Citation
Phylogenetic analysis of baculoviruses using gp41 structural protein gene and five other genes

Material Information

Title:
Phylogenetic analysis of baculoviruses using gp41 structural protein gene and five other genes
Creator:
Liu, Jaw-Ching, 1966-
Publication Date:
Language:
English
Physical Description:
xiii, 144 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Baculoviridae ( jstor )
DNA ( jstor )
Genomics ( jstor )
Nucleopolyhedrovirus ( jstor )
Nucleotide sequences ( jstor )
Nucleotides ( jstor )
Open reading frames ( jstor )
Phylogenetics ( jstor )
Virology ( jstor )
Baculoviruses -- Classification ( lcsh )
Baculoviruses -- Evolution ( lcsh )
Baculoviruses -- Genetics ( lcsh )
Dissertations, Academic -- Entomology and Nematology -- UF ( lcsh )
Entomology and Nematology thesis, Ph. D ( lcsh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1997.
Bibliography:
Includes bibliographical references (leaves 122-143).
Additional Physical Form:
Also available online.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Jaw-Ching Liu.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
027702722 ( ALEPH )
37306519 ( OCLC )

Downloads

This item has the following downloads:


Full Text











PHYLOGENETIC ANALYSIS OF BACULOVIRUSES USING GP41 STRUCTURAL
PROTEIN GENE AND FIVE OTHER GENES









By

JAW-CHING LIU




















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1997


























To my dear parents, family and friends












Love is patient. Love is kind. It does not envy. It does not boast. It is not proud. It is not rude. It is not self-seeking. It is not easily angered. It keeps no record of wrongs.

Love does not delight in evil but rejoices with the truth.

It always protects, always trusts, always hopes, always perseveres.

Love never fails. CORINTHIANS 13:4-8














ACKNOWLEDGMENTS


I would like to thank Dr. James E. Maruniak, my

committee chairman, and Drs., Richard C. Condit, Pauline O. Lawrence, and Susan E. Webb, my committee members. I also would like to thank Dr. Drion G. Boucias who served as a committee member for my dissertation defense and Dr. Simon S. J. Yu who served as a committee member for my qualifying examination. The greatest appreciation and best wishes go to Dr. Alejandra Garcia-Maruniak for her friendship and support during the past four years. I would like to share my happiness with my friend, Rejane Moraes, and I wish she may finish her studies as soon as possible. My sincere appreciation goes to Drs. Dale Habeck, Jackie Pendland, A. Jeyaprakash, Glenn Hall, Roberto Pereira, Mrs. Raquel McTiernan and many more. I apologize for those who have helped me, but who I have not mentioned here, and I would like to thank them also. Lastly, thanks be to God for making me strong and peaceful while I was writing my dissertation.

iv
















TABLE OF CONTENTS





ACKNOWLEDGMENTS . . . . . . . . . . . . . . . . . . . . . iv

LIST OF TABLES .. . . . . . . . . . . .... ... . viii


LIST OF FIGURES . . . . . . . . . . . . . . . . . . . . . ix

ABSTRACT . . . . . . . . . . . . . . . . . . . . . . . . xi

CHAPTERS

1 INTRODUCTION TO BACULOVIRUSES . .... . . . . . 1

Review . . . . .. . . . . . . . . . . . . . . . 1
Fundamental Studies on Baculoviruses .. 2 Baculovirus infection . . . . . . . . 2 Baculovirus structural proteins . 5 Baculovirus DNA genome . . . . . . . 10 Regulation of baculovirus gene expression . . . . . . . . . . . . 11
Application of Baculoviruses in Agriculture
and Biotechnology . .. . . . . . . . . . 13
Use of baculoviruses as biological control agents . . . . . . . . . . . 13
Baculovirus expression system . . . . 16 Future Study and Prospects . . . . . . . . 18 Evolutionary studies of baculoviruses . . . . . . . . . . . 18
Bioinformatic study . . . . . . . . . 22 Present study . . . . . . . . . . . . 23

2 NUCLEOTIDE SEQUENCE AND TRANSCRIPTIONAL ANALYSIS OF
THE GP41 GENE OF Spodoptera frugiperda NUCLEAR
POLYHEDROSIS VIRUS . .. .... . . . . . . . . . 25

v









Introduction . . . . . . . . . . . . . . . . . 25
Methods . . . . . . . . . . . . . . . . . . . . 28
Virus and Cell Culture . . . . . . . . . . 28 DNA Cloning and Sequencing . . . . . . . . 28 Computer Analysis . . . . . . . . . . . . 29
RNA Purification . . . . . . . . . . . . . 30
Northern Blot Hybridization . . . . . . . 30 Primer Extension . . . . . . . . . . . . . 31
Results . . . . . . . . . . . . . . . . . . . . 33
Cloning and Sequencing of the
S. frugiperda EcoRI-S Fragment . . . . . . 33 Transcriptional Analysis of the GP41 Gene 35
Amino Acid and Nucleotide Sequence comparison of SfMNPV-2 with Other
Baculoviruses . . . . . . . . . . . . . . 38
Discussion . . . . . . . . . . . . . . . . . . 42

3 NUCLEOTIDE SEQUENCE, AMINO ACID SEQUENCE AND
GENOMIC STRUCTURE ANALYSIS OF THE GP41 GENE REGION
AMONG FIVE NUCLEAR POLYHEDROSIS VIRUSES . . . . . 50

Introduction . . . . . . . . . . . . . . . . . 50
Methods . . . . . . . . . . . . . . . . . . . 52
Virus and Cell Culture . . . . . . . . . . 52 DNA Cloning and Sequencing . . . . . . . . 53 Computer Analysis . . . . . . . . . . . . 55
Results . . . . . . . . . . . . . . . . . . ... . 56
DNA Sequencing of the GP41 Region . . . . 56 Phylogenetic Analysis . . . . . . . . . . 60 Protein Hydrophobicity Profile Analysis . 62 Protein Secondary Structure Analysis . . 62 Genomic Structure Analysis . . . . . . . . 66
Discussion .. . . . . . . . . . . . . . . . . . 66

4 PHYLOGENETIC ANALYSIS OF BACULOVIRUSES . . . . . . 74

Introduction . . . . . . . . . . . . . . . . . 74
Methods . . . . . . . . . . . . . . . . . . . . 76
DNA Purification of LdMNPV . . . . . . . . 76
PCR Amplification and DNA Sequencing of
LdMNPV gp41 Gene . . . . . . . . . . . . . 76
Search of Baculovirus Genes through
GenBank . . . . . . . . . . . . . . . . . 78

vi









Reconstruction of Phylogenetic Trees of
Baculovirus Genes . . . . . . . . . . . . 83
Relationship of Baculoviruses with
Insect Hosts . . .. .. . ..... .. . 85
Results . . . . . . . . . . . . . . . . . . . . 85
PCR Amplification and DNA Sequencing of
LdMNPV gp41 Gene . ... . . . . . . . . 85
Phylogenetic Trees of Baculovirus polh
Genes . . . . . . . . . . . . . . . . . . 87
Phylogenetic Trees of p10, gp41, and
gp64 Genes . . . . . . . . . . . . . . . . 88
Phylogenetic Trees of dnapol and egt
Genes . . . . . . . . . . . . . . . . . . 93
Relationship of Baculoviruses and Their
Hosts . . . . . . . . . . . . . . . . . . 96
Congruent Analysis of Baculovirus Genes . 96
Discussion . . . . . . . . . . . . . . . . . . 97

5 SUMMARY OF CURRENT RESEARCH ... . . . . .. . 108

APPENDICES

A NUCLEOTIDE SEQUENCE OF Spodoptera frugiperda
MNPV EcoRI-S FRAGMENT AND TRANSLATED AMINO
ACID SEQUENCE OF GP41 GENE .. .... . . . . . . 112

B INTERNET SERVERS USED FOR DATABASE SEARCH AND
PROTEIN SECONDARY STRUCTURE PREDICTION . . . . 114

C NUCLEOTIDE SEQUENCE OF Anticarsia gemmatalis
MNPV PstI-HindIII FRAGMENT AND TRANSLATED
AMINO ACID SEQUENCE OF GP41 GENE . . . . . . . . 115

D PURIFICATION OF POLYHEDRA, ALKALINE-RELEASED
VIRUSES AND DNA FROM Lymantria dispar MNPV
COMMERCIAL FORMULATION ... .... .... . 118

E PARTIAL NUCLEOTIDE AND TRANSLATED AMINO ACID
SEQUENCES OF Lymantria dispar GP41 GENE . . . . 121

LIST OF REFERENCES . . . . . . . . . . . . . . . . . . 122

BIOGRAPHICAL SKETCH . ............ . . . . . 144


vii














LIST OF TABLES


Table pagg

2.1. Amino acid sequence similarities and nucleotide sequence identities(%) of gp41 structural protein . 38

3.1. Percentage of the nucleotide sequence identities and amino acid sequence similarities of the ORFs
within the gp41 gene region . . . . . . . . . . . . 59

4.1. List of GenBank accession numbers, baculovirus
species, and references of DNA sequences that were
used in construction of baculovirus phylogenetic
trees . . . . . . . . . . . . . . . . . . . . . . . 79




























viii















LIST OF FIGURES


Figure


2.1. Position of the gp41 gene on the SfMNPV genomic map and sequencing strategy . . . . . . . . . . . 34

2.2. Northern blot analysis of gp41 gene transcripts . 36

2.3. Primer extension analysis of gp41 gene
transcripts . . . . . . . . . . . . .. . .. . . 37

2.4. Comparison of hydrophilic-hydrophobic profiles
among the homologous gp41 proteins..... . . . . . 40

2.5. Comparison of the amino acid sequence of four
NPV gp41 proteins. ........ . . . ... . . 41

2.6. Computer alignment of the DNA sequence flanking
the gp41 structural protein genes of AcMNPV-E2,
BmMNPV, HzSNPV and SfMNPV-2 .. ... ... . . . . 42

3.1. Position of the gp41 gene on the AgMNPV-2D
genomic map . . . . . . . . . . . . ... . . . . 54

3.2. Phenogram of the divergence among five NPVs . .. 61

3.3. Hydrophobicity profile of the gp41 protein among
five different NPVs .. .. . . . . . . ... . . 63

3.4. Alignment of the amino acid sequence of the gp41
protein among five different NPVs . ... .... . 64

3.5. Genomic structure of gp41 gene flanking regions
of the AcMNPV, BmMNPV, AgMNPV-2D, SfMNPV-2 and
HzSNPV . . . . . . . . . . .................... . 67

ix








4.1. Phylogenetic tree of baculovirus polh gene based
on the translated amino acid sequences . . .. . 86

4.2. Phylogenetic tree of baculovirus polh gene based
on the nucleotide sequence ... . . . . . . . . . 89

4.3. Phylogenetic trees of baculovirus plO (A),
gp41 (B), and gp64 (C) genes based on translated
amino acid sequences . . . . . . . . . . . . . . . 90

4.4. Phylogenetic trees of baculovirus plO (A),
gp41 (B), and gp64 (C) genes based on nucleotide
sequences . . . . . . . . . . . . . . . . . . . . 91

4.5. Phylogenetic trees of baculovirus dnapol (A), and
egt (B) genes based on translated amino acid
sequences . . . . . . . . . . . . . . . . . . . . 94

4.6. Phylogenetic trees of baculovirus dnapol (A), and
egt (B) genes based on nucleotide sequences . . . 95





























x














Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

PHYLOGENETIC ANALYSIS OF BACULOVIRUSES USING GP41 STRUCTURAL
PROTEIN GENE AND FIVE OTHER GENES By

Jaw-Ching Liu

May, 1997

Chairperson: Dr. James E. Maruniak Major Department: Entomology and Nematology

Baculoviruses are pathogenic to insects. Presently, their origin and evolutionary paths are not clearly understood. Using a baculovirus structural protein gene, gp41, that has been shown to be highly conserved among baculoviruses, the gene transcription, protein structure, genomic structure and phylogenetic relationships were studied.

Two complete gp41 nucleotide sequences from Spodoptera frugiperda multiple nucleocapsid nucleopolyhedrovirus (SfMNPV-2) and Anticarsia gemmatalis MNPV (AgMNPV-2D), and a partial gp41 gene from Lymantria dispar MNPV (LdMNPV), were


xi








sequenced.

Northern blot analysis showed that the SfMNPV-2 gp41

was a late gene expressed 12 hours post-infection. The gp41 promoter region contained three transcriptional start sites, two within a consensus transcriptional start site (TAAG) of baculovirus late genes, and the other located in a region where no consensus motif has been determined.

The comparison of nucleotide and amino acid sequences of the AgMNPV-2D with four other NPVs, Autographa californica MNPV (AcMNPV), Bombyx mori MNPV (BmMNPV), SfMNPV and Helicoverpa zea single nucleocapsid nucleopolyhedrovirus (HzSNPV), showed a minimum of 59% nucleotide identity and 70% amino acid similarity. Analysis of the hydrophobicity and protein secondary structure of gp41 revealed several conserved domains including eight a-helix, four loop, one P-sheet and one transmembrane domains.

The analysis of the gp41 upstream and downstream

regions from those five NPVs showed that they contained vlf-1 gene, ORF 330, ORF 300, gp41 and ORF >667 positioned from right to left and with a similar arrangement in their genomic maps. Among these ORFs, the AgMNPV-2D shared 50 to



xii








70% nucleotide identity and 60 to 90% amino acid similarity with the four other NPVs.

Six baculovirus genes including polyhedrin (polh), plO, gp41, gp64, DNA polymerase (dnapol) and ecdysteroid UDPglucosyltransferase (egt), were used to reconstruct phylogenetic trees. The results confirmed that hymenopteran NPVs diverged earlier from lepidopteran granuloviruses (GVs) and lepidopteran NPVs, later lepidopteran GVs diverged from lepidopteran NPVs. The dnapol phylogenetic tree also showed that the baculoviruses had an independent evolutionary path from two other insect DNA viruses, Spodoptera ascovirus (SAV) and Choristoneura fumiferana entomopoxvirus (CbEPV).

























xiii














CHAPTER 1
INTRODUCTION TO BACULOVIRUSES


Review




Scientific literature on the study of baculoviruses goes back to the beginning of the nineteenth century, and now includes thousands of scientific articles that have contributed to the understanding of this class of viruses. Some papers cover fundamental studies such as those involving the baculovirus infection processes (Volkman & Keddie, 1990; Granados & Williams, 1986), the baculovirus structural proteins (Summers & Smith, 1978; Maruniak, 1979, 1986; Rohrmann, 1992), the baculovirus DNA genome (Ayres et al., 1994), and the regulation of gene expression (Friesen & Miller, 1986; Blissard and Rohrmann, 1990). Studies dealing with the application of baculoviruses in agriculture and biotechnology such as the use of baculoviruses as biological control agents (Huber, 1986; Bonning & Hammock, 1992; Moscardi & Sosa-Gomez, 1993) and the baculovirus expression


1








2

system (Summers & Smith, 1987; King & Possee, 1992; O'Reilly et al., 1992; Richardson, 1995; Shuler et al., 1995) have also been reported.




Fundamental Studies on Baculoviruses


The fundamental characteristics of baculoviruses have been described in several review papers and books (Granados & Federici, 1986; Blissard & Rohrmann, 1990; Tanada & Kaya, 1993; Miller, 1996). These reviews include the study of viral particles, nucleocapsids, enveloped virions, infectious elements, the viral infection pathway, cytopathology, viral replication, host specificity, viral gene regulation, and viral DNA replication. In this section, the viral infection process, structural proteins, DNA genome and regulation of gene expression of baculoviruses will be briefly discussed.




Baculovirus infection


Baculoviruses have an enveloped rod-shaped virion

(Federici, 1986). The virions are generally 40-50 nm in diameter and 200-400 nm in length (Bilimoria, 1986). The








3

baculoviruses are divided into two genera based upon the morphology of the inclusion bodies (IBs) (Murphy et al., 1995). Virions of the genus Nucleopolyhedrovirus (NPV) are occluded in a proteinaceous matrix, the polyhedron. The polyhedron ranges from 0.5 to 15 tm, and there are usually several virions embedded in each polyhedron (Federici, 1986). Two subtypes of NPVs have been found: the single nucleocapsid NPV (SNPV) contains only one nucleocapsid per envelope, and the multiple nucleocapsid NPV (MNPV) contains several nucleocapsids (1-17) per envelope (Bilimoria, 1986). The second genus, Granulovirus (GV), contains only one virion occluded in an oval shaped proteinaceous matrix, and ranges in size from 160 to 300 nm in width by 300 to 500 nm in length (Federici, 1986). The virion of GVs usually consists of one nucleocapsid per envelope, but in a few cases has been found to have more than one (Murphy et al., 1995).

Two different types of virions are produced during the replication cycle of baculovirus. One is the occluded virion (OV) that is only found inside the polyhedron (Volkman, 1986), and the other is the budded virion (BV)








4

that functions in cell to cell infection (Granados & Lawler, 1981). The OV is occluded in either a polyhedron (for NPV) or granule (for GV). The polyhedron protects the virion from environmental decay. Upon ingestion by insect larvae, the polyhedra are dissolved in the midgut's alkaline juices (Pritchett et al., 1982). The liberated OVs then penetrate the peritrophic membrane and infect the columnar epithelial cells (Tanada et al., 1975)., This step marks the end of the primary infection. The budded virions that are produced in the infected nucleus of columnar cells then cause a secondary infection (Granados & Williams, 1986). The BVs go through the hemocoel to infect other cells such as those of the tracheal and the connective tissues (Adams et al., 1977; Keddie et al., 1989; Volkman & Keddie, 1990). Late in the infection, occluded virions are formed in the nuclei of infected cells. The progeny virions (BVs) are found as early as sixteen hours after initiation of the infection (Granados & Lawler, 1981). Polyhedra are found starting at 24 hours post-infection (P.I.) (Granados & Lawler, 1981) and are released upon cell death.








5

Baculovirus structural proteins




Although BVs and OVs have identical DNA genomes (Smith & Summers, 1978), the surrounding membrane and proteins are very different (Summers & Volkman, 1976). The OV membrane is formed in the nuclei by de novo synthesis (Stoltz et al., 1973), while the BV membrane is constructed from the cytoplasmic membrane (Tanada & Hess, 1976; Adams et al., 1977). The differences between OV and BV membrane composition in Autographa californica MNPV (AcMNPV) have been studied (Braunagel & Summers, 1994). The protein and the lipid compositions were both compared, and it was observed that the major BV phospholipid is phosphatidylserine, while the major OV lipids are phosphatidylcholine and phosphatidylethanolamine. The results also indicated that the nuclear membrane of infected Spodoptera frugiperda cell line (Sf9) has a different lipid compositions compared to the OVs and BVs.

The protein composition of OVs and BVs were analyzed, and the dominant phosphoproteins differed between the two virions. The OVs have a 36 kDa major phosphoprotein, while the BVs have a 85 kDa major phosphoprotein. Glycoprotein








6

analysis showed that more glycoproteins were present in BV than OV. The BV specific glycoproteins are 136, 128, 89, 45 and 40 kDa, and the OV specific glycoproteins are 70, 53, 49, 42 and 40 kDa. Moreover, several specific OV structural proteins were identified. These proteins include the ODVE18, ODV-E35, ODV-E27, ODV-E56 and ODV-E66 (Maruniak & Summers, 1981; Hong et al., 1994; Braunagel et al., 1996a, 1996b; Theilmann et al., 1996). These OV specific proteins, such as ODV-E56 and ODV-E66, may be involved in the production of intranuclear membrane and protein transport and insertion into the viral envelope membrane (Braunagel et al., 1996a; 1996b).

The gp41 gene also has been shown to code for an OV

specific protein (Whitford & Faulkner, 1992a). Gp41 genes are highly conserved with 60% nucleotide sequence homology among four different baculoviruses (Liu & Maruniak, 1995). The .gp41 protein was identified as an O-linked glycoprotein, and its localization was predicted to be in the tegument (Whitford & Faulkner, 1992a). Although the biological function of gp41 protein has not yet been defined, it may have functions similar to those of other OV specific proteins, such as formation of the envelope membrane and/or








7

protein transport into the membrane. Another OV specific protein, p74, has been proved to be essential for virulence of baculoviruses. Polyhedra produced by the AcMNPV virus with mutations in the p74 gene failed to kill Trichoplusia ni larvae per os (Kuzio et al., 1989). This indicated that p74 is required for viral infectivity. However, details of the mechanism of p74 protein function still need to be elucidated.

In contrast to the OV specific proteins, the gp64

protein is specifically found in BV (Blissard & Rohrmann, 1989; Whitford et al., 1989) and plays an important role in cell to cell infection (Volkman & Goldsmith, 1984). The gp64 protein is concentrated at one end of the virion membrane and may be involved in a pH dependent fusion with the host cell endosomal membrane (Volkman & Goldsmith, 1985). Furthermore, gp64 has been shown to be a type I integral membrane protein with one membrane fusion domain and one oligomerization domain (Monsma & Blissard, 1995; Monsma et al., 1996). Gp64 is highly glycosylated, and glycosylation is required for the incorporation of gp64 into the virion envelope (Rohrmann, 1992). In addition, a signal peptide sequence was found in the N-terminal of gp64 that








8

was missing in the mature form of the protein (Rohrmann, 1992).

Besides the OV and BV structural proteins, there are three other major structural proteins found in baculoviruses: polyhedrin, PE, and p10 proteins. Polyhedrin is the basic subunit of polyhedra and is reported to be a 29 kDa protein with highly conserved amino acid sequences between NPVs and GVs (Akiyoshi et al., 1985; Maruniak, 1986; Blissard & Rohrmann, 1990). It has 80% identity among lepidopteran NPVs, 50% identity between the lepidopteran

-NPVs and GVs, and 40% identity between the lepidopteran and hymenopteran NPVs (Rohrmann, 1992). The carboxyl terminal and central region of polyhedrin genes are highly conserved, but the N-terminal is less conserved (Akiyoshi et al., 1985; Chakerian et al., 1985; Rohrmann, 1986). The cytoplasmic polyhedrosis virus (CPV) also produces polyhedrin protein to form a type of polyhedra. However, the polyhedrin amino acid composition between NPVs and CPVs are different quantitatively and qualitatively (Maruniak, 1986; Rohrmann, 1986).

An electron-dense envelope named polyhedron membrane or polyhedron calyx surrounds the polyhedra (Rohrmann, 1992).








9

PE (polyhedron electron-dense envelope) protein has been suggested to be a major component of the PE, and is phosphorylated and thiolly linked to the carbohydrate component of the polyhedron envelope (Minion et al., 1979; Whitt & Manning, 1988; Rohrmann, 1992). The PE gene is a late gene, expressed at 48 hours post infection (Russell & Rohrmann, 1990). The PE nucleotide homology among AcMNPV, OpMNPV and LdMNPV is 58, 27 and 34%, respectively (Rohrmann, 1992). Thus, the PE protein is not highly conserved among the different baculoviruses.

The p10 protein has been proved to be an essential gene for polyhedra formation. Three functional domains of p10 proteins were identified in AcMNPV using a site directed mutation analysis (van Oers et al., 1993). These functional domains include a fibrillar structure formation domain (15 amino acids from the carboxyl terminus), a nuclear disintegration domain (amino acid residue 52-79), and an intermolecular binding domain (the amino terminal half of the p10 protein). The unsuccessful substitution of the AcMNPV p10 gene with the Spodoptera exigua MNPV (SeMNPV) p10 gene indicated that at least one virus-specific factor was required to interact with the pl0 protein for nuclear








10

disintegration (van Oers et al., 1994). In general, the homology of p10 genes among baculoviruses is very low; there is only 42, 26 and 38% amino acid sequence identity among AcMNPV, SeMNPV and OpMNPV, respectively (Rohrmann, 1992).




Baculovirus DNA genome




Baculoviruses are double stranded DNA viruses with the genome size ranging from 88 to 160 kilobase pairs (kb) (Burgess, 1977; Blissard & Rohrmann, 1990). The genomic structure among baculoviruses has been shown to be similar (Leisy et al., 1984). The alignment of AcMNPV, Orgyia pseudotsugata MNPV (OpMNPV), and SeMNPV genomes showed that these baculoviruses have similar locations for the polyhedrin gene, p10 gene and ecdysteroid UDPglucosyltransferase (egt) gene (.van Strien et al., 1.996). On the other hand, the genomic location of the ubiquitin gene is different among.these baculoviruses, and this difference is probably caused by gene rearrangement. Gene rearrangement is also apparent for the gp41 genes of five different NPVs (Chapter 3).

The genomic DNA sequences of AcMNPV (Ayres et al.,








11

1994) and BmMNPV (Maeda, unpublished data; GenBank accession number, L33180) have been completed and provide valuable information in analyzing the potential open reading frames (ORFs). In AcMNPV, 154 potential ORFs (greater than 150 nucleotides in length) and the potential transcription motifs of these ORFs have also been identified. A complete genomic structural map has located all the identified genes of AcMNPV (Ayres et al., 1994).




Regulation of baculovirus gene expression



The baculovirus genes are transcribed in an ordered

cascade. Four types of genes (immediate early, early, late, and very late genes) have been described according to their dependence on the transcription of previous types cf genes and on their occurrence before or after viral DNA replication (Friesen & Miller, 1986; Guarino & Summers, 1986; Blissard & Rohrmann, 1990).

The immediate early (IE) genes, also called regulatory genes, do not require any viral gene products for their transcription and are involved in the transactivation of the next gene expression phase (early genes) (Guarino & Summers,








12

1986; Chisholm & Henner, 1988). Examples of IE genes include the IE-O, IE-1, IE-N, PE-38 and CG-30 genes (Carson et al., 1988; Chisholm & Henner, 1988; Guarino & Summers, 1988). The second type of genes are called the early genes and are involved in viral DNA replication. RNA polymerase II is believed to be responsible for the transcription of early genes (Grula et al., 1981; Fuchs et al., 1983). The transcriptional motif, CAGT, is conserved in the promoters of both immediate early and early genes (Blissard & Rohrmann, 1989; Theilmann & Stewart, 1991; Ayres et al., 1994).

In contrast to the IE and early genes, the late and

very late genes are transcribed after viral DNA replication, and depend on the expression of the early genes (Miller, 1988; Thiem & Miller, 1989). RNA polymerase III is believed to be responsible for the transcription of late and very late genes (Blissard & Rohrmann, 1990; Zanotto et al., 1992). By using a primer extension assay (Rohrmann, 1986; Thiem & Miller, 1989), a common motif of late and very late genes (TAAG) has been proved to be a transcription start site (the first T or first A). Most of the late and very late genes code for structural proteins needed for the








13

assembly of baculovirus virions and polyhedra (Miller, 1988; Williams et al., 1989).




Application of Baculoviruses in Agriculture and


Biotechnology


The baculoviruses are mainly used as microbial control agents against insect pests (Huber, 1986). They have also been developed as protein expression systems in biotechnology (Summers & Smith, 1987; King & Possee, 1992; O'Reilly et al., 1992; Richardson, 1995; Shuler et al., 1995). Both applications represent the keystone for studying baculoviruses, and contribute to the knowledge of these viruses.




Use of baculoviruses as biological control agents




Baculoviruses can infect a wide range of insects

including 34 families of Lepidoptera, a few families of Hymenoptera, Diptera, Coleoptera, Neuroptera, Trichoptera, Thysanura, and Siphonaptera (Tanada & Kaya, 1993, Murphy, 1995). More than 800 species of baculoviruses have been








14

reported from lepidopteran and dipteran hosts. They have been used as microbial control agents for decades because of their host specificity (Hawtin et al., 1992). At present, several commercial baculovirus pesticides are registered (Huber, 1986). These commercial baculovirus pesticides include SeMNPV, HzSNPV, AcMNPV, Anagrapha falicfera MNPV (AfMNPV), Cydia pomonella (codling moth) GV (Biosys Inc.), LdMNPV, and NsSNPV (U.S. Forest Service, USDA). In Brazil and the southern United States, AgMNPV has been used to control the velvetbean caterpillar, Anticarsia gemmatalis, in soybean crops (Moscardi & Sosa-Gomez, 1993; Funderburk et al., 1992). In the northern regions of America, LdMNPV has been successfully used to control the forest pest, gypsy moth (Huber, 1986). There are, however some limitations to the use of baculoviruses, because the time required to kill the hosts after baculovirus infection is often too long (5 to 10 days) to prevent crop losses. Therefore, baculoviruses are only suitable for those crops presenting certain levels of tolerance to insect damage (Bonning & Hammock, 1992). The development of recombinant baculoviruses with integrated toxin genes has the potential to control pests more efficiently (Carbonell et al., 1988;











Bonning & Hammock, 1992). Some of the genetically improved baculovirus insecticides have already been tested in the field (Wood & Granados, 1991; Cory et al., 1994). The results show that the modified baculoviruses kill insect pests faster than wildtype baculoviruses, and therefore could reduce crop damage (Maeda et al., 1991). Genetically engineered baculoviruses will become useful to control insect pests in forests and.agricultural systems in the future (Bonning & Hammock, 1992). However, the release of recombinant baculoviruses to the natural environment is still controversial (Fuxa, 1989).

Environmental safety is a main issue when baculoviruses are applied as biological pesticides. Several species of birds, aquatic organisms and mammals have been tested for toxicology safety (Betz, 1986), and no deleterious effects have yet been reported. Beneficial insects were also tested, and no direct adverse effects were found (Gr6ner, 1986). However, some parasite and predator species were indirectly affected by baculoviruses due to the decrease in host larvae resources (Betz, 1986).

The persistence of baculoviruses in the environment has also been studied. Several environmental factors affect the








16

distribution and persistence of baculoviruses. These factors include ultraviolet light (UV), rainfall, temperature, pH of soil, and the microenvironment of the plant surface (Bitton et al., 1987). Several techniques have been used for detecting, tracing and identifying baculoviruses in the field. These techniques include microscopic diagnosis (Kaupp & Burke, 1984; Traverner & Connor, 1992), bioassay, serological assays such as Enzyme Linked ImmunoSorbent Assay (ELISA) (Naser & Miltenburger, 1982, 1983; Webb & Shelton, 1990), DNA dot blot hybridization (Ward et al., 1987;.Keating et al., 1989.) and polymerase chain reaction (PCR) (Burand et al., 1992; Moraes & Maruniak, 1997). The latest development of a PCR technique provides a convenient, fast and accurate way to detect and identify baculoviruses in their natural environment (Moraes & Maruniak, 1997).






Baculovirus expression system




The baculovirus expression system was developed based on the understanding of the baculovirus life cycle,








17

baculovirus gene regulation and baculovirus genome structure. The original transfer vector has been created by using the polyhedrin gene region and the polyhedrin gene promoter of AcMNPV to carry and express a foreign gene (Smith et al., 1983). The constructed vector DNA is delivered into insect cells that are infected with the wildtype baculovirus to produce a .recombinant virus. A recombinant virus that carries the foreign gene is produced due to the homologous DNA exchange between the polyhedrin gene regions from the vector and the wildtype virus DNA. This exchange interrupts polyhedrin gene transcription in the recombinant virus, which.then does not express the polyhedrin protein. Therefore, the recombinant virus does not form the polyhedra. The recombinant virus is usually selected by the expression of a marker gene such as that coding for the P-galactosidase that digests the substrate, 5-bromo-4-cholor-3-indolyl--D-galacto-pyranoside (X-gal), to form blue plaques (Summers & Smith, 1987). Currently, several baculovirus vectors as well as laboratory manuals are available (Summers & Smith, 1987; King & Possee, 1992; O'Reilly et al., 1992; Richardson, 1995; Shuler et al.,








18

1995). Sophisticated procedures for the expression of foreign genes and subsequent protein purification have been well established.

The benefit of using the baculovirus expression system includes high yields and protein posttranslational modifications that are similar to eukaryotic systems, such as protein glycosylation, phosphorylation, and amidation (Luckow & Summers, 1988a; Maeda, 1989). This expression system can be used for pharmaceutical purposes, insect physiology studies and pest control (Maeda, 1989).




Future Study and Prospects


Evolutionary studies of baculoviruses


In the 1960s and 1970s, the study of phylogenetic

relationships using a molecular approach showed tremendous progress, mainly through the use of various techniques such as protein electrophoresis, DNA-DNA hybridization, immunological methods and protein sequencing. Statistical measurements of genetic distances and methods for reconstruction of phylogenetic trees have also been developed (Li & Graur, 1991). The accumulation of DNA








19

sequence data has facilitated phylogenetic analysis. Molecular evolutionary data could potentially be used to interpret the relationships among baculoviruses and to other viruses. The evolution of DNA viruses is usually caused by modifications of their genomes due to DNA deletion, DNA recombination (gene rearrangement), and DNA insertion from the host genome. Several baculovirus genes show homology with the host cell genes such as ubiquitin (van Strien et al., 1996), and such data support the evolutionary mechanism of incorporating of host cell DNA into the viral genome.

The baculovirus polyhedrin gene has been used to reconstruct a phylogenetic tree, showing the early divergence of NPVs and GVs (Zanotto et al., 1993). The results showed that the hymenopteran NPV diverged earlier from the lepidopteran NPVs than from the lepidopteran GVs. The data also suggested that the lepidopteran NPVs were divided into two major branches. Until 1996, three baculovirus genes have been used to reconstruct the phylogenetic trees including the polyhedrin gene, DNA polymerase (Ahrens & Rohrmann, 1996; Pellock et al., 1996) and ecdysteroid UDP-glucosyltransferase (Barrett et al., 1995). The results of the last two gene phylogenetic trees








20

supported the hypothesis generated from the phylogenetic tree of polyhedrin genes.

DNA polymerase genes have been classified into four

families including A, B, C, and X (Heringa & Argos, 1994). The baculovirus DNA polymerase belongs to family B, which is also the type of polymerase found in various other species ranging from bacteria, viruses, yeasts and mammals (Heringa & Argos, 1994). By comparing the nucleotide sequence of the AcMNPV DNA polymerase gene with those from two other insect DNA viruses, the ascovirus and entomopoxvirus, it was concluded that they have independent evolutionary paths (Pellock et al., 1996).

Moreover, baculovirus egt genes were used to study

their phylogenetic relationships. The egt proteins range from 55 to 60 kDa (O'Reilly & Miller, 1990; Riegel et al., 1994), and catalyze the transfer of glucose to ecdysteroids (O'Reilly & Miller, 1989). The molting and pupation of infected insect larvae have been shown to be blocked because of an imbalance in this insect hormone (O'Reilly & Miller, 1989). Deletion of the egt gene can speed the killing time of insect larvae by AcMNPV (O'Reilly & Miller, 1991). However, histopathological investigation showed that the








21

degeneration of Malpighian tubules causes the death more rapidly in these insect larvae that were infected by an AcMNPV egt gene deletion mutant (Flipsen et al., 1995). A baculovirus pesticide improvement is suggested by deletion of the egt gene (O'Reilly & Miller, 1991). The egt proteins also share 21 to 22% amino acid sequence identities with several mammalian UDP-glucuronosyl transferases (O'Reilly & Miller, 1989). Overall, the phylogenetic analysis of the egt genes from six different baculoviruses supports the evolutionary scheme of the polyhedrin sequence phylogeny tree (Barrett et al., 1995).

The reconstruction of a baculovirus phylogenetic tree, based on other baculovirus genes such as gp41, gp64 and p10 will provide additional information for examining the evolutionary hypothesis based on the polyhedrin phylogenetic tree. Also, the non-protein coding sequences of baculoviruses could provide useful information for understanding baculovirus phylogeny. For instance, the divergence and evolution of homologous regions (HR) between AcMNPV and BmMNPV have been studied, and results have shown that the HRs of AcMNPV and BmMNPV are highly conserved (Majima et al., 1993). However, the high variability of the








22

HR sequences between genomic variants of the same virus (Garcia-Maruniak et al., 1996), and the facts that there are four to eight HR regions in the genome of different baculoviruses, cause a problem in analyzing the data.




Bioinformatic study


Recently, the rapid development of genomic projects

including the mapping of bacterial (Escherichia coli), yeast (Saccharomyces cerevisiae), nematode (Caenorhabditis elegans), fruit fly (Drosophila melanogaster), and human (Homo sapiens) genomes created a new field called bioinformatics (Schomburg & Lessel, 1995; Schulze-Kremer, 1996). Using computer programs and macromolecular databases, scientists are able to evaluate the potential biological function of a newly detected gene and the phylogenetic relationship to other genes. A complete search of the homologous sequences in the databanks not only provides the data to reconstruct a phylogenetic tree between the unknown protein and the homologous proteins, but also provides the structural backbone to build a possible threedimensional (3D) image of the unknown protein (Benner,








23

1995). Two major databases, the GenBank at the National Center for Biotechnology (NCBI, USA) and the EMBL (European Molecular Biology Laboratory Database) at the European Bioinformatics Institutes (EBI, England) are accessible around the world (Doolittle, 1996), providing information on nucleotide and primary amino acid sequences. In addition, the protein data bank (PDB), a protein structure database, collects protein structure information from crystallographic results, and is therefore an important database for constructing 3D structures of unknown proteins. The development of such databases, computer programs, and computer facilities provides scientists with more efficient ways to search for homologous sequences of an unknown gene, to align multiple sequences, and to reconstruct phylogenetic relationships.




Present study


In this study, the baculovirus gp41 gene was chosen for phylogenetic analysis, because it has been proved to be highly conserved (Brown et al., 1985; Liu & Maruniak, 1995). Two new gp41 gene DNA sequences of AgMNPV and SfMNPV were








24

generated and compared with other known gp41 genes. The secondary structure and possible functional domains of the gp41 genes were predicted using several computer programs. Genomic regions of the gp41 gene from different baculoviruses were compared in order to better understand the evolutionary relationships among these viruses. The phylogenetic tree of baculoviruses was reconstructed based on several phylogenetic trees of baculovirus genes so that the present baculovirus evolutionary hypotheses could be examined. Insect hosts of baculoviruses were also studied in order to reveal the evolutionary relationship between baculoviruses and their hosts.

This study will not only contribute to an understanding of the evolutionary relationships among baculoviruses, but also could be used as a reference to choose baculoviruses for developing recombinant baculoviruses. Since recombinant baculovirus techniques depend on the homology of the baculovirus DNA genome, the phylogenetic tree could be used as a phenetic tree to indicate homologous relationships among the viruses. Eventually, this study will benefit research involving both the basic molecular evolution analysis and the practical application of baculoviruses.














CHAPTER 2
NUCLEOTIDE SEQUENCE AND TRANSCRIPTIONAL ANALYSIS OF THE GP41
GENE OF Spodoptera frugiperda NUCLEAR POLYHEDROSIS VIRUS


Introduction




Spodoptera frugiperda MNPV (SfMNPV-2) is a member of the family Baculoviridae. SfMNPV-2 has a double-stranded DNA genome of approximately 121 kb. The SfMNPV physical map for a number of restriction endonucleases has been described, and the restriction endonuclease profiles also shows differences comparing to other NPVs (Loh et al., 1981; Maruniak et al., 1984). However, two regions of DNA homology on the physical maps of SfMNPV-2 and S. exempta MNPV (SeMNPV-25), an Autographa californica MNPV genomic variant (Brown et al., 1985), have been identified by hybridization under high stringency conditions. One of these two regions contained the polyhedrin gene (Brown et al., 1987); the other region has been identified in the current report to be associated with the gp41 structural protein gene.

25








26

Two types of virions are produced during the nuclear polyhedrosis life cycle. Those virions found within the viral inclusion bodies (IBs) are termed occluded viruses (OVs). They obtain their envelope in the nuclei of infected cells de novo, and the OV envelope is involved in the recognition of host microvilli during infection. The second type of baculovirus virion is the budded virus (BV). The single nucleocapsids bud through the plasma membrane of infected cells and form the ECV (Granados & Williams, 1986; Blissard & Rohrmann, 1990). These virions appear to be specialized for secondary infection of other host cells and contain virus-encoded envelope glycoproteins which are involved in host cell infection, i.e. gp64 (Maruniak, 1979; Keddie & Volkman, 1985).

The gp41 structural protein has been identified as a

major OV glycoprotein by metabolic labeling (Maruniak 1979; Stiles & Wood, 1983). It has also been detected by the binding of horseradish peroxidase-linked concanavalin A, thus indicating it is glycosylated (Braunagel & Summers, 1994). Furthermore, an O-linked single N-acetylglucosamine covalently bonded to the polypeptide was identified (Whitford & Faulkner, 1992a). Experiments with monoclonal








27

antibodies indicated that gp41 is present only in OV; it appears to be associated with OV but not with purified nucleocapsids or the ECV (Whitford & Faulkner, 1992a; Ma et al., 1993). The location of the gp41 protein has been predicted to be between the envelope membrane and the capsid (tegument) of the OV. On the other hand, Braunagel & Summers (1994) indicated that the viral proteins of 40-41 kDa are glycosylated in the OV and ECV. However, the monoclonal antibody data suggest that the gp41 proteins of ECV and OV are different proteins. The gene encoding the gp41 protein has been characterized (Nagamine et al., 1991; Whitford & Faulkner, 1992b; Ma et al., 1993; Ayres et al., 1994; Kool et al., 1994), but the biological function of the gp41 protein is still unknown.

In this chapter, the complete nucleotide and translated amino acid sequence of the SfMNPV-2 gp41 gene is presented. The sequences were compared with other known gp41 gene sequences of different baculoviruses to reveal the possible functional domain of the gp41 protein. A possible transcriptional regulation mechanism and the phylogenetic relationships of the gp41 gene among the different baculoviruses are discussed in this paper.








28


Methods



Virus and Cell Culture


The S. frugiperda MNPV isolate SfMNPV-2 (Maruniak et al., 1984) was propagated in the S. frugiperda Sf-9 cell line (Luckow and Summers, 1988b). Sf-9 cells were maintained at 270C in TC-100 medium supplemented with 10% fetal bovine serum (Life Technology) and 50 Ag/ml gentamicin.




DNA Cloning and Sequencing


The SfMNPV-2 EcoRI-S DNA fragment was cloned into. pGEM3Z and pGEM7Zf(+) vectors (Promega Corp.), and the subfragments EcoRI-HindIII (0.5 kbp), EcoRI-PstI (0.8 kbp), PstI-EcoRI (1.1 kbp) and HhaI-HhaI (0.7 kbp) were cloned into pGEM3Z. Exonuclease digested subclones were generated with the Erase-a-Base system (Promega Corp.). A modification of the experimental protocol was made to precipitate the exo-nuclease-digested DNA before the next step of DNA ligation, because an incomplete inhibition of








29

exo-nuclease was found when the manufacturer's instructions were followed. The extra DNA precipitation step was introduced between the S1 nuclease digestion and Klenow enzyme treatment. Sequencing was performed by the dideoxynucleotide chain terminator sequencing method (Sanger et al., 1977) with Sequenase (United States Biochemical Corp.). The oligonucleotide primers were synthesized by the DNA Synthesis Laboratory of the Interdisciplinary Center for Biotechnology Research at the University of Florida.


Computer Analysis


The Wisconsin Sequence Analysis PackageTM (Version 8.1, VMS; Genetic Computer Group) was used for comparing the nucleotide sequence and amino acid sequence identities (GAP), generating the multiple sequence alignment (Pileup), and plotting the hydrophobicity profile (Pepplot). The Blast program (Altschul et al., 1990) was used to search the GenBank databank for the homologous nucleotide sequences through the e-mail service at the National Center for Biotechnology Information (NCBI, USA). The Fetch program was used to retrieve nucleotide sequences from the local GenBank database.








30

RNA Purification


The total cellular RNA was isolated using the guanidine isothiocyanate method (Ausubel et al., 1989) from 3x106 Sf-9 cells infected with SfMNPV-2 at a multiplicity of infection of 10 plaque forming units (PFU) per cell. At various times postinfection (p.i.), the cells were lysed in 4 M guanidine isothiocyanate pH 5.5, 20 mM sodium acetate, 0.1 mM dithiotheitol (DTT) and 0.5% sarkosyl. Cell lysates were layered over a 5.7 M CsCl solution (0.1 mM EDTA) and centrifuged at 100k X g for 24 hours in a swinging bucket AH650 rotor (DuPont). The RNA was dissolved in sterile water and ethanol precipitated. After washing the RNA pellet in 70% (v/v) ethanol, the pellet was dissolved in sterile water. The RNA concentration was determined by measuring the UV absorbance at 260 nm (OD260 x 40 = pg/ml).




Northern Blot Hybridization


A total of 5 pg RNA was denatured with 7% formaldehyde, 50% formamide and 1X MOPS buffer (0.2 M MOPS pH 7.0, 50 mM sodium acetate and 10 mM EDTA) at 550C for 15 min. Before








31

electrophoresis, 0.1 volume of 10X loading buffer (20% Ficoll 400, 1% SDS, 0.1 mM EDTA, 0.25% Bromophenol Blue and Xylene Cyanol FF) was added. Total RNA was electrophoresed in a 1% agarose gel (1% formaldehyde and 1X MOPS buffer) in 1X MOPS buffer (Maniatis et al., 1989). The separated RNAs were transferred to a Zeta-Probe blotting membrane (Bio-Rad Laboratories, Inc.) with 20X SSC buffer (Maniatis et al., 1989). After transfer, the membrane was air dried and baked at 800C for 1 h. The DNA probe containing 50 ng of the SfMNPV-2 EcoRI-S DNA fragment was prepared by the nick translation method (United States Biochemical Corp.) using 30 [tCi [a-32P]dCTP (3000 mCi/mmole). Hybridization was done overnight at 420C, and the blot was rinsed at 420C with 5% and 1% SDS washing buffer twice each (40 mM NaHPO4 pH 7.2, 1 mM EDTA) as described by the manufacturer (Bio-Rad Laboratories, Inc.). The blot was exposed with Kodak X-OMAT film.




Primer Extension


A total of 10 yg RNA, isolated from the infected Sf-9 cells, was mixed with 0.5 g of 20-mer oligonucleotide








32

primer (5'-GACGTAATCGACACATTTGT-3'). This primer was complementary to the region from 104 to 123 bases downstream of the translation start codon of the SfMNPV-2 gp41 protein gene. The RNA and the primer were incubated at 300C overnight. The extension reaction was done in buffer containing 50 mM Tris-HC1, pH 8.3, 75 mM KC1, 3 mM MgC12, 10 mM DTT, 0.12 mM of each deoxyribonucleotide triphosphate, 25 ACi [a-32P]dCTP (3000 mCi/mmol) and 200 units of Maloney murine leukemia virus reverse transcriptase (Life Technology) for 60 min at 370C (modified from Ausubel et al., 1989). The reaction was stopped by adding EDTA to a final concentration of 20 mM. The extension products were ethanol-precipitated and resolved on a 6% polyacrylamide sequencing gel. A sequence marker was done with dideoxynucleotide chain terminator sequencing reaction by using the same primer with a DNA template containing the SfMNPV-2 EcoRI-S fragment.








33

Results




Cloning and Sequencing of the S. fruciperda EcoRI-S Fragment


The S. frugiperda MNPV-2 EcoRI-S fragment containing

the gp41 structural protein gene was cloned into pGEM3Z and pGEM7Zf(+) (Fig. 2.1 A). The specific restriction endonuclease digested subclones and exonuclease III deleted subclones were constructed. The T7 and SP6 promoter primers present in the pGEM vector and several specific oligonucleotide primers were used for sequencing (Fig. 2.1 B). A major open reading frame (ORF) which contained 999 nucleotides encoded the gp41 gene, and it was oriented from right to left according to the conventional physical maps (Fig. 2.1 B) (Maruniak et al., 1984). The complete sequence of SfMNPV-2 EcoRI-S fragment (Appendix A) was deposited with the GenBank Data Library. One baculovirus late promoter consensus motif TAAG (Blissard & Rohrmann, 1990) was found from 39 to 43 nucleotides upstream from the ATG translation start codon. The translation stop codon TGA was followed by 394 nucleotides downstream to the polyadenylation signal AATAA.








34





(A)


b a

P A RTJOY C NZG ULS D I VQXE WKHM B F

S "111 ' I ' I' I I I I I EcoRI

0 10 20 30 40 50 60 70 80 90 100 mu

(B)





EcoRI Pstl Hindlll Sacil Sail EcoRI 43.5 mu 45mu


gp41 ORF




4-- -4 -- ------*- ---p.*~--- -b.

,*.- -----*



Figure 2.1. Position of the gp41 gene on the SfMNPV genomic map and sequencing strategy. (A) EcoRI restriction map of the SfMNPV-2 genome (Maruniak et al., 1984). (B) Detailed physical map of EcoRI-S fragment. The gp41 999 bp open reading frame is indicated by the bold arrow under the map. The small arrows below the map indicate the extension and direction of the sequence using T7 or SP6 primers or specific primers indicated by an asterisk.








35

Transcriptional Analysis of the GP41 Gene


Northern blot analysis of total RNA from infected cells isolated from 3 to 48 h p.i. is shown (Fig. 2.2). Two mRNAs of approximately 1.6 and 2.8 kbp were detected after 12 h p.i. and remained detectable at 48 h p.i. when the SfMNPV EcoRI-S fragment containing the gp41 coding region was used as a probe.

Primer extension analysis was used to identify the transcription start site. A 20-mer oligonucleotide, corresponding to the complement region of the coding sequence from nucleotides 104 to 123, was used. Three transcription start sites were located (Fig. 2.3). Two of the transcription start sites were located at -42 and -41 nucleotides from the ATG translation start codon within the first T and second A of the TAAG consensus motif (Fig. 2.3). Another transcriptional start site was located at nucleotide

-140 from the ATG start codon for which no consensus motif has been determined (Fig. 2.3).





i_ I I I ::_ :



II
~~~5







I Ii:i~di~.:i:: :3::::
:r::::i::ll~ii::~r~'j :?l~)4~~:;S~i;L~. ~ :~i~~i:~:I
Iii~~ ii ~ e~aii
-i~::iii~iii iiiili~lii 3 6~~:~l j~
i~.ijii iiiii 1 :i ~ilii

. I . Ii O~~: :.::::::~ ~ ; ~ ~iiiidii l~:~iiiiEili~~~~i~~~iji~i~~ja~~~
:::;i: S~iii~i: ~iiiil?21:~::~:'~: ~ iiiilI
:::::;::::i:::::~l::al~:;:r::::a: - i~!~ :::B:::-%
::;.~~~~i(~: :~ ~ ~ iiiiii~ iliiiiiiI.iili

I I b i:~
I I .~i~~::i:::::::i'i:::
I~i~iliii
Ill""":i8r~ ~ llliiiB
. . L~~~F8i8iiiiiiiiiiri~~:: ~iaixais~i ieiiiii~r~:a:a::::::::::I'iisl;:'';liilliii Iss~i~ :iii~lr* ,is _il~.aiiii~i-i if~~i' ii ::::::::::::::::::illiiiiE i~iiiii~i~~ . .::::: i~:: ;i:iiiiii lili
. :r: : : : %i~ ~~~j~~i liill~lI9 ~riiriiiiiiii iiil
:::;::::;:::siiii iiar :: itiiiiiii$% :::::::::::::i --.
i Iii ::liiiiiilI,: . iliii~ i I :.::: ;:::::;: r:::s B:
I .:::r:::::::i;;:::: ri sii x~iLt:i~~~::::::: ~ ~.:i 1~ll r: ::;::;t::~jliii :Jiiijji i :::: :::ii: ::: :::::r eiiiiiii:::: ::i': I ~ lilil~ ..:::::::::::::::::: i :::::::!::'':i I 5iiiiiiliiiii j::::::::::::::::iai ~i li~iii ii~,'- ',,- : - iiiil iiiiiili~~ ..~giiii" ,, k:::~r~: ~~l'iiiiliilijiiiiii ~ ii .. . . ". - iijiiiri 8ii~~i~ ~rsra f:il~r ,". _... i:" " " ' 1 i - ' 'i iii.**."*.-...."iiiiiiiiiiiii."!?, "..*i""*. ".''I "i" il ",,.,"..."' I" . ,,>,.' ' .i ., ".''. . 11i "- .i -''".-*.,.. *"1 .. " " "iil., : .
1 :.111. ' *,., '". ---'" ll .-. , .' ".-. *' ....', "ii -1-,"i 1 ili'l B .'".. l.-'".l 1 "".--,"-.-1,------. "11.,!iiiiii...,"iii."..--,*".l;.-,,"- i""Iiiiiiiiiiiiii 11.".-" II.." .."' - .. .. ..i - -- 1 1 *1 '1 1,... . , ,-L '
i..., '.% .'".' ". "... "...-..--".'..-. .,. "I 11'....i: ..."...-'...,,".-',*' , .i.- "" " , "' , "" "" ..... '
,,'.. "" : ~i ..-_ . ......... . . .......::I"ii'o:':::::::::i::~i:::ii
' - i....' ..... '. .. :. -11 Il. :::::;::: .' :'i ::
. - I ,I
_...' ..', ......,, -1.1. .......... --
. .. i-~tiilllli~ il~.: ;: ::: ::~:I~ ~::
;;;;;;;;;;;;;;." i :: , -__, . .. - 1,1,11 ' 1 I i ",',.' . " . . . l ..
;:j ".. , ....... F ' i ,"', " " - liiiilu'': ~ E~ , ' ... 'W - ,".".:: ., , , ". *'"",--- ' -l.- ', "l - .., , .--'i. ,. "'"..-" .-- ----.,,-,!!.- .' i.-.---.:".i, ..
.. ...... .. ": ; -- -- - --S':
. ... .. .'..'."'.._' -_- ....... .,. ,a~i
:t. .. I~,i~:
....... ' I'll *.' "11,111. . " - ."11 4:10 11 "I ", -1-ii"., .' '
. .. . ' . . . . . . _ 1 . ..
iiii~i. .. I-- _ _ ii:'iiiiiiiijliilj~iiilI
1:1: ... . ... ..irr ii8iiiiii:ii:iiiiii
_- 11 ' iliiiili i "'"', ',__', -.'-- "': "".:iiiii
" - " " ' 1tiii '::'::iil.iii_!'_ .. .......... E ..... ca "" "', , ' .."'I " "'C:::::::::::;:~
' . . .',_,_i: ".- .. ...... _'... ,i:::::-zs~,:
"' ." -111", ."...__ , ,1111,1,- - "". '1 -1 ill i~iilllgii"~~'-''iI 11i'll'.1111jiiii _.
... s "', 111., ,,,T.' "..i ~*F~ li iii ... ?:'
- . I - .... ... *'iIll lliiii~iiiiiiiillllll- :::: ::: :i: - -:: : :-.- 'i:-' .
~ :~~ li~ ii" , - - - - " " ' - - - - - - - *-' ". - - - " i iii'_'.'_11 ., ". ..,. .. ",.-" ,,.,
k4:.'t?: I- 11. - 111,11 , % .- I:::iiI ,~ i~ .. '' '.'---" .. , ,..,i,
-.11,,, .... . ... - 111111' .. .......
;R:: ~~ ~L~iiiiii~ ~__,r
g ~. __ .....il
, ',:..,. - " " "-1 . .. ..........-- , ,-. , .,-,-.-- .- .----., .,
fb:ll$. __'--" "'I ,__.. ,j~ii~ii ii liil~:'~
__ .. ---..
_ _:::p:lr::I::::::::
' ' 'i --"--,--..* .-i.,."--*'iii~ii" - - '-i5N l_ .' - - .
-i ""I. "..---..---".'.'i. 'l.".""""i--'.ii -- -- --,'ll -.-" --e..,-.--,.iilii'
"".ii" '.""i l'. " '"'""-" " 1"* " iiii' , . ii'l-l l..'..- " '-i,"'i -" - -,--'.. .. .
1,111 1;-_"1_.11__1 ii""""" ",11". 11 .1 !ilo l ..' -,ii---""-"" l--..-- " .-.. il""I - 5 ........ - _
..i .I~. ,- ," -.-'- "-e-.-----.,I .
:ilil ,.-.ir l..-"i...,-' -.,"-,',-. '.,"-,"., .."
: ~ il , ...l..""-"i -.--"..". ,.'-. . :1
. . ." "i~."... iii"' .""" ,"" ii!ii,.i..iiiiiiii~iiiI iiiiiii."*...' i.'* ."l-,.,.",'ii.,"i"". -...* ....,,.'.- "".,"!".. , ".,,*.....m ..i ,,''*,"" MI__ii :
'' . I - l""':"L : x ' ' " ""_" -" " II
i 1'...", ' ":::a::~ :: I~ ~j
-,""I ", .: illiiii~ i: X"iiii .11 '1
.' - ... -- - - -I,,-------- _-_____-_ii~ii'!ii ~
: "*":,,","" ,.,, ",f"-.'*--'-- ,. i-.*,, , 111,111,11, 1,11 "..", '
I : . .. .. ..-,- --- .- - - ....'... """", "--!,II
.... I ',111, 111111 i l l;:u::::: Eiiiiiib r t .! ., ....I .-,'.",--"-" , - - , --, "?- , ,,,.. , : iilllllill!
11 _1,1_111'. ...~ .';;' 3~E P:a lj 11 - ---- - ... 2t- - - .. I--------.---.- - - ---- - -- - - - 111----, -1
I ' " """""""' '""
I . I * ' I. -'-----i- .,,.,.,,....... F -1-__ .'. .""
11 . -, " ' ,'-"--,,-- - , ,,---,'..'P .*"* iiii~iS1~F
i~g ifji13~i"' "'' - .... ~~~~i Zi






Sfce""'11 , , !!m24 m.,.ll'.,.~e 3 t
.. ."...., '."--l" - .... - ..,' - - - i .,-'i_ - _ '... ..'.. ....,.....,.. !1. ,.i. .,.,.:Im -. -- 1 11* !*:.
""ii " I""', l l l -- - . I I .. -'---- -"'-- ,...... .. .. ..... -, iii ... . i 'I
.-. '. .. '. .. Ill! I 1 111mi l l - " v __ -i'll ijjjhj !
I - iiI 1 111,1111 11 1 -111 '. .".'.,,. i t .-.,., , i,, ,, " ---.- .,-.,"--.,...."













D pu Jp
'V p'o tGzu Mnfbos, GDT4q sp GpTS IJGT GI4q uo uMOL[s ST ,9ppP[ GouonbGs A;uouGWTdo;D Gqtj "jTv4O uMouN Aue t{;TM po;9TOOsSP
40U s'eM O.TS 4qs UoTdTTDSUPeq J, aoddn qT, "W~Ou DVVL GTjq UT17qqTM GaGM SG;Ts ,q;qs UoT4dT-xDsu-ecq; VL OT" (qonpoxd UOTSUGDqXG 'd !S oust) pGTJTqupT GJGM S~qTS

qaqs UOTqdT.Dsu..q . GILU "TGB GouGnbos %9 P uo pGqWLdGs GJoM pup GspqdTiosuaq GSJIGAG2 snatTA PTG)nG GUtTn AGOuOrW BUTsn pZTSGtf4UAs GaGIA SVNGO oTL " -lDELLLVDVDVDLVVIODVD q-S GU d PGXT spm T'd aLq 8: qp STTGD 6-JS PGq4DGUT AdNNJS wo2E poqoJ qxG VNNd lqO "sqdT-I3SU~Eq GuGB. TIdB o STSA{euP uOTsuGqxG . 2GTd -E GJanLT








. . . . . . . . . . . . . . . . . . . . . ....... ~
]~


.... ......


:P P


i 01



mgNi


. . . ....... .. ....





-, Ii-M I II IN Milk ll

.. i ............

... . ... .......
. . ..........
. . . . . . . . . . . 4 ...... .. ...,........ . ..44444....44:.

... .44.... 4~ ~ % s ~ . . ......, : i i
i ..
.............. 44.4 " 444i4,4&.444:


.... 444i444 44.







4 : . .. ..... .' $ } 4 4 . .44. .. .. .. . ......'. . . ... s.








38

Amino Acid and Nucleotide Sequence Comparison of SfMNPV-2


with Other Baculoviruses


The amino acid and nucleotide sequences of the S.

frugiperda gp41 gene were compared with three other NPV gp41 genes including A. californica MNPV (AcMNPV-E2), Bombyx mori MNPV (BmMNPV) and Helicoverpa zea SNPV (HzSNPV) (Table 2.1).




Table 2.1. Amino acid sequence similarities and nucleotide sequence identities (%) of gp41 structural protein*.


BmMNPV HzSNPV SfMNPV-2 AcMNPV-E2 96 75 72
(96) (60) (59) BmMNPV 75 74
(59) (59)
HzSNPV 76
(62)

Bold and normal lettering in parentheses denote amino acid sequence similarities and nucleotide sequence identities, respectively.


At the nucleotide level, the sequences of the NPVs had an average of 60% identity among them except for AcMNPV-E2 and BmMNPV which shared a much higher identity (97%). However, at the amino acid level, the predicted polypeptide sequences








39

were more conserved (70% similarity). Kyte-Doolittle (1982) and Goldman (reviewed by Engelman et al., 1986) analyses were performed to compare the distributions of hydrophilic and hydrophobic domains among the four NPV proteins. AcMNPV-E2 and BmMNPV had almost identical hydrophobicity patterns, while SfMNPV-2 and HzSNPV showed a similar hydrophobicity pattern overall (Fig. 2.4). In general, the hydrophobic profiles of all four NPVs were similar within amino acids 100 to 340 of AcMNPV-E2 and BmMNPV and amino acids 40 to 280 of SfMNPV-2 and HzSNPV (Fig. 2.4). The predicted amino acid sequences of all four NPVs were compared to show the conserved regions (Fig. 2.5). Sixteen conserved regions (defined as more than three contiguous amino acids being the same) were found within the whole sequence alignment. Within the 50 to 350 amino acid comparison region, 9 of 14 prolines were conserved among the NPVs.

In addition to the comparison of amino acid sequences, the nucleotide sequences of the upstream region from the ATG translation codon of the four NPVs were compared. The sequence alignment around the late gene transcriptional consensus motif from -52 to -46 nucleotides of all four NPVs








40




AcMNPV








BmMNPV

I A i k P i






HzSNPV







SfMNPV













Figure 2.4. Comparison of hydrophilic-hydrophobic profiles among the homologous gp41 proteins. The solid line is done by Kyte-Doolittle (1982) analysis and the dash line is done by Goldman et al. (review by Engelman et al., 1986) analysis.











41



1 60 AcMNPV-E2 MTDERGNFYY NT-PPPLRYP SNPATAIFTS AQTY-NAPGY VPPATVPTTV ATRDNRMDYT AcMNPV-HR3 .......... .. .......... ..... ..... .......... ..........
BmMNPV .......... ..P....... ..........N .... N ..... ...-- ..--- .....K..-.
HzSNPV ---------- ---------- -------- ---------- ---------- --------MS
SfMNPV-2 ---------- ---------- ---------- ---------- ---------- -----MAN..

61 120 AcMNPV-E2 SRSNSTNSVA IAPYNKS-KE PTLDAGESIW YNKCVDFVQK IIRYYRCNDM SELSPLMILF AcMNPV-HR3 ................. .......... .......... ........ ..........
BmMNPV .......... .......-.. ...... .... ..... ...... ......... ........H.
HzSNPV LPHAV.TALQ HQQHQ.QLQ. SSS..----. T.....Y.ER ...F..T... .H.T.Q..ML
SfMNPV-2 RPNSI.K.-- STMSSS.LSS SSSA.ITEP. MD.... Y.N. .V....T... .Q.T.Q.LNL

121 180 AcMNPV-E2 INTIRDMCID TNPISVNVVK RFESEETMIR HLIRLQKELG QSNAAESLSS DSNIFQPSFV AcMNPV-HR3 .......... .......... .......... .......... ........ ..........
BmMNPV .......... .... N ..... .......... .......... .G ......P. ...... A ...
HzSNPV ......L.VE SH........ ..D.D.NL.K HYS..R.... G.EV.----- -E........
SfMNPV-2 .....NV..E .Y.VD..AT. ..D.DVNLMN NYK ....... NKPIT----- -.D..KA...

181 240
AcMNPV-E2 LNSLPAYAQK FYNGGADMLG KDALAEAAKQ LSLAVQYMVA EAVTCNIPIP LPFNQQLANN AcMNPV-HR3 .......... .......... .......... .......... ........ ..........
BmMNPV .......... ......... ...... ... .......... .S........
HzSNPV Y.V..S .... ...K..ENVS G.SVS...HE .GE.L..QI. ...AS.T... ..VRH..V.T
SfMNPV-2 YSV..S .... ...K.G.H.A SGSVE...RH .GY.L..QI. Q...T.T ... ...D...... D

241 300 AcMNPV-E2 YMTLLLKHAT LPPNIQSAVE S----RRFPH INMINDLINA VIDDLFAGG- GDYYHYVLNE AcMNPV-HR3 .......... .. ........ . ..................... . ....... ..........
BmMNPV .......... ....... ..........
HzSNPV .I....QR.N I...V.D..S .---- .KY.T L.I......N ....V.T.VY .N..Y.....
SfMNPV-2 .L.... QR.N I.T...EIIN .GNRTHGNSR VH...A...N .........- S...L .....

301 360 AcMNPV-E2 KNRARVMSLK ENVAFLAPLS ASANIFNYMA ELATRAGKQP SMFQNATFLT SAANAVNSPA AcMNPV-HR3 .......... .. ...... .......... .......... .. .................
BmMNPV . ..... I .......... ......... .......... .......... ..p------HzSNPV .....IVT.. ..IG...... ..TD..Q.I. N .......R. .L..G....N APSS--.GSN
SfMNPV-2 T.KS.IL... ..ISYM.... .TT....FI. T...NS..K. .V..S.SM.. MPLT--KPV361 418 AcMNPV-E2 AHLTKSACQE SLTELAFQNE TLRRFIFQQI NYNKDANAII AAAAPNATRP NTKGRTA* AcMNPV-HR3 ---.R.IRRP LI*------BmMNPV ---.R.IRLP LI*------HzSNPV VEQNRTS..Q .......... A...Y...KL S.KQNY*--SfMNPV-2 VSES.NV..Q Q......E.. A........ L S.KN.ISQL*



Figure 2.5. Comparison of the amino acid sequence of four NPV gp41 proteins. The one-letter code designation is used. The hyphens denote the gap filled by the computer program. The dots denote identical amino acids. The abbreviation for the viruses are described in the text.








42

was identical (Fig. 2.6). Another late gene transcriptional motif from -20 to -17 was identified in AcMNPV-E2 and BmMNPV; however, this consensus region of SfMNPV and HzSNPV was changed by one or two nucleotides.



-99 -40 AcMNPV-E2 TAATTTTGTT AATTTTATTA TCGCTTTTTT GTCACAACAA CTATATTATA AGTAATCCGT BmMNPV .......... ... ... ......... ..... .. ....... .. ..
HzMNPV .C...A.A.. C..... GA.. .TAT.G.A.G TGA....... T.....G... .... G ....A
SfMNPV .T.....CG. ...GA ....C .T...A.A.C TAA.... T.. T . .. .... . ......AA

-39 1
AcMNPV-E2 ATATTGAGTT TTGTAATCAT AAGAGTACAA ATAAAAAGTA TG BmMNPV G......... .......... .......... ......... A TG
HzMNPV CG..AA.T.A C...CCA..C ..ATTG.T.. ..T.T.---A TG
SfMNPV .A....TT.A C..CCC .... ..A.AACAC. ---------A TG


Figure 2.6. Computer alignment of the DNA sequence flanking the gp41 structural protein genes of AcMNPV-E2, BmMNPV, HzSNPV and SfMNPV-2. The TAAG consensus sequences are underlined or double underlined. The translation start codon ATG sites are denoted in bold and italic letters.





Discussion




A unique feature of the NPV life cycle is the

production of two virion phenotypes: the occluded virion

(OV) and extracellular virus (ECV). The biophysical, biochemical and morphological characteristics between the OV and ECV are quite different. These structural differences








43

may play a functional role in their biological properties. During the viral infection, one of the virus-encoded envelope glycoproteins, gp64, is expressed and involved in the host cell infection. The gp64 protein is a component of the virion peplomers which are only detected in the ECV and are essential for entry of ECV into the cells by adsorptive endocytosis (Keddie & Volkman, 1985). In contrast to gp64, gp41 is only associated with OV. The gp41 structural protein was found exclusively in enveloped OV but not in either ECV or enveloped stripped OVs (Whitofrd & Falunker, 1992a). Currently, the biological function of gp41 is not known, but gp41 may be involved in facilitating the occlusion of virions in the polyhedra or the infection of host midgut cells according to their biochemical characteristics.

In this study, we presented the nucleotide sequence and transcriptional analysis of the SfMNPV-2 gp41 gene. The nucleotide sequence of the SfMNPV-2 gp41 gene shows a different degree of homology with the three other NPVs including AcMNPV-E2, BmMNPV and HzSNPV (Table 1). The nucleotide sequence identities of SfMNPV-2 and the other NPVs were low (60%). Similar results have been reported








44

when the DNA homology was compared among four different Spodoptera sp. including S. exempta, S. exigua, S. frugiperda and S. littoralis. SfMNPV is considered distantly related (20-30%, reassociation kinetics) among those NPVs (Kelly, 1977). The molecular biology approach based on the polyhedrin gene phylogenetic tree also suggested that the SfMNPV is distantly grouped from the AcMNPV and BmMNPV (Zanotto et al., 1993). The results showed that the SfMNPV diverged earlier from these other NPVs, whereas the DNA homology of the gp41 gene of AcMNPV and BmMNPV is almost identical (97%). Comparing these results to those found in the polyhedrin gene analysis suggests that AcMNPV and BmMNPV are very closely related species (Rohrmann, 1986; van Strien et al., 1992).

When the hydrophilic and hydrophobic profiles of the

gp41 polypeptide of SfMNPV-2 were compared with other NPVs, the SfMNPV-2 showed an overall pattern similar to that of HzSNPV. The amino acids 40-to 280 of AcMNPV-E2 and BmMNPV showed an identical hydrophobic pattern with amino acids 100 to 340 of HzSNPV and SfMNPV-2. The high hydrophilicity of the carboxyl terminal of the pl0 gene has been reported and shows that it displays a functional domain which is exposed








45

at the surface of the protein. The hydrophobic region in the middle of the pl0 protein may play a bundling or crosslinking function (van Oers et al., 1993). The amino acid sequences of the gp41 polypeptide of these NPVs were compared to reveal the conserved sequence regions (Fig.

2.5). These conserved amino sequences may play an important role to be a functional domain since no amino acid change was found in those regions. Specifically, these regions containing the proline and cysteine may be involved in maintaining the gp41 polypeptide conformation. In addition to these conserved regions, the alignment of the first 50 amino acids between AcMNPV and BmMNPV were identical. Also, the last 368 to 393 amino acid sequences between SfMNPV-2 and HzSNPV were almost identical (Fig. 2.5). These data suggest that the SfMNPV-2 and HzSNPV may have evolved from a common ancestor, and that the AcMNPV and BmMNPV diverged from.another distantly related ancestor.

By northern blot analysis, two gp41 gene transcripts were found after 12 h p.i. These data confirm the data previously shown, that the gp41 gene is a late gene product (Whitford & Faulkner, 1992b; Ma et al., 1993). One of the transcripts was 1.6 kb and another was 2.8 kb long.








46

According to the DNA sequence, the distance between the gp41 gene transcriptional start site to poly(A) signal is 1,433 nucleotides. By adding the poly(A) tail (a poly(A) tail usually contains 200 bases), the estimated size of the gp41 gene transcript was about 1.6 kb. On the other hand, the

2.8 kb transcript did not fit the transcription termination stop signal principle. One explanation for the 2.8 kb transcript is the poly(A) signal which was located 394 nucleotides downstream from the translation stop codon was bypassed. This phenomena of ignoring the major transcriptional stop signal has been reported both in the gp41 gene (Whitford & Faulkner, 1992b) and in the p39 capsid gene of AcMNPV (Thiem & Miller, 1989). Another explanation for the two different size transcripts is that the 1.6 kb transcript was a spliced product from the 2.8 kb RNA. However, this explanation is not favored because the gp41 gene coding sequence does not seem to be separated into two regions. The gene splicing is not a common phenomena in baculoviruses except for the IE1 or IEO (Kovacs et al., 1991). The 2.8 kb transcript was also acknowledged that could be a transcription product of the gene other than gp41 since the SfMNPV EcoRI-S fragment was used as a probe.








47

Totally four potential open reading frame were identified within the SfMNPV EcoRI-S fragment.

By primer extension analysis, the transcription start site for the gp41 gene mRNA of SfMNPV-2 was mapped in the promoter region within the TAAG.motif at approximately nucleotide -42 or -41 (T or A). This motif is conserved in all baculovirus late genes, especially the baculovirus structural proteins (Rohrmann, 1986; 1992; Rankin et al., 1988). However, another transcriptional start site was located at the -140 nucleotide for which no consensus motif has been determined. The phenomenon in which the transcription start site is dissimilar to a late gene consensus motif is also found in the AcMNPV p74 gene (Kuzio et al., 1989). Another explanation for the difference could be a non-specific primer hybridization, since the baculoviruses contain a large DNA genome.

An unexpected small ORF was located downstream of the

-140 nucleotide transcriptional start site, and the -140 nucleotide transcriptional start site may be used for a bicistronic transcription. Similar bicistronic transcripts have been reported by Kovacs et al. (1991). A translational regulation mechanism is proposed in that paper since the








48

translation of the downstream ORF is more efficient compared to the upstream ORF. The upstream ORF may be used for increasing the translation initiation activity. At the same time, Ooi and Miller (1991) suggest an antisense RNA mechanism for transcriptional regulation, which may be used to turn off a 3.2 kb RNA initiation. In the transcription of the gp41 gene, the upstream ORF may be used as a competition inhibitor to control the gp41 gene transcription. However, a bicistron model could not be excluded even though the upstream transcriptional start site is not a common transcriptional start site for baculovirus late genes. A site specific mutation at the upstream transcription start site can help elucidate if this transcription start site is involved in the gene regulation of gp41.

Kool et al. (1994) sequenced the AcMNPV-E2 EcoRI-C

fragment and found an extra G residue which is close to the end of the gp41 gene coding region when comparing it with the data published by Whitford & Faulkner (1992b). These results were confirmed by the recent data of Ayres et al. (1994). The differences in the gp41 gene sequences of AcMNPV may be caused by using a different strain. The








49

results from Kool et al. (1994) and Ayres et al. (1994) not only enlarge the gp41 protein by 65 amino acid sequences but also increase the homology with HzSNPV and SfMNPV at the Cterminal regions (Fig. 2.5). These data provide new information showing the possible evolutionary path of the gp41 gene and by comparing these data, the evolutionary relationship of baculoviruses may be inferred.














CHAPTER 3
NUCLEOTIDE SEQUENCE, AMINO ACID SEQUENCE AND GENOMIC STRUCTURE ANALYSIS OF THE GP41 GENE REGION AMONG FIVE
NUCLEAR POLYHEDROSIS VIRUSES




Introduction

Anticarsia gemmatalis MNPV (AgMNPV) belongs to the

genus Nucleopolyhedrovirus (family: Baculoviridae) with a 133-kbp, closed-circle double-stranded DNA genome (Murphy et al., 1995). The virus has been applied as a commercial insecticide on a large scale to control the soybean pest, A. gemmatalis (velvetbean caterpillar), in Brazil (Moscardi 1989). In addition to the successful field application, the AgMNPV has undergone a series of comprehensive laboratory studies including the construction of the genomic map (Johnson and Maruniak, 1989), the nucleotide sequence of the polyhedrin gene (Zanotto et al., 1992), and the identification and sequence of a variable region, homologous region 4 (hr-4) (Garcia-Maruniak et al., 1996).

The gp41 structural protein is a major occluded virion

(OV) glycoprotein of baculoviruses (Maruniak, 1979). The 50








51

monoclonal data indicate the gp41 is associated with OV, but not with the purified nucleocapsid nor with the budded virion (BV) (Whitford & Faulkner, 1992a; Ma et al., 1993). The location of the gp41 protein is predicted to be the tegument between the envelope and the capsid (Whitford & Faulkner, 1992a). However, the biological function of the gp41 protein is still unknown because of the unsuccessful selection of the recombinant mutants, which suggested the gp41 may be an essential gene.

Recently, the developments of bioinformatic analysis bring a new aspect for studying gene function in terms of using the primary nucleotide and/or amino acid sequence to predict the biological function of a protein. Several computer programs are available through public access including a protein secondary structure analysis program that shows more than 70% accuracy (Rost and Sander, 1993), a transmembrane domain prediction program (Jones et al., 1994), an O-glycosylation sites prediction program (Hansen et al., 1995), and a three dimensional structure protein comparison program (Madej et al., 1995). These computer programs provide theoretical data before the laboratory data is obtained, and are also useful for designing laboratory








52

experiments.

In this study, the gp41 nucleotide sequence of AgMNPV2D was compared with the nucleotide sequences of Autographa californica MNPV (AcMNPV) (Kool et al., 1994), Bombyx mori MNPV (BmMNPV) (Nagamine et al., 1991), Helicoverpa zea SNPV (HzSNPV) (Ma et al., 1993) and Spodoptera frugiperda MNPV-2 (SfMNPV-2) (Liu & Maruniak, 1995) gp41 regions to understand the relationship of AgMNPV-2D with other NPVs. A protein secondary structure analysis was done based on different computer programs to predict the potential motifs responsible for the biological function of the gp41 protein. Lastly, the genomic structure of gp41 gene regions among five different NPVs was compared to provide some indications of the phylogenetic relationships.





Methods


Virus and Cell Culture


The AgMNPV-2D isolate (Maruniak, 1989) was used as the virus source and propagated in the Sf-9 (S. frugiperda, fall armyworm) cell line (Luckow & Summers, 1988). The Sf-9 cell








53

line was maintained at 270C in TC-100 medium with 10% fetal bovine serum (Life Technologies).




DNA Cloning and Sequencing


Southern blot hybridization was employed to locate the gp41 gene of AgMNPV-2D. A DNA fragment of SfMNPV-2 within the gp41 gene (described in Liu & Maruniak, 1995) was labeled with 32p-[dCTPI using a nick translation kit (United States Biochemical Corp.), and used as a probe. The AgMNPV2D gp41 gene was first mapped to the 9 kbp HindIII-C fragment (Fig. 3.1). Subsequently, the gp41 gene was localized within a 3.5 kb PstI-HindIII fragment (at 49.8 52.4 map unit, m.u.) which was cloned into the pGEM7Zf(+) plasmid (Promega Corp.). A series of exo-nuclease deletion subclones was constructed for sequencing purposes using the Erase-a-Base system (Promega Corp.). A modification of experimental protocol was made to precipitate the exonuclease-digested DNA before the next step of DNA ligation, because an incomplete inhibition of exo-nuclease was found when the manufacturer's instructions were followed. The extra DNA precipitation step was introduced between the S1







54









AgMNPV
polh
XP Q,RS,UV
G JTUV B K D RS C E OHW A I F N LM
I , i l I I I i i , i I 44.95 mu i52.42 mu

9 kb

Hindlll Smal BgIllPstI Bglll EcoRI Hindll 49.77 mu 52.42 mu
3.5 kb

Pstl Sacll Hincll Sacll Hincll Hindill

1.005 kb
gp41 ORF





Figure 3.1. Position of the gp41 gene on the AgMNPV-2D genomic map. The gp41 1,-005 kb open reading frame is indicated by the arrow under the map. Notice the gp41 gene and polyhedrin gene have the same transcription direction that is from right to left in the conventional map.








55

nuclease digestion and Klenow enzyme treatment. The dideoxy nucleotide chain-terminator method was performed for DNA sequencing, and the DNA sequence gap between different deletion subclones was completed using synthesized oligonucleotide primers. Two different sequencing kits were used: the SequenaseTM Version 2.0 DNA Sequence Kit with Sequenase polymerase (United States Biochemical Corp.) and fmolTM DNA Sequencing System with Taq DNA polymerase (Promega Corp.).


Computer Analysis


The Wisconsin Sequence Analysis PackageTM (Version 8.1, VMS; Genetic Computer Group) was used for comparing the nucleotide sequence and amino acids sequence identities (GAP), generating the multiple sequence alignment (Pileup), and plotting the hydrophobicity profile (Pepplot). The Blast program (Altschul et al., 1990) was used to search the GenBank and SwissProt data banks for the homologous nucleotide sequences and amino acid sequences through the e-mail service (Appendix B) at the National Center for Biotechnology Information (NCBI, USA). The protein secondary structure prediction program (Rost and Sander,








56

1993) was available through the Internet server (Appendix B) at the European Molecular Biology Laboratory (EMBL: Heidelberg, Germany). The transmembrane domain analysis program (MEMSAT) is a freeware (Jones et al., 1994), and the 0-glycosylation site prediction program (Appendix B) was accessed through the Internet server (Hansen et al., 1995).

For phylogenetic analysis, the MEGA program was used to construct the phylogenetic tree of the gp41 gene (Kumar et al., 1993). Both the nucleotide sequences and amino sequences were used. The p-distance and neighbor-joining methods were chosen to generate the phylogenetic tree based on amino acid sequences. For the phylogenetic tree based on nucleotide sequences, the p-distance and maximum parsimony method were used.




Results


DNA Sequencing of the GP41 Region


The complete nucleotide sequence of the PstI-HindIII

fragment resulted in 3,517 nucleotides (Appendix C) and has been deposited in GenBank under the accession number U37728. An interesting phenomenon was observed during the DNA








57

sequencing. When the fmolTM DNA sequencing system was used for DNA sequencing, one inconsistent nucleotide pair was always found (three repetitions) at nucleotide 1,116, C versus T, from the gp41 coding strand and non-coding strand. The data were confirmed by the Sequenase sequencing system which showed this specific nucleotide pair should be C/G. No specific secondary structure of DNA was found around the nucleotide at 1,116.

An open reading frame (ORF) of 1,005 nucleotides was identified containing the gp41 gene from nucleotide 669 to 1,673. The transcriptional direction of this gene was oriented from right hand to left hand (relative to the AcMNPV polyhedrin gene) in the conventional genome map (Fig. 3.1). Two NPV late gene motifs (TAAG) were found at -17 to

-20 and -48 to -51 nucleotides from the protein translation initiation site (ATG) respectively. A transcriptional stop signal AATAAA was found downstream at nucleotide 745 from the translation stop site (TGA). In additional to the transcriptional motifs, the translation start site fits the Kozak principle of AXXATG(A/G) (Kozak, 1986). When the nucleotide sequence and translated amino acid sequence were compared with four other published NPVs gp41 gene sequences








58

using the GAP program obtained from the GCG package, more than 59% nucleotide sequence identities and more than 69% amino acid sequence similarities were found (Table 3.1).

In addition to the gp41 ORF, several ORFs of AgMNPV-2D were found inside the 3.5 kbp sequence region. The AgMNPV2D ORF 1062 was identified to have a high homology with the AcMNPV vlf-1 gene. The AgMNPV-2D vlf-1 gene was then compared with the vlf-1 of AcMNPV, BmMNPV, the ORF >300 of SfMNPV-2 and the ORF >195 of HzSNPV. The results presented a nucleotide homology of 76, 77, 63, and 65% respectively and amino acid similarity of 91, 90, 78 and 66% respectively (Table 3.1).

Other than the vlf-1 gene, two potential ORFs (ORF 330 and ORF 300) were found at nucleotides, 1,804 - 2,103 and 2,100 - 2,429 respectively. The ORF 330 of the AgMNPV-2D was compared with the ORF 330 of AcMNPV, ORF 330 of BmMNPV, ORF 348 of SfMNPV-2, and ORF 330 of HzSNPV and showed high nucleotide homologies of 68, 65, 58, and 57% respectively (similarity of amino acid sequences of 78, 80, 60, and 64% respectively; Table 3.1). The data suggested there were minimal (50-60%) homologies and similarities among these analyzed NPVs. Meanwhile, the AgMNPV-2D ORF 300 showed










59

Table 3.1. Precentage of the nucleotide sequence identities and amino acid
sequence similarities of the ORFs within the gp41 gene region'.


BmMNPV SfMNPV HzSNPV AgMNPV

vlf-1 AcMNPV 97 65 65 76 X71415' (99) (80)2 (71) (91)

BmMNPV -- 67 61 77 L33180' (80)2 (71) (90) SfMNPV -- -- 63 63
U14725' (73)2 (78)2
HzSNPV -- -- -- 65 L04747' (66)

ORF 327 AcMNPV 95 51 55 68
(96) (56) (64) (78) BmMNPV -- 53 54 65
(59) (64) (80) SfMNPV -- -- 54 58
(61) (60)
HzSNPV -- -- -- 57
(64)
ORF 312 AcMNPV 99 -- -- 70 (100) (75) BmMNPV -- -- -- 70
(75)
gp41 AcMNPV 98 59 60 70
(96) (70) (75) (82) BmSNPV -- 59 60 74
(72) (74) (80) SfMNPV -- -- 75 58
(62) (69)
HzMNPV -- -- -- 59
(71)
ORF 699 AcMNPV 94 58 54 69
(97) (70)2 (70)2 (80)2 BmMNPV -- 59 55 68
(70)2 (70)2 (81)2 SfMNPV -- -- 58 58
(72)2 (68)2
HzSNPV -- -- -- 53
(71)2

"Bold and normal lettering in parentheses denote nucleotide sequence identities and amino acid similarities, respectively. 'GenBank accession number. The sequence of AgMNPV gp41 gene region has been deposited under U37728.
2Incomplete ORFs were used for amino acid sequence comparison.








60

homologies with ORF 312 of AcMNPV and BmMNPV (70% homology and 75% similarity; Table 3.1). However, there were no homologous sequences found between the AgMNPV-2D ORF 300 with the SfMNPV-2 and HzSNPV gp41 regions.

In addition .to the intact ORFS, one partial ORF > 667

was found at nucleotides 1-667 which had moderate nucleotide sequence homology (69%) but high amino acid similarity (80%) with AcMNPV ORF 699. When the partial ORF >667 of the AgMNPV-2D was compared with the ORF 699 of AcMNPV, ORF 702 of BmMNPV, ORF >258 of SfMNPV-2 and ORF >299 of HzSNPV, the results indicated a nucleotide homology of 69, 68, 58, and 53% respectively and an amino acid similarity of 80, 81, 68, 71% respectively (Table 3.1).


Phylogenetic Analysis


Based on the nucleotide sequences and translated amino acid sequences, a phylogenetic tree of the gp41 gene (Fig. 3.2) was generated by the Pileup program (GCG package) and MEGA package (Kumar et al., 1993). The results showed that AcMNPV and BmMNPV were closely related. Subsequently, HzSNPV and SfMNPV-2 were grouped into a branch and AcMNPV, BmMNPV and AgMNPV-2D were grouped into another branch.






61





(A)

,103 ,018 AcMNPV .076 .018 BmMNPV ,132 AgMNPV AgMNPV
.176 HzSNPV
.011 .197 SfMNPV




(B)
015
113 - AcMNPV ' BmMNPV
.117
164 AgMNPV S222 HzSNPV
,DOS SfMNPV







Figure 3.2. Phenogram of the divergence among five NPVs based on the (A) nucleotide sequences and (B) the amino acid sequences of the gp41 genes. The number on the top of lines represents the distance between each NPV or to the branch point.








62

Protein Hydrophobicity Profile Analysis


Figure 3.3 shows the hydrophobicity profile and the

conserved hydrophobic domain of gp41 protein among five NPVs (Kyte & Doolittle, 1982). Five conserved hydrophobic domains were assigned arbitrarily based on the similarity of hydrophobic pattern among five NPVs.




Protein Secondary Structure Analysis


The amino acid sequence alignment showed (Fig. 3.4) two cysteines and nine prolines were found conserved among five different NPVs. The secondary structure analysis showed eight potential a-helixes, four loops and one 1-sheet. Several conserved domains were found inside these specific secondary structures. Most of the conserved domains were found in the middle of the gp41 amino acid sequences. The amino and carboxyl terminals were highly variable. No N-glycosylation sites, Rx(S/T), were presented in Fig. 3.4, because the gp41 protein has been reported as an 0linked glycoprotein. However, no consensus 0-glycosylation sites were predicted by the aligned








63



I III IV V AcNPV


) V, ,i N : I IV


BmNPV


IhoIl




AgNPV









n N s C s hii Ihobic Silte ' I *


HzNPV

. APhobic SIlhile






Figure 3.3. Hydrophobicity profile of the gp41 protein among five different NPVs. Conserved hydrophobic domains I-V were arbitrarily assigned (see text for details).










64



1 50 AcMNPV MTDERGNFYY NT-PPPLRYP SNPATAIFTS AQTY-NAPGY VPPATVPTTV BmMNPV .......... ..P....... ..........N ....N...............
AgMNPV -MN..DG..L .VSQA.A.H. FA.TS.TV.. S.-------- --SGNY...M
HzSNPV ---------- ---------- ---------- ---------- ---MSL.HA.
SfMNPV--------------------------------------------------CONS

51 100 a-helix
AcMNPV ATRDNRMDYT SRSNSTNSVA IAPYNKSKEP TLDAGESIWY NE^'VDFVQKI BmMNPV .....K ..- . ..... .... ......... ...... .... ..........
AgMNPV S.MVQ.T.-- --RG.A..LV -----.T..D A--S .........T.Y.H..
HzSNPV T.ALQHQQHQ KQLQESS.-- ---------- --..-----.T .....Y.ER.
SfMNPV -------MSS .SLS.SS.-- ---------- --A.ITEP.M D. ...Y.N..
CONS ---------- -------S-- ---------- --------W- -C -D-V--I



101 150
a-helix
AcMNPV ERYY CNDMS ELSPLMILFI NTIRDMCIDT NPISVNVVKR FESETMIRH BmMNPV ......... ............ ..........N
AgMNPV ...... .. T....H.. ..........S ..V...II.. VQTr.EIV..
HzSNPV .F.T .... H.T.Q..ML. .....L.VES H......... . D..NL.K.
SfMNPV I....T.... Q.T.Q.LNL. ....NV..ET Y.VD..AT.. .D.EVNLMNN
CONS -R-Y_-NDMS -L-P-M---I NTIR--C--- -P--VN--KR ---------* *


151 200
loop a-helix
AcMNPV LIRLQKE GQ SNAAESLSSD SN FQPSFVL NSIPAYAQKF Y.GGVDMLGK BmMNPV ......... G......P. ......A............... ....A ...
AgMNPV ..G .... R. NSV...ID.. .. ........ ......... ....A.T...
HzSNPV YS..R. .G .EV.------ EN ......Y .V..S..... ..K.AENVSG
SfMNPV YK...... .N KPIT------ . .KA...Y SV..S..... .K.G.HLAS
CONS ---L-KE -- --------- - F--SFV- --IP-YAQKF YI-G-----Figure 3.4. Alignment of the amino acid sequences of the gp41 protein among five different NPVs. CONS represents the consensus sequence. The dots indicate the gap and the dashes indicate the gaps or non-conserved sequences (for CONS sequence). The conserved proline sites are denoted by the * symbol and the conserved cysteine sites are denoted by the @ symbol. Specific secondary structure domains were labeled inside the boxes, and the transmembrane domain is highlighted by double underlines.











65



201 250
a-helix loop a-helix
AcMNPV DALAEAAKQL SLAVQYMVAE AVCCNPIPL PFN)QLANNY MTLLLKBfTL BmMNPV .......... .......... S..... . . ..... ... ....... ...
AgMNPV ...N...... ........S. .. .. ......... V..... ..
HzSNPV .SVS...HE. GE.L..QI.. ..S. r.... .IRH..V.T. I.... QR.NI
SfMNPV GSVE...RH. GY.L..QI.Q ..T..... D.....D. L....QR.NI
CONS ----EAA--L --A-QY---- -V-- PIPL P---QL-N-Y -TLLL--4-251 300
a-helix loop a-helix P-sheet
AcMNPV PENIQSAVES ----RRF HI NMENDLINAV IDDLF GG-G DY EK BmMNPV .......... - .. .. .. .......... ..... .... ... . .
AgMNPV . .V.E..K. ----S. ... ......S. ........-. N. ...
HzSNPV ...V.D..S. ----.KY.TL .I.....N. ...V..VY. N. ...
SfMNPV .' ...EI . RTHGNRV H..A...N ........-S ..I .
CONS P-N-Q--- -S --N-LIN-V IDD-FG--- -Y 4EK



301 350
a-helix transmembrane domain
AcMNPV NPJRVMSIKE NVAFLAPLSA SANIFNYM4E LATRAGKQPS MFQNATFLTS BmMNPV ... I....... ......... .......... .......... ..........
AgMNPV .....VG... ..G....... ..D..... SQ .... H..R.D ..E..A....
HzSNPV ....IVT.... .IG...... . .TD.. .I.N .......R.. L..G .... NA
SfMNPV .K.IL... ISYM ..... TT....FI.T ...NS..K.. V..S.SM..M
CONS N--R---IKE N----APLSA ---IF----- LAT--GK-P- -F--A--L-* *


351 400
loop
AcMNPV AAN>VNSPAA HTKSACQES LTELAFQNET LRRFIFQQIN YNKDANAIIA BmMNPV .P-------- - .R.IRLPL *-------- ---------- ----------....................
AgMNPV ......... I-------- -----------------------------HzSNPV PSS-I-NGSNV E)NRTS..Q. .........A ...Y...KLS .KQNY* ---SfMNPV PLT-B-KPV-V SES.NV..QQ ......E..A .....L..LS .KN.ISQL*CONS ----I------ ---------- ---------- ---------- ---------CONS


401 417
AcMNPV AAAPNATRPN TKGRTA*
BmMNPV ----------------AgMNPV ----------------HzSNPV ----------------SfMNPV ----------------CONS





Figure 3.4. Continued.








66

sequences. One potential transmembrane segment was found close to the carboxyl end with a consensus sequence of ENX4APLSAX3IFX using the transmembrane domain prediction program.




Genomic Structure Analysis


The genomic structures of the gp41 gene flanking

regions of the AgMNPV-2D were analyzed (Fig. 3.5). When the whole gp41 gene regions of five NPVs were aligned, they showed similar genomic structures and transcriptional orientations (relative to the transcription direction of the AcMNPV polyhedrin gene) with the exception of HzSNPV. In general, the gp41 gene regions were located at m.u. 45 to 52, but the gp41 gene region of HzSNPV was located at m.u. 96.5 to 97.6. Also, the transcriptional direction of all the ORFs of HzSNPV is opposite to other NPVs.





Discussion




In summary, the nucleotide sequence of the gp41 gene region of the AgMNPV-2D was sequenced. Several ORFs were








67







AcMNPV
47.6 mu 50.4 mu

4 +-- +- 4 - -vlf- ORF 327 *ORF 312 gp4 ORF 699
BmMNPV
45.3 mu 48.2 mu


vlf- ORF 330 *ORF 312 gp41 ORF 702
AgMNPV
49.8 mu 52,4 mu


ORF 330 'ORF 300 gp4l ORF>667

SfMNPV
45.3 mu 45.0 mu

4- 4---- 4ORF>300 ORF348 gp4l ORF>258 (vf- 1)
HzSNPV
96.5 mu 97.6 mu

--+~- ---ORF >299 gp4 ORF 330 ORF 195 (vlf- 1)




Figure 3.5. Genomic structure of gp41 gene flanking regions of AcMNPV, BmMNPV, AgMNPV-2D, SfMNPV-2, and HzSNPV. * refers to the ORF which was not found in either SfMNPV or HzSNPV. Note the data of HzSNPV is modified from isolate HzS-15 which is considered as a genomic rearrangement isolate (see text for details).








68

identified including the vlf-1 gene, ORF 330, ORF 300, gp41 gene, and ORF >667. Among these ORFs, the AgMNPV-2D shared 50 to 70% of the nucleotide sequence identities and 60 to 80% of the amino acid sequence similarities with four other NPVs. However, the AgMNPV-2D ORF 300 did not show homologies with the gp41 regions of all five NPVs. The gp41 gene region of SfMNPV-2 and HzSNPV did not contain the ORF 300 homologous sequences. This result may be caused by a genomic deletion. However, it was not shown whether a homologous sequence of the AgMNPV ORF 300 was present in a different genomic region of SfMNPV-2 or HzSNPV. Furthermore, the homologous sequences of the AgMNPV-2D ORF 300 were searched using the BLAST program and no significant homologous sequence was found other than the AcMNPV and BmMNPV ORF 312.

The gp41 gene is a unique gene which is only found in the OV. However, no biological function has been proved yet. An attempt to select a recombinant virus with a deletion in the gp41 gene was not successful. The results suggested the gp41 gene could be an essential gene and have influences on both BV and OV even though the gp41 protein is only found in the OV. If the gp41 gene is an essential








69

gene, a transformed cell line that constantly expresses the gp41 protein will be needed to complement the gp41 gene when the gp41 gene deletion mutant is selected. Nevertheless, several computer programs were used to predict the potential biological function based on the biochemical characterization of the gp41 protein.

Four a-helices at consensus sites of 93 to 104, 204 to 222, 244 to 257, and 273 to 284 (CvDyxkIiRyY, EaakqLslAvQYmvaeaV, qQLaNnYxTLLLkr, and IndLINxVIDDl), one loop domain at 237 to 241, (PIPLP), and one P-sheet domain at 292 to 295 (YYxYV) were found to be conserved (Fig. 3.4). The results were confirmed using both the PHD (EMBL) and Darwin programs (Benner, 1995). One transmembrane domain was predicted at amino acid sequences of 309 to 328. The transmembrane domain (Fig. 3.4), was also found to be a conserved hydrophobic domain (Fig. 3.5). The results strongly suggested that the gp41 protein is a membrane protein. The hydrophobic profile revealed five conserved hydrophobic domains, and region III was also found to be a conserved a-helix domain. The correlation of the conserved hydrophobic domains and a-helix may suggest that region III








70

has a specific biological function. An attempt to generate a three-dimensional (3D) graph using the threading method (Madej et al. 1995) was not successful because no homologous sequence against the gp41 protein was found in the PDB (protein data bank). The crystallographic data of gp41 or a closely related transmembrane protein will be needed to generate the 3D graph of the gp41 protein.

In contrast with the gp41 protein, the gp64 protein is only found in the BV. The gp64 is a glycosylated membrane protein and is involved in cell to cell infection. It has been proved to be an essential gene for baculovirus infectivity. Two conserved hydrophobic domains at amino acid sequences of 220 to 230 and 327 to 338 (TELVACLLIKD and LNNMMHDLIYSV) were associated with biological function. Region I is involved in the fusion activity of the gp64 protein, and region II is involved in the oligomerization and transport of gp64 protein (Monsa & Blissard, 1995). Also, one transmembrane domain was identified at the carboxyl terminal. No similarity of amino acid sequence was found between the gp64 and gp41 transmembrane domain. The study of the similarities of the secondary structure of the gp41 and gp64 proteins will provide information for








71

understanding the baculovirus structural proteins.

The AcMNPV vlf-1 gene is a very late expression factor to regulate the polyhedrin gene transcripts (McLachlin & Miller, 1994), and is required for strong expression of the polyhedrin gene in a characterized temperature sensitive mutant. The translated amino acid sequence showed homology with a family of integrases, resolvases and RNA helicases (McLachlin & Miller, 1994) which may be involved in the interaction with DNA and/or RNA during the transcription. Unfortunately, the partial amino acid sequence of SfMNPV and HzSNPV did not overlap with these specific motifs, and no further analysis was done because of Insufficient information.

The phylogenetic analysis of the gp41 gene showed the AgMNPV-2D had a closer relationship to the AcMNPV and the BmMNPV than to SfMNPV-2 and HzSNPV. This result is consistent with the DNA hybridization data (Smith & Summers, 1982), in which AcMNPV was found to have low homology with HzSNPV and SfMNPV (1% relative homology) but moderate homology with AgMNPV-2D (8% relative homology). Not only the DNA hybridization data, but also the phylogenetic tree of baculovirus polyhedrin genes agrees with the phylogenetic








72

tree of the gp41 gene (Cowan et al., 1994; Zanotto et al., 1993). The results of the phylogenetic tree of the polyhedrin gene also divided the AcMNPV, AgMNPV-2D, and BmMNPV into one group and HzSNPV and SfMNPV-2 into another group.

Overall, the genomic structure of the gp41 gene region showed that all of the NPVs have similar local ORF arrangements except HzSNPV. The HzS-15 isolate analyzed in the present study was described as a rearranged genomic isolate based on the overall genomic structural comparison with another HzSNPV isolate, ELCAR (Cowan et al., 1994). The gp41 gene of the HzS-15 isolate terminates upstream of the polyhedrin gene, near m.u. 97. But the gp41 gene of HzSNPV ELCAR isolate is placed downstream of the DNA polymerase-related ORF, near m.u. 50, which is far away from the polyhedrin gene. This explains why the HzS-15 has a different genomic and transcriptional orientation. The reason we did not use the-isolate ELCAR instead of HzS-15 is because of the incomplete sequence in the gp41 gene region (specific for the gp41 gene). When the HzSNPV isolate ELCAR instead of HzS-15 was compared with four other NPVs, we found the gp41 gene regions are always located around m.u.








73

45 to m.u. 52. These data indicate that most NPVs still maintain similar.genomic structures even though there is a mechanism for genomic DNA rearrangement.














CHAPTER 4
PHYLOGENETIC ANALYSIS OF BACULOVIRUSES


Introduction




The evolutionary relationships among baculoviruses have been predicted using molecular approaches. Until 1996, three baculovirus genes including the polyhedrin (polh) gene (Rohrmann, 1986; Zanotto et al., 1993; Cowan et al., 1994), the DNA polymerase (dnapol) gene (Pellock et al., 1996) and the ecdysteroid UDP-glucosyltransferase (egt) gene (Barrett et al., 1995) have been used to reconstruct the phylogenetic trees. The results based on the polh gene of baculoviruses (Rohrmann, 1986; Zanotto et al., 1993; Cowan et al.., 1994) suggest that dipteran NPVs and hymenopteran NPVs diverge from the lepidopteran NPVs and GVs before they split. The phylogenetic tree of the baculovirus dnapol genes is reconstructed using six baculoviruses including Autographa californica MNPV (AcMNPV), Bombyx mori MNPV (BmMNPV), Orgyia pseudotsugata MNPV (OpMNPV), Choristoneura fumiferana MNPV


74








75

(CfMNPV), Helicoverpa zea SNPV (HzSNPV) and Lymantria dispar MNPV (LdMNPV) (Ahrens & Rohrmann, 1996), and is generally comparable to the phylogenetic tree scheme based on the polh gene. Furthermore, the dnapol genes of two baculoviruses, AcMNPV and HzSNPV, are compared with two other insect DNA viruses (Spodoptera ascovirus, SAV, and Choristoneura biennis entomopoxvirus, CbEPV) (Pellock et al., 1996), and with human viruses to reveal their evolutionary relationships. The results suggest that the baculoviruses have an independent evolutionary pathway from other insect and human viruses. -Phylogenetic analysis of the third baculovirus gene-(egt) among six different baculoviruses shows similar topology to the phylogenetic trees of polh and dnapol genes (Barrett et al., 1995).

Although the molecular approach can be used to elucidate the evolutionary relationships among baculoviruses, critics agree that the phylogenetic tree of a particular gene does not represent the evolutionary pathway of the whole organism (Li & Graur, 1991). So far, all baculovirus phylogenetic trees are based on a single gene, and therefore may not properly represent the evolutionary pathway of baculoviruses. In the present study, this








76

problem is approached using a congruent .analysis (Miyamoto, 1985; Wheeler, 1991). The evolutionary relationship of baculoviruses is revealed based on multiple phylogenetic trees of baculovirus genes.instead of a single gene. The congruent results are concluded from six different phylogenetic trees of baculovirus genes including either structural proteins (polh, plO, gp64, and gp41) or enzymatic proteins (dnapol and egt). The results will provide more solid support for a current hypothesis of baculovirus evolutionary pathway.


Methods



DNA Purification of LdMNPV


Lymantria dispar MNPV (LdMNPV) DNA (GYPCHEK, U.S.

Forest Service) was purified (Appendix D) from a commercial preparation of polyhedra and used as a DNA template for PCR amplification.



PCR Amplification and DNA Sequencing of LdMNPV gp41 Gene


A set of polymerase chain reaction (PCR) primers was








77

constructed to amplify the gp41 gene of LdMNPV. The oligonucleotide primers were designed based upon the conserved sequences of gp41 genes from five baculoviruses including AcMNPV (Kool et al., 1994), Anticarsia gemmatalis MNPV (AgMNPV) (Liu & Maruniak, unpublished data), BmMNPV (Nagamine et al., 1991), HzSNPV (Ma et al., 1992), and SfMNPV (Liu & Maruniak, 1995).

The JM37 upstream primer of the gp41 gene was a 25 nucleotide oligomer with the following sequence: ACAA(C/T)AA(C/T)TATATTATAAGTA(A/G)TCC. This primer was located within the transcriptional initiation site region of the gp41 gene. The JM40 downstream primer was a 21 nucleotide oligomer with the following sequence: GTTGTAAAA(C/T)TTTTGNGC(G/A)TA. Based on DNA sequence alignment, the expected size of the PCR product using this primer set was around 500 base pairs (bp).

The PCR reaction was done in a final volume of 25 il containing 200 PM of each dNTP, 4 pmoles of each primer,

2 mM MgC12, 0.5 units of Primezyme (Biometra), and reaction buffer (10 mM Tris-HC1, pH 8.8, 50 mM KC1, 0.1% Triton X-100). A concentration of 100 ng of DNA template (LdMNPV








78

genomic DNA) was used per PCR reaction. Thirty il of autoclaved mineral oil was applied to the top of the reaction mixture to prevent evaporation. The PCR reaction was performed in a PTC-100 programmable Thermal Cycler (MJ Research, Inc). The PCR cycle consisted of an initial denaturation step at 950C for 1 min, followed by 35 cycles at 940C for 1 min (denaturation), 450C for 1.5 min (annealing), and 720C for 2 min (extension). The final extension step had a 15 min duration. The PCR product was purified through a DNA purification column (QIAquickTM Qiagen Inc.) to remove salts and enzyme.

The purified PCR product was then cloned into a pGEM-T vector (Promega Corp.), and sequenced using an automatic sequencer (ABI 373a) from the DNA Sequencing Core Laboratory (DSEQ) of the Interdisciplinary Center for Biotechnology Research (ICBR) at the University of Florida.




Search of Baculovirus Genes through GenBank


The BLAST (Madden et al., 1996) and ENTREZ (Schuler et al., 1996) programs (Appendix B) available from the National Center for Biotechnology Information (NCBI, USA) were used








79

to search the homologous sequences of six baculovirus genes. A list containing the GenBank accession numbers, baculovirus species names and related references used in the present work is presented in Table 4.1.

Twenty-three nucleotide sequences of baculovirus polh genes were found in the GenBank. Three undeposited polh gene sequences, Anagrapha falcifera MNPV (Dr. Federici, personal communication), A. gemmatalis MNPV and Neodiprion .sertifer SNPV (Zanotto et al., 1993), were entered manually into a Micro VAX.computer at the Biological Computing Facility (BCF) of the ICBR at the University of Florida.




Table 4.1. List of GenBank accession numbers, baculovirus species and references for DNA sequences used in the construction of baculovirus phylogenetic trees. Accession Baculovirus Reference number species

Polyhedrin
gene

D00437 Panolis flammea MNPV Oakey et al., 1989.
(PfMNPV) J.Gen.Virol. 70:769 D01017 Spodoptera littoralis MNPV Croizer & Croizer,
(SpliMNPV) 1994. unpublished
D14573 Hyphantria cunea MNPV Isayama et al., 1993.
(HcMNPV) unpublished
J04333 Spodoptera frugiperda MNPV Gonzalez et al., 1989.
(SfMNPV) Virology 170:160










80
Table 4.1. Continued


K01149 Autographa californica MNPV Hooft van Iddekinge et
(AcMNPV) al., 1983. Virology 131:561

M14885 Orgyia pseudotsugata MNPV Leisy et al., 1986b.
(OpMNPV) Virology 153:280

M20927 Mamestra brassicae MNPV Cameron & Possee,
(MbMNPV) 1989. Virus Res.
125:183

M23176 Lymantria dispar MNPV Smith et al., 1988.
(LdMNPV) Gene 71:97

M30925 Bombyx mori MNPV (BmMNPV) Maeda et al., 1985.
Nature 315:529

M32433 Orgyia pseudotsugata SNPV Leisy et al., 1986a.
(OpSNPV) J.Gen.Virol. 67:1073

S48199 Spodoptera exigua MNPV van Strien et al.,
(SeMNPV) 1992. J.Gen.Virol.
73:2813

S68462 Attacus ricini NPV (ArMNPV) Hu et al., 1993.
I Chuan Hsueh Pao
20:300

U22824 Perina nuda MNPV (PnMNPV) Chou et al., 1993.
unpublished

U30302 Leucania separata MNPV Wang et al., 1996.
(LsMNPV) unpublished

U40833 Choristoneura fumiferana Rieth et al., 1996.
MNPV (CfMNPV) unpublished

U40834 Archips cerasivoranus MNPV Rieth et al., 1996.
(ArcMNPV) unpublished

X55658 Malacosoma neustria MNPV Vladimir & Kavasan,
(MnMNPV) 1990. unpublished

X70844 Buzura suppressaria MNPV Hu et al., 1993.
(BsMNPV) J.Gen.Virol. 74:1617

X94437 Spodoptera litura MNPV Bansal et al., 1996.
(SlMNPV) unpublished

Z12117 Helicoverpa zea SNPV Cowan et al., 1994.
(HzSNPV) J.Gen.Virol. 75:3211 K02910 Trichoplusia ni GV (TnGV) Akiyoshi et al., 1985.
Virology 141:328









81
Table 4.1. Continued


X02498 Pieris brassicae GV (PbGV) Chakerian et al., 1985. J.Gen.Virol. 66:1263

X79569 Cryptophlebia leucotreta GV Jehle & Backhaus,
(ClGV) 1994. J.Gen.Virol.
75:3667

p10 gene

M10023 Autographa californica MNPV Kuzio et al., 1984.
Virology 139:414 M14883 Orgyia pseudotsugata MNPV Leisy et al., 1986c; Virology 153:157 M98513 Choristoneura fumiferana Wilson et al., 1995.
MNPV J.Gen.Virol. 76:2923 U46757 Bombyx mori MNPV Palhan & Gopinathan, 1995. thesis, Indian Inst.Sci., India U50411 Perina nuda MNPV Chou et al., 1996.
unpublished

X69615 Spodoptera exigua NPV Zuidema et al., 1993.
J.Gen.Virol. 74:1017 X92713 Spodoptera litura NPV Behera et al., 1996..
unpublished

gp41 gene

D14468 Bombyx mori MNPV Nagamine et al., 1991.
J.Invertebr.Pathol. 58:290

L04748 Helicoverpa zea SNPV Ma et al., 1992.
Virology 192:224 U14725 Spodoptera frugiperda MNPV Liu & Maruniak, 1995.
J.Gen.Virol. 76:1443 U37728 Anticarsia gemmatalis MNPV Liu & Maruniak, 1996.
(AgMNPV) unpublished

X71415 Autographa californica MNPV Kool et al., 1994.
J.Gen.Virol. 75:487 gp64 gene

L12412 Choristoneura fumiferana Hill & Faulkner, 1994.
MNPV J.Gen.Virol. 75:1811









82
Table. 4.1. Continued


L33180 Bombyx.mori MNPV Maeda, 1994.
unpublished

M22446 Orgyia pseudotsugata MNPV Blissard & Rohrmann, 1989. Virology 170:537 M25420 Autographa californica MNPV Whitford et al., 1989.
J. Virol. 63:1393 X00410 Galleria mellonella MNPV Blinov et al., 1984.
(GmMNPV) FEBS Lett. 167:254 DNA
polymerase
gene

D11476 Lymantria dispar MNPV Bjornson et al., 1992.
J.Gen.Virol. 73:3177 D16231 Bombyx mori MNPV Chaeychomsri et al., 1995. Virology, 206:436

M20744 Autographa californica MNPV Tomalski et al., 1988.
Virology 167:591 U11242 Helicoverpa zea SNPV Cowan et al., 1994.
J.Gen.Virol. 75:3211 U18677 Choristoneura fumiferana Liu & Carstens, 1995.
MNPV Virology 209:538

U39145 Orgyia pseudotsugata MNPV Gross et al., 1993.
J. Virol. 67:469 U35732 Spodoptera Ascovirus Pellock et al., 1996.
Virology 216:146 X57314 Choristoneura biennis Mustafa & Yuen, 1991.
entomopoxvirus DNA Sequence 2:39 egt gene

D17353 Orgyia pseudotsugata MNPV Rohrmann, 1994.
unpublished

L33180 Bombyx mori MNPV Maeda, 1994.
unpublished

M22619 Autographa californica MNPV Miller, 1989.
unpublished

U04321 Lymantria dispar MNPV Riegel et al., 1994.
J.Gen.Virol. 75:829








83

U10441 Choristoneura fumiferana Barrett et al., 1995.
MNPV J.Gen.Virol. 76:2447 U41999 Mamestra brassicae MNPV Clarke et al., 1996.
J.Gen.Virol. in press
X84701 Spodoptera littoralis MNPV Faktor et al., 1995.
(SlittMNPV) Virus Genes 11:47
Y08294 Lacanobia oleracea GV (LoGV) Smith & Goodale, 1996.
unpublished


In addition to polh, the nucleotide sequences of p10, gp41, gp64, dnapol and egt genes were searched. Seven baculovirus plO genes and five gp64 genes were found. For the gp41 gene, five complete nucleotide sequences were obtained from GenBank and two partial sequences of LdMNPV and Xestia c-nigrum granulovirus (XcGV) (Dr. Goto, personal communication) were included for further analysis. Five gp64 and eight egt genes from different baculoviruses were also included in this study. Finally, dnapol genes of six baculoviruses and two other insect viruses (Spodoptera ascovirus, ASV, and Choristoneura biennis entomopoxvirus, CbEPV) were included for the phylogenetic studies.




Reconstruction of Phylogenetic Trees of Baculovirus Genes



The nucleotide sequences obtained from BLAST and ENTREZ








84

programs were analyzed using the Wisconsin Sequence Analysis PackageTM (Version 8.1 VMS for VAX computer; Genetic Computer Group). Amino acid sequences were translated from the nucleotide sequence. The multiple sequence alignment of both nucleotide and amino acid sequences were first produced using the Pileup program. The aligned multiple sequences were realigned using the CLUSTAL program (Higgins et al., 1996) because of its accuracy for low homologous sequence comparison.

MEGA (Kumar et al., 1993) and PAUP (Swafford, 1990)

computer programs were used to reconstruct the phylogenetic tree based on the final aligned sequences that were produced by CLUSTAL. The p-distance (proportion distance) and maximum parsimony methods (Fitch, 1971) were used for reconstructing phylogenetic trees based on nucleotide sequence data. The p-distance and neighbor-joining methods (Saitou & Nei, 1987) were chosen for reconstructing phylogenetic trees based on the amino acid sequence data. The bootstrap test with 500 replications was done to show the reliability of the constructed trees using the neighborjoining method. The bootstrap result was given in terms of percentage confidence level.








85

Relationship of Baculoviruses with Insect Hosts




The insect host families (Hodges et al., 1983) are

presented in Figure 4.1. The family name of the insect host in parentheses after the baculovirus species name corresponds to the hosts of the baculoviruses used in this study to reconstruct the polh gene phylogenetic tree. The correlation between the baculoviruses and their insect hosts was studied by determining whether or not the insect hosts of closely related baculoviruses belong to the same family.


Results



PCR Amplification and DNA Sequencing of LdMNPV gp41 Gene


A partial sequence of the LdMNPV gp4l gene (381 bp) was amplified and sequenced (Appendix E). A baculovirus late gene motif was found upstream from the ATG translation start site (-32 to -28). The translation start site did not fit the Kozak principle completely, but it was very similar. A AxxATQC was found instead of the theoretical sequence AxxAT_ (A/G).

The partial LdMNPV gp41 coding sequence was compared










69 CfMNNPV (Tortricidae) 85 PnMNPV (Lymantriidae) 43 OpMNPV (Lymantriidae) ArcMNPV (Tortricidae) 73 - HcMNPV (Arctiidae) AgMNPV (Noctuidae)
(I) 98 ArMNPV (Saturniidae) 85 AfMNPV (Noctuidae) BmMNPV (Bombycidae) AcMNPV (Noctuidae) 62 OpSNPV (Lymantriidae)

58 BsSNPV (Geometridae) 53 - PfMNPV (Noctuidae)

76 93 LsMNPV (Noctuidae)

72 MbMNPV (Noctuidae) SlMNPV (Noctuidae)

100 -- 100 SeMNPV (Noctuidae) 75 co
(II) 87 SfMNPV (Noctuidae) 57' MnMNPV (Lasiocampidae)

HzSNPV (Noctuidae) 41
SpliMNPV (Noctuidae) LdMNPV (Lymantriidae) PbGV (Pieridae) C1GV (Tortricidae) 100
93 TnGV (Noctuidae) NsSNPV (Diprionidae)
Scale: each - is approximately equal to the distance of 0.004943

Figure 4.1. Phylogenetic tree of baculovirus polh gene based on the translated and published amino acid sequences. The number shown in each branch represents the percentage of bootstrap confidence level. The neighbor-joining method was used to construct the phylogenetic tree. The family name of insect host in parentheses after the baculovirus species name corresponds to the hosts of the baculoviruses used in this study.








87

with the AcMNPV gp41 coding sequence, and it showed 56% nucleotide sequence identity and 76% amino acid sequence similarity. The partial LdMNPV gp41 nucleotide sequence and translated amino acid sequence were used to reconstruct the phylogenetic tree.




Phylogenetic Tree of Baculovirus polh Genes


Twenty-six amino acid sequences from different

baculoviruses were obtained from translated nucleotide sequences of published data (Table 4.1), and used to reconstruct the phylogenetic tree. In Figure 4.1, the phylogenetic tree was divided into three main branches: the lepidopteran NPVs, the lepidopteran GVs and the hymenopteran NPV (NsSNPV). Within the lepidopteran NPV branch, the tree was divided into two main groups and one outgroup branch. Group I included AcMNPV, BmMNPV, AfMNPV, ArMNPV, AgMNPV, HcMNPV, ArcMNPV, OpMNPV, PnMNPV, and CfMNPV. Group II included OpSNPV, BsSNPV, PfMNPV, LsMNPV, MbMNPV, S1MNPV, SeMNPV, SfMNPV, MnMNPV, HzSNPV and SpliMNPV. The only member of the outgroup branch was LdMNPV (for complete name of baculoviruses, see Table 4.1). The tree reliability test




Full Text
31
electrophoresis, 0.1 volume of 10X loading buffer (20%
Ficoll 400, 1% SDS, 0.1 mM EDTA, 0.25% Bromophenol Blue and
Xylene Cyanol FF) was added. Total RNA was electrophoresed
in a 1% agarose gel (1% formaldehyde and IX MOPS buffer) in
IX MOPS buffer (Maniatis et al., 1989). The separated RNAs
were transferred to a Zeta-Probe blotting membrane (Bio-Rad
Laboratories, Inc.) with 20X SSC buffer (Maniatis et al.,
1989). After transfer, the membrane was air dried and baked
at 80C for 1 h. The DNA probe containing 50 ng of the
SfMNPV-2 EcoRI-S DNA fragment was prepared by the nick
translation method (United States Biochemical Corp.) using
30 fiCi [a-32p]dCTP (3000 mCi/mmole) Hybridization was
done overnight at 42C, and the blot was rinsed at 42C with
5% and 1% SDS washing buffer twice each (40 mM NaHP04 pH
7.2, 1 mM EDTA) as described by the manufacturer (Bio-Rad
Laboratories, Inc.). The blot was exposed with Kodak X-OMAT
film.
Primer Extension
A total of 10 fig RNA, isolated from the infected Sf-9
cells, was mixed with 0.5 fig of 20-mer oligonucleotide


24
generated and compared with other known gp41 genes. The
secondary structure and possible functional domains of the
gp41 genes were predicted using several computer programs.
Genomic regions of the gp41 gene from different
baculoviruses were compared in order to better understand
the evolutionary relationships among these viruses. The
phylogenetic tree of baculoviruses was reconstructed based
on several phylogenetic trees of baculovirus genes so that
the present baculovirus evolutionary hypotheses could be
examined. Insect hosts of baculoviruses were also studied
in order to reveal the evolutionary relationship between
baculoviruses and their hosts.
This study will not only contribute to an understanding
of the evolutionary relationships among baculoviruses, but
also could be used as a reference to choose baculoviruses
for developing recombinant baculoviruses. Since recombinant
baculovirus techniques depend on the homology of the
baculovirus DNA genome, the phylogenetic tree could be used
as a phenetic tree to indicate homologous relationships
among the viruses. Eventually, this study will benefit
research involving both the basic molecular evolution
analysis and the practical application of baculoviruses.


142
Whitford, M. & Faulkner, P. 1992b. Nucleotide sequence and
transcriptional analysis of a gene encoding gp41, a
structural glycoprotein of the baculovirus Autographa
cali fornica nuclear polyhedrosis virus. Journal of
Virology 66. 4763-4768.
Whitford, M., Stewart, S., Kuzio, J. & Faulkner, P. 1989.
Identification and sequence analysis of a gene encoding
gp67, an abundant envelope glycoprotein of the
baculovirus Autographa cali fornica nuclear polyhedrosis
virus. Journal of Virology 63. 1393-1399.
Whitt, M. A. & Manning, J. S. 1988. A phosphorylated 34-kDa
protein and a subpopulation of polyhedrin are thiol
linked to the carbohydrate layer surrounding a
baculovirus occlusion body. Virology 163. 33-42.
Williams, G. V., Rohel, D. Z., Kuzio, J., & Faulkner, P.
1989. A cytopathological investigation of Autographa
cali fornica nuclear polyhedrosis virus plO gene
function using insertion/deletion mutants. Journal of
General Virology 70. 187-202.
Wilson, J. A., Hill, J. E., Kuzio, J. & Faulkner, P. 1995.
Characterization of the baculovirus Choristoneura
fumiferana multicapsid nuclear polyhedrosis virus plO
gene indicates that the polypeptide contains a
coiled-coil domain. Journal of General Virology 76.
2923-2932.
Wood, H. A. & Granados, R. R. 1991. Genetically engineered
baculoviruses as agents for pest control. Annual Review
of Microbiology 45, 69-87.
Zanotto, P. M. de A., Gao, G. F., Gritsun, T., Marin, M. S.,
Jiang, W. R., Venugopal, K., Reid, H. W. & Gould, E. A.
1995. An arbovirus cline across the northern
hemisphere. Virology 210. 152-159.
Zanotto, P. M. de A., Kessing, B. D. & Maruniak, J. E. 1993.
Phylogenetic interrelationships among baculoviruses:
evolutionary rates and host associations. Journal of
Invertebrate Pathology 62. 147-164.


C1GV
PbGV
TnGV
AfMNPV
BmMNPV
AgMNPV
ArMNPV
OpMNPV
BnMNBV
ArcMNPV
CfMNPV
HcMNPV
AcMNPV
LsMNPV
MfcjMNBV'
PfMNPV
SfMNPV
S1MNPV
SesMNBV
H z SNPV
MnMNPV
B S SNPV
OpSNPV
LdMNPC
SlittMNPV
CD
co
Figure 4.2.
sequences.
tree.
Phylogenetic tree of baculovirus polh gene based on the nucleotide
The maximum parsimony method was used to construct the phylogenetic


59
Table 3.1. Precentage of the nucleotide sequence identities and amino acid
sequence similarities of the ORFs within the gp41 gene region".
BmMNPV
SfMNPV
HzSNPV
AgMNPV
vlf-1
AcMNPV
97
65
65
76
X714151
(99)
(80) 2
(71)
(91)
BmMNPV
67
61
77
L331801
(80) 2
(71)
(90)
SfMNPV


63
63
U147251
(73) 2
(IB)2
HzSNPV
65
L047471
(66)
ORF 327
AcMNPV
95
51
55
68
(96)
(56)
(64)
(78)
BmMNPV
53
54
65
(59)
(64)
(80)
SfMNPV


54
58
(61)
(60)
HzSNPV
57
(64)
ORF 312
AcMNPV
99
70
(100)
(75)
BmMNPV
70
(75)
gp41
AcMNPV
98
59
60
70
(96)
(70)
(75)
(82)
BmSNPV
59
60
74
(72)
(74)
(80)
SfMNPV
75
58
(62)
(69)
HzMNPV

59
(71)
ORF 699
AcMNPV
94
58
54
69
(97)
(10) 2
(70) 2
(80) 2
BmMNPV

59
55
68
(70) 2
(70) 2
(81) 2
SfMNPV

58
58
(12) 2
(68) 2
HzSNPV

53
(71) 2
Bold and normal lettering in parentheses denote nucleotide sequence
identities and amino acid similarities, respectively.
'GenBank accession number. The sequence of AgMNPV gp41 gene region has
been deposited under U37728.
incomplete ORFs were used for amino acid sequence comparison.


60
homologies with ORF 312 of AcMNPV and BmMNPV (70% homology
and 75% similarity; Table 3.1). However, there were no
homologous sequences found between the AgMNPV-2D ORF 300
with the SfMNPV-2 and HzSNPV gp41 regions.
In addition to the intact ORFS, one partial ORF > 667
was found at nucleotides 1-667 which had moderate nucleotide
sequence homology (69%) but high amino acid similarity (80%)
with AcMNPV ORF 699. When the partial ORF >667 of the
AgMNPV-2D was compared with the ORF 699 of AcMNPV, ORF 702
of BmMNPV, ORF >258 of SfMNPV-2 and ORF >299 of HzSNPV, the
results indicated a nucleotide homology of 69, 68, 58, and
53% respectively and an amino acid similarity of 80, 81, 68,
71% respectively (Table 3.1).
Phylogenetic Analysis
Based on the nucleotide sequences and translated amino
acid sequences, a phylogenetic tree of the gp41 gene (Fig.
3.2) was generated by the Pileup program (GCG package) and
MEGA package (Kumar et al., 1993). The results showed that
AcMNPV and BmMNPV were closely related. Subsequently,
HzSNPV and SfMNPV-2 were grouped into a branch and AcMNPV,
BmMNPV and AgMNPV-2D were grouped into another branch.


105
as AcMNPV (host family, Noctuidae) BmMNPV (host family,
bombycide) ArMNPV (host family Saturniidae) and HcMNPV
(host family, Arctiidae) are host-independent and go through
a nonparallel divergence from their hosts. The way that
agriculture systems were involved in distributing the
baculoviruses may indirectly result in evolutionary changes
of baculoviruses.
Some association between viruses and their geographic
distribution has been reported.(Fenner & Kerr, 1994; Zanotto
et al. 1993; 1995) The genetic distance of tick-borne
encephalitis was found to be correlated with the geographic
distance (Zanotto et al. 1995). However,, no significant
evidence was found in this study to support such a
correlation for baculoviruses: Most baculoviruses that were
analyzed in this study are distributed all over the world
from North America, South America, Europe, the Middle East,
and Asia. Thus, the geographic distribution of
baculoviruses does not appear to be associated with their
genetic distances. Although a geographic correlation with
genetic distance was found among GVs in South East Asia and
AgMNPV in South American (Zanotto et al., 1993), this
correlation was applied only to the strains of the same


70% nucleotide identity and 60 to 90% amino acid similarity
with the four other NPVs.
Six baculovirus genes including polyhedrin (polh), plO,
gp41, gp64, DNA polymerase (dnapol) and ecdysteroid UDP-
glucosyltransferase (egt), were used to reconstruct
phylogenetic trees. The results confirmed that hymenopteran
NPVs diverged earlier from lepidopteran granuloviruses (GVs)
and lepidopteran NPVs, later lepidopteran GVs diverged from
lepidopteran NPVs. The dnapol phylogenetic tree also showed
that the baculoviruses had an independent evolutionary path
from two other insect DNA viruses, Spodoptera ascovirus
(SAV) and Choristoneura fumiferana entomopoxvirus (CbEPV).
xm


5
Baculovirus structural proteins
Although BVs and OVs have identical DNA genomes (Smith
& Summers, 1978), the surrounding membrane and proteins axe
very different (Summers & Volkman, 1976). The OV membrane
is formed in the nuclei by de novo synthesis (Stoltz et al.,
1973), while the BV membrane is constructed from the
cytoplasmic membrane (Taada & Hess, 1976; Adams et al.,
1977). The differences between OV and BV membrane
composition in Autographa cali fornica MNPV (AcMNPV) have
been studied (Braunagel & Summers, 1994). The protein and
the lipid compositions were both compared, and it was
observed that the major BV phospholipid is
phosphatidylserine, while the major OV lipids are
phosphatidylcholine and phosphatidylethanolamine. The
results also indicated that the nuclear membrane of infected
Spodoptera frugiperda cell line (Sf9) has a different lipid
compositions compared to the OVs and BVs.
The protein composition of OVs and BVs were analyzed,
and the dominant phosphoproteins differed between the two
virions. The OVs have a 36 kDa major phosphoprotein, while
the BVs have a 85 kDa major phosphoprotein. Glycoprotein


132
Kuzio, J., Rohel, D. Z., Curry, C. J., Carstens, E. B. &
Faulkner, P. 1984. Nucleotide sequence of the plO
polypeptide gene of Autographa californica nuclear
polyhedrosis virus. Virology 139. 414-418.
Kyte, J. & Doolittle, R. F. 1982. A simple method for
displaying the hydropathic character of a protein.
Journal of Molecular Biology 157. 105-132.
Leisy, D., Nesson, M., Pearson, M., Rohrmann, G. &
Beaudreau, G. S. 1986a. Location and nucleotide
sequence of the Orgyia pseudotsugata single
nucleocapsid nuclear polyhedrosis virus polyhedrin
gene. Journal of General Virology 67. 1073-1079.
Leisy, D., Rohrmann, G. & Beaudreau, G. 1984. Conservation
of genome organization in two multicapsid nuclear
polyhedrosis viruses. Journal of Virology 52. 699-702.
Leisy, D., Rohrmann, G. & Beaudreau, G. 1986b. The
nucleotide sequence of the polyhedrin gene region from
the multicapsid baculovirus of Orgyia pseudotsugata.
Virology 153. 280-288.
Leisy, D. J., Rohrmann, G. F., Nesson, M. & Beaudreau, G. S.
1986c. Nucleotide sequencing and transcriptional
mapping of the Orgyia pseudotsugata multicapsid nuclear
polyhedrosis virus plO gene. Virology 153. 157-167.
Li, W.-H. Sc Graur, D. 1991. "Molecular Evolution". Sinauer
Associates, Inc. Sunderland, MA. pp, 99-135.
Liu, J.-C. Sc Maruniak, J. E. 1995. Nucleotide sequence and
transcriptional analysis of the gp41 gene of Spodoptera
frugiperda nuclear polyhedrosis. Journal of General
Virology 76. 1443-1450.
Liu, J. J. Sc Carstens, E. B. 1995. Identification,
localization, transcription, and sequence analysis
of the Choristoneura fumiferana nuclear polyhedrosis
virus DNA polymerase gene. Virology 209. 538-549.
Loh, L. C., Hamm, J. J. & Huang, E.-S. 1981. Spodoptera


54
AgMNPV
polh
xp Q.RS.uv
G JTUV B K D RS C E OH W A I F N LM
11 Mil I HHI 1 tt-H Hhm
44.95 mu 52.42 mu
9 kb
Hindlll Smal BglllPstl Bglll EcoRI Hindlll
1.005 kb
gp41 ORF
Figure 3.1. Position of the gp41 gene on the AgMNPV-2D
genomic map. The gp41 1,005 kb open reading frame is
indicated by the arrow under the map. Notice the gp41 gene
and polyhedrin gene have the same transcription direction
that is from right to left in the conventional map.


119
Purification of the Alkaline Released Virus from LdMNPV
Polyhedra
1. Add one third volume of DAS (final concentration: 0.1 M
Na2C03, 0.01 M EDTA, 0.17 M NaCl, pH 10.9) to the
polyhedra solution and mix. Keep the polyhedra solution
on ice all the time. If the polyhedra is not dissolved,
add a few drops (100 |^1) of 0.5 M NaOH to the polyhedra
solution, and vortex the solution.
2. Prepare a sucrose gradient from 40% to 56%.
3. Centrifuge at 24,000 rpm for 1 hr at 4C.
4. Transfer the different bands (alkaline released virus
with different numbers of nucleocapsids) to a new tube.
5. Add TE to fill the tube and mix well. Centrifuge at
24,000 rpm for 30 min.
6. Discard supernatant.
7. Resuspend the virus (alkali-released virus) in 500 fil TE
buffer.
Viral DNA Purification
1. Add 40 (.il of 20% SDS to the alkaline released virus
solution.
2. Incubate 10 min at room temperature.
3. Add 10-25 |^1 proteinase K (5 mg/ml) and incubate
overnight at 37C.


32
primer (51-GACGTAATCGACACATTTGT-3'). This primer was
complementary to the region from 104 to 123 bases downstream
of the translation start codon of the SfMNPV-2 gp41 protein
gene. The RNA and the primer were incubated at 30C
overnight. The extension reaction was done in buffer
containing 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10
mM DTT, 0.12 mM of each deoxyribonucleotide triphosphate, 25
¡jlC [a-32p]dCTP (3000 mCi/mmol) and 200 units of Maloney
murine leukemia virus reverse transcriptase (Life
Technology) for 60 min at 37C (modified from Ausubel et
al. 1989) The reaction was stopped by adding EDTA to a
final concentration of 20 mM. The extension products were
ethanol-precipitated and resolved on a 6% polyacrylamide
sequencing gel. A sequence marker was done with
dideoxynucleotide chain terminator sequencing reaction by
using the same primer with a DNA template containing the
SfMNPV-2 EcoRI-S fragment.


109
baculovirus late genes, and another transcriptional start
site was located in a region where no consensus motif had
been determined (-140 nucleotide from the translation start
codon, ATG).
The AgMNPV-2D gp41 gene contained 1,005 nucleotides and
encoded 334 amino acids. Comparison of the nucleotide and
amino acid sequences of the AgMNPV-2D with four other NPVs
including Autographa cali fornica MNPV (AcMNPV), Bombyx mori
MNPV (BmMNPV), SfMNPV and Helicoverpa zea single
nucleocapsid nucleopolyhedrovirus (HzSNPV) showed a minimum
of 59% nucleotide identity and 70% amino acid similarity.
Analysis of the protein secondary structure and amino acid
sequence alignment of AgMNPV-2D gp41 gene revealed several
conserved domains including eight a-helix domains, four
loop domains, one p-sheet domain and one transmembrane
domain. Furthermore, the hydrophobicity analysis of the
gp41 gene showed five conserved domains. Domain III was
correlated with one of the conserved a-helix domains
(qQLaNnYxTLLLkr), and domain V was correlated with the
transmembrane domain (EnxxxxAPLSAxxxIFxxx). The genomic
structure of the AgMNPV-2D gp41 region also contained vlf-1


65
250
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
201
k-helix loop a-helix
DALAEAAKQL SLAVQYMVAE AV
S .
rcN
IPIPL P
7N
2QLANNY MTLLLKH
ATL
.SVS...HE. GE.L..QI..
GSVE...RH. GY.L..QI.Q ..
EAA--L --A-QY -V
IS.
.T.
r
r
-PIPL P
JR
.D
V R
3..V.T. I....QR
D. L. . QR
-QL-N-Y -TLLL--
. NI
. NI
A--
-*
251
a-helix
.E.V.E..
...V.D..
N-Q---
loop
a-helix
K.
S.
.s.v.. .
.KY.TL .I.
.T...EIIN. 3NRTHGNS RV HM . A. . N
-S
PEfNIQSAVjES RRFEHI NMINDLINAV IDDLF\GG-G DYYHYVIjNEK
.Y.
.S.
.N.
...-. N.
. V. [T. VY. N.
. -S .
-- --IN-LIN-V IDD-F-G -Yf-YVENEK
Y. .
Y. .
L. .
301
a-helix
350
transmembrane domain
NRARVMSKE NVAFLAPLSA SANIFNYMAE LATRAGKQPS MFQNATFLTS
. I.
. KS
N- -
. .VG.
. IVT.
. IL. .
R 1
.D.
SQ
.H..R.D ..E..A.
. IG TD.
. ISYM TT. .
KE N APLSA

-IF
J. N R. L. .G. . .NA
. FJ.T ...NS..K.. V..S.SM..M
--- LAT--GK-P- -F--A--L--

351
400
loop
AANAVNSPAA H3TKSACQES LTELAFQNET LRRFIFQQIN YNKDANAIIA
. R IRLPL I*
.1 I
-NGSNV E 2NRTS ..Q A...Y...
-KPV-V S3S.NV. .QQ E..A L.
KLS
.LS
.KQNY*
.KN.ISQL*-
401 417
AAAPNATRPN TKGRTA*
Figure 3.4. Continued.


107
hymenopteran NPVs, dipteran NPVs and decapodan NPVs (shrimp)
will help in understanding the complete evolutionary pathway
of baculoviruses. The results of this study also suggest
that the phylogenetic tree of polh gene can be used to
represent the baculovirus species tree. The comparison of
the polh tree with five other genes and the universal tree
shows no significant differences and suggests that the polh
gene is a reliable gene for evolutionary studies of
baculoviruses.


96
Relationship of Baculoviruses and Their Hosts
The family name of the insect hosts of baculoviruses
was also shown in Fig 4.1. When hosts were compared with
the polh gene phylogenetic tree, the results showed a
certain level of correlation between hosts and
baculoviruses. For example, the hosts of OpMNPV, CfMNPV and
PnMNPV that were closely related, belonged to the family
Lymantriidae. Also, most NPVs from group II including
MbMNPV, PfMNPV, SfMNPV, SeMNPV, SlMNPV, and HzSNPV infected
hosts from the family Noctuidae.
Congruent Analysis of Baculovirus Genes
A congruent analysis based on combined baculovirus gene
data sets was compared with six independent phylogenetic
trees of baculovirus genes. The six genes included polh,
dnapol, egt, plO, gp41 and gp64 of AcMNPV, BmMNPV, OpMNPV
and PfMNPV. The phylogenetic tree of combined sequence data
was reconstructed and compared to each single gene tree.
The results did not show any difference between the
universal tree that was based on the combined sequence data
and each single gene tree.


125
shortwave UV irradiation to detect baculovirus DNA on
the surface of gypsy moth eggs. Journal of Virological
Methods 36, 141-150.
Burgess, S. 1977. Molecular weights of lepidopteran
baculovirus DNAs: derivation by electron microscope.
Journal of General Virology 37. 501-510.
Cameron, I. R. & Possee, R. D. 1989. Conservation of
polyhedrin gene promoter function between
Autographa cali fornica and Mamestra brassicae nuclear
polyhedrosis viruses. Virus Research 125. 183-199.
Carbonell, L. F., Hodge, M. R., Tomalski, M. D. & Miller, L.
K. 1988. Synthesis of a gene coding for an insect-
specific scorpion neurotoxin and attempts to express it
using baculovirus vectors. Gene 73. 409-418.
Carson, D. D., Guarino, L .A., & Summers, M. D. 1988.
Functional mapping of an AcNPV immediate early gene
which augments expression of the IE-1 trans-activated
39 k gene. Virology 162. 444-451.
Chaeychomsri, S., Ikeda, M. & Kobayashi, M. 1995. Nucleotide
sequence and transcriptional analysis of the DNA
polymerase gene of Bombyx mori nuclear polyhedrosis
virus. Virology 206.436-447.
Chakerian, R., Rohrmann, G. F., Nesson, M. H., Leisy, D. J.
& Beaudreau, G. S. 1985. The nucleotide sequence of the
Pieris brassicae granulosis virus granulin gene.
Journal of General Virology 66. 1263-1269.
Chisholm, G. E. & Henner, D. J. 1988. Multiple early
transcripts and splicing of the Autographa cali fornica
nuclear polyhedrosis virus IE-1 gene. Journal of
Virology 62. 3193-3200.
Clarke, E. E., Tristem, M., Cory, J. & O'Reilly, D. R. 1996.
Characterization of the Mamestra brassicae multicapsid
nuclear polyhedrosis virus ecdysteroid
UDP-glucosyltransferase (egt) gene. Journal of General
Virology. In press.


APPENDIX B
INTERNET SERVERS USED FOR DATABASE SEARCH AND PROTEIN
SECONDARY STRUCTURE PREDICTION
PROGRAM
URL Site (Server Institute)
Databank search
BLAST
http://www3.ncbi.nlm.nih.gov/Blast/
(National Biotechnology Information Center, USA)
ENTREZ
http://www3.ncbi.nlm.nih.gov/Entrez/
(National Biotechnology Information Center, USA)
Protein secondary structure
Darwin
http://cbrg.inf.ethz.ch/subsection3 1 7.html
(Swiss Federal Institute of Technology Zurich)
PHD
http : //www. embl-heidelberg. de/pred.ictprotein/
predictprotein.html
(European Molecular Biology Laboratory, Germany)
O-linked glycosylation site prediction
NetOglyc http://genome.cbs.dtu.dk/netOglyc/
cbsnetOglyc.html
(The Technical University, Denmark)
Transmembrane domain analysis
MEMSAT
http://globin.bio.Warwick.ac.uk/-jones/
memsat.html
(University of. Warwick, U.K.)
114


3
baculoviruses are divided into two genera based upon the
morphology of the inclusion bodies (IBs) (Murphy et al.,
1995). Virions of the genus Nucleopolyhedrovirus (NPV) are
occluded in a proteinaceous matrix, the polyhedron. The
polyhedron ranges from 0.5 to 15 pm, and there are usually
several virions embedded in each polyhedron (Federici,
1986). Two subtypes of NPVs have been found: the single
nucleocapsid NPV (SNPV) contains only one nucleocapsid per
envelope, and the multiple nucleocapsid NPV (MNPV) contains
several nucleocapsids (1-17) per envelope (Bilimoria, 1986)
The second genus, Granulovirus (GV), contains only one
virion occluded in an oval shaped proteinaceous matrix, and
ranges in size from 160 to 300 nm in width by 300 to 500 nm
in length (Federici, 1986). The virion of GVs usually
consists of one nucleocapsid per envelope, but in a few
cases has been found to have more than one (Murphy et al.,
1995).
Two different types of virions are produced during the
replication cycle of baculovirus. One is the occluded
virion (OV) that is only found inside the polyhedron
(Volkman, 1986), and the other is the budded virion (BV)


128
sequences. Virus Research 41. 123-132.
Gonzalez, M. A., Smith, G. E. & Summers, M. D. 1989.
Insertion of the SfMNPV polyhedrin gene into an AcMNPV
polyhedrin deletion mutant during viral infection.
Virology 170. 160-175.
Granados, R. R. & Federici, B. A. 1986. "The Biology of
Baculoviruses". CRC Press, Inc. Boca Raton, FL. VI, pp,
1-275.
Granados, R. R. & Lawler, K. A. 1981. In vivo pathway of
Autographa cali fornica baculovirus invasion and
infection. Virology 108. 297-308.
Granados, R. R. & Williams, K. A. 1986. In vivo infection
and replication of baculoviruses. In "The Biology of
Baculoviruses". Granados, R. R. & Federici, B. A., Eds.
Boca Raton, Florida: CRC Press, Inc. VI,89-108.
Grner, A. 1986. Specificity and safety of baculoviruses. In
"The Biology of Baculoviruses". Granados, R. R. &
Federici, B. A., Eds. Boca Raton, Florida: CRC Press,
Inc. VI,177-202.
Gross, C. H., Wolgamot, G. M., Russell, R. L., Pearson, M.
N. & Rohrmann, G. F. 1993. A 37-kilodalton glycoprotein
from a baculovirus of Orgyia pseudotsugata is localized
to cytoplasmic inclusion bodies. Journal of Virology
67. 469-475.
Grua, M. A., Buller, P. L., & Weaver, R. F. 1981. Alpha
amanitin-resistant viral RNA synthesis in nuclei
isolated from nuclear polyhedrosis virus-infected
Heliothis zea larvae and Spodoptera frugiperda cells.
Journal of Virology 38. 916-921.
Guarino, L. A. Sc Summers, M. D. 1986. Interspersed
homologous DNA of Autographa cali fornica nuclear
polyhedrosis virus enhances delayed-early gene
expression. Journal of Virology 60. 215-223.
Guarino, L. A. Sc Summers, M. D. 1988. Functional mapping of


66
sequences. One potential transmembrane segment was found
close to the carboxyl end with a consensus sequence of
ENX4APLSAX3IFX using the transmembrane domain prediction
program.
Genomic Structure Analysis
The genomic structures of the gp4l gene flanking
regions of the AgMNPV-2D were analyzed (Fig. 3.5). When the
whole gp4l gene regions of five NPVs were aligned, they
showed similar genomic structures and transcriptional
orientations (relative to the transcription direction of the
AcMNPV polyhedrin gene) with the exception of HzSNPV. In
general, the gp4l gene regions were located at m.u. 45 to
52, but the gp4l gene region of HzSNPV was located at m.u.
96.5 to 97.6. Also, the transcriptional direction of all
the ORFs of HzSNPV is opposite to other NPVs.
Discussion
In summary, the nucleotide sequence of the gp4i gene
region of the AgMNPV-2D was sequenced. Several ORFs were


104
baculoviruses were compared with their hosts. The results
showed that several branches of baculoviruses have the same
host family. Most of the baculovirus in lepidopteran NPV
subgroup II appear to infect the insect family Noctuidae.
Two closely related lepidopteran NPV subgroup II branches
including the branch of LsMNPV, MbMNPV, and PfMNPV, and the
branch of SfMNPV, S1MNPV and SeMNPV are found to infect the
same host family (Noctuidae) with closely related
subfamilies (Hadaninae and Amphipyrinae). Based on the
results, it can be suggested that the lepidopteran NPV
subgroup II has undergone a host-dependent evolution. On
the other hand, the lepidopteran NPV subgroup I was more
diverse than group II. Some baculovirus species such as the
branch of OpMNPV and PnMNPV, and the branch of ArcMNPV and
CfMNPV infect closely related families of insect hosts.
These two closely related branches infect insects from the
family Lymantriidae, and the family Tortriciidae (Grner,
1986; Zanotto et al., 1993) that are closely related. This
also shows that a host-dependent evolutionary pathway could
exist. However, the rest of lepidopteran NPV subgroup I
species did not have strong associations with the same
family of insect hosts. It implies that these species such


48
translation of the downstream ORF is more efficient compared
to the upstream ORF. The upstream ORF may be used for
increasing the translation initiation activity. At the same
time, Ooi and Miller (1991) suggest an antisense RNA
mechanism for transcriptional regulation, which may be used
to turn off a 3.2 kb RNA initiation. In the transcription
of the gp41 gene, the upstream ORF may be used as a
competition inhibitor to control the gp41 gene
transcription. However, a bicistron model could not be
excluded even though the upstream transcriptional start site
is not a common transcriptional start site for baculovirus
late genes. A site specific mutation at the upstream
transcription start site can help elucidate if this
transcription start site is involved in the gene regulation
of gp4l.
Kool et al. (1994) sequenced the AcMNPV-E2 EcoRI-C
fragment and found an extra G residue which is close to the
end of the gp41 gene coding region when comparing it with
the data published by Whitford & Faulkner (1992b). These
results were confirmed by the recent data of Ayres et al.
(1994). The differences in the gp41 gene sequences of
AcMNPV may be caused by using a different strain. The


4.1. Phylogenetic tree of baculovirus polh gene based
on the translated amino acid sequences 86
4.2. Phylogenetic tree of baculovirus polh gene based
on the nucleotide sequence 89
4.3. Phylogenetic trees of baculovirus plO (A),
gp41 (B), and gp64 (C) genes based on translated
amino acid sequences 90
4.4. Phylogenetic trees of baculovirus plO (A),
gp41 (B), and gp64 (C) genes based on nucleotide
sequences 91
4.5. Phylogenetic trees of baculovirus dnapol (A), and
egt (B) genes based on translated amino acid
sequences 94
4.6. Phylogenetic trees of baculovirus dnapol (A), and
egt (B) genes based on nucleotide sequences ... 95
x


120
4. Extract DNA with 0.75 ml distilled phenol (saturated with
TE). Invert tubes gently. Spin in microcentrifuge for
about 1 min. Transfer upper aqueous phase to a clean
microcentrifuge tube. Extract the aqueous phase twice
more with phenol.
5. Extract the aqueous phase three times with 0.75 ml water
saturated ether.
6. Heat the DNA solution at 56C for 15 min in a heat block
with caps open to evaporate ether.
7. Dialyze the DNA solution 4 times against 1 L TE (2 times
daily for 2 days).
8. Measure the DNA concentration by reading optical density
(OD) at 260 nm. The DNA concentration (|ag/ml) equals to
od260 x 50


Table 4.1. Continued
81
X02498
Pieris brassicae GV (PbGV)
Chakerian et al.,
1985. J.Gen.Virol.
66:1263
X79569
Cryptophlebia leucotreta GV
(C1GV)
Jehle & Backhaus,
1994. J.Gen.Virol.
75:3667
plO gene
M10023
Autographa californica MNPV
Kuzio et al., 1984.
Virology 139:414
M14883
Orgyia pseudotsugata MNPV
Leisy et al., 1986c;
Virology 153:157
M98513
Choristoneura fumiferana
MNPV
Wilson et al., 1995.
J.Gen.Virol. 76:2923
U46757
Bombyx mori MNPV
Palhan & Gopinathan,
1995. thesis, Indian
Inst.Sci., India
U50411
Perina nuda MNPV
Chou et al., 1996.
unpublished
X69615
Spodoptera exigua NPV
Zuidema et al., 1993.
J.Gen.Virol. 74:1017
X92713
Spodoptera litura NPV
Behera et al., 1996,
unpublished
gp41 gene
D14468
Bombyx mori MNPV
Nagamine et al., 1991.
J. Invertebr.Pathol.
58:290
L04748
Helicoverpa zea SNPV
Ma et al., 1992 .
Virology 192:224
U14725
Spodoptera frugiperda MNPV
Liu & Maruniak, 1995.
J.Gen.Virol. 76:1443
U37728
Anticarsia gemma talis MNPV
(AgMNPV)
Liu & Maruniak, 1996.
unpublished
X71415
Autographa cali fornica MNPV
Kool et al., 1994.
J.Gen.Virol. 75:487
gp64 gene
L12412
Choristoneura fumiferana
MNPV
Hill & Faulkner, 1994.
J.Gen.Virol. 75:1811


sequenced.
Northern blot analysis showed that the SfMNPV-2 gp41
was a late gene expressed 12 hours post-infection. The gp41
promoter region contained three transcriptional start sites,
two within a consensus transcriptional start site (TAAG) of
baculovirus late genes, and the other located in a region
where no consensus motif has been determined.
The comparison of nucleotide and amino acid sequences
of the AgMNPV-2D with four other NPVs, Autographa
cali fornica MNPV (AcMNPV) Bombyx mori MNPV (BmMNPV) SfMNPV
and Helicoverpa zea single nucleocapsid nucleopolyhedrovirus
(HzSNPV), showed a minimum of 59% nucleotide identity and
70% amino acid similarity. Analysis of the hydrophobicity
and protein secondary structure of gp41 revealed several
conserved domains including eight a-helix, four loop, one
p-sheet and one transmembrane domains.
The analysis of the gp41 upstream and downstream
regions from those five NPVs showed that they contained
vlf-1 gene, ORF 330, ORF 300, gp41 and GRF >667 positioned
from right to left and with a similar arrangement in their
genomic maps. Among these ORFs, the AgMNPV-2D shared 50 to
Xll


ACKNOWLEDGMENTS
I would like to thank Dr. James E. Maruniak, my
committee chairman, and Drs., Richard C. Condit, Pauline 0.
Lawrence, and Susan E. Webb, my committee members. I also
would like to thank Dr. Drion G. Boucias who served as a
committee member for my dissertation defense and Dr. Simon
S. J. Yu who served as a committee member for my qualifying
examination. The greatest appreciation and best wishes go
to Dr. Alejandra Garcia-Maruniak for her friendship and
support during the past four years. I would like to share
my happiness with my friend, Rejane Moraes, and I wish she
may finish her studies as soon as possible. My sincere
appreciation goes to Drs. Dale Habeck, Jackie Pendland, A.
Jeyaprakash, Glenn Hall, Roberto Pereira, Mrs. Raquel
McTiernan and many more. I apologize for those who have
helped me, but who I have not mentioned here, and I would
like to thank them also. Lastly, thanks be to God for
making me strong and peaceful while I was writing my
dissertation.
IV


(A)plO gene
AcMNPV
(B) gp41 gene
AcMNPV
BmMNPV
AgMNPV
HzMNPV
LdMNPV
SfMNPV
XcGV
(C) gp64 gene
AcMNPV
GmMNPV
BmMNPV
CfMNPV
OpMNPV
Figure 4.4. Phylogenetic tree of baculovirus plO (A), gp41 (B), and gp64 (C) genes
based on the nucleotide sequences. The maximum parsimony method was used to
construct the phylogenetic trees.


40
AcMNPV
BmMNPV
MoMc
Milk
HzSNPV
SfMNPV
Motlc
Milk
Figure 2.4. Comparison of hydrophilic-hydrophobic profiles
among the homologous gp41 proteins. The solid line is done
by Kyte-Doolittle (1982) analysis and the dash line is done
by Goldman et al. (review by Engelman et al., 1986)
analysis.


41
AcMNPV-E2
ACMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
1 60
MTDERGNFYY NT-PPPLRYP SNPATAIFTS AQTY-NAPGY VPPATVPTTV ATRDNRMDYT
P N ....N K. .
MS
MAN. .
ACMNPV-E2
AcMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
61 120
SRSNSTNSVA IAPYNKS-KE PTLDAGESIW YNKCVDFVQK IIRYYRCNDM SELSPLMILF
- H.
LPHAV.TALQ HQQHQ.QLQ. SSS.. T Y.ER ...F..T... .H.T.Q..ML
RPNSI.K.-- STMSSS.LSS SSSA.ITEP. MD....Y.N. .V....T... .Q.T.Q.LNL
121 180
AcMNPV-E2 INTIRDMCID TNPISVNWK RFESEETMIR HLIRLQKELG QSNAAESLSS DSNIFQPSFV
AcMNPV-HR3
BmMNPV N G P A...
HzSNPV L.VE SH D.D.NL.K HYS . R . . G.EV. -E
SfMNPV-2 NV..E .Y.VD..AT. . D DVNLMN NYK NKPIT -.D..KA...
181 240
AcMNPV-E2 LNSLPAYAQK FYNGGADMLG KDALAEAAKQ LSLAVQYMVA EAVTCNIPIP LPFNQQLANN
AcMNPV-HR3
BmMNPV S
HzSNPV Y.V..S K. .ENVS G.SVS. .HE .GE.L..QI. ...AS.T VRH..V.T
SfMNPV-2 YSV..S K.G.H.A SGSVE. .RH .GY.L..QI. Q...T.T D D
AcMNPV-E2
ACMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
241
YMTLLLKHAT
LPPNIQSAVE S RRFPH
INMINDLINA
VIDDLFAGG-
300
GDYYHYVLNE
.I....QR.N
.L....QR.N
I...V.D..S .KY.T
I.T... ElIN .GNRTHGNSR
L. I N
VH...A...N
....V.T.VY
.N..Y
S...L
AcMNPV-E2
AcMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
301
KNRARVMSLK
ENVAFLAPLS
ASANIFNYMA
ELATRAGKQP
SMFQNATFLT
360
SAANAVNS PA
I . .
IVT..
. IG
.G....N
APSS--.GSN
T.KS.IL. .
. .ISYM. . .
.TT....FI.
T. ,
,.NS..K.
V.
.S.SM..
MPLT--KPV-
AcMNPV-E2
AcMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
361
AHLTKSACQE
.R.IRRP
.R.IRLP
VEQNRTS..Q
VSES.NV..Q
418
SLTELAFQNE TLRRFIFQQI NYNKDANAII AAAAPNATRP NTKGRTA*
LI*
LI*
A. .Y. .KL S.KQNY*
Q E.. A L S.KN.ISQL*
Figure 2.5. Comparison of the amino acid sequence of four
NPV gp41 proteins. The one-letter code designation is used.
The hyphens denote the gap filled by the computer program.
The dots denote identical amino acids. The abbreviation for
the viruses are described in the text.


LIST OF REFERENCES
Adams, J. R.( Goodwin, R. H., & Wilcox, T. A. 1977. Electron
microscopic investigations on invasion and replication
of insect baculovirus in vivo and in vitro. Review of
Biology and Cell. 28. 261-268.
Ahrens, C. H. & Rohrmann, G. F. 1996. The DNA polymerase and
helicase genes of a baculovirus of Orgyia
pseudotsugata. Journal of General Virology 77. 825-
837.
Akiyoshi, D. E., Chakerian, R., Rohrmann, G. F., Nesson, M.
H. & Beaudreau, G. S. 1985. Cloning and sequencing of
the granulin gene from the Trichoplusia ni granulosis
virus. Virology 141. 328-332.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. &
Lipman, D. J. 1990. Basic local alignment search tool.
Journal of Molecular Biology 215. 403-410.
Aotsuka, T., Chang, H.-Y., Aruga, M., Lin, F.-J., &
Kitagawa, 0. 1994. Mitochondrial DNA variation in
natural populations of Drosophila immigrans. Zoological
Studies 33. 29-33.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D.,
Seidman, J. G., Smith, J. A., Struhl, K., Wang-
Iverson, P. & Bonita, S. G. 1989. "Short Protocols in
Molecular Biology". John Wiley & Sons, Inc. New York,
pp, 139-162.
Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. &
Possee, R. D. 1994. The complete DNA sequence of
Autographs cali fornica nuclear polyhedrosis virus.
Virology 202. 586-605.
122


53
line was maintained at 27C in TC-100 medium with 10% fetal
bovine serum (Life Technologies).
DNA Cloning and Sequencing
Southern blot hybridization was employed to locate the
gp4l gene of AgMNPV-2D. A DNA fragment of SfMNPV-2 within
the gp4l gene (described in Liu & Maruniak, 1995) was
labeled with ^^p- [dCTP] using a nick translation kit (United
States Biochemical Corp.), and used as a probe. The AgMNPV-
2D gp4l gene was first mapped to the 9 kbp HindIII-C
fragment (Fig. 3.1). Subsequently, the gp4l gene was
localized within a 3.5 kb Pstl-Hindlll fragment (at 49.8 -
52.4 map unit, m.u.) which was cloned into the pGEM7Zf(+)
plasmid (Promega Corp.). A series of exo-nuclease deletion
subclones was constructed for sequencing purposes using the
Erase-a-Base system (Promega Corp.). A modification of
experimental protocol was made to precipitate the exo
nuclease-digested DNA before the next step of DNA ligation,
because an incomplete inhibition of exo-nuclease was found
when the manufacturer's instructions were followed. The
extra DNA precipitation step was introduced between the SI


PHYLOGENETIC ANALYSIS OF BACULOVIRUSES USING GP41 STRUCTURAL
PROTEIN GENE AND FIVE OTHER GENES
By
JAW-CHING LIU
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1997

To my dear parents, family and friends

Love is patient.
Love is kind.
It does not envy.
It does not boast.
It is not proud.
It is not rude.
It is not self-seeking.
It is not easily angered.
It keeps no record of wrongs.
Love does not delight in evil but rejoices with the truth.
It always protects, always trusts, always hopes, always perseveres.
Love never fails.
CORINTHIANS 13:4-8

ACKNOWLEDGMENTS
I would like to thank Dr. James E. Maruniak, my
committee chairman, and Drs., Richard C. Condit, Pauline 0.
Lawrence, and Susan E. Webb, my committee members. I also
would like to thank Dr. Drion G. Boucias who served as a
committee member for my dissertation defense and Dr. Simon
S. J. Yu who served as a committee member for my qualifying
examination. The greatest appreciation and best wishes go
to Dr. Alejandra Garcia-Maruniak for her friendship and
support during the past four years. I would like to share
my happiness with my friend, Rejane Moraes, and I wish she
may finish her studies as soon as possible. My sincere
appreciation goes to Drs. Dale Habeck, Jackie Pendland, A.
Jeyaprakash, Glenn Hall, Roberto Pereira, Mrs. Raquel
McTiernan and many more. I apologize for those who have
helped me, but who I have not mentioned here, and I would
like to thank them also. Lastly, thanks be to God for
making me strong and peaceful while I was writing my
dissertation.
IV

TABLE OF CONTENTS
ACKNOWLEDGMENTS iv
LIST OF TABLES viii
LIST OF FIGURES ix
ABSTRACT xi
CHAPTERS
1 INTRODUCTION TO BACULOVIRUSES 1
Review . . 1
Fundamental Studies on Baculoviruses ... 2
Baculovirus infection 2
Baculovirus structural proteins ... 5
Baculovirus DNA genome 10
Regulation of baculovirus gene
expression 11
Application of Baculoviruses in Agriculture
and Biotechnology 13
Use of baculoviruses as biological
control agents 13
Baculovirus expression system .... 16
Future Study and Prospects 18
Evolutionary studies of
baculoviruses 18
Bioinformatic study 22
Present study 23
2 NUCLEOTIDE SEQUENCE AND TRANSCRIPTIONAL ANALYSIS OF
THE GP41 GENE OF Spodoptera frugiperda NUCLEAR
POLYHEDROSIS VIRUS 25
v

Introduction 25
Methods 28
Virus and Cell Culture 28
DNA Cloning and Sequencing 2 8
Computer Analysis 29
RNA Purification 30
Northern Blot Hybridization 30
Primer Extension 31
Results 33
Cloning and Sequencing of the
S. frugiperda EcoRI-S Fragment 33
Transcriptional Analysis of the GP41 Gene 35
Amino Acid and Nucleotide Sequence
comparison of SfMNPV-2 with Other
Baculoviruses 38
Discussion 42
3 NUCLEOTIDE SEQUENCE, AMINO ACID SEQUENCE AND
GENOMIC STRUCTURE ANALYSIS OF THE GP41 GENE REGION
AMONG FIVE NUCLEAR POLYHEDROSIS VIRUSES 50
Introduction 50
Methods 52
Virus and Cell Culture 52
DNA Cloning and Sequencing 53
Computer Analysis 55
Results 56
DNA Sequencing of the GP41 Region .... 56
Phylogenetic Analysis 60
Protein Hydrophobicity Profile Analysis 62
Protein Secondary Structure Analysis ... 62
Genomic Structure Analysis 66
Discussion 66
4 PHYLOGENETIC ANALYSIS OF BACULOVIRUSES 74
Introduction 74
Methods 76
DNA Purification of LdMNPV 76
PCR Amplification and DNA Sequencing of
LdMNPV gp41 Gene 76
Search of Baculovirus Genes through
GenBank 78
vi

Reconstruction of Phylogenetic Trees of
Baculovirus Genes 83
Relationship of Baculoviruses with
Insect Hosts 85
Results 85
PCR Amplification and DNA Sequencing of
LdMNPV gp41 Gene 85
Phylogenetic Trees of Baculovirus polh
Genes 87
Phylogenetic Trees of plO, gp41, and
gp64 Genes 88
Phylogenetic Trees of dnapol and egt
Genes 93
Relationship of Baculoviruses and Their
Hosts 96
Congruent Analysis of Baculovirus Genes 96
Discussion 97
5 SUMMARY OF CURRENT RESEARCH 108
APPENDICES
A NUCLEOTIDE SEQUENCE OF Spodoptera frugiperda
MNPV EcoRI-S FRAGMENT AND TRANSLATED AMINO
ACID SEQUENCE OF GP41 GENE 112
B INTERNET SERVERS USED FOR DATABASE SEARCH AND
PROTEIN SECONDARY STRUCTURE PREDICTION .... 114
C NUCLEOTIDE SEQUENCE OF Anticarsia gemmatalis
MNPV PstI-HindiII FRAGMENT AND TRANSLATED
AMINO ACID SEQUENCE OF GP41 GENE 115
D PURIFICATION OF POLYHEDRA, ALKALINE-RELEASED
VIRUSES AND DNA FROM Lymantria dispar MNPV
COMMERCIAL FORMULATION 118
E PARTIAL NUCLEOTIDE AND TRANSLATED AMINO ACID
SEQUENCES OF Lymantria dispar GP41 GENE .... 121
LIST OF REFERENCES 122
BIOGRAPHICAL SKETCH 144
vii

LIST OF TABLES
Table page
2.1. Amino acid sequence similarities and nucleotide
sequence identities(%) of gp41 structural protein 38
3.1. Percentage of the nucleotide sequence identities
and amino acid sequence similarities of the ORFs
within the gp41 gene region 59
4.1. List of GenBank accession numbers, baculovirus
species, and references of DNA sequences that were
used in construction of baculovirus phylogenetic
trees 79
viii

LIST OF FIGURES
Figure
Page
2.1. Position of the gp41 gene on the SfMNPV genomic
map and sequencing strategy 34
2.2. Northern blot analysis of gp41 gene transcripts 36
2.3. Primer extension analysis of gp41 gene
transcripts 37
2.4. Comparison of hydrophilic-hydrophobic profiles
among the homologous gp41 proteins 4 0
2.5. Comparison of the amino acid sequence of four
NPV gp41 proteins. 41
2.6. Computer alignment of the DNA sequence flanking
the gp41 structural protein genes of AcMNPV-E2,
BmMNPV, HzSNPV and SfMNPV-2 42
3.1.Position of the gp41 gene on the AgMNPV-2D
genomic map 54
3.2. Phenogram of the divergence among five NPVs ... 61
3.3. Hydropnobicity profile of the gp41 protein among
five different NPVs 63
3.4. Alignment of the amino acid sequence of the gp41
protein among five different NPVs 64
3.5. Genomic structure of gp41 gene flanking regions
of the AcMNPV, BmMNPV, AgMNPV-2D, SfMNPV-2 and
HzSNPV 67
IX

4.1. Phylogenetic tree of baculovirus polh gene based
on the translated amino acid sequences 86
4.2. Phylogenetic tree of baculovirus polh gene based
on the nucleotide sequence 89
4.3. Phylogenetic trees of baculovirus plO (A),
gp41 (B), and gp64 (C) genes based on translated
amino acid sequences 90
4.4. Phylogenetic trees of baculovirus plO (A),
gp41 (B), and gp64 (C) genes based on nucleotide
sequences 91
4.5. Phylogenetic trees of baculovirus dnapol (A), and
egt (B) genes based on translated amino acid
sequences 94
4.6. Phylogenetic trees of baculovirus dnapol (A), and
egt (B) genes based on nucleotide sequences ... 95
x

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
PHYLOGENETIC ANALYSIS OF BACULOVIRUSES USING GP41 STRUCTURAL
PROTEIN GENE AND FIVE OTHER GENES
By
Jaw-Ching Liu
May, 1997
Chairperson: Dr. James E. Maruniak
Major Department: Entomology and Nematology
Baculoviruses are pathogenic to insects. Presently,
their origin and evolutionary paths are not clearly
understood. Using a baculovirus structural protein gene,
gp41, that has been shown to be highly conserved among
baculoviruses, the gene transcription, protein structure,
genomic structure and phylogenetic relationships were
studied.
Two complete gp41 nucleotide sequences from Spodoptera
frugiperda multiple nucleocapsid nucleopolyhedrovirus
(SfMNPV-2) and Anticarsia gemmatalis MNPV (AgMNPV-2D), and a
partial gp41 gene from Lymantria dispar MNPV (LdMNPV), were
xi

sequenced.
Northern blot analysis showed that the SfMNPV-2 gp41
was a late gene expressed 12 hours post-infection. The gp41
promoter region contained three transcriptional start sites,
two within a consensus transcriptional start site (TAAG) of
baculovirus late genes, and the other located in a region
where no consensus motif has been determined.
The comparison of nucleotide and amino acid sequences
of the AgMNPV-2D with four other NPVs, Autographa
cali fornica MNPV (AcMNPV) Bombyx mori MNPV (BmMNPV) SfMNPV
and Helicoverpa zea single nucleocapsid nucleopolyhedrovirus
(HzSNPV), showed a minimum of 59% nucleotide identity and
70% amino acid similarity. Analysis of the hydrophobicity
and protein secondary structure of gp41 revealed several
conserved domains including eight a-helix, four loop, one
p-sheet and one transmembrane domains.
The analysis of the gp41 upstream and downstream
regions from those five NPVs showed that they contained
vlf-1 gene, ORF 330, ORF 300, gp41 and GRF >667 positioned
from right to left and with a similar arrangement in their
genomic maps. Among these ORFs, the AgMNPV-2D shared 50 to
Xll

70% nucleotide identity and 60 to 90% amino acid similarity
with the four other NPVs.
Six baculovirus genes including polyhedrin (polh), plO,
gp41, gp64, DNA polymerase (dnapol) and ecdysteroid UDP-
glucosyltransferase (egt), were used to reconstruct
phylogenetic trees. The results confirmed that hymenopteran
NPVs diverged earlier from lepidopteran granuloviruses (GVs)
and lepidopteran NPVs, later lepidopteran GVs diverged from
lepidopteran NPVs. The dnapol phylogenetic tree also showed
that the baculoviruses had an independent evolutionary path
from two other insect DNA viruses, Spodoptera ascovirus
(SAV) and Choristoneura fumiferana entomopoxvirus (CbEPV).
xm

CHAPTER 1
INTRODUCTION TO BACULOVIRUSES
Review
Scientific literature on the study of baculoviruses
goes back to the beginning of the nineteenth century, and
now includes thousands of scientific articles that have
contributed to the understanding of this class of viruses.
Some papers cover fundamental studies such as those
involving the baculovirus infection processes (Volkman &
Keddie, 1990; Granados & Williams, 1986), the baculovirus
structural proteins (Summers & Smith, 1978; Maruniak, 1979,
1986; Rohrmann, 1992), the baculovirus DNA genome (Ayres et
al. 1994), and the regulation of gene expression (Friesen &
Miller, 1986; Blissard and Rohrmann, 1990). Studies dealing
with the application of baculoviruses in agriculture and
biotechnology such as the use of baculoviruses as biological
control agents (Huber, 1986; Bonning & Hammock, 1992;
Moscardi & Sosa-Gomez, 1993) and the baculovirus expression
1

2
system (Summers & Smith, 1987; King & Possee, 1992; O'Reilly
et al. 1992; Richardson, 1995; Shuler et al., 1995) have
also been reported.
Fundamental Studies on Baculoviruses
The fundamental characteristics of baculoviruses have
been described in several review papers and books (Granados
Sc Federici, 1986; Blissard & Rohrmann, 1990; Taada & Kaya,
1993; Miller, 1996). These reviews include the study of
viral particles, nucleocapsids, enveloped virions,
infectious elements, the viral infection pathway,
cytopathology, viral replication, host specificity, viral
gene regulation, and viral DNA replication. In this
section, the viral infection process, structural proteins,
DNA genome and regulation of gene expression of
baculoviruses will be briefly discussed.
Baculovirus infection
Baculoviruses have an enveloped rod-shaped virion
(Federici, 1986). The virions are generally 40-50 nm in
diameter and 200-400 nm in length (Bilimoria, 1986). The

3
baculoviruses are divided into two genera based upon the
morphology of the inclusion bodies (IBs) (Murphy et al.,
1995). Virions of the genus Nucleopolyhedrovirus (NPV) are
occluded in a proteinaceous matrix, the polyhedron. The
polyhedron ranges from 0.5 to 15 pm, and there are usually
several virions embedded in each polyhedron (Federici,
1986). Two subtypes of NPVs have been found: the single
nucleocapsid NPV (SNPV) contains only one nucleocapsid per
envelope, and the multiple nucleocapsid NPV (MNPV) contains
several nucleocapsids (1-17) per envelope (Bilimoria, 1986)
The second genus, Granulovirus (GV), contains only one
virion occluded in an oval shaped proteinaceous matrix, and
ranges in size from 160 to 300 nm in width by 300 to 500 nm
in length (Federici, 1986). The virion of GVs usually
consists of one nucleocapsid per envelope, but in a few
cases has been found to have more than one (Murphy et al.,
1995).
Two different types of virions are produced during the
replication cycle of baculovirus. One is the occluded
virion (OV) that is only found inside the polyhedron
(Volkman, 1986), and the other is the budded virion (BV)

4
that functions in cell to cell infection (Granados & Lawler,
1981). The OV is occluded in either a polyhedron (for NPV)
or granule (for GV). The polyhedron protects the virion
from environmental decay. Upon ingestion by insect larvae,
the polyhedra are dissolved in the midgut's alkaline juices
(Pritchett et al., 1982). The liberated OVs then penetrate
the peritrophic membrane and infect the columnar epithelial
cells (Taada et al., 1975). This step marks the end of the
primary infection. The budded virions that are produced in
the infected nucleus of columnar cells then cause a
secondary infection (Granados & Williams, 1986). The BVs go
through the hemocoel to infect other cells such as those of
the tracheal and the connective tissues (Adams et al., 1977;
Keddie et al., 1989; Volkman & Keddie, 1990). Late in the
infection, occluded virions are formed in the nuclei of
infected cells. The progeny virions (BVs) are found as
early as sixteen hours after initiation of the infection
(Granados & Lawler, 1981). Polyhedra are found starting at
24 hours post-infection (P.I.) (Granados & Lawler, 1981) and
are released upon cell death.

5
Baculovirus structural proteins
Although BVs and OVs have identical DNA genomes (Smith
& Summers, 1978), the surrounding membrane and proteins axe
very different (Summers & Volkman, 1976). The OV membrane
is formed in the nuclei by de novo synthesis (Stoltz et al.,
1973), while the BV membrane is constructed from the
cytoplasmic membrane (Taada & Hess, 1976; Adams et al.,
1977). The differences between OV and BV membrane
composition in Autographa cali fornica MNPV (AcMNPV) have
been studied (Braunagel & Summers, 1994). The protein and
the lipid compositions were both compared, and it was
observed that the major BV phospholipid is
phosphatidylserine, while the major OV lipids are
phosphatidylcholine and phosphatidylethanolamine. The
results also indicated that the nuclear membrane of infected
Spodoptera frugiperda cell line (Sf9) has a different lipid
compositions compared to the OVs and BVs.
The protein composition of OVs and BVs were analyzed,
and the dominant phosphoproteins differed between the two
virions. The OVs have a 36 kDa major phosphoprotein, while
the BVs have a 85 kDa major phosphoprotein. Glycoprotein

6
analysis showed that more glycoproteins were present in BV
than OV. The BV specific glycoproteins are 136, 128, 89, 45
and 40 kDa, and the OV specific glycoproteins are 70, 53,
49, 42 and 40 kDa. Moreover, several specific OV structural
proteins were identified. These proteins include the ODV-
E18, ODV-E35, ODV-E27, ODV-E56 and ODV-E66 (Maruniak &
Summers, 1981; Hong et al., 1994; Braunagel et al., 1996a,
1996b; Theilmann et al., 1996). These OV specific
proteins, such as ODV-E56 and ODV-E66, may be involved in
the production of intranuclear membrane and protein
transport and insertion into the viral envelope membrane
(Braunagel et al., 1996a; 1996b).
The gp41 gene also has been shown to code for an OV
specific protein (Whitford & Faulkner, 1992a). Gp41 genes
are highly conserved with 60% nucleotide sequence homology
among four different baculoviruses (Liu & Maruniak, 1995).
The gp41 protein was identified as an O-linked glycoprotein,
and its localization was predicted to be in the tegument
(Whitford & Faulkner, 1992a). Although the biological
function of gp41 protein has not yet been defined, it may
have functions similar to those of other OV specific
proteins, such as formation of the envelope membrane and/or

7
protein transport into the membrane. Another OV specific
protein, p74, has been proved to be essential for virulence
of baculoviruses. Polyhedra produced by the AcMNPV virus
with mutations in the p74 gene failed to kill Trichoplusia
ni larvae per os (Kuzio et al., 1989). This indicated that
p74 is required for viral infectivity. However, details of
the mechanism of p74 protein function still need to be
elucidated.
In contrast to the OV specific proteins, the gp64
protein is specifically found in BV (Blissard & Rohrmann,
1989; Whitford et al., 1989) and plays an important role in
cell to cell infection (Volkman & Goldsmith, 1984). The
gp64 protein is concentrated at one end of the virion
membrane and may be involved in a pH dependent fusion with
the host cell endosomal membrane (Volkman & Goldsmith,
1985). Furthermore, gp64 has been shown to be a type I
integral membrane protein with one membrane fusion domain
and one oligomerization domain (Monsma & Blissard, 1995;
Monsma et al., 1996). Gp64 is highly glycosylated, and
glycosylation is required for the incorporation of gp64 into
the virion envelope (Rohrmann, 1992). In addition, a signal
peptide sequence was found in the N-terminal of gp64 that

8
was missing in the mature form of the protein (Rohrmann,
1992) .
Besides the OV and BV structural proteins, there are
three other major structural proteins found in
baculoviruses: polyhedrin, PE, and plO proteins. Polyhedrin
is the basic subunit of polyhedra and is reported to be a
29 kDa protein with highly conserved amino acid sequences
between NPVs and GVs (Akiyoshi et al., 1985; Maruniak, 1986;
Blissard & Rohrmann, 1990). It has 80% identity among
lepidopteran NPVs, 50% identity between the lepidopteran
NPVs and GVs, and 40% identity between the lepidopteran and
hymenopteran NPVs (Rohrmann, 1992). The carboxyl terminal
and central region of polyhedrin genes are highly conserved,
but the N-terminal is less conserved (Akiyoshi et al., 1985;
Chakerian et al., 1985; Rohrmann, 1986). The cytoplasmic
polyhedrosis virus (CPV) also produces polyhedrin protein to
form a type of polyhedra. However, the polyhedrin amino
acid composition between NPVs and CPVs are different
quantitatively and qualitatively (Maruniak, 1986; Rohrmann,
1986) .
An electron-dense envelope named polyhedron membrane or
polyhedron calyx surrounds the polyhedra (Rohrmann, 1992).

9
PE (polyhedron electron-dense envelope) protein has been
suggested to be a major component of the PE, and is
phosphorylated and thiolly linked to the carbohydrate
component of the polyhedron envelope (Minion et al. 1979;
Whitt & Manning, 1988; Rohrmann, 1992). The PE gene is a
late gene, expressed at 48 hours post infection (Russell &
Rohrmann, 1990). The PE nucleotide homology among AcMNPV,
OpMNPV and LdMNPV is 58, 27 and 34%, respectively (Rohrmann,
1992). Thus, the PE protein is not highly conserved among
the different baculoviruses.
The plO protein has been proved to be an essential gene
for polyhedra formation. Three functional domains of plO
proteins were identified in AcMNPV using a site directed
mutation analysis (van Oers et al., 1993). These functional
domains include a fibrillar structure formation domain (15
amino acids from the carboxyl terminus), a nuclear
disintegration domain (amino acid residue 52-79) and an
intermolecular binding domain (the amino terminal half of
the plO protein). The unsuccessful substitution of the
AcMNPV plO gene with the Spodoptera exigua MNPV (SeMNPV) plO
gene indicated that at least one virus-specific factor was
required to interact with the plO protein for nuclear

10
disintegration (van Oers et al., 1994). In general, the
homology of plO genes among baculoviruses is very low; there
is only 42, 26 and 38% amino acid sequence identity among
AcMNPV, SeMNPV and OpMNPV, respectively (Rohrmann, 1992).
Baculovirus DNA genome
Baculoviruses are double stranded DNA viruses with the
genome size ranging from 88 to 160 kilobase pairs (kb)
(Burgess, 1977; Blissard & Rohrmann, 1990). The genomic
structure among baculoviruses has been shown to be similar
(Leisy et al., 1984). The alignment of AcMNPV, Orgyia
pseudotsugata MNPV (OpMNPV), and SeMNPV genomes showed that
these baculoviruses have similar locations for the
polyhedrin gene, plO gene and ecdysteroid UDP-
glucosyltransferase (egt) gene (van Strien et al., 1996).
On the other hand, the genomic location of the ubiquitin
gene is different among, these baculoviruses, and this
difference is probably caused by gene rearrangement. Gene
rearrangement is also apparent for the gp41 genes of five
different NPVs (Chapter 3).
The genomic DNA sequences of AcMNPV (Ayres et al.,

11
1994) and BmMNPV (Maeda, unpublished data; GenBank accession
number, L33180) have been completed and provide valuable
information in analyzing the potential open reading frames
(ORFs). In AcMNPV, 154 potential ORFs (greater than 150
nucleotides in length) and the potential transcription
motifs of these ORFs have also been identified. A complete
genomic structural map has located all the identified genes
of AcMNPV (Ayres et al., 1994).
Regulation of baculovirus gene expression
The baculovirus genes are transcribed in an ordered
cascade. Four types of genes (immediate early, early, late,
and very late genes) have been described according to their
dependence on the transcription of previous types cf genes
and on their occurrence before or after viral DNA
replication (Friesen & Miller, 1986; Guarino & Summers,
1986; Blissard & Rohrmann, 1990).
The immediate early (IE) genes, also called regulatory
genes, do not require any viral gene products for their
transcription and are involved in the transactivation of the
next gene expression phase (early genes) (Guarino & Summers,

12
1986; Chisholm Sc.Henner, 1988). Examples of IE genes
include the IE-0, IE-1, IE-N, PE-38 and CG-30 genes (Carson
et al., 1988; Chisholm & Henner, 1988; Guarino & Summers,
1988). The second type of genes are called the early genes
and are involved in viral DNA replication. RNA polymerase
II is believed to be responsible for the transcription of
early genes (Grua et al., 1981; Fuchs et al., 1983). The
transcriptional motif, CAGT, is conserved in the promoters
of both immediate early and early genes (Blissard &
Rohrmann, 1989; Theilmann & Stewart, 1991; Ayres et al.,
1994) .
In contrast to the IE and early genes, the late and
very late genes are transcribed after viral DNA replication,
and depend on the expression of the early genes (Miller,
1988; Thiem & Miller, 1989). RNA polymerase III is believed
to be responsible for the transcription of late and very
late genes (Blissard & Rohrmann, 1990; Zanotto et al.,
1992). By using a primer extension assay (Rohrmann, 1986;
Thiem & Miller, 1989), a common motif of late and very late
genes (TAAG) has been proved to be a transcription start
site (the first T or first A). Most of the late and very
late genes code for structural proteins needed for the

13
assembly of baculovirus virions and polyhedra (Miller, 1988;
Williams et al. 1989) .
Application of Baculoviruses in Agriculture and
Biotechnology
The baculoviruses are mainly used as microbial control
agents against insect pests (Huber, 1986). They have also
been developed as protein expression systems in
biotechnology (Summers & Smith, 1987; King & Possee, 1992;
O'Reilly et al., 1992; Richardson, 1995; Shuler et al.,
1995). Both applications represent the keystone for
studying baculoviruses, and contribute to the knowledge of
these viruses.
Use of baculoviruses as biological control agents
Baculoviruses can infect a wide range of insects
including 34 families of Lepidoptera, a few families of
Hymenoptera, Diptera, Coleptera, Neuroptera, Trichoptera,
Thysanura, and Siphonaptera (Taada & Kaya, 1993, Murphy,
1995). More than 800 species of baculoviruses have been

14
reported from lepidopteran and dipteran hosts. They have
been used as microbial control- agents for decades because of
their host specificity (Hawtin et al. 1992). At present,
several commercial baculovirus pesticides are registered
(Huber, 1986). These commercial baculovirus pesticides
include SeMNPV, HzSNPV, AcMNPV, Anagrapha falicfera MNPV
(AfMNPV), Cydia pomonella (codling moth) GV (Biosys Inc.),
LdMNPV, and NsSNPV (U.S. Forest Service, USDA). In Brazil
and the southern United States, AgMNPV has been used to
control the velvetbean caterpillar, Anticarsia gemmatalis,
in soybean crops (Moscardi & Sosa-Gomez, 1993; Funderburk et
al., 1992). In the northern regions of America, LdMNPV has
been successfully used to control the forest pest, gypsy
moth (Huber, 1986). There are, however some limitations to
the use of baculoviruses, because the time required to kill
the hosts after baculovirus infection is often too long (5
to 10 days) to prevent crop losses. Therefore,
baculoviruses are only suitable for those crops presenting
certain levels of tolerance to insect damage (Bonning &
Hammock, 1992). The development of recombinant
baculoviruses with integrated toxin genes has the potential
to control pests more efficiently (Carbonell et al. 1988;

15
Bonning & Hammock, 1992). Some of the genetically improved
baculovirus insecticides have already been tested in the
field (Wood & Granados, 1991; Cory et al. 1994). The
results show that the modified baculoviruses kill insect
pests faster than wildtype baculoviruses, and therefore
could reduce crop damage (Maeda et al., 1991). Genetically
engineered baculoviruses will become useful to control
insect pests in forests and.agricultural systems in the
future (Bonning & Hammock, 1992). However, the release of
recombinant baculoviruses to the natural environment is
still controversial (Fuxa, 1989) .
Environmental safety is a main issue when baculoviruses
are applied as biological pesticides. Several species of
birds, aquatic organisms and mammals have been tested for
toxicology safety (Betz, 1986), and no deleterious effects
have yet been reported. Beneficial insects were also
tested, and no direct adverse effects were found (Grner,
1986). However, some parasite and predator species were
indirectly affected by baculoviruses due to the decrease in
host larvae resources (Betz, 1986).
The persistence of baculoviruses in the environment has
also been studied. Several environmental factors affect the

16
distribution and persistence of baculoviruses. These
factors include ultraviolet light (UV), rainfall,
temperature, pH of soil, and the microenvironment of the
plant surface (Bitton et al., 1987). Several techniques
have been used for detecting, tracing and identifying
baculoviruses in the field. These techniques include
microscopic diagnosis (Kaupp & Burke, 1984; Traverner &
Connor, 1992), bioassay, serological assays such as Enzyme
Linked Immunosorbent Assay (ELISA) (Naser & Miltenburger,
1982, 1983; Webb & Shelton, 1990), DNA dot blot
hybridization (Ward et al., 1987;.Keating et al., 1989) and
polymerase chain reaction (PCR) (Burand et al., 1992; Moraes
& Maruniak, 1997) The latest development of a PCR
technique provides a convenient, fast and accurate way to
detect and identify baculoviruses in their natural
environment (Moraes & Maruniak, 1997).
Baculovirus expression system
The baculovirus expression system was developed based
on the understanding of the baculovirus life cycle,

17
baculovirus gene regulation and baculovirus genome
structure. The original transfer vector has been created
by using the polyhedrin gene region and the polyhedrin gene
promoter of AcMNPV to carry and express a foreign gene
(Smith et al., 1983). The constructed vector DNA is
delivered into insect cells that are infected with the
wildtype baculovirus to produce a recombinant virus. A
recombinant virus that carries the foreign gene is produced
due to the homologous DNA exchange between the polyhedrin
gene regions from the vector and the wildtype virus DNA.
This exchange interrupts polyhedrin gene transcription in
the recombinant virus, which then does not express the
polyhedrin protein. Therefore, the recombinant virus does
not form the polyhedra. The recombinant virus is usually
selected by the expression of a marker gene such as that
coding for the (3-galactosidase that digests the substrate,
5-bromo-4-cholor-3 indolyl-(3-D-galacto-pyranoside (X-gal) ,
to form blue plaques (Summers & Smith, 1987). Currently,
several baculovirus vectors as well as laboratory manuals
are available (Summers & Smith, 1987; King & Possee, 1992;
O'Reilly et al., 1992; Richardson, 1995; Shuler et al.,

18
1995). Sophisticated procedures for the expression of
foreign genes and subsequent protein purification have been
well established.
The benefit of using the baculovirus expression system
includes high yields and protein posttranslational
modifications that are similar to eukaryotic systems, such
as protein glycosylation, phosphorylation, and amidation
(Luckow Sc Summers, 1988a; Maeda, 1989). This expression
system can be used for pharmaceutical purposes, insect
physiology studies and pest control (Maeda, 1989).
Future Study and Prospects
Evolutionary studies of baculoviruses
In the 1960s and 1970s, the study of phylogenetic
relationships using a molecular approach showed tremendous
progress, mainly through the use of various techniques such
as protein electrophoresis, DNA-DNA hybridization,
immunological methods and protein sequencing. Statistical
measurements of genetic distances and methods for
reconstruction of phylogenetic trees have also been
developed (Li & Graur, 1991) The accumulation of DNA

19
sequence data has facilitated phylogenetic analysis.
Molecular evolutionary data could potentially be used to
interpret the relationships among baculoviruses and to other
viruses. The evolution of DNA viruses is usually caused by
modifications of their genomes due to DNA deletion, DNA
recombination (gene rearrangement), and DNA insertion from
the host genome. Several baculovirus genes show homology
with the host cell genes such as ubiquitin (van Strien et
al. 1996), and such data support the evolutionary mechanism
of incorporating of host cell DNA into the viral genome.
The baculovirus polyhedrin gene has been used to
reconstruct a phylogenetic tree, showing the early
divergence of NPVs and GVs (Zanotto et al., 1993). The
results showed that the hymenopteran NPV diverged earlier
from the lepidopteran NPVs than from the lepidopteran GVs.
The data also suggested that the lepidopteran NPVs were
divided into two major branches. Until 1996, three
baculovirus genes have been used to reconstruct the
phylogenetic trees including the polyhedrin gene, DNA
polymerase (Ahrens & Rohrmann, 1996; Pellock et al., 1996)
and ecdysteroid UDP-glucosyltransferase (Barrett et al.,
1995). The results of the last two gene phylogenetic trees

20
supported the hypothesis generated from the phylogenetic
tree of polyhedrin genes.
DNA polymerase genes have been classified into four
families including A, B, C, and X (Heringa & Argos, 1994).
The baculovirus DNA polymerase belongs to family B, which is
also the type of polymerase found in various other species
ranging from bacteria, viruses, yeasts and mammals (Heringa
& Argos, 1994). By comparing the nucleotide sequence of the
AcMNPV DNA polymerase gene with those from two other insect
DNA viruses, the ascovirus and entompoxvirus, it was
concluded that they have independent evolutionary paths
(Pellock et al., 1996).
Moreover, baculovirus egt genes were used to study
their phylogenetic relationships. The egt proteins range
from 55 to 60 kDa (O'Reilly Sc Miller, 1990; Riegel et al. ,
1994), and catalyze the transfer of glucose to ecdysteroids
(O'Reilly Sc Miller, 1989) The molting and pupation of
infected insect larvae have been shown to be blocked because
of an imbalance in this insect hormone (O'Reilly Sc Miller,
1989). Deletion of the egt gene can speed the killing time
of insect larvae by AcMNPV (O'Reilly Sc Miller, 1991).
However, histopathological investigation showed that the

21
degeneration of Malpighian tubules causes the death more
rapidly in these insect larvae that were infected by an
AcMNPV egt gene deletion mutant (Flipsen et al., 1995). A
baculovirus pesticide improvement is suggested by deletion
of the egt gene (O'Reilly & Miller, 1991). The egt proteins
also share 21 to 22% amino acid sequence identities with
several mammalian UDP-glucuronosyl transferases (O'Reilly &
Miller, 1989). Overall, the phylogenetic analysis of the
egt genes from six different baculoviruses supports the
evolutionary scheme of the polyhedrin sequence phylogeny
tree (Barrett et al., 1995).
The reconstruction of a baculovirus phylogenetic tree,
based on other baculovirus genes such as gp41, gp64 and plO
will provide additional information for examining the
evolutionary hypothesis based on the polyhedrin phylogenetic
tree. Also, the non-protein coding sequences of
baculoviruses could provide useful information for
understanding baculovirus phylogeny. For instance, the
divergence and evolution of homologous regions (HR) between
AcMNPV and BmMNPV have been studied, and results have shown
that the HRs of AcMNPV and BmMNPV are highly conserved
(Majima et al., 1993). However, the high variability of the

22
HR sequences between genomic variants of the same virus
(Garcia-Maruniak et al., 1996), and the facts that there are
four to eight HR regions in the genome of different
baculoviruses, cause a problem in analyzing the data.
Bioinformatic study
Recently, the rapid development of genomic projects
including the mapping of bacterial (Escherichia coli) yeast
(Saccharomyces cerevisiae) nematode (Caenorhabd.itis
elegans), fruit fly (Drosophila melanogaster), and human
(Homo sapiens) genomes created a new field called
bioinformatics (Schomburg & Lessel, 1995; Schulze-Kremer,
1996). Using computer programs and macromolecular
databases, scientists are able to evaluate the potential
biological function of a newly detected gene and the
phylogenetic relationship to other genes. A complete search
of the homologous sequences in the databanks not only
provides the data to reconstruct a phylogenetic tree between
the unknown protein and the homologous proteins, but also
provides the structural backbone to build a possible three-
dimensional (3D) image of the unknown protein (Benner,

23
1995). Two major databases, the GenBank at the National
Center for Biotechnology (NCBI, USA) and the EMBL (European
Molecular Biology Laboratory Database) at the European
Bioinformatics Institutes (EBI, England) are accessible
around the world (Doolittle, 1996) providing information on
nucleotide and primary amino acid sequences. In addition,
the protein data bank (PDB), a protein structure database,
collects protein structure information from crystallographic
results, and is therefore an important database for
constructing 3D structures of unknown proteins. The
development of such databases, computer programs, and
computer facilities provides scientists with more efficient
ways to search for homologous sequences of an unknown gene,
to align multiple sequences, and to reconstruct phylogenetic
relationships.
Present study
In this study, the baculovirus gp41 gene was chosen for
phylogenetic analysis, because it has been proved to be
highly conserved (Brown et al., 1985; Liu & Maruniak, 1995).
Two new gp41 gene DNA sequences of AgMNPV and SfMNPV were

24
generated and compared with other known gp41 genes. The
secondary structure and possible functional domains of the
gp41 genes were predicted using several computer programs.
Genomic regions of the gp41 gene from different
baculoviruses were compared in order to better understand
the evolutionary relationships among these viruses. The
phylogenetic tree of baculoviruses was reconstructed based
on several phylogenetic trees of baculovirus genes so that
the present baculovirus evolutionary hypotheses could be
examined. Insect hosts of baculoviruses were also studied
in order to reveal the evolutionary relationship between
baculoviruses and their hosts.
This study will not only contribute to an understanding
of the evolutionary relationships among baculoviruses, but
also could be used as a reference to choose baculoviruses
for developing recombinant baculoviruses. Since recombinant
baculovirus techniques depend on the homology of the
baculovirus DNA genome, the phylogenetic tree could be used
as a phenetic tree to indicate homologous relationships
among the viruses. Eventually, this study will benefit
research involving both the basic molecular evolution
analysis and the practical application of baculoviruses.

CHAPTER 2
NUCLEOTIDE SEQUENCE AND TRANSCRIPTIONAL ANALYSIS OF THE GP41
GENE OF Spodoptera frugiperda NUCLEAR POLYHEDROSIS VIRUS
Introduction
Spodoptera frugiperda MNPV (SfMNPV-2) is a member of
the family Baculoviridae. SfMNPV-2 has a double-stranded
DNA genome of approximately 121 kb. The SfMNPV physical map
for a number of restriction endonucleases has been
described, and the restriction endonuclease profiles also
shows differences comparing to other NPVs (Loh et al., 1981;
Maruniak et al., 1984) However, two regions of DNA
homology on the physical maps of SfMNPV-2 and S. exempta
MNPV (SeMNPV-25), an Autographa cali fornica MNPV genomic
variant (Brown et al., 1985), have been identified by
hybridization under high stringency conditions. One of
these two regions contained the polyhedrin gene (Brown et
al. 1987); the other region has been identified in the
current report to be associated with the gp41 structural
protein gene.
25

26
Two types of virions are produced during the nuclear
polyhedrosis life cycle. Those virions found within the
viral inclusion bodies (IBs) are termed occluded viruses
(OVs). They obtain their envelope in the nuclei of infected
cells de novo, and the OV envelope is involved in the
recognition of host microvilli during infection. The second
type of baculovirus virion is the budded virus (BV). The
single nucleocapsids bud through the plasma membrane of
infected cells and form the ECV (Granados & Williams, 1986;
Blissard & Rohrmann, 1990). These virions appear to be
specialized for secondary infection of other host cells and
contain virus-encoded envelope glycoproteins which are
involved in host cell infection, i.e. gp64 (Maruniak, 1979;
Keddie & Volkman, 1985).
The gp41 structural protein has been identified as a
major OV glycoprotein by metabolic labeling (Maruniak 1979;
Stiles & Wood, 1983) It has also been detected by the
binding of horseradish peroxidase-linked concanavalin A,
thus indicating it is glycosylated (Braunagel & Summers,
1994). Furthermore, an O-linked single N-acetylglucosamine
covalently bonded to the polypeptide was identified
(Whitford Sc Faulkner, 1992a) Experiments with monoclonal

27
antibodies indicated that gp41 is present only in OV; it
appears to be associated with OV but not with purified
nucleocapsids or the ECV (Whitford & Faulkner, 1992a; Ma et
al. 1993). The location of the gp41 protein has been
predicted to be between the envelope membrane and the capsid
(tegument) of the OV. On the other hand, Braunagel &
Summers (1994) indicated that the viral proteins of 40-41
kDa are glycosylated in the OV and ECV. However, the
monoclonal antibody data suggest that the gp41 proteins of
ECV and OV are different proteins. The gene encoding the
gp41 protein has been characterized (Nagamine et al., 1991;
Whitford & Faulkner, 1992b; Ma et al., 1993; Ayres et al.,
1994; Kool et al., 1994), but the biological function of the
gp41 protein is still unknown.
In this chapter, the complete nucleotide and translated
amino acid sequence of the SfMNPV-2 gp41 gene is presented.
The sequences were compared with other known gp41 gene
sequences of different baculoviruses to reveal the possible
functional domain of the gp41 protein. A possible
transcriptional regulation mechanism and the phylogenetic
relationships of the gp41 gene among the different
baculoviruses are discussed in this paper.

Methods
Virus and Cell Culture
The S. frugiperda MNPV isolate SfMNPV-2 (Maruniak et
al. 1984) was propagated in the S. frugiperda Sf-9 cell
line (Luckow and Summers', 1988b) Sf-9 cells were
maintained at 27C in TC-100 medium supplemented with 10%
fetal bovine serum (Life Technology) and 50 /g/ml
gentamicin.
DNA Cloning and Sequencing
The SfMNPV-2 EcoRI-S DNA fragment was cloned into
pGEM3Z and pGEM7Zf(+) vectors (Promega Corp.), and the
subfragments EcoRI-Hindlll (0.5 kbp), EcoRI-PstI (0.8 kbp),
Pstl-EcoRI (1.1 kbp) and Hhal-Hhal (0.7 kbp) were cloned
into pGEM3Z. Exonuclease digested subclones were generated
with the Erase-a-Base system (Promega Corp.). A
modification of the experimental protocol was made to
precipitate the exo-nuclease-digested DNA before the next
step of DNA ligation, because an incomplete inhibition of

29
exo-nuclease was found when the manufacturer's instructions
were followed. The extra DNA precipitation step was
introduced between the SI nuclease digestion and Klenow
enzyme treatment. Sequencing was performed by the
dideoxynucleotide chain terminator sequencing method (Sanger
et al., 1977) with Sequenase (United States Biochemical
Corp.). The oligonucleotide primers were synthesized by the
DNA Synthesis Laboratory of the Interdisciplinary Center for
Biotechnology Research at the University of Florida.
Computer Analysis
The Wisconsin Sequence Analysis Package (Version 8.1,
VMS; Genetic Computer Group) was used for comparing the
nucleotide sequence and amino acid sequence identities
(GAP), generating the multiple sequence alignment (Pileup),
and plotting the hydrophobicity profile (Pepplot). The
Blast program (Altschul et al., 1990) was used to search the
GenBank databank for the homologous nucleotide sequences
through the e-mail service at the National Center for
Biotechnology Information (NCBI, USA). The Fetch program
was used to retrieve nucleotide sequences from the local
GenBank database.

30
RNA Purification
The total cellular RNA was isolated using the guanidine
isothiocyanate method (Ausubel et al., 1989) from 3xl06 Sf-9
cells infected with SfMNPV-2 at a multiplicity of infection
of 10 plaque forming units (PFU) per cell. At various times
postinfection (p.i.), the cells were lysed in 4 M guanidine
isothiocyanate pH 5.5, 20 mM sodium acetate, 0.1 mM
dithiotheitol (DTT) and 0.5% sarkosyl. Cell lysates were
layered over a 5.7 M CsCl solution (0.1 mM EDTA) and
centrifuged at 100k X g for 24 hours in a swinging bucket
AH650 rotor (DuPont). The RNA was dissolved in sterile
water and ethanol precipitated. After washing the RNA
pellet in 70% (v/v) ethanol, the pellet was dissolved in
sterile water. The RNA concentration was determined by
measuring the UV absorbance at 260 nm (OD2go x 40 = Mg/ml).
Northern Blot Hybridization
A total of 5 fig RNA was denatured with 7% formaldehyde,
50% formamide and IX MOPS buffer (0.2 M MOPS pH 7.0, 50 mM
sodium acetate and 10 mM EDTA) at 55C for 15 min. Before

31
electrophoresis, 0.1 volume of 10X loading buffer (20%
Ficoll 400, 1% SDS, 0.1 mM EDTA, 0.25% Bromophenol Blue and
Xylene Cyanol FF) was added. Total RNA was electrophoresed
in a 1% agarose gel (1% formaldehyde and IX MOPS buffer) in
IX MOPS buffer (Maniatis et al., 1989). The separated RNAs
were transferred to a Zeta-Probe blotting membrane (Bio-Rad
Laboratories, Inc.) with 20X SSC buffer (Maniatis et al.,
1989). After transfer, the membrane was air dried and baked
at 80C for 1 h. The DNA probe containing 50 ng of the
SfMNPV-2 EcoRI-S DNA fragment was prepared by the nick
translation method (United States Biochemical Corp.) using
30 fiCi [a-32p]dCTP (3000 mCi/mmole) Hybridization was
done overnight at 42C, and the blot was rinsed at 42C with
5% and 1% SDS washing buffer twice each (40 mM NaHP04 pH
7.2, 1 mM EDTA) as described by the manufacturer (Bio-Rad
Laboratories, Inc.). The blot was exposed with Kodak X-OMAT
film.
Primer Extension
A total of 10 fig RNA, isolated from the infected Sf-9
cells, was mixed with 0.5 fig of 20-mer oligonucleotide

32
primer (51-GACGTAATCGACACATTTGT-3'). This primer was
complementary to the region from 104 to 123 bases downstream
of the translation start codon of the SfMNPV-2 gp41 protein
gene. The RNA and the primer were incubated at 30C
overnight. The extension reaction was done in buffer
containing 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10
mM DTT, 0.12 mM of each deoxyribonucleotide triphosphate, 25
¡jlC [a-32p]dCTP (3000 mCi/mmol) and 200 units of Maloney
murine leukemia virus reverse transcriptase (Life
Technology) for 60 min at 37C (modified from Ausubel et
al. 1989) The reaction was stopped by adding EDTA to a
final concentration of 20 mM. The extension products were
ethanol-precipitated and resolved on a 6% polyacrylamide
sequencing gel. A sequence marker was done with
dideoxynucleotide chain terminator sequencing reaction by
using the same primer with a DNA template containing the
SfMNPV-2 EcoRI-S fragment.

33
Results
Cloning and Sequencing of the S. frugiperda EcoRI-S Fragment
The S. frugiperda MNPV-2 EcoRI-S fragment containing
the gp41 structural protein gene was cloned into pGEM3Z and
pGEM7Zf(+) (Fig. 2.1 A). The specific restriction
endonuclease digested subclones and exonuclease III deleted
subclones were constructed. The T7 and SP6 promoter primers
present in the pGEM vector and several specific
oligonucleotide primers were used for sequencing (Fig. 2.1
B). A major open reading frame (ORE) which contained 999
nucleotides encoded the gp41 gene, and it was oriented from
right to left according to the conventional physical maps
(Fig. 2.1 B) (Maruniak et al., 1984) The complete sequence
of SfMNPV-2 EcoRI-S fragment (Appendix A) was deposited with
the GenBank Data Library. One baculovirus late promoter
consensus motif TAAG (Blissard & Rohrmann, 1990) was found
from 39 to 43 nucleotides upstream from the ATG translation
start codon. The translation stop codon TGA was followed by
394 nucleotides downstream to the polyadenylation signal
AATAA.

34
b a
P A RTJOY C NZGULS D IVQXE WK H M B F
h11^| 11 'I11 |1 'V '|1 'i'i1i EcoRI
0 10 20 30 40 50 60 70 80 90 100 mu
43.5 mu 45 mu
*
>
*
gp41 ORF


Figure 2.1. Position of the gp41 gene on the SfMNPV genomic
map and sequencing strategy. (A) EcoRI restriction map of
the SfMNPV-2 genome (Maruniak et al., 1984). (B) Detailed
physical map of EcoRI-S fragment. The gp41 999 bp open
reading frame is indicated by the bold arrow under the map.
The small arrows below the map indicate the extension and
direction of the sequence using T7 or SP6 primers or
specific primers indicated by an asterisk.

35
Transcriptional Analysis of the GP41 Gene
Northern blot analysis of total RNA from infected cells
isolated from 3 to 48 h p.i. is shown (Fig. 2.2). Two mRNAs
of approximately 1.6 and 2.8 kbp were detected after 12 h
p.i. and remained detectable at 48 h p.i. when the SfMNPV
EcoRI-S fragment containing the gp41 coding region was used
as a probe.
Primer extension analysis was used to identify the
transcription start site. A 20-mer oligonucleotide,
corresponding to the complement region of the coding
sequence from nucleotides 104 to 123, was used. Three
transcription start sites were located (Fig. 2.3). Two of
the transcription start sites were located at -42 and -41
nucleotides from the ATG translation start codon within the
first T and second A of the TAAG consensus motif (Fig. 2.3).
Another transcriptional start site was located at nucleotide
-140 from the ATG start codon for which no consensus motif
has been determined (Fig. 2.3).

36
..... INFECTED CELLS
'y, (h p.L)
(kb) M C 3 8 12 24 48
Figure 2.2. Northern blot analysis of gp41 gene
transcripts. Total RNA was extracted from uninfected Sf-9
cells (lane 2; C, the uninfected cell control) and SfMNPV
infected Sf-9 cells at 3, 6, 12, 24 and 48 p.i. (lane 3 to 7
respectively). The gp41 gene transcripts were detected with
a 32P-labeled SfMNPV EcoRI-S DNA fragment. 1 kb ladder
standard (in kilobase) is shown on the left side of the blot
(Lane 1; M, the size marker).

Figure 2.3. Primer extension analysis of gp41 gene
transcripts. Total RNA extracted from SfMNPV infected Sf-9
cells at 48 hr p.i. was mixed with the primer 5'-
GACGTAATCGACACATTTGT-3'. The cDNAs were synthesized using
Maloney murine leukemia virus reverse transcriptase and were
separated on a 6% sequence gel. Three transcription start
sites were identified (lane 5; P, the primer extension
product). The TA transcription start sites were within the
TAAG motif. The upper T transcription start site was not
associated with any known motif. The complementary sequence
ladder is shown on the left side as the sequence order G, A,
T and C.

38
Amino Acid and Nucleotide Sequence Comparison of SfMNPV-2
with Other Baculoviruses
The amino acid and nucleotide sequences of the S.
frugiperda gp41 gene were compared with three other NPV gp41
genes including A. cali fornica MNPV (AcMNPV-E2), Bombyx mori
MNPV (BmMNPV) and Helicoverpa zea SNPV (HzSNPV) (Table 2.1).
Table 2.1. Amino acid sequence similarities and nucleotide
sequence identities (%) of gp41 structural protein*.
BmMNPV
HzSNPV
SfMNPV-2
AcMNPV-E2
96
75
72
(96)
(60)
(59)
BmMNPV
75
74
(59)
(59)
HzSNPV
76
(62)
k
Bold and normal lettering in parentheses denote amino acid
sequence similarities and nucleotide sequence identities,
respectively.
At the nucleotide level, the sequences of the NPVs had an
average of 60% identity among them except for AcMNPV-E2 and
BmMNPV which shared a much higher identity (97%). However,
at the amino acid level, the predicted polypeptide sequences

39
were more conserved (70% similarity). Kyte-Doolittle (1982)
and Goldman (reviewed by Engelman et al., 1986) analyses
were performed to compare the distributions of hydrophilic
and hydrophobic domains among the four NPV proteins.
AcMNPV-E2 and BmMNPV had almost identical hydrophobicity
patterns, while SfMNPV-2 and HzSNPV showed a similar
hydrophobicity pattern overall (Fig. 2.4). In general, the
hydrophobic profiles of all four NPVs were similar within
amino acids 100 to 340 of AcMNPV-E2 and BmMNPV and amino
acids 40 to 280 of SfMNPV-2 and HzSNPV (Fig. 2.4). The
predicted amino acid sequences of all four NPVs were
compared to show the conserved regions (Fig. 2.5). Sixteen
conserved regions (defined as more than three contiguous
amino acids being the same) were found within the whole
sequence alignment. Within the 50 to 350 amino acid
comparison region, 9 of 14 prolines were conserved among the
NPVs.
In addition to the comparison of amino acid sequences,
the nucleotide sequences of the upstream region from the ATG
translation codon of the four NPVs were compared. The
sequence alignment around the late gene transcriptional
consensus motif from -52 to -46 nucleotides of all four NPVs

40
AcMNPV
BmMNPV
MoMc
Milk
HzSNPV
SfMNPV
Motlc
Milk
Figure 2.4. Comparison of hydrophilic-hydrophobic profiles
among the homologous gp41 proteins. The solid line is done
by Kyte-Doolittle (1982) analysis and the dash line is done
by Goldman et al. (review by Engelman et al., 1986)
analysis.

41
AcMNPV-E2
ACMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
1 60
MTDERGNFYY NT-PPPLRYP SNPATAIFTS AQTY-NAPGY VPPATVPTTV ATRDNRMDYT
P N ....N K. .
MS
MAN. .
ACMNPV-E2
AcMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
61 120
SRSNSTNSVA IAPYNKS-KE PTLDAGESIW YNKCVDFVQK IIRYYRCNDM SELSPLMILF
- H.
LPHAV.TALQ HQQHQ.QLQ. SSS.. T Y.ER ...F..T... .H.T.Q..ML
RPNSI.K.-- STMSSS.LSS SSSA.ITEP. MD....Y.N. .V....T... .Q.T.Q.LNL
121 180
AcMNPV-E2 INTIRDMCID TNPISVNWK RFESEETMIR HLIRLQKELG QSNAAESLSS DSNIFQPSFV
AcMNPV-HR3
BmMNPV N G P A...
HzSNPV L.VE SH D.D.NL.K HYS . R . . G.EV. -E
SfMNPV-2 NV..E .Y.VD..AT. . D DVNLMN NYK NKPIT -.D..KA...
181 240
AcMNPV-E2 LNSLPAYAQK FYNGGADMLG KDALAEAAKQ LSLAVQYMVA EAVTCNIPIP LPFNQQLANN
AcMNPV-HR3
BmMNPV S
HzSNPV Y.V..S K. .ENVS G.SVS. .HE .GE.L..QI. ...AS.T VRH..V.T
SfMNPV-2 YSV..S K.G.H.A SGSVE. .RH .GY.L..QI. Q...T.T D D
AcMNPV-E2
ACMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
241
YMTLLLKHAT
LPPNIQSAVE S RRFPH
INMINDLINA
VIDDLFAGG-
300
GDYYHYVLNE
.I....QR.N
.L....QR.N
I...V.D..S .KY.T
I.T... ElIN .GNRTHGNSR
L. I N
VH...A...N
....V.T.VY
.N..Y
S...L
AcMNPV-E2
AcMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
301
KNRARVMSLK
ENVAFLAPLS
ASANIFNYMA
ELATRAGKQP
SMFQNATFLT
360
SAANAVNS PA
I . .
IVT..
. IG
.G....N
APSS--.GSN
T.KS.IL. .
. .ISYM. . .
.TT....FI.
T. ,
,.NS..K.
V.
.S.SM..
MPLT--KPV-
AcMNPV-E2
AcMNPV-HR3
BmMNPV
HzSNPV
SfMNPV-2
361
AHLTKSACQE
.R.IRRP
.R.IRLP
VEQNRTS..Q
VSES.NV..Q
418
SLTELAFQNE TLRRFIFQQI NYNKDANAII AAAAPNATRP NTKGRTA*
LI*
LI*
A. .Y. .KL S.KQNY*
Q E.. A L S.KN.ISQL*
Figure 2.5. Comparison of the amino acid sequence of four
NPV gp41 proteins. The one-letter code designation is used.
The hyphens denote the gap filled by the computer program.
The dots denote identical amino acids. The abbreviation for
the viruses are described in the text.

42
was identical (Fig. 2.6). Another late gene transcriptional
motif from -20 to -17 was identified in AcMNPV-E2 and
BmMNPV; however, this consensus region of SfMNPV and HzSNPV
was changed by one or two nucleotides.
-99
-40
ACMNPV-E2
TAATTTTGTT
AATTTTATTA
TCGCTTTTTT
GT CACAACAA
CTATATTATA
AGTAATCCGT
BmMNPV
HzMNPV
.C...A.A..
C GA. .
.TAT.G.A.G
TGA
T G. .
. . -G. . .A
SfMNPV
. T CG .
...GA....C
.T...A.A.C
TAA....T..
T G. .
AA
AcMNPV-E2
-39
ATATTGAGTT
TTGTAATCAT
AAGAGTACAA
1
ATAAAAAGTA
TG
BmMNPV
G
A
TG
HzMNPV
CG..AA.T.A
C...CCA..C
..ATTG.T..
. T T. A
TG
SfMNPV
.A....TT.A
C..CCC....
..A.AACAC.
A
TG
Figure 2.6. Computer alignment of the DNA sequence flanking
the gp41 structural protein genes of AcMNPV-E2, BmMNPV,
HzSNPV and SfMNPV-2. The TAAG consensus sequences are
underlined or double underlined. The translation start
codon ATG sites are denoted in bold and italic letters.
Discussion
A unique feature of the NPV life cycle is the
production of two virion phenotypes: the occluded virion
(OV) and extracellular virus (ECV). The biophysical,
biochemical and morphological characteristics between the OV
and ECV are quite different. These structural differences

43
may play a functional role in their biological properties.
During the viral infection, one of the virus-encoded
envelope glycoproteins, gp64, is expressed and involved in
the host cell infection. The gp64 protein is a component of
the virion peplomers which are only detected in the ECV and
are essential for entry of ECV into the cells by adsorptive
endocytosis (Keddie & Volkman, 1985) In contrast to gp64,
gp41 is only associated with OV. The gp41 structural
protein was found exclusively in enveloped OV but not in
either ECV or enveloped stripped OVs (Whitofrd & Falunker,
1992a). Currently, the biological function of gp41 is not
known, but gp41 may be involved in facilitating the
occlusion of virions in the polyhedra or the infection of
host midgut cells according to their biochemical
characteristics.
In this study, we presented the nucleotide sequence and
transcriptional analysis of the SfMNPV-2 gp41 gene. The
nucleotide sequence of the SfMNPV-2 gp41 gene shows a
different degree of homology with the three other NPVs
including AcMNPV-E2, BmMNPV and HzSNPV (Table 1). The
nucleotide sequence identities of SfMNPV-2 and the other
NPVs were low (60%). Similar results have been reported

44
when the DNA homology was compared among four different
Spodoptera sp. including S. exempts, S. exigua, S.
frugiperda and S. littoralis. SfMNPV is considered
distantly related (20-30%, reassociation kinetics) among
those NPVs (Kelly, 1977). The molecular biology approach
based on the polyhedrin gene phylogenetic tree also
suggested that the SfMNPV is distantly grouped from the
AcMNPV and BmMNPV (Zanotto et al., 1993). The results
showed that the SfMNPV diverged earlier from these other
NPVs, whereas the DNA homology of the gp41 gene of AcMNPV
and BmMNPV is almost identical (97%). Comparing these
results to those found in the polyhedrin gene analysis
suggests that AcMNPV and BmMNPV are very closely related
species (Rohrmann, 1986; van Strien et al., 1992).
When the hydrophilic and hydrophobic profiles of the
gp41 polypeptide of SfMNPV-2 were compared with other NPVs,
the SfMNPV-2 showed an overall pattern similar to that of
HzSNPV. The amino acids 40-to 280 of AcMNPV-E2 and BmMNPV
showed an identical hydrophobic pattern with amino acids 100
to 340 of HzSNPV and SfMNPV-2. The high hydrophilicity of
the carboxyl terminal of the plO gene has been reported and
shows that it displays a functional domain which is exposed

45
at the surface of the protein. The hydrophobic region in
the middle of the plO protein may play a bundling or cross-
linking function (van Oers et al., 1993) The amino acid
sequences of the gp41 polypeptide of these NPVs were
compared to reveal the conserved sequence regions (Fig.
2.5). These conserved amino sequences may play an important
role to be a functional domain since no amino acid change
was found in those regions. Specifically, these regions
containing the proline and cysteine may be involved in
maintaining the gp41 polypeptide conformation. In addition
to these conserved regions, the alignment of the first 50
amino acids between AcMNPV and BmMNPV were identical.
Also, the last 368 to 393 amino acid sequences between
SfMNPV-2 and HzSNPV were almost identical (Fig. 2.5). These
data suggest that the SfMNPV-2 and HzSNPV may have evolved
from a common ancestor, and that the AcMNPV and BmMNPV
diverged from another distantly related ancestor.
By northern blot analysis, two gp41 gene transcripts
were found after 12 h p.i. These data confirm the data
previously shown, that the gp41 gene is a late gene product
(Whitford & Faulkner, 1992b; Ma et al., 1993). One of the
transcripts was 1.6 kb and another was 2.8 kb long.

46
According to the DNA sequence, the distance between the gp41
gene transcriptional start site to poly(A) signal is 1,433
nucleotides. By adding the poly(A) tail (a poly(A) tail
usually contains 200 bases), the estimated size of the gp41
gene transcript was about 1.6 kb. On the other hand, the
2.8 kb transcript did not fit the transcription termination
stop signal principle. One explanation for the 2.8 kb
transcript is the poly(A) signal which was located 394
nucleotides downstream from the translation stop codon was
bypassed. This phenomena of ignoring the major
transcriptional stop signal has been reported both in the
gp41 gene (Whitford & Faulkner, 1992b) and in the p39 capsid
gene of AcMNPV (Thiem & Miller, 1989). Another explanation
for the two different size transcripts is that the 1.6 kb
transcript was a spliced product from the 2.8 kb RNA.
However, this explanation is not favored because the gp41
gene coding sequence does not seem to be separated into two
regions. The gene splicing is not a common phenomena in
baculoviruses except for the IE1 or IEO (Kovacs et al.,
1991). The 2.8 kb transcript was also acknowledged that
could be a transcription product of the gene other than gp41
since the SfMNPV EcoRI-S fragment was used as a probe.

47
Totally four potential open reading frame were identified
within the SfMNPV EcoRI-S fragment.
By primer extension analysis, the transcription start
site for the gp41 gene mRNA of SfMNPV-2 was mapped in the
promoter region within the TAAG motif at approximately
nucleotide -42 or -41 (T or A). This motif is conserved in
all baculovirus late genes, especially the baculovirus
structural proteins (Rohrmann, 1986; 1992; Rankin et al.,
1988). However, another transcriptional start site was
located at the -140 nucleotide for which no consensus motif
has been determined. The phenomenon in which the
transcription start site is dissimilar to a late gene
consensus motif is also found in the AcMNPV p74 gene (Kuzio
et al., 1989). Another explanation for the difference could
be a non-specific primer hybridization, since the
baculoviruses contain a large DNA genome.
An unexpected small ORF was located downstream of the
-140 nucleotide transcriptional start site, and the -140
nucleotide transcriptional start site may be used for a
bicistronic transcription. Similar bicistronic transcripts
have been reported by Kovacs et al. (1991). A translational
regulation mechanism is proposed in that paper since the

48
translation of the downstream ORF is more efficient compared
to the upstream ORF. The upstream ORF may be used for
increasing the translation initiation activity. At the same
time, Ooi and Miller (1991) suggest an antisense RNA
mechanism for transcriptional regulation, which may be used
to turn off a 3.2 kb RNA initiation. In the transcription
of the gp41 gene, the upstream ORF may be used as a
competition inhibitor to control the gp41 gene
transcription. However, a bicistron model could not be
excluded even though the upstream transcriptional start site
is not a common transcriptional start site for baculovirus
late genes. A site specific mutation at the upstream
transcription start site can help elucidate if this
transcription start site is involved in the gene regulation
of gp4l.
Kool et al. (1994) sequenced the AcMNPV-E2 EcoRI-C
fragment and found an extra G residue which is close to the
end of the gp41 gene coding region when comparing it with
the data published by Whitford & Faulkner (1992b). These
results were confirmed by the recent data of Ayres et al.
(1994). The differences in the gp41 gene sequences of
AcMNPV may be caused by using a different strain. The

49
results from Kool et al. (1994) and Ayres et al. (1994) not
only enlarge the gp41 protein by 65 amino acid sequences but
also increase the homology with HzSNPV and SfMNPV at the C-
terminal regions (Fig. 2.5). These data provide new
information showing the possible evolutionary path of the
gp41 gene and by comparing these data, the evolutionary
relationship of baculoviruses may be inferred.

CHAPTER 3
NUCLEOTIDE SEQUENCE, AMINO ACID SEQUENCE AND GENOMIC
STRUCTURE ANALYSIS OF THE GP41 GENE REGION AMONG FIVE
NUCLEAR POLYHEDROSIS VIRUSES
Introduction
Anticarsia gemmatalis MNPV (AgMNPV) belongs to the
genus Nucleopolyhedrovirus (family: Baculoviridae) with a
133-kbp, closed-circle double-stranded DNA genome (Murphy et
al., 1995). The virus has been applied as a commercial
insecticide on a large scale to control the soybean pest, A.
gemmatalis (velvetbean caterpillar), in Brazil (Moscardi
1989). In addition to the successful field application, the
AgMNPV has undergone a series of comprehensive laboratory
studies including the construction of the genomic map
(Johnson and Maruniak, 1989), the nucleotide sequence of the
polyhedrin gene (Zanotto et al., 1992), and the
identification and sequence of a variable region, homologous
region 4 (hr-4) (Garcia-Maruniak et al., 1996).
The gp4l structural protein is a major occluded virion
(OV) glycoprotein of baculoviruses (Maruniak, 1979). The
50

51
monoclonal data indicate the gp4l is associated with OV, but
not with the purified nucleocapsid nor with the budded
virion (BV) (Whitford & Faulkner, 1992a; Ma et al., 1993).
The location of the gp4l protein is predicted to be the
tegument between the envelope and the capsid (Whitford &
Faulkner, 1992a). However, the biological function of the
gp4l protein is still unknown because of the unsuccessful
selection of the recombinant mutants, which suggested the
gp4l may be an essential gene.
Recently, the developments of bioinformatic analysis
bring a new aspect for studying gene function in terms of
using the primary nucleotide and/or amino acid sequence to
predict the biological function of a protein. Several
computer programs are available through public access
including a protein secondary structure analysis program
that shows more than 70% accuracy (Rost and Sander, 1993), a
transmembrane domain prediction program (Jones et al.,
1994), an O-glycosylation sites prediction program (Hansen
et al. 1995), and a three dimensional structure protein
comparison program (Madej et al., 1995). These computer
programs provide theoretical data before the laboratory data
is obtained, and are also useful for designing laboratory

52
experiments.
In this study, the gp4l nucleotide sequence of AgMNPV-
2D was compared with the nucleotide sequences of Autographa
californica MNPV (AcMNPV) (Kool et al., 1994), Bombyx mor
MNPV (BmMNPV) (Nagamine et al., 1991), Helicoverpa zea SNPV
(HzSNPV) (Ma et al., 1993) and Spodoptera frugiperda MNPV-2
(SfMNPV-2) (Liu & Maruniak, 1995) gp4l regions to understand
the relationship of AgMNPV-2D with other NPVs. A protein
secondary structure analysis was done based on different
computer programs to predict the potential motifs
responsible for the biological function of the gp4l protein.
Lastly, the genomic structure of gp4l gene regions among
five different NPVs was compared to provide some indications
of the phylogenetic relationships.
Methods
Virus and Cell Culture
The AgMNPV-2D isolate (Maruniak, 1989) was used as the
virus source and propagated in the Sf-9 (S. frugiperda, fall
armyworm) cell line (Luckow & Summers, 1988). The Sf-9 cell

53
line was maintained at 27C in TC-100 medium with 10% fetal
bovine serum (Life Technologies).
DNA Cloning and Sequencing
Southern blot hybridization was employed to locate the
gp4l gene of AgMNPV-2D. A DNA fragment of SfMNPV-2 within
the gp4l gene (described in Liu & Maruniak, 1995) was
labeled with ^^p- [dCTP] using a nick translation kit (United
States Biochemical Corp.), and used as a probe. The AgMNPV-
2D gp4l gene was first mapped to the 9 kbp HindIII-C
fragment (Fig. 3.1). Subsequently, the gp4l gene was
localized within a 3.5 kb Pstl-Hindlll fragment (at 49.8 -
52.4 map unit, m.u.) which was cloned into the pGEM7Zf(+)
plasmid (Promega Corp.). A series of exo-nuclease deletion
subclones was constructed for sequencing purposes using the
Erase-a-Base system (Promega Corp.). A modification of
experimental protocol was made to precipitate the exo
nuclease-digested DNA before the next step of DNA ligation,
because an incomplete inhibition of exo-nuclease was found
when the manufacturer's instructions were followed. The
extra DNA precipitation step was introduced between the SI

54
AgMNPV
polh
xp Q.RS.uv
G JTUV B K D RS C E OH W A I F N LM
11 Mil I HHI 1 tt-H Hhm
44.95 mu 52.42 mu
9 kb
Hindlll Smal BglllPstl Bglll EcoRI Hindlll
1.005 kb
gp41 ORF
Figure 3.1. Position of the gp41 gene on the AgMNPV-2D
genomic map. The gp41 1,005 kb open reading frame is
indicated by the arrow under the map. Notice the gp41 gene
and polyhedrin gene have the same transcription direction
that is from right to left in the conventional map.

55
nuclease digestion and Klenow enzyme treatment. The dideoxy
nucleotide chain-terminator method was performed for DNA
sequencing, and the DNA sequence gap between different
deletion subclones was completed using synthesized oligo
nucleotide primers. Two different sequencing kits were
used: the Sequenase Version 2.0 DNA Sequence Kit with
Sequenase polymerase (United States Biochemical Corp.) and
fmol DNA Sequencing System with Taq DNA polymerase
(Promega Corp.).
Computer Analysis
The Wisconsin Sequence Analysis Package (Version 8.1,
VMS; Genetic Computer Group) was used for comparing the
nucleotide sequence and amino acids sequence identities
(GAP), generating the multiple sequence alignment (Pileup),
and plotting the hydrophobicity profile (Pepplot). The
Blast program (Altschul et al., 1990) was used to search the
GenBank and SwissProt data banks for the homologous
nucleotide sequences and amino acid sequences through the
e-mail service (Appendix B) at the National Center for
Biotechnology Information (NCBI, USA). The protein
secondary structure prediction program (Rost and Sander,

56
1993) was available through the Internet server (Appendix B)
at the European Molecular Biology Laboratory (EMBL:
Heidelberg, Germany). The transmembrane domain analysis
program (MEMSAT) is a freeware (Jones et al. 1994), and the
O-glycosylation site prediction program (Appendix B) was
accessed through the Internet server (Hansen et al., 1995) .
For phylogenetic analysis, the MEGA program was used to
construct the phylogenetic tree of the gp4l gene (Kumar et
al., 1993). Both the nucleotide sequences and amino
sequences were used. The p-distance and neighbor-joining
methods were chosen to generate the phylogenetic tree based
on amino acid sequences. For the phylogenetic tree based on
nucleotide sequences, the p-distance and maximum parsimony
method were used.
Results
DNA Sequencing of the GP41 Region
The complete nucleotide sequence of the Pstl-Hindlll
fragment resulted in 3,517 nucleotides (Appendix C) and has
been deposited in GenBank under the accession number U37728.
An interesting phenomenon was observed during the DNA

57
sequencing. When the fmolTiy! DNA sequencing system was used
for DNA sequencing, one inconsistent nucleotide pair was
always found (three repetitions) at nucleotide 1,116, C
versus T, from the gp4l coding strand and non-coding strand
The data were confirmed by the Sequenase sequencing system
which showed this specific nucleotide pair should be C/G.
No specific secondary structure of DNA was found around the
nucleotide at 1,116.
An open reading frame (ORF) of 1,005 nucleotides was
identified containing the gp4l gene from nucleotide 669 to
1,673. The transcriptional direction of this gene was
oriented from right hand to left hand (relative to the
AcMNPV polyhedrin gene) in the conventional genome map (Fig
3.1). Two NPV late gene motifs (TAAG) were found at -17 to
-20 and -48 to -51 nucleotides from the protein translation
initiation site (ATG) respectively. A transcriptional stop
signal AATAAA was found downstream at nucleotide 745 from
the translation stop site (TGA). In additional to the
transcriptional motifs, the translation start site fits the
Kozak principle of AXXATG(A/G) (Kozak, 1986). When the
nucleotide sequence and translated amino acid sequence were
compared with four other published NPVs gp4l gene sequences

58
using the GAP program obtained from the GCG package, more
than 59% nucleotide sequence identities and more than 69%
amino acid sequence similarities were found (Table 3.1).
In addition to the gp4l ORF, several ORFs of AgMNPV-2D
were found inside the 3.5 kbp sequence region. The AgMNPV-
2D ORF 1062 was identified to have a high homology with the
AcMNPV vlf-1 gene. The AgMNPV-2D vlf-1 gene was then
compared with the vlf-1 of AcMNPV, BmMNPV, the ORF >300 of
SfMNPV-2 and the ORF >195 of HzSNPV. The results presented
a nucleotide homology of 76, 77, 63, and 65% respectively
and amino acid similarity of 91, 90, 78 and 66%
respectively (Table 3.1).
Other than the vlf-1 gene, two potential ORFs (ORF 330
and ORF 300) were found at nucleotides, 1,804 2,103 and
2,100 2,429 respectively. The ORF 330 of the AgMNPV-2D
was compared with the ORF 330 of AcMNPV, ORF 330 of BmMNPV,
ORF 348 of SfMNPV-2, and ORF 330 of HzSNPV and showed high
nucleotide homologies of 68, 65, 58, and 57% respectively
(similarity of amino acid sequences of 78, 80, 60, and 64%
respectively; Table 3.1). The data suggested there were
minimal (50-60%) homologies and similarities among these
analyzed NPVs. Meanwhile, the AgMNPV-2D ORF 300 showed

59
Table 3.1. Precentage of the nucleotide sequence identities and amino acid
sequence similarities of the ORFs within the gp41 gene region".
BmMNPV
SfMNPV
HzSNPV
AgMNPV
vlf-1
AcMNPV
97
65
65
76
X714151
(99)
(80) 2
(71)
(91)
BmMNPV
67
61
77
L331801
(80) 2
(71)
(90)
SfMNPV


63
63
U147251
(73) 2
(IB)2
HzSNPV
65
L047471
(66)
ORF 327
AcMNPV
95
51
55
68
(96)
(56)
(64)
(78)
BmMNPV
53
54
65
(59)
(64)
(80)
SfMNPV


54
58
(61)
(60)
HzSNPV
57
(64)
ORF 312
AcMNPV
99
70
(100)
(75)
BmMNPV
70
(75)
gp41
AcMNPV
98
59
60
70
(96)
(70)
(75)
(82)
BmSNPV
59
60
74
(72)
(74)
(80)
SfMNPV
75
58
(62)
(69)
HzMNPV

59
(71)
ORF 699
AcMNPV
94
58
54
69
(97)
(10) 2
(70) 2
(80) 2
BmMNPV

59
55
68
(70) 2
(70) 2
(81) 2
SfMNPV

58
58
(12) 2
(68) 2
HzSNPV

53
(71) 2
Bold and normal lettering in parentheses denote nucleotide sequence
identities and amino acid similarities, respectively.
'GenBank accession number. The sequence of AgMNPV gp41 gene region has
been deposited under U37728.
incomplete ORFs were used for amino acid sequence comparison.

60
homologies with ORF 312 of AcMNPV and BmMNPV (70% homology
and 75% similarity; Table 3.1). However, there were no
homologous sequences found between the AgMNPV-2D ORF 300
with the SfMNPV-2 and HzSNPV gp41 regions.
In addition to the intact ORFS, one partial ORF > 667
was found at nucleotides 1-667 which had moderate nucleotide
sequence homology (69%) but high amino acid similarity (80%)
with AcMNPV ORF 699. When the partial ORF >667 of the
AgMNPV-2D was compared with the ORF 699 of AcMNPV, ORF 702
of BmMNPV, ORF >258 of SfMNPV-2 and ORF >299 of HzSNPV, the
results indicated a nucleotide homology of 69, 68, 58, and
53% respectively and an amino acid similarity of 80, 81, 68,
71% respectively (Table 3.1).
Phylogenetic Analysis
Based on the nucleotide sequences and translated amino
acid sequences, a phylogenetic tree of the gp41 gene (Fig.
3.2) was generated by the Pileup program (GCG package) and
MEGA package (Kumar et al., 1993). The results showed that
AcMNPV and BmMNPV were closely related. Subsequently,
HzSNPV and SfMNPV-2 were grouped into a branch and AcMNPV,
BmMNPV and AgMNPV-2D were grouped into another branch.

61
J03
J32
J76
,197
JI_ AcMNPV
~BmMNPV
AgMNPV
- HzSNPV
SfMNPV
(B)
,113
,015
,019
,117
AcMNPV
-BmMNPV
,164
,008
,222
HzSNPV
-AgMNPV
SfMNPV
Figure 3.2. Phenogram of the divergence among five NPVs
based on the (A) nucleotide sequences and (B) the amino acid
sequences of the gp41 genes. The number on the top of lines
represents the distance between each NPV or to the branch
point.

62
Protein Hydrophobicitv Profile Analysis
Figure 3.3 shows the hydrophobicity profile and the
conserved hydrophobic domain of gp41 protein among five NPVs
(Kyte & Doolittle, 1982) Five conserved hydrophobic
domains were assigned arbitrarily based on the similarity of
hydrophobic pattern among five NPVs.
Protein Secondary Structure Analysis
The amino acid sequence alignment showed (Fig. 3.4) two
cysteines and nine prolines were found conserved among five
different NPVs. The secondary structure analysis showed
eight potential a-helixes, four loops and one P-sheet.
Several conserved domains were found inside these specific
secondary structures. Most of the conserved domains were
found in the middle of the gp4l amino acid sequences. The
amino and carboxyl terminals were highly variable.
No N-glycosylation sites, Rx(S/T), were presented in Fig.
3.4, because the gp4l protein has been reported as an 0-
linked glycoprotein. However, no consensus
0-glycosylation sites were predicted by the aligned

63
Figure 3.3. Hydrophobicity profile of the gp41 protein among
five different NPVs. Conserved hydrophobic domains I-V were
arbitrarily assigned (see text for details).

64
l 50
AcMNPV MTDERGNFYY NT-PPPLRYP SNPATAIFTS AQTY-NAPGY VPPATVPTTV
BmMNPV P N....N
AgMNPV -MN..DG..L .VSQA.A.H. FA.TS.TV.. S. --SGNY...M
HzSNPV MS L. HA.
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
51
100
a-helix
ATRDNRMDYT SRSNSTNSVA IAPYNKSKEP TLDAGESIWY NKjCVDFVQKI
K. .-
S.MVQ.T.-- --RG.A. .LV .T..DA--S
T.ALQHQQHQ KQLQESS.-- .T ..
MSS .SLS.SS --A.ITEP.MD.
T.Y.H..
..Y.ER.
..Y.N..
S W- -KjC-D-V- -1
@
101 150
a-helix
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
@ *
[RYY^CNDMS ELSPLMILFI NTIRDMCIDT NPISVNWKR FESE ETMIRH
.H.
.N.
. F.
/. .
R-Y
T. . .H S .V. . II. VQTE
.T.... H.T.Q..ML L.VES H D.E
.T.... Q.T.Q. LNL NV. ET Y. VD . AT. . D.
i-NDMS -L-P-M 1 NTIR--C -P--VN--KR
evn:
EIV. .
NEi. K.
XiMNN
151
200
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
LIRLQKE4GQ SNAAESLSSD SN
. G P. .
loop
(X- helix
LFQPSFVL NSEPAYAQKF YsTGGVDMLGK
. G . .
YS..R..
YK
L-KE
R. NSV...ID.. .
.G .EV. EN
.N KPIT .D
Y .V
.KA...Y SV
ttF--SFV- --U
..A.T...
K.AENVSG
K.G.HLAS
P-YAQKF YN-G
Figure 3.4. Alignment of the amino acid sequences of the
gp41 protein among five different NPVs. CONS represents the
consensus sequence. The dots indicate the gap and the
dashes indicate the gaps or non-conserved sequences (for
CONS sequence). The conserved proline sites are denoted by
the symbol and the conserved cysteine sites are denoted by
the @ symbol. Specific secondary structure domains were
labeled inside the boxes, and the transmembrane domain is
highlighted by double underlines.

65
250
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
201
k-helix loop a-helix
DALAEAAKQL SLAVQYMVAE AV
S .
rcN
IPIPL P
7N
2QLANNY MTLLLKH
ATL
.SVS...HE. GE.L..QI..
GSVE...RH. GY.L..QI.Q ..
EAA--L --A-QY -V
IS.
.T.
r
r
-PIPL P
JR
.D
V R
3..V.T. I....QR
D. L. . QR
-QL-N-Y -TLLL--
. NI
. NI
A--
-*
251
a-helix
.E.V.E..
...V.D..
N-Q---
loop
a-helix
K.
S.
.s.v.. .
.KY.TL .I.
.T...EIIN. 3NRTHGNS RV HM . A. . N
-S
PEfNIQSAVjES RRFEHI NMINDLINAV IDDLF\GG-G DYYHYVIjNEK
.Y.
.S.
.N.
...-. N.
. V. [T. VY. N.
. -S .
-- --IN-LIN-V IDD-F-G -Yf-YVENEK
Y. .
Y. .
L. .
301
a-helix
350
transmembrane domain
NRARVMSKE NVAFLAPLSA SANIFNYMAE LATRAGKQPS MFQNATFLTS
. I.
. KS
N- -
. .VG.
. IVT.
. IL. .
R 1
.D.
SQ
.H..R.D ..E..A.
. IG TD.
. ISYM TT. .
KE N APLSA

-IF
J. N R. L. .G. . .NA
. FJ.T ...NS..K.. V..S.SM..M
--- LAT--GK-P- -F--A--L--

351
400
loop
AANAVNSPAA H3TKSACQES LTELAFQNET LRRFIFQQIN YNKDANAIIA
. R IRLPL I*
.1 I
-NGSNV E 2NRTS ..Q A...Y...
-KPV-V S3S.NV. .QQ E..A L.
KLS
.LS
.KQNY*
.KN.ISQL*-
401 417
AAAPNATRPN TKGRTA*
Figure 3.4. Continued.

66
sequences. One potential transmembrane segment was found
close to the carboxyl end with a consensus sequence of
ENX4APLSAX3IFX using the transmembrane domain prediction
program.
Genomic Structure Analysis
The genomic structures of the gp4l gene flanking
regions of the AgMNPV-2D were analyzed (Fig. 3.5). When the
whole gp4l gene regions of five NPVs were aligned, they
showed similar genomic structures and transcriptional
orientations (relative to the transcription direction of the
AcMNPV polyhedrin gene) with the exception of HzSNPV. In
general, the gp4l gene regions were located at m.u. 45 to
52, but the gp4l gene region of HzSNPV was located at m.u.
96.5 to 97.6. Also, the transcriptional direction of all
the ORFs of HzSNPV is opposite to other NPVs.
Discussion
In summary, the nucleotide sequence of the gp4i gene
region of the AgMNPV-2D was sequenced. Several ORFs were

67
AcMNPV
47,6 mu
50.4 mu
Vlf-J
BmMNPV
45.3 mu
ORF327 VRF312
gp41
ORF 699
48.2 mu
Vlf-1
AgMNPV
49,8 mu
ORF330 VRF312 gp41
ORF 702
52.4 mu
Vlf-1
SfMNPV
ORF 330 VRF300 gp41 ORF >667
45.3 mu
45,0 mu
HzSNPV
ORF >300 ORF 348
(vlf-1)
gp41 ORF >258
96,5 mu
97.6 mu
ORF>299 gp41 ORF330
ORF 195
(vlf-1)
Figure 3.5. Genomic structure of gp41 gene flanking regions
of AcMNPV, BmMNPV, AgMNPV-2D, SfMNPV-2, and HzSNPV. *
refers to the ORF which was not found in either SfMNPV or
HzSNPV. Note the data of HzSNPV is modified from isolate
HzS-15 which is considered as a genomic rearrangement
isolate (see text for details).

68
identified including the vlf-1 gene, ORF 330, ORF 300, gp4l
gene, and ORF >667. Among these ORFs, the AgMNPV-2D shared
50 to 70% of the nucleotide sequence identities and 60 to
80% of the amino acid sequence similarities with four other
NPVs. However, the AgMNPV-2D ORF 300 did not show
homologies with the gp41 regions of all five NPVs. The gp4l
gene region of SfMNPV-2 and HzSNPV did not contain the ORF
300 homologous sequences. This result may be caused by a
genomic deletion. However, it was not shown whether a
homologous sequence of the AgMNPV ORF 300 was present in a
different genomic region of SfMNPV-2 or HzSNPV.
Furthermore, the homologous sequences of the AgMNPV-2B ORF
300 were searched using the BLAST program and no significant
homologous sequence was found other than the AcMNPV and
BmMNPV ORF 312.
The gp4l gene is a unique gene which is only found in
the OV. However, no biological function has been proved
yet. An attempt to select a recombinant virus with a
deletion in the gp4l gene was not successful. The results
suggested the gp41 gene could be an essential gene and have
influences on both BV and OV even though the gp41 protein is
only found in the OV. If the gp41 gene is an essential

69
gene, a transformed cell line that constantly expresses the
gp41 protein will be needed to complement the gp41 gene when
the gp41 gene deletion mutant is selected. Nevertheless,
several computer programs were used to predict the potential
biological function based on the biochemical
characterization of the gp4l protein.
Four a-helices at consensus sites of 93 to 104, 204 to
222, 244 to 257, and 273 to 284 (CvDyxkliRyY,
EaakqLslAvQYmvaeaV, qQLaNnYxTLLLkr, and IndLINxVIDDl), one
loop domain at 237 to 241, (PIPLP), and one P-sheet domain
at 292 to 295 (YYxYV) were found to be conserved (Fig. 3.4).
The results were confirmed using both the PHD (EMBL) and
Darwin programs (Benner, 1995). One transmembrane domain
was predicted at amino acid sequences of 309 to 328. The
transmembrane domain (Fig. 3.4), was also found to be a
conserved hydrophobic domain (Fig. 3.5). The results
strongly suggested that the gp4l protein is a membrane
protein. The hydrophobic profile revealed five conserved
hydrophobic domains, and region III was also found to be a
conserved a-helix domain. The correlation of the conserved
hydrophobic domains and a-helix may suggest that region III

70
has a specific biological function. An attempt to generate
a three-dimensional (3D) graph using the threading method
(Madej et al. 1995) was not successful because no homologous
sequence against the gp41 protein was found in the PDB
(protein data bank). The crystallographic data of gp41 or a
closely related transmembrane protein will be needed to
generate the 3D graph of the gp4l protein.
In contrast with the gp4l px'otein, the gp64 protein is
only found in the BV. The gp64 is a glycosylated membrane
protein and is involved in cell to cell infection. It has
been proved to be an essential gene for baculovirus
infectivity. Two conserved hydrophobic domains at amino
acid sequences of 220 to 230 and 327 to 338 (TELVACLLIKD and
LNNMMHDLIYSV) were associated with biological function.
Region I is involved in the fusion activity of the gp64
protein, and region II is involved in the oligomerization
and transport of gp64 protein (Monsa & Blissard, 1995).
Also, one transmembrane domain was identified at the
carboxyl terminal. No similarity of amino acid sequence was
found between the gp64 and gp41 transmembrane domain. The
study of the similarities of the secondary structure of the
gp4l and gp64 proteins will provide information for

71
understanding the baculovirus structural proteins.
The AcMNPV vlf-1 gene is a very late expression factor
to regulate the polyhedrin gene transcripts (McLachlin &
Miller, 1994), and is required for strong expression of the
polyhedrin gene in a characterized temperature sensitive
mutant. The translated amino acid sequence showed homology
with a family of integrases, resolvases and RNA helicases
(McLachlin & Miller, 1994) which may be involved in the
interaction with DNA and/or RNA during the transcription.
Unfortunately, the partial ammo acid sequence of SfMNPV and
HzSNPV did not overlap with these specific motifs, and no
further analysis was done because of insufficient
information.
The phylogenetic analysis of the gp4l gene showed the
AgMNPV-2D had a closer relationship to the AcMNPV and the
BmMNPV than to SfMNPV-2 and HzSNPV. This result is
consistent with the DNA hybridization data (Smith & Summers,
1982), in which AcMNPV was found to have low homology with
HzSNPV and SfMNPV (1% relative homology) but moderate
homology with AgMNPV-2D (8% relative homology). Not only
the DNA hybridization data, but also the phylogenetic tree
of baculovirus polyhedrin genes agrees with the phylogenetic

72
tree of the gp4l gene (Cowan et al. 1994; Zanotto et al.,
1993). The results of the phylogenetic tree of the
polyhedrin gene also divided the AcMNPV, AgMNPV-2D, and
BmMNPV into one group and HzSNPV and SfMNPV-2 into another
group.
Overall, the genomic structure of the gp41 gene region
showed that all of the NPVs have similar local ORF
arrangements except HzSNPV. The HzS-15 isolate analyzed in
the present study was described as a rearranged genomic
isolate based on the overall genomic structural comparison
with another HzSNPV isolate, ELCAR (Cowan et al., 1994). .
The gp4l gene of the HzS-15 isolate terminates upstream of
the polyhedrin gene, near m.u. 97. But the gp4l gene of
HzSNPV ELCAR isolate is placed downstream of the DNA
polymerase-related ORF, near m.u. 50, which is far away from
the polyhedrin gene. This explains why the HzS-15 has a
different genomic and transcriptional orientation. The
reason we did not use theisolate ELCAR instead of HzS-15 is
because of the incomplete sequence in the gp4l gene region
(specific for the gp4l gene). When the HzSNPV isolate ELCAR
instead of HzS-15 was compared with four other NPVs, we
found the gp4l gene regions are always located around m.u.

73
45 to m.u. 52. These data indicate that most NPVs still
maintain similar genomic structures even though there is a
mechanism for genomic DNA rearrangement.

CHAPTER 4
PHYLOGENETIC ANALYSIS OF BACULOVIRUSES
Introduction
The evolutionary relationships among baculoviruses have
been predicted using molecular approaches. Until 1996,
three baculovirus genes including the polyhedrin (polh) gene
(Rohrmann, 1986; Zanotto et al. 1993; Cowan et al., 1994),
the DNA polymerase (dnapol) gene (Pellock et al., 1996) and
the ecdysteroid UDP-glucosyltransferase (egt) gene (Barrett
et al., 1995) have been used to reconstruct the phylogenetic
trees. The results based on the polh gene of baculoviruses
(Rohrmann, 1986; Zanotto et al., 1993; Cowan et al., 1994)
suggest that dipteran NPVs and hymenopteran NPVs diverge
from the lepidopteran NPVs and GVs before they split. The
phylogenetic tree of the baculovirus dnapol genes is
reconstructed using six baculoviruses including Autographa
californica MNPV (AcMNPV), Bombyx mori MNPV (BmMNPV), Orgyia
pseudotsugata MNPV (OpMNPV), Choristoneura fumiferana MNPV
74

75
(CfMNPV), Helicoverpa zea SNPV (HzSNPV) and Lymantria dispar
MNPV (LdMNPV) (Ahrens & Rohrmann, 1996), and is generally
comparable to the phylogenetic tree scheme based on the polh
gene. Furthermore, the dnapol genes of two baculoviruses,
AcMNPV and HzSNPV, are compared with two other insect DNA
viruses (Spodoptera ascovirus, SAV, and Choristoneura
biennis entomopoxvirus, CbEPV) (Pellock et al., 1996), and
with human viruses to reveal their evolutionary
relationships. The results suggest that the baculoviruses
have an independent evolutionary pathway from other insect
and human viruses. Phylogenetic analysis of the third
baculovirus gene'(egt) among six different baculoviruses
shows similar topology to the phylogenetic trees of polh and
dnapol genes (Barrett et al., 1995).
Although the molecular approach can be used to
elucidate the evolutionary relationships among
baculoviruses, critics agree that the phylogenetic tree of a
particular gene does not represent the evolutionary pathway
of the whole organism (Li & Graur, 1991) So far, all
baculovirus phylogenetic trees are based on a single gene,
and therefore may not properly represent the evolutionary
pathway of baculoviruses. In the present study, this

76
problem is approached using a congruent analysis (Miyamoto,
1985; Wheeler, 1991). The evolutionary relationship of
baculoviruses is revealed based on multiple phylogenetic
trees of baculovirus genes instead of a single gene. The
congruent results are concluded from six different
phylogenetic trees of baculovirus genes including either
structural proteins (polh, plO, gp64, and gp41) or enzymatic
proteins (dnapol and egt) The results will provide more
solid support for a current hypothesis of baculovirus
evolutionary pathway.
Methods
DNA Purification of LdMNPV
Lymantria dispar MNPV (LdMNPV) DNA (GYPCHEK, U.S.
Forest Service) was purified (Appendix D) from a commercial
preparation of polyhedra and used as a DNA template for PCR
amplification.
PCR Amplification and DNA Sequencing of LdMNPV gp41 Gene
A set of polymerase chain reaction (PCR) primers was

77
constructed to amplify the gp41 gene of LdMNPV. The
oligonucleotide primers were designed based upon the
conserved sequences of gp41 genes from five baculoviruses
including AcMNPV (Kool et al. 1994), Anticarsia gemmatalis
MNPV (AgMNPV) (Liu & Maruniak, unpublished data), BmMNPV
(Nagamine et al., 1991), HzSNPV (Ma et al., 1992), and
SfMNPV (Liu Sc Maruniak, 1995) .
The JM37 upstream primer of the gp41 gene was a 25
nucleotide oligomer with the following sequence:
ACAA(C/T)AA(C/T)TATATTATAAGTA(A/G)TCC. This primer was
located within the transcriptional initiation site region of
the gp41 gene. The JM40 downstream primer was a 21
nucleotide oligomer with the following sequence:
GTTGTAAAA(C/T)TTTTGNGC(G/A)TA. Based on DNA sequence
alignment, the expected size of the PCR product using this
primer set was around 500 base pairs (bp).
The PCR reaction was done in a final volume of 25 p.1
containing 200 j.iM of each dNTP, 4 pmoles of each primer,
2 mM MgCl2, 0.5 units of Primezyme (Biometra), and reaction
buffer (10 mM Tris-HCi, pH 8.8, 50 mM KCl, 0.1% Triton
X-100). A concentration of 100 ng of DNA template (LdMNPV

78
genomic DNA) was used per PCR reaction. Thirty pi of
autoclaved mineral oil was applied to the top of the
reaction mixture to prevent evaporation. The PCR reaction
was performed in a PTC-100 programmable Thermal Cycler
(MJ Research, Inc). The PCR cycle consisted of an initial
denaturation step at 95C for 1 min, followed by 35 cycles
at 94C for 1 min (denaturation), 45C for 1.5 min
(annealing), and 72C for 2 min (extension). The final
extension step had a 15 min duration. The PCR product was
purified through a DNA purification column (QIAquickiIV*,
Qiagen Inc.) to remove salts and enzyme.
The purified PCR product was then cloned into a pGEM-T
vector (Promega Corp.), and sequenced using an automatic
sequencer (ABI 373a) from the DNA Sequencing Core Laboratory
(DSEQ) of the Interdisciplinary Center for Biotechnology
Research (ICBR) at the University of Florida.
Search of Baculovirus Genes through GenBank
The BLAST (Madden et al., 1996) and ENTREZ (Schuler et
al., 1996) programs (Appendix B) available from the National
Center for Biotechnology Information (NCBI, USA) were used

79
to search the homologous sequences of six baculovirus genes.
A list containing the GenBank accession numbers, baculovirus
species names and related references used in the present
work is presented in Table 4.1.
Twenty-three nucleotide sequences of baculovirus polh
genes were found in the GenBank. Three undeposited polh
gene sequences, Anagrapha falcifera MNPV (Dr. Federici,
personal communication), A. gemmatalis MNPV and Neodiprion
sertifer SNPV (Zanotto et al., 1993), were entered manually
into a Micro VAX. computer at the Biological Computing
Facility (BCF) of tne ICBR at the University of Florida.
Table 4.1. List of GenBank accession numbers, baculovirus
species and references for DNA sequences used in the
construction of baculovirus phylogenetic trees.
Accession
number
Baculovirus
species
Reference
Polyhedrin
gene
D00437
Panolis flammea MNPV
(PfMNPV)
Oakey et al., 1989.
J.Gen.Virol. 70:769
D01017
Spodoptera littoralis MNPV
(SpliMNPV)
Croizer & Croizer,
1994. unpublished
D14573
Hyphantria cunea MNPV
(HcMNPV)
Isayama et al., 1993.
unpublished
J04333
Spodoptera frugiperda MNPV
(SfMNPV)
Gonzalez et al., 1989.
Virology 170:160

Table 4.1. Continued
80
K01149
Autographa cali fornica MNPV
(AcMNPV)
Hooft van Iddekinge et
al. 1983. Virology-
131 : 561
M4885
Orgyia pseudotsugata MNPV
(OpMNPV)
Leisy et al., 1986b.
Virology 153:280
M20927
Mamestra brassicae MNPV
(MbMNPV)
Cameron & Possee,
1989. Virus Res.
125:183
M23176
Lymantria dispar MNPV
(LdMNPV)
Smith et al., 1988.
Gene 71:97
M30925
Bombyx mori MNPV (BmMNPV)
Maeda et al., 1985.
Nature 315:529
M32433
Orgyia pseudotsugata SNPV
(OpSNPV)
Leisy et al., 1986a.
J.Gen.Virol. 67:1073
S48199
Spodoptera exigua MNPV
(SeMNPV)
van Strien et al.,
1992. J.Gen.Virol.
73:2813
S68462
Attacus ricini NPV (ArMNPV)
Hu et al. 1993 .
I Chuan Hsueh Pao
20:300
U22824
Penna nuda MNPV (PnMNPV)
Chou et al., 1993.
unpublished
U30302
Leucania separata MNPV
(LsMNPV)
Wang et al., 1996.
unpublished
U40833
Choristoneura fumiferana
MNPV (CfMNPV)
Rieth et al., 1996.
unpublished
U40834
Archips cerasivoranus MNPV
(ArcMNPV)
Rieth et al. 1996.
unpublished
X55658
Malacosoma neustria MNPV
(MnMNPV)
Vladimir & Kavasan,
1990. unpublished
X70844
Buzura suppressaria MNPV
(BsMNPV)
Hu et al., 1993.
J.Gen.Virol. 74:1617
X94437
Spodoptera litura MNPV
(SlMNPV)
Bansal et al., 1996.
unpublished
Z12117
Helicoverpa zea SNPV
(HzSNPV)
Cowan et al., 1994.
J.Gen.Virol. 75:3211
K02910
Trichoplusia ni GV (TnGV)
Akiyoshi et al., 1985.
Virology 141:328

Table 4.1. Continued
81
X02498
Pieris brassicae GV (PbGV)
Chakerian et al.,
1985. J.Gen.Virol.
66:1263
X79569
Cryptophlebia leucotreta GV
(C1GV)
Jehle & Backhaus,
1994. J.Gen.Virol.
75:3667
plO gene
M10023
Autographa californica MNPV
Kuzio et al., 1984.
Virology 139:414
M14883
Orgyia pseudotsugata MNPV
Leisy et al., 1986c;
Virology 153:157
M98513
Choristoneura fumiferana
MNPV
Wilson et al., 1995.
J.Gen.Virol. 76:2923
U46757
Bombyx mori MNPV
Palhan & Gopinathan,
1995. thesis, Indian
Inst.Sci., India
U50411
Perina nuda MNPV
Chou et al., 1996.
unpublished
X69615
Spodoptera exigua NPV
Zuidema et al., 1993.
J.Gen.Virol. 74:1017
X92713
Spodoptera litura NPV
Behera et al., 1996,
unpublished
gp41 gene
D14468
Bombyx mori MNPV
Nagamine et al., 1991.
J. Invertebr.Pathol.
58:290
L04748
Helicoverpa zea SNPV
Ma et al., 1992 .
Virology 192:224
U14725
Spodoptera frugiperda MNPV
Liu & Maruniak, 1995.
J.Gen.Virol. 76:1443
U37728
Anticarsia gemma talis MNPV
(AgMNPV)
Liu & Maruniak, 1996.
unpublished
X71415
Autographa cali fornica MNPV
Kool et al., 1994.
J.Gen.Virol. 75:487
gp64 gene
L12412
Choristoneura fumiferana
MNPV
Hill & Faulkner, 1994.
J.Gen.Virol. 75:1811

Table. 4.1. Continued
82
L33180
Bombyx mori MNPV
Maeda, 1994.
unpublished
M22446
Orgyia pseudotsugata MNPV
Blissard & Rohrmann,
1989. Virology 170:537
M2 542 0
Autographa cali fornica MNPV
Whitford et al., 1989.
J. Virol. 63:1393
X00410
Galleria mellonella MNPV
(GmMNPV)
Blinov et al., 1984.
FEBS Lett. 167:254
DNA
polymerase
gene
D11476
Lymantria dispar MNPV
Bjornson et al. 1992.
J.Gen.Virol. 73:3177
D16231
Bombyx mori MNPV
Chaeychomsri et al. ,
1995. Virology,
206:436
M20744
Autographa californios MNPV
Tomalski et al., 1988.
Virology 167:591
U11242
Helicoverpa zea SNPV
Cowan et al., 1994.
J.Gen.Virol. 75:3211
U18677
Choristoneura fumiferana
MNPV
Liu & Carstens, 1995.
Virology 209:538
U39145
Orgyia pseudotsugata MNPV
Gross et al., 1993.
J. Virol. 67:469
U35732
Spodoptera Ascovirus
Pellock et al., 1996.
Virology 216:146
X57314
Choristoneura biennis
entomopoxvirus
Mustafa & Yuen, 1991.
DNA Sequence 2:39
egt gene
D17353
Orgyia pseudotsugata MNPV
Rohrmann, 1994.
unpublished
L33180
Bombyx mori MNPV
Maeda, 1994.
unpublished
M22619
Autographa cali fornica MNPV
Miller, 1989.
unpublished
U04321
Lymantria dispar MNPV
Riegel et al., 1994.
J.Gen.Virol. 75:829

83
U10441
Choristoneura fumiferana
MNP V
Barrett et al., 1995.
J.Gen.Virol. 76:2447
U41999
Mamestra brassicae MNPV
Clarke et al., 1996.
J.Gen.Virol, in press
X84701
Spodoptera littoralis MNPV
(SlittMNPV)
Faktor et al., 1995.
Virus Genes 11:47
Y08294
Lacanobia olercea GV (LoGV)
Smith & Goodale, 1996.
unpublished
In addition to polh, the nucleotide sequences of plO,
gp41, gp64, dnapol and egt genes were searched. Seven
baculovirus plO genes and five gp64 genes were found. For
the gp41 gene, five complete nucleotide sequences were
obtained from GenBank and two partial sequences of LdMNPV
and Xestia c-nigrum granulovirus (XcGV) (Dr. Goto, personal
communication) were included for further analysis. Five
gp64 and eight egt genes from different baculoviruses were
also included in this study. Finally, dnapol genes of six
baculoviruses and two other insect viruses (Spodoptera
ascovirus, ASV, and Choristoneura biennis entomopoxvirus,
CbEPV) were included for the phylogenetic studies.
Reconstruction of Phylogenetic Trees of Baculovirus Genes
The nucleotide sequences obtained from BLAST and ENTREZ

84
programs were analyzed using the Wisconsin Sequence Analysis
Package (Version 8.1 VMS for VAX computer; Genetic
Computer Group). Amino acid sequences were translated from
the nucleotide sequence. The multiple sequence alignment of
both nucleotide and amino acid sequences were first produced
using the Pileup program. The aligned multiple sequences
were realigned using the CLUSTAL program (Higgins et al.,
1996) because of its accuracy for low homologous sequence
comparison.
MEGA (Kumar et al., 1993) and PAUP (Swafford, 1990)
computer programs were used to reconstruct the phylogenetic
tree based on the final aligned sequences that were produced
by CLUSTAL. The p-distance (proportion distance) and
maximum parsimony methods (Fitch, 1971) were used for
reconstructing phylogenetic trees based on nucleotide
sequence data. The p-distance and neighbor-joining methods
(Saitou & Nei, 1987) were chosen for reconstructing
phylogenetic trees based on the amino acid sequence data.
The bootstrap test with 500 replications was done to show
the reliability of the constructed trees using the neighbor
joining method. The bootstrap result was given in terms of
percentage confidence level.

85
Relationship of Baculoviruses with Insect Hosts
The insect host families (Hodges et al., 1983) are
presented in Figure 4.1. The family name of the insect host
in parentheses after the baculovirus species name
corresponds to the hosts of the baculoviruses used in this
study to reconstruct the polh gene phylogenetic tree. The
correlation between the baculoviruses and their insect hosts
was studied by determining whether or not the insect hosts
of closely related baculoviruses belong to the same family.
Results
PCR Amplification and DNA Sequencing of LdMNPV gp41 Gene
A partial sequence of the LdMNPV gp41 gene (381 bp) was
amplified and sequenced (Appendix E). A baculovirus late
gene motif was found upstream from the ATG translation start
site (-32 to -28). The translation start site did not fit
the Kozak principle completely, but it was very similar. A
AxxATGC was found instead of the theoretical sequence
AxxATG(A/G).
The partial LdMNPV gp41 coding sequence was compared

69
85
43
73
(I)
85
98
53
100
CfMNNPV (Tortricidae)
PnMNPV (Lymantriidae)
OpMNPV (Lymantriidae)
ArcMNPV (Tortricidae)
HcMNPV (Arctiidae)
AgMNPV (Noctuidae)
ArMNPV (Saturniidae)
AfMNPV (Noctuidae)
BmMNPV (Bombycidae)
62
58
76
75
(II)
93
72
- AcMNPV (Noctuidae)
OpSNPV (Lymantriidae)
BsSNPV (Geometridae)
PfMNPV (Noctuidae)
LsMNPV (Noctuidae)
100
MbMNPV (Noctuidae)
- S1MNPV (Noctuidae)
SeMNPV (Noctuidae)
57
41
87 SfMNPV (Noctuidae)
MnMNPV (Lasiocampidae)
HzSNPV (Noctuidae)
- SpliMNPV (Noctuidae)
LdMNPV (Lymantriidae)
PbGV (Pieridae)
C1GV (Tortricidae)
oo
o-\
100
93
Scale: each is approximately equal to the distance of 0.004943
- TnGV (Noctuidae)
NsSNPV (Diprionidae)
Figure 4.1. Phylogenetic tree of baculovirus polh gene based on the translated
and published amino acid sequences. The number shown in each branch represents the
percentage of bootstrap confidence level. The neighbor-joining method was used to
construct the phylogenetic tree. The family name of insect host in parentheses after the
baculovirus species name corresponds to the hosts of the baculoviruses used in this study.

87
with the AcMNPV gp41 coding sequence, and it showed 56%
nucleotide sequence identity and 76% amino acid sequence
similarity. The partial LdMNPV gp41 nucleotide sequence and
translated amino acid sequence were used to reconstruct the
phylogenetic tree.
Phylogenetic Tree of Baculovirus polh Genes
Twenty-six amino acid sequences from different
baculoviruses were obtained from translated nucleotide
sequences of published data (Table 4.1), and used to
reconstruct the phylogenetic tree. In Figure 4.1, the
phylogenetic tree was divided into three main branches: the
lepidopteran NPVs, the lepidopteran GVs and the hymenopteran
NPV (NsSNPV). Within the lepidopteran NPV branch, the tree
was divided into two main groups and one outgroup branch.
Group I included AcMNPV, BmMNPV, AfMNPV, ArMNPV, AgMNPV,
HcMNPV, ArcMNPV, OpMNPV, PnMNPV, and CfMNPV. Group II
included OpSNPV, BsSNPV, PfMNPV, LsMNPV, MbMNPV, SlMNPV,
SeMNPV, SfMNPV, MnMNPV, HzSNPV and SpliMNPV. The only
member of the outgroup branch was LdMNPV (for complete name
of baculoviruses, see Table 4.1). The tree reliability test

88
using bootstrap analysis showed a low confidence level of
53% (Fig 4.1) in the branch that divides group I and II.
Maximum parsimony analysis of the nucleotide sequences
of 25 baculovirus polh genes (Fig. 4.2) showed two main
branches of lepidopteran NPVs, and agreed with the grouping
profile from the phylogenetic tree based on the amino acid
sequences (Fig 4.1). Group II was divided into two
subgroups. Subgroup A included the LsMNPV, MbMNPV, PfMNPV,
SfMNPV, SlMNPV and SeMNPV, and subgroup B included HzSNPV,
MnMNPV, BsSNPV and OpSNPV.
The distance lengths between lepidopteran GVs and
lepidopteran NPVs was calculated to be 0.3 to 0.4, and to be
0.56 between lepidopteran GVs and NsSNPV (Fig. 4.1).
Phylogenetic Trees of plO. ap41 and gp64 Genes
The phylogenetic trees of baculovirus genes coding for
the structural proteins, plO, gp41 and gp64 were presented
in Figure 4.3 (based on the amino acid sequences) and Figure
4.4 (based on the nucleotide sequences). The plO gene
phylogenetic tree based on the amino acid sequence showed
that AcMNPV and BmMNPV were in the same group. OpMNPV and

C1GV
PbGV
TnGV
AfMNPV
BmMNPV
AgMNPV
ArMNPV
OpMNPV
BnMNBV
ArcMNPV
CfMNPV
HcMNPV
AcMNPV
LsMNPV
MfcjMNBV'
PfMNPV
SfMNPV
S1MNPV
SesMNBV
H z SNPV
MnMNPV
B S SNPV
OpSNPV
LdMNPC
SlittMNPV
CD
co
Figure 4.2.
sequences.
tree.
Phylogenetic tree of baculovirus polh gene based on the nucleotide
The maximum parsimony method was used to construct the phylogenetic

(A) po gene
(B) gp41 gene
100
100
86
91
HzMNPV
LdMNPV
AcMNPV
BmMNPV
AgMNPV
SfMNPV
Scale: each is approximately equal to the distance of 0.005262
XcGV
o
(C) gp64 gene
50
100
BmMNPV
L GmMNPV
- AcMNPV
CfMNPV
Scale: each is approximately equal to the distance of 0.001643
OpMNPV
Figure 4.3. Phylogenetic tree of baculovirus plO (A), gp41 (B), and gp64 (C) genes
based on the translated amino acid sequences. The number shown in each branch
represents the percentage of bootstrap confidence level. The neighbor-joining
method was used to construct the phylogenetic trees.

(A)plO gene
AcMNPV
(B) gp41 gene
AcMNPV
BmMNPV
AgMNPV
HzMNPV
LdMNPV
SfMNPV
XcGV
(C) gp64 gene
AcMNPV
GmMNPV
BmMNPV
CfMNPV
OpMNPV
Figure 4.4. Phylogenetic tree of baculovirus plO (A), gp41 (B), and gp64 (C) genes
based on the nucleotide sequences. The maximum parsimony method was used to
construct the phylogenetic trees.

92
PnMNPV were also closely related. The results also showed
that the SlMNPV was distantly related to the other NPVs that
were analyzed. When the plO gene phylogenetic tree based
on the nucleotide sequence (Fig. 4.4 A) was compared with
the tree based on the amino acid sequence (Fig 4.3 A), the
results showed some differences. The OpMNPV and PnMNPV were
distantly related to AcMNPV and BmMNPV based on nucleotide
sequences, whereas SeMNPV and SlMNPV were distantly related
in the amino acid based tree.
The gp41 gene phylogenetic tree based on the amino acid
sequences (Fig. 4.3 B) groups the AcMNPV, BmMNPV and AgMNPV
together, and LdMNPV and HzSNPV in a separate group. The
SfMNPV was distantly related to these two groups. The
results also positioned the XcGV as an outgroup. The gp41
gene phylogenetic tree based on the nucleotide sequences
(Fig. 4.4 B) agrees with the tree based on amino acid
sequences. The gp64 gene phylogenetic tree based on amino
acid sequences (Fig. 4.3 C) presented the AcMNPV, BmMNPV and
GmMNPV in one group, and OpMNPV and CfMNPV in a second
group. However, the phylogenetic tree based on the
nucleotide sequence (Fig. 4.4 C) showed that BmMNPV was
closer to OpMNPV and CfMNPV than to AcMNPV and GmMNPV.

93
Phylogenetic Trees of dnapol and ecrt Genes
The dnapol gene phylogenetic tree based on the amino
acid sequences from six baculoviruses (Ahrens & Rohrmann,
1996), one ascovirus and one entomopoxvirus (Pellock et al.,
1996) was reconstructed and showed that AcMNPV, BmMNPV,
CfMNPV and OpMNPV were closely related, while HzSNPV and
LdMNPV were groupedseparately (Fig. 4.5 A). The results
also indicated that SAV and CbEPV were distantly related to
baculoviruses. The phylogenetic tree obtained from the
nucleotide sequence data (Fig. 4.6 A) confirmed these
results.
The egt gene phylogenetic tree (Barrett et al., 1996)
showed that AcMNPV and BmMNPV group together, while CfMNPV
and OpMNPV form another group, and the LdMNPV and MbMNPV a
third group. S. littoralis MNPV (SpliMNPV; abbreviated to
distinguish it from S. litura MNPV which is abbreviated
SlMNPV) was distantly related to the other lepidopteran
NPVs. LoGV was considered to be an outgroup virus in this
analysis. Both phylogenetic trees based on the amino acid
and nucleotide sequences agreed with each other (Fig 4.5 B
and 4.6 B).

(A) DNA polymerase gene
(B) egt gene
100
97
100
100 AcMNPV
BmMNPV
CfMNPV
OpMNPV
53
- LdMNPV
MbMNPV
SpliMNPV
LoGV
Scale: each is approximately equal to the distance of 0.006323
Figure 4.5. Phylogenetic tree of baculovirus dnapol (A), and egt (B) genes based on
the translated amino acid sequences. The number shown in each branch represents
the percentage of bootstrap confidence level. The neighbor-joining method was used
to construct the phylogenetic trees.

(A) DNA polymerase gene
AcMNPV
BmMNPV
CfMNPV
OpMNPV
LdMNPV
HzSNPV
ASV
CbEPV
(B) egt gene
AcMNPV
BmMNPV
CfMNPV
OpMNPV
LdMNPV
MbMNPV
SpliMNPV
LoGV
U)
on
Figure 4.6. Phylogenetic tree of baculovirus dnapol (A), and egt (B) genes based on
the nucleotide sequences. The maximum parsimony method was used to construct the
phylogenetic trees.

96
Relationship of Baculoviruses and Their Hosts
The family name of the insect hosts of baculoviruses
was also shown in Fig 4.1. When hosts were compared with
the polh gene phylogenetic tree, the results showed a
certain level of correlation between hosts and
baculoviruses. For example, the hosts of OpMNPV, CfMNPV and
PnMNPV that were closely related, belonged to the family
Lymantriidae. Also, most NPVs from group II including
MbMNPV, PfMNPV, SfMNPV, SeMNPV, SlMNPV, and HzSNPV infected
hosts from the family Noctuidae.
Congruent Analysis of Baculovirus Genes
A congruent analysis based on combined baculovirus gene
data sets was compared with six independent phylogenetic
trees of baculovirus genes. The six genes included polh,
dnapol, egt, plO, gp41 and gp64 of AcMNPV, BmMNPV, OpMNPV
and PfMNPV. The phylogenetic tree of combined sequence data
was reconstructed and compared to each single gene tree.
The results did not show any difference between the
universal tree that was based on the combined sequence data
and each single gene tree.

97
Discussion
This study presents for the first time an analysis of
the evolutionary relationships among baculoviruses using
phylogenetic trees based on multiple baculovirus genes.
A congruent analysis was made in order to alleviate problems
in previous evolutionary studies that were based on a single
baculovirus gene (Rohrmann, 1986; Zanotto et al., 1993). It
has been a challenge to determine whether or not the gene
tree can represent the species tree for evolutionary studies
(Li & Graur, 1991). A congruent analysis was used in an
attempt to solve this problem. Although only six gene
sequences of four baculovirus species were available for
comparison in this study, more gene sequence data will
become available for congruent analyses of baculoviruses in
the future. Currently, there are no guidelines for how many
genes and species need to be tested to support a
phylogenetic tree based on congruent analysis. The
development of PCR and automatic DNA sequencing techniques
is rapidly increasing the number of available sequences and
will help improve data analysis.

98
The congruent approach also allowed us to find out if
an independent gene tree agrees with other gene trees
including the universal tree. The results suggested that
the polh gene is a useful marker to represent the universal
tree and/or the baculovirus species tree. In addition, the
phylogenetic tree of polh gene can be used to identify a
newly isolated baculovirus. Two reasons have been found for
using the polh gene tree to represent the baculovirus
species tree in this study. First, the polh gene group has
the biggest nucleotide sequence group that is currently
available and include nucleotide sequences from 25
baculovirus species and amino acid sequences from 26
baculovirus species. Second, the polh gene tree agrees with
all other gene trees that have been tested in this study.
No significant difference was found between the polh gene
tree with other gene trees. The data of the polh gene also
agree with the universal tree that in total represents
around 6% of genomic DNA (based on AcMNPV) and 4% of the
total potential encoded genes. Since it compares to these
available baculovirus gene sequences, the polh gene is.
considered as the most reliable and useful gene to represent
the phylogenetic tree for baculovirus species.

99
In comparison to the data published by Zanotto et al.
(1993), the polh gene phylogenetic tree in this study was
reconstructed with newly available sequences. The results
showed that there were three main branches including
lepidopteran NPVs, lepidopteran GVs and a hymenopteran NPV.
They also indicated that lepidopteran NPVs can be divided
into two groups, I and II. Lepidopteran group II can be
further subdivided into several subgroups as Cowan et al.
(1994) suggested. The divergence of lepidopteran NPV
subgroups may be indicative of an ongoing evolutionary
pathway for baculoviruses. More careful examinations of the
evolutionary rate such as nucleotide substitutions per
nucleotide site (Aotsuka et al., 1994) is needed to
determine if subgroups I and II will become well-separated
branches.
Overall, there is a 59% nucleotide sequence identity of
the polh gene between lepidopteran NPVs and lepidopteran
GVs, and there are 74% to 92% identities among lepidopteran
NPVs (Rohrmann, 1992) In addition, the baculovirus polh
gene has a functional counterpart to the cytoplasmic
polyhedrosis virus (CPV) RNA viral family. In 1989, Fossies
et al. characterized the gene that encoded for the major

100
protein present in the proteinaceous occlusion body
(polyhedrin gene) for Euxoa scandens CPV. The homologies of
polh gene amino acid sequences between OpNPVs (OpMNPV and
OpSNPV) and OpCPV are as little as 12% (Galinski et al.,
1994). Although the nucleotide sequence identities between
NPVs and CPVs are very low, their polh protein functions are
very similar. The dissimilarities between NPVs and CPVs
such as low identities of polh gene sequences and different
types of genome structure (DNA viruses vs. RNA viruses)
indicated that their polh genes may involve a convergent
evolution.
The dnapol gene is used for comparison between
baculoviruses and other insect DNA viruses, because it is
the most common gene among DNA viruses from different
organisms. It has been reported that the AcMNPV dnapol gene
is classified in the viral subgroup of dnapol gene family B,
and is related to the dnapol gene of human virus and
eukaryotic organisms such as fungi (Heringa & Argos, 1994).
In this study, the results showed that baculovirus group had
evolutionary paths independent of other enveloped insect DNA
viruses, SAV and CbEPV. This agrees with previous published
results (Pellock et al., 1996) and is not surprising,

101
because these DNA viruses have different genomic DNA
replication and viral infection strategies (Taada & Kaya,
1993) .
A previous published phy-logenetic tree of the
baculovirus egt gene (Barrett et al., 1995) was
reconstructed and compared to the phylogenetic trees of polh
and dnapol genes to examine the true topology of baculovirus
phylogenetic trees. No significant difference was found
between the egt gene and the other gene trees. Although it
is very common to find that different gene trees have
different topologies (Forterre, 1997), the comparison
between polh, dnapol and egt gene trees showed that these
genes have similar evolutionary paths and/or rates. Since
all the analyzed trees agreed with each other, it should be
reasonable to predict the evolutionary pathway based on a
single gene tree such as polh gene.
Furthermore, three phylogenetic trees based on
baculovirus plO, gp41 and gp64 were reconstructed in this
study. For the phylogenetic trees of the baculovirus plO
gene, the results showed different schemes based on either
the nucleotide sequences or amino acid sequences. The
inconsistences may be caused by the low homology of plO

102
genes among baculoviruses (20 to 40% identities of amino
acid sequences). Kumar et al. (1993) found that it is easy
to misinterpret the results when low homology sequences are
used to construct phylogenetic trees. However, it could
also be caused by using different methods when the
phylogenetic trees were reconstructed. In this study, the
nucleotide sequences were analyzed using the maximum
parsimony method, while the amino acid sequences were
analyzed using the neighbor-joining method. These two
methods have completely different algorithms, which may
explain why the plO gene trees based on different types of
data did not agree with each other. Since there is no
evidence to suggest one method is superior to other, it is
probable that the plO gene group has a higher evolutionary
rate (more nucleotide.substitutions per site) than other
gene groups.
The phylogenetic trees of the baculovirus gp41 and gp64
genes show similar topologies based on either nucleotide or
amino acid sequences. In this study, two partial sequences
were used to reconstruct the gp41 gene phylogenetic tree.
Partial sequences coding for highly conserved domains have
been used for reconstructing a dnapcl gene phylogenetic tree

103
(Heringa & Argos, 1994) and show a reliable result. In
general, the phylogenetic tree of baculovirus gp41 genes
agree with other gene trees. However, it is necessary to
note that incomplete sequences may sometimes result in a
dissimilarity with other trees.
Only five sequences were used to reconstruct the
phylogenetic tree of gp64 genes. Two functional domains of
gp64 proteins have been identified (Monsma & Blissard,
1995). It will be helpful to compare these specific domains
in a protein function study, and to reconstruct the
phylogenetic tree using the comparison of function domains.
Moreover, a glycoprotein of a togoto virus (a tick-borne
orthomyxo-like virus) shows homology with the gp64 gene of
baculoviruses (Morse et al., 1992) Even though the amino
acid sequence identity between the gp64 gene and the togoto
glycoprotein gene is low (28-33%), similarities between
their hydrophobicity profiles and the conserved cysteine
sites are highly significant. Again, it indicates that
protein functional domains are highly conserved during
evolutionary processing.
In order to understand the host inference on
baculovirus evolution, the phylogenetic relationships of

104
baculoviruses were compared with their hosts. The results
showed that several branches of baculoviruses have the same
host family. Most of the baculovirus in lepidopteran NPV
subgroup II appear to infect the insect family Noctuidae.
Two closely related lepidopteran NPV subgroup II branches
including the branch of LsMNPV, MbMNPV, and PfMNPV, and the
branch of SfMNPV, S1MNPV and SeMNPV are found to infect the
same host family (Noctuidae) with closely related
subfamilies (Hadaninae and Amphipyrinae). Based on the
results, it can be suggested that the lepidopteran NPV
subgroup II has undergone a host-dependent evolution. On
the other hand, the lepidopteran NPV subgroup I was more
diverse than group II. Some baculovirus species such as the
branch of OpMNPV and PnMNPV, and the branch of ArcMNPV and
CfMNPV infect closely related families of insect hosts.
These two closely related branches infect insects from the
family Lymantriidae, and the family Tortriciidae (Grner,
1986; Zanotto et al., 1993) that are closely related. This
also shows that a host-dependent evolutionary pathway could
exist. However, the rest of lepidopteran NPV subgroup I
species did not have strong associations with the same
family of insect hosts. It implies that these species such

105
as AcMNPV (host family, Noctuidae) BmMNPV (host family,
bombycide) ArMNPV (host family Saturniidae) and HcMNPV
(host family, Arctiidae) are host-independent and go through
a nonparallel divergence from their hosts. The way that
agriculture systems were involved in distributing the
baculoviruses may indirectly result in evolutionary changes
of baculoviruses.
Some association between viruses and their geographic
distribution has been reported.(Fenner & Kerr, 1994; Zanotto
et al. 1993; 1995) The genetic distance of tick-borne
encephalitis was found to be correlated with the geographic
distance (Zanotto et al. 1995). However,, no significant
evidence was found in this study to support such a
correlation for baculoviruses: Most baculoviruses that were
analyzed in this study are distributed all over the world
from North America, South America, Europe, the Middle East,
and Asia. Thus, the geographic distribution of
baculoviruses does not appear to be associated with their
genetic distances. Although a geographic correlation with
genetic distance was found among GVs in South East Asia and
AgMNPV in South American (Zanotto et al., 1993), this
correlation was applied only to the strains of the same

106
viral species instead of to the different viral species.
Although no correlation between geographic distance with
genetic distance was found among baculoviruses, the
understanding of their relationship cannot be ignored since
it is necessary for a complete evolutionary study. In
addition, the evolutionary pathway of baculoviruses may be
related to other factors such as the feeding preferences of
baculovirus insect hosts. Certain closely related
baculoviruses were found to infect specific types of insect
hosts such as forest pests, crop pests and vegetable pests.
More studies will be needed to ascertain whether or not this
factor really plays any role in baculovirus evolutionary
paths.
In conclusion, the congruent analysis done in this
study validates the evolutionary hypothesis of baculoviruses
as suggested by Rohrmann (1986 & 1992) and Zanotto et al.
(1993). The results confirm that hymenopteran NPV diverged
early from lepidopteran NPVs and GVs, and that the
lepidopteran NPVs and GVs then split. Lepidopteran NPVs
continued to evolve and become two subgroups I and II, and
subgroup II diverged into several subgroups again. In the
future more information obtained from other NPVs such as

107
hymenopteran NPVs, dipteran NPVs and decapodan NPVs (shrimp)
will help in understanding the complete evolutionary pathway
of baculoviruses. The results of this study also suggest
that the phylogenetic tree of polh gene can be used to
represent the baculovirus species tree. The comparison of
the polh tree with five other genes and the universal tree
shows no significant differences and suggests that the polh
gene is a reliable gene for evolutionary studies of
baculoviruses.

CHAPTER 5
SUMMARY
In this study, a baculovirus conserved gene, gp41, was
used as a model to study the phylogenetic relationship among
baculoviruses. The transcriptional analysis and protein
secondary structure of the gp41 gene, and the structural
analysis of the surrounding genomic region were also
studied.
Two complete gp41 gene nucleotide sequences from
Spodoptera frugiperda multiple nucleocapsid
nucleopolyhedrovirus (SfMNPV-2) and Anticarsia gemmatalis
MNPV (AgMNPV-2D), and a partial gp41 gene from Lymantria
dispar MNPV (LdMNPV) were sequenced. The SfMNPV-2 gp41
contained 999 nucleotides and encoded 332 amino acids. Two
SfMNPV-2 gp41 gene transcripts were detected 12 hours post
infection. Primer extension analysis demonstrated that the
gp41 gene promoter region contained three transcriptional
start sites. Two of them were in the first two nucleotides
of a consensus transcriptional start site (TAAG) of
108

109
baculovirus late genes, and another transcriptional start
site was located in a region where no consensus motif had
been determined (-140 nucleotide from the translation start
codon, ATG).
The AgMNPV-2D gp41 gene contained 1,005 nucleotides and
encoded 334 amino acids. Comparison of the nucleotide and
amino acid sequences of the AgMNPV-2D with four other NPVs
including Autographa cali fornica MNPV (AcMNPV), Bombyx mori
MNPV (BmMNPV), SfMNPV and Helicoverpa zea single
nucleocapsid nucleopolyhedrovirus (HzSNPV) showed a minimum
of 59% nucleotide identity and 70% amino acid similarity.
Analysis of the protein secondary structure and amino acid
sequence alignment of AgMNPV-2D gp41 gene revealed several
conserved domains including eight a-helix domains, four
loop domains, one p-sheet domain and one transmembrane
domain. Furthermore, the hydrophobicity analysis of the
gp41 gene showed five conserved domains. Domain III was
correlated with one of the conserved a-helix domains
(qQLaNnYxTLLLkr), and domain V was correlated with the
transmembrane domain (EnxxxxAPLSAxxxIFxxx). The genomic
structure of the AgMNPV-2D gp41 region also contained vlf-1

110
gene, ORF 330, ORF300 and ORF >667, showing a similar
arrangement with AcMNPV, BmMNPV and SfMNPV. On the other
hand, this region had a different genomic location and
transcriptional orientation in HzSNPV. Among these ORFs,
the AgMNPV-2D shared 50 to 70% nucleotide identity and 60 to
90% amino acid similarity to the four other NPVs.
Lastly, six bacuiovirus genes including polyhedrin
ipolh), plO, gp41, gp64, DNA polymerase (dnapol) and
ecdysteroid UDP-glucosyltransferase (egt) were used to
construct phylogenetic trees. The phylogenetic trees
confirmed that the hymenopteran NPVs diverged earlier from
the lepidopteran granuloviruses (GVs) and lepidopteran NPVs.
Later, the lepidopteran GVs diverged from lepidopteran NPVs.
The results also showed that AcMNPV was closely related to
BmMNPV, and that Orgyia pseudosugata MNPV (OpMNPV) was
closely related to Perina nuda MNPV (PnMNPV) and
Choristoneura fumiferana MNPV (CfMNPV). The phylogenetic
analysis of dnapol showed that the baculoviruses had
independent evolutionary paths when compared to two other
insect DNA viruses, Spodoptera ascovirus (SAV) and
Choristoneura fumiferana entomopoxvirus (CbEPV). In
conclusion, this is the first time that phylogenetic trees

Ill
from six different baculovirus genes were constructed to
study the evolutionary paths of baculoviruses.
In the future, additional molecular data (nucleotide
sequence, amino acid sequence, and three dimensional protein
structure data) of baculoviruses will become available.
These basic data can be used to construct phylogenetic trees
of different baculovirus genes, and to predict the
biological function of a particular baculovirus gene using
computer modeling systems.

APPENDIX A
NUCLEOTIDE SEQUENCE OF Spodoptera frugiperda MNPV EcorRI-S
FRAGMENT AND TRANSLATED AMINO ACID SEQUENCE OF GP41 GENE
1
GAATTCAATG
TCGCTTTTAA
AAATTGCGAA
AGCATTCTGT
GTAAACGTAG
51
AAGCGTGCAA
ACCGCCTATA
TCACCATGGC
GGTTATAGTT
TTATTTATCA
101
ACATTATACA
TTTTTCATGG
TATTTTGTAC
TATTTATTTT
CGTAATGATA
151
TTCTTGCTAT
ATCTAAACAA
TAATTATATG
ATAAGTAATC
CAAAAATTGT
201
TTACTGCCCT
CATAAAAAAC
ACAATGGCCA
ATTACACGAG
GCCAAATTCA
MAN
Y T R
P N S
251
ATAACTAAAT
CGTCGACAAT
GTCATCGTCT
TCGTTGTCGT
CGTCCTCGTC
I T K S
STM
s s s
S L S S
s s s
301
CGCGGCCATA
ACCGAACCGT
GGATGGACAA
ATGTGTCGAT
TACGTCAATA
A A I
T E P W
M D K
C V D
Y V N K
351
AAATCGTTCG
ATACTATAGA
ACAAACGACA
TGTCTCAATT
GACCCCACAA
I V R
Y Y R
T N D M
SQL
T P Q
401
ATGCTAAACC
TCATCAACAC
CATACGGAAT
GTTTGCATCG
AAACGTATCC
M L N L
I N T
I R N
V C I E
T Y P
451
CGTAGACGTC
AACGCCACCA
AGCGTTTCGA
CAGCGACGTC
AACCTTATGA
V D V
N A T K
R F D
S D V
N L M N
501
ACAATTACAA
ACGACTGCAA
AAAGAGCTGG
GCAATAAACC
GATCACGAGC
N Y K
R L Q
K E L G
N K P
ITS
551
GACATTTTCA
AAGCTTCGTT
CGTGTACAGC
GTTTTGCCGT
CGTACGCTCA
D I F K
ASF
V Y S
V L P S
Y A Q
601
AAAATTTTAC
AACAAGGGCG
GCGATCATCT
AGCCAGCGGC
AGCGTCGAAG
K F Y
N K G G
DHL
A S G
S V E E
651
AAGCGGCCCG
TCATTTGGGC
TACGCTTTAC
AATATCAAAT
CGCGCAAGCT
AAR
H L G
Y A L Q
Y Q I
A Q A
701
GTGACCACAA
ACACACCCAT
CCCCCTGCCG
TTCGATCAAC
AGCTTGCCAA
V T T N
T P I
P L P
F D Q Q
LAN
751
CGATTATCTA
ACGTTGCTTC
TGCAGCGAGC
CAACATTCCG
ACAAACATAC
D Y L
T L L L
Q R A
NIP
T N I Q
801
AGGAGATCAT
CAACAGCGGC
AATCGGACGC
ACGGCAACTC
GCGCGTTCAC
Eli
N S G
N R T H
G N S
R V H
851
ATGATCAACG
CTCTCATCAA
CAACGTGATC
GACGATCTGT
TTGCCGGCGG
MINA
LIN
N V I
D D L F
A G G
901
CAGTGACTAT
TATCTGTACG
TGCTCAACGA
AACTAACAAA
TCTCGCATTC
S D Y
Y L Y V
L N E
T N K
S R I L
951
TAAGTTTGAA
AGAAAATATC
AGTTACATGG
CACCATTGTC
CGCCACCACT
S L K
E N I
S Y M A
P L S
ATT
1001
AACATATTCA
ACTTTATCGC
AACGCTCGCC
ACCAATTCGG
GTAAAAAGCC
N I F N
FIA
TLA
T N S G
K K P
1051
GAGCGTGTTC
CAGAGCGCTT
CGATGTTGAC
CATGCCTCTA
ACTAAACCTG
S V F
Q S A S
M L T
M P L
T K P V
1101
TCGTCAGCGA
ATCCAAAAAC
GTGTGCCAAC
AGCAACTGAC
TGAACTGGCG
V S E
S K N
v c Q Q
Q L T
E L A
1151
TTTGAAAATG
AAGCATTAAG
AAGATTTATC
TTGCAACAGT
TAAGTTATAA
F E N E
A L R
R F I
L Q Q L
S Y K
112

113
1201 AAACGACATT TCGCAACTGT GATAACAACT GAGGCTAGAA AAAAAAAGAT
N D X SQL*
1251 GAGTCTTGAC GTTCCGTACG AACGTTTAGG CACAGCGACC AAAGTCGATT
1301 ATATTCCGCT AAAATTAGCT TTGACTGATT TACCTTCAGA AAACACTTCA
1351 GACAACAATG ACGACAATCA AAAAAACAAC AATACCCAAA ATCCCAAAAT
1401 TGATATTAAT CAATCAAACG CCAACAATTA TAATCAACAT CAATCGGTTC
1451 GTTCAAAACA ACAGTTTTAC GACATTTTAG TTTTAGGTAT GCTGACAGTG
1501 TTTTGTATTT TGGTATTGCT GTATGCTATA TATTACTTTG TTATATTAAG
1551 AGACAGACAA AAATCCAACA CTATAAGACC TAGTTATATG TTTTAGCATG
1601 ACTGATAACA TTTTCAATAA AACAAACAAT GTGAGAAATG AATATTCGTT
1651 TAATTGTTGG AAATCCAAAA TCCAAAGTCA TTTTAGATTC GAGACCGTGT
1701 TTCAACTGGC CACCGATCGA CAGCGATGCA CGCCCGACAA GGTTCGTAAC
1751 GGTCGGTGGT CCAAGTTTAT TTTTAACAAA CCGTTTGCGC CCACCACATT
1801 GAAAAGTTAC AAGTCTAGAT TCATCAAAAT CATCTACTGT CTAATCGACG
1851 AGTCTCATCT CGACGAACTA AACACCTACG ATCTTAATCA AGAATTC
* TAAG is the transcription start site of baculovirus late
genes
* ATG is the protein translation start site
* AATAA is the poly(A) tail signal site

APPENDIX B
INTERNET SERVERS USED FOR DATABASE SEARCH AND PROTEIN
SECONDARY STRUCTURE PREDICTION
PROGRAM
URL Site (Server Institute)
Databank search
BLAST
http://www3.ncbi.nlm.nih.gov/Blast/
(National Biotechnology Information Center, USA)
ENTREZ
http://www3.ncbi.nlm.nih.gov/Entrez/
(National Biotechnology Information Center, USA)
Protein secondary structure
Darwin
http://cbrg.inf.ethz.ch/subsection3 1 7.html
(Swiss Federal Institute of Technology Zurich)
PHD
http : //www. embl-heidelberg. de/pred.ictprotein/
predictprotein.html
(European Molecular Biology Laboratory, Germany)
O-linked glycosylation site prediction
NetOglyc http://genome.cbs.dtu.dk/netOglyc/
cbsnetOglyc.html
(The Technical University, Denmark)
Transmembrane domain analysis
MEMSAT
http://globin.bio.Warwick.ac.uk/-jones/
memsat.html
(University of. Warwick, U.K.)
114

APPENDIX C
NUCLEOTIDE SEQUENCE OF Anticarsia gemmatalis MNPV Pstl-
Hindlll FRAGMENT AND TRANSLATED AMINO ACID SEQUENCE OF GP41
GENE
1
AAGCTTGCCG
ATACGCCGGT
GCCGCACCAT
GGGCCCGCCG
AAGAAGAAAA
51
CGTTGTCGCC
GAACGCTTTG
GGTCAGAATC
TGGCGACGCA
CCATCGTCCC
101
CCAAAAAGCA
AAAATTGGAC
GAGTCTGAAC
AAGATTAAAT
ACGACAGCGA
151
ACTGCTCATT
CACTATCTAT
ACGAAGGGTT
TTGCACCGAC
AAACAACAAT
201
GCAATTTGAA
CGTGATAAAA
ATTTACAAAG
TAAAAGTAAA
GAAAACGGGC
251
GCTTCCATTT
TGGCACATTA
TTTTGCGCAA
ATTTCTACTT
CAAGCGGTTA
301
CGAGTTTGAA
TTCCACCCCG
GCAGTCAGCC
TCGCACCTTT
CAAACGGTAC
351
ACACCGACGG
TCTCATTATA
AAGGTGCACA
TTATGTGCGA
TGAATGCTGC
401
AAAGCGGAAT
TGCGCAGATA
CATCAAAGGA
GAAAACGGCT
TCAACGTAGC
451
GTTTCGCAAT
TGCGAAAGTA
TCCTGTGTCA
ACGTGTCAGT
TTTCAAACGC
501
TTTTGCTGGG
ATGCGCCATT
CTGTTGCTGC
TGTTTAACGT
GGAAAAATTT
551
TCGATATTAA
ATTTGCTTGT
CATTTTGTTA
CTTTTAGTAG
CGTTGTTTTG
601
TAACAACAAT
TATATTATAA
GTAAT C CATA
CGTTGTATTT
TGCAATCATA
651
AGAACGCATT
AAAAAACCAT
M
GAATGAACGG
N E R
GACGGCTTTT
D G F Y
ATTTGAACGT
L N V
701
TTCGCAGGCG
CCTGCGAGAC
ACCCGTTTGC
ACCCACCAGC
GCGACCGTTA
S Q A
P A R H
P F A
P T S
A T V T
751
CTAGTTCGCA
AAGCGGTAAT
TATCCAACCA
CAATGTCCAC
AATGGTGCAG
S S Q
S G N
Y P T T
M S T
M V Q
801
CGGACAGATC
GCGGCAGCGC
AAACTCGCTT
GTTAAAACCA
AAGAAGACGC
R T D R
G S A
N S L
V K T K
EDA
851
CAGCGGCGAA
TCTATTTGGT
ACAACAAGTG
CACAGACTAT
GTACATAAAA
S G E
S I W Y
N K C
T D Y
V H K X
901
TTATTCGCTA
TTATCGCTGT
AACGACATGT
CTGAATTGAC
TCCTTTAATG
I R Y
Y R C
N D M S
E L T
P L M
951
ATTCATTTTA
TCAACACAAT
ACGCGACATG
TGCATTGACA
GCAACCCTGT
I H F I
N T I
RDM
C I D S
N P V
1001
TAGTGTAAAC
ATAATCAAGC
GCGTGCAAAC
TGACGAAGAA
ATTGTTCGCC
S V N
I I K R
V Q T
DEE
I V R H
1051
ACCTAATTGG
GTTGCAAAAA
GAACTGCGTC
AGAATAGCGT
GGCAGAGTCC
L I G
L Q K
E L R Q
N S V
AES
1101
ATCGATTCGG
ATTCCAACAT
TTTTCAGCCT
TCGTTTGTAC
TCAATTCGCT
I D S D
S N I
F Q P
S F V L
N S L
1151
GCCGGCGTAC
GCGCAAAAAT
TTTACAACGG
CGGCGCAGAC
ACGCTTGGCA
PAY
A Q K F
Y N G
GAD
T L G K
1201
AAGACGCGCT
CAACGAGGCG
GCCAAACAGC
TTAGTTTGGC
CGTGCAGTAC
DAL
N E A
A K Q L
SLA
V Q Y
1251
ATGGTGTCGG
AAGCGGTCAC
GTGCAGTATT
CCCATCCCGT
TGCCGTTTGA
M V S E
A V T
C S I
P I P L
P F D
115

1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
2151
2201
2251
2301
2351
2401
2451
2501
2551
2601
2651
2701
2751
2801
2851
2901
2951
3001
3051
3101
3151
3201
3251
3301
3351
116
CCAGCAGCTT GCCAACAATT ATGTGACACT ACTTTTAAAA CGCGCCACGC
QQL ANNY VTL LLK RATL
TACCTGACAA CGTGCAAGAA GCCGTCAAGT CGCGCAGCTT TGTGCACATT
PDN VQE AVKS RSF VHI
AACATGATCA ATGACCTCAT AAATTCAGTG ATTGACGATT TGTTTGCTGG
NMIN DLI NSV IDDL FAG
CGGCGGCAAC
G G N
TCGTAGGGCT
V G L
GCGGACATTT
A D I F
TCCCGACATG
P D M
TCAACTCGCC
N S P
CTCAATTAGC
GTCAAGCAAA
AATATGAGTT
AGACGACGGC
TGAACCAACA
TCTTTGCGTT
CGCGCAATTG
TGCAATTAAT
TGAACTTGGA
TACATTCCGC
CAACGACGAC
CGCGCACGGG
GCGTTTGTGG
ATTAAGAGAA
CTTCTTTTTT
ACGCACGCAA
GCGCCACAAT
CACGCCGGAC
CCAAACCGTT
AAAATTATTT
TTCGTTAAAC
ACCCCAAAGA
GAAACGTTGC
CGAATTTAAA
AAACCATTCG
ACAATTTTGG
CGTGCACGAC
TAGGTACGGG
CTTAACGTGC
AAAACGCAAA
CGTTGGAGCT
ATCTCTAAAA
CGAAGCGGGC
ATTTGAGCAG
TATTATTATT
Y Y Y Y
CAAGGAAAAC
KEN
TTAATTACAT
N Y M
TTTGAGAACG
F E N A
GGCCGCCATT
A A I
GGCGCAGTGT
CTGACGCCGA
TGTACAAGAA
AAACTGTACA
CAAACGCGGC
TACTTTATTG
GAATACAATC
TAAAGCGCAA
CGTGCCCTAC
TAAAACTAGC
ACTGCTGTGT
TCAAATGTCG
CTTTGTTTCT
GAGCCGCAAT
GTTTAATAAA
CGAAAATGTT
TTGAGCACGT
GAAGTAAAAA
TGCGCCCACC
TTAGCCTAAT
AGGGAATTTG
ACTGTGCAAA
AGCTTACCAT
ATCCCGCGCA
AGAAAAAGAA
ATTTTATTAA
CGCGGCCTTA
CATGCGCATC
TAATTAAAAA
CGCAGCCGCA
GGCTCGTGAA
ACACTTCCAC
GTAGAAATGG
CAATTTGTAC
ACGTGCTCAA
V L N
GTGGGATTTT
V G F L
GTCGCAACTT
SQL
CGGCGTTTCT
A F L
TGACGCAGAG
*
GAAACGCTAA
CAGATTACTG
CAAAGTGTGG
CGGGCATCAC
GTTGGTGCGC
CAGCGCAAAC
TTAAGCGTAA
CCTCAACATT
TACCGTTTGG
GCTAAACGAC
ACGAATACTC
GCCGGTTTAA
GCTATTGTAT
ATTCTTCCGA
TTTGATTAAT
TTTAACGATT
GTTTGATTTG
ACGACAGCCT
ACACTAAAAA
AGAGGAACCG
ATTCGATTGA
CGCATGCTTG
TAACTTTTAC
TGGTCATGTT
AAAAATTTTA
TTCCAAAATA
TTCGAGGCGC
AACGAGGCGC
AGGCAAACTG
ACAACACGCT
ATTTACGCGC
GCCTTTTAAA
AACGGCCACG
AACAGCGGCG
CGAAAAGAAT
E K N
TGGCACCATT
A P L
GCTACGCGAC
A T R H
TACGTCGGCC
T S A
CGCGTGCCAA
CCCGGTTCAT
AATCCGCCGC
TGCGTGTACA
CAGCGATTTG
GTTTTTTACG
GCGTACGATT
ACGCGGGAAA
TGCATCAATA
GCAACCACGA
GATGCGCCCG
GGACGTACAC
TTGTGCTGAT
GTTATCTATT
CACAATTGAC
TACAATGAAC
GGAAAATGCG
GCCACCGACC
GTGGAGCAAG
GTTACAAGTC
GATTTGCAAA
ATATCAACGG
AATTGAGGTC
ACAAACGCTA
GCCACGTGAC
TGCTCAAAAA
AAAATGTTAA
CATAGTGTTT
GCCAGCTCAG
CGCAGCAACA
CAACACGATC
GCAACCCCAC
GACTTTCGCC
TAGCAACATG
TGCCGTTGCA
CGCGCGCGCG
R A R V
GTCCGCGTCC
S A S
ACGGCAAACG
G K R
GCCAACGCCA
A N A I
AAGAGTTTGT
ATTCATGATT
GTTCGCGCGC
TTGTGCGGCG
CGACGTCGTT
CAATGCAAAC
ACAAGACCGC
TATTTTAAAT
TTTGTCATCA
GCGCGTAGAA
TCAACAACAA
AAAGGCGAAA
TAGTCTGGTG
ATTTTGTAAT
AACAGCGATC
GAGCTGTTGA
CATTCAATCA
GACAGCGGTG
TACATGTTTC
ACGTTTTATT
ACACCGCATA
TTGCTTGTGA
TGTGACCAAG
TGGGTTTGGC
AAGGAACTTA
CGCAATAGAC
ACGGCGATTA
TGCATAATGT
CGTGGAAGAT
CTATCAATTT
AAAACCAAAC
CGTGTTGCAA
GTTTGCTGGA
ATAAGACACT
AAAGGTGGCG

117
3401 CGCTTGATGA ACCACGAATC GCCGGCCAGT ACCAAACCGT ATTTGAACAA
3451 GTACAATTTT GACGAAAGCA GCAGCAGCAC GAGGAATCAG AGTTGAACAA
3501 CCGCGACTCG TCTGCAG
* TAAG is the transcription start site of baculovirus late
genes
* ATG is the protein translation start site
* AATAA is the poly(A) tail signal site

APPENDIX D
PURIFICATION OF POLYHEDRA, ALKALINE-RELEASED VIRUSES AND DNA
FROM Lymantria dispar MNPV COMMERCIAL FORMULATION (MODIFIED
FROM THE LABORATORY PROTOCOL OF DR. MARUNIAK)
Purification of Polyhedra from LdMNPV Commercial Formulation
1. Dissolve 2 g LdMNPV in 10 ml homogenization buffer (1%
ascorbic acid, 2% SDS, 10 mM Tris-HCl and 1 mM EDTA, pH
8.0).
2. Filter the polyhedra solution through 4 layers of
cheesecloth.
3. Centrifuge the solution at 10,000 rpm for 10 min at 4C
(BECKMAN J21-C centrifuge and JA20 rotor).
4. Discard supernatant and resuspend pellet in 9 ml of
distilled water with 1 ml 5 M NaCl.
5. Centrifuge the solution at 10,000 rpm for 15 min at 4C.
6. Resuspend in 5 ml distilled water.
7. Make a 30 ml sucrose gradient from 63% to 40% in TE
buffer (10 mM Tris and 1 mM EDTA, pH 8.0), using a
gradient former (MBA, Clearwater, FL) and Masterflex pump
(Cole-Parmer Instrument Co.).
8. Centrifuge the resuspended viral solution on top of
sucrose gradient in an ultracentrifuge at 24,000 rpm for
30 min at 4C (DuPont OTD 65B ultracentrifuge and AH627
swinging bucket rotor).
9. Transfer the polyhedra band to a new tube, and mix with
distilled water.
10. Centrifuge the solution at 10,000 rpm for 15 min at 4C.
11. Resuspend the pellet in 0.5 ml distilled water.
118

119
Purification of the Alkaline Released Virus from LdMNPV
Polyhedra
1. Add one third volume of DAS (final concentration: 0.1 M
Na2C03, 0.01 M EDTA, 0.17 M NaCl, pH 10.9) to the
polyhedra solution and mix. Keep the polyhedra solution
on ice all the time. If the polyhedra is not dissolved,
add a few drops (100 |^1) of 0.5 M NaOH to the polyhedra
solution, and vortex the solution.
2. Prepare a sucrose gradient from 40% to 56%.
3. Centrifuge at 24,000 rpm for 1 hr at 4C.
4. Transfer the different bands (alkaline released virus
with different numbers of nucleocapsids) to a new tube.
5. Add TE to fill the tube and mix well. Centrifuge at
24,000 rpm for 30 min.
6. Discard supernatant.
7. Resuspend the virus (alkali-released virus) in 500 fil TE
buffer.
Viral DNA Purification
1. Add 40 (.il of 20% SDS to the alkaline released virus
solution.
2. Incubate 10 min at room temperature.
3. Add 10-25 |^1 proteinase K (5 mg/ml) and incubate
overnight at 37C.

120
4. Extract DNA with 0.75 ml distilled phenol (saturated with
TE). Invert tubes gently. Spin in microcentrifuge for
about 1 min. Transfer upper aqueous phase to a clean
microcentrifuge tube. Extract the aqueous phase twice
more with phenol.
5. Extract the aqueous phase three times with 0.75 ml water
saturated ether.
6. Heat the DNA solution at 56C for 15 min in a heat block
with caps open to evaporate ether.
7. Dialyze the DNA solution 4 times against 1 L TE (2 times
daily for 2 days).
8. Measure the DNA concentration by reading optical density
(OD) at 260 nm. The DNA concentration (|ag/ml) equals to
od260 x 50

APPENDIX E
PARTIAL NUCLEOTIDE AND TRANSLATED AMINO ACID SEQUENCES OF
Lymantria dispar MNPV GP41 GENE
1 TATGATAAGTAGTCCTCGGGTGGAGTTTTGCGAGCATCATGCAGTCCGAG
M Q S E
51 CCCGCTGACCGCGACGCGGCGGCCGCCGTCTACAGCGCCGCCTGGATGAA
DAAAAVY SAAWMNQCVD
101 ACCGGGTCATCAAGTACTATCGCACCAACGACATGTCCCACTTGACGCCC
YVDPADRRVI KYYRTND
151 CAGATGCAATCCAGTGCGTGGACTACGTGGTGCTGATCAACACCATTCGC
MSHLTPQMQLLINTIR
201 GACCTGTGCCTGGACACCAACCCGGTGGACGTGAACGTGGTGAAGCGCTT
DLCLDTNPVDVNVVKRF
251 CGACAGCGACGAGAACCTGATCAAGCACTACGCGCGCCTCGCCAAGGACA
DSDENLIKHYARLAKDM
301 TGGGCGGCTCGGCGGTGCCCGACAACGTGTTCCAGCCCTCTTTCGTCTAC
GGSAVPDNVFQPSFVY
361 ACCGTCCTGCCGGCCTACGCGCAAAAGTTTTACAACAAGGGT
TVLPAYAQKFYNKG
* TAAG is the transcription start site of baculovirus late
genes
* ATG is the protein translation start site
121

LIST OF REFERENCES
Adams, J. R.( Goodwin, R. H., & Wilcox, T. A. 1977. Electron
microscopic investigations on invasion and replication
of insect baculovirus in vivo and in vitro. Review of
Biology and Cell. 28. 261-268.
Ahrens, C. H. & Rohrmann, G. F. 1996. The DNA polymerase and
helicase genes of a baculovirus of Orgyia
pseudotsugata. Journal of General Virology 77. 825-
837.
Akiyoshi, D. E., Chakerian, R., Rohrmann, G. F., Nesson, M.
H. & Beaudreau, G. S. 1985. Cloning and sequencing of
the granulin gene from the Trichoplusia ni granulosis
virus. Virology 141. 328-332.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. &
Lipman, D. J. 1990. Basic local alignment search tool.
Journal of Molecular Biology 215. 403-410.
Aotsuka, T., Chang, H.-Y., Aruga, M., Lin, F.-J., &
Kitagawa, 0. 1994. Mitochondrial DNA variation in
natural populations of Drosophila immigrans. Zoological
Studies 33. 29-33.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D.,
Seidman, J. G., Smith, J. A., Struhl, K., Wang-
Iverson, P. & Bonita, S. G. 1989. "Short Protocols in
Molecular Biology". John Wiley & Sons, Inc. New York,
pp, 139-162.
Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. &
Possee, R. D. 1994. The complete DNA sequence of
Autographs cali fornica nuclear polyhedrosis virus.
Virology 202. 586-605.
122

123
Barrett, J. W., Krell, P. J. & Arif, B. M. 1995.
Characterization, sequencing and phylogeny of the
ecdysteroid UDP-glucosyltransferase gene from two
distinct nuclear polyhedrosis viruses isolated from
Choristoneura fumiferana. Journal of General Virology
76, 2447-2456.
Benner, S. A. 1995. Predicting the conformation of proteins
from sequences. Progress and future progress. Journal
of Molecular Recognition 8. 9-28.
Betz, F. S. 1986. Registration of baculoviruses as
pesticides. In "The Biology of Baculoviruses".
Granados, R. R. & Federici, B. A., Eds. Boca Raton,
Florida: CRC Press, Inc. VI, pp, 203-222.
Bilimoria, S. L. 1986. Taxonomy and identification of
baculoviruses. In "The Biology of Baculoviruses".
Granados, R. R. & Federici, B. A., Eds. Boca Raton,
Florida: CRC Press, Inc. VI, pp, 37-60
Bitton, G., Maruniak, J. E. & Zettler, F. W. 1987. Virus
survival in nature ecosystems. In "Survival and
Dormancy of Microorganisms". Henis, Y., ed. New York:
John Wiley & Sons. Inc. pp, 301-332.
Bjornson, R. M., Glocker, B. & Rohrmann, G. F. 1992.
Characterization of the nucleotide sequence of
the Lymantria dispar nuclear polyhedrosis virus DNA
polymerase gene region. Journal of General Virology
73, 3177-3183.
Blinov, V. M., Gutorov, V. V., Holodilov, N. G.,
Iljichev, A. A., Karginov, V. A., Mikrjukov, N. N.,
Mordvinov, V. A., Nikonov, I. V., Petrov, N. A.,
Urmanov, I. H. & Vasilenko, S. K. 1984. Nucleotide
sequence of the Galleria mellonella nuclear
polyhedrosis virus origin of DNA replication.
Federation of European Biochemical Societies Letters
167, 254-258.
Blissard, G. W. & Rohrmann, G. F. 1989. Location, sequence,
transcriptional mapping, and temporal expression of

124
the gp64 envelope glycoprotein gene of the Orgyia
pseudotsugata multicapsid nuclear polyhedrosis virus.
Virology 170. 537-555.
Blissard, G. W. & Rohrmann, G. F. 1990. Baculovirus
diversity and molecular biology. Annual Review of
Entomology 35. 127-155.
Bonning, B. C. & Hammock, B. D. 1992. Developmental and
potential of genetically engineered viral
insecticides. Biotechnology and Genetic Engineering
Reviews 10. 455-489.
Braunagel, S. C., Elton, D. M., Ma, H. & Summers, M. D.
1996a. Identification and analysis of an Autographa
cali fornica nuclear polyhedrosis virus structural
protein of the occlusion-derived virus envelope: ODV-
E56. Virology 217. 97-110.
Braunagel, S. C., He, H., Ramamurthy, P. & Summers, M. D.
1996b. Transcription, translation, and cellular
localization of three Autographa cali fornica nuclear
polyhedrosis virus structural proteins: ODV-E18, ODV-
E35, and ODV-EC27. Virology 222. 100-114.
Braunagel, S. C. & Summers, M. D. 1994. Autographa
cali fornica nuclear polyhedrosis virus, PDV, and ECV
viral envelopes and nucleocapsids: structural proteins,
antigens, lipid and fatty acid profiles. Virology 202.
315-328.
Brown, S. E., Maruniak, J. E. & Knudson, D. L. 1985.
Baculovirus (MNPV) genomic variants: characterization
of Spodoptera exempta MNPV DNAs and comparison with
other Autographa cali fornica MNPV DNAs. Journal of
General Virology 66. 2431-2441.
Brown, S. E., Maruniak, J. E. & Knudson, D. L. 1987.
Conserved homologous regions between two baculovirus
DNAs. Journal of General Virology 68. 207-212.
Burand, J. P., Horton, H. M., Retnasami, S. & Elkington, J.
S. 1992. The use of polymerase chain reaction and

125
shortwave UV irradiation to detect baculovirus DNA on
the surface of gypsy moth eggs. Journal of Virological
Methods 36, 141-150.
Burgess, S. 1977. Molecular weights of lepidopteran
baculovirus DNAs: derivation by electron microscope.
Journal of General Virology 37. 501-510.
Cameron, I. R. & Possee, R. D. 1989. Conservation of
polyhedrin gene promoter function between
Autographa cali fornica and Mamestra brassicae nuclear
polyhedrosis viruses. Virus Research 125. 183-199.
Carbonell, L. F., Hodge, M. R., Tomalski, M. D. & Miller, L.
K. 1988. Synthesis of a gene coding for an insect-
specific scorpion neurotoxin and attempts to express it
using baculovirus vectors. Gene 73. 409-418.
Carson, D. D., Guarino, L .A., & Summers, M. D. 1988.
Functional mapping of an AcNPV immediate early gene
which augments expression of the IE-1 trans-activated
39 k gene. Virology 162. 444-451.
Chaeychomsri, S., Ikeda, M. & Kobayashi, M. 1995. Nucleotide
sequence and transcriptional analysis of the DNA
polymerase gene of Bombyx mori nuclear polyhedrosis
virus. Virology 206.436-447.
Chakerian, R., Rohrmann, G. F., Nesson, M. H., Leisy, D. J.
& Beaudreau, G. S. 1985. The nucleotide sequence of the
Pieris brassicae granulosis virus granulin gene.
Journal of General Virology 66. 1263-1269.
Chisholm, G. E. & Henner, D. J. 1988. Multiple early
transcripts and splicing of the Autographa cali fornica
nuclear polyhedrosis virus IE-1 gene. Journal of
Virology 62. 3193-3200.
Clarke, E. E., Tristem, M., Cory, J. & O'Reilly, D. R. 1996.
Characterization of the Mamestra brassicae multicapsid
nuclear polyhedrosis virus ecdysteroid
UDP-glucosyltransferase (egt) gene. Journal of General
Virology. In press.

126
Cory, J. S., Hirst, M. L., Williams, T., Hails, R. S.,
Goulson, D., Green, B. M., Carty, T. M. Possee, R. D.,
Cayley, P. J. & Bishop, D. H. L. 1994. Field trial of a
genetically improved baculovirus insecticide. Nature
3 70. 138-140.
Cowan, P., Bulach, D., Goodge, K., Robertson, A. & Tribe, D.
E. 1994. Nucleotide sequence of the polyhedrin gene
region of Helicoverpa zea single nucleocapsid nuclear
polyhedrosis virus: placement of the virus in
lepidopteran nuclear polyhedrosis virus group II.
Journal of General Virology 75. 3211-3218.
Doolittle, R. F. 1996. Computer methods for macromolecular
sequence analysis. Methods in Enzymology 266.
Engelman, D. M., Steitz, T. A. & Goldman, A. 1986.
Identifying nonpolar transbilayer helices in amino acid
sequences of membrane proteins. Annual Review of
Biophysics and Biophysical Chemistry 15, 321-53
Faktor, 0., Toister-Achituv, M. & Kamensky, B. 1995.
Identification and nucleotide sequence of an
ecdysteroid UDP-glucosyltransferase gene of Spodoptera
littoralis multicapsid nuclear polyhedrosis virus.
Virus Genes 11. 47-52.
Federici, B. A. 1986. Ultrastructure of baculoviruses. In
"The Biology of Baculoviruses". Granados, R. R. &
Federici, B. A., Eds. Boca Raton, Florida: CRC Press,
Inc. VI, pp, 61-88.
Fenner, F. & Kerr, P. J. 1994. Evolution of the poxviruses',
including the coevolution of virus and host in
myxomatosis. In "The Evolutionary Biology of
Viruses". Morse, S. S. Ed. Raven Press, New York, pp,
273-292.
Fitch, W. M. 1971. Towards defining the course of evolution:
minimum change for a specific tree topology. Systematic
Biology 42. 193-200.
Flipsen, J. T., Mans, R. M., Kleefsman, A. W., Knebel-

127
Morsdorf, D. & Vlak, J. M. 1995. Deletion of the
baculovirus ecdysteroid UDP-glucosyltransferase gene
induces early degeneration of Malpighian tubules in
infected insects. Journal of Virology 69. 4529-4532.
Forterre, P. 1997. Protein versus rRNA: problems in rooting
the universal tree of life. The News Magazine of the
American Society for Microbiology 63. 89-95.
Fossiez, F., Belloncik, S. & Arella, M. 1989. Nucleotide
sequence of the polyhedrin gene of Euxoa scandens
cytoplasmic polyhedrosis virus (EsCPV). Virology 169.
462-465.
Friesen, P. D. & Miller, L. K. 1986. The regulation of
baculovirus gene expression. Current Topics of
Microbiology and Immunology 131, 31-49.
Fuch, Y. L., Woods, M. S., & Weaver, R. F. 1983. Viral
transcription during Autographa cali fornica nuclear
polyhedrosis virus infection: A novel RNA polymerase
induced in infected Spodoptera frugiperda cells.
Journal of Virology 48, 641-646.
Funderburk, J., Maruniak, J., Boucias, D. & Garcia-Canedo,
A. 1992. Efficacy of baculoviruses and their impact on
pest management programs. In "Pest Management in
Soybean". Copping, L. G. Gz'een, M. B. & Rees, R. T.,
Eds. Elsevier, England, pp. 88-97.
Fuxa, J. R. 1989. Fate of released entomopathogens with
reference to risk assessment of genetically engineered
microorganisms. Bulletin of the ESA 35. 12-23.
Galinski, M. S., Yu, Y., Heminway, B. R. & Beaudreau, G. S.
1994. Analysis of the C-polyhedrin genes from different
geographical isolates of a type 5 cytoplasmic
polyhedrosis virus. Journal of General Virology 75.
1969-1974.
Garcia-Maruniak, A., Pavan, O. H. 0. & Maruniak, J. E. 1996.
A variable region of Anticarsia genunatalis nuclear
polyhedrosis virus contains tandemly repeated DNA

128
sequences. Virus Research 41. 123-132.
Gonzalez, M. A., Smith, G. E. & Summers, M. D. 1989.
Insertion of the SfMNPV polyhedrin gene into an AcMNPV
polyhedrin deletion mutant during viral infection.
Virology 170. 160-175.
Granados, R. R. & Federici, B. A. 1986. "The Biology of
Baculoviruses". CRC Press, Inc. Boca Raton, FL. VI, pp,
1-275.
Granados, R. R. & Lawler, K. A. 1981. In vivo pathway of
Autographa cali fornica baculovirus invasion and
infection. Virology 108. 297-308.
Granados, R. R. & Williams, K. A. 1986. In vivo infection
and replication of baculoviruses. In "The Biology of
Baculoviruses". Granados, R. R. & Federici, B. A., Eds.
Boca Raton, Florida: CRC Press, Inc. VI,89-108.
Grner, A. 1986. Specificity and safety of baculoviruses. In
"The Biology of Baculoviruses". Granados, R. R. &
Federici, B. A., Eds. Boca Raton, Florida: CRC Press,
Inc. VI,177-202.
Gross, C. H., Wolgamot, G. M., Russell, R. L., Pearson, M.
N. & Rohrmann, G. F. 1993. A 37-kilodalton glycoprotein
from a baculovirus of Orgyia pseudotsugata is localized
to cytoplasmic inclusion bodies. Journal of Virology
67. 469-475.
Grua, M. A., Buller, P. L., & Weaver, R. F. 1981. Alpha
amanitin-resistant viral RNA synthesis in nuclei
isolated from nuclear polyhedrosis virus-infected
Heliothis zea larvae and Spodoptera frugiperda cells.
Journal of Virology 38. 916-921.
Guarino, L. A. Sc Summers, M. D. 1986. Interspersed
homologous DNA of Autographa cali fornica nuclear
polyhedrosis virus enhances delayed-early gene
expression. Journal of Virology 60. 215-223.
Guarino, L. A. Sc Summers, M. D. 1988. Functional mapping of

129
Autographa cali fornica nuclear polyhedrosis virus genes
for late gene expression. Journal of Virology 62. 463-
471.
Hansen, J. E., Lund, 0., Engelbrecht, J., Bohr, H., Nielsen,
J. 0., Hansen, J.-E. S. & Brunak, S. 1995. Prediction
of 0-glycosylation of mammalian proteins: specificity
patterns of UDP-GalNAc: polypeptide N-
acetylgalactosaminyltransferase. Biochemistry Journal
308. 801-813.
Hawtin, R. E., King, L. A. & Possee, R. D. 1992. Prospects
for the development of a genetically engineered
baculovirus insecticide. Pesticide Science 34. 9-15.
Heringa, J. & Argos, P. 1994. Evolution of viruses as
recorded by their polymerase. In "The Evolutionary
Biology of Viruses". Mrse, S. S. Ed. Raven Press, New
York, pp, 87-103.
Higgins, D. G., Thompson, J. D., & Gibson, T. J. 1996. Using
CLUSTAL for multiple sequence alignments. In "Computer
Methods for Macromolecular Sequence Analysis".
Dolittle, R. F. Ed. Methods in Enzymology 266, 383-402.
Hill, J. E. & Faulkner, P. 1994. Identification of the gp67
gene of a baculovirus pathogenic to the spruce budworm,
Choristoneura fumiferana multinucleocapsid nuclear
polyhedrosis virus. Journal of General Virology 75.
1811-1813.
Hodges, R. W., Dominick, D. R., Davis, D. R., Ferguson, D.
C., Franclemont, J. G., Munroe, E. G., & Powell, J. A.
1983. "Check List of The Lepidoptera of America North
of Mexico". E. W. Classey Limited and The Wedge
Entomological Research Foundation, London, pp, 1-284.
Hong, T., Braunagel, S. C. & Summers, M. D. 1994.
Transcription, translation, and cellular localization
of PDV-E66: a structural protein of the PDV envelope of
Autographa cali fornica nuclear polyhedrosis virus.
Virology 204. 210-222.

130
Hooft van Iddekinge, B. J. L. Smith, G. E. & Summers, M.
D. 1983. Nucleotide sequence of the polyhedrin gene of
Autographa cali fornica nuclear polyhedrosis virus.
Virology 131. 561-565.
Hu, J., Ding, H. & Wu, X. 1993. Cloning and sequencing of
Attacus ricini nuclear polyhedrosis virus polyhedrin
gene. I Chuan Hsueh Pao 20. 300-304.
Hu, Z. H., Liu, M. F., Jin, F., Wang, Z. X., Liu, X. Y., Li,
M. J., Liang, B. F. & Xie, T. E. 1993. Nucleotide
sequence of the Buzura suppressaria single nucleocapsid
nuclear polyhedrosis virus polyhedrin gene. Journal of
General Virology 74. 1617-1620.
Huber, J. 1986. Use of baculoviruses in pest management
programs. In "The Biology of Baculoviruses". Granados,
R. R. & Federici, B. A., Eds. Boca Raton, Florida: CRC
Press, Inc. V2,181-202.
Jehle, J. A. & Backhaus, H. 1994. The granulin gene region
of Cryptophlebia leucotrea granulosis virus: sequence
analysis and phylogenetic considerations. Journal of
General Virology 75, 3667-3671.
Johnson, D. W. & Maruniak, J. E. 1989. Physical map of
Anticarsia gemmatalis nuclear polyhedrosis virus
(AgMNPV-2) DNA. Journal of General Virology 70. 1877-
1883 .
Jones, D. T., Taylor, W. R. & Thornton, J. M. 1994. A model
recognition approach to the prediction of all-helical
membrane protein structure and topology. Biochemistry
31,3038-3049.
Kaupp, W. J. & Burke, R. F. 1984. A staining technique for
gene of Bombyx mori nuclear polyhedrosis virus. Journal
of Virology 54. 436-445.
Keating, S. T., Burand, J. P., & Elkington, J. S. 1989. DNA
hybridization assay for detection of gypsy month
nuclear polyhedrosis virus in infected gypsy moth
(Lymantria dispar L.) Larvae. Applied and

131
Environmental Microbiology 55. 2749-2754.
Keddie, A. B., Aponte, G. W., & Volkman, L. E. 1989. The
pathway of infection of Autographa cali fornica nuclear
polyhedrosis virus in an insect host. Science 243.
1728-1730.
Keddie, A. B. & Volkman, L. E. 1985. Infectivity difference
between the two phenotypes of Autographa californica
nuclear polyhedrosis virus: importance of the 64k
envelope glycoprotein. Journal of General Virology 66.
1195-1200.
Kelly, D. C. 1977. The DNA contained by nuclear polyhedrosis
viruses isolated from four Spodoptera sp. (Lepidoptera,
Noctuidae): genome size and homology assessed by DNA
reassociation kinetics. Virology 76. 468-471.
King, L. A. & Possee, R. D. 1992. "The Baculovirus
Expression System". Chapman & Hall, London, pp, 1-229.
Kool, M., Broer, R., Zuidema, D., Goldbach, R. W. & Vlak, J.
M. 1994. Nucleotide sequence and genetic organization
of a 7.3 kb region (map unit 47 to 52.5) of Autographa
californica nuclear polyhedrosis virus fragment EcoRI-
C. Journal of General Virology 75. 487-494.
Kovacs, G. R., Guarino, L. A., Graham, B. L. & Summers, M.
D. 1991. Identification of spliced baculovirus RNAs
expressed late in infection. Virology 185. 633-643.
Kozak, M. 1986. Point mutations define a sequence flanking
the AUG initiator codon that modulates translation by
eukaryotic ribosomes. Cell 44. 283-292.
Kumar, S., Tamura, K. & Nei, M. 1993. MEGA: Molecular
Evolutionary Genetics Analysis, Version 1.01. The
Pennsylvania State University. University Park, PA
16802 .
Kuzio, J., Jaques, R. & Faulkner, P. 1989. Identification of
p74, a gene essential for virulence of baculovirus
occlusion bodies. Virology 173. 759-763.

132
Kuzio, J., Rohel, D. Z., Curry, C. J., Carstens, E. B. &
Faulkner, P. 1984. Nucleotide sequence of the plO
polypeptide gene of Autographa californica nuclear
polyhedrosis virus. Virology 139. 414-418.
Kyte, J. & Doolittle, R. F. 1982. A simple method for
displaying the hydropathic character of a protein.
Journal of Molecular Biology 157. 105-132.
Leisy, D., Nesson, M., Pearson, M., Rohrmann, G. &
Beaudreau, G. S. 1986a. Location and nucleotide
sequence of the Orgyia pseudotsugata single
nucleocapsid nuclear polyhedrosis virus polyhedrin
gene. Journal of General Virology 67. 1073-1079.
Leisy, D., Rohrmann, G. & Beaudreau, G. 1984. Conservation
of genome organization in two multicapsid nuclear
polyhedrosis viruses. Journal of Virology 52. 699-702.
Leisy, D., Rohrmann, G. & Beaudreau, G. 1986b. The
nucleotide sequence of the polyhedrin gene region from
the multicapsid baculovirus of Orgyia pseudotsugata.
Virology 153. 280-288.
Leisy, D. J., Rohrmann, G. F., Nesson, M. & Beaudreau, G. S.
1986c. Nucleotide sequencing and transcriptional
mapping of the Orgyia pseudotsugata multicapsid nuclear
polyhedrosis virus plO gene. Virology 153. 157-167.
Li, W.-H. Sc Graur, D. 1991. "Molecular Evolution". Sinauer
Associates, Inc. Sunderland, MA. pp, 99-135.
Liu, J.-C. Sc Maruniak, J. E. 1995. Nucleotide sequence and
transcriptional analysis of the gp41 gene of Spodoptera
frugiperda nuclear polyhedrosis. Journal of General
Virology 76. 1443-1450.
Liu, J. J. Sc Carstens, E. B. 1995. Identification,
localization, transcription, and sequence analysis
of the Choristoneura fumiferana nuclear polyhedrosis
virus DNA polymerase gene. Virology 209. 538-549.
Loh, L. C., Hamm, J. J. & Huang, E.-S. 1981. Spodoptera

133
frugiperda nuclear polyhedrosis virus genome: physical
maps for restriction endonucleases BamHI and Hindlll.
Journal of Virology 38. 922-931.
Luckow, V. A. & Summers, M. D. 1988a. Trends in the
development of baculovirus expression vectors.
Bio/Technology 6. 47-55.
Luckow, V. A. Sc Summers, M. D. 1988b. Signals important for
high-level expression of foreign genes in Autographa
californica nuclear polyhedrosis virus expression
vectors. Virology 167. 56-71.
Ma, S.-W., Corsaro, B. G., Klebba, P. E. & Fraser, M. J.
1993. Cloning and sequence analysis of a p40 structural
protein gene of Helicoverpa zea nuclear polyhedrosis
virus. Virology 192. 224-233.
Madden, T. L., Tatusov. & Zhang, J. 1996. Applications of
network BLAST server. In "Computer Methods for
Macromolecular Sequence Analysis". Doolittle, R. F. Ed.
Methods in Enzymology 266, 131-141.
Madej, T., Boguski, M. S. & Bryant, S. H. 1995. Threading
analysis suggests that the obese gene product may be a
helical cytokine. Federation of European Biochemical
Societies Letters 373. 13-18.
Maeda, S. 1989. Expression of foreign genes in insects using
baculovirus vectors. Annual Review of Entomology 34.
351-372.
Maeda, S., Kawai, T., Obinata, M., Fujiwara, H., Horiuchi,
T., Saeki, Y., Sato, Y. & Furusawa, M. 1985. Production
of human alpha-interferon in silkworm using a
baculovirus vector. Nature 315. 592-594.
Maeda, S., Volrath, S. L., Hanzlik, T. N., Harper, S. A.,
Majima, K., Maddox, D. W., Hammock, B. D. & Fowler, E.
1991. Insecticidal effects of an insect-specific
neurotoxin expressed by a recombinant baculovirus.
Virology 184. 777-780.

134
Majima, K., Robara, R. & Maeda, S. 1993. Divergence and
evolution of homologous regions of Bombyx mori nuclear
polyhedrosis virus. Journal of Virology 67. 7513-7521.
Maniatis, T., Fritsch, E. F. & Sambrook, J. 1989. "Molecular
Cloning: A Laboratory Manual", 2nd Ed. Cold Spring
Harbor, New York: Cold Spring Harbor Laboratory. V3,
pp, B9-B14.
Maruniak, J. E. 1979. Biochemical characterization of
baculovirus structural and infected TN-368 cell
polypeptides, glycoproteins, and phosphoproteins. Ph.D.
dissertation,' University of Texas, Austin.
Maruniak, J. E. 1986. Baculovirus structural proteins and
protein synthesis. In "The Biology of Baculoviruses".
Granados, R. R. & Federici, B. A., Eds. Boca Raton,
Florida: CRC Press, Inc. VI, pp, 129-146.
Maruniak, J. E., Brown, S. E. & Kundson, D. L. 1984.
Physical maps of SfMNPV baculovirus DNA and its genomic
variants. Virology 136. 221-234.
Maruniak, J. E., & Summers, M. D. 1981. Autographa
cali fornica nuclear polyhedrosis virus phosphoproteins
and synthesis of intracellular proteins after virus
infection. Virology 109. 25-34.
McLachlin, J. R. & Miller, L. K. 1994. Identification and
characterization of vlf-1, a baculovirus gene involved
in very late gene expression. Journal of Virology 68.
7746-7756.
Miller, L. K. 1988. Baculoviruses as gene expression
vectors. Annual Review of Microbiology 42. 177-199.
Miller, L. K. 1996. Insect viruses. In "Fundamental
Virology". Fields, B. N., Knipe, D. M., & Howley, P. M.
Eds. Lippincott-Raven, Publisher. Philadelphia, pp,
401-424.
Minion, F. C., Coons, L. B. & Broome, J. R. 1979.
Characterization of the polyhedral envelope of the

135
nuclear polyhedrosis virus of Heliothis virescens.
Journal of Invertebrate Pathology 34. 303-307.
Miyamoto, M. M. 1985. Consensus caldograms and general
classifications. Cladistics 1. 186-189.
Monsma, S. A. & Blissard, G. W. 1995. Identification of a
membrane fusion domain and an oligomerization domain in
the baculovirus gp64 envelope fusion protein. Journal
of Virology 69. 2583-2595.
Monsma, S. A., Oomens, A. G. P. & Blissard, G. W. 1996. The
gp64 envelope fusion protein is an essential
baculovirus protein required for cell-to-cell
transmission of infection. Journal of Virology 70.
4607-4616.
Moraes, R. R. & Maruniak, J. E. 1997. Detection and
identification of multiple baculoviruses using the
polymerase chain reaction (PCR) and restriction
endonuclease analysis. Journal of Virological Methods
63 209-217.
Morse, M. A., Marriott, A. C. & Nuttall, P. A. 1992. The
glycoprotein of togoto virus (a tick-borne orthomyxo-
like virus) is related to the baculovirus glycoprotein
gp64. Virology 186. 640-646.
Moscardi, F. 1989. Use of viruses for pest control in
Brazil: the case of the nuclear polyhedrosis virus of
the soybean caterpillar, Anticarsia gemmatalis.
Memorias do Instituto Oswaldo Cruz 84. 51-56.
Moscardi, F. & Sosa-Gomez, D. R. 1993. A case study in
biological control: soybean defoliating caterpillars in
Brazil. In "International Crop Sciences I". Buxton, D.
R., Shibles, R., Forsberg, R. A., Blad, B. L., Asay, K.
H., Paulsen, G. M., & Wilson, R. F. Eds. Crop Science
Society of American, Inc. Madison, WI. pp, 115-119.
Murphy, F. A., Fauquet, C. M., Bishop, D. H. L., Ghabrial,
S. A., Jarvis, A. W., Martelli, G. P., Mayo, M. A. &
Summers, M. D. 1995. "Virus Taxomony". Springer-Verlag

136
Wien, New York, pp, 104-113.
Mustafa, A. & Yuen, L. 1991. Identification and sequencing
of the Choristoneura biennis entomopoxvirus DNA
polymerase gene. DNA Sequence 2. 39-45.
Nagamine, T., Sugimori, H., Nakamura, K., Saga, S. &
Kobayashi, M. 1991. Nucleotide sequence of the gene
coding for p40, an occluded, virion-specific polypeptide
of Bombyx mori nuclear poiyhedrosis virus. Journal of
Invertebrate Pathology 58. 290-293.
Naser, W. L. & Miltenburger, H. G. 1983. Rapid baculovirus
detection, identification, and serological
classification by western blotting-ELISA using a
monoclonal antibody. Journal of General Virology 64.
639-647.
Oakey, R., Cameron, I. R., Davis, B., Davis, E. & Possee, R.
D. 1989. Analysis of transcription initiation in the
Panolis flanimea nuclear poiyhedrosis virus polyhedrin
gene. Journal of General Virology 70. 769-775.
Ooi, B. G. & Miller, L. K. 1991. The influence of antisense
RNA on transcriptional mapping of the 5' terminus of a
baculovirus RNA. Journal of General Virology 72. 527-
534 .
O'Reilly, D. R. Sc Miller, L. K. 1989. A baculovirus blocks
insect molting by producing ecdysteroid UDP-glucoysl
transferase. Science 245. 1110-1112.
O'Reilly, D. R. Sc Miller, L. K. 1990. Regulation of
expression of a baculovirus ecdysteroid UDP-
glucotransferase gene. Journal of virology 245. 1110-
1112 .
O'Reilly, D. R. Sc Miller, L. K. 1991. Improvement of a
baculovirus pesticide by deletion of the egt gene.
Bio/Technolocry 9. 1086-1089.
O'Reilly, D. R., Miller, L. K Sc Luckow, V. A. 1992.
"Baculovirus Expression Vectors". W. H. Freeman and

137
Company, New York, pp, 1-347.
Pellock, B. J., Lu, A., Meagher, R. B., Weise, M. J. &
Miller, L. K. 1996. Sequence, function, and
phylogenetic analysis of an ascovirus DNA polymerase
gene. Virology 216. 146-157.
Pritchett, D. W., Young, S. Y., & Yearin, W. C. 1982.
Dissolution of Autographa cali fornica nuclear
polyhedrosis virus polyhedra by the digestive fluid of
Trichoplusia ni (Lepidoptera: Noctuidae) larvae.
Journal of Invertebrate Pathology 39. 354-361.
Rankin, C., Ooi, B. G. & Miller, L. K. 1988. Eight base
pairs encompassing the transcriptional start point are
the major determinant for baculovirus polyhedrin gene
expression. Gene 70. 39-49.
Richardson, C. D. 1995. "Baculovirus Expression Protocols".
Humana Press Inc., New Jersey, pp, 1-418.
Riegel, C. I., Lahner-Herrera, C. & Slavicek, J. M. 1994.
Identification and characterization of the ecdystroid
UDP-glucosyltransferase gene of the Lymantria dispar
multinucleocapsid nuclear polyhedrosis virus. Journal
of General Virology 75, 829-838.
Rohrmann, G. F. 1986. Polyhedrin structure. Journal of
General Virology 67. 1499-1513.
Rohrmann, G. F. 1992. Baculovirus structural proteins.
Journal of General Virology 73. 749-761.
Rost, B. & Sander, C. 1993. Prediction of protein secondary
structure at better than 70% accuracy. Journal of
Molecular Biology 232. 584-599.
Russell, R. L. Q. & Rohrmann, G. F. 1990. A baculovirus
polyhedron envelope protein: immunogold localization in
infected cells and mature polyhedra. Virology 174. 177-
184 .
Saitou, N. & Nei, M. 1987. The neighbor-joining method:
a

138
new method for constructing phylogenetic trees.
Molecular Biology and Evolution 4. 406-425.
Sanger, F., Nicklen, S. & Coulson, A. R. 1977. DNA
sequencing with chain-terminating inhibitors.
Proceedings of National Academy Sciences USA 74. 5463--
5467.
Schomburg, D. & Lessel, U. 1995. Bioinformatics: from
nucleotide acids and proteins to cell mechanism. GBF
Monographs 18, pp, 1-195.
Schuler, G. D., Epstein, J. A., Ohkawa, H & Kans, J. A.
1996. Entrez: molecular biology database and retrieval
system. In "Computer Methods for Macromolecular
Sequence Analysis". Doolittle, R. F. Ed. Methods in
Enzymology 266, 141-162.
Schulze-Kremer, S. 1996. "Molecular Bioinformatics". Walter
de Gruyter, Berlin, Germany, pp, 1-296.
Shuler, M. L., Wood, H. A., Granados, R. R. & Hammer, D. A.
1995. "Baculovirus Expression System an Biopesticides".
Wiley-Liss Inc., New York, pp, 1-259.
Smith, G. E. & Summers, M. D. 1978. Analysis of baculovirus
genomes with restriction endonucleases. Virology 89.
517-527.
Smith, G. E. Sc Summers, M. D. 1982. DNA homology among
subgroup A, B, and C baculoviruses. Virology 123. 393-
406 .
Smith, G. E., Summers, M. D. & Fraser, M. J. 1983.
Production of human (5-interferon in insect cells
infected with a baculovirus expression vector.
Molecular and Cellular Biology 3. 2156-2165.
Smith, I. R. L., van Beek, N. A. M., Podgwaite, J. D. &
Wood, H. A. 1988. Physical map and polyhedrin gene
sequence of Lymantria dispar nuclear polyhedrosis virus
Gene 71. 97-105.

139
Stiles, B. & Wood, H. A. 1983. A study of the glycoproteins
of Autographa- californica nuclear polyhedrosis virus
(AcNPV). Virology 131. 230-241.
Stoltz, D. B., Pavan, C. & Da Chunha, A. B. 1973. Nuclear
polyhedrosis virus: a possible example of de novo
intranuclear membrane morphogenesis. Journal of General
Virology 19. 145-150.
Summers, M. D. & Smith, G. E. 1978. Baculovirus structural
polypeptides. Virology 84. 390-402.
Summers, M. D. & Smith, G. E. 1987. A Manual of Methods for
Baculovirus Vectors and Insect Cell Culture
Procedures. Texas Agricultural Experiment Station, pp,
1-57.
Summers, M. D. & Volkman, L. E. 1976. Comparison of
biophysical and morphological properties of occluded
and extracellular nonoccluded baculovirus from in vivo
and in vitro host systems. Journal of Virology 17. 962-
972 .
Swafford, D. L. 1990. "PAUP: Phylogenetic Analysis Using
Parsimony". Version 3.0. Illinois Natural History
Survey, Champaign, IL.
Taada, Y. & Hess, R. T. 1976. Development of a nuclear
polyhedrosis virus in midgut cells and penetration of
the virus into the hemocoel of the armyworm,
Pseudaletia unipuncta. Journal of Invertebrate
Pathology 28. 67-76.
Taada, Y., Hess, R. T., & Omi, E. M. 1975. Invasion of a
nuclear polyhedrosis virus in midgut of the armyworm,
Psedoaletia unipuncta, and the enhancement of
synergistic enzyme. Journal of Invertebrate Pathology
18, 307-312.
Taada, Y. & Kaya, H. K. 1993. "Insect Pathology". Academic
Press, Inc., San Diego, CA. pp, 171-244.
Theilmann, D. A., Chantler, J. K., Stewart, S., Flipsen, H.

140
T. M., Vlak, J. M. & Crook, N. E. 1996.
Characterization of a highly conserved baculovirus
structural protein that is specific for occlusion-
derived virions. Virology 218. 148-158.
Theilmann, D. A. & Stewart, S. 1991. Identification and
characterization of the IE-1 gene of Orgyia
pseudotsugata multicapsid nuclear polyhedrosis virus.
Virology 180. 492-508.
Thiem, S. M. & Miller, L. K. 1989. Identification, sequence,
and transcriptional mapping of the major capsid protein
gene of the baculovirus Autographa californica nuclear
polyhedrosis virus. Journal of Virology 63. 2008-2018.
Tomalski, M. D., Wu, J. & Miller, L. K. 1988. The location,
sequence, transcription, and regulation of a
baculovirus DNA polymerase. Virology 167. 591-600.
Traverner, M. P. & Connor, E. F. 1992. Optical enumeration
technique for detection of baculovirus in the
environment. Environmental Entomology 21. 307-313.
van Oers, M. M., Flipsen, J. T. M., Reusken, C. B. E. M.,
Sliwinsky, E. L., Goldbach, R. W. & Vlak, J. M. 1993.
Functional domains of the plO protein of Autographa
californica nuclear polyhedrosis virus. Journal of
General Virology 74. 563-574.
van Oers, M. M., Flipsen, J. T. M., Reusken, C. B. E. M. &
Vlak, J. M. 1994. Specificity of baculovirus plO
functions. Virology 200. 513-523.
van Strien, E. A., Jansen, B. J. H., Mans, R. M. W.,
Zuidema, D. & Vlak, J. M. 1996. Sequence and
transcriptional analysis of the ubiquitin gene cluster
in the genome of Spodoptera exigua
nucleopolyhedrovirus. Journal of General Virology 11.
2311-2319.
van Strien, E. A., Zuidema, D., Goldbach, R. W. & Vlak, J.
M. 1992. Nucleotide sequence and transcriptional
analysis of the polyhedrin gene of Spodoptera exigua

141
nuclear polyhedrosis virus. Journal of General Virology
73, 2813-2821.
Volkman. L. E. 1986. The 64k envelope protein of budded
Autographa californica nuclear polyhedrosis virus.
Current Topics of Microbiology and Immunology 131,
103-118.
Volkman, L. E. & Goldsmith, P. A. 1984. Budded Autographa
cali fornica NPV 64k protein: further biochemical
analysis and effects of post-immunoprecipitation sample
preparation conditions. Virology 143. 185-195.
Volkman, L. E. & Goldsmith, P. A. 1985. Mechanism of
neutralization of budded Autographa cali fornica nuclear
polyhedrosis virus by a monoclonal antibody: inhibition
of entry by adsorptive endocytosis. Virology 143. 185-
195 .
Volkman, L. E. & Keddie, B. A. 1990. Nuclear polyhedrosis
virus pathogenesis. Seminars in Virology 1. 249-256.
Ward, V. K., Fleming, S. B. & Kalmakoff, J. 1987. Comparison
of a DNA-DNA dot-blot hybridization assay with light
microscope and radioimmunoassay for the detection of a
nuclear polyhedrosis virus. Journal of Virological
Methods 15. 65-73.
Webb, S. E. & Shelton, A. M. 1990. Effect of age structure
on the outcome of viral epizootics in field populations
of imported cabbageworm (Lepidoptera:Pieridae).
Environmental Entomology 19, 111-116.
Wheeler, W. C. 1991. Congruence among data sets: a bayesian
approach. In "Phylogenetic Analysis of DNA Sequences".
Eds, Miyamoto, M. M. & Cracraft, J. Oxford University
Press, New York, pp, 334-346.
Whitford, M. & Faulkner, P. 1992a. A structural polypeptide
of the baculovirus Autographa californica nuclear
polyhedrosis virus contains O-linked N-
acetylglucosamine. Journal of Virology 66. 3324-3329.

142
Whitford, M. & Faulkner, P. 1992b. Nucleotide sequence and
transcriptional analysis of a gene encoding gp41, a
structural glycoprotein of the baculovirus Autographa
cali fornica nuclear polyhedrosis virus. Journal of
Virology 66. 4763-4768.
Whitford, M., Stewart, S., Kuzio, J. & Faulkner, P. 1989.
Identification and sequence analysis of a gene encoding
gp67, an abundant envelope glycoprotein of the
baculovirus Autographa cali fornica nuclear polyhedrosis
virus. Journal of Virology 63. 1393-1399.
Whitt, M. A. & Manning, J. S. 1988. A phosphorylated 34-kDa
protein and a subpopulation of polyhedrin are thiol
linked to the carbohydrate layer surrounding a
baculovirus occlusion body. Virology 163. 33-42.
Williams, G. V., Rohel, D. Z., Kuzio, J., & Faulkner, P.
1989. A cytopathological investigation of Autographa
cali fornica nuclear polyhedrosis virus plO gene
function using insertion/deletion mutants. Journal of
General Virology 70. 187-202.
Wilson, J. A., Hill, J. E., Kuzio, J. & Faulkner, P. 1995.
Characterization of the baculovirus Choristoneura
fumiferana multicapsid nuclear polyhedrosis virus plO
gene indicates that the polypeptide contains a
coiled-coil domain. Journal of General Virology 76.
2923-2932.
Wood, H. A. & Granados, R. R. 1991. Genetically engineered
baculoviruses as agents for pest control. Annual Review
of Microbiology 45, 69-87.
Zanotto, P. M. de A., Gao, G. F., Gritsun, T., Marin, M. S.,
Jiang, W. R., Venugopal, K., Reid, H. W. & Gould, E. A.
1995. An arbovirus cline across the northern
hemisphere. Virology 210. 152-159.
Zanotto, P. M. de A., Kessing, B. D. & Maruniak, J. E. 1993.
Phylogenetic interrelationships among baculoviruses:
evolutionary rates and host associations. Journal of
Invertebrate Pathology 62. 147-164.

143
Zanotto, P. M. de A., Sampaio, M. J. A., Johnson, D. W.,
Rocha, T. L. & Maruniak, J. E. 1992. The Anticarsia
gernmatalis nuclear polyhedrosis virus polyhedrin gene
region: sequence analysis, gene product and structural
comparisons. Journal of General Virology 73. 1049-1056.
Zuidema, D., van Oers, M. M., van Strien, E. A., Caballero,
P. C., Klok, E.-J., Goldbach, R. W. & Vlak, J. M. 1993.
Nucleotide sequence and transcriptional analysis of the
plO gene of Spodoptera exigua nuclear polyhedrosis
virus. Journal of General Virology 74. 1017-1024.

BIOGRAPHICAL SKETCH
Jaw-Ching Liu was born in Taiwan, on May 8, 1966. He
entered National Chung-Hsing University (NCHU) in September
1984 and completed his Bachelor of Science degree in the
Entomology Department in June 1988. He started his Master
of Science program in the same department in September 1988,
and took a leave in December 1989. From December 1989 to
May 1991, he worked at the Institute of Biomedicine,
Academic Sinica, as a research assistant. Then, he went
back to NCHU in June 1991, and finished his Master of
Science degree in December 1992.
He started his Ph.D. program with Dr. James Maruniak in
January 1993 in the Department of Entomology and Nematology
at the University of Florida. Presently, he is finishing
his Ph.D.
144

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
ratnes E. Maruniak, Chairman
Associate Professor of
Entomology and Nematology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree
Professor of Molecular
Genetics and Microbiology
Doctor of Philosophy.
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, irp-yscope and quality, as
a dissertation for the degree of Docj^qr of Philosophy
Pauline 0. Lawrence
Professor of Entomology and
Nematology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
<7rv
Susan E. Webb
Associate Professor of
% *
Entomology and Nematology

This dissertation was submitted to the Graduate Faculty
of the College of Agriculture and to the Graduate School and
was accepted as partial fulfillment of the requirements for
the degree of Doctor of Philosophy.
May, 1997
Dean, College of Agriculture
Dean, Graduate School



APPENDIX C
NUCLEOTIDE SEQUENCE OF Anticarsia gemmatalis MNPV Pstl-
Hindlll FRAGMENT AND TRANSLATED AMINO ACID SEQUENCE OF GP41
GENE
1
AAGCTTGCCG
ATACGCCGGT
GCCGCACCAT
GGGCCCGCCG
AAGAAGAAAA
51
CGTTGTCGCC
GAACGCTTTG
GGTCAGAATC
TGGCGACGCA
CCATCGTCCC
101
CCAAAAAGCA
AAAATTGGAC
GAGTCTGAAC
AAGATTAAAT
ACGACAGCGA
151
ACTGCTCATT
CACTATCTAT
ACGAAGGGTT
TTGCACCGAC
AAACAACAAT
201
GCAATTTGAA
CGTGATAAAA
ATTTACAAAG
TAAAAGTAAA
GAAAACGGGC
251
GCTTCCATTT
TGGCACATTA
TTTTGCGCAA
ATTTCTACTT
CAAGCGGTTA
301
CGAGTTTGAA
TTCCACCCCG
GCAGTCAGCC
TCGCACCTTT
CAAACGGTAC
351
ACACCGACGG
TCTCATTATA
AAGGTGCACA
TTATGTGCGA
TGAATGCTGC
401
AAAGCGGAAT
TGCGCAGATA
CATCAAAGGA
GAAAACGGCT
TCAACGTAGC
451
GTTTCGCAAT
TGCGAAAGTA
TCCTGTGTCA
ACGTGTCAGT
TTTCAAACGC
501
TTTTGCTGGG
ATGCGCCATT
CTGTTGCTGC
TGTTTAACGT
GGAAAAATTT
551
TCGATATTAA
ATTTGCTTGT
CATTTTGTTA
CTTTTAGTAG
CGTTGTTTTG
601
TAACAACAAT
TATATTATAA
GTAAT C CATA
CGTTGTATTT
TGCAATCATA
651
AGAACGCATT
AAAAAACCAT
M
GAATGAACGG
N E R
GACGGCTTTT
D G F Y
ATTTGAACGT
L N V
701
TTCGCAGGCG
CCTGCGAGAC
ACCCGTTTGC
ACCCACCAGC
GCGACCGTTA
S Q A
P A R H
P F A
P T S
A T V T
751
CTAGTTCGCA
AAGCGGTAAT
TATCCAACCA
CAATGTCCAC
AATGGTGCAG
S S Q
S G N
Y P T T
M S T
M V Q
801
CGGACAGATC
GCGGCAGCGC
AAACTCGCTT
GTTAAAACCA
AAGAAGACGC
R T D R
G S A
N S L
V K T K
EDA
851
CAGCGGCGAA
TCTATTTGGT
ACAACAAGTG
CACAGACTAT
GTACATAAAA
S G E
S I W Y
N K C
T D Y
V H K X
901
TTATTCGCTA
TTATCGCTGT
AACGACATGT
CTGAATTGAC
TCCTTTAATG
I R Y
Y R C
N D M S
E L T
P L M
951
ATTCATTTTA
TCAACACAAT
ACGCGACATG
TGCATTGACA
GCAACCCTGT
I H F I
N T I
RDM
C I D S
N P V
1001
TAGTGTAAAC
ATAATCAAGC
GCGTGCAAAC
TGACGAAGAA
ATTGTTCGCC
S V N
I I K R
V Q T
DEE
I V R H
1051
ACCTAATTGG
GTTGCAAAAA
GAACTGCGTC
AGAATAGCGT
GGCAGAGTCC
L I G
L Q K
E L R Q
N S V
AES
1101
ATCGATTCGG
ATTCCAACAT
TTTTCAGCCT
TCGTTTGTAC
TCAATTCGCT
I D S D
S N I
F Q P
S F V L
N S L
1151
GCCGGCGTAC
GCGCAAAAAT
TTTACAACGG
CGGCGCAGAC
ACGCTTGGCA
PAY
A Q K F
Y N G
GAD
T L G K
1201
AAGACGCGCT
CAACGAGGCG
GCCAAACAGC
TTAGTTTGGC
CGTGCAGTAC
DAL
N E A
A K Q L
SLA
V Q Y
1251
ATGGTGTCGG
AAGCGGTCAC
GTGCAGTATT
CCCATCCCGT
TGCCGTTTGA
M V S E
A V T
C S I
P I P L
P F D
115


57
sequencing. When the fmolTiy! DNA sequencing system was used
for DNA sequencing, one inconsistent nucleotide pair was
always found (three repetitions) at nucleotide 1,116, C
versus T, from the gp4l coding strand and non-coding strand
The data were confirmed by the Sequenase sequencing system
which showed this specific nucleotide pair should be C/G.
No specific secondary structure of DNA was found around the
nucleotide at 1,116.
An open reading frame (ORF) of 1,005 nucleotides was
identified containing the gp4l gene from nucleotide 669 to
1,673. The transcriptional direction of this gene was
oriented from right hand to left hand (relative to the
AcMNPV polyhedrin gene) in the conventional genome map (Fig
3.1). Two NPV late gene motifs (TAAG) were found at -17 to
-20 and -48 to -51 nucleotides from the protein translation
initiation site (ATG) respectively. A transcriptional stop
signal AATAAA was found downstream at nucleotide 745 from
the translation stop site (TGA). In additional to the
transcriptional motifs, the translation start site fits the
Kozak principle of AXXATG(A/G) (Kozak, 1986). When the
nucleotide sequence and translated amino acid sequence were
compared with four other published NPVs gp4l gene sequences


46
According to the DNA sequence, the distance between the gp41
gene transcriptional start site to poly(A) signal is 1,433
nucleotides. By adding the poly(A) tail (a poly(A) tail
usually contains 200 bases), the estimated size of the gp41
gene transcript was about 1.6 kb. On the other hand, the
2.8 kb transcript did not fit the transcription termination
stop signal principle. One explanation for the 2.8 kb
transcript is the poly(A) signal which was located 394
nucleotides downstream from the translation stop codon was
bypassed. This phenomena of ignoring the major
transcriptional stop signal has been reported both in the
gp41 gene (Whitford & Faulkner, 1992b) and in the p39 capsid
gene of AcMNPV (Thiem & Miller, 1989). Another explanation
for the two different size transcripts is that the 1.6 kb
transcript was a spliced product from the 2.8 kb RNA.
However, this explanation is not favored because the gp41
gene coding sequence does not seem to be separated into two
regions. The gene splicing is not a common phenomena in
baculoviruses except for the IE1 or IEO (Kovacs et al.,
1991). The 2.8 kb transcript was also acknowledged that
could be a transcription product of the gene other than gp41
since the SfMNPV EcoRI-S fragment was used as a probe.


135
nuclear polyhedrosis virus of Heliothis virescens.
Journal of Invertebrate Pathology 34. 303-307.
Miyamoto, M. M. 1985. Consensus caldograms and general
classifications. Cladistics 1. 186-189.
Monsma, S. A. & Blissard, G. W. 1995. Identification of a
membrane fusion domain and an oligomerization domain in
the baculovirus gp64 envelope fusion protein. Journal
of Virology 69. 2583-2595.
Monsma, S. A., Oomens, A. G. P. & Blissard, G. W. 1996. The
gp64 envelope fusion protein is an essential
baculovirus protein required for cell-to-cell
transmission of infection. Journal of Virology 70.
4607-4616.
Moraes, R. R. & Maruniak, J. E. 1997. Detection and
identification of multiple baculoviruses using the
polymerase chain reaction (PCR) and restriction
endonuclease analysis. Journal of Virological Methods
63 209-217.
Morse, M. A., Marriott, A. C. & Nuttall, P. A. 1992. The
glycoprotein of togoto virus (a tick-borne orthomyxo-
like virus) is related to the baculovirus glycoprotein
gp64. Virology 186. 640-646.
Moscardi, F. 1989. Use of viruses for pest control in
Brazil: the case of the nuclear polyhedrosis virus of
the soybean caterpillar, Anticarsia gemmatalis.
Memorias do Instituto Oswaldo Cruz 84. 51-56.
Moscardi, F. & Sosa-Gomez, D. R. 1993. A case study in
biological control: soybean defoliating caterpillars in
Brazil. In "International Crop Sciences I". Buxton, D.
R., Shibles, R., Forsberg, R. A., Blad, B. L., Asay, K.
H., Paulsen, G. M., & Wilson, R. F. Eds. Crop Science
Society of American, Inc. Madison, WI. pp, 115-119.
Murphy, F. A., Fauquet, C. M., Bishop, D. H. L., Ghabrial,
S. A., Jarvis, A. W., Martelli, G. P., Mayo, M. A. &
Summers, M. D. 1995. "Virus Taxomony". Springer-Verlag


47
Totally four potential open reading frame were identified
within the SfMNPV EcoRI-S fragment.
By primer extension analysis, the transcription start
site for the gp41 gene mRNA of SfMNPV-2 was mapped in the
promoter region within the TAAG motif at approximately
nucleotide -42 or -41 (T or A). This motif is conserved in
all baculovirus late genes, especially the baculovirus
structural proteins (Rohrmann, 1986; 1992; Rankin et al.,
1988). However, another transcriptional start site was
located at the -140 nucleotide for which no consensus motif
has been determined. The phenomenon in which the
transcription start site is dissimilar to a late gene
consensus motif is also found in the AcMNPV p74 gene (Kuzio
et al., 1989). Another explanation for the difference could
be a non-specific primer hybridization, since the
baculoviruses contain a large DNA genome.
An unexpected small ORF was located downstream of the
-140 nucleotide transcriptional start site, and the -140
nucleotide transcriptional start site may be used for a
bicistronic transcription. Similar bicistronic transcripts
have been reported by Kovacs et al. (1991). A translational
regulation mechanism is proposed in that paper since the


76
problem is approached using a congruent analysis (Miyamoto,
1985; Wheeler, 1991). The evolutionary relationship of
baculoviruses is revealed based on multiple phylogenetic
trees of baculovirus genes instead of a single gene. The
congruent results are concluded from six different
phylogenetic trees of baculovirus genes including either
structural proteins (polh, plO, gp64, and gp41) or enzymatic
proteins (dnapol and egt) The results will provide more
solid support for a current hypothesis of baculovirus
evolutionary pathway.
Methods
DNA Purification of LdMNPV
Lymantria dispar MNPV (LdMNPV) DNA (GYPCHEK, U.S.
Forest Service) was purified (Appendix D) from a commercial
preparation of polyhedra and used as a DNA template for PCR
amplification.
PCR Amplification and DNA Sequencing of LdMNPV gp41 Gene
A set of polymerase chain reaction (PCR) primers was


To my dear parents, family and friends


117
3401 CGCTTGATGA ACCACGAATC GCCGGCCAGT ACCAAACCGT ATTTGAACAA
3451 GTACAATTTT GACGAAAGCA GCAGCAGCAC GAGGAATCAG AGTTGAACAA
3501 CCGCGACTCG TCTGCAG
* TAAG is the transcription start site of baculovirus late
genes
* ATG is the protein translation start site
* AATAA is the poly(A) tail signal site


20
supported the hypothesis generated from the phylogenetic
tree of polyhedrin genes.
DNA polymerase genes have been classified into four
families including A, B, C, and X (Heringa & Argos, 1994).
The baculovirus DNA polymerase belongs to family B, which is
also the type of polymerase found in various other species
ranging from bacteria, viruses, yeasts and mammals (Heringa
& Argos, 1994). By comparing the nucleotide sequence of the
AcMNPV DNA polymerase gene with those from two other insect
DNA viruses, the ascovirus and entompoxvirus, it was
concluded that they have independent evolutionary paths
(Pellock et al., 1996).
Moreover, baculovirus egt genes were used to study
their phylogenetic relationships. The egt proteins range
from 55 to 60 kDa (O'Reilly Sc Miller, 1990; Riegel et al. ,
1994), and catalyze the transfer of glucose to ecdysteroids
(O'Reilly Sc Miller, 1989) The molting and pupation of
infected insect larvae have been shown to be blocked because
of an imbalance in this insect hormone (O'Reilly Sc Miller,
1989). Deletion of the egt gene can speed the killing time
of insect larvae by AcMNPV (O'Reilly Sc Miller, 1991).
However, histopathological investigation showed that the


(A) DNA polymerase gene
(B) egt gene
100
97
100
100 AcMNPV
BmMNPV
CfMNPV
OpMNPV
53
- LdMNPV
MbMNPV
SpliMNPV
LoGV
Scale: each is approximately equal to the distance of 0.006323
Figure 4.5. Phylogenetic tree of baculovirus dnapol (A), and egt (B) genes based on
the translated amino acid sequences. The number shown in each branch represents
the percentage of bootstrap confidence level. The neighbor-joining method was used
to construct the phylogenetic trees.


143
Zanotto, P. M. de A., Sampaio, M. J. A., Johnson, D. W.,
Rocha, T. L. & Maruniak, J. E. 1992. The Anticarsia
gernmatalis nuclear polyhedrosis virus polyhedrin gene
region: sequence analysis, gene product and structural
comparisons. Journal of General Virology 73. 1049-1056.
Zuidema, D., van Oers, M. M., van Strien, E. A., Caballero,
P. C., Klok, E.-J., Goldbach, R. W. & Vlak, J. M. 1993.
Nucleotide sequence and transcriptional analysis of the
plO gene of Spodoptera exigua nuclear polyhedrosis
virus. Journal of General Virology 74. 1017-1024.


134
Majima, K., Robara, R. & Maeda, S. 1993. Divergence and
evolution of homologous regions of Bombyx mori nuclear
polyhedrosis virus. Journal of Virology 67. 7513-7521.
Maniatis, T., Fritsch, E. F. & Sambrook, J. 1989. "Molecular
Cloning: A Laboratory Manual", 2nd Ed. Cold Spring
Harbor, New York: Cold Spring Harbor Laboratory. V3,
pp, B9-B14.
Maruniak, J. E. 1979. Biochemical characterization of
baculovirus structural and infected TN-368 cell
polypeptides, glycoproteins, and phosphoproteins. Ph.D.
dissertation,' University of Texas, Austin.
Maruniak, J. E. 1986. Baculovirus structural proteins and
protein synthesis. In "The Biology of Baculoviruses".
Granados, R. R. & Federici, B. A., Eds. Boca Raton,
Florida: CRC Press, Inc. VI, pp, 129-146.
Maruniak, J. E., Brown, S. E. & Kundson, D. L. 1984.
Physical maps of SfMNPV baculovirus DNA and its genomic
variants. Virology 136. 221-234.
Maruniak, J. E., & Summers, M. D. 1981. Autographa
cali fornica nuclear polyhedrosis virus phosphoproteins
and synthesis of intracellular proteins after virus
infection. Virology 109. 25-34.
McLachlin, J. R. & Miller, L. K. 1994. Identification and
characterization of vlf-1, a baculovirus gene involved
in very late gene expression. Journal of Virology 68.
7746-7756.
Miller, L. K. 1988. Baculoviruses as gene expression
vectors. Annual Review of Microbiology 42. 177-199.
Miller, L. K. 1996. Insect viruses. In "Fundamental
Virology". Fields, B. N., Knipe, D. M., & Howley, P. M.
Eds. Lippincott-Raven, Publisher. Philadelphia, pp,
401-424.
Minion, F. C., Coons, L. B. & Broome, J. R. 1979.
Characterization of the polyhedral envelope of the


44
when the DNA homology was compared among four different
Spodoptera sp. including S. exempts, S. exigua, S.
frugiperda and S. littoralis. SfMNPV is considered
distantly related (20-30%, reassociation kinetics) among
those NPVs (Kelly, 1977). The molecular biology approach
based on the polyhedrin gene phylogenetic tree also
suggested that the SfMNPV is distantly grouped from the
AcMNPV and BmMNPV (Zanotto et al., 1993). The results
showed that the SfMNPV diverged earlier from these other
NPVs, whereas the DNA homology of the gp41 gene of AcMNPV
and BmMNPV is almost identical (97%). Comparing these
results to those found in the polyhedrin gene analysis
suggests that AcMNPV and BmMNPV are very closely related
species (Rohrmann, 1986; van Strien et al., 1992).
When the hydrophilic and hydrophobic profiles of the
gp41 polypeptide of SfMNPV-2 were compared with other NPVs,
the SfMNPV-2 showed an overall pattern similar to that of
HzSNPV. The amino acids 40-to 280 of AcMNPV-E2 and BmMNPV
showed an identical hydrophobic pattern with amino acids 100
to 340 of HzSNPV and SfMNPV-2. The high hydrophilicity of
the carboxyl terminal of the plO gene has been reported and
shows that it displays a functional domain which is exposed


14
reported from lepidopteran and dipteran hosts. They have
been used as microbial control- agents for decades because of
their host specificity (Hawtin et al. 1992). At present,
several commercial baculovirus pesticides are registered
(Huber, 1986). These commercial baculovirus pesticides
include SeMNPV, HzSNPV, AcMNPV, Anagrapha falicfera MNPV
(AfMNPV), Cydia pomonella (codling moth) GV (Biosys Inc.),
LdMNPV, and NsSNPV (U.S. Forest Service, USDA). In Brazil
and the southern United States, AgMNPV has been used to
control the velvetbean caterpillar, Anticarsia gemmatalis,
in soybean crops (Moscardi & Sosa-Gomez, 1993; Funderburk et
al., 1992). In the northern regions of America, LdMNPV has
been successfully used to control the forest pest, gypsy
moth (Huber, 1986). There are, however some limitations to
the use of baculoviruses, because the time required to kill
the hosts after baculovirus infection is often too long (5
to 10 days) to prevent crop losses. Therefore,
baculoviruses are only suitable for those crops presenting
certain levels of tolerance to insect damage (Bonning &
Hammock, 1992). The development of recombinant
baculoviruses with integrated toxin genes has the potential
to control pests more efficiently (Carbonell et al. 1988;


84
programs were analyzed using the Wisconsin Sequence Analysis
Package (Version 8.1 VMS for VAX computer; Genetic
Computer Group). Amino acid sequences were translated from
the nucleotide sequence. The multiple sequence alignment of
both nucleotide and amino acid sequences were first produced
using the Pileup program. The aligned multiple sequences
were realigned using the CLUSTAL program (Higgins et al.,
1996) because of its accuracy for low homologous sequence
comparison.
MEGA (Kumar et al., 1993) and PAUP (Swafford, 1990)
computer programs were used to reconstruct the phylogenetic
tree based on the final aligned sequences that were produced
by CLUSTAL. The p-distance (proportion distance) and
maximum parsimony methods (Fitch, 1971) were used for
reconstructing phylogenetic trees based on nucleotide
sequence data. The p-distance and neighbor-joining methods
(Saitou & Nei, 1987) were chosen for reconstructing
phylogenetic trees based on the amino acid sequence data.
The bootstrap test with 500 replications was done to show
the reliability of the constructed trees using the neighbor
joining method. The bootstrap result was given in terms of
percentage confidence level.


97
Discussion
This study presents for the first time an analysis of
the evolutionary relationships among baculoviruses using
phylogenetic trees based on multiple baculovirus genes.
A congruent analysis was made in order to alleviate problems
in previous evolutionary studies that were based on a single
baculovirus gene (Rohrmann, 1986; Zanotto et al., 1993). It
has been a challenge to determine whether or not the gene
tree can represent the species tree for evolutionary studies
(Li & Graur, 1991). A congruent analysis was used in an
attempt to solve this problem. Although only six gene
sequences of four baculovirus species were available for
comparison in this study, more gene sequence data will
become available for congruent analyses of baculoviruses in
the future. Currently, there are no guidelines for how many
genes and species need to be tested to support a
phylogenetic tree based on congruent analysis. The
development of PCR and automatic DNA sequencing techniques
is rapidly increasing the number of available sequences and
will help improve data analysis.


22
HR sequences between genomic variants of the same virus
(Garcia-Maruniak et al., 1996), and the facts that there are
four to eight HR regions in the genome of different
baculoviruses, cause a problem in analyzing the data.
Bioinformatic study
Recently, the rapid development of genomic projects
including the mapping of bacterial (Escherichia coli) yeast
(Saccharomyces cerevisiae) nematode (Caenorhabd.itis
elegans), fruit fly (Drosophila melanogaster), and human
(Homo sapiens) genomes created a new field called
bioinformatics (Schomburg & Lessel, 1995; Schulze-Kremer,
1996). Using computer programs and macromolecular
databases, scientists are able to evaluate the potential
biological function of a newly detected gene and the
phylogenetic relationship to other genes. A complete search
of the homologous sequences in the databanks not only
provides the data to reconstruct a phylogenetic tree between
the unknown protein and the homologous proteins, but also
provides the structural backbone to build a possible three-
dimensional (3D) image of the unknown protein (Benner,


69
gene, a transformed cell line that constantly expresses the
gp41 protein will be needed to complement the gp41 gene when
the gp41 gene deletion mutant is selected. Nevertheless,
several computer programs were used to predict the potential
biological function based on the biochemical
characterization of the gp4l protein.
Four a-helices at consensus sites of 93 to 104, 204 to
222, 244 to 257, and 273 to 284 (CvDyxkliRyY,
EaakqLslAvQYmvaeaV, qQLaNnYxTLLLkr, and IndLINxVIDDl), one
loop domain at 237 to 241, (PIPLP), and one P-sheet domain
at 292 to 295 (YYxYV) were found to be conserved (Fig. 3.4).
The results were confirmed using both the PHD (EMBL) and
Darwin programs (Benner, 1995). One transmembrane domain
was predicted at amino acid sequences of 309 to 328. The
transmembrane domain (Fig. 3.4), was also found to be a
conserved hydrophobic domain (Fig. 3.5). The results
strongly suggested that the gp4l protein is a membrane
protein. The hydrophobic profile revealed five conserved
hydrophobic domains, and region III was also found to be a
conserved a-helix domain. The correlation of the conserved
hydrophobic domains and a-helix may suggest that region III


71
understanding the baculovirus structural proteins.
The AcMNPV vlf-1 gene is a very late expression factor
to regulate the polyhedrin gene transcripts (McLachlin &
Miller, 1994), and is required for strong expression of the
polyhedrin gene in a characterized temperature sensitive
mutant. The translated amino acid sequence showed homology
with a family of integrases, resolvases and RNA helicases
(McLachlin & Miller, 1994) which may be involved in the
interaction with DNA and/or RNA during the transcription.
Unfortunately, the partial ammo acid sequence of SfMNPV and
HzSNPV did not overlap with these specific motifs, and no
further analysis was done because of insufficient
information.
The phylogenetic analysis of the gp4l gene showed the
AgMNPV-2D had a closer relationship to the AcMNPV and the
BmMNPV than to SfMNPV-2 and HzSNPV. This result is
consistent with the DNA hybridization data (Smith & Summers,
1982), in which AcMNPV was found to have low homology with
HzSNPV and SfMNPV (1% relative homology) but moderate
homology with AgMNPV-2D (8% relative homology). Not only
the DNA hybridization data, but also the phylogenetic tree
of baculovirus polyhedrin genes agrees with the phylogenetic


83
U10441
Choristoneura fumiferana
MNP V
Barrett et al., 1995.
J.Gen.Virol. 76:2447
U41999
Mamestra brassicae MNPV
Clarke et al., 1996.
J.Gen.Virol, in press
X84701
Spodoptera littoralis MNPV
(SlittMNPV)
Faktor et al., 1995.
Virus Genes 11:47
Y08294
Lacanobia olercea GV (LoGV)
Smith & Goodale, 1996.
unpublished
In addition to polh, the nucleotide sequences of plO,
gp41, gp64, dnapol and egt genes were searched. Seven
baculovirus plO genes and five gp64 genes were found. For
the gp41 gene, five complete nucleotide sequences were
obtained from GenBank and two partial sequences of LdMNPV
and Xestia c-nigrum granulovirus (XcGV) (Dr. Goto, personal
communication) were included for further analysis. Five
gp64 and eight egt genes from different baculoviruses were
also included in this study. Finally, dnapol genes of six
baculoviruses and two other insect viruses (Spodoptera
ascovirus, ASV, and Choristoneura biennis entomopoxvirus,
CbEPV) were included for the phylogenetic studies.
Reconstruction of Phylogenetic Trees of Baculovirus Genes
The nucleotide sequences obtained from BLAST and ENTREZ


12
1986; Chisholm Sc.Henner, 1988). Examples of IE genes
include the IE-0, IE-1, IE-N, PE-38 and CG-30 genes (Carson
et al., 1988; Chisholm & Henner, 1988; Guarino & Summers,
1988). The second type of genes are called the early genes
and are involved in viral DNA replication. RNA polymerase
II is believed to be responsible for the transcription of
early genes (Grua et al., 1981; Fuchs et al., 1983). The
transcriptional motif, CAGT, is conserved in the promoters
of both immediate early and early genes (Blissard &
Rohrmann, 1989; Theilmann & Stewart, 1991; Ayres et al.,
1994) .
In contrast to the IE and early genes, the late and
very late genes are transcribed after viral DNA replication,
and depend on the expression of the early genes (Miller,
1988; Thiem & Miller, 1989). RNA polymerase III is believed
to be responsible for the transcription of late and very
late genes (Blissard & Rohrmann, 1990; Zanotto et al.,
1992). By using a primer extension assay (Rohrmann, 1986;
Thiem & Miller, 1989), a common motif of late and very late
genes (TAAG) has been proved to be a transcription start
site (the first T or first A). Most of the late and very
late genes code for structural proteins needed for the


Table. 4.1. Continued
82
L33180
Bombyx mori MNPV
Maeda, 1994.
unpublished
M22446
Orgyia pseudotsugata MNPV
Blissard & Rohrmann,
1989. Virology 170:537
M2 542 0
Autographa cali fornica MNPV
Whitford et al., 1989.
J. Virol. 63:1393
X00410
Galleria mellonella MNPV
(GmMNPV)
Blinov et al., 1984.
FEBS Lett. 167:254
DNA
polymerase
gene
D11476
Lymantria dispar MNPV
Bjornson et al. 1992.
J.Gen.Virol. 73:3177
D16231
Bombyx mori MNPV
Chaeychomsri et al. ,
1995. Virology,
206:436
M20744
Autographa californios MNPV
Tomalski et al., 1988.
Virology 167:591
U11242
Helicoverpa zea SNPV
Cowan et al., 1994.
J.Gen.Virol. 75:3211
U18677
Choristoneura fumiferana
MNPV
Liu & Carstens, 1995.
Virology 209:538
U39145
Orgyia pseudotsugata MNPV
Gross et al., 1993.
J. Virol. 67:469
U35732
Spodoptera Ascovirus
Pellock et al., 1996.
Virology 216:146
X57314
Choristoneura biennis
entomopoxvirus
Mustafa & Yuen, 1991.
DNA Sequence 2:39
egt gene
D17353
Orgyia pseudotsugata MNPV
Rohrmann, 1994.
unpublished
L33180
Bombyx mori MNPV
Maeda, 1994.
unpublished
M22619
Autographa cali fornica MNPV
Miller, 1989.
unpublished
U04321
Lymantria dispar MNPV
Riegel et al., 1994.
J.Gen.Virol. 75:829


110
gene, ORF 330, ORF300 and ORF >667, showing a similar
arrangement with AcMNPV, BmMNPV and SfMNPV. On the other
hand, this region had a different genomic location and
transcriptional orientation in HzSNPV. Among these ORFs,
the AgMNPV-2D shared 50 to 70% nucleotide identity and 60 to
90% amino acid similarity to the four other NPVs.
Lastly, six bacuiovirus genes including polyhedrin
ipolh), plO, gp41, gp64, DNA polymerase (dnapol) and
ecdysteroid UDP-glucosyltransferase (egt) were used to
construct phylogenetic trees. The phylogenetic trees
confirmed that the hymenopteran NPVs diverged earlier from
the lepidopteran granuloviruses (GVs) and lepidopteran NPVs.
Later, the lepidopteran GVs diverged from lepidopteran NPVs.
The results also showed that AcMNPV was closely related to
BmMNPV, and that Orgyia pseudosugata MNPV (OpMNPV) was
closely related to Perina nuda MNPV (PnMNPV) and
Choristoneura fumiferana MNPV (CfMNPV). The phylogenetic
analysis of dnapol showed that the baculoviruses had
independent evolutionary paths when compared to two other
insect DNA viruses, Spodoptera ascovirus (SAV) and
Choristoneura fumiferana entomopoxvirus (CbEPV). In
conclusion, this is the first time that phylogenetic trees


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
PHYLOGENETIC ANALYSIS OF BACULOVIRUSES USING GP41 STRUCTURAL
PROTEIN GENE AND FIVE OTHER GENES
By
Jaw-Ching Liu
May, 1997
Chairperson: Dr. James E. Maruniak
Major Department: Entomology and Nematology
Baculoviruses are pathogenic to insects. Presently,
their origin and evolutionary paths are not clearly
understood. Using a baculovirus structural protein gene,
gp41, that has been shown to be highly conserved among
baculoviruses, the gene transcription, protein structure,
genomic structure and phylogenetic relationships were
studied.
Two complete gp41 nucleotide sequences from Spodoptera
frugiperda multiple nucleocapsid nucleopolyhedrovirus
(SfMNPV-2) and Anticarsia gemmatalis MNPV (AgMNPV-2D), and a
partial gp41 gene from Lymantria dispar MNPV (LdMNPV), were
xi


131
Environmental Microbiology 55. 2749-2754.
Keddie, A. B., Aponte, G. W., & Volkman, L. E. 1989. The
pathway of infection of Autographa cali fornica nuclear
polyhedrosis virus in an insect host. Science 243.
1728-1730.
Keddie, A. B. & Volkman, L. E. 1985. Infectivity difference
between the two phenotypes of Autographa californica
nuclear polyhedrosis virus: importance of the 64k
envelope glycoprotein. Journal of General Virology 66.
1195-1200.
Kelly, D. C. 1977. The DNA contained by nuclear polyhedrosis
viruses isolated from four Spodoptera sp. (Lepidoptera,
Noctuidae): genome size and homology assessed by DNA
reassociation kinetics. Virology 76. 468-471.
King, L. A. & Possee, R. D. 1992. "The Baculovirus
Expression System". Chapman & Hall, London, pp, 1-229.
Kool, M., Broer, R., Zuidema, D., Goldbach, R. W. & Vlak, J.
M. 1994. Nucleotide sequence and genetic organization
of a 7.3 kb region (map unit 47 to 52.5) of Autographa
californica nuclear polyhedrosis virus fragment EcoRI-
C. Journal of General Virology 75. 487-494.
Kovacs, G. R., Guarino, L. A., Graham, B. L. & Summers, M.
D. 1991. Identification of spliced baculovirus RNAs
expressed late in infection. Virology 185. 633-643.
Kozak, M. 1986. Point mutations define a sequence flanking
the AUG initiator codon that modulates translation by
eukaryotic ribosomes. Cell 44. 283-292.
Kumar, S., Tamura, K. & Nei, M. 1993. MEGA: Molecular
Evolutionary Genetics Analysis, Version 1.01. The
Pennsylvania State University. University Park, PA
16802 .
Kuzio, J., Jaques, R. & Faulkner, P. 1989. Identification of
p74, a gene essential for virulence of baculovirus
occlusion bodies. Virology 173. 759-763.


42
was identical (Fig. 2.6). Another late gene transcriptional
motif from -20 to -17 was identified in AcMNPV-E2 and
BmMNPV; however, this consensus region of SfMNPV and HzSNPV
was changed by one or two nucleotides.
-99
-40
ACMNPV-E2
TAATTTTGTT
AATTTTATTA
TCGCTTTTTT
GT CACAACAA
CTATATTATA
AGTAATCCGT
BmMNPV
HzMNPV
.C...A.A..
C GA. .
.TAT.G.A.G
TGA
T G. .
. . -G. . .A
SfMNPV
. T CG .
...GA....C
.T...A.A.C
TAA....T..
T G. .
AA
AcMNPV-E2
-39
ATATTGAGTT
TTGTAATCAT
AAGAGTACAA
1
ATAAAAAGTA
TG
BmMNPV
G
A
TG
HzMNPV
CG..AA.T.A
C...CCA..C
..ATTG.T..
. T T. A
TG
SfMNPV
.A....TT.A
C..CCC....
..A.AACAC.
A
TG
Figure 2.6. Computer alignment of the DNA sequence flanking
the gp41 structural protein genes of AcMNPV-E2, BmMNPV,
HzSNPV and SfMNPV-2. The TAAG consensus sequences are
underlined or double underlined. The translation start
codon ATG sites are denoted in bold and italic letters.
Discussion
A unique feature of the NPV life cycle is the
production of two virion phenotypes: the occluded virion
(OV) and extracellular virus (ECV). The biophysical,
biochemical and morphological characteristics between the OV
and ECV are quite different. These structural differences


127
Morsdorf, D. & Vlak, J. M. 1995. Deletion of the
baculovirus ecdysteroid UDP-glucosyltransferase gene
induces early degeneration of Malpighian tubules in
infected insects. Journal of Virology 69. 4529-4532.
Forterre, P. 1997. Protein versus rRNA: problems in rooting
the universal tree of life. The News Magazine of the
American Society for Microbiology 63. 89-95.
Fossiez, F., Belloncik, S. & Arella, M. 1989. Nucleotide
sequence of the polyhedrin gene of Euxoa scandens
cytoplasmic polyhedrosis virus (EsCPV). Virology 169.
462-465.
Friesen, P. D. & Miller, L. K. 1986. The regulation of
baculovirus gene expression. Current Topics of
Microbiology and Immunology 131, 31-49.
Fuch, Y. L., Woods, M. S., & Weaver, R. F. 1983. Viral
transcription during Autographa cali fornica nuclear
polyhedrosis virus infection: A novel RNA polymerase
induced in infected Spodoptera frugiperda cells.
Journal of Virology 48, 641-646.
Funderburk, J., Maruniak, J., Boucias, D. & Garcia-Canedo,
A. 1992. Efficacy of baculoviruses and their impact on
pest management programs. In "Pest Management in
Soybean". Copping, L. G. Gz'een, M. B. & Rees, R. T.,
Eds. Elsevier, England, pp. 88-97.
Fuxa, J. R. 1989. Fate of released entomopathogens with
reference to risk assessment of genetically engineered
microorganisms. Bulletin of the ESA 35. 12-23.
Galinski, M. S., Yu, Y., Heminway, B. R. & Beaudreau, G. S.
1994. Analysis of the C-polyhedrin genes from different
geographical isolates of a type 5 cytoplasmic
polyhedrosis virus. Journal of General Virology 75.
1969-1974.
Garcia-Maruniak, A., Pavan, O. H. 0. & Maruniak, J. E. 1996.
A variable region of Anticarsia genunatalis nuclear
polyhedrosis virus contains tandemly repeated DNA


APPENDIX E
PARTIAL NUCLEOTIDE AND TRANSLATED AMINO ACID SEQUENCES OF
Lymantria dispar MNPV GP41 GENE
1 TATGATAAGTAGTCCTCGGGTGGAGTTTTGCGAGCATCATGCAGTCCGAG
M Q S E
51 CCCGCTGACCGCGACGCGGCGGCCGCCGTCTACAGCGCCGCCTGGATGAA
DAAAAVY SAAWMNQCVD
101 ACCGGGTCATCAAGTACTATCGCACCAACGACATGTCCCACTTGACGCCC
YVDPADRRVI KYYRTND
151 CAGATGCAATCCAGTGCGTGGACTACGTGGTGCTGATCAACACCATTCGC
MSHLTPQMQLLINTIR
201 GACCTGTGCCTGGACACCAACCCGGTGGACGTGAACGTGGTGAAGCGCTT
DLCLDTNPVDVNVVKRF
251 CGACAGCGACGAGAACCTGATCAAGCACTACGCGCGCCTCGCCAAGGACA
DSDENLIKHYARLAKDM
301 TGGGCGGCTCGGCGGTGCCCGACAACGTGTTCCAGCCCTCTTTCGTCTAC
GGSAVPDNVFQPSFVY
361 ACCGTCCTGCCGGCCTACGCGCAAAAGTTTTACAACAAGGGT
TVLPAYAQKFYNKG
* TAAG is the transcription start site of baculovirus late
genes
* ATG is the protein translation start site
121


36
..... INFECTED CELLS
'y, (h p.L)
(kb) M C 3 8 12 24 48
Figure 2.2. Northern blot analysis of gp41 gene
transcripts. Total RNA was extracted from uninfected Sf-9
cells (lane 2; C, the uninfected cell control) and SfMNPV
infected Sf-9 cells at 3, 6, 12, 24 and 48 p.i. (lane 3 to 7
respectively). The gp41 gene transcripts were detected with
a 32P-labeled SfMNPV EcoRI-S DNA fragment. 1 kb ladder
standard (in kilobase) is shown on the left side of the blot
(Lane 1; M, the size marker).


136
Wien, New York, pp, 104-113.
Mustafa, A. & Yuen, L. 1991. Identification and sequencing
of the Choristoneura biennis entomopoxvirus DNA
polymerase gene. DNA Sequence 2. 39-45.
Nagamine, T., Sugimori, H., Nakamura, K., Saga, S. &
Kobayashi, M. 1991. Nucleotide sequence of the gene
coding for p40, an occluded, virion-specific polypeptide
of Bombyx mori nuclear poiyhedrosis virus. Journal of
Invertebrate Pathology 58. 290-293.
Naser, W. L. & Miltenburger, H. G. 1983. Rapid baculovirus
detection, identification, and serological
classification by western blotting-ELISA using a
monoclonal antibody. Journal of General Virology 64.
639-647.
Oakey, R., Cameron, I. R., Davis, B., Davis, E. & Possee, R.
D. 1989. Analysis of transcription initiation in the
Panolis flanimea nuclear poiyhedrosis virus polyhedrin
gene. Journal of General Virology 70. 769-775.
Ooi, B. G. & Miller, L. K. 1991. The influence of antisense
RNA on transcriptional mapping of the 5' terminus of a
baculovirus RNA. Journal of General Virology 72. 527-
534 .
O'Reilly, D. R. Sc Miller, L. K. 1989. A baculovirus blocks
insect molting by producing ecdysteroid UDP-glucoysl
transferase. Science 245. 1110-1112.
O'Reilly, D. R. Sc Miller, L. K. 1990. Regulation of
expression of a baculovirus ecdysteroid UDP-
glucotransferase gene. Journal of virology 245. 1110-
1112 .
O'Reilly, D. R. Sc Miller, L. K. 1991. Improvement of a
baculovirus pesticide by deletion of the egt gene.
Bio/Technolocry 9. 1086-1089.
O'Reilly, D. R., Miller, L. K Sc Luckow, V. A. 1992.
"Baculovirus Expression Vectors". W. H. Freeman and


72
tree of the gp4l gene (Cowan et al. 1994; Zanotto et al.,
1993). The results of the phylogenetic tree of the
polyhedrin gene also divided the AcMNPV, AgMNPV-2D, and
BmMNPV into one group and HzSNPV and SfMNPV-2 into another
group.
Overall, the genomic structure of the gp41 gene region
showed that all of the NPVs have similar local ORF
arrangements except HzSNPV. The HzS-15 isolate analyzed in
the present study was described as a rearranged genomic
isolate based on the overall genomic structural comparison
with another HzSNPV isolate, ELCAR (Cowan et al., 1994). .
The gp4l gene of the HzS-15 isolate terminates upstream of
the polyhedrin gene, near m.u. 97. But the gp4l gene of
HzSNPV ELCAR isolate is placed downstream of the DNA
polymerase-related ORF, near m.u. 50, which is far away from
the polyhedrin gene. This explains why the HzS-15 has a
different genomic and transcriptional orientation. The
reason we did not use theisolate ELCAR instead of HzS-15 is
because of the incomplete sequence in the gp4l gene region
(specific for the gp4l gene). When the HzSNPV isolate ELCAR
instead of HzS-15 was compared with four other NPVs, we
found the gp4l gene regions are always located around m.u.


1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
2151
2201
2251
2301
2351
2401
2451
2501
2551
2601
2651
2701
2751
2801
2851
2901
2951
3001
3051
3101
3151
3201
3251
3301
3351
116
CCAGCAGCTT GCCAACAATT ATGTGACACT ACTTTTAAAA CGCGCCACGC
QQL ANNY VTL LLK RATL
TACCTGACAA CGTGCAAGAA GCCGTCAAGT CGCGCAGCTT TGTGCACATT
PDN VQE AVKS RSF VHI
AACATGATCA ATGACCTCAT AAATTCAGTG ATTGACGATT TGTTTGCTGG
NMIN DLI NSV IDDL FAG
CGGCGGCAAC
G G N
TCGTAGGGCT
V G L
GCGGACATTT
A D I F
TCCCGACATG
P D M
TCAACTCGCC
N S P
CTCAATTAGC
GTCAAGCAAA
AATATGAGTT
AGACGACGGC
TGAACCAACA
TCTTTGCGTT
CGCGCAATTG
TGCAATTAAT
TGAACTTGGA
TACATTCCGC
CAACGACGAC
CGCGCACGGG
GCGTTTGTGG
ATTAAGAGAA
CTTCTTTTTT
ACGCACGCAA
GCGCCACAAT
CACGCCGGAC
CCAAACCGTT
AAAATTATTT
TTCGTTAAAC
ACCCCAAAGA
GAAACGTTGC
CGAATTTAAA
AAACCATTCG
ACAATTTTGG
CGTGCACGAC
TAGGTACGGG
CTTAACGTGC
AAAACGCAAA
CGTTGGAGCT
ATCTCTAAAA
CGAAGCGGGC
ATTTGAGCAG
TATTATTATT
Y Y Y Y
CAAGGAAAAC
KEN
TTAATTACAT
N Y M
TTTGAGAACG
F E N A
GGCCGCCATT
A A I
GGCGCAGTGT
CTGACGCCGA
TGTACAAGAA
AAACTGTACA
CAAACGCGGC
TACTTTATTG
GAATACAATC
TAAAGCGCAA
CGTGCCCTAC
TAAAACTAGC
ACTGCTGTGT
TCAAATGTCG
CTTTGTTTCT
GAGCCGCAAT
GTTTAATAAA
CGAAAATGTT
TTGAGCACGT
GAAGTAAAAA
TGCGCCCACC
TTAGCCTAAT
AGGGAATTTG
ACTGTGCAAA
AGCTTACCAT
ATCCCGCGCA
AGAAAAAGAA
ATTTTATTAA
CGCGGCCTTA
CATGCGCATC
TAATTAAAAA
CGCAGCCGCA
GGCTCGTGAA
ACACTTCCAC
GTAGAAATGG
CAATTTGTAC
ACGTGCTCAA
V L N
GTGGGATTTT
V G F L
GTCGCAACTT
SQL
CGGCGTTTCT
A F L
TGACGCAGAG
*
GAAACGCTAA
CAGATTACTG
CAAAGTGTGG
CGGGCATCAC
GTTGGTGCGC
CAGCGCAAAC
TTAAGCGTAA
CCTCAACATT
TACCGTTTGG
GCTAAACGAC
ACGAATACTC
GCCGGTTTAA
GCTATTGTAT
ATTCTTCCGA
TTTGATTAAT
TTTAACGATT
GTTTGATTTG
ACGACAGCCT
ACACTAAAAA
AGAGGAACCG
ATTCGATTGA
CGCATGCTTG
TAACTTTTAC
TGGTCATGTT
AAAAATTTTA
TTCCAAAATA
TTCGAGGCGC
AACGAGGCGC
AGGCAAACTG
ACAACACGCT
ATTTACGCGC
GCCTTTTAAA
AACGGCCACG
AACAGCGGCG
CGAAAAGAAT
E K N
TGGCACCATT
A P L
GCTACGCGAC
A T R H
TACGTCGGCC
T S A
CGCGTGCCAA
CCCGGTTCAT
AATCCGCCGC
TGCGTGTACA
CAGCGATTTG
GTTTTTTACG
GCGTACGATT
ACGCGGGAAA
TGCATCAATA
GCAACCACGA
GATGCGCCCG
GGACGTACAC
TTGTGCTGAT
GTTATCTATT
CACAATTGAC
TACAATGAAC
GGAAAATGCG
GCCACCGACC
GTGGAGCAAG
GTTACAAGTC
GATTTGCAAA
ATATCAACGG
AATTGAGGTC
ACAAACGCTA
GCCACGTGAC
TGCTCAAAAA
AAAATGTTAA
CATAGTGTTT
GCCAGCTCAG
CGCAGCAACA
CAACACGATC
GCAACCCCAC
GACTTTCGCC
TAGCAACATG
TGCCGTTGCA
CGCGCGCGCG
R A R V
GTCCGCGTCC
S A S
ACGGCAAACG
G K R
GCCAACGCCA
A N A I
AAGAGTTTGT
ATTCATGATT
GTTCGCGCGC
TTGTGCGGCG
CGACGTCGTT
CAATGCAAAC
ACAAGACCGC
TATTTTAAAT
TTTGTCATCA
GCGCGTAGAA
TCAACAACAA
AAAGGCGAAA
TAGTCTGGTG
ATTTTGTAAT
AACAGCGATC
GAGCTGTTGA
CATTCAATCA
GACAGCGGTG
TACATGTTTC
ACGTTTTATT
ACACCGCATA
TTGCTTGTGA
TGTGACCAAG
TGGGTTTGGC
AAGGAACTTA
CGCAATAGAC
ACGGCGATTA
TGCATAATGT
CGTGGAAGAT
CTATCAATTT
AAAACCAAAC
CGTGTTGCAA
GTTTGCTGGA
ATAAGACACT
AAAGGTGGCG


98
The congruent approach also allowed us to find out if
an independent gene tree agrees with other gene trees
including the universal tree. The results suggested that
the polh gene is a useful marker to represent the universal
tree and/or the baculovirus species tree. In addition, the
phylogenetic tree of polh gene can be used to identify a
newly isolated baculovirus. Two reasons have been found for
using the polh gene tree to represent the baculovirus
species tree in this study. First, the polh gene group has
the biggest nucleotide sequence group that is currently
available and include nucleotide sequences from 25
baculovirus species and amino acid sequences from 26
baculovirus species. Second, the polh gene tree agrees with
all other gene trees that have been tested in this study.
No significant difference was found between the polh gene
tree with other gene trees. The data of the polh gene also
agree with the universal tree that in total represents
around 6% of genomic DNA (based on AcMNPV) and 4% of the
total potential encoded genes. Since it compares to these
available baculovirus gene sequences, the polh gene is.
considered as the most reliable and useful gene to represent
the phylogenetic tree for baculovirus species.



PAGE 1

PHYLOGENETIC ANALYSIS OF BACULOVIRUSES USING GP41 STRUCTURAL PROTEIN GENE AND FIVE OTHER GENES By JAW-CHING LIU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1997

PAGE 2

To my dear parents, family and friends

PAGE 3

Love is patient. Love is kind. It does not envy. It does not boast. It is not proud. It is not rude. It is not self-seeking. It is not easily angered. It keeps no record of wrongs. Love does not delight in evil but rejoices with the truth. It always protects, always trusts, always hopes, always perseveres. Love never fails. CORINTHIANS 13:4-8

PAGE 4

ACKNOWLEDGMENTS I would like to thank Dr. James E. Maruniak, my committee chairman, and Drs . , Richard C. Condit, Pauline 0. Lawrence, and Susan E. Webb, my committee members. I also would like to thank Dr. Drion G. Boucias who served as a committee member for my dissertation defense and Dr. Simon S. J. Yu who served as a committee member for my qualifying examination. The greatest appreciation and best wishes go to Dr. Alejandra Garcia-Maruniak for her friendship and support during the past four years. I would like to share my happiness with my friend, Re jane Moraes, and I wish she may finish her studies as soon as possible. My sincere appreciation goes to Drs. Dale Habeck, Jackie Pendland, A. Jeyaprakash, Glenn Hall, Roberto Pereira, Mrs. Raquel McTiernan and many more. I apologize for those who have helped me, but who I have not mentioned here, and I would like to thank them also. Lastly, thanks be to God for making me strong and peaceful while I was writing my dissertation . iv

PAGE 5

TABLE OF CONTENTS ACKNOWLEDGMENTS iv LIST OF TABLES viii LIST OF FIGURES ix ABSTRACT xi CHAPTERS 1 INTRODUCTION TO BACULOVIRUSES 1 Review . . . . 1 Fundamental Studies on Baculoviruses ... 2 Baculovirus infection 2 Baculovirus structural proteins ... 5 Baculovirus DNA genome 10 Regulation of baculovirus gene expression 11 Application of Baculoviruses in Agriculture and Biotechnology 13 Use of baculoviruses as biological control agents 13 Baculovirus expression system .... 16 Future Study and Prospects 18 Evolutionary studies of baculoviruses 18 Bioinf ormatic study 22 Present study 23 2 NUCLEOTIDE SEQUENCE AND TRANSCRIPTIONAL ANALYSIS OF THE GP41 GENE OF Spodoptera frugiperda NUCLEAR POLYHEDROSIS VIRUS 25 v

PAGE 6

Introduction 25 Methods 28 Virus and Cell Culture 28 DNA Cloning and Sequencing 28 Computer Analysis 29 RNA Purification 3 0 Northern Blot Hybridization 3 0 Primer Extension 31 Results 33 Cloning and Sequencing of the S. frugiperda EcoRI-S Fragment 3 3 Transcriptional Analysis of the GP41 Gene 35 Amino Acid and Nucleotide Sequence comparison of SfMNPV-2 with Other Baculoviruses 38 Discussion 42 3 NUCLEOTIDE SEQUENCE, AMINO ACID SEQUENCE AND GENOMIC STRUCTURE ANALYSIS OF THE GP41 GENE REGION AMONG FIVE NUCLEAR POLYHEDROSIS VIRUSES 50 Introduction 50 Methods 52 Virus and Cell Culture 52 DNA Cloning and Sequencing 53 Computer Analysis 55 Results 56 DNA Sequencing of the GP41 Region . . . .56 Phylogenetic Analysis 60 Protein Hydrophobicity Profile Analysis . 62 Protein Secondary Structure Analysis ... 62 Genomic Structure Analysis 66 Discussion 66 4 PHYLOGENETIC ANALYSIS OF BACULOVIRUSES 74 Introduction 74 Methods 76 DNA Purification of LdMNPV 76 PCR Amplification and DNA Sequencing of LdMNPV gp41 Gene 76 Search of Baculovirus Genes through GenBank 78 vi

PAGE 7

" Reconstruction of Phylogenetic Trees of Baculovirus Genes 83 Relationship of Baculoviruses with Insect Hosts 85 Results 85 PCR Amplification and DNA Sequencing of LdMNPV gp41 Gene 85 Phylogenetic Trees of Baculovirus polh Genes 8 7 Phylogenetic Trees of plO, gp41, and gp64 Genes 88 Phylogenetic Trees of dnapol and egt Genes 93 Relationship of Baculoviruses and Their Hosts 96 Congruent Analysis of Baculovirus Genes . 96 Discussion 97 5 SUMMARY OF CURRENT RESEARCH 108 APPENDICES A NUCLEOTIDE SEQUENCE OF Spodoptera frugiperda MNPV EcoRI-S FRAGMENT AND TRANSLATED AMINO ACID SEQUENCE OF GP41 GENE 112 B INTERNET SERVERS USED FOR DATABASE SEARCH AND PROTEIN SECONDARY STRUCTURE PREDICTION .... 114 C NUCLEOTIDE SEQUENCE OF Anticarsia gemmatalis MNPV Pstl-Hindlll FRAGMENT AND TRANSLATED AMINO ACID SEQUENCE OF GP41 GENE 115 D PURIFICATION OF POLYHEDRA, ALKALINE -RELEASED VIRUSES AND DNA FROM Lyman.tr ia dispar MNPV COMMERCIAL FORMULATION 118 E PARTIAL NUCLEOTIDE AND TRANSLATED AMINO ACID SEQUENCES OF Lymantria dispar GP41 GENE .... 121 LIST OF REFERENCES 122 BIOGRAPHICAL SKETCH 144 vii

PAGE 8

LIST OF TABLES Table page 2.1. Amino acid sequence similarities and nucleotide sequence identities (%) of gp41 structural protein . 38 3.1. Percentage of the nucleotide sequence identities and amino acid sequence similarities of the ORFs within the gp41 gene region 59 4.1. List of GenBank accession numbers, baculovirus species, and references of DNA sequences that were used in construction of baculovirus phylogenetic trees 79 viii

PAGE 9

LIST OF FIGURES Figure Page 2.1. Position of the gp41 gene on the SfMNPV genomic map and sequencing strategy 34 2.2. Northern blot analysis of gp41 gene transcripts . 36 2.3. Primer extension analysis of gp41 gene transcripts 37 2.4. Comparison of hydrophi lie -hydrophobic profiles among the homologous gp41 proteins 40 2.5. Comparison of the amino acid sequence of four NPV gp41 proteins. 41 2.6. Computer alignment of the DNA sequence flanking the gp41 structural protein genes of AcMNPV-E2, BmMNPV, HzSNPV and SfMNPV2 4 2 3.1. Position of the gp41 gene on the AgMNPV-2D genomic map 54 3.2. Phenogram of the divergence among five NPVs ... 61 3.3. Hydrophobicity profile of the gp41 protein among five different NPVs 63 3.4. Alignment of the amino acid sequence of the gp41 protein among five different NPVs 64 3.5. Genomic structure of gp41 gene flanking regions of the AcMNPV, BmMNPV, AgMNPV2D , SfMNPV2 and HzSNPV 6 7 ix

PAGE 10

4.1. Phylogenetic tree of baculovirus polh gene based on the translated amino acid sequences 86 4.2. Phylogenetic tree of baculovirus polh gene based on the nucleotide sequence 8 9 4.3. Phylogenetic trees of baculovirus plO (A), gp41 (B) , and gp64 (C) genes based on translated amino acid sequences 90 4.4. Phylogenetic trees of baculovirus plO (A), gp41 (B) , and gp64 .(C) genes based on nucleotide sequences 91 4.5. Phylogenetic trees of baculovirus dnapol (A), and egt (B) genes based on translated amino acid sequences 94 4.6. Phylogenetic trees of baculovirus dnapol (A), and egt (B) genes based on nucleotide sequences ... 95 x

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy PHYLOGENETIC ANALYSIS OF BACULOVIRUSES USING GP41 STRUCTURAL PROTEIN GENE AND FIVE OTHER GENES By Jaw-Ching Liu May, 1997 Chairperson: Dr. James E. Maruniak Major Department: Entomology and Nematology Baculoviruses are pathogenic to insects. Presently, their origin and evolutionary paths are not clearly understood. Using a baculovirus structural protein gene, gp41, that has been shown to be highly conserved among baculoviruses, the gene transcription, protein structure, genomic structure and phylogenetic relationships were studied . Two complete gp41 nucleotide sequences from Spodoptera frugiperda multiple nucleocapsid nucleopolyhedrovirus (SfMNPV-2) and Anticarsia gemmatalis MNPV ( AgMNPV2D) , and a partial gp41 gene from Lymantria dispar MNPV (LdMNPV) , were xi

PAGE 12

sequenced . Northern blot analysis showed that the SfMNPV-2 gp41 was a late gene expressed 12 hours post-infection. The gp41 promoter region contained three transcriptional start sites, two within a consensus transcriptional start site (TAAG) of baculovirus late genes, and the other located in a region where no consensus motif has been determined. The comparison of nucleotide and amino acid sequences of the AgMNPV2D with four other NPVs, Autographa calif ornica MNPV (AcMNPV) , Bombyx mori MNPV (BmMNPV) , SfMNPV and Helicoverpa zea single nucleocapsid nucleopolyhedrovirus (HzSNPV) , showed a minimum of 59% nucleotide identity and 70% amino acid similarity. Analysis of the hydrophobicity and protein secondary structure of gp41 revealed several conserved domains including eight a-helix, four loop, one P-sheet and one transmembrane domains. The analysis of the gp41 upstream and downstream regions from those five NPVs showed that they contained vlf-l gene, ORF 330, ORF 300, gp41 and CRF >667 positioned from right to left and with a similar arrangement in their genomic maps. Among these ORFs, the AgMNPV2D shared 50 to xii

PAGE 13

70% nucleotide identity and 60 to 90% ammo acid similarity with the four other NPVs . Six baculovirus genes including polyhedrin (polh) , plO, gp41, gp64, DNA polymerase {dnapol) and ecdysteroid UDPglucosyltransf erase (egt) , were used to reconstruct phylogenetic trees. The results confirmed that hymenopteran NPVs diverged earlier from lepidopteran granuloviruses (GVs) and lepidopteran NPVs, later lepidopteran GVs diverged from lepidopteran NPVs. The dnapol phylogenetic tree also showed that the baculoviruses had an independent evolutionary path from two other insect DNA viruses, Spodoptera ascovirus (SAV) and Choristoneura fumiferana entomopoxvirus (CbEPV) .

PAGE 14

I CHAPTER 1 INTRODUCTION TO BACULOVI RUSES Review Scientific literature on the study of baculoviruses goes back to the beginning of the nineteenth century, and now includes thousands of scientific articles that have contributed to the understanding of this class of viruses. Some papers cover fundamental studies such as those involving the baculovirus infection processes (Volkman & Keddie, 1990; Granados & Williams, 1986), the baculovirus structural proteins (Summers & Smith, 1978; Maruniak, 1979, 1986; Rohrmann, 1992), the baculovirus DNA genome (Ayres et al . , 1994), and the regulation of gene expression (Friesen & Miller, 1986; Blissard and Rohrmann, 1990). Studies dealing with the application of baculoviruses in agriculture and biotechnology such as the use of baculoviruses as biological control agents (Huber, 1986; Bonning & Hammock, 1992; Moscardi & Sosa-Gomez, 1993) and the baculovirus expression 1

PAGE 15

system (Summers & Smith, 1987; King & Possee, 1992; O'Reilly et al., 1992; Richardson, 1995; Shuler et al . , 1995) have also been reported. Fundamental Studies on Baculoviruses The fundamental characteristics of baculoviruses have been described in several review papers and books (Granados & Federici, 1986; Blissard & Rohrmann, 1990; Tanada & Kaya, 1993; Miller, 1996) . These reviews include the study of viral particles, nucleocapsids , enveloped virions, infectious elements, the viral infection pathway, cytopathology , viral replication, host specificity, viral gene regulation, and viral DNA replication. In this section, the viral infection process, structural proteins, DNA genome and regulation of gene expression of baculoviruses will be briefly discussed. Baculovirus infection Baculoviruses have an enveloped rodshaped virion (Federici, 1986) . The virions are generally 40-50 nm in diameter and 200-400 nm in length (Bilimoria, 1986) . The

PAGE 16

baculoviruses are divided into two genera based upon the morphology of the inclusion bodies (IBs) (Murphy et al . , 1995) . Virions of the genus Nucleopolyhedrovirus (NPV) are occluded in a proteinaceous matrix, the polyhedron. The polyhedron ranges from 0.5 to 15 um, and there are usually several virions embedded in each polyhedron (Federici, 1986) . Two subtypes of NPVs have been found: the single nucleocapsid NPV (SNPV) contains only one nucleocapsid per envelope, and the multiple nucleocapsid NPV (MNPV) contains several nucleocapsids (1-17) per envelope (Bilimoria, 1986). The second genus, Granulovirus (GV) , contains only one virion occluded in an oval shaped proteinaceous matrix, and ranges in size from 160 to 300 nm in width by 300 to 500 nm in length (Federici, 1986) . The virion of GVs usually consists of one nucleocapsid per envelope, but in a few cases has been found to have more than one (Murphy et aJ . , 1995) . Two different types of virions are produced during the replication cycle of baculovirus . One is the occluded virion (OV) that is only found inside the polyhedron (Volkman, 1986) , and the other is the budded virion (BV)

PAGE 17

4 that functions in cell to cell infection (Granados & Lawler, 1981) . The OV is occluded in either a polyhedron (for NPV) or granule (for GV) . The polyhedron protects the virion from environmental decay. Upon ingestion by insect larvae, the polyhedra are dissolved in the midgut's alkaline juices (Pritchett et al . , 1982). The liberated OVs then penetrate the peritrophic membrane and infect the columnar epithelial cells (Tanada et al . , 1975) . This step marks the end of the primary infection. The budded virions that are produced in the infected nucleus of columnar cells then cause a secondary infection (Granados & Williams, 1986) . The BVs go through the hemocoel to infect other cells such as those of the tracheal and the connective tissues (Adams et al . , 1977; Keddie et al . , 1989; Volkman & Keddie, 1990). Late in the infection, occluded virions are formed in the nuclei of infected cells. The progeny virions (BVs) are found as early as sixteen hours after initiation of the infection (Granados & Lawler, 1981) . Polyhedra are found starting at 24 hours post infect ion (P.I.) (Granados & Lawler, 1981) and are released upon cell death.

PAGE 18

5 Baculovirus structural proteins Although BVs and OVs have identical DNA genomes (Smith & Summers, 1978) , the surrounding membrane and proteins axe very different (Summers & Volkman, 1976) . The OV membrane is formed in the nuclei by de novo synthesis (Stoltz et al . , 1973) , while the BV membrane is constructed from the cytoplasmic membrane (Tanada. & Hess, 1976; Adams et al . , 1977) . The differences between OV and BV membrane composition in Autographa calif omica MNPV (AcMNPV) have been studied (Braunagel & Summers, 1994) . The protein and the lipid compositions were both compared, and it was observed that the major BV phospholipid is phosphatidylserine, while the major OV lipids are phosphatidylcholine and phosphatidylethanolamine . The results also indicated that the nuclear membrane of infected Spodoptera frugiperda cell line (Sf9) has a different lipid compositions compared to the OVs and BVs. The protein composition of OVs and BVs were analyzed, and the dominant phosphoproteins differed between the two virions. The OVs have a 36 kDa major phosphoprotein, while the BVs have a 85 kDa major phosphoprotein. Glycoprotein

PAGE 19

6 analysis showed that more glycoproteins were present in BV than OV. The BV specific glycoproteins are 136, 128, 89, 45 and 40 kDa, and the OV specific glycoproteins are 70, 53, 49, 42 and 40 kDa. Moreover, several specific OV structural proteins were identified. These proteins include the ODVE18, ODV-E35, ODV-E27, ODV-E56 and ODV-E66 (Maruniak & Summers, 1981; Hong et al . , 1994; Braunagel et ai . , 1996a, 1996b; Theilmann et al . , 1996). These OV specific proteins, such as ODV-E56 and ODV-E66, may be involved in the production of intranuclear membrane and protein transport and insertion into the viral envelope membrane (Braunagel et al . , 1996a; 1996b). The gp41 gene also has been shown to code for an OV specific protein (Whitford & Faulkner, 1992a) . Gp41 genes are highly conserved with 60% nucleotide sequence homology among four different baculoviruses (Liu & Maruniak, 1995) . The gp41 protein was identified as an O-linked glycoprotein, and its localization was predicted to be in the tegument (Whitford & Faulkner, 1992a) . Although the biological function of gp41 protein has not yet been defined, it may have functions similar to those of other OV specific proteins, such as formation of the envelope membrane and/or

PAGE 20

protein transport into the membrane. Another OV specific protein, p74, has been proved to be essential for virulence of baculoviruses . Polyhedra produced by the AcMNPV virus with mutations in the p74 gene failed to kill Trichoplusia ni larvae per os (Kuzio et al . , 1989) . This indicated that p74 is required for viral infect ivity. However, details of the mechanism of p74 protein function still need to be elucidated . In contrast to the OV specific proteins, the gp64 protein is specifically found in BV (Blissard & Rohrmann, 1989; Whitford et al . , 1989) and plays an important role in cell to cell infection (Volkman & Goldsmith, 1984) . The gp64 protein is concentrated at one end of the virion membrane and may be involved in a pH dependent fusion with the host cell endosomal membrane (Volkman & Goldsmith, 1985) . Furthermore, gp64 has been shown to be a type I integral membrane protein with one membrane fusion domain and one oligomerizat ion domain (Monsma & Blissard, 1995; Monsma et al . , 1996). Gp64 is highly glycosylated, and glycosylation is required for the incorporation of gp64 into the virion envelope (Rohrmann, 1992) . In addition, a signal peptide sequence was found in the N-terminal of gp64 that

PAGE 21

8 was missing in the mature form of the protein (Rohrmann, 1992) . Besides the OV and BV structural proteins, there are three other major structural proteins found in baculoviruses : polyhedrin, PE, and plO proteins. Polyhedrin is the basic subunit of polyhedra and is reported to be a 2 9 kDa protein with highly conserved amino acid sequences between NPVs and GVs (Akiyoshi et al . , 1985; Maruniak, 1986; Blissard & Rohrmann, 1990) . It has 80% identity among lepidopteran NPVs, 50% identity between the lepidopteran NPVs and GVs, and 40% identity between the lepidopteran and hymenopteran NPVs (Rohrmann, 1992) . The carboxyl terminal and central region of polyhedrin genes are highly conserved, but the N-terminal is less conserved (Akiyoshi et al . , 1985; Chakerian et al . , 1985; Rohrmann, 1986). The cytoplasmic polyhedrosis virus (CPV) also produces polyhedrin protein to form a type of polyhedra. However, the polyhedrin amino acid composition between NPVs and CPVs are different quantitatively and qualitatively (Maruniak, 1986; Rohrmann, 1986) . An electron-dense envelope named polyhedron membrane or polyhedron calyx surrounds the polyhedra (Rohrmann, 1992) .

PAGE 22

9 PE (polyhedron electron-dense envelope) protein has been suggested to be a major component of the PE, and is phosphorylated and thiolly linked to the carbohydrate component of the polyhedron envelope (Minion et al . , 1979; Whitt & Manning, 1988; Rohrmann, 1992) . The PE gene is a late gene, expressed at 48 hours post infection (Russell & Rohrmann, 1990) . The PE nucleotide homology among AcMNPV, OpMNPV and LdMNPV is 58, 27 and 34%, respectively (Rohrmann, 1992) . Thus, the PE protein is not highly conserved among the different baculoviruses . The plO protein has been proved to be an essential gene, for polyhedra formation. Three functional domains of plO proteins were identified in AcMNPV using a site directed mutation analysis (van Oers et al . , 1993). These functional domains include a fibrillar structure formation domain (15 amino acids from the carboxyl terminus) , a nuclear disintegration domain (amino acid residue 52-79), and an intermolecular binding domain (the amino terminal half of the plO protein) . The unsuccessful substitution of the AcMNPV plO gene with the Spodoptera exigua MNPV (SeMNPV) plO gene indicated that at least one virus-specific factor was required to interact with the plO protein for nuclear

PAGE 23

10 disintegration (van Oers et al . , 1994) . In general, the homology of plO genes among baculoviruses is very low; there is only 42, 26 and 38% amino acid sequence identity among AcMNPV, SeMNPV and OpMNPV, respectively (Rohrmann, 1992) . Baculovirus DNA genome Baculoviruses are double stranded DNA viruses with the genome size ranging from 88 to 160 kilobase pairs (kb) (Burgess, 1977; Blissard & Rohrmann, 1990). The genomic structure among baculoviruses has been shown to be similar (Leisy et al . , 1984). The alignment of AcMNPV, Orgyia pseudotsugata MNPV (OpMNPV) , and SeMNPV genomes showed that these baculoviruses have similar locations for the polyhedrin gene, plO gene and ecdysteroid UDPglucosyltransf erase (egrt) gene (van Strien et al . , 1996). On the other hand, the genomic location of the ubiquitin gene is different among, these baculoviruses, and this difference is probably caused by gene rearrangement. Gene rearrangement is also apparent for the gp41 genes of five different NPVs (Chapter 3) . The genomic DNA sequences of AcMNPV (Ayres et al . ,

PAGE 24

11 1994) and BmMNPV (Maeda, unpublished data; GenBank accession number, L3318 0) have been completed and provide valuable information in analyzing the potential open reading frames (ORFs) . In AcMNPV, 154 potential ORFs (greater than 150 nucleotides in length) and the potential transcription motifs of these ORFs have also been identified. A complete genomic structural map has located all the identified genes of AcMNPV (Ayres et al . , 1994). Regulation of baculovirus gene expression The baculovirus genes are transcribed in an ordered cascade. Four types of genes (immediate early, early, late, and very late genes) have been described according to their dependence on the transcription of previous types cf genes and on their occurrence before or after viral DNA replication (Friesen & Miller, 1986; Guarino & Summers, 1986; Blissard & Rohrmann, 1990) . The immediate early (IE) genes, also called regulatory genes, do not require any viral gene products for their transcription and are involved in the transactivat ion of the next gene expression phase (early genes) (Guarino & Summers,

PAGE 25

12 1986; Chisholm Sc.Henner, 1988). Examples of IE genes include the IE-O, IE-1, IE-N, PE-28 and CG-30 genes (Carson et al . , 1988; Chisholm & Henner, 1988; Guarino & Summers, 1988) . The second type of genes are called the early genes and are involved in viral DNA replication. RNA polymerase II is believed to be responsible for the transcription of early genes (Grula et al., 1981; Fuchs et al . , 1983). The transcriptional motif, CAGT, is conserved in the promoters of both immediate early and early genes (Blissard & Rohrmann, 1989; Theilmann & Stewart, 1991; Ayres et al . , 1994) . In contrast to the IE and early genes, the late and very late genes are transcribed after viral DNA replication, and depend on the expression of the early genes (Miller, 1988; Thiem & Miller, 1989) . RNA polymerase III is believed to be responsible for the transcription of late and very late genes (Blissard & Rohrmann, 1990; Zanotto et al . , 1992) . By using a primer extension assay (Rohrmann, 1986; Thiem & Miller, 1989) , a common motif of late and very late genes (TAAG) has been proved to be a transcription start site (the first T or first A) . Most of the late and very late genes code for structural proteins needed for the

PAGE 26

13 assembly of baculovirus virions and polyhedra (Miller, 1988; Williams et al . , 1989). Application of Baculoviruses in Agriculture and Biotechnology The baculoviruses are mainly used as microbial control agents against insect pests (Huber, 1986) . They have also been developed as protein expression systems in biotechnology (Summers & Smith, 1987; King & Possee, 1992; O'Reilly et al . , 1992; Richardson, 1995; Shuler et al., 1995) . Both applications represent the keystone for studying baculoviruses, and contribute to the knowledge of these viruses. Use of baculoviruses as biological control agents Baculoviruses can infect a wide range of insects including 34 families of Lepidoptera, a few families of Hymenoptera, Diptera, Coleoptera, Neuroptera, Trichoptera, Thysanura, and Siphonaptera (Tanada & Kaya, 1993, Murphy, 1995) . More than 800 species of baculoviruses have been

PAGE 27

14 reported from lepidopteran and dipteran hosts. They have been used as microbial control agents for decades because of their host specificity (Hawtin et al . , 1992). At present, several commercial baculovirus pesticides are registered (Huber, 1986) . These commercial baculovirus pesticides include SeMNPV, HzSNPV, AcMNPV, Anagrapha falicfera MNPV (AfMNPV) , Cydia pomonella (codling moth) GV (Biosys Inc.), LdMNPV, and NsSNPV (U.S. Forest Service, USDA) . In Brazil and the southern United States, AgMNPV has been used to control the velvetbean caterpillar, Anticarsia gemmatalis , in soybean crops (Moscardi & Sosa-Gomez, 1993; Funderburk et ai . , 1992) . In the northern regions of America, LdMNPV has been successfully used to control the forest pest, gypsy moth (Huber, 1986) . There are, however some limitations to the use of baculoviruses , because the time required to kill the hosts after baculovirus infection is often too long (5 to 10 days) to prevent crop losses. Therefore, baculoviruses are only suitable for those crops presenting certain levels of tolerance to insect damage (Bonning & Hammock, 1992) . The development of recombinant baculoviruses with integrated toxin genes has the potential to control pests more efficiently (Carbonell et al . , 1988;

PAGE 28

15 Bonning & Hammock, 1992) . Some of the genetically improved baculovirus insecticides have already been tested in the field (Wood & Granados, 1991; Cory et al . , 1994). The results show that the modified baculoviruses kill insect pests faster than wildtype baculoviruses, and therefore could reduce crop damage (Maeda et al . , 1991) . Genetically engineered baculoviruses will become useful to control insect pests in forests and . agricultural systems in the future (Bonning & Hammock, 1992) . However, the release of recombinant baculoviruses to the natural environment is still controversial (Fuxa, 1989) . Environmental safety is a main issue when baculoviruses are applied as biological pesticides. Several species of birds, aquatic organisms and mammals have been tested for toxicology safety (Betz, 1986) , and no deleterious effects have yet been reported. Beneficial insects were also tested, and no direct adverse effects were found (Groner, 1986) . However, some parasite and predator species were indirectly affected by baculoviruses due to the decrease in host larvae resources (Betz, 1986). The persistence of baculoviruses in the environment has also been studied. Several environmental factors affect the

PAGE 29

16 distribution and persistence of baculoviruses . These factors include ultraviolet light (UV) , rainfall, temperature, pH of soil, and the microenvironment of the plant surface (Bitton et al . , 1987). Several techniques have been used for detecting, tracing and identifying baculoviruses in the field. These techniques include microscopic diagnosis (Kaupp & Burke, 1984; Traverner & Connor, 1992) , bioassay, serological assays such as Enzyme Linked Immunosorbent Assay (ELISA) (Naser & Miltenburger , 1982, 1983; Webb & Shelton, 1990), DNA dot blot hybridization (Ward et al . , 1987 ; . Keat ing et al . , 1989) and polymerase chain reaction (PCR) (Burand et al . , 1992; Moraes & Maruniak, 1997) . The latest development of a PCR technique provides a convenient, fast and accurate way to detect and identify baculoviruses in their natural environment (Moraes & Maruniak, 1997) . Baculovirus expression system The baculovirus expression system was developed based on the understanding of the baculovirus life cycle,

PAGE 30

17 baculovirus gene regulation and baculovirus genome structure. The original transfer vector has been created by using the polyhedrin gene region and the polyhedrin gene promoter of AcMNPV to carry and express a foreign gene (Smith et al . , 1983) . The constructed vector DNA is delivered into insect cells that are infected with the wildtype baculovirus to produce a recombinant virus. A recombinant virus that carries the foreign gene is produced due to the homologous DNA exchange between the polyhedrin gene regions from the vector and the wildtype virus DNA. This exchange interrupts polyhedrin gene transcription in the recombinant virus, which then does not express the polyhedrin protein. Therefore, the recombinant virus does not form the polyhedra . The recombinant virus is usually selected by the expression of a marker gene such as that coding for the p-galactosidase that digests the substrate, 5-bromo-4-cholor-3-indolyl -(3-Dgalacto-pyranoside (X-gal) , to form blue plaques (Summers & Smith, 1987) . Currently, several baculovirus vectors as well as laboratory manuals are available (Summers & Smith, 1987; King & Possee, 1992; O'Reilly et al . , 1992; Richardson, 1995; Shuler et al . ,

PAGE 31

18 1995) . Sophisticated procedures for the expression of foreign genes and subsequent protein purification have been well established. The benefit of using the baculovirus expression system includes high yields and protein posttranslational modifications that are similar to eukaryotic systems, such as protein glycosylation, phosphorylation, and amidation (Luckow & Summers, 1988a; Maeda, 1989) . This expression system can be used for pharmaceutical purposes, insect physiology studies and pest control (Maeda, 1989) . Future Study and Prospects Evolutionary studies of baculoviruses In the 1960s and 1970s, the study of phylogenetic relationships using a molecular approach showed tremendous progress, mainly through the use of various techniques such as protein electrophoresis, DNA-DNA hybridization, immunological methods and protein sequencing. Statistical measurements of genetic distances and methods for reconstruction of phylogenetic trees have also been developed (Li & Graur, 1991) . The accumulation of DNA

PAGE 32

sequence data has facilitated phylogenetic analysis. Molecular evolutionary data could potentially be used to interpret the relationships among baculoviruses and to other viruses. The evolution of DNA viruses is usually caused by modifications of their genomes due to DNA deletion, DNA recombination (gene rearrangement) , and DNA insertion from the host genome. Several baculovirus genes show homology with the host cell genes such as ubiquitin (van Strien et al . , 1996), and such data support the evolutionary mechanism of incorporating of host cell DNA into the viral genome. The baculovirus polyhedrin gene has been used to reconstruct a phylogenetic tree, showing the early divergence of NPVs and GVs (Zanotto et al . , 1993). The results showed that the hymenopteran NPV diverged earlier from the lepidopteran NPVs than from the lepidopteran GVs. The data also suggested that the lepidopteran NPVs were divided into two major branches. Until 1996, three baculovirus genes have been used to reconstruct the phylogenetic trees including the polyhedrin gene, DNA polymerase (Ahrens & Rohrmann, 1996; Pellock et al . , 1996) and ecdysteroid UDP-glucosyltransf erase (Barrett et al . , 1995) . The results of the last two gene phylogenetic trees

PAGE 33

20 supported the hypothesis generated from the phylogenetic tree of polyhedrin genes . DNA polymerase genes have been classified into four families including A, B, C, and X (Heringa & Argos , 1994) . The baculovirus DNA polymerase belongs to family B, which is also the type of polymerase found in various other species ranging from bacteria, viruses, yeasts and mammals (Heringa & Argos, 1994) . By comparing the nucleotide sequence of the AcMNPV DNA polymerase gene with those from two other insect DNA viruses, the ascovirus and entomopoxvirus , it was concluded that they have independent evolutionary paths (Pellock et al . , 1996) . Moreover, baculovirus egt genes were used to study their phylogenetic relationships. The egt proteins range from 55 to 60 kDa (O'Reilly & Miller, 1990; Riegel et al . , 1994) , and catalyze the transfer of glucose to ecdysteroids (O'Reilly & Miller, 1989) . The molting and pupation of infected insect larvae have been shown to be blocked because of an imbalance in this insect hormone (O'Reilly & Miller, 1989) . Deletion of the egt gene can speed the killing time of insect larvae by AcMNPV (O'Reilly & Miller, 1991) . However, histopathological investigation showed that the

PAGE 34

degeneration of Malpighian tubules causes the death more rapidly in these insect larvae that were infected by an AcMNPV egt gene deletion mutant (Flipsen et al . , 1995) . A baculovirus pesticide improvement is suggested by deletion of the egt gene (O'Reilly & Miller, 1991) . The egt proteins also share 21 to 22% amino acid sequence identities with several mammalian UDP-glucuronosyl transferases (O'Reilly & Miller, 1989) . Overall, the phylogenetic analysis of the egt genes from six different baculoviruses supports the evolutionary scheme of the polyhedrin sequence phylogeny tree (Barrett et al., 1995). The reconstruction of a baculovirus phylogenetic tree, based on other baculovirus genes such as gp41, gp64 and plQ will provide additional information for examining the evolutionary hypothesis based on the polyhedrin phylogenetic tree. Also, the non-protein coding sequences of baculoviruses could provide useful information for understanding baculovirus phylogeny. For instance, the divergence and evolution of homologous regions (HR) between AcMNPV and BmMNPV have been studied, and results have shown that the HRs of AcMNPV and BmMNPV are highly conserved (Majima et al . , 1993). However, the high variability of the

PAGE 35

22 HR sequences between genomic variants of the same virus (Garcia-Maruniak et al . , 1996), and the facts that there are four to eight HR regions in the genome of different baculoviruses , cause a problem in analyzing the data. Bioinf ormat ic study Recently, the rapid development of genomic projects including the mapping of bacterial {Escherichia coli) , yeast (Saccharomyces cerevisiae) , nematode (Caenorhabditis elegans) , fruit fly (Drosophila melanogaster) , and human (Homo sapiens) genomes created a new field called bioinf ormatics (Schomburg & Lessel, 1995; Schulze-Kremer , 1996) . Using computer programs and macromolecular databases, scientists are able to evaluate the potential biological function of a newly detected gene and the phylogenetic relationship to other genes. A complete search of the homologous sequences in the databanks not only provides the data to reconstruct a phylogenetic tree between the unknown protein and the homologous proteins, but also provides the structural backbone to build a possible threedimensional (3D) image of the unknown protein (Benner,

PAGE 36

23 1995) . Two major databases, the GenBank at the National Center for Biotechnology (NCBI, USA) and the EMBL (European Molecular Biology Laboratory Database) at the European Bioinf ormatics Institutes (EBI, England) are accessible around the world (Doolittle, 1996) , providing information on nucleotide and primary amino acid sequences. In addition, the protein data bank (PDB) , a protein structure database, collects protein structure information from crystal lographic results, and is therefore an important database for constructing 3D structures of unknown proteins. The development of such databases, computer programs, and computer facilities provides scientists with more efficient ways to search for homologous sequences of an unknown gene, to align multiple sequences, and to reconstruct phylogenetic relationships . Present study In this study, the baculovirus gp41 gene was chosen for phylogenetic analysis, because it has been proved to be highly conserved (Brown et al . , 1985; Liu & Maruniak, 1995). Two new gp41 gene DNA sequences of AgMNPV and SfMNPV were

PAGE 37

24 generated and compared with other known gp41 genes. The secondary structure and possible functional domains of the gp41 genes were predicted using several computer programs. Genomic regions of the gp41 gene from different baculoviruses were compared in order to better understand the evolutionary relationships among these viruses. The phylogenetic tree of baculoviruses was reconstructed based on several phylogenetic trees of baculovirus genes so that the present baculovirus evolutionary hypotheses could be examined. Insect hosts of baculoviruses were also studied in order to reveal the evolutionary relationship between baculoviruses and their hosts. This study will not only contribute to an understanding of the evolutionary relationships among baculoviruses, but also could be used as a reference to choose baculoviruses for developing recombinant baculoviruses. Since recombinant baculovirus techniques depend on the homology of the baculovirus DNA genome, the phylogenetic tree could be used as a phenetic tree to indicate homologous relationships among the viruses. Eventually, this study will benefit research involving both the basic molecular evolution analysis and the practical application of baculoviruses.

PAGE 38

CHAPTER 2 NUCLEOTIDE SEQUENCE AND TRANSCRIPTIONAL ANALYSIS OF THE GP41 GENE OF Spodoptera frugiperda NUCLEAR POLYHEDROSIS VIRUS Introduction Spodoptera frugiperda MNPV (SfMNPV-2) is a member of the family Baculoviridae . SfMNPV-2 has a double -stranded DNA genome of approximately 121 kb . The SfMNPV physical map for a number of restriction endonucleases has been described, and the restriction endonuclease profiles also shows differences comparing to other NPVs (Loh et al . , 1981; Maruniak et al . , 1984). However, two regions of DNA homology on the physical maps of SfMNPV-2 and S. exempta MNPV (SeMNPV-25) , an Autographa calif ornica MNPV genomic variant (Brown et al . , 1985), have been identified by hybridization under high stringency conditions. One of these two regions contained the polyhedrin gene (Brown et al . , 1987); the other region has been identified in the current report to be associated with the gp41 structural protein gene. 25

PAGE 39

26 Two types of virions are produced during the nuclear polyhedrosis life cycle. Those virions found within the viral inclusion bodies (IBs) are termed occluded viruses (OVs) . They obtain their envelope in the nuclei of infected cells de novo, and the OV envelope is involved in the recognition of host microvilli during infection. The second type of baculovirus virion is the budded virus (BV) . The single nucleocapsids bud through the plasma membrane of infected cells and form the ECV (Granados & Williams, 1986; Blissard & Rohrmann, 1990) . These virions appear to be specialized for secondary infection of other host cells and contain virus-encoded envelope glycoproteins which are involved in host cell infection, i.e. gp64 (Maruniak, 1979; Keddie & Volkman, 1985) . The gp41 structural protein has been identified as a major OV glycoprotein by metabolic labeling (Maruniak 1979; Stiles & Wood, 1983) . It has also been detected by the binding of horseradish peroxidase-linked concanavalin A, thus indicating it is glycosylated (Braunagel & Summers, 1994) . Furthermore, an Olinked single N-acetylglucosamine covalently bonded to the polypeptide was identified (Whitford & Faulkner, 1992a) . Experiments with monoclonal

PAGE 40

antibodies indicated that gp41 is present only in OV; it appears to be associated with OV but not with purified nucleocapsids or the ECV (Whitford & Faulkner, 1992a; Ma et al . , 1993) . The location of the gp41 protein has been predicted to be between the envelope membrane and the capsid (tegument) of the OV. On the other hand, Braunagel & Summers (1994) indicated that the viral proteins of 40-41 kDa are glycosylated in the OV and ECV. However, the monoclonal antibody data suggest that the gp41 proteins of ECV and OV are different proteins. The gene encoding the gp41 protein has been characterized (Nagamine et al . , 1991; Whitford & Faulkner, 1992b; Ma et al . , 1993; Ayres et al . , 1994; Kool et al . , 1994), but the biological function of the gp41 protein is still unknown. In this chapter, the complete nucleotide and translated amino acid sequence of the SfMNPV-2 gp41 gene is presented. The sequences were compared with other known gp41 gene sequences of different baculoviruses to reveal the possible functional domain of the gp41 protein. A possible transcriptional regulation mechanism and the phylogenetic relationships of the gp41 gene among the different baculoviruses are discussed in this paper.

PAGE 41

28 Methods Virus and Cell Culture The S. frugiperda MNPV isolate SfMNPV-2 (Maruniak et al . , 1984) was propagated in the S. frugiperda Sf-9 cell line (Luckow and Summers', 1988b) . Sf-9 cells were maintained at 27°C in TC-100 medium supplemented with 10% fetal bovine serum (Life Technology) and 50 /xg/ml gentamicin . DNA Cloning and Sequencing The SfMNPV-2 EcoRI-S DNA fragment was cloned into pGEM3Z and pGEM7Zf(+) vectors (Promega Corp.), and the subfragments EcoRI-Hindlll (0.5 kbp) , EcoRI-PstI (0.8 kbp) , Pstl-EcoRI (1.1 kbp) and Hhal-Hhal (0.7 kbp) were cloned into pGEM3Z. Exonuclease digested subclones were generated with the Erase-a-Base system (Promega Corp.). A modification of the experimental protocol was made to precipitate the exo-nuclease-digested DNA before the next step of DNA ligation, because an incomplete inhibition of

PAGE 42

exo-nuclease was found when the manufacturer's instructions were followed. The extra DNA precipitation step was introduced between the SI nuclease digestion and Klenow enzyme treatment. Sequencing was performed by the dideoxynucleotide chain terminator sequencing method (Sanger et al . , 1977) with Sequenase (United States Biochemical Corp.) . The oligonucleotide primers were synthesized by the DNA Synthesis Laboratory of the Interdisciplinary Center for Biotechnology Research at the University of Florida. Computer Analysis The Wisconsin Sequence Analysis Package™ (Version 8.1, VMS; Genetic Computer Group) was used for comparing the nucleotide sequence and amino acid sequence identities (GAP) , generating the multiple sequence alignment (Pileup) , and plotting the hydrophobic ity profile (Pepplot) . The Blast program (Altschul et al . , 1990) was used to search the GenBank databank for the homologous nucleotide sequences through the e-mail service at the National Center for Biotechnology Information (NCBI, USA) . The Fetch program was used to retrieve nucleotide sequences from the local GenBank database .

PAGE 43

RNA Purification The total cellular RNA was isolated using the guanidine isothiocyanate method (Ausubel et al . , 1989) from 3xl0 6 Sf-9 cells infected with SfMNPV-2 at a multiplicity of infection of 10 plaque forming units (PFU) per cell. At various times postinfection (p.i.), the cells were lysed in 4 M guanidine isothiocyanate pH 5.5, 20 mM sodium acetate, 0.1 mM dithiotheitol (DTT) and 0.5% sarkosyl . Cell lysates were layered over a 5.7 M CsCl solution (0.1 mM EDTA) and centrifuged at 10 0k X g for 24 hours in a swinging bucket AH650 rotor (DuPont) . The RNA was dissolved in sterile water and ethanol precipitated. After washing the RNA pellet in 70% (v/v) ethanol, the pellet was dissolved in sterile water. The RNA concentration was determined by measuring the UV absorbance at 260 nm (OD 2 go x 40 = Hg/ml) . Northern Blot Hybridization A total of 5 /ig RNA was denatured with 7% formaldehyde, 50% formamide and IX MOPS buffer (0.2 M MOPS pH 7.0, 50 mM sodium acetate and 10 mM EDTA) at 55°C for 15 min. Before

PAGE 44

31 electrophoresis, 0.1 volume of 10X loading buffer (20% Ficoll 400, 1% SDS, 0.1 mM EDTA, 0.25% Bromophenol Blue and Xylene Cyanol FF) was added. Total RNA was electrophoresed in a 1% agarose gel (1% formaldehyde and IX MOPS buffer) in IX MOPS buffer (Maniatis et al . , 1989). The separated RNAs were transferred to a ZetaProbe blotting membrane (Bio-Rad Laboratories, Inc.) with 20X SSC buffer (Maniatis et al . , 1989) . After transfer, the membrane was air dried and baked at 80°C for 1 h. The DNA probe containing 50 ng of the SfMNPV-2 EcoRI-S DNA fragment was prepared by the nick translation method (United States Biochemical Corp.) using 30 fiCi [a32 P]dCTP (3000 mCi/mmole) . Hybridization was done overnight at 42°C, and the blot was rinsed at 42°C with 5% and 1% SDS washing buffer twice each (40 mM NaHP0 4 pH 7.2, 1 mM EDTA) as described by the manufacturer (Bio-Rad Laboratories, Inc.). The blot was exposed with Kodak X-OMAT film. Primer Extension A total of 10 pig RNA, isolated from the infected Sf-9 cells, was mixed with 0.5 /xg of 20-mer oligonucleotide

PAGE 45

32 primer (5 1 -GACGTAATCGACACATTTGT-3 1 ) . This primer was complementary to the region from 104 to 123 bases downstream of the translation start codon of the SfMNPV-2 gp41 protein gene. The RNA and the primer were incubated at 3 0°C overnight. The extension reaction was done in buffer containing 50 mM Tris-HCl, pH 8 . 3 , 75 mM KCl, 3 mM MgCl 2 , 10 mM DTT, 0.12 mM of each deoxyribonucleotide triphosphate, 25 /xCi [a32 P]dCTP (3000 mCi/mmol) and 200 units of Maloney murine leukemia virus reverse transcriptase (Life Technology) for 60 min at 37°C (modified from Ausubel et al., 1989) . The reaction was stopped by adding EDTA to a final concentration of 20 mM. The extension products were ethanol-precipitated and resolved on a 6% polyacrylamide sequencing gel . A sequence marker was done with dideoxynucleotide chain terminator sequencing reaction by using the same primer with a DNA template containing the SfMNPV-2 EcoRI-S fragment.

PAGE 46

33 Results Cloning and Sequencing of the S. frugiperda EcoRI-S Fragment The S. frugiperda MNPV-2 EcoRI-S fragment containing the gp41 structural protein gene was cloned into pGEM3Z and pGEM7Zf(+) (Fig. 2.1 A). The specific restriction endonuclease digested subclones and exonuclease III deleted subclones were constructed. The T7 and SP6 promoter primers present in the pGEM vector and several specific oligonucleotide primers were used for sequencing (Fig. 2.1 B) . A major open reading frame (ORF) which contained 999 nucleotides encoded the gp41 gene, and it was oriented from right to left according to the conventional physical maps (Fig. 2.1 B) (Maruniak et al . , 1984). The complete sequence of Sf MNPV-2 EcoRI-S fragment (Appendix A) was deposited with the GenBank Data Library. One baculovirus late promoter consensus motif TAAG (Blissard & Rohrmann, 1990) was found from 3 9 to 43 nucleotides upstream from the ATG translation start codon. The translation stop codon TGA was followed by 3 94 nucleotides downstream to the polyadenylat ion signal AATAA.

PAGE 47

34 (A) b a P A RTJOY C NZGULS D IVQXE WK H M B F 1 1 1 ,1 111, 1 I EcoRI 0 10 20 30 40 50 60 70 80 90 100 mu (B) EcoRI 43.5 mu Pstl Hindlll Sacll Sail EcoRI 45 mu gp41 ORF 4 * + * 4 — Figure 2.1. Position of the gp41 gene on the SfMNPV genomic map and sequencing strategy. (A) EcoRI restriction map of the SfMNPV-2 genome (Maruniak et al . , 1984). (B) Detailed physical map of EcoRI-S fragment. The gp41 999 bp open reading frame is indicated by the bold arrow under the map. The small arrows below the map indicate the extension and direction of the sequence using T7 or SP6 primers or specific primers indicated by an asterisk.

PAGE 48

35 Transcriptional Analysis of the GP41 Gene Northern blot analysis of total RNA from infected cells isolated from 3 to 48 h p. i. is shown (Fig. 2.2) . Two mRNAs of approximately 1.6 and 2.8 kbp were detected after 12 h p.i. and remained detectable at 4 8 h p.i. when the SfMNPV EcoRI-S fragment containing the gp41 coding region was used as a probe . Primer extension analysis was used to identify the transcription start site. A 20-mer oligonucleotide, corresponding to the complement region of the coding sequence from nucleotides 104 to 123, was used. Three transcription start sites were located (Fig. 2.3). Two of the transcription start sites were located at -42 and -41 nucleotides from the ATG translation start codon within the first T and second A of the TAAG consensus motif (Fig. 2.3) . Another transcriptional start site was located at nucleotide -14 0 from the ATG start codon for which no consensus motif has been determined (Fig. 2.3).

PAGE 49

36 Figure 2.2. Northern blot analysis of gp41 gene transcripts. Total RNA was extracted from uninfected Sf-9 cells (lane 2; C, the uninfected cell control) and SfMNPV infected Sf-9 cells at 3, 6, 12, 24 and 48 p.i. (lane 3 to 7 respectively) . The gp41 gene transcripts were detected with a 32 P-labeled SfMNPV EcoRI-S DNA fragment. 1 kb ladder standard (in kilobase) is shown on the left side of the blot (Lane 1; M, the size marker) .

PAGE 50

37 Figure 2.3. Primer extension analysis of gp41 gene transcripts. Total RNA extracted from SfMNPV infected Sf-9 cells at 48 hr p.i. was mixed with the primer 5 ' GACGTAATCGACACATTTGT-3 1 . The cDNAs were synthesized using Maloney murine leukemia virus reverse transcriptase and were separated on a 6% sequence gel. Three transcription start sites were identified (lane 5; P, the primer extension product) . The TA transcription start sites were within the TAAG motif. The upper T transcription start site was not associated with any known motif. The complementary sequence ladder is shown on the left side as the sequence order G, A, T and C.

PAGE 51

38 Amino Acid and Nucleotide Sequence Comparison of SfMNPV-2 with Other Baculoviruses The amino acid and nucleotide sequences of the S. frugiperda gp41 gene were compared with three other NPV gp41 genes including A. californica MNPV (AcMNPV-E2), Bombyx mori MNPV (BmMNPV) and Helicoverpa zea SNPV (HzSNPV) (Table 2.1). Table 2.1. Amino acid sequence similarities and nucleotide sequence identities (%) of gp41 structural protein*. BmMNPV HzSNPV SfMNPV-2 AcMNPV-E2 96 75 72 (96) (60) (59) BmMNPV 75 74 (59) (59) HzSNPV 76 (62) JL Bold and normal lettering in parentheses denote amino acid sequence similarities and nucleotide sequence identities, respectively. At the nucleotide level, the sequences of the NPVs had an average of 60% identity among them except for AcMNPV-E2 and BmMNPV which shared a much higher identity (97%) . However, at the amino acid level, the predicted polypeptide sequences

PAGE 52

39 were more conserved (70% similarity) . Kyte-Doolitt le (1982) and Goldman (reviewed by Engelman et al . , 1986) analyses were performed to compare the distributions of hydrophilic and hydrophobic domains among the four NPV proteins. AcMNPV-E2 and BmMNPV had almost identical hydrophobicity patterns, while SfMNPV-2 and HzSNPV showed a similar hydrophobicity pattern overall (Fig. 2.4). In general, the hydrophobic profiles of all four NPVs were similar within amino acids 100 to 34 0 of AcMNPV-E2 and BmMNPV and amino acids 40 to 280 of SfMNPV-2 and HzSNPV (Fig. 2.4). The predicted amino acid sequences of all four NPVs were compared to show the conserved regions (Fig. 2.5). Sixteen conserved regions (defined as more than three contiguous amino acids being the same) were found within the whole sequence alignment. Within the 50 to 350 amino acid comparison region, 9 of 14 prolines were conserved among the NPVs. In addition to the comparison of amino acid sequences, the nucleotide sequences of the upstream region from the ATG translation codon of the four NPVs were compared. The sequence alignment around the late gene transcriptional consensus motif from -52 to -46 nucleotides of all four NPVs

PAGE 53

40 Figure 2.4. Comparison of hydrophilic-hydrophobic profiles among the homologous gp41 proteins. The solid line is done by Kyte-Doolittle (1982) analysis and the dash line is done by Goldman et al . (review by Engelman et al . , 1986) analysis .

PAGE 54

41 1 60 AcMNPV-E2 MTDERGNFYY NT-PPPLRYP SNPATAIFTS AQTY-NAPGY VPPATVPTTV ATRDNRMDYT AcMNPV-HR3 BmMNPV P N . . . . N K. . . HzSNPV MS SfMNPV-2 MAN.. 61 120 ACMNPV-E2 SRSNSTNSVA IAPYNKS KE PTLDAGESIW YNKCVDFVQK I IRYYRCNDM SELSPLMILF ACMNPV-HR3 BmMNPV H . HzSNPV LPHAV.TALQ HQQHQ.QLQ. SSS . . . T Y.ER ...F..T... .H.T.Q..ML SfMNPV-2 RPNSI.K.-STMSSS . LSS SSSA.ITEP. MD....Y.N. .V....T... . Q . T . Q . LNL 121 180 AcMNPV-E2 INTIRDMCID TNPISVNWK RFESEETMIR HLIRLQKELG QSNAAESLSS DSNIFQPSFV AcMNPV-HR3 BmMNPV N G P A... HzSNPV L.VE SH D . D . NL . K HYS . . R . . . . G.EV. -E SfMNPV-2 NV..E .Y.VD. .AT. . . D . DVNLMN NYK NKPIT -.D..KA... 181 240 AcMNPVE2 LNSLPAYAQK FYNGGADMLG KDALAEAAKQ LSLAVQYMVA EAVTCNIPIP LPFNQQIANN ACMNPV-HR3 BmMNPV S HzSNPV Y.V..S K. .ENVS G.SVS. . .HE .GE.L..QI. ...AS.T VRH..V.T SfMNPV-2 YSV..S K.G.H.A SGSVE . . .RH .GY.L..QI. Q...T.T D D 241 300 AcMNPVE2 YMTLLLKHAT LPPNIQSAVE S RRFPH INMINDLINA VIDDLFAGGGDYYHYVLNE ACMNPV-HR3 BmMNPV HzSNPV . I....QR.N I...V.D..S . .KY.T L.I N ....V.T.VY .N..Y SfMNPV-2 .L....QR.N I.T...EIIN . GNRTHGNSR VH...A...N S...L 301 360 AcMNPVE2 KNRARVMSLK ENVAFLAPLS AS AN I FNYMA ELATRAGKQP SMFQNATFLT S AANAVNS PA AcMNPVHR3 BmMNPV I p HzSNPV IVT. . ..IG TD..Q.I. N R. . L . . G . . . . N APSS. GSN SfMNPV-2 T.KS.IL ISYM TT....FI. T...NS..K. .V..S.SM.. MPLT--KPV361 418 AcMNPVE2 AHLTKSACQE SLTELAFQNE TLRRFIFQQI NYNKDANAI I AAAAPNATRP NTKGRTA* AcMNPVHR3 .R.IRRP LI* BmMNPV .R.IRLP LI* HzSNPV VEQNRTS . . Q A...Y...KL S.KQNY* SfMNPV-2 VSES.NV..Q Q E. . A L S.KN.ISQL* Figure 2.5. Comparison of the amino acid sequence of four NPV gp41 proteins. The one-letter code designation is used. The hyphens denote the gap filled by the computer program. The dots denote identical amino acids. The abbreviation for the viruses are described in the text.

PAGE 55

42 was identical (Fig. 2.6). Another late gene transcriptional motif from -20 to -17 was identified in AcMNPV-E2 and BmMNPV; however, this consensus region of SfMNPV and HzSNPV was changed by one or two nucleotides. -99 -40 AcMNPVBmMNPV HzMNPV SfMNPV E2 TAATTTTGTT AATTTTATTA TCGCTTTTTT GTCACAACAA CTATATTA TA AG TAATCCGT .C...A.A.. C GA. . .TAT.G.A.G TGA T G.^ G.... A .T CG. ...GA....C . T . . . A . A . C TAA . . . . T . . T G.^ AA -39 1 AcMNPVE2 ATATTGAGTT TTGTAATCA T AAGA GTACAA ATAAAAAGTA TG BmMNPV G . . A TG HzMNPV CG. .AA.T.A C. . .CCA. .C . . ATTG . T . . . . T . T . A TG SfMNPV .A....TT.A C..CCC A.AACAC. A TG Figure 2.6. Computer alignment of the DNA sequence flanking the gp41 structural protein genes of AcMNPV-E2, BmMNPV, HzSNPV and 3fMNPV-2. The TAAG consensus sequences are underlined or double underlined. The translation start codon ATG sites are denoted in bold and italic letters. Discussion A unique feature of the NPV life cycle is the production of two virion phenotypes : the occluded virion (OV) and extracellular virus (ECV) . The biophysical, biochemical and morphological characteristics between the OV and ECV are quite different. These structural differences

PAGE 56

may play a functional role in their biological properties. During the viral infection, one of the virus-encoded envelope glycoproteins, gp64 , is expressed and involved in the host cell infection. The gp64 protein is a component of the virion peplomers which are only detected in the ECV and are essential for entry of ECV into the cells by adsorptive endocytosis (Keddie & Volkman, 1985). In contrast to gp64, gp41 is only associated with OV. The gp41 structural protein was found exclusively in enveloped OV but not in either ECV or enveloped stripped OVs (Whitofrd & Falunker, 1992a) . Currently, the biological function of gp41 is not known, but gp41 may be involved in facilitating the occlusion of virions in the polyhedra or the infection of host midgut cells according to their biochemical characteristics . In this study, we presented the nucleotide sequence and transcriptional analysis of the SfMNPV-2 gp41 gene. The nucleotide sequence of the SfMNPV-2 gp41 gene shows a different degree of homology with the three other NPVs including AcMNPV-E2, BmMNPV and HzSNPV (Table 1) . The nucleotide sequence identities of SfMNPV-2 and the other NPVs were low (60%) . Similar results have been reported

PAGE 57

44 when the DNA homology was compared among four different Spodoptera sp . including S. exempts, S. exigua, S. frugiperda and S. littoralis . SfMNPV is considered distantly related (20-30%, reassociation kinetics) among those NPVs (Kelly, 1977) . The molecular biology approach based on the polyhedrin gene phylogenetic tree also suggested that the SfMNPV is distantly grouped from the AcMNPV and BmMNPV (Zanotto et al . , 1993). The results showed that the SfMNPV diverged earlier from these other NPVs, whereas the DNA homology of the gp41 gene of AcMNPV and BmMNPV is almost identical (97%) . Comparing these results to those found in the polyhedrin gene analysis suggests that AcMNPV and BmMNPV are very closely related species (Rohrmann, 1986; van Strien et al . , 1992). When the hydrophilic and hydrophobic profiles of the gp41 polypeptide of SfMNPV2 were compared with other NPVs, the SfMNPV-2 showed an overall pattern similar to that of HzSNPV. The amino acids 40 to 280 of AcMNPV-E2 and BmMNPV showed an identical hydrophobic pattern with amino acids 100 to 340 of HzSNPV and SfMNPV-2. The high hydrophilicity of the carboxyl terminal of the plO gene has been reported and shows that it displays a functional domain which is exposed

PAGE 58

45 at the surface of the protein. The hydrophobic region in the middle of the plO protein may play a bundling or crosslinking function (van Oers et al . , 1993) . The amino acid sequences of the gp41 polypeptide of these NPVs were compared to reveal the conserved sequence regions (Fig. 2.5) . These conserved amino sequences may play an important role to be a functional domain since no amino acid change was found in those regions. Specifically, these regions containing the proline and cysteine may be involved in maintaining the gp41 polypeptide conformation. In addition to these conserved regions, the alignment of the first 50 amino acids between AcMNPV and BmMNPV were identical. Also, the last 368 to 393 amino acid sequences between SfMNPV-2 and HzSNPV were almost identical (Fig. 2.5). These data suggest that the SfMNPV-2 and HzSNPV may have evolved from a common ancestor, and that the AcMNPV and BmMNPV diverged from another distantly related ancestor. By northern blot analysis, two gp41 gene transcripts were found after 12 h p.i. These data confirm the data previously shown, that the gp41 gene is a late gene product (Whitford & Faulkner, 1992b; Ma et al . , 1993). One of the transcripts was 1.6 kb and another was 2.8 kb long.

PAGE 59

According to the DNA sequence, the distance between the gp41 gene transcriptional start site to poly(A) signal is 1,433 nucleotides. By adding the poly (A) tail (a poly (A) tail usually contains 200 bases) , the estimated size of the gp41 gene transcript was about 1.6 kb. On the other hand, the 2.8 kb transcript did not fit the transcription termination stop signal principle. One explanation for the 2.8 kb transcript is the poly (A) signal which was located 3 94 nucleotides downstream from the translation stop codon was bypassed. This phenomena of ignoring the major transcriptional stop signal has been reported both in the gp41 gene (Whitford & Faulkner, 1992b) and in the p39 capsid gene of AcMNPV (Thiem & Miller, 1989) . Another explanation for the two different size transcripts is that the 1.6 kb transcript was a spliced product from the 2.8 kb RNA. However, this explanation is not favored because the gp41 gene coding sequence does not seem to be separated into two regions. The gene splicing is not a common phenomena in baculoviruses except for the IE1 or IE0 (Kovacs et al . , 1991). The 2.8 kb transcript was also acknowledged that could be a transcription product of the gene other than gp41 since the SfMNPV EcoRI-S fragment was used as a probe.

PAGE 60

47 Totally four potential open reading frame were identified within the SfMNPV EcoRI-S fragment. By primer extension analysis, the transcription start site for the gp41 gene mRNA of SfMNPV-2 was mapped in the promoter region within the TAAG motif at approximately nucleotide -42 or -41 (T or A) . This motif is conserved in all baculovirus late genes, especially the baculovirus structural proteins (Rohrmann, 1986; 1992; Rankin et al . , 1988) . However, another transcriptional start site was located at the -140 nucleotide for which no consensus motif has been determined. The phenomenon in which the transcription start site is dissimilar to a late gene consensus motif is also found in the AcMNPV p74 gene (Kuzio et al., 1989). Another explanation for the difference could be a non-specific primer hybridization, since the baculoviruses contain a large DNA genome. An unexpected small ORF was located downstream of the -140 nucleotide transcriptional start site, and the -140 nucleotide transcriptional start site may be used for a bicistronic transcription. Similar bicistronic transcripts have been reported by Kovacs et al . (1991) . A translat ional regulation mechanism is proposed in that paper since the

PAGE 61

48 translation of the downstream ORF is more efficient compared to the upstream ORF. The upstream ORF may be used for increasing the translation initiation activity. At the same time, Ooi and Miller (1991) suggest an antisense RNA mechanism for transcriptional regulation, which may be used to turn off a 3.2 kb RNA initiation. In the transcription of the gp41 gene, the upstream ORF may be used as a competition inhibitor to control the gp41 gene transcription. However, a bicistron model could not be excluded even though the upstream transcriptional start site is not a common transcriptional start site for baculovirus late genes. A site specific mutation at the upstream transcription start site can help elucidate if this transcription start site is involved in the gene regulation of gp4l. Kool et al. (1994) sequenced the AcMNPV-E2 EcoRI-C fragment and found an extra G residue which is close to the end of the gp41 gene coding region when comparing it with the data published by Whitford & Faulkner (1992b) . These results were confirmed by the recent data of Ayres et al . (1994) . The differences in the gp41 gene sequences of AcMNPV may be caused by using a different strain. The

PAGE 62

49 results from Kool et al . (1994) and Ayres et al . (1994) not only enlarge the gp41 protein by 65 amino acid sequences but also increase the homology with HzSNPV and SfMNPV at the Cterminal regions (Fig. 2.5). These data provide new information showing the possible evolutionary path of the gp41 gene and by comparing these data, the evolutionary relationship of baculoviruses may be inferred.

PAGE 63

CHAPTER 3 NUCLEOTIDE SEQUENCE, AMINO ACID SEQUENCE AND GENOMIC STRUCTURE ANALYSIS OF THE GP41 GENE REGION AMONG FIVE NUCLEAR POLYHEDROSIS VIRUSES Introduction Anticarsia gemmatalis MNPV (AgMNPV) belongs to the genus Nucleopolyhedrovirus (family: Baculoviridae) with a 133-kbp, closed-circle double-stranded DNA genome (Murphy et al . , 1995) . The virus has been applied as a commercial insecticide on a large scale to control the soybean pest, A. gemmatalis (velvetbean caterpillar) , in Brazil (Moscardi 1989) . In addition to the successful field application, the AgMNPV has undergone a series of comprehensive laboratory studies including the construction of the genomic map (Johnson and Maruniak, 1989) , the nucleotide sequence of the polyhedrin gene (Zanotto et al . , 1992), and the identification and sequence of a variable region, homologous region 4 (hr-4) (Garcia-Maruniak et al . , 1996). The gp41 structural protein is a major occluded virion (OV) glycoprotein of baculoviruses (Maruniak, 1979) . The 50

PAGE 64

51 monoclonal data indicate the gp4l is associated with OV, but not with the purified nucleocapsid nor with the budded virion (BV) (Whitford & Faulkner, 1992a; Ma et al . , 1993). The location of the gp4l protein is predicted to be the tegument between the envelope and the capsid (Whitford & Faulkner, 1992a) . However, the biological function of the gp4l protein is still unknown because of the unsuccessful selection of the recombinant mutants, which suggested the gp4l may be an essential gene. Recently, the developments of bioinf ormatic analysis bring a new aspect for studying gene function in terms of using the primary nucleotide and/or amino acid sequence to predict the biological function of a protein. Several computer programs are available through public access including a protein secondary structure analysis program that shows more than 70% accuracy (Rost and Sander, 1993) , a transmembrane domain prediction program (Jones et al . , 1994) , an O-glycosylation sites prediction program (Hansen et al . , 1995), and a three dimensional structure protein comparison program (Madej et al . , 1995). These computer programs provide theoretical data before the laboratory data is obtained, and are also useful for designing laboratory

PAGE 65

52 experiments . In this study, the gp4l nucleotide sequence of AgMNPV2D was compared with the nucleotide sequences of Autographa californica MNPV (AcMNPV) (Kool et al . , 1994), Bombyx mori MNPV (BmMNPV) (Nagamine et al . , 1991), Helicoverpa zea SNPV (HzSNPV) (Ma et al . , 1993) and Spodoptera frugiperda MNPV-2 (SfMNPV-2) (Liu Sc Maruniak, 1995) gp4l regions to understand the relationship of AgMNPV-2D with other NPVs . A protein secondary structure analysis was done based on different computer programs to predict the potential motifs responsible for the biological function of the gp4l protein. Lastly, the genomic structure of gp4l gene regions among five different NPVs was compared to provide some indications of the phylogenetic relationships. Methods Virus and Cell Culture The AgMNPV2D isolate (Maruniak, 1989) was used as the virus source and propagated in the Sf-9 (S. frugiperda, fall armyworm) cell line (Luckow & Summers, 1988) . The Sf-9 cell

PAGE 66

53 line was maintained at 27°C in TC-100 medium with 10% fetal bovine serum (Life Technologies) . DNA Cloning and Sequencing Southern blot hybridization was employed to locate the gp4l gene of AgMNPV2D . A DNA fragment of SfMNPV-2 within the gp4l gene (described in Liu & Maruniak, 1995) was labeled with 32 p[dCTP] using a nick translation kit (United States Biochemical Corp.), and used as a probe. The AgMNPV2D gp4l gene was first mapped to the 9 kbp Hindlll-C fragment (Fig. 3.1) . Subsequently, the gp4l gene was localized within a 3.5 kb Pstl-Hindlll fragment (at 49.8 52.4 map unit, m.u.) which was cloned into the pGEM7Zf (+) plasmid (Promega Corp.). A series of exo-nuclease deletion subclones was constructed for sequencing purposes using the Erase-a-Base system (Promega Corp.). A modification of experimental protocol was made to precipitate the exonuclease-digested DNA before the next step of DNA ligation, because an incomplete inhibition of exo-nuclease was found when the manufacturer's instructions were followed. The extra DNA precipitation step was introduced between the SI

PAGE 67

54 AgMNPV polh PstI Sacll Hindi Sacll Hindi Hindlll 1.005 kb gp41 ORF Figure 3.1. Position of the gp41 gene on the AgMNPV2D genomic map. The gp41 1,005 kb open reading frame is indicated by the arrow under the map. Notice the gp41 gene and polyhedrin gene have the same transcription direction that is from right to left in the conventional map.

PAGE 68

55 nuclease digestion and Klenow enzyme treatment. The dideoxy nucleotide chain-terminator method was performed for DNA sequencing, and the DNA sequence gap between different deletion subclones was completed using synthesized oligonucleotide primers. Two different sequencing kits were used: the Sequenase™ Version 2.0 DNA Sequence Kit with Sequenase polymerase (United States Biochemical Corp.) and fmol™ DNA Sequencing System with Taq DNA polymerase (Promega Corp.) . Computer Analysis The Wisconsin Sequence Analysis Package™ (Version 8.1, VMS; Genetic Computer Group) was used for comparing the nucleotide sequence and amino acids sequence identities (GAP) , generating the multiple sequence alignment (Pileup) , and plotting the hydrophobicity profile (Pepplot) . The Blast program (Altschul et al . , 1990) was used to search the GenBank and SwissProt data banks for the homologous nucleotide sequences and amino acid sequences through the e-mail service (Appendix B) at the National Center for Biotechnology Information (NCBI, USA) . The protein secondary structure prediction program (Rost and Sander,

PAGE 69

56 1993) was available through the Internet server (Appendix B) at the European Molecular Biology Laboratory (EMBL: Heidelberg, Germany) . The transmembrane domain analysis program (MEMSAT) is a freeware (Jones et al . , 1994), and the O-glycosylation site prediction program (Appendix B) was accessed through the Internet server (Hansen et al . , 1995) . For phylogenetic analysis, the MEGA program was used to construct the phylogenetic tree of the gp4l gene (Kumar et al . , 1993) . Both the nucleotide sequences and amino sequences were used. The p-distance and neighborjoining methods were chosen to generate the phylogenetic tree based on amino acid sequences. For the phylogenetic tree based on nucleotide sequences, the p-distance and maximum parsimony method were used. Results DNA Sequencing of the GP41 Region The complete nucleotide sequence of the Pstl-Hindlll fragment resulted in 3,517 nucleotides (Appendix C) and has been deposited in GenBank under the accession number U37728. An interesting phenomenon was observed during the DNA

PAGE 70

57 sequencing. When the fmol TI ^ DNA sequencing system was used for DNA sequencing, one inconsistent nucleotide pair was always found (three repetitions) at nucleotide 1,116, C versus T, from the gp4l coding strand and non-coding strand. The data were confirmed by the Sequenase sequencing system which showed this specific nucleotide pair should be C/G. No specific secondary structure of DNA was found around the nucleotide at 1,116. An open reading frame (ORF) of 1,005 nucleotides was identified containing the gp4l gene from nucleotide 669 to 1,673. The transcriptional direction of this gene was oriented from right hand to left hand (relative to the AcMNPV polyhedrin gene) in the conventional genome map (Fig. 3.1). Two NPV late gene motifs (TAAG) were found at -17 to -20 and -48 to -51 nucleotides from the protein translation initiation site (ATG) respectively. A transcriptional stop signal AATAAA was found downstream at nucleotide 745 from the translation stop site (TGA) . In additional to the transcriptional motifs, the translation start site fits the Kozak principle of AXXATG (A/G) (Kozak, 1986) . When the nucleotide sequence and translated amino acid sequence were compared with four other published NPVs gp4l gene sequences

PAGE 71

58 using the GAP program obtained from the GCG package, more than 59% nucleotide sequence identities and more than 69% amino acid sequence similarities were found (Table 3.1) . In addition to the gp4l ORF, several ORFs of AgMNPV2D were found inside the 3.5 kbp sequence region. The AgMNPV 2D ORF 1062 was identified to have a high homology with the AcMNPV vlf-1 gene. The AgMNPV2D vlf-1 gene was then compared with the vlf-1 of AcMNPV, BmMNPV, the ORF >300 of SfMNPV-2 and the ORF >195 of HzSNPV. The results presented a nucleotide homology of 76, 77, 63, and 6 5% respectively and amino acid similarity of 91, 90, 78 and 66% respectively (Table 3.1). Other than the vlf-1 gene, two potential ORFs (ORF 330 and ORF 300) were found at nucleotides, 1,804 2,103 and 2,100 2,429 respectively. The ORF 330 of the AgMNPV2D was compared with the ORF 330 of AcMNPV, ORF 33 0 of BmMNPV, ORF 348 of SfMNPV-2, and ORF 33 0 of HzSNPV and showed high nucleotide homologies of 68, 65, 58, and 57% respectively (similarity of amino acid sequences of 78, 80, 60, and 64% respectively; Table 3.1). The data suggested there were minimal (50-60%) homologies and similarities among these analyzed NPVs . Meanwhile, the AgMNPV2D ORF 300 showed

PAGE 72

59 Table 3.1. Precentage of the nucleotide sequence identities and amino acid sequence similarities of the ORFs within the gp41 gene region*. C -F "VTTJDV o L VLvi • V tl Z o Vt XT V QrrMMDV nMrln c V vlf-1 AcMNPV 97 (33 ) 65 65 ( 111 76 ( 91) BmMNPV L33180 67 (80) 61 (71) 77 (90) SfMNPV U14725 63 (73) c 63 (78) ' HzSNPV L04747 1 65 (66) ORF 327 AcMNPV 95 (96) 51 (56) 55 (64) 68 (78) BmMNPV 53 (59) 54 (64) 65 (80) SfMNPV 54 (61) 58 (60) HzSNPV _ _ 57 (64) ORF 312 AcMNPV BmMNPV 99 (100) _ _ 70 (75) 70 (75) gp41 AcMNPV 98 (96) 59 (70) 60 (75) 70 (82) BmSNPV 59 (72) 60 (74) 74 (80) SfMNPV 75 (62) 58 (69) HzMNPV 59 (71) ORF 699 AcMNPV 94 (97) 58 (70) 2 54 (70) 2 69 (80) 2 BmMNPV 59 (70) 2 55 (70) 2 68 (81) 2 SfMNPV 58 (72) 2 58 (68) 2 HzSNPV 53 (71) 2 "Bold and normal lettering in parentheses denote nucleotide sequence identities and amino acid similarities, respectively. ^enBank accession number. The sequence of AgMNPV gp41 gene region has been deposited under U37728. incomplete ORFs were used for amino acid sequence comparison.

PAGE 73

60 homologies with ORF 312 of AcMNPV and BmMNPV (70% homology and 75% similarity; Table 3.1). However, there were no homologous sequences found between the AgMNPV-2D ORF 3 00 with the SfMNPV-2 and HzSNPV gp41 regions. In addition to the intact ORFS, one partial ORF > 667 was found at nucleotides 1-667 which had moderate nucleotide sequence homology (69%) but high amino acid similarity (80%) with AcMNPV ORF 699. When the partial ORF >667 of the AgMNPV2D was compared with the ORF 699 of AcMNPV, ORF 702 of BmMNPV, ORF >258 of SfMNPV-2 and ORF >299 of HzSNPV, the results indicated a nucleotide homology of 69, 68, 58, and 53% respectively and an amino acid similarity of 80, 81, 68, 71% respectively (Table 3.1). Phylogenetic Analysis Based on the nucleotide sequences and translated amino acid sequences, a phylogenetic tree of the gp41 gene (Fig. 3.2) was generated by the Pileup program (GCG package) and MEGA package (Kumar et al . , 1993). The results showed that AcMNPV and BmMNPV were closely related. Subsequently, HzSNPV and SfMNPV-2 were grouped into a branch and AcMNPV, BmMNPV and AgMNPV2D were grouped into another branch.

PAGE 74

61 (A) ,076 ,011 J3_ J32_ _J7^ .197 A. AcMNPV ^-BmMNPV AgMNPV HzSNPV -SfMNPV (B) ,113 ,164 117 ,222 ,015 ,019 HzSNPV AcMNPV -BmMNPV -AgMNPV -SfMNPV Figure 3.2. Phenogram of the divergence among five NPVs based on the (A) nucleotide sequences and (B) the amino ac sequences of the gp41 genes. The number on the top of lin represents the distance between each NPV or to the branch point .

PAGE 75

62 Protein Hydrophobicity Profile Analysis Figure 3.3 shows the hydrophobicity profile and the conserved hydrophobic domain of gp41 protein among five NPVs (Kyte & Doolittle, 1982) . Five conserved hydrophobic domains were assigned arbitrarily based on the similarity of hydrophobic pattern among five NPVs. Protein Secondary Structure Analysis The amino acid sequence alignment showed (Fig. 3.4) two cysteines and nine prolines were found conserved among five different NPVs. The secondary structure analysis showed eight potential a-helixes, four loops and one P -sheet. Several conserved domains were found inside these specific secondary structures. Most of the conserved domains were found in the middle of the gp4l amino acid sequences. The amino and carboxyl terminals were highly variable. No N-glycosylation sites, Rx(S/T), were presented in Fig. 3.4, because the gp4l protein has been reported as an 0linked glycoprotein. However, no consensus 0-glycosylation sites were predicted by the aligned

PAGE 76

Figure 3.3. Hydrophobicity profile of the gp41 protein among five different NPVs . Conserved hydrophobic domains I-V were arbitrarily assigned (see text for details) .

PAGE 77

64 l 50 AcMNPV MTDERGNFYY NT-PPPLRYP SNPATAIFTS AQTY-NAPGY VPPATVPTTV BmMNPV P N....N AgMNPV -MN..DG..L .VSQA.A.H. FA.TS.TV.. S. --SGNY...M HzSNPV MSL.HA. SfMNPV CONS 51 a 100 -helix AcMNPV ATRDNRMDYT SRSNSTNSVA IAPYNKSKEP TLDAGESIWY NKjCVDFVQKI BmMNPV K . . AgMNPV S.MVQ.T.---RG.A..LV .T..DA--S HzSNPV T . ALQHQQHQ KQLQESS . .T . SfMNPV MSS . SLS.SS.CONS S-A. ITEP.M D. -WT. Y.H. , . .Y.ER. . .Y.N. , KC-D-V--I 101 AcMNPV BmMNPV AgMNPV HzSNPV SfMNPV CONS .F. [RYYpCNDMS ELSPLMILFI NTIRDMCIDT NPISVNWKR FESEjETMIRH H N T. . . .H S . .V. . .II. . VQTEj.EIV. . T H.T.Q..ML L. VES H D . E . NL . K . T . . . . Q.T.Q.LNL NV . . ET Y . VD . . AT . . . D . E VNLMNN -R-Y^-NDMS -LM 1 NTTR-C@ •P--VN--KR AcMNPV BmMNPV AgMNPV HzSNPV SfMNPV CONS 151 LIRLQKEIiGQ SNAAESLSSD SN [FQPSFVL NSIPAYAQKF YSTGGVDMLGK .G. . . YS . . R . YK. . . . -L-KEL-loop a-helix 200 . . G. . . . R . NSV . . . G . EV . .N KPIT. .P. . ID. EN .D .A. .KA. .Y .V . Y SV [F--SFV--LP-YAQKF Ytf-G . .A . . A. T . . . K.AENVSG K . G . HLAS Figure 3.4. Alignment of the amino acid sequences of the gp41 protein among five different NPVs . CONS represents the consensus sequence. The dots indicate the gap and the dashes indicate the gaps or nonconserved sequences (for CONS sequence) . The conserved proline sites are denoted by the * symbol and the conserved cysteine sites are denoted by the @ symbol. Specific secondary structure domains were labeled inside the boxes, and the transmembrane domain is highlighted by double underlines.

PAGE 78

65 201 a-helix 250 DALAEAAKQL SLAVQYMVAE AVpCNfrPIPL P S . . .N S . . .SVS. . .HE. GE.L. .QI . . GSVE. . . RH. GY.L. .QI .Q EAA--L --A-QY -V loop a -helix S .T. FN 2QLANNY MTLLLKH A.TL .... V R V . T . I QR . . . . D . L . . . . QR QL-N-Y -TLLL r. . . r. . . PIPL P D. . .NI .NI AcMNPV BmMNPV AgMNPV HzSNPV SfMNPV CONS 251 a-helix PENIQSAVES .q.v.E. .V.D. .EIIN. N-Qloop a-helix K. S. RRFEHI NMINDLINAV IDDLF \GG .S.V. . KY . TL . I . . . S . . . . N . HMJ. .A. . .N IN-LIN-V IDD-F 300 P -sheet . V.tT.VY. . . -S G G DY^HYVIJNEK Y. Y. . Y. L. -Yif-YVINEK AcMNPV BmMNPV AgMNPV HzSNPV SfMNPV CONS 301 a-helix transmembrane domain 350 .VG. . IVT. .K£ . IL. . N--R IKE N . D . NRijRVMSIl KE NVAFLAPLSA SANIFNYM VE LATRAGKQPS MFQNATFLTS . I :_SQ . . . . H . . R . D . . E . . A .R. . L. .G. . .FI .T . . .NS. .K — LAT--GK-P. IG. . TP. .Q.I.N . ISYM. . . . . TT . V. -APLSA IF.NA S . SM . . M -A--L-351 400 AcMNPV BmMNPV AgMNPV HzSNPV SfMNPV CONS loop AANAjVNSPAA HL.TKSACQES LTELAFQNET LRRFIFQQIN YNKDANAI I A _ . R . IRLPL I* I I* -NGSNV E 2NRTS . .Q A...Y.. . KLS . KQNY* -KPV-V S3S.NV. .QQ E..A L . . LS .KN.ISQL*AcMNPV BmMNPV AgMNPV HzSNPV SfMNPV CONS 401 417 AAAPNATRPN TKGRTA* Figure 3.4. Continued.

PAGE 79

66 sequences. One potential transmembrane segment was found close to the carboxyl end with a consensus sequence of ENX4APLSAX3IFX using the transmembrane domain prediction program . Genomic Structure Analysis The genomic structures of the gp4l gene flanking regions of the AgMNPV-2D were analyzed (Fig. 3.5) . When the whole gp4l gene regions of five NPVs were aligned, they showed similar genomic structures and transcriptional orientations (relative to the transcription direction of the AcMNPV polyhedrin gene) with the exception of HzSNPV. In general, the gp4l gene regions were located at m.u. 45 to 52, but the gp4l gene region of HzSNPV was located at m.u. 96.5 to 97.6. Also, the transcriptional direction of all the ORFs of HzSNPV is opposite to other NPVs. Discussion In summary, the nucleotide sequence of the gp4i gene region of the AgMNPV2D was sequenced. Several ORFs were

PAGE 80

67 AcMNPV 47.6 mu 50.4 mu VlfBmMNPV 45.3 mu ORF 327 'ORF312 gp41 ORF 699 48.2 mu VlfAgMNPV 49.8 mu ORF330 VRF312 9P41 ORF702 52.4 mu vlf-1 SfMNPV HzSNPV 45.3 mu ORF>300 ORF348 (vlf-1) 96.5 mu ORF330 VRF300 gp41 ORF>667 45.0 mu gp41 ORF>258 97.6 mu ORF>299 gp41 ORF330 ORF 195 (vlf-1) Figure 3.5. Genomic structure of gp41 gene flanking regions of AcMNPV, BmMNPV , AgMNPV2D , SfMNPV2, and HzSNPV. * refers to the ORF which was not found in either SfMNPV or HzSNPV. Note the data of HzSNPV is modified from isolate HzS-15 which is considered as a genomic rearrangement isolate (see text for details) .

PAGE 81

68 identified including the vlf-1 gene, ORF 330, ORF 300, gp4l gene, and ORF >667. Among these ORFs, the AgMNPV2D shared 50 to 70% of the nucleotide sequence identities and 60 to 80% of the amino acid sequence similarities with four other NPVs. However, the AgMNPV2D ORF 300 did not show homologies with the gp41 regions of all five NPVs. The gp4l gene region of SfMNPV-2 and HzSNPV did not contain the ORF 300 homologous sequences. This result may be caused by a genomic deletion. However, it was not shown whether a homologous sequence of the AgMNPV ORF 3 00 was present in a different genomic region of SfMNPV-2 or HzSNPV. Furthermore, the homologous sequences of the AgMNPV2D ORF 300 were searched using the BLAST program and no significant homologous sequence was found other than the AcMNPV and BmMNPV ORF 312 . The gp4l gene is a unique gene which is only found in the OV. However, no biological function has been proved yet. An attempt to select a recombinant virus with a deletion in the gp4l gene was not successful. The results suggested the gp41 gene could be an essential gene and have influences on both BV and OV even though the gp41 protein is only found in the OV. If the gp41 gene is an essential

PAGE 82

69 gene, a transformed cell line that constantly expresses the gp41 protein will be needed to complement the gp41 gene when the gp41 gene deletion mutant is selected. Nevertheless, several computer programs were used to predict the potential biological function based on the biochemical characterization of the gp4l protein. Four a-helices at consensus sites of 93 to 104, 204 to 222, 244 to 257, and 273 to 284 (CvDyxkliRyY, EaakqLsiAvQYmvaeaV, qQLaNnYxTLLLkr , and IndLINxVIDDl ) , one loop domain at 237 to 241, (PIPLP) , and one P-sheet domain at 292 to 295 (YYxYV) were found to be conserved (Fig. 3.4). The results were confirmed using both the PHD (EMBL) and Darwin programs (Benner, 1995) . One transmembrane domain was predicted at amino acid sequences of 309 to 328. The transmembrane domain (Fig. 3.4), was also found to be a conserved hydrophobic domain (Fig. 3.5). The results strongly suggested that the gp4l protein is a membrane protein. The hydrophobic profile revealed five conserved hydrophobic domains, and region III was also found to be a conserved a-helix domain. The correlation of the conserved hydrophobic domains and a-helix may suggest that region III

PAGE 83

70 has a specific biological function. An attempt to generate a three-dimensional (3D) graph using the threading method (Madej et al . 1995) was not successful because no homologous sequence against the gp41 protein was found in the PDB (protein data bank) . The crystallographic data of gp41 or a closely related transmembrane protein will be needed to generate the 3D graph of the gp4l protein. In contrast with the gp4l px'otein, the gp64 protein is only found in the BV. The gp64 is a glycosylated membrane protein and is involved in cell to cell infection. . It has been proved to be an essential gene for baculovirus infectivity. Two conserved hydrophobic domains at amino acid sequences of 220 to 230 and 327 to 338 (TELVACLLIKD and LNNMMHDL I YS V ) were associated with biological function. Region I is involved in the fusion activity of the gp64 protein, and region II is involved in the oligomerization and transport of gp64 protein (Monsa & Blissard, 1995) . Also, one transmembrane domain was identified at the carboxyl terminal. No similarity of amino acid sequence was found between the gp64 and gp41 transmembrane domain. The study of the similarities of the secondary structure of the gp4l and gp64 proteins will provide information for

PAGE 84

71 understanding the baculovirus structural proteins. The AcMNPV vlf-1 gene is a very late expression factor to regulate the polyhedrin gene transcripts (McLachlin & Miller, 1994), and is required for strong expression of the polyhedrin gene in a characterized temperature sensitive mutant. The translated amino acid sequence showed homology with a family of integrases, resolvases and RNA helicases (McLachlin & Miller, 1994) which may be involved in the interaction with DNA and/or RNA during the transcription. Unfortunately, the partial amino acid sequence of SfMNPV and HzSNPV did not overlap with these specific motifs, and no further analysis was done because of insufficient information. The phylogenetic analysis of the gp4l gene showed the AgMNPV2D had a closer relationship to the AcMNPV and the BmMNPV than to SfMNPV2 and HzSNPV. This result is consistent with the DNA hybridization data (Smith & Summers, 1982) , in which AcMNPV was found to have low homology with HzSNPV and SfMNPV (1% relative homology) but moderate homology with AgMNPV2D (8% relative homology) . Not only the DNA hybridization data, but also the phylogenetic tree of baculovirus polyhedrin genes agrees with the phylogenetic

PAGE 85

72 tree of the gp4l gene (Cowan et al . , 1994; Zanotto et al . , 1993) . The results of the phylogenetic tree of the polyhedrin gene also divided the AcMNPV, AgMNPV-2D, and BmMNPV into one group and HzSNPV and SfMNPV-2 into another group . Overall, the genomic structure of the gp41 gene region showed that all of the NPVs have similar local ORF arrangements except HzSNPV. The HzS-15 isolate analyzed in the present study was described as a rearranged genomic isolate based on the overall genomic structural comparison with another HzSNPV isolate, ELCAR (Cowan et al. , 1994) . . The gp4l gene of the HzS-15 isolate terminates upstream of the polyhedrin gene, near m.u. 97. But the gp4l gene of HzSNPV ELCAR isolate is placed downstream of the DNA polymerase -related ORF, near m.u. 50, which is far away from the polyhedrin gene. This explains why the HzS-15 has a different genomic and transcriptional orientation. The reason we did not use the isolate ELCAR instead of HzS-15 is because of the incomplete sequence in the gp4l gene region (specific for the gp4l gene) . When the HzSNPV isolate ELCAR instead of HzS-15 was compared with four other NPVs, we found the gp4l gene regions are always located around m.u.

PAGE 86

73 45 to m.u. 52. These data indicate that most NPVs still maintain similar genomic structures even though there is a mechanism for genomic DNA rearrangement .

PAGE 87

CHAPTER 4 PHYLOGENETIC ANALYSIS OF BACULOVIRUSES Introduction The evolutionary relationships among baculoviruses have been predicted using molecular approaches. Until 1996, three baculovirus genes including the polyhedrin (polh) gene (Rohrmann, 1986; Zanotto et al . , 1993; Cowan et al . , 1994), the DNA polymerase (dnapol) gene (Pellock et al . , 1996) and the ecdysteroid UDP-glucosyltransf erase (egt) gene (Barrett et al . , 1995) have been used to reconstruct the phylogenetic trees. The results based on the polh gene of baculoviruses (Rohrmann, 1986; Zanotto et al . , 1993; Cowan et al..-, 1994) suggest that dipteran NPVs and hymenopteran NPVs diverge from the lepidopteran NPVs and GVs before they split. The phylogenetic tree of the baculovirus dnapol genes is reconstructed using six baculoviruses including Autographa calif ornica MNPV (AcMNPV) , Bombyx mori MNPV (BmMNPV) , Orgyia pseudotsugata MNPV (OpMNPV) , Choristoneura fumiferana MNPV 74

PAGE 88

75 (CfMNPV) , Helicoverpa zea SNPV (HzSNPV) and Lyman tria dispar MNPV (LdMNPV) (Ahrens & Rohrmann, 1996), and is generally comparable to the phylogenetic tree scheme based on the polh gene. Furthermore, the dnapol genes of two baculoviruses , AcMNPV and HzSNPV, are compared with two other insect DNA viruses {Spodoptera ascovirus, SAV, and Choristoneura biennis entomopoxvirus , CbEPV) (Pellock et al . , 1996), and with human viruses to reveal their evolutionary relationships. The results suggest that, the baculoviruses have an independent evolutionary pathway from other insect and human viruses. Phylogenetic analysis of the third baculovirus gene' (egrt) among six different baculoviruses shows similar topology to the phylogenetic trees of polh and dnapol genes (Barrett et al . , 1995) . Although the molecular approach can be used to elucidate the evolutionary relationships among baculoviruses, critics agree that the phylogenetic tree of a particular gene does not represent the evolutionary pathway of the whole organism (Li & Graur, 1991) . So far, all baculovirus phylogenetic trees are based on a single gene, and therefore may not properly represent the evolutionary pathway of baculoviruses. In the present study, this

PAGE 89

76 problem is approached using a congruent analysis (Miyamoto, 1985; Wheeler, 1991). The evolutionary relationship of baculoviruses is revealed based on multiple phylogenetic trees of baculovirus genes instead of a single gene. The congruent results are concluded from six different phylogenetic trees of baculovirus genes including either structural proteins (polh, plO, gp64, and gp41) or enzymatic proteins {dnapol and egt) . The results will provide more solid support for a current hypothesis of baculovirus evolutionary pathway. Method s DNA Purification of LdMNPV Lymantria dispar MNPV (LdMNPV) DNA (GYPCHEK, U.S. Forest Service) was purified (Appendix D) from a commercial preparation of polyhedra and used as a DNA template for PCR amplification. PGR Amplification and DNA Sequencing of LdMNPV gp41 Gene A set of polymerase chain reaction (PCR) primers was

PAGE 90

77 constructed to amplify the gp41 gene of LdMNPV. The oligonucleotide primers were designed based upon the conserved sequences of gp41 genes from five baculoviruses including AcMNPV (Kool et al . , 1994), Anticarsia gemmatalis MNPV (AgMNPV) (Liu & Maruniak, unpublished data) , BmMNPV (Nagamine et al . , 1991), HzSNPV (Ma et al . , 1992), and SfMNPV (Liu & Maruniak, 1995) . The JM37 upstream primer of the gp41 gene was a 25 nucleotide oligomer with the following sequence: ACAA ( C/T) AA ( C/T) TATATTATAAGTA (A/G) TCC . This primer was located within the transcriptional initiation site region of the gp41 gene. The JM40 downstream primer was a 21 nucleotide oligomer with the following sequence: GTTGTAAAA (C/T) TTTTGNGC (G/A) TA. Based on DNA sequence alignment, the expected size of the PCR product using this primer set was around 500 base pairs (bp) . The PCR reaction was done in a final volume of 25 ul containing 200 uM of each dNTP, 4 pmoles of each primer, 2 mM MgCl 2 , 0.5 units of Primezyme (Biometra) , and reaction buffer (10 mM Tris-HCi, pH 8.8, 50 mM KCl, 0.1% Triton X-100) . A concentration of 100 ng of DNA template (LdMNPV

PAGE 91

78 genomic DNA) was used per PCR reaction. Thirty fil of autoclaved mineral oil was applied to the top of the reaction mixture to prevent evaporation. The PCR reaction was performed in a PTC100 programmable Thermal Cycler (MJ Research, Inc) . The PCR cycle consisted of an initial denaturation step at 95°C for 1 min, followed by 35 cycles at 94°C for 1 min (denaturation), 45°C for 1.5 min (annealing) , and 72°C for 2 min (extension) . The final extension step had a 15 min duration. The PCR product was purified through a DNA purification column (QIAquick™. Qiagen Inc.) to remove salts and enzyme. The purified PCR product was then cloned into a pGEM-T vector (Promega Corp.), and sequenced using an automatic sequencer (ABI 373a) from the DNA Sequencing Core Laboratory (DSEQ) of the Interdisciplinary Center for Biotechnology Research (ICBR) at the University of Florida. Search of Baculovirus Genes through GenBank The BLAST (Madden et al . , 1996) and ENTREZ (Schuler et al., 1996) programs (Appendix B) available from the National Center for Biotechnology Information (NCBI, USA) were used

PAGE 92

to search the homologous sequences of six baculovirus genes. A list containing the GenBank accession numbers, baculovirus species names and related references used in the present work is presented in Table 4.1. Twenty-three nucleotide sequences of baculovirus polh genes were found in the GenBank. Three undeposited polh gene sequences, Anagrapha falcifera MNPV (Dr. Federici, personal communication) , A. gemmatalis MNPV and Neodiprion sertifer SNPV (Zanotto et al . , 1993), were entered manually into a Micro VAX. computer at the Biological Computing Facility (BCF) of tne ICBR at the University of Florida. Table 4.1. List of GenBank accession numbers, baculovirus species and references for DNA sequences used in the construction of baculovirus phylogenetic trees. Accession number Baculovirus species Reference Polyhedrin gene DO 04 3 7 Panolis flanmea MNPV (PfMNPV) Oakey et al. , 1989. J. Gen. Virol. 70:769 D01017 Spodoptera littoralis MNPV (SpliMNPV) Croizer & Croizer, 1994. unpublished D14573 Hyphantria cunea MNPV (HcMNPV) Isayama et al., 1993. unpublished J04333 Spodoptera frugiperda MNPV (SfMNPV) Gonzalez et al . , 1989. Virology 170:160

PAGE 93

80 Table 4.1. Continued K01149 Autographa calif ornica MNPV ( ACFLNFV ) Hooft van Iddekinge et 3.1 . , . virology 131 : 561 tjfi A o o c Orgyia pseudotsugata MNPV (OpMNPV) Leisy et ai . , lSobD. Virology 153:280 Mamestra brassicae MNPV (MbMNPV) Cameron & Possee, 1989. Virus Res. 125 : 183 M23176 Lymantria dispar MNPV (LdMNPV) Smith et al . , 1988 . Gene 71:97 MJ U y z r> Bombyx mori MNPV (BmMNPV) Maeua et al . , 1985. Nature 315:529 M32433 Orgyia pseudotsugata SNPV (OpSNPV) Leisy et al . , 1986a. J. Gen. Virol. 67:1073 S48199 Spodoptera exigua MNPV ( seMNPV; van Strien et al . , 1992. J. Gen. Virol. 73 :2813 bo b4 D Z flttacus ncim NPV (ArMNPV) Hu et al . , .1993 . I Chuan Hsueh Pao 20 :300 U22824 Perma nuda MNPV (PnMNPV) Chou et al. , 1993 . unpublished U30302 Leucania separata MNPV (LsMNPV) Wang et al. , 1996 . unpublished U40833 Choristoneura fumiferana MNPV (CfMNPV) Rieth et al . , 1996 . unpublished U40834 Archips cerasivoranus MNPV (ArcMNPV) Rieth et al . , 1996 . unpublished X55658 Malacosoma neustria MNPV (MnMNPV) Vladimir & Kavasan, 1990. unpublished X70844 Buzura suppressaria MNPV (BsMNPV) Hu et al. , 1993 . J. Gen. Virol. 74:1617 X94437 Spodoptera litura MNPV (S1MNPV) Bansal et al. , 1996 . unpublished Z12117 Helicoverpa zea SNPV (HzSNPV) Cowan et al . , 1994. J. Gen. Virol. 75:3211 K02910 Trichoplusia ni GV (TnGV) Akiyoshi et al . , 1985. Virology 141:328

PAGE 94

81 Table 4.1. Continued Y no A Q o AU Z ft j O rieilS JJZaSSlCac VFJjLjv.' Chakerian et al . , 1985. J. Gen. Virol. 66 : 1263 X79569 Cryptophlebia leucotreta GV (C1GV) Jehle & Backhaus, 1994. J. Gen. Virol. 75 : 3667 plO gene M10023 Autographs calif ornica MNPV Kuzio et al. , 1984 . Virology 139:414 1VJ X ft O O J O-^^yia pseudotsugata MNPV Leisy et al . , 1986c. Virology 153 : 157 UQQC1 O Chori stoneura fumiferana MNPV Wilson et al . , 1995. J. Gen. Virol. 76:2923 TT-i CTC;7 UiO / 3 / Bonibyx mori MNPV Palhan & Gopinathan, 1995. thesis, Indian Inst . Sci . , India U50411 Perina nuda MNPV Chou et al . , 1996 . unpublished X69615 Spodoptera exigua NPV Zuidema et al., 1993. J. Gen. Virol. 74:1017 X92713 Spodoptera litura NPV Behera et al . , 1996 . unpublished gp41 gene D1446 8 I5UlIU3ysL MOn l v LN±rV Nagamine et al., 1991. J . Invertebr . Pathol . 58 :290 L04748 Helicoverpa zea SNPV Ma et al. , 1992 . Virology 192 -224 U14725 Spodoptera frugiperda MNPV Liu & Maruniak, 1995. J. Gen. Virol. 76:1443 U37728 .Anticarsia gemmatalis MNPV (AgMNPV) Liu & Maruniak, 1996. unpublished X71415 Autographa calif ornica MNPV Kool et al. , 1994 . J. Gen. Virol. 75:487 gp64 gene L12412 Choristoneura fumiferana MNPV Hill & Faulkner, 1994. J. Gen. Virol. 75:1811

PAGE 95

82 Table. 4.1. Continued L33180 Bombyx mori MNPV Maeda, 1994. unpublished M22446 Orgyia pseudotsugata MNPV Blissard & Rohrmann, 1989. Virology 170:537 M25420 fly tocrranha ca 7 i fnrn i ca MNPV Whitfoi-ri et 1989 J. Virol. 63:1393 X00410 (7a I Ipri^ m(=> 7 1 nn&l la MNPV (GmMNPV) D± X11U V CTLCIX./ JL _7 C *x . FEBS Lett. 167:254 DNA T3olvmerase gene D11476 T •\sma n 1~ v~i a r\i cn^ r MWCV7 XJ V 1LIC3.11 L.J. _L d Li _L *DLJd±. 1*11N ir v DJ UI Ufa Oil crC ax . t .LZ? y A . J. Gen. Virol. 73:3177 D16231 Rnmhw mnri MMDU i— > i_yi i IX-/ y j\. iiiLvx J. i 11 n t v i^iia ey uiiomsr 1 ec 3.J. . , 1995. Virology, 206 :436 M20744 Autographa calif ornica MNPV Tomalski et al . , 1988. Virology 167:591 U11242 Helicoverpa zea SNPV Cowan et al . , 1994. J. Gen. Virol. 75:3211 U18677 Choristoneura fumi/erana MNPV Liu & Carstens, 1995. Virology 2 09:538 U39145 Orgyia pseudotsugrata MNPV Gross et al., 1993. : J. Virol. 67:469 U35732 Spodoptera Ascovirus Pellock et al . , 1996 . Virology 216:146 X57314 Choristoneura biennis entomopoxvirus Mustafa & Yuen, 1991. DNA Sequence 2:39 egt gene D17353 Orgyia pseudotsugata MNPV Rohrmann, 1994. unpublished L33180 Bombyx mori MNPV Maeda, 1994. unpublished M22619 Autographa calif ornica MNPV Miller, 1989. unpublished U04321 Lyman tria dispar MNPV Riegel et al., 1994. J. Gen. Virol. 75:829

PAGE 96

83 U10441 Choristoneura fumiferana MNPV Barrett et al . , 1995. J. Gen. Virol. 76:2447 U41999 Mamestra brassicae MNPV Clarke et al . , 1996. J. Gen. Virol, in press X84701 Spodoptera littoralis MNPV (SlittMNPV) Faktor et al . , 1995 . Virus Genes 11:47 Y08294 Lacanobia oleracea GV (LoGV) Smith & Goodale, 1996. unpublished In addition to polh, the nucleotide sequences of plO , gp4l, gp64, dnapol and egt genes were searched. Seven baculovirus plO genes and five gp64 genes were found. For the gp41 gene, five complete nucleotide sequences were obtained from GenBank and two partial sequences of LdMNPV and Xestia c -nigrum granulovirus (XcGV) (Dr. Goto, personal communication) were included for further analysis. Five gp64 and eight egt genes from different baculoviruses were also included in this study. Finally, dnapol genes of six baculoviruses and two other insect viruses {Spodoptera ascovirus, ASV, and Choristoneura biennis entomopoxvirus, CbEPV) were included for the phylogenetic studies. Reconstruction of Phyloaenetic Trees of Baculovirus Genes The nucleotide sequences obtained from BLAST and ENTREZ

PAGE 97

84 programs were analyzed using the Wisconsin Sequence Analysis Package™ (Version 8.1 VMS for VAX computer; Genetic Computer Group) . Amino acid sequences were translated from the nucleotide sequence. The multiple sequence alignment of both nucleotide and amino acid sequences were first produced using the Pileup program. The aligned multiple sequences were realigned using the CLUSTAL program (Higgins et al . , 1996) because of its accuracy for low homologous sequence comparison . MEGA (Kumar et al . . 1993) and PAUP (Swafford, 1990) computer programs were used to reconstruct the phylogenetic tree based on the final aligned sequences that were produced by CLUSTAL. The p-distance (proportion distance) and maximum parsimony methods (Fitch, 1971) were used for reconstructing phylogenetic trees based on nucleotide sequence data. The p-distance and neighborjoining methods (Saitou & Nei, 1987) were chosen for reconstructing phylogenetic trees based on the amino acid sequence data. The bootstrap test with 500 replications was done to show the reliability of the constructed trees using the neighborjoining method. The bootstrap result was given in terms of percentage confidence level.

PAGE 98

85 Relationship of Baculoviruses with Insect Hosts The insect host families (Hodges et al . , 1983) are presented in Figure 4.1. The family name of the insect host in parentheses after the baculovirus species name corresponds to the hosts of the baculoviruses used in this study to reconstruct the polh gene phylogenetic tree. The correlation between the baculoviruses and their insect hosts was studied by determining whether or not the insect hosts of closely related baculoviruses belong to the same family. Results PCR Amplification and DNA Sequencing of Ld M NPV gp41 Gene A partial sequence of the LdMNPV gp41 gene (381 bp.) was amplified and sequenced (Appendix E) . A baculovirus late gene motif was found upstream from the ATG translation start site (-32 to -28) . The translation start site did not fit the Kozak principle completely, but it was very similar. A Axx ATG C was found instead of the theoretical sequence Axx ATG (A/G) . The partial LdMNPV gp41 coding sequence was compared

PAGE 99

86 -a 01 TO 01 > > MNP ft ft HzS O (13 0) 0) 4-> fO E »H X o a, 0, a! a H U 0) 03 U X! • 4J >1 !h 3 CD 4-1 4J CD 4-4 o tc ai CQ Xi ra T) cj J1 T) 4-> CD CQ a CQ CD H CD 3 X " H CD Xi a) fO CQ CD CQ rd cd T3 CD CO CQ c as r rd CD rd 3 ^ ^1) a U O X! X CD O 4-> CD 4-1 c. x) cd n o r x -. CD rd -H CQ CD O rd -i— CO 0) CO M •H > O ^8 • CQ ™ U 5 « cd O cd ° Si -H 0 CQ CD o M Q, CD CD CQ E Eh u -H > CD rH O XI CD Eh > CD CD e cq rrj 4J C CQ O >,XJ <-H H 6 O Xi u >i rd rQ CD D4 T3 Mh CD CQ (1) OX • Xi 4-1 H CQ CD • -H CD 4-1 (C O (D 3 G h in D) (1) 4J H 3 O CQ 3 CDT3 U C CJ •H C CD O rd rd a u X> CO 3 -H > O

PAGE 100

87 with the AcMNPV gp41 coding sequence, and it showed 56% nucleotide sequence identity and 76% amino acid sequence similarity. The partial LdMNPV gp41 nucleotide sequence and translated amino acid sequence were used to reconstruct the phylogenetic tree. Phylogenetic Tree of Baculovirus polh Genes Twenty-six amino acid sequences from different baculoviruses were obtained from translated nucleotide sequences of published data (Table 4.1), and used to reconstruct the phylogenetic tree. In Figure 4.1, the phylogenetic tree was divided into three main branches: the lepidopteran NPVs, the lepidopteran GVs and the hymenopteran NPV (NsSNPV) . Within the lepidopteran NPV branch, the tree was divided into two main groups and one outgroup branch. Group I included AcMNPV, BmMNPV, AfMNPV, ArMNPV, AgMNPV, HcMNPV, ArcMNPV, OpMNPV, PnMNPV, and CfMNPV. Group II included OpSNPV, BsSNPV, PfMNPV, LsMNPV, MbMNPV, SlMNPV, SeMNPV, SfMNPV, MnMNPV, HzSNPV and SpliMNPV. The only member of the outgroup branch was LdMNPV (for complete name of baculoviruses, see Table 4.1). The tree reliability test

PAGE 101

using bootstrap analysis showed a low confidence level of 53% (Fig 4.1) in the branch that divides group I and II. Maximum parsimony analysis of the nucleotide sequences of 25 baculovirus polh genes (Fig. 4.2) showed two main branches of lepidopteran NPVs, and agreed with the grouping profile from the phylogenetic tree based on the amino acid sequences (Fig 4.1) . Group II was divided into two subgroups. Subgroup A included the LsMNPV, MbMNPV, PfMNPV, SfMNPV, SlMNPV and SeMNPV, and subgroup B included HzSNPV, MnMNPV, BsSNPV and OpSNPV. The distance lengths between lepidopteran GVs and. lepidopteran NPVs was calculated to be 0.3 to 0.4, and to be 0.56 between lepidopteran GVs and NsSNPV (Fig. 4.1). Phylogenetic Trees of plO. gp41 and gp64 Genes The phylogenetic trees of baculovirus genes coding for the structural proteins, plO, gp41 and gp64 were presented in Figure 4.3 (based on the amino acid sequences) and Figure 4.4 (based on the nucleotide sequences) . The plO gene phylogenetic tree based on the amino acid sequence showed that AcMNPV and BmMNPV were in the same group. OpMNPV and

PAGE 102

89 > > > 0 0 0 H A G >>>>>>&>>>>>>>>>>>>> ft ft ft ft ft ft 2 ft ft ft ft ft ftftftftftftftft to n «H g ft H ft C H 0 0 »p H H 1 N C B ft < « 4 4 o & o 3J k1 s fcwwwKSfflO aj TS H -U O U H JJ 0) C ID tn H O U rH 0) 43 CD 4J J=! o T! 0! DQ rO X) TS O O rH & U 0) m g 42 4-1 a o o g 0) -H CD CQ .u m g 3 u -H 4J (U C -H (U X tn rd O g 0) CO a; u a 0) CD tJ 1 0) H CD U b CO 4-> 0) 3 0)

PAGE 103

90 > ft u 4 > > > CQ >W O U > ft ft > w ft o o o CO 0) 1) Cn o to CO O o 4-1 0 0) 0 a m -U W H T3 (U JJ o 4J a >i d) 4J 03 E •H X 0 !h a ft (0 43 u n) a) > ft u > o u o o o o > ft N 33 CO > ft 14-1 CO a 01 ft tn CN CN in o o 4-1 0 0) U a n) -U ra H T3 0) 4-> 0 P W ft U o > ft 4-1 u o o 0) a 51 ft o n H o o 4-1 0 — a a> o H O CQ d) 4-1 U o c cu c o a (D CJ (U 3 tn tJ 1 ft o CD rd r-H SH >, XI TS CQ ft -H 4-) 4H O 0 CD o u ox: CD O X! -U C 4-1 4J o o U -H -U m cd u o -U CD -U cu -u tn jJ CQ a o (0 a) u H u u o 0) 4J CD tn co o a rH tC ft >i >H ts Xi 4-> 0 CD D-i X! tQ CD 4J 3 n 4J co cq 4-) fC c a <: O CD CD CQ T5 U Ti (D O 3 (D >h x; tn CQ ft 4J -H fO CD CD fcX5 S4 E

PAGE 104

91 > ft 0 > > > > > ft ft ft 0. ft g g s § M-l rH ft 0 > ft 2> > N > ft CO > 0 u > ft u > ft u > ft ft o T5 0) to to. & 3 CO T3 ro m O ~Xi PQ -U — a) &i o < o 0, CO U -H > o H U m x> o CD CD u -U u •H 4J CD a CO M nl £ H X £ cu X CO cu u a cu cu CO (U T3 •H 4J O tn a) o i — I H o X! a , X! (U x 4-) o jj CO O u

PAGE 105

92 PnMNPV were also closely related. The results also showed that the SlMNPV was distantly related to the other NPVs that were analyzed. When the plO gene phylogenetic tree based on the nucleotide sequence (Fig. 4.4 A) was compared with the tree based on the amino acid sequence (Fig 4.3 A) , the results showed some differences. The OpMNPV and PnMNPV were distantly related to AcMNPV and BmMNPV based on nucleotide sequences, whereas SeMNPV and SlMNPV were distantly related in the amino acid based tree. The gp41 gene phylogenetic tree based on the amino acid sequences (Fig. 4.3 B) groups the AcMNPV, BmMNPV and AgMNPV together, and LdMNPV and HzSNPV in a separate group. The SfMNPV was distantly related to these two groups. The results also positioned the XcGV as an outgroup. The gp42 gene phylogenetic tree based on the nucleotide sequences (Fig. 4.4 B) agrees with the tree based on amino acid sequences. The gp64 gene phylogenetic tree based on amino acid sequences (Fig. 4.3 C) presented the AcMNPV, BmMNPV and GmMNPV in one group, and OpMNPV and CfMNPV in a second group. However, the phylogenetic tree based on the nucleotide sequence (Fig. 4.4 C) showed that BmMNPV was closer to OpMNPV and CfMNPV than to AcMNPV and GmMNPV.

PAGE 106

93 Phylogenetic Trees of dnapol and egt Genes The dnapol gene phylogenetic tree based on the amino acid sequences from six baculoviruses (Ahrens & Rohrmann, 1996), one ascovirus and one entomopoxvirus (Pellock et al . , 1996) was reconstructed and showed that AcMNPV, BmMNPV, CfMNPV and OpMNPV were closely related, while HzSNPV and LdMNPV were grouped • separately (Fig. 4.5 A). The results also indicated that SAV and CbEPV were distantly related to baculoviruses. The phylogenetic tree obtained from the nucleotide sequence data (Fig. 4.6 A) confirmed these results . • The egt gene phylogenetic tree (Barrett et al . , 1996) showed that AcMNPV and BmMNPV group together, while CfMNPV and OpMNPV form another group, and the LdMNPV and MbMNPV a third group. S. littoralis MNPV (SpliMNPV; abbreviated to distinguish it from S. litura MNPV which is abbreviated S1MNPV) was distantly related to the other lepidopteran NPVs . LoGV was considered to be an outgroup virus in this analysis. Both phylogenetic trees based on the amino acid and nucleotide sequences agreed with each other (Fig 4.5 B and 4.6 B) .

PAGE 107

94 > o o > >l g co 2 N 4-1 aw u o > > CO o o o o 0) G 0) 01 w M a) o ft a > w u o o 0 u > P* u o o > pi ft o o o H O o > 1 > 43 & •H ft CO in en 0) a 13 O O H hH (0 0< I) >, rH OJ U aj 6 •H 0 In ft ft id u rd id u CO 0 Q) CQ T3 CQ 3 CD 4J CQ £ CQ rd CD rd XI CQ 5 CD a) a o cox (1) rl -U tjl CD m a tn — rrJ £ U -rl •HDD > 43 rH O E-i rH (1) 3 U u • a ns cq a) CQ X! QJ TS d) U -rl d) 14H f3 4H M O (U a -U P 0 a) o 1 u u CD CD -rH !h CQ Ojjcj -U rd 0) T} U C U -H 4-> CD H U CQ CD -u rd u 0 CD 0 rH COO >i d a tD-H a o e 4h H IS O 0) 43 43 T5 CL> .iJ ft a) Cn 4J rd 4J • rd jj U If H fj 3 • CQ CD rH ^ C U 4-> rd in CQ CD rH CD a ri*j ao u in CD CD •H 43 43 0 h JJ 4~>

PAGE 108

95 a ft u > ft > ft ft o > ft > > > > > > > > ft ft > ft ft ft ft ft ft g SN > ft W MN MN MN H rH N .Q u M-l ft T3 ft < u < u O w > o o PQ 0 — 4J CQ

PAGE 109

96 Relationship of Baculoviruses and Their Hosts The family name of the insect hosts of baculoviruses was also shown in Fig 4.1. When hosts were compared with the polh gene phylogenetic tree, the results showed a certain level of correlation between hosts and baculoviruses. For example, the hosts of OpMNPV, CfMNPV and PnMNPV that were closely related, belonged to the family Lymantriidae . Also, most NPVs from group II including MbMNPV , FfMNPV, SfMNPV, SeMNPV, SiMNPV, and HzSNPV infected hosts from the family Noctuidae . Congruent Analysis of Baculovirus Genes A congruent analysis based on combined baculovirus gene data sets was compared with six independent phylogenetic trees of baculovirus genes. The six genes included polh, dnapol, egt, plO, gp41 and gp64 of AcMNPV, BmMNPV , OpMNPV and PfMNPV. The phylogenetic tree of combined sequence data was reconstructed and compared to each single gene tree. The results did not show any difference between the universal tree that was based on the combined sequence data and each single gene tree.

PAGE 110

97 Discussion This study presents for the first time an analysis of the evolutionary relationships among baculoviruses using phylogenetic trees based on multiple baculovirus genes. A congruent analysis was made in order to alleviate problems in previous evolutionary studies that were based on a single baculovirus gene (Rohrmann, 1986; Zanotto et al . , 1993) . It has been a challenge to determine whether or not the gene tree can represent the species tree for evolutionary studies (Li & Graur, 1991) . A congruent analysis was used in an attempt to solve this problem. Although only six gene sequences of four baculovirus species were available for comparison in this study, more gene sequence data will become available for congruent analyses of baculoviruses in the future. Currently, there are no guidelines for how many genes and species need to be tested to support a phylogenetic tree based on congruent analysis. The development of PCR and automatic DNA sequencing techniques is rapidly increasing the number of available sequences and will help improve data analysis.

PAGE 111

98 The congruent approach also allowed us to find out if an independent gene tree agrees with other gene trees including the universal tree. The results suggested that the polh gene is a useful marker to represent the universal tree and/or the baculovirus species tree. In addition, the phylogenetic tree of polh gene can be used to identify a newly isolated baculovirus. Two reasons have been found for using the polh gene tree to represent the baculovirus species tree in this study. First, the polh gene group has the biggest nucleotide sequence group that is currently available and include nucleotide sequences from 25 baculovirus species and amino acid sequences from 26 baculovirus species. Second, the polh gene tree agrees with all other gene trees that have oeen tested in this study. No significant difference was found between zhe polh gene tree with other gene trees. The data of the polh gene also agree with the universal tree that in total represents around 6% of genomic DNA (based on AcMNPV) and 4% of the total potential encoded genes. Since it compares to these available baculovirus gene sequences, the polh gene is considered as the most reliable and useful gene to represent the phylogenetic tree for baculovirus species.

PAGE 112

99 In comparison to the data published by Zanotto et al . (1993) , the polh gene phylogenetic tree in this study was reconstructed with newly available sequences. The results showed that there were three main branches including lepidopteran NPVs, lepidopteran GVs and a hymenopteran NPV. They also indicated that lepidopteran NPVs can be divided into two groups, I and II. Lepidopteran group II can be further subdivided into several subgroups as Cowan et al . (1994) suggested. The divergence of lepidopteran NPV subgroups may be indicative of an ongoing evolutionary pathway for baculoviruses . More careful examinations of the evolutionary rate such as nucleotide substitutions per nucleotide site (Aotsuka ef. al . , 1994) is needed to determine if subgroups I and II will become well-separated branches . Overall, there is a 59% nucleotide sequence identity of the polh gene between lepidopteran NPVs and lepidopteran GVs, and there are 74% to 92% identities among lepidopteran NPVs (Rohrmann, 1992) . In addition, the baculovirus polh gene has a functional counterpart to the cytoplasmic polyhedrosis virus (CPV) RNA viral family. In 1989, Fossies et al . characterized the gene that encoded for the major

PAGE 113

100 protein present in the proteinaceous occlusion body (polyhedrin gene) for Euxoa scandens CPV. The homologies of polh gene amino acid sequences between OpNPVs (OpMNPV and OpSNPV) and OpCPV are as little as 12% (Galinski et al . , 1994). Although the nucleotide sequence identities between NPVs and CPVs are very low, their polh protein functions are very similar. The dissimilarities between NPVs and CPVs such as low identities of polh gene sequences and different types of genome structure (DNA viruses vs. RNA viruses) indicated that their polh genes may involve a convergent evolution . The dnapol gene is used for comparison between baculoviruses and other insect DNA viruses, because it is the most common gene among DNA viruses from different organisms. It has been reported that the AcMNPV dnapol gene is classified in the viral subgroup of dnapol gene family B, and is related to the dnapol gene of human virus and eukaryotic organisms such as fungi (Heringa & Argos, 1994). In this study, the results showed that baculovirus group had evolutionary paths independent of other enveloped insect DNA viruses, SAV and CbEPV. This agrees with previous published results (Pellock et al . , 1996) and is not surprising,

PAGE 114

101 because these DNA viruses have different genomic DNA replication and viral infection strategies (Tanada & Kaya, 1993) . A previous published phylogenetic tree of the baculovirus egt gene (Barrett et al . , 1995) was reconstructed and compared to the phylogenetic trees of polh and dnapol genes to examine the true topology of baculovirus phylogenetic trees. No significant difference was found between the egt gene and the other gene trees. Although it is very common to find that different gene trees have different topologies (Forterre, 1997), the comparison between polh, dnapol and egt gene trees showed that these genes have similar evolutionary paths and/or rates. Since all the analyzed trees agreed with each other, it should be reasonable to predict the evolutionary pathway based on a single gene tree such as. polh gene. Furthermore, three phylogenetic trees based on baculovirus plO, gp41 and gp64 were reconstructed in this study. For the phylogenetic trees of the baculovirus plO gene, the results showed different schemes based on either the nucleotide sequences or amino acid sequences. The inconsistences may be caused by the low homology of plO

PAGE 115

102 genes among baculoviruses (20 to 40% identities of amino acid sequences). Kumar et al . (1993) found that it is easy to misinterpret the results when low homology sequences are used to construct phylogenetic trees. However, it could also be caused by using different methods when the phylogenetic trees were reconstructed. In this study, the nucleotide sequences were analyzed using the maximum parsimony method, while the amino acid sequences were analyzed using the neighborjoining method. These two methods have completely different algorithms, which may explain why the plO gene trees based on different types of data did not agree with each other. Since there is no evidence to suggest one method is superior to other, it is probable that the plO gene group has a higher evolutionary rate (more nucleotide. substitutions per site) than other gene groups . The phylogenetic trees of the baculovirus gp41 and gp64 genes show similar topologies based on either nucleotide or amino acid sequences. In this study, two partial sequences were used to reconstruct the gp41 gene phylogenetic tree. . Partial sequences coding for highly conserved domains have been used for reconstructing a dnapol gene phylogenetic tree

PAGE 116

103 (Heringa & Argos, 1994) and show a reliable result. In general, the phylogenetic tree of baculovirus gp41 genes agree with other gene trees. However, it is necessary to note that incomplete sequences may sometimes result in a dissimilarity with other trees. Only five sequences were used to reconstruct the phylogenetic tree of gp64 genes. Two functional domains of gp64 proteins have been identified (Monsma & Blissard, 1995) . It will be helpful to compare these specific domain in a protein function study, and to reconstruct the phylogenetic tree using the comparison of function domains. Moreover, a glycoprotein of a togoto virus (a tick-borne orthomyxolike virus) shows homology with the gp64 gene of bacul oviruses (Morse et 3.1 . , 1992) . Even though the amino acid sequence identity between the gp64 gene and the togoto glycoprotein gene is low (28-33%) , similarities between their hydrophobicity profiles and the conserved cysteine sites are highly significant. Again, it indicates that protein functional domains are highly conserved during evolutionary processing. In order to understand the host inference on baculovirus evolution, the phylogenetic relationships of

PAGE 117

104 baculoviruses were compared with their hosts.. The results showed that several branches of baculoviruses have the same host family. Most of the baculovirus in lepidopteran NPV subgroup II appear to infect the insect family Noctuidae . Two closely related lepidopteran NPV subgroup II branches including the branch of LsMNPV, MbMNPV, and PfMNPV, and the branch of SfMNPV, S1MNPV and SeMNPV are found to infect the same host family {Noctuidae) with closely related subfamilies (Hadeninae and Amphipyrinae) . Based on the results, it can be suggested that the lepidopteran NPV subgroup II has undergone a host --dependent evolution. On the other hand, the lepidopteran NPV subgroup I was more diverse than group II. Some baculovirus species such as the branch of OpMNPV and PnMNPV, and the branch of ArcMNPV and CfMNPV infect closely related families of insect hosts. These two closely related branches infect insects from the family Lymantriidae , and the family Tortriciidae (Groner, 1986; Zanotto et al . , 1993) that are closely related. This also shows that a host -dependent evolutionary pathway could exist. However, the rest of lepidopteran NPV subgroup I species did not have strong associations with the same family of insect hosts. It implies that these species such

PAGE 118

105 as AcMNPV (host family, Noctuidae) , BmMNPV (hose family, bowbycide) , ArMNPV (host family Saturniidae) and HcMNPV (host family, Arctiidae) are hostindependent and go through a nonparallel divergence from their hosts. The way that agriculture systems were involved in distributing the baculoviruses may indirectly result in evolutionary changes of baculoviruses. Some association between viruses and their geographic distribution has been reported. (Fenner & Kerr, 1994; Zanotto et al . , 1993 ; 1995). The genetic distance of tick-borne encephalitis was found to be correlated with the geographic distance (Zanotto et al . , 1995). However, no significant evidence was found in this study to support such a correlation for baculoviruses. Most baculoviruses that were analyzed in this study are distributed all over the world from North America, South America, Europe, the Middle East, and Asia. Thus, the geographic distribution of baculoviruses does not appear to be associated with their genetic distances. Although a geographic correlation with genetic distance was found among GVs in South East Asia and AgMNPV in South American (Zanotto et al . , 1993), this correlation was applied only to the strains of the same

PAGE 119

106 viral species instead of to the different viral species. Although no correlation between geographic distance with genetic distance was found among baculoviruses , the understanding of their relationship cannot be ignored since it is necessary for a complete evolutionary study. In addition, the evolutionary pathway of baculoviruses may be related to other factors such as the feeding preferences of baculovirus insect hosts. Certain closely related baculoviruses were found tc infect specific types of insect hosts such as forest pests, crop pests and vegetable pests. More studies willbe needed to ascertain whether or not this factor really plays any role in baculovirus evolutionary paths . In conclusion, the congruent analysis done in this study validates the evolutionary hypothesis of baculoviruses as suggested by Rohrmann (1986 & 1992) and Zanotto et al . (1993). The results confirm that hymenopteran NPV diverged early from lepidopteran NPVs and GVs, and that the lepidopteran NPVs and GVs then split. Lepidopteran NPVs continued to evolve and become two subgroups I and II, and subgroup II diverged into several subgroups again. In the future more information obtained from other NPVs such as

PAGE 120

107 hyraenopteran NPVs, dipteran NPVs and decapodan NPVs (shrimp) will help in understanding the complete evolutionary pathway of baculoviruses . The results of this study also suggest that the phylogenetic tree of polh gene can be used to represent the baculovirus species tree. The comparison of the polh tree with five other genes and the universal tree shows no significant differences and suggests that the polh gene is a reliable gene for evolutionary studies of baculoviruses. '

PAGE 121

CHAPTER 5 SUMMARY In this study, a baculovirus conserved gene, gp41, was used as a model to study the phylogenetic relationship among baculoviruses . The transcriptional analysis and protein secondary structure of the gp41 gene, and the structural analysis of the surrounding genomic region were also studied . Two complete gp41 gene nucleotide sequences from Spodoptera frugiperda multiple nucleocapsid nucleopolyhedrovirus (SfMNPV-2) and Anticarsia gemmatalis MNPV (AgMNPV2D) , and a partial gp41 gene from Lymantria dispar MNPV (LdMNPV) were sequenced. The SfMNPV-2 gp41 contained 999 nucleotides and encoded 332 amino acids. Two SfMNPV-2 gp41 gene transcripts were detected 12 hours postinfection. Primer extension analysis demonstrated that the gp41 gene promoter region contained three transcriptional start sites. Two of them were in the first two nucleotides of a consensus transcriptional start site (TAAG) of 108

PAGE 122

109 baculovirus late genes, and another transcriptional start site was located in a region where no consensus motif had been determined (-140 nucleotide from the translation start codon, ATG) . The AgMNPV2D gp41 gene contained 1,005 nucleotides and encoded 334 amino acids. Comparison of the nucleotide and amino acid sequences of the AgMNPV2D with four other NPVs including Autographa calif ornica MNPV (AcMNPV) , Bombyx mori MNPV (BmMNPV) , SfMNPV and Helicoverpa zea single nucleocapsid nucleopolyhedrovirus (HzSNPV) showed a minimum of 59% nucleotide identity and 70% amino acid similarity. Analysis of the protein secondary structure and amino acid sequence alignment of AgMNPV-2D gp41 gene revealed several conserved domains including eight cc-helix domains, four loop domains, one Psheet domain and one transmembrane domain. Furthermore, the hydrophobicity analysis of the gp41 gene showed five conserved domains. Domain III was correlated with one of the conserved ct-helix domains (qQLaNnYxTLLLkr) , and domain V was correlated with the transmembrane domain (EnxxxxAPLSAxxxIFxxx) . The genomic structure of the AgMNPV2D gp41 region also contained vlf-1

PAGE 123

110 gene, ORF 330, ORF300 and ORF >667, showing a similar arrangement with AcMNPV, BmMNPV and SfMNPV. On the other hand, this region had a different genomic location and transcriptional orientation in HzSNPV. Among these ORFs, the AgMNPV2D shared 50 to 70% nucleotide identity and 60 t 90% amino acid similarity to the four other NPVs . Lastly, six baculovirus genes including polyhedrin {polh) , plO, gp41, gp64, DNA polymerase (dnapol) and ecdysteroid UDP-glucosyltransf erase (egt) were used to construct phylogenetic trees. The phylogenetic trees confirmed that the hymenopteran NPVs diverged earlier from the lepidopteran granuloviruses (GVs) and lepidopteran NPVs Later, the lepidopteran GVs diverged from lepidopteran NPVs The results also showed that AcMNPV was closely related to BmMNPV, and that Orgyia pseudosugata MNPV (OpMNPV) was closely related to Perina nuda MNPV (PnMNPV) and Choristoneura fumiferana MNPV (CfMNPV) . The phylogenetic analysis of dnapol showed that the baculoviruses had independent evolutionary paths when compared to two other insect DNA viruses, Spodoptera ascovirus (SAV) and Choristoneura fumiferana entomopoxvirus (CbEPV) . In conclusion, this is the first time that phylogenetic trees

PAGE 124

Ill from six different baculovirus genes were constructed to study the evolutionary paths of baculoviruses . In the future, additional molecular data (nucleotide sequence, amino acid sequence, and three dimensional protein structure data) of baculoviruses will become available. These basic data can be used to construct phylogenetic trees of different baculovirus genes, and to predict the biological function of a particular baculovirus gene using computer modeling systems .

PAGE 125

APPENDIX A NUCLEOTIDE SEQUENCE OF Spodoptera frugiperda MNPV EcorRI-S FRAGMENT AND TRANSLATED AMINO ACID SEQUENCE OF GP41 GENE 1 GAATTCAATG TCGCTTTTAA 51 AAGCGTGCAA ACCGCCTATA 101 ACATTATACA TTTTTCATGG 151 TTCTTGCTAT ATCTAAACAA 2 01 TTACTGCCCT CATAAAAAAC 251 ATAACTAAAT CGTCGACAAT I T K S S T M 3 01 CGCGGCCATA ACCGAACCGT A A I T E P W 351 AAATCGTTCG ATACTATAGA I V R Y Y R 401 ATGCTAAACC TCATCAACAC M L N L INT 451 CGTAGACGTC AACGCCACCA V D V N A T K 501 ACAATTACAA ACGACTGCAA N Y K R L Q 551 GACATTTTCA AAGCTTCGTT D I F K ASF 601 AAAATTTTAC AACAAGGGCG K F Y N K G G 651 AAGCGGCCCG TCATTTGGGC A A R H L G 701 GTGACCACAA ACACACCCAT V T T N T P I 751 CGATTATCTA ACGTTGCTTC D Y L T L L L 801 AGGAGATCAT CAACAGCGGC E I I N S G 851 ATGATCAACG CTCTCATCAA M I N A LIN 901 CAGTGACTAT TATCTGTACG S D Y Y L Y V 951 TAAGTTTGAA AGAAAATATC S L K E N I 1001 AACATATTCA ACTTTATCGC N I F N F I A 1051 GAGCGTGTTC CAGAGCGCTT S V F Q S A S 1101 TCGTCAGCGA ATCCAAAAAC V S E S K N 1151 TTTGAAAATG AAGCATTAAG F E N E A L R AAATTGCGAA AGCATTCTGT GTAAACGTAG TCACCATGGC GGTTATAGTT TTATTTATCA TATTTTGTAC TATTTATTTT CGTAATGATA TAATTATATG A TAAG TAATC CAAAAATTGT AC AA TG GCCA ATTACACGAG GCCAAATTCA MAN YTR PNS GTCATCGTCT TCGTTGTCGT CGTCCTCGTC SSS S L S S SSS GGATGGACAA ATGTGTCGAT TACGTCAATA MDK CVD YVNK ACAAACGACA TGTCTCAATT GACCCCACAA TNDM SQL TPQ CATACGGAAT GTTTGCATCG AAACGTATCC IRN VCIE TYP AGCGTTTCGA CAGCGACGTC AACCTTATGA RFD SDV NLMN AAAGAGCTGG GCAATAAACC GATCACGAGC KELG NKP ITS CGTGTACAGC GTTTTGCCGT CGTACGCTCA VYS VLPS YAQ GCGATCATCT AGCCAGCGGC AGCGTCGAAG DHL ASG SVEE TACGCTTTAC AATATCAAAT CGCGCAAGCT YALQ YQI A Q A CCCCCTGCCG TTCGATCAAC AGCTTGCCAA PLP FDQQ LAN TGCAGCGAGC CAACATTCCG ACAAACATAC QRA NIP TNIQ AATCGGACGC ACGGCAACTC GCGCGTTCAC NRTH GNS RVH CAACGTGATC GACGATCTGT TTGCCGGCGG NVI DDLF AGG TGCTCAACGA AACTAACAAA TCTCGCATTC LNE TNK SRIL AGTTACATGG CACCATTGTC CGCCACCACT SYMA PLS ATT AACGCTCGCC ACCAATTCGG GTAAAAAGCC TLA TNSG KKP CGATGTTGAC CATGCCTCTA ACTAAACCTG MLT MPL TKPV GTGTGCCAAC AGCAACTGAC TGAACTGGCG VCQQ QLT ELA AAGATTTATC TTGCAACAGT TAAGTTATAA . RFI LQQL SYK 112

PAGE 126

113 1201 AAACGACATT N D I 12 51 GAGTCTTGAC 13 01 ATATTCCGCT 13 51 GACAACAATG 14 01 TGATATTAAT 1451 GTTCAAAACA 1501 TTTTGTATTT 1551 AGACAGACAA 16 01 ACTGATAACA 1651 TAATTGTTGG 1701 TTCAACTGGC 1751 GGTCGGTGGT 1801 GAAAAGTTAC 18 51 AGTCTCATCT TCGCAACTGT GATAACAACT SQL* GTTCCGTACG AACGTTTAGG AAAATTAGCT TTGACTGATT ACGACAATCA AAAAAACAAC CAATCAAACG CCAACAATTA ACAGTTTTAC GACATTTTAG TGGTATTGCT GTATGCTATA AAATCCAACA CTATAAGACC TTTTC AATAA AACAAACAAT AAATCCAAAA TCCAAAGTCA CACCGATCGA CAGCGATGCA CCAAGTTTAT TTTTAACAAA AAGTCTAGAT TCATCAAAAT CGACGAACTA AACACCTACG GAGGCTAGAA AAAAAAAGAT CACAGCGACC AAAGTCGATT TACCTTCAGA AAACACTTCA AAT AC C C AAA ATCCCAAAAT TAATCAACAT CAATCGGTTC TTTTAGGTAT GCTGACAGTG TATTACTTTG TTATATTAAG TAGTTATATG TTTTAGCATG GTGAGAAATG AATATTCGTT TTTTAGATTC GAGACCGTGT CGCCCGACAA GGTTCGTAAC CCGTTTGCGC CCACCACATT CATCTACTGT CTAATCGACG ATCTTAATCA AGAATTC * TAAG is the transcription start site of baculovirus late genes * ATG is the protein translation start site * AATAA is the poly (A) tail signal site

PAGE 127

APPENDIX B INTERNET SERVERS USED FOR DATABASE SEARCH AND PROTEIN SECONDARY STRUCTURE PREDICTION PROGRAM URL Site (Server Institute) Databank search BLAST http : / /www3 . ncbi . nlm . nih . gov/Blast / (National Biotechnology Information Center, USA) ENTREZ http : //www3 . ncbi . nlm . nih . gov/Entrez/ (National Biotechnology Information Center, USA) Protein secondary structure Darwin http : / /cbrg . inf . ethz . ch/ subsect ion3_l_7 . html (Swiss Federal Institute of Technology Zurich) PHD http : / /www. embl-heidelberg. de/predictprotein/ predictprotein.html (European Molecular Biology Laboratory, Germany) 0linked glycosylation site prediction NetOglyc http : / /genome . cbs . dtu . dk/netOglyc / cbsnetOglyc . html (The Technical University, Denmark) Transmembrane domain analysis MEMSAT http : //globin . bio . Warwick . ac . uk/~ j ones / memsat . html (University of. Warwick, U.K.) 114

PAGE 128

APPENDIX C NUCLEOTIDE SEQUENCE OF Anticarsia gemmatalis MNPV PstlHindlll FRAGMENT AND TRANSLATED AMINO ACID SEQUENCE OF GP41 GENE 1 AAGCTTGCCG ATACGCCGGT GCCGCACCAT GGGCCCGCCG AAGAAGAAAA 51 CGTTGTCGCC GAACGCTTTG GGTCAGAATC TGGCGACGCA CCATCGTCCC 101 CCAAAAAGCA AAAATTGGAC GAGTCTGAAC AAGATTAAAT ACGACAGCGA 151 ACTGCTCATT CACTATCTAT ACGAAGGGTT TTGCACCGAC AAACAACAAT 2 01 GCAATTTGAA CGTGATAAAA ATTTACAAAG TAAAAGTAAA GAAAACGGGC 2 51 GCTTCCATTT TGGCACATTA TTTTGCGCAA ATTTCTACTT CAAGCGGTTA 3 01 CGAGTTTGAA TTCCACCCCG GCAGTCAGCC TCGCACCTTT CAAACGGTAC 3 51 ACACCGACGG TCTCATTATA AAGGTGCACA TTATGTGCGA TGAATGCTGC 4 01 AAAGCGGAAT TGCGCAGATA CATCAAAGGA GAAAACGGCT TCAACGTAGC 4 51 GTTTCGCAAT TGCGAAAGTA TCCTGTGTCA ACGTGTCAGT TTTCAAACGC 501 TTTTGCTGGG ATGCGCCATT CTGTTGCTGC TGTTTAACGT GGAAAAATTT 551 TCGATATTAA ATTTGCTTGT CATTTTGTTA CTTTTAGTAG CGTTGTTTTG 6 01 TAACAACAAT TATATTA TAA GTAATCCATA CGTTGTATTT TGCAATCATA 6 51 AGAACGCATT AAAAAAC CAT GAATGAACGG GACGGCTTTT ATTTGAACGT M NER DGFY LNV 701 TTCGCAGGCG CCTGCGAGAC ACCCGTTTGC ACCCACCAGC GCGACCGTTA SQA PARH PFA PTS ATVT 751 CTAGTTCGCA AAGCGGTAAT TATCCAACCA CAATGTCCAC AATGGTGCAG SSQ SGN YPTT MST MVQ 801 CGGACAGATC GCGGCAGCGC AAACTCGCTT GTTAAAACCA AAGAAGACGC RTDR GSA NSL VKTK EDA 851 CAGCGGCGAA TCTATTTGGT ACAACAAGTG CACAGACTAT GTACATAAAA SGE SIWY NKC TDY VHKI 901 TTATTCGCTA TTATCGCTGT AACGACATGT CTGAATTGAC TCCTTTAATG IRY YRC NDMS ELT PLM 951 ATTCATTTTA TCAACACAAT ACGCGACATG TGCATTGACA GCAACCCTGT IHFI NTI RDM CIDS NPV 1001 TAGTGTAAAC ATAATCAAGC GCGTGCAAAC TGACGAAGAA ATTGTTCGCC SVN IIKR VQT DEE IVRH 1051 ACCTAATTGG GTTGCAAAAA GAACTGCGTC AGAATAGCGT GGCAGAGTCC LIG LQK ELRQ NSV AES 1101 ATCGATTCGG ATTCCAACAT TTTTCAGCCT TCGTTTGTAC TCAATTCGCT IDSD SNI FQP SFVL NSL 1151 GCCGGCGTAC GCGCAAAAAT TTTACAACGG CGGCGCAGAC ACGCTTGGCA PAY AQKF YNG GAD TLGK 1201 AAGACGCGCT CAACGAGGCG GCCAAACAGC TTAGTTTGGC CGTGCAGTAC DAL NEA AKQL SLA VQY 1251 ATGGTGTCGG AAGCGGTCAC GTGCAGTATT CCCATCCCGT TGCCGTTTGA MVSE A V T CSI PIPL PFD 115

PAGE 129

116 13 01 CCAGCAGCTT GCCAACAATT ATGTGACACT ACTTTTAAAA CGCGCCACGC QQL ANNY VTL L L K RATL 1351 TACCTGACAA CGTGCAAGAA GCCGTCAAGT CGCGCAGCTT TGTGCACATT PDN VQE AVKS RSF VHI 14 01 AACATGATCA ATGACCTCAT AAATTCAGTG ATTGACGATT TGTTTGCTGG NMIN DLI NSV IDDL FAG 1451 CGGCGGCAAC TATTATTATT ACGTGCTCAA CGAAAAGAAT CGCGCGCGCG GGN YYYY VLN EKN RARV 1501 TCGTAGGGCT CAAGGAAAAC GTGGGATTTT TGGCA CCA TT GTCCGCGTCC VGL KEN VGFL APL SAS 1551 GCGGACATTT TTAATTACAT GTCGCAACTT GCTACGCGAC ACGGCAAACG ADIF NYM SQL ATRH GKR 1601 TCCCGACATG TTTGAGAACG CGGCGTTTCT TACGTCGGCC GCCAACGCCA PDM FENA AFL TSA A N A I 1651 TCAACTCGCC GGCCGCCATT TGACGCAGAG CGCGTGCCAA AAGAGTTTGT N S P A A I * 1701 CTCAATTAGC GGCGCAGTGT GAAACGCTAA CCCGGTTCAT ATTCATGATT 1751 GTCAAGCAAA CTGACGCCGA CAGATTACTG AATCCGCCGC GTTCGCGCGC 1801 AATATGAGTT TGTACAAGAA CAAAGTGTGG TGCGTGTACA TTGTGCGGCG 1851 AGACGACGGC AAACTGTACA CGGGCATCAC CAGCGATTTG CGACGTCGTT 1901 TGAACCAACA CAAACGCGGC GTTGGTGCGC GTTTTTTACG CAATGCAAAC 1951 TCTTTGCGTT TACTTTATTG CAGCGCAAAC GCGTACGATT ACAAGACCGC 2 001 CGCGCAATTG GAATACAATC TTAAGCGTAA ACGCGGGAAA TATTTTAAAT 2051 TGCAATTAAT TAAAGCGCAA CCTCAACATT TGCATCAATA TTTGTCATCA 2101 TGAACTTGGA CGTGCCCTAC TACCGTTTGG GCAACCACGA GCGCGTAGAA 2151 TACATTCCGC TAAAACTAGC GCTAAACGAC GATGCGCCCG TCAACAACAA 2201 CAACGACGAC ACTGCTGTGT ACGAATACTC GGACGTACAC AAAGG CG AAA 2251 CGCGCACGGG TCAAATGTCG GCCGGTTTAA TTGTGCTGAT TAGTCTGGTG 23 01 GCGTTTGTGG CTTTGTTTCT GCTATTGTAT GTTATCTATT ATTTTGTAAT 2351 ATTAAGAGAA GAGCCGCAAT ATTCTTCCGA CACAATTGAC AACAGCGATC 2401 CTTCTTTTTT GTTT AATAA A TTTGATTAAT TACAATGAAC GAGCTGTTGA 2451 ACGCACGCAA CGAAAATGTT TTTAACGATT GGAAAATGCG CATTCAATCA 2501 GCGCCACAAT TTGAGCACGT GTTTGATTTG GCCACCGACC GACAGCGGTG 2551 CACGCCGGAC GAAGTAAAAA ACGACAGCCT GTGGAGCAAG TACATGTTTC 26 01 CCAAACCGTT TGCGCCCACC ACACTAAAAA GTTACAAGTC ACGTTTTATT 2651 AAAATTATTT TTAGCCTAAT AGAGGAACCG GATTTGCAAA ACACCGCATA 2 701 TTCGTTAAAC AGGGAATTTG ATTCGATTGA ATATCAACGG TTGCTTGTGA 2 751 ACCCCAAAGA ACTGTGCAAA CGCATGCTTG AATTGAGGTC TGTGACCAAG 28 01 GAAACGTTGC AGCTTACCAT TAACTTTTAC ACAAACGCTA TGGGTTTGGC 2 851 CGAATTTAAA ATCCCGCGCA TGGTCATGTT GCCACGTGAC AAGGAACTTA 2 901 AAACCATTCG AGAAAAAGAA AAAAATTTTA TGCTCAAAAA CGCAATAGAC 2951 ACAATTTTGG ATTTTATTAA TTCCAAAATA AAAATGTTAA ACGGCGATTA 3 001 CGTGCACGAC CGCGGCCTTA TTCGAGGCGC CATAGTGTTT TGCATAATGT 3 051 TAGGTACGGG CATGCGCATC AACGAGGCGC GCCAGCTCAG CGTGGAAGAT 3101 CTTAACGTGC TAATTAAAAA AGGCAAACTG CGCAGCAACA CTATCAATTT 3151 AAAACGCAAA CGCAGCCGCA ACAACACGCT CAACACGATC AAAACCAAAC 32 01 CGTTGGAGCT GGCTCGTGAA ATTTACGCGC GCAACCCCAC CGTGTTGCAA 3251 ATCTCTAAAA ACACTTCCAC GCCTTTTAAA GACTTTCGCC GTTTGCTGGA 33 01 CGAAGCGGGC GTAGAAATGG AACGGCCACG TAGCAACATG AT AAG AC AC T 33 51 ATTTGAGCAG CAATTTGTAC AACAGCGGCG TGCCGTTGCA AAAGGTGGCG

PAGE 130

117 34 01 CGCTTGATGA ACCACGAATC GCCGGCCAGT ACCAAACCGT ATTTGAACAA 3451 GTACAATTTT GACGAAAGCA GCAGCAGCAC GAGGAATCAG AGTTGAACAA 3 501 CCGCGACTCG TCTGCAG * TAAG is the transcription start site of baculovirus late genes * ATG is the protein translation start site * AATAA is the poly (A) tail signal site

PAGE 131

APPENDIX D PURIFICATION OF POLYHEDRA, ALKALINE -RELEASED VIRUSES AND DNA FROM Lymantria dispar MNPV COMMERCIAL FORMULATION (MODIFIED FROM THE LABORATORY PROTOCOL OF DR. MARUNIAK) Purification of Polyhedra from LdMNPV Commercial Formulation 1. Dissolve 2 g LdMNPV in 10 ml homogenization buffer (1% ascorbic acid, 2% SDS, 10 mM Tris-HCl and 1 mM EDTA, pH 8.0). 2. Filter the polyhedra solution through 4 layers of cheesecloth. 3. Centrifuge the solution at 10,000 rpm for 10 min at 4°C (BECKMAN J21-C centrifuge and JA2 0 rotor) . 4. Discard supernatant and resuspend pellet in 9 ml of distilled water with 1 ml 5 M NaCl . 5. Centrifuge the solution at 10,000 rpm for 15 min at 4°C. 6. Resuspend in 5 ml distilled water. 7. Make a 30 ml sucrose gradient from 63% to 40% in TE buffer (10 mM Tris and 1 mM EDTA, pH 8.0), using a gradient former (MBA, Clearwater, FL) and Masterflex pump (Cole-Parmer Instrument Co.). 8. Centrifuge the resuspended viral solution on top of sucrose gradient in an ultracent rif uge at 24,000 rpm for 3 0 min at 4°C (DuPont OTD 65B ultracentrif uge and AH627 swinging bucket rotor) . 9. Transfer the polyhedra band to a new tube, and mix with distilled water. 10. Centrifuge the solution at 10,000 rpm for 15 min at 4°C. 11. Resuspend the pellet in 0.5 ml distilled water. 118

PAGE 132

119 Purification of the Alkaline Released Virus from LdMNPV Polyhedra 1. Add one third volume of DAS (final concentration: 0.1 M Na 2 C0 3 , 0.01 M EDTA, 0.17 M NaCl , pH 10.9) to the polyhedra solution and mix. Keep the polyhedra solution on ice all the time. If the polyhedra is not dissolved, add a few drops (100 ul) of 0.5 M NaOH to the polyhedra solution, and vortex the solution. 2. Prepare a sucrose gradient from 40% to 56%. 3. Centrifuge at 24,000 rpm for 1 hr at 4°C. 4. Transfer the different bands (alkaline released virus with different numbers of nucleocapsids) to a new tube. 5. Add TE to fill the tube and mix well. Centrifuge at 24,000 rpm for 30 min. 6 . Discard supernatant . 7. Resuspend the virus (alkali-released virus) in 500 ul TE buffer . Viral DNA Purification 1. Add 40 (.il of 20% SDS to the alkaline released virus solution . 2. Incubate 10 min at room temperature. 3. Add 10-25 ul proteinase K (5 mg/ml) and incubate overnight at 3 7°C.

PAGE 133

120 4. Extract DNA with 0.75 ml distilled phenol (saturated with TE) . Invert tubes gently. Spin in microcentrifuge for about 1 min. Transfer upper aqueous phase to a clean microcentrifuge tube. Extract the aqueous phase twice more with phenol . 5. Extract the aqueous phase three times with 0.75 ml water saturated ether. 6. Heat the DNA solution at 56°C for 15 min in a heat block with caps open to evaporate ether. 7. Dialyze the DNA solution 4 times against 1 L TE (2 times daily for 2 days) . 8. Measure the DNA concentration by reading optical density (OD) at 260 nm. The DNA concentration (ug/ml) equals to OD 260 X 50.

PAGE 134

APPENDIX E PARTIAL NUCLEOTIDE AND TRANSLATED AMINO ACID SEQUENCES OF Lyman tria dispar MNPV GP41 GENE 1 TATGATAAGTAGTCCTCGGGTGGAGTTTTGCGAGCATCATGCAGTCCGAG M Q S E 5 1 CCCGCTGACCGCGACGCGGCGGCCGCCGTCTACAGCGCCGCCTGGATGAA DAAAAVYSAAWMNQCVD 101 AC CGGGT CAT CAAGT ACTAT CGC AC C AACGACATGT CC CACTTGACGCCC YVDPADRRVI KYYRTND 151 CAGATGCAATCCAGTGCGTGGACTACGTGGTGCTGATCAACACCATTCGC MSHLTPQMQLLINTIR 2 01 GACCTGTGCCTGGACACCAACCCGGTGGACGTGAACGTGGTGAAGCGCTT DLCLDTNPVDVNVVKRF 251 CGACAGCGACGAGAACCTGATCAAGCACTACGCGCGCCTCGCCAAGGACA DSDENL I KH YARLAKDM 3 01 TGGGCGGCTCGGCGGTGCCCGACAACGTGTTCCAGCCCTCTTTCGTCTAC GGSAVPDNVFQPSFVY 3 61 ACCGTCCTGCCGGCCTACGCGCAAAAGTTTTACAACAAGGGT TVLPAYAQKFYNKG * TAAG is the transcription start site of baculovirus late genes * ATG is the protein translation start site 121

PAGE 135

LIST OF REFERENCES Adams, J. R., Goodwin, R. H., & Wilcox, T. A. 1977. Electron microscopic investigations on invasion and replication of insect baculovirus in vivo and in vitro. Review of Biology and Cell. 28 . 261-268. Ahrens, C. H. & Rohrmann, G. F. 1996. The DNA polymerase and helicase genes of a baculovirus of Orgyia pseudotsugata . Journal of General Virology 77 . 825837 . Akiyoshi, D. E., Chakerian, R., Rohrmann, G. F . , Nesson, M. H. & Beaudreau, G. S. 1985. Cloning and sequencing of the granulin gene from the Trichoplusia ni granulosis virus. Virology 141 , 328-332. Altschul, S. F., Gish, W. , Miller, W. , Myers, E. W. & Lipman, D. J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215 . 403-410. Aotsuka, T., Chang, H.-Y., Aruga, M . , Lin, F.-J., & Kitagawa, 0. 1994. Mitochondrial DNA variation in natural populations of Drosophila immigrans . Zoological Studies 33 . 29-33. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G. , Smith, J. A., Struhl, K. , WangIverson, P. & Bonita, S. G. 1989. "Short Protocols in Molecular Biology". John Wiley & Sons, Inc. New York, pp, 139-162. Ayres, M. D., Howard, S. C, Kuzio, J., Lopez-Ferber , M. & Possee, R. D. 1994. The complete DNA sequence of Autographa calif ornica nuclear polyhedrosis virus. Virology 202 , 586-605. 122

PAGE 136

123 Barrett, J. W., Krell, P. J. & Arif, B. M. 1995. Characterization, sequencing and phylogeny of the ecdysteroid UDP-glucosyltransf erase gene from two distinct nuclear polyhedrosis viruses isolated from Choristoneura fumiferana. Journal of General Virology 76, 2447-2456. Benner, S. A. 1995. Predicting the conformation of proteins from sequences. Progress and future progress. Journal of Molecular Recognition 8 . 9-28. Betz, F. S. 1986. Registration of baculoviruses as pesticides. In "The Biology of Baculoviruses". Granados, R. R. & Federici, B. A., Eds. Boca Raton, Florida: CRC Press, Inc. VI, pp, 203-222. Bilimoria, S. L. 1986. Taxonomy and identification of baculoviruses. In "The Biology of Baculoviruses". Granados, R. R. & Federici, B. A., Eds. Boca Raton, Florida: CRC Press, Inc. VI, pp, 37-60 Bitton, G., Maruniak, J. E. & Zettler, F. W. 1987. Virus survival in nature ecosystems . In "Survival and Dormancy of Microorganisms". Henis, Y., ed. New York: John Wiley & Sons. Inc. pp, 301-332. Bjornson, R. M., Glocker, B. & Rohrmann, G. F. 1992. Characterization of the nucleotide sequence of the Lymantria dispar nuclear polyhedrosis virus DNA polymerase gene region. Journal of General Virology 73, 3177-3183. Blinov, V. M., Gutorov, V. V., Holodilov, N. G., Iljichev, A. A., Karginov, V. A., Mikrjukov, N. N. , Mordvinov, V. A., Nikonov, I. V., Petrov, N. A., Urmanov, I. H. & Vasilenko, S. K. 1984. Nucleotide sequence of the Galleria mellonella nuclear polyhedrosis virus origin of DNA replication. Federation of European Biochemical Societies Letters 167, 254-258. Blissard, G. W. & Rohrmann, G. F. 1989. Location, sequence, transcriptional mapping, and temporal expression of

PAGE 137

the gp64 envelope glycoprotein gene of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 170 , 537-555. Blissard, G. W. & Rohrmann, G. F. 1990. Baculovirus diversity and molecular biology. Annual Review of Entomology 35 , 127-155. Bonning, B. C. & Hammock, B. D. 1992. Developmental and potential of genetically engineered viral insecticides. Biotechnology and Genetic Engineering Reviews 10 , 455-489. Braunagel, S. C., Elton, D. M . , Ma, H. & Summers, M. D. 1996a. Identification and analysis of an Autographa calif omica nuclear polyhedrosis virus structural protein of the occlusion-derived virus envelope: ODVE56. Virology 217 . 97-110. Braunagel, S. C., He, H., Ramamurthy, P. & Summers, M. D. 1996b. Transcription, translation, and cellular localization of three Autographa calif omica nuclear polyhedrosis virus structural proteins: 0DV-E18, ODVE35, and ODV-EC27. Virology 222 , 100-114. Braunagel, S. C. & Summers, M. D. 1994. Autographa calif omica nuclear polyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids : structural proteins, antigens, lipid and fatty acid profiles. Virology 202 , 315-328 . Brown, S. E., Maruniak, J. E. & Knudson, D. L. 1985. Baculovirus (MNPV) genomic variants: characterization of Spodoptera exewpta MNPV DNAs and comparison with other Autographa calif omica MNPV DNAs. Journal of General Virology 66 . 2431-2441. Brown, S. E., Maruniak, J. E. & Knudson, D. L. 1987. Conserved homologous regions between two baculovirus DNAs. Journal of General Virology 68 , 207-212. Burand, J. P., Horton, H. M., Retnasami, S. & Elkington, J. S. 1992. The use of polymerase chain reaction and

PAGE 138

125 shortwave UV irradiation to detect baculovirus DNA on the surface of gypsy moth eggs. Journal of Virological Methods 36, 141-150. Burgess, S. 1977. Molecular weights of lepidopteran baculovirus DNAs : derivation by electron microscope. Journal of General Virology 37 . 501-510. Cameron, I. R. & Possee, R. D. 1989. Conservation of polyhedrin gene promoter function between Autographa calif omica and Mamestra brassicae nuclear polyhedrosis viruses. Virus Research 125 . 183-199. Carbonell, L. F., Hodge, M. R. , Tomalski, M. D. & Miller, L. K. 1988. Synthesis of a gene coding for an insectspecific scorpion neurotoxin and attempts to express it using baculovirus vectors. Gene 7 3. 409-418. Carson, D. D., Guarino, L .A., & Summers, M. D. 1988. Functional mapping of an AcNPV immediate early gene which augments expression of the IE-1 trans-activated 39 k gene. Virology 162 . 444-451. Chaeychomsri, S., Ikeda, M. & Kobayashi, M. 1995. Nucleotide sequence and transcriptional analysis of the DNA polymerase gene of Bombyx mori nuclear polyhedrosis virus. Virology 206 .436-447. Chakerian, R. , Rohrmann, G. F., Nesson, M. H. , Leisy, D. J. & Beaudreau, G. S. 1985. The nucleotide sequence of the Pieris brassicae granulosis virus granulin gene. Journal of General Virology 66 . 1263-1269. Chisholm, G. E. & Henner, D. J. 1988. Multiple early transcripts and splicing of the Autographa calif ornica nuclear polyhedrosis virus IE-1 gene. Journal of Virology 62 . 3193-3200. Clarke, E. E., Tristem, M. , Cory, J. & O'Reilly, D. R. 1996. Characterization of the Mamestra brassicae multicapsid nuclear polyhedrosis virus ecdysteroid UDP-glucosyltransf erase (egt) gene. Journal of General Virology . In press.

PAGE 139

126 Cory, J. S., Hirst, M. L . , Williams, T . , Hails, R. S., Goulson, D., Green, B. M . , Carty, T. M. , Possee, R. D., Cayley, P. J. & Bishop, D. H. L. 1994. Field trial of a genetically improved baculovirus insecticide. Nature 370 . 138-140. Cowan, P., Bulach, D., Goodge , K., Robertson, A. & Tribe, D. E. 1994. Nucleotide sequence of the polyhedrin gene region of Helicoverpa zea single nucleocapsid nuclear polyhedrosis virus: placement of the virus in lepidopteran nuclear polyhedrosis virus group II. Journal of General Virology 75 . 3211-3218. Doolittle, R. F. 1996. Computer methods for macromolecular sequence analysis. Methods in Enzymology 266 . Engelman, D. M. , Steitz, T. A. & Goldman, A. 1986. Identifying nonpolar transbilayer helices in amino acid sequences of membrane proteins . Annual Review of Biophysics and Biophysical Chemistry 15, 321-53 Faktor, O., Toister-Achituv, M. & Kamensky, B. 1995. Identification and nucleotide sequence of an ecdysteroid UDP-glucosyl transferase gene of Spodoptera littoralis multicapsid nuclear polyhedrosis virus. Virus Genes 11 . 47-52. Federici, B. A. 1986. Ultrastructure of baculoviruses . In "The Biology of Baculoviruses". Granados, R. R. & Federici, B. A., Eds. Boca Raton, Florida: CRC Press, Inc. VI, pp, 61-88. Fenner, F. & Kerr, P. J. 1994. Evolution of the poxviruses', including the coevolution of virus and host in myxomatosis. In "The Evolutionary Biology of Viruses". Morse, S. S. Ed. Raven Press, New York, pp, 273-292 . Fitch, W. M. 1971. Towards defining the course of evolution: minimum change for a specific tree topology. Systematic Biology 42 , 193-200. Flipsen, J. T., Mans, R. M . , Kleefsman, A. W. , Knebel-

PAGE 140

127 Morsdorf, D. & Vlak, J. M. 1995. Deletion of the baculovirus ecdysteroid UDP-glucosyltransf erase gene induces early degeneration of Malpighian tubules in infected insects. Journal of Virology 69 . 4529-4532. Forterre, P. 1997. Protein versus rRNA : problems in rooting the universal tree of life. The News Magazine of the American Society for Microbiology 63 . 89-95. Fossiez, F. ; Belloncik, S. & Arella, M. 1989. Nucleotide sequence of the polyhedrin gene of Euxoa scandens cytoplasmic polyhedrosis virus (EsCPV) . Virology 169 . 462-465 . Friesen, P. D. & Miller, L. K. 1986. The regulation of baculovirus gene expression. Current Topics of Microbiology and Immunology 131 , 31-49. Fuch, Y. L., Woods, M. S., & Weaver, R. F. 1983. Viral transcription during Autographa calif ornica nuclear polyhedrosis virus infection: A novel RNA polymerase induced in infected Spodoptera frugiperda cells. Journal of V i rology 4 8 , 6 4 .1 6 4 6 . Funderburk, J., Maruniak, J., Boucias, D. & Garcia-Canedo, A. 1992. Efficacy of baculoviruses and their impact on pest management programs. In "Pest Management in Soybean". Copping, L. G., Green, M. B. & Rees, R. T., Eds. Elsevier, England, pp. 88-97. Fuxa, J. R. 1989. Fate of released entomopathogens with reference to risk assessment of genetically engineered microorganisms. Bulletin of the ESA 35 , 12-23. Galinski, M. S., Yu, Y. , Heminway, B. R. & Beaiidreau, G. S. 1994. Analysis of the C-polyhedrin genes from different geographical isolates of a type 5 cytoplasmic polyhedrosis virus. Journal of General Virology 75 , 1969-1974 . Garcia-Maruniak, A., Pavan, 0. H. 0. & Maruniak, J. E. 1996. A variable region of Anticarsia gemmatalis nuclear polyhedrosis virus contains tandemly repeated DNA

PAGE 141

128 sequences. Virus Research 41 . 123-132. Gonzalez, M. A., Smith, G. E. & Summers, M. D. 1989. Insertion of the SfMNPV polyhedrin gene into an AcMNPV polyhedrin deletion mutant during viral infection. Virology 170 . 160-175. Granados, R. R. & Federici, B. A. 1986. "The Biology of Baculoviruses" . CRC Press, Inc. Boca Raton, FL . VI, pp, 1-275. Granados, R. R. & Lawler, K. A. 1981. In vivo pathway of Autographa calif ornica baculovirus invasion and infection. Virology 108 . 297-308. Granados, R. R. & Williams, K. A. 1986. In vivo infection and replication of baculoviruses. In "The Biology of Baculoviruses". Granados, R. R. & Federici, B. A., Eds. Boca Raton, Florida: CRC Press, Inc. VI, 89-108. Groner, A. 1986. Specificity and safety of baculoviruses. In "The Biology of Baculoviruses". Granados, R. R. & Federici, B. A., Eds. Boca Raton, Florida: CRC Press, Inc. VI, 177-202. Gross, C. H., Wolgamot, G. M., Russell, R. L., Pearson, M. N. & Rohrmann, G. F. 1993. A 37-kilodalton glycoprotein from a baculovirus of Orgyia pseudotsugata is localized to cytoplasmic inclusion bodies. Journal of Virology 67 . 469-475. Grula, M. A., Buller, P. L., & Weaver, R. F. 1981. Alpha amanitin-resistant viral RNA synthesis in nuclei isolated from nuclear polyhedrosis virus-infected Heliothis zea larvae and Spodoptera frugiperda cells. Journal of Virology 38 . 916-921. Guarino, L. A. & Summers, M. D. 1986. Interspersed homologous DNA of Autographa calif ornica nuclear polyhedrosis virus enhances delayed-early gene expression. Journal of Virology 60 . 215-223. Guarino, L. A. & Summers, M. D. 1988. Functional mapping of

PAGE 142

129 Autographa calif ornica nuclear polyhedrosis virus genes for late gene expression. Journal of Virology 62 , 463471 . Hansen, J. E. , Lund, 0., Engelbrecht, J., Bohr, H., Nielsen, J. 0., Hansen, J.-E. S. & Brunak, S. 1995. Prediction of 0-glycosylation of mammalian proteins: specificity patterns of UDP-GalNAc: polypeptide Nacetylgalactosaminyltransf erase . Biochemistry Journal 308 . 801-813. Hawtin, R. E., King, L. A. & Possee, R. D. 1992. Prospects for the development of a genetically engineered baculovirus insecticide. Pesticide Science 34 , 9-15. Heringa, J. & Argos, P. 1994. Evolution of viruses as recorded by their polymerase. In "The Evolutionary Biology of Viruses". Morse, S. S. Ed. Raven Press, New York, pp, 87-103. Higgins, D. G., Thompson, J. D., & Gibson, T. J. 1996. Using CLUSTAL for multiple sequence alignments. In "Computer Methods for Macromolecular Sequence Analysis" . Dolittle, R. F. Ed. Methods in Enzymology 266, 383-402. Hill, J. E. & Faulkner, P. 1994. Identification of the gp67 gene of a baculovirus pathogenic to the spruce budworm, Choristoneura fumiferana multinucleocapsid nuclear polyhedrosis virus. Journal of General Virology 75 . 1811-1813 . Hodges, R. W., Dominick, D. R., Davis, D. R. , Ferguson, D. C., Franclemont, J. G., Munroe, E. G., & Powell, J. A. 1983 . "Check List of The Lepidoptera of America North of Mexico". E. W. Classey Limited and The Wedge Entomological Research Foundation, London, pp, 1-284. Hong, T., Braunagel, S. C. & Summers, M. D. 1994. Transcription, translation, and cellular localization of PDV-E66: a structural protein of the PDV envelope of Autographa calif ornica nuclear polyhedrosis virus. Virology 204 . 210-222.

PAGE 143

130 Hooft van Iddekinge, B. J. L. , Smith, G. E. & Summers, M. D. 1983. Nucleotide sequence of the polyhedrin gene of Autographs, calif ornica nuclear polyhedrosis virus. Virology 131 . 561-565. Hu, J., Ding, H. & Wu, X. 1993. Cloning and sequencing of Attacus ricini nuclear polyhedrosis virus polyhedrin gene. I Chuan Hsueh Pao 20 , 300-304. Hu, Z. H., Liu, M. F., Jin, F., Wang, Z. X., Liu, X. Y . , Li, M. J., Liang, B. F. & Xie, T. E. 1993. Nucleotide sequence of the Buzurasuppressaria single nucleocapsid nuclear polyhedrosis virus polyhedrin gene. Journal of General Virology 74 , 1617-1620. Huber, J. 1986. Use of baculoviruses in pest management programs. In "The Biology of Baculoviruses". Granados, R. R. & Federici, B. A,, Eds. Boca Raton, Florida: CRC Press, Inc. V2, 181-202. Jehle, J. A. & Backhaus, H. 1994. The granulin gene region of Cryptophlebia leucotrea granulosis virus: sequence analysis and phylogenetic considerations. Journal of General Virology 75, 3667-3671. Johnson, D. W. & Maruniak, J. E. 198 9. Physical map of Anticarsia gewmatalis nuclear polyhedrosis virus (AgMNPV-2) DNA. Journal of General Virology 70 . 18771883 . Jones, D. T., Taylor, W. R. & Thornton, J. M. 1994. A model recognition approach to the prediction of all-helical membrane protein structure and topology. Biochemistry 33., 3 038-3 049 . Kaupp, W. J. & Burke, R. F. 1984. A staining technique for gene of Bombyx mori nuclear polyhedrosis virus. Journal of Virology 54 . 436-445. Keating, S. T., Burand, J. P., & Elkington, J. S. 1989. DNA hybridization assay for detection of gypsy month nuclear polyhedrosis virus in infected gypsy moth (Lymantria dispar L.) Larvae. Applied and

PAGE 144

131 Environmental Microbiology 55 , 2749-2754. Keddie, A. B . , Aponte, G. W. , & Volkman, L. E. 1989. The pathway of infection of Autographs calif ornica nuclear polyhedrosis virus in an insect host . Science 243 , 1728-1730 . Keddie, A. B. & Volkman, L. E. 1985. Infectivity difference between the two phenotypes of Autographa calif ornica nuclear polyhedrosis virus: importance of the 64k envelope glycoprotein. Journal of General Virology 66 . 1195-1200 . Kelly, D. C. 1977. The DNA contained by nuclear polyhedrosis viruses isolated from four Spodoptera sp . (Lepidoptera , Noctuidae) : genome size and homology assessed by DNA reassociation kinetics. Viroiogy 76 . 468-471. King, L. A. & Possee, R. D. 1992. "The Baculovirus Expression System". Chapman & Hall, London, pp, 1-229. Kool, M . , Broer, R., Zuidema, D., Goldbach, R. W. & Vlak, J. M. 1994. Nucleotide sequence and genetic organization of a 7.3 kb region (map unit 47 to 52.5) of Autographa calif ornica nuclear polyhedrosis virus fragment EcoRI C. Journal of General Virology 75 . 4 87-4 94. Kovacs, G. R., Guarino, L. A., Graham, B. L. & Summers, M. D. 1991. Identification of spliced baculovirus RNAs expressed late in infection. Virology 185 . 633-643. Kozak, M. 1986. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes . Cell 44 . 283-292. Kumar, S., Tamura, K. & Nei, M. 1993. MEGA: Molecular Evolutionary Genetics Analysis, Version 1.01. The Pennsylvania State University. University Park, PA 16802 . Kuzio, J., Jaques, R. & Faulkner, P. 1989. Identification of p74, a gene essential for virulence of baculovirus occlusion bodies. Virology 173 . 759-763.

PAGE 145

132 Kuzio, J., Rohel, D. Z., Curry, C. J., Carstens, E. B. & Faulkner, P. 1984. Nucleotide sequence of the plO polypeptide gene of Autographa calif omica nuclear polyhedrosis virus. Virology 139 , 414-418. Kyte, J. & Doolittle, R. F. 1982. A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology 157 , 105-132. Leisy, D., Nesson, M. , Pearson, M., Rohrmann, G. & Beaudreau, G. S. 1986a. Location and nucleotide sequence of the Orgyia pseudotsugata single nucleocapsid nuclear polyhedrosis virus polyhedrin gene. Journal of General Virology 67 , 1073-1079. Leisy, D., Rohrmann, G. & Beaudreau, G. 1984. Conservation of genome organization in two multicapsid nuclear polyhedrosis viruses. Journal of Virology 52 . 699-702. Leisy, D., Rohrmann, G. & Beaudreau, G. 1986b. The nucleotide sequence of the polyhedrin gene region from the multicapsid baculovirus of Orgyia pseudotsugata. Virology 153 . 280-288. Leisy, D. J., Rohrmann, G. F., Nesson, M. & Beaudreau, G. S. 1986c. Nucleotide sequencing and transcriptional mapping of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus plO gene. Virology 153 . 157-167. Li, W.-H. & Graur, D. 1991. "Molecular Evolution". Sinauer Associates, Inc. Sunderland, MA. pp, 99-135. Liu, J.-C. & Maruniak, J. E. 19 95. Nucleotide sequence and transcriptional analysis of the gp41 gene of Spodoptera frugiperda nuclear polyhedrosis. Journal of General Virology 76 . 1443-1450. Liu, J. J. & Carstens, E. B. 1995. Identification, localization, transcription, and sequence analysis of the Choristoneura fumiferana nuclear polyhedrosis virus DNA polymerase gene. Virology 209 . 538-549. Loh, L. C, Hamm, J. J. & Huang, E.-S. 1981. Spodoptera

PAGE 146

133 frugiperda nuclear polyhedrosis virus genome: physical maps for restriction endonucleases BamHI and Hindlll. Journal of Virology 38 , 922-931. Luckow, V. A. & Summers, M. D. 1988a. Trends in the development of baculovirus expression vectors. Bio/Technology 6 , 47-55. Luckow, V. A. & Summers, M. D. 1988b. Signals important for high-level expression of foreign genes in Autographa calif ornica nuclear polyhedrosis virus expression vectors. Virology 167 , 56-71. Ma, S.-W., Corsaro, B. G., Klebba, P. E. & Fraser, M. J. 1993. Cloning and sequence analysis of a p40 structural protein gene of Helicoverpa zea nuclear polyhedrosis virus. Virology 192 , 224-233. Madden, T. L . , Tatusov. & Zhang, J. 1996. Applications of network BLAST server. In "Computer Methods for Macromolecular Sequence Analysis". Doolittle, R. F. Ed. Methods in Enzymology 266, 131-141. Madej , T. ( Boguski, M. S. & Bryant, S. H. 1995. Threading analysis suggests that the obese gene product may be a helical cytokine. Federation of European Biochemical Societies Letters 373 . 13-18. Maeda, S. 1989. Expression of foreign genes in insects using baculovirus vectors. Annual Review of Entomology 34 . 351-372 . Maeda, S., Kawai, T., Obinata, M. , Fujiwara, H., Horiuchi, T., Saeki, Y. , Sato, Y. & Furusawa, M. 1985. Production of human alphainterferon in silkworm using a baculovirus vector. Nature 315 . 592-594. Maeda, S., Volrath, S. L., Hanzlik, T. N. , Harper, S. A., Majima, K. , Maddox, D. W. , Hammock, B. D. & Fowler, E. 1991. Insecticidal effects of an insect-specific neurotoxin expressed by a recombinant baculovirus . Virology 184 . 777-780.

PAGE 147

134 Majima, K., Kobara, R. & Maeda, S. 1993. Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus. Journal of Virology 67 , 7513-7521. Maniatis, T., Fritsch, E. F. & Sambrook, J. 1989. "Molecular Cloning: A Laboratory Manual", 2nd Ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory. V3 , pp, B9-B14. Maruniak, J. E. 1979. Biochemical characterization of baculovirus structural and infected TN-368 cell polypeptides, glycoproteins, and phosphoproteins . Ph.D. dissertation,' University of Texas, Austin. Maruniak, J. E. 1986. Baculovirus structural proteins and protein synthesis. In "The Biology of Baculoviruses" . Granados, R. R. & Federici, B. A., Eds. Boca Raton, Florida: CRC Press, Inc. VI, pp, 129-146. Maruniak, J. E., Brown, S. E. & Kundson, D. L. 1984. Physical maps of SfMNPV baculovirus DNA and its genomic variants. Virology 136 . 221-234. Maruniak, J. E., & Summers, M. D. 1981. Autographa calif omica nuclear polyhedrosis virus phosphoproteins and synthesis of intracellular proteins after virus infection. Virology 109 . 25-34. McLachlin, J. R. & Miller, L. K. 1994. Identification and characterization of vlf-1, a baculovirus gene involved in very late gene expression. Journal of Virology 68 . 7746-7756 . Miller, L. K. 1988. Baculoviruses as gene expression vectors. Annual Review of Microbiology 42 . 177-199. Miller, L. K. 1996. Insect viruses. In "Fundamental Virology". Fields, B. N . , Knipe, D. M., & Howley, P. M. Eds. Lippincott -Raven, Publisher. Philadelphia, pp, 401-424 . Minion, F. C, Coons, L. B. & Broome, J. R. 1979. Characterization of the polyhedral envelope of the

PAGE 148

nuclear polyhedrosis virus of Heliothis virescens . Journal of Invertebrate Pathology 34 , 303-307. Miyamoto, M. M. 1985. Consensus caldograms and general classifications. Cladistics 1 . 186-189. Monsma, S. A. & Blissard, G. W. 1995. Identification of a membrane fusion domain and an oligomerizat ion domain in the baculovirus gp64 envelope fusion protein. Journal of Virology 69 . 2583-2.595. Monsma, S. A., Oomens, A. G. P. & Blissard, G. W. 1996. The gp64 envelope fusion protein is an essential baculovirus protein required for cell-to-cell transmission of infection. Journal of Virology 70 , 4607-4616 . Moraes, R. R. & Maruniak, J. E. 1997. Detection and identification of multiple baculoviruses using the polymerase chain reaction (PCR) and restriction endonuclease analysis. Journal of Virological Methods 63 . 209-217. Morse, M. A., Marriott, A. C. & Nuttall, P. A. 1992. The glycoprotein of togoto virus (a tick-borne orthomyxolike virus) is related to the baculovirus glycoprotein gp64 . Virology 186 , 640-646. Moscardi, F. 1989. Use of viruses for pest control in Brazil: the case of the nuclear polyhedrosis virus of the soybean caterpillar, Anticarsia gemmatalis . Memorias do Instituto Oswaldo Cruz 84 . 51-56. Moscardi, F. & Sosa-Gomez, D. R. 1993. A case study in biological control: soybean defoliating caterpillars in Brazil. In "International Crop Sciences I". Buxton, D. R., Shibles, R., Forsberg, R. A., Blad, B. L . , Asay, K. H., Paulsen, G. M., & Wilson, R. F. Eds. Crop Science Society of American, Inc. Madison, WI . pp, 115-119. Murphy, F. A., Fauquet, C. M . , Bishop, D. H. L., Ghabrial, S. A., Jarvis, A. W. , Martelli, G. P., Mayo, M. A. & Summers, M. D. 1995. "Virus Taxomony" . Springer-Verlag

PAGE 149

136 Wien, New York, pp., 104-113. Mustafa, A. & Yuen, L. 1991. Identification and sequencing of the Choristoneura biennis entomopoxvirus DNA polymerase gene. DNA Sequence 2 , 39-45. Nagamine, T . , Sugimori, H., Nakamura, K. , Saga, S. & Kobayashi, M. 1991. Nucleotide sequence of the gene coding for p40, an occluded virion-specif ic polypeptide of Bombyx mori nuclear poiyhedrosis virus. Journal of Invertebrate Pathology 58 , 290-293. Naser, W. L. & Mil tenburger , H. G. 1983. Rapid baculovirus detection, identification, and serological classification by western blotting-ELISA using a monoclonal antibody. Journal of General Virology 64 , 639-647 . Oakey, R. , Cameron, I. R., Davis, B., Davis, E. & Possee, R. D. 1989. Analysis of transcription initiation in the Panolis flawmea nuclear poiyhedrosis virus polyhedrin gene. Journal of G eneral Virology 70 , 769-775. Ooi, B. G. & Miller, L. K. 1991. The influence of antisense RNA on transcriptional mapping of the 5' terminus of a baculovirus RNA. Journal of General Virology 7 2. 527534 . O'Reilly, D. R. & Miller, L. K. 1989. A baculovirus blocks insect molting by producing ecdysteroid UDP-glucoysl transferase. Science 245 . 1110-1112. O'Reilly, D. R. & Miller, L. K. 1990. Regulation of expression of a baculovirus ecdysteroid UDPglucotransf erase gene. Journal of virology 245 . 11101112 . O'Reilly, D. R. & Miller, L. K. 1991. Improvement of a baculovirus pesticide by deletion of the egrt gene. Bio/Technology 9 . 1086-1089. O'Reilly, D. R., Miller, L . K & Luckow, V. A. 1992. "Baculovirus Expression Vectors". W. H. Freeman and

PAGE 150

Company, New York, pp, 1-347. Pellock, B. J., Lu, A., Meagher, R. B., Weise, M. J. & Miller, L. K. 1996. Sequence, function, and phylogenetic analysis of an ascovirus DNA polymerase gene. Virology 216 , 146-157. Pritchett, D. W., Young, S. Y., & Yearin, W. C. 1982. Dissolution of Autographa calif ornica nuclear polyhedrosis virus polyhedra by the digestive fluid of Trichoplusia ni (Lepidoptera : Noctuidae) larvae. Journal of Invertebrate Pathology 3 9 , 3 5 4-361. Rankin, C, Ooi, B. G. & Miller, L. K. 1988. Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin gene expression. Gene 70 . 39-49. Richardson, C. D. 1995. "Baculovirus Expression Protocols". Humana Press Inc., New Jersey, pp, 1-418. Riegel, C. I., Lahner-Herrera, C. & Slavicek, J. M. 1994. Identification and characterization of the ecdysteroid UDP-glucosyltransf erase gene of the Lymantria dispar multinucleocapsid nuclear polyhedrosis virus. Journal of General Virology 75 . 829-838. Rohrmann, G. F. 1986. Polyhedrin structure. Journal of General Virology 67 . 1499-1513. Rohrmann, G. F. 1992. Baculovirus structural proteins. Journal of General Virology 73 f 749-761. Rost, B. & Sander, C. 1993. Prediction of protein secondary structure at better than 70% accuracy. Journal of Molecular Biology 232 . 584-599. Russell, R. L. Q . & Rohrmann, G. F. 1990. A baculovirus polyhedron envelope protein: immunogold localization in infected cells and mature polyhedra. Virology 174 , 177184 . Saitou, N. Sc Nei, M. 1987. The neighborj oining method: a

PAGE 151

138 new method for constructing phylogenetic trees. Molecular Biology and Evolution 4 , 406-425. Sanger, F., Nicklen, S. & Coulson, A. R. 1977. DNA sequencing with chainterminating inhibitors. Proceedings of National Academy Sciences USA 74 . 54635467 . Schomburg, D. & Lessel, U. 1995. Bioinf ormatics : from nucleotide acids and proteins to cell mechanism. GBF Monographs 18 , pp , 1-195. Schuler, G. D., Epstein, J. A., Ohkawa, H & Kans, J. A. 1996. Entrez : molecular biology database and retrieval system. In "Computer Methods for Macromolecular Sequence Analysis". Doolittle, R. F. Ed. Methods in Enzymology 266, 141-162. Schulze-Kremer , S. 1996. "Molecular Bioinf ormatics" . Walter de Gruyter, Berlin, Germany, pp, 1-296. Shuler, M. L . , Wood, H. A., Granados, R. R. & Hammer, D. A. 1995. "Baculovirus Expression System an Biopesticides" . Wiley-Liss Inc., New York, pp, 1-259. Smith, G. E. & Summers, M. D. 1978. Analysis of baculovirus genomes with restriction endonucleases . Virology 89 , 517-527 . Smith, G. E. & Summers, M. D. 1982. DNA homology among subgroup A, B, and C baculoviruses . Virology 123 . 3 93406 . Smith, G. E., Summers, M. D. & Fraser, M. J. 1983. Production of human Pinterferon in insect cells infected with a baculovirus expression vector. Molecular and Cellular Biology 3 , 2156-2165. Smith, I. R. L., van Beek, N. A. M . , Podgwaite, J. D. & Wood, H. A. 1988. Physical map and polyhedrin gene sequence of Lymantria dispar nuclear polyhedrosis virus Gene 71 . 97-105.

PAGE 152

139 Stiles, B. & Wood, H. A. 1983. A study of the glycoproteins of Autographacalif omica nuclear polyhedrosis virus (AcNPV) . Virology 131 . 230-241. Stoltz, D. B., Pavan, C. & Da Chunha, A. B. 1973. Nuclear polyhedrosis virus: a possible example of de novo intranuclear membrane morphogenesis. Journal of General Virology 19 . 145-150. Summers, M. D. & Smith, G. E. 1978. Baculovirus structural polypeptides. Virology 84 . 390-402. Summers, M . D. & Smith, G. E. 1987. A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures. Texas Agricultural Experiment Station, pp, 1-57. Summers, M. D. & Volkman, L. E. 1976. Comparison of biophysical and morphological properties of occluded and extracellular nonoccluded baculovirus from in vivo and in vitro host systems. Journal of Virology 17 . 962972 . Swafford, D. L. 1990. "PAUP: Phylogenetic Analysis Using Parsimony". Version 3.0. Illinois Natural History Survey, Champaign, IL. Tanada, Y. & Hess, R. T. 1976. Development of a nuclear polyhedrosis virus in midgut cells and penetration of the virus into the hemocoel of the armyworm, Pseudaletia unipuncta . Journal of Invertebrate Pathology 28 . 67-76. Tanada, Y., Hess, R. T., & Omi, E. M. 1975. Invasion of a nuclear polyhedrosis virus in midgut of the armyworm, Psedoaletia unipuncta , and the enhancement of synergistic enzyme. Journal of Invertebrate Pathology 18, 307-312. Tanada, Y. & Kaya, H. K. 1993. "Insect Pathology". Academic Press, Inc., San Diego, CA. pp, 171-244. Theilmann, D. A., Chantler, J. K. , Stewart, S., Flipsen, H.

PAGE 153

140 T. M . , Vlak, J. M. & Crook, N. E. 1996. Characterization of a highly conserved baculovirus structural protein that is specific for occlusionderived virions. Virology 218 , 148-158. Theilmann, D. A. & Stewart, S. 1991. Identification and characterization of the IE-1 gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 180 . 492-508. Thiem, S. M. & Miller, L. K. 1989. Identification, sequence, and transcriptional mapping of the major capsid protein gene of the baculovirus Autographa calif ornica nuclear polyhedrosis virus. Journal of Virology 63 . 2008-2018. Tomalski, M. D., Wu, J. & Miller, L. K. 1988. The location, sequence, transcription, and regulation of a baculovirus DNA polymerase. Virology 167 . 591-600. Traverner, M. P. & Connor, E. F. 1992. Optical enumeration technique for detection of baculovirus in the . • environment. Environmental Entomology 21 . 307-313. van Oers, M. M., Flipsen, J. T. M., Reusken, C. B. E. M. , Sliwinsky, E. L . , Goldbach, R. W. & Vlak, J. M. 1993. Functional domains of the plO protein of Autographa calif ornica nuclear polyhedrosis virus. Journal of General Virology 74 . 563-574. van Oers, M. M., Flipsen, J. T. M., Reusken, C. B. E. M. & Vlak, J. M. 1994. Specificity of baculovirus plO functions. Virology 200 , 513-523. van Strien, E. A., Jansen, B. J. H., Mans, R. M. W. , Zuidema, D. & Vlak, J. M. 1996. Sequence and transcriptional analysis of the ubiquitin gene cluster in the genome of Spodoptera exigua nucleopolyhedrovirus . Journal of General Virology 77 r 2311-2319 . van Strien, E. A., Zuidema, D., Goldbach, R. W. & Vlak, J. M. 1992. Nucleotide sequence and transcriptional analysis of the polyhedrin gene of Spodoptera exigua

PAGE 154

141 nuclear polyhedrosis virus. Journal of General Virology 73 . 2813-2821. Volkman. L . E. 1986. The 64k envelope protein of budded Autographa calif ornica nuclear polyhedrosis virus. Current Topics of Microbiology and Immunology 131 . 103-118 . Volkman, L. E. & Goldsmith, P. A. 1984. Budded Autographa calif ornica NPV 64k protein: further biochemical analysis and effects of post immunoprecipitat ion sample preparation conditions. Virology 143 . 185-195. Volkman, L . E. & Goldsmith, P. A. 1985. Mechanism of neutralization of budded Autographa calif ornica nuclear polyhedrosis virus by a monoclonal antibody: inhibition of entry by adsorptive endocytosis. Virology 143 . 185195 . Volkman, L . E. & Keddie, B. A. 1990. Nuclear polyhedrosis virus pathogenesis. Seminars in Virology 1 , 249-256. Ward, V. K. , Fleming, S. B. & Kalmakoff, J. 1987. Comparison of a DNA-DNA dot -blot hybridization assay with light microscope and radioimmunoassay for the detection of a nuclear polyhedrosis virus. Journal of Virological Methods 15 . 65-73. Webb, S. E. & Shelton, A. M. 1990. Effect of age structure on the outcome of viral epizootics in field populations of imported cabbageworm (Lepidoptera : Pieridae) . Environmental Entomology 19 . 111-116. Wheeler, W. C. 1991. Congruence among data sets: a bayesian approach. In " Phylogenetic Analysis of DMA Sequences". Eds, Miyamoto, M. M. & Cracraft, J. Oxford University Press, New York, pp, 334-34 6. Whitford, M. & Faulkner, P. 1992a. A structural polypeptide of the baculovirus Autographa calif ornica nuclear polyhedrosis virus contains Olinked Nacetylglucosamine . Journal of Virology 66 . 3324-3329.

PAGE 155

142 Whitford, M. & Faulkner, P. 1992b. Nucleotide sequence and transcriptional analysis of a gene encoding gp41, a structural glycoprotein of the baculovirus Autographa calif omica nuclear polyhedrosis virus. Journal of Virology 66 . 4763-4768. Whitford, M. , Stewart, S., Kuzio, J. & Faulkner, P. 1989. Identification and sequence analysis of a gene encoding gp6 7, an abundant envelope glycoprotein of the baculovirus Autographa calif omica nuclear polyhedrosis virus. Journal of Virology 63 , 1393-1399. Whitt, M. A. & Manning, J. S. 1988. A phosphorylated 34-kDa protein and a subpopulation of polyhedrin are thiol • . linked to the carbohydrate layer surrounding a baculovirus occlusion body. Virology 163 . 33-42. Williams, G. V., Rohel, D. Z., Kuzio, J., & Faulkner, P. 1989. A cytopathological investigation of Autographa calif omica nuclear polyhedrosis virus plO gene function using insertion/deletion mutants. Journal of General Virology 70 , 187-202. Wilson, J. A., Hill, J. E . , Kuzio, J. & Faulkner, P. 1995. Characterization of the baculovirus Choristoneura fumiferana multicapsid nuclear polyhedrosis virus plO gene indicates that the polypeptide contains a coiled-coil domain. Journal of General Virology 76 , 2923-2932 . Wood, H. A. & Granados, R. R. 1991. Genetically engineered baculoviruses as agents for pest control . Annual Review of Microbiology 45 , 6 9-87. Zanotto, P. M. de A. , Gao, G. P., Grit sun, T., Marin, M. S., Jiang, W. R., Venugopal, K. , Reid, H. W. & Gould, E. A. 1995. An arbovirus cline across the northern hemisphere. Virology 210 . 152-159. Zanotto, P. M. de A., Kessing, B. D. & Maruniak, J. E. 1993. Phylogenetic interrelationships among baculoviruses: evolutionary rates and host associations. Journal of Invertebrate Pathology 62 . 147-164.

PAGE 156

143 Zanotto, P. M. de A., Sampaio, M. J. A., Johnson, D. W., Rocha, T. L. & Maruniak, J. E. 1992. The Anticarsia genmatalis nuclear polyhedrosis virus polyhedrin gene region: sequence analysis, gene product and structural comparisons. Journal of General Virology 73 , 1049-1056. Zuidema, D., van Oers, M. M . , van Strien, E. A., Caballero, P. C, Klok, E.-J., Goldbach, R. W. & Vlak, J. M. 1993. Nucleotide sequence and transcriptional analysis of the plO gene of Spodoptera exigua nuclear polyhedrosis virus. Journal of General Virology 74 , 1017-1024.

PAGE 157

BIOGRAPHICAL SKETCH Jaw-Ching Liu was born in Taiwan, on May 8, 1966. He entered National Chung-Hsing University (NCHU) in September 1984 and completed his Bachelor of Science degree in the Entomology Department in June 1988. He started his Master of Science program in the same department in September 1988, and took a leave in December 1989. From December 1989 to May 1991, he worked at the Institute of Biomedicine, Academic Sinica, as a research assistant. Then, he went back to NCHU in June 1991, and finished his Master of Science degree in December 1992. He started his Ph.D. program with Dr. James Maruniak in January 1993 in the Department of Entomology and Nematology at the University of Florida. Presently, he is finishing his Ph.D. 144

PAGE 158

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. rapes E. Maruniak, Chairman Associate Professor of Entomology and Nematology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Professor of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in-jscope and quality, as a dissertation for the degree of DocJ^o/ of Philosophy Pauline 0. Lawrence Professor of Entomology and Nematology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. _ ybetn f/i )oJ^ — Susan E. Webb Associate Professor of Entomology and Nematology

PAGE 159

This dissertation was submitted to the Graduate Faculty of the College of Agriculture and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. May, 1997 Dean, College of Agriculture Dean, Graduate School


87
with the AcMNPV gp41 coding sequence, and it showed 56%
nucleotide sequence identity and 76% amino acid sequence
similarity. The partial LdMNPV gp41 nucleotide sequence and
translated amino acid sequence were used to reconstruct the
phylogenetic tree.
Phylogenetic Tree of Baculovirus polh Genes
Twenty-six amino acid sequences from different
baculoviruses were obtained from translated nucleotide
sequences of published data (Table 4.1), and used to
reconstruct the phylogenetic tree. In Figure 4.1, the
phylogenetic tree was divided into three main branches: the
lepidopteran NPVs, the lepidopteran GVs and the hymenopteran
NPV (NsSNPV). Within the lepidopteran NPV branch, the tree
was divided into two main groups and one outgroup branch.
Group I included AcMNPV, BmMNPV, AfMNPV, ArMNPV, AgMNPV,
HcMNPV, ArcMNPV, OpMNPV, PnMNPV, and CfMNPV. Group II
included OpSNPV, BsSNPV, PfMNPV, LsMNPV, MbMNPV, SlMNPV,
SeMNPV, SfMNPV, MnMNPV, HzSNPV and SpliMNPV. The only
member of the outgroup branch was LdMNPV (for complete name
of baculoviruses, see Table 4.1). The tree reliability test


34
b a
P A RTJOY C NZGULS D IVQXE WK H M B F
h11^| 11 'I11 |1 'V '|1 'i'i1i EcoRI
0 10 20 30 40 50 60 70 80 90 100 mu
43.5 mu 45 mu
*
>
*
gp41 ORF


Figure 2.1. Position of the gp41 gene on the SfMNPV genomic
map and sequencing strategy. (A) EcoRI restriction map of
the SfMNPV-2 genome (Maruniak et al., 1984). (B) Detailed
physical map of EcoRI-S fragment. The gp41 999 bp open
reading frame is indicated by the bold arrow under the map.
The small arrows below the map indicate the extension and
direction of the sequence using T7 or SP6 primers or
specific primers indicated by an asterisk.


27
antibodies indicated that gp41 is present only in OV; it
appears to be associated with OV but not with purified
nucleocapsids or the ECV (Whitford & Faulkner, 1992a; Ma et
al. 1993). The location of the gp41 protein has been
predicted to be between the envelope membrane and the capsid
(tegument) of the OV. On the other hand, Braunagel &
Summers (1994) indicated that the viral proteins of 40-41
kDa are glycosylated in the OV and ECV. However, the
monoclonal antibody data suggest that the gp41 proteins of
ECV and OV are different proteins. The gene encoding the
gp41 protein has been characterized (Nagamine et al., 1991;
Whitford & Faulkner, 1992b; Ma et al., 1993; Ayres et al.,
1994; Kool et al., 1994), but the biological function of the
gp41 protein is still unknown.
In this chapter, the complete nucleotide and translated
amino acid sequence of the SfMNPV-2 gp41 gene is presented.
The sequences were compared with other known gp41 gene
sequences of different baculoviruses to reveal the possible
functional domain of the gp41 protein. A possible
transcriptional regulation mechanism and the phylogenetic
relationships of the gp41 gene among the different
baculoviruses are discussed in this paper.


APPENDIX A
NUCLEOTIDE SEQUENCE OF Spodoptera frugiperda MNPV EcorRI-S
FRAGMENT AND TRANSLATED AMINO ACID SEQUENCE OF GP41 GENE
1
GAATTCAATG
TCGCTTTTAA
AAATTGCGAA
AGCATTCTGT
GTAAACGTAG
51
AAGCGTGCAA
ACCGCCTATA
TCACCATGGC
GGTTATAGTT
TTATTTATCA
101
ACATTATACA
TTTTTCATGG
TATTTTGTAC
TATTTATTTT
CGTAATGATA
151
TTCTTGCTAT
ATCTAAACAA
TAATTATATG
ATAAGTAATC
CAAAAATTGT
201
TTACTGCCCT
CATAAAAAAC
ACAATGGCCA
ATTACACGAG
GCCAAATTCA
MAN
Y T R
P N S
251
ATAACTAAAT
CGTCGACAAT
GTCATCGTCT
TCGTTGTCGT
CGTCCTCGTC
I T K S
STM
s s s
S L S S
s s s
301
CGCGGCCATA
ACCGAACCGT
GGATGGACAA
ATGTGTCGAT
TACGTCAATA
A A I
T E P W
M D K
C V D
Y V N K
351
AAATCGTTCG
ATACTATAGA
ACAAACGACA
TGTCTCAATT
GACCCCACAA
I V R
Y Y R
T N D M
SQL
T P Q
401
ATGCTAAACC
TCATCAACAC
CATACGGAAT
GTTTGCATCG
AAACGTATCC
M L N L
I N T
I R N
V C I E
T Y P
451
CGTAGACGTC
AACGCCACCA
AGCGTTTCGA
CAGCGACGTC
AACCTTATGA
V D V
N A T K
R F D
S D V
N L M N
501
ACAATTACAA
ACGACTGCAA
AAAGAGCTGG
GCAATAAACC
GATCACGAGC
N Y K
R L Q
K E L G
N K P
ITS
551
GACATTTTCA
AAGCTTCGTT
CGTGTACAGC
GTTTTGCCGT
CGTACGCTCA
D I F K
ASF
V Y S
V L P S
Y A Q
601
AAAATTTTAC
AACAAGGGCG
GCGATCATCT
AGCCAGCGGC
AGCGTCGAAG
K F Y
N K G G
DHL
A S G
S V E E
651
AAGCGGCCCG
TCATTTGGGC
TACGCTTTAC
AATATCAAAT
CGCGCAAGCT
AAR
H L G
Y A L Q
Y Q I
A Q A
701
GTGACCACAA
ACACACCCAT
CCCCCTGCCG
TTCGATCAAC
AGCTTGCCAA
V T T N
T P I
P L P
F D Q Q
LAN
751
CGATTATCTA
ACGTTGCTTC
TGCAGCGAGC
CAACATTCCG
ACAAACATAC
D Y L
T L L L
Q R A
NIP
T N I Q
801
AGGAGATCAT
CAACAGCGGC
AATCGGACGC
ACGGCAACTC
GCGCGTTCAC
Eli
N S G
N R T H
G N S
R V H
851
ATGATCAACG
CTCTCATCAA
CAACGTGATC
GACGATCTGT
TTGCCGGCGG
MINA
LIN
N V I
D D L F
A G G
901
CAGTGACTAT
TATCTGTACG
TGCTCAACGA
AACTAACAAA
TCTCGCATTC
S D Y
Y L Y V
L N E
T N K
S R I L
951
TAAGTTTGAA
AGAAAATATC
AGTTACATGG
CACCATTGTC
CGCCACCACT
S L K
E N I
S Y M A
P L S
ATT
1001
AACATATTCA
ACTTTATCGC
AACGCTCGCC
ACCAATTCGG
GTAAAAAGCC
N I F N
FIA
TLA
T N S G
K K P
1051
GAGCGTGTTC
CAGAGCGCTT
CGATGTTGAC
CATGCCTCTA
ACTAAACCTG
S V F
Q S A S
M L T
M P L
T K P V
1101
TCGTCAGCGA
ATCCAAAAAC
GTGTGCCAAC
AGCAACTGAC
TGAACTGGCG
V S E
S K N
v c Q Q
Q L T
E L A
1151
TTTGAAAATG
AAGCATTAAG
AAGATTTATC
TTGCAACAGT
TAAGTTATAA
F E N E
A L R
R F I
L Q Q L
S Y K
112


CHAPTER 3
NUCLEOTIDE SEQUENCE, AMINO ACID SEQUENCE AND GENOMIC
STRUCTURE ANALYSIS OF THE GP41 GENE REGION AMONG FIVE
NUCLEAR POLYHEDROSIS VIRUSES
Introduction
Anticarsia gemmatalis MNPV (AgMNPV) belongs to the
genus Nucleopolyhedrovirus (family: Baculoviridae) with a
133-kbp, closed-circle double-stranded DNA genome (Murphy et
al., 1995). The virus has been applied as a commercial
insecticide on a large scale to control the soybean pest, A.
gemmatalis (velvetbean caterpillar), in Brazil (Moscardi
1989). In addition to the successful field application, the
AgMNPV has undergone a series of comprehensive laboratory
studies including the construction of the genomic map
(Johnson and Maruniak, 1989), the nucleotide sequence of the
polyhedrin gene (Zanotto et al., 1992), and the
identification and sequence of a variable region, homologous
region 4 (hr-4) (Garcia-Maruniak et al., 1996).
The gp4l structural protein is a major occluded virion
(OV) glycoprotein of baculoviruses (Maruniak, 1979). The
50


30
RNA Purification
The total cellular RNA was isolated using the guanidine
isothiocyanate method (Ausubel et al., 1989) from 3xl06 Sf-9
cells infected with SfMNPV-2 at a multiplicity of infection
of 10 plaque forming units (PFU) per cell. At various times
postinfection (p.i.), the cells were lysed in 4 M guanidine
isothiocyanate pH 5.5, 20 mM sodium acetate, 0.1 mM
dithiotheitol (DTT) and 0.5% sarkosyl. Cell lysates were
layered over a 5.7 M CsCl solution (0.1 mM EDTA) and
centrifuged at 100k X g for 24 hours in a swinging bucket
AH650 rotor (DuPont). The RNA was dissolved in sterile
water and ethanol precipitated. After washing the RNA
pellet in 70% (v/v) ethanol, the pellet was dissolved in
sterile water. The RNA concentration was determined by
measuring the UV absorbance at 260 nm (OD2go x 40 = Mg/ml).
Northern Blot Hybridization
A total of 5 fig RNA was denatured with 7% formaldehyde,
50% formamide and IX MOPS buffer (0.2 M MOPS pH 7.0, 50 mM
sodium acetate and 10 mM EDTA) at 55C for 15 min. Before


126
Cory, J. S., Hirst, M. L., Williams, T., Hails, R. S.,
Goulson, D., Green, B. M., Carty, T. M. Possee, R. D.,
Cayley, P. J. & Bishop, D. H. L. 1994. Field trial of a
genetically improved baculovirus insecticide. Nature
3 70. 138-140.
Cowan, P., Bulach, D., Goodge, K., Robertson, A. & Tribe, D.
E. 1994. Nucleotide sequence of the polyhedrin gene
region of Helicoverpa zea single nucleocapsid nuclear
polyhedrosis virus: placement of the virus in
lepidopteran nuclear polyhedrosis virus group II.
Journal of General Virology 75. 3211-3218.
Doolittle, R. F. 1996. Computer methods for macromolecular
sequence analysis. Methods in Enzymology 266.
Engelman, D. M., Steitz, T. A. & Goldman, A. 1986.
Identifying nonpolar transbilayer helices in amino acid
sequences of membrane proteins. Annual Review of
Biophysics and Biophysical Chemistry 15, 321-53
Faktor, 0., Toister-Achituv, M. & Kamensky, B. 1995.
Identification and nucleotide sequence of an
ecdysteroid UDP-glucosyltransferase gene of Spodoptera
littoralis multicapsid nuclear polyhedrosis virus.
Virus Genes 11. 47-52.
Federici, B. A. 1986. Ultrastructure of baculoviruses. In
"The Biology of Baculoviruses". Granados, R. R. &
Federici, B. A., Eds. Boca Raton, Florida: CRC Press,
Inc. VI, pp, 61-88.
Fenner, F. & Kerr, P. J. 1994. Evolution of the poxviruses',
including the coevolution of virus and host in
myxomatosis. In "The Evolutionary Biology of
Viruses". Morse, S. S. Ed. Raven Press, New York, pp,
273-292.
Fitch, W. M. 1971. Towards defining the course of evolution:
minimum change for a specific tree topology. Systematic
Biology 42. 193-200.
Flipsen, J. T., Mans, R. M., Kleefsman, A. W., Knebel-


Love is patient.
Love is kind.
It does not envy.
It does not boast.
It is not proud.
It is not rude.
It is not self-seeking.
It is not easily angered.
It keeps no record of wrongs.
Love does not delight in evil but rejoices with the truth.
It always protects, always trusts, always hopes, always perseveres.
Love never fails.
CORINTHIANS 13:4-8


17
baculovirus gene regulation and baculovirus genome
structure. The original transfer vector has been created
by using the polyhedrin gene region and the polyhedrin gene
promoter of AcMNPV to carry and express a foreign gene
(Smith et al., 1983). The constructed vector DNA is
delivered into insect cells that are infected with the
wildtype baculovirus to produce a recombinant virus. A
recombinant virus that carries the foreign gene is produced
due to the homologous DNA exchange between the polyhedrin
gene regions from the vector and the wildtype virus DNA.
This exchange interrupts polyhedrin gene transcription in
the recombinant virus, which then does not express the
polyhedrin protein. Therefore, the recombinant virus does
not form the polyhedra. The recombinant virus is usually
selected by the expression of a marker gene such as that
coding for the (3-galactosidase that digests the substrate,
5-bromo-4-cholor-3 indolyl-(3-D-galacto-pyranoside (X-gal) ,
to form blue plaques (Summers & Smith, 1987). Currently,
several baculovirus vectors as well as laboratory manuals
are available (Summers & Smith, 1987; King & Possee, 1992;
O'Reilly et al., 1992; Richardson, 1995; Shuler et al.,


64
l 50
AcMNPV MTDERGNFYY NT-PPPLRYP SNPATAIFTS AQTY-NAPGY VPPATVPTTV
BmMNPV P N....N
AgMNPV -MN..DG..L .VSQA.A.H. FA.TS.TV.. S. --SGNY...M
HzSNPV MS L. HA.
SfMNPV
CONS
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
51
100
a-helix
ATRDNRMDYT SRSNSTNSVA IAPYNKSKEP TLDAGESIWY NKjCVDFVQKI
K. .-
S.MVQ.T.-- --RG.A. .LV .T..DA--S
T.ALQHQQHQ KQLQESS.-- .T ..
MSS .SLS.SS --A.ITEP.MD.
T.Y.H..
..Y.ER.
..Y.N..
S W- -KjC-D-V- -1
@
101 150
a-helix
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
@ *
[RYY^CNDMS ELSPLMILFI NTIRDMCIDT NPISVNWKR FESE ETMIRH
.H.
.N.
. F.
/. .
R-Y
T. . .H S .V. . II. VQTE
.T.... H.T.Q..ML L.VES H D.E
.T.... Q.T.Q. LNL NV. ET Y. VD . AT. . D.
i-NDMS -L-P-M 1 NTIR--C -P--VN--KR
evn:
EIV. .
NEi. K.
XiMNN
151
200
AcMNPV
BmMNPV
AgMNPV
HzSNPV
SfMNPV
CONS
LIRLQKE4GQ SNAAESLSSD SN
. G P. .
loop
(X- helix
LFQPSFVL NSEPAYAQKF YsTGGVDMLGK
. G . .
YS..R..
YK
L-KE
R. NSV...ID.. .
.G .EV. EN
.N KPIT .D
Y .V
.KA...Y SV
ttF--SFV- --U
..A.T...
K.AENVSG
K.G.HLAS
P-YAQKF YN-G
Figure 3.4. Alignment of the amino acid sequences of the
gp41 protein among five different NPVs. CONS represents the
consensus sequence. The dots indicate the gap and the
dashes indicate the gaps or non-conserved sequences (for
CONS sequence). The conserved proline sites are denoted by
the symbol and the conserved cysteine sites are denoted by
the @ symbol. Specific secondary structure domains were
labeled inside the boxes, and the transmembrane domain is
highlighted by double underlines.


52
experiments.
In this study, the gp4l nucleotide sequence of AgMNPV-
2D was compared with the nucleotide sequences of Autographa
californica MNPV (AcMNPV) (Kool et al., 1994), Bombyx mor
MNPV (BmMNPV) (Nagamine et al., 1991), Helicoverpa zea SNPV
(HzSNPV) (Ma et al., 1993) and Spodoptera frugiperda MNPV-2
(SfMNPV-2) (Liu & Maruniak, 1995) gp4l regions to understand
the relationship of AgMNPV-2D with other NPVs. A protein
secondary structure analysis was done based on different
computer programs to predict the potential motifs
responsible for the biological function of the gp4l protein.
Lastly, the genomic structure of gp4l gene regions among
five different NPVs was compared to provide some indications
of the phylogenetic relationships.
Methods
Virus and Cell Culture
The AgMNPV-2D isolate (Maruniak, 1989) was used as the
virus source and propagated in the Sf-9 (S. frugiperda, fall
armyworm) cell line (Luckow & Summers, 1988). The Sf-9 cell


103
(Heringa & Argos, 1994) and show a reliable result. In
general, the phylogenetic tree of baculovirus gp41 genes
agree with other gene trees. However, it is necessary to
note that incomplete sequences may sometimes result in a
dissimilarity with other trees.
Only five sequences were used to reconstruct the
phylogenetic tree of gp64 genes. Two functional domains of
gp64 proteins have been identified (Monsma & Blissard,
1995). It will be helpful to compare these specific domains
in a protein function study, and to reconstruct the
phylogenetic tree using the comparison of function domains.
Moreover, a glycoprotein of a togoto virus (a tick-borne
orthomyxo-like virus) shows homology with the gp64 gene of
baculoviruses (Morse et al., 1992) Even though the amino
acid sequence identity between the gp64 gene and the togoto
glycoprotein gene is low (28-33%), similarities between
their hydrophobicity profiles and the conserved cysteine
sites are highly significant. Again, it indicates that
protein functional domains are highly conserved during
evolutionary processing.
In order to understand the host inference on
baculovirus evolution, the phylogenetic relationships of


Figure 2.3. Primer extension analysis of gp41 gene
transcripts. Total RNA extracted from SfMNPV infected Sf-9
cells at 48 hr p.i. was mixed with the primer 5'-
GACGTAATCGACACATTTGT-3'. The cDNAs were synthesized using
Maloney murine leukemia virus reverse transcriptase and were
separated on a 6% sequence gel. Three transcription start
sites were identified (lane 5; P, the primer extension
product). The TA transcription start sites were within the
TAAG motif. The upper T transcription start site was not
associated with any known motif. The complementary sequence
ladder is shown on the left side as the sequence order G, A,
T and C.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ET3CQDZAM_V7WKRR INGEST_TIME 2015-02-17T20:18:43Z PACKAGE AA00028762_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


2
system (Summers & Smith, 1987; King & Possee, 1992; O'Reilly
et al. 1992; Richardson, 1995; Shuler et al., 1995) have
also been reported.
Fundamental Studies on Baculoviruses
The fundamental characteristics of baculoviruses have
been described in several review papers and books (Granados
Sc Federici, 1986; Blissard & Rohrmann, 1990; Taada & Kaya,
1993; Miller, 1996). These reviews include the study of
viral particles, nucleocapsids, enveloped virions,
infectious elements, the viral infection pathway,
cytopathology, viral replication, host specificity, viral
gene regulation, and viral DNA replication. In this
section, the viral infection process, structural proteins,
DNA genome and regulation of gene expression of
baculoviruses will be briefly discussed.
Baculovirus infection
Baculoviruses have an enveloped rod-shaped virion
(Federici, 1986). The virions are generally 40-50 nm in
diameter and 200-400 nm in length (Bilimoria, 1986). The


CHAPTER 1
INTRODUCTION TO BACULOVIRUSES
Review
Scientific literature on the study of baculoviruses
goes back to the beginning of the nineteenth century, and
now includes thousands of scientific articles that have
contributed to the understanding of this class of viruses.
Some papers cover fundamental studies such as those
involving the baculovirus infection processes (Volkman &
Keddie, 1990; Granados & Williams, 1986), the baculovirus
structural proteins (Summers & Smith, 1978; Maruniak, 1979,
1986; Rohrmann, 1992), the baculovirus DNA genome (Ayres et
al. 1994), and the regulation of gene expression (Friesen &
Miller, 1986; Blissard and Rohrmann, 1990). Studies dealing
with the application of baculoviruses in agriculture and
biotechnology such as the use of baculoviruses as biological
control agents (Huber, 1986; Bonning & Hammock, 1992;
Moscardi & Sosa-Gomez, 1993) and the baculovirus expression
1


79
to search the homologous sequences of six baculovirus genes.
A list containing the GenBank accession numbers, baculovirus
species names and related references used in the present
work is presented in Table 4.1.
Twenty-three nucleotide sequences of baculovirus polh
genes were found in the GenBank. Three undeposited polh
gene sequences, Anagrapha falcifera MNPV (Dr. Federici,
personal communication), A. gemmatalis MNPV and Neodiprion
sertifer SNPV (Zanotto et al., 1993), were entered manually
into a Micro VAX. computer at the Biological Computing
Facility (BCF) of tne ICBR at the University of Florida.
Table 4.1. List of GenBank accession numbers, baculovirus
species and references for DNA sequences used in the
construction of baculovirus phylogenetic trees.
Accession
number
Baculovirus
species
Reference
Polyhedrin
gene
D00437
Panolis flammea MNPV
(PfMNPV)
Oakey et al., 1989.
J.Gen.Virol. 70:769
D01017
Spodoptera littoralis MNPV
(SpliMNPV)
Croizer & Croizer,
1994. unpublished
D14573
Hyphantria cunea MNPV
(HcMNPV)
Isayama et al., 1993.
unpublished
J04333
Spodoptera frugiperda MNPV
(SfMNPV)
Gonzalez et al., 1989.
Virology 170:160


13
assembly of baculovirus virions and polyhedra (Miller, 1988;
Williams et al. 1989) .
Application of Baculoviruses in Agriculture and
Biotechnology
The baculoviruses are mainly used as microbial control
agents against insect pests (Huber, 1986). They have also
been developed as protein expression systems in
biotechnology (Summers & Smith, 1987; King & Possee, 1992;
O'Reilly et al., 1992; Richardson, 1995; Shuler et al.,
1995). Both applications represent the keystone for
studying baculoviruses, and contribute to the knowledge of
these viruses.
Use of baculoviruses as biological control agents
Baculoviruses can infect a wide range of insects
including 34 families of Lepidoptera, a few families of
Hymenoptera, Diptera, Coleptera, Neuroptera, Trichoptera,
Thysanura, and Siphonaptera (Taada & Kaya, 1993, Murphy,
1995). More than 800 species of baculoviruses have been


138
new method for constructing phylogenetic trees.
Molecular Biology and Evolution 4. 406-425.
Sanger, F., Nicklen, S. & Coulson, A. R. 1977. DNA
sequencing with chain-terminating inhibitors.
Proceedings of National Academy Sciences USA 74. 5463--
5467.
Schomburg, D. & Lessel, U. 1995. Bioinformatics: from
nucleotide acids and proteins to cell mechanism. GBF
Monographs 18, pp, 1-195.
Schuler, G. D., Epstein, J. A., Ohkawa, H & Kans, J. A.
1996. Entrez: molecular biology database and retrieval
system. In "Computer Methods for Macromolecular
Sequence Analysis". Doolittle, R. F. Ed. Methods in
Enzymology 266, 141-162.
Schulze-Kremer, S. 1996. "Molecular Bioinformatics". Walter
de Gruyter, Berlin, Germany, pp, 1-296.
Shuler, M. L., Wood, H. A., Granados, R. R. & Hammer, D. A.
1995. "Baculovirus Expression System an Biopesticides".
Wiley-Liss Inc., New York, pp, 1-259.
Smith, G. E. & Summers, M. D. 1978. Analysis of baculovirus
genomes with restriction endonucleases. Virology 89.
517-527.
Smith, G. E. Sc Summers, M. D. 1982. DNA homology among
subgroup A, B, and C baculoviruses. Virology 123. 393-
406 .
Smith, G. E., Summers, M. D. & Fraser, M. J. 1983.
Production of human (5-interferon in insect cells
infected with a baculovirus expression vector.
Molecular and Cellular Biology 3. 2156-2165.
Smith, I. R. L., van Beek, N. A. M., Podgwaite, J. D. &
Wood, H. A. 1988. Physical map and polyhedrin gene
sequence of Lymantria dispar nuclear polyhedrosis virus
Gene 71. 97-105.


39
were more conserved (70% similarity). Kyte-Doolittle (1982)
and Goldman (reviewed by Engelman et al., 1986) analyses
were performed to compare the distributions of hydrophilic
and hydrophobic domains among the four NPV proteins.
AcMNPV-E2 and BmMNPV had almost identical hydrophobicity
patterns, while SfMNPV-2 and HzSNPV showed a similar
hydrophobicity pattern overall (Fig. 2.4). In general, the
hydrophobic profiles of all four NPVs were similar within
amino acids 100 to 340 of AcMNPV-E2 and BmMNPV and amino
acids 40 to 280 of SfMNPV-2 and HzSNPV (Fig. 2.4). The
predicted amino acid sequences of all four NPVs were
compared to show the conserved regions (Fig. 2.5). Sixteen
conserved regions (defined as more than three contiguous
amino acids being the same) were found within the whole
sequence alignment. Within the 50 to 350 amino acid
comparison region, 9 of 14 prolines were conserved among the
NPVs.
In addition to the comparison of amino acid sequences,
the nucleotide sequences of the upstream region from the ATG
translation codon of the four NPVs were compared. The
sequence alignment around the late gene transcriptional
consensus motif from -52 to -46 nucleotides of all four NPVs


7
protein transport into the membrane. Another OV specific
protein, p74, has been proved to be essential for virulence
of baculoviruses. Polyhedra produced by the AcMNPV virus
with mutations in the p74 gene failed to kill Trichoplusia
ni larvae per os (Kuzio et al., 1989). This indicated that
p74 is required for viral infectivity. However, details of
the mechanism of p74 protein function still need to be
elucidated.
In contrast to the OV specific proteins, the gp64
protein is specifically found in BV (Blissard & Rohrmann,
1989; Whitford et al., 1989) and plays an important role in
cell to cell infection (Volkman & Goldsmith, 1984). The
gp64 protein is concentrated at one end of the virion
membrane and may be involved in a pH dependent fusion with
the host cell endosomal membrane (Volkman & Goldsmith,
1985). Furthermore, gp64 has been shown to be a type I
integral membrane protein with one membrane fusion domain
and one oligomerization domain (Monsma & Blissard, 1995;
Monsma et al., 1996). Gp64 is highly glycosylated, and
glycosylation is required for the incorporation of gp64 into
the virion envelope (Rohrmann, 1992). In addition, a signal
peptide sequence was found in the N-terminal of gp64 that


Table 4.1. Continued
80
K01149
Autographa cali fornica MNPV
(AcMNPV)
Hooft van Iddekinge et
al. 1983. Virology-
131 : 561
M4885
Orgyia pseudotsugata MNPV
(OpMNPV)
Leisy et al., 1986b.
Virology 153:280
M20927
Mamestra brassicae MNPV
(MbMNPV)
Cameron & Possee,
1989. Virus Res.
125:183
M23176
Lymantria dispar MNPV
(LdMNPV)
Smith et al., 1988.
Gene 71:97
M30925
Bombyx mori MNPV (BmMNPV)
Maeda et al., 1985.
Nature 315:529
M32433
Orgyia pseudotsugata SNPV
(OpSNPV)
Leisy et al., 1986a.
J.Gen.Virol. 67:1073
S48199
Spodoptera exigua MNPV
(SeMNPV)
van Strien et al.,
1992. J.Gen.Virol.
73:2813
S68462
Attacus ricini NPV (ArMNPV)
Hu et al. 1993 .
I Chuan Hsueh Pao
20:300
U22824
Penna nuda MNPV (PnMNPV)
Chou et al., 1993.
unpublished
U30302
Leucania separata MNPV
(LsMNPV)
Wang et al., 1996.
unpublished
U40833
Choristoneura fumiferana
MNPV (CfMNPV)
Rieth et al., 1996.
unpublished
U40834
Archips cerasivoranus MNPV
(ArcMNPV)
Rieth et al. 1996.
unpublished
X55658
Malacosoma neustria MNPV
(MnMNPV)
Vladimir & Kavasan,
1990. unpublished
X70844
Buzura suppressaria MNPV
(BsMNPV)
Hu et al., 1993.
J.Gen.Virol. 74:1617
X94437
Spodoptera litura MNPV
(SlMNPV)
Bansal et al., 1996.
unpublished
Z12117
Helicoverpa zea SNPV
(HzSNPV)
Cowan et al., 1994.
J.Gen.Virol. 75:3211
K02910
Trichoplusia ni GV (TnGV)
Akiyoshi et al., 1985.
Virology 141:328


35
Transcriptional Analysis of the GP41 Gene
Northern blot analysis of total RNA from infected cells
isolated from 3 to 48 h p.i. is shown (Fig. 2.2). Two mRNAs
of approximately 1.6 and 2.8 kbp were detected after 12 h
p.i. and remained detectable at 48 h p.i. when the SfMNPV
EcoRI-S fragment containing the gp41 coding region was used
as a probe.
Primer extension analysis was used to identify the
transcription start site. A 20-mer oligonucleotide,
corresponding to the complement region of the coding
sequence from nucleotides 104 to 123, was used. Three
transcription start sites were located (Fig. 2.3). Two of
the transcription start sites were located at -42 and -41
nucleotides from the ATG translation start codon within the
first T and second A of the TAAG consensus motif (Fig. 2.3).
Another transcriptional start site was located at nucleotide
-140 from the ATG start codon for which no consensus motif
has been determined (Fig. 2.3).


133
frugiperda nuclear polyhedrosis virus genome: physical
maps for restriction endonucleases BamHI and Hindlll.
Journal of Virology 38. 922-931.
Luckow, V. A. & Summers, M. D. 1988a. Trends in the
development of baculovirus expression vectors.
Bio/Technology 6. 47-55.
Luckow, V. A. Sc Summers, M. D. 1988b. Signals important for
high-level expression of foreign genes in Autographa
californica nuclear polyhedrosis virus expression
vectors. Virology 167. 56-71.
Ma, S.-W., Corsaro, B. G., Klebba, P. E. & Fraser, M. J.
1993. Cloning and sequence analysis of a p40 structural
protein gene of Helicoverpa zea nuclear polyhedrosis
virus. Virology 192. 224-233.
Madden, T. L., Tatusov. & Zhang, J. 1996. Applications of
network BLAST server. In "Computer Methods for
Macromolecular Sequence Analysis". Doolittle, R. F. Ed.
Methods in Enzymology 266, 131-141.
Madej, T., Boguski, M. S. & Bryant, S. H. 1995. Threading
analysis suggests that the obese gene product may be a
helical cytokine. Federation of European Biochemical
Societies Letters 373. 13-18.
Maeda, S. 1989. Expression of foreign genes in insects using
baculovirus vectors. Annual Review of Entomology 34.
351-372.
Maeda, S., Kawai, T., Obinata, M., Fujiwara, H., Horiuchi,
T., Saeki, Y., Sato, Y. & Furusawa, M. 1985. Production
of human alpha-interferon in silkworm using a
baculovirus vector. Nature 315. 592-594.
Maeda, S., Volrath, S. L., Hanzlik, T. N., Harper, S. A.,
Majima, K., Maddox, D. W., Hammock, B. D. & Fowler, E.
1991. Insecticidal effects of an insect-specific
neurotoxin expressed by a recombinant baculovirus.
Virology 184. 777-780.


10
disintegration (van Oers et al., 1994). In general, the
homology of plO genes among baculoviruses is very low; there
is only 42, 26 and 38% amino acid sequence identity among
AcMNPV, SeMNPV and OpMNPV, respectively (Rohrmann, 1992).
Baculovirus DNA genome
Baculoviruses are double stranded DNA viruses with the
genome size ranging from 88 to 160 kilobase pairs (kb)
(Burgess, 1977; Blissard & Rohrmann, 1990). The genomic
structure among baculoviruses has been shown to be similar
(Leisy et al., 1984). The alignment of AcMNPV, Orgyia
pseudotsugata MNPV (OpMNPV), and SeMNPV genomes showed that
these baculoviruses have similar locations for the
polyhedrin gene, plO gene and ecdysteroid UDP-
glucosyltransferase (egt) gene (van Strien et al., 1996).
On the other hand, the genomic location of the ubiquitin
gene is different among, these baculoviruses, and this
difference is probably caused by gene rearrangement. Gene
rearrangement is also apparent for the gp41 genes of five
different NPVs (Chapter 3).
The genomic DNA sequences of AcMNPV (Ayres et al.,


CHAPTER 5
SUMMARY
In this study, a baculovirus conserved gene, gp41, was
used as a model to study the phylogenetic relationship among
baculoviruses. The transcriptional analysis and protein
secondary structure of the gp41 gene, and the structural
analysis of the surrounding genomic region were also
studied.
Two complete gp41 gene nucleotide sequences from
Spodoptera frugiperda multiple nucleocapsid
nucleopolyhedrovirus (SfMNPV-2) and Anticarsia gemmatalis
MNPV (AgMNPV-2D), and a partial gp41 gene from Lymantria
dispar MNPV (LdMNPV) were sequenced. The SfMNPV-2 gp41
contained 999 nucleotides and encoded 332 amino acids. Two
SfMNPV-2 gp41 gene transcripts were detected 12 hours post
infection. Primer extension analysis demonstrated that the
gp41 gene promoter region contained three transcriptional
start sites. Two of them were in the first two nucleotides
of a consensus transcriptional start site (TAAG) of
108


55
nuclease digestion and Klenow enzyme treatment. The dideoxy
nucleotide chain-terminator method was performed for DNA
sequencing, and the DNA sequence gap between different
deletion subclones was completed using synthesized oligo
nucleotide primers. Two different sequencing kits were
used: the Sequenase Version 2.0 DNA Sequence Kit with
Sequenase polymerase (United States Biochemical Corp.) and
fmol DNA Sequencing System with Taq DNA polymerase
(Promega Corp.).
Computer Analysis
The Wisconsin Sequence Analysis Package (Version 8.1,
VMS; Genetic Computer Group) was used for comparing the
nucleotide sequence and amino acids sequence identities
(GAP), generating the multiple sequence alignment (Pileup),
and plotting the hydrophobicity profile (Pepplot). The
Blast program (Altschul et al., 1990) was used to search the
GenBank and SwissProt data banks for the homologous
nucleotide sequences and amino acid sequences through the
e-mail service (Appendix B) at the National Center for
Biotechnology Information (NCBI, USA). The protein
secondary structure prediction program (Rost and Sander,


18
1995). Sophisticated procedures for the expression of
foreign genes and subsequent protein purification have been
well established.
The benefit of using the baculovirus expression system
includes high yields and protein posttranslational
modifications that are similar to eukaryotic systems, such
as protein glycosylation, phosphorylation, and amidation
(Luckow Sc Summers, 1988a; Maeda, 1989). This expression
system can be used for pharmaceutical purposes, insect
physiology studies and pest control (Maeda, 1989).
Future Study and Prospects
Evolutionary studies of baculoviruses
In the 1960s and 1970s, the study of phylogenetic
relationships using a molecular approach showed tremendous
progress, mainly through the use of various techniques such
as protein electrophoresis, DNA-DNA hybridization,
immunological methods and protein sequencing. Statistical
measurements of genetic distances and methods for
reconstruction of phylogenetic trees have also been
developed (Li & Graur, 1991) The accumulation of DNA


130
Hooft van Iddekinge, B. J. L. Smith, G. E. & Summers, M.
D. 1983. Nucleotide sequence of the polyhedrin gene of
Autographa cali fornica nuclear polyhedrosis virus.
Virology 131. 561-565.
Hu, J., Ding, H. & Wu, X. 1993. Cloning and sequencing of
Attacus ricini nuclear polyhedrosis virus polyhedrin
gene. I Chuan Hsueh Pao 20. 300-304.
Hu, Z. H., Liu, M. F., Jin, F., Wang, Z. X., Liu, X. Y., Li,
M. J., Liang, B. F. & Xie, T. E. 1993. Nucleotide
sequence of the Buzura suppressaria single nucleocapsid
nuclear polyhedrosis virus polyhedrin gene. Journal of
General Virology 74. 1617-1620.
Huber, J. 1986. Use of baculoviruses in pest management
programs. In "The Biology of Baculoviruses". Granados,
R. R. & Federici, B. A., Eds. Boca Raton, Florida: CRC
Press, Inc. V2,181-202.
Jehle, J. A. & Backhaus, H. 1994. The granulin gene region
of Cryptophlebia leucotrea granulosis virus: sequence
analysis and phylogenetic considerations. Journal of
General Virology 75, 3667-3671.
Johnson, D. W. & Maruniak, J. E. 1989. Physical map of
Anticarsia gemmatalis nuclear polyhedrosis virus
(AgMNPV-2) DNA. Journal of General Virology 70. 1877-
1883 .
Jones, D. T., Taylor, W. R. & Thornton, J. M. 1994. A model
recognition approach to the prediction of all-helical
membrane protein structure and topology. Biochemistry
31,3038-3049.
Kaupp, W. J. & Burke, R. F. 1984. A staining technique for
gene of Bombyx mori nuclear polyhedrosis virus. Journal
of Virology 54. 436-445.
Keating, S. T., Burand, J. P., & Elkington, J. S. 1989. DNA
hybridization assay for detection of gypsy month
nuclear polyhedrosis virus in infected gypsy moth
(Lymantria dispar L.) Larvae. Applied and


9
PE (polyhedron electron-dense envelope) protein has been
suggested to be a major component of the PE, and is
phosphorylated and thiolly linked to the carbohydrate
component of the polyhedron envelope (Minion et al. 1979;
Whitt & Manning, 1988; Rohrmann, 1992). The PE gene is a
late gene, expressed at 48 hours post infection (Russell &
Rohrmann, 1990). The PE nucleotide homology among AcMNPV,
OpMNPV and LdMNPV is 58, 27 and 34%, respectively (Rohrmann,
1992). Thus, the PE protein is not highly conserved among
the different baculoviruses.
The plO protein has been proved to be an essential gene
for polyhedra formation. Three functional domains of plO
proteins were identified in AcMNPV using a site directed
mutation analysis (van Oers et al., 1993). These functional
domains include a fibrillar structure formation domain (15
amino acids from the carboxyl terminus), a nuclear
disintegration domain (amino acid residue 52-79) and an
intermolecular binding domain (the amino terminal half of
the plO protein). The unsuccessful substitution of the
AcMNPV plO gene with the Spodoptera exigua MNPV (SeMNPV) plO
gene indicated that at least one virus-specific factor was
required to interact with the plO protein for nuclear


140
T. M., Vlak, J. M. & Crook, N. E. 1996.
Characterization of a highly conserved baculovirus
structural protein that is specific for occlusion-
derived virions. Virology 218. 148-158.
Theilmann, D. A. & Stewart, S. 1991. Identification and
characterization of the IE-1 gene of Orgyia
pseudotsugata multicapsid nuclear polyhedrosis virus.
Virology 180. 492-508.
Thiem, S. M. & Miller, L. K. 1989. Identification, sequence,
and transcriptional mapping of the major capsid protein
gene of the baculovirus Autographa californica nuclear
polyhedrosis virus. Journal of Virology 63. 2008-2018.
Tomalski, M. D., Wu, J. & Miller, L. K. 1988. The location,
sequence, transcription, and regulation of a
baculovirus DNA polymerase. Virology 167. 591-600.
Traverner, M. P. & Connor, E. F. 1992. Optical enumeration
technique for detection of baculovirus in the
environment. Environmental Entomology 21. 307-313.
van Oers, M. M., Flipsen, J. T. M., Reusken, C. B. E. M.,
Sliwinsky, E. L., Goldbach, R. W. & Vlak, J. M. 1993.
Functional domains of the plO protein of Autographa
californica nuclear polyhedrosis virus. Journal of
General Virology 74. 563-574.
van Oers, M. M., Flipsen, J. T. M., Reusken, C. B. E. M. &
Vlak, J. M. 1994. Specificity of baculovirus plO
functions. Virology 200. 513-523.
van Strien, E. A., Jansen, B. J. H., Mans, R. M. W.,
Zuidema, D. & Vlak, J. M. 1996. Sequence and
transcriptional analysis of the ubiquitin gene cluster
in the genome of Spodoptera exigua
nucleopolyhedrovirus. Journal of General Virology 11.
2311-2319.
van Strien, E. A., Zuidema, D., Goldbach, R. W. & Vlak, J.
M. 1992. Nucleotide sequence and transcriptional
analysis of the polyhedrin gene of Spodoptera exigua


69
85
43
73
(I)
85
98
53
100
CfMNNPV (Tortricidae)
PnMNPV (Lymantriidae)
OpMNPV (Lymantriidae)
ArcMNPV (Tortricidae)
HcMNPV (Arctiidae)
AgMNPV (Noctuidae)
ArMNPV (Saturniidae)
AfMNPV (Noctuidae)
BmMNPV (Bombycidae)
62
58
76
75
(II)
93
72
- AcMNPV (Noctuidae)
OpSNPV (Lymantriidae)
BsSNPV (Geometridae)
PfMNPV (Noctuidae)
LsMNPV (Noctuidae)
100
MbMNPV (Noctuidae)
- S1MNPV (Noctuidae)
SeMNPV (Noctuidae)
57
41
87 SfMNPV (Noctuidae)
MnMNPV (Lasiocampidae)
HzSNPV (Noctuidae)
- SpliMNPV (Noctuidae)
LdMNPV (Lymantriidae)
PbGV (Pieridae)
C1GV (Tortricidae)
oo
o-\
100
93
Scale: each is approximately equal to the distance of 0.004943
- TnGV (Noctuidae)
NsSNPV (Diprionidae)
Figure 4.1. Phylogenetic tree of baculovirus polh gene based on the translated
and published amino acid sequences. The number shown in each branch represents the
percentage of bootstrap confidence level. The neighbor-joining method was used to
construct the phylogenetic tree. The family name of insect host in parentheses after the
baculovirus species name corresponds to the hosts of the baculoviruses used in this study.


LIST OF TABLES
Table page
2.1. Amino acid sequence similarities and nucleotide
sequence identities(%) of gp41 structural protein 38
3.1. Percentage of the nucleotide sequence identities
and amino acid sequence similarities of the ORFs
within the gp41 gene region 59
4.1. List of GenBank accession numbers, baculovirus
species, and references of DNA sequences that were
used in construction of baculovirus phylogenetic
trees 79
viii


38
Amino Acid and Nucleotide Sequence Comparison of SfMNPV-2
with Other Baculoviruses
The amino acid and nucleotide sequences of the S.
frugiperda gp41 gene were compared with three other NPV gp41
genes including A. cali fornica MNPV (AcMNPV-E2), Bombyx mori
MNPV (BmMNPV) and Helicoverpa zea SNPV (HzSNPV) (Table 2.1).
Table 2.1. Amino acid sequence similarities and nucleotide
sequence identities (%) of gp41 structural protein*.
BmMNPV
HzSNPV
SfMNPV-2
AcMNPV-E2
96
75
72
(96)
(60)
(59)
BmMNPV
75
74
(59)
(59)
HzSNPV
76
(62)
k
Bold and normal lettering in parentheses denote amino acid
sequence similarities and nucleotide sequence identities,
respectively.
At the nucleotide level, the sequences of the NPVs had an
average of 60% identity among them except for AcMNPV-E2 and
BmMNPV which shared a much higher identity (97%). However,
at the amino acid level, the predicted polypeptide sequences


CHAPTER 4
PHYLOGENETIC ANALYSIS OF BACULOVIRUSES
Introduction
The evolutionary relationships among baculoviruses have
been predicted using molecular approaches. Until 1996,
three baculovirus genes including the polyhedrin (polh) gene
(Rohrmann, 1986; Zanotto et al. 1993; Cowan et al., 1994),
the DNA polymerase (dnapol) gene (Pellock et al., 1996) and
the ecdysteroid UDP-glucosyltransferase (egt) gene (Barrett
et al., 1995) have been used to reconstruct the phylogenetic
trees. The results based on the polh gene of baculoviruses
(Rohrmann, 1986; Zanotto et al., 1993; Cowan et al., 1994)
suggest that dipteran NPVs and hymenopteran NPVs diverge
from the lepidopteran NPVs and GVs before they split. The
phylogenetic tree of the baculovirus dnapol genes is
reconstructed using six baculoviruses including Autographa
californica MNPV (AcMNPV), Bombyx mori MNPV (BmMNPV), Orgyia
pseudotsugata MNPV (OpMNPV), Choristoneura fumiferana MNPV
74


(A) po gene
(B) gp41 gene
100
100
86
91
HzMNPV
LdMNPV
AcMNPV
BmMNPV
AgMNPV
SfMNPV
Scale: each is approximately equal to the distance of 0.005262
XcGV
o
(C) gp64 gene
50
100
BmMNPV
L GmMNPV
- AcMNPV
CfMNPV
Scale: each is approximately equal to the distance of 0.001643
OpMNPV
Figure 4.3. Phylogenetic tree of baculovirus plO (A), gp41 (B), and gp64 (C) genes
based on the translated amino acid sequences. The number shown in each branch
represents the percentage of bootstrap confidence level. The neighbor-joining
method was used to construct the phylogenetic trees.


51
monoclonal data indicate the gp4l is associated with OV, but
not with the purified nucleocapsid nor with the budded
virion (BV) (Whitford & Faulkner, 1992a; Ma et al., 1993).
The location of the gp4l protein is predicted to be the
tegument between the envelope and the capsid (Whitford &
Faulkner, 1992a). However, the biological function of the
gp4l protein is still unknown because of the unsuccessful
selection of the recombinant mutants, which suggested the
gp4l may be an essential gene.
Recently, the developments of bioinformatic analysis
bring a new aspect for studying gene function in terms of
using the primary nucleotide and/or amino acid sequence to
predict the biological function of a protein. Several
computer programs are available through public access
including a protein secondary structure analysis program
that shows more than 70% accuracy (Rost and Sander, 1993), a
transmembrane domain prediction program (Jones et al.,
1994), an O-glycosylation sites prediction program (Hansen
et al. 1995), and a three dimensional structure protein
comparison program (Madej et al., 1995). These computer
programs provide theoretical data before the laboratory data
is obtained, and are also useful for designing laboratory


61
J03
J32
J76
,197
JI_ AcMNPV
~BmMNPV
AgMNPV
- HzSNPV
SfMNPV
(B)
,113
,015
,019
,117
AcMNPV
-BmMNPV
,164
,008
,222
HzSNPV
-AgMNPV
SfMNPV
Figure 3.2. Phenogram of the divergence among five NPVs
based on the (A) nucleotide sequences and (B) the amino acid
sequences of the gp41 genes. The number on the top of lines
represents the distance between each NPV or to the branch
point.


102
genes among baculoviruses (20 to 40% identities of amino
acid sequences). Kumar et al. (1993) found that it is easy
to misinterpret the results when low homology sequences are
used to construct phylogenetic trees. However, it could
also be caused by using different methods when the
phylogenetic trees were reconstructed. In this study, the
nucleotide sequences were analyzed using the maximum
parsimony method, while the amino acid sequences were
analyzed using the neighbor-joining method. These two
methods have completely different algorithms, which may
explain why the plO gene trees based on different types of
data did not agree with each other. Since there is no
evidence to suggest one method is superior to other, it is
probable that the plO gene group has a higher evolutionary
rate (more nucleotide.substitutions per site) than other
gene groups.
The phylogenetic trees of the baculovirus gp41 and gp64
genes show similar topologies based on either nucleotide or
amino acid sequences. In this study, two partial sequences
were used to reconstruct the gp41 gene phylogenetic tree.
Partial sequences coding for highly conserved domains have
been used for reconstructing a dnapcl gene phylogenetic tree


APPENDIX D
PURIFICATION OF POLYHEDRA, ALKALINE-RELEASED VIRUSES AND DNA
FROM Lymantria dispar MNPV COMMERCIAL FORMULATION (MODIFIED
FROM THE LABORATORY PROTOCOL OF DR. MARUNIAK)
Purification of Polyhedra from LdMNPV Commercial Formulation
1. Dissolve 2 g LdMNPV in 10 ml homogenization buffer (1%
ascorbic acid, 2% SDS, 10 mM Tris-HCl and 1 mM EDTA, pH
8.0).
2. Filter the polyhedra solution through 4 layers of
cheesecloth.
3. Centrifuge the solution at 10,000 rpm for 10 min at 4C
(BECKMAN J21-C centrifuge and JA20 rotor).
4. Discard supernatant and resuspend pellet in 9 ml of
distilled water with 1 ml 5 M NaCl.
5. Centrifuge the solution at 10,000 rpm for 15 min at 4C.
6. Resuspend in 5 ml distilled water.
7. Make a 30 ml sucrose gradient from 63% to 40% in TE
buffer (10 mM Tris and 1 mM EDTA, pH 8.0), using a
gradient former (MBA, Clearwater, FL) and Masterflex pump
(Cole-Parmer Instrument Co.).
8. Centrifuge the resuspended viral solution on top of
sucrose gradient in an ultracentrifuge at 24,000 rpm for
30 min at 4C (DuPont OTD 65B ultracentrifuge and AH627
swinging bucket rotor).
9. Transfer the polyhedra band to a new tube, and mix with
distilled water.
10. Centrifuge the solution at 10,000 rpm for 15 min at 4C.
11. Resuspend the pellet in 0.5 ml distilled water.
118


75
(CfMNPV), Helicoverpa zea SNPV (HzSNPV) and Lymantria dispar
MNPV (LdMNPV) (Ahrens & Rohrmann, 1996), and is generally
comparable to the phylogenetic tree scheme based on the polh
gene. Furthermore, the dnapol genes of two baculoviruses,
AcMNPV and HzSNPV, are compared with two other insect DNA
viruses (Spodoptera ascovirus, SAV, and Choristoneura
biennis entomopoxvirus, CbEPV) (Pellock et al., 1996), and
with human viruses to reveal their evolutionary
relationships. The results suggest that the baculoviruses
have an independent evolutionary pathway from other insect
and human viruses. Phylogenetic analysis of the third
baculovirus gene'(egt) among six different baculoviruses
shows similar topology to the phylogenetic trees of polh and
dnapol genes (Barrett et al., 1995).
Although the molecular approach can be used to
elucidate the evolutionary relationships among
baculoviruses, critics agree that the phylogenetic tree of a
particular gene does not represent the evolutionary pathway
of the whole organism (Li & Graur, 1991) So far, all
baculovirus phylogenetic trees are based on a single gene,
and therefore may not properly represent the evolutionary
pathway of baculoviruses. In the present study, this


124
the gp64 envelope glycoprotein gene of the Orgyia
pseudotsugata multicapsid nuclear polyhedrosis virus.
Virology 170. 537-555.
Blissard, G. W. & Rohrmann, G. F. 1990. Baculovirus
diversity and molecular biology. Annual Review of
Entomology 35. 127-155.
Bonning, B. C. & Hammock, B. D. 1992. Developmental and
potential of genetically engineered viral
insecticides. Biotechnology and Genetic Engineering
Reviews 10. 455-489.
Braunagel, S. C., Elton, D. M., Ma, H. & Summers, M. D.
1996a. Identification and analysis of an Autographa
cali fornica nuclear polyhedrosis virus structural
protein of the occlusion-derived virus envelope: ODV-
E56. Virology 217. 97-110.
Braunagel, S. C., He, H., Ramamurthy, P. & Summers, M. D.
1996b. Transcription, translation, and cellular
localization of three Autographa cali fornica nuclear
polyhedrosis virus structural proteins: ODV-E18, ODV-
E35, and ODV-EC27. Virology 222. 100-114.
Braunagel, S. C. & Summers, M. D. 1994. Autographa
cali fornica nuclear polyhedrosis virus, PDV, and ECV
viral envelopes and nucleocapsids: structural proteins,
antigens, lipid and fatty acid profiles. Virology 202.
315-328.
Brown, S. E., Maruniak, J. E. & Knudson, D. L. 1985.
Baculovirus (MNPV) genomic variants: characterization
of Spodoptera exempta MNPV DNAs and comparison with
other Autographa cali fornica MNPV DNAs. Journal of
General Virology 66. 2431-2441.
Brown, S. E., Maruniak, J. E. & Knudson, D. L. 1987.
Conserved homologous regions between two baculovirus
DNAs. Journal of General Virology 68. 207-212.
Burand, J. P., Horton, H. M., Retnasami, S. & Elkington, J.
S. 1992. The use of polymerase chain reaction and


45
at the surface of the protein. The hydrophobic region in
the middle of the plO protein may play a bundling or cross-
linking function (van Oers et al., 1993) The amino acid
sequences of the gp41 polypeptide of these NPVs were
compared to reveal the conserved sequence regions (Fig.
2.5). These conserved amino sequences may play an important
role to be a functional domain since no amino acid change
was found in those regions. Specifically, these regions
containing the proline and cysteine may be involved in
maintaining the gp41 polypeptide conformation. In addition
to these conserved regions, the alignment of the first 50
amino acids between AcMNPV and BmMNPV were identical.
Also, the last 368 to 393 amino acid sequences between
SfMNPV-2 and HzSNPV were almost identical (Fig. 2.5). These
data suggest that the SfMNPV-2 and HzSNPV may have evolved
from a common ancestor, and that the AcMNPV and BmMNPV
diverged from another distantly related ancestor.
By northern blot analysis, two gp41 gene transcripts
were found after 12 h p.i. These data confirm the data
previously shown, that the gp41 gene is a late gene product
(Whitford & Faulkner, 1992b; Ma et al., 1993). One of the
transcripts was 1.6 kb and another was 2.8 kb long.


63
Figure 3.3. Hydrophobicity profile of the gp41 protein among
five different NPVs. Conserved hydrophobic domains I-V were
arbitrarily assigned (see text for details).


70
has a specific biological function. An attempt to generate
a three-dimensional (3D) graph using the threading method
(Madej et al. 1995) was not successful because no homologous
sequence against the gp41 protein was found in the PDB
(protein data bank). The crystallographic data of gp41 or a
closely related transmembrane protein will be needed to
generate the 3D graph of the gp4l protein.
In contrast with the gp4l px'otein, the gp64 protein is
only found in the BV. The gp64 is a glycosylated membrane
protein and is involved in cell to cell infection. It has
been proved to be an essential gene for baculovirus
infectivity. Two conserved hydrophobic domains at amino
acid sequences of 220 to 230 and 327 to 338 (TELVACLLIKD and
LNNMMHDLIYSV) were associated with biological function.
Region I is involved in the fusion activity of the gp64
protein, and region II is involved in the oligomerization
and transport of gp64 protein (Monsa & Blissard, 1995).
Also, one transmembrane domain was identified at the
carboxyl terminal. No similarity of amino acid sequence was
found between the gp64 and gp41 transmembrane domain. The
study of the similarities of the secondary structure of the
gp4l and gp64 proteins will provide information for


123
Barrett, J. W., Krell, P. J. & Arif, B. M. 1995.
Characterization, sequencing and phylogeny of the
ecdysteroid UDP-glucosyltransferase gene from two
distinct nuclear polyhedrosis viruses isolated from
Choristoneura fumiferana. Journal of General Virology
76, 2447-2456.
Benner, S. A. 1995. Predicting the conformation of proteins
from sequences. Progress and future progress. Journal
of Molecular Recognition 8. 9-28.
Betz, F. S. 1986. Registration of baculoviruses as
pesticides. In "The Biology of Baculoviruses".
Granados, R. R. & Federici, B. A., Eds. Boca Raton,
Florida: CRC Press, Inc. VI, pp, 203-222.
Bilimoria, S. L. 1986. Taxonomy and identification of
baculoviruses. In "The Biology of Baculoviruses".
Granados, R. R. & Federici, B. A., Eds. Boca Raton,
Florida: CRC Press, Inc. VI, pp, 37-60
Bitton, G., Maruniak, J. E. & Zettler, F. W. 1987. Virus
survival in nature ecosystems. In "Survival and
Dormancy of Microorganisms". Henis, Y., ed. New York:
John Wiley & Sons. Inc. pp, 301-332.
Bjornson, R. M., Glocker, B. & Rohrmann, G. F. 1992.
Characterization of the nucleotide sequence of
the Lymantria dispar nuclear polyhedrosis virus DNA
polymerase gene region. Journal of General Virology
73, 3177-3183.
Blinov, V. M., Gutorov, V. V., Holodilov, N. G.,
Iljichev, A. A., Karginov, V. A., Mikrjukov, N. N.,
Mordvinov, V. A., Nikonov, I. V., Petrov, N. A.,
Urmanov, I. H. & Vasilenko, S. K. 1984. Nucleotide
sequence of the Galleria mellonella nuclear
polyhedrosis virus origin of DNA replication.
Federation of European Biochemical Societies Letters
167, 254-258.
Blissard, G. W. & Rohrmann, G. F. 1989. Location, sequence,
transcriptional mapping, and temporal expression of


58
using the GAP program obtained from the GCG package, more
than 59% nucleotide sequence identities and more than 69%
amino acid sequence similarities were found (Table 3.1).
In addition to the gp4l ORF, several ORFs of AgMNPV-2D
were found inside the 3.5 kbp sequence region. The AgMNPV-
2D ORF 1062 was identified to have a high homology with the
AcMNPV vlf-1 gene. The AgMNPV-2D vlf-1 gene was then
compared with the vlf-1 of AcMNPV, BmMNPV, the ORF >300 of
SfMNPV-2 and the ORF >195 of HzSNPV. The results presented
a nucleotide homology of 76, 77, 63, and 65% respectively
and amino acid similarity of 91, 90, 78 and 66%
respectively (Table 3.1).
Other than the vlf-1 gene, two potential ORFs (ORF 330
and ORF 300) were found at nucleotides, 1,804 2,103 and
2,100 2,429 respectively. The ORF 330 of the AgMNPV-2D
was compared with the ORF 330 of AcMNPV, ORF 330 of BmMNPV,
ORF 348 of SfMNPV-2, and ORF 330 of HzSNPV and showed high
nucleotide homologies of 68, 65, 58, and 57% respectively
(similarity of amino acid sequences of 78, 80, 60, and 64%
respectively; Table 3.1). The data suggested there were
minimal (50-60%) homologies and similarities among these
analyzed NPVs. Meanwhile, the AgMNPV-2D ORF 300 showed


15
Bonning & Hammock, 1992). Some of the genetically improved
baculovirus insecticides have already been tested in the
field (Wood & Granados, 1991; Cory et al. 1994). The
results show that the modified baculoviruses kill insect
pests faster than wildtype baculoviruses, and therefore
could reduce crop damage (Maeda et al., 1991). Genetically
engineered baculoviruses will become useful to control
insect pests in forests and.agricultural systems in the
future (Bonning & Hammock, 1992). However, the release of
recombinant baculoviruses to the natural environment is
still controversial (Fuxa, 1989) .
Environmental safety is a main issue when baculoviruses
are applied as biological pesticides. Several species of
birds, aquatic organisms and mammals have been tested for
toxicology safety (Betz, 1986), and no deleterious effects
have yet been reported. Beneficial insects were also
tested, and no direct adverse effects were found (Grner,
1986). However, some parasite and predator species were
indirectly affected by baculoviruses due to the decrease in
host larvae resources (Betz, 1986).
The persistence of baculoviruses in the environment has
also been studied. Several environmental factors affect the


19
sequence data has facilitated phylogenetic analysis.
Molecular evolutionary data could potentially be used to
interpret the relationships among baculoviruses and to other
viruses. The evolution of DNA viruses is usually caused by
modifications of their genomes due to DNA deletion, DNA
recombination (gene rearrangement), and DNA insertion from
the host genome. Several baculovirus genes show homology
with the host cell genes such as ubiquitin (van Strien et
al. 1996), and such data support the evolutionary mechanism
of incorporating of host cell DNA into the viral genome.
The baculovirus polyhedrin gene has been used to
reconstruct a phylogenetic tree, showing the early
divergence of NPVs and GVs (Zanotto et al., 1993). The
results showed that the hymenopteran NPV diverged earlier
from the lepidopteran NPVs than from the lepidopteran GVs.
The data also suggested that the lepidopteran NPVs were
divided into two major branches. Until 1996, three
baculovirus genes have been used to reconstruct the
phylogenetic trees including the polyhedrin gene, DNA
polymerase (Ahrens & Rohrmann, 1996; Pellock et al., 1996)
and ecdysteroid UDP-glucosyltransferase (Barrett et al.,
1995). The results of the last two gene phylogenetic trees


CHAPTER 2
NUCLEOTIDE SEQUENCE AND TRANSCRIPTIONAL ANALYSIS OF THE GP41
GENE OF Spodoptera frugiperda NUCLEAR POLYHEDROSIS VIRUS
Introduction
Spodoptera frugiperda MNPV (SfMNPV-2) is a member of
the family Baculoviridae. SfMNPV-2 has a double-stranded
DNA genome of approximately 121 kb. The SfMNPV physical map
for a number of restriction endonucleases has been
described, and the restriction endonuclease profiles also
shows differences comparing to other NPVs (Loh et al., 1981;
Maruniak et al., 1984) However, two regions of DNA
homology on the physical maps of SfMNPV-2 and S. exempta
MNPV (SeMNPV-25), an Autographa cali fornica MNPV genomic
variant (Brown et al., 1985), have been identified by
hybridization under high stringency conditions. One of
these two regions contained the polyhedrin gene (Brown et
al. 1987); the other region has been identified in the
current report to be associated with the gp41 structural
protein gene.
25


Ill
from six different baculovirus genes were constructed to
study the evolutionary paths of baculoviruses.
In the future, additional molecular data (nucleotide
sequence, amino acid sequence, and three dimensional protein
structure data) of baculoviruses will become available.
These basic data can be used to construct phylogenetic trees
of different baculovirus genes, and to predict the
biological function of a particular baculovirus gene using
computer modeling systems.


Methods
Virus and Cell Culture
The S. frugiperda MNPV isolate SfMNPV-2 (Maruniak et
al. 1984) was propagated in the S. frugiperda Sf-9 cell
line (Luckow and Summers', 1988b) Sf-9 cells were
maintained at 27C in TC-100 medium supplemented with 10%
fetal bovine serum (Life Technology) and 50 /g/ml
gentamicin.
DNA Cloning and Sequencing
The SfMNPV-2 EcoRI-S DNA fragment was cloned into
pGEM3Z and pGEM7Zf(+) vectors (Promega Corp.), and the
subfragments EcoRI-Hindlll (0.5 kbp), EcoRI-PstI (0.8 kbp),
Pstl-EcoRI (1.1 kbp) and Hhal-Hhal (0.7 kbp) were cloned
into pGEM3Z. Exonuclease digested subclones were generated
with the Erase-a-Base system (Promega Corp.). A
modification of the experimental protocol was made to
precipitate the exo-nuclease-digested DNA before the next
step of DNA ligation, because an incomplete inhibition of


This dissertation was submitted to the Graduate Faculty
of the College of Agriculture and to the Graduate School and
was accepted as partial fulfillment of the requirements for
the degree of Doctor of Philosophy.
May, 1997
Dean, College of Agriculture
Dean, Graduate School


11
1994) and BmMNPV (Maeda, unpublished data; GenBank accession
number, L33180) have been completed and provide valuable
information in analyzing the potential open reading frames
(ORFs). In AcMNPV, 154 potential ORFs (greater than 150
nucleotides in length) and the potential transcription
motifs of these ORFs have also been identified. A complete
genomic structural map has located all the identified genes
of AcMNPV (Ayres et al., 1994).
Regulation of baculovirus gene expression
The baculovirus genes are transcribed in an ordered
cascade. Four types of genes (immediate early, early, late,
and very late genes) have been described according to their
dependence on the transcription of previous types cf genes
and on their occurrence before or after viral DNA
replication (Friesen & Miller, 1986; Guarino & Summers,
1986; Blissard & Rohrmann, 1990).
The immediate early (IE) genes, also called regulatory
genes, do not require any viral gene products for their
transcription and are involved in the transactivation of the
next gene expression phase (early genes) (Guarino & Summers,


100
protein present in the proteinaceous occlusion body
(polyhedrin gene) for Euxoa scandens CPV. The homologies of
polh gene amino acid sequences between OpNPVs (OpMNPV and
OpSNPV) and OpCPV are as little as 12% (Galinski et al.,
1994). Although the nucleotide sequence identities between
NPVs and CPVs are very low, their polh protein functions are
very similar. The dissimilarities between NPVs and CPVs
such as low identities of polh gene sequences and different
types of genome structure (DNA viruses vs. RNA viruses)
indicated that their polh genes may involve a convergent
evolution.
The dnapol gene is used for comparison between
baculoviruses and other insect DNA viruses, because it is
the most common gene among DNA viruses from different
organisms. It has been reported that the AcMNPV dnapol gene
is classified in the viral subgroup of dnapol gene family B,
and is related to the dnapol gene of human virus and
eukaryotic organisms such as fungi (Heringa & Argos, 1994).
In this study, the results showed that baculovirus group had
evolutionary paths independent of other enveloped insect DNA
viruses, SAV and CbEPV. This agrees with previous published
results (Pellock et al., 1996) and is not surprising,


TABLE OF CONTENTS
ACKNOWLEDGMENTS iv
LIST OF TABLES viii
LIST OF FIGURES ix
ABSTRACT xi
CHAPTERS
1 INTRODUCTION TO BACULOVIRUSES 1
Review . . 1
Fundamental Studies on Baculoviruses ... 2
Baculovirus infection 2
Baculovirus structural proteins ... 5
Baculovirus DNA genome 10
Regulation of baculovirus gene
expression 11
Application of Baculoviruses in Agriculture
and Biotechnology 13
Use of baculoviruses as biological
control agents 13
Baculovirus expression system .... 16
Future Study and Prospects 18
Evolutionary studies of
baculoviruses 18
Bioinformatic study 22
Present study 23
2 NUCLEOTIDE SEQUENCE AND TRANSCRIPTIONAL ANALYSIS OF
THE GP41 GENE OF Spodoptera frugiperda NUCLEAR
POLYHEDROSIS VIRUS 25
v


LIST OF FIGURES
Figure
Page
2.1. Position of the gp41 gene on the SfMNPV genomic
map and sequencing strategy 34
2.2. Northern blot analysis of gp41 gene transcripts 36
2.3. Primer extension analysis of gp41 gene
transcripts 37
2.4. Comparison of hydrophilic-hydrophobic profiles
among the homologous gp41 proteins 4 0
2.5. Comparison of the amino acid sequence of four
NPV gp41 proteins. 41
2.6. Computer alignment of the DNA sequence flanking
the gp41 structural protein genes of AcMNPV-E2,
BmMNPV, HzSNPV and SfMNPV-2 42
3.1.Position of the gp41 gene on the AgMNPV-2D
genomic map 54
3.2. Phenogram of the divergence among five NPVs ... 61
3.3. Hydropnobicity profile of the gp41 protein among
five different NPVs 63
3.4. Alignment of the amino acid sequence of the gp41
protein among five different NPVs 64
3.5. Genomic structure of gp41 gene flanking regions
of the AcMNPV, BmMNPV, AgMNPV-2D, SfMNPV-2 and
HzSNPV 67
IX


139
Stiles, B. & Wood, H. A. 1983. A study of the glycoproteins
of Autographa- californica nuclear polyhedrosis virus
(AcNPV). Virology 131. 230-241.
Stoltz, D. B., Pavan, C. & Da Chunha, A. B. 1973. Nuclear
polyhedrosis virus: a possible example of de novo
intranuclear membrane morphogenesis. Journal of General
Virology 19. 145-150.
Summers, M. D. & Smith, G. E. 1978. Baculovirus structural
polypeptides. Virology 84. 390-402.
Summers, M. D. & Smith, G. E. 1987. A Manual of Methods for
Baculovirus Vectors and Insect Cell Culture
Procedures. Texas Agricultural Experiment Station, pp,
1-57.
Summers, M. D. & Volkman, L. E. 1976. Comparison of
biophysical and morphological properties of occluded
and extracellular nonoccluded baculovirus from in vivo
and in vitro host systems. Journal of Virology 17. 962-
972 .
Swafford, D. L. 1990. "PAUP: Phylogenetic Analysis Using
Parsimony". Version 3.0. Illinois Natural History
Survey, Champaign, IL.
Taada, Y. & Hess, R. T. 1976. Development of a nuclear
polyhedrosis virus in midgut cells and penetration of
the virus into the hemocoel of the armyworm,
Pseudaletia unipuncta. Journal of Invertebrate
Pathology 28. 67-76.
Taada, Y., Hess, R. T., & Omi, E. M. 1975. Invasion of a
nuclear polyhedrosis virus in midgut of the armyworm,
Psedoaletia unipuncta, and the enhancement of
synergistic enzyme. Journal of Invertebrate Pathology
18, 307-312.
Taada, Y. & Kaya, H. K. 1993. "Insect Pathology". Academic
Press, Inc., San Diego, CA. pp, 171-244.
Theilmann, D. A., Chantler, J. K., Stewart, S., Flipsen, H.


43
may play a functional role in their biological properties.
During the viral infection, one of the virus-encoded
envelope glycoproteins, gp64, is expressed and involved in
the host cell infection. The gp64 protein is a component of
the virion peplomers which are only detected in the ECV and
are essential for entry of ECV into the cells by adsorptive
endocytosis (Keddie & Volkman, 1985) In contrast to gp64,
gp41 is only associated with OV. The gp41 structural
protein was found exclusively in enveloped OV but not in
either ECV or enveloped stripped OVs (Whitofrd & Falunker,
1992a). Currently, the biological function of gp41 is not
known, but gp41 may be involved in facilitating the
occlusion of virions in the polyhedra or the infection of
host midgut cells according to their biochemical
characteristics.
In this study, we presented the nucleotide sequence and
transcriptional analysis of the SfMNPV-2 gp41 gene. The
nucleotide sequence of the SfMNPV-2 gp41 gene shows a
different degree of homology with the three other NPVs
including AcMNPV-E2, BmMNPV and HzSNPV (Table 1). The
nucleotide sequence identities of SfMNPV-2 and the other
NPVs were low (60%). Similar results have been reported


137
Company, New York, pp, 1-347.
Pellock, B. J., Lu, A., Meagher, R. B., Weise, M. J. &
Miller, L. K. 1996. Sequence, function, and
phylogenetic analysis of an ascovirus DNA polymerase
gene. Virology 216. 146-157.
Pritchett, D. W., Young, S. Y., & Yearin, W. C. 1982.
Dissolution of Autographa cali fornica nuclear
polyhedrosis virus polyhedra by the digestive fluid of
Trichoplusia ni (Lepidoptera: Noctuidae) larvae.
Journal of Invertebrate Pathology 39. 354-361.
Rankin, C., Ooi, B. G. & Miller, L. K. 1988. Eight base
pairs encompassing the transcriptional start point are
the major determinant for baculovirus polyhedrin gene
expression. Gene 70. 39-49.
Richardson, C. D. 1995. "Baculovirus Expression Protocols".
Humana Press Inc., New Jersey, pp, 1-418.
Riegel, C. I., Lahner-Herrera, C. & Slavicek, J. M. 1994.
Identification and characterization of the ecdystroid
UDP-glucosyltransferase gene of the Lymantria dispar
multinucleocapsid nuclear polyhedrosis virus. Journal
of General Virology 75, 829-838.
Rohrmann, G. F. 1986. Polyhedrin structure. Journal of
General Virology 67. 1499-1513.
Rohrmann, G. F. 1992. Baculovirus structural proteins.
Journal of General Virology 73. 749-761.
Rost, B. & Sander, C. 1993. Prediction of protein secondary
structure at better than 70% accuracy. Journal of
Molecular Biology 232. 584-599.
Russell, R. L. Q. & Rohrmann, G. F. 1990. A baculovirus
polyhedron envelope protein: immunogold localization in
infected cells and mature polyhedra. Virology 174. 177-
184 .
Saitou, N. & Nei, M. 1987. The neighbor-joining method:
a


Introduction 25
Methods 28
Virus and Cell Culture 28
DNA Cloning and Sequencing 2 8
Computer Analysis 29
RNA Purification 30
Northern Blot Hybridization 30
Primer Extension 31
Results 33
Cloning and Sequencing of the
S. frugiperda EcoRI-S Fragment 33
Transcriptional Analysis of the GP41 Gene 35
Amino Acid and Nucleotide Sequence
comparison of SfMNPV-2 with Other
Baculoviruses 38
Discussion 42
3 NUCLEOTIDE SEQUENCE, AMINO ACID SEQUENCE AND
GENOMIC STRUCTURE ANALYSIS OF THE GP41 GENE REGION
AMONG FIVE NUCLEAR POLYHEDROSIS VIRUSES 50
Introduction 50
Methods 52
Virus and Cell Culture 52
DNA Cloning and Sequencing 53
Computer Analysis 55
Results 56
DNA Sequencing of the GP41 Region .... 56
Phylogenetic Analysis 60
Protein Hydrophobicity Profile Analysis 62
Protein Secondary Structure Analysis ... 62
Genomic Structure Analysis 66
Discussion 66
4 PHYLOGENETIC ANALYSIS OF BACULOVIRUSES 74
Introduction 74
Methods 76
DNA Purification of LdMNPV 76
PCR Amplification and DNA Sequencing of
LdMNPV gp41 Gene 76
Search of Baculovirus Genes through
GenBank 78
vi


78
genomic DNA) was used per PCR reaction. Thirty pi of
autoclaved mineral oil was applied to the top of the
reaction mixture to prevent evaporation. The PCR reaction
was performed in a PTC-100 programmable Thermal Cycler
(MJ Research, Inc). The PCR cycle consisted of an initial
denaturation step at 95C for 1 min, followed by 35 cycles
at 94C for 1 min (denaturation), 45C for 1.5 min
(annealing), and 72C for 2 min (extension). The final
extension step had a 15 min duration. The PCR product was
purified through a DNA purification column (QIAquickiIV*,
Qiagen Inc.) to remove salts and enzyme.
The purified PCR product was then cloned into a pGEM-T
vector (Promega Corp.), and sequenced using an automatic
sequencer (ABI 373a) from the DNA Sequencing Core Laboratory
(DSEQ) of the Interdisciplinary Center for Biotechnology
Research (ICBR) at the University of Florida.
Search of Baculovirus Genes through GenBank
The BLAST (Madden et al., 1996) and ENTREZ (Schuler et
al., 1996) programs (Appendix B) available from the National
Center for Biotechnology Information (NCBI, USA) were used


56
1993) was available through the Internet server (Appendix B)
at the European Molecular Biology Laboratory (EMBL:
Heidelberg, Germany). The transmembrane domain analysis
program (MEMSAT) is a freeware (Jones et al. 1994), and the
O-glycosylation site prediction program (Appendix B) was
accessed through the Internet server (Hansen et al., 1995) .
For phylogenetic analysis, the MEGA program was used to
construct the phylogenetic tree of the gp4l gene (Kumar et
al., 1993). Both the nucleotide sequences and amino
sequences were used. The p-distance and neighbor-joining
methods were chosen to generate the phylogenetic tree based
on amino acid sequences. For the phylogenetic tree based on
nucleotide sequences, the p-distance and maximum parsimony
method were used.
Results
DNA Sequencing of the GP41 Region
The complete nucleotide sequence of the Pstl-Hindlll
fragment resulted in 3,517 nucleotides (Appendix C) and has
been deposited in GenBank under the accession number U37728.
An interesting phenomenon was observed during the DNA


141
nuclear polyhedrosis virus. Journal of General Virology
73, 2813-2821.
Volkman. L. E. 1986. The 64k envelope protein of budded
Autographa californica nuclear polyhedrosis virus.
Current Topics of Microbiology and Immunology 131,
103-118.
Volkman, L. E. & Goldsmith, P. A. 1984. Budded Autographa
cali fornica NPV 64k protein: further biochemical
analysis and effects of post-immunoprecipitation sample
preparation conditions. Virology 143. 185-195.
Volkman, L. E. & Goldsmith, P. A. 1985. Mechanism of
neutralization of budded Autographa cali fornica nuclear
polyhedrosis virus by a monoclonal antibody: inhibition
of entry by adsorptive endocytosis. Virology 143. 185-
195 .
Volkman, L. E. & Keddie, B. A. 1990. Nuclear polyhedrosis
virus pathogenesis. Seminars in Virology 1. 249-256.
Ward, V. K., Fleming, S. B. & Kalmakoff, J. 1987. Comparison
of a DNA-DNA dot-blot hybridization assay with light
microscope and radioimmunoassay for the detection of a
nuclear polyhedrosis virus. Journal of Virological
Methods 15. 65-73.
Webb, S. E. & Shelton, A. M. 1990. Effect of age structure
on the outcome of viral epizootics in field populations
of imported cabbageworm (Lepidoptera:Pieridae).
Environmental Entomology 19, 111-116.
Wheeler, W. C. 1991. Congruence among data sets: a bayesian
approach. In "Phylogenetic Analysis of DNA Sequences".
Eds, Miyamoto, M. M. & Cracraft, J. Oxford University
Press, New York, pp, 334-346.
Whitford, M. & Faulkner, P. 1992a. A structural polypeptide
of the baculovirus Autographa californica nuclear
polyhedrosis virus contains O-linked N-
acetylglucosamine. Journal of Virology 66. 3324-3329.


I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
ratnes E. Maruniak, Chairman
Associate Professor of
Entomology and Nematology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree
Professor of Molecular
Genetics and Microbiology
Doctor of Philosophy.
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, irp-yscope and quality, as
a dissertation for the degree of Docj^qr of Philosophy
Pauline 0. Lawrence
Professor of Entomology and
Nematology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
<7rv
Susan E. Webb
Associate Professor of
% *
Entomology and Nematology


4
that functions in cell to cell infection (Granados & Lawler,
1981). The OV is occluded in either a polyhedron (for NPV)
or granule (for GV). The polyhedron protects the virion
from environmental decay. Upon ingestion by insect larvae,
the polyhedra are dissolved in the midgut's alkaline juices
(Pritchett et al., 1982). The liberated OVs then penetrate
the peritrophic membrane and infect the columnar epithelial
cells (Taada et al., 1975). This step marks the end of the
primary infection. The budded virions that are produced in
the infected nucleus of columnar cells then cause a
secondary infection (Granados & Williams, 1986). The BVs go
through the hemocoel to infect other cells such as those of
the tracheal and the connective tissues (Adams et al., 1977;
Keddie et al., 1989; Volkman & Keddie, 1990). Late in the
infection, occluded virions are formed in the nuclei of
infected cells. The progeny virions (BVs) are found as
early as sixteen hours after initiation of the infection
(Granados & Lawler, 1981). Polyhedra are found starting at
24 hours post-infection (P.I.) (Granados & Lawler, 1981) and
are released upon cell death.


85
Relationship of Baculoviruses with Insect Hosts
The insect host families (Hodges et al., 1983) are
presented in Figure 4.1. The family name of the insect host
in parentheses after the baculovirus species name
corresponds to the hosts of the baculoviruses used in this
study to reconstruct the polh gene phylogenetic tree. The
correlation between the baculoviruses and their insect hosts
was studied by determining whether or not the insect hosts
of closely related baculoviruses belong to the same family.
Results
PCR Amplification and DNA Sequencing of LdMNPV gp41 Gene
A partial sequence of the LdMNPV gp41 gene (381 bp) was
amplified and sequenced (Appendix E). A baculovirus late
gene motif was found upstream from the ATG translation start
site (-32 to -28). The translation start site did not fit
the Kozak principle completely, but it was very similar. A
AxxATGC was found instead of the theoretical sequence
AxxATG(A/G).
The partial LdMNPV gp41 coding sequence was compared


67
AcMNPV
47,6 mu
50.4 mu
Vlf-J
BmMNPV
45.3 mu
ORF327 VRF312
gp41
ORF 699
48.2 mu
Vlf-1
AgMNPV
49,8 mu
ORF330 VRF312 gp41
ORF 702
52.4 mu
Vlf-1
SfMNPV
ORF 330 VRF300 gp41 ORF >667
45.3 mu
45,0 mu
HzSNPV
ORF >300 ORF 348
(vlf-1)
gp41 ORF >258
96,5 mu
97.6 mu
ORF>299 gp41 ORF330
ORF 195
(vlf-1)
Figure 3.5. Genomic structure of gp41 gene flanking regions
of AcMNPV, BmMNPV, AgMNPV-2D, SfMNPV-2, and HzSNPV. *
refers to the ORF which was not found in either SfMNPV or
HzSNPV. Note the data of HzSNPV is modified from isolate
HzS-15 which is considered as a genomic rearrangement
isolate (see text for details).


77
constructed to amplify the gp41 gene of LdMNPV. The
oligonucleotide primers were designed based upon the
conserved sequences of gp41 genes from five baculoviruses
including AcMNPV (Kool et al. 1994), Anticarsia gemmatalis
MNPV (AgMNPV) (Liu & Maruniak, unpublished data), BmMNPV
(Nagamine et al., 1991), HzSNPV (Ma et al., 1992), and
SfMNPV (Liu Sc Maruniak, 1995) .
The JM37 upstream primer of the gp41 gene was a 25
nucleotide oligomer with the following sequence:
ACAA(C/T)AA(C/T)TATATTATAAGTA(A/G)TCC. This primer was
located within the transcriptional initiation site region of
the gp41 gene. The JM40 downstream primer was a 21
nucleotide oligomer with the following sequence:
GTTGTAAAA(C/T)TTTTGNGC(G/A)TA. Based on DNA sequence
alignment, the expected size of the PCR product using this
primer set was around 500 base pairs (bp).
The PCR reaction was done in a final volume of 25 p.1
containing 200 j.iM of each dNTP, 4 pmoles of each primer,
2 mM MgCl2, 0.5 units of Primezyme (Biometra), and reaction
buffer (10 mM Tris-HCi, pH 8.8, 50 mM KCl, 0.1% Triton
X-100). A concentration of 100 ng of DNA template (LdMNPV


8
was missing in the mature form of the protein (Rohrmann,
1992) .
Besides the OV and BV structural proteins, there are
three other major structural proteins found in
baculoviruses: polyhedrin, PE, and plO proteins. Polyhedrin
is the basic subunit of polyhedra and is reported to be a
29 kDa protein with highly conserved amino acid sequences
between NPVs and GVs (Akiyoshi et al., 1985; Maruniak, 1986;
Blissard & Rohrmann, 1990). It has 80% identity among
lepidopteran NPVs, 50% identity between the lepidopteran
NPVs and GVs, and 40% identity between the lepidopteran and
hymenopteran NPVs (Rohrmann, 1992). The carboxyl terminal
and central region of polyhedrin genes are highly conserved,
but the N-terminal is less conserved (Akiyoshi et al., 1985;
Chakerian et al., 1985; Rohrmann, 1986). The cytoplasmic
polyhedrosis virus (CPV) also produces polyhedrin protein to
form a type of polyhedra. However, the polyhedrin amino
acid composition between NPVs and CPVs are different
quantitatively and qualitatively (Maruniak, 1986; Rohrmann,
1986) .
An electron-dense envelope named polyhedron membrane or
polyhedron calyx surrounds the polyhedra (Rohrmann, 1992).


29
exo-nuclease was found when the manufacturer's instructions
were followed. The extra DNA precipitation step was
introduced between the SI nuclease digestion and Klenow
enzyme treatment. Sequencing was performed by the
dideoxynucleotide chain terminator sequencing method (Sanger
et al., 1977) with Sequenase (United States Biochemical
Corp.). The oligonucleotide primers were synthesized by the
DNA Synthesis Laboratory of the Interdisciplinary Center for
Biotechnology Research at the University of Florida.
Computer Analysis
The Wisconsin Sequence Analysis Package (Version 8.1,
VMS; Genetic Computer Group) was used for comparing the
nucleotide sequence and amino acid sequence identities
(GAP), generating the multiple sequence alignment (Pileup),
and plotting the hydrophobicity profile (Pepplot). The
Blast program (Altschul et al., 1990) was used to search the
GenBank databank for the homologous nucleotide sequences
through the e-mail service at the National Center for
Biotechnology Information (NCBI, USA). The Fetch program
was used to retrieve nucleotide sequences from the local
GenBank database.


73
45 to m.u. 52. These data indicate that most NPVs still
maintain similar genomic structures even though there is a
mechanism for genomic DNA rearrangement.


113
1201 AAACGACATT TCGCAACTGT GATAACAACT GAGGCTAGAA AAAAAAAGAT
N D X SQL*
1251 GAGTCTTGAC GTTCCGTACG AACGTTTAGG CACAGCGACC AAAGTCGATT
1301 ATATTCCGCT AAAATTAGCT TTGACTGATT TACCTTCAGA AAACACTTCA
1351 GACAACAATG ACGACAATCA AAAAAACAAC AATACCCAAA ATCCCAAAAT
1401 TGATATTAAT CAATCAAACG CCAACAATTA TAATCAACAT CAATCGGTTC
1451 GTTCAAAACA ACAGTTTTAC GACATTTTAG TTTTAGGTAT GCTGACAGTG
1501 TTTTGTATTT TGGTATTGCT GTATGCTATA TATTACTTTG TTATATTAAG
1551 AGACAGACAA AAATCCAACA CTATAAGACC TAGTTATATG TTTTAGCATG
1601 ACTGATAACA TTTTCAATAA AACAAACAAT GTGAGAAATG AATATTCGTT
1651 TAATTGTTGG AAATCCAAAA TCCAAAGTCA TTTTAGATTC GAGACCGTGT
1701 TTCAACTGGC CACCGATCGA CAGCGATGCA CGCCCGACAA GGTTCGTAAC
1751 GGTCGGTGGT CCAAGTTTAT TTTTAACAAA CCGTTTGCGC CCACCACATT
1801 GAAAAGTTAC AAGTCTAGAT TCATCAAAAT CATCTACTGT CTAATCGACG
1851 AGTCTCATCT CGACGAACTA AACACCTACG ATCTTAATCA AGAATTC
* TAAG is the transcription start site of baculovirus late
genes
* ATG is the protein translation start site
* AATAA is the poly(A) tail signal site


21
degeneration of Malpighian tubules causes the death more
rapidly in these insect larvae that were infected by an
AcMNPV egt gene deletion mutant (Flipsen et al., 1995). A
baculovirus pesticide improvement is suggested by deletion
of the egt gene (O'Reilly & Miller, 1991). The egt proteins
also share 21 to 22% amino acid sequence identities with
several mammalian UDP-glucuronosyl transferases (O'Reilly &
Miller, 1989). Overall, the phylogenetic analysis of the
egt genes from six different baculoviruses supports the
evolutionary scheme of the polyhedrin sequence phylogeny
tree (Barrett et al., 1995).
The reconstruction of a baculovirus phylogenetic tree,
based on other baculovirus genes such as gp41, gp64 and plO
will provide additional information for examining the
evolutionary hypothesis based on the polyhedrin phylogenetic
tree. Also, the non-protein coding sequences of
baculoviruses could provide useful information for
understanding baculovirus phylogeny. For instance, the
divergence and evolution of homologous regions (HR) between
AcMNPV and BmMNPV have been studied, and results have shown
that the HRs of AcMNPV and BmMNPV are highly conserved
(Majima et al., 1993). However, the high variability of the


93
Phylogenetic Trees of dnapol and ecrt Genes
The dnapol gene phylogenetic tree based on the amino
acid sequences from six baculoviruses (Ahrens & Rohrmann,
1996), one ascovirus and one entomopoxvirus (Pellock et al.,
1996) was reconstructed and showed that AcMNPV, BmMNPV,
CfMNPV and OpMNPV were closely related, while HzSNPV and
LdMNPV were groupedseparately (Fig. 4.5 A). The results
also indicated that SAV and CbEPV were distantly related to
baculoviruses. The phylogenetic tree obtained from the
nucleotide sequence data (Fig. 4.6 A) confirmed these
results.
The egt gene phylogenetic tree (Barrett et al., 1996)
showed that AcMNPV and BmMNPV group together, while CfMNPV
and OpMNPV form another group, and the LdMNPV and MbMNPV a
third group. S. littoralis MNPV (SpliMNPV; abbreviated to
distinguish it from S. litura MNPV which is abbreviated
SlMNPV) was distantly related to the other lepidopteran
NPVs. LoGV was considered to be an outgroup virus in this
analysis. Both phylogenetic trees based on the amino acid
and nucleotide sequences agreed with each other (Fig 4.5 B
and 4.6 B).


62
Protein Hydrophobicitv Profile Analysis
Figure 3.3 shows the hydrophobicity profile and the
conserved hydrophobic domain of gp41 protein among five NPVs
(Kyte & Doolittle, 1982) Five conserved hydrophobic
domains were assigned arbitrarily based on the similarity of
hydrophobic pattern among five NPVs.
Protein Secondary Structure Analysis
The amino acid sequence alignment showed (Fig. 3.4) two
cysteines and nine prolines were found conserved among five
different NPVs. The secondary structure analysis showed
eight potential a-helixes, four loops and one P-sheet.
Several conserved domains were found inside these specific
secondary structures. Most of the conserved domains were
found in the middle of the gp4l amino acid sequences. The
amino and carboxyl terminals were highly variable.
No N-glycosylation sites, Rx(S/T), were presented in Fig.
3.4, because the gp4l protein has been reported as an 0-
linked glycoprotein. However, no consensus
0-glycosylation sites were predicted by the aligned


101
because these DNA viruses have different genomic DNA
replication and viral infection strategies (Taada & Kaya,
1993) .
A previous published phy-logenetic tree of the
baculovirus egt gene (Barrett et al., 1995) was
reconstructed and compared to the phylogenetic trees of polh
and dnapol genes to examine the true topology of baculovirus
phylogenetic trees. No significant difference was found
between the egt gene and the other gene trees. Although it
is very common to find that different gene trees have
different topologies (Forterre, 1997), the comparison
between polh, dnapol and egt gene trees showed that these
genes have similar evolutionary paths and/or rates. Since
all the analyzed trees agreed with each other, it should be
reasonable to predict the evolutionary pathway based on a
single gene tree such as polh gene.
Furthermore, three phylogenetic trees based on
baculovirus plO, gp41 and gp64 were reconstructed in this
study. For the phylogenetic trees of the baculovirus plO
gene, the results showed different schemes based on either
the nucleotide sequences or amino acid sequences. The
inconsistences may be caused by the low homology of plO


6
analysis showed that more glycoproteins were present in BV
than OV. The BV specific glycoproteins are 136, 128, 89, 45
and 40 kDa, and the OV specific glycoproteins are 70, 53,
49, 42 and 40 kDa. Moreover, several specific OV structural
proteins were identified. These proteins include the ODV-
E18, ODV-E35, ODV-E27, ODV-E56 and ODV-E66 (Maruniak &
Summers, 1981; Hong et al., 1994; Braunagel et al., 1996a,
1996b; Theilmann et al., 1996). These OV specific
proteins, such as ODV-E56 and ODV-E66, may be involved in
the production of intranuclear membrane and protein
transport and insertion into the viral envelope membrane
(Braunagel et al., 1996a; 1996b).
The gp41 gene also has been shown to code for an OV
specific protein (Whitford & Faulkner, 1992a). Gp41 genes
are highly conserved with 60% nucleotide sequence homology
among four different baculoviruses (Liu & Maruniak, 1995).
The gp41 protein was identified as an O-linked glycoprotein,
and its localization was predicted to be in the tegument
(Whitford & Faulkner, 1992a). Although the biological
function of gp41 protein has not yet been defined, it may
have functions similar to those of other OV specific
proteins, such as formation of the envelope membrane and/or


Reconstruction of Phylogenetic Trees of
Baculovirus Genes 83
Relationship of Baculoviruses with
Insect Hosts 85
Results 85
PCR Amplification and DNA Sequencing of
LdMNPV gp41 Gene 85
Phylogenetic Trees of Baculovirus polh
Genes 87
Phylogenetic Trees of plO, gp41, and
gp64 Genes 88
Phylogenetic Trees of dnapol and egt
Genes 93
Relationship of Baculoviruses and Their
Hosts 96
Congruent Analysis of Baculovirus Genes 96
Discussion 97
5 SUMMARY OF CURRENT RESEARCH 108
APPENDICES
A NUCLEOTIDE SEQUENCE OF Spodoptera frugiperda
MNPV EcoRI-S FRAGMENT AND TRANSLATED AMINO
ACID SEQUENCE OF GP41 GENE 112
B INTERNET SERVERS USED FOR DATABASE SEARCH AND
PROTEIN SECONDARY STRUCTURE PREDICTION .... 114
C NUCLEOTIDE SEQUENCE OF Anticarsia gemmatalis
MNPV PstI-HindiII FRAGMENT AND TRANSLATED
AMINO ACID SEQUENCE OF GP41 GENE 115
D PURIFICATION OF POLYHEDRA, ALKALINE-RELEASED
VIRUSES AND DNA FROM Lymantria dispar MNPV
COMMERCIAL FORMULATION 118
E PARTIAL NUCLEOTIDE AND TRANSLATED AMINO ACID
SEQUENCES OF Lymantria dispar GP41 GENE .... 121
LIST OF REFERENCES 122
BIOGRAPHICAL SKETCH 144
vii


129
Autographa cali fornica nuclear polyhedrosis virus genes
for late gene expression. Journal of Virology 62. 463-
471.
Hansen, J. E., Lund, 0., Engelbrecht, J., Bohr, H., Nielsen,
J. 0., Hansen, J.-E. S. & Brunak, S. 1995. Prediction
of 0-glycosylation of mammalian proteins: specificity
patterns of UDP-GalNAc: polypeptide N-
acetylgalactosaminyltransferase. Biochemistry Journal
308. 801-813.
Hawtin, R. E., King, L. A. & Possee, R. D. 1992. Prospects
for the development of a genetically engineered
baculovirus insecticide. Pesticide Science 34. 9-15.
Heringa, J. & Argos, P. 1994. Evolution of viruses as
recorded by their polymerase. In "The Evolutionary
Biology of Viruses". Mrse, S. S. Ed. Raven Press, New
York, pp, 87-103.
Higgins, D. G., Thompson, J. D., & Gibson, T. J. 1996. Using
CLUSTAL for multiple sequence alignments. In "Computer
Methods for Macromolecular Sequence Analysis".
Dolittle, R. F. Ed. Methods in Enzymology 266, 383-402.
Hill, J. E. & Faulkner, P. 1994. Identification of the gp67
gene of a baculovirus pathogenic to the spruce budworm,
Choristoneura fumiferana multinucleocapsid nuclear
polyhedrosis virus. Journal of General Virology 75.
1811-1813.
Hodges, R. W., Dominick, D. R., Davis, D. R., Ferguson, D.
C., Franclemont, J. G., Munroe, E. G., & Powell, J. A.
1983. "Check List of The Lepidoptera of America North
of Mexico". E. W. Classey Limited and The Wedge
Entomological Research Foundation, London, pp, 1-284.
Hong, T., Braunagel, S. C. & Summers, M. D. 1994.
Transcription, translation, and cellular localization
of PDV-E66: a structural protein of the PDV envelope of
Autographa cali fornica nuclear polyhedrosis virus.
Virology 204. 210-222.


23
1995). Two major databases, the GenBank at the National
Center for Biotechnology (NCBI, USA) and the EMBL (European
Molecular Biology Laboratory Database) at the European
Bioinformatics Institutes (EBI, England) are accessible
around the world (Doolittle, 1996) providing information on
nucleotide and primary amino acid sequences. In addition,
the protein data bank (PDB), a protein structure database,
collects protein structure information from crystallographic
results, and is therefore an important database for
constructing 3D structures of unknown proteins. The
development of such databases, computer programs, and
computer facilities provides scientists with more efficient
ways to search for homologous sequences of an unknown gene,
to align multiple sequences, and to reconstruct phylogenetic
relationships.
Present study
In this study, the baculovirus gp41 gene was chosen for
phylogenetic analysis, because it has been proved to be
highly conserved (Brown et al., 1985; Liu & Maruniak, 1995).
Two new gp41 gene DNA sequences of AgMNPV and SfMNPV were


PHYLOGENETIC ANALYSIS OF BACULOVIRUSES USING GP41 STRUCTURAL
PROTEIN GENE AND FIVE OTHER GENES
By
JAW-CHING LIU
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1997


68
identified including the vlf-1 gene, ORF 330, ORF 300, gp4l
gene, and ORF >667. Among these ORFs, the AgMNPV-2D shared
50 to 70% of the nucleotide sequence identities and 60 to
80% of the amino acid sequence similarities with four other
NPVs. However, the AgMNPV-2D ORF 300 did not show
homologies with the gp41 regions of all five NPVs. The gp4l
gene region of SfMNPV-2 and HzSNPV did not contain the ORF
300 homologous sequences. This result may be caused by a
genomic deletion. However, it was not shown whether a
homologous sequence of the AgMNPV ORF 300 was present in a
different genomic region of SfMNPV-2 or HzSNPV.
Furthermore, the homologous sequences of the AgMNPV-2B ORF
300 were searched using the BLAST program and no significant
homologous sequence was found other than the AcMNPV and
BmMNPV ORF 312.
The gp4l gene is a unique gene which is only found in
the OV. However, no biological function has been proved
yet. An attempt to select a recombinant virus with a
deletion in the gp4l gene was not successful. The results
suggested the gp41 gene could be an essential gene and have
influences on both BV and OV even though the gp41 protein is
only found in the OV. If the gp41 gene is an essential


(A) DNA polymerase gene
AcMNPV
BmMNPV
CfMNPV
OpMNPV
LdMNPV
HzSNPV
ASV
CbEPV
(B) egt gene
AcMNPV
BmMNPV
CfMNPV
OpMNPV
LdMNPV
MbMNPV
SpliMNPV
LoGV
U)
on
Figure 4.6. Phylogenetic tree of baculovirus dnapol (A), and egt (B) genes based on
the nucleotide sequences. The maximum parsimony method was used to construct the
phylogenetic trees.


16
distribution and persistence of baculoviruses. These
factors include ultraviolet light (UV), rainfall,
temperature, pH of soil, and the microenvironment of the
plant surface (Bitton et al., 1987). Several techniques
have been used for detecting, tracing and identifying
baculoviruses in the field. These techniques include
microscopic diagnosis (Kaupp & Burke, 1984; Traverner &
Connor, 1992), bioassay, serological assays such as Enzyme
Linked Immunosorbent Assay (ELISA) (Naser & Miltenburger,
1982, 1983; Webb & Shelton, 1990), DNA dot blot
hybridization (Ward et al., 1987;.Keating et al., 1989) and
polymerase chain reaction (PCR) (Burand et al., 1992; Moraes
& Maruniak, 1997) The latest development of a PCR
technique provides a convenient, fast and accurate way to
detect and identify baculoviruses in their natural
environment (Moraes & Maruniak, 1997).
Baculovirus expression system
The baculovirus expression system was developed based
on the understanding of the baculovirus life cycle,


33
Results
Cloning and Sequencing of the S. frugiperda EcoRI-S Fragment
The S. frugiperda MNPV-2 EcoRI-S fragment containing
the gp41 structural protein gene was cloned into pGEM3Z and
pGEM7Zf(+) (Fig. 2.1 A). The specific restriction
endonuclease digested subclones and exonuclease III deleted
subclones were constructed. The T7 and SP6 promoter primers
present in the pGEM vector and several specific
oligonucleotide primers were used for sequencing (Fig. 2.1
B). A major open reading frame (ORE) which contained 999
nucleotides encoded the gp41 gene, and it was oriented from
right to left according to the conventional physical maps
(Fig. 2.1 B) (Maruniak et al., 1984) The complete sequence
of SfMNPV-2 EcoRI-S fragment (Appendix A) was deposited with
the GenBank Data Library. One baculovirus late promoter
consensus motif TAAG (Blissard & Rohrmann, 1990) was found
from 39 to 43 nucleotides upstream from the ATG translation
start codon. The translation stop codon TGA was followed by
394 nucleotides downstream to the polyadenylation signal
AATAA.


88
using bootstrap analysis showed a low confidence level of
53% (Fig 4.1) in the branch that divides group I and II.
Maximum parsimony analysis of the nucleotide sequences
of 25 baculovirus polh genes (Fig. 4.2) showed two main
branches of lepidopteran NPVs, and agreed with the grouping
profile from the phylogenetic tree based on the amino acid
sequences (Fig 4.1). Group II was divided into two
subgroups. Subgroup A included the LsMNPV, MbMNPV, PfMNPV,
SfMNPV, SlMNPV and SeMNPV, and subgroup B included HzSNPV,
MnMNPV, BsSNPV and OpSNPV.
The distance lengths between lepidopteran GVs and
lepidopteran NPVs was calculated to be 0.3 to 0.4, and to be
0.56 between lepidopteran GVs and NsSNPV (Fig. 4.1).
Phylogenetic Trees of plO. ap41 and gp64 Genes
The phylogenetic trees of baculovirus genes coding for
the structural proteins, plO, gp41 and gp64 were presented
in Figure 4.3 (based on the amino acid sequences) and Figure
4.4 (based on the nucleotide sequences). The plO gene
phylogenetic tree based on the amino acid sequence showed
that AcMNPV and BmMNPV were in the same group. OpMNPV and


99
In comparison to the data published by Zanotto et al.
(1993), the polh gene phylogenetic tree in this study was
reconstructed with newly available sequences. The results
showed that there were three main branches including
lepidopteran NPVs, lepidopteran GVs and a hymenopteran NPV.
They also indicated that lepidopteran NPVs can be divided
into two groups, I and II. Lepidopteran group II can be
further subdivided into several subgroups as Cowan et al.
(1994) suggested. The divergence of lepidopteran NPV
subgroups may be indicative of an ongoing evolutionary
pathway for baculoviruses. More careful examinations of the
evolutionary rate such as nucleotide substitutions per
nucleotide site (Aotsuka et al., 1994) is needed to
determine if subgroups I and II will become well-separated
branches.
Overall, there is a 59% nucleotide sequence identity of
the polh gene between lepidopteran NPVs and lepidopteran
GVs, and there are 74% to 92% identities among lepidopteran
NPVs (Rohrmann, 1992) In addition, the baculovirus polh
gene has a functional counterpart to the cytoplasmic
polyhedrosis virus (CPV) RNA viral family. In 1989, Fossies
et al. characterized the gene that encoded for the major


106
viral species instead of to the different viral species.
Although no correlation between geographic distance with
genetic distance was found among baculoviruses, the
understanding of their relationship cannot be ignored since
it is necessary for a complete evolutionary study. In
addition, the evolutionary pathway of baculoviruses may be
related to other factors such as the feeding preferences of
baculovirus insect hosts. Certain closely related
baculoviruses were found to infect specific types of insect
hosts such as forest pests, crop pests and vegetable pests.
More studies will be needed to ascertain whether or not this
factor really plays any role in baculovirus evolutionary
paths.
In conclusion, the congruent analysis done in this
study validates the evolutionary hypothesis of baculoviruses
as suggested by Rohrmann (1986 & 1992) and Zanotto et al.
(1993). The results confirm that hymenopteran NPV diverged
early from lepidopteran NPVs and GVs, and that the
lepidopteran NPVs and GVs then split. Lepidopteran NPVs
continued to evolve and become two subgroups I and II, and
subgroup II diverged into several subgroups again. In the
future more information obtained from other NPVs such as


26
Two types of virions are produced during the nuclear
polyhedrosis life cycle. Those virions found within the
viral inclusion bodies (IBs) are termed occluded viruses
(OVs). They obtain their envelope in the nuclei of infected
cells de novo, and the OV envelope is involved in the
recognition of host microvilli during infection. The second
type of baculovirus virion is the budded virus (BV). The
single nucleocapsids bud through the plasma membrane of
infected cells and form the ECV (Granados & Williams, 1986;
Blissard & Rohrmann, 1990). These virions appear to be
specialized for secondary infection of other host cells and
contain virus-encoded envelope glycoproteins which are
involved in host cell infection, i.e. gp64 (Maruniak, 1979;
Keddie & Volkman, 1985).
The gp41 structural protein has been identified as a
major OV glycoprotein by metabolic labeling (Maruniak 1979;
Stiles & Wood, 1983) It has also been detected by the
binding of horseradish peroxidase-linked concanavalin A,
thus indicating it is glycosylated (Braunagel & Summers,
1994). Furthermore, an O-linked single N-acetylglucosamine
covalently bonded to the polypeptide was identified
(Whitford Sc Faulkner, 1992a) Experiments with monoclonal


BIOGRAPHICAL SKETCH
Jaw-Ching Liu was born in Taiwan, on May 8, 1966. He
entered National Chung-Hsing University (NCHU) in September
1984 and completed his Bachelor of Science degree in the
Entomology Department in June 1988. He started his Master
of Science program in the same department in September 1988,
and took a leave in December 1989. From December 1989 to
May 1991, he worked at the Institute of Biomedicine,
Academic Sinica, as a research assistant. Then, he went
back to NCHU in June 1991, and finished his Master of
Science degree in December 1992.
He started his Ph.D. program with Dr. James Maruniak in
January 1993 in the Department of Entomology and Nematology
at the University of Florida. Presently, he is finishing
his Ph.D.
144


49
results from Kool et al. (1994) and Ayres et al. (1994) not
only enlarge the gp41 protein by 65 amino acid sequences but
also increase the homology with HzSNPV and SfMNPV at the C-
terminal regions (Fig. 2.5). These data provide new
information showing the possible evolutionary path of the
gp41 gene and by comparing these data, the evolutionary
relationship of baculoviruses may be inferred.


92
PnMNPV were also closely related. The results also showed
that the SlMNPV was distantly related to the other NPVs that
were analyzed. When the plO gene phylogenetic tree based
on the nucleotide sequence (Fig. 4.4 A) was compared with
the tree based on the amino acid sequence (Fig 4.3 A), the
results showed some differences. The OpMNPV and PnMNPV were
distantly related to AcMNPV and BmMNPV based on nucleotide
sequences, whereas SeMNPV and SlMNPV were distantly related
in the amino acid based tree.
The gp41 gene phylogenetic tree based on the amino acid
sequences (Fig. 4.3 B) groups the AcMNPV, BmMNPV and AgMNPV
together, and LdMNPV and HzSNPV in a separate group. The
SfMNPV was distantly related to these two groups. The
results also positioned the XcGV as an outgroup. The gp41
gene phylogenetic tree based on the nucleotide sequences
(Fig. 4.4 B) agrees with the tree based on amino acid
sequences. The gp64 gene phylogenetic tree based on amino
acid sequences (Fig. 4.3 C) presented the AcMNPV, BmMNPV and
GmMNPV in one group, and OpMNPV and CfMNPV in a second
group. However, the phylogenetic tree based on the
nucleotide sequence (Fig. 4.4 C) showed that BmMNPV was
closer to OpMNPV and CfMNPV than to AcMNPV and GmMNPV.