (1975). E.
coli strain DH5a was transformed by the manufacturers
recommended method (GIBCO BRL) .
Induction of malE::GCRl Gene Fusions
E. coli strain TBl, harboring plasmids encoding
malE: :GCR1 gene fusions, was used for the production of
hybrid MBP-Gcrlp polypeptide. 500 ml cultures in 2 liter
shake flasks were grown to an optical density of 0.5 (A60o)
Then isopropyl-S-D-thiogalactopyranoside (IPTG) was added to
27


Uemura, H. and Fraenkel, D.G. (1990). gcr2, a new mutation
affecting glycolytic gene expression in Saccharomyces
cerevisiae. Mol. Cell. Biol. 10, 6389-6396.
136
Uemura, H. and Jigami, Y. (1992). Role of GCR2 in
transcriptional activation of yeast glycolytic genes. Mol.
Cell. Biol. 12, 3834-3842.
VanDyke, M.W. and Sawadogo, M. (1990). DNA-binding and
transcriptional properties of human transcription factor
TFIID after mild proteolysis. Mol. Cell. Biol. 10, 3415-3420.
VanHolde, K.E., Lohr, D.E., and Robert, C. (1992). What
happens to nucleosomes during transcription? J. Biol. Chem.
267, 2837-2840.
Van Hoy, M., Leuther, K.K., Kodadek, T. and Johnston, S.A.
(1993). The acidic activation domains of the GCN4 and GAL4
proteins are not alpha helical but form beta sheets. Cell. 72,
587-594.
Vignais, M.L., Huet, J., Buhler, J-M, and Sentenac, A.
(1990) Contacts between the factor TUF and RPG sequences. J.
Biol. Chem. 265, 14669-14674.
Vignais, M.L. and Sentenac, A. (1989). Asymmetric DNA bending
induced by the yeast multifunctional factor TUF. J. Biol.
Chem. 264, 8463-8466.
Vignais, M.L., Woudt, L.P., Wassenaar, G.M., Mager, W.H.,
Sentenac, A., and Planta, R.J. (1987). Specific binding of
TUF factor to upstream activation sites of yeast ribosomal
protein genes. EMBO J. 6, 1451-1457.
Warner, J.R. (1989). Synthesis of ribosomes in Saccharomyces
cerevisiae. Micro. Rev. 53, 256-271.
Weinzierl, R. Ruppert, S., Dynlacht, B., Taese, N. and
Tjian, R. (1993). Cloning and expression of Drosophila
TAFII60 and human TAFII70 reveal conserved interactions with
other subunits of TFIID. EMBO J. 12, 5303-5309.
Weiss, M.A., Ellenberger, T., Wobbe, C.R., Lee, J.P.,
Harrison, S.C., and Struhl, K. (1990). Folding transition in
the DNA-binding domain of GCN4 on specific binding to DNA.
Nature 347, 575-578.
White, R. and Jackson, S. (1992). Mechanism of TATA-binding
protein recruitment to a TATA-less class III promoter. Cell
71, 1041-1053.
White, R., Jackson, S., and Rigby, P. (1992). A role for the
TATA-box-binding protein component of the transcription
factor I ID complex as a general RNA polymerase III
transcipton factor. Poc. Natl. Acad. sci. USA 89,1949-1953.


78
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
UMUWk.
f y. ft ft
Figure 13. Competition experiment using specific competitor.
DNA band-shift experiments were performed as described in Material
and Methods. Radiolabeled DNA probe and purified MBP-Gcrlp(690-844)
were held constant and increasing amounts of specific competitor
were added to mixtures.


43
extracted, ethanol precipitated, and then resuspended in 20
|iL of ddH20 and stored at -70 C.
In vitro Translation
In vitro-derived transcripts were translate in a rabbit
reticulocyte lysate system in the presence of L-
[35S] methionine by using a kit obtained from Promega. Two
microliters of substrate RNA (prepared as described above)
was incubated with 18 H.L of nuclease treated rabbit
reticulocyte lysate, 4 |j.L ddH20, 1 HL RNasin (50 U) 0.5 ^.L 1
mM amino acid mixture (minus methionine), and 2.0 p.L of
[35S]methionine. The amount of Gcrlp produced in the rabbit
reticulocyte lysates was estimated by determining the amount
of [35S]-methionine incorporated into trichloroacetic acid-
precipitable material. One microliter of the lysate was
incubated with 50 ^.L of 0.1 N NaOH at 37 C for 15 min and
then added to 1 ml of 10% TCA and placed on ice for 30 min.
Samples were then vacuum filter through filter paper, and
washed with 1 ml of 10% TCA. Filters were then added to 5 ml
of scintillation fluid and counted. Typical in vitro
translation reactions yielded approximately 2.4 ng of GCR1
per |iL of rabbit reticulocyte lysate. The translation
products were analyzed by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE), and the
radiolabeled proteins were visualized by autoradiography at -
70 C and compared with known molecular weight standards.
In Vitro DNase I Protection Assays
GCR1 binding sites in the UASTPI were determined by
DNase I footprints, carried out by a modification of the


Casadaban, M.J. and Cohen, S.N. (1980). Analysis of gene
control signals by DNA fusion and coloning in Escherichia
coli. J. Mol. Biol. 138, 179-207.
117
Cavallini, B., Huet, J. Plassat, J-L., Sentenac, A., Egly,
J-M., and Chambn, P. (1988). A yeast activity can substitute
for the HeLa cell TATA box factor. Nature 334, 77-80.
Chadwick, P. Pirrotta, V., Steinberg, R. Hopkins, N. and
Ptashne, M. (1970). The lambda and 434 phage repressors. Cold
Spring Harbor Symposia on Quantitative Biology XXXV, 283-294.
Chambers, A., Stanway, C. Kingsman, A.J., and Kingsman, S.M.
(1988). The UAS of the yeast PGK gene is composed of multiple
functional elements. Nucleic Acids Res. 16, 8245-8260.
Chambers, A., Stanway, C., Tsang, J.S.H., Henry, Y. ,
Kingsman, A.J., and Kingsman, S.M. (1990). ARS binding factor
1 binds adjacent to RAPl at the UASs of the yeast glycolytic
genes PGK and PYK. Nucleic Acids Res. 18, 5393-5399.
Chambers, A., Tsang, J.S.H., Stanway, C., Kingsman, A.J., and
Kingsman, S.M. (1989). Transcriptional control of the
Saccharomyces cerevisiae PGK gene by RAPl. Mol. Cell. Biol.
9, 5516-5524.
Chasman, D.I., Le, N.F., Buchman, A., LaPointe, J.W., Lorch,
Y. and Kornberg, R.D. (1990). A yeast protein that
influences the chromatin structure of UASG and functions as a
powerful auxiliary gene activator. Genes Dev. 4, 503-514.
Chittenden, T. Livingston, D.M., and Kaelin Jr, W.G. (1991).
The T/ElA-binding domain of the Retinoblastoma product can
interact selectively with a sequence-specific DNA-binding
protein. Cell 65, 1073-1082.
Clifton, D. and Fraenkel, D.G. (1981) The gcrl (glycolysis
regulation) mutation of Saccharomyces cerevisiae. J. Biol.
Chem. 256, 13074-13078.
Clifton, D., Weinstock, D., and Fraenkel, D.G. (1978).
Glycolysis mutants of Saccharomyces cerevisiae. Genetics 88,
1-11.
Cohen, R., Holland, J.P., Yokoi, T. and Holland, M.J.
(1986). Identification of a regulatory region that mediates
glucose-dependent induction of the Saccharomyces cerevisiae
enolase gene EN02 Mol. Cell. Biol. 6, 2287-2297.
Cohen, R. Yokoi, T., Holland, J.P., Pepper, A.E., and
Holland, M.J. (1987). Transcription of the constitutively
expressed yeast enolase gene ENOl is mediated by positive and
negative cis-acting regulatory sequences. Mol. Cell. Biol. 7,
2753-2761.


35
Determination of DNA Concentrations
DNA concentration were determined by spectrophotometry
in a Beckman DU-70 spectrophotometer outfitted with a micro
cell using e26o = 1.3 x 104 M-1 (per mole bp) as described in
Fried and Crothers (1981).
Generation of Double Strand DNA Oligonucleotides
Double-stranded oligonucleotides were generated by three
different methods. The most common protocol was by the
method of Oliphant et al. (1987) as modified by Scott (1992).
Single-stranded oligonucleotides were synthesized (University
of Florida Interdisciplinary Center for Biotechnology
Research) with the desired sequence flanked by restriction
sites. The restriction site at the 3' end was contained in a
larger (usually 8-10 base pair) palindrome by the addition of
G and C residues. The oligonucleotides were heated in 10 (IL
of 3x Buffer (30 mM Tris [pH 7.5], 150 mM NaCl, 30 mM MgCl2,
15 mM DTT, 0.1 mg/ml) at 37 C for 60 mins, to allow the 3'
ends to self-anneal. The solution was then diluted to 30 |IL
with the addition of 9.5 |i.L of ddH20 and 7.5 of dNTPs (10-
3M) and the 3'-ends were extended with the addition of 2 ^.L
(10 units) of the large fragment of E. coli DNA polymerase
I. The double-stranded extension products were then gel
purified after 8% polyacrylamide (40:1.3 Acrylamide/Bis) gel
electrophoresis (PAGE), digested with appropriate restriction
enzymes, and cloned into the polylinker region of pUC18 or
pUC19 (Messing, 1983). This method was used to generate
double-stranded oligonucleotides from HB61, HB62, HB63, HB64,
HB65, HB66, HB76, HB77, and HB79.


25
been shown to purify with the nuclear scaffold (Cardenas et
al, 1990), as do ARS sequences (Amati and Gasser, 1988).
Re.bija
REBl is an essential gene in Saccharomyces cerevisiae
encoding a highly hydrophilic protein of 809 amino acids (Ju
et al., 1990). The protein was originally isolated as a
factor binding to the rRNA enhancer (Morrow et al., 1989 and
1990), but now appears to play a more global role in
transcription. It is likely to be identical (Ju et al.,
1990) to the proteins Y (Fedor et al., 1988), Grf2p (Chasman
et al, 1990), and QBP (Brandi and Struhl, 1990). The Reblp
consensus binding site is present upstream of a number of
genes transcribed by RNA polymerase II, including the highly
expressed glycolytic genes PYK (Chasman et al., 1990), TPI1
(Scott and Baker, 1993), TDH3 (Bitter et al., 1991) and ENOl
(Machida et al., 189). The exact role of Reblp in the
expression of genes transcribed br RNA polymerase II is
currently unknown; however, it has been shown to effect
chromatin structure (Fedor et al., 1988), and although Reblp-
binding sites have little effect on activation by themselves,
they do potentiate nearby activators (Chasman et al., 1990;
Holmberg and Remade, personal communication) This
synergistic effect is strongly distance dependent. This
observation has lead to the suggestion that Reblp exerts its
effect by clearing chromatin of nucleosomes, or other
obstacles, allowing activators easier access to bind their
sites (Kornberg and Lorch, 1991).


2
syntax. Because as in language this allows unlimited
arrangement of a finite set to generate creativity and
innovation, an understanding of these rules will lead to an
insight of life currently unavailable.
It has been pointed out long ago (Mayr, 1970; Britten
and Davidson, 1969) that most structural genes do not differ
greatly between simple single-cellular organisms and their
more sophisticated mammalian brethren. The tremendous
difference in complexity between the two forms of life seems
to be due chiefly to the emergence of algorithms able to
generate new biological structures with novel function. In
fact, analysis of the rates of mutation, using either neutral
or selection theory, suggest that mutations are insufficient
to drive saltatory speciation unless they affect regulatory
genes (King and Wilson, 1975; Delbrck, 1975; Gould, 1977;
Jacob, 1977). Stated by the neo-Darwinian evolutionist Ernst
May r:
The fact that the macromolecules of most important
structural genes have remained so similar, from
bacteria to the highest organism, can be much better
understood if we ascribe to the regulatory genes a
major role in evolution. Since they strongly affect
the viability of the individual they will be major
targets of natural selection... The day will come
when much of population genetics will have to be
rewritten in terms of the interaction between
regulator and structural genes. (Mayr, 1970, p.183)
Indeed, developmental biology, molecular genetics, cellular
biology, evolutionary biology, and physical biochemistry have
been converging toward a unified theory in recent years. As
stated recently in an editorial justifying the existence of a
new journal: Virtually all of the biological sciences are


69
immediately. This rapid decrease in activity made it
extremely difficult to use full-length Gcrlp in experiments
were the active protein concentration needs to be accurately
known, or in experiments in which the protein must be of a
fixed concentration over time. However, truncated MBP-Gcrlp
fusion-proteins including the Gcrlp DNA-binding domain has
proven to be very stable, especially when stored at high
concentration. I do not detect a noticeable loss of activity
over months of storage at -70 C. This allowed me to measure
the binding affinity of the DNA-binding domain. Fusion-
proteins have been used to measure the DNA binding affinity
of other proteins (Desplan et al., 1985; Johnson and
Herskorwitz, 1985; Giese et al., 1991).
A single Gcrlp-binding site from the UAS of the triose-
phosphate isomerase gene was used in these experiments. The
site is listed as TPIx in Table 3, and, as mentioned above, it
has been shown to be protected in a GCRl-dependent manner in
vivo (Huie et al., 1992; Scott, 1992). The concentration of
the radiolabeled, gel-purified probe was determined by
spectrophotometry.
Purified hybrid MBP-Gcrlp(690-844) fusion protein was
used for these experiments. Active protein concentration was
determined by the methods described by Riggs et al. (1970)
and Chadwick et al. (1970), except that band-shift assays
were used instead of DNA filter-binding assays. The protein
concentration was held constant, using 1 (iL of a 1:1000
dilution of the stock solution, and increasing amounts of
radiolabeled DNA was added. The concentration of the stock


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF THE DNA-BINDING ACTIVITY OF THE
SACCHAROMYCES CEREVISIAE TRANSCRIPTIONAL ACTIVATOR GCR1P
By
Michael Andrew Huie
August 1994
Chairman: Henry V. Baker, Ph.D.
Major Department: Immunology and Medical Microbiology
The enzymes of the glycolytic pathway constitute
approximately 50 percent of the soluble proteins of the yeast
Saccharomyces cerevisiae. Deletion of the gene encoding the
transcriptional activator Gcrlp results in a 20-fold
reduction of these enzymes. This study presents a biochemical
analysis of the DNA-binding activity of Gcrlp. The DNA-
binding domain of Gcrlp is mapped to the carboxy-terminal 154
amino acids of the polypeptide. DNase I protection studies
presented here show that the Gcrlp DNA-binding domain
protects a region of the upstream activating sequence of TPI1
harboring the CTTCC sequence motif. This sequence has been
shown by genetic methods to be important for high-level gene
expression of a number of the glycolytic enzymes. By DNA
band-shift assays it is shown that the Gcrlp DNA-binding
domain also forms nucleoprotein complexes with CTTCC sequence
elements found in the upstream activating sequences of PGK1,
vi i i


105
bent piece of DNA (Kahn and Crothers, 1992) Likewise, IHF
has also been shown to have a greater affinity for curved DNA
(Bonnefoy and Rouviere-Yaniv, 1991). This mechanism, in which
a protein contorts a nearby site, was proposed for the
functional versatility of Raplp when it was first noted that
Raplp bends DNA (Vignais and Sentenac, 1989).
A third mechanism in which specificity could be
increased would be due to modification of the DNA-binding
protein. For example, the binding of sequence-specific
transcription factors to DNA can be affected either
positively or negatively by phosphorylation (reviewed in
Hunter and Karin, 1992). Examples of negative regulation
include the products of c-myb and c-jun in which
phosphorylation decreases the protein's DNA-binding affinity
(Luscher et al., 1990; Boyle et al., 1991). Myb binds to
several characterized Myb-response-elements (MRE) with
varying affinities. Phosphorylation of Myb completely
inhibits binding to the MREs with low affinities, but is not
very efficient at inhibiting Myb binding to MREs with high
binding affinity, thus in effect increasing the specificity
(Luscher et al., 1990). The factor SRF, on the other hand,
increases its affinity for DNA when phosphorylated at serine
residues (Janknecht et al., 1992; Maris et al., 1992) This
is presumably due to a conformational change of the protein
when phosphorylated (Marak and Pryuses, 1991).
In the final analysis, transcription complexes are held
together by multiple cooperative interactions, even if some
individual interactions are of low specificity. As Frankel


84
is bent DNA, then it can be detected by the circular
permutation assay.
I set out to test first if Raplp also bends DNA when
bound to its binding-site in the UAS of a glycolytic gene.
Raplp was translated in rabbit reticulocyte lysates and
incubated with radiolabeled DNA from UASTpii (a schematic of
the probe is shown in Figure 17.) under standard band-shift
assay conditions. Samples were then run on a 5% TE non
denaturing PAGE which had been pre-run for 1.5 hours.
Results are shown in Figure 18. When the Raplp-binding site
is located in the middle of the DNA fragment (restriction
endonucleases EcoRV and Nhel) the mobility is decreased
relative to the fragments containing the Raplp-binding site
at the ends of the fragments (restriction endonucleases EcoRI
and BamHI) This result is consistent with Raplp-inducing
DNA bending.
The purified MBP-Gcrlp(690-844) fusion protein was used
to assay if the Gcrplp DNA-binding domain bends DNA in the
nucleoprotein complex. Protein was incubated with
radiolabeled DNA under standard DNA band-shift assay
conditions. Samples were then run into a 10% nondenaturing
0.5 x TBE PAG which had been pre-run for 1.5 hours. The
results are shown in Figure 19. When the Gcrlp-binding site
is located in the middle of the fragment (restriction
endonucleases EcoRV and Nhel) the mobility is decreased
relative to the fragments containing the Gcrlp-binding site
at the ends of the fragments (restriction endonucleases EcoRI
and BamHI). These results are consistent with the notion


This dissertation was submitted to the Graduate Faculty
of the College of Medicine and to the Graduate School and was
accepted as partial fulfillment of the requirements for the
degree of Doctor of Philosophy.
Dean, College of Medicine
Dean, Graduate School


26
Gcrlp as a DNA-Binding Protein
The experiments presented in this study were designed to
characterize several basic properties of the DNA-binding
activity of Gcrlp. Since Gcrlp is a transcriptional
activator it should adhere to the modular nature of this
class of proteins. The experiments described in this study
set out to determine whether Gcrlp does have a modular design
and a DNA binding domain. Deletion analysis of Gcrlp was used
to address this point. Experiments also were designed to
determine if the Gcrlp DNA-binding domain binds to DNA in a
sequence specific manner and to define a consensus sequence
to which it binds. This was studied by DNase I footprinting
and DNA band-shift assays. Whether the CTTCC core sequence is
sufficient to convey DNA binding, or if surrounding base
pairs are important in the ligand interaction was also
addressed in this study by DNA band-shift assays.
Determination of affinity and specificity of binding by Gcrlp
to a consensus sequence is presented. Finally, since many
DNA-binding proteins have been shown to distort DNA when
bound, Gcrlp was also assayed for this activity. The
implications of the findings in this study are discussed in
the context of the combinatorial nature of interactions of
factors important for glycolytic gene expression.


135
Suzuki, M. (1990). The heptad repeat in the largest subunit
of RNA polymerase II binds by intercalating into DNA. Nature
344, 562-565.
Sweder, K.S., Rhode, P.R., and Campbell, J.L. (1988).
Purification and characterization of proteins that bind to
yeast ARSs. J. Biol. Chem. 263, 17270-17277.
Synder, M. Buchman, A.R., and Davis, R. (1986). Bent DNA at
a yeast autonomously replicating sequence. Nature 324, 87-89.
Sypes, M. and Gilmour, D. (1994). Protein/DNA crosslinking of
a TFIID complex reveals novel interactins downstream of the
transcription start. Nucleic Acids Res. 22, 807-814.
Taggart, A., Fisher, T. and Pugh, B. (1992). The TATA-
binding protein and associated factors are components of pol
III transcription factor TFIIIB. Cell 71, 1015-1028.
Talanian, R.V., McKnight, C.J., and Kim, P.S. (1990).
Sequence-specific DNA binding by a short peptide diamer.
Science 249, 769-771.
Tamura, T., Sumita, K. Fujino, I., Aoyama, A. Horikoshi, M.
Hoffmann, A. Roeder, R.G., Muramatsu, M. and Mikoshiba, K.
(1991). Striking homology of the 'variable' N-terminal as
well as the 'conserved core' domains of the mouse and human
TATA-factors (TFIID). Nucleic Acids Res. 19, 3861-3865.
Tornow, J. and Santangelo, G.M. (1990). Efficient expression
of the Saccharomyces cerevisiae glycolytic gene ADH1 is
dependent upon a cis-acting regulatory element (UASRPG) found
initially in genes encoding ribosomal proteins. Gene 90,
79-85.
Tornow, J., Xiao Z. Wei, G., and Santangelo, G.M. (1993).
GCR1, a transcriptional activator in Saccharomyces
cerevisiae, complexes with RAP1 and can function without its
DNA binding domain. EMBO J. 12, 2431-2437.
Travers, A.A. (1989). DNA conformation and protein binding.
Annu. Rev. Biochem. 58, 427-452.
Trumbly, R.J. (1992). Glucose repression in the yeast
Saccharomyces cerevisiae. Molecular Microbiology 6, 15-21.
Tsang, J.S.H., Henry, Y. Chambers, A., Kingsman, A.J., and
Kingsman, S.M. (1990). Phosphorylation influences the binding
of the yeast RAPl protein to the upstream activating sequence
of the PGK gene. Nucleic Acids Res. 18, 7331-7337.
Trkel, S. (1994). Transcriptional Regulation of Yeast
Retrotransposon Ty2-917. Ph.D. dissertation, University of
Maryland.


116
Brent, R. and Ptashne, M. (1985). A eukaryotic
transcriptional activator bearing the DNA specificity of a
prokaryotic repressor. Cell 43, 729-736.
Brindle, P.K., Holland, J.P., Willett, C.E., Innis, M.A., and
Holland, M.J. (1990). Multiple factors bind the upstream
activation sites of the yeast enolase genes ENOl and EN02:
ABFl protein, like repressor activator protein RAPl, binds
cis-acting sequences which modulate repression or activation
of transcription. Mol. Cell. Biol. 10, 4872-4895.
Britten, R. J. and Davidson, E.H. (1969) Gene regulation for
higher cells: a theory. Science 165, 349-358.
Bucher, P. (1990). Weight matrix descriptions of four
eukaryotic RNA polymerase II promoter elements derived from
502 unrelated promoter sequences. J. Mol. Biol. 212, 563-578.
Buchman, A., Kimmerley, W.J., Rie, J. and Kornberg, R.D.
(1988). Two DNA-binding factors recognize specific sequences
at silencers, upstream activating sequences, autonomously
replicating sequences, and telomeres in Saccharomyces
cerevisiae. Mol. Cell. Biol. 8, 210-225.
Buchman, A., Le, N.F., and Kornberg, R.D. (1988).
Connections between transcriptional activators, silencers,
and telomeres as revealed by functional analysis of a yeast
DNA-binding protein. Mol. Cell. Biol. 8, 5086-5099.
Buratowski, S., Hahn, S., Sharp, P.A., and Guarente, L.
(1988). Function of a yeast TATA element-binding protein in a
mammalian transcription system. Nature 334, 37-42.
Butler, G., Dawes, I.W., and McConnell, D.J. (1990). TUF
factor binds to the upstream region of the pyruvate
decarboxylase structural gene (PDC1) of Saccharomyece
cerevisiae. Mol. Gen. Genet. 223, 449-456.
Cagniard-Latour (1938). Memoire sur la fermentation vineuse.
Ann. Chim 68, 206-223.
Calladine, C.R., Collis, C.M., Drew, H.R., and Mott, M.R.
(1991). A study of electrophoretic mobility of DNA in agarose
and polyacrylamide gels. J. Mol. Biol. 221, 981-1005.
Capieux, E., Vignais, M.L., Sentenac, A., and Goffeau, A.
(1989). The yeast H+-ATPase gene is controlled by the promoter
binding factor TUF. J. Biol. Chem. 264, 7437-7446.
Cardenas, M.E., LaRoche, T.L., and Gasser, S.M. (1990). The
composition and morphology of the yeast nuclear scaffolds. J.
Cell Sci. 96, 439-450.
Carey, J. (1991). Gel retardation. Meth. Enzymol. 208,
103-117 .


34
Polyacrylamide Gel Electrophoresis
Various types of polyacrylamide gels electrophoresis
(PAGE) were used throughout the course of this study.
Nondenaturing PAGE was used for separation and purification
of DNA and for band shift assays. The percentage and ratio
of acrylamide to N,N'-methylenebisacrylamide (bis) was
determined by the particular use of the gel. For
purification of DNA, generally 6% or 8% gels with 30:1
acrylamide:bis ratio polymerized in TBE buffer (0.1 M Tris
[pH 7.5], 0.1 M Boric Acid, 10 mM EDTA) were used. Running
buffer was 1 x TBE. Gels were run at constant voltage,
usually 1-8 V/cm.
For band shift assays, 5-10% non-denaturing gels with
82.6:1 acrylamide:bis polymerized in 0.5 x TBE buffer were
commonly used. Running buffer was 0.5 x TBE. In cases were
GCRl was translated in rabbit reticulocyte lysate, TE (10 mM
Tris [pH 7.5], 1 mM EDTA) gels produced better resolution.
These gels ranged between 5-10% with a acrylamide:bis ratio
of 82:1 and were polymerized in TE buffer. Running buffer
was TE with recirculation. Band shift gels were pre-run for
at least 1.5 hours at 100 volts.
For DNA sequencing and DNase I footprinting, denaturing
gels containing 7 M urea were used. An acrylamide:bis ratio
of 30:1 was polymerized in 0.5 x TBE buffer. These gels were
pre-run for at least 30 min at 1500 volts.
For separation of proteins 10% SDS-PAGE were used
containing 0.1% SDS. The 3% stacking and 10% resolving gels
contained 37.5:1 acrylamide:bis.


83
B
Figure 16. Circular permutaticr. assay for determination of DNA bending
A) A cloned tandem dimer is cleaved with a series of restriction enzymes
generating probes of equal length but with varing DNA-binding site
postitions. B) When a protein binds to a site in the middle of the
fragment, producing a bend in tr.e center, the DNA is contorted to a lower
electrophoretic mobility form. When a protein binds to a site near the
end of the fragment, the DNA is less cotcrted producing a fragment with
higher electrophoretic mobility (Figure based or. Crothers et al, 1991 and
Prentki et al., 1987).


124
Irvine, D. Tuerk, C., and Gold, L. (1991). Systematic
evolution of ligand by exponential enrichment with integrated
optimization by non-linear analysis. J. Mol. Biol. 222,
739-761.
Irwin, N. and Ptashne, M. (1987) Mutants of the catabolite
activator protein of Escherichia coli that are specifically
deficient in the gene-activation function. Poc. Natl. Acad,
sci. USA 84, 8315-8319.
Jacob, F. (1977). Evolution and tinkering. Science 196, 1161.
Janknecht, R. Hipskind, R., Houthaeve, T. Nordheim, A., and
Stunnenberg, H. (1992). Identification of multiple SRF N-
terminal phosphoryation sites affecting DNA binding
properties. EMBO J. 11,1045-1054.
Janson, L. and Pettersson, U. (1990). Cooperative
interactions between transcription factors Spl and OTF-1.
Proc. Natl. Acad. Sci. USA 87, 4732-4736.
Jantzen, H., Chow, A., King, D. and Tjian, R. (1992).
Multiple domains of the RNA polymerase I activator hUBF
interact with the TATA-binding protein complex hSLl to
mediate transcription. Genes Dev. 6, 1950-1963.
Jordan, S. and Pabo, C.O. (1988). Structure of the lambda
complex at 2.5A resolution: details of the
repressor-operator interactions. Science 242, 893-907.
Ju, Q. Morrow, B.E., and Warner, J.R. (1990). REBl, a yeast
DNA-binding protein with many targets, is essential for
growth and bears some resemblance to the oncogene myb. Mol.
Cell. Biol. 10, 5226-5234.
Kahn, J. and Crothers, D. (1992). Protein-induced bending and
DNA cyclization. Proc. Natl. Acad. Sci. USA 89, 6343-6347.
Kahn, J. and Crothers, D. (1994). Cetection of localized DNA
flexibility. Nature 368, 163-166.
Kakidani, H. and Ptashne, M. (1987). GAL4 activates gene
expression in mammalian cells. Cell 52, 161-167.
Kao, C.C., Lieberman, P.M., Schmidt, M.C., Zhou, Q. Pei, R. ,
and Berk, A.J. (1990). Cloning of a transcriptionally active
human TATA binding factor. Science 248, 1646-1650.
Karim, F.D., Urness, L.D., Thummel, C.S., Klemsz, M.J.,
McKercher, S.R., Celada, A., VanBeveren, C., Maki, R.A. ,
Gunther, C.V., Nye, J.A., and Graves, B.J. (1990). The
ETS-domain: a new DNA-binding motif that recognizes a
purine-rich core DNA sequence. Genes Dev. 4, 1451-1453.


Figure 1. Comparison of DNA-binding activity of Gcrlp and
hybrid MBP-Gcrlp fusion protein. DNA band-shift assays were
carried out with a radiolabeled fragment of DNA carrying
UASt-pu (see Table 3. for sequence). The radiolabeled DNA was
incubated in binding buffer with protein extract indicated
above the lanes as described in Material and Methods.
Fragment alone, radiolabeled DNA fragment; No RNA RRL, 5 nl
of untreated rabbit reticulocyte lysate (RRL); Gcrlp RRL, 5
p.1 of rabbit reticulocyte lysate containing in vitro
synthesized Gcrlp; E. coli/pMAL-cRl Uninduced, 1 M-l of an
extract of a E. coli culture harboring plasmid pMAL-cRl; E.
col i /pMAL-cRl Induced, 1 |il of an extract of a E. coli
culture harboring plasmid pMAL-cRl which had been induced
with IPTG 2 h prior to harvest; E. coIi/pMAL-Gcrlp (1-844)
Uninduced, 1 |il of an extract of a E. coli culture harboring
plasmid pMAL-Gcrlp(1-844) (numbers in parentheses denote
amino acid residues of Gcrlp present in the expressed
polypeptide, see Table 2.); E. coli/pMAL-Gcrlp (1-844)
Induced, 1 ^.1 of an extract of a E. coli culture harboring
plasmid pMAL-Gcrlp(1-844) which had been induced with IPTG 2
h prior to harvest; f, free unbound probe.


13
phlogiston theory of combustion, were the first to outline a
theory of fermentation in the early modern period (for an
excellent review, see Fruton, 1972). They attributed an
internal motion to the "ferment.' Contact of quiescent
substances by the ferment then caused them to undergo decay.
A similar view was also put forth by Isaac Newton (1730), in
his book Opticks, where he describes the interaction of
ferments as an example of the force of gravity.
Lavoisier, the founder of modern chemistry, extinguished
the phlogiston theory with his work describing oxygen. But
it is in Lavoisier writings on fermentation, not oxygen,
where he outlines his theory of conservation of matter:
Nothing is created either in the operation of art or of
nature, and the principle may be formulated that in every
process there is an equal quantity of matter before and
after the reaction, that the quality and the quantity of
the principles are the same and that there are only changes
or modifications, (in Fruton,1972, p. 39)
Lavoisier, and later Gay-Lassie (1810), used fermentation to
demonstrate this 'conservation of matter.' This 'law,' in
its form modified by Einstein, remains a foundation of modern
chemistry and physics. Although the phlogiston theory of
combustion was abandoned, Lavoisier was largely responsible
for sustaining the 'purely chemical' theory of fermentation
that dominated the scientific opinion during his day.
In 1779, the French Academy of Science offered the prize
of one kilogram of gold to anyone who could explain the
nature of alcoholic fermentation (Fruton, 1972). The
question was stated as, 'What are the characteristics which
distinguish vegetable and animal substance that act as


40
Table 3. Oligonucleotides containing CTTCC sequences
Oligonucleotide Sequence
LINKER
agcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgatt
UASTPI
agcttAGCTTCCTCTATTGATGTTACACCTGGACACCCCTTTTCTGGCATCCAGTTgcat
TPIlx
agcttGACTTTTCAGCTTCCTCTATTGATGgcatgcggatccccgggtaccgagctcgatt
TPI12
agcttt-TTTTCTGGCATCCAGTTTTTAATgcatgcggatccccgggtaccgagctcgatt
PGK
agcttGACTTCCTGTCTTCCTATTGATTGCgcatgcggatccccgggtaccgagctcgatt
ENOl
agcttCTAATCCGAGCTTCCACTAGGATAGgcatgcggatccccgggtaccgagctcgatt
PYK
agcttAGACATCGGGCTTCCACAATTTTCGgcatgcggatccccgggtaccgagctcgatt
ADH1
agcttACAATATGGACTTCCTCTTTTCTGGgcatgcggatccccgggtaccgagctcgatt


81
experiment is shown in Figure 13. An increasing amount of
unlabeled competitor DNA containing a known Gcrlp-binding
site was incubated with fixed concentrations of radiolabeled
DNA and fusion-protein. In Figure 14 an increasing amount of
unlabelled DNA containing random sequence was used as
competitor. A graphical representation of these experiments
is presented in Figure 15. From these experiments the
difference in the amount of competitor necessary for
competition of one-half binding is approximately 33-fold.
Bending of DNA in the Gcrlp-DNA Nucleoprotein Complex
Over the last few years a growing number of regulatory
proteins which bind to DNA have been shown to induce bending
of DNA. X-ray crystallographic data clearly reveals that the
physical structure of DNA is contorted when bound to some of
the best characterized transcriptional factors. For example,
as determined by 3 angstrom resolution, the catabolite
activator protein (CAP) induces a 90 degree bend in DNA by
forming two 40 degree kinks around the dimeric protein
(Schultz et al., 1991) An increasing body of literature has
revealed that DNA bending plays an important role in
transcriptional regulation, as well as control of replication
(Williams et al., 1988; Doepsel and Khan, 1986; Zahn and
Blattner, 1985; Mukherjee et al., 1985; Ryder et al., 1986;
Snyder et al., 1986) and recombination (Better et al., 1982).
Protein-induced DNA bending can be detected easily by
polyacrylamide gel electrophoresis (Calladine et al., 1991),
and a technique to detect, map, and measure the extent of
bending has been developed (reviewed in Crothers et al. ,


Table 1. Oligonucleotides
Name
HB01
HB09
HB10
HB39
HB40
HB57
HB58
HB59
HB61
HB62
HB63
HB64
HB65
HB66
HB7 6
HB77
HB79R
Sequence
5 ATGTGTGGAATTGTGAGCGG 3 '
5 -GGCATGCCAACATGTATGGGTTCCAAGCTTG-3'
5'-CAAGCTTGGAACCCATACATGTTGGCATGCC-3'
5 -GCTAAGCTTAGCTTCCTCTATTGATGGC ATGCC 3 '
5'-GGCATGCCATCAATAGAGGAAGCTAAGCTTAGC-3'
5 -GACGAATTCTGCAGGGCCCGAN25GCCAAGCTTAGCATGCACGGCC-3 '
5'-CGTGCATGCTAAGCTTG-3'
5'-CGAATTCTGCAGGGC-3'
5 -GGAAGCTTGACTTTTCAGCTTCCTCTATTGATGGCATGCGGATCCGC 3
5 -GGAAGCTTGACTTCCTGTCTTCCTATTGATTGCGCATGCGGATCCGC-3
5 -GGAAGCTTACAATATGGACTTCCTCTTTTCTGGGCATGCGGATCCGC 3
5 -GGAAGCTTCTAATCCGAGCTTCCACTAGGATAGGCATGCGGATCCGC-3
5 -GGAAGCTTAGACATCGGGCTTCCACAATTTTCGGCATGCGGATCCGC- 3
5 -GGAAGCTTTTTTCTGGCATCCAGTTTTTAATGCATGCGGATCCGC-3 '
5 -GGAAGCTTCTTTTTTACTCTTCCAGATTTTCTCGCATGCGGATCCGC 3
5 GGAAGCTTTCCCCTCTTTCTTCCTCTAGGGTGTGCATGCGGATCCGC-3
5 -GGAAGCTTTGGTGCAGGGCTTCCTCAGGTAGACGCATGCGGATCCGC 3


126
Lavoisier, A.I. (1789). Elements of Chemistry, translated by
R. Kerr (Creech. Edinburgh) .
Leidig, F., Shepard, A.R., Zhang, W. Stelter, A., Cattini,
P.A., Baxter, J.D., and Eberhardt, N.L. (1992). Thyroid
hormone responsiveness in human growth hormone-related genes.
J. Biol. Chem. 267, 913-921.
Letovsky, J. and Dynan, W.S. (1989). Measurement of the
binding of transcription factor Spl to a single GC box
recognition sequence. Nucleic Acids Res. 13, 2639-2653.
Leuther, K.K., Salmern, J.M., and Johnston, S.A. (1993).
Genetic evidence that an activation domain of GAL4 does not
require acidity and may form a (3 sheet. Cell 72, 575-585.
Levine, A.S. (1989). A new reductionism and a new journal.
New Biol. 1, 1-2.
Lewin, B. (1990). Commitment and activation at pol II
promoters: a tail of protein-protein interactions. Cell 61,
1161-1164 .
Lieberman, P.M., Schmidt, M.C., Kao, C.C., and Berk, A.J.
(1991) Two distinct domains in the yeast transcription
factor IID and evidence for a TATA box-induced conformational
change. Mol. Cell. Biol. 11, 63-74.
Lin, Y-S. and Green, M.R. (1991). Mechanism of action of an
acidic transcriptional activation vitro. Cell 64, 971-981.
Longtine, M.S., Wilson, N.M., Petracek, M.E., and Berman, J.
(1989). A yeast telomere binding activity binds to two
related telomere sequence motifs and is indistinguishable
from RAPl. Curr. Genet. 16, 225-239.
Luscher, B. Christenson, E., Litchfield, D.W., Krebs, E.G.,
and Eisenman, R.N. (1990). Myb DNA binding inhibited by
phosphorylation at a site deleted during oncogenic
activation. Science 344, 517-522.
Lustig, A.J., Kurtz, S., and Shore, D. (1990). Involvement of
the silencer and UAS binding protein RAPl in regulation of
telomere length. Science 250, 549-553.
Ma, J. and Ptashne, M. (1987a) A new class of yeast
transcriptional activators. Cell 51, 113-119.
Ma, J. and Ptashne, M. (1987b). Deletion analysis of GAL4
defines two transcriptional activating segments. Cell 48,
847-853 .


16
Pasteur, who was held in respect among chemists,
supported the work of Cagniard de Latour and Schwann, and was
instrumental in countering the opposition of the chemists,
and in bolstering the concept of vitalism in biology. Said
Pasteur:
My present and most fixed opinion regarding the
nature of alcoholic fermentation is this: I believe
that there is never any alcoholic fermentation without
there being simultaneously the organization, develop
ment, and multiplication of the globules, or at least
the pursued, continued life of globules that are
already present. The totality of the results in this
article seem to me to be in complete opposition to the
opinions of Liebig and Wohler, (in Kornberg,1989, p. 33)
Pasteur strongly supported an ideology vitalism and held that
life processes are not reducible to the laws of physics and
chemistry.
Pasteur's 'fixed opinion' was shown to be false when
Eduard Buchner made the following observations in 1897:
If one mixes 1,000 grams of brewer's yeast with an
equal weight of sand and then grinds the mixture, the
mass becomes moist and pliable. Now if 100 grams
of water are added, and the paste, wrapped in
cheesecloth, is gradually subjected to 400-500
atmospheres of pressure in a hydraulic press, one
obtains about 500 milliliters of 'press juice'; to
remove any residual unbroken cells, the press juice
is passed through a paper filter. The final solution
contains a collection of substances derived from the
cell interior. The 'cell extract' obtained in this
way is a clear, slightly yellow liquid with a pleasant
yeast smell, (in Kornberg, 1989, p. 34)
When Buchner added sugar to this solution in an effort to
preserve it, he noticed that bubbles of gas appeared within
minutes. He repeated his experiments and concluded that
fermentation was possible outside of the yeast cell. Buchner
believed that the reaction was catalyzed by a single enzyme
and named the substance zymase. The word enzyme means 'in


8
domain apparently wraps around the DNA helix upon binding. A
similar occurrence is also seen in the N-terminal arm of the
lambda repressor which is disordered in the free protein but
wraps around the 'back side1 of the DNA helix when bound
(Jordan and Pabo, 1988).
Activation domains appear to become structured upon
interaction with other molecules. By selecting for
activation from random E. coli genomic sequences Ma and
Ptashne (1987) showed that a high density of negative
charges, rather than well-defined amino acid sequences, was
the major determinant of an activation domain in yeast. This
type of activation domain has been termed an "acid blob" or
"negative noodle" and has been proposed to be disorganized
(Sigler 1988), an alpha helix (Irwin and Ptashne, 1987), or a
beta sheet (Leuther et al., 1993 ; Van Hoy et al., 1993).
Polypeptides of the acidic activation domain of Gal4p and
Gcn4p have been shown to form beta sheets by circular
dichroism spectroscopy (Van Hoy et al., 1993) and by genetic
studies (Leuther et al., 1993). However, the active form of
the activation domain may change with additional protein
interactions (Hahn, 1993).
Another type of activation domain has been described and
also displays a "disorganized" structure. Deletion analysis
has revealed that the most potent activation domain of Spl
contains ~25 percent glutamine and very few charged amino
acids (Courey and Tjian, 1988). Furthermore, a glutamine-
rich stretch of 145 amino acids from Antennapedia can
substitute for this activation domain in a swap experiment


ENOI, PYK1, and ADH1. From these experiments a consensus
Gcrlp-binding site is derived which is 5'-(T/A)N(T/C)N(G/A)
NC(T/A)TCC(T/A)N(T/A) (T/A) (T/G)- 3'. The apparent dissociation
constant of the Gcrlp DNA-binding domain with the sequence
5'-TTTCAGCTTCCTCTAT-3' is 2.9xlO-iM. However, only a 33-fold
difference is observed between the ability of specific
competitor and random DNA to inhibit formation of the
nucleoprotein complexes between Gcrlp and this binding site.
Circular permutation DNA band-shift assays are used to show
that the Gcrlp-DNA nucleoprotein complexes contains bent DNA.
The implications of these findings, in terms of the
combinatorial interactions that occur at upstream activating
sequences of GCR1-dependent genes, are discussed.
IX


15
that the microscope has been used to study the
phenomena upon which it depends. This essay, as one
can judge by the researches which I have just
mentioned, will be useful since it has furnished a
number of new observations from which the principal
results that can be drawn are: 1, that beer yeast,
this ferment which is in such use and which, for this
reason, should be examined very closely, is a mass of
little globular bodies capable of reproducing them
selves, and thus organized beings, and not a simple
organic or chemical substance as has been supposed;
2, that these bodies seem to belong to the vegetable
kingdom and regenerate themselves in two different
ways, and 3, that they seem to act on a solution of
sugar only so long as they are in the vital state:
from which it can be concluded that it is very
probably by some effect of their vegetation that they
are able to disengage carbon dioxide from this
solution and convert the solution into a spirituous
liquor. I would like to remark, further, that yeast,
considered as an organized matter, perhaps merits the
attention of physiologists in this sense: 1, that it
can be born and develop in certain circumstances with
great rapidity even in the middle of carbonic acid as
in the brewers' barrels; 2, that its mode of
reproduction presents particularities of a kind which
have not been observed in other microscopical products
composed of isolated globules and 3, that it does not
die by very considerable refrigeration nor by
deprivation of water, (in Williams and Steffens,
1978,p. 446)
Cagniard de Latour's work was confirmed by Theodore
Schwann (1838), yet it still was attacked and dismissed by
many of the scientists of the day who maintained
institutional power, such as Berzelius, Liebig, and Wohler.
This group of prominent scientists were chemist who had
succeeded at synthesizing bio-organic compounds and found the
notion of 'vital forces' as somewhat superstitious. 'It is
not,' said Liebig, 'because it is organized that the beer
yeast is active, but because it has been in contact with the
air. It is the dead portion of the yeast, which has been
alive and is in process of alteration, that acts on the
sugar.' (in Pasteur Valler-Radot, 1957)


92
The DNA-binding Domain of GcrLo
Two lines of evidence identify a DNA-binding domain in
the carboxy-terminus of Gcrlp. First, carboxy-terminus
truncations of Gcrlp abolish DNA binding. Second, all
fusion-proteins containing the carboxy-terminal 154 amino
acid residues of Gcrlp retained sequence-specific DNA-binding
activity. Additionally, the MBP-Gcrlp (690-844) fusion-
protein--containing the carboxy-terminal 154 amino acid
residues--protected from in vitro DNasel digestion CT-boxes
which are protected in a GCR1 -dependent manner in vivo (Huie
et al., 1992) .
It had been previously suggested, on the basis of DNA
sequence analysis, that the carboxy-terminus of Gcrlp may
contain a DNA-binding domain since a possible helix-turn-
helix (H-T-H) motif was identified at amino acids 784 to 803
(Baker, 1986). The H-T-H structure forms the basis of a DNA-
binding domain in a superfamily of DNA-binding proteins
(Harrison and Aggarwal, 1990). The Gcrlp fusion-proteins
that contained amino acids 706 to 844 and amino acids 784 to
844 failed to bind DNA even though they contained the
putative H-T-H. This negative result does not exclude the H-
T-H motif from forming the core of the actual DNA-binding
domain, as smaller deletions could have disrupted the domain.
In an effort to compare the Gcrlp DNA-binding domain to
other proteins, sequence analysis was performed on the entire
protein with particular attention paid to the carboxy
terminus. Comparison against updated databases using the
algorithms BLAZE (Smith and Waterman, 1992), BLAST (Altschul


77
complexes were in the higher bands (data not shown).
Specificity of the Gcrlp DNA-Binding Domain
The results of the binding affinity studies showed that
Gcrlp had a higher affinity for DNA than had been expected.
Since nonspecific DNA-binding appeared to occur at less than
100-fold of the measured Kd, this suggested that the
difficulty in demonstrating DNA-binding activity may have
been due to a low specificity of binding. Specificity of
binding is defined as the ratio of binding to a known binding
site compared to binding to a random sequence of DNA
(Affolter et al., 1990; Giese et al., 1991; Ferrari et al.f
1992). Most assays for Gcrlp binding did not use purified
Gcrlp (Baker, personal communication) and therefore poly
dl/dC DNA was used as an competitor of nonspecific binding.
It was possible, that if Gcrlp had a low specificity, this
could mask the binding of Gcrlp. To test this I next set out
to determine the specificity of binding of the Gcrlp DNA-
binding domain to its recognition site.
To measure the specificity of Gcrlp for its high-
affinity binding site in UAS^pj-j a series of competition
experiments were performed. Competition experiments were
performed with either specific DNA containing a known Gcrlp-
binding site, or nonspecific DNA containing random DNA. The
specific competitor, containing a Gcrlp-binding site, was
made by annealing the complementary oligonucleotides HB39 and
HB40 (see Table 1) The nonspecific competitor was made by
extending oligonucleotide HB57 with HB58 (see Table 1). This
DNA contained a random sequence at its core. A typical


Titration of DNA-Binding Activity 46
Calculation of Equilibrium Binding Constant 46
RESULTS 47
Gcrlp Expressed in E. coli or Rabbit Reticulocyte
Lysate Binds to DNA 48
The DNA-Binding Domain of Gcrlp Resides within
the Carboxy-Terminal 154 Amino Acid
Residues 52
DNasel Footprint Analysis 57
Identification of a Consensus Gcrlp Binding
Sequence 65
The Gcrlp-DNA Nucleoprotein Complex 68
The DNA-binding affinity of the
GCR1 binding domain 68
Specificity of the Gcrlp DNA-Binding
Domain 77
Bending of DNA in the Gcrlp-DNA Nucleoprotein
complex 81
DISCUSSION 89
The DNA-Binding Domain of Gcrlp 92
A DNA Consensus Sequence for Gcrlp 95
The Binding Affinity of the Gcrlp
DNA-Binding Domain 97
The Bending of DNA by Raplp and Gcrlp 106
The Significance of Adjacent Raplp and Gcrlp
Binding Sites in the UAS of the Glycolytic
Genes 108
Conclusions 113
REFERENCES 115
BIOGRAPHICAL SKETCH 139
IV


DISCUSSION
For skepticism is this: that an unknown quantity,
some x, can explain everything. But when everything
is explained through an x which is not explained,
then in toto nothing is explained, nothing at all.
If this is not skepticism, then it is superstition.
Soren Kierkegaard (p.251)
Since Copernicus man has been rolling from the
center toward x.
Friedrick Nietzsche (p.8)
The enzymes of the glycolytic pathway constitute
approximately 30-60 percent of the soluble cellular proteins
in Saccharomyces cerevisiae (Hess et al., 1969 and Fraenkel,
1982) The observation that the most abundant mRNA species in
this organism code for glycolytic enzymes (Holland and
Holland, 1978), and the demonstration of high-level
expression of heterologous genes using glycolytic gene
promoters (Bitter and Egan, 1984 ; 1988; Bitter et al. 1987)
revealed that these promoters are among the most powerful
known in any species. The promoters of the glycolytic genes
have been exploited commercially to manufacture recombinant
human erythropoietin and recombinant hepatitis B viral
antigens (Bitter and Egan, 1984; 1988; Bitter et al., 1987).
The upstream activating sequence, UAS, elements of many
glycolytic enzyme genes have been studied in detail and a
89


BIOGRAPHICAL SKETCH
Michael Andrew Huie was born in 1963 in Munich to
Douglas T. Huie and Ingrid A.Huie. He attended college at
Columbia University in New York where he recieved an A.B.
degree in molecular biology in 1985. He studied medicine at
the University of Florida, recieving an M.D.degree in 1993.
He also recieved internship training at the University of
Florida between 1993 and 1994. He plans to further his
training studying dermatology at the University of
California, San Francisco begining in 1994.
138


37
prepared from 10 ml cultures of E. coli by the alkaline lysis
method (Birnboim and Doley, 1979; Ish-Horowwicz and Burke,
1981) they were further purified by resuspending the total
precipitated DNA from the preparation in 12 8 p.L ddH20. Then
32 |IL of 4 M NaCl and 160 |iL, of 13% polyethylene glycol-8000
(PEG) were added and the solution was mixed well. The
solution was incubated on ice for exactly 20 mins, and then
microcentrifuged for 10 mins, at room temperature. The
pellet was washed with 70% ethanol and then dried under
vacuum. The pellet was resuspended in 75 |iL of TE pH 7.5.
2 5 |1L of this solution was then used in the sequencing method
described by U.S. Biochemicals.
Plasmid Construction
The plasmids used in this study are listed in Table 2.
A number of plasmids which contain CTTCC sequence elements
were constructed. Plasmid pUC66 contains sequence from
UASypj, from positions -317 to -327. This region harbors two
GCRl-binding sites and a RAPl-binding site (Scott, 1992).
Plasmid pUC66 was constructed by cloning the Hindlll-SphI
fragment from plasmid pES119 (Scott, 1992) into the Hindlll-
Sphl sites of pUC18.
Plasmids pUCT61-pUCT79 contain CTTCC sequence elements
from a number of glycolytic and translational machinery
genes. The number of the plasmid refers to the HB
oligonucleotide from which the insert was derived (sequences
are listed in Table 1). After the oligonucleotides were made
double-stranded (described above) 5 |ig of DNA was digested
with Hindlll and BamHI and cloned into the Hindlll-BamHl


23
Santangelo, 1990). Furthermore, putative Raplp-binding sites
can be identified in the 5' region of other genes in the
glycolytic pathway (Huie et al. 1992; and discussion).
Raplp appears to undergo phosphorylation which may influence
its binding at the UASFCth- (Tsang et al., 1990). This
post-translational modification has been suggested (Tsang et
al., 1990) to be responsible for the glucose induction of PGK
(Chambers et al., 1989).
The mechanism of action of Raplp is currently unknown.
Although Raplp binding sites are necessary for high-level
expression of glycolytic genes, they are unable to convey
high-level expression of reporter genes by themselves
(Stanway et al., 1989). Protein-protein interactions with
the putative coactivator GAL11/SPT13 has been proposed
(Nishizawa et al. 1990; Fassler and Winston, 1989; Stanway
et al., 1993), and the mapping of an activation domain in
Raplp to 66 amino acids with a net negative charge of -12
(Hardy et al., 1992) also supports a coactivation model
(Baker, 1991). Alternatively, Raplp has been proposed to
alter chromatin structure providing access to DNA by other
activator proteins (Devlin et al., 1991; Sentenac and
Vignais, 1987). Finally, Scott and Baker (1993) have
proposed that Raplp facilitates binding of Gcrlp by either a
protein-protein interactions or by altering the topology of
the DNA to which Gcrlp binds.
Abf lp
Abflp (for ARS binding factor), like Raplp, is also
involved in multiple cellular functions including


ACKNOWLEDGMENTS
I would first like to thank my parents for their
encouragement and support throughout the course of my
training. I am especially indebted to my mentor, Henry V.
Baker, for his patience, and for providing me with an ex
cellent training and a stimulating work environment. The
members of my committee, Daniel J. Driscoll, Richard W.
Moyer, and Thomas P. Yang, are thanked for their invaluable
insights. John Olson, Michael Brooks, Michael Waters, Jeff
Smerage, Lucia Eisner, Carolyn Drazinic, Ed Scott, Clive
Stanway, Jeff Harris, Mary-Catherine Bowman, Jim Anderson,
Rob Nicholls, Gerry Shaw, Maurice Swanson, Jace Dienhart,
William Hausworth, Al Lewin, Paul Gulig, Cecila Lopez, Didi
Gravenstein, and Andy Wilcox are thanked for uncountable
hours of discussion related to this work and for technical
assistance and advice. This work is dedicated to Matt
Memolo, who died during the course of the writing. He is
thanked for his inspiring conversations and for his example
of how to live life.


17. Schematic of probe used in circular
permutation assay 85
18. DNA is bent in the Raplp-DNA nucleoprotein
complex 86
19. DNA is bent in the Gcrlp-DNA nucleoprotein
complex 87
20. SAPS analysis of Gcrlp 94
vii


LINKER UAStpj TP\ TP I PGK ENOI PYK ADH1
n 71 n 71 r 71 n Tin 71 r 71 r 71 n 71
I k I I V
M
Figure 9. Gcrlp DNA-binding domain binds to CTTCC sequence elements found in front of other
glycolytic genes. DNA band-shift analysis was carried out with purified MBP-Gcrlp (690-844)
and the radiolabeled oligonucleotides listed in Table 3. The absence (-) and presence ( + )
on 10 ng of MBP-Gcrlp fusion protein in the DNA band-shift assay are indicated above each
lane.
CTl


72


TABLE OF CONTENTS
page,
ACKNOWLEDGMENTS ii
LIST OF TABLES v
LIST OF FIGURES vi
ABSTRACT viii
INTRODUCTION 1
Basal Transcriptional Machinery and TFIID 4
Activators, Coactivators, and Adaptors 7
History of Fermentation in Yeast 11
Coordinate Regulation of Glycolysis in
Saccharomyces cerevisiae 18
Gcrlp 18
Gcr2p 20
Raplp 21
Abflp 23
Reblp 25
Gcrlp as a DNA-Binding Protein 26
MATERIALS AND METHODS 27
Bacterial Strains 27
Media and Growth Conditions 27
Transformations 27
Induction of Mal::GCRl Gene Fusions 27
Purification of MBP-Gcrlp Fusion Proteins 28
Nucleic Acid Manipulations 30
DNA Precipitation 30
Purification of DNA Fragments and
Oligonucleotides 31
Radio-Labeling of DNA Fragments 31
Polyacrylamide Gel Electrophoresis 34
Determination of DNA Concentrations 35
Generation of Double Strand DNA
Oligonucleotides 35
DNA Sequencing 36
Plasmid Construction 37
In Vitro Transcription 42
In Vitro Translation 43
In Vitro DNase I Protection Assays 44
DNA Band-Shift Assays 45
iii


62
quantity. The stability of the MBP-Gcrlp(690-844) protein
also allowed for its purification. The fusion protein was
purified as described in Material and Methods. A 234 base-
pair DNA fragment from the UASTPI1 was generated by cleavage
of the plasmid pES37 (Scott, 1992) with the restriction
endonucleases SphI and HinduI. The fragment was
radiolabeled at the Hindlll site. Nucleoprotein complexes
were allowed to form under standard band shift reaction
conditions after which DNase I was added to the mixture.
Reactions were terminated by inhibiting DNase I with high
concentrations of EDTA, and then the samples were immediately
run into a non-denaturing acrylamide gel. Complexes were
identified by autoradiography and purified from the gel. The
nicked DNA was then transferred to DEAE paper using
electrophoresis. DNA was eluted with high-salt buffer and
then isolated by phenol extraction and ethanol precipitation.
The DNA was then denatured and run on a sequencing gel. A
DNA fragment incubated without protein was digested with
DNase I to generate a control ladder. Figure 8 shows the
results of the DNase I protection studies using purified MBP-
Gcrlp ( 690-844 ) fusion-protein. Two areas of protection were
observed: one clear area of protection centered over the
CTTCC motif and another area of partial protection centered
over the related sequence CATCC. Edward Scott has shown that
both of these sequences are protected in vivo in a GCR1-
dependent manner by in vivo G methylation protection
experiments (Huie et al., 1992; Scott, 1992; Scott and Baker,
1993 ) .


44
method of Pfeifer et al. (1987). A 234 bp DNA fragment from
the UAStpj was generated by cleavage of the plasmid pES37
(Scott, 1992) with the restriction endonucleases Hindlll and
SphI. This fragment was then radiolabeled only at the
Hindlll end by filling in with the large fragment of E.coli
DNA polymerase I in the presence of a32P dATP. The DNA probe
was isolated from the plasmid by 8% PAGE. After
visualization of the ethidium bromide stained gel by long
wave UV, the area of the gel containing the DNA probe was
excised, and the DNA extracted from the gel by the DEAE paper
method as described above.
Nucleoprotein complexes were allowed to form under
standard band-shift reaction conditions in a total volume of
20 )i.L, and then various amounts of DNase I (0.2 to 0.5 U)
were added. The reaction mixture was incubated at ambient
temperature for 2 min. The reaction was stopped by the
addition of an equal volume of stop solution (50% glycerol,
0.25 M EDTA [pH 8.0]). The resulting mixture was immediately
loaded onto a native 5% polyacrylamide (49.4:0.6) 0.5 x TBE
gel. Free and complexed DNA were detected by autoradiography
of the wet gel. Bound DNA from both the upper and lower
complexes was cut out of the gel and eluted from the gel by
either soaking overnight at 37 C in 500 mM ammonium acetate-1
mM EDTA or by the DEAE paper method described above. The
eluted DNA was then precipitated, washed with 70% ethanol,
suspended in 10 [iL of loading buffer (95% Formamide, 20 mM
EDTA, 0.05% Bromophenol Blue, and 0.05% Xylene Cyanol FF) ,
boiled for 5 min, and loaded onto a denaturing sequencing


18
Coordinate Regulation of Glycolysis in
Saccharomvces cerevisiae
In Saccharomyces cerevisiae the enzymes of the
glycolytic pathway are among the most highly expressed genes,
constituting between 30-60 percent of the total soluble
protein when grown in the presence of glucose (Hess et al.,
1969; Fraenkel, 1982). The demonstration (Holland and
Holland, 1978) that the most abundant mRNA species in the
yeast code for glycolytic enzymes suggested that this is
largely due to high-level transcription of the corresponding
genes. High-level expression of heterologous genes under
glycolytic-gene promoters (Bitter and Egan, 1984; 1988;
Bitter et al., 1987) further demonstrated that the glycolytic
gene promoters are among the strongest known.
A number of trans- and cis-acting elements have been
discovered to be important for the coordinate high-level
expression of the glycolytic genes. The trans-factors
include Gcrlp, Gcr2p, and Raplp/Grflp/Tuflp (hereafter
referred to as Raplp). Additionally the factors GAL11/SPT13
(referred to as Galllp), Abflp/Taflp/Sufp/Gflp/SBF-B (now
designated Abflp) and Reblp/Grf2p/QBP/Y (hereafter referred
to as Reblp) are believed to play a role in high-level
expression of some of the genes. I will review these factors
here. A model of how these factors may work together will be
presented in the Discussion.
It was observed in 1978 that mutation in a single gene
can causes a dramatic decrease in expression of most of the
glycolytic genes (Clifton et al., 1978; Clifton and Fraenkel,


21
1990) The GCR2 gene was cloned by complementation and shown
to be distinct from GCR1. Although the effects on glycolytic
gene expression are similar in the gcrl and gcr2 mutants, the
gcr2 mutant does not have as severe of a growth defect as
gcrl mutants when grown on glucose at 30 C (Uemura and
Fraenkel, 1990).
The role of Gcr2p in glycolytic gene expression is
currently under investigation. Like Gcrlp, Gcr2p appears to
exert its effects at the transcriptional level, as measured
by Northern analysis (Uemura and Fraenkel, 1990). Gcr2p does
not appear to interact directly with the CTTCC sequence
element. In vivo footprinting experiments demonstrate
protection of the CTTCC sequence elements in UASTPI in the
gcr2 mutant (Scott and Baker, 1992). In the gcrl mutant these
sequences are not protected (Huie et al., 1991; Scott and
Baker, 1993 ). A clue to the function of Gcr2p in glycolytic
gene expression was provided by genetic studies (Uemura and
Jugami,1992) based on the method of Fields and Song (1988).
A GAL4::GCR1 gene fusion containing the activation domain of
GAL4 and amino acids 68-844 of Gcrlp can complement a gcr2
mutant. Furthermore, a RAP1::GCR2 gene fusion which carries
the DNA binding domain of Raplp can partially complement a
gcrl mutant. These observations have led to the suggestion
that Gcrlp and Gcr2p function together as an activation
complex (Uemura and Jigami, 1992).
Rapio
RAP1, for repressor/activator protein, is an essential
gene (Shore and Nasmyth, 1987) whose product binds to DNA.


128
Moehle, C.M. and Hinnebusch, A.G. (1991). Association of RAPl
binding sites with stringent control of ribosomal protein
gene transcription in Saccharomyces cerevisiae. Mol. Cell.
Biol. 11, 2723-2735.
Morrow, B.E., Johnson, S.P., and Warner, J.R. (1989).
Proteins that bind to the yeast rDNA enhancer. J. Biol. Chem.
264, 9061-9068.
Morrow, B.E., Ju, Q. and Warner, J.R. (1990). Purification
and characterization of the yeast rDNA binding protein REBl.
J. Biol. Chem. 265, 20778-20783.
Morse, R.H. (1992). Transcribed chromatin. Trends Biol. Sci.
17, 23-26.
Muhich, M.L., Iida, C.T., Horikoshi, M. Roeder, R. and
Parker, C.S. (1990) cDNA clone encoding Drosophila
transcription factor TFIID. Poc. Natl. Acad. sci. USA
87, 9148-9152 .
Nasmyth, K.A. (1982). The regulation of yeast mating-type
chromatin structure by SIR: an action at a distance
affecting both transcription and transposition. Cell 30,
567-578 .
Nelson, H.B. and Laughon, A. (1990). The DNA binding
specificity of the Drosophila fushi tarazu protein: a
possible role for DNA bending in homeodomain recognition. New
Biol. 2, 171-178.
Newton, I. (1718). Opticks: or a Treatis of the Reflections,
Refractions, Inflections and Colours of Light. (Innys,
London).
Nietzsche, F. (1967). The Will to Power, (translated by W.
Kaufmann) New York: Random House.
Nikolov, D. Hu, S. Lin, J. Gasch, A., Hoffmann, A.
Horikoshi, M. Chua, N. Roeder, R. and Burley, S. (1992).
Crystal structure of TFIID TATA-box binding protein. Nature
360, 40-46.
Nishizawa, M. Araki, R., and Teranishi, Y. (1989).
Identification of an upstream activating sequence and an
upstream repressible sequence of the pyruvate kinase gene of
the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 9,
442-451.
Nishizawa, M. Suzuki, Y., Nogi, Y., Matsumoto, K., and
Fukasawa, T. (1990). Yeast Galll protein mediates the
transcriptional activation signal of two different
transacting factors, Gal4 and general regulatory factor
I/repressor/activator site binding protein 1/translation
upstream factor. Poc. Natl. Acad. sci. USA 87, 5373-5377.


96
for a protein. From the studies presented here, it is almost
certain that GPE sites are Gcrlp-binding sites.
From the consensus Gcrlp-binding site listed above it
was predicted (Huie et al., 1992) that Gcrlp would bind at
position -451, relative to the start codon, in the UAS of
EN02. This site has recently been shown to bind Gcrlp in
vitro (Willett et al 1993) .
It is appreciated that Gcrlp may interact with sequences
which contain several mismatches to the proposed consensus
sequence. In fact, it is likely that such cases will be
found, since this consensus is base on a limited set of
binding sites. Additionally, the true binding site in vivo
may be affected by other proteins bound at adjacent sites
(see below) or by the topology of the DNA in and around the
Gcrlp-binding site. For example, the CTTCC sequence is often
centered between a cluster of T and A residues spaced by 10
base-pairs (see, in particular, the sequence of TPIli, TPI12,
and ADH1 listed in Table 3) Runs of three or four A/Ts
regularly spaced at 10 bp (one helical turn) are associated
with intrinsically bent DNA (Wu and Crothers, 1984 ).
Sequences involved in nuclear matrix attachment have patterns
characteristic of intrinsically bent DNA (Anderson, 1986) .
This is worth noting since Raplp purifies with the nuclear
matrix (Cardenas et al. 1990) and since all known Gcrlp-
binding sites are adjacent to Raplp-oinding sites (see
below) Similarly, the B element of the ARS sequence, to
which Abflp binds, has been shown to have a strong intrinsic


106
and Kim (1991) have pointed out, it would be difficult to
dissociate or regulate the activity of a transcription
complex if every component had an exceedingly high affinity
or specificity for every other component; and furthermore,
extremely tight or specific interactions might interfere with
the combinatorial use of factors by many promoters (see
Dynan, 1989) Ribosomes have been suggested as an apt analogy
to the assembly of transcription complexes (Frankel and Kim,
1991) In general, both systems are complex macromolecular
assembles, millions of kiloDaltons in size, built upon
multiple cooperative protein-protein and protein-nucleic acid
interactions of varying affinities and specificities. Only
when the entire complex is assembled is the true specificity
of the system revealed. Individual interactions with modest
specificity seems to be inherent to designs of systems with
such complexity--with cooperativity resulting largely from
entropic factors (Creighton, 1983).
The Bending of DNA by Raplp and Gcrlp
It has been pointed out (Kerppola and Curran, 1991) that
the circular permutation assay cannot distinguish between
static DNA bends or other alterations, such as triple helix
formation. This caveat is included with the term DNA "bend"
when referring to the patterns of electrophoretic mobility
observed in this study. With this in mind, it was shown here
that Gcrlp bends DNA upon binding to it. It is important to
note here that this distortion of DNA represents a
thermodynamic barrier which if reduced would presumably
facilitate binding (see Kahn and Crothers, 1992). This can


100
Vignais et al. (1990) measured the apparent Kd of Raplp
for its optimal binding site at 1.3 :< 10-1: M. Comparing this
value with that of Gcrlp gives good agreement with band shift
data from other studies (Baker, 1991; Huie and Baker,
unpublished data) where it was estimated that 50-fold more
full-length Gcrlp had to be added, compared to Raplp, to see
the same degree of DNA-binding of a labeled fragment
containing both binding sites.
In the DNase I footprint assay presented in this study
(Figure 8), only two specific regions in a 234 bp fragment
were protected from DNase I digestion. The regions are
identical to genetically defined cis-elements responsible for
high-level expression of TPI1 (Scott and Baker, 1993) .
Furthermore, Edward Scott demonstrated in vivo that these
sequences are protected in wild-type strains and deprotected
in gcrl mutant strains (Huie et al., 1992; Scott, 1992; Scott
and Baker, 1993) .
One unanticipated result of this study was the
relatively high-affinity but modestly low-specificity of the
interaction of the Gcrlp DNA-binding domain with DNA when
measured in vitro. Other lines of evidence also support the
notion that Gcrlp has a low specificity for its specific
binding site. Preliminary results using a PCR-based
oligonucleotide selection and amplification technique
suggests that the Gcrlp DNA-binding domain is very poor at
enriching for highly specific sites (Esiner and Baker,
unpublished data). Theoretical considerations (Irvine et
al., 1991) of the technique are consistent with the


57
were provided by Carolyn Drazinic. These plasmids contain
subgenic portions of GCR1 fused in-frame to malE in the
fusion vector pMAL-cRl (see Figure 5) E. coli lysates from
induced strains harboring the malE::GCRl gene fusions were
prepared. Production of MBP-Gcrlp hybrid polypeptide of the
desired molecular mass was confirmed by SDS-PAGE and the
fusion-protein visualized by coomassie blue staining (data
not shown). In general, there was an inverse correlation
between the size of the fusion polypeptide and the amount of
material observed. E. coli lysates containing hybrid MBP-
Gcrlp polypeptide were then tested in DNA-band-shift assays
(Figure 6). All constructs that carried the carboxy-terminal
154 amino acid residues of Gcrlp were able to bind to the
upstream activating sequence of TPIl. Whereas lysates from
strains expressing fusion protein carrying the carboxy-
terminal 138 amino acids of Gcrlp were unable to bind the DNA
fragment used in the study.
A summary of the mapping data is shown in Figure 7.
From these results it was concluded that the DNA-binding
domain of Gcrlp resides somewhere within the carboxy-terminal
154 amino acids of Gcrlp.
DNase I Footprint Analysis of UASrpr
To establish that Gcrlp indeed bound to the CTTCC
sequence element, in vitro DNase I footprinting experiments
were performed. For these experiments purified preparations
of the smallest fusion protein which retained DNA-binding
activity, MBP-Gcrlp(690-844), were used. The smaller fusion
proteins were more stable and could be produced in larger


59
Figure 6. DNA-binding activity of MBP-Gcrlp hybrid proteins.
A DNA band-shift assay using a Gcrlp amino-terminal deletion
series of hybrid MBP-Gcrlp fusion proteins is displayed. One
microliter of an extract of the induced E. coli culture,
indicated above each lane, was added to the standard band-
shift reaction mixture, as described in the legend to Figure
1.


131
Remade, J. and Holmberg, S. (1992). A REBl-binding site is
required for GCN4-independent ILV1 basal level transcription
and can be functionally replaced by an ABFl-binding site.
Mol. Cell. Biol. 12, 5516-5526.
Rhode, P.R., Sweder, K.S., Oegema, K.F., and Campbell, J.L.
(1989). The gene encoding ARS-binding factor I is essential
for the viability of yeast. Genes Dev. 3, 1926-1939.
Rigby, R. (1993). Three in one and one in three: it all
depends on TBP. Cell 72, 7-10.
Riggs, A.D., Suzuki, H., Bourgeois, S. (1970). lac repressor-
operator interactions. J. Mol. Biol.48, 67-83.
Riggs, P.D. (1990). Expression and purification of
maltose-binding protein fusions. In Current protocols in
molecular biology. F.M. Ausubel, R.E. Brent, and R.P. Perry,
eds. (New York, New York: Green Publishing Associates and
Wiley Interscience),
Rie, J. and Herskowitz, I. (1987). Four genes responsible
for position effect on expression from HML and HMR in
Saccharomyces cerevisiae. Genetics 116, 9-22.
Roeder, R.G. (1991). The complexities of eukaryotic
transcription initiation: regulation of preinitiation
complex assembly. Trends Gens. 16, 402-408.
Rose, M.D., Winston, F., and Hieter, P. (1990). Methods in
Yeast Genetics (Cold Spring Harbor, New York: Cold Spring
Harbor Laboratory Press).
Ruppert, S., Wang, E., and Tjian, R. (1993). Cloning and
expression of human TAFII250: a TBP-associated factor
implicated in cell-cylcle regulation. Nature. 362, 175-179.
Ryder, K., Silver, S., DeLucia, A., Fanning, E., and
Tegtmeyer, P. (1986). An altered DNA conformation in origin
region I is a determinant for the binding of SV40 large T
antigen. Cell 44, 719-725.
Saltzman, A.G. and Weinmann, R. (1989). Promoter specificity
and modulation of RNA polymerase II transcription. FASEB J.
3, 1723-1733.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989).
Molecular Cloning (Cold Spring Harbor, New York: Cold Spring
Harbor Laboratory Press).
Samuels, M., Fire, A., and Sharp, P.A. (1982). Separation and
characterization of factors mediating accurate transcription
by RNA polymerase II. J. Biol. Chem. 257, 14419-14427.


125
Karlin, S. and Brendel, V. (1992). Chance and statistical
significance in protein DNA sequence analysis. Science 257,
39-49.
Kassavetis, G.A., Bartholomew, B., Blanco, J.A., Johnson,
T.E., and Geiduschek, E.P. (1991). Two essential components
of the Saccharomyces cerevisiae transcription factor TFIIB:
transcription and DNA-binding properties. Poc. Natl. Acad,
sci. USA 88, 7308-7312.
Kawasaki, G. and Fraenkel, D.G. (1982). Cloning of yeast
glycolysis genes by complementation. Biochem. Biophys. Res.
Commun. 108, 1107-1112.
Kelleher III, R.J., Flanagan, P.M., Chasman, D.I.,
Ponticelli, A.S, Struhl, K., and Kornberg, R.D. (1992). Yeast
and human TFlIDs are interchangeable for the response to
acidic transcriptional activators in vitro. Genes Dev. 6,
296-303 .
Kerppola, T.K. and Curran, T. (1991). DNA bending by Fos and
Jun: the flexible hinge model. Science 254, 1210-1214.
Kierkegaard, S. (1975). Journals and Papers, (translated by
H.V. Hong and E.H. Hong) Bloomington: Indiana University
Press.
Kim J., Nikolov, D. and Burley, S. (1993). Co-crystal
structure of TBP recognizing the minor groove of a TATA
element. Nature 365, 520-527.
Kim, J., Zwieb, C., Wu, C., and Adhy, S. (1989). Bending of
DNA by gene-regulatory proteins: construction and use of a
DNA bending vector. Gene 85, 15-23.
Kimmerley, W.J., Buchman, A., Kornberg, R.D., and Rie, J.
(1988). Roles of two DNA-binding factors in replication,
segregation and transcriptional repression mediated by a
yeast silencer. EMBO J. 7, 2241-2253.
King, M.C. and Wilson, A.C. (1975). Evolution on two levels
in human and chimpanzee. Science 188, 107-116.
Kohler, R.E. (1972). The Enzyme Theory and the Origin of
Biochemistry. (Philadelphia, W.B. Saunders).
Kornberg, A. (1989). For the Love of Enzymes. (Cambridge,
Mass) .
Kornberg, R.D. and Lorch, Y. (1991). Irresistible force meets
immovable object: transcription and the nucleosome. Cell 67,
833-836.
Lahm, A. and Suck, D. (1991) DNasel-induced DNA
conformation. 2A structure of a DNasel-octamer complex. J.
Mol. Biol. 222, 645-667.


130
Peterson, M.G., Inostroza, J. Maxon, M.E., Flores, 0.,
Admon, A., Reinberg, D. and Tjian, R. (1991). Structure and
functional properties of human general transcription factor
HE. Nature 354, 369-373.
Peterson, M.G., Taese, N. Pugh, B.F., and Tjian, R. (1990).
Functional domains and upstream activation properties of
cloned human TATA binding protein. Science 248, 1625-1630.
Pfeifer, K. Arcangioli, B., and Guarente, L. (1987). Yeast
HAPl activator competes with the factor RC2 for binding to
the upstream activation site USA1 of the CYC1 gene. Cell 49,
9-18.
Polaczek, P. (1990). Bending of the origin of replication of
E. coli by binding of IHF at a specific site. New Biol. 2,
265-271.
Pollock, R. and Treisman, R. (1990). A sensitive method for
the determination of protein-DNA binding specificities.
Nucleic Acids Res. 18, 6197-6204.
Prentki, P., Chandler, M. and Galas, D.J. (1987).
Escherichia coli integration host factor bends the DNA at the
ends of IS1 and in an insertion hotspot with multiple IHF
binding sites. EMBO J. 6, 2479-2487.
Prentki, P., Pham, M-H., and Galas, D.J. (1987). Plasmid
permutation vectors to monitor DNA bending. Nucleic Acids
Res. 15, 10060.
Ptashne, M. (1988). How eukaryotic transcriptional activators
work. Nature 335, 683-689.
Ptashne, M. and Gann, A.F. (1990). Activators and targets.
Nature 346, 329-331.
Pugh, B.F. and Tjian, R. (1990). Mechanism of transcriptional
activation by Spl: evidence for coactivators. Cell 61,
1187-1197.
Pugh, B.F. and Tjian, R. (1992). Diverse transcriptional
functions of the multisubunit eukaryotic TFIID complex. J.
Biol. Chem. 267, 679-682.
Reinberg, D., Horikoshi, M. and Roeder, R.G. (1987). Factors
involved in specific transcription in mammalian RNA
polymerase II. functional analysis of initiation factors IIA
and identification of a new factor operating at sequences
downstream of the initiation site. J. Biol. Chem. 262,
3322-3330.
Reinberg, D. and Roeder, R.G. (1987). Factors involved in
specific transcription by mammalian RNA polymerase II.
Transcription factor IIS stimulates elongation of RNA chains.
J. Biol. Chem. 262, 3331-3337.


Figure 11. Determination of Gcrlp DNA-binding domain binding
affinity. A single Gcrlp binding site (probe TPIX in Table
3.) was radiolabelled and held at a concentration of 1.9x10-
iiM. Increasing amounts of purified MBP-Gcrlp(6900-844)
fusion-protein were incubated with the DNA probe. Samples
were run into a 5 percent non-denaturing fel as described in
Material and Methods. Numbers above the lanes represents the
concentration of the DNA-binding activiy.


INTRODUCTION
We can, first, describe an organism with concepts
men have developed through contact with living
beings over the millennia. In that case, we speak
of living, organic function, metabolism, breathing,
healing, etc. Or else we can inquire into causal
processes. Then we use the language of physics
and chemistry, study chemical or electrical processes,
and assume, apparently with great success, that the
laws of physics and chemistry, or more generally the
laws of quantum theory, are fully applicable to
living organisms. These two ways of looking at
things are contradictory. For in the first case we
assume that an event is determined by the purpose it
serves, by its goal. In the second case we believe
that an event is determined by its immediate
predecessor. It seems most unlikely that both
approaches should have led to the same result by
pure chance. In fact, they complement each other,
and, as we have long since realized, both are correct
precisely because there is such a thing as life.
Biology thus has no need to ask which of the two
viewpoints is the more correct, but only how nature
managed to arrange things so that the two should fit
together.
Niels Bohr (in Heisenberg, p. 110)
The regulation of gene expression in space and time is
foundational to the generation of structural and functional
diversity in living systems. It is in regulation that the
abstract information content of DNA is made manifest and
interactive with the environment. Using the working metaphor
of the genetic code as the language of life, to a large
degree the alphabet has been determined. The next challenge
in molecular biology is the determination of the operational
1


98
of full-length Gcrlp makes the full-length polypeptide
difficult to use for these types of measurements. As
mentioned in the introduction, transcriptional activators
often contain "disorganized" structures, such as exposed
hydrophobic residues, which undergo an induced-fit with other
factors when they interact (reviewed in Frankel and Kim,
1991) This disorganized structure makes transcriptional
activators very sensitive to proteases. Full-length Gcrlp
seems to be unstable whether translated in rabbit
reticulocyte lysate or manufactured in E. coli.
However, due to the modular nature of transcriptional
activators, many structural questions can still be addressed
and have been addressed by studying the discrete domains.
For example, the RNA-binding affinity of a short peptide that
contains the RNA-binding domain of the HIV tat protein gives
the same measurements as with the intact protein (Calnan et
al. 1991; Dingwall et al., 1990). The DNA binding-domain of
LEF-1 expressed as a peptide or a GST-LEF-1 fusion protein,
containing only the DNA-binding domain, gives similar binding
affinities (Giese, 1991). Nevertheless, the binding affinity
from the studies presented here must be understood in the
context of studying the DNA-binding domain, and not the full-
length protein.
The binding affinity of the DNA-binding domain of Gcrlp
falls into the middle of a range of affinities described for
known DNA-binding domains of transcriptional activators. A
few factors are listed in Table 4. for comparison.


127
Machida, M. Jigami, Y. and Tanaka, H. (1989). Purification
and characterization of a nuclear factor which binds
specifically to the upstream activation sequence of
Saccharomyces cerevisiae enolase 1 gene. Eur. J. Biochem.
184, 305-311.
Malik, S., Hisatake, K. Sumimoto, H. Horikoshi, M. and
Roeder, R.G. (1991). Sequence of general transcription factor
TFIIB and relationships to other initiation factors. Poc.
Natl. Acad. sci. USA 88, 9553-9557.
Marahrens, Y. and Stillman, B. (1992). A yeast chromosomal
origin of DNA replication defined by multiple functional
elements. Science 255, 817-823.
Marshall, M. Mahoney, D., Rose, A., Hicks, J.B., and Broach,
J.R. (1987). Functional domains of SIR4, a gene required for
position effect regulation in Saccharomyces cerevisiae. Mol.
Cell. Biol. 7, 4441-4452.
Martin, K.J. (1991) The interactions of transcription
factors and their adaptors, coactivators and accessory
proteins. BioEssays 13, 499-503.
Matsui, T. Segall, J., Weil, P.A., and Roeder, R.G. (1980).
Multiple factors required for accurate initiation of
transcription by purified RNA polymerase II. J. Biol. Chem.
255, 11992-11996.
Mayr, E. (1970). Population, Species, and Evolution
(Cambridge, Massachusetts: Harvard University Press).
McNeil, J.B., Dykshoorn, P. Huy, J.N., and Small, S. (1990).
The DNA-binding protein RAP1 is required for efficient
transcriptional activation of the yeast PYK glycolytic gene.
Curr. Genet. 18, 405-412.
Mermod, N. O'Neill, E.A., Kelly, T.J., and Tjian, R. (1989).
The proline-rich transcriptional activator of CTF/NF-1 is
distinct from the replication and DNA binding domain. Cell
58, 741-753.
Messing, J. New M13 vectors for cloning. (1983). Methods
Enzymol. 101, 20-78.
Meyers, R. and Sharp, P. (1993). TATA-binding protein and
asociated factors in polymerase II and polymerase III
transcription. Mol. Cell. Biol. 13, 7953-7960.
Mitchell, P.J. and Tjian, R. (1989). Transcriptional
regulation in mammalian cells by sequence-specific DNA
binding proteins. Science 245, 371-378.


Gcrlp
Region DNA
of binding
GCR1 activity
1-844
1-690
1-594
1-431
1-229
MBP-Gcrlp
1-844
277-844
422-844
690-844
706-844
783-844
+
+
+
+
Figure 7. Summary of data mapping the Gcrlp DNA-binding domain. The figure is a schematic representation
of the Gcrlp polypeptides used in the mapping study and summary of results obtained. Solid lines represent
regions of Gcrlp carried in the polypeptide. The stippled lines indicate maltose-binding protein moiety
carried in the fusion protein.


68
DNA with greater affinity than the polylinker of pUC18 (data
not shown).
From the results of the band-shift experiments the
following consensus DNA-binding sequence for Gcrlp was
derived (see Discussion):
(T/A)N(T/C)N(G/A)N C (T/A) T C C (T/A)N(T/A) (T/A) (T/G)
The Gcrlp-DNA Nucleoprotein Complex
Having defined the DNA-binding domain of Gcrlp, and a
consensus DNA-binding site which it recognizes, I set out to
characterize the affinity and specificity of the Gcrlp
interaction with its binding site. Historically, it had been
very difficult to demonstrate that Gcrlp was a DNA-binding
protein. During the period between sequencing of the gene
(Baker, 1986) and the demonstration of the binding activity
of it product (Baker, 1991) many laboratories had attempted
to demonstrate Gcrlp DNA-binding activity, yet failed. It
was therefore reasoned that Gcrlp may have a low affinity for
its DNA site, and that it may be facilitated to bind DNA by
other proteins. To test this I measured the binding affinity
of Gcrlp for its target site.
The DNA-binding affinity of the Gcrlp-binding domain
Experience working with the Gcrlp protein revealed that
the full-length protein is very unstable. This seems to be
the case whether the product is translated in vitro in rabbit
reticulocyte lysate or whether it is expressed in E. coli.
Full-length in vitro translated product must be used
immediately for detectable activity. Similarly, the full
length MBP-Gcrlp(1-844) fusion-protein must be used


52
untranslated rabbit reticulocyte lysates, E. coli extracts
prepared from uninduced and induced cultures of strains
carrying the parent plasmid, pMAL-cRl, and extracts prepared
from uninduced cultures of E. coli strains carrying the
malE::GCR1 gene fusion.
The DNA-Bindino Domain of Gcrlp Resides within the Carboxv-
Terminal 154 Amino Acid Residues
To map the DNA-binding domain of Gcrlp a series of DNA
band-shift experiments with truncated versions of Gcrlp were
performed. Carboxy-terminal truncations of Gcrlp were
synthesized in vitro. Plasmid pHB66 was linearized with a
series of restriction endonucleases that cleaved within the
GCRl structural gene as shown in Figure 2. The linearized
constructs were then used as templates for in vitro RNA
synthesis, and run off transcripts were translated in vitro
using rabbit reticulocyte lysates. Production of poly
peptides of the desired molecular mass was confirmed by SDS-
PAGE and autoradiography (Figure 3). The rabbit reticulocyte
lysates were then used in a series of band-shift experiments
to determine which, if any, of the truncated fusion-proteins
had DNA-binding activity. Figure 4 shows that only full
length Gcrlp had binding activity. This suggested that the
DNA-binding domain resided in the carboxy terminus of the
polypeptide.
To test this possibility, a similar set of experiments
with an amino-terminal deletion series was carried out. For
these experiments, plasmids pCDl, pCD2, pCD3, and pCD5
(coding for various gene fusions--see Material and Methods)


95
region was used as a probe to screen a genomic DNA from a
variety of organisms from yeast to humans, homologous
sequence could be detected by low stringency hybridization
(Huie and Baker, unpublished observations) Thus, homologous
Gcrlp DNA-binding domains may not yet have been cloned and
reported.
A dna Consensus Sequence £or.,-£.cxlp_.Ein.ding
In this study it was shown that Gcrlp can interact
directly with the CTTCC sequence elements found in the
upstream regions of TPI1, PGK, EN01, PYK, and ADH1. From
these experiments a degenerate consensus Gcrlp-binding site
was formulated:
(T/A)N(T/C)N(G/A)N C (T/A) T C C T/A)N (T/A) (T/A) (T/G)
The extent of the proposed consensus Gcrlp-binding site (16
nucleotides) was chosen on the basis of the area of
protection observed in the in vitro DNase I footprinting
study. This sequence is in good agreement with the GPE (for
£RF1 [RAP1] site Eotentiator Element) motif recently defined
by Bitter et al. (1991) as:
G(A/Q (ft/T)-.T-C-g (A/T)
The GPE motif, found adjacent to Raplp-binding sites in
glycolytic genes has no UAS activity by itself, but
potentiated the activation effects of a Raplp-binding site
when placed next to it either upstream or downstream and in
either orientation (Bitter et al., 1991). Bitter et al.
(1991) concluded that Raplp-binding sites and GPE are
responsible for the majority of activation potential of the
UAS of TDH3 and suggested that GPE represented a binding site


123
Hoey, T. Dynlacht, B.D. Peterson, M.G., Pugh, B.F., and
Tjian, R. (1990). Isolation and characterization of the
Drosophila gene encoding the TATA box binding protein, TFIID.
Cell 61, 1179-1186.
Hoffmann, A., Sinn, E., Yamamoto, T. Wang, J. Roy, A.,
Horikoshi, M. and Roeder, R.G. (1990). Highly conserved core
domain and unique N terminus with presumptive regulatory
motifs in a human TATA factor (TFIID). Nature 346, 387-390.
Hofmann, J.F-X., Laroche, T. Brand, A.H., and Gasser, S.M.
(1989). RAP-1 loop formation is necessary for DNA loop
formation in vitro at the silent mating type locus HML. Cell
57, 725-737.
Holland, M.J., and Holland, J.P. (1978). Isolation and
identification of yeast messenger ribonucleic acids coding
for enolase, glyceraldehyde-3-phosphate dehydrogenase, and
phosphoglycerate kinase. Biochemistry 17, 4900-4907.
Holland, M.J., Yokoi, T. Holland, J.P., Myambo, K., and
Innis, M.A. (1987). The GCR1 gene encodes a positive
transcriptional regulator of the enolase and
glyceraldehyde-3-phosphate dehydrogenase gene families in
Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 813-820.
Hollenberg, S.M. and Evans, R.M. (1988). Multiple and
cooperative Trans-activation domains of the human
glucocorticoid receptor. Cell 55, 899-906.
Hope, I.A. and Struhl, K. (1987). GCN4, eukaryotic
transcriptional activator protein, binds as a diamer to
target DNA. EMBO J. 6, 2781-2784.
Horikoshi, M. Bertuccioli, C., Takada, R. Wang, J.,
Yamamoto, T., and Roeder, R.G. (1992). Transcription factor
TFIID induces DNA bending upon binding to the TATA element.
Poc. Natl. Acad. sci. USA 89, 1060-1064.
Horikoshi, M. Wang, C.K., Fujii, H. Cromlish, J.A., Weil,
P.A., and Roeder, R.G. (1989). Cloning and structure of a
yeast gene encoding a general transcription initiation factor
TFIID that binds to the TATA box. Nature 341, 299-303.
Huet, J., Cottrelle, P., Cool, M. Vignais, M.L., Thiele, D.,
Marck, C., Buhler, J-M., Sentenac, A., and Fromageot, P.
(1985). A general upstream binding factor for genes of the
yeast translational apparatus. EMBO J. 4, 3539-3547.
Huie, M.A., Scott, E.W., Drazinic, C.M., Lopez, M.C.,
Hornstra, I.K., Yang, T.P., and Baker, H.V. (1992).
Characterization of the DNA-binding activity of GCR1: in
vivo evidence for two GCRl-binding sites in the upstream
activating sequence of TPI of Saccharomyces cerevisiae. Mol.
Cell. Biol. 12. 2690-2700.


134
Stanway C.A. Chambers, A., Kingsman A.J., and Kingsman, S.M.
(1987). Characterization of the transcriptional potency of
sub-elements of the UAS of the yeast PGY mini-promoter.
Nucleic Acids Res. 17, 9205-9218.
Stanway, C., Mellor, J. Ogden, J.E., Kingsman, A.J., and
Kingsman, S.M. (1987). The UAS of the yeast PGK gene contains
functionally distinct domains. Nucleic Acids Res. 15,
6855-6873 .
Stanway, C.A., Sowden, M.P., Wilson, L.E., Kingsman A.J., and
Kingsman, S.M. (1987). Efficient activation of transcription
in yeast by the BPV1 E2 protein. Nucleic Acids Res. 17, 2187-
2196.
Stanway, C.A., Chambers, A., Kingsman, A., and Kingsman, S.
(1989). Characterization of the transcriptional potency of
sub-elements of the UAS of the yeast PGK gene in a PGK mini
promoter [published erratum appears in Nucleic Acid Res. 25,
10526]. Nucleic Acids Res. 25,9205-9218.
Stanway, C.A., Gibbs, J.M., Kearsey, S.E., Lopez, M.C., and
Baker, H.V. (1994). The yeast co-activator GAL11 positively
influences transcription of the phosphoglycerate kinase gene,
but only when RAP1 is bound to its upstream activation
sequence. Mol. Gen. Genet.243, 207-214.
Struhl, K. (1985). Naturally occurring poly(dA-dT) sequences
are upstream promoter elements for constitutive transcription
in yeast. Poc. Natl. Acad. sci. USA 82, 8419-8423.
Struhl, K. (1987). Promoters, activator proteins, and the
mechanism of transcriptional initiation in yeast. Cell 49,
295-297 .
Suck, D. Lahm, A., and Oefner, C. (1988). Structure refined
to 2A of a nicked DNA octanucleotide complex with DNasel.
Nature 332, 464-468.
Suck, D. and Oefner, C. (1986). Structure of DNasel at 2.0A
resolution suggests a mechanism for binding to and cutting
DNA. Nature 321, 620-625.
Sumimoto, H., Ohkuma, Y. Sinn, E. Kato, H., Shimasaki, S.,
Horikoshi, M. and Roeder, R.G. (1991). Conserved sequence
motifs in the small subunit of human general transcription
factor TFIIE. Nature 354, 401-404.
Sussel, L. and Shore, D. (1991). Separation of
transcriptional activation and silencing functions of the
RAPl-encoded repressor/activator protein 1: isolation of
viable mutants affecting both silencing and telomere length.
Poc. Natl. Acad. sci. USA 88, 7749-7753.


86
FcoRl HindIII EcoRV Nhe 1 BamHl
rapi: r- n rn rn rn r:
Figure 18. DNA is bent in the Raplp-DNA nucleoprotein complex.
Circular permutation assay was performed as described in
Material and Methods. Schematic of the DNA probes used in
this assay is shown in Figure 17. Two microliters of Raplp
polypeptide translated in rabbit reliculocyte lysates were
incubated with radiolabed probes and then run into a 5 per
cent non-denaturing polyacrlamide gel. (+) represents addition
of Raplp; (-) absence of Raplp. f, free probe. Enzymes
listed above lanes indicates probes shown in Figure 17.


133
Scott, E.W. (1992). Expression of the TPI gene of
Saccharomyces cerevisiae is controlled by a single complex
upstream activating sequence containing binding sites for
three trans-acting factors: REB1, RAP1, and GCR1. Ph.D.
dissertation, University of Florida.
Scott, E.W. and Baker, H.V. (1993).Concerted action of the
transcriptional activators REB1, RAP1, and GCR1 in the high-
level expression of the glycolytic gene TPI. Mol. Cell. Biol.
13, 543-550.
Scott, E.W., Allison, H.E., and Baker, H.V. (1990).
Characterization of TPI gene expression in isogeneic
wild-type and gcrl-deletion mutant strains of Saccharomyces
cerevisiae. Nucleic Acids Res. 18, 7099-7107.
Seta, F.D., Ciafre, S-A., Marck, C., Santoro, B., Presutti,
C., Sentenac, A., and Bozzoni, I. (1990). The ABF1 factor is
the transcriptional activator of the L2 ribosomal protein
gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 10,
2437-2441.
Sharp, P.A. (1992). TATA-binding protein is a classless
factor. Cell 68, 819-821.
Sherman, F. Fink, G.R., and Hicks, J.B. (1986). Methods in
Yeast Genetics (Cold Spring Harbor, New York: Cold Spring
Harbor Laboratory Press).
Shore, D. and Nasmyth, K. (1987). Purification and cloning of
a DNA binding protein from yeast that binds to both silencer
and activator elements. Cell 51, 721-732.
Shore, D. Stillman, D.J., Brand, A.H., and Nasmyth, K.
(1987). Identification of silencer binding proteins from
yeast: possible roles in SIR control and DNA replication.
EMBO J. 6, 461-467.
Sigler, P.B. (1988). Acid blobs and negative noodles. Nature
333, 210-212.
Singer, V.L., Wobbe, C.R., and Struhl, K. (1990). A wide
variety of DNA sequences can functionally replace a yeast
TATA element for transcriptional activation. Genes Dev. 3,
636-645.
Snyder, U.K., Thompson, J.F., and Landy, A. (1989). Phasing
of protein-induced DNA bends in a recombination complex.
Nature 341, 255-257.
Stahl, G.E. (1697). Zymotechnie fundamentalis order
allgemeine Grund-erkamtuis der Gahrungs-kunst. (Frankfurt and
Liepzig).


66
sequence listed in Table 3 has recently been shown to be
protected in wild-type strains and deprotected in a gcrl null
mutant by in vivo footprinting (Stanway et al.,1994). The
oligonucleotides were then tested for their ability to
interact with the DNA-binding domain of Gcrlp in a series of
DNA-band-shift assays. As a negative control the polylinker
from pUCl8 was used in the band shift assays. The results of
the band shift assays are shown in Figure 9. The appearance
of shifted bands were not detected when the polylinker from
pUC18 was used as probe. On the other hand, each of the
putative Gcrlp-binding sites gave rise to the appearance of
shifted bands, thus providing evidence that Gcrlp is capable
of interacting with these sequences. Additionally, the UAS
of CYC1, which does not contain a CTTCC sequence element and
is not under control of GCR1, also did not form a nucleo-
protein complex with Gcrlp (data not shown).
The expression of the genes encoding elongation factor
EF-la (TEF1 and TEF2) and ribosomal protein 59 (CRYl) is
reduced two- to four-fold in gcrl mutant strains (Santangelo
and Tornow, 1990). Potential Gcrlp-binding sites were
identified located in the 5' noncoding region of these genes.
A model was entertained that Gcrlp played a direct role in
expression of these genes at the transcriptional level.
Therefore, oligonucleotides which carried 25 nucleotides
containing the CTTCC motif from the genes of interest were
synthesized. These oligonucleotides were also tested by DNA-
band-shif t assay for their ability to interact with the DNA-
binding domain of Gcrlp. None of the oligonucleotides bound


3
converging on two central phenomena, namely, signal
transmission and differential gene expression (Levine, 1989).
The physical structure of DNA and proteins places
constraints on the available mechanisms of transcriptional
regulation, and this is seen in the strong evolutionary
conservation of many aspects of the transcriptional machinery
(Guarente and Bermingham-McDonogh, 1992). This provides a
tremendous advantage in the research of eukaryotic gene
regulation because many processes can be dissected in the
yeast Saccharomyces cerevisiae, using the powerful methods
available for the study of this organism. Not surprisingly
many recent advances have come from the study of S.
cerevisiae.
In the complicated area of the regulation and initiation
of transcription by RNA polymerase II, a large number of
observations and experiments have lead to a heuristic model.
Many components involved in promoter specific activation, the
basal transcriptional machinery, chromatin structure, and
nuclear scaffold have recently been cloned and sequenced.
Biochemical and genetic analysis has revealed relationships
and interactions among these factors (reviewed in Gasser and
Laemmli,1987; Workman and Buchman, 1993). Factors involved
in communication between activation domains and the basal
transcriptional machinery have been isolated (Dynlacht et
al.,1991; Berger et al.,1990 and 1992; Flanagan et al.,
1991). I will present a current view of transcriptional
activation based on recent information and then relate it to


120
Fields, S. and Song, O-K. (1989). A novel genetic system to
detect protein-protein interactions. Nature 340, 245-246.
Fikes, J.D., Becker, D.M., Winston, F. and Guarente, L.
(1990). Striking conservation of TFIID in Schizosaccharomyces
pombe and Saccharomyces cerevisiae. Nature 346, 291-294.
Finkelstein, A., Kostrab, C.F., Li, J., Chavez, D.P., Wang,
B.Q., Fang, S.M., Greenblatt, J. and Burton, Z.F. (1992). A
cDNA encoding RAP74, a general initiation factor for
transcription by RNA polymerase II. Nature 355, 464-467.
Fitzpatrick, V. Percival-Smith, A., Ingles, C. and Krause,
H. (1992). Homeodomain-independent activity of the fushi
tarazu polypeptide in Drosophila embryos. Nature 356, 610-
612 .
Flanagan, P.M., Kelleher III, R.J., Sayre, M.H., Tschochner,
H., and Kornberg, R.D. (1991). A mediator required for
activation of RNA polymerase II transcription in vitro.
Nature 350, 436-438.
Flashner, Y. and Gralla, J. (1988). DNA dynamic flexibility
and protein recognition: differential stimulation by
bacterial histone-like protein HU. Cell 54, 713-721.
Florence, B., Handrow, R. and Laughon, A. (1991). DNA-
binding specificity of the fushi tarazu homeodomain. Mol.
Cell. Biol. 11, 3613-3623.
Fraenkel, D.G. (1982). Carbohydrate metabolism. In The
Molecular Biology of the yeast Saccharomyces cerevisiae:
Metabolism and Gene Expression. J.N. Strathern, E.W. Jones,
and J.R. Borach, eds. (Cold Spring Harbor, New York: Cold
Spring Harbor Laboratory Press), pp. 1-37.
Frankel, A.D. and Kim, P.S. (1991). Modular structure of
transcription factors: implications for gene regulation. Cell
65, 717-719.
Fried, M. and Crothers, D.M. (1981). Equilibria and kinetics
of lac repressor-operator interactions by polyacrylamide gel
electrophoresis. Nucleic Acids Res. 9,6505-6525.
Fruton, J.S. (1972). Molecules and Life. (Wiley, New York).
Fruton, J.s. (1976). The emergence of biochemistry. Science
192, 327-334.
Ganster R.W., Shen W. and Schmidt, M.C. (1991). Isolation of
STD1, a high-copy-number suppressor of a dominant negative
mutation in the yeast TATA-binding protein. Mol. Cell. Biol.
13,3650-3659 .


79
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
Figure 14. Competition experiment using non-specific competitor.
DNA band-shift experiments were performed as described in Material
and Methods. Radiolabeled DNA probe and purified MBP-Gcrlp(690-844)
were held constant and increasing amounts of specific competitor
were added to mixtures.


45
gel. Depending on the experiment 10-20,000 counts/min were
loaded per lane.
DNA Band-Shift Assays
Protein-DNA complexes were studied using modifications
of the procedures of Fried and Crothers (1981) and Garner and
Revzin (1981). The binding reactions were incubated for 20
minutes in a 20 (1L volume at ambient temperature in binding
buffer composed of 12 mM HEPES (pH 7.5), 60 mM KCl, 5 mM
MgCl2, 4 mM Tris, 0.6 mM EDTA, 0.6 mM DTT, 10% glycerol, and
0.3 ng/|iL BSA. In some cases poly (dl/dC) was used as a non
specific competitor at 0.2 6 In some case double-
stranded oligonucleotides were used as competitor.
Competitors were diluted and added as a constant volume per
reaction mixture. Protein extracts used in experiments were
diluted with binding buffer. Components were added in the
following order: binding buffer, competitor, probe, protein.
In qualitative experiments, the amount of DNA added was based
upon disintegrations/min, usually between 10-20,000
counts/min. Depending upon the experiment, gels varied
between 5-10% polyacrylamide. Buffers were either TE (0.1 M
Tris [pH 7.5], 5 mM EDTA) or 0.5 TBE (0.05 M Tris [pH 7.5],
0.05 M Boric Acid, 5 mM EDTA). In the case of TE the running
buffer (10 mM Tris [pH 7.5], 1 mM EDTA) was recirculated.
All gels were pre-run for at least 1.5 hours at 100 volts.
Samples were applied to the running gel. After all samples
were loaded the voltage was increased to 150 volts and the
gels were run until the adequate separation desired (based on
pilot experiments).


91
the UAS elements of TPI1 (Scott et al., 1990), TDH3 (Bitter
et al., 1991), PGK1 (Chambers et al.,1989), ENOl (Machida et
al., 1989; Brindle et al., 1990), EN02 (Brindle et al.,
1990), PYK1 (McNeil et al., 1990), PDC1 (Butler et al.,
1990), and ADH1 (Tornow and Santangelo, 1990) has shown that
Raplp-binding is essential for full activity of these UASs.
In each case mutation of the Raplp-binding site reduced
expression more than ten-fold. It has additionally been
shown that the Raplp-binding site from PGK alone is unable to
confer UAS activity to a test promoter (Stanway et al.,
1989). Thus, whereas both Gcrlp and Raplp DNA-binding sites
are required for high-level glycolytic gene expression,
neither site alone is sufficient for high-level expression.
The experiments in this study demonstrate conclusively
that Gcrlp is a DNA-binding protein, and that Gcrlp interacts
with the CTTCC sequence element directly. Additionally a
Gcrlp consensus-sequence is approximated, and an initial
characterization of the DNA-protein interaction is presented.
Although this study focused mainly on Gcrlp, the results bear
strongly on how Gcrlp and Raplp interact, and how they exert
a synergistic effect at the UAS of the glycolytic genes. One
feature appears to be common to all of the glycolytic gene
promoters regulated by GCR1: the finding of adjacent Gcrlp-
and Raplp-DNA-binding sites (Huie et al., 1992). The
implications of the adjacent binding sites will be discussed
in the context of the findings of this study.


70
solution of protein was 0.35 |ig/|i.L as determined by the
method of Bradford (1976). After complexes were allowed to
form, the reaction mixtures were run into a 0.5 x TBE 5%
native PAGE. The gels were dried on the Whatman paper, and
then the separated radiolabeled DNA was quantitated with a
Phospholmager (Molecular Dynamics). The fraction of DNA
shifted by protein was determined. At saturating conditions,
all of the active protein was bound to the DNA. Since the
concentration and specific activity of the DNA in the complex
was known, the concentration of the complex was determined by
quantitating the amount of DNA complexed. The active protein
concentration therefore was expressed in DNA equivalents per
volume (see Chadwick et al., 1970). A typical experiment is
shown in Figure 10. In two independent experiments the
active protein concentration of the stock was determined to
be 1 x 10~6 M. The active fraction was approximated to be 16%
of the total protein concentration.
Pilot experiments were performed to estimate the
dissociation constant of DNA-binding domain of Gcrlp from its
recognition site. With the protein activity known, an
arbitrary small concentration of DNA was held constant at 1.2
x 10-10 M and increasing concentrations of the protein were
added. The concentration at which one-half of the DNA was
bound was used to estimate the binding affinity. The
dissociation constant was estimated to be in the 10*10 M
range. Therefore, the DNA concentration was maintained below
this approximated dissociation constant. DNA concentrations
of 6.3 x 10~12 M, 1.9 x 10'11 M, and 5.5 x 1C)-11 M were used in


31
of ethanol. Samples were cooled, centrifuged, and dried as
described above.
Purification of DNA Fragments and Oligonucleotides
Oligo-nucleotides used in this study were initially
synthesized on an Applied Biosystems 380B DNA synthesizer by
the University of Florida Interdisciplinary Center for
Biotechnology Research. The sequence of the oligonucleotides
used are listed in Table 1. In some cases oligonucleotides
were purified by 10% PAGE. After DNA was visualized by
ethidium bromide staining, gel slices were incubated at 37 C
overnight in 3 volumes of 0.5 M ammonium acetate, 1 mM EDTA,
and then precipitated the next morning by the addition of 2.5
volumes ethanol and centrifugation.
DNA was purified from acrylamide gels by transfer to
DEAE paper. The excised gel was embedded in 0.8% agarose
gel. Current was applied at constant voltage of 100 V and
the DNA was run into NA4 5 DEAE cellulose paper (pre soaked
for 10 min in 10 mM EDTA pH 7.6; then 5 min in 0.5 M NaOH,
followed by several rapid washes in ddH20) The DNA was freed
from the paper by incubating the paper in Hi-Salt NET Buffer
(1 mM NaCl, 0.1 mM EDTA, 20 mM Tris [pH 8.0]) for 1 hour at
65 C, phenol extracted, ethanol precipitated, and resuspended
in TE pH 7.5.
Radio-labelina DNA Fragments
Probes were prepared by either of two methods: filling
in with the large fragment of E. coli DNA polymerase I or end
labeling with polynucleotide kinase.


12
civilization, dating to 2,500 BC, written in the Sumerian and
Akkadian languages describe an established profession of
alcohol fermentation 3,500 years earlier. Assyrian writings
dating to 2,000 BC list beer as a commodity on Noah's Ark.
The Bible explicitly mentions Noah's knowledge of
fermentation and his use of alcohol. (Genesis 9:20-21: Noah
was the first tiller of the soil. He planted a vineyard; and
he drank of the wine, and became drunk, and lay uncovered in
his tent.) The daughters of Lott (Genesis 20:30-37) found
creative use for alcohol. Egyptian writings from the Fourth
Dynasty, circa 2,500 BC, describe the process of malting
barley and its fermentation. Man's knowledge of these
techniques clearly preceded his acquisition of written
language. The effects of the products of fermentation,
principally ethanol, undoubtedly influenced the perceptions
and analysis of many of the unknown artists and religious
charismatics of the antediluvian past. Anthropological
studies reveal that all cultures independently learned early
to ferment fruits and grains to produce alcohol.
The scientific study of fermentation by yeast has
spanned many centuries and has been associated with and
attributed with changes in fundamental beliefs in modern
biology. Indeed, historians tell us that the study of
fermentation in yeast underlies the birth of chemistry,
biochemistry, and microbiology (Fruton, 1976; Kohler, 1972).
Speculation on the nature of fermentation was advanced by
some of history's most notable scientists.
Willis (1659) and Stahl (1697), founders of the


10
An alternative explanation of the role of acidic
residues in activation domains has been proposed (Leuther et
al., 1993) in which the acidic residues function to make the
hydrophobic residues more accessible to interact with other
factors. According to this hypothesis positive as well as
negative charged amino acids can function in activation
domains, and the hydrophobic residues are more important in
making contacts with other proteins. Detailed mutagenesis
studies of some acidic activation domains support this
proposal (Cress and Triezenberg, 1991; Hardwick et al., 1992;
Regier et al., 1993; Leuther et al., 1993).
The idea that these different types of activation
domains all interact directly with TBP seemed unlikely, and
indeed, after the cloning of TBP, various investigators
reported that this protein alone could not replace the TFIID
fraction in transcriptional activation by Spl or CTF (Pough
and Tjian, 1990; Peterson et al., 1990), NTF1 (Dynlacht et
al., 1991), or USF (Hoffmann et al., 1990). Furthermore,
these activators apparently do not stimulate binding of TBP
to the TATA- box by direct interaction. Proteins that carry
out this function have been termed coactivators or adaptors/
mediators (reviewed in Lewin, 1990; Martin 1991;and
Greenblatt, 1991). A large number of polypeptides can be
coimmunoprecipitated with antibodies to TBP and are referred
to as TAFs (for TBP associated factors) (Dynlacht et al. ,
1991). Recently, by biochemical and genetic methods, a
number of RNA polymerase II TAFs (Taggart et al., 1992;
Ganster et al., 1993; Eisenmann et al., 1992; Koleske et al.,


87
EcoRl Hindi 11 EcoRV Nhel BairiHl
MBP-Gcrip: r-n n i +1 n~ i +1
Figure 19. DNA is bent in the Gcrlp-DNA nucleoprotein
complex. Circular permutation assay was performed as
described in Material and Methods. Schematic of the DNA
probes used in this assay is shown in Figure 17. One
microliters of purified MBP-Gcrip(690-844) fusion-protein
were incubated with radiolabed probes and then run into a 5
per cent non-denaturing polyacrlamide gel. (+) represents
addition of MBP-Gcrip(690-844); (-), absence of MBP-Gcrip
(690-844). f, free probe. Enzymes listed above lanes
indicates probes shown in Figure 17.


108
of DNA plays a significant role in facilitating the binding
of Gcrlp.
The Significance of Adjacent Raplp and GcrlP Binding Sites in
the UAS of the Glycolytic Genes
Given the findings that Gcrlp has a low specificity of
interaction with its specific DNA sites as measured in vitro,
that Gcrlp either recognizes bent DNA or bends DNA upon
binding, and the models discussed above, what can we surmise
about the role of the other factors which have DNA binding
sites in the UASs of the glycolytic genes and which are also
required for high-level expression of the corresponding
genes ?
Due to the low specificity of Gcrlp interaction with its
binding sites, the concept of facilitation most likely can
explain the findings. The factor that most likely would play
a role in facilitating the binding of Gcrlp to its sites is
Raplp. A number of observations that support this view will
be reviewed at this point.
The first observation is the relationship between Raplp-
and Gcrlp-binding sites in the UAS of the glycolytic genes
which are dependent upon GCR1 for full expression. All known
Gcrlp-binding sites (Willett et al., 1993; Huie et al., 1992;
and this study) are found next to Raplp-binding sites.
Furthermore, putative Gcrlp-binding sites in the UAS of the
GCR1 dependent glycolytic genes reveal adjacent Raplp-binding
sites. The presence of a Raplp-binding site near putative
Gcrlp-binding sites in the glycolytic genes raises the
possibility that either a direct interaction between these
two proteins occurs or that Raplp affects the structure of


LIST OF FIGURES
Figure page
1. Comparison of DNA-binding activity of Gcrl
and hybrid MBP-Gcrlp fusion protein 51
2. Templets used to generate carboxy-terminal
deletions of Gcrlp 53
3. Carboxy-terminal truncation polypeptides of
Gcrlp 55
4 DNA-binding activity of Gcrlp carboxy-
terminal deletion polypeptides 56
5. malE::GCRl gene fusions 58
6. DNA-binding activity of MBP-Gcrlp hybrid
proteins 60
7. Summary of data mapping the Gcrlp DNA-binding
domain 61
8. Gcrlp DNA-binding domain protects the CTTCC
sequence motif in UASTPi; 64
9. Gcrlp DNA-binding domain binds to CTTCC
sequence elements found in front of other
glycolytic genes 67
10. Titration of Gcrlp DNA-binding activity 72
11. Determination of Gcrlp DNA-binding domain binding
affinity 75
12. Graphical representation of binding affinity ... 76
13. Competition experiment using specific
competitor 78
14. Competition experiment using non-specific
competitor 79
15. Graphical representation of competition
experiments 80
16. Circular permutation assay 83
v 1


104
(Janson and Pettersson, 1990) Using band-shift assays these
authors demonstrated a 10-fold increase in affinity of OTF-1
to its site in the presence of Spl when an Spl site was
adjacent to an OTF-1 site. Furthermore, OTF-1 binding was
decreased when a 15 bp segment was inserted between the Spl
and OTF-1 binding sites (Janson and Pettersson, 1990) In
perhaps a more classic example, the A. repressor has been
shown to facilitate the binding of another repressor to a
lower affinity site by a protein-protein interaction
(Hochschild and Ptashne, 1986) .
An alternative mechanism, which does not exclude the one
mentioned above, is one in which the specificity of a
protein-DNA interaction is increased by another protein
modifying the DNA topology. Wu and Crothers (1984) suggested
that protein induced bending of DNA can facilitate additional
protein-DNA interactions. In this scenario, the DNA sequence
is contorted making a more favorable binding site and thus
increasing the affinity. This contortion could be caused by
the binding of a protein to an adjacent site which then
distorts the DNA making a more favorable binding site for the
protein with low specificity; or alternatively, a primary DNA
sequence could alter the adjacent binding site to produce a
more favorable site. An example of the former mechanism was
proposed (Flashner and Gralla, 1988) for the stimulation of
CAP binding to lac DNA by HU the major histone like protein
of E coli. For an example of the latter mechanism, it has
been shown that the affinity of CAP for its binding site is
increased 200-fold when it is located on an intrinsically


88
that Gcrlp does indeed contort the DNA when bound, or that
bent DNA is a more favorable target for Gcrlp (see
Discussion).


118
Colgan, J. and Manley, J.L. (1992) TFIID can be rate
limiting in vivo for TATA-containing, but not TATA-lacking,
RNA polymerase II promoters. Genes Dev. 6, 304-315.
Comai, L., taese, N. and Tjian, R. (1992). The TATA-binding
protein and associated factors are integral components of the
RNA polymerase I transcription factor, SL1. Cell 68, 965-976.
Conrad, M.N., Wright, J.H., Wolf, A.J., and Zakian, V.A.
(1990). RAP1 protein interacts with yeast telomeres in vivo:
overproduction alters telomere structure and decreases
chromosome stability. Cell 63, 739-750.
Corden, J.L., Caden, D.L., Ahearn Jr, J.M., and Dahmus, M.E.
(1985). A unique structure at the carboxyl terminus of the
largest subunit of eukaryotic RNA polymerase II. Poc. Natl.
Acad. Sci. USA 82, 7934-7938.
Corsetti, M. Briata, P., Sanseverino, L. Daga, A., Airoldi,
I., Simeon, A., Palmisano, G. Angelini, C., Boncinelli, E.,
and Corte, G. (1992). Differential DNA binding protperties of
three human homeodomain proteins. Nucleic Acids Res. 20,
4465-4472.
Cortes, P., Flores, 0., and Reinberg, D. (1992). Factors
involved in specific transcription by mammalian RNA
polymerase II: purification and analysis of transcription
factor IIA and identification of transcription factor IIJ.
Mol. Cell. Biol. 12, 413-421.
Courey, A. and Tjian, R. (1988). Analysis of Spl in vivo
reveals multiple transcriptional domains including a novel
glutamine-rich activation motif. Cell 55, 887-898.
Craig, N. and Nash, H. (1984). E. coli integration host
factor binds to specific sites in DNA. Cell 39, 707-716.
Cress, A, and Triezenberg, S. (1991). Critical structural
elements of the VP16 transriptional activation domain.
Science 251, 87-90.
Crothers, D.M., Gartenberg, M.R., and Shrader, T.E. (1991).
DNA bending in protein-DNA complexes. Meth. Enzymol. 208,
118-146.
Davison, B.L., Egly, J-M., Mulvihill, E.R., and Chambn, P.
(1983). Formation of stable preinitiation complexes between
eukaryotic class B transcription factors and promoter
sequences. Nature 301, 680-686.
Delbrck, M. (1975) Mind from matter? An essay on
evolutionary epistemology (Carlton, Victoria: Blackwell
Scientific Publications).


101
observations found from experiments (Huie and Eisner,
unpublished observation) that Gcrlp has a low specificity.
The low specificity was unanticipated because even though
Gcrlp is expressed in low amounts in the cell, its sites at
UAST?:1 seem to be fully occupied in vivo (Scott and Baker,
1993; Scott and Baker, unpublished data) .
In this respect, the Gcrlp DNA-binding domain can be
added to a growing list of transcriptional factors that
posses a high affinity for DNA, yet a low specificity of
interaction with their specific binding sites. Other
characterized transcription factors with these properties are
found in humans, mice, insects, and bacteria. For example,
the homeodomain of Antennapedia from Drosophila has a high
affinity for DNA, but displays a specificity of less than
100-fold (Affolter et al. 1990). As measured by kinetic
studies, the glucocorticoid receptor complex with its DNA
binding site displays only about a 10-fold difference in
affinity for specific verse nonspecific DNA (Schauer et al.,
1989). The transcriptional activator LEF-1, which binds to
the T-cell receptor enhancer, has a measured dissociation
constant of 10'9 M, yet a specificity of only 20-40 fold
(Giese, 1991) The mammalian sex-determining gene, SRY, also
encodes for a DNA-binding protein with a very low specificity
(Nasrin et al., 1991; Harley et al., 1992). All of these
proteins, despite the low specificity, demonstrate clear
areas of protection in DNase I footprinting studies. In
addition, many of these proteins, like Gcrlp, have been shown


19
1981) This gene was named GCR1 for Glycolysis Regulation.
The gcrl mutant has a severe growth defect when glucose is
present in the medium. This growth defect is presumably due
to the fact that aerobic respiration is repressed in
Saccharomyces cerevisiae when glucose is present, as part of
the global phenomenon known as glucose repression. When
glucose is present a large number of genes involved in the
metabolism of alternate carbon sources are repressed.
Genetic analysis has identified a large number of genes
involved in this regulatory process, involving multiple steps
and branches regulating subsets of glucose-repressible genes
(for a recent review see Trumbly, 1992). Since the gcrl
mutant produces the glycolytic enzymes in reduced amounts it
grows poorly in the presence of glucose. It does, however,
grow adequately on non-carbohydrate carbon sources, and if
glucose is added a noticeable induction of most of the
glycolytic enzymes is observed (Clifton and Fraenkel, 1981;
Baker, 1986). GCR1 has been cloned by complementation
(Kawasaki and Fraenkel, 1982), mapped to chromosome XVI
(referred to as the sit3 mutant in Arndt et al. 1989, and
Devlin et al., 1991), and sequenced (Baker, 1986; Holland et
al., 1987) revealing an open reading frame coding for a
protein of 844 amino acids. The low codon bias of -0.00086
according to the rules of Bennetzen and Hall (1982) suggested
that the gene is expressed in low amounts, and this was
confirmed by Northern analysis (Baker, 1986). A single base
pair insertion at codon 304 causing a frame-shift mutation is
apparently responsible for the phenotype associated with the


99
Table 4. DNA-Binding Affinity of
Select Transcriptional Activators
factor
reference
CAP
3 x 10-9
(Liu-Johnson
et al., 1986)
Antennapedia
1 2 x 10-9
(Affolter et
al., 1990;
Corsetti et al. 1992)
Spl
5.3
x 10--c
(Letovsky
and Dynan, 1989)
Raplp
1.3
x 10 -i -
(Vignais et al., 1990)
NF-1
2.1
x 10 -11
(Eberly et
al., 1985)
ft z
2.5
x 10-ii
(Florence
et al., 1991)
HSTF
4 x
10-12
(de Vries
and Koogh-
Schuuring,
1973)


33
Most DNA fragments used for probes in experiments were
labeled by first digesting the fragment with restriction
endonucleases which produce protruding 5' ends. The overhang
was then filled in and labeled by using the large fragment of
E. coli DNA polymerase I in the presence of a32P dATP (3,000
mCi/mM). The reaction was carried out in the restriction
digest reaction mixture, after digestion, by adding dNTPs
(minus dATP) at 10-3M. One to six units of the large fragment
of E. coli DNA polymerase was then added and the reaction was
allowed to proceed at 37 C for 30 min. Probes were then
purified by 6% PAGE as described below.
In some cases probes were labeled using polynucleotide
kinase. In these cases this was accomplished by first
treating the DNA fragments with 0.1 U of bacterial alkaline
phosphatase for 30 min at 60 C in BAP buffer (50 mM Tris [pH
8.0], 1 mM ZnCl2). The reaction mixture was then treated with
Proteinase K (25 (ig) for 30 min at 37 C followed by two
phenol extractions. The sample was then ethanol precipitated.
The pellet was resuspended in polynucleotide kinase buffer
(50 mM Tris [pH 7.6], 1 mM MgC12, 5 mM DTT, 0.1 mM
spermidine, 0.1 mM EDTA) with 200 |i.Ci of y32P atp and 20 U of
T4 polynucleotide kinase. The reaction was allowed to
proceed for 1 hour at 37 C. Probes were then purified by 6%
PAGE as described above.
Disintegrations/min were determined by suspending 1 |IL
in 5 ml of ddH20 and measuring Cerenkov radiation occurring in
the solution and wall of the scintillation vial (Jelley,
1958) with a scintillation counter.


VO
.C-1110V001V0091011- .9 1V101001109V011110V9VV1- ,9
)
I
)) 1
U. i i
** M
j ni mi j m
0hk n ttt i i m 4
-mmm \\m n mn
t MHBlffiia I in HHli mi<| t
i m>B i
' I
it ti 11
II ft
I) )fc ft
i I I
I I
< i
I I I
i I
II ti |i I
# |i ( #
M (
ll II §1 I I
4
|


49
presumably due to instability of full-length Gcrlp in the
extracts.
The DNA probe used for the band-shift assay was the
upstream activating sequence (UAS) of the gene encoding
triose-phosphate isomerase (TPI1). Plasmid pES119 (Scott,
1992) containing the UASTPJi, was digested with the
restriction endonucleases Sphl and Hindlll liberating a 60
base pair fragment containing UASTPx from positions -377 to -
327 relative to the start of translation. The fragment was
then radiolabeled at the Hindlll site.
As seen in Figure 1, both Gcrlp synthesized in vitro and
the full length MBP-Gcrlp fusion protein were able to form
nucleoprotein complexes with DNA carrying UASTPIi. The
position of the nucleoprotein complexes observed with the
fusion protein migrate more slowly than the complexes
observed with rabbit reticulocyte lysate containing Gcrlp
(Figure 1) This difference is presumably due to the
increase in molecular weight of the nucleoprotein complex due
to the presence of the maltose binding moiety of the fusion
protein. This is consistent with the notion that Gcrlp
interacts directly with UASTPJI. The appearance of two
shifted bands in the band shift assay with Gcrlp and its
derivatives was routinely observed and had been noted
previously (Baker, 1991) It has also recently been shown
that Gcrlp synthesized in yeast also results in two shifted
complexes in the band shift assay (Willett et al., 1993).
The reason for two bands is currently unknown. Figure 1 also
shows that no nucleoprotein complexes were observed with


I
Frag, alone
NO RNA RRL
Gcrlp RRL
£.coli/pMAL-cRl Uninduced
E.coli/pMAL-cRl Induced
E. coli/pMAL-Gcrlp(1-844) Uninduced
E. coli/pMAL-Gcrlp(1-844) Induced


Figure 8. Gcrlp DNA-binding domain protects the CTTCC
sequence motif and a related sequence element, CATCC, in
UAS tpii from DNase I cleavage. Analysis of UASTPI_¡ was carried
out with purified MBP-Gcrlp (690-844) and a radiolabeled 234-
bp fragment carrying the UAS of TPI1. Lanes T, G, C, and A,
are the products of the dideoxy sequencing reactions of
Ml3mpl8 and serve as molecular weight standards; lanes 1 and
4, free fragment treated with DNase I; lane 2, nucleoprotein
complex treated with 0.2 U of DNase I, as described in
Material and Methods; lane 3, nucleoprotein complex treated
with 0.5 U DN ase I. The sequences of protected areas are
denoted on the right. The exact extent of the area protected
over the CTTCC sequence element could not be determined
because of lack of bands in the control lanes (lanes 1 and
4); therefore, two 5' boundaries are indicated on the figure.


36
In some instances oligonucleotides were made double-
stranded by directly annealing equimolar concentrations of
complementary oligonucleotides. Hybridization of the
oligonucleotides was determined spectrophotometrically by
measuring the change in the hypochromatic shift (Bloomfield
et al., 1974; Eisenberg and Crothers, 1979). Fifty
micrograms of each oligonucleotides were mixed, heated to 100
C for 5 min, and then allowed to slow cool to ambient
temperature. This method was used to generate double-
stranded oligonucleotides from HB09/HB10, and from HB39/HB40
(see Baker, 1991).
Finally, some oligonucleotides were made double-stranded
by annealing a smaller primer to a longer template
oligonucleotide and extending with dNTPs (lO-3 M) in the
presence of the large fragment of E. coli DNA polymerase I at
37 C for 30 min using 3x Buffer (described above) This
method allowed incorporation of the polymerase chain reaction
(PCR) for re-amplification of the template oligonucleotide by
using an additional smaller primer. PCR cycle temperatures
and times were as follows: denaturation, 94 C for 50 sec;
annealing, 50 C for 40 sec; and extension, 72 C for 35 sec.
This method was used to generate double-stranded
oligonucleotides from HB57, HB58, and HB59.
DNA Sequencing
DNA sequencing was carried out by the dideoxy chain
termination method of Sanger (1977) as modified by U.S.
Biochemicals (Cleveland, Ohio) utilizing the Sequenase
enzyme, with the following addition: After plasmids were


109
the DNA is such a way to increase Gcrlp-binding at its site.
However, in the Ty2 retrotransposon UAS and enhancer, several
Gcrlp-sites have been mapped which do not have adjacent
Raplp-sites (Turek, 1994). DNA-binding protein sites are
adjacent to the Gcrlp-sites, but the identiy of the proteins
are currently unknown.
A second point to consider is that for the genes TDH3
(Bitter et al., 1991), PGK1 (Chambers et al. 1990), and ADH1
(Tornow et al., 1993) a Gcrlp-binding sites by itself is
unable to convey UAS activity. However, Baker and Scott
(1993) have shown that if a lexA binding domain is tethered
to full-length Gcrlp, activation of a lex operator::GAL1:lacZ
reporter can be observed. This activation occurs in the
absence of a Raplp- binding site (Scott and Baker, 1993).
This demonstrates that Gcrlp can activate transcription in
the absence of Raplp if bound to DNA. This result was
recently confirmed by other investigators (Tornow et al.,
1993) That Gcrlp can activate transcription when bound to
DNA through a lex operator is consistent with the notion that
the role of Raplp is to facilitate binding of Gcrlp and that
Gcrlp contains an activation domain.
A third point: Raplp is an abundant sequence specific
DNA-binding protein in yeast which is known to bind to its
sites with a very high degree of specificity. Vignais et al.
(1990) measured the apparent K of Raplp for its optimal
binding site and for nonspecific DNA. These values were
found to be 1.3 x 10*'-- M and 8.7 x 10~ M respectively. Thus,
the specificity of Raplp binding to its site verse random DNA